Mercurial > repos > artbio > metavisitor_2_workflows

comparison Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-4.ga @ 0:c375489bbcb0 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows/metavisitor_2_workflows commit ecf95caa7d5e9ab001a75cbf5fb306e7ecd3def3
author artbio
date Sun, 21 Jul 2019 19:22:52 -0400
parents
children
comparison
equal deleted inserted replaced
-1:000000000000 0:c375489bbcb0
1 {
2 "a_galaxy_workflow": "true",
3 "uuid": "c87376ff-1e6d-47a3-ad9a-2defc67e5f7d",
4 "tags": [],
5 "format-version": "0.1",
6 "version": 2,
7 "steps": {
8 "1": {
9 "tool_id": null,
10 "errors": null,
11 "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca",
12 "tool_version": null,
13 "outputs": [],
14 "workflow_outputs": [
15 {
16 "output_name": "output",
17 "uuid": "6bd2d24e-e12f-41fe-9308-631cc6718143",
18 "label": null
19 }
20 ],
21 "annotation": "",
22 "content_id": null,
23 "input_connections": {},
24 "inputs": [],
25 "position": {
26 "top": 799.9833374023438,
27 "left": 1109.9666748046875
28 },
29 "tool_state": "{}",
30 "label": "viral nucleotide BLAST database (V2)",
31 "type": "data_input",
32 "id": 1,
33 "name": "Input dataset"
34 },
35 "0": {
36 "tool_id": null,
37 "errors": null,
38 "uuid": "aa5c2a9c-0f52-4884-9f1c-74432b24af61",
39 "tool_version": null,
40 "outputs": [],
41 "workflow_outputs": [
42 {
43 "output_name": "output",
44 "uuid": "b5da90b2-1c4f-4646-8c70-fc9952f6cb94",
45 "label": null
46 }
47 ],
48 "annotation": "",
49 "content_id": null,
50 "input_connections": {},
51 "inputs": [],
52 "position": {
53 "top": 597,
54 "left": 298
55 },
56 "tool_state": "{\"collection_type\": \"list\"}",
57 "label": null,
58 "type": "data_collection_input",
59 "id": 0,
60 "name": "Input dataset collection"
61 },
62 "3": {
63 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1",
64 "errors": null,
65 "uuid": "31d99ab7-8eb2-458c-82bd-b8c90e8689a5",
66 "tool_version": "1.4.1",
67 "outputs": [
68 {
69 "type": "input",
70 "name": "paired_output"
71 },
72 {
73 "type": "input",
74 "name": "list_output"
75 },
76 {
77 "type": "input",
78 "name": "out_file1"
79 },
80 {
81 "type": "_sniff_",
82 "name": "paired_out_file"
83 }
84 ],
85 "post_job_actions": {
86 "HideDatasetActionpaired_out_file": {
87 "output_name": "paired_out_file",
88 "action_type": "HideDatasetAction",
89 "action_arguments": {}
90 },
91 "HideDatasetActionout_file1": {
92 "output_name": "out_file1",
93 "action_type": "HideDatasetAction",
94 "action_arguments": {}
95 },
96 "HideDatasetActionlist_output": {
97 "output_name": "list_output",
98 "action_type": "HideDatasetAction",
99 "action_arguments": {}
100 },
101 "HideDatasetActionpaired_output": {
102 "output_name": "paired_output",
103 "action_type": "HideDatasetAction",
104 "action_arguments": {}
105 }
106 },
107 "workflow_outputs": [],
108 "annotation": "",
109 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1",
110 "input_connections": {
111 "global_condition|inputs": {
112 "output_name": "output",
113 "id": 2
114 }
115 },
116 "inputs": [
117 {
118 "name": "global_condition",
119 "description": "runtime parameter for tool Concatenate multiple datasets"
120 }
121 ],
122 "position": {
123 "top": 539.5,
124 "left": 568
125 },
126 "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}",
127 "label": null,
128 "type": "tool",
129 "id": 3,
130 "tool_shed_repository": {
131 "owner": "artbio",
132 "changeset_revision": "55cf9d9defd1",
133 "name": "concatenate_multiple_datasets",
134 "tool_shed": "toolshed.g2.bx.psu.edu"
135 },
136 "name": "Concatenate multiple datasets"
137 },
138 "2": {
139 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0",
140 "errors": null,
141 "uuid": "41212793-f400-4bd6-9827-c083025f3e01",
