| Previous changeset 105:b3b5ee557170 (2014-07-07) Next changeset 107:ee2b105d772a (2014-07-07) |
|
Commit message:
add new test files |
|
added:
test-data/blast xml example3b.html test-data/blast xml example4b.html |
| b |
| diff -r b3b5ee557170 -r ed71448ee154 test-data/blast xml example3b.html --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/blast xml example3b.html Mon Jul 07 11:50:50 2014 +0200 |
| b |
| b'@@ -0,0 +1,3509 @@\n+<!DOCTYPE html>\n+<html>\n+ <head>\n+ <meta charset="UTF-8">\n+ <meta name=generator content="blast2html; see https://github.com/thehyve/blast2html/">\n+ \n+ <title>Blast output</title>\n+ \n+ <style>\n+ body {\n+ color: #333333;\n+ font-family: Arial,Sans-Serif;\n+ }\n+\n+ :link {\n+ color: #336699;\n+ }\n+\n+ .right {\n+ float: right;\n+ }\n+\n+ /* Galaxy with html sanitization enabled strips the header of this html page. If so, show the user a warning.*/\n+ #strip_html_warning {\n+ display: none;\n+ }\n+ \n+ #content {\n+ margin: 0 2em;\n+ padding: 0.5em;\n+ border: 1px solid #888888;\n+ background-color: #d3dff5;\n+ }\n+\n+ h1, h2, h3, h4, h5, h6 {\n+ color: #2A6979;\n+ font-family: arial,verdana,sans-serif;\n+ letter-spacing: -1px;\n+ margin: 1.2em 0 0.3em;\n+ }\n+\n+ h1 {\n+ border-bottom: 1px solid #CCCCCC;\n+ font-size: 150%;\n+ padding-bottom: 0.1em;\n+ }\n+\n+ h2 {\n+ font-size: 120%;\n+ font-weight: bold;\n+ }\n+\n+ h4.darkHeader {\n+ color: #4D4D4D;\n+ letter-spacing: 0;\n+ font-weight: bold;\n+ }\n+\n+ #nodata {\n+ font-weight: bold;\n+ }\n+\n+ .index {\n+ margin-bottom: 3em;\n+ }\n+ .index div.indexentry {\n+ margin: 1.2em 1.6em;\n+ font-weight: bold;\n+ font-size: 100%;\n+ }\n+ \n+ .headerdata {\n+ font-size: 90%;\n+ }\n+ .headerdata .param {\n+ font-weight: bold;\n+ text-align: right;\n+ padding: 0 1em;\n+ }\n+\n+ .grey {\n+ background-color: #eeeeee;\n+ border: 1px solid #cccccc;\n+ padding: 1em;\n+ }\n+\n+ .white {\n+ background-color: white;\n+ border: 1px solid #cccccc;\n+ padding: 1.5em 2%;\n+ }\n+\n+ .graphicrow {\n+ clear: left;\n+ width: 100%;\n+ }\n+\n+ .graphicitem {\n+ float: left;\n+ }\n+\n+\n+ \n+ .graphics .grey {\n+ text-align: center;\n+ }\n+\n+ .graphic {\n+ background-color: white;\n+ border: 2px solid black;\n+ padding: 1.5em;\n+ margin: auto;\n+ }\n+\n+ .centered, .defline, div.legend, div.tablewrapper {\n+ margin-left: auto;\n+ margin-right: auto;\n+ }\n+\n+ .defline {\n+ background-color: white;\n+ border: 1px solid black;\n+ margin: .5em auto;\n+ padding-left: .2em;\n+ padding-right: .2em;\n+ max-width: 50em;\n+ text-align: left;\n+ height: 2.8em;\n+ overflow: hidden;\n+ }\n+\n+ div.legend {\n+ max-width: 40em;\n+ }\n+ div.legend div {\n+ width: 100%;\n+ color: white;\n+ font-weight: bold;\n+ border-spacing: 0;\n+ }\n+ div.legend div .graphicitem {\n+ width: 20%;\n+ padding: 0;\n+ margin: 0;\n+ border: none;\n+ }\n+\n+ div.tablewrapper {\n+ width: 50%;\n+ min-width: 60em;\n+ }\n+\n+ /* For small widths we give the graphic 100% */\n+ @media (max-width: 72.5em) {\n+ div.tablewrapper {\n+ width: 100%;\n+ min-width: 0px;\n+ }\n+ }\n+\n+ .scale {\n+ width: 100%;\n+ margin: .5em 0;\n+ font-weight: bold;\n+ }\n+ .scale div {\n+ color: red;\n+ text-align: left;\n+ }\n+ .scale .graphicrow {\n+ margin: .5em 0 .5em 0;\n+ color: white;\n+ }\n+ .scale .graphicitem {\n+ position: relative;\n+ }\n+ .scale .graphicitem div {\n+ margin: 0 1px;\n+ padding: 0 2px;\n+ text-align: right;\n+ background-color: red;\n+ color: white;\n+ }\n+ .scale .graphicitem:first-child div {\n+ margin-left: 0px;\n+ }\n+ .scale .graphicitem:last-child div {\n+ margin-right: 0px;\n+ }\n+ .scale .graphicitem .lastlabel {\n+ position: absolute;\n+ top: 0px;\n+ left: 100%;\n+ background-color: transparent;\n+ color: red;\n+ }\n+\n+ a.matchresult {\n+ display: block;\n'..b'37607180000">\n+ <div class="matchrow graphicrow">\n+ <div class="matchitem graphicitem"\n+ style="background-color: green; width: 100%"></div>\n+ </div>\n+ </a>\n+\n+ </div>\n+ </div>\n+ </div>\n+ </section>\n+\n+\n+\n+ <section class=descriptions>\n+ <h2>Descriptions</h2>\n+\n+ <div class=grey><div class=white>\n+ <h4 class=darkHeader>Sequences producing significant alignments:</h4>\n+\n+ <table class=descriptiontable>\n+ <col/><col/><col/><col/><col/><col/><col/>\n+ <tr>\n+ <th>Description</th>\n+ <th>Max score</th>\n+ <th>Total score</th>\n+ <th>Query cover</th>\n+ <th>E value</th>\n+ <th>Ident</th>\n+ <th>Accession</th>\n+ </tr>\n+ <tr>\n+ <td><div><a href="#hit56-1"\n+ title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"\n+ id="description56-1">\n+ EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000\n+ </a></div></td>\n+ <td>89.7</td>\n+ <td>89.7</td>\n+ <td>100%</td>\n+ <td>6.629e-23</td>\n+ <td>86%</td>\n+ <td><a href="http://example.com/example-genebank?id=Subject_8">Subject_8</a></td>\n+ </tr>\n+ </table>\n+\n+ </div></div>\n+ </section>\n+\n+\n+\n+ <section class=alignments>\n+ <h2>Alignments</h2>\n+\n+ <div class=grey><div class=white>\n+ <div class=alignment id=hit56-1>\n+\n+ <div class=linkheader>\n+ <div class=right><a href="#description56-1">Descriptions</a></div>\n+ <a class="linkheader" href="http://example.com/example-genebank?id=Subject_8">Gene Bank</a>\n+ </div>\n+\n+ <div class=title>\n+ <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p>\n+ <p class=titleinfo>\n+ <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank?id=Subject_8">Subject_8</a>\n+ <span class=b>Length:</span> 4983\n+ <span class=b>Number of Matches:</span> 1\n+ </p>\n+ </div>\n+\n+\n+ <div class=hotspot id=hotspot56-1-1>\n+ <p class=range>\n+ <span class=range>Range 1: 2319 to 2392</span>\n+ </p>\n+\n+ <table class=hotspotstable>\n+ <tr>\n+ <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>\n+ </tr>\n+ <tr>\n+ <td>89.7 bits(98)</td>\n+ <td>0.0</td>\n+ <td>64/74(86%)</td>\n+ <td>0/74(0%)</td>\n+ <td>Plus/Plus</td>\n+ </tr>\n+ </table>\n+\n+ <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60\n+ ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | \n+Subject 2319 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 2378</pre>\n+ <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74\n+ ||||| ||||||||\n+Subject 2379 TTCGCCGTCCAGAA 2392</pre>\n+ </div>\n+\n+ </div>\n+\n+ </div></div>\n+ </section>\n+ </section>\n+\n+ </div>\n+\n+ <footer>\n+ This page was generated by <a href="https://github.com/thehyve/blast2html/">blast2html</a>.\n+ </footer>\n+ </body>\n+</html>\n+\n' |
| b |
| diff -r b3b5ee557170 -r ed71448ee154 test-data/blast xml example4b.html --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/blast xml example4b.html Mon Jul 07 11:50:50 2014 +0200 |
| b |
| b'@@ -0,0 +1,1585 @@\n+<!DOCTYPE html>\n+<html>\n+ <head>\n+ <meta charset="UTF-8">\n+ <meta name=generator content="blast2html; see https://github.com/thehyve/blast2html/">\n+ \n+ <title>Blast output</title>\n+ \n+ <style>\n+ body {\n+ color: #333333;\n+ font-family: Arial,Sans-Serif;\n+ }\n+\n+ :link {\n+ color: #336699;\n+ }\n+\n+ .right {\n+ float: right;\n+ }\n+\n+ /* Galaxy with html sanitization enabled strips the header of this html page. If so, show the user a warning.*/\n+ #strip_html_warning {\n+ display: none;\n+ }\n+ \n+ #content {\n+ margin: 0 2em;\n+ padding: 0.5em;\n+ border: 1px solid #888888;\n+ background-color: #d3dff5;\n+ }\n+\n+ h1, h2, h3, h4, h5, h6 {\n+ color: #2A6979;\n+ font-family: arial,verdana,sans-serif;\n+ letter-spacing: -1px;\n+ margin: 1.2em 0 0.3em;\n+ }\n+\n+ h1 {\n+ border-bottom: 1px solid #CCCCCC;\n+ font-size: 150%;\n+ padding-bottom: 0.1em;\n+ }\n+\n+ h2 {\n+ font-size: 120%;\n+ font-weight: bold;\n+ }\n+\n+ h4.darkHeader {\n+ color: #4D4D4D;\n+ letter-spacing: 0;\n+ font-weight: bold;\n+ }\n+\n+ #nodata {\n+ font-weight: bold;\n+ }\n+\n+ .index {\n+ margin-bottom: 3em;\n+ }\n+ .index div.indexentry {\n+ margin: 1.2em 1.6em;\n+ font-weight: bold;\n+ font-size: 100%;\n+ }\n+ \n+ .headerdata {\n+ font-size: 90%;\n+ }\n+ .headerdata .param {\n+ font-weight: bold;\n+ text-align: right;\n+ padding: 0 1em;\n+ }\n+\n+ .grey {\n+ background-color: #eeeeee;\n+ border: 1px solid #cccccc;\n+ padding: 1em;\n+ }\n+\n+ .white {\n+ background-color: white;\n+ border: 1px solid #cccccc;\n+ padding: 1.5em 2%;\n+ }\n+\n+ .graphicrow {\n+ clear: left;\n+ width: 100%;\n+ }\n+\n+ .graphicitem {\n+ float: left;\n+ }\n+\n+\n+ \n+ .graphics .grey {\n+ text-align: center;\n+ }\n+\n+ .graphic {\n+ background-color: white;\n+ border: 2px solid black;\n+ padding: 1.5em;\n+ margin: auto;\n+ }\n+\n+ .centered, .defline, div.legend, div.tablewrapper {\n+ margin-left: auto;\n+ margin-right: auto;\n+ }\n+\n+ .defline {\n+ background-color: white;\n+ border: 1px solid black;\n+ margin: .5em auto;\n+ padding-left: .2em;\n+ padding-right: .2em;\n+ max-width: 50em;\n+ text-align: left;\n+ height: 2.8em;\n+ overflow: hidden;\n+ }\n+\n+ div.legend {\n+ max-width: 40em;\n+ }\n+ div.legend div {\n+ width: 100%;\n+ color: white;\n+ font-weight: bold;\n+ border-spacing: 0;\n+ }\n+ div.legend div .graphicitem {\n+ width: 20%;\n+ padding: 0;\n+ margin: 0;\n+ border: none;\n+ }\n+\n+ div.tablewrapper {\n+ width: 50%;\n+ min-width: 60em;\n+ }\n+\n+ /* For small widths we give the graphic 100% */\n+ @media (max-width: 72.5em) {\n+ div.tablewrapper {\n+ width: 100%;\n+ min-width: 0px;\n+ }\n+ }\n+\n+ .scale {\n+ width: 100%;\n+ margin: .5em 0;\n+ font-weight: bold;\n+ }\n+ .scale div {\n+ color: red;\n+ text-align: left;\n+ }\n+ .scale .graphicrow {\n+ margin: .5em 0 .5em 0;\n+ color: white;\n+ }\n+ .scale .graphicitem {\n+ position: relative;\n+ }\n+ .scale .graphicitem div {\n+ margin: 0 1px;\n+ padding: 0 2px;\n+ text-align: right;\n+ background-color: red;\n+ color: white;\n+ }\n+ .scale .graphicitem:first-child div {\n+ margin-left: 0px;\n+ }\n+ .scale .graphicitem:last-child div {\n+ margin-right: 0px;\n+ }\n+ .scale .graphicitem .lastlabel {\n+ position: absolute;\n+ top: 0px;\n+ left: 100%;\n+ background-color: transparent;\n+ color: red;\n+ }\n+\n+ a.matchresult {\n+ display: block;\n'..b'der" href="http://example.com/example-genebank/EUG/">Gene Bank</a>\n+ </div>\n+\n+ <div class=title>\n+ <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p>\n+ <p class=titleinfo>\n+ <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/EUG/">gnl|BL_ORD_ID|7</a>\n+ <span class=b>Length:</span> 4983\n+ <span class=b>Number of Matches:</span> 1\n+ </p>\n+ </div>\n+\n+\n+ <div class=hotspot id=hotspot7-1-1>\n+ <p class=range>\n+ <span class=range>Range 1: 2319 to 2392</span>\n+ </p>\n+\n+ <table class=hotspotstable>\n+ <tr>\n+ <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>\n+ </tr>\n+ <tr>\n+ <td>67.9 bits(34)</td>\n+ <td>0.0</td>\n+ <td>64/74(86%)</td>\n+ <td>0/74(0%)</td>\n+ <td>Plus/Plus</td>\n+ </tr>\n+ </table>\n+\n+ <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60\n+ ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | \n+Subject 2319 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 2378</pre>\n+ <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74\n+ ||||| ||||||||\n+Subject 2379 TTCGCCGTCCAGAA 2392</pre>\n+ </div>\n+\n+ </div>\n+\n+ <div class=alignment id=hit7-2>\n+\n+ <div class=linkheader>\n+ <div class=right><a href="#description7-2">Descriptions</a></div>\n+ <a class="linkheader" href="http://example.com/example-genebank/AY326434/">Gene Bank</a>\n+ </div>\n+\n+ <div class=title>\n+ <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p>\n+ <p class=titleinfo>\n+ <span class=b>Sequence ID:</span> <a href="http://example.com/example-genebank/AY326434/">gnl|BL_ORD_ID|6</a>\n+ <span class=b>Length:</span> 4180\n+ <span class=b>Number of Matches:</span> 1\n+ </p>\n+ </div>\n+\n+\n+ <div class=hotspot id=hotspot7-2-1>\n+ <p class=range>\n+ <span class=range>Range 1: 1589 to 1516</span>\n+ </p>\n+\n+ <table class=hotspotstable>\n+ <tr>\n+ <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th>\n+ </tr>\n+ <tr>\n+ <td>67.9 bits(34)</td>\n+ <td>0.0</td>\n+ <td>64/74(86%)</td>\n+ <td>0/74(0%)</td>\n+ <td>Plus/Minus</td>\n+ </tr>\n+ </table>\n+\n+ <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60\n+ ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | \n+Subject 1589 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 1530</pre>\n+ <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74\n+ ||||| ||||||||\n+Subject 1529 TTCGCCGTCCAGAA 1516</pre>\n+ </div>\n+\n+ </div>\n+\n+ </div></div>\n+ </section>\n+ </section>\n+\n+ </div>\n+\n+ <footer>\n+ This page was generated by <a href="https://github.com/thehyve/blast2html/">blast2html</a>.\n+ </footer>\n+ </body>\n+</html>\n+\n' |