Repository 'hyphy_busted'
hg clone https://toolshed.g2.bx.psu.edu/repos/iuc/hyphy_busted

Changeset 0:edabb77ac0d4 (2019-01-17)
Next changeset 1:b678fe748dc5 (2019-08-21)
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hyphy/ commit 538d41e9789e18c8edb3dc68a1aabbee9b9f8bea
added:
hyphy_busted.xml
macros.xml
test-data/absrel-in1.fa
test-data/absrel-in1.nhx
test-data/absrel-out1.json
test-data/busted-out1.json
test-data/fel-out1.json
test-data/fubar-in1.fa
test-data/fubar-in1.nhx
test-data/fubar-out1.json
test-data/meme-in1.fa
test-data/meme-in1.nhx
test-data/meme-out1.json
test-data/params.json
test-data/slac-out1.json
b
diff -r 000000000000 -r edabb77ac0d4 hyphy_busted.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/hyphy_busted.xml Thu Jan 17 04:25:13 2019 -0500
[
@@ -0,0 +1,44 @@
+<?xml version="1.0"?>
+<tool id="hyphy_busted" name="HyPhy-BUSTED" version="@VERSION@+galaxy0">
+    <description>Branch-site Unrestricted Statistical Test for Episodic Diversification</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements" />
+    <expand macro="version_command" />
+    <command detect_errors="exit_code">
+    <![CDATA[
+    ln -s '$input_file' busted_input.fa &&
+    ln -s '$input_nhx' busted_input.nhx &&
+    echo $gencodeid > tool_params &&
+    echo `pwd`/busted_input.fa >> tool_params &&
+    echo `pwd`/busted_input.nhx >> tool_params &&
+    echo '$branches' >> tool_params &&
+    @HYPHY_INVOCATION@ \$HYPHY_LIB/TemplateBatchFiles/SelectionAnalyses/BUSTED.bf > '$busted_log'
+    ]]>
+    </command>
+    <inputs>
+        <expand macro="inputs" />
+        <expand macro="gencode" />
+        <expand macro="branches" />
+    </inputs>
+    <outputs>
+        <data name="busted_log" format="txt" />
+        <data name="busted_output" format="json" from_work_dir="busted_input.fa.BUSTED.json" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="input_file" ftype="fasta" value="absrel-in1.fa" />
+            <param name="input_nhx" ftype="nhx" value="absrel-in1.nhx" />
+            <output name="busted_output" file="busted-out1.json" compare="sim_size" />
+        </test>
+    </tests>
+    <help>
+        <![CDATA[
+BUSTED will test for gene-wide selection at pre-specified lineages. This method is particularly useful for relatively small datasets (fewer than 10 taxa) where other methods may not have sufficient power to detect selection. This method is not suitable for identifying specific sites subject to positive selection.
+        ]]>
+    </help>
+    <expand macro="citations">
+        <citation type="doi">10.1093/molbev/msv035</citation>
+    </expand>
+</tool>
b
diff -r 000000000000 -r edabb77ac0d4 macros.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml Thu Jan 17 04:25:13 2019 -0500
[
@@ -0,0 +1,57 @@
+<?xml version="1.0"?>
+<macros>
+    <xml name="inputs">
+        <param name="input_file" type="data" format="fasta" label="Input FASTA file" />
+        <param name="input_nhx" type="data" format="nhx" label="Input newick file" />
+    </xml>
+    <xml name="gencode">
+        <param name="gencodeid" type="select" label="Genetic code">
+            <option value="1">Universal code</option>
+            <option value="2">Vertebrate mitochondrial DNA code</option>
+            <option value="3">Yeast mitochondrial DNA code</option>
+            <option value="4">Mold, Protozoan and Coelenterate mt; Mycloplasma/Spiroplasma</option>
+            <option value="5">Invertebrate mitochondrial DNA code</option>
+            <option value="6">Ciliate, Dasycladacean and Hexamita Nuclear code</option>
+            <option value="7">Echinoderm mitochondrial DNA code</option>
+            <option value="8">Euplotid Nuclear code</option>
+            <option value="9">Alternative Yeast Nuclear code</option>
+            <option value="10">Ascidian mitochondrial DNA code</option>
+            <option value="11">Flatworm mitochondrial DNA code</option>
+            <option value="12">Blepharisma Nuclear code</option>
+        </param>
+    </xml>
+    <xml name="branches">
+        <param name="branches" type="select" label="Set of branches to test">
+            <option value="1">All branches</option>
+            <option value="2">Internal branches</option>
+            <option value="3">Leaf branches</option>
+            <option value="4">Unlabeled branches</option>
+        </param>
+    </xml>
+    <xml name="version_command">
+        <version_command>HYPHYMP --version | tail -n 1 | awk '{print $1}'</version_command>
+    </xml>
+    <xml name="citations">
+        <citations>
+            <citation type="doi">10.1093/bioinformatics/bti079</citation>
+            <yield />
+        </citations>
+    </xml>
+    <token name="@VERSION@">2.3.14</token>
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="@VERSION@">hyphy</requirement>
+            <yield />
+        </requirements>
+    </xml>
+    <token name="@HYPHY_INVOCATION@"><![CDATA[export HYPHY=`which HYPHYMP` &&
+export HYPHY_PATH=`dirname \$HYPHY` &&
+export HYPHY_LIB=`readlink -f \$HYPHY_PATH/../lib/hyphy` &&
+cat tool_params | HYPHYMP LIBPATH=\$HYPHY_LIB ]]>
+    </token>
+    <token name="@HYPHYMPI_INVOCATION@"><![CDATA[export HYPHY=`which HYPHYMP` &&
+export HYPHY_PATH=`dirname \$HYPHY` &&
+export HYPHY_LIB=`readlink -f \$HYPHY_PATH/../lib/hyphy` &&
+cat tool_params | mpirun -np \${GALAXY_SLOTS:-1} HYPHYMPI LIBPATH=\$HYPHY_LIB ]]>
+    </token>
+</macros>
\ No newline at end of file
b
diff -r 000000000000 -r edabb77ac0d4 test-data/absrel-in1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/absrel-in1.fa Thu Jan 17 04:25:13 2019 -0500
b
@@ -0,0 +1,20 @@
+>Human
+AAAGAGATTACGAATGCCTTGGAAACCTGGGGTGCCTTGGGTCAGGACATCAACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGACGATATAAAATGGGAAAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAAGAGACTTTCAAGGAAAAAGATACATATAAGCTATTTAAAAATGGAACTCTGAAAATTAAGCAT---CTGAAGACCGATGATCAGGATATCTACAAGGTATCAATATATGATACAAAAGGAAAAAATGTGTTGGAAAAAATATTTGATTTGAAGATTCAAGAGAGGGTCTCAAAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAGGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCAAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGTGTCGAGCCTGTCAGCTGTCCAGAGAAAGGTCTGGAC
+>Chimp
+GAAGAGATTACGAATGCCTTGGAAACCTGGGGTGCCTTGGGTCAGGACATCAACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGACGATATAAAATGGGAAAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAAGAGACTTTCAAGGAAAAAGATACATATAAGCTATTTAAAAATGGAACTCTGAAAATTAAGCAT---CTGAAGACCGATGATCAGGATATCTACAAGGTATCAATATATGATACAAAAGGAAAAAATGTGTTGGAAAAAATATTTGATTTGAAGATTCAAGAGAGGGTCTCAAAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAGGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCAAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGTGTCGAGCCTGTCAGCTGTCCAGAGAAAGGTCTGGAC
+>Baboon
+AAAGAGATTAGGAATGCTTTGGAAACCTGGGGAGCGCTGGGTCAGGACATCGACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGATGATATAAAATGGGAGAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAGGAGACTTTCGAGGAAAAAGATGCATATAAGCTATTTAAAAACGGAACTCTGAAAATTAAGCAT---CTGAAGATCCATGATCAGGATAGCTACAAGGTATCAATATACGATACAAAAGGAAAAAATGTGTTGGAAAAAACATTTGATTTGAAGATTCAAGAGAGGGTCTCAGAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAAGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCGAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGGATGGAGACTGTCAGCTGTCCAGAGAAAGGTCTGGAC
+>RhMonkey
+AAAGAGATTAGGAATGCTTTGGAAACCTGGGGAGCGCTGGGTCAGGACATCGACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGATGATATAAGATGGGAAAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAGGAGACTTTCGAGGAAAAAGATGCATATAAGCTATTTAAAAACGGAACTCTGAAAAYTAAGCAT---CTGAAGATCCATGATCAGGATAGCTACAAGGTATCAATATACGATACAAAAGGAAAAAATGTGTTGGAAAAAACATTTGATTTGAAGATTCAAGAGAGGGTCTCAGAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAAGTAATGAATGGAACTGRCCCCGAATTAAACCTGTATCAAGATGGGAAACATGTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCGAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGGATGGAGACTGTCAGCTGTCCAGAGAAAGGTCTGGAC
+>Cow
+------------GAAAGCATTGTCGTCTGGGGTGCCCTGGATCATGACCTCAACCTGGACATTCCTGGTTTTCCAAGAAGTGATATAGTGGCAGATATAAAATGGAACAGA------AACAAAAACAAGATTGCACGAATAAAGAAAGATATGCCACTTCACAATGAAATGGACAAATATGATATGTTTACAAATGGAACTCTGAAAATTAAAACT---CTGATGAGAAACGATAGTGGTCTCTATGAGGTAGAGGTTTATGATTCAAATGGAGTAAACCTACTGAGCAAAAAATTTGATTTGAAGATTCAAGAGATGCTCTCAGGACCTGAAATTAACTGGATCTGTACCAACAGAACTGTGAGCTGCAAGGTAGAAAATGGAAGTAATCCTAAATTACAACTGTTTTTAAATACGACCCGTGTCAAACAAGATCATGGGAAGCTCATCACCTACACGTGGAACACCAGATGGAATAAAACATTCAAGTGCGTGGCGAGTAACCATGTCGATAGCAAAGTCAGCATAGAGATCGCCGTGTGTCCAGATGAAGGTCTGGAT
+>Pig
+---------------ACTGAGGTTGTCTGGGGCATCGTGGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATATACGATGGCAGAAG------AATGAAAACAAGATCGCAGAATTTAAAAAAAACAAAGAAACTCACCCTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGAT---CTGAAGAGAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGGAGAGAAAATTTGATTTGCCGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCTGTGCCGACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGTATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACACCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCATGGTGACCATCAGTTGTACGGGGCAAGGTCTGGAT
+>Horse
+------------AAGAATATCACCATCTTGGGTGCCCTGGAACGTGATATCAACCTGGACATTCCTGCTTTTCAAATGAGTGAGCATGTAGAAGATATACAATGGAGCAAA------GGAAAAACCAAGATTGCAAAATTCAAAAATGGCAGTATGACTTTCCAGAAAGATAAAACATACGAGGTATTAAAAAATGGAACTCTGAAAATTAAACAT---CTGGAGAGAATTCATGAAGGTACCTACAAGGTAGACGCATATGATAGTGATGGAAAAAATGTGTTGGAGGAAACATTTCATTTGAGCCTTCTAGAGATGGTCTCAAAACCTAATATCTCCTGGAGCTGCACCAACACCACCCTGACCTGCGAGGTGACAAAAGGAACTGACTTTGAGTTAAAACTCTATCTAAATGGGAGAATGATCCAAAAAAGTCCTCGCAAAGTCATCGTATACAAGCGGGCCAGCAACCAAATTGCGTCCTTCAAGTGCACAGCCAATAACACAGTCAGCGAGGAAAGCAGCTCTGTGGTCATCAGGTGTACAGAGAAAGGTCTGGAT
+>Cat
+---------GCAAATGATGATATCGTCTGGGGTACCCTGGGTCAGGACATCAACCTGGACATTCCTGATTCTCAA---GGGATTAATATAGATGATATACACTGGGAAAAA------GGCAAGAAGAAGGTGGCGAGGTTCCAAATTAGCAACAAGCCTAAGAATCCAGATGAAAAATATAATGTGTCAATGAATGGAACTCTGAAAATTAAACAT---CTGATGCTAGAAGACTGCGATACCTACAAGGTTGTTATATACGATAAGGATGGAAAGAATGTGTTGGATAAAACATTTCAGCTGAAGATTCAAGAGAAGGTCTCAACGCCTAACATCGACTGGAATTGTATCAACAAAACCCTGGTCTGTAAGGTATCAAATGGAACAGACCCTGAATTAAAACTGTACGTAAATGGGACCAGTATCAAGCCCGTTTCTTCGAAGTTCAGCACATACAGGTTTATAAACAAGCAGAAGATATTAGTCAACTGCACGGCAGAAAACAAAGTCAGCAAGGAAAGCGACGTGAAGATGATCACTTGTTCAGAGAAGGGTCTGGAC
+>Mouse
+---------AGAGACAATGAGACCATCTGGGGTGTCTTGGGTCATGGCATCACCCTGAACATCCCCAACTTTCAAATGACTGATGATATTGATGAGGTGCGATGGGTAAGG------AGGGGCACCCTGGTCGCAGAGTTTAAAAGGAAGAAGCCACCTTTTTTGATATCAGAAACGTATGAGGTCTTAGCAAACGGATCCCTGAAGATAAAGAAGCCGATGATGAGAAACGACAGTGGCACCTATAATGTAATGGTGTATGGCACAAATGGGATGACTAGGCTGGAGAAGGACCTGGACGTGAGGATTCTGGAGAGGGTCTCAAAGCCCATGATCCACTGGGAATGCCCCAACACAACCCTGACCTGTGCGGTCTTGCAAGGGACAGATTTTGAACTGAAGCTGTATCAAGGGGAAACACTACTCAATAGTCTCCCCCAGAAGAACATGAGTTACCAGTGG---ACCAACCTGAACGCACCATTCAAGTGTGAGGCGATAAACCCGGTCAGCAAGGAGTCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCC
