Repository 'fraggenescan'
hg clone

Changeset 0:1f0a3e4497d4 (2017-09-06)
Commit message:
planemo upload for repository commit 59ac8955ccb33e3fcd6649c61779bb3ae9ccb6d4
diff -r 000000000000 -r 1f0a3e4497d4 fraggenescan.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fraggenescan.xml Wed Sep 06 13:23:14 2017 -0400
@@ -0,0 +1,86 @@
+<tool id="fraggenescan" name="FragGeneScan" version="@WRAPPER_VERSION@.0">
+    <description>for finding (fragmented) genes in short reads</description>
+    <macros>
+        <token name="@WRAPPER_VERSION@">1.30</token>
+    </macros>
+    <requirements>
+        <requirement type="package" version="@WRAPPER_VERSION@">fraggenescan</requirement>
+    </requirements>
+    <version_command>@WRAPPER_VERSION@</version_command>
+    <command detect_errors="aggressive"><![CDATA[
+    -genome='$genome'
+    -out="output_file_name"
+    -complete='$complete'
+    -train='$train'
+    -thread=\${GALAXY_SLOTS:-4}
+    ]]></command>
+    <inputs>
+        <param argument="-genome" type="data" format="fasta" label="Input equence file"/>
+        <param argument="-complete" type="boolean" truevalue="1" falsevalue="0" label="Does the sequence file have complete genomic sequences?"/>
+        <param argument="-train" type="select" label="Model">
+            <option value="454_5">454 pyrosequencing reads with about 0.5% error rate (454_5)</option>
+            <option value="454_10">454 pyrosequencing reads with about 1% error rate (454_10)</option>
+            <option value="454_30">454 pyrosequencing reads with about 3% error rate (454_30)</option>
+            <option value="complete">complete genomic sequences or short sequence reads without sequencing error (complete)</option>
+            <option value="gene">gene</option>
+            <option value="illumina_1">Illumina sequencing reads with about 0.01% error rate (illumina_1)</option>
+            <option value="illumina_5">Illumina sequencing reads with about 0.5% error rate (illumina_5)</option>
+            <option value="illumina_10">Illumina sequencing reads with about 1% error rate (illumina_10)</option>
+            <option value="noncoding">noncoding</option>
+            <option value="pwm">pwm</option>
+            <option value="rgene">rgene</option>
+            <option value="sanger_5">Sanger sequencing reads with about 0.5% error rate (sanger_5)</option>
+            <option value="sanger_10">Sanger sequencing reads with about 1% error rate (sanger_10)</option>
+            <option value="start">start</option>
+            <option value="start1">start1</option>
+            <option value="stop">stop</option>
+            <option value="stop1">stop1</option>
+        </param>
+    </inputs>
+    <outputs>
+        <data name="coord" format="tabular" from_work_dir="output_file_name.out" label="${} on ${on_string}: Coordinates of putative genes"/>
+        <data name="nt_seq" format="fasta" from_work_dir="output_file_name.ffn" label="${} on ${on_string}: Nucleotide equences of putative genes"/>
+        <data name="prot_seq" format="fasta" from_work_dir="output_file_name.faa" label="${} on ${on_string}: Protein equences of putative genes"/>
+        <data name="gff" format="gff" from_work_dir="output_file_name.gff" label="${} on ${on_string}"/>
+    </outputs>
+    <tests>
+        <test>
+            <param name="genome" value="contigs.fasta"/>
+            <param name="complete" value="False"/>
+            <param name="train" value="complete"/>
+            <output name="coord" ftype="tabular" value="contigs.out"/>
+            <output name="nt_seq" ftype="fasta" value="contigs.ffn"/>
+            <output name="prot_seq" ftype="fasta" value="contigs.faa"/>
+            <output name="gff" ftype="gff" value="contigs.gff"/>
+        </test>
+        <test>
+            <param name="genome" value="NC_000913.fasta"/>
+            <param name="complete" value="True"/>
+            <param name="train" value="complete"/>
+            <output name="coord" ftype="tabular" value="NC_000913.out"/>
+            <output name="nt_seq" ftype="fasta" value="NC_000913.ffn"/>
+            <output name="prot_seq" ftype="fasta" value="NC_000913.faa"/>
+            <output name="gff" ftype="gff" value="NC_000913.gff"/>
+        </test>
+        <test>
+            <param name="genome" value="NC_000913-454.fasta"/>
+            <param name="complete" value="False"/>
+            <param name="train" value="454_10"/>
+            <output name="coord" ftype="tabular" value="NC_000913-454.out"/>
+            <output name="nt_seq" ftype="fasta" value="NC_000913-454.ffn"/>
+            <output name="prot_seq" ftype="fasta" value="NC_000913-454.faa"/>
+            <output name="gff" ftype="gff" value="NC_000913-454.gff"/>
+        </test>
+    </tests>
+    <help><![CDATA[
+**What it does**
+FragGeneScan is an application for finding (fragmented) genes in short reads.
+It can also be applied to predict prokaryotic genes in incomplete assemblies or complete genomes. 
+    ]]></help>
+    <citations>
+        <citation type="doi">10.1093/nar/gkq747</citation>
+    </citations>
diff -r 000000000000 -r 1f0a3e4497d4 test-data/NC_000913-454.faa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/NC_000913-454.faa Wed Sep 06 13:23:14 2017 -0400
diff -r 000000000000 -r 1f0a3e4497d4 test-data/NC_000913-454.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/NC_000913-454.fasta Wed Sep 06 13:23:14 2017 -0400
b'@@ -0,0 +1,10000 @@\n+>r1.1 |SOURCES={GI=49175990,fw,4460184-4460264}|ERRORS={}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+AGTAATCGAGATCGTGATAGTGAATATCGCCACGCTCATGTGCCTGCACCACGTCACGCGGCAGC\n+AGGTGCTGACGTGCA\n+>r2.1 |SOURCES={GI=49175990,fw,3987220-3987313}|ERRORS={}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+GTCGACAGTGTAGTAACCAGTGCTCACGATACCATTGTGGGATCAGCGACCAGAGTTGCTGCAAC\n+ATTTCACCGCTGGTAACAACGACCATCG\n+>r3.1 |SOURCES={GI=49175990,fw,1788591-1788680}|ERRORS={78_1:T}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+GTACGTGCGACAACATCGCTAAACCAGAGACGGTATTTGTCCTCATCATCTGCAAGATGTGACCA\n+GTAATGACGAATAGTCAAAGTCAGC\n+>r4.1 |SOURCES={GI=49175990,fw,2524219-2524308}|ERRORS={}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+ACAATATTCGCCTGAATACCATTGCGCGCCAGCGCTGCGTCAATCAGCGGTCGGCTGCCTGACGC\n+GTAATCCTGCAACACCAATTTCGC\n+>r10.1 |SOURCES={GI=49175990,fw,3984360-3984462}|ERRORS={22_1:C}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+AGTTATTACTCAGGAAGCAAAGACGGATTACAGAATTATCTCATAACAAGTGTTAAGGGATGTTA\n+TTTCCCGATTCTCTGTGGCATAATAAACGAGTAGATGC\n+>r11.1 |SOURCES={GI=49175990,fw,3825309-3825415}|ERRORS={}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+CGTAAAAGGCGGCAGTGAGAAGACCGCCATTTCAGGTTACCCTACCTTCCTGCCGGATGCGATTC\n+ATCACCCTACAAATTCAATAAATTATGAATCAATACGCAGG\n+>r15.1 |SOURCES={GI=49175990,fw,645102-645205}|ERRORS={90_1:C}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+AACCAGCTAATCTGGATACCGGCAATTTTGCTGACGAACTCCAGACCCAGCACGTTTGGTGCCGC\n+ACCGGTGACAAACATGGACGAACTCACGACTGGTACTAA\n+>r16.1 |SOURCES={GI=49175990,fw,2861966-2862071}|ERRORS={16_1:C,18_1:G,31_1:A}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+TTATTCGTCCGTTCACACCCGATACGTGGTGATGACGGATGGGAAATGTCCCGCTGGTGCCTTAT\n+TACCGACCGGGCGATAAACGCATCGCACAGGATCTGGCGGAAC\n+>r18.1 |SOURCES={GI=49175990,fw,3142456-3142551}|ERRORS={}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+CAGATTTCAGCGTCTGACGCGGATAGTGGTATTCGCTGCCAGGCTTCAGCGCCAGACGTTTTTTC\n+GCCTCCGCCATCAGCTCTTCACGCGTACCG\n+>r19.1 |SOURCES={GI=49175990,fw,2749965-2750057}|ERRORS={79:-}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+TGAAGCCGACATGGTGCGTACCGGCGCTGCTCGCGCTGACCTGTGCGCCCGTTTTTCTCTGAAAG\n+ATACGCCAGCGGCTTGCGCTGGCTGG\n+>r20.1 |SOURCES={GI=49175990,fw,2183340-2183438}|ERRORS={25_1:C}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+ACGTGAAGAAGCAATGACCTGGTGGTCCCGTGACTTCCCTACGCTGGCATTATCCAGATCAGGTG\n+ATACGGGTATTTCTCAGCCTTCACGCAGAAGGGC\n+>r21.1 |SOURCES={GI=49175990,fw,710407-710509}|ERRORS={88:-}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+TAATCTTCCTGGTCACCACAACCAAACAGCGCAACCAGTTTGCCGTTGAAATCAATCTCTTCGAG\n+AGTCGGGAAGAAGTCATCCCAGTACACTGCGCTTCG\n+>r23.1 |SOURCES={GI=49175990,fw,3063738-3063831}|ERRORS={25_1:C}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+GCCTCCAGCCTGACAATCTCGGCCGACTTCCCTGCGCAAGATTTACGACAATATGGATTACTTTG\n+CCAGCCGCATTGTGTTGCGTCCGCAGGAG\n+>r25.1 |SOURCES={GI=49175990,fw,2503687-2503788}|ERRORS={}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+CCGGCTCCACGGTCAGTAACATGCCTGGCTGTAGCGTCGTGGTGTCCCGCGGTGAAAAACGCGGA\n+TCTTCATGAACTTCAATGCCGATAGCGTGACCGGTG\n+>r26.1 |SOURCES={GI=49175990,fw,952817-952933}|ERRORS={18_1:C,21_1:A,81_1:G}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+TACTTCGACAACCATTAATCGGTAGGTCGTTTTCACGCAGGTAAATGACCCAGTATGTCAACCCA\n+ACCAACAAACCACCACCGAGTAATGTTGCCGATCGTAACCGGAATCAGGTTATC\n+>r28.1 |SOURCES={GI=49175990,fw,34196'..b'GTG\n+>r6627.1 |SOURCES={GI=49175990,fw,3588247-3588350}|ERRORS={5_1:C,65_1:T}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+GTCGAACGAAGGCATACACCAGGTTCACTACCAGCAGGAAGAAACTCACCGGGGCGATAAGCGGC\n+AGTCGCAATCTTAAAGAAGCGGCGAATCGGCCCTGCACCG\n+>r6628.1 |SOURCES={GI=49175990,fw,3516248-3516359}|ERRORS={38_1:G}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+GCCGTAAAGACGGTATCGAGTACAGCCAGGCTTTTATACGTGCTCGCCGTCAGGGAGGATAACGC\n+TATCGACGTTAACACCCGCCTGTTCAAGTACGCCGCGGACCTTATCG\n+>r6629.1 |SOURCES={GI=49175990,fw,4151423-4151520}|ERRORS={30_1:T,46_1:C}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+TTTGGCAACAGTGCCGGATGCGGCGCGAGCGTCCTTATCCGGCCTACACGTTGGGCATCGTTTGA\n+GTCACTGTCGGTCGGATAAGATGCGCAAGTATCG\n+>r6630.1 |SOURCES={GI=49175990,fw,3466388-3466482}|ERRORS={91_1:A}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+GCCACCAGAGCAGGGTTGTCACTTTGCGTCCAGAACAGCGCTTCATAAGCCTGCCCATCAACAAC\n+AACGCGATCACCTTTCACGTACACAGTAGG\n+>r6631.1 |SOURCES={GI=49175990,fw,162495-162593}|ERRORS={96_1:T}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+AGGCGGATTTGGCGTTGGCGCTGTTACTCGATGTGCAACAAGGTCTGCGTGATGACCTTAAACTG\n+CTGATTATGTCGGCTACCCTGGACAACGACCGTC\n+>r6632.1 |SOURCES={GI=49175990,fw,4116430-4116536}|ERRORS={77_1:C}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+GCTTCATACAATCGGAGCTAACTAAAGTGCGCTCGTATTTATTAAGGCGTCACCGGTAATCGGGA\n+CGAGGATTTTTATCCCATCAACGCCTTGCAATTCAGGAGAGG\n+>r6633.1 |SOURCES={GI=49175990,fw,2351739-2351834}|ERRORS={13_1:G}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+TATCGGCTGATGGCGTGAATGGGCTACCGACGCGGTATGCCGCAAACTGGGCAACACGCGCCCCT\n+GTACGACTGCCGATCTGGCACTGCCTGGTTC\n+>r6634.1 |SOURCES={GI=49175990,fw,3702649-3702756}|ERRORS={9_1:T}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+GATGAACAGCTACGATGACGACGTAAACCAGCCCGACGACCGCGCCTTTGTTGCGTTTAAAATAG\n+TGCCAGAACTCCTGTAACGGGGTCATCGGCACCGGTGCGCTAA\n+>r6635.1 |SOURCES={GI=49175990,fw,1077130-1077225}|ERRORS={44_1:G,88_1:A}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+GCCCGGCCCTTCATAGATGCCACGACCGTTAGACGCTTTACCGATGGGCGTGAATCGCCTGCTGA\n+TAGGAAACCATATACGCCTGTGCATACTGCGG\n+>r6645.1 |SOURCES={GI=49175990,fw,1737869-1737978}|ERRORS={54_1:C,66_1:C,67_1:A,82_1:G}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+CACAACACTAATTTCACTCCCTACACTTTGCGGCGGTGTTTAATTGAGAGATTTACGAGAATATA\n+CATCGACAACCTGGGAAAAGAGTTTTTAGTCTGGCTGGCGGGTTTGAG\n+>r6647.1 |SOURCES={GI=49175990,fw,3690431-3690523}|ERRORS={2_1:A,84_1:T}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+TCTAGCGCCACGACTGGCGCATCAGCGCCCTGCACGCCCGGCATCACTTGCCCCACCTGCGGATT\n+TTGTTCCGTCTGGGCGGCTACTAGCTGGC\n+>r6649.1 |SOURCES={GI=49175990,fw,1823922-1824041}|ERRORS={39_1:C}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+TATTAATTTATAAGAAAGCAACTTAATACCCGCAGAATGACTTTCTGCGGGTAAGTATTAGCTTA\n+TTTTTTCGAGCATTAATCCCGCGCGTAATCCCAACGCTACCAACGGATTAGGGAA\n+>r6651.1 |SOURCES={GI=49175990,fw,4283826-4283926}|ERRORS={}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+GAGACGTTCAGCACGTCGTCCACACGCCCGGTTATCCAGTAATAGCCATCTTCATCGCGACGCGC\n+GCCGTCGCCGCTGAAATACATATTTTTGAAGGTGG\n+>r6652.1 |SOURCES={GI=49175990,fw,2843298-2843399}|ERRORS={11_1:G}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n+GACCGCTGGCACGGGACCATCGGGCCGACGTTACTGAAGTCGCGAGCGATTTCCGGGTCCAGACG\n+ACCAATGCCGACAGTGCGCTGTTCCATGTTCGGAGTG\n+>r6653.1 |SOURCES={GI=49175990,fw,3845215-3845312}|ERRORS={}|SOURCE_1="Escherichia coli str. K-12 substr. MG1655" (cf77cbe42208fbf232179e8864f9dcf39151cb85)\n'
diff -r 000000000000 -r 1f0a3e4497d4 test-data/NC_000913-454.ffn
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/NC_000913-454.ffn Wed Sep 06 13:23:14 2017 -0400
diff -r 000000000000 -r 1f0a3e4497d4 test-data/NC_000913-454.gff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/NC_000913-454.gff Wed Sep 06 13:23:14 2017 -0400
b'@@ -0,0 +1,3183 @@\n+##gff-version 3\n+r1.1\tFGS\tCDS\t1\t80\t.\t-\t1\tID=r1.1_1_80_-;product=predicted protein\n+r2.1\tFGS\tCDS\t1\t93\t.\t-\t0\tID=r2.1_1_93_-;product=predicted protein\n+r3.1\tFGS\tCDS\t1\t90\t.\t-\t2\tID=r3.1_1_90_-;product=predicted protein\n+r4.1\tFGS\tCDS\t1\t89\t.\t-\t2\tID=r4.1_1_89_-;product=predicted protein\n+r11.1\tFGS\tCDS\t1\t106\t.\t+\t1\tID=r11.1_1_106_+;product=predicted protein\n+r15.1\tFGS\tCDS\t1\t104\t.\t-\t2\tID=r15.1_1_104_-;product=predicted protein\n+r16.1\tFGS\tCDS\t1\t108\t.\t+\t1\tID=r16.1_1_108_+;product=predicted protein\n+r18.1\tFGS\tCDS\t1\t95\t.\t-\t1\tID=r18.1_1_95_-;product=predicted protein\n+r19.1\tFGS\tCDS\t11\t91\t.\t+\t1\tID=r19.1_11_91_+;product=predicted protein\n+r20.1\tFGS\tCDS\t1\t99\t.\t+\t1\tID=r20.1_1_99_+;product=predicted protein\n+r21.1\tFGS\tCDS\t1\t101\t.\t-\t2\tID=r21.1_1_101_-;product=predicted protein\n+r23.1\tFGS\tCDS\t1\t94\t.\t+\t0\tID=r23.1_1_94_+;product=predicted protein\n+r25.1\tFGS\tCDS\t1\t101\t.\t-\t1\tID=r25.1_1_101_-;product=predicted protein\n+r26.1\tFGS\tCDS\t1\t119\t.\t-\t1\tID=r26.1_1_119_-;product=predicted protein\n+r28.1\tFGS\tCDS\t1\t104\t.\t+\t1\tID=r28.1_1_104_+;product=predicted protein\n+r29.1\tFGS\tCDS\t1\t100\t.\t+\t0\tID=r29.1_1_100_+;product=predicted protein\n+r30.1\tFGS\tCDS\t1\t108\t.\t-\t2\tID=r30.1_1_108_-;product=predicted protein\n+r32.1\tFGS\tCDS\t1\t99\t.\t+\t0\tID=r32.1_1_99_+;product=predicted protein\n+r34.1\tFGS\tCDS\t1\t91\t.\t+\t1\tID=r34.1_1_91_+;product=predicted protein\n+r36.1\tFGS\tCDS\t1\t95\t.\t-\t2\tID=r36.1_1_95_-;product=predicted protein\n+r40.1\tFGS\tCDS\t1\t103\t.\t-\t0\tID=r40.1_1_103_-;product=predicted protein\n+r43.1\tFGS\tCDS\t33\t107\t.\t-\t2\tID=r43.1_33_107_-;product=predicted protein\n+r45.1\tFGS\tCDS\t1\t102\t.\t-\t2\tID=r45.1_1_102_-;product=predicted protein\n+r51.1\tFGS\tCDS\t1\t105\t.\t-\t0\tID=r51.1_1_105_-;product=predicted protein\n+r53.1\tFGS\tCDS\t1\t97\t.\t+\t0\tID=r53.1_1_97_+;product=predicted protein\n+r54.1\tFGS\tCDS\t1\t117\t.\t-\t0\tID=r54.1_1_117_-;product=predicted protein\n+r56.1\tFGS\tCDS\t1\t96\t.\t-\t1\tID=r56.1_1_96_-;product=predicted protein\n+r60.1\tFGS\tCDS\t1\t102\t.\t-\t1\tID=r60.1_1_102_-;product=predicted protein\n+r61.1\tFGS\tCDS\t7\t100\t.\t+\t0\tID=r61.1_7_100_+;product=predicted protein\n+r63.1\tFGS\tCDS\t15\t110\t.\t+\t2\tID=r63.1_15_110_+;product=predicted protein\n+r66.1\tFGS\tCDS\t1\t103\t.\t+\t1\tID=r66.1_1_103_+;product=predicted protein\n+r70.1\tFGS\tCDS\t1\t102\t.\t-\t0\tID=r70.1_1_102_-;product=predicted protein\n+r74.1\tFGS\tCDS\t1\t91\t.\t-\t2\tID=r74.1_1_91_-;product=predicted protein\n+r75.1\tFGS\tCDS\t1\t108\t.\t+\t0\tID=r75.1_1_108_+;product=predicted protein\n+r76.1\tFGS\tCDS\t1\t97\t.\t+\t0\tID=r76.1_1_97_+;product=predicted protein\n+r79.1\tFGS\tCDS\t1\t92\t.\t+\t2\tID=r79.1_1_92_+;product=predicted protein\n+r81.1\tFGS\tCDS\t1\t105\t.\t+\t1\tID=r81.1_1_105_+;product=predicted protein\n+r82.1\tFGS\tCDS\t1\t96\t.\t+\t2\tID=r82.1_1_96_+;product=predicted protein\n+r83.1\tFGS\tCDS\t1\t102\t.\t-\t2\tID=r83.1_1_102_-;product=predicted protein\n+r84.1\tFGS\tCDS\t1\t94\t.\t-\t1\tID=r84.1_1_94_-;product=predicted protein\n+r87.1\tFGS\tCDS\t1\t97\t.\t-\t2\tID=r87.1_1_97_-;product=predicted protein\n+r88.1\tFGS\tCDS\t1\t93\t.\t+\t0\tID=r88.1_1_93_+;product=predicted protein\n+r91.1\tFGS\tCDS\t1\t116\t.\t+\t1\tID=r91.1_1_116_+;product=predicted protein\n+r96.1\tFGS\tCDS\t1\t92\t.\t+\t0\tID=r96.1_1_92_+;product=predicted protein\n+r97.1\tFGS\tCDS\t1\t107\t.\t-\t0\tID=r97.1_1_107_-;product=predicted protein\n+r99.1\tFGS\tCDS\t1\t99\t.\t-\t2\tID=r99.1_1_99_-;product=predicted protein\n+r101.1\tFGS\tCDS\t1\t108\t.\t+\t2\tID=r101.1_1_108_+;product=predicted protein\n+r102.1\tFGS\tCDS\t1\t107\t.\t+\t2\tID=r102.1_1_107_+;product=predicted protein\n+r104.1\tFGS\tCDS\t1\t101\t.\t+\t0\tID=r104.1_1_101_+;product=predicted protein\n+r106.1\tFGS\tCDS\t1\t102\t.\t+\t2\tID=r106.1_1_102_+;product=predicted protein\n+r107.1\tFGS\tCDS\t1\t91\t.\t-\t2\tID=r107.1_1_91_-;product=predicted protein\n+r108.1\tFGS\tCDS\t1\t98\t.\t-\t2\tID=r108.1_1_98_-;product=predicted protein\n+r116.1\tFGS\tCDS\t1\t111\t.\t-\t1\tID=r116.1_1_111_-;product=predicted protein\n+r117.1\tFGS\tCDS\t1\t102\t.\t+\t1\tID=r117.1_1_102_+;product=predicted protein\n+r123.1\tFGS\tCDS\t1\t101\t.\t-\t0\tID=r123.1_1_101_-;product=predicted protein\n+r124.1\tFGS\tCDS\t1\t103\t.\t+\t0\tID=r124.1_1_103_+;product=predicted protein\n+r127.1\tFGS\tCDS\t1\t108\t.\t+\t0\tID=r127.1_1_108_+;product=predicted protein\n+'..b'\t.\t+\t2\tID=r6540.1_1_87_+;product=predicted protein\n+r6541.1\tFGS\tCDS\t1\t92\t.\t-\t1\tID=r6541.1_1_92_-;product=predicted protein\n+r6543.1\tFGS\tCDS\t1\t94\t.