| Previous changeset 3:d7b97b60d0ea (2018-01-24) Next changeset 5:5e2877685afc (2018-01-31) |
|
Commit message:
Uploaded 20180131 |
|
modified:
.shed.yml |
|
added:
._.shed.yml ._example.tsv ._query.py ._query.xml example.tsv query.py query.xml |
|
removed:
retrieve.py retrieve.xml search.py search.xml |
| b |
| diff -r d7b97b60d0ea -r 35593423c2e2 ._.shed.yml |
| b |
| Binary file ._.shed.yml has changed |
| b |
| diff -r d7b97b60d0ea -r 35593423c2e2 ._example.tsv |
| b |
| Binary file ._example.tsv has changed |
| b |
| diff -r d7b97b60d0ea -r 35593423c2e2 ._query.py |
| b |
| Binary file ._query.py has changed |
| b |
| diff -r d7b97b60d0ea -r 35593423c2e2 ._query.xml |
| b |
| Binary file ._query.xml has changed |
| b |
| diff -r d7b97b60d0ea -r 35593423c2e2 .shed.yml --- a/.shed.yml Wed Jan 24 11:26:33 2018 -0500 +++ b/.shed.yml Wed Jan 31 11:28:53 2018 -0500 |
| b |
| @@ -1,20 +1,12 @@ name: sbtas_se owner: iuc categories: + - Data Source - Web Services - - Data Source description: AllSome Sequence Bloom Tree Search Engine long_description: | - A fast querying tool to search on the Sequence Read Archive repository - using Bloom Filters. + A fast querying tool to identify all publicly available sequenced + samples which express a transcript of interest remote_repository_url: https://github.com/fabio-cumbo/bloomtree-allsome-search-engine homepage_url: https://github.com/fabio-cumbo/bloomtree-allsome-search-engine -type: unrestricted -auto_tool_repositories: - name_template: "{{ tool_id }}" - descriptor_template: "Wrapper for AllSome Sequence Bloom Tree Search Engine application: {{ tool_name }}." -suite: - name: "sbtas_se_suite" - description: "A suite of Galaxy tools designed to interface with the AllSome Sequence Bloom Tree Search Engine APIs." - long_description: | - Rapid querying of massive sequence datasets \ No newline at end of file +type: unrestricted \ No newline at end of file |
| b |
| diff -r d7b97b60d0ea -r 35593423c2e2 example.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/example.tsv Wed Jan 31 11:28:53 2018 -0500 |
| b |
| @@ -0,0 +1,3 @@ +0 CCAACCAAAGGGAAAACTTTTTTCCGACTTTGGCCTAAAGGGTTTAACGGCCAAGTCAGAAGGGAAAAAGTTGCGCCAAAAATGGCGTTAAAATGTGTAATCAGAGAAGCGACACGAAAAGGGGATCAGCTCTTGGCTGGCAATTGGTAGGTCAGAGGTGGATTGGGAAAAGGCAAGTCAGCAACTGTCGATGACGGCGACTGACTGTTAATGAAAATTGTTTTGGCTGTGTGGAAAAAAATACGCGGGAATCCGTGAATTTTCCGAGGAGCTGGTGGAGCGAAGAAAACGGGGTGCTGCTGTTGTAAATGATTGGTGAAAGTCACACGCCCGCAGCCTTGCCAAACTAATTAACGCCAAATGGAGCTAAGGCCTTTGAATGATGGCTGCAGGCTAGCTTATGAAAAGGGGTTGAAGAGAAGTGGAAAAATTGGTAGAAAGGGATTTGCTCAAGATGCC +1 TTAATGACAGGGCCACATGATGTGAAAAAAAATCAGAAACCGAGTCAACGTGAGAAGATAGTACGTACTACCGCAAATGAATGGCCATTTCATTTGCATGTTGGGAGCAACAGAAATGAGAGAGCATCCGAAGCTAACCACAAAAATGGACTTTGCTTCATTATGCACAAACACGCCAATAAATGTAACGAGAAAGATAGTAGGAGCGAAAGACGAGACGAGACAAACAGGAAGAAGACGAGTGGACGAGTGTTTTTTGTAACGAAACTCTTAATCGCTCCTTTGCAGGCTTAAGCTGATAGTTGCTACGTTTATGCCATGAATTTCAAGATCTCTCAAATGCGTGAAAATCCAGTTTATGCGACAGACAAATTCATGTATTTGAAAAATCTTAGCTGATAGAAATCAAAGGTGATT +2 CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC \ No newline at end of file |
| b |
| diff -r d7b97b60d0ea -r 35593423c2e2 query.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/query.py Wed Jan 31 11:28:53 2018 -0500 |
| [ |
| b'@@ -0,0 +1,174 @@\n+#!/usr/bin/env python\n+\n+# https://github.com/ross/requests-futures\n+# http://docs.python-requests.org/en/master/user/quickstart/#more-complicated-post-requests\n+\n+import os, uuid, optparse, requests, json, time\n+#from requests_futures.sessions import FuturesSession\n+\n+#### NN14 ####\n+service_url = "http://nn14.galaxyproject.org:8080/";\n+#service_url = "http://127.0.0.1:8082/";\n+query_url = service_url+"tree/0/query";\n+status_url = service_url+"status/<task_id>";\n+##############\n+\n+def query_request( options, args, payload ):\n+ # add additional parameters to the payload\n+ #payload["tree_id"] = str(options.treeid);\n+ payload["search_mode"] = str(options.search);\n+ payload["exact_algorithm"] = int(options.exact);\n+ payload["search_threshold"] = float(options.sthreshold);\n+ # set the content type to application/json\n+ headers = {\'Content-type\': \'application/json\'};\n+\n+ # create a session\n+ session = requests.Session();\n+ # make a synchronous post request to the query route\n+ req = session.post(query_url, headers=headers, json=payload);\n+ resp_code = req.status_code;\n+ #print(str(req.content)+"\\n\\n");\n+ if resp_code == requests.codes.ok:\n+ resp_content = str(req.content);\n+ # convert out to json\n+ json_content = json.loads(resp_content);\n+ # retrieve task id\n+ task_id = json_content[\'task_id\'];\n+ task_processed = False;\n+ # results json content\n+ json_status_content = None;\n+ task_status = None;\n+ while task_processed is False:\n+ # create a new session\n+ session = requests.Session();\n+ # make a synchronous get request to the status route\n+ status_query_url = status_url.replace("<task_id>", task_id);\n+ status_req = session.get(status_query_url);\n+ status_resp_content = str(status_req.content);\n+ #print(status_resp_content+"\\n\\n");\n+ # convert out to json\n+ json_status_content = json.loads(status_resp_content);\n+ # take a look at the state\n+ # state attribute is always available\n+ if json_status_content[\'state\'] == \'SUCCESS\':\n+ task_processed = True;\n+ break;\n+ elif json_status_content[\'state\'] in [\'FAILURE\', \'REVOKED\']:\n+ return "Task status: "+str(json_status_content[\'state\']);\n+ else:\n+ time.sleep(60); # in seconds\n+ \n+ # get output dir (collection) path\n+ output_dir_path = options.outputdir;\n+ if not os.path.exists(output_dir_path):\n+ os.makedirs(output_dir_path);\n+ out_file_format = "txt";\n+\n+ for block in json_status_content[\'results\']:\n+ seq_id = block[\'sequence_id\'];\n+ accessions = block[\'accession_numbers\'];\n+ # put response block in the output collection\n+ output_file_path = os.path.join(output_dir_path, seq_id + "_" + out_file_format);\n+ accessions_list = "";\n+ for accession_number in accessions:\n+ accessions_list = accessions_list + accession_number + "\\n";\n+ with open(output_file_path, \'w\') as out:\n+ out.write(accessions_list.strip());\n+ else:\n+ return "Unable to query the remote server. Please try again in a while.";\n+\n+def query( options, args ):\n+ multiple_data = {};\n+ comma_sep_file_paths = options.files;\n+ #print("files: "+str(comma_sep_file_paths)+" - "+str(type(comma_sep_file_paths)));\n+ # check if options.files contains at least one file path\n+ if comma_sep_file_paths is not None:\n+ # split file paths\n+ file_paths = comma_sep_file_paths.split(",");\n+ # split file names\n+ comma_sep_file_names = str(options.names);\n+ #print("names: "+str(comma_sep_file_names));\n+ file_names = comma_sep_file_names.split(",");\n+ for idx, file_path in enumerate(fil'..b's, args );\n+ else:\n+ return "An error has occurred. Please be sure that your input files are valid.";\n+ else:\n+ # try with the sequence in --sequence\n+ text_content = options.sequences;\n+ #print("sequences: "+text_content);\n+ # check if options.sequences contains a list of sequences (one for each row)\n+ if text_content is not None:\n+ text_content = str(text_content);\n+ if text_content.strip():\n+ # populate a dictionary with the files containing the sequences to query\n+ text_content = text_content.strip().split("__cn__"); # split on new line\n+ for line in text_content:\n+ if