+>Rat
+---------AGAGACAGTGGGACCGTCTGGGGTGCCCTGGGTCATGGCATCAACCTGAACATCCCTAACTTTCAAATGACTGATGATATTGATGAGGTGCGATGGGAGAGG------GGGAGCACCCTGGTTGCCGAGTTTAAAAGGAAGATGAAGCCTTTTTTGAAATCGGGAGCATTTGAGATCTTAGCAAATGGAGACTTGAAGATAAAGAAT---CTGACAAGAGATGACAGTGGCACCTATAATGTAACGGTATACAGCACAAATGGGACACGTATCCTGGACAAGGCACTGGACTTGAGGATTCTAGAGATGGTCTCAAAGCCGATGATCTACTGGGAGTGCAGCAACGCAACCCTGACCTGTGAGGTCTTGGAAGGAACAGATGTTGAACTAAAGCTGTACCAAGGAAAGGAGCATCTCAGGAGCCTCCGTCAGAAGACCATGAGTTACCAGTGG---ACCAACCTGAGAGCACCGTTTAAGTGCAAGGCGGTAAACAGGGTCAGCCAGGAGTCTGAGATGGAAGTTGTCAACTGTCCAGAGAAAGGTCTGCCC
b
diff -r 000000000000 -r edabb77ac0d4 test-data/absrel-in1.nhx
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/absrel-in1.nhx Thu Jan 17 04:25:13 2019 -0500
b
@@ -0,0 +1,1 @@
+((((Pig:0.147969,Cow:0.213430):0.085099,Horse:0.165787,Cat:0.264806):0.058611,((RhMonkey:0.002015,Baboon:0.003108):0.022733,(Human:0.004349,Chimp:0.000799):0.011873):0.101856):0.340802,Rat:0.050958,Mouse:0.097950);
\ No newline at end of file
b
diff -r 000000000000 -r edabb77ac0d4 test-data/absrel-out1.json
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/absrel-out1.json Thu Jan 17 04:25:13 2019 -0500
[
b'@@ -0,0 +1,456 @@\n+{\n+ "analysis":{\n+   "info":"aBSREL (Adaptive branch-site random effects likelihood)\\n                            uses an adaptive random effects branch-site model framework\\n                            to test whether each branch has evolved under positive selection,\\n                            using a procedure which infers an optimal number of rate categories per branch.",\n+   "version":"2.0",\n+   "citation":"Less Is More: An Adaptive Branch-Site Random Effects Model for Efficient Detection of Episodic Diversifying Selection (2015). Mol Biol Evol 32 (5): 1342-1353",\n+   "authors":"Sergei L Kosakovsky Pond, Ben Murrell, Steven Weaver and Temple iGEM / UCSD viral evolution group",\n+   "contact":"spond@temple.edu",\n+   "requirements":"in-frame codon alignment and a phylogenetic tree"\n+  },\n+ "input":{\n+   "file name":"/tmp/tmpCAMqUO/job_working_directory/002/2602/working/absrel_input.fa",\n+   "number of sequences":10,\n+   "number of sites":187,\n+   "partition count":1,\n+   "trees":{\n+     "0":"((((Pig:0.147969,Cow:0.21343)Node3:0.085099,Horse:0.165787,Cat:0.264806)Node2:0.058611,((RhMonkey:0.002015,Baboon:0.003108)Node9:0.022733,(Human:0.004349,Chimp:0.000799)Node12:0.011873)Node8:0.101856)Node1:0.340802,Rat:0.050958,Mouse:0.09795)"\n+    }\n+  },\n+ "fits":{\n+   "Nucleotide GTR":{\n+     "Log Likelihood":-3531.96369518556,\n+     "estimated parameters":24,\n+     "AIC-c":7112.577796875186,\n+     "Equilibrium frequencies":[\n+      [0.3563279857397504],\n+      [0.1837789661319073],\n+      [0.2402852049910873],\n+      [0.2196078431372549]\n+      ],\n+     "Rate Distributions":{\n+       "Substitution rate from nucleotide A to nucleotide C":0.5474707834424497,\n+       "Substitution rate from nucleotide A to nucleotide G":1,\n+       "Substitution rate from nucleotide A to nucleotide T":0.2645731370379643,\n+       "Substitution rate from nucleotide C to nucleotide G":0.4867482826410435,\n+       "Substitution rate from nucleotide C to nucleotide T":1.018295973581558,\n+       "Substitution rate from nucleotide G to nucleotide T":0.3026112531229544\n+      },\n+     "display order":0\n+    },\n+   "Baseline MG94xREV":{\n+     "Log Likelihood":-3450.669934819203,\n+     "estimated parameters":46,\n+     "AIC-c":6995.711784065174,\n+     "Equilibrium frequencies":[\n+      [0.04787662253946073],\n+      [0.03913388100305117],\n+      [0.04844580322128512],\n+      [0.0407178971288476],\n+      [0.01817959331488358],\n+      [0.01485982100934833],\n+      [0.01839572120297191],\n+      [0.01546129971531724],\n+      [0.0190238172858878],\n+      [0.01554988139098808],\n+      [0.01924998172104109],\n+      [0.01617929156565557],\n+      [0.02798385246472159],\n+      [0.02287372613761008],\n+      [0.02831653817605838],\n+      [0.02379958245776909],\n+      [0.01680670574479072],\n+      [0.01373763619452979],\n+      [0.01700651207463693],\n+      [0.01429369239710176],\n+      [0.006381800954137531],\n+      [0.005216421415661322],\n+      [0.006457670922102578],\n+      [0.00542756570877943],\n+      [0.006678159032689796],\n+      [0.005458661598138652],\n+      [0.00675755225029668],\n+      [0.00567961101013393],\n+      [0.009823507779659469],\n+      [0.008029638769211124],\n+      [0.009940294440024354],\n+      [0.008354653231583485],\n+      [0.0329096029621651],\n+      [0.02689998621179963],\n+      [0.03330084840219455],\n+      [0.02798881284619018],\n+      [0.01249635346589736],\n+      [0.01021439657952951],\n+      [0.01264491622176376],\n+      [0.01062784315018763],\n+      [0.01307665913959002],\n+      [0.01068873273724336],\n+      [0.0132321208528494],\n+      [0.01112137894012831],\n+      [0.01923563996618058],\n+      [0.01572302316926395],\n+      [0.01946432265285621],\n+      [0.01635944157725275],\n+      [0.01977100255021048],\n+      [0.02057127040149398],\n+      [0.009184593415672956],\n+      [0.007507396443725858],\n+      [0.009293784349897772],\n+      [0.007811272183233558],\n+      [0.007856024926654371],\n+      [0.009725369116048951],\n+      ['..b'1\n+      },\n+     "Node1":{\n+       "Nucleotide GTR":0.2772613398768408,\n+       "Baseline MG94xREV":0.2903229694372956,\n+       "Baseline MG94xREV omega ratio":0.4389914526526448,\n+       "Rate classes":2,\n+       "Full adaptive model":0.3664538683295676,\n+       "Rate Distributions":[\n+        [0.1934444279004118, 0.7920338324503209],\n+        [2.595458156723663, 0.2079661675496791]\n+        ],\n+       "LRT":1.095302853601424,\n+       "Uncorrected P-value":0.232551772988317,\n+       "Corrected P-value":1\n+      },\n+     "Node12":{\n+       "Nucleotide GTR":0.01783922546179193,\n+       "Baseline MG94xREV":0.01797212760838867,\n+       "Baseline MG94xREV omega ratio":0.3712490894908597,\n+       "Rate classes":1,\n+       "Full adaptive model":0.01648897148329989,\n+       "Rate Distributions":[\n+        [0.3341484726344874, 1]\n+        ],\n+       "LRT":0,\n+       "Uncorrected P-value":1,\n+       "Corrected P-value":1\n+      },\n+     "Node2":{\n+       "Nucleotide GTR":0.06619058539001231,\n+       "Baseline MG94xREV":0.06580724801157116,\n+       "Baseline MG94xREV omega ratio":0.6811307469311604,\n+       "Rate classes":2,\n+       "Full adaptive model":0.1259563484776556,\n+       "Rate Distributions":[\n+        [0, 0.902872882268449],\n+        [33.80023214939837, 0.09712711773155103]\n+        ],\n+       "LRT":7.670975764417562,\n+       "Uncorrected P-value":0.007599562698001494,\n+       "Corrected P-value":0.09119475237601793\n+      },\n+     "Node3":{\n+       "Nucleotide GTR":0.09883236156840018,\n+       "Baseline MG94xREV":0.102749851157051,\n+       "Baseline MG94xREV omega ratio":1.47449378631578,\n+       "Rate classes":2,\n+       "Full adaptive model":0.1389308407753113,\n+       "Rate Distributions":[\n+        [0, 0.7024206790833775],\n+        [8.065310624699681, 0.2975793209166225]\n+        ],\n+       "LRT":6.598417720076213,\n+       "Uncorrected P-value":0.0131150962965953,\n+       "Corrected P-value":0.1442660592625483\n+      },\n+     "Node8":{\n+       "Nucleotide GTR":0.1061134663636472,\n+       "Baseline MG94xREV":0.110140333084973,\n+       "Baseline MG94xREV omega ratio":1.896243438714738,\n+       "Rate classes":2,\n+       "Full adaptive model":0.2165540926910564,\n+       "Rate Distributions":[\n+        [1, 0.9077840705139004],\n+        [33.32075865076668, 0.09221592948609958]\n+        ],\n+       "LRT":7.97288393366216,\n+       "Uncorrected P-value":0.006519360772582139,\n+       "Corrected P-value":0.08475169004356781\n+      },\n+     "Node9":{\n+       "Nucleotide GTR":0.02566719422260768,\n+       "Baseline MG94xREV":0.02590165433349057,\n+       "Baseline MG94xREV omega ratio":0.4071738826525522,\n+       "Rate classes":1,\n+       "Full adaptive model":0.02766629863085238,\n+       "Rate Distributions":[\n+        [0.4488424899910019, 1]\n+        ],\n+       "LRT":0,\n+       "Uncorrected P-value":1,\n+       "Corrected P-value":1\n+      }\n+    },\n+   "attributes":{\n+     "original name":{\n+       "attribute type":"node label",\n+       "display order":-1\n+      },\n+     "Nucleotide GTR":{\n+       "attribute type":"branch length",\n+       "display order":0\n+      },\n+     "Baseline MG94xREV":{\n+       "attribute type":"branch length",\n+       "display order":1\n+      },\n+     "Baseline MG94xREV omega ratio":{\n+       "attribute type":"branch label",\n+       "display order":1\n+      },\n+     "Rate classes":{\n+       "attribute type":"branch label",\n+       "display order":2\n+      },\n+     "Full adaptive model":{\n+       "attribute type":"branch length",\n+       "display order":2\n+      },\n+     "Rate Distributions":{\n+       "attribute type":"branch label",\n+       "display order":3\n+      },\n+     "LRT":{\n+       "attribute type":"branch label",\n+       "display order":4\n+      },\n+     "Uncorrected P-value":{\n+       "attribute type":"branch label",\n+       "display order":5\n+      },\n+     "Corrected P-value":{\n+       "attribute type":"branch label",\n+       "display order":6\n+      }\n+    }\n+  }\n+}\n\\ No newline at end of file\n'
b
diff -r 000000000000 -r edabb77ac0d4 test-data/busted-out1.json
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/busted-out1.json Thu Jan 17 04:25:13 2019 -0500
[
