| Previous changeset 4:249c8393f2d4 (2020-02-19) Next changeset 6:397dc333436b (2024-10-04) |
|
Commit message:
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/galaxy_sequence_utils/fastq_paired_end_splitter commit a1525904286610e94e833a648d9b20aebb0967e7" |
|
modified:
fastq_paired_end_splitter.xml |
| b |
| diff -r 249c8393f2d4 -r e39cc71d3ed6 fastq_paired_end_splitter.xml --- a/fastq_paired_end_splitter.xml Wed Feb 19 12:34:16 2020 -0500 +++ b/fastq_paired_end_splitter.xml Wed Mar 09 08:11:31 2022 +0000 |
| b |
| @@ -1,4 +1,4 @@ -<tool id="fastq_paired_end_splitter" name="FASTQ splitter" version="@TOOL_VERSION@"> +<tool id="fastq_paired_end_splitter" name="FASTQ splitter" version="@TOOL_VERSION@+galaxy1"> <description>on joined paired end reads</description> <macros> <import>macros.xml</import> @@ -17,8 +17,8 @@ <param name="input1_file" type="data" format="fastqsanger,fastqcssanger,fastqsanger.gz,fastqcssanger.gz,fastqsanger.bz2,fastqcssanger.bz2" label="FASTQ reads" /> </inputs> <outputs> - <data name="output1_file" format_source="input1_file" /> - <data name="output2_file" format_source="input1_file" /> + <data name="output1_file" format_source="input1_file" label="${tool.name} on ${on_string}: Forward"/> + <data name="output2_file" format_source="input1_file" label="${tool.name} on ${on_string}: Reverse"/> </outputs> <tests> <test> @@ -32,7 +32,7 @@ Splits a single fastq dataset representing paired-end run into two datasets (one for each end). This tool works only for datasets where both ends have **the same** length. -Sequence identifiers will have /1 or /2 appended for the split left-hand and right-hand reads, respectively. +Sequence identifiers will have /1 or /2 appended for the split forward and reverse reads, respectively. ----- @@ -49,14 +49,14 @@ **Outputs** -Left-hand Read:: +Forward Read:: @HWI-EAS91_1_30788AAXX:7:21:1542:1758/1 GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC +HWI-EAS91_1_30788AAXX:7:21:1542:1758/1 hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh -Right-hand Read:: +Reverse Read:: @HWI-EAS91_1_30788AAXX:7:21:1542:1758/2 GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA |