| Previous changeset 5:86a940341a00 (2017-09-28) |
|
Commit message:
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 36681a08c6e44c663169caaefd964781c43d0d29 |
|
modified:
test-data/rnaalifold_input1.fa test-data/rnaduplex_input1.fa test-data/rnaduplex_result1.txt test-data/rnafold_input1.fa test-data/rnafold_input2.fa test-data/rnafold_result1.txt test-data/rnafold_result2.txt test-data/rnafold_result3.txt test-data/rnalfold_input1.fa test-data/rnalfold_result1.txt test-data/rnapaln_input1.fa test-data/rnapaln_result1.txt test-data/rnapdist_input1.fa test-data/rnapdist_result1.txt test-data/rnapkplex_input1.fa test-data/rnapkplex_result1.txt test-data/rnaplex_input1.fa test-data/rnaplex_result1.txt test-data/rnaplfold_input1.fa test-data/rnaplot_input1.fa test-data/rnasubopt_input1.fa test-data/rnasubopt_result1.txt test-data/rnaup_input1.fa test-data/rnaup_result1.txt test-data/sample_3_result.txt |
|
added:
test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_ss.ps test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_dp.ps test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_ss.ps test-data/rnafold_result1_mea.txt test-data/rnafold_result1_pf.txt |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps Wed Dec 20 08:35:14 2017 -0500 |
| [ |
| b'@@ -0,0 +1,370 @@\n+%!PS-Adobe-3.0 EPSF-3.0\n+%%Title: RNA Dot Plot\n+%%Creator: ViennaRNA-2.2.10\n+%%CreationDate: Tue Dec 19 19:42:58 2017\n+%%BoundingBox: 66 211 518 662\n+%%DocumentFonts: Helvetica\n+%%Pages: 1\n+%%EndComments\n+\n+%Options: \n+% \n+%This file contains the square roots of the base pair probabilities in the form\n+% i j sqrt(p(i,j)) ubox\n+\n+%%BeginProlog\n+/DPdict 100 dict def\n+DPdict begin\n+/logscale false def\n+/lpmin 1e-05 log def\n+\n+/box { %size x y box - draws box centered on x,y\n+ 2 index 0.5 mul sub % x -= 0.5\n+ exch 2 index 0.5 mul sub exch % y -= 0.5\n+ 3 -1 roll dup rectfill\n+} bind def\n+\n+/ubox {\n+ logscale {\n+ log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if\n+ } if\n+ 3 1 roll\n+ exch len exch sub 1 add box\n+} bind def\n+\n+/lbox {\n+ 3 1 roll\n+ len exch sub 1 add box\n+} bind def\n+\n+/drawseq {\n+% print sequence along all 4 sides\n+[ [0.7 -0.3 0 ]\n+ [0.7 0.7 len add 0]\n+ [-0.3 len sub -0.4 -90]\n+ [-0.3 len sub 0.7 len add -90]\n+] {\n+ gsave\n+ aload pop rotate translate\n+ 0 1 len 1 sub {\n+ dup 0 moveto\n+ sequence exch 1 getinterval\n+ show\n+ } for\n+ grestore\n+ } forall\n+} bind def\n+\n+/drawgrid{\n+ 0.01 setlinewidth\n+ len log 0.9 sub cvi 10 exch exp % grid spacing\n+ dup 1 gt {\n+ dup dup 20 div dup 2 array astore exch 40 div setdash\n+ } { [0.3 0.7] 0.1 setdash } ifelse\n+ 0 exch len {\n+ dup dup\n+ 0 moveto\n+ len lineto\n+ dup\n+ len exch sub 0 exch moveto\n+ len exch len exch sub lineto\n+ stroke\n+ } for\n+ [] 0 setdash\n+ 0.04 setlinewidth\n+ currentdict /cutpoint known {\n+ cutpoint 1 sub\n+ dup dup -1 moveto len 1 add lineto\n+ len exch sub dup\n+ -1 exch moveto len 1 add exch lineto\n+ stroke\n+ } if\n+ 0.5 neg dup translate\n+} bind def\n+\n+end\n+%%EndProlog\n+DPdict begin\n+%delete next line to get rid of title\n+270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_caro_chrUn_GL343207.trna3_AlaAGC) show\n+\n+/sequence { (\\\n+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\\\n+) } def\n+/len { sequence length } bind def\n+\n+72 216 translate\n+72 6 mul len 1 add div dup scale\n+/Helvetica findfont 0.95 scalefont setfont\n+\n+drawseq\n+0.5 dup translate\n+% draw diagonal\n+0.04 setlinewidth\n+0 len moveto len 0 lineto stroke\n+\n+/min { 2 copy gt { exch } if pop } bind def\n+\n+/utri{ % i j prob utri\n+ gsave\n+ 1 min 2 div\n+ 0.85 mul 0.15 add 0.95 0.33\n+ 3 1 roll % prepare hsb color\n+ sethsbcolor\n+ % now produce the coordinates for lines\n+ exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub\n+ moveto lineto lineto closepath fill\n+ grestore\n+} bind def\n+/uHmotif{ % i j uHmotif\n+ gsave\n+ 1 min 2 div\n+ 0.85 mul 0.15 add 0.95 0.99\n+ 3 1 roll % prepare hsb color\n+ sethsbcolor\n+ % now produce the coordinates for lines\n+ exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub\n+ moveto lineto lineto closepath fill\n+ grestore\n+} bind def\n+/lHmotif{ % i j lHmotif\n+ gsave\n+ 1 min 2 div\n+ 0.85 mul 0.15 add 0.95 0.99\n+ 3 1 roll % prepare hsb color\n+ sethsbcolor\n+ % now produce the coordinates for lines\n+ dup len exch sub dup 4 -1 roll 1 sub dup 3 1 roll dup len exch sub\n+ moveto lineto lineto closepath fill\n+ grestore\n+} bind def\n+/uImotif{ % i j k l uImotif\n+ gsave\n+ 1 min 2 div\n+ 0.85 mul 0.15 add 0.95 0.99\n+ 3 1 roll % prepare hsb color\n+ sethsbcolor\n+ % now produce the coordinates for lines\n+ 1 sub dup 5 1 roll exch len exch sub dup 5 1 roll 3 -1 roll dup\n+ 5 1 roll exch 4 1 roll 3 1 roll exch 1 sub len exch sub dup 3 1 roll\n+ moveto lineto lineto lineto closepath fill\n+ grestore\n+} bind def\n+/lImotif{ % i j k l lImotif\n+ gsave\n+ 1 min 2 div\n+ 0.85 mul 0.15 add 0.95 0.99\n+ 3 1 roll % prepare hsb color\n+ sethsbcolor\n+ % now produce the coordinates for lines\n+ 4 -1 roll 1 sub dup 5 1 roll exch 1 sub len exch sub dup 3 -1 roll exch\n+ 5 -1 roll len exch sub dup 6 -1 roll dup 3 1 roll 7 4 roll\n+ moveto lineto lineto lineto cl'..b'6669769 ubox\n+7 23 0.006395271 ubox\n+7 26 0.010803708 ubox\n+7 45 0.003325342 ubox\n+7 46 0.008388346 ubox\n+7 66 0.889354167 ubox\n+8 18 0.004993356 ubox\n+8 21 0.043576199 ubox\n+8 22 0.009051039 ubox\n+8 23 0.003412982 ubox\n+8 26 0.053349931 ubox\n+8 44 0.006391561 ubox\n+8 45 0.009575801 ubox\n+8 46 0.006511628 ubox\n+8 48 0.044296110 ubox\n+8 66 0.051228716 ubox\n+9 17 0.005076838 ubox\n+9 20 0.044973880 ubox\n+9 47 0.045851242 ubox\n+9 67 0.006907131 ubox\n+10 20 0.031947572 ubox\n+10 25 0.993218795 ubox\n+10 47 0.003684611 ubox\n+10 61 0.005362683 ubox\n+11 18 0.045881626 ubox\n+11 19 0.032788757 ubox\n+11 22 0.010762380 ubox\n+11 24 