b'@@ -0,0 +1,361 @@\n+{\n+ "analysis":{\n+   "info":"BUSTED (branch-site unrestricted statistical test of episodic diversification) uses a random effects branch-site model fitted jointly to all or a subset of tree branches in order to test for alignment-wide evidence of episodic diversifying selection. Assuming there is evidence of positive selection (i.e. there is an omega > 1), BUSTED will also perform a quick evidence-ratio style analysis to explore which individual sites may have been subject to selection.",\n+   "version":"1.2",\n+   "citation":"*Gene-wide identification of episodic selection*, Mol Biol Evol. 32(5):1365-71",\n+   "authors":"Sergei L Kosakovsky Pond",\n+   "contact":"spond@temple.edu",\n+   "requirements":"in-frame codon alignment and a phylogenetic tree (optionally annotated with {})"\n+  },\n+ "input":{\n+   "file name":"/Users/stephenshank/Documents/Galaxy/tools-iuc/tools/hyphy/test-data/absrel-in1.fa",\n+   "number of sequences":10,\n+   "number of sites":187,\n+   "partition count":1,\n+   "trees":{\n+     "0":"((((Pig:0.147969,Cow:0.21343)Node3:0.085099,Horse:0.165787,Cat:0.264806)Node2:0.058611,((RhMonkey:0.002015,Baboon:0.003108)Node9:0.022733,(Human:0.004349,Chimp:0.000799)Node12:0.011873)Node8:0.101856)Node1:0.340802,Rat:0.050958,Mouse:0.09795)"\n+    }\n+  },\n+ "background":0,\n+ "fits":{\n+   "Nucleotide GTR":{\n+     "Log Likelihood":-3531.963798530155,\n+     "estimated parameters":24,\n+     "AIC-c":7112.142458295762,\n+     "Equilibrium frequencies":[\n+      [0.3563279857397504],\n+      [0.1837789661319073],\n+      [0.2402852049910873],\n+      [0.2196078431372549]\n+      ],\n+     "Rate Distributions":{\n+       "Substitution rate from nucleotide A to nucleotide C":0.5474490057204714,\n+       "Substitution rate from nucleotide A to nucleotide G":1,\n+       "Substitution rate from nucleotide A to nucleotide T":0.2645352969683238,\n+       "Substitution rate from nucleotide C to nucleotide G":0.4863078374555331,\n+       "Substitution rate from nucleotide C to nucleotide T":1.018028772244997,\n+       "Substitution rate from nucleotide G to nucleotide T":0.3025951149895378\n+      },\n+     "display order":0\n+    },\n+   "MG94xREV with separate rates for branch sets":{\n+     "Log Likelihood":-3466.725508616141,\n+     "estimated parameters":31,\n+     "AIC-c":6996.530451399855,\n+     "Equilibrium frequencies":[\n+      [0.04785168648208005],\n+      [0.03911346079312019],\n+      [0.04842054060317301],\n+      [0.04069665666515385],\n+      [0.01817010744778396],\n+      [0.01485205303123071],\n+      [0.01838611113045968],\n+      [0.01545321970309948],\n+      [0.0190138898893362],\n+      [0.01554175184587827],\n+      [0.01923992433904378],\n+      [0.01617083546230154],\n+      [0.02796925133965702],\n+      [0.02286176927319543],\n+      [0.02830174586718859],\n+      [0.02378714529482007],\n+      [0.01687870337957799],\n+      [0.01379647304851128],\n+      [0.01707935503225849],\n+      [0.01435491300079667],\n+      [0.006409133648843443],\n+      [0.005238757839512795],\n+      [0.006485324528555602],\n+      [0.005450807083377185],\n+      [0.006706760641638982],\n+      [0.005482034985409045],\n+      [0.006786489669196017],\n+      [0.005703931360295163],\n+      [0.009865581170012171],\n+      [0.008064021368173151],\n+      [0.009982861811889655],\n+      [0.008390428826966174],\n+      [0.03287895020631181],\n+      [0.02687490503171972],\n+      [0.033269810543681],\n+      [0.0279627207822247],\n+      [0.01248470225271473],\n+      [0.01020486315060615],\n+      [0.01263311863778268],\n+      [0.01061792547971484],\n+      [0.01306446616325414],\n+      [0.01067875601941112],\n+      [0.01321977470017749],\n+      [0.01111100011404158],\n+      [0.01921770557551369],\n+      [0.01570834862514353],\n+      [0.01944616295744266],\n+      [0.01634417558076203],\n+      [0.01975257768318274],\n+      [0.02055210293142003],\n+      [0.009176034326710849],\n+      [0.007500393094996483],\n+      [0.00928511773266342],\n+      [0.007803986567571961],\n+      [0.007848'..b'1561323465,\n+       "constrained":0.001757260248005238\n+      },\n+     "RhMonkey":{\n+       "original name":"RhMonkey",\n+       "Nucleotide GTR":0.003773669075849421,\n+       "MG94xREV with separate rates for branch sets":0.003717699096857038,\n+       "unconstrained":0.003672835047422234,\n+       "constrained":0.00373144096412681\n+      },\n+     "Cow":{\n+       "original name":"Cow",\n+       "Nucleotide GTR":0.2483322373763571,\n+       "MG94xREV with separate rates for branch sets":0.2480141631033857,\n+       "unconstrained":0.2960120156157274,\n+       "constrained":0.2592686681333873\n+      },\n+     "Pig":{\n+       "original name":"Pig",\n+       "Nucleotide GTR":0.187244836750842,\n+       "MG94xREV with separate rates for branch sets":0.1926081878751187,\n+       "unconstrained":0.2187526946336905,\n+       "constrained":0.1943776301130502\n+      },\n+     "Horse":{\n+       "original name":"Horse",\n+       "Nucleotide GTR":0.2091766851769093,\n+       "MG94xREV with separate rates for branch sets":0.2111575880588217,\n+       "unconstrained":0.2572135566477119,\n+       "constrained":0.218486450878766\n+      },\n+     "Cat":{\n+       "original name":"Cat",\n+       "Nucleotide GTR":0.266381043956941,\n+       "MG94xREV with separate rates for branch sets":0.273601177885004,\n+       "unconstrained":0.3292215104251173,\n+       "constrained":0.28483085314287\n+      },\n+     "Mouse":{\n+       "original name":"Mouse",\n+       "Nucleotide GTR":0.1181831744338598,\n+       "MG94xREV with separate rates for branch sets":0.1201847378516324,\n+       "unconstrained":0.1489713993010398,\n+       "constrained":0.1233480139851019\n+      },\n+     "Rat":{\n+       "original name":"Rat",\n+       "Nucleotide GTR":0.06669700444436912,\n+       "MG94xREV with separate rates for branch sets":0.0670850471739789,\n+       "unconstrained":0.07366345007817726,\n+       "constrained":0.06713082546371778\n+      },\n+     "Node1":{\n+       "Nucleotide GTR":0.276880831396131,\n+       "MG94xREV with separate rates for branch sets":0.2843521449765504,\n+       "unconstrained":0.459085769955035,\n+       "constrained":0.3115534692518958\n+      },\n+     "Node12":{\n+       "Nucleotide GTR":0.01783434870161725,\n+       "MG94xREV with separate rates for branch sets":0.01788794906051452,\n+       "unconstrained":0.01828498503175797,\n+       "constrained":0.01770410398930177\n+      },\n+     "Node2":{\n+       "Nucleotide GTR":0.06617535490721377,\n+       "MG94xREV with separate rates for branch sets":0.06447679597474805,\n+       "unconstrained":0.0623969317369398,\n+       "constrained":0.06097949807503514\n+      },\n+     "Node3":{\n+       "Nucleotide GTR":0.09884524766349881,\n+       "MG94xREV with separate rates for branch sets":0.1017497956116402,\n+       "unconstrained":0.1285021744856729,\n+       "constrained":0.1065011238088613\n+      },\n+     "Node8":{\n+       "Nucleotide GTR":0.1061610073141143,\n+       "MG94xREV with separate rates for branch sets":0.1093806684969149,\n+       "unconstrained":0.1348034716617685,\n+       "constrained":0.1118205234697939\n+      },\n+     "Node9":{\n+       "Nucleotide GTR":0.02568007351415409,\n+       "MG94xREV with separate rates for branch sets":0.02593963430985144,\n+       "unconstrained":0.02761127562964508,\n+       "constrained":0.02639493109700932\n+      }\n+    },\n+   "attributes":{\n+     "original name":{\n+       "attribute type":"node label",\n+       "display order":0\n+      },\n+     "Nucleotide GTR":{\n+       "attribute type":"branch length",\n+       "display order":0\n+      },\n+     "MG94xREV with separate rates for branch sets":{\n+       "attribute type":"branch length",\n+       "display order":1\n+      },\n+     "unconstrained":{\n+       "attribute type":"branch length",\n+       "display order":0\n+      },\n+     "constrained":{\n+       "attribute type":"branch length",\n+       "display order":1\n+      }\n+    }\n+  },\n+ "test results":{\n+   "LRT":44.77492170961614,\n+   "p-value":1.893429857346973e-10\n+  }\n+}\n\\ No newline at end of file\n'
b
diff -r 000000000000 -r edabb77ac0d4 test-data/fel-out1.json
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fel-out1.json Thu Jan 17 04:25:13 2019 -0500
[
b'@@ -0,0 +1,450 @@\n+{\n+ "analysis":{\n+   "info":"FEL (Fixed Effects Likelihood)\\n    estimates site-wise synonymous (&alpha;) and non-synonymous (&beta;) rates, and\\n    uses a likelihood ratio test to determine if beta &neq; alpha at a site.\\n    The estimates aggregate information over all branches,\\n    so the signal is derived from\\n    pervasive diversification or conservation. A subset of branches can be selected\\n    for testing as well, in which case an additional (nuisance) parameter will be\\n    inferred -- the non-synonymous rate on branches NOT selected for testing.\\n    Multiple partitions within a NEXUS file are also supported\\n    for recombination - aware analysis.\\n    ",\n+   "version":"2.00",\n+   "citation":"Not So Different After All: A Comparison of Methods for Detecting Amino Acid Sites Under Selection (2005). _Mol Biol Evol_ 22 (5): 1208-1222",\n+   "authors":"Sergei L Kosakovsky Pond and Simon DW Frost",\n+   "contact":"spond@temple.edu",\n+   "requirements":"in-frame codon alignment and a phylogenetic tree"\n+  },\n+ "input":{\n+   "file name":"/Users/stephenshank/Documents/Data/Datamonkey/CD2.fasta",\n+   "number of sequences":10,\n+   "number of sites":187,\n+   "partition count":1,\n+   "trees":{\n+     "0":"((((Pig:0.147969,Cow:0.21343)Node3:0.085099,Horse:0.165787,Cat:0.264806)Node2:0.058611,((RhMonkey:0.002015,Baboon:0.003108)Node9:0.022733,(Human:0.004349,Chimp:0.000799)Node12:0.011873)Node8:0.101856)Node1:0.340802,Rat:0.050958,Mouse:0.09795)"\n+    }\n+  },\n+ "fits":{\n+   "Nucleotide GTR":{\n+     "Log Likelihood":-3531.963798530155,\n+     "estimated parameters":24,\n+     "AIC-c":7112.142458295762,\n+     "Equilibrium frequencies":[\n+      [0.3563279857397504],\n+      [0.1837789661319073],\n+      [0.2402852049910873],\n+      [0.2196078431372549]\n+      ],\n+     "Rate Distributions":{\n+       "Substitution rate from nucleotide A to nucleotide C":0.5474490057204714,\n+       "Substitution rate from nucleotide A to nucleotide G":1,\n+       "Substitution rate from nucleotide A to nucleotide T":0.2645352969683238,\n+       "Substitution rate from nucleotide C to nucleotide G":0.4863078374555331,\n+       "Substitution rate from nucleotide C to nucleotide T":1.018028772244997,\n+       "Substitution rate from nucleotide G to nucleotide T":0.3025951149895378\n+      },\n+     "display order":0\n+    },\n+   "Global MG94xREV":{\n+     "Log Likelihood":-3466.725508616141,\n+     "estimated parameters":31,\n+     "AIC-c":6996.530451399855,\n+     "Equilibrium frequencies":[\n+      [0.04785168648208005],\n+      [0.03911346079312019],\n+      [0.04842054060317301],\n+      [0.04069665666515385],\n+      [0.01817010744778396],\n+      [0.01485205303123071],\n+      [0.01838611113045968],\n+      [0.01545321970309948],\n+      [0.0190138898893362],\n+      [0.01554175184587827],\n+      [0.01923992433904378],\n+      [0.01617083546230154],\n+      [0.02796925133965702],\n+      [0.02286176927319543],\n+      [0.02830174586718859],\n+      [0.02378714529482007],\n+      [0.01687870337957799],\n+      [0.01379647304851128],\n+      [0.01707935503225849],\n+      [0.01435491300079667],\n+      [0.006409133648843443],\n+      [0.005238757839512795],\n+      [0.006485324528555602],\n+      [0.005450807083377185],\n+      [0.006706760641638982],\n+      [0.005482034985409045],\n+      [0.006786489669196017],\n+      [0.005703931360295163],\n+      [0.009865581170012171],\n+      [0.008064021368173151],\n+      [0.009982861811889655],\n+      [0.008390428826966174],\n+      [0.03287895020631181],\n+      [0.02687490503171972],\n+      [0.033269810543681],\n+      [0.0279627207822247],\n+      [0.01248470225271473],\n+      [0.01020486315060615],\n+      [0.01263311863778268],\n+      [0.01061792547971484],\n+      [0.01306446616325414],\n+      [0.01067875601941112],\n+      [0.01321977470017749],\n+      [0.01111100011404158],\n+      [0.01921770557551369],\n+      [0.01570834862514353],\n+      [0.01944616295744266],\n+      [0.01634417558076203],\n+      [0.01975257768318274],\n+      ['..b'871235417342727, 1.658943187728135],\n+      [0, 1.009408180447169, 0.7201317416266795, 1.906505699392216, 0.1673519284290025, 1.293896776352589],\n+      [1.701545575395463e-14, 1.16201561388296, 1.114130105107937, 0.2442491813364853, 0.6211538364843379, 1.489514634415266],\n+      [0.8883515458297054, 1.623622648529189, 1.334319744829745, 0.1803627821799836, 0.6710616565201941, 2.477143670911062],\n+      [0, 0.5570419450087813, 0.3610157342941877, 1.689213063741757, 0.193704737236408, 0.7140369881099469],\n+      [2.804120856177222e-15, 1.378683497609396, 1.139416739891161, 1.532228496397977, 0.215778295124767, 1.767247549328411],\n+      [0.630106498235145, 1.530183136222741, 1.176306017317766, 0.5627230344194487, 0.4531651666494674, 2.242273764894695],\n+      [4.996412325715582, 2.072849087019975, 2.501919619833955, 0.4374688424558926, 0.5083466741660978, 4.883875616363817],\n+      [1.476720795366284, 1.192713829097381, 1.265398043718104, 0.04756528081958322, 0.827355357807033, 2.187015539850353],\n+      [1.778599502537943, 2.833030015698272, 2.535624910277768, 0.2150914997093523, 0.642805674139892, 4.424176058896644],\n+      [1.502754420888704, 0.2825342556426603, 0.4733601919284142, 1.180637234982843, 0.2772263054246996, 1.031916435368656],\n+      [0, 0.2915937523113351, 0.2283654592452333, 0.4790160930559324, 0.4888683243803773, 0.3737756671964466],\n+      [10.08767614696688, 0, 0.4133910037948654, 8.462162631979279, 0.003626104567950983, 4.495915621518065],\n+      [1.984506219150062, 1.662771746660892, 1.756718773063347, 0.03121207319557584, 0.8597680862487451, 3.015865008244778],\n+      [3.805655301370652, 0, 0.7005303037771143, 11.62838958327228, 0.0006495276635800629, 1.696119588919385],\n+      [3.173406516538895, 2.860065663238961, 2.926441853316894, 0.003891888657044262, 0.9502562372040178, 5.080474489659786],\n+      [0, 0, 0, 0, 1, 0],\n+      [2.194271257132928, 4.019627316522699, 3.237226152191341, 0.09176983643381931, 0.7619391181878015, 6.130458650322728],\n+      [0, 0.2994174888128062, 0.1834705090468997, 0.9675444779876443, 0.3252933434590788, 0.3838044222970849],\n+      [1.737488918246139, 0.4263169813102716, 0.5705211950188817, 0.9504457433159637, 0.3296058631975952, 1.320839860569391],\n+      [9.491047642026737e-16, 2.201411562959478, 1.602398780540194, 2.916382754860905, 0.08768422447478674, 2.82185084281439],\n+      [1.033236674389839, 0.5673779129005597, 0.6682462878144323, 0.1916420169326862, 0.6615534805841186, 1.187783044398971],\n+      [0.6633763440867723, 2.065196310532788, 1.40713862608088, 0.9931353495817845, 0.318977273245592, 2.942901296371888],\n+      [3.88753619664278e-15, 1.779262169776622, 1.549159808629328, 1.288480285336618, 0.2563282037478503, 2.280724121673174],\n+      [137.6200023666397, 1.712312972734741, 2.612335663828599, 4.571254357285468, 0.03251275075427451, 63.52993609974021],\n+      [0.9069803858948896, 1.008331374883533, 0.9795641413367016, 0.006632998551161506, 0.9350894763840309, 1.696743112350582],\n+      [1.250218074119796, 2.685270528336648, 2.279331033581541, 0.4656302199387952, 0.4950043706394306, 3.99928134132692],\n+      [0.5981237480607854, 1.191515517605649, 0.9684057167421628, 0.3651500230254783, 0.5456598635374844, 1.793902873797072],\n+      [5.567356236371868, 1.655977785625157, 2.134648959148231, 0.8514639837247273, 0.3561385136046764, 4.60397510129604],\n+      [0, 0, 0, 0, 1, 0],\n+      [0.5915176036957202, 0.7772525687759813, 0.7215979531128016, 0.05398776775817282, 0.8162640993312603, 1.259941036310695],\n+      [0, 0.543676760549953, 0.4362855008937696, 0.8539326132569869, 0.3554421959431151, 0.6969049998601837],\n+      [1.00226665989553, 0.6268338660673796, 0.7169253651929272, 0.1172739583266811, 0.7320101172431673, 1.250193047146509],\n+      [0, 0, 0, 0, 1, 0],\n+      [0, 0, 0, 0, 1, 0],\n+      [2.797676857161142, 0.824684447244541, 1.167394064072366, 1.285234262338761, 0.2569280765461694, 2.303990803636788]\n+      ]\n+    }\n+  }\n+}\n\\ No newline at end of file\n'
b
diff -r 000000000000 -r edabb77ac0d4 test-data/fubar-in1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fubar-in1.fa Thu Jan 17 04:25:13 2019 -0500
b
b'@@ -0,0 +1,326 @@\n+>KF789585\n+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCCCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGACACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAATTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT\n+>CY025485\n+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCATCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAGTGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGGAATCTGCAACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAATTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAGAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCAGCCTATATGCTCAAGCACCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCCGAGTAAGGGATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGACAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGCTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGACCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGACCTAACTGACTCAGAAATGAACAAATTGTTTGAAAGAACAAAAAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT\n+>KC535396\n+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAATAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGA'..b'GAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT\n+>CY012232\n+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCCCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAGAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTACCAACGAAAACTTCAATTGGACTGGAGTCGCTCAGGATGGGAAAAGCTATGCTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTCCGAGCATCAGGGAAAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGGATATCGGGTATAGACCATGGGTAAGGGGTCTTTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAGAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAGAATTCTGAGGGCACAGGACAAGCTGCAGATCTTAAAAGCACTCAAGCAGCAATCGACCAAATCAACGGGAAACTGAATAGGTTAGTCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAATGCGGAGCTTCTTGTTGCTCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTATTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTTGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT\n+>EU199367\n+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAGTCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACCAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGCGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT\n'
b
diff -r 000000000000 -r edabb77ac0d4 test-data/fubar-in1.nhx
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fubar-in1.nhx Thu Jan 17 04:25:13 2019 -0500
b
@@ -0,0 +1,1 @@
+((KF790010:0.001247,CY147300:0.000623):0.0,((CY168239:0.001872,(CY171039:0.001874,KF790389:0.000623):0.000624):0.0,((CY141224:0.001247,(CY147305:0.0,KF790037:0.000623):0.000623):0.0,(((KF790403:0.000623,KF761507:0.001876):0.0,KC526205:0.000623):0.0,((CY169303:0.0,(KF789585:0.000623,CY141202:0.000623):0.000623):0.000623,(((KJ667974:0.002501,KJ938675:0.001873):0.000623,CY134876:0.0):0.000623,((KF790414:0.001248,(KF790384:0.001245,KF790408:0.00125):0.0):0.0,((KF886352:0.001882,(KF790438:0.000623,CY134996:0.001873):0.000623):0.001875,(KF789591:0.001879,((KF790049:0.001255,(CY134956:0.000624,CY183153:0.000624):0.000626):0.001249,((CY168407:0.004394,CY183065:0.003128):0.0,(KF598733:0.002501,((KC892174:0.0,(KF685747:0.000624,CY168471:0.000625):0.00375):0.000624,(((KC892685:0.000624,KC892641:0.0):0.001874,KC893110:0.001249):0.0,(KC892480:0.0,(JX913043:0.001249,(KF551075:0.00125,((CY114509:0.0,(KC892889:0.0,KC893018:0.002498):0.005006):0.001877,(((KC892519:0.0,KC892498:0.000624):0.002497,KC892266:0.000623):0.001026,((KC892156:0.003756,(JX978746:0.001256,KC892407:0.001883):0.001875):0.00355,((KC535402:0.000623,(KC882488:0.002498,KC535387:0.001247):0.001872):0.0,(KC535363:0.000623,((KC535396:0.000623,(KC882883:0.0,KC882867:0.000623):0.003124):0.0,((KC535378:0.001872,KC535375:0.002498):0.0,(GQ385891:0.001248,((EU779522:0.001251,(CY037727:0.0,FJ179354:0.003124):0.0):0.000623,((GQ385889:0.005007,(FJ686933:0.001243,FJ179356:0.003117):0.0):0.000622,(CY173095:0.001245,(((CY173191:0.0,CY037703:0.001247):0.000622,CY035062:0.00249):0.0,((CY173255:0.001871,(CY044748:0.0,GQ385846:0.001247):0.000623):0.0,((CY027075:0.000623,(EU199367:0.0,CY172823:0.000623):0.0):0.000623,(((CY172847:0.000623,CY025643:0.0):0.000623,CY172839:0.000623):0.001247,(((CY026251:0.002497,CY092241:0.00125):0.000624,CY026019:0.000623):0.0,((CY025341:0.002502,(CY172775:0.001247,CY172903:0.000623):0.001248):0.000622,(EU199255:0.003134,(CY172431:0.000621,((CY172223:0.003127,(CY172191:0.001254,CY020069:0.000628):0.000621):0.0,((CY092217:0.003119,(CY025485:0.001283,EU516019:0.00059):0.008843):0.001868,(CY002080:0.000622,((CY002064:0.001873,(CY002456:0.000626,CY002048:0.002491):0.001243):0.003763,(AB434109:0.006307,(((CY088198:0.001245,CY088475:0.000621):0.0,CY000257:0.000621):0.002494,((CY112957:0.003135,CY006859:0.001253):0.000616,((CY000721:0.001243,(CY114493:0.0,CY090885:0.002483):0.002488):0.0,((CY001792:0.000621,(CY001600:0.00062,CY002368:0.001865):0.0):0.0,((CY002304:0.002489,(CY006163:0.001242,CY003632:0.00062):0.0):0.00062,(CY001920:0.003739,(CY001912:0.002498,((CY001504:0.0,CY006060:0.001241):0.00062,((CY001744:0.0,CY002136:0.00124):0.00062,((CY114309:0.003746,(CY006899:0.001874,CY112901:0.001863):0.002496):0.000618,(((CY006579:0.001245,CY006283:0.000621):0.001244,CY007979:0.001864):0.0,((CY006499:0.001241,(CY006491:0.001863,CY006635:0.00124):0.0):0.00062,(((CY036847:0.002495,CY010004:0.001867):0.000621,CY012200:0.000621):0.0,(((CY010028:0.001242,CY009732:0.001242):0.0,CY010012:0.002484):0.001875,(((CY010020:0.002497,CY011416:0.001237):0.001252,CY009484:0.00062):0.005658,((CY010036:0.0,(CY039879:0.002489,CY039880:0.000621):0.002487):0.003109,((CY010628:0.000619,(CY010716:0.002485,CY010516:0.001239):0.0):0.000619,((CY012728:0.0,CY013701:0.000621):0.001243,(((CY012760:0.001239,CY013200:0.001239):0.0,CY011888:0.005614):0.0,((CY013693:0.000619,(CY012184:0.002484,CY013669:0.00124):0.00124):0.0,((CY112669:0.004353,(CY112556:0.001861,CY011896:0.000619):0.00186):0.0,(CY112605:0.001243,(CY012224:0.006953,((CY012512:0.000619,(CY012896:0.00062,CY012232:0.00062):0.000621):0.0,(CY011848:0.0,(((CY011328:0.0,CY114221:0.000619):0.001241,CY011560:0.00124):0.0,((CY012456:0.000619,CY011824:0.00124):0.0,CY017283:0.000619):0.0):0.0):0.0):0.002439):0.008263):0.000618):0.0):0.0):0.000617):0.012609):0.000619):0.001215):0.003782):0.000613):0.006878):0.0):0.001862):0.0):0.0):0.001863):0.001862):0.001245):0.0):0.001241):0.021084):0.000623):0.00065):0.003713):0.002495):0.0):0.005637):0.00313):0.002515):0.001876):0.0):0.000623):0.0):0.003749):0.0):0.0):0.000623):0.000623):0.001872):0.002503):0.0):0.0):0.000623):0.001468):0.00189):0.002721):0.002524):0.0):0.000624):0.0):0.0):0.0):0.000623):0.001248):0.001255):0.000619):0.0):0.0):0.0):0.000623):0.0):0.0):0.0):0.0;
