changeset 0:9dfb65ebb02e draft

planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/blastparser_and_hits commit 48132e5edac97d54804ccbaf620068a5fb800bdc
author artbio
date Sun, 15 Oct 2017 18:43:37 -0400
parents
children 9beb85dba280
files BlastParser_and_hits.py BlastParser_and_hits.xml test-data/al_sequences.fa test-data/blast.tab test-data/input.fa test-data/output.fa test-data/output.tab test-data/un_sequences.fa
diffstat 8 files changed, 11452 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BlastParser_and_hits.py	Sun Oct 15 18:43:37 2017 -0400
@@ -0,0 +1,342 @@
+#!/usr/bin/python
+import argparse
+from collections import defaultdict
+
+
+def Parser():
+    the_parser = argparse.ArgumentParser()
+    the_parser.add_argument('--blast', action="store", type=str,
+                            help="Path to the blast output\
+                                  (tabular format, 12 column)")
+    the_parser.add_argument('--sequences', action="store", type=str,
+                            help="Path to the fasta file with blasted\
+                                  sequences")
+    the_parser.add_argument('--fastaOutput', action="store", type=str,
+                            help="fasta output file of blast hits")
+    the_parser.add_argument('--tabularOutput', action="store", type=str,
+                            help="tabular output file of blast analysis")
+    the_parser.add_argument('--flanking', action="store", type=int,
+                            help="number of flanking nucleotides\
+                                  added to the hit sequences")
+    the_parser.add_argument('--mode', action="store",
+                            choices=["verbose", "short"], type=str,
+                            help="reporting (verbose) or not reporting (short)\
+                                  oases contigs")
+    the_parser.add_argument('--filter_relativeCov', action="store", type=float,
+                            default=0,
+                            help="filter out relative coverages\
+                                  below the specified ratio (float number)")
+    the_parser.add_argument('--filter_maxScore', action="store", type=float,
+                            default=0, help="filter out best BitScores below\
+                                             the specified float number")
+    the_parser.add_argument('--filter_meanScore', action="store", type=float,
+                            default=0,
+                            help="filter out mean BitScores below the\
+                                  specified float number")
+    the_parser.add_argument('--filter_term_in', action="store", type=str,
+                            default="",
+                            help="select the specified term in the\
+                                  subject list")
+    the_parser.add_argument('--filter_term_out', action="store", type=str,
+                            default="",
+                            help="exclude the specified term from\
+                                  the subject list")
+    the_parser.add_argument('--al_sequences', action="store", type=str,
+                            help="sequences that have been blast aligned")
+    the_parser.add_argument('--un_sequences', action="store", type=str,
+                            help="sequences that have not been blast aligned")
+    the_parser.add_argument('--dataset_name', action="store", type=str,
+                            default="",
+                            help="the name of the dataset that has been parsed,\
+                                  to be reported in the output")
+    args = the_parser.parse_args()
+    if not all((args.sequences, args.blast, args.fastaOutput,
+                args.tabularOutput)):
+        the_parser.error('argument(s) missing, call the\
+                         -h option of the script')
+    if not args.flanking:
+        args.flanking = 0
+    return args
+
+
+def median(lst):
+    lst = sorted(lst)
+    if len(lst) < 1:
+            return None
+    if len(lst) % 2 == 1:
+            return lst[((len(lst)+1)/2)-1]
+    if len(lst) % 2 == 0:
+            return float(sum(lst[(len(lst)/2)-1:(len(lst)/2)+1]))/2.0
+
+
+def mean(lst):
+    if len(lst) < 1:
+        return 0
+    return sum(lst) / float(len(lst))
+
+
+def getfasta(fastafile):
+    fastadic = {}
+    for line in open(fastafile):
+        if line[0] == ">":
+            header = line[1:-1]
+            fastadic[header] = ""
+        else:
+            fastadic[header] += line
+    for header in fastadic:
+        fastadic[header] = "".join(fastadic[header].split("\n"))
+    return fastadic
+
+
+def insert_newlines(string, every=60):
+    lines = []
+    for i in range(0, len(string), every):
+        lines.append(string[i:i+every])
+    return '\n'.join(lines)
+
+
+def getblast(blastfile):
+    '''blastinfo [0]	Percentage of identical matches
+       blastinfo [1]	Alignment length
+       blastinfo [2]	Number of mismatches
+       blastinfo [3]	Number of gap openings
+       blastinfo [4]	Start of alignment in query
+       blastinfo [5]	End of alignment in query
+       blastinfo [6]	Start of alignment in subject (database hit)
+       blastinfo [7]	End of alignment in subject (database hit)
+       blastinfo [8]	Expectation value (E-value)
+       blastinfo [9]	Bit score
+       blastinfo [10]	Subject length
+                        (NEED TO BE SPECIFIED WHEN RUNNING BLAST) '''
+    blastdic = defaultdict(dict)
+    for line in open(blastfile):
+        fields = line[:-1].split("\t")
+        transcript = fields[0]
+        subject = fields[1]
+        # blastinfo[0]
+        blastinfo = [float(fields[2])]
+        # blastinfo[1:8] insets 1 to 7
+        blastinfo = blastinfo + [int(i) for i in fields[3:10]]
+        # blastinfo[8] E-value remains as a string type
+        blastinfo.append(fields[10])
+        # blastinfo[9] Bit score
+        blastinfo.append(float(fields[11]))
+        # blastinfo[10] Subject length MUST BE RETRIEVED
+        # THROUGH A 13 COLUMN BLAST OUTPUT
+        blastinfo.append(int(fields[12]))
+        try:
+            blastdic[subject][transcript].append(blastinfo)
+        except Exception:
+            blastdic[subject][transcript] = [blastinfo]
+    return blastdic
+
+
+def getseq(fastadict, transcript, up, down, orientation="direct"):
+    def reverse(seq):
+        revdict = {"A": "T", "T": "A", "G": "C", "C": "G", "N": "N"}
+        revseq = [revdict[i] for i in seq[::-1]]
+        return "".join(revseq)
+    pickseq = fastadict[transcript][up-1:down]
+    if orientation == "direct":
+        return pickseq
+    else:
+        return reverse(pickseq)
+
+
+def subjectCoverage(fastadict, blastdict, subject,
+                    QueriesFlankingNucleotides=0):
+    SubjectCoverageList = []
+    HitDic = {}
+    bitScores = []
+    for transcript in blastdict[subject]:
+        prefix = "%s--%s_" % (subject, transcript)
+        hitNumber = 0
+        for hit in blastdict[subject][transcript]:
+            hitNumber += 1
+            suffix = "hit%s_IdMatch=%s,AligLength=%s,E-val=%s" % (hitNumber,
+                                                                  hit[0],
+                                                                  hit[1],
+                                                                  hit[8])
+            # query coverage by a hit is in hit[4:6]
+            HitDic[prefix+suffix] = GetHitSequence(fastadict, transcript,
+                                                   hit[4], hit[5],
+                                                   QueriesFlankingNucleotides)
+            # subject coverage by a hit is in hit[6:8]
+            SubjectCoverageList += range(min([hit[6], hit[7]]),
+                                         max([hit[6], hit[7]]) + 1)
+            bitScores.append(hit[9])
+            # always the same value for a given subject. Stupid but simple
+            subjectLength = hit[10]
+    TotalSubjectCoverage = len(set(SubjectCoverageList))
+    RelativeSubjectCoverage = TotalSubjectCoverage/float(subjectLength)
+    return (HitDic, subjectLength, TotalSubjectCoverage,
+            RelativeSubjectCoverage, max(bitScores), mean(bitScores))
+
+
+def GetHitSequence(fastadict, FastaHeader, leftCoordinate, rightCoordinate,
+                   FlankingValue):
+    if rightCoordinate > leftCoordinate:
+        polarity = "direct"
+    else:
+        polarity = "reverse"
+        leftCoordinate, rightCoordinate = rightCoordinate, leftCoordinate
+    if leftCoordinate - FlankingValue > 0:
+        leftCoordinate -= FlankingValue
+    else:
+        leftCoordinate = 1
+    return getseq(fastadict, FastaHeader, leftCoordinate, rightCoordinate,
+                  polarity)
+
+
+def outputParsing(dataset_name, F, Fasta, results, Xblastdict, fastadict,
+                  filter_relativeCov=0, filter_maxScore=0, filter_meanScore=0,
+                  filter_term_in="", filter_term_out="", mode="verbose"):
+    def filter_results(results, filter_relativeCov=0, filter_maxScore=0,
+                       filter_meanScore=0, filter_term_in="",
+                       filter_term_out=""):
+        for subject in results.keys():
+            if results[subject][
+                       "RelativeSubjectCoverage"] < filter_relativeCov:
+                del results[subject]
+                continue
+            if results[subject]["maxBitScores"] < filter_maxScore:
+                del results[subject]
+                continue
+            if results[subject]["meanBitScores"] < filter_meanScore:
+                del results[subject]
+                continue
+            if filter_term_in in subject:
+                pass
+            else:
+                del results[subject]
+                continue
+            if filter_term_out and filter_term_out in subject:
+                del results[subject]
+                continue
+        return results
+
+    F = open(F, "w")
+    Fasta = open(Fasta, "w")
+    blasted_transcripts = []
+    filter_results(results, filter_relativeCov, filter_maxScore,
+                   filter_meanScore, filter_term_in, filter_term_out)
+    for subject in results:
+        for transcript in Xblastdict[subject]:
+            blasted_transcripts.append(transcript)
+    blasted_transcripts = list(set(blasted_transcripts))
+    if mode == "verbose":
+        F.write("--- %s ---\n" % dataset_name)
+        F.write("# %s\t%s\t%s\t%s\t%s\t%s\t%s\t%s\n" % ("SeqId", "%Identity",
+                                                        "AlignLength",
+                                                        "StartSubject",
+                                                        "EndSubject",
+                                                        "%QueryHitCov",
+                                                        "E-value",
+                                                        "BitScore"))
+        for subject in sorted(results,
+                              key=lambda x: results[x]["meanBitScores"],
+                              reverse=True):
+            F.write(" \n# %s\n" % subject)
+            F.write("# Suject Length: %s\n" %
+                    results[subject]["subjectLength"])
+            F.write("# Total Subject Coverage: %s\n" %
+                    results[subject]["TotalCoverage"])
+            F.write("# Relative Subject Coverage: %s\n" %
+                    results[subject]["RelativeSubjectCoverage"])
+            F.write("# Best Bit Score: %s\n" % results[subject][
+                                                       "maxBitScores"])
+            F.write("# Mean Bit Score: %s\n" % results[subject][
+                                                       "meanBitScores"])
+            for header in results[subject]["HitDic"]:
+                Fasta.write(">%s\n%s\n" % (header,
+                                           insert_newlines(results[subject][
+                                                                   "HitDic"][
+                                                                   header])))
+            Fasta.write("\n")  # final carriage return for the sequence
+            for transcript in Xblastdict[subject]:
+                transcriptSize = float(len(fastadict[transcript]))
+                for hit in Xblastdict[subject][transcript]:
+                    percentIdentity = hit[0]
+                    alignLenght = hit[1]
+                    subjectStart = hit[6]
+                    subjectEnd = hit[7]
+                    queryCov = "%.1f" % (abs(hit[5]-hit[4])/transcriptSize*100)
+                    Eval, BitScore = hit[8], hit[9]
+                    info = [transcript] + [percentIdentity, alignLenght,
+                                           subjectStart, subjectEnd, queryCov,
+                                           Eval, BitScore]
+                    info = [str(i) for i in info]
+                    info = "\t".join(info)
+                    F.write("%s\n" % info)
+    else:
+        F.write("--- %s ---\n" % dataset_name)
+        F.write("# subject\tsubject length\tTotal Subject Coverage\tRelative\
+                 Subject Coverage\tBest Bit Score\tMean Bit Score\n")
+        for subject in sorted(results,
+                              key=lambda x: results[x]["meanBitScores"],
+                              reverse=True):
+            line = []
+            line.append(subject)
+            line.append(results[subject]["subjectLength"])
+            line.append(results[subject]["TotalCoverage"])
+            line.append(results[subject]["RelativeSubjectCoverage"])
+            line.append(results[subject]["maxBitScores"])
+            line.append(results[subject]["meanBitScores"])
+            line = [str(i) for i in line]
+            F.write("%s\n" % "\t".join(line))
+            for header in results[subject]["HitDic"]:
+                Fasta.write(">%s\n%s\n" % (header,
+                                           insert_newlines(
+                                               results[subject][
+                                                       "HitDic"][header])))
+            Fasta.write("\n")  # final carriage return for the sequence
+    F.close()
+    Fasta.close()
+    return blasted_transcripts
+
+
+def dispatch_sequences(fastadict, blasted_transcripts, matched_sequences,
+                       unmatched_sequences):
+    '''to output the sequences that matched and did not matched in the blast'''
+    F_matched = open(matched_sequences, "w")
+    F_unmatched = open(unmatched_sequences, "w")
+    for transcript in fastadict:
+        if transcript in blasted_transcripts:
+            ''''list of blasted_transcripts is generated
+            by the outputParsing function'''
+            F_matched.write(">%s\n%s\n" % (transcript, insert_newlines(
+                                           fastadict[transcript])))
+        else:
+            F_unmatched.write(">%s\n%s\n" % (transcript, insert_newlines(
+                                             fastadict[transcript])))
+    F_matched.close()
+    F_unmatched.close()
+    return
+
+
+def __main__():
+    args = Parser()
+    fastadict = getfasta(args.sequences)
+    Xblastdict = getblast(args.blast)
+    results = defaultdict(dict)
+    for subject in Xblastdict:
+        results[subject]["HitDic"], results[subject]["subjectLength"], results[
+            subject]["TotalCoverage"], results[subject][
+            "RelativeSubjectCoverage"], results[subject][
+            "maxBitScores"], results[subject][
+            "meanBitScores"] = subjectCoverage(fastadict, Xblastdict, subject,
+                                               args.flanking)
+    blasted_transcripts = outputParsing(
+        args.dataset_name, args.tabularOutput,
+        args.fastaOutput, results, Xblastdict, fastadict,
+        filter_relativeCov=args.filter_relativeCov,
+        filter_maxScore=args.filter_maxScore,
+        filter_meanScore=args.filter_meanScore,
+        filter_term_in=args.filter_term_in,
+        filter_term_out=args.filter_term_out, mode=args.mode)
+    dispatch_sequences(fastadict, blasted_transcripts, args.al_sequences,
+                       args.un_sequences)
+
+
+if __name__ == "__main__":
+    __main__()
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/BlastParser_and_hits.xml	Sun Oct 15 18:43:37 2017 -0400
@@ -0,0 +1,94 @@
+<tool id="BlastParser_and_hits" name="Parse blast output and compile hits" version="2.5.0">
+<description>for virus discovery</description>
+<requirements></requirements>
+<command><![CDATA[
+    python '$__tool_directory__'/BlastParser_and_hits.py
+	--sequences '$sequences'
+	--blast '$blast'
+	--tabularOutput '$tabularOutput'
+	--fastaOutput '$fastaOutput'
+	--flanking $flanking
+	--mode $mode
+	## Additional parameters.
+    #if $additional_filters.use_filters == "yes":
+        --filter_relativeCov $additional_filters.filter_relativeCov
+        --filter_maxScore $additional_filters.filter_maxScore
+        --filter_meanScore $additional_filters.filter_meanScore
+        --filter_term_in "$additional_filters.filter_term_in"
+        --filter_term_out "$additional_filters.filter_term_out"
+    #end if
+    --al_sequences '$al_sequences'
+    --un_sequences '$un_sequences'
+    --dataset_name "$blast.element_identifier"
+
+    ]]></command>
+<inputs>
+	<param name="sequences" type="data" format="fasta"  label="fasta sequences that have been blasted" />
+	<param name="blast" type="data" format="tabular" label="The blast output you wish to parse">
+            <validator type="expression" message="Blast file must have 13 columns">value.metadata.columns == 13</validator>
+        </param>
+	<param name="flanking" type="integer" value= "5" label="Number of flanking nucleotides to add to hits for CAP3 assembly"/>
+	<param name="mode" type="select" label="Extensive or compact  reporting mode" help="display (extensive)  or not (compact) the oases contigs">
+	    <option value="verbose" selected="true">extensive</option>
+	    <option value="short">compact</option>
+	</param>
+    <conditional name="additional_filters">
+            <param name="use_filters" type="select" label="Use Additional Filters?">
+                <option value="no">No</option>
+                <option value="yes">Yes</option>
+            </param>
+            <when value="no">
+            </when>
+            <when value="yes">            
+                <param name="filter_relativeCov" type="float" value="0" max="1" label="Minimum Relative Subject Coverage" help=""/>
+                <param name="filter_maxScore" type="float" value="0" label="Minimum maximum BitScore" help=""/>
+                <param name="filter_meanScore" type="float" value="0" label="Minimum mean BitScore" help=""/>
+                <param name="filter_term_in" type="text" value="" label="filter the subject list with a keyword" help=""/>
+                <param name="filter_term_out" type="text" value="" label="filter the subject list excluding a keyword" help=""/>
+            </when>
+    </conditional>
+</inputs>
+<outputs>
+	<data name="tabularOutput" format="tabular" label="blast analysis, by subjects"/>
+	<data name="fastaOutput" format="fasta" label="hits"/>
+	<data name="al_sequences" format="fasta" label="Blast aligned sequences"/>
+	<data name="un_sequences" format="fasta" label="Blast unaligned sequences"/>
+</outputs>
+
+  <tests>
+    <test>
+        <param ftype="fasta" name="sequences" value="input.fa" />
+        <param ftype="tabular" name="blast" value="blast.tab" />
+        <param name="flanking" value="5" />
+        <param name="use_filters" value="no" />
+        <param name="mode" value="verbose" />
+        <output name="tabularOutput" ftype="tabular" file="output.tab" />
+        <output name="fastaOutput" ftype="fasta" file="output.fa" />
+        <output name="al_sequences" ftype="fasta" file="al_sequences.fa" />
+        <output name="un_sequences" ftype="fasta" file="un_sequences.fa" />
+    </test>
+  </tests>
+
+<help>
+
+**What it does**
+
+Parse blast output for viruses genome assembly.
+
+Takes as inputs
+
+ - 1. the fasta sequences that have been submitted to blast
+ - 2. a blast alignment in a tabular format. **Importantly** this tabular output must contains the 12 standard columns (see blast documentation), **plus a column 13** that will report the length of the subject sequence (slen). When you use blast tools prior using this tool, remember to **check the appropriate box** to get the 13th column in the blast tabular output.
+ - 3. the numbers of flanking nucleotides to be recovered at the ends of blast hit sequences
+
+The tool returns 4 datasets
+
+ - 1. the fasta input sequences that produced significant blast hits
+ - 2. the fasta sequences that did not produced significant blast hits
+ - 3. the sequences of the blast hits, plus the flanking sequences (as specified in the tool form). This dataset may be further used in metavisitor workflows to produce contigs of hits.
+ - 4. and the parsing of the blast alignments which summarizes the blast results by "subject" sequences (blast analysis, by subjects)
+
+This latter parsing dataset may be customized by tuning the reporting mode and/or using filters
+
+</help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/al_sequences.fa	Sun Oct 15 18:43:37 2017 -0400
@@ -0,0 +1,1228 @@
+>Locus_81_Transcript_1/1_Confidence_1.000_Length_155
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGATTAGCGCGA
+GTTTGCTTGGCATCGTTAAGCTTAGGTAACGATTCATCCACGGAGCCCGGCATAACGCCG
+TCTTAATCTTCTCCCAGCATGATCCGTGTAACTCG
+>Locus_10_Transcript_6/8_Confidence_0.333_Length_1121
+CGTTATCCAGCTGGATTATGTTGTTATTGTGTAGAAAATATAGGAGTCTCGAAGACTCTT
+TAGAAAGCATACATGTAGTTGCCTCCCTCGTTCTGGATGTACTGAACGGCCTGCTTGCAT
+ACTGATGTTAAGTGCAGAGCTATGTTTTCTCTTCCTCGCCAAAAAGAAAAACCACTTTTG
+ACGACTATCTTACTTATCCAGGGTGTTAGTATTGGATTCAATATCCCTGTTGGTTCAAGA
+GGGACTTTACCTGTTGCAATGTTAATTGCATCAGTCCTATGCCATCCTTTCCTTTCATAT
+TCCGTCATAGTTTTGTAAGCTTCAGGATACCATTTGGCCAAACATTCTTTTAGACTAGGT
+ATCTCAATCTTAGCTTTCTTCGCGATTTGATGTTGTCTTATAAATTCGCTGAATATTGGC
+ATTCCGTTTGGACCAGCCTCATGAGATTGAATCATACGTCTAGGCCAAATGTTATTTTCG
+CACGTTGGTCCTTCTGTTTTGTAAAACCTGTATGTGGGTACAACCGTCTTCTCCCATACC
+GGTTTCAACTTCCTTAAATTTTTGATATAATTGCTGGAAATGTGTTTTTGCGGTCCAGGA
+ATGTCGTCGGCTGCTATTTTCATTGAAAATTCGACTTGTTGATAAGCCGTCTTTTCCTCA
+TCTGTCATTTGCTTCCACGTCAAGTTGATGTTTTCACTAAACAGTCCAGGAACATCGAAC
+GTTGGGATGTCAGCAAGTGGTAGCTTGCTAGTAGTTTTCCACCCTTTCCATTCGTATATT
+CCGAAACCACCCAGTCGTTTAGGCAGGTGCAGCCAGTGATAGCTCTGTCCCGTGTATTTA
+CTCCACTTAATTTTGTTTGCTTGATGTAACCAATCCAATTGTTTCTTGCTTCTCCTTTCT
+AATAAATAGATATTATTAGCGGTTGTCTCAACTTGTTGATTTGCAGTCCATGGTTGTGGG
+TTCCACGGTTTCCTTTGTGTCACGCTAGGGATAGCCCGATTTGTCCAGCCTCTGACGCCT
+TGAGTAGATATTTCTGTCCTTAAGAATTCGCAACAATTTTGCATAATTCCAAACTTGCTG
+TTTTCTCCAACGGCGTTGATTGCCTGATAGCTATACCTAAA
+>Locus_20_Transcript_1/1_Confidence_0.000_Length_191
+CCCCCCCCACCTTCGCAATCACAGACAAATTAAACGTAAAACAAACGACATGGATGCATC
+CAACCCTATTATTTCAAGCGATAGGAGCACTGTGAATCAGGTTTATGCGAAGATGGTGAG
+GAGAAAACGGCAAGATCTTGCCTATCTCCAGGAGTTGGTGAGGACAGCCCATCGAGAGAT
+TCTCCCCCAAG
+>Locus_1_Transcript_5/7_Confidence_0.231_Length_163
+AATAATGAGGCGGAATCGCCGTCGTGGACGTGGCAAGGCAAAGCTAACGGTAAGCGAAGG
+AAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCGAAAGCTGGAGCTCAG
+CCACAGCCTTCCAACAACCGGAAGTGACCCCCCACCCGCTAAA
+>Locus_15_Transcript_1/1_Confidence_0.000_Length_436
+AGCCAGAGCATCCTGTCTAGCACCCCTCTGCGTCCCTGGTGCATCTCGGTGTACATTCTT
+AACTTACCTATTTAATCACCCATGCGAGAACGATACTACGAAGATACTGAACTCAATAAC
+CTCAGCTACAGTGAACAAGATAAACAGCTAAAACAAATATGTCAAACGAGTACCTTAGAT
+CAATCCTCATGCCTGAGAGAGGTCCCTCCAGTATACCAGACGACAACGTCCGCCGTCATT
+GCGTACGACAAGAAACAATCACTGCGAACATTGTGGTCGGATCTTCTGGAAAAGGGGCCT
+TTGTTCTGTTCCCTAACAATCCTAGCAGCCTTATTGGCGCTCATTTTAAGTATGATGACC
+AGGGCAAATCTTACAAATACACCCAATCACTCGTTGTCGCCCAACGCCTCAATGAGTCCT
+ATAATTACGGAAGAAA
+>Locus_58_Transcript_1/2_Confidence_0.333_Length_476
+CCGAGTCTCCTCGGAGATTGCCTTTGCAGCGTTTCTTGGTATCGGTTGGTCCAACTCTTC
+CAGGAATGGGTTCGTGTTCATGAATGGGTTCATGCTCGCGGACCCGGCTGTCCAGTGCGG
+GAGGGTCTGTTTTGGGGTTCTTCTCTTTACGTCTCCCATATCTTTTATCTTTTTGTCCAG
+AGATGTCAGGGTCTTTACTTGAACTAATCCTGGTGAGTTCCCAAGTAGTGGAATCCCAAG
+AGAGTCCGTCAATTGGAGTTTCAGGTTGATGCCAAAAACTTCTCCCACACTGGACCCGAC
+AACGGATCCTGTGAAAGCTGCAAATGGTGCCTTCCCCAAAACTCCACTCTTTAGTAAGTC
+GTCTGCTGCATAAATGGCAAGCTGGTGGGACGTTCCCGTTACCTTGTTTGGTGATGTCGA
+GGATGCGAGTCTTCCTTCTAATAATTGATAGCATGGTAGGAGGATGTAATCGCTTC
+>Locus_48_Transcript_1/1_Confidence_0.000_Length_372
+ATTGACGCGGCTCACCTCCGATTATCTCGAAAACCGCCCTAAGTTGTAGTTGTTGGGACG
+GCTTGTTCAGACGCTCAATCGTTTCCTCGATTGACAATGGGTCAAGGTTGTTGAAAGGCC
+CGTTCATCAACCGTACGAAAGTGTCGGCGATCCTCGCGATACGGTCGCTTGGTTTCTTGT
+CGTTGGCGACAAAGGTTACCCTGCGTTCAATTGATTCAGACATTGTCTCCCAGCGTTTAA
+TCATTGGCATCATCATACAGTCACTCACGATAGGCAAGGTGTATTGGCGTGCGCTCACTT
+CTGGTACATCTGCGTCACTGGTTACTGGCCAATGGACGCGTGGCATTGTAGGTTTATACA
+CAGTTGGACTAA
+>Locus_4_Transcript_4/5_Confidence_0.333_Length_1170
+GTCTTTTTCTTTCTCATTTGGTTCATGCAATTTTTCACCTGCGCAGGTATTTTTCTGTCT
+TGTTGTTGATCTTGTTGTTGCCTTTGGTATCTGTCTATTTATTGCTTTAAGTTCTCCGAT
+TGTTATTCGGGACAATGCGTCTGCGACATGATTATCCCTCCCCTTGAGATATTCTACTGT
+GAATTCAAACTCCTCCAAGTCTAGTCTCATTCTGGTTAATTTTGAACTGGGGTTTCTCAT
+TGAAAAGAGATGTGAACGCGATTAAGACTCATGGGAATGGTTTTGGCATCATGAAACCTG
+ATAGTAGTTGGGAAATTGCTCCACCTCAACCCAAGGAAAAATACCTCAGATATTACGCAA
+ATGGTGAATTCGTTGATATGAAAAACCTCGTTAACGAGAAACACCCCGTCATCGTTAACG
+ATTATTGTGAATTTGCCCTGGAACATGAAATGTATCGTATTCTCCAACCTATGGACCCTT
+CCAATTTTGCACCTCCACGGGAAACGGGAACAATGCAAGCTGGACCCGGTACTGGAAAAA
+CGACATGGATCCTGAAAGAACACGTGCCTTATTTTGCAGACAATCCGTCCACTGTCATAC
+TCGCGACGGTAGAGGGAAAAGACGACTTCATTGATCGTGTCAATAAAATTTACCCAAAAG
+AAGGCAATCGCGATTTGCAAAAAATATACTATCGCACTCTTGCAAGTTATCTGCTCCACC
+CCGAAAAGAACCGAAAAACCGATAGTATCTTTATTGACGAAGCCTTGATGTCCCATCCAG
+GAGCTGTTTTTTATGCTGTTTGGATGTCTGGTGCGTCAAAAGTTAGATTTCTCGGTGACA
+ACTTGCAAATTCCATTTGTAAACCGTTCTCCGCAGTTCAAGATGAGTTACGATCGTTTGG
+AAAAAATGGTCCCAATTGTCGGTTCACTTTTTATCTCGTACCGCTGTCCTGTCGATGTCG
+TTTATAGGTTTACCGACGACTACCGTGAAGTGAACAAAAAAGCAGGAAAAGATGTAGGTT
+TGATGAGTGCGCGCGACGGTGTTAATACCTGTAGGTTTGTCCGAATATCGACATTGAATG
+AGGTCCCGCTCCGTAAGGAAGTTAAATATCTCGTCTTTACACAAGCCGAAAAAACCGAAC
+TTGCCATGAAGAAATATAATGTCTCGACAG
+>Locus_31_Transcript_1/1_Confidence_0.000_Length_373
+GATATTATCTATAACCAGCAATCCCATGGACAAACTAGGAAATGTGGGAGTACTTGAGGG
+TGTAGCCGTACTGACATTACCAGCCAGTTATGATATTGATTATACACGACTGGCAGATCT
+ATCACCAAGCTCTGCTAAGAATGGATGCGTGGTCAATGACAGTGGTCAATCTCTCATCTA
+CACTCAGTACGATGAAATCAATTACACAGGATCTCAGGAAAAGCAACTGCTATCATTCAA
+CATTGATAGCAATATATTGGTCACAACTACAGCTACTCTTGACTTCTACACCACAGCTTC
+AGATGCCCAGGTAACCATTAAAATCAAGTATCTTGGCATTGATGGTCTAGTGGTGTCAGA
+GAATGAAATAATT
+>Locus_10_Transcript_8/8_Confidence_0.000_Length_1134
+CCTTTCGTGGGTATGTGACCAATAAAATGGATGTTGTGAAAATTCAGGTAATTCTTTTAT
+AATAATGATAAAAACGAACGAACGAAACGAATCACATATCCAAACTTATCTCGTTTGCAA
+GTTGGCAACTCCTTATGTTAATTTCCAAAACCAATGAGCAATACTATACTACTACTATCC
+TGACTATCTTTAATTCAAGAGTATGACTCTCTTCGCCTTATAATGCATTTTCAATATCCC
+TGTTGGTTCAAGAGGGACTTTACCTGTTGCAATGTTAATTGCATCAGTCCTATGCCATCC
+TTTCCTTTCATATTCCGTCATAGTTTTGTAAGCTTCAGGATACCATTTGGCCAAACATTC
+TTTTAGACTAGGTATCTCAATCTTAGCTTTCTTCGCGATTTGATGTTGTCTTATAAATTC
+GCTGAATATTGGCATTCCGTTTGGACCAGCCTCATGAGATTGAATCATACGTCTAGGCCA
+AATGTTATTTTCGCACGTTGGTCCTTCTGTTTTGTAAAACCTGTATGTGGGTACAACCGT
+CTTCTCCCATACCGGTTTCAACTTCCTTAAATTTTTGATATAATTGCTGGAAATGTGTTT
+TTGCGGTCCAGGAATGTCGTCGGCTGCTATTTTCATTGAAAATTCGACTTGTTGATAAGC
+CGTCTTTTCCTCATCTGTCATTTGCTTCCACGTCAAGTTGATGTTTTCACTAAACAGTCC
+AGGAACATCGAACGTTGGGATGTCAGCAAGTGGTAGCTTGCTAGTAGTTTTCCACCCTTT
+CCATTCGTATATTCCGAAACCACCCAGTCGTTTAGGCAGGTGCAGCCAGTGATAGCTCTG
+TCCCGTGTATTTACTCCACTTAATTTTGTTTGCTTGATGTAACCAATCCAATTGTTTCTT
+GCTTCTCCTTTCTAATAAATAGATATTATTAGCGGTTGTCTCAACTTGTTGATTTGCAGT
+CCATGGTTGTGGGTTCCACGGTTTCCTTTGTGTCACGCTAGGGATAGCCCGATTTGTCCA
+GCCTCTGACGCCTTGAGTAGATATTTCTGTCCTTAAGAATTCGCAACAATTTTGCATAAT
+TCCAAACTTGCTGTTTTCTCCAACGGCGTTGATTGCCTGATAGCTATACCTAAA
+>Locus_46_Transcript_1/1_Confidence_0.667_Length_178
+CAAGGCAAAGCTAACGGTAAGCCGAATGGTAACATCACTGCTGGAGAAACCCAGCGTGGT
+GGCATACCTCGAAGGAAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCG
+AAAGCTGGAGCTCAGCCACAGCCTTCCAACAACCGGAAGTGACCCCCCACCCGCTAAA
+>Locus_42_Transcript_2/2_Confidence_0.333_Length_597
+TTCTGAGGTACGGCCAAATGCTGCCAATCCTGTTGGAGTTAGGCTCTATGCCCACAGCCA
+CCATACCCAGGACATGAAGCTGTTGGGAGAAGCCTGGTCCTCCTCTGCCAAACTGGCTAA
+GGAATACATCTGTGCAGCTATTTTGGAGGTTAACAACATCCCATACAAGAAGTCTAGCTT
+TGCGACCCCTAATGTAGTGCCTCCCCCGCCTGAGTCTTCCTGGGCTCGGCAGGTTGAATA
+CGCAACTGCCCCTAAAGCTGTGCCACAGATTGTTCCCGTTCATGAAACCCTGGATTTGGA
+GCTGTTTCACAGTATAATGCAGCAATTCCCAGGGCACTGTCCCCGCCAGGTGCAGATGCT
+TATTAGAGAGGTAAGTCATAAAAATCCTGATGACTACCGTGTGAGAATTCAAGACTTATT
+CTCCCGGTTTCCACCTCCTAAAGTAGCATCGAAGAGATCACTGCTGAGCGCAGAACAAAG
+GACGAGACTCAACAAAAAGACTCTCGACCGCAAAAAGAGGAAGAAAATTGCAAGTAAGCT
+CTTGCCAACCCTATAACATCAAACAACCCAAACCTCAAATCAAGAATACAATTTGCA
+>Locus_8_Transcript_2/4_Confidence_0.200_Length_117
+TTTAGGTATAGCTATCAGGCAATCAATAACATTGATGCCAAAAAATATGTGACTAAAATC
+GAATTTATTTCCTGGGTCGTCGATTAGGAAATAAGAATGAGAGGTAAATGCGCAGTC
+>Locus_36_Transcript_1/1_Confidence_0.000_Length_445
+TGTTTGGATAAAACTCTTCGACCGTGGTGTACTTTCGAAATGGCCGACACGAGGAACAAA
+GTGCATTCGTTCTCCCTGAACATCCGATAAACGCATATTTTTCATATGAAAAGTAGCGTA
+TGAAGTGTTCACTGGACACTCCGACACAGTAAGTTCCTCGGAGTAGAAACCATTATCGAC
+GGCTCCGACTGTAGTTTTTAAGAGACGTCGTATTTTGTCAGGTGAGGCGAGTTGAAAGAC
+ATTAACGTTGTCCACTTTGATTTTTTTACACACAAGATCATCCGTTCTGCGTGTGTAATA
+GACAAGTTCTTCAGTATGACGAGTTAAAGCGACTAAGACGTACGGATGTCGCAAGAATAC
+GTCCGTCTGTGGATATTGGTTAAGTCTGACGAGGTATATGGTTTTAGCCTCTTTGCCTTG
+GAATTCATGTACTGTCGAGACATTA
+>Locus_1_Transcript_2/7_Confidence_0.231_Length_143
+AATGGCCTATAAAGCTGAGCACTGTACAATTCCCGGTTGCTACAGAGCAAGCCACCTCTT
+CACTAGTACACATTCTTGCTGGTTTAAATGGTGTATTAGCGGTGGGACCAGACAATTAAA
+ACGGATGCCAACATAAATGGGCA
+>Locus_4_Transcript_5/5_Confidence_0.111_Length_956
+ATCATTTGTCAACAGAATTCTACCATTGAAAAGAGATGTGAACGCGATTAAGACTCATGG
+GAATGGTTTTGGCATCATGAAACCTGATAGTAGTTGGGAAATTGCTCCACCTCAACCCAA
+GGAAAAATACCTCAGATATTACGCAAATGGTGAATTCGTTGATATGAAAAACCTCGTTAA
+CGAGAAACACCCCGTCATCGTTAACGATTATTGTGAATTTGCCCTGGAACATGAAATGTA
+TCGTATTCTCCAACCTATGGACCCTTCCAATTTTGCACCTCCACGGGAAACGGGAACAAT
+GCAAGCTGGACCCGGTACTGGAAAAACGACATGGATCCTGAAAGAACACGTGCCTTATTT
+TGCAGACAATCCGTCCACTGTCATACTCGCGACGGTAGAGGGAAAAGACGACTTCATTGA
+TCGTGTCAATAAAATTTACCCAAAAGAAGGCAATCGCGATTTGCAAAAAATATACTATCG
+CACTCTTGCAAGTTATCTGCTCCACCCCGAAAAGAACCGAAAAACCGATAGTATCTTTAT
+TGACGAAGCCTTGATGTCCCATCCAGGAGCTGTTTTTTATGCTGTTTGGATGTCTGGTGC
+GTCAAAAGTTAGATTTCTCGGTGACAACTTGCAAATTCCATTTGTAAACCGTTCTCCGCA
+GTTCAAGATGAGTTACGATCGTTTGGAAAAAATGGTCCCAATTGTCGGTTCACTTTTTAT
+CTCGTACCGCTGTCCTGTCGATGTCGTTTATAGGTTTACCGACGACTACCGTGAAGTGAA
+CAAAAAAGCAGGAAAAGATGTAGGTTTGATGAGTGCGCGCGACGGTGTTAATACCTGTAG
+GTTTGTCCGAATATCGACATTGAATGAGGTCCCGCTCCGTAAGGAAGTTAAATATCTCGT
+CTTTACACAAGCCGAAAAAACCGAACTTGCCATGAAGAAATATAATGTCTCGACAG
+>Locus_9_Transcript_1/3_Confidence_0.667_Length_681
+TCGAATAGACTCATTAGAAAGAACTGTTTCAATAGATGCCTTCTATCCATTCCCTCAGGT
+CATCAAAGAGGGTGGACAGGAGCCTGTAGCCGCCGTAGAGTTATACCTAACCAGTGATAA
+GTCCACTAGTATCACTGGGACAATTAGAAGCATTACCACTGCTCATAGTGCTGCTAGACC
+TGGTATAACATCACCAACGACAATAGTGGCTTATGAGGGAGTTCAATCCGGTGCTAGTAT
+CACCGTGGCTGGAGTGAGTAACTATGAGCTTATACCTAACCCAGAACTAGCACGCAATAT
+GGAAACCAGATATGCAAGAACTGACCCCTATGGCATGATATACACCAAGTATGTACTTGC
+AAATAGGGACAGATTAGGCATACGCAGCGTCTGGCCCACTAATGACTATAAAGCCAGGTT
+CCCATTATTCGAGGAACTTGGCCTCATGCAGTCAGACGCCAGTATCACAGAGGCCATGGC
+TTTCGGTATACATGATGTTATATCATGGATACGTGGCCTAGTACCAGCAGCCTCAGACTG
+GGCCAATCGTATGCTACCAGGTTCAGGGGATGTGATTAAAGGAATCAACAGAACCGCAGG
+GCACCTTCTTTATGGAGAAGCTGCCTCAGGCCGGTTGATAGCACAATCCGCGAGCGGATC
+ACTAATAGGTCAGCTGGGGCA
+>Locus_7_Transcript_9/11_Confidence_0.154_Length_552
+AAAACGATTTCGATACTTTCGCAACAAAAGGAAGCAAGATTAGTGCATTTGTCAAGCGTT
+TTCCCTTCGACAAGGATGATGCCAAAGCTAGATGGGCAGAGATCAACACGCTGACGGGCT
+ATTTGCAGAATGATTTTGGAAACTTCGATTACGATAAGGAATTTGAAGCTTTAGCTACCG
+GAGATAGTAACCACCCCGCTTGGTGGGAAGAAGTATTCACTAAGAAAATAAAAGAGTTGA
+TGACACATCAAGAACACAAAAAGTATATCAGTTTTGAAAAATATGTTAAGGAAGGATATT
+GGATAACATCTGGCAGCAGCAGCATCGGCAAAGTCAATTGGTCATATGACGGAGACTTGG
+GCAAATTTAAGGCTAGAAAGAACATGTTATTAGATCTATATACGCCGGACGAAATCTACA
+AAATGGCTGTAGAATGGGACGGGAAACTAGAGAATAGAGTGTTCATCAAAGATGAATTGG
+CAAAGAGAAGATTGGCAGTGGCAAGCAATATTGAAGCATATTTGAATCAAGGGTATATAT
+TTTATCTATTTG
+>Locus_60_Transcript_2/4_Confidence_0.400_Length_217
+GCCACAGCATCCGCAAGACGTCCATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATG
+TCTGGGAGAAGATTACACGTGACAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAG
+ACGGCGTTATGCCGGGCTCCGTGGATGAATCGTTACCTAAGCTTAACGATGCCAAGCAAA
+CTCGCGCTAATCAATGGGAATGAGCTATCAGGACGCA
+>Locus_44_Transcript_1/1_Confidence_0.000_Length_557
+TACAATGTCATTGTCCTCTCCACGCACTCTTCGCAATCGGTCAAGTGCGGCCCTCCTTCC
+GGGGGGATCAGTTTGAGCAGTCTGAGCTGATACAATTCGGCGTGGGGCTATTCTAGGAAC
+AGTTGCCGGTTGGTTGACAAGTGAGTGCGAAATAAGCCTGCGGACAGCATGACTTAATTC
+CCGAGCTTGTTCCTGGGATGGCCCCTTCCCTTGATTTCTGTCGTATATGTCGTCGACAAG
+GTCCTTAACAGCATCGGCTTGTTCTTGGGTTGGTGACGGCCCAAGCATCATAATGTAGCT
+GTCATAGTGTCGTCTTTGGACACGAGGTGGTATTGGCTGGGACCAATCGTCACCCTTTAA
+CCACATTATGATTTGTATGCCAGTAGGCAATGACTCCTGCTCCATCCAATAGGATACAAA
+GTCATCCACAGTGTACGACTCTTGGATCGAGGCGTTATTGCTATAGATTCTCCGTAACTT
+TGCATCCTTTTGGTTCTTCCGAGCAATCCTCATTGCTAGTTCCGTGTCTTCTTTCGATAT
+TCTTCCTCTTGACATTA
+>Locus_42_Transcript_1/2_Confidence_0.333_Length_3138
+TCTCCCCCAAGGAGAACTTCTCCATGAGTCGGAGGCCAAACAGTATGTAGCCGAATATAA
+GGCTCGACTACCTGTGGTTGACACTAAGAAAGTTGGCGAACTGCCAACTGAGGTCTTCCA
+GGTAGCACTCCCAAGTATCCCTGTTTGTGGGATTATGGATGCTGTTGGTGTCCCGTTGCA
+CCCCCCATCCATTAACAATCGGGGTGGGCATACTCATGTCACTCGCCAGATGGGCGGAGT
+ACCCCACCCTCCTCTTGGTCTAATACCCATAGCTCAGAAGTATGGGGTAGAGATCTTGGA
+CCAGAAACATGTCTACACAGGAGGCACTTGGGATGGCTTTCTTAATAGACTCGCCCAACA
+GATGGGCCGGACAACGGTCCCCCTGGCAAGAACAGTTTCAGCAGGCAAAAAGAATGCCTC
+TGATAGGGCAATCATAAAACTGTTAAATAAATACATGCCTAGGACGGGAAATAAGAACTG
+GCCTGGTGTCCATACAACCCCGGAAGAAGGCATACTTGATGGTATCAAGATAACGGCCAA
+ATCCAGTGCAGGCGCTCCCTATTGGAGACACAAGGGGGAATGCCTAGACCATATAATTGA
+TACTGGACTTCCTGTTGTGCTAAAGCATATAAAGGAAGGAACCCTCAACCAGTTGTGGCG
+GGAAAACCCTGAGATGTTCCTCGTTGAAGTTAAGAACAAACTTGATAGATACGAAGTCTC
+GAAGCTTAAAGAGAAGACTAGACCCTATGTGTGTGTACCTGCGCACTGGGCTCTCCTATT
+CTCGTGCTTGACTCAAGGATTCCAAGAAGGACTTCAAGTTTTTAGTAACTTGGACCCCAG
+TACAGAATGCTCGAATGCATATGGATTTTCATCCATTGCTGGAGGGCTTACTAGGATGGT
+CGACTGGATGTATGCCTGCCCAAAGCGGCGGGGACGGGTTGTCTGTTACGGTGACGATGC
+ATGTATAACATTTTGGAGCCAGGGCGTCCTCTATCGGGTGGATCCAGATTTTAAACAAAT
+GGACGGGTCCATAGATAGAGAGGATGCAAGAATCACCATTGAGTGGGTCCTCCACCATCT
+CAGAAAGGATTTAGGTGTAGAGGAGACCCCTGCTTTTTGGAAGACAGTTGCAGCAGTGTG
+GCTTGATATGGCCATTGACCCCCACTTTATCGTGGATGGTAAGACTGTTTACAGGAAGAA
+GAACCCCCATGGACTCATGACTGGAGTTCCAGGAACAACCTTATTTGACACTGTGAAATC
+TGTAATAGTCTGGAACGAAATGTTGGATCAGGCTAGTGCAGGTTCCATAGACCTTTTAAA
+TGAAGCTCAAGTAGTTAAATGGATGAAGAGACAAGGCTTGGTTGTCAAAGAGGGAACTTG
+GAGTCCGGTTGCACTCCCTGCAAGGGACACAGAGGGTCTAATTACGGACCACAAATTTCT
+TGGTGTACAAATTATGGGAGTGTACCACAGACACCGTGTGATACATGTCCCCACAATGCC
+TGAGAGCGATGCTCTTGAGATGATGCTCTGCCAGAAGGATAACCCCTTTGAAAAGGCAGT
+ATCTAGAACTGCACACCAAAGAACTCTGTATGACCGTATGAGGGGTTTAATGATAACAAT
+GGGATTCAGCATACCTCGGATCGAAGAGACAATACACGCTGTGGTTAATACAATCCCCGG
+CGAGATTATTGTCATGCAAACGCAAGAGCAAACCGGAACGAAGCCAGAACATATAACCCT
+CCAGGACTTTGAATATCCAGATTCGTCTGGATTCCCCTCTCGGGACTTCTGTCTAGACCT
+CTATTCAGATGGAGGGGATGACAAAGCGGGATGGATTAATCTGTTCCCCACATTGTCAGG
+ATTCCTTGACGAGTTTAAGAGGGAACAGAGAGTGGCTGTGAGGCAGATAAATTTGACAGT
+CCAATCCAACGACTATGATGTCAAGGAGGTTGTAGGATGTCCTCCTCCTCCTGAGGCGAA
+TCTGAATGATGAGTACAAAGTGTTTGAGGCTCTTAAACCTCAGCAAGTCCAGTATTCAGA
+ACCGAACCCCAGACCCAAAGTAGTTCGGATTACAGAAAGTGGTGACATCCCTGAGAAATT
+CCTACCAAATATGGCTCAAGCCGTCGTTAGATGGCTTACCTCAGTTGGAGGTGTTTCTCA
+GGTTGGTACTGTTGCCGATAAAGTTGGAGCCAGTGCCTACCAAATTGTTGTGGGTGCTGC
+TAAAGGGGGCTATTTCACTACTGGAGATGAACTTGGAGACTTGATTTCCCTATACCCACT
+AGTGACTCCCTTCCCTACATTGCAGGACAGTCAAAGAGAAGAAATGGAGGAAAATCGTAA
+TCTGATTGATAGGACTACTGCAGCCAGAACGTCAGCTTTGAGACGGGGGATTGTAAAAAC
+CCAACCTGAGCTCATTAATCTGGACGTTGCAGGAGTATCCAACCTCCATCCACCTCCCTA
+CGATATAAATACAGCAGAGGATGCCATGGCATATGTCCATGCAGTGGTCAGCGGGAGATT
+TTCAGGATTCACTAAATGGATATCTGAGGTACGGCCAAATGCTGCCAATCCTGTTGGAGT
+TAGGCTCTATGCCCACAGCCACCATACCCAGGACATGAAGCTGTTGGGAGAAGCCTGGTC
+CTCCTCTGCCAAACTGGCTAAGGAATACATCTGTGCAGCTATTTTGGAGGTTAACAACAT
+CCCATACAAGAAGTCTAGCTTTGCGACCCCTAATGTAGTGCCTCCCCCGCCTGAGTCTTC
+CTGGGCTCGGCAGGTTGAATACGCAACTGCCCCTAAAGCTGTGCCACAGATTGTTCCCGT
+TCATGAAACCCTGGATTTGGAGCTGTTTCACAGTATAATGCAGCAATTCCCAGGGCACTG
+TCCCCGCCAGGTGCAGATGCTTATTAGAGAGGTAAGTCATAAAAATCCTGATGACTACCG
+TGTGAGAATTCAAGACTTATTCTCCCGGTTTCCACCTCCTAAAGTAGCATCGAAGAGATC
+ACTGCTGAGCGCAGAACAAAGGACGAGACTCAACAAAAAGACTCTCGACCGCAAAAAGAG
+GAAGAAAATTGCAAGTAAGCTCTTGCCAACCCTATAACATCAAACAACCCAAACCTCAAA
+TCAAGAATACAATTTGCA
+>Locus_17_Transcript_3/3_Confidence_0.200_Length_456
+GAACAATCATGTATTAACCACTATACTGATGAACAAGTGGTCTGAGATAGGTAAGCCACA
+ACCCTCCCCGGATGTTATCGAGAAGCTGGCCTCAATGACAGGAATTGATTTCAAGGTTGA
+ACTAGTAGTGACAAACTTCAGAGAGAAACTAATAGCAGCTTCAAGGCATTCGATCCCTAC
+AAGTAACAGGGTTGAACCCAGAACAATTGTAGAGATGGACATGCTGGGCTGGGACGTAAC
+TCACACGGAGTTTGGCTTCACACCGGTACTGTCAAAAGAACGACTATTCAAATCAATAGC
+CTGCCCACAACCACCAAGTAGCACCTTTCAAACGAGCGTGGCAAAACAGGTACACAAGTA
+CATTCAGAATGTAGCTCTGTTGTACGTGGGTGCCTGGGCTTATCCATGCATAGCACAGAC
+CGTAGAGGGGTATGCTCTAAATCATTGGAACACTAT
+>Locus_56_Transcript_1/1_Confidence_0.000_Length_450
+ACCTTCAAATAAGGCCGACAGTCCACTAATGCCGCTTGCGGCGACACCGATAGGGCCAGG
+AATGTTGCTTGCAGCAGCTAAGGAGGACTTGATGATAGCTTTAACTCTCTCCCACATTGA
+TGCGTTTTGCGCTGCGATGACAGCAACCGGCAAAGATTTGGCAACCGTACGGTATTCTTG
+AAGTGCTACCTCATCAAGAGGTGGCGAGTCATGGCCGAATTGATACAGCATAGCATTAGG
+ATTGGGTCTGTACTCAATGCAAGACCATGCCTTGAGTATGGCGGAGTTGACTGCGCCAGT
+GGGGGCAGAGACACGGATGACAATGGTGTCCATATTACCCCAGCCAACAGTGCCACTGGT
+GTTTTCGTCTCCTGCGGACAAGGTAAACGGTTGGCCCGTAGAACCTATATCCACATTAGA
+TGGTGGCAATGTTTGGATACCCTCCAATAT
+>Locus_35_Transcript_1/1_Confidence_0.000_Length_166
+CCTTGAGCGGGGCTATAGTCCAAAGAAGGTGCTAGACCTGTACGGGTGGCGAAGCGAACG
+GTTGGTTGCTCCTTGGAGTCGGGTTGCCTGGGATCGCAGCCCAAAGTTGGTGGTAGACCT
+CATCTAAGGCTAAATATGGCCACGAAACCGATAGCAAACAAGTACC
+>Locus_73_Transcript_1/1_Confidence_0.000_Length_164
+TCGGATAATATCCGGCTTTCCTGACATCCTTTTCATCCTGAAGGTCTCCAGATACACATT
+AGCGTACTCGGATATCGTTCTACATGCCGAGCATAATCAACATTGGTATTATCCTGGAAG
+GAACCCAACTGAGATCGCCGATGGGGTTTGTGAATTTGTCAGTG
+>Locus_82_Transcript_1/1_Confidence_1.000_Length_165
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGCGAGTTTGCTTGGCATCGTTAA
+GCTTAGGTAACGATTCATCCACGGAGCCCGGCATAACGCCGTCTT
+>Locus_7_Transcript_4/11_Confidence_0.154_Length_571
+CAGGATGAAACTGAAGTTAATCTGTTTCCTCCAACTTTATTACCGGATATTTGGGTTCAA
+TATCCAGCGACTCACACCCCAATCATGTGTGCTTCGTTCCCACCCGTTTTCGGCCAAGAC
+TCAACACAAGGGTTCGGCAAAGAATCACAACTTATACCCTTTCGAAACGCAAACAACAAT
+CTTGTAGCACCATACGTTGAAGCTTTCGTTGCCAATCAAGCTTATTTCCCGATAGGATCG
+GGCCCAAACATCAACGACAAGGTTCTGTGGAATAGTAGATTGTGGATGACAAGTGGTTTC
+GTTCAGTACTTGGATTACGCTGGCAACGCAATCAACGAAGTGGTTCCTGCAGCAGGGCTA
+CCTTTGGGTAGGTCAATCCCATTACTGCCAGGGGAAGTTCAGCCGGTTGGTAACACCAAC
+ATGAGCACAAGCTGCGTTCCTCGTTATTCTGTGGACGGTCGCCGAATTTTTACTTATGTC
+AACACAGCTCAATCCGTTCCTTTGATACAAGCGTGTAATAGAGCCAATAGATTGGCCAGA
+TCGGCATGGCTATTATTGCATGTCTACATCG
+>Locus_3_Transcript_5/5_Confidence_0.250_Length_1016
+CTGGTTTTCTTAACTCCTTTTACCTCAACCTCAGTCTCCTCAATGAAGAGGGTTGGTAAA
+TATCTCAAGGATATTGTCTGAGAGAGGTCTACAGCGTTTATGGGTAGTGTTTTCTCTAGT
+ATCTTGCTGAATGATTCAAGATCGTATCCCAGTTCCTTTAATGATTTGGGTAAGAACTTT
+CCGTCAACTCCGTGTCTTATGTTTTGCATGTCTTTCAGCCTAGCCAGTTGTCCTTGCCAT
+GTGCCGCTGCTCAGTCGGTAATCGATACAGGCCTGTCTGCAGCGCTTGATAGTGGTATCC
+ATGTCCGTAGGATCAGCTATTCTGTCTCTCTGGACTACATACCCTTTGGCAGTCTCAAAG
+TTCCCTTGTGTTTCTTTACTTGCCAGCCATTGGAAAGCTATAGCATTCAGTAGCTTATCA
+TCATAGGTGCCGGTTGTGAATCTGGGTCGATAGAAGGGAATCTTGGGGTCGCCATCAGGT
+AAATGTATTTTGGTGCAGTCTTCATAATCTTTGGGGTTACCACTTTCAAGTTGTAGTGTG
+CGAATGGTTTGGAGGTATCTTACTATCTGCTCATCTAGGACGGAGCTCGCTTCAAACTCT
+AGGTTTTGGCGTAGATAGTAAGGTTTGAATGCGTGTATTCTGCGTTTGGCGATATACTGG
+GCTATTTCAAGCACTCTTGTCGAATTGACAAGTTTGGTCTCATTCATATTAGGTTGAGGT
+GGTTTCAAGTAACTTTCTGTGATTAAGTCTGTAACTGAAGAATCGTCTTCGCTCTTGATT
+TTGAAAAGCTCGCTAAAGCGGTGCTTTGCACTACCAGTATTAAAGACGTCAGACATAGTT
+CGTTAGAATGGAATGTAGAAGTTCGACAGTTAGCGGGGGGTGTAGAATCATTCCCCCGCC
+GATGGGAGGAAGGATGCCGGTGATGCGCCTTACGACACCTTAAGGTGTCATAGACACGGT
+GAGGTGGCAATTAGGGCGCACCGTGGGGCACCCTTCACCGTCAACCCTTCTTATCC
+>Locus_66_Transcript_1/2_Confidence_0.333_Length_255
+GTACATGCATGTACTGACGAACTATCATGTCGATGAGAGGGAAGCATCGAGCTTCGATTT
+CTGGCAACTACTGAAACAGATAAAAAATGTTGCTGTGCCCTTGGCAGCCACCCTTGCCCC
+CCAGTTCGCACCAATAATCGGTGCTGCCGATGGGTTAGCCAATGCACTATTGGGTGATAG
+CGCCAGCGGAAGGCCTGTTGGCAATTCCGCTAGCGGTATGCCCATTTCAATGAGTAGGCG
+TCTTAGAAACGCTTA
+>Locus_7_Transcript_1/11_Confidence_0.154_Length_1632
+TGCGATATTAGAGAAGATCCTACTCTAATATCATACGGATTCCATGGATCAGACGAGGAA
+GACCCATACAGCCGATGAAGATGACAACTGAAAGGAAAACAAGAGGATACAGGTGCTTCG
+CTTTGTTCGTGAGACGGCAAAGATTTGAACCTTTTTAGAAACAATTTAAATATGCTGAAC
+AACTATCACAATAACTTTAACAGTCCTAGCCTGGCTATGATGGACGATGACAAAGCTTGT
+GTTGATGATGGTTGTAAGCTAACAAAGTGGTGATGAGTTGGTGATACCCTCACTTTGGTA
+TTTAATTGTAGACAAGATGGAACATTAGCATCCGAGGTCACTACGTTCCGGAAAGAAACT
+CAAATACAACAGGAACTGATGGGAGAATATCTGACGAAAAATGGAAAACGGGACAGGATT
+GACAAAATGAAAGGATTTTGACAGCTCGGAACAGACGGCAAAATGGAACAAAAGTATGAA
+ACAAGAAACACGTGTTCCTCAGTCTCACATTGAATATCCAGATATCGAGATGCACCTCAT
+ATCTGAGAATAAACAACTACAACCAGTAGAAGGTGTCAAACCAAATCCCGGACCATCAAT
+AATTGAGCCAAATCATGGACCAAGCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCA
+ACGACAGCTGGCAAAACAAGACCAAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCT
+ACTGGACGATCTGACCGAATTAAAGACTACGGTACAACCACAGATTGACAATTCGGGATT
+CTTGGCTCATGTTGATCATGCAGCTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGT
+GATGAAATACATTCTCACGAATTCTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTAC
+TGATATACCCGACGAGCCAGTAGAGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAA
+AGAGAAAAAAGAAGAAAAAAAAGATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACG
+AGAATCGATGGCAATGCCAGCCAGTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGA
+AATTGAAAGGAAAAACGTCATCAGGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTA
+CAAGCTTGTACTATGGTTAGACAAACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGA
+TGAGCTTTGGGGAAGTGGTTGGCAGGAACGAAATAAGATGAACCAGTATGAATGGTTGTC
+TTACTGCTGGGCAAATAATGTCACTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGA
+CATCAAATGGCAACAACTACCTGCTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGC
+TGATCTTGAAGCTCAAAAAACTCACAATAAAGTGATGCATGCATACAACGGTAACCCTTT
+GTGTCAGGGATTTCAAGAAGTTGAAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAG
+TAATTCAGTTCTGAAACCATATACTGGACTGGAAGCTGAGAAATACATCACCAACATTGT
+AGGAGACATGAATCCGAATCAATCAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCA
+ATACAATGCCAA
+>Locus_59_Transcript_1/1_Confidence_0.000_Length_123
+ATAAACATCAATTATGGAAACAACACCAATGGTGACAGCTCGTTCAGTGTGGACTCATCA
+TTTACCATCAATGTCATTGGGGGCGCCACCATTGGCGTCAACTCTCCAACAGTCGTTGTT
+GGT
+>Locus_21_Transcript_1/1_Confidence_0.000_Length_919
+TTAAGAAAACCAGTTACATAGATAACACACCCAAACTTAAACCTGACAGCAAGGCTGGCC
+CTCCCTTCCAATCTAAGTATAGGAAAGGAGACATGTTCAGTAGTATACTCGCACTAGCAG
+ATGACGCACTGCTAGGACTTAGTGAAGTTATACACGGTAGAATGGATAGACATAAGTATT
+TCAAAGACAGAATCTATCTTGCGATGTGCTTCCTGTTCCCTAAAGAAGAAAGATATGAAG
+CGAGTAAGTTAACCACGAAAACACGCAATATAGCAAGCGTGTGTGGAGTCACACATTACT
+TAATGCTCCATGCCATGGAACCCGTCATGGAGAAGAGTAAATGGAATTGCATGTCCTCAG
+AAACCTATGAAAACCCCAGCTTATCAAAGTTCACACCTTACTTCGGCAATTTACAGAAAT
+TCTTAGACTTCGGCCTGCATCGTGAGAAGAAGAAGGTCTTTATGCCTAGAGGGGCAAAAC
+CCACACATAGAGACTTTATTTATGCAGATAATTGGTACATCTTCTACCGAAACGAGGACG
+GCACTACTGACTACTACTCCCTTGACTTGGAGAAGGGTGAAGCTAATGCGACCCCCGACA
+TAGCCCAATGCATTAGCTACTACCTTCTAACGCGCGGTTGGATTAGTGATGACGGTATTG
+TGGGGTTCGGCCCGACCTGGAGTACATTTTTAACACAAATTGTACCAGCATGTATAGTTG
+ATAATATATCAGTATACTACAACATGCAATTAAGATTCCCAGGACAGGCCAGTGGCAACA
+CATACACATTCCTCATTAATCATGCTGTGACGACCAAGTTAAGGCAGGAGTGGCTCAATA
+GAGGGTGTCCTCGGCCAGGCTCAGCAGAGTTCACTCAATGCTGCAAGAAAACAGGAGTCA
+ATACAAAAATAGAATTCCA
+>Locus_10_Transcript_2/8_Confidence_0.111_Length_1023
+GTCGTCGGCTGCTATTTTCATTGAAAATTCGACTTGTTGATAAGCCGTCTTTTCCTCATC
+TGTCATTTGCTTCCACGTCAAGTTGATGTTTTCACTAAACAGTCCAGGAACATCGAACGT
+TGGGATGTCAGCAAGTGGTAGCTTGCTAGTAGTTTTCCACCCTTTCCATTCGTATATTCC
+GAAACCACCCAGTCGTTTAGGCAGGTGCAGCCAGTGATAGCTCTGTCCCGTGTATTTACT
+CCACTTAATTTTGTTTGCTTGATGTAACCAATCCAATTGTTTCTTGCTTCTCCTTTCTAA
+TAAATAGATATTATTAGCGGTTGTCTCAACTTGTTGATTTGCAGTCCATGGTTGTGGGTT
+CCACGGTTTCCTTTGTGTCACGCTAGGGATAGCCCGATTTGTCCAGCCTCTGACGCCTTG
+AGTAGATATTTCTGTCCTTAAGAATTCGCAACAATTTTGCATAATTCCAAACTTGCTGTT
+TTCTCCAACGGCGTTGATTGCCTGATAGCTATACCTAAACACCAGACATGTCATGAAATC
+CTTAGCTAATATTTTTGTGTCGTCGCCTTTCAATGCTATTAACCTAATGTTATCTTTGCC
+CAATATCAAACTCGTCTGATCTCTTGCTATATCCGTTGTTATCATATTCCAGACATTGCC
+GATGAAACTTGTTGGACGTATTCCAGAAGGTATGCCGTTAGTCTGTTTCTTTGTTTCCTT
+TGTTAACGGTGAGTACAGGTAATTATTGTCGTAACACGAAATATTTTTCGCAGCTATTTT
+AGTGAATAAATGTCGATCTTGTGGAGGTACCAAATATTTGATTTGGTCTATGACGCGTTT
+CGTAATCTGCTTCACTTCCCAAATTGTTGGTTGTCTGTCAAACCCTTTGAAATCAAAAGG
+TAGGGCAAAACACCCGTCTTTCAATGCTTTAATTGTTTCACAGTTCCTAAGATGCGTTTC
+ACCTGGTGTTTCGTCTAATGTTATGTATTTCCAATTTTTAAAGCCATGTCCAAATAGATA
+AAA
+>Locus_69_Transcript_1/1_Confidence_0.000_Length_164
+CCAGAGGATTGGATGTTATTGACAGGATCCTATCGTAAGAGTAGTCAGACACTTCACTCA
+AGGTCCCTTGGAACCAGACTGCATTGAATGTTCCATTCAGTGCATAAACACCCGCAGGTA
+AGGTGCTGGACTTAATGCTTAGCGAGCCTGAAATCAGTCTGCCA
+>Locus_12_Transcript_1/1_Confidence_0.000_Length_1279
+GGGGGGGTCTCTCACGCTAACAATTACTAATTTGTCTGGTGTTCTGGACGATCCCCGTAT
+TATTCCCCCGGGTCTGCAATATCGTCCAGCTCATCTAAATCAGTTACAGATCTTCCTCAT
+GCTTCCTTATTTCTCCCAACGCATCTCTACTCCAGCTGGCTTGCTCAATATCGCGAAGCT
+TGCTAATCCTCTGCTTTTTCTTGAGATTCTTTTTCTGGCTTTTTGTTAAGCTAGCTGGTA
+TGGTTGAGGAGCTTTCAGGGAAAGTGTGCTTGCCCACTAGTGTTTGAGCTCCTTTGTATC
+CTAGTGGGTCGGCTAATTTTGTAGGGTCCTTCTCGTAAAAGGCCTCTATGTTCTCATAGT
+CTTGCACCTGTGCCTGTTGGACAACCCTTATAGACTTCCTCATAGCCTCTTCCATTTCAT
+GTTGGGCTTGGTTTATCCAGTGTGTGAGCTTGTCCATGAAGTCTTCAATTTTCATTTTGT
+TGTTGTAGACTTCATCGAGTTCTGAGTATAAGTCTTCATATTTACCCATAATTGTTATTA
+TTGCTTCTAATGATGGGAATGTTTTTATGACTTCCTCCAATTTGCTCCTAACATACTCTG
+GCTTAGCAAGTAATTTTTCTGTATGAGAGGATGTTAGATTGGTCAGACTCTTTTTCAACT
+CTTGCAAGTCTGCCATTAACTCTGGTTTTGATAGGTGTCTAGGTTTGGGCTTCACTGGCA
+TATGCTCGGGGCTGGTCTGCTTCGGTGTGTTGAGCCGAGTTAATAGCTCGTGTGTCATAG
+AGAATTCAGGGTTCAGAGCCAGTTCTGTTGTTAAGCCAGAATCCTCCATGGCGCCCCACA
+GGTCTGGTGCAAGGTCCTCTTGACCTAAGAATGTGCTTGTATCCATCTTGTGTCTTTTGT
+CTACTATGTTGGTCCTGATGTTTGTAGCCATGTTATGCAGTGCTTGATCTGCTAACGGGA
+TAGTCCATCCTCCCATAATTCTGAGCACTTCATAACGCACCAGGTTGTAAAGGTTCCTTT
+GGATGTAGTCCTTTATTGTTTCACCACCTTTTCGGGGCCACATCATTGATGGATAGAACC
+TTTCTTCAGCCAGCACAGGTATGAATATACCCAACTGATGGCTGTAGACAGCATCATACC
+CTAGTAAATCGAGTTTAAGTCTTGGTAACGCTTTCTGGAACCAGCTTTGTCCATTCGCGT
+CCACACTGTCCGTGCTGTCACCTTGCAGAAAGCCGACGTTCGGTGTGTTAGCGATTGTCT
+CTTTTACTTGTTGTTCTAA
+>Locus_10_Transcript_3/8_Confidence_0.222_Length_529
+CAGGAATGTCGTCGTCGGCTGCTATTTTCATTGAAAATTCGACTTGTTGATAAGCCGTCT
+TTTCCTCATCTGTCATTTGCTTCCACGTCAAGTTGATGTTTTCACTAAACAGTCCAGGAA
+CATCGAACGTTGGGATGTCAGCAAGTGGTAGCTTGCTAGTAGTTTTCCACCCTTTCCATT
+CGTATATTCCGAAACCACCCAGTCGTTTAGGCAGGTGCAGCCAGTGATAGCTCTGTCCCG
+TGTATTTACTCCACTTAATTTTGTTTGCTTGATGTAACCAATCCAATTGTTTCTTGCTTC
+TCCTTTCTAATAAATAGATATTATTAGCGGTTGTCTCAACTTGTTGATTTGCAGTCCATG
+GTTGTGGGTTCCACGGTTTCCTTTGTGTCACGCTAGGGATAGCCCGATTTGTCCAGCCTC
+TGACGCCTTGAGTAGATATTTCTGTCCTTAAGAATTCGCAACAATTTTGCATAATTCCAA
+ACTTGCTGTTTTCTCCAACGGCGTTGATTGCCTGATAGCTATACCTAAA
+>Locus_9_Transcript_3/3_Confidence_0.000_Length_1571
+ATCCGCGAGCGGATCACTAATAGGTCGGCTGGGGCACCGGGATGCCTTGGCTTGTGATGT
+AGACCCAACGCTCATGGGTCACAATGCAGCACAACTCATTTGTTACAACACAGCCCTGGG
+AGTAAGGAGTACTGGTAATCGTATCTACATGATACGTTTAAAAACTCCAAAGCGCAACCC
+CCGTGTTACTATATTTCCCGCTCTAGTATTCAACACAACACCATTAGGACCGGAAGTTTC
+TGGAACCCAACTATATGCAGTCATAGAGGGGTTATACAACCAGGTCCCACAATCCAGATT
+CAAGGTTACAGGCAAGAACGGACGCACAATTTATGGAATAAAGCCTGGTGCCTATATACC
+ACCGGGCCCCAATTGCACAGTTGTGCCCATTAGCTCCATAACCCAGAATGAAATAACAAC
+CACAGCCACCCCACCAATACCAAGGGGTGGAAGTATGGAAGCAGCCTTAGCCCTGTTACA
+GTACATTCCCCCTGGAGTGACTCCATTTGCAGTCACAGGCAATGTTATAGAAGGTAAAAT
+AGTGCCCAACAAATGGGCTGATCTGAAGAGAGAGGGAATGAAAGGAACTGGCATACCACT
+TGTAACAGATCAAGATTACAAGACCATCAAGGACCTGGCCAAAGCAACTGAAATGTTGCA
+GAGAATAACCACTGCGCAACATCCAGCAGTGATTGGAACGATAGCCAGTGCCATGGATTA
+TGACGACTTTCCTCCACCTCCTCCTCCGGTCACAGATGAAAACATAATGGAAACACTGGA
+GGATCTACTTGTTGCAGCCGCCGATAGAGACCCTAGGATGGCTAAACTTAAGGACGTTGT
+GCTCTGGTTAGCCAAAATAGACAACAACAACCCTGGAGTGCTAGACACACTACACAACTT
+TTCACGGCAGGATGTAGAAGGTGAAAAGATGAATAGAATAGTCCAGAACTCCTTAACCAC
+AGCAGTCCACAACAGGGGGCCAACCCAGGAAGTTCTACAACACCAGAAGGCGGTAAGGAT
+CCGAGAAAACTACCTAAACCAGGGTGTAGACCTGTCAATCGAGTGGATCAAGAATAATGG
+TTTTAGAGGCCCAAGTGCAGACCAGATGAAAACTATAAAAGCTGGCCTAGAACCTCCTCC
+AGATACCACCACCAAATCGCCTACACCCCACAATGACACATCAACACCAGCACTTGTCAT
+GAAAATCATAAAGAACAGTTTAGGCATCCATTATGACAATGCCAGCCCTGAAACCCAGAA
+GGAAATCAATGAACGCATTACCACGATGGTAATTAACAATGGCAACAGAGGCTTGAATCA
+GTACCAGGCAAAAGAAATTGTACAGGATTACGGCAAAACAAAGAAAAGTGCACAGATGAA
+CTTGCGCTATGTCGGGCCAAGAAAGATCGGATACACCCCACCTAGCGCAAACCAGGTCGT
+AGATGTACCGCCTCCCGAAAACACAAGGGATGTTGTTATCGCACGACCTACTCAGCGGGT
+ACCCGCGAATGTGTTGACCAGGGGTAATCGAACTGGTCAAATATAGGGTATATTAGTAGT
+TTATAGATATA
+>Locus_68_Transcript_1/1_Confidence_0.000_Length_211
+TGAAAACTCTTTTAAACCCAGCACAATTTATCTCAGACATTCCTGATGATATAATGATCC
+GACACGTAAACAGGGCCCAGACCATCACCTACAACTTGAAGTCAGGGTCCTCTGGCACCG
+GCCTGATCGTGGTCTATCCAAACACCCCGTCGAGTATTAGCGGCTTCCATTACATATGGG
+ATTCCGCTACCTCGAATTGGGTGTTTGATCA
+>Locus_1_Transcript_3/7_Confidence_0.231_Length_407
+ATCCGGGCTTTACATCGATGTTCGGTACTACTGCAACATCTAGGTCCGACCAAGTGTCCT
+ATTTCAGGTACGCTTCCATGAACGTGGGCATTTACCCAACGTCGAACTTGATGCAGTTTA
+CCGGAAGCATAACTGTTTGGAAATGTCCTATAAAGCTGAGCACTGTACAATTCCCGGTTG
+CTACAGAGCAAGCCACCTCTTCACTAGTACACATTCTTGCTGGTTTAAATGGTGTATTAG
+CGGTGGGACCAGACAATTCAAACCGGATGCCAACCTAACTGGGCAATTAGGCCACAATAA
+GCCCAACTTGGTTGATGATCGAAACAGTGAGCCCCCTCCCATGTAATGGAAGACGTCGAC
+GCAATCGTGCGAGACGTAATGACAGTTTAAGTCAGCCGACTAAGGGG
+>Locus_80_Transcript_1/1_Confidence_1.000_Length_101
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGCAA
+>Locus_7_Transcript_2/11_Confidence_0.077_Length_1069
+CAGTAGAAGGTGTCGAACCAAATCCCGGACCATCAATAATTGAGCCAAATCATGGACCAA
+GCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCAACGACAGCTGGCAAAACAAGACC
+AAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCTACTGGACGATCTGACCGAATTAA
+AGACTACGGTACAACCACAGATTGACAATTCGGGATTCTTGGCTCATGTTGATCATGCAG
+CTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGTGATGAAATACATTCTCACGAATT
+CTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTACTGATATACCCGACGAGCCAGTAG
+AGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAAAGAGAAAAAAGAAGAAAAAAAAG
+ATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACGAGAATCGATGGCAATGCCAGCCA
+GTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGAAATTGAAAGGAAAAACGTCATCA
+GGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTACAAGCTTGTACTATGGTTAGACA
+AACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGATGAGCTTTGGGGAAGTGGTTGGC
+AGGAACGAAATAAGATGAACCAGTATGAATGGTTGTCTTACTGCTGGGCAAATAATGTCA
+CTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGACATCAAATGGCAACAACTACCTG
+CTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGCTGATCTTGAAGCTCAAAAAACTC
+ACAATAAAGTGATGCATGCATACAACGGTAACCCTTTGTGTCAGGGATTTCAAGAAGTTG
+AAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAGTAATTCAGTTCTGAAACCATATA
+CTGGACTGGAAGCTGAGAAATACATCACCAACATTGTAGGAGACATGAATCCGAATCAAT
+CAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCAATACAATGCCAA
+>Locus_47_Transcript_1/1_Confidence_0.000_Length_940
+GAATAAGAGCTTTAAAGAAATGGGGATAACTCCCTATCGTGTGATGGAGTGGCTTGATGA
+GTACATGCCACTCAGTGATGACGAGCCTGAGATAACCTTATCAAACACCCTTGACTGGCT
+TGTATACACGCCAGAAGAGGCTGAATTGATGGGGGTCCCAGACTCGTTACCAGACATCAC
+ACAATCCTCAGCAGCGGGTCTCCCCTGGCTGGGTAAGAAGAAGGGCGAAGTTGCCGTATC
+TGCTCTGATTACGGCGAATATGCTGATAAAAGACGTGTCGCAACTTCTGAAAGAAACCCT
+CTTTACTGGATCCAACAATCCATTGGATCCCAAGAAGGAAGGTGTAGCAGAAGTTGCGAC
+AAAGAACCCCAGGAGGGCAGCAGACCAATTCTCCCGACAGGTACTCGATAGAATCATTAA
+AGAGTACTCTTACACAATGATGGGTCTACTTTTCCCGAAAGGAGAGCGGTATGCCATAGC
+TGACCATTTAACCAAGACTAGGAATATTTGGAGCGCCAGTTATGTCACACACCTAATCGG
+GTCAACAATATCAGACCAGCCAGCAAAACGCATGCTAAACGTCCTTACATCAACATCAAG
+GACGCCATCCCTAGCTAAGTTTTCTCCAACTCAGGGAGGGATGGAGGCTCTTATTAATAT
+CATCCTCAACGCAACAGATATAGTGGAACTAGTATACGCTGATAACGCATACATATACTA
+TCCGAACGAAGATATATGGTATAGCATAGACCTAACAAAAGGCGAGGCTAACTGTACACG
+CGATGTGGCAATGACAACAGCCATGTACCTATTAACAAGAGGTTGGACATCGAAACAGGG
+TACACCTATATACAATTACACATGGGCATACTTAGCCTTGTATGGTATACCATATATGAC
+CGTGGACTCAATTAGTGTATTAAAGAACTTCCAGATAAAG
+>Locus_7_Transcript_11/11_Confidence_0.000_Length_1206
+TGAGAATAAACAACAACAACCAAGTGCACCGATGCCACACGAGCCAAGGGCAGCAGGTCA
+GGCACTTAAGGATTTGAATTTGGCTTATTTGAATAACGACCAAAAAACAACATTGTCGGC
+ATGGGTACGAGGCCTAACAGTAGAAGGTGTCGAACCAAATCCCGGACCATCAATAATTGA
+GCCAAATCATGGACCAAGCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCAACGACA
+GCTGGCAAAACAAGACCAAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCTACTGGA
+CGATCTGACCGAATTAAAGACTACGGTACAACCACAGATTGACAATTCGGGATTCTTGGC
+TCATGTTGATCATGCAGCTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGTGATGAA
+ATACATTCTCACGAATTCTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTACTGATAT
+ACCCGACGAGCCAGTAGAGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAAAGAGAA
+AAAAGAAGAAAAAAAAGATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACGAGAATC
+GATGGCAATGCCAGCCAGTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGAAATTGA
+AAGGAAAAACGTCATCAGGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTACAAGCT
+TGTACTATGGTTAGACAAACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGATGAGCT
+TTGGGGAAGTGGTTGGCAGGAACGAAATAAGATGAACCAGTATGAATGGTTGTCTTACTG
+CTGGGCAAATAATGTCACTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGACATCAA
+ATGGCAACAACTACCTGCTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGCTGATCT
+TGAAGCTCAAAAAACTCACAATAAAGTGATGCATGCATACAACGGTAACCCTTTGTGTCA
+GGGATTTCAAGAAGTTGAAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAGTAATTC
+AGTTCTGAAACCATATACTGGACTGGAAGCTGAGAAATACATCACCAACATTGTAGGAGA
+CATGAATCCGAATCAATCAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCAATACAA
+TGCCAA
+>Locus_2_Transcript_3/5_Confidence_0.250_Length_207
+GTCAGGACCTTGCTGCCCTCCATACCATGGCCAAAGCCTCCACACGAACATATGTTGGTG
+GTGCGCTCCCTGACCGTGACAACATCATGGAGGTGTTCAAACAGTTGGACGCAGCTACTC
+AAGCGGTTGACCCGACACCAATGTCTGACTTCTCATACCTAAATTCTCATCCGGCAATTC
+CGGTATGGAGGGCAGCAAGGTCCTGAC
+>Locus_16_Transcript_1/1_Confidence_0.000_Length_152
+ATTACGGAAGAAAGTCCGCAGGAGTCATATACATCAGAAGTTCCACACTCCCATCAGGAG
+TCTACAACATCTCAGGAACAATCAATGCCGCCACGTATGAAGGCCCACCTTCGGAGGTAG
+GATTGCCAGAGTACAATAAGATATTATCTATA
+>Locus_60_Transcript_1/4_Confidence_0.600_Length_282
+GCCACAGCATCCGCAAGACGTCCATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATG
+TCTGGGAGAAGATTACACGTGACAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAG
+ACGGCGTTATGCCGGGCTCCGTGGATGAATCGTTACCTAAGCTTAACGATGCCAAGCAAA
+CTCGCGCTAATCCAGGAACTTCCCGACCGCATTCAAACGGCGGCGGAAGCAGCAATGGGA
+ATGAGCTATCAGGACGCACCGAACAACGTGCGCAGGGACCTC
+>Locus_55_Transcript_1/1_Confidence_0.000_Length_246
+ACAAGTCACCGTCCACTCTATCCTCTCCAACCCACATAACCAACACTTCCCAGAACTTGG
+GCTACGGAGGTGCATTCATGATCCCAGTAACCACAGTTCCTGGGCAAGAATTCCATAACA
+AGGAATTCAGCATTAATGTGGACTCCGTAGGGCCAGTTGACATCTTGTGGTCTGGTCAAA
+TGACTATGCAGGACGAATGGACTGTAACTGCAAATTATCAACCATTGAACATCTCTGGCA
+AGCTAA
+>Locus_17_Transcript_2/3_Confidence_0.400_Length_2274
+TTTTATCCAAACAAAATCCGTCACTTTTTCCATTACTCCATCCGGGCGGGACTGGTTCGT
+AGTTGCGGCTGATAATGCTTATTGCAAACCCTCATTACGTGTAATTAGACGAAGTCTCCG
+CAATAACACTTCGCCCTTCGATGTTGAAAAAATCAGTATCGATGCCGAGATACTTAATCA
+TATTCAGGCGTCCGAACTTGCTCAACTTTTTTACAAATCAGTAAAATGTCGAATAATGGT
+TTGTTCGAACGAGTTTGTCGAACAAATCGAACCACAGGTTTTTGAGCTTTTGAATACCAA
+CGCAATGATCGCGCTCCCGAACCCAAAGAAAATCAGAACGCACATTGTTATGCCCGAAGA
+AACTGTCATAAAATTTGTCGGACCGCGACCTTCTGTATCCCTGATGCAGAATTTTATCGA
+CAACGTCTTTGGATCAACCGCATACGTTGATCAATCTCTAGATGCGTGGATGGTGCACAA
+TTACGACCTCACGATGTACACTGGTGGTCTTCAATTCTCACGGGTTAAGGCCATTTACGA
+GATATCCAGATACGACTGTTTAAAACCAGTGTTAAAAACTCCAATGTACCACTCACGTCA
+GTACACCAGTAGAGAATCGCGACTTGCGCTTGACAAAAGGAACAAAAACGTGCCCCAGAT
+TAACGGAGTTGTCGATGTTGAAACTGTGACTGATGAAATGCTTGAAAGGTTTGTCGAGGG
+ATGTCTTGACAACGCAAAATTGAATATCTATAATTGCGATAAGATACGGATATCAGAGAA
+CGAAATACATGAATGGTTGAGAAGTCAACCTACTGTCGTCGTCGATCAGATCGTCCCCGA
+TTATCCCCTTCATTTGAGTGAAGTGAATTACTACAACTTTTCTATTAAGCGCACCCCAAA
+ACCTAACTTAACTATCGACGCCACACGCACGTACGCCGCTCTTCAGACAATAGTTTACCA
+TGAAAAACATATCAACGCATTATTTTGTGCTGCTTTTAAAGAACTAAAGCTACGCGTTAT
+GCGTTGTCTGAAAGATTACATCCATATGTTTACCGATATGTCGCCCGACGAATTCGCTGA
+AAAGCTTACGCAATCTTATAAGGGTTTCGTCGCGATGTTTTCTGGTGATGATTCATATAT
+TTTTGACGGCGCGTACAAACTCGAGATCGACATCAGTAAATACGATAAATCCCAAGGATA
+CTTGGCCCTGTGTTATGATTGCAAAATAATGCGATTCTTCGGATTTCCAGAATGGTTGGT
+CGATCTATGGTTTAATGGCCATGTTCTCACGTTGATCTACGACAGAAACGCTGCGATGAA
+ATGTCTCATTCCTTTTCAACGGAAATCTGGCGATGCGTCGACATTTATTTTGAATACCAT
+CTTCCTAATGGGTGTAATATCTCACCAAATTCCTCTCAGTCGATTATCCACAATAAACCT
+AAAAAAATACTGTATTCCGGACAACTTTGCGTACATCTTTAATCTTGAAGTGAAATTTTT
+TTCCTACGAGCACCCATACTTTTGTTCAAAATTTTTGTTGTTTGACGGAAGGAAATTTTA
+TTTCGTTCCTGATCCATTGAAACTTCTAGTAAAACTTGGGCGATCAGATATGATTAATAA
+ATACCACGTCGAGTGTTACCGTCGTTCCGTTGAGGATAGTGTTAGGCATTACTCAGATAT
+GTACGTTCCCCATCTTCTTGTCCCCGCGCTTAGAGAAAGGTATAACGTTGAATACGATTA
+CCACTACGTTATACTCATGATGGCAAATATTCACGAGAGAGAATTTTTTAGTAGTCTGTA
+CTTTGAGGAACAGGGAGCTAACATTGATAAAAATAGGCTCCAATTCGCCGGTATGCGCGA
+TGAGATAGGTAAGCCACAACCCTCCCCGGATGTTATCGAGAAGCTGGCCTCAATGACAGG
+AATTGATTTCAAGGTTGAACTAGTAGTGACAAACTTCAGAGAGAAACTAATAGCAGCTTC
+AAGGCATTCGATCCCTACAAGTAACAGGGTTGAACCCAGAACAATTGTAGAGATGGACAT
+GCTGGGCTGGGACGTAACTCACACGGAGTTTGGCTTCACACCGGTACTGTCAAAAGAACG
+ACTATTCAAATCAATAGCCTGCCCACAACCACCAAGTAGCACCTTTCAAACGAGCGTGGC
+AAAACAGGTACACAAGTACATTCAGAATGTAGCTCTGTTGTACGTGGGTGCCTGGGCTTA
+TCCATGCATAGCACAGACCGTAGAGGGGTATGCTCTAAATCATTGGAACACTAT
+>Locus_1_Transcript_7/7_Confidence_0.231_Length_184
+AATAATGAGGCGGAATCGCCGTCGTGGACGTGGCAAGGCAAAGCTAACGGTAAGCGAAGG
+AAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCGAAAGCTGGAGCTCAG
+CCCCCCACCCGCTAAACCGTAGCTGACTCCTAGGAGCACCTACACCCGTTCTAGCCCGAA
+AGGG
+>Locus_7_Transcript_8/11_Confidence_0.154_Length_552
+TAAACGATTTTGATACTTTCGCAACAAAAGGAAGCAAGATTAGTGCATTTGTCAAGCGTT
+TTCCCTTCGACAAGGATGATGCCAAAGCTAGATGGGCAGAGATCAACACGCTGACGGGCT
+ATTTGCAGAATGATTTTGGAAACTTCGATTACGATAAGGAATTTGAAGCTTTAGCTACCG
+GAGATAGTAACCACCCCGCTTGGTGGGAAGAAGTATTCACTAAGAAAATAAAAGAGTTGA
+TGACACATCAAGAACACAAAAAGTATATCAGTTTTGAAAAATATGTTAAGGAAGGATATT
+GGATAACATCTGGCAGCAGCAGCATCGGCAAAGTCAATTGGTCATATGACGGAGACTTGG
+GCAAATTTAAGGCTAGAAAGAACATGTTATTAGATCTATATACGCCGGACGAAATCTACA
+AAATGGCTGTAGAATGGGACGGGAAACTAGAGAATAGAGTGTTCATCAAAGATGAATTGG
+CAAAGAGAAGATTGGCAGTGGCAAGCAATATTGAAGCATATTTGAATCAAGGGTATATAT
+TTTATCTATTTG
+>Locus_78_Transcript_1/1_Confidence_1.000_Length_154
+AACGTGCGCAGGGACCTCATACCTCGAAGGAAGGGCCCCCCGAGGAGGCAAATCAGCACT
+CGAAGAACGCCTCCGAAAGCTGGAGCTCAGCCCCCCACCCGCTAAACCGTAGGTGTCTCC
+TAGGAGCACCCACACACGTTCTAGCCCGAAAGGG
+>Locus_83_Transcript_1/1_Confidence_1.000_Length_196
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGCGAGTTTGCTTGGCATCGTTAA
+GCTTAGGTAACGATTCATCCACGGAGCCCGGCATAACGCCGTCTTAATCTTCTCCCAGCA
+TGATCCGTGTAACTCG
+>Locus_66_Transcript_2/2_Confidence_0.333_Length_167
+GTTGCCGTGCCATTGGCAGCCACCCTTGCCCCCCAGTTCGCACCAATAATCGGTGCTGCC
+GATGGGTTAGCCAATGCACTATTGGGTGATAGCGCCAGCGGAAGGCCTGTTGGCAATTCC
+GCTAGCGGTATGCCCATTTCAATGAGTAGGCGTCTTAGAAACGCTTA
+>Locus_49_Transcript_1/1_Confidence_0.000_Length_499
+AACCGCCAAACAGTATACTGCGGTATTGTGTAGACGAGTGTTCGATCTGGACAATCAGTC
+CAGGGTCTACAATGGTGGATTTTGTGATAACCGACCTTTTCTAAACCAACTATTCTCAAT
+GGCAGTTGTAAAAACCATTCCTTCCAACTTGTTCGGACGCGGCTGGCGATGAACTCACCA
+GCTTCGCACCAATCCCAAACTGGATGGACCCATGCAGCACCTCCACTAACCTTGTATTCA
+ACCAGGTTGTTCTTGATGGTGAATGGTGAGTCAGCATCAAAGCCACTCACTTTCTTCGGG
+TTGAAGGTGTGTAAAACCACTGGACGCATGTGCTCTAACAGCACATCTGGCTCGGTGACA
+TAATAATCAACATCAACACCAACGATGAAGGCGTCTTCCGCTGGTGTATCATTGCGAAAG
+TCTTGCGCCAGATCACCGACGGCGAAGTGGAAATGGTTCCGCAGTCCAGTGCTGGAATTT
+GGGTTCGGGTTAACTTCAA
+>Locus_51_Transcript_1/1_Confidence_0.500_Length_320
+TCTCTCACGTGTTTTTGTGGACCCGCTCGCAACGACGACAACAATACAAGACCCACTGCG
+TACACTGCGAAAACTGCACCTCACAGCAAGAGATCCTACGATACCACTAGCTGACGCGGC
+TTGCGACCGCGTCGAGGGTTATCTTTGTACCGATGCGCTTACTCCGTTGATATCGGATTA
+CTGCAAAATGGTACTACGGTTATACGGGCCGACTGCCTCCACAGAGGAAGTCAGGAACCA
+ACGTAGAAGCCGGAATAAGGAGAAACCCTACTGGTTAATGTGCGATGGATCATGGCCACA
+GCATCCGCAAGACGTCCATT
+>Locus_10_Transcript_5/8_Confidence_0.333_Length_628
+CGTTATCCAGCTGGATTATGTTGTTATTGTGTAGAAAATATAGGAGTCTCGAAGACTCTT
+TAGAAAGCATACATGTAGTTGCCTCCCTCGTTCTGGATGTACTGAACGGCCTGCTTGCAT
+ACTGATGTTAAGTGCAGAGCTATGTTTTCTCTTCCTCGCCAAAAAGAAAAACCACTTTTG
+ACGACTATCTTACTTATCCAGGGTGTTAGTATTGGATTCAATATCCCTGTTGGTTCAAGA
+GGGACTTTACCTGTTGCAATGTTAATTGCATCAGTCCTATGCCATCCTTTCCTTTCATAT
+TCCGTCATAGTTTTGTAAGCTTCAGGATACCATTTGGCCAAACATTCTTTTAGACTAGGT
+ATCTCAATCTTAGCTTTCTTCGCGATTTGATGTTGTCTTATAAATTCGCTGAATATTGGC
+ATTCCGTTTGGACCAGCCTCATGAGATTGAATCATACGTCTAGGCCAAATGTTATTTTCG
+CACGTTGGTCCTTCTGTTTTGTAAAACCTGTATGTGGGTACAACCGTCTTCTCCCATACC
+GGTTTCAACTTCCTTAAATTTTTGATATAATTGCTGGAAATGTGTTTTTGCGGTCCAGGA
+ATGTCGTCGGCTGCTATTTTCATTGAAA
+>Locus_65_Transcript_1/1_Confidence_0.000_Length_158
+CTGGCAAGCTAATTGCAAACAGTCTGCGAACCCTAACATGGTCCAACACTGGTGTAGACA
+ATGGCAGCCACTACATGAACATGAACAACCTTAATGTCTCCCTTTTCCATGAGAATCCAC
+CACCTGAACCCGTTGCCGCCATAAAAATAAACATCAAT
+>Locus_79_Transcript_1/1_Confidence_1.000_Length_154
+AACGTGCGCAGGGACCTCATACCTCGAAGGAAGGGCCCCCCGAGGAGGCAAATCAGCACT
+CGAAGAACGCCTCCGAAAGCTGGAGCTCAGCCCCCCACCCGCTAAACCGTAGCTGACTCC
+TAGGAGCACCTACACCCGTTCTAGCCCGAAAGGG
+>Locus_7_Transcript_10/11_Confidence_0.154_Length_4093
+TGAGAATAAACAACAACAACCAAGTGCACCGATGCCACACGAGCCAAGGGCAGCAGGTCA
+GGCACTTAAGGATTTGAATTTGGCTTATTTGAATAACGACCAAAAAACAACATTGTCGGC
+ATGGGTACGAGGCCTAACAGTAGAAGGTGTCGAACCAAATCCCGGACCATCAATAATTGA
+GCCAAATCATGGACCAAGCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCAACGACA
+GCTGGCAAAACAAGACCAAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCTACTGGA
+CGATCTGACCGAATTAAAGACTACGGTACAACCACAGATTGACAATTCGGGATTCTTGGC
+TCATGTTGATCATGCAGCTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGTGATGAA
+ATACATTCTCACGAATTCTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTACTGATAT
+ACCCGACGAGCCAGTAGAGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAAAGAGAA
+AAAAGAAGAAAAAAAAGATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACGAGAATC
+GATGGCAATGCCAGCCAGTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGAAATTGA
+AAGGAAAAACGTCATCAGGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTACAAGCT
+TGTACTATGGTTAGACAAACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGATGAGCT
+TTGGGGAAGTGGTTGGCAGGAACGAAATAAGATGAACCAGTATGAATGGTTGTCTTACTG
+CTGGGCAAATAATGTCACTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGACATCAA
+ATGGCAACAACTACCTGCTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGCTGATCT
+TGAAGCTCAAAAAACTCACAATAAAGTGATGCATGCATACAACGGTAACCCTTTGTGTCA
+GGGATTTCAAGAAGTTGAAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAGTAATTC
+AGTTCTGAAACCATATACTGGACTGGAAGCTGAGAAATACATCACCAACATTGTAGGAGA
+CATGAATCCGAATCAATCAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCAATACAA
+TGCCAATGGGGCTGTGGTTCATAATGCTGTATCAACTATTCCGTTTACAAACCTCATTCC
+TAGGACGATTCGATCTGATGATGACGTCCTTGAGAAGTCGGCCAACAGATTACAGGTTAC
+AGAGACAAACGTTACGGATTACTACGTTAATCCGATTGAGCCAACTGAATTATCCAAAAC
+AATAAGTGACCAGATCAAAAACAATCAATCATCTAACTGGCGACGAGATAACACGTCATT
+GGCTGGTTTCAATAGTTTCGACATTGCGACAGTCAACACTGCACTAATTGCAAGAGGTCT
+AAGCACTGAATCAATGACTCTCAAGTTAGAGCTATTGCACGGAATAATGGCTATGCAGGT
+TGAAGCACCAATGATCAATTCCAGCACTTATTCGATCGTAGATAATCATACAATCCCGAC
+CGTAACTGACAGGGCCGTCATAGGCATCAATGACTCGCCTGTGTTTGGCGAGGACTGTGG
+TGGTGATCTTCCTGAATATCCTTTCGGCGGCGGAACCGGTACAATTGCCTTTCACCTAAC
+ATTGCAAACTGTTCCTGAAGAGAGGAGAGATAAGGCAATCTTCTGCCCTCCTGGTTTGTT
+GCAAGCAGCCCGAGATGGAGCAGAGGCATTGGCCCTATTTGTTTTGTCGATGTCTGAATG
+GCCTTTCGGTATTTATACTGTCACCAAGAGAACAACCGATGAGAAGGGACTGAATCCTGC
+GGATCAGGTTTACGTGCCGATGGAGACCATAACCCGTGTAGGTGGAGATAGAGTATTGGA
+CGTTGTACTTCCTCGAAGGTATGCGGTTGCAAATCCAACGACTCAAGGAAATGCTAATGC
+TCTAGCAGTTATACAGCCTCAAGCTGGGCCTTTAGATAACGGTGCGGACGGATTAGCCGC
+TGGTGAATTATTGGATGTCAATTTCATCGGCGCCGACGGCATTACTGAATATCCATTGAC
+ATATTACTTGTATACCTGGGCACTTCGATTTGATATAACGACGATTAGGCAATACATTGG
+TAGAATGGCAGCGTTAATTGGAGTGAAACACCAACTATGGGCTAGTCATGAAATCAGAGT
+AGCTTTGTGTCAAGTTGCACCCAAAATGGTGGTCGGAGTTACAGGTTCGGGAGACCTGCC
+AAGAGGATCAGCCGCTGCAAGCGAGGTATGTTACTCAAGCTTATTGGAGGTCTCACGCTC
+TGAAGAAGATTTTCCGCTGCTTGGTCAGGTTCAAGCCGATTTCAGAGTCTTTGAAACCAA
+TACAAGCACATGGAATAAAGTAGTTTTGGGATTGGCAACAGCACCAAACGTGACAAGTGA
+ACAAAACATGCATGTACCATTCGTTGTTGGCGATCCGAGATCTAACGCGTGGGACCGACT
+CGAAGCAGTACCAATTGCTGCTGCTTGGCAGATGTACTACCATTCAAGGGGCGTAACTAC
+TGCCGCTTGGAATGATGCGTACACTAACGTAAATAACGTTTGGTTGCAAAAGATGGCCCG
+TGATAGCTTCTCAACGACCCAAAGCACTGGGACGATACTGCCTGCCAGATATGGTAAGAT
+AGTCAAAAACCTGATGAGAAACATGTTTGAAAGAGAACCTGCCAAAGTAGTAACAAGCGT
+GGGAGGCGATGAATATGAGATAACCCATTTTGAGCGCTGGTTACCGGGTAATAGATATGC
+TTCCGTGTTTGAACAAGATGAAACTGAAGTTAATCTGTTTCCTCCAACTTTATTACCGGA
+TATTTGGGTTCAATATCCAGCGACTCACACCCCAATCATGTGTGCTTCGTTCCCACCCGT
+TTTCGGCCAAGACTCAACACAAGGGTTCGGCAAAGAATCACAACTTATACCCTTTCGAAA
+CGCAAACAACAATCTTGTAGCACCATACGTTGAAGCTTTCGTTGCCAATCAAGCTTATTT
+CCCGATAGGATCGGGCCCAAACATCAACGACAAGGTTCTGTGGAATAGTAGATTGTGGAT
+GACAAGTGGTTTCGTTCAGTACTTGGATTACGCTGGCAACGCAATCAACGAAGTGGTTCC
+TGCAGCAGGGCTACCTTTGGGTAGGTCAATCCCATTACTGCCAGGGGAAGTTCAGCCGGT
+TGGTAACACCAACATGAGCACAAGCTGCGTTCCTCGTTATTCTGTGGACGGTCGCCGAAT
+TTTTACTTATGTCAACACAGCTCAATCCGTTCCTTTGATACAAGCGTGTAATAGAGCCAA
+TAGATTGGCCAGATCGGCATGGCTATTATTGCATGTCTACATCGAACCAGAGTTGCAGCT
+ATTGAGCGATGAAGTGGTGGACATATTCGACCAACTGACAAGCAAGACTTTTTTAGATGT
+AGCAAAATCGGCTGCGGACAGTGCGGAGGGCAACATTCCGGCAACGAAGGTATTGACAGA
+CCTCCAGGCAGTGGATTCAGCAACGCTGCCGAGTACTTTGGATCCATCCACAAATATGCT
+CCAACCAGCTCCTTTACTCGGCGAACCTACGACAAATTAACTCGATACATTCATGATGGG
+GTAAGTCGAAGTAGTCAGAGAGAAATTTCATCATTGTCGGATGATTTAGTTAGATTTAGT
+ACTCTCACAGATTTTACTGTCATCGATTTTATTACTAAGAAATTAGATTTAGAACGTCCG
+ATTAGTACTCAAGGAGATTTATTGGCGTTAGAACCTAGATGCAAGGGTGACCTCGCTGTA
+GCAAGACTTAAGATTAAGGACATAATAGGTAGGATTGATAAGGATATTAGAACGTGGTGT
+GAAGCAAATTTATGCCATTTGGATGCAATCTTGGTAACGAACTTGATAATCTGGGGACAA
+ATCTGGGGGTTGGAAATTCTGAAAGCTTTACATTCAACAGGAATATTAAACGATTTCGAT
+ACTTTCGCAACAA
+>Locus_54_Transcript_1/1_Confidence_0.000_Length_244
+CCGAGGAGACTCGGGATTTGTTTCTATCGGACGGTCAAACCATCCCAAGCTCTCAAGAGA
+AGATTGCCACAATACACGAGTACCTCCTGGAACACAAGGAGTTAGAGGAGGCAATGTTCA
+GCTTGATAAGCCAAGGGAGAGGCCGGTCTCTTATCAACATGGTAGTAAAAAGCGCTCTGA
+ACATCGAAACCCAGTCTCGAGAAGTCACCGACGAAAGAAGGCAAAGACTAGAACGAAAAC
+TTCG
+>Locus_17_Transcript_1/3_Confidence_0.400_Length_1889
+TTTTATCCAAACAAAATCCGTCACTTTTTCCATTACTCCATCCGGGCGGGACTGGTTCGT
+AGTTGCGGCTGATAATGCTTATTGCAAACCCTCATTACGTGTAATTAGACGAAGTCTCCG
+CAATAACACTTCGCCCTTCGATGTTGAAAAAATCAGTATCGATGCCGAGATACTTAATCA
+TATTCAGGCGTCCGAACTTGCTCAACTTTTTTACAAATCAGTAAAATGTCGAATAATGGT
+TTGTTCGAACGAGTTTGTCGAACAAATCGAACCACAGGTTTTTGAGCTTTTGAATACCAA
+CGCAATGATCGCGCTCCCGAACCCAAAGAAAATCAGAACGCACATTGTTATGCCCGAAGA
+AACTGTCATAAAATTTGTCGGACCGCGACCTTCTGTATCCCTGATGCAGAATTTTATCGA
+CAACGTCTTTGGATCAACCGCATACGTTGATCAATCTCTAGATGCGTGGATGGTGCACAA
+TTACGACCTCACGATGTACACTGGTGGTCTTCAATTCTCACGGGTTAAGGCCATTTACGA
+GATATCCAGATACGACTGTTTAAAACCAGTGTTAAAAACTCCAATGTACCACTCACGTCA
+GTACACCAGTAGAGAATCGCGACTTGCGCTTGACAAAAGGAACAAAAACGTGCCCCAGAT
+TAACGGAGTTGTCGATGTTGAAACTGTGACTGATGAAATGCTTGAAAGGTTTGTCGAGGG
+ATGTCTTGACAACGCAAAATTGAATATCTATAATTGCGATAAGATACGGATATCAGAGAA
+CGAAATACATGAATGGTTGAGAAGTCAACCTACTGTCGTCGTCGATCAGATCGTCCCCGA
+TTATCCCCTTCATTTGAGTGAAGTGAATTACTACAACTTTTCTATTAAGCGCACCCCAAA
+ACCTAACTTAACTATCGACGCCACACGCACGTACGCCGCTCTTCAGACAATAGTTTACCA
+TGAAAAACATATCAACGCATTATTTTGTGCTGCTTTTAAAGAACTAAAGCTACGCGTTAT
+GCGTTGTCTGAAAGATTACATCCATATGTTTACCGATATGTCGCCCGACGAATTCGCTGA
+AAAGCTTACGCAATCTTATAAGGGTTTCGTCGCGATGTTTTCTGGTGATGATTCATATAT
+TTTTGACGGCGCGTACAAACTCGAGATCGACATCAGTAAATACGATAAATCCCAAGGATA
+CTTGGCCCTGTGTTATGATTGCAAAATAATGCGATTCTTCGGATTTCCAGAATGGTTGGT
+CGATCTATGGTTTAATGGCCATGTTCTCACGTTGATCTACGACAGAAACGCTGCGATGAA
+ATGTCTCATTCCTTTTCAACGGAAATCTGGCGATGCGTCGACATTTATTTTGAATACCAT
+CTTCCTAATGGGTGTAATATCTCACCAAATTCCTCTCAGTCGATTATCCACAATAAACCT
+AAAAAAATACTGTATTCCGGACAACTTTGCGTACATCTTTAATCTTGAAGTGAAATTTTT
+TTCCTACGAGCACCCATACTTTTGTTCAAAATTTTTGTTGTTTGACGGAAGGAAATTTTA
+TTTCGTTCCTGATCCATTGAAACTTCTAGTAAAACTTGGGCGATCAGATATGATTAATAA
+ATACCACGTCGAGTGTTACCGTCGTTCCGTTGAGGATAGTGTTAGGCATTACTCAGATAT
+GTACGTTCCCCATCTTCTTGTCCCCGCGCTTAGAGAAAGGTATAACGTTGAATACGATTA
+CCACTACGTTATACTCATGATGGCAAATATTCACGAGAGAGAATTTTTTAGTAGTCTGTA
+CTTTGAGGAACAGGGAGCTAACATTGATAAAAATAGGCTCCAATTCGCCGGTATGCGCGA
+TGAGATAGGTAAGCTACTTTAACATAGTC
+>Locus_29_Transcript_1/1_Confidence_0.000_Length_870
+AGATGTTAGTAAAATAAATGTTTTTGGATTTTAGAGTCGCGTTTATAGCGAATAGCTCTA
+TGAATTTTTTAGGTGGGGTCAGAAACGCCGGGTGATTGAGCGGTGTCTTTATTTATTTCC
+GCCCAAGGAGAGAAAGCCGAGAAAGTATGAGACGACGACGATGAGGACGACGACAAACCG
+TGCATTGTCAGTTTTGACACGGAAATAAGTGTGAAGCGCAAGTGCTTGGATGGCGTATTC
+AAGTACAGTGGATTCAGGTACGAACATTACCCAAAGAAAAGCTAGGCAAGCAAGCATCAC
+CTGATTCTTCTTCGGGATATCGATTACAGCGGGTATGAATATAATTAACCCGGCAAATTT
+AAACGCATTTTGGCCGACCCAGGTGGTGAAAGAGTTGTCATAATTTGAAAGCCAGTCGAA
+TAATACTCCTTCTTTCGAATAAAAATCGTGGGTGAGGAATATACCGAGAGTGAGAACAAT
+CGTGACGAGGAACGTCGGGTTAGCTAGAGGTCGAGAAAAGGTATTGAATATTTCATCAAT
+AGCCTTGGAAAAATCGCTGGATGACGAGGGAATTTTCGGACGTGAAGGCGAAGGGCGAGG
+GCGAGGAGACGCTGCGGTTCTCATCGTAATGGTAGCCGAACGAGCGCGTTGTGTTGGCGC
+CGAAGCACGACGGCGTGGACGTGAAGGACGCGAGTTGTTAATTTGTGGAGCAGACATGAT
+AATTGTAAATATGTTTATGACAAATTAGCTTTAAAGGTAAAATAAACAATCAACGGAAGG
+AAAAGCACAATAAGGACTGCGATCCAACTGCGAAAACGACTATAGATTTTTATAGAAAGG
+ATAAGTAATGGGGCAGAAATTATTATTACA
+>Locus_40_Transcript_1/1_Confidence_0.000_Length_1029
+ACTTTTGGATCCCTTGCTATAGGATGGTCTCCAGACCCCGCCAACAATATCTCAGGCAAT
+GATACTCAAAACCTCAACCGAGTTATGGCCTGCAGGCCCTCCTCAATGAACCGCATGAAC
+CAAACGACTGTCCTAAACATTCCTGTGGCAACCACCCGTAAGTGGTATCTCACCAAAGGC
+AACCCTGATGACGCCCATCATGGATTCATCAATGTGGTTGTTGCTTCCACCACCGGTGGA
+TACACAGGAAGCACCACCTTCACTGTCACACTCGAATGGGTGATTGAGTTTGAAGGTGCT
+GAATTAGGAGCTGTCTCCATTGACGAGGATATCACTCCAGATACTGGTTTCCAGGACCTT
+TTTACCACCTCAGATGGTTCCTGGAACAATGACTACCTTACAATGAAAATGCACCATGGG
+GGACAAATGGTCCCCTTTTCGGCTGCCCACCAGGCTTATGTGTATACAAATGCACCAGGG
+ACAAATGTAACCTACTATCTTGAAGACAAGACGACCTTGAAGACAGCAAACTTCTTTGCA
+GTTATACAAGGTTACTCTATCCCAGGTTTTGTTATGTTTGCCAGTTACACAGATGCAAAA
+GATTATATTCGCACTGGAGATACTGGCAAATGTCTCAAGTATTACACCCAAGGTCCTGTC
+ATTAGCCCTCCCATCCCTAAATTTAGGGTGGCTGATGAAGCAGTTCAGACTGTCGAAACC