\t-\t1\tID=r6543.1_1_94_-;product=predicted protein\n+r6544.1\tFGS\tCDS\t1\t99\t.\t+\t0\tID=r6544.1_1_99_+;product=predicted protein\n+r6545.1\tFGS\tCDS\t1\t106\t.\t+\t0\tID=r6545.1_1_106_+;product=predicted protein\n+r6550.1\tFGS\tCDS\t1\t91\t.\t-\t1\tID=r6550.1_1_91_-;product=predicted protein\n+r6558.1\tFGS\tCDS\t1\t96\t.\t-\t0\tID=r6558.1_1_96_-;product=predicted protein\n+r6562.1\tFGS\tCDS\t1\t115\t.\t-\t2\tID=r6562.1_1_115_-;product=predicted protein\n+r6567.1\tFGS\tCDS\t1\t95\t.\t-\t2\tID=r6567.1_1_95_-;product=predicted protein\n+r6569.1\tFGS\tCDS\t1\t101\t.\t+\t2\tID=r6569.1_1_101_+;product=predicted protein\n+r6570.1\tFGS\tCDS\t1\t91\t.\t-\t0\tID=r6570.1_1_91_-;product=predicted protein\n+r6571.1\tFGS\tCDS\t1\t113\t.\t-\t1\tID=r6571.1_1_113_-;product=predicted protein\n+r6572.1\tFGS\tCDS\t3\t109\t.\t-\t2\tID=r6572.1_3_109_-;product=predicted protein\n+r6573.1\tFGS\tCDS\t1\t110\t.\t+\t0\tID=r6573.1_1_110_+;product=predicted protein\n+r6574.1\tFGS\tCDS\t1\t89\t.\t+\t1\tID=r6574.1_1_89_+;product=predicted protein\n+r6575.1\tFGS\tCDS\t1\t87\t.\t+\t1\tID=r6575.1_1_87_+;product=predicted protein\n+r6576.1\tFGS\tCDS\t1\t97\t.\t+\t1\tID=r6576.1_1_97_+;product=predicted protein\n+r6577.1\tFGS\tCDS\t1\t106\t.\t-\t2\tID=r6577.1_1_106_-;product=predicted protein\n+r6580.1\tFGS\tCDS\t1\t90\t.\t+\t1\tID=r6580.1_1_90_+;product=predicted protein\n+r6581.1\tFGS\tCDS\t1\t101\t.\t+\t1\tID=r6581.1_1_101_+;product=predicted protein\n+r6583.1\tFGS\tCDS\t1\t95\t.\t-\t2\tID=r6583.1_1_95_-;product=predicted protein\n+r6584.1\tFGS\tCDS\t1\t111\t.\t+\t2\tID=r6584.1_1_111_+;product=predicted protein\n+r6585.1\tFGS\tCDS\t1\t103\t.\t-\t0\tID=r6585.1_1_103_-;product=predicted protein\n+r6588.1\tFGS\tCDS\t1\t113\t.\t-\t0\tID=r6588.1_1_113_-;product=predicted protein\n+r6589.1\tFGS\tCDS\t57\t129\t.\t-\t2\tID=r6589.1_57_129_-;product=predicted protein\n+r6592.1\tFGS\tCDS\t1\t92\t.\t+\t0\tID=r6592.1_1_92_+;product=predicted protein\n+r6594.1\tFGS\tCDS\t1\t107\t.\t-\t1\tID=r6594.1_1_107_-;product=predicted protein\n+r6599.1\tFGS\tCDS\t1\t85\t.\t-\t0\tID=r6599.1_1_85_-;product=predicted protein\n+r6600.1\tFGS\tCDS\t1\t90\t.\t+\t0\tID=r6600.1_1_90_+;product=predicted protein\n+r6604.1\tFGS\tCDS\t1\t91\t.\t-\t2\tID=r6604.1_1_91_-;product=predicted protein\n+r6608.1\tFGS\tCDS\t1\t111\t.\t-\t0\tID=r6608.1_1_111_-;product=predicted protein\n+r6613.1\tFGS\tCDS\t1\t111\t.\t+\t1\tID=r6613.1_1_111_+;product=predicted protein\n+r6614.1\tFGS\tCDS\t1\t109\t.\t+\t2\tID=r6614.1_1_109_+;product=predicted protein\n+r6615.1\tFGS\tCDS\t1\t93\t.\t+\t0\tID=r6615.1_1_93_+;product=predicted protein\n+r6616.1\tFGS\tCDS\t1\t77\t.\t+\t2\tID=r6616.1_1_77_+;product=predicted protein\n+r6617.1\tFGS\tCDS\t1\t105\t.\t+\t1\tID=r6617.1_1_105_+;product=predicted protein\n+r6618.1\tFGS\tCDS\t1\t94\t.\t+\t0\tID=r6618.1_1_94_+;product=predicted protein\n+r6621.1\tFGS\tCDS\t1\t103\t.\t-\t1\tID=r6621.1_1_103_-;product=predicted protein\n+r6623.1\tFGS\tCDS\t1\t112\t.\t-\t1\tID=r6623.1_1_112_-;product=predicted protein\n+r6624.1\tFGS\tCDS\t1\t92\t.\t-\t1\tID=r6624.1_1_92_-;product=predicted protein\n+r6625.1\tFGS\tCDS\t1\t101\t.\t+\t2\tID=r6625.1_1_101_+;product=predicted protein\n+r6627.1\tFGS\tCDS\t1\t105\t.\t-\t1\tID=r6627.1_1_105_-;product=predicted protein\n+r6628.1\tFGS\tCDS\t1\t112\t.\t+\t2\tID=r6628.1_1_112_+;product=predicted protein\n+r6629.1\tFGS\tCDS\t1\t99\t.\t-\t2\tID=r6629.1_1_99_-;product=predicted protein\n+r6630.1\tFGS\tCDS\t1\t95\t.\t-\t2\tID=r6630.1_1_95_-;product=predicted protein\n+r6631.1\tFGS\tCDS\t1\t99\t.\t+\t2\tID=r6631.1_1_99_+;product=predicted protein\n+r6632.1\tFGS\tCDS\t22\t107\t.\t-\t0\tID=r6632.1_22_107_-;product=predicted protein\n+r6633.1\tFGS\tCDS\t1\t96\t.\t+\t0\tID=r6633.1_1_96_+;product=predicted protein\n+r6634.1\tFGS\tCDS\t1\t108\t.\t-\t1\tID=r6634.1_1_108_-;product=predicted protein\n+r6635.1\tFGS\tCDS\t1\t97\t.\t-\t0\tID=r6635.1_1_97_-;product=predicted protein\n+r6645.1\tFGS\tCDS\t1\t113\t.\t+\t0\tID=r6645.1_1_113_+;product=predicted protein\n+r6647.1\tFGS\tCDS\t1\t94\t.\t-\t2\tID=r6647.1_1_94_-;product=predicted protein\n+r6649.1\tFGS\tCDS\t1\t120\t.\t-\t0\tID=r6649.1_1_120_-;product=predicted protein\n+r6651.1\tFGS\tCDS\t1\t100\t.\t-\t2\tID=r6651.1_1_100_-;product=predicted protein\n+r6652.1\tFGS\tCDS\t1\t102\t.\t-\t2\tID=r6652.1_1_102_-;product=predicted protein\n'
diff -r 000000000000 -r 1f0a3e4497d4 test-data/NC_000913-454.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/NC_000913-454.out Wed Sep 06 13:23:14 2017 -0400
b'@@ -0,0 +1,6514 @@\n+>r1.1\n+1\t80\t-\t2\t1.263302\tI:\tD:\n+>r2.1\n+1\t93\t-\t1\t1.359780\tI:38,\tD:\n+>r3.1\n+1\t90\t-\t3\t1.336793\tI:\tD:\n+>r4.1\n+1\t89\t-\t3\t1.268571\tI:\tD:\n+>r10.1\n+>r11.1\n+1\t106\t+\t2\t1.344881\tI:\tD:\n+>r15.1\n+1\t104\t-\t3\t1.307056\tI:\tD:\n+>r16.1\n+1\t108\t+\t2\t1.370906\tI:44,\tD:\n+>r18.1\n+1\t95\t-\t2\t1.250596\tI:\tD:\n+>r19.1\n+11\t91\t+\t2\t1.360719\tI:19,42,\tD:\n+>r20.1\n+1\t99\t+\t2\t1.392627\tI:52,\tD:\n+>r21.1\n+1\t101\t-\t3\t1.284426\tI:\tD:\n+>r23.1\n+1\t94\t+\t1\t1.322426\tI:28,\tD:\n+>r25.1\n+1\t101\t-\t2\t1.316849\tI:\tD:\n+>r26.1\n+1\t119\t-\t2\t1.368915\tI:84,\tD:\n+>r28.1\n+1\t104\t+\t2\t1.315648\tI:\tD:\n+>r29.1\n+1\t100\t+\t1\t1.360202\tI:19,\tD:\n+>r30.1\n+1\t108\t-\t3\t1.321930\tI:\tD:\n+>r32.1\n+1\t99\t+\t1\t1.335313\tI:\tD:\n+>r34.1\n+1\t91\t+\t2\t1.289163\tI:\tD:\n+>r36.1\n+1\t95\t-\t3\t1.384603\tI:36,\tD:\n+>r40.1\n+1\t103\t-\t1\t1.284467\tI:19,\tD:\n+>r43.1\n+33\t107\t-\t3\t1.307641\tI:\tD:\n+>r45.1\n+1\t102\t-\t3\t1.272768\tI:\tD:\n+>r51.1\n+1\t105\t-\t1\t1.358837\tI:\tD:\n+>r53.1\n+1\t97\t+\t1\t1.278206\tI:\tD:\n+>r54.1\n+1\t117\t-\t1\t1.290726\tI:\tD:\n+>r56.1\n+1\t96\t-\t2\t1.361510\tI:\tD:\n+>r60.1\n+1\t102\t-\t2\t1.370007\tI:69,70,\tD:\n+>r61.1\n+7\t100\t+\t1\t1.330265\tI:13,\tD:\n+>r63.1\n+15\t110\t+\t3\t1.361227\tI:\tD:\n+>r66.1\n+1\t103\t+\t2\t1.343871\tI:\tD:\n+>r70.1\n+1\t102\t-\t1\t1.296679\tI:\tD:\n+>r72.1\n+>r74.1\n+1\t91\t-\t3\t1.351847\tI:\tD:\n+>r75.1\n+1\t108\t+\t1\t1.320475\tI:\tD:\n+>r76.1\n+1\t97\t+\t1\t1.275519\tI:\tD:\n+>r79.1\n+1\t92\t+\t3\t1.337747\tI:54,\tD:\n+>r81.1\n+1\t105\t+\t2\t1.376998\tI:62,\tD:\n+>r82.1\n+1\t96\t+\t3\t1.352855\tI:\tD:\n+>r83.1\n+1\t102\t-\t3\t1.336279\tI:\tD:\n+>r84.1\n+1\t94\t-\t2\t1.295955\tI:\tD:\n+>r87.1\n+1\t97\t-\t3\t1.315752\tI:\tD:\n+>r88.1\n+1\t93\t+\t1\t1.329426\tI:67,\tD:\n+>r89.1\n+>r91.1\n+1\t116\t+\t2\t1.322925\tI:\tD:\n+>r96.1\n+1\t92\t+\t1\t1.343033\tI:\tD:\n+>r97.1\n+1\t107\t-\t1\t1.288291\tI:\tD:\n+>r99.1\n+1\t99\t-\t3\t1.350663\tI:\tD:\n+>r101.1\n+1\t108\t+\t3\t1.320046\tI:28,50,51,\tD:\n+>r102.1\n+1\t107\t+\t3\t1.338579\tI:64,\tD:\n+>r104.1\n+1\t101\t+\t1\t1.367761\tI:\tD:\n+>r106.1\n+1\t102\t+\t3\t1.366683\tI:72,\tD:\n+>r107.1\n+1\t91\t-\t3\t1.366736\tI:\tD:\n+>r108.1\n+1\t98\t-\t3\t1.296799\tI:\tD:\n+>r112.1\n+>r116.1\n+1\t111\t-\t2\t1.359326\tI:81,\tD:\n+>r117.1\n+1\t102\t+\t2\t1.309613\tI:\tD:\n+>r123.1\n+1\t101\t-\t1\t1.315295\tI:\tD:\n+>r124.1\n+1\t103\t+\t1\t1.357733\tI:\tD:\n+>r127.1\n+1\t108\t+\t1\t1.324166\tI:\tD:\n+>r128.1\n+1\t97\t+\t3\t1.306949\tI:\tD:\n+>r130.1\n+1\t126\t-\t1\t1.377788\tI:\tD:\n+>r132.1\n+1\t102\t+\t3\t1.338936\tI:\tD:\n+>r133.1\n+1\t101\t+\t2\t1.381154\tI:67,\tD:\n+>r136.1\n+1\t90\t+\t1\t1.382849\tI:68,\tD:\n+>r137.1\n+1\t109\t-\t1\t1.363306\tI:\tD:\n+>r140.1\n+1\t107\t+\t1\t1.243350\tI:\tD:\n+>r141.1\n+1\t90\t-\t2\t1.334609\tI:56,\tD:\n+>r146.1\n+1\t98\t-\t1\t1.384920\tI:55,\tD:\n+>r147.1\n+1\t115\t-\t1\t1.305458\tI:\tD:\n+>r148.1\n+1\t89\t-\t2\t1.301582\tI:\tD:\n+>r150.1\n+1\t115\t+\t2\t1.418529\tI:54,\tD:\n+>r152.1\n+1\t109\t+\t3\t1.341196\tI:\tD:\n+>r154.1\n+1\t105\t-\t1\t1.324008\tI:47,\tD:\n+>r156.1\n+1\t105\t-\t3\t1.341401\tI:\tD:\n+>r159.1\n+1\t102\t-\t3\t1.429197\tI:44,45,65,\tD:\n+>r160.1\n+1\t100\t+\t2\t1.260637\tI:\tD:\n+>r163.1\n+1\t103\t-\t2\t1.303473\tI:54,\tD:\n+>r164.1\n+1\t101\t-\t3\t1.304168\tI:\tD:\n+>r166.1\n+1\t116\t-\t1\t1.321807\tI:81,\tD:\n+>r168.1\n+1\t97\t+\t1\t1.247120\tI:\tD:\n+>r169.1\n+1\t109\t-\t3\t1.275608\tI:\tD:\n+>r172.1\n+1\t119\t+\t3\t1.346842\tI:79,\tD:\n+>r173.1\n+1\t94\t+\t2\t1.376745\tI:\tD:\n+>r178.1\n+1\t102\t+\t2\t1.365434\tI:\tD:\n+>r179.1\n+1\t95\t+\t1\t1.295098\tI:\tD:\n+>r180.1\n+1\t105\t-\t3\t1.336075\tI:\tD:\n+>r182.1\n+1\t98\t+\t3\t1.299825\tI:\tD:\n+>r184.1\n+1\t98\t-\t2\t1.309435\tI:\tD:\n+>r185.1\n+1\t96\t+\t3\t1.344333\tI:49,\tD:\n+>r186.1\n+1\t96\t-\t2\t1.233759\tI:\tD:\n+>r187.1\n+1\t100\t-\t3\t1.248129\tI:\tD:\n+>r189.1\n+1\t90\t-\t3\t1.363029\tI:\tD:\n+>r191.1\n+1\t122\t-\t1\t1.343453\tI:\tD:\n+>r195.1\n+1\t92\t-\t3\t1.279477\tI:\tD:\n+>r196.1\n+1\t93\t-\t1\t1.359659\tI:85,\tD:\n+>r199.1\n+1\t107\t+\t1\t1.408516\tI:\tD:\n+>r200.1\n+1\t94\t+\t3\t1.375002\tI:\tD:\n+>r202