Mercurial > repos > artbio > metavisitor_2_workflows
comparison Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-1.ga @ 0:c375489bbcb0 draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows/metavisitor_2_workflows commit ecf95caa7d5e9ab001a75cbf5fb306e7ecd3def3
author | artbio |
---|---|
date | Sun, 21 Jul 2019 19:22:52 -0400 |
parents | |
children |
comparison
equal
deleted
inserted
replaced
-1:000000000000 | 0:c375489bbcb0 |
---|---|
1 { | |
2 "a_galaxy_workflow": "true", | |
3 "uuid": "1187ab6d-a4f6-4ee7-817c-d12db902fed7", | |
4 "tags": [], | |
5 "format-version": "0.1", | |
6 "version": 3, | |
7 "steps": { | |
8 "11": { | |
9 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/cap3/cap3/2.0.0", | |
10 "errors": null, | |
11 "uuid": "bd3f2dd0-b170-433d-b1e8-2b0f303006a7", | |
12 "tool_version": "2.0.0", | |
13 "outputs": [ | |
14 { | |
15 "type": "fasta", | |
16 "name": "contigsandsinglets" | |
17 }, | |
18 { | |
19 "type": "txt", | |
20 "name": "cap3stdout" | |
21 }, | |
22 { | |
23 "type": "fasta", | |
24 "name": "contigs" | |
25 }, | |
26 { | |
27 "type": "txt", | |
28 "name": "contigsqual" | |
29 }, | |
30 { | |
31 "type": "txt", | |
32 "name": "contigslink" | |
33 }, | |
34 { | |
35 "type": "txt", | |
36 "name": "ace" | |
37 }, | |
38 { | |
39 "type": "txt", | |
40 "name": "info" | |
41 }, | |
42 { | |
43 "type": "txt", | |
44 "name": "singlets" | |
45 } | |
46 ], | |
47 "post_job_actions": { | |
48 "HideDatasetActioninfo": { | |
49 "output_name": "info", | |
50 "action_type": "HideDatasetAction", | |
51 "action_arguments": {} | |
52 }, | |
53 "HideDatasetActioncontigsqual": { | |
54 "output_name": "contigsqual", | |
55 "action_type": "HideDatasetAction", | |
56 "action_arguments": {} | |
57 }, | |
58 "RenameDatasetActioncontigsandsinglets": { | |
59 "output_name": "contigsandsinglets", | |
60 "action_type": "RenameDatasetAction", | |
61 "action_arguments": { | |
62 "newname": "CAP3 assembled contigs" | |
63 } | |
64 }, | |
65 "HideDatasetActioncontigslink": { | |
66 "output_name": "contigslink", | |
67 "action_type": "HideDatasetAction", | |
68 "action_arguments": {} | |
69 }, | |
70 "HideDatasetActioncontigs": { | |
71 "output_name": "contigs", | |
72 "action_type": "HideDatasetAction", | |
73 "action_arguments": {} | |
74 }, | |
75 "HideDatasetActioncap3stdout": { | |
76 "output_name": "cap3stdout", | |
77 "action_type": "HideDatasetAction", | |
78 "action_arguments": {} | |
79 }, | |
80 "HideDatasetActionsinglets": { | |
81 "output_name": "singlets", | |
82 "action_type": "HideDatasetAction", | |
83 "action_arguments": {} | |
84 }, | |
85 "HideDatasetActionace": { | |
86 "output_name": "ace", | |
87 "action_type": "HideDatasetAction", | |
88 "action_arguments": {} | |
89 } | |
90 }, | |
91 "workflow_outputs": [ | |
92 { | |
93 "output_name": "contigsandsinglets", | |
94 "uuid": "e2dff9ee-9235-4087-9a51-30b5b9974537", | |
95 "label": null | |
96 } | |
97 ], | |
98 "annotation": "", | |
99 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/cap3/cap3/2.0.0", | |
100 "input_connections": { | |
101 "inputSequences": { | |
102 "output_name": "fastaOutput", | |
103 "id": 10 | |
104 } | |
105 }, | |
106 "inputs": [ | |
107 { | |
108 "name": "inputSequences", | |
109 "description": "runtime parameter for tool cap3" | |
110 } | |
111 ], | |
112 "position": { | |
113 "top": 633, | |
114 "left": 2061.5 | |
115 }, | |
116 "tool_state": "{\"overlapidentity\": \"\\\"90\\\"\", \"inputSequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"overlaplength\": \"\\\"40\\\"\", \"__page__\": null}", | |
117 "label": "CAP3 to re-assembe contigs", | |
118 "type": "tool", | |
119 "id": 11, | |
120 "tool_shed_repository": { | |
121 "owner": "artbio", | |
122 "changeset_revision": "d76a0d8a9eac", | |