0.996351171 ubox\n+11 43 0.031784396 ubox\n+11 45 0.044997253 ubox\n+11 46 0.003273388 ubox\n+11 60 0.005393685 ubox\n+12 18 0.028759750 ubox\n+12 19 0.007591504 ubox\n+12 21 0.010602364 ubox\n+12 23 0.996289342 ubox\n+12 42 0.031993047 ubox\n+12 44 0.044989514 ubox\n+12 58 0.005409282 ubox\n+13 18 0.016589428 ubox\n+13 19 0.009128152 ubox\n+13 22 0.996158882 ubox\n+13 41 0.032010508 ubox\n+13 43 0.044839517 ubox\n+13 57 0.005483356 ubox\n+14 20 0.079642667 ubox\n+14 56 0.005446527 ubox\n+15 20 0.129735024 ubox\n+15 55 0.005085787 ubox\n+16 20 0.018529841 ubox\n+16 38 0.051862141 ubox\n+17 21 0.010497970 ubox\n+17 26 0.003797728 ubox\n+17 37 0.052295806 ubox\n+17 39 0.003520191 ubox\n+17 42 0.004660118 ubox\n+17 52 0.004889289 ubox\n+18 25 0.005375323 ubox\n+18 36 0.051745231 ubox\n+18 38 0.003387544 ubox\n+19 25 0.004215070 ubox\n+19 36 0.018363451 ubox\n+19 40 0.005479857 ubox\n+19 50 0.005352275 ubox\n+20 24 0.003956630 ubox\n+20 34 0.049426221 ubox\n+20 35 0.019676299 ubox\n+20 39 0.005488315 ubox\n+20 49 0.005308891 ubox\n+21 33 0.037607150 ubox\n+21 38 0.005407841 ubox\n+22 32 0.023047831 ubox\n+22 33 0.039236028 ubox\n+23 32 0.049874318 ubox\n+23 47 0.036867639 ubox\n+24 31 0.055184372 ubox\n+24 47 0.041474959 ubox\n+25 30 0.055108050 ubox\n+25 41 0.003625640 ubox\n+25 45 0.072422399 ubox\n+25 46 0.047506335 ubox\n+26 36 0.020612775 ubox\n+26 40 0.011634581 ubox\n+26 47 0.044476135 ubox\n+27 35 0.020631543 ubox\n+27 39 0.011645626 ubox\n+27 43 0.992061337 ubox\n+27 45 0.025461226 ubox\n+27 46 0.039850990 ubox\n+28 34 0.019643833 ubox\n+28 42 0.996960401 ubox\n+28 44 0.021374269 ubox\n+28 45 0.024434496 ubox\n+29 41 0.997917003 ubox\n+29 43 0.018395309 ubox\n+29 45 0.003166236 ubox\n+30 36 0.012434123 ubox\n+30 40 0.998065717 ubox\n+30 47 0.007404570 ubox\n+31 35 0.012393915 ubox\n+31 39 0.997764981 ubox\n+31 41 0.005414838 ubox\n+31 43 0.003645699 ubox\n+31 46 0.007622516 ubox\n+32 37 0.068093187 ubox\n+32 39 0.013599795 ubox\n+32 42 0.003678913 ubox\n+32 45 0.007610493 ubox\n+33 37 0.102337630 ubox\n+33 39 0.003720007 ubox\n+33 41 0.003538594 ubox\n+33 44 0.007538047 ubox\n+34 38 0.013851913 ubox\n+36 41 0.007501659 ubox\n+38 48 0.018700348 ubox\n+39 47 0.020533473 ubox\n+40 46 0.020625702 ubox\n+44 68 0.005576608 ubox\n+44 70 0.006111196 ubox\n+45 50 0.003800521 ubox\n+45 62 0.010043051 ubox\n+45 65 0.003484260 ubox\n+45 67 0.009783316 ubox\n+45 68 0.032579696 ubox\n+45 69 0.007408521 ubox\n+46 61 0.010086460 ubox\n+46 65 0.005780351 ubox\n+46 67 0.077112938 ubox\n+46 68 0.006873266 ubox\n+47 60 0.010092967 ubox\n+47 64 0.003785455 ubox\n+47 66 0.084736602 ubox\n+48 59 0.008724857 ubox\n+48 67 0.019275395 ubox\n+49 65 0.998806957 ubox\n+50 57 0.009062054 ubox\n+50 64 0.999848265 ubox\n+51 56 0.007052370 ubox\n+51 62 0.010700667 ubox\n+51 63 0.999834583 ubox\n+52 61 0.014860342 ubox\n+52 62 0.999778783 ubox\n+52 63 0.005533111 ubox\n+53 61 0.998254922 ubox\n+53 62 0.007658167 ubox\n+54 59 0.156536412 ubox\n+55 60 0.324268739 ubox\n+56 60 0.024269416 ubox\n+1 72 0.9500000 lbox\n+2 71 0.9500000 lbox\n+3 70 0.9500000 lbox\n+4 69 0.9500000 lbox\n+5 68 0.9500000 lbox\n+6 67 0.9500000 lbox\n+7 66 0.9500000 lbox\n+10 25 0.9500000 lbox\n+11 24 0.9500000 lbox\n+12 23 0.9500000 lbox\n+13 22 0.9500000 lbox\n+27 43 0.9500000 lbox\n+28 42 0.9500000 lbox\n+29 41 0.9500000 lbox\n+30 40 0.9500000 lbox\n+31 39 0.9500000 lbox\n+49 65 0.9500000 lbox\n+50 64 0.9500000 lbox\n+51 63 0.9500000 lbox\n+52 62 0.9500000 lbox\n+53 61 0.9500000 lbox\n+showpage\n+end\n+%%EOF\n' |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_ss.ps --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_ss.ps Wed Dec 20 08:35:14 2017 -0500 |
| [ |
| @@ -0,0 +1,231 @@ +%!PS-Adobe-3.0 EPSF-3.0 +%%Creator: ViennaRNA-2.2.10 +%%CreationDate: Tue Dec 19 19:42:58 2017 +%%Title: RNA Secondary Structure Plot +%%BoundingBox: 66 210 518 662 +%%DocumentFonts: Helvetica +%%Pages: 1 +%%EndComments + +%Options: +% to switch off outline pairs of sequence comment or +% delete the appropriate line near the end of the file + +%%BeginProlog +/RNAplot 100 dict def +RNAplot begin +/fsize 14 def +/outlinecolor {0.2 setgray} bind def +/paircolor {0.2 setgray} bind def +/seqcolor {0 setgray} bind def +/cshow { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def +/min { 2 copy gt { exch } if pop } bind def +/max { 2 copy lt { exch } if pop } bind def +/arccoords { % i j arccoords + % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j + % onto the stack + dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if + dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup + 4 -2 roll 5 -1 roll {exch} if 4 2 roll + sequence length dup 2 div exch 3 1 roll lt + {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll} + { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if + 4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll + exch add 4 -1 roll dup 5 1 roll sub 1 sub + 5 -1 roll not {4 -2 roll exch 4 2 roll} if + }ifelse + % compute the scalingfactor and prepare (1-sf) and sf*r + 2 mul exch cpr 3 1 roll div dup + 3 -1 roll mul exch 1 exch sub exch + % compute the coordinates + 3 -1 roll 1 sub coor exch get aload pop % get coord for i + 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1 + 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1 + 5 -1 roll 1 sub coor exch get aload pop % get coord for j + % duplicate j coord + dup 3 -1 roll dup 4 1 roll exch 8 2 roll + 6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2 + 6 -1 roll mul 5 -1 roll add exch % calculate x2 + 6 -2 roll % reorder +} bind def +/drawoutline { + gsave outlinecolor newpath + coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence + currentdict /cutpoint known % check if cutpoint is defined + {coor 0 cutpoint getinterval + {aload pop lineto} forall % draw outline of 1st sequence + coor cutpoint 1 add get aload pop + 2 copy moveto 0.8 0 360 arc % draw 5' circle of 2nd sequence + coor cutpoint 1 add coor length cutpoint 1 add sub getinterval + {aload pop lineto} forall} % draw outline of 2nd sequence + {coor {aload pop lineto} forall} % draw outline as a whole + ifelse + stroke grestore +} bind def +/drawpairs { + paircolor + 0.7 setlinewidth + [9 3.01] 9 setdash + newpath + pairs {aload pop + currentdict (cpr) known + { exch dup + coor exch 1 sub get aload pop moveto + exch arccoords curveto + } + { coor exch 1 sub get aload pop moveto + coor exch 1 sub get aload pop lineto + }ifelse + } forall + stroke +} bind def +% draw bases +/drawbases { + [] 0 setdash + seqcolor + 0 + coor { + aload pop moveto + dup sequence exch 1 getinterval cshow + 1 add + } forall + pop +} bind def + +/init { + /Helvetica findfont fsize scalefont setfont + 1 setlinejoin + 1 setlinecap + 0.8 setlinewidth + 72 216 translate + % find the coordinate range + /xmax -1000 def /xmin 10000 def + /ymax -1000 def /ymin 10000 def + coor { + aload pop + dup ymin lt {dup /ymin exch def} if + dup ymax gt {/ymax exch def} {pop} ifelse + dup xmin lt {dup /xmin exch def} if + dup xmax gt {/xmax exch def} {pop} ifelse + } forall + /size {xmax xmin sub ymax ymin sub max} bind def + 72 6 mul size div dup scale + size xmin sub xmax sub 2 div size ymin sub ymax sub 2 div + translate +} bind def +end +%%EndProlog +RNAplot begin +% data start here +/sequence (\ +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\ +) def +/coor [ +[111.04756165 225.82804871] +[110.41094971 210.84155273] +[109.77433014 195.85507202] +[109.13771057 180.86859131] +[108.50109100 165.88211060] +[107.86447144 150.89561462] +[107.22785950 135.90913391] +[90.28739166 133.48460388] +[77.11851501 123.91786957] +[70.32070923 110.05319977] +[55.37474823 111.32528687] +[40.42878342 112.59737396] +[25.48282242 113.86946106] +[17.57515907 127.22043610] +[3.31690264 133.34266663] +[-11.80935574 129.88204956] +[-21.98726082 118.16923523] +[-23.30319977 102.70806122] +[-15.25116920 89.44365692] +[-0.92733771 83.47645569] +[14.16048908 87.10096741] +[24.21073341 98.92350006] +[39.15669632 97.65141296] +[54.10265732 96.37932587] +[69.04862213 95.10723114] +[75.20735168 80.83619690] +[87.46604156 71.28019714] +[84.93103027 56.49596024] +[82.39601898 41.71172333] +[79.86100006 26.92748451] +[77.32598877 12.14324570] +[63.73017883 4.41744947] +[58.32971573 -10.25800610] +[63.67453384 -24.95381927] +[77.24097443 -32.73107910] +[92.62337494 -29.91759682] +[102.55863953 -17.84181786] +[102.35564423 -2.20555139] +[92.11022949 9.60823345] +[94.64524078 24.39247131] +[97.18025208 39.17671204] +[99.71526337 53.96094894] +[102.25028229 68.74518585] +[111.61898041 69.95008087] +[120.45154572 73.97383881] +[127.89853668 80.59681702] +[133.19635010 89.34370422] +[135.74378967 99.51597595] +[135.16680908 110.24712372] +[150.04531860 112.15238953] +[164.92382812 114.05766296] +[179.80232239 115.96292877] +[194.68083191 117.86819458] +[206.04914856 107.13062286] +[221.66270447 106.26418304] +[234.14927673 115.67798615] +[237.61306763 130.92712402] +[230.41859436 144.81141663] +[215.96286011 150.77513123] +[201.07142639 146.00236511] +[192.77557373 132.74670410] +[177.89706421 130.84143066] +[163.01855469 128.93617249] +[148.14004517 127.03089905] +[133.26153564 125.12563324] +[122.21434021 135.27252197] +[122.85095978 150.25900269] +[123.48757935 165.24548340] +[124.12419128 180.23197937] +[124.76081085 195.21846008] +[125.39743042 210.20494080] +[126.03404999 225.19142151] +[129.04023743 244.33856201] +] def +/pairs [ +[1 72] +[2 71] +[3 70] +[4 69] +[5 68] +[6 67] +[7 66] +[10 25] +[11 24] +[12 23] +[13 22] +[27 43] +[28 42] +[29 41] +[30 40] +[31 39] +[49 65] +[50 64] +[51 63] +[52 62] +[53 61] +] def + +init + +% switch off outline pairs or bases by removing these lines +drawoutline +drawpairs +drawbases +% show it +showpage +end +%%EOF |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_dp.ps --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_dp.ps Wed Dec 20 08:35:14 2017 -0500 |
| [ |
| b'@@ -0,0 +1,507 @@\n+%!PS-Adobe-3.0 EPSF-3.0\n+%%Title: RNA Dot Plot\n+%%Creator: ViennaRNA-2.2.10\n+%%CreationDate: Tue Dec 19 19:42:58 2017\n+%%BoundingBox: 66 211 518 662\n+%%DocumentFonts: Helvetica\n+%%Pages: 1\n+%%EndComments\n+\n+%Options: \n+% \n+%This file contains the square roots of the base pair probabilities in the form\n+% i j sqrt(p(i,j)) ubox\n+\n+%%BeginProlog\n+/DPdict 100 dict def\n+DPdict begin\n+/logscale false def\n+/lpmin 1e-05 log def\n+\n+/box { %size x y box - draws box centered on x,y\n+ 2 index 0.5 mul sub % x -= 0.5\n+ exch 2 index 0.5 mul sub exch % y -= 0.5\n+ 3 -1 roll dup rectfill\n+} bind def\n+\n+/ubox {\n+ logscale {\n+ log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if\n+ } if\n+ 3 1 roll\n+ exch len exch sub 1 add box\n+} bind def\n+\n+/lbox {\n+ 3 1 roll\n+ len exch sub 1 add box\n+} bind def\n+\n+/drawseq {\n+% print sequence along all 4 sides\n+[ [0.7 -0.3 0 ]\n+ [0.7 0.7 len add 0]\n+ [-0.3 len sub -0.4 -90]\n+ [-0.3 len sub 0.7 len add -90]\n+] {\n+ gsave\n+ aload pop rotate translate\n+ 0 1 len 1 sub {\n+ dup 0 moveto\n+ sequence exch 1 getinterval\n+ show\n+ } for\n+ grestore\n+ } forall\n+} bind def\n+\n+/drawgrid{\n+ 0.01 setlinewidth\n+ len log 0.9 sub cvi 10 exch exp % grid spacing\n+ dup 1 gt {\n+ dup dup 20 div dup 2 array astore exch 40 div setdash\n+ } { [0.3 0.7] 0.1 setdash } ifelse\n+ 0 exch len {\n+ dup dup\n+ 0 moveto\n+ len lineto\n+ dup\n+ len exch sub 0 exch moveto\n+ len exch len exch sub lineto\n+ stroke\n+ } for\n+ [] 0 setdash\n+ 0.04 setlinewidth\n+ currentdict /cutpoint known {\n+ cutpoint 1 sub\n+ dup dup -1 moveto len 1 add lineto\n+ len exch sub dup\n+ -1 exch moveto len 1 add exch lineto\n+ stroke\n+ } if\n+ 0.5 neg dup translate\n+} bind def\n+\n+end\n+%%EndProlog\n+DPdict begin\n+%delete next line to get rid of