.1\n+1\t104\t-\t1\t1.300442\tI:\tD:\n+>r207.1\n+1\t97\t+\t3\t1.311523\tI:\tD:\n+>r208.1\n+1\t97\t-\t3\t1.383029\tI:\tD:\n+>r209.1\n+1\t102\t-\t3\t1.339115\tI:\tD:\n+>r211.1\n+1\t90\t+\t3\t1.350797\tI:81,\tD:\n+>r212.1\n+1\t101\t-\t1\t1.305462\tI:77,\tD:\n+>r216.1\n+1\t87\t-\t2\t1.265748\tI:\tD:\n+>r217.1\n+1\t98\t-\t1\t1.311673\tI:\tD:\n+>r221.1\n+1\t101\t+\t3\t1.369334\tI:90,\tD:\n+>r223.1\n+>r224.1\n+>r225.1\n+1\t100\t-\t1\t1.328450\tI:33,\tD:\n+>r231.1\n+10\t113\t-\t1\t1.308359\tI:\tD:\n+>r235.1\n+1\t92\t+\t2\t1.330388\tI:24,\tD:\n+>r236.1\n+1\t107\t+\t2\t1.332603\tI:\tD:\n+>r237.1\n+1\t98\t+\t1\t1.308269\tI:\tD:\n+>r238.1\n+1\t83\t-\t2\t1.289012\tI:22,\tD:\n+>r239.1\n+1\t117\t+\t3\t1.338334\tI:\tD:\n+>r242.1\n+1\t'..b'41.1\n+1\t111\t+\t1\t1.351667\tI:\tD:\n+>r6445.1\n+1\t111\t+\t2\t1.315174\tI:82,83,\tD:\n+>r6447.1\n+1\t95\t-\t1\t1.347968\tI:\tD:\n+>r6448.1\n+1\t100\t-\t2\t1.329427\tI:72,\tD:\n+>r6449.1\n+1\t116\t-\t1\t1.282402\tI:\tD:\n+>r6452.1\n+1\t105\t+\t3\t1.319907\tI:\tD:\n+>r6453.1\n+1\t92\t-\t1\t1.253835\tI:\tD:\n+>r6455.1\n+1\t97\t-\t3\t1.343896\tI:87,\tD:\n+>r6457.1\n+1\t103\t+\t3\t1.326597\tI:24,\tD:\n+>r6461.1\n+1\t104\t+\t2\t1.370915\tI:59,\tD:\n+>r6463.1\n+1\t104\t-\t3\t1.316189\tI:\tD:\n+>r6464.1\n+1\t103\t-\t3\t1.243446\tI:19,\tD:\n+>r6467.1\n+1\t105\t+\t3\t1.270095\tI:\tD:\n+>r6468.1\n+1\t95\t+\t2\t1.302282\tI:\tD:\n+>r6469.1\n+1\t109\t-\t2\t1.370347\tI:\tD:\n+>r6470.1\n+1\t97\t+\t1\t1.295492\tI:\tD:\n+>r6472.1\n+1\t117\t-\t3\t1.362034\tI:68,\tD:\n+>r6473.1\n+1\t96\t+\t2\t1.363726\tI:\tD:\n+>r6475.1\n+1\t103\t+\t1\t1.348754\tI:80,\tD:\n+>r6476.1\n+1\t117\t+\t2\t1.315679\tI:\tD:\n+>r6477.1\n+1\t102\t+\t3\t1.334419\tI:\tD:\n+>r6479.1\n+1\t115\t-\t2\t1.293131\tI:\tD:\n+>r6480.1\n+1\t112\t-\t2\t1.308419\tI:\tD:\n+>r6481.1\n+1\t102\t-\t1\t1.363479\tI:\tD:\n+>r6483.1\n+1\t104\t+\t2\t1.380798\tI:\tD:\n+>r6484.1\n+1\t103\t+\t1\t1.357567\tI:\tD:\n+>r6487.1\n+1\t67\t+\t2\t1.335953\tI:\tD:\n+>r6490.1\n+1\t108\t+\t3\t1.378896\tI:\tD:\n+>r6492.1\n+1\t106\t-\t1\t1.366536\tI:\tD:\n+>r6493.1\n+1\t100\t+\t1\t1.345601\tI:\tD:\n+>r6494.1\n+1\t100\t-\t3\t1.286603\tI:\tD:\n+>r6496.1\n+1\t93\t-\t1\t1.291016\tI:\tD:\n+>r6497.1\n+>r6498.1\n+1\t96\t-\t3\t1.381949\tI:\tD:\n+>r6499.1\n+1\t127\t-\t2\t1.284857\tI:\tD:\n+>r6500.1\n+1\t114\t+\t2\t1.308687\tI:\tD:\n+>r6501.1\n+40\t109\t+\t1\t1.257579\tI:\tD:\n+>r6502.1\n+1\t95\t+\t3\t1.382701\tI:\tD:\n+>r6503.1\n+1\t117\t-\t1\t1.356656\tI:\tD:\n+>r6504.1\n+1\t103\t+\t1\t1.300513\tI:\tD:\n+>r6505.1\n+1\t105\t+\t3\t1.350506\tI:\tD:\n+>r6511.1\n+1\t75\t+\t1\t1.279181\tI:\tD:\n+>r6512.1\n+1\t96\t-\t2\t1.344484\tI:66,\tD:\n+>r6514.1\n+1\t98\t+\t1\t1.351535\tI:\tD:\n+>r6515.1\n+1\t103\t-\t1\t1.349268\tI:\tD:\n+>r6517.1\n+1\t97\t+\t3\t1.281819\tI:\tD:\n+>r6518.1\n+1\t125\t+\t2\t1.320435\tI:\tD:\n+>r6519.1\n+>r6520.1\n+1\t111\t-\t3\t1.290467\tI:\tD:\n+>r6522.1\n+1\t83\t+\t2\t1.213321\tI:\tD:\n+>r6530.1\n+1\t102\t+\t3\t1.331510\tI:\tD:\n+>r6531.1\n+1\t101\t+\t2\t1.393292\tI:31,\tD:\n+>r6534.1\n+>r6535.1\n+>r6537.1\n+1\t97\t+\t3\t1.375456\tI:70,\tD:\n+>r6538.1\n+1\t90\t-\t3\t1.368686\tI:\tD:\n+>r6539.1\n+1\t103\t-\t2\t1.247902\tI:\tD:\n+>r6540.1\n+1\t87\t+\t3\t1.325689\tI:\tD:\n+>r6541.1\n+1\t92\t-\t2\t1.308958\tI:\tD:\n+>r6543.1\n+1\t94\t-\t2\t1.352970\tI:67,\tD:\n+>r6544.1\n+1\t99\t+\t1\t1.258367\tI:\tD:\n+>r6545.1\n+1\t106\t+\t1\t1.333935\tI:52,\tD:\n+>r6550.1\n+1\t91\t-\t2\t1.258232\tI:\tD:\n+>r6551.1\n+>r6558.1\n+1\t96\t-\t1\t1.317454\tI:\tD:\n+>r6561.1\n+>r6562.1\n+1\t115\t-\t3\t1.342864\tI:\tD:\n+>r6567.1\n+1\t95\t-\t3\t1.284989\tI:\tD:\n+>r6569.1\n+1\t101\t+\t3\t1.329492\tI:\tD:\n+>r6570.1\n+1\t91\t-\t1\t1.237145\tI:\tD:\n+>r6571.1\n+1\t113\t-\t2\t1.353015\tI:\tD:\n+>r6572.1\n+3\t109\t-\t3\t1.301969\tI:\tD:\n+>r6573.1\n+1\t110\t+\t1\t1.337211\tI:\tD:\n+>r6574.1\n+1\t89\t+\t2\t1.383750\tI:\tD:\n+>r6575.1\n+1\t87\t+\t2\t1.260734\tI:\tD:\n+>r6576.1\n+1\t97\t+\t2\t1.266427\tI:\tD:\n+>r6577.1\n+1\t106\t-\t3\t1.336813\tI:96,\tD:\n+>r6580.1\n+1\t90\t+\t2\t1.325621\tI:\tD:\n+>r6581.1\n+1\t101\t+\t2\t1.332409\tI:\tD:\n+>r6583.1\n+1\t95\t-\t3\t1.306719\tI:42,43,\tD:\n+>r6584.1\n+1\t111\t+\t3\t1.363458\tI:\tD:\n+>r6585.1\n+1\t103\t-\t1\t1.326255\tI:\tD:\n+>r6588.1\n+1\t113\t-\t1\t1.385866\tI:\tD:\n+>r6589.1\n+57\t129\t-\t3\t1.184744\tI:\tD:\n+>r6592.1\n+1\t92\t+\t1\t1.266619\tI:\tD:\n+>r6594.1\n+1\t107\t-\t2\t1.386051\tI:\tD:\n+>r6599.1\n+1\t85\t-\t1\t1.285663\tI:\tD:\n+>r6600.1\n+1\t90\t+\t1\t1.323376\tI:\tD:\n+>r6604.1\n+1\t91\t-\t3\t1.390162\tI:47,\tD:\n+>r6608.1\n+1\t111\t-\t1\t1.397602\tI:55,\tD:\n+>r6613.1\n+1\t111\t+\t2\t1.360498\tI:\tD:\n+>r6614.1\n+1\t109\t+\t3\t1.308331\tI:\tD:\n+>r6615.1\n+1\t93\t+\t1\t1.340788\tI:\tD:\n+>r6616.1\n+1\t77\t+\t3\t1.284392\tI:\tD:\n+>r6617.1\n+1\t105\t+\t2\t1.279951\tI:\tD:\n+>r6618.1\n+1\t94\t+\t1\t1.313166\tI:34,73,\tD:\n+>r6621.1\n+1\t103\t-\t2\t1.315935\tI:\tD:\n+>r6622.1\n+>r6623.1\n+1\t112\t-\t2\t1.351761\tI:30,\tD:\n+>r6624.1\n+1\t92\t-\t2\t1.385696\tI:\tD:\n+>r6625.1\n+1\t101\t+\t3\t1.290943\tI:48,\tD:\n+>r6627.1\n+1\t105\t-\t2\t1.326238\tI:\tD:\n+>r6628.1\n+1\t112\t+\t3\t1.350369\tI:36,\tD:\n+>r6629.1\n+1\t99\t-\t3\t1.392335\tI:\tD:\n+>r6630.1\n+1\t95\t-\t3\t1.303368\tI:\tD:\n+>r6631.1\n+1\t99\t+\t3\t1.268373\tI:\tD:\n+>r6632.1\n+22\t107\t-\t1\t1.344035\tI:\tD:\n+>r6633.1\n+1\t96\t+\t1\t1.335631\tI:16,\tD:\n+>r6634.1\n+1\t108\t-\t2\t1.301261\tI:\tD:\n+>r6635.1\n+1\t97\t-\t1\t1.353989\tI:53,\tD:\n+>r6645.1\n+1\t113\t+\t1\t1.397612\tI:\tD:\n+>r6647.1\n+1\t94\t-\t3\t1.312608\tI:\tD:\n+>r6649.1\n+1\t120\t-\t1\t1.391779\tI:49,50,65,\tD:\n+>r6651.1\n+1\t100\t-\t3\t1.256730\tI:\tD:\n+>r6652.1\n+1\t102\t-\t3\t1.302640\tI:\tD:\n'
diff -r 000000000000 -r 1f0a3e4497d4 test-data/NC_000913.faa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/NC_000913.faa Wed Sep 06 13:23:14 2017 -0400
diff -r 000000000000 -r 1f0a3e4497d4 test-data/NC_000913.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/NC_000913.fasta Wed Sep 06 13:23:14 2017 -0400
diff -r 000000000000 -r 1f0a3e4497d4 test-data/NC_000913.ffn
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/NC_000913.ffn Wed Sep 06 13:23:14 2017 -0400
diff -r 000000000000 -r 1f0a3e4497d4 test-data/NC_000913.gff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/NC_000913.gff Wed Sep 06 13:23:14 2017 -0400
b'@@ -0,0 +1,688 @@\n+##gff-version 3\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t337\t2799\t.\t+\t0\tID=gi|49175990|ref|NC_000913.2|_337_2799_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t2801\t3733\t.\t+\t1\tID=gi|49175990|ref|NC_000913.2|_2801_3733_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t3734\t5020\t.\t+\t1\tID=gi|49175990|ref|NC_000913.2|_3734_5020_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t5234\t5530\t.\t+\t1\tID=gi|49175990|ref|NC_000913.2|_5234_5530_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t5683\t6459\t.\t-\t0\tID=gi|49175990|ref|NC_000913.2|_5683_6459_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t6529\t7959\t.\t-\t0\tID=gi|49175990|ref|NC_000913.2|_6529_7959_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t8238\t9191\t.\t+\t2\tID=gi|49175990|ref|NC_000913.2|_8238_9191_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t9306\t9893\t.\t+\t2\tID=gi|49175990|ref|NC_000913.2|_9306_9893_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t9928\t10494\t.\t-\t0\tID=gi|49175990|ref|NC_000913.2|_9928_10494_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t10643\t11356\t.\t-\t1\tID=gi|49175990|ref|NC_000913.2|_10643_11356_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t11382\t11786\t.\t-\t2\tID=gi|49175990|ref|NC_000913.2|_11382_11786_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t12163\t14079\t.\t+\t0\tID=gi|49175990|ref|NC_000913.2|_12163_14079_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t14168\t15298\t.\t+\t1\tID=gi|49175990|ref|NC_000913.2|_14168_15298_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t15445\t16557\t.\t+\t0\tID=gi|49175990|ref|NC_000913.2|_15445_16557_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t16580\t16720\t.\t+\t1\tID=gi|49175990|ref|NC_000913.2|_16580_16720_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t16751\t16993\t.\t-\t1\tID=gi|49175990|ref|NC_000913.2|_16751_16993_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t17489\t18655\t.\t+\t1\tID=gi|49175990|ref|NC_000913.2|_17489_18655_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t18715\t19620\t.\t+\t0\tID=gi|49175990|ref|NC_000913.2|_18715_19620_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t19811\t20314\t.\t-\t1\tID=gi|49175990|ref|NC_000913.2|_19811_20314_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t20233\t20508\t.