123 "name": "cap3", | |
124 "tool_shed": "toolshed.g2.bx.psu.edu" | |
125 }, | |
126 "name": "cap3" | |
127 }, | |
128 "10": { | |
129 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", | |
130 "errors": null, | |
131 "uuid": "bac749b9-96e4-4a92-baac-cd160c09f9ec", | |
132 "tool_version": "2.6.1", | |
133 "outputs": [ | |
134 { | |
135 "type": "tabular", | |
136 "name": "tabularOutput" | |
137 }, | |
138 { | |
139 "type": "fasta", | |
140 "name": "fastaOutput" | |
141 }, | |
142 { | |
143 "type": "fasta", | |
144 "name": "al_sequences" | |
145 }, | |
146 { | |
147 "type": "fasta", | |
148 "name": "un_sequences" | |
149 } | |
150 ], | |
151 "post_job_actions": { | |
152 "RenameDatasetActionfastaOutput": { | |
153 "output_name": "fastaOutput", | |
154 "action_type": "RenameDatasetAction", | |
155 "action_arguments": { | |
156 "newname": "Assembled contigs hitting viral database" | |
157 } | |
158 }, | |
159 "HideDatasetActional_sequences": { | |
160 "output_name": "al_sequences", | |
161 "action_type": "HideDatasetAction", | |
162 "action_arguments": {} | |
163 }, | |
164 "HideDatasetActionun_sequences": { | |
165 "output_name": "un_sequences", | |
166 "action_type": "HideDatasetAction", | |
167 "action_arguments": {} | |
168 } | |
169 }, | |
170 "workflow_outputs": [ | |
171 { | |
172 "output_name": "tabularOutput", | |
173 "uuid": "f858a698-d9dd-4cc2-a047-6664b0519271", | |
174 "label": null | |
175 }, | |
176 { | |
177 "output_name": "fastaOutput", | |
178 "uuid": "d9c341c8-d826-4633-a6a5-9462677092d8", | |
179 "label": null | |
180 } | |
181 ], | |
182 "annotation": "", | |
183 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1", | |
184 "input_connections": { | |
185 "blast": { | |
186 "output_name": "output1", | |
187 "id": 9 | |
188 }, | |
189 "sequences": { | |
190 "output_name": "transcripts", | |
191 "id": 8 | |
192 } | |
193 }, | |
194 "inputs": [ | |
195 { | |
196 "name": "blast", | |
197 "description": "runtime parameter for tool Parse blast output and compile hits" | |
198 }, | |
199 { | |
200 "name": "sequences", | |
201 "description": "runtime parameter for tool Parse blast output and compile hits" | |
202 } | |
203 ], | |
204 "position": { | |
205 "top": 404, | |
206 "left": 1740 | |
207 }, | |
208 "tool_state": "{\"__page__\": null, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"__current_case__\\\": 1, \\\"filter_maxScore\\\": \\\"0.0\\\", \\\"filter_meanScore\\\": \\\"0.0\\\", \\\"filter_relativeCov\\\": \\\"0.0\\\", \\\"filter_term_in\\\": \\\"Nora_virus\\\", \\\"filter_term_out\\\": \\\"JX220408.1\\\", \\\"use_filters\\\": \\\"yes\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", | |
209 "label": "Get viral contigs", | |
210 "type": "tool", | |
211 "id": 10, | |
212 "tool_shed_repository": { | |
213 "owner": "artbio", | |
214 "changeset_revision": "b4c9c085d709", | |
215 "name": "blastparser_and_hits", | |
216 "tool_shed": "toolshed.g2.bx.psu.edu" | |
217 }, | |
218 "name": "Parse blast output and compile hits" | |
219 }, | |
220 "13": { | |
221 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_to_scaffold/blast2scaffold/1.0.0", | |
222 "errors": null, | |
223 "uuid": "7f0913f8-f7f9-4ba3-878c-9c502460331d", | |
224 "tool_version": "1.0.0", | |
225 "outputs": [ | |
226 { | |
227 "type": "fasta", | |
228 "name": "output" | |
229 } | |
230 ], | |
231 "post_job_actions": { | |
232 "HideDatasetActionoutput": { | |
233 "output_name": "output", | |
234 "action_type": "HideDatasetAction", | |
235 "action_arguments": {} | |
236 }, | |
237 "RenameDatasetActionoutput": { | |
238 "output_name": "output", | |
239 "action_type": "RenameDatasetAction", | |
240 "action_arguments": { | |
241 "newname": "generated CDS" | |
242 } | |
243 } | |
244 }, | |