title\n+270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_caro_chrUn_GL343590.trna2_AlaAGC) show\n+\n+/sequence { (\\\n+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA\\\n+) } def\n+/len { sequence length } bind def\n+\n+72 216 translate\n+72 6 mul len 1 add div dup scale\n+/Helvetica findfont 0.95 scalefont setfont\n+\n+drawseq\n+0.5 dup translate\n+% draw diagonal\n+0.04 setlinewidth\n+0 len moveto len 0 lineto stroke\n+\n+/min { 2 copy gt { exch } if pop } bind def\n+\n+/utri{ % i j prob utri\n+ gsave\n+ 1 min 2 div\n+ 0.85 mul 0.15 add 0.95 0.33\n+ 3 1 roll % prepare hsb color\n+ sethsbcolor\n+ % now produce the coordinates for lines\n+ exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub\n+ moveto lineto lineto closepath fill\n+ grestore\n+} bind def\n+/uHmotif{ % i j uHmotif\n+ gsave\n+ 1 min 2 div\n+ 0.85 mul 0.15 add 0.95 0.99\n+ 3 1 roll % prepare hsb color\n+ sethsbcolor\n+ % now produce the coordinates for lines\n+ exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub\n+ moveto lineto lineto closepath fill\n+ grestore\n+} bind def\n+/lHmotif{ % i j lHmotif\n+ gsave\n+ 1 min 2 div\n+ 0.85 mul 0.15 add 0.95 0.99\n+ 3 1 roll % prepare hsb color\n+ sethsbcolor\n+ % now produce the coordinates for lines\n+ dup len exch sub dup 4 -1 roll 1 sub dup 3 1 roll dup len exch sub\n+ moveto lineto lineto closepath fill\n+ grestore\n+} bind def\n+/uImotif{ % i j k l uImotif\n+ gsave\n+ 1 min 2 div\n+ 0.85 mul 0.15 add 0.95 0.99\n+ 3 1 roll % prepare hsb color\n+ sethsbcolor\n+ % now produce the coordinates for lines\n+ 1 sub dup 5 1 roll exch len exch sub dup 5 1 roll 3 -1 roll dup\n+ 5 1 roll exch 4 1 roll 3 1 roll exch 1 sub len exch sub dup 3 1 roll\n+ moveto lineto lineto lineto closepath fill\n+ grestore\n+} bind def\n+/lImotif{ % i j k l lImotif\n+ gsave\n+ 1 min 2 div\n+ 0.85 mul 0.15 add 0.95 0.99\n+ 3 1 roll % prepare hsb color\n+ sethsbcolor\n+ % now produce the coordinates for lines\n+ 4 -1 roll 1 sub dup 5 1 roll exch 1 sub len exch sub dup 3 -1 roll exch\n+ 5 -1 roll len exch sub dup 6 -1 roll dup 3 1 roll 7 4 roll\n+ moveto lineto lineto lineto cl'..b'219551670 ubox\n+22 33 0.403084545 ubox\n+22 68 0.003789411 ubox\n+22 69 0.055392027 ubox\n+23 28 0.006024870 ubox\n+23 32 0.500859862 ubox\n+23 33 0.004324443 ubox\n+23 47 0.031904991 ubox\n+23 67 0.003787974 ubox\n+23 68 0.052636256 ubox\n+24 29 0.008474011 ubox\n+24 31 0.549100761 ubox\n+24 47 0.049197557 ubox\n+24 67 0.030536001 ubox\n+25 30 0.548338702 ubox\n+25 41 0.004144135 ubox\n+25 45 0.067140277 ubox\n+25 46 0.053750180 ubox\n+26 36 0.057394616 ubox\n+26 40 0.012772171 ubox\n+26 47 0.064315077 ubox\n+26 50 0.004714852 ubox\n+27 35 0.057448226 ubox\n+27 39 0.013170691 ubox\n+27 43 0.815569764 ubox\n+27 45 0.049009957 ubox\n+27 46 0.063413875 ubox\n+27 49 0.005262423 ubox\n+27 53 0.004564973 ubox\n+28 34 0.054697757 ubox\n+28 42 0.820379890 ubox\n+28 44 0.048191892 ubox\n+28 45 0.035895579 ubox\n+28 46 0.029285776 ubox\n+28 48 0.006599916 ubox\n+28 52 0.004579520 ubox\n+29 41 0.821245880 ubox\n+29 43 0.046763735 ubox\n+29 45 0.057920583 ubox\n+29 46 0.006457134 ubox\n+29 51 0.004606001 ubox\n+30 36 0.024024302 ubox\n+30 40 0.821070294 ubox\n+30 47 0.027558338 ubox\n+30 50 0.004615290 ubox\n+31 35 0.023900118 ubox\n+31 39 0.821259198 ubox\n+31 41 0.031662456 ubox\n+31 43 0.068739658 ubox\n+31 45 0.005088084 ubox\n+31 46 0.028387067 ubox\n+31 49 0.004618779 ubox\n+32 37 0.056070394 ubox\n+32 39 0.007808716 ubox\n+32 41 0.004679327 ubox\n+32 42 0.069668252 ubox\n+32 44 0.005113833 ubox\n+32 45 0.028339924 ubox\n+32 48 0.003694275 ubox\n+33 37 0.084188349 ubox\n+33 39 0.012554387 ubox\n+33 41 0.069738589 ubox\n+33 43 0.004988753 ubox\n+33 44 0.028077519 ubox\n+33 48 0.005052659 ubox\n+34 38 0.015647295 ubox\n+34 40 0.068716940 ubox\n+34 47 0.005883003 ubox\n+35 72 0.003223293 ubox\n+36 41 0.028025736 ubox\n+36 45 0.006071525 ubox\n+37 47 0.004492398 ubox\n+37 67 0.004929165 ubox\n+38 46 0.004623641 ubox\n+38 66 0.005612639 ubox\n+38 73 0.096471321 ubox\n+39 65 0.006372388 ubox\n+39 72 0.134387529 ubox\n+40 64 0.006366003 ubox\n+40 73 0.044296160 ubox\n+41 63 0.006315212 ubox\n+41 71 0.157425382 ubox\n+41 72 0.055795571 ubox\n+42 47 0.003279277 ubox\n+42 70 0.158258676 ubox\n+43 63 0.003504831 ubox\n+43 69 0.159460464 ubox\n+43 71 0.083592343 ubox\n+43 72 0.004963441 ubox\n+44 67 0.003632562 ubox\n+44 68 0.157762054 ubox\n+44 70 0.122775573 ubox\n+45 56 0.003216980 ubox\n+45 62 0.033079448 ubox\n+45 63 0.006333865 ubox\n+45 65 0.005683413 ubox\n+45 67 0.142807045 ubox\n+45 68 0.102004762 ubox\n+45 69 0.139542279 ubox\n+45 70 0.038496405 ubox\n+45 71 0.007227554 ubox\n+45 72 0.051023600 ubox\n+46 55 0.003223253 ubox\n+46 61 0.033233869 ubox\n+46 62 0.005934201 ubox\n+46 65 0.014068389 ubox\n+46 67 0.151344698 ubox\n+46 68 0.117431569 ubox\n+46 69 0.048110592 ubox\n+46 70 0.005932615 ubox\n+46 71 0.051023157 ubox\n+47 60 0.033207628 ubox\n+47 64 0.011567823 ubox\n+47 66 0.169443202 ubox\n+48 59 0.032419774 ubox\n+48 67 0.054982355 ubox\n+48 68 0.015912705 ubox\n+48 70 0.010752649 ubox\n+49 56 0.003800040 ubox\n+49 59 0.006023614 ubox\n+49 63 0.008508712 ubox\n+49 65 0.996813137 ubox\n+49 67 0.013145831 ubox\n+49 69 0.007555919 ubox\n+50 57 0.025044897 ubox\n+50 58 0.008142900 ubox\n+50 64 0.998396751 ubox\n+50 66 0.013239028 ubox\n+51 56 0.028984258 ubox\n+51 62 0.014992485 ubox\n+51 63 0.999154389 ubox\n+51 65 0.013340412 ubox\n+52 56 0.007696861 ubox\n+52 61 0.018442907 ubox\n+52 62 0.999085217 ubox\n+52 63 0.014927477 ubox\n+52 72 0.003975401 ubox\n+53 61 0.997430929 ubox\n+53 62 0.015882748 ubox\n+53 71 0.003986825 ubox\n+54 59 0.163009340 ubox\n+54 70 0.003908232 ubox\n+55 60 0.162646810 ubox\n+56 60 0.056948332 ubox\n+57 68 0.004617988 ubox\n+58 67 0.004981508 ubox\n+59 66 0.005078979 ubox\n+60 65 0.005070973 ubox\n+2 71 0.9500000 lbox\n+3 70 0.9500000 lbox\n+4 69 0.9500000 lbox\n+5 68 0.9500000 lbox\n+6 67 0.9500000 lbox\n+7 66 0.9500000 lbox\n+10 25 0.9500000 lbox\n+11 24 0.9500000 lbox\n+12 23 0.9500000 lbox\n+13 22 0.9500000 lbox\n+27 43 0.9500000 lbox\n+28 42 0.9500000 lbox\n+29 41 0.9500000 lbox\n+30 40 0.9500000 lbox\n+31 39 0.9500000 lbox\n+49 65 0.9500000 lbox\n+50 64 0.9500000 lbox\n+51 63 0.9500000 lbox\n+52 62 0.9500000 lbox\n+53 61 0.9500000 lbox\n+showpage\n+end\n+%%EOF\n' |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_ss.ps --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_ss.ps Wed Dec 20 08:35:14 2017 -0500 |