\t-\t0\tID=gi|49175990|ref|NC_000913.2|_20233_20508_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t20815\t21078\t.\t-\t0\tID=gi|49175990|ref|NC_000913.2|_20815_21078_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t21181\t21399\t.\t+\t0\tID=gi|49175990|ref|NC_000913.2|_21181_21399_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t21407\t22348\t.\t+\t1\tID=gi|49175990|ref|NC_000913.2|_21407_22348_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t22391\t25207\t.\t+\t1\tID=gi|49175990|ref|NC_000913.2|_22391_25207_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t25207\t25701\t.\t+\t0\tID=gi|49175990|ref|NC_000913.2|_25207_25701_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t25826\t26275\t.\t+\t1\tID=gi|49175990|ref|NC_000913.2|_25826_26275_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t26277\t27227\t.\t+\t2\tID=gi|49175990|ref|NC_000913.2|_26277_27227_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t27293\t28207\t.\t+\t1\tID=gi|49175990|ref|NC_000913.2|_27293_28207_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t28374\t29195\t.\t+\t2\tID=gi|49175990|ref|NC_000913.2|_28374_29195_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t29624\t30799\t.\t+\t1\tID=gi|49175990|ref|NC_000913.2|_29624_30799_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t30817\t34038\t.\t+\t0\tID=gi|49175990|ref|NC_000913.2|_30817_34038_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFG'..b'519_669130_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t669154\t669795\t.\t-\t0\tID=gi|49175990|ref|NC_000913.2|_669154_669795_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t669797\t670828\t.\t-\t1\tID=gi|49175990|ref|NC_000913.2|_669797_670828_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t670828\t671409\t.\t-\t0\tID=gi|49175990|ref|NC_000913.2|_670828_671409_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t671424\t674147\t.\t-\t2\tID=gi|49175990|ref|NC_000913.2|_671424_674147_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t674241\t674723\t.\t+\t2\tID=gi|49175990|ref|NC_000913.2|_674241_674723_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t674793\t675770\t.\t-\t2\tID=gi|49175990|ref|NC_000913.2|_674793_675770_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t675934\t676641\t.\t+\t0\tID=gi|49175990|ref|NC_000913.2|_675934_676641_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t676638\t678065\t.\t+\t2\tID=gi|49175990|ref|NC_000913.2|_676638_678065_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t678075\t678629\t.\t-\t2\tID=gi|49175990|ref|NC_000913.2|_678075_678629_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t678731\t679438\t.\t+\t1\tID=gi|49175990|ref|NC_000913.2|_678731_679438_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t679435\t680886\t.\t+\t0\tID=gi|49175990|ref|NC_000913.2|_679435_680886_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t680946\t682616\t.\t-\t2\tID=gi|49175990|ref|NC_000913.2|_680946_682616_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t682700\t683635\t.\t-\t1\tID=gi|49175990|ref|NC_000913.2|_682700_683635_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t683753\t684478\t.\t-\t1\tID=gi|49175990|ref|NC_000913.2|_683753_684478_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t684478\t685152\t.\t-\t0\tID=gi|49175990|ref|NC_000913.2|_684478_685152_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t685152\t685892\t.\t-\t2\tID=gi|49175990|ref|NC_000913.2|_685152_685892_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t686062\t687045\t.\t-\t0\tID=gi|49175990|ref|NC_000913.2|_686062_687045_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t687220\t688200\t.\t-\t0\tID=gi|49175990|ref|NC_000913.2|_687220_688200_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t688566\t690104\t.\t-\t2\tID=gi|49175990|ref|NC_000913.2|_688566_690104_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t690129\t691007\t.\t-\t2\tID=gi|49175990|ref|NC_000913.2|_690129_691007_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t691097\t691564\t.\t-\t1\tID=gi|49175990|ref|NC_000913.2|_691097_691564_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t691561\t692640\t.\t-\t0\tID=gi|49175990|ref|NC_000913.2|_691561_692640_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t692754\t694178\t.\t-\t2\tID=gi|49175990|ref|NC_000913.2|_692754_694178_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t694324\t695499\t.\t+\t0\tID=gi|49175990|ref|NC_000913.2|_694324_695499_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t695581\t695916\t.\t+\t0\tID=gi|49175990|ref|NC_000913.2|_695581_695916_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t695978\t696184\t.\t+\t1\tID=gi|49175990|ref|NC_000913.2|_695978_696184_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t696185\t696337\t.\t+\t1\tID=gi|49175990|ref|NC_000913.2|_696185_696337_+;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t696736\t698481\t.\t-\t0\tID=gi|49175990|ref|NC_000913.2|_696736_698481_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t698797\t699549\t.\t-\t0\tID=gi|49175990|ref|NC_000913.2|_698797_699549_-;product=predicted protein\n+gi|49175990|ref|NC_000913.2|\tFGS\tCDS\t699597\t699930\t.\t-\t2\tID=gi|49175990|ref|NC_000913.2|_699597_699930_-;product=predicted protein\n'
diff -r 000000000000 -r 1f0a3e4497d4 test-data/NC_000913.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/NC_000913.out Wed Sep 06 13:23:14 2017 -0400
b'@@ -0,0 +1,688 @@\n+>gi|49175990|ref|NC_000913.2|\n+337\t2799\t+\t1\t1.301725\tI:\tD:\n+2801\t3733\t+\t2\t1.314035\tI:\tD:\n+3734\t5020\t+\t2\t1.291513\tI:\tD:\n+5234\t5530\t+\t2\t1.355441\tI:\tD:\n+5683\t6459\t-\t1\t1.289726\tI:\tD:\n+6529\t7959\t-\t1\t1.321762\tI:\tD:\n+8238\t9191\t+\t3\t1.284299\tI:\tD:\n+9306\t9893\t+\t3\t1.315930\tI:\tD:\n+9928\t10494\t-\t1\t1.274179\tI:\tD:\n+10643\t11356\t-\t2\t1.305824\tI:\tD:\n+11382\t11786\t-\t3\t1.314599\tI:\tD:\n+12163\t14079\t+\t1\t1.278534\tI:\tD:\n+14168\t15298\t+\t2\t1.298903\tI:\tD:\n+15445\t16557\t+\t1\t1.352050\tI:\tD:\n+16580\t16720\t+\t2\t1.371934\tI:\tD:\n+16751\t16993\t-\t2\t1.356243\tI:\tD:\n+17489\t18655\t+\t2\t1.317664\tI:\tD:\n+18715\t19620\t+\t1\t1.327252\tI:\tD:\n+19811\t20314\t-\t2\t1.338071\tI:\tD:\n+20233\t20508\t-\t1\t1.367180\tI:\tD:\n+20815\t21078\t-\t1\t1.293657\tI:\tD:\n+21181\t21399\t+\t1\t1.363635\tI:\tD:\n+21407\t22348\t+\t2\t1.309624\tI:\tD:\n+22391\t25207\t+\t2\t1.296178\tI:\tD:\n+25207\t25701\t+\t1\t1.285131\tI:\tD:\n+25826\t26275\t+\t2\t1.286565\tI:\tD:\n+26277\t27227\t+\t3\t1.293395\tI:\tD:\n+27293\t28207\t+\t2\t1.311996\tI:\tD:\n+28374\t29195\t+\t3\t1.298878\tI:\tD:\n+29624\t30799\t+\t2\t1.304728\tI:\tD:\n+30817\t34038\t+\t1\t1.279614\tI:\tD:\n+34086\t34265\t-\t3\t1.345869\tI:\tD:\n+34300\t34695\t+\t1\t1.348762\tI:\tD:\n+34781\t35371\t-\t2\t1.325219\tI:\tD:\n+35377\t36270\t-\t1\t1.288786\tI:\tD:\n+36271\t37839\t-\t1\t1.319264\tI:\tD:\n+37898\t39115\t-\t2\t1.290538\tI:\tD:\n+39244\t40386\t-\t1\t1.290195\tI:\tD:\n+40417\t41931\t-\t1\t1.320463\tI:\tD:\n+42340\t43173\t+\t1\t1.287244\tI:\tD:\n+43188\t44129\t+\t3\t1.289489\tI:\tD:\n+44180\t45466\t+\t2\t1.287836\tI:\tD:\n+45463\t45750\t+\t1\t1.325824\tI:\tD:\n+45807\t47138\t+\t3\t1.313209\tI:\tD:\n+47246\t47776\t+\t2\t1.311083\tI:\tD:\n+47769\t49631\t+\t3\t1.284002\tI:\tD:\n+49688\t50302\t+\t2\t1.322252\tI:\tD:\n+50380\t51222\t-\t1\t1.306762\tI:\tD:\n+51229\t51606\t-\t1\t1.319936\tI:\tD:\n+51609\t52430\t-\t3\t1.305854\tI:\tD:\n+52427\t53416\t-\t2\t1.308345\tI:\tD:\n+53416\t54702\t-\t1\t1.283812\tI:\tD:\n+54755\t57109\t-\t2\t1.315184\tI:\tD:\n+57364\t58179\t+\t1\t1.292132\tI:\tD:\n+58191\t58334\t+\t3\t1.396101\tI:\tD:\n+58474\t59124\t+\t1\t1.352791\tI:\tD:\n+59687\t60346\t-\t2\t1.311323\tI:\tD:\n+60358\t63264\t-\t1\t1.275991\tI:\tD:\n+63429\t65780\t-\t3\t1.302706\tI:\tD:\n+65855\t66550\t-\t2\t1.292199\tI:\tD:\n+66577\t66732\t+\t1\t1.359699\tI:\tD:\n+66835\t68337\t-\t1\t1.290077\tI:\tD:\n+68348\t70048\t-\t2\t1.306920\tI:\tD:\n+70336\t71265\t+\t1\t1.337014\tI:\tD:\n+71351\t72115\t+\t2\t1.302517\tI:\tD:\n+72229\t72927\t-\t1\t1.319433\tI:\tD:\n+72911\t74521\t-\t2\t1.305542\tI:\tD:\n+74497\t75480\t-\t1\t1.292610\tI:\tD:\n+75644\t77299\t-\t2\t1.315765\tI:\tD:\n+77388\t77519\t+\t3\t1.341030\tI:\tD:\n+77621\t78799\t+\t2\t1.337159\tI:\tD:\n+78848\t79453\t-\t2\t1.283278\tI:\tD:\n+79464\t80864\t-\t3\t1.283776\tI:\tD:\n+80867\t81958\t-\t2\t1.282949\tI:\tD:\n+81958\t83529\t-\t1\t1.281339\tI:\tD:\n+84350\t85312\t+\t2\t1.334329\tI:\tD:\n+85546\t87354\t+\t1\t1.327117\tI:\tD:\n+87357\t87848\t+\t3\t1.306994\tI:\tD:\n+88028\t89032\t+\t2\t1.301831\tI:\tD:\n+89634\t90092\t+\t3\t1.325896\tI:\tD:\n+90094\t91035\t+\t1\t1.294867\tI:\tD:\n+91032\t91397\t+\t3\t1.312308\tI:\tD:\n+91413\t93179\t+\t3\t1.311412\tI:\tD:\n+93