245 "workflow_outputs": [], | |
246 "annotation": "Generate CDS from aligned contigs", | |
247 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blast_to_scaffold/blast2scaffold/1.0.0", | |
248 "input_connections": { | |
249 "guideSequence": { | |
250 "output_name": "outfile", | |
251 "id": 2 | |
252 }, | |
253 "blast_tab": { | |
254 "output_name": "output1", | |
255 "id": 12 | |
256 }, | |
257 "sequences": { | |
258 "output_name": "contigsandsinglets", | |
259 "id": 11 | |
260 } | |
261 }, | |
262 "inputs": [ | |
263 { | |
264 "name": "guideSequence", | |
265 "description": "runtime parameter for tool blast_to_scaffold" | |
266 }, | |
267 { | |
268 "name": "blast_tab", | |
269 "description": "runtime parameter for tool blast_to_scaffold" | |
270 }, | |
271 { | |
272 "name": "sequences", | |
273 "description": "runtime parameter for tool blast_to_scaffold" | |
274 } | |
275 ], | |
276 "position": { | |
277 "top": 669, | |
278 "left": 2728.5 | |
279 }, | |
280 "tool_state": "{\"__page__\": null, \"guideSequence\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast_tab\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", | |
281 "label": "Generate CDS", | |
282 "type": "tool", | |
283 "id": 13, | |
284 "tool_shed_repository": { | |
285 "owner": "artbio", | |
286 "changeset_revision": "7d96b28eec49", | |
287 "name": "blast_to_scaffold", | |
288 "tool_shed": "toolshed.g2.bx.psu.edu" | |
289 }, | |
290 "name": "blast_to_scaffold" | |
291 }, | |
292 "12": { | |
293 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", | |
294 "errors": null, | |
295 "uuid": "4f996123-d155-426a-ba26-e649c422431e", | |
296 "tool_version": "0.3.1", | |
297 "outputs": [ | |
298 { | |
299 "type": "tabular", | |
300 "name": "output1" | |
301 } | |
302 ], | |
303 "post_job_actions": { | |
304 "HideDatasetActionoutput1": { | |
305 "output_name": "output1", | |
306 "action_type": "HideDatasetAction", | |
307 "action_arguments": {} | |
308 }, | |
309 "RenameDatasetActionoutput1": { | |
310 "output_name": "output1", | |
311 "action_type": "RenameDatasetAction", | |
312 "action_arguments": { | |
313 "newname": "Contigs aligned to ${ncbi_guide_ID}" | |
314 } | |
315 } | |
316 }, | |
317 "workflow_outputs": [], | |
318 "annotation": "", | |
319 "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", | |
320 "input_connections": { | |
321 "query": { | |
322 "output_name": "contigsandsinglets", | |
323 "id": 11 | |
324 }, | |
325 "db_opts|histdb": { | |
326 "output_name": "outfile", | |
327 "id": 4 | |
328 } | |
329 }, | |
330 "inputs": [ | |
331 { | |
332 "name": "db_opts", | |
333 "description": "runtime parameter for tool NCBI BLAST+ blastn" | |
334 }, | |
335 { | |
336 "name": "query", | |
337 "description": "runtime parameter for tool NCBI BLAST+ blastn" | |
338 } | |
339 ], | |
340 "position": { | |
341 "top": 837, | |
342 "left": 2402 | |
343 }, | |
344 "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 0, \\\"adv_opts_selector\\\": \\\"basic\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", | |
345 "label": "Blast contigs to specific virus database", | |
346 "type": "tool", | |
347 "id": 12, | |
348 "tool_shed_repository": { | |
349 "owner": "devteam", | |
350 "changeset_revision": "e25d3acf6e68", | |
351 "name": "ncbi_blast_plus", | |
352 "tool_shed": "toolshed.g2.bx.psu.edu" | |
353 }, | |
354 "name": "NCBI BLAST+ blastn" | |
355 }, | |
356 "14": { | |
357 "tool_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0", | |
358 "errors": null, | |
359 "uuid": "c81173fb-317d-4c00-9da8-f0072b62a569", | |
360 "tool_version": "1.0.0", | |
361 "outputs": [ | |
362 { | |
363 "type": "input", | |
364 "name": "out_file1" | |
365 } | |
366 ], | |
367 "post_job_actions": { | |
368 "ChangeDatatypeActionout_file1": { | |