| [ |
| @@ -0,0 +1,230 @@ +%!PS-Adobe-3.0 EPSF-3.0 +%%Creator: ViennaRNA-2.2.10 +%%CreationDate: Tue Dec 19 19:42:58 2017 +%%Title: RNA Secondary Structure Plot +%%BoundingBox: 66 210 518 662 +%%DocumentFonts: Helvetica +%%Pages: 1 +%%EndComments + +%Options: +% to switch off outline pairs of sequence comment or +% delete the appropriate line near the end of the file + +%%BeginProlog +/RNAplot 100 dict def +RNAplot begin +/fsize 14 def +/outlinecolor {0.2 setgray} bind def +/paircolor {0.2 setgray} bind def +/seqcolor {0 setgray} bind def +/cshow { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def +/min { 2 copy gt { exch } if pop } bind def +/max { 2 copy lt { exch } if pop } bind def +/arccoords { % i j arccoords + % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j + % onto the stack + dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if + dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup + 4 -2 roll 5 -1 roll {exch} if 4 2 roll + sequence length dup 2 div exch 3 1 roll lt + {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll} + { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if + 4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll + exch add 4 -1 roll dup 5 1 roll sub 1 sub + 5 -1 roll not {4 -2 roll exch 4 2 roll} if + }ifelse + % compute the scalingfactor and prepare (1-sf) and sf*r + 2 mul exch cpr 3 1 roll div dup + 3 -1 roll mul exch 1 exch sub exch + % compute the coordinates + 3 -1 roll 1 sub coor exch get aload pop % get coord for i + 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1 + 4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1 + 5 -1 roll 1 sub coor exch get aload pop % get coord for j + % duplicate j coord + dup 3 -1 roll dup 4 1 roll exch 8 2 roll + 6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2 + 6 -1 roll mul 5 -1 roll add exch % calculate x2 + 6 -2 roll % reorder +} bind def +/drawoutline { + gsave outlinecolor newpath + coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence + currentdict /cutpoint known % check if cutpoint is defined + {coor 0 cutpoint getinterval + {aload pop lineto} forall % draw outline of 1st sequence + coor cutpoint 1 add get aload pop + 2 copy moveto 0.8 0 360 arc % draw 5' circle of 2nd sequence + coor cutpoint 1 add coor length cutpoint 1 add sub getinterval + {aload pop lineto} forall} % draw outline of 2nd sequence + {coor {aload pop lineto} forall} % draw outline as a whole + ifelse + stroke grestore +} bind def +/drawpairs { + paircolor + 0.7 setlinewidth + [9 3.01] 9 setdash + newpath + pairs {aload pop + currentdict (cpr) known + { exch dup + coor exch 1 sub get aload pop moveto + exch arccoords curveto + } + { coor exch 1 sub get aload pop moveto + coor exch 1 sub get aload pop lineto + }ifelse + } forall + stroke +} bind def +% draw bases +/drawbases { + [] 0 setdash + seqcolor + 0 + coor { + aload pop moveto + dup sequence exch 1 getinterval cshow + 1 add + } forall + pop +} bind def + +/init { + /Helvetica findfont fsize scalefont setfont + 1 setlinejoin + 1 setlinecap + 0.8 setlinewidth + 72 216 translate + % find the coordinate range + /xmax -1000 def /xmin 10000 def + /ymax -1000 def /ymin 10000 def + coor { + aload pop + dup ymin lt {dup /ymin exch def} if + dup ymax gt {/ymax exch def} {pop} ifelse + dup xmin lt {dup /xmin exch def} if + dup xmax gt {/xmax exch def} {pop} ifelse + } forall + /size {xmax xmin sub ymax ymin sub max} bind def + 72 6 mul size div dup scale + size xmin sub xmax sub 2 div size ymin sub ymax sub 2 div + translate +} bind def +end +%%EndProlog +RNAplot begin +% data start here +/sequence (\ +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA\ +) def +/coor [ +[102.34599304 225.12051392] +[110.41094971 210.84155273] +[109.77433014 195.85507202] +[109.13771057 180.86859131] +[108.50109100 165.88211060] +[107.86447144 150.89561462] +[107.22785950 135.90913391] +[90.28739166 133.48460388] +[77.11851501 123.91786957] +[70.32070923 110.05319977] +[55.37474823 111.32528687] +[40.42878342 112.59737396] +[25.48282242 113.86946106] +[17.57515907 127.22043610] +[3.31690264 133.34266663] +[-11.80935574 129.88204956] +[-21.98726082 118.16923523] +[-23.30319977 102.70806122] +[-15.25116920 89.44365692] +[-0.92733771 83.47645569] +[14.16048908 87.10096741] +[24.21073341 98.92350006] +[39.15669632 97.65141296] +[54.10265732 96.37932587] +[69.04862213 95.10723114] +[75.20735168 80.83619690] +[87.46604156 71.28019714] +[84.93103027 56.49596024] +[82.39601898 41.71172333] +[79.86100006 26.92748451] +[77.32598877 12.14324570] +[63.73017883 4.41744947] +[58.32971573 -10.25800610] +[63.67453384 -24.95381927] +[77.24097443 -32.73107910] +[92.62337494 -29.91759682] +[102.55863953 -17.84181786] +[102.35564423 -2.20555139] +[92.11022949 9.60823345] +[94.64524078 24.39247131] +[97.18025208 39.17671204] +[99.71526337 53.96094894] +[102.25028229 68.74518585] +[111.61898041 69.95008087] +[120.45154572 73.97383881] +[127.89853668 80.59681702] +[133.19635010 89.34370422] +[135.74378967 99.51597595] +[135.16680908 110.24712372] +[150.04531860 112.15238953] +[164.92382812 114.05766296] +[179.80232239 115.96292877] +[194.68083191 117.86819458] +[206.04914856 107.13062286] +[221.66270447 106.26418304] +[234.14927673 115.67798615] +[237.61306763 130.92712402] +[230.41859436 144.81141663] +[215.96286011 150.77513123] +[201.07142639 