142 "tool_version": "2.3.0",
143 "outputs": [
144 {
145 "type": "input",
146 "name": "output"
147 }
148 ],
149 "post_job_actions": {
150 "RenameDatasetActionoutput": {
151 "output_name": "output",
152 "action_type": "RenameDatasetAction",
153 "action_arguments": {
154 "newname": "#{input} clipped"
155 }
156 }
157 },
158 "workflow_outputs": [
159 {
160 "output_name": "output",
161 "uuid": "2f70387c-80f0-47d5-86ac-ec54a6349f0d",
162 "label": null
163 }
164 ],
165 "annotation": "",
166 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0",
167 "input_connections": {
168 "input": {
169 "output_name": "output",
170 "id": 0
171 }
172 },
173 "inputs": [
174 {
175 "name": "input",
176 "description": "runtime parameter for tool Clip adapter"
177 }
178 ],
179 "position": {
180 "top": 782,
181 "left": 429.5
182 },
183 "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": null, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"__current_case__\\\": 0, \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"clip_source_list\\\": \\\"prebuilt\\\"}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"Nmode\": \"\\\"reject\\\"\"}",
184 "label": null,
185 "type": "tool",
186 "id": 2,
187 "tool_shed_repository": {
188 "owner": "artbio",
189 "changeset_revision": "f7947c5a18b8",
190 "name": "yac_clipper",
191 "tool_shed": "toolshed.g2.bx.psu.edu"
192 },
193 "name": "Clip adapter"
194 },
195 "5": {
196 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1",
197 "errors": null,
198 "uuid": "0094651e-e2dc-4932-87eb-9f1292b85bbf",
199 "tool_version": "2.1.1",
200 "outputs": [
201 {
202 "type": "tabular",
203 "name": "output"
204 },
205 {
206 "type": "input",
207 "name": "aligned"
208 },
209 {
210 "type": "input",
211 "name": "unaligned"
212 }
213 ],
214 "post_job_actions": {
215 "HideDatasetActionaligned": {
216 "output_name": "aligned",
217 "action_type": "HideDatasetAction",
218 "action_arguments": {}
219 },
220 "HideDatasetActionoutput": {
221 "output_name": "output",
222 "action_type": "HideDatasetAction",
223 "action_arguments": {}
224 },
225 "RenameDatasetActionunaligned": {
226 "output_name": "unaligned",
227 "action_type": "RenameDatasetAction",
228 "action_arguments": {
229 "newname": "Non D. melanogaster sequences"
230 }
231 }
232 },
233 "workflow_outputs": [
234 {
235 "output_name": "unaligned",
236 "uuid": "5fdb9817-061d-438b-8605-95b63d290655",
237 "label": null
238 }
239 ],
240 "annotation": "Get non-host reads",
241 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1",
242 "input_connections": {
243 "input": {
244 "output_name": "output",
245 "id": 4
246 }
247 },
248 "inputs": [
249 {
250 "name": "input",
251 "description": "runtime parameter for tool sR_bowtie"
252 }
253 ],
254 "position": {
255 "top": 574,
256 "left": 876
257 },
258 "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 0, \\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"dm6\\\"}\", \"method\": \"\\\"k_option\\\"\"}",
259 "label": "Align to host genome",
260 "type": "tool",
261 "id": 5,
262 "tool_shed_repository": {
263 "owner": "artbio",
264 "changeset_revision": "0281bb245635",
265 "name": "sr_bowtie",
266 "tool_shed": "toolshed.g2.bx.psu.edu"
267 },
268 "name": "sR_bowtie"
269 },
270 "4": {
271 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1",
272 "errors": null,
273 "uuid": "a82646ef-d5fe-4e6b-b294-19005c9973e4",
274 "tool_version": "2.1.1",
275 "outputs": [
276 {
277 "type": "fasta",
278 "name": "output"
279 }
280 ],
281 "post_job_actions": {
282 "RenameDatasetActionoutput": {
283 "output_name": "output",
284 "action_type": "RenameDatasetAction",
285 "action_arguments": {
286 "newname": "Initial Clipped sequences"
287 }
288 }