369 "output_name": "out_file1", | |
370 "action_type": "ChangeDatatypeAction", | |
371 "action_arguments": { | |
372 "newtype": "fasta" | |
373 } | |
374 }, | |
375 "RenameDatasetActionout_file1": { | |
376 "output_name": "out_file1", | |
377 "action_type": "RenameDatasetAction", | |
378 "action_arguments": { | |
379 "newname": "Nora_MV_${ncbi_guide_ID}_guided" | |
380 } | |
381 } | |
382 }, | |
383 "workflow_outputs": [ | |
384 { | |
385 "output_name": "out_file1", | |
386 "uuid": "e202eeb0-f65c-4295-afe0-44a56634a452", | |
387 "label": null | |
388 } | |
389 ], | |
390 "annotation": "", | |
391 "content_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0", | |
392 "input_connections": { | |
393 "input": { | |
394 "output_name": "output", | |
395 "id": 13 | |
396 } | |
397 }, | |
398 "inputs": [ | |
399 { | |
400 "name": "input", | |
401 "description": "runtime parameter for tool Regex Find And Replace" | |
402 } | |
403 ], | |
404 "position": { | |
405 "top": 927, | |
406 "left": 2971 | |
407 }, | |
408 "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"pattern\\\": \\\">.+\\\", \\\"replacement\\\": \\\">Nora_MV\\\"}]\", \"__page__\": null}", | |
409 "label": "Change CDS header", | |
410 "type": "tool", | |
411 "id": 14, | |
412 "tool_shed_repository": { | |
413 "owner": "galaxyp", | |
414 "changeset_revision": "209b7c5ee9d7", | |
415 "name": "regex_find_replace", | |
416 "tool_shed": "toolshed.g2.bx.psu.edu" | |
417 }, | |
418 "name": "Regex Find And Replace" | |
419 }, | |
420 "1": { | |
421 "tool_id": null, | |
422 "errors": null, | |
423 "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca", | |
424 "tool_version": null, | |
425 "outputs": [], | |
426 "workflow_outputs": [ | |
427 { | |
428 "output_name": "output", | |
429 "uuid": "6bd2d24e-e12f-41fe-9308-631cc6718143", | |
430 "label": null | |
431 } | |
432 ], | |
433 "annotation": "", | |
434 "content_id": null, | |
435 "input_connections": {}, | |
436 "inputs": [], | |
437 "position": { | |
438 "top": 976.9833374023438, | |
439 "left": 1205.9666748046875 | |
440 }, | |
441 "tool_state": "{}", | |
442 "label": "viral nucleotide BLAST database (V2)", | |
443 "type": "data_input", | |
444 "id": 1, | |
445 "name": "Input dataset" | |
446 }, | |
447 "0": { | |
448 "tool_id": null, | |
449 "errors": null, | |
450 "uuid": "aa5c2a9c-0f52-4884-9f1c-74432b24af61", | |
451 "tool_version": null, | |
452 "outputs": [], | |
453 "workflow_outputs": [ | |
454 { | |
455 "output_name": "output", | |
456 "uuid": "b5da90b2-1c4f-4646-8c70-fc9952f6cb94", | |
457 "label": null | |
458 } | |
459 ], | |
460 "annotation": "", | |
461 "content_id": null, | |
462 "input_connections": {}, | |
463 "inputs": [], | |
464 "position": { | |
465 "top": 163, | |
466 "left": 200 | |
467 }, | |
468 "tool_state": "{\"collection_type\": \"list\"}", | |
469 "label": "Fastq files", | |
470 "type": "data_collection_input", | |
471 "id": 0, | |
472 "name": "Input dataset collection" | |
473 }, | |
474 "3": { | |
475 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", | |
476 "errors": null, | |
477 "uuid": "41212793-f400-4bd6-9827-c083025f3e01", | |
478 "tool_version": "2.3.0", | |
479 "outputs": [ | |
480 { | |
481 "type": "input", | |
482 "name": "output" | |
483 } | |
484 ], | |
485 "post_job_actions": { | |
486 "RenameDatasetActionoutput": { | |
487 "output_name": "output", | |
488 "action_type": "RenameDatasetAction", | |
489 "action_arguments": { | |
490 "newname": "#{input} clipped" | |
491 } | |
492 } | |
493 }, | |
494 "workflow_outputs": [ | |
495 { | |
496 "output_name": "output", | |
497 "uuid": "3939be31-c091-4dbe-86a7-fd05c01f9598", | |
498 "label": null | |
499 } | |
500 ], | |
501 "annotation": "", | |
502 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", | |