+AATCTACTTCGCCGCATTGACCAGCTGACCGAGCAACTTAGAGCAGTGAATACTCCAGTA
+ACAAGAACTGTTGCTCTCAGCAAGGACACGGCTAAGATTAGGACCAAACTTGAGGGTATG
+CCTGATGGAACGACACTCAGTCCTTTCAAAGTGATATCTGAAGACCCAGTGGCCGCTCAA
+GATTTTGAAATTGTATAACCTCTCCCCAAAACCCATCATCTTTTCATAATCACCACCCCG
+TCCCTCCTCGGTGGCTCTCTGGTTACTACACAACTGGAGAGTGTGAGTTCGATTCTCTTA
+GGGGCACCA
+>Locus_72_Transcript_1/1_Confidence_0.000_Length_108
+AAATGATCTCATCTCTGTATTCTGGCCGGAATGCTTGAACCATCGCCTTTTGAGCGATAT
+TTCGTTGCATCCAGCCAGAAACCCGGCCATCAAGGTTGGAAAAATCCG
+>Locus_45_Transcript_1/1_Confidence_0.000_Length_631
+CGGAGAGGGGTGTCCGCACCAATTAATAAGCTAACAAATGTAACAATCATGAGTGACATT
+TTCAATCAACAGGGACTGAAATCCAAATTTTCGAACATTGTCAAGAATGAAGGACAAGGT
+GACTCGGACATCAGAGAGGTATTCAATGAATTAGCAAGACCTCAAGCCGAAGTTGGCCGA
+GACATAGAATATTCAGAACTTAGTCAGGCATTAAATGACAATGGCGTTAAAGTCTTTAGA
+CCGCAGCCGTTTGATGAGTTGGTTAATATTCCCTTTATAGAGGCCGCATCTCCTAGAATG
+ATGGCCCTGTACGGGGAACTGTTGGATTCCAAAGACGTTTCACTGCCTGTTGGCTCTGGC
+CTGCACATACCAACCTATAAGCCAGGCCATGAGGTCACCCCACCCCTCCTCACTTTACCT
+AACTCGCTTTCCTATGAGTACATGCATTACATAGCTAACTCAGCTAATGACACGTGGGAC
+AAGCAGACTTATGAGACCCTTAAAGAACTACTTGTAACTCAAGCTACAAATAGGTTCTCT
+ACTGGTTCCCTACTTGGTCAAGTGAAGAGGGTTGCGGCCGGCCAAGATGTGGCATATGGA
+AGAAAAGGTCACCATAAGAATAAGAGCTTTA
+>Locus_10_Transcript_4/8_Confidence_0.444_Length_1097
+TGTAGAAAAAAAAATATAGGAGTCTCGAAGACTCTTTAGAAAGCATACATGTAGTTGCCT
+CCCTCGTTCTGGATGTACTGAACGGCCTGCTTGCATACTGATGTTAAGTGCAGAGCTATG
+TTTTCTCTTCCTCGCCAAAAAGAAAAACCACTTTTGACGACTATCTTACTTATCCAGGGT
+GTTAGTATTGGATTCAATATCCCTGTTGGTTCAAGAGGGACTTTACCTGTTGCAATGTTA
+ATTGCATCAGTCCTATGCCATCCTTTCCTTTCATATTCCGTCATAGTTTTGTAAGCTTCA
+GGATACCATTTGGCCAAACATTCTTTTAGACTAGGTATCTCAATCTTAGCTTTCTTCGCG
+ATTTGATGTTGTCTTATAAATTCGCTGAATATTGGCATTCCGTTTGGACCAGCCTCATGA
+GATTGAATCATACGTCTAGGCCAAATGTTATTTTCGCACGTTGGTCCTTCTGTTTTGTAA
+AACCTGTATGTGGGTACAACCGTCTTCTCCCATACCGGTTTCAACTTCCTTAAATTTTTG
+ATATAATTGCTGGAAATGTGTTTTTGCGGTCCAGGAATGTCGTCGGCTGCTATTTTCATT
+GAAAATTCGACTTGTTGATAAGCCGTCTTTTCCTCATCTGTCATTTGCTTCCACGTCAAG
+TTGATGTTTTCACTAAACAGTCCAGGAACATCGAACGTTGGGATGTCAGCAAGTGGTAGC
+TTGCTAGTAGTTTTCCACCCTTTCCATTCGTATATTCCGAAACCACCCAGTCGTTTAGGC
+AGGTGCAGCCAGTGATAGCTCTGTCCCGTGTATTTACTCCACTTAATTTTGTTTGCTTGA
+TGTAACCAATCCAATTGTTTCTTGCTTCTCCTTTCTAATAAATAGATATTATTAGCGGTT
+GTCTCAACTTGTTGATTTGCAGTCCATGGTTGTGGGTTCCACGGTTTCCTTTGTGTCACG
+CTAGGGATAGCCCGATTTGTCCAGCCTCTGACGCCTTGAGTAGATATTTCTGTCCTTAAG
+AATTCGCAACAATTTTGCATAATTCCAAACTTGCTGTTTTCTCCAACGGCGTTGATTGCC
+TGATAGCTATACCTAAA
+>Locus_10_Transcript_7/8_Confidence_0.111_Length_255
+CCTTTCGTGGGTATGTGACCAATAAAATGGATGTTGTGAAAATTCAGGTAATTCTTTTAT
+AATAATGATAAAAACGAACGAACGAAACGAATCACATATCCAAACTTATCTCGTTTGCAA
+GTTGGCAACTCCTTATGTTAATTTCCAAAACCAATGAGCAATACTATACTACTACTATCC
+TGACTATCTTTAATTCAAGAGTATGACTCTCTTCGCCTTATAATGCATTTTCAATATCCC
+TGTTGGTTCAAGAGG
+>Locus_7_Transcript_3/11_Confidence_0.154_Length_1743
+CCTTAGAGGTAACCAATACAATGCCAATGGGGCTGTGGTTCATAATGCTGTATCAACTAT
+TCCGTTTACAAACCTCATTCCTAGGACGATTCGATCTGATGATGACGTCCTTGAGAAGTC
+GGCCAACAGATTACAGGTTACAGAGACAAACGTTACGGATTACTACGTTAATCCGATTGA
+GCCAACTGAATTATCCAAAACAATAAGTGACCAGATCAAAAACAATCAATCATCTAACTG
+GCGACGAGATAACACGTCATTGGCTGGTTTCAATAGTTTCGACATTGCGACAGTCAACAC
+TGCACTAATTGCAAGAGGTCTAAGCACTGAATCAATGACTCTCAAGTTAGAGCTATTGCA
+CGGAATAATGGCTATGCAGGTTGAAGCACCAATGATCAATTCCAGCACTTATTCGATCGT
+AGATAATCATACAATCCCGACCGTAACTGACAGGGCCGTCATAGGCATCAATGACTCGCC
+TGTGTTTGGCGAGGACTGTGGTGGTGATCTTCCTGAATATCCTTTCGGCGGCGGAACCGG
+TACAATTGCCTTTCACCTAACATTGCAAACTGTTCCTGAAGAGAGGAGAGATAAGGCAAT
+CTTCTGCCCTCCTGGTTTGTTGCAAGCAGCCCGAGATGGAGCAGAGGCATTGGCCCTATT
+TGTTTTGTCGATGTCTGAATGGCCTTTCGGTATTTATACTGTCACCAAGAGAACAACCGA
+TGAGAAGGGACTGAATCCTGCGGATCAGGTTTACGTGCCGATGGAGACCATAACCCGTGT
+AGGTGGAGATAGAGTATTGGACGTTGTACTTCCTCGAAGGTATGCGGTTGCAAATCCAAC
+GACTCAAGGAAATGCTAATGCTCTAGCAGTTATACAGCCTCAAGCTGGGCCTTTAGATAA
+CGGTGCGGACGGATTAGCCGCTGGTGAATTATTGGATGTCAATTTCATCGGCGCCGACGG
+CATTACTGAATATCCATTGACATATTACTTGTATACCTGGGCACTTCGATTTGATATAAC
+GACGATTAGGCAATACATTGGTAGAATGGCAGCGTTAATTGGAGTGAAACACCAACTATG
+GGCTAGTCATGAAATCAGAGTAGCTTTGTGTCAAGTTGCACCCAAAATGGTGGTCGGAGT
+TACAGGTTCGGGAGACCTGCCAAGAGGATCAGCCGCTGCAAGCGAGGTATGTTACTCAAG
+CTTATTGGAGGTCTCACGCTCTGAAGAAGATTTTCCGCTGCTTGGTCAGGTTCAAGCCGA
+TTTCAGAGTCTTTGAAACCAATACAAGCACATGGAATAAAGTAGTTTTGGGATTGGCAAC
+AGCACCAAACGTGACAAGTGAACAAAACATGCATGTACCATTCGTTGTTGGCGATCCGAG
+ATCTAACGCGTGGGACCGACTCGAAGCAGTACCAATTGCTGCTGCTTGGCAGATGTACTA
+CCATTCAAGGGGCGTAACTACTGCCGCTTGGAATGATGCGTACACTAACGTAAATAACGT
+TTGGTTGCAAAAGATGGCCCGTGATAGCTTCTCAACGACCCAAAGCACTGGGACGATACT
+GCCTGCCAGATATGGTAAGATAGTCAAAAACCTGATGAGAAACATGTTTGAAAGAGAACC
+TGCCAAAGTAGTAACAAGCGTGGGAGGCGATGAATATGAGATAACCCATTTTGAGCGCTG
+GTTACCGGGTAATAGATATGCTTCCGTGTTTGAACAAGATGAAACTGAAGTTAATCTGTT
+TCC
+>Locus_63_Transcript_1/1_Confidence_0.000_Length_371
+AGTGTTCGCACTTCCAGATCCCACTACCAGCACTCGGAGTTTCTTGGGTCGCCAGCGGGA
+GTATAGCTTACTCTGCTGCTGCAGCCTAGAATCACTCATAGCCGTTGGACATATGGCTTG
+AGAAAAAAGGCTAGCTCCCACTGCGCGCTGCGATTGTACCTCAATAACGCCTATAATGTC
+CACGCCCGAGAGCATGGTCTTGGGCATGGCACTGTAGGCGACCTGGCTCCCAGACTTTCG
+AGGGCGATTTCGCCCTCTTCGACGGGGTCCTTGAACCATTGAGCAATTCTTTCCCACAAT
+TTGACGAGAAGATGCGCTCTGTACGGTAACCTTGGGGGAACGACGGTTTCTGGTGGAAAA
+ATTGTTTCCAC
+>Locus_57_Transcript_1/1_Confidence_0.000_Length_260
+TTAACTTCAAATTTAGATCCTCCTACAGATGTTATAGCCTCGTCGATTAAACGACGGGCG
+GCATCACGTACGGCTCCTGAAACGGCATGCCCGTTGTTAAAGGCACGCTTAGGCGTTACG
+GTACGCAGGCTGTCAAGCGGATAGAAACGTGTTTCTATCGGGGTCTTCGTTTTGTCAATG
+ACAGCCCGTTGCAATGCGCGTGTAACTCGGTTCCCTCCACTCTGGGGATAGGGCGCAATT
+GCCCCATAGCCCCAGAACTT
+>Locus_10_Transcript_1/8_Confidence_0.222_Length_565
+CGATTTTAGTCACATATTTTTTGGCATCAATGTTATTGATTGCCTGATAGCTATACCTAA
+ACACCAGACATGTCATGAAATCCTTAGCTAATATTTTTGTGTCGTCGCCTTTCAATGCTA
+TTAACCTAATGTTATCTTTGCCCAATATCAAACTCGTCTGATCTCTTGCTATATCCGTTG
+TTATCATATTCCAGACATTGCCGATGAAACTTGTTGGACGTATTCCAGAAGGTATGCCGT
+TAGTCTGTTTCTTTGTTTCCTTTGTTAACGGTGAGTACAGGTAATTATTGTCGTAACACG
+AAATATTTTTCGCAGCTATTTTAGTGAATAAATGTCGATCTTGTGGAGGTACCAAATATT
+TGATTTGGTCTATGACGCGTTTCGTAATCTGCTTCACTTCCCAAATTGTTGGTTGTCTGT
+CAAACCCTTTGAAATCAAAAGGTAGGGCAAAACACCCGTCTTTCAATGCTTTAATTGTTT
+CACAGTTCCTAAGATGCGTTTCACCTGGTGTTTCGTCTAATGTTATGTATTTCCAATTTT
+TAAAGCCATGTCCAAATAGATAAAA
+>Locus_62_Transcript_1/1_Confidence_0.000_Length_130
+TGACAAAGTCATTCCATCCGACCCTGAGGAGCTGTATATTGCTGTATCACTAACAGAATC
+CCTCAGGAAGCAGATACCGAACCTCAATGACATGCCATACTATGAGATGGGTGGCTATAG
+GGTGTACAAC
+>Locus_1_Transcript_6/7_Confidence_0.077_Length_216
+GTAAACAATTCCAAGTTCCAAATGGTTAACAACATCAAACCAAGACGGCAACGATCCCAA
+CGTGTTGCCGTAACAACAACCCAAACAGCGCCTATTCCACAGCGAAACGTACCACGTAAT
+CGGAGTGAGCCGCGTCAATAATGAGGCGGAATCGCCGTCGTGGACGTGGCAAGGCAAAGC
+TAACGGTAAGCGAAGGAAGGGCCCCCGAGGAGGCAA
+>Locus_2_Transcript_5/5_Confidence_0.000_Length_447
+CTAAATTCTCATCCGGCAATTCCGGTTGATAATACTAAGTATCAGGGAATTCAGATCCAT
+CCTGCATCGAAAAATCAGCAGAAGGGTTATGTTAGCTCAAACAGGATGTTTGGACGAGTC
+CAGAAGTACGACTCCTTACTCACTGTGGGAGCTTCTGTAGCCTTCAGCAGAGATGAGTTG
+CTTGATAGTTATAGGAAATACACCTACTGTTATGGAACGGCTAAAGGATTTGAGAAACGG
+TTAAAAATGCTCACCACTCGCAAGTGCAAACGGCCATATACGCCCAAAGTTGTGGCCAGC
+AAACTTATGAGGTTAATGCCCTGTGGTAGTTTACCTGACTGGCATGAGTTCGAAGATCTC
+TTGTCACAGGTTAAAACAACAGCAGGTGCAAGTGCTGGAGCTCCGTATTTCAAGGAGAAA
+CGCAAGGCATAGAAAGAAAGAAATTTC
+>Locus_2_Transcript_4/5_Confidence_0.125_Length_605
+GTCAGGACCTTGCTGCCCTCCATACCATGGCCAAAGCCTCCACACGAACATATGTTGGTG
+GTGCGCTCCCTGACCGTGACAACATCATGGAGGTGTTCAAACAGTTGGACGCAGCTACTC
+AAGCGGTTGACCCGACACCAATGTCTGACTTCTCATACCTAAATTCTCATCCGGCAATTC
+CGGTTGATAATACTAAGTATCAGGGAATTCAGATCCATCCTGCATCGAAAAATCAGCAGA
+AGGGTTATGTTAGCTCAAACAGGATGTTTGGACGAGTCCAGAAGTACGACTCCTTACTCA
+CTGTGGGAGCTTCTGTAGCCTTCAGCAGAGATGAGTTGCTTGATAGTTATAGGAAATACA
+CCTACTGTTATGGAACGGCTAAAGGATTTGAGAAACGGTTAAAAATGCTCACCACTCGCA
+AGTGCAAACGGCCATATACGCCCAAAGTTGTGGCCAGCAAACTTATGAGGTTAATGCCCT
+GTGGTAGTTTACCTGACTGGCATGAGTTCGAAGATCTCTTGTCACAGGTTAAAACAACAG
+CAGGTGCAAGTGCTGGAGCTCCGTATTTCAAGGAGAAACGCAAGGCATAGAAAGAAAGAA
+ATTTC
+>Locus_9_Transcript_2/3_Confidence_0.333_Length_2216
+TCGAATAGACTCATTAGAAAGAACTGTTTCAATAGATGCCTTCTATCCATTCCCTCAGGT
+CATCAAAGAGGGTGGACAGGAGCCTGTAGCCGCCGTAGAGTTATACCTAACCAGTGATAA
+GTCCACTAGTATCACTGGGACAATTAGAAGCATTACCACTGCTCATAGTGCTGCTAGACC
+TGGTATAACATCACCAACGACAATAGTGGCTTATGAGGGAGTTCAATCCGGTGCTAGTAT
+CACCGTGGCTGGAGTGAGTAACTATGAGCTTATACCTAACCCAGAACTAGCACGCAATAT
+GGAAACCAGATATGCAAGAACTGACCCCTATGGCATGATATACACCAAGTATGTACTTGC
+AAATAGGGACAGATTAGGCATACGCAGCGTCTGGCCCACTAATGACTATAAAGCCAGGTT
+CCCATTATTCGAGGAACTTGGCCTCATGCAGTCAGACGCCAGTATCACAGAGGCCATGGC
+TTTCGGTATACATGATGTTATATCATGGATACGTGGCCTAGTACCAGCAGCCTCAGACTG
+GGCCAATCGTATGCTACCAGGTTCAGGGGATGTGATTAAAGGAATCAACAGAACCGCAGG
+GCACCTTCTTTATGGAGAAGCTGCCTCAGGCCGGTTGATAGCACAATCCGCGAGCGGATC
+ACTAATAGGTCGGCTGGGGCACCGGGATGCCTTGGCTTGTGATGTAGACCCAACGCTCAT
+GGGTCACAATGCAGCACAACTCATTTGTTACAACACAGCCCTGGGAGTAAGGAGTACTGG
+TAATCGTATCTACATGATACGTTTAAAAACTCCAAAGCGCAACCCCCGTGTTACTATATT
+TCCCGCTCTAGTATTCAACACAACACCATTAGGACCGGAAGTTTCTGGAACCCAACTATA
+TGCAGTCATAGAGGGGTTATACAACCAGGTCCCACAATCCAGATTCAAGGTTACAGGCAA
+GAACGGACGCACAATTTATGGAATAAAGCCTGGTGCCTATATACCACCGGGCCCCAATTG
+CACAGTTGTGCCCATTAGCTCCATAACCCAGAATGAAATAACAACCACAGCCACCCCACC
+AATACCAAGGGGTGGAAGTATGGAAGCAGCCTTAGCCCTGTTACAGTACATTCCCCCTGG
+AGTGACTCCATTTGCAGTCACAGGCAATGTTATAGAAGGTAAAATAGTGCCCAACAAATG
+GGCTGATCTGAAGAGAGAGGGAATGAAAGGAACTGGCATACCACTTGTAACAGATCAAGA
+TTACAAGACCATCAAGGACCTGGCCAAAGCAACTGAAATGTTGCAGAGAATAACCACTGC
+GCAACATCCAGCAGTGATTGGAACGATAGCCAGTGCCATGGATTATGACGACTTTCCTCC
+ACCTCCTCCTCCGGTCACAGATGAAAACATAATGGAAACACTGGAGGATCTACTTGTTGC
+AGCCGCCGATAGAGACCCTAGGATGGCTAAACTTAAGGACGTTGTGCTCTGGTTAGCCAA
+AATAGACAACAACAACCCTGGAGTGCTAGACACACTACACAACTTTTCACGGCAGGATGT
+AGAAGGTGAAAAGATGAATAGAATAGTCCAGAACTCCTTAACCACAGCAGTCCACAACAG
+GGGGCCAACCCAGGAAGTTCTACAACACCAGAAGGCGGTAAGGATCCGAGAAAACTACCT
+AAACCAGGGTGTAGACCTGTCAATCGAGTGGATCAAGAATAATGGTTTTAGAGGCCCAAG
+TGCAGACCAGATGAAAACTATAAAAGCTGGCCTAGAACCTCCTCCAGATACCACCACCAA
+ATCGCCTACACCCCACAATGACACATCAACACCAGCACTTGTCATGAAAATCATAAAGAA
+CAGTTTAGGCATCCATTATGACAATGCCAGCCCTGAAACCCAGAAGGAAATCAATGAACG
+CATTACCACGATGGTAATTAACAATGGCAACAGAGGCTTGAATCAGTACCAGGCAAAAGA
+AATTGTACAGGATTACGGCAAAACAAAGAAAAGTGCACAGATGAACTTGCGCTATGTCGG
+GCCAAGAAAGATCGGATACACCCCACCTAGCGCAAACCAGGTCGTAGATGTACCGCCTCC
+CGAAAACACAAGGGATGTTGTTATCGCACGACCTACTCAGCGGGTACCCGCGAATGTGTT
+GACCAGGGGTAATCGAACTGGTCAAATATAGGGTATATTAGTAGTTTATAGATATA
+>Locus_1_Transcript_1/7_Confidence_0.231_Length_224
+CTTTCAGGTACGCTTCCATGAACGTGGGCATTTACCCAACGTCGAACTTGATGCAGTTTA
+CCGGAAGCATAACTGTTTGGAAATGTCCTATAAAGCTGAGCACTGTACAATTCCCGGTTG
+CTACAGAGCAAGCCACCTCTTCACTAGTACACATTCTTGCTGGTTTAAATGGTGTATTAG
+CGGTGGGACCAGACAATTAAAACGGATGCCAACATAAATGGGCA
+>Locus_1_Transcript_4/7_Confidence_0.077_Length_591
+GTAAACAATTCCAAGTTCCAAATGGTTAACAACATCAAACCAAGACGGCAACGATCCCAA
+CGTGTTGCCGTAACAACAACCCAAACAGCGCCTATTCCACAGCGAAACGTACCACGTAAT
+CGGAGTGAGCCGCGTCAATAATGAGGCGGAATCGCCGTCGTGTACGTGGCATGAATATGG
+CGGCGCTTTCCCGGCTTAGTCAGCCTGGGTTAGCGTTTCTCAAGTGTGCATTCGCACCAC
+CTGACTTTCAGGTACGCTTCCATGAACGTGGGCATTTACCCAACGTCGAACTTGATGCAG
+TTTACCGGAAGCATAACTGTTTGGAAATGTCCTATAAAGCTGAGCACTGTACAATTCCCG
+GTTGCTACAGAGCAAGCCACCTCTTCACTAGTACACATTCTTGCTGGTTTAAATGGTGTA
+TTAGCGGTGGGACCAGACAATTCAAACCGGATGCCAACCTAACTGGGCAATTAGGCCACA
+ATAAGCCCAACTTGGTTGATGATCGAAACAGTGAGCCCCCTCCCATGTAATGGAAGACGT
+CGACGCAATCGTGCGAGACGTAATGACAGTTTAAGTCAGCCGACTAAGGGG
+>Locus_58_Transcript_2/2_Confidence_0.333_Length_368
+TGCAAGTAACTTGGCCCTCGGGGCTGTCCTTTCTCAAAACGGTCATCCCATATCTTTTAT
+CTTTTTGTCCAGAGATGTCAGGGTCTTTACTTGAACTAATCCTGGTGAGTTCCCAAGTAG
+TGGAATCCCAAGAGAGTCCGTCAATTGGAGTTTCAGGTTGATGCCAAAAACTTCTCCCAC
+ACTGGACCCGACAACGGATCCTGTGAAAGCTGCAAATGGTGCCTTCCCCAAAACTCCACT
+CTTTAGTAAGTCGTCTGCTGCATAAATGGCAAGCTGGTGGGACGTTCCCGTTACCTTGTT
+TGGTGATGTCGAGGATGCGAGTCTTCCTTCTAATAATTGATAGCATGGTAGGAGGATGTA
+ATCGCTTC
+>Locus_3_Transcript_4/5_Confidence_0.250_Length_926
+CTGGTTTTCTTAACTCCTTTTACCTCAACCTCAGTCTCCTCAATGAAGAGGGTTGGTAAA
+TATCTCAAGGATATTGTCTGAGAGAGGTCTACAGCGTTTATGGGTAGTGTTTTCTCTAGT
+ATCTTGCTGAATGATTCAAGATCGTATCCCAGTTCCTTTAATGATTTGGGTAAGAACTTT
+CCGTCAACTCCGTGTCTTATGTTTTGCATGTCTTTCAGCCTAGCCAGTTGTCCTTGCCAT
+GTGCCGCTGCTCAGTCGGTAATCGATACAGGCCTGTCTGCAGCGCTTGATAGTGGTATCC
+ATGTCCGTAGGATCAGCTATTCTGTCTCTCTGGACTACATACCCTTTGGCAGTCTCAAAG
+TTCCCTTGTGTTTCTTTACTTGCCAGCCATTGGAAAGCTATAGCATTCAGTAGCTTATCA
+TCATAGGTGCCGGTTGTGAATCTGGGTCGATAGAAGGGAATCTTGGGGTCGCCATCAGGT
+AAATGTATTTTGGTGCAGTCTTCATAATCTTTGGGGTTACCACTTTCAAGTTGTAGTGTG
+CGAATGGTTTGGAGGTATCTTACTATCTGCTCATCTAGGACGGAGCTCGCTTCAAACTCT
+AGGTTTTGGCGTAGATAGTAAGGTTTGAATGCGTGTATTCTGCGTTTGGCGATATACTGG
+GCTATTTCAAGCACTCTTGTCGAATTGACAAGTTTGGTCTCATTCATATTAGGTTGAGGT
+GGTTTCAAGTAACTTTCTGTGATTAAGTCTGTAACTGAAGAATCGTCTTCGCTCTTGATT
+TTGAAAAGCTCGCTAAAGCGGTGCTTTGCACTACCAGTATTAAAGACGTCAGACATAGTT
+CGTTAGAATGGAATGTAGAAGTTCGACAGTTAGCGGGGGGTGTAGAATCATTCCCCCGCC
+GATGGGAGGAAGGATGCCGGTGATGC
+>Locus_43_Transcript_1/1_Confidence_0.000_Length_1002
+TATCAGCCTGTTAAGCTTGGATAGACCGATGCATGAGCAAAATTACGCACAGGTCCTATA
+CCAACAGAAGACCATCGAAAAGAAAGAGGCAAAATCAAAGGTTAGCAACCCGCTATACAA
+ACGGGATACAGAGACCTACCACGAATACACAACGCGTATGGCGAGAATGAGGATCAATGA
+CGACATGGTTGGTCCTCACTGGGAACCAATAATAAACCTGGTTACCAAACTCTATCCGCG
+GGAGGCTACAGGAGAGAACCAAAAGTCTAGGGAATCACTGACAAGGGTTAAGATACGAGG
+ATTATTGGAAGACATGGAAAGACAGTTAGAAAGCAATAACAGATCAATGGATGTATGGTA
+CAATGCATACCTAACAGGAAAGAAACCAAGTGGAGTCGACAAAAAGTTGGCAACATTACT
+AGTCCTGTTAGCACCAAAAAGAACTAAGAAACTGCCTTCAGGAGTTTATCAAAAACTACT
+TGGGTACCCGCCCATAGATAAATCTCCCGTTCCATCTCTTACATCTGATGAGTCGTATCT
+TTACGACATGAATTCCCTAGAATACAACCGGATAGCATACGTAAGCAAATTGAATGAAGA
+TGACATCACAGTTTATGCCAATAAGTACATGGTGTACAGCAGCACCATGTTGTCAAGCCT
+TCTACCAGACAAAGTAGATTGGCCAGAACTGAGATCAATGAACGTCGAGGGCGCATCGGA
+TCCTTATCAAGTGAAGGGCTACAAAAAGAAGGAGTTGAAGCCACGGTTTGGTGAGGAGAT
+ACTAGACGATGAGCCAACTGGCAAGAAGTCATCAACAGAAAAGAGAAGGCTACAGAGGAA
+AGGCCAAAAAGCCAAGTTGCAGAGACAAGCTGCAACAGGCACAACATTTGTTAGAAAACC
+ATTAAATTAACTCCGGGAGGGGGGGGACTAAATCTTGGTAAGGAATAGACCATCCGCCAC
+TGGCTTAAGAACCAGGTCCCTAGCCGTTAGACTAAAAGCAAG
+>Locus_2_Transcript_2/5_Confidence_0.250_Length_809
+TTCCTGCATCGATTTGTGGTCTTCGCACGCGCCTCGAACCGAAAACTAATGCATAAAGTA
+GATCATAGAGCAACGACTGCCTTTTAAAGAAATTTCTTTAGAGAAAGGACGAAAATCACG
+AGACAATCTTTGGTTGGATTGTAACGTCCTGACTCGTAGAGGATTTCCCGACCATGAAGT
+AGCAAACCCAAAACTCTTGATATCTCAACATATGTATACGTAATGGATGCATCAAACCCA
+ACTAATTCGTCTGAAAGGTTTACCTTGGAGGACTTGCGGTACGAACATGTGAAGAGAAAG
+CGTCAGGACCTTGCTGCCCTCCATACCATGGCCAAAGCCTCCACACGAACATATGTTGGT
+GGTGCGCTCCCTGACCGTGACAACATCATGGAGGTGTTCAAACAGTTGGACGCAGCTACT
+CAAGCGGTTGACCCGACACCAATGTCTGACTTCTCATACCTAAATTCTCATCCGGCAATT
+CCGGTATGGAGGGCAGCAAGGTCCTGACGCTTTCTCTTCACATGTTCGTACCGCAAGTCC
+TCCAAGGTAAACCTTTCAGACGAATTAGTTGGGTTTGATGCATCCATTACGTATACATAT
+GTTGAGATATCAAGAGTTTTGGGTTTGCTACTTCATGGTCGGGAAATCCTCTACGAGTCA
+GGACGTTACAATCCAACCAAAGATTGTCTCGTGATTTTCGTCCTTTCTCTAAAGAAATTT
+CTTTAAAAGGCAGTCGTTGCTCTATGATCTACTTTATGCATTAGTTTTCGGTTCGAGGCG
+CGTGCGAAGACCACAAATCGATGCAGGAA
+>Locus_7_Transcript_5/11_Confidence_0.308_Length_4519
+TGCGATATTAGAGAAGATCCTACTCTAATATCATACGGATTCCATGGATCAGACGAGGAA
+GACCCATACAGCCGATGAAGATGACAACTGAAAGGAAAACAAGAGGATACAGGTGCTTCG
+CTTTGTTCGTGAGACGGCAAAGATTTGAACCTTTTTAGAAACAATTTAAATATGCTGAAC
+AACTATCACAATAACTTTAACAGTCCTAGCCTGGCTATGATGGACGATGACAAAGCTTGT
+GTTGATGATGGTTGTAAGCTAACAAAGTGGTGATGAGTTGGTGATACCCTCACTTTGGTA
+TTTAATTGTAGACAAGATGGAACATTAGCATCCGAGGTCACTACGTTCCGGAAAGAAACT
+CAAATACAACAGGAACTGATGGGAGAATATCTGACGAAAAATGGAAAACGGGACAGGATT
+GACAAAATGAAAGGATTTTGACAGCTCGGAACAGACGGCAAAATGGAACAAAAGTATGAA
+ACAAGAAACACGTGTTCCTCAGTCTCACATTGAATATCCAGATATCGAGATGCACCTCAT
+ATCTGAGAATAAACAACTACAACCAGTAGAAGGTGTCAAACCAAATCCCGGACCATCAAT
+AATTGAGCCAAATCATGGACCAAGCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCA
+ACGACAGCTGGCAAAACAAGACCAAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCT
+ACTGGACGATCTGACCGAATTAAAGACTACGGTACAACCACAGATTGACAATTCGGGATT
+CTTGGCTCATGTTGATCATGCAGCTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGT
+GATGAAATACATTCTCACGAATTCTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTAC
+TGATATACCCGACGAGCCAGTAGAGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAA
+AGAGAAAAAAGAAGAAAAAAAAGATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACG
+AGAATCGATGGCAATGCCAGCCAGTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGA
+AATTGAAAGGAAAAACGTCATCAGGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTA
+CAAGCTTGTACTATGGTTAGACAAACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGA
+TGAGCTTTGGGGAAGTGGTTGGCAGGAACGAAATAAGATGAACCAGTATGAATGGTTGTC
+TTACTGCTGGGCAAATAATGTCACTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGA
+CATCAAATGGCAACAACTACCTGCTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGC
+TGATCTTGAAGCTCAAAAAACTCACAATAAAGTGATGCATGCATACAACGGTAACCCTTT
+GTGTCAGGGATTTCAAGAAGTTGAAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAG
+TAATTCAGTTCTGAAACCATATACTGGACTGGAAGCTGAGAAATACATCACCAACATTGT
+AGGAGACATGAATCCGAATCAATCAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCA
+ATACAATGCCAATGGGGCTGTGGTTCATAATGCTGTATCAACTATTCCGTTTACAAACCT
+CATTCCTAGGACGATTCGATCTGATGATGACGTCCTTGAGAAGTCGGCCAACAGATTACA
+GGTTACAGAGACAAACGTTACGGATTACTACGTTAATCCGATTGAGCCAACTGAATTATC
+CAAAACAATAAGTGACCAGATCAAAAACAATCAATCATCTAACTGGCGACGAGATAACAC
+GTCATTGGCTGGTTTCAATAGTTTCGACATTGCGACAGTCAACACTGCACTAATTGCAAG
+AGGTCTAAGCACTGAATCAATGACTCTCAAGTTAGAGCTATTGCACGGAATAATGGCTAT
+GCAGGTTGAAGCACCAATGATCAATTCCAGCACTTATTCGATCGTAGATAATCATACAAT
+CCCGACCGTAACTGACAGGGCCGTCATAGGCATCAATGACTCGCCTGTGTTTGGCGAGGA
+CTGTGGTGGTGATCTTCCTGAATATCCTTTCGGCGGCGGAACCGGTACAATTGCCTTTCA
+CCTAACATTGCAAACTGTTCCTGAAGAGAGGAGAGATAAGGCAATCTTCTGCCCTCCTGG
+TTTGTTGCAAGCAGCCCGAGATGGAGCAGAGGCATTGGCCCTATTTGTTTTGTCGATGTC
+TGAATGGCCTTTCGGTATTTATACTGTCACCAAGAGAACAACCGATGAGAAGGGACTGAA
+TCCTGCGGATCAGGTTTACGTGCCGATGGAGACCATAACCCGTGTAGGTGGAGATAGAGT
+ATTGGACGTTGTACTTCCTCGAAGGTATGCGGTTGCAAATCCAACGACTCAAGGAAATGC
+TAATGCTCTAGCAGTTATACAGCCTCAAGCTGGGCCTTTAGATAACGGTGCGGACGGATT
+AGCCGCTGGTGAATTATTGGATGTCAATTTCATCGGCGCCGACGGCATTACTGAATATCC
+ATTGACATATTACTTGTATACCTGGGCACTTCGATTTGATATAACGACGATTAGGCAATA
+CATTGGTAGAATGGCAGCGTTAATTGGAGTGAAACACCAACTATGGGCTAGTCATGAAAT
+CAGAGTAGCTTTGTGTCAAGTTGCACCCAAAATGGTGGTCGGAGTTACAGGTTCGGGAGA
+CCTGCCAAGAGGATCAGCCGCTGCAAGCGAGGTATGTTACTCAAGCTTATTGGAGGTCTC
+ACGCTCTGAAGAAGATTTTCCGCTGCTTGGTCAGGTTCAAGCCGATTTCAGAGTCTTTGA
+AACCAATACAAGCACATGGAATAAAGTAGTTTTGGGATTGGCAACAGCACCAAACGTGAC
+AAGTGAACAAAACATGCATGTACCATTCGTTGTTGGCGATCCGAGATCTAACGCGTGGGA
+CCGACTCGAAGCAGTACCAATTGCTGCTGCTTGGCAGATGTACTACCATTCAAGGGGCGT
+AACTACTGCCGCTTGGAATGATGCGTACACTAACGTAAATAACGTTTGGTTGCAAAAGAT
+GGCCCGTGATAGCTTCTCAACGACCCAAAGCACTGGGACGATACTGCCTGCCAGATATGG
+TAAGATAGTCAAAAACCTGATGAGAAACATGTTTGAAAGAGAACCTGCCAAAGTAGTAAC
+AAGCGTGGGAGGCGATGAATATGAGATAACCCATTTTGAGCGCTGGTTACCGGGTAATAG
+ATATGCTTCCGTGTTTGAACAAGATGAAACTGAAGTTAATCTGTTTCCTCCAACTTTATT
+ACCGGATATTTGGGTTCAATATCCAGCGACTCACACCCCAATCATGTGTGCTTCGTTCCC
+ACCCGTTTTCGGCCAAGACTCAACACAAGGGTTCGGCAAAGAATCACAACTTATACCCTT
+TCGAAACGCAAACAACAATCTTGTAGCACCATACGTTGAAGCTTTCGTTGCCAATCAAGC
+TTATTTCCCGATAGGATCGGGCCCAAACATCAACGACAAGGTTCTGTGGAATAGTAGATT
+GTGGATGACAAGTGGTTTCGTTCAGTACTTGGATTACGCTGGCAACGCAATCAACGAAGT
+GGTTCCTGCAGCAGGGCTACCTTTGGGTAGGTCAATCCCATTACTGCCAGGGGAAGTTCA
+GCCGGTTGGTAACACCAACATGAGCACAAGCTGCGTTCCTCGTTATTCTGTGGACGGTCG
+CCGAATTTTTACTTATGTCAACACAGCTCAATCCGTTCCTTTGATACAAGCGTGTAATAG
+AGCCAATAGATTGGCCAGATCGGCATGGCTATTATTGCATGTCTACATCGAACCAGAGTT
+GCAGCTATTGAGCGATGAAGTGGTGGACATATTCGACCAACTGACAAGCAAGACTTTTTT
+AGATGTAGCAAAATCGGCTGCGGACAGTGCGGAGGGCAACATTCCGGCAACGAAGGTATT
+GACAGACCTCCAGGCAGTGGATTCAGCAACGCTGCCGAGTACTTTGGATCCATCCACAAA
+TATGCTCCAACCAGCTCCTTTACTCGGCGAACCTACGACAAATTAACTCGATACATTCAT
+GATGGGGTAAGTCGAAGTAGTCAGAGAGAAATTTCATCATTGTCGGATGATTTAGTTAGA
+TTTAGTACTCTCACAGATTTTACTGTCATCGATTTTATTACTAAGAAATTAGATTTAGAA
+CGTCCGATTAGTACTCAAGGAGATTTATTGGCGTTAGAACCTAGATGCAAGGGTGACCTC
+GCTGTAGCAAGACTTAAGATTAAGGACATAATAGGTAGGATTGATAAGGATATTAGAACG
+TGGTGTGAAGCAAATTTATGCCATTTGGATGCAATCTTGGTAACGAACTTGATAATCTGG
+GGACAAATCTGGGGGTTGGAAATTCTGAAAGCTTTACATTCAACAGGAATATTAAACGAT
+TTCGATACTTTCGCAACAA
+>Locus_2_Transcript_1/5_Confidence_0.125_Length_327
+TTCCTGCATCGATTTGTGGTCTTCGCACGCGCCTCGAACCGAAAACTAATGCATAAAGTA
+GATCATAGAGCAACGACTGCCTTTTAAAGAAATTTCTTTAGAGAAAGGACGAAAATCACG
+AGACAATCTTTGGTTGGATTGTAACGTCCTGACTCGTAGAGGATTTCCCGACCATGAAGT
+AGCAAACCCAAAACTCTTGATATCTCAACATATGTATACGTAATGGATGCATCAAACCCA
+ACTAATTCGTCTGAAAGGTTTACCTTGGAGGACTTGCGGTACGAACATGTGAAGAGAAAG
+CGTCAGGACCTTGCTGCCCTCCATACC
+>Locus_60_Transcript_3/4_Confidence_0.400_Length_168
+AGGGAACCGAGTTACACGGATCATGGCCACAGCATCCGCAAGACGTCCATTACACTCATT
+GGGCGTTTTGCCGCAATGAAGGATGTCTGGGAGAAGATTACACGTGACAGCGAGGAGAGC
+GCCGCTGCATGTACGTTTGATGAAGACGGCGTTATGCCGGGCTCCGTG
+>Locus_70_Transcript_1/1_Confidence_0.000_Length_147
+AAAAGTTAATTTTGTTAGTAAGAAAATTTGATAAAACTTACAGGAAAGGCGATAAAACTT
+TCCTTTTAACAAGGTTCGATTAGTACACACGAGAAGAACCAAGAAGAAACTCGAGTGACA
+TTAATGACTACAATAAGATGTTAGTAA
+>Locus_60_Transcript_4/4_Confidence_0.100_Length_204
+GGATCATGGCCACAGCATCCGCAAGACGTCCATTTGATGAAGCAGGTTTTAATCAAGCGT
+ACTAGAATTGACGAAGATCAGGTCGATGCACTCATTGGGCGTTTTGCCGCAATGAAGGAT
+GTCTGGGAGAAGATTACACGTGACAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAA
+GACGGCGTTATGCCGGGCTCCGTG
+>Locus_52_Transcript_1/1_Confidence_0.000_Length_112
+TACCATCGAGAAAGAAAAGTTGGATATGCTCTCGGGATTATCCGCCACACAATCTGTCAA
+CGCTAGGCTTATCGGTATGGGGCACAAGGACCCACAGTACACATCTATGATT
+>Locus_30_Transcript_1/1_Confidence_0.000_Length_395
+ATGTATATTCTATACTGGTTAACACGTTGCTTCGATACTGTAAGAGTTGTGAAACTCCAT
+TCATCACGTCCAGCATCCAGTGAATTGCATATCATTTGTCAAGGATTTAAAGTCTCACGA
+AACGTCAGTCGCGAATTTGCAATAAGTTATGAATTCACTTGTCCTCCAGAAGAACGTGTT
+TTTGTACCTAGGAATGTACCGTCCAACGTCGAGGAGAGAAGTGTACCAAAAAACTTTTTC
+CAAAACACCTTGAAAATTCAGCGCGAATTCGACGCATTGAACGTGTCTGCTGTTTCTCTT
+CTTCTCCAGCATTACGACTTCGCAGCCGCTAAACGCGAGATAATTTTGCGCCCTGAGAAA
+TACATTGTTGAGAGTTACCTAAAAGTACTTTCATA
+>Locus_7_Transcript_6/11_Confidence_0.154_Length_656
+TATGGCTATTATTGCATGTCTACATCGAACCAGAGTTGCAGCTATTGAGCGATGAAGTGG
+TGGACATATTCGACCAACTGACAAGCAAGACTTTTTTAGATGTAGCAAAATCGGCTGCGG
+ACAGTGCGGAGGGCAACATTCCGGCAACGAAGGTATTGACAGACCTCCAGGCAGTGGATT
+CAGCAACGCTGCCGAGTACTTTGGATCCATCCACAAATATGCTCCAACCAGCTCCTTTAC
+TCGGCGAACCTACGACAAATTAACTCGATACATTCATGATGGGGTAAGTCGAAGTAGTCA
+GAGAGAAATTTCATCATTGTCGGATGATTTAGTTAGATTTAGTACTCTCACAGATTTTAC
+TGTCATCGATTTTATTACTAAGAAATTAGATTTAGAACGTCCGATTAGTACTCAAGGAGA
+TTTATTGGCGTTAGAACCTAGATGCAAGGGTGACCTCGCTGTAGCAAGACTTAAGATTAA
+GGACATAATAGGTAGGATTGATAAGGATATTAGAACGTGGTGTGAAGCAAATTTATGCCA
+TTTGGATGCAATCTTGGTAACGAACTTGATAATCTGGGGACAAATCTGGGGGTTGGAAAT
+TCTGAAAGCTTTACATTCAACAGGAATATTAAACGATTTCGATACTTTCGCAACAA
+>Locus_7_Transcript_7/11_Confidence_0.462_Length_4481
+CAGTAGAAGGTGTCGAACCAAATCCCGGACCATCAATAATTGAGCCAAATCATGGACCAA
+GCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCAACGACAGCTGGCAAAACAAGACC
+AAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCTACTGGACGATCTGACCGAATTAA
+AGACTACGGTACAACCACAGATTGACAATTCGGGATTCTTGGCTCATGTTGATCATGCAG
+CTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGTGATGAAATACATTCTCACGAATT
+CTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTACTGATATACCCGACGAGCCAGTAG
+AGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAAAGAGAAAAAAGAAGAAAAAAAAG
+ATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACGAGAATCGATGGCAATGCCAGCCA
+GTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGAAATTGAAAGGAAAAACGTCATCA
+GGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTACAAGCTTGTACTATGGTTAGACA
+AACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGATGAGCTTTGGGGAAGTGGTTGGC
+AGGAACGAAATAAGATGAACCAGTATGAATGGTTGTCTTACTGCTGGGCAAATAATGTCA
+CTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGACATCAAATGGCAACAACTACCTG
+CTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGCTGATCTTGAAGCTCAAAAAACTC
+ACAATAAAGTGATGCATGCATACAACGGTAACCCTTTGTGTCAGGGATTTCAAGAAGTTG
+AAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAGTAATTCAGTTCTGAAACCATATA
+CTGGACTGGAAGCTGAGAAATACATCACCAACATTGTAGGAGACATGAATCCGAATCAAT
+CAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCAATACAATGCCAATGGGGCTGTGG
+TTCATAATGCTGTATCAACTATTCCGTTTACAAACCTCATTCCTAGGACGATTCGATCTG
+ATGATGACGTCCTTGAGAAGTCGGCCAACAGATTACAGGTTACAGAGACAAACGTTACGG
+ATTACTACGTTAATCCGATTGAGCCAACTGAATTATCCAAAACAATAAGTGACCAGATCA
+AAAACAATCAATCATCTAACTGGCGACGAGATAACACGTCATTGGCTGGTTTCAATAGTT
+TCGACATTGCGACAGTCAACACTGCACTAATTGCAAGAGGTCTAAGCACTGAATCAATGA
+CTCTCAAGTTAGAGCTATTGCACGGAATAATGGCTATGCAGGTTGAAGCACCAATGATCA
+ATTCCAGCACTTATTCGATCGTAGATAATCATACAATCCCGACCGTAACTGACAGGGCCG
+TCATAGGCATCAATGACTCGCCTGTGTTTGGCGAGGACTGTGGTGGTGATCTTCCTGAAT
+ATCCTTTCGGCGGCGGAACCGGTACAATTGCCTTTCACCTAACATTGCAAACTGTTCCTG
+AAGAGAGGAGAGATAAGGCAATCTTCTGCCCTCCTGGTTTGTTGCAAGCAGCCCGAGATG
+GAGCAGAGGCATTGGCCCTATTTGTTTTGTCGATGTCTGAATGGCCTTTCGGTATTTATA
+CTGTCACCAAGAGAACAACCGATGAGAAGGGACTGAATCCTGCGGATCAGGTTTACGTGC
+CGATGGAGACCATAACCCGTGTAGGTGGAGATAGAGTATTGGACGTTGTACTTCCTCGAA
+GGTATGCGGTTGCAAATCCAACGACTCAAGGAAATGCTAATGCTCTAGCAGTTATACAGC
+CTCAAGCTGGGCCTTTAGATAACGGTGCGGACGGATTAGCCGCTGGTGAATTATTGGATG
+TCAATTTCATCGGCGCCGACGGCATTACTGAATATCCATTGACATATTACTTGTATACCT
+GGGCACTTCGATTTGATATAACGACGATTAGGCAATACATTGGTAGAATGGCAGCGTTAA
+TTGGAGTGAAACACCAACTATGGGCTAGTCATGAAATCAGAGTAGCTTTGTGTCAAGTTG
+CACCCAAAATGGTGGTCGGAGTTACAGGTTCGGGAGACCTGCCAAGAGGATCAGCCGCTG
+CAAGCGAGGTATGTTACTCAAGCTTATTGGAGGTCTCACGCTCTGAAGAAGATTTTCCGC
+TGCTTGGTCAGGTTCAAGCCGATTTCAGAGTCTTTGAAACCAATACAAGCACATGGAATA
+AAGTAGTTTTGGGATTGGCAACAGCACCAAACGTGACAAGTGAACAAAACATGCATGTAC
+CATTCGTTGTTGGCGATCCGAGATCTAACGCGTGGGACCGACTCGAAGCAGTACCAATTG
+CTGCTGCTTGGCAGATGTACTACCATTCAAGGGGCGTAACTACTGCCGCTTGGAATGATG
+CGTACACTAACGTAAATAACGTTTGGTTGCAAAAGATGGCCCGTGATAGCTTCTCAACGA
+CCCAAAGCACTGGGACGATACTGCCTGCCAGATATGGTAAGATAGTCAAAAACCTGATGA
+GAAACATGTTTGAAAGAGAACCTGCCAAAGTAGTAACAAGCGTGGGAGGCGATGAATATG
+AGATAACCCATTTTGAGCGCTGGTTACCGGGTAATAGATATGCTTCCGTGTTTGAACAAG
+ATGAAACTGAAGTTAATCTGTTTCCTCCAACTTTATTACCGGATATTTGGGTTCAATATC
+CAGCGACTCACACCCCAATCATGTGTGCTTCGTTCCCACCCGTTTTCGGCCAAGACTCAA
+CACAAGGGTTCGGCAAAGAATCACAACTTATACCCTTTCGAAACGCAAACAACAATCTTG
+TAGCACCATACGTTGAAGCTTTCGTTGCCAATCAAGCTTATTTCCCGATAGGATCGGGCC
+CAAACATCAACGACAAGGTTCTGTGGAATAGTAGATTGTGGATGACAAGTGGTTTCGTTC
+AGTACTTGGATTACGCTGGCAACGCAATCAACGAAGTGGTTCCTGCAGCAGGGCTACCTT
+TGGGTAGGTCAATCCCATTACTGCCAGGGGAAGTTCAGCCGGTTGGTAACACCAACATGA
+GCACAAGCTGCGTTCCTCGTTATTCTGTGGACGGTCGCCGAATTTTTACTTATGTCAACA
+CAGCTCAATCCGTTCCTTTGATACAAGCGTGTAATAGAGCCAATAGATTGGCCAGATCGG
+CATGGCTATTATTGCATGTCTACATCGAACCAGAGTTGCAGCTATTGAGCGATGAAGTGG
+TGGACATATTCGACCAACTGACAAGCAAGACTTTTTTAGATGTAGCAAAATCGGCTGCGG
+ACAGTGCGGAGGGCAACATTCCGGCAACGAAGGTATTGACAGACCTCCAGGCAGTGGATT
+CAGCAACGCTGCCGAGTACTTTGGATCCATCCACAAATATGCTCCAACCAGCTCCTTTAC
+TCGGCGAACCTACGACAAATTAACTCGATACATTCATGATGGGGTAAGTCGAAGTAGTCA
+GAGAGAAATTTCATCATTGTCGGATGATTTAGTTAGATTTAGTACTCTCACAGATTTTAC
+TGTCATCGATTTTATTACTAAGAAATTAGATTTAGAACGTCCGATTAGTACTCAAGGAGA
+TTTATTGGCGTTAGAACCTAGATGCAAGGGTGACCTCGCTGTAGCAAGACTTAAGATTAA
+GGACATAATAGGTAGGATTGATAAGGATATTAGAACGTGGTGTGAAGCAAATTTATGCCA
+TTTGGATGCAATCTTGGTAACGAACTTGATAATCTGGGGACAAATCTGGGGGTTGGAAAT
+TCTGAAAGCTTTACATTCAACAGGAATATTAAACGATTTCGATACTTTCGCAACAAAAGG
+AAGCAAGATTAGTGCATTTGTCAAGCGTTTTCCCTTCGACAAGGATGATGCCAAAGCTAG
+ATGGGCAGAGATCAACACGCTGACGGGCTATTTGCAGAATGATTTTGGAAACTTCGATTA
+CGATAAGGAATTTGAAGCTTTAGCTACCGGAGATAGTAACCACCCCGCTTGGTGGGAAGA
+AGTATTCACTAAGAAAATAAAAGAGTTGATGACACATCAAGAACACAAAAAGTATATCAG
+TTTTGAAAAATATGTTAAGGAAGGATATTGGATAACATCTGGCAGCAGCAGCATCGGCAA
+AGTCAATTGGTCATATGACGGAGACTTGGGCAAATTTAAGGCTAGAAAGAACATGTTATT
+AGATCTATATACGCCGGACGAAATCTACAAAATGGCTGTAGAATGGGACGGGAAACTAGA
+GAATAGAGTGTTCATCAAAGATGAATTGGCAAAGAGAAGATTGGCAGTGGCAAGCAATAT
+TGAAGCATATTTGAATCAAGGGTATATATTTTATCTATTTG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/blast.tab	Sun Oct 15 18:43:37 2017 -0400
@@ -0,0 +1,695 @@
+Locus_1_Transcript_1/7_Confidence_0.231_Length_224	gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2	98.47	196	3	0	3	198	517	712	9e-92	  340	1416
+Locus_1_Transcript_1/7_Confidence_0.231_Length_224	gi|351066204|gb|JF461542.1|_Flock_house_virus_isolate_IP-VIA-022011_coat_protein_precursor,_gene,_c	95.41	196	9	0	3	198	517	712	1e-83	  313	1365
+Locus_1_Transcript_1/7_Confidence_0.231_Length_224	gi|152143030|gb|EF690538.1|_Flock_house_virus_isolate_TNCL_segment_RNA2_protein_alpha_mRNA,_complet	94.39	196	11	0	3	198	518	713	7e-81	  304	1383
+Locus_1_Transcript_1/7_Confidence_0.231_Length_224	gi|22711883|ref|NC_004144.1|_Flock_house_virus,_complete_genome	89.18	194	21	0	3	196	518	711	3e-66	  255	1400
+Locus_1_Transcript_1/7_Confidence_0.231_Length_224	gi|9632343|ref|NC_002037.1|_Black_beetle_virus_RNA_2,_complete_sequence	87.63	194	24	0	3	196	518	711	2e-62	  242	1399
+Locus_1_Transcript_2/7_Confidence_0.231_Length_143	gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2	97.44	117	3	0	1	117	596	712	4e-49	  197	1416
+Locus_1_Transcript_2/7_Confidence_0.231_Length_143	gi|351066204|gb|JF461542.1|_Flock_house_virus_isolate_IP-VIA-022011_coat_protein_precursor,_gene,_c	92.31	117	9	0	1	117	596	712	6e-41	  170	1365
+Locus_1_Transcript_2/7_Confidence_0.231_Length_143	gi|152143030|gb|EF690538.1|_Flock_house_virus_isolate_TNCL_segment_RNA2_protein_alpha_mRNA,_complet	91.45	117	10	0	1	117	597	713	7e-40	  167	1383
+Locus_1_Transcript_2/7_Confidence_0.231_Length_143	gi|9632343|ref|NC_002037.1|_Black_beetle_virus_RNA_2,_complete_sequence	84.35	115	18	0	1	115	597	711	6e-28	  127	1399
+Locus_1_Transcript_2/7_Confidence_0.231_Length_143	gi|22711883|ref|NC_004144.1|_Flock_house_virus,_complete_genome	83.48	115	19	0	1	115	597	711	3e-26	  122	1400
+Locus_1_Transcript_3/7_Confidence_0.231_Length_407	gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2	97.67	258	6	0	1	258	455	712	2e-121	  439	1416
+Locus_1_Transcript_3/7_Confidence_0.231_Length_407	gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2	87.95	166	1	1	259	405	1250	1415	3e-56	  223	1416
+Locus_1_Transcript_3/7_Confidence_0.231_Length_407	gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2	85.71	42	6	0	339	380	112	153	4e-04	50.0	1416
+Locus_1_Transcript_3/7_Confidence_0.231_Length_407	gi|351066204|gb|JF461542.1|_Flock_house_virus_isolate_IP-VIA-022011_coat_protein_precursor,_gene,_c	94.96	258	13	0	1	258	455	712	1e-111	  407	1365
+Locus_1_Transcript_3/7_Confidence_0.231_Length_407	gi|351066204|gb|JF461542.1|_Flock_house_virus_isolate_IP-VIA-022011_coat_protein_precursor,_gene,_c	77.08	96	3	1	261	337	1252	1347	2e-15	87.8	1365
+Locus_1_Transcript_3/7_Confidence_0.231_Length_407	gi|351066204|gb|JF461542.1|_Flock_house_virus_isolate_IP-VIA-022011_coat_protein_precursor,_gene,_c	85.71	42	6	0	339	380	112	153	4e-04	50.0	1365
+Locus_1_Transcript_3/7_Confidence_0.231_Length_407	gi|152143030|gb|EF690538.1|_Flock_house_virus_isolate_TNCL_segment_RNA2_protein_alpha_mRNA,_complet	93.02	258	18	0	1	258	456	713	5e-105	  385	1383
+Locus_1_Transcript_3/7_Confidence_0.231_Length_407	gi|152143030|gb|EF690538.1|_Flock_house_virus_isolate_TNCL_segment_RNA2_protein_alpha_mRNA,_complet	94.87	78	4	0	260	337	1252	1329	2e-26	  123	1383
+Locus_1_Transcript_3/7_Confidence_0.231_Length_407	gi|152143030|gb|EF690538.1|_Flock_house_virus_isolate_TNCL_segment_RNA2_protein_alpha_mRNA,_complet	85.42	48	7	0	339	386	113	160	1e-05	55.4	1383
+Locus_1_Transcript_3/7_Confidence_0.231_Length_407	gi|22711883|ref|NC_004144.1|_Flock_house_virus,_complete_genome	88.67	256	29	0	1	256	456	711	9e-89	  331	1400
+Locus_1_Transcript_3/7_Confidence_0.231_Length_407	gi|22711883|ref|NC_004144.1|_Flock_house_virus,_complete_genome	86.54	52	7	0	286	337	1295	1346	7e-08	62.6	1400
+Locus_1_Transcript_3/7_Confidence_0.231_Length_407	gi|9632343|ref|NC_002037.1|_Black_beetle_virus_RNA_2,_complete_sequence	83.53	255	42	0	2	256	457	711	8e-71	  271	1399
+Locus_1_Transcript_3/7_Confidence_0.231_Length_407	gi|9632343|ref|NC_002037.1|_Black_beetle_virus_RNA_2,_complete_sequence	90.38	52	5	0	286	337	1292	1343	1e-10	71.6	1399
+Locus_1_Transcript_3/7_Confidence_0.231_Length_407	gi|9632343|ref|NC_002037.1|_Black_beetle_virus_RNA_2,_complete_sequence	96.67	30	1	0	351	380	125	154	4e-04	50.0	1399
+Locus_1_Transcript_4/7_Confidence_0.077_Length_591	gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2	91.98	262	18	2	1	260	1	261	4e-101	  372	1416
+Locus_1_Transcript_4/7_Confidence_0.077_Length_591	gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2	98.47	196	3	0	247	442	517	712	3e-91	  340	1416
+Locus_1_Transcript_4/7_Confidence_0.077_Length_591	gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2	87.95	166	1	1	443	589	1250	1415	5e-56	  223	1416
+Locus_1_Transcript_4/7_Confidence_0.077_Length_591	gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2	85.71	42	6	0	523	564	112	153	7e-04	50.0	1416
+Locus_1_Transcript_4/7_Confidence_0.077_Length_591	gi|152143030|gb|EF690538.1|_Flock_house_virus_isolate_TNCL_segment_RNA2_protein_alpha_mRNA,_complet	89.60	250	22	3	1	247	1	249	2e-86	  324	1383
+Locus_1_Transcript_4/7_Confidence_0.077_Length_591	gi|152143030|gb|EF690538.1|_Flock_house_virus_isolate_TNCL_segment_RNA2_protein_alpha_mRNA,_complet	94.39	196	11	0	247	442	518	713	2e-80	  304	1383
+Locus_1_Transcript_4/7_Confidence_0.077_Length_591	gi|152143030|gb|EF690538.1|_Flock_house_virus_isolate_TNCL_segment_RNA2_protein_alpha_mRNA,_complet	94.87	78	4	0	444	521	1252	1329	4e-26	  123	1383
+Locus_1_Transcript_4/7_Confidence_0.077_Length_591	gi|152143030|gb|EF690538.1|_Flock_house_virus_isolate_TNCL_segment_RNA2_protein_alpha_mRNA,_complet	85.42	48	7	0	523	570	113	160	2e-05	55.4	1383
+Locus_1_Transcript_4/7_Confidence_0.077_Length_591	gi|351066204|gb|JF461542.1|_Flock_house_virus_isolate_IP-VIA-022011_coat_protein_precursor,_gene,_c	88.89	252	24	3	1	250	1	250	9e-85	  318	1365
+Locus_1_Transcript_4/7_Confidence_0.077_Length_591	gi|351066204|gb|JF461542.1|_Flock_house_virus_isolate_IP-VIA-022011_coat_protein_precursor,_gene,_c	95.41	196	9	0	247	442	517	712	4e-83	  313	1365
+Locus_1_Transcript_4/7_Confidence_0.077_Length_591	gi|351066204|gb|JF461542.1|_Flock_house_virus_isolate_IP-VIA-022011_coat_protein_precursor,_gene,_c	77.08	96	3	1	445	521	1252	1347	3e-15	87.8	1365
+Locus_1_Transcript_4/7_Confidence_0.077_Length_591	gi|351066204|gb|JF461542.1|_Flock_house_virus_isolate_IP-VIA-022011_coat_protein_precursor,_gene,_c	85.71	42	6	0	523	564	112	153	7e-04	50.0	1365
+Locus_1_Transcript_4/7_Confidence_0.077_Length_591	gi|22711883|ref|NC_004144.1|_Flock_house_virus,_complete_genome	89.18	194	21	0	247	440	518	711	9e-66	  255	1400
+Locus_1_Transcript_4/7_Confidence_0.077_Length_591	gi|22711883|ref|NC_004144.1|_Flock_house_virus,_complete_genome	83.67	251	35	5	1	247	1	249	1e-64	  251	1400
+Locus_1_Transcript_4/7_Confidence_0.077_Length_591	gi|22711883|ref|NC_004144.1|_Flock_house_virus,_complete_genome	86.54	52	7	0	470	521	1295	1346	1e-07	62.6	1400
+Locus_1_Transcript_4/7_Confidence_0.077_Length_591	gi|9632343|ref|NC_002037.1|_Black_beetle_virus_RNA_2,_complete_sequence	87.63	194	24	0	247	440	518	711	5e-62	  242	1399
+Locus_1_Transcript_4/7_Confidence_0.077_Length_591	gi|9632343|ref|NC_002037.1|_Black_beetle_virus_RNA_2,_complete_sequence	75.49	253	57	4	1	250	1	251	4e-38	  163	1399
+Locus_1_Transcript_4/7_Confidence_0.077_Length_591	gi|9632343|ref|NC_002037.1|_Black_beetle_virus_RNA_2,_complete_sequence	90.38	52	5	0	470	521	1292	1343	2e-10	71.6	1399
+Locus_1_Transcript_4/7_Confidence_0.077_Length_591	gi|9632343|ref|NC_002037.1|_Black_beetle_virus_RNA_2,_complete_sequence	96.67	30	1	0	535	564	125	154	7e-04	50.0	1399
+Locus_1_Transcript_5/7_Confidence_0.231_Length_163	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	97.25	109	3	0	55	163	2944	3052	1e-44	  183	3107
+Locus_1_Transcript_5/7_Confidence_0.231_Length_163	gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence	96.33	109	4	0	55	163	2944	3052	1e-43	  179	3107
+Locus_1_Transcript_5/7_Confidence_0.231_Length_163	gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd	95.41	109	5	0	55	163	2944	3052	6e-42	  174	3107
+Locus_1_Transcript_5/7_Confidence_0.231_Length_163	gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds	95.37	108	5	0	56	163	227	334	2e-41	  172	389
+Locus_1_Transcript_5/7_Confidence_0.231_Length_163	gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence	95.37	108	5	0	56	163	2945	3052	2e-41	  172	3107
+Locus_1_Transcript_5/7_Confidence_0.231_Length_163	gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome	95.37	108	5	0	56	163	2944	3051	2e-41	  172	3106
+Locus_1_Transcript_5/7_Confidence_0.231_Length_163	gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds	81.52	92	15	2	73	163	2949	3039	3e-14	82.4	3096
+Locus_1_Transcript_5/7_Confidence_0.231_Length_163	gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome	81.52	92	15	2	73	163	2949	3039	3e-14	82.4	3096
+Locus_1_Transcript_5/7_Confidence_0.231_Length_163	gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2	100.00	27	0	0	9	35	146	172	2e-04	50.0	1416
+Locus_1_Transcript_6/7_Confidence_0.077_Length_216	gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2	89.60	173	15	2	1	171	1	172	5e-57	  224	1416
+Locus_1_Transcript_6/7_Confidence_0.077_Length_216	gi|152143030|gb|EF690538.1|_Flock_house_virus_isolate_TNCL_segment_RNA2_protein_alpha_mRNA,_complet	86.78	174	19	3	1	171	1	173	6e-50	  201	1383
+Locus_1_Transcript_6/7_Confidence_0.077_Length_216	gi|351066204|gb|JF461542.1|_Flock_house_virus_isolate_IP-VIA-022011_coat_protein_precursor,_gene,_c	86.13	173	21	2	1	171	1	172	7e-49	  197	1365
+Locus_1_Transcript_6/7_Confidence_0.077_Length_216	gi|22711883|ref|NC_004144.1|_Flock_house_virus,_complete_genome	84.34	166	20	5	1	162	1	164	4e-39	  165	1400
+Locus_1_Transcript_6/7_Confidence_0.077_Length_216	gi|9632343|ref|NC_002037.1|_Black_beetle_virus_RNA_2,_complete_sequence	82.35	102	17	1	1	101	1	102	1e-19	  100	1399
+Locus_1_Transcript_6/7_Confidence_0.077_Length_216	gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd	100.00	26	0	0	191	216	2944	2969	8e-04	48.2	3107
+Locus_1_Transcript_6/7_Confidence_0.077_Length_216	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	100.00	26	0	0	191	216	2944	2969	8e-04	48.2	3107
+Locus_1_Transcript_7/7_Confidence_0.231_Length_184	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	80.89	157	3	1	55	184	2944	3100	3e-40	  168	3107
+Locus_1_Transcript_7/7_Confidence_0.231_Length_184	gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd	78.34	157	7	1	55	184	2944	3100	7e-35	  150	3107
+Locus_1_Transcript_7/7_Confidence_0.231_Length_184	gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence	77.71	157	8	1	55	184	2944	3100	3e-33	  145	3107
+Locus_1_Transcript_7/7_Confidence_0.231_Length_184	gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds	76.28	156	10	1	56	184	227	382	6e-30	  134	389
+Locus_1_Transcript_7/7_Confidence_0.231_Length_184	gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence	76.28	156	10	1	56	184	2945	3100	6e-30	  134	3107
+Locus_1_Transcript_7/7_Confidence_0.231_Length_184	gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome	76.28	156	10	1	56	184	2944	3099	6e-30	  134	3106
+Locus_1_Transcript_7/7_Confidence_0.231_Length_184	gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds	88.00	50	6	0	73	122	2949	2998	8e-09	64.4	3096
+Locus_1_Transcript_7/7_Confidence_0.231_Length_184	gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome	88.00	50	6	0	73	122	2949	2998	8e-09	64.4	3096
+Locus_1_Transcript_7/7_Confidence_0.231_Length_184	gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2	100.00	27	0	0	9	35	146	172	2e-04	50.0	1416
+Locus_2_Transcript_1/5_Confidence_0.125_Length_327	gi|821369836|gb|KP714070.1|_Newfield_virus_putative_replicase_gene,_complete_cds	98.56	209	3	0	119	327	1	209	1e-98	  363	4743
+Locus_2_Transcript_2/5_Confidence_0.250_Length_809	gi|821369836|gb|KP714070.1|_Newfield_virus_putative_replicase_gene,_complete_cds	94.55	367	20	0	119	485	1	367	3e-161	  572	4743
+Locus_2_Transcript_2/5_Confidence_0.250_Length_809	gi|821369836|gb|KP714070.1|_Newfield_virus_putative_replicase_gene,_complete_cds	98.56	209	3	0	483	691	209	1	3e-98	  363	4743
+Locus_2_Transcript_3/5_Confidence_0.250_Length_207	gi|821369836|gb|KP714070.1|_Newfield_virus_putative_replicase_gene,_complete_cds	90.76	184	17	0	1	184	184	367	3e-66	  255	4743
+Locus_2_Transcript_3/5_Confidence_0.250_Length_207	gi|821369836|gb|KP714070.1|_Newfield_virus_putative_replicase_gene,_complete_cds	100.00	26	0	0	182	207	209	184	7e-04	48.2	4743
+Locus_2_Transcript_4/5_Confidence_0.125_Length_605	gi|821369836|gb|KP714070.1|_Newfield_virus_putative_replicase_gene,_complete_cds	85.40	596	87	0	1	596	184	779	0.0	  682	4743
+Locus_2_Transcript_5/5_Confidence_0.000_Length_447	gi|821369836|gb|KP714070.1|_Newfield_virus_putative_replicase_gene,_complete_cds	82.99	435	74	0	4	438	345	779	4e-125	  452	4743
+Locus_3_Transcript_4/5_Confidence_0.250_Length_926	gi|262225305|gb|GQ342963.1|_Drosophila_melanogaster_birnavirus_SW-2009a_strain_DBV_segment_B,_compl	100.00	825	0	0	1	825	825	1	0.0	 1489	3014
+Locus_3_Transcript_5/5_Confidence_0.250_Length_1016	gi|262225305|gb|GQ342963.1|_Drosophila_melanogaster_birnavirus_SW-2009a_strain_DBV_segment_B,_compl	100.00	825	0	0	1	825	825	1	0.0	 1489	3014
+Locus_4_Transcript_4/5_Confidence_0.333_Length_1170	gi|831181913|dbj|AB935183.1|_Negev_virus_genes_for_hypothetical_protein,_complete_cds,_isolate:_#73	69.83	116	35	0	750	865	4652	4767	4e-04	51.8	9545
+Locus_4_Transcript_5/5_Confidence_0.111_Length_956	gi|831181913|dbj|AB935183.1|_Negev_virus_genes_for_hypothetical_protein,_complete_cds,_isolate:_#73	69.83	116	35	0	536	651	4652	4767	3e-04	51.8	9545
+Locus_7_Transcript_1/11_Confidence_0.154_Length_1632	gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome	99.16	1069	3	1	564	1632	679	1741	0.0	 1889	6780
+Locus_7_Transcript_1/11_Confidence_0.154_Length_1632	gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome	98.06	566	6	2	2	565	1	563	0.0	  967	6780
+Locus_7_Transcript_1/11_Confidence_0.154_Length_1632	gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome	99.16	1069	3	1	564	1632	679	1741	0.0	 1889	6780
+Locus_7_Transcript_1/11_Confidence_0.154_Length_1632	gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome	98.06	566	6	2	2	565	1	563	0.0	  967	6780
+Locus_7_Transcript_1/11_Confidence_0.154_Length_1632	gi|380715048|gb|JN391187.1|_Tianjin_totivirus,_complete_genome	74.36	78	20	0	1546	1623	2481	2558	5e-04	51.8	7611
+Locus_7_Transcript_1/11_Confidence_0.154_Length_1632	gi|394935462|ref|NC_017084.1|_Tianjin_totivirus,_complete_genome	74.36	78	20	0	1546	1623	2481	2558	5e-04	51.8	7611
+Locus_7_Transcript_2/11_Confidence_0.077_Length_1069	gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome	99.06	1069	4	1	1	1069	679	1741	0.0	 1884	6780
+Locus_7_Transcript_2/11_Confidence_0.077_Length_1069	gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome	99.06	1069	4	1	1	1069	679	1741	0.0	 1884	6780
+Locus_7_Transcript_2/11_Confidence_0.077_Length_1069	gi|380715048|gb|JN391187.1|_Tianjin_totivirus,_complete_genome	74.36	78	20	0	983	1060	2481	2558	4e-04	51.8	7611
+Locus_7_Transcript_2/11_Confidence_0.077_Length_1069	gi|394935462|ref|NC_017084.1|_Tianjin_totivirus,_complete_genome	74.36	78	20	0	983	1060	2481	2558	4e-04	51.8	7611
+Locus_7_Transcript_3/11_Confidence_0.154_Length_1743	gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome	99.89	1742	2	0	2	1743	1716	3457	0.0	 3133	6780
+Locus_7_Transcript_3/11_Confidence_0.154_Length_1743	gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome	99.89	1742	2	0	2	1743	1716	3457	0.0	 3133	6780
+Locus_7_Transcript_3/11_Confidence_0.154_Length_1743	gi|380715048|gb|JN391187.1|_Tianjin_totivirus,_complete_genome	65.11	685	230	7	40	721	2580	3258	6e-29	  134	7611
+Locus_7_Transcript_3/11_Confidence_0.154_Length_1743	gi|394935462|ref|NC_017084.1|_Tianjin_totivirus,_complete_genome	65.11	685	230	7	40	721	2580	3258	6e-29	  134	7611
+Locus_7_Transcript_3/11_Confidence_0.154_Length_1743	gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	65.07	687	225	8	41	721	2581	3258	6e-29	  134	7611
+Locus_7_Transcript_3/11_Confidence_0.154_Length_1743	gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	68.46	279	82	2	29	304	2572	2847	1e-19	  104	7617
+Locus_7_Transcript_3/11_Confidence_0.154_Length_1743	gi|198286505|gb|EU715328.1|_Armigeres_subalbatus_virus_SaX06-AK20,_complete_genome	74.70	83	21	0	986	1068	3397	3479	5e-05	55.4	7510
+Locus_7_Transcript_3/11_Confidence_0.154_Length_1743	gi|309259994|ref|NC_014609.1|_Armigeres_subalbatus_virus_SaX06-AK20,_complete_genome	74.70	83	21	0	986	1068	3397	3479	5e-05	55.4	7510
+Locus_7_Transcript_4/11_Confidence_0.154_Length_571	gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome	99.82	571	1	0	1	571	3429	3999	0.0	 1025	6780
+Locus_7_Transcript_4/11_Confidence_0.154_Length_571	gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome	99.82	571	1	0	1	571	3429	3999	0.0	 1025	6780
+Locus_7_Transcript_5/11_Confidence_0.308_Length_4519	gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome	99.67	3956	7	1	564	4519	679	4628	0.0	 7077	6780
+Locus_7_Transcript_5/11_Confidence_0.308_Length_4519	gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome	98.06	566	6	2	2	565	1	563	0.0	  967	6780
+Locus_7_Transcript_5/11_Confidence_0.308_Length_4519	gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome	99.67	3956	7	1	564	4519	679	4628	0.0	 7077	6780
+Locus_7_Transcript_5/11_Confidence_0.308_Length_4519	gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome	98.06	566	6	2	2	565	1	563	0.0	  967	6780
+Locus_7_Transcript_5/11_Confidence_0.308_Length_4519	gi|380715048|gb|JN391187.1|_Tianjin_totivirus,_complete_genome	62.65	2608	870	50	1546	4101	2481	5036	1e-42	  181	7611
+Locus_7_Transcript_5/11_Confidence_0.308_Length_4519	gi|394935462|ref|NC_017084.1|_Tianjin_totivirus,_complete_genome	62.65	2608	870	50	1546	4101	2481	5036	1e-42	  181	7611
+Locus_7_Transcript_5/11_Confidence_0.308_Length_4519	gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	65.19	790	254	10	1546	2326	2481	3258	4e-36	  159	7611
+Locus_7_Transcript_5/11_Confidence_0.308_Length_4519	gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	64.49	628	209	7	3481	4101	4416	5036	6e-21	  109	7611
+Locus_7_Transcript_5/11_Confidence_0.308_Length_4519	gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	68.39	367	107	3	1546	1909	2487	2847	2e-28	  134	7617
+Locus_7_Transcript_5/11_Confidence_0.308_Length_4519	gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	65.43	564	177	9	3541	4095	4482	5036	2e-22	  114	7617
+Locus_7_Transcript_5/11_Confidence_0.308_Length_4519	gi|198286505|gb|EU715328.1|_Armigeres_subalbatus_virus_SaX06-AK20,_complete_genome	74.70	83	21	0	2591	2673	3397	3479	1e-04	55.4	7510
+Locus_7_Transcript_5/11_Confidence_0.308_Length_4519	gi|309259994|ref|NC_014609.1|_Armigeres_subalbatus_virus_SaX06-AK20,_complete_genome	74.70	83	21	0	2591	2673	3397	3479	1e-04	55.4	7510
+Locus_7_Transcript_6/11_Confidence_0.154_Length_656	gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome	99.69	655	2	0	2	656	3974	4628	0.0	 1173	6780
+Locus_7_Transcript_6/11_Confidence_0.154_Length_656	gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome	99.69	655	2	0	2	656	3974	4628	0.0	 1173	6780
+Locus_7_Transcript_6/11_Confidence_0.154_Length_656	gi|380715048|gb|JN391187.1|_Tianjin_totivirus,_complete_genome	75.00	148	34	1	91	238	4892	5036	2e-18	98.7	7611
+Locus_7_Transcript_6/11_Confidence_0.154_Length_656	gi|394935462|ref|NC_017084.1|_Tianjin_totivirus,_complete_genome	75.00	148	34	1	91	238	4892	5036	2e-18	98.7	7611
+Locus_7_Transcript_6/11_Confidence_0.154_Length_656	gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	75.00	148	34	1	91	238	4892	5036	2e-18	98.7	7611
+Locus_7_Transcript_6/11_Confidence_0.154_Length_656	gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	72.54	142	36	1	91	232	4898	5036	2e-12	78.8	7617
+Locus_7_Transcript_7/11_Confidence_0.462_Length_4481	gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome	99.60	4481	12	1	1	4481	679	5153	0.0	 8001	6780
+Locus_7_Transcript_7/11_Confidence_0.462_Length_4481	gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome	99.60	4481	12	1	1	4481	679	5153	0.0	 8001	6780
+Locus_7_Transcript_7/11_Confidence_0.462_Length_4481	gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	68.67	565	165	5	3923	4481	5427	5985	3e-51	  210	7617
+Locus_7_Transcript_7/11_Confidence_0.462_Length_4481	gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	68.39	367	107	3	983	1346	2487	2847	2e-28	  134	7617
+Locus_7_Transcript_7/11_Confidence_0.462_Length_4481	gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	65.43	564	177	9	2978	3532	4482	5036	2e-22	  114	7617
+Locus_7_Transcript_7/11_Confidence_0.462_Length_4481	gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	69.64	504	145	6	3982	4481	5480	5979	5e-48	  199	7611
+Locus_7_Transcript_7/11_Confidence_0.462_Length_4481	gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	65.19	790	254	10	983	1763	2481	3258	4e-36	  159	7611
+Locus_7_Transcript_7/11_Confidence_0.462_Length_4481	gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	64.49	628	209	7	2918	3538	4416	5036	6e-21	  109	7611
+Locus_7_Transcript_7/11_Confidence_0.462_Length_4481	gi|380715048|gb|JN391187.1|_Tianjin_totivirus,_complete_genome	62.65	2608	870	50	983	3538	2481	5036	1e-42	  181	7611
+Locus_7_Transcript_7/11_Confidence_0.462_Length_4481	gi|380715048|gb|JN391187.1|_Tianjin_totivirus,_complete_genome	67.86	501	157	4	3983	4481	5481	5979	3e-37	  163	7611
+Locus_7_Transcript_7/11_Confidence_0.462_Length_4481	gi|394935462|ref|NC_017084.1|_Tianjin_totivirus,_complete_genome	62.65	2608	870	50	983	3538	2481	5036	1e-42	  181	7611
+Locus_7_Transcript_7/11_Confidence_0.462_Length_4481	gi|394935462|ref|NC_017084.1|_Tianjin_totivirus,_complete_genome	67.86	501	157	4	3983	4481	5481	5979	3e-37	  163	7611
+Locus_7_Transcript_7/11_Confidence_0.462_Length_4481	gi|198286505|gb|EU715328.1|_Armigeres_subalbatus_virus_SaX06-AK20,_complete_genome	74.70	83	21	0	2028	2110	3397	3479	1e-04	55.4	7510
+Locus_7_Transcript_7/11_Confidence_0.462_Length_4481	gi|309259994|ref|NC_014609.1|_Armigeres_subalbatus_virus_SaX06-AK20,_complete_genome	74.70	83	21	0	2028	2110	3397	3479	1e-04	55.4	7510
+Locus_7_Transcript_8/11_Confidence_0.154_Length_552	gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome	99.28	552	4	0	1	552	4602	5153	0.0	  978	6780
+Locus_7_Transcript_8/11_Confidence_0.154_Length_552	gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome	99.28	552	4	0	1	552	4602	5153	0.0	  978	6780
+Locus_7_Transcript_8/11_Confidence_0.154_Length_552	gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	68.82	542	157	5	17	552	5450	5985	1e-50	  205	7617
+Locus_7_Transcript_8/11_Confidence_0.154_Length_552	gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	69.64	504	145	6	53	552	5480	5979	5e-49	  199	7611
+Locus_7_Transcript_8/11_Confidence_0.154_Length_552	gi|380715048|gb|JN391187.1|_Tianjin_totivirus,_complete_genome	67.86	501	157	4	54	552	5481	5979	4e-38	  163	7611
+Locus_7_Transcript_8/11_Confidence_0.154_Length_552	gi|394935462|ref|NC_017084.1|_Tianjin_totivirus,_complete_genome	67.86	501	157	4	54	552	5481	5979	4e-38	  163	7611
+Locus_7_Transcript_9/11_Confidence_0.154_Length_552	gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome	99.09	551	5	0	2	552	4603	5153	0.0	  971	6780
+Locus_7_Transcript_9/11_Confidence_0.154_Length_552	gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome	99.09	551	5	0	2	552	4603	5153	0.0	  971	6780
+Locus_7_Transcript_9/11_Confidence_0.154_Length_552	gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	68.71	556	162	5	3	552	5436	5985	4e-51	  206	7617
+Locus_7_Transcript_9/11_Confidence_0.154_Length_552	gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	69.64	504	145	6	53	552	5480	5979	5e-49	  199	7611
+Locus_7_Transcript_9/11_Confidence_0.154_Length_552	gi|380715048|gb|JN391187.1|_Tianjin_totivirus,_complete_genome	67.86	501	157	4	54	552	5481	5979	4e-38	  163	7611
+Locus_7_Transcript_9/11_Confidence_0.154_Length_552	gi|394935462|ref|NC_017084.1|_Tianjin_totivirus,_complete_genome	67.86	501	157	4	54	552	5481	5979	4e-38	  163	7611
+Locus_7_Transcript_10/11_Confidence_0.154_Length_4093	gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome	99.66	4093	8	1	1	4093	542	4628	0.0	 7319	6780
+Locus_7_Transcript_10/11_Confidence_0.154_Length_4093	gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome	99.66	4093	8	1	1	4093	542	4628	0.0	 7319	6780
+Locus_7_Transcript_10/11_Confidence_0.154_Length_4093	gi|380715048|gb|JN391187.1|_Tianjin_totivirus,_complete_genome	62.65	2608	870	50	1120	3675	2481	5036	1e-42	  181	7611
+Locus_7_Transcript_10/11_Confidence_0.154_Length_4093	gi|394935462|ref|NC_017084.1|_Tianjin_totivirus,_complete_genome	62.65	2608	870	50	1120	3675	2481	5036	1e-42	  181	7611
+Locus_7_Transcript_10/11_Confidence_0.154_Length_4093	gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	65.19	790	254	10	1120	1900	2481	3258	4e-36	  159	7611
+Locus_7_Transcript_10/11_Confidence_0.154_Length_4093	gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	64.49	628	209	7	3055	3675	4416	5036	6e-21	  109	7611
+Locus_7_Transcript_10/11_Confidence_0.154_Length_4093	gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	68.39	367	107	3	1120	1483	2487	2847	1e-28	  134	7617
+Locus_7_Transcript_10/11_Confidence_0.154_Length_4093	gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	65.43	564	177	9	3115	3669	4482	5036	1e-22	  114	7617
+Locus_7_Transcript_10/11_Confidence_0.154_Length_4093	gi|198286505|gb|EU715328.1|_Armigeres_subalbatus_virus_SaX06-AK20,_complete_genome	74.70	83	21	0	2165	2247	3397	3479	1e-04	55.4	7510
+Locus_7_Transcript_10/11_Confidence_0.154_Length_4093	gi|309259994|ref|NC_014609.1|_Armigeres_subalbatus_virus_SaX06-AK20,_complete_genome	74.70	83	21	0	2165	2247	3397	3479	1e-04	55.4	7510
+Locus_7_Transcript_11/11_Confidence_0.000_Length_1206	gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome	99.17	1206	4	1	1	1206	542	1741	0.0	 2131	6780
+Locus_7_Transcript_11/11_Confidence_0.000_Length_1206	gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome	99.17	1206	4	1	1	1206	542	1741	0.0	 2131	6780
+Locus_7_Transcript_11/11_Confidence_0.000_Length_1206	gi|380715048|gb|JN391187.1|_Tianjin_totivirus,_complete_genome	74.36	78	20	0	1120	1197	2481	2558	4e-04	51.8	7611
+Locus_7_Transcript_11/11_Confidence_0.000_Length_1206	gi|394935462|ref|NC_017084.1|_Tianjin_totivirus,_complete_genome	74.36	78	20	0	1120	1197	2481	2558	4e-04	51.8	7611
+Locus_8_Transcript_2/4_Confidence_0.200_Length_117	gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome	100.00	26	0	0	1	26	5645	5670	4e-04	48.2	6780
+Locus_8_Transcript_2/4_Confidence_0.200_Length_117	gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome	100.00	26	0	0	1	26	5645	5670	4e-04	48.2	6780
+Locus_9_Transcript_1/3_Confidence_0.667_Length_681	gi|262225302|gb|GQ342962.1|_Drosophila_melanogaster_birnavirus_SW-2009a_strain_DBV_segment_A,_compl	100.00	681	0	0	1	681	972	1652	0.0	 1229	3260
+Locus_9_Transcript_1/3_Confidence_0.667_Length_681	gi|34559206|gb|AY374435.1|_Infectious_pancreatic_necrosis_virus_isolate_NVI-001_segment_A_15.4_kDa_	75.00	88	20	2	242	328	1211	1297	6e-05	53.6	3097
+Locus_9_Transcript_1/3_Confidence_0.667_Length_681	gi|38049606|gb|AY354519.1|_Infectious_pancreatic_necrosis_virus_isolate_Sp103_15-kDa_nonstructural_	73.20	97	24	2	193	288	1162	1257	2e-04	51.8	3097
+Locus_9_Transcript_1/3_Confidence_0.667_Length_681	gi|38049624|gb|AY354520.1|_Infectious_pancreatic_necrosis_virus_isolate_Sp116_15-kDa_nonstructural_	73.20	97	24	2	193	288	1162	1257	2e-04	51.8	3097
+Locus_9_Transcript_1/3_Confidence_0.667_Length_681	gi|38049628|gb|AY354521.1|_Infectious_pancreatic_necrosis_virus_isolate_Sp122_12-kDa_nonstructural_	73.20	97	24	2	193	288	1162	1257	2e-04	51.8	3097
+Locus_9_Transcript_1/3_Confidence_0.667_Length_681	gi|60550099|gb|AY823632.1|_Infectious_pancreatic_necrosis_virus_isolate_VP5-deficient_Sp103_polypro	73.20	97	24	2	193	288	1162	1257	2e-04	51.8	3097
+Locus_9_Transcript_1/3_Confidence_0.667_Length_681	gi|1762324|gb|U56907.1|IPU56907_Infectious_pancreatic_necrosis_virus_structural_polyprotein_gene,_c	73.20	97	24	2	193	288	1066	1161	2e-04	51.8	2962
+Locus_9_Transcript_1/3_Confidence_0.667_Length_681	gi|4204721|gb|U48225.1|IPU48225_Infectious_pancreatic_necrosis_virus_structural_polyprotein_gene_in	73.20	97	24	2	193	288	1044	1139	2e-04	51.8	2919
+Locus_9_Transcript_1/3_Confidence_0.667_Length_681	gi|100913606|gb|DQ536091.1|_Infectious_pancreatic_necrosis_virus_isolate_S-IPNV/SH96_segment_A,_com	73.20	97	24	2	193	288	1141	1236	2e-04	51.8	3050
+Locus_9_Transcript_1/3_Confidence_0.667_Length_681	gi|100913603|gb|DQ536090.1|_Infectious_pancreatic_necrosis_virus_isolate_S-IPNV/FS12-01_segment_A,_	73.20	97	24	2	193	288	1139	1234	2e-04	51.8	3048
+Locus_9_Transcript_1/3_Confidence_0.667_Length_681	gi|1235705|gb|L40582.1|IPNVP5C_Infectious_pancreatic_necrosis_virus_(d'Honnincthun_(Fr.21))_segment	73.20	97	24	2	193	288	1162	1257	2e-04	51.8	1736
+Locus_9_Transcript_1/3_Confidence_0.667_Length_681	gi|34559180|gb|AY379735.1|_Infectious_pancreatic_necrosis_virus_isolate_NVI-011_segment_A_14.7_kDa_	73.20	97	24	2	193	288	1162	1257	2e-04	51.8	3097
+Locus_9_Transcript_1/3_Confidence_0.667_Length_681	gi|34559183|gb|AY379736.1|_Infectious_pancreatic_necrosis_virus_isolate_NVI-020_segment_A_15.4_kDa_	73.20	97	24	2	193	288	1162	1257	2e-04	51.8	3097
+Locus_9_Transcript_1/3_Confidence_0.667_Length_681	gi|34559186|gb|AY379737.1|_Infectious_pancreatic_necrosis_virus_isolate_NVI-023_segment_A_12.1_kDa_	73.20	97	24	2	193	288	1162	1257	2e-04	51.8	3097
+Locus_9_Transcript_1/3_Confidence_0.667_Length_681	gi|34559189|gb|AY379738.1|_Infectious_pancreatic_necrosis_virus_isolate_NVI-013_segment_A_12.1_kDa_	73.20	97	24	2	193	288	1162	1257	2e-04	51.8	3097
+Locus_9_Transcript_1/3_Confidence_0.667_Length_681	gi|34559194|gb|AY379740.1|_Infectious_pancreatic_necrosis_virus_isolate_NVI-015_segment_A_12.1_kDa_	73.20	97	24	2	193	288	1162	1257	2e-04	51.8	3097
+Locus_9_Transcript_1/3_Confidence_0.667_Length_681	gi|34559199|gb|AY379742.1|_Infectious_pancreatic_necrosis_virus_isolate_NVI-016_segment_A_15.4_kDa_	73.20	97	24	2	193	288	1162	1257	2e-04	51.8	3097
+Locus_9_Transcript_1/3_Confidence_0.667_Length_681	gi|34559204|gb|AY379744.1|_Infectious_pancreatic_necrosis_virus_isolate_NVI-010_segment_A_107_kDa_p	73.20	97	24	2	193	288	1162	1257	2e-04	51.8	3097
+Locus_9_Transcript_1/3_Confidence_0.667_Length_681	gi|344165501|gb|HQ833317.1|_Infectious_pancreatic_necrosis_virus_isolate_S-IPNV/FS1-01_VP5_and_poly	73.20	97	24	2	193	288	1141	1236	2e-04	51.8	3046
+Locus_9_Transcript_1/3_Confidence_0.667_Length_681	gi|344165504|gb|HQ833318.1|_Infectious_pancreatic_necrosis_virus_isolate_S-IPNV/FS2-01_VP5_and_poly	73.20	97	24	2	193	288	1141	1236	2e-04	51.8	3046
+Locus_9_Transcript_1/3_Confidence_0.667_Length_681	gi|344165507|gb|HQ833319.1|_Infectious_pancreatic_necrosis_virus_isolate_S-IPNV/FS3-01_nonfunctiona	73.20	97	24	2	193	288	1142	1237	2e-04	51.8	3047
+Locus_9_Transcript_1/3_Confidence_0.667_Length_681	gi|344165509|gb|HQ833320.1|_Infectious_pancreatic_necrosis_virus_isolate_S-IPNV/FS5-01_nonfunctiona	73.20	97	24	2	193	288	1141	1236	2e-04	51.8	3046
+Locus_9_Transcript_1/3_Confidence_0.667_Length_681	gi|145693790|gb|EF493156.1|_Infectious_pancreatic_necrosis_virus_from_Spain_segment_A_polyprotein_g	82.98	47	8	0	242	288	1188	1234	8e-04	50.0	3056
+Locus_9_Transcript_2/3_Confidence_0.333_Length_2216	gi|262225302|gb|GQ342962.1|_Drosophila_melanogaster_birnavirus_SW-2009a_strain_DBV_segment_A,_compl	99.59	2217	6	2	1	2216	972	3186	0.0	 3952	3260
+Locus_9_Transcript_2/3_Confidence_0.333_Length_2216	gi|34559206|gb|AY374435.1|_Infectious_pancreatic_necrosis_virus_isolate_NVI-001_segment_A_15.4_kDa_	75.00	88	20	2	242	328	1211	1297	2e-04	53.6	3097
+Locus_9_Transcript_2/3_Confidence_0.333_Length_2216	gi|38049606|gb|AY354519.1|_Infectious_pancreatic_necrosis_virus_isolate_Sp103_15-kDa_nonstructural_	73.20	97	24	2	193	288	1162	1257	7e-04	51.8	3097
+Locus_9_Transcript_2/3_Confidence_0.333_Length_2216	gi|38049624|gb|AY354520.1|_Infectious_pancreatic_necrosis_virus_isolate_Sp116_15-kDa_nonstructural_	73.20	97	24	2	193	288	1162	1257	7e-04	51.8	3097
+Locus_9_Transcript_2/3_Confidence_0.333_Length_2216	gi|38049628|gb|AY354521.1|_Infectious_pancreatic_necrosis_virus_isolate_Sp122_12-kDa_nonstructural_	73.20	97	24	2	193	288	1162	1257	7e-04	51.8	3097
+Locus_9_Transcript_2/3_Confidence_0.333_Length_2216	gi|60550099|gb|AY823632.1|_Infectious_pancreatic_necrosis_virus_isolate_VP5-deficient_Sp103_polypro	73.20	97	24	2	193	288	1162	1257	7e-04	51.8	3097
+Locus_9_Transcript_2/3_Confidence_0.333_Length_2216	gi|1762324|gb|U56907.1|IPU56907_Infectious_pancreatic_necrosis_virus_structural_polyprotein_gene,_c	73.20	97	24	2	193	288	1066	1161	7e-04	51.8	2962
+Locus_9_Transcript_2/3_Confidence_0.333_Length_2216	gi|4204721|gb|U48225.1|IPU48225_Infectious_pancreatic_necrosis_virus_structural_polyprotein_gene_in	73.20	97	24	2	193	288	1044	1139	7e-04	51.8	2919
+Locus_9_Transcript_2/3_Confidence_0.333_Length_2216	gi|100913606|gb|DQ536091.1|_Infectious_pancreatic_necrosis_virus_isolate_S-IPNV/SH96_segment_A,_com	73.20	97	24	2	193	288	1141	1236	7e-04	51.8	3050
+Locus_9_Transcript_2/3_Confidence_0.333_Length_2216	gi|100913603|gb|DQ536090.1|_Infectious_pancreatic_necrosis_virus_isolate_S-IPNV/FS12-01_segment_A,_	73.20	97	24	2	193	288	1139	1234	7e-04	51.8	3048
+Locus_9_Transcript_2/3_Confidence_0.333_Length_2216	gi|1235705|gb|L40582.1|IPNVP5C_Infectious_pancreatic_necrosis_virus_(d'Honnincthun_(Fr.21))_segment	73.20	97	24	2	193	288	1162	1257	7e-04	51.8	1736
+Locus_9_Transcript_2/3_Confidence_0.333_Length_2216	gi|34559180|gb|AY379735.1|_Infectious_pancreatic_necrosis_virus_isolate_NVI-011_segment_A_14.7_kDa_	73.20	97	24	2	193	288	1162	1257	7e-04	51.8	3097
+Locus_9_Transcript_2/3_Confidence_0.333_Length_2216	gi|34559183|gb|AY379736.1|_Infectious_pancreatic_necrosis_virus_isolate_NVI-020_segment_A_15.4_kDa_	73.20	97	24	2	193	288	1162	1257	7e-04	51.8	3097
+Locus_9_Transcript_2/3_Confidence_0.333_Length_2216	gi|34559186|gb|AY379737.1|_Infectious_pancreatic_necrosis_virus_isolate_NVI-023_segment_A_12.1_kDa_	73.20	97	24	2	193	288	1162	1257	7e-04	51.8	3097
+Locus_9_Transcript_2/3_Confidence_0.333_Length_2216	gi|34559189|gb|AY379738.1|_Infectious_pancreatic_necrosis_virus_isolate_NVI-013_segment_A_12.1_kDa_	73.20	97	24	2	193	288	1162	1257	7e-04	51.8	3097
+Locus_9_Transcript_2/3_Confidence_0.333_Length_2216	gi|34559194|gb|AY379740.1|_Infectious_pancreatic_necrosis_virus_isolate_NVI-015_segment_A_12.1_kDa_	73.20	97	24	2	193	288	1162	1257	7e-04	51.8	3097
+Locus_9_Transcript_2/3_Confidence_0.333_Length_2216	gi|34559199|gb|AY379742.1|_Infectious_pancreatic_necrosis_virus_isolate_NVI-016_segment_A_15.4_kDa_	73.20	97	24	2	193	288	1162	1257	7e-04	51.8	3097
+Locus_9_Transcript_2/3_Confidence_0.333_Length_2216	gi|34559204|gb|AY379744.1|_Infectious_pancreatic_necrosis_virus_isolate_NVI-010_segment_A_107_kDa_p	73.20	97	24	2	193	288	1162	1257	7e-04	51.8	3097
+Locus_9_Transcript_2/3_Confidence_0.333_Length_2216	gi|344165501|gb|HQ833317.1|_Infectious_pancreatic_necrosis_virus_isolate_S-IPNV/FS1-01_VP5_and_poly	73.20	97	24	2	193	288	1141	1236	7e-04	51.8	3046
+Locus_9_Transcript_2/3_Confidence_0.333_Length_2216	gi|344165504|gb|HQ833318.1|_Infectious_pancreatic_necrosis_virus_isolate_S-IPNV/FS2-01_VP5_and_poly	73.20	97	24	2	193	288	1141	1236	7e-04	51.8	3046
+Locus_9_Transcript_2/3_Confidence_0.333_Length_2216	gi|344165507|gb|HQ833319.1|_Infectious_pancreatic_necrosis_virus_isolate_S-IPNV/FS3-01_nonfunctiona	73.20	97	24	2	193	288	1142	1237	7e-04	51.8	3047
+Locus_9_Transcript_2/3_Confidence_0.333_Length_2216	gi|344165509|gb|HQ833320.1|_Infectious_pancreatic_necrosis_virus_isolate_S-IPNV/FS5-01_nonfunctiona	73.20	97	24	2	193	288	1141	1236	7e-04	51.8	3046
+Locus_9_Transcript_3/3_Confidence_0.000_Length_1571	gi|262225302|gb|GQ342962.1|_Drosophila_melanogaster_birnavirus_SW-2009a_strain_DBV_segment_A,_compl	99.43	1572	6	2	1	1571	1617	3186	0.0	 2789	3260
+Locus_10_Transcript_1/8_Confidence_0.222_Length_565	gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome	99.81	530	1	0	36	565	5670	5141	0.0	  951	6780
+Locus_10_Transcript_1/8_Confidence_0.222_Length_565	gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome	99.81	530	1	0	36	565	5670	5141	0.0	  951	6780
+Locus_10_Transcript_1/8_Confidence_0.222_Length_565	gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	67.59	395	128	0	168	562	6364	5970	6e-30	  136	7611
+Locus_10_Transcript_1/8_Confidence_0.222_Length_565	gi|380715048|gb|JN391187.1|_Tianjin_totivirus,_complete_genome	67.34	395	129	0	168	562	6364	5970	2e-28	  131	7611
+Locus_10_Transcript_1/8_Confidence_0.222_Length_565	gi|394935462|ref|NC_017084.1|_Tianjin_totivirus,_complete_genome	67.34	395	129	0	168	562	6364	5970	2e-28	  131	7611
+Locus_10_Transcript_1/8_Confidence_0.222_Length_565	gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	63.73	477	163	4	87	558	6451	5980	2e-10	71.6	7617
+Locus_10_Transcript_1/8_Confidence_0.222_Length_565	gi|198286505|gb|EU715328.1|_Armigeres_subalbatus_virus_SaX06-AK20,_complete_genome	71.92	146	33	5	420	561	5989	5848	3e-08	64.4	7510
+Locus_10_Transcript_1/8_Confidence_0.222_Length_565	gi|309259994|ref|NC_014609.1|_Armigeres_subalbatus_virus_SaX06-AK20,_complete_genome	71.92	146	33	5	420	561	5989	5848	3e-08	64.4	7510
+Locus_10_Transcript_2/8_Confidence_0.111_Length_1023	gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome	99.90	1023	1	0	1	1023	6163	5141	0.0	 1840	6780
+Locus_10_Transcript_2/8_Confidence_0.111_Length_1023	gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome	99.90	1023	1	0	1	1023	6163	5141	0.0	 1840	6780
+Locus_10_Transcript_2/8_Confidence_0.111_Length_1023	gi|380715048|gb|JN391187.1|_Tianjin_totivirus,_complete_genome	67.04	895	281	7	133	1020	6857	5970	8e-69	  266	7611
+Locus_10_Transcript_2/8_Confidence_0.111_Length_1023	gi|394935462|ref|NC_017084.1|_Tianjin_totivirus,_complete_genome	67.04	895	281	7	133	1020	6857	5970	8e-69	  266	7611
+Locus_10_Transcript_2/8_Confidence_0.111_Length_1023	gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	66.96	896	280	7	133	1020	6857	5970	3e-68	  264	7611
+Locus_10_Transcript_2/8_Confidence_0.111_Length_1023	gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	66.11	897	278	13	133	1016	6863	5980	2e-52	  212	7617
+Locus_10_Transcript_2/8_Confidence_0.111_Length_1023	gi|124303516|gb|EF061744.1|_Penaeid_shrimp_infectious_myonecrosis_virus_from_Indonesia,_complete_ge	67.02	376	114	8	131	501	6805	6435	1e-16	93.3	7561
+Locus_10_Transcript_2/8_Confidence_0.111_Length_1023	gi|198286505|gb|EU715328.1|_Armigeres_subalbatus_virus_SaX06-AK20,_complete_genome	67.15	347	106	6	132	474	6738	6396	1e-16	93.3	7510
+Locus_10_Transcript_2/8_Confidence_0.111_Length_1023	gi|198286505|gb|EU715328.1|_Armigeres_subalbatus_virus_SaX06-AK20,_complete_genome	71.92	146	33	5	878	1019	5989	5848	5e-08	64.4	7510
+Locus_10_Transcript_2/8_Confidence_0.111_Length_1023	gi|309259994|ref|NC_014609.1|_Armigeres_subalbatus_virus_SaX06-AK20,_complete_genome	67.15	347	106	6	132	474	6738	6396	1e-16	93.3	7510
+Locus_10_Transcript_2/8_Confidence_0.111_Length_1023	gi|309259994|ref|NC_014609.1|_Armigeres_subalbatus_virus_SaX06-AK20,_complete_genome	71.92	146	33	5	878	1019	5989	5848	5e-08	64.4	7510
+Locus_10_Transcript_2/8_Confidence_0.111_Length_1023	gi|619810684|gb|KF836757.1|_Penaeid_shrimp_infectious_myonecrosis_virus_strain_Indonesia,_complete_	67.02	376	114	8	131	501	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_2/8_Confidence_0.111_Length_1023	gi|675273514|gb|AY570982.3|_Penaeid_shrimp_infectious_myonecrosis_virus,_complete_genome	67.02	376	114	8	131	501	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_2/8_Confidence_0.111_Length_1023	gi|686484099|gb|KJ556923.1|_Penaeid_shrimp_infectious_myonecrosis_virus_strain_Brazil,_complete_gen	67.02	376	114	8	131	501	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_2/8_Confidence_0.111_Length_1023	gi|723265769|ref|NC_007915.3|_Penaeid_shrimp_infectious_myonecrosis_virus,_complete_genome	67.02	376	114	8	131	501	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_2/8_Confidence_0.111_Length_1023	gi|751662875|gb|KJ636783.2|_Penaeid_shrimp_infectious_myonecrosis_virus_isolate_IMNV-ID-EJ-12-1_ORF	67.02	376	114	8	131	501	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_2/8_Confidence_0.111_Length_1023	gi|823383611|gb|KR815474.1|_Penaeid_shrimp_infectious_myonecrosis_virus_isolate_Brazil_2009,_comple	67.02	376	114	8	131	501	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_2/8_Confidence_0.111_Length_1023	gi|751662874|gb|KJ636782.2|_Penaeid_shrimp_infectious_myonecrosis_virus_isolate_IMNV-ID-LP-11_compl	66.76	376	115	8	131	501	7451	7081	5e-15	87.8	8230
+Locus_10_Transcript_3/8_Confidence_0.222_Length_529	gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome	99.43	529	0	1	1	529	6170	5645	0.0	  939	6780
+Locus_10_Transcript_3/8_Confidence_0.222_Length_529	gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome	99.43	529	0	1	1	529	6170	5645	0.0	  939	6780
+Locus_10_Transcript_3/8_Confidence_0.222_Length_529	gi|380715048|gb|JN391187.1|_Tianjin_totivirus,_complete_genome	70.81	394	101	7	143	529	6857	6471	2e-41	  174	7611
+Locus_10_Transcript_3/8_Confidence_0.222_Length_529	gi|394935462|ref|NC_017084.1|_Tianjin_totivirus,_complete_genome	70.81	394	101	7	143	529	6857	6471	2e-41	  174	7611
+Locus_10_Transcript_3/8_Confidence_0.222_Length_529	gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	70.87	381	101	7	143	518	6863	6488	1e-38	  165	7617
+Locus_10_Transcript_3/8_Confidence_0.222_Length_529	gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	69.97	383	99	7	143	517	6857	6483	6e-36	  156	7611
+Locus_10_Transcript_3/8_Confidence_0.222_Length_529	gi|124303516|gb|EF061744.1|_Penaeid_shrimp_infectious_myonecrosis_virus_from_Indonesia,_complete_ge	67.02	376	114	8	141	511	6805	6435	6e-17	93.3	7561
+Locus_10_Transcript_3/8_Confidence_0.222_Length_529	gi|198286505|gb|EU715328.1|_Armigeres_subalbatus_virus_SaX06-AK20,_complete_genome	67.15	347	106	6	142	484	6738	6396	6e-17	93.3	7510
+Locus_10_Transcript_3/8_Confidence_0.222_Length_529	gi|309259994|ref|NC_014609.1|_Armigeres_subalbatus_virus_SaX06-AK20,_complete_genome	67.15	347	106	6	142	484	6738	6396	6e-17	93.3	7510
+Locus_10_Transcript_3/8_Confidence_0.222_Length_529	gi|619810684|gb|KF836757.1|_Penaeid_shrimp_infectious_myonecrosis_virus_strain_Indonesia,_complete_	67.02	376	114	8	141	511	7448	7078	6e-17	93.3	8226
+Locus_10_Transcript_3/8_Confidence_0.222_Length_529	gi|675273514|gb|AY570982.3|_Penaeid_shrimp_infectious_myonecrosis_virus,_complete_genome	67.02	376	114	8	141	511	7448	7078	6e-17	93.3	8226
+Locus_10_Transcript_3/8_Confidence_0.222_Length_529	gi|686484099|gb|KJ556923.1|_Penaeid_shrimp_infectious_myonecrosis_virus_strain_Brazil,_complete_gen	67.02	376	114	8	141	511	7448	7078	6e-17	93.3	8226
+Locus_10_Transcript_3/8_Confidence_0.222_Length_529	gi|723265769|ref|NC_007915.3|_Penaeid_shrimp_infectious_myonecrosis_virus,_complete_genome	67.02	376	114	8	141	511	7448	7078	6e-17	93.3	8226
+Locus_10_Transcript_3/8_Confidence_0.222_Length_529	gi|751662875|gb|KJ636783.2|_Penaeid_shrimp_infectious_myonecrosis_virus_isolate_IMNV-ID-EJ-12-1_ORF	67.02	376	114	8	141	511	7448	7078	6e-17	93.3	8226
+Locus_10_Transcript_3/8_Confidence_0.222_Length_529	gi|823383611|gb|KR815474.1|_Penaeid_shrimp_infectious_myonecrosis_virus_isolate_Brazil_2009,_comple	67.02	376	114	8	141	511	7448	7078	6e-17	93.3	8226
+Locus_10_Transcript_3/8_Confidence_0.222_Length_529	gi|751662874|gb|KJ636782.2|_Penaeid_shrimp_infectious_myonecrosis_virus_isolate_IMNV-ID-LP-11_compl	66.76	376	115	8	141	511	7451	7081	2e-15	87.8	8230
+Locus_10_Transcript_4/8_Confidence_0.444_Length_1097	gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome	99.91	1087	1	0	11	1097	6731	5645	0.0	 1956	6780
+Locus_10_Transcript_4/8_Confidence_0.444_Length_1097	gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome	99.91	1087	1	0	11	1097	6731	5645	0.0	 1956	6780
+Locus_10_Transcript_4/8_Confidence_0.444_Length_1097	gi|380715048|gb|JN391187.1|_Tianjin_totivirus,_complete_genome	70.81	394	101	7	711	1097	6857	6471	4e-41	  174	7611
+Locus_10_Transcript_4/8_Confidence_0.444_Length_1097	gi|380715048|gb|JN391187.1|_Tianjin_totivirus,_complete_genome	80.30	66	11	2	568	632	7000	6936	1e-04	53.6	7611
+Locus_10_Transcript_4/8_Confidence_0.444_Length_1097	gi|394935462|ref|NC_017084.1|_Tianjin_totivirus,_complete_genome	70.81	394	101	7	711	1097	6857	6471	4e-41	  174	7611
+Locus_10_Transcript_4/8_Confidence_0.444_Length_1097	gi|394935462|ref|NC_017084.1|_Tianjin_totivirus,_complete_genome	80.30	66	11	2	568	632	7000	6936	1e-04	53.6	7611
+Locus_10_Transcript_4/8_Confidence_0.444_Length_1097	gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	70.87	381	101	7	711	1086	6863	6488	2e-38	  165	7617
+Locus_10_Transcript_4/8_Confidence_0.444_Length_1097	gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	69.97	383	99	7	711	1085	6857	6483	1e-35	  156	7611
+Locus_10_Transcript_4/8_Confidence_0.444_Length_1097	gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	79.73	74	13	2	568	640	7000	6928	2e-06	59.0	7611
+Locus_10_Transcript_4/8_Confidence_0.444_Length_1097	gi|124303516|gb|EF061744.1|_Penaeid_shrimp_infectious_myonecrosis_virus_from_Indonesia,_complete_ge	67.02	376	114	8	709	1079	6805	6435	1e-16	93.3	7561
+Locus_10_Transcript_4/8_Confidence_0.444_Length_1097	gi|198286505|gb|EU715328.1|_Armigeres_subalbatus_virus_SaX06-AK20,_complete_genome	67.15	347	106	6	710	1052	6738	6396	1e-16	93.3	7510
+Locus_10_Transcript_4/8_Confidence_0.444_Length_1097	gi|309259994|ref|NC_014609.1|_Armigeres_subalbatus_virus_SaX06-AK20,_complete_genome	67.15	347	106	6	710	1052	6738	6396	1e-16	93.3	7510
+Locus_10_Transcript_4/8_Confidence_0.444_Length_1097	gi|619810684|gb|KF836757.1|_Penaeid_shrimp_infectious_myonecrosis_virus_strain_Indonesia,_complete_	67.02	376	114	8	709	1079	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_4/8_Confidence_0.444_Length_1097	gi|675273514|gb|AY570982.3|_Penaeid_shrimp_infectious_myonecrosis_virus,_complete_genome	67.02	376	114	8	709	1079	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_4/8_Confidence_0.444_Length_1097	gi|686484099|gb|KJ556923.1|_Penaeid_shrimp_infectious_myonecrosis_virus_strain_Brazil,_complete_gen	67.02	376	114	8	709	1079	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_4/8_Confidence_0.444_Length_1097	gi|723265769|ref|NC_007915.3|_Penaeid_shrimp_infectious_myonecrosis_virus,_complete_genome	67.02	376	114	8	709	1079	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_4/8_Confidence_0.444_Length_1097	gi|751662875|gb|KJ636783.2|_Penaeid_shrimp_infectious_myonecrosis_virus_isolate_IMNV-ID-EJ-12-1_ORF	67.02	376	114	8	709	1079	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_4/8_Confidence_0.444_Length_1097	gi|823383611|gb|KR815474.1|_Penaeid_shrimp_infectious_myonecrosis_virus_isolate_Brazil_2009,_comple	67.02	376	114	8	709	1079	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_4/8_Confidence_0.444_Length_1097	gi|751662874|gb|KJ636782.2|_Penaeid_shrimp_infectious_myonecrosis_virus_isolate_IMNV-ID-LP-11_compl	66.76	376	115	8	709	1079	7451	7081	5e-15	87.8	8230
+Locus_10_Transcript_5/8_Confidence_0.333_Length_628	gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome	99.84	628	1	0	1	628	6765	6138	0.0	 1128	6780
+Locus_10_Transcript_5/8_Confidence_0.333_Length_628	gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome	99.84	628	1	0	1	628	6765	6138	0.0	 1128	6780
+Locus_10_Transcript_6/8_Confidence_0.333_Length_1121	gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome	99.91	1121	1	0	1	1121	6765	5645	0.0	 2017	6780
+Locus_10_Transcript_6/8_Confidence_0.333_Length_1121	gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome	99.91	1121	1	0	1	1121	6765	5645	0.0	 2017	6780
+Locus_10_Transcript_6/8_Confidence_0.333_Length_1121	gi|380715048|gb|JN391187.1|_Tianjin_totivirus,_complete_genome	70.81	394	101	7	735	1121	6857	6471	4e-41	  174	7611
+Locus_10_Transcript_6/8_Confidence_0.333_Length_1121	gi|380715048|gb|JN391187.1|_Tianjin_totivirus,_complete_genome	80.30	66	11	2	592	656	7000	6936	1e-04	53.6	7611
+Locus_10_Transcript_6/8_Confidence_0.333_Length_1121	gi|394935462|ref|NC_017084.1|_Tianjin_totivirus,_complete_genome	70.81	394	101	7	735	1121	6857	6471	4e-41	  174	7611
+Locus_10_Transcript_6/8_Confidence_0.333_Length_1121	gi|394935462|ref|NC_017084.1|_Tianjin_totivirus,_complete_genome	80.30	66	11	2	592	656	7000	6936	1e-04	53.6	7611
+Locus_10_Transcript_6/8_Confidence_0.333_Length_1121	gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	70.87	381	101	7	735	1110	6863	6488	2e-38	  165	7617
+Locus_10_Transcript_6/8_Confidence_0.333_Length_1121	gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	69.97	383	99	7	735	1109	6857	6483	1e-35	  156	7611
+Locus_10_Transcript_6/8_Confidence_0.333_Length_1121	gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	79.73	74	13	2	592	664	7000	6928	2e-06	59.0	7611
+Locus_10_Transcript_6/8_Confidence_0.333_Length_1121	gi|124303516|gb|EF061744.1|_Penaeid_shrimp_infectious_myonecrosis_virus_from_Indonesia,_complete_ge	67.02	376	114	8	733	1103	6805	6435	1e-16	93.3	7561
+Locus_10_Transcript_6/8_Confidence_0.333_Length_1121	gi|198286505|gb|EU715328.1|_Armigeres_subalbatus_virus_SaX06-AK20,_complete_genome	67.15	347	106	6	734	1076	6738	6396	1e-16	93.3	7510
+Locus_10_Transcript_6/8_Confidence_0.333_Length_1121	gi|309259994|ref|NC_014609.1|_Armigeres_subalbatus_virus_SaX06-AK20,_complete_genome	67.15	347	106	6	734	1076	6738	6396	1e-16	93.3	7510
+Locus_10_Transcript_6/8_Confidence_0.333_Length_1121	gi|619810684|gb|KF836757.1|_Penaeid_shrimp_infectious_myonecrosis_virus_strain_Indonesia,_complete_	67.02	376	114	8	733	1103	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_6/8_Confidence_0.333_Length_1121	gi|675273514|gb|AY570982.3|_Penaeid_shrimp_infectious_myonecrosis_virus,_complete_genome	67.02	376	114	8	733	1103	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_6/8_Confidence_0.333_Length_1121	gi|686484099|gb|KJ556923.1|_Penaeid_shrimp_infectious_myonecrosis_virus_strain_Brazil,_complete_gen	67.02	376	114	8	733	1103	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_6/8_Confidence_0.333_Length_1121	gi|723265769|ref|NC_007915.3|_Penaeid_shrimp_infectious_myonecrosis_virus,_complete_genome	67.02	376	114	8	733	1103	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_6/8_Confidence_0.333_Length_1121	gi|751662875|gb|KJ636783.2|_Penaeid_shrimp_infectious_myonecrosis_virus_isolate_IMNV-ID-EJ-12-1_ORF	67.02	376	114	8	733	1103	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_6/8_Confidence_0.333_Length_1121	gi|823383611|gb|KR815474.1|_Penaeid_shrimp_infectious_myonecrosis_virus_isolate_Brazil_2009,_comple	67.02	376	114	8	733	1103	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_6/8_Confidence_0.333_Length_1121	gi|751662874|gb|KJ636782.2|_Penaeid_shrimp_infectious_myonecrosis_virus_isolate_IMNV-ID-LP-11_compl	66.76	376	115	8	733	1103	7451	7081	5e-15	87.8	8230
+Locus_10_Transcript_7/8_Confidence_0.111_Length_255	gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome	100.00	26	0	0	230	255	6549	6524	0.001	48.2	6780
+Locus_10_Transcript_7/8_Confidence_0.111_Length_255	gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome	100.00	26	0	0	230	255	6549	6524	0.001	48.2	6780
+Locus_10_Transcript_8/8_Confidence_0.000_Length_1134	gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome	99.89	905	1	0	230	1134	6549	5645	0.0	 1627	6780
+Locus_10_Transcript_8/8_Confidence_0.000_Length_1134	gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome	99.89	905	1	0	230	1134	6549	5645	0.0	 1627	6780
+Locus_10_Transcript_8/8_Confidence_0.000_Length_1134	gi|380715048|gb|JN391187.1|_Tianjin_totivirus,_complete_genome	70.81	394	101	7	748	1134	6857	6471	5e-41	  174	7611
+Locus_10_Transcript_8/8_Confidence_0.000_Length_1134	gi|380715048|gb|JN391187.1|_Tianjin_totivirus,_complete_genome	80.30	66	11	2	605	669	7000	6936	1e-04	53.6	7611
+Locus_10_Transcript_8/8_Confidence_0.000_Length_1134	gi|394935462|ref|NC_017084.1|_Tianjin_totivirus,_complete_genome	70.81	394	101	7	748	1134	6857	6471	5e-41	  174	7611
+Locus_10_Transcript_8/8_Confidence_0.000_Length_1134	gi|394935462|ref|NC_017084.1|_Tianjin_totivirus,_complete_genome	80.30	66	11	2	605	669	7000	6936	1e-04	53.6	7611
+Locus_10_Transcript_8/8_Confidence_0.000_Length_1134	gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	70.87	381	101	7	748	1123	6863	6488	2e-38	  165	7617
+Locus_10_Transcript_8/8_Confidence_0.000_Length_1134	gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	69.97	383	99	7	748	1122	6857	6483	1e-35	  156	7611
+Locus_10_Transcript_8/8_Confidence_0.000_Length_1134	gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera	79.73	74	13	2	605	677	7000	6928	3e-06	59.0	7611
+Locus_10_Transcript_8/8_Confidence_0.000_Length_1134	gi|124303516|gb|EF061744.1|_Penaeid_shrimp_infectious_myonecrosis_virus_from_Indonesia,_complete_ge	67.02	376	114	8	746	1116	6805	6435	1e-16	93.3	7561
+Locus_10_Transcript_8/8_Confidence_0.000_Length_1134	gi|198286505|gb|EU715328.1|_Armigeres_subalbatus_virus_SaX06-AK20,_complete_genome	67.15	347	106	6	747	1089	6738	6396	1e-16	93.3	7510
+Locus_10_Transcript_8/8_Confidence_0.000_Length_1134	gi|309259994|ref|NC_014609.1|_Armigeres_subalbatus_virus_SaX06-AK20,_complete_genome	67.15	347	106	6	747	1089	6738	6396	1e-16	93.3	7510
+Locus_10_Transcript_8/8_Confidence_0.000_Length_1134	gi|619810684|gb|KF836757.1|_Penaeid_shrimp_infectious_myonecrosis_virus_strain_Indonesia,_complete_	67.02	376	114	8	746	1116	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_8/8_Confidence_0.000_Length_1134	gi|675273514|gb|AY570982.3|_Penaeid_shrimp_infectious_myonecrosis_virus,_complete_genome	67.02	376	114	8	746	1116	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_8/8_Confidence_0.000_Length_1134	gi|686484099|gb|KJ556923.1|_Penaeid_shrimp_infectious_myonecrosis_virus_strain_Brazil,_complete_gen	67.02	376	114	8	746	1116	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_8/8_Confidence_0.000_Length_1134	gi|723265769|ref|NC_007915.3|_Penaeid_shrimp_infectious_myonecrosis_virus,_complete_genome	67.02	376	114	8	746	1116	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_8/8_Confidence_0.000_Length_1134	gi|751662875|gb|KJ636783.2|_Penaeid_shrimp_infectious_myonecrosis_virus_isolate_IMNV-ID-EJ-12-1_ORF	67.02	376	114	8	746	1116	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_8/8_Confidence_0.000_Length_1134	gi|823383611|gb|KR815474.1|_Penaeid_shrimp_infectious_myonecrosis_virus_isolate_Brazil_2009,_comple	67.02	376	114	8	746	1116	7448	7078	1e-16	93.3	8226
+Locus_10_Transcript_8/8_Confidence_0.000_Length_1134	gi|751662874|gb|KJ636782.2|_Penaeid_shrimp_infectious_myonecrosis_virus_isolate_IMNV-ID-LP-11_compl	66.76	376	115	8	746	1116	7451	7081	5e-15	87.8	8230
+Locus_12_Transcript_1/1_Confidence_0.000_Length_1279	gi|262225305|gb|GQ342963.1|_Drosophila_melanogaster_birnavirus_SW-2009a_strain_DBV_segment_B,_compl	100.00	1273	0	0	7	1279	3014	1742	0.0	 2296	3014
+Locus_15_Transcript_1/1_Confidence_0.000_Length_436	gi|262225302|gb|GQ342962.1|_Drosophila_melanogaster_birnavirus_SW-2009a_strain_DBV_segment_A,_compl	100.00	436	0	0	1	436	35	470	0.0	  787	3260
+Locus_16_Transcript_1/1_Confidence_0.000_Length_152	gi|262225302|gb|GQ342962.1|_Drosophila_melanogaster_birnavirus_SW-2009a_strain_DBV_segment_A,_compl	100.00	152	0	0	1	152	458	609	2e-72	  275	3260
+Locus_17_Transcript_1/3_Confidence_0.400_Length_1889	gi|384638749|gb|JQ675611.1|_Loreto_virus_strain_Pe_AR_2612/77_hypothetical_protein_1,_hypothetical_	78.05	82	18	0	897	978	6195	6276	8e-09	68.0	9207
+Locus_17_Transcript_1/3_Confidence_0.400_Length_1889	gi|384638734|gb|JQ675608.1|_Negev_virus_strain_M30957_hypothetical_protein_1,_hypothetical_protein_	68.16	201	58	4	790	987	6264	6461	3e-07	62.6	9538
+Locus_17_Transcript_1/3_Confidence_0.400_Length_1889	gi|384638739|gb|JQ675609.1|_Negev_virus_strain_M33056_hypothetical_protein_1,_hypothetical_protein_	68.16	201	58	4	790	987	6262	6459	3e-07	62.6	9532
+Locus_17_Transcript_1/3_Confidence_0.400_Length_1889	gi|831181913|dbj|AB935183.1|_Negev_virus_genes_for_hypothetical_protein,_complete_cds,_isolate:_#73	68.16	201	58	4	790	987	6262	6459	3e-07	62.6	9545
+Locus_17_Transcript_1/3_Confidence_0.400_Length_1889	gi|831181913|dbj|AB935183.1|_Negev_virus_genes_for_hypothetical_protein,_complete_cds,_isolate:_#73	70.21	141	34	4	1155	1291	6600	6736	5e-05	55.4	9545
+Locus_17_Transcript_1/3_Confidence_0.400_Length_1889	gi|384638729|gb|JQ675607.1|_Piura_virus_strain_P60_hypothetical_protein_1,_hypothetical_protein_2,_	97.06	34	1	0	1155	1188	7002	7035	1e-05	57.2	10059
+Locus_17_Transcript_1/3_Confidence_0.400_Length_1889	gi|384638719|gb|JQ675605.1|_Negev_virus_strain_EO-329_hypothetical_protein_1,_hypothetical_protein_	70.21	141	34	4	1155	1291	6600	6736	5e-05	55.4	9536
+Locus_17_Transcript_2/3_Confidence_0.400_Length_2274	gi|18254451|gb|AF196645.2|_Drosophila_x_virus_segment_B_putative_RNA-dependent_RNA_polymerase_VP1_(	99.03	414	4	0	1861	2274	1694	2107	0.0	  729	3243
+Locus_17_Transcript_2/3_Confidence_0.400_Length_2274	gi|22855185|ref|NC_004169.1|_Drosophila_x_virus_segment_B,_complete_sequence	99.03	414	4	0	1861	2274	1694	2107	0.0	  729	3243
+Locus_17_Transcript_2/3_Confidence_0.400_Length_2274	gi|407750681|gb|JX403942.1|_Mosquitoe_x_virus_segment_B,_complete_sequence	74.16	387	92	4	1892	2274	1709	2091	9e-60	  237	3220
+Locus_17_Transcript_2/3_Confidence_0.400_Length_2274	gi|545716023|gb|KF298272.1|_Culicine-associated_Z_virus_isolate_acc_9.2_segment_B_VP1/RdRp_gene,_co	72.22	414	107	3	1865	2274	1688	2097	2e-55	  223	3220
+Locus_17_Transcript_2/3_Confidence_0.400_Length_2274	gi|545716052|gb|KF298283.1|_Culicine-associated_Z_virus_isolate_acc_9.2s_segment_B_VP1/RdRp_gene,_c	72.22	414	107	3	1865	2274	1646	2055	2e-55	  223	3103
+Locus_17_Transcript_2/3_Confidence_0.400_Length_2274	gi|403311045|gb|JQ659255.1|_Culex_Y_virus_isolate_P1-BS2010_segment_B,_complete_sequence	72.80	386	99	2	1892	2274	1731	2113	2e-54	  219	3254
+Locus_17_Transcript_2/3_Confidence_0.400_Length_2274	gi|365735166|gb|JN589002.1|_Espirito_Santo_virus_segment_B,_complete_sequence	72.54	386	100	2	1892	2274	1726	2108	3e-53	  215	3250
+Locus_17_Transcript_2/3_Confidence_0.400_Length_2274	gi|366091740|ref|NC_016517.1|_Espirito_Santo_virus_segment_B,_complete_genome	72.54	386	100	2	1892	2274	1726	2108	3e-53	  215	3250
+Locus_17_Transcript_2/3_Confidence_0.400_Length_2274	gi|384638749|gb|JQ675611.1|_Loreto_virus_strain_Pe_AR_2612/77_hypothetical_protein_1,_hypothetical_	78.05	82	18	0	897	978	6195	6276	1e-08	68.0	9207
+Locus_17_Transcript_2/3_Confidence_0.400_Length_2274	gi|384638734|gb|JQ675608.1|_Negev_virus_strain_M30957_hypothetical_protein_1,_hypothetical_protein_	68.16	201	58	4	790	987	6264	6461	4e-07	62.6	9538
+Locus_17_Transcript_2/3_Confidence_0.400_Length_2274	gi|384638739|gb|JQ675609.1|_Negev_virus_strain_M33056_hypothetical_protein_1,_hypothetical_protein_	68.16	201	58	4	790	987	6262	6459	4e-07	62.6	9532
+Locus_17_Transcript_2/3_Confidence_0.400_Length_2274	gi|831181913|dbj|AB935183.1|_Negev_virus_genes_for_hypothetical_protein,_complete_cds,_isolate:_#73	68.16	201	58	4	790	987	6262	6459	4e-07	62.6	9545
+Locus_17_Transcript_2/3_Confidence_0.400_Length_2274	gi|831181913|dbj|AB935183.1|_Negev_virus_genes_for_hypothetical_protein,_complete_cds,_isolate:_#73	70.21	141	34	4	1155	1291	6600	6736	6e-05	55.4	9545
+Locus_17_Transcript_2/3_Confidence_0.400_Length_2274	gi|384638729|gb|JQ675607.1|_Piura_virus_strain_P60_hypothetical_protein_1,_hypothetical_protein_2,_	97.06	34	1	0	1155	1188	7002	7035	2e-05	57.2	10059
+Locus_17_Transcript_2/3_Confidence_0.400_Length_2274	gi|384638719|gb|JQ675605.1|_Negev_virus_strain_EO-329_hypothetical_protein_1,_hypothetical_protein_	70.21	141	34	4	1155	1291	6600	6736	6e-05	55.4	9536
+Locus_17_Transcript_3/3_Confidence_0.200_Length_456	gi|18254451|gb|AF196645.2|_Drosophila_x_virus_segment_B_putative_RNA-dependent_RNA_polymerase_VP1_(	98.90	456	5	0	1	456	1652	2107	0.0	  800	3243
+Locus_17_Transcript_3/3_Confidence_0.200_Length_456	gi|22855185|ref|NC_004169.1|_Drosophila_x_virus_segment_B,_complete_sequence	98.90	456	5	0	1	456	1652	2107	0.0	  800	3243
+Locus_17_Transcript_3/3_Confidence_0.200_Length_456	gi|407750681|gb|JX403942.1|_Mosquitoe_x_virus_segment_B,_complete_sequence	73.20	459	115	4	2	456	1637	2091	4e-68	  262	3220
+Locus_17_Transcript_3/3_Confidence_0.200_Length_456	gi|545716023|gb|KF298272.1|_Culicine-associated_Z_virus_isolate_acc_9.2_segment_B_VP1/RdRp_gene,_co	72.83	460	117	3	1	456	1642	2097	2e-67	  260	3220
+Locus_17_Transcript_3/3_Confidence_0.200_Length_456	gi|545716052|gb|KF298283.1|_Culicine-associated_Z_virus_isolate_acc_9.2s_segment_B_VP1/RdRp_gene,_c	72.83	460	117	3	1	456	1600	2055	2e-67	  260	3103
+Locus_17_Transcript_3/3_Confidence_0.200_Length_456	gi|403311045|gb|JQ659255.1|_Culex_Y_virus_isolate_P1-BS2010_segment_B,_complete_sequence	72.27	458	121	2	2	456	1659	2113	3e-64	  250	3254
+Locus_17_Transcript_3/3_Confidence_0.200_Length_456	gi|365735166|gb|JN589002.1|_Espirito_Santo_virus_segment_B,_complete_sequence	72.27	458	121	3	2	456	1654	2108	3e-63	  246	3250
+Locus_17_Transcript_3/3_Confidence_0.200_Length_456	gi|366091740|ref|NC_016517.1|_Espirito_Santo_virus_segment_B,_complete_genome	72.27	458	121	3	2	456	1654	2108	3e-63	  246	3250
+Locus_20_Transcript_1/1_Confidence_0.000_Length_191	gi|225356593|gb|FJ150422.1|_Drosophila_A_virus_isolate_HD,_complete_genome	97.86	187	4	0	5	191	43	229	7e-86	  320	4806
+Locus_20_Transcript_1/1_Confidence_0.000_Length_191	gi|253761971|ref|NC_012958.1|_Drosophila_A_virus,_complete_genome	97.86	187	4	0	5	191	43	229	7e-86	  320	4806
+Locus_21_Transcript_1/1_Confidence_0.000_Length_919	gi|262225305|gb|GQ342963.1|_Drosophila_melanogaster_birnavirus_SW-2009a_strain_DBV_segment_B,_compl	100.00	919	0	0	1	919	813	1731	0.0	 1658	3014
+Locus_29_Transcript_1/1_Confidence_0.000_Length_870	gi|831181913|dbj|AB935183.1|_Negev_virus_genes_for_hypothetical_protein,_complete_cds,_isolate:_#73	88.89	45	5	0	197	241	9125	9081	2e-06	59.0	9545
+Locus_29_Transcript_1/1_Confidence_0.000_Length_870	gi|384638734|gb|JQ675608.1|_Negev_virus_strain_M30957_hypothetical_protein_1,_hypothetical_protein_	86.67	45	6	0	197	241	9126	9082	2e-05	55.4	9538
+Locus_29_Transcript_1/1_Confidence_0.000_Length_870	gi|384638739|gb|JQ675609.1|_Negev_virus_strain_M33056_hypothetical_protein_1,_hypothetical_protein_	86.67	45	6	0	197	241	9124	9080	2e-05	55.4	9532
+Locus_29_Transcript_1/1_Confidence_0.000_Length_870	gi|693673074|gb|KM350508.1|_Brejeira_virus_strain_AR800208-B_hypothetical_protein_1,_hypothetical_p	72.73	88	24	0	194	281	9447	9360	3e-04	51.8	9863
+Locus_29_Transcript_1/1_Confidence_0.000_Length_870	gi|693673085|gb|KM350510.1|_Brejeira_virus_strain_AR800213-B_hypothetical_protein_1,_hypothetical_p	72.73	88	24	0	194	281	9248	9161	3e-04	51.8	9663
+Locus_29_Transcript_1/1_Confidence_0.000_Length_870	gi|693673091|gb|KM350511.1|_Brejeira_virus_strain_AR800214_hypothetical_protein_1,_hypothetical_pro	72.73	88	24	0	194	281	9448	9361	3e-04	51.8	9838
+Locus_29_Transcript_1/1_Confidence_0.000_Length_870	gi|693673097|gb|KM350512.1|_Brejeira_virus_strain_AR800224_hypothetical_protein_1,_hypothetical_pro	72.73	88	24	0	194	281	9523	9436	3e-04	51.8	9940
+Locus_29_Transcript_1/1_Confidence_0.000_Length_870	gi|693673109|gb|KM350514.1|_Brejeira_virus_strain_AR800233-B_hypothetical_protein_1,_hypothetical_p	72.73	88	24	0	194	281	9361	9274	3e-04	51.8	9776
+Locus_29_Transcript_1/1_Confidence_0.000_Length_870	gi|693673115|gb|KM350515.1|_Brejeira_virus_strain_AR800239_hypothetical_protein_1,_hypothetical_pro	72.73	88	24	0	194	281	9425	9338	3e-04	51.8	9815
+Locus_29_Transcript_1/1_Confidence_0.000_Length_870	gi|384638719|gb|JQ675605.1|_Negev_virus_strain_EO-329_hypothetical_protein_1,_hypothetical_protein_	84.44	45	7	0	197	241	9124	9080	0.001	50.0	9536
+Locus_30_Transcript_1/1_Confidence_0.000_Length_395	gi|384638719|gb|JQ675605.1|_Negev_virus_strain_EO-329_hypothetical_protein_1,_hypothetical_protein_	74.76	103	23	2	19	121	3216	3315	7e-08	62.6	9536
+Locus_30_Transcript_1/1_Confidence_0.000_Length_395	gi|831181913|dbj|AB935183.1|_Negev_virus_genes_for_hypothetical_protein,_complete_cds,_isolate:_#73	74.76	103	23	2	19	121	3216	3315	7e-08	62.6	9545
+Locus_30_Transcript_1/1_Confidence_0.000_Length_395	gi|384638734|gb|JQ675608.1|_Negev_virus_strain_M30957_hypothetical_protein_1,_hypothetical_protein_	73.39	109	25	3	27	132	3225	3332	3e-06	57.2	9538
+Locus_30_Transcript_1/1_Confidence_0.000_Length_395	gi|384638739|gb|JQ675609.1|_Negev_virus_strain_M33056_hypothetical_protein_1,_hypothetical_protein_	73.39	109	25	3	27	132	3223	3330	3e-06	57.2	9532
+Locus_31_Transcript_1/1_Confidence_0.000_Length_373	gi|262225302|gb|GQ342962.1|_Drosophila_melanogaster_birnavirus_SW-2009a_strain_DBV_segment_A,_compl	100.00	373	0	0	1	373	597	969	0.0	  673	3260
+Locus_35_Transcript_1/1_Confidence_0.000_Length_166	gi|567840469|gb|KF478765.1|_Lassa_virus_strain_Soromba-R_segment_S,_complete_sequence	83.87	93	14	1	75	166	150	58	1e-18	96.9	3571
+Locus_35_Transcript_1/1_Confidence_0.000_Length_166	gi|84683224|gb|DQ333351.1|_Choristoneura_occidentalis_granulovirus,_complete_genome	88.10	42	5	0	125	166	20023	19982	1e-05	53.6	104710
+Locus_35_Transcript_1/1_Confidence_0.000_Length_166	gi|109255272|ref|NC_008168.1|_Choristoneura_occidentalis_granulovirus,_complete_genome	88.10	42	5	0	125	166	20023	19982	1e-05	53.6	104710
+Locus_36_Transcript_1/1_Confidence_0.000_Length_445	gi|693673074|gb|KM350508.1|_Brejeira_virus_strain_AR800208-B_hypothetical_protein_1,_hypothetical_p	70.32	155	42	3	290	442	5438	5286	8e-08	62.6	9863
+Locus_36_Transcript_1/1_Confidence_0.000_Length_445	gi|693673085|gb|KM350510.1|_Brejeira_virus_strain_AR800213-B_hypothetical_protein_1,_hypothetical_p	70.32	155	42	3	290	442	5239	5087	8e-08	62.6	9663
+Locus_36_Transcript_1/1_Confidence_0.000_Length_445	gi|693673091|gb|KM350511.1|_Brejeira_virus_strain_AR800214_hypothetical_protein_1,_hypothetical_pro	70.32	155	42	3	290	442	5439	5287	8e-08	62.6	9838
+Locus_36_Transcript_1/1_Confidence_0.000_Length_445	gi|693673103|gb|KM350513.1|_Brejeira_virus_strain_AR800227_hypothetical_protein_1,_hypothetical_pro	70.32	155	42	3	290	442	5424	5272	8e-08	62.6	9862
+Locus_36_Transcript_1/1_Confidence_0.000_Length_445	gi|693673109|gb|KM350514.1|_Brejeira_virus_strain_AR800233-B_hypothetical_protein_1,_hypothetical_p	70.32	155	42	3	290	442	5352	5200	8e-08	62.6	9776
+Locus_36_Transcript_1/1_Confidence_0.000_Length_445	gi|693673080|gb|KM350509.1|_Brejeira_virus_strain_AR800212-B_hypothetical_protein_1,_hypothetical_p	69.68	155	43	3	290	442	5397	5245	9e-07	59.0	9822
+Locus_36_Transcript_1/1_Confidence_0.000_Length_445	gi|693673097|gb|KM350512.1|_Brejeira_virus_strain_AR800224_hypothetical_protein_1,_hypothetical_pro	69.68	155	43	3	290	442	5514	5362	9e-07	59.0	9940
+Locus_36_Transcript_1/1_Confidence_0.000_Length_445	gi|693673115|gb|KM350515.1|_Brejeira_virus_strain_AR800239_hypothetical_protein_1,_hypothetical_pro	69.68	155	43	3	290	442	5416	5264	9e-07	59.0	9815
+Locus_36_Transcript_1/1_Confidence_0.000_Length_445	gi|428227288|gb|JQ686833.1|_Ngewotan_virus,_complete_genome	73.75	80	21	0	350	429	4879	4800	5e-04	50.0	9226
+Locus_40_Transcript_1/1_Confidence_0.000_Length_1029	gi|225356593|gb|FJ150422.1|_Drosophila_A_virus_isolate_HD,_complete_genome	97.47	1028	26	0	1	1028	3779	4806	0.0	 1737	4806
+Locus_40_Transcript_1/1_Confidence_0.000_Length_1029	gi|253761971|ref|NC_012958.1|_Drosophila_A_virus,_complete_genome	97.47	1028	26	0	1	1028	3779	4806	0.0	 1737	4806
+Locus_42_Transcript_1/2_Confidence_0.333_Length_3138	gi|262225307|gb|GQ342964.1|_Drosophila_melanogaster_tetravirus_SW-2009a_strain_DTRV_putative_RNA-de	100.00	3001	0	0	135	3135	1	3001	0.0	 5413	3005
+Locus_42_Transcript_1/2_Confidence_0.333_Length_3138	gi|225356593|gb|FJ150422.1|_Drosophila_A_virus_isolate_HD,_complete_genome	97.61	3136	75	0	1	3136	219	3354	0.0	 5317	4806
+Locus_42_Transcript_1/2_Confidence_0.333_Length_3138	gi|253761971|ref|NC_012958.1|_Drosophila_A_virus,_complete_genome	97.61	3136	75	0	1	3136	219	3354	0.0	 5317	4806
+Locus_42_Transcript_2/2_Confidence_0.333_Length_597	gi|262225307|gb|GQ342964.1|_Drosophila_melanogaster_tetravirus_SW-2009a_strain_DTRV_putative_RNA-de	100.00	593	0	0	2	594	2409	3001	0.0	 1070	3005
+Locus_42_Transcript_2/2_Confidence_0.333_Length_597	gi|225356593|gb|FJ150422.1|_Drosophila_A_virus_isolate_HD,_complete_genome	97.81	594	13	0	2	595	2761	3354	0.0	 1012	4806
+Locus_42_Transcript_2/2_Confidence_0.333_Length_597	gi|253761971|ref|NC_012958.1|_Drosophila_A_virus,_complete_genome	97.81	594	13	0	2	595	2761	3354	0.0	 1012	4806
+Locus_43_Transcript_1/1_Confidence_0.000_Length_1002	gi|18254451|gb|AF196645.2|_Drosophila_x_virus_segment_B_putative_RNA-dependent_RNA_polymerase_VP1_(	98.40	1003	15	1	1	1002	2189	3191	0.0	 1734	3243
+Locus_43_Transcript_1/1_Confidence_0.000_Length_1002	gi|22855185|ref|NC_004169.1|_Drosophila_x_virus_segment_B,_complete_sequence	98.40	1003	15	1	1	1002	2189	3191	0.0	 1734	3243
+Locus_43_Transcript_1/1_Confidence_0.000_Length_1002	gi|545716023|gb|KF298272.1|_Culicine-associated_Z_virus_isolate_acc_9.2_segment_B_VP1/RdRp_gene,_co	70.90	457	117	8	557	1002	2738	3189	8e-50	  203	3220
+Locus_43_Transcript_1/1_Confidence_0.000_Length_1002	gi|365735166|gb|JN589002.1|_Espirito_Santo_virus_segment_B,_complete_sequence	70.52	458	117	10	557	1002	2749	3200	2e-45	  188	3250
+Locus_43_Transcript_1/1_Confidence_0.000_Length_1002	gi|366091740|ref|NC_016517.1|_Espirito_Santo_virus_segment_B,_complete_genome	70.52	458	117	10	557	1002	2749	3200	2e-45	  188	3250
+Locus_43_Transcript_1/1_Confidence_0.000_Length_1002	gi|407750681|gb|JX403942.1|_Mosquitoe_x_virus_segment_B,_complete_sequence	70.31	458	118	9	557	1002	2732	3183	2e-45	  188	3220
+Locus_43_Transcript_1/1_Confidence_0.000_Length_1002	gi|403311045|gb|JQ659255.1|_Culex_Y_virus_isolate_P1-BS2010_segment_B,_complete_sequence	70.31	458	118	10	557	1002	2754	3205	2e-44	  185	3254
+Locus_43_Transcript_1/1_Confidence_0.000_Length_1002	gi|545716052|gb|KF298283.1|_Culicine-associated_Z_virus_isolate_acc_9.2s_segment_B_VP1/RdRp_gene,_c	70.30	404	106	6	557	951	2696	3094	4e-41	  174	3103
+Locus_44_Transcript_1/1_Confidence_0.000_Length_557	gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds	98.92	557	6	0	1	557	3203	2647	0.0	  978	3360
+Locus_44_Transcript_1/1_Confidence_0.000_Length_557	gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence	98.92	557	6	0	1	557	3203	2647	0.0	  978	3360
+Locus_45_Transcript_1/1_Confidence_0.000_Length_631	gi|18254451|gb|AF196645.2|_Drosophila_x_virus_segment_B_putative_RNA-dependent_RNA_polymerase_VP1_(	98.73	631	8	0	1	631	57	687	0.0	 1103	3243
+Locus_45_Transcript_1/1_Confidence_0.000_Length_631	gi|22855185|ref|NC_004169.1|_Drosophila_x_virus_segment_B,_complete_sequence	98.73	631	8	0	1	631	57	687	0.0	 1103	3243
+Locus_45_Transcript_1/1_Confidence_0.000_Length_631	gi|545716023|gb|KF298272.1|_Culicine-associated_Z_virus_isolate_acc_9.2_segment_B_VP1/RdRp_gene,_co	68.31	590	171	8	48	629	94	675	6e-49	  199	3220
+Locus_45_Transcript_1/1_Confidence_0.000_Length_631	gi|545716052|gb|KF298283.1|_Culicine-associated_Z_virus_isolate_acc_9.2s_segment_B_VP1/RdRp_gene,_c	68.31	590	171	8	48	629	52	633	6e-49	  199	3103
+Locus_45_Transcript_1/1_Confidence_0.000_Length_631	gi|407750681|gb|JX403942.1|_Mosquitoe_x_virus_segment_B,_complete_sequence	68.24	595	171	13	44	629	93	678	6e-43	  179	3220
+Locus_45_Transcript_1/1_Confidence_0.000_Length_631	gi|403311045|gb|JQ659255.1|_Culex_Y_virus_isolate_P1-BS2010_segment_B,_complete_sequence	70.39	412	110	7	226	631	288	693	9e-41	  172	3254
+Locus_45_Transcript_1/1_Confidence_0.000_Length_631	gi|403311045|gb|JQ659255.1|_Culex_Y_virus_isolate_P1-BS2010_segment_B,_complete_sequence	83.33	48	8	0	45	92	107	154	2e-04	51.8	3254
+Locus_45_Transcript_1/1_Confidence_0.000_Length_631	gi|365735166|gb|JN589002.1|_Espirito_Santo_virus_segment_B,_complete_sequence	70.15	412	111	7	226	631	283	688	1e-39	  168	3250
+Locus_45_Transcript_1/1_Confidence_0.000_Length_631	gi|365735166|gb|JN589002.1|_Espirito_Santo_virus_segment_B,_complete_sequence	84.44	45	7	0	45	89	102	146	7e-04	50.0	3250
+Locus_45_Transcript_1/1_Confidence_0.000_Length_631	gi|366091740|ref|NC_016517.1|_Espirito_Santo_virus_segment_B,_complete_genome	70.15	412	111	7	226	631	283	688	1e-39	  168	3250
+Locus_45_Transcript_1/1_Confidence_0.000_Length_631	gi|366091740|ref|NC_016517.1|_Espirito_Santo_virus_segment_B,_complete_genome	84.44	45	7	0	45	89	102	146	7e-04	50.0	3250
+Locus_46_Transcript_1/1_Confidence_0.667_Length_178	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	98.31	178	3	0	1	178	2875	3052	4e-82	  307	3107
+Locus_46_Transcript_1/1_Confidence_0.667_Length_178	gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence	97.19	178	5	0	1	178	2875	3052	2e-79	  298	3107
+Locus_46_Transcript_1/1_Confidence_0.667_Length_178	gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd	96.63	178	6	0	1	178	2875	3052	3e-78	  295	3107
+Locus_46_Transcript_1/1_Confidence_0.667_Length_178	gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds	94.94	178	9	0	1	178	157	334	6e-74	  280	389
+Locus_46_Transcript_1/1_Confidence_0.667_Length_178	gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence	94.94	178	9	0	1	178	2875	3052	6e-74	  280	3107
+Locus_46_Transcript_1/1_Confidence_0.667_Length_178	gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome	94.94	178	9	0	1	178	2874	3051	6e-74	  280	3106
+Locus_46_Transcript_1/1_Confidence_0.667_Length_178	gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds	80.45	179	33	2	1	178	2862	3039	5e-37	  158	3096
+Locus_46_Transcript_1/1_Confidence_0.667_Length_178	gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome	80.45	179	33	2	1	178	2862	3039	5e-37	  158	3096
+Locus_47_Transcript_1/1_Confidence_0.000_Length_940	gi|18254451|gb|AF196645.2|_Drosophila_x_virus_segment_B_putative_RNA-dependent_RNA_polymerase_VP1_(	99.26	940	7	0	1	940	674	1613	0.0	 1663	3243
+Locus_47_Transcript_1/1_Confidence_0.000_Length_940	gi|22855185|ref|NC_004169.1|_Drosophila_x_virus_segment_B,_complete_sequence	99.26	940	7	0	1	940	674	1613	0.0	 1663	3243
+Locus_47_Transcript_1/1_Confidence_0.000_Length_940	gi|407750681|gb|JX403942.1|_Mosquitoe_x_virus_segment_B,_complete_sequence	72.01	904	236	5	41	940	707	1597	6e-134	  482	3220
+Locus_47_Transcript_1/1_Confidence_0.000_Length_940	gi|365735166|gb|JN589002.1|_Espirito_Santo_virus_segment_B,_complete_sequence	72.35	897	234	7	50	939	724	1613	2e-133	  480	3250
+Locus_47_Transcript_1/1_Confidence_0.000_Length_940	gi|366091740|ref|NC_016517.1|_Espirito_Santo_virus_segment_B,_complete_genome	72.35	897	234	7	50	939	724	1613	2e-133	  480	3250
+Locus_47_Transcript_1/1_Confidence_0.000_Length_940	gi|403311045|gb|JQ659255.1|_Culex_Y_virus_isolate_P1-BS2010_segment_B,_complete_sequence	72.35	897	234	7	50	939	729	1618	2e-133	  480	3254
+Locus_47_Transcript_1/1_Confidence_0.000_Length_940	gi|545716023|gb|KF298272.1|_Culicine-associated_Z_virus_isolate_acc_9.2_segment_B_VP1/RdRp_gene,_co	71.43	903	252	3	41	940	704	1603	2e-126	  457	3220
+Locus_47_Transcript_1/1_Confidence_0.000_Length_940	gi|545716052|gb|KF298283.1|_Culicine-associated_Z_virus_isolate_acc_9.2s_segment_B_VP1/RdRp_gene,_c	71.43	903	252	3	41	940	662	1561	2e-126	  457	3103
+Locus_48_Transcript_1/1_Confidence_0.000_Length_372	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	99.73	372	1	0	1	372	1564	1193	0.0	  666	3107
+Locus_48_Transcript_1/1_Confidence_0.000_Length_372	gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence	98.12	372	7	0	1	372	1564	1193	0.0	  639	3107
+Locus_48_Transcript_1/1_Confidence_0.000_Length_372	gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd	95.14	370	18	0	1	370	1564	1195	7e-166	  587	3107
+Locus_48_Transcript_1/1_Confidence_0.000_Length_372	gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence	87.90	372	45	0	1	372	1564	1193	5e-130	  468	3107
+Locus_48_Transcript_1/1_Confidence_0.000_Length_372	gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome	87.63	372	46	0	1	372	1563	1192	6e-129	  464	3106
+Locus_48_Transcript_1/1_Confidence_0.000_Length_372	gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds	76.84	367	85	0	2	368	1550	1184	5e-73	  279	3096
+Locus_48_Transcript_1/1_Confidence_0.000_Length_372	gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome	76.84	367	85	0	2	368	1550	1184	5e-73	  279	3096
+Locus_49_Transcript_1/1_Confidence_0.000_Length_499	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	100.00	499	0	0	1	499	893	395	0.0	  901	3107
+Locus_49_Transcript_1/1_Confidence_0.000_Length_499	gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence	98.00	499	10	0	1	499	893	395	0.0	  856	3107
+Locus_49_Transcript_1/1_Confidence_0.000_Length_499	gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd	93.59	499	32	0	1	499	893	395	0.0	  756	3107
+Locus_49_Transcript_1/1_Confidence_0.000_Length_499	gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence	87.98	499	60	0	1	499	893	395	9e-179	  630	3107
+Locus_49_Transcript_1/1_Confidence_0.000_Length_499	gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome	87.98	499	60	0	1	499	892	394	9e-179	  630	3106
+Locus_49_Transcript_1/1_Confidence_0.000_Length_499	gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds	77.13	494	113	0	6	499	875	382	7e-104	  381	3096
+Locus_49_Transcript_1/1_Confidence_0.000_Length_499	gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome	77.13	494	113	0	6	499	875	382	7e-104	  381	3096
+Locus_49_Transcript_1/1_Confidence_0.000_Length_499	gi|9739005|gb|AF174533.1|_Nodamura_virus_RNA1_segment,_complete_sequence	78.12	64	14	0	167	230	751	688	5e-05	53.6	3204
+Locus_49_Transcript_1/1_Confidence_0.000_Length_499	gi|13249660|ref|NC_002690.1|_Nodamura_virus_RNA1,_complete_sequence	78.12	64	14	0	167	230	751	688	5e-05	53.6	3204
+Locus_51_Transcript_1/1_Confidence_0.500_Length_320	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	100.00	320	0	0	1	320	2223	2542	3e-163	  578	3107
+Locus_51_Transcript_1/1_Confidence_0.500_Length_320	gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence	99.06	320	3	0	1	320	2223	2542	7e-159	  563	3107
+Locus_51_Transcript_1/1_Confidence_0.500_Length_320	gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd	95.31	320	15	0	1	320	2223	2542	1e-142	  509	3107
+Locus_51_Transcript_1/1_Confidence_0.500_Length_320	gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence	87.77	319	39	0	2	320	2224	2542	2e-109	  399	3107
+Locus_51_Transcript_1/1_Confidence_0.500_Length_320	gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome	87.46	319	40	0	2	320	2223	2541	2e-108	  396	3106
+Locus_51_Transcript_1/1_Confidence_0.500_Length_320	gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds	73.89	314	80	2	5	317	2214	2526	2e-46	  190	3096
+Locus_51_Transcript_1/1_Confidence_0.500_Length_320	gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome	73.89	314	80	2	5	317	2214	2526	2e-46	  190	3096
+Locus_52_Transcript_1/1_Confidence_0.000_Length_112	gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence	100.00	111	0	0	2	112	1045	1155	2e-50	  201	3107
+Locus_52_Transcript_1/1_Confidence_0.000_Length_112	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	98.21	112	2	0	1	112	1044	1155	4e-48	  194	3107
+Locus_52_Transcript_1/1_Confidence_0.000_Length_112	gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd	97.32	112	3	0	1	112	1044	1155	2e-46	  188	3107
+Locus_52_Transcript_1/1_Confidence_0.000_Length_112	gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence	94.64	112	6	0	1	112	1044	1155	1e-42	  176	3107
+Locus_52_Transcript_1/1_Confidence_0.000_Length_112	gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome	94.64	112	6	0	1	112	1043	1154	1e-42	  176	3106
+Locus_54_Transcript_1/1_Confidence_0.000_Length_244	gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds	99.59	244	1	0	1	244	2362	2605	2e-120	  435	3360
+Locus_54_Transcript_1/1_Confidence_0.000_Length_244	gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence	99.59	244	1	0	1	244	2362	2605	2e-120	  435	3360
+Locus_54_Transcript_1/1_Confidence_0.000_Length_244	gi|365735168|gb|JN589003.1|_Espirito_Santo_virus_segment_A,_complete_sequence	69.50	200	57	2	21	218	2446	2643	1e-13	80.6	3427
+Locus_54_Transcript_1/1_Confidence_0.000_Length_244	gi|366091742|ref|NC_016518.1|_Espirito_Santo_virus_segment_A,_complete_genome	69.50	200	57	2	21	218	2446	2643	1e-13	80.6	3427
+Locus_54_Transcript_1/1_Confidence_0.000_Length_244	gi|403311043|gb|JQ659254.1|_Culex_Y_virus_isolate_P1-BS2010_segment_A,_complete_sequence	69.50	200	57	2	21	218	2456	2653	1e-13	80.6	3429
+Locus_54_Transcript_1/1_Confidence_0.000_Length_244	gi|407750679|gb|JX403941.1|_Mosquitoe_x_virus_segment_A,_complete_sequence	70.45	176	48	2	21	194	2446	2619	5e-13	78.8	3418
+Locus_55_Transcript_1/1_Confidence_0.000_Length_246	gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds	97.98	247	3	2	1	246	634	879	2e-114	  416	3360
+Locus_55_Transcript_1/1_Confidence_0.000_Length_246	gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence	97.98	247	3	2	1	246	634	879	2e-114	  416	3360
+Locus_55_Transcript_1/1_Confidence_0.000_Length_246	gi|545716020|gb|KF298271.1|_Culicine-associated_Z_virus_isolate_acc_9.1_segment_A_pVP2-VP4-VP3_poly	75.00	212	49	2	29	238	652	861	6e-31	  138	3420
+Locus_55_Transcript_1/1_Confidence_0.000_Length_246	gi|407750679|gb|JX403941.1|_Mosquitoe_x_virus_segment_A,_complete_sequence	72.22	216	60	0	29	244	654	869	2e-25	  120	3418
+Locus_55_Transcript_1/1_Confidence_0.000_Length_246	gi|365735168|gb|JN589003.1|_Espirito_Santo_virus_segment_A,_complete_sequence	70.49	244	72	0	1	244	629	872	2e-24	  116	3427
+Locus_55_Transcript_1/1_Confidence_0.000_Length_246	gi|366091742|ref|NC_016518.1|_Espirito_Santo_virus_segment_A,_complete_genome	70.49	244	72	0	1	244	629	872	2e-24	  116	3427
+Locus_55_Transcript_1/1_Confidence_0.000_Length_246	gi|403311043|gb|JQ659254.1|_Culex_Y_virus_isolate_P1-BS2010_segment_A,_complete_sequence	70.49	244	72	0	1	244	636	879	2e-24	  116	3429
+Locus_56_Transcript_1/1_Confidence_0.000_Length_450	gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2	100.00	448	0	0	3	450	1231	784	0.0	  809	1416
+Locus_56_Transcript_1/1_Confidence_0.000_Length_450	gi|351066204|gb|JF461542.1|_Flock_house_virus_isolate_IP-VIA-022011_coat_protein_precursor,_gene,_c	98.00	450	9	0	1	450	1233	784	0.0	  771	1365
+Locus_56_Transcript_1/1_Confidence_0.000_Length_450	gi|152143030|gb|EF690538.1|_Flock_house_virus_isolate_TNCL_segment_RNA2_protein_alpha_mRNA,_complet	96.44	450	16	0	1	450	1234	785	0.0	  740	1383
+Locus_56_Transcript_1/1_Confidence_0.000_Length_450	gi|22711883|ref|NC_004144.1|_Flock_house_virus,_complete_genome	84.41	449	70	0	2	450	1233	785	4e-138	  495	1400
+Locus_56_Transcript_1/1_Confidence_0.000_Length_450	gi|9632343|ref|NC_002037.1|_Black_beetle_virus_RNA_2,_complete_sequence	77.16	451	101	2	1	450	1234	785	6e-92	  342	1399
+Locus_56_Transcript_1/1_Confidence_0.000_Length_450	gi|22711868|ref|NC_004145.1|_Boolarra_virus_RNA_2,_complete_sequence	67.82	202	61	3	100	299	1111	912	8e-08	62.6	1305
+Locus_57_Transcript_1/1_Confidence_0.000_Length_260	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	100.00	260	0	0	1	260	404	145	9e-131	  470	3107
+Locus_57_Transcript_1/1_Confidence_0.000_Length_260	gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence	98.46	260	4	0	1	260	404	145	2e-125	  452	3107
+Locus_57_Transcript_1/1_Confidence_0.000_Length_260	gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd	95.38	260	12	0	1	260	404	145	2e-114	  416	3107
+Locus_57_Transcript_1/1_Confidence_0.000_Length_260	gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome	93.08	260	18	0	1	260	403	144	2e-106	  389	3106
+Locus_57_Transcript_1/1_Confidence_0.000_Length_260	gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence	91.54	260	22	0	1	260	404	145	6e-101	  370	3107
+Locus_57_Transcript_1/1_Confidence_0.000_Length_260	gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds	85.10	255	38	0	6	260	386	132	2e-76	  289	3096
+Locus_57_Transcript_1/1_Confidence_0.000_Length_260	gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome	85.10	255	38	0	6	260	386	132	2e-76	  289	3096
+Locus_58_Transcript_1/2_Confidence_0.333_Length_476	gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds	99.16	476	4	0	1	476	2375	1900	0.0	  841	3360
+Locus_58_Transcript_1/2_Confidence_0.333_Length_476	gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence	99.16	476	4	0	1	476	2375	1900	0.0	  841	3360
+Locus_58_Transcript_1/2_Confidence_0.333_Length_476	gi|365735168|gb|JN589003.1|_Espirito_Santo_virus_segment_A,_complete_sequence	81.99	272	45	2	206	475	2168	1899	1e-68	  264	3427
+Locus_58_Transcript_1/2_Confidence_0.333_Length_476	gi|366091742|ref|NC_016518.1|_Espirito_Santo_virus_segment_A,_complete_genome	81.99	272	45	2	206	475	2168	1899	1e-68	  264	3427
+Locus_58_Transcript_1/2_Confidence_0.333_Length_476	gi|403311043|gb|JQ659254.1|_Culex_Y_virus_isolate_P1-BS2010_segment_A,_complete_sequence	81.99	272	45	2	206	475	2175	1906	1e-68	  264	3429
+Locus_58_Transcript_1/2_Confidence_0.333_Length_476	gi|407750679|gb|JX403941.1|_Mosquitoe_x_virus_segment_A,_complete_sequence	81.25	272	47	2	206	475	2165	1896	7e-66	  255	3418
+Locus_58_Transcript_1/2_Confidence_0.333_Length_476	gi|545716020|gb|KF298271.1|_Culicine-associated_Z_virus_isolate_acc_9.1_segment_A_pVP2-VP4-VP3_poly	80.92	262	48	2	215	475	2154	1894	2e-61	  241	3420
+Locus_58_Transcript_2/2_Confidence_0.333_Length_368	gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds	99.69	323	1	0	46	368	2222	1900	3e-163	  578	3360
+Locus_58_Transcript_2/2_Confidence_0.333_Length_368	gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence	99.69	323	1	0	46	368	2222	1900	3e-163	  578	3360
+Locus_58_Transcript_2/2_Confidence_0.333_Length_368	gi|365735168|gb|JN589003.1|_Espirito_Santo_virus_segment_A,_complete_sequence	81.99	272	45	2	98	367	2168	1899	1e-68	  264	3427
+Locus_58_Transcript_2/2_Confidence_0.333_Length_368	gi|366091742|ref|NC_016518.1|_Espirito_Santo_virus_segment_A,_complete_genome	81.99	272	45	2	98	367	2168	1899	1e-68	  264	3427
+Locus_58_Transcript_2/2_Confidence_0.333_Length_368	gi|403311043|gb|JQ659254.1|_Culex_Y_virus_isolate_P1-BS2010_segment_A,_complete_sequence	81.99	272	45	2	98	367	2175	1906	1e-68	  264	3429
+Locus_58_Transcript_2/2_Confidence_0.333_Length_368	gi|407750679|gb|JX403941.1|_Mosquitoe_x_virus_segment_A,_complete_sequence	81.25	272	47	2	98	367	2165	1896	5e-66	  255	3418
+Locus_58_Transcript_2/2_Confidence_0.333_Length_368	gi|545716020|gb|KF298271.1|_Culicine-associated_Z_virus_isolate_acc_9.1_segment_A_pVP2-VP4-VP3_poly	80.92	262	48	2	107	367	2154	1894	1e-61	  241	3420
+Locus_59_Transcript_1/1_Confidence_0.000_Length_123	gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds	99.19	123	1	0	1	123	1014	1136	4e-55	  217	3360
+Locus_59_Transcript_1/1_Confidence_0.000_Length_123	gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence	99.19	123	1	0	1	123	1014	1136	4e-55	  217	3360
+Locus_59_Transcript_1/1_Confidence_0.000_Length_123	gi|545716020|gb|KF298271.1|_Culicine-associated_Z_virus_isolate_acc_9.1_segment_A_pVP2-VP4-VP3_poly	71.00	100	29	0	15	114	1018	1117	1e-04	50.0	3420
+Locus_60_Transcript_1/4_Confidence_0.600_Length_282	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	100.00	257	0	0	26	282	2595	2851	4e-129	  464	3107
+Locus_60_Transcript_1/4_Confidence_0.600_Length_282	gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence	98.43	255	4	0	28	282	2597	2851	1e-122	  443	3107
+Locus_60_Transcript_1/4_Confidence_0.600_Length_282	gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd	96.47	255	9	0	28	282	2597	2851	2e-115	  419	3107
+Locus_60_Transcript_1/4_Confidence_0.600_Length_282	gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence	93.73	255	16	0	28	282	2597	2851	3e-106	  389	3107
+Locus_60_Transcript_1/4_Confidence_0.600_Length_282	gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome	93.73	255	16	0	28	282	2596	2850	3e-106	  389	3106
+Locus_60_Transcript_1/4_Confidence_0.600_Length_282	gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds	83.27	257	43	0	26	282	2582	2838	2e-70	  269	3096
+Locus_60_Transcript_1/4_Confidence_0.600_Length_282	gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome	83.27	257	43	0	26	282	2582	2838	2e-70	  269	3096
+Locus_60_Transcript_1/4_Confidence_0.600_Length_282	gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds	93.23	133	9	0	150	282	1	133	3e-49	  199	389
+Locus_60_Transcript_2/4_Confidence_0.400_Length_217	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	100.00	167	0	0	26	192	2595	2761	2e-80	  302	3107
+Locus_60_Transcript_2/4_Confidence_0.400_Length_217	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	100.00	26	0	0	1	26	2517	2542	8e-04	48.2	3107
+Locus_60_Transcript_2/4_Confidence_0.400_Length_217	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	100.00	26	0	0	192	217	2802	2827	8e-04	48.2	3107
+Locus_60_Transcript_2/4_Confidence_0.400_Length_217	gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence	98.79	165	2	0	28	192	2597	2761	1e-76	  289	3107
+Locus_60_Transcript_2/4_Confidence_0.400_Length_217	gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence	100.00	26	0	0	1	26	2517	2542	8e-04	48.2	3107
+Locus_60_Transcript_2/4_Confidence_0.400_Length_217	gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence	100.00	26	0	0	192	217	2802	2827	8e-04	48.2	3107
+Locus_60_Transcript_2/4_Confidence_0.400_Length_217	gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd	98.18	165	3	0	28	192	2597	2761	6e-75	  284	3107
+Locus_60_Transcript_2/4_Confidence_0.400_Length_217	gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence	92.73	165	12	0	28	192	2597	2761	5e-63	  244	3107
+Locus_60_Transcript_2/4_Confidence_0.400_Length_217	gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome	92.73	165	12	0	28	192	2596	2760	5e-63	  244	3106
+Locus_60_Transcript_2/4_Confidence_0.400_Length_217	gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds	83.13	166	28	0	26	191	2582	2747	8e-42	  174	3096
+Locus_60_Transcript_2/4_Confidence_0.400_Length_217	gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome	83.13	166	28	0	26	191	2582	2747	8e-42	  174	3096
+Locus_60_Transcript_2/4_Confidence_0.400_Length_217	gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds	90.70	43	4	0	150	192	1	43	1e-07	60.8	389
+Locus_60_Transcript_3/4_Confidence_0.400_Length_168	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	100.00	118	0	0	51	168	2595	2712	7e-54	  214	3107
+Locus_60_Transcript_3/4_Confidence_0.400_Length_168	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	100.00	34	0	0	18	51	2509	2542	3e-08	62.6	3107
+Locus_60_Transcript_3/4_Confidence_0.400_Length_168	gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd	99.14	116	1	0	53	168	2597	2712	3e-51	  205	3107
+Locus_60_Transcript_3/4_Confidence_0.400_Length_168	gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd	91.18	34	3	0	18	51	2509	2542	6e-04	48.2	3107
+Locus_60_Transcript_3/4_Confidence_0.400_Length_168	gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence	99.14	116	1	0	53	168	2597	2712	3e-51	  205	3107
+Locus_60_Transcript_3/4_Confidence_0.400_Length_168	gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence	100.00	34	0	0	18	51	2509	2542	3e-08	62.6	3107
+Locus_60_Transcript_3/4_Confidence_0.400_Length_168	gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence	93.97	116	7	0	53	168	2597	2712	5e-43	  178	3107
+Locus_60_Transcript_3/4_Confidence_0.400_Length_168	gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence	97.22	36	1	0	16	51	2507	2542	9e-08	60.8	3107
+Locus_60_Transcript_3/4_Confidence_0.400_Length_168	gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome	93.97	116	7	0	53	168	2596	2711	5e-43	  178	3106
+Locus_60_Transcript_3/4_Confidence_0.400_Length_168	gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome	100.00	30	0	0	16	45	2506	2535	4e-06	55.4	3106
+Locus_60_Transcript_3/4_Confidence_0.400_Length_168	gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds	81.36	118	22	0	51	168	2582	2699	5e-24	  114	3096
+Locus_60_Transcript_3/4_Confidence_0.400_Length_168	gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds	96.77	31	1	0	18	48	2496	2526	5e-05	51.8	3096
+Locus_60_Transcript_3/4_Confidence_0.400_Length_168	gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome	81.36	118	22	0	51	168	2582	2699	5e-24	  114	3096
+Locus_60_Transcript_3/4_Confidence_0.400_Length_168	gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome	96.77	31	1	0	18	48	2496	2526	5e-05	51.8	3096
+Locus_60_Transcript_4/4_Confidence_0.100_Length_204	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	99.51	204	1	0	1	204	2509	2712	7e-99	  363	3107
+Locus_60_Transcript_4/4_Confidence_0.100_Length_204	gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence	99.02	204	2	0	1	204	2509	2712	9e-98	  360	3107
+Locus_60_Transcript_4/4_Confidence_0.100_Length_204	gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd	97.55	204	5	0	1	204	2509	2712	2e-93	  345	3107
+Locus_60_Transcript_4/4_Confidence_0.100_Length_204	gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence	93.63	204	13	0	1	204	2509	2712	1e-82	  309	3107
+Locus_60_Transcript_4/4_Confidence_0.100_Length_204	gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome	93.14	204	14	0	1	204	2508	2711	2e-81	  306	3106
+Locus_60_Transcript_4/4_Confidence_0.100_Length_204	gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds	78.92	204	43	0	1	204	2496	2699	7e-42	  174	3096
+Locus_60_Transcript_4/4_Confidence_0.100_Length_204	gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome	78.92	204	43	0	1	204	2496	2699	7e-42	  174	3096
+Locus_62_Transcript_1/1_Confidence_0.000_Length_130	gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds	98.46	130	2	0	1	130	1733	1862	8e-58	  226	3360
+Locus_62_Transcript_1/1_Confidence_0.000_Length_130	gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence	98.46	130	2	0	1	130	1733	1862	8e-58	  226	3360
+Locus_62_Transcript_1/1_Confidence_0.000_Length_130	gi|407750679|gb|JX403941.1|_Mosquitoe_x_virus_segment_A,_complete_sequence	87.01	77	10	0	2	78	1726	1802	3e-18	95.1	3418
+Locus_62_Transcript_1/1_Confidence_0.000_Length_130	gi|545716020|gb|KF298271.1|_Culicine-associated_Z_virus_isolate_acc_9.1_segment_A_pVP2-VP4-VP3_poly	80.39	102	20	0	1	102	1723	1824	3e-18	95.1	3420
+Locus_62_Transcript_1/1_Confidence_0.000_Length_130	gi|365735168|gb|JN589003.1|_Espirito_Santo_virus_segment_A,_complete_sequence	85.71	77	11	0	2	78	1729	1805	1e-16	89.7	3427
+Locus_62_Transcript_1/1_Confidence_0.000_Length_130	gi|366091742|ref|NC_016518.1|_Espirito_Santo_virus_segment_A,_complete_genome	85.71	77	11	0	2	78	1729	1805	1e-16	89.7	3427
+Locus_62_Transcript_1/1_Confidence_0.000_Length_130	gi|403311043|gb|JQ659254.1|_Culex_Y_virus_isolate_P1-BS2010_segment_A,_complete_sequence	85.71	77	11	0	2	78	1736	1812	1e-16	89.7	3429
+Locus_63_Transcript_1/1_Confidence_0.000_Length_371	gi|225356593|gb|FJ150422.1|_Drosophila_A_virus_isolate_HD,_complete_genome	95.96	371	15	0	1	371	3781	3411	3e-170	  601	4806
+Locus_63_Transcript_1/1_Confidence_0.000_Length_371	gi|253761971|ref|NC_012958.1|_Drosophila_A_virus,_complete_genome	95.96	371	15	0	1	371	3781	3411	3e-170	  601	4806
+Locus_65_Transcript_1/1_Confidence_0.000_Length_158	gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds	97.47	158	4	0	1	158	868	1025	3e-70	  268	3360
+Locus_65_Transcript_1/1_Confidence_0.000_Length_158	gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence	97.47	158	4	0	1	158	868	1025	3e-70	  268	3360
+Locus_65_Transcript_1/1_Confidence_0.000_Length_158	gi|407750679|gb|JX403941.1|_Mosquitoe_x_virus_segment_A,_complete_sequence	71.31	122	35	0	25	146	884	1005	2e-08	62.6	3418
+Locus_65_Transcript_1/1_Confidence_0.000_Length_158	gi|365735168|gb|JN589003.1|_Espirito_Santo_virus_segment_A,_complete_sequence	70.49	122	36	0	25	146	887	1008	3e-07	59.0	3427
+Locus_65_Transcript_1/1_Confidence_0.000_Length_158	gi|366091742|ref|NC_016518.1|_Espirito_Santo_virus_segment_A,_complete_genome	70.49	122	36	0	25	146	887	1008	3e-07	59.0	3427
+Locus_65_Transcript_1/1_Confidence_0.000_Length_158	gi|403311043|gb|JQ659254.1|_Culex_Y_virus_isolate_P1-BS2010_segment_A,_complete_sequence	70.49	122	36	0	25	146	894	1015	3e-07	59.0	3429
+Locus_66_Transcript_1/2_Confidence_0.333_Length_255	gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds	98.43	255	4	0	1	255	1349	1603	1e-122	  443	3360
+Locus_66_Transcript_1/2_Confidence_0.333_Length_255	gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence	98.43	255	4	0	1	255	1349	1603	1e-122	  443	3360
+Locus_66_Transcript_1/2_Confidence_0.333_Length_255	gi|403311043|gb|JQ659254.1|_Culex_Y_virus_isolate_P1-BS2010_segment_A,_complete_sequence	69.41	219	67	0	15	233	1365	1583	2e-17	93.3	3429
+Locus_66_Transcript_1/2_Confidence_0.333_Length_255	gi|365735168|gb|JN589003.1|_Espirito_Santo_virus_segment_A,_complete_sequence	68.49	219	69	0	15	233	1358	1576	1e-14	84.2	3427
+Locus_66_Transcript_1/2_Confidence_0.333_Length_255	gi|366091742|ref|NC_016518.1|_Espirito_Santo_virus_segment_A,_complete_genome	68.49	219	69	0	15	233	1358	1576	1e-14	84.2	3427
+Locus_66_Transcript_1/2_Confidence_0.333_Length_255	gi|407750679|gb|JX403941.1|_Mosquitoe_x_virus_segment_A,_complete_sequence	68.49	219	69	0	15	233	1355	1573	1e-14	84.2	3418
+Locus_66_Transcript_2/2_Confidence_0.333_Length_167	gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds	97.60	167	4	0	1	167	1437	1603	4e-75	  284	3360
+Locus_66_Transcript_2/2_Confidence_0.333_Length_167	gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence	97.60	167	4	0	1	167	1437	1603	4e-75	  284	3360
+Locus_68_Transcript_1/1_Confidence_0.000_Length_211	gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds	99.05	211	2	0	1	211	130	340	1e-101	  372	3360
+Locus_68_Transcript_1/1_Confidence_0.000_Length_211	gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence	99.05	211	2	0	1	211	130	340	1e-101	  372	3360
+Locus_68_Transcript_1/1_Confidence_0.000_Length_211	gi|365735168|gb|JN589003.1|_Espirito_Santo_virus_segment_A,_complete_sequence	75.42	179	44	0	3	181	127	305	3e-27	  125	3427
+Locus_68_Transcript_1/1_Confidence_0.000_Length_211	gi|366091742|ref|NC_016518.1|_Espirito_Santo_virus_segment_A,_complete_genome	75.42	179	44	0	3	181	127	305	3e-27	  125	3427
+Locus_68_Transcript_1/1_Confidence_0.000_Length_211	gi|545716020|gb|KF298271.1|_Culicine-associated_Z_virus_isolate_acc_9.1_segment_A_pVP2-VP4-VP3_poly	73.21	209	56	0	3	211	122	330	3e-27	  125	3420
+Locus_68_Transcript_1/1_Confidence_0.000_Length_211	gi|403311043|gb|JQ659254.1|_Culex_Y_virus_isolate_P1-BS2010_segment_A,_complete_sequence	74.30	179	46	0	3	181	134	312	2e-24	  116	3429
+Locus_68_Transcript_1/1_Confidence_0.000_Length_211	gi|407750679|gb|JX403941.1|_Mosquitoe_x_virus_segment_A,_complete_sequence	73.74	179	47	0	3	181	124	302	7e-23	  111	3418
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds	99.39	164	1	0	1	164	546	383	3e-77	  291	3360
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence	99.39	164	1	0	1	164	546	383	3e-77	  291	3360
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|545716020|gb|KF298271.1|_Culicine-associated_Z_virus_isolate_acc_9.1_segment_A_pVP2-VP4-VP3_poly	77.61	134	28	2	1	133	536	404	1e-19	  100	3420
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|14582979|gb|AF362773.1|_Infectious_bursal_disease_virus_strain_23/82_segment_A_structural_polypr	73.63	91	24	0	41	131	514	424	1e-06	57.2	3191
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|158426958|gb|EU184687.1|_Infectious_bursal_disease_virus_strain_Cro-Po/00_VP5_and_structural_pol	74.39	82	21	0	50	131	468	387	1e-05	53.6	3101
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|17066747|gb|AF443294.1|_Infectious_bursal_disease_virus_polyprotein_gene,_complete_cds	74.39	82	18	1	50	131	420	342	5e-05	51.8	3054
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|20805928|gb|AF508177.1|_Infectious_bursal_disease_virus_VP2_gene,_complete_cds	73.17	82	22	0	50	131	408	327	2e-04	50.0	1356
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|145864612|gb|EF517528.1|_Infectious_bursal_disease_virus_isolate_Harbin-1_segment_A,_complete_se	73.17	82	22	0	50	131	538	457	2e-04	50.0	3261
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|89112096|gb|AY444873.3|_Infectious_bursal_disease_virus_VP5_protein_and_structural_polyprotein_g	73.17	82	22	0	50	131	538	457	2e-04	50.0	3260
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|114153396|gb|DQ927040.1|_Infectious_bursal_disease_virus_strain_mb_segment_A_polyprotein_mRNA,_c	73.17	82	22	0	50	131	477	396	2e-04	50.0	3163
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|117582107|gb|DQ927042.1|_Infectious_bursal_disease_virus_strain_ks_segment_A_polyprotein_mRNA,_c	73.17	82	22	0	50	131	477	396	2e-04	50.0	3163
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|158426953|gb|EU184685.1|_Infectious_bursal_disease_virus_strain_Cro-Ig/02_VP5_and_structural_pol	73.17	82	22	0	50	131	512	431	2e-04	50.0	3145
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|227438895|gb|FJ842492.1|_Infectious_bursal_disease_virus_strain_BDG23_polyprotein_gene,_complete	73.17	82	22	0	50	131	408	327	2e-04	50.0	3039
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|227438897|gb|FJ842491.1|_Infectious_bursal_disease_virus_strain_G202_polyprotein_gene,_complete_	73.17	82	22	0	50	131	408	327	2e-04	50.0	3039
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|9230678|gb|AF240686.1|_Infectious_bursal_disease_virus_segment_A_viral_protein_5_and_polyprotein	73.17	82	22	0	50	131	538	457	2e-04	50.0	3260
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|14582985|gb|AF362776.1|_Infectious_bursal_disease_virus_strain_BD_3/99_segment_A_structural_poly	73.17	82	22	0	50	131	508	427	2e-04	50.0	3201
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|20805925|gb|AF508176.1|_Infectious_bursal_disease_virus_segment_A,_complete_sequence	73.17	82	22	0	50	131	539	458	2e-04	50.0	3269
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|22654953|gb|AY134874.1|_Infectious_bursal_disease_virus_strain_SH95_polyprotein_gene,_complete_c	73.17	82	22	0	50	131	409	328	2e-04	50.0	3040
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|171906486|gb|EU595667.1|_Infectious_bursal_disease_virus_segment_A_VP5_and_polyprotein_genes,_co	73.17	82	22	0	50	131	538	457	2e-04	50.0	3260
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|171906489|gb|EU595668.1|_Infectious_bursal_disease_virus_VP5_and_polyprotein_genes,_complete_cds	73.17	82	22	0	50	131	538	457	2e-04	50.0	3260
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|171906495|gb|EU595670.1|_Infectious_bursal_disease_virus_segment_A_VP5_and_polyprotein_genes,_co	73.17	82	22	0	50	131	538	457	2e-04	50.0	3259
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|4566479|gb|AF092943.1|_Infectious_bursal_disease_virus_VP5_(VP5)_and_structural_polyprotein_(VP2	73.17	82	22	0	50	131	539	458	2e-04	50.0	3269
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|24306007|gb|AF322444.1|_Infectious_bursal_disease_virus_segment_A_VP5_protein_and_polyprotein_ge	73.17	82	22	0	50	131	454	373	2e-04	50.0	3085
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|28629198|gb|AF533670.1|_Infectious_bursal_disease_virus_strain_SH/92_polyprotein_mRNA,_complete_	73.17	82	22	0	50	131	408	327	2e-04	50.0	3039
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|32492037|gb|AY323952.1|_Infectious_bursal_disease_virus_segment_A_structural_protein_VP5_(VP5)_a	73.17	82	22	0	50	131	469	388	2e-04	50.0	3179
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|62860669|gb|AY918948.1|_Infectious_bursal_disease_virus_isolate_Lukert_VP5_and_polyprotein_genes	72.41	87	24	0	45	131	543	457	2e-04	50.0	3260
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|51242682|gb|AY598356.1|_Infectious_bursal_disease_virus_segment_A,_complete_sequence	73.17	82	22	0	50	131	538	457	2e-04	50.0	3260
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|56117954|gb|AY665672.1|_Infectious_bursal_disease_virus_isolate_PO7_polyprotein_gene,_complete_c	73.17	82	22	0	50	131	408	327	2e-04	50.0	3131
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|350543517|gb|JF907702.1|_Infectious_bursal_disease_virus_isolate_CAHFS-785-SESW_polyprotein_gene	73.17	82	22	0	50	131	546	465	2e-04	50.0	3186
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|350543519|gb|JF907703.1|_Infectious_bursal_disease_virus_isolate_2009CAH495-SESW_polyprotein_gen	73.17	82	22	0	50	131	539	458	2e-04	50.0	3193
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|367057603|gb|JN585293.1|_Infectious_bursal_disease_virus_isolate_CAHFS_K669_segment_A,_complete_	73.17	82	22	0	50	131	532	451	2e-04	50.0	3184
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|385139617|gb|JQ403646.1|_Infectious_bursal_disease_virus_isolate_7741-SEGA-SESW_polyprotein_gene	73.17	82	22	0	50	131	532	451	2e-04	50.0	3184
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|417346921|gb|JX682711.1|_Infectious_bursal_disease_virus_isolate_ZZ-11_segment_A,_complete_seque	73.17	82	22	0	50	131	538	457	2e-04	50.0	3260
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|431823432|gb|JX948746.1|_Infectious_bursal_disease_virus_isolate_DG12_polyprotein_gene,_complete	73.17	82	22	0	50	131	408	327	2e-04	50.0	3039
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|452029935|gb|KC189836.1|_Infectious_bursal_disease_virus_strain_3529/92_polyprotein_mRNA,_comple	73.17	82	22	0	50	131	408	327	2e-04	50.0	3039
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|395863886|gb|JN982253.1|_Infectious_bursal_disease_virus_isolate_SP9_VP2_protein_gene,_complete_	73.17	82	22	0	50	131	408	327	2e-04	50.0	1356
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|395863888|gb|JN982254.1|_Infectious_bursal_disease_virus_isolate_SC9_VP2_protein_gene,_complete_	73.17	82	22	0	50	131	408	327	2e-04	50.0	1356
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|395863890|gb|JN982255.1|_Infectious_bursal_disease_virus_isolate_SP22_VP2_protein_gene,_complete	73.17	82	22	0	50	131	408	327	2e-04	50.0	1356
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|395863892|gb|JN982256.1|_Infectious_bursal_disease_virus_isolate_SP33_VP2_protein_gene,_complete	73.17	82	22	0	50	131	408	327	2e-04	50.0	1356
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|395863894|gb|JN982257.1|_Infectious_bursal_disease_virus_isolate_SP5_VP2_protein_gene,_complete_	73.17	82	22	0	50	131	408	327	2e-04	50.0	1356
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|395863898|gb|JN982259.1|_Infectious_bursal_disease_virus_isolate_SP25_VP2_protein_gene,_complete	73.17	82	22	0	50	131	408	327	2e-04	50.0	1356
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|395863900|gb|JN982260.1|_Infectious_bursal_disease_virus_isolate_SP26_VP2_protein_gene,_complete	73.17	82	22	0	50	131	408	327	2e-04	50.0	1356
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|395863902|gb|JN982261.1|_Infectious_bursal_disease_virus_isolate_SP28_VP2_protein_gene,_complete	73.17	82	22	0	50	131	408	327	2e-04	50.0	1356
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|395863904|gb|JN982262.1|_Infectious_bursal_disease_virus_isolate_SP11_VP2_protein_gene,_complete	73.17	82	22	0	50	131	408	327	2e-04	50.0	1356
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|395863906|gb|JN982263.1|_Infectious_bursal_disease_virus_isolate_SC6_VP2_protein_gene,_complete_	73.17	82	22	0	50	131	408	327	2e-04	50.0	1356
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|395863908|gb|JN982264.1|_Infectious_bursal_disease_virus_isolate_SP20_VP2_protein_gene,_complete	73.17	82	22	0	50	131	408	327	2e-04	50.0	1356
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|395863910|gb|JN982265.1|_Infectious_bursal_disease_virus_isolate_SP21_VP2_protein_gene,_complete	73.17	82	22	0	50	131	408	327	2e-04	50.0	1356
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|395863912|gb|JN982266.1|_Infectious_bursal_disease_virus_isolate_SP30_VP2_protein_gene,_complete	73.17	82	22	0	50	131	408	327	2e-04	50.0	1356
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|395863914|gb|JN982267.1|_Infectious_bursal_disease_virus_isolate_SC8_VP2_protein_gene,_complete_	73.17	82	22	0	50	131	408	327	2e-04	50.0	1356
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|395863916|gb|JN982268.1|_Infectious_bursal_disease_virus_isolate_SC10_VP2_protein_gene,_complete	73.17	82	22	0	50	131	408	327	2e-04	50.0	1356
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|395863918|gb|JN982269.1|_Infectious_bursal_disease_virus_isolate_SC12_VP2_protein_gene,_complete	73.17	82	22	0	50	131	408	327	2e-04	50.0	1356
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|395863926|gb|JN982273.1|_Infectious_bursal_disease_virus_isolate_SC5_VP2_protein_gene,_complete_	73.17	82	22	0	50	131	408	327	2e-04	50.0	1356
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|630375496|gb|KJ547670.1|_Infectious_bursal_disease_virus_isolate_Ventri-IBDV-Plus_polyprotein_mR	73.17	82	22	0	50	131	409	328	2e-04	50.0	3040
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|630375498|gb|KJ547671.1|_Infectious_bursal_disease_virus_isolate_VRDC-IBDV-SZ_polyprotein_mRNA,_	73.17	82	22	0	50	131	409	328	2e-04	50.0	3040
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|630375502|gb|KJ547673.1|_Infectious_bursal_disease_virus_isolate_VRDC-IBDV-WZ_polyprotein_mRNA,_	73.17	82	22	0	50	131	446	365	2e-04	50.0	3084
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|630375504|gb|KJ547674.1|_Infectious_bursal_disease_virus_isolate_VRDC-IBDV-NZ_polyprotein_mRNA,_	73.17	82	22	0	50	131	417	336	2e-04	50.0	3164
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|544586540|gb|KF241548.1|_Infectious_bursal_disease_virus_isolate_SA-KZN95_polyprotein_gene,_comp	73.17	82	22	0	50	131	408	327	2e-04	50.0	3039
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|667756313|gb|KF569803.1|_Infectious_bursal_disease_virus_isolate_SD10LY01_segment_A,_complete_se	73.17	82	22	0	50	131	538	457	2e-04	50.0	3260
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|667756318|gb|KF569805.1|_Infectious_bursal_disease_virus_isolate_HuB-1_segment_A,_complete_seque	73.17	82	22	0	50	131	538	457	2e-04	50.0	3260
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|22855166|ref|NC_004178.1|_Infectious_bursal_disease_virus_segment_A,_complete_sequence	73.17	82	22	0	50	131	537	456	2e-04	50.0	3183
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|157886466|emb|AM111353.1|_Infectious_bursal_disease_virus_segment_A,_complete_sequence,_genomic_	73.17	82	22	0	50	131	538	457	2e-04	50.0	3262
+Locus_69_Transcript_1/1_Confidence_0.000_Length_164	gi|803378129|emb|HG974563.1|_Infectious_bursal_disease_virus_segment_A,_complete_genome,_strain_891	73.17	82	22	0	50	131	507	426	2e-04	50.0	3198
+Locus_70_Transcript_1/1_Confidence_0.000_Length_147	gi|8100530|gb|AF183905.1|_Black_queen_cell_virus_nonstructural_polyprotein_(orf1)_and_structural_po	88.64	44	5	0	69	112	8510	8467	9e-07	57.2	8550