289 },
290 "workflow_outputs": [
291 {
292 "output_name": "output",
293 "uuid": "a2474d73-a111-4675-b236-df907b7dbf1a",
294 "label": null
295 }
296 ],
297 "annotation": "",
298 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sequence_format_converter/sequence_format_converter/2.1.1",
299 "input_connections": {
300 "input": {
301 "output_name": "out_file1",
302 "id": 3
303 }
304 },
305 "inputs": [
306 {
307 "name": "input",
308 "description": "runtime parameter for tool sequence_format_converter"
309 }
310 ],
311 "position": {
312 "top": 804,
313 "left": 720.5
314 },
315 "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"output_format\": \"\\\"fastaw\\\"\", \"__rerun_remap_job_id__\": null, \"__page__\": null}",
316 "label": "Collapse reads",
317 "type": "tool",
318 "id": 4,
319 "tool_shed_repository": {
320 "owner": "artbio",
321 "changeset_revision": "f1d59113125a",
322 "name": "sequence_format_converter",
323 "tool_shed": "toolshed.g2.bx.psu.edu"
324 },
325 "name": "sequence_format_converter"
326 },
327 "7": {
328 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1",
329 "errors": null,
330 "uuid": "37904c73-85c7-40e8-b1d5-e5f3d6a12135",
331 "tool_version": "0.3.1",
332 "outputs": [
333 {
334 "type": "tabular",
335 "name": "output1"
336 }
337 ],
338 "post_job_actions": {
339 "HideDatasetActionoutput1": {
340 "output_name": "output1",
341 "action_type": "HideDatasetAction",
342 "action_arguments": {}
343 }
344 },
345 "workflow_outputs": [],
346 "annotation": "",
347 "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.3.1",
348 "input_connections": {
349 "query": {
350 "output_name": "transcripts",
351 "id": 6
352 },
353 "db_opts|histdb": {
354 "output_name": "output",
355 "id": 1
356 }
357 },
358 "inputs": [
359 {
360 "name": "db_opts",
361 "description": "runtime parameter for tool NCBI BLAST+ blastn"
362 },
363 {
364 "name": "query",
365 "description": "runtime parameter for tool NCBI BLAST+ blastn"
366 }
367 ],
368 "position": {
369 "top": 782,
370 "left": 1340
371 },
372 "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"__current_case__\\\": 2, \\\"ext_cols\\\": [\\\"slen\\\"], \\\"ids_cols\\\": null, \\\"misc_cols\\\": null, \\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"tax_cols\\\": null}\", \"adv_opts\": \"{\\\"__current_case__\\\": 1, \\\"adv_optional_id_files_opts\\\": {\\\"__current_case__\\\": 0, \\\"adv_optional_id_files_opts_selector\\\": \\\"none\\\"}, \\\"adv_opts_selector\\\": \\\"advanced\\\", \\\"filter_query\\\": \\\"true\\\", \\\"gapextend\\\": \\\"\\\", \\\"gapopen\\\": \\\"\\\", \\\"identity_cutoff\\\": \\\"0.0\\\", \\\"max_hits\\\": \\\"5\\\", \\\"max_hsps\\\": \\\"\\\", \\\"parse_deflines\\\": \\\"false\\\", \\\"qcov_hsp_perc\\\": \\\"0.0\\\", \\\"strand\\\": \\\"-strand both\\\", \\\"ungapped\\\": \\\"false\\\", \\\"window_size\\\": \\\"\\\", \\\"word_size\\\": \\\"\\\"}\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\", \\\"db_opts_selector\\\": \\\"histdb\\\", \\\"histdb\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"subject\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}",
373 "label": "Blast assembled reads to vir2",
374 "type": "tool",
375 "id": 7,
376 "tool_shed_repository": {
377 "owner": "devteam",
378 "changeset_revision": "e25d3acf6e68",
379 "name": "ncbi_blast_plus",
380 "tool_shed": "toolshed.g2.bx.psu.edu"
381 },
382 "name": "NCBI BLAST+ blastn"
383 },
384 "6": {
385 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2",
386 "errors": null,
387 "uuid": "04b99c48-2bf7-4842-b28e-c9085ffe40e9",
388 "tool_version": "1.2.2",
389 "outputs": [
390 {
391 "type": "fasta",
392 "name": "transcripts"
393 }
394 ],
395 "post_job_actions": {
