Mercurial > repos > artbio > metavisitor_2_workflows
view Galaxy-Workflow-Metavisitor__Workflow_for_small_RNA_profiling_of_contigs.ga @ 1:6396f06de8a9 draft default tip
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows/metavisitor_2_workflows commit 46881c948d0ad16e8c687657648402eeb5a886fb
author | artbio |
---|---|
date | Wed, 21 Aug 2019 06:30:46 -0400 |
parents | c375489bbcb0 |
children |
line wrap: on
line source
{ "a_galaxy_workflow": "true", "uuid": "691e3812-602f-4492-93f3-f1355698b197", "tags": [], "format-version": "0.1", "version": 1, "steps": { "1": { "tool_id": null, "errors": null, "uuid": "9b24b7ef-5eb5-4c87-9272-42f9f05e109f", "tool_version": null, "outputs": [], "workflow_outputs": [ { "output_name": "output", "uuid": "aa452f52-79bc-4b65-b230-6bcd9badfb2f", "label": null } ], "annotation": "", "content_id": null, "input_connections": {}, "inputs": [], "position": { "top": 439, "left": 304 }, "tool_state": "{}", "label": "de novo assembled Oases contigs", "type": "data_input", "id": 1, "name": "Input dataset" }, "0": { "tool_id": null, "errors": null, "uuid": "ed07d831-9b23-4def-b883-f6fe24eb55a0", "tool_version": null, "outputs": [], "workflow_outputs": [ { "output_name": "output", "uuid": "e73d1517-c1f3-4a7f-8fbd-e2297906ee1f", "label": null } ], "annotation": "", "content_id": null, "input_connections": {}, "inputs": [], "position": { "top": 289, "left": 271 }, "tool_state": "{\"collection_type\": \"list\"}", "label": "Input Dataset Collection of fastq reads", "type": "data_collection_input", "id": 0, "name": "Input dataset collection" }, "3": { "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1", "errors": null, "uuid": "88093ee6-2279-4398-8350-6c0e6f59720c", "tool_version": "1.1", "outputs": [ { "type": "fasta", "name": "output" } ], "post_job_actions": { "RenameDatasetActionoutput": { "output_name": "output", "action_type": "RenameDatasetAction", "action_arguments": { "newname": "Contig (>300 nt)" } } }, "workflow_outputs": [ { "output_name": "output", "uuid": "7eaafc91-9c84-4307-bbff-6ad629170bdc", "label": null } ], "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1", "input_connections": { "input": { "output_name": "output", "id": 1 } }, "inputs": [ { "name": "input", "description": "runtime parameter for tool Filter sequences by length" } ], "position": { "top": 451, "left": 569 }, "tool_state": "{\"__page__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"max_length\": \"\\\"0\\\"\", \"min_length\": \"\\\"300\\\"\"}", "label": null, "type": "tool", "id": 3, "tool_shed_repository": { "owner": "devteam", "changeset_revision": "2fd6033d0e9c", "name": "fasta_filter_by_length", "tool_shed": "toolshed.g2.bx.psu.edu" }, "name": "Filter sequences by length" }, "2": { "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", "errors": null, "uuid": "a07a6d78-bdd3-4092-b463-c0bd7f796efe", "tool_version": "2.3.0", "outputs": [ { "type": "input", "name": "output" } ], "post_job_actions": { "RenameDatasetActionoutput": { "output_name": "output", "action_type": "RenameDatasetAction", "action_arguments": { "newname": "Clipped reads" } } }, "workflow_outputs": [ { "output_name": "output", "uuid": "890a91ad-07e6-421d-a40f-b75aff18f95b", "label": null } ], "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/yac_clipper/yac/2.3.0", "input_connections": { "input": { "output_name": "output", "id": 0 } }, "inputs": [ { "name": "input", "description": "runtime parameter for tool Clip adapter" } ], "position": { "top": 294, "left": 587 }, "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": null, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"__current_case__\\\": 