changeset 0:fec6a0b53189 draft

"planemo upload for repository https://bionanogenomics.com/support/software-downloads/ commit 1d3a1a449c7398c8fad07663224738265f77c0be"
author bgruening
date Mon, 17 May 2021 15:07:05 +0000
parents
children 9bd94d9a1b2e
files bionano_scaffold_edited.xml macros.xml test-data/assembly.fasta test-data/assembly.fasta.gz test-data/colormap_assembly.cmap test-data/configuration.xml test-data/test_01.agp test-data/test_01.gap test-data/test_01_report.txt test-data/test_02.agp test-data/test_02.gap test-data/test_02_report.txt test-data/test_03.agp test-data/test_03.gap test-data/test_03_report.txt test-data/test_04.agp test-data/test_04.gap test-data/test_04_report.txt
diffstat 18 files changed, 80926 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/bionano_scaffold_edited.xml	Mon May 17 15:07:05 2021 +0000
@@ -0,0 +1,617 @@
+<tool id="bionano_scaffold" name="Bionano Hybrid Scaffold" version="@TOOL_VERSION@+@GALAXY_TOOL_VERSION@" profile="20.01">
+    <description>automates the scaffolding process</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="edam_ontology"/>
+    <expand macro="requirements"/>
+    <version_command>perl /HybridScaffold/hybridScaffold.pl --version</version_command>
+    <command detect_errors="exit_code"><![CDATA[
+        #set RefAligner = '/usr/local/bin/RefAligner'
+        ## softlinks do not work
+        cp '${ngs_fasta}' ./ngs.fasta
+        && cp '${bionano_cmap}' ./bionano.cmap
+        #if $configuration_options.configuration == 'vgp'
+            && cp '${vgp_mode}' ./config.xml
+        #else
+            #import os
+            #set cores = os.environ.get('GALAXY_SLOTS', 2)
+            #set memory = os.environ.get('GALAXY_MEMORY_MB', 4000) / 1000
+            && cp '${configuration_file}' ./config.xml
+            && sed -i 's|attr="maxmem" val0=.* display|attr="maxmem" val0="$memory" display|' ./config.xml
+            && sed -i 's|attr="maxthreads" val0=.* display|attr="maxthreads" val0="$cores" display|' ./config.xml
+            && sed -i 's|attr="maxvirtmem" val0=.*/>|attr="maxvirtmem" val0="$cores"/>|' ./config.xml
+            && sed -i 's|attr="insertThreads" val0=.*/>|attr="insertThreads" val0="$cores"/>|' ./config.xml
+        #end if
+        ## output the configuration file on stdout
+        && cat ./config.xml
+        && perl '/HybridScaffold/hybridScaffold.pl'
+        -n ./ngs.fasta
+        -b ./bionano.cmap
+        -c ./config.xml
+        -r $RefAligner
+        #if $conflict_resolution
+            -M '${conflict_resolution}'
+        #end if
+        #if not $conflict_resolution
+            -B $conflict_filter_genome
+            -N $conflict_filter_sequence
+        #end if
+        ##$align_molecules_options.align_molecules
+        ###if $align_molecules_options.align_molecules
+        ##    -m $align_molecules_options.bionano_molecules
+        ##    -q '${align_molecules_options.optarguments_xml}'
+        ##    -p ##/home/bionano/tools/pipeline/1.0/Pipeline/1.0/ 
+        ###end if
+        ##$quimeric_quality_options.quimeric_quality
+        ###if $quimeric_quality_options.quimeric_quality
+        ##    -m $align_molecules_options.bionano_molecules
+        ##    #if $quimeric_quality_conditional.noise_parameter
+        ##        -e '${quimeric_quality_conditional.noise_parameter}'
+        ##    #end if
+        ###end if
+        -f
+        $zip_file
+        -o ./
+        ##;
+        ##sleep 1000000
+
+    ]]>    </command>
+    <configfiles>
+        <configfile name="vgp_mode"><![CDATA[
+            #if $configuration_options.configuration == 'vgp'
+                #import os
+                #set cores = os.environ.get('GALAXY_SLOTS', 2)
+                #set memory = os.environ.get('GALAXY_MEMORY_MB', 4000) / 1000
+                <hybridScaffold>
+                    <version>
+                        <flag attr="version" val0="\$Id: hybridScaffold_DLE1_config.xml 7702 2018-06-25 20:53:51Z apang \$"/>
+                    </version>
+                    <global>
+                        <flag attr="maxmem" val0="$memory" display="Maximum memory (GB)" group="Global options" description="Define the maximum amount of RAM in gigabytes to be used by each process."/>
+                        <flag attr="maxthreads" val0="$cores" display="Max threads" group="Global options" description="Define maximum number of threads to be used by each process."/>
+                        <flag attr="maxvirtmem" val0="$memory"/>
+                        <flag attr="RAmem" val0="3" val1="1"/>
+                    </global>
+                    <fasta2cmap>
+                        <flag attr="enzyme" val0="$configuration_options.enzyme" display="Enzyme" group="FASTA to CMAP digestion" description="Define single enzyme for in-silico FASTA to CMAP digestion. Avalible enzymes: BspQI, BbvCI, BsmI, BsrDI, BssSI, DLE1."/>
+                        <flag attr="channelNum" val0="1" display="Channel number" group="FASTA to CMAP digestion" description="Specify the channel the enzyme was used."/>
+                        <flag attr="minLabels" val0="0" display="Minimum label sites" group="FASTA to CMAP digestion" description="Specify minimum number of label sites per digested contig."/>
+                        <flag attr="minLength" val0="0" display="Minimum length (Kb)" group="FASTA to CMAP digestion" description="Specify minimum length in Kb of each digested contig."/>
+                    </fasta2cmap>
+                    <align0>
+                        <flag attr="M" val0="1" val1="3"/>
+                        <flag attr="ScaleDelta" val0="0.02" val1="15"/>
+                        <flag attr="ScaleDeltaBPP"/>
+                        <flag attr="hashScaleDelta" val0="2"/>
+                        <flag attr="res" val0="2.9"/>
+                        <flag attr="FP" val0="0.6"/>
+                        <flag attr="FN" val0="0.06"/>
+                        <flag attr="sf" val0="0.20"/>
+                        <flag attr="sd" val0="0.0"/>
+                        <flag attr="sr" val0="0.01"/>
+                        <flag attr="extend" val0="1"/>
+                        <flag attr="outlier" val0="0.0001"/>
+                        <flag attr="endoutlier" val0="0.001"/>
+                        <flag attr="PVendoutlier"/>
+                        <flag attr="deltaX" val0="12"/>
+                        <flag attr="deltaY" val0="12"/>
+                        <flag attr="xmapchim" val0="12"/>
+                        <flag attr="hashgen" val0="5" val1="7" val2="2.4" val3="1.5" val4="0.05" val5="5.0" val6="1" val7="1" val8="4"/>
+                        <flag attr="hash" val0="-hashdelta" val1="26" val2="10" val3="46"/>
+                        <flag attr="hashMultiMatch" val0="30" val1="10"/>
+                        <flag attr="insertThreads" val0="$cores"/>
+                        <flag attr="nosplit" val0="2"/>
+                        <flag attr="biaswt" val0="0"/>
+                        <flag attr="T" val0="1e-10" display="P-value" group="Initial alignment" description="Minimum confidence value to output initial alignments. Recommended starting value of 1e-5/genome size in Mb."/>
+                        <flag attr="S" val0="-1000"/>
+                        <flag attr="indel"/>
+                        <flag attr="PVres" val0="2"/>
+                        <flag attr="rres" val0="0.9"/>
+                        <flag attr="MaxSE" val0="0.5"/>
+                        <flag attr="HSDrange" val0="1.0"/>
+                        <flag attr="outlierBC"/>
+                        <flag attr="xmapUnique" val0="12"/>
+                        <flag attr="AlignRes" val0="2."/>
+                        <flag attr="outlierExtend" val0="12" val1="24"/>
+                        <flag attr="Kmax" val0="12"/>
+                        <flag attr="resEstimate"/>
+                        <flag attr="f"/>
+                        <flag attr="mres" val0="0.9"/>
+                    </align0>
+                    <align1>
+                        <flag attr="res" val0="2.9"/>
+                        <flag attr="FP" val0="0.6"/>
+                        <flag attr="FN" val0="0.06"/>
+                        <flag attr="sf" val0="0.20"/>
+                        <flag attr="sd" val0="0.0"/>
+                        <flag attr="sr" val0="0.01"/>
+                        <flag attr="extend" val0="1"/>
+                        <flag attr="outlier" val0="0.0001"/>
+                        <flag attr="endoutlier" val0="0.001"/>
+                        <flag attr="PVendoutlier"/>
+                        <flag attr="deltaX" val0="12"/>
+                        <flag attr="deltaY" val0="12"/>
+                        <flag attr="xmapchim" val0="12"/>
+                        <flag attr="hashgen" val0="5" val1="7" val2="2.4" val3="1.5" val4="0.05" val5="5.0" val6="1" val7="1" val8="4"/>
+                        <flag attr="hash" val0="-hashdelta" val1="26" val2="10" val3="46"/>
+                        <flag attr="hashMultiMatch" val0="30" val1="10"/>
+                        <flag attr="insertThreads" val0="$cores"/>
+                        <flag attr="nosplit" val0="2"/>
+                        <flag attr="biaswt" val0="0"/>
+                        <flag attr="T" val0="1e-10" display="P-value" group="Initial alignment" description="Minimum confidence value to output initial alignments. Recommended starting value of 1e-5/genome size in Mb."/>
+                        <flag attr="S" val0="-1000"/>
+                        <flag attr="indel"/>
+                        <flag attr="PVres" val0="2"/>
+                        <flag attr="rres" val0="0.9"/>
+                        <flag attr="MaxSE" val0="0.5"/>
+                        <flag attr="HSDrange" val0="1.0"/>
+                        <flag attr="outlierBC"/>
+                        <flag attr="xmapUnique" val0="12"/>
+                        <flag attr="AlignRes" val0="2."/>
+                        <flag attr="outlierExtend" val0="12" val1="24"/>
+                        <flag attr="Kmax" val0="12"/>
+                        <flag attr="resEstimate"/>
+                        <flag attr="f"/>
+                        <flag attr="mres" val0="0.9"/>
+                    </align1>
+                    <assignAlignType>
+                        <flag attr="T_cutoff" val0="1e-11" display="P-value" group="Chimeric/conflicting alignment flagging" description="Minimum confidence value used to flag chimeric/conflicting alignments. Recommand to set it to be the same as the merge_Tvalue below."/>
+                        <flag attr="max_overhang" val0="5" display=""/>
+                    </assignAlignType>
+                    <cut_conflicts>
+                        <flag attr="window_size" val0="10000" display="Distance (bp)" group="Conflict-cut" description="The distance (bp) from a conflicting site within which the chimeric quality score of BioNano genome map labels will be examined"/>
+                        <flag attr="min_quality_score_threshold" val0="35" display="Percent (%)" group="Conflict-cut" description="The minimal percentage of molecules spanning to the left and right of a label of interest, thus supporting the BioNano assembly at that region"/>
+                        <flag attr="min_coverage_threshold" val0="10" display="Coverage (X)" group="Conflict-cut" description="The minimal number of molecules aligning to a label of interest in the BioNano assembly"/>
+                    </cut_conflicts>
+                    <mergeNGS_BN>
+                        <flag attr="merge_Tvalue" val0="1e-11" display="P-value" group="Merging" description="Minimum confidence value used to merge alignments. Recommand to set it to be the same as the assignAlignType T_cutoff above"/>
+                        <flag attr="id_shift" val0="100000" display="BioNano cmap id shift" group="Merging" description="Value to shift the BioNano cmap id to distinguish the BioNano cmaps from sequence cmaps. Recommand to set it to be greater than the number of sequence entries."/>
+                        <flag attr="max_merge_rounds" val0="40" display=""/>
+                        <flag attr="endoutlier" val0="1e-4" display=""/>
+                        <flag attr="outlier" val0="1e-4" display=""/>
+                        <flag attr="biaswt" val0="0" display=""/>
+                        <flag attr="sd" val0="0.1" display=""/>
+                        <flag attr="res" val0="2.9" display=""/>
+                        <flag attr="mres" val0="2.9" display=""/>
+                        <flag attr="sf" val0="0.2" display=""/>
+                        <flag attr="RepeatMask" val0="4" val1="0.01" display=""/>
+                        <flag attr="RepeatRec" val0="0.7" val1="0.6" val2="1.4" display=""/>
+                        <flag attr="pairmerge" val0="80" val1="0.2" display="Min alignment length and Max endoutlier" group="Merging" description="Minimum alignment length required for pair merge, and the maximum endoutlier allowed."/>
+                        <flag attr="maxmem" val0="$memory" display=""/>
+                        <flag attr="pairmergeRepeat"/>
+                        <flag attr="NoBpp"/>
+                        <flag attr="first" val0="-1" display=""/>
+                        <flag attr="f"/>
+                    </mergeNGS_BN>
+                    <align_final_1st_pass>
+                        <flag attr="res" val0="2.9"/>
+                        <flag attr="FP" val0="0.6"/>
+                        <flag attr="FN" val0="0.06"/>
+                        <flag attr="sf" val0="0.20"/>
+                        <flag attr="sd" val0="0.0"/>
+                        <flag attr="sr" val0="0.01"/>
+                        <flag attr="extend" val0="1"/>
+                        <flag attr="outlier" val0="0.0001"/>
+                        <flag attr="endoutlier" val0="0.001"/>
+                        <flag attr="PVendoutlier"/>
+                        <flag attr="deltaX" val0="12"/>
+                        <flag attr="deltaY" val0="12"/>
+                        <flag attr="xmapchim" val0="12"/>
+                        <flag attr="hashgen" val0="5" val1="7" val2="2.4" val3="1.5" val4="0.05" val5="5.0" val6="1" val7="1" val8="4"/>
+                        <flag attr="hash" val0="-hashdelta" val1="26" val2="10" val3="46"/>
+                        <flag attr="hashMultiMatch" val0="30" val1="10"/>
+                        <flag attr="insertThreads" val0="$cores"/>
+                        <flag attr="nosplit" val0="2"/>
+                        <flag attr="biaswt" val0="0"/>
+                        <flag attr="T" val0="1e-10" display="P-value" group="Initial alignment" description="Minimum confidence value to output intial alignments. Recommended starting value of 1e-5/genome size in Mb."/>
+                        <flag attr="S" val0="-1000"/>
+                        <flag attr="indel"/>
+                        <flag attr="PVres" val0="2"/>
+                        <flag attr="rres" val0="0.9"/>
+                        <flag attr="MaxSE" val0="0.5"/>
+                        <flag attr="HSDrange" val0="1.0"/>
+                        <flag attr="outlierBC"/>
+                        <flag attr="xmapUnique" val0="12"/>
+                        <flag attr="AlignRes" val0="2."/>
+                        <flag attr="outlierExtend" val0="6" val1="24"/>
+                        <flag attr="Kmax" val0="6"/>
+                        <flag attr="resEstimate"/>
+                        <flag attr="f"/>
+                        <flag attr="mres" val0="0.9"/>
+                        <flag attr="MultiMatches" val0="5"/>
+                    </align_final_1st_pass>
+                    <align_final_2nd_pass>
+                        <flag attr="res" val0="2.9"/>
+                        <flag attr="FP" val0="0.6"/>
+                        <flag attr="FN" val0="0.06"/>
+                        <flag attr="sf" val0="0.20"/>
+                        <flag attr="sd" val0="0.0"/>
+                        <flag attr="sr" val0="0.01"/>
+                        <flag attr="extend" val0="1"/>
+                        <flag attr="outlier" val0="0.0001"/>
+                        <flag attr="endoutlier" val0="0.001"/>
+                        <flag attr="PVendoutlier"/>
+                        <flag attr="deltaX" val0="12"/>
+                        <flag attr="deltaY" val0="12"/>
+                        <flag attr="xmapchim" val0="12"/>
+                        <flag attr="hashgen" val0="5" val1="3" val2="2.4" val3="1.5" val4="0.05" val5="5.0" val6="1" val7="1" val8="4"/>
+                        <flag attr="hash" val0="-hashdelta" val1="50"/>
+                        <flag attr="hashMultiMatch" val0="30" val1="10" val2="3"/>
+                        <flag attr="insertThreads" val0="$cores"/>
+                        <flag attr="nosplit" val0="2"/>
+                        <flag attr="biaswt" val0="0"/>
+                        <flag attr="T" val0="1e-10" display="P-value" group="Final alignment" description="Minimum confidence score used to align NGS contigs back to hybrid scaffold."/>
+                        <flag attr="S" val0="-1000"/>
+                        <flag attr="indel"/>
+                        <flag attr="PVres" val0="2"/>
+                        <flag attr="rres" val0="0.9"/>
+                        <flag attr="MaxSE" val0="0.5"/>
+                        <flag attr="HSDrange" val0="1.0"/>
+                        <flag attr="outlierBC"/>
+                        <flag attr="xmapUnique" val0="12"/>
+                        <flag attr="AlignRes" val0="2."/>
+                        <flag attr="outlierExtend" val0="12" val1="24"/>
+                        <flag attr="Kmax" val0="12"/>
+                        <flag attr="resEstimate"/>
+                        <flag attr="f"/>
+                        <flag attr="mres" val0="0.9"/>
+                        <flag attr="MultiMatches" val0="5"/>
+                    </align_final_2nd_pass>
+                    <align_final_BNG>
+                        <flag attr="res" val0="2.9"/>
+                        <flag attr="FP" val0="0.6"/>
+                        <flag attr="FN" val0="0.06"/>
+                        <flag attr="sf" val0="0.20"/>
+                        <flag attr="sd" val0="0.0"/>
+                        <flag attr="sr" val0="0.01"/>
+                        <flag attr="extend" val0="1"/>
+                        <flag attr="outlier" val0="0.0001"/>
+                        <flag attr="endoutlier" val0="0.001"/>
+                        <flag attr="PVendoutlier"/>
+                        <flag attr="deltaX" val0="6"/>
+                        <flag attr="deltaY" val0="6"/>
+                        <flag attr="xmapchim" val0="12"/>
+                        <flag attr="hashgen" val0="5" val1="7" val2="2.4" val3="1.5" val4="0.05" val5="5.0" val6="1" val7="1" val8="4"/>
+                        <flag attr="hash" val0="-hashdelta" val1="26" val2="10" val3="46"/>
+                        <flag attr="hashMultiMatch" val0="30" val1="10"/>
+                        <flag attr="insertThreads" val0="$cores"/>
+                        <flag attr="nosplit" val0="2"/>
+                        <flag attr="biaswt" val0="0"/>
+                        <flag attr="T" val0="1e-10" display="P-value" group="Final alignment" description="Minimum confidence score used to align NGS contigs back to hybrid scaffold."/>
+                        <flag attr="S" val0="-1000"/>
+                        <flag attr="indel"/>
+                        <flag attr="PVres" val0="2"/>
+                        <flag attr="rres" val0="0.9"/>
+                        <flag attr="MaxSE" val0="0.5"/>
+                        <flag attr="HSDrange" val0="1.0"/>
+                        <flag attr="outlierBC"/>
+                        <flag attr="xmapUnique" val0="14"/>
+                        <flag attr="AlignRes" val0="2."/>
+                        <flag attr="outlierExtend" val0="6" val1="24"/>
+                        <flag attr="Kmax" val0="6"/>
+                        <flag attr="resEstimate"/>
+                        <flag attr="BestRef" val0="1"/>
+                        <flag attr="f"/>
+                        <flag attr="mres" val0="0.9"/>
+                    </align_final_BNG>
+                    <refineFinal1>
+                        <flag attr="refine" val0="1" display="Refine Map" group="Final Refinement" default0="3"/>
+                        <flag attr="usecolor" val0="1" default0="1" display="Color Channel" group="Final Refinement"/>
+                        <flag attr="A" val0="5" display="Aligned Sites Threshold" group="Final Refinement" default0="5"/>
+                        <flat attr="S" val0="-9"/>
+                        <flag attr="L" val0="130"/>
+                        <flag attr="maptype" val0="0"/>
+                        <flag attr="extend" val0="1" display="Allow Extended Molecule" group="Final Refinement" default0="1"/>
+                        <flag attr="MaxCov" val0="100" display="Max Coverage" group="Final Refinement" default0="100"/>
+                        <flag attr="Mprobeval" display="Fast Mode" group="Final Refinement"/>
+                        <flag attr="splitcnt"/>
+                        <flag attr="splitrev" val0="2"/>
+                        <flag attr="CmapSNR"/>
+                        <flag attr="splitsite"/>
+                        <flag attr="MinSplitLen" val0="50.0"/>
+                        <flag attr="MaxSE" val0="0.5"/>
+                        <flag attr="outlier" val0="2e-2" display="Min Outliers P-value" group="Second Refinement" default0="1e-5"/>
+                        <flag attr="outlierMax" val0="80."/>
+                        <flag attr="outlierLambda" val0="20."/>
+                        <flag attr="endoutlier" val0="1e-3" display="Molecule Ends P-value Cutoff" group="Second Refinement" default0="1e-4"/>
+                        <flag attr="endoutlierRef" val0="1e-4" val1="1e-3"/>
+                        <flag attr="skip_dist" val0="0.0" val2="0.0"/>
+                        <flag attr="endoutlierFinal" val0="1"/>
+                        <flag attr="maxEnd" val0="90."/>
+                        <flag attr="RTHETA_FIX" val0="0"/>
+                        <flag attr="TB" val0="1e-6" val1="1e-6" val2="-TBmult" val3="0.1"/>
+                        <flag attr="nosplit" val0="2" display="Allow Chimeric Split" group="Final Refinement" default0="2"/>
+                        <flag attr="EndTrim" val0="0.0" display="Min End Trim Coverage" group="Final Refinement" default0="4.99"/>
+                        <flag attr="biaswt" val0="0.7" display="Bias" group="Final Refinement" default0="0"/>
+                        <flag attr="biaswtEnd" val0="0.0"/>
+                        <flag attr="biaswtRefine" val0="0.7" val2="1"/>
+                        <flag attr="biaswtOutlier" val0="0.0"/>
+                        <flag attr="LRbias" val0="1e0" display="Soft Threshold" group="Final Refinement" default0="1e2"/>
+                        <flag attr="deltaX" val0="6" display="Molecule Labels Metric" group="Final Refinement" default0="4"/>
+                        <flag attr="deltaY" val0="7" display="Mapped Labels Metric" group="Final Refinement" default0="6"/>
+                        <flag attr="RepeatMask" val0="5" val1="0.01" display="Repeat Mask P-values" group="Final Refinement" default0="2" default1="0.01"/>
+                        <flag attr="RepeatRec" val0="0.7" val1="0.6" val2="1.4"/>
+                        <flag attr="CovTrim" val0="2"/>
+                        <flag attr="CovTrimLen" val0="55"/>
+                        <flag attr="TrimNorm" val0="0"/>
+                        <flag attr="TrimNormMed" val0="100"/>
+                        <flag attr="TrimNormChim" val0="2"/>
+                        <flag attr="TrimNormMin" val0="2"/>
+                        <flag attr="PVres" val0="2"/>
+                        <flag attr="PVendoutlier"/>
+                        <flag attr="AlignRes" val0="1.5"/>
+                        <flag attr="rres" val0="1.2"/>
+                        <flag attr="cres" val0="5.6" val1="3" val2="0.1"/>
+                        <flag attr="hashgen" val00="5" val01="3" val02="2.4" val03="1.5" val04="0.05" val05="5.0" val06="1" val07="1" val08="3"/>
+                        <flag attr="hash" val00="-hashdelta" val01="10" val02="10" val03="-mres" val04="0.9"/>
+                        <flag attr="HSDrange" val0="1.0"/>
+                        <flag attr="hashoffset" val0="1"/>
+                        <flag attr="hashMultiMatch" val0="15"/>
+                        <flag attr="insertThreads" val0="$cores"/>
+                        <flag attr="BestRef" val0="1"/>
+                        <flag attr="BestRefPV" val0="1"/>
+                        <flag attr="ChimQuality"/>
+                        <flag attr="f" display="Overwrite Output Files" group="Final Refinement"/>
+                        <flag attr="T" val0="1e-11" display="P Value Cutoff Threshold"/>
+                    </refineFinal1>
+                </hybridScaffold>
+            #end if
+        ]]></configfile>
+    </configfiles>
+    <inputs>
+        <param name="ngs_fasta" argument="-n" type="data" format="fasta" label="NGS FASTA" help="Input NGS FASTA"/>
+        <param name="bionano_cmap" argument="-b" type="data" format="cmap" label="BioNano CMAP" help="Input BioNano CMAP"/>
+        <conditional name="configuration_options">
+            <param name="configuration" argument="-c" type="select" label="Configuration mode" help="It defines the parameters used in each step of hybrid scaffold">
+                <option value="vgp">VGP mode</option>
+                <option value="file">Select a configuration file</option>
+            </param>
+            <when value="vgp">
+                <param name="enzyme" type="text" value="CTTAAG" label="Restriction enzyme" help="Define single enzyme for in-silico FASTA to CMAP digestion. Avalible enzymes: BspQI, BbvCI, BsmI, BsrDI, BssSI, DLE1.">
+                    <expand macro="sanitize_string" />
+                </param>
+            </when>
+            <when value="file">
+                <param name="configuration_file" type="data" format="xml" label="Configuration file" help="Depending on the complexity of the genome of interest, the values of certain parameters could be adjusted accordingly."/>
+            </when>
+        </conditional>
+        <param name="conflict_resolution" argument="-M" type="data" format="txt" optional="True" label="Conflict resolution file" help="Input a conflict resolution file indicating which NGS and BioNano conflicting contigs to be cut [optional]"/>
+        <param name="conflict_filter_genome"  argument="-B" type="select" label="Genome maps conflict filter" help="Conflict filter level genome maps [required if not using -M option]">
+            <option value="1">No filter</option>
+            <option value="2">Cut contig at conflict</option>
+            <option value="3">Exclude conflicting contig</option>
+        </param>
+        <param name="conflict_filter_sequence" argument="-N" type="select" label="Sequences conflict filter" help="Conflict filter level for sequences [required if not using -M option]">
+            <option value="1">No filter</option>
+            <option value="2">Cut contig at conflict</option>
+            <option value="3">Exclude conflicting contig</option>
+        </param>
+        <param name="zip_file" argument="-z" type="boolean" truevalue="-z results.zip" falsevalue="" checked="false" label="Generate an output package in ZIP format" help="The hybrid scaffold output package (.zip) can be imported into Access for visualization" />
+        <!-- 
+        
+        Those options have been disabled because the Docker container doesn't include the required packages
+
+        <conditional name="align_molecules_options">
+            <param name="align_molecules" type="select" label="Align molecules to hybrid scaffolds and genome maps" help="Flag to generate molecules to hybrid scaffold alignment and molecules to genome map alignment">
+                <option value="-x">True</option>
+                <option value="" selected="True">False</option>
+            </param>
+            <when value="-x">
+                <param name="bionano_molecules" type="data" format="bnx" label="Bionano molecules" help="Input BioNano molecules BNX [optional; only required for either the -x or -y option]"/>
+                <param name="optarguments_xml" type="data" format="xml" label="OptArguments XML script" help="Input de novo assembly pipeline optArguments XML script [optional; only required for -x option]"/>
+            </when>
+            <when value="">
+            </when>
+        </conditional>
+        <conditional name="quimeric_quality_options">
+            <param name="quimeric_quality" type="select" label="Generate quimeric quality score" help="Flag to generate chimeric quality score for the Input BioNano CMAP">
+                <option value="-y">True</option>
+                <option value="" selected="True">False</option>
+            </param>
+            <when value="-y">
+                <param name="bionano_molecules" type="data" format="bnx" label="Bionano molecules" help="Input BioNano molecules BNX [optional; only required for either the -x or -y option]"/>
+                <param name="noise_parameter" type="data" format="txt" optional="True" label="Noise parameter file" help="Input de novo assembly noise parameter .errbin or .err file [optional; recommended for -y option but not required]"/>
+            </when>
+            <when value="">
+            </when>
+        </conditional>
+        -->
+    </inputs>
+    <outputs>
+        <data name="ngs_contigs_scaffold_fasta" format="fasta" from_work_dir="hybrid_scaffolds/bionano_bppAdjust_cmap_ngs_fasta_NGScontigs_HYBRID_SCAFFOLD.fasta" label="${tool.name} on ${on_string}: NGScontigs hybrid scaffold (fasta)"/>
+        <data name="ngs_contigs_scaffold_agp" format="txt" from_work_dir="hybrid_scaffolds/bionano_bppAdjust_cmap_ngs_fasta_NGScontigs_HYBRID_SCAFFOLD.agp" label="${tool.name} on ${on_string}: NGScontigs hybrid scaffold (agp)"/>
+        <data name="ngs_contigs_scaffold_gap" format="txt" from_work_dir="hybrid_scaffolds/bionano_bppAdjust_cmap_ngs_fasta_NGScontigs_HYBRID_SCAFFOLD.gap" label="${tool.name} on ${on_string}: NGScontigs hybrid scaffold (gap)"/>
+        <data name="report" format="txt" from_work_dir="hybrid_scaffolds/hybrid_scaffold_informatics_report.txt" label="${tool.name} on ${on_string}: hybrid scaffold report"/>
+        <data name="results" format="zip" from_work_dir="results.zip" label="${tool.name} on ${on_string}: results">
+            <filter>zip_file</filter>
+        </data>
+    </outputs>
+    <tests>
+        <test expect_num_outputs="5">
+            <param name="ngs_fasta" value="assembly.fasta.gz"/>
+            <param name="bionano_cmap" value="colormap_assembly.cmap"/>
+            <param name="conflict_filter_genome" value="3"/>
+            <param name="conflict_filter_sequence" value="3"/>
+            <conditional name="configuration_options">
+                <param name="configuration" value="file"/>
+                <param name="configuration_file" value="configuration.xml"/>
+            </conditional>
+            <param name="zip_file" value="true"/>
+            <output name="ngs_contigs_scaffold_fasta" ftype="fasta">
+                <assert_contents>
+                    <has_size value="4753369" delta="300" />
+                </assert_contents>
+            </output>
+            <output name="ngs_contigs_scaffold_agp" file="test_01.agp" ftype="txt"/>
+            <output name="ngs_contigs_scaffold_gap" file="test_01.gap" ftype="txt"/>
+            <output name="report" file="test_01_report.txt" ftype="txt"/>
+            <output name="results" ftype="zip">
+                <assert_contents>
+                    <!--<has_size value="4231746" delta="300" />-->
+                    <has_archive_member path=".*/status.txt"/>
+                </assert_contents>
+            </output>
+            <assert_stdout>
+                <has_text text='attr="maxmem" val0="4.0"'/>
+            </assert_stdout>
+            <assert_stdout>
+                <has_text text='attr="maxthreads" val0="2"'/>
+            </assert_stdout>
+            <assert_stdout>
+                <has_text text='attr="insertThreads" val0="2"'/>
+            </assert_stdout>
+             <assert_stdout>
+                <has_text text='attr="maxvirtmem" val0="4.0"'/>
+            </assert_stdout>
+            <assert_stdout>
+                <has_text text="hybridScaffold"/>
+            </assert_stdout>
+        </test>
+        <test expect_num_outputs="4">
+            <param name="ngs_fasta" value="assembly.fasta.gz"/>
+            <param name="bionano_cmap" value="colormap_assembly.cmap"/>
+            <param name="conflict_filter_genome" value="2"/>
+            <param name="conflict_filter_sequence" value="2"/>
+            <conditional name="configuration_options">
+                <param name="configuration" value="file"/>
+                <param name="configuration_file" value="configuration.xml"/>
+            </conditional>
+            <output name="ngs_contigs_scaffold_fasta" ftype="fasta">
+                <assert_contents>
+                    <has_size value="4753369" delta="100" />
+                    <has_n_lines n="2"/>
+                    <has_line line=">Super-Scaffold_1"/>
+                </assert_contents>
+            </output>
+            <output name="ngs_contigs_scaffold_agp" file="test_02.agp" ftype="txt"/>
+            <output name="ngs_contigs_scaffold_gap" file="test_02.gap" ftype="txt"/>
+            <output name="report" file="test_02_report.txt" ftype="txt"/>
+            <assert_stdout>
+                <has_text text='attr="maxmem" val0="4.0"'/>
+            </assert_stdout>
+            <assert_stdout>
+                <has_text text='attr="maxthreads" val0="2"'/>
+            </assert_stdout>
+            <assert_stdout>
+                <has_text text='attr="insertThreads" val0="2"'/>
+            </assert_stdout>
+             <assert_stdout>
+                <has_text text='attr="maxvirtmem" val0="4.0"'/>
+            </assert_stdout>
+            <assert_stdout>
+                <has_text text="hybridScaffold"/>
+                <!--attribute_is path="hybridScaffold/global/flag[@attr='maxthreads']" attribute="val0" text="2"/-->
+            </assert_stdout>
+        </test>
+        <test expect_num_outputs="5">
+            <param name="ngs_fasta" value="assembly.fasta.gz"/>
+            <param name="bionano_cmap" value="colormap_assembly.cmap"/>
+            <param name="conflict_filter_genome" value="2"/>
+            <param name="conflict_filter_sequence" value="3"/>
+            <conditional name="configuration_options">
+                <param name="configuration" value="file"/>
+                <param name="configuration_file" value="configuration.xml"/>
+            </conditional>
+            <param name="zip_file" value="true"/>
+            <output name="ngs_contigs_scaffold_fasta" ftype="fasta">
+                <assert_contents>
+                    <has_size value="4753369" delta="100" />
+                    <has_n_lines n="2"/>
+                    <has_line line=">Super-Scaffold_1"/>
+                </assert_contents>
+            </output>
+            <output name="ngs_contigs_scaffold_agp" file="test_03.agp" ftype="txt"/>
+            <output name="ngs_contigs_scaffold_gap" file="test_03.gap" ftype="txt"/>
+            <output name="report" file="test_03_report.txt" ftype="txt"/>
+            <output name="results" ftype="zip">
+                <assert_contents>
+                    <!--<has_size value="4231908" delta="300" />-->
+                    <has_archive_member path=".*/status.txt"/>
+                </assert_contents>
+            </output>
+            <assert_stdout>
+                <has_text text='attr="maxmem" val0="4.0"'/>
+            </assert_stdout>
+            <assert_stdout>
+                <has_text text='attr="maxthreads" val0="2"'/>
+            </assert_stdout>
+            <assert_stdout>
+                <has_text text='attr="insertThreads" val0="2"'/>
+            </assert_stdout>
+             <assert_stdout>
+                <has_text text='attr="maxvirtmem" val0="4.0"'/>
+            </assert_stdout>
+            <assert_stdout>
+                <has_text text="hybridScaffold"/>
+            </assert_stdout>
+        </test>
+        <test expect_num_outputs="5">
+            <param name="ngs_fasta" value="assembly.fasta.gz"/>
+            <param name="bionano_cmap" value="colormap_assembly.cmap"/>
+            <param name="conflict_filter_genome" value="2"/>
+            <param name="conflict_filter_sequence" value="3"/>
+            <conditional name="configuration_options">
+                <param name="configuration" value="vgp"/>
+                <param name="enzyme" value="BspQI"/>
+            </conditional>
+            <param name="zip_file" value="true"/>
+            <output name="ngs_contigs_scaffold_fasta" ftype="fasta">
+                <assert_contents>
+                    <has_size value="4753369" delta="100" />
+                    <has_n_lines n="2"/>
+                    <has_line line=">Super-Scaffold_1"/>
+                </assert_contents>
+            </output>
+            <output name="ngs_contigs_scaffold_agp" file="test_04.agp" ftype="txt"/>
+            <output name="ngs_contigs_scaffold_gap" file="test_04.gap" ftype="txt"/>
+            <output name="report" file="test_04_report.txt" ftype="txt"/>
+            <output name="results" ftype="zip">
+                <assert_contents>
+                    <has_archive_member path=".*/status.txt"/>
+                </assert_contents>
+            </output>
+            <assert_stdout>
+                <has_text text='attr="maxmem" val0="4.0"'/>
+            </assert_stdout>
+            <assert_stdout>
+                <has_text text='attr="maxthreads" val0="2"'/>
+            </assert_stdout>
+            <assert_stdout>
+                <has_text text='attr="insertThreads" val0="2"'/>
+            </assert_stdout>
+             <assert_stdout>
+                <has_text text='attr="maxvirtmem" val0="4.0"'/>
+            </assert_stdout>
+            <assert_stdout>
+                <has_text text="hybridScaffold"/>
+            </assert_stdout>
+        </test>
+    </tests>
+    <help><![CDATA[
+.. class:: infomark
+
+**Purpose**
+
+The Hybrid Scaffold pipeline automates the comprehensive scaffolding process and is consisted of five major steps: 1) generate in silico maps for sequence assembly; 2) align in silico sequence maps against Bionano genome maps to identify and resolve potential conflicts in either data set; 3) merge the non-conflicting maps into hybrid scaffolds; 4) align sequence maps to the hybrid scaffolds; and 5) generate AGP and FASTA files for the scaffolds. 
+
+----
+                    
+.. class:: infomark
+                                        
+**Coverage**
+
+For Hybrid Scaffold, we recommend using as input a minimum of 80X effective molecule coverage in order to build an accurate and contiguous consensus genome map assembly for each enzyme. When using nickases, using more coverage does not significantly improve map contiguity. When using a DLS enzyme such as DLE-1, effective coverage up to and beyond 100X has shown improved map contiguities for some plants and animals.
+
+----
+                    
+.. class:: infomark
+                                        
+**Input Bionano assembly**
+
+When running the de novo assembly pipeline for hybrid scaffolding applications, users are recommended to use assembly parameters for non-haplotype-aware assembly. The current Hybrid Scaffold pipeline does not explicitly handle haplotype information and assumes there is only one genome map or NGS sequence contig covering a given genomic region. If multiple haplotypes are present, the pipeline may make false positive conflict cuts and incorrectly mix haplotypes in the final scaffolds. We understand that haplotype information is important in many applications, and a fully haplotype-aware Hybrid Scaffold pipeline is in our roadmap for a future release.