+Locus_70_Transcript_1/1_Confidence_0.000_Length_147	gi|20451021|ref|NC_003784.1|_Black_queen_cell_virus,_complete_genome	88.64	44	5	0	69	112	8510	8467	9e-07	57.2	8550
+Locus_70_Transcript_1/1_Confidence_0.000_Length_147	gi|667668455|gb|KJ738331.1|_UNVERIFIED:_Black_queen_cell_virus_non-structural_polyprotein-like_gene	88.64	44	5	0	69	112	8238	8195	9e-07	57.2	8278
+Locus_70_Transcript_1/1_Confidence_0.000_Length_147	gi|732449831|gb|KP119603.1|_Black_queen_cell_virus_isolate_JL1,_complete_genome	88.64	44	5	0	69	112	8318	8275	9e-07	57.2	8358
+Locus_70_Transcript_1/1_Confidence_0.000_Length_147	gi|365176197|gb|JN542439.1|_Black_queen_cell_virus_isolate_Kor1-BQCV3_polyprotein_gene,_complete_cd	90.00	40	4	0	73	112	627	588	3e-06	55.4	627
+Locus_70_Transcript_1/1_Confidence_0.000_Length_147	gi|401668676|gb|JX149531.1|_Black_queen_cell_virus_strain_AY_non-structural_polyprotein_and_structu	86.36	44	6	0	69	112	8364	8321	1e-05	53.6	8392
+Locus_72_Transcript_1/1_Confidence_0.000_Length_108	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	100.00	108	0	0	1	108	1903	1796	1e-48	  196	3107
+Locus_72_Transcript_1/1_Confidence_0.000_Length_108	gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence	99.07	108	1	0	1	108	1903	1796	4e-47	  190	3107
+Locus_72_Transcript_1/1_Confidence_0.000_Length_108	gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd	93.52	108	7	0	1	108	1903	1796	6e-39	  163	3107
+Locus_72_Transcript_1/1_Confidence_0.000_Length_108	gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence	89.62	106	11	0	1	106	1903	1798	2e-32	  141	3107
+Locus_72_Transcript_1/1_Confidence_0.000_Length_108	gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome	89.62	106	11	0	1	106	1902	1797	2e-32	  141	3106
+Locus_72_Transcript_1/1_Confidence_0.000_Length_108	gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds	75.96	104	25	0	3	106	1888	1785	2e-12	75.2	3096
+Locus_72_Transcript_1/1_Confidence_0.000_Length_108	gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome	75.96	104	25	0	3	106	1888	1785	2e-12	75.2	3096
+Locus_73_Transcript_1/1_Confidence_0.000_Length_164	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	100.00	164	0	0	1	164	1608	1771	7e-79	  297	3107
+Locus_73_Transcript_1/1_Confidence_0.000_Length_164	gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence	99.39	164	1	0	1	164	1608	1771	3e-77	  291	3107
+Locus_73_Transcript_1/1_Confidence_0.000_Length_164	gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd	96.89	161	5	0	2	162	1609	1769	3e-70	  268	3107
+Locus_73_Transcript_1/1_Confidence_0.000_Length_164	gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome	87.73	163	20	0	2	164	1608	1770	3e-51	  205	3106
+Locus_73_Transcript_1/1_Confidence_0.000_Length_164	gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence	87.12	163	21	0	2	164	1609	1771	1e-49	  199	3107
+Locus_73_Transcript_1/1_Confidence_0.000_Length_164	gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds	75.46	163	40	0	2	164	1596	1758	5e-24	  114	3096
+Locus_73_Transcript_1/1_Confidence_0.000_Length_164	gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome	75.46	163	40	0	2	164	1596	1758	5e-24	  114	3096
+Locus_73_Transcript_1/1_Confidence_0.000_Length_164	gi|351066210|gb|JN187416.1|_Macrobrachium_rosenbergii_nodavirus_RNA-dependent_RNA_polymerase_gene,_	74.68	79	20	0	81	159	1711	1789	1e-05	53.6	3199
+Locus_78_Transcript_1/1_Confidence_1.000_Length_154	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	78.79	165	6	3	18	154	2937	3100	2e-35	  152	3107
+Locus_78_Transcript_1/1_Confidence_1.000_Length_154	gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence	78.79	165	6	3	18	154	2937	3100	2e-35	  152	3107
+Locus_78_Transcript_1/1_Confidence_1.000_Length_154	gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd	78.18	165	7	3	18	154	2937	3100	2e-34	  149	3107
+Locus_78_Transcript_1/1_Confidence_1.000_Length_154	gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds	76.36	165	10	3	18	154	219	382	5e-30	  134	389
+Locus_78_Transcript_1/1_Confidence_1.000_Length_154	gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence	76.36	165	10	3	18	154	2937	3100	5e-30	  134	3107
+Locus_78_Transcript_1/1_Confidence_1.000_Length_154	gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome	76.36	165	10	3	18	154	2936	3099	5e-30	  134	3106
+Locus_78_Transcript_1/1_Confidence_1.000_Length_154	gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds	80.26	76	13	2	18	92	2924	2998	2e-08	62.6	3096
+Locus_78_Transcript_1/1_Confidence_1.000_Length_154	gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome	80.26	76	13	2	18	92	2924	2998	2e-08	62.6	3096
+Locus_79_Transcript_1/1_Confidence_1.000_Length_154	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	81.21	165	2	3	18	154	2937	3100	6e-41	  170	3107
+Locus_79_Transcript_1/1_Confidence_1.000_Length_154	gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd	78.18	165	7	3	18	154	2937	3100	2e-34	  149	3107
+Locus_79_Transcript_1/1_Confidence_1.000_Length_154	gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence	77.58	165	8	3	18	154	2937	3100	9e-33	  143	3107
+Locus_79_Transcript_1/1_Confidence_1.000_Length_154	gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds	75.76	165	11	3	18	154	219	382	6e-29	  131	389
+Locus_79_Transcript_1/1_Confidence_1.000_Length_154	gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence	75.76	165	11	3	18	154	2937	3100	6e-29	  131	3107
+Locus_79_Transcript_1/1_Confidence_1.000_Length_154	gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome	75.76	165	11	3	18	154	2936	3099	6e-29	  131	3106
+Locus_79_Transcript_1/1_Confidence_1.000_Length_154	gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds	80.26	76	13	2	18	92	2924	2998	2e-08	62.6	3096
+Locus_79_Transcript_1/1_Confidence_1.000_Length_154	gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome	80.26	76	13	2	18	92	2924	2998	2e-08	62.6	3096
+Locus_80_Transcript_1/1_Confidence_1.000_Length_101	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	100.00	99	0	0	1	99	2851	2753	7e-44	  179	3107
+Locus_80_Transcript_1/1_Confidence_1.000_Length_101	gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence	97.98	99	2	0	1	99	2851	2753	4e-41	  170	3107
+Locus_80_Transcript_1/1_Confidence_1.000_Length_101	gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence	95.96	99	4	0	1	99	2851	2753	2e-38	  161	3107
+Locus_80_Transcript_1/1_Confidence_1.000_Length_101	gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome	95.96	99	4	0	1	99	2850	2752	2e-38	  161	3106
+Locus_80_Transcript_1/1_Confidence_1.000_Length_101	gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds	94.95	99	5	0	1	99	133	35	8e-37	  156	389
+Locus_80_Transcript_1/1_Confidence_1.000_Length_101	gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd	93.94	99	6	0	1	99	2851	2753	1e-35	  152	3107
+Locus_80_Transcript_1/1_Confidence_1.000_Length_101	gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds	83.84	99	16	0	1	99	2838	2740	4e-22	  107	3096
+Locus_80_Transcript_1/1_Confidence_1.000_Length_101	gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome	83.84	99	16	0	1	99	2838	2740	4e-22	  107	3096
+Locus_81_Transcript_1/1_Confidence_1.000_Length_155	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	75.15	169	1	1	1	128	2851	2683	2e-34	  149	3107
+Locus_81_Transcript_1/1_Confidence_1.000_Length_155	gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence	74.56	169	2	1	1	128	2851	2683	9e-33	  143	3107
+Locus_81_Transcript_1/1_Confidence_1.000_Length_155	gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd	96.20	79	3	0	50	128	2761	2683	2e-28	  129	3107
+Locus_81_Transcript_1/1_Confidence_1.000_Length_155	gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd	90.00	50	5	0	1	50	2851	2802	6e-10	68.0	3107
+Locus_81_Transcript_1/1_Confidence_1.000_Length_155	gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence	87.34	79	10	0	50	128	2761	2683	3e-19	98.7	3107
+Locus_81_Transcript_1/1_Confidence_1.000_Length_155	gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence	95.83	48	2	0	1	48	2851	2804	3e-13	78.8	3107
+Locus_81_Transcript_1/1_Confidence_1.000_Length_155	gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome	87.34	79	10	0	50	128	2760	2682	3e-19	98.7	3106
+Locus_81_Transcript_1/1_Confidence_1.000_Length_155	gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome	95.83	48	2	0	1	48	2850	2803	3e-13	78.8	3106
+Locus_81_Transcript_1/1_Confidence_1.000_Length_155	gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds	85.90	78	11	0	51	128	2747	2670	5e-17	91.5	3096
+Locus_81_Transcript_1/1_Confidence_1.000_Length_155	gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds	87.23	47	6	0	1	47	2838	2792	3e-07	59.0	3096
+Locus_81_Transcript_1/1_Confidence_1.000_Length_155	gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome	85.90	78	11	0	51	128	2747	2670	5e-17	91.5	3096
+Locus_81_Transcript_1/1_Confidence_1.000_Length_155	gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome	87.23	47	6	0	1	47	2838	2792	3e-07	59.0	3096
+Locus_81_Transcript_1/1_Confidence_1.000_Length_155	gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds	95.83	48	2	0	1	48	133	86	3e-13	78.8	389
+Locus_81_Transcript_1/1_Confidence_1.000_Length_155	gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds	90.70	43	4	0	50	92	43	1	8e-08	60.8	389
+Locus_82_Transcript_1/1_Confidence_1.000_Length_165	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	100.00	165	0	0	1	165	2851	2687	2e-79	  298	3107
+Locus_82_Transcript_1/1_Confidence_1.000_Length_165	gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence	98.18	165	3	0	1	165	2851	2687	4e-75	  284	3107
+Locus_82_Transcript_1/1_Confidence_1.000_Length_165	gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd	95.15	165	8	0	1	165	2851	2687	1e-68	  262	3107
+Locus_82_Transcript_1/1_Confidence_1.000_Length_165	gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence	92.12	165	13	0	1	165	2851	2687	2e-61	  239	3107
+Locus_82_Transcript_1/1_Confidence_1.000_Length_165	gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome	92.12	165	13	0	1	165	2850	2686	2e-61	  239	3106
+Locus_82_Transcript_1/1_Confidence_1.000_Length_165	gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds	93.23	133	9	0	1	133	133	1	1e-49	  199	389
+Locus_82_Transcript_1/1_Confidence_1.000_Length_165	gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds	84.85	165	25	0	1	165	2838	2674	3e-45	  185	3096
+Locus_82_Transcript_1/1_Confidence_1.000_Length_165	gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome	84.85	165	25	0	1	165	2838	2674	3e-45	  185	3096
+Locus_83_Transcript_1/1_Confidence_1.000_Length_196	gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1	99.41	169	1	0	1	169	2851	2683	7e-80	  300	3107
+Locus_83_Transcript_1/1_Confidence_1.000_Length_196	gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence	97.63	169	4	0	1	169	2851	2683	4e-76	  288	3107
+Locus_83_Transcript_1/1_Confidence_1.000_Length_196	gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd	94.67	169	9	0	1	169	2851	2683	5e-69	  264	3107
+Locus_83_Transcript_1/1_Confidence_1.000_Length_196	gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence	91.72	169	14	0	1	169	2851	2683	2e-62	  242	3107
+Locus_83_Transcript_1/1_Confidence_1.000_Length_196	gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome	91.72	169	14	0	1	169	2850	2682	2e-62	  242	3106
+Locus_83_Transcript_1/1_Confidence_1.000_Length_196	gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds	93.23	133	9	0	1	133	133	1	2e-49	  199	389
+Locus_83_Transcript_1/1_Confidence_1.000_Length_196	gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds	84.62	169	26	0	1	169	2838	2670	3e-46	  188	3096
+Locus_83_Transcript_1/1_Confidence_1.000_Length_196	gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome	84.62	169	26	0	1	169	2838	2670	3e-46	  188	3096
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/input.fa	Sun Oct 15 18:43:37 2017 -0400
@@ -0,0 +1,1712 @@
+>Locus_1_Transcript_1/7_Confidence_0.231_Length_224
+CTTTCAGGTACGCTTCCATGAACGTGGGCATTTACCCAACGTCGAACTTGATGCAGTTTA
+CCGGAAGCATAACTGTTTGGAAATGTCCTATAAAGCTGAGCACTGTACAATTCCCGGTTG
+CTACAGAGCAAGCCACCTCTTCACTAGTACACATTCTTGCTGGTTTAAATGGTGTATTAG
+CGGTGGGACCAGACAATTAAAACGGATGCCAACATAAATGGGCA
+>Locus_1_Transcript_2/7_Confidence_0.231_Length_143
+AATGGCCTATAAAGCTGAGCACTGTACAATTCCCGGTTGCTACAGAGCAAGCCACCTCTT
+CACTAGTACACATTCTTGCTGGTTTAAATGGTGTATTAGCGGTGGGACCAGACAATTAAA
+ACGGATGCCAACATAAATGGGCA
+>Locus_1_Transcript_3/7_Confidence_0.231_Length_407
+ATCCGGGCTTTACATCGATGTTCGGTACTACTGCAACATCTAGGTCCGACCAAGTGTCCT
+ATTTCAGGTACGCTTCCATGAACGTGGGCATTTACCCAACGTCGAACTTGATGCAGTTTA
+CCGGAAGCATAACTGTTTGGAAATGTCCTATAAAGCTGAGCACTGTACAATTCCCGGTTG
+CTACAGAGCAAGCCACCTCTTCACTAGTACACATTCTTGCTGGTTTAAATGGTGTATTAG
+CGGTGGGACCAGACAATTCAAACCGGATGCCAACCTAACTGGGCAATTAGGCCACAATAA
+GCCCAACTTGGTTGATGATCGAAACAGTGAGCCCCCTCCCATGTAATGGAAGACGTCGAC
+GCAATCGTGCGAGACGTAATGACAGTTTAAGTCAGCCGACTAAGGGG
+>Locus_1_Transcript_4/7_Confidence_0.077_Length_591
+GTAAACAATTCCAAGTTCCAAATGGTTAACAACATCAAACCAAGACGGCAACGATCCCAA
+CGTGTTGCCGTAACAACAACCCAAACAGCGCCTATTCCACAGCGAAACGTACCACGTAAT
+CGGAGTGAGCCGCGTCAATAATGAGGCGGAATCGCCGTCGTGTACGTGGCATGAATATGG
+CGGCGCTTTCCCGGCTTAGTCAGCCTGGGTTAGCGTTTCTCAAGTGTGCATTCGCACCAC
+CTGACTTTCAGGTACGCTTCCATGAACGTGGGCATTTACCCAACGTCGAACTTGATGCAG
+TTTACCGGAAGCATAACTGTTTGGAAATGTCCTATAAAGCTGAGCACTGTACAATTCCCG
+GTTGCTACAGAGCAAGCCACCTCTTCACTAGTACACATTCTTGCTGGTTTAAATGGTGTA
+TTAGCGGTGGGACCAGACAATTCAAACCGGATGCCAACCTAACTGGGCAATTAGGCCACA
+ATAAGCCCAACTTGGTTGATGATCGAAACAGTGAGCCCCCTCCCATGTAATGGAAGACGT
+CGACGCAATCGTGCGAGACGTAATGACAGTTTAAGTCAGCCGACTAAGGGG
+>Locus_1_Transcript_5/7_Confidence_0.231_Length_163
+AATAATGAGGCGGAATCGCCGTCGTGGACGTGGCAAGGCAAAGCTAACGGTAAGCGAAGG
+AAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCGAAAGCTGGAGCTCAG
+CCACAGCCTTCCAACAACCGGAAGTGACCCCCCACCCGCTAAA
+>Locus_1_Transcript_6/7_Confidence_0.077_Length_216
+GTAAACAATTCCAAGTTCCAAATGGTTAACAACATCAAACCAAGACGGCAACGATCCCAA
+CGTGTTGCCGTAACAACAACCCAAACAGCGCCTATTCCACAGCGAAACGTACCACGTAAT
+CGGAGTGAGCCGCGTCAATAATGAGGCGGAATCGCCGTCGTGGACGTGGCAAGGCAAAGC
+TAACGGTAAGCGAAGGAAGGGCCCCCGAGGAGGCAA
+>Locus_1_Transcript_7/7_Confidence_0.231_Length_184
+AATAATGAGGCGGAATCGCCGTCGTGGACGTGGCAAGGCAAAGCTAACGGTAAGCGAAGG
+AAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCGAAAGCTGGAGCTCAG
+CCCCCCACCCGCTAAACCGTAGCTGACTCCTAGGAGCACCTACACCCGTTCTAGCCCGAA
+AGGG
+>Locus_2_Transcript_1/5_Confidence_0.125_Length_327
+TTCCTGCATCGATTTGTGGTCTTCGCACGCGCCTCGAACCGAAAACTAATGCATAAAGTA
+GATCATAGAGCAACGACTGCCTTTTAAAGAAATTTCTTTAGAGAAAGGACGAAAATCACG
+AGACAATCTTTGGTTGGATTGTAACGTCCTGACTCGTAGAGGATTTCCCGACCATGAAGT
+AGCAAACCCAAAACTCTTGATATCTCAACATATGTATACGTAATGGATGCATCAAACCCA
+ACTAATTCGTCTGAAAGGTTTACCTTGGAGGACTTGCGGTACGAACATGTGAAGAGAAAG
+CGTCAGGACCTTGCTGCCCTCCATACC
+>Locus_2_Transcript_2/5_Confidence_0.250_Length_809
+TTCCTGCATCGATTTGTGGTCTTCGCACGCGCCTCGAACCGAAAACTAATGCATAAAGTA
+GATCATAGAGCAACGACTGCCTTTTAAAGAAATTTCTTTAGAGAAAGGACGAAAATCACG
+AGACAATCTTTGGTTGGATTGTAACGTCCTGACTCGTAGAGGATTTCCCGACCATGAAGT
+AGCAAACCCAAAACTCTTGATATCTCAACATATGTATACGTAATGGATGCATCAAACCCA
+ACTAATTCGTCTGAAAGGTTTACCTTGGAGGACTTGCGGTACGAACATGTGAAGAGAAAG
+CGTCAGGACCTTGCTGCCCTCCATACCATGGCCAAAGCCTCCACACGAACATATGTTGGT
+GGTGCGCTCCCTGACCGTGACAACATCATGGAGGTGTTCAAACAGTTGGACGCAGCTACT
+CAAGCGGTTGACCCGACACCAATGTCTGACTTCTCATACCTAAATTCTCATCCGGCAATT
+CCGGTATGGAGGGCAGCAAGGTCCTGACGCTTTCTCTTCACATGTTCGTACCGCAAGTCC
+TCCAAGGTAAACCTTTCAGACGAATTAGTTGGGTTTGATGCATCCATTACGTATACATAT
+GTTGAGATATCAAGAGTTTTGGGTTTGCTACTTCATGGTCGGGAAATCCTCTACGAGTCA
+GGACGTTACAATCCAACCAAAGATTGTCTCGTGATTTTCGTCCTTTCTCTAAAGAAATTT
+CTTTAAAAGGCAGTCGTTGCTCTATGATCTACTTTATGCATTAGTTTTCGGTTCGAGGCG
+CGTGCGAAGACCACAAATCGATGCAGGAA
+>Locus_2_Transcript_3/5_Confidence_0.250_Length_207
+GTCAGGACCTTGCTGCCCTCCATACCATGGCCAAAGCCTCCACACGAACATATGTTGGTG
+GTGCGCTCCCTGACCGTGACAACATCATGGAGGTGTTCAAACAGTTGGACGCAGCTACTC
+AAGCGGTTGACCCGACACCAATGTCTGACTTCTCATACCTAAATTCTCATCCGGCAATTC
+CGGTATGGAGGGCAGCAAGGTCCTGAC
+>Locus_2_Transcript_4/5_Confidence_0.125_Length_605
+GTCAGGACCTTGCTGCCCTCCATACCATGGCCAAAGCCTCCACACGAACATATGTTGGTG
+GTGCGCTCCCTGACCGTGACAACATCATGGAGGTGTTCAAACAGTTGGACGCAGCTACTC
+AAGCGGTTGACCCGACACCAATGTCTGACTTCTCATACCTAAATTCTCATCCGGCAATTC
+CGGTTGATAATACTAAGTATCAGGGAATTCAGATCCATCCTGCATCGAAAAATCAGCAGA
+AGGGTTATGTTAGCTCAAACAGGATGTTTGGACGAGTCCAGAAGTACGACTCCTTACTCA
+CTGTGGGAGCTTCTGTAGCCTTCAGCAGAGATGAGTTGCTTGATAGTTATAGGAAATACA
+CCTACTGTTATGGAACGGCTAAAGGATTTGAGAAACGGTTAAAAATGCTCACCACTCGCA
+AGTGCAAACGGCCATATACGCCCAAAGTTGTGGCCAGCAAACTTATGAGGTTAATGCCCT
+GTGGTAGTTTACCTGACTGGCATGAGTTCGAAGATCTCTTGTCACAGGTTAAAACAACAG
+CAGGTGCAAGTGCTGGAGCTCCGTATTTCAAGGAGAAACGCAAGGCATAGAAAGAAAGAA
+ATTTC
+>Locus_2_Transcript_5/5_Confidence_0.000_Length_447
+CTAAATTCTCATCCGGCAATTCCGGTTGATAATACTAAGTATCAGGGAATTCAGATCCAT
+CCTGCATCGAAAAATCAGCAGAAGGGTTATGTTAGCTCAAACAGGATGTTTGGACGAGTC
+CAGAAGTACGACTCCTTACTCACTGTGGGAGCTTCTGTAGCCTTCAGCAGAGATGAGTTG
+CTTGATAGTTATAGGAAATACACCTACTGTTATGGAACGGCTAAAGGATTTGAGAAACGG
+TTAAAAATGCTCACCACTCGCAAGTGCAAACGGCCATATACGCCCAAAGTTGTGGCCAGC
+AAACTTATGAGGTTAATGCCCTGTGGTAGTTTACCTGACTGGCATGAGTTCGAAGATCTC
+TTGTCACAGGTTAAAACAACAGCAGGTGCAAGTGCTGGAGCTCCGTATTTCAAGGAGAAA
+CGCAAGGCATAGAAAGAAAGAAATTTC
+>Locus_3_Transcript_1/5_Confidence_0.125_Length_388
+CCACATAATACAAATAAATTTCAGGCATCGGAAAAATATATAAGGAGATTGCAGCCAGCA
+CCTTGGGGAACCAGCAAAGATCTCAGCTCGTTATGGCCATCGACATTGTCCGGCATCTGA
+CAAATTTTTGGATTTTGCTTCACGGCGATCATCTCTCAATCTCAATTTTGGACCCAATCT
+CGATCGCCATCTTCCCCGGCTGCCAATCCATTTGGTCTGTGGCCAGTAGCTGTGGGGCTT
+GATTGCGTCGATCGGCCTGTGTGGAATTGGAATTGGAAGTGGAGCTCTAGTTAACAGTTG
+AGACCTGGACACCGAATGCGTGTCTCCGCCCCCGGGAACTGCAGAAGCAACAACTGCAGC
+CGCAAACAATTGACAGAGACAAGCGCCT
+>Locus_3_Transcript_2/5_Confidence_0.250_Length_408
+GATGGGAGGAAGGATGCCGGTGATGCGCCTTACGACACCTTAAGGTGTCATAGACACGGT
+GAGGTGGCAATTAGGGCGCACCGTGGGGAACCAGCAAAGATCTCAGCTCGTTATGGCCAT
+CGACATTGTCCGGCATCTGACAAATTTTTGGATTTTGCTTCACGGCGATCATCTCTCAAT
+CTCAATTTTGGACCCAATCTCGATCGCCATCTTCCCCGGCTGCCAATCCATTTGGTCTGT
+GGCCAGTAGCTGTGGGGCTTGATTGCGTCGATCGGCCTGTGTGGAATTGGAATTGGAAGT
+GGAGCTCTAGTTAACAGTTGAGACCTGGACACCGAATGCGTGTCTCCGCCCCCGGGAACT
+GCAGAAGCAACAACTGCAGCCGCAAACAATTGACAGAGACAAGCGCCT
+>Locus_3_Transcript_3/5_Confidence_0.375_Length_130
+TCCCATCGGCGGGGGATGGGAGGAAGGATGCCGGTGATGCGCCTTACGACACCTTAAGGT
+GTCATAGACACGGTGAGGTGGCAATTAGGGCGCACCGTGGGGCACCCTTCACCGTCAACC
+CTTCTTATCC
+>Locus_3_Transcript_4/5_Confidence_0.250_Length_926
+CTGGTTTTCTTAACTCCTTTTACCTCAACCTCAGTCTCCTCAATGAAGAGGGTTGGTAAA
+TATCTCAAGGATATTGTCTGAGAGAGGTCTACAGCGTTTATGGGTAGTGTTTTCTCTAGT
+ATCTTGCTGAATGATTCAAGATCGTATCCCAGTTCCTTTAATGATTTGGGTAAGAACTTT
+CCGTCAACTCCGTGTCTTATGTTTTGCATGTCTTTCAGCCTAGCCAGTTGTCCTTGCCAT
+GTGCCGCTGCTCAGTCGGTAATCGATACAGGCCTGTCTGCAGCGCTTGATAGTGGTATCC
+ATGTCCGTAGGATCAGCTATTCTGTCTCTCTGGACTACATACCCTTTGGCAGTCTCAAAG
+TTCCCTTGTGTTTCTTTACTTGCCAGCCATTGGAAAGCTATAGCATTCAGTAGCTTATCA
+TCATAGGTGCCGGTTGTGAATCTGGGTCGATAGAAGGGAATCTTGGGGTCGCCATCAGGT
+AAATGTATTTTGGTGCAGTCTTCATAATCTTTGGGGTTACCACTTTCAAGTTGTAGTGTG
+CGAATGGTTTGGAGGTATCTTACTATCTGCTCATCTAGGACGGAGCTCGCTTCAAACTCT
+AGGTTTTGGCGTAGATAGTAAGGTTTGAATGCGTGTATTCTGCGTTTGGCGATATACTGG
+GCTATTTCAAGCACTCTTGTCGAATTGACAAGTTTGGTCTCATTCATATTAGGTTGAGGT
+GGTTTCAAGTAACTTTCTGTGATTAAGTCTGTAACTGAAGAATCGTCTTCGCTCTTGATT
+TTGAAAAGCTCGCTAAAGCGGTGCTTTGCACTACCAGTATTAAAGACGTCAGACATAGTT
+CGTTAGAATGGAATGTAGAAGTTCGACAGTTAGCGGGGGGTGTAGAATCATTCCCCCGCC
+GATGGGAGGAAGGATGCCGGTGATGC
+>Locus_3_Transcript_5/5_Confidence_0.250_Length_1016
+CTGGTTTTCTTAACTCCTTTTACCTCAACCTCAGTCTCCTCAATGAAGAGGGTTGGTAAA
+TATCTCAAGGATATTGTCTGAGAGAGGTCTACAGCGTTTATGGGTAGTGTTTTCTCTAGT
+ATCTTGCTGAATGATTCAAGATCGTATCCCAGTTCCTTTAATGATTTGGGTAAGAACTTT
+CCGTCAACTCCGTGTCTTATGTTTTGCATGTCTTTCAGCCTAGCCAGTTGTCCTTGCCAT
+GTGCCGCTGCTCAGTCGGTAATCGATACAGGCCTGTCTGCAGCGCTTGATAGTGGTATCC
+ATGTCCGTAGGATCAGCTATTCTGTCTCTCTGGACTACATACCCTTTGGCAGTCTCAAAG
+TTCCCTTGTGTTTCTTTACTTGCCAGCCATTGGAAAGCTATAGCATTCAGTAGCTTATCA
+TCATAGGTGCCGGTTGTGAATCTGGGTCGATAGAAGGGAATCTTGGGGTCGCCATCAGGT
+AAATGTATTTTGGTGCAGTCTTCATAATCTTTGGGGTTACCACTTTCAAGTTGTAGTGTG
+CGAATGGTTTGGAGGTATCTTACTATCTGCTCATCTAGGACGGAGCTCGCTTCAAACTCT
+AGGTTTTGGCGTAGATAGTAAGGTTTGAATGCGTGTATTCTGCGTTTGGCGATATACTGG
+GCTATTTCAAGCACTCTTGTCGAATTGACAAGTTTGGTCTCATTCATATTAGGTTGAGGT
+GGTTTCAAGTAACTTTCTGTGATTAAGTCTGTAACTGAAGAATCGTCTTCGCTCTTGATT
+TTGAAAAGCTCGCTAAAGCGGTGCTTTGCACTACCAGTATTAAAGACGTCAGACATAGTT
+CGTTAGAATGGAATGTAGAAGTTCGACAGTTAGCGGGGGGTGTAGAATCATTCCCCCGCC
+GATGGGAGGAAGGATGCCGGTGATGCGCCTTACGACACCTTAAGGTGTCATAGACACGGT
+GAGGTGGCAATTAGGGCGCACCGTGGGGCACCCTTCACCGTCAACCCTTCTTATCC
+>Locus_4_Transcript_1/5_Confidence_0.222_Length_234
+TTTGAACTGGGGTTTCTCATTGAAAAAAGATATGATAGTGGCCTATGGTCACTTTGTACT
+AAGAAATGTCCACCATATACGTATGGTCTGAAGTGATTTATTGCCCAGTGAATAGCTGCT
+AGCTCCTGCTCTGTAGTGGACTTATTACTTTCGCCTTTTGTAAAGCTTCTTGAAGCGTAT
+GCCACTGGTAGCTGTTGACCGTTATGGTCTTGAGATAGTGCCGCTCCACATGCC
+>Locus_4_Transcript_2/5_Confidence_0.444_Length_332
+CCTTCCCCTTGAGACATTCTACTGTGAATTCAAACTCCTCCAAGTCTAGTCTCATTCTGG
+TTAATTTTGAACTGGGGTTTCTCATTGAAAAAAGATATGATAGTGGCCTATGGTCACTTT
+GTACTAAGAAATGTCCACCATATACGTATGGTCTGAAGTGATTTATTGCCCAGTGAATAG
+CTGCTAGCTCCTGCTCTGTAGTGGACTTATTACTTTCGCCTTTTGTAAAGCTTCTTGAAG
+CGTATGCCACTGGTAGCTGTTGACCGTTATGGTCCTGAGATAGTACCGCTCCACATGCTT
+GTTTACTAGCATCTGTGGTTATGCAAAATTGT
+>Locus_4_Transcript_3/5_Confidence_0.222_Length_487
+GTCTTTTTCTTTCTCATTTGGTTCATGCAATTTTTCACCTGCGCAGGTATTTTTCTGTCT
+TGTTGTTGATCTTGTTGTTGCCTTTGGTATCTGTCTATTTATTGCTTTAAGTTCTCCGAT
+TGTTATTCGGGACAATGCGTCTGCGACATGATTATCCCTCCCCTTGAGATATTCTACTGT
+GAATTCAAACTCCTCCAAGTCTAGTCTCATTCTGGTTAATTTTGAACTGGGGTTTCTCAT
+TGAAAAAAGATATGATAGTGGCCTATGGTCACTTTGTACTAAGAAATGTCCACCATATAC
+GTATGGTCTGAAGTGATTTATTGCCCAGTGAATAGCTGCTAGCTCCTGCTCTGTAGTGGA
+CTTATTACTTTCGCCTTTTGTAAAGCTTCTTGAAGCGTATGCCACTGGTAGCTGTTGACC
+GTTATGGTCCTGAGATAGTACCGCTCCACATGCTTGTTTACTAGCATCTGTGGTTATGCA
+AAATTGT
+>Locus_4_Transcript_4/5_Confidence_0.333_Length_1170
+GTCTTTTTCTTTCTCATTTGGTTCATGCAATTTTTCACCTGCGCAGGTATTTTTCTGTCT
+TGTTGTTGATCTTGTTGTTGCCTTTGGTATCTGTCTATTTATTGCTTTAAGTTCTCCGAT
+TGTTATTCGGGACAATGCGTCTGCGACATGATTATCCCTCCCCTTGAGATATTCTACTGT
+GAATTCAAACTCCTCCAAGTCTAGTCTCATTCTGGTTAATTTTGAACTGGGGTTTCTCAT
+TGAAAAGAGATGTGAACGCGATTAAGACTCATGGGAATGGTTTTGGCATCATGAAACCTG
+ATAGTAGTTGGGAAATTGCTCCACCTCAACCCAAGGAAAAATACCTCAGATATTACGCAA
+ATGGTGAATTCGTTGATATGAAAAACCTCGTTAACGAGAAACACCCCGTCATCGTTAACG
+ATTATTGTGAATTTGCCCTGGAACATGAAATGTATCGTATTCTCCAACCTATGGACCCTT
+CCAATTTTGCACCTCCACGGGAAACGGGAACAATGCAAGCTGGACCCGGTACTGGAAAAA
+CGACATGGATCCTGAAAGAACACGTGCCTTATTTTGCAGACAATCCGTCCACTGTCATAC
+TCGCGACGGTAGAGGGAAAAGACGACTTCATTGATCGTGTCAATAAAATTTACCCAAAAG
+AAGGCAATCGCGATTTGCAAAAAATATACTATCGCACTCTTGCAAGTTATCTGCTCCACC
+CCGAAAAGAACCGAAAAACCGATAGTATCTTTATTGACGAAGCCTTGATGTCCCATCCAG
+GAGCTGTTTTTTATGCTGTTTGGATGTCTGGTGCGTCAAAAGTTAGATTTCTCGGTGACA
+ACTTGCAAATTCCATTTGTAAACCGTTCTCCGCAGTTCAAGATGAGTTACGATCGTTTGG
+AAAAAATGGTCCCAATTGTCGGTTCACTTTTTATCTCGTACCGCTGTCCTGTCGATGTCG
+TTTATAGGTTTACCGACGACTACCGTGAAGTGAACAAAAAAGCAGGAAAAGATGTAGGTT
+TGATGAGTGCGCGCGACGGTGTTAATACCTGTAGGTTTGTCCGAATATCGACATTGAATG
+AGGTCCCGCTCCGTAAGGAAGTTAAATATCTCGTCTTTACACAAGCCGAAAAAACCGAAC
+TTGCCATGAAGAAATATAATGTCTCGACAG
+>Locus_4_Transcript_5/5_Confidence_0.111_Length_956
+ATCATTTGTCAACAGAATTCTACCATTGAAAAGAGATGTGAACGCGATTAAGACTCATGG
+GAATGGTTTTGGCATCATGAAACCTGATAGTAGTTGGGAAATTGCTCCACCTCAACCCAA
+GGAAAAATACCTCAGATATTACGCAAATGGTGAATTCGTTGATATGAAAAACCTCGTTAA
+CGAGAAACACCCCGTCATCGTTAACGATTATTGTGAATTTGCCCTGGAACATGAAATGTA
+TCGTATTCTCCAACCTATGGACCCTTCCAATTTTGCACCTCCACGGGAAACGGGAACAAT
+GCAAGCTGGACCCGGTACTGGAAAAACGACATGGATCCTGAAAGAACACGTGCCTTATTT
+TGCAGACAATCCGTCCACTGTCATACTCGCGACGGTAGAGGGAAAAGACGACTTCATTGA
+TCGTGTCAATAAAATTTACCCAAAAGAAGGCAATCGCGATTTGCAAAAAATATACTATCG
+CACTCTTGCAAGTTATCTGCTCCACCCCGAAAAGAACCGAAAAACCGATAGTATCTTTAT
+TGACGAAGCCTTGATGTCCCATCCAGGAGCTGTTTTTTATGCTGTTTGGATGTCTGGTGC
+GTCAAAAGTTAGATTTCTCGGTGACAACTTGCAAATTCCATTTGTAAACCGTTCTCCGCA
+GTTCAAGATGAGTTACGATCGTTTGGAAAAAATGGTCCCAATTGTCGGTTCACTTTTTAT
+CTCGTACCGCTGTCCTGTCGATGTCGTTTATAGGTTTACCGACGACTACCGTGAAGTGAA
+CAAAAAAGCAGGAAAAGATGTAGGTTTGATGAGTGCGCGCGACGGTGTTAATACCTGTAG
+GTTTGTCCGAATATCGACATTGAATGAGGTCCCGCTCCGTAAGGAAGTTAAATATCTCGT
+CTTTACACAAGCCGAAAAAACCGAACTTGCCATGAAGAAATATAATGTCTCGACAG
+>Locus_5_Transcript_1/6_Confidence_0.333_Length_630
+CGCCTGCATTAAAGCATTCCCACAGATTTACGGTCTCACTTTCCCCCTTCAAAAGATTGC
+AGGCAACTTCTGCCAAGTGTTCAGCTCCTTTTTAGAGCATCGCAATGGATCTTGGGGCAG
+CTGAGACTTTTCCGGTATTCCACTCGACAGCAACTTTCATGTTCTCGGCAGATGCGCGGC
+AAATGATAACATAAAATGCGTTTTCCATTTCGAGGCATAATTTCGTGGCGCGGGCAAAAC
+CATTTTCCGCATTTTCTCGGCCAATTTTCGTTGCCTCTGCGTGCTGTTCACAACTTGGCG
+GTGAAAGAGGCACTATGAAAGAATCAAAAGCAGTCAACTCCTGTTCAGCAGCAAACAAAC
+AGCAAAGAGGCGGGAAAAACAATATTGTATTTTGCGGAAGGGGAAAGGTACGAGGTCCCC
+CCCGGGCTCCAGAAGTCTGCTGGAGCAATAAAAATAATAATCGAACTGCAGCCGCATTGC
+GTTGGCCGCAAGGTCATTGCCCATTGGCTCTGATCGATTGGGCCAACAAGGTGGGCAAGA
+GGGGCGATTCGAGCCAAGAGAAATGAGAGAGGGCAGAAACTGCCGTTGGTTAGCGATGGT
+AATTTGATAATTGGCAAAACTGTCTGCTCG
+>Locus_5_Transcript_2/6_Confidence_0.333_Length_642
+ACCCACGAAAAGTGCCTGCATTAAAGTATTCCCACAGATTTACGGTCTCACTTTCCCCCT
+TCAAAAGATTGCAGGCAACTTCTGCCAAGTGTTCAGCTCCTTTTTAGAGCATCGCAATGG
+ATCTTGGGGCAGCTGAGACTTTTCCGGTATTCCACTCGACAGCAACTTTCATGTTCTCGG
+CAGATGCGCGGCAAATGATAACATAAAATGCGTTTTCCATTTCGAGGCATAATTTCGTGG
+CGCGGGCAAAACCATTTTCCGCATTTTCTCGGCCAATTTTCGTTGCCTCTGCGTGCTGTT
+CACAACTTGGCGGTGAAAGAGGCACTATGAAAGAATCAAAAGCAGTCAACTCCTGTTCAG
+CAGCAAACAAACAGCAAAGAGGCGGGAAAAACAATATTGTATTTTGCGGAAGGGGAAAGG
+TACGAGGTCCCCCCCGGGCTCCAGAAGTCTGCTGGAGCAATAAAAATAATAATCGAACTG
+CAGCCGCATTGCGTTGGCCGCAAGGTCATTGCCCATTGGCTCTGATCGATTGGGCCAACA
+AGGTGGGCAAGAGGGGCGATTCGAGCCAAGAGAAATGAGAGAGGGCAGAAACTGCCGTTG
+GTTAGCGATGGTAATTTGATAATTGGCAAAACTGTCTGCTCG
+>Locus_5_Transcript_3/6_Confidence_0.222_Length_630
+CGCCTGCATTAAAGCACTCCCACAGATTTACGGTCTCACCTTCCCCCTTCAAAAGATTGC
+AGGCAACTTCTGCCAAGTGTTCAGCTCCTTTTTAGAGCATCGCAATGGATCTTGGGGCAG
+CTGAGACTTTTCCGGTATTCCACTCGACAGCAACTTTCATGTTCTCGGCAGATGCGCGGC
+AAATGATAACATAAAATGCGTTTTCCATTTCGAGGCATAATTTCGTGGCGCGGGCAAAAC
+CATTTTCCGCATTTTCTCGGCCAATTTTCGTTGCCTCTGCGTGCTGTTCACAACTTGGCG
+GTGAAAGAGGCACTATGAAAGAATCAAAAGCAGTCAACTCCTGTTCAGCAGCAAACAAAC
+AGCAAAGAGGCGGGAAAAACAATATTGTATTTTGCGGAAGGGGAAAGGTACGAGGTCCCC
+CCCGGGCTCCAGAAGTCTGCTGGAGCAATAAAAATAATAATCGAACTGCAGCCGCATTGC
+GTTGGCCGCAAGGTCATTGCCCATTGGCTCTGATCGATTGGGCCAACAAGGTGGGCAAGA
+GGGGCGATTCGAGCCAAGAGAAATGAGAGAGGGCAGAAACTGCCGTTGGTTAGCGATGGT
+AATTTGATAATTGGCAAAACTGTCTGCTCG
+>Locus_5_Transcript_4/6_Confidence_0.222_Length_915
+TTCCCCCTTCAAAAGATTGCAGGCAACTTCTGCCAAGTGTTCAGCTCCTTTTTAGAGCAT
+CGCAATGGATCTTGGGGCAGCTGAGACTTTTCCGGTATTCCACTCGACAGCAACTTTCAT
+GTTCTCGGCAGATGCGCGGCAAATGATAACATAAAATGCGTTTTCCATTTCGAGGCATAA
+TTTCGTGGCGCGGGCAAAACCATTTTCCGCATTTTCTCGGCCAATTTTCGTTGCCTCTGC
+GTGCTGTTCACAACTTGGCGGTGAAAGAGGCACTATGAAAGAATCAAAAGCAGTCAACTC
+CTGTTCAGCAGCAAACAAACAGCAAAGAGGCGGGAAAAACAATATTGTATTTTGCGGAAG
+GGGAAAGGTACGAGGTCCCCCCCGGGCTCCAGAAGTCTGCTGGAGCAATAAAAATAATAA
+TCGAACTGCAGCCGCATTGCGTTGGCCGCAAGGTCATTGCCCATTGGCTCTGATCGATTG
+GGCCAACAAGGTGGGCAAGAGGGGCGATTCGAGCCAAGAGAAATGAGAGAGGGCAGAAAC
+TGCCGTTGGTTAGCGATGGTAATTTGATAATTGGCAAAACTGTCTGCTCGAGAGTTGCAT
+AACATAGGGTTAAGAGTGGACCAGTTCAAATTACTGAAGCACAGTGTAAGTCTAAAGATT
+AATCCCTAATCAAAGATCCATTCTTACACTGAAGTTTGGTTAAGATTGAAGCTATAGCTT
+GAGCGGAGTTAAGCCATCTTCAAGGAAACTTCTTCTTACGAATCGCAGCGATCCCTAAAC
+CTATTTCGAGTTGACCCCAATTTCCAGACCTCCAATGGTTATTACGGTTAACCAGAGATT
+ACCCAACCGACTAACCGACTAACATTTGCCACTTCATTGCCCTGCCACCTTCCGCCGAAC
+GCCGAACGCCGAACG
+>Locus_5_Transcript_5/6_Confidence_0.222_Length_353
+CCTGATAATTGGCAAAACTGTCTGCTCGAGAGTTGCATAACATAGGGTTAAGAGTGGACC
+AGTTCAAATTACTGAAGCACAGTGTAAGTCTAAAGATTAATCCCTAATCAAAGATCCATT
+CTTACACTGAAGTTTGGTTAAGATTGAAGCTATAGCTTGAGCGGAGTTAAGCCATCTTCA
+AGGAAACTTCTTCTTACGAATCGCAGCGATCCCTAAACCTATTTCGAGTTGACCCCAATT
+TCCAGACCTCCAATGGTTATTACGGTTAACCAGAGATTACCCAACCGACTAACCGACTAA
+CATTTGCCACTTCATTGCCCTGCCACCTTCCGCCGAACGCCGAACGCCGAACG
+>Locus_5_Transcript_6/6_Confidence_0.111_Length_262
+AGGGATTAATCCCTAATCAAAGATCCATTCTTACACTGAAGTTTGGTTAAGATTGAAGCT
+ATAGCTTGAGCGGAGTTAAGCCATCTTCAAGGAAACTTCTTCTTACGAATCGCAGCGATC
+CCTAAACCTATTTCGAGTTGACCCCAATTTCCAGACCTCCAATGGTTATTACGGTTAACC
+AGAGATTACCCAACCGACTAACCGACTAACATTTGCCACTTCATTGCCCTGCCACCTTCC
+GCCGAACGCCGAACGCCGAACG
+>Locus_6_Transcript_1/3_Confidence_0.400_Length_598
+AAATGCGCAGTCTGCTCCAATATCTTATGGTTTGAAACAAAACAAAAGCAGTATACCATC
+GACTATATATTAAGTAGATAAAACTATTTTCCAGTGAGAGATTGTGCTTCATTAACACTC
+GCCGCTCGTTCGCCTGAGTTTCCTTTTGTTTGCCGCAGTTTTTGACACCAAACTTGGCGT
+CACTTCAAAGCCCTGGCGATTAATCTTGAGTGCTGGTGGGGAAGGAGTGGGGCTTCTCCA
+GTGCCAGATCTTCCAGATCCGGTCGTGTCTGCAATTTGCAGGCATTTTGTTTTGCATTAT
+CCAAGATTCTGTGCTGGCGCAAACAACAAGCAACTCATCTGCCACTTTTCACACCCTTGA
+AGCGGAGTTTTCACTTCTCTTTGGGTGAGCTTTAGCCGCAAATGGAGGAGCCGCCTCATA
+AATCATCGCCCAGGCCACCGGTGGGCGTCGTCCAACGTCCAATGCTAGAAGTGTGCGCAG
+GCGCAGCTGCTGCTCACCCCCTCCTCCCCTTAATTTCCCCAACTCATTGTCAGCTGCAAA
+GGTGCCAAAGAAGTGTACAAACTTCGCGACTGATTTGGGGGGATTTGGCCAGCCGTAC
+>Locus_6_Transcript_2/3_Confidence_0.400_Length_523
+TGGATAAAACTATTTTCCAGTGAGAGATTGTGCTTCATTAACACTCGCCGCTCGTTCGCC
+TGAGTTTCCTTTTGTTTGCCGCAGTTTTTGACACCAAACTTGGCGTCACTTCAAAGCCCT
+GGCGATTAATCTTGAGTGCTGGTGGGGAAGGAGTGGGGCTTCTCCAGTGCCAGATCTTCC
+AGATCCGGTCGTGTCTGCAATTTGCAGGCATTTTGTTTTGCATTATCCAAGATTCTGTGC
+TGGCGCAAACAACAAGCAACTCATCTGCCACTTTTCACACCCTTGAAGCGGAGTTTTCAC
+TTCTCTTTGGGTGAGCTTTAGCCGCAAATGGAGGAGCCGCCTCATAAATCATCGCCCAGG
+CCACCGGTGGGCGTCGTCCAACGTCCAATGCTAGAAGTGTGCGCAGGCGCAGCTGCTGCT
+CACCCCCTCCTCCCCTTAATTTCCCCAACTCATTGTCAGCTGCAAAGGTGCCAAAGAAGT
+GTACAAACTTCGCGACTGATTTGGGGGGATTTGGCCAGCCGTA
+>Locus_6_Transcript_3/3_Confidence_0.000_Length_643
+GATAAAACTATTTTCCAGTGAGAGATTGTGCTTCATTAACACTCGCCGCTCGTTCGCCTG
+AGTTTCCTTTTGTTTGCCGCAGTTTTTGACACCAAACTTGGCGTCACTTCAAAGCCCTGG
+CGATTAATCTTGAGTGCTGGTGGGGAAGGAGTGGGGCTTCTCCAGTGCCAGATCTTCCAG
+ATCCGGTCGTGTCTGCAATTTGCAGGCATTTTGTTTTGCATTATCCAAGATTCTGTGCTG
+GCGCAAACAACAAGCAACTCATCTGCCACTTTTCACACCCTTGAAGCGGAGTTTTCACTT
+CTCTTTGGGTGAGCTTTAGCCGCAAATGGAGGAGCCGCCTCATAAATCATCGCCCAGGCC
+ACCGGTGGGCGTCGTCCAACGTCCAATGCTAGAAGTGTGCGCAGGCGCAGCTGCTGCTCA
+CCCCCTCCTCCCCTTAATTTCCCCAACTCATTGTCAGCTGCAAAGGTGCCAAAGAAGTGT
+ACAAACTTCGCGACTGATTTGGGGGGATTTGGCCAGCCGTATATCTATCTGTTCATATTG
+TTTGCCAGATTGCCAACCGATTGTGGAGCACTGGGTCAAGCCAGTCAGTCAGTCGCTCAG
+TCGGTGAATTGAAGTGTGAAATTCTAAGGAAATTGCTTTATTG
+>Locus_7_Transcript_1/11_Confidence_0.154_Length_1632
+TGCGATATTAGAGAAGATCCTACTCTAATATCATACGGATTCCATGGATCAGACGAGGAA
+GACCCATACAGCCGATGAAGATGACAACTGAAAGGAAAACAAGAGGATACAGGTGCTTCG
+CTTTGTTCGTGAGACGGCAAAGATTTGAACCTTTTTAGAAACAATTTAAATATGCTGAAC
+AACTATCACAATAACTTTAACAGTCCTAGCCTGGCTATGATGGACGATGACAAAGCTTGT
+GTTGATGATGGTTGTAAGCTAACAAAGTGGTGATGAGTTGGTGATACCCTCACTTTGGTA
+TTTAATTGTAGACAAGATGGAACATTAGCATCCGAGGTCACTACGTTCCGGAAAGAAACT
+CAAATACAACAGGAACTGATGGGAGAATATCTGACGAAAAATGGAAAACGGGACAGGATT
+GACAAAATGAAAGGATTTTGACAGCTCGGAACAGACGGCAAAATGGAACAAAAGTATGAA
+ACAAGAAACACGTGTTCCTCAGTCTCACATTGAATATCCAGATATCGAGATGCACCTCAT
+ATCTGAGAATAAACAACTACAACCAGTAGAAGGTGTCAAACCAAATCCCGGACCATCAAT
+AATTGAGCCAAATCATGGACCAAGCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCA
+ACGACAGCTGGCAAAACAAGACCAAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCT
+ACTGGACGATCTGACCGAATTAAAGACTACGGTACAACCACAGATTGACAATTCGGGATT
+CTTGGCTCATGTTGATCATGCAGCTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGT
+GATGAAATACATTCTCACGAATTCTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTAC
+TGATATACCCGACGAGCCAGTAGAGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAA
+AGAGAAAAAAGAAGAAAAAAAAGATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACG
+AGAATCGATGGCAATGCCAGCCAGTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGA
+AATTGAAAGGAAAAACGTCATCAGGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTA
+CAAGCTTGTACTATGGTTAGACAAACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGA
+TGAGCTTTGGGGAAGTGGTTGGCAGGAACGAAATAAGATGAACCAGTATGAATGGTTGTC
+TTACTGCTGGGCAAATAATGTCACTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGA
+CATCAAATGGCAACAACTACCTGCTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGC
+TGATCTTGAAGCTCAAAAAACTCACAATAAAGTGATGCATGCATACAACGGTAACCCTTT
+GTGTCAGGGATTTCAAGAAGTTGAAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAG
+TAATTCAGTTCTGAAACCATATACTGGACTGGAAGCTGAGAAATACATCACCAACATTGT
+AGGAGACATGAATCCGAATCAATCAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCA
+ATACAATGCCAA
+>Locus_7_Transcript_2/11_Confidence_0.077_Length_1069
+CAGTAGAAGGTGTCGAACCAAATCCCGGACCATCAATAATTGAGCCAAATCATGGACCAA
+GCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCAACGACAGCTGGCAAAACAAGACC
+AAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCTACTGGACGATCTGACCGAATTAA
+AGACTACGGTACAACCACAGATTGACAATTCGGGATTCTTGGCTCATGTTGATCATGCAG
+CTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGTGATGAAATACATTCTCACGAATT
+CTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTACTGATATACCCGACGAGCCAGTAG
+AGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAAAGAGAAAAAAGAAGAAAAAAAAG
+ATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACGAGAATCGATGGCAATGCCAGCCA
+GTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGAAATTGAAAGGAAAAACGTCATCA
+GGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTACAAGCTTGTACTATGGTTAGACA
+AACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGATGAGCTTTGGGGAAGTGGTTGGC
+AGGAACGAAATAAGATGAACCAGTATGAATGGTTGTCTTACTGCTGGGCAAATAATGTCA
+CTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGACATCAAATGGCAACAACTACCTG
+CTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGCTGATCTTGAAGCTCAAAAAACTC
+ACAATAAAGTGATGCATGCATACAACGGTAACCCTTTGTGTCAGGGATTTCAAGAAGTTG
+AAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAGTAATTCAGTTCTGAAACCATATA
+CTGGACTGGAAGCTGAGAAATACATCACCAACATTGTAGGAGACATGAATCCGAATCAAT
+CAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCAATACAATGCCAA
+>Locus_7_Transcript_3/11_Confidence_0.154_Length_1743
+CCTTAGAGGTAACCAATACAATGCCAATGGGGCTGTGGTTCATAATGCTGTATCAACTAT
+TCCGTTTACAAACCTCATTCCTAGGACGATTCGATCTGATGATGACGTCCTTGAGAAGTC
+GGCCAACAGATTACAGGTTACAGAGACAAACGTTACGGATTACTACGTTAATCCGATTGA
+GCCAACTGAATTATCCAAAACAATAAGTGACCAGATCAAAAACAATCAATCATCTAACTG
+GCGACGAGATAACACGTCATTGGCTGGTTTCAATAGTTTCGACATTGCGACAGTCAACAC
+TGCACTAATTGCAAGAGGTCTAAGCACTGAATCAATGACTCTCAAGTTAGAGCTATTGCA
+CGGAATAATGGCTATGCAGGTTGAAGCACCAATGATCAATTCCAGCACTTATTCGATCGT
+AGATAATCATACAATCCCGACCGTAACTGACAGGGCCGTCATAGGCATCAATGACTCGCC
+TGTGTTTGGCGAGGACTGTGGTGGTGATCTTCCTGAATATCCTTTCGGCGGCGGAACCGG
+TACAATTGCCTTTCACCTAACATTGCAAACTGTTCCTGAAGAGAGGAGAGATAAGGCAAT
+CTTCTGCCCTCCTGGTTTGTTGCAAGCAGCCCGAGATGGAGCAGAGGCATTGGCCCTATT
+TGTTTTGTCGATGTCTGAATGGCCTTTCGGTATTTATACTGTCACCAAGAGAACAACCGA
+TGAGAAGGGACTGAATCCTGCGGATCAGGTTTACGTGCCGATGGAGACCATAACCCGTGT
+AGGTGGAGATAGAGTATTGGACGTTGTACTTCCTCGAAGGTATGCGGTTGCAAATCCAAC
+GACTCAAGGAAATGCTAATGCTCTAGCAGTTATACAGCCTCAAGCTGGGCCTTTAGATAA
+CGGTGCGGACGGATTAGCCGCTGGTGAATTATTGGATGTCAATTTCATCGGCGCCGACGG
+CATTACTGAATATCCATTGACATATTACTTGTATACCTGGGCACTTCGATTTGATATAAC
+GACGATTAGGCAATACATTGGTAGAATGGCAGCGTTAATTGGAGTGAAACACCAACTATG
+GGCTAGTCATGAAATCAGAGTAGCTTTGTGTCAAGTTGCACCCAAAATGGTGGTCGGAGT
+TACAGGTTCGGGAGACCTGCCAAGAGGATCAGCCGCTGCAAGCGAGGTATGTTACTCAAG
+CTTATTGGAGGTCTCACGCTCTGAAGAAGATTTTCCGCTGCTTGGTCAGGTTCAAGCCGA
+TTTCAGAGTCTTTGAAACCAATACAAGCACATGGAATAAAGTAGTTTTGGGATTGGCAAC
+AGCACCAAACGTGACAAGTGAACAAAACATGCATGTACCATTCGTTGTTGGCGATCCGAG
+ATCTAACGCGTGGGACCGACTCGAAGCAGTACCAATTGCTGCTGCTTGGCAGATGTACTA
+CCATTCAAGGGGCGTAACTACTGCCGCTTGGAATGATGCGTACACTAACGTAAATAACGT
+TTGGTTGCAAAAGATGGCCCGTGATAGCTTCTCAACGACCCAAAGCACTGGGACGATACT
+GCCTGCCAGATATGGTAAGATAGTCAAAAACCTGATGAGAAACATGTTTGAAAGAGAACC
+TGCCAAAGTAGTAACAAGCGTGGGAGGCGATGAATATGAGATAACCCATTTTGAGCGCTG
+GTTACCGGGTAATAGATATGCTTCCGTGTTTGAACAAGATGAAACTGAAGTTAATCTGTT
+TCC
+>Locus_7_Transcript_4/11_Confidence_0.154_Length_571
+CAGGATGAAACTGAAGTTAATCTGTTTCCTCCAACTTTATTACCGGATATTTGGGTTCAA
+TATCCAGCGACTCACACCCCAATCATGTGTGCTTCGTTCCCACCCGTTTTCGGCCAAGAC
+TCAACACAAGGGTTCGGCAAAGAATCACAACTTATACCCTTTCGAAACGCAAACAACAAT
+CTTGTAGCACCATACGTTGAAGCTTTCGTTGCCAATCAAGCTTATTTCCCGATAGGATCG
+GGCCCAAACATCAACGACAAGGTTCTGTGGAATAGTAGATTGTGGATGACAAGTGGTTTC
+GTTCAGTACTTGGATTACGCTGGCAACGCAATCAACGAAGTGGTTCCTGCAGCAGGGCTA
+CCTTTGGGTAGGTCAATCCCATTACTGCCAGGGGAAGTTCAGCCGGTTGGTAACACCAAC
+ATGAGCACAAGCTGCGTTCCTCGTTATTCTGTGGACGGTCGCCGAATTTTTACTTATGTC
+AACACAGCTCAATCCGTTCCTTTGATACAAGCGTGTAATAGAGCCAATAGATTGGCCAGA
+TCGGCATGGCTATTATTGCATGTCTACATCG
+>Locus_7_Transcript_5/11_Confidence_0.308_Length_4519
+TGCGATATTAGAGAAGATCCTACTCTAATATCATACGGATTCCATGGATCAGACGAGGAA
+GACCCATACAGCCGATGAAGATGACAACTGAAAGGAAAACAAGAGGATACAGGTGCTTCG
+CTTTGTTCGTGAGACGGCAAAGATTTGAACCTTTTTAGAAACAATTTAAATATGCTGAAC
+AACTATCACAATAACTTTAACAGTCCTAGCCTGGCTATGATGGACGATGACAAAGCTTGT
+GTTGATGATGGTTGTAAGCTAACAAAGTGGTGATGAGTTGGTGATACCCTCACTTTGGTA
+TTTAATTGTAGACAAGATGGAACATTAGCATCCGAGGTCACTACGTTCCGGAAAGAAACT
+CAAATACAACAGGAACTGATGGGAGAATATCTGACGAAAAATGGAAAACGGGACAGGATT
+GACAAAATGAAAGGATTTTGACAGCTCGGAACAGACGGCAAAATGGAACAAAAGTATGAA
+ACAAGAAACACGTGTTCCTCAGTCTCACATTGAATATCCAGATATCGAGATGCACCTCAT
+ATCTGAGAATAAACAACTACAACCAGTAGAAGGTGTCAAACCAAATCCCGGACCATCAAT
+AATTGAGCCAAATCATGGACCAAGCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCA
+ACGACAGCTGGCAAAACAAGACCAAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCT
+ACTGGACGATCTGACCGAATTAAAGACTACGGTACAACCACAGATTGACAATTCGGGATT
+CTTGGCTCATGTTGATCATGCAGCTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGT
+GATGAAATACATTCTCACGAATTCTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTAC
+TGATATACCCGACGAGCCAGTAGAGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAA
+AGAGAAAAAAGAAGAAAAAAAAGATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACG
+AGAATCGATGGCAATGCCAGCCAGTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGA
+AATTGAAAGGAAAAACGTCATCAGGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTA
+CAAGCTTGTACTATGGTTAGACAAACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGA
+TGAGCTTTGGGGAAGTGGTTGGCAGGAACGAAATAAGATGAACCAGTATGAATGGTTGTC
+TTACTGCTGGGCAAATAATGTCACTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGA
+CATCAAATGGCAACAACTACCTGCTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGC
+TGATCTTGAAGCTCAAAAAACTCACAATAAAGTGATGCATGCATACAACGGTAACCCTTT
+GTGTCAGGGATTTCAAGAAGTTGAAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAG
+TAATTCAGTTCTGAAACCATATACTGGACTGGAAGCTGAGAAATACATCACCAACATTGT
+AGGAGACATGAATCCGAATCAATCAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCA
+ATACAATGCCAATGGGGCTGTGGTTCATAATGCTGTATCAACTATTCCGTTTACAAACCT
+CATTCCTAGGACGATTCGATCTGATGATGACGTCCTTGAGAAGTCGGCCAACAGATTACA
+GGTTACAGAGACAAACGTTACGGATTACTACGTTAATCCGATTGAGCCAACTGAATTATC
+CAAAACAATAAGTGACCAGATCAAAAACAATCAATCATCTAACTGGCGACGAGATAACAC
+GTCATTGGCTGGTTTCAATAGTTTCGACATTGCGACAGTCAACACTGCACTAATTGCAAG
+AGGTCTAAGCACTGAATCAATGACTCTCAAGTTAGAGCTATTGCACGGAATAATGGCTAT
+GCAGGTTGAAGCACCAATGATCAATTCCAGCACTTATTCGATCGTAGATAATCATACAAT
+CCCGACCGTAACTGACAGGGCCGTCATAGGCATCAATGACTCGCCTGTGTTTGGCGAGGA
+CTGTGGTGGTGATCTTCCTGAATATCCTTTCGGCGGCGGAACCGGTACAATTGCCTTTCA
+CCTAACATTGCAAACTGTTCCTGAAGAGAGGAGAGATAAGGCAATCTTCTGCCCTCCTGG
+TTTGTTGCAAGCAGCCCGAGATGGAGCAGAGGCATTGGCCCTATTTGTTTTGTCGATGTC
+TGAATGGCCTTTCGGTATTTATACTGTCACCAAGAGAACAACCGATGAGAAGGGACTGAA
+TCCTGCGGATCAGGTTTACGTGCCGATGGAGACCATAACCCGTGTAGGTGGAGATAGAGT
+ATTGGACGTTGTACTTCCTCGAAGGTATGCGGTTGCAAATCCAACGACTCAAGGAAATGC
+TAATGCTCTAGCAGTTATACAGCCTCAAGCTGGGCCTTTAGATAACGGTGCGGACGGATT
+AGCCGCTGGTGAATTATTGGATGTCAATTTCATCGGCGCCGACGGCATTACTGAATATCC
+ATTGACATATTACTTGTATACCTGGGCACTTCGATTTGATATAACGACGATTAGGCAATA
+CATTGGTAGAATGGCAGCGTTAATTGGAGTGAAACACCAACTATGGGCTAGTCATGAAAT
+CAGAGTAGCTTTGTGTCAAGTTGCACCCAAAATGGTGGTCGGAGTTACAGGTTCGGGAGA
+CCTGCCAAGAGGATCAGCCGCTGCAAGCGAGGTATGTTACTCAAGCTTATTGGAGGTCTC
+ACGCTCTGAAGAAGATTTTCCGCTGCTTGGTCAGGTTCAAGCCGATTTCAGAGTCTTTGA
+AACCAATACAAGCACATGGAATAAAGTAGTTTTGGGATTGGCAACAGCACCAAACGTGAC
+AAGTGAACAAAACATGCATGTACCATTCGTTGTTGGCGATCCGAGATCTAACGCGTGGGA
+CCGACTCGAAGCAGTACCAATTGCTGCTGCTTGGCAGATGTACTACCATTCAAGGGGCGT
+AACTACTGCCGCTTGGAATGATGCGTACACTAACGTAAATAACGTTTGGTTGCAAAAGAT
+GGCCCGTGATAGCTTCTCAACGACCCAAAGCACTGGGACGATACTGCCTGCCAGATATGG
+TAAGATAGTCAAAAACCTGATGAGAAACATGTTTGAAAGAGAACCTGCCAAAGTAGTAAC
+AAGCGTGGGAGGCGATGAATATGAGATAACCCATTTTGAGCGCTGGTTACCGGGTAATAG
+ATATGCTTCCGTGTTTGAACAAGATGAAACTGAAGTTAATCTGTTTCCTCCAACTTTATT
+ACCGGATATTTGGGTTCAATATCCAGCGACTCACACCCCAATCATGTGTGCTTCGTTCCC
+ACCCGTTTTCGGCCAAGACTCAACACAAGGGTTCGGCAAAGAATCACAACTTATACCCTT
+TCGAAACGCAAACAACAATCTTGTAGCACCATACGTTGAAGCTTTCGTTGCCAATCAAGC
+TTATTTCCCGATAGGATCGGGCCCAAACATCAACGACAAGGTTCTGTGGAATAGTAGATT
+GTGGATGACAAGTGGTTTCGTTCAGTACTTGGATTACGCTGGCAACGCAATCAACGAAGT
+GGTTCCTGCAGCAGGGCTACCTTTGGGTAGGTCAATCCCATTACTGCCAGGGGAAGTTCA
+GCCGGTTGGTAACACCAACATGAGCACAAGCTGCGTTCCTCGTTATTCTGTGGACGGTCG
+CCGAATTTTTACTTATGTCAACACAGCTCAATCCGTTCCTTTGATACAAGCGTGTAATAG
+AGCCAATAGATTGGCCAGATCGGCATGGCTATTATTGCATGTCTACATCGAACCAGAGTT
+GCAGCTATTGAGCGATGAAGTGGTGGACATATTCGACCAACTGACAAGCAAGACTTTTTT
+AGATGTAGCAAAATCGGCTGCGGACAGTGCGGAGGGCAACATTCCGGCAACGAAGGTATT
+GACAGACCTCCAGGCAGTGGATTCAGCAACGCTGCCGAGTACTTTGGATCCATCCACAAA
+TATGCTCCAACCAGCTCCTTTACTCGGCGAACCTACGACAAATTAACTCGATACATTCAT
+GATGGGGTAAGTCGAAGTAGTCAGAGAGAAATTTCATCATTGTCGGATGATTTAGTTAGA
+TTTAGTACTCTCACAGATTTTACTGTCATCGATTTTATTACTAAGAAATTAGATTTAGAA
+CGTCCGATTAGTACTCAAGGAGATTTATTGGCGTTAGAACCTAGATGCAAGGGTGACCTC
+GCTGTAGCAAGACTTAAGATTAAGGACATAATAGGTAGGATTGATAAGGATATTAGAACG
+TGGTGTGAAGCAAATTTATGCCATTTGGATGCAATCTTGGTAACGAACTTGATAATCTGG
+GGACAAATCTGGGGGTTGGAAATTCTGAAAGCTTTACATTCAACAGGAATATTAAACGAT
+TTCGATACTTTCGCAACAA
+>Locus_7_Transcript_6/11_Confidence_0.154_Length_656
+TATGGCTATTATTGCATGTCTACATCGAACCAGAGTTGCAGCTATTGAGCGATGAAGTGG
+TGGACATATTCGACCAACTGACAAGCAAGACTTTTTTAGATGTAGCAAAATCGGCTGCGG
+ACAGTGCGGAGGGCAACATTCCGGCAACGAAGGTATTGACAGACCTCCAGGCAGTGGATT
+CAGCAACGCTGCCGAGTACTTTGGATCCATCCACAAATATGCTCCAACCAGCTCCTTTAC
+TCGGCGAACCTACGACAAATTAACTCGATACATTCATGATGGGGTAAGTCGAAGTAGTCA
+GAGAGAAATTTCATCATTGTCGGATGATTTAGTTAGATTTAGTACTCTCACAGATTTTAC
+TGTCATCGATTTTATTACTAAGAAATTAGATTTAGAACGTCCGATTAGTACTCAAGGAGA
+TTTATTGGCGTTAGAACCTAGATGCAAGGGTGACCTCGCTGTAGCAAGACTTAAGATTAA
+GGACATAATAGGTAGGATTGATAAGGATATTAGAACGTGGTGTGAAGCAAATTTATGCCA
+TTTGGATGCAATCTTGGTAACGAACTTGATAATCTGGGGACAAATCTGGGGGTTGGAAAT
+TCTGAAAGCTTTACATTCAACAGGAATATTAAACGATTTCGATACTTTCGCAACAA
+>Locus_7_Transcript_7/11_Confidence_0.462_Length_4481
+CAGTAGAAGGTGTCGAACCAAATCCCGGACCATCAATAATTGAGCCAAATCATGGACCAA
+GCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCAACGACAGCTGGCAAAACAAGACC
+AAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCTACTGGACGATCTGACCGAATTAA
+AGACTACGGTACAACCACAGATTGACAATTCGGGATTCTTGGCTCATGTTGATCATGCAG
+CTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGTGATGAAATACATTCTCACGAATT
+CTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTACTGATATACCCGACGAGCCAGTAG
+AGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAAAGAGAAAAAAGAAGAAAAAAAAG
+ATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACGAGAATCGATGGCAATGCCAGCCA
+GTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGAAATTGAAAGGAAAAACGTCATCA
+GGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTACAAGCTTGTACTATGGTTAGACA
+AACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGATGAGCTTTGGGGAAGTGGTTGGC
+AGGAACGAAATAAGATGAACCAGTATGAATGGTTGTCTTACTGCTGGGCAAATAATGTCA
+CTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGACATCAAATGGCAACAACTACCTG
+CTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGCTGATCTTGAAGCTCAAAAAACTC
+ACAATAAAGTGATGCATGCATACAACGGTAACCCTTTGTGTCAGGGATTTCAAGAAGTTG
+AAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAGTAATTCAGTTCTGAAACCATATA
+CTGGACTGGAAGCTGAGAAATACATCACCAACATTGTAGGAGACATGAATCCGAATCAAT
+CAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCAATACAATGCCAATGGGGCTGTGG
+TTCATAATGCTGTATCAACTATTCCGTTTACAAACCTCATTCCTAGGACGATTCGATCTG
+ATGATGACGTCCTTGAGAAGTCGGCCAACAGATTACAGGTTACAGAGACAAACGTTACGG
+ATTACTACGTTAATCCGATTGAGCCAACTGAATTATCCAAAACAATAAGTGACCAGATCA
+AAAACAATCAATCATCTAACTGGCGACGAGATAACACGTCATTGGCTGGTTTCAATAGTT
+TCGACATTGCGACAGTCAACACTGCACTAATTGCAAGAGGTCTAAGCACTGAATCAATGA
+CTCTCAAGTTAGAGCTATTGCACGGAATAATGGCTATGCAGGTTGAAGCACCAATGATCA
+ATTCCAGCACTTATTCGATCGTAGATAATCATACAATCCCGACCGTAACTGACAGGGCCG
+TCATAGGCATCAATGACTCGCCTGTGTTTGGCGAGGACTGTGGTGGTGATCTTCCTGAAT
+ATCCTTTCGGCGGCGGAACCGGTACAATTGCCTTTCACCTAACATTGCAAACTGTTCCTG
+AAGAGAGGAGAGATAAGGCAATCTTCTGCCCTCCTGGTTTGTTGCAAGCAGCCCGAGATG
+GAGCAGAGGCATTGGCCCTATTTGTTTTGTCGATGTCTGAATGGCCTTTCGGTATTTATA
+CTGTCACCAAGAGAACAACCGATGAGAAGGGACTGAATCCTGCGGATCAGGTTTACGTGC
+CGATGGAGACCATAACCCGTGTAGGTGGAGATAGAGTATTGGACGTTGTACTTCCTCGAA
+GGTATGCGGTTGCAAATCCAACGACTCAAGGAAATGCTAATGCTCTAGCAGTTATACAGC
+CTCAAGCTGGGCCTTTAGATAACGGTGCGGACGGATTAGCCGCTGGTGAATTATTGGATG
+TCAATTTCATCGGCGCCGACGGCATTACTGAATATCCATTGACATATTACTTGTATACCT
+GGGCACTTCGATTTGATATAACGACGATTAGGCAATACATTGGTAGAATGGCAGCGTTAA
+TTGGAGTGAAACACCAACTATGGGCTAGTCATGAAATCAGAGTAGCTTTGTGTCAAGTTG
+CACCCAAAATGGTGGTCGGAGTTACAGGTTCGGGAGACCTGCCAAGAGGATCAGCCGCTG
+CAAGCGAGGTATGTTACTCAAGCTTATTGGAGGTCTCACGCTCTGAAGAAGATTTTCCGC
+TGCTTGGTCAGGTTCAAGCCGATTTCAGAGTCTTTGAAACCAATACAAGCACATGGAATA
+AAGTAGTTTTGGGATTGGCAACAGCACCAAACGTGACAAGTGAACAAAACATGCATGTAC
+CATTCGTTGTTGGCGATCCGAGATCTAACGCGTGGGACCGACTCGAAGCAGTACCAATTG
+CTGCTGCTTGGCAGATGTACTACCATTCAAGGGGCGTAACTACTGCCGCTTGGAATGATG
+CGTACACTAACGTAAATAACGTTTGGTTGCAAAAGATGGCCCGTGATAGCTTCTCAACGA
+CCCAAAGCACTGGGACGATACTGCCTGCCAGATATGGTAAGATAGTCAAAAACCTGATGA
+GAAACATGTTTGAAAGAGAACCTGCCAAAGTAGTAACAAGCGTGGGAGGCGATGAATATG
+AGATAACCCATTTTGAGCGCTGGTTACCGGGTAATAGATATGCTTCCGTGTTTGAACAAG
+ATGAAACTGAAGTTAATCTGTTTCCTCCAACTTTATTACCGGATATTTGGGTTCAATATC
+CAGCGACTCACACCCCAATCATGTGTGCTTCGTTCCCACCCGTTTTCGGCCAAGACTCAA
+CACAAGGGTTCGGCAAAGAATCACAACTTATACCCTTTCGAAACGCAAACAACAATCTTG
+TAGCACCATACGTTGAAGCTTTCGTTGCCAATCAAGCTTATTTCCCGATAGGATCGGGCC
+CAAACATCAACGACAAGGTTCTGTGGAATAGTAGATTGTGGATGACAAGTGGTTTCGTTC
+AGTACTTGGATTACGCTGGCAACGCAATCAACGAAGTGGTTCCTGCAGCAGGGCTACCTT
+TGGGTAGGTCAATCCCATTACTGCCAGGGGAAGTTCAGCCGGTTGGTAACACCAACATGA
+GCACAAGCTGCGTTCCTCGTTATTCTGTGGACGGTCGCCGAATTTTTACTTATGTCAACA
+CAGCTCAATCCGTTCCTTTGATACAAGCGTGTAATAGAGCCAATAGATTGGCCAGATCGG
+CATGGCTATTATTGCATGTCTACATCGAACCAGAGTTGCAGCTATTGAGCGATGAAGTGG
+TGGACATATTCGACCAACTGACAAGCAAGACTTTTTTAGATGTAGCAAAATCGGCTGCGG
+ACAGTGCGGAGGGCAACATTCCGGCAACGAAGGTATTGACAGACCTCCAGGCAGTGGATT
+CAGCAACGCTGCCGAGTACTTTGGATCCATCCACAAATATGCTCCAACCAGCTCCTTTAC
+TCGGCGAACCTACGACAAATTAACTCGATACATTCATGATGGGGTAAGTCGAAGTAGTCA
+GAGAGAAATTTCATCATTGTCGGATGATTTAGTTAGATTTAGTACTCTCACAGATTTTAC
+TGTCATCGATTTTATTACTAAGAAATTAGATTTAGAACGTCCGATTAGTACTCAAGGAGA
+TTTATTGGCGTTAGAACCTAGATGCAAGGGTGACCTCGCTGTAGCAAGACTTAAGATTAA
+GGACATAATAGGTAGGATTGATAAGGATATTAGAACGTGGTGTGAAGCAAATTTATGCCA
+TTTGGATGCAATCTTGGTAACGAACTTGATAATCTGGGGACAAATCTGGGGGTTGGAAAT
+TCTGAAAGCTTTACATTCAACAGGAATATTAAACGATTTCGATACTTTCGCAACAAAAGG
+AAGCAAGATTAGTGCATTTGTCAAGCGTTTTCCCTTCGACAAGGATGATGCCAAAGCTAG
+ATGGGCAGAGATCAACACGCTGACGGGCTATTTGCAGAATGATTTTGGAAACTTCGATTA
+CGATAAGGAATTTGAAGCTTTAGCTACCGGAGATAGTAACCACCCCGCTTGGTGGGAAGA
+AGTATTCACTAAGAAAATAAAAGAGTTGATGACACATCAAGAACACAAAAAGTATATCAG
+TTTTGAAAAATATGTTAAGGAAGGATATTGGATAACATCTGGCAGCAGCAGCATCGGCAA
+AGTCAATTGGTCATATGACGGAGACTTGGGCAAATTTAAGGCTAGAAAGAACATGTTATT
+AGATCTATATACGCCGGACGAAATCTACAAAATGGCTGTAGAATGGGACGGGAAACTAGA
+GAATAGAGTGTTCATCAAAGATGAATTGGCAAAGAGAAGATTGGCAGTGGCAAGCAATAT
+TGAAGCATATTTGAATCAAGGGTATATATTTTATCTATTTG
+>Locus_7_Transcript_8/11_Confidence_0.154_Length_552
+TAAACGATTTTGATACTTTCGCAACAAAAGGAAGCAAGATTAGTGCATTTGTCAAGCGTT
+TTCCCTTCGACAAGGATGATGCCAAAGCTAGATGGGCAGAGATCAACACGCTGACGGGCT
+ATTTGCAGAATGATTTTGGAAACTTCGATTACGATAAGGAATTTGAAGCTTTAGCTACCG
+GAGATAGTAACCACCCCGCTTGGTGGGAAGAAGTATTCACTAAGAAAATAAAAGAGTTGA
+TGACACATCAAGAACACAAAAAGTATATCAGTTTTGAAAAATATGTTAAGGAAGGATATT
+GGATAACATCTGGCAGCAGCAGCATCGGCAAAGTCAATTGGTCATATGACGGAGACTTGG
+GCAAATTTAAGGCTAGAAAGAACATGTTATTAGATCTATATACGCCGGACGAAATCTACA
+AAATGGCTGTAGAATGGGACGGGAAACTAGAGAATAGAGTGTTCATCAAAGATGAATTGG
+CAAAGAGAAGATTGGCAGTGGCAAGCAATATTGAAGCATATTTGAATCAAGGGTATATAT
+TTTATCTATTTG
+>Locus_7_Transcript_9/11_Confidence_0.154_Length_552
+AAAACGATTTCGATACTTTCGCAACAAAAGGAAGCAAGATTAGTGCATTTGTCAAGCGTT
+TTCCCTTCGACAAGGATGATGCCAAAGCTAGATGGGCAGAGATCAACACGCTGACGGGCT
+ATTTGCAGAATGATTTTGGAAACTTCGATTACGATAAGGAATTTGAAGCTTTAGCTACCG
+GAGATAGTAACCACCCCGCTTGGTGGGAAGAAGTATTCACTAAGAAAATAAAAGAGTTGA
+TGACACATCAAGAACACAAAAAGTATATCAGTTTTGAAAAATATGTTAAGGAAGGATATT
+GGATAACATCTGGCAGCAGCAGCATCGGCAAAGTCAATTGGTCATATGACGGAGACTTGG
+GCAAATTTAAGGCTAGAAAGAACATGTTATTAGATCTATATACGCCGGACGAAATCTACA
+AAATGGCTGTAGAATGGGACGGGAAACTAGAGAATAGAGTGTTCATCAAAGATGAATTGG
+CAAAGAGAAGATTGGCAGTGGCAAGCAATATTGAAGCATATTTGAATCAAGGGTATATAT
+TTTATCTATTTG
+>Locus_7_Transcript_10/11_Confidence_0.154_Length_4093
+TGAGAATAAACAACAACAACCAAGTGCACCGATGCCACACGAGCCAAGGGCAGCAGGTCA
+GGCACTTAAGGATTTGAATTTGGCTTATTTGAATAACGACCAAAAAACAACATTGTCGGC
+ATGGGTACGAGGCCTAACAGTAGAAGGTGTCGAACCAAATCCCGGACCATCAATAATTGA
+GCCAAATCATGGACCAAGCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCAACGACA
+GCTGGCAAAACAAGACCAAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCTACTGGA
+CGATCTGACCGAATTAAAGACTACGGTACAACCACAGATTGACAATTCGGGATTCTTGGC
+TCATGTTGATCATGCAGCTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGTGATGAA
+ATACATTCTCACGAATTCTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTACTGATAT
+ACCCGACGAGCCAGTAGAGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAAAGAGAA
+AAAAGAAGAAAAAAAAGATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACGAGAATC
+GATGGCAATGCCAGCCAGTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGAAATTGA
+AAGGAAAAACGTCATCAGGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTACAAGCT
+TGTACTATGGTTAGACAAACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGATGAGCT
+TTGGGGAAGTGGTTGGCAGGAACGAAATAAGATGAACCAGTATGAATGGTTGTCTTACTG
+CTGGGCAAATAATGTCACTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGACATCAA
+ATGGCAACAACTACCTGCTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGCTGATCT
+TGAAGCTCAAAAAACTCACAATAAAGTGATGCATGCATACAACGGTAACCCTTTGTGTCA
+GGGATTTCAAGAAGTTGAAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAGTAATTC
+AGTTCTGAAACCATATACTGGACTGGAAGCTGAGAAATACATCACCAACATTGTAGGAGA
+CATGAATCCGAATCAATCAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCAATACAA
+TGCCAATGGGGCTGTGGTTCATAATGCTGTATCAACTATTCCGTTTACAAACCTCATTCC
+TAGGACGATTCGATCTGATGATGACGTCCTTGAGAAGTCGGCCAACAGATTACAGGTTAC
+AGAGACAAACGTTACGGATTACTACGTTAATCCGATTGAGCCAACTGAATTATCCAAAAC
+AATAAGTGACCAGATCAAAAACAATCAATCATCTAACTGGCGACGAGATAACACGTCATT
+GGCTGGTTTCAATAGTTTCGACATTGCGACAGTCAACACTGCACTAATTGCAAGAGGTCT
+AAGCACTGAATCAATGACTCTCAAGTTAGAGCTATTGCACGGAATAATGGCTATGCAGGT
+TGAAGCACCAATGATCAATTCCAGCACTTATTCGATCGTAGATAATCATACAATCCCGAC
+CGTAACTGACAGGGCCGTCATAGGCATCAATGACTCGCCTGTGTTTGGCGAGGACTGTGG
+TGGTGATCTTCCTGAATATCCTTTCGGCGGCGGAACCGGTACAATTGCCTTTCACCTAAC
+ATTGCAAACTGTTCCTGAAGAGAGGAGAGATAAGGCAATCTTCTGCCCTCCTGGTTTGTT
+GCAAGCAGCCCGAGATGGAGCAGAGGCATTGGCCCTATTTGTTTTGTCGATGTCTGAATG
+GCCTTTCGGTATTTATACTGTCACCAAGAGAACAACCGATGAGAAGGGACTGAATCCTGC
+GGATCAGGTTTACGTGCCGATGGAGACCATAACCCGTGTAGGTGGAGATAGAGTATTGGA
+CGTTGTACTTCCTCGAAGGTATGCGGTTGCAAATCCAACGACTCAAGGAAATGCTAATGC
+TCTAGCAGTTATACAGCCTCAAGCTGGGCCTTTAGATAACGGTGCGGACGGATTAGCCGC
+TGGTGAATTATTGGATGTCAATTTCATCGGCGCCGACGGCATTACTGAATATCCATTGAC
+ATATTACTTGTATACCTGGGCACTTCGATTTGATATAACGACGATTAGGCAATACATTGG
+TAGAATGGCAGCGTTAATTGGAGTGAAACACCAACTATGGGCTAGTCATGAAATCAGAGT
+AGCTTTGTGTCAAGTTGCACCCAAAATGGTGGTCGGAGTTACAGGTTCGGGAGACCTGCC
+AAGAGGATCAGCCGCTGCAAGCGAGGTATGTTACTCAAGCTTATTGGAGGTCTCACGCTC
+TGAAGAAGATTTTCCGCTGCTTGGTCAGGTTCAAGCCGATTTCAGAGTCTTTGAAACCAA
+TACAAGCACATGGAATAAAGTAGTTTTGGGATTGGCAACAGCACCAAACGTGACAAGTGA
+ACAAAACATGCATGTACCATTCGTTGTTGGCGATCCGAGATCTAACGCGTGGGACCGACT
+CGAAGCAGTACCAATTGCTGCTGCTTGGCAGATGTACTACCATTCAAGGGGCGTAACTAC
+TGCCGCTTGGAATGATGCGTACACTAACGTAAATAACGTTTGGTTGCAAAAGATGGCCCG
+TGATAGCTTCTCAACGACCCAAAGCACTGGGACGATACTGCCTGCCAGATATGGTAAGAT
+AGTCAAAAACCTGATGAGAAACATGTTTGAAAGAGAACCTGCCAAAGTAGTAACAAGCGT
+GGGAGGCGATGAATATGAGATAACCCATTTTGAGCGCTGGTTACCGGGTAATAGATATGC
+TTCCGTGTTTGAACAAGATGAAACTGAAGTTAATCTGTTTCCTCCAACTTTATTACCGGA
+TATTTGGGTTCAATATCCAGCGACTCACACCCCAATCATGTGTGCTTCGTTCCCACCCGT
+TTTCGGCCAAGACTCAACACAAGGGTTCGGCAAAGAATCACAACTTATACCCTTTCGAAA
+CGCAAACAACAATCTTGTAGCACCATACGTTGAAGCTTTCGTTGCCAATCAAGCTTATTT
+CCCGATAGGATCGGGCCCAAACATCAACGACAAGGTTCTGTGGAATAGTAGATTGTGGAT
+GACAAGTGGTTTCGTTCAGTACTTGGATTACGCTGGCAACGCAATCAACGAAGTGGTTCC
+TGCAGCAGGGCTACCTTTGGGTAGGTCAATCCCATTACTGCCAGGGGAAGTTCAGCCGGT
+TGGTAACACCAACATGAGCACAAGCTGCGTTCCTCGTTATTCTGTGGACGGTCGCCGAAT
+TTTTACTTATGTCAACACAGCTCAATCCGTTCCTTTGATACAAGCGTGTAATAGAGCCAA
+TAGATTGGCCAGATCGGCATGGCTATTATTGCATGTCTACATCGAACCAGAGTTGCAGCT
+ATTGAGCGATGAAGTGGTGGACATATTCGACCAACTGACAAGCAAGACTTTTTTAGATGT
+AGCAAAATCGGCTGCGGACAGTGCGGAGGGCAACATTCCGGCAACGAAGGTATTGACAGA
+CCTCCAGGCAGTGGATTCAGCAACGCTGCCGAGTACTTTGGATCCATCCACAAATATGCT
+CCAACCAGCTCCTTTACTCGGCGAACCTACGACAAATTAACTCGATACATTCATGATGGG
+GTAAGTCGAAGTAGTCAGAGAGAAATTTCATCATTGTCGGATGATTTAGTTAGATTTAGT
+ACTCTCACAGATTTTACTGTCATCGATTTTATTACTAAGAAATTAGATTTAGAACGTCCG
+ATTAGTACTCAAGGAGATTTATTGGCGTTAGAACCTAGATGCAAGGGTGACCTCGCTGTA
+GCAAGACTTAAGATTAAGGACATAATAGGTAGGATTGATAAGGATATTAGAACGTGGTGT
+GAAGCAAATTTATGCCATTTGGATGCAATCTTGGTAACGAACTTGATAATCTGGGGACAA
+ATCTGGGGGTTGGAAATTCTGAAAGCTTTACATTCAACAGGAATATTAAACGATTTCGAT
+ACTTTCGCAACAA
+>Locus_7_Transcript_11/11_Confidence_0.000_Length_1206
+TGAGAATAAACAACAACAACCAAGTGCACCGATGCCACACGAGCCAAGGGCAGCAGGTCA
+GGCACTTAAGGATTTGAATTTGGCTTATTTGAATAACGACCAAAAAACAACATTGTCGGC
+ATGGGTACGAGGCCTAACAGTAGAAGGTGTCGAACCAAATCCCGGACCATCAATAATTGA
+GCCAAATCATGGACCAAGCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCAACGACA
+GCTGGCAAAACAAGACCAAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCTACTGGA
+CGATCTGACCGAATTAAAGACTACGGTACAACCACAGATTGACAATTCGGGATTCTTGGC
+TCATGTTGATCATGCAGCTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGTGATGAA
+ATACATTCTCACGAATTCTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTACTGATAT
+ACCCGACGAGCCAGTAGAGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAAAGAGAA
+AAAAGAAGAAAAAAAAGATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACGAGAATC
+GATGGCAATGCCAGCCAGTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGAAATTGA
+AAGGAAAAACGTCATCAGGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTACAAGCT
+TGTACTATGGTTAGACAAACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGATGAGCT
+TTGGGGAAGTGGTTGGCAGGAACGAAATAAGATGAACCAGTATGAATGGTTGTCTTACTG
+CTGGGCAAATAATGTCACTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGACATCAA
+ATGGCAACAACTACCTGCTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGCTGATCT
+TGAAGCTCAAAAAACTCACAATAAAGTGATGCATGCATACAACGGTAACCCTTTGTGTCA
+GGGATTTCAAGAAGTTGAAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAGTAATTC
+AGTTCTGAAACCATATACTGGACTGGAAGCTGAGAAATACATCACCAACATTGTAGGAGA
+CATGAATCCGAATCAATCAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCAATACAA
+TGCCAA
+>Locus_8_Transcript_1/4_Confidence_0.400_Length_658
+TTTGCTTTTTTCTTTTATTCTCTGCCTTCCATCTTCACTATGACCATCTCATCATTAAGG
+CAAATCCGAAGAGGCTCTAAGACAATCGGATCGATTTATGCAAATGATACTCCAATCTTC
+GAGCGTTTCTTCCTGTGCCTCTCCGCCACCACGAAGAATAGCAACTCGTCATTATGGCAA
+ACAAAGATCGAAGACCAGTTTTCACCTCAATCTAATGATGTTTGCCTCATTTATCCTGAT
+CCGCTGTGATCCGCTTGTAATCAATCCCCATCCATCCTCAGCCAGGGGCAAGTTCAAGTT
+GCCAGCTCTCCGCAGCGATCTCCTCCACGGTTCCTTTATGATCTCGAGTTTCATCCTTTC
+CACTCCACCTGGCTTGAGTGGGTGGCTCAACATAATGGGGGGATCTGCCGTTATTCGGTT
+GTATCCCGATCGCAGCCGCAGCTGCAAATAAAATAAGAGTCGACTTCAACACTCGACTTG
+GCTTAATGCAAAGTGCCGCTGAGGAGAGATGCGTGGGTGGGCCCACATTGGGAAGCCAAC
+TGGGTCTGCTCTAAGTCGCAGAGTGCAGATAAACACTGCCAAAAAATATGTGACTAAAAT
+CGAATTTATTTCCTGGGTCGTCGATTAGGAAATAAGAATGAGAGGTAAATGCGCAGTC
+>Locus_8_Transcript_2/4_Confidence_0.200_Length_117
+TTTAGGTATAGCTATCAGGCAATCAATAACATTGATGCCAAAAAATATGTGACTAAAATC
+GAATTTATTTCCTGGGTCGTCGATTAGGAAATAAGAATGAGAGGTAAATGCGCAGTC
+>Locus_8_Transcript_3/4_Confidence_0.200_Length_696
+GCAACGAATATCTTTAATTACGCTCTATAATCAAATATAGAGAGGGTCTTAAATATTCCC
+AGAAGAGGCCATTTCAAGTCACTAACAATTTGACTTTGCTTTTTTCTTTTATTCTCTGCC
+TTCCATCTTCACTATGACCATCTCATCATTAAGGCAAATCCGAAGAGGCTCTAAGACAAT
+CGGATCGATTTATGCAAATGATACTCCAATCTTCGAGCGTTTCTTCCTGTGCCTCTCCGC
+CACCACGAAGAATAGCAACTCGTCATTATGGCAAACAAAGATCGAAGACCAGTTTTCACC
+TCAATCTAATGATGTTTGCCTCATTTATCCTGATCCGCTGTGATCCGCTTGTAATCAATC
+CCCATCCATCCTCAGCCAGGGGCAAGTTCAAGTTGCCAGCTCTCCGCAGCGATCTCCTCC
+ACGGTTCCTTTATGATCTCGAGTTTCATCCTTTCCACTCCACCTGGCTTGAGTGGGTGGC
+TCAACATAATGGGGGGATCTGCCGTTATTCGGTTGTATCCCGATCGCAGCCGCAGCTGCA
+AATAAAATAAGAGTCGACTTCAACACTCGACTTGGCTTAATGCAAAGTGCCGCTGAGGAG
+AGATGCGTGGGTGGGCCCACATTGGGAAGCCAACTGGGTCTGCTCTAAGTCGCAGAGTGC
+AGATAAACACTGCCAAAAAATATGTGACTAAAATCG
+>Locus_8_Transcript_4/4_Confidence_0.200_Length_135
+GCAACGAATATCTTTAATTACGCTCTATAATCAAATATAGAGAGGGTCTTAAATATTCCC
+AGAAGAGGCCATTTCAAGTCACTAACAATTTGACTTTGCTTTTTTCTTTTATTCTCTGCC
+CTCCATCTTCACCAT
+>Locus_9_Transcript_1/3_Confidence_0.667_Length_681
+TCGAATAGACTCATTAGAAAGAACTGTTTCAATAGATGCCTTCTATCCATTCCCTCAGGT
+CATCAAAGAGGGTGGACAGGAGCCTGTAGCCGCCGTAGAGTTATACCTAACCAGTGATAA
+GTCCACTAGTATCACTGGGACAATTAGAAGCATTACCACTGCTCATAGTGCTGCTAGACC
+TGGTATAACATCACCAACGACAATAGTGGCTTATGAGGGAGTTCAATCCGGTGCTAGTAT
+CACCGTGGCTGGAGTGAGTAACTATGAGCTTATACCTAACCCAGAACTAGCACGCAATAT
+GGAAACCAGATATGCAAGAACTGACCCCTATGGCATGATATACACCAAGTATGTACTTGC
+AAATAGGGACAGATTAGGCATACGCAGCGTCTGGCCCACTAATGACTATAAAGCCAGGTT
+CCCATTATTCGAGGAACTTGGCCTCATGCAGTCAGACGCCAGTATCACAGAGGCCATGGC
+TTTCGGTATACATGATGTTATATCATGGATACGTGGCCTAGTACCAGCAGCCTCAGACTG
+GGCCAATCGTATGCTACCAGGTTCAGGGGATGTGATTAAAGGAATCAACAGAACCGCAGG
+GCACCTTCTTTATGGAGAAGCTGCCTCAGGCCGGTTGATAGCACAATCCGCGAGCGGATC
+ACTAATAGGTCAGCTGGGGCA
+>Locus_9_Transcript_2/3_Confidence_0.333_Length_2216
+TCGAATAGACTCATTAGAAAGAACTGTTTCAATAGATGCCTTCTATCCATTCCCTCAGGT
+CATCAAAGAGGGTGGACAGGAGCCTGTAGCCGCCGTAGAGTTATACCTAACCAGTGATAA
+GTCCACTAGTATCACTGGGACAATTAGAAGCATTACCACTGCTCATAGTGCTGCTAGACC
+TGGTATAACATCACCAACGACAATAGTGGCTTATGAGGGAGTTCAATCCGGTGCTAGTAT
+CACCGTGGCTGGAGTGAGTAACTATGAGCTTATACCTAACCCAGAACTAGCACGCAATAT
+GGAAACCAGATATGCAAGAACTGACCCCTATGGCATGATATACACCAAGTATGTACTTGC
+AAATAGGGACAGATTAGGCATACGCAGCGTCTGGCCCACTAATGACTATAAAGCCAGGTT
+CCCATTATTCGAGGAACTTGGCCTCATGCAGTCAGACGCCAGTATCACAGAGGCCATGGC
+TTTCGGTATACATGATGTTATATCATGGATACGTGGCCTAGTACCAGCAGCCTCAGACTG
+GGCCAATCGTATGCTACCAGGTTCAGGGGATGTGATTAAAGGAATCAACAGAACCGCAGG
+GCACCTTCTTTATGGAGAAGCTGCCTCAGGCCGGTTGATAGCACAATCCGCGAGCGGATC
+ACTAATAGGTCGGCTGGGGCACCGGGATGCCTTGGCTTGTGATGTAGACCCAACGCTCAT
+GGGTCACAATGCAGCACAACTCATTTGTTACAACACAGCCCTGGGAGTAAGGAGTACTGG
+TAATCGTATCTACATGATACGTTTAAAAACTCCAAAGCGCAACCCCCGTGTTACTATATT
+TCCCGCTCTAGTATTCAACACAACACCATTAGGACCGGAAGTTTCTGGAACCCAACTATA
+TGCAGTCATAGAGGGGTTATACAACCAGGTCCCACAATCCAGATTCAAGGTTACAGGCAA
+GAACGGACGCACAATTTATGGAATAAAGCCTGGTGCCTATATACCACCGGGCCCCAATTG
+CACAGTTGTGCCCATTAGCTCCATAACCCAGAATGAAATAACAACCACAGCCACCCCACC
+AATACCAAGGGGTGGAAGTATGGAAGCAGCCTTAGCCCTGTTACAGTACATTCCCCCTGG
+AGTGACTCCATTTGCAGTCACAGGCAATGTTATAGAAGGTAAAATAGTGCCCAACAAATG
+GGCTGATCTGAAGAGAGAGGGAATGAAAGGAACTGGCATACCACTTGTAACAGATCAAGA
+TTACAAGACCATCAAGGACCTGGCCAAAGCAACTGAAATGTTGCAGAGAATAACCACTGC
+GCAACATCCAGCAGTGATTGGAACGATAGCCAGTGCCATGGATTATGACGACTTTCCTCC
+ACCTCCTCCTCCGGTCACAGATGAAAACATAATGGAAACACTGGAGGATCTACTTGTTGC
+AGCCGCCGATAGAGACCCTAGGATGGCTAAACTTAAGGACGTTGTGCTCTGGTTAGCCAA
+AATAGACAACAACAACCCTGGAGTGCTAGACACACTACACAACTTTTCACGGCAGGATGT
+AGAAGGTGAAAAGATGAATAGAATAGTCCAGAACTCCTTAACCACAGCAGTCCACAACAG
+GGGGCCAACCCAGGAAGTTCTACAACACCAGAAGGCGGTAAGGATCCGAGAAAACTACCT
+AAACCAGGGTGTAGACCTGTCAATCGAGTGGATCAAGAATAATGGTTTTAGAGGCCCAAG
+TGCAGACCAGATGAAAACTATAAAAGCTGGCCTAGAACCTCCTCCAGATACCACCACCAA
+ATCGCCTACACCCCACAATGACACATCAACACCAGCACTTGTCATGAAAATCATAAAGAA
+CAGTTTAGGCATCCATTATGACAATGCCAGCCCTGAAACCCAGAAGGAAATCAATGAACG
+CATTACCACGATGGTAATTAACAATGGCAACAGAGGCTTGAATCAGTACCAGGCAAAAGA
+AATTGTACAGGATTACGGCAAAACAAAGAAAAGTGCACAGATGAACTTGCGCTATGTCGG
+GCCAAGAAAGATCGGATACACCCCACCTAGCGCAAACCAGGTCGTAGATGTACCGCCTCC
+CGAAAACACAAGGGATGTTGTTATCGCACGACCTACTCAGCGGGTACCCGCGAATGTGTT
+GACCAGGGGTAATCGAACTGGTCAAATATAGGGTATATTAGTAGTTTATAGATATA
+>Locus_9_Transcript_3/3_Confidence_0.000_Length_1571
+ATCCGCGAGCGGATCACTAATAGGTCGGCTGGGGCACCGGGATGCCTTGGCTTGTGATGT
+AGACCCAACGCTCATGGGTCACAATGCAGCACAACTCATTTGTTACAACACAGCCCTGGG
+AGTAAGGAGTACTGGTAATCGTATCTACATGATACGTTTAAAAACTCCAAAGCGCAACCC
+CCGTGTTACTATATTTCCCGCTCTAGTATTCAACACAACACCATTAGGACCGGAAGTTTC
+TGGAACCCAACTATATGCAGTCATAGAGGGGTTATACAACCAGGTCCCACAATCCAGATT
+CAAGGTTACAGGCAAGAACGGACGCACAATTTATGGAATAAAGCCTGGTGCCTATATACC
+ACCGGGCCCCAATTGCACAGTTGTGCCCATTAGCTCCATAACCCAGAATGAAATAACAAC
+CACAGCCACCCCACCAATACCAAGGGGTGGAAGTATGGAAGCAGCCTTAGCCCTGTTACA
+GTACATTCCCCCTGGAGTGACTCCATTTGCAGTCACAGGCAATGTTATAGAAGGTAAAAT
+AGTGCCCAACAAATGGGCTGATCTGAAGAGAGAGGGAATGAAAGGAACTGGCATACCACT
+TGTAACAGATCAAGATTACAAGACCATCAAGGACCTGGCCAAAGCAACTGAAATGTTGCA
+GAGAATAACCACTGCGCAACATCCAGCAGTGATTGGAACGATAGCCAGTGCCATGGATTA
+TGACGACTTTCCTCCACCTCCTCCTCCGGTCACAGATGAAAACATAATGGAAACACTGGA
+GGATCTACTTGTTGCAGCCGCCGATAGAGACCCTAGGATGGCTAAACTTAAGGACGTTGT
+GCTCTGGTTAGCCAAAATAGACAACAACAACCCTGGAGTGCTAGACACACTACACAACTT
+TTCACGGCAGGATGTAGAAGGTGAAAAGATGAATAGAATAGTCCAGAACTCCTTAACCAC
+AGCAGTCCACAACAGGGGGCCAACCCAGGAAGTTCTACAACACCAGAAGGCGGTAAGGAT
+CCGAGAAAACTACCTAAACCAGGGTGTAGACCTGTCAATCGAGTGGATCAAGAATAATGG
+TTTTAGAGGCCCAAGTGCAGACCAGATGAAAACTATAAAAGCTGGCCTAGAACCTCCTCC
+AGATACCACCACCAAATCGCCTACACCCCACAATGACACATCAACACCAGCACTTGTCAT
+GAAAATCATAAAGAACAGTTTAGGCATCCATTATGACAATGCCAGCCCTGAAACCCAGAA
+GGAAATCAATGAACGCATTACCACGATGGTAATTAACAATGGCAACAGAGGCTTGAATCA
+GTACCAGGCAAAAGAAATTGTACAGGATTACGGCAAAACAAAGAAAAGTGCACAGATGAA
+CTTGCGCTATGTCGGGCCAAGAAAGATCGGATACACCCCACCTAGCGCAAACCAGGTCGT
+AGATGTACCGCCTCCCGAAAACACAAGGGATGTTGTTATCGCACGACCTACTCAGCGGGT
+ACCCGCGAATGTGTTGACCAGGGGTAATCGAACTGGTCAAATATAGGGTATATTAGTAGT
+TTATAGATATA
+>Locus_10_Transcript_1/8_Confidence_0.222_Length_565
+CGATTTTAGTCACATATTTTTTGGCATCAATGTTATTGATTGCCTGATAGCTATACCTAA
+ACACCAGACATGTCATGAAATCCTTAGCTAATATTTTTGTGTCGTCGCCTTTCAATGCTA
+TTAACCTAATGTTATCTTTGCCCAATATCAAACTCGTCTGATCTCTTGCTATATCCGTTG
+TTATCATATTCCAGACATTGCCGATGAAACTTGTTGGACGTATTCCAGAAGGTATGCCGT
+TAGTCTGTTTCTTTGTTTCCTTTGTTAACGGTGAGTACAGGTAATTATTGTCGTAACACG
+AAATATTTTTCGCAGCTATTTTAGTGAATAAATGTCGATCTTGTGGAGGTACCAAATATT
+TGATTTGGTCTATGACGCGTTTCGTAATCTGCTTCACTTCCCAAATTGTTGGTTGTCTGT
+CAAACCCTTTGAAATCAAAAGGTAGGGCAAAACACCCGTCTTTCAATGCTTTAATTGTTT
+CACAGTTCCTAAGATGCGTTTCACCTGGTGTTTCGTCTAATGTTATGTATTTCCAATTTT
+TAAAGCCATGTCCAAATAGATAAAA
+>Locus_10_Transcript_2/8_Confidence_0.111_Length_1023
+GTCGTCGGCTGCTATTTTCATTGAAAATTCGACTTGTTGATAAGCCGTCTTTTCCTCATC
+TGTCATTTGCTTCCACGTCAAGTTGATGTTTTCACTAAACAGTCCAGGAACATCGAACGT
+TGGGATGTCAGCAAGTGGTAGCTTGCTAGTAGTTTTCCACCCTTTCCATTCGTATATTCC
+GAAACCACCCAGTCGTTTAGGCAGGTGCAGCCAGTGATAGCTCTGTCCCGTGTATTTACT
+CCACTTAATTTTGTTTGCTTGATGTAACCAATCCAATTGTTTCTTGCTTCTCCTTTCTAA
+TAAATAGATATTATTAGCGGTTGTCTCAACTTGTTGATTTGCAGTCCATGGTTGTGGGTT
+CCACGGTTTCCTTTGTGTCACGCTAGGGATAGCCCGATTTGTCCAGCCTCTGACGCCTTG
+AGTAGATATTTCTGTCCTTAAGAATTCGCAACAATTTTGCATAATTCCAAACTTGCTGTT
+TTCTCCAACGGCGTTGATTGCCTGATAGCTATACCTAAACACCAGACATGTCATGAAATC
+CTTAGCTAATATTTTTGTGTCGTCGCCTTTCAATGCTATTAACCTAATGTTATCTTTGCC
+CAATATCAAACTCGTCTGATCTCTTGCTATATCCGTTGTTATCATATTCCAGACATTGCC
+GATGAAACTTGTTGGACGTATTCCAGAAGGTATGCCGTTAGTCTGTTTCTTTGTTTCCTT
+TGTTAACGGTGAGTACAGGTAATTATTGTCGTAACACGAAATATTTTTCGCAGCTATTTT
+AGTGAATAAATGTCGATCTTGTGGAGGTACCAAATATTTGATTTGGTCTATGACGCGTTT
+CGTAATCTGCTTCACTTCCCAAATTGTTGGTTGTCTGTCAAACCCTTTGAAATCAAAAGG
+TAGGGCAAAACACCCGTCTTTCAATGCTTTAATTGTTTCACAGTTCCTAAGATGCGTTTC
+ACCTGGTGTTTCGTCTAATGTTATGTATTTCCAATTTTTAAAGCCATGTCCAAATAGATA
+AAA
+>Locus_10_Transcript_3/8_Confidence_0.222_Length_529
+CAGGAATGTCGTCGTCGGCTGCTATTTTCATTGAAAATTCGACTTGTTGATAAGCCGTCT
+TTTCCTCATCTGTCATTTGCTTCCACGTCAAGTTGATGTTTTCACTAAACAGTCCAGGAA
+CATCGAACGTTGGGATGTCAGCAAGTGGTAGCTTGCTAGTAGTTTTCCACCCTTTCCATT
+CGTATATTCCGAAACCACCCAGTCGTTTAGGCAGGTGCAGCCAGTGATAGCTCTGTCCCG
+TGTATTTACTCCACTTAATTTTGTTTGCTTGATGTAACCAATCCAATTGTTTCTTGCTTC
+TCCTTTCTAATAAATAGATATTATTAGCGGTTGTCTCAACTTGTTGATTTGCAGTCCATG
+GTTGTGGGTTCCACGGTTTCCTTTGTGTCACGCTAGGGATAGCCCGATTTGTCCAGCCTC
+TGACGCCTTGAGTAGATATTTCTGTCCTTAAGAATTCGCAACAATTTTGCATAATTCCAA
+ACTTGCTGTTTTCTCCAACGGCGTTGATTGCCTGATAGCTATACCTAAA
+>Locus_10_Transcript_4/8_Confidence_0.444_Length_1097
+TGTAGAAAAAAAAATATAGGAGTCTCGAAGACTCTTTAGAAAGCATACATGTAGTTGCCT
+CCCTCGTTCTGGATGTACTGAACGGCCTGCTTGCATACTGATGTTAAGTGCAGAGCTATG
+TTTTCTCTTCCTCGCCAAAAAGAAAAACCACTTTTGACGACTATCTTACTTATCCAGGGT
+GTTAGTATTGGATTCAATATCCCTGTTGGTTCAAGAGGGACTTTACCTGTTGCAATGTTA
+ATTGCATCAGTCCTATGCCATCCTTTCCTTTCATATTCCGTCATAGTTTTGTAAGCTTCA
+GGATACCATTTGGCCAAACATTCTTTTAGACTAGGTATCTCAATCTTAGCTTTCTTCGCG
+ATTTGATGTTGTCTTATAAATTCGCTGAATATTGGCATTCCGTTTGGACCAGCCTCATGA
+GATTGAATCATACGTCTAGGCCAAATGTTATTTTCGCACGTTGGTCCTTCTGTTTTGTAA
+AACCTGTATGTGGGTACAACCGTCTTCTCCCATACCGGTTTCAACTTCCTTAAATTTTTG
+ATATAATTGCTGGAAATGTGTTTTTGCGGTCCAGGAATGTCGTCGGCTGCTATTTTCATT
+GAAAATTCGACTTGTTGATAAGCCGTCTTTTCCTCATCTGTCATTTGCTTCCACGTCAAG
+TTGATGTTTTCACTAAACAGTCCAGGAACATCGAACGTTGGGATGTCAGCAAGTGGTAGC
+TTGCTAGTAGTTTTCCACCCTTTCCATTCGTATATTCCGAAACCACCCAGTCGTTTAGGC
+AGGTGCAGCCAGTGATAGCTCTGTCCCGTGTATTTACTCCACTTAATTTTGTTTGCTTGA
+TGTAACCAATCCAATTGTTTCTTGCTTCTCCTTTCTAATAAATAGATATTATTAGCGGTT
+GTCTCAACTTGTTGATTTGCAGTCCATGGTTGTGGGTTCCACGGTTTCCTTTGTGTCACG
+CTAGGGATAGCCCGATTTGTCCAGCCTCTGACGCCTTGAGTAGATATTTCTGTCCTTAAG
+AATTCGCAACAATTTTGCATAATTCCAAACTTGCTGTTTTCTCCAACGGCGTTGATTGCC
+TGATAGCTATACCTAAA
+>Locus_10_Transcript_5/8_Confidence_0.333_Length_628
+CGTTATCCAGCTGGATTATGTTGTTATTGTGTAGAAAATATAGGAGTCTCGAAGACTCTT
+TAGAAAGCATACATGTAGTTGCCTCCCTCGTTCTGGATGTACTGAACGGCCTGCTTGCAT
+ACTGATGTTAAGTGCAGAGCTATGTTTTCTCTTCCTCGCCAAAAAGAAAAACCACTTTTG
+ACGACTATCTTACTTATCCAGGGTGTTAGTATTGGATTCAATATCCCTGTTGGTTCAAGA
+GGGACTTTACCTGTTGCAATGTTAATTGCATCAGTCCTATGCCATCCTTTCCTTTCATAT
+TCCGTCATAGTTTTGTAAGCTTCAGGATACCATTTGGCCAAACATTCTTTTAGACTAGGT
+ATCTCAATCTTAGCTTTCTTCGCGATTTGATGTTGTCTTATAAATTCGCTGAATATTGGC
+ATTCCGTTTGGACCAGCCTCATGAGATTGAATCATACGTCTAGGCCAAATGTTATTTTCG
+CACGTTGGTCCTTCTGTTTTGTAAAACCTGTATGTGGGTACAACCGTCTTCTCCCATACC
+GGTTTCAACTTCCTTAAATTTTTGATATAATTGCTGGAAATGTGTTTTTGCGGTCCAGGA
+ATGTCGTCGGCTGCTATTTTCATTGAAA
+>Locus_10_Transcript_6/8_Confidence_0.333_Length_1121
+CGTTATCCAGCTGGATTATGTTGTTATTGTGTAGAAAATATAGGAGTCTCGAAGACTCTT
+TAGAAAGCATACATGTAGTTGCCTCCCTCGTTCTGGATGTACTGAACGGCCTGCTTGCAT
+ACTGATGTTAAGTGCAGAGCTATGTTTTCTCTTCCTCGCCAAAAAGAAAAACCACTTTTG
+ACGACTATCTTACTTATCCAGGGTGTTAGTATTGGATTCAATATCCCTGTTGGTTCAAGA
+GGGACTTTACCTGTTGCAATGTTAATTGCATCAGTCCTATGCCATCCTTTCCTTTCATAT
+TCCGTCATAGTTTTGTAAGCTTCAGGATACCATTTGGCCAAACATTCTTTTAGACTAGGT
+ATCTCAATCTTAGCTTTCTTCGCGATTTGATGTTGTCTTATAAATTCGCTGAATATTGGC
+ATTCCGTTTGGACCAGCCTCATGAGATTGAATCATACGTCTAGGCCAAATGTTATTTTCG
+CACGTTGGTCCTTCTGTTTTGTAAAACCTGTATGTGGGTACAACCGTCTTCTCCCATACC
+GGTTTCAACTTCCTTAAATTTTTGATATAATTGCTGGAAATGTGTTTTTGCGGTCCAGGA
+ATGTCGTCGGCTGCTATTTTCATTGAAAATTCGACTTGTTGATAAGCCGTCTTTTCCTCA
+TCTGTCATTTGCTTCCACGTCAAGTTGATGTTTTCACTAAACAGTCCAGGAACATCGAAC
+GTTGGGATGTCAGCAAGTGGTAGCTTGCTAGTAGTTTTCCACCCTTTCCATTCGTATATT
+CCGAAACCACCCAGTCGTTTAGGCAGGTGCAGCCAGTGATAGCTCTGTCCCGTGTATTTA
+CTCCACTTAATTTTGTTTGCTTGATGTAACCAATCCAATTGTTTCTTGCTTCTCCTTTCT
+AATAAATAGATATTATTAGCGGTTGTCTCAACTTGTTGATTTGCAGTCCATGGTTGTGGG
+TTCCACGGTTTCCTTTGTGTCACGCTAGGGATAGCCCGATTTGTCCAGCCTCTGACGCCT
+TGAGTAGATATTTCTGTCCTTAAGAATTCGCAACAATTTTGCATAATTCCAAACTTGCTG
+TTTTCTCCAACGGCGTTGATTGCCTGATAGCTATACCTAAA
+>Locus_10_Transcript_7/8_Confidence_0.111_Length_255
+CCTTTCGTGGGTATGTGACCAATAAAATGGATGTTGTGAAAATTCAGGTAATTCTTTTAT
+AATAATGATAAAAACGAACGAACGAAACGAATCACATATCCAAACTTATCTCGTTTGCAA
+GTTGGCAACTCCTTATGTTAATTTCCAAAACCAATGAGCAATACTATACTACTACTATCC
+TGACTATCTTTAATTCAAGAGTATGACTCTCTTCGCCTTATAATGCATTTTCAATATCCC
+TGTTGGTTCAAGAGG
+>Locus_10_Transcript_8/8_Confidence_0.000_Length_1134
+CCTTTCGTGGGTATGTGACCAATAAAATGGATGTTGTGAAAATTCAGGTAATTCTTTTAT
+AATAATGATAAAAACGAACGAACGAAACGAATCACATATCCAAACTTATCTCGTTTGCAA
+GTTGGCAACTCCTTATGTTAATTTCCAAAACCAATGAGCAATACTATACTACTACTATCC
+TGACTATCTTTAATTCAAGAGTATGACTCTCTTCGCCTTATAATGCATTTTCAATATCCC
+TGTTGGTTCAAGAGGGACTTTACCTGTTGCAATGTTAATTGCATCAGTCCTATGCCATCC
+TTTCCTTTCATATTCCGTCATAGTTTTGTAAGCTTCAGGATACCATTTGGCCAAACATTC
+TTTTAGACTAGGTATCTCAATCTTAGCTTTCTTCGCGATTTGATGTTGTCTTATAAATTC
+GCTGAATATTGGCATTCCGTTTGGACCAGCCTCATGAGATTGAATCATACGTCTAGGCCA
+AATGTTATTTTCGCACGTTGGTCCTTCTGTTTTGTAAAACCTGTATGTGGGTACAACCGT
+CTTCTCCCATACCGGTTTCAACTTCCTTAAATTTTTGATATAATTGCTGGAAATGTGTTT
+TTGCGGTCCAGGAATGTCGTCGGCTGCTATTTTCATTGAAAATTCGACTTGTTGATAAGC
+CGTCTTTTCCTCATCTGTCATTTGCTTCCACGTCAAGTTGATGTTTTCACTAAACAGTCC
+AGGAACATCGAACGTTGGGATGTCAGCAAGTGGTAGCTTGCTAGTAGTTTTCCACCCTTT
+CCATTCGTATATTCCGAAACCACCCAGTCGTTTAGGCAGGTGCAGCCAGTGATAGCTCTG
+TCCCGTGTATTTACTCCACTTAATTTTGTTTGCTTGATGTAACCAATCCAATTGTTTCTT
+GCTTCTCCTTTCTAATAAATAGATATTATTAGCGGTTGTCTCAACTTGTTGATTTGCAGT
+CCATGGTTGTGGGTTCCACGGTTTCCTTTGTGTCACGCTAGGGATAGCCCGATTTGTCCA
+GCCTCTGACGCCTTGAGTAGATATTTCTGTCCTTAAGAATTCGCAACAATTTTGCATAAT
+TCCAAACTTGCTGTTTTCTCCAACGGCGTTGATTGCCTGATAGCTATACCTAAA
+>Locus_11_Transcript_1/2_Confidence_0.333_Length_1638
+GAAATTTTTTAAAGTTAGAAGTGTGTTCACAGTCACCTTCCACTGCATTGGCGAGAAGTT
+TGCTGATGGTGGCTTGTTCTATCTCGTATGGGATATGTGTTCGAGGTTGAATCTTATTAC
+GCAGTCTGTTGACGACCCCAGATACGTATCTACACAAGAAATTCCTTTCTGATGATTTTC
+TTATTTCTGTCTCTTGGTTAATTAGCGTAGATGTAACCTTCGTCGCCTCGTATTGACTGA
+TAAAAACGAGGACGAAAACGGCATGGACAAGATTTTGCACGTCAAATGGTGGCATACGGT
+CGGGATCTGAAACAGCGGTACCGTTGATGACTTCACGTGTGTTAAAGGTTGTTGCGGCGG
+TCATCAAATTTTTTGAAGTGAATTTTCCTTCAGGTAAGACCAATGCATACGAGATCAGGG
+AATCAACGAGACGTTTGTTGACGATTATTCTAATTGGTTTCATATGGCCGCGATCGCTAT
+TCAGCAGATCGACTGCAAGTGTATCCCATTCCCAGTAATAGAGAATCAGTTTATCTTTCA
+TATGGTCCATAGTAAATACATTAAAAACTAACGACCTTGGGACACGGCCGCTGACACTGC
+GAAGGATGTCAAAAAAAAGAACCTGATTTTTAATTTCGACTGGACGACAGTTGAAATAGT
+GGGAGCGGTTTCCATCCCAGTATTCAAAACGGCGGTTTGTGATGATGTTTACATAATCCT
+CAAATTTGTGCTCGTATCCTGCTTGTGTGTCGTTCTCAAACCAAAAGCGTATAAAGACAG
+TGCCGGAACGCTTGAATTTCTTGAAATAACATTCCTGTTCTGAAAGGTATCCGTCGGTTT
+CGACAAGCACTACAGGATCAAAAATCATACACCCATATGCGATATTTGCTCGTGAAATAT
+GCATTATTTTTCCAATGTCTGGTGTAGAAATGTCATAGATAGAATGCAAGAACATCAATC
+GTTCTGAAGTTACTGTACAATATTGAGCCGGTTTACGGCAAATGACTTTCGGGTCTTCAT
+TGAGATGCAGTTTTAGAACTTCCGAATGGTGTTTGGTGAGACCCTCTTGTTTGTATGATC
+GAAGTTCAAATAAGTAACGACTGTGACGGTAATCGTCGTTAGCATCGAGTAAGGGGTAAC
+ATGTATGGGTATATTTCTCTGCTGCATTCAGATGGGTCAAAGGGTTACCCCCAATATCTT
+TTAGTACACAATCAAATCCGTTGATTGGTACAGTGCCTCGTTCAATCCTCATTCGATACT
+TCATGTAACGTTCGCTCAATAAGCGATGTGCACGTGCGAATGCATGAGGTGCACTATCCG
+TAGCTTTCGAATAATCTAGGTTGAACATGCTGAATGATTTATTCAGTTTGGATTCTTGAT
+TCGATGTGAGATGTTGCTTGATGTATACTTTTTGGAAGTTGCGCTTCGCAAGTATTTCTT
+GCTTAGCTTTGCAAATTCTTTTGTGTGCATAGGCTTCTTGGAACAATGCATCACTGCCCA