b
diff -r 000000000000 -r edabb77ac0d4 test-data/fubar-out1.json
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fubar-out1.json Thu Jan 17 04:25:13 2019 -0500
b
b'@@ -0,0 +1,3909 @@\n+{\n+ "analysis":{\n+   "info":"Perform a Fast Unbiased AppRoximate Bayesian (FUBAR)\\n    analysis of a coding sequence alignment to determine whether some\\n    sites have been subject to pervasive purifying or diversifying\\n    selection.\\n\\n    Please note that a FUBAR analysis generates a cache and a results JSON file in the same directory as\\n    directory as the original alignment. HyPhy needs to have write\\n    privileges to this directory. For example if the original file is in\\n    /home/sergei/FUBAR/data/pol.nex then at the end of a FUBAR run, there\\n    will also exist FUBAR-generated files /home/sergei/FUBAR/data/pol.nex.FUBAR.json,\\n    /home/sergei/FUBAR/data/pol.nex.fubrar.cache. They also\\n    provide checkpointing so that a partially completed analysis can be\\n    restarted.",\n+   "version":"2.0",\n+   "citation":"FUBAR: a fast, unconstrained bayesian approximation for inferring selection (2013), Mol Biol Evol. 30(5):1196-205",\n+   "authors":"Sergei L Kosakovsky Pond",\n+   "contact":"spond@temple.edu",\n+   "requirements":"in-frame codon alignment (possibly partitioned) and a phylogenetic tree (one per partition)"\n+  },\n+ "input":{\n+   "file name":"/tmp/tmpZU5xzE/job_working_directory/002/2526/working/fubar_input.fa",\n+   "number of sequences":163,\n+   "number of sites":566,\n+   "partition count":1,\n+   "trees":{\n+     "0":"(KF790010:0.001247,CY147300:0.000623,((CY168239:0.001872,(CY171039:0.001874,KF790389:0.000623)Node7:0.000624)Node5:1e-10,((CY141224:0.001247,(CY147305:1e-10,KF790037:0.000623)Node13:0.000623)Node11:1e-10,(((KF790403:0.000623,KF761507:0.001876)Node18:1e-10,KC526205:0.000623)Node17:1e-10,((CY169303:1e-10,(KF789585:0.000623,CY141202:0.000623)Node25:0.000623)Node23:0.000623,(((KJ667974:0.002501,KJ938675:0.001873)Node30:0.000623,CY134876:1e-10)Node29:0.000623,((KF790414:0.001248,(KF790384:0.001245,KF790408:0.00125)Node37:1e-10)Node35:1e-10,((KF886352:0.001882,(KF790438:0.000623,CY134996:0.001873)Node43:0.000623)Node41:0.001875,(KF789591:0.001879,((KF790049:0.001255,(CY134956:0.000624,CY183153:0.000624)Node51:0.000626)Node49:0.001249,((CY168407:0.004394,CY183065:0.003128)Node55:1e-10,(KF598733:0.002501,((KC892174:1e-10,(KF685747:0.000624,CY168471:0.000625)Node63:0.00375)Node61:0.000624,(((KC892685:0.000624,KC892641:1e-10)Node68:0.001874,KC893110:0.001249)Node67:1e-10,(KC892480:1e-10,(JX913043:0.001249,(KF551075:0.00125,((CY114509:1e-10,(KC892889:1e-10,KC893018:0.002498)Node81:0.005006)Node79:0.001877,(((KC892519:1e-10,KC892498:0.000624)Node86:0.002497,KC892266:0.000623)Node85:0.001026,((KC892156:0.003756,(JX978746:0.001256,KC892407:0.001883)Node93:0.001875)Node91:0.00355,((KC535402:0.000623,(KC882488:0.002498,KC535387:0.001247)Node99:0.001872)Node97:1e-10,(KC535363:0.000623,((KC535396:0.000623,(KC882883:1e-10,KC882867:0.000623)Node107:0.003124)Node105:1e-10,((KC535378:0.001872,KC535375:0.002498)Node111:1e-10,(GQ385891:0.001248,((EU779522:0.001251,(CY037727:1e-10,FJ179354:0.003124)Node119:1e-10)Node117:0.000623,((GQ385889:0.005007,(FJ686933:0.001243,FJ179356:0.003117)Node125:1e-10)Node123:0.000622,(CY173095:0.001245,(((CY173191:1e-10,CY037703:0.001247)Node132:0.000622,CY035062:0.00249)Node131:1e-10,((CY173255:0.001871,(CY044748:1e-10,GQ385846:0.001247)Node139:0.000623)Node137:1e-10,((CY027075:0.000623,(EU199367:1e-10,CY172823:0.000623)Node145:1e-10)Node143:0.000623,(((CY172847:0.000623,CY025643:1e-10)Node150:0.000623,CY172839:0.000623)Node149:0.001247,(((CY026251:0.002497,CY092241:0.00125)Node156:0.000624,CY026019:0.000623)Node155:1e-10,((CY025341:0.002502,(CY172775:0.001247,CY172903:0.000623)Node163:0.001248)Node161:0.000622,(EU199255:0.003134,(CY172431:0.000621,((CY172223:0.003127,(CY172191:0.001254,CY020069:0.000628)Node173:0.000621)Node171:1e-10,((CY092217:0.003119,(CY025485:0.001283,EU516019:0.00059)Node179:0.008843)Node177:0.001868,(CY002080:0.000622,((CY002064:0.001873,(CY002456:0.000626,CY002048:0.002491)Node187:0.001243)Node185:0.003763,(AB434109:0.006307,(((CY088198:0.0012'..b'},\n+     "Node286":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node29":{\n+       "Nucleotide GTR":0.0005897474508257188\n+      },\n+     "Node290":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node291":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node293":{\n+       "Nucleotide GTR":0.00117430959838688\n+      },\n+     "Node296":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node297":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node299":{\n+       "Nucleotide GTR":0.00176761199218168\n+      },\n+     "Node30":{\n+       "Nucleotide GTR":0.0005898078881093438\n+      },\n+     "Node302":{\n+       "Nucleotide GTR":0.0005848345127768663\n+      },\n+     "Node304":{\n+       "Nucleotide GTR":0.007745275417429301\n+      },\n+     "Node306":{\n+       "Nucleotide GTR":0.002330629204008603\n+      },\n+     "Node307":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node309":{\n+       "Nucleotide GTR":0.0005885956619248423\n+      },\n+     "Node312":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node314":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node315":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node316":{\n+       "Nucleotide GTR":0.001176407357032325\n+      },\n+     "Node320":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node321":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node34":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node35":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node37":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node4":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node40":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node41":{\n+       "Nucleotide GTR":0.001772862258434722\n+      },\n+     "Node43":{\n+       "Nucleotide GTR":0.0005878632625248081\n+      },\n+     "Node46":{\n+       "Nucleotide GTR":0.0005879445935582034\n+      },\n+     "Node48":{\n+       "Nucleotide GTR":0.001184645468765879\n+      },\n+     "Node49":{\n+       "Nucleotide GTR":0.001181793995876719\n+      },\n+     "Node5":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node51":{\n+       "Nucleotide GTR":0.0005898360185680268\n+      },\n+     "Node54":{\n+       "Nucleotide GTR":0.001180511953516042\n+      },\n+     "Node55":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node58":{\n+       "Nucleotide GTR":0.00058961101366409\n+      },\n+     "Node60":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node61":{\n+       "Nucleotide GTR":0.0005896414839818972\n+      },\n+     "Node63":{\n+       "Nucleotide GTR":0.00295495604791381\n+      },\n+     "Node66":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node67":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node68":{\n+       "Nucleotide GTR":0.001772143799097988\n+      },\n+     "Node7":{\n+       "Nucleotide GTR":0.0005903801268444384\n+      },\n+     "Node72":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node74":{\n+       "Nucleotide GTR":0.0005900700305158231\n+      },\n+     "Node76":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node78":{\n+       "Nucleotide GTR":0.002369096606403036\n+      },\n+     "Node79":{\n+       "Nucleotide GTR":0.001772323973649173\n+      },\n+     "Node81":{\n+       "Nucleotide GTR":0.004730848174672563\n+      },\n+     "Node84":{\n+       "Nucleotide GTR":0.002072779597743145\n+      },\n+     "Node85":{\n+       "Nucleotide GTR":0.00147286203050845\n+      },\n+     "Node86":{\n+       "Nucleotide GTR":0.002362326634870749\n+      },\n+     "Node90":{\n+       "Nucleotide GTR":0.001781845478584892\n+      },\n+     "Node91":{\n+       "Nucleotide GTR":0.003853035355238686\n+      },\n+     "Node93":{\n+       "Nucleotide GTR":0.001777432790890143\n+      },\n+     "Node96":{\n+       "Nucleotide GTR":0.0008853901614979664\n+      },\n+     "Node97":{\n+       "Nucleotide GTR":0\n+      },\n+     "Node99":{\n+       "Nucleotide GTR":0.00177368320099115\n+      }\n+    },\n+   "attributes":{\n+     "original name":{\n+       "attribute type":"node label",\n+       "display order":-1\n+      },\n+     "Nucleotide GTR":{\n+       "attribute type":"branch length",\n+       "display order":0\n+      }\n+    }\n+  }\n+}\n\\ No newline at end of file\n'
b
diff -r 000000000000 -r edabb77ac0d4 test-data/meme-in1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/meme-in1.fa Thu Jan 17 04:25:13 2019 -0500
b