+
+
+    ]]>    </help>
+    <expand macro="citations"/>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Mon May 17 15:07:05 2021 +0000
@@ -0,0 +1,28 @@
+<macros>
+    <token name="@TOOL_VERSION@">3.6.1</token>
+    <token name="@GALAXY_TOOL_VERSION@">galaxy0</token>
+    <xml name="edam_ontology">
+        <edam_topics>                                                                                  
+            <edam_topic>topic_0196</edam_topic>
+        </edam_topics>
+        <edam_operations>
+            <edam_operation>operation_0525</edam_operation>
+        </edam_operations>
+    </xml>
+    <xml name="requirements">
+        <requirements>
+            <container type="docker">bionanodocker/bionano-docker-scaffold:latest</container>
+        </requirements>
+    </xml>
+    <macro name="sanitize_string" >
+        <sanitizer invalid_char="">
+            <valid initial="string.letters,string.digits">
+            </valid>
+        </sanitizer>
+    </macro>
+    <xml name="citations">
+        <citations>
+            <citation type="doi">10.1186/s12864-015-1911-8</citation>
+        </citations>
+    </xml>
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/assembly.fasta	Mon May 17 15:07:05 2021 +0000
@@ -0,0 +1,79224 @@
+>Super_scaffold_3
+TTCATCGGTTAAATCATCGCCCAGAAATACGGGCGTTCGCCCGATAAAGGGAGCTTCCTG
+CATAAAAGCTGCAATTGCCTCACCTTTACTGGTACCTCTCGGTTTGATCTCGACAACACA
+CTTTCCCTGCTGTAACGCCATTTGTGGCCAGATCTGAGTAATACGTTGCGCTAATGTCAT
+TAATGCGTCTTCATGCTGCGGAGCCTGACGATAATGCAGCGCAAAAGCCATCCCTTTCGC
+CTCCAGCTCCGCGCCGGGATACTGAGCGATGACTGTATGCAGTTGCACGCTAATATCACG
+CGCAATCGCATCCGGCAGATGAACGATATGTGTTTTACCATTGATGTCACGGCGCTCCGC
+CCCATGCACGCCCGCTAACGGGAAGCGATAAGGTTTTGCCAGTGCGTCAAGCTCCACCAT
+TGAGCGCCCTGATATCAATGCCAATGCACCATCACTTGCGGTTGCCAGTAGCTGTAGTCC
+TTGCAGAATATTGTCAGGCACGACGACCTGATCGGGATGCGGTTTGATTTCCGCCAGCGT
+TCCATCAAGATCAAAAAACCAGGCATATTTCGCGGATAGTTCAGGGGTTTCGGTTAACGG
+TTCTGTCACCCGGTTCTCCTCCTTCTCTTTTCTTATTGTGTTGCGCAGAACGCGCTTTAC
+AGACATGTAAGTATAGACAGTGTGACGGGGGTCGCCATTTGCAACGAAGAACAGCCAACC
+GTTATGGCGGTTGGCTATGGTGGGAAAAAACGCTAAATTGTTGCAGAAAAAAGCATCAGA
+CAGTGCGTTTCGCTTTTTGCTTGTAACGGTCGAAGATCACCGCTGCCAGCAGGATTAAGC
+CGCGAACCACGTACTGCGCGAAAGGAGAAATATTAAGCAGGTTCATGGCGTTTTCCACGG
+TGCCTAAAATTAAGATACCCGCCACCACATATGAGATTTTTCCGATGCCACCTTTCAGAG
+AAACGCCACCTAAAACGCAGGCGGAGATAACAATCAGCTCATAACCAATCGACGTCATTG
+GCTGCCCACTGGTCATACGTGAAGCCAGAATAATTCCGGCTATCGCTGATACCAGGCCTG
+AGAGAACAAAGATAATAATTTTGGTGCGAACAACCGGTACACCCGCCAGACGCGCGGCCT
+CTTCGTTCCCGCCAATCGCCAGGGTGTTACGACCAAAGGTGGTTTTATTCAGCAGCAAAC
+CAAAGATAATCAGACACGCGACGGTGAGCCAGATTGGCGCAGGCAGACCGAACCAGTTGG
+CGTAACCAAGGGCAAAGAAGCTTTCATCTTCGATACCGACCGCTTTACCGTCTGAAATGA
+TGTACGCCAGACCTCGAACAATCTGCATCGTTGCCAATGTCGTGATCAGAGCATTTATTT
+TCAGTTTGGCGATAACAAAGCCATTGACCAGGCCACAGAGAACGCCCAGCAACAACCCCG
+CTGCCACGCCAATCCACAGGCTTTCAGTCAGGTTAATAACCACCGCCGTGGTGACACCCG
+CACAGGCAATTACGGAGGCGACAGAAAGGTCAAAGTCACCGGAAGCGAGGCAGAACAACA
+TGCCACAAGCCACCATCCCCGACATGGAAATTGCCAGGCCCAACCCTTTCATATTAATGA
+AGGTGGCAAAATTTGGGACAAAAATGGCACAGGCGATAAAGAGCACCGCAAACACCACCA
+GCATGCCGTACTGATCCCAGATACGCCCGAAGCTGAATGACGACTTAGGTGCGCCAGACC
+CCGATGTAGAAACAGAAGACATCATACTCTCCTTACTCAGGCAACAGCCTGGCTGACTTT
+AGGCATCGCAAGGCTCAGTGCCTGACGCTCATCTGCCTGCTCGTGTAACAATTCACCGGC
+GATTTCACCTTCCCGCATCACCACAATCCGGTCGGCAACGCCGAGGACTTCAGGTAAGTC
+GCTGGAGGCAAACAGCACCGCCACGCCCTGCGCCGCCAGCGCATAAATTACGTTATATAT
+TTCGTGCTTAGCGCCAACATCAATGCCGCGCGTAGGTTCATCCAGCAAAATGACCTTCAT
+CTCTTCCGATAACCAGCGGCCCAGAATGGCTTTTTGCTGATTTCCGCCTGAGAGATTCAT
+GATCAGTTGCTCCGCGCCCGGCGTTTTGATGTTGAGCGAACGAATGTGGTGATCGGCATT
+GTTTTCTTCCCAACCGTTGTTGATTACACAACCGCCGAGCACATGTTTACGTCTGGCACT
+GATGTTGATATTGTCGCGAACGGAGTGCACGGGAATAATGCCTTCCGCTTTGCGATCTTC
+CGGGCAGAGCATCATGCCTGCGGCAATGGCGTGGCTCGGTTTACGAATATCGATCGGCTG
+TTGGTCGATATAAACCTGACCGGCGGTGATTTGCGTCCCGCCAAACATGCCTTTCATTAA
+TTCGCTACGCCCCGCCCCTACCAGACCAAACAGCCCAACAATTTCACCACTGCGAACCGC
+CAGACTTATTGGCGTACGCACGCCTGGTGCTTTCACAGCATCAAGACGTAGGCGCTCCTC
+GCCATAACTACGCGGTTGCCAGCCGTAGATATCGCCAATGTCGCGCCCGACCATCGCCTG
+CACCAGCGCGTCGTGGTCAACCTGCTGCATATCGGTAAAGGTTTTGACATAACGTCCATC
+TTTAAAGACAGTAATGGCATCGCTGAGGGCAAATATTTCTTCCATACGGTGAGAAACGTA
+TAAGATTACCCGCCCCTCTTTTCGCAGTTCACGAATAACGCGGAAAAGATTGTCGATTTC
+ACGGGCAGAGAGGGAGCTGGTTGGCTCATCAAAGGCGATAATTTTGGCGTTACGCGCCAG
+CGCTTTGGCGATTTCAACCATCTGCCACTGACCAATGGAGAGATATTTCAGCGGCGTGTC
+CGGGTCAATATCCATACCAAGATGTTTAAGTTGTAAACCCGCCTCATAATTCAGCAATGA
+GCGATTCACAATGCCGCCTTTATGCGGCAGCTGGCCGAGATAGATGTTTTCCGCGACGGT
+CATTTCCGGCACGAGATGCAGTTCCTGGTAAATAATCGCCACGCCCGCGTTAAGTGCTGC
+GGTCGTGTCGGAAAAGGACATTTCCTGCCCATTAATCACTACAGAACCCGTGGTTGGCGC
+ATAGTTGCCGCTGAGGATTTTTAAGAGAGTTGATTTTCCTGCGCCATTTTCACCCATCAA
+CGCATGAACCTGACCGGCATAGCAGTCAAAACTAATATCCGTCAGCGCCTTAACGCCGGG
+AAACGTTTTACCGATGCCGCGAAATGAGAGATACGGGGTAGACTGTTGCATAACGTCTCC
+GTGAATCACTGGTCGTTCACACCCCCTCTGCATCATGCAGAGGGGAATTTTTCCGGCAAA
+TTACTTACCGCCTAAACCTTTTTTCTCCAGTTCTTCTTTAAAGTTGTCACGCGTGATCAG
+TACCACGTCGGTAACTTCGGTAAATTTTGGCGGTTCAACGTCTTTTGCTACCCAGTTGTA
+AAGCATTTCGCTGGATTTATAGCCATGTACGTCCGGGCTTGGCAGCAGGGAACCGTAGAA
+GCCGGTTGCCTGTGCTTTAGACAGTTCGCTCACCGCATCCACACCGTTAATGCCAATGCC
+GATGATATCGGCCGCTTTAAAGCCCTGACCTTCCGTCGCGCGTACGCCGCCCAGCACGGT
+GCTGTCGTTCATACCGACGATCAGCCAATGTTTAACTTCCGGATGTTGAACCAGCATTGA
+GTTGGCAGCGTCAAATGCCCCCGGGATGTCGTTAGATTTGGTAGGTACCTGATAAATTTG
+TTTTTCCGGGAATCCGGCCGCTTTCAGCGCATCCATAGATCCCGTAGTACGGCGGCGGGC
+GGTATCCAGTTCGTTGGCGGTAATCGCCATCACCGCGCTTTCTTTGACATCCCAGCCACG
+TTTCTGCATCTCTTTATACAGTTCCTGGCCCTGACGTTCGCCAATTTTAGTCGCCGCCAT
+CATCACCAGCGGAACGGTATCCATTGGCTTACCTTTGGCGTTAACAAACTGGTCATCCAC
+GGCAATGACTTTCATATCGTAGCCACGCGCTTTCGCGACGATGGCAGAGCCGAGTTTGGG
+GTCCGGAGTACAAATAACGAAACCTTTTGCGCCACTGGCAGCCAGGCTGTCGATCGCGTT
+CAATGTTTTTTCGCCATCCGGCACGGCAATCTTAATAACCTCAAACCCTAAATCCTTCCC
+GGCTTTATCGGCAAACTTCCATTCGGTCTGGAACCACGGCTCTTCCGGTTGCTTCACCAG
+AAAACCGAGCTTCAGGTTCTCCGCCATAGCGGATTGTGACATAACGGCTGCCAGACCAAT
+GGCTGCCAGGGCTTTAGTAAATTTGTGCATGGTTCTCTCCAGCTTTAGTGTCGTTTTGTG
+TAGGGCAAAAACGAATGACATTCGTTAAATTAATCGGAAAACAAAGCATTACCTTTTAAC
+TAAAAGATAAGTGACTGTGTTGACATAGTTTTAGCGAGAAATTAATTCTCCATAGGAGAG
+CAATATCACATCGCAGAATTACAGTGAGAACGTGCATAAATTTAGCGGGAAAAGACATAA
+GGGAAAGCCAATTTGTCAGACAAATTGTCGAATGCACAGCAGATTAATCCATAAGATTAG
+CCTGGAAATCCTTGTTGTCTTTGGTACCCATGCGGGATGTCTTCTTTTTAACCAGTCAAT
+AGGCCGCATTACCTGGCGTTGAGTTTTTGAAATGGTGTAATAACCGCAACTCAAAGATGT
+GGAAAATGCACGTCATTCATTTCGTCATTAATTATCACTGTGCTCATTAATTAACAGAAC
+ACGTATAATGAGAGCCATCTCGCAAAAATGAAAAAACGTTTTATAAAATCATCACTTCAT
+CATGAATTCAAATTCATTGATTAATATCAACAAGATACAAAAAGCACTATCATTAAAATT
+CATTGCAGTTACATTGATTTCATCAATGAAATGTAAAAATATATAAACTTGATGATTTAA
+GCATTTTCTTATACCCGTTCAGACGTTATTCTTATTTCAGATCATCGTCAGAATTGACTC
+CACGATCACATTTCGGACCGGCAGAAAGGAATTATTCTGCAAACAGTAATTATGGTGTTT
+TGATTTATCTTGCACCTCTCCACTTCTGGATATAAGGATATTAGGTATGGCAACCGCTGG
+AATGCTTCTCAAACTCAACTCTCAAATGAACCGCGAGTTTTACGCATCCAATCTCTACCT
+TCACCTGAGTAACTGGTGTTCTGAACAGAGTCTGAACGGCACCGCCACTTTCCTTCGCGC
+CCAGGCACAGAGTAATGTGACCCAAATGATGCGCATGTTTAACTTTATGAAGAGTGTCGG
+CGCTACCCCCATCGTTAAAGCCATTGATGTTCCCGGTGAAAAACTGAACTCTCTGGAAGA
+ACTGTTCCAAAAAACGATGGAAGAATACGAGCAACGTTCTAGTACGTTGGCACAGTTAGC
+CGATGAAGCGAAAGAACTGAATGATGATTCAACCGTCAATTTCCTGCGCGATCTGGAAAA
+AGAACAGCAGCATGATGGTCTGTTGCTGCAAACCATTCTTGATGAAGTGCGCAGTGCGAA
+ACTTGCGGGTATGTGCCCTGTGCAGACCGACCAACATGTTCTGAATGTCGTGTCACACCA
+GCTGCATTGATCATCATCGGCGCTAATGCATTGCGCCGATGAAGGTTTTGAGAAACCGCT
+GCCTCATCTGTTTGAAGCAGAGGTTTTTTTAATGGGATTCACCCTGTGGGGTAAACTTGA
+GTTCAATAAGCGCGATGGCTTTTTGGATTGCCCGCATGGTGACCGGGTCTGCGGCGGCGG
+GATGGTTAGTAAAGTCGATATTCTTCAGCTGACTGGACATTTTTTCACGAACTTCAACGG
+GCGCGATTACATCGAGAACATCCAGAATTTGTTTGATAACCAACTGGCAAGCAACCACAT
+CAGAAACCAATTCCTGATCGGCATTCAGCGGCTGGGACATCGTAAACTCCTGATAGCATT
+TTGAAAGCCGTTATAGTAGCGACTTCACATCTTCAGCGATAGTCACATCCACCGTCATCA
+GGACACAAAAAAACCTGCCGGAGCAGGTTTTTTGTTATCGGAACATATTGCCTGGCGGTA
+CGTCTTTGAACGTCTTGCAATAGTTATTGAACATACTTTTCAGGATTTTGCGCAGTTTCA
+TCGCGGCACTCCGACCATTTGTTATACAGGTGTTATTGTCTTTGCGCTTATAATATGACA
+ACCATCACAAAAATCAATCTTTATGTGATACAAATCACATAAATACCCCTTTAATGTTAT
+AAAAATGATAATCAAAAAACAGCCCCCCTATTTCTGACACCTACAGATGGCAAGAAATAG
+CGCCTGCCAGGCGTCTTTTCCGGCCATTGTCGCAGCACTGTAACGCGTAAAATAGTGCTT
+TCTCTTACTCTTCTGGCTGGACCATGAGACTTCTGATTCTGACTCTTTCATTAATAACGC
+TGGCGGGGTGTACGGTTACTCGCCAAGCCCATGTGAGCGAAGTTGACGCGGCAACAGGTA
+TTGTACGGTTAGTTTATGACCAGGCTTTTTTGCAGCATGCCCATACCGATCGTTATGTCA
+GTCGCGGGATCGCCGATCGCGCATGCCAGCAGGAAGGCTATACCCACGCGGTCCCCTTTG
+GTCAGCCAGTAGGCAACTGTAGCCTTTTTGCGGGTTCCTTATGTTTGAATACGGAATTCA
+CTTTGTCATATCAGTGCCATCATTCCGCCTTCCCTGTCTTTCTCTAAATATTTTAATCAG
+CGAGGGGATCTTCGCTGATTAAAGAAATAGCGGTAATGCGTTTTATTCCCATTCGTATTT
+TTAATAATTGAAGTTTATATTTTACCTTTTGCAAATAATAAAATAACAAATTATAGTGAC
+GCCACAGCAACAAATATAACCTTTGTGGAGCACTATCATGCTGAAACCAGAAATGATTGA
+AAAACTTAATGAGCAGATGAACCTGGAACTGTACTCTTCACTGCTTTATCAGCAAATGAG
+CGCCTGGTGCAGCTATCATACCTTCGAAGGTGCTGCCGCGTTCCTGCGCCGTCACGCCCA
+GGAAGAGATGACGCATATGCAGCGTCTGTTTGATTACCTGACTGATACCGGCAATTTACC
+GCGTATTAATACCGTTGAATCTCCGTTTGCTGAATATTCCTCACTTGATGAATTATTCCA
+GGAAACCTATAAACACGAACAATTAATCACCCAGAAAATTAACGAACTGGCTCATGCTGC
+AATGACCAATCAGGACTACCCAACATTTAATTTCCTGCAATGGTATGTTTCTGAGCAGCA
+TGAAGAAGAGAAACTGTTCAAATCGATTATTGATAAATTAAGCCTGGCAGGCAAAAGCGG
+CGAAGGTCTGTATTTTATCGACAAAGAACTCTCTACCCTCGACACACAAAACTAATGCTC
+TCCGGCGGCAGGTTTACTGCCGCCGTTTCAAATCAGTGACGGCAAATCTTACTCTGATCG
+GTCGAAAAACCGTCTTTCGAAGGTATAAATTTGCCTTTTGCTGCCAGAAACGCTACCAGC
+TCTCCCGCTGTCATCCCTTCTGCCGAGCAGGTGTGAAAACGTGCCTGTTCACCAAAACGC
+GCTTTAATCGCAGCTTCCAGACTGGCATGCGTATATTGCTCGCCTGATTCAATCATCATA
+TTTAACACTTCATGACCGTGAATAGAGTCCATCGTCCCTCCTCAAAAAAAGCCTAGCGTA
+GCGATTGCCGCTTATGAAGACTTTGCGCCAGCGCAGGACTGAATGCTTTTTATTGTACAT
+TTATATTTACACCATATGTAACGTCGGTTTGACGAAGCAGCCGTTATGCCTTAACCTGCG
+CCGCAGATATCACTCATAAAGATCGTCAGGACAGAAGAAAGCGTGAAAAACAGAACCCTG
+GGAAGTGTTTTTATCGTGGCGGGAACCACAATTGGCGCAGGCATGCTGGCAATGCCGCTG
+GCTGCGGCCGGTGTTGGTTTTAGCGTTACGTTAATCTTGTTGATTGGGCTTTGGGCGTTG
+ATGTGCTACACGGCGCTATTACTGCTGGAGGTGTACCAGCATGTTCCGGCAGATACCGGT
+CTGGGCACGCTGGCAAAACGCTATCTGGGACGCTACGGTCAATGGCTGACGGGCTTCAGT
+ATGATGTTCTTAATGTATGCTCTGACTGCGGCATACATCAGCGGTGCCGGTGAATTGTTG
+GCCTCCAGCATCAGCGACTGGACAGGTATTTCTATGTCGGCAACCGCTGGCGTGCTGTTG
+TTCACTTTTGTTGCCGGTGGCGTGGTTTGTGTCGGAACTTCACTGGTCGATTTATTTAAC
+CGTTTTCTGTTCAGCGCCAAGATTATTTTTCTGGTGGTAATGCTGGTACTACTGCTGCCG
+CATATTCACAAAGTGAATCTTTTAACCCTGCCGTTGCAACAGGGGCTGGCTCTGTCTGCA
+ATCCCGGTGATTTTTACGTCGTTTGGTTTTCACGGTAGCGTGCCGAGTATTGTCAGCTAT
+ATGGATGGCAACATTCGTAAGCTACGCTGGGTGTTTATAATCGGTAGTGCGATCCCCCTG
+GTGGCATATATTTTCTGGCAGGTGGCGACGCTTGGCAGCATTGATTCAACAACCTTTATG
+GGATTGCTGGCTAATCATGCTGGATTAAACGGGCTGTTACAGGCGTTACGCGAAATGGTG
+GCCTCTCCGCATGTTGAGCTGGCAGTGCATTTATTTGCTGATTTAGCCCTCGCCACGTCA
+TTTCTCGGCGTTGCGTTAGGCTTATTTGATTATCTGGCTGATTTATTTCAGCGTTCAAAT
+ACCGTTGGTGGACGGTTGCAAACTGGTGCAATTACGTTTCTGCCGCCGTTGGCGTTTGCA
+CTGTTTTATCCACGAGGATTTGTGATGGCGCTGGGTTACGCCGGTGTGGCGCTGGCGGTA
+CTGGCATTGATTATCCCTTCGCTGTTGACCTGGCAAAGCAGAAAGCACAATCCTCAGGCG
+GGTTACCGGGTCAAAGGTGGTCGTCCGGCGCTGGTGGTGGTGTTTCTCTGTGGTATTGCT
+GTGATTGGCGTGCAATTTTTGATTGCGGCAGGGTTGTTACCAGAAGTGGGGTGATCAGAT
+AGCCTCAAATTCCTTATTGGGTGCCAGAATTAACGCTGACACCCAATTTGGCCTCTTAAT
+GCAGGCAGCACTGCTTAAATTTCTTACCACTACCGCACGGGCAAGGATCGTTACGCCCCG
+GTTTCTCTTCTGCTTTGATCGGTTGCTGAACAGCTTTTTCCTGCGGATGCGCCATCCAGT
+ACGCATGTAGATCAAGCGCCGCCAGTCGAATGGCATCTACGCTCTCTTCAAACGCTTCTG
+GCGACATCTTTTCTACCCGCTCGAAGTTTTCCTCAGTACCGTGCAGCGCAATCGCCTCCA
+GCGCTGGTTTTAACGAATCGGGCAACGTTGACCAGTCAGAAAGTGCCACGCCCCGCATAT
+AGCCAAAGCACCACTCCTCAACAATCGTCAGCTCGCTGCCATCAACTTCTCGCAAGCCGA
+ATAACGGCTCAAACTGCTCCGGGAATTCGTTCAGACGCTCTGCGGTATCGGCCATATGTT
+GAAAAGCCAGATTCATAAAGCGCGTCATCTCTTTCTCTGACGCCCAGCGCGGCACATAGT
+CAGCCCCACCCCACACGGCAACCAGCCACTGTTCCGGTTCAATCTCTTGCGGAGAACTCA
+ACACCGCCGTCAATAAACCGTCCAGCTCCGCCACATCAAGGATGGCGTGGTCAGTGTTGT
+ATTTGGTCAGAATATCGTCCAGCCATTCCAACTCACTTTCGTTTAACGGTCCCGTTTTCA
+TACGCTTTTCCTTGTGGATCTCAACTCGCCAGCACCTATCTTACATGCCGGTCCGTATCA
+GAGATACTTTTTGAGTGGCTTTGCTGGTGATTAAAAATTAAGGAGGGTGTAACGACAAGT
+TGCAGGCACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTT
+ATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGA
+GGGATTTTAAATCCCTTGTGTCTACCGATTCCACCATCCGGGCTCGGGAAGAAAGTGGAG
+GCGCGTTCCGGAGTCGAACCGGACTAGACGGATTTGCAATCCGCTACATAACCGCTTTGT
+TAACGCGCCAAATTCTTCAGGCCTTTCAGCCAGACATCCGCTTGACGCCGATGTCTTTTA
+AACTGGAGCGGGAAACGAGACTCGAACTCGCGACCCCGACCTTGGCAAGGTCGTGCTCTA
+CCAACTGAGCTATTCCCGCATTCATCAAGCAATCAGTTAATCACTTGATTTTATTATCGT
+CTGGCAATCAGTGCCGCCGTTCGATGCGTTGCATTCTACTTACCTGGCGCGATGAGTCAA
+CGATATTTTTCACCACTTTTGATCGTTTGCTGAAAATTACGCCGAAACGATCACTGATCA
+AGCAAATCTGCACGCGCAGCGCTCAAATATTGCAACATTGACCACAGAGTCAGTACCGCA
+GCCACAAAGAAAAGTGCAATACCGGCGTACTCAACCCAAATGTTCGGACGCCACAGCAGC
+CATGCCAACGCCACCATCTGGGCAGTGGTTTTCACTTTCCCAATCCAGGAGACGGCCACG
+CTACTGCGTTTACCCAACTCCGCCATCCATTCGCGTAGCGCAGAAATAATAATTTCACGG
+GCGATCATCGTTGCCGCCGGTAATGTCACCCACCAGCTGTGATAATGCTCGGTTACCAGC
+ACCATGGCGATAGCCACGAGAACTTTATCTGCCACAGGGTCAAGGAAAGCACCAAACCGG
+GTACTCTGGTTCCAGCGGCGTGCCAGAAAACCATCGAACCAGTCAGTCACCGCCGCGACG
+CAGAAAATGAGCGCGGCGGCAAACGGCGACCAGGTGACAGGCAGATAAAAGACCAATACA
+AAGAATGGGATAAGGATGACACGGAACAGTGTAAGCAACGTAGGGATATTAAATTGCATA
+ATGACGGGTAACTATCTGTTGTCAGTAAGATTACCCCTATGTTGCTACAGAGACATCAAT
+GTTTCAACGACCAGAAGATCTTTTCTGCCAGACCTTGCGAAATACCCGGCACTTTTGCAA
+TTTCCTCGACGCTGGCGTTACGTAAACCTTGCAAACCGCCCATATATTTCAACAACATTT
+GCCGACGTTTTGGCCCGACGCCTTCAATGGTTTCCAGGGAACTGGTATTTTTGACCTTCG
+CCCGTTTTTTACGGTGCCCGCCAATCGCGTGATCATGTGATTCATCGCGAATATGCTGGA
+TAACATGCAGCGCGGGTGAATCTGGCGGCAAACTAAATCCCTCACCTTCCGGCTCAAAGA
+ACAGCGTTTCCAGTCCAGCCTTACGATCTGCTCCTTTGGCAACGCCAAGTAGCAGCGGAT
+GATTTTTATCCCATGAGACATCCAGTTCGGCGAAGACATTTTTCGCCTGCGCAAGCTGGC
+CTTTGCCGCCGTCGATAAGGATCACATCCGGGATCTTACTGTCGTCAATGGCTTTACCAT
+AACGCCGACGCAGCACCTGATTCATCGCCGCATAATCATCGCCCGGCGTGATGCCTGTAA
+TGTTATAGCGCCGATACTCCGCACGCAGCGGGCCGTTAGCATCAAACACCACACAGGAAG
+CGACGGTTTGTTCGCCCATGGTATGGCTGATGTCAAAGCACTCCATCCGCTTCACTTCCG
+GCAATTTCAACACGCTGGCAAGCGCGGTCAGTCGCTGGTGAACGGTAGATTGCTGCGAAA
+GTTTGCTGGTTAAGGCCGTCGCCGCATTGGTGCGCGCGAGTTTCAGATAACGCGCCCTAT
+CGCCGCGAGGTTTGGTTTGAACATTAATCTTGCGTCCCGCCAGTTCTGAAAGGGAATCGG
+CGAGCAGCGTTTTATCGCTAAGATTAAAATCGAGCAGGATCTCACCCGGTAAGGTGCGCA
+TCTGGCTGCCTTGTAAATAGAACTGGCCTACGAAGGTTTCTACCACCTCGCTCAGTTCCG
+TACCGCCAGGCACTTTCGGGAAATAGCTGCGGCTGCCGAGCACTTTGCCCTGACGAATGA
+ACAATACGTGGACACAAGCCATGCCCGCATCGAACGCCACACCAATAACGTCGAGGTCGT
+CGCCGGTATTGGAAACGAATTGTTTTTCGGTGACGCGTCGCACCGCCTGAATTTGGTCGC
+GAATACGTGCAGCTTCTTCAAACTCCAGATTCTGGCTGGCAGTTTCCATACGACTAATGA
+GTTGCGTAAGCACCTGATCATCTTTGCCAGACAAAAACAGGCGCACATACTCGACCTGCT
+GAGCGTATTCTTCTTCACTCACCAGTCCTTCAACGCACGGTCCCAGACAGCGCCCTATCT
+GGTATTGCAGACACGGACGCGAGCGATTGCGATAAACACTATTTTCGCACTGGCGAATGG
+GGAAAATCTTTTGCAGTAGCGCCAGTGTTTCACGTACGGCATAGCCATTCGGGAACGGGC
+CGAAATATTCACCTTTGGCATGCTTCGCACCACGATGCATCGCCAGACGCGGGTGGGTAT
+CACCACTCAGGAAGATAAAAGGATATGATTTATCATCGCGTAGCAAAACGTTGTAACGCG
+GCTGATAGAGTTTGATGTAGTTGTGTTCCAGCAACAGCGCTTCGGTTTCTGTGTGAGTAA
+CCGTTACATCAATTTGCTGGATCTGGGCGACCAGCGCTTCGGTTTTGCGCGAAGCGAGGT
+TGCTACGGAAATAGCTGGAAAGCCGTTTTTTCAGGTCTTTCGCTTTGCCGACATAGATAA
+CCGTACCACCAGCATCGTACATGCGATAAACGCCTGGCTGGCTGGTTACGGTTTTTAAAA
+ACGCTTTTGCGTCAAACTGATCACTCACTGACTTGATAATGTCTCCGCATTACACAGACC
+ATGGCGAATTGCCAGGTGAGTCAGCTCAACATCGCCATGAATGTTTAGTTTACTGAACAT
+ACGATAGCGGTAGCTGTTCACCGTTTTCGGACTGAGATTGAGCTGTTCTGAGATCTCATT
+GACCTTCTGGCCCTTGGTGATCATCAGCATAATCTGCAATTCACGTTCAGACAAACTGGC
+AAATGGGCTTTCTGTTTTTTCTGGTTCGATCTGGCTTAACGCCATTTGTTGAGCGATGTC
+AGAAGCAATGTAACGCTGCCCTGAATAGACAGAACGAATCGCACTCACGACTTCCTGCGG
+AGCCGCGCCTTTGCTGAGGTAGCCCGCAGCACCGGCCTGCATGACTTTCGCTGGTAAAGG
+GTTTTCTGTATGGACGGTAAGCATGATGATTTTGACATCAGCTGTGGAACGCGCGATTTT
+ACGCGTCGCCTCAAGACCGCCAATGCCCGGCATACTCATGTCCATTAGCACCACGTCAAC
+GGCATTTGTCCGGCACCACTTAACGGCGTCTTCACCGCACGATGCCTCACCGACGACTTT
+TATACCCTTTATATCTTCCAGAATGCGTCGTATCCCTGCGCGCACCAGTTCGTGGTCATC
+AACAAGTAGAACGTTGATCAAAGGAATATCTCCAGAAATAGGGATAACGCTACTGATAGT
+TAGTCATTCGTATATTAGCGGTTTTTATTGCAACTTTGAAACGTTAAAAATGGTGGGTAT
+TCGATTTTTCTCTCGTTTTTGTCAATTCGATTGTCCACAGTTATGGTCACGCCCGTCACC
+AACGGCTTACCGGATCGTTTCACAGTAAGCCCTACGATGAAATGTGACAAAAATTGACTT
+TATTCAGCAAAAATGAAAATCAGCCCGCTGAATATGTAACATTAATTAACCCGAACAATA
+CGGGCAAAAAACATTCATGATAAAAATATTTATTGGTCATTATATTAACGTATTTTATAG
+CACTGCCGATATCACGCTCAAAAAACAACCACTGCTATTTTTAGCAAAGCTTATGGTATA
+CTCCGCCGCCTTAACATTTTTCACCGCAAATTTTCATTGCAACATGACGAGGAAAATAAA
+TGAGTACGCCTGATTTTTCTACTGCCGAGAATAATCAAGAACTGGCAAATGAAGTCTCCT
+GCCTGAAAGCGATGCTGACGCTGATGCTGCAGGCGATGGGACAAGCTGACGCGGGCCGCG
+TGATGTTAAAGATGGAAAAACAGCTTGCGCTGATCGAAGACGAAACCCAGGCTGCAGTAT
+TTTCCAAAACGGTTAAGCAAATTAAACAAGCCTACCGTCAGTAATATAAAACCGGCTGAT
+AGCGTGCCTTTCAGCCGGTTTTTGCATCTGGCACGCAGGACAGAAAAGAGATCAAATTAA
+GCCAGTAGCGGCCGCGTAACAGGCAACCTGGGTCTTATTTGGTGCATTAATTTTTTTCTG
+CATGTTTTTCTGGTGGAAATTGACCGTATTCTCAGAGATTGACAAAATCATCGCTATCTC
+TGCTGATGTTTTCCCTTCCGCCGTCCACCTCAGAATTTCTTTTTCGCGCTTGCTGAAATT
+CATCTCTGGCGTCATCACTATTTCATCATTTAAACGCATCAGAGCCATCAGACTTTCGCG
+CACCAGTAACTGCATTTTTAATTGCAGTTCATCACTAAGAATGGGTATTTCGCGCGCGCT
+GCAACGGGAAAAGGACAAAAAGCCCAGCGCCCGGTTTGGCAGCATTAAATACTGAGTGAC
+ACCGCGGCGTAAACCATGTGCGCGCGCGGCTTCCCATAACGGCTGTGCTTCGCTGAATAA
+GTCATCATTCCACATTAAATGGCCCTGACTAAAGTTTTCAGGGTTCAGCACCGGATCAAT
+TGCGAGAAAGTTTTTTGCCTGATAATAACTAACCCACGCCTCAGGGTAATTGGTGTAAAA
+AGCCACTTTAGGTCGAGTGAATGGTACCGGGTGGCGGACACATAACGAATAGTAATCGTA
+CTCCAGCTGCTGAGCCTGAAGCTCAATTTCATGGTAGACCTCTTCTGCGGTCTCCATCCT
+CTGAAAACGCAACAGCATCGTGCGACGCCAGCTGAAAAAATCCTTATCCTGCATAGTAAA
+CCGCAACGCCCCTGAGAGTGAGTATCATTTATAATGATAATTCAAACTATCACATAAATA
+AGATTTATATATAATTTATATTATTCAGGCAATGAATTACTTTTGCAAGCCATCGCATTC
+TCTTATGTTATTAATGAGTTATGCTGATTTGTTAAGCAGTTTTATCAGGCTTGAAATGGC
+GTCCAGCCCCGACAGGTGAATCGTCGGGGCTGATTTTTTCTTATTATTGCAGCAGAAACT
+TCTCGAGGAACTGGCGGGTGCGAGGCTGCTCGGGGTCGGCAAATAACGCTTTTGCGGCCC
+CCTGCTCGACTATCCGCCCCTGGTCCATAAAGATCGCCCGGTCCGCAACATCCCGGGCAA
+AGCTCATTTCGTGCGTCACAATCACCATCGTGCGCTTTTCCTGCGCCAGCTGACGGATGG
+TGTTCAGGACTTCACCCACCAGCTCTGGATCCAGCGCTGACGTTGGCTCGTCAAACAAAA
+TCACCTCAGGACGCATTGCCAGCGCACGCGCAATCGCAACACGCTGCTGTTGACCGCCAG
+ACAAACGACGTGGATAGCTGGTTTCTTTACCTGCCAGCCCAACTTTTGCCAGCAGCTCGC
+GAGCGCGCGCCGTGGCCTCTTCTTTCGGTTCACCTTTGACGATCACCGGCCCTTCAATAA
+TGTTCTCCAGCACCGTACGATGCGGAAACAAATTAAAGTTCTGGAAGACAAACCCGACGT
+GCTGACGCAACTGGCGAATCAGAGATTTTTGCTGACTTAATGAACGTGCAGTATCAATAG
+TGATATCGCCAACGGTGATCGTTCCCGCTTCGGGTTGTTCCAGCAGATTTATGCTGCGTA
+GCAACGTGGTTTTGCCGGAACCACTCGGACCGATAATTGCCACCACTTCGCCAGGCTTTA
+CCTCAAGGTCGATACCGTGCAGCACCGTCTGACCGTGGAATTTTTTCACCAGGTTCTTAA
+CTTCAATGGCACTCATTTTGGTTCTCTCTCCTGGCGATTAAGTTGATTCTCAAAATGGTT
+CTGCAACGTCGATAACACAGTCGCCATGATCCAGTAGATGAGCGAAGCCGCCAGATACAT
+GGTGAACACCTCCAGCGTACGCGAGGTAATCAACTGCGCCTGACGGAACAGCTCCGGCAC
+CTGGATTGTCGCGGCCAGCGACGTATCTTTTACCAGGCTAATAAAGCTGTTCGACAGCGG
+CGGCAACGCCACACGCGCCGCCTGTGGCAAAATCGCGCGACGCATGGTCTGCCACGGCGT
+CATACCAATACTGGCTGCCGCTTCCCACTGACCTTTATCAATAGAAGAAATGGCGGCGCG
+CAGCGTTTCGGCAGCATAGGCGGCAGTGTTCAACGACAGACCAATCATTGCTGACGGAAT
+GGGATCTAATTCGATACCAAACTGCGGCAGGCCGTAATAGATCATAAACAGTTGTGCGAT
+GAGCGGCGTACCACGAAAAATAGAGATATAAAAACGCGCCAGCCAGCGCACGGGCCAGAT
+TGGCGACAGACGCATCAGCGCGAGAATAAACCCGAGCAGTAAGCCAAAAAACATGCCGCC
+GATACTGAGTTGCAGCGTATACCCAGCCCCTTTCAGCAGGAACGGCAAGGAATCAATAAC
+CAGTTGTATACTTTCTTGCATGAGCGTTTCCGGAGCTAAACGTGGGGATGATAGGCGAAC
+AGCGCAGGCGCACCGCCGGTATGAATAAACAGAATCGGCCCTTCATCTTTGAAGCGTTTC
+TGACTGATACCGTCAATCAGCCCCGCCATCGCTTTTCCGGTATACACAGGATCAAGCAGA
+ATGCCTTCCAGCCGCGCCAGCAATTTCACTGCTTCCATGCCTTCGTCGTTCGGCACGCCG
+TAGCCAGGTGCAAAATAGTCATCCCAGAGTAAAATTTCCGCTGATGCGGTCAGCTCCAGT
+TCTTTCGCAATCGCCTGTTGTAGGTTAACCACTTTCGGCAATTGATCGGCAACGGAACGC
+GACACGGTCACGCCAATCAGTTCGCTTTCAGGCATCAGGTGTTCCAGCCCAACAGCCAGT
+CCGGCGTGAGTTCCGGCACTGCCCGATGCGACTACCACCGATGAAATATTAACCGCCCCT
+TCACACTGTTGCGCGATTTCCAGCGCACTCTCCACATAACCTAGCGCGCCAAGAGCATTA
+GAACCGCCAACCGGAATGACATACGGGCGAAAGCCTTGTGCTTCGACTCGCGTCGCCAGC
+TCTTCCAGTTGGGCATTGGGATCGGTCAGTGCGTCGCACATTTCAATCTGGGTATTGAAC
+AGATCCAGCAACAAGCGATTGCCGTTGGTTAAATAGTTTTCTGCGGTTGTGCCAATAGGA
+TTTTCCAGCAGCGCCACGCAGTGCAGACCGAGTTTGGCAGCGACTGCGGCAGTCTGCCGC
+ACATGGTTAGACTGGATCGCCCCGGCAGTAATCAGCGTATCGGCACCTTCACGCAGAGCA
+TCTGCCGCGAGAAATTCCAGCTTACGTAATTTATTGCCGCCCATTGCCATGGGGGTGACG
+TCATCCCGTTTGATGAAAATTTCCCGTCCTAGATAATCAGAAAAGCGCGGCAGATATTCG
+AGCGGCGTTGGCGCGCCGATAAACTCCAGCCGTGGAAAACGGGTTAAATTATGCAGTGGC
+ATAACAGCCTCCGATGTGTGTTGTTGTGATTTTCTTATTATGCACGCTGAAAACGCGTAA
+ATAAAAAAGGCGCTAGTGAAAGCGCCCTTTTTTGTCATTATGCTGATTATTTGGTCACAT
+CAGCACCAAACCATTTTTCGGAAAGGGCTTGCAGAGTGCCATCTTTTTGCATTTCCGCAA
+TTGCATCATTCACTGCTTTCAGCAGGTCCTCATTTCCTTTACGCAGCGCCACGCCAGACT
+CCTGACGGGAGAATGCTTCACCGGTTACTGCCAGCGTATCGTTGGTTTTCTTCACCAGAT
+CCAGCGCCGCCAGACGATCAACGAGGATCGCATCGATACGCCCTACGCGCAGATCCTGAT
+ATTTGGTCGGGTCATCATCATAGGTACGCACATCGACGCCCTGAACATTCTGCCGCAGCC
+ACTCTTCATAGTTGGTGCCCAGACCGACCCCCACTTTTTTGCCTTTCAGATCATCGGCTG
+TTTTAATGGTGCCTTCGTTACCTTTTTTCACCAGCGCCTGAATACCAGAAATGGTGTACG
+GGGTTGAGAAATCGTATTTTTTCTTGCGCTCATCAGAAATGGTGACCTGATTAATCACCA
+CATCAATACGTTTAGAGTCCAGCGACGCCAGCATACCGTCCCATTTGGTCGGTTTTAGTG
+ACGCCTCAACGCCAAGATGTTTTGCCAGCTGTTGGGCAAATTCCACTTCAAAACCGGTTA
+ATTTGCCGTCATCTCCCTGAAAACTGAACGGCGGATAAGTTCCTTCCAGCCCTACCAGCA
+GCGTGCCGCGCTCTTTAACTTTATTAAGCAGACCTTCATCTGCAAAACTTTTAACGCTCA
+TGCCCGCAACCAGCGCCACGGCCATCACACCCATCAATGCCTGACGTCCCAGATGTGCTA
+ATTTCATATTCACCCCGAATGTTGTTATGTCTGTTTGCAGTGTAGAGCCATTGTTTGTAA
+ACACAAAAACAACTCCGCTACATCTTATTCTTATTTAATATATATCAGAAGAAGGCAGGC
+TGGAGGATTTCTGCACAAGTCTGGTACAGGTTTGGCGCTGATAGTGTTGATACTTCCGTA
+ACGCGATGCGGTAATTGTTGGTGCTGGTGGTGGGCAGCCACGGGGCGAGGATTTCATCAA
+GGAAACCGTCCTGCAGCTGATCGAGGGAAATATTTTGCTCGTGTAGATGATTCCCCAAAC
+GGCGCAAACGAACGACATATTCACGCACCGTACCTGGGCTCATTTCAGTTTGCTCAAAAA
+GAAATTGCTTAAAGCCGATAATATCGAAAAAATCACTCTGCGTTTTGCAATGTAAATCAC
+CGCAAAATCGGCACAATGCCGCCCATGATTTTTGTTCCGTTTGCCAGCCATTTTCATCAA
+GCAGCGTGTCCAGGCGGGAAATCTCGATTTTATTCACTATTTTGCCGTCGCGAACTAAGG
+TAATGCGATCGAGTAATTTACGGCAATGCGCGCAATGGGTCTGGCTGTGTTTAAAGTCTT
+TAAGATAGCGGCTTAATGGCCGTCTTTTCAGGTGCTGCACCATCATTAAGAACTCCTGGT
+AGTCAAAGTTAAAGTGCGGCATTTACTGACGTTATAACTTACCCAGTTTAGTGCGTAACC
+GTTTAATAGCCTGGCTGTGTAACTGACTGACCCGCGATTCCCCGACCTCCAGCACCGCGC
+CAATCTCTTTGAGATTCAGCTCTTCCTGGTAATAGAGGGTTAATACCAGTTTTTCGCGCT
+CCGGCAACGTTTCGATGGCTTCCATCACCCGCTGGCGCAGATTACTGTCCAGTAGTTGTT
+GTAGCGGGTTTTCTCGCTGATGATCATCAGTAACCAGTTCGATGCTATCGCCGTGCTCTT
+CGCGCCACTCATCGTAGGAGAAGAGCTGGCTGTTATTGGTGTCGAGCAACATTTGGCGAT
+AATCGGCAATATCGATCCCTAAACGTTCCGCTACCTCAGTTTCCGTGGCGTTGCGGCCAA
+GTTCCTGCTCCAGTTGCCCTATTGCCTGTGCCACTTCACGCGCGTTGCGTCGCACGCTGC
+GCGGCACCCAGTCACGGCTGCGAAGTTCATCCAGCATAGCGCCACGGATACGCTGCACTG
+CGTAAGTTGTAAATGCCGTTCCTTGTAGGGCGTCATAGCGTTCGACGGCATTAAGTAACC
+CAATGCCGCCCGCCTGTAGCAGATCGTCAAGTTCCACGCTCGCGGGCAGTCGAACCTGCA
+GGCGCAATGCTTCGTGACGCACCAGCGGGACATAACGCTGCCACAGCGAGTGTTTATCCA
+TTACACCTTCAGCGGTATAGAGTGAATTCACGATAAACAGCCCTGCGTTATATGAGTTAT
+CGGCATGATTATCCGTTTCTGCAGGGTTTTTAATCGGACGATTAGTGGGTGAAATGAGGG
+GTTATTTGGGGGTTACAGGTAAATTCCAGGCAGAAAAAAACCCCGCCGGTGGCGGGGAAG
+CACGTTGCTGACAAATTGCGCTTTATGTTGCCGGATGCGGCGTAAACGCCTTATCCGGCC
+TACAAAAATGTGCAAATTCAATAAATTGCAATTCAACTTGTAGGCCTGATAAGCGCAGCG
+CATCAGGCAATTTGGCGTTGCCGTCAGTCTCAGTTAATCAGGTTACAACGATTAACCCTG
+CAGCAGAGACAGAACCTGCTGCGGTACCTGGTTAGCTTTTGCCAACACGGAGTTACCGGC
+CTGCTGGATGATCTGCGCTTTCGACATATTGGACACTTCGGTCGCATAGTCGGCGTCCTG
+AATACGGGACTGCGCTTCAGACAGGTTGGTAGTGGTGTTGTTCAGGTTGGTAACCGCGGA
+ATCCAGACGGTTTTGCACCGCACCGAGGGAAGAACGGAATTTGTCTACAGATGCGATAGC
+ATCGTCCAGCGCTTTCAGCGGATCCGTGGTTTTACCATTTGCAACAGCAGTCAGAGCCTC
+ACCACCAGCAGTCAAACCTGTTTGCAGATTACCGCCATTTAAATCGGCAGAATCGTATGT
+TTTACCATCAATATCGACCACTTCTGTTTTGCCATCATCTCCGCCCAGTTTGACCGCGGT
+TGGAGAACTGGCGGCACCGGAAGAGTCAGTATAGGTAATAGTTTTAACAGAAACAGCACC
+AGTAGTTTCATTCACATCCGCAGCGTAAAGATTGCCATTTGTATCTTTAAGCGCATATGT
+ATCGGTATCATTACCCTTGGAATCCTGCAGTTTTACTAAGCTAACAGCACCAAGGTTGGC
+AGTTGCGGAACCTGCAGTATTATCAATCTGAACAGGTGTACCGCCTGAAGTGATAGTTGT
+AGCTTTAGTAGTATTTGCATCAGTTACAGTTGCATTTGCCGTTGCTCCAGTCGCCATTGT
+CACTGTACCATCATTAGCAACTGTTACTGCGTAATACTTCCCATCGTTATCACCACCGGT
+GATTTTCGCATAGTAATCATTACCATTATCAGTATAAACACCCTCAATTGAAGCTGGGTT
+AGTTCCGCCAGTATCAGTGGCTGCTTCCGTAGAAAGGGTAATTCCAGTAAGTTTAATATT
+GTTTGTGGTGGTAGCACCAAAAGCAGTTACTGGAGCACTAGTGGTAACTGTATCGTTATT