line.strip() != "":\n+ line_split = line.strip().split("__tc__"); # split on tab\n+ if len(line_split) == 2: # 0:id , 1:seq , otherwise skip line\n+ seq_id = line_split[0];\n+ seq_text = line_split[1];\n+ if seq_id in multiple_data:\n+ return "Error: the id \'"+seq_id+"\' is duplicated";\n+ multiple_data[seq_id] = seq_text;\n+ if len(multiple_data) > 0:\n+ return async_request( options, args, multiple_data );\n+ #return echo( options, args );\n+ else:\n+ return "An error has occurred. Please be sure that your input files are valid.";\n+ else:\n+ return "You have to insert at least one row formatted as a tab delimited <id, sequence> touple";\n+ return -1;\n+\n+def __main__():\n+ # Parse the command line options\n+ usage = "Usage: query.py --files comma_sep_file_paths --names comma_seq_file_names --sequences sequences_text --search search_mode --exact exact_alg --sthreshold threshold --outputdir output_dir_path";\n+ parser = optparse.OptionParser(usage = usage);\n+ parser.add_option("-f", "--files", type="string",\n+ action="store", dest="files", help="comma separated files path");\n+ parser.add_option("-n", "--names", type="string",\n+ action="store", dest="names", help="comma separated names associated to the files specified in --files");\n+ parser.add_option("-s", "--sequences", type="string",\n+ action="store", dest="sequences", help="contains a list of sequences (one for each row)");\n+ parser.add_option("-a", "--fasta", type="string",\n+ action="store", dest="fasta", help="contains the content of a fasta file");\n+ parser.add_option("-x", "--search", type="string", default=0,\n+ action="store", dest="search", help="search mode");\n+ parser.add_option("-e", "--exact", type="int", default=0,\n+ action="store", dest="exact", help="exact algorithm (required if search is 1 only)");\n+ parser.add_option("-t", "--sthreshold", type="float",\n+ action="store", dest="sthreshold", help="threshold applied to the search algrithm");\n+ parser.add_option("-o", "--outputdir", type="string",\n+ action="store", dest="outputdir", help="output directory (collection) path");\n+\n+ #parser.add_option("-k", "--outfile", type="string",\n+ #action="store", dest="outfile", help="output file");\n+ \n+ # TEST\n+ #--search \'rrr\'\n+ #--sthreshold 0.5\n+ #--exact 0\n+ #--sequences \'id0__tc__CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC\'\n+ #--outputdir \'collection_content\'\n+ #sequences = \'id0__tc__CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC\';\n+ #print(sequences);\n+ #(options, args) = parser.parse_args([\'-x\', \'rrr\', \'-t\', 0.5, \'-s\', sequences, \'-o\', \'collection_content\']);\n+ \n+ (options, args) = parser.parse_args();\n+ return query( options, args );\n+\n+if __name__ == "__main__": __main__()\n' |
| b |
| diff -r d7b97b60d0ea -r 35593423c2e2 query.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/query.xml Wed Jan 31 11:28:53 2018 -0500 |
| [ |
| @@ -0,0 +1,86 @@ +<?xml version="1.0"?> +<tool name="Query" id="sbtas_se_query" version="1.0.0"> + <description>the AllSome Sequence Bloom Tree</description> + <requirements> + <requirement type="package" version="2.7.10">python</requirement> + <requirement type="package" version="2.18.4">requests</requirement> + </requirements> + <command detect_errors="exit_code"> +<![CDATA[ + python '$__tool_directory__/query.py' + + --search 'rrr' + --sthreshold ${sthreshold} + --exact 0 + + #if $conditional_input.inputtype == '0': + #set file_paths = ','.join( [ str( $f ) for $f in $conditional_input.txtfiles ] ) + #if $file_paths is not 'None': + --files '${file_paths}' + #set file_names = ','.join( [ str( $f.name ) for $f in $conditional_input.txtfiles ] ) + --names '${file_names}' + #end if + #elif $conditional_input.inputtype == '1': + --sequences '${conditional_input.sequences}' + #end if + + --outputdir 'collection_content' +]]> + </command> + <inputs> + <conditional name="conditional_input"> + <param name="inputtype" type="select" label="Input mode" help="Select a mode based on how do you want to specify the input"> + <option value="0" selected="true">By file</option> + <option value="1">By manually inserted text</option> + </param> + <when value="0"> + <param format="tabular" name="txtfiles" type="data" label="Select files" multiple="true" optional="true" help="Select one or more tabular files containing (ID, TRANSCRIPT) touples for each line. The content of these files will be merged and the result will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each id. The content of these files as result of the tool will be a list of accession numbers." /> + </when> + <when value="1"> + <param name="sequences" type="text" area="True" size="5x25" label="Manually insert sequences" optional="true" help="Insert a list of (ID, TRANSCRIPT) touples in a tab delimited format, one for each line. The content of this text box will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each id. The content of these files as result of the tool will be a list of accession numbers." /> + </when> + </conditional> + <param name="sthreshold" size="3" type="float" value="0.5" min="0.0" max="1.0" label="Search threshold" help="This threshold controls the specificity. Lower values will produce more hits to the query. Higher values are more stringent and will produce fewer hits." /> + </inputs> + <outputs> + <collection name="output_collect" type="list" label="AllSome Sequence Bloom Tree Search Collection"> + <discover_datasets pattern="(?P<identifier_0>[^_]+)_(?P<ext>[^_]+)" directory="collection_content" ext="tabular" /> + </collection> + </outputs> + + <help><![CDATA[ +The AllSome Sequence Bloom Tree Search Engine is a fast querying tool to identify all publicly available +sequenced samples which express a transcript of interest. + +---- + +**Example** + +The input for this tool is a list of (ID, TRANSCRIPT) touples, one for each line, +in a tab delimited format:: + + seq_id_0 CCAACCAAAGGGAAAACTTTTTTCCGACTTTGGCCTAAAGGGTTTAACGGCCAAGTCAGAAGGGAAAAAGTTGCGCCA + seq_id_1 TTAATGACAGGGCCACATGATGTGAAAAAAAATCAGAAACCGAGTCAACGTGAGAAGATAGTACGTACTACCGCAAAT + ... + seq_id_n CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC + +The output of the tool is a collection that contains a file for each ID with a list of +accession numbers representing the samples that express one particular transcript. + +---- + +.. class:: infomark + +**Notes** + +This Galaxy tool has been developed by Fabio Cumbo. + +Please visit this GithHub_repository_ for more information about the AllSome Sequence Bloom Tree Search Engine + +.. _GithHub_repository: https://github.com/fabio-cumbo/bloomtree-allsome-search-engine + ]]></help> + + <citations> + <citation type="doi">10.1101/090464</citation> + </citations> +</tool> |
| b |
| diff -r d7b97b60d0ea -r 35593423c2e2 retrieve.py --- a/retrieve.py Wed Jan 24 11:26:33 2018 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| [ |