+GACTCTTTGCAAGTTGAGCTTGTGTGACAGCATGTGTTGATGGAAATTCAGAAGCGACGT
+TATCAAGAACAAGGTCAATTGCGGCACTATTTTCAATCGAATCAAAAGTGACGTCTGAAC
+GATCAACAGACGTCAAAA
+>Locus_11_Transcript_2/2_Confidence_0.333_Length_1110
+GCTTATCTTTCATATGGTCCATAGTAAATACATTAAAAACTAACGACCTTGGGACACGGC
+CGCTGACACTGCGAAGGATGTCAAAAAAAAGAACCTGATTTTTAATTTCGACTGGACGAC
+AGTTGAAATAGTGGGAGCGGTTTCCATCCCAGTATTCAAAACGGCGGTTTGTGATGATGT
+TTACATAATCCTCAAATTTGTGCTCGTATCCTGCTTGTGTGTCGTTCTCAAACCAAAAGC
+GTATAAAGACAGTGCCGGAACGCTTGAATTTCTTGAAATAACATTCCTGTTCTGAAAGGT
+ATCCGTCGGTTTCGACAAGCACTACAGGATCAAAAATCATACACCCATATGCGATATTTG
+CTCGTGAAATATGCATTATTTTTCCAATGTCTGGTGTAGAAATGTCATAGATAGAATGCA
+AGAACATCAATCGTTCTGAAGTTACTGTACAATATTGAGCCGGTTTACGGCAAATGACTT
+TCGGGTCTTCATTGAGATGCAGTTTTAGAACTTCCGAATGGTGTTTGGTGAGACCCTCTT
+GTTTGTATGATCGAAGTTCAAATAAGTAACGACTGTGACGGTAATCGTCGTTAGCATCGA
+GTAAGGGGTAACATGTATGGGTATATTTCTCTGCTGCATTCAGATGGGTCAAAGGGTTAC
+CCCCAATATCTTTTAGTACACAATCAAATCCGTTGATTGGTACAGTGCCTCGTTCAATCC
+TCATTCGATACTTCATGTAACGTTCGCTCAATAAGCGATGTGCACGTGCGAATGCATGAG
+GTGCACTATCCGTAGCTTTCGAATAATCTAGGTTGAACATGCTGAATGATTTATTCAGTT
+TGGATTCTTGATTCGATGTGAGATGTTGCTTGATGTATACTTTTTGGAAGTTGCGCTTCG
+CAAGTATTTCTTGCTTAGCTTTGCAAATTCTTTTGTGTGCATAGGCTTCTTGGAACAATG
+CATCACTGCCCAGACTCTTTGCAAGTTGAGCTTGTGTGACAGCATGTGTTGATGGAAATT
+CAGAAGCGACGTTATCAAGAACAAGGTCAATTGCGGCACTATTTTCAATCGAATCAAAAG
+TGACGTCTGAACGATCAACAGACGTCAAAA
+>Locus_12_Transcript_1/1_Confidence_0.000_Length_1279
+GGGGGGGTCTCTCACGCTAACAATTACTAATTTGTCTGGTGTTCTGGACGATCCCCGTAT
+TATTCCCCCGGGTCTGCAATATCGTCCAGCTCATCTAAATCAGTTACAGATCTTCCTCAT
+GCTTCCTTATTTCTCCCAACGCATCTCTACTCCAGCTGGCTTGCTCAATATCGCGAAGCT
+TGCTAATCCTCTGCTTTTTCTTGAGATTCTTTTTCTGGCTTTTTGTTAAGCTAGCTGGTA
+TGGTTGAGGAGCTTTCAGGGAAAGTGTGCTTGCCCACTAGTGTTTGAGCTCCTTTGTATC
+CTAGTGGGTCGGCTAATTTTGTAGGGTCCTTCTCGTAAAAGGCCTCTATGTTCTCATAGT
+CTTGCACCTGTGCCTGTTGGACAACCCTTATAGACTTCCTCATAGCCTCTTCCATTTCAT
+GTTGGGCTTGGTTTATCCAGTGTGTGAGCTTGTCCATGAAGTCTTCAATTTTCATTTTGT
+TGTTGTAGACTTCATCGAGTTCTGAGTATAAGTCTTCATATTTACCCATAATTGTTATTA
+TTGCTTCTAATGATGGGAATGTTTTTATGACTTCCTCCAATTTGCTCCTAACATACTCTG
+GCTTAGCAAGTAATTTTTCTGTATGAGAGGATGTTAGATTGGTCAGACTCTTTTTCAACT
+CTTGCAAGTCTGCCATTAACTCTGGTTTTGATAGGTGTCTAGGTTTGGGCTTCACTGGCA
+TATGCTCGGGGCTGGTCTGCTTCGGTGTGTTGAGCCGAGTTAATAGCTCGTGTGTCATAG
+AGAATTCAGGGTTCAGAGCCAGTTCTGTTGTTAAGCCAGAATCCTCCATGGCGCCCCACA
+GGTCTGGTGCAAGGTCCTCTTGACCTAAGAATGTGCTTGTATCCATCTTGTGTCTTTTGT
+CTACTATGTTGGTCCTGATGTTTGTAGCCATGTTATGCAGTGCTTGATCTGCTAACGGGA
+TAGTCCATCCTCCCATAATTCTGAGCACTTCATAACGCACCAGGTTGTAAAGGTTCCTTT
+GGATGTAGTCCTTTATTGTTTCACCACCTTTTCGGGGCCACATCATTGATGGATAGAACC
+TTTCTTCAGCCAGCACAGGTATGAATATACCCAACTGATGGCTGTAGACAGCATCATACC
+CTAGTAAATCGAGTTTAAGTCTTGGTAACGCTTTCTGGAACCAGCTTTGTCCATTCGCGT
+CCACACTGTCCGTGCTGTCACCTTGCAGAAAGCCGACGTTCGGTGTGTTAGCGATTGTCT
+CTTTTACTTGTTGTTCTAA
+>Locus_13_Transcript_1/3_Confidence_0.400_Length_270
+GGTATCCTGTAGTTGGACTCAAACAAGTCCCTCCTTCCGCTTGACAGACGCTGGAAAATC
+AAAGCCGGTGGTCTCGAAAGGCGGAAGAGTGAGGATTTTGGTGGGCGATAGGTGCCAAGT
+GTTAAGGGTTGTCGTGGGTTGATAGTCGTTAAACGTCAGCGAGGGTCAGTGGCTTACCAG
+GGTCTAAGGATATTTGAGATGTGGACTTTTGCTTAGAGAGGAAAATGCAAGTGAAAGAGT
+CAAGCTATAATTGTAAATGGTGAACTACAA
+>Locus_13_Transcript_2/3_Confidence_0.600_Length_223
+CTTCTGAGAAATCAAAGCCGGTGGTCTCGAAAGGCGGAAGAGTGAGGATTTTGGTGGGCG
+ATAGGTGCCAAGTGTTAAGGGTTGTCGTGGGTTGATAGTCGTTAAACGTCAGCGAGGGTC
+AGTGGCTTACCAGGGTCTAAGGATATTTGAGATGTGGACTTTTGCTTAGAGAGGAAAATG
+CAAGTGAAAGAGTCAAGCTATAATTGTAAATGGTGAACTACAA
+>Locus_13_Transcript_3/3_Confidence_0.400_Length_213
+CTTCTGAGAAATCAAAGCCGGTGGTCTCGAAAGGCGGAAGAGTGAGGATTTTGGTGGGCG
+ATAGGTGCCAAGTGTTAAGGGTTGTCGTGGGTTGATAGTCGTTAAACGTCAGCGAGGGTC
+AGTGGCTTACCAGGGTCTAAGGATATTTGAGATGTGGACTTTTGCTTAGAGAGGAAAATG
+CAAGTGAAAGAGTCAAGCTATAATTGTAAATAG
+>Locus_14_Transcript_1/1_Confidence_0.000_Length_123
+GATTGAAACGGATAGAGTTAACGAAACTCGGCTGCATTCATCCGATCGGCCTAATGGATC
+AATAGCGTTCGCATCCTCGATGAGGGCAACGTTATCGTTAACTATTGGGTAATTGATCGG
+TGT
+>Locus_15_Transcript_1/1_Confidence_0.000_Length_436
+AGCCAGAGCATCCTGTCTAGCACCCCTCTGCGTCCCTGGTGCATCTCGGTGTACATTCTT
+AACTTACCTATTTAATCACCCATGCGAGAACGATACTACGAAGATACTGAACTCAATAAC
+CTCAGCTACAGTGAACAAGATAAACAGCTAAAACAAATATGTCAAACGAGTACCTTAGAT
+CAATCCTCATGCCTGAGAGAGGTCCCTCCAGTATACCAGACGACAACGTCCGCCGTCATT
+GCGTACGACAAGAAACAATCACTGCGAACATTGTGGTCGGATCTTCTGGAAAAGGGGCCT
+TTGTTCTGTTCCCTAACAATCCTAGCAGCCTTATTGGCGCTCATTTTAAGTATGATGACC
+AGGGCAAATCTTACAAATACACCCAATCACTCGTTGTCGCCCAACGCCTCAATGAGTCCT
+ATAATTACGGAAGAAA
+>Locus_16_Transcript_1/1_Confidence_0.000_Length_152
+ATTACGGAAGAAAGTCCGCAGGAGTCATATACATCAGAAGTTCCACACTCCCATCAGGAG
+TCTACAACATCTCAGGAACAATCAATGCCGCCACGTATGAAGGCCCACCTTCGGAGGTAG
+GATTGCCAGAGTACAATAAGATATTATCTATA
+>Locus_17_Transcript_1/3_Confidence_0.400_Length_1889
+TTTTATCCAAACAAAATCCGTCACTTTTTCCATTACTCCATCCGGGCGGGACTGGTTCGT
+AGTTGCGGCTGATAATGCTTATTGCAAACCCTCATTACGTGTAATTAGACGAAGTCTCCG
+CAATAACACTTCGCCCTTCGATGTTGAAAAAATCAGTATCGATGCCGAGATACTTAATCA
+TATTCAGGCGTCCGAACTTGCTCAACTTTTTTACAAATCAGTAAAATGTCGAATAATGGT
+TTGTTCGAACGAGTTTGTCGAACAAATCGAACCACAGGTTTTTGAGCTTTTGAATACCAA
+CGCAATGATCGCGCTCCCGAACCCAAAGAAAATCAGAACGCACATTGTTATGCCCGAAGA
+AACTGTCATAAAATTTGTCGGACCGCGACCTTCTGTATCCCTGATGCAGAATTTTATCGA
+CAACGTCTTTGGATCAACCGCATACGTTGATCAATCTCTAGATGCGTGGATGGTGCACAA
+TTACGACCTCACGATGTACACTGGTGGTCTTCAATTCTCACGGGTTAAGGCCATTTACGA
+GATATCCAGATACGACTGTTTAAAACCAGTGTTAAAAACTCCAATGTACCACTCACGTCA
+GTACACCAGTAGAGAATCGCGACTTGCGCTTGACAAAAGGAACAAAAACGTGCCCCAGAT
+TAACGGAGTTGTCGATGTTGAAACTGTGACTGATGAAATGCTTGAAAGGTTTGTCGAGGG
+ATGTCTTGACAACGCAAAATTGAATATCTATAATTGCGATAAGATACGGATATCAGAGAA
+CGAAATACATGAATGGTTGAGAAGTCAACCTACTGTCGTCGTCGATCAGATCGTCCCCGA
+TTATCCCCTTCATTTGAGTGAAGTGAATTACTACAACTTTTCTATTAAGCGCACCCCAAA
+ACCTAACTTAACTATCGACGCCACACGCACGTACGCCGCTCTTCAGACAATAGTTTACCA
+TGAAAAACATATCAACGCATTATTTTGTGCTGCTTTTAAAGAACTAAAGCTACGCGTTAT
+GCGTTGTCTGAAAGATTACATCCATATGTTTACCGATATGTCGCCCGACGAATTCGCTGA
+AAAGCTTACGCAATCTTATAAGGGTTTCGTCGCGATGTTTTCTGGTGATGATTCATATAT
+TTTTGACGGCGCGTACAAACTCGAGATCGACATCAGTAAATACGATAAATCCCAAGGATA
+CTTGGCCCTGTGTTATGATTGCAAAATAATGCGATTCTTCGGATTTCCAGAATGGTTGGT
+CGATCTATGGTTTAATGGCCATGTTCTCACGTTGATCTACGACAGAAACGCTGCGATGAA
+ATGTCTCATTCCTTTTCAACGGAAATCTGGCGATGCGTCGACATTTATTTTGAATACCAT
+CTTCCTAATGGGTGTAATATCTCACCAAATTCCTCTCAGTCGATTATCCACAATAAACCT
+AAAAAAATACTGTATTCCGGACAACTTTGCGTACATCTTTAATCTTGAAGTGAAATTTTT
+TTCCTACGAGCACCCATACTTTTGTTCAAAATTTTTGTTGTTTGACGGAAGGAAATTTTA
+TTTCGTTCCTGATCCATTGAAACTTCTAGTAAAACTTGGGCGATCAGATATGATTAATAA
+ATACCACGTCGAGTGTTACCGTCGTTCCGTTGAGGATAGTGTTAGGCATTACTCAGATAT
+GTACGTTCCCCATCTTCTTGTCCCCGCGCTTAGAGAAAGGTATAACGTTGAATACGATTA
+CCACTACGTTATACTCATGATGGCAAATATTCACGAGAGAGAATTTTTTAGTAGTCTGTA
+CTTTGAGGAACAGGGAGCTAACATTGATAAAAATAGGCTCCAATTCGCCGGTATGCGCGA
+TGAGATAGGTAAGCTACTTTAACATAGTC
+>Locus_17_Transcript_2/3_Confidence_0.400_Length_2274
+TTTTATCCAAACAAAATCCGTCACTTTTTCCATTACTCCATCCGGGCGGGACTGGTTCGT
+AGTTGCGGCTGATAATGCTTATTGCAAACCCTCATTACGTGTAATTAGACGAAGTCTCCG
+CAATAACACTTCGCCCTTCGATGTTGAAAAAATCAGTATCGATGCCGAGATACTTAATCA
+TATTCAGGCGTCCGAACTTGCTCAACTTTTTTACAAATCAGTAAAATGTCGAATAATGGT
+TTGTTCGAACGAGTTTGTCGAACAAATCGAACCACAGGTTTTTGAGCTTTTGAATACCAA
+CGCAATGATCGCGCTCCCGAACCCAAAGAAAATCAGAACGCACATTGTTATGCCCGAAGA
+AACTGTCATAAAATTTGTCGGACCGCGACCTTCTGTATCCCTGATGCAGAATTTTATCGA
+CAACGTCTTTGGATCAACCGCATACGTTGATCAATCTCTAGATGCGTGGATGGTGCACAA
+TTACGACCTCACGATGTACACTGGTGGTCTTCAATTCTCACGGGTTAAGGCCATTTACGA
+GATATCCAGATACGACTGTTTAAAACCAGTGTTAAAAACTCCAATGTACCACTCACGTCA
+GTACACCAGTAGAGAATCGCGACTTGCGCTTGACAAAAGGAACAAAAACGTGCCCCAGAT
+TAACGGAGTTGTCGATGTTGAAACTGTGACTGATGAAATGCTTGAAAGGTTTGTCGAGGG
+ATGTCTTGACAACGCAAAATTGAATATCTATAATTGCGATAAGATACGGATATCAGAGAA
+CGAAATACATGAATGGTTGAGAAGTCAACCTACTGTCGTCGTCGATCAGATCGTCCCCGA
+TTATCCCCTTCATTTGAGTGAAGTGAATTACTACAACTTTTCTATTAAGCGCACCCCAAA
+ACCTAACTTAACTATCGACGCCACACGCACGTACGCCGCTCTTCAGACAATAGTTTACCA
+TGAAAAACATATCAACGCATTATTTTGTGCTGCTTTTAAAGAACTAAAGCTACGCGTTAT
+GCGTTGTCTGAAAGATTACATCCATATGTTTACCGATATGTCGCCCGACGAATTCGCTGA
+AAAGCTTACGCAATCTTATAAGGGTTTCGTCGCGATGTTTTCTGGTGATGATTCATATAT
+TTTTGACGGCGCGTACAAACTCGAGATCGACATCAGTAAATACGATAAATCCCAAGGATA
+CTTGGCCCTGTGTTATGATTGCAAAATAATGCGATTCTTCGGATTTCCAGAATGGTTGGT
+CGATCTATGGTTTAATGGCCATGTTCTCACGTTGATCTACGACAGAAACGCTGCGATGAA
+ATGTCTCATTCCTTTTCAACGGAAATCTGGCGATGCGTCGACATTTATTTTGAATACCAT
+CTTCCTAATGGGTGTAATATCTCACCAAATTCCTCTCAGTCGATTATCCACAATAAACCT
+AAAAAAATACTGTATTCCGGACAACTTTGCGTACATCTTTAATCTTGAAGTGAAATTTTT
+TTCCTACGAGCACCCATACTTTTGTTCAAAATTTTTGTTGTTTGACGGAAGGAAATTTTA
+TTTCGTTCCTGATCCATTGAAACTTCTAGTAAAACTTGGGCGATCAGATATGATTAATAA
+ATACCACGTCGAGTGTTACCGTCGTTCCGTTGAGGATAGTGTTAGGCATTACTCAGATAT
+GTACGTTCCCCATCTTCTTGTCCCCGCGCTTAGAGAAAGGTATAACGTTGAATACGATTA
+CCACTACGTTATACTCATGATGGCAAATATTCACGAGAGAGAATTTTTTAGTAGTCTGTA
+CTTTGAGGAACAGGGAGCTAACATTGATAAAAATAGGCTCCAATTCGCCGGTATGCGCGA
+TGAGATAGGTAAGCCACAACCCTCCCCGGATGTTATCGAGAAGCTGGCCTCAATGACAGG
+AATTGATTTCAAGGTTGAACTAGTAGTGACAAACTTCAGAGAGAAACTAATAGCAGCTTC
+AAGGCATTCGATCCCTACAAGTAACAGGGTTGAACCCAGAACAATTGTAGAGATGGACAT
+GCTGGGCTGGGACGTAACTCACACGGAGTTTGGCTTCACACCGGTACTGTCAAAAGAACG
+ACTATTCAAATCAATAGCCTGCCCACAACCACCAAGTAGCACCTTTCAAACGAGCGTGGC
+AAAACAGGTACACAAGTACATTCAGAATGTAGCTCTGTTGTACGTGGGTGCCTGGGCTTA
+TCCATGCATAGCACAGACCGTAGAGGGGTATGCTCTAAATCATTGGAACACTAT
+>Locus_17_Transcript_3/3_Confidence_0.200_Length_456
+GAACAATCATGTATTAACCACTATACTGATGAACAAGTGGTCTGAGATAGGTAAGCCACA
+ACCCTCCCCGGATGTTATCGAGAAGCTGGCCTCAATGACAGGAATTGATTTCAAGGTTGA
+ACTAGTAGTGACAAACTTCAGAGAGAAACTAATAGCAGCTTCAAGGCATTCGATCCCTAC
+AAGTAACAGGGTTGAACCCAGAACAATTGTAGAGATGGACATGCTGGGCTGGGACGTAAC
+TCACACGGAGTTTGGCTTCACACCGGTACTGTCAAAAGAACGACTATTCAAATCAATAGC
+CTGCCCACAACCACCAAGTAGCACCTTTCAAACGAGCGTGGCAAAACAGGTACACAAGTA
+CATTCAGAATGTAGCTCTGTTGTACGTGGGTGCCTGGGCTTATCCATGCATAGCACAGAC
+CGTAGAGGGGTATGCTCTAAATCATTGGAACACTAT
+>Locus_18_Transcript_1/1_Confidence_0.000_Length_725
+CGCAAACTCCTAAACATTGCAATGCTTTACGTGAAATAAATATATTGGAAGACCTTTCAT
+TCGATCACATTATCGAAAGCGACGAATCTGAAGAATCCATGGTATTGCACCTTGATGCCG
+AAAGAGAACGAGACAAGATAGTTGCTAATCTTTTTGAACAACATCGCAAACTCCTAAAGG
+ACGGAAACAATACATATAAAATTAATGTGAGTAAAGCACGTTTTACATCTGATCGTTTCG
+GTTTTCTAAAGACTTCCGGGTTTTTGTGTCGCTCTGGAGTAAAAACGGCTGAAATGCTAC
+ATCGCTTCTTCACCGGTCCAATAAATAGCGCTGTCTCAATTGGTGGACCCGGCGGAGAAG
+TTCAAGCTCTCTATCAGGAAAAATTTTGTCACATCCTGGGTATTACTCTAATAACTCGAC
+CTGGAATTGATTTTGACGTTTCAATCAAAGAGATCTCCAAATTTCGTCAACTTCTTGGAG
+ACAAATTTACAGGTGATATCACTGATTTCGACAACATGAATAGTCTCCGCCAAGAGATAC
+TCGATTACTTCCCTGATGGTGTTGACTTCTTTGGTGGAGATATTGCTGGACCGCGAGACG
+ATCATATTGAAGTTGACTTTACTGACGAACAACGTCTCTTATTCGCTGAGGTTCTTCTCG
+CTCTTTCCGTGCTCACCCTTGGTGGTAATGCCTATTTCAAAGTTTTTGAAATTGTTTCAC
+GAAAT
+>Locus_19_Transcript_1/1_Confidence_0.500_Length_164
+ACCATTCAGGTTCCACTTCCTTTTCAGTTTAAAGTAAGTTTCTCGGCCAGAGTTGGGCAA
+TTTCATTACTCTATTAGGGGGAAAAAACAGCAATTTGCTGCTCGATTATGACGAAGTCAT
+TTGATCCGCTTCACATGTGACGTCGTCTTTTTGTTGGGCCTGTC
+>Locus_20_Transcript_1/1_Confidence_0.000_Length_191
+CCCCCCCCACCTTCGCAATCACAGACAAATTAAACGTAAAACAAACGACATGGATGCATC
+CAACCCTATTATTTCAAGCGATAGGAGCACTGTGAATCAGGTTTATGCGAAGATGGTGAG
+GAGAAAACGGCAAGATCTTGCCTATCTCCAGGAGTTGGTGAGGACAGCCCATCGAGAGAT
+TCTCCCCCAAG
+>Locus_21_Transcript_1/1_Confidence_0.000_Length_919
+TTAAGAAAACCAGTTACATAGATAACACACCCAAACTTAAACCTGACAGCAAGGCTGGCC
+CTCCCTTCCAATCTAAGTATAGGAAAGGAGACATGTTCAGTAGTATACTCGCACTAGCAG
+ATGACGCACTGCTAGGACTTAGTGAAGTTATACACGGTAGAATGGATAGACATAAGTATT
+TCAAAGACAGAATCTATCTTGCGATGTGCTTCCTGTTCCCTAAAGAAGAAAGATATGAAG
+CGAGTAAGTTAACCACGAAAACACGCAATATAGCAAGCGTGTGTGGAGTCACACATTACT
+TAATGCTCCATGCCATGGAACCCGTCATGGAGAAGAGTAAATGGAATTGCATGTCCTCAG
+AAACCTATGAAAACCCCAGCTTATCAAAGTTCACACCTTACTTCGGCAATTTACAGAAAT
+TCTTAGACTTCGGCCTGCATCGTGAGAAGAAGAAGGTCTTTATGCCTAGAGGGGCAAAAC
+CCACACATAGAGACTTTATTTATGCAGATAATTGGTACATCTTCTACCGAAACGAGGACG
+GCACTACTGACTACTACTCCCTTGACTTGGAGAAGGGTGAAGCTAATGCGACCCCCGACA
+TAGCCCAATGCATTAGCTACTACCTTCTAACGCGCGGTTGGATTAGTGATGACGGTATTG
+TGGGGTTCGGCCCGACCTGGAGTACATTTTTAACACAAATTGTACCAGCATGTATAGTTG
+ATAATATATCAGTATACTACAACATGCAATTAAGATTCCCAGGACAGGCCAGTGGCAACA
+CATACACATTCCTCATTAATCATGCTGTGACGACCAAGTTAAGGCAGGAGTGGCTCAATA
+GAGGGTGTCCTCGGCCAGGCTCAGCAGAGTTCACTCAATGCTGCAAGAAAACAGGAGTCA
+ATACAAAAATAGAATTCCA
+>Locus_22_Transcript_1/1_Confidence_0.000_Length_312
+ATCGAAAAATTTGTCAAATCTGCTAAGAAAAAACTAACAGATGAATGTTTCCCAGTCGAA
+GCTTGCAACGAACATGAACCTGAATTCGATGAATCAGATTTAGGTACAGGAATAACCTAT
+TCACCCATTTATGCAGTCGTCAAAGTACAAAAATGTGAACTTCCTGCAACTCCCGTGCCG
+TTTGATGAACCTGTCGAGAAGGATAAACCAGATACAGAAAGGATAGAGGTTGGTGATATA
+CGCAAATCTATGGATGAATTCACACGCTACCTTAAATTCACACATGATTCAGAAATTAAC
+AATATGAAATCA
+>Locus_23_Transcript_1/1_Confidence_0.000_Length_197
+AATTGAGATTAAATGACAAAACTCCGGTCTATATCAAAAACTATAGAATGCCAGAAAGTC
+AAAAACCAGAAATTCAAAGGCAAGTTGACAAATTAATAAAAGATGGCATCGTCGAACCAT
+CTATTTCAGAATATAATAGCCCTCTTCTCTTGGTACCCAAGAAATCACTGCCTAACTCGG
+AGGAAAAGAGATGGCGA
+>Locus_24_Transcript_1/1_Confidence_0.000_Length_549
+AGTTCAGATACTGAACGTTCTTCTGTTGGCAATTCTACGGAACTTTCATCTTGATCGTCG
+GATAACAATCTGAAAGTCTCAATGTCCATCAATGCATCAAAGTGGTTATCGCCATTATTA
+ATTACGACAACATCACCAGAACAGAAGAGTTCAGAAGTTTGTACGGTATTATTGGAATCG
+ACCAAAGAGTGGACAATGACATCGTCAATTTTTTCGTACAGATGTGCTCGAACATTGTAA
+AGTTTGCAAAGGAATTTGAGGTGGATATCAGTAGTGAACCAACCGTTCTGATCACGTGGG
+TGGTGGTTTTCACATAGCGCGCGCATAGTTTTGAAATCTTCAGTTTTCCTTATTGAAGTG
+AGGAATGCGTGCAACAAACAGTCTCCATCACGTGGGACTGGAATCAATTGAAGATTGTCA
+GGGACAGATGTTTCAAGTGGCTGTGAAATTTCCTTCATCTCAACCGCTTCTTCAGGGATG
+TCGAAAAAGTCGTTTCGCGTATTTTTCTTTGCAGGCCGTGTGAAATAAGTAAAAATGTTT
+TTTCCGACA
+>Locus_25_Transcript_1/3_Confidence_0.400_Length_162
+ATTACTTGAATTTTTCAACACTTCAATACAAGATTCCTGACAACCACATTGTACCTTCTC
+CACTAAGTGGTTGCAATCCTATGGTAATCGACGATCAACTCTTTAACAAGCACATGAACT
+GATGGACTAACTAATGGGCAAGCAAGGTGTTTTAGGCATTCG
+>Locus_25_Transcript_2/3_Confidence_0.200_Length_363
+ATTACTTGAATTTTTCAACACTTCAATACAAGATTCCTGACAACCACATTGTACCTTCTC
+CACTAAGTGGTTGCAATCCTATGGTAATCGACGATCAACTCTTTAACAAGCACATGAACT
+GATGGACTAACTAATGGGCAAGCAAAGTGTTTTAGGCATTCGCTGTTCTGGTCAACCGAG
+GTGTAAGCACTCATGTTCCCTGTCGCCTGAAACGACAGGATGTCTTTGTTTTCCGCAAAA
+CTTAAGACTCCGAAAATGGTCAAGACAAGCAGCAGGCAGCATGATAAAGCGGGGGGAATG
+AGTTTGTTTTCCCTGGTTGCCGTGGCTTCCCTGGAAAAGCCGCAGGAAAAGTGAAGGTGG
+TGC
+>Locus_25_Transcript_3/3_Confidence_0.200_Length_182
+TGCAAGCACTCATGCTCCCTGTCGCCTGAAACGACAGGATGTCTTTGTTTTCCGCAAAAC
+TTAAGACTCCGAAAATGGTCAAGACAAGCAGCAGGCAGCATGATAAAGCGGGGGGAATGA
+GTTTGTTTTCCCTGGTTGCCGTGGCTTCCCTGGAAAAGCCGCAGGAAAAGTGAAGGTGGT
+GC
+>Locus_26_Transcript_1/1_Confidence_0.667_Length_138
+CATTATGTAATTGTGTGTGAGTTCGTTAAATCTAAGACGGAGGAGTGTCTGTGGCTTTGG
+TCTCCGCCTGTGGCTTTGATTTGTGTTGGATGCAGTTGAGCTTTGACCGTGACAGAAGTT
+AATCGGTGCAAGGAGGAA
+>Locus_27_Transcript_1/3_Confidence_0.429_Length_532
+GGGAACTTTCAATTAGCCCAAAAAAACTGAAAAGTGCAAAAACAAATCTGTGGGCAATTC
+AGAGACTTTGAATTCAGTCTCGATTGAAGGTGTTGCAAACGTCCGAATGCCAATTATCAA
+GTCGGGGTTCGAGGAGGTTATCTCAAGACCCCTTCCTCTCCCTCGCAACAGTTTTCACTT
+TCAGTCCAATAAATTTTCGTAACAAAATGGGGAAGGGAAAGAGCGAAGAAAACAAGGGAG
+CATTGTTGTCCGATTTTCGAGGGGAAGCCAATAGACAGACGGACTGAGGGGATTTAAGCA
+GTTGGCGGGGGGCAATGAGAATGACTGACGGATTTGGTATTTTTTCGCTGTTTGAGACAC
+AAAACTAGTTGCACAATTTCGGGACGCACTAACGGAAGCCGATGGATATGGAAAACTCAA
+AGAAAAGGCTCAAAAACGCAAGTCATTGGGGCGAATATGAAAAGCAATATAACTAAATGC
+GTAAAATTGGTTTTTTTTCGAGATGTTTACGATTTGCTACACTTTTACCTCA
+>Locus_27_Transcript_2/3_Confidence_0.429_Length_792
+CCTTCCTCCCATCGACAGCGTGACAAAGCAATTGTCGTAAATCAGGAGCAGGCAGCCGGA
+GTTTGGGCCAGCTAAGCTTTTGTCTTGAGCATTTTTCGGCTAACCGCCCACAATGCAATC
+TTAAGTTTTACAGAGTTTCGTCTGGCCTGCTGTCTTTATTTACTTTCATTTGGCTCGTGG
+CCGGCTGCGCTTTTTCCTTCGATTTTTGGTGAGAAGGAAGAGCGAATGTGTGCACGGAAT
+TCCATTGAAAAAAGCTTAAAAGGAACTTTCAATTAGCCCAAAAAAACTGAAAAGTGCAAA
+AACAAATCTGTGGGCAATTCAGAGACTTTGAATTCAGTCTCGATTGAAGGTGTTGCAAAC
+GTCCGAATGCCAATTATCAAGTCGGGGTTCGAGGAGGTTATCTCAAGACCCCTTCCTCTC
+CCTCGCAACAGTTTTCACTTTCAGTCCAATAAATTTTCGTAACAAAATGGGGAAGGGAAA
+GAGCGAAGAAAACAAGGGAGCATTGTTGTCCGATTTTCGAGGGGAAGCCAATAGACAGAC
+GGACTGAGGGGATTTAAGCAGTTGGCGGGGGGCAATGAGAATGACTGACGGATTTGGTAT
+TTTTTCGCTGTTTGAGACACAAAACTAGTTGCACAATTTCGGGACGCACTAACGGAAGCC
+GATGGATATGGAAAACTCAAAGAAAAGGCTCAAAAACGCAAGTCATTGGGGCGAATATGA
+AAAGCAATATAACTAAATGCGTAAAATTGGTTTTTTTTCGAGATGTTTACGATTTGCTAC
+ACTTTTACCTCA
+>Locus_27_Transcript_3/3_Confidence_0.429_Length_618
+CCTTCCTCCCATCGACAGCGTGACAAAGCAATTGTCGTAAATCAGGAGCAGGCAGCCGGA
+GTTTGGGCCAGCTAAGCTTTTGTCTTGAGCATTTTTCGGCTAACCGCCCACAATGCAATC
+TTAAGTTTTACAGAGTTTCGTCTGGCCTGCTGTCTTTATTTACTTTCATTTGGCTCGTGG
+CCGGCTGCGCTTTTTCCTTCGATTTTTGGTGAGAAGGAAGAGCGAATGTGTGCACGGAAT
+TCCATTGAAAAAAGCTTAAAAGGAACTTTCAATTAGCCCAAAAAAACTGAAAAGTGCAAA
+AACAAATCTGTGGGCAATTCAGAGACTTTGAATTCAGTCTCGATTGAAGGTGTTGCAAAC
+GTCCGAATGCCAATTATCAAGTCGGGGTTCGAGGAGGTTATCTCAAGACCCCTTCCTCTC
+CCTCGCAACAGTTTTCACTTTCAGTCCAATAAATTTTCGTAACAAAATGGGGAAGGGAAA
+GAGCGAAGAAAACAAGGGAGCATTGTTGTCCGATTTTCGAGGGGAAGCCAATAGACAGAC
+GGACTGAGGGGATTTAAGCAGTTGGCGGGGGGTGTAGAATCATTCCCCCGCCGATGGGAG
+GAAGGATGCCGGTGATGC
+>Locus_28_Transcript_1/1_Confidence_0.000_Length_404
+TATTCTCAATATGGAAGTGGTAAACTGGCCCCTCTCCAAACCTTTTACAGGTATCTCCTA
+CATGGATGCAAGCGCAAAATTTGTACTCGAGAGCAGCAAGCATAAAATTCTCGAGAGTTG
+CGAAGGACATTGCGGAACCTTCGGGAGCTTGCAAATTGGAAAGAATTTCGCCGGAGTTTT
+TGAACATCGGAAGATGAGCTGACGAAAGCAGACGCCTTTTAACGAAACGCGGTTCGTCAG
+TTGTGACACCAACGTCTTTCATGGACACATAAAAACAGTTTCCATTGGATTTATTTGGGA
+CGAGACTCAATGGTGTGTCACAGTCTACGTGGTCGAACAAATCTTCACTAATGTAAGGAT
+CCGGGTGTTCATCGGAGGGGAGGGAATTTTCAATTGCTTCATAA
+>Locus_29_Transcript_1/1_Confidence_0.000_Length_870
+AGATGTTAGTAAAATAAATGTTTTTGGATTTTAGAGTCGCGTTTATAGCGAATAGCTCTA
+TGAATTTTTTAGGTGGGGTCAGAAACGCCGGGTGATTGAGCGGTGTCTTTATTTATTTCC
+GCCCAAGGAGAGAAAGCCGAGAAAGTATGAGACGACGACGATGAGGACGACGACAAACCG
+TGCATTGTCAGTTTTGACACGGAAATAAGTGTGAAGCGCAAGTGCTTGGATGGCGTATTC
+AAGTACAGTGGATTCAGGTACGAACATTACCCAAAGAAAAGCTAGGCAAGCAAGCATCAC
+CTGATTCTTCTTCGGGATATCGATTACAGCGGGTATGAATATAATTAACCCGGCAAATTT
+AAACGCATTTTGGCCGACCCAGGTGGTGAAAGAGTTGTCATAATTTGAAAGCCAGTCGAA
+TAATACTCCTTCTTTCGAATAAAAATCGTGGGTGAGGAATATACCGAGAGTGAGAACAAT
+CGTGACGAGGAACGTCGGGTTAGCTAGAGGTCGAGAAAAGGTATTGAATATTTCATCAAT
+AGCCTTGGAAAAATCGCTGGATGACGAGGGAATTTTCGGACGTGAAGGCGAAGGGCGAGG
+GCGAGGAGACGCTGCGGTTCTCATCGTAATGGTAGCCGAACGAGCGCGTTGTGTTGGCGC
+CGAAGCACGACGGCGTGGACGTGAAGGACGCGAGTTGTTAATTTGTGGAGCAGACATGAT
+AATTGTAAATATGTTTATGACAAATTAGCTTTAAAGGTAAAATAAACAATCAACGGAAGG
+AAAAGCACAATAAGGACTGCGATCCAACTGCGAAAACGACTATAGATTTTTATAGAAAGG
+ATAAGTAATGGGGCAGAAATTATTATTACA
+>Locus_30_Transcript_1/1_Confidence_0.000_Length_395
+ATGTATATTCTATACTGGTTAACACGTTGCTTCGATACTGTAAGAGTTGTGAAACTCCAT
+TCATCACGTCCAGCATCCAGTGAATTGCATATCATTTGTCAAGGATTTAAAGTCTCACGA
+AACGTCAGTCGCGAATTTGCAATAAGTTATGAATTCACTTGTCCTCCAGAAGAACGTGTT
+TTTGTACCTAGGAATGTACCGTCCAACGTCGAGGAGAGAAGTGTACCAAAAAACTTTTTC
+CAAAACACCTTGAAAATTCAGCGCGAATTCGACGCATTGAACGTGTCTGCTGTTTCTCTT
+CTTCTCCAGCATTACGACTTCGCAGCCGCTAAACGCGAGATAATTTTGCGCCCTGAGAAA
+TACATTGTTGAGAGTTACCTAAAAGTACTTTCATA
+>Locus_31_Transcript_1/1_Confidence_0.000_Length_373
+GATATTATCTATAACCAGCAATCCCATGGACAAACTAGGAAATGTGGGAGTACTTGAGGG
+TGTAGCCGTACTGACATTACCAGCCAGTTATGATATTGATTATACACGACTGGCAGATCT
+ATCACCAAGCTCTGCTAAGAATGGATGCGTGGTCAATGACAGTGGTCAATCTCTCATCTA
+CACTCAGTACGATGAAATCAATTACACAGGATCTCAGGAAAAGCAACTGCTATCATTCAA
+CATTGATAGCAATATATTGGTCACAACTACAGCTACTCTTGACTTCTACACCACAGCTTC
+AGATGCCCAGGTAACCATTAAAATCAAGTATCTTGGCATTGATGGTCTAGTGGTGTCAGA
+GAATGAAATAATT
+>Locus_32_Transcript_1/5_Confidence_0.286_Length_124
+CGCAGGAAGGGTGAGGGTGGTGCAATTTGGAGTCTGGCCGCGCGATTAGCTAAGCGCTGC
+GACCATATAATCGCATTGACAACTCCGATTTGTGTGCGGGAGTCGAGGAAGTGCTCCACT
+TTAT
+>Locus_32_Transcript_2/5_Confidence_0.286_Length_124
+CGCAGGAAAGGTGAAGGTGGTGCAATTTGGAGTCTGGCCGCGCGATTAGCTAAGCGCTGC
+GACCATATAATCGCATTGACAACTCCGATTTGTGTGCGGGAGTCGAGGAAGTGCTCCACT
+TTAT
+>Locus_32_Transcript_3/5_Confidence_0.286_Length_111
+GGTGGTGCAATTTGGAGTCTGGCCGCGCGATTAGCTAAGCGCTGCGACCATATAATCGCA
+TTGACAACTCCGATTTGTGTGCGGGAGTCGAGGAAGTGCTCCACTTTATTG
+>Locus_32_Transcript_4/5_Confidence_0.286_Length_242
+GGTGGTGCAATTTGGAGTCTGGCCGCGCGATTAGCTAAGCGCTGCGACCATATAATCGCA
+TTGACAACTCCGATTTGTGTGCGGGAGTCGAGGAAGTGCTCCACTTTATGGCAGTCACAA
+TTTCATGTTTGAATGTTTCGCCTCGATAGGATTCGGAATGGGGATTTTCGAATTGCGATT
+TGGTCCGCTGGCCTGGCCTGGACTGGCTGGCCGCTTGTCCGATTCTATCGAATGCGTGTC
+TC
+>Locus_32_Transcript_5/5_Confidence_0.143_Length_193
+GGAGTCGAGGAAGTGCTCCACTTTATGGCAGTCACAATTTCATGTTTGAATGTTTCGCCT
+CGATAGGATTCGGAATGGGGATTTTCGAATTGCGATTTGGTCCGCTGGCCTGGCCTGGAC
+TGGCTGGCCGCTTGTCCGATTCTATCGAATGGGCGTCCATTGTGTTCGCGGCAATCTCCC
+TCCGCCAGATTTG
+>Locus_33_Transcript_1/2_Confidence_0.667_Length_263
+AGTTGAAAATGAAAAGACCATTATCGGTATAATAAATCTATTAAAAGCATCAGTTAAAGG
+CGAATCGCCCGATGTCATCAAAGCAAAAATGCCTAGTACACAACAGCGCGGCAAAACTGC
+AGCGCAATATACCACGGAGATAGAAAACCTACGTGGGTTGCTCGAAGCAGCCTATATAGA
+TGATGGTTTGGATTCCAACAATGCAGACAAATTCGCTACAAAGGAAGCCATATCTGCAAT
+GACCAAGAACTGTGGGCACGATA
+>Locus_33_Transcript_2/2_Confidence_0.333_Length_227
+TATATTAAAAGCATCAGTTAAAGGCGAATCGCCCGATGTCATCAAAGCAAAAATGCCTAG
+TACACAACAGCGCGGCAAAACTGCAGCGCAATATACCACGGAGATAGAAAACCTACGTGG
+GTTGCTCGAAGCAGCCTATATAGATGATGGTTTGGATTCCAACAATGCAGACAAATTCGC
+TACAAAGGAAGCCATATCTGCAATGACCAAGAACTGTGGGCACGATA
+>Locus_34_Transcript_1/1_Confidence_0.000_Length_790
+ACCAAAAAAAGAATTAGAAATGGCTTCTTGCAAATGATACCTACGTGAAGTTAAGTTTAG
+CTGGACAGGTGAAAGTGAGCAGTCAGTACAGCCGTATTGTTCAATCGAGCAGTTTGAGAC
+ATAACCGCTGGACAGAATAACGGAAGAAGGAGGGTAATTACAACGGTATGTGGAATAAAT
+ATCATTGATGTCTTGTTGGGGGTACTGAGTGTGGAATTGGAAGGGATACCTACGGACAAG
+GATTTTGGAGAAATCGGAAAGTTCGGTACCCTCAAATACGAGAATAGGTTTGCAGTCGGG
+ATCGTAGAAACTATAGAAAAGTTCAATGTACTCACCGATACCGAGATGGAAGAAATACCG
+GGGAGTAGACAAAGTATGATGCGAATCGACAGTGAAGAAGTGGTTTAGGCAAATGTCAGT
+AAAAAGGGCAATGGTAGTGGGATAACGGACAGCAACAAGTGACTGGGACATTTGGTGTGC
+AAGATTTCTATAGGAGAAACGATAATTTTTTCCGTTAATACGAAAAAGAAATGAGGACTT
+GGACAAAGTGATATTGTAAGTTTGGTAAAAGGATGTCACCGAACCACGGTAACCAGCACA
+GTGAACAATATCGGAAGAAAAGGTATGATGTACAATATTCCGTCTGAAGGAACCAGAGGT
+ACGCGGGAAACGTGGGCATTTGACACCGAATATTTTGTCCCAAACAGAAGCTTCGTAAAA
+CCCATTGAATTTGTCATCGGGCAATAAAGTAGCGTTGGTGATGAAGTGTTGGGATTTATA
+ATGGATCATA
+>Locus_35_Transcript_1/1_Confidence_0.000_Length_166
+CCTTGAGCGGGGCTATAGTCCAAAGAAGGTGCTAGACCTGTACGGGTGGCGAAGCGAACG
+GTTGGTTGCTCCTTGGAGTCGGGTTGCCTGGGATCGCAGCCCAAAGTTGGTGGTAGACCT
+CATCTAAGGCTAAATATGGCCACGAAACCGATAGCAAACAAGTACC
+>Locus_36_Transcript_1/1_Confidence_0.000_Length_445
+TGTTTGGATAAAACTCTTCGACCGTGGTGTACTTTCGAAATGGCCGACACGAGGAACAAA
+GTGCATTCGTTCTCCCTGAACATCCGATAAACGCATATTTTTCATATGAAAAGTAGCGTA
+TGAAGTGTTCACTGGACACTCCGACACAGTAAGTTCCTCGGAGTAGAAACCATTATCGAC
+GGCTCCGACTGTAGTTTTTAAGAGACGTCGTATTTTGTCAGGTGAGGCGAGTTGAAAGAC
+ATTAACGTTGTCCACTTTGATTTTTTTACACACAAGATCATCCGTTCTGCGTGTGTAATA
+GACAAGTTCTTCAGTATGACGAGTTAAAGCGACTAAGACGTACGGATGTCGCAAGAATAC
+GTCCGTCTGTGGATATTGGTTAAGTCTGACGAGGTATATGGTTTTAGCCTCTTTGCCTTG
+GAATTCATGTACTGTCGAGACATTA
+>Locus_37_Transcript_1/3_Confidence_0.600_Length_140
+TGGGTCACAAGTGTGCTGACAAAGGTATATTGCCAGATGACTCCAAATATGAGGTAATAA
+AGAACTGCCCCAAACCAGTAAACGCAGACGAAGCTAGACGCTTCGTGGCATTTTGCAATT
+ATTACAGAGGATTTATTAAG
+>Locus_37_Transcript_2/3_Confidence_0.400_Length_145
+TTATTTAGGTCACAAGTGTACTGACAAAGGTATATTGCCAGATGACTCCAAATATGAGGT
+AATAAAGAACTGCCCCAAACCAGTAAACGCAGACGAAGCTAGACGCTTCGTGGCATTTTG
+CAATTATTACAGAGGATTTATTAAG
+>Locus_37_Transcript_3/3_Confidence_0.400_Length_160
+TATGAAAGAGGCTGCTTATTTAGGTCACAAGTGTGCTGACAAAGGTATATTGCCAGATGA
+CTCCAAATATGAGGTAATAAAGAACTGCCCCAAACCAGTAAACGCAGACGAAGCTAGACG
+CTTCGTGGCATTTTGCAATTATTACAGAGGATTTATTAAG
+>Locus_38_Transcript_1/1_Confidence_0.000_Length_243
+CAACGTTCTCAATAATAGTGACAAAAGGTCAACTAATTTTAAATATAAAGGTTTCAAAAT
+TTCTGTTACAAAGTGAACAAACAATTCAGAAAGACTATCAATGATGTGATAAATTTTAGG
+GTCAGAAAGAAAGCCGGAAAGGAATTGATGGAGAAAATCGACTAACTGATCGACCAAAAA
+GAGTGCAATATCGATCAGAACAGAAAAGATATGAGACGCCTGTTCACCTAAAAAACCAAA
+AAA
+>Locus_39_Transcript_1/2_Confidence_0.667_Length_187
+ATTAAAACAGAGGAGACAGATGGCCCTTGCGAGCGTTGACTGTCTCTGATTTCTGCCCAG
+TGCTCTGAATGTCAAAGTGAAGAAATTCAAGTAAGCGCGGGTCAACGGCGGGAGTAACTA
+TGACTCTCTTAAGGTAGCCAAATGCCTCTTCATCTTGGAGACCAGCTGCGGATATTGGTA
+CGGCCTG
+>Locus_39_Transcript_2/2_Confidence_0.333_Length_164
+GAAACCCGGGTTTCGACACAATGTGATTTCTGCCCAGTGCTCTGAATGTCAAAGTGAAGA
+AATTCAAGTAAGCGCGGGTCAACGGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAAT
+GCCTCTTCATCTTGGAGACCAGCTGCGGATATTGGTACGGCCTG
+>Locus_40_Transcript_1/1_Confidence_0.000_Length_1029
+ACTTTTGGATCCCTTGCTATAGGATGGTCTCCAGACCCCGCCAACAATATCTCAGGCAAT
+GATACTCAAAACCTCAACCGAGTTATGGCCTGCAGGCCCTCCTCAATGAACCGCATGAAC
+CAAACGACTGTCCTAAACATTCCTGTGGCAACCACCCGTAAGTGGTATCTCACCAAAGGC
+AACCCTGATGACGCCCATCATGGATTCATCAATGTGGTTGTTGCTTCCACCACCGGTGGA
+TACACAGGAAGCACCACCTTCACTGTCACACTCGAATGGGTGATTGAGTTTGAAGGTGCT
+GAATTAGGAGCTGTCTCCATTGACGAGGATATCACTCCAGATACTGGTTTCCAGGACCTT
+TTTACCACCTCAGATGGTTCCTGGAACAATGACTACCTTACAATGAAAATGCACCATGGG
+GGACAAATGGTCCCCTTTTCGGCTGCCCACCAGGCTTATGTGTATACAAATGCACCAGGG
+ACAAATGTAACCTACTATCTTGAAGACAAGACGACCTTGAAGACAGCAAACTTCTTTGCA
+GTTATACAAGGTTACTCTATCCCAGGTTTTGTTATGTTTGCCAGTTACACAGATGCAAAA
+GATTATATTCGCACTGGAGATACTGGCAAATGTCTCAAGTATTACACCCAAGGTCCTGTC
+ATTAGCCCTCCCATCCCTAAATTTAGGGTGGCTGATGAAGCAGTTCAGACTGTCGAAACC
+AATCTACTTCGCCGCATTGACCAGCTGACCGAGCAACTTAGAGCAGTGAATACTCCAGTA
+ACAAGAACTGTTGCTCTCAGCAAGGACACGGCTAAGATTAGGACCAAACTTGAGGGTATG
+CCTGATGGAACGACACTCAGTCCTTTCAAAGTGATATCTGAAGACCCAGTGGCCGCTCAA
+GATTTTGAAATTGTATAACCTCTCCCCAAAACCCATCATCTTTTCATAATCACCACCCCG
+TCCCTCCTCGGTGGCTCTCTGGTTACTACACAACTGGAGAGTGTGAGTTCGATTCTCTTA
+GGGGCACCA
+>Locus_41_Transcript_1/2_Confidence_0.667_Length_155
+CAACTGGACTCCAATTTCGACTCGGATGCGGCCCAGGTGGCCAGCTGCAGTTGCTGGGCG
+GCAATAAAACATTTACCACCGAATTAGCCCAGTCGGAGAGTAGTTCAAGTAGTTTAAGTG
+CAAGACCACTTAAAATTCAGTTACGACTGCTGCCC
+>Locus_41_Transcript_2/2_Confidence_0.000_Length_213
+CAATTGCTGACTGTAACCTTTCGCCCAATAAGTTAGCTGCAGCTCCAGCTCCAGCTTCAG
+TCTGGACTCCAATTTCGACTCGGATGCGGCCCAGGTGGCCAGCTGCAGTTGCTGGGCGGC
+AATAAAACATTTACCACCGAATTAGCCCAGTCGGAGAGTAGTTCAAGTAGTTTAAGTGCA
+AGACCACTTAAAATTCAGTTACGACTGCTGCCC
+>Locus_42_Transcript_1/2_Confidence_0.333_Length_3138
+TCTCCCCCAAGGAGAACTTCTCCATGAGTCGGAGGCCAAACAGTATGTAGCCGAATATAA
+GGCTCGACTACCTGTGGTTGACACTAAGAAAGTTGGCGAACTGCCAACTGAGGTCTTCCA
+GGTAGCACTCCCAAGTATCCCTGTTTGTGGGATTATGGATGCTGTTGGTGTCCCGTTGCA
+CCCCCCATCCATTAACAATCGGGGTGGGCATACTCATGTCACTCGCCAGATGGGCGGAGT
+ACCCCACCCTCCTCTTGGTCTAATACCCATAGCTCAGAAGTATGGGGTAGAGATCTTGGA
+CCAGAAACATGTCTACACAGGAGGCACTTGGGATGGCTTTCTTAATAGACTCGCCCAACA
+GATGGGCCGGACAACGGTCCCCCTGGCAAGAACAGTTTCAGCAGGCAAAAAGAATGCCTC
+TGATAGGGCAATCATAAAACTGTTAAATAAATACATGCCTAGGACGGGAAATAAGAACTG
+GCCTGGTGTCCATACAACCCCGGAAGAAGGCATACTTGATGGTATCAAGATAACGGCCAA
+ATCCAGTGCAGGCGCTCCCTATTGGAGACACAAGGGGGAATGCCTAGACCATATAATTGA
+TACTGGACTTCCTGTTGTGCTAAAGCATATAAAGGAAGGAACCCTCAACCAGTTGTGGCG
+GGAAAACCCTGAGATGTTCCTCGTTGAAGTTAAGAACAAACTTGATAGATACGAAGTCTC
+GAAGCTTAAAGAGAAGACTAGACCCTATGTGTGTGTACCTGCGCACTGGGCTCTCCTATT
+CTCGTGCTTGACTCAAGGATTCCAAGAAGGACTTCAAGTTTTTAGTAACTTGGACCCCAG
+TACAGAATGCTCGAATGCATATGGATTTTCATCCATTGCTGGAGGGCTTACTAGGATGGT
+CGACTGGATGTATGCCTGCCCAAAGCGGCGGGGACGGGTTGTCTGTTACGGTGACGATGC
+ATGTATAACATTTTGGAGCCAGGGCGTCCTCTATCGGGTGGATCCAGATTTTAAACAAAT
+GGACGGGTCCATAGATAGAGAGGATGCAAGAATCACCATTGAGTGGGTCCTCCACCATCT
+CAGAAAGGATTTAGGTGTAGAGGAGACCCCTGCTTTTTGGAAGACAGTTGCAGCAGTGTG
+GCTTGATATGGCCATTGACCCCCACTTTATCGTGGATGGTAAGACTGTTTACAGGAAGAA
+GAACCCCCATGGACTCATGACTGGAGTTCCAGGAACAACCTTATTTGACACTGTGAAATC
+TGTAATAGTCTGGAACGAAATGTTGGATCAGGCTAGTGCAGGTTCCATAGACCTTTTAAA
+TGAAGCTCAAGTAGTTAAATGGATGAAGAGACAAGGCTTGGTTGTCAAAGAGGGAACTTG
+GAGTCCGGTTGCACTCCCTGCAAGGGACACAGAGGGTCTAATTACGGACCACAAATTTCT
+TGGTGTACAAATTATGGGAGTGTACCACAGACACCGTGTGATACATGTCCCCACAATGCC
+TGAGAGCGATGCTCTTGAGATGATGCTCTGCCAGAAGGATAACCCCTTTGAAAAGGCAGT
+ATCTAGAACTGCACACCAAAGAACTCTGTATGACCGTATGAGGGGTTTAATGATAACAAT
+GGGATTCAGCATACCTCGGATCGAAGAGACAATACACGCTGTGGTTAATACAATCCCCGG
+CGAGATTATTGTCATGCAAACGCAAGAGCAAACCGGAACGAAGCCAGAACATATAACCCT
+CCAGGACTTTGAATATCCAGATTCGTCTGGATTCCCCTCTCGGGACTTCTGTCTAGACCT
+CTATTCAGATGGAGGGGATGACAAAGCGGGATGGATTAATCTGTTCCCCACATTGTCAGG
+ATTCCTTGACGAGTTTAAGAGGGAACAGAGAGTGGCTGTGAGGCAGATAAATTTGACAGT
+CCAATCCAACGACTATGATGTCAAGGAGGTTGTAGGATGTCCTCCTCCTCCTGAGGCGAA
+TCTGAATGATGAGTACAAAGTGTTTGAGGCTCTTAAACCTCAGCAAGTCCAGTATTCAGA
+ACCGAACCCCAGACCCAAAGTAGTTCGGATTACAGAAAGTGGTGACATCCCTGAGAAATT
+CCTACCAAATATGGCTCAAGCCGTCGTTAGATGGCTTACCTCAGTTGGAGGTGTTTCTCA
+GGTTGGTACTGTTGCCGATAAAGTTGGAGCCAGTGCCTACCAAATTGTTGTGGGTGCTGC
+TAAAGGGGGCTATTTCACTACTGGAGATGAACTTGGAGACTTGATTTCCCTATACCCACT
+AGTGACTCCCTTCCCTACATTGCAGGACAGTCAAAGAGAAGAAATGGAGGAAAATCGTAA
+TCTGATTGATAGGACTACTGCAGCCAGAACGTCAGCTTTGAGACGGGGGATTGTAAAAAC
+CCAACCTGAGCTCATTAATCTGGACGTTGCAGGAGTATCCAACCTCCATCCACCTCCCTA
+CGATATAAATACAGCAGAGGATGCCATGGCATATGTCCATGCAGTGGTCAGCGGGAGATT
+TTCAGGATTCACTAAATGGATATCTGAGGTACGGCCAAATGCTGCCAATCCTGTTGGAGT
+TAGGCTCTATGCCCACAGCCACCATACCCAGGACATGAAGCTGTTGGGAGAAGCCTGGTC
+CTCCTCTGCCAAACTGGCTAAGGAATACATCTGTGCAGCTATTTTGGAGGTTAACAACAT
+CCCATACAAGAAGTCTAGCTTTGCGACCCCTAATGTAGTGCCTCCCCCGCCTGAGTCTTC
+CTGGGCTCGGCAGGTTGAATACGCAACTGCCCCTAAAGCTGTGCCACAGATTGTTCCCGT
+TCATGAAACCCTGGATTTGGAGCTGTTTCACAGTATAATGCAGCAATTCCCAGGGCACTG
+TCCCCGCCAGGTGCAGATGCTTATTAGAGAGGTAAGTCATAAAAATCCTGATGACTACCG
+TGTGAGAATTCAAGACTTATTCTCCCGGTTTCCACCTCCTAAAGTAGCATCGAAGAGATC
+ACTGCTGAGCGCAGAACAAAGGACGAGACTCAACAAAAAGACTCTCGACCGCAAAAAGAG
+GAAGAAAATTGCAAGTAAGCTCTTGCCAACCCTATAACATCAAACAACCCAAACCTCAAA
+TCAAGAATACAATTTGCA
+>Locus_42_Transcript_2/2_Confidence_0.333_Length_597
+TTCTGAGGTACGGCCAAATGCTGCCAATCCTGTTGGAGTTAGGCTCTATGCCCACAGCCA
+CCATACCCAGGACATGAAGCTGTTGGGAGAAGCCTGGTCCTCCTCTGCCAAACTGGCTAA
+GGAATACATCTGTGCAGCTATTTTGGAGGTTAACAACATCCCATACAAGAAGTCTAGCTT
+TGCGACCCCTAATGTAGTGCCTCCCCCGCCTGAGTCTTCCTGGGCTCGGCAGGTTGAATA
+CGCAACTGCCCCTAAAGCTGTGCCACAGATTGTTCCCGTTCATGAAACCCTGGATTTGGA
+GCTGTTTCACAGTATAATGCAGCAATTCCCAGGGCACTGTCCCCGCCAGGTGCAGATGCT
+TATTAGAGAGGTAAGTCATAAAAATCCTGATGACTACCGTGTGAGAATTCAAGACTTATT
+CTCCCGGTTTCCACCTCCTAAAGTAGCATCGAAGAGATCACTGCTGAGCGCAGAACAAAG
+GACGAGACTCAACAAAAAGACTCTCGACCGCAAAAAGAGGAAGAAAATTGCAAGTAAGCT
+CTTGCCAACCCTATAACATCAAACAACCCAAACCTCAAATCAAGAATACAATTTGCA
+>Locus_43_Transcript_1/1_Confidence_0.000_Length_1002
+TATCAGCCTGTTAAGCTTGGATAGACCGATGCATGAGCAAAATTACGCACAGGTCCTATA
+CCAACAGAAGACCATCGAAAAGAAAGAGGCAAAATCAAAGGTTAGCAACCCGCTATACAA
+ACGGGATACAGAGACCTACCACGAATACACAACGCGTATGGCGAGAATGAGGATCAATGA
+CGACATGGTTGGTCCTCACTGGGAACCAATAATAAACCTGGTTACCAAACTCTATCCGCG
+GGAGGCTACAGGAGAGAACCAAAAGTCTAGGGAATCACTGACAAGGGTTAAGATACGAGG
+ATTATTGGAAGACATGGAAAGACAGTTAGAAAGCAATAACAGATCAATGGATGTATGGTA
+CAATGCATACCTAACAGGAAAGAAACCAAGTGGAGTCGACAAAAAGTTGGCAACATTACT
+AGTCCTGTTAGCACCAAAAAGAACTAAGAAACTGCCTTCAGGAGTTTATCAAAAACTACT
+TGGGTACCCGCCCATAGATAAATCTCCCGTTCCATCTCTTACATCTGATGAGTCGTATCT
+TTACGACATGAATTCCCTAGAATACAACCGGATAGCATACGTAAGCAAATTGAATGAAGA
+TGACATCACAGTTTATGCCAATAAGTACATGGTGTACAGCAGCACCATGTTGTCAAGCCT
+TCTACCAGACAAAGTAGATTGGCCAGAACTGAGATCAATGAACGTCGAGGGCGCATCGGA
+TCCTTATCAAGTGAAGGGCTACAAAAAGAAGGAGTTGAAGCCACGGTTTGGTGAGGAGAT
+ACTAGACGATGAGCCAACTGGCAAGAAGTCATCAACAGAAAAGAGAAGGCTACAGAGGAA
+AGGCCAAAAAGCCAAGTTGCAGAGACAAGCTGCAACAGGCACAACATTTGTTAGAAAACC
+ATTAAATTAACTCCGGGAGGGGGGGGACTAAATCTTGGTAAGGAATAGACCATCCGCCAC
+TGGCTTAAGAACCAGGTCCCTAGCCGTTAGACTAAAAGCAAG
+>Locus_44_Transcript_1/1_Confidence_0.000_Length_557
+TACAATGTCATTGTCCTCTCCACGCACTCTTCGCAATCGGTCAAGTGCGGCCCTCCTTCC
+GGGGGGATCAGTTTGAGCAGTCTGAGCTGATACAATTCGGCGTGGGGCTATTCTAGGAAC
+AGTTGCCGGTTGGTTGACAAGTGAGTGCGAAATAAGCCTGCGGACAGCATGACTTAATTC
+CCGAGCTTGTTCCTGGGATGGCCCCTTCCCTTGATTTCTGTCGTATATGTCGTCGACAAG
+GTCCTTAACAGCATCGGCTTGTTCTTGGGTTGGTGACGGCCCAAGCATCATAATGTAGCT
+GTCATAGTGTCGTCTTTGGACACGAGGTGGTATTGGCTGGGACCAATCGTCACCCTTTAA
+CCACATTATGATTTGTATGCCAGTAGGCAATGACTCCTGCTCCATCCAATAGGATACAAA
+GTCATCCACAGTGTACGACTCTTGGATCGAGGCGTTATTGCTATAGATTCTCCGTAACTT
+TGCATCCTTTTGGTTCTTCCGAGCAATCCTCATTGCTAGTTCCGTGTCTTCTTTCGATAT
+TCTTCCTCTTGACATTA
+>Locus_45_Transcript_1/1_Confidence_0.000_Length_631
+CGGAGAGGGGTGTCCGCACCAATTAATAAGCTAACAAATGTAACAATCATGAGTGACATT
+TTCAATCAACAGGGACTGAAATCCAAATTTTCGAACATTGTCAAGAATGAAGGACAAGGT
+GACTCGGACATCAGAGAGGTATTCAATGAATTAGCAAGACCTCAAGCCGAAGTTGGCCGA
+GACATAGAATATTCAGAACTTAGTCAGGCATTAAATGACAATGGCGTTAAAGTCTTTAGA
+CCGCAGCCGTTTGATGAGTTGGTTAATATTCCCTTTATAGAGGCCGCATCTCCTAGAATG
+ATGGCCCTGTACGGGGAACTGTTGGATTCCAAAGACGTTTCACTGCCTGTTGGCTCTGGC
+CTGCACATACCAACCTATAAGCCAGGCCATGAGGTCACCCCACCCCTCCTCACTTTACCT
+AACTCGCTTTCCTATGAGTACATGCATTACATAGCTAACTCAGCTAATGACACGTGGGAC
+AAGCAGACTTATGAGACCCTTAAAGAACTACTTGTAACTCAAGCTACAAATAGGTTCTCT
+ACTGGTTCCCTACTTGGTCAAGTGAAGAGGGTTGCGGCCGGCCAAGATGTGGCATATGGA
+AGAAAAGGTCACCATAAGAATAAGAGCTTTA
+>Locus_46_Transcript_1/1_Confidence_0.667_Length_178
+CAAGGCAAAGCTAACGGTAAGCCGAATGGTAACATCACTGCTGGAGAAACCCAGCGTGGT
+GGCATACCTCGAAGGAAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCG
+AAAGCTGGAGCTCAGCCACAGCCTTCCAACAACCGGAAGTGACCCCCCACCCGCTAAA
+>Locus_47_Transcript_1/1_Confidence_0.000_Length_940
+GAATAAGAGCTTTAAAGAAATGGGGATAACTCCCTATCGTGTGATGGAGTGGCTTGATGA
+GTACATGCCACTCAGTGATGACGAGCCTGAGATAACCTTATCAAACACCCTTGACTGGCT
+TGTATACACGCCAGAAGAGGCTGAATTGATGGGGGTCCCAGACTCGTTACCAGACATCAC
+ACAATCCTCAGCAGCGGGTCTCCCCTGGCTGGGTAAGAAGAAGGGCGAAGTTGCCGTATC
+TGCTCTGATTACGGCGAATATGCTGATAAAAGACGTGTCGCAACTTCTGAAAGAAACCCT
+CTTTACTGGATCCAACAATCCATTGGATCCCAAGAAGGAAGGTGTAGCAGAAGTTGCGAC
+AAAGAACCCCAGGAGGGCAGCAGACCAATTCTCCCGACAGGTACTCGATAGAATCATTAA
+AGAGTACTCTTACACAATGATGGGTCTACTTTTCCCGAAAGGAGAGCGGTATGCCATAGC
+TGACCATTTAACCAAGACTAGGAATATTTGGAGCGCCAGTTATGTCACACACCTAATCGG
+GTCAACAATATCAGACCAGCCAGCAAAACGCATGCTAAACGTCCTTACATCAACATCAAG
+GACGCCATCCCTAGCTAAGTTTTCTCCAACTCAGGGAGGGATGGAGGCTCTTATTAATAT
+CATCCTCAACGCAACAGATATAGTGGAACTAGTATACGCTGATAACGCATACATATACTA
+TCCGAACGAAGATATATGGTATAGCATAGACCTAACAAAAGGCGAGGCTAACTGTACACG
+CGATGTGGCAATGACAACAGCCATGTACCTATTAACAAGAGGTTGGACATCGAAACAGGG
+TACACCTATATACAATTACACATGGGCATACTTAGCCTTGTATGGTATACCATATATGAC
+CGTGGACTCAATTAGTGTATTAAAGAACTTCCAGATAAAG
+>Locus_48_Transcript_1/1_Confidence_0.000_Length_372
+ATTGACGCGGCTCACCTCCGATTATCTCGAAAACCGCCCTAAGTTGTAGTTGTTGGGACG
+GCTTGTTCAGACGCTCAATCGTTTCCTCGATTGACAATGGGTCAAGGTTGTTGAAAGGCC
+CGTTCATCAACCGTACGAAAGTGTCGGCGATCCTCGCGATACGGTCGCTTGGTTTCTTGT
+CGTTGGCGACAAAGGTTACCCTGCGTTCAATTGATTCAGACATTGTCTCCCAGCGTTTAA
+TCATTGGCATCATCATACAGTCACTCACGATAGGCAAGGTGTATTGGCGTGCGCTCACTT
+CTGGTACATCTGCGTCACTGGTTACTGGCCAATGGACGCGTGGCATTGTAGGTTTATACA
+CAGTTGGACTAA
+>Locus_49_Transcript_1/1_Confidence_0.000_Length_499
+AACCGCCAAACAGTATACTGCGGTATTGTGTAGACGAGTGTTCGATCTGGACAATCAGTC
+CAGGGTCTACAATGGTGGATTTTGTGATAACCGACCTTTTCTAAACCAACTATTCTCAAT
+GGCAGTTGTAAAAACCATTCCTTCCAACTTGTTCGGACGCGGCTGGCGATGAACTCACCA
+GCTTCGCACCAATCCCAAACTGGATGGACCCATGCAGCACCTCCACTAACCTTGTATTCA
+ACCAGGTTGTTCTTGATGGTGAATGGTGAGTCAGCATCAAAGCCACTCACTTTCTTCGGG
+TTGAAGGTGTGTAAAACCACTGGACGCATGTGCTCTAACAGCACATCTGGCTCGGTGACA
+TAATAATCAACATCAACACCAACGATGAAGGCGTCTTCCGCTGGTGTATCATTGCGAAAG
+TCTTGCGCCAGATCACCGACGGCGAAGTGGAAATGGTTCCGCAGTCCAGTGCTGGAATTT
+GGGTTCGGGTTAACTTCAA
+>Locus_50_Transcript_1/1_Confidence_0.000_Length_132
+TATAATGGATCATATCCGCGAATATATCACTGACATGACCCATTTTTAAGTTGTTGGTGA
+ACAAGTCATGTTGAAGAATTTCCGCGCTGACAAAGCAAATAAGCACGAGGAACACAAACA
+TTTTGATATGAC
+>Locus_51_Transcript_1/1_Confidence_0.500_Length_320
+TCTCTCACGTGTTTTTGTGGACCCGCTCGCAACGACGACAACAATACAAGACCCACTGCG
+TACACTGCGAAAACTGCACCTCACAGCAAGAGATCCTACGATACCACTAGCTGACGCGGC
+TTGCGACCGCGTCGAGGGTTATCTTTGTACCGATGCGCTTACTCCGTTGATATCGGATTA
+CTGCAAAATGGTACTACGGTTATACGGGCCGACTGCCTCCACAGAGGAAGTCAGGAACCA
+ACGTAGAAGCCGGAATAAGGAGAAACCCTACTGGTTAATGTGCGATGGATCATGGCCACA
+GCATCCGCAAGACGTCCATT
+>Locus_52_Transcript_1/1_Confidence_0.000_Length_112
+TACCATCGAGAAAGAAAAGTTGGATATGCTCTCGGGATTATCCGCCACACAATCTGTCAA
+CGCTAGGCTTATCGGTATGGGGCACAAGGACCCACAGTACACATCTATGATT
+>Locus_53_Transcript_1/2_Confidence_0.333_Length_220
+ATGCTCATCTTAGTATATGTTGATGATTTGATTCTAGCGTGCCAGTCAAGAGAAGATATG
+GAGGATCTGAAAGCCAAGATTTCGGAGTCTTCGAGTGCACGGACAAGGGTCCACTGCATT
+TGTTCTTAGGCATGGAGGTGCAACGAGATGGCGACCTTGGAGAAATCACTTTGGGCCATT
+CGCAATATATCAAGGAACTATTGCGGGCATATGGCAGCGA
+>Locus_53_Transcript_2/2_Confidence_0.333_Length_144
+GATTTCGGAGTCTTTCGAGTGCACGGACAAGGGTCCACTGCATTTGTTCTTAGGCATGGA
+GGTGCAACGAGATGGCGACCTTGGAGAAATCACTTTGGGCCATTCGCAATATATCAAGGA
+ACTATTGCGGGCATATGGCAGCGA
+>Locus_54_Transcript_1/1_Confidence_0.000_Length_244
+CCGAGGAGACTCGGGATTTGTTTCTATCGGACGGTCAAACCATCCCAAGCTCTCAAGAGA
+AGATTGCCACAATACACGAGTACCTCCTGGAACACAAGGAGTTAGAGGAGGCAATGTTCA
+GCTTGATAAGCCAAGGGAGAGGCCGGTCTCTTATCAACATGGTAGTAAAAAGCGCTCTGA
+ACATCGAAACCCAGTCTCGAGAAGTCACCGACGAAAGAAGGCAAAGACTAGAACGAAAAC
+TTCG
+>Locus_55_Transcript_1/1_Confidence_0.000_Length_246
+ACAAGTCACCGTCCACTCTATCCTCTCCAACCCACATAACCAACACTTCCCAGAACTTGG
+GCTACGGAGGTGCATTCATGATCCCAGTAACCACAGTTCCTGGGCAAGAATTCCATAACA
+AGGAATTCAGCATTAATGTGGACTCCGTAGGGCCAGTTGACATCTTGTGGTCTGGTCAAA
+TGACTATGCAGGACGAATGGACTGTAACTGCAAATTATCAACCATTGAACATCTCTGGCA
+AGCTAA
+>Locus_56_Transcript_1/1_Confidence_0.000_Length_450
+ACCTTCAAATAAGGCCGACAGTCCACTAATGCCGCTTGCGGCGACACCGATAGGGCCAGG
+AATGTTGCTTGCAGCAGCTAAGGAGGACTTGATGATAGCTTTAACTCTCTCCCACATTGA
+TGCGTTTTGCGCTGCGATGACAGCAACCGGCAAAGATTTGGCAACCGTACGGTATTCTTG
+AAGTGCTACCTCATCAAGAGGTGGCGAGTCATGGCCGAATTGATACAGCATAGCATTAGG
+ATTGGGTCTGTACTCAATGCAAGACCATGCCTTGAGTATGGCGGAGTTGACTGCGCCAGT
+GGGGGCAGAGACACGGATGACAATGGTGTCCATATTACCCCAGCCAACAGTGCCACTGGT
+GTTTTCGTCTCCTGCGGACAAGGTAAACGGTTGGCCCGTAGAACCTATATCCACATTAGA
+TGGTGGCAATGTTTGGATACCCTCCAATAT
+>Locus_57_Transcript_1/1_Confidence_0.000_Length_260
+TTAACTTCAAATTTAGATCCTCCTACAGATGTTATAGCCTCGTCGATTAAACGACGGGCG
+GCATCACGTACGGCTCCTGAAACGGCATGCCCGTTGTTAAAGGCACGCTTAGGCGTTACG
+GTACGCAGGCTGTCAAGCGGATAGAAACGTGTTTCTATCGGGGTCTTCGTTTTGTCAATG
+ACAGCCCGTTGCAATGCGCGTGTAACTCGGTTCCCTCCACTCTGGGGATAGGGCGCAATT
+GCCCCATAGCCCCAGAACTT
+>Locus_58_Transcript_1/2_Confidence_0.333_Length_476
+CCGAGTCTCCTCGGAGATTGCCTTTGCAGCGTTTCTTGGTATCGGTTGGTCCAACTCTTC
+CAGGAATGGGTTCGTGTTCATGAATGGGTTCATGCTCGCGGACCCGGCTGTCCAGTGCGG
+GAGGGTCTGTTTTGGGGTTCTTCTCTTTACGTCTCCCATATCTTTTATCTTTTTGTCCAG
+AGATGTCAGGGTCTTTACTTGAACTAATCCTGGTGAGTTCCCAAGTAGTGGAATCCCAAG
+AGAGTCCGTCAATTGGAGTTTCAGGTTGATGCCAAAAACTTCTCCCACACTGGACCCGAC
+AACGGATCCTGTGAAAGCTGCAAATGGTGCCTTCCCCAAAACTCCACTCTTTAGTAAGTC
+GTCTGCTGCATAAATGGCAAGCTGGTGGGACGTTCCCGTTACCTTGTTTGGTGATGTCGA
+GGATGCGAGTCTTCCTTCTAATAATTGATAGCATGGTAGGAGGATGTAATCGCTTC
+>Locus_58_Transcript_2/2_Confidence_0.333_Length_368
+TGCAAGTAACTTGGCCCTCGGGGCTGTCCTTTCTCAAAACGGTCATCCCATATCTTTTAT
+CTTTTTGTCCAGAGATGTCAGGGTCTTTACTTGAACTAATCCTGGTGAGTTCCCAAGTAG
+TGGAATCCCAAGAGAGTCCGTCAATTGGAGTTTCAGGTTGATGCCAAAAACTTCTCCCAC
+ACTGGACCCGACAACGGATCCTGTGAAAGCTGCAAATGGTGCCTTCCCCAAAACTCCACT
+CTTTAGTAAGTCGTCTGCTGCATAAATGGCAAGCTGGTGGGACGTTCCCGTTACCTTGTT
+TGGTGATGTCGAGGATGCGAGTCTTCCTTCTAATAATTGATAGCATGGTAGGAGGATGTA
+ATCGCTTC
+>Locus_59_Transcript_1/1_Confidence_0.000_Length_123
+ATAAACATCAATTATGGAAACAACACCAATGGTGACAGCTCGTTCAGTGTGGACTCATCA
+TTTACCATCAATGTCATTGGGGGCGCCACCATTGGCGTCAACTCTCCAACAGTCGTTGTT
+GGT
+>Locus_60_Transcript_1/4_Confidence_0.600_Length_282
+GCCACAGCATCCGCAAGACGTCCATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATG
+TCTGGGAGAAGATTACACGTGACAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAG
+ACGGCGTTATGCCGGGCTCCGTGGATGAATCGTTACCTAAGCTTAACGATGCCAAGCAAA
+CTCGCGCTAATCCAGGAACTTCCCGACCGCATTCAAACGGCGGCGGAAGCAGCAATGGGA
+ATGAGCTATCAGGACGCACCGAACAACGTGCGCAGGGACCTC
+>Locus_60_Transcript_2/4_Confidence_0.400_Length_217
+GCCACAGCATCCGCAAGACGTCCATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATG
+TCTGGGAGAAGATTACACGTGACAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAG
+ACGGCGTTATGCCGGGCTCCGTGGATGAATCGTTACCTAAGCTTAACGATGCCAAGCAAA
+CTCGCGCTAATCAATGGGAATGAGCTATCAGGACGCA
+>Locus_60_Transcript_3/4_Confidence_0.400_Length_168
+AGGGAACCGAGTTACACGGATCATGGCCACAGCATCCGCAAGACGTCCATTACACTCATT
+GGGCGTTTTGCCGCAATGAAGGATGTCTGGGAGAAGATTACACGTGACAGCGAGGAGAGC
+GCCGCTGCATGTACGTTTGATGAAGACGGCGTTATGCCGGGCTCCGTG
+>Locus_60_Transcript_4/4_Confidence_0.100_Length_204
+GGATCATGGCCACAGCATCCGCAAGACGTCCATTTGATGAAGCAGGTTTTAATCAAGCGT
+ACTAGAATTGACGAAGATCAGGTCGATGCACTCATTGGGCGTTTTGCCGCAATGAAGGAT
+GTCTGGGAGAAGATTACACGTGACAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAA
+GACGGCGTTATGCCGGGCTCCGTG
+>Locus_61_Transcript_1/2_Confidence_0.667_Length_164
+CACCGTCCTGCTGTCTATATCAACCAACGCCTTTCATGGGGTCTCATGAGCGGGAAGTTT
+GGCACTTTAACCCGACGTTTGGTTCATCCCACAGCGCCAGTTCTGCTTACCAAAAGTGGC
+CCACTGGGCACATTATATCATAACCTTGAACTTCATATCAGGAA
+>Locus_61_Transcript_2/2_Confidence_0.333_Length_147
+AGGCAATCAACGCCTTTCATGGGGTCTCATGAGCGGGAAGTTTGGCACTTTAACCCGACG
+TTTGGTTCATCCCACAGCGCCAGTTCTGCTTACCAAAAGTGGCCCACTGGGCACATTATA
+TCATAACCTTGAACTTCATATCAGGAA
+>Locus_62_Transcript_1/1_Confidence_0.000_Length_130
+TGACAAAGTCATTCCATCCGACCCTGAGGAGCTGTATATTGCTGTATCACTAACAGAATC
+CCTCAGGAAGCAGATACCGAACCTCAATGACATGCCATACTATGAGATGGGTGGCTATAG
+GGTGTACAAC
+>Locus_63_Transcript_1/1_Confidence_0.000_Length_371
+AGTGTTCGCACTTCCAGATCCCACTACCAGCACTCGGAGTTTCTTGGGTCGCCAGCGGGA
+GTATAGCTTACTCTGCTGCTGCAGCCTAGAATCACTCATAGCCGTTGGACATATGGCTTG
+AGAAAAAAGGCTAGCTCCCACTGCGCGCTGCGATTGTACCTCAATAACGCCTATAATGTC
+CACGCCCGAGAGCATGGTCTTGGGCATGGCACTGTAGGCGACCTGGCTCCCAGACTTTCG
+AGGGCGATTTCGCCCTCTTCGACGGGGTCCTTGAACCATTGAGCAATTCTTTCCCACAAT
+TTGACGAGAAGATGCGCTCTGTACGGTAACCTTGGGGGAACGACGGTTTCTGGTGGAAAA
+ATTGTTTCCAC
+>Locus_64_Transcript_1/1_Confidence_0.000_Length_172
+AGGGATGTTGTTTCCGTAAAGCGCCACGGTTCCTGTGGTGTCTCGTGCGCTCTATTCGGC
+CCTTGAAAAACCGAGGGAGGCTATTTGAATTTCGTGCCAGGCCGTACCGATATCCGCAGC
+AGGTCTCCAAGGTGAACAGCCTCTAGTCGATAGAATAATGTAGGTAAGGGAA
+>Locus_65_Transcript_1/1_Confidence_0.000_Length_158
+CTGGCAAGCTAATTGCAAACAGTCTGCGAACCCTAACATGGTCCAACACTGGTGTAGACA
+ATGGCAGCCACTACATGAACATGAACAACCTTAATGTCTCCCTTTTCCATGAGAATCCAC
+CACCTGAACCCGTTGCCGCCATAAAAATAAACATCAAT
+>Locus_66_Transcript_1/2_Confidence_0.333_Length_255
+GTACATGCATGTACTGACGAACTATCATGTCGATGAGAGGGAAGCATCGAGCTTCGATTT
+CTGGCAACTACTGAAACAGATAAAAAATGTTGCTGTGCCCTTGGCAGCCACCCTTGCCCC
+CCAGTTCGCACCAATAATCGGTGCTGCCGATGGGTTAGCCAATGCACTATTGGGTGATAG
+CGCCAGCGGAAGGCCTGTTGGCAATTCCGCTAGCGGTATGCCCATTTCAATGAGTAGGCG
+TCTTAGAAACGCTTA
+>Locus_66_Transcript_2/2_Confidence_0.333_Length_167
+GTTGCCGTGCCATTGGCAGCCACCCTTGCCCCCCAGTTCGCACCAATAATCGGTGCTGCC
+GATGGGTTAGCCAATGCACTATTGGGTGATAGCGCCAGCGGAAGGCCTGTTGGCAATTCC
+GCTAGCGGTATGCCCATTTCAATGAGTAGGCGTCTTAGAAACGCTTA
+>Locus_67_Transcript_1/2_Confidence_0.333_Length_210
+TGCAACAACTTTAATATACGCTATTGGAGCTGGAATTACCGCGGCTGCTGGCACCAGACT
+TGCCCTCCAATTGGTCCTTGTTAAATGCGCTGGATGGTGGTGGTTTTTGGCAAAACACAG
+TGGTGTCTCGATAGCGGGGCTACCAGTCACATGTGCTGTGACAGAGGTGTTTTTACTGAG
+TATGAAGAGCACACTGAAAAAATTAGTCTT
+>Locus_67_Transcript_2/2_Confidence_0.333_Length_155
+AGCGACACAAAAACAATGCTCCTTGTTAAATGCGCTGGATGGTGGTGGTTTTTGGCAAAA
+CACAGTGGTGTCTCGATAGCGGGGCTACCAGTCACATGTGCTGTGACAGAGGTGTTTTTA
+CTGAGTATGAAGAGCACACTGAAAAAATTAGTCTT
+>Locus_68_Transcript_1/1_Confidence_0.000_Length_211
+TGAAAACTCTTTTAAACCCAGCACAATTTATCTCAGACATTCCTGATGATATAATGATCC
+GACACGTAAACAGGGCCCAGACCATCACCTACAACTTGAAGTCAGGGTCCTCTGGCACCG
+GCCTGATCGTGGTCTATCCAAACACCCCGTCGAGTATTAGCGGCTTCCATTACATATGGG
+ATTCCGCTACCTCGAATTGGGTGTTTGATCA
+>Locus_69_Transcript_1/1_Confidence_0.000_Length_164
+CCAGAGGATTGGATGTTATTGACAGGATCCTATCGTAAGAGTAGTCAGACACTTCACTCA
+AGGTCCCTTGGAACCAGACTGCATTGAATGTTCCATTCAGTGCATAAACACCCGCAGGTA
+AGGTGCTGGACTTAATGCTTAGCGAGCCTGAAATCAGTCTGCCA
+>Locus_70_Transcript_1/1_Confidence_0.000_Length_147
+AAAAGTTAATTTTGTTAGTAAGAAAATTTGATAAAACTTACAGGAAAGGCGATAAAACTT
+TCCTTTTAACAAGGTTCGATTAGTACACACGAGAAGAACCAAGAAGAAACTCGAGTGACA
+TTAATGACTACAATAAGATGTTAGTAA
+>Locus_71_Transcript_1/2_Confidence_0.333_Length_170
+GATTAATGAAAACATCTTTGGCAAATGCTTTCGCAGTCGGACGTCTCGCTACGGTCCAAG
+AATTTCACCTCTCGCGTCGTAATACTAATGCCCCCAAACTGCTTCTATTAATCATTACCT
+CTTGATCTGAAAACCAATGAAAGCAGAACAGAGGTCTTATTTCATTATCC
+>Locus_71_Transcript_2/2_Confidence_0.333_Length_106
+ACACCTCTCGCGTCGTAATACTAATGCCCCCAAACTGCTTCTATTAATCATTACCTCTTG
+ATCTGAAAACCAATGAAAGCAGAACAGAGGTCTTATTTCATTATCC
+>Locus_72_Transcript_1/1_Confidence_0.000_Length_108
+AAATGATCTCATCTCTGTATTCTGGCCGGAATGCTTGAACCATCGCCTTTTGAGCGATAT
+TTCGTTGCATCCAGCCAGAAACCCGGCCATCAAGGTTGGAAAAATCCG
+>Locus_73_Transcript_1/1_Confidence_0.000_Length_164
+TCGGATAATATCCGGCTTTCCTGACATCCTTTTCATCCTGAAGGTCTCCAGATACACATT
+AGCGTACTCGGATATCGTTCTACATGCCGAGCATAATCAACATTGGTATTATCCTGGAAG
+GAACCCAACTGAGATCGCCGATGGGGTTTGTGAATTTGTCAGTG
+>Locus_74_Transcript_1/2_Confidence_0.333_Length_232
+ATCATATCCAACAGCTCTTCAGCTCTGCTCCTCGTTATCTTCGGAAATGGTTGCACATGG
+ATTTTTGCCAGCATGCACGTCTTGCATACTGCGTCTGGTTTGAAAACGACCTTTTCAACA
+CCGTACACCATCCTCTTCCTCACCATCTCCTGTAGGCTGCTTGTATTCAAATGGCCATAC
+CTTTTATGCCATAGTGAACCATCAGCATCAACGGCCGCAAAACAACTGTTAT
+>Locus_74_Transcript_2/2_Confidence_0.333_Length_109
+CATTCGCTCTTCCTCCTCACCATCTCCTGTAGGCTGCTTGTATTCAAATGGCCATACCTT
+TTATGCCATAGTGAACCATCAGCATCAACGGCCGCAAAACAACTGTTAT
+>Locus_76_Transcript_1/1_Confidence_0.500_Length_196
+TCAGTTTCAGCTTTGTTTTTCAGCCTGCTGCTACCATTCAGGTTCCACCTCCTTTTCAGT
+TTAAAGTGGGTTTCTCGGCCAGAGTTGGGCAATTCCATTACTCTATTAGGGGGAAAAAAT
+GGTAATTTGCTGCTCGATTATGACGAAGTCATTTGATCCGCTTCACATGTGACGTCGTCT
+TTTTGTTGGGCCTGTC
+>Locus_78_Transcript_1/1_Confidence_1.000_Length_154
+AACGTGCGCAGGGACCTCATACCTCGAAGGAAGGGCCCCCCGAGGAGGCAAATCAGCACT
+CGAAGAACGCCTCCGAAAGCTGGAGCTCAGCCCCCCACCCGCTAAACCGTAGGTGTCTCC
+TAGGAGCACCCACACACGTTCTAGCCCGAAAGGG
+>Locus_79_Transcript_1/1_Confidence_1.000_Length_154
+AACGTGCGCAGGGACCTCATACCTCGAAGGAAGGGCCCCCCGAGGAGGCAAATCAGCACT
+CGAAGAACGCCTCCGAAAGCTGGAGCTCAGCCCCCCACCCGCTAAACCGTAGCTGACTCC
+TAGGAGCACCTACACCCGTTCTAGCCCGAAAGGG
+>Locus_80_Transcript_1/1_Confidence_1.000_Length_101
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGCAA
+>Locus_81_Transcript_1/1_Confidence_1.000_Length_155
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGATTAGCGCGA
+GTTTGCTTGGCATCGTTAAGCTTAGGTAACGATTCATCCACGGAGCCCGGCATAACGCCG
+TCTTAATCTTCTCCCAGCATGATCCGTGTAACTCG
+>Locus_82_Transcript_1/1_Confidence_1.000_Length_165
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGCGAGTTTGCTTGGCATCGTTAA
+GCTTAGGTAACGATTCATCCACGGAGCCCGGCATAACGCCGTCTT
+>Locus_83_Transcript_1/1_Confidence_1.000_Length_196
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGCGAGTTTGCTTGGCATCGTTAA
+GCTTAGGTAACGATTCATCCACGGAGCCCGGCATAACGCCGTCTTAATCTTCTCCCAGCA
+TGATCCGTGTAACTCG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/output.fa	Sun Oct 15 18:43:37 2017 -0400
@@ -0,0 +1,5087 @@
+>gi|262225307|gb|GQ342964.1|_Drosophila_melanogaster_tetravirus_SW-2009a_strain_DTRV_putative_RNA-de--Locus_42_Transcript_2/2_Confidence_0.333_Length_597_hit1_IdMatch=100.0,AligLength=593,E-val=0.0
+TTCTGAGGTACGGCCAAATGCTGCCAATCCTGTTGGAGTTAGGCTCTATGCCCACAGCCA
+CCATACCCAGGACATGAAGCTGTTGGGAGAAGCCTGGTCCTCCTCTGCCAAACTGGCTAA
+GGAATACATCTGTGCAGCTATTTTGGAGGTTAACAACATCCCATACAAGAAGTCTAGCTT
+TGCGACCCCTAATGTAGTGCCTCCCCCGCCTGAGTCTTCCTGGGCTCGGCAGGTTGAATA
+CGCAACTGCCCCTAAAGCTGTGCCACAGATTGTTCCCGTTCATGAAACCCTGGATTTGGA
+GCTGTTTCACAGTATAATGCAGCAATTCCCAGGGCACTGTCCCCGCCAGGTGCAGATGCT
+TATTAGAGAGGTAAGTCATAAAAATCCTGATGACTACCGTGTGAGAATTCAAGACTTATT
+CTCCCGGTTTCCACCTCCTAAAGTAGCATCGAAGAGATCACTGCTGAGCGCAGAACAAAG
+GACGAGACTCAACAAAAAGACTCTCGACCGCAAAAAGAGGAAGAAAATTGCAAGTAAGCT
+CTTGCCAACCCTATAACATCAAACAACCCAAACCTCAAATCAAGAATACAATTT
+>gi|262225307|gb|GQ342964.1|_Drosophila_melanogaster_tetravirus_SW-2009a_strain_DTRV_putative_RNA-de--Locus_42_Transcript_1/2_Confidence_0.333_Length_3138_hit1_IdMatch=100.0,AligLength=3001,E-val=0.0
+CCCAAGTATCCCTGTTTGTGGGATTATGGATGCTGTTGGTGTCCCGTTGCACCCCCCATC
+CATTAACAATCGGGGTGGGCATACTCATGTCACTCGCCAGATGGGCGGAGTACCCCACCC
+TCCTCTTGGTCTAATACCCATAGCTCAGAAGTATGGGGTAGAGATCTTGGACCAGAAACA
+TGTCTACACAGGAGGCACTTGGGATGGCTTTCTTAATAGACTCGCCCAACAGATGGGCCG
+GACAACGGTCCCCCTGGCAAGAACAGTTTCAGCAGGCAAAAAGAATGCCTCTGATAGGGC
+AATCATAAAACTGTTAAATAAATACATGCCTAGGACGGGAAATAAGAACTGGCCTGGTGT
+CCATACAACCCCGGAAGAAGGCATACTTGATGGTATCAAGATAACGGCCAAATCCAGTGC
+AGGCGCTCCCTATTGGAGACACAAGGGGGAATGCCTAGACCATATAATTGATACTGGACT
+TCCTGTTGTGCTAAAGCATATAAAGGAAGGAACCCTCAACCAGTTGTGGCGGGAAAACCC
+TGAGATGTTCCTCGTTGAAGTTAAGAACAAACTTGATAGATACGAAGTCTCGAAGCTTAA
+AGAGAAGACTAGACCCTATGTGTGTGTACCTGCGCACTGGGCTCTCCTATTCTCGTGCTT
+GACTCAAGGATTCCAAGAAGGACTTCAAGTTTTTAGTAACTTGGACCCCAGTACAGAATG
+CTCGAATGCATATGGATTTTCATCCATTGCTGGAGGGCTTACTAGGATGGTCGACTGGAT
+GTATGCCTGCCCAAAGCGGCGGGGACGGGTTGTCTGTTACGGTGACGATGCATGTATAAC
+ATTTTGGAGCCAGGGCGTCCTCTATCGGGTGGATCCAGATTTTAAACAAATGGACGGGTC
+CATAGATAGAGAGGATGCAAGAATCACCATTGAGTGGGTCCTCCACCATCTCAGAAAGGA
+TTTAGGTGTAGAGGAGACCCCTGCTTTTTGGAAGACAGTTGCAGCAGTGTGGCTTGATAT
+GGCCATTGACCCCCACTTTATCGTGGATGGTAAGACTGTTTACAGGAAGAAGAACCCCCA
+TGGACTCATGACTGGAGTTCCAGGAACAACCTTATTTGACACTGTGAAATCTGTAATAGT
+CTGGAACGAAATGTTGGATCAGGCTAGTGCAGGTTCCATAGACCTTTTAAATGAAGCTCA
+AGTAGTTAAATGGATGAAGAGACAAGGCTTGGTTGTCAAAGAGGGAACTTGGAGTCCGGT
+TGCACTCCCTGCAAGGGACACAGAGGGTCTAATTACGGACCACAAATTTCTTGGTGTACA
+AATTATGGGAGTGTACCACAGACACCGTGTGATACATGTCCCCACAATGCCTGAGAGCGA
+TGCTCTTGAGATGATGCTCTGCCAGAAGGATAACCCCTTTGAAAAGGCAGTATCTAGAAC
+TGCACACCAAAGAACTCTGTATGACCGTATGAGGGGTTTAATGATAACAATGGGATTCAG
+CATACCTCGGATCGAAGAGACAATACACGCTGTGGTTAATACAATCCCCGGCGAGATTAT
+TGTCATGCAAACGCAAGAGCAAACCGGAACGAAGCCAGAACATATAACCCTCCAGGACTT
+TGAATATCCAGATTCGTCTGGATTCCCCTCTCGGGACTTCTGTCTAGACCTCTATTCAGA
+TGGAGGGGATGACAAAGCGGGATGGATTAATCTGTTCCCCACATTGTCAGGATTCCTTGA
+CGAGTTTAAGAGGGAACAGAGAGTGGCTGTGAGGCAGATAAATTTGACAGTCCAATCCAA
+CGACTATGATGTCAAGGAGGTTGTAGGATGTCCTCCTCCTCCTGAGGCGAATCTGAATGA
+TGAGTACAAAGTGTTTGAGGCTCTTAAACCTCAGCAAGTCCAGTATTCAGAACCGAACCC
+CAGACCCAAAGTAGTTCGGATTACAGAAAGTGGTGACATCCCTGAGAAATTCCTACCAAA
+TATGGCTCAAGCCGTCGTTAGATGGCTTACCTCAGTTGGAGGTGTTTCTCAGGTTGGTAC
+TGTTGCCGATAAAGTTGGAGCCAGTGCCTACCAAATTGTTGTGGGTGCTGCTAAAGGGGG
+CTATTTCACTACTGGAGATGAACTTGGAGACTTGATTTCCCTATACCCACTAGTGACTCC
+CTTCCCTACATTGCAGGACAGTCAAAGAGAAGAAATGGAGGAAAATCGTAATCTGATTGA
+TAGGACTACTGCAGCCAGAACGTCAGCTTTGAGACGGGGGATTGTAAAAACCCAACCTGA
+GCTCATTAATCTGGACGTTGCAGGAGTATCCAACCTCCATCCACCTCCCTACGATATAAA
+TACAGCAGAGGATGCCATGGCATATGTCCATGCAGTGGTCAGCGGGAGATTTTCAGGATT
+CACTAAATGGATATCTGAGGTACGGCCAAATGCTGCCAATCCTGTTGGAGTTAGGCTCTA
+TGCCCACAGCCACCATACCCAGGACATGAAGCTGTTGGGAGAAGCCTGGTCCTCCTCTGC
+CAAACTGGCTAAGGAATACATCTGTGCAGCTATTTTGGAGGTTAACAACATCCCATACAA
+GAAGTCTAGCTTTGCGACCCCTAATGTAGTGCCTCCCCCGCCTGAGTCTTCCTGGGCTCG
+GCAGGTTGAATACGCAACTGCCCCTAAAGCTGTGCCACAGATTGTTCCCGTTCATGAAAC
+CCTGGATTTGGAGCTGTTTCACAGTATAATGCAGCAATTCCCAGGGCACTGTCCCCGCCA
+GGTGCAGATGCTTATTAGAGAGGTAAGTCATAAAAATCCTGATGACTACCGTGTGAGAAT
+TCAAGACTTATTCTCCCGGTTTCCACCTCCTAAAGTAGCATCGAAGAGATCACTGCTGAG
+CGCAGAACAAAGGACGAGACTCAACAAAAAGACTCTCGACCGCAAAAAGAGGAAGAAAAT
+TGCAAGTAAGCTCTTGCCAACCCTATAACATCAAACAACCCAAACCTCAAATCAAGAATA
+CAATTT
+
+>gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome--Locus_7_Transcript_6/11_Confidence_0.154_Length_656_hit1_IdMatch=99.69,AligLength=655,E-val=0.0
+TATGGCTATTATTGCATGTCTACATCGAACCAGAGTTGCAGCTATTGAGCGATGAAGTGG
+TGGACATATTCGACCAACTGACAAGCAAGACTTTTTTAGATGTAGCAAAATCGGCTGCGG
+ACAGTGCGGAGGGCAACATTCCGGCAACGAAGGTATTGACAGACCTCCAGGCAGTGGATT
+CAGCAACGCTGCCGAGTACTTTGGATCCATCCACAAATATGCTCCAACCAGCTCCTTTAC
+TCGGCGAACCTACGACAAATTAACTCGATACATTCATGATGGGGTAAGTCGAAGTAGTCA
+GAGAGAAATTTCATCATTGTCGGATGATTTAGTTAGATTTAGTACTCTCACAGATTTTAC
+TGTCATCGATTTTATTACTAAGAAATTAGATTTAGAACGTCCGATTAGTACTCAAGGAGA
+TTTATTGGCGTTAGAACCTAGATGCAAGGGTGACCTCGCTGTAGCAAGACTTAAGATTAA
+GGACATAATAGGTAGGATTGATAAGGATATTAGAACGTGGTGTGAAGCAAATTTATGCCA
+TTTGGATGCAATCTTGGTAACGAACTTGATAATCTGGGGACAAATCTGGGGGTTGGAAAT
+TCTGAAAGCTTTACATTCAACAGGAATATTAAACGATTTCGATACTTTCGCAACAA
+>gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome--Locus_10_Transcript_8/8_Confidence_0.000_Length_1134_hit1_IdMatch=99.89,AligLength=905,E-val=0.0
+GCATTTTCAATATCCCTGTTGGTTCAAGAGGGACTTTACCTGTTGCAATGTTAATTGCAT
+CAGTCCTATGCCATCCTTTCCTTTCATATTCCGTCATAGTTTTGTAAGCTTCAGGATACC
+ATTTGGCCAAACATTCTTTTAGACTAGGTATCTCAATCTTAGCTTTCTTCGCGATTTGAT
+GTTGTCTTATAAATTCGCTGAATATTGGCATTCCGTTTGGACCAGCCTCATGAGATTGAA
+TCATACGTCTAGGCCAAATGTTATTTTCGCACGTTGGTCCTTCTGTTTTGTAAAACCTGT
+ATGTGGGTACAACCGTCTTCTCCCATACCGGTTTCAACTTCCTTAAATTTTTGATATAAT
+TGCTGGAAATGTGTTTTTGCGGTCCAGGAATGTCGTCGGCTGCTATTTTCATTGAAAATT
+CGACTTGTTGATAAGCCGTCTTTTCCTCATCTGTCATTTGCTTCCACGTCAAGTTGATGT
+TTTCACTAAACAGTCCAGGAACATCGAACGTTGGGATGTCAGCAAGTGGTAGCTTGCTAG
+TAGTTTTCCACCCTTTCCATTCGTATATTCCGAAACCACCCAGTCGTTTAGGCAGGTGCA
+GCCAGTGATAGCTCTGTCCCGTGTATTTACTCCACTTAATTTTGTTTGCTTGATGTAACC
+AATCCAATTGTTTCTTGCTTCTCCTTTCTAATAAATAGATATTATTAGCGGTTGTCTCAA
+CTTGTTGATTTGCAGTCCATGGTTGTGGGTTCCACGGTTTCCTTTGTGTCACGCTAGGGA
+TAGCCCGATTTGTCCAGCCTCTGACGCCTTGAGTAGATATTTCTGTCCTTAAGAATTCGC
+AACAATTTTGCATAATTCCAAACTTGCTGTTTTCTCCAACGGCGTTGATTGCCTGATAGC
+TATACCTAAA
+>gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome--Locus_7_Transcript_9/11_Confidence_0.154_Length_552_hit1_IdMatch=99.09,AligLength=551,E-val=0.0
+AAAACGATTTCGATACTTTCGCAACAAAAGGAAGCAAGATTAGTGCATTTGTCAAGCGTT
+TTCCCTTCGACAAGGATGATGCCAAAGCTAGATGGGCAGAGATCAACACGCTGACGGGCT
+ATTTGCAGAATGATTTTGGAAACTTCGATTACGATAAGGAATTTGAAGCTTTAGCTACCG
+GAGATAGTAACCACCCCGCTTGGTGGGAAGAAGTATTCACTAAGAAAATAAAAGAGTTGA
+TGACACATCAAGAACACAAAAAGTATATCAGTTTTGAAAAATATGTTAAGGAAGGATATT
+GGATAACATCTGGCAGCAGCAGCATCGGCAAAGTCAATTGGTCATATGACGGAGACTTGG
+GCAAATTTAAGGCTAGAAAGAACATGTTATTAGATCTATATACGCCGGACGAAATCTACA
+AAATGGCTGTAGAATGGGACGGGAAACTAGAGAATAGAGTGTTCATCAAAGATGAATTGG
+CAAAGAGAAGATTGGCAGTGGCAAGCAATATTGAAGCATATTTGAATCAAGGGTATATAT
+TTTATCTATTTG
+>gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome--Locus_7_Transcript_10/11_Confidence_0.154_Length_4093_hit1_IdMatch=99.66,AligLength=4093,E-val=0.0
+TGAGAATAAACAACAACAACCAAGTGCACCGATGCCACACGAGCCAAGGGCAGCAGGTCA
+GGCACTTAAGGATTTGAATTTGGCTTATTTGAATAACGACCAAAAAACAACATTGTCGGC
+ATGGGTACGAGGCCTAACAGTAGAAGGTGTCGAACCAAATCCCGGACCATCAATAATTGA
+GCCAAATCATGGACCAAGCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCAACGACA
+GCTGGCAAAACAAGACCAAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCTACTGGA
+CGATCTGACCGAATTAAAGACTACGGTACAACCACAGATTGACAATTCGGGATTCTTGGC
+TCATGTTGATCATGCAGCTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGTGATGAA
+ATACATTCTCACGAATTCTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTACTGATAT
+ACCCGACGAGCCAGTAGAGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAAAGAGAA
+AAAAGAAGAAAAAAAAGATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACGAGAATC
+GATGGCAATGCCAGCCAGTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGAAATTGA
+AAGGAAAAACGTCATCAGGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTACAAGCT
+TGTACTATGGTTAGACAAACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGATGAGCT
+TTGGGGAAGTGGTTGGCAGGAACGAAATAAGATGAACCAGTATGAATGGTTGTCTTACTG
+CTGGGCAAATAATGTCACTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGACATCAA
+ATGGCAACAACTACCTGCTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGCTGATCT
+TGAAGCTCAAAAAACTCACAATAAAGTGATGCATGCATACAACGGTAACCCTTTGTGTCA
+GGGATTTCAAGAAGTTGAAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAGTAATTC
+AGTTCTGAAACCATATACTGGACTGGAAGCTGAGAAATACATCACCAACATTGTAGGAGA
+CATGAATCCGAATCAATCAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCAATACAA
+TGCCAATGGGGCTGTGGTTCATAATGCTGTATCAACTATTCCGTTTACAAACCTCATTCC
+TAGGACGATTCGATCTGATGATGACGTCCTTGAGAAGTCGGCCAACAGATTACAGGTTAC
+AGAGACAAACGTTACGGATTACTACGTTAATCCGATTGAGCCAACTGAATTATCCAAAAC
+AATAAGTGACCAGATCAAAAACAATCAATCATCTAACTGGCGACGAGATAACACGTCATT
+GGCTGGTTTCAATAGTTTCGACATTGCGACAGTCAACACTGCACTAATTGCAAGAGGTCT
+AAGCACTGAATCAATGACTCTCAAGTTAGAGCTATTGCACGGAATAATGGCTATGCAGGT
+TGAAGCACCAATGATCAATTCCAGCACTTATTCGATCGTAGATAATCATACAATCCCGAC
+CGTAACTGACAGGGCCGTCATAGGCATCAATGACTCGCCTGTGTTTGGCGAGGACTGTGG
+TGGTGATCTTCCTGAATATCCTTTCGGCGGCGGAACCGGTACAATTGCCTTTCACCTAAC
+ATTGCAAACTGTTCCTGAAGAGAGGAGAGATAAGGCAATCTTCTGCCCTCCTGGTTTGTT
+GCAAGCAGCCCGAGATGGAGCAGAGGCATTGGCCCTATTTGTTTTGTCGATGTCTGAATG
+GCCTTTCGGTATTTATACTGTCACCAAGAGAACAACCGATGAGAAGGGACTGAATCCTGC
+GGATCAGGTTTACGTGCCGATGGAGACCATAACCCGTGTAGGTGGAGATAGAGTATTGGA
+CGTTGTACTTCCTCGAAGGTATGCGGTTGCAAATCCAACGACTCAAGGAAATGCTAATGC
+TCTAGCAGTTATACAGCCTCAAGCTGGGCCTTTAGATAACGGTGCGGACGGATTAGCCGC
+TGGTGAATTATTGGATGTCAATTTCATCGGCGCCGACGGCATTACTGAATATCCATTGAC
+ATATTACTTGTATACCTGGGCACTTCGATTTGATATAACGACGATTAGGCAATACATTGG
+TAGAATGGCAGCGTTAATTGGAGTGAAACACCAACTATGGGCTAGTCATGAAATCAGAGT
+AGCTTTGTGTCAAGTTGCACCCAAAATGGTGGTCGGAGTTACAGGTTCGGGAGACCTGCC
+AAGAGGATCAGCCGCTGCAAGCGAGGTATGTTACTCAAGCTTATTGGAGGTCTCACGCTC
+TGAAGAAGATTTTCCGCTGCTTGGTCAGGTTCAAGCCGATTTCAGAGTCTTTGAAACCAA
+TACAAGCACATGGAATAAAGTAGTTTTGGGATTGGCAACAGCACCAAACGTGACAAGTGA
+ACAAAACATGCATGTACCATTCGTTGTTGGCGATCCGAGATCTAACGCGTGGGACCGACT
+CGAAGCAGTACCAATTGCTGCTGCTTGGCAGATGTACTACCATTCAAGGGGCGTAACTAC
+TGCCGCTTGGAATGATGCGTACACTAACGTAAATAACGTTTGGTTGCAAAAGATGGCCCG
+TGATAGCTTCTCAACGACCCAAAGCACTGGGACGATACTGCCTGCCAGATATGGTAAGAT
+AGTCAAAAACCTGATGAGAAACATGTTTGAAAGAGAACCTGCCAAAGTAGTAACAAGCGT
+GGGAGGCGATGAATATGAGATAACCCATTTTGAGCGCTGGTTACCGGGTAATAGATATGC
+TTCCGTGTTTGAACAAGATGAAACTGAAGTTAATCTGTTTCCTCCAACTTTATTACCGGA
+TATTTGGGTTCAATATCCAGCGACTCACACCCCAATCATGTGTGCTTCGTTCCCACCCGT
+TTTCGGCCAAGACTCAACACAAGGGTTCGGCAAAGAATCACAACTTATACCCTTTCGAAA
+CGCAAACAACAATCTTGTAGCACCATACGTTGAAGCTTTCGTTGCCAATCAAGCTTATTT
+CCCGATAGGATCGGGCCCAAACATCAACGACAAGGTTCTGTGGAATAGTAGATTGTGGAT
+GACAAGTGGTTTCGTTCAGTACTTGGATTACGCTGGCAACGCAATCAACGAAGTGGTTCC
+TGCAGCAGGGCTACCTTTGGGTAGGTCAATCCCATTACTGCCAGGGGAAGTTCAGCCGGT
+TGGTAACACCAACATGAGCACAAGCTGCGTTCCTCGTTATTCTGTGGACGGTCGCCGAAT
+TTTTACTTATGTCAACACAGCTCAATCCGTTCCTTTGATACAAGCGTGTAATAGAGCCAA
+TAGATTGGCCAGATCGGCATGGCTATTATTGCATGTCTACATCGAACCAGAGTTGCAGCT
+ATTGAGCGATGAAGTGGTGGACATATTCGACCAACTGACAAGCAAGACTTTTTTAGATGT
+AGCAAAATCGGCTGCGGACAGTGCGGAGGGCAACATTCCGGCAACGAAGGTATTGACAGA
+CCTCCAGGCAGTGGATTCAGCAACGCTGCCGAGTACTTTGGATCCATCCACAAATATGCT
+CCAACCAGCTCCTTTACTCGGCGAACCTACGACAAATTAACTCGATACATTCATGATGGG
+GTAAGTCGAAGTAGTCAGAGAGAAATTTCATCATTGTCGGATGATTTAGTTAGATTTAGT
+ACTCTCACAGATTTTACTGTCATCGATTTTATTACTAAGAAATTAGATTTAGAACGTCCG
+ATTAGTACTCAAGGAGATTTATTGGCGTTAGAACCTAGATGCAAGGGTGACCTCGCTGTA
+GCAAGACTTAAGATTAAGGACATAATAGGTAGGATTGATAAGGATATTAGAACGTGGTGT
+GAAGCAAATTTATGCCATTTGGATGCAATCTTGGTAACGAACTTGATAATCTGGGGACAA
+ATCTGGGGGTTGGAAATTCTGAAAGCTTTACATTCAACAGGAATATTAAACGATTTCGAT
+ACTTTCGCAACAA
+>gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome--Locus_10_Transcript_2/8_Confidence_0.111_Length_1023_hit1_IdMatch=99.9,AligLength=1023,E-val=0.0
+GTCGTCGGCTGCTATTTTCATTGAAAATTCGACTTGTTGATAAGCCGTCTTTTCCTCATC
+TGTCATTTGCTTCCACGTCAAGTTGATGTTTTCACTAAACAGTCCAGGAACATCGAACGT
+TGGGATGTCAGCAAGTGGTAGCTTGCTAGTAGTTTTCCACCCTTTCCATTCGTATATTCC
+GAAACCACCCAGTCGTTTAGGCAGGTGCAGCCAGTGATAGCTCTGTCCCGTGTATTTACT
+CCACTTAATTTTGTTTGCTTGATGTAACCAATCCAATTGTTTCTTGCTTCTCCTTTCTAA
+TAAATAGATATTATTAGCGGTTGTCTCAACTTGTTGATTTGCAGTCCATGGTTGTGGGTT
+CCACGGTTTCCTTTGTGTCACGCTAGGGATAGCCCGATTTGTCCAGCCTCTGACGCCTTG
+AGTAGATATTTCTGTCCTTAAGAATTCGCAACAATTTTGCATAATTCCAAACTTGCTGTT
+TTCTCCAACGGCGTTGATTGCCTGATAGCTATACCTAAACACCAGACATGTCATGAAATC
+CTTAGCTAATATTTTTGTGTCGTCGCCTTTCAATGCTATTAACCTAATGTTATCTTTGCC
+CAATATCAAACTCGTCTGATCTCTTGCTATATCCGTTGTTATCATATTCCAGACATTGCC
+GATGAAACTTGTTGGACGTATTCCAGAAGGTATGCCGTTAGTCTGTTTCTTTGTTTCCTT
+TGTTAACGGTGAGTACAGGTAATTATTGTCGTAACACGAAATATTTTTCGCAGCTATTTT
+AGTGAATAAATGTCGATCTTGTGGAGGTACCAAATATTTGATTTGGTCTATGACGCGTTT
+CGTAATCTGCTTCACTTCCCAAATTGTTGGTTGTCTGTCAAACCCTTTGAAATCAAAAGG
+TAGGGCAAAACACCCGTCTTTCAATGCTTTAATTGTTTCACAGTTCCTAAGATGCGTTTC
+ACCTGGTGTTTCGTCTAATGTTATGTATTTCCAATTTTTAAAGCCATGTCCAAATAGATA
+AAA
+>gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome--Locus_7_Transcript_7/11_Confidence_0.462_Length_4481_hit1_IdMatch=99.6,AligLength=4481,E-val=0.0
+CAGTAGAAGGTGTCGAACCAAATCCCGGACCATCAATAATTGAGCCAAATCATGGACCAA
+GCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCAACGACAGCTGGCAAAACAAGACC
+AAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCTACTGGACGATCTGACCGAATTAA
+AGACTACGGTACAACCACAGATTGACAATTCGGGATTCTTGGCTCATGTTGATCATGCAG
+CTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGTGATGAAATACATTCTCACGAATT
+CTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTACTGATATACCCGACGAGCCAGTAG
+AGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAAAGAGAAAAAAGAAGAAAAAAAAG
+ATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACGAGAATCGATGGCAATGCCAGCCA
+GTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGAAATTGAAAGGAAAAACGTCATCA
+GGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTACAAGCTTGTACTATGGTTAGACA
+AACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGATGAGCTTTGGGGAAGTGGTTGGC
+AGGAACGAAATAAGATGAACCAGTATGAATGGTTGTCTTACTGCTGGGCAAATAATGTCA
+CTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGACATCAAATGGCAACAACTACCTG
+CTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGCTGATCTTGAAGCTCAAAAAACTC
+ACAATAAAGTGATGCATGCATACAACGGTAACCCTTTGTGTCAGGGATTTCAAGAAGTTG
+AAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAGTAATTCAGTTCTGAAACCATATA
+CTGGACTGGAAGCTGAGAAATACATCACCAACATTGTAGGAGACATGAATCCGAATCAAT
+CAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCAATACAATGCCAATGGGGCTGTGG
+TTCATAATGCTGTATCAACTATTCCGTTTACAAACCTCATTCCTAGGACGATTCGATCTG
+ATGATGACGTCCTTGAGAAGTCGGCCAACAGATTACAGGTTACAGAGACAAACGTTACGG
+ATTACTACGTTAATCCGATTGAGCCAACTGAATTATCCAAAACAATAAGTGACCAGATCA
+AAAACAATCAATCATCTAACTGGCGACGAGATAACACGTCATTGGCTGGTTTCAATAGTT
+TCGACATTGCGACAGTCAACACTGCACTAATTGCAAGAGGTCTAAGCACTGAATCAATGA
+CTCTCAAGTTAGAGCTATTGCACGGAATAATGGCTATGCAGGTTGAAGCACCAATGATCA
+ATTCCAGCACTTATTCGATCGTAGATAATCATACAATCCCGACCGTAACTGACAGGGCCG
+TCATAGGCATCAATGACTCGCCTGTGTTTGGCGAGGACTGTGGTGGTGATCTTCCTGAAT
+ATCCTTTCGGCGGCGGAACCGGTACAATTGCCTTTCACCTAACATTGCAAACTGTTCCTG
+AAGAGAGGAGAGATAAGGCAATCTTCTGCCCTCCTGGTTTGTTGCAAGCAGCCCGAGATG
+GAGCAGAGGCATTGGCCCTATTTGTTTTGTCGATGTCTGAATGGCCTTTCGGTATTTATA
+CTGTCACCAAGAGAACAACCGATGAGAAGGGACTGAATCCTGCGGATCAGGTTTACGTGC
+CGATGGAGACCATAACCCGTGTAGGTGGAGATAGAGTATTGGACGTTGTACTTCCTCGAA
+GGTATGCGGTTGCAAATCCAACGACTCAAGGAAATGCTAATGCTCTAGCAGTTATACAGC
+CTCAAGCTGGGCCTTTAGATAACGGTGCGGACGGATTAGCCGCTGGTGAATTATTGGATG
+TCAATTTCATCGGCGCCGACGGCATTACTGAATATCCATTGACATATTACTTGTATACCT
+GGGCACTTCGATTTGATATAACGACGATTAGGCAATACATTGGTAGAATGGCAGCGTTAA
+TTGGAGTGAAACACCAACTATGGGCTAGTCATGAAATCAGAGTAGCTTTGTGTCAAGTTG
+CACCCAAAATGGTGGTCGGAGTTACAGGTTCGGGAGACCTGCCAAGAGGATCAGCCGCTG
+CAAGCGAGGTATGTTACTCAAGCTTATTGGAGGTCTCACGCTCTGAAGAAGATTTTCCGC
+TGCTTGGTCAGGTTCAAGCCGATTTCAGAGTCTTTGAAACCAATACAAGCACATGGAATA
+AAGTAGTTTTGGGATTGGCAACAGCACCAAACGTGACAAGTGAACAAAACATGCATGTAC
+CATTCGTTGTTGGCGATCCGAGATCTAACGCGTGGGACCGACTCGAAGCAGTACCAATTG
+CTGCTGCTTGGCAGATGTACTACCATTCAAGGGGCGTAACTACTGCCGCTTGGAATGATG
+CGTACACTAACGTAAATAACGTTTGGTTGCAAAAGATGGCCCGTGATAGCTTCTCAACGA
+CCCAAAGCACTGGGACGATACTGCCTGCCAGATATGGTAAGATAGTCAAAAACCTGATGA
+GAAACATGTTTGAAAGAGAACCTGCCAAAGTAGTAACAAGCGTGGGAGGCGATGAATATG
+AGATAACCCATTTTGAGCGCTGGTTACCGGGTAATAGATATGCTTCCGTGTTTGAACAAG
+ATGAAACTGAAGTTAATCTGTTTCCTCCAACTTTATTACCGGATATTTGGGTTCAATATC
+CAGCGACTCACACCCCAATCATGTGTGCTTCGTTCCCACCCGTTTTCGGCCAAGACTCAA
+CACAAGGGTTCGGCAAAGAATCACAACTTATACCCTTTCGAAACGCAAACAACAATCTTG
+TAGCACCATACGTTGAAGCTTTCGTTGCCAATCAAGCTTATTTCCCGATAGGATCGGGCC
+CAAACATCAACGACAAGGTTCTGTGGAATAGTAGATTGTGGATGACAAGTGGTTTCGTTC
+AGTACTTGGATTACGCTGGCAACGCAATCAACGAAGTGGTTCCTGCAGCAGGGCTACCTT
+TGGGTAGGTCAATCCCATTACTGCCAGGGGAAGTTCAGCCGGTTGGTAACACCAACATGA
+GCACAAGCTGCGTTCCTCGTTATTCTGTGGACGGTCGCCGAATTTTTACTTATGTCAACA
+CAGCTCAATCCGTTCCTTTGATACAAGCGTGTAATAGAGCCAATAGATTGGCCAGATCGG
+CATGGCTATTATTGCATGTCTACATCGAACCAGAGTTGCAGCTATTGAGCGATGAAGTGG
+TGGACATATTCGACCAACTGACAAGCAAGACTTTTTTAGATGTAGCAAAATCGGCTGCGG
+ACAGTGCGGAGGGCAACATTCCGGCAACGAAGGTATTGACAGACCTCCAGGCAGTGGATT
+CAGCAACGCTGCCGAGTACTTTGGATCCATCCACAAATATGCTCCAACCAGCTCCTTTAC
+TCGGCGAACCTACGACAAATTAACTCGATACATTCATGATGGGGTAAGTCGAAGTAGTCA
+GAGAGAAATTTCATCATTGTCGGATGATTTAGTTAGATTTAGTACTCTCACAGATTTTAC
+TGTCATCGATTTTATTACTAAGAAATTAGATTTAGAACGTCCGATTAGTACTCAAGGAGA
+TTTATTGGCGTTAGAACCTAGATGCAAGGGTGACCTCGCTGTAGCAAGACTTAAGATTAA
+GGACATAATAGGTAGGATTGATAAGGATATTAGAACGTGGTGTGAAGCAAATTTATGCCA
+TTTGGATGCAATCTTGGTAACGAACTTGATAATCTGGGGACAAATCTGGGGGTTGGAAAT
+TCTGAAAGCTTTACATTCAACAGGAATATTAAACGATTTCGATACTTTCGCAACAAAAGG
+AAGCAAGATTAGTGCATTTGTCAAGCGTTTTCCCTTCGACAAGGATGATGCCAAAGCTAG
+ATGGGCAGAGATCAACACGCTGACGGGCTATTTGCAGAATGATTTTGGAAACTTCGATTA
+CGATAAGGAATTTGAAGCTTTAGCTACCGGAGATAGTAACCACCCCGCTTGGTGGGAAGA
+AGTATTCACTAAGAAAATAAAAGAGTTGATGACACATCAAGAACACAAAAAGTATATCAG
+TTTTGAAAAATATGTTAAGGAAGGATATTGGATAACATCTGGCAGCAGCAGCATCGGCAA
+AGTCAATTGGTCATATGACGGAGACTTGGGCAAATTTAAGGCTAGAAAGAACATGTTATT
+AGATCTATATACGCCGGACGAAATCTACAAAATGGCTGTAGAATGGGACGGGAAACTAGA
+GAATAGAGTGTTCATCAAAGATGAATTGGCAAAGAGAAGATTGGCAGTGGCAAGCAATAT
+TGAAGCATATTTGAATCAAGGGTATATATTTTATCTATTTG
+>gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome--Locus_7_Transcript_5/11_Confidence_0.308_Length_4519_hit2_IdMatch=98.06,AligLength=566,E-val=0.0
+TGCGATATTAGAGAAGATCCTACTCTAATATCATACGGATTCCATGGATCAGACGAGGAA
+GACCCATACAGCCGATGAAGATGACAACTGAAAGGAAAACAAGAGGATACAGGTGCTTCG
+CTTTGTTCGTGAGACGGCAAAGATTTGAACCTTTTTAGAAACAATTTAAATATGCTGAAC
+AACTATCACAATAACTTTAACAGTCCTAGCCTGGCTATGATGGACGATGACAAAGCTTGT
+GTTGATGATGGTTGTAAGCTAACAAAGTGGTGATGAGTTGGTGATACCCTCACTTTGGTA
+TTTAATTGTAGACAAGATGGAACATTAGCATCCGAGGTCACTACGTTCCGGAAAGAAACT
+CAAATACAACAGGAACTGATGGGAGAATATCTGACGAAAAATGGAAAACGGGACAGGATT
+GACAAAATGAAAGGATTTTGACAGCTCGGAACAGACGGCAAAATGGAACAAAAGTATGAA
+ACAAGAAACACGTGTTCCTCAGTCTCACATTGAATATCCAGATATCGAGATGCACCTCAT
+ATCTGAGAATAAACAACTACAACCA
+>gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome--Locus_7_Transcript_3/11_Confidence_0.154_Length_1743_hit1_IdMatch=99.89,AligLength=1742,E-val=0.0
+CCTTAGAGGTAACCAATACAATGCCAATGGGGCTGTGGTTCATAATGCTGTATCAACTAT
+TCCGTTTACAAACCTCATTCCTAGGACGATTCGATCTGATGATGACGTCCTTGAGAAGTC
+GGCCAACAGATTACAGGTTACAGAGACAAACGTTACGGATTACTACGTTAATCCGATTGA
+GCCAACTGAATTATCCAAAACAATAAGTGACCAGATCAAAAACAATCAATCATCTAACTG
+GCGACGAGATAACACGTCATTGGCTGGTTTCAATAGTTTCGACATTGCGACAGTCAACAC
+TGCACTAATTGCAAGAGGTCTAAGCACTGAATCAATGACTCTCAAGTTAGAGCTATTGCA
+CGGAATAATGGCTATGCAGGTTGAAGCACCAATGATCAATTCCAGCACTTATTCGATCGT
+AGATAATCATACAATCCCGACCGTAACTGACAGGGCCGTCATAGGCATCAATGACTCGCC
+TGTGTTTGGCGAGGACTGTGGTGGTGATCTTCCTGAATATCCTTTCGGCGGCGGAACCGG
+TACAATTGCCTTTCACCTAACATTGCAAACTGTTCCTGAAGAGAGGAGAGATAAGGCAAT
+CTTCTGCCCTCCTGGTTTGTTGCAAGCAGCCCGAGATGGAGCAGAGGCATTGGCCCTATT
+TGTTTTGTCGATGTCTGAATGGCCTTTCGGTATTTATACTGTCACCAAGAGAACAACCGA
+TGAGAAGGGACTGAATCCTGCGGATCAGGTTTACGTGCCGATGGAGACCATAACCCGTGT
+AGGTGGAGATAGAGTATTGGACGTTGTACTTCCTCGAAGGTATGCGGTTGCAAATCCAAC
+GACTCAAGGAAATGCTAATGCTCTAGCAGTTATACAGCCTCAAGCTGGGCCTTTAGATAA
+CGGTGCGGACGGATTAGCCGCTGGTGAATTATTGGATGTCAATTTCATCGGCGCCGACGG
+CATTACTGAATATCCATTGACATATTACTTGTATACCTGGGCACTTCGATTTGATATAAC
+GACGATTAGGCAATACATTGGTAGAATGGCAGCGTTAATTGGAGTGAAACACCAACTATG
+GGCTAGTCATGAAATCAGAGTAGCTTTGTGTCAAGTTGCACCCAAAATGGTGGTCGGAGT
+TACAGGTTCGGGAGACCTGCCAAGAGGATCAGCCGCTGCAAGCGAGGTATGTTACTCAAG
+CTTATTGGAGGTCTCACGCTCTGAAGAAGATTTTCCGCTGCTTGGTCAGGTTCAAGCCGA
+TTTCAGAGTCTTTGAAACCAATACAAGCACATGGAATAAAGTAGTTTTGGGATTGGCAAC
+AGCACCAAACGTGACAAGTGAACAAAACATGCATGTACCATTCGTTGTTGGCGATCCGAG
+ATCTAACGCGTGGGACCGACTCGAAGCAGTACCAATTGCTGCTGCTTGGCAGATGTACTA
+CCATTCAAGGGGCGTAACTACTGCCGCTTGGAATGATGCGTACACTAACGTAAATAACGT
+TTGGTTGCAAAAGATGGCCCGTGATAGCTTCTCAACGACCCAAAGCACTGGGACGATACT
+GCCTGCCAGATATGGTAAGATAGTCAAAAACCTGATGAGAAACATGTTTGAAAGAGAACC
+TGCCAAAGTAGTAACAAGCGTGGGAGGCGATGAATATGAGATAACCCATTTTGAGCGCTG
+GTTACCGGGTAATAGATATGCTTCCGTGTTTGAACAAGATGAAACTGAAGTTAATCTGTT
+TCC
+>gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome--Locus_10_Transcript_5/8_Confidence_0.333_Length_628_hit1_IdMatch=99.84,AligLength=628,E-val=0.0
+CGTTATCCAGCTGGATTATGTTGTTATTGTGTAGAAAATATAGGAGTCTCGAAGACTCTT
+TAGAAAGCATACATGTAGTTGCCTCCCTCGTTCTGGATGTACTGAACGGCCTGCTTGCAT
+ACTGATGTTAAGTGCAGAGCTATGTTTTCTCTTCCTCGCCAAAAAGAAAAACCACTTTTG
+ACGACTATCTTACTTATCCAGGGTGTTAGTATTGGATTCAATATCCCTGTTGGTTCAAGA
+GGGACTTTACCTGTTGCAATGTTAATTGCATCAGTCCTATGCCATCCTTTCCTTTCATAT
+TCCGTCATAGTTTTGTAAGCTTCAGGATACCATTTGGCCAAACATTCTTTTAGACTAGGT
+ATCTCAATCTTAGCTTTCTTCGCGATTTGATGTTGTCTTATAAATTCGCTGAATATTGGC
+ATTCCGTTTGGACCAGCCTCATGAGATTGAATCATACGTCTAGGCCAAATGTTATTTTCG
+CACGTTGGTCCTTCTGTTTTGTAAAACCTGTATGTGGGTACAACCGTCTTCTCCCATACC
+GGTTTCAACTTCCTTAAATTTTTGATATAATTGCTGGAAATGTGTTTTTGCGGTCCAGGA
+ATGTCGTCGGCTGCTATTTTCATTGAAA
+>gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome--Locus_7_Transcript_2/11_Confidence_0.077_Length_1069_hit1_IdMatch=99.06,AligLength=1069,E-val=0.0
+CAGTAGAAGGTGTCGAACCAAATCCCGGACCATCAATAATTGAGCCAAATCATGGACCAA
+GCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCAACGACAGCTGGCAAAACAAGACC
+AAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCTACTGGACGATCTGACCGAATTAA
+AGACTACGGTACAACCACAGATTGACAATTCGGGATTCTTGGCTCATGTTGATCATGCAG
+CTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGTGATGAAATACATTCTCACGAATT
+CTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTACTGATATACCCGACGAGCCAGTAG
+AGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAAAGAGAAAAAAGAAGAAAAAAAAG
+ATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACGAGAATCGATGGCAATGCCAGCCA
+GTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGAAATTGAAAGGAAAAACGTCATCA
+GGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTACAAGCTTGTACTATGGTTAGACA
+AACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGATGAGCTTTGGGGAAGTGGTTGGC
+AGGAACGAAATAAGATGAACCAGTATGAATGGTTGTCTTACTGCTGGGCAAATAATGTCA
+CTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGACATCAAATGGCAACAACTACCTG
+CTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGCTGATCTTGAAGCTCAAAAAACTC
+ACAATAAAGTGATGCATGCATACAACGGTAACCCTTTGTGTCAGGGATTTCAAGAAGTTG
+AAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAGTAATTCAGTTCTGAAACCATATA
+CTGGACTGGAAGCTGAGAAATACATCACCAACATTGTAGGAGACATGAATCCGAATCAAT
+CAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCAATACAATGCCAA
+>gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome--Locus_10_Transcript_4/8_Confidence_0.444_Length_1097_hit1_IdMatch=99.91,AligLength=1087,E-val=0.0
+AAAAAAAAATATAGGAGTCTCGAAGACTCTTTAGAAAGCATACATGTAGTTGCCTCCCTC
+GTTCTGGATGTACTGAACGGCCTGCTTGCATACTGATGTTAAGTGCAGAGCTATGTTTTC
+TCTTCCTCGCCAAAAAGAAAAACCACTTTTGACGACTATCTTACTTATCCAGGGTGTTAG
+TATTGGATTCAATATCCCTGTTGGTTCAAGAGGGACTTTACCTGTTGCAATGTTAATTGC
+ATCAGTCCTATGCCATCCTTTCCTTTCATATTCCGTCATAGTTTTGTAAGCTTCAGGATA
+CCATTTGGCCAAACATTCTTTTAGACTAGGTATCTCAATCTTAGCTTTCTTCGCGATTTG
+ATGTTGTCTTATAAATTCGCTGAATATTGGCATTCCGTTTGGACCAGCCTCATGAGATTG
+AATCATACGTCTAGGCCAAATGTTATTTTCGCACGTTGGTCCTTCTGTTTTGTAAAACCT
+GTATGTGGGTACAACCGTCTTCTCCCATACCGGTTTCAACTTCCTTAAATTTTTGATATA
+ATTGCTGGAAATGTGTTTTTGCGGTCCAGGAATGTCGTCGGCTGCTATTTTCATTGAAAA
+TTCGACTTGTTGATAAGCCGTCTTTTCCTCATCTGTCATTTGCTTCCACGTCAAGTTGAT
+GTTTTCACTAAACAGTCCAGGAACATCGAACGTTGGGATGTCAGCAAGTGGTAGCTTGCT
+AGTAGTTTTCCACCCTTTCCATTCGTATATTCCGAAACCACCCAGTCGTTTAGGCAGGTG
+CAGCCAGTGATAGCTCTGTCCCGTGTATTTACTCCACTTAATTTTGTTTGCTTGATGTAA
+CCAATCCAATTGTTTCTTGCTTCTCCTTTCTAATAAATAGATATTATTAGCGGTTGTCTC
+AACTTGTTGATTTGCAGTCCATGGTTGTGGGTTCCACGGTTTCCTTTGTGTCACGCTAGG
+GATAGCCCGATTTGTCCAGCCTCTGACGCCTTGAGTAGATATTTCTGTCCTTAAGAATTC
+GCAACAATTTTGCATAATTCCAAACTTGCTGTTTTCTCCAACGGCGTTGATTGCCTGATA
+GCTATACCTAAA
+>gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome--Locus_7_Transcript_5/11_Confidence_0.308_Length_4519_hit1_IdMatch=99.67,AligLength=3956,E-val=0.0