503 "input_connections": { | |
504 "input": { | |
505 "output_name": "output", | |
506 "id": 0 | |
507 } | |
508 }, | |
509 "inputs": [ | |
510 { | |
511 "name": "input", | |
512 "description": "runtime parameter for tool Clip adapter" | |
513 } | |
514 ], | |
515 "position": { | |
516 "top": 318, | |
517 "left": 364.5 | |
518 }, | |
519 "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": null, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"__current_case__\\\": 0, \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"clip_source_list\\\": \\\"prebuilt\\\"}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"Nmode\": \"\\\"reject\\\"\"}", | |
520 "label": null, | |
521 "type": "tool", | |
522 "id": 3, | |
523 "tool_shed_repository": { | |
524 "owner": "artbio", | |
525 "changeset_revision": "f7947c5a18b8", | |
526 "name": "yac_clipper", | |
527 "tool_shed": "toolshed.g2.bx.psu.edu" | |
528 }, | |
529 "name": "Clip adapter" | |
530 }, | |
531 "2": { | |
532 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", | |
533 "errors": null, | |
534 "uuid": "13214523-9fb0-4e23-8cdf-f389331ba0c9", | |
535 "tool_version": "2.3.0", | |
536 "outputs": [ | |
537 { | |
538 "type": "fasta", | |
539 "name": "outfile" | |
540 }, | |
541 { | |
542 "type": "txt", | |
543 "name": "logfile" | |
544 } | |
545 ], | |
546 "post_job_actions": { | |
547 "HideDatasetActionlogfile": { | |
548 "output_name": "logfile", | |
549 "action_type": "HideDatasetAction", | |
550 "action_arguments": {} | |
551 }, | |
552 "RenameDatasetActionoutfile": { | |
553 "output_name": "outfile", | |
554 "action_type": "RenameDatasetAction", | |
555 "action_arguments": { | |
556 "newname": "${ncbi_guide_ID}" | |
557 } | |
558 } | |
559 }, | |
560 "workflow_outputs": [ | |
561 { | |
562 "output_name": "outfile", | |
563 "uuid": "9c9b23f2-66ae-4eeb-88f1-e4a0a8bd596b", | |
564 "label": null | |
565 } | |
566 ], | |
567 "annotation": "", | |
568 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/2.3.0", | |
569 "input_connections": {}, | |
570 "inputs": [], | |
571 "position": { | |
572 "top": 1043, | |
573 "left": 1750 | |
574 }, | |
575 "tool_state": "{\"__page__\": null, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"${ncbi_guide_ID}\\\"\", \"dbname\": \"\\\"nuccore\\\"\", \"dry_run\": \"\\\"false\\\"\"}", | |
576 "label": null, | |
577 "type": "tool", | |
578 "id": 2, | |
579 "tool_shed_repository": { | |
580 "owner": "artbio", | |
581 "changeset_revision": "c667d0ee39f5", | |
582 "name": "fetch_fasta_from_ncbi", | |
583 "tool_shed": "toolshed.g2.bx.psu.edu" | |
584 }, | |
585 "name": "Retrieve FASTA from NCBI" | |
586 }, | |
587 "5": { | |
588 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", | |
589 "errors": null, | |
590 "uuid": "02a6f0a8-8f83-4b0f-85ad-0370a5753a13", | |
591 "tool_version": "1.4.1", | |
592 "outputs": [ | |
593 { | |
594 "type": "input", | |
595 "name": "paired_output" | |
596 }, | |
597 { | |
598 "type": "input", | |
599 "name": "list_output" | |
600 }, | |
601 { | |
602 "type": "input", | |
603 "name": "out_file1" | |
604 }, | |
605 { | |
606 "type": "_sniff_", | |
607 "name": "paired_out_file" | |
608 } | |
609 ], | |
610 "post_job_actions": { | |
611 "HideDatasetActionpaired_out_file": { | |
612 "output_name": "paired_out_file", | |
613 "action_type": "HideDatasetAction", | |
614 "action_arguments": {} | |
615 }, | |
616 "RenameDatasetActionout_file1": { | |
617 "output_name": "out_file1", | |
618 "action_type": "RenameDatasetAction", | |
619 "action_arguments": { | |
620 "newname": "#{global_condition.inputs} concatenated" | |
621 } | |
622 }, | |
623 "HideDatasetActionpaired_output": { | |
624 "output_name": "paired_output", | |
625 "action_type": "HideDatasetAction", | |