+TTTAACGCTAAAACCATCAAGGCCAAGAGTTTTAGCATCAATCTGCTTCAGATCGATAGT
+GATAGTCTGGTTATCATTTGCGCCAACCTGGATTTTCATGGAGCCATTTTTTGCCAGCAC
+GTTCACGCCGTTGAACTGGGTCTGACCAGATACGCGGTCAATTTCATCCAGACGGGATTT
+AATTTCGTCCTGGATAGCAGACAGATCAGACTCAGAGTTAGTACCGGTAGTGGCCTGTAC
+CGTCAGTTCACGCACACGCTGTAAGTTGTTGTTGATTTCGGACAGCGCGCCTTCGGTGGT
+CTGCGCAACGGAGATACCGTCGTTGGCGTTACGGGCCGCCTGAGTCAGGCCTTTAATGTT
+AGAGGTGAAACGGTTAGCAATCGACTGACCCGCTGCGTCATCCTTCGCGCTGTTAATACG
+CAAGCCAGAAGACAGACGCTCGATAGAACTCGACAGCGCAGACTGGTTCTTGTTGATATT
+ATTTTGAGTGATCAGCGAGAGGCTGTTGGTATTAATGACTTGTGCCATGATTCGTTATCC
+TATATTGCAAGTCGTTGATTACGTATTGGGTTTCCACCCGTCGGCTCAATCGCCGTCAAC
+CCTGTTATCGTCTGTCGTAAAACAACCTTTAGAATTTTTTTCAAAAACAGCCATTTTTTG
+TTAGTCGCCGAAATACTCTTTTCTCTGCCCCTTATTCCCGCTATTAAAAAAAACAATTAA
+ACGTAAACTTTGCGCAATTCAGACCGATAACCCCGGTATTCGTTTTACGTGTCGAAAGAT
+AAAAGGAAATCGCATGGCAAGTATTTCATCGCTGGGAGTCGGGTCAGGTCTGGATTTAAG
+TTCCATCCTTGATAGCCTCACCGCCGCGCAAAAAGCGACGCTAACCCCCATTTCAAATCA
+GCAATCGTCGTTTACCGCTAAACTTAGCGCCTACGGTACGCTGAAAAGCGCGCTGACGAC
+TTTCCAGACCGCCAATACTGCATTGTCTAAAGCCGATCTTTTTTCCGCCACCAGCACCAC
+CAGCAGCACCACCGCGTTCAGTGCCACCACTGCGGGTAACGCCATCGCCGGGAAATACAC
+CATCAGCGTCACCCATCTGGCGCAGGCGCAAACCCTGACCACGCGCACCACCAGAGACGA
+TACGAAAACGGCGATCGCCACCAGCGACAGTAAACTCACCATTCAACAAGGCGGCGACAA
+AGATCCGATTACCATTGATATCAGCGCGGCTAACTCATCGTTAAGCGGGATCCGTGATGC
+CATCAACAACGCAAAAGCAGGCGTAAGCGCAAGCATCATTAACGTGGGTAACGGTGAATA
+TCGTCTGTCAGTCACATCAAATGACACCGGCCTTGATAATGCGATGACACTCTCGGTCAG
+CGGTGATGATGCGCTACAAAGTTTTATGGGCTATGACGCCAGTGCCAGCAGCAACGGTAT
+GGAGGTCTCGGTTGCCGCCCAGAATGCGCAGCTGACAGTCAACAACGTCGCCATCGAGAA
+CAGCAGCAACACCATCAGCGACGCGCTGGAAAACATCACCCTGAACCTGAACGATGTCAC
+CACGGGCAACCAGACGCTAACCATCACTCAGGACACCTCCAAAGCGCAAACGGCGATTAA
+AGACTGGGTGAATGCCTACAACTCGCTAATAGATACCTTCAGCAGCCTGACCAAATACAC
+CGCCGTAGATGCGGGAGCTGATAGCCAGAGTTCTAGCAATGGTGCACTGCTCGGCGACTC
+CACGCTGCGGACGATTCAGACGCAGTTGAAATCGATGCTGAGTAATACCGTCAGTTCTTC
+CAGCTATAAAACGTTGGCGCAGATTGGTATCACGACCGATCCCAGCGATGGCAAACTGGA
+ACTGGATGCCGACAAACTCACCGCTGCACTGAAAAAAGATGCCAGCGGCGTAGGTGCATT
+GATTGTTGGCGATGGTAAAAAAACCGGCATCACGACCACCATCGGCAGCAACCTGACCAG
+TTGGCTTTCGACAACGGGCATTATTAAAGCCGCTACCGATGGCGTTAGTAAGACCCTGAA
+TAAATTAACTAAAGACTACAACGCCGCCAGCGATCGCATTGATGCGCAGGTCGCTCGCTA
+CAAAGAACAATTTACCCAACTGGACGTTTTAATGACCTCGTTAAACAGCACCAGCAGCTA
+CTTAACGCAGCAGTTCGAAAACAACAGTAATTCCAAGTAAGCAATATTCATCGGGAGACA
+GGTCATGTACGCGGCAAAAGGCACCCAGGCCTATGCACAAATTGGCGTCGAAAGCGCCGT
+AATGAGCGCCAGCCAGCAGCAGCTGGTCACCATGCTATTTGATGGAGTGCTGAGCGCACT
+GGTTAGAGCGAGCCTGTTTATGCAGGACAACAATCAGCAAGGCAAAGGCGTCTCTTTGTC
+AAAAGCGATCAACATCATTGAGAACGGACTGCGGGTGAGTCTTGATGAAGAGAGCAAAGA
+CGAACTAACCCAAAACTTGATTGCTCTTTATAGCTATATGGTCAGGCGCTTGCTGCAAGC
+CAATTTACGCAACGATGTCTCCGCAGTCGAAGAAGTGGAAGCATTAATGCGCAATATTGC
+CGATGCCTGGAAAGAGTCGTTACTCTCCCCTTCTTTGATTCAGGACCCAGTCTGATGAAC
+CATGCACCGCATTTATATTTCGCCTGGCAACAACTCGTCGAAAAAAGCCAGCTCATGTTA
+CGCCTGGCAACGGAAGAACAATGGGACGAACTCATCGCCAGCGAAATGGCGTATGTGAAT
+GCGGTGCAGGAGATTGCACATTTGACTGAAGAGGTTGACCCGTCCACCACGATGCAGGAG
+CAGCTCCGCCCGATGCTGCGCCTGATTCTCGACAACGAAAGCAAGGTAAAGCAGTTATTA
+CAGATTCGGATGGATGAACTGGCGAAACTGGTCGGTCAGTCATCGGTGCAAAAATCGGTG
+TTAAGTGCCTATGGCGATCAGGGCGGCTTTGTGCTGGCTCCGCAGGATAACCTCTTTTGA
+ATCTGAATGAGTCGATGGCTCGCGAATAATCCGATTACGGCTACGCTTCTAATGTTCCCC
+TTGAATGGAGTCGAAGAATGCGTAATCCCACGCTGTTACAATGTTTTCACTGGTATTACC
+CGGAAGGCGGTAAGCTCTGGCCTGAACTGGCCGAGCGCGCCGACGGTTTTAATGATATTG
+GTATCAATATGGTCTGGTTGCCGCCCGCCTATAAAGGCGCATCGGGCGGGTATTCGGTCG
+GCTACGACTCCTATGATTTATTTGATTTAGGCGAGTTTGATCAGAAAGGCAGCATCCCTA
+CTAAATATGGCGATAAAGCACAACTGCTGGCCGCCATTGATGCTCTGAAACGTAATGACA
+TTGCGGTGCTGTTGGATGTGGTAGTCAACCACAAAATGGGCGCGGATGAAAAAGAAGCTA
+TTCGCGTGCAGCGTGTAAATGCTGATGACCGTACGCAAATTGACGAAGAAATCATTGAGT
+GTGAAGGCTGGACGCGTTACACCTTCCCCGCCCGTGCCGGGCAATACTCGCAGTTTATCT
+GGGATTTCAAATGTTTTAGCGGTATCGACCATATCGAAAACCCTGACGAAGATGGCATTT
+TTAAAATTGTTAACGACTACACCGGCGAAGGCTGGAACGATCAGGTTGATGATGAATTAG
+GTAATTTCGATTATCTGATGGGCGAGAATATCGATTTTCGCAATCATGCCGTGACGGAAG
+AGATTAAATACTGGGCGCGCTGGGTGATGGAACAAACGCAATGCGACGGTTTTCGTCTTG
+ATGCGGTCAAACATATTCCAGCCTGGTTTTATAAAGAGTGGATCGAACACGTACAGGAAG
+TTGCGCCAAAGCCGCTGTTTATTGTGGCGGAGTACTGGTCGCATGAAGTTGATAAGCTGC
+AAACGTATATTGATCAGGTGGAAGGCAAAACCATGCTGTTTGATGCGCCGCTGCAGATGA
+AATTCCATGAAGCATCGCGCATGGGGCGCGACTACGACATGACGCAGATTTTCACGGGTA
+CATTAGTGGAAGCCGATCCTTTCCACGCCGTGACGCTCGTTGCCAATCACGACACCCAAC
+CGTTGCAAGCCCTCGAAGCGCCGGTCGAACCGTGGTTTAAACCGCTGGCGTATGCCTTAA
+TTTTGTTGCGGGAAAATGGCGTTCCTTCGGTATTCTATCCGGACCTCTACGGTGCGCATT
+ACGAAGATGTCGGTGGTGACGGGCAAACCTATCCGATAGATATGCCAATAATCGAACAGC
+TTGATGAGTTAATTCTCGCCCGTCAGCGTTTCGCCCACGGTGTACAGACGTTATTTTTCG
+ACCATCCGAACTGCATTGCCTTTAGCCGCAGTGGCACCGACGAATTTCCCGGCTGCGTGG
+TGGTCATGTCGAACGGGGATGATGGCGAAAAAACCATTCATCTGGGAGAGAATTACGGCA
+ATAAAACCTGGCGTGATTTTCTGGGGAACCGGCAAGAGAGAGTAGTGACCGACGAAAACG
+GCGAAGCAACCTTCTTTTGCAACGGCGGCAGCGTCAGCGTGTGGGTTATCGAAGAGGTGA
+TTTAAATTCATCCCCGGCGGCAAGCCGGGGAGATTTCATTACGGCAGTGGCGTCGGTAAC
+GGCGCTTTATCCAGCGCGGCGGCACACTCTGCTGTCGGGCGATCCACACGCTCCATCGTC
+ATACCATCGTACTCAATGGTGTTACCGTCACGCTCAACCTCGTACAGCTCACGTTTTACG
+GTAACGTTAGTGAGATCATCAGACATCAATGTCAACTTACCCGGCACGGCAATCACCCGC
+TGCCACTGACGGCAATCCAGGGTATCGCCCTCTTTAGTGACAATCAGGCTGCCTATCGCT
+TCCGGGCTGACCAGCGCACGTTGCGGCCCTTTGGTCTGCCAGTAGCCCGCCAGCCAGTCC
+GGCGCGGGGGTTTTCACGACATTGTTATAGTTTTCGACTTCGGCACAGCCCGCCAGCAAC
+AAGAGCGCGCCTGCAATTGCGAGTTTTTTCATCATTCGTCCTGCATGAGAAGAAAAGAGG
+ATTGTGGCATTAAAGCCCTGATGTCGCCAGCCTTTCAAGGTTCAGAGAGAAATTTGATCT
+AACTATTATTTTTGTGAATTATTACCCCGAAAATAAATTTGCATGGTGTATGATTCGCGA
+CTCTTGTTTCAAACCTTCTGAGTTCAGAGGCTACATTCATGTCATGGCAGCAATTCAAAC
+ACGCCTGGTTGATTAAATTCTGGGCCCCCATCCCTGCGGTCATCGCGGCGGGTATTCTCT
+CTACTTACTATTTTGGCATTACTGGCACCTTTTGGGCTGTCACGGGTGAATTTACCCGTT
+GGGGCGGCCAGCTCCTGCAACTGTTCGGCGTCCATGCTGAAGAGTGGGGTTACTTTAAAA
+TTATCCATCTGGAAGGATCGCCATTAACCCGCATCGACGGGATGATGATCCTCGGTATGT
+TTGGCGGCTGCTTTGCCGCAGCGCTGTGGGCCAACAATGTCAAACTGCGAATGCCGCGCA
+GCCGTATCCGCATTATGCAGGCCATCATTGGCGGCATTATCGCCGGTTTTGGCGCGCGTC
+TGGCAATGGGCTGTAACCTGGCGGCGTTCTTTACCGGTATTCCTCAGTTCTCGCTGCATG
+CCTGGTTCTTTGCCATCGCCACTGCCATTGGTTCATGGTTTGGCGCGCGCTTTACCCTGC
+TGCCCATCTTCCGTATTCCCGTGAAAATGCAGAAAGTTTCTGCCGCCTCACCGCTGACGC
+AAAAACCGGATCAGGCGCGGCGTCGTTTTCGTCTCGGGATGCTGGTCTTTTTCGGCATGC
+TGGGCTGGGCGCTGCTCACAGCGATGAACCAACCCAAACTGGGGCTGGCAATGCTGTTTG
+GCGTCGGCTTTGGTTTACTGATTGAACGTGCGCAAATCTGCTTTACTTCAGCGTTCCGCG
+ATATGTGGATCACCGGACGTACCCATATGGCGAAAGCAATCATTATCGGTATGGCGGTGA
+GTGCCATCGGGATCTTCAGTTACGTACAGTTAGGCGTTGAACCCAAAATCATGTGGGCGG
+GACCAAACGCGGTAATTGGTGGTTTACTGTTTGGTTTTGGCATCGTGCTGGCTGGCGGCT
+GCGAAACCGGCTGGATGTACCGCGCGGTAGAAGGCCAGGTGCACTACTGGTGGGTCGGTC
+TGGGCAATGTGATCGGCTCAACGATTCTGGCGTATTACTGGGATGATTTCGCTCCGGCGC
+TGGCCACCGACTGGGACAAAATCAACCTGCTGAAAACCTTTGGTCCGATGGGTGGCCTGC
+TGGTGACATATTTGCTGTTGTTTGCTGCGCTGATGTTGATTATCGGCTGGGAAAAACGCT
+TCTTCCGCCGTGCGGCACCGCAGACTGCTAAGGAGATCGCATGAAAAATATCGTTCCTGA
+TTACCGCCTTGATATGGTGGGTGAACCCTGCCCTTATCCGGCAGTCGCAACCCTTGAGGC
+GATGCCGCAGTTAAAAAAAGGGGAAATCCTGGAAGTGGTGAGCGACTGTCCGCAGTCGAT
+CAATAATATTCCACTGGATGCGCGTAATCACGGCTATACGGTGCTGGATATTCAGCAAGA
+CGGGCCGACCATTCGTTATTTAATTCAGAAGTAATCCCTCATTCCCGCTGTGACCCACAG
+CGGGAACATCGTTACCTTTGTATCACATAGATTTTACCCGCCCCCACTCCTATTCTTTTC
+AGTATGATCTCAGGAGGTTTCTATGTGTGGACGCTTTGCCCAATCCCAAACGCGTGAAGA
+TTACCTTGCGCTTCTCGCGGAAGATATTGAACGCGATATTCCCTATGATCCCGAACCCAT
+TGGCAGATACAACGTCGCGCCGGGAACCAAAGTCCTACTGCTCAGTGAACGTGATGAACA
+CCTTCATCTGGATCCGGTTTTCTGGGGATATGCTCCCGGATGGTGGGATAAACCGCCGCT
+GATTAACGCCCGCGTAGAAACTGCGGCAACCAGTCGTATGTTTAAACCGCTCTGGCAACA
+TGGTCGGGCAATCTGTTTTGCCGATGGCTGGTTTGAGTGGAAAAAAGAAGGCGACAAAAA
+ACAGCCTTTTTTTATCTATCGTGCTGATGGACAACCTATTTTTATGGCCGCGATAGGTAG
+CACACCATTTGAGCGTGGTGACGAAGCCGAAGGATTTTTGATCGTCACTGCTGCGGCAGA
+TCAAGGTCTGGTAGATATTCATGACCGCCGCCCACTGGTACTGTCGCCAGAAGCTGCGCG
+GGAATGGATGCGGCAAGAGATTAGCGGTAAAGAAGCCTCAGAAATCGCGGCCAGTGGCTG
+TGTTCCAGCAAACCAGTTCTCCTGGCACCCGGTATCGCGCGCGGTGGGTAATGTTAAAAA
+CCAGGGCGCGGAGTTAATTCAACCTGTTTGATAAGCCTGGAGATTATTGATCAACAATAC
+TGCGTCATAAGAAATCTCTATTAGACAAAGATTTCATTACCTGTTGGCATATTGCAAAAA
+TAACACCAATACGGAATCGTCATGTTCACGATTAAAACAGATGATCTCACCCATCCAGCA
+GTGCAAGCATTAGTGGCTTACCATATTTCCGGCATGCTGCAGCAGTCTCCCCCCGAAAGC
+AGTCATGCTTTAGATGTGCAAAAATTACGTAACCCGACAGTGACATTCTGGTCAGTATGG
+GAAGGCGAACAACTCGCAGGAATTGGTGCGCTGAAGTTGCTGGATGATAAACACGGCGAG
+CTGAAATCAATGCGTACCGCGCCAAATTATTTACGTCGTGGTGTCGCCAGTCTGATTTTA
+CGCCACATTTTGCAGGTCGCCCAGGACAGATGCCTTCATCGCCTGAGCTTAGAAACGGGT
+ACACAGGCTGGATTTACGGCCTGCCATCAACTTTATTTGAAGCATGGTTTCGCTGATTGC
+GAACCGTTTGCTGATTATCGACTTGATCCACACAGTCGATTTTTATCATTGACGCTATGC
+GAAAATAATGAATTGCCATGAGCCAGACGCAGCACATTCTTGCATTCGACGTGCTGCGCC
+TTTATTTATCACCAGCAGGAAACGCCTTGTCCATAGACGCCCCTTCCACATGCGCCACAA
+GAAACCTCTATTCCAGTGACACAATTGCGCCTAATTAATTACATTTAATATTTAATTATG
+AGTTCCTCACCATCTATTACATACTTTTTAACCATATCGGAATATTTATCATAATCAGCG
+GGATTCGTAACAATATATTTTCGCTGCGATCTTTCATAGCAAATCCCTGTCAAAGTCCAT
+GATATAAAAATGTCTCTTCAAAAGAATTACATTCTTTAAAAAGTAATTCTTTATTGCTAT
+ATATCGCAGAGACAACCTCAATATCACACTCCATACGTGCTTTCTCCAGATGATTTGGGA
+AGTATTGAATTTCTTTTATCTTATTATCGCCACAATTAAACAGCTTAGTAGTCTCAGGCA
+TTGCTGGTATTTACCATATTTTATTGCGATAAATAGAAATTGTCATAGCCTTTGACGGAG
+ATGAGTCAACACGCGATATCAGATTATTATCTACGGAGACCTGGGTAATTCCATCGGATA
+CTTTTGGAAATACCATATAATTATTGAAATCGAGCTCTAATTCTTTGCAGAATTTGGGAA
+TTTGTATTGTGGCAAGGCCATTATGACGAAGATAAAGCACCTCAATCCAGGATGGAAGAG
+GTGGCAAAGACCCCAAGTGAAGATCTGTTAAGTCAAGTTTACTATTGTGGAGTTCAACAC
+ATTTAAACAATCTCACCAATGCTATATCCACATTTTTTTTGAAGTCATTCGATGCGCCTT
+CTTTTACTGAATTAGCCCAGTCGCTGAAACCTTTGCAAAGTCTGGAATCTGTAATTTTCG
+TAAAGTTGTCTAGAAACTCTGCAATATTAGTCGATATAAACTCTAATTTATGCCGAATGG
+GTGGGTTACCAGTTCCCTGATTTTTTCTATCATGATAAAACCTATCTTATTATAAATCGA
+GAAATCTTGAAACCAGAGACTATAATCACCCCATTCGAAATATTCTGAGTGCAATAACTT
+AAATTCTGACAGCATATTAAATAATTTGCTGTCTTCACTAATTGGTGTAAACTTACCATT
+TCCAAGACAACTGACTAACTCACTTGATAATTCATTTATGATTGCATCATCAGATACTAA
+CTCATGTTGTTTTATCGTAGATTCAGTATTAGATGTGACTTTATTTAATTGAACCGGCTG
+AGTTTTTAACGAAAGATCATTTAATGGAAACATTTACACTCCTGTTTAATAAATTATATT
+GCCCAGGGCGCATTCTAAAACACAATAAAATTACCACTATCAAAAATCGCTCATATCCAT
+CGCCCGGAATATGAATAAAAACATCAACAAAGATTAAATTATCCAGAGGTTACTGTTGCG
+TCTGTGGTCGTAACAACATCCGACGTGGTGATGTGTCAAATGAGACGCTCTGATGTTCAG
+GGGGGTTATCGCGTATACGGATCGTGGATGGCAGAAAACGTTCAGGATCAGGTATCCATT
+TTAAACCAGAAATTGAGTGAGTTTGCCCCATCCATGCCCCACGCGGTGAGATCGGATGTA
+ATTAACAACAGGTTACAAAACCTACACCTGCATGCTCATCACTTCCTGATACGCCGCCAC
+CAGCTTATTACGCACCTGAATCCCCATTTGCATAGAAACTGAGGCTTTTTGCATATCGGT
+CATCACATCGTTTAACGCCACGCCGGGTTCACCGAGAGTGAATTTTTCTGCCTGCGTGCG
+GGCAGCTGTTTGTGTATCACTAATGCGATCGAGCGCGGCGTGCAGCTGCCCGGCAAAACT
+AATGGTCGGTTGCGGCAGTGATTCCTGCGCACGCGCACTCATCGCCGTAGCCTGTAACTG
+GCTGATAACCCCTTCAATCCCCTGTATCGCTGACATTCTCGTCTCCCGGATAATTTCTGG
+TAGCAAAGCCTACCAGTAAGTCAATAAGACAAAGGCGCTAAATAGCAACAAAAAAACGGG
+TTTATTGGCGGATAGAAAAAAACGAAAGCACAAATAATGGGAGCGTCAATTTTTCGAGTT
+TGCTGACCCGGGAGTGAGTCTTGTTCCACTTTGCCAATAACGCCGTCCATAATCAGCCAC
+GAGGTGCGCGATGAATGCGACTGCAGCCCAGACAAAATCTCTTGAGTGGCTTAATCGCCT
+GCGTGCGAATCCGAAAATTCCATTGATTGTTGCCGGTTCCGCGGCAGTGGCGGTCATGGT
+CGCACTGATCCTGTGGGCGAAAGCCCCCGACTACCGCACATTATTCAGCAATCTTTCCGA
+TCAGGATGGTGGCGCAATTGTCAGCCAACTGACGCAAATGAATATTCCTTACCGCTTCAG
+CGAAGCCAGCGGCGCTATTGAAGTTCCGGCAGATAAAGTTCACGAACTGCGTCTGCGCCT
+GGCACAACAAGGTTTGCCAAAAGGCGGCGCGGTCGGTTTCGAACTGCTTGATCAGGAAAA
+GTTTGGTATCAGCCAGTTCAGCGAACAGGTGAATTATCAGCGGGCGCTGGAAGGCGAGCT
+TTCTCGTACCATCGAAACTATCGGCCCGGTAAAAGGGGCGCGCGTACATCTGGCAATGCC
+GAAACCGTCTTTATTCGTCCGTGAACAAAAATCCCCTTCTGCATCGGTGACGGTAAATCT
+GTTACCCGGCCGCGCACTCGATGAAGGGCAAATTAGCGCCATTGTGCATCTGGTTTCCAG
+CGCCGTTGCTGGTCTGCCGCCGGGAAACGTCACGCTGGTGGATCAGGGCGGACATCTGTT
+AACCCAGTCCAATACCAGCGGGCGCGATCTTAATGACGCTCAGTTGAAATATGCCAGCGA
+TGTCGAAGGCCGTATTCAGCGGCGTATTGAAGCGATCCTGTCGCCTATTGTTGGTAACGG
+TAATATTCACGCCCAGGTTACGGCGCAGCTGGACTTCGCCAGTAAAGAACAAACGGAAGA
+ACAGTATCGCCCTAACGGTGATGAATCTCATGCGGCGCTTCGTTCACGCCAGCTTAATGA
+GAGCGAGCAAAGCGGTTCCGGTTATCCGGGCGGCGTACCGGGGGCGTTGTCGAATCAACC
+GGCACCTGCGAATAACGCGCCAATCAGCACGCCTCCGGCAAATCAAAATAACCGCCAGCA
+GCAGGCGAGCACCACCAGCAATAGTGGGCCGCGTAGCACACAGCGGAATGAAACCAGTAA
+CTACGAAGTCGATCGCACCATTCGTCATACCAAAATGAACGTGGGCGATGTGCAACGTCT
+GTCAGTCGCGGTCGTGGTGAATTACAAAACCTTGCCAGATGGCAAACCGTTGCCTCTCAG
+CAACGAACAGATGAAGCAAATTGAAGATCTGACCCGCGAGGCGATGGGCTTTTCTGAAAA
+ACGCGGTGACTCGCTCAATGTCGTTAACTCGCCGTTCAATAGCAGTGACGAAAGCGGCGG
+AGAACTGCCATTCTGGCAACAGCAAGCGTTTATCGATCAGTTACTTGCTGCCGGTCGCTG
+GTTGCTGGTACTGCTGGTGGCGTGGCTGCTGTGGCGGAAAGCGGTACGTCCGCAGCTAAC
+ACGTCGCGCTGAGGCGATGAAAGCTGTACAGCAACAGGCGCAGGCCCGCGAGGAAGTGGA
+AGATGCGGTGGAAGTCCGCCTGAGCAAAGACGAACAACTACAACAACGGCGCGCTAACCA
+ACGTCTGGGGGCAGAAGTCATGAGCCAGCGTATCCGTGAAATGTCTGATAACGATCCGCG
+CGTGGTGGCGCTGGTCATTCGCCAGTGGATAAATAACGATCATGAGTAACCTGACAGGCA
+CCGATAAAAGCGTCATCCTGCTGATGACCATTGGCGAAGACCGGGCGGCAGAGGTGTTCA
+AGCACCTCTCCCAGCGTGAAGTACAAACCCTGAGCGCTGCAATGGCGAACGTCACGCAGA
+TCTCCAACAAGCAGCTAACCGATGTGCTGGCGGAGTTTGAGCAAGAAGCTGAACAGTTTG
+CCGCACTGAATATCAACGCCAACGATTATCTGCGCTCGGTATTGGTCAAAGCTCTGGGTG
+AAGAACGTGCCGCCAGCCTGCTGGAAGATATTCTCGAAACTCGCGATACCGCCAGCGGTA
+TTGAAACGCTCAACTTTATGGAGCCACAGAGCGCCGCCGATCTGATTCGCGATGAGCATC
+CGCAAATTATCGCCACCATTCTGGTGCATCTGAAGCGCGCCCAAGCCGCCGATATTCTGG
+CGTTGTTCGATGAACGTCTGCGCCACGACGTGATGTTGCGTATCGCCACCTTTGGCGGCG
+TGCAGCCAGCCGCGCTGGCGGAGCTGACCGAAGTACTGAATGGCTTGCTCGACGGTCAGA
+ATCTCAAGCGCAGCAAAATGGGCGGCGTGAGAACGGCAGCCGAAATTATCAACCTGATGA
+AAACTCAGCAGGAAGAAGCCGTTATTACCGCCGTGCGTGAATTCGACGGCGAGCTGGCGC
+AGAAAATCATCGACGAGATGTTCCTGTTCGAGAATCTGGTGGATGTCGACGATCGCAGCA
+TTCAGCGTCTGTTGCAGGAAGTGGATTCCGAATCGCTGTTGATCGCGCTGAAAGGAGCCG
+AGCAGCCACTGCGCGAGAAATTCTTGCGCAATATGTCGCAGCGTGCCGCCGATATTCTGC
+GCGACGATCTCGCCAACCGTGGTCCGGTGCGTCTGTCGCAGGTGGAAAACGAACAGAAAG
+CGATTCTGCTGATTGTGCGCCGCCTTGCCGAAACTGGCGAGATGGTAATTGGCAGCGGCG
+AGGATACCTATGTCTGATAATCTGCCGTGGAAAACCTGGACGCCGGACGATCTCGCGCCA
+CCACAGGCAGAGTTTGTGCCCATAGTCGAGCCGGAAGAAACCATCATTGAAGAGGCTGAA
+CCCAGCCTTGAGCAGCAACTGGCGCAACTGCAAATGCAGGCCCATGAGCAAGGTTATCAG
+GCGGGTATTGCCGAAGGTCGCCAGCAAGGTCATAAGCAGGGCTATCAGGAAGGACTGGCC
+CAGGGGCTGGAGCAAGGTCTGGCAGAGGCGAAGTCTCAACAAGCGCCAATTCATGCCCGG
+ATGCAGCAACTGGTCAGCGAATTTCAAACTACCCTTGATGCACTTGATAGTGTGATAGCG
+TCGCGCCTGATGCAGATGGCGCTGGAGGCGGCACGTCAGGTCATCGGTCAGACGCCAACG
+GTGGATAACTCGGCACTGATCAAACAGATCCAACAGTTGTTGCAGCAAGAACCGTTATTC
+AGCGGTAAACCACAGCTGCGCGTGCACCCGGATGATCTGCAACGTGTGGATGATATGCTC
+GGCGCTACCTTAAGTTTGCATGGCTGGCGCTTGCGGGGCGATCCCACCCTCCATCCTGGC
+GGCTGTAAAGTCTCCGCCGATGAAGGCGATCTCGACGCCAGTGTCGCCACTCGCTGGCAA
+GAACTCTGCCGTCTGGCAGCACCAGGAGTGGTGTAATGACCACGCGCCTGACTCGCTGGC
+TAACCACGCTGGATAACTTTGAAGCCAAAATGGCGCAGTTGCCTGCGGTACGTCGCTACG
+GGCGATTAACCCGCGCTACCGGGCTGGTGCTGGAAGCCACCGGATTACAATTGCCGCTCG
+GCGCAACCTGTGTCATTGAGCGCCAGAACGGCAGCGAAACGCACGAAGTAGAAAGCGAAG
+TCGTTGGCTTTAACGGTCAACGGCTGTTTTTAATGCCGCTGGAGGAAGTCGAAGGTGTCC
+TGCCCGGCGCGCGTGTTTATGCCAAAAACATTTCGGCAGAAGGGCTGCAAAGCGGCAAGC
+AGTTGCCGCTCGGTCCGGCGTTATTAGGTCGCGTTCTGGACGGCAGCGGTAAACCGCTCG
+ATGGCCTGCCCTCCCCCGATACGACGGAAACCGGTGCGCTGATTACCCCGCCATTTAACC
+CGTTGCAACGTACACCGATTGAACATGTGCTGGACACCGGCGTGCGCCCAATCAATGCCC
+TGCTTACCGTTGGGCGTGGGCAGCGTATGGGGCTGTTTGCCGGGTCCGGCGTTGGTAAAA
+GTGTGCTGCTGGGGATGATGGCACGTTACACCCGCGCCGATGTCATTGTCGTGGGTTTGA
+TTGGTGAACGTGGGCGCGAAGTAAAAGATTTTATTGAGAACATCCTCGGTGCCGAAGGGC
+GTGCACGCTCAGTGGTGATTGCCGCTCCGGCGGATGTTTCTCCGCTCCTGCGAATGCAGG
+GTGCCGCCTATGCCACGCGCATTGCCGAAGATTTTCGCGATCGTGGTCAGCATGTGTTGC
+TGATTATGGACTCCCTCACCCGCTACGCGATGGCCCAGCGTGAAATTGCGCTGGCGATTG
+GCGAACCCCCCGCCACCAAAGGTTATCCACCGTCGGTGTTTGCCAAATTACCGGCACTGG
+TCGAGCGTGCCGGAAATGGCATTAGCGGCGGCGGCTCGATTACCGCGTTTTATACCGTGC
+TCACTGAAGGCGATGACCAGCAGGATCCGATTGCCGACTCCGCGCGGGCGATCCTCGACG
+GTCACATTGTGCTGTCTCGCCGACTGGCGGAAGCCGGGCACTATCCGGCTATCGATATTG
+AAGCGTCGATCAGCCGCGCAATGACGGCGTTGATCAGTGAGCAACATTACGCGCGAGTGC
+GCACCTTCAAACAGCTGTTGTCGAGTTTTCAGCGTAACCGCGATCTGGTTAGCGTCGGCG
+CGTATGCCAAAGGCAGCGATCCGATGCTCGATAAAGCCATCGCCCTGTGGCCGCAGCTGG
+AGGGCTATTTGCAACAAGGCATTTTTGAACGCGCGGACTGGGAAGCGTCTCTCCAGGGGC
+TGGAGCGTATTTTCCCGACAGTGTCATAACCCAGGAGATAACGGCAGATGGCAGAACATG
+GTGCGCTGGCGACCCTGAAAGATCTGGCAGAAAAAGAGGTAGAGGATGCCGCGCGCCTGC
+TGGGTGAAATGCGTCGCGGATGTCAGCAGGCGGAAGAACAGCTCAAAATGCTGATTGATT
+ATCAGAATGAATATCGCAATAACCTCAACAGCGATATGAGTGCCGGGATAACCAGCAACC
+GCTGGATCAACTATCAGCAGTTTATCCAGACGCTGGAAAAAGCCATTACTCAGCATCGCC
+AGCAACTTAATCAGTGGACGCAGAAAGTTGACATTGCCCTGAACAGTTGGCGAGAAAAAA
+AACAACGTTTGCAGGCCTGGCAGACACTGCAGGAACGGCAATCCACGGCGGCACTGCTTG
+CAGAAAACCGCCTCGATCAGAAAAAGATGGATGAGTTCGCCCAGCGCGCCGCCATGAGGA
+AACCTGAATGATTCGCTTAGCGCCCTTGATTACCGCCGACGTTGACACCACCACATTGCC
+TGGCGGCAAAGCCAGCGATGCTGCACAAGATTTTCTCGCGTTGTTGAGCGAAGCATTAGC
+AGGCGAGACAACTACCGACAAAGCGGCCCCCCAGTTGCTGGTGGCAACAGATAAGCCCAC
+GACAAAAGGCGAGCCGCTGATCAGCGATATTGTTTCCGACGCGCAACAAGCTAATTTACT
+GATCCCTGTGGATGAAACACCGCCTGTCATCAACGACGAACAATCCACATCAACACCGTT
+AACCACCGCTCAGACGATGGCGTTGGCTGCGGTGGCTGACAAAAATACGACAAAAGACGA
+AAAAGCGGATGATCTGAATGAAGACGTCACCGCAAGCCTGAGCGCCCTTTTTGCGATGTT
+GCCGGGTTTTGACAATACGCCCAAAGTGACTGATGCGCCGTCAACCGTGTTACCGACAGA
+GAAACCAACGCTCTTCACAAAACTGACTTCTGAGCAACTCACAACAGCACAGCCTGATGA
+CGCCCCCGGCACACCAGCTCAGCCATTAACACCGCTGGTAGCAGAAGCCCAGAGTAAAGC
+GGAAGTCATCAGCACACCTTCACCGGTGACCGCTGCCGCCAGCCCGCTAATCACTCCACA
+CCAGACACAGCCACTGCCCACCGTCGCCGCACCTGTTTTGAGTGCACCGCTGGGTTCTCA
+CGAATGGCAACAATCATTAAGCCAGCATATTTCGCTGTTCACCCGCCAGGGGCAACAAAG
+TGCAGAGTTGCGTCTGCACCCGCAGGATTTAGGTGAAGTGCAAATCTCCCTCAAAGTGGA
+TGATAACCAGGCGCAAATCCAGATGGTTTCACCGCATCAGCATGTACGCGCCGCCCTGGA
+AGCAGCGCTGCCGGTACTGCGCACGCAGCTGGCCGAAAGTGGCATTCAGTTAGGGCAAAG
+CAACATCAGTGGCGAAAGCTTTAGTGGTCAGCAGCAGGCCGCTTCCCAGCAACAGCAAAG
+CCAACGCACAGCAAACCATGAACCTCTGGCGGGGGAAGACGACGATACGCTTCCGGTTCC
+CGTCTCTTTACAAGGGCGTGTAACAGGCAACAGCGGCGTTGATATTTTCGCCTAACGTCA
+GAGGTAGCACCGTAATCCGCGTCTTTTCCCCGCTTTGTTGCGCTCAAGACGCAGGATAAT
+TAGCCGATAAGCAGTAGCGACACAGGAAGACCGCAACACATGACTGATTACGCGATAAGC
+AAGAAAAGCAAGCGATCGCTTTGGATCCCGATTCTGGTATTCATTACCCTCGCGGCCTGT
+GCCAGCGCAGGTTACAGCTACTGGCATTCGCATCAGGTTGCCGCTGACGACAAAGCGCAG
+CAACGCGTCGTGCCCTCACCGGTCTTCTACGCGCTGGATACCTTCACGGTCAATTTGGGC
+GATGCGGATCGCGTACTTTATATCGGCATAACCCTGCGCCTGAAAGATGAAGCTACCCGC
+TCGCGGCTGAGTGAGTATTTGCCGGAAGTCCGTAGTCGCTTGCTGTTACTGTTTTCGCGT
+CAGGATGCTGCCGTACTGGCGACAGAAGAAGGCAAGAAAAACCTGATTGCCGAGATTAAA
+ACCACACTTTCCACCCCGCTTGTTGCCGGGCAACCGAAACAGGATGTCACCGACGTGCTG
+TATACCGCTTTTATTCTGCGATAACGACATGGGCGATAGTATTCTTTCTCAAGCTGAAAT
+TGATGCGCTGTTGAATGGTGACAGCGAAGTCAAAGACGAACCGACAGCCAGTGTTAGCGG
+CGAAAGTGACATTCGTCCGTACGATCCGAATACCCAACGACGGGTTGTGCGCGAACGTTT
+GCAGGCGCTGGAAATCATTAATGAGCGCTTTGCCCGCCATTTTCGTATGGGGCTGTTCAA
+CCTGCTGCGTCGTAGCCCGGATATAACCGTCGGGGCCATCCGCATTCAGCCGTACCATGA
+ATTTGCCCGCAACCTGCCGGTGCCGACCAACCTGAACCTTATCCATCTGAAACCGCTGCG
+CGGCACTGGGCTGGTGGTGTTCTCACCGAGTCTGGTGTTTATCGCCGTGGATAACCTGTT
+TGGCGGCGATGGACGCTTCCCGACCAAAGTGGAAGGTCGCGAGTTTACCCATACCGAACA
+GCGCGTCATCAACCGCATGTTGAAACTGGCGCTTGAAGGCTATAGCGACGCCTGGAAGGC
+GATTAATCCGCTGGAAGTTGAGTACGTGCGTTCGGAAATGCAGGTGAAATTTACCAATAT
+CACCACCTCGCCGAACGACATTGTGGTTAACACGCCGTTCCATGTGGAGATTGGCAACCT
+GACCGGCGAATTTAATATCTGCCTGCCATTCAGCATGATCGAGCCGCTACGGGAATTGTT
+GGTTAACCCGCCGCTGGAAAACTCGCGTAATGAAGATCAGAACTGGCGCGATAACCTGGT
+GCGCCAGGTGCAGCATTCACAGCTGGAGCTGGTCGCCAACTTTGCCGATATCTCGCTACG
+CCTGTCGCAGATTTTAAAACTGAACCCCGGCGACGTCCTGCCGATAGAAAAACCCGATCG
+CATCATCGCCCATGTTGACGGCGTCCCGGTGCTGACCAGTCAGTATGGCACCCTCAACGG
+TCAGTATGCGTTACGGATAGAACATTTGATTAACCCGATTTTAAATTCTCTGAACGAGGA
+ACAGCCCAAATGAGTGACATGAATAATCCGGCCGATGACAACAACGGCGCAATGGACGAT
+CTGTGGGCTGAAGCGTTGAGCGAACAAAAATCAACCAGCAGCAAAAGCGCTGCCGAGACG
+GTGTTCCAGCAATTTGGCGGTGGTGATGTCAGCGGAACGTTGCAGGATATCGACCTGATT
+ATGGATATTCCGGTCAAGCTGACCGTCGAGCTGGGCCGTACGCGGATGACCATCAAAGAG
+CTGTTGCGTCTGACGCAAGGGTCCGTCGTGGCGCTGGACGGTCTGGCGGGCGAACCACTG
+GATATTCTGATCAACGGTTATTTAATCGCCCAGGGCGAAGTGGTGGTCGTTGCCGATAAA
+TATGGCGTGCGGATCACCGATATCATTACTCCGTCTGAGCGAATGCGCCGCCTGAGCCGT
+TAGTGATGAATAACCACGCTACTGTGCAATCTTCCGCGCCGGTTTCTGCTGCGCCACTGC
+TGCAGGTGAGCGGCGCACTCATCGCCATTATTGCCCTGATCCTCGCTGCTGCCTGGCTGG
+TAAAACGGTTGGGATTTGCCCCTAAACGCACTGGCGTTAACGGTCTGAAAATTAGCGCCA
+GTGCTTCACTGGGCGCGCGTGAAAGGGTTGTGGTGGTCGATGTGGAAGATGCACGGCTGG
+TGCTCGGCGTTACCGCAGGTCAAATCAATCTGCTGCATAAACTTCCCCCTTCTGCACCAA
+CGGAAGAGATACCGCAGACCGATTTTCAGTCGGTCATGAAAAATTTGCTTAAGCGTAGCG
+GGAGATCCTGATGCGTCGTTTATTGTCTGTCGCACCTGTCCTTCTCTGGCTGATTACGCC
+CCTCGCCTTCGCGCAACTGCCGGGTATCACCAGCCAGCCGCTGCCTGGCGGTGGACAAAG
+CTGGTCGCTCCCGGTGCAGACGCTGGTGTTCATCACCTCGTTGACGTTTATTCCGGCAAT
+TTTACTGATGATGACCAGTTTCACCCGCATCATCATTGTTTTTGGTTTATTGCGTAACGC
+GCTGGGAACACCCTCCGCGCCACCTAACCAGGTATTGCTGGGGCTGGCACTGTTTTTGAC
+CTTTTTTATTATGTCACCGGTGATCGACAAAATTTATGTAGATGCGTACCAGCCATTCAG
+CGAAGAGAAAATATCAATGCAGGAGGCGCTGGAAAAAGGGGCGCAGCCGCTGCGTGAGTT
+TATGCTGCGTCAGACCCGTGAGGCAGATTTAGGGTTGTTTGCCAGACTGGCGAATACCGG
+CCCGTTGCAGGGACCTGAAGCCGTGCCGATGCGCATTTTGCTCCCGGCCTACGTGACCAG
+CGAGTTGAAAACCGCATTTCAGATAGGCTTCACGATTTTCATCCCTTTTTTGATTATCGA
+CCTGGTGATAGCCAGCGTGTTGATGGCATTGGGGATGATGATGGTTCCCCCAGCCACCAT
+TGCTCTGCCCTTTAAACTGATGCTGTTTGTACTGGTGGATGGCTGGCAATTGCTGGTCGG
+TTCGCTGGCGCAGAGCTTTTACAGCTAGAGAGGCAAAATGACACCTGAATCGGTCATGAT
+GATGGGGACTGAAGCGATGAAAGTCGCGCTGGCACTGGCTGCCCCGCTATTGTTGGTAGC
+GTTGGTCACGGGCCTTATCATCAGTATTTTGCAGGCCGCCACGCAGATTAACGAAATGAC
+GCTGTCGTTTATTCCGAAAATCATCGCCGTATTTATCGCCATTATTATTGCCGGACCGTG
+GATGCTCAATCTGTTGCTGGATTACGTCCGCACCTTGTTCACTAACCTGCCGTATATCAT
+CGGGTAGCCGTACTATGTTGCAGGTGACAAGCGAACAATGGCTATCCTGGTTAAACCTGT
+ACTTCTGGCCGTTACTGCGCGTGCTGGCGCTGATCTCCACCGCGCCGATTCTGAGCGAAC
+GCAGCGTACCGAAACGGGTAAAACTGGGTCTGGCAATGATGATCACGTTCGCCATTGCCC
+CATCATTACCTGCCAACGATGTTCCTGTTTTTTCGTTCTTTGCTCTGTGGCTGGCCGTGC
+AGCAGATCCTGATCGGCATTGCGCTTGGTTTTACCATGCAATTTGCCTTTGCCGCTGTGC
+GAACCGCTGGCGAAATTATCGGTCTGCAAATGGGGCTGTCATTTGCGACGTTTGTCGATC
+CGGCCAGCCATCTTAATATGCCCGTTTTAGCGCGTATCATGGATATGCTGGCGTTACTGC
+TGTTCCTGACATTTAACGGTCATTTATGGTTGATTTCACTGCTGGTCGATACCTTTCACA
+CCCTGCCGATTGGTGGCGAACCGTTGAACAGCAATGCGTTTCTGGCACTCACCAAAGCAG
+GGAGTTTGATTTTCCTTAACGGGCTGATGCTGGCGTTACCGCTCATTACTCTGCTGCTGA
+CACTGAATCTGGCATTAGGTTTACTTAATCGTATGGCCCCGCAATTATCCATTTTTGTTA
+TTGGATTTCCATTAACTCTGACTGTCGGCATCTCTTTAATGGCGGCATTAATGCCGTTAA
+TTGCACCTTTTTGCGAACATTTATTCAGTGAAATTTTTAATTTGCTGGCTGATATTATTA
+GTGAATTGCCATTAATATAATTCCGTAACGTTTATCATGTTATCCTAAGGATTATCCGAA
+AAATAATACCTACGAACATCTTCCAGGATACTCCTGCAGCGAAATATTTGTTTTAAGCTC
+ACTCACATATCGCAACATTTACTTTACTTTAAGACAATTCCAGGCAAATTATACAACACT
+TTACGGGATAGTAAGTCCGCCTGAAAAATCGCGAGAGTGGCGCATTAGGTGACCCATGTT
+GTTCCGTTTAGTCATGATGAAATATTCAGGTAAGGGGAATTATCGTTACGCATTGAGTGA
+GGGTATGCCATGTCAACGATTATTATGGATTTATGTAGTTACACCCGACTAGGTTTAACC
+GGGTATCTGTTGAGTAGAGGGGTTAAAAAAAGAGAAATCAACGACATTGAAACCGTTGAT
+GACCTTGCCATAGCTTGTGATTCACAGCGCCCTTCAGTGGTGTTTATTAATGAGGACTGT
+TTCATCCACGATGCTTCTAACAGTCAGCGTATCAAGCTCATCATTAATCAACATCCCAAT
+ACGTTATTTATCGTTTTTATGGCAATTGCCAATGTTCATTTTGATGAATATCTATTGGTC
+AGAAAAAATTTATTGATCAGTTCTAAATCGATTAAACCGGAATCTCTCGACGATATCCTT
+GGCGATATTCTGAAAAAAGAGACAACGATAACCTCGTTTTTAAATATGCCGACGTTATCA
+TTGAGCCGAACCGAATCGAGTATGTTGCGAATGTGGATGGCAGGTCAGGGAACCATTCAA
+ATCTCTGACCAAATGAATATCAAAGCCAAGACCGTTTCATCGCATAAAGGTAATATTAAA
+CGTAAGATCAAAACGCATAATAAACAGGTTATCTACCATGTCGTCCGACTGACGGATAAT
+GTGACTAATGGTATTTTTGTCAACATGCGCTAACACATTCTGACTGGTGGTTTCCCACCA
+GTCAGGCTGAATAAGATTACTCTGCTTTCTCCACAAAGATACCGTCCTGATGCCCTGCTT
+CATTAAAGAACCAGATGCCGAGCGGGTAGTCTTCCAGCGAAACCAGGTACATTGTGCCTT
+CACTAAACTCCTCAACTGCCAGTACCACGCCAGGACGACGCGGACCGCCATCCGTTTTGA
+CTGTTACCCGATCATTCACCTTCATCGTTTTCCTCCTGTGGCTTTGTGCCAGTGTAGAAC
+AATTTCGTTTTTCTGGCAGCGCCAGGCGCGCGCGAGTGCTGATTTTCTCGACGGTCTATA
+CTTAAGAGATGCCAGGCGGACTTAACGACTGGCGGCAACAACAGAGTAACGGTTGCGAGG
+AAAGATGATGAAAACCGCAAAAGAGTACAGCGATACCGCAAAACGTGAGGTCAGCGTCGA
+TGTCGATGCCCTGCTGGCGGCGATCAATGAAATTAGCGAAAGCGAAGTTCATCGCAGCCA
+GAACGATTCTGAACACGTTAGCGTCGATGGACGTGAATATCATACATGGCGTGAATTGGC
+GGATGCCTTCGAACTGGATATTCATGACTTCAGCGTCTCTGAAGTGAATCGTTGAATGCA
+CAATAAAAAAATCCCGACCCTGAGGGGGTCGGGATGAAACTTGCTTAAGCAAGAAGCACT
+TAAAAAATTCGTTACACCAGGAAATCTGATGTGTTCATCACCTTATCCGCAATTTTTTTC
+GCTGACAAGAAAATATTCGCCATATGAATGATTAACGCTACTTATGAATAGAAATGTGAC
+GCACGTCACCCCTTGGTGGCTCTGGCGTCAGCGGGATCGCTCCCGAAAAAATCATCTTTG
+ATAATTTGTGCGGTTTTGAGAATCATCCTGGTAAGAGGAGTACTGCGCGACTATGTTTTC
+AATTCAACAACCACTACTGGTTTTTAGCGATCTTGATGGCACCCTGCTGGACAGTCATAG