+ACAACCAGTAGAAGGTGTCAAACCAAATCCCGGACCATCAATAATTGAGCCAAATCATGG
+ACCAAGCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCAACGACAGCTGGCAAAACA
+AGACCAAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCTACTGGACGATCTGACCGA
+ATTAAAGACTACGGTACAACCACAGATTGACAATTCGGGATTCTTGGCTCATGTTGATCA
+TGCAGCTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGTGATGAAATACATTCTCAC
+GAATTCTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTACTGATATACCCGACGAGCC
+AGTAGAGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAAAGAGAAAAAAGAAGAAAA
+AAAAGATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACGAGAATCGATGGCAATGCC
+AGCCAGTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGAAATTGAAAGGAAAAACGT
+CATCAGGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTACAAGCTTGTACTATGGTT
+AGACAAACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGATGAGCTTTGGGGAAGTGG
+TTGGCAGGAACGAAATAAGATGAACCAGTATGAATGGTTGTCTTACTGCTGGGCAAATAA
+TGTCACTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGACATCAAATGGCAACAACT
+ACCTGCTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGCTGATCTTGAAGCTCAAAA
+AACTCACAATAAAGTGATGCATGCATACAACGGTAACCCTTTGTGTCAGGGATTTCAAGA
+AGTTGAAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAGTAATTCAGTTCTGAAACC
+ATATACTGGACTGGAAGCTGAGAAATACATCACCAACATTGTAGGAGACATGAATCCGAA
+TCAATCAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCAATACAATGCCAATGGGGC
+TGTGGTTCATAATGCTGTATCAACTATTCCGTTTACAAACCTCATTCCTAGGACGATTCG
+ATCTGATGATGACGTCCTTGAGAAGTCGGCCAACAGATTACAGGTTACAGAGACAAACGT
+TACGGATTACTACGTTAATCCGATTGAGCCAACTGAATTATCCAAAACAATAAGTGACCA
+GATCAAAAACAATCAATCATCTAACTGGCGACGAGATAACACGTCATTGGCTGGTTTCAA
+TAGTTTCGACATTGCGACAGTCAACACTGCACTAATTGCAAGAGGTCTAAGCACTGAATC
+AATGACTCTCAAGTTAGAGCTATTGCACGGAATAATGGCTATGCAGGTTGAAGCACCAAT
+GATCAATTCCAGCACTTATTCGATCGTAGATAATCATACAATCCCGACCGTAACTGACAG
+GGCCGTCATAGGCATCAATGACTCGCCTGTGTTTGGCGAGGACTGTGGTGGTGATCTTCC
+TGAATATCCTTTCGGCGGCGGAACCGGTACAATTGCCTTTCACCTAACATTGCAAACTGT
+TCCTGAAGAGAGGAGAGATAAGGCAATCTTCTGCCCTCCTGGTTTGTTGCAAGCAGCCCG
+AGATGGAGCAGAGGCATTGGCCCTATTTGTTTTGTCGATGTCTGAATGGCCTTTCGGTAT
+TTATACTGTCACCAAGAGAACAACCGATGAGAAGGGACTGAATCCTGCGGATCAGGTTTA
+CGTGCCGATGGAGACCATAACCCGTGTAGGTGGAGATAGAGTATTGGACGTTGTACTTCC
+TCGAAGGTATGCGGTTGCAAATCCAACGACTCAAGGAAATGCTAATGCTCTAGCAGTTAT
+ACAGCCTCAAGCTGGGCCTTTAGATAACGGTGCGGACGGATTAGCCGCTGGTGAATTATT
+GGATGTCAATTTCATCGGCGCCGACGGCATTACTGAATATCCATTGACATATTACTTGTA
+TACCTGGGCACTTCGATTTGATATAACGACGATTAGGCAATACATTGGTAGAATGGCAGC
+GTTAATTGGAGTGAAACACCAACTATGGGCTAGTCATGAAATCAGAGTAGCTTTGTGTCA
+AGTTGCACCCAAAATGGTGGTCGGAGTTACAGGTTCGGGAGACCTGCCAAGAGGATCAGC
+CGCTGCAAGCGAGGTATGTTACTCAAGCTTATTGGAGGTCTCACGCTCTGAAGAAGATTT
+TCCGCTGCTTGGTCAGGTTCAAGCCGATTTCAGAGTCTTTGAAACCAATACAAGCACATG
+GAATAAAGTAGTTTTGGGATTGGCAACAGCACCAAACGTGACAAGTGAACAAAACATGCA
+TGTACCATTCGTTGTTGGCGATCCGAGATCTAACGCGTGGGACCGACTCGAAGCAGTACC
+AATTGCTGCTGCTTGGCAGATGTACTACCATTCAAGGGGCGTAACTACTGCCGCTTGGAA
+TGATGCGTACACTAACGTAAATAACGTTTGGTTGCAAAAGATGGCCCGTGATAGCTTCTC
+AACGACCCAAAGCACTGGGACGATACTGCCTGCCAGATATGGTAAGATAGTCAAAAACCT
+GATGAGAAACATGTTTGAAAGAGAACCTGCCAAAGTAGTAACAAGCGTGGGAGGCGATGA
+ATATGAGATAACCCATTTTGAGCGCTGGTTACCGGGTAATAGATATGCTTCCGTGTTTGA
+ACAAGATGAAACTGAAGTTAATCTGTTTCCTCCAACTTTATTACCGGATATTTGGGTTCA
+ATATCCAGCGACTCACACCCCAATCATGTGTGCTTCGTTCCCACCCGTTTTCGGCCAAGA
+CTCAACACAAGGGTTCGGCAAAGAATCACAACTTATACCCTTTCGAAACGCAAACAACAA
+TCTTGTAGCACCATACGTTGAAGCTTTCGTTGCCAATCAAGCTTATTTCCCGATAGGATC
+GGGCCCAAACATCAACGACAAGGTTCTGTGGAATAGTAGATTGTGGATGACAAGTGGTTT
+CGTTCAGTACTTGGATTACGCTGGCAACGCAATCAACGAAGTGGTTCCTGCAGCAGGGCT
+ACCTTTGGGTAGGTCAATCCCATTACTGCCAGGGGAAGTTCAGCCGGTTGGTAACACCAA
+CATGAGCACAAGCTGCGTTCCTCGTTATTCTGTGGACGGTCGCCGAATTTTTACTTATGT
+CAACACAGCTCAATCCGTTCCTTTGATACAAGCGTGTAATAGAGCCAATAGATTGGCCAG
+ATCGGCATGGCTATTATTGCATGTCTACATCGAACCAGAGTTGCAGCTATTGAGCGATGA
+AGTGGTGGACATATTCGACCAACTGACAAGCAAGACTTTTTTAGATGTAGCAAAATCGGC
+TGCGGACAGTGCGGAGGGCAACATTCCGGCAACGAAGGTATTGACAGACCTCCAGGCAGT
+GGATTCAGCAACGCTGCCGAGTACTTTGGATCCATCCACAAATATGCTCCAACCAGCTCC
+TTTACTCGGCGAACCTACGACAAATTAACTCGATACATTCATGATGGGGTAAGTCGAAGT
+AGTCAGAGAGAAATTTCATCATTGTCGGATGATTTAGTTAGATTTAGTACTCTCACAGAT
+TTTACTGTCATCGATTTTATTACTAAGAAATTAGATTTAGAACGTCCGATTAGTACTCAA
+GGAGATTTATTGGCGTTAGAACCTAGATGCAAGGGTGACCTCGCTGTAGCAAGACTTAAG
+ATTAAGGACATAATAGGTAGGATTGATAAGGATATTAGAACGTGGTGTGAAGCAAATTTA
+TGCCATTTGGATGCAATCTTGGTAACGAACTTGATAATCTGGGGACAAATCTGGGGGTTG
+GAAATTCTGAAAGCTTTACATTCAACAGGAATATTAAACGATTTCGATACTTTCGCAACA
+A
+>gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome--Locus_10_Transcript_1/8_Confidence_0.222_Length_565_hit1_IdMatch=99.81,AligLength=530,E-val=0.0
+TGTTATTGATTGCCTGATAGCTATACCTAAACACCAGACATGTCATGAAATCCTTAGCTA
+ATATTTTTGTGTCGTCGCCTTTCAATGCTATTAACCTAATGTTATCTTTGCCCAATATCA
+AACTCGTCTGATCTCTTGCTATATCCGTTGTTATCATATTCCAGACATTGCCGATGAAAC
+TTGTTGGACGTATTCCAGAAGGTATGCCGTTAGTCTGTTTCTTTGTTTCCTTTGTTAACG
+GTGAGTACAGGTAATTATTGTCGTAACACGAAATATTTTTCGCAGCTATTTTAGTGAATA
+AATGTCGATCTTGTGGAGGTACCAAATATTTGATTTGGTCTATGACGCGTTTCGTAATCT
+GCTTCACTTCCCAAATTGTTGGTTGTCTGTCAAACCCTTTGAAATCAAAAGGTAGGGCAA
+AACACCCGTCTTTCAATGCTTTAATTGTTTCACAGTTCCTAAGATGCGTTTCACCTGGTG
+TTTCGTCTAATGTTATGTATTTCCAATTTTTAAAGCCATGTCCAAATAGATAAAA
+>gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome--Locus_10_Transcript_7/8_Confidence_0.111_Length_255_hit1_IdMatch=100.0,AligLength=26,E-val=0.001
+GCATTTTCAATATCCCTGTTGGTTCAAGAGG
+>gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome--Locus_7_Transcript_11/11_Confidence_0.000_Length_1206_hit1_IdMatch=99.17,AligLength=1206,E-val=0.0
+TGAGAATAAACAACAACAACCAAGTGCACCGATGCCACACGAGCCAAGGGCAGCAGGTCA
+GGCACTTAAGGATTTGAATTTGGCTTATTTGAATAACGACCAAAAAACAACATTGTCGGC
+ATGGGTACGAGGCCTAACAGTAGAAGGTGTCGAACCAAATCCCGGACCATCAATAATTGA
+GCCAAATCATGGACCAAGCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCAACGACA
+GCTGGCAAAACAAGACCAAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCTACTGGA
+CGATCTGACCGAATTAAAGACTACGGTACAACCACAGATTGACAATTCGGGATTCTTGGC
+TCATGTTGATCATGCAGCTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGTGATGAA
+ATACATTCTCACGAATTCTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTACTGATAT
+ACCCGACGAGCCAGTAGAGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAAAGAGAA
+AAAAGAAGAAAAAAAAGATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACGAGAATC
+GATGGCAATGCCAGCCAGTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGAAATTGA
+AAGGAAAAACGTCATCAGGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTACAAGCT
+TGTACTATGGTTAGACAAACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGATGAGCT
+TTGGGGAAGTGGTTGGCAGGAACGAAATAAGATGAACCAGTATGAATGGTTGTCTTACTG
+CTGGGCAAATAATGTCACTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGACATCAA
+ATGGCAACAACTACCTGCTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGCTGATCT
+TGAAGCTCAAAAAACTCACAATAAAGTGATGCATGCATACAACGGTAACCCTTTGTGTCA
+GGGATTTCAAGAAGTTGAAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAGTAATTC
+AGTTCTGAAACCATATACTGGACTGGAAGCTGAGAAATACATCACCAACATTGTAGGAGA
+CATGAATCCGAATCAATCAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCAATACAA
+TGCCAA
+>gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome--Locus_7_Transcript_4/11_Confidence_0.154_Length_571_hit1_IdMatch=99.82,AligLength=571,E-val=0.0
+CAGGATGAAACTGAAGTTAATCTGTTTCCTCCAACTTTATTACCGGATATTTGGGTTCAA
+TATCCAGCGACTCACACCCCAATCATGTGTGCTTCGTTCCCACCCGTTTTCGGCCAAGAC
+TCAACACAAGGGTTCGGCAAAGAATCACAACTTATACCCTTTCGAAACGCAAACAACAAT
+CTTGTAGCACCATACGTTGAAGCTTTCGTTGCCAATCAAGCTTATTTCCCGATAGGATCG
+GGCCCAAACATCAACGACAAGGTTCTGTGGAATAGTAGATTGTGGATGACAAGTGGTTTC
+GTTCAGTACTTGGATTACGCTGGCAACGCAATCAACGAAGTGGTTCCTGCAGCAGGGCTA
+CCTTTGGGTAGGTCAATCCCATTACTGCCAGGGGAAGTTCAGCCGGTTGGTAACACCAAC
+ATGAGCACAAGCTGCGTTCCTCGTTATTCTGTGGACGGTCGCCGAATTTTTACTTATGTC
+AACACAGCTCAATCCGTTCCTTTGATACAAGCGTGTAATAGAGCCAATAGATTGGCCAGA
+TCGGCATGGCTATTATTGCATGTCTACATCG
+>gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome--Locus_10_Transcript_6/8_Confidence_0.333_Length_1121_hit1_IdMatch=99.91,AligLength=1121,E-val=0.0
+CGTTATCCAGCTGGATTATGTTGTTATTGTGTAGAAAATATAGGAGTCTCGAAGACTCTT
+TAGAAAGCATACATGTAGTTGCCTCCCTCGTTCTGGATGTACTGAACGGCCTGCTTGCAT
+ACTGATGTTAAGTGCAGAGCTATGTTTTCTCTTCCTCGCCAAAAAGAAAAACCACTTTTG
+ACGACTATCTTACTTATCCAGGGTGTTAGTATTGGATTCAATATCCCTGTTGGTTCAAGA
+GGGACTTTACCTGTTGCAATGTTAATTGCATCAGTCCTATGCCATCCTTTCCTTTCATAT
+TCCGTCATAGTTTTGTAAGCTTCAGGATACCATTTGGCCAAACATTCTTTTAGACTAGGT
+ATCTCAATCTTAGCTTTCTTCGCGATTTGATGTTGTCTTATAAATTCGCTGAATATTGGC
+ATTCCGTTTGGACCAGCCTCATGAGATTGAATCATACGTCTAGGCCAAATGTTATTTTCG
+CACGTTGGTCCTTCTGTTTTGTAAAACCTGTATGTGGGTACAACCGTCTTCTCCCATACC
+GGTTTCAACTTCCTTAAATTTTTGATATAATTGCTGGAAATGTGTTTTTGCGGTCCAGGA
+ATGTCGTCGGCTGCTATTTTCATTGAAAATTCGACTTGTTGATAAGCCGTCTTTTCCTCA
+TCTGTCATTTGCTTCCACGTCAAGTTGATGTTTTCACTAAACAGTCCAGGAACATCGAAC
+GTTGGGATGTCAGCAAGTGGTAGCTTGCTAGTAGTTTTCCACCCTTTCCATTCGTATATT
+CCGAAACCACCCAGTCGTTTAGGCAGGTGCAGCCAGTGATAGCTCTGTCCCGTGTATTTA
+CTCCACTTAATTTTGTTTGCTTGATGTAACCAATCCAATTGTTTCTTGCTTCTCCTTTCT
+AATAAATAGATATTATTAGCGGTTGTCTCAACTTGTTGATTTGCAGTCCATGGTTGTGGG
+TTCCACGGTTTCCTTTGTGTCACGCTAGGGATAGCCCGATTTGTCCAGCCTCTGACGCCT
+TGAGTAGATATTTCTGTCCTTAAGAATTCGCAACAATTTTGCATAATTCCAAACTTGCTG
+TTTTCTCCAACGGCGTTGATTGCCTGATAGCTATACCTAAA
+>gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome--Locus_7_Transcript_1/11_Confidence_0.154_Length_1632_hit1_IdMatch=99.16,AligLength=1069,E-val=0.0
+ACAACCAGTAGAAGGTGTCAAACCAAATCCCGGACCATCAATAATTGAGCCAAATCATGG
+ACCAAGCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCAACGACAGCTGGCAAAACA
+AGACCAAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCTACTGGACGATCTGACCGA
+ATTAAAGACTACGGTACAACCACAGATTGACAATTCGGGATTCTTGGCTCATGTTGATCA
+TGCAGCTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGTGATGAAATACATTCTCAC
+GAATTCTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTACTGATATACCCGACGAGCC
+AGTAGAGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAAAGAGAAAAAAGAAGAAAA
+AAAAGATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACGAGAATCGATGGCAATGCC
+AGCCAGTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGAAATTGAAAGGAAAAACGT
+CATCAGGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTACAAGCTTGTACTATGGTT
+AGACAAACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGATGAGCTTTGGGGAAGTGG
+TTGGCAGGAACGAAATAAGATGAACCAGTATGAATGGTTGTCTTACTGCTGGGCAAATAA
+TGTCACTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGACATCAAATGGCAACAACT
+ACCTGCTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGCTGATCTTGAAGCTCAAAA
+AACTCACAATAAAGTGATGCATGCATACAACGGTAACCCTTTGTGTCAGGGATTTCAAGA
+AGTTGAAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAGTAATTCAGTTCTGAAACC
+ATATACTGGACTGGAAGCTGAGAAATACATCACCAACATTGTAGGAGACATGAATCCGAA
+TCAATCAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCAATACAATGCCAA
+>gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome--Locus_10_Transcript_3/8_Confidence_0.222_Length_529_hit1_IdMatch=99.43,AligLength=529,E-val=0.0
+CAGGAATGTCGTCGTCGGCTGCTATTTTCATTGAAAATTCGACTTGTTGATAAGCCGTCT
+TTTCCTCATCTGTCATTTGCTTCCACGTCAAGTTGATGTTTTCACTAAACAGTCCAGGAA
+CATCGAACGTTGGGATGTCAGCAAGTGGTAGCTTGCTAGTAGTTTTCCACCCTTTCCATT
+CGTATATTCCGAAACCACCCAGTCGTTTAGGCAGGTGCAGCCAGTGATAGCTCTGTCCCG
+TGTATTTACTCCACTTAATTTTGTTTGCTTGATGTAACCAATCCAATTGTTTCTTGCTTC
+TCCTTTCTAATAAATAGATATTATTAGCGGTTGTCTCAACTTGTTGATTTGCAGTCCATG
+GTTGTGGGTTCCACGGTTTCCTTTGTGTCACGCTAGGGATAGCCCGATTTGTCCAGCCTC
+TGACGCCTTGAGTAGATATTTCTGTCCTTAAGAATTCGCAACAATTTTGCATAATTCCAA
+ACTTGCTGTTTTCTCCAACGGCGTTGATTGCCTGATAGCTATACCTAAA
+>gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome--Locus_7_Transcript_8/11_Confidence_0.154_Length_552_hit1_IdMatch=99.28,AligLength=552,E-val=0.0
+TAAACGATTTTGATACTTTCGCAACAAAAGGAAGCAAGATTAGTGCATTTGTCAAGCGTT
+TTCCCTTCGACAAGGATGATGCCAAAGCTAGATGGGCAGAGATCAACACGCTGACGGGCT
+ATTTGCAGAATGATTTTGGAAACTTCGATTACGATAAGGAATTTGAAGCTTTAGCTACCG
+GAGATAGTAACCACCCCGCTTGGTGGGAAGAAGTATTCACTAAGAAAATAAAAGAGTTGA
+TGACACATCAAGAACACAAAAAGTATATCAGTTTTGAAAAATATGTTAAGGAAGGATATT
+GGATAACATCTGGCAGCAGCAGCATCGGCAAAGTCAATTGGTCATATGACGGAGACTTGG
+GCAAATTTAAGGCTAGAAAGAACATGTTATTAGATCTATATACGCCGGACGAAATCTACA
+AAATGGCTGTAGAATGGGACGGGAAACTAGAGAATAGAGTGTTCATCAAAGATGAATTGG
+CAAAGAGAAGATTGGCAGTGGCAAGCAATATTGAAGCATATTTGAATCAAGGGTATATAT
+TTTATCTATTTG
+>gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome--Locus_8_Transcript_2/4_Confidence_0.200_Length_117_hit1_IdMatch=100.0,AligLength=26,E-val=4e-04
+TTTAGGTATAGCTATCAGGCAATCAA
+>gi|268053723|ref|NC_013499.1|_Drosophila_melanogaster_totivirus_SW-2009a,_complete_genome--Locus_7_Transcript_1/11_Confidence_0.154_Length_1632_hit2_IdMatch=98.06,AligLength=566,E-val=0.0
+TGCGATATTAGAGAAGATCCTACTCTAATATCATACGGATTCCATGGATCAGACGAGGAA
+GACCCATACAGCCGATGAAGATGACAACTGAAAGGAAAACAAGAGGATACAGGTGCTTCG
+CTTTGTTCGTGAGACGGCAAAGATTTGAACCTTTTTAGAAACAATTTAAATATGCTGAAC
+AACTATCACAATAACTTTAACAGTCCTAGCCTGGCTATGATGGACGATGACAAAGCTTGT
+GTTGATGATGGTTGTAAGCTAACAAAGTGGTGATGAGTTGGTGATACCCTCACTTTGGTA
+TTTAATTGTAGACAAGATGGAACATTAGCATCCGAGGTCACTACGTTCCGGAAAGAAACT
+CAAATACAACAGGAACTGATGGGAGAATATCTGACGAAAAATGGAAAACGGGACAGGATT
+GACAAAATGAAAGGATTTTGACAGCTCGGAACAGACGGCAAAATGGAACAAAAGTATGAA
+ACAAGAAACACGTGTTCCTCAGTCTCACATTGAATATCCAGATATCGAGATGCACCTCAT
+ATCTGAGAATAAACAACTACAACCA
+
+>gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome--Locus_10_Transcript_2/8_Confidence_0.111_Length_1023_hit1_IdMatch=99.9,AligLength=1023,E-val=0.0
+GTCGTCGGCTGCTATTTTCATTGAAAATTCGACTTGTTGATAAGCCGTCTTTTCCTCATC
+TGTCATTTGCTTCCACGTCAAGTTGATGTTTTCACTAAACAGTCCAGGAACATCGAACGT
+TGGGATGTCAGCAAGTGGTAGCTTGCTAGTAGTTTTCCACCCTTTCCATTCGTATATTCC
+GAAACCACCCAGTCGTTTAGGCAGGTGCAGCCAGTGATAGCTCTGTCCCGTGTATTTACT
+CCACTTAATTTTGTTTGCTTGATGTAACCAATCCAATTGTTTCTTGCTTCTCCTTTCTAA
+TAAATAGATATTATTAGCGGTTGTCTCAACTTGTTGATTTGCAGTCCATGGTTGTGGGTT
+CCACGGTTTCCTTTGTGTCACGCTAGGGATAGCCCGATTTGTCCAGCCTCTGACGCCTTG
+AGTAGATATTTCTGTCCTTAAGAATTCGCAACAATTTTGCATAATTCCAAACTTGCTGTT
+TTCTCCAACGGCGTTGATTGCCTGATAGCTATACCTAAACACCAGACATGTCATGAAATC
+CTTAGCTAATATTTTTGTGTCGTCGCCTTTCAATGCTATTAACCTAATGTTATCTTTGCC
+CAATATCAAACTCGTCTGATCTCTTGCTATATCCGTTGTTATCATATTCCAGACATTGCC
+GATGAAACTTGTTGGACGTATTCCAGAAGGTATGCCGTTAGTCTGTTTCTTTGTTTCCTT
+TGTTAACGGTGAGTACAGGTAATTATTGTCGTAACACGAAATATTTTTCGCAGCTATTTT
+AGTGAATAAATGTCGATCTTGTGGAGGTACCAAATATTTGATTTGGTCTATGACGCGTTT
+CGTAATCTGCTTCACTTCCCAAATTGTTGGTTGTCTGTCAAACCCTTTGAAATCAAAAGG
+TAGGGCAAAACACCCGTCTTTCAATGCTTTAATTGTTTCACAGTTCCTAAGATGCGTTTC
+ACCTGGTGTTTCGTCTAATGTTATGTATTTCCAATTTTTAAAGCCATGTCCAAATAGATA
+AAA
+>gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome--Locus_7_Transcript_3/11_Confidence_0.154_Length_1743_hit1_IdMatch=99.89,AligLength=1742,E-val=0.0
+CCTTAGAGGTAACCAATACAATGCCAATGGGGCTGTGGTTCATAATGCTGTATCAACTAT
+TCCGTTTACAAACCTCATTCCTAGGACGATTCGATCTGATGATGACGTCCTTGAGAAGTC
+GGCCAACAGATTACAGGTTACAGAGACAAACGTTACGGATTACTACGTTAATCCGATTGA
+GCCAACTGAATTATCCAAAACAATAAGTGACCAGATCAAAAACAATCAATCATCTAACTG
+GCGACGAGATAACACGTCATTGGCTGGTTTCAATAGTTTCGACATTGCGACAGTCAACAC
+TGCACTAATTGCAAGAGGTCTAAGCACTGAATCAATGACTCTCAAGTTAGAGCTATTGCA
+CGGAATAATGGCTATGCAGGTTGAAGCACCAATGATCAATTCCAGCACTTATTCGATCGT
+AGATAATCATACAATCCCGACCGTAACTGACAGGGCCGTCATAGGCATCAATGACTCGCC
+TGTGTTTGGCGAGGACTGTGGTGGTGATCTTCCTGAATATCCTTTCGGCGGCGGAACCGG
+TACAATTGCCTTTCACCTAACATTGCAAACTGTTCCTGAAGAGAGGAGAGATAAGGCAAT
+CTTCTGCCCTCCTGGTTTGTTGCAAGCAGCCCGAGATGGAGCAGAGGCATTGGCCCTATT
+TGTTTTGTCGATGTCTGAATGGCCTTTCGGTATTTATACTGTCACCAAGAGAACAACCGA
+TGAGAAGGGACTGAATCCTGCGGATCAGGTTTACGTGCCGATGGAGACCATAACCCGTGT
+AGGTGGAGATAGAGTATTGGACGTTGTACTTCCTCGAAGGTATGCGGTTGCAAATCCAAC
+GACTCAAGGAAATGCTAATGCTCTAGCAGTTATACAGCCTCAAGCTGGGCCTTTAGATAA
+CGGTGCGGACGGATTAGCCGCTGGTGAATTATTGGATGTCAATTTCATCGGCGCCGACGG
+CATTACTGAATATCCATTGACATATTACTTGTATACCTGGGCACTTCGATTTGATATAAC
+GACGATTAGGCAATACATTGGTAGAATGGCAGCGTTAATTGGAGTGAAACACCAACTATG
+GGCTAGTCATGAAATCAGAGTAGCTTTGTGTCAAGTTGCACCCAAAATGGTGGTCGGAGT
+TACAGGTTCGGGAGACCTGCCAAGAGGATCAGCCGCTGCAAGCGAGGTATGTTACTCAAG
+CTTATTGGAGGTCTCACGCTCTGAAGAAGATTTTCCGCTGCTTGGTCAGGTTCAAGCCGA
+TTTCAGAGTCTTTGAAACCAATACAAGCACATGGAATAAAGTAGTTTTGGGATTGGCAAC
+AGCACCAAACGTGACAAGTGAACAAAACATGCATGTACCATTCGTTGTTGGCGATCCGAG
+ATCTAACGCGTGGGACCGACTCGAAGCAGTACCAATTGCTGCTGCTTGGCAGATGTACTA
+CCATTCAAGGGGCGTAACTACTGCCGCTTGGAATGATGCGTACACTAACGTAAATAACGT
+TTGGTTGCAAAAGATGGCCCGTGATAGCTTCTCAACGACCCAAAGCACTGGGACGATACT
+GCCTGCCAGATATGGTAAGATAGTCAAAAACCTGATGAGAAACATGTTTGAAAGAGAACC
+TGCCAAAGTAGTAACAAGCGTGGGAGGCGATGAATATGAGATAACCCATTTTGAGCGCTG
+GTTACCGGGTAATAGATATGCTTCCGTGTTTGAACAAGATGAAACTGAAGTTAATCTGTT
+TCC
+>gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome--Locus_7_Transcript_5/11_Confidence_0.308_Length_4519_hit2_IdMatch=98.06,AligLength=566,E-val=0.0
+TGCGATATTAGAGAAGATCCTACTCTAATATCATACGGATTCCATGGATCAGACGAGGAA
+GACCCATACAGCCGATGAAGATGACAACTGAAAGGAAAACAAGAGGATACAGGTGCTTCG
+CTTTGTTCGTGAGACGGCAAAGATTTGAACCTTTTTAGAAACAATTTAAATATGCTGAAC
+AACTATCACAATAACTTTAACAGTCCTAGCCTGGCTATGATGGACGATGACAAAGCTTGT
+GTTGATGATGGTTGTAAGCTAACAAAGTGGTGATGAGTTGGTGATACCCTCACTTTGGTA
+TTTAATTGTAGACAAGATGGAACATTAGCATCCGAGGTCACTACGTTCCGGAAAGAAACT
+CAAATACAACAGGAACTGATGGGAGAATATCTGACGAAAAATGGAAAACGGGACAGGATT
+GACAAAATGAAAGGATTTTGACAGCTCGGAACAGACGGCAAAATGGAACAAAAGTATGAA
+ACAAGAAACACGTGTTCCTCAGTCTCACATTGAATATCCAGATATCGAGATGCACCTCAT
+ATCTGAGAATAAACAACTACAACCA
+>gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome--Locus_7_Transcript_4/11_Confidence_0.154_Length_571_hit1_IdMatch=99.82,AligLength=571,E-val=0.0
+CAGGATGAAACTGAAGTTAATCTGTTTCCTCCAACTTTATTACCGGATATTTGGGTTCAA
+TATCCAGCGACTCACACCCCAATCATGTGTGCTTCGTTCCCACCCGTTTTCGGCCAAGAC
+TCAACACAAGGGTTCGGCAAAGAATCACAACTTATACCCTTTCGAAACGCAAACAACAAT
+CTTGTAGCACCATACGTTGAAGCTTTCGTTGCCAATCAAGCTTATTTCCCGATAGGATCG
+GGCCCAAACATCAACGACAAGGTTCTGTGGAATAGTAGATTGTGGATGACAAGTGGTTTC
+GTTCAGTACTTGGATTACGCTGGCAACGCAATCAACGAAGTGGTTCCTGCAGCAGGGCTA
+CCTTTGGGTAGGTCAATCCCATTACTGCCAGGGGAAGTTCAGCCGGTTGGTAACACCAAC
+ATGAGCACAAGCTGCGTTCCTCGTTATTCTGTGGACGGTCGCCGAATTTTTACTTATGTC
+AACACAGCTCAATCCGTTCCTTTGATACAAGCGTGTAATAGAGCCAATAGATTGGCCAGA
+TCGGCATGGCTATTATTGCATGTCTACATCG
+>gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome--Locus_7_Transcript_11/11_Confidence_0.000_Length_1206_hit1_IdMatch=99.17,AligLength=1206,E-val=0.0
+TGAGAATAAACAACAACAACCAAGTGCACCGATGCCACACGAGCCAAGGGCAGCAGGTCA
+GGCACTTAAGGATTTGAATTTGGCTTATTTGAATAACGACCAAAAAACAACATTGTCGGC
+ATGGGTACGAGGCCTAACAGTAGAAGGTGTCGAACCAAATCCCGGACCATCAATAATTGA
+GCCAAATCATGGACCAAGCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCAACGACA
+GCTGGCAAAACAAGACCAAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCTACTGGA
+CGATCTGACCGAATTAAAGACTACGGTACAACCACAGATTGACAATTCGGGATTCTTGGC
+TCATGTTGATCATGCAGCTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGTGATGAA
+ATACATTCTCACGAATTCTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTACTGATAT
+ACCCGACGAGCCAGTAGAGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAAAGAGAA
+AAAAGAAGAAAAAAAAGATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACGAGAATC
+GATGGCAATGCCAGCCAGTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGAAATTGA
+AAGGAAAAACGTCATCAGGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTACAAGCT
+TGTACTATGGTTAGACAAACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGATGAGCT
+TTGGGGAAGTGGTTGGCAGGAACGAAATAAGATGAACCAGTATGAATGGTTGTCTTACTG
+CTGGGCAAATAATGTCACTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGACATCAA
+ATGGCAACAACTACCTGCTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGCTGATCT
+TGAAGCTCAAAAAACTCACAATAAAGTGATGCATGCATACAACGGTAACCCTTTGTGTCA
+GGGATTTCAAGAAGTTGAAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAGTAATTC
+AGTTCTGAAACCATATACTGGACTGGAAGCTGAGAAATACATCACCAACATTGTAGGAGA
+CATGAATCCGAATCAATCAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCAATACAA
+TGCCAA
+>gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome--Locus_10_Transcript_5/8_Confidence_0.333_Length_628_hit1_IdMatch=99.84,AligLength=628,E-val=0.0
+CGTTATCCAGCTGGATTATGTTGTTATTGTGTAGAAAATATAGGAGTCTCGAAGACTCTT
+TAGAAAGCATACATGTAGTTGCCTCCCTCGTTCTGGATGTACTGAACGGCCTGCTTGCAT
+ACTGATGTTAAGTGCAGAGCTATGTTTTCTCTTCCTCGCCAAAAAGAAAAACCACTTTTG
+ACGACTATCTTACTTATCCAGGGTGTTAGTATTGGATTCAATATCCCTGTTGGTTCAAGA
+GGGACTTTACCTGTTGCAATGTTAATTGCATCAGTCCTATGCCATCCTTTCCTTTCATAT
+TCCGTCATAGTTTTGTAAGCTTCAGGATACCATTTGGCCAAACATTCTTTTAGACTAGGT
+ATCTCAATCTTAGCTTTCTTCGCGATTTGATGTTGTCTTATAAATTCGCTGAATATTGGC
+ATTCCGTTTGGACCAGCCTCATGAGATTGAATCATACGTCTAGGCCAAATGTTATTTTCG
+CACGTTGGTCCTTCTGTTTTGTAAAACCTGTATGTGGGTACAACCGTCTTCTCCCATACC
+GGTTTCAACTTCCTTAAATTTTTGATATAATTGCTGGAAATGTGTTTTTGCGGTCCAGGA
+ATGTCGTCGGCTGCTATTTTCATTGAAA
+>gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome--Locus_7_Transcript_1/11_Confidence_0.154_Length_1632_hit2_IdMatch=98.06,AligLength=566,E-val=0.0
+TGCGATATTAGAGAAGATCCTACTCTAATATCATACGGATTCCATGGATCAGACGAGGAA
+GACCCATACAGCCGATGAAGATGACAACTGAAAGGAAAACAAGAGGATACAGGTGCTTCG
+CTTTGTTCGTGAGACGGCAAAGATTTGAACCTTTTTAGAAACAATTTAAATATGCTGAAC
+AACTATCACAATAACTTTAACAGTCCTAGCCTGGCTATGATGGACGATGACAAAGCTTGT
+GTTGATGATGGTTGTAAGCTAACAAAGTGGTGATGAGTTGGTGATACCCTCACTTTGGTA
+TTTAATTGTAGACAAGATGGAACATTAGCATCCGAGGTCACTACGTTCCGGAAAGAAACT
+CAAATACAACAGGAACTGATGGGAGAATATCTGACGAAAAATGGAAAACGGGACAGGATT
+GACAAAATGAAAGGATTTTGACAGCTCGGAACAGACGGCAAAATGGAACAAAAGTATGAA
+ACAAGAAACACGTGTTCCTCAGTCTCACATTGAATATCCAGATATCGAGATGCACCTCAT
+ATCTGAGAATAAACAACTACAACCA
+>gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome--Locus_7_Transcript_6/11_Confidence_0.154_Length_656_hit1_IdMatch=99.69,AligLength=655,E-val=0.0
+TATGGCTATTATTGCATGTCTACATCGAACCAGAGTTGCAGCTATTGAGCGATGAAGTGG
+TGGACATATTCGACCAACTGACAAGCAAGACTTTTTTAGATGTAGCAAAATCGGCTGCGG
+ACAGTGCGGAGGGCAACATTCCGGCAACGAAGGTATTGACAGACCTCCAGGCAGTGGATT
+CAGCAACGCTGCCGAGTACTTTGGATCCATCCACAAATATGCTCCAACCAGCTCCTTTAC
+TCGGCGAACCTACGACAAATTAACTCGATACATTCATGATGGGGTAAGTCGAAGTAGTCA
+GAGAGAAATTTCATCATTGTCGGATGATTTAGTTAGATTTAGTACTCTCACAGATTTTAC
+TGTCATCGATTTTATTACTAAGAAATTAGATTTAGAACGTCCGATTAGTACTCAAGGAGA
+TTTATTGGCGTTAGAACCTAGATGCAAGGGTGACCTCGCTGTAGCAAGACTTAAGATTAA
+GGACATAATAGGTAGGATTGATAAGGATATTAGAACGTGGTGTGAAGCAAATTTATGCCA
+TTTGGATGCAATCTTGGTAACGAACTTGATAATCTGGGGACAAATCTGGGGGTTGGAAAT
+TCTGAAAGCTTTACATTCAACAGGAATATTAAACGATTTCGATACTTTCGCAACAA
+>gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome--Locus_10_Transcript_7/8_Confidence_0.111_Length_255_hit1_IdMatch=100.0,AligLength=26,E-val=0.001
+GCATTTTCAATATCCCTGTTGGTTCAAGAGG
+>gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome--Locus_10_Transcript_6/8_Confidence_0.333_Length_1121_hit1_IdMatch=99.91,AligLength=1121,E-val=0.0
+CGTTATCCAGCTGGATTATGTTGTTATTGTGTAGAAAATATAGGAGTCTCGAAGACTCTT
+TAGAAAGCATACATGTAGTTGCCTCCCTCGTTCTGGATGTACTGAACGGCCTGCTTGCAT
+ACTGATGTTAAGTGCAGAGCTATGTTTTCTCTTCCTCGCCAAAAAGAAAAACCACTTTTG
+ACGACTATCTTACTTATCCAGGGTGTTAGTATTGGATTCAATATCCCTGTTGGTTCAAGA
+GGGACTTTACCTGTTGCAATGTTAATTGCATCAGTCCTATGCCATCCTTTCCTTTCATAT
+TCCGTCATAGTTTTGTAAGCTTCAGGATACCATTTGGCCAAACATTCTTTTAGACTAGGT
+ATCTCAATCTTAGCTTTCTTCGCGATTTGATGTTGTCTTATAAATTCGCTGAATATTGGC
+ATTCCGTTTGGACCAGCCTCATGAGATTGAATCATACGTCTAGGCCAAATGTTATTTTCG
+CACGTTGGTCCTTCTGTTTTGTAAAACCTGTATGTGGGTACAACCGTCTTCTCCCATACC
+GGTTTCAACTTCCTTAAATTTTTGATATAATTGCTGGAAATGTGTTTTTGCGGTCCAGGA
+ATGTCGTCGGCTGCTATTTTCATTGAAAATTCGACTTGTTGATAAGCCGTCTTTTCCTCA
+TCTGTCATTTGCTTCCACGTCAAGTTGATGTTTTCACTAAACAGTCCAGGAACATCGAAC
+GTTGGGATGTCAGCAAGTGGTAGCTTGCTAGTAGTTTTCCACCCTTTCCATTCGTATATT
+CCGAAACCACCCAGTCGTTTAGGCAGGTGCAGCCAGTGATAGCTCTGTCCCGTGTATTTA
+CTCCACTTAATTTTGTTTGCTTGATGTAACCAATCCAATTGTTTCTTGCTTCTCCTTTCT
+AATAAATAGATATTATTAGCGGTTGTCTCAACTTGTTGATTTGCAGTCCATGGTTGTGGG
+TTCCACGGTTTCCTTTGTGTCACGCTAGGGATAGCCCGATTTGTCCAGCCTCTGACGCCT
+TGAGTAGATATTTCTGTCCTTAAGAATTCGCAACAATTTTGCATAATTCCAAACTTGCTG
+TTTTCTCCAACGGCGTTGATTGCCTGATAGCTATACCTAAA
+>gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome--Locus_7_Transcript_1/11_Confidence_0.154_Length_1632_hit1_IdMatch=99.16,AligLength=1069,E-val=0.0
+ACAACCAGTAGAAGGTGTCAAACCAAATCCCGGACCATCAATAATTGAGCCAAATCATGG
+ACCAAGCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCAACGACAGCTGGCAAAACA
+AGACCAAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCTACTGGACGATCTGACCGA
+ATTAAAGACTACGGTACAACCACAGATTGACAATTCGGGATTCTTGGCTCATGTTGATCA
+TGCAGCTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGTGATGAAATACATTCTCAC
+GAATTCTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTACTGATATACCCGACGAGCC
+AGTAGAGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAAAGAGAAAAAAGAAGAAAA
+AAAAGATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACGAGAATCGATGGCAATGCC
+AGCCAGTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGAAATTGAAAGGAAAAACGT
+CATCAGGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTACAAGCTTGTACTATGGTT
+AGACAAACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGATGAGCTTTGGGGAAGTGG
+TTGGCAGGAACGAAATAAGATGAACCAGTATGAATGGTTGTCTTACTGCTGGGCAAATAA
+TGTCACTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGACATCAAATGGCAACAACT
+ACCTGCTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGCTGATCTTGAAGCTCAAAA
+AACTCACAATAAAGTGATGCATGCATACAACGGTAACCCTTTGTGTCAGGGATTTCAAGA
+AGTTGAAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAGTAATTCAGTTCTGAAACC
+ATATACTGGACTGGAAGCTGAGAAATACATCACCAACATTGTAGGAGACATGAATCCGAA
+TCAATCAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCAATACAATGCCAA
+>gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome--Locus_10_Transcript_3/8_Confidence_0.222_Length_529_hit1_IdMatch=99.43,AligLength=529,E-val=0.0
+CAGGAATGTCGTCGTCGGCTGCTATTTTCATTGAAAATTCGACTTGTTGATAAGCCGTCT
+TTTCCTCATCTGTCATTTGCTTCCACGTCAAGTTGATGTTTTCACTAAACAGTCCAGGAA
+CATCGAACGTTGGGATGTCAGCAAGTGGTAGCTTGCTAGTAGTTTTCCACCCTTTCCATT
+CGTATATTCCGAAACCACCCAGTCGTTTAGGCAGGTGCAGCCAGTGATAGCTCTGTCCCG
+TGTATTTACTCCACTTAATTTTGTTTGCTTGATGTAACCAATCCAATTGTTTCTTGCTTC
+TCCTTTCTAATAAATAGATATTATTAGCGGTTGTCTCAACTTGTTGATTTGCAGTCCATG
+GTTGTGGGTTCCACGGTTTCCTTTGTGTCACGCTAGGGATAGCCCGATTTGTCCAGCCTC
+TGACGCCTTGAGTAGATATTTCTGTCCTTAAGAATTCGCAACAATTTTGCATAATTCCAA
+ACTTGCTGTTTTCTCCAACGGCGTTGATTGCCTGATAGCTATACCTAAA
+>gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome--Locus_7_Transcript_9/11_Confidence_0.154_Length_552_hit1_IdMatch=99.09,AligLength=551,E-val=0.0
+AAAACGATTTCGATACTTTCGCAACAAAAGGAAGCAAGATTAGTGCATTTGTCAAGCGTT
+TTCCCTTCGACAAGGATGATGCCAAAGCTAGATGGGCAGAGATCAACACGCTGACGGGCT
+ATTTGCAGAATGATTTTGGAAACTTCGATTACGATAAGGAATTTGAAGCTTTAGCTACCG
+GAGATAGTAACCACCCCGCTTGGTGGGAAGAAGTATTCACTAAGAAAATAAAAGAGTTGA
+TGACACATCAAGAACACAAAAAGTATATCAGTTTTGAAAAATATGTTAAGGAAGGATATT
+GGATAACATCTGGCAGCAGCAGCATCGGCAAAGTCAATTGGTCATATGACGGAGACTTGG
+GCAAATTTAAGGCTAGAAAGAACATGTTATTAGATCTATATACGCCGGACGAAATCTACA
+AAATGGCTGTAGAATGGGACGGGAAACTAGAGAATAGAGTGTTCATCAAAGATGAATTGG
+CAAAGAGAAGATTGGCAGTGGCAAGCAATATTGAAGCATATTTGAATCAAGGGTATATAT
+TTTATCTATTTG
+>gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome--Locus_10_Transcript_1/8_Confidence_0.222_Length_565_hit1_IdMatch=99.81,AligLength=530,E-val=0.0
+TGTTATTGATTGCCTGATAGCTATACCTAAACACCAGACATGTCATGAAATCCTTAGCTA
+ATATTTTTGTGTCGTCGCCTTTCAATGCTATTAACCTAATGTTATCTTTGCCCAATATCA
+AACTCGTCTGATCTCTTGCTATATCCGTTGTTATCATATTCCAGACATTGCCGATGAAAC
+TTGTTGGACGTATTCCAGAAGGTATGCCGTTAGTCTGTTTCTTTGTTTCCTTTGTTAACG
+GTGAGTACAGGTAATTATTGTCGTAACACGAAATATTTTTCGCAGCTATTTTAGTGAATA
+AATGTCGATCTTGTGGAGGTACCAAATATTTGATTTGGTCTATGACGCGTTTCGTAATCT
+GCTTCACTTCCCAAATTGTTGGTTGTCTGTCAAACCCTTTGAAATCAAAAGGTAGGGCAA
+AACACCCGTCTTTCAATGCTTTAATTGTTTCACAGTTCCTAAGATGCGTTTCACCTGGTG
+TTTCGTCTAATGTTATGTATTTCCAATTTTTAAAGCCATGTCCAAATAGATAAAA
+>gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome--Locus_10_Transcript_4/8_Confidence_0.444_Length_1097_hit1_IdMatch=99.91,AligLength=1087,E-val=0.0
+AAAAAAAAATATAGGAGTCTCGAAGACTCTTTAGAAAGCATACATGTAGTTGCCTCCCTC
+GTTCTGGATGTACTGAACGGCCTGCTTGCATACTGATGTTAAGTGCAGAGCTATGTTTTC
+TCTTCCTCGCCAAAAAGAAAAACCACTTTTGACGACTATCTTACTTATCCAGGGTGTTAG
+TATTGGATTCAATATCCCTGTTGGTTCAAGAGGGACTTTACCTGTTGCAATGTTAATTGC
+ATCAGTCCTATGCCATCCTTTCCTTTCATATTCCGTCATAGTTTTGTAAGCTTCAGGATA
+CCATTTGGCCAAACATTCTTTTAGACTAGGTATCTCAATCTTAGCTTTCTTCGCGATTTG
+ATGTTGTCTTATAAATTCGCTGAATATTGGCATTCCGTTTGGACCAGCCTCATGAGATTG
+AATCATACGTCTAGGCCAAATGTTATTTTCGCACGTTGGTCCTTCTGTTTTGTAAAACCT
+GTATGTGGGTACAACCGTCTTCTCCCATACCGGTTTCAACTTCCTTAAATTTTTGATATA
+ATTGCTGGAAATGTGTTTTTGCGGTCCAGGAATGTCGTCGGCTGCTATTTTCATTGAAAA
+TTCGACTTGTTGATAAGCCGTCTTTTCCTCATCTGTCATTTGCTTCCACGTCAAGTTGAT
+GTTTTCACTAAACAGTCCAGGAACATCGAACGTTGGGATGTCAGCAAGTGGTAGCTTGCT
+AGTAGTTTTCCACCCTTTCCATTCGTATATTCCGAAACCACCCAGTCGTTTAGGCAGGTG
+CAGCCAGTGATAGCTCTGTCCCGTGTATTTACTCCACTTAATTTTGTTTGCTTGATGTAA
+CCAATCCAATTGTTTCTTGCTTCTCCTTTCTAATAAATAGATATTATTAGCGGTTGTCTC
+AACTTGTTGATTTGCAGTCCATGGTTGTGGGTTCCACGGTTTCCTTTGTGTCACGCTAGG
+GATAGCCCGATTTGTCCAGCCTCTGACGCCTTGAGTAGATATTTCTGTCCTTAAGAATTC
+GCAACAATTTTGCATAATTCCAAACTTGCTGTTTTCTCCAACGGCGTTGATTGCCTGATA
+GCTATACCTAAA
+>gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome--Locus_7_Transcript_10/11_Confidence_0.154_Length_4093_hit1_IdMatch=99.66,AligLength=4093,E-val=0.0
+TGAGAATAAACAACAACAACCAAGTGCACCGATGCCACACGAGCCAAGGGCAGCAGGTCA
+GGCACTTAAGGATTTGAATTTGGCTTATTTGAATAACGACCAAAAAACAACATTGTCGGC
+ATGGGTACGAGGCCTAACAGTAGAAGGTGTCGAACCAAATCCCGGACCATCAATAATTGA
+GCCAAATCATGGACCAAGCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCAACGACA
+GCTGGCAAAACAAGACCAAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCTACTGGA
+CGATCTGACCGAATTAAAGACTACGGTACAACCACAGATTGACAATTCGGGATTCTTGGC
+TCATGTTGATCATGCAGCTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGTGATGAA
+ATACATTCTCACGAATTCTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTACTGATAT
+ACCCGACGAGCCAGTAGAGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAAAGAGAA
+AAAAGAAGAAAAAAAAGATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACGAGAATC
+GATGGCAATGCCAGCCAGTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGAAATTGA
+AAGGAAAAACGTCATCAGGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTACAAGCT
+TGTACTATGGTTAGACAAACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGATGAGCT
+TTGGGGAAGTGGTTGGCAGGAACGAAATAAGATGAACCAGTATGAATGGTTGTCTTACTG
+CTGGGCAAATAATGTCACTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGACATCAA
+ATGGCAACAACTACCTGCTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGCTGATCT
+TGAAGCTCAAAAAACTCACAATAAAGTGATGCATGCATACAACGGTAACCCTTTGTGTCA
+GGGATTTCAAGAAGTTGAAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAGTAATTC
+AGTTCTGAAACCATATACTGGACTGGAAGCTGAGAAATACATCACCAACATTGTAGGAGA
+CATGAATCCGAATCAATCAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCAATACAA
+TGCCAATGGGGCTGTGGTTCATAATGCTGTATCAACTATTCCGTTTACAAACCTCATTCC
+TAGGACGATTCGATCTGATGATGACGTCCTTGAGAAGTCGGCCAACAGATTACAGGTTAC
+AGAGACAAACGTTACGGATTACTACGTTAATCCGATTGAGCCAACTGAATTATCCAAAAC
+AATAAGTGACCAGATCAAAAACAATCAATCATCTAACTGGCGACGAGATAACACGTCATT
+GGCTGGTTTCAATAGTTTCGACATTGCGACAGTCAACACTGCACTAATTGCAAGAGGTCT
+AAGCACTGAATCAATGACTCTCAAGTTAGAGCTATTGCACGGAATAATGGCTATGCAGGT
+TGAAGCACCAATGATCAATTCCAGCACTTATTCGATCGTAGATAATCATACAATCCCGAC
+CGTAACTGACAGGGCCGTCATAGGCATCAATGACTCGCCTGTGTTTGGCGAGGACTGTGG
+TGGTGATCTTCCTGAATATCCTTTCGGCGGCGGAACCGGTACAATTGCCTTTCACCTAAC
+ATTGCAAACTGTTCCTGAAGAGAGGAGAGATAAGGCAATCTTCTGCCCTCCTGGTTTGTT
+GCAAGCAGCCCGAGATGGAGCAGAGGCATTGGCCCTATTTGTTTTGTCGATGTCTGAATG
+GCCTTTCGGTATTTATACTGTCACCAAGAGAACAACCGATGAGAAGGGACTGAATCCTGC
+GGATCAGGTTTACGTGCCGATGGAGACCATAACCCGTGTAGGTGGAGATAGAGTATTGGA
+CGTTGTACTTCCTCGAAGGTATGCGGTTGCAAATCCAACGACTCAAGGAAATGCTAATGC
+TCTAGCAGTTATACAGCCTCAAGCTGGGCCTTTAGATAACGGTGCGGACGGATTAGCCGC
+TGGTGAATTATTGGATGTCAATTTCATCGGCGCCGACGGCATTACTGAATATCCATTGAC
+ATATTACTTGTATACCTGGGCACTTCGATTTGATATAACGACGATTAGGCAATACATTGG
+TAGAATGGCAGCGTTAATTGGAGTGAAACACCAACTATGGGCTAGTCATGAAATCAGAGT
+AGCTTTGTGTCAAGTTGCACCCAAAATGGTGGTCGGAGTTACAGGTTCGGGAGACCTGCC
+AAGAGGATCAGCCGCTGCAAGCGAGGTATGTTACTCAAGCTTATTGGAGGTCTCACGCTC
+TGAAGAAGATTTTCCGCTGCTTGGTCAGGTTCAAGCCGATTTCAGAGTCTTTGAAACCAA
+TACAAGCACATGGAATAAAGTAGTTTTGGGATTGGCAACAGCACCAAACGTGACAAGTGA
+ACAAAACATGCATGTACCATTCGTTGTTGGCGATCCGAGATCTAACGCGTGGGACCGACT
+CGAAGCAGTACCAATTGCTGCTGCTTGGCAGATGTACTACCATTCAAGGGGCGTAACTAC
+TGCCGCTTGGAATGATGCGTACACTAACGTAAATAACGTTTGGTTGCAAAAGATGGCCCG
+TGATAGCTTCTCAACGACCCAAAGCACTGGGACGATACTGCCTGCCAGATATGGTAAGAT
+AGTCAAAAACCTGATGAGAAACATGTTTGAAAGAGAACCTGCCAAAGTAGTAACAAGCGT
+GGGAGGCGATGAATATGAGATAACCCATTTTGAGCGCTGGTTACCGGGTAATAGATATGC
+TTCCGTGTTTGAACAAGATGAAACTGAAGTTAATCTGTTTCCTCCAACTTTATTACCGGA
+TATTTGGGTTCAATATCCAGCGACTCACACCCCAATCATGTGTGCTTCGTTCCCACCCGT
+TTTCGGCCAAGACTCAACACAAGGGTTCGGCAAAGAATCACAACTTATACCCTTTCGAAA
+CGCAAACAACAATCTTGTAGCACCATACGTTGAAGCTTTCGTTGCCAATCAAGCTTATTT
+CCCGATAGGATCGGGCCCAAACATCAACGACAAGGTTCTGTGGAATAGTAGATTGTGGAT
+GACAAGTGGTTTCGTTCAGTACTTGGATTACGCTGGCAACGCAATCAACGAAGTGGTTCC
+TGCAGCAGGGCTACCTTTGGGTAGGTCAATCCCATTACTGCCAGGGGAAGTTCAGCCGGT
+TGGTAACACCAACATGAGCACAAGCTGCGTTCCTCGTTATTCTGTGGACGGTCGCCGAAT
+TTTTACTTATGTCAACACAGCTCAATCCGTTCCTTTGATACAAGCGTGTAATAGAGCCAA
+TAGATTGGCCAGATCGGCATGGCTATTATTGCATGTCTACATCGAACCAGAGTTGCAGCT
+ATTGAGCGATGAAGTGGTGGACATATTCGACCAACTGACAAGCAAGACTTTTTTAGATGT
+AGCAAAATCGGCTGCGGACAGTGCGGAGGGCAACATTCCGGCAACGAAGGTATTGACAGA
+CCTCCAGGCAGTGGATTCAGCAACGCTGCCGAGTACTTTGGATCCATCCACAAATATGCT
+CCAACCAGCTCCTTTACTCGGCGAACCTACGACAAATTAACTCGATACATTCATGATGGG
+GTAAGTCGAAGTAGTCAGAGAGAAATTTCATCATTGTCGGATGATTTAGTTAGATTTAGT
+ACTCTCACAGATTTTACTGTCATCGATTTTATTACTAAGAAATTAGATTTAGAACGTCCG
+ATTAGTACTCAAGGAGATTTATTGGCGTTAGAACCTAGATGCAAGGGTGACCTCGCTGTA
+GCAAGACTTAAGATTAAGGACATAATAGGTAGGATTGATAAGGATATTAGAACGTGGTGT
+GAAGCAAATTTATGCCATTTGGATGCAATCTTGGTAACGAACTTGATAATCTGGGGACAA
+ATCTGGGGGTTGGAAATTCTGAAAGCTTTACATTCAACAGGAATATTAAACGATTTCGAT
+ACTTTCGCAACAA
+>gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome--Locus_7_Transcript_7/11_Confidence_0.462_Length_4481_hit1_IdMatch=99.6,AligLength=4481,E-val=0.0
+CAGTAGAAGGTGTCGAACCAAATCCCGGACCATCAATAATTGAGCCAAATCATGGACCAA
+GCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCAACGACAGCTGGCAAAACAAGACC
+AAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCTACTGGACGATCTGACCGAATTAA
+AGACTACGGTACAACCACAGATTGACAATTCGGGATTCTTGGCTCATGTTGATCATGCAG
+CTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGTGATGAAATACATTCTCACGAATT
+CTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTACTGATATACCCGACGAGCCAGTAG
+AGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAAAGAGAAAAAAGAAGAAAAAAAAG
+ATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACGAGAATCGATGGCAATGCCAGCCA
+GTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGAAATTGAAAGGAAAAACGTCATCA
+GGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTACAAGCTTGTACTATGGTTAGACA
+AACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGATGAGCTTTGGGGAAGTGGTTGGC
+AGGAACGAAATAAGATGAACCAGTATGAATGGTTGTCTTACTGCTGGGCAAATAATGTCA
+CTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGACATCAAATGGCAACAACTACCTG
+CTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGCTGATCTTGAAGCTCAAAAAACTC
+ACAATAAAGTGATGCATGCATACAACGGTAACCCTTTGTGTCAGGGATTTCAAGAAGTTG
+AAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAGTAATTCAGTTCTGAAACCATATA
+CTGGACTGGAAGCTGAGAAATACATCACCAACATTGTAGGAGACATGAATCCGAATCAAT
+CAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCAATACAATGCCAATGGGGCTGTGG
+TTCATAATGCTGTATCAACTATTCCGTTTACAAACCTCATTCCTAGGACGATTCGATCTG
+ATGATGACGTCCTTGAGAAGTCGGCCAACAGATTACAGGTTACAGAGACAAACGTTACGG
+ATTACTACGTTAATCCGATTGAGCCAACTGAATTATCCAAAACAATAAGTGACCAGATCA
+AAAACAATCAATCATCTAACTGGCGACGAGATAACACGTCATTGGCTGGTTTCAATAGTT
+TCGACATTGCGACAGTCAACACTGCACTAATTGCAAGAGGTCTAAGCACTGAATCAATGA
+CTCTCAAGTTAGAGCTATTGCACGGAATAATGGCTATGCAGGTTGAAGCACCAATGATCA
+ATTCCAGCACTTATTCGATCGTAGATAATCATACAATCCCGACCGTAACTGACAGGGCCG
+TCATAGGCATCAATGACTCGCCTGTGTTTGGCGAGGACTGTGGTGGTGATCTTCCTGAAT
+ATCCTTTCGGCGGCGGAACCGGTACAATTGCCTTTCACCTAACATTGCAAACTGTTCCTG
+AAGAGAGGAGAGATAAGGCAATCTTCTGCCCTCCTGGTTTGTTGCAAGCAGCCCGAGATG
+GAGCAGAGGCATTGGCCCTATTTGTTTTGTCGATGTCTGAATGGCCTTTCGGTATTTATA
+CTGTCACCAAGAGAACAACCGATGAGAAGGGACTGAATCCTGCGGATCAGGTTTACGTGC
+CGATGGAGACCATAACCCGTGTAGGTGGAGATAGAGTATTGGACGTTGTACTTCCTCGAA
+GGTATGCGGTTGCAAATCCAACGACTCAAGGAAATGCTAATGCTCTAGCAGTTATACAGC
+CTCAAGCTGGGCCTTTAGATAACGGTGCGGACGGATTAGCCGCTGGTGAATTATTGGATG
+TCAATTTCATCGGCGCCGACGGCATTACTGAATATCCATTGACATATTACTTGTATACCT
+GGGCACTTCGATTTGATATAACGACGATTAGGCAATACATTGGTAGAATGGCAGCGTTAA
+TTGGAGTGAAACACCAACTATGGGCTAGTCATGAAATCAGAGTAGCTTTGTGTCAAGTTG
+CACCCAAAATGGTGGTCGGAGTTACAGGTTCGGGAGACCTGCCAAGAGGATCAGCCGCTG
+CAAGCGAGGTATGTTACTCAAGCTTATTGGAGGTCTCACGCTCTGAAGAAGATTTTCCGC
+TGCTTGGTCAGGTTCAAGCCGATTTCAGAGTCTTTGAAACCAATACAAGCACATGGAATA
+AAGTAGTTTTGGGATTGGCAACAGCACCAAACGTGACAAGTGAACAAAACATGCATGTAC
+CATTCGTTGTTGGCGATCCGAGATCTAACGCGTGGGACCGACTCGAAGCAGTACCAATTG
+CTGCTGCTTGGCAGATGTACTACCATTCAAGGGGCGTAACTACTGCCGCTTGGAATGATG
+CGTACACTAACGTAAATAACGTTTGGTTGCAAAAGATGGCCCGTGATAGCTTCTCAACGA
+CCCAAAGCACTGGGACGATACTGCCTGCCAGATATGGTAAGATAGTCAAAAACCTGATGA
+GAAACATGTTTGAAAGAGAACCTGCCAAAGTAGTAACAAGCGTGGGAGGCGATGAATATG
+AGATAACCCATTTTGAGCGCTGGTTACCGGGTAATAGATATGCTTCCGTGTTTGAACAAG
+ATGAAACTGAAGTTAATCTGTTTCCTCCAACTTTATTACCGGATATTTGGGTTCAATATC
+CAGCGACTCACACCCCAATCATGTGTGCTTCGTTCCCACCCGTTTTCGGCCAAGACTCAA
+CACAAGGGTTCGGCAAAGAATCACAACTTATACCCTTTCGAAACGCAAACAACAATCTTG
+TAGCACCATACGTTGAAGCTTTCGTTGCCAATCAAGCTTATTTCCCGATAGGATCGGGCC
+CAAACATCAACGACAAGGTTCTGTGGAATAGTAGATTGTGGATGACAAGTGGTTTCGTTC
+AGTACTTGGATTACGCTGGCAACGCAATCAACGAAGTGGTTCCTGCAGCAGGGCTACCTT
+TGGGTAGGTCAATCCCATTACTGCCAGGGGAAGTTCAGCCGGTTGGTAACACCAACATGA
+GCACAAGCTGCGTTCCTCGTTATTCTGTGGACGGTCGCCGAATTTTTACTTATGTCAACA
+CAGCTCAATCCGTTCCTTTGATACAAGCGTGTAATAGAGCCAATAGATTGGCCAGATCGG
+CATGGCTATTATTGCATGTCTACATCGAACCAGAGTTGCAGCTATTGAGCGATGAAGTGG
+TGGACATATTCGACCAACTGACAAGCAAGACTTTTTTAGATGTAGCAAAATCGGCTGCGG
+ACAGTGCGGAGGGCAACATTCCGGCAACGAAGGTATTGACAGACCTCCAGGCAGTGGATT
+CAGCAACGCTGCCGAGTACTTTGGATCCATCCACAAATATGCTCCAACCAGCTCCTTTAC
+TCGGCGAACCTACGACAAATTAACTCGATACATTCATGATGGGGTAAGTCGAAGTAGTCA
+GAGAGAAATTTCATCATTGTCGGATGATTTAGTTAGATTTAGTACTCTCACAGATTTTAC
+TGTCATCGATTTTATTACTAAGAAATTAGATTTAGAACGTCCGATTAGTACTCAAGGAGA
+TTTATTGGCGTTAGAACCTAGATGCAAGGGTGACCTCGCTGTAGCAAGACTTAAGATTAA
+GGACATAATAGGTAGGATTGATAAGGATATTAGAACGTGGTGTGAAGCAAATTTATGCCA
+TTTGGATGCAATCTTGGTAACGAACTTGATAATCTGGGGACAAATCTGGGGGTTGGAAAT
+TCTGAAAGCTTTACATTCAACAGGAATATTAAACGATTTCGATACTTTCGCAACAAAAGG
+AAGCAAGATTAGTGCATTTGTCAAGCGTTTTCCCTTCGACAAGGATGATGCCAAAGCTAG
+ATGGGCAGAGATCAACACGCTGACGGGCTATTTGCAGAATGATTTTGGAAACTTCGATTA
+CGATAAGGAATTTGAAGCTTTAGCTACCGGAGATAGTAACCACCCCGCTTGGTGGGAAGA
+AGTATTCACTAAGAAAATAAAAGAGTTGATGACACATCAAGAACACAAAAAGTATATCAG
+TTTTGAAAAATATGTTAAGGAAGGATATTGGATAACATCTGGCAGCAGCAGCATCGGCAA
+AGTCAATTGGTCATATGACGGAGACTTGGGCAAATTTAAGGCTAGAAAGAACATGTTATT
+AGATCTATATACGCCGGACGAAATCTACAAAATGGCTGTAGAATGGGACGGGAAACTAGA
+GAATAGAGTGTTCATCAAAGATGAATTGGCAAAGAGAAGATTGGCAGTGGCAAGCAATAT
+TGAAGCATATTTGAATCAAGGGTATATATTTTATCTATTTG
+>gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome--Locus_7_Transcript_5/11_Confidence_0.308_Length_4519_hit1_IdMatch=99.67,AligLength=3956,E-val=0.0
+ACAACCAGTAGAAGGTGTCAAACCAAATCCCGGACCATCAATAATTGAGCCAAATCATGG
+ACCAAGCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCAACGACAGCTGGCAAAACA
+AGACCAAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCTACTGGACGATCTGACCGA
+ATTAAAGACTACGGTACAACCACAGATTGACAATTCGGGATTCTTGGCTCATGTTGATCA
+TGCAGCTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGTGATGAAATACATTCTCAC
+GAATTCTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTACTGATATACCCGACGAGCC
+AGTAGAGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAAAGAGAAAAAAGAAGAAAA
+AAAAGATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACGAGAATCGATGGCAATGCC
+AGCCAGTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGAAATTGAAAGGAAAAACGT
+CATCAGGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTACAAGCTTGTACTATGGTT
+AGACAAACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGATGAGCTTTGGGGAAGTGG
+TTGGCAGGAACGAAATAAGATGAACCAGTATGAATGGTTGTCTTACTGCTGGGCAAATAA
+TGTCACTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGACATCAAATGGCAACAACT
+ACCTGCTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGCTGATCTTGAAGCTCAAAA
+AACTCACAATAAAGTGATGCATGCATACAACGGTAACCCTTTGTGTCAGGGATTTCAAGA
+AGTTGAAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAGTAATTCAGTTCTGAAACC
+ATATACTGGACTGGAAGCTGAGAAATACATCACCAACATTGTAGGAGACATGAATCCGAA
+TCAATCAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCAATACAATGCCAATGGGGC
+TGTGGTTCATAATGCTGTATCAACTATTCCGTTTACAAACCTCATTCCTAGGACGATTCG
+ATCTGATGATGACGTCCTTGAGAAGTCGGCCAACAGATTACAGGTTACAGAGACAAACGT
+TACGGATTACTACGTTAATCCGATTGAGCCAACTGAATTATCCAAAACAATAAGTGACCA
+GATCAAAAACAATCAATCATCTAACTGGCGACGAGATAACACGTCATTGGCTGGTTTCAA
+TAGTTTCGACATTGCGACAGTCAACACTGCACTAATTGCAAGAGGTCTAAGCACTGAATC
+AATGACTCTCAAGTTAGAGCTATTGCACGGAATAATGGCTATGCAGGTTGAAGCACCAAT
+GATCAATTCCAGCACTTATTCGATCGTAGATAATCATACAATCCCGACCGTAACTGACAG
+GGCCGTCATAGGCATCAATGACTCGCCTGTGTTTGGCGAGGACTGTGGTGGTGATCTTCC
+TGAATATCCTTTCGGCGGCGGAACCGGTACAATTGCCTTTCACCTAACATTGCAAACTGT
+TCCTGAAGAGAGGAGAGATAAGGCAATCTTCTGCCCTCCTGGTTTGTTGCAAGCAGCCCG
+AGATGGAGCAGAGGCATTGGCCCTATTTGTTTTGTCGATGTCTGAATGGCCTTTCGGTAT
+TTATACTGTCACCAAGAGAACAACCGATGAGAAGGGACTGAATCCTGCGGATCAGGTTTA
+CGTGCCGATGGAGACCATAACCCGTGTAGGTGGAGATAGAGTATTGGACGTTGTACTTCC
+TCGAAGGTATGCGGTTGCAAATCCAACGACTCAAGGAAATGCTAATGCTCTAGCAGTTAT
+ACAGCCTCAAGCTGGGCCTTTAGATAACGGTGCGGACGGATTAGCCGCTGGTGAATTATT
+GGATGTCAATTTCATCGGCGCCGACGGCATTACTGAATATCCATTGACATATTACTTGTA
+TACCTGGGCACTTCGATTTGATATAACGACGATTAGGCAATACATTGGTAGAATGGCAGC
+GTTAATTGGAGTGAAACACCAACTATGGGCTAGTCATGAAATCAGAGTAGCTTTGTGTCA
+AGTTGCACCCAAAATGGTGGTCGGAGTTACAGGTTCGGGAGACCTGCCAAGAGGATCAGC
+CGCTGCAAGCGAGGTATGTTACTCAAGCTTATTGGAGGTCTCACGCTCTGAAGAAGATTT
+TCCGCTGCTTGGTCAGGTTCAAGCCGATTTCAGAGTCTTTGAAACCAATACAAGCACATG
+GAATAAAGTAGTTTTGGGATTGGCAACAGCACCAAACGTGACAAGTGAACAAAACATGCA
+TGTACCATTCGTTGTTGGCGATCCGAGATCTAACGCGTGGGACCGACTCGAAGCAGTACC
+AATTGCTGCTGCTTGGCAGATGTACTACCATTCAAGGGGCGTAACTACTGCCGCTTGGAA
+TGATGCGTACACTAACGTAAATAACGTTTGGTTGCAAAAGATGGCCCGTGATAGCTTCTC
+AACGACCCAAAGCACTGGGACGATACTGCCTGCCAGATATGGTAAGATAGTCAAAAACCT
+GATGAGAAACATGTTTGAAAGAGAACCTGCCAAAGTAGTAACAAGCGTGGGAGGCGATGA
+ATATGAGATAACCCATTTTGAGCGCTGGTTACCGGGTAATAGATATGCTTCCGTGTTTGA
+ACAAGATGAAACTGAAGTTAATCTGTTTCCTCCAACTTTATTACCGGATATTTGGGTTCA
+ATATCCAGCGACTCACACCCCAATCATGTGTGCTTCGTTCCCACCCGTTTTCGGCCAAGA
+CTCAACACAAGGGTTCGGCAAAGAATCACAACTTATACCCTTTCGAAACGCAAACAACAA
+TCTTGTAGCACCATACGTTGAAGCTTTCGTTGCCAATCAAGCTTATTTCCCGATAGGATC
+GGGCCCAAACATCAACGACAAGGTTCTGTGGAATAGTAGATTGTGGATGACAAGTGGTTT
+CGTTCAGTACTTGGATTACGCTGGCAACGCAATCAACGAAGTGGTTCCTGCAGCAGGGCT
+ACCTTTGGGTAGGTCAATCCCATTACTGCCAGGGGAAGTTCAGCCGGTTGGTAACACCAA
+CATGAGCACAAGCTGCGTTCCTCGTTATTCTGTGGACGGTCGCCGAATTTTTACTTATGT
+CAACACAGCTCAATCCGTTCCTTTGATACAAGCGTGTAATAGAGCCAATAGATTGGCCAG
+ATCGGCATGGCTATTATTGCATGTCTACATCGAACCAGAGTTGCAGCTATTGAGCGATGA
+AGTGGTGGACATATTCGACCAACTGACAAGCAAGACTTTTTTAGATGTAGCAAAATCGGC
+TGCGGACAGTGCGGAGGGCAACATTCCGGCAACGAAGGTATTGACAGACCTCCAGGCAGT
+GGATTCAGCAACGCTGCCGAGTACTTTGGATCCATCCACAAATATGCTCCAACCAGCTCC
+TTTACTCGGCGAACCTACGACAAATTAACTCGATACATTCATGATGGGGTAAGTCGAAGT
+AGTCAGAGAGAAATTTCATCATTGTCGGATGATTTAGTTAGATTTAGTACTCTCACAGAT
+TTTACTGTCATCGATTTTATTACTAAGAAATTAGATTTAGAACGTCCGATTAGTACTCAA
+GGAGATTTATTGGCGTTAGAACCTAGATGCAAGGGTGACCTCGCTGTAGCAAGACTTAAG
+ATTAAGGACATAATAGGTAGGATTGATAAGGATATTAGAACGTGGTGTGAAGCAAATTTA
+TGCCATTTGGATGCAATCTTGGTAACGAACTTGATAATCTGGGGACAAATCTGGGGGTTG
+GAAATTCTGAAAGCTTTACATTCAACAGGAATATTAAACGATTTCGATACTTTCGCAACA
+A
+>gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome--Locus_7_Transcript_8/11_Confidence_0.154_Length_552_hit1_IdMatch=99.28,AligLength=552,E-val=0.0
+TAAACGATTTTGATACTTTCGCAACAAAAGGAAGCAAGATTAGTGCATTTGTCAAGCGTT
+TTCCCTTCGACAAGGATGATGCCAAAGCTAGATGGGCAGAGATCAACACGCTGACGGGCT
+ATTTGCAGAATGATTTTGGAAACTTCGATTACGATAAGGAATTTGAAGCTTTAGCTACCG
+GAGATAGTAACCACCCCGCTTGGTGGGAAGAAGTATTCACTAAGAAAATAAAAGAGTTGA
+TGACACATCAAGAACACAAAAAGTATATCAGTTTTGAAAAATATGTTAAGGAAGGATATT
+GGATAACATCTGGCAGCAGCAGCATCGGCAAAGTCAATTGGTCATATGACGGAGACTTGG
+GCAAATTTAAGGCTAGAAAGAACATGTTATTAGATCTATATACGCCGGACGAAATCTACA
+AAATGGCTGTAGAATGGGACGGGAAACTAGAGAATAGAGTGTTCATCAAAGATGAATTGG
+CAAAGAGAAGATTGGCAGTGGCAAGCAATATTGAAGCATATTTGAATCAAGGGTATATAT
+TTTATCTATTTG
+>gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome--Locus_8_Transcript_2/4_Confidence_0.200_Length_117_hit1_IdMatch=100.0,AligLength=26,E-val=4e-04
+TTTAGGTATAGCTATCAGGCAATCAA
+>gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome--Locus_10_Transcript_8/8_Confidence_0.000_Length_1134_hit1_IdMatch=99.89,AligLength=905,E-val=0.0
+GCATTTTCAATATCCCTGTTGGTTCAAGAGGGACTTTACCTGTTGCAATGTTAATTGCAT
+CAGTCCTATGCCATCCTTTCCTTTCATATTCCGTCATAGTTTTGTAAGCTTCAGGATACC
+ATTTGGCCAAACATTCTTTTAGACTAGGTATCTCAATCTTAGCTTTCTTCGCGATTTGAT
+GTTGTCTTATAAATTCGCTGAATATTGGCATTCCGTTTGGACCAGCCTCATGAGATTGAA
+TCATACGTCTAGGCCAAATGTTATTTTCGCACGTTGGTCCTTCTGTTTTGTAAAACCTGT
+ATGTGGGTACAACCGTCTTCTCCCATACCGGTTTCAACTTCCTTAAATTTTTGATATAAT
+TGCTGGAAATGTGTTTTTGCGGTCCAGGAATGTCGTCGGCTGCTATTTTCATTGAAAATT
+CGACTTGTTGATAAGCCGTCTTTTCCTCATCTGTCATTTGCTTCCACGTCAAGTTGATGT
+TTTCACTAAACAGTCCAGGAACATCGAACGTTGGGATGTCAGCAAGTGGTAGCTTGCTAG
+TAGTTTTCCACCCTTTCCATTCGTATATTCCGAAACCACCCAGTCGTTTAGGCAGGTGCA
+GCCAGTGATAGCTCTGTCCCGTGTATTTACTCCACTTAATTTTGTTTGCTTGATGTAACC
+AATCCAATTGTTTCTTGCTTCTCCTTTCTAATAAATAGATATTATTAGCGGTTGTCTCAA
+CTTGTTGATTTGCAGTCCATGGTTGTGGGTTCCACGGTTTCCTTTGTGTCACGCTAGGGA
+TAGCCCGATTTGTCCAGCCTCTGACGCCTTGAGTAGATATTTCTGTCCTTAAGAATTCGC
+AACAATTTTGCATAATTCCAAACTTGCTGTTTTCTCCAACGGCGTTGATTGCCTGATAGC
+TATACCTAAA
+>gi|262225299|gb|GQ342961.1|_Drosophila_melanogaster_totivirus_SW-2009a_strain_DTV,_complete_genome--Locus_7_Transcript_2/11_Confidence_0.077_Length_1069_hit1_IdMatch=99.06,AligLength=1069,E-val=0.0
+CAGTAGAAGGTGTCGAACCAAATCCCGGACCATCAATAATTGAGCCAAATCATGGACCAA
+GCGATGAGTTGACTCAAGCCGAGATTCAGATTCTCCAACGACAGCTGGCAAAACAAGACC
+AAAAACCAGCTCTGATTATGAAAGACCAGGAGAATCTACTGGACGATCTGACCGAATTAA
+AGACTACGGTACAACCACAGATTGACAATTCGGGATTCTTGGCTCATGTTGATCATGCAG
+CTGAATTCTCGGGAACTAAGGGTGAATATTTCGCCGTGATGAAATACATTCTCACGAATT
+CTCACTCCAATAGGTTCGCCTGTTTAGCGAATCTTACTGATATACCCGACGAGCCAGTAG
+AGGCCTTTGTGCCTATGAGCTTTTCCAGACCAAAAAAAGAGAAAAAAGAAGAAAAAAAAG
+ATAACCACATGGAAGAGAAGAAGAAAAAAGAAAAACGAGAATCGATGGCAATGCCAGCCA
+GTCAGAAGCCGAAACTTAAAACCGACGAAGAAAAGGAAATTGAAAGGAAAAACGTCATCA
+GGAGAATTGTGGAACAATTCAGGGACAAGAAGATGTACAAGCTTGTACTATGGTTAGACA
+AACCAATGAGCAGAAAATTTAAGACAGAAGTACTCGATGAGCTTTGGGGAAGTGGTTGGC
+AGGAACGAAATAAGATGAACCAGTATGAATGGTTGTCTTACTGCTGGGCAAATAATGTCA
+CTAAGGTCGATACTCAAACCGTGCTTCTATCTTATGACATCAAATGGCAACAACTACCTG
+CTGATATGAAAATGGCTATTCTCGGCGATTCGCGAGCTGATCTTGAAGCTCAAAAAACTC
+ACAATAAAGTGATGCATGCATACAACGGTAACCCTTTGTGTCAGGGATTTCAAGAAGTTG
+AAGCTTCAAAAACCTTCCTCAACATCGCGGAAGAGAGTAATTCAGTTCTGAAACCATATA
+CTGGACTGGAAGCTGAGAAATACATCACCAACATTGTAGGAGACATGAATCCGAATCAAT
+CAAGGATCTTCGATCAGGACAGGCTTAGAGGTAACCAATACAATGCCAA
+
+>gi|253761971|ref|NC_012958.1|_Drosophila_A_virus,_complete_genome--Locus_42_Transcript_2/2_Confidence_0.333_Length_597_hit1_IdMatch=97.81,AligLength=594,E-val=0.0
+TTCTGAGGTACGGCCAAATGCTGCCAATCCTGTTGGAGTTAGGCTCTATGCCCACAGCCA
+CCATACCCAGGACATGAAGCTGTTGGGAGAAGCCTGGTCCTCCTCTGCCAAACTGGCTAA
+GGAATACATCTGTGCAGCTATTTTGGAGGTTAACAACATCCCATACAAGAAGTCTAGCTT
+TGCGACCCCTAATGTAGTGCCTCCCCCGCCTGAGTCTTCCTGGGCTCGGCAGGTTGAATA
+CGCAACTGCCCCTAAAGCTGTGCCACAGATTGTTCCCGTTCATGAAACCCTGGATTTGGA
+GCTGTTTCACAGTATAATGCAGCAATTCCCAGGGCACTGTCCCCGCCAGGTGCAGATGCT
+TATTAGAGAGGTAAGTCATAAAAATCCTGATGACTACCGTGTGAGAATTCAAGACTTATT
+CTCCCGGTTTCCACCTCCTAAAGTAGCATCGAAGAGATCACTGCTGAGCGCAGAACAAAG
+GACGAGACTCAACAAAAAGACTCTCGACCGCAAAAAGAGGAAGAAAATTGCAAGTAAGCT
+CTTGCCAACCCTATAACATCAAACAACCCAAACCTCAAATCAAGAATACAATTTG
+>gi|253761971|ref|NC_012958.1|_Drosophila_A_virus,_complete_genome--Locus_20_Transcript_1/1_Confidence_0.000_Length_191_hit1_IdMatch=97.86,AligLength=187,E-val=7e-86
+CCCCCCCCACCTTCGCAATCACAGACAAATTAAACGTAAAACAAACGACATGGATGCATC
+CAACCCTATTATTTCAAGCGATAGGAGCACTGTGAATCAGGTTTATGCGAAGATGGTGAG
+GAGAAAACGGCAAGATCTTGCCTATCTCCAGGAGTTGGTGAGGACAGCCCATCGAGAGAT
+TCTCCCCCAAG
+>gi|253761971|ref|NC_012958.1|_Drosophila_A_virus,_complete_genome--Locus_42_Transcript_1/2_Confidence_0.333_Length_3138_hit1_IdMatch=97.61,AligLength=3136,E-val=0.0
+TCTCCCCCAAGGAGAACTTCTCCATGAGTCGGAGGCCAAACAGTATGTAGCCGAATATAA
+GGCTCGACTACCTGTGGTTGACACTAAGAAAGTTGGCGAACTGCCAACTGAGGTCTTCCA
+GGTAGCACTCCCAAGTATCCCTGTTTGTGGGATTATGGATGCTGTTGGTGTCCCGTTGCA
+CCCCCCATCCATTAACAATCGGGGTGGGCATACTCATGTCACTCGCCAGATGGGCGGAGT
+ACCCCACCCTCCTCTTGGTCTAATACCCATAGCTCAGAAGTATGGGGTAGAGATCTTGGA
+CCAGAAACATGTCTACACAGGAGGCACTTGGGATGGCTTTCTTAATAGACTCGCCCAACA
+GATGGGCCGGACAACGGTCCCCCTGGCAAGAACAGTTTCAGCAGGCAAAAAGAATGCCTC
+TGATAGGGCAATCATAAAACTGTTAAATAAATACATGCCTAGGACGGGAAATAAGAACTG
+GCCTGGTGTCCATACAACCCCGGAAGAAGGCATACTTGATGGTATCAAGATAACGGCCAA
+ATCCAGTGCAGGCGCTCCCTATTGGAGACACAAGGGGGAATGCCTAGACCATATAATTGA
+TACTGGACTTCCTGTTGTGCTAAAGCATATAAAGGAAGGAACCCTCAACCAGTTGTGGCG
+GGAAAACCCTGAGATGTTCCTCGTTGAAGTTAAGAACAAACTTGATAGATACGAAGTCTC
+GAAGCTTAAAGAGAAGACTAGACCCTATGTGTGTGTACCTGCGCACTGGGCTCTCCTATT
+CTCGTGCTTGACTCAAGGATTCCAAGAAGGACTTCAAGTTTTTAGTAACTTGGACCCCAG
+TACAGAATGCTCGAATGCATATGGATTTTCATCCATTGCTGGAGGGCTTACTAGGATGGT
+CGACTGGATGTATGCCTGCCCAAAGCGGCGGGGACGGGTTGTCTGTTACGGTGACGATGC
+ATGTATAACATTTTGGAGCCAGGGCGTCCTCTATCGGGTGGATCCAGATTTTAAACAAAT
+GGACGGGTCCATAGATAGAGAGGATGCAAGAATCACCATTGAGTGGGTCCTCCACCATCT
+CAGAAAGGATTTAGGTGTAGAGGAGACCCCTGCTTTTTGGAAGACAGTTGCAGCAGTGTG
+GCTTGATATGGCCATTGACCCCCACTTTATCGTGGATGGTAAGACTGTTTACAGGAAGAA
+GAACCCCCATGGACTCATGACTGGAGTTCCAGGAACAACCTTATTTGACACTGTGAAATC
+TGTAATAGTCTGGAACGAAATGTTGGATCAGGCTAGTGCAGGTTCCATAGACCTTTTAAA
+TGAAGCTCAAGTAGTTAAATGGATGAAGAGACAAGGCTTGGTTGTCAAAGAGGGAACTTG
+GAGTCCGGTTGCACTCCCTGCAAGGGACACAGAGGGTCTAATTACGGACCACAAATTTCT
+TGGTGTACAAATTATGGGAGTGTACCACAGACACCGTGTGATACATGTCCCCACAATGCC
+TGAGAGCGATGCTCTTGAGATGATGCTCTGCCAGAAGGATAACCCCTTTGAAAAGGCAGT
+ATCTAGAACTGCACACCAAAGAACTCTGTATGACCGTATGAGGGGTTTAATGATAACAAT
+GGGATTCAGCATACCTCGGATCGAAGAGACAATACACGCTGTGGTTAATACAATCCCCGG
+CGAGATTATTGTCATGCAAACGCAAGAGCAAACCGGAACGAAGCCAGAACATATAACCCT
+CCAGGACTTTGAATATCCAGATTCGTCTGGATTCCCCTCTCGGGACTTCTGTCTAGACCT
+CTATTCAGATGGAGGGGATGACAAAGCGGGATGGATTAATCTGTTCCCCACATTGTCAGG
+ATTCCTTGACGAGTTTAAGAGGGAACAGAGAGTGGCTGTGAGGCAGATAAATTTGACAGT
+CCAATCCAACGACTATGATGTCAAGGAGGTTGTAGGATGTCCTCCTCCTCCTGAGGCGAA
+TCTGAATGATGAGTACAAAGTGTTTGAGGCTCTTAAACCTCAGCAAGTCCAGTATTCAGA
+ACCGAACCCCAGACCCAAAGTAGTTCGGATTACAGAAAGTGGTGACATCCCTGAGAAATT
+CCTACCAAATATGGCTCAAGCCGTCGTTAGATGGCTTACCTCAGTTGGAGGTGTTTCTCA
+GGTTGGTACTGTTGCCGATAAAGTTGGAGCCAGTGCCTACCAAATTGTTGTGGGTGCTGC
+TAAAGGGGGCTATTTCACTACTGGAGATGAACTTGGAGACTTGATTTCCCTATACCCACT
+AGTGACTCCCTTCCCTACATTGCAGGACAGTCAAAGAGAAGAAATGGAGGAAAATCGTAA
+TCTGATTGATAGGACTACTGCAGCCAGAACGTCAGCTTTGAGACGGGGGATTGTAAAAAC
+CCAACCTGAGCTCATTAATCTGGACGTTGCAGGAGTATCCAACCTCCATCCACCTCCCTA
+CGATATAAATACAGCAGAGGATGCCATGGCATATGTCCATGCAGTGGTCAGCGGGAGATT
+TTCAGGATTCACTAAATGGATATCTGAGGTACGGCCAAATGCTGCCAATCCTGTTGGAGT
+TAGGCTCTATGCCCACAGCCACCATACCCAGGACATGAAGCTGTTGGGAGAAGCCTGGTC
+CTCCTCTGCCAAACTGGCTAAGGAATACATCTGTGCAGCTATTTTGGAGGTTAACAACAT
+CCCATACAAGAAGTCTAGCTTTGCGACCCCTAATGTAGTGCCTCCCCCGCCTGAGTCTTC
+CTGGGCTCGGCAGGTTGAATACGCAACTGCCCCTAAAGCTGTGCCACAGATTGTTCCCGT
+TCATGAAACCCTGGATTTGGAGCTGTTTCACAGTATAATGCAGCAATTCCCAGGGCACTG
+TCCCCGCCAGGTGCAGATGCTTATTAGAGAGGTAAGTCATAAAAATCCTGATGACTACCG
+TGTGAGAATTCAAGACTTATTCTCCCGGTTTCCACCTCCTAAAGTAGCATCGAAGAGATC
+ACTGCTGAGCGCAGAACAAAGGACGAGACTCAACAAAAAGACTCTCGACCGCAAAAAGAG
+GAAGAAAATTGCAAGTAAGCTCTTGCCAACCCTATAACATCAAACAACCCAAACCTCAAA
+TCAAGAATACAATTTG
+>gi|253761971|ref|NC_012958.1|_Drosophila_A_virus,_complete_genome--Locus_63_Transcript_1/1_Confidence_0.000_Length_371_hit1_IdMatch=95.96,AligLength=371,E-val=3e-170
+AGTGTTCGCACTTCCAGATCCCACTACCAGCACTCGGAGTTTCTTGGGTCGCCAGCGGGA
+GTATAGCTTACTCTGCTGCTGCAGCCTAGAATCACTCATAGCCGTTGGACATATGGCTTG
+AGAAAAAAGGCTAGCTCCCACTGCGCGCTGCGATTGTACCTCAATAACGCCTATAATGTC
+CACGCCCGAGAGCATGGTCTTGGGCATGGCACTGTAGGCGACCTGGCTCCCAGACTTTCG
+AGGGCGATTTCGCCCTCTTCGACGGGGTCCTTGAACCATTGAGCAATTCTTTCCCACAAT
+TTGACGAGAAGATGCGCTCTGTACGGTAACCTTGGGGGAACGACGGTTTCTGGTGGAAAA
+ATTGTTTCCAC
+>gi|253761971|ref|NC_012958.1|_Drosophila_A_virus,_complete_genome--Locus_40_Transcript_1/1_Confidence_0.000_Length_1029_hit1_IdMatch=97.47,AligLength=1028,E-val=0.0
+ACTTTTGGATCCCTTGCTATAGGATGGTCTCCAGACCCCGCCAACAATATCTCAGGCAAT
+GATACTCAAAACCTCAACCGAGTTATGGCCTGCAGGCCCTCCTCAATGAACCGCATGAAC
+CAAACGACTGTCCTAAACATTCCTGTGGCAACCACCCGTAAGTGGTATCTCACCAAAGGC
+AACCCTGATGACGCCCATCATGGATTCATCAATGTGGTTGTTGCTTCCACCACCGGTGGA
+TACACAGGAAGCACCACCTTCACTGTCACACTCGAATGGGTGATTGAGTTTGAAGGTGCT
+GAATTAGGAGCTGTCTCCATTGACGAGGATATCACTCCAGATACTGGTTTCCAGGACCTT
+TTTACCACCTCAGATGGTTCCTGGAACAATGACTACCTTACAATGAAAATGCACCATGGG
+GGACAAATGGTCCCCTTTTCGGCTGCCCACCAGGCTTATGTGTATACAAATGCACCAGGG
+ACAAATGTAACCTACTATCTTGAAGACAAGACGACCTTGAAGACAGCAAACTTCTTTGCA
+GTTATACAAGGTTACTCTATCCCAGGTTTTGTTATGTTTGCCAGTTACACAGATGCAAAA
+GATTATATTCGCACTGGAGATACTGGCAAATGTCTCAAGTATTACACCCAAGGTCCTGTC
+ATTAGCCCTCCCATCCCTAAATTTAGGGTGGCTGATGAAGCAGTTCAGACTGTCGAAACC
+AATCTACTTCGCCGCATTGACCAGCTGACCGAGCAACTTAGAGCAGTGAATACTCCAGTA
+ACAAGAACTGTTGCTCTCAGCAAGGACACGGCTAAGATTAGGACCAAACTTGAGGGTATG
+CCTGATGGAACGACACTCAGTCCTTTCAAAGTGATATCTGAAGACCCAGTGGCCGCTCAA
+GATTTTGAAATTGTATAACCTCTCCCCAAAACCCATCATCTTTTCATAATCACCACCCCG
+TCCCTCCTCGGTGGCTCTCTGGTTACTACACAACTGGAGAGTGTGAGTTCGATTCTCTTA
+GGGGCACC
+
+>gi|225356593|gb|FJ150422.1|_Drosophila_A_virus_isolate_HD,_complete_genome--Locus_42_Transcript_2/2_Confidence_0.333_Length_597_hit1_IdMatch=97.81,AligLength=594,E-val=0.0
+TTCTGAGGTACGGCCAAATGCTGCCAATCCTGTTGGAGTTAGGCTCTATGCCCACAGCCA
+CCATACCCAGGACATGAAGCTGTTGGGAGAAGCCTGGTCCTCCTCTGCCAAACTGGCTAA
+GGAATACATCTGTGCAGCTATTTTGGAGGTTAACAACATCCCATACAAGAAGTCTAGCTT
+TGCGACCCCTAATGTAGTGCCTCCCCCGCCTGAGTCTTCCTGGGCTCGGCAGGTTGAATA
+CGCAACTGCCCCTAAAGCTGTGCCACAGATTGTTCCCGTTCATGAAACCCTGGATTTGGA
+GCTGTTTCACAGTATAATGCAGCAATTCCCAGGGCACTGTCCCCGCCAGGTGCAGATGCT
+TATTAGAGAGGTAAGTCATAAAAATCCTGATGACTACCGTGTGAGAATTCAAGACTTATT
+CTCCCGGTTTCCACCTCCTAAAGTAGCATCGAAGAGATCACTGCTGAGCGCAGAACAAAG
+GACGAGACTCAACAAAAAGACTCTCGACCGCAAAAAGAGGAAGAAAATTGCAAGTAAGCT
+CTTGCCAACCCTATAACATCAAACAACCCAAACCTCAAATCAAGAATACAATTTG
+>gi|225356593|gb|FJ150422.1|_Drosophila_A_virus_isolate_HD,_complete_genome--Locus_40_Transcript_1/1_Confidence_0.000_Length_1029_hit1_IdMatch=97.47,AligLength=1028,E-val=0.0
+ACTTTTGGATCCCTTGCTATAGGATGGTCTCCAGACCCCGCCAACAATATCTCAGGCAAT
+GATACTCAAAACCTCAACCGAGTTATGGCCTGCAGGCCCTCCTCAATGAACCGCATGAAC
+CAAACGACTGTCCTAAACATTCCTGTGGCAACCACCCGTAAGTGGTATCTCACCAAAGGC
+AACCCTGATGACGCCCATCATGGATTCATCAATGTGGTTGTTGCTTCCACCACCGGTGGA
+TACACAGGAAGCACCACCTTCACTGTCACACTCGAATGGGTGATTGAGTTTGAAGGTGCT
+GAATTAGGAGCTGTCTCCATTGACGAGGATATCACTCCAGATACTGGTTTCCAGGACCTT
+TTTACCACCTCAGATGGTTCCTGGAACAATGACTACCTTACAATGAAAATGCACCATGGG
+GGACAAATGGTCCCCTTTTCGGCTGCCCACCAGGCTTATGTGTATACAAATGCACCAGGG
+ACAAATGTAACCTACTATCTTGAAGACAAGACGACCTTGAAGACAGCAAACTTCTTTGCA
+GTTATACAAGGTTACTCTATCCCAGGTTTTGTTATGTTTGCCAGTTACACAGATGCAAAA
+GATTATATTCGCACTGGAGATACTGGCAAATGTCTCAAGTATTACACCCAAGGTCCTGTC
+ATTAGCCCTCCCATCCCTAAATTTAGGGTGGCTGATGAAGCAGTTCAGACTGTCGAAACC
+AATCTACTTCGCCGCATTGACCAGCTGACCGAGCAACTTAGAGCAGTGAATACTCCAGTA
+ACAAGAACTGTTGCTCTCAGCAAGGACACGGCTAAGATTAGGACCAAACTTGAGGGTATG
+CCTGATGGAACGACACTCAGTCCTTTCAAAGTGATATCTGAAGACCCAGTGGCCGCTCAA
+GATTTTGAAATTGTATAACCTCTCCCCAAAACCCATCATCTTTTCATAATCACCACCCCG
+TCCCTCCTCGGTGGCTCTCTGGTTACTACACAACTGGAGAGTGTGAGTTCGATTCTCTTA
+GGGGCACC
+>gi|225356593|gb|FJ150422.1|_Drosophila_A_virus_isolate_HD,_complete_genome--Locus_42_Transcript_1/2_Confidence_0.333_Length_3138_hit1_IdMatch=97.61,AligLength=3136,E-val=0.0
+TCTCCCCCAAGGAGAACTTCTCCATGAGTCGGAGGCCAAACAGTATGTAGCCGAATATAA
+GGCTCGACTACCTGTGGTTGACACTAAGAAAGTTGGCGAACTGCCAACTGAGGTCTTCCA
+GGTAGCACTCCCAAGTATCCCTGTTTGTGGGATTATGGATGCTGTTGGTGTCCCGTTGCA
+CCCCCCATCCATTAACAATCGGGGTGGGCATACTCATGTCACTCGCCAGATGGGCGGAGT
+ACCCCACCCTCCTCTTGGTCTAATACCCATAGCTCAGAAGTATGGGGTAGAGATCTTGGA
+CCAGAAACATGTCTACACAGGAGGCACTTGGGATGGCTTTCTTAATAGACTCGCCCAACA
+GATGGGCCGGACAACGGTCCCCCTGGCAAGAACAGTTTCAGCAGGCAAAAAGAATGCCTC
+TGATAGGGCAATCATAAAACTGTTAAATAAATACATGCCTAGGACGGGAAATAAGAACTG
+GCCTGGTGTCCATACAACCCCGGAAGAAGGCATACTTGATGGTATCAAGATAACGGCCAA
+ATCCAGTGCAGGCGCTCCCTATTGGAGACACAAGGGGGAATGCCTAGACCATATAATTGA
+TACTGGACTTCCTGTTGTGCTAAAGCATATAAAGGAAGGAACCCTCAACCAGTTGTGGCG
+GGAAAACCCTGAGATGTTCCTCGTTGAAGTTAAGAACAAACTTGATAGATACGAAGTCTC
+GAAGCTTAAAGAGAAGACTAGACCCTATGTGTGTGTACCTGCGCACTGGGCTCTCCTATT
+CTCGTGCTTGACTCAAGGATTCCAAGAAGGACTTCAAGTTTTTAGTAACTTGGACCCCAG
+TACAGAATGCTCGAATGCATATGGATTTTCATCCATTGCTGGAGGGCTTACTAGGATGGT
+CGACTGGATGTATGCCTGCCCAAAGCGGCGGGGACGGGTTGTCTGTTACGGTGACGATGC
+ATGTATAACATTTTGGAGCCAGGGCGTCCTCTATCGGGTGGATCCAGATTTTAAACAAAT
+GGACGGGTCCATAGATAGAGAGGATGCAAGAATCACCATTGAGTGGGTCCTCCACCATCT
+CAGAAAGGATTTAGGTGTAGAGGAGACCCCTGCTTTTTGGAAGACAGTTGCAGCAGTGTG
+GCTTGATATGGCCATTGACCCCCACTTTATCGTGGATGGTAAGACTGTTTACAGGAAGAA
+GAACCCCCATGGACTCATGACTGGAGTTCCAGGAACAACCTTATTTGACACTGTGAAATC
+TGTAATAGTCTGGAACGAAATGTTGGATCAGGCTAGTGCAGGTTCCATAGACCTTTTAAA
+TGAAGCTCAAGTAGTTAAATGGATGAAGAGACAAGGCTTGGTTGTCAAAGAGGGAACTTG
+GAGTCCGGTTGCACTCCCTGCAAGGGACACAGAGGGTCTAATTACGGACCACAAATTTCT
+TGGTGTACAAATTATGGGAGTGTACCACAGACACCGTGTGATACATGTCCCCACAATGCC
+TGAGAGCGATGCTCTTGAGATGATGCTCTGCCAGAAGGATAACCCCTTTGAAAAGGCAGT
+ATCTAGAACTGCACACCAAAGAACTCTGTATGACCGTATGAGGGGTTTAATGATAACAAT
+GGGATTCAGCATACCTCGGATCGAAGAGACAATACACGCTGTGGTTAATACAATCCCCGG
+CGAGATTATTGTCATGCAAACGCAAGAGCAAACCGGAACGAAGCCAGAACATATAACCCT
+CCAGGACTTTGAATATCCAGATTCGTCTGGATTCCCCTCTCGGGACTTCTGTCTAGACCT
+CTATTCAGATGGAGGGGATGACAAAGCGGGATGGATTAATCTGTTCCCCACATTGTCAGG
+ATTCCTTGACGAGTTTAAGAGGGAACAGAGAGTGGCTGTGAGGCAGATAAATTTGACAGT
+CCAATCCAACGACTATGATGTCAAGGAGGTTGTAGGATGTCCTCCTCCTCCTGAGGCGAA
+TCTGAATGATGAGTACAAAGTGTTTGAGGCTCTTAAACCTCAGCAAGTCCAGTATTCAGA
+ACCGAACCCCAGACCCAAAGTAGTTCGGATTACAGAAAGTGGTGACATCCCTGAGAAATT
+CCTACCAAATATGGCTCAAGCCGTCGTTAGATGGCTTACCTCAGTTGGAGGTGTTTCTCA
+GGTTGGTACTGTTGCCGATAAAGTTGGAGCCAGTGCCTACCAAATTGTTGTGGGTGCTGC
+TAAAGGGGGCTATTTCACTACTGGAGATGAACTTGGAGACTTGATTTCCCTATACCCACT
+AGTGACTCCCTTCCCTACATTGCAGGACAGTCAAAGAGAAGAAATGGAGGAAAATCGTAA
+TCTGATTGATAGGACTACTGCAGCCAGAACGTCAGCTTTGAGACGGGGGATTGTAAAAAC
+CCAACCTGAGCTCATTAATCTGGACGTTGCAGGAGTATCCAACCTCCATCCACCTCCCTA
+CGATATAAATACAGCAGAGGATGCCATGGCATATGTCCATGCAGTGGTCAGCGGGAGATT
+TTCAGGATTCACTAAATGGATATCTGAGGTACGGCCAAATGCTGCCAATCCTGTTGGAGT
+TAGGCTCTATGCCCACAGCCACCATACCCAGGACATGAAGCTGTTGGGAGAAGCCTGGTC
+CTCCTCTGCCAAACTGGCTAAGGAATACATCTGTGCAGCTATTTTGGAGGTTAACAACAT
+CCCATACAAGAAGTCTAGCTTTGCGACCCCTAATGTAGTGCCTCCCCCGCCTGAGTCTTC
+CTGGGCTCGGCAGGTTGAATACGCAACTGCCCCTAAAGCTGTGCCACAGATTGTTCCCGT
+TCATGAAACCCTGGATTTGGAGCTGTTTCACAGTATAATGCAGCAATTCCCAGGGCACTG
+TCCCCGCCAGGTGCAGATGCTTATTAGAGAGGTAAGTCATAAAAATCCTGATGACTACCG
+TGTGAGAATTCAAGACTTATTCTCCCGGTTTCCACCTCCTAAAGTAGCATCGAAGAGATC
+ACTGCTGAGCGCAGAACAAAGGACGAGACTCAACAAAAAGACTCTCGACCGCAAAAAGAG
+GAAGAAAATTGCAAGTAAGCTCTTGCCAACCCTATAACATCAAACAACCCAAACCTCAAA
+TCAAGAATACAATTTG
+>gi|225356593|gb|FJ150422.1|_Drosophila_A_virus_isolate_HD,_complete_genome--Locus_20_Transcript_1/1_Confidence_0.000_Length_191_hit1_IdMatch=97.86,AligLength=187,E-val=7e-86
+CCCCCCCCACCTTCGCAATCACAGACAAATTAAACGTAAAACAAACGACATGGATGCATC
+CAACCCTATTATTTCAAGCGATAGGAGCACTGTGAATCAGGTTTATGCGAAGATGGTGAG
+GAGAAAACGGCAAGATCTTGCCTATCTCCAGGAGTTGGTGAGGACAGCCCATCGAGAGAT
+TCTCCCCCAAG
+>gi|225356593|gb|FJ150422.1|_Drosophila_A_virus_isolate_HD,_complete_genome--Locus_63_Transcript_1/1_Confidence_0.000_Length_371_hit1_IdMatch=95.96,AligLength=371,E-val=3e-170
+AGTGTTCGCACTTCCAGATCCCACTACCAGCACTCGGAGTTTCTTGGGTCGCCAGCGGGA
+GTATAGCTTACTCTGCTGCTGCAGCCTAGAATCACTCATAGCCGTTGGACATATGGCTTG
+AGAAAAAAGGCTAGCTCCCACTGCGCGCTGCGATTGTACCTCAATAACGCCTATAATGTC
+CACGCCCGAGAGCATGGTCTTGGGCATGGCACTGTAGGCGACCTGGCTCCCAGACTTTCG
+AGGGCGATTTCGCCCTCTTCGACGGGGTCCTTGAACCATTGAGCAATTCTTTCCCACAAT
+TTGACGAGAAGATGCGCTCTGTACGGTAACCTTGGGGGAACGACGGTTTCTGGTGGAAAA
+ATTGTTTCCAC
+
+>gi|262225305|gb|GQ342963.1|_Drosophila_melanogaster_birnavirus_SW-2009a_strain_DBV_segment_B,_compl--Locus_12_Transcript_1/1_Confidence_0.000_Length_1279_hit1_IdMatch=100.0,AligLength=1273,E-val=0.0
+GGGGGGTCTCTCACGCTAACAATTACTAATTTGTCTGGTGTTCTGGACGATCCCCGTATT
+ATTCCCCCGGGTCTGCAATATCGTCCAGCTCATCTAAATCAGTTACAGATCTTCCTCATG
+CTTCCTTATTTCTCCCAACGCATCTCTACTCCAGCTGGCTTGCTCAATATCGCGAAGCTT
+GCTAATCCTCTGCTTTTTCTTGAGATTCTTTTTCTGGCTTTTTGTTAAGCTAGCTGGTAT
+GGTTGAGGAGCTTTCAGGGAAAGTGTGCTTGCCCACTAGTGTTTGAGCTCCTTTGTATCC
+TAGTGGGTCGGCTAATTTTGTAGGGTCCTTCTCGTAAAAGGCCTCTATGTTCTCATAGTC
+TTGCACCTGTGCCTGTTGGACAACCCTTATAGACTTCCTCATAGCCTCTTCCATTTCATG
+TTGGGCTTGGTTTATCCAGTGTGTGAGCTTGTCCATGAAGTCTTCAATTTTCATTTTGTT
+GTTGTAGACTTCATCGAGTTCTGAGTATAAGTCTTCATATTTACCCATAATTGTTATTAT
+TGCTTCTAATGATGGGAATGTTTTTATGACTTCCTCCAATTTGCTCCTAACATACTCTGG
+CTTAGCAAGTAATTTTTCTGTATGAGAGGATGTTAGATTGGTCAGACTCTTTTTCAACTC
+TTGCAAGTCTGCCATTAACTCTGGTTTTGATAGGTGTCTAGGTTTGGGCTTCACTGGCAT
+ATGCTCGGGGCTGGTCTGCTTCGGTGTGTTGAGCCGAGTTAATAGCTCGTGTGTCATAGA
+GAATTCAGGGTTCAGAGCCAGTTCTGTTGTTAAGCCAGAATCCTCCATGGCGCCCCACAG
+GTCTGGTGCAAGGTCCTCTTGACCTAAGAATGTGCTTGTATCCATCTTGTGTCTTTTGTC
+TACTATGTTGGTCCTGATGTTTGTAGCCATGTTATGCAGTGCTTGATCTGCTAACGGGAT
+AGTCCATCCTCCCATAATTCTGAGCACTTCATAACGCACCAGGTTGTAAAGGTTCCTTTG
+GATGTAGTCCTTTATTGTTTCACCACCTTTTCGGGGCCACATCATTGATGGATAGAACCT
+TTCTTCAGCCAGCACAGGTATGAATATACCCAACTGATGGCTGTAGACAGCATCATACCC
+TAGTAAATCGAGTTTAAGTCTTGGTAACGCTTTCTGGAACCAGCTTTGTCCATTCGCGTC
+CACACTGTCCGTGCTGTCACCTTGCAGAAAGCCGACGTTCGGTGTGTTAGCGATTGTCTC
+TTTTACTTGTTGTTCTAA
+>gi|262225305|gb|GQ342963.1|_Drosophila_melanogaster_birnavirus_SW-2009a_strain_DBV_segment_B,_compl--Locus_3_Transcript_5/5_Confidence_0.250_Length_1016_hit1_IdMatch=100.0,AligLength=825,E-val=0.0
+CTGGTTTTCTTAACTCCTTTTACCTCAACCTCAGTCTCCTCAATGAAGAGGGTTGGTAAA
+TATCTCAAGGATATTGTCTGAGAGAGGTCTACAGCGTTTATGGGTAGTGTTTTCTCTAGT
+ATCTTGCTGAATGATTCAAGATCGTATCCCAGTTCCTTTAATGATTTGGGTAAGAACTTT
+CCGTCAACTCCGTGTCTTATGTTTTGCATGTCTTTCAGCCTAGCCAGTTGTCCTTGCCAT
+GTGCCGCTGCTCAGTCGGTAATCGATACAGGCCTGTCTGCAGCGCTTGATAGTGGTATCC
+ATGTCCGTAGGATCAGCTATTCTGTCTCTCTGGACTACATACCCTTTGGCAGTCTCAAAG
+TTCCCTTGTGTTTCTTTACTTGCCAGCCATTGGAAAGCTATAGCATTCAGTAGCTTATCA
+TCATAGGTGCCGGTTGTGAATCTGGGTCGATAGAAGGGAATCTTGGGGTCGCCATCAGGT
+AAATGTATTTTGGTGCAGTCTTCATAATCTTTGGGGTTACCACTTTCAAGTTGTAGTGTG
+CGAATGGTTTGGAGGTATCTTACTATCTGCTCATCTAGGACGGAGCTCGCTTCAAACTCT
+AGGTTTTGGCGTAGATAGTAAGGTTTGAATGCGTGTATTCTGCGTTTGGCGATATACTGG
+GCTATTTCAAGCACTCTTGTCGAATTGACAAGTTTGGTCTCATTCATATTAGGTTGAGGT
+GGTTTCAAGTAACTTTCTGTGATTAAGTCTGTAACTGAAGAATCGTCTTCGCTCTTGATT
+TTGAAAAGCTCGCTAAAGCGGTGCTTTGCACTACCAGTATTAAAG
+>gi|262225305|gb|GQ342963.1|_Drosophila_melanogaster_birnavirus_SW-2009a_strain_DBV_segment_B,_compl--Locus_21_Transcript_1/1_Confidence_0.000_Length_919_hit1_IdMatch=100.0,AligLength=919,E-val=0.0
+TTAAGAAAACCAGTTACATAGATAACACACCCAAACTTAAACCTGACAGCAAGGCTGGCC
+CTCCCTTCCAATCTAAGTATAGGAAAGGAGACATGTTCAGTAGTATACTCGCACTAGCAG
+ATGACGCACTGCTAGGACTTAGTGAAGTTATACACGGTAGAATGGATAGACATAAGTATT
+TCAAAGACAGAATCTATCTTGCGATGTGCTTCCTGTTCCCTAAAGAAGAAAGATATGAAG
+CGAGTAAGTTAACCACGAAAACACGCAATATAGCAAGCGTGTGTGGAGTCACACATTACT
+TAATGCTCCATGCCATGGAACCCGTCATGGAGAAGAGTAAATGGAATTGCATGTCCTCAG
+AAACCTATGAAAACCCCAGCTTATCAAAGTTCACACCTTACTTCGGCAATTTACAGAAAT
+TCTTAGACTTCGGCCTGCATCGTGAGAAGAAGAAGGTCTTTATGCCTAGAGGGGCAAAAC
+CCACACATAGAGACTTTATTTATGCAGATAATTGGTACATCTTCTACCGAAACGAGGACG
+GCACTACTGACTACTACTCCCTTGACTTGGAGAAGGGTGAAGCTAATGCGACCCCCGACA
+TAGCCCAATGCATTAGCTACTACCTTCTAACGCGCGGTTGGATTAGTGATGACGGTATTG
+TGGGGTTCGGCCCGACCTGGAGTACATTTTTAACACAAATTGTACCAGCATGTATAGTTG
+ATAATATATCAGTATACTACAACATGCAATTAAGATTCCCAGGACAGGCCAGTGGCAACA
+CATACACATTCCTCATTAATCATGCTGTGACGACCAAGTTAAGGCAGGAGTGGCTCAATA
+GAGGGTGTCCTCGGCCAGGCTCAGCAGAGTTCACTCAATGCTGCAAGAAAACAGGAGTCA
+ATACAAAAATAGAATTCCA
+>gi|262225305|gb|GQ342963.1|_Drosophila_melanogaster_birnavirus_SW-2009a_strain_DBV_segment_B,_compl--Locus_3_Transcript_4/5_Confidence_0.250_Length_926_hit1_IdMatch=100.0,AligLength=825,E-val=0.0
+CTGGTTTTCTTAACTCCTTTTACCTCAACCTCAGTCTCCTCAATGAAGAGGGTTGGTAAA
+TATCTCAAGGATATTGTCTGAGAGAGGTCTACAGCGTTTATGGGTAGTGTTTTCTCTAGT
+ATCTTGCTGAATGATTCAAGATCGTATCCCAGTTCCTTTAATGATTTGGGTAAGAACTTT
+CCGTCAACTCCGTGTCTTATGTTTTGCATGTCTTTCAGCCTAGCCAGTTGTCCTTGCCAT
+GTGCCGCTGCTCAGTCGGTAATCGATACAGGCCTGTCTGCAGCGCTTGATAGTGGTATCC
+ATGTCCGTAGGATCAGCTATTCTGTCTCTCTGGACTACATACCCTTTGGCAGTCTCAAAG
+TTCCCTTGTGTTTCTTTACTTGCCAGCCATTGGAAAGCTATAGCATTCAGTAGCTTATCA
+TCATAGGTGCCGGTTGTGAATCTGGGTCGATAGAAGGGAATCTTGGGGTCGCCATCAGGT
+AAATGTATTTTGGTGCAGTCTTCATAATCTTTGGGGTTACCACTTTCAAGTTGTAGTGTG
+CGAATGGTTTGGAGGTATCTTACTATCTGCTCATCTAGGACGGAGCTCGCTTCAAACTCT
+AGGTTTTGGCGTAGATAGTAAGGTTTGAATGCGTGTATTCTGCGTTTGGCGATATACTGG
+GCTATTTCAAGCACTCTTGTCGAATTGACAAGTTTGGTCTCATTCATATTAGGTTGAGGT
+GGTTTCAAGTAACTTTCTGTGATTAAGTCTGTAACTGAAGAATCGTCTTCGCTCTTGATT
+TTGAAAAGCTCGCTAAAGCGGTGCTTTGCACTACCAGTATTAAAG
+
+>gi|262225302|gb|GQ342962.1|_Drosophila_melanogaster_birnavirus_SW-2009a_strain_DBV_segment_A,_compl--Locus_9_Transcript_3/3_Confidence_0.000_Length_1571_hit1_IdMatch=99.43,AligLength=1572,E-val=0.0
+ATCCGCGAGCGGATCACTAATAGGTCGGCTGGGGCACCGGGATGCCTTGGCTTGTGATGT
+AGACCCAACGCTCATGGGTCACAATGCAGCACAACTCATTTGTTACAACACAGCCCTGGG
+AGTAAGGAGTACTGGTAATCGTATCTACATGATACGTTTAAAAACTCCAAAGCGCAACCC
+CCGTGTTACTATATTTCCCGCTCTAGTATTCAACACAACACCATTAGGACCGGAAGTTTC
+TGGAACCCAACTATATGCAGTCATAGAGGGGTTATACAACCAGGTCCCACAATCCAGATT
+CAAGGTTACAGGCAAGAACGGACGCACAATTTATGGAATAAAGCCTGGTGCCTATATACC
+ACCGGGCCCCAATTGCACAGTTGTGCCCATTAGCTCCATAACCCAGAATGAAATAACAAC
+CACAGCCACCCCACCAATACCAAGGGGTGGAAGTATGGAAGCAGCCTTAGCCCTGTTACA
+GTACATTCCCCCTGGAGTGACTCCATTTGCAGTCACAGGCAATGTTATAGAAGGTAAAAT
+AGTGCCCAACAAATGGGCTGATCTGAAGAGAGAGGGAATGAAAGGAACTGGCATACCACT
+TGTAACAGATCAAGATTACAAGACCATCAAGGACCTGGCCAAAGCAACTGAAATGTTGCA
+GAGAATAACCACTGCGCAACATCCAGCAGTGATTGGAACGATAGCCAGTGCCATGGATTA
+TGACGACTTTCCTCCACCTCCTCCTCCGGTCACAGATGAAAACATAATGGAAACACTGGA
+GGATCTACTTGTTGCAGCCGCCGATAGAGACCCTAGGATGGCTAAACTTAAGGACGTTGT
+GCTCTGGTTAGCCAAAATAGACAACAACAACCCTGGAGTGCTAGACACACTACACAACTT
+TTCACGGCAGGATGTAGAAGGTGAAAAGATGAATAGAATAGTCCAGAACTCCTTAACCAC
+AGCAGTCCACAACAGGGGGCCAACCCAGGAAGTTCTACAACACCAGAAGGCGGTAAGGAT
+CCGAGAAAACTACCTAAACCAGGGTGTAGACCTGTCAATCGAGTGGATCAAGAATAATGG
+TTTTAGAGGCCCAAGTGCAGACCAGATGAAAACTATAAAAGCTGGCCTAGAACCTCCTCC
+AGATACCACCACCAAATCGCCTACACCCCACAATGACACATCAACACCAGCACTTGTCAT
+GAAAATCATAAAGAACAGTTTAGGCATCCATTATGACAATGCCAGCCCTGAAACCCAGAA
+GGAAATCAATGAACGCATTACCACGATGGTAATTAACAATGGCAACAGAGGCTTGAATCA
+GTACCAGGCAAAAGAAATTGTACAGGATTACGGCAAAACAAAGAAAAGTGCACAGATGAA
+CTTGCGCTATGTCGGGCCAAGAAAGATCGGATACACCCCACCTAGCGCAAACCAGGTCGT
+AGATGTACCGCCTCCCGAAAACACAAGGGATGTTGTTATCGCACGACCTACTCAGCGGGT
+ACCCGCGAATGTGTTGACCAGGGGTAATCGAACTGGTCAAATATAGGGTATATTAGTAGT
+TTATAGATATA
+>gi|262225302|gb|GQ342962.1|_Drosophila_melanogaster_birnavirus_SW-2009a_strain_DBV_segment_A,_compl--Locus_9_Transcript_1/3_Confidence_0.667_Length_681_hit1_IdMatch=100.0,AligLength=681,E-val=0.0
+TCGAATAGACTCATTAGAAAGAACTGTTTCAATAGATGCCTTCTATCCATTCCCTCAGGT
+CATCAAAGAGGGTGGACAGGAGCCTGTAGCCGCCGTAGAGTTATACCTAACCAGTGATAA
+GTCCACTAGTATCACTGGGACAATTAGAAGCATTACCACTGCTCATAGTGCTGCTAGACC
+TGGTATAACATCACCAACGACAATAGTGGCTTATGAGGGAGTTCAATCCGGTGCTAGTAT
+CACCGTGGCTGGAGTGAGTAACTATGAGCTTATACCTAACCCAGAACTAGCACGCAATAT
+GGAAACCAGATATGCAAGAACTGACCCCTATGGCATGATATACACCAAGTATGTACTTGC
+AAATAGGGACAGATTAGGCATACGCAGCGTCTGGCCCACTAATGACTATAAAGCCAGGTT
+CCCATTATTCGAGGAACTTGGCCTCATGCAGTCAGACGCCAGTATCACAGAGGCCATGGC
+TTTCGGTATACATGATGTTATATCATGGATACGTGGCCTAGTACCAGCAGCCTCAGACTG
+GGCCAATCGTATGCTACCAGGTTCAGGGGATGTGATTAAAGGAATCAACAGAACCGCAGG
+GCACCTTCTTTATGGAGAAGCTGCCTCAGGCCGGTTGATAGCACAATCCGCGAGCGGATC
+ACTAATAGGTCAGCTGGGGCA
+>gi|262225302|gb|GQ342962.1|_Drosophila_melanogaster_birnavirus_SW-2009a_strain_DBV_segment_A,_compl--Locus_16_Transcript_1/1_Confidence_0.000_Length_152_hit1_IdMatch=100.0,AligLength=152,E-val=2e-72
+ATTACGGAAGAAAGTCCGCAGGAGTCATATACATCAGAAGTTCCACACTCCCATCAGGAG
+TCTACAACATCTCAGGAACAATCAATGCCGCCACGTATGAAGGCCCACCTTCGGAGGTAG
+GATTGCCAGAGTACAATAAGATATTATCTATA
+>gi|262225302|gb|GQ342962.1|_Drosophila_melanogaster_birnavirus_SW-2009a_strain_DBV_segment_A,_compl--Locus_9_Transcript_2/3_Confidence_0.333_Length_2216_hit1_IdMatch=99.59,AligLength=2217,E-val=0.0
+TCGAATAGACTCATTAGAAAGAACTGTTTCAATAGATGCCTTCTATCCATTCCCTCAGGT
+CATCAAAGAGGGTGGACAGGAGCCTGTAGCCGCCGTAGAGTTATACCTAACCAGTGATAA
+GTCCACTAGTATCACTGGGACAATTAGAAGCATTACCACTGCTCATAGTGCTGCTAGACC
+TGGTATAACATCACCAACGACAATAGTGGCTTATGAGGGAGTTCAATCCGGTGCTAGTAT
+CACCGTGGCTGGAGTGAGTAACTATGAGCTTATACCTAACCCAGAACTAGCACGCAATAT
+GGAAACCAGATATGCAAGAACTGACCCCTATGGCATGATATACACCAAGTATGTACTTGC
+AAATAGGGACAGATTAGGCATACGCAGCGTCTGGCCCACTAATGACTATAAAGCCAGGTT
+CCCATTATTCGAGGAACTTGGCCTCATGCAGTCAGACGCCAGTATCACAGAGGCCATGGC
+TTTCGGTATACATGATGTTATATCATGGATACGTGGCCTAGTACCAGCAGCCTCAGACTG
+GGCCAATCGTATGCTACCAGGTTCAGGGGATGTGATTAAAGGAATCAACAGAACCGCAGG
+GCACCTTCTTTATGGAGAAGCTGCCTCAGGCCGGTTGATAGCACAATCCGCGAGCGGATC
+ACTAATAGGTCGGCTGGGGCACCGGGATGCCTTGGCTTGTGATGTAGACCCAACGCTCAT
+GGGTCACAATGCAGCACAACTCATTTGTTACAACACAGCCCTGGGAGTAAGGAGTACTGG
+TAATCGTATCTACATGATACGTTTAAAAACTCCAAAGCGCAACCCCCGTGTTACTATATT
+TCCCGCTCTAGTATTCAACACAACACCATTAGGACCGGAAGTTTCTGGAACCCAACTATA
+TGCAGTCATAGAGGGGTTATACAACCAGGTCCCACAATCCAGATTCAAGGTTACAGGCAA
+GAACGGACGCACAATTTATGGAATAAAGCCTGGTGCCTATATACCACCGGGCCCCAATTG
+CACAGTTGTGCCCATTAGCTCCATAACCCAGAATGAAATAACAACCACAGCCACCCCACC
+AATACCAAGGGGTGGAAGTATGGAAGCAGCCTTAGCCCTGTTACAGTACATTCCCCCTGG
+AGTGACTCCATTTGCAGTCACAGGCAATGTTATAGAAGGTAAAATAGTGCCCAACAAATG
+GGCTGATCTGAAGAGAGAGGGAATGAAAGGAACTGGCATACCACTTGTAACAGATCAAGA
+TTACAAGACCATCAAGGACCTGGCCAAAGCAACTGAAATGTTGCAGAGAATAACCACTGC
+GCAACATCCAGCAGTGATTGGAACGATAGCCAGTGCCATGGATTATGACGACTTTCCTCC
+ACCTCCTCCTCCGGTCACAGATGAAAACATAATGGAAACACTGGAGGATCTACTTGTTGC
+AGCCGCCGATAGAGACCCTAGGATGGCTAAACTTAAGGACGTTGTGCTCTGGTTAGCCAA
+AATAGACAACAACAACCCTGGAGTGCTAGACACACTACACAACTTTTCACGGCAGGATGT
+AGAAGGTGAAAAGATGAATAGAATAGTCCAGAACTCCTTAACCACAGCAGTCCACAACAG
+GGGGCCAACCCAGGAAGTTCTACAACACCAGAAGGCGGTAAGGATCCGAGAAAACTACCT
+AAACCAGGGTGTAGACCTGTCAATCGAGTGGATCAAGAATAATGGTTTTAGAGGCCCAAG
+TGCAGACCAGATGAAAACTATAAAAGCTGGCCTAGAACCTCCTCCAGATACCACCACCAA
+ATCGCCTACACCCCACAATGACACATCAACACCAGCACTTGTCATGAAAATCATAAAGAA
+CAGTTTAGGCATCCATTATGACAATGCCAGCCCTGAAACCCAGAAGGAAATCAATGAACG
+CATTACCACGATGGTAATTAACAATGGCAACAGAGGCTTGAATCAGTACCAGGCAAAAGA
+AATTGTACAGGATTACGGCAAAACAAAGAAAAGTGCACAGATGAACTTGCGCTATGTCGG
+GCCAAGAAAGATCGGATACACCCCACCTAGCGCAAACCAGGTCGTAGATGTACCGCCTCC
+CGAAAACACAAGGGATGTTGTTATCGCACGACCTACTCAGCGGGTACCCGCGAATGTGTT
+GACCAGGGGTAATCGAACTGGTCAAATATAGGGTATATTAGTAGTTTATAGATATA
+>gi|262225302|gb|GQ342962.1|_Drosophila_melanogaster_birnavirus_SW-2009a_strain_DBV_segment_A,_compl--Locus_15_Transcript_1/1_Confidence_0.000_Length_436_hit1_IdMatch=100.0,AligLength=436,E-val=0.0