396 "ChangeDatatypeActiontranscripts": {
397 "output_name": "transcripts",
398 "action_type": "ChangeDatatypeAction",
399 "action_arguments": {
400 "newtype": "fasta"
401 }
402 },
403 "RenameDatasetActiontranscripts": {
404 "output_name": "transcripts",
405 "action_type": "RenameDatasetAction",
406 "action_arguments": {
407 "newname": "Oases Contigs"
408 }
409 }
410 },
411 "workflow_outputs": [
412 {
413 "output_name": "transcripts",
414 "uuid": "704bb7a9-199c-4028-a482-ebc60ab1d02e",
415 "label": null
416 }
417 ],
418 "annotation": "",
419 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/oases/oasesoptimiserv/1.2.2",
420 "input_connections": {
421 "inputs_0|input": {
422 "output_name": "unaligned",
423 "id": 5
424 }
425 },
426 "inputs": [],
427 "position": {
428 "top": 623,
429 "left": 1167
430 },
431 "tool_state": "{\"__page__\": null, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}",
432 "label": "Assemble reads",
433 "type": "tool",
434 "id": 6,
435 "tool_shed_repository": {
436 "owner": "artbio",
437 "changeset_revision": "f7dd852c8f4c",
438 "name": "oases",
439 "tool_shed": "toolshed.g2.bx.psu.edu"
440 },
441 "name": "Oases_optimiser"
442 },
443 "8": {
444 "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1",
445 "errors": null,
446 "uuid": "bbbbec1e-cc46-4b89-aa5c-3213562ae405",
447 "tool_version": "2.6.1",
448 "outputs": [
449 {
450 "type": "tabular",
451 "name": "tabularOutput"
452 },
453 {
454 "type": "fasta",
455 "name": "fastaOutput"
456 },
457 {
458 "type": "fasta",
459 "name": "al_sequences"
460 },
461 {
462 "type": "fasta",
463 "name": "un_sequences"
464 }
465 ],
466 "post_job_actions": {
467 "HideDatasetActional_sequences": {
468 "output_name": "al_sequences",
469 "action_type": "HideDatasetAction",
470 "action_arguments": {}
471 },
472 "RenameDatasetActiontabularOutput": {
473 "output_name": "tabularOutput",
474 "action_type": "RenameDatasetAction",
475 "action_arguments": {
476 "newname": "Blastn assembled reads vs vir2"
477 }
478 },
479 "HideDatasetActionun_sequences": {
480 "output_name": "un_sequences",
481 "action_type": "HideDatasetAction",
482 "action_arguments": {}
483 },
484 "HideDatasetActionfastaOutput": {
485 "output_name": "fastaOutput",
486 "action_type": "HideDatasetAction",
487 "action_arguments": {}
488 }
489 },
490 "workflow_outputs": [
491 {
492 "output_name": "tabularOutput",
493 "uuid": "f73c0a89-1b19-4dd5-843f-3c7c68d13338",
494 "label": null
495 }
496 ],
497 "annotation": "",
498 "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/blastparser_and_hits/BlastParser_and_hits/2.6.1",
499 "input_connections": {
500 "blast": {
501 "output_name": "output1",
502 "id": 7
503 },
504 "sequences": {
505 "output_name": "transcripts",
506 "id": 6
507 }
508 },
509 "inputs": [
510 {
511 "name": "blast",
512 "description": "runtime parameter for tool Parse blast output and compile hits"
513 },
514 {
515 "name": "sequences",
516 "description": "runtime parameter for tool Parse blast output and compile hits"
517 }
518 ],
519 "position": {
520 "top": 579,
521 "left": 1652
522 },
523 "tool_state": "{\"__page__\": null, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"__current_case__\\\": 0, \\\"use_filters\\\": \\\"no\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"blast\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}",
524 "label": null,
525 "type": "tool",
526 "id": 8,
527 "tool_shed_repository": {
528 "owner": "artbio",
529 "changeset_revision": "b4c9c085d709",
530 "name": "blastparser_and_hits",
531 "tool_shed": "toolshed.g2.bx.psu.edu"
532 },
533 "name": "Parse blast output and compile hits"
534 }
535 },
536 "annotation": "",
537 "name": "Metavisitor: Workflow for Use Case 1-4"
538 }