| @@ -1,118 +0,0 @@ -#!/usr/bin/env python - -# NCBI SRA Tools -# https://galaxyproject.org/tutorials/upload/ - -import os -import optparse -from subprocess import Popen, PIPE - -db_key = "?"; -sra_instant_url = "ftp://ftp-trace.ncbi.nlm.nih.gov/sra/sra-instant/reads/ByRun/sra/SRR/"; - -def convertSRA(tmp_dir, accession_number, data_format): - absolute_tmp_dir = os.path.abspath(tmp_dir); - sra_file_path = os.path.join(absolute_tmp_dir, accession_number+".sra"); - if os.path.isdir(absolute_tmp_dir) and os.path.exists(sra_file_path): - process = None; - if data_format == ".fasta.gz": - process = Popen(["fastq-dump", "--fasta", "--gzip", sra_file_path, "--outdir", absolute_tmp_dir], stdout=PIPE); - elif data_format == ".fastq.gz": - process = Popen(["fastq-dump", "--gzip", sra_file_path, "--outdir", absolute_tmp_dir], stdout=PIPE); - elif data_format == ".fasta": - process = Popen(["fastq-dump", "--fasta", sra_file_path, "--outdir", absolute_tmp_dir], stdout=PIPE); - elif data_format == ".fastq": - process = Popen(["fastq-dump", sra_file_path, "--outdir", absolute_tmp_dir], stdout=PIPE); - else: - process = None; - if process is not None: - (output, err) = process.communicate(); - if err: - # kill the process - # kill_process(process.pid); - # remove any trace of the output file - an_file_path = os.path.join(tmp_dir, accession_number+data_format); - if os.path.exists(an_file_path): - os.unlink(an_file_path); - # try to restart the process - return downloadAccessionData(tmp_dir, accession_number, data_format); - #exit_code = process.wait(); - return os.path.join(tmp_dir, accession_number+data_format); - return ""; - -def downloadAccessionData(accession_number, accession_path, appdata_path, data_format, limit=10): - split = accession_number[:6]; - srr_path = sra_instant_url+split+"/"+accession_number+"/"+accession_number+".sra"; - sra_file_path = os.path.join(appdata_path, accession_number+".sra"); - process = Popen(['wget', srr_path, "--output-document="+sra_file_path], stdout=PIPE); - (output, err) = process.communicate(); - if err: - # remove any trace of the output file - if os.path.exists(an_file_path): - os.unlink(an_file_path); - # try to restart the process - if limit > 0: - return downloadAccessionData(accession_number, accession_path, appdata_path, data_format, limit-1); - return -1; - if os.path.exists(sra_file_path): - converted_file_path = convertSRA(appdata_path, accession_number, data_format); - if os.path.exists(converted_file_path): - os.rename(converted_file_path, accession_path); - os.unlink(sra_file_path); - return 0; - -def process_accessions( options, args ): - # create appdata dir if it does not exist - appdata_path = options.appdata; - if not os.path.exists(appdata_path): - os.makedirs(appdata_path); - data_format = options.dataformat; - ''' - # Collection test - test_file_name = "Test Collection" + "_" + "SRRtest" + "_" + data_format[1:] + "_" + db_key; - test_file_path = os.path.join(appdata_path, test_file_name); - file = open(test_file_path, "w"); - file.write("Hello World"); - file.close(); - ''' - # read inputs - comma_sep_file_paths = options.files; - #print("files: "+str(comma_sep_file_paths)+" - "+str(type(comma_sep_file_paths))); - # check if options.files contains at least one file path - if comma_sep_file_paths is not None: - # split file paths - file_paths = comma_sep_file_paths.split(","); - # split file names - comma_sep_file_names = str(options.names); - #print("names: "+str(comma_sep_file_names)); - file_names = comma_sep_file_names.split(","); - # populate a dictionary with the files containing the sequences to query - for idx, file_path in enumerate(file_paths): - file_name = file_names[idx]; - #print(file_name + ": " + file_path); - with open(file_path) as accessions: - for line in accessions: - if line.strip() != "" and not line.startswith(">"): - accession_number = line.strip(); - filename_with_collection_prefix = file_name + "_" + accession_number + "_" + data_format[1:] + "_" + db_key; - accession_path = os.path.join(appdata_path, filename_with_collection_prefix) - # download fastq filte related to accession_number - downloadAccessionData( accession_number, accession_path, appdata_path, data_format ); - return 0; - -def __main__(): - # Parse the command line options - usage = "Usage: retrieve.py --files comma_sep_file_paths --names comma_seq_file_names --format data_format --appdata folder_name"; - parser = optparse.OptionParser(usage = usage); - parser.add_option("-f", "--files", type="string", - action="store", dest="files", help="comma separated files path"); - parser.add_option("-n", "--names", type="string", - action="store", dest="names", help="comma separated names associated to the files specified in --files"); - parser.add_option("-e", "--format", type="string", - action="store", dest="dataformat", help="data format"); - parser.add_option("-a", "--appdata", type="string", - action="store", dest="appdata", help="appdata folder name"); - (options, args) = parser.parse_args(); - return process_accessions( options, args ); - -if __name__ == "__main__": __main__() |
| b |
| diff -r d7b97b60d0ea -r 35593423c2e2 retrieve.xml --- a/retrieve.xml Wed Jan 24 11:26:33 2018 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| [ |
| @@ -1,41 +0,0 @@ -<?xml version="1.0"?> -<tool name="Retrieve" id="sbtas_se_retrieve" version="1.0.0"> - <description>data from SRA</description> - <requirements> - <requirement type="package" version="2.7.10">python</requirement> - <requirement type="package" version="2.8.2">sra-tools</requirement> - </requirements> - <command detect_errors="exit_code"> -<![CDATA[ - python '$__tool_directory__/retrieve.py' - #set file_paths = ','.join( [ str( $f ) for $f in $files ] ) - --files '${file_paths}' - #set file_names = ','.join( [ str( $f.name ) for $f in $files ] ) - --names '${file_names}' - --format '${dataformat}' - --appdata 'tmp' - > ${stdouterr} -]]> - </command> - <inputs> - <param format="json" name="files" type="data" label="Select input files" multiple="true" optional="false" help="Select one or more json files containing a list of accession numbers (as result of the Search tool)." /> - <param name="dataformat" type="select" label="Select a data format" help="Select a data format for the accession numbers related files that will be downloaded"> - <option value=".fastq">.fastq</option> - <option value=".fastq.gz">.fastq.gz</option> - <option value=".fasta">.fasta</option> - <option value=".fasta.gz">.fasta.gz</option> - </param> - </inputs> - <outputs> - <collection name="list_output" type="list:list" label="${tool.name} Accessions: Output Collection"> - <discover_datasets pattern="(?P<identifier_0>[^_]+)_(?P<identifier_1>[^_]+)_(?P<ext>[^_]+)_(?P<dbkey>[^_]+)" ext="auto" visible="False" directory="tmp" /> - </collection> - <data format="txt" name="stdouterr" /> - </outputs> - - <help><![CDATA[ -Authors: Fabio Cumbo, Robert S. Harris, Chen Sun - -This tool will retrieve fastq files associated to the accession numbers listed in the input files. - ]]></help> -</tool> |
| b |
| diff -r d7b97b60d0ea -r 35593423c2e2 search.py --- a/search.py Wed Jan 24 11:26:33 2018 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| [ |
| @@ -1,140 +0,0 @@ -#!/usr/bin/env python - -# https://github.com/ross/requests-futures -# http://docs.python-requests.org/en/master/user/quickstart/#more-complicated-post-requests - -import os, uuid -import optparse -import requests -from requests_futures.sessions import FuturesSession - -#### UV0 #### -# proxy to uv0 -#service_url = "http://deputy.bx.psu.edu/"; -# url to query page -#query_url = service_url+"query.php"; -# url to echo page: just return 'it works!' -#echo_url = service_url+"echo.php"; -############# - -#### NN14 #### -service_url = "http://nn14.galaxyproject.org:8080/"; -query_url = service_url+"tree/0/query"; -############## - -''' -# synchronous -def echo( options, args ): - # create a session - session = requests.Session() - # make a sync get request - resp = session.get(echo_url) - # check for response status code - resp_code = resp.status_code; - if resp_code == requests.codes.ok: - # get output file path - output_file_path = options.output; - # write response on the output file - with open(output_file_path, 'w') as out: - #out.write(resp.data); - out.write(resp.content); - return 0; - else: - return resp_code; -''' - -# asynchronous -def async_request( options, args, payload ): - # add additional parameters to the payload - #payload["tree_id"] = str(options.treeid); - payload["search_mode"] = str(options.search); - payload["exact_algorithm"] = int(options.exact); - payload["search_threshold"] = float(options.sthreshold); - # set the content type to application/json - headers = {'Content-type': 'application/json'}; - # create a session - session = FuturesSession(); - # make an async post request with requests-futures - future_req = session.post(query_url, headers=headers, json=payload); - # wait for the request to complete, if it has not already - resp = future_req.result(); - # check for response status code - resp_code = resp.status_code; - # get output file path - output_file_path = options.output; - # write response on the output file - with open(output_file_path, 'w') as out: - #out.write(resp.data); - out.write(str(resp.content)); - if resp_code == requests.codes.ok: - return 0; - else: - return resp_code; - -def srase_query( options, args ): - multiple_data = {}; - comma_sep_file_paths = options.files; - #print("files: "+str(comma_sep_file_paths)+" - "+str(type(comma_sep_file_paths))); - # check if options.files contains at least one file path - if comma_sep_file_paths is not None: - # split file paths - file_paths = comma_sep_file_paths.split(","); - # split file names - comma_sep_file_names = str(options.names); - #print("names: "+str(comma_sep_file_names)); - file_names = comma_sep_file_names.split(","); - # populate a dictionary with the files containing the sequences to query - sequences = []; - for idx, file_path in enumerate(file_paths): - #file_name = file_names[idx]; - with open(file_path, 'r') as content_file: - content = content_file.read() - sequences.append(content.strip()); - #multiple_data[file_name] = content; - #print(file_name+": "+content+"\n"); - if len(sequences) > 0: - multiple_data['sequences'] = sequences; - return async_request( options, args, multiple_data ); - #return echo( options, args ); - else: - return -1; - else: - # try with the sequence in --sequence - text_content = options.sequences; - #print("sequences: "+text_content); - # check if options.sequences contains a list of sequences (one for each row) - if text_content is not None: - text_content = str(text_content); - if text_content.strip(): - # populate a dictionary with the files containing the sequences to query - multiple_data['sequences'] = text_content.strip().split("__cn__"); - return async_request( options, args, multiple_data ); - #return echo( options, args ); - else: - return -1; - return -1; - -def __main__(): - # Parse the command line options - usage = "Usage: search.py --files comma_sep_file_paths --names comma_seq_file_names --sequences sequences_text --search search_mode --exact exact_alg --sthreshold threshold --output output_file_path"; - parser = optparse.OptionParser(usage = usage); - parser.add_option("-f", "--files", type="string", - action="store", dest="files", help="comma separated files path"); - parser.add_option("-n", "--names", type="string", - action="store", dest="names", help="comma separated names associated to the files