+AGCCAGAGCATCCTGTCTAGCACCCCTCTGCGTCCCTGGTGCATCTCGGTGTACATTCTT
+AACTTACCTATTTAATCACCCATGCGAGAACGATACTACGAAGATACTGAACTCAATAAC
+CTCAGCTACAGTGAACAAGATAAACAGCTAAAACAAATATGTCAAACGAGTACCTTAGAT
+CAATCCTCATGCCTGAGAGAGGTCCCTCCAGTATACCAGACGACAACGTCCGCCGTCATT
+GCGTACGACAAGAAACAATCACTGCGAACATTGTGGTCGGATCTTCTGGAAAAGGGGCCT
+TTGTTCTGTTCCCTAACAATCCTAGCAGCCTTATTGGCGCTCATTTTAAGTATGATGACC
+AGGGCAAATCTTACAAATACACCCAATCACTCGTTGTCGCCCAACGCCTCAATGAGTCCT
+ATAATTACGGAAGAAA
+>gi|262225302|gb|GQ342962.1|_Drosophila_melanogaster_birnavirus_SW-2009a_strain_DBV_segment_A,_compl--Locus_31_Transcript_1/1_Confidence_0.000_Length_373_hit1_IdMatch=100.0,AligLength=373,E-val=0.0
+GATATTATCTATAACCAGCAATCCCATGGACAAACTAGGAAATGTGGGAGTACTTGAGGG
+TGTAGCCGTACTGACATTACCAGCCAGTTATGATATTGATTATACACGACTGGCAGATCT
+ATCACCAAGCTCTGCTAAGAATGGATGCGTGGTCAATGACAGTGGTCAATCTCTCATCTA
+CACTCAGTACGATGAAATCAATTACACAGGATCTCAGGAAAAGCAACTGCTATCATTCAA
+CATTGATAGCAATATATTGGTCACAACTACAGCTACTCTTGACTTCTACACCACAGCTTC
+AGATGCCCAGGTAACCATTAAAATCAAGTATCTTGGCATTGATGGTCTAGTGGTGTCAGA
+GAATGAAATAATT
+
+>gi|18254451|gb|AF196645.2|_Drosophila_x_virus_segment_B_putative_RNA-dependent_RNA_polymerase_VP1_(--Locus_43_Transcript_1/1_Confidence_0.000_Length_1002_hit1_IdMatch=98.4,AligLength=1003,E-val=0.0
+TATCAGCCTGTTAAGCTTGGATAGACCGATGCATGAGCAAAATTACGCACAGGTCCTATA
+CCAACAGAAGACCATCGAAAAGAAAGAGGCAAAATCAAAGGTTAGCAACCCGCTATACAA
+ACGGGATACAGAGACCTACCACGAATACACAACGCGTATGGCGAGAATGAGGATCAATGA
+CGACATGGTTGGTCCTCACTGGGAACCAATAATAAACCTGGTTACCAAACTCTATCCGCG
+GGAGGCTACAGGAGAGAACCAAAAGTCTAGGGAATCACTGACAAGGGTTAAGATACGAGG
+ATTATTGGAAGACATGGAAAGACAGTTAGAAAGCAATAACAGATCAATGGATGTATGGTA
+CAATGCATACCTAACAGGAAAGAAACCAAGTGGAGTCGACAAAAAGTTGGCAACATTACT
+AGTCCTGTTAGCACCAAAAAGAACTAAGAAACTGCCTTCAGGAGTTTATCAAAAACTACT
+TGGGTACCCGCCCATAGATAAATCTCCCGTTCCATCTCTTACATCTGATGAGTCGTATCT
+TTACGACATGAATTCCCTAGAATACAACCGGATAGCATACGTAAGCAAATTGAATGAAGA
+TGACATCACAGTTTATGCCAATAAGTACATGGTGTACAGCAGCACCATGTTGTCAAGCCT
+TCTACCAGACAAAGTAGATTGGCCAGAACTGAGATCAATGAACGTCGAGGGCGCATCGGA
+TCCTTATCAAGTGAAGGGCTACAAAAAGAAGGAGTTGAAGCCACGGTTTGGTGAGGAGAT
+ACTAGACGATGAGCCAACTGGCAAGAAGTCATCAACAGAAAAGAGAAGGCTACAGAGGAA
+AGGCCAAAAAGCCAAGTTGCAGAGACAAGCTGCAACAGGCACAACATTTGTTAGAAAACC
+ATTAAATTAACTCCGGGAGGGGGGGGACTAAATCTTGGTAAGGAATAGACCATCCGCCAC
+TGGCTTAAGAACCAGGTCCCTAGCCGTTAGACTAAAAGCAAG
+>gi|18254451|gb|AF196645.2|_Drosophila_x_virus_segment_B_putative_RNA-dependent_RNA_polymerase_VP1_(--Locus_47_Transcript_1/1_Confidence_0.000_Length_940_hit1_IdMatch=99.26,AligLength=940,E-val=0.0
+GAATAAGAGCTTTAAAGAAATGGGGATAACTCCCTATCGTGTGATGGAGTGGCTTGATGA
+GTACATGCCACTCAGTGATGACGAGCCTGAGATAACCTTATCAAACACCCTTGACTGGCT
+TGTATACACGCCAGAAGAGGCTGAATTGATGGGGGTCCCAGACTCGTTACCAGACATCAC
+ACAATCCTCAGCAGCGGGTCTCCCCTGGCTGGGTAAGAAGAAGGGCGAAGTTGCCGTATC
+TGCTCTGATTACGGCGAATATGCTGATAAAAGACGTGTCGCAACTTCTGAAAGAAACCCT
+CTTTACTGGATCCAACAATCCATTGGATCCCAAGAAGGAAGGTGTAGCAGAAGTTGCGAC
+AAAGAACCCCAGGAGGGCAGCAGACCAATTCTCCCGACAGGTACTCGATAGAATCATTAA
+AGAGTACTCTTACACAATGATGGGTCTACTTTTCCCGAAAGGAGAGCGGTATGCCATAGC
+TGACCATTTAACCAAGACTAGGAATATTTGGAGCGCCAGTTATGTCACACACCTAATCGG
+GTCAACAATATCAGACCAGCCAGCAAAACGCATGCTAAACGTCCTTACATCAACATCAAG
+GACGCCATCCCTAGCTAAGTTTTCTCCAACTCAGGGAGGGATGGAGGCTCTTATTAATAT
+CATCCTCAACGCAACAGATATAGTGGAACTAGTATACGCTGATAACGCATACATATACTA
+TCCGAACGAAGATATATGGTATAGCATAGACCTAACAAAAGGCGAGGCTAACTGTACACG
+CGATGTGGCAATGACAACAGCCATGTACCTATTAACAAGAGGTTGGACATCGAAACAGGG
+TACACCTATATACAATTACACATGGGCATACTTAGCCTTGTATGGTATACCATATATGAC
+CGTGGACTCAATTAGTGTATTAAAGAACTTCCAGATAAAG
+>gi|18254451|gb|AF196645.2|_Drosophila_x_virus_segment_B_putative_RNA-dependent_RNA_polymerase_VP1_(--Locus_17_Transcript_3/3_Confidence_0.200_Length_456_hit1_IdMatch=98.9,AligLength=456,E-val=0.0
+GAACAATCATGTATTAACCACTATACTGATGAACAAGTGGTCTGAGATAGGTAAGCCACA
+ACCCTCCCCGGATGTTATCGAGAAGCTGGCCTCAATGACAGGAATTGATTTCAAGGTTGA
+ACTAGTAGTGACAAACTTCAGAGAGAAACTAATAGCAGCTTCAAGGCATTCGATCCCTAC
+AAGTAACAGGGTTGAACCCAGAACAATTGTAGAGATGGACATGCTGGGCTGGGACGTAAC
+TCACACGGAGTTTGGCTTCACACCGGTACTGTCAAAAGAACGACTATTCAAATCAATAGC
+CTGCCCACAACCACCAAGTAGCACCTTTCAAACGAGCGTGGCAAAACAGGTACACAAGTA
+CATTCAGAATGTAGCTCTGTTGTACGTGGGTGCCTGGGCTTATCCATGCATAGCACAGAC
+CGTAGAGGGGTATGCTCTAAATCATTGGAACACTAT
+>gi|18254451|gb|AF196645.2|_Drosophila_x_virus_segment_B_putative_RNA-dependent_RNA_polymerase_VP1_(--Locus_45_Transcript_1/1_Confidence_0.000_Length_631_hit1_IdMatch=98.73,AligLength=631,E-val=0.0
+CGGAGAGGGGTGTCCGCACCAATTAATAAGCTAACAAATGTAACAATCATGAGTGACATT
+TTCAATCAACAGGGACTGAAATCCAAATTTTCGAACATTGTCAAGAATGAAGGACAAGGT
+GACTCGGACATCAGAGAGGTATTCAATGAATTAGCAAGACCTCAAGCCGAAGTTGGCCGA
+GACATAGAATATTCAGAACTTAGTCAGGCATTAAATGACAATGGCGTTAAAGTCTTTAGA
+CCGCAGCCGTTTGATGAGTTGGTTAATATTCCCTTTATAGAGGCCGCATCTCCTAGAATG
+ATGGCCCTGTACGGGGAACTGTTGGATTCCAAAGACGTTTCACTGCCTGTTGGCTCTGGC
+CTGCACATACCAACCTATAAGCCAGGCCATGAGGTCACCCCACCCCTCCTCACTTTACCT
+AACTCGCTTTCCTATGAGTACATGCATTACATAGCTAACTCAGCTAATGACACGTGGGAC
+AAGCAGACTTATGAGACCCTTAAAGAACTACTTGTAACTCAAGCTACAAATAGGTTCTCT
+ACTGGTTCCCTACTTGGTCAAGTGAAGAGGGTTGCGGCCGGCCAAGATGTGGCATATGGA
+AGAAAAGGTCACCATAAGAATAAGAGCTTTA
+>gi|18254451|gb|AF196645.2|_Drosophila_x_virus_segment_B_putative_RNA-dependent_RNA_polymerase_VP1_(--Locus_17_Transcript_2/3_Confidence_0.400_Length_2274_hit1_IdMatch=99.03,AligLength=414,E-val=0.0
+CGCGATGAGATAGGTAAGCCACAACCCTCCCCGGATGTTATCGAGAAGCTGGCCTCAATG
+ACAGGAATTGATTTCAAGGTTGAACTAGTAGTGACAAACTTCAGAGAGAAACTAATAGCA
+GCTTCAAGGCATTCGATCCCTACAAGTAACAGGGTTGAACCCAGAACAATTGTAGAGATG
+GACATGCTGGGCTGGGACGTAACTCACACGGAGTTTGGCTTCACACCGGTACTGTCAAAA
+GAACGACTATTCAAATCAATAGCCTGCCCACAACCACCAAGTAGCACCTTTCAAACGAGC
+GTGGCAAAACAGGTACACAAGTACATTCAGAATGTAGCTCTGTTGTACGTGGGTGCCTGG
+GCTTATCCATGCATAGCACAGACCGTAGAGGGGTATGCTCTAAATCATTGGAACACTAT
+
+>gi|22855185|ref|NC_004169.1|_Drosophila_x_virus_segment_B,_complete_sequence--Locus_17_Transcript_3/3_Confidence_0.200_Length_456_hit1_IdMatch=98.9,AligLength=456,E-val=0.0
+GAACAATCATGTATTAACCACTATACTGATGAACAAGTGGTCTGAGATAGGTAAGCCACA
+ACCCTCCCCGGATGTTATCGAGAAGCTGGCCTCAATGACAGGAATTGATTTCAAGGTTGA
+ACTAGTAGTGACAAACTTCAGAGAGAAACTAATAGCAGCTTCAAGGCATTCGATCCCTAC
+AAGTAACAGGGTTGAACCCAGAACAATTGTAGAGATGGACATGCTGGGCTGGGACGTAAC
+TCACACGGAGTTTGGCTTCACACCGGTACTGTCAAAAGAACGACTATTCAAATCAATAGC
+CTGCCCACAACCACCAAGTAGCACCTTTCAAACGAGCGTGGCAAAACAGGTACACAAGTA
+CATTCAGAATGTAGCTCTGTTGTACGTGGGTGCCTGGGCTTATCCATGCATAGCACAGAC
+CGTAGAGGGGTATGCTCTAAATCATTGGAACACTAT
+>gi|22855185|ref|NC_004169.1|_Drosophila_x_virus_segment_B,_complete_sequence--Locus_43_Transcript_1/1_Confidence_0.000_Length_1002_hit1_IdMatch=98.4,AligLength=1003,E-val=0.0
+TATCAGCCTGTTAAGCTTGGATAGACCGATGCATGAGCAAAATTACGCACAGGTCCTATA
+CCAACAGAAGACCATCGAAAAGAAAGAGGCAAAATCAAAGGTTAGCAACCCGCTATACAA
+ACGGGATACAGAGACCTACCACGAATACACAACGCGTATGGCGAGAATGAGGATCAATGA
+CGACATGGTTGGTCCTCACTGGGAACCAATAATAAACCTGGTTACCAAACTCTATCCGCG
+GGAGGCTACAGGAGAGAACCAAAAGTCTAGGGAATCACTGACAAGGGTTAAGATACGAGG
+ATTATTGGAAGACATGGAAAGACAGTTAGAAAGCAATAACAGATCAATGGATGTATGGTA
+CAATGCATACCTAACAGGAAAGAAACCAAGTGGAGTCGACAAAAAGTTGGCAACATTACT
+AGTCCTGTTAGCACCAAAAAGAACTAAGAAACTGCCTTCAGGAGTTTATCAAAAACTACT
+TGGGTACCCGCCCATAGATAAATCTCCCGTTCCATCTCTTACATCTGATGAGTCGTATCT
+TTACGACATGAATTCCCTAGAATACAACCGGATAGCATACGTAAGCAAATTGAATGAAGA
+TGACATCACAGTTTATGCCAATAAGTACATGGTGTACAGCAGCACCATGTTGTCAAGCCT
+TCTACCAGACAAAGTAGATTGGCCAGAACTGAGATCAATGAACGTCGAGGGCGCATCGGA
+TCCTTATCAAGTGAAGGGCTACAAAAAGAAGGAGTTGAAGCCACGGTTTGGTGAGGAGAT
+ACTAGACGATGAGCCAACTGGCAAGAAGTCATCAACAGAAAAGAGAAGGCTACAGAGGAA
+AGGCCAAAAAGCCAAGTTGCAGAGACAAGCTGCAACAGGCACAACATTTGTTAGAAAACC
+ATTAAATTAACTCCGGGAGGGGGGGGACTAAATCTTGGTAAGGAATAGACCATCCGCCAC
+TGGCTTAAGAACCAGGTCCCTAGCCGTTAGACTAAAAGCAAG
+>gi|22855185|ref|NC_004169.1|_Drosophila_x_virus_segment_B,_complete_sequence--Locus_17_Transcript_2/3_Confidence_0.400_Length_2274_hit1_IdMatch=99.03,AligLength=414,E-val=0.0
+CGCGATGAGATAGGTAAGCCACAACCCTCCCCGGATGTTATCGAGAAGCTGGCCTCAATG
+ACAGGAATTGATTTCAAGGTTGAACTAGTAGTGACAAACTTCAGAGAGAAACTAATAGCA
+GCTTCAAGGCATTCGATCCCTACAAGTAACAGGGTTGAACCCAGAACAATTGTAGAGATG
+GACATGCTGGGCTGGGACGTAACTCACACGGAGTTTGGCTTCACACCGGTACTGTCAAAA
+GAACGACTATTCAAATCAATAGCCTGCCCACAACCACCAAGTAGCACCTTTCAAACGAGC
+GTGGCAAAACAGGTACACAAGTACATTCAGAATGTAGCTCTGTTGTACGTGGGTGCCTGG
+GCTTATCCATGCATAGCACAGACCGTAGAGGGGTATGCTCTAAATCATTGGAACACTAT
+>gi|22855185|ref|NC_004169.1|_Drosophila_x_virus_segment_B,_complete_sequence--Locus_45_Transcript_1/1_Confidence_0.000_Length_631_hit1_IdMatch=98.73,AligLength=631,E-val=0.0
+CGGAGAGGGGTGTCCGCACCAATTAATAAGCTAACAAATGTAACAATCATGAGTGACATT
+TTCAATCAACAGGGACTGAAATCCAAATTTTCGAACATTGTCAAGAATGAAGGACAAGGT
+GACTCGGACATCAGAGAGGTATTCAATGAATTAGCAAGACCTCAAGCCGAAGTTGGCCGA
+GACATAGAATATTCAGAACTTAGTCAGGCATTAAATGACAATGGCGTTAAAGTCTTTAGA
+CCGCAGCCGTTTGATGAGTTGGTTAATATTCCCTTTATAGAGGCCGCATCTCCTAGAATG
+ATGGCCCTGTACGGGGAACTGTTGGATTCCAAAGACGTTTCACTGCCTGTTGGCTCTGGC
+CTGCACATACCAACCTATAAGCCAGGCCATGAGGTCACCCCACCCCTCCTCACTTTACCT
+AACTCGCTTTCCTATGAGTACATGCATTACATAGCTAACTCAGCTAATGACACGTGGGAC
+AAGCAGACTTATGAGACCCTTAAAGAACTACTTGTAACTCAAGCTACAAATAGGTTCTCT
+ACTGGTTCCCTACTTGGTCAAGTGAAGAGGGTTGCGGCCGGCCAAGATGTGGCATATGGA
+AGAAAAGGTCACCATAAGAATAAGAGCTTTA
+>gi|22855185|ref|NC_004169.1|_Drosophila_x_virus_segment_B,_complete_sequence--Locus_47_Transcript_1/1_Confidence_0.000_Length_940_hit1_IdMatch=99.26,AligLength=940,E-val=0.0
+GAATAAGAGCTTTAAAGAAATGGGGATAACTCCCTATCGTGTGATGGAGTGGCTTGATGA
+GTACATGCCACTCAGTGATGACGAGCCTGAGATAACCTTATCAAACACCCTTGACTGGCT
+TGTATACACGCCAGAAGAGGCTGAATTGATGGGGGTCCCAGACTCGTTACCAGACATCAC
+ACAATCCTCAGCAGCGGGTCTCCCCTGGCTGGGTAAGAAGAAGGGCGAAGTTGCCGTATC
+TGCTCTGATTACGGCGAATATGCTGATAAAAGACGTGTCGCAACTTCTGAAAGAAACCCT
+CTTTACTGGATCCAACAATCCATTGGATCCCAAGAAGGAAGGTGTAGCAGAAGTTGCGAC
+AAAGAACCCCAGGAGGGCAGCAGACCAATTCTCCCGACAGGTACTCGATAGAATCATTAA
+AGAGTACTCTTACACAATGATGGGTCTACTTTTCCCGAAAGGAGAGCGGTATGCCATAGC
+TGACCATTTAACCAAGACTAGGAATATTTGGAGCGCCAGTTATGTCACACACCTAATCGG
+GTCAACAATATCAGACCAGCCAGCAAAACGCATGCTAAACGTCCTTACATCAACATCAAG
+GACGCCATCCCTAGCTAAGTTTTCTCCAACTCAGGGAGGGATGGAGGCTCTTATTAATAT
+CATCCTCAACGCAACAGATATAGTGGAACTAGTATACGCTGATAACGCATACATATACTA
+TCCGAACGAAGATATATGGTATAGCATAGACCTAACAAAAGGCGAGGCTAACTGTACACG
+CGATGTGGCAATGACAACAGCCATGTACCTATTAACAAGAGGTTGGACATCGAAACAGGG
+TACACCTATATACAATTACACATGGGCATACTTAGCCTTGTATGGTATACCATATATGAC
+CGTGGACTCAATTAGTGTATTAAAGAACTTCCAGATAAAG
+
+>gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds--Locus_54_Transcript_1/1_Confidence_0.000_Length_244_hit1_IdMatch=99.59,AligLength=244,E-val=2e-120
+CCGAGGAGACTCGGGATTTGTTTCTATCGGACGGTCAAACCATCCCAAGCTCTCAAGAGA
+AGATTGCCACAATACACGAGTACCTCCTGGAACACAAGGAGTTAGAGGAGGCAATGTTCA
+GCTTGATAAGCCAAGGGAGAGGCCGGTCTCTTATCAACATGGTAGTAAAAAGCGCTCTGA
+ACATCGAAACCCAGTCTCGAGAAGTCACCGACGAAAGAAGGCAAAGACTAGAACGAAAAC
+TTCG
+>gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds--Locus_44_Transcript_1/1_Confidence_0.000_Length_557_hit1_IdMatch=98.92,AligLength=557,E-val=0.0
+TACAATGTCATTGTCCTCTCCACGCACTCTTCGCAATCGGTCAAGTGCGGCCCTCCTTCC
+GGGGGGATCAGTTTGAGCAGTCTGAGCTGATACAATTCGGCGTGGGGCTATTCTAGGAAC
+AGTTGCCGGTTGGTTGACAAGTGAGTGCGAAATAAGCCTGCGGACAGCATGACTTAATTC
+CCGAGCTTGTTCCTGGGATGGCCCCTTCCCTTGATTTCTGTCGTATATGTCGTCGACAAG
+GTCCTTAACAGCATCGGCTTGTTCTTGGGTTGGTGACGGCCCAAGCATCATAATGTAGCT
+GTCATAGTGTCGTCTTTGGACACGAGGTGGTATTGGCTGGGACCAATCGTCACCCTTTAA
+CCACATTATGATTTGTATGCCAGTAGGCAATGACTCCTGCTCCATCCAATAGGATACAAA
+GTCATCCACAGTGTACGACTCTTGGATCGAGGCGTTATTGCTATAGATTCTCCGTAACTT
+TGCATCCTTTTGGTTCTTCCGAGCAATCCTCATTGCTAGTTCCGTGTCTTCTTTCGATAT
+TCTTCCTCTTGACATTA
+>gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds--Locus_66_Transcript_1/2_Confidence_0.333_Length_255_hit1_IdMatch=98.43,AligLength=255,E-val=1e-122
+GTACATGCATGTACTGACGAACTATCATGTCGATGAGAGGGAAGCATCGAGCTTCGATTT
+CTGGCAACTACTGAAACAGATAAAAAATGTTGCTGTGCCCTTGGCAGCCACCCTTGCCCC
+CCAGTTCGCACCAATAATCGGTGCTGCCGATGGGTTAGCCAATGCACTATTGGGTGATAG
+CGCCAGCGGAAGGCCTGTTGGCAATTCCGCTAGCGGTATGCCCATTTCAATGAGTAGGCG
+TCTTAGAAACGCTTA
+>gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds--Locus_59_Transcript_1/1_Confidence_0.000_Length_123_hit1_IdMatch=99.19,AligLength=123,E-val=4e-55
+ATAAACATCAATTATGGAAACAACACCAATGGTGACAGCTCGTTCAGTGTGGACTCATCA
+TTTACCATCAATGTCATTGGGGGCGCCACCATTGGCGTCAACTCTCCAACAGTCGTTGTT
+GGT
+>gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds--Locus_68_Transcript_1/1_Confidence_0.000_Length_211_hit1_IdMatch=99.05,AligLength=211,E-val=1e-101
+TGAAAACTCTTTTAAACCCAGCACAATTTATCTCAGACATTCCTGATGATATAATGATCC
+GACACGTAAACAGGGCCCAGACCATCACCTACAACTTGAAGTCAGGGTCCTCTGGCACCG
+GCCTGATCGTGGTCTATCCAAACACCCCGTCGAGTATTAGCGGCTTCCATTACATATGGG
+ATTCCGCTACCTCGAATTGGGTGTTTGATCA
+>gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds--Locus_69_Transcript_1/1_Confidence_0.000_Length_164_hit1_IdMatch=99.39,AligLength=164,E-val=3e-77
+CCAGAGGATTGGATGTTATTGACAGGATCCTATCGTAAGAGTAGTCAGACACTTCACTCA
+AGGTCCCTTGGAACCAGACTGCATTGAATGTTCCATTCAGTGCATAAACACCCGCAGGTA
+AGGTGCTGGACTTAATGCTTAGCGAGCCTGAAATCAGTCTGCCA
+>gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds--Locus_62_Transcript_1/1_Confidence_0.000_Length_130_hit1_IdMatch=98.46,AligLength=130,E-val=8e-58
+TGACAAAGTCATTCCATCCGACCCTGAGGAGCTGTATATTGCTGTATCACTAACAGAATC
+CCTCAGGAAGCAGATACCGAACCTCAATGACATGCCATACTATGAGATGGGTGGCTATAG
+GGTGTACAAC
+>gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds--Locus_55_Transcript_1/1_Confidence_0.000_Length_246_hit1_IdMatch=97.98,AligLength=247,E-val=2e-114
+ACAAGTCACCGTCCACTCTATCCTCTCCAACCCACATAACCAACACTTCCCAGAACTTGG
+GCTACGGAGGTGCATTCATGATCCCAGTAACCACAGTTCCTGGGCAAGAATTCCATAACA
+AGGAATTCAGCATTAATGTGGACTCCGTAGGGCCAGTTGACATCTTGTGGTCTGGTCAAA
+TGACTATGCAGGACGAATGGACTGTAACTGCAAATTATCAACCATTGAACATCTCTGGCA
+AGCTAA
+>gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds--Locus_65_Transcript_1/1_Confidence_0.000_Length_158_hit1_IdMatch=97.47,AligLength=158,E-val=3e-70
+CTGGCAAGCTAATTGCAAACAGTCTGCGAACCCTAACATGGTCCAACACTGGTGTAGACA
+ATGGCAGCCACTACATGAACATGAACAACCTTAATGTCTCCCTTTTCCATGAGAATCCAC
+CACCTGAACCCGTTGCCGCCATAAAAATAAACATCAAT
+>gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds--Locus_66_Transcript_2/2_Confidence_0.333_Length_167_hit1_IdMatch=97.6,AligLength=167,E-val=4e-75
+GTTGCCGTGCCATTGGCAGCCACCCTTGCCCCCCAGTTCGCACCAATAATCGGTGCTGCC
+GATGGGTTAGCCAATGCACTATTGGGTGATAGCGCCAGCGGAAGGCCTGTTGGCAATTCC
+GCTAGCGGTATGCCCATTTCAATGAGTAGGCGTCTTAGAAACGCTTA
+>gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds--Locus_58_Transcript_1/2_Confidence_0.333_Length_476_hit1_IdMatch=99.16,AligLength=476,E-val=0.0
+CCGAGTCTCCTCGGAGATTGCCTTTGCAGCGTTTCTTGGTATCGGTTGGTCCAACTCTTC
+CAGGAATGGGTTCGTGTTCATGAATGGGTTCATGCTCGCGGACCCGGCTGTCCAGTGCGG
+GAGGGTCTGTTTTGGGGTTCTTCTCTTTACGTCTCCCATATCTTTTATCTTTTTGTCCAG
+AGATGTCAGGGTCTTTACTTGAACTAATCCTGGTGAGTTCCCAAGTAGTGGAATCCCAAG
+AGAGTCCGTCAATTGGAGTTTCAGGTTGATGCCAAAAACTTCTCCCACACTGGACCCGAC
+AACGGATCCTGTGAAAGCTGCAAATGGTGCCTTCCCCAAAACTCCACTCTTTAGTAAGTC
+GTCTGCTGCATAAATGGCAAGCTGGTGGGACGTTCCCGTTACCTTGTTTGGTGATGTCGA
+GGATGCGAGTCTTCCTTCTAATAATTGATAGCATGGTAGGAGGATGTAATCGCTTC
+>gi|1545997|gb|U60650.1|DXU60650_Drosophila_x_virus_polyprotein_gene,_complete_cds--Locus_58_Transcript_2/2_Confidence_0.333_Length_368_hit1_IdMatch=99.69,AligLength=323,E-val=3e-163
+GGTCATCCCATATCTTTTATCTTTTTGTCCAGAGATGTCAGGGTCTTTACTTGAACTAAT
+CCTGGTGAGTTCCCAAGTAGTGGAATCCCAAGAGAGTCCGTCAATTGGAGTTTCAGGTTG
+ATGCCAAAAACTTCTCCCACACTGGACCCGACAACGGATCCTGTGAAAGCTGCAAATGGT
+GCCTTCCCCAAAACTCCACTCTTTAGTAAGTCGTCTGCTGCATAAATGGCAAGCTGGTGG
+GACGTTCCCGTTACCTTGTTTGGTGATGTCGAGGATGCGAGTCTTCCTTCTAATAATTGA
+TAGCATGGTAGGAGGATGTAATCGCTTC
+
+>gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence--Locus_44_Transcript_1/1_Confidence_0.000_Length_557_hit1_IdMatch=98.92,AligLength=557,E-val=0.0
+TACAATGTCATTGTCCTCTCCACGCACTCTTCGCAATCGGTCAAGTGCGGCCCTCCTTCC
+GGGGGGATCAGTTTGAGCAGTCTGAGCTGATACAATTCGGCGTGGGGCTATTCTAGGAAC
+AGTTGCCGGTTGGTTGACAAGTGAGTGCGAAATAAGCCTGCGGACAGCATGACTTAATTC
+CCGAGCTTGTTCCTGGGATGGCCCCTTCCCTTGATTTCTGTCGTATATGTCGTCGACAAG
+GTCCTTAACAGCATCGGCTTGTTCTTGGGTTGGTGACGGCCCAAGCATCATAATGTAGCT
+GTCATAGTGTCGTCTTTGGACACGAGGTGGTATTGGCTGGGACCAATCGTCACCCTTTAA
+CCACATTATGATTTGTATGCCAGTAGGCAATGACTCCTGCTCCATCCAATAGGATACAAA
+GTCATCCACAGTGTACGACTCTTGGATCGAGGCGTTATTGCTATAGATTCTCCGTAACTT
+TGCATCCTTTTGGTTCTTCCGAGCAATCCTCATTGCTAGTTCCGTGTCTTCTTTCGATAT
+TCTTCCTCTTGACATTA
+>gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence--Locus_55_Transcript_1/1_Confidence_0.000_Length_246_hit1_IdMatch=97.98,AligLength=247,E-val=2e-114
+ACAAGTCACCGTCCACTCTATCCTCTCCAACCCACATAACCAACACTTCCCAGAACTTGG
+GCTACGGAGGTGCATTCATGATCCCAGTAACCACAGTTCCTGGGCAAGAATTCCATAACA
+AGGAATTCAGCATTAATGTGGACTCCGTAGGGCCAGTTGACATCTTGTGGTCTGGTCAAA
+TGACTATGCAGGACGAATGGACTGTAACTGCAAATTATCAACCATTGAACATCTCTGGCA
+AGCTAA
+>gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence--Locus_69_Transcript_1/1_Confidence_0.000_Length_164_hit1_IdMatch=99.39,AligLength=164,E-val=3e-77
+CCAGAGGATTGGATGTTATTGACAGGATCCTATCGTAAGAGTAGTCAGACACTTCACTCA
+AGGTCCCTTGGAACCAGACTGCATTGAATGTTCCATTCAGTGCATAAACACCCGCAGGTA
+AGGTGCTGGACTTAATGCTTAGCGAGCCTGAAATCAGTCTGCCA
+>gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence--Locus_65_Transcript_1/1_Confidence_0.000_Length_158_hit1_IdMatch=97.47,AligLength=158,E-val=3e-70
+CTGGCAAGCTAATTGCAAACAGTCTGCGAACCCTAACATGGTCCAACACTGGTGTAGACA
+ATGGCAGCCACTACATGAACATGAACAACCTTAATGTCTCCCTTTTCCATGAGAATCCAC
+CACCTGAACCCGTTGCCGCCATAAAAATAAACATCAAT
+>gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence--Locus_58_Transcript_1/2_Confidence_0.333_Length_476_hit1_IdMatch=99.16,AligLength=476,E-val=0.0
+CCGAGTCTCCTCGGAGATTGCCTTTGCAGCGTTTCTTGGTATCGGTTGGTCCAACTCTTC
+CAGGAATGGGTTCGTGTTCATGAATGGGTTCATGCTCGCGGACCCGGCTGTCCAGTGCGG
+GAGGGTCTGTTTTGGGGTTCTTCTCTTTACGTCTCCCATATCTTTTATCTTTTTGTCCAG
+AGATGTCAGGGTCTTTACTTGAACTAATCCTGGTGAGTTCCCAAGTAGTGGAATCCCAAG
+AGAGTCCGTCAATTGGAGTTTCAGGTTGATGCCAAAAACTTCTCCCACACTGGACCCGAC
+AACGGATCCTGTGAAAGCTGCAAATGGTGCCTTCCCCAAAACTCCACTCTTTAGTAAGTC
+GTCTGCTGCATAAATGGCAAGCTGGTGGGACGTTCCCGTTACCTTGTTTGGTGATGTCGA
+GGATGCGAGTCTTCCTTCTAATAATTGATAGCATGGTAGGAGGATGTAATCGCTTC
+>gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence--Locus_58_Transcript_2/2_Confidence_0.333_Length_368_hit1_IdMatch=99.69,AligLength=323,E-val=3e-163
+GGTCATCCCATATCTTTTATCTTTTTGTCCAGAGATGTCAGGGTCTTTACTTGAACTAAT
+CCTGGTGAGTTCCCAAGTAGTGGAATCCCAAGAGAGTCCGTCAATTGGAGTTTCAGGTTG
+ATGCCAAAAACTTCTCCCACACTGGACCCGACAACGGATCCTGTGAAAGCTGCAAATGGT
+GCCTTCCCCAAAACTCCACTCTTTAGTAAGTCGTCTGCTGCATAAATGGCAAGCTGGTGG
+GACGTTCCCGTTACCTTGTTTGGTGATGTCGAGGATGCGAGTCTTCCTTCTAATAATTGA
+TAGCATGGTAGGAGGATGTAATCGCTTC
+>gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence--Locus_66_Transcript_1/2_Confidence_0.333_Length_255_hit1_IdMatch=98.43,AligLength=255,E-val=1e-122
+GTACATGCATGTACTGACGAACTATCATGTCGATGAGAGGGAAGCATCGAGCTTCGATTT
+CTGGCAACTACTGAAACAGATAAAAAATGTTGCTGTGCCCTTGGCAGCCACCCTTGCCCC
+CCAGTTCGCACCAATAATCGGTGCTGCCGATGGGTTAGCCAATGCACTATTGGGTGATAG
+CGCCAGCGGAAGGCCTGTTGGCAATTCCGCTAGCGGTATGCCCATTTCAATGAGTAGGCG
+TCTTAGAAACGCTTA
+>gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence--Locus_62_Transcript_1/1_Confidence_0.000_Length_130_hit1_IdMatch=98.46,AligLength=130,E-val=8e-58
+TGACAAAGTCATTCCATCCGACCCTGAGGAGCTGTATATTGCTGTATCACTAACAGAATC
+CCTCAGGAAGCAGATACCGAACCTCAATGACATGCCATACTATGAGATGGGTGGCTATAG
+GGTGTACAAC
+>gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence--Locus_54_Transcript_1/1_Confidence_0.000_Length_244_hit1_IdMatch=99.59,AligLength=244,E-val=2e-120
+CCGAGGAGACTCGGGATTTGTTTCTATCGGACGGTCAAACCATCCCAAGCTCTCAAGAGA
+AGATTGCCACAATACACGAGTACCTCCTGGAACACAAGGAGTTAGAGGAGGCAATGTTCA
+GCTTGATAAGCCAAGGGAGAGGCCGGTCTCTTATCAACATGGTAGTAAAAAGCGCTCTGA
+ACATCGAAACCCAGTCTCGAGAAGTCACCGACGAAAGAAGGCAAAGACTAGAACGAAAAC
+TTCG
+>gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence--Locus_66_Transcript_2/2_Confidence_0.333_Length_167_hit1_IdMatch=97.6,AligLength=167,E-val=4e-75
+GTTGCCGTGCCATTGGCAGCCACCCTTGCCCCCCAGTTCGCACCAATAATCGGTGCTGCC
+GATGGGTTAGCCAATGCACTATTGGGTGATAGCGCCAGCGGAAGGCCTGTTGGCAATTCC
+GCTAGCGGTATGCCCATTTCAATGAGTAGGCGTCTTAGAAACGCTTA
+>gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence--Locus_68_Transcript_1/1_Confidence_0.000_Length_211_hit1_IdMatch=99.05,AligLength=211,E-val=1e-101
+TGAAAACTCTTTTAAACCCAGCACAATTTATCTCAGACATTCCTGATGATATAATGATCC
+GACACGTAAACAGGGCCCAGACCATCACCTACAACTTGAAGTCAGGGTCCTCTGGCACCG
+GCCTGATCGTGGTCTATCCAAACACCCCGTCGAGTATTAGCGGCTTCCATTACATATGGG
+ATTCCGCTACCTCGAATTGGGTGTTTGATCA
+>gi|22855187|ref|NC_004177.1|_Drosophila_x_virus_segment_A,_complete_sequence--Locus_59_Transcript_1/1_Confidence_0.000_Length_123_hit1_IdMatch=99.19,AligLength=123,E-val=4e-55
+ATAAACATCAATTATGGAAACAACACCAATGGTGACAGCTCGTTCAGTGTGGACTCATCA
+TTTACCATCAATGTCATTGGGGGCGCCACCATTGGCGTCAACTCTCCAACAGTCGTTGTT
+GGT
+
+>gi|821369836|gb|KP714070.1|_Newfield_virus_putative_replicase_gene,_complete_cds--Locus_2_Transcript_5/5_Confidence_0.000_Length_447_hit1_IdMatch=82.99,AligLength=435,E-val=4e-125
+CTAAATTCTCATCCGGCAATTCCGGTTGATAATACTAAGTATCAGGGAATTCAGATCCAT
+CCTGCATCGAAAAATCAGCAGAAGGGTTATGTTAGCTCAAACAGGATGTTTGGACGAGTC
+CAGAAGTACGACTCCTTACTCACTGTGGGAGCTTCTGTAGCCTTCAGCAGAGATGAGTTG
+CTTGATAGTTATAGGAAATACACCTACTGTTATGGAACGGCTAAAGGATTTGAGAAACGG
+TTAAAAATGCTCACCACTCGCAAGTGCAAACGGCCATATACGCCCAAAGTTGTGGCCAGC
+AAACTTATGAGGTTAATGCCCTGTGGTAGTTTACCTGACTGGCATGAGTTCGAAGATCTC
+TTGTCACAGGTTAAAACAACAGCAGGTGCAAGTGCTGGAGCTCCGTATTTCAAGGAGAAA
+CGCAAGGCATAGAAAGAA
+>gi|821369836|gb|KP714070.1|_Newfield_virus_putative_replicase_gene,_complete_cds--Locus_2_Transcript_1/5_Confidence_0.125_Length_327_hit1_IdMatch=98.56,AligLength=209,E-val=1e-98
+AATCACGAGACAATCTTTGGTTGGATTGTAACGTCCTGACTCGTAGAGGATTTCCCGACC
+ATGAAGTAGCAAACCCAAAACTCTTGATATCTCAACATATGTATACGTAATGGATGCATC
+AAACCCAACTAATTCGTCTGAAAGGTTTACCTTGGAGGACTTGCGGTACGAACATGTGAA
+GAGAAAGCGTCAGGACCTTGCTGCCCTCCATACC
+>gi|821369836|gb|KP714070.1|_Newfield_virus_putative_replicase_gene,_complete_cds--Locus_2_Transcript_2/5_Confidence_0.250_Length_809_hit2_IdMatch=98.56,AligLength=209,E-val=3e-98
+ATTCCGGTATGGAGGGCAGCAAGGTCCTGACGCTTTCTCTTCACATGTTCGTACCGCAAG
+TCCTCCAAGGTAAACCTTTCAGACGAATTAGTTGGGTTTGATGCATCCATTACGTATACA
+TATGTTGAGATATCAAGAGTTTTGGGTTTGCTACTTCATGGTCGGGAAATCCTCTACGAG
+TCAGGACGTTACAATCCAACCAAAGATTGTCTCG
+>gi|821369836|gb|KP714070.1|_Newfield_virus_putative_replicase_gene,_complete_cds--Locus_2_Transcript_2/5_Confidence_0.250_Length_809_hit1_IdMatch=94.55,AligLength=367,E-val=3e-161
+AATCACGAGACAATCTTTGGTTGGATTGTAACGTCCTGACTCGTAGAGGATTTCCCGACC
+ATGAAGTAGCAAACCCAAAACTCTTGATATCTCAACATATGTATACGTAATGGATGCATC
+AAACCCAACTAATTCGTCTGAAAGGTTTACCTTGGAGGACTTGCGGTACGAACATGTGAA
+GAGAAAGCGTCAGGACCTTGCTGCCCTCCATACCATGGCCAAAGCCTCCACACGAACATA
+TGTTGGTGGTGCGCTCCCTGACCGTGACAACATCATGGAGGTGTTCAAACAGTTGGACGC
+AGCTACTCAAGCGGTTGACCCGACACCAATGTCTGACTTCTCATACCTAAATTCTCATCC
+GGCAATTCCGGT
+>gi|821369836|gb|KP714070.1|_Newfield_virus_putative_replicase_gene,_complete_cds--Locus_2_Transcript_3/5_Confidence_0.250_Length_207_hit1_IdMatch=90.76,AligLength=184,E-val=3e-66
+GTCAGGACCTTGCTGCCCTCCATACCATGGCCAAAGCCTCCACACGAACATATGTTGGTG
+GTGCGCTCCCTGACCGTGACAACATCATGGAGGTGTTCAAACAGTTGGACGCAGCTACTC
+AAGCGGTTGACCCGACACCAATGTCTGACTTCTCATACCTAAATTCTCATCCGGCAATTC
+CGGT
+>gi|821369836|gb|KP714070.1|_Newfield_virus_putative_replicase_gene,_complete_cds--Locus_2_Transcript_3/5_Confidence_0.250_Length_207_hit2_IdMatch=100.0,AligLength=26,E-val=7e-04
+ATTCCGGTATGGAGGGCAGCAAGGTCCTGAC
+>gi|821369836|gb|KP714070.1|_Newfield_virus_putative_replicase_gene,_complete_cds--Locus_2_Transcript_4/5_Confidence_0.125_Length_605_hit1_IdMatch=85.4,AligLength=596,E-val=0.0
+GTCAGGACCTTGCTGCCCTCCATACCATGGCCAAAGCCTCCACACGAACATATGTTGGTG
+GTGCGCTCCCTGACCGTGACAACATCATGGAGGTGTTCAAACAGTTGGACGCAGCTACTC
+AAGCGGTTGACCCGACACCAATGTCTGACTTCTCATACCTAAATTCTCATCCGGCAATTC
+CGGTTGATAATACTAAGTATCAGGGAATTCAGATCCATCCTGCATCGAAAAATCAGCAGA
+AGGGTTATGTTAGCTCAAACAGGATGTTTGGACGAGTCCAGAAGTACGACTCCTTACTCA
+CTGTGGGAGCTTCTGTAGCCTTCAGCAGAGATGAGTTGCTTGATAGTTATAGGAAATACA
+CCTACTGTTATGGAACGGCTAAAGGATTTGAGAAACGGTTAAAAATGCTCACCACTCGCA
+AGTGCAAACGGCCATATACGCCCAAAGTTGTGGCCAGCAAACTTATGAGGTTAATGCCCT
+GTGGTAGTTTACCTGACTGGCATGAGTTCGAAGATCTCTTGTCACAGGTTAAAACAACAG
+CAGGTGCAAGTGCTGGAGCTCCGTATTTCAAGGAGAAACGCAAGGCATAGAAAGAA
+
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_51_Transcript_1/1_Confidence_0.500_Length_320_hit1_IdMatch=100.0,AligLength=320,E-val=3e-163
+TCTCTCACGTGTTTTTGTGGACCCGCTCGCAACGACGACAACAATACAAGACCCACTGCG
+TACACTGCGAAAACTGCACCTCACAGCAAGAGATCCTACGATACCACTAGCTGACGCGGC
+TTGCGACCGCGTCGAGGGTTATCTTTGTACCGATGCGCTTACTCCGTTGATATCGGATTA
+CTGCAAAATGGTACTACGGTTATACGGGCCGACTGCCTCCACAGAGGAAGTCAGGAACCA
+ACGTAGAAGCCGGAATAAGGAGAAACCCTACTGGTTAATGTGCGATGGATCATGGCCACA
+GCATCCGCAAGACGTCCATT
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_79_Transcript_1/1_Confidence_1.000_Length_154_hit1_IdMatch=81.21,AligLength=165,E-val=6e-41
+GACCTCATACCTCGAAGGAAGGGCCCCCCGAGGAGGCAAATCAGCACTCGAAGAACGCCT
+CCGAAAGCTGGAGCTCAGCCCCCCACCCGCTAAACCGTAGCTGACTCCTAGGAGCACCTA
+CACCCGTTCTAGCCCGAAAGGG
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_81_Transcript_1/1_Confidence_1.000_Length_155_hit1_IdMatch=75.15,AligLength=169,E-val=2e-34
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGATTAGCGCGA
+GTTTGCTTGGCATCGTTAAGCTTAGGTAACGATTCATCCACGGAGCCCGGCATAACGCCG
+TCTTAATC
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_1_Transcript_5/7_Confidence_0.231_Length_163_hit1_IdMatch=97.25,AligLength=109,E-val=1e-44
+GTAAGCGAAGGAAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCGAAAG
+CTGGAGCTCAGCCACAGCCTTCCAACAACCGGAAGTGACCCCCCACCCGCTAAA
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_72_Transcript_1/1_Confidence_0.000_Length_108_hit1_IdMatch=100.0,AligLength=108,E-val=1e-48
+AAATGATCTCATCTCTGTATTCTGGCCGGAATGCTTGAACCATCGCCTTTTGAGCGATAT
+TTCGTTGCATCCAGCCAGAAACCCGGCCATCAAGGTTGGAAAAATCCG
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_60_Transcript_3/4_Confidence_0.400_Length_168_hit2_IdMatch=100.0,AligLength=34,E-val=3e-08
+TACACGGATCATGGCCACAGCATCCGCAAGACGTCCATT
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_1_Transcript_6/7_Confidence_0.077_Length_216_hit1_IdMatch=100.0,AligLength=26,E-val=8e-04
+GTAAGCGAAGGAAGGGCCCCCGAGGAGGCAA
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_78_Transcript_1/1_Confidence_1.000_Length_154_hit1_IdMatch=78.79,AligLength=165,E-val=2e-35
+GACCTCATACCTCGAAGGAAGGGCCCCCCGAGGAGGCAAATCAGCACTCGAAGAACGCCT
+CCGAAAGCTGGAGCTCAGCCCCCCACCCGCTAAACCGTAGGTGTCTCCTAGGAGCACCCA
+CACACGTTCTAGCCCGAAAGGG
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_82_Transcript_1/1_Confidence_1.000_Length_165_hit1_IdMatch=100.0,AligLength=165,E-val=2e-79
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGCGAGTTTGCTTGGCATCGTTAA
+GCTTAGGTAACGATTCATCCACGGAGCCCGGCATAACGCCGTCTT
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_48_Transcript_1/1_Confidence_0.000_Length_372_hit1_IdMatch=99.73,AligLength=372,E-val=0.0
+ATTGACGCGGCTCACCTCCGATTATCTCGAAAACCGCCCTAAGTTGTAGTTGTTGGGACG
+GCTTGTTCAGACGCTCAATCGTTTCCTCGATTGACAATGGGTCAAGGTTGTTGAAAGGCC
+CGTTCATCAACCGTACGAAAGTGTCGGCGATCCTCGCGATACGGTCGCTTGGTTTCTTGT
+CGTTGGCGACAAAGGTTACCCTGCGTTCAATTGATTCAGACATTGTCTCCCAGCGTTTAA
+TCATTGGCATCATCATACAGTCACTCACGATAGGCAAGGTGTATTGGCGTGCGCTCACTT
+CTGGTACATCTGCGTCACTGGTTACTGGCCAATGGACGCGTGGCATTGTAGGTTTATACA
+CAGTTGGACTAA
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_60_Transcript_3/4_Confidence_0.400_Length_168_hit1_IdMatch=100.0,AligLength=118,E-val=7e-54
+TCCATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATGTCTGGGAGAAGATTACACGT
+GACAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAGACGGCGTTATGCCGGGCTCC
+GTG
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_73_Transcript_1/1_Confidence_0.000_Length_164_hit1_IdMatch=100.0,AligLength=164,E-val=7e-79
+TCGGATAATATCCGGCTTTCCTGACATCCTTTTCATCCTGAAGGTCTCCAGATACACATT
+AGCGTACTCGGATATCGTTCTACATGCCGAGCATAATCAACATTGGTATTATCCTGGAAG
+GAACCCAACTGAGATCGCCGATGGGGTTTGTGAATTTGTCAGTG
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_1_Transcript_7/7_Confidence_0.231_Length_184_hit1_IdMatch=80.89,AligLength=157,E-val=3e-40
+GTAAGCGAAGGAAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCGAAAG
+CTGGAGCTCAGCCCCCCACCCGCTAAACCGTAGCTGACTCCTAGGAGCACCTACACCCGT
+TCTAGCCCGAAAGGG
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_83_Transcript_1/1_Confidence_1.000_Length_196_hit1_IdMatch=99.41,AligLength=169,E-val=7e-80
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGCGAGTTTGCTTGGCATCGTTAA
+GCTTAGGTAACGATTCATCCACGGAGCCCGGCATAACGCCGTCTTAATC
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_60_Transcript_1/4_Confidence_0.600_Length_282_hit1_IdMatch=100.0,AligLength=257,E-val=4e-129
+TCCATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATGTCTGGGAGAAGATTACACGT
+GACAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAGACGGCGTTATGCCGGGCTCC
+GTGGATGAATCGTTACCTAAGCTTAACGATGCCAAGCAAACTCGCGCTAATCCAGGAACT
+TCCCGACCGCATTCAAACGGCGGCGGAAGCAGCAATGGGAATGAGCTATCAGGACGCACC
+GAACAACGTGCGCAGGGACCTC
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_46_Transcript_1/1_Confidence_0.667_Length_178_hit1_IdMatch=98.31,AligLength=178,E-val=4e-82
+CAAGGCAAAGCTAACGGTAAGCCGAATGGTAACATCACTGCTGGAGAAACCCAGCGTGGT
+GGCATACCTCGAAGGAAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCG
+AAAGCTGGAGCTCAGCCACAGCCTTCCAACAACCGGAAGTGACCCCCCACCCGCTAAA
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_49_Transcript_1/1_Confidence_0.000_Length_499_hit1_IdMatch=100.0,AligLength=499,E-val=0.0
+AACCGCCAAACAGTATACTGCGGTATTGTGTAGACGAGTGTTCGATCTGGACAATCAGTC
+CAGGGTCTACAATGGTGGATTTTGTGATAACCGACCTTTTCTAAACCAACTATTCTCAAT
+GGCAGTTGTAAAAACCATTCCTTCCAACTTGTTCGGACGCGGCTGGCGATGAACTCACCA
+GCTTCGCACCAATCCCAAACTGGATGGACCCATGCAGCACCTCCACTAACCTTGTATTCA
+ACCAGGTTGTTCTTGATGGTGAATGGTGAGTCAGCATCAAAGCCACTCACTTTCTTCGGG
+TTGAAGGTGTGTAAAACCACTGGACGCATGTGCTCTAACAGCACATCTGGCTCGGTGACA
+TAATAATCAACATCAACACCAACGATGAAGGCGTCTTCCGCTGGTGTATCATTGCGAAAG
+TCTTGCGCCAGATCACCGACGGCGAAGTGGAAATGGTTCCGCAGTCCAGTGCTGGAATTT
+GGGTTCGGGTTAACTTCAA
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_57_Transcript_1/1_Confidence_0.000_Length_260_hit1_IdMatch=100.0,AligLength=260,E-val=9e-131
+TTAACTTCAAATTTAGATCCTCCTACAGATGTTATAGCCTCGTCGATTAAACGACGGGCG
+GCATCACGTACGGCTCCTGAAACGGCATGCCCGTTGTTAAAGGCACGCTTAGGCGTTACG
+GTACGCAGGCTGTCAAGCGGATAGAAACGTGTTTCTATCGGGGTCTTCGTTTTGTCAATG
+ACAGCCCGTTGCAATGCGCGTGTAACTCGGTTCCCTCCACTCTGGGGATAGGGCGCAATT
+GCCCCATAGCCCCAGAACTT
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_60_Transcript_2/4_Confidence_0.400_Length_217_hit1_IdMatch=100.0,AligLength=167,E-val=2e-80
+TCCATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATGTCTGGGAGAAGATTACACGT
+GACAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAGACGGCGTTATGCCGGGCTCC
+GTGGATGAATCGTTACCTAAGCTTAACGATGCCAAGCAAACTCGCGCTAATC
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_52_Transcript_1/1_Confidence_0.000_Length_112_hit1_IdMatch=98.21,AligLength=112,E-val=4e-48
+TACCATCGAGAAAGAAAAGTTGGATATGCTCTCGGGATTATCCGCCACACAATCTGTCAA
+CGCTAGGCTTATCGGTATGGGGCACAAGGACCCACAGTACACATCTATGATT
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_80_Transcript_1/1_Confidence_1.000_Length_101_hit1_IdMatch=100.0,AligLength=99,E-val=7e-44
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGC
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_60_Transcript_2/4_Confidence_0.400_Length_217_hit3_IdMatch=100.0,AligLength=26,E-val=8e-04
+CTAATCAATGGGAATGAGCTATCAGGACGCA
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_60_Transcript_4/4_Confidence_0.100_Length_204_hit1_IdMatch=99.51,AligLength=204,E-val=7e-99
+GGATCATGGCCACAGCATCCGCAAGACGTCCATTTGATGAAGCAGGTTTTAATCAAGCGT
+ACTAGAATTGACGAAGATCAGGTCGATGCACTCATTGGGCGTTTTGCCGCAATGAAGGAT
+GTCTGGGAGAAGATTACACGTGACAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAA
+GACGGCGTTATGCCGGGCTCCGTG
+>gi|262225309|gb|GQ342965.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA1--Locus_60_Transcript_2/4_Confidence_0.400_Length_217_hit2_IdMatch=100.0,AligLength=26,E-val=8e-04
+GCCACAGCATCCGCAAGACGTCCATT
+
+>gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence--Locus_48_Transcript_1/1_Confidence_0.000_Length_372_hit1_IdMatch=98.12,AligLength=372,E-val=0.0
+ATTGACGCGGCTCACCTCCGATTATCTCGAAAACCGCCCTAAGTTGTAGTTGTTGGGACG
+GCTTGTTCAGACGCTCAATCGTTTCCTCGATTGACAATGGGTCAAGGTTGTTGAAAGGCC
+CGTTCATCAACCGTACGAAAGTGTCGGCGATCCTCGCGATACGGTCGCTTGGTTTCTTGT
+CGTTGGCGACAAAGGTTACCCTGCGTTCAATTGATTCAGACATTGTCTCCCAGCGTTTAA
+TCATTGGCATCATCATACAGTCACTCACGATAGGCAAGGTGTATTGGCGTGCGCTCACTT
+CTGGTACATCTGCGTCACTGGTTACTGGCCAATGGACGCGTGGCATTGTAGGTTTATACA
+CAGTTGGACTAA
+>gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence--Locus_83_Transcript_1/1_Confidence_1.000_Length_196_hit1_IdMatch=97.63,AligLength=169,E-val=4e-76
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGCGAGTTTGCTTGGCATCGTTAA
+GCTTAGGTAACGATTCATCCACGGAGCCCGGCATAACGCCGTCTTAATC
+>gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence--Locus_79_Transcript_1/1_Confidence_1.000_Length_154_hit1_IdMatch=77.58,AligLength=165,E-val=9e-33
+GACCTCATACCTCGAAGGAAGGGCCCCCCGAGGAGGCAAATCAGCACTCGAAGAACGCCT
+CCGAAAGCTGGAGCTCAGCCCCCCACCCGCTAAACCGTAGCTGACTCCTAGGAGCACCTA
+CACCCGTTCTAGCCCGAAAGGG
+>gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence--Locus_49_Transcript_1/1_Confidence_0.000_Length_499_hit1_IdMatch=98.0,AligLength=499,E-val=0.0
+AACCGCCAAACAGTATACTGCGGTATTGTGTAGACGAGTGTTCGATCTGGACAATCAGTC
+CAGGGTCTACAATGGTGGATTTTGTGATAACCGACCTTTTCTAAACCAACTATTCTCAAT
+GGCAGTTGTAAAAACCATTCCTTCCAACTTGTTCGGACGCGGCTGGCGATGAACTCACCA
+GCTTCGCACCAATCCCAAACTGGATGGACCCATGCAGCACCTCCACTAACCTTGTATTCA
+ACCAGGTTGTTCTTGATGGTGAATGGTGAGTCAGCATCAAAGCCACTCACTTTCTTCGGG
+TTGAAGGTGTGTAAAACCACTGGACGCATGTGCTCTAACAGCACATCTGGCTCGGTGACA
+TAATAATCAACATCAACACCAACGATGAAGGCGTCTTCCGCTGGTGTATCATTGCGAAAG
+TCTTGCGCCAGATCACCGACGGCGAAGTGGAAATGGTTCCGCAGTCCAGTGCTGGAATTT
+GGGTTCGGGTTAACTTCAA
+>gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence--Locus_57_Transcript_1/1_Confidence_0.000_Length_260_hit1_IdMatch=98.46,AligLength=260,E-val=2e-125
+TTAACTTCAAATTTAGATCCTCCTACAGATGTTATAGCCTCGTCGATTAAACGACGGGCG
+GCATCACGTACGGCTCCTGAAACGGCATGCCCGTTGTTAAAGGCACGCTTAGGCGTTACG
+GTACGCAGGCTGTCAAGCGGATAGAAACGTGTTTCTATCGGGGTCTTCGTTTTGTCAATG
+ACAGCCCGTTGCAATGCGCGTGTAACTCGGTTCCCTCCACTCTGGGGATAGGGCGCAATT
+GCCCCATAGCCCCAGAACTT
+>gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence--Locus_73_Transcript_1/1_Confidence_0.000_Length_164_hit1_IdMatch=99.39,AligLength=164,E-val=3e-77
+TCGGATAATATCCGGCTTTCCTGACATCCTTTTCATCCTGAAGGTCTCCAGATACACATT
+AGCGTACTCGGATATCGTTCTACATGCCGAGCATAATCAACATTGGTATTATCCTGGAAG
+GAACCCAACTGAGATCGCCGATGGGGTTTGTGAATTTGTCAGTG
+>gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence--Locus_60_Transcript_1/4_Confidence_0.600_Length_282_hit1_IdMatch=98.43,AligLength=255,E-val=1e-122
+CATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATGTCTGGGAGAAGATTACACGTGA
+CAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAGACGGCGTTATGCCGGGCTCCGT
+GGATGAATCGTTACCTAAGCTTAACGATGCCAAGCAAACTCGCGCTAATCCAGGAACTTC
+CCGACCGCATTCAAACGGCGGCGGAAGCAGCAATGGGAATGAGCTATCAGGACGCACCGA
+ACAACGTGCGCAGGGACCTC
+>gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence--Locus_60_Transcript_2/4_Confidence_0.400_Length_217_hit1_IdMatch=98.79,AligLength=165,E-val=1e-76
+CATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATGTCTGGGAGAAGATTACACGTGA
+CAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAGACGGCGTTATGCCGGGCTCCGT
+GGATGAATCGTTACCTAAGCTTAACGATGCCAAGCAAACTCGCGCTAATC
+>gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence--Locus_80_Transcript_1/1_Confidence_1.000_Length_101_hit1_IdMatch=97.98,AligLength=99,E-val=4e-41
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGC
+>gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence--Locus_51_Transcript_1/1_Confidence_0.500_Length_320_hit1_IdMatch=99.06,AligLength=320,E-val=7e-159
+TCTCTCACGTGTTTTTGTGGACCCGCTCGCAACGACGACAACAATACAAGACCCACTGCG
+TACACTGCGAAAACTGCACCTCACAGCAAGAGATCCTACGATACCACTAGCTGACGCGGC
+TTGCGACCGCGTCGAGGGTTATCTTTGTACCGATGCGCTTACTCCGTTGATATCGGATTA
+CTGCAAAATGGTACTACGGTTATACGGGCCGACTGCCTCCACAGAGGAAGTCAGGAACCA
+ACGTAGAAGCCGGAATAAGGAGAAACCCTACTGGTTAATGTGCGATGGATCATGGCCACA
+GCATCCGCAAGACGTCCATT
+>gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence--Locus_78_Transcript_1/1_Confidence_1.000_Length_154_hit1_IdMatch=78.79,AligLength=165,E-val=2e-35
+GACCTCATACCTCGAAGGAAGGGCCCCCCGAGGAGGCAAATCAGCACTCGAAGAACGCCT
+CCGAAAGCTGGAGCTCAGCCCCCCACCCGCTAAACCGTAGGTGTCTCCTAGGAGCACCCA
+CACACGTTCTAGCCCGAAAGGG
+>gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence--Locus_60_Transcript_3/4_Confidence_0.400_Length_168_hit1_IdMatch=99.14,AligLength=116,E-val=3e-51
+CATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATGTCTGGGAGAAGATTACACGTGA
+CAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAGACGGCGTTATGCCGGGCTCCGT
+G
+>gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence--Locus_1_Transcript_5/7_Confidence_0.231_Length_163_hit1_IdMatch=96.33,AligLength=109,E-val=1e-43
+GTAAGCGAAGGAAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCGAAAG
+CTGGAGCTCAGCCACAGCCTTCCAACAACCGGAAGTGACCCCCCACCCGCTAAA
+>gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence--Locus_60_Transcript_2/4_Confidence_0.400_Length_217_hit3_IdMatch=100.0,AligLength=26,E-val=8e-04
+CTAATCAATGGGAATGAGCTATCAGGACGCA
+>gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence--Locus_46_Transcript_1/1_Confidence_0.667_Length_178_hit1_IdMatch=97.19,AligLength=178,E-val=2e-79
+CAAGGCAAAGCTAACGGTAAGCCGAATGGTAACATCACTGCTGGAGAAACCCAGCGTGGT
+GGCATACCTCGAAGGAAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCG
+AAAGCTGGAGCTCAGCCACAGCCTTCCAACAACCGGAAGTGACCCCCCACCCGCTAAA
+>gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence--Locus_1_Transcript_7/7_Confidence_0.231_Length_184_hit1_IdMatch=77.71,AligLength=157,E-val=3e-33
+GTAAGCGAAGGAAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCGAAAG
+CTGGAGCTCAGCCCCCCACCCGCTAAACCGTAGCTGACTCCTAGGAGCACCTACACCCGT
+TCTAGCCCGAAAGGG
+>gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence--Locus_60_Transcript_2/4_Confidence_0.400_Length_217_hit2_IdMatch=100.0,AligLength=26,E-val=8e-04
+GCCACAGCATCCGCAAGACGTCCATT
+>gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence--Locus_81_Transcript_1/1_Confidence_1.000_Length_155_hit1_IdMatch=74.56,AligLength=169,E-val=9e-33
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGATTAGCGCGA
+GTTTGCTTGGCATCGTTAAGCTTAGGTAACGATTCATCCACGGAGCCCGGCATAACGCCG
+TCTTAATC
+>gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence--Locus_72_Transcript_1/1_Confidence_0.000_Length_108_hit1_IdMatch=99.07,AligLength=108,E-val=4e-47
+AAATGATCTCATCTCTGTATTCTGGCCGGAATGCTTGAACCATCGCCTTTTGAGCGATAT
+TTCGTTGCATCCAGCCAGAAACCCGGCCATCAAGGTTGGAAAAATCCG
+>gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence--Locus_82_Transcript_1/1_Confidence_1.000_Length_165_hit1_IdMatch=98.18,AligLength=165,E-val=4e-75
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGCGAGTTTGCTTGGCATCGTTAA
+GCTTAGGTAACGATTCATCCACGGAGCCCGGCATAACGCCGTCTT
+>gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence--Locus_60_Transcript_3/4_Confidence_0.400_Length_168_hit2_IdMatch=100.0,AligLength=34,E-val=3e-08
+TACACGGATCATGGCCACAGCATCCGCAAGACGTCCATT
+>gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence--Locus_52_Transcript_1/1_Confidence_0.000_Length_112_hit1_IdMatch=100.0,AligLength=111,E-val=2e-50
+TACCATCGAGAAAGAAAAGTTGGATATGCTCTCGGGATTATCCGCCACACAATCTGTCAA
+CGCTAGGCTTATCGGTATGGGGCACAAGGACCCACAGTACACATCTATGATT
+>gi|351066201|gb|JF461541.1|_Flock_house_virus_isolate_IP-VIA-022011_segment_RNA1,_complete_sequence--Locus_60_Transcript_4/4_Confidence_0.100_Length_204_hit1_IdMatch=99.02,AligLength=204,E-val=9e-98
+GGATCATGGCCACAGCATCCGCAAGACGTCCATTTGATGAAGCAGGTTTTAATCAAGCGT
+ACTAGAATTGACGAAGATCAGGTCGATGCACTCATTGGGCGTTTTGCCGCAATGAAGGAT
+GTCTGGGAGAAGATTACACGTGACAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAA
+GACGGCGTTATGCCGGGCTCCGTG
+
+>gi|407750681|gb|JX403942.1|_Mosquitoe_x_virus_segment_B,_complete_sequence--Locus_45_Transcript_1/1_Confidence_0.000_Length_631_hit1_IdMatch=68.24,AligLength=595,E-val=6e-43
+TGTAACAATCATGAGTGACATTTTCAATCAACAGGGACTGAAATCCAAATTTTCGAACAT
+TGTCAAGAATGAAGGACAAGGTGACTCGGACATCAGAGAGGTATTCAATGAATTAGCAAG
+ACCTCAAGCCGAAGTTGGCCGAGACATAGAATATTCAGAACTTAGTCAGGCATTAAATGA
+CAATGGCGTTAAAGTCTTTAGACCGCAGCCGTTTGATGAGTTGGTTAATATTCCCTTTAT
+AGAGGCCGCATCTCCTAGAATGATGGCCCTGTACGGGGAACTGTTGGATTCCAAAGACGT
+TTCACTGCCTGTTGGCTCTGGCCTGCACATACCAACCTATAAGCCAGGCCATGAGGTCAC
+CCCACCCCTCCTCACTTTACCTAACTCGCTTTCCTATGAGTACATGCATTACATAGCTAA
+CTCAGCTAATGACACGTGGGACAAGCAGACTTATGAGACCCTTAAAGAACTACTTGTAAC
+TCAAGCTACAAATAGGTTCTCTACTGGTTCCCTACTTGGTCAAGTGAAGAGGGTTGCGGC
+CGGCCAAGATGTGGCATATGGAAGAAAAGGTCACCATAAGAATAAGAGCTT
+>gi|407750681|gb|JX403942.1|_Mosquitoe_x_virus_segment_B,_complete_sequence--Locus_17_Transcript_2/3_Confidence_0.400_Length_2274_hit1_IdMatch=74.16,AligLength=387,E-val=9e-60
+CGGATGTTATCGAGAAGCTGGCCTCAATGACAGGAATTGATTTCAAGGTTGAACTAGTAG
+TGACAAACTTCAGAGAGAAACTAATAGCAGCTTCAAGGCATTCGATCCCTACAAGTAACA
+GGGTTGAACCCAGAACAATTGTAGAGATGGACATGCTGGGCTGGGACGTAACTCACACGG
+AGTTTGGCTTCACACCGGTACTGTCAAAAGAACGACTATTCAAATCAATAGCCTGCCCAC
+AACCACCAAGTAGCACCTTTCAAACGAGCGTGGCAAAACAGGTACACAAGTACATTCAGA
+ATGTAGCTCTGTTGTACGTGGGTGCCTGGGCTTATCCATGCATAGCACAGACCGTAGAGG
+GGTATGCTCTAAATCATTGGAACACTAT
+>gi|407750681|gb|JX403942.1|_Mosquitoe_x_virus_segment_B,_complete_sequence--Locus_43_Transcript_1/1_Confidence_0.000_Length_1002_hit1_IdMatch=70.31,AligLength=458,E-val=2e-45
+ATTCCCTAGAATACAACCGGATAGCATACGTAAGCAAATTGAATGAAGATGACATCACAG
+TTTATGCCAATAAGTACATGGTGTACAGCAGCACCATGTTGTCAAGCCTTCTACCAGACA
+AAGTAGATTGGCCAGAACTGAGATCAATGAACGTCGAGGGCGCATCGGATCCTTATCAAG
+TGAAGGGCTACAAAAAGAAGGAGTTGAAGCCACGGTTTGGTGAGGAGATACTAGACGATG
+AGCCAACTGGCAAGAAGTCATCAACAGAAAAGAGAAGGCTACAGAGGAAAGGCCAAAAAG
+CCAAGTTGCAGAGACAAGCTGCAACAGGCACAACATTTGTTAGAAAACCATTAAATTAAC
+TCCGGGAGGGGGGGGACTAAATCTTGGTAAGGAATAGACCATCCGCCACTGGCTTAAGAA
+CCAGGTCCCTAGCCGTTAGACTAAAAGCAAG
+>gi|407750681|gb|JX403942.1|_Mosquitoe_x_virus_segment_B,_complete_sequence--Locus_47_Transcript_1/1_Confidence_0.000_Length_940_hit1_IdMatch=72.01,AligLength=904,E-val=6e-134
+ATCGTGTGATGGAGTGGCTTGATGAGTACATGCCACTCAGTGATGACGAGCCTGAGATAA
+CCTTATCAAACACCCTTGACTGGCTTGTATACACGCCAGAAGAGGCTGAATTGATGGGGG
+TCCCAGACTCGTTACCAGACATCACACAATCCTCAGCAGCGGGTCTCCCCTGGCTGGGTA
+AGAAGAAGGGCGAAGTTGCCGTATCTGCTCTGATTACGGCGAATATGCTGATAAAAGACG
+TGTCGCAACTTCTGAAAGAAACCCTCTTTACTGGATCCAACAATCCATTGGATCCCAAGA
+AGGAAGGTGTAGCAGAAGTTGCGACAAAGAACCCCAGGAGGGCAGCAGACCAATTCTCCC
+GACAGGTACTCGATAGAATCATTAAAGAGTACTCTTACACAATGATGGGTCTACTTTTCC
+CGAAAGGAGAGCGGTATGCCATAGCTGACCATTTAACCAAGACTAGGAATATTTGGAGCG
+CCAGTTATGTCACACACCTAATCGGGTCAACAATATCAGACCAGCCAGCAAAACGCATGC
+TAAACGTCCTTACATCAACATCAAGGACGCCATCCCTAGCTAAGTTTTCTCCAACTCAGG
+GAGGGATGGAGGCTCTTATTAATATCATCCTCAACGCAACAGATATAGTGGAACTAGTAT
+ACGCTGATAACGCATACATATACTATCCGAACGAAGATATATGGTATAGCATAGACCTAA
+CAAAAGGCGAGGCTAACTGTACACGCGATGTGGCAATGACAACAGCCATGTACCTATTAA
+CAAGAGGTTGGACATCGAAACAGGGTACACCTATATACAATTACACATGGGCATACTTAG
+CCTTGTATGGTATACCATATATGACCGTGGACTCAATTAGTGTATTAAAGAACTTCCAGA
+TAAAG
+>gi|407750681|gb|JX403942.1|_Mosquitoe_x_virus_segment_B,_complete_sequence--Locus_17_Transcript_3/3_Confidence_0.200_Length_456_hit1_IdMatch=73.2,AligLength=459,E-val=4e-68
+GAACAATCATGTATTAACCACTATACTGATGAACAAGTGGTCTGAGATAGGTAAGCCACA
+ACCCTCCCCGGATGTTATCGAGAAGCTGGCCTCAATGACAGGAATTGATTTCAAGGTTGA
+ACTAGTAGTGACAAACTTCAGAGAGAAACTAATAGCAGCTTCAAGGCATTCGATCCCTAC
+AAGTAACAGGGTTGAACCCAGAACAATTGTAGAGATGGACATGCTGGGCTGGGACGTAAC
+TCACACGGAGTTTGGCTTCACACCGGTACTGTCAAAAGAACGACTATTCAAATCAATAGC
+CTGCCCACAACCACCAAGTAGCACCTTTCAAACGAGCGTGGCAAAACAGGTACACAAGTA
+CATTCAGAATGTAGCTCTGTTGTACGTGGGTGCCTGGGCTTATCCATGCATAGCACAGAC
+CGTAGAGGGGTATGCTCTAAATCATTGGAACACTAT
+
+>gi|545716023|gb|KF298272.1|_Culicine-associated_Z_virus_isolate_acc_9.2_segment_B_VP1/RdRp_gene,_co--Locus_43_Transcript_1/1_Confidence_0.000_Length_1002_hit1_IdMatch=70.9,AligLength=457,E-val=8e-50
+ATTCCCTAGAATACAACCGGATAGCATACGTAAGCAAATTGAATGAAGATGACATCACAG
+TTTATGCCAATAAGTACATGGTGTACAGCAGCACCATGTTGTCAAGCCTTCTACCAGACA
+AAGTAGATTGGCCAGAACTGAGATCAATGAACGTCGAGGGCGCATCGGATCCTTATCAAG
+TGAAGGGCTACAAAAAGAAGGAGTTGAAGCCACGGTTTGGTGAGGAGATACTAGACGATG
+AGCCAACTGGCAAGAAGTCATCAACAGAAAAGAGAAGGCTACAGAGGAAAGGCCAAAAAG
+CCAAGTTGCAGAGACAAGCTGCAACAGGCACAACATTTGTTAGAAAACCATTAAATTAAC
+TCCGGGAGGGGGGGGACTAAATCTTGGTAAGGAATAGACCATCCGCCACTGGCTTAAGAA
+CCAGGTCCCTAGCCGTTAGACTAAAAGCAAG
+>gi|545716023|gb|KF298272.1|_Culicine-associated_Z_virus_isolate_acc_9.2_segment_B_VP1/RdRp_gene,_co--Locus_17_Transcript_2/3_Confidence_0.400_Length_2274_hit1_IdMatch=72.22,AligLength=414,E-val=2e-55
+ATGAGATAGGTAAGCCACAACCCTCCCCGGATGTTATCGAGAAGCTGGCCTCAATGACAG
+GAATTGATTTCAAGGTTGAACTAGTAGTGACAAACTTCAGAGAGAAACTAATAGCAGCTT
+CAAGGCATTCGATCCCTACAAGTAACAGGGTTGAACCCAGAACAATTGTAGAGATGGACA
+TGCTGGGCTGGGACGTAACTCACACGGAGTTTGGCTTCACACCGGTACTGTCAAAAGAAC
+GACTATTCAAATCAATAGCCTGCCCACAACCACCAAGTAGCACCTTTCAAACGAGCGTGG
+CAAAACAGGTACACAAGTACATTCAGAATGTAGCTCTGTTGTACGTGGGTGCCTGGGCTT
+ATCCATGCATAGCACAGACCGTAGAGGGGTATGCTCTAAATCATTGGAACACTAT
+>gi|545716023|gb|KF298272.1|_Culicine-associated_Z_virus_isolate_acc_9.2_segment_B_VP1/RdRp_gene,_co--Locus_47_Transcript_1/1_Confidence_0.000_Length_940_hit1_IdMatch=71.43,AligLength=903,E-val=2e-126
+ATCGTGTGATGGAGTGGCTTGATGAGTACATGCCACTCAGTGATGACGAGCCTGAGATAA
+CCTTATCAAACACCCTTGACTGGCTTGTATACACGCCAGAAGAGGCTGAATTGATGGGGG
+TCCCAGACTCGTTACCAGACATCACACAATCCTCAGCAGCGGGTCTCCCCTGGCTGGGTA
+AGAAGAAGGGCGAAGTTGCCGTATCTGCTCTGATTACGGCGAATATGCTGATAAAAGACG
+TGTCGCAACTTCTGAAAGAAACCCTCTTTACTGGATCCAACAATCCATTGGATCCCAAGA
+AGGAAGGTGTAGCAGAAGTTGCGACAAAGAACCCCAGGAGGGCAGCAGACCAATTCTCCC
+GACAGGTACTCGATAGAATCATTAAAGAGTACTCTTACACAATGATGGGTCTACTTTTCC
+CGAAAGGAGAGCGGTATGCCATAGCTGACCATTTAACCAAGACTAGGAATATTTGGAGCG
+CCAGTTATGTCACACACCTAATCGGGTCAACAATATCAGACCAGCCAGCAAAACGCATGC
+TAAACGTCCTTACATCAACATCAAGGACGCCATCCCTAGCTAAGTTTTCTCCAACTCAGG
+GAGGGATGGAGGCTCTTATTAATATCATCCTCAACGCAACAGATATAGTGGAACTAGTAT
+ACGCTGATAACGCATACATATACTATCCGAACGAAGATATATGGTATAGCATAGACCTAA
+CAAAAGGCGAGGCTAACTGTACACGCGATGTGGCAATGACAACAGCCATGTACCTATTAA
+CAAGAGGTTGGACATCGAAACAGGGTACACCTATATACAATTACACATGGGCATACTTAG
+CCTTGTATGGTATACCATATATGACCGTGGACTCAATTAGTGTATTAAAGAACTTCCAGA
+TAAAG
+>gi|545716023|gb|KF298272.1|_Culicine-associated_Z_virus_isolate_acc_9.2_segment_B_VP1/RdRp_gene,_co--Locus_45_Transcript_1/1_Confidence_0.000_Length_631_hit1_IdMatch=68.31,AligLength=590,E-val=6e-49
+ACAATCATGAGTGACATTTTCAATCAACAGGGACTGAAATCCAAATTTTCGAACATTGTC
+AAGAATGAAGGACAAGGTGACTCGGACATCAGAGAGGTATTCAATGAATTAGCAAGACCT
+CAAGCCGAAGTTGGCCGAGACATAGAATATTCAGAACTTAGTCAGGCATTAAATGACAAT
+GGCGTTAAAGTCTTTAGACCGCAGCCGTTTGATGAGTTGGTTAATATTCCCTTTATAGAG
+GCCGCATCTCCTAGAATGATGGCCCTGTACGGGGAACTGTTGGATTCCAAAGACGTTTCA
+CTGCCTGTTGGCTCTGGCCTGCACATACCAACCTATAAGCCAGGCCATGAGGTCACCCCA
+CCCCTCCTCACTTTACCTAACTCGCTTTCCTATGAGTACATGCATTACATAGCTAACTCA
+GCTAATGACACGTGGGACAAGCAGACTTATGAGACCCTTAAAGAACTACTTGTAACTCAA
+GCTACAAATAGGTTCTCTACTGGTTCCCTACTTGGTCAAGTGAAGAGGGTTGCGGCCGGC
+CAAGATGTGGCATATGGAAGAAAAGGTCACCATAAGAATAAGAGCTT
+>gi|545716023|gb|KF298272.1|_Culicine-associated_Z_virus_isolate_acc_9.2_segment_B_VP1/RdRp_gene,_co--Locus_17_Transcript_3/3_Confidence_0.200_Length_456_hit1_IdMatch=72.83,AligLength=460,E-val=2e-67
+GAACAATCATGTATTAACCACTATACTGATGAACAAGTGGTCTGAGATAGGTAAGCCACA
+ACCCTCCCCGGATGTTATCGAGAAGCTGGCCTCAATGACAGGAATTGATTTCAAGGTTGA
+ACTAGTAGTGACAAACTTCAGAGAGAAACTAATAGCAGCTTCAAGGCATTCGATCCCTAC
+AAGTAACAGGGTTGAACCCAGAACAATTGTAGAGATGGACATGCTGGGCTGGGACGTAAC
+TCACACGGAGTTTGGCTTCACACCGGTACTGTCAAAAGAACGACTATTCAAATCAATAGC
+CTGCCCACAACCACCAAGTAGCACCTTTCAAACGAGCGTGGCAAAACAGGTACACAAGTA
+CATTCAGAATGTAGCTCTGTTGTACGTGGGTGCCTGGGCTTATCCATGCATAGCACAGAC
+CGTAGAGGGGTATGCTCTAAATCATTGGAACACTAT
+
+>gi|545716052|gb|KF298283.1|_Culicine-associated_Z_virus_isolate_acc_9.2s_segment_B_VP1/RdRp_gene,_c--Locus_17_Transcript_2/3_Confidence_0.400_Length_2274_hit1_IdMatch=72.22,AligLength=414,E-val=2e-55
+ATGAGATAGGTAAGCCACAACCCTCCCCGGATGTTATCGAGAAGCTGGCCTCAATGACAG
+GAATTGATTTCAAGGTTGAACTAGTAGTGACAAACTTCAGAGAGAAACTAATAGCAGCTT
+CAAGGCATTCGATCCCTACAAGTAACAGGGTTGAACCCAGAACAATTGTAGAGATGGACA
+TGCTGGGCTGGGACGTAACTCACACGGAGTTTGGCTTCACACCGGTACTGTCAAAAGAAC
+GACTATTCAAATCAATAGCCTGCCCACAACCACCAAGTAGCACCTTTCAAACGAGCGTGG
+CAAAACAGGTACACAAGTACATTCAGAATGTAGCTCTGTTGTACGTGGGTGCCTGGGCTT
+ATCCATGCATAGCACAGACCGTAGAGGGGTATGCTCTAAATCATTGGAACACTAT
+>gi|545716052|gb|KF298283.1|_Culicine-associated_Z_virus_isolate_acc_9.2s_segment_B_VP1/RdRp_gene,_c--Locus_47_Transcript_1/1_Confidence_0.000_Length_940_hit1_IdMatch=71.43,AligLength=903,E-val=2e-126
+ATCGTGTGATGGAGTGGCTTGATGAGTACATGCCACTCAGTGATGACGAGCCTGAGATAA
+CCTTATCAAACACCCTTGACTGGCTTGTATACACGCCAGAAGAGGCTGAATTGATGGGGG
+TCCCAGACTCGTTACCAGACATCACACAATCCTCAGCAGCGGGTCTCCCCTGGCTGGGTA
+AGAAGAAGGGCGAAGTTGCCGTATCTGCTCTGATTACGGCGAATATGCTGATAAAAGACG
+TGTCGCAACTTCTGAAAGAAACCCTCTTTACTGGATCCAACAATCCATTGGATCCCAAGA
+AGGAAGGTGTAGCAGAAGTTGCGACAAAGAACCCCAGGAGGGCAGCAGACCAATTCTCCC
+GACAGGTACTCGATAGAATCATTAAAGAGTACTCTTACACAATGATGGGTCTACTTTTCC
+CGAAAGGAGAGCGGTATGCCATAGCTGACCATTTAACCAAGACTAGGAATATTTGGAGCG
+CCAGTTATGTCACACACCTAATCGGGTCAACAATATCAGACCAGCCAGCAAAACGCATGC
+TAAACGTCCTTACATCAACATCAAGGACGCCATCCCTAGCTAAGTTTTCTCCAACTCAGG
+GAGGGATGGAGGCTCTTATTAATATCATCCTCAACGCAACAGATATAGTGGAACTAGTAT
+ACGCTGATAACGCATACATATACTATCCGAACGAAGATATATGGTATAGCATAGACCTAA
+CAAAAGGCGAGGCTAACTGTACACGCGATGTGGCAATGACAACAGCCATGTACCTATTAA
+CAAGAGGTTGGACATCGAAACAGGGTACACCTATATACAATTACACATGGGCATACTTAG
+CCTTGTATGGTATACCATATATGACCGTGGACTCAATTAGTGTATTAAAGAACTTCCAGA
+TAAAG
+>gi|545716052|gb|KF298283.1|_Culicine-associated_Z_virus_isolate_acc_9.2s_segment_B_VP1/RdRp_gene,_c--Locus_17_Transcript_3/3_Confidence_0.200_Length_456_hit1_IdMatch=72.83,AligLength=460,E-val=2e-67
+GAACAATCATGTATTAACCACTATACTGATGAACAAGTGGTCTGAGATAGGTAAGCCACA
+ACCCTCCCCGGATGTTATCGAGAAGCTGGCCTCAATGACAGGAATTGATTTCAAGGTTGA
+ACTAGTAGTGACAAACTTCAGAGAGAAACTAATAGCAGCTTCAAGGCATTCGATCCCTAC
+AAGTAACAGGGTTGAACCCAGAACAATTGTAGAGATGGACATGCTGGGCTGGGACGTAAC
+TCACACGGAGTTTGGCTTCACACCGGTACTGTCAAAAGAACGACTATTCAAATCAATAGC
+CTGCCCACAACCACCAAGTAGCACCTTTCAAACGAGCGTGGCAAAACAGGTACACAAGTA
+CATTCAGAATGTAGCTCTGTTGTACGTGGGTGCCTGGGCTTATCCATGCATAGCACAGAC
+CGTAGAGGGGTATGCTCTAAATCATTGGAACACTAT
+>gi|545716052|gb|KF298283.1|_Culicine-associated_Z_virus_isolate_acc_9.2s_segment_B_VP1/RdRp_gene,_c--Locus_43_Transcript_1/1_Confidence_0.000_Length_1002_hit1_IdMatch=70.3,AligLength=404,E-val=4e-41
+ATTCCCTAGAATACAACCGGATAGCATACGTAAGCAAATTGAATGAAGATGACATCACAG
+TTTATGCCAATAAGTACATGGTGTACAGCAGCACCATGTTGTCAAGCCTTCTACCAGACA
+AAGTAGATTGGCCAGAACTGAGATCAATGAACGTCGAGGGCGCATCGGATCCTTATCAAG
+TGAAGGGCTACAAAAAGAAGGAGTTGAAGCCACGGTTTGGTGAGGAGATACTAGACGATG
+AGCCAACTGGCAAGAAGTCATCAACAGAAAAGAGAAGGCTACAGAGGAAAGGCCAAAAAG
+CCAAGTTGCAGAGACAAGCTGCAACAGGCACAACATTTGTTAGAAAACCATTAAATTAAC
+TCCGGGAGGGGGGGGACTAAATCTTGGTAAGGAATAGACC
+>gi|545716052|gb|KF298283.1|_Culicine-associated_Z_virus_isolate_acc_9.2s_segment_B_VP1/RdRp_gene,_c--Locus_45_Transcript_1/1_Confidence_0.000_Length_631_hit1_IdMatch=68.31,AligLength=590,E-val=6e-49
+ACAATCATGAGTGACATTTTCAATCAACAGGGACTGAAATCCAAATTTTCGAACATTGTC
+AAGAATGAAGGACAAGGTGACTCGGACATCAGAGAGGTATTCAATGAATTAGCAAGACCT
+CAAGCCGAAGTTGGCCGAGACATAGAATATTCAGAACTTAGTCAGGCATTAAATGACAAT
+GGCGTTAAAGTCTTTAGACCGCAGCCGTTTGATGAGTTGGTTAATATTCCCTTTATAGAG
+GCCGCATCTCCTAGAATGATGGCCCTGTACGGGGAACTGTTGGATTCCAAAGACGTTTCA
+CTGCCTGTTGGCTCTGGCCTGCACATACCAACCTATAAGCCAGGCCATGAGGTCACCCCA
+CCCCTCCTCACTTTACCTAACTCGCTTTCCTATGAGTACATGCATTACATAGCTAACTCA
+GCTAATGACACGTGGGACAAGCAGACTTATGAGACCCTTAAAGAACTACTTGTAACTCAA
+GCTACAAATAGGTTCTCTACTGGTTCCCTACTTGGTCAAGTGAAGAGGGTTGCGGCCGGC
+CAAGATGTGGCATATGGAAGAAAAGGTCACCATAAGAATAAGAGCTT
+
+>gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd--Locus_79_Transcript_1/1_Confidence_1.000_Length_154_hit1_IdMatch=78.18,AligLength=165,E-val=2e-34
+GACCTCATACCTCGAAGGAAGGGCCCCCCGAGGAGGCAAATCAGCACTCGAAGAACGCCT
+CCGAAAGCTGGAGCTCAGCCCCCCACCCGCTAAACCGTAGCTGACTCCTAGGAGCACCTA
+CACCCGTTCTAGCCCGAAAGGG
+>gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd--Locus_60_Transcript_3/4_Confidence_0.400_Length_168_hit1_IdMatch=99.14,AligLength=116,E-val=3e-51
+CATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATGTCTGGGAGAAGATTACACGTGA
+CAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAGACGGCGTTATGCCGGGCTCCGT
+G
+>gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd--Locus_81_Transcript_1/1_Confidence_1.000_Length_155_hit2_IdMatch=90.0,AligLength=50,E-val=6e-10
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTG
+>gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd--Locus_57_Transcript_1/1_Confidence_0.000_Length_260_hit1_IdMatch=95.38,AligLength=260,E-val=2e-114
+TTAACTTCAAATTTAGATCCTCCTACAGATGTTATAGCCTCGTCGATTAAACGACGGGCG
+GCATCACGTACGGCTCCTGAAACGGCATGCCCGTTGTTAAAGGCACGCTTAGGCGTTACG
+GTACGCAGGCTGTCAAGCGGATAGAAACGTGTTTCTATCGGGGTCTTCGTTTTGTCAATG
+ACAGCCCGTTGCAATGCGCGTGTAACTCGGTTCCCTCCACTCTGGGGATAGGGCGCAATT
+GCCCCATAGCCCCAGAACTT
+>gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd--Locus_49_Transcript_1/1_Confidence_0.000_Length_499_hit1_IdMatch=93.59,AligLength=499,E-val=0.0
+AACCGCCAAACAGTATACTGCGGTATTGTGTAGACGAGTGTTCGATCTGGACAATCAGTC
+CAGGGTCTACAATGGTGGATTTTGTGATAACCGACCTTTTCTAAACCAACTATTCTCAAT
+GGCAGTTGTAAAAACCATTCCTTCCAACTTGTTCGGACGCGGCTGGCGATGAACTCACCA
+GCTTCGCACCAATCCCAAACTGGATGGACCCATGCAGCACCTCCACTAACCTTGTATTCA
+ACCAGGTTGTTCTTGATGGTGAATGGTGAGTCAGCATCAAAGCCACTCACTTTCTTCGGG
+TTGAAGGTGTGTAAAACCACTGGACGCATGTGCTCTAACAGCACATCTGGCTCGGTGACA
+TAATAATCAACATCAACACCAACGATGAAGGCGTCTTCCGCTGGTGTATCATTGCGAAAG
+TCTTGCGCCAGATCACCGACGGCGAAGTGGAAATGGTTCCGCAGTCCAGTGCTGGAATTT
+GGGTTCGGGTTAACTTCAA
+>gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd--Locus_1_Transcript_5/7_Confidence_0.231_Length_163_hit1_IdMatch=95.41,AligLength=109,E-val=6e-42
+GTAAGCGAAGGAAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCGAAAG
+CTGGAGCTCAGCCACAGCCTTCCAACAACCGGAAGTGACCCCCCACCCGCTAAA
+>gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd--Locus_60_Transcript_3/4_Confidence_0.400_Length_168_hit2_IdMatch=91.18,AligLength=34,E-val=6e-04
+TACACGGATCATGGCCACAGCATCCGCAAGACGTCCATT
+>gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd--Locus_60_Transcript_2/4_Confidence_0.400_Length_217_hit1_IdMatch=98.18,AligLength=165,E-val=6e-75
+CATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATGTCTGGGAGAAGATTACACGTGA
+CAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAGACGGCGTTATGCCGGGCTCCGT
+GGATGAATCGTTACCTAAGCTTAACGATGCCAAGCAAACTCGCGCTAATC
+>gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd--Locus_82_Transcript_1/1_Confidence_1.000_Length_165_hit1_IdMatch=95.15,AligLength=165,E-val=1e-68
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGCGAGTTTGCTTGGCATCGTTAA
+GCTTAGGTAACGATTCATCCACGGAGCCCGGCATAACGCCGTCTT
+>gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd--Locus_83_Transcript_1/1_Confidence_1.000_Length_196_hit1_IdMatch=94.67,AligLength=169,E-val=5e-69
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGCGAGTTTGCTTGGCATCGTTAA
+GCTTAGGTAACGATTCATCCACGGAGCCCGGCATAACGCCGTCTTAATC
+>gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd--Locus_78_Transcript_1/1_Confidence_1.000_Length_154_hit1_IdMatch=78.18,AligLength=165,E-val=2e-34
+GACCTCATACCTCGAAGGAAGGGCCCCCCGAGGAGGCAAATCAGCACTCGAAGAACGCCT
+CCGAAAGCTGGAGCTCAGCCCCCCACCCGCTAAACCGTAGGTGTCTCCTAGGAGCACCCA
+CACACGTTCTAGCCCGAAAGGG
+>gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd--Locus_60_Transcript_4/4_Confidence_0.100_Length_204_hit1_IdMatch=97.55,AligLength=204,E-val=2e-93
+GGATCATGGCCACAGCATCCGCAAGACGTCCATTTGATGAAGCAGGTTTTAATCAAGCGT
+ACTAGAATTGACGAAGATCAGGTCGATGCACTCATTGGGCGTTTTGCCGCAATGAAGGAT
+GTCTGGGAGAAGATTACACGTGACAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAA
+GACGGCGTTATGCCGGGCTCCGTG
+>gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd--Locus_51_Transcript_1/1_Confidence_0.500_Length_320_hit1_IdMatch=95.31,AligLength=320,E-val=1e-142
+TCTCTCACGTGTTTTTGTGGACCCGCTCGCAACGACGACAACAATACAAGACCCACTGCG
+TACACTGCGAAAACTGCACCTCACAGCAAGAGATCCTACGATACCACTAGCTGACGCGGC
+TTGCGACCGCGTCGAGGGTTATCTTTGTACCGATGCGCTTACTCCGTTGATATCGGATTA
+CTGCAAAATGGTACTACGGTTATACGGGCCGACTGCCTCCACAGAGGAAGTCAGGAACCA
+ACGTAGAAGCCGGAATAAGGAGAAACCCTACTGGTTAATGTGCGATGGATCATGGCCACA
+GCATCCGCAAGACGTCCATT
+>gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd--Locus_1_Transcript_7/7_Confidence_0.231_Length_184_hit1_IdMatch=78.34,AligLength=157,E-val=7e-35
+GTAAGCGAAGGAAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCGAAAG
+CTGGAGCTCAGCCCCCCACCCGCTAAACCGTAGCTGACTCCTAGGAGCACCTACACCCGT
+TCTAGCCCGAAAGGG
+>gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd--Locus_60_Transcript_1/4_Confidence_0.600_Length_282_hit1_IdMatch=96.47,AligLength=255,E-val=2e-115
+CATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATGTCTGGGAGAAGATTACACGTGA
+CAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAGACGGCGTTATGCCGGGCTCCGT
+GGATGAATCGTTACCTAAGCTTAACGATGCCAAGCAAACTCGCGCTAATCCAGGAACTTC
+CCGACCGCATTCAAACGGCGGCGGAAGCAGCAATGGGAATGAGCTATCAGGACGCACCGA
+ACAACGTGCGCAGGGACCTC
+>gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd--Locus_52_Transcript_1/1_Confidence_0.000_Length_112_hit1_IdMatch=97.32,AligLength=112,E-val=2e-46
+TACCATCGAGAAAGAAAAGTTGGATATGCTCTCGGGATTATCCGCCACACAATCTGTCAA
+CGCTAGGCTTATCGGTATGGGGCACAAGGACCCACAGTACACATCTATGATT
+>gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd--Locus_73_Transcript_1/1_Confidence_0.000_Length_164_hit1_IdMatch=96.89,AligLength=161,E-val=3e-70
+TCGGATAATATCCGGCTTTCCTGACATCCTTTTCATCCTGAAGGTCTCCAGATACACATT
+AGCGTACTCGGATATCGTTCTACATGCCGAGCATAATCAACATTGGTATTATCCTGGAAG
+GAACCCAACTGAGATCGCCGATGGGGTTTGTGAATTTGTCAG
+>gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd--Locus_48_Transcript_1/1_Confidence_0.000_Length_372_hit1_IdMatch=95.14,AligLength=370,E-val=7e-166
+ATTGACGCGGCTCACCTCCGATTATCTCGAAAACCGCCCTAAGTTGTAGTTGTTGGGACG
+GCTTGTTCAGACGCTCAATCGTTTCCTCGATTGACAATGGGTCAAGGTTGTTGAAAGGCC
+CGTTCATCAACCGTACGAAAGTGTCGGCGATCCTCGCGATACGGTCGCTTGGTTTCTTGT
+CGTTGGCGACAAAGGTTACCCTGCGTTCAATTGATTCAGACATTGTCTCCCAGCGTTTAA
+TCATTGGCATCATCATACAGTCACTCACGATAGGCAAGGTGTATTGGCGTGCGCTCACTT
+CTGGTACATCTGCGTCACTGGTTACTGGCCAATGGACGCGTGGCATTGTAGGTTTATACA
+CAGTTGGACT
+>gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd--Locus_81_Transcript_1/1_Confidence_1.000_Length_155_hit1_IdMatch=96.2,AligLength=79,E-val=2e-28
+CCATTGATTAGCGCGAGTTTGCTTGGCATCGTTAAGCTTAGGTAACGATTCATCCACGGA
+GCCCGGCATAACGCCGTCTTAATC
+>gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd--Locus_72_Transcript_1/1_Confidence_0.000_Length_108_hit1_IdMatch=93.52,AligLength=108,E-val=6e-39
+AAATGATCTCATCTCTGTATTCTGGCCGGAATGCTTGAACCATCGCCTTTTGAGCGATAT
+TTCGTTGCATCCAGCCAGAAACCCGGCCATCAAGGTTGGAAAAATCCG
+>gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd--Locus_1_Transcript_6/7_Confidence_0.077_Length_216_hit1_IdMatch=100.0,AligLength=26,E-val=8e-04
+GTAAGCGAAGGAAGGGCCCCCGAGGAGGCAA
+>gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd--Locus_46_Transcript_1/1_Confidence_0.667_Length_178_hit1_IdMatch=96.63,AligLength=178,E-val=3e-78
+CAAGGCAAAGCTAACGGTAAGCCGAATGGTAACATCACTGCTGGAGAAACCCAGCGTGGT
+GGCATACCTCGAAGGAAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCG
+AAAGCTGGAGCTCAGCCACAGCCTTCCAACAACCGGAAGTGACCCCCCACCCGCTAAA
+>gi|152143028|gb|EF690537.1|_Flock_house_virus_isolate_TNCL_segment_RNA1_protein_A_mRNA,_complete_cd--Locus_80_Transcript_1/1_Confidence_1.000_Length_101_hit1_IdMatch=93.94,AligLength=99,E-val=1e-35
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGC
+
+>gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2--Locus_1_Transcript_1/7_Confidence_0.231_Length_224_hit1_IdMatch=98.47,AligLength=196,E-val=9e-92
+CTTTCAGGTACGCTTCCATGAACGTGGGCATTTACCCAACGTCGAACTTGATGCAGTTTA
+CCGGAAGCATAACTGTTTGGAAATGTCCTATAAAGCTGAGCACTGTACAATTCCCGGTTG
+CTACAGAGCAAGCCACCTCTTCACTAGTACACATTCTTGCTGGTTTAAATGGTGTATTAG
+CGGTGGGACCAGACAATT
+>gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2--Locus_1_Transcript_5/7_Confidence_0.231_Length_163_hit1_IdMatch=100.0,AligLength=27,E-val=2e-04
+AATGAGGCGGAATCGCCGTCGTGGACGTGGCA
+>gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2--Locus_1_Transcript_3/7_Confidence_0.231_Length_407_hit2_IdMatch=87.95,AligLength=166,E-val=3e-56
+CAATTCAAACCGGATGCCAACCTAACTGGGCAATTAGGCCACAATAAGCCCAACTTGGTT
+GATGATCGAAACAGTGAGCCCCCTCCCATGTAATGGAAGACGTCGACGCAATCGTGCGAG
+ACGTAATGACAGTTTAAGTCAGCCGACTAAGG
+>gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2--Locus_1_Transcript_2/7_Confidence_0.231_Length_143_hit1_IdMatch=97.44,AligLength=117,E-val=4e-49
+AATGGCCTATAAAGCTGAGCACTGTACAATTCCCGGTTGCTACAGAGCAAGCCACCTCTT
+CACTAGTACACATTCTTGCTGGTTTAAATGGTGTATTAGCGGTGGGACCAGACAATT
+>gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2--Locus_1_Transcript_4/7_Confidence_0.077_Length_591_hit4_IdMatch=85.71,AligLength=42,E-val=7e-04
+CCCTCCCATGTAATGGAAGACGTCGACGCAATCGTGCGAGACGTAAT
+>gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2--Locus_1_Transcript_4/7_Confidence_0.077_Length_591_hit3_IdMatch=87.95,AligLength=166,E-val=5e-56
+CAATTCAAACCGGATGCCAACCTAACTGGGCAATTAGGCCACAATAAGCCCAACTTGGTT
+GATGATCGAAACAGTGAGCCCCCTCCCATGTAATGGAAGACGTCGACGCAATCGTGCGAG
+ACGTAATGACAGTTTAAGTCAGCCGACTAAGG
+>gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2--Locus_1_Transcript_6/7_Confidence_0.077_Length_216_hit1_IdMatch=89.6,AligLength=173,E-val=5e-57
+GTAAACAATTCCAAGTTCCAAATGGTTAACAACATCAAACCAAGACGGCAACGATCCCAA
+CGTGTTGCCGTAACAACAACCCAAACAGCGCCTATTCCACAGCGAAACGTACCACGTAAT
+CGGAGTGAGCCGCGTCAATAATGAGGCGGAATCGCCGTCGTGGACGTGGCA
+>gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2--Locus_1_Transcript_3/7_Confidence_0.231_Length_407_hit3_IdMatch=85.71,AligLength=42,E-val=4e-04
+CCCTCCCATGTAATGGAAGACGTCGACGCAATCGTGCGAGACGTAAT
+>gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2--Locus_1_Transcript_4/7_Confidence_0.077_Length_591_hit2_IdMatch=98.47,AligLength=196,E-val=3e-91
+TGACTTTCAGGTACGCTTCCATGAACGTGGGCATTTACCCAACGTCGAACTTGATGCAGT
+TTACCGGAAGCATAACTGTTTGGAAATGTCCTATAAAGCTGAGCACTGTACAATTCCCGG
+TTGCTACAGAGCAAGCCACCTCTTCACTAGTACACATTCTTGCTGGTTTAAATGGTGTAT
+TAGCGGTGGGACCAGACAATT
+>gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2--Locus_1_Transcript_7/7_Confidence_0.231_Length_184_hit1_IdMatch=100.0,AligLength=27,E-val=2e-04
+AATGAGGCGGAATCGCCGTCGTGGACGTGGCA
+>gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2--Locus_1_Transcript_4/7_Confidence_0.077_Length_591_hit1_IdMatch=91.98,AligLength=262,E-val=4e-101
+GTAAACAATTCCAAGTTCCAAATGGTTAACAACATCAAACCAAGACGGCAACGATCCCAA
+CGTGTTGCCGTAACAACAACCCAAACAGCGCCTATTCCACAGCGAAACGTACCACGTAAT
+CGGAGTGAGCCGCGTCAATAATGAGGCGGAATCGCCGTCGTGTACGTGGCATGAATATGG
+CGGCGCTTTCCCGGCTTAGTCAGCCTGGGTTAGCGTTTCTCAAGTGTGCATTCGCACCAC
+CTGACTTTCAGGTACGCTTC
+>gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2--Locus_1_Transcript_3/7_Confidence_0.231_Length_407_hit1_IdMatch=97.67,AligLength=258,E-val=2e-121
+ATCCGGGCTTTACATCGATGTTCGGTACTACTGCAACATCTAGGTCCGACCAAGTGTCCT
+ATTTCAGGTACGCTTCCATGAACGTGGGCATTTACCCAACGTCGAACTTGATGCAGTTTA
+CCGGAAGCATAACTGTTTGGAAATGTCCTATAAAGCTGAGCACTGTACAATTCCCGGTTG
+CTACAGAGCAAGCCACCTCTTCACTAGTACACATTCTTGCTGGTTTAAATGGTGTATTAG
+CGGTGGGACCAGACAATT
+>gi|262225312|gb|GQ342966.1|_Drosophila_melanogaster_American_nodavirus_(ANV)_SW-2009a_segment_RNA2--Locus_56_Transcript_1/1_Confidence_0.000_Length_450_hit1_IdMatch=100.0,AligLength=448,E-val=0.0
+ACCTTCAAATAAGGCCGACAGTCCACTAATGCCGCTTGCGGCGACACCGATAGGGCCAGG
+AATGTTGCTTGCAGCAGCTAAGGAGGACTTGATGATAGCTTTAACTCTCTCCCACATTGA
+TGCGTTTTGCGCTGCGATGACAGCAACCGGCAAAGATTTGGCAACCGTACGGTATTCTTG
+AAGTGCTACCTCATCAAGAGGTGGCGAGTCATGGCCGAATTGATACAGCATAGCATTAGG
+ATTGGGTCTGTACTCAATGCAAGACCATGCCTTGAGTATGGCGGAGTTGACTGCGCCAGT
+GGGGGCAGAGACACGGATGACAATGGTGTCCATATTACCCCAGCCAACAGTGCCACTGGT
+GTTTTCGTCTCCTGCGGACAAGGTAAACGGTTGGCCCGTAGAACCTATATCCACATTAGA
+TGGTGGCAATGTTTGGATACCCTCCAATAT
+
+>gi|152143030|gb|EF690538.1|_Flock_house_virus_isolate_TNCL_segment_RNA2_protein_alpha_mRNA,_complet--Locus_1_Transcript_4/7_Confidence_0.077_Length_591_hit4_IdMatch=85.42,AligLength=48,E-val=2e-05
+CCCTCCCATGTAATGGAAGACGTCGACGCAATCGTGCGAGACGTAATGACAGT
+>gi|152143030|gb|EF690538.1|_Flock_house_virus_isolate_TNCL_segment_RNA2_protein_alpha_mRNA,_complet--Locus_1_Transcript_2/7_Confidence_0.231_Length_143_hit1_IdMatch=91.45,AligLength=117,E-val=7e-40
+AATGGCCTATAAAGCTGAGCACTGTACAATTCCCGGTTGCTACAGAGCAAGCCACCTCTT
+CACTAGTACACATTCTTGCTGGTTTAAATGGTGTATTAGCGGTGGGACCAGACAATT
+>gi|152143030|gb|EF690538.1|_Flock_house_virus_isolate_TNCL_segment_RNA2_protein_alpha_mRNA,_complet--Locus_1_Transcript_6/7_Confidence_0.077_Length_216_hit1_IdMatch=86.78,AligLength=174,E-val=6e-50
+GTAAACAATTCCAAGTTCCAAATGGTTAACAACATCAAACCAAGACGGCAACGATCCCAA
+CGTGTTGCCGTAACAACAACCCAAACAGCGCCTATTCCACAGCGAAACGTACCACGTAAT
+CGGAGTGAGCCGCGTCAATAATGAGGCGGAATCGCCGTCGTGGACGTGGCA
+>gi|152143030|gb|EF690538.1|_Flock_house_virus_isolate_TNCL_segment_RNA2_protein_alpha_mRNA,_complet--Locus_1_Transcript_3/7_Confidence_0.231_Length_407_hit1_IdMatch=93.02,AligLength=258,E-val=5e-105
+ATCCGGGCTTTACATCGATGTTCGGTACTACTGCAACATCTAGGTCCGACCAAGTGTCCT
+ATTTCAGGTACGCTTCCATGAACGTGGGCATTTACCCAACGTCGAACTTGATGCAGTTTA
+CCGGAAGCATAACTGTTTGGAAATGTCCTATAAAGCTGAGCACTGTACAATTCCCGGTTG
+CTACAGAGCAAGCCACCTCTTCACTAGTACACATTCTTGCTGGTTTAAATGGTGTATTAG
+CGGTGGGACCAGACAATT
+>gi|152143030|gb|EF690538.1|_Flock_house_virus_isolate_TNCL_segment_RNA2_protein_alpha_mRNA,_complet--Locus_1_Transcript_4/7_Confidence_0.077_Length_591_hit1_IdMatch=89.6,AligLength=250,E-val=2e-86
+GTAAACAATTCCAAGTTCCAAATGGTTAACAACATCAAACCAAGACGGCAACGATCCCAA
+CGTGTTGCCGTAACAACAACCCAAACAGCGCCTATTCCACAGCGAAACGTACCACGTAAT
+CGGAGTGAGCCGCGTCAATAATGAGGCGGAATCGCCGTCGTGTACGTGGCATGAATATGG
+CGGCGCTTTCCCGGCTTAGTCAGCCTGGGTTAGCGTTTCTCAAGTGTGCATTCGCACCAC
+CTGACTT
+>gi|152143030|gb|EF690538.1|_Flock_house_virus_isolate_TNCL_segment_RNA2_protein_alpha_mRNA,_complet--Locus_1_Transcript_4/7_Confidence_0.077_Length_591_hit3_IdMatch=94.87,AligLength=78,E-val=4e-26
+AATTCAAACCGGATGCCAACCTAACTGGGCAATTAGGCCACAATAAGCCCAACTTGGTTG
+ATGATCGAAACAGTGAGCCCCCT
+>gi|152143030|gb|EF690538.1|_Flock_house_virus_isolate_TNCL_segment_RNA2_protein_alpha_mRNA,_complet--Locus_1_Transcript_1/7_Confidence_0.231_Length_224_hit1_IdMatch=94.39,AligLength=196,E-val=7e-81
+CTTTCAGGTACGCTTCCATGAACGTGGGCATTTACCCAACGTCGAACTTGATGCAGTTTA
+CCGGAAGCATAACTGTTTGGAAATGTCCTATAAAGCTGAGCACTGTACAATTCCCGGTTG
+CTACAGAGCAAGCCACCTCTTCACTAGTACACATTCTTGCTGGTTTAAATGGTGTATTAG
+CGGTGGGACCAGACAATT
+>gi|152143030|gb|EF690538.1|_Flock_house_virus_isolate_TNCL_segment_RNA2_protein_alpha_mRNA,_complet--Locus_56_Transcript_1/1_Confidence_0.000_Length_450_hit1_IdMatch=96.44,AligLength=450,E-val=0.0
+ACCTTCAAATAAGGCCGACAGTCCACTAATGCCGCTTGCGGCGACACCGATAGGGCCAGG
+AATGTTGCTTGCAGCAGCTAAGGAGGACTTGATGATAGCTTTAACTCTCTCCCACATTGA
+TGCGTTTTGCGCTGCGATGACAGCAACCGGCAAAGATTTGGCAACCGTACGGTATTCTTG
+AAGTGCTACCTCATCAAGAGGTGGCGAGTCATGGCCGAATTGATACAGCATAGCATTAGG
+ATTGGGTCTGTACTCAATGCAAGACCATGCCTTGAGTATGGCGGAGTTGACTGCGCCAGT
+GGGGGCAGAGACACGGATGACAATGGTGTCCATATTACCCCAGCCAACAGTGCCACTGGT
+GTTTTCGTCTCCTGCGGACAAGGTAAACGGTTGGCCCGTAGAACCTATATCCACATTAGA
+TGGTGGCAATGTTTGGATACCCTCCAATAT
+>gi|152143030|gb|EF690538.1|_Flock_house_virus_isolate_TNCL_segment_RNA2_protein_alpha_mRNA,_complet--Locus_1_Transcript_3/7_Confidence_0.231_Length_407_hit2_IdMatch=94.87,AligLength=78,E-val=2e-26
+AATTCAAACCGGATGCCAACCTAACTGGGCAATTAGGCCACAATAAGCCCAACTTGGTTG
+ATGATCGAAACAGTGAGCCCCCT
+>gi|152143030|gb|EF690538.1|_Flock_house_virus_isolate_TNCL_segment_RNA2_protein_alpha_mRNA,_complet--Locus_1_Transcript_3/7_Confidence_0.231_Length_407_hit3_IdMatch=85.42,AligLength=48,E-val=1e-05
+CCCTCCCATGTAATGGAAGACGTCGACGCAATCGTGCGAGACGTAATGACAGT
+>gi|152143030|gb|EF690538.1|_Flock_house_virus_isolate_TNCL_segment_RNA2_protein_alpha_mRNA,_complet--Locus_1_Transcript_4/7_Confidence_0.077_Length_591_hit2_IdMatch=94.39,AligLength=196,E-val=2e-80
+TGACTTTCAGGTACGCTTCCATGAACGTGGGCATTTACCCAACGTCGAACTTGATGCAGT
+TTACCGGAAGCATAACTGTTTGGAAATGTCCTATAAAGCTGAGCACTGTACAATTCCCGG
+TTGCTACAGAGCAAGCCACCTCTTCACTAGTACACATTCTTGCTGGTTTAAATGGTGTAT
+TAGCGGTGGGACCAGACAATT
+
+>gi|351066204|gb|JF461542.1|_Flock_house_virus_isolate_IP-VIA-022011_coat_protein_precursor,_gene,_c--Locus_56_Transcript_1/1_Confidence_0.000_Length_450_hit1_IdMatch=98.0,AligLength=450,E-val=0.0
+ACCTTCAAATAAGGCCGACAGTCCACTAATGCCGCTTGCGGCGACACCGATAGGGCCAGG
+AATGTTGCTTGCAGCAGCTAAGGAGGACTTGATGATAGCTTTAACTCTCTCCCACATTGA
+TGCGTTTTGCGCTGCGATGACAGCAACCGGCAAAGATTTGGCAACCGTACGGTATTCTTG
+AAGTGCTACCTCATCAAGAGGTGGCGAGTCATGGCCGAATTGATACAGCATAGCATTAGG
+ATTGGGTCTGTACTCAATGCAAGACCATGCCTTGAGTATGGCGGAGTTGACTGCGCCAGT
+GGGGGCAGAGACACGGATGACAATGGTGTCCATATTACCCCAGCCAACAGTGCCACTGGT
+GTTTTCGTCTCCTGCGGACAAGGTAAACGGTTGGCCCGTAGAACCTATATCCACATTAGA
+TGGTGGCAATGTTTGGATACCCTCCAATAT
+>gi|351066204|gb|JF461542.1|_Flock_house_virus_isolate_IP-VIA-022011_coat_protein_precursor,_gene,_c--Locus_1_Transcript_4/7_Confidence_0.077_Length_591_hit1_IdMatch=88.89,AligLength=252,E-val=9e-85
+GTAAACAATTCCAAGTTCCAAATGGTTAACAACATCAAACCAAGACGGCAACGATCCCAA
+CGTGTTGCCGTAACAACAACCCAAACAGCGCCTATTCCACAGCGAAACGTACCACGTAAT
+CGGAGTGAGCCGCGTCAATAATGAGGCGGAATCGCCGTCGTGTACGTGGCATGAATATGG
+CGGCGCTTTCCCGGCTTAGTCAGCCTGGGTTAGCGTTTCTCAAGTGTGCATTCGCACCAC
+CTGACTTTCA
+>gi|351066204|gb|JF461542.1|_Flock_house_virus_isolate_IP-VIA-022011_coat_protein_precursor,_gene,_c--Locus_1_Transcript_4/7_Confidence_0.077_Length_591_hit2_IdMatch=95.41,AligLength=196,E-val=4e-83
+TGACTTTCAGGTACGCTTCCATGAACGTGGGCATTTACCCAACGTCGAACTTGATGCAGT
+TTACCGGAAGCATAACTGTTTGGAAATGTCCTATAAAGCTGAGCACTGTACAATTCCCGG
+TTGCTACAGAGCAAGCCACCTCTTCACTAGTACACATTCTTGCTGGTTTAAATGGTGTAT
+TAGCGGTGGGACCAGACAATT
+>gi|351066204|gb|JF461542.1|_Flock_house_virus_isolate_IP-VIA-022011_coat_protein_precursor,_gene,_c--Locus_1_Transcript_4/7_Confidence_0.077_Length_591_hit4_IdMatch=85.71,AligLength=42,E-val=7e-04
+CCCTCCCATGTAATGGAAGACGTCGACGCAATCGTGCGAGACGTAAT
+>gi|351066204|gb|JF461542.1|_Flock_house_virus_isolate_IP-VIA-022011_coat_protein_precursor,_gene,_c--Locus_1_Transcript_4/7_Confidence_0.077_Length_591_hit3_IdMatch=77.08,AligLength=96,E-val=3e-15
+ATTCAAACCGGATGCCAACCTAACTGGGCAATTAGGCCACAATAAGCCCAACTTGGTTGA
+TGATCGAAACAGTGAGCCCCCT
+>gi|351066204|gb|JF461542.1|_Flock_house_virus_isolate_IP-VIA-022011_coat_protein_precursor,_gene,_c--Locus_1_Transcript_2/7_Confidence_0.231_Length_143_hit1_IdMatch=92.31,AligLength=117,E-val=6e-41
+AATGGCCTATAAAGCTGAGCACTGTACAATTCCCGGTTGCTACAGAGCAAGCCACCTCTT
+CACTAGTACACATTCTTGCTGGTTTAAATGGTGTATTAGCGGTGGGACCAGACAATT
+>gi|351066204|gb|JF461542.1|_Flock_house_virus_isolate_IP-VIA-022011_coat_protein_precursor,_gene,_c--Locus_1_Transcript_1/7_Confidence_0.231_Length_224_hit1_IdMatch=95.41,AligLength=196,E-val=1e-83
+CTTTCAGGTACGCTTCCATGAACGTGGGCATTTACCCAACGTCGAACTTGATGCAGTTTA
+CCGGAAGCATAACTGTTTGGAAATGTCCTATAAAGCTGAGCACTGTACAATTCCCGGTTG
+CTACAGAGCAAGCCACCTCTTCACTAGTACACATTCTTGCTGGTTTAAATGGTGTATTAG
+CGGTGGGACCAGACAATT
+>gi|351066204|gb|JF461542.1|_Flock_house_virus_isolate_IP-VIA-022011_coat_protein_precursor,_gene,_c--Locus_1_Transcript_3/7_Confidence_0.231_Length_407_hit2_IdMatch=77.08,AligLength=96,E-val=2e-15
+ATTCAAACCGGATGCCAACCTAACTGGGCAATTAGGCCACAATAAGCCCAACTTGGTTGA
+TGATCGAAACAGTGAGCCCCCT
+>gi|351066204|gb|JF461542.1|_Flock_house_virus_isolate_IP-VIA-022011_coat_protein_precursor,_gene,_c--Locus_1_Transcript_3/7_Confidence_0.231_Length_407_hit1_IdMatch=94.96,AligLength=258,E-val=1e-111
+ATCCGGGCTTTACATCGATGTTCGGTACTACTGCAACATCTAGGTCCGACCAAGTGTCCT
+ATTTCAGGTACGCTTCCATGAACGTGGGCATTTACCCAACGTCGAACTTGATGCAGTTTA
+CCGGAAGCATAACTGTTTGGAAATGTCCTATAAAGCTGAGCACTGTACAATTCCCGGTTG
+CTACAGAGCAAGCCACCTCTTCACTAGTACACATTCTTGCTGGTTTAAATGGTGTATTAG
+CGGTGGGACCAGACAATT
+>gi|351066204|gb|JF461542.1|_Flock_house_virus_isolate_IP-VIA-022011_coat_protein_precursor,_gene,_c--Locus_1_Transcript_6/7_Confidence_0.077_Length_216_hit1_IdMatch=86.13,AligLength=173,E-val=7e-49
+GTAAACAATTCCAAGTTCCAAATGGTTAACAACATCAAACCAAGACGGCAACGATCCCAA
+CGTGTTGCCGTAACAACAACCCAAACAGCGCCTATTCCACAGCGAAACGTACCACGTAAT
+CGGAGTGAGCCGCGTCAATAATGAGGCGGAATCGCCGTCGTGGACGTGGCA
+>gi|351066204|gb|JF461542.1|_Flock_house_virus_isolate_IP-VIA-022011_coat_protein_precursor,_gene,_c--Locus_1_Transcript_3/7_Confidence_0.231_Length_407_hit3_IdMatch=85.71,AligLength=42,E-val=4e-04
+CCCTCCCATGTAATGGAAGACGTCGACGCAATCGTGCGAGACGTAAT
+
+>gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome--Locus_81_Transcript_1/1_Confidence_1.000_Length_155_hit1_IdMatch=87.34,AligLength=79,E-val=3e-19
+CCATTGATTAGCGCGAGTTTGCTTGGCATCGTTAAGCTTAGGTAACGATTCATCCACGGA
+GCCCGGCATAACGCCGTCTTAATC
+>gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome--Locus_80_Transcript_1/1_Confidence_1.000_Length_101_hit1_IdMatch=95.96,AligLength=99,E-val=2e-38
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGC
+>gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome--Locus_78_Transcript_1/1_Confidence_1.000_Length_154_hit1_IdMatch=76.36,AligLength=165,E-val=5e-30
+GACCTCATACCTCGAAGGAAGGGCCCCCCGAGGAGGCAAATCAGCACTCGAAGAACGCCT
+CCGAAAGCTGGAGCTCAGCCCCCCACCCGCTAAACCGTAGGTGTCTCCTAGGAGCACCCA
+CACACGTTCTAGCCCGAAAGGG
+>gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome--Locus_57_Transcript_1/1_Confidence_0.000_Length_260_hit1_IdMatch=93.08,AligLength=260,E-val=2e-106
+TTAACTTCAAATTTAGATCCTCCTACAGATGTTATAGCCTCGTCGATTAAACGACGGGCG
+GCATCACGTACGGCTCCTGAAACGGCATGCCCGTTGTTAAAGGCACGCTTAGGCGTTACG
+GTACGCAGGCTGTCAAGCGGATAGAAACGTGTTTCTATCGGGGTCTTCGTTTTGTCAATG
+ACAGCCCGTTGCAATGCGCGTGTAACTCGGTTCCCTCCACTCTGGGGATAGGGCGCAATT
+GCCCCATAGCCCCAGAACTT
+>gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome--Locus_60_Transcript_4/4_Confidence_0.100_Length_204_hit1_IdMatch=93.14,AligLength=204,E-val=2e-81
+GGATCATGGCCACAGCATCCGCAAGACGTCCATTTGATGAAGCAGGTTTTAATCAAGCGT
+ACTAGAATTGACGAAGATCAGGTCGATGCACTCATTGGGCGTTTTGCCGCAATGAAGGAT
+GTCTGGGAGAAGATTACACGTGACAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAA
+GACGGCGTTATGCCGGGCTCCGTG
+>gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome--Locus_60_Transcript_1/4_Confidence_0.600_Length_282_hit1_IdMatch=93.73,AligLength=255,E-val=3e-106
+CATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATGTCTGGGAGAAGATTACACGTGA
+CAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAGACGGCGTTATGCCGGGCTCCGT
+GGATGAATCGTTACCTAAGCTTAACGATGCCAAGCAAACTCGCGCTAATCCAGGAACTTC
+CCGACCGCATTCAAACGGCGGCGGAAGCAGCAATGGGAATGAGCTATCAGGACGCACCGA
+ACAACGTGCGCAGGGACCTC
+>gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome--Locus_60_Transcript_3/4_Confidence_0.400_Length_168_hit1_IdMatch=93.97,AligLength=116,E-val=5e-43
+CATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATGTCTGGGAGAAGATTACACGTGA
+CAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAGACGGCGTTATGCCGGGCTCCGT
+G
+>gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome--Locus_48_Transcript_1/1_Confidence_0.000_Length_372_hit1_IdMatch=87.63,AligLength=372,E-val=6e-129
+ATTGACGCGGCTCACCTCCGATTATCTCGAAAACCGCCCTAAGTTGTAGTTGTTGGGACG
+GCTTGTTCAGACGCTCAATCGTTTCCTCGATTGACAATGGGTCAAGGTTGTTGAAAGGCC
+CGTTCATCAACCGTACGAAAGTGTCGGCGATCCTCGCGATACGGTCGCTTGGTTTCTTGT
+CGTTGGCGACAAAGGTTACCCTGCGTTCAATTGATTCAGACATTGTCTCCCAGCGTTTAA
+TCATTGGCATCATCATACAGTCACTCACGATAGGCAAGGTGTATTGGCGTGCGCTCACTT
+CTGGTACATCTGCGTCACTGGTTACTGGCCAATGGACGCGTGGCATTGTAGGTTTATACA
+CAGTTGGACTAA
+>gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome--Locus_81_Transcript_1/1_Confidence_1.000_Length_155_hit2_IdMatch=95.83,AligLength=48,E-val=3e-13
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCAT
+>gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome--Locus_60_Transcript_3/4_Confidence_0.400_Length_168_hit2_IdMatch=100.0,AligLength=30,E-val=4e-06
+GTTACACGGATCATGGCCACAGCATCCGCAAGACG
+>gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome--Locus_73_Transcript_1/1_Confidence_0.000_Length_164_hit1_IdMatch=87.73,AligLength=163,E-val=3e-51
+TCGGATAATATCCGGCTTTCCTGACATCCTTTTCATCCTGAAGGTCTCCAGATACACATT
+AGCGTACTCGGATATCGTTCTACATGCCGAGCATAATCAACATTGGTATTATCCTGGAAG
+GAACCCAACTGAGATCGCCGATGGGGTTTGTGAATTTGTCAGTG
+>gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome--Locus_72_Transcript_1/1_Confidence_0.000_Length_108_hit1_IdMatch=89.62,AligLength=106,E-val=2e-32
+AAATGATCTCATCTCTGTATTCTGGCCGGAATGCTTGAACCATCGCCTTTTGAGCGATAT
+TTCGTTGCATCCAGCCAGAAACCCGGCCATCAAGGTTGGAAAAATC
+>gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome--Locus_1_Transcript_7/7_Confidence_0.231_Length_184_hit1_IdMatch=76.28,AligLength=156,E-val=6e-30
+TAAGCGAAGGAAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCGAAAGC
+TGGAGCTCAGCCCCCCACCCGCTAAACCGTAGCTGACTCCTAGGAGCACCTACACCCGTT
+CTAGCCCGAAAGGG
+>gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome--Locus_51_Transcript_1/1_Confidence_0.500_Length_320_hit1_IdMatch=87.46,AligLength=319,E-val=2e-108
+TCTCTCACGTGTTTTTGTGGACCCGCTCGCAACGACGACAACAATACAAGACCCACTGCG
+TACACTGCGAAAACTGCACCTCACAGCAAGAGATCCTACGATACCACTAGCTGACGCGGC
+TTGCGACCGCGTCGAGGGTTATCTTTGTACCGATGCGCTTACTCCGTTGATATCGGATTA
+CTGCAAAATGGTACTACGGTTATACGGGCCGACTGCCTCCACAGAGGAAGTCAGGAACCA
+ACGTAGAAGCCGGAATAAGGAGAAACCCTACTGGTTAATGTGCGATGGATCATGGCCACA
+GCATCCGCAAGACGTCCATT
+>gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome--Locus_49_Transcript_1/1_Confidence_0.000_Length_499_hit1_IdMatch=87.98,AligLength=499,E-val=9e-179
+AACCGCCAAACAGTATACTGCGGTATTGTGTAGACGAGTGTTCGATCTGGACAATCAGTC
+CAGGGTCTACAATGGTGGATTTTGTGATAACCGACCTTTTCTAAACCAACTATTCTCAAT
+GGCAGTTGTAAAAACCATTCCTTCCAACTTGTTCGGACGCGGCTGGCGATGAACTCACCA
+GCTTCGCACCAATCCCAAACTGGATGGACCCATGCAGCACCTCCACTAACCTTGTATTCA
+ACCAGGTTGTTCTTGATGGTGAATGGTGAGTCAGCATCAAAGCCACTCACTTTCTTCGGG
+TTGAAGGTGTGTAAAACCACTGGACGCATGTGCTCTAACAGCACATCTGGCTCGGTGACA
+TAATAATCAACATCAACACCAACGATGAAGGCGTCTTCCGCTGGTGTATCATTGCGAAAG
+TCTTGCGCCAGATCACCGACGGCGAAGTGGAAATGGTTCCGCAGTCCAGTGCTGGAATTT
+GGGTTCGGGTTAACTTCAA
+>gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome--Locus_79_Transcript_1/1_Confidence_1.000_Length_154_hit1_IdMatch=75.76,AligLength=165,E-val=6e-29
+GACCTCATACCTCGAAGGAAGGGCCCCCCGAGGAGGCAAATCAGCACTCGAAGAACGCCT
+CCGAAAGCTGGAGCTCAGCCCCCCACCCGCTAAACCGTAGCTGACTCCTAGGAGCACCTA
+CACCCGTTCTAGCCCGAAAGGG
+>gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome--Locus_83_Transcript_1/1_Confidence_1.000_Length_196_hit1_IdMatch=91.72,AligLength=169,E-val=2e-62
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGCGAGTTTGCTTGGCATCGTTAA
+GCTTAGGTAACGATTCATCCACGGAGCCCGGCATAACGCCGTCTTAATC
+>gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome--Locus_60_Transcript_2/4_Confidence_0.400_Length_217_hit1_IdMatch=92.73,AligLength=165,E-val=5e-63
+CATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATGTCTGGGAGAAGATTACACGTGA
+CAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAGACGGCGTTATGCCGGGCTCCGT
+GGATGAATCGTTACCTAAGCTTAACGATGCCAAGCAAACTCGCGCTAATC
+>gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome--Locus_52_Transcript_1/1_Confidence_0.000_Length_112_hit1_IdMatch=94.64,AligLength=112,E-val=1e-42
+TACCATCGAGAAAGAAAAGTTGGATATGCTCTCGGGATTATCCGCCACACAATCTGTCAA
+CGCTAGGCTTATCGGTATGGGGCACAAGGACCCACAGTACACATCTATGATT
+>gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome--Locus_46_Transcript_1/1_Confidence_0.667_Length_178_hit1_IdMatch=94.94,AligLength=178,E-val=6e-74
+CAAGGCAAAGCTAACGGTAAGCCGAATGGTAACATCACTGCTGGAGAAACCCAGCGTGGT
+GGCATACCTCGAAGGAAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCG
+AAAGCTGGAGCTCAGCCACAGCCTTCCAACAACCGGAAGTGACCCCCCACCCGCTAAA
+>gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome--Locus_1_Transcript_5/7_Confidence_0.231_Length_163_hit1_IdMatch=95.37,AligLength=108,E-val=2e-41
+TAAGCGAAGGAAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCGAAAGC
+TGGAGCTCAGCCACAGCCTTCCAACAACCGGAAGTGACCCCCCACCCGCTAAA
+>gi|51014188|ref|NC_001411.2|_Black_beetle_virus,_complete_genome--Locus_82_Transcript_1/1_Confidence_1.000_Length_165_hit1_IdMatch=92.12,AligLength=165,E-val=2e-61
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGCGAGTTTGCTTGGCATCGTTAA
+GCTTAGGTAACGATTCATCCACGGAGCCCGGCATAACGCCGTCTT
+
+>gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence--Locus_82_Transcript_1/1_Confidence_1.000_Length_165_hit1_IdMatch=92.12,AligLength=165,E-val=2e-61
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGCGAGTTTGCTTGGCATCGTTAA
+GCTTAGGTAACGATTCATCCACGGAGCCCGGCATAACGCCGTCTT
+>gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence--Locus_73_Transcript_1/1_Confidence_0.000_Length_164_hit1_IdMatch=87.12,AligLength=163,E-val=1e-49
+TCGGATAATATCCGGCTTTCCTGACATCCTTTTCATCCTGAAGGTCTCCAGATACACATT
+AGCGTACTCGGATATCGTTCTACATGCCGAGCATAATCAACATTGGTATTATCCTGGAAG
+GAACCCAACTGAGATCGCCGATGGGGTTTGTGAATTTGTCAGTG
+>gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence--Locus_60_Transcript_2/4_Confidence_0.400_Length_217_hit1_IdMatch=92.73,AligLength=165,E-val=5e-63
+CATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATGTCTGGGAGAAGATTACACGTGA
+CAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAGACGGCGTTATGCCGGGCTCCGT
+GGATGAATCGTTACCTAAGCTTAACGATGCCAAGCAAACTCGCGCTAATC
+>gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence--Locus_79_Transcript_1/1_Confidence_1.000_Length_154_hit1_IdMatch=75.76,AligLength=165,E-val=6e-29
+GACCTCATACCTCGAAGGAAGGGCCCCCCGAGGAGGCAAATCAGCACTCGAAGAACGCCT
+CCGAAAGCTGGAGCTCAGCCCCCCACCCGCTAAACCGTAGCTGACTCCTAGGAGCACCTA
+CACCCGTTCTAGCCCGAAAGGG
+>gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence--Locus_1_Transcript_7/7_Confidence_0.231_Length_184_hit1_IdMatch=76.28,AligLength=156,E-val=6e-30
+TAAGCGAAGGAAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCGAAAGC
+TGGAGCTCAGCCCCCCACCCGCTAAACCGTAGCTGACTCCTAGGAGCACCTACACCCGTT
+CTAGCCCGAAAGGG
+>gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence--Locus_1_Transcript_5/7_Confidence_0.231_Length_163_hit1_IdMatch=95.37,AligLength=108,E-val=2e-41
+TAAGCGAAGGAAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCGAAAGC
+TGGAGCTCAGCCACAGCCTTCCAACAACCGGAAGTGACCCCCCACCCGCTAAA
+>gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence--Locus_72_Transcript_1/1_Confidence_0.000_Length_108_hit1_IdMatch=89.62,AligLength=106,E-val=2e-32
+AAATGATCTCATCTCTGTATTCTGGCCGGAATGCTTGAACCATCGCCTTTTGAGCGATAT
+TTCGTTGCATCCAGCCAGAAACCCGGCCATCAAGGTTGGAAAAATC
+>gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence--Locus_60_Transcript_1/4_Confidence_0.600_Length_282_hit1_IdMatch=93.73,AligLength=255,E-val=3e-106
+CATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATGTCTGGGAGAAGATTACACGTGA
+CAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAGACGGCGTTATGCCGGGCTCCGT
+GGATGAATCGTTACCTAAGCTTAACGATGCCAAGCAAACTCGCGCTAATCCAGGAACTTC
+CCGACCGCATTCAAACGGCGGCGGAAGCAGCAATGGGAATGAGCTATCAGGACGCACCGA
+ACAACGTGCGCAGGGACCTC
+>gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence--Locus_49_Transcript_1/1_Confidence_0.000_Length_499_hit1_IdMatch=87.98,AligLength=499,E-val=9e-179
+AACCGCCAAACAGTATACTGCGGTATTGTGTAGACGAGTGTTCGATCTGGACAATCAGTC
+CAGGGTCTACAATGGTGGATTTTGTGATAACCGACCTTTTCTAAACCAACTATTCTCAAT
+GGCAGTTGTAAAAACCATTCCTTCCAACTTGTTCGGACGCGGCTGGCGATGAACTCACCA
+GCTTCGCACCAATCCCAAACTGGATGGACCCATGCAGCACCTCCACTAACCTTGTATTCA
+ACCAGGTTGTTCTTGATGGTGAATGGTGAGTCAGCATCAAAGCCACTCACTTTCTTCGGG
+TTGAAGGTGTGTAAAACCACTGGACGCATGTGCTCTAACAGCACATCTGGCTCGGTGACA
+TAATAATCAACATCAACACCAACGATGAAGGCGTCTTCCGCTGGTGTATCATTGCGAAAG
+TCTTGCGCCAGATCACCGACGGCGAAGTGGAAATGGTTCCGCAGTCCAGTGCTGGAATTT
+GGGTTCGGGTTAACTTCAA
+>gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence--Locus_83_Transcript_1/1_Confidence_1.000_Length_196_hit1_IdMatch=91.72,AligLength=169,E-val=2e-62
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGCGAGTTTGCTTGGCATCGTTAA
+GCTTAGGTAACGATTCATCCACGGAGCCCGGCATAACGCCGTCTTAATC
+>gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence--Locus_81_Transcript_1/1_Confidence_1.000_Length_155_hit1_IdMatch=87.34,AligLength=79,E-val=3e-19
+CCATTGATTAGCGCGAGTTTGCTTGGCATCGTTAAGCTTAGGTAACGATTCATCCACGGA
+GCCCGGCATAACGCCGTCTTAATC
+>gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence--Locus_46_Transcript_1/1_Confidence_0.667_Length_178_hit1_IdMatch=94.94,AligLength=178,E-val=6e-74
+CAAGGCAAAGCTAACGGTAAGCCGAATGGTAACATCACTGCTGGAGAAACCCAGCGTGGT
+GGCATACCTCGAAGGAAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCG
+AAAGCTGGAGCTCAGCCACAGCCTTCCAACAACCGGAAGTGACCCCCCACCCGCTAAA
+>gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence--Locus_78_Transcript_1/1_Confidence_1.000_Length_154_hit1_IdMatch=76.36,AligLength=165,E-val=5e-30
+GACCTCATACCTCGAAGGAAGGGCCCCCCGAGGAGGCAAATCAGCACTCGAAGAACGCCT
+CCGAAAGCTGGAGCTCAGCCCCCCACCCGCTAAACCGTAGGTGTCTCCTAGGAGCACCCA
+CACACGTTCTAGCCCGAAAGGG
+>gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence--Locus_51_Transcript_1/1_Confidence_0.500_Length_320_hit1_IdMatch=87.77,AligLength=319,E-val=2e-109
+TCTCTCACGTGTTTTTGTGGACCCGCTCGCAACGACGACAACAATACAAGACCCACTGCG
+TACACTGCGAAAACTGCACCTCACAGCAAGAGATCCTACGATACCACTAGCTGACGCGGC
+TTGCGACCGCGTCGAGGGTTATCTTTGTACCGATGCGCTTACTCCGTTGATATCGGATTA
+CTGCAAAATGGTACTACGGTTATACGGGCCGACTGCCTCCACAGAGGAAGTCAGGAACCA
+ACGTAGAAGCCGGAATAAGGAGAAACCCTACTGGTTAATGTGCGATGGATCATGGCCACA
+GCATCCGCAAGACGTCCATT
+>gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence--Locus_80_Transcript_1/1_Confidence_1.000_Length_101_hit1_IdMatch=95.96,AligLength=99,E-val=2e-38
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGC
+>gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence--Locus_81_Transcript_1/1_Confidence_1.000_Length_155_hit2_IdMatch=95.83,AligLength=48,E-val=3e-13
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCAT
+>gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence--Locus_60_Transcript_3/4_Confidence_0.400_Length_168_hit2_IdMatch=97.22,AligLength=36,E-val=9e-08
+GTTACACGGATCATGGCCACAGCATCCGCAAGACGTCCATT
+>gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence--Locus_48_Transcript_1/1_Confidence_0.000_Length_372_hit1_IdMatch=87.9,AligLength=372,E-val=5e-130
+ATTGACGCGGCTCACCTCCGATTATCTCGAAAACCGCCCTAAGTTGTAGTTGTTGGGACG
+GCTTGTTCAGACGCTCAATCGTTTCCTCGATTGACAATGGGTCAAGGTTGTTGAAAGGCC
+CGTTCATCAACCGTACGAAAGTGTCGGCGATCCTCGCGATACGGTCGCTTGGTTTCTTGT
+CGTTGGCGACAAAGGTTACCCTGCGTTCAATTGATTCAGACATTGTCTCCCAGCGTTTAA
+TCATTGGCATCATCATACAGTCACTCACGATAGGCAAGGTGTATTGGCGTGCGCTCACTT
+CTGGTACATCTGCGTCACTGGTTACTGGCCAATGGACGCGTGGCATTGTAGGTTTATACA
+CAGTTGGACTAA
+>gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence--Locus_57_Transcript_1/1_Confidence_0.000_Length_260_hit1_IdMatch=91.54,AligLength=260,E-val=6e-101
+TTAACTTCAAATTTAGATCCTCCTACAGATGTTATAGCCTCGTCGATTAAACGACGGGCG
+GCATCACGTACGGCTCCTGAAACGGCATGCCCGTTGTTAAAGGCACGCTTAGGCGTTACG
+GTACGCAGGCTGTCAAGCGGATAGAAACGTGTTTCTATCGGGGTCTTCGTTTTGTCAATG
+ACAGCCCGTTGCAATGCGCGTGTAACTCGGTTCCCTCCACTCTGGGGATAGGGCGCAATT
+GCCCCATAGCCCCAGAACTT
+>gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence--Locus_60_Transcript_3/4_Confidence_0.400_Length_168_hit1_IdMatch=93.97,AligLength=116,E-val=5e-43
+CATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATGTCTGGGAGAAGATTACACGTGA
+CAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAGACGGCGTTATGCCGGGCTCCGT
+G
+>gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence--Locus_52_Transcript_1/1_Confidence_0.000_Length_112_hit1_IdMatch=94.64,AligLength=112,E-val=1e-42
+TACCATCGAGAAAGAAAAGTTGGATATGCTCTCGGGATTATCCGCCACACAATCTGTCAA
+CGCTAGGCTTATCGGTATGGGGCACAAGGACCCACAGTACACATCTATGATT
+>gi|22681055|ref|NC_004146.1|_Flock_house_virus_RNA_1,_complete_sequence--Locus_60_Transcript_4/4_Confidence_0.100_Length_204_hit1_IdMatch=93.63,AligLength=204,E-val=1e-82
+GGATCATGGCCACAGCATCCGCAAGACGTCCATTTGATGAAGCAGGTTTTAATCAAGCGT
+ACTAGAATTGACGAAGATCAGGTCGATGCACTCATTGGGCGTTTTGCCGCAATGAAGGAT
+GTCTGGGAGAAGATTACACGTGACAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAA
+GACGGCGTTATGCCGGGCTCCGTG
+
+>gi|403311045|gb|JQ659255.1|_Culex_Y_virus_isolate_P1-BS2010_segment_B,_complete_sequence--Locus_47_Transcript_1/1_Confidence_0.000_Length_940_hit1_IdMatch=72.35,AligLength=897,E-val=2e-133
+TGGAGTGGCTTGATGAGTACATGCCACTCAGTGATGACGAGCCTGAGATAACCTTATCAA
+ACACCCTTGACTGGCTTGTATACACGCCAGAAGAGGCTGAATTGATGGGGGTCCCAGACT
+CGTTACCAGACATCACACAATCCTCAGCAGCGGGTCTCCCCTGGCTGGGTAAGAAGAAGG
+GCGAAGTTGCCGTATCTGCTCTGATTACGGCGAATATGCTGATAAAAGACGTGTCGCAAC
+TTCTGAAAGAAACCCTCTTTACTGGATCCAACAATCCATTGGATCCCAAGAAGGAAGGTG
+TAGCAGAAGTTGCGACAAAGAACCCCAGGAGGGCAGCAGACCAATTCTCCCGACAGGTAC
+TCGATAGAATCATTAAAGAGTACTCTTACACAATGATGGGTCTACTTTTCCCGAAAGGAG
+AGCGGTATGCCATAGCTGACCATTTAACCAAGACTAGGAATATTTGGAGCGCCAGTTATG
+TCACACACCTAATCGGGTCAACAATATCAGACCAGCCAGCAAAACGCATGCTAAACGTCC
+TTACATCAACATCAAGGACGCCATCCCTAGCTAAGTTTTCTCCAACTCAGGGAGGGATGG
+AGGCTCTTATTAATATCATCCTCAACGCAACAGATATAGTGGAACTAGTATACGCTGATA
+ACGCATACATATACTATCCGAACGAAGATATATGGTATAGCATAGACCTAACAAAAGGCG
+AGGCTAACTGTACACGCGATGTGGCAATGACAACAGCCATGTACCTATTAACAAGAGGTT
+GGACATCGAAACAGGGTACACCTATATACAATTACACATGGGCATACTTAGCCTTGTATG
+GTATACCATATATGACCGTGGACTCAATTAGTGTATTAAAGAACTTCCAGATAAA
+>gi|403311045|gb|JQ659255.1|_Culex_Y_virus_isolate_P1-BS2010_segment_B,_complete_sequence--Locus_17_Transcript_3/3_Confidence_0.200_Length_456_hit1_IdMatch=72.27,AligLength=458,E-val=3e-64
+GAACAATCATGTATTAACCACTATACTGATGAACAAGTGGTCTGAGATAGGTAAGCCACA
+ACCCTCCCCGGATGTTATCGAGAAGCTGGCCTCAATGACAGGAATTGATTTCAAGGTTGA
+ACTAGTAGTGACAAACTTCAGAGAGAAACTAATAGCAGCTTCAAGGCATTCGATCCCTAC
+AAGTAACAGGGTTGAACCCAGAACAATTGTAGAGATGGACATGCTGGGCTGGGACGTAAC
+TCACACGGAGTTTGGCTTCACACCGGTACTGTCAAAAGAACGACTATTCAAATCAATAGC
+CTGCCCACAACCACCAAGTAGCACCTTTCAAACGAGCGTGGCAAAACAGGTACACAAGTA
+CATTCAGAATGTAGCTCTGTTGTACGTGGGTGCCTGGGCTTATCCATGCATAGCACAGAC
+CGTAGAGGGGTATGCTCTAAATCATTGGAACACTAT
+>gi|403311045|gb|JQ659255.1|_Culex_Y_virus_isolate_P1-BS2010_segment_B,_complete_sequence--Locus_45_Transcript_1/1_Confidence_0.000_Length_631_hit1_IdMatch=70.39,AligLength=412,E-val=9e-41
+ATGGCGTTAAAGTCTTTAGACCGCAGCCGTTTGATGAGTTGGTTAATATTCCCTTTATAG
+AGGCCGCATCTCCTAGAATGATGGCCCTGTACGGGGAACTGTTGGATTCCAAAGACGTTT
+CACTGCCTGTTGGCTCTGGCCTGCACATACCAACCTATAAGCCAGGCCATGAGGTCACCC
+CACCCCTCCTCACTTTACCTAACTCGCTTTCCTATGAGTACATGCATTACATAGCTAACT
+CAGCTAATGACACGTGGGACAAGCAGACTTATGAGACCCTTAAAGAACTACTTGTAACTC
+AAGCTACAAATAGGTTCTCTACTGGTTCCCTACTTGGTCAAGTGAAGAGGGTTGCGGCCG
+GCCAAGATGTGGCATATGGAAGAAAAGGTCACCATAAGAATAAGAGCTTTA
+>gi|403311045|gb|JQ659255.1|_Culex_Y_virus_isolate_P1-BS2010_segment_B,_complete_sequence--Locus_43_Transcript_1/1_Confidence_0.000_Length_1002_hit1_IdMatch=70.31,AligLength=458,E-val=2e-44
+ATTCCCTAGAATACAACCGGATAGCATACGTAAGCAAATTGAATGAAGATGACATCACAG
+TTTATGCCAATAAGTACATGGTGTACAGCAGCACCATGTTGTCAAGCCTTCTACCAGACA
+AAGTAGATTGGCCAGAACTGAGATCAATGAACGTCGAGGGCGCATCGGATCCTTATCAAG
+TGAAGGGCTACAAAAAGAAGGAGTTGAAGCCACGGTTTGGTGAGGAGATACTAGACGATG
+AGCCAACTGGCAAGAAGTCATCAACAGAAAAGAGAAGGCTACAGAGGAAAGGCCAAAAAG
+CCAAGTTGCAGAGACAAGCTGCAACAGGCACAACATTTGTTAGAAAACCATTAAATTAAC
+TCCGGGAGGGGGGGGACTAAATCTTGGTAAGGAATAGACCATCCGCCACTGGCTTAAGAA
+CCAGGTCCCTAGCCGTTAGACTAAAAGCAAG
+>gi|403311045|gb|JQ659255.1|_Culex_Y_virus_isolate_P1-BS2010_segment_B,_complete_sequence--Locus_45_Transcript_1/1_Confidence_0.000_Length_631_hit2_IdMatch=83.33,AligLength=48,E-val=2e-04
+GTAACAATCATGAGTGACATTTTCAATCAACAGGGACTGAAATCCAAATTTTC
+>gi|403311045|gb|JQ659255.1|_Culex_Y_virus_isolate_P1-BS2010_segment_B,_complete_sequence--Locus_17_Transcript_2/3_Confidence_0.400_Length_2274_hit1_IdMatch=72.8,AligLength=386,E-val=2e-54
+CGGATGTTATCGAGAAGCTGGCCTCAATGACAGGAATTGATTTCAAGGTTGAACTAGTAG
+TGACAAACTTCAGAGAGAAACTAATAGCAGCTTCAAGGCATTCGATCCCTACAAGTAACA
+GGGTTGAACCCAGAACAATTGTAGAGATGGACATGCTGGGCTGGGACGTAACTCACACGG
+AGTTTGGCTTCACACCGGTACTGTCAAAAGAACGACTATTCAAATCAATAGCCTGCCCAC
+AACCACCAAGTAGCACCTTTCAAACGAGCGTGGCAAAACAGGTACACAAGTACATTCAGA
+ATGTAGCTCTGTTGTACGTGGGTGCCTGGGCTTATCCATGCATAGCACAGACCGTAGAGG
+GGTATGCTCTAAATCATTGGAACACTAT
+
+>gi|365735166|gb|JN589002.1|_Espirito_Santo_virus_segment_B,_complete_sequence--Locus_45_Transcript_1/1_Confidence_0.000_Length_631_hit1_IdMatch=70.15,AligLength=412,E-val=1e-39
+ATGGCGTTAAAGTCTTTAGACCGCAGCCGTTTGATGAGTTGGTTAATATTCCCTTTATAG
+AGGCCGCATCTCCTAGAATGATGGCCCTGTACGGGGAACTGTTGGATTCCAAAGACGTTT
+CACTGCCTGTTGGCTCTGGCCTGCACATACCAACCTATAAGCCAGGCCATGAGGTCACCC
+CACCCCTCCTCACTTTACCTAACTCGCTTTCCTATGAGTACATGCATTACATAGCTAACT
+CAGCTAATGACACGTGGGACAAGCAGACTTATGAGACCCTTAAAGAACTACTTGTAACTC
+AAGCTACAAATAGGTTCTCTACTGGTTCCCTACTTGGTCAAGTGAAGAGGGTTGCGGCCG
+GCCAAGATGTGGCATATGGAAGAAAAGGTCACCATAAGAATAAGAGCTTTA
+>gi|365735166|gb|JN589002.1|_Espirito_Santo_virus_segment_B,_complete_sequence--Locus_47_Transcript_1/1_Confidence_0.000_Length_940_hit1_IdMatch=72.35,AligLength=897,E-val=2e-133
+TGGAGTGGCTTGATGAGTACATGCCACTCAGTGATGACGAGCCTGAGATAACCTTATCAA
+ACACCCTTGACTGGCTTGTATACACGCCAGAAGAGGCTGAATTGATGGGGGTCCCAGACT
+CGTTACCAGACATCACACAATCCTCAGCAGCGGGTCTCCCCTGGCTGGGTAAGAAGAAGG
+GCGAAGTTGCCGTATCTGCTCTGATTACGGCGAATATGCTGATAAAAGACGTGTCGCAAC
+TTCTGAAAGAAACCCTCTTTACTGGATCCAACAATCCATTGGATCCCAAGAAGGAAGGTG
+TAGCAGAAGTTGCGACAAAGAACCCCAGGAGGGCAGCAGACCAATTCTCCCGACAGGTAC
+TCGATAGAATCATTAAAGAGTACTCTTACACAATGATGGGTCTACTTTTCCCGAAAGGAG
+AGCGGTATGCCATAGCTGACCATTTAACCAAGACTAGGAATATTTGGAGCGCCAGTTATG
+TCACACACCTAATCGGGTCAACAATATCAGACCAGCCAGCAAAACGCATGCTAAACGTCC
+TTACATCAACATCAAGGACGCCATCCCTAGCTAAGTTTTCTCCAACTCAGGGAGGGATGG
+AGGCTCTTATTAATATCATCCTCAACGCAACAGATATAGTGGAACTAGTATACGCTGATA
+ACGCATACATATACTATCCGAACGAAGATATATGGTATAGCATAGACCTAACAAAAGGCG
+AGGCTAACTGTACACGCGATGTGGCAATGACAACAGCCATGTACCTATTAACAAGAGGTT
+GGACATCGAAACAGGGTACACCTATATACAATTACACATGGGCATACTTAGCCTTGTATG
+GTATACCATATATGACCGTGGACTCAATTAGTGTATTAAAGAACTTCCAGATAAA
+>gi|365735166|gb|JN589002.1|_Espirito_Santo_virus_segment_B,_complete_sequence--Locus_17_Transcript_3/3_Confidence_0.200_Length_456_hit1_IdMatch=72.27,AligLength=458,E-val=3e-63
+GAACAATCATGTATTAACCACTATACTGATGAACAAGTGGTCTGAGATAGGTAAGCCACA
+ACCCTCCCCGGATGTTATCGAGAAGCTGGCCTCAATGACAGGAATTGATTTCAAGGTTGA
+ACTAGTAGTGACAAACTTCAGAGAGAAACTAATAGCAGCTTCAAGGCATTCGATCCCTAC
+AAGTAACAGGGTTGAACCCAGAACAATTGTAGAGATGGACATGCTGGGCTGGGACGTAAC
+TCACACGGAGTTTGGCTTCACACCGGTACTGTCAAAAGAACGACTATTCAAATCAATAGC
+CTGCCCACAACCACCAAGTAGCACCTTTCAAACGAGCGTGGCAAAACAGGTACACAAGTA
+CATTCAGAATGTAGCTCTGTTGTACGTGGGTGCCTGGGCTTATCCATGCATAGCACAGAC
+CGTAGAGGGGTATGCTCTAAATCATTGGAACACTAT
+>gi|365735166|gb|JN589002.1|_Espirito_Santo_virus_segment_B,_complete_sequence--Locus_43_Transcript_1/1_Confidence_0.000_Length_1002_hit1_IdMatch=70.52,AligLength=458,E-val=2e-45
+ATTCCCTAGAATACAACCGGATAGCATACGTAAGCAAATTGAATGAAGATGACATCACAG
+TTTATGCCAATAAGTACATGGTGTACAGCAGCACCATGTTGTCAAGCCTTCTACCAGACA
+AAGTAGATTGGCCAGAACTGAGATCAATGAACGTCGAGGGCGCATCGGATCCTTATCAAG
+TGAAGGGCTACAAAAAGAAGGAGTTGAAGCCACGGTTTGGTGAGGAGATACTAGACGATG
+AGCCAACTGGCAAGAAGTCATCAACAGAAAAGAGAAGGCTACAGAGGAAAGGCCAAAAAG
+CCAAGTTGCAGAGACAAGCTGCAACAGGCACAACATTTGTTAGAAAACCATTAAATTAAC
+TCCGGGAGGGGGGGGACTAAATCTTGGTAAGGAATAGACCATCCGCCACTGGCTTAAGAA
+CCAGGTCCCTAGCCGTTAGACTAAAAGCAAG
+>gi|365735166|gb|JN589002.1|_Espirito_Santo_virus_segment_B,_complete_sequence--Locus_17_Transcript_2/3_Confidence_0.400_Length_2274_hit1_IdMatch=72.54,AligLength=386,E-val=3e-53
+CGGATGTTATCGAGAAGCTGGCCTCAATGACAGGAATTGATTTCAAGGTTGAACTAGTAG
+TGACAAACTTCAGAGAGAAACTAATAGCAGCTTCAAGGCATTCGATCCCTACAAGTAACA
+GGGTTGAACCCAGAACAATTGTAGAGATGGACATGCTGGGCTGGGACGTAACTCACACGG
+AGTTTGGCTTCACACCGGTACTGTCAAAAGAACGACTATTCAAATCAATAGCCTGCCCAC
+AACCACCAAGTAGCACCTTTCAAACGAGCGTGGCAAAACAGGTACACAAGTACATTCAGA
+ATGTAGCTCTGTTGTACGTGGGTGCCTGGGCTTATCCATGCATAGCACAGACCGTAGAGG
+GGTATGCTCTAAATCATTGGAACACTAT
+>gi|365735166|gb|JN589002.1|_Espirito_Santo_virus_segment_B,_complete_sequence--Locus_45_Transcript_1/1_Confidence_0.000_Length_631_hit2_IdMatch=84.44,AligLength=45,E-val=7e-04
+GTAACAATCATGAGTGACATTTTCAATCAACAGGGACTGAAATCCAAATT
+
+>gi|366091740|ref|NC_016517.1|_Espirito_Santo_virus_segment_B,_complete_genome--Locus_45_Transcript_1/1_Confidence_0.000_Length_631_hit1_IdMatch=70.15,AligLength=412,E-val=1e-39
+ATGGCGTTAAAGTCTTTAGACCGCAGCCGTTTGATGAGTTGGTTAATATTCCCTTTATAG
+AGGCCGCATCTCCTAGAATGATGGCCCTGTACGGGGAACTGTTGGATTCCAAAGACGTTT
+CACTGCCTGTTGGCTCTGGCCTGCACATACCAACCTATAAGCCAGGCCATGAGGTCACCC
+CACCCCTCCTCACTTTACCTAACTCGCTTTCCTATGAGTACATGCATTACATAGCTAACT
+CAGCTAATGACACGTGGGACAAGCAGACTTATGAGACCCTTAAAGAACTACTTGTAACTC
+AAGCTACAAATAGGTTCTCTACTGGTTCCCTACTTGGTCAAGTGAAGAGGGTTGCGGCCG
+GCCAAGATGTGGCATATGGAAGAAAAGGTCACCATAAGAATAAGAGCTTTA
+>gi|366091740|ref|NC_016517.1|_Espirito_Santo_virus_segment_B,_complete_genome--Locus_47_Transcript_1/1_Confidence_0.000_Length_940_hit1_IdMatch=72.35,AligLength=897,E-val=2e-133
+TGGAGTGGCTTGATGAGTACATGCCACTCAGTGATGACGAGCCTGAGATAACCTTATCAA
+ACACCCTTGACTGGCTTGTATACACGCCAGAAGAGGCTGAATTGATGGGGGTCCCAGACT
+CGTTACCAGACATCACACAATCCTCAGCAGCGGGTCTCCCCTGGCTGGGTAAGAAGAAGG
+GCGAAGTTGCCGTATCTGCTCTGATTACGGCGAATATGCTGATAAAAGACGTGTCGCAAC
+TTCTGAAAGAAACCCTCTTTACTGGATCCAACAATCCATTGGATCCCAAGAAGGAAGGTG
+TAGCAGAAGTTGCGACAAAGAACCCCAGGAGGGCAGCAGACCAATTCTCCCGACAGGTAC
+TCGATAGAATCATTAAAGAGTACTCTTACACAATGATGGGTCTACTTTTCCCGAAAGGAG
+AGCGGTATGCCATAGCTGACCATTTAACCAAGACTAGGAATATTTGGAGCGCCAGTTATG
+TCACACACCTAATCGGGTCAACAATATCAGACCAGCCAGCAAAACGCATGCTAAACGTCC
+TTACATCAACATCAAGGACGCCATCCCTAGCTAAGTTTTCTCCAACTCAGGGAGGGATGG
+AGGCTCTTATTAATATCATCCTCAACGCAACAGATATAGTGGAACTAGTATACGCTGATA
+ACGCATACATATACTATCCGAACGAAGATATATGGTATAGCATAGACCTAACAAAAGGCG
+AGGCTAACTGTACACGCGATGTGGCAATGACAACAGCCATGTACCTATTAACAAGAGGTT
+GGACATCGAAACAGGGTACACCTATATACAATTACACATGGGCATACTTAGCCTTGTATG
+GTATACCATATATGACCGTGGACTCAATTAGTGTATTAAAGAACTTCCAGATAAA
+>gi|366091740|ref|NC_016517.1|_Espirito_Santo_virus_segment_B,_complete_genome--Locus_17_Transcript_3/3_Confidence_0.200_Length_456_hit1_IdMatch=72.27,AligLength=458,E-val=3e-63
+GAACAATCATGTATTAACCACTATACTGATGAACAAGTGGTCTGAGATAGGTAAGCCACA
+ACCCTCCCCGGATGTTATCGAGAAGCTGGCCTCAATGACAGGAATTGATTTCAAGGTTGA
+ACTAGTAGTGACAAACTTCAGAGAGAAACTAATAGCAGCTTCAAGGCATTCGATCCCTAC
+AAGTAACAGGGTTGAACCCAGAACAATTGTAGAGATGGACATGCTGGGCTGGGACGTAAC
+TCACACGGAGTTTGGCTTCACACCGGTACTGTCAAAAGAACGACTATTCAAATCAATAGC
+CTGCCCACAACCACCAAGTAGCACCTTTCAAACGAGCGTGGCAAAACAGGTACACAAGTA
+CATTCAGAATGTAGCTCTGTTGTACGTGGGTGCCTGGGCTTATCCATGCATAGCACAGAC
+CGTAGAGGGGTATGCTCTAAATCATTGGAACACTAT
+>gi|366091740|ref|NC_016517.1|_Espirito_Santo_virus_segment_B,_complete_genome--Locus_43_Transcript_1/1_Confidence_0.000_Length_1002_hit1_IdMatch=70.52,AligLength=458,E-val=2e-45
+ATTCCCTAGAATACAACCGGATAGCATACGTAAGCAAATTGAATGAAGATGACATCACAG
+TTTATGCCAATAAGTACATGGTGTACAGCAGCACCATGTTGTCAAGCCTTCTACCAGACA
+AAGTAGATTGGCCAGAACTGAGATCAATGAACGTCGAGGGCGCATCGGATCCTTATCAAG
+TGAAGGGCTACAAAAAGAAGGAGTTGAAGCCACGGTTTGGTGAGGAGATACTAGACGATG
+AGCCAACTGGCAAGAAGTCATCAACAGAAAAGAGAAGGCTACAGAGGAAAGGCCAAAAAG
+CCAAGTTGCAGAGACAAGCTGCAACAGGCACAACATTTGTTAGAAAACCATTAAATTAAC
+TCCGGGAGGGGGGGGACTAAATCTTGGTAAGGAATAGACCATCCGCCACTGGCTTAAGAA
+CCAGGTCCCTAGCCGTTAGACTAAAAGCAAG
+>gi|366091740|ref|NC_016517.1|_Espirito_Santo_virus_segment_B,_complete_genome--Locus_17_Transcript_2/3_Confidence_0.400_Length_2274_hit1_IdMatch=72.54,AligLength=386,E-val=3e-53
+CGGATGTTATCGAGAAGCTGGCCTCAATGACAGGAATTGATTTCAAGGTTGAACTAGTAG
+TGACAAACTTCAGAGAGAAACTAATAGCAGCTTCAAGGCATTCGATCCCTACAAGTAACA
+GGGTTGAACCCAGAACAATTGTAGAGATGGACATGCTGGGCTGGGACGTAACTCACACGG
+AGTTTGGCTTCACACCGGTACTGTCAAAAGAACGACTATTCAAATCAATAGCCTGCCCAC
+AACCACCAAGTAGCACCTTTCAAACGAGCGTGGCAAAACAGGTACACAAGTACATTCAGA
+ATGTAGCTCTGTTGTACGTGGGTGCCTGGGCTTATCCATGCATAGCACAGACCGTAGAGG
+GGTATGCTCTAAATCATTGGAACACTAT
+>gi|366091740|ref|NC_016517.1|_Espirito_Santo_virus_segment_B,_complete_genome--Locus_45_Transcript_1/1_Confidence_0.000_Length_631_hit2_IdMatch=84.44,AligLength=45,E-val=7e-04
+GTAACAATCATGAGTGACATTTTCAATCAACAGGGACTGAAATCCAAATT
+
+>gi|22711883|ref|NC_004144.1|_Flock_house_virus,_complete_genome--Locus_1_Transcript_4/7_Confidence_0.077_Length_591_hit2_IdMatch=83.67,AligLength=251,E-val=1e-64
+GTAAACAATTCCAAGTTCCAAATGGTTAACAACATCAAACCAAGACGGCAACGATCCCAA
+CGTGTTGCCGTAACAACAACCCAAACAGCGCCTATTCCACAGCGAAACGTACCACGTAAT
+CGGAGTGAGCCGCGTCAATAATGAGGCGGAATCGCCGTCGTGTACGTGGCATGAATATGG
+CGGCGCTTTCCCGGCTTAGTCAGCCTGGGTTAGCGTTTCTCAAGTGTGCATTCGCACCAC
+CTGACTT
+>gi|22711883|ref|NC_004144.1|_Flock_house_virus,_complete_genome--Locus_1_Transcript_2/7_Confidence_0.231_Length_143_hit1_IdMatch=83.48,AligLength=115,E-val=3e-26
+AATGGCCTATAAAGCTGAGCACTGTACAATTCCCGGTTGCTACAGAGCAAGCCACCTCTT
+CACTAGTACACATTCTTGCTGGTTTAAATGGTGTATTAGCGGTGGGACCAGACAA
+>gi|22711883|ref|NC_004144.1|_Flock_house_virus,_complete_genome--Locus_1_Transcript_4/7_Confidence_0.077_Length_591_hit1_IdMatch=89.18,AligLength=194,E-val=9e-66
+TGACTTTCAGGTACGCTTCCATGAACGTGGGCATTTACCCAACGTCGAACTTGATGCAGT
+TTACCGGAAGCATAACTGTTTGGAAATGTCCTATAAAGCTGAGCACTGTACAATTCCCGG
+TTGCTACAGAGCAAGCCACCTCTTCACTAGTACACATTCTTGCTGGTTTAAATGGTGTAT
+TAGCGGTGGGACCAGACAA
+>gi|22711883|ref|NC_004144.1|_Flock_house_virus,_complete_genome--Locus_1_Transcript_3/7_Confidence_0.231_Length_407_hit1_IdMatch=88.67,AligLength=256,E-val=9e-89
+ATCCGGGCTTTACATCGATGTTCGGTACTACTGCAACATCTAGGTCCGACCAAGTGTCCT
+ATTTCAGGTACGCTTCCATGAACGTGGGCATTTACCCAACGTCGAACTTGATGCAGTTTA
+CCGGAAGCATAACTGTTTGGAAATGTCCTATAAAGCTGAGCACTGTACAATTCCCGGTTG
+CTACAGAGCAAGCCACCTCTTCACTAGTACACATTCTTGCTGGTTTAAATGGTGTATTAG
+CGGTGGGACCAGACAA
+>gi|22711883|ref|NC_004144.1|_Flock_house_virus,_complete_genome--Locus_1_Transcript_4/7_Confidence_0.077_Length_591_hit3_IdMatch=86.54,AligLength=52,E-val=1e-07
+GGGCAATTAGGCCACAATAAGCCCAACTTGGTTGATGATCGAAACAGTGAGCCCCCT
+>gi|22711883|ref|NC_004144.1|_Flock_house_virus,_complete_genome--Locus_1_Transcript_6/7_Confidence_0.077_Length_216_hit1_IdMatch=84.34,AligLength=166,E-val=4e-39
+GTAAACAATTCCAAGTTCCAAATGGTTAACAACATCAAACCAAGACGGCAACGATCCCAA
+CGTGTTGCCGTAACAACAACCCAAACAGCGCCTATTCCACAGCGAAACGTACCACGTAAT
+CGGAGTGAGCCGCGTCAATAATGAGGCGGAATCGCCGTCGTG
+>gi|22711883|ref|NC_004144.1|_Flock_house_virus,_complete_genome--Locus_56_Transcript_1/1_Confidence_0.000_Length_450_hit1_IdMatch=84.41,AligLength=449,E-val=4e-138
+ACCTTCAAATAAGGCCGACAGTCCACTAATGCCGCTTGCGGCGACACCGATAGGGCCAGG
+AATGTTGCTTGCAGCAGCTAAGGAGGACTTGATGATAGCTTTAACTCTCTCCCACATTGA
+TGCGTTTTGCGCTGCGATGACAGCAACCGGCAAAGATTTGGCAACCGTACGGTATTCTTG
+AAGTGCTACCTCATCAAGAGGTGGCGAGTCATGGCCGAATTGATACAGCATAGCATTAGG
+ATTGGGTCTGTACTCAATGCAAGACCATGCCTTGAGTATGGCGGAGTTGACTGCGCCAGT
+GGGGGCAGAGACACGGATGACAATGGTGTCCATATTACCCCAGCCAACAGTGCCACTGGT
+GTTTTCGTCTCCTGCGGACAAGGTAAACGGTTGGCCCGTAGAACCTATATCCACATTAGA
+TGGTGGCAATGTTTGGATACCCTCCAATAT
+>gi|22711883|ref|NC_004144.1|_Flock_house_virus,_complete_genome--Locus_1_Transcript_3/7_Confidence_0.231_Length_407_hit2_IdMatch=86.54,AligLength=52,E-val=7e-08
+GGGCAATTAGGCCACAATAAGCCCAACTTGGTTGATGATCGAAACAGTGAGCCCCCT
+>gi|22711883|ref|NC_004144.1|_Flock_house_virus,_complete_genome--Locus_1_Transcript_1/7_Confidence_0.231_Length_224_hit1_IdMatch=89.18,AligLength=194,E-val=3e-66
+CTTTCAGGTACGCTTCCATGAACGTGGGCATTTACCCAACGTCGAACTTGATGCAGTTTA
+CCGGAAGCATAACTGTTTGGAAATGTCCTATAAAGCTGAGCACTGTACAATTCCCGGTTG
+CTACAGAGCAAGCCACCTCTTCACTAGTACACATTCTTGCTGGTTTAAATGGTGTATTAG
+CGGTGGGACCAGACAA
+
+>gi|9632343|ref|NC_002037.1|_Black_beetle_virus_RNA_2,_complete_sequence--Locus_1_Transcript_6/7_Confidence_0.077_Length_216_hit1_IdMatch=82.35,AligLength=102,E-val=1e-19
+GTAAACAATTCCAAGTTCCAAATGGTTAACAACATCAAACCAAGACGGCAACGATCCCAA
+CGTGTTGCCGTAACAACAACCCAAACAGCGCCTATTCCACA
+>gi|9632343|ref|NC_002037.1|_Black_beetle_virus_RNA_2,_complete_sequence--Locus_1_Transcript_4/7_Confidence_0.077_Length_591_hit2_IdMatch=75.49,AligLength=253,E-val=4e-38
+GTAAACAATTCCAAGTTCCAAATGGTTAACAACATCAAACCAAGACGGCAACGATCCCAA
+CGTGTTGCCGTAACAACAACCCAAACAGCGCCTATTCCACAGCGAAACGTACCACGTAAT
+CGGAGTGAGCCGCGTCAATAATGAGGCGGAATCGCCGTCGTGTACGTGGCATGAATATGG
+CGGCGCTTTCCCGGCTTAGTCAGCCTGGGTTAGCGTTTCTCAAGTGTGCATTCGCACCAC
+CTGACTTTCA
+>gi|9632343|ref|NC_002037.1|_Black_beetle_virus_RNA_2,_complete_sequence--Locus_1_Transcript_1/7_Confidence_0.231_Length_224_hit1_IdMatch=87.63,AligLength=194,E-val=2e-62
+CTTTCAGGTACGCTTCCATGAACGTGGGCATTTACCCAACGTCGAACTTGATGCAGTTTA
+CCGGAAGCATAACTGTTTGGAAATGTCCTATAAAGCTGAGCACTGTACAATTCCCGGTTG
+CTACAGAGCAAGCCACCTCTTCACTAGTACACATTCTTGCTGGTTTAAATGGTGTATTAG
+CGGTGGGACCAGACAA
+>gi|9632343|ref|NC_002037.1|_Black_beetle_virus_RNA_2,_complete_sequence--Locus_1_Transcript_3/7_Confidence_0.231_Length_407_hit3_IdMatch=96.67,AligLength=30,E-val=4e-04
+ATGGAAGACGTCGACGCAATCGTGCGAGACGTAAT
+>gi|9632343|ref|NC_002037.1|_Black_beetle_virus_RNA_2,_complete_sequence--Locus_1_Transcript_4/7_Confidence_0.077_Length_591_hit4_IdMatch=96.67,AligLength=30,E-val=7e-04
+ATGGAAGACGTCGACGCAATCGTGCGAGACGTAAT
+>gi|9632343|ref|NC_002037.1|_Black_beetle_virus_RNA_2,_complete_sequence--Locus_1_Transcript_2/7_Confidence_0.231_Length_143_hit1_IdMatch=84.35,AligLength=115,E-val=6e-28
+AATGGCCTATAAAGCTGAGCACTGTACAATTCCCGGTTGCTACAGAGCAAGCCACCTCTT
+CACTAGTACACATTCTTGCTGGTTTAAATGGTGTATTAGCGGTGGGACCAGACAA
+>gi|9632343|ref|NC_002037.1|_Black_beetle_virus_RNA_2,_complete_sequence--Locus_1_Transcript_4/7_Confidence_0.077_Length_591_hit1_IdMatch=87.63,AligLength=194,E-val=5e-62
+TGACTTTCAGGTACGCTTCCATGAACGTGGGCATTTACCCAACGTCGAACTTGATGCAGT
+TTACCGGAAGCATAACTGTTTGGAAATGTCCTATAAAGCTGAGCACTGTACAATTCCCGG
+TTGCTACAGAGCAAGCCACCTCTTCACTAGTACACATTCTTGCTGGTTTAAATGGTGTAT
+TAGCGGTGGGACCAGACAA
+>gi|9632343|ref|NC_002037.1|_Black_beetle_virus_RNA_2,_complete_sequence--Locus_1_Transcript_3/7_Confidence_0.231_Length_407_hit1_IdMatch=83.53,AligLength=255,E-val=8e-71
+ATCCGGGCTTTACATCGATGTTCGGTACTACTGCAACATCTAGGTCCGACCAAGTGTCCT
+ATTTCAGGTACGCTTCCATGAACGTGGGCATTTACCCAACGTCGAACTTGATGCAGTTTA
+CCGGAAGCATAACTGTTTGGAAATGTCCTATAAAGCTGAGCACTGTACAATTCCCGGTTG
+CTACAGAGCAAGCCACCTCTTCACTAGTACACATTCTTGCTGGTTTAAATGGTGTATTAG
+CGGTGGGACCAGACAA
+>gi|9632343|ref|NC_002037.1|_Black_beetle_virus_RNA_2,_complete_sequence--Locus_1_Transcript_3/7_Confidence_0.231_Length_407_hit2_IdMatch=90.38,AligLength=52,E-val=1e-10
+GGGCAATTAGGCCACAATAAGCCCAACTTGGTTGATGATCGAAACAGTGAGCCCCCT
+>gi|9632343|ref|NC_002037.1|_Black_beetle_virus_RNA_2,_complete_sequence--Locus_56_Transcript_1/1_Confidence_0.000_Length_450_hit1_IdMatch=77.16,AligLength=451,E-val=6e-92
+ACCTTCAAATAAGGCCGACAGTCCACTAATGCCGCTTGCGGCGACACCGATAGGGCCAGG
+AATGTTGCTTGCAGCAGCTAAGGAGGACTTGATGATAGCTTTAACTCTCTCCCACATTGA
+TGCGTTTTGCGCTGCGATGACAGCAACCGGCAAAGATTTGGCAACCGTACGGTATTCTTG
+AAGTGCTACCTCATCAAGAGGTGGCGAGTCATGGCCGAATTGATACAGCATAGCATTAGG
+ATTGGGTCTGTACTCAATGCAAGACCATGCCTTGAGTATGGCGGAGTTGACTGCGCCAGT
+GGGGGCAGAGACACGGATGACAATGGTGTCCATATTACCCCAGCCAACAGTGCCACTGGT
+GTTTTCGTCTCCTGCGGACAAGGTAAACGGTTGGCCCGTAGAACCTATATCCACATTAGA
+TGGTGGCAATGTTTGGATACCCTCCAATAT
+>gi|9632343|ref|NC_002037.1|_Black_beetle_virus_RNA_2,_complete_sequence--Locus_1_Transcript_4/7_Confidence_0.077_Length_591_hit3_IdMatch=90.38,AligLength=52,E-val=2e-10
+GGGCAATTAGGCCACAATAAGCCCAACTTGGTTGATGATCGAAACAGTGAGCCCCCT
+
+>gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome--Locus_73_Transcript_1/1_Confidence_0.000_Length_164_hit1_IdMatch=75.46,AligLength=163,E-val=5e-24
+TCGGATAATATCCGGCTTTCCTGACATCCTTTTCATCCTGAAGGTCTCCAGATACACATT
+AGCGTACTCGGATATCGTTCTACATGCCGAGCATAATCAACATTGGTATTATCCTGGAAG
+GAACCCAACTGAGATCGCCGATGGGGTTTGTGAATTTGTCAGTG
+>gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome--Locus_49_Transcript_1/1_Confidence_0.000_Length_499_hit1_IdMatch=77.13,AligLength=494,E-val=7e-104
+AACCGCCAAACAGTATACTGCGGTATTGTGTAGACGAGTGTTCGATCTGGACAATCAGTC
+CAGGGTCTACAATGGTGGATTTTGTGATAACCGACCTTTTCTAAACCAACTATTCTCAAT
+GGCAGTTGTAAAAACCATTCCTTCCAACTTGTTCGGACGCGGCTGGCGATGAACTCACCA
+GCTTCGCACCAATCCCAAACTGGATGGACCCATGCAGCACCTCCACTAACCTTGTATTCA
+ACCAGGTTGTTCTTGATGGTGAATGGTGAGTCAGCATCAAAGCCACTCACTTTCTTCGGG
+TTGAAGGTGTGTAAAACCACTGGACGCATGTGCTCTAACAGCACATCTGGCTCGGTGACA
+TAATAATCAACATCAACACCAACGATGAAGGCGTCTTCCGCTGGTGTATCATTGCGAAAG
+TCTTGCGCCAGATCACCGACGGCGAAGTGGAAATGGTTCCGCAGTCCAGTGCTGGAATTT
+GGGTTCGGGTTAACTTCAA
+>gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome--Locus_57_Transcript_1/1_Confidence_0.000_Length_260_hit1_IdMatch=85.1,AligLength=255,E-val=2e-76
+TTAACTTCAAATTTAGATCCTCCTACAGATGTTATAGCCTCGTCGATTAAACGACGGGCG
+GCATCACGTACGGCTCCTGAAACGGCATGCCCGTTGTTAAAGGCACGCTTAGGCGTTACG
+GTACGCAGGCTGTCAAGCGGATAGAAACGTGTTTCTATCGGGGTCTTCGTTTTGTCAATG
+ACAGCCCGTTGCAATGCGCGTGTAACTCGGTTCCCTCCACTCTGGGGATAGGGCGCAATT
+GCCCCATAGCCCCAGAACTT
+>gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome--Locus_60_Transcript_3/4_Confidence_0.400_Length_168_hit1_IdMatch=81.36,AligLength=118,E-val=5e-24
+TCCATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATGTCTGGGAGAAGATTACACGT
+GACAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAGACGGCGTTATGCCGGGCTCC
+GTG
+>gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome--Locus_83_Transcript_1/1_Confidence_1.000_Length_196_hit1_IdMatch=84.62,AligLength=169,E-val=3e-46
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGCGAGTTTGCTTGGCATCGTTAA
+GCTTAGGTAACGATTCATCCACGGAGCCCGGCATAACGCCGTCTTAATC
+>gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome--Locus_81_Transcript_1/1_Confidence_1.000_Length_155_hit2_IdMatch=87.23,AligLength=47,E-val=3e-07
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCA
+>gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome--Locus_46_Transcript_1/1_Confidence_0.667_Length_178_hit1_IdMatch=80.45,AligLength=179,E-val=5e-37
+CAAGGCAAAGCTAACGGTAAGCCGAATGGTAACATCACTGCTGGAGAAACCCAGCGTGGT
+GGCATACCTCGAAGGAAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCG
+AAAGCTGGAGCTCAGCCACAGCCTTCCAACAACCGGAAGTGACCCCCCACCCGCTAAA
+>gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome--Locus_80_Transcript_1/1_Confidence_1.000_Length_101_hit1_IdMatch=83.84,AligLength=99,E-val=4e-22
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGC
+>gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome--Locus_79_Transcript_1/1_Confidence_1.000_Length_154_hit1_IdMatch=80.26,AligLength=76,E-val=2e-08
+GACCTCATACCTCGAAGGAAGGGCCCCCCGAGGAGGCAAATCAGCACTCGAAGAACGCCT
+CCGAAAGCTGGAGCTCAGCC
+>gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome--Locus_60_Transcript_4/4_Confidence_0.100_Length_204_hit1_IdMatch=78.92,AligLength=204,E-val=7e-42
+GGATCATGGCCACAGCATCCGCAAGACGTCCATTTGATGAAGCAGGTTTTAATCAAGCGT
+ACTAGAATTGACGAAGATCAGGTCGATGCACTCATTGGGCGTTTTGCCGCAATGAAGGAT
+GTCTGGGAGAAGATTACACGTGACAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAA
+GACGGCGTTATGCCGGGCTCCGTG
+>gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome--Locus_1_Transcript_7/7_Confidence_0.231_Length_184_hit1_IdMatch=88.0,AligLength=50,E-val=8e-09
+CCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCGAAAGCTGGAGCTCAGCC
+>gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome--Locus_60_Transcript_2/4_Confidence_0.400_Length_217_hit1_IdMatch=83.13,AligLength=166,E-val=8e-42
+TCCATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATGTCTGGGAGAAGATTACACGT
+GACAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAGACGGCGTTATGCCGGGCTCC
+GTGGATGAATCGTTACCTAAGCTTAACGATGCCAAGCAAACTCGCGCTAAT
+>gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome--Locus_60_Transcript_3/4_Confidence_0.400_Length_168_hit2_IdMatch=96.77,AligLength=31,E-val=5e-05
+TACACGGATCATGGCCACAGCATCCGCAAGACGTCC
+>gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome--Locus_78_Transcript_1/1_Confidence_1.000_Length_154_hit1_IdMatch=80.26,AligLength=76,E-val=2e-08
+GACCTCATACCTCGAAGGAAGGGCCCCCCGAGGAGGCAAATCAGCACTCGAAGAACGCCT
+CCGAAAGCTGGAGCTCAGCC
+>gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome--Locus_60_Transcript_1/4_Confidence_0.600_Length_282_hit1_IdMatch=83.27,AligLength=257,E-val=2e-70
+TCCATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATGTCTGGGAGAAGATTACACGT
+GACAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAGACGGCGTTATGCCGGGCTCC
+GTGGATGAATCGTTACCTAAGCTTAACGATGCCAAGCAAACTCGCGCTAATCCAGGAACT
+TCCCGACCGCATTCAAACGGCGGCGGAAGCAGCAATGGGAATGAGCTATCAGGACGCACC
+GAACAACGTGCGCAGGGACCTC
+>gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome--Locus_1_Transcript_5/7_Confidence_0.231_Length_163_hit1_IdMatch=81.52,AligLength=92,E-val=3e-14
+CCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCGAAAGCTGGAGCTCAGCCACAGC
+CTTCCAACAACCGGAAGTGACCCCCCACCCGCTAAA
+>gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome--Locus_81_Transcript_1/1_Confidence_1.000_Length_155_hit1_IdMatch=85.9,AligLength=78,E-val=5e-17
+CATTGATTAGCGCGAGTTTGCTTGGCATCGTTAAGCTTAGGTAACGATTCATCCACGGAG
+CCCGGCATAACGCCGTCTTAATC
+>gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome--Locus_82_Transcript_1/1_Confidence_1.000_Length_165_hit1_IdMatch=84.85,AligLength=165,E-val=3e-45
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGCGAGTTTGCTTGGCATCGTTAA
+GCTTAGGTAACGATTCATCCACGGAGCCCGGCATAACGCCGTCTT
+>gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome--Locus_51_Transcript_1/1_Confidence_0.500_Length_320_hit1_IdMatch=73.89,AligLength=314,E-val=2e-46
+TCTCTCACGTGTTTTTGTGGACCCGCTCGCAACGACGACAACAATACAAGACCCACTGCG
+TACACTGCGAAAACTGCACCTCACAGCAAGAGATCCTACGATACCACTAGCTGACGCGGC
+TTGCGACCGCGTCGAGGGTTATCTTTGTACCGATGCGCTTACTCCGTTGATATCGGATTA
+CTGCAAAATGGTACTACGGTTATACGGGCCGACTGCCTCCACAGAGGAAGTCAGGAACCA
+ACGTAGAAGCCGGAATAAGGAGAAACCCTACTGGTTAATGTGCGATGGATCATGGCCACA
+GCATCCGCAAGACGTCC
+>gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome--Locus_48_Transcript_1/1_Confidence_0.000_Length_372_hit1_IdMatch=76.84,AligLength=367,E-val=5e-73
+ATTGACGCGGCTCACCTCCGATTATCTCGAAAACCGCCCTAAGTTGTAGTTGTTGGGACG
+GCTTGTTCAGACGCTCAATCGTTTCCTCGATTGACAATGGGTCAAGGTTGTTGAAAGGCC
+CGTTCATCAACCGTACGAAAGTGTCGGCGATCCTCGCGATACGGTCGCTTGGTTTCTTGT
+CGTTGGCGACAAAGGTTACCCTGCGTTCAATTGATTCAGACATTGTCTCCCAGCGTTTAA
+TCATTGGCATCATCATACAGTCACTCACGATAGGCAAGGTGTATTGGCGTGCGCTCACTT
+CTGGTACATCTGCGTCACTGGTTACTGGCCAATGGACGCGTGGCATTGTAGGTTTATACA
+CAGTTGGA
+>gi|22681027|ref|NC_004142.1|_Boolarra_virus_RNA1,_complete_genome--Locus_72_Transcript_1/1_Confidence_0.000_Length_108_hit1_IdMatch=75.96,AligLength=104,E-val=2e-12
+AAATGATCTCATCTCTGTATTCTGGCCGGAATGCTTGAACCATCGCCTTTTGAGCGATAT
+TTCGTTGCATCCAGCCAGAAACCCGGCCATCAAGGTTGGAAAAATC
+
+>gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds--Locus_83_Transcript_1/1_Confidence_1.000_Length_196_hit1_IdMatch=84.62,AligLength=169,E-val=3e-46
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGCGAGTTTGCTTGGCATCGTTAA
+GCTTAGGTAACGATTCATCCACGGAGCCCGGCATAACGCCGTCTTAATC
+>gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds--Locus_1_Transcript_5/7_Confidence_0.231_Length_163_hit1_IdMatch=81.52,AligLength=92,E-val=3e-14
+CCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCGAAAGCTGGAGCTCAGCCACAGC
+CTTCCAACAACCGGAAGTGACCCCCCACCCGCTAAA
+>gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds--Locus_48_Transcript_1/1_Confidence_0.000_Length_372_hit1_IdMatch=76.84,AligLength=367,E-val=5e-73
+ATTGACGCGGCTCACCTCCGATTATCTCGAAAACCGCCCTAAGTTGTAGTTGTTGGGACG
+GCTTGTTCAGACGCTCAATCGTTTCCTCGATTGACAATGGGTCAAGGTTGTTGAAAGGCC
+CGTTCATCAACCGTACGAAAGTGTCGGCGATCCTCGCGATACGGTCGCTTGGTTTCTTGT
+CGTTGGCGACAAAGGTTACCCTGCGTTCAATTGATTCAGACATTGTCTCCCAGCGTTTAA
+TCATTGGCATCATCATACAGTCACTCACGATAGGCAAGGTGTATTGGCGTGCGCTCACTT
+CTGGTACATCTGCGTCACTGGTTACTGGCCAATGGACGCGTGGCATTGTAGGTTTATACA
+CAGTTGGA
+>gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds--Locus_60_Transcript_4/4_Confidence_0.100_Length_204_hit1_IdMatch=78.92,AligLength=204,E-val=7e-42
+GGATCATGGCCACAGCATCCGCAAGACGTCCATTTGATGAAGCAGGTTTTAATCAAGCGT
+ACTAGAATTGACGAAGATCAGGTCGATGCACTCATTGGGCGTTTTGCCGCAATGAAGGAT
+GTCTGGGAGAAGATTACACGTGACAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAA
+GACGGCGTTATGCCGGGCTCCGTG
+>gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds--Locus_60_Transcript_3/4_Confidence_0.400_Length_168_hit2_IdMatch=96.77,AligLength=31,E-val=5e-05
+TACACGGATCATGGCCACAGCATCCGCAAGACGTCC
+>gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds--Locus_51_Transcript_1/1_Confidence_0.500_Length_320_hit1_IdMatch=73.89,AligLength=314,E-val=2e-46
+TCTCTCACGTGTTTTTGTGGACCCGCTCGCAACGACGACAACAATACAAGACCCACTGCG
+TACACTGCGAAAACTGCACCTCACAGCAAGAGATCCTACGATACCACTAGCTGACGCGGC
+TTGCGACCGCGTCGAGGGTTATCTTTGTACCGATGCGCTTACTCCGTTGATATCGGATTA
+CTGCAAAATGGTACTACGGTTATACGGGCCGACTGCCTCCACAGAGGAAGTCAGGAACCA
+ACGTAGAAGCCGGAATAAGGAGAAACCCTACTGGTTAATGTGCGATGGATCATGGCCACA
+GCATCCGCAAGACGTCC
+>gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds--Locus_60_Transcript_2/4_Confidence_0.400_Length_217_hit1_IdMatch=83.13,AligLength=166,E-val=8e-42
+TCCATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATGTCTGGGAGAAGATTACACGT
+GACAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAGACGGCGTTATGCCGGGCTCC
+GTGGATGAATCGTTACCTAAGCTTAACGATGCCAAGCAAACTCGCGCTAAT
+>gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds--Locus_78_Transcript_1/1_Confidence_1.000_Length_154_hit1_IdMatch=80.26,AligLength=76,E-val=2e-08
+GACCTCATACCTCGAAGGAAGGGCCCCCCGAGGAGGCAAATCAGCACTCGAAGAACGCCT
+CCGAAAGCTGGAGCTCAGCC
+>gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds--Locus_49_Transcript_1/1_Confidence_0.000_Length_499_hit1_IdMatch=77.13,AligLength=494,E-val=7e-104
+AACCGCCAAACAGTATACTGCGGTATTGTGTAGACGAGTGTTCGATCTGGACAATCAGTC
+CAGGGTCTACAATGGTGGATTTTGTGATAACCGACCTTTTCTAAACCAACTATTCTCAAT
+GGCAGTTGTAAAAACCATTCCTTCCAACTTGTTCGGACGCGGCTGGCGATGAACTCACCA
+GCTTCGCACCAATCCCAAACTGGATGGACCCATGCAGCACCTCCACTAACCTTGTATTCA
+ACCAGGTTGTTCTTGATGGTGAATGGTGAGTCAGCATCAAAGCCACTCACTTTCTTCGGG
+TTGAAGGTGTGTAAAACCACTGGACGCATGTGCTCTAACAGCACATCTGGCTCGGTGACA
+TAATAATCAACATCAACACCAACGATGAAGGCGTCTTCCGCTGGTGTATCATTGCGAAAG
+TCTTGCGCCAGATCACCGACGGCGAAGTGGAAATGGTTCCGCAGTCCAGTGCTGGAATTT
+GGGTTCGGGTTAACTTCAA
+>gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds--Locus_60_Transcript_3/4_Confidence_0.400_Length_168_hit1_IdMatch=81.36,AligLength=118,E-val=5e-24
+TCCATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATGTCTGGGAGAAGATTACACGT
+GACAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAGACGGCGTTATGCCGGGCTCC
+GTG
+>gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds--Locus_82_Transcript_1/1_Confidence_1.000_Length_165_hit1_IdMatch=84.85,AligLength=165,E-val=3e-45
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGCGAGTTTGCTTGGCATCGTTAA
+GCTTAGGTAACGATTCATCCACGGAGCCCGGCATAACGCCGTCTT
+>gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds--Locus_79_Transcript_1/1_Confidence_1.000_Length_154_hit1_IdMatch=80.26,AligLength=76,E-val=2e-08
+GACCTCATACCTCGAAGGAAGGGCCCCCCGAGGAGGCAAATCAGCACTCGAAGAACGCCT
+CCGAAAGCTGGAGCTCAGCC
+>gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds--Locus_46_Transcript_1/1_Confidence_0.667_Length_178_hit1_IdMatch=80.45,AligLength=179,E-val=5e-37
+CAAGGCAAAGCTAACGGTAAGCCGAATGGTAACATCACTGCTGGAGAAACCCAGCGTGGT
+GGCATACCTCGAAGGAAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCG
+AAAGCTGGAGCTCAGCCACAGCCTTCCAACAACCGGAAGTGACCCCCCACCCGCTAAA
+>gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds--Locus_1_Transcript_7/7_Confidence_0.231_Length_184_hit1_IdMatch=88.0,AligLength=50,E-val=8e-09
+CCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCGAAAGCTGGAGCTCAGCC
+>gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds--Locus_72_Transcript_1/1_Confidence_0.000_Length_108_hit1_IdMatch=75.96,AligLength=104,E-val=2e-12
+AAATGATCTCATCTCTGTATTCTGGCCGGAATGCTTGAACCATCGCCTTTTGAGCGATAT
+TTCGTTGCATCCAGCCAGAAACCCGGCCATCAAGGTTGGAAAAATC
+>gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds--Locus_80_Transcript_1/1_Confidence_1.000_Length_101_hit1_IdMatch=83.84,AligLength=99,E-val=4e-22
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGC
+>gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds--Locus_73_Transcript_1/1_Confidence_0.000_Length_164_hit1_IdMatch=75.46,AligLength=163,E-val=5e-24
+TCGGATAATATCCGGCTTTCCTGACATCCTTTTCATCCTGAAGGTCTCCAGATACACATT
+AGCGTACTCGGATATCGTTCTACATGCCGAGCATAATCAACATTGGTATTATCCTGGAAG
+GAACCCAACTGAGATCGCCGATGGGGTTTGTGAATTTGTCAGTG
+>gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds--Locus_81_Transcript_1/1_Confidence_1.000_Length_155_hit2_IdMatch=87.23,AligLength=47,E-val=3e-07
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCA
+>gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds--Locus_60_Transcript_1/4_Confidence_0.600_Length_282_hit1_IdMatch=83.27,AligLength=257,E-val=2e-70
+TCCATTACACTCATTGGGCGTTTTGCCGCAATGAAGGATGTCTGGGAGAAGATTACACGT
+GACAGCGAGGAGAGCGCCGCTGCATGTACGTTTGATGAAGACGGCGTTATGCCGGGCTCC
+GTGGATGAATCGTTACCTAAGCTTAACGATGCCAAGCAAACTCGCGCTAATCCAGGAACT
+TCCCGACCGCATTCAAACGGCGGCGGAAGCAGCAATGGGAATGAGCTATCAGGACGCACC
+GAACAACGTGCGCAGGGACCTC
+>gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds--Locus_57_Transcript_1/1_Confidence_0.000_Length_260_hit1_IdMatch=85.1,AligLength=255,E-val=2e-76
+TTAACTTCAAATTTAGATCCTCCTACAGATGTTATAGCCTCGTCGATTAAACGACGGGCG
+GCATCACGTACGGCTCCTGAAACGGCATGCCCGTTGTTAAAGGCACGCTTAGGCGTTACG
+GTACGCAGGCTGTCAAGCGGATAGAAACGTGTTTCTATCGGGGTCTTCGTTTTGTCAATG
+ACAGCCCGTTGCAATGCGCGTGTAACTCGGTTCCCTCCACTCTGGGGATAGGGCGCAATT
+GCCCCATAGCCCCAGAACTT
+>gi|13195547|gb|AF329080.1|_Boolarra_virus_segment_RNA1_protein_A_and_B2_genes,_complete_cds--Locus_81_Transcript_1/1_Confidence_1.000_Length_155_hit1_IdMatch=85.9,AligLength=78,E-val=5e-17
+CATTGATTAGCGCGAGTTTGCTTGGCATCGTTAAGCTTAGGTAACGATTCATCCACGGAG
+CCCGGCATAACGCCGTCTTAATC
+
+>gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds--Locus_1_Transcript_5/7_Confidence_0.231_Length_163_hit1_IdMatch=95.37,AligLength=108,E-val=2e-41
+TAAGCGAAGGAAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCGAAAGC
+TGGAGCTCAGCCACAGCCTTCCAACAACCGGAAGTGACCCCCCACCCGCTAAA
+>gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds--Locus_1_Transcript_7/7_Confidence_0.231_Length_184_hit1_IdMatch=76.28,AligLength=156,E-val=6e-30
+TAAGCGAAGGAAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCGAAAGC
+TGGAGCTCAGCCCCCCACCCGCTAAACCGTAGCTGACTCCTAGGAGCACCTACACCCGTT
+CTAGCCCGAAAGGG
+>gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds--Locus_81_Transcript_1/1_Confidence_1.000_Length_155_hit2_IdMatch=90.7,AligLength=43,E-val=8e-08
+CCATTGATTAGCGCGAGTTTGCTTGGCATCGTTAAGCTTAGGTAACGA
+>gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds--Locus_60_Transcript_1/4_Confidence_0.600_Length_282_hit1_IdMatch=93.23,AligLength=133,E-val=3e-49
+ATGAATCGTTACCTAAGCTTAACGATGCCAAGCAAACTCGCGCTAATCCAGGAACTTCCC
+GACCGCATTCAAACGGCGGCGGAAGCAGCAATGGGAATGAGCTATCAGGACGCACCGAAC
+AACGTGCGCAGGGACCTC
+>gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds--Locus_83_Transcript_1/1_Confidence_1.000_Length_196_hit1_IdMatch=93.23,AligLength=133,E-val=2e-49
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGCGAGTTTGCTTGGCATCGTTAA
+GCTTAGGTAACGA
+>gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds--Locus_81_Transcript_1/1_Confidence_1.000_Length_155_hit1_IdMatch=95.83,AligLength=48,E-val=3e-13
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCAT
+>gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds--Locus_80_Transcript_1/1_Confidence_1.000_Length_101_hit1_IdMatch=94.95,AligLength=99,E-val=8e-37
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGC
+>gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds--Locus_60_Transcript_2/4_Confidence_0.400_Length_217_hit1_IdMatch=90.7,AligLength=43,E-val=1e-07
+ATGAATCGTTACCTAAGCTTAACGATGCCAAGCAAACTCGCGCTAATC
+>gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds--Locus_78_Transcript_1/1_Confidence_1.000_Length_154_hit1_IdMatch=76.36,AligLength=165,E-val=5e-30
+GACCTCATACCTCGAAGGAAGGGCCCCCCGAGGAGGCAAATCAGCACTCGAAGAACGCCT
+CCGAAAGCTGGAGCTCAGCCCCCCACCCGCTAAACCGTAGGTGTCTCCTAGGAGCACCCA
+CACACGTTCTAGCCCGAAAGGG
+>gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds--Locus_79_Transcript_1/1_Confidence_1.000_Length_154_hit1_IdMatch=75.76,AligLength=165,E-val=6e-29
+GACCTCATACCTCGAAGGAAGGGCCCCCCGAGGAGGCAAATCAGCACTCGAAGAACGCCT
+CCGAAAGCTGGAGCTCAGCCCCCCACCCGCTAAACCGTAGCTGACTCCTAGGAGCACCTA
+CACCCGTTCTAGCCCGAAAGGG
+>gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds--Locus_46_Transcript_1/1_Confidence_0.667_Length_178_hit1_IdMatch=94.94,AligLength=178,E-val=6e-74
+CAAGGCAAAGCTAACGGTAAGCCGAATGGTAACATCACTGCTGGAGAAACCCAGCGTGGT
+GGCATACCTCGAAGGAAGGGCCCCCGAGGAGGCAAAATCAGCACTCGAAGAACGCCTCCG
+AAAGCTGGAGCTCAGCCACAGCCTTCCAACAACCGGAAGTGACCCCCCACCCGCTAAA
+>gi|210673|gb|M33065.1|BBVRNA3_Black_beetle_virus_RNA3_proteins_B1_and_B2_genes,_complete_cds--Locus_82_Transcript_1/1_Confidence_1.000_Length_165_hit1_IdMatch=93.23,AligLength=133,E-val=1e-49
+GAGGTCCCTGCGCACGTTGTTCGGTGCGTCCTGATAGCTCATTCCCATTGCTGCTTCCGC
+CGCCGTTTGAATGCGGTCGGGAAGTTCCTGGATTAGCGCGAGTTTGCTTGGCATCGTTAA
+GCTTAGGTAACGA
+
+>gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_7_Transcript_5/11_Confidence_0.308_Length_4519_hit1_IdMatch=68.39,AligLength=367,E-val=2e-28
+AAATACATCACCAACATTGTAGGAGACATGAATCCGAATCAATCAAGGATCTTCGATCAG
+GACAGGCTTAGAGGTAACCAATACAATGCCAATGGGGCTGTGGTTCATAATGCTGTATCA
+ACTATTCCGTTTACAAACCTCATTCCTAGGACGATTCGATCTGATGATGACGTCCTTGAG
+AAGTCGGCCAACAGATTACAGGTTACAGAGACAAACGTTACGGATTACTACGTTAATCCG
+ATTGAGCCAACTGAATTATCCAAAACAATAAGTGACCAGATCAAAAACAATCAATCATCT
+AACTGGCGACGAGATAACACGTCATTGGCTGGTTTCAATAGTTTCGACATTGCGACAGTC
+AACACTGCA
+>gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_10_Transcript_1/8_Confidence_0.222_Length_565_hit1_IdMatch=63.73,AligLength=477,E-val=2e-10
+CCTTAGCTAATATTTTTGTGTCGTCGCCTTTCAATGCTATTAACCTAATGTTATCTTTGC
+CCAATATCAAACTCGTCTGATCTCTTGCTATATCCGTTGTTATCATATTCCAGACATTGC
+CGATGAAACTTGTTGGACGTATTCCAGAAGGTATGCCGTTAGTCTGTTTCTTTGTTTCCT
+TTGTTAACGGTGAGTACAGGTAATTATTGTCGTAACACGAAATATTTTTCGCAGCTATTT
+TAGTGAATAAATGTCGATCTTGTGGAGGTACCAAATATTTGATTTGGTCTATGACGCGTT
+TCGTAATCTGCTTCACTTCCCAAATTGTTGGTTGTCTGTCAAACCCTTTGAAATCAAAAG
+GTAGGGCAAAACACCCGTCTTTCAATGCTTTAATTGTTTCACAGTTCCTAAGATGCGTTT
+CACCTGGTGTTTCGTCTAATGTTATGTATTTCCAATTTTTAAAGCCATGTCCAAATA
+>gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_7_Transcript_3/11_Confidence_0.154_Length_1743_hit1_IdMatch=68.46,AligLength=279,E-val=1e-19
+CCAATGGGGCTGTGGTTCATAATGCTGTATCAACTATTCCGTTTACAAACCTCATTCCTA
+GGACGATTCGATCTGATGATGACGTCCTTGAGAAGTCGGCCAACAGATTACAGGTTACAG
+AGACAAACGTTACGGATTACTACGTTAATCCGATTGAGCCAACTGAATTATCCAAAACAA
+TAAGTGACCAGATCAAAAACAATCAATCATCTAACTGGCGACGAGATAACACGTCATTGG
+CTGGTTTCAATAGTTTCGACATTGCGACAGTCAACACTGCA
+>gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_7_Transcript_7/11_Confidence_0.462_Length_4481_hit3_IdMatch=65.43,AligLength=564,E-val=2e-22
+CAAGCTTATTTCCCGATAGGATCGGGCCCAAACATCAACGACAAGGTTCTGTGGAATAGT
+AGATTGTGGATGACAAGTGGTTTCGTTCAGTACTTGGATTACGCTGGCAACGCAATCAAC
+GAAGTGGTTCCTGCAGCAGGGCTACCTTTGGGTAGGTCAATCCCATTACTGCCAGGGGAA
+GTTCAGCCGGTTGGTAACACCAACATGAGCACAAGCTGCGTTCCTCGTTATTCTGTGGAC
+GGTCGCCGAATTTTTACTTATGTCAACACAGCTCAATCCGTTCCTTTGATACAAGCGTGT
+AATAGAGCCAATAGATTGGCCAGATCGGCATGGCTATTATTGCATGTCTACATCGAACCA
+GAGTTGCAGCTATTGAGCGATGAAGTGGTGGACATATTCGACCAACTGACAAGCAAGACT
+TTTTTAGATGTAGCAAAATCGGCTGCGGACAGTGCGGAGGGCAACATTCCGGCAACGAAG
+GTATTGACAGACCTCCAGGCAGTGGATTCAGCAACGCTGCCGAGTACTTTGGATCCATCC
+ACAAATATGCTCCAACCAGC
+>gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_7_Transcript_9/11_Confidence_0.154_Length_552_hit1_IdMatch=68.71,AligLength=556,E-val=4e-51
+AAAACGATTTCGATACTTTCGCAACAAAAGGAAGCAAGATTAGTGCATTTGTCAAGCGTT
+TTCCCTTCGACAAGGATGATGCCAAAGCTAGATGGGCAGAGATCAACACGCTGACGGGCT
+ATTTGCAGAATGATTTTGGAAACTTCGATTACGATAAGGAATTTGAAGCTTTAGCTACCG
+GAGATAGTAACCACCCCGCTTGGTGGGAAGAAGTATTCACTAAGAAAATAAAAGAGTTGA
+TGACACATCAAGAACACAAAAAGTATATCAGTTTTGAAAAATATGTTAAGGAAGGATATT
+GGATAACATCTGGCAGCAGCAGCATCGGCAAAGTCAATTGGTCATATGACGGAGACTTGG
+GCAAATTTAAGGCTAGAAAGAACATGTTATTAGATCTATATACGCCGGACGAAATCTACA
+AAATGGCTGTAGAATGGGACGGGAAACTAGAGAATAGAGTGTTCATCAAAGATGAATTGG
+CAAAGAGAAGATTGGCAGTGGCAAGCAATATTGAAGCATATTTGAATCAAGGGTATATAT
+TTTATCTATTTG
+>gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_10_Transcript_6/8_Confidence_0.333_Length_1121_hit1_IdMatch=70.87,AligLength=381,E-val=2e-38
+TCAGCAAGTGGTAGCTTGCTAGTAGTTTTCCACCCTTTCCATTCGTATATTCCGAAACCA
+CCCAGTCGTTTAGGCAGGTGCAGCCAGTGATAGCTCTGTCCCGTGTATTTACTCCACTTA
+ATTTTGTTTGCTTGATGTAACCAATCCAATTGTTTCTTGCTTCTCCTTTCTAATAAATAG
+ATATTATTAGCGGTTGTCTCAACTTGTTGATTTGCAGTCCATGGTTGTGGGTTCCACGGT
+TTCCTTTGTGTCACGCTAGGGATAGCCCGATTTGTCCAGCCTCTGACGCCTTGAGTAGAT
+ATTTCTGTCCTTAAGAATTCGCAACAATTTTGCATAATTCCAAACTTGCTGTTTTCTCCA
+ACGGCGTTGATTGCCTGATAG
+>gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_10_Transcript_4/8_Confidence_0.444_Length_1097_hit1_IdMatch=70.87,AligLength=381,E-val=2e-38
+TCAGCAAGTGGTAGCTTGCTAGTAGTTTTCCACCCTTTCCATTCGTATATTCCGAAACCA
+CCCAGTCGTTTAGGCAGGTGCAGCCAGTGATAGCTCTGTCCCGTGTATTTACTCCACTTA
+ATTTTGTTTGCTTGATGTAACCAATCCAATTGTTTCTTGCTTCTCCTTTCTAATAAATAG
+ATATTATTAGCGGTTGTCTCAACTTGTTGATTTGCAGTCCATGGTTGTGGGTTCCACGGT
+TTCCTTTGTGTCACGCTAGGGATAGCCCGATTTGTCCAGCCTCTGACGCCTTGAGTAGAT
+ATTTCTGTCCTTAAGAATTCGCAACAATTTTGCATAATTCCAAACTTGCTGTTTTCTCCA
+ACGGCGTTGATTGCCTGATAG
+>gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_10_Transcript_8/8_Confidence_0.000_Length_1134_hit1_IdMatch=70.87,AligLength=381,E-val=2e-38
+TCAGCAAGTGGTAGCTTGCTAGTAGTTTTCCACCCTTTCCATTCGTATATTCCGAAACCA
+CCCAGTCGTTTAGGCAGGTGCAGCCAGTGATAGCTCTGTCCCGTGTATTTACTCCACTTA
+ATTTTGTTTGCTTGATGTAACCAATCCAATTGTTTCTTGCTTCTCCTTTCTAATAAATAG
+ATATTATTAGCGGTTGTCTCAACTTGTTGATTTGCAGTCCATGGTTGTGGGTTCCACGGT
+TTCCTTTGTGTCACGCTAGGGATAGCCCGATTTGTCCAGCCTCTGACGCCTTGAGTAGAT
+ATTTCTGTCCTTAAGAATTCGCAACAATTTTGCATAATTCCAAACTTGCTGTTTTCTCCA
+ACGGCGTTGATTGCCTGATAG
+>gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_7_Transcript_10/11_Confidence_0.154_Length_4093_hit1_IdMatch=68.39,AligLength=367,E-val=1e-28
+AAATACATCACCAACATTGTAGGAGACATGAATCCGAATCAATCAAGGATCTTCGATCAG
+GACAGGCTTAGAGGTAACCAATACAATGCCAATGGGGCTGTGGTTCATAATGCTGTATCA
+ACTATTCCGTTTACAAACCTCATTCCTAGGACGATTCGATCTGATGATGACGTCCTTGAG
+AAGTCGGCCAACAGATTACAGGTTACAGAGACAAACGTTACGGATTACTACGTTAATCCG
+ATTGAGCCAACTGAATTATCCAAAACAATAAGTGACCAGATCAAAAACAATCAATCATCT
+AACTGGCGACGAGATAACACGTCATTGGCTGGTTTCAATAGTTTCGACATTGCGACAGTC
+AACACTGCA
+>gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_7_Transcript_7/11_Confidence_0.462_Length_4481_hit2_IdMatch=68.39,AligLength=367,E-val=2e-28
+AAATACATCACCAACATTGTAGGAGACATGAATCCGAATCAATCAAGGATCTTCGATCAG
+GACAGGCTTAGAGGTAACCAATACAATGCCAATGGGGCTGTGGTTCATAATGCTGTATCA
+ACTATTCCGTTTACAAACCTCATTCCTAGGACGATTCGATCTGATGATGACGTCCTTGAG
+AAGTCGGCCAACAGATTACAGGTTACAGAGACAAACGTTACGGATTACTACGTTAATCCG
+ATTGAGCCAACTGAATTATCCAAAACAATAAGTGACCAGATCAAAAACAATCAATCATCT
+AACTGGCGACGAGATAACACGTCATTGGCTGGTTTCAATAGTTTCGACATTGCGACAGTC
+AACACTGCA
+>gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_7_Transcript_8/11_Confidence_0.154_Length_552_hit1_IdMatch=68.82,AligLength=542,E-val=1e-50
+GATACTTTCGCAACAAAAGGAAGCAAGATTAGTGCATTTGTCAAGCGTTTTCCCTTCGAC
+AAGGATGATGCCAAAGCTAGATGGGCAGAGATCAACACGCTGACGGGCTATTTGCAGAAT
+GATTTTGGAAACTTCGATTACGATAAGGAATTTGAAGCTTTAGCTACCGGAGATAGTAAC
+CACCCCGCTTGGTGGGAAGAAGTATTCACTAAGAAAATAAAAGAGTTGATGACACATCAA
+GAACACAAAAAGTATATCAGTTTTGAAAAATATGTTAAGGAAGGATATTGGATAACATCT
+GGCAGCAGCAGCATCGGCAAAGTCAATTGGTCATATGACGGAGACTTGGGCAAATTTAAG
+GCTAGAAAGAACATGTTATTAGATCTATATACGCCGGACGAAATCTACAAAATGGCTGTA
+GAATGGGACGGGAAACTAGAGAATAGAGTGTTCATCAAAGATGAATTGGCAAAGAGAAGA
+TTGGCAGTGGCAAGCAATATTGAAGCATATTTGAATCAAGGGTATATATTTTATCTATTT
+G
+>gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_7_Transcript_10/11_Confidence_0.154_Length_4093_hit2_IdMatch=65.43,AligLength=564,E-val=1e-22
+CAAGCTTATTTCCCGATAGGATCGGGCCCAAACATCAACGACAAGGTTCTGTGGAATAGT
+AGATTGTGGATGACAAGTGGTTTCGTTCAGTACTTGGATTACGCTGGCAACGCAATCAAC
+GAAGTGGTTCCTGCAGCAGGGCTACCTTTGGGTAGGTCAATCCCATTACTGCCAGGGGAA
+GTTCAGCCGGTTGGTAACACCAACATGAGCACAAGCTGCGTTCCTCGTTATTCTGTGGAC
+GGTCGCCGAATTTTTACTTATGTCAACACAGCTCAATCCGTTCCTTTGATACAAGCGTGT
+AATAGAGCCAATAGATTGGCCAGATCGGCATGGCTATTATTGCATGTCTACATCGAACCA
+GAGTTGCAGCTATTGAGCGATGAAGTGGTGGACATATTCGACCAACTGACAAGCAAGACT
+TTTTTAGATGTAGCAAAATCGGCTGCGGACAGTGCGGAGGGCAACATTCCGGCAACGAAG
+GTATTGACAGACCTCCAGGCAGTGGATTCAGCAACGCTGCCGAGTACTTTGGATCCATCC
+ACAAATATGCTCCAACCAGC
+>gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_7_Transcript_7/11_Confidence_0.462_Length_4481_hit1_IdMatch=68.67,AligLength=565,E-val=3e-51
+CAACAGGAATATTAAACGATTTCGATACTTTCGCAACAAAAGGAAGCAAGATTAGTGCAT
+TTGTCAAGCGTTTTCCCTTCGACAAGGATGATGCCAAAGCTAGATGGGCAGAGATCAACA
+CGCTGACGGGCTATTTGCAGAATGATTTTGGAAACTTCGATTACGATAAGGAATTTGAAG
+CTTTAGCTACCGGAGATAGTAACCACCCCGCTTGGTGGGAAGAAGTATTCACTAAGAAAA
+TAAAAGAGTTGATGACACATCAAGAACACAAAAAGTATATCAGTTTTGAAAAATATGTTA
+AGGAAGGATATTGGATAACATCTGGCAGCAGCAGCATCGGCAAAGTCAATTGGTCATATG
+ACGGAGACTTGGGCAAATTTAAGGCTAGAAAGAACATGTTATTAGATCTATATACGCCGG
+ACGAAATCTACAAAATGGCTGTAGAATGGGACGGGAAACTAGAGAATAGAGTGTTCATCA
+AAGATGAATTGGCAAAGAGAAGATTGGCAGTGGCAAGCAATATTGAAGCATATTTGAATC
+AAGGGTATATATTTTATCTATTTG
+>gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_7_Transcript_6/11_Confidence_0.154_Length_656_hit1_IdMatch=72.54,AligLength=142,E-val=2e-12
+CAAGACTTTTTTAGATGTAGCAAAATCGGCTGCGGACAGTGCGGAGGGCAACATTCCGGC
+AACGAAGGTATTGACAGACCTCCAGGCAGTGGATTCAGCAACGCTGCCGAGTACTTTGGA
+TCCATCCACAAATATGCTCCAACCAGC
+>gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_10_Transcript_3/8_Confidence_0.222_Length_529_hit1_IdMatch=70.87,AligLength=381,E-val=1e-38
+TCAGCAAGTGGTAGCTTGCTAGTAGTTTTCCACCCTTTCCATTCGTATATTCCGAAACCA
+CCCAGTCGTTTAGGCAGGTGCAGCCAGTGATAGCTCTGTCCCGTGTATTTACTCCACTTA
+ATTTTGTTTGCTTGATGTAACCAATCCAATTGTTTCTTGCTTCTCCTTTCTAATAAATAG
+ATATTATTAGCGGTTGTCTCAACTTGTTGATTTGCAGTCCATGGTTGTGGGTTCCACGGT
+TTCCTTTGTGTCACGCTAGGGATAGCCCGATTTGTCCAGCCTCTGACGCCTTGAGTAGAT
+ATTTCTGTCCTTAAGAATTCGCAACAATTTTGCATAATTCCAAACTTGCTGTTTTCTCCA
+ACGGCGTTGATTGCCTGATAG
+>gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_7_Transcript_5/11_Confidence_0.308_Length_4519_hit2_IdMatch=65.43,AligLength=564,E-val=2e-22
+CAAGCTTATTTCCCGATAGGATCGGGCCCAAACATCAACGACAAGGTTCTGTGGAATAGT
+AGATTGTGGATGACAAGTGGTTTCGTTCAGTACTTGGATTACGCTGGCAACGCAATCAAC
+GAAGTGGTTCCTGCAGCAGGGCTACCTTTGGGTAGGTCAATCCCATTACTGCCAGGGGAA
+GTTCAGCCGGTTGGTAACACCAACATGAGCACAAGCTGCGTTCCTCGTTATTCTGTGGAC
+GGTCGCCGAATTTTTACTTATGTCAACACAGCTCAATCCGTTCCTTTGATACAAGCGTGT
+AATAGAGCCAATAGATTGGCCAGATCGGCATGGCTATTATTGCATGTCTACATCGAACCA
+GAGTTGCAGCTATTGAGCGATGAAGTGGTGGACATATTCGACCAACTGACAAGCAAGACT
+TTTTTAGATGTAGCAAAATCGGCTGCGGACAGTGCGGAGGGCAACATTCCGGCAACGAAG
+GTATTGACAGACCTCCAGGCAGTGGATTCAGCAACGCTGCCGAGTACTTTGGATCCATCC
+ACAAATATGCTCCAACCAGC
+>gi|307933352|dbj|AB555545.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_10_Transcript_2/8_Confidence_0.111_Length_1023_hit1_IdMatch=66.11,AligLength=897,E-val=2e-52
+TCAGCAAGTGGTAGCTTGCTAGTAGTTTTCCACCCTTTCCATTCGTATATTCCGAAACCA
+CCCAGTCGTTTAGGCAGGTGCAGCCAGTGATAGCTCTGTCCCGTGTATTTACTCCACTTA
+ATTTTGTTTGCTTGATGTAACCAATCCAATTGTTTCTTGCTTCTCCTTTCTAATAAATAG
+ATATTATTAGCGGTTGTCTCAACTTGTTGATTTGCAGTCCATGGTTGTGGGTTCCACGGT
+TTCCTTTGTGTCACGCTAGGGATAGCCCGATTTGTCCAGCCTCTGACGCCTTGAGTAGAT
+ATTTCTGTCCTTAAGAATTCGCAACAATTTTGCATAATTCCAAACTTGCTGTTTTCTCCA
+ACGGCGTTGATTGCCTGATAGCTATACCTAAACACCAGACATGTCATGAAATCCTTAGCT
+AATATTTTTGTGTCGTCGCCTTTCAATGCTATTAACCTAATGTTATCTTTGCCCAATATC
+AAACTCGTCTGATCTCTTGCTATATCCGTTGTTATCATATTCCAGACATTGCCGATGAAA
+CTTGTTGGACGTATTCCAGAAGGTATGCCGTTAGTCTGTTTCTTTGTTTCCTTTGTTAAC
+GGTGAGTACAGGTAATTATTGTCGTAACACGAAATATTTTTCGCAGCTATTTTAGTGAAT
+AAATGTCGATCTTGTGGAGGTACCAAATATTTGATTTGGTCTATGACGCGTTTCGTAATC
+TGCTTCACTTCCCAAATTGTTGGTTGTCTGTCAAACCCTTTGAAATCAAAAGGTAGGGCA
+AAACACCCGTCTTTCAATGCTTTAATTGTTTCACAGTTCCTAAGATGCGTTTCACCTGGT
+GTTTCGTCTAATGTTATGTATTTCCAATTTTTAAAGCCATGTCCAAATA
+
+>gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_7_Transcript_9/11_Confidence_0.154_Length_552_hit1_IdMatch=69.64,AligLength=504,E-val=5e-49
+TTTGTCAAGCGTTTTCCCTTCGACAAGGATGATGCCAAAGCTAGATGGGCAGAGATCAAC
+ACGCTGACGGGCTATTTGCAGAATGATTTTGGAAACTTCGATTACGATAAGGAATTTGAA
+GCTTTAGCTACCGGAGATAGTAACCACCCCGCTTGGTGGGAAGAAGTATTCACTAAGAAA
+ATAAAAGAGTTGATGACACATCAAGAACACAAAAAGTATATCAGTTTTGAAAAATATGTT
+AAGGAAGGATATTGGATAACATCTGGCAGCAGCAGCATCGGCAAAGTCAATTGGTCATAT
+GACGGAGACTTGGGCAAATTTAAGGCTAGAAAGAACATGTTATTAGATCTATATACGCCG
+GACGAAATCTACAAAATGGCTGTAGAATGGGACGGGAAACTAGAGAATAGAGTGTTCATC
+AAAGATGAATTGGCAAAGAGAAGATTGGCAGTGGCAAGCAATATTGAAGCATATTTGAAT
+CAAGGGTATATATTTTATCTATTTG
+>gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_7_Transcript_5/11_Confidence_0.308_Length_4519_hit1_IdMatch=65.19,AligLength=790,E-val=4e-36
+AAATACATCACCAACATTGTAGGAGACATGAATCCGAATCAATCAAGGATCTTCGATCAG
+GACAGGCTTAGAGGTAACCAATACAATGCCAATGGGGCTGTGGTTCATAATGCTGTATCA
+ACTATTCCGTTTACAAACCTCATTCCTAGGACGATTCGATCTGATGATGACGTCCTTGAG
+AAGTCGGCCAACAGATTACAGGTTACAGAGACAAACGTTACGGATTACTACGTTAATCCG
+ATTGAGCCAACTGAATTATCCAAAACAATAAGTGACCAGATCAAAAACAATCAATCATCT
+AACTGGCGACGAGATAACACGTCATTGGCTGGTTTCAATAGTTTCGACATTGCGACAGTC
+AACACTGCACTAATTGCAAGAGGTCTAAGCACTGAATCAATGACTCTCAAGTTAGAGCTA
+TTGCACGGAATAATGGCTATGCAGGTTGAAGCACCAATGATCAATTCCAGCACTTATTCG
+ATCGTAGATAATCATACAATCCCGACCGTAACTGACAGGGCCGTCATAGGCATCAATGAC
+TCGCCTGTGTTTGGCGAGGACTGTGGTGGTGATCTTCCTGAATATCCTTTCGGCGGCGGA
+ACCGGTACAATTGCCTTTCACCTAACATTGCAAACTGTTCCTGAAGAGAGGAGAGATAAG
+GCAATCTTCTGCCCTCCTGGTTTGTTGCAAGCAGCCCGAGATGGAGCAGAGGCATTGGCC
+CTATTTGTTTTGTCGATGTCTGAATGGCCTTTCGGTATTTATACTGTCACCAAGAGAACA
+ACCGAT
+>gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_10_Transcript_6/8_Confidence_0.333_Length_1121_hit1_IdMatch=69.97,AligLength=383,E-val=1e-35
+TCAGCAAGTGGTAGCTTGCTAGTAGTTTTCCACCCTTTCCATTCGTATATTCCGAAACCA
+CCCAGTCGTTTAGGCAGGTGCAGCCAGTGATAGCTCTGTCCCGTGTATTTACTCCACTTA
+ATTTTGTTTGCTTGATGTAACCAATCCAATTGTTTCTTGCTTCTCCTTTCTAATAAATAG
+ATATTATTAGCGGTTGTCTCAACTTGTTGATTTGCAGTCCATGGTTGTGGGTTCCACGGT
+TTCCTTTGTGTCACGCTAGGGATAGCCCGATTTGTCCAGCCTCTGACGCCTTGAGTAGAT
+ATTTCTGTCCTTAAGAATTCGCAACAATTTTGCATAATTCCAAACTTGCTGTTTTCTCCA
+ACGGCGTTGATTGCCTGATA
+>gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_10_Transcript_4/8_Confidence_0.444_Length_1097_hit1_IdMatch=69.97,AligLength=383,E-val=1e-35
+TCAGCAAGTGGTAGCTTGCTAGTAGTTTTCCACCCTTTCCATTCGTATATTCCGAAACCA
+CCCAGTCGTTTAGGCAGGTGCAGCCAGTGATAGCTCTGTCCCGTGTATTTACTCCACTTA
+ATTTTGTTTGCTTGATGTAACCAATCCAATTGTTTCTTGCTTCTCCTTTCTAATAAATAG
+ATATTATTAGCGGTTGTCTCAACTTGTTGATTTGCAGTCCATGGTTGTGGGTTCCACGGT
+TTCCTTTGTGTCACGCTAGGGATAGCCCGATTTGTCCAGCCTCTGACGCCTTGAGTAGAT
+ATTTCTGTCCTTAAGAATTCGCAACAATTTTGCATAATTCCAAACTTGCTGTTTTCTCCA
+ACGGCGTTGATTGCCTGATA
+>gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_10_Transcript_2/8_Confidence_0.111_Length_1023_hit1_IdMatch=66.96,AligLength=896,E-val=3e-68
+TCAGCAAGTGGTAGCTTGCTAGTAGTTTTCCACCCTTTCCATTCGTATATTCCGAAACCA
+CCCAGTCGTTTAGGCAGGTGCAGCCAGTGATAGCTCTGTCCCGTGTATTTACTCCACTTA
+ATTTTGTTTGCTTGATGTAACCAATCCAATTGTTTCTTGCTTCTCCTTTCTAATAAATAG
+ATATTATTAGCGGTTGTCTCAACTTGTTGATTTGCAGTCCATGGTTGTGGGTTCCACGGT
+TTCCTTTGTGTCACGCTAGGGATAGCCCGATTTGTCCAGCCTCTGACGCCTTGAGTAGAT
+ATTTCTGTCCTTAAGAATTCGCAACAATTTTGCATAATTCCAAACTTGCTGTTTTCTCCA
+ACGGCGTTGATTGCCTGATAGCTATACCTAAACACCAGACATGTCATGAAATCCTTAGCT
+AATATTTTTGTGTCGTCGCCTTTCAATGCTATTAACCTAATGTTATCTTTGCCCAATATC
+AAACTCGTCTGATCTCTTGCTATATCCGTTGTTATCATATTCCAGACATTGCCGATGAAA
+CTTGTTGGACGTATTCCAGAAGGTATGCCGTTAGTCTGTTTCTTTGTTTCCTTTGTTAAC
+GGTGAGTACAGGTAATTATTGTCGTAACACGAAATATTTTTCGCAGCTATTTTAGTGAAT
+AAATGTCGATCTTGTGGAGGTACCAAATATTTGATTTGGTCTATGACGCGTTTCGTAATC
+TGCTTCACTTCCCAAATTGTTGGTTGTCTGTCAAACCCTTTGAAATCAAAAGGTAGGGCA
+AAACACCCGTCTTTCAATGCTTTAATTGTTTCACAGTTCCTAAGATGCGTTTCACCTGGT
+GTTTCGTCTAATGTTATGTATTTCCAATTTTTAAAGCCATGTCCAAATAGATA
+>gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_7_Transcript_7/11_Confidence_0.462_Length_4481_hit1_IdMatch=69.64,AligLength=504,E-val=5e-48
+TTTGTCAAGCGTTTTCCCTTCGACAAGGATGATGCCAAAGCTAGATGGGCAGAGATCAAC
+ACGCTGACGGGCTATTTGCAGAATGATTTTGGAAACTTCGATTACGATAAGGAATTTGAA
+GCTTTAGCTACCGGAGATAGTAACCACCCCGCTTGGTGGGAAGAAGTATTCACTAAGAAA
+ATAAAAGAGTTGATGACACATCAAGAACACAAAAAGTATATCAGTTTTGAAAAATATGTT
+AAGGAAGGATATTGGATAACATCTGGCAGCAGCAGCATCGGCAAAGTCAATTGGTCATAT
+GACGGAGACTTGGGCAAATTTAAGGCTAGAAAGAACATGTTATTAGATCTATATACGCCG
+GACGAAATCTACAAAATGGCTGTAGAATGGGACGGGAAACTAGAGAATAGAGTGTTCATC
+AAAGATGAATTGGCAAAGAGAAGATTGGCAGTGGCAAGCAATATTGAAGCATATTTGAAT
+CAAGGGTATATATTTTATCTATTTG
+>gi|307933349|dbj|AB555544.1|_Omono_River_virus_genes_for_capsid_protein,_RNA-dependent_RNA_polymera--Locus_7_Transcript_7/11_Confidence_0.462_Length_4481_hit3_IdMatch=64.49,AligLength=628,E-val=6e-21
+CCCTTTCGAAACGCAAACAACAATCTTGTAGCACCATACGTTGAAGCTTTCGTTGCCAAT
+CAAGCTTATTTCCCGATAGGATCGGGCCCAAACATCAACGACAAGGTTCTGTGGAATAGT