166\t94653\t+\t1\t1.300128\tI:\tD:\n+94650\t96008\t+\t3\t1.304326\tI:\tD:\n+96002\t97084\t+\t2\t1.297910\tI:\tD:\n+97087\t98403\t+\t1\t1.295298\tI:\tD:\n+98403\t99647\t+\t3\t1.299237\tI:\tD:\n+99644\t100711\t+\t2\t1.309815\tI:\tD:\n+100765\t102240\t+\t1\t1.296759\tI:\tD:\n+102233\t103153\t+\t2\t1.324378\tI:\tD:\n+103155\t103985\t+\t3\t1.308174\tI:\tD:\n+103982\t105244\t+\t2\t1.314610\tI:\tD:\n+105305\t106456\t+\t2\t1.281101\tI:\tD:\n+106557\t107474\t+\t3\t1.298838\tI:\tD:\n+107552\t108217\t+\t2\t1.337220\tI:\tD:\n+108279\t110984\t+\t3\t1.284485\tI:\tD:\n+111044\t111433\t+\t2\t1.304605\tI:\tD:\n+111598\t111843\t+\t1\t1.363706\tI:\tD:\n+111856\t112557\t-\t1\t1.309304\tI:\tD:\n+112599\t113219\t-\t3\t1.307348\tI:\tD:\n+113444\t114487\t+\t2\t1.304771\tI:\tD:\n+114522\t115724\t-\t3\t1.324363\tI:\tD:\n+115714\t117099\t-\t1\t1.336929\tI:\tD:\n+117109\t117549\t-\t1\t1.306552\tI:\tD:\n+117752\t118645\t-\t2\t1.292525\tI:\tD:\n+118733\t119284\t+\t2\t1.326774\tI:\tD:\n+119281\t120135\t+\t1\t1.315844\tI:\tD:\n+120178\t121548\t-\t1\t1.301073\tI:\tD:\n+122092\t122856\t+\t1\t1.314460\tI:\tD:\n+123017\t125680\t+\t2\t1.288761\tI:\tD:\n+125695\t127587\t+\t1\t1.275229\tI:\tD:\n+127879\t129336\t+\t1\t1.280063\tI:\tD:\n+129407\t131260\t-\t2\t1.343664\tI:\tD:\n+131462\t134212\t+\t2\t1.295203\tI:\tD:\n+134340\t134750\t+\t3\t1.296766\tI:\tD:\n+134788\t135582\t-\t1\t1.299867\tI:\tD:\n+135598\t136464\t-\t1\t1.304347\tI:\tD:\n+136570\t136917\t-\t1\t1.304661\tI:\tD:\n+137083\t138633\t+\t1\t1.302442\tI:\tD:\n+138835\t141225\t-\t1\t1.304471\tI:\tD:\n+141431\t141967\t+\t2\t1.294204\tI:\t'..b'6\t-\t2\t1.342696\tI:\tD:\n+578407\t578859\t-\t1\t1.381139\tI:\tD:\n+579103\t579309\t+\t1\t1.343688\tI:\tD:\n+580057\t580602\t+\t1\t1.300496\tI:\tD:\n+580757\t581320\t+\t2\t1.319921\tI:\tD:\n+581375\t581806\t-\t2\t1.359244\tI:\tD:\n+582098\t582283\t+\t2\t1.298098\tI:\tD:\n+582904\t583653\t+\t1\t1.394550\tI:\tD:\n+583903\t584856\t-\t1\t1.346272\tI:\tD:\n+585370\t586131\t-\t1\t1.349133\tI:\tD:\n+586314\t587204\t-\t3\t1.311778\tI:\tD:\n+587205\t590177\t-\t3\t1.309019\tI:\tD:\n+590164\t592401\t-\t1\t1.300961\tI:\tD:\n+592551\t593891\t-\t3\t1.321642\tI:\tD:\n+593983\t594666\t-\t1\t1.274934\tI:\tD:\n+594823\t596196\t+\t1\t1.314266\tI:\tD:\n+596354\t596686\t+\t2\t1.289191\tI:\tD:\n+596702\t597925\t+\t2\t1.294455\tI:\tD:\n+597937\t601080\t+\t1\t1.292623\tI:\tD:\n+601146\t602558\t+\t3\t1.296242\tI:\tD:\n+602639\t603886\t-\t2\t1.305991\tI:\tD:\n+603994\t604647\t-\t1\t1.283298\tI:\tD:\n+604741\t605109\t-\t1\t1.322310\tI:\tD:\n+605174\t605422\t-\t2\t1.314671\tI:\tD:\n+605488\t606606\t-\t1\t1.317488\tI:\tD:\n+606960\t607211\t+\t3\t1.366156\tI:\tD:\n+607288\t608400\t+\t1\t1.352050\tI:\tD:\n+608423\t608563\t+\t2\t1.371934\tI:\tD:\n+608682\t609452\t-\t3\t1.352845\tI:\tD:\n+609477\t611717\t-\t3\t1.298988\tI:\tD:\n+611960\t613162\t+\t2\t1.330717\tI:\tD:\n+613165\t613383\t+\t1\t1.342677\tI:\tD:\n+613380\t617261\t+\t3\t1.304112\tI:\tD:\n+617477\t618610\t+\t2\t1.314890\tI:\tD:\n+618889\t619266\t+\t1\t1.354436\tI:\tD:\n+619419\t620411\t-\t3\t1.297129\tI:\tD:\n+620408\t621424\t-\t2\t1.299534\tI:\tD:\n+621523\t622773\t+\t1\t1.304682\tI:\tD:\n+622777\t623733\t-\t1\t1.302116\tI:\tD:\n+624108\t625283\t+\t3\t1.307151\tI:\tD:\n+625293\t626903\t+\t3\t1.300181\tI:\tD:\n+626917\t627774\t+\t1\t1.288887\tI:\tD:\n+627774\t628520\t+\t3\t1.297414\tI:\tD:\n+628523\t628936\t+\t2\t1.327069\tI:\tD:\n+629117\t631222\t+\t2\t1.290202\tI:\tD:\n+631241\t631393\t+\t2\t1.403673\tI:\tD:\n+631405\t631602\t+\t1\t1.292004\tI:\tD:\n+631612\t632700\t-\t1\t1.299241\tI:\tD:\n+632809\t633969\t+\t1\t1.309417\tI:\tD:\n+633970\t634587\t-\t1\t1.307919\tI:\tD:\n+634572\t635792\t-\t3\t1.347562\tI:\tD:\n+635939\t636841\t-\t2\t1.372788\tI:\tD:\n+637050\t637856\t-\t3\t1.325179\tI:\tD:\n+638168\t638731\t+\t2\t1.292011\tI:\tD:\n+638946\t640541\t+\t3\t1.285608\tI:\tD:\n+640662\t641090\t-\t3\t1.321703\tI:\tD:\n+641143\t641490\t-\t1\t1.360537\tI:\tD:\n+641497\t642549\t+\t1\t1.327266\tI:\tD:\n+642780\t643190\t-\t3\t1.298158\tI:\tD:\n+643420\t644244\t-\t1\t1.334655\tI:\tD:\n+644340\t645803\t-\t3\t1.315509\tI:\tD:\n+645854\t646732\t-\t2\t1.322277\tI:\tD:\n+646707\t647258\t-\t3\t1.323517\tI:\tD:\n+647262\t648794\t-\t3\t1.290176\tI:\tD:\n+648805\t649713\t-\t1\t1.269747\tI:\tD:\n+649710\t650006\t-\t3\t1.300829\tI:\tD:\n+650021\t651079\t-\t2\t1.315533\tI:\tD:\n+651458\t653116\t+\t2\t1.312664\tI:\tD:\n+653085\t653765\t+\t3\t1.324697\tI:\tD:\n+653806\t655191\t-\t1\t1.311904\tI:\tD:\n+655780\t656340\t+\t1\t1.323931\tI:\tD:\n+656515\t656724\t+\t1\t1.319986\tI:\tD:\n+656778\t657161\t-\t3\t1.354561\tI:\tD:\n+657254\t657481\t+\t2\t1.292529\tI:\tD:\n+657478\t658041\t+\t1\t1.304132\tI:\tD:\n+658170\t658373\t+\t3\t1.290298\tI:\tD:\n+658474\t659439\t-\t1\t1.303100\tI:\tD:\n+659648\t660601\t-\t2\t1.345389\tI:\tD:\n+660659\t660808\t+\t2\t1.375233\tI:\tD:\n+660860\t661501\t-\t2\t1.331094\tI:\tD:\n+661602\t661865\t-\t3\t1.302701\tI:\tD:\n+661975\t663258\t-\t1\t1.296726\tI:\tD:\n+663325\t664413\t-\t1\t1.333691\tI:\tD:\n+664424\t665536\t-\t2\t1.313492\tI:\tD:\n+665539\t667440\t-\t1\t1.299125\tI:\tD:\n+667471\t667938\t-\t1\t1.304694\tI:\tD:\n+667942\t668259\t-\t1\t1.298733\tI:\tD:\n+668519\t669130\t-\t2\t1.327834\tI:\tD:\n+669154\t669795\t-\t1\t1.322024\tI:\tD:\n+669797\t670828\t-\t2\t1.319737\tI:\tD:\n+670828\t671409\t-\t1\t1.316403\tI:\tD:\n+671424\t674147\t-\t3\t1.294015\tI:\tD:\n+674241\t674723\t+\t3\t1.320336\tI:\tD:\n+674793\t675770\t-\t3\t1.321820\tI:\tD:\n+675934\t676641\t+\t1\t1.354641\tI:\tD:\n+676638\t678065\t+\t3\t1.336904\tI:\tD:\n+678075\t678629\t-\t3\t1.352470\tI:\tD:\n+678731\t679438\t+\t2\t1.361104\tI:\tD:\n+679435\t680886\t+\t1\t1.332069\tI:\tD:\n+680946\t682616\t-\t3\t1.314735\tI:\tD:\n+682700\t683635\t-\t2\t1.310200\tI:\tD:\n+683753\t684478\t-\t2\t1.274756\tI:\tD:\n+684478\t685152\t-\t1\t1.314360\tI:\tD:\n+685152\t685892\t-\t3\t1.312291\tI:\tD:\n+686062\t687045\t-\t1\t1.289582\tI:\tD:\n+687220\t688200\t-\t1\t1.298428\tI:\tD:\n+688566\t690104\t-\t3\t1.303475\tI:\tD:\n+690129\t691007\t-\t3\t1.286140\tI:\tD:\n+691097\t691564\t-\t2\t1.283469\tI:\tD:\n+691561\t692640\t-\t1\t1.283071\tI:\tD:\n+692754\t694178\t-\t3\t1.285656\tI:\tD:\n+694324\t695499\t+\t1\t1.307314\tI:\tD:\n+695581\t695916\t+\t1\t1.388537\tI:\tD:\n+695978\t696184\t+\t2\t1.368425\tI:\tD:\n+696185\t696337\t+\t2\t1.347315\tI:\tD:\n+696736\t698481\t-\t1\t1.307023\tI:\tD:\n+698797\t699549\t-\t1\t1.294112\tI:\tD:\n+699597\t699930\t-\t3\t1.280677\tI:\tD:\n'
diff -r 000000000000 -r 1f0a3e4497d4 test-data/contigs.faa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/contigs.faa Wed Sep 06 13:23:14 2017 -0400
diff -r 000000000000 -r 1f0a3e4497d4 test-data/contigs.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/contigs.fasta Wed Sep 06 13:23:14 2017 -0400
diff -r 000000000000 -r 1f0a3e4497d4 test-data/contigs.ffn
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/contigs.ffn Wed Sep 06 13:23:14 2017 -0400
diff -r 000000000000 -r 1f0a3e4497d4 test-data/contigs.gff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/contigs.gff Wed Sep 06 13:23:14 2017 -0400
b'@@ -0,0 +1,1296 @@\n+##gff-version 3\n+1506879\tFGS\tCDS\t1\t1328\t.\t+\t0\tID=1506879_1_1328_+;product=predicted protein\n+1506881\tFGS\tCDS\t43\t216\t.\t-\t0\tID=1506881_43_216_-;product=predicted protein\n+1506881\tFGS\tCDS\t267\t449\t.\t-\t2\tID=1506881_267_449_-;product=predicted protein\n+1506881\tFGS\tCDS\t500\t1117\t.\t-\t1\tID=1506881_500_1117_-;product=predicted protein\n+1506883\tFGS\tCDS\t1\t1328\t.\t+\t2\tID=1506883_1_1328_+;product=predicted protein\n+1506885\tFGS\tCDS\t1\t235\t.\t+\t1\tID=1506885_1_235_+;product=predicted protein\n+1506885\tFGS\tCDS\t261\t857\t.\t+\t2\tID=1506885_261_857_+;product=predicted protein\n+1506885\tFGS\tCDS\t899\t1328\t.\t+\t1\tID=1506885_899_1328_+;product=predicted protein\n+1506887\tFGS\tCDS\t1\t1328\t.\t-\t2\tID=1506887_1_1328_-;product=predicted protein\n+1506889\tFGS\tCDS\t1\t304\t.\t-\t1\tID=1506889_1_304_-;product=predicted protein\n+1506889\tFGS\tCDS\t307\t495\t.\t-\t0\tID=1506889_307_495_-;product=predicted protein\n+1506889\tFGS\tCDS\t531\t758\t.\t-\t2\tID=1506889_531_758_-;product=predicted protein\n+1506889\tFGS\tCDS\t760\t1328\t.\t-\t0\tID=1506889_760_1328_-;product=predicted protein\n+1506891\tFGS\tCDS\t61\t957\t.\t-\t0\tID=1506891_61_957_-;product=predicted protein\n+1506891\tFGS\tCDS\t981\t1328\t.\t-\t2\tID=1506891_981_1328_-;product=predicted protein\n+1506893\tFGS\tCDS\t1\t875\t.\t-\t2\tID=1506893_1_875_-;product=predicted protein\n+1506893\tFGS\tCDS\t951\t1328\t.\t-\t2\tID=1506893_951_1328_-;product=predicted protein\n+1506895\tFGS\tCDS\t93\t1241\t.\t-\t2\tID=1506895_93_1241_-;product=predicted protein\n+1506897\tFGS\tCDS\t1\t112\t.