| Previous changeset 1:83b8e36e9cbe (2019-09-06) Next changeset 3:d0a568e1904b (2021-09-28) |
|
Commit message:
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/samtools/samtools_markdup commit e33502c1fc025859ccbcd2a273f837fac9d322e0" |
|
modified:
macros.xml samtools_markdup.xml |
|
added:
test-data/7_two_read_mapped.sam |
| b |
| diff -r 83b8e36e9cbe -r a312a0fdaf31 macros.xml --- a/macros.xml Fri Sep 06 06:35:26 2019 -0400 +++ b/macros.xml Thu Apr 22 12:58:55 2021 +0000 |
| b |
| @@ -77,18 +77,18 @@ <param name="seed" type="integer" optional="True" label="Seed for random number generator" help="If empty a random seed is used." /> </xml> <xml name="flag_options"> - <option value="1">read is paired</option> - <option value="2">read is mapped in a proper pair</option> - <option value="4">read is unmapped</option> - <option value="8">mate is unmapped</option> - <option value="16">read reverse strand</option> - <option value="32">mate reverse strand</option> - <option value="64">read is the first in a pair</option> - <option value="128">read is the second in a pair</option> - <option value="256">alignment or read is not primary</option> - <option value="512">read fails platform/vendor quality checks</option> - <option value="1024">read is a PCR or optical duplicate</option> - <option value="2048">supplementary alignment</option> + <option value="1">Read is paired</option> + <option value="2">Read is mapped in a proper pair</option> + <option value="4">Read is unmapped</option> + <option value="8">Mate is unmapped</option> + <option value="16">Read is mapped to the reverse strand of the reference</option> + <option value="32">Mate is mapped to the reverse strand of the reference</option> + <option value="64">Read is the first in a pair</option> + <option value="128">Read is the second in a pair</option> + <option value="256">Alignment of the read is not primary</option> + <option value="512">Read fails platform/vendor quality checks</option> + <option value="1024">Read is a PCR or optical duplicate</option> + <option value="2048">Alignment is supplementary</option> </xml> <!-- region specification macros and tokens for tools that allow the specification |
| b |
| diff -r 83b8e36e9cbe -r a312a0fdaf31 samtools_markdup.xml --- a/samtools_markdup.xml Fri Sep 06 06:35:26 2019 -0400 +++ b/samtools_markdup.xml Thu Apr 22 12:58:55 2021 +0000 |
| [ |
| @@ -1,4 +1,4 @@ -<tool id="samtools_markdup" name="Samtools markdup" version="@TOOL_VERSION@+galaxy2"> +<tool id="samtools_markdup" name="Samtools markdup" version="@TOOL_VERSION@+galaxy3"> <description>marks duplicate alignments</description> <macros> <import>macros.xml</import> @@ -31,7 +31,7 @@ coordsort.sam '$output' #if $stats - 2> '$stats_output' + 2> >(tee -a '$stats_output' >&2) #end if ]]></command> <inputs> @@ -44,7 +44,7 @@ <outputs> <!-- output bam, if input was name sorted then restore this sorting order --> <data name="output" format="bam"/> - <data name="stats_output" format="txt"> + <data name="stats_output" format="txt" label="${tool.name} on ${on_string}: statistics"> <filter>stats</filter> </data> </outputs> @@ -81,6 +81,20 @@ <output name="output" file="5_markdup.expected.bam" /> <output name="stats_output" file="stats.txt" /> </test> + <!-- check that stderr is not swallowed w test data from fixmate --> + <test expect_num_outputs="2" expect_exit_code="1" expect_failure="true"> + <param name="bamfile" value="7_two_read_mapped.sam" /> + <param name="stats" value="true"/> + <!-- for some reason this is not possible at the moment + <output name="stats_output"> + <assert_contents> + <has_line line="[markdup] error: no MC tag. Please run samtools fixmate on file first."/> + </assert_contents> + </output> --> + <assert_stderr> + <has_line line="[markdup] error: no MC tag. Please run samtools fixmate on file first."/> + </assert_stderr> + </test> </tests> <help> Mark duplicate alignments from a coordinate sorted file that has been run through fixmate with the -m option. This program relies on the MC and ms tags that fixmate provides. |
| b |
| diff -r 83b8e36e9cbe -r a312a0fdaf31 test-data/7_two_read_mapped.sam --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/7_two_read_mapped.sam Thu Apr 22 12:58:55 2021 +0000 |
| b |
| @@ -0,0 +1,22 @@ +@HD VN:1.4 SO:queryname +@SQ SN:ref1 LN:45 +@SQ SN:ref2 LN:40 +of1 99 ref1 10 30 23M = 8 2 AAGTCGGCAGCGTCAGATGTGTA ??????????????????????? +of1 147 ref1 8 30 23M = 10 -2 CTGTCTCTTATACACATCTCCTT ??????????????????????? +r001 83 ref1 37 30 9M = 7 -39 CAGCGCCAT * +r001 163 ref1 7 30 8M4I4M1D3M = 37 39 TTAGATAAAGAGGATACTG * XX:B:S,12561,2,20,112 YY:i:100 +r002 0 ref1 9 30 1S2I6M1P1I1P1I4M2I * 0 0 AAAAGATAAGGGATAAA * XA:Z:abc XB:i:-10 +r003 0 ref1 9 30 5H6M * 0 0 AGCTAA * +r003 16 ref1 29 30 6H5M * 0 0 TAGGC * +r004 0 ref1 16 30 6M14N1I5M * 0 0 ATAGCTCTCAGC * +r007 8 ref1 9 30 5H6M * 0 0 AGCTAA * +r007 4 ref1 9 30 * * 0 0 GGGGGG * +r008 12 ref1 9 30 5H6M * 0 0 AGCTAA * +r008 4 ref1 9 30 * * 0 0 GGGGGG * +uu1 4 * 0 30 * * 0 0 TAATTGGGTCTTCAGAGCACCTA ??????????????????????? +x1 0 ref2 1 30 20M * 0 0 AGGTTTTATAAAACAAATAA * +x2 0 ref2 2 30 21M * 0 0 GGTTTTATAAAACAAATAATT ????????????????????? +x3 0 ref2 6 30 9M4I13M * 0 0 TTATAAAACAAATAATTAAGTCTACA ?????????????????????????? +x4 0 ref2 10 30 25M * 0 0 CAAATAATTAAGTCTACAGAGCAAC ????????????????????????? +x5 0 ref2 12 30 24M * 0 0 AATAATTAAGTCTACAGAGCAACT ???????????????????????? +x6 0 ref2 14 30 23M * 0 0 TAATTAAGTCTACAGAGCAACTA ??????????????????????? |