specified in --files"); - parser.add_option("-s", "--sequences", type="string", - action="store", dest="sequences", help="contains a list of sequences (one for each row)"); - parser.add_option("-a", "--fasta", type="string", - action="store", dest="fasta", help="contains the content of a fasta file"); - parser.add_option("-x", "--search", type="string", default=0, - action="store", dest="search", help="search mode"); - parser.add_option("-e", "--exact", type="int", default=0, - action="store", dest="exact", help="exact algorithm (required if search is 1 only)"); - parser.add_option("-t", "--sthreshold", type="float", - action="store", dest="sthreshold", help="threshold applied to the search algrithm"); - parser.add_option("-o", "--output", type="string", - action="store", dest="output", help="output file path"); - (options, args) = parser.parse_args(); - return srase_query( options, args ); - -if __name__ == "__main__": __main__() |
| b |
| diff -r d7b97b60d0ea -r 35593423c2e2 search.xml --- a/search.xml Wed Jan 24 11:26:33 2018 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| [ |
| @@ -1,57 +0,0 @@ -<?xml version="1.0"?> -<tool name="Search" id="sbtas_se_search" version="1.0.0"> - <description>your sequences in the big SRA data lake</description> - <requirements> - <requirement type="package" version="2.7.10">python</requirement> - <requirement type="package" version="2.18.4">requests</requirement> - <requirement type="package" version="0.9.7">requests-futures</requirement> - </requirements> - <command detect_errors="exit_code"> -<![CDATA[ - python '$__tool_directory__/search.py' - - --search 'rrr' - --sthreshold ${sthreshold} - --exact 0 - - #if $conditional_input_zero.inputtype_zero == '0': - #set file_paths = ','.join( [ str( $f ) for $f in $conditional_input_zero.txtfiles ] ) - #if $file_paths is not 'None': - --files '${file_paths}' - #set file_names = ','.join( [ str( $f.name ) for $f in $conditional_input_zero.txtfiles ] ) - --names '${file_names}' - #end if - #elif $conditional_input_zero.inputtype_zero == '1': - --sequences '${conditional_input_zero.sequences}' - #end if - - --output '${output}' -]]> - </command> - <inputs> - <conditional name="conditional_input_zero"> - <param name="inputtype_zero" type="select" label="Input mode" help="Select a mode based on how do you want to specify the input"> - <option value="0" selected="true">By file</option> - <option value="1">By manually inserted text</option> - </param> - <when value="0"> - <param format="txt" name="txtfiles" type="data" label="Select sequences" multiple="true" optional="true" help="Select one or more txt files containing a sequence. A single file can contain more sequences, one for each row. Every file will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a list of accession numbers. It is worth noting that the result could be empty." /> - </when> - <when value="1"> - <param name="sequences" type="text" area="True" size="5x25" label="Manually insert sequence" optional="true" help="Insert a list of sequences (one for each row) in this text field representing a query to the AllSome Sequence Bloom Tree Search Engine. It is worth noting that the result could be empty." /> - </when> - </conditional> - <param name="sthreshold" size="3" type="float" value="0.5" min="0.0" max="1.0" label="Threshold applied to the search algorithm" /> - </inputs> - <outputs> - <data name="output" format="json" label="${tool.name} on ${on_string}: AllSome Sequence Bloom Tree Search Result" /> - </outputs> - - <help><![CDATA[ -Authors: Fabio Cumbo, Robert S. Harris, Chen Sun - ]]></help> - - <citations> - <citation type="doi">10.1101/090464</citation> - </citations> -</tool> |