0, \\\"clip_sequence\\\": \\\"TGGAATTCTCGGGTGCCAAG\\\", \\\"clip_source_list\\\": \\\"prebuilt\\\"}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"Nmode\": \"\\\"reject\\\"\"}", "label": null, "type": "tool", "id": 2, "tool_shed_repository": { "owner": "artbio", "changeset_revision": "f7947c5a18b8", "name": "yac_clipper", "tool_shed": "toolshed.g2.bx.psu.edu" }, "name": "Clip adapter" }, "5": { "tool_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0", "errors": null, "uuid": "a069c8db-14ef-4708-89be-3a5d5a926498", "tool_version": "1.0.0", "outputs": [ { "type": "input", "name": "out_file1" } ], "post_job_actions": { "RenameDatasetActionout_file1": { "output_name": "out_file1", "action_type": "RenameDatasetAction", "action_arguments": { "newname": "contig (>300t, simplified names)" } } }, "workflow_outputs": [ { "output_name": "out_file1", "uuid": "fa095644-f7e0-4c44-a555-4d24f8fddc85", "label": null } ], "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/galaxyp/regex_find_replace/regex1/1.0.0", "input_connections": { "input": { "output_name": "output", "id": 3 } }, "inputs": [ { "name": "input", "description": "runtime parameter for tool Regex Find And Replace" } ], "position": { "top": 443, "left": 842 }, "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"pattern\\\": \\\"_Confidence_.+\\\", \\\"replacement\\\": \\\"\\\"}]\", \"__page__\": null}", "label": null, "type": "tool", "id": 5, "tool_shed_repository": { "owner": "galaxyp", "changeset_revision": "209b7c5ee9d7", "name": "regex_find_replace", "tool_shed": "toolshed.g2.bx.psu.edu" }, "name": "Regex Find And Replace" }, "4": { "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", "errors": null, "uuid": "a10d3b12-9018-4b96-9492-18e1b1e87a83", "tool_version": "1.4.1", "outputs": [ { "type": "input", "name": "paired_output" }, { "type": "input", "name": "list_output" }, { "type": "input", "name": "out_file1" }, { "type": "_sniff_", "name": "paired_out_file" } ], "post_job_actions": { "HideDatasetActionpaired_out_file": { "output_name": "paired_out_file", "action_type": "HideDatasetAction", "action_arguments": {} }, "RenameDatasetActionout_file1": { "output_name": "out_file1", "action_type": "RenameDatasetAction", "action_arguments": { "newname": "Merged clipped reads" } }, "HideDatasetActionpaired_output": { "output_name": "paired_output", "action_type": "HideDatasetAction", "action_arguments": {} }, "HideDatasetActionlist_output": { "output_name": "list_output", "action_type": "HideDatasetAction", "action_arguments": {} } }, "workflow_outputs": [ { "output_name": "out_file1", "uuid": "362a4d36-9fd9-4f68-a271-d068a245d307", "label": null } ], "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/concatenate_multiple_datasets/cat_multi_datasets/1.4.1", "input_connections": { "global_condition|inputs": { "output_name": "output", "id": 2 } }, "inputs": [ { "name": "global_condition", "description": "runtime parameter for tool Concatenate multiple datasets" } ], "position": { "top": 221.5, "left": 831 }, "tool_state": "{\"dataset_names\": \"\\\"false\\\"\", \"headers\": \"\\\"0\\\"\", \"__page__\": null, \"__rerun_remap_job_id__\": null, \"global_condition\": \"{\\\"__current_case__\\\": 0, \\\"input_type\\\": \\\"singles\\\", \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\"}", "label": null, "type": "tool", "id": 4, "tool_shed_repository": { "owner": "artbio", "changeset_revision": "55cf9d9defd1", "name": "concatenate_multiple_datasets", "tool_shed": "toolshed.g2.bx.psu.edu" }, "name": "Concatenate multiple