626 "action_arguments": {} | |
627 }, | |
628 "HideDatasetActionout_file1": { | |
629 "output_name": "out_file1", | |
630 "action_type": "HideDatasetAction", | |
631 "action_arguments": {} | |
632 }, | |
633 "HideDatasetActionlist_output": { | |
634 "output_name": "list_output", | |
635 "action_type": "HideDatasetAction", | |
636 "action_arguments": {} | |
637 } | |
638 }, | |
639 "workflow_outputs": [], | |
640 "annotation": "", | |
641 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", | |
642 "input_connections": { | |
643 "global_condition|inputs": { | |
644 "output_name": "output", | |
645 "id": 3 | |
646 } | |
647 }, | |
648 "inputs": [ | |
649 { | |
650 "name": "global_condition", | |
651 "description": "runtime parameter for tool Concatenate multiple datasets" | |
652 } | |
653 ], | |
654 "position": { | |
655 "top": 492.5, | |
656 "left": 474 | |
657 }, | |
658 "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", | |
659 "label": "Concatenate read files", | |
660 "type": "tool", | |
661 "id": 5, | |
662 "tool_shed_repository": { | |
663 "owner": "artbio", | |
664 "changeset_revision": "55cf9d9defd1", | |
665 "name": "concatenate_multiple_datasets", | |
666 "tool_shed": "toolshed.g2.bx.psu.edu" | |
667 }, | |
668 "name": "Concatenate multiple datasets" | |
669 }, | |
670 "4": { | |
671 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1", | |
672 "errors": null, | |
673 "uuid": "1a39e6e8-8079-4f7a-b4c2-2028e5dbc2dd", | |
674 "tool_version": "0.3.1", | |
675 "outputs": [ | |
676 { | |
677 "type": "data", | |
678 "name": "outfile" | |
679 } | |
680 ], | |
681 "post_job_actions": { | |
682 "HideDatasetActionoutfile": { | |
683 "output_name": "outfile", | |
684 "action_type": "HideDatasetAction", | |
685 "action_arguments": {} | |
686 }, | |
687 "RenameDatasetActionoutfile": { | |
688 "output_name": "outfile", | |
689 "action_type": "RenameDatasetAction", | |
690 "action_arguments": { | |
691 "newname": "#{input_file} blast database" | |
692 } | |
693 } | |
694 }, | |
695 "workflow_outputs": [], | |
696 "annotation": "", | |
697 "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.3.1", | |
698 "input_connections": { | |
699 "input_file": { | |
700 "output_name": "outfile", | |
701 "id": 2 | |
702 } | |
703 }, | |
704 "inputs": [ | |
705 { | |
706 "name": "mask_data_file", | |
707 "description": "runtime parameter for tool NCBI BLAST+ makeblastdb" | |
708 }, | |
709 { | |
710 "name": "input_file", | |
711 "description": "runtime parameter for tool NCBI BLAST+ makeblastdb" | |
712 } | |
713 ], | |
714 "position": { | |
715 "top": 1060, | |
716 "left": 2100.5 | |
717 }, | |
718 "tool_state": "{\"__page__\": null, \"mask_data_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"input_file\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"true\\\"\", \"tax\": \"{\\\"__current_case__\\\": 0, \\\"taxselect\\\": \\\"\\\"}\", \"title\": \"\\\"Blastn candidate database\\\"\", \"parse_seqids\": \"\\\"false\\\"\"}", | |
719 "label": "Make a blast database", | |
720 "type": "tool", | |
721 "id": 4, | |
722 "tool_shed_repository": { | |
723 "owner": "devteam", | |
724 "changeset_revision": "e25d3acf6e68", | |
725 "name": "ncbi_blast_plus", | |
726 "tool_shed": "toolshed.g2.bx.psu.edu" | |
727 }, | |
728 "name": "NCBI BLAST+ makeblastdb" | |
729 }, | |
730 "7": { | |
731 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", | |
732 "errors": null, | |
733 "uuid": "62876927-ee09-4764-95eb-d86548fdce73", | |
734 "tool_version": "2.1.1", | |
735 "outputs": [ | |
736 { | |
737 "type": "tabular", | |
738 "name": "output" | |
739 }, | |
740 { | |
741 "type": "input", | |
742 "name": "aligned" | |
743 }, | |
744 { | |
745 "type": "input", | |
746 "name": "unaligned" | |