+TTATGACTGGCAACCGGCAGCCCCCTGGCTCACCCGTTTACGCGAAGCAAATGTTCCCGT
+CATTCTCTGTAGCAGTAAAACATCAGCGGAAATGCTGTACTTGCAAAAAACGTTGGGGCT
+ACAAGGTTTACCGCTGATTGCCGAAAATGGCGCAGTGATCCAGCTTGCTGAGCAATGGCA
+GGAGATAGACGGTTTTCCACGCATCATCTCAGGTATTAGCCATGGCGAAATCAGCCTGGT
+TTTAAATACGCTACGCGAGAAAGAACATTTTAAATTCACGACTTTTGATGATGTCGACGA
+TGCAACCATCGCCGAATGGACGGGATTAAGCCGTAGCCAGGCGGCGCTGACGCAGCTTCA
+TGAGGCGTCGGTAACGCTAATCTGGCGCGACAGTGACGAGCGTATGGCACAATTTACCGC
+TCGTCTGAACGAACTGGGCTTACAGTTTATGCAGGGTGCGCGCTTCTGGCACGTACTGGA
+TGCTTCTGCCGGAAAAGATCAGGCTGCCAACTGGATTATCGCGACCTATCAACAATTGTC
+AGGCAAACGCCCAACCACACTTGGCCTGGGCGATGGGCCAAACGATGCGCCCTTACTGGA
+GGTAATGGATTACGCGGTGATTGTGAAAGGGCTAAATCGTGAAGGGGTGCATCTGCATGA
+TGAGGATCCGGCCCGCGTCTGGCGAACGCAGCGTGAAGGACCGGAAGGATGGCGTGAAGG
+GCTGGACCATTTTTTCTCCGCCCGTTAAGCGTTATCGCTCGCGAATACCCGATTACGCCC
+AGCCTGTTTAGCGAGATAAAGCCGACGGTCGGCCAGTGACTGGAGTTGTTCAAAATCATA
+ATCACCGGTTTCCTCGCTGCTGCTTACCCCCAGCGAGGCACTGATGCGTATCGTCGTACT
+CTTGGCGATCAACATCTCTTTTTCATTTAATTTCAGTCGAATACGTTCTGCGACCTCCGC
+AGCCTCCGTCAGACTCGCGCCTGGCAGAATCACACAAAACTCCTCACCACCGACCCGCCC
+GGCAACGTCCTGCGCACGCAAGGAACTGCTAATTAATCCGGCAGCATGAGAAAGAACACG
+GTCGCCCGCCTGATGACCAAAGCGGTCATTAATCGCTTTAAAATGGTCAAGATCGACCTG
+AATGACAGAAAAAGGATGTTGGTGCGTCTGACACAATTTAGCGAGCGGACGGGCTTTTTC
+GAACAGTGCGCCACGGTTATATAAACGCGTTAAGGTGTCGTGCCACGCCTGCCACTGCAA
+CGAGCTTTGCAGAACATACATGTTGCTAACCATCCGGCGAATCACATACCAGGAGATGAG
+TAACATGGTGGTAAAGAGCGCCCACAGCAGGGTTAATGCAATGCTGATACTGCCGAAATC
+GCCGCGCACGCCTTCGCTTAACGTATGGACACGCACCAGCACACCGTCGAAATGGTCCAG
+ACGTTCCCAGCTAACATAGCGACTGTCCATACGAATGCCGCCCCGCGTGTCATGTTCCAT
+TGCCTGCGCCAGCAAGGCCAGTTCACGAGGATCAAAAATATTCCCTGTTGGATGGTCAGG
+ATTGGAAGAGGTCAAAAATCTCAGCTTACTGTCATAGAGCTGATACTCACCATCGAGGTT
+TTTATCGATGGCGTTTCTTAAAAATTGCTGCATAGTACGCACGGGAATACTCATCCCCAG
+CACGCCATACCAGTAGTTATTACTGTCTACCGGAACACTGACGGTAACCTGCGGTTCAGT
+ATTGCTGGCGTGTTCCGGTTGCGAAGTGAACCAGCGTACCGCGCGGTGACGATTTTCTCG
+TTGTGAATGGCCAATAAACCAGGGTTGGGTGACATAGCCGTAATAACGCGTTGGAACATT
+GCGCGTAAACAAGGTCGGCTGCGTCGAAACGTAAAATCCGGCACGCGAGACATACATCGC
+CTGTTCAACCATCGACGAGGAGTTGTGCGCTAGTCGCAGCAAGTAACCAACTTCCAGTGC
+AGCGGTAATTTCATTGTCGAGGCTTTCATTTTCGCGAGACAGGAGATTCCCCTCGCTGAC
+TAATGCATCCGACACACCATTAACTGGCAGAGTGCGTCGTCGGTTGAGTTCGATTTTCCA
+GGCGTGCTCGTCGCGATGCTGTTCGAACTCGGTTACAGCATCACGCAGAGAGGTGAAATC
+CAGTGGCGCTACGAGAGCTTCGCGCATGCCATTACGTAAAAAGATCAGTTTGTCGACGTT
+ATACTGCAAATGCTTATCGAGCGCGTTGGCAACGTTTTCCAGATGATTACGCTGGCTGGA
+GATATAGGCATCTTCCAGCACCACCACTTCACGCCAGGTGAGCAAGGTGGAAAAAAGCAA
+TACCACGATAAAGCAGAGATTAACGACATGACCAGGCCCCAGGCGGCGTGCGAGTTTTTT
+CAACCAGCTCTGGTTTTCCATTTTTGTCTCGTGCTGCACCCTGACGACTCCCAACCTGCT
+TTTTTATGATTCTGGCATAACCTGGCGATAGCGTACCGCAAAACAGCGATAATTTTATAA
+TGGTGGCATGATAAGACGCGACTATCATTCATTGCAGGCATTAGCACACCAGGCCGGATG
+TGATCCGGCCTGATGTTAATGATACCCTTTCACACTTCTTCCGCAGAACGACTCCCCTCC
+CCCGGAACAAGCTCGGTTTCATGAAAAGCTTCCCGCTTGACCCCGTAACCGTCATACCAA
+CGACACTCAACCATACCGCTGGAGTATCCAGTGACAATCATCCGCGGGCCGCCCTCTTTA
+ACCGTAACTTCCTCACTAACCATAAAGCTCATACTCGCCTCCTTTTTTCGAGTGAAACTT
+GTTCACCTTAGTTGAAGATGGCGAATTTTGCATAATAGCCAGTGCGAGTATTAATGTGCC
+TGACCGCGCATTTTCTCTACGGCTTTCACTCCCAGCACCACGATGCCGCCGATGATAAAT
+CCAAGAATCAGATTTAAAACAGTCGGTAATATCATCGCCACTACTGCACTTTGCTGCCCG
+GCGAAATGTTCAATGGCGTGATGCAGCGGCGCAATTCCATGTACCACAATCCCACCGCCG
+ACGAGGAACATCGCCAGCGTGCCGACAATCGATAACGCTTTCATCAGCCAGGGCGCGATA
+ATCAATAACCCTTTACCTAATGCCTGCATCAGCGCGCTGGATTTTTCCGCCAGCCAATAC
+CCCAGGTCATCAATCTTAACGATAACCCCTACCAGACCGTAGACGCCCACGGTCACTACC
+AGCGCGATGCCTGAAAGCACCAGCACCTGATTAAGCAACGGCGCTTCGGCCACAATCCCC
+AGCGTGATGGCGACGATTTCCGCAGACAATATAAAATCGGTACGAATCGCCCCTTTTATT
+TTGTCCTTTTCAAACTTCAGCGGATCCTGCGCCGCCAGCTTCTCCAGACGCTGCTGGCTC
+TGCGCCGGATCTTCTTTATGTTTACGCGCCTCCAGCATATGCAGCACTTTCTCTACTCCT
+TCAAAGCAGAGAAACGCGCCACCAATCATCAACAGAGGCGTAATCGCCCACGGGATAAAC
+GCACTGATGATCAGCGCCAGCGGCACCAGAATCACTTTATTAATCAGCGATCCTTTCGCC
+ACGCCCCAGACCACGGGAAGTTCCCGGTTGGCCCGCACGCCTGAAACTTGTTGCGCATTG
+AGCGATAAGTCATCCCCTAATACACCGGCGGTTTTCTTCGCCGCCAGTTTGCCCATCACG
+GAGATATCGTCCAGTAGTGTGGCGATATCATCGAGCAACGTCAGTAAACTACTCCCGGCC
+AAAAGCATTCCCTCTCATTTTTATTGTTGAAGGGTGTAAGTATGAAGCAAAAACGGCAGC
+TCTGATACTTGCTTCACAGGTCAACATTTTTTTAACAATCAAGTGCAATTATATCTCTCG
+CCAGCAGAATGATTTTCACGTTTACTATGAACCACCTTTTTATTTCCACCGTGAGGGATT
+ATGCGTTTCCGCCAGTTGTTACCGCTTTTTGGCGCGCTGTTTGCGTTGTATATCATTTGG
+GGCTCAACCTATTTTGTCATTCGGATTGGCGTGGAAAGCTGGCCTCCGTTAATGATGGCG
+GGCGTTCGATTCCTGGCAGCCGGTATTTTATTGCTGGCATTTTTGCTACTGCGCGGACAC
+AAACTCCCCCCGCTACGTCCGCTGCTCAATGCCGCGCTGATTGGCCTGTTATTGCTGGCT
+GTCGGTAATGGCATGGTGACGGTTGCCGAACATCAAAATGTTCCTTCCGGCATCGCCGCC
+GTAGTGGTTGCAACCGTGCCCCTCTTTACCCTGTGCTTCAGCCGCCTGTTTGGCATTAAA
+ACGCGCAAACTGGAATGGGTGGGTATTGCCATTGGGCTTGCCGGAATCATCATGCTCAAT
+AGCGGTGGAAATTTAAGCGGCAATCCGTGGGGCGCGATTCTGATTTTAATCGGCTCGATT
+AGCTGGGCGTTTGGCTCAGTTTATGGCTCGCGCATTACCTTACCTGTAGGGATGATGGCG
+GGTGCGATTGAGATGCTGGCGGCAGGCGTGGTGTTAATGATCGCGTCGATGATTGCGGGT
+GAAAAACTGACGGCGCTCCCTTCCCTTTCAGGCTTCCTTGCGGTCGGCTATCTGGCGCTG
+TTTGGTTCGATTATCGCCATCAACGCTTATATGTATTTAATCCGTAATGTCAGTCCGGCT
+CTCGCCACCAGCTACGCTTACGTTAACCCGGTGGTCGCGGTCTTGCTGGGTACGGGACTG
+GGTGGAGAAACACTGTCGAAGATTGAATGGCTGGCGCTCGGCGTAATTGTCTTCGCGGTG
+GTACTGGTCACGTTGGGAAAATATCTCTTCCCGGCAAAACCCGTAGTTGCGCCAGTTATT
+CAGGACGCATCAAGCGAGTAAATGAATCCCCTGCGTGTCGATCTGCGCGCTGGCACCTTC
+GCCGCAGATCCACTCTTCCAGACGCTCGGTAAGCGCTTCATCCGTCAGCTTCTCGCGCCC
+ACGTAACGCGCACTCCCAGACAATCAATACGCGCCAGCCGAGTTCCTGCAAGCGACTGAT
+ATCGCGGCGATCGCGCTCAACATTTTTACCTATCTTCTCCAGCCAGAACTCGGTTCGAGT
+CGCAGGCACTTTAAACAGATAGCAGTGATGATGATGCCAGAAGCAGCCATGGGTAAATAT
+CACGCAGCGATATTCATCAACGACAAAATCCGGACGTCCGGGCAGACTGGCGTCCTGAAC
+GCGAAATGCCAGGCCCTGCCCGGTTAACAGACTGGCGAGGCGCTTCTCTATCGCCGTATC
+ACGCGTGGCAATCGCGCGCATATTTTTGCTGCGAGTGGCCTTATCGTGAACGTCGGCCAT
+GTTGTGCCTCTTGCTGACGCAACGCCACCGCCTGTTTGATTTTTGGCTCAAGCAGTTTTG
+CCACCGCGGCAAAGACCGGCACGACCACCGAGTTACCGAACTGGCGATAGGCCTGAGTGT
+CCGAAACCGGAATACGGAATTTCGCTTCTCCCGGCGCTTCAAAACCCATTAAGCGCGCGC
+ATTCCCGAGGCGTTAACCGACGTGGACGATGTTGCTGATTCAGCGGATCGTCAAAGTCTT
+TCTCACCCGTGGCCATATCCCAGCCGCGATCGATTAAAATTTCCGCGCCATCTTTGTAAT
+AACGCGCAGACAGCGTACGCGTGACGCTTTGCGGATTGTTCGGATAAACCATTCCATAAC
+CGAAGCCGTTACCGCGCGCCTGATGTTTTTTCGCATATCGATAGAGGTACTTCCACAGCA
+CCGGCGTCAGGATATATTTCGCCTCGACCATCGGGTCCAACAGCTGCGCCAGCGTCACTC
+GCTGCGCAGGGAAACATTCGCTGATATCACGCAGGGTAAAATCGGCTTTCAGATTCAGAT
+CGCGACGAAAACCCACCAGCACGATGCGTTCACGGTGCTGCGGCAGAAAATGTTTGCCGT
+CGATGATTTTCGGATCGTCTGGCCCATTATCTTCTGCATCAGCCACGTCATAGCCCAGTT
+CGTCCAGCGTCTGCATGATGATGCGGAACGTTTTACCCTGGTCGTGACTTTTCAGGTTTT
+TGACGTTTTCGAGCACAAACATCGCCGGACGACGCGCGTCGATAATGCGTACCACATCAA
+AAAACAGCGTGCCCTGGGTATCGCAGGCAAAACCGTGCGCCCGCCCGAGCGAGTTCTTTT
+TCGATACGCCAGCCAGCGAAAATGGCTGACAAGGGAAACCGGCCAGTAAAACATCGTGTT
+CAGGAATGTGTTGACGAATATGTTCCGCCGCCGCCTCATCACTCACGCCTTCTTTATGGC
+TGAGGGTGATGTCGCGGATATCTTCATTAAAATGATGCGTCGCCGGATCGCAATAATGGT
+TGGCTTTATAAGTGCGTACCGCATGTTTGTTCCATTCGCTGGTAAACACGCACTGTCCGC
+CAATCGATTCAAAACCGCGACGGATGCCGCCAATTCCGGCGAATAGATCGATAAAGCGAA
+ACGCATAATGCGGATGATGTGCCGGTGGTTTGGGTAATAACGTTTGCAGATGGGCGAACT
+CTTTCTCACTTAAACGGTGCCATGCCGAGTCATTCGCCAGCGCACGTTTTAAAATTGCCG
+CGCTCCAGTGATTCTCACCTACACCATTAAGCTGCGCCACCAACGTTTTAACATCATAAA
+TTTGCAGCAGTTTCTCCAGCATTGCCTGTGCGGCATTCCCGGTGCTGTATGAATCGGTTA
+CTGATATATTTTCCTGCATAGATTTCACCGGCCATCTGAGATGGCCGACAGGTTAACATA
+ATTACAGCCATTTAGGGCCACGCGCTCAGCCAGCGGATGAAAACGCATCTATCACCTTGT
+GATCGACACCTTCATTCTCCCCCGCCAGTTCGGCACTGAGCTTCGCCATAAACTCGACTA
+AAAAATGCGCGTTGTGCTGCGCCAGCTGCTTGCCTCTTGCGGTTTGCATGGTTTGCGGTA
+GCTTCAGCAACTTAGTCTGGAAATGATCCAGCGCGTAGCGTTTATCATCAAGCGGGCGAT
+GCTGTGCGAACGGATCTTCACCATCAAACAGCGCCACGCCCAATGCCCCTGAAACGGCAA
+ACACGCGCGCCAGGCCAATCGCCCCCAGGGCTTCCAGCCGATCCGCATCCTGGACAATTT
+TAGCTTCCGTTGTTAAGGGGGCGATTTGCGCGCTGAAACTGTGAGCGGCAATGGCATGAC
+AAACGGCCTCGATTTTCTCCGCCGGAAATTGCTCGAACTCTTCACGGAGCAGGCGACGCG
+TCTCTTCTGCCGCCAGGATTGAAGAACGCTGCCTTTGCGGATGATTTTTCGCCAGGCTCA
+CAATATCGTGAAAATAACAGGCGGTTAAAATCACCAGCATATCGACATCGTCATCTGCCG
+CCAGCTTCTGTGCCGTAGCCCAGACGCGGCGAAAATGACACACGTCATGGGCCGCGTCCT
+GGTGCTGATGATGGTTTTTCAACCAGTTTTCGAACTGTGCCTGCCAGTGTTGTAAGTCCA
+TACGCGCTCCGTTGCCAAAGAGTCGCCACCTTAGCAGTTTTTATTCATAGCGTCTGCTAC
+GTGCGGGACGAGGTCGGGTGTACCAGGCAATGCTGCCTAACAATGCCCCGACCAGAGCCA
+TAAATAAAAATCCGACCAGTGCCCCTAACCACTTTCCCGCGGTAGAGCCTAAATCGCTTT
+CAAATCCCGACACGGGGGCATCGGGAATCCGGCTCATCACCCAGATGTAACGCGCCATTG
+CCCAGACGAAATAGCCACACCATGTATAGAAAGCCCACAAAGCCAGTTTGCCGCCAGGGC
+TGCGAGAGAGTCTCTCTTCCATCTTTGTCGAACCGTATTCCATTTTGAGATAACCCGGAA
+AATTCAGACTTAGTACTATTATGTGATAAAAGTCACATTTTTCCACATTGGATGAGCCAG
+TCAAGACTCAATCATTTTTTGAACAAATAGATAAATTTTGCGCAACGGCAGTGAATACAG
+GAAAAATCGTTTTGAGCGATTTTATTTATCTTTGATATCGGCTTTATTAATTCATTTAAT
+CAATATATTAGCACTGATTACAATTATACCTTTTTATTATTCTGTGTCATGATGCTTCCG
+TTATTAGCCTTTTATCGTCTTGTTTATATTTTTTGGGCCGGCATGATGCCGGCTTTTTTT
+TATGCCTTCATTAATGTGCGCCTGATCACACCAGCCGTTTGGCGCAACAATCATTGATAC
+CCCCTATGTTTCCGCTCAACTCATAACATATTGATATACATTTATAATTTTCATGAATAT
+TTATATTTAGAATTCATAATTATGAATTATATTAAATAGATTAGAAACATTTTGATATCT
+TTTAAATACATTTGTTACATGTAATCCTTAAAATAAAATGAACTTCATAGAATAGTATCC
+AAATGTGCTTTTTTTTGGATAACGGCACTTATTGATATATTCATGAAGATTATAATCACA
+AGGGAATACATAATGAAAAGAAAAGTTCTGGCAATGCTGGTCCCGGCGTTATTAGTTGCT
+GGCGCAGCAAATGCGGCTGAAGTCTATAATAAAGATGGTAATAAACTGGATTTGTACGGA
+AAAGTAGTGGGTCTGCACTACTTCTCTGATGATTCTGGCAGCGATGGCGACATGTCATAT
+GCCCGTATCGGTTTCAAAGGTGAAACTCAGATCGCTGATCAATTCACTGGTTATGGTCAG
+TGGGAATTTAACATTGGCGCAAACGGTCCTGAAAGCGACAAGGGTAATACCGCAACGCGT
+CTGGCATTTGCAGGTTTAGGCTTTGGTCAGAATGGTACTTTCGACTATGGTCGTAACTAC
+GGTGTCGTATATGACGTAGAAGCATGGACCGATATGCTGCCAGAATTTGGTGGCGATACC
+TATGCTGGCGCTGACAACTTCATGAACGGTCGTGCTAATGGTGTTGCAACCTACCGTAAC
+AATGGCTTCTTTGGTTAGGTCGATGGCTTGAACTTTGCTTTGCAATATCAGGGTAATAAT
+GAAAGTGGTGGACCATTCGGGCAGGAAGGTTCCGGTAGTGGTGATGGCCGTAGCCTTTCC
+AAAGAAAATGGTGATGGTTTCGGTATGTCAACATCCTACGACTTCGACTTCGGTTTAAGT
+CTGGGTGCTGCATATCAAACTCTGATCGTTCAGATCGTCAGGTTGGAGTTGGTTTAAATG
+ATCGTAACCATAGCAACAGAAATGCTGGTGGTGAAACCGCTGAAGCATGGACTGTTGGTG
+CAAAATATGATGCTAATAATGTGTATTTAGCAGCTATGTACGCTGAAACTCGCAATATGA
+CCCCATATGGTGGTGGCGAGTTTGATAATGGTGAATCAAGATCAGCCATCGCTAACAAAA
+CCCAAAACTTTGAAGTTGTTGCTCAGTATCAGTTCGACTTTGGCCTGCGCCCGTCCATCG
+CTTACCTGCAATCTAAAGGTAAGGATTTAGGCGGTTGGGCTCATGACGGCAACGGCGACC
+CACGTTACACCAATAAAGATCTGGTTAAATACGTTGATATTGGTGCGACCTACTACTTCA
+ACAAAAACATGTCCACCTATGTTGATTACAAAATCAACCTGCTGGACAACGACGATGACT
+TCTACGAAGCAAACGGCATCGCTACCGATGATATCGTTGCTGTGGGCTTAGTCTACCAGT
+TCTAATCAGTCAACTCGCTGCGGCGTGTTACTGTAAAACTGAACACTAGCCTGAGTTCGT
+CCCTCATCGAACTCAGGCTTTTTTATTGGCATTTCATCTCCATCTGCGGCACACGCAATT
+GCCGAAGCATATCGATACAGCACCTTACCCTGCCCCTCCTGGCACAATAACATCAACCAG
+CTACTCTTCAAGCTAACACCCAAATGCATTTCTTTATGAATTAATCCGTAACAAACACGC
+TTCCCATATAGAAATATTTGCAAAAATAGTGCATGAAATAAGCTTTTTCTCTACCAATCC
+GGGATATAAATATTCATCAGCACCACAATATTCCACAGCACTAAATCTCTCCCCGCCACC
+CCGTACCTCTGATAATGGTCTAAAATCATTGAAGCCACTTGCGACGACGTTGCTCAATAA
+GGAAAATTTGGCGTGAATAATATTCAACACCAGTGCAGCATCATCATTACATACTTACAG
+CCGCCGACTACCGCTTTCGATATATTGACTCAATTTTCCAGCCTGGTTAAAAATAGCGAC
+CAGCTCAGTCGCAAATATAGTGACTACCCTAACTAAGCAACAATAAGGAATACACTATGA
+CTGTTCAAACAAGTAAAAATCCGCAGGTCGATATTGCTGAAGATAATGCATTCTTCCCTT
+CAGAATATTCGCTTAGCCAATATACCAGTCCTGTCTCTGATCTTGATGGCGTGGACTATC
+CAAAACCTTATCGCGGTAAACATAAAATTCTGGTGATCGCCGCGGACGAACGTTATTTGC
+CGACCGATAACGGAAAACTGTTCTCGACCGGTAACCATCCGATTGAAACGTTGCTGCCGT
+TGTATCATCTCCATGCTGCAGGTTTCGAATTCGAAGTGGCGACCATTTCCGGTCTGATGA
+CCAAGTTTGAATACTGGGCTATGCCGCACAAAGATGAAAAAGTAATGCCATTCTTTGAGC
+AGCATAAATCGTTGTTCCGCAATCCGAAGAAACTCGCGGATGTTGTTGCCAGCCTCAACG
+CTGATAGCGAATATGCAGCAATCTTTGTTCCTGGTGGTCATGGCGCACTTATTGGTTTAC
+CTGAAAGCCAGGACGTGGCTGCCGCTTTACAGTGGGCAATCAAAAATGACCGTTTTGTTA
+TCTCCCTTTGCCACGGCCCGGCGGCTTTTCTGGCGCTTCGCCACGGCGATAACCCACTGA
+ATGGTTATTCCATTTGCGCATTCCCAGACGCCGCAGACAAACAAACGCCAGAGATTGGCT
+ATATGCCGGGTCATCTCACCTGGTACTTCGGCGAAGAACTGAAGAAAATGGGCATGAATA
+TCATTAATGACGACATCACCGGGCGAGTACATAAGGACCGTAAACTTCTCACCGGCGACA
+GTCCTTTTGCAGCGAATGCGTTGGGTAAACTGGCGGCGCAGGAAATGCTGGCAGCTTACG
+CGGGTTAATCCCTGTTACGTTTGAATGTAAGCGCATAATCAATCGCGGCCGCGTTAGTAC
+TCACGACGTGGCTGCGTTTTTTCACGGTTAATTTATGGCGTACTGAAGCCCTATGTTAAT
+TTCTTTGCGGTAACGTAATCCGGAACACATTATGCTTATTGAGATAGTGATACGTAGCAC
+TTCCCCCATGCAATTCGGCAATCGCTTTGACTAAAGAAAGGCCTAGTCCCTGACCTACGG
+AATGACGCGAATTATCTCCCCGCCAAAATCTACGGAAGAGTTTTTCAGGCTCATTAATTT
+TCGTTCCAGGGCTGGCGATATCAATATTAAGATAGCTGTTGGTATCAAGAAAACTGGTTA
+TATGAATACGCGATTTTTCTGGCGAATATCTAATGGCATTAACAATAAGATTCGATAACA
+TTCGTTGTAGTAAAATTTTATCCGCAAAGATTTGCTGATTGCACTCGACCTTAAAGCAAA
+TCTCTTTCTCGTCTGAAAGGTATTCAAGATAGTCCAACAAATTTTCGACTTCCTTATTGA
+GAGAAAGCGAGTCCAGTTTCACCAAAACATTGTTTTTATCTGCCCTGGCAAGAAACAGTA
+TGTTCTCTGTTAACCGCGAAATATTTTCCAGCTCTTCAATGTTTCCGGCAATTGTTTTTT
+GATATTCAGCGATACTTCTGGTTTGACTGAGCGTAACCTGATTCTGACCCAGTAATGCAT
+TAATTGGCGTTCTAAGTTCATGAGCGAGATCGTCAGCAAACTGACTTAGACGCTCAAAAT
+CTTTGACTAAAGCATGATGCATTTTATTCAACGCCTGCCCAAGAGGTTTTAGTTCTCTCG
+GTAATGCGCTAACCTCAACAGGCTCTCGGCTATCGTTATAATTCAGCGCTTCCGTTACAC
+CACTCAACTTTTTGATCTCTCGTAATCCCGTTCTGATTAACAGCGGACTTAATACTGAGC
+AAAGTACAATGGCGACAATGCAAATTATAATGCTATTAATTTTATACTGTTCAAGCATGT
+TATGTCTGGCTGAAGCCAATTTAGCCACAGTAACCGTTAATGATGGCGAAACTTCATCAA
+TATTAATTCGTAAAGCATCTATCTCTGTATCATTAATAATGCTTCTGTAAATGCCAGCTG
+CGCTGATTGTCTCACTAGCAGGTATGTTATTTAACATGCCATCACTGACATTTGTCCGGT
+TAACAATTTTATTGATGCTATCACCATGAATAATCAAGATATCCTGACTAACATCCATCA
+TCCGGTTAAAGTACACAGGTAACGTATCTGGATTTACCCCATCAATTAACAACTGCTTGA
+TCTGCGCTGTCCGGTTAATGAGTGTTGTATCATCGCGCCATTTCAACTCACTTGCCAGGC
+CATTATAGAGAGTCCAGACAATTCCGGCGCCAGCAACAGACAGTAGCAATATAAAAAGCA
+AGGTTAAACGGACGGTTATAGATAGTCTTTTCATTATTTTTTTACCGCTACGAATGAATA
+GCCCATCCCCCGGATTGTGGCAATTAGCTTTTCAGGAAAAGGATCATCAACTTTTGCGCG
+GAGCCTGCGAATGGCGACGTCCACCGTATTGGTATCACTATCAAAGTTGATTCCCCAAAT
+TTCACTCGCAATAACCGTTCTGGGTATAATTTCGCCAGCTCTGGAGGCCAGTAGCCAAAG
+TAACTGAAACTCCTTGCGCGTCAGTGTAATACTGATATTGTCCCTGCTCACACTATGACT
+AACAGAGTCCATTCTTAAGCCGCTGATTTCTAATGTTGAATTCAAAGCGTGATGTTGCCT
+TAATTGTGCCCGAACCCTTGCCAGCAACTCAGAAAATGAAAAAGGTTTTACCAGATAATC
+ATTTGCCCCACTGTCCAGCCCTCTGACTCTGTCATCGACAGAATCCCTTGCAGTAAGGCA
+AATAACAGGGGTTTGCTTTGCTGTTCTTAACGTTTGTAAGATCTGCCAGCCATCCATACC
+CGGAAGCATAATATCCAGAATGATCAATGCATAATCATCCTTCAGCGCAAGATAAAGCCC
+ATCTCTGCCATCAGAAACGGCATCGATGACATAACCCGCTTCGGAAAGCCCCTGCGTTAC
+CCATTCCTGGGTCCTTTGATTATCTTCAATAAGTAGAATCTTCATGAAAATAATATGCCA
+TAAATCATATGTTATAGAAACAGCCTGGTTCATTACAAAATTGTAATGCTGCTGTAAGGT
+TACCCTGGACGCTTTTTCGCTATCCTCAAAACTCATTCACATGACAAGGATATAAACATG
+TTAAAGCGTTATTTAGTACTCTCGGTAGCAACGGCAGCATTTTCATTACCTTCTTTGGTT
+AATGCCGCACAACAAAACATTCTTAGCGTGCACATTTTGAACCAGCAAACAGGAAAACCC
+GCTGCTGACGTGACAGTCACTCTTGAAAAGAAGGCGGATAACGGCTGGTTACAACTTAAT
+ACCGCCAAAACAGATAAGGATGGACGAATTAAGGCACTGTGGCCCGAGCAAACTGCAACT
+ACGGGCGATTACCGTGTCGTATTTAAAACCGGGGACTATTTCAAGAAACAAAATCTTGAA
+AGTTTCTTCCCTGAGATCCCCGTTGAATTTCATATTAATAAAGTGAACGAGCATTATCAT
+GTGCCTTTATTACTTAGCCAATATGGGTATTCAACCTATCGTGGCAGTTAATGCATAAAT
+ATGTAAAAGCAGATCTCTGCTACTGTTAGGGAGGACACTCCCTGACAGATTAACAGTAAA
+CGGCTCTTGCTGGCTAACGACAAAAAAGTGTGATGGCTTATGAAAAAGAATCAATTTTTA
+AAAGAATCAGATGTTACGGCCGAGTCGGTATTCTTTATGAAGCGTCGGCAGGTGTTAAAA
+GCACTGGGCATCAGTGCAACTGCACTTTCTTTGCCTCACGCTGCGCATGCCGATCTGCTT
+AGCTGGTTTAAAGGGAACGATCGCCCGCCCGCCCCCGCCGGAAAAGCGCTGGAGTTCAGC
+AAGCCTGCCGCCTGGCAAAATAACCTGCCACTGACGCCAGCAGATAAAGTTTCCGGTTAT
+AATAACTTCTATGAATTCGGGCTGGATAAAGCCGATCCCGCCGCTAATGCTGGTAGCCTG
+AAAACCGATCCATGGACACTGAAAATCAGCGGCGAAGTGGCAAAACCATTGACCCTCGAT
+CATGATGACTTAACCCGTCGCTTCCCGCTGGAAGAGCGTATTTATCGTATGCGCTGCGTG
+GAAGCGTGGTCGATGGTGGTGCCGTGGATTGGTTTTCCGCTGCACAAATTGCTGGCGCTT
+GCCGAACCTACCAGCAATGCGAAGTATGTCGCTTTCGAAACAATTTATGCACCGGAACAG
+ATGCCAGGCCAGCAGGACCGCTTTATCGGCGGTGGGCTGAAATATCCTTATGTCGAAGGA
+TTGCGTCTCGACGAAGCAATGCATCCGCTCACACTGATGACCGTAGGTGTTTATGGCAAG
+GCGTTACCGCCACAAAATGGCGCGCCGGTGCGACTGATTGTGCCGTGGAAATATGGCTTT
+AAAGGGATTAAATCGATAGTCAGTATTAAGCTGACCCGCGAGCGTCCGCCAACCACCTGG
+AATCTGGCAGCGCCTGACGAATACGGTTTTTACGCCAACGTTAATCCGTATGTTGATCAC
+CCGCGCTGGTCACAGGCTACCGAACGATTTATTGGTTCAGGCGGCATCCTCGATGTACAG
+CGCCAGCCAACGCTACTGTTTAATGGTTACGCCGACCAGGTGGCATCGCTGTATCGTGGC
+CTGGATTTGCGGGAGAATTTCTAAATGCGTCTGACAGCAAAACAGGTGACATGGCTGAAA
+GTTTGCCTGCATCTTGCCGGATTGTTGCCGTTTCTCTGGCTGGTCTGGGCGATCAATCAC
+GGTGGACTGGGTGCCGATCCGGTGAAAGATATTCAGCATTTTACTGGTCGCACTGCACTG
+AAATTTTTGCTGGCGACCTTGTTAATCACCCCTCTGGCACGCTACGCAAAACAGCCGTTA
+TTGATACGCACTCGCCGCCTGTTAGGATTATGGTGCTTTGCCTGGGCGACACTGCATTTA
+ACAAGTTACGCATTGCTGGAGCTGGGCGTGAATAATCTGGCGTTATTAGGTAAGGAGTTA
+ATTACCCGGCCTTATTTAACGTTAGGTATTATCAGCTGGGTAATTTTGCTTGCTTTAGCG
+TTCACTTCAACCCAGGCGATGCAGCGAAAACTCGGCAAGCACTGGCAACAGTTGCATAAT
+TTCGTCTATCTTGTCGCGATTCTGGCCCCAATACATTATCTGTGGTCCGTGAAGATTATT
+TCACCGCAGCCGCTCATCTACGCTGGGCTGGCTGTACTGCTTTTAGCCTTACGGTATAAG
+AAGTTGCGTTCCCTTTTTAACCGGTTACGCAAGCAGGTTCACAACAAATTATCTGTATAA
+CTTCATATTGCCGACAAAGTACGCGTTATCCCTGCCGGATGTGGCGCGAGCGCCCTATCC
+GGCATACACAGATCGCATCAGGTTATGTTTCGTTTGTCATCAACCTCAAATCACCAAAAT
+AATTTATTTTATTTCAATAAGATAGATAAGTAGAACTGAGAAAGCCATGCTCTCGTTTCC
+TAAGAGTTGTTGCATTTTGCTATATGTTACAATATAACATTACACATCATATACATTAAC
+TCTGGAGGAAACTGTTTTGGCGATTCGTCTTTACAAACTGGCTGTTGCTTTAGGTGTCTT
+TATTGTTAGCGCTCCTGCCTTTTCGCATGGTCATCACTCACACGGCAAACCCTTAACAGA
+GGTCGAACAAAAAGCTGCTAATGGTGTTTTTGATGATGCCAATGTACAAAACCGAACGCT
+CAGTGACTGGGATGGAGTCTGGCAATCCGTTTATCCTTTACTGCAAAGTGGCAAACTTGA
+CCCCGTCTTTCAGAAGAAAGCGGATGCAGATAAAACTAAAACATTTGCTGAAATTAAAGA
+TTATTATCACAAAGGTTATGCAACAGATATCGAGATGATTGGCATTGAGGACGGCATTGT
+TGAATTCCATAGAAATAATGAAACAACATCGTGTAAATATGATTACGATGGATACAAAAT
+ACTCACCTATAAATCAGGCAAGAAAGGCGTTCGTTACTTATTCGAATGTAAAGATCCTGA
+AAGCAAAGCCCCTAAATATATACAATTTAGCGATCATATAATTGCACCACGAAAATCATC
+TCATTTTCACATTTTTATGGGTAATGATTCACAGCAATCTTTATTAAATGAAATGGAAAA
+CTGGCCAACGTATTATCCATATCAGTTGAGTAGCGAAGAAGTGGTCGAGGAAATGATGTC
+TCATTGAGTATTCTCATGATAACGCCTCGATGCCGCTTTAGTAAGTTATCATAACTGCCA
+CTGGTCCATCCACAAACGCCACTGAACGCAAGCTAGCTACAGACACGCTCATCACTATGA
+CGTGTCTGTATATTAATAAGCTAACCCGCATTGAGTTAACCAATAACGGATTCCATACAC
+AATACGGCCAACAGAGAAAGATACCTGTGCTCACGCCATTGCTTATATTGGCTGGTTACA
+ATATGCACTATCAATTTTTTAAATAACAAATTATTAAAACCACATCTGTATAAGGAATTT
+TTAAGGTTCGTGGGATAGCTTGACTGTGAAAATCACAGGAGCTACAAAAATGAACCGATT
+CTCAAAAACTCAAATTTATTTACATTGGATAACGCTGCTTTTCGTTGCAATAACCTATGC
+CGCGATGGAACTCCGTGGCTGGTTTCCTAAAGGTAGTAGTACTTATCTGCTGATGCGAGA
+AACACATTACAATGCGGGTATATTCGTTTGGGTGTTAATGTTTTCACGCCTGATTATAAA
+ACACCGTTATAGTGATCCTTCTATTGTGCCACCGCCACCTGCCTGGCAAATGAAAGCGGC
+TTCGCTAATGCACATCATGCTTTATATAACCTTCCTTGCACTTCCTCTGCTGGGGATTGC
+TTTGATGGCTTACAGTGGAAAATCGTGGAGTTTCCTTGGTTTCAATGTGTCTCCCTTTGT
+TACCCCAAACAGCGAAATTAAAGCACTGATAAAAAATATTCACGAAACCTGGGCAAATAT
+AGGCTACTTTTTAATCGCAGCTCACGCTGGCGCAGCACTCTTTCATCACTACATTCAGAA
+AGATAATACTCTGTTACGAATGATGCCTCGCCGCAAATAAGTCGATCCCCTTACAAGGAA
+ATGTGAACCATGGACATCAACGCGTCATAAATGTTTACGCAAGTGCACAATGCACCCTTT
+CCACTATCAACAAGGAGGAGCAGAAACTGTGTAAATCGTACAATGGTAAGACTTATCAAA
+AATACAGGTTAATTTTGGTATTTAAACCTTTTTTACTTGTTAGTATGATACAAAGGCTTT
+CAAAAAAGCTGCGAAATTCAACAACTCTTGGAAATTATGGACTTTGTCCCGCGGCTTTAA
+TCTGACGGCCGCGTTCCTTTTTTGACTCAATTATTGAACCCTTCTCTACGCAACTTCAGT
+TCCCACCACCAACTTTGCGGCAGTTTCATAGGATGAATGTCTAAAAGAATAATGGTGAGC
+GATAAGAAAACGACTGAATAACTGCACATTTTCGCTCGAAAGCTTCCTGTCAGATCCATA
+GCGAATCAAGTGCTGAATGTCACAGTATCGAACAGAAAACAGTGACGATCTAACCCTTCA
+AGAATATTCTACGATTGTTCTGTTTAGGAAAAGCAAGGCGGGAAGTCGGGAGATAAGTCA
+TTGATAAAGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTACTCCGGT
+TTTCGAGACCGGTCCGTTCAGCCGCTCCGGCATCTCTCCGTTCAGATGGTTGCCATGATG
+CCAGGAAATTTGGCATTTTAACAGTCCCTGTCCGTGCAATTTTGTTCAAGTGACGAGTTT
+GCGAGCAAAACGATGATTAAGTGGCCCTGGAAAGTACAAGAATCAGCACATCAAACTGCC
+CTTCCCTGGCAGGAAGCACTATCGATCCCCCTTTTAACGTGTCTGACGGAACAGGAACAA
+AGCAAATTAGTCACTCTTGCCGAACGTTTTTTACAGCAAAAGCGGCTTGTTCCTTTACAG
+GGCTTTGAACTGGATTCATTAAGAAGCTGCCGGATAGCACTTCTATTTTGCCTACCCGTT
+CTGGAGTTAGGACTGGAATGGCTGGATGGTTTTCATGAAGTCTTAATTTATCCTGCGCCA
+TTTGTGGTCGATGATGAATGGGAAGACGATATCGGTCTGGTGCATAACCAACGTATTGTT
+CAGTCAGGTCAGAGCTGGCAGCAAGGGCCTATCGTTTTGAACTGGTTGGATATACAAGAT
+TCTTTTGATGCTTCTGGTTTTAACCTGATTATTCATGAAGTCGCTCATAAGCTGGACACC
+CGTAACGGCGATCGCGCCAGCGGAGTTCCCTTTATTCCGTTGCGTGAGGTTGCTGGCTGG
+GAACACGATCTTCATGCTGCAATGAACAACATTCAGGAAGAAATCGAATTGGTTGGCGAG
+AATGCGGCGAGCATTGATGCTTATGCAGCCAGCGATCCTGCTGAATGTTTTGCCGTACTT
+TCTGAATATTTCTTTAGCGCCCCAGAACTTTTTGCTCCTCGTTTCCCTTCATTGTGGCAA
+CGTTTCTGCCAATTTTATCAACAAGATCCTTTGCAGAGACTGCATCACGCTAATGATACA
+GACTCGTTTTCGGCGACGAATGTTCATTAATTAACAACTTTGCAGATTAATTAACCAATT
+GAAATGACTTATGAAATTTAGTGTTGACAGACAAGGTACCGCTAAGTAATATTCGCCCCG
+TTCACACGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCAC
+TGGTTCGAGTCCAGTCAGAGGAGCCAAATTCTAAAAATTCGCTTTTTTAGCGCAATGTCA
+CTGACCTTAGTTGAACATTGTTTTTTAACGGATAGCGGGTTTTTAACATCTTAAGCGCCC
+TCGACCTTTATGGTTGAGGGCGTTTTGCTATGAACGCCATCACCATTTTCCCCTCGATTA
+TAAAACTTGAGTTATTCAGTAGTCTCCCCTCTTGCAACTCACACCCAAAACTGCCTAACG
+AAAAGTTATTAATTTTCAATCATATTGCTATCAGTATTTACATTTTTTCGCTGTGCTAGA
+AAGGGCGCATTTATGTTAGCTCGTTCAGGGAAGGTAAGCATGGCTACGAAGAAGAGAAGT
+GGAGAAGAAATAAATGACCGACAAATATTATGCGGGATGGGAATTAAACTACGCCGCTTA
+ACTGCGGGTATCTGTCTGATAACTCAACTTGCGTTCCCTATGGCTGCGGCAGCACAAGGT
+GTGGTAAACGCCGCAACCCAACAACCAGTTCCTGCACAAATTGCCATTGCAAATGCCAAT
+ACGGTGCCCTACACCCTTGGAGCGTTGGAATCGGCCCAAAGCGTTGCCGAACGTTTCGGT
+ATTTCGGTGGCTGAGTTACGCAAACTCAACCAGTTTCGTACGTTTGCTCGAGGTTTTGAT
+AATGTCCGCCAGGGTGATGAACTGGATGTCCCGGCACAAGTTAGTGAAAAAAAATTAACC
+CCGCCGCCGGGTAATAGCAGTGACAACCTCGAGCAACAGATAGCCAGTACTTCACAGCAA
+ATCGGGTCTCTGCTCGCCGAAGATATGAACAGCGAGCAAGCGGCAAATATGGCGCGTGGA
+TGGGCCTCTTCTCAGGCTTCAGGCGCAATGACAGACTGGTTAAGCCGCTTCGGTACCGCA
+AGAATCACGCTGGGCGTGGATGAAGATTTTAGCCTGAAGAACTCCCAGTTCGATTTTCTC
+CATCCGTGGTATGAAACGCCTGATAATCTCTTTTTCAGTCAGCATACTCTCCATCGTACT
+GACGAGCGTACGCAGATTAACAACGGCTTAGGTTGGCGTCATTTCACTCCCACATGGATG
+TCGGGCATCAACTTCTTTTTCGACCACGATCTTAGCCGTTACCACTCCCGCGCCGGCATT
+GGCGCGGAGTACTGGCGCGACTATCTAAAATTAAGCAGTAACGGCTATTTGCGACTGACC
+AACTGGCGCAGCGCACCTGAACTGGACAACGATTATGAAGCACGCCCGGCCAATGGCTGG
+GATGTACGCGCAGAAAGCTGGCTACCCGCCTGGCCGCACCTTGGCGGTAAACTGGTCTAT
+GAACAGTATTATGGCGATGAAGTGGCCCTGTTCGATAAAGACGATCGGCAAAGTAATCCT
+CATGCCATAACCGCTGGACTTAACTATACCCCCTTCCCGCTGATGACCTTCAGCGCGGAG
+CAACGCCAGGGTAAACAGGGCGAAAATGACACCCGTTTTGCCGTCGATTTTACCTGGCAA
+CCTGGCAGCGCAATGCAGAAACAGCTTGACCCGAATGAAGTCGCTGCACGGCGTAGCCTT
+GCAGGCAGCCGTTATGATCTGGTGGATCGCAACAACAATATCGTTCTGGAATATCGCAAA
+AAAGAACTGGTTCGCCTGACCCTGACAGACCCCGTGACAGGGAAGTCAGGAGAAGTGAAA
+TCACTGGTTTCGTCGCTACAAACCAAATATGCCCTGAAAGGCTATAACGTCGAAGCCACC
+GCACTGGAAGCTGCCGGTGGCAAAGTGGTCACAACGGGTAAAGATATTCTGGTTACCCTG
+CCGGCTTACCGGTTCACCAGTACGCCAGAAACCGATAACACCTGGCCGATTGAAGTCACC
+GCCGAAGATGTCAAAGGCAATTTGTCGAATCGTGAACAGAGCATGGTGGTCGTTCAGGCA
+CCTACGCTAAGCCAGAAAGATTCCTCGGTATCGTTAAGTACCCAAACATTGAACGCGGAT
+TCCCATTCAACCGCCACACTGACTTTTATTGCGCATGATGCAGCAGGTAATCCTGTTGTC
+GGGCTGGTGCTCTCGACGCGTCACGAAGGTGTTCAGGACATCACCCTTTCTGACTGGAAA
+GATAATGGTGACGGAAGCTATACCCAGATCCTGACCACAGGAGCGATGTCTGGCACGCTG
+ACGCTGATGCCACAGCTGAATGGTGTGGATGCGGCTAAAGCCCCCGCCGTGGTGAATATC
+ATTTCTGTTTCGTCATCCCGAACTCACTCGTCAATTAAGATTGATAAGGACCGTTATCTC
+TCCGGCAATCCTATCGAGGTGACGGTAGAACTGAGAGATGAAAATGACAAACCTGTTAAG
+GAACAAAAACAGCAACTGAATAACGCAGTCAGCATCGACAACGTGAAACCAGGAGTCACT
+ACAGACTGGAAAGAAACCGCAGATGGCGTCTATAAGGCGACCTATACCGCCTATACCAAA
+GGCAGTGGACTTACTGCGAAGCTATTAATGCAAAACTGGAATGAAGATTTGCATACCGCT
+GGATTTATCATCGACGCCAACCCGCAGTCAGCGAAAATTGCGACATTATCTGCCAGCAAT
+AATGGTGTGCTCGCCAATGAGAATGCAGCAAACACCGTCTCGGTCAATGTCGCTGATGAA
+GGAAGCAACCCAATCAATGATCATACCGTCACGTTTGCGGTATTAAGCGGATCGGCAACT
+TCCTTCAACAATCAAAACACCGCAAAAACGGATGTTAATGGTCTGGCGACTTTTGATCTG
+AAAAGTAGTAAGCAGGAAGACAACACGGTTGAAGTCACCCTTGAAAATGGCGTGAAACAA
+ACGTTAATCGTCAGTTTTGTCGGCGACTCGAGTACTGCGCAGGTTGATCTGCAGAAGTCG
+AAAAATGAAGTGGTTGCTGACGGCAATGACAGCGTCACAATGACCGCGACCGTCCGGGAT
+GCAAAAGGCAACCTGCTCAATGACGTCATGGTCACTTTCAATGTTAATTCAGCAGAGGCG
+AAACTGAGCCAAACCGAAGTGAATAGCCACGACGGGATCGCCACAGCTACGCTGACCAGT
+TTGAAAAATGGTGATTATAGGGTTACGGCCTCTGTGAGCTCTGGTTCCCAGGCTAATCAA
+CAGGTGAATTTTATCGGTGATCAAAGTACTGCTGCCCTGACCCTCAGTGTGCCTTCAGGT
+GATATCACCGTCACCAACACAGCTCCGCAATATATGACTGCAACCTTGCAGGATAAAAAT
+GGCAACCCACTAAAAGATAAAGAAATCACCTTCTCTGTGCCAAACGACGTCGCAAGTAAG
+TTCTCGATTAGCAACGGAGGAAAAGGCATGACGGATAGTAACGGGGTTGCAATCGCCTCC
+CTGACCGGCACGTTAGCGGGCACGCATATGATCATGGCTCGTCTGGCTAACAGCAATGTC
+AGCGATGCACAGCCAATGACGTTTGTGGCGGATAAAGACAGAGCGGTTGTCGTTTTGCAA
+ACATCGAAAGCGGAAATCATTGGGAATGGCGTGGATGAGACAACTCTGACAGCAACAGTG