datasets" }, "7": { "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/small_rna_maps/small_rna_maps/2.14.0", "errors": null, "uuid": "95dc4ba8-402f-4d64-b5e9-8706589bc7fc", "tool_version": "2.14.0", "outputs": [ { "type": "tabular", "name": "output_tab" }, { "type": "bed", "name": "output_bed" }, { "type": "tabular", "name": "extra_output_tab" }, { "type": "pdf", "name": "output_pdf" } ], "post_job_actions": { "HideDatasetActionextra_output_tab": { "output_name": "extra_output_tab", "action_type": "HideDatasetAction", "action_arguments": {} }, "HideDatasetActionoutput_tab": { "output_name": "output_tab", "action_type": "HideDatasetAction", "action_arguments": {} } }, "workflow_outputs": [ { "output_name": "output_bed", "uuid": "cab2a668-47c6-4e86-aab6-22155d6a3e4d", "label": null }, { "output_name": "output_pdf", "uuid": "9436b9c9-2dda-4649-8367-10e71d3a429e", "label": null } ], "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/small_rna_maps/small_rna_maps/2.14.0", "input_connections": { "inputs": { "output_name": "output", "id": 6 } }, "inputs": [ { "name": "inputs", "description": "runtime parameter for tool small_rna_maps" } ], "position": { "top": 383, "left": 1496.5 }, "tool_state": "{\"inputs\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__page__\": null, \"series\": \"[{\\\"__index__\\\": 0, \\\"inputs\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"normalization\\\": \\\"1.0\\\"}]\", \"__rerun_remap_job_id__\": null, \"ylimits_cond\": \"{\\\"__current_case__\\\": 1, \\\"ylimits\\\": \\\"false\\\"}\", \"minsize\": \"\\\"18\\\"\", \"cluster\": \"\\\"0\\\"\", \"maxsize\": \"\\\"30\\\"\", \"normalization\": \"\\\"1\\\"\", \"plots_options\": \"{\\\"__current_case__\\\": 0, \\\"extra_plot\\\": \\\"Size\\\", \\\"first_plot\\\": \\\"Counts\\\", \\\"plots_options_selector\\\": \\\"two_plot\\\"}\"}", "label": null, "type": "tool", "id": 7, "tool_shed_repository": { "owner": "artbio", "changeset_revision": "14adf24603b6", "name": "small_rna_maps", "tool_shed": "toolshed.g2.bx.psu.edu" }, "name": "small_rna_maps" }, "6": { "tool_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", "errors": null, "uuid": "7e4be478-ae45-4282-812c-e72dc15c3d2d", "tool_version": "2.1.1", "outputs": [ { "type": "tabular", "name": "output" }, { "type": "input", "name": "aligned" }, { "type": "input", "name": "unaligned" } ], "post_job_actions": { "HideDatasetActionunaligned": { "output_name": "unaligned", "action_type": "HideDatasetAction", "action_arguments": {} }, "HideDatasetActionaligned": { "output_name": "aligned", "action_type": "HideDatasetAction", "action_arguments": {} } }, "workflow_outputs": [ { "output_name": "output", "uuid": "39529cb2-4ae9-4b89-bab0-9cb59f577046", "label": null } ], "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/artbio/sr_bowtie/bowtieForSmallRNA/2.1.1", "input_connections": { "input": { "output_name": "out_file1", "id": 4 }, "refGenomeSource|ownFile": { "output_name": "out_file1", "id": 5 } }, "inputs": [ { "name": "input", "description": "runtime parameter for tool sR_bowtie" }, { "name": "refGenomeSource", "description": "runtime parameter for tool sR_bowtie" } ], "position": { "top": 368, "left": 1164 }, "tool_state": "{\"__page__\": null, \"output_format\": \"\\\"tabular\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"__current_case__\\\": 1, \\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}\", \"method\": \"\\\"a_option\\\"\"}", "label": "Align reads against contigs", "type": "tool", "id": 6, "tool_shed_repository": { "owner": "artbio", "changeset_revision": "0281bb245635", "name": "sr_bowtie", "tool_shed": "toolshed.g2.bx.psu.edu" }, "name": "sR_bowtie" } }, "annotation": "", "name": "Metavisitor: Workflow for small RNA profiling of contigs" }