747 } | |
748 ], | |
749 "post_job_actions": { | |
750 "HideDatasetActionaligned": { | |
751 "output_name": "aligned", | |
752 "action_type": "HideDatasetAction", | |
753 "action_arguments": {} | |
754 }, | |
755 "HideDatasetActionoutput": { | |
756 "output_name": "output", | |
757 "action_type": "HideDatasetAction", | |
758 "action_arguments": {} | |
759 }, | |
760 "RenameDatasetActionunaligned": { | |
761 "output_name": "unaligned", | |
762 "action_type": "RenameDatasetAction", | |
763 "action_arguments": { | |
764 "newname": "Non D. melanogaster sequences" | |
765 } | |
766 } | |
767 }, | |
768 "workflow_outputs": [ | |
769 { | |
770 "output_name": "unaligned", | |
771 "uuid": "608ff661-018b-44c2-b020-59b31c5ff2d4", | |
772 "label": null | |
773 } | |
774 ], | |
775 "annotation": "Align reads to host (dm6) genome.\nThe unaligned reads will most likely have a viral source.", | |
776 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", | |
777 "input_connections": { | |
778 "input": { | |
779 "output_name": "output", | |
780 "id": 6 | |
781 } | |
782 }, | |
783 "inputs": [ | |
784 { | |
785 "name": "input", | |
786 "description": "runtime parameter for tool sR_bowtie" | |
787 } | |
788 ], | |
789 "position": { | |
790 "top": 238, | |
791 "left": 952 | |
792 }, | |
793 "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 0, \\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"dm6\\\"}\", \"method\": \"\\\"k_option\\\"\"}", | |
794 "label": "Get non-host sequences", | |
795 "type": "tool", | |
796 "id": 7, | |
797 "tool_shed_repository": { | |
798 "owner": "artbio", | |
799 "changeset_revision": "0281bb245635", | |
800 "name": "sr_bowtie", | |
801 "tool_shed": "toolshed.g2.bx.psu.edu" | |
802 }, | |
803 "name": "sR_bowtie" | |
804 }, | |
805 "6": { | |
806 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1", | |
807 "errors": null, | |
808 "uuid": "e693b793-ae94-42c8-9f59-4b4b847aa4b1", | |
809 "tool_version": "2.1.1", | |
810 "outputs": [ | |
811 { | |
812 "type": "fasta", | |
813 "name": "output" | |
814 } | |
815 ], | |
816 "post_job_actions": { | |
817 "RenameDatasetActionoutput": { | |
818 "output_name": "output", | |
819 "action_type": "RenameDatasetAction", | |
820 "action_arguments": { | |
821 "newname": "Initial Clipped sequences" | |
822 } | |
823 } | |
824 }, | |
825 "workflow_outputs": [ | |
826 { | |
827 "output_name": "output", | |
828 "uuid": "b81a3224-0d3e-4dec-996f-5fa3d525cabd", | |
829 "label": null | |
830 } | |
831 ], | |
832 "annotation": "", | |
833 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1", | |
834 "input_connections": { | |
835 "input": { | |
836 "output_name": "out_file1", | |
837 "id": 5 | |
838 } | |
839 }, | |
840 "inputs": [ | |
841 { | |
842 "name": "input", | |
843 "description": "runtime parameter for tool sequence_format_converter" | |
844 } | |
845 ], | |
846 "position": { | |
847 "top": 621, | |
848 "left": 787.5 | |
849 }, | |
850 "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"output_format\": \"\\\"fastaw\\\"\", \"__rerun_remap_job_id__\": null, \"__page__\": null}", | |
851 "label": "Change sequence format to weighted fasta", | |
852 "type": "tool", | |
853 "id": 6, | |
854 "tool_shed_repository": { | |
855 "owner": "artbio", | |
856 "changeset_revision": "f1d59113125a", | |
857 "name": "sequence_format_converter", | |
858 "tool_shed": "toolshed.g2.bx.psu.edu" | |
859 }, | |
860 "name": "sequence_format_converter" | |
861 }, | |
862 "9": { | |
863 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", | |
864 "errors": null, | |
865 "uuid": "37904c73-85c7-40e8-b1d5-e5f3d6a12135", | |
866 "tool_version": "0.3.1", | |
867 "outputs": [ | |
868 { | |
869 "type": "tabular", | |
870 "name": "output1" | |
871 } | |
872 ], | |