146.00236511] +[192.77557373 132.74670410] +[177.89706421 130.84143066] +[163.01855469 128.93617249] +[148.14004517 127.03089905] +[133.26153564 125.12563324] +[122.21434021 135.27252197] +[122.85095978 150.25900269] +[123.48757935 165.24548340] +[124.12419128 180.23197937] +[124.76081085 195.21846008] +[125.39743042 210.20494080] +[134.64427185 223.74850464] +[127.29573059 238.40902710] +] def +/pairs [ +[2 71] +[3 70] +[4 69] +[5 68] +[6 67] +[7 66] +[10 25] +[11 24] +[12 23] +[13 22] +[27 43] +[28 42] +[29 41] +[30 40] +[31 39] +[49 65] +[50 64] +[51 63] +[52 62] +[53 61] +] def + +init + +% switch off outline pairs or bases by removing these lines +drawoutline +drawpairs +drawbases +% show it +showpage +end +%%EOF |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnaalifold_input1.fa --- a/test-data/rnaalifold_input1.fa Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnaalifold_input1.fa Wed Dec 20 08:35:14 2017 -0500 |
| b |
| @@ -1,4 +1,4 @@ ->Anolis_carolinensis_chrUn_GL34 +>Anolis_caro_chrUn_GL34 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA ->Anolis_carolinensis_chrUn_GL35 +>Anolis_caro_chrUn_GL35 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnaduplex_input1.fa --- a/test-data/rnaduplex_input1.fa Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnaduplex_input1.fa Wed Dec 20 08:35:14 2017 -0500 |
| b |
| @@ -1,4 +1,4 @@ ->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA ->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnaduplex_result1.txt --- a/test-data/rnaduplex_result1.txt Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnaduplex_result1.txt Wed Dec 20 08:35:14 2017 -0500 |
| b |
| @@ -1,3 +1,3 @@ ->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC ->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC .((((((..((......((((...((((..(((.((((((.......((((((..(..((((...(((((((.&)))))))..........))))..)..))))))..))))))..)))..)))).......)))).)))))))). 1,73 : 1,72 (-40.70) |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnafold_input1.fa --- a/test-data/rnafold_input1.fa Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnafold_input1.fa Wed Dec 20 08:35:14 2017 -0500 |
| b |
| @@ -1,4 +1,4 @@ ->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_caro_chrUn_GL343590.trna2_AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA ->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +>Anolis_caro_chrUn_GL343207.trna3_AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnafold_input2.fa --- a/test-data/rnafold_input2.fa Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnafold_input2.fa Wed Dec 20 08:35:14 2017 -0500 |
| b |
| @@ -1,4 +1,4 @@ ->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA ->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnafold_result1.txt --- a/test-data/rnafold_result1.txt Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnafold_result1.txt Wed Dec 20 08:35:14 2017 -0500 |
| [ |
| @@ -1,14 +1,6 @@ ->Anolis_carolinensis_chrUn_GL343590.trna2-A +>Anolis_caro_chrUn_GL343590.trna2_AlaAGC UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA .((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) -,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), [-23.20] -.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 d=9.72} -.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 MEA=58.88} - frequency of mfe structure in ensemble 0.142309; ensemble diversity 14.51 ->Anolis_carolinensis_chrUn_GL343207.trna3-A +>Anolis_caro_chrUn_GL343207.trna3_AlaAGC GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA (((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60) -(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). [-29.88] -(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-29.60 d=0.64} -(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-29.60 MEA=71.81} - frequency of mfe structure in ensemble 0.63265; ensemble diversity 1.15 |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnafold_result1_mea.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_result1_mea.txt Wed Dec 20 08:35:14 2017 -0500 |
| [ |
| @@ -0,0 +1,14 @@ +>Anolis_caro_chrUn_GL343590.trna2_AlaAGC +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) +,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), [-23.20] +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 d=9.72} +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 MEA=58.88} + frequency of mfe structure in ensemble 0.142309; ensemble diversity 14.51 +>Anolis_caro_chrUn_GL343207.trna3_AlaAGC +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60) +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). [-29.88] +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-29.60 d=0.64} +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-29.60 MEA=71.81} + frequency of mfe structure in ensemble 0.63265; ensemble diversity 1.15 |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnafold_result1_pf.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/rnafold_result1_pf.txt Wed Dec 20 08:35:14 2017 -0500 |
| [ |
| @@ -0,0 +1,12 @@ +>Anolis_caro_chrUn_GL343590.trna2_AlaAGC +UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) +,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), [-23.20] +.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 d=9.72} + frequency of mfe structure in ensemble 0.142309; ensemble diversity 14.51 +>Anolis_caro_chrUn_GL343207.trna3_AlaAGC +GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60) +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). [-29.88] +(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-29.60 d=0.64} + frequency of mfe structure in ensemble 0.63265; ensemble diversity 1.15 |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnafold_result2.txt --- a/test-data/rnafold_result2.txt Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnafold_result2.txt Wed Dec 20 08:35:14 2017 -0500 |