\t+\t1\tID=1506897_1_112_+;product=predicted protein\n+1506897\tFGS\tCDS\t206\t1285\t.\t+\t1\tID=1506897_206_1285_+;product=predicted protein\n+1506899\tFGS\tCDS\t1\t1328\t.\t-\t2\tID=1506899_1_1328_-;product=predicted protein\n+1506901\tFGS\tCDS\t1\t1328\t.\t+\t1\tID=1506901_1_1328_+;product=predicted protein\n+1506903\tFGS\tCDS\t167\t1328\t.\t-\t1\tID=1506903_167_1328_-;product=predicted protein\n+1506905\tFGS\tCDS\t1\t821\t.\t-\t2\tID=1506905_1_821_-;product=predicted protein\n+1506905\tFGS\tCDS\t894\t1328\t.\t-\t2\tID=1506905_894_1328_-;product=predicted protein\n+1506907\tFGS\tCDS\t1\t146\t.\t-\t2\tID=1506907_1_146_-;product=predicted protein\n+1506907\tFGS\tCDS\t177\t680\t.\t+\t2\tID=1506907_177_680_+;product=predicted protein\n+1506907\tFGS\tCDS\t790\t1328\t.\t+\t0\tID=1506907_790_1328_+;product=predicted protein\n+1506909\tFGS\tCDS\t1\t261\t.\t-\t0\tID=1506909_1_261_-;product=predicted protein\n+1506909\tFGS\tCDS\t618\t1328\t.\t-\t2\tID=1506909_618_1328_-;product=predicted protein\n+1506911\tFGS\tCDS\t1\t380\t.\t+\t2\tID=1506911_1_380_+;product=predicted protein\n+1506911\tFGS\tCDS\t448\t690\t.\t+\t0\tID=1506911_448_690_+;product=predicted protein\n+1506911\tFGS\tCDS\t720\t1025\t.\t+\t2\tID=1506911_720_1025_+;product=predicted protein\n+1506911\tFGS\tCDS\t1061\t1329\t.\t+\t1\tID=1506911_1061_1329_+;product=predicted protein\n+1506913\tFGS\tCDS\t104\t1030\t.\t-\t1\tID=1506913_104_1030_-;product=predicted protein\n+1506913\tFGS\tCDS\t1039\t1149\t.\t-\t0\tID=1506913_1039_1149_-;product=predicted protein\n+1506913\tFGS\tCDS\t1165\t1329\t.\t+\t0\tID=1506913_1165_1329_+;product=predicted protein\n+1506915\tFGS\tCDS\t1\t634\t.\t+\t1\tID=1506915_1_634_+;product=predicted protein\n+1506915\tFGS\tCDS\t654\t1329\t.\t+\t2\tID=1506915_654_1329_+;product=predicted protein\n+1506917\tFGS\tCDS\t1\t1329\t.\t+\t1\tID=1506917_1_1329_+;product=predicted protein\n+1506919\tFGS\tCDS\t1\t1329\t.\t+\t2\tID=1506919_1_1329_+;product=predicted protein\n+1506921\tFGS\tCDS\t1\t1329\t.\t-\t1\tID=1506921_1_1329_-;product=predicted protein\n+1506923\tFGS\tCDS\t1\t855\t.\t+\t0\tID=1506923_1_855_+;product=predicted protein\n+1506923\tFGS\tCDS\t891\t1329\t.\t+\t2\tID=1506923_891_1329_+;product=predicted protein\n+1506925\tFGS\tCDS\t328\t1329\t.\t-\t0\tID=1506925_328_1329_-;product=predicted protein\n+1506927\tFGS\tCDS\t1\t1066\t.\t-\t1\tID=1506927_1_1066_-;product=predicted protein\n+1506927\tFGS\tCDS\t1148\t1329\t.\t-\t1\tID=1506927_1148_1329_-;product=predicted protein\n+1506929\tFGS\tCDS\t1\t797\t.\t-\t2\tID=1506929_1_797_-;product=predicted protein\n+1506929\tFGS\tCDS\t985\t1329\t.\t-\t0\tID=1506929_985_1329_-;product=predicted protein\n+1506931\tFGS\tCDS\t60\t1329\t.\t+\t2\tID=1506931_60_1329_+;product=predicted protein\n+1506933\tFGS\tCDS\t307\t1329\t.\t+\t0\tID=1506933_307_1329_+;product=predicted protein\n+'..b'duct=predicted protein\n+1508161\tFGS\tCDS\t1\t124\t.\t-\t1\tID=1508161_1_124_-;product=predicted protein\n+1508161\tFGS\tCDS\t192\t1016\t.\t-\t2\tID=1508161_192_1016_-;product=predicted protein\n+1508161\tFGS\tCDS\t1018\t1352\t.\t-\t0\tID=1508161_1018_1352_-;product=predicted protein\n+1508163\tFGS\tCDS\t1\t1060\t.\t-\t1\tID=1508163_1_1060_-;product=predicted protein\n+1508163\tFGS\tCDS\t1120\t1352\t.\t-\t0\tID=1508163_1120_1352_-;product=predicted protein\n+1508165\tFGS\tCDS\t1\t624\t.\t+\t0\tID=1508165_1_624_+;product=predicted protein\n+1508165\tFGS\tCDS\t716\t1352\t.\t-\t1\tID=1508165_716_1352_-;product=predicted protein\n+1508167\tFGS\tCDS\t1\t576\t.\t+\t0\tID=1508167_1_576_+;product=predicted protein\n+1508167\tFGS\tCDS\t864\t1353\t.\t-\t2\tID=1508167_864_1353_-;product=predicted protein\n+1508169\tFGS\tCDS\t107\t349\t.\t-\t1\tID=1508169_107_349_-;product=predicted protein\n+1508169\tFGS\tCDS\t484\t1152\t.\t-\t0\tID=1508169_484_1152_-;product=predicted protein\n+1508169\tFGS\tCDS\t1167\t1353\t.\t-\t2\tID=1508169_1167_1353_-;product=predicted protein\n+1508171\tFGS\tCDS\t1\t1084\t.\t-\t1\tID=1508171_1_1084_-;product=predicted protein\n+1508171\tFGS\tCDS\t1189\t1353\t.\t-\t0\tID=1508171_1189_1353_-;product=predicted protein\n+1508173\tFGS\tCDS\t1\t1086\t.\t+\t0\tID=1508173_1_1086_+;product=predicted protein\n+1508173\tFGS\tCDS\t1134\t1353\t.\t-\t2\tID=1508173_1134_1353_-;product=predicted protein\n+1508175\tFGS\tCDS\t1\t1353\t.\t+\t0\tID=1508175_1_1353_+;product=predicted protein\n+1508177\tFGS\tCDS\t1\t457\t.\t-\t1\tID=1508177_1_457_-;product=predicted protein\n+1508177\tFGS\tCDS\t489\t1353\t.\t-\t2\tID=1508177_489_1353_-;product=predicted protein\n+1508179\tFGS\tCDS\t1\t231\t.\t+\t0\tID=1508179_1_231_+;product=predicted protein\n+1508179\tFGS\tCDS\t243\t1353\t.\t+\t2\tID=1508179_243_1353_+;product=predicted protein\n+1508181\tFGS\tCDS\t1\t1043\t.\t+\t2\tID=1508181_1_1043_+;product=predicted protein\n+1508181\tFGS\tCDS\t1096\t1353\t.\t+\t0\tID=1508181_1096_1353_+;product=predicted protein\n+1508183\tFGS\tCDS\t1\t642\t.\t-\t0\tID=1508183_1_642_-;product=predicted protein\n+1508183\tFGS\tCDS\t674\t1108\t.\t-\t1\tID=1508183_674_1108_-;product=predicted protein\n+1508183\tFGS\tCDS\t1125\t1353\t.\t-\t2\tID=1508183_1125_1353_-;product=predicted protein\n+1508185\tFGS\tCDS\t1\t1169\t.\t+\t2\tID=1508185_1_1169_+;product=predicted protein\n+1508187\tFGS\tCDS\t63\t1160\t.\t+\t2\tID=1508187_63_1160_+;product=predicted protein\n+1508187\tFGS\tCDS\t1282\t1353\t.\t-\t0\tID=1508187_1282_1353_-;product=predicted protein\n+1508189\tFGS\tCDS\t1\t578\t.\t-\t2\tID=1508189_1_578_-;product=predicted protein\n+1508189\tFGS\tCDS\t648\t1178\t.\t-\t2\tID=1508189_648_1178_-;product=predicted protein\n+1508189\tFGS\tCDS\t1229\t1353\t.\t-\t1\tID=1508189_1229_1353_-;product=predicted protein\n+1508191\tFGS\tCDS\t1\t1353\t.\t+\t1\tID=1508191_1_1353_+;product=predicted protein\n+1508193\tFGS\tCDS\t1\t817\t.\t-\t1\tID=1508193_1_817_-;product=predicted protein\n+1508193\tFGS\tCDS\t932\t1353\t.\t-\t1\tID=1508193_932_1353_-;product=predicted protein\n+1508195\tFGS\tCDS\t250\t1353\t.\t-\t0\tID=1508195_250_1353_-;product=predicted protein\n+1508197\tFGS\tCDS\t1\t128\t.\t+\t2\tID=1508197_1_128_+;product=predicted protein\n+1508197\tFGS\tCDS\t174\t530\t.\t+\t2\tID=1508197_174_530_+;product=predicted protein\n+1508197\tFGS\tCDS\t563\t1353\t.\t+\t1\tID=1508197_563_1353_+;product=predicted protein\n+1508199\tFGS\tCDS\t1\t231\t.\t-\t0\tID=1508199_1_231_-;product=predicted protein\n+1508199\tFGS\tCDS\t422\t721\t.\t+\t1\tID=1508199_422_721_+;product=predicted protein\n+1508199\tFGS\tCDS\t732\t1007\t.\t-\t2\tID=1508199_732_1007_-;product=predicted protein\n+1508199\tFGS\tCDS\t1171\t1296\t.\t+\t0\tID=1508199_1171_1296_+;product=predicted protein\n+1508201\tFGS\tCDS\t1\t553\t.\t-\t1\tID=1508201_1_553_-;product=predicted protein\n+1508201\tFGS\tCDS\t625\t1263\t.\t-\t0\tID=1508201_625_1263_-;product=predicted protein\n+1508203\tFGS\tCDS\t1\t1353\t.\t-\t1\tID=1508203_1_1353_-;product=predicted protein\n+1508205\tFGS\tCDS\t1\t1353\t.\t+\t1\tID=1508205_1_1353_+;product=predicted protein\n+1508207\tFGS\tCDS\t1\t777\t.\t+\t0\tID=1508207_1_777_+;product=predicted protein\n+1508207\tFGS\tCDS\t803\t1353\t.\t+\t1\tID=1508207_803_1353_+;product=predicted protein\n+1508209\tFGS\tCDS\t13\t1221\t.\t-\t0\tID=1508209_13_1221_-;product=predicted protein\n+1508211\tFGS\tCDS\t1\t900\t.\t+\t2\tID=1508211_1_900_+;product=predicted protein\n'
diff -r 000000000000 -r 1f0a3e4497d4 test-data/contigs.out
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/contigs.out Wed Sep 06 13:23:14 2017 -0400