873 "post_job_actions": { | |
874 "HideDatasetActionoutput1": { | |
875 "output_name": "output1", | |
876 "action_type": "HideDatasetAction", | |
877 "action_arguments": {} | |
878 } | |
879 }, | |
880 "workflow_outputs": [], | |
881 "annotation": "Align the assembled transcripts to the viral database to filter out non-viral sequences.", | |
882 "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1", | |
883 "input_connections": { | |
884 "query": { | |
885 "output_name": "transcripts", | |
886 "id": 8 | |
887 }, | |
888 "db_opts|histdb": { | |
889 "output_name": "output", | |
890 "id": 1 | |
891 } | |
892 }, | |
893 "inputs": [ | |
894 { | |
895 "name": "db_opts", | |
896 "description": "runtime parameter for tool NCBI BLAST+ blastn" | |
897 }, | |
898 { | |
899 "name": "query", | |
900 "description": "runtime parameter for tool NCBI BLAST+ blastn" | |
901 } | |
902 ], | |
903 "position": { | |
904 "top": 690, | |
905 "left": 1455 | |
906 }, | |
907 "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 1, \\\"adv_optional_id_files_opts\\\": {\\\"__current_case__\\\": 0, \\\"adv_optional_id_files_opts_selector\\\": \\\"none\\\"}, \\\"adv_opts_selector\\\": \\\"advanced\\\", \\\"filter_query\\\": \\\"true\\\", \\\"gapextend\\\": \\\"\\\", \\\"gapopen\\\": \\\"\\\", \\\"identity_cutoff\\\": \\\"0.0\\\", \\\"max_hits\\\": \\\"5\\\", \\\"max_hsps\\\": \\\"\\\", \\\"parse_deflines\\\": \\\"false\\\", \\\"qcov_hsp_perc\\\": \\\"0.0\\\", \\\"strand\\\": \\\"-strand both\\\", \\\"ungapped\\\": \\\"false\\\", \\\"window_size\\\": \\\"\\\", \\\"word_size\\\": \\\"\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", | |
908 "label": "BLASTn contigs to the viral database", | |
909 "type": "tool", | |
910 "id": 9, | |
911 "tool_shed_repository": { | |
912 "owner": "devteam", | |
913 "changeset_revision": "e25d3acf6e68", | |
914 "name": "ncbi_blast_plus", | |
915 "tool_shed": "toolshed.g2.bx.psu.edu" | |
916 }, | |
917 "name": "NCBI BLAST+ blastn" | |
918 }, | |
919 "8": { | |
920 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", | |
921 "errors": null, | |
922 "uuid": "04b99c48-2bf7-4842-b28e-c9085ffe40e9", | |
923 "tool_version": "1.2.2", | |
924 "outputs": [ | |
925 { | |
926 "type": "fasta", | |
927 "name": "transcripts" | |
928 } | |
929 ], | |
930 "post_job_actions": { | |
931 "ChangeDatatypeActiontranscripts": { | |
932 "output_name": "transcripts", | |
933 "action_type": "ChangeDatatypeAction", | |
934 "action_arguments": { | |
935 "newtype": "fasta" | |
936 } | |
937 }, | |
938 "RenameDatasetActiontranscripts": { | |
939 "output_name": "transcripts", | |
940 "action_type": "RenameDatasetAction", | |
941 "action_arguments": { | |
942 "newname": "Oases Contigs" | |
943 } | |
944 } | |
945 }, | |
946 "workflow_outputs": [ | |
947 { | |
948 "output_name": "transcripts", | |
949 "uuid": "704bb7a9-199c-4028-a482-ebc60ab1d02e", | |
950 "label": null | |
951 } | |
952 ], | |
953 "annotation": "", | |
954 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2", | |
955 "input_connections": { | |
956 "inputs_0|input": { | |
957 "output_name": "unaligned", | |
958 "id": 7 | |
959 } | |
960 }, | |
961 "inputs": [], | |
962 "position": { | |
963 "top": 442, | |
964 "left": 1287 | |
965 }, | |
966 "tool_state": "{\"__page__\": null, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}", | |
967 "label": "Assemble contigs", | |
968 "type": "tool", | |
969 "id": 8, | |
970 "tool_shed_repository": { | |
971 "owner": "artbio", | |
972 "changeset_revision": "f7dd852c8f4c", | |
973 "name": "oases", | |
974 "tool_shed": "toolshed.g2.bx.psu.edu" | |
975 }, | |
976 "name": "Oases_optimiser" | |
977 } | |
978 }, | |
979 "annotation": "", | |
980 "name": "Metavisitor: Workflow for Use Case 1-1" | |
981 } |