| [ |
| @@ -1,14 +1,6 @@ ->Anolis_carolinensis_chrUn_GL343590.trna2-A +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA ..(((.....((((....((..(((....)))..))...)))).....(((((.......)))))....))). ( -3.37) -.{((,..,..{(({.,{,.{,.(((....)))},.}},.}}}},,..,(((((.......)))))..,,})). [ -7.81] -...........((...(.....(((....)))....)...))......(((((.......)))))........ { 2.85 d=11.83} -.((........(((..(.....(((....)))....)..)))......(((((.......))))).....)). { 1.96 MEA=51.92} - frequency of mfe structure in ensemble 0.00162209; ensemble diversity 17.27 ->Anolis_carolinensis_chrUn_GL343207.trna3-A +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA (((((..((.(((.....((..(((....)))..))......))).))(((((.......)))))..))))). ( -5.02) -(((((..,..{({...{,.{.,{((....))),..},,..,.}},.,,(((((.......))))).,))))). [ -9.30] -(((((.................(((....)))................(((((.......)))))..))))). { -4.42 d=10.17} -(((((......((.........(((....)))..........))....(((((.......)))))..))))). { -2.50 MEA=54.73} - frequency of mfe structure in ensemble 0.00205781; ensemble diversity 15.91 |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnafold_result3.txt --- a/test-data/rnafold_result3.txt Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnafold_result3.txt Wed Dec 20 08:35:14 2017 -0500 |
| [ |
| @@ -1,7 +1,3 @@ >Sequence UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA .((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00) -,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), [-23.20] -.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 d=9.72} -.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 MEA=58.88} - frequency of mfe structure in ensemble 0.142309; ensemble diversity 14.51 |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnalfold_input1.fa --- a/test-data/rnalfold_input1.fa Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnalfold_input1.fa Wed Dec 20 08:35:14 2017 -0500 |
| b |
| @@ -1,4 +1,4 @@ ->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA ->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnalfold_result1.txt --- a/test-data/rnalfold_result1.txt Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnalfold_result1.txt Wed Dec 20 08:35:14 2017 -0500 |
| b |
| @@ -1,4 +1,4 @@ ->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 .((((....)))). ( -0.10) 56 .(((..((((....)))).))). ( -3.40) 51 .(((((.......))))). ( -7.70) 48 @@ -13,7 +13,7 @@ .((((((..((((........)))).(((((.......))))).....(((((.......))))))))))). (-22.00) 1 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA (-22.00) ->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 .(((..((((....)))).))). ( -3.40) 51 .(((((.......))))). ( -9.20) 48 .((((..(((((.......)))))..)))). (-11.80) 42 |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnapaln_input1.fa --- a/test-data/rnapaln_input1.fa Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnapaln_input1.fa Wed Dec 20 08:35:14 2017 -0500 |
| b |
| @@ -1,4 +1,4 @@ ->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA ->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnapaln_result1.txt --- a/test-data/rnapaln_result1.txt Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnapaln_result1.txt Wed Dec 20 08:35:14 2017 -0500 |
| b |
| @@ -1,5 +1,5 @@ ->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 ->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 68.8844 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA ,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnapdist_input1.fa --- a/test-data/rnapdist_input1.fa Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnapdist_input1.fa Wed Dec 20 08:35:14 2017 -0500 |
| b |
| @@ -1,4 +1,4 @@ ->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA ->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnapdist_result1.txt --- a/test-data/rnapdist_result1.txt Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnapdist_result1.txt Wed Dec 20 08:35:14 2017 -0500 |
| b |
| @@ -1,3 +1,3 @@ ->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 ->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 8.66253 |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnapkplex_input1.fa --- a/test-data/rnapkplex_input1.fa Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnapkplex_input1.fa Wed Dec 20 08:35:14 2017 -0500 |
| b |
| @@ -1,4 +1,4 @@ ->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA ->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnapkplex_result1.txt --- a/test-data/rnapkplex_result1.txt Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnapkplex_result1.txt Wed Dec 20 08:35:14 2017 -0500 |
| [ |
| @@ -1,6 +1,6 @@ ->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA .((((((..((((........)))).(((((.......))))).[[[.(((((]]]....))))))))))).. (-31.90) ->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA (((((((..((((..[[[.[[)))).(((((.]].]]]))))).....(((((.......)))))))))))). (-38.54) |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnaplex_input1.fa --- a/test-data/rnaplex_input1.fa Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnaplex_input1.fa Wed Dec 20 08:35:14 2017 -0500 |
| b |
| @@ -1,4 +1,4 @@ ->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA ->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnaplex_result1.txt --- a/test-data/rnaplex_result1.txt Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnaplex_result1.txt Wed Dec 20 08:35:14 2017 -0500 |
| b |
| @@ -1,4 +1,4 @@ ->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 ->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 .((((((..((......((((...((((..(((.((((((.......((((((..(..((((...(((((((.&)))))))..........))))..)..))))))..))))))..)))..)))).......)))).)))))))). 1,73 : 1,72 (-40.70) i:72,j:1 <-41.26> |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnaplfold_input1.fa --- a/test-data/rnaplfold_input1.fa Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnaplfold_input1.fa Wed Dec 20 08:35:14 2017 -0500 |
