annotate vcfprimers.xml @ 1:8be427d0e4c3

Updated to vcflib 86723982aa

<tool id="vcfprimers" name="VCFprimers:" version="0.0.1">
<requirements>
    <requirement type="package" version="86723982aa">vcflib</requirement>
    <!-- <requirement type="package" version="0.1.18">samtools</requirement> -->
</requirements>
  <description>Extract flanking sequences for each VCF record</description>
  <command>
    #set $reference_fasta_filename = "localref.fa"
    #if str( $reference_source.reference_source_selector ) == "history":
       ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" &amp;&amp;
    #else:
       #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path )
    #end if    
   vcfprimers -f "${reference_fasta_filename}" -l "${primer_length}" "${input_vcf}" > "${out_file1}"</command>
  <inputs>
<param name="input_vcf" type="data" format="vcf" label="VCF dataset to extract flanks" />
    <conditional name="reference_source">
       <param name="reference_source_selector" type="select" label="Choose the source for the reference genome">
         <option value="cached">Locally cached</option>
         <option value="history">History</option>
       </param>
       <when value="cached">
         <param name="ref_file" type="select" label="Select reference genome">
           <options from_data_table="fasta_indexes">
           </options>
	   <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
         </param>
       </when>
       <when value="history"> <!-- FIX ME!!!! -->
         <param name="ref_file" type="data" format="fasta" label="Using reference file" />
       </when>
     </conditional>
     <param name="primer_length" type="integer" value="20" label="The length of the primer sequences on each side of the variant" help="default = 20 bp" />
  </inputs>
  <outputs>
    <data format="fasta" name="out_file1" />
  </outputs>
 <stdio>
    <exit_code range="1:" level="fatal" />
 </stdio>
  <tests>
    <test>
      <param name="reference_source_selector" value="history" />
      <param name="input_vcf" value="vcflib-phix.vcf"/>
      <param name="ref_file" value="vcflib-test-genome-phix.fa" />
      <param name="primer_length" value="5" />
      <output name="out_file1" file="vcfprimers-test1.fasta"/>
    </test>
    </tests>
  <help>

For each VCF record, extract the flanking sequences, and write them to stdout as FASTA
records suitable for alignment.  This tool is intended for use in designing validation
experiments.  Primers extracted which would flank all of the alleles at multi-allelic
sites.  The name of the FASTA "reads" indicates the VCF record which they apply to.
The form is >CHROM_POS_LEFT for the 3' primer and >CHROM_POS_RIGHT for the 5' primer,
for example::

 >20_233255_LEFT
 CCATTGTATATATAGACCATAATTTCTTTATCCAATCATCTGTTGATGGA
 >20_233255_RIGHT
 ACTCAGTTGATTCCATACCTTTGCCATCATGAATCATGTTGTAATAAACA

----

Vcfprimers is a part of VCFlib toolkit developed by Erik Garrison (https://github.com/ekg/vcflib).                                                                                                                                 

</help>
</tool>