b'@@ -0,0 +1,1962 @@\n+>1506879\n+1\t1328\t+\t1\t1.335375\tI:\tD:\n+>1506881\n+43\t216\t-\t1\t1.345291\tI:\tD:\n+267\t449\t-\t3\t1.317623\tI:\tD:\n+500\t1117\t-\t2\t1.313978\tI:\tD:\n+>1506883\n+1\t1328\t+\t3\t1.312882\tI:\tD:\n+>1506885\n+1\t235\t+\t2\t1.355853\tI:\tD:\n+261\t857\t+\t3\t1.330280\tI:\tD:\n+899\t1328\t+\t2\t1.333517\tI:\tD:\n+>1506887\n+1\t1328\t-\t3\t1.303908\tI:\tD:\n+>1506889\n+1\t304\t-\t2\t1.343305\tI:\tD:\n+307\t495\t-\t1\t1.290148\tI:\tD:\n+531\t758\t-\t3\t1.289764\tI:\tD:\n+760\t1328\t-\t1\t1.278989\tI:\tD:\n+>1506891\n+61\t957\t-\t1\t1.326159\tI:\tD:\n+981\t1328\t-\t3\t1.309421\tI:\tD:\n+>1506893\n+1\t875\t-\t3\t1.329602\tI:\tD:\n+951\t1328\t-\t3\t1.313525\tI:\tD:\n+>1506895\n+93\t1241\t-\t3\t1.335646\tI:\tD:\n+>1506897\n+1\t112\t+\t2\t1.269465\tI:\tD:\n+206\t1285\t+\t2\t1.274151\tI:\tD:\n+>1506899\n+1\t1328\t-\t3\t1.317670\tI:\tD:\n+>1506901\n+1\t1328\t+\t2\t1.326350\tI:\tD:\n+>1506903\n+167\t1328\t-\t2\t1.306832\tI:\tD:\n+>1506905\n+1\t821\t-\t3\t1.327059\tI:\tD:\n+894\t1328\t-\t3\t1.281852\tI:\tD:\n+>1506907\n+1\t146\t-\t3\t1.333542\tI:\tD:\n+177\t680\t+\t3\t1.314280\tI:\tD:\n+790\t1328\t+\t1\t1.301056\tI:\tD:\n+>1506909\n+1\t261\t-\t1\t1.251385\tI:\tD:\n+618\t1328\t-\t3\t1.210419\tI:\tD:\n+>1506911\n+1\t380\t+\t3\t1.286080\tI:\tD:\n+448\t690\t+\t1\t1.263309\tI:\tD:\n+720\t1025\t+\t3\t1.274980\tI:\tD:\n+1061\t1329\t+\t2\t1.297660\tI:\tD:\n+>1506913\n+104\t1030\t-\t2\t1.350441\tI:\tD:\n+1039\t1149\t-\t1\t1.309741\tI:\tD:\n+1165\t1329\t+\t1\t1.351521\tI:\tD:\n+>1506915\n+1\t634\t+\t2\t1.337184\tI:\tD:\n+654\t1329\t+\t3\t1.318330\tI:\tD:\n+>1506917\n+1\t1329\t+\t2\t1.307771\tI:\tD:\n+>1506919\n+1\t1329\t+\t3\t1.294749\tI:\tD:\n+>1506921\n+1\t1329\t-\t2\t1.299315\tI:\tD:\n+>1506923\n+1\t855\t+\t1\t1.324715\tI:\tD:\n+891\t1329\t+\t3\t1.337010\tI:\tD:\n+>1506925\n+328\t1329\t-\t1\t1.366519\tI:\tD:\n+>1506927\n+1\t1066\t-\t2\t1.238349\tI:\tD:\n+1148\t1329\t-\t2\t1.247108\tI:\tD:\n+>1506929\n+1\t797\t-\t3\t1.349207\tI:\tD:\n+985\t1329\t-\t1\t1.311836\tI:\tD:\n+>1506931\n+60\t1329\t+\t3\t1.343945\tI:\tD:\n+>1506933\n+307\t1329\t+\t1\t1.217670\tI:\tD:\n+>1506935\n+1\t206\t+\t3\t1.180469\tI:\tD:\n+411\t1329\t+\t3\t1.203187\tI:\tD:\n+>1506937\n+1\t80\t+\t3\t1.349407\tI:\tD:\n+117\t881\t-\t3\t1.302915\tI:\tD:\n+1200\t1329\t+\t3\t1.313698\tI:\tD:\n+>1506939\n+1\t856\t+\t2\t1.326847\tI:\tD:\n+877\t978\t+\t1\t1.341209\tI:\tD:\n+1004\t1329\t+\t2\t1.326178\tI:\tD:\n+>1506941\n+1\t1200\t+\t1\t1.227617\tI:\tD:\n+>1506943\n+1\t379\t-\t2\t1.228718\tI:\tD:\n+517\t1329\t+\t1\t1.247200\tI:\tD:\n+>1506945\n+6\t842\t-\t3\t1.328333\tI:\tD:\n+918\t1329\t-\t3\t1.323479\tI:\tD:\n+>1506947\n+1\t1267\t+\t2\t1.326315\tI:\tD:\n+>1506949\n+1\t458\t-\t3\t1.224815\tI:\tD:\n+802\t1329\t+\t1\t1.238904\tI:\tD:\n+>1506951\n+18\t1283\t-\t3\t1.300856\tI:\tD:\n+>1506953\n+1\t1329\t-\t1\t1.320941\tI:\tD:\n+>1506955\n+1\t1161\t+\t1\t1.269207\tI:\tD:\n+1176\t1330\t+\t3\t1.248758\tI:\tD:\n+>1506957\n+1\t477\t-\t1\t1.303625\tI:\tD:\n+724\t1330\t-\t1\t1.326662\tI:\tD:\n+>1506959\n+57\t998\t+\t3\t1.327956\tI:\tD:\n+1122\t1330\t+\t3\t1.318405\tI:\tD:\n+>1506961\n+1\t902\t-\t3\t1.320706\tI:\tD:\n+937\t1017\t-\t1\t1.279537\tI:\tD:\n+1041\t1330\t-\t3\t1.306330\tI:\tD:\n+>1506963\n+1\t104\t+\t3\t1.371324\tI:\tD:\n+129\t845\t+\t3\t1.313297\tI:\tD:\n+852\t1271\t+\t3\t1.347616\tI:\tD:\n+>1506965\n+1\t1107\t+\t1\t1.317715\tI:\tD:\n+1131\t1330\t+\t3\t1.277994\tI:\tD:\n+>1506967\n+1\t1146\t+\t1\t1.309398\tI:\tD:\n+1261\t1330\t+\t1\t1.313068\tI:\tD:\n+>1506969\n+1\t1330\t+\t3\t1.345505\tI:\tD:\n+>1506971\n+1\t270\t+\t1\t1.305448\tI:\tD:\n+335\t1330\t-\t2\t1.308011\tI:\tD:\n+>1506973\n+199\t1068\t+\t1\t1.344770\tI:\tD:\n+1167\t1330\t+\t3\t1.359602\tI:\tD:\n+>1506975\n+1\t213\t+\t1\t1.312847\tI:\tD:\n+373\t633\t+\t1\t1.337824\tI:\tD:\n+666\t920\t+\t3\t1.292755\tI:\tD:\n+1029\t1330\t+\t3\t1.329028\tI:\tD:\n+>1506977\n+33\t1313\t+\t3\t1.332438\tI:\tD:\n+>1506979\n+1\t764\t+\t3\t1.285698\tI:\tD:\n+768\t1330\t+\t3\t1.286039\tI:\tD:\n+>1506981\n+1\t70\t+\t2\t1.342696\tI:\tD:\n+104\t877\t+\t2\t1.342161\tI:\tD:\n+897\t1330\t+\t3\t1.336439\tI:\tD:\n+>1506983\n+1\t1330\t+\t1\t1.306611\tI:\tD:\n+>1506985\n+1\t1330\t+\t1\t1.309472\tI:\tD:\n+>1506987\n+1\t511\t-\t2\t1.263519\tI:\tD:\n+515\t928\t-\t2\t1.286091\tI:\tD:\n+987\t1256\t-\t3\t1.306575\tI:\tD:\n+>1506989\n+1\t316\t+\t2\t1.302539\tI:\tD:\n+361\t1330\t-\t1\t1.336007\tI:\tD:\n+>1506991\n+1\t1198\t+\t2\t1.317997\tI:\tD:\n+>1506993\n+158\t1330\t-\t2\t1.323857\tI:\tD:\n+>1506995\n+1\t96\t+\t1\t1.352891\tI:\tD:\n+208\t1293\t+\t1\t1.328743\tI:\tD:\n+>1506997\n+1\t82\t+\t2\t1.392981\tI:\tD:\n+163\t474\t+\t1\t1.256568\tI:\tD:\n+500\t622\t+\t2\t1.258613\tI:\tD:\n+1118\t1330\t+\t2\t1.255623\tI:\tD:\n+>1506999\n+1\t423\t+\t1\t1.347075\tI:\tD:\n+436\t1062\t+\t1\t1.308789\tI:\tD:\n+1097\t1330\t+\t2\t1.358523\tI:\tD:\n+>1507001\n+1\t91\t-\t2\t1.265205\tI:\tD:\n+160\t1330\t-\t1\t1.326945\tI:\tD:\n+>1507003\n+1\t779\t+\t3\t1.'..b'-\t2\t1.212404\tI:\tD:\n+>1508087\n+1\t971\t+\t3\t1.303766\tI:\tD:\n+1003\t1351\t+\t1\t1.317398\tI:\tD:\n+>1508089\n+1\t848\t+\t3\t1.282720\tI:\tD:\n+858\t1351\t+\t3\t1.348065\tI:\tD:\n+>1508091\n+1\t1351\t-\t1\t1.324128\tI:\tD:\n+>1508093\n+1\t1017\t+\t1\t1.331485\tI:\tD:\n+1087\t1215\t+\t1\t1.326293\tI:\tD:\n+1260\t1351\t+\t3\t1.263214\tI:\tD:\n+>1508095\n+1\t1351\t+\t3\t1.324189\tI:\tD:\n+>1508097\n+1\t779\t-\t3\t1.334088\tI:\tD:\n+1014\t1351\t+\t3\t1.352377\tI:\tD:\n+>1508099\n+1\t981\t-\t1\t1.305321\tI:\tD:\n+1040\t1351\t-\t2\t1.252074\tI:\tD:\n+>1508101\n+1\t169\t+\t2\t1.360179\tI:\tD:\n+273\t1351\t+\t3\t1.314474\tI:\tD:\n+>1508103\n+1\t1351\t+\t3\t1.324912\tI:\tD:\n+>1508105\n+1\t1271\t+\t3\t1.316650\tI:\tD:\n+>1508107\n+213\t482\t-\t3\t1.263226\tI:\tD:\n+811\t1251\t-\t1\t1.254627\tI:\tD:\n+>1508109\n+1\t1351\t-\t2\t1.317338\tI:\tD:\n+>1508111\n+1\t77\t+\t3\t1.393056\tI:\tD:\n+96\t269\t+\t3\t1.333181\tI:\tD:\n+305\t1351\t-\t2\t1.352103\tI:\tD:\n+>1508113\n+1\t305\t-\t3\t1.337155\tI:\tD:\n+313\t1233\t-\t1\t1.322659\tI:\tD:\n+>1508115\n+53\t1351\t-\t2\t1.340310\tI:\tD:\n+>1508117\n+1\t583\t+\t2\t1.309133\tI:\tD:\n+655\t1351\t+\t1\t1.329902\tI:\tD:\n+>1508119\n+1\t855\t+\t1\t1.265574\tI:\tD:\n+885\t1351\t+\t3\t1.274871\tI:\tD:\n+>1508121\n+1\t72\t+\t1\t1.293136\tI:\tD:\n+288\t1082\t-\t3\t1.326983\tI:\tD:\n+1088\t1352\t-\t2\t1.356354\tI:\tD:\n+>1508123\n+1\t341\t+\t3\t1.342137\tI:\tD:\n+374\t1279\t+\t2\t1.352505\tI:\tD:\n+>1508125\n+141\t674\t+\t3\t1.329497\tI:\tD:\n+890\t1003\t-\t2\t1.312260\tI:\tD:\n+1197\t1304\t-\t3\t1.292731\tI:\tD:\n+>1508127\n+24\t1001\t-\t3\t1.318710\tI:\tD:\n+1088\t1352\t-\t2\t1.309129\tI:\tD:\n+>1508129\n+1\t604\t+\t2\t1.321396\tI:\tD:\n+673\t1352\t+\t1\t1.336703\tI:\tD:\n+>1508131\n+1\t486\t+\t1\t1.288512\tI:\tD:\n+636\t1352\t+\t3\t1.352249\tI:\tD:\n+>1508133\n+1\t1352\t+\t1\t1.341927\tI:\tD:\n+>1508135\n+1\t188\t+\t3\t1.309335\tI:\tD:\n+232\t1352\t+\t1\t1.327484\tI:\tD:\n+>1508137\n+1\t348\t+\t1\t1.219679\tI:\tD:\n+460\t903\t+\t1\t1.222560\tI:\tD:\n+945\t1352\t+\t3\t1.258209\tI:\tD:\n+>1508139\n+40\t684\t+\t1\t1.342447\tI:\tD:\n+735\t1352\t+\t3\t1.334160\tI:\tD:\n+>1508141\n+1\t1352\t-\t1\t1.223934\tI:\tD:\n+>1508143\n+1\t491\t-\t3\t1.263573\tI:\tD:\n+515\t1352\t-\t2\t1.240300\tI:\tD:\n+>1508145\n+139\t1352\t-\t1\t1.254985\tI:\tD:\n+>1508147\n+173\t619\t-\t2\t1.320561\tI:\tD:\n+812\t1352\t+\t2\t1.334295\tI:\tD:\n+>1508149\n+1\t1311\t+\t1\t1.346301\tI:\tD:\n+>1508151\n+1\t1352\t+\t3\t1.316657\tI:\tD:\n+>1508153\n+1\t143\t+\t3\t1.236011\tI:\tD:\n+178\t798\t+\t1\t1.156224\tI:\tD:\n+870\t1100\t+\t3\t1.127797\tI:\tD:\n+1129\t1352\t+\t1\t1.133388\tI:\tD:\n+>1508155\n+1\t979\t+\t2\t1.196161\tI:\tD:\n+1075\t1352\t+\t1\t1.226950\tI:\tD:\n+>1508157\n+1\t1352\t-\t2\t1.307009\tI:\tD:\n+>1508159\n+173\t1069\t-\t2\t1.254653\tI:\tD:\n+1138\t1352\t+\t1\t1.206174\tI:\tD:\n+>1508161\n+1\t124\t-\t2\t1.303702\tI:\tD:\n+192\t1016\t-\t3\t1.328676\tI:\tD:\n+1018\t1352\t-\t1\t1.342528\tI:\tD:\n+>1508163\n+1\t1060\t-\t2\t1.313121\tI:\tD:\n+1120\t1352\t-\t1\t1.322123\tI:\tD:\n+>1508165\n+1\t624\t+\t1\t1.292879\tI:\tD:\n+716\t1352\t-\t2\t1.236273\tI:\tD:\n+>1508167\n+1\t576\t+\t1\t1.322002\tI:\tD:\n+864\t1353\t-\t3\t1.399470\tI:\tD:\n+>1508169\n+107\t349\t-\t2\t1.341722\tI:\tD:\n+484\t1152\t-\t1\t1.284360\tI:\tD:\n+1167\t1353\t-\t3\t1.290562\tI:\tD:\n+>1508171\n+1\t1084\t-\t2\t1.360552\tI:\tD:\n+1189\t1353\t-\t1\t1.309567\tI:\tD:\n+>1508173\n+1\t1086\t+\t1\t1.300398\tI:\tD:\n+1134\t1353\t-\t3\t1.385147\tI:\tD:\n+>1508175\n+1\t1353\t+\t1\t1.326877\tI:\tD:\n+>1508177\n+1\t457\t-\t2\t1.330962\tI:\tD:\n+489\t1353\t-\t3\t1.311390\tI:\tD:\n+>1508179\n+1\t231\t+\t1\t1.348318\tI:\tD:\n+243\t1353\t+\t3\t1.317207\tI:\tD:\n+>1508181\n+1\t1043\t+\t3\t1.255088\tI:\tD:\n+1096\t1353\t+\t1\t1.260930\tI:\tD:\n+>1508183\n+1\t642\t-\t1\t1.242278\tI:\tD:\n+674\t1108\t-\t2\t1.258474\tI:\tD:\n+1125\t1353\t-\t3\t1.227766\tI:\tD:\n+>1508185\n+1\t1169\t+\t3\t1.311759\tI:\tD:\n+>1508187\n+63\t1160\t+\t3\t1.338482\tI:\tD:\n+1282\t1353\t-\t1\t1.399498\tI:\tD:\n+>1508189\n+1\t578\t-\t3\t1.360275\tI:\tD:\n+648\t1178\t-\t3\t1.320305\tI:\tD:\n+1229\t1353\t-\t2\t1.398857\tI:\tD:\n+>1508191\n+1\t1353\t+\t2\t1.324239\tI:\tD:\n+>1508193\n+1\t817\t-\t2\t1.299648\tI:\tD:\n+932\t1353\t-\t2\t1.367327\tI:\tD:\n+>1508195\n+250\t1353\t-\t1\t1.320809\tI:\tD:\n+>1508197\n+1\t128\t+\t3\t1.299104\tI:\tD:\n+174\t530\t+\t3\t1.298316\tI:\tD:\n+563\t1353\t+\t2\t1.307035\tI:\tD:\n+>1508199\n+1\t231\t-\t1\t1.305298\tI:\tD:\n+422\t721\t+\t2\t1.382217\tI:\tD:\n+732\t1007\t-\t3\t1.322985\tI:\tD:\n+1171\t1296\t+\t1\t1.353722\tI:\tD:\n+>1508201\n+1\t553\t-\t2\t1.346457\tI:\tD:\n+625\t1263\t-\t1\t1.325586\tI:\tD:\n+>1508203\n+1\t1353\t-\t2\t1.320331\tI:\tD:\n+>1508205\n+1\t1353\t+\t2\t1.324949\tI:\tD:\n+>1508207\n+1\t777\t+\t1\t1.306431\tI:\tD:\n+803\t1353\t+\t2\t1.317544\tI:\tD:\n+>1508209\n+13\t1221\t-\t1\t1.327260\tI:\tD:\n+>1508211\n+1\t900\t+\t3\t1.254169\tI:\tD:\n'