| b |
| @@ -1,4 +1,4 @@ ->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_caro_chrUn_GL343590.trna2-A (218800-218872) Ala (AGC) 73 bp Sc: 49.55 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA ->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +>Anolis_caro_chrUn_GL343207.trna3-A (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnaplot_input1.fa --- a/test-data/rnaplot_input1.fa Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnaplot_input1.fa Wed Dec 20 08:35:14 2017 -0500 |
| b |
| @@ -1,4 +1,4 @@ ->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA ->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnasubopt_input1.fa --- a/test-data/rnasubopt_input1.fa Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnasubopt_input1.fa Wed Dec 20 08:35:14 2017 -0500 |
| b |
| @@ -1,4 +1,4 @@ ->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA ->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnasubopt_result1.txt --- a/test-data/rnasubopt_result1.txt Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnasubopt_result1.txt Wed Dec 20 08:35:14 2017 -0500 |
| [ |
| @@ -1,7 +1,7 @@ ->Anolis_carolinensis_chrUn_GL343590.trna2-A [0] +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC [0] UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA -22.00 0.00 (((((((..((((........)))).(((((.......))))).....(((((.......))))))))).))) -22.00 .((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. -22.00 ->Anolis_carolinensis_chrUn_GL343207.trna3-A [0] +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC [0] GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA -29.60 0.00 (((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). -29.60 |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnaup_input1.fa --- a/test-data/rnaup_input1.fa Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnaup_input1.fa Wed Dec 20 08:35:14 2017 -0500 |
| b |
| @@ -1,4 +1,4 @@ ->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872) Ala (AGC) 73 bp Sc: 49.55 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA ->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698) Ala (AGC) 73 bp Sc: 56.15 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/rnaup_result1.txt --- a/test-data/rnaup_result1.txt Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/rnaup_result1.txt Wed Dec 20 08:35:14 2017 -0500 |
| b |
| @@ -1,6 +1,6 @@ ->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC +>Anolis_caro_chrUn_GL343590.trna2-AlaAGC 55, 58 (0.019) for u= 4 -RNAup output in file: Anolis_carolinensis_chrUn_GL343590.trna2-A_u1.out ->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC +RNAup output in file: Anolis_caro_chrUn_GL343590.trna2-AlaAGC_u1.out +>Anolis_caro_chrUn_GL343207.trna3-AlaAGC 16, 19 (0.004) for u= 4 -RNAup output in file: Anolis_carolinensis_chrUn_GL343207.trna3-A_u1.out +RNAup output in file: Anolis_caro_chrUn_GL343207.trna3-AlaAGC_u1.out |
| b |
| diff -r 86a940341a00 -r 271fdfd36786 test-data/sample_3_result.txt --- a/test-data/sample_3_result.txt Thu Sep 28 16:24:56 2017 -0400 +++ b/test-data/sample_3_result.txt Wed Dec 20 08:35:14 2017 -0500 |
| [ |
| @@ -1,21 +1,9 @@ >SECIS_1 AUUUUAUCCAUGAAAGUGUUUCCUCUAAACCUAUGUGGAGGAACACCUGAUGUCCAGGAAAAU .((((...(((.(..(((.((((((((........))))))))))).).))).....)))).. (-27.97) -.((((...(((.{..(((.((((((((........))))))))))).}.))).....)))}.. [-29.13] -..(((...(((....(((.((((((((........)))))))))))...))).....)))... {-26.59 d=5.82} -.((((...(((.(..(((.((((((((........))))))))))).).))).....)))).. {-27.97 MEA=54.87} - frequency of mfe structure in ensemble 0.151171; ensemble diversity 8.50 >6S_1 GAAACCCUAAUGUAUUCGAUAUAGUUCCUGAUAUUUUUGAACCGAACAAUUUUUUAUACCUAGGGAGCUUGGAGUUCCGGCGCGGCGCACAUGCCUUCACACGAGGAAGUGCAAACCGUUAGACAGAGCACCCACCUGCUUUAAUUGAGAGCGGGUUCAAAGGAAGGGAAUCCUAAACGGUACGAUUGGGGUUUCU (((((((...(((((.((.....((((((....((((((((((...................(((.((((.....((.((((.(..((((.(.((((.....))))).))))...))))).))..)))).)))....(((((.....))))).))))))))))..))))))......)))))))....))))))). (-110.38) -(((((((,,{(((((,((.....{(((((....(((((((((({{{....,},.........(((.((((.....((.((((.(..((((.{.((((.....)))),.))))...))))).))}.)))).)))....(((((.....))))).))))))))))..))))),......))))))).}.,))))))). [-115.12] -(((((((..((((((.((......(((((....((((((((((...................(((.((((.....((.((((.(..((((...((((.....))))..))))...))))).))..)))).)))....(((((.....))))).))))))))))..))))).......))))))).)..))))))). {-109.37 d=10.73} -(((((((..((((((.((......(((((....((((((((((...................(((.((((.....((.((((.(..((((...((((.....))))..))))...))))).))..)))).)))....(((((.....))))).))))))))))..))))).......))))))).)..))))))). {-109.37 MEA=177.59} - frequency of mfe structure in ensemble 0.000456946; ensemble diversity 17.02 >6S_2 UUGUCCCUGCCGUGCUCGUGACUUGGCCAUACAUUCUCUGAACCUAUGUCUUACGGCAUAUGGGUUGCGGGAGUGUAGAGCUGGAGUGAUCGUCUACUCGUAGACGAACCCGAUGCUCUUCGGAUCGCGACCACCUUGAACCUCAGGGUUCGAGAUGCCGGCCUUGACGGCACAGGCGGGGCAUC .((.(((((((((((.(((.(...((((...((.((((.((((((..(((....))).....((((((((...((.(((((.((.((..((((((......))))))))))...))))).))..)))))))).............))))))))))))..)))).).))))))).))))))))).. (-129.27) -.((,(((((((((((.(((.{...((((...,,.((((.((((((..(((....))).....((((((((...{(.(((((.((.((..((((((,....,))))))))))...))))).)}..)))))))).....,,...,,.)))))))))),}..)))).}.))))))).))))))))).. [-132.48] -.((.(((((((((((.(((.(...((((......((((.((((((..(((....))).....((((((((...((.(((((.((.((..((((((......))))))))))...))))).))..)))))))).............))))))))))....)))).).))))))).))))))))).. {-129.23 d=10.34} -.((.(((((((((((.(((.(...((((...(..((((.((((((..(((....))).....((((((((...((.(((((.((.((..((((((......))))))))))...))))).))..)))))))).............)))))))))).)..)))).).))))))).))))))))).. {-128.23 MEA=168.16} - frequency of mfe structure in ensemble 0.00547171; ensemble diversity 14.91 |