+AAAGATCCGTCGAATCATCCGGTGGCGGGGATAACGGTAAACTTCACCATGCCACAGGAC
+GTTGCGGCAAACTTTACCCTTGAAAATAACGGTATTGCCATCACTCAGGCCAATGGGGAA
+GCGCATGTCACGCTGAAAGGTAAAAAAGCGGGCACGCATACGGTTACCGCAACGCTGGGT
+AATAACAATACCAGTGATTCGCAGCCGGTAACATTTGTGGCGGACAAAGCCTCGGCTCAG
+GTTGTCCTGCAGATATCAAAAGATGAGATCACAGGTAATGGCGTCGATAGCGCAACGCTA
+ACTGCAACGGTTAAAGATCAGTTCGACAATGAGGTGAATAATCTTCCGGTAACATTCAGC
+TCAGCCTCTTCAGGACTCACCCTGACCCCGGGAGTAAGTAATACCAACGAGTCTGGCATC
+GCGCAGGCCACTCTCGCAGGCGTTGCCTTTGGTGAGAAGACGGTTACTGCATCACTGGCT
+AATAATGGTGCCAGCGACAACAAAACTGTGCATTTTATTGGCGACACAGCGGCGGCAAAA
+ATTATCGAGTTGGCGCCTGTCCCAGACAGCATAATCGCCGGTACCCCGCAGAACAGCTCC
+GGCAGCGTCATCACCGCCACAGTCGTTGATAATAATGGCTTTCCGGTGAAAGGTGTGACT
+GTGAACTTCACCAGCAACGCAGCGACAGCCGAAATGACGAACGGCGGTCAAGCCGTGACG
+AACGAACAGGGTAAGGCTACCGTCACTTATACCAATACCCGCTCCTCGATAGAATCAGGA
+GCGAGACCGGATACCGTTGAGGCCAGTCTGGAAAATGGTAGCTCCACGCTTAGCACATCA
+ATTAATGTCAACGCTGATGCGTCTACGGCACATCTCACCTTGCTACAGGCACTTTTTGAT
+ACAGTCTCCGCAGGCGAGACAACCAGTCTGTATATTGAGGTGAAGGATAATTACGGCAAC
+GGTGTCCCCCAGCAGGAGGTAACCCTCAGCGTTTCACCAAGTGAAGGCGTGACCCCCAGT
+AATAACGCTATATATACTACCAACCACGACGGCAATTTTTACGCAAGCTTTACCGCTACA
+AAAGCCGGGGTTTATCAATTGACGGCAACCCTCGAAAATGGCGATTCGATGCAACAAACA
+GTGACCTATGTGCCGAACGTCGCGAATGCTGAAATCACGCTGGCAGCCTCGAAGGATCCG
+GTGATTGCCGACAATAACGATCTCACGACACTAACAGCAACAGTCGCTGATACAGAGGGC
+AATGCGATAGCCAACACTGAGGTAACATTTACTCTGCCGGAAGATGTGAAGGCGAACTTC
+ACGCTGAGCGATGGCGGTAAAGTGATTACTGATGCTGAAGGCAAAGCGAAAGTCACGCTG
+AAAGGTACAAAAGCAGGCGCTCATACTGTTACAGCATCGATGACTGGCGGTAAGAGTGAG
+CAGTTGGTGGTGAACTTTATTGCGGATACGCTCACTGCGCAGGTTAATCTTAACGTTACC
+GAGGACAATTTTATCGCTAATAACGTCGGGATGACCAGGCTGCAGGCAACAGTGACTGAT
+GGAAACGGCAACCCGTTAGCCAATGAGGCGGTGACATTCACGCTACCGGCAGATGTGAGC
+GCAAGCTTTACTCTCGGACAAGGCGGTTCCGCCATTACTGATATCAACGGCAAGGCTGAA
+GTTACACTGAGCGGTACAAAATCCGGCACCTACCCCGTGACAGTTAGCGTGAACAATTAT
+GGTGTCAGTGATACGAAACAGGTGACTTTGATTGCCGATGCTGGTACCGCAAAACTAGCC
+TCCTTAACCTCTGTATACTCATTCGTCGTCAGCACGACCGAGGGCGCAACCATGACGGCA
+AGCGTCACTGACGCTAACGGCAACCCGGTAGAAGGCATAAAAGTTAATTTCCGCGGAACC
+TCCGTCACGCTAAGCAGCACCAGCGTTGAAACGGATGATCGGGGTTTCGCTGAAATTCTT
+GTGACAAGCACCGAGGTCGGACTGAAAACAGTTTCAGCCTCTCTGGCAGATAAACCTACT
+GAAGTCATCTCGCGATTACTGAATGCCAGTGCAGATGTTAATTCTGCGACGATTACCAGT
+CTGGAGATACCGGAAGGTCAGGTAATGGTCGCACAAGACGTAGCAGTTAAAGCTCACGTT
+AACGACCAGTTTGGCAACCCGGTTGCGCATCAACCCGTGACATTCAGTGCAGAGCCATCC
+TCGCAAATGATCATCAGCCAGAATACGGTCTCTACTAATACGCAGGGTGTAGCCGAGGTC
+ACCATGACGCCCGAAAGAAACGGTTCGTATATGGTGAAAGCATCCCTGCCGAATGGAGCC
+TCACTTGAGAAACAACTGGAGGCTATTGATGAAAAACTGACACTCACGGCGTCCAGTCCG
+CTTATCGGTGTCTATGCCCCTACAGGCGCTACTCTGACGGCAACGCTAACCTCTGCAAAT
+GGCACTCCAGTGGAGGGTCAGGTCATCAACTTTAGCGTAACGCCAGAAGGGGCGACGTTA
+AGTGGCGGAAAAGTGAGAACTAACTCTTCAGGTCAGGCTCCAGTCGTTTTGACCAGCAAT
+AAAGTCGGTACATATACGGTGACTGCATCTTTCCATAACGGCGTAACAATACAGACACAG
+ACAACCGTGAAAGTCACTGGCAACTCAAGCACCGCCCATGTTGCTAGCTTTATCGCTGAT
+CCATCGACTATCGCCGCCACCAACACTGATTTAAGTACCTTAAAGGCAACGGTTGAGGAT
+GGCAGTGGTAACCTGATCGAAGGTCTCACTGTGTACTTCGCCTTAAAAAGCGGCTCTGCC
+ACATTAACGTCATTAACAGCGGTGACCGATCAAAACGGAATCGCGACAACAAGCGTGAAA
+GGAGCGATGACAGGTAGCGTCACGGTAAGCGCAGTCACGACCGCTGGTGGAATGCAAACA
+GTAGATATAACGCTGGTGGCTGGCCCGGCAGACACCTCGCAGTCCGTCCTTAAGAGCAAT
+CGGTCATCACTGAAAGGGGACTATACCGATAGTGCTGAATTACGTCTTGTTCTGCACGAT
+ATATCAGGCAATCCGATCAAAGTTTCTGAAGGGATGGAATTTGTGCAATCAGGTACTAAC
+GTGCCCTATATAAAAATTAGCGCAATTGATTACAGTCTAAATATCAACGGTGATTACAAA
+GCCACTGTTACAGGAGGCGGAGAGGGTATCGCAACGCTGATCCCTGTATTGAATGGTGTT
+CATCAAGCTGGTCTGAGTACCACAATACAATTCACTCGCGCAGAAGACAAAATAATGAGC
+GGTACAGTATCAGTCAATGGTACTGACCTACCGACAACTACATTCCCTTCGCAGGGGTTC
+ACCGGGGCGTATTATCAGTTGAATAATGACAACTTTGCCCCAGGAAAAACGGCGGCTGAT
+TATGAGTTTTCAAGCTCTGCCTCCTGGGTCGATGTTGATGCTACCGGTAAAGTGACATTT
+AAAAATGTCGGCAGCAATTCGGAAAGGATTACGGCGACGCCAAAATCAGGAGGCCCTAGC
+TATGTATACGAAATCCGTGTGAAGAGTTGGTGGGTGAACGCCGGCGAGGCTTTCATGATA
+TACAGCCTTGCTGAAAATTTTTGCAGCAGCAATGGCTACACGCTCCCCAGAGCAAACTAT
+TTAAACCACTGTAGTTCCCGAGGCATCGGGTCACTGTACAGTGAATGGGGAGATATGGGG
+CATTACACGACTGACGCTGGTTTTCAATCAAATATGTATTGGTCATCTAGTCCCGCAAAC
+TCAAGCGAACAATACGTAGTTTCCCTGGCAACAGGTGATCAAAGCGTATTTGAAAAGCTT
+GGGTTTGCTTATGCGACATGTTATAAAAACCTGTGATTTTCCGTTATAATTTCTTAAAGA
+GTGTTCCATTCGGGGCACTCTTTTTTACATTCCCTCTACAGAACTAGCCCTTCTCTCACA
+GAAAATGAATAAATAAAAATGCGGCACCGCCAGAATCGCGTTCGATGTGACTATGATCAT
+TTTCGGTGAGTACTGCTTTGATCTAAAGGCTGGTTTTCTGTGATGATTGACCAGCCTCAG
+AGTATTGATGACACCACCGTTCATAACAGATCGGCATTACTATGCATAAGTACTGTCTCA
+TATTCTCGCCAAAACACTTTTTAATGCCTTTGCGAATTCATCCAGACTTATATTGTCAAT
+TTTTTGCCCAACGACGACTGACTCCGAGACATCGGCCATTGCGGGCCATCGCGTTTTGTA
+ATCAGCATAAATTGCAACAACAGGGGTATTATAGGCACTTGCCATATGTAATATTGAGGT
+GTCAGGAGTTATTGCGATATAAGCATCTTTTATGATTGCTGCTGAACGTTTAATCGAGGG
+TGGTAAGGATAAACGGTAGACATTATTATAACAATCCACTAATGCCCTGGCTTTATCTTC
+ACCTTTGGGTCCATGAACGATCACTATTGGTATATCTGTTTCACTTTAAATTTTTGCTAT
+TAGATTTTCTGCAATCGATAATGAAAATGTACGTTCCTGCGAGCTACCTTCTAAATTGAA
+CGCAATGTAAGATCCTAACGATCGCATTTCCTCGCGCACCTCATCGAGTACATCCTCACT
+TAGTGGCAATTCATATATTGGCCTGACTGCTGGAAAACCCGCCTCACGCATCATAAATGC
+CCATGTCATAGGTACGGGAGCCCGGAGTTTCTGATCCATACTGGACGCGTTCTTGCACAA
+AGGGGAGAAGCAATTCATGGTTATACCAACAACCTGAAAATTCGTTTTTGCTTTCAACTG
+ACTGATAAATAACATCGTTTTCAGGTTCTTTTTACGCATCCCCTCAATGCAAAGATCCGG
+CGTACCGTATTGCTGTGTTATGTTCTTTGCTAAATCTTTTATTTCTTTTAATGTTGCGTG
+ATCCTGCATAGTCATTGTGACTAATGTTAATTTAGTCTGTTCAAGTTTAAGCGCATTAAA
+GACTTCTAAATTAATTGTCGACGTTACAATTAAAAGATGCTTAATTTTATGCAATTCAAG
+CGCCCGAATAACAGGAAAGATGGCCATAGCATCGCCAATCTGATCGGGAATATGGATGAC
+AACAAAGTCTGTTTTTTCAATATTGAAATTATAAGCTTTATAATCGTAGTAACTAAATGC
+AATACGTCTCAACAATGATGCTAAAAACATACCTAACCTCGCCTCCCTACTGGTTATAAT
+GCAATGCAGTCTATCAGACTCATCAGGGTGCCATTTTGTGCATATGCGGACTTTTATGTT
+TCATATCTCTAACCTGTGGGTCCTCTGCTTAATCCTTAAACAACACCAGCAACTCCTGCG
+CTTTCATCTTCCATCGAATTTTTCATGTTGCCGCTAATCAGCCATAAAATCATTTGCAGA
+TGCGCTCTGTCGAGGTAGTCTCATAAGGTTCGTTTATAGATCGACGGCAATGTGAGTTAC
+CTTTTCCATACTAATTATAAAAAGACAGTACAAACAGGATCATTATGGACTCCACGCTCA
+TCTCCACTCGTCCCGATGAAGGGACGCTTTCGTTAAGTCGCGCCCGACGAGCTGCGTTAG
+GCAGCTTCGCTGGTGCCGTCGTCGACTGGTATGATTTTTTACTCTATGGCATCACCGCCG
+CACTGGTGTTTAATCGCGAGTTTTTCCCGCAAGTAAGCCCGGCGATGGGAACGCTCGCCG
+CATTTGCTACCTTTGGCGTCGGATTTCTTTTCCGTCCGCTCGGCGGTGTCATTTTCGGTC
+ACTTTGGCGACCGACTGGGACGTAAGCGCATGTTAATGCTGACCGTCTGGATGATGGGCA
+TCGCGACAGCCTTGATTGGTATTCTTCCTTCATTCTCGACCATTGGGTGGTGGGCACCTA
+TTTTGCTGGTGACACTGCGTGCCATTCAGGGATTTGCAGTCGGCGGCGAATGGGGAGGCG
+CGGCGTTGCTTTCCGTTGAAAGTGCACCGAAAAATAAAAAAGCCTTTTACAGTAGCGGTG
+TACAAGTTGGCTACGGTGTAGGTTTACTGCTTTCAACCGGACTGGTTTCATTGATCAGTA
+TGATGACGACTGACGAACAGTTTTTAAGCTGGGGCTGGCGCATTCCTTTCCTGTTTAGCA
+TCGTACTGGTACTGGGAGCATTGTGGGTGCGCAATGGCATGGAGGAGTCCGCGGAATTTG
+AACAACAGCAACATTATCAAGCTGCCGCGAAAAAACGCATCCCGGTTATCGAAGCGCTGT
+TACGACATCCCGGTGCTTTCCTGAAGATTATTGCGCTACGACTGTGCGAATTGCTGACGA
+TGTACATCGTTACTGCCTTTGCACTTAATTATTCAACCCAGAATATGGGGCTACCGCGCG
+AACTTTTCCTTAATATTGGTTTGCTGGTAGGTGGATTAAGCTGCCTGACAATTCCCTGTT
+TTGCCTGGCTTGCCGATCGTTTTGGTCGCCGTAGGGTTTATATCACAGGTACGTTAATCG
+GAACGTTGAGCGCATTTCCTTTCTTTATGGCGCTTGAAGCACAATCTATTTTCTGGATAG
+TTTTCTTCTCCATAATGCTGGCAAACATTGCGCATGACATGGTGGTGTGTGTGCAACAAC
+CGATGTTTACCGAAATGTTTGGTGCCAGTTATCGCTATAGTGGCGCTGGAGTCGGTTATC
+AGGTTGCCAGTGTGGTTGGCGGTGGATTTACACCTTTTATTGCCGCTGCACTCATCACTT
+ACTTTGCCGGGAACTGGCATAGCGTCGCCATTTATTTGCTGGCTGGATGCCTGATTTCCG
+CAATGACCGCTTTGTTGATGAAAGACAGTCAACGCGCTTGATAGCCTGGCGAAGATCATC
+CGATCTTCGCCTTACACTTTTGTTTCACATTTCTGTGACATACTATCGGATGTGCGGTAA
+TTGTATGGAACAGGAGACACACATGAATAATAAGGGCTCCGGTCTGACCCCAGCTCAGGC
+ACTGGATAAACTCGACGCGCTGTATGAGCAATCTGTAGTCGCATTACGCAACGCCATTGG
+CAACTATATTACAAGTGGCGAATTACCTGATGAAAACGCCCGCAAACAAGGTCTTTTTGT
+CTATCCATCACTGACCGTAACCTGGGACGGTAGCACAACCAATCCCCCCAAAACGCGCGC
+ATTTGGTCGCTTTACCCACGCAGGCAGCTACACCACCACGATTACTCGCCCTACTCTCTT
+TCGTTCGTATCTTAATGAACAACTTACGTTGCTGTATCAGGATTATGGTGCGCATATCTC
+AGTGCAACCCTCGCAGCATGAAATCCCTTATCCTTATGTCATCGATGGCTCTGAATTGAC
+ACTTGATCGCTCAATGAGCGCTGGGTTAACTCGCTACTTCCCGACAACAGAACTGGCGCA
+AATTGGCGATGAAACTGCAGACGGCATTTATCATCCAACTGAATTCTCCCCGCTATCGCA
+TTTTGATGCGCGCCGCGTCGATTTTTCCCTCGCACGGTTGCGCCATTATACCGGTACGCC
+AGTTGAACATTTTCAGCCGTTCGTCTTGTTTACCAACTACACACGTTATGTGGATGAATT
+CGTTCGTTGGGGATGCAGCCAGATCCTCGATCCTGATAGTCCCTACATTGCCCTTTCTTG
+TGCTGGCGGGAACTGGATCACCGCCGAAACCGAAGCGCCAGAAGAAGCCATTTCCGACCT
+TGCATGGAAAAAACATCAGATGCCAGCATGGCATTTAATTACCGCCGATGGTCAGGGTAT
+TACTCTGGTGAATATTGGCGTGGGACCGTCAAATGCTAAAACCATCTGCGATCATCTGGC
+AGTGCTACGCCCGGATGTCTGGTTGATGATTGGTCACTGTGGCGGATTACGTGAAAGTCA
+GGCCATTGGCGATTATGTACTTGCACACGCTTATTTACGCGATGACCACGTTCTTGATGC
+GGTTCTGCCGCCCGATATTCCTATTCCGAGCATTGCTGAAGTGCAACGTGCGCTTTATGA
+CGCCACCAAGCTGGTGAGCGGCAGGCCCGGTGAGGAAGTCAAACAGCGGCTACGTACTGG
+TACTGTGGTAACCACAGATGACAGGAACTGGGAATTACGTTACTCAGCTTCTGCACTTCG
+TTTTAACTTAAGCCGGGCCGTAGCAATTGATATGGAAAGTGCAACCATTGCCGCGCAAGG
+ATATCGTTTCCGCGTGCCATACGGGACACTACTGTGTGTTTCAGATAAACCGTTGCATGG
+CGAGATTAAACTTCCCGGCCAGGCTAACCGTTTTTATGAAGGCGCTATTTCCGAACATCT
+GCAAATTGGCATTCGGGCGATCGATTTGCTGCGCGCAGAAGGCGACCGACTGCATTCGCG
+TAAATTACGAACCTTTAATGAGCCGCCGTTCCGATAATAAGTTCTGAACCTTCTTATCAG
+AAATAGATGTGAAGGAGTAAGTAAGACACCTGGCAAATAGCCTGCAATAATCGTGGGCTG
+TTTGCTTCCTTGGGCGGATACGAGTTTTATTATCGTCTTAATGATTTCCACATATTAAAA
+GCAAGTATGCTTTCAAAACACAATTATAAAAAATCCCGCCAACAATATAAGTTTTTATAA
+AATTAAATATAAGATTATGGCTTTAGAATATTTTTATTTCTAATAGACGAGATTTTTCCT
+GTTATGATATAATATGCTGAATTAACACATGTTAACGATTTACCAGTAATGTAAATAAAT
+TTTCGAGGAGATCATTCCAGTGGGACGTAAATGGGCCAATATTGTTGCTAAAAAAACGGC
+TAAAGACGGTGCAACGTCTAAAATTTATGCAAAATTCGGTGTAGAAATCTATGCTGCTGC
+TAAACAAGGTGAACCCGATCCAGAATTAAACACATCTTTAAAATTCGTTATTGAACGTGC
+AAAGCAGGCACAAGTTCCAAAGCACGTTATTGATAAAGCAATTGATAAAGCCAAAGGCGG
+CGGAGATGAAACGTTCGTGCAGGGACGTTATGAAGGCTTTGGTCCTAATGGCTCAATGAT
+TATCGCCGAGACATTGACTTCAAATGTTAACCGTACGATTGCTAACGTTCGCACAATTTT
+CAATAAAAAAGGCGGCAATATCGGAGCGGCAGGTTCTGTCAGCTATATGTTTGACAATAC
+GGGTGTGATTGTATTTAAAGGGACAGACCCTGACCATATTTTTGAAATTTTACTTGAAGC
+TGAAGTTGATGTTCGTGATGTGACTGAAGAAGAAGGTAACATTGTTATTTATACTGAACC
+TACTGACCTTCATAAAGGAATCGCGGCTCTAAAAGCAGCTGGAATCACTGAGTTCTCAAC
+AACAGAATTAGAAATGATTGCTCAATCTGAAGTTGAGCTTTCCCCAGAAGATTTAGAAAT
+CTTTGAAGGGCTTGTTGATGCCCTTGAAGATGACGACGATGTACAAAAAGTTTATCATAA
+CGTCGCAAATCTCTAATTATCTTTTAAAGAAATCTGTCTTTACGGCAGATTTCTTTAATC
+TCATATAATTCTTATAAAAAATATAATATTCAACTCGTCATATTGATTATACCCCCCCGT
+TCCCAGAGAAATAATATTTATTAAAATTCCAGTTCTTCTTTTTCTGATTACAGAAGGCAA
+AGTGGCAATTACGCATAGTTTCCCGATAAAGACGCGATAGCGACATCCCGCATAAGGCAT
+TTTTCTCTTTATCTTTGTACGGTACTTCATGGAACAGAGTTTTTGACCTTGCGAATCGTG
+ATGTCTGTTGGGGAGGGACAATTTGCTCACTGAAGCGTGAGACTCGATTAAGCGCACGAA
+ACACAGAAATCAAAAAACCCGGTCACTTTTTTACAAGGTAACCGGGTAAAAATAATTTTT
+ATTTTTTAACTGTTTTGAGACTCATAGAGATGTCTCAAAACTAAAATTTGGCTCCTCTGA
+CTGGACTCGAACCAGTGACATACGGATTAACAGTCCGCCGTTCTACCGACTGAACTACAG
+AGGAATCGTGAGAACGAGGCGAATATTAGCGATGCCCACCCACAATGTCAAAGCCTGTTT
+TTTAAATTTGAAATCGTTTGCTGAAATAATCTGCATTTTGTCGTTTATTCCGACACAACT
+GGCTTTTTTTCACACTTTTGCGGCTCGGGTCGAGGGTATTTCCATAGCCAACGTCCAGTA
+ACCATTCGCCAGTAAAACAGCACGGCCCGCACAGCCCAGTCGGCAAACATTCCCATCCAG
+ACACCAACCACACCCCAGCCAAGCATGATTCCCAGCACATAACCGACTACAACCCGACAA
+CCCCACATGCTCAACATCGAAACCCACATGGCGTAACGGGCATCACGAGCACCTTTAAAT
+CCAGCGGGTAGCACCCATGAGGCGGACCAAATAGGCATAAATAAAGCATTTAGCCAAATC
+AGAATCACAACGACATGTTTAACCTGTGGATCCTGGGTGTAAAACGATGCCATAACCCCG
+GCAAAGGGAGCCGTTAGCCAGGCGATGGCCGTTAATCCAAGAGTGGAAAGCCAGAACACA
+TGCCGCAACTGAATCTCTGCTTGCGCTATCTGCCCTACCCCCAACCTTCGGCCTGTAATG
+ATCGTAGAAGCAGAGCCGAGCGCACTTCCGGGTAAGTTGATAAGAGCCGCAATTGAAAAC
+GCGATAAAATTTCCGGCAATAACACTGGTCCCCATCCCGGCAACGAACATTTGGGTTAAT
+AACCGACCACTGGTAAATAACACTGATTCGACACTCGCGGGAATACCAATCCCCATGACT
+TCCCAGATAATGCTAAAATTCAGCGGTTTAAAATAGCTCTTTAACGAAATCCTTAGCGCA
+GGATTAAAACCAATCGCCAGCACCCACAAAATTGCAACTGCGCCAATATAACGAGAAATG
+GTTAAACCCAGCCCTGCCCCGACAAATCCCAGTCCCGGCCAGGAGAAAAGGCCGTAAATC
+AATATGCCGCTAATAATAATATTAAGAATATTCAGGCTACCGTTAATCAATAGCGGTATT
+TTCGTATTCCCTGCACCACGAAGTGCCCCGCTACCAATAAGAGTGATGGCAGCTGCTGGA
+TAACTGAGTACCGTCAGCTCCAGATAAGTCAACGCCAGTGCTTTAACTTCTGTCGTGGCA
+TCACCCGCGACGAAATCAATAATTTGTTCGCCAAAATGATGAATAAGCGTTGCCAACAGT
+ACGGCAAACAACGTCATGATCACCAATGACTGCCGCGTCGCCACCCTCGCTCGTCGTCGA
+TCCCGCTTACCGAGACTAAATGCCACAACGACAGTAGTACCAAGATCGATAGCAGCAAAA
+AAAGCCATAATGACCATATTGAAGCTGTCCGCCAATCCCACGCCGGCCATCGCATCTTTT
+CCCAGCCAGCTGACCAGAAAAGTGCTCAGAACCCCCATCAACAGGACACAGGCATTCTCC
+ATGAAGATAGGAACAGCAAGCGGGGTTATCTCGCGCCAGAACAACACTTTGTAGCTCTTG
+CGTTTAGCGTGCCAGCGAGTGCCGTGAACAACCTGGCGTAAAGCAGAGGAGATATTCAAA
+GCCGACCTTAATTGCAGAAAGTGAAACCACATTTCAAATAATGAGGGAGAATCAGCAAAG
+CTGCAAAGATTTTCGCCAACAAATTGTCTGCAAATGCAACAAACTGTTGATAGAAACGGC
+AAACAGTTGGGGAATTTAAAAATCGGGTTTGACAAAAGATTTTTCGCCGTTAAGATGTGC
+CTCAACAACGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTC
+ACTGGTTCGAGTCCAGTCAGAGGAGCCAAATTCCTGAAAAGCCCGCTTTTATAGCGGGAT
+TTTTGCTATATCTGATAATCAATTTCCTCTTCACTGCTTTCCATCACCTGCCGCTTGATA
+TCCTCAACTGACAGTCCTGCATTACAAAGTTCCAGAAAGCGCCAGACATAGTTACGCTGA
+AGTTGTCCTCGCTTCAGTCCCAACCAGACAGTATTAGCATCAAAAAGATGCCGCGTATCC
+AGGCGGATTAAATTCTCTTCCTCTTGTTCGCCACTGGATTGCTCGGCAACTAATCCGATC
+CCAAGCCCAAGAGCAACATAGGTTTTAATGACATCAGAATCCTGCGCACTTAATACAATA
+TCTGCCAGCAAACCTTTGCGGGCAAATGCGTCATCAATACGTGAGCGCCCCGTAATCCCC
+TGTCGGTAAGTGATTAACGGCCACTTCGCTATTGATTCCAGCGTCAATGGTGAAATTTGC
+GTCAAGGGATGATCGTGTGGAACAAGCAAACTATGGTGCCAACGAAACCACGGGAAGGCG
+ACGAGCTGCGGGTCATTACTCAAACGCTCGCTGGCGATACCAATATCAGCTTCGCCATTT
+TGCAACAATGTCGCAATTTCCTGTGGCGTCCCCTGGATTAGCTCGAGCCGAACCTCCGGG
+AAAAGTTCGCGAAAAGCTTTAATGACCTCTGGCAAGCTATAACGTGCCTGAGTATGCGTC
+GTTGCAATAGTGAGAACGCCAGACGTATCGTTGGTAAACAGGTCTGCAAGCCGACGAACA
+TTACTGGCTTCATTCAGAATACGTTCTGCAATGACCAGTAATGCTTTGCCCGGTTCAGTC
+ATGCCCAGCAGTCGCTTACCTCGTCGAACAAATATTTCGATGCCAAGTTCATCCTCCAGT
+TCCCGAATATGACGGCTGACGCCTGACTGTGAGGTAAAAAGCATATTCGCAACCTCTGTC
+AGGTTGTAATCCTGACGTGCAGCCTCGCGGATTATCTTTAGTTGTTGGAAATTCACGGTA
+AACTCCGGGCAGTTCAGATTTCCCGTTATTGTTAAAGTCTAATGCCCGGCATAACAAATA
+ATAAAAACCCGCATCTTATTCCATCCCGATATAACACTTAGCTCACCAATTGCCACTGCC
+TTTTTTCCATCACTGGAGAACTAATCACTGACATTAACAACTCTTTCACTGCCTGTGCCT
+GTGGCGATAAGTTCGCTCTGGCGGGTAAATTTAATGACAAAGAGAGACTCATGGAAGGAG
+TGGTAATGCGTGACATCCACCCATTTACTGCGCCACATAACGAACGCGCGGCCGATTCGG
+GTAATACTGCAACGCCCATGCCGCTGGCAATCGCTGCGGTAAGCGTGGCAATAGACTCAA
+TTTCACCAATAACTTTTGCCGTGAGTCGCCGTAGGGAAAAAGCCTCATCAACACGAAGTC
+TAATAGCACTGTAATCACTGGGGAGAAAGAGGTTCATTTGCGCAATAGCATTCACATCAA
+CGCTTTGCCCCGGGCAATCTTGAGTTCCTACCAGAAAAAGATCTTCTTTCAGCAAAGCCT
+GACTGGATACACCAGCCACAGGGGAATGCTCATAAATCACCGCCATATCGAGTTGGTGAT
+TTATCAATTTTTCGTTAAGCACTGCACCACTATTTTCATGAAGATAGATAACGATCTCCG
+GAAATTCAGCGCGAACCGCCTGTAATAAGGGCATGGTGATGGATGACGCAGCGGTTCCTG
+GTGCAAAGCCAATCGAGACTTGCCCCGATAATGCCTGACCAACGTTATGCACCGCCAGTT
+GGGCCTGTTCACACTGACGTAAAATGGCCCGCGCATGGGTATAGAGAATTTTTCCGGCGT
+CTGTTGGTGTAACGCCCCGCTTTGTACGGATCAAAAGTTGTTGATTTAACTCACCTTCCA
+GTGTGGCAACCTGCTGGCTGAGCGCTGGTTGTGCGATATGCAATACTTCAGCAGCCTGGG
+TCAGGCTACCAATATCTACAATTTTTACGAAGTATTTCAGGCGTCTGAAGTTCATGTTGC
+CTCCGGTTTTTAAGAATCGGCCCAAGTGCCGCCATTACTTACAACCAGATTGCAAGATGC
+TTGCCAGTTTTATTTTGGTGTTGATGTACAAGCTAACCAACTGTCAAATAAGAGATTATG
+ATAGATTCGTCATTTGCTCCTTTAATCAGCTGTCGCGTTCCCCTGCCCTATAAAAGGAGG
+GTATGCACCACGATGGTTCATTACCCAATAAGATTGAAAGCTCACCACTTTGTTGAAATT
+GACAGCAAACAAACAAAAAAATGCATTTCACCCTTTGACATCACCATGCACTGCCATTAA
+TATGCGCCCCGTTCACACGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAAT
+CCGTATGTCACTGGTTCGAGTCCAGTCAGAGGAGCCAAATTCAAAAAAGCCTGCTTTCTA
+GCAGGCTTTTTGCTTTCTAATTACCAACGCTCTTAAAACATCTGTCTTGAACCAGAACTA
+ATTTGCACAGGCATTCCCGATCGACGTTGCAACGCAGCATTTGCGCGATTTACATCAACT
+TCTTGCCCGTTGATAAACGCCCGCAAAGATGGGGTTACCGGCAATGGCACTTTTCGGTCA
+GACTCATATTCTGCACGATTGCGCGACAATGGCTCATGAACTTCCAGCCAGTTCGAGCCA
+TCTGGTTCAGTGGTGTATTTTACTGGCTGGTCGATAATTTGCACACGCGTCCCAACAGGA
+ACATTATCAAACAGATATTTGATATCGTCATTGCGCAGACGAATACAGCCCTGACTTACC
+CGGAGCCCAATACCAAAATTGGCATTGGTACCATGGATGGCATACAACCTGCCAATATAA
+ATCGCGTACAGCCCCATGGGATTATCGGGGCCCGCAGGAACAAATGCGGGCAAACTCTCC
+CCTCGTTTCGCATATTCGCGCCGAGTGTTCGGCGTTGGCGTCCAGGTTGGAGCTTCTTGT
+TTACGTTCAACGGTAGTCACCCAGTTACGCGGGGTTTCTCGCCCAGCCTGGCCGATACCA
+ATAGGAAAGACTTCCACAGTATTACTGTCTGGTGGGTAGTAATAAAGACGCATCTCAGCG
+ACGTTAACAACAATCCCTTTACGAACAGTGTCGGGCAAAATCAGTTGCTGCGGAATGGTG
+AGTTGCGAGCCAGACTTCGGCAAAAAAACATCAGCGCCCGGGTTCGCTTCCAGCATGTTA
+CTTAACCCTTGCCCGTATTGTGCGGCAAAAGTCTCCAGCGGCTGGGTATTGTGATCAGGA
+ACAGTTACAGTAAACGACTGCCCCACTAAACGGCTACCCTCTGGAGGTAATGGATAAGTT
+ACCGCCAGGCTAGTATGGCTGGCAAAAAGCAGAGCAAATGAGCAAAGAATATTTACACGA
+CGCATCATGTCCCTTTCCTATGTCGCGAAAGCTATCCGTTAAGTATAGCTTTTATCAGAC
+TTTTCGTTTTTAACTGTTCAAATCAGAAGTCGTATTCCCCGGTAGAACAATATTACTGGC
+AGCAAGTTCGCCCATGTTGTTGTATATCGCACAGGCAGCTTCGATGATGGGCATCGCCAG
+AGCTGCGCCACTCCCCTCACCTAAACGCATCTCCATATTGAGATAAGGCTCCAGCCCCAA
+ATGCGAGAGCGCTATACGCGCGCCTTTTTCTGCCGACAGGTGAGAAGGAATGAGATACGG
+TTTGATCGCAGGAGACATCTGGCAGGCTGCGAGCGCAGCAGCATAAGAAAGAAATCCATC
+CAGCAACACGGGTAAACCGCAGGAAGCAGCACCTAACATCACTCCAGCTATTCCGACCAA
+ATCAAATCCACCCACTTTTGCCAGGACATCAACACCATCCTGAGGATTTGGTTGATTCAA
+CGTAATCGCCCGACGCACAACATCAATTTTATTAGCCAGTTTATCTGTCGGCAGGTTTGC
+GCCAATCCCAACCACTTCTTCAGGATCCCGGCCAGTGATTGTGCTGACTATTGCTGCTGC
+CGGTGTCGTGTTTGCCATCCCCAGTTCACCTACACCAAACAGCGTGACACCGTTTTTTGC
+CAGCTCCTGCGTATAACATATGACGTCCAAAAGCAACTTTTCAGCCTGACGGCGACTCAT
+TGCCGGAGCTGAAGCAATATTGCCGCTACCTCGTGCGACACGCATGTTGATAAGCCCGGG
+GATAGGCTCAGCAGTATCAATACCAACATCAATTACGTGGACGTTAGCGCCCGCTTGTTC
+TGCCAGCACACACACGCCGGTTGTTCCACGGGTCATATTTTCAGCCTGTATGGCTGTCAC
+TTCTTTTGGAGAAATAGCGACCCCTTCCTCCCAGACGCCGTGATCGGCACACATAACCAG
+TACCGCTTTTTTGCCCACATGCGGTATGCCATTCAACCCCGGCATTCCTGCCAGTTGTAT
+GGCAAGCACCTCCAGCTTTCCCAGGCTACCAACAGGTTTGAGTAACCCGTCAATATGCCG
+TTGTGCACGCGACATAGCGGTAGAATCGATGGCTGGGATCGTATTCAGTAAATCGGCAAG
+TATTTGCATCTCACGTCTCTTTATAGCAGTGCCAGCAGGAAGACCAGTTCACCAAGCTCT
+ATGGCTGCTCCCAGCGTATCGCCCGTTTGCCCGCCCAGCGTACGTTTGAGAAGCTGACCG
+AGGATGAAAATCGCCACCATCGTCACCACCATAGCAGCCACACCATGCATACCCGGCAAT
+AATACGGCAGCAAAAATAGCGGCTAAGCCGAGTGTGACGCAGGTTTGTCGCCCATCAATT
+TTGCCAATGAACACATTGCCAAGCCCTTCTTCCCGCGCATAACGATGACGATACATCAAT
+AATGCGGCAGTCCCGCGGCTGACCGCACATGCTGCCGCCAGCGATGCAAGGATCGATTCG
+CCACGCAGAGCCAACTCGCTTAACACCAGAATCTTTGCCAGTACCACAAAAATCAATGCC
+AGACCGCCGTGGGTGCCTAAACGGCTATCACGCATGATTTCCAACATGCGATCGCGGCTA
+CGTGCAGAAAATACGCCATCACAGGTATCAGCGAGGCCGTCCAGATGGAATCCCCCGGTC
+ATCAGCACCAGCACAAGTACGCTAAACAGTGCCGCCAGTGGTGCGCCACACCATGCCTGC
+AGCACCATGAAGACCAGCCCGCTAATCGCGCCAAGCAATAATCCAATCAAAGGAAAAGTA
+ATAATACCGCGAGAATAATGCTCGAAATCCAGTCCCTGGGACCAGCGACGCGGTACAGGC
+AGACGCGTAATAAATGAGAGCATCGCCCAAAATAATTTACTCATTTGATTTTTACTCCAA
+TACCCGAAACCACCAGCCATACTTCATTTGCCGCAGCGGCCAACTGCTGATTTACCCGCC
+CGGCAATATCACGAAAATGTCGTGCCAGACGACTCTCCGGCACAATCCCCATTCCCACTT
+CGTTAGTCACTAATACAACCTTTGCGGGGCAACGTTGGCAGGCAGCAATCAACGACTGAA
+TCTCAGCATTAATCGCCTGTTCCATCGCCTGATAATCCCATTCATCAGGGTCTTTATCGC
+CGCCATAATCAAACAACAGATTAGTCACCATTGTGGTAACGCATTCAAGCAACACAACCT
+CATTCGGGTTAATGTCTGCATGAATTAATTCATCAAGATGTTGCCAGCGCTCCACTGTGC
+GCCAGTGCTCCGGGCGGCCTTGCCGATGATGTTCTATCCGTGCAGCCATCTCATCATCAA
+GGATTTGCGAGGTAGCGATATACAGAACCTGTGAAGAGTCCCCAATAAGCGCCTCTGCGT
+GGCGACTCTTCCCGCTCCGTGCGCCCCCCGTCACCAAAATCATCATACCGACTCCTGATT
+CAAATGTATGATGGTATTCATTGAACAGAACAATGGATCCCCCACCGTTGCTGACCGCAA
+AACATTTACGCGATTAATACTGCGCGTAATATAATTAAAAATCCAGCATTCTCAATCCAT
+TACGAAATAAGATGGCATTACGGAATAGCCAGACTTTCTCGTGTTAACGTCCGACAAAAT
+GCGTCATTGACAGCGGTTTCTGTGGATTGACACATTTCATTCAGATAATGAATTAATGCT
+ACTGCCGGAACAACCAGCAAACGGGCATTGTGTTCTGAAATCCAGGCTATTGATTCAACG
+TCAGCGACAGATCTGCGCTGTAAAAGAACTTGTAAAACAACGTAATAGAATTATCCGGAA
+TGGTGGCGACTATGCACTAGGGAAGGTGCGAATAAGTGGGGAAATTCTTCTCGGCTGACT
+CAGTCATTTCATTTCTTCATGTTTGAGCCGATTTTTTCTCCCGTAAATGCCTTGAATCAG
+CCTATTTAGACCGTTTCTTCGCCATTTAAGGCGTTATCCCCAGTTTTTAGTGAGATCTCT
+CCCACTGACGTATCATTTGGTCCGCCCGAAACAGGTTGGCCAGCGTGAATAACATCGCCA
+GTTGGTTATCGTTTTTCAGCAACCCCTTGTATCTGGCTTTCACGAAGCCGAACTGTCGCT
+TGATGATGCGAAATGGGTGCTCCACCTTGGCCCGGATGCTGGCTTTCATGTATTCGATGT
+TGATGGCCGTTTTGTTCTTGCGTGGATGCTGTTTCAAGGTTCTTACCTTGCCGGGGCGCT
+CGGCGATCAGCCAGTCCACATCCACCTCGGCCAGCTCCTCGCGCTGTGGCGCCCCTTGGT
+AGCCGGCATCGGCTGAGACAAATTGCTCCTCTCCATGCAGCAGATTACCCAGCTGATTGA
+GGTCATGCTCGTTGGCCGCGGTGGTGACTAGGCTGTGGGTCAGGCCGCTCTTGGCATCGA
+CACCAATGTGGGCCTTCATGCCAAAGTGCCACTGATTGCCTTTCTTGGTCTGATGCATCT
+CCGGATCGCGTTGCTGCTCTTTGTTCTTGGTCGAGCTGGGTGCCTCAATGATGGTGGCAT
+CGACCAAGGTGCCTTGAGTCATCATGACGCCTGCTTCGGCCAGCCAGCGATTGATGGTCT
+TGAACAATTGGCGGGCCAGTTGATGCTGCTCCAGCAGGTGGCGGAAATTCATGATGGTGG
+TGCGGTCCGGCAAGGCGCTATCCAGGGATAACCGGGCAAACAGACGCATGGAGGCGATTT
+CGTACAGAGCATCTTCCATCGCGCCATCGCTCAGGTTGTACCAATGCTGCATGCAGTGAA
+TGCGTAGCATGGTTTCCAGCGGATAAGGTCGCCGGCCATTACCAGCCTTGGGGTAAAACG
+GCTCGATGACTTCCACCATGTTTTGCCATGGCAGAATCTGCTCCATGCGGGACAAGAAAA
+TCTCTTTTCTGGTCTGACGGCGCTTACTGCTGAATTCACTGTCGGCGAAGGTAAGTTGAT
+GACTCATGATGAACCCTGTTCCATGGCTCCAGATGACAAACATGATCTCATATCAGGGAC
+TTGTTCGCACCTTCCCTAGAACACCACAATTTCGCTCTCTCGGTAAGGCACTGTCACAGC
+ATTCAACAGAATGTGACTTGCCAGATTTATTAGCGCCACCAGATGTTTAACCGGGTAACC
+ACGACCCAGTCGGGGATATATTCCATCTTCTCGCTGACATCATCAAGAATAAAAAGGTTT
+ATCACACTCAGAGCAACGTTCTTCAGCAGGCGGGATAATTCTTCAACATTTAGAAGATGT
+GTTATTAAAGGCATACAAACTGGACGTATTGTATTTTCTTTTGGTGGTTGACCTAAGGTA
+GCAGTTTATCCTGATGCGCTGAGATTTCTGTAATATCTACGTCAACATTCTCCTCGAATA
+GAAAATGCAGCCCCGGCAAGTGATTCACATTTTTTAACAAAACGTTGTTAGCGTGCCATT
+TTCAGAAGCTCTCCAAGAAAGCGAATTCTTTTCTCAAATTCTGCATTCTCAGACACAGCT
+TTCTACTCCATGGTAATGGCCCAAATACGAAGTTGCTCAGGATCATTAGTGGTGCTGAGA
+AGTTAAATAACCATGCGGAGTACCACTCGTCATCACGTATTTATATATCATGAAGCTATT
+GTTGTGTTTTGTACATCAGTAGATATATTCTGATATACTCCTTTTGCTAGACATAACCTT
+TCACCTGCTTGCAAAGCTTCTGTGTTCTGACATTGCCAAATTGTTGCAATTCTGTATCCA
+GCCTTCTTTCAGTCATAGCTTCGGGCCGCGATAAGACTCACTGATCTGACCCTGATTCCT
+CTTGCAGACTTTATAGACCAATTAAAATGCAGTTTCTGCAGGTCAACGTCTGACCATCAT
+TGTCATCACTCTGGCCATTAGAGTAACCTTCTGCATTCATCCTTTTGTAAAAAGTTTATA
+TTAGTATCAGCAATTAACCGGACCTGATACTGATATGAGTCTTACCGCATATACGGTCAA
+TTTCAGCAATTAATTACATTATCCACGCCAAAGTATTTGTCATCACAATGATGGTACCTT
+CTTTCAGACACCATTTTTTCAACTCCGTTTTCCACGGACCGCACTCTTATGTCAAGAGTG
+CGGTCCGTGGATACAACCAGAGACCGACTGACACGAGTCAGAGGAAACGACGGATATGTT
+CAGTCGTAAAATATCTATCAAAAAACATGATTAAGGTCAAAAATGTTTGATATTTACAAT
+TTATGAAGATGACAATAATTATAGATATATGAGAACATAAATGAAAATAATTATCATTAC
+AGTAATCATTTGTACTTTGTATTAATGAGGGATGAAATGTTATATAATATACCTTGTCGA
+ATTTATATCCTTTCCACTCTGTCATTATGCATTTCTGGGATAGTTTCTACTGCAACCGCA
+ACTTCTTCAGAAACAAAAATCAGCAACGAAGAGACGCTCGTCGTGACCACGAATCGTTCG
+GCAAGCAACCTTTGGGAAAGCCCGGCGACTATACAGGTTATTGACCAACAAACATTGCAG
+AACTCCACCAATGCCTCCATAGCCGATAATTTGCAGGACATCCCCGGAGTAGAGATAACA
+GACAACTCCTTGGCAGGCCGTAAACAAATCCGCATTCGTGGCTGGATTTGCCCCTATATT
+TCCAGACATCTGTTATCACTTAACCCATTACAAGCCCGCTGCCGCAGATATTCCCGTGGC
+GAGCGATAACCCAGCGCACTATGCGGATGCCATTCGTTATAATGCTCGAACGCCTCTGCA
+AGGTTCTTTGCTGCCGTTAACCCGTCTGGTTTGGGCATGATACTGATGTAGTCACGCTTT
+ATCGTTTTCACGAAGCTCTCTGCTATTCCGTTACTCTCCGGACTCCGCACCGCCGTGTTC
+TTCGGTTCAAGTCCCAACATCCGGGCGAACTGGCGTGTTTCATTAGCCCGGTAGCATGAA
+CCATTATCCGTCAGCCACTCCACTGGAGACGACGGAAGATCGTTGCCGAAGCGGCGTTCC
+ACCGCTCCCAGCATGACGTCCTGTACTGTTTCACTGTTGAAGCCGCCGGTAGTGACCGCC
+CAGTGCAGTGCCTCACGATCACAGCAGTCCAGCGCGAACGTGACACGCAGTCTCTCTCCG
+TTATCACAGCAGAACTCGAACCCGTCAGAGCACCATCGCTGATTGCTTTCTTTCACGGCC
+ACTCTGCCTGTATGTGCCCGTTTCGATGGCGGTACAGCAGGTTTTCGCTCAAGCAACAGC
+GCATTCTGGCGCATGATCCGGTAAACACGTTTGGCATTGATCGCAGGCATACCATCAAGT
+TCTGCCTGTCTGCGAAGCAGCGCCCATACCCGACGATAACCATACGTTGGCAGCTCTCCG
+ATAACATGGTGTATACGGAGAAGCACATCCGTATCATCAGTGTGACGACTGCGGCGGCCA
+TCCATCCAGTCATCGGTTCGTCTGAGAATGACGTGCAACTGCGCACGCGACACCCGGAGA
+CAACGGCTGACTAAGCTTACTCCCCATCCCCGGGCAATAAGGGCGCGTGCGCTATCCACT
+TTTTTGCCCGTCCATATTCAACGGCTTCTTTGAGGAGTTCATTTTCCATCGTTTTCTTGC
+CGAGCAGGCGCTGGAGTTCTTTAATCTGCTTCATGGCGGCAGCAAGTTCAGAGGCAGGAA
+CAACCTGTTCTCCGGCGGCGACAGCAGTAAGACTTCCTTCCTGGTATTGCTTACGCCAGA
+GAAATAACTGGCTGGCTGCTACACCATGTTGCCGGGCAACGAGGGAGACCGTCATCCCCG
+GTTCAAAGCTCTGCTGAACAATTGCGATCTTTTCCTGTGTGGTACGCCGTCTGCGTTTCT
+CCGGCCCTAAGACATCAATCATCTGTTCTCCAATGACTAGTCTAAAAACTAGTATTAAGA
+CTATCACTTATTTAAGTGATATTGGTTGTCTGGAGATTCAGGGGGCCAGTCTAGTGGCGA
+AGCATCCTCCCGTGTTTTAATTCTCATTGATGGTCAGGAGGTAACTTATCAGCGCGCCGG
+AGATAATTATGGTGTGGGACTGTTGATAGATGAGTCTGCGCTGGAGCGTGTTGAGGTAGT
+GAAAGGTCCATATTCCGTACTGTACGGTTCACAGGCAATTGGCGGTATTGTTAACTTCAT
+CACCAAAAAGGGTGAATCTCCGGACTCCCTATATCACTTAAATTGATACAACTTTTTAGA
+GTAGTCATTAGTGAACAGATAATTGATAACTCAGAACCAGTAAAATGCAAAAGACGCACC
+ACGCTGGGAAAATCGCTGCTATTCAGCAGAGTTTTGTATCGAGAATGGTGGCCAGCCACT
+TATTGCTCTCGCGTAAGCGGGTACCGTGACATTCTGCCTGAACTTGACCTGGTACTGTGG
+CTGATTAAAGCCGATGACCGTGCCCTGTCTGTGGATGAGTATTTCTGGCGACACATCCTG
+CAGTGCGGACATCAGCAGGTGCTGTTTGTGGTGACGCAGGCCGACAAAACGGAGCCCTGC
+CATGAATGGGATATGGCCGGTATTCAGCCTTCTCCTGCACAGGCACAGAATATTCGCGAA
+AAAACGGAGGCGGTATTCCGTCTGTTCCGGCCCGTACATCCGGTTGTGGCCGTATCGGCC
+CGCACCGGCTGGGAACTGGATACGCTGGTCAGTGCGCTCATGACAGCGCTTCCCGACCAT
+GCCGCCAGTCCCCTGATGACCCGACTGCAGGACGAGCTGCGCACGGAATCTGTCCGGTCT
+CAGGCCCGTGAACAGTTTACCGGTGCGGTGGACCGGATATTTGACACGGCGGAGAGCGTC
+TGTATTGCCTCTGTTGCACGCACGGTTCTGCGTGCCGTCCGTGACACGGTGGTCTCTGTT
+GCCCGTGCGGTATGGAACTGGATTTTCTTCTGAACCTGTCGTGACTGATGCCCTCCCTGA
+CTCTGAGTCTGCTCACAAAAGCACTGTTTTCGTTACTGTCTCTCTTGTCCGTGCAATAGC
+TCAATAATAGAATAAAACGATCAATATCTATTTTATCGATCGTTTATATCGATCGATAAG
+CTAATAATAACCTTTGTCAGTAACATGCACAGATACGTACAGAAAGACATTCAGGGAACA
+ACAGAACCACAATTCAGAAACTCCCACAGCCGGACCTCCGGCACTGTAACCCTTTACCTG
+CCGGTATCCACGTTTGTGGGTACCGGCTTTTTTATTCACCCTCAATCTAAGGAAAAGCTG
+ATGAAACGACATCTGAATACCTGCTACAGGCTGGTATGGAATCACATGACGGGCGCTTTC
+GTGGTTGCCTCCGAACTGGCCCGCGCACGGGGTAAACGTGGCGGTGTGGCGGTTGCACTG
+TCTCTTGCCGCAGTCACGTCACTCCCGGTGCTGGCTGCTGACATCGTTGTGCACCCGGGA
+GAAACCGTGAACGGCGGAACACTGGCAAATCATGACAACCAGATTGTCTTCGGTACGACC
+AACGGAATGACCATCAGTACCGGGCTGGAGTATGGGCCGGATAACGAGGCCAATACCGGC
+GGGCAATGGGTACAGGATGGCGGAACAGCCAACAAAACGACTGTCACCAGTGGTGGTCTT
+CAGAGAGTGAACCCCGGTGGAAGTGTCTCAGACACGGTTATCAGTGCCGGAGGCGGACAG
+AGCCTTCAGGGACGGGCTGTGAACACCACGCTGAATGGTGGCGAACAGTGGATGCATGAG
+GGGGCGATAGCCACAGGAACCGTCATTAATGATAAGGGCTGGCAGGTCGTCAAGCCCGGT
+ACAGTGGCAACGGATACCGTTGTTAATACCGGGGCGGAAGGGGGACCGGATGCAGAAAAC
+GGTGATACCGGGCAGTTTGTTCGCGGGGATGCCGTACGCACAACCATCAATAAAAACGGT
+CGCCAGATTGTGAGAGCTGAAGGAACGGCAAATACCACTGTGGTTTATGCCGGCGGCGAC
+CAGACTGTACATGGTCACGCACTGGATACCACGCTGAATGGGGGATACCAGTATGTGCAC
+AACGGCGGTACAGCGTCTGACACTGTTGTGAACAGTGACGGCTGGCAGATTGTCAAAAAC
+GGGGGTGTGGCCGGGAATACCACCGTTAATCAGAAGGGCAGACTGCAGGTGGACGCCGGT
+GGTACAGCCACGAATGTCACCCTGAAGCAGGGCGGCGCACTGGTTACCAGTACGGCTGCA
+ACCGTTACCGGCATAAACCGCCTGGGAGCATTCTCTGTTGTGGAGGGTAAAGCTGATAAT
+GTCGTACTGGAAAATGGCGGACGCCTGGATGTGCTGACCGGACACACAGCCACTAATACC
+CGCGTGGATGATGGCGGAACGCTGGATGTCCGCAACGGTGGCACCGCCACCACCGTATCC
+ATGGGAAATGGCGGTGTACTGCTGGCCGATTCCGGTGCCGCTGTCAGTGGTACCCGGAGC
+GACGGAAAGGCATTCAGTATCGGAGGCGGTCAGGCGGATGCCCTGATGCTGGAAAAAGGC
+AGTTCATTCACGCTGAACGCCGGTGATACGGCCACGGATACCACGGTAAATGGCGGACTG
+TTCACCGCCAGGGGCGGCACACTGGCGGGCACCACCACGCTGAATAACGGCGCCATACTT
+ACCCTTTCCGGGAAGACGGTGAACAACGATACCCTGACCATCCGTGAAGGCGATGCACTC
+CTGCAGGGAGGCTCTCTCACCGGTAACGGCAGCGTGGAAAAATCAGGAAGTGGCACACTC
+ACTGTCAGCAACACCACACTCACCCAGAAAGCCGTCAACCTGAATGAAGGCACGCTGACG
+CTGAACGACAGTACCGTCACCACGGATGTCATTGCTCAGCGCGGTACAGCCCTGAAGCTG
+ACCGGCAGCACTGTGCTGAACGGTGCCATTGACCCCACGAATGTCACTCTCGCCTCCGGT
+GCCACCTGGAATATCCCCGATAACGCCACGGTGCAGTCGGTGGTGGATGACCTCAGCCAT
+GCCGGACAGATTCATTTCACCTCCACCCGCACAGGGAAGTTCGTACCGGCAACCCTGAAA
+GTGAAAAACCTGAACGGACAGAATGGCACCATCAGCCTGCGTGTACGCCCGGATATGGCA
+CAGAACAATGCTGACAGACTGGTCATTGACGGCGGCAGGGCAACCGGAAAAACCATCCTG
+AACCTGGTGAACGCCGGCAACAGTGCGTCGGGGCTGGCGACCAGCGGTAAGGGTATTCAG
+GTGGTGGAAGCCATTAACGGTGCCACCACGGAGGAAGGGGCCTTTGTCCAGGGGAACAGG
+CTGCAGGCCGGTGCCTTTAACTACTCCCTCAACCGGGACAGTGATGAGAGCTGGTATCTG
+CGCAGTGAAAATGCTTATCGTGCAGAAGTCCCCCTGTATGCCTCCATGCTGACACAGGCA
+ATGGACTATGACCGGATTGTGGCAGGCTCCCGCAGCCATCAGACCGGTGTAAATGGTGAA
+AACAACAGCGTCCGTCTCAGCATTCAGGGCGGTCATCTCGGTCACGATAACAATGGCGGT
+ATTGCCCGTGGGGCCACGCCGGAAAGCAGCGGCAGCTATGGATTCGTCCGTCTGGAGGGT
+GACCTGATGAGAACAGAGGTTGCCGGTATGTCTGTGACCGCGGGGGTATATGGTGCTGCT
+GGCCATTCTTCCGTTGATGTTAAGGATGATGACGGCTCCCGTGCCGGCACGGTCCGGGAT
+GATGCCGGCAGCCTGGGCGGATACCTGAATCTGGTACACACGTCCTCCGGCCTGTGGGCT
+GACATTGTGGCACAGGGAACCCGCCACAGCATGAAAGCGTCATCGGACAATAACGACTTC
+CGCGCCCGGGGCTGGGGCTGGCTGGGCTCACTGGAAACCGGTCTGCCCTTCAGTATCACT
+GACAACCTGATGCTGGAGCCACAACTGCAGTATACCTGGCAGGGACTTTCCCTGGATGAC
+GGTAAGGACAACGCCGGTTATGTGAAGTTCGGGCATGGCAGTGCACAACATGTGCGTGCC
+GGTTTCCGTCTGGGCAGCCACAACGATATGACCTTTGGCGAAGGCACCTCATCCCGTGCC
+CCCCTGCGTGACAGTGCAAAACACAGTGTGAGTGAATTACCGGTGAACTGGTGGGTACAG
+CCTTCTGTTATCCGCACCTTCAGCTCCCGGGGAGATATGCGTGTGGGGACTTCCACTGCA
+GGCAGCGGGATGACGTTCTCTCCCTCACAGAATGGCACATCACTGGACCTGCAGGCCGGA
+CTGGAAGCCCGTGTCCGGGAAAATATCACCCTGGGCGTTCAGGCCGGTTATGCCCACAGC
+GTCAGCGGCAGCAGCGCTGAAGGGTATAACGGTCAGGCCACACTGAATGTGACCTTCTGA
+CAGAACCATCGCCTCTCTGTGGTCCCGGTCATCATGACCGGGACCCGGACCGGCGCAACG
+GATCTTCAACGCCACATTCGCTGGCATTAACAATAACATGATATTCATCACGGAGTGACT
+ATGTTACAGATAGTCGGCGCGCTGATCCTGCTGATCGCAGGATTTGCCATTCTTCGCCTT
+TTGTTCAGAGCATTAATCAGCACGGCTTCTGCGCTGGCAGGGCTCATATTGCTGTGTCTG
+TTCGGCCCGGCCTTACTGGCTGGCTATATCACCGAACGCATAACCCGGTTGTTCCATATT
+CGCTGGCTGGCAGGCGTATTTCTGACGATTGCCGGAATGATCATCAGCTTCATGTGGGGA
+CTTGATGGTAAACATATCGCGCTGGAGGCTCACACCTTTGACTCTGTGAAATTTATTCTG
+ACCACCGCTCTCGCCGGTGGTCTGCTGGCTGTTCCCCTGCAGATCAAAAACATTCAGCAG
+AACGGGATCACACCAGAAGATATCAGCAAGGAAATTAACGGGTATTACTGCTGTTTTTAT
+ACTGCCTTTTTCCTTATGGCGTGTTCTGCATGCGCACCATTGATCGCGTTACAGTACGAT
+ATTTCACCGTCACTGATGTGGTGGGGCGGGTTGTTGTACTGGCTGGCTGCATTAGTGACG
+CTGCTATGGGCGGCCAGCCAGATCCAGGCGCTGAAAAAACTGACCTGTGCCATCAGCCAG
+ACACTGGAAGAACAACCGGTGCTCAACAGTAAATCGTGGCTGACCAGTTTGCAAAACGAT
+TACAGCCTTCCTGACTCACTGACGGAGCGCATCTGGCTGACGCTCATTTCTCAACGGATT
+TCCCGGGGAGAGCTGAGGGAATTTGAACTGGCAGACGGAAACTGGTTACTGAACAATGCC
+TGGTATGAAAGAAACATGGCAGGGTTTAACGAACAGTTGAAAGAGAACCTGTCATTCACA
+CCTGATGAACTGAAAACGCTCTTCCGGAACCGCCTGAATTTATCACCGGAAGCGAATGAC
+GATTTTCTCGATCGTTGCCTGGACGGCGGTGACTGGTATCCCTTTTCAGAAGGTCGCCGT
+TTTGTATCATTCCATCACGTGGATGAGCTTCGTATCTGTGCCTCCTGCGGGCTGACAGAA
+GTACATCATGCCCCGGAAAATCATAAGCCGGATCCGGAATGGTACTGCTCCTCTCTTTGT
+CGCGAAACAGAAACACTGTGTCAGGAAATTTATGAACGCCCTTACAACAGCTTTATTTCC
+GATGCAACGGCGAATGGTCTGATTCTCATGAAACTGCCGGAAACCTGGAGTACAAATGAG
+AAAATGTTTGCTTCCGGAGGGCAGGGACATGGGTTTGCCGCTGAACGGGGAAACCATATT
+GTCGACAGAGTCCGTCTGAAAAACGCACGGATCCTCGGTGATAATAATGCCAGAAATGGA
+GCAGACAGACTGGTCAGCGGAACAGAAATCCAGACGAAATATTGTTCAACTGCAGCCCGT
+AGCGTCGGTGCGGCATTCGACGGACAAAACGGACAGTATCGTTACATGGGAAATAATGGC
+CCCATGCAACTGGAAGTCCCCCGTGATCAGTATGCCGGCGCTGTTGAAACCATGAGGAAT
+AAGATCCGCGAAGGTAAAGTAGAGGAGAGATGACGCCCGGCGAGCGCAGCCTCATTCAAC
+GGGCCCTGAAAACCCTGGACCGCCATCTTCATGAACCCGGCGTGGCCTTCACCTCCACCC
+GTGCAGCACGGGAATGGCTGATTCTGAACATGGCGGGACTGGAGCGTGAAGAATTCCGGG
+TGCTGTATCTGAACAACCAGAATCAGCTGATTGCCGGTGAAACCCTCTTCACCGGCACCA
+TCAACCGCACGGAAGTCCATCCCCGGGAAGTGATTAAACGCGCCCTGTACCACAATGCCG
+CTGCCGTGGTACTGGCACACAATCACCCGTCCGGTGAAGTCACACCCAGTAAGGCAGACC
+GGCTTATCACCGAACGTCTGGTACAGGCACTGGGCCTGGTGGATATCCGGGTGCCGGACC
+ATCTGATAGTCGGTGGCAACCAGGTTTTCTCCTTTGCCGAACATGGTCTGCTTTAACCCT
+TCACAACCACATCACACCTGTTTTCACTTTTATCTTCTGTCTTCAGAGGTATCCCATTAT
+GAAAATTATCACCCGTGGTGAAGCCATGCGTATTCACCAACAACATCCGACATCCCGTCT
+TTTTCCGTTCTGTACCGGTAAATACCGCTGGCACGGCAGTGCTGAAGCGTATACCGGTCG
+TGAAGTGCAGGATATTCCCGGTGTGCTGGCCGTGTTTGCTGAACGCCGTAAGGACAGTTT
+TGGTCCGTATGTCCGGCTGATGAGCGTCACCCTGAACTGAGTGGGAATTCTGATGAGCAG
+AATTATCGCCACTACCGGACCATTCTTAGCCGATTTTCTGTAAGGATTTTATCGTGTCAG
+ACACACTCCCCGGGACAACACTTCCCGACGACAATCACGACCGCCCCTGGTGGGGGCTGC
+CCTGCACCGTGACGCCCTGTTTCGGGGCACGTCTGGTGCAGGAGGGTAACCGGTTGCATT
+ACCTTGCCGACCGCGCCGGTATCAGAGGCCTGTTCAGCGATGCAGATGCGTACCACCTGG
+ACCAGGCCTTTCCGCTGCTGATGAAACAACTGGAACTCATGCTCACCAGCGGTGAACTGA
+ATCCCCGCCATCAGCATACCGTCACGCTGTATGCAAAAGGGCTGACCTGCAAAGCCGATA
+CCCTCAGCAGTTGTGATTACGTTTATCTGGCTGTTTATCCGACGCCCGAAATGAAAAATT
+AACTCTCCAGAATAGCCTTCTGCTACGGCCTGGTGTTTTCACCACGCCACTTTTCCATTT
+TTATATCTGCATATCAGGAAAATCTTCAGTATGAAAACATTACCTGTATTACCCGGGCAG
+GCGGCCAGTTCTCGCCCGTCTCCTGTTGAAATCTGGCAGATACTGCTGTCCCGACTGCTG
+GACCAGCACTATGGCCTCACACTGAATGACACACCTTTTGCCGATGAACGTGTGATTGAG
+CAGCATATTGAGGCAGGCATTTCACTGTGTGATGCGGTGAACTTTCTCGTGGAAAAATAC
+GCGCTGGTGCGTACCGACCAGCCGGGATTCAGCGCCTGTACCCGCTCTCAGTTAATAAAC
+AGCATCGATATCCTCCGGGCTCGCAGGGCGACCGGCCTGATGACCCGCGACAATTACAGA
+ACGGTAAATAACATTACCCTGGGTAAGTATCCGGAGGCGAAATGATGACACTGGAAGCCG
+ACAGCGTTAACGTACAGGCGCTGGATATGGGGCACATTGTCGTTGACATTGATGGTGTTA
+ATATCACTGAACTGATTAATAAGGCCGCTGAAAACGGTTATTCACTCCGCGTGGTGGATG
+ACCGTGACTCTACCGAAACACCGGCAACTTATGCCAGCCCTCACCAGTTGCTGTAAGACA
+ATGCAGTGATACAGGGTATAGTGCCATTAACCACAGAAACAGCACTGTTGTCCTGTATTA
+AGCAGGCAAGAGAAGATGTCCTTACCCTGCGCCATCTGCAGCTTCTGCACCAGAACCGGT
+GAATCTCACTCAACAGGCTTCATTTCTCCTGACGCCAGCCTGAATACAGCTGGCGTTTTC
+ATTTATAAACAGAAAGGAAAACCGATAATAATGGAATGGACGCCCCGACCATGAAGCAAC
+GGTAGGATATTACTGATAAACCTTCCAGTGGAGGTGCGTTATGGCCGTTTTAACGATTAG
+CATTGACCTGACAAAAAATGAATTCCAAATCCACGGTCTGGGTAGGAACAGAAAAATCTA
+AGCTCAGAAAACGGATTAAAGTAAGCGTCAACGGAGCACCGTATTGACGCTTATTTATTG
+GTGAGAACTACGTTCCATGGCAGGAGTTCGTCAACACGGTTGGAGGGCCATTCCGGCAGT
+ATGCTCAGAATATGGCGCAGATACGCTTCCGGATCGATACCGTTCAGACGGCAGGTGCCT
+GCTTTTCTGGCAACAAGCAGGAATCTCAGCGCTGAAGCAGGAATTAGAGGTAAAAACGCC
+CTACCGGGCCATGAATCACCCGGTCATTGGAGTAGTAACCAAAGCAGATTTAGCCAGCAT
+GGAACAAATATCTTTGGTGAAAAGTTGGTTACGGGAAGCTGGAGCGCACAACGTGTTAGT
+AACCAGTGCAGTTAATAACAATGGAGTTACAGAACTTTTTGCCTTGCTGCATACAGAAGA
+AGGCTGTTGTTAATTTCGATTGGTTCTCGGATGAGAATGATGACGGTGATACACAGATAA
+GAATCAATGAGCAATGAGGGTTGCCGGGCAACCCTCATTGAATAAAACGGGAATTACTTC
+GCTTCGCCGTTTTTCATTTCGCCCATAGCTTTCAGCTTTTTGGAGATATCGCGGCGTTCT
+TTGGAGAGCTCGGCATTTTTGATGATGTAATCGTCAACGCGATCTTCATAGTCACCTTTC
+ATGCTGGCGATGATGCCCTGGATTGCTTCAACGCTCATCCCCGGCTTGATGTAATCGCTC
+AGGTTGTCCAGCAGCAGGACGCGCTTCTGGTTGTCACGGATCTTTTTCTCAACGTCCTGA
+ATTTCACGTTGCAGTTTGTTCTTACGACGGAACAGACGAACAAATTCCAGTACGTCCTGG
+AATGAAGGCTTGGTAGTTTCCATTTTTATACCCCTGATAATGTGAGAGTCGGATTCGTTT
+AAGCAACCGCTATTCGTTAGGGCCAACATTACTCATAGCTGCCGCAGATGACAATGCTTT
+TATCCCTTTTCACTATCATACCCTTTATCCTTGCTGAATCGAAGCAGCAGCAAGATGATT
+CTGAAGTTCAGGAATTATTTGCGCAAGGCCCGGCAAATCAGATTCGATAGCAACTCAAGC
+TGATGCGCCGTTTCCATGTTCAGCCACACATAACCATAGATTGGTGTTTCCACAACCTTC
+AGGTCATGGTGGTTATTGAGCAACTGACGCAGCTCTTCCACAGCATCGTTCAATTTTTCC
+GTATTGGCAAAAACCGGCTGCGGATTACCTTCGTACAGCGCATGAACAAGGCTCAGCAGT
+ATTTGCTGCATCATGTGCTGGGTATCACGAAGTTTTTGCGCGTTCAATAACACGAAATGG
+CTGGGGCGCGTGGCCCAGTATGCATTGATTTGCAACTCCAGCATACAAACCAGATTGCGG
+TTAATGGTCTGGATACCTTCATATATCGATTTTGGAATACGGGTTTCTTTGCTGGCGGGC
+GCAATCAGTCCACGCATTTTCACGGCATCGGTCAGGAGTTTTTGTAGATGGCTTTCCAGA
+CGTGGGCGTTCGAGTAAGTTCGGTGAGAATGCAGATTGATAGACCCGATTATACTCGGTC
+AGACTTTTCGCCAGTTGAATGCGCCAGTGGATGAACGCCCGTTGTGGCCAGATACCGGTA
+AACAACATTGCCAGTAAAGAGCCGAGGATCACATCGCCGCTTCGCCATAACGCCGTATCA
+ATTTCACCTGTCGGGGAACCCACAACAATTGCCAGCGTCACCCCAATCAATAAACCTTGA
+TACGGTTTCTTGCCCAGCGCCAGCCAACCGCAAAGGAACATGGCCGCCGCGCACCAGACT
+AACATCAGCGGTAACGAGATTAACTCCAGTTGCAGAGCGATAAGACCTAAAATCGAACCC
+AACACCGTACCGCCAATACGCTCAAAGGCGCGAGGGACAACGTTACCCCAGAACGAGATT
+GGCCCCATAATCACCACCATGGTGACCAGCGGCCAGGTGCTTTCCGGGATAGTAAACAGG
+CGGATAATGAGAAAAGTGAGCAGGAATGCCAGCGCGACCCGAGTACCATGCACAATGCGG
+TAATGGCGGTATACCCGGATTTCAAACGGGCTTAATGACTTATCGGCACGCACGCAGAAA
+CTCCGTAATGAGATTAAAAGCGCTCATAACTCATCTGTCGGCCAGAAGGCGCGCCTCTGA
+ATTATCCGACGGACAAACCGGGAACAGTGTAATTTCCCGGCAGGAGCGAAAAAATTGAAA
+GGCGCATCTTACTCTTTTCGCTTTCAAAAAAAAGAGTGGTCATCGCGTTAACACACCGCC
+CTGAGATGAATTAGTGATGTTTTGGCTGCACCGCAACATACATTTCGATATCCCAGTACC
+CATCTTCCGCGCCATTGTTCAAATAAACCTCGAAGCAGGGCTTTGGTAACATTTCATAAG
+CACTGTCCTGCAAGAGACTATTAAAGAACTGATACCAGGGTTTAGCAAAATCATCACCGA
+CTACACGAGCTACCGCCACCGCATACTGACCACCTGTAATTTCTGTCAGAATGACGCCCT
+CACTGTTTTCGGGAAGCGTAAAGTAACCCGGCACCGTCACGACGGTGTCGCAGCGTAATT
+TTTCGGCGGGTGTTTCATCTGGATTGTCGTAATAGACAGCAACCCACTCCTTCGGCACAA
+TATTTTTGCTATCTACCCACATCATCAACTGCTCAAAGCCTTTCTTTACCGTCTGTTCCC
+ACGGGCCAACGAGATGGAAACCTGCAACGGTACGTTTCTCTTCCTGCTTAATCTCGTAGT
+TCATGACGCCTCCATTGATACTGTTTTTATATACAGTATAGTTGCAAAATTAAAACCACA
+AGGAATGAGTGTTGATTATGCGAGCAGACTCGCACTCCTGCCAGTCTGCTGCAAAAGAAA
+GGTCAGGCCTTATGGTGGAAATAATCACTCAGGCGAGAAAACATGCTGCCTTCCCCGACA
+GATTCCAGGGTAACCAGCGGCCAGTGCGCCACCTGTTTATCACGGTCGTAAAGTTCAATT
+TCCCCTACCCGCTGATGGGCGCTAATTGGCGCGGTGAGTTCTTTACCATCAAGGGTATAT
+TTGGCTTTGATATGTGGAATTTCGGCTTTCGGTAGCACCATCCAGAACTCTTGTTCCGTT
+CCCAGGTCGATATTTTCTTTATCGCCATACCAGATGCGTTCCGTTCCGACCTTTTTCCCA
+CGGTGCAAAATTTGCACCGTAGTAAAGTTTTGTTGCCCCCAACGCAGTAATTTTCTTGCC
+TCTTCCTCACGACCTTTTGCACTGTCAGCCCCCATTACCACTGCAATGAGACGACGCTGC
+CCATCTACAGCCGAAGCAATGAGATTAAACCCGGCACCAGAAGTATGACCCGTTTTCAGG
+CCGTCAACATTCATGGTTTTATCCCACAACAACCCGTTACGGTTTTGCTGGGTGATACCG
+TTCCAGGTGAGACTTTTCTCACTGTACATATGATAAAACTCGGGCTCGCCGTGGATGATA
+GCACGAGAAAGCACAGCTAAATCATAAGCCGAGCTATGCTGGCCAGGTGCATCCAGACCA
+TGCACTGTTTCAAAATGCGTATCCTTGAGATGCAGCTTCTCGGCATAGTTGTTCATCATT
+TCAACAAACTGCCGTTGCCCACCGGCAATATAGTCAGCCAGAGCAACACAAGCGTCATTT
+CCGGAATCCACAATTAAACCACGGCTTAAATCACGTACCGATACGCGATCGCCCTCTTTC
+AAAAACATCAGTGAAGAACCGACAAACACCGGATTATCTTTCGCCCACGCATCGCGCCCC
+ACGGTGACAATATCGTCTGGCGTAATGCGATGACTATCGATAGCGCGATCCACGACATAA
+CCCGTCATCAGCTTTGTCAGGCTGGCGGGATTGCGCTGTTGATGCTCATTACCCGCGGTG
+AGGATCTGACCGGTGGTGTAATCCATCAATACCCAGGACCCGGCATGAATCTCTGGAGGC
+TGAGGTGAAAAAGGAATGTTTTCCGCCGCAAAACCAGACGATAAGTTAAAAACGAACAAA
+GAAGCAGCAATAATAAGACGGCGTTTCAACAGCAAACCCTCAGGAGTTTCAAATAGCTGT
+TCTTTTTACGGAAATACTTATGAACTGGCTGGAATAAAGTGCAAGAAAATGTGACTACCC
+TCTCATTTTTATCTGACATGATCTGTTGCCACTCGCTGCCAAATTGTGGCGCTAAAGCTG
+ATTAGCACGGTGATATTTGATACTCTGGCAGACAGCAGAAATAACGGATTTAACCTAATG
+ATGAATGACGGTAAGCAACAATCTACCTTTTTGTTTCACGATTACGAAACCTTTGGCACG
+CACCCCGCGTTAGATCGCCCTGCACAGTTCGCAGCCATTCGCACCGATAGCGAATTCAAT
+GTCATCGGCGAACCCGAAGTCTTTTACTGCAAGCCCGCTGATGACTATTTACCCCAGCCA
+GGAGCCGTATTAATTACCGGTATTACCCCGCAGGAAGCACGGGCGAAAGGAGAAAACGAA
+GCCGCGTTTGCCGCCCGTATTCACTCGCTTTTTACCGTACCGAAGACCTGTATTCTGGGC
+TACAACAATGTGCGTTTCGACGACGAAGTCACACGCAACATTTTTTATCGTAATTTCTAC
+GATCCTTACGCCTGGAGCTGGCAGCATGATAACTCGCGCTGGGATTTACTGGATGTTATG
+CGTGCCTGTTATGCCCTGCGCCCGGAAGGAATAAACTGGCCTGAAAATGATGACGGTCTA
+CCGAGCTTTCGCCTTGAGCATTTAACCAAAGCGAATGGTATTGAACATAGCAACGCCCAC
+GATGCGATGGCTGATGTGTACGCCACTATTGCGATGGCAAAGCTGGTAAAAACGCGTCAG
+CCACGCCTGTTTGATTATCTCTTTACCCATCGTAATAAACACAAACTGATGGCGTTGATT
+GATGTTCCGCAGATGAAACCCCTGGTGCACGTTTCCGGAATGTTTGGAGCATGGCGCGGC
+AATACCAGCTGGGTGGCACCGCTGGCGTGGCATCCTGAAAATCGCAATGCCGTAATTATG
+GTGGATTTGGCAGGAGACATTTCGCCATTACTGGAACTGGATAGCGACACATTGCGCGAG
+CGTTTATATACCGCAAAAACCGATCTTGGCGATAACGCCGCCGTTCCGGTTAAGCTGGTG
+CATATCAATAAATGTCCGGTGCTGGCCCAGGCGAATACGCTACGCCCGGAAGATGCCGAC
+CGACTGGGAATTAATCGTCAGCATTGCCTCGATAACCTGAAAATTCTGCGTGAAAATCCG
+CAAGTGCGCGAAAAAGTGGTGGCGATATTCGCGGAAGCCGAACCGTTTACGCCTTCAGAT
+AACGTGGATGCACAGCTTTATAACGGCTTTTTCAGTGACGCAGATCGTGCAGCAATGAAA
+ATTGTGCTGGAAACCGAGCCGCGTAATTTACCGGCACTGGATATCACTTTTGTTGATAAA
+CGGATTGAAAAGCTGTTGTTCAATTATCGGGCACGCAACTTCCCGGGGACGCTGGATTAT
+GCCGAGCAGCAACGCTGGCTGGAGCACCGTCGCCAGGTCTTCACGCCAGAGTTTTTGCAG
+GGTTATGCTGATGAATTGCAGATGCTGGTACAACAATATGCCGATGACAAAGAGAAAGTG
+GCGCTGTTAAAAGCACTTTGGCAGTACGCGGAAGAGATTGTCTAATTTGAAGCCTCCGCC
+GCTGGTACGGCGGAGGACAATGTTGAGTCAGGCTTTTTGAACGGTGATGCTCCACGCTGC
+ATCGCCAATCTGCTGATAATCGGTGATGGCATGTCCTTCTTCTGCCGCCCACTGTGGGAT
+TGCTTCAGTTGCCTGGGTGCAATCAAACTCAATCACTAACTCATCGCCGCTGACCATTTC
+TGCCAGAGCTGCTTTTGCTTCTATGAGTGGAAACGGACAGACCTGCGTCACCACATCCAG
+CTTTTTAATCACCATCTTTACACCTTACTTAATTTGCCGCAGCAGTTGCCAGTCGCGCCT
+TACGCTGCGGTCGAACATACACAAGCCAGGACGCAGTCCAGACTCCGAGAATCATAAATA
+CAAGGCCAATCCAGCCCTGCCAGGTCATCATTGCAGTCATAACCAGTCCATTACCGATAG
+AGCAACCACCTGCAATACTGGCACCGAAGCCCATCAGTACACCACCTAACCCGCTACGTA
+ATGTTGTTTGTGCATCAGCTGCGCGAACGCGGAACTCACGGCTCGCTTTGGCTGCAATAA
+ATGACCCCACGAAGATCCCTAACACCAGGAAAACGCCCCAGTTAATGTATTTCATGTCAC
+CCGCGACCAGAAATTGCAGAATATTGGCCGTTGGGGAAGTGATTCCTAACCCAAACATGC
+GTCCGGTTGCTTCACTCAGGGGCCAGGCTAAAAGCGCAATCAAACCGATGAGTACAGCTG
+TGACAAAGGGATGCCAGCGTTTTTCAAACAGAATATGAGCGATCCCGGTTCGGCGCGGCG
+GTAAGGTCGCGACTTTGAGTTTTGGCTTCTTCAACTCTTTCATCACCACCCAGAGCGTTA
+TCACCAGCAAAACGGCAACCAACGGCCACACAGACAAATTAAAAGTCTCAGCAATAGAGT
+TATGTTCAGTACTGTAGTGCTGCAAGGTTTGATTTAAACCACTGGCATGTGGAGAACGCA
+TCACCGCACTCATCACCATATAAGTGAAAAGCGCGATCCAACTGCCGATCAATCCCTCAC
+CCGCGCGATACCAGGTCCCGGTGGCACATCCACCCGCCAGAACAATTCCCAGCCCGAAGA
+TATACCCACCTATAACAGTACCAAGCCACGGGAACGCCCCGGCTTCGTAAGTCAGTAGGC
+CCGCCTGAATTAACGCAAAAACCCCCACGCTTTGTACCGAAATTGCAATCAGCAAGGCGT
+AAAACATGCGATTATTTTTCACGATATACATATCGCGAAAACCACCTGTCAGGCAAAAAC
+GCCCACGCTGCATGACAAATCCCAGCAGAGCACCACAAATTAGCCCGCTTAATATCATTG
+AAAACATAAATTAATTAACCAGATGAATGTTAATGAGGAAATTATTCATGACTGGTGGAA
+TGCAGACCAATAACCAAATTCTCTAAATTAGAACAAATGGTTATTAATGAGGAGTTCGAT
+ACAAAAGAATAAAAAAACCGGAGCCAAATGTTCATTCGACTCCGGTTTATTATTAGAAAA
+GATGATTATGCTACGTCTTCGTACTGCGGAACCGGATTACGGAAGCTCTTGGTGACGCAA
+GCCAGGTAAATCAGACCGATAGCAGCCCAGATCAGACCCAGAACCATTGAGCTTTCTTCC
+AGGTTAACCCACAGCGCACCAACGGTCAGCGCACCACACATCGGCAGGAACAGATACTGG
+AAGTGATCTTTCAGCGTCTTGTTACGCTTCTCACGGATCCAGAACTGCGAGATGACCGAC
+AGGTTAACGAAAGTGAACGCCACCAGCGCACCAAAGTTAATCAGCGCCGTTGCCATTACC
+AGGTCGAAGTTGATTGCCAGCAGGGCAATCGCGCCAACCAGGATGATGTTCATCGCCGGA
+GTACGCCATTTCGGGTGTACATAACCGAAGAAGCTTTTCGGGAATACGCCGTCACGACCC
+ATTACGTACATCAGACGCGCTACGCCTGCATGCGCCGCCATACCGGACGCCAGTACGGTA
+ATGGTGGAGAAGATCAGCGCGCCAACCTGGAACGCTTTACCCGCAACGTACAGCATGATT
+TCAGGCTGTGACGCATCCGGATCTTTAAAGCGAGAGATATCCGGGAAGTACAGCTGCAGG
+AAGTAAGTTGCAAAGATGAAGATCATGCCGCCGATCAGCGCGGTCAGGAAAATCGCACGC
+GGGATCACGCGCTCTGCATCTTTGGTTTCTTCCGACAGGTTGCTGATGCCGTCAAAGCCG
+GTAAAGGAGAAGCACAGGATTGTCGCCCCGGTAATCATCGGGATAACATGCGCATCGCCA
+GACCAGAATGGACGAGTGCTCGCCAGCGTACCAGCGCCTTCACCTTCAAATACGCCATAA
+ACAACCATGCCCAGAATCACCGCGATCAGCACTACCTGCAACACGACGATTACAGTGTTG
+AAGTTCGCTACGGATTTCAGACTACGCAGGTTAAAGGCGGTCATAAAGGCCACCAGCGCC
+ACCACAAACATCCACGATGGGATGGAAGGCACCAGAGCTTCAAAATAGATTTTCGCCAGT
+AGAATGTTGATCATCGGCGCGAACAGATAGTCGAGCAGAGAAGACCAACCCACCATAAAG
+CCGACAGTCGGGCTAATGGATTTCTGGGCGTAAGTGTATGCAGAGCCAGCAGAAGGATAG
+CGGCGAACCAGCTTCCCGTAGCTCAGAGCCGTAAACAGGATCGCAATCAATGCGAACGCA
+TAGGCTGTCGGCACATGACCATCCGTGAGGCCTGAAACGATACCAAAAGTATCAAACAGC
+GTCATCGGCTGCATATAGGCAAGACCCATCATTACAACCGGAACTAACGTAAGCGTTTTA
+CGCAATTCCACGCGAGAGGTGTTTGGAGTAACGTTATGCGACATGGTCATTCTCCTTTAC
+GGTGATAACCGTCGCGTAAGCAAAAAATTGCCCCATTTTTTTGGATTCCTCAGCGACAAC
+AACTGTCGATTTTTAGTAAATATCTATCCGGTACGAAGCCCGGCCTCTTGGTATGAATGA
+TTGGTTTGAAGCAAAAAATAACCGACGCTGATGAAACGTCGGTTTTTAGTCATTTTTTGA
+CAGCGGCGCATTGTGCCTAAATGGGGGGGAAATGACAAGAGAATGAGAGGCTTGTCAGAA
+TAATTTTTCTTTAAATGGCTGATTTTCCGTCATCAGATTTTGCATAAACACCGGCGATCG
+CACTATTTGCTAAAATTTCATCCCGCCACCAGCCACTGGCAAGTCCTGCGGTCTGTTCGT
+TCCAGCCAATCCAGACGGGTTCAAAGAGAGTTTGGGCGACCACTTTCTTCTCGATTAACG
+CGCCACTATCGAGAAAACGTTGCGCCAGATAACGGGGTAAATAGCCGCAGCCGAGGCCGC
+TAATTTGCAGCTCCAGTTTGGTTTTAAAATCGAAAACGGTAATGGCTTCTTGTTCGTCGA
+GAAGTTGTGATGCCGTAGAAGCGCCTGCCTGCGCAGTATCCCCCACCACAATCGCCCGAT
+ATCGCTTAATAATACGACGATTTAACGGCTCTTCTTCCAGGGCTAACGGATGATGAGGCG
+CGACCGCAAAGACTTGTTCCAGATCGCCCAACCGTGAAAAACCAAACTCACTGGAAGATG
+GTGGCTCATGCATCGCGCCAACAATAATATCCGCTCGCCCCTGAGTCAGGGCATCCCATG
+AACCACCGAGTACGCCATTGATAAACTTCAGGCGCGTCACGCTATGATGTTGATAAAAAG
+CTTCAATGAGTGGCGCAAGCAGAGAAAAAGGAAACGTGTCGTCCACGCCAATCACCAGCT
+CGTTTTCCCAGCCTTCATGCAGTTTGATCGCCTGCTTTTCCAGTTCCCGCACGGTATGCA
+GAACTTCCCGCCCTTTCTCTAATAACATTTTTCCGGTGCGGGTGAATTTAGCGCGGTGTC
+CGCTACGATCAAGCAATTGAATATTAAGGTCGCTTTCCAGCTTGTGAACGGTGTAACTCA
+GAGCGGACGGCGTCTTGTAGAGTTTGGCCGACGCCGCCGCAAAACTGCCTTCTTTTTCTA
+AGGCATCGAGGATCATCAACACATCCAGCAGTGGTTTCATACACGCCCCCTTGCAGTGCA
+TGCGGCGTCCTGCTGGCGTGATCGTTTACTCCAGCGGCATTACCAGCGGATCGGGATACT
+GGTATTCAAATCCCAGTTCATTACAAATCCGACTGCCATCAATAATCTTACCTTTGCCGC
+TGTCCAGACTATTTCTGAACTGCGGAGGTTCCAGCCCCAGTAAACGGGCCATCTGCGGAT
+AGAAAACATTACGCGCAGGGTGAGCTGGCGCACATATATTATAGATGTGTCCGCCTTTAG
+GTGCCTGTAACAACAGAGTGATAGCGCCAATAACATCTTCTAAATGGACTAAATTAACAC
+CATGTTCACCATCAGGCGCGGTTTTTCCGGCAAAGAAGCGTCCGGGATGACGTCCCGGTC
+CGACCAGGCCCGCAAGACGCAGAATATCGACCGAAGTACCGGGTAAATTGTGCAGCCAGT
+CTTCGAGTTCTTCTAATACTCGTCCACTGTTGGTTACTGGATTACGCGGGGTGGTTTCTT
+TCACCGTGCCTTGCGCGTCGCCATAGACAGATGTTGAGCTGGTAAAAATAATGCGGGGAA
+TACGATGGGCCAGCGCGCTATCCACTAACTCTTGTACCGCTTGTAAATAGAACTCATCGC
+CGGGGCCGCTACGACGTGCCGGAAGCGTAATGACCAGCGCATCGGCATCCATCAGGGCAT
+CCAGATCGTCAGAATCGCAAACTAGCTCAGGCTCCATGCGAAGCAGATAGCTATCAATGC
+CACTCATTCGGGCCGCTTCGACACCATCTTGTGTGGTTTTACTCCCGGTGACTTGCCAGC
+CTCGCGCTGAAAGTGACATCGCCAGCGGCATGCCTAACCACCCTAACCCGACAATTGCGA
+CCTTTTTCATCCGTTATCTCCTGATACACCTTAGATCTATAAGGCTACGCTAGCGTATCA
+AAACTGACAATTCATTCTATGAATGAATCTGTTCAATAATGATAACGACATGCTGCAATG
+AGCAGTGAATCGTCGGTAACCGCGTATACCAGACGGTGCTCCTCTGTAATGCGTCGGGAC
+CAGAAACCTGACAAATTATGTTTCAGGGGTTCTGGCTTCCCCTTACCTTCAAATGGCGTT
+CTGCGGGTATCTTTGATAAGTTCATTGATCTTTTTAACAATTCGCTTATCTGTTTCCTGC
+CAGTACAGATAATCGTCCCATGATTCCTCAGACCAGATTAGTTTCACTCAATGATGTCCT
+TTTCCGTTCCTTTGCCTGATTTCAGGCTATCGATTGAGTCCATCAATCTCCGGGCGTTAG
+CGGGGGAGCGCAGTAGATAAGCCGTCTCTTCCAGCGAGTTGTATTCTTCGAGTGACATCA
+GAACACAAGCCTCTCCATTCTGACGAGTAATAAGGATCGGGGCATGATCTTCAACGGCTT
+TCATCATTGTTGCCGACAAATTCTGACGCGCTTCGCTGTAGCTAATTGTACGCATGTCAA
+TCTCCTCTTTTGTACAGTTCATTGTACAATGATGAGCGTTAATTAACTATTTATTAATTA
+GTTTGTAGATCAAGGTATTGTCAGTGAGACGAAAATCCAGGCTTCGCTATTTTTGGTGCC
+ATCAGCTAAGAGGACAGTCCTCTTAGCCCCCTCCTTTCCCCGCTCATTCATTAAACAAAT
+CCATTGCCATAAAATATATAAAAAAGCCCTTGCTTTCTAACGTGAAAGTGGTTTAGGTTA
+AAAGACATCAGTTGAATAAACATTCACAGAGACTTTTATGACACGCGTTCAATTTAAACA
+CCACCATCATCACCATCATCCTGACTAGTCTTTCAGGCGATGTGTGCTGGAAGACATTCA
+GATCTTCCAGTGGTGCATGAACGCATGAGAAAGCCCCCGGAAGATCACCTTCCGGGGGCT
+TTTTTATTGCGCGGTTGATAACGGTTCAGACAGGTTTAAAGAGGAATAACAAAATGACAG
+ACAACACTCGTTTACGCATAGCTATGCAGAAATCCGGCCGTTTAAGTGATGACTCACGCG
+AATTGCTGGCGCGCTGTGGCATTAAAATTAATCTTCACACCCAGCGCCTGATCGCGATGG
+CAGAAAACATGCCGATTGATATTCTGCGCGTGCGTGACGACGACATTCCCGGTCTGGTAA
+TGGATGGCGTGGTAGACCTTGGGATTATCGGCGAAAACGTGCTGGAAGAAGAGCTGCTTA
+ACCGCCGCGCCCAGGGTGAAGATCCACGCTACTTTACCCTGCGTCGTCTGGATTTCGGCG
+GCTGTCGTCTTTCGCTGGCAACGCCGGTTGATGAAGCCTGGGACGGTCCGCTCTCCTTAA
+ACGGTAAACGTATCGCCACCTCTTATCCTCACCTGCTCAAGCGTTATCTCGACCAGAAAG
+GCATCTCTTTTAAATCCTGCTTACTGAACGGTTCTGTTGAAGTCGCCCCGCGTGCCGGAC
+TGGCGGATGCGATTTGCGATCTGGTTTCCACCGGTGCCACGCTGGAAGCTAACGGCCTGC
+GCGAAGTCGAAGTTATCTATCGCTCGAAAGCCTGCCTGATTCAACGCGATGGCGAAATGG
+AAGAATCCAAACAGCAACTGATCGACAAACTGCTGACCCGTATTCAGGGTGTGATCCAGG
+CGCGCGAATCAAAATACATCATGATGCACGCACCGACCGAACGTCTGGATGAAGTCATCG
+CCCTGCTGCCAGGTGCCGAACGCCCAACTATTCTGCCGCTGGCGGGTGACCAACAGCGCG
+TAGCGATGCACATGGTCAGCAGCGAAACCCTGTTCTGGGAAACCATGGAAAAACTGAAAG
+CGCTGGGTGCCAGTTCAATTCTGGTCCTGCCGATTGAGAAGATGATGGAGTGATCGCCAT
+GAGCTTTAACACAATCATTGACTGGAATAGCTGTACTGCGGAGCAACAACGCCAGCTGTT
+AATGCGCCCGGCGATTTCCGCCTCTGAAAGCATTACCCGCACTGTTAACGATATTCTCGA
+TAACGTGAAAGCACGCGGCGATGAGGCCCTGCGGGAATACAGCGCGAAGTTTGATAAAAC
+CACGGTTACCGCGCTGAAGGTGTCTGCAGAGGAGATCGCCGCCGCCAGCGAACGCCTGAG
+CGACGAGCTAAAACAGGCGATGGCGGTGGCAGTAAAGAATATTGAAACCTTCCACACTGC
+GCAAAAACTGCCGCCGGTAGATGTAGAAACGCAGCCAGGCGTGCGTTGCCAGCAGGTCAC
+GCGTCCGGTAGCTTCAGTTGGGTTGTATATTCCTGGCGGCTCCGCCCCGCTCTTCTCAAC
+GGTATTAATGCTGGCGACTCCGGCGAGTATTGCGGGCTGTAAAAAAGTGGTGCTGTGCTC
+ACCGCCGCCGATTGCCGATGAGATCCTTTATGCGGCGCAGCTGTGCGGTGTGCAGGACGT
+GTTTAACGTCGGCGGCGCACAGGCCATTGCCGCACTGGCGTTTGGTACGGAATCTGTGCC
+AAAAGTGGACAAAATCTTCGGGCCGGGTAACGCCTTTGTCACCGAAGCGAAACGTCAGGT
+GAGCCAGCGTCTGGACGGTGCGGCGATCGATATGCCCGCAGGCCCGTCGGAAGTGCTGGT
+GATTGCTGACAGCGGCGCTACGCCGGATTTCGTGGCTTCTGATTTGCTCTCTCAGGCTGA
+ACACGGCCCGGACTCACAGGTGATTTTACTGACGCCCGCTGCTGATATGGCGCGTCGCGT
+TGCCGAGGCCGTCGAACGCCAACTGGCAGAACTGCCGCGTGCCGAAACCGCCCGCCAGGC
+ACTGAACGCCAGCCGCCTGATCGTGACTAAAGATTTAGCGCAGTGCGTGGAGATCTCCAA
+CCAGTACGGCCCGGAGCACCTGATCATTCAGACCCGCAACGCCCGTGAACTGGTCGATAG
+CATCACCAGCGCCGGTTCGGTATTTCTTGGTGACTGGTCACCGGAATCGGCAGGTGATTA
+CGCCTCCGGCACCAACCACGTTCTACCGACTTACGGTTACACCGCCACCTGTTCCAGCCT
+CGGGCTGGCAGATTTCCAGAAGCGCATGACCGTACAGGAACTGTCGAAAGAGGGGTTCTC
+CGCGCTGGCTTCAACCATAGAAACACTGGCCGCCGCCGAGCGCCTGACCGCCCACAAAAA
+TGCCGTTACTTTGCGTGTTAACGCCCTTAAGGAGCAAGCATGAGCACCGTGACTATTACC
+GATTTAGCGCGTGAAAACGTCCGCAACCTGACGCCGTATCAGTCGGCGCGTCGTCTGGGC
+GGTAACGGCGATGTCTGGCTGAACGCCAACGAATACCCCACTGCCGTGGAGTTTCAGCTT
+ACTCAGCAAACGCTCAACCGCTACCCGGAATGCCAGCCGAAAGCGGTGATTGAAAATTAC
+GCGCAATATGCAGGCGTAAAACCGGAGCAGGTGCTGGTCAGCCGTGGCGCGGACGAAGGT
+ATTGAACTGCTGATTCGCGCTTTTTGCGAACCGGGTAAAGACGCCATCCTCTACTGCCCG
+CCAACGTACGGCATGTACAGCGTCAGCGCCGAAACGATTGGCGTCGAGTGCCGCACAGTG
+CCGACGCTGGACAACTGGCAACTGGACTTACAGGGCATTTCCGACAAGCTGGACGGCGTA
+AAAGTGGTTTATGTTTGCAGCCCCAATAACCCGACCGGGCAACTGATCAATCCGCAGGAT
+TTTCGCACCCTGCTGGAGTTAACCCGCGGTAAGGCGATTGTGGTTGCCGATGAAGCCTAT
+ATCGAGTTTTGCCCGCAGGCATCGCTGGCTGGCTGGCTGGCGGAATATCCGCACCTGGCT
+ATTTTACGCACACTGTCGAAAGCTTTTGCTCTGGCGGGGCTTCGTTGCGGATTTACGCTG
+GCAAACGAAGAAGTCATCAACCTGCTGATGAAAGTGATCGCCCCCTACCCGCTCTCGACG
+CCGGTTGCCGACATTGCGGCCCAGGCGTTAAGCCCACAGGGAATCGTCGCCATGCGCGAA
+CGGGTAGCGCAAATTATTGCAGAACGCGAATACCTGATTGCCGCACTGAAAGAGATCCCC
+TGCGTAGAGCAGGTTTTCGACTCTGAAACCAACTACATTCTGGCGCGCTTTAAAGCCTCC
+AGTGCGGTGTTTAAATCTTTGTGGGATCAGGGCATTATCTTACGTGATCAGAATAAACAA
+CCCTCTTTAAGCGGCTGCCTGCGAATTACCGTCGGAACCCGTGAAGAAAGCCAGCGCGTC
+ATTGACGCCTTACGTGCGGAGCAAGTTTGATGAGTCAGAAGTATCTTTTTATCGATCGCG
+ATGGAACCCTGATTAGCGAACCGCCGAGTGATTTTCAGGTGGACCGTTTTGATAAACTCG
+CCTTTGAACCGGGCGTGATCCCGGAACTGCTGAAGCTGCAAAAAGCGGGCTACAAGCTGG
+TGATGATCACTAATCAGGATGGTCTTGGAACACAAAGTTTCCCACAGGCGGATTTCGATG
+GCCCGCACAACCTGATGATGCAGATCTTCACCTCGCAAGGCGTACAGTTTGATGAAGTGC
+TGATTTGTCCGCACCTGCCCGCCGATGAGTGCGACTGCCGTAAGCCGAAAGTAAAACTGG
+TGGAACGTTATCTGGCTGAGCAAGCGATGGATCGCGCTAACAGTTATGTGATTGGCGATC
+GCGCGACCGACATTCAACTGGCGGAAAACATGGGCATTACTGGTTTACGCTACGACCGCG
+AAACCCTGAACTGGCCAATGATTGGCGAGCAACTCACCAGACGTGACCGTTACGCTCACG
+TAGTGCGTAATACCAAAGAGACGCAGATTGACGTTCAGGTGTGGCTGGATCGTGAAGGTG
+GCAGCAAGATTAACACCGGCGTTGGCTTCTTTGATCATATGCTGGATCAGATCGCTACCC
+ACGGCGGTTTCCGCATGGAAATCAACGTCAAAGGCGACCTCTATATCGACGATCACCACA
+CCGTCGAAGATACCGGCCTGGCGCTGGGCGAAGCGCTAAAAATCGCCCTCGGAGACAAAC
+GCGGTATTTGCCGCTTTGGTTTTGTGCTACCGATGGACGAATGCCTTGCCCGCTGCGCGC
+TGGATATCTCTGGTCGCCCGCACCTGGAATATAAAGCCGAGTTTACCTACCAGCGCGTGG
+GCGATCTCAGCACCGAAATGATCGAGCACTTCTTCCGTTCGCTCTCATACACCATGGGCG
+TGACGCTACACCTGAAAACCAAAGGTAAAAACGATCATCACCGTGTAGAGAGTCTGTTCA
+AAGCCTTTGGTCGCACCCTGCGCCAGGCCATCCGCGTGGAAGGCGATACCCTGCCCTCGT
+CGAAAGGAGTGCTGTAATGAACGTGGTGATCCTTGATACCGGCTGCGCCAACCTGAACTC
+GGTGAAGTCTGCCATTGCGCGTCACGGTTATGAACCCAAAGTCAGCCGTGACCCGGACGT
+CGTGTTGCTGGCCGATAAACTGTTTTTACCCGGCGTTGGCACTGCGCAAGCGGCGATGGA
+TCAGGTACGTGAGCGCGAGCTGTTTGATCTCATCAAAGCCTGTACCCAACCGGTGCTGGG
+CATCTGCTTAGGGATGCAACTGCTGGGGCGGCGCAGCGAAGAGAGCAACGGCGTCGACTT
+GCTGGGCATCATCGACGAAGACGTGCCGAAAATGACCGACTTTGGTCTGCCACTGCCACA
+TATGGGCTGGAACCGCGTTTACCCGCAGGCAGGCAACCGCCTGTTTCAGGGGATTGAAGA
+CGGCGCGTACTTTTACTTTGTTCACAGCTACGCAATGCCGGTCAATCCGTGGACCATCGC
+CCAGTGTAATTACGGCGAACCGTTCACCGCGGCGGTACAAAAAGATAACTTCTACGGCGT
+GCAGTTCCACCCGGAGCGTTCTGGTGCCGCTGGTGCTAAGTTGCTGAAAAACTTCCTGGA
+GATGTGATGATTATTCCGGCATTAGATTTAATCGACGGCACTGTGGTGCGTCTCCATCAG
+GGCGATTACGGCAAACAGCGCGATTACGGTAACGACCCGCTGCCGCGATTGCAGGATTAC
+GCCGCGCAGGGTGCCGAAGTGCTGCACCTGGTGGATCTGACCGGGGCAAAAGATCCGGCT
+AAACGTCAAATCCCGCTGATTAAAACCCTGGTCGCGGGCGTTAACGTTCCGGTGCAGGTT
+GGCGGCGGCGTGCGTAGCGAAGAAGATGTGGCGGCGTTACTGGAAGCGGGCGTTGCGCGC
+GTAGTGGTCGGCTCCACCGCGGTGAAATCACAAGATATGGTGAAAGGCTGGTTTGAACGC
+TTCGGTGCCGATGCCTTAGTGCTGGCGCTGGATGTCCGTATTGACGAGCAAGGCAACAAG
+CAGGTGGCAGTCAGCGGCTGGCAAGAGAACTCGGGCGTTTCACTGGAACAACTGGTGGAA
+ACCTATCTGCCCGTCGGCCTGAAACATGTGCTGTGTACCGATATCTCGCGCGACGGCACG
+CTGGCAGGCTCTAACGTCTCTTTATATGAAGAAGTGTGCGCCAGATATCCGCAGGTGGCA
+TTTCAGTCCTCCGGCGGTATTGGCGACATTGATGATGTGGCGGCCCTGCGTGGCACTGGT
+GTGCGCGGCGTAATAGTTGGTCGGGCATTACTGGAAGGTAAATTCACCGTGAAGGAGGCC
+ATCGCATGCTGGCAAAACGCATAATCCCATGTCTCGACGTTCGTGATGGTCAGGTGGTGA
+AAGGCGTACAGTTTCGCAACCATGAAATCATTGGCGATATCGTGCCGCTGGCAAAACGCT
+ACGCTGAAGAAGGCGCTGACGAACTGGTGTTCTACGATATCACCGCTTCCAGCGATGGCC
+GTGTGGTAGATAAAAGCTGGGTATCTCGCGTGGCGGAAGTGATCGACATTCCGTTTTGTG
+TGGCGGGTGGGATTAAGTCTCTGGAAGATGCCGCGAAAATTCTTTCCTTTGGCGCGGATA
+AAATTTCCATCAACTCTCCTGCGCTGGCAGACCCAACATTAATTACTCGCCTGGCCGATC
+GCTTTGGCGTGCAGTGTATTGTGGTCGGTATTGATACCTGGTACGACGCCGAAACCGGTA
+AATATCATGTGAATCAATATACCGGCGATGAAAGCCGCACCCGCGTCACTCAATGGGAAA
+CGCTCGACTGGGTACAGGAAGTGCAAAAACGCGGTGCCGGAGAAATCGTCCTCAATATGA
+TGAATCAGGACGGCGTGCGTAACGGTTACGACCTCGAACAACTGAAAAAAGTGCGTGAAG
+TTTGCCACGTCCCGCTGATTGCCTCCGGTGGCGCGGGCACCATGGAACACTTCCTCGAAG
+CCTTCCGCGATGCCGACGTTGACGGCGCGCTGGCAGCTTCCGTATTCCACAAACAAATAA
+TCAATATTGGTGAATTAAAAGCGTACCTGGCAACACAGGGCGTGGAGATCAGGATATGTT
+AACAGAACAACAACGTCGCGAACTGGACTGGGAAAAAACCGACGGACTTATGCCGGTGAT
+TGTGCAACACGCGGTATCCGGCGAAGTGCTAATGCTGGGCTATATGAACCCGGAAGCCTT
+AGACAAAACCCTCGAAAGCGGCAAAGTCACCTTCTTCTCGCGCACTAAACAGCGACTGTG
+GACCAAAGGCGAAACGTCGGGCAATTTCCTCAACGTAGTGAGTATTGCCCCGGACTGCGA
+CAACGACACGTTACTGGTGCTGGCGAATCCCATCGGCCCGACCTGCCACAAAGGCACCAG
+CAGTTGCTTCGGCGACACCGCTCACCAGTGGCTGTTCCTGTATCAACTGGAACAACTGCT
+CGCCGAGCGCAAATCTGCCGATCCGGAAACCTCCTACACCGCCAAACTGTATGCCAGCGG
+CACCAAACGCATTGCGCAGAAAGTGGGTGAAGAAGGCGTGGAAACCGCGCTGGCAGCAAC
+GGTACATGACCGCTTTGAGCTGACCAACGAGGCGTCTGATTTGATGTATCACCTGCTGGT
+GTTGTTGCAGGATCAGGGGCTGGATTTAACGACGGTAATTGAGAACCTGCGTAAACGGCA
+TCAGTGAGTTGCGGGGTAAGCGGATGCGATATTGTTGCCGCATCCGGCAAAAAAACGGGC
+AAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTGTAATT
+GCGTAGAGCATTACGCCCCAGCACAATCCCCGCGCCAACCATGCCACCCAGCAGCACCGC
+CAGAATCAAGGTAATTGCCTTTTTCGGGCTATCACGACGAATAGGTAACATCGGTTTCAT
+CACATAACGGTAAGCATGAATATCAAGATCATCAACTTTTAAGCTTTCGATATCCAGCAG
+GTTTTGACGAGTCTGATAGTAGTTTGGCGAGAACACCAACGGACGGGTCGCCTCATGCTT
+AATCATCGACTCCAGCGCTTCGCTCCCCAAAAGGAACAACGTATCTTGTGTGATATCTTC
+GCCAGTCTGTTGAATCTGCGGTTTTGTCACCTGCGCCTGATTCGCATACTGCAACGCTTC
+CTGAATCTGACGGATACGCAGATCTTTCTGCTCCTGCGCGACTACTTCCTGCGTTCTTAA
+AGAGTCCTGCAAGTTTTTCCGTCCCAGAGCAATGTTGTCTTTGAGATCCTTTTCTAGCTC
+TTGATTCACTTTATCGTCAACTTGCTGAATGTATTGGGCCAACTTCATTTGTGCGCCCTC
+TGCAGTTTGCCCAACATAAGAAACAGTCAATGGTAATTGCTGGTTCTTAACAGAAGGTTC
+GATGGTAAGTTTTTCTCGTTCTTCCTGATTATCCAGCGTTTCTGCTAATGCAGAGAAGGC
+AGAACTGAAGCGACCAATTAACGTCTCCTGCAAATCCGATACTTTCGGTGCAGCCTGACC
+ATAGATAACATTCATGGCATTGTTATAGCCAGCAATTTGCCCCACGTCGGGCTGAGTGAT
+AATTGCTGTTGACGTCCATTTCTCCTTCGCTACTGCCAAATATCCAATAGCCAGGGCAAT
+AGCCACAATGACGGAAATGATGATTGTCATCTTGCCACGCCACAACTGCACTAGTAAATC
+AATCAAATCAATCTGTTCCGGGTCATGGTTTTGCCCAGAAACATTATTATTTTCTACTCT
+CATCATTACCCTAACTGACGGAAATTTCCAAGTCCGCATAGTTTAGCGATAATCCTCGTG
+AATGCTATAGGATAAGTGATAAAAATAATGAATTGTTGTGTAAGTAACAAAAGACAATCA
+GGGCGTAAATAGCCCTGATAACAAGATGTTAGTCGCTGCCAAAGAGATCGCGGGTGTATA
+CCTTATCTGCCACATCCTTAAGCTCTTCTGCCATTCGGTTAGAGATAATGACGTCGGCTT
+GTTGTTTGAAGGTGGCGAGATCACGTTCCAGGCGAGAGTTGAAGAATGAGTCTTCTTTCA
+TCACTGGCTCGTAGATGATCACTTCAACACCTTTCGCCTTGATACGTTTCATAATCCCCT
+GAATAGAAGACGCACGGAAGTTATCTGAACCGCTCTTCATAATCAGACGATAAATACCCA
+CCACTTGCGGCTTGCGTGACAAAATGGCATCGGCAATAAAATCTTTACGCGTGCGGTTAG
+CATCGACAATTGCCGAGATCAGGTTATTCGGCACAGACTGGTAGTTCGCCAGTAACTGCT
+TGGTATCTTTCGGCAGACAATAACCACCATAACCAAACGACGGATTGTTGTAATGGTTGC
+CAATACGTGGGTCGAGACAAACGCCTTCGATTATTTGACGGGAATTCAGACCTAAACTTT
+CTGCATAGCTATCCAGTTCGTTAAAGTACGCCACGCGCATCGCCAGGTAGGTGTTTGCAA
+AAAGTTTAATCGCTTCTGCTTCAGTGGAGTCGGTAAACAGCATCGGGATATTTTGCTTAA
+TCGCGCCTTCCTGTAACAGAGCAGCGAAACGTTCTGCGCGTTCTGAACGCTCACCGATGA
+CAATACGTGAAGGATGGAGATTATCGTAAAGGGCTTTACCCTCACGGAGAAATTCCGGGG
+AGAATATAATATTTTCAGTGCGATATTTCTTATGCATCGCTGCGGTAAAACCAACGGGAA
+CCGTTGATTTGATGACCATAACCGCATAAGGATTTATCTCAACTACGTCTTTAATTACTG
+ATTCTACACTGGATGTATTGAAATAATTAGTTTTAGGATCATAGTCGGTTGGAGTGGCGA
+TGATGACATAATCAGCATCCCGGTAGGCTTCATTTTTATCTAATGTGGCATTAAAGTGTA
+TTTTATCTGATTGCAAAAACTGCTGAATTTCCTTATCAACAATAGGAGATATCCGATCAT
+TCAGCATAGCAACGCGTGACGGTAAAATATCTAATGCCACAACCTCATGATTTTGTGCGA
+TTAGAAGCCCGTTTGACAAGCCTACATAGCCAGTACCGGAAATGGTGATTTTCATTTCAT
+GCTCTCAGAATTAACTTAACTGTGAATCATGATGTTTTTAGCATCCTGATAAGAGCTAAA
+AGTTTTAACGCTACGTTGTTCGATGGTCAACGCAACGAAAAACAATTCAGATTTTCTTTA
+TAAGAATAGCTGATATTTATTAAGTTAATATTAAGCAGTGAAATTTAGTCTATAAGATAT
+TTGGCAAAAAAAAGCCCGGTGCAATATACGCCGGGCCTCAATTTTATTGTTGGTTAAATC
+AGATTAATCCAGCCATTCGGTATGGAACACACCTTCTTTATCAATACGCTTATAAGTATG
+CGCACCAAAATAGTCACGCTGTGCCTGGATCAGGTTCGCAGGCAGAACAGCAGCACGGTA
+GCTGTCGTAATAGGCAACCGCTGCGGAGAAGGTCGGAACCGGAATACCGTTCTGTACTGC
+ATAAGCAACGACATCACGCAGCGCCTGCTGGTAGTCATCGGCAATTTGCTTGAAGTACGG
+AGCCAGCAACAGGTTAGCGATCTGTGGATTTTCGGCATAAGCATCGGTGATTTTCTGCAG
+GAACTGCGCACGGATGATGCAGCCAGCACGGAAAATCTTCGCGATTTCGCCGTAGTTCAG
+ATCCCAGTTGTACTCTTCAGACGCAGCACGCAGCTGAGAGAAGCCCTGGGCGTAAGAAAC
+GATTTTGCCCAGATACAGCGCACGACGAACTTTTTCGATGAACTCAGCCTTGTCGCCTGC
+TGGCTGTGCTTGCGGACCAGAGAGAACTTTAGATGCGGCAACACGCTGATCTTTCAGAGA
+AGAGATATAACGTGCAAACACAGACTCGGTAATCAGCGACAGCGGTTCGCCGAGATCCAG
+CGCGCTCTGGCTGGTCCATTTACCGGTACCTTTGTTAGCCGCTTCATCCAGGATCACATC
+AACCAGGTAGTTACCGTCTTCATCTTTTTTGGTGAAGATATCTTTGGTGATGTCGATCAG
+GTAACTGCTCAGTTCACCGTTATTCCACTCGGTAAAGGTCTGCGCCAGTTCTTCGTTGGT
+GAGGTTCAGGCCACCTTTAAGCAGAGAATAGGCTTCAGCAATCAGCTGCATATCGCCGTA
+TTCAATACCGTTGTGAACCATCTTCACATAGTGACCTGCGCCATCGGCACCAATATAGGT
+AACGCATGGTTCACCGTCTTCAGCTACGGCGGCGATTTTGGTCAGGATCGGTGCTACCAA
+TTCATAGGCTTCTTTCTGGCCACCAGGCATAATAGAAGGACCTTTCAGCGCCCCCTCTTC
+ACCGCCAGAAACACCGGTACCGATGAAGTTAAAGCCCTCTGCTGAAAGCTCACGATTACG
+ACGAATAGTGTCCTGGAAGAAGGTGTTACCACCATCAATGATGATGTCTCCTTTATCGAG
+ATATGGTTTGAGGGAATCAATAGCAGCATCCGTGCCTGCACCTGCTTTCACCATTAACAG
+GATGCGACGAGGCGTTTCCAGAGATTCGACAAACTCTTTCACCGTATAGTAAGGAACCAG
+TTTCTTGCCTGGATTTTCGGCAATCACTTCTTCCGTCTTCTCACGGGAACGGTTGAAAAT
+AGAGACGGTATAACCACGGCTTTCGATGTTGAGCGCAAGGTTGCGTCCCATCACTGCCAT
+ACCGACTACGCCGATCTGTTGCTTGGACATTACATACTCCTGTCAGGTGTGATCACCGCG
+CTGAATGCTCGCGGCCTGGAATGTTCGCAAATAAGTATACAAAGTACTTATTAAAGTATA
+AATAGCTTATCCATGCTTATATGCTTACGGCTTTATATTACGGGTGAAAAACTGATGAAA
+TTCGATCAAAGTTGCGATTTGATAAAATACGTTTTCTGGCTAAATATCTAAAAGTACTTT
+TTAAGTGCCATCTGAAGGCTTTTGAAAAAAAACTTCGATTGTCATGATGAGCATAATGTA
+TCGCATGAAAAGCGGGAACATAATGAAGTCTGACACCAGCCAGGCTAAGCCTCAAGCACA
+GGTCAATATCTTCACAGTACATAAAGTAACCTTGATCGAAGCCATTTACACGCACAAAAT
+CTGAAAAACGTACCAGCATAAATGATCCTGCGCACCAATCAACAACCGTATCAGAATAGA
+TACTTTCTTTAGGAATTTTTGTTTTATTAAGGAAGGTGCGAATAAGCGGGGAAATTCTTC
+TCGGCTGACTCAGTCATTTCATTTCTTCATGTTTGAGCCGATTTTTTCTCCCGTAAATGC
+CTTGAATCAGCCTATTTAGACCGTTTCTTCGCCATTTAAGGCGTTATCCCCAGTTTTTAG
+TGAGATCTCTCCCACTGACGTATCATTTGGTCCGCCCGAAACAGGTTGGCCAGCGTGAAT
+AACATCGCCAGTTGGTTATCGTTTTTCAGCAACCCCTTGTATCTGGCTTTCACGAAGCCG
+AACTGTCGCTTGATGATGCGAAATGGGTGCTCCACCCTGGCCCGGATGCTGGCTTTCATG
+TATTCGATGTTGATGGCCGTTTTGTTCTTGCGTGGATGCTGTTTCAAGGTTCTTACCTTG
+CCGGGGCGCTCGGCGATCAGCCAGTCCACATCCACCTCGGCCAGCTCCTCGCGCTGTGGC
+GCCCCTTGGTAGCCGGCATCGGCTGAGACAAATTGCTCCTCTCCATGCAGCAGATTACCC
+AGCTGATTGAGGTCATGCTCGTTGGCCGCGGTGGTGACCAGGCTGTGGGTCAGGCCACTC
+TTGGCATCGACACCAATGTGGGCCTTCATGCCAAAGTGCCACTGATTGCCTTTCTTGGTC
+TGATGCATCTCCGGATCGCGTTGCTGCTCTTTGTTCTTGGTCGAGCTGGGTGCCTCAATG
+ATGGTGGCATCGACCAAGGTGCCTTGAGTCATCATGACGCCTGCTTCGGCCAGCCAGCGA
+TTGATGGTCTTGAACAATTGGCGGGCCAGTTGATGCTGCTCCAGCAGGTGGCGGAAATTC
+ATGATGGTGGTGCGGTCCGGCAAGGCGCTATCCAGGGATAACCGGGCAAACAGACGCATG
+GAGGCGATTTCGTACAGAGCATCTTCCATCGCGCCATCGCTCAGGTTGTACCAATGCTGC
+ATGCAGTGAATGCGTAGCATGGTTTCCAGCGGATAAGGTCGCCGGCCATTACCAGCCTTG
+GGGTAAAACGGCTCGATGACTTCCACCATGTTTTGCCATGGCAGAATCTGCTCCATGCGG
+GACAAGAAAATCTCTTTTCTGGTCTGACGGCGCTTACTGCTGAATTCACTGTCGGCGAAG
+GTAAGTTGATGACTCATGATGAACCCTGTTCTATGGCTCCAGATGACAAACATGATCTCA
+TATCAGGGACTTGTTCGCACCTTCCTTAATCCCTAACATAAATGACACAATAAAATCAGA
+AAGCACAGGAAATTTTCTTACGGAATAATCATGTAAAGATTTCGCTTCATCTCGGAACAG
+GCATAATGTACTAAAAGCATAACGCTTACTTTCGACATATTTAATATATGTCAGCAAATC
+ATCATGCTTCATGATGATATCGGGATTCAAAAACAAAATGTAATCATCATCTGCGGGTCT
+ATATTTTTCCTTTACATACGCCACCGCAATATTATTATTATGACCAAAGCCGTATACACC
+TCCACTAATATAGTCCAGGCCTGCATAATGCTGGCATATTTGTTTCAATAATAGAGAGTC
+TTTGTTGTCGCGTACGATAATCTTGTAGTGCTCATCGTCAGCATTAAGATTTTCGAGTAA
+TTTTTTGATGTAGTCTTCATGTCCGTGGGAAACGATTATTATATATACCATTTCAATGTT
+CTTCAGTAATAAAATTAACTAGTTCATCAAACCCAACTAATACATTTTCATTACGATAAA
+TGAAATTTGCATCAGAGATATCTTTTTTGAGGTTACCTTTTTTGAAGTCAATAATAAGTT
+TAACTAACATGTCATCGTTATTAGAATCAAAAAAAGCTTTCTTTTCATAACTACCAAGAG
+TTTCTCTAGTAAATGGGAAATCTGATGCTAATACCCACTTACCTCGCTCTTTAGCTTCAG
+ACAACGGCAATCCCCATGTTTCTAACCTAGAGGGAAAACAAACTATATCTGAAATATTAT
+AACAATGATCGATTTTTTCTTTATCCAAGTACCCGAGGAAATGAACATTATCCAGTCCTT
+CTGCAAGACTGATAATATATTTTGCATACGCATTTTCTGTACCACTGATAGTAAGCAGAA
+ATTTAATATTGGATTGTTCTTTCAATTTCCTTGCTGCACTAATAATAAGCTCGTAATTTT
+TAAATACTCGTGGAACAGCAGGGTAAAATATTGTCAACTCAGAAGGGTTATTCTTAAATT
+GAGAATCATCATCAGTAAGTTGGCTTTTATCAGATAATTTAATTTCTGGCCGACTGACAA
+TGATGTTATTTATAGAATATTTCTTGATAAATTTTTCTTTCATCCAGAATTGTTGAACAA
+ACACTGCAGTATTTTTTTTAATGTTTATTTTATATATCAGCCCGTATAGCATTTTAAATA
+AGAAAAAGCTAGGCTCCATAAGAATTTCACGGAATAAAATTCCTTTATAAAAAGGTGCAG
+GGTTATGACAATACACATATCTTTTTTTAGTGACGACATTGGCCGTAATATCATGCAGAC
+AAATCCAATGCGTAGCATTCAGCTCTTTTGAAAGTTTTTTACAAACTACATATTCAAAGT
+GCAAACGTTTTAGCCACGACCCTTTAACCTCAGGAAACTCAATGAATTTAACCCATGGAT
+AACTTTCTTTTAACTCTTTAGCAGAATGGACTAATGCGATAAAACTGACATTTTCTTTAT
+TATTAGTTGCTGCCAAAAATTTTTTCAAAATGGTAAATGGACCGCCAGTGGTAAAATTGA
+CCGCAGAAACAACGACTATGCTTTTTCCCATAATTTGGTCTCATGATTGTATTTCTTTAT
+GATTTTTGCTGGTACTCCCGCAATGACAGTATTTTCGGGAATAGAACCTCTAACAACAGA
+ATTGGCGCCGACTACGACTCCATTACCAATAATTGTTCCAGGCAAAACCGTCACATTCTC
+ACCCAACCAAACCCTCTGGCCAATTACAACAGCTGAAGATTCCAACGTGCGCATGTCTGG
+AGGTATATTTGGCGAACTCATTGGATCAGAGTGCTTAAAGGAACCGTGATTATGATCGGT
+AATAAATACTTTACTTGCAATAAGCGTATCCCGACCTATCGTAACGCTCTCAATTGAGGC
+GATATGAACATAGTCGTTAACTTGCACATTATCGGAAAAAAAAATCACGCCACGTCCAAA
+TGCATCCAGCCTGAGACCGACTCCACTTGTGAAATTTTCACCAAAATTAATGCTACCATC
+ATTGCGAATATAGCAGGGAAATCGAATAATTCTACAGTTCCGGTAAAATACACGAGTCAA
+TAAGACATCTCTAACAAGCCGAATAAAACCACAGAGACCATATCGTTTAGCGAGTTTTAA
+GATCATCGATCACCTCTTCAAGAACATCCCTGAAGTAACTTCCTGTTCGAATTTTCTGAG
+AAATAATTTTTGTATTCTCACTAATTTGCTTATAAGTTTCTATTGTCATGGAGTCAACAA
+TCTCTTGCATTTCTTTGATTGATCCCACTGCATATCCTATTCTATTATCTACAATGAAAT
+CCGCAAGGGCGGCTTTATCCCATATAAATACTGGAAGTTCCATTGAAAGATAAAGAGATG
+TCTTATGAGGGTTATTAAACTTTAAATAGTCGCCAAAGGCACCACTACAGGTTTCGACAG
+AATCTCCATCCCAAATGAGTCCAAATTGCATGCCTGGGAGGTTAATCTTTTCCGGAGATT
+GAGCATCAAAACTTCCAAGATATTTAGGATTATCTTTATTTTCATAGTTGACACCAAAGA
+GAGTAAAATCGCATCCTTCAGTATATATGAAAGAACATTTATGCCTAGAAAGGTTGCCAG
+CATATATGACCCCTCGTTGCTTATCCGTAACATCTCGATGCTCCACATCAGATGAGACGA
+GGTAATCAAATATTTTTATGTCTTTGATTTTATCCTGAGACATATATTTACTAAGGTACT
+TTGTCATTTGTGGATTGTGACTTATGACCATATCACAGGTAGCAAGCCGCACAGAATCAC
+TACCCCCTCCTCCTCTTAATTCATCAATATCATGAATCAGAGGTACTATTCTAAATTTTA
+GAAGGCGGTGAAAGAATGACAATATATGCCAAAATGGTTTGGCCATCGGGAAATTGAAAA
+TTAAAACATCTTTATTTTCAAGACCGCAGAGAAATGTACTAAGCTTAACAGAACTAATAA
+TTCTCTGGACTACTCCACCCCATAGAGGAATGTTAACAACAGAAATGTTTTCATAATCTG
+AAGCAATGTCCAGTGCATCTTTTCTTGCTTTAAATCCAGCATCGCGTCTAGAGAAATTTA
+AATCATTCAAAAAATACATTTTCACTTTATTTTCTGGGCCTTAAGAAATTGAGAGAATAC
+TATGATACAAAGAGTTATTTGTATCCAACTGCTAATATTAGTCATGAAGCTTTCATGATA
+AAAAATGAAAGAAAAGGTATAAATAAAATATGAATAAAATATTTTCACAGATATGTAATT
+TCGAGACAATCTCCATAAAACACCTGAAATACAGCCATGAATAACCATCATCAAATAGCT
+TAGCTCCGCGGAAATATAAACATAATCCGAAAAAGCAGTATAAACATTTGTTGGCAAACC
+CACCCACACAAATTCTTTATGCAACGACATAGAGACTCCACCTGTTAATAGCCCCATCAG
+CCTTTCAAAAAACCAAAAGACATGAGAACTGGCAGAGTTAGATACTTGCTGAAAATAAAA
+CTCCTGAAACGCGATTATAGGGCTGACCAAATACATGGATAGATAATATGCCATCCCCCC
+AGGCAGTCCACGTAAAAAGAGCATATACAAGGAGAATAGAACACCTACAGCTGTAATAAG
+ATAAACATAATGTTTTACTCTATTAACACCTACGATGAATGCATAAGAGATGATAACCAT
+AAAGACAATTTGCTTACCAGTATTCAGTATAATTGCAAAGATGAATACAATAAAAACAAG
+TAAAGTAAATGTTTTACTTACCTTTGTATTAGTAAATTTTTTAGACCAAATAAATAAAGC
+AAAAGTAGTTAGAATGATTGGCTGCATGTATGCTGAGAAATTTCTTGATGTGTCTTCAAC
+ATCAGCATCTCTTATCAAATTCATATAGCTAAGTAAGCTAGTCCCGAACTGGTAGTTACT
+TAACCTCATGCATATATATATCATCGAAAAAGAAATAACTAACAAGCCTACATTATGCAC
+TTTCTTCGATGGTATGCTATAAATAGCATTATTGACTTTTCTGATATTTAGATCTAATAC
+ACTTTCCGTCAATAAACATGACAGGGTAAATGTCAAAACATTGCAAAGTAGAAAAATCAA
+CGTAGCGTCATTTAACTGAAAAGCATATATATCTGACGTTATTTCATATCCCAATAAGAC
+CAGTGCGAAGATGATATTAACGCATACGGCTGGATAAAATATATCCTTCTTAAGATATAA
+ACAGATAAATGCTGTAATGAGAAAGACACTAATTACAAGATAGATCATTAATCCGTACTC
+ATTATATTTTTCACTTGATAAAGAGCGGCAGATATCACTTGATGCATATCATAATATTTA
+TACTCGGCCAAACGCCCGCCAAATATAACCTTGTCTTCTCTGCTAGCTAACTCTCTATAT
+TTCTTAAAAAGCTCCATGTTTTTATTATCATTAACTGGATAGTAGGGTTCGTCGCCAACT
+TTCCACTCTAATGGATATTCTTTTGTAACAACCGTATGCTTTGTCTCAACATAGTCAAAA
+TGTTTATGCTCAATTATTCTGGTATATGGTACATTAGCATCAGTGAAATTTATTACTGCA
+TTCCCTTGGAAGTTTGGAAATTCATGGCGTTCCGTCTCAAATTTTAAAGAGCGATATTCT
+AACGCTCCAAACCTATAGTCGAAGTACTGATCAATGGGTCCAGTGTAGATGATTCTATGG
+GCTTTACTCGCTAGAGAATCTTTGTCTTTCAAAAAATCAATGCCTAATTTTACGTCCACA
+CCTTCAAGCATTTTTTCAATAAGCTTAGTGTAGCCTCCCACCGGAATACCTTGATAGCGA
+TCGGAAAAATAATTGTTATCAAACGTAAATCTCACTGGGATTCGCTTAATAATAAATGCA
+GGCAATTCTTTTGCACTTCTTCCCCACTGCTTCTCCGTATAACCCTTTATCAATGCTTGG
+TATAAGTCCTCCCCAACTAATGAAATCGCCTGCTCCTCCAAATTTTCAGGTACCTTGTCA
+CCATACTTTTTTTTCTGAGCATTAATGATATTTTGAGCTTCTTGAGGATCTTTAACTCCC
+CACATTTGGTGGAAAGTATTCATATTAAAAGGAAGGTTGAATAATTTGTCTTTATAAATC
+GCCAGTGGAGAATTAGTAAAACGATTAAATTCTACTAAATCATTAACGTAATCCCATATA
+TATTTATCATTGGTATGAAAAATATGTGCACCATATTTATGAATCTGGATACCCTCACAG
+TCCTCTGTGTACGCATTTCCACCGATATGATTTCTTTTCTCAATCACTAAAACTTTTTTG
+TTTAGCTTTTTTAACTCATTCGCACAAACGGCACCAAACAAACCAGAACCAACAATGATA
+TAATCGTACATAAAATCCTCAGCAAACCAGTAATTTATTATTTCTTACGAACATCAGCAT
+GAGTGACGTAACTAAGCACTCTGTTGCAAGCAATGTTATTGCTGCACCAATCTCTTTAAA
+AAGAGTTGTTAGCGGAAAAATCAACAACAAACTCAACAAACCCGCAGCGATTAAAATCTT
+ACTGAATTCTTTCTTATAATTATGGGTCAGCATAACTTGAATGCCATAGACATTACTTAA
+TGAAATAAGAAAAGGCAGAGGCGATATAATCATTAGCACAATCACTGCATTATCATATCC
+CGGCCCTATACTTATTTTTACTAGTATAGATGCACCCAAGAGCAGAATTAATGAAAAAGC
+ACCACCAATCAAACTCAAGCAGGTCAATGATTTTTTAATTAAAATCACACCCTTCACACG
+ATTAAGAACAAGCGTACTTGATATTCTTGGGTATATTGCTTGGGTGATAGGATTTAATAG
+CCCTTGAAGCGCGTTTCTTATAGTATTGGCCGCATTAAAATTCCCTACGGACGTTGGTCC
+AGATATAAATCCCAGGATAATAACTATTCCCGTAGAATATAAACTAATAGCAGATGTGGA
+AATAAAAACATGAAAACCGTCTGCTAAAGATCGACGCACATTATGTAATGATAGCGTAAC
+TTTACCAATCCAACCTTCATGAACAACGATAGCTAGTGCAATAATTCCAGCAACCAGATT
+TGCACTTGACTGAATAAAACCGGCAATTGCTATATCTGACTTTGTGTTCACAAAAATAAA
+TGTTAGAGGGATAATAGCCAAGCGGGATAAAATACTACTTAAAGTCAGCCATTTCATTTT
+TTCTTTTCCCTGAAACAGCCAGATAGGGTAGATTAAATTCCCGACTAATGCAGGAACAAA
+CGACCATATAATTACGGCATGCTTGTTATATTCAGGAACAAGCAAGGTCATCGACGTTAA
+GAAAATCAATGTAATGACGATAAGAACTATTTTTGAAAATATCACCGCCCAAAAAATAGA
+CGTTACTTTATCTTTACTATCTGCTGCTTTGGCAATACTCTGAGTTGCTGTGAGATTGAA
+ACCATATTCAACAAACATTATCATATATAGCATAGTCGCTTGGCAAAAACCGAATATACC
+GAAATTTTCAGGACCAAGTGTTCTTACAAGATATGGAAATGTAAGCAATGGTAAAAGATA
+ATTGCTACCTTGAACGACAGCCAGATATATAACGTTTCTTCTTAAAGATAATTTATTCGT
+ATTCATGCAATTAATTTTAATCTGATAAGCTCATCTAACGTAAAGAGCCTTTCATCTTTT
+GGCGAAAGGATTAACCCTGATGTTTGGGGCCAATCAATTGCAATGCGTTCATCATTCCAA
+CATATTCCACAATCGCTTTCAGGATGATAATAGTTTGTAGTTTTATATTGAAATTCAGCG
+ATATCAGACAGAACCAAAAAGCCATGAGCAAACCCTTTTGGTATCCACAACTGCTGCTTA
+TTATCAGCTGAAAGCAGAACACCAACCCATTTACCAAAGGATACCGAATTGGGTCGAATA
+TCAACAGCAACATCAAAAACTGCTCCATGAGTGCAGCGTACAAGTTTATCTTGTGCGTAC
+TCGCCGCGTTGAAAGTGAAGGCCTCTGAGTACATTTTTTGATGAACGTGAGTGATTGTCT
+TGAACAAAGCTGACCGGATAGCCTAGAATATGTTCAAATGCTGATTGATTAAAGCTCTCA
+TAAAAGAAACCTCTATCATCACCAAATACTCTTGGCTCCAGAATTAGCACATCTTCAATT
+TCAGTTCTAATCACATTCATTAATTTGAATCCTTCGTCATTTTATAAAGATACTGCCCAT
+AATTATTCTTTATTAGTGGTACAGCTAATTTTCTTACTTGCTCAACATCAATAAAACCTT
+TACGAAATGCAATCTCTTCAGGACAGGAAACCTTCAATCCCTGGCGCTCTTCAATTGTCG
+CAATAAAATTACTTGCTTCTATCAGACTCTGATGAGTCCCCGTGTCCAGCCACGCGTAGC
+CACGCCCCATCATCGCGACAGACAGACGTCCCTGCTCAAGATAAATACGGTTAATATCTG
+TAATTTCTAACTCACCACGTGCAGACGGCTTCAAGTTTTTCGCCATCTGAACCACGTCGT
+TATCATAAAAGTACAGACCTGTAACGGCGTAATTACTCTTTGGTTCTAACGGTTTTTCTT
+CCAGACTGATTGCCGTACCGTTTTTATCAAACTCAACGACACCATAGCGTTCTGGATCAT
+TAACGTGATAGGCAAATACCGTTGCACCACTTTCTTTGTTAACAGCGGCCTCCATTAGCT
+TCGGCAGATCGTGACCGTAAAAGATATTATCACCAAGAACCAAAGCACAATCATCACCAC
+CAATAAACTCTTCACCGATGATAAATGCCTGCGCGAGGCCATCTGGGCTAGGTTGCACTT
+TGTACTGAAGATTCAGGCCCCACTGGCTACCGTCACCCAGCAATTGTTGAAAACGAGGAG
+TATCCTGAGGTGTACTGATAATCAAAATATCGCGAATACCCGCCAACATCAGTGTAGAGA
+GCGGGTAATAGATCATCGGTTTATCATAAATAGGTAATAGCTGTTTACTGACAGCCATAG
+TCACAGGATAAAGACGTGTACCAGAACCACCCGCTAAAATAATACCTTTACGCATTTTCA
+TTTCATCATTCCTTTTAATTCATCTTGCTCCACCATCACGAACAAGATGCAAAAACTATT
+AAATTGCTGTAGTCGTAAATAATTCATTGAGCATTCGTTTCACGCCAACCTGCCAGTCAG
+GCAAGACAAGCGCAAAGTTCTGCTGAAATTTTTCTGTATTAAGGCGAGAGTTATGTGGAC
+GACGAGCTGGTGTAGGATAGGCTGTTGTTGGTACTGCGTTGAGCTTGTTGAGTGCAAGGG
+GAATGCCTGCTTTGCGCGCCTCTTCAAAAACCAGCGCAGCATAATCGTACCAGGTTGTGG
+TACCACTGGCTACCAAATGGTACAAGCCTGCGACATCCGGTTTATTCAGTGCGACACGAA
+TGGCATGTGCTGTACAATCAGCCAGCAGTTCAGCACCTGTTGGCGCACCAAACTGATCGT
+TAATAACCGCTAATTCTTCACGCTCTTTTGCCAGACGTAACATCGTTTTGGCGAAGTTAT
+TTCCTTTTCCTGCATAGACCCAGCTGGTCCGGAAAATAAGATGCTTCGCGCAATATTCCT
+GTAACGCTTTTTCTCCGGCTAACTTGGTTTCACCGTAAACATTTAGTGGTGCGGTTGCAT
+CCGTCTCCAGCCATGGCATATCGCCATTTCCAGGGAAGACGTAATCAGTCGAGTAATGGA
+TAACCCAGGCTCCAACTTCATTTGCTGCTTTCGCAATCGCTTCGACACTTGTTGCGTTAA
+TTAATTGTGCAAACTCCGGTTCTGATTCTGCTTTGTCTACTGCGGTGTGAGCGGCTGCAT
+TGACAATAATATCCGGCCGAATGCTTCTTACGGTTTCAGCTACACCTTCAGGATTACTAA
+AATCACCGCAATAATCAGTAGAGTGAACATCAAAAGCAATCAAATTACCCAAAGGTGCCA
+GAGCACGCTGTAGTTCCCAACCTACCTGCCCTGTTTTGCCAAAAAGGAGGATATTCATTA
+CTGGCGGCCCTCATAGTTCTGTTCAATCCACGATTGATAGGCACCACTTTTCACATTATC
+AACCCATTTTGTATTGGACAGGTACCATTCCACCGTTTTACGAATCCCGCTCTCAAACGT
+TTCCTGTGGTTTCCATCCCAATGCGCGACCAATCTTCTCAGCATCAATAGCATAGCGGCG
+ATCGTGTCCCGGACGATCAGCAACATAAGTGATTTGCTCACGATAAGATTTCTCTTTCGG
+TACAATCTCATCCAGCAAATCACAAATAGTGAGCACTACATCGATGTTTTTCTTTTCGTT
+GTGCCCACCAATGTTATAAGTTTCACCCGCTTTACCTTCGGTTACGACGGTATATAACGC
+ACGCGCATGATCTTCAACATACAACCAGTCGCGGATCTGATCTCCTTTGCCATAAATAGG
+TAATGCCTTACCTTCCAGTGCATTAAGAATAACCAGTGGAATAAGCTTTTCCGGGAAATG
+ATAAGGACCATAGTTGTTCGAGCAATTAGTCACAATTGTCGGTAAACCATATGTACGTTT
+CCACGCGCGGACTAAATGATCGCTGGATGCTTTGGATGCGGAATAAGGGCTGCTTGGCGC
+GTAAGCTGTCGTCTCAGTAAATAAGGGTAATTCTTCTGTATTATTTACTTCATCTGGATG
+AGGCAAATCACCATAGACTTCGTCAGTAGAAATATGATGAAAACGGAAGCTATTTTTCTT
+GTCGCTATCAAGAGCAGACCAGTAATTGCGAGCGGCTTCCAAAAGGACATAAGTACCAAC
+AATATTGGTTTCAATAAATGCCGCAGGGCCTGTAATTGAACGGTCAACATGGCTTTCAGC
+AGCCAGGTGCATCACTGCATCCGGCTGATGCTGAGCAAAAATCCGTGCCATTGCAGGTGC
+ATCGCAAATATCCGCATGTTCAAAAACATAGCGTTCAGAATCAGAAACATCAGCAAGTGA
+TTCCCGGTTTCCGGCGTACGTTAATTTATCGACATTAACAACACTATCCTGCGTATTATT
+TATAATGTGACGAACTACAGCTGAACCAATAAATCCTGCGCCACCAGTAACAAGTATTTT
+CACTTAATTTATTCCATATTACTTCAGAGCATGCTGTGAAATAAGCGGCTCTCAGTTTGA
+TTAATAGAGGTATTAATGCACGCTACCGCCCCTGGCTTTACAGCTACCAGAGCACTGCAT
+GCATGCCTATGATGTGACGAGCGTTACCCACTCGCGCTAAACCCGAAAAATTCAAACGCT
+AATTGTCTTACCAATCCGCTCTGGAAACAAGGAAAATCCTGGAAAACTTTGAATAAAACC
+CTACTGCTAACTCGTTGTTATTCTGATGGTTTATATAAAACAACGGCAGGAAGATTCGCA
+ACAAATTACTTTTGCTGCGAATTTTCACTGCCGTTATAATTTTCTTATCAACCGTTACAT
+CCGGTCAGATTTTCATTATTCGCTTAACAGCTTCTCAATACCTTTACGGAACTTCGCCCC
+TTCTTTCAGGTTGCGTAGGCCATACTTCACAAACGCCTGCATATAGCCCATTTTTTTGCC
+GCAGTCGTAACTGTCGCCGGTCATCAGCATTGCATCAACGGATTGTTTTTTCGCCAGCTC
+GGCAATAGCATCAGTCAGCTGAATACGTCCCCATGCACCAGGCTGAGTACGTTCCAGTTC
+CGGCCAAATATCGGCAGAAAGCACATAGCGACCTACGGCCATGATGTCTGAGTCCAGCGT
+CTGCGGCTGATCCGGTTTTTCGATAAATTCAACAATGCGGCTGACTTTACCCTCACGGTC
+CAGCGGCTCTTTAGTCTGGATGACGGAGTATTCAGAGAGGTCACCCGGCATACGTTTTGC
+CAGCACCTGGCTGCGGCCCGTTTCGTTGAAACGTGCAATCATGGCAGCAAGGTTGTAACG
+TAGCGGGTCGGCGCTGGCATCGTCGATCACAACGTCTGGCAGTACCACGACAAATGGGTT
+GTCACCAATGGCAGGTCGCGCACACAAAATGGAGTGGCCTAAACCTAAAGGTTCGCCCTG
+ACGCACGTTCATAATGGTCACGCCCGGCGGACAGATGGACTGTACTTCCGCCAGCAGTTG
+ACGCTTCACGCGCTGCTCAAGGAGTGATTCTAACTCATAAGAGGTGTCGAAGTGGTTTTC
+GACCGCGTTCTTGGACGCGTGAGTTACCAGGAGGATTTCTTTGATCCCTGCAGCCACAAT
+CTCGTCAACAATGTACTGAATCATTGGCTTGTCGACGATTGGTAGCATCTCTTTGGGTAT
+CGCCTTAGTGGCAGGCAACATATGCATCCCGAGACCCGCTACAGGAATAACTGCTTTTAA
+ATTCGTCATTATTTCATCCACCTGTAAAATGGTTGCTGAATTATAGCTTGTTCGATTTTT
+TTCGCCAGCATCAATTACCCTGAATTGATTACTGAATTACTTGTGATGTTACGCCGCTTC
+GTTGTGGATTGCAGTAGCATTGTTCCTAAGTATGACTCCATTTTTCCAGGAATGGTCGCA
+AATCTACTCCCTCAGTTCCGGCAATCTAAAGTTAATCTTCTCCACATTAACAATATGGTG
+ATTAATCCTGTCGATATCGACGGAGCTTTGTCCTTTTTCATTCACCGCATGAACATTTGC
+AAGAGACAGCAGTGTTTCTTTTTTCGCCATAAAAACACCACGAACGTCTTTGCGCATGTC
+AAAGTTCATGCTCAATGCGGGTCCAACTGAGGATTCCTGCATCACATTGATATTTCGCAT
+AAAAAAATGTTGCGGTTTGTTGTGTAACTCCAGCGACGCACGCTTCATCTCAATGTTAGT
+TAGCGCCACAAAGGAAACAGCATTCCCGGCGGAGATTTGAATGCCGCGCAATTTATAAGC
+AAGATGAGTATTATCCAGTTGAATATCATTCACCCGGAAATTTTGCGGTATCGAGAGATA
+TTTGCCTTTAATTACCCCATAGCCGATTAACATCCCGGCGCTATTAATCATTTCAATATT
+ATCAATCACGAAATTGTCACAACCGTAAATAGCGACTGTCGCGTTATCAATGCCCGCTTT
+CTTACTGAAATCCGGCGTGATATTGCGGGCTTTGATATTACGAATAACAAAATGTTTACC
+ATTTTCAACATGTATCAACTGCCGACAATCCGATCCCGTGATATTCGCCACGACAAAGTT
+TTTCACTGCCTGGTCTTCCGGGTAGTTGTTATCATAAGTGCTTCCCGCAAGGCCTATGCC
+GATGCCCCAGTTGATTTTGCCGTTGGTACAGTTGATGCGCTCGATGACATGGTCAGATAT
+CAAAATATCACGGTCGTTAATTGCCACGTTCCATTCAATGGCGTCGCCTTGTAAGTCGCT
+GAACTTACAATTGGTGATGTTGGCACCGATAATCTGGTTATGAAATCCCTGGCGTAAGAT
+GGCGTAATTAGCGTGGCTAACGGTCAGGTTATCGATGATCAGGTTGCGCATGACCCGTTT
+GTTTTTGCCGCCGATATAAATCTGCGTCACCGGGCCAAAGCCGCTCATAGTCAGCCCTTT
+GATGGTGCAGTCAGAACCACGCACATCCAGGGTGATGTTATGCATACTGCCGCCATCCTC
+CCCTGTCACCTGGCTGCCGTCCTGTAAGACAAATCGCCCTCTGCCGTTGCCGCGCAAGCT
+TCCAAGAATGTGTAACGTTTTACCGGGAGGGATAAAGATGCCGGTGTTGATATTGTCACA
+AACCAATCCGGCAGGCACGACGACTGTTTGCCCTTCGCTGAAGGCTTGTTTAAATGAGGC
+GATCCAGTCGTGTGGGTTGTAGTCGTTAATGTTAACGCTTTGTCGGGCGGGAAGCGCGCG
+GGCGAAAGGGGTATGGAGGAAGGCAAGCGCCGAGCTTGCCGTCAGGAACGTGCGTCGGGA
+GAGTTTTTTAAATGGCATGCGTTCTCCTCTATAAAGCCTGCAGCAAGCTGGCGAGTTCTC
+GATTGATCACCTGCTGGTTAAAATCGTGTTCAACTTTTTCGCGCGCGCGTTTGACGACCG
+GAGCCAATTCGTCGGTGTCCAGTTGGCTAAACGCCGCCAGTCGTTGCGCCAGTGCGCGAG
+CATCGTTCTCAGGCACCAGCCAGCCGGATTTGTCAGCCTCCACCAGTTCCGGTATTCCAC
+TATGCAGAGTAGAAACCACCGGAATACCGACCGCCATCGCTTCCATTAGCGCCACCGGAA
+TACCTTCCATATCACCATCCGCACCTGTAACCGATGGCAACAGGAAGACATCCGCGTCGT
+CGAGCATCGCTTTCACTTCATGGCTCGGTTTAAAGCCCGGCATCTCCACCACATCTTCCA
+GTTGATATTGTTCGATGAGGGTGCGCAGGCGTCTTTCCCACGGGCCAATGCCGAGGATGC
+GATAGCGAAATGCCACGCCCTGCTCTTTCAACTGACGGCAGGCTTCGATCGCCACATGCA
+GGCCTTTTTTCTCGGTTAAGCGTGCGACGGAAATAATCTCCAGCGGCGTTGCGGGCGCTT
+TCACGGGACGCGGGCTAAAGCGCGTCATATCTACGCCCATGCGCGATACGGCGATTTTTT
+CCCTCGGGCAGCCCATTTTTTGCAGCCTTCCGGCCCACAGATCGCTTATCGGTAACATCA
+GGTCGCCACGGCGAAACAGTTGCTGATATTCGGGAGTGTAGTGGTTGAGCACTTCCCGAC
+TGGAGATATCAATACCGTGGAAGATAGTGGCAATTTTGCCGCGAATGACACCCAGTTCGC
+GGAGTTTTGCTGCGGTTACCCCCGCGGGACCAAAATGAGCGATGAACACATCGGCGCGAA
+ACGGTGTTGCGACCTGGCCGCAAATGGCAGACAAAATCAGGTTCCGCGACTCGGCACCAT
+AGCGTTTGAGGTTGAGCGCCTGCCAGGTATTTTTACGATGAATGCCGCGCAAGGTCTGGC
+TGGCTCGGTGGCGCAGTTTCGCCACTTTGCCCGTAGGTTCGTCCTGTAACCAGCGGGTTC
+TGGCAGCAAGGTTGTATTTCGTCCATGCCGCGTGGGTGTTTTGTGTGTCGCCTTTTTGCA
+GCGCGAGAATCTCTACCTCAAATCCCATATCAATAAACGCGGTAATTTGGTTAAGGACGA
+AGGTTTCTGACGACAGCGGGAATTTCAGTAAAAAGAAGCCGACCTTCATTTCACCTCCCC
+GATGCGCTCAAGCACAGACTGCACCATCTGCATTCCTGTCTGACGCTCACGACTGACGGC
+TTCACTAAGTCGCGCATTCAGCGCCGGAAGCTGGCCTAAGGTATCCGCAACCATCGCTTG
+CAGGCTGCCGTCTAATAAATGACGGATATCAATTGCCATCTCCGGTAGTCCCAGCTGCTG
+CATAATCCCGGCGGATTTATGTTCGTAGTTGATGGCAATTGCCGGAGTGGCAAAATTCAT
+CGAGATAATGGCAGAGTGCAGGCGCGTACCGACGGTGAGTTCACAGGCCCCCAGAATTTT
+GCCCATTTCCAGATCGTTGAGTTCATCCATCACTACGTGGTAACGGGCAGGATCGCTGAT
+GTGCTGGCGCAGGTTGAGCGCCACCATGCGGTCGTCTTTGTTATAGCTGTCAATGCCCGT
+ACAGGTGGAGAGCGCAATCACCTGATACCCTTCATCGAGAATGCGATTGACCACCCCGGC
+AAAGGCTTTTTCATACGCTTGTTGAGTGGTGCCGAGACGTTTGTCAAACGGTGCCAGTTC
+GCGCAGGGTAATGGCCACCGTTTTCTGTTGTGCGGCAACGTCCAGCCAGTGTTGAACGGC
+ATAGCTGGCGGTGAAGTCTTCTGTGTGGTGATCGACCAGCCACGCGGTATCGACGCCATG
+TTCCACTTTTGCGGTGGTGATATTGCTGCGTTTCATCAGATCAAAGCTGACCGATTCGCG
+CAGGATCAGCGCGTCGCAGTGACCAAAAACGTAGTTCGCCAGTTGGTTAAATTGCTCATC
+CTGGAACGGGCCAACACTGTGACCAATCATAAACAGCGGCTTTTTCGCCATAAACGTGCA
+AAGTGCATGTTCAAACTGCGGCACGCCATAGAGATCGACAAAAAACGATCCGCCGACCTG
+GATAATGGCGTCGTAACCTGACAGCAGGCGCACGAAGTCGGTGAATCCCTGGGCGATGGC
+GATATTGCGCAGCTTGCCAGTGTCGGTGACGCGTGAGAGCAATACCTGATGCTGGTAGCG
+GCGACGGAGGACTTTTTTAACGCGCCCGACAACGCCCGCCGCGCTGTTGTGTTGTTTCAT
+TTGCAGGAACAGCGGATCGCCCATTACCGGGCGGTTGAGCAGCCAGGAAGAACTGACCGG
+ATAGCGGCTCATCACATCCACTTCGGCGTGTGGATTGAGAATGTTGATGGCATCAAGTAA
+GCCGCGCAGGATGGCGCTGTCGCCACGATTGCCGCAAGTGTGGTTGCCCAGAATAAGTAA
+TTTCATTTTTTCCTCATAAATTTGATGCCAGGTGAGGCTGCGTTTGTTTTGTTCGTTGCC
+GCTTTTTGCCTGATGCGACGCTGACGCGTCTTATCAGGCCTACAAGACCCGAGCACAGAA
+CCGTAGGACGGATAAGGCGTTCACGCCGCATCCGGCATTCAGTGCCTGATGCGACGCTGA
+CGCGTCTTATCAGGCCTACAGGTCCCGAGCACAGAACCGTAGGACGGATAAGGCGTTTTA
+CGCCGCATCCGGCAACCGTTGTCGGAACCGAAAACAGCAACTCACCCCGCCCGTAAAAGC
+ATTTTCATTTTTTCGCTGCGACAAAACTGACGCTTCACTTCCACCACCAGCGGATGGCGC
+GACAGCACAATCATCACCACAAACGCCAGCACCCCCGTGGCTATTTGCACCGCCAGCAGC
+ATCCCCAGCGCCAGTTGCCCTTTCAGCACAATGCCCAGCGCATAACTGACCACCAGCGTC
+GGCAGCGAGAGATAAAACGGCAGCCATAAACTCAGGATGTACTGGCGATAACTGGAACCA
+AGAACCGGTTTAATCATCACGAAGTAACTCAGAATGGTGTTGATAATTTGCACCAGCAGG
+AAGCCAAGCGTGACGCCGATCGCGCCCGCCATCTGCCCACCTATAACAATCGCCGGAATA
+AACAGAAATGTTTTGAATACGTTGAATTTAAAGCTGATATCGACCCGCGCTTTCGCCATC
+AGCAGCGAACCAATCGGGTTACCTACGGAGCGCAGCAGACCCACCACACACAGCAATTGC
+AGCACCGGAATAATGCTGTTCCACTTCTCACCAAAGACCAGCGGTACAAAGTTATTCGAC
+ACCACCATTAGCCCGAGCAGCGCCGGAAAGTTGATAATCCCCACTACCGACAGCAGCTTG
+TAGAAGTTAACACGCAGCTTTTCGGTATCGTCCTGAATTTTGGCGAATGCCGGAAACAAC
+ACGCGGGTGATGATTGGGTTCAGCTTCATCGGTGGCACAACGGCCACGTTGTACGCCAGG
+TTGTATCCCCCTGCCACGCCCGCGCCGAGAATACGCGCCAGCACGAGCGTTGAAAGGTTG
+GTATTGAGATAGTTGATGATGCTGTCCGCCGTCAGCCAGGCACCAAAGCGTAAGTTCGGT
+GCCACCGACGCCAGCGAGAAATGCAGACCGGGGCGATAAATTTTGCGGCCAAAGTAGCCA
+AACAGCAGCGTTCTCACCGCACTATTGACCAGATAACCGAGGATCGCGGTCATCGCCAGC
+GGCCAGAAATGGGCGCTAACCACCGTACAAGTGAAGCCCGCCAGCACCGCGCTGGTTTCG
+ATCATGCCGATTTTGTTGAACTCCAGCTCTTTTTGCATCAACGCGCGGAACTGTTGCCCG
+TGGGGGATTACCACAAACGCCAGCGATAATGTTTTAATCAACGGTGCCAGGTCCGGGTTA
+TTCAGCACGTCGCCGATGAGATCACTCAACAAAAACACCGCCACGCACACCACGATCCCC
+AGCCCGACGTTCAGCCAGTACAACGTGGTGAGTTCAAGGTGACTGATTTCTTTTCGCTGA
+ATAATCGAGTTAGCGATACCGAAGTCAGAAAGCGTATCTGCCAGCGCGATAATCACCAGC
+GACACGGTAAGCAGGCCGAACTGGTGGTTGTCGATAATCCGCGCCAGCACGGTCATCTGC
+ACCAGCCCGAGGCCGATGATGATCACCGTGGCAATCGCCGACCACTTCGCGCCGCTGATG
+GTTTTTTCACGTAAGCTCATATCAATATGCCGCTTTGTTAACGAAACCTTTGAACACCGT
+CAGGAAAACGATTTTGATATCGAACCAGACGCTCCATTCGCGGATGTACTCAAGGTCGAA
+CTCGACGCGTTTTTCCATTTTCTCCAGCGTGTCGGTTTCGCCGCGCCAGCCGTTAATCTG
+CGCCCAGCCGGTAATGCCCGGTTTCACCTTATGGCGCAGCATGTAGCCTTCAATGAGCTG
+TCGATACTGTTCGTTATGCGCTACTGCGTGCGGACGTGGACCGACAATCGACATCCCCCC
+GGTCAGCACATTGATAAACTGCGGCAATTCATCCAGCGAGGTACGGCGCAGAAAGTTCCC
+CACTTTGGTGACGCGCGGATCGTTCTGCGTCGCCTGGGTCACCACTTTGTCGTTCTCCAT
+CACTTTCATGGAACGGAACTTCCACACTTTGATCGGCTTGCCATCCATGCCGTAGCGAGT
+CTGGCGGAAAATAACCGGCCCTGGTGAACTGAGTTTCACCGCCAGCGCAATACAGCACAG
+CACCGGGGAGATCAGCAGCAGAATAAGCGTCGCCAGCACAATGTCTTCCGCACGTTTGAG
+CAGGCGGTTAACCCCGGAAAGCGGCGTGTCGTAAAGCGGCACCACCGGTACGCCGTTCAT
+CTCTTCGAGGCGTGAATGGAGAATGTTGAAGGTAAAGACGTCGGGGATCAGCAGCACCGA
+ACAGGTGGTGTCCGCCAGTTGATGGACCAGTTTTTTCACTCGCGCGCCGTCGCACATTTG
+CATCGCGATATAGACGTTATGAATCTTGCCCGCTTTCGCGTCCTCGACCAGCTGTTGCAG
+GTTACCCGCCCAGTCGTTAGAAACGCCGCCCGGTTTCGGGTCGTGGTAAACGCCCACCAC
+TTCAAACCCTAACCACGGCTGGTTACGGAAGCTCTCCATCAGCATTTGCCCGGCGGCTAA
+ATCCCCCGCCACCGCGACCATGCGCTTGTTATAGCCATGATTACGCAGCCAGCCCGCCCC
+AATGCGAATACACGAACGGCAAACCACCAGTCCGATGCTGGTCAGCGCATACCACGCCAG
+CCAGATTTTCAGTTGCGTGTCGAAATCATTGTTGAACGCCACCAGTCCGGCGCTGAAAAT
+CACGCTTAAGGTCCAGTTTTGTAGCAACAGGGCAAATTCTGTCGCTGCCCGAACACCGCG
+CCATGAGCGATAAAAATCGGTGATGCCGCCCAGCATCTGGAACACCACCAGCGTAATCAG
+CGCCACCAACAGGTGCATGTAGAGGAATGACAGTCCGCTGACTTCGCAAACCAGCCATAG
+TCCGGCAAACATGATGGTGATATCTGAAAAGCGTTGCACCATAGAGATTAACGATGCATT
+GGTTTTCGCTCGCTCGCGCTTTTTTAGATTTGTCATCGTTGTTCCTGTTATTAGCCCCTT
+ACCCGCAGTGGGGTAAGGGAAGATCCGACATTACTCGTTCAGCAACGTCAGCAGAGTTCG
+CGTTCGCGCTTCCATCAGCGGCACATCACCGCGCGATTCCACATTCAGGCGCACCACCGG
+TTCGGTATTGGAGGTGCGCAGGTTAAAGCGCCAGTCGGCAAAGGTCATGCTGATGCCATC
+GGTGCGATCCACCGCCAGCGCCTCACGGCTAAAATGCTGTTCCACGCGGTTAATCGCCTC
+AACGGGTTGCGCCAGTTTGCTGTTGATCTCACCGCTTGCCGGAAACGCCGCCATCCGGTC
+GCGTACCAGTTCGCCCAGCGTTTTATCTTTCAGGCACACCAGTTCGGCGACCAGCAGCCA
+CGGGATCATGCCGCTGTCGCAGTAAGCGAAATCACGGAAGTAATGGTGGGCGCTCATTTC
+GCCACCATAGATGGCGTCTTCCTTGCGCATACGTTCTTTAATAAAGGCGTGTCCGGTTTT
+CGACATTACCGGCGTGCCACCTGCGGCAGTCACCACATCAACGGTGTTCCAGGAGAGACG
+TGGATCGTGGATGATCTTCGCGCCGGGATTTTTTTCGAGGAATGCTTCTGCCAACAGGCC
+GACAATGTAGTAGCCCTCAATAAACTGCCCTTTTTCGTCAAACAGGAAACAGCGGTCAAA
+ATCGCCATCAAAAGCAATGCCCATATCCGCGCCGTGTTTGATGACCGCATTGCGGGTGTC
+GTCGCGGCATTCCGGCAGTAGTGGGTTAGGAATACCGTTGGGGAAATTGCCGTCCGGCGT
+GTTGTGCACTTTGATTAATTCCACGGGCGCGCCGAGGGCTTTAAAGCGGGCTTCAATGGC
+GTCCACCACCGGACCCGCTGCGCCGTTCCCGGAGTTGATCACCAGCTTGAGCGGCGTGAG
+GTTTTTGACATTGATATAACCGAACAGGTGATCAACGTAAGCGTCACGCAGGTTGATTTG
+CTGATAGCGACCGCGTTTGGTTTCATCGACGGGAGGAAAGTCGTTGGCTTCAGCCAGACG
+CTGGACGTCGCGCAGTCCGGTATCTCCGCTGATCGGGCGAGCCCCCTCGCGAACCAGCTT
+CATGCCGTTATAATCCATCGGATTATGGCTGGCGGTAACTTCAATGCCGCCATCCACGCC
+GAGATGGAACGTGGCGAAATAGATCTCTTCGGTGCCGGACATACCAATATCCAGCACGTC
+AACGCCCGCATCCTGTAAACCTTTCGCCAGCGCCAGTTTTAAGGTTTCGCTGGTGAGGCG
+GACATCACCGCCTAACACAATGGTTTTCGGTTTGAGAAATTCGCCATAGGCGCGACCAAT
+GCGCCAGGCGATATCTTCATTCAGTTCTTCGCCTAATTTCCCGCGAATATCATAGGCTTT
+AAAGCAGGTTAATTTTTTCATATCGTTACCCTTTTTCAGGCAATAGTTGGCCCTGACCGA
+AGCGGCCAATTTTATTTTTGTCGTTATTTACACCGCGGTTTCGCATTCATTGCCTGATGC
+GACGTTTACACCCGTCCGTAGCGATCCGCGAAACGCACCACATCATCCTCTTCGAGATAA
+GAGCCGGAGCGCACTTCAATTAAATCGAGCGGAATTTTCCCCGGGTTTTCCAGGCAATGC
+GTCGCCCCCAGCGGAATATAAATGGACTCGTTTTCACCAAGCAGTTTGATATCACCATCA
+ATGGTGACTTTTGCCGTTCCCGCGACAACCACCCAGTGTTCCGCGCGGTGATGGTGCATC
+TGTACCGACAAGCCCTCGCCCGGTTTCACGGTGATGCGTTTCACCTGGTAGCGGTCGCCC
+GCGTCGATAGAGTCATATTTGCCCCACGGACGATACACTTCGCGATGCACCCGATGCTCA
+TGGCGACCATCGGCTTTGATCTGCTCGACCACTTTTTTCACATCCTGTACCGCGTTACGG
+TCGGCAATCAGCACCGCATCTTTGGTCTGCACCACTACCAGATCTTTCACCCCGACGGTG
+GTGACCAGGCCAGATTCAGCATACACATAGCTGTTTTCAGTTTTGTGATTAATCACATCG
+CCGTGGCAAACGTTGCCCTCGGCGGTGTGGGCGCTGATCTCCCATAATGAAGACCAGGAG
+CCAACATCGCTCCAGCCCGCATCCATCGGCACCACAACAGCATCTGCCGTACGTTCCATG
+ACCGCGTAATCCACCGACTCTTCCGGGCAGGCGAGAAACGCTTCTTCATCCACGCGAATA
+AAATTGAGATCCGGATCGACGGCGCTCATCGCTTTTTCACAGGCATCGAGGATATCCGGG
+CGATATTTTTTCAGTTCTTCGAGATAGCGTCCGGCGCGGAACAGGAACATACCGCTGTTC
+CAGTAATATTCGCCGCTTGCCACATAGGCCTGAGCGGTTTCCAGATTCGGTTTTTCGACA
+AACTGCGCCACTTCAAAGGCCACCATATCCTGCTCACCCGCAGACACTTCACCGCGACGA
+ATATAGCCATAACCGGTTTCTGGTAGATCCGGCACAATGCCGAAGGTCACCAGCTTGCCC
+GCTTCGGCATATGGCATGGCATTACGCACGGCGGCACGGAACGCGTCTTCATCGGCAATC
+ACATGATCCGCCGCCAATACCAGCATTAACGGGTCGCTCTCCGGGCTATGACGTTTTGCC
+GCCAGCGCCGCCAGCGCAATGGCAGGTGCCGTGTTTCGCCCTGCCGGTTCGAGAATAATG
+TTCTCGGTAAGTTTGTTCAGTTGACGCAGCTGTTCCGCGACAATAAAGCGGTGCTGCTCA
+TTGCAAATCACCACCGGGCTTTCGCACTCCACGCCGTTCAGGCGGCAGATGGTGGTTTGC
+AGCATGGTGAGATCGCCTTTCAGGCATAAAAACTGCTTGGGATAAAGTACGCGGGAAAGC
+GGCCATAAGCGGCTACCGGAGCCACCTGCCATCACAACTGGATAGAGTTTCGACTGCGCC
+ATAATTATCCCCGAATATCATTTATAAATTGACGTAACACGTTCTCTTTATCGAGCGTGC
+GTTCGGCATATTCACGTGCCACCGTGTTGTGTTTGGGCAGCAGGAGCGCCTGACGGATCC
+CCGCCACCAGCGCCTCGACCGATTCCGGTTCAACGCAAACCGCAATGCCCGGAAAGGTTT
+CGCAAAGCTGCCCCAGTTCTGTGTAGGCTTCAGCAGTAATCACCGCGTTACCGCCTACTG
+CCAGAATATTGGTCAGTTTCGACGGCAATACGGCATCTGCCGCGCCGCGTTTTTGCACCA
+CCAGATGGCAATCGCCCATCTTCAGCAGTGCGGGTAAAGCGTCATACGATTGCAGCGGGA
+AAAATTGCATGTTGCGCAGTCCACGCTGCTGCGCCATTTTTTCCAGCCGCGCTTTGCCGC
+CGCCCTGCCCGACAATGGCAAAAATCAGCGGTTCATCGCGCAGACGATCGGCAGCTTCAA
+TAACGTTTTCCAGCCCCTGCTTTTCACCAATATTGCCGGAGTAAAGAATGATTTTTTTGT
+TATCCGGCAGGTCAAGCTGGTTACGAAGGGCATCAACATCGGCATCTGCAACATGCTGAA
+AACGGGCAATTTCCGACCAGTTGGGGAAGAAGATGACGTTTTCCGCCGCCACGCCTTTTT
+CGATGGCTTTATTCATCATCGAACGCGAAATCGTGGAGACGTTATCGACGTTATGCAGTC
+CGCTACGTTCGAACGCCGTTGCCAGCTGTGCCACTTTGCCGCCTTTGCCTTTTCCGGCAA
+GGCCCAGCCCCAGCATGGCGTCCACTTCGTAATCCTGAATATGCAGCACGGTACGCGCAC
+CAGAGAGTTTCGCCAGCAGGCGCATTCCCGGCGCGCAAAACAGCGTTGGCACCACGCCAA
+TAATGCGATCCGGCTTCCAGCGACGTTGCGCCATCAGCGGAAAGAAACTGCTGACGGCAA
+AACTGCCCAGATGCAACAGGCGTTTCAGGGTGCTCGGCTGTTTTGGCACATACAGCGGGC
+AGCGCCACACCGTGGCGGCCCCCTCTTCTCGTTTGTAGCGCCAGGCGGAATAGTTCTCGC
+CCACCTGCCATTGCGGGTAGTAAGGCGGTGCGGTAATGACCCGCACCTCATGACCTTGTG
+CCGCCAGCCATTCCACCATCTCGCCGGTGTATTTGCCGATGCCGGTTAACTCCGGCGAGT
+AGTTAATGCCGTAGACCAGTATTTTCATAATCCGGGTACTCCGGTACGCTTCTCAGCGAG
+AAAATAGGCGCGGCTGTTAGCATGAACATTATCACTGGCGAGCAGCGCGTCCGACGTCAG
+CCAGCGGTAATCGTCATGCTGCTCATCCGGCAGTAACAGCTCTTCTTCCGATACTCTGAA
+GCGAAAACCGAGCACCACATAGTGAGTGGTGAAATCCGTGCCAGAGAAGTTATCGTCATA
+AAAGTGCTGCCAGACACCGTAAAACTGGCCTGCTGTTATCGGCAAACGCAGCCCCAGTTC
+CGCCATCGTCAGCCGCTCAAATGCGGCTTCCAGCGTTTCGTCTTTCTGCACGCGCCCTCC
+CGGCACAAACCAGTAACCCTGCGCCGGGCGGTTGGTTCTTTTGCCAAGCAGAAACTCGCC
+GCGACTGTTCTCGACAATAAAGTCGAGAGAGACAAGCGGAGTGGAGCGCACTACCGTGGC
+AAAGTCTTCCTGACGTAAAAACATCATTACCCCCGAAAGCGGTCTTGATTCTCAAGGAAC
+CACTGGTAAGTGCTGGCAAGCCCCGCTTCCAGTGAGATTTCGTGATACCAGCCAAGCTGA
+TGCAGGCGCGTCACATCCAGCAGTTTGCGCGGCGTGCCATCCGGTTTGCTGGCATCAAAA
+ACCACCCGGCCTTTGTAACCCACCACTTTGGCGATGGTTTGCGCCAGCTCGCGGATAGTG
+CAGTCAACGCCCGTGCCGACGTTAATGTGCGACAACATCGGCTGGGTGTTCTCCAGCCAG
+ACTTCATGCGCCAGCTCCATGACATGAATGCTCGCCGCCGCCATATCATCGACGTGCAGA
+AATTCGCGCATCGGTGTACCGCTGCCCCATACCACCACGTCCGGCGCATTCTGTGCCGTC
+GCCTCGTGGAAGCGACGCAGCAATGCTGGGATCACATGCGAATTACTCGGGTGGAAGTTG
+TCGTGTGGCCCGTACAGGTTGGTCGGCATGACTGAGCGGTAATCGCGTCCGTACTGGCGG
+TTGTATGATTCGCACAGTTTGATCCCGGCGATTTTGGCAATAGCATAAGGCTCGTTAGTC
+GGCTCCAGCGTGCCCTGCAACAACTCGCTTTCTGCCATCGGCTGTTTTGCCAGTTTCGGG
+TAGATGCAGGACGATCCGAGAAACAGCAGTTTGTTCACGTCGTTCTGATGCGCGGCGTGA
+ATGATGTTGCTCTCAATCATCATGTTCTGGTAGATGAAATCCGCCGGATAGGTGTTGTTG
+GCAACAATGCCGCCCACTTTCGCCGCCGCCAGATAGACCTGGTCAATACGTTCGCTGGCA
+AAGAAATCATGCACGGCGCGGCTGTCCAGCAGGTTCAGCTCGTCGCGGGTGCGTAATACC
+AGTTCCACATCACCGCGCTGTTCGAGCTGCCGCCTGATGGCGGAACCGACCATCCCGCGA
+TGACCAGCAATAAAAACTCGTTGTTTACTCATGCTTATGACTCCAGCGCGATCGCCACGT
+CGTAGCCGTGAGATTTCAGCAGAGAGTGTTTTTTCGCCGCTTCGAGGTCATTAGCCACCA
+TTTCAGACACCATCTCTCTGAGGGTGATTTCCGGTTTCCAGCCCAGTTTTTCGTGCGCTT
+TGGTCGGGTCGCCGAGCAGCGTTTCAACTTCAGCCGGACGGAAGTAACGCGGGTCAACAG
+CGATAATCACATCACCCGGTTTAACGCCCGGCGCGTCATGCCCGGTGACGGAAACCACAA
+TGCCCTTCTCTTCAACGCCCGTGCCTTCAAAGCGCAGTTTGATGCCCAGCTGTGCTGCCG
+CCATTTCCACGAACTGACGCACGGAGTACTGAACGCCGGTCGCGATAACGAAATCTTCCG
+GCTGTTCCTGCTGCAGCATCATCCACTGCATTTTTACGTAGTCTTTGGCGTGGCCCCAGT
+CACGCAGGGAATCCATATTGCCGAGGTACAGGCACGACTCCAGCCCCTGGGCGATGTTGG
+CGATTGCGCGGGTGATTTTGCGGGTAACGAAGGTTTCGCCGCGGCGCGGGGATTCATGGT
+TGAAGAGAATTCCGTTACAGGCGTACATGCCGTAGGATTCACGGTAGTTAACGGTGATCC
+AGTAGGCGTACAGTTTGGCGACCGCATACGGAGATCGCGGGTAGAACGGCGTGGTCTCTT
+TCTGCGGAATTTCCTGCACCAGACCATACAGTTCAGAGGTGGAAGCCTGATAGAAACGAG
+TTTTCTTTTCCAGACCGAGGAAGCGGATCGCCTCCAGCAGGCGCAGCGTACCCATCGCGT
+CGACGTCAGCGGTATATTCTGGTGACTCAAAAGAGACCGCAACGTGGCTCATTGCGCCCA
+GGTTGTACACTTCATCCGGCTGTACTTCACGCAAAATGCGCGTCAGGTTAGAGGTATCAC
+TCAGGTCGCCATAATGCAGATGGAATTTCGGGTTGCAGGTGTGCGGATCCTGATAAATGT
+GATCCACGCGCTCGGTGTTGAATGACGATGCGCGACGCTTAATACCATGCACCTCGTAAC
+CTTTTTCCAGCAGAAACTCTGCCAGGTAAGAACCGTCTTGTCCGGTTACACCGGTGATGA
+GAGCGACTTTTGACATGTATTATTCCTCTGTATTTTTGAATTTATTCAGTTTCAACGCGT
+TCGCGTATCACCACTGCGGGATTCCCCCGGCAAACCACATTTGCCGGAAGCGATTTAAAA
+ACACTGCTTCGTGCACCCACGACGGTGCCGTCGCCGATTGTGACGCCTGGGGCAACAAAG
+ACATCGGTTGCCAGCCAGCATTTCTCGCCAATCACAATAGGCGTGGCGTTAATGGTGAAA
+TGTTGACTTGCATGGTCGTGGCTACCGGTGCATAAATAACTTTTTTGCGATATCACCGAA
+TGTGCGCCAATGGTTATTTCACCGAGGGTATATAAATTGACGTCATCGCCGACCCACGCG
+TAATCACCTAAGGTTAATTTCCACGGATAGGTAATTTTTACTGACGGACGAATAACTACG
+TTTTTTCCTATTTTTGCTCCGAATAAACGTAATAAAAAAGCCCGCCAGCGATACAATACT
+TGTGGCGACCAGGCAAATATTGTTGCCTGTACTGCCCACCATAATTGCACTTTAATAGCG
+TTGCCGCCCCGGAACCCTTTCGGCACCGAGAAACCGCTTAAATCTTGCATTGGTTTTCCT
+TATATTCAGACTTTGTTATATAAGGCTTTCGTCTTTGAGGTAGTACGTTGGCGTAAATGC
+CAGGATAATTCAGCCCAAAAGCCAGGCACATGTAATATTTGTCGTTGGACTTTTTTCGCG
+TCAGCACACAATTCCATATTATTGGTGGTAGATACCCCACCCATGGAAAATTCAGACACC
+AGGCCATTGAGTTTTTTAAATGCATAACCGGCTTTATACATTTTGGCTGCCAGCGCGTAG
+TCGGAAGAAACTTTATATTCCAGGTCATAACGCCATTTTTTCAAGCCGGATACAGGGAAA
+AATATCGCCTGATGACTGGCGGGCAGGCTGTGATAAATATACCAGCCCGGTTTGGCGCTA
+CGTTTAATTTTATGCCCGTCGCCAAAATCCAGCAGCGCATCGCCGGTGATCATCACGTTA
+TCTTTTTGCATTTTTAACTTACGGACAAAATTTGCGGCATTCTGATGAAAAATATCGCCC
+GAATTGAGAAACAACGCGAACTTGCCTTGTGCCATCGCAATGCCTTTGTTCATGGCGTCG
+TAGATACCGTTATCTGGCTCGCTGACAAAGCGTAGGTTAAAGATACCATTGAGATTTTCC
+AGATACTCACGGGTGCCGTCGTTGGAACCGCCATCGACAACAATCCATTCGAAGCTGATA
+TCTTCCACCTGCGCCAGATGCGCCAGCGAGGCATGTGTTTTGACTATCCCTTCGAGGTTA
+CGAAACGCGACAGTGATTATGCTAAGCAACATGTTCTTATTCTTACCTCGTAATATTTAA
+CGCTTTTCGCAAAATAAACGGACAGACGATTAAAAATGCATATTCCGGGCTAAATATCGA
+ACCGGTAAAAAACAGCGATACCGGAGTAAAAAGATATAATTGCACGCGAAAATTGCGGTT
+ATCACCAAAAGCGTTGATCATCATTTTTATCACTTTCCCCATGTACCACAGTGATAAAAA
+CACCGCGAACCAGGAAAAATAAATAATCAGCAGATACAAACCATTGTCTATGGTTTTTCC
+GACATCCGCACCGTTAAATATTCCGAATGATGCGACATATTCATAAAGTGAGCCAAATCT
+GACTACACCGTCAATATGGGTCAAAGAATAACCGACCATCACCAGCGGACCGACAATACG
+ATAATATGATGACGATCCTTCCGTACCTAAATCGCCCAGACGGGTGGAAATATAAGGAAA
+CGCGATTACCACACCAACCAGGAATACAGCCAGAGAAATCAATGCTAACGGTAACTTTTT
+CTTAATCGCCTCTTTATTCAGATATTGAAATGCCCACTCCAGCAAATAAAACAGGATAAA
+GGTCATAACCCCTGAAAACGATCCGGATAATATTATCCCTGCGAGAATCATAGCATCTGT
+TTTAGGCGTTTTGATACCAAACTGTTTGATGCTGAGCCAAATTGAGATTAATGCCAGAGC
+GAAAAATGCCGGTTCGAAATAAAGTGCTGTCGTGCGCTTGCCGCCGAATTTAATGAAATT
+CAGCACATAGCTGTTGCTGTAAATCAGATATTTCGAAATCGACTCCATAATACTGCTGCC
+ACCGGTGAGGATAATTTGTGCCATCTCCACCGCCGCCAGCGCCACCACCAGCCCGACCAC
+CAGATAAAAGAAACGTAATATCTTGCGATGGTTGTGTGGCGAAATTGTTTTAAAACGAAT
+ACTCCACACCATGCCAATAATGATCACAATATAGACAAACAGCATAGTTGAAGTGACGTA
+TTTACTGGCATCCAGCGACTGACCAAACAGATAGTTAAACGCCGTGAGTCCCGCGCCAAT
+CCCTAAGGCAATCATCAATTTTTTAACGCTGATGCGTTCTAAAAACAGCAGTAACAAGAC
+AGGTAAAAAAGTGACGATGGTGATGGGGAAACTTTCGCCAAGCTGGGCGATTTTGACGTT
+AACCAGCAGATAAATCAGCGGCAGCAACAGGTAGCTACAGATTCTGATAGAAGTTGACAT
+ACTCCTCCAGCATCTGTTGTCCACTGTAGGCGGCGCGGCTGCGTTGGCTGAACTCAGCCA
+GCGTGGTACCAAATATCGCCTGCGCGATTTCCGGTTTGCTTAACTGCACCAGTTGCAGCA
+CCTCTTCTTCGCTGACGGTTTTACCGCCGGATTTTTGCAACACTTCCCGCGCCGCATCGC
+TATGGGTGGCAATCACCGGCACGCCAATCGATAGCGCCTCACACAAAATCAGCGGGTAGT
+TATCGACGCGAGAACTGAATACCAGCGCATCCATCTGATTGAGCGCGCTCATCAGCTTAC
+GTTTGTCGGTTTCAAAGCCGTGATTAACCACGTTGCCAGCGGTGAACGGCGAGAACTTAC
+CAAAGGTATGCAGTTCAATTTTGTCGCCCAGCGCCATCATCTCGCGTACCAGTTGCTGGT
+TAGTTTTGCCGTCGTAACGCAGATCATGCGCCACCACCGCGATTTTCGGCTTGCCCTGGG
+TTTCGCGCACCGGAGGCAAGTCCGCCAGAATCGCTTCAGTTGCCATATCAATGCCATTAT
+TGATAATCCGGCAACGCCCTGGACCGTACAGGCTATTGAAAGCGTCAGCCACATGCTGGC
+TGGGGGAAATAAACTGACAGCCCAGCGCCAGCATCTCACGGAATAACTGGCGTTTGCCCG
+CCACCAGTTGGTGTGCGCGATCAATCTTCACCGGCGGATAGTTATTTAAGGTCGGGCATT
+TCTGGCAGCCTGTTTTCCAGCCTTCGCAACCGTCGGTAAAGGCGCAGCGTCCGGTAACAC
+TCCAGTGGTCGTGCAGCGTCCAGACCAGAGTGACGTCCGGTTTATGGTTTTTCACTTTTT
+CGCAAAAGCGCACCACGCTCTTAAGATTTAGCCAGTAGCTGTGCAGCACATGAAAATGCA
+GGACCACCGGACCCGCTGTGCGAGTAATGGTGCGATATAACTCATTGAAATTGCCAAACA
+GATCGCGATTAAACAGACGAAACAGAGCAATATTCGCCATCGCGGTCATCCGCGGCGTAT
+GTTTGATGACCTGCGGATAGTTCTGATGGCTGACGCTCTCTTTGCCGCCTTTGCCGTAAC
+CGTAGACAAAATGTGACGCCAGCCCCTGTTGCAGCGCACGCTGGTGGAGATCTAACGCCA
+CACCTGCTGCCCCGCCTTCCGCCAGTCGCACATTAAATTGCAAAATATTCATTTAATTAC
+CTTCACTCGCGCTTTTTCTCCCACCACCAGCGCGTTGTCCGGGACAGAGTCGAGCACCAC
+GCTGCCCGCGCCCACGGTGACGTTGTTACCAAGCGTGATATCACCAAGAATAATGACGTT
+GGCACCGAGTTCGACGCCGTTGCCAATGTGTGGACATGCCATGTTATCGGCACCACGATT
+GCCGATAGTGACGCCGTGGCGAATGGTAAAATCATCCCCCGCTACCACGTTTTTATTGAT
+CACGACGGCGTAACCGTGATGGATAGTAAAGCGGCGGCCAATGGTCGCGGCAGCCTGGAT
+TTCATAACCGAAAAAGCATTCGGTGATAATGCGATACAGCACCAGCAGCGGGGCCGCCCA
+CAGATTGTTGAGGACGTTCTTTTTGCGCCACACCGAACAAAAATGAGCAACACGATAGGC
+AAGAACCATGCAGCACGGGCGTAAACTCCAGCTGTTGGCGCGCAGATCTTCCAGCATCTT
+TAGCGCCCCCGAATACCATCAGCCAGACGTTTGCCGTTACGCACCGACAGCAGCGTCAGC
+AAAGTGCGCCAGGTCATACGTTTATTGCGGATCTGGTAGAGGGTAAACAGCTGATATTTT
+TTGCTGGCGCGGTCGAATTTGTCTTTGTGCTTGCGGTAAAAGTGGAAGTACCCGGAGAAT
+TTTTTCGGTGACGAGGTGATCTGCATTTCACCGTGATTGATATGCAGGATCTGCGTCGCC
+TCTTCTACTTTCCACGGTTCGCCGTACTCCACCACCATCCGCAGGAAGATGTCGTAATCC
+TGTGCCGCTTTCAGTTCGGTATCGAACAAACACTCTTTGAAACGCCATGCCCAGGTAAAG
+ACCTGGTTGCCAATGATATTGCGTTTGTAGAACAGGCGGCGTGAATACGGCGATTTGGGA
+TACAGCGGCAAGCTTGCCGGTTGGGAATAGACTTCGCCCTGGCAAACGTAGTCGTTAGCG
+TACAAAAAGGCGTGTGTGACCAGTTGCTGTTTATGGGCGAGGAAGACGCTCAGACGGTTG
+GGTGTCCATTCGTCATCGTCATCAATCCCGGTGATATATTCCCCTTGCGCCAGCATAATC
+GCCTGGTTACGTACCGCGCACGCCCCGCTGTTAATGTCGTTGTGAATGTAAGTGATACGC
+GGATCGTTGAGGGCGGTGACGTACTGTTGCAGTTGTTCCCAGGAGGTGGAGCAATCATCC
+ACGATGATCATCTCCCAGTTGCTGTAGTCCTGGCGCAAAACCGATTTTATTGCCCGAATC
+GCCAGTTGTTGGCGGTTCCAGGTCGGCATATAGATTGAGATCAGCGGATTGTTTTTCATA
+GGTTGTTCTCCCGGCTTATGAGCTGGTTTGCTTGCCGGATGCGGCGTGAACGCCTTATCC
+GGCCTACGGGGCGGTGCGAATGCAGGCGTCGTTATTTCGCATCCGACTTATATTCGTATT
+CGTAATAGCCATAATCCTGATACGCGCTGGCGCGGCGGAAGATGGAGTTCAGAATCACCC
+CTTTCACCGGAATACCGTTTTGCTCAAAGCGGCTCAGACTGGTTTCCACTTCTTTCAATG
+TGTTGACCGCATAACGCGCCACCATTAACGTGGTTCCGACATGACGACCAACAATTGCCG
+CATCGGTCACTGCCAGAATCGGCGGCGTATCAATCAACACCAGGTCATAGTTTTTACTCG
+CCCAGTTCACCAGTTCGGCAAAGCGTTCGCTCATCAACAGTTCAGAAGGATTTGGCGGCA
+CCTGACCGCGCGGGATCAGGTCAAATTTGGCAATAGAGGTCGGTTTAGCAGCGGTAGTAA
+TATCGCCCTGACCAATCAGAATTTCCGACAGGCCATTAACGTTATTAGTGCCCAACAGCT
+CGTGGGTGTAGCCTTTGCGCATATCGCAGTCGATCAACAACACGCGTTTATTGGTCTGGC
+TGATCACCGCCGCCAGGTTGGCGCAGACAAAGGTTTTACCAATTGACGGGCTAACCCCGG
+TCATCATCAACACATTGTTCTGTGCCTGCATCATCGCGAAGTGCAAACTGGTACGCAGAC
+TACGGATGGCTTCAATCGCCAGATCGGTTGGATTCCCCACCGCCAGTAGCTGGCTCTGTT
+TATAGCGTTTAATCCCTTTGATGGTTTTGACGCTATCACGCGCTTTCTGCCATTCCGACA
+GCGGGATGCTGGCATAGACGCTAATACCGTGTTCTTCCAGTACTTGCGGGCTTTCAATGC
+CGCGATTAAACAACGAGCGCAGCAGCACACCCACGATAGAAAGCATCAGGCCAAGGATAA
+TCGCGCCGAGGATAATCAGCCCTTTCTTCGGTTTCAGCACGCCAGGCTGAGTGATTGCCG
+GGTCAACAATGCGCACATCGCCGACGGTGCTGGCCTCGGTGATTTTCAGCTCCTGCTCTT
+TATTCAGCAGTTGCATATAGACCTGCTGACCAGACTCGACATCGCGGGTCAGACGGACAA
+TCTCCTGCTGGGTTTTCGGCATCGCCGTTACGCGACCGTTAAGTTTGGCTTTTTCGTCTT
+CCAGCGCCTGACGTTTCTCCAGCAGCGTGCGGTACGCCGGGTGAACTTTGGTGTACAGCT
+TGGAGATTTCCGCCTCTTTAAAGGTCAGTTCGTTCAACTGCGCATCGATGTTCACCATCG
+AATCGAGCACCGCTTTTGCTTCCAGCGGCAGATCAACAGAATCTTTATCCTGACGGAAGG
+CATTCAGTTTGTTTTCGGCAACATCCAAGCGGCTACGTACTTCCGGTAACTGTTGCGCGA
+GGAAGGCGAGGCTTTTCGACGCTTCCGCCGATTTGCGCTCAATATTTTGTTCCTGATAGT
+TACGGGCGATGCTGTTAAGAATGTCGCGGATCTGTTCACGATCTTCACCGGTATAAGTCA
+GGCTCAAAACGCCAGCGTCTTTGCCGTTCTCCGTTACCGTCAGGCTGTTTTGCAGTTGGT
+TGATCATCCCCAGCGTGGAGTATTTGGTGACGGTAAACTCACTGCCCGGGCTGGCGTGAA
+TGGCTTCAACCATCAGCGTGACGCCTTCTTTTTTCAGCATCTGGCCCGCTTGCCCCCGGG
+CGCTAAAGCCGCCGTCGCTGCTCAGGGTGTAGTTTTTGTTGTCCAGCACATTAAGCGTAA
+ACACCTGATCCGCCATCTCTTTCGGGCGGTTAAAGGTGGTCACTTTCACCGTCTCGTTCT
+GACGTCCCATCAGGCGATCCCAGCCCGCACCGAAAATCGGGAACGTGTTTTTGCTCACTG
+CAATATCGAGGTCGAGATCGTCCACCGTTTTACCAAGCACCAGACGCGAACGAATCAACT
+GGATCTCGGCGTCCGATGCAGGCGGTTTGTTGGCTAATGCCGAACCAATGTCCTGCACTA
+ACGAATTGCCGCTGTTTTGCTCGATTTGTACCAGTGCGTCGGCACTATAAATCGGCGTGG
+CGAAGAAGGTGTAAACCACGGCACAGAGGGCGAATACGGTGGTGATGCCAATCACCCACC
+AGCGCGCTTCAATGACGGTGCCGACCAGGCGACCAATATCGATTTCATCACTGCCCGTTA
+CCGGAGCGGCATGTTGTTTTACTTTTTCTGTCATTCTTATACCTGCTCTGCGTTCAATGC
+CTGCGCCCACTGGCGGGCAGACCGTTCAAGTAATGTGTACACCGCTGCAAACGTTTCCCG
+GCTTTTGCGATACGGATCGGGGATTTCACATTCGTTATCCCAGTGACCAAACAGCATCAC
+TTTGCCGCGCATCTCCGGTGCCATCTCGCATAAGCGTTCGATATGGCGCTTTTCCATGGT
+CAAAATCAGGTCGTAGTTGCGACACAGACGGCGGCTGATTTGACGGGCACAGTGACCTTC
+CAGAGACAGTTGATGTTCTGCGGCGACGCTGATAGCGGTAGGATCAGCGCCCTTACCGAC
+CAGCGCGCCGAGTCCAGCGGACTCCACTTTCAGCTCCGGGTGATAACGTTGCAGTAAGCG
+TTCCGCCGTCGGGGAACGGCAAATATTGCCGACACAGACAACTAAGATGTTGTTAAACAT
+GACGATTACCAGTTATGAATGTCGCTGGCTGTATCCGTCATGTAACGGACACCGCTAATA
+GTTGGCAGCAACTGATTGATCAGACGGTTCCAGCGGGAAACCGGGGCGGTGGTGACATAC
+ACCACGTCATAAGGTTGCAGGCGGAATTCTGTCGCCATCACCAGCGACGTGGCATCGGAC
+ATATCCAGCTGGTAGATATTGGCAATCTTGCCGTTACGCCCGCCCTCGCCTTTCAGCGGA
+CGAATGACAAAGATGCCGCTGGCGTTGGAGGTGGTCATGTCGATGCCTTCAGCATTGCCC
+AGGGCTTCAGTCAGGGTCATGCCGCTAAAGTCCATTTTCAGGGTGCTCTGTTTCTTCACT
+TCACCCATCACAAATACTTTCAGATCATCATTACGTGGCACGTAGAGAATATCGCCGGGG
+TAAAGCAGGCGATTCTGGTTGAGGTCGCCGTTTTGCATCAGCGCCTGCAAAGAAATGCGC
+TCTTCACGACCATTGTGTGTTAGCACCACGTTGCGCCAGTCAGCGGTGTCGGTCAGGCCA
+CCTGCGGCGTTGATGGCGTCGAGAATAGTCAGTGGCACGTTGGTGATCGCCTGTTGACCG
+GATTTATTCACCTGACCGGAGATATAGGCCTTTTGTGAGCGGAAGGCGGCGATATTAACG
+TCCACCTGCGGGTCAGCGATGTACGTCGCTAAGCGCCCGGTAATATCACTGCGGATTTCA
+GCGAGCGTTTTCCCGACTACGTGGACCTTGCCGATATACGGGTAAAACATAGTGCCGTCA
+GGCTGTACCCAGTTGCCGGTGTCGCTGGAGCTGCGGTACTGACCGGCTGGCGTGGTGAGT
+TCCGGGTGATCCCAGACGGTGACATTAAGAACGTCCCCCGGCCCGACGCGATACTGGTAA
+TTCGCGATCTCACTTTCCAGCGTCATATTGGGGCGCGCTACATTCGGGCGTGGGCGTAAT
+TGGTCAATCAGGCGCGGGGTCAGCGGATAAACATTCACCATTTTGTCGAGATCGAAATCA
+GCGTCCTGCTGTTTGATGACGTCTTTGCCCATCGTCGACATATTGCTGCCCGGAAGTACT
+GTGCAACCGCTTATCAAGGTTACTGACACCAATAATGGCATCAATTTCATTTTGGATTTC
+ATCATTGTTTATTTATCACTTTGGCAGAGTAATTATCCTGTGCACTATTAATAGCAATGT
+CGCCATGCACATTTACCTTGCAGTTAATTGAATAAAAATTTAACTGGCATCAGTCCTAAA
+AAAATTGATTTCATCCGCAGGCTATTGACAGAATAATTCAGACTGGTCTTTCAGGCATCC
+AGACACGCTACCGCCCCTGGCTTTTTAGCTACCAATACACTGATTTAGTTTAATTTTTCA
+CACCCTCTCAGCATGCAGTCGTTGATGAGAAAGGGTTATTACGGAAATTAACTTCCGAAT
+ATAAGGTGACATTATGGTAATTGAATATTGGCTTTCCAATAATGCAGGAGGAAGTGTTAC
+AGCTAACGGAATAGCAGGCAAGATAACAATTCGGTAATTGGCTATTTTTAAGAATTATAT
+TAAGTGTCATTCAATATGGTTTTTAGGAGTTTCTTTAGGTTGACAATATTTAATATAGTG
+TCTCCACATGCGATATTTCTTAAATAATGTTTTATTATTACCACTTTTAATTCAGGGATA
+ATGTGAGGTTATTACCCTCAAATAATATGAGATAAATAGTGCTGCAACATTGCATTTTTG
+CCCCGATTTATCCATGATCGAATTGTGACATTTGTCATACAACGAATAGGTTTTGTACTT
+ACTATGGAATGGATTGCCGATCCGTCTATCTGGGCCGGGTTAATCACGCTGATTGTGATC
+GAACTGGTCCTCGGCATTGATAACCTGGTCTTTATTGCCATCCTCGCCGAAAAACTACCG
+CCGAAGCAGCGTGACCGCGCACGGGTTACCGGGCTGCTGCTGGCAATGTTAATGCGCCTG
+TTACTGCTGGCGTCAATCTCCTGGCTGGTCACCCTGACTCAACCGCTGTTCAGCTTCCGC
+TCGTTTACCTTTAGCGCCCGCGACTTAATCATGCTGTTTGGTGGTTTCTTCCTGTTGTTC
+AAAