| Previous changeset 7:2a9baa0c4316 (2022-02-03) Next changeset 9:ee17a294d3a3 (2023-10-12) |
|
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/shovill commit 1e28eb4ffcf3d9168877c291d27e533b96021445 |
|
modified:
shovill.xml test-data/contigs.fa |
|
added:
test-data/shovill.bam test-data/shovill_std_log |
| b |
| diff -r 2a9baa0c4316 -r ad80238462c1 shovill.xml --- a/shovill.xml Thu Feb 03 20:41:04 2022 +0000 +++ b/shovill.xml Fri Sep 16 14:39:43 2022 +0000 |
| [ |
| b'@@ -1,11 +1,12 @@\n-<tool id="shovill" name="Shovill" version="@TOOL_VERSION@+galaxy1">\n+<tool id="shovill" name="Shovill" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@">\n <description>Faster SPAdes assembly of Illumina reads</description>\n+ <macros>\n+ <token name="@TOOL_VERSION@">1.1.0</token>\n+ <token name="@VERSION_SUFFIX@">1</token>\n+ </macros>\n <xrefs>\n <xref type="bio.tools">shovill</xref>\n </xrefs>\n- <macros>\n- <token name="@TOOL_VERSION@">1.1.0</token>\n- </macros>\n <requirements>\n <requirement type="package" version="@TOOL_VERSION@">shovill</requirement>\n </requirements>\n@@ -19,10 +20,10 @@\n #set r2_ext = $library.R2.extension\n #if $r1_ext == \'fastqsanger.gz\' or $r1_ext == \'fastqsanger.bz2\'\n cp \'$library.R1\' fastq_r1.\'$r1_ext\' &&\n- cp \'$library.R2\' fastq_r2.\'$r2_ext\' && \n+ cp \'$library.R2\' fastq_r2.\'$r2_ext\' &&\n #else\n ln -s \'$library.R1\' fastq_r1.\'$r1_ext\' &&\n- ln -s \'$library.R2\' fastq_r2.\'$r2_ext\' && \n+ ln -s \'$library.R2\' fastq_r2.\'$r2_ext\' &&\n #end if\n #else if str($library.lib_type) == "collection"\n #set r1_ext = $library.input1.forward.extension\n@@ -42,13 +43,13 @@\n \t## (3) Or default to 4 GB if GALAXY_MEMORY_MB is unset\n \tGALAXY_MEMORY_GB=\\$((\\${GALAXY_MEMORY_MB:-4096}/1024)) &&\n \tSHOVILL_RAM=\\${SHOVILL_RAM:-\\${GALAXY_MEMORY_GB}} &&\n- \n+\n shovill\n --outdir \'out\'\n --cpus \\${GALAXY_SLOTS:-1}\n --ram \\${SHOVILL_RAM:-4}\n- --R1 fastq_r1.\'$r1_ext\'\n- --R2 fastq_r2.\'$r2_ext\'\n+ --R1 \'fastq_r1.$(r1_ext)\'\n+ --R2 \'fastq_r2.$(r2_ext)\'\n $trim\n --namefmt \'$adv.namefmt\'\n --depth \'$adv.depth\'\n@@ -61,11 +62,14 @@\n #if $adv.opts\n --opts \'$adv.opts\'\n #end if\n- $adv.nocorr\n --minlen $adv.minlen\n --mincov $adv.mincov\n --assembler $assembler\n-\n+ #if $adv.keep_files.nocorr == \'no_correction\'\n+ --nocorr\n+ #else\n+ $adv.keep_files.keepfiles\n+ #end if\n ]]></command>\n <inputs>\n <conditional name="library">\n@@ -82,7 +86,6 @@\n </when>\n </conditional>\n <param name="trim" argument="--trim" type="boolean" truevalue="--trim" falsevalue="" label="Trim reads" help="Use Trimmomatic to remove common adaptors first (default: OFF)" />\n- <param name="log" type="boolean" label="Output log file?" checked="true" help="Return the Shovill log file as part of the output. Default is on" />\n <param name="assembler" argument="--assembler" type="select" label="Assembler to use" help="Which assembler would you like shovill to use, default is Spades">\n <option value="skesa">skesa</option>\n <option value="megahit">megahit</option>\n@@ -104,22 +107,34 @@\n <param name="gsize" argument="--gsize" type="text" value="" label="Estimated genome size" help="An estimate of the final genome size, it will autodetect if this is blank. (default: \'\')" />\n <param name="kmers" argument="--kmers" type="text" value="" label="List of kmer sizes to use" help="List of K-mer sizes to use in SPAdes. Blank is AUTO. default: \'\'" />\n <param name="opts" argument="--opts" type="text" value="" label="Extra SPAdes options" help="eg. --plasmid --sc ... (default: \'\')" />\n- <param name="nocorr" argument="--nocorr" type="boolean" truevalue="--nocorr" falsevalue="" checked="True" label="Disable post-assembly correction" help="Disable post assembly correction with pilon (default: ON)" />\n+ <conditional name="keep_files">\n+ <param name="nocorr" argument="--nocorr" type="select" label="Disable post-assembly correction" help="Disable post assembly corr'..b'ection name="adv">\n+ <conditional name="keep_files">\n+ <param name="nocorr" value="yes_correction" />\n+ <param name="keepfiles" value="True" />\n+ </conditional>\n+ <param name="log" value="true"/>\n+ </section>\n+ <output name="contigs" ftype="fasta">\n+ <assert_contents>\n+ <has_text text=">contig00001"/>\n+ </assert_contents>\n+ </output>\n+ <output name="bamfiles" ftype="unsorted.bam">\n+ <assert_contents>\n+ <has_size value="36359" delta="1000" />\n+ </assert_contents>\n+ </output>\n+ </test>\n </tests>\n <help><![CDATA[\n-Synopsis:\n- Faster de novo assembly pipeline for Illumina paired end reads based around Spades\n+ Synopsis:\n+ Faster de novo assembly pipeline for Illumina paired end reads based around Spades\n \n-Details and options:\n- - Takes paired end Illumina fastq reads\n- - Trim reads: Use Trimmomatic to remove common adaptors first (default: OFF)\n- - Output log file: If set to "Yes", tool will return Shovill\'s log file as part of the output\n- - Assembler: Which assembler should shovill use from: Skesa, Megahit, Velvet or Spades. Spades is the default.\n+ Details and options:\n+ - Takes paired end Illumina fastq reads\n+ - Trim reads: Use Trimmomatic to remove common adaptors first (default: OFF)\n+ - Output log file: If set to "Yes", tool will return Shovill\'s log file as part of the output\n+ - Assembler: Which assembler should shovill use from: Skesa, Megahit, Velvet or Spades. Spades is the default.\n \n-Advanced options:\n- - Name format: Format of output contig FASTA IDs in \'printf\' style (default: \'contig%05d\')\n- - Depth: Sub-sample the reads to this depth. Disable with *Depth: 0* (default: 100)\n- - Estimated genomesize: An estimate of the final genome size, it will autodetect if this is blank. (default: \'\')\n- - List of kmers to use: List of K-mer sizes to use in SPAdes. Blank is AUTO. (default: \'\')\n- - Extra SPAdes options: Extra SPAdes options eg. --plasmid --sc ... (default: \'\')\n- - Disable post-assembly correction: Disable post assembly correction with pilon (default: ON)\n- - Minimum contig length: Minimum length of contig to be output. 0 is AUTO (default: 0)\n- - Minimum contig coverage: Minimum coverage to call part of a contig. 0 is AUTO (default: 2)\n- - Spades result to correct: Spades result to correct: before_rr, contigs or scaffolds (default: \'contigs\')\n+ Advanced options:\n+ - Name format: Format of output contig FASTA IDs in \'printf\' style (default: \'contig%05d\')\n+ - Depth: Sub-sample the reads to this depth. Disable with *Depth: 0* (default: 100)\n+ - Estimated genomesize: An estimate of the final genome size, it will autodetect if this is blank. (default: \'\')\n+ - List of kmers to use: List of K-mer sizes to use in SPAdes. Blank is AUTO. (default: \'\')\n+ - Extra SPAdes options: Extra SPAdes options eg. --plasmid --sc ... (default: \'\')\n+ - Disable post-assembly correction: Disable post assembly correction with pilon (default: ON)\n+ - Keep the bam files : Enable to keep mapped files from bwa in the post assembly correction (default: OFF)\n+ - Minimum contig length: Minimum length of contig to be output. 0 is AUTO (default: 0)\n+ - Minimum contig coverage: Minimum coverage to call part of a contig. 0 is AUTO (default: 2)\n+ - Spades result to correct: Spades result to correct: before_rr, contigs or scaffolds (default: \'contigs\')\n \n-Documentation can be found at Torsten Seemann `site <https://github.com/tseemann/shovill>`_.\n+ Documentation can be found at Torsten Seemann `site <https://github.com/tseemann/shovill>`_.\n ]]></help>\n <citations>\n <citation type="bibtex">\n' |
| b |
| diff -r 2a9baa0c4316 -r ad80238462c1 test-data/contigs.fa --- a/test-data/contigs.fa Thu Feb 03 20:41:04 2022 +0000 +++ b/test-data/contigs.fa Fri Sep 16 14:39:43 2022 +0000 |
| b |
| @@ -1,22 +1,20 @@ ->contig00001 len=14151 cov=4.0 corr=0 spades=NODE_1_length_14151_cov_3.95289_pilon -GAAGAAGTAAAAAAGGGCTATTTTCCAATCAAACGTGCGATTGACTTGGTATTAAGTATC -GTTTTATTATTTTTAACATTTCCGATTATGTTCATATTCGCCATTGCTATCGTCATAGAT -TCGCCAGGAAACCCTATTTATAGTCAGGTTAGAGTTGGGAAGATGGGTAAATTAATTAAA -ATATACAAATTACGTTCGATGTGTAAAAACGCAGAGAAAAACGGTGCGCAATGGGCTGAT -AAAGATGATGATCGTATAACAAATGTCGGGAAGTTTATTCGTAAAACACGCATTGATGAA -TTACCACAACTAATTAATGTTGTTAAAGGGGAAATGAGTTTTATTGGACCACGCCCGGAA -CGTCCAGAATTTGTAGAATTATTTAGTTCAGAAATAATAGGATTTGAGCAAAGATGTCTT -GTTACACCAGGATTAACAGGTCTTGCGCAAATTCAAGGTGGATATGACTTAACACCACAA -CAAAAATTAAAATATGACATGAAATATATACATAAAGGTAGCTTAATGATGGAATTATAT -ATATCAATTAGAACATTGATGGTTGTTATTACAGGGGAAGGCTCAAGGTAGTCTTAATTT -GCTTAATAAGTTTAAATAAAAGTTACATTTTAAAGATTGTGACCAATTGTTACAGTATAA -CGAGGAATCCCTTGAGACAGTATCAAATGGCATTAAGAAATATTTGCCATCATTGATTTG -CATGGCTATAAATACTATTCATCTGATGAGATAGCCATGTTAAGAAATTGAAAGTATAGC -ATTAAAGGGGTTTGTAACAGTTGAAAATTATATATTGTATTACTAAAGCAGATAATGGTG -GTGCACAAACACATCTCATTCAACTCGCTAACCATTTTTGCGTACACCATGATGTTTATG -TCATTGTAGGCAATCATGGACCAATGATTGAACAACTAGATGCAAGAGTCAATGTAATTA -TTATCGAACATTTAGTAGGTCCAATTGACTTTAAACAAGATATTTTAGCTGTCAAAGTGT -TAGCACAGTTATTCTCGAAAATTAAACCTGATGTTATCCATCTACATTCTTCCAAAGCTG -GAACGGTCGGACGAATTGCGAAGTTCATTTCGAAATCGAAAGACACACGTGTAGTTTTTA -CTGCGCATGGATGGGCTTTTACAGAGGGTGTTAAACCAGCTAAAAAATTTCTATATCTAG -TTATTGAAAAATTAATGTCACGTATTACAGATAGCATTATTTGTGTTTCAGATTTCGATA +>contig00001 len=1129 cov=61.4 corr=0 origname=Contig_1_61.3517 sw=shovill-skesa/1.1.0 date=20220816 +TAGAAATTTTTTAGCTGGTTTAACACCCTCTGTAAAAGCCCATCCATGCGCAGTAAAAAC +TACACGTGTGTCTTTCGATTTCGAAATGAACTTCGCAATTCGTCCGACCGTTCCAGCTTT +GGAAGAATGTAGATGGATAACATCAGGTTTAATTTTCGAGAATAACTGTGCTAACACTTT +GACAGCTAAAATATCTTGTTTAAAGTCAATTGGACCTACTAAATGTTCGATAATAATTAC +ATTGACTCTTGCATCTAGTTGTTCAATCATTGGTCCATGATTGCCTACAATGACATAAAC +ATCATGGTGTACGCAAAAATGGTTAGCGAGTTGAATGAGATGTGTTTGTGCACCACCATT +ATCTGCTTTAGTAATACAATATATAATTTTCAACTGTTACAAACCCCTTTAATGCTATAC +TTTCAATTTCTTAACATGGCTATCTCATCAGATGAATAGTATTTATAGCCATGCAAATCA +ATGATGGCAAATATTTCTTAATGCCATTTGATACTGTCTCAAGGGATTCCTCGTTATACT +GTAACAATTGGTCACAATCTTTAAAATGTAACTTTTATTTAAACTTATTAAGCAAATTAA +GACTACCTTGAGCCTTCCCCTGTAATAACAACCATCAATGTTCTAATTGATATATATAAT +TCCATCATTAAGCTACCTTTATGTATATATTTCATGTCATATTTTAATTTTTGTTGTGGT +GTTAAGTCATATCCACCTTGAATTTGCGCAAGACCTGTTAATCCTGGTGTAACAAGACAT +CTTTGCTCAAATCCTATTATTTCTGAACTAAATAATTCTACAAATTCTGGACGTTCCGGG +CGTGGTCCAATAAAACTCATTTCCCCTTTAACAACATTAATTAGTTGTGGTAATTCATCA +ATGCGTGTTTTACGAATAAACTTCCCGACATTTGTTATACGATCATCATCTTTATCAGCC +CATTGCGCACCGTTTTTCTCTGCGTTTTTACACATCGAACGTAATTTGTATATTTTAATT +AATTTACCCATCTTCCCAACTCTAACCTGACTATAAATAGGGTTTCCTGGCGAATCTATG +ACGATAGCAATGGCGAATATGAACATAATCGGAAATGTTAAAAATAATA |
| b |
| diff -r 2a9baa0c4316 -r ad80238462c1 test-data/shovill.bam |
| b |
| Binary file test-data/shovill.bam has changed |
| b |
| diff -r 2a9baa0c4316 -r ad80238462c1 test-data/shovill_std_log --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/shovill_std_log Fri Sep 16 14:39:43 2022 +0000 |
| [ |
| b'@@ -0,0 +1,1460 @@\n+[shovill] Hello piemari\n+[shovill] You ran: /home/piemari/apps/conda/envs/metaphlan/bin/shovill --outdir ../shovill_bam/ --cpus 8 --ram 4 --R1 ../mutant_R1.fastq --R2 ../mutant_R2.fastq --namefmt contig%05d --depth 100 --keepfiles --minlen 0 --mincov 2 --assembler spades --force\n+[shovill] This is shovill 1.1.0\n+[shovill] Written by Torsten Seemann\n+[shovill] Homepage is https://github.com/tseemann/shovill\n+[shovill] Operating system is linux\n+[shovill] Perl version is v5.32.1\n+[shovill] Machine has 32 CPU cores and 251.66 GB RAM\n+[shovill] Using bwa - /home/piemari/apps/conda/envs/metaphlan/bin/bwa | Version: 0.7.17-r1188\n+[shovill] Using flash - /home/piemari/apps/conda/envs/metaphlan/bin/flash | FLASH v1.2.11\n+[shovill] Using java - /home/piemari/apps/conda/envs/metaphlan/bin/java | openjdk version "11.0.1" 2018-10-16 LTS\n+[shovill] Using kmc - /home/piemari/apps/conda/envs/metaphlan/bin/kmc | K-Mer Counter (KMC) ver. 3.2.1 (2022-01-04)\n+[shovill] Using lighter - /home/piemari/apps/conda/envs/metaphlan/bin/lighter | Lighter v1.1.2\n+[shovill] Using megahit - /home/piemari/apps/conda/envs/metaphlan/bin/megahit | MEGAHIT v1.2.9\n+[shovill] Using megahit_toolkit - /home/piemari/apps/conda/envs/metaphlan/bin/megahit_toolkit | v1.2.9\n+[shovill] Using pigz - /home/piemari/apps/conda/envs/metaphlan/bin/pigz | pigz 2.6\n+[shovill] Using pilon - /home/piemari/apps/conda/envs/metaphlan/bin/pilon | Pilon version 1.24 Thu Jan 28 13:00:45 2021 -0500\n+[shovill] Using samclip - /home/piemari/apps/conda/envs/metaphlan/bin/samclip | samclip 0.4.0\n+[shovill] Using samtools - /home/piemari/apps/conda/envs/metaphlan/bin/samtools | Version: 1.15 (using htslib 1.14)\n+[shovill] Using seqtk - /home/piemari/apps/conda/envs/metaphlan/bin/seqtk | Version: 1.3-r106\n+[shovill] Using skesa - /home/piemari/apps/conda/envs/metaphlan/bin/skesa | SKESA 2.4.0\n+[shovill] Using spades.py - /home/piemari/apps/conda/envs/metaphlan/bin/spades.py | SPAdes genome assembler v3.14.1\n+[shovill] Using trimmomatic - /home/piemari/apps/conda/envs/metaphlan/bin/trimmomatic | 0.39\n+[shovill] Using velvetg - /home/piemari/apps/conda/envs/metaphlan/bin/velvetg | Version 1.2.10\n+[shovill] Using velveth - /home/piemari/apps/conda/envs/metaphlan/bin/velveth | Version 1.2.10\n+[shovill] Found spades version: 003014000\n+[shovill] Will use spades 003014000 options: --isolate and --merged\n+[shovill] Forced overwrite of existing --outdir ../shovill_bam/\n+[shovill] Using tempdir: /tmp\n+[shovill] Changing into folder: /home/piemari/shovill_bam\n+[shovill] Collecting raw read statistics with \'seqtk\'\n+[shovill] Running: seqtk fqchk -q3 \\/home\\/piemari\\/mutant_R1\\.fastq >/tmp/1MILzK1fer 2>&1 | sed \'s/^/[seqtk] /\' | tee -a shovill.log\n+[shovill] Read stats: max_len = 150\n+[shovill] Read stats: min_len = 150\n+[shovill] Read stats: total_bp = 300000\n+[shovill] Read stats: avg_len = 150\n+[shovill] Estimating genome size by counting unqiue 21-mers > frequency 10 \n+[shovill] Running: kmc -sm -m2 -t8 -k21 -ci10 \\/home\\/piemari\\/mutant_R1\\.fastq /tmp/_n_4cOtiee/kmc /tmp/_n_4cOtiee 2>&1 | sed \'s/^/[kmc] /\' | tee -a shovill.log\n+[kmc] **\n+[kmc] \rStage 1: 0%\rStage 1: 100%\n+[kmc] \rStage 2: 0%\rStage 2: 84%\rStage 2: 90%\rStage 2: 94%\rStage 2: 96%\rStage 2: 98%\rStage 2: 99%\rStage 2: 100%\n+[kmc] \n+[kmc] \n+[kmc] 1st stage: 0.08264s\n+[kmc] 2nd stage: 0.104849s\n+[kmc] 3rd stage: 0.002521s\n+[kmc] Total : 0.19001s\n+[kmc] Tmp size : 0MB\n+[kmc] Tmp size strict memory : 0MB\n+[kmc] Tmp total: 0MB\n+[kmc] \n+[kmc] Stats:\n+[kmc] No. of k-mers below min. threshold : 34495\n+[kmc] No. of k-mers above max. threshold : 0\n+[kmc] No. of unique k-mers : 35683\n+[kmc] No. of unique counted k-mers : 1188\n+[kmc] Total no. of k-mers : 130000\n+[kmc] Total no. of reads : 1000\n+[kmc] Total no. of super-k-mers : 18576\n+[shovill] Using genome size 1188 bp\n+[shovill] Estimated sequenci'..b"CPU: 0.004 sec\n+[shovill] Running: samtools faidx spades.fasta 2>&1 | sed 's/^/[faidx] /' | tee -a shovill.log\n+[shovill] Running: (bwa mem -v 3 -x intractg -t 8 spades.fasta R1.fq.gz R2.fq.gz | samclip --ref spades.fasta.fai | samtools sort --threads 2 -m 1024m --reference spades.fasta -T /tmp -o shovill.bam) 2>&1 | sed 's/^/[bwa+samtools-sort] /' | tee -a shovill.log\n+[bwa+samtools-sort] [M::bwa_idx_load_from_disk] read 0 ALT contigs\n+[bwa+samtools-sort] [M::process] read 820 sequences (123000 bp)...\n+[bwa+samtools-sort] [M::mem_pestat] # candidate unique pairs for (FF, FR, RF, RR): (0, 410, 0, 0)\n+[bwa+samtools-sort] [M::mem_pestat] skip orientation FF as there are not enough pairs\n+[bwa+samtools-sort] [M::mem_pestat] analyzing insert size distribution for orientation FR...\n+[bwa+samtools-sort] [M::mem_pestat] (25, 50, 75) percentile: (163, 197, 230)\n+[bwa+samtools-sort] [M::mem_pestat] low and high boundaries for computing mean and std.dev: (29, 364)\n+[bwa+samtools-sort] [M::mem_pestat] mean and std.dev: (200.81, 42.23)\n+[bwa+samtools-sort] [M::mem_pestat] low and high boundaries for proper pairs: (1, 431)\n+[bwa+samtools-sort] [M::mem_pestat] skip orientation RF as there are not enough pairs\n+[bwa+samtools-sort] [M::mem_pestat] skip orientation RR as there are not enough pairs\n+[bwa+samtools-sort] [M::mem_process_seqs] Processed 820 reads in 0.101 CPU sec, 0.021 real sec\n+[bwa+samtools-sort] [samclip] samclip 0.4.0 by Torsten Seemann (@torstenseemann)\n+[bwa+samtools-sort] [samclip] Loading: spades.fasta.fai\n+[bwa+samtools-sort] [samclip] Found 1 sequences in spades.fasta.fai\n+[bwa+samtools-sort] [main] Version: 0.7.17-r1188\n+[bwa+samtools-sort] [main] CMD: bwa mem -v 3 -x intractg -t 8 spades.fasta R1.fq.gz R2.fq.gz\n+[bwa+samtools-sort] [main] Real time: 0.053 sec; CPU: 0.107 sec\n+[bwa+samtools-sort] [samclip] Total SAM records 820, removed 63, allowed 123, passed 757\n+[bwa+samtools-sort] [samclip] Header contained 2 lines\n+[bwa+samtools-sort] [samclip] Done.\n+[bwa+samtools-sort] [bam_sort_core] merging from 0 files and 2 in-memory blocks...\n+[shovill] Running: samtools index shovill.bam 2>&1 | sed 's/^/[samtools-index] /' | tee -a shovill.log\n+[shovill] Correcting errors in spades.fasta\n+[shovill] Running: pilon --genome spades.fasta --frags shovill.bam --minmq 60 --minqual 3 --fix bases --output pilon --threads 8 --changes --mindepth 0.25 2>&1 | sed 's/^/[pilon] /' | tee -a shovill.log\n+[pilon] Picked up _JAVA_OPTIONS: -Xmx4g\n+[pilon] Pilon version 1.24 Thu Jan 28 13:00:45 2021 -0500\n+[pilon] --threads argument no longer supported; ignoring!\n+[pilon] Genome: spades.fasta\n+[pilon] Fixing snps, indels\n+[pilon] Input genome size: 1251\n+[pilon] Processing NODE_1_length_1251_cov_25.164912:1-1251\n+[pilon] frags shovill.bam: coverage 79\n+[pilon] Total Reads: 757, Coverage: 79, minDepth: 20\n+[pilon] Confirmed 1152 of 1251 bases (92,09%)\n+[pilon] Corrected 0 snps; 0 ambiguous bases; corrected 0 small insertions totaling 0 bases, 0 small deletions totaling 0 bases\n+[pilon] NODE_1_length_1251_cov_25.164912:1-1251 log:\n+[pilon] Finished processing NODE_1_length_1251_cov_25.164912:1-1251\n+[pilon] Writing NODE_1_length_1251_cov_25.164912:1-1251 changes to pilon.changes\n+[pilon] Writing updated NODE_1_length_1251_cov_25.164912_pilon to pilon.fasta\n+[pilon] Mean frags coverage: 79\n+[pilon] Mean total coverage: 79\n+[shovill] Repaired 0 contigs from spades.fasta at 0 positions.\n+[shovill] Assembly is 1251, estimated genome size was 1188 (+5.30%)\n+[shovill] Using genome graph file 'spades/assembly_graph_with_scaffolds.gfa' => 'contigs.gfa'\n+[shovill] Walltime used: 0 min 10 sec\n+[shovill] Results in: /home/piemari/shovill_bam\n+[shovill] Final assembly graph: /home/piemari/shovill_bam/contigs.gfa\n+[shovill] Final assembly contigs: /home/piemari/shovill_bam/contigs.fa\n+[shovill] It contains 1 (min=75) contigs totalling 1251 bp.\n+[shovill] Have a suggestion for shovill? Tell me at https://github.com/tseemann/shovill/issues\n+[shovill] Done.\n" |