b'@@ -0,0 +1,1 @@\n+>TREESPARROW_HENAN_1_2004\rATGGAGAAAATAGTGCTTCTTCGTGCAATGATCAATCTTGTTAAAAGTGA\rTCAGATTGGCGTTGGTTACCATGCAGACTACTCGACAGAGCAGGGTGACA\rCAATAATGGAAAAGAACGTTACTGTTACACATGCTCAAGACATATTGGAA\rAAGACACACAACGGGAAGCTCTGCGACCTAGATGGAGTGAAGCCTCTAAT\rTTTGAAAGATTGTAGTGTAGCTGGATGGCTCCTCGGAAACCCAATGTGTG\rACGAATTCATCAATGTGCCGGAGTGGTCTTACATAGTGGAGAAGGCCAGT\rCCAGCCAATGACCTCTGTTACCCAGGGGATTTCAACGACTATGAAGAACT\rGAAACACCTATTGAGCAGAATAAACCATTTTGAAAAAATTCAGATCATCC\rCCAAAAGTTCTTGGTCCGATCATGAAGCCTCATCAGGGGTGAGCTCAGCA\rTGTCCATACCTGGGGAAGCCCTCCTTTTTCAGAAATGTGGTATGGCTTAT\rCAAAAAGAACAGTACATACCCAACAATAAAGAGGGGCTACAATAATACCA\rACCCAGAAGATCTTTTGGTACTGTGGGGGATTCACCATCCTAATGATGCG\rGCAGAGCAGATAAAGCTCTATCAAAACCCAACCACCTATATTTCCGTTGG\rAACATCAACACTAAACCAGAGATTGGTACCAAAAATAGCTACTAGATCCA\rAAGTAAATGGGCAAAGTGGAAGAATGGAGTTCTTCTGGACAATTTTAAAG\rCCGAATGACGCTATCAACTTCGAGAGTAATGGAAATTTCATTGCTCCAGA\rATATGCATACCAAATTGTCAAGAAAGGGGACTCAGCAATTATGAAAAGTG\rAATTGGAATATGGTAACTGCAACACCAAGTGTCAAACTCCAATGGGGGCG\rATAAACTCTAGTATGCCATTCCACAACATACACCCTCTCACCATCGGGGA\rATGCCCCAAATATGTGAAATCAAACAGATTAGTCCTTGCGACAGGGCTCA\rGAAATAGCCCTCAAAGAGAGAGAAGAAGAAAAAAGAGAGGACTATTTGGA\rGCTATAGCAGGTTTTATAGAGGGAGGATGGCAGGGAATGGTAGATGGTTG\rGTATGGGTACCACCATAGCAATGAGCAGGGGAGTGGATACGCTGCAGACA\rAAGAATCCACTCAAAAAGCAATAGATGGAGTCACCAATAAGGTCAACTCG\rATCATTGACAAAATGAACACTCAGTTTGAGGCCGTTGGAAGGGAATTTAA\rTAACTTAGAAAGGAGAATAGAAAATTTAAACAAGAAGATGGAGGACGGAT\rTCCTAGATGTCTGGACTTATAATGCTGAACTTCTGGTTCTCATGGAAAAT\rGAGAGAACTCTAGACTTTCATGACTCAAATGTCAAGAACCTTTACGAAAA\rGGTCCGACTACAACTTAGGGATAATGCAAAGGAGCTGGGTAACGGTTGTT\rTCGAGTTCTATCACAAATGTGATAATGAATGTATGGAAAGTGTAAAAAAC\rGGAACGTATGACTACCCGCAGTATTCAGAAGAAGCAAGACTAAACAGAGA\rGGAAATAAGTGGAGTAAAATTGGAATCAATAGGAACTTACCAAATACTGT\rCAATTTATTCAACAGTGGCGAGTTCCCTAGCACTGGCAATCATGGTAGCT\rGGTCTATCTTTATGGATGTGCTCCAATGGATCGTTACAATGCAGAATT\r>HUMAN_VIETNAM_CL105_2005\rATGGAGAAAATAGTGCTTCTTTTTGCGATAGTCAGTCTTGTTAAAAGTGA\rTCAGATTTGCATTGGTTACCATGCAAACAACTCGACAGAGCAGGTTGACA\rCAATAATGGAAAAGAACGTTACTGTTACACATGCCCAAGACATACTGGAA\rAAGACACACAACGGGAAGCTCTGCGATCTAGATGGAGTGAAGCCTCTAAT\rTTTGAGAGATTGTAGTGTAGCTGGATGGCTACTCGGAAACCCAATGTGTG\rACGAATTCATCAATGTGCCGGAATGGTCTTACATAGTGGAGAAGGTCAAT\rCCAGTCAATGACCTCTGTTACCCAGGGGTTTTCAATGACTATGAAGAATT\rGAAACACCTATTGAGCAGAATAAACCATTTTGAGAAAATTCAGATCATCC\rCCAAAAGTTCTTGGTCCAGTCATGAAGCCTCATTAGGGGTGAGCTCAGTA\rTGTCCATACCAGGGAAAGTCCTCCTTTTTCAGAAATGTGGTATGGCTTAT\rCAAAAAGAACAGTACATACCCAACAATAAAGAGGAGCTACAATAATACCA\rACCAAGAAGATCTTTTGGTAATATGGGGGATTCATCATCCTAATGATGCG\rGCAGAGCAGATAAAGCTCTATCAAAACCCAACCACCTATATTTCCGTTGG\rGACATCAACACTAAACCAGAGATTGGTACCAAGAATAGCTACTAGATCCA\rAAGTAAACGGGCAAAGTGGGAGGATGGAGTTCTTCTGGACAATTTTAAAA\rCCGAATGATGCAATCAACTTCGAGAGTAATGGAAATTTCATTGCTCCAGA\rATATGCATACAAGATTGTCAAGAAAGGGGACTCAACAATTATGAAAAGTG\rAATTGGAATATGGTAACTGCAACACCAAGTGTCAAACTCCAATGGGGGCG\rATAAACTCTAGTATGCCATTCCACAATATACACCCTCTCACCATCGGGGA\rATGCCCCAAATATGTGAAATCAAACAGATTAGTCCTTGCGACTGGGCTCA\rGAAATAGCCCTCAAAAAGAGAGAAGAAGAAAAAAGAGAGGATTATTTGGA\rGCTATAGCAGGTTTTATAGAGGGAGGATGGCAGGGAATGGTAGATGGTTG\rGTATGGGTACCACCATAGCAATGAGCAGGGGAGTGGGTACGCTGCAGACA\rAAGAATCCACTCAAAAGGCAATAGATGGAGTCACCAATAAGGTCAACTCG\rATCATTGACAAAATGAACACTCAGTTTGAGGCCGTTGGAAGGGAATTTAA\rCAACTTAGAAAGGAGAATAGAGAATTTAAACAAGAAGATGGAAGACGGGT\rTCCTAGATGTCTGGACTTATAATGCTGAACTTCTGGTTCTCATGGAAAAT\rGAGAGAACTCTAGACTTTCATGACTCAAATGTCAAGAACCTTTACGACAA\rGGTCCGACTACAGCTTAGGGATAATGCAAAGGAGCTGGGTAACGGTTGTT\rTCGAGTTCTATCATAAATGTGATAATGAATGTATGGAAAGTGTAAGAAAC\rGGAACGTATGACTACCCGCAGTATTCAGAAGAAGCAAGATTAAAAAGAGA\rGGAAATAAGTGGAGTAAAATTGGAATCAATAGGAATTTACCAAATACTGT\rCAATTTATTCTACAGTGGCGAGTTCCCTAGCACTGGCAATCATGATAGCT\rGGTCTATCCTTATGGATGTGCTCCAATGGGTCGTTACAA---------\r>TREESPARROW_HENAN_4_2004\rATGGAGAAAATAGTGCTTCTTCTTGCAATAGTCAGTCTTGTTAAAAGTGA\rTCAGATTTGCATTGGTTACCATGCAAACAACTCGACAGAGCAGGTTGACA\rCAATAATGCAAAAGAACGTTACTGTTACACATGCCCAAGACATACTGGAA\rAAGACACACAACGGGAAGCTCTGCGATCTAGATGGAGTGAAACCTCTAAT\rTTTAAGAGATTGTAGTGTAGCTGGATGGCTCCTCGGAAACCCAATGTGTG\rACGAATTCATCAATGTGCCGGAATGGTCTTACATAGTGGAGAAGGCCAGT\rCCAGCCAATGACCTCTGTTACCCAGGGGATTTCAACGACTATGAAGAACT\rGAAACACCTATTGAGCAGAATAAACCATTTTGAGAAAATTCAGATCATCC\rCCAAAAGTTCTTGGTCCGATCATGAAGCCTCA'..b'AA\rTAACTTAGAAAGGAGAATAGAGAATTTAAACAAGAAGATGGAAGACGGAT\rTCCTAGATGTCTGGACTTATAATGCTGAACTTCTGGTTCTCATGGAAAAT\rGAGAGAACTCTAGACTTTCATGACTCAAATGTCAAGAACCTTTACGACAA\rGGTCCGACTACAGCTTAGGGATAATGCAAAAGAGCTGGGTAACGGTTGTT\rTCGAGTTCTATCACAAATGTGATAATGAATGTATGGAAAGTGTAAGAAAC\rGGAACGTATGACTACCCGCAGTATTCAGAAGAAGCAAGACTAAAAAGAGA\rGGAAATAAGTGGAGTAAAATTGGAATCAATAGGAACTTACCAAATACTGT\rCAATTTATTCAACAGTGGCGAGTTCCCTAGCGCTGGCAATCATGGTAGCT\rGGTCTATCTTTATGGATGTGCTCC------------------------\r>TREESPARROW_HENAN_2_2004\rATGGAGAAAATAGTGCTTCTTCTTGCAATAGTCAGTCTTGTTAAAAGTGA\rTCAGATTTGCATTGGTTACCATGCAAACAACTCGACAGAGCAGGTTGACA\rCAATAATGGAAAAGAACGTTACTGTTACACATGCTCAAGACATATTGGAA\rAAGACACACAACGGGAAGCTCTGCGACCTAGATGGAGTGAAGCCTCTAAT\rTTTGAAAGATTGTAGTGTAGCTGGATGGCTCCTCGGAAACCCAATGTGTG\rACGAATTCATCAATGTGCCGGAGTGGTCTTACATAGTGGAGAAGGCCAGT\rCCAGCCAATGACCTCTGTTACCCAGGGGATTTCAACGACTATGAAGAACT\rGAAACACCTATTGAGCAGAATAAACCATTTTGAAAAAATTCAGATCATCC\rCCAAAAGTTCTTGGTCCGATCATGAAGCCTCATCAGGGGTGAGCTCAGCA\rTGTCCATACCTGGGGAAGCCCTCCTTTTTCAGAAATGTGGTATGGCTTAT\rCAAAAAGAACAGTACATACCCAACAATAAAGAGGGGCTACAATAATACCA\rACCAAGAAGATCTTTTGGTACTGTGGGGGATTCACCATCCTAATGATGCG\rGCAGAGCAGATAAAGCTCTATCAAAACCCAACCACCTATATTTCCGTTGG\rAACATCAACACTAAACCAGAGATTGGTACCAAAAATAGCTACTAGATCCA\rAAGTAAACGGACAAAGTGGAAGAATGGAGTTCTTCTGGACAATTTTAAAA\rCCGAATGATGCTATCAATTTCGAGAGTAATGGAAATTTCATTGCTCCAGA\rATATGCATACAAAATTGTCAAGAAAGGGGACTCTGCAATTATGAAGAGTG\rAATTGGAATATGGCAACTGCAACACCAAGTGTCAAACTCCAGTGGGGGCG\rATAAATTCTAGCATGCCATTCCACAACATACACCCTCTCACCATCGGGGA\rATGCCCCAAATATGTGAAATCAAACAGATTAGTCCTTGCGACTGGACTCA\rGAAATGCCCCTCAAAGAGAGGGAAGAAGAAAAAAGAGAGGACTATTTGGA\rGCTATAGCAGGGTTTATAGAGGGAGGATGGCAGGGGATGGTAGATGGTTG\rGTATGGGTACCACCATAGCAATGAGCAGGGGAGTGGATACGCTGCAGACA\rAAGAATCCACTCAAAAAGCAATAGATGGAGTCACCAATAAGGTCAACTCG\rATCATTGACAAAATGAACACTCAGTTTGAGGCCGTTGGAAGGGAATTTAA\rTAACTTAGAAAGGAGAATAGAAAATTTAAACAAGAAGATGGAGGACGGAT\rTCCTAGATGTCTGGACTTATAATGCTGAACTTCTGGTTCTCATGGAAAAT\rGAGAGAACTCTAGACTTTCATGACTCAAATGTCAAGAACCTTTACGAAAA\rGGTCCGACTACAACTTAGGGATAATGCAAAGGAGCTGGGTAACGGTTGTT\rTCGAGTTCTATCACAAATGTGATAATGAATGTATGGAAAGTGTAAAAAAC\rGGAACGTATGACTACCGGCTGGACTCAGAAGAAGCAAGACTAAACAGAGA\rGGAAATAAGTGGAGTAAAATTGGAATCAATAGGAACTTACCAAATACTGT\rCAATTTATTCAACAGTGGCGAGTTCCCTAGCACTGGCAATCATGGTAGCT\rGGTCTATCTTTATGGATGTGCTCCAATGGATCGTTACAATGCAGAATT\r>HONGKONG_1_538_97\r------------------------------------------------GA\rTCAGATTTGCATTGGTTACCATGCAAACAACTCGACAGAGCAGGTTGACA\rCAATAATGGAAAAGAATGTTACTGTTACACATGCCCAAGACATACTGGAA\rAGGACACACAACGGGAAGCTCTGCGATCTAAATGGAGTGAAACCTCTCAT\rTTTGAGGGATTGTAGTGTAGCTGGATGGCTCCTCGGAAACCCTATGTGTG\rACGAATTCATCAATGTGCCGGAATGGTCTTACATAGTGGAGAAGGCCAGT\rCCAGCCAATGACCTCTGTTATCCAGGGAATTTCAACGACTATGAAGAACT\rGAAACACCTATTGAGCAGAATAAACCATTTTGAGAAAATTCAGATCATCC\rCCAAAAGTTCTTGGTCCAATCATGATGCCTCATCAGGGGTGAGCTCAGCA\rTGTCCATACCTTGGGAGGTCCTCCTTTTTCAGAAATGTGGTATGGCTTAT\rCAAAAAGAACAGTGCATACCCAACAATAAAGAGGAGCTACAATAATACCA\rACCAAGAAGATCTTTTGGTACTGTGGGGGATTCACCATCCTAATGATGCG\rGCAGAGCAGACAAAGCTCTATCAAAATCCAACCACCTACATTTCCGTTGG\rAACATCAACACTGAACCAGAGATTGGTTCCAGAAATAGCTACTAGACCCA\rAAGTAAACGGGCAAAGTGGAAGAATGGAGTTCTTCTGGACAATTTTAAAG\rCCGAATGATGCCATCAATTTCGAGAGTAATGGAAATTTCATTGCCCCAGA\rATATGCATACAAAATTGTCAAGAAAGGGGACTCAACAATTATGAAAAGTG\rAATTGGAATATGGTAACTGCAACACCAAGTGTCAAACTCCAATGGGGGCG\rATAAACTCTAGTATGCCATTCCACAACATACACCCCCTCACCATCGGGGA\rATGCCCCAAATATGTGAAATCAAACAGATTAGTTCTTGCGACTGGACTCA\rGAAATACCCCTCAAAGGGAGAGAAGAAGAAAAAAGAGAGGACTATTTGGA\rGCTATAGCAGGTTTTATAGAGGGAGGATGGCAGGGAATGGTAGATGGTTG\rGTATGGGTACCACCATAGCAATGAGCAGGGGAGTGGATACGCTGCAGACC\rAAGAATCCACTCAAAAGGCAATAGATGGAGTCACCAATAAGGTCAACTCG\rATCATTAACAAAATGAACACTCAGTTTGAGGCCGTTGGAAGGGAATTTAA\rTAACTTAGAAAGGAGAATAGAGAATTTAAACAAGAAAATGGAAGACGGAT\rTCCTAGATGTCTGGACTTACAATGCTGAACTTCTGGTTCTCATGGAAAAT\rGAGAGAACTCTCGACTTTCATGACTCAAATGTCAAGAACCTTTACGACAA\rGGTCCGACTACAGCTTAGGGATAATGCAAAGGAACTGGGTAATGGTTGTT\rTCGAATTCTATCACAAATGTGATAATGAATGTATGGAAAGTGTAAGAAAC\rGGAACGTATGACTACCCGCAGTATTCAGAAGAAGCAAGACTAAACAGAGA\rGGAAATAAGTGGAGTAAAATTGGAATCAATGGGAACTTACCAAATACTGT\rCAATTTATTCAACAGTGGCGAGTTCCCTAGCACTGGCAATCATGGTAGCT\rGGTCTATCTTTATGGATGTGCTCCAATGGATCGTTACAATGCAGAATT\r\r\n\\ No newline at end of file\n'
b
diff -r 000000000000 -r edabb77ac0d4 test-data/meme-in1.nhx
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/meme-in1.nhx Thu Jan 17 04:25:13 2019 -0500
b
@@ -0,0 +1,1 @@
+(((((((TREESPARROW_HENAN_1_2004{FG}:0.0111333782927653,TREESPARROW_HENAN_3_2004{FG}:0.006193745941169043):0.0009956664967877545,TREESPARROW_HENAN_4_2004:0.004351652686857959):0.002267763895256407,(CHICKEN_HEBEI_326_2005:0.02100885319673648,(SWINE_ANHUI_1_2004:0.007702393698306516,TREESPARROW_HENAN_2_2004:0.00906278098731238):0.002095219592954275):0.003887237703073042):0.003404921392531202,(((CHICKEN_HONGKONG_915_97,(GOOSE_HONGKONG_W355_97,DUCK_HONGKONG_Y283_97:0.002798420018760263):0.002899766890966483):0.001306376767766534,HONGKONG_1_97_98:0.003844928589233716):0.000182535836694054,HONGKONG_1_538_97):0.02096173714686362):0.003130608143291779,(((DUCK_GUANGZHOU_20_2005:0.006299389645455026,GOOSE_SHANTOU_2216_2005:0.006207842095177651):0.002530613798219486,PEREGRINEFALCON_HK_D0028_2004:0.003608296348267232):0.003288900909856382,CK_HK_WF157_2003:0.00663129750258774):0.004655295319725731):0.0116808817874948,(((HUMAN_VIETNAM_CL105_2005:0.006521522005742001,DUCK_VIETNAM_376_2005:0.007877615936285868):0.001967887030302483,HUMAN_VIETNAM_3062_2004:0.001641397323851184):0.0003125512332168847,MALLARD_VIETNAM_16_2003:0.003244216605281072):0.0004125980823087554):0.0003400912533471183,CHICKEN_CK_160_2005:0.006168335080088849,DUCK_VIETNAM_272_2005:0.009465302724994452)
b
diff -r 000000000000 -r edabb77ac0d4 test-data/meme-out1.json
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/meme-out1.json Thu Jan 17 04:25:13 2019 -0500
[
b'@@ -0,0 +1,9816 @@\n+{\n+ "analysis":{\n+   "info":"MEME (Mixed Effects Model of Evolution)\\n    estimates a site-wise synonymous (&alpha;) and a two-category mixture of non-synonymous\\n    (&beta;-, with proportion p-, and &beta;+ with proportion [1-p-]) rates, and\\n    uses a likelihood ratio test to determine if &beta;+ > &alpha; at a site.\\n    The estimates aggregate information over a proportion of branches at a site,\\n    so the signal is derived from\\n    episodic diversification, which is a combination of strength of selection [effect size] and\\n    the proportion of the tree affected. A subset of branches can be selected\\n    for testing as well, in which case an additional (nuisance) parameter will be\\n    inferred -- the non-synonymous rate on branches NOT selected for testing. Multiple partitions within a NEXUS file are also supported\\n    for recombination - aware analysis.\\n    ",\n+   "version":"2.0.1",\n+   "citation":"Detecting Individual Sites Subject to Episodic Diversifying Selection. _PLoS Genet_ 8(7): e1002764.",\n+   "authors":"Sergei L. Kosakovsky Pond, Steven Weaver",\n+   "contact":"spond@temple.edu",\n+   "requirements":"in-frame codon alignment and a phylogenetic tree"\n+  },\n+ "fits":{\n+   "Nucleotide GTR":{\n+     "Log Likelihood":-4394.17778442101,\n+     "estimated parameters":47,\n+     "AIC-c":8882.482274823486,\n+     "Equilibrium frequencies":[\n+      [0.3460163217230355],\n+      [0.1876507375623983],\n+      [0.2296889898480005],\n+      [0.2366439508665657]\n+      ],\n+     "Rate Distributions":{\n+       "Substitution rate from nucleotide A to nucleotide C":0.1602243049428088,\n+       "Substitution rate from nucleotide A to nucleotide G":1,\n+       "Substitution rate from nucleotide A to nucleotide T":0.1350661843114337,\n+       "Substitution rate from nucleotide C to nucleotide G":0.04669906431175039,\n+       "Substitution rate from nucleotide C to nucleotide T":1.290725939052547,\n+       "Substitution rate from nucleotide G to nucleotide T":0.1442807316736102\n+      },\n+     "display order":0\n+    },\n+   "Global MG94xREV":{\n+     "Log Likelihood":-4272.739394378317,\n+     "estimated parameters":54,\n+     "AIC-c":8653.980859587502,\n+     "Equilibrium frequencies":[\n+      [0.04794212053691846],\n+      [0.02918423386756777],\n+      [0.03061835466109362],\n+      [0.03395226455636327],\n+      [0.02063374857573568],\n+      [0.01256056547467788],\n+      [0.01317779490778274],\n+      [0.01461267216775245],\n+      [0.02309512129134449],\n+      [0.01405889880167917],\n+      [0.01474975672164567],\n+      [0.01635579860179934],\n+      [0.03032452824999034],\n+      [0.01845972006369387],\n+      [0.01936683547765817],\n+      [0.02147561255447049],\n+      [0.02137643485619778],\n+      [0.01301266750638816],\n+      [0.01365211335015547],\n+      [0.01513863724385318],\n+      [0.009200176740799796],\n+      [0.005600505497450756],\n+      [0.005875715784779066],\n+      [0.006515498921838312],\n+      [0.01029765371767897],\n+      [0.006268582428525358],\n+      [0.0065766221888793],\n+      [0.007292724214466442],\n+      [0.01352110201678854],\n+      [0.00823082081030041],\n+      [0.008635285471781717],\n+      [0.009575547089413102],\n+      [0.03891475766269277],\n+      [0.02368892689369449],\n+      [0.02485300688252417],\n+      [0.02755915117048418],\n+      [0.01674847329457107],\n+      [0.01019544726180969],\n+      [0.01069645417478218],\n+      [0.01186114818960848],\n+      [0.0187463766345312],\n+      [0.01141164874946168],\n+      [0.01197242011780667],\n+      [0.01327604894903844],\n+      [0.02461450713626915],\n+      [0.01498380807429274],\n+      [0.01572011627491417],\n+      [0.01743181671681681],\n+      [0.02096427272215724],\n+      [0.0243893513506083],\n+      [0.01482209656025475],\n+      [0.009022786801619234],\n+      [0.009466168876559794],\n+      [0.0104969020572672],\n+      [0.01009910316608133],\n+      [0.0105953757052942],\n+      [0.01174906369078435],\n+      [0.02178339453036125],\n+      [0.0132603996920412'..b'0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [3.814755404861853, 1.572851816866315, 0.1438716660523674, 0.9133509310228476, 0.8561283339476325, 0, 0.6666666666666666, 0, 0.7227144053850797],\n+      [1.632925368858752, 9.067515371869682e-14, 0.006624396040964042, 0, 0.993375603959036, 0, 0.6666666666666666, 0, 0.1893861876435577],\n+      [6.910467162191216e-17, 6.644009788709589e-17, 0.9530537860422115, 85.70098840469475, 0.04694621395778853, 1.225935500569101, 0.2790979511294799, 1, 1.118452011325364],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [11.1535743907125, 5.495472588337348e-15, 0.01781925113627541, 0, 0.9821807488637246, 0, 0.6666666666666666, 0, 1.293588165595197],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1.010942372745582e-08, 1.91494782694605, 0.9999999898905763, 0.2892532193905701, 0.4945031377423876, 2, 0.5323385189861313],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [1.4067965522307e-18, 1.29678984354774e-18, 1.168435917029792e-08, 1.208349982163844, 0.9999999883156409, 0.7347666355131786, 0.3713355934229282, 1, 0.335910581926816],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [6.368685611187767, 1.355989920668704e-13, 0.01759475909141055, 0, 0.9824052409085895, 0, 0.6666666666666666, 0, 0.7386382202183567],\n+      [2.971299687611712, 5.046872141495953e-14, 0.03213540026814934, 0, 0.9678645997318507, 0, 0.6666666666666666, 0, 0.3446104340803781],\n+      [5.225788799949489, 4.947569585464828e-14, 0.04033984096140914, 0, 0.9596601590385908, 0, 0.6666666666666666, 0, 0.6060853956507083],\n+      [2.274039764208154, 2.2709112751361, 0.3496099543716427, 2.266704309337646, 0.6503900456283573, 0, 0.6666666666666666, 0, 0.8942750177686055],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [2.911915266799392, 4.584056471766455e-14, 0.03076462226890157, 0, 0.9692353777310985, 0, 0.6666666666666666, 0, 0.3377230470156978],\n+      [1.26771203129804, 6.909493443060373e-14, 0.04025953489340931, 0, 0.9597404651065907, 0, 0.6666666666666666, 0, 0.1470288558289737],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [2.901922012595191, 2.621061526763822, 0.4839161180134702, 0.0006260070449028816, 0.5160838819865299, 0, 0.6666666666666666, 0, 0.6892505519758656],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [2.678942456400262, 5.858652373777976e-14, 0.03445131768569747, 0, 0.9655486823143026, 0, 0.6666666666666666, 0, 0.3107029313217802],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [8.844981831006641e-17, 8.153334315915164e-17, 0.6000047345675635, 3.553758402405184, 0.3999952654324365, 0.8531795900839363, 0.346031112193832, 1, 0.3951606587101648],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [5.922636877376851, 3.830380225985632e-14, 0.01771536752991297, 0, 0.982284632470087, 0, 0.6666666666666666, 0, 0.6869056237318886],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [3.778232489478013, 2.03776205152443e-13, 0.02561078725613944, 0, 0.9743892127438606, 0, 0.6666666666666666, 0, 0.4381982550209036],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0],\n+      [0, 0, 1, 0, 0, 0, 1, 0, 0]\n+      ]\n+    }\n+  }\n+}\n\\ No newline at end of file\n'
b
diff -r 000000000000 -r edabb77ac0d4 test-data/params.json
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/params.json Thu Jan 17 04:25:13 2019 -0500
[
b'@@ -0,0 +1,280 @@\n+{\n+    "filepath": "/home/sweaver/datamonkey/datamonkey-js-dev/app/models/../../uploads/msa/5446bc0d355080301f18a8c6.fasta",\n+    "msa": [\n+        {\n+            "rawsites": 1698,\n+            "nj": "(((((((TREESPARROW_HENAN_1_2004:0.0111333782927653,TREESPARROW_HENAN_3_2004:0.006193745941169043):0.0009956664967877545,TREESPARROW_HENAN_4_2004:0.004351652686857959):0.002267763895256407,(CHICKEN_HEBEI_326_2005:0.02100885319673648,(SWINE_ANHUI_1_2004:0.007702393698306516,TREESPARROW_HENAN_2_2004:0.009062780987312381):0.002095219592954275):0.003887237703073042):0.003404921392531202,(((CHICKEN_HONGKONG_915_97:-0.001089936320307174,(GOOSE_HONGKONG_W355_97:-0.002798420018760263,DUCK_HONGKONG_Y283_97:0.002798420018760263):0.002899766890966483):0.001306376767766534,HONGKONG_1_97_98:0.003844928589233716):0.000182535836694054,HONGKONG_1_538_97:-8.034074555865944e-05):0.02096173714686362):0.003130608143291779,(((DUCK_GUANGZHOU_20_2005:0.006299389645455026,GOOSE_SHANTOU_2216_2005:0.006207842095177651):0.002530613798219486,PEREGRINEFALCON_HK_D0028_2004:0.003608296348267232):0.003288900909856382,CK_HK_WF157_2003:0.00663129750258774):0.004655295319725731):0.0116808817874948,(((HUMAN_VIETNAM_CL105_2005:0.006521522005742001,DUCK_VIETNAM_376_2005:0.007877615936285868):0.001967887030302483,HUMAN_VIETNAM_3062_2004:0.001641397323851184):0.0003125512332168847,MALLARD_VIETNAM_16_2003:0.003244216605281072):0.0004125980823087554):0.0003400912533471183,CHICKEN_CK_160_2005:0.006168335080088849,DUCK_VIETNAM_272_2005:0.009465302724994452)",\n+            "goodtree": 0,\n+            "sequences": 21,\n+            "sites": 566,\n+            "partitions": 1,\n+            "analysis_type": "1",\n+            "gencodeid": 0,\n+            "datatype": 0,\n+            "_id": "5446bc0d355080301f18a8c7",\n+            "created": "2014-10-21T20:03:25.803Z",\n+            "sequence_info": [\n+                {\n+                    "seqindex": 0,\n+                    "name": "TREESPARROW_HENAN_1_2004",\n+                    "_id": "5446bc0d355080301f18a8c8"\n+                },\n+                {\n+                    "seqindex": 1,\n+                    "name": "HUMAN_VIETNAM_CL105_2005",\n+                    "_id": "5446bc0d355080301f18a8c9"\n+                },\n+                {\n+                    "seqindex": 2,\n+                    "name": "TREESPARROW_HENAN_4_2004",\n+                    "_id": "5446bc0d355080301f18a8ca"\n+                },\n+                {\n+                    "seqindex": 3,\n+                    "name": "CHICKEN_HEBEI_326_2005",\n+                    "_id": "5446bc0d355080301f18a8cb"\n+                },\n+                {\n+                    "seqindex": 4,\n+                    "name": "CHICKEN_HONGKONG_915_97",\n+                    "_id": "5446bc0d355080301f18a8cc"\n+                },\n+                {\n+                    "seqindex": 5,\n+                    "name": "HUMAN_VIETNAM_3062_2004",\n+                    "_id": "5446bc0d355080301f18a8cd"\n+                },\n+                {\n+                    "seqindex": 6,\n+                    "name": "GOOSE_HONGKONG_W355_97",\n+                    "_id": "5446bc0d355080301f18a8ce"\n+                },\n+                {\n+                    "seqindex": 7,\n+                    "name": "DUCK_HONGKONG_Y283_97",\n+                    "_id": "5446bc0d355080301f18a8cf"\n+                },\n+                {\n+                    "seqindex": 8,\n+                    "name": "DUCK_VIETNAM_376_2005",\n+                    "_id": "5446bc0d355080301f18a8d0"\n+                },\n+                {\n+                    "seqindex": 9,\n+                    "name": "MALLARD_VIETNAM_16_2003",\n+                    "_id": "5446bc0d355080301f18a8d1"\n+                },\n+                {\n+                    "seqindex": 10,\n+                    "name": "CHICKEN_CK_160_2005",\n+                    "_id": "5446bc0d355080301f18a8d2"\n+                },\n+                {\n+                    "seqindex": 11,\n+      '..b'ex": 10\n+                    },\n+                    {\n+                        "_id": "5446bc0d355080301f18a8d3",\n+                        "name": "DUCK_GUANGZHOU_20_2005",\n+                        "seqindex": 11\n+                    },\n+                    {\n+                        "_id": "5446bc0d355080301f18a8d4",\n+                        "name": "CK_HK_WF157_2003",\n+                        "seqindex": 12\n+                    },\n+                    {\n+                        "_id": "5446bc0d355080301f18a8d5",\n+                        "name": "SWINE_ANHUI_1_2004",\n+                        "seqindex": 13\n+                    },\n+                    {\n+                        "_id": "5446bc0d355080301f18a8d6",\n+                        "name": "DUCK_VIETNAM_272_2005",\n+                        "seqindex": 14\n+                    },\n+                    {\n+                        "_id": "5446bc0d355080301f18a8d7",\n+                        "name": "HONGKONG_1_97_98",\n+                        "seqindex": 15\n+                    },\n+                    {\n+                        "_id": "5446bc0d355080301f18a8d8",\n+                        "name": "GOOSE_SHANTOU_2216_2005",\n+                        "seqindex": 16\n+                    },\n+                    {\n+                        "_id": "5446bc0d355080301f18a8d9",\n+                        "name": "TREESPARROW_HENAN_3_2004",\n+                        "seqindex": 17\n+                    },\n+                    {\n+                        "_id": "5446bc0d355080301f18a8da",\n+                        "name": "PEREGRINEFALCON_HK_D0028_2004",\n+                        "seqindex": 18\n+                    },\n+                    {\n+                        "_id": "5446bc0d355080301f18a8db",\n+                        "name": "TREESPARROW_HENAN_2_2004",\n+                        "seqindex": 19\n+                    },\n+                    {\n+                        "_id": "5446bc0d355080301f18a8dc",\n+                        "name": "HONGKONG_1_538_97",\n+                        "seqindex": 20\n+                    }\n+                ],\n+                "created": "2014-10-21T20:03:25.803Z",\n+                "_id": "5446bc0d355080301f18a8c7",\n+                "datatype": 0,\n+                "gencodeid": 0,\n+                "partitions": 1,\n+                "sites": 566,\n+                "sequences": 21,\n+                "goodtree": 0,\n+                "nj": "(((((((TREESPARROW_HENAN_1_2004:0.0111333782927653,TREESPARROW_HENAN_3_2004:0.006193745941169043):0.0009956664967877545,TREESPARROW_HENAN_4_2004:0.004351652686857959):0.002267763895256407,(CHICKEN_HEBEI_326_2005:0.02100885319673648,(SWINE_ANHUI_1_2004:0.007702393698306516,TREESPARROW_HENAN_2_2004:0.009062780987312381):0.002095219592954275):0.003887237703073042):0.003404921392531202,(((CHICKEN_HONGKONG_915_97:-0.001089936320307174,(GOOSE_HONGKONG_W355_97:-0.002798420018760263,DUCK_HONGKONG_Y283_97:0.002798420018760263):0.002899766890966483):0.001306376767766534,HONGKONG_1_97_98:0.003844928589233716):0.000182535836694054,HONGKONG_1_538_97:-8.034074555865944e-05):0.02096173714686362):0.003130608143291779,(((DUCK_GUANGZHOU_20_2005:0.006299389645455026,GOOSE_SHANTOU_2216_2005:0.006207842095177651):0.002530613798219486,PEREGRINEFALCON_HK_D0028_2004:0.003608296348267232):0.003288900909856382,CK_HK_WF157_2003:0.00663129750258774):0.004655295319725731):0.0116808817874948,(((HUMAN_VIETNAM_CL105_2005:0.006521522005742001,DUCK_VIETNAM_376_2005:0.007877615936285868):0.001967887030302483,HUMAN_VIETNAM_3062_2004:0.001641397323851184):0.0003125512332168847,MALLARD_VIETNAM_16_2003:0.003244216605281072):0.0004125980823087554):0.0003400912533471183,CHICKEN_CK_160_2005:0.006168335080088849,DUCK_VIETNAM_272_2005:0.009465302724994452)",\n+                "rawsites": 1698\n+            }\n+        ],\n+        "created": "2014-10-21T20:03:25.798Z"\n+    },\n+    "status_stack": [\n+        "In Queue",\n+        "Running",\n+        "Completed"\n+    ],\n+    "type": "relax"\n+}\n'
b
diff -r 000000000000 -r edabb77ac0d4 test-data/slac-out1.json
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/slac-out1.json Thu Jan 17 04:25:13 2019 -0500
[
b'@@ -0,0 +1,2076 @@\n+{\n+ "analysis":{\n+   "info":"SLAC (Single Likelihood Ancestor Counting)\\n    uses a maximum likelihood ancestral state reconstruction\\n    and minimum path substitution counting to estimate site - level\\n    dS and dN,\\n    and applies a simple binomial - based test to test\\n    if dS differs drom dN.\\n    The estimates aggregate information over all branches,\\n    so the signal is derived from\\n    pervasive diversification or conservation. A subset of branches can be selected\\n    for testing as well.\\n    Multiple partitions within a NEXUS file are also supported\\n    for recombination - aware analysis.\\n    ",\n+   "version":"2.00",\n+   "citation":"Not So Different After All: A Comparison of Methods for Detecting Amino Acid Sites Under Selection (2005). _Mol Biol Evol_ 22 (5): 1208-1222",\n+   "authors":"Sergei L Kosakovsky Pond and Simon DW Frost",\n+   "contact":"spond@temple.edu",\n+   "requirements":"in-frame codon alignment and a phylogenetic tree"\n+  },\n+ "fits":{\n+   "Nucleotide GTR":{\n+     "Log Likelihood":-3531.963798530155,\n+     "estimated parameters":24,\n+     "AIC-c":7112.142458295762,\n+     "Equilibrium frequencies":[\n+      [0.3563279857397504],\n+      [0.1837789661319073],\n+      [0.2402852049910873],\n+      [0.2196078431372549]\n+      ],\n+     "Rate Distributions":{\n+       "Substitution rate from nucleotide A to nucleotide C":0.5474490057204714,\n+       "Substitution rate from nucleotide A to nucleotide G":1,\n+       "Substitution rate from nucleotide A to nucleotide T":0.2645352969683238,\n+       "Substitution rate from nucleotide C to nucleotide G":0.4863078374555331,\n+       "Substitution rate from nucleotide C to nucleotide T":1.018028772244997,\n+       "Substitution rate from nucleotide G to nucleotide T":0.3025951149895378\n+      },\n+     "display order":0\n+    },\n+   "Global MG94xREV":{\n+     "Log Likelihood":-3466.724829119623,\n+     "estimated parameters":31,\n+     "AIC-c":6996.52909240682,\n+     "Equilibrium frequencies":[\n+      [0.04785168648208005],\n+      [0.03911346079312019],\n+      [0.04842054060317301],\n+      [0.04069665666515385],\n+      [0.01817010744778396],\n+      [0.01485205303123071],\n+      [0.01838611113045968],\n+      [0.01545321970309948],\n+      [0.0190138898893362],\n+      [0.01554175184587827],\n+      [0.01923992433904378],\n+      [0.01617083546230154],\n+      [0.02796925133965702],\n+      [0.02286176927319543],\n+      [0.02830174586718859],\n+      [0.02378714529482007],\n+      [0.01687870337957799],\n+      [0.01379647304851128],\n+      [0.01707935503225849],\n+      [0.01435491300079667],\n+      [0.006409133648843443],\n+      [0.005238757839512795],\n+      [0.006485324528555602],\n+      [0.005450807083377185],\n+      [0.006706760641638982],\n+      [0.005482034985409045],\n+      [0.006786489669196017],\n+      [0.005703931360295163],\n+      [0.009865581170012171],\n+      [0.008064021368173151],\n+      [0.009982861811889655],\n+      [0.008390428826966174],\n+      [0.03287895020631181],\n+      [0.02687490503171972],\n+      [0.033269810543681],\n+      [0.0279627207822247],\n+      [0.01248470225271473],\n+      [0.01020486315060615],\n+      [0.01263311863778268],\n+      [0.01061792547971484],\n+      [0.01306446616325414],\n+      [0.01067875601941112],\n+      [0.01321977470017749],\n+      [0.01111100011404158],\n+      [0.01921770557551369],\n+      [0.01570834862514353],\n+      [0.01944616295744266],\n+      [0.01634417558076203],\n+      [0.01975257768318274],\n+      [0.02055210293142003],\n+      [0.009176034326710849],\n+      [0.007500393094996483],\n+      [0.00928511773266342],\n+      [0.007803986567571961],\n+      [0.00784869593340758],\n+      [0.009716299514778986],\n+      [0.008166387662818644],\n+      [0.01412467213650941],\n+      [0.01154535713247913],\n+      [0.01429258425298098],\n+      [0.01201267864744234]\n+      ],\n+     "Rate Distributions":{\n+       "non-synonymous/synonymous rate ratio for *test*":[\n+        [0.9952474740528205, 1]\n+        ]\n+      }'..b' 0.7667128671748024, 0.890841230650352, 0.8320854747642759, 1.723419162497329],\n+      [1, 2, 5, 0.4749999999999517, 0.3333333333333333, 5, 0.2374999999999758, -2.183160128350873, 1, 0.03782959914646881, 1.723419162497329],\n+      [0.843656832841698, 2.408185306598483, 2.938888888888878, 9.886111111111106, 0.2843369743316476, 4.574922684961112, 4.238621782785534, 1.594080406346652, 0.7883087325663475, 0.9345721380406598, 1.723419162497329],\n+      [0.4015666212427145, 2.598433378757286, 0, 0.4749999999999517, 0.1338555404142381, 0, 0.1828024546956531, 0.1060696426461699, 1, 1, 1.723419162497329],\n+      [0.7631315455164901, 2.303416321948652, 4, 8.579166666666659, 0.2598642419466547, 6.13519119941088, 3.924250265172389, 0.9761043336904643, 0.9485561128462242, 0.8823115672560321, 1.723419162497329],\n+      [1, 2, 0, 2, 0.3333333333333333, 0, 1, 0.5802418945783016, 0.6666666666666667, 1, 1.723419162497329],\n+      [0.5108071114874615, 2.57138242847146, 2, 3, 0.1702690371624872, 4.689333452586883, 1.205209935254436, -0.4366182159717286, 0.989584442823033, 0.5260318186931501, 1.723419162497329],\n+      [0.7355430390802056, 2.24582979842974, 0.5, 7.5, 0.2547488097891927, 0.6797698753634438, 3.49464769706217, 1.865065863585222, 0.2612708950448336, 1, 1.723419162497329],\n+      [0.6267060118898431, 2.238010426610814, 2, 2, 0.2199736580517843, 3.214404615308581, 0.9115992408219742, -0.4173100575643724, 0.9651119805840197, 0.5225975649035184, 1.723419162497329],\n+      [0.9101251033652521, 2.317095536064913, 2, 7.158333333333317, 0.303375034455084, 2.290533001213371, 3.425698572354657, 1.350172793073417, 0.6586555929582461, 0.9471075623091124, 1.723419162497329],\n+      [0.673672140559856, 2.489920391149622, 2.158333333333317, 8.13194444444443, 0.226629447539539, 4.126852101032075, 3.54552687644596, 1.976804163754458, 0.836071480785966, 1, 1.723419162497329],\n+      [0.6897615550532064, 2.790263254042777, 2.333333333333333, 8.526388888888887, 0.2304358158933025, 6.094648833588598, 3.276393298181066, 0.3613328345356598, 0.9231255898428308, 0.6686732177677085, 1.723419162497329],\n+      [0.7946586568361008, 2.167975169364766, 1, 6, 0.2715103527844899, 1.405104306225133, 2.818037808360176, 0.8363424597513123, 0.7430921944460164, 0.8718081545299928, 1.723419162497329],\n+      [0.925309922046851, 2.236871623721474, 2.579166666666659, 8.5, 0.3084366406822837, 2.925882077362623, 4.049552410687498, 1.364532301558911, 0.6461765519656628, 0.9254887173196068, 1.723419162497329],\n+      [0.9581686586422306, 2.13880638531327, 2, 5, 0.3193895528807435, 2.322358138625455, 2.415212293435113, 0.7773494920126088, 0.7795378572552829, 0.8920156958059355, 1.723419162497329],\n+      [0.7593283298052359, 2.460727196465021, 3, 8.526388888888887, 0.253391086431764, 4.622736289498208, 3.556429743974461, 1.477112310794914, 0.8989574146760382, 0.8927015041979159, 1.723419162497329],\n+      [0.5112602866741613, 2.217104081344285, 0, 0, 0.1873871000028779, 0, 0, 0, 1, 1, 1.723419162497329],\n+      [1, 1.952467466533022, 2, 4, 0.342663635137335, 2, 2.086372572382543, 0.63035887961715, 0.7821097289668139, 0.8770423554138478, 1.723419162497329],\n+      [0.75154665371034, 2.194207467544889, 0.7374999999999758, 2.895833333333293, 0.2591620486295864, 1.086891717767276, 1.342183608392251, 0.6579931372011264, 0.7050462382636092, 1, 1.723419162497329],\n+      [0.6018431830315369, 2.241218884393843, 1, 2, 0.2148519149742012, 1.661562393982619, 0.9093567672257744, -0.4364612179818503, 0.8845364432183682, 0.5159895622684771, 1.723419162497329],\n+      [1, 2, 0, 0, 0.3333333333333333, 0, 0, 0, 1, 1, 1.723419162497329],\n+      [1.401566621242714, 1.598433378757286, 0, 0, 0.4671888737475713, 0, 0, 0, 1, 1, 1.723419162497329],\n+      [0.5861816684921827, 2.463353001049777, 3, 4.158333333333317, 0.1963715666467496, 5.590266983451943, 1.70370382635879, -1.259842549492376, 0.9887093275905696, 0.2624813117321075, 1.723419162497329]\n+      ]\n+    }\n+  }\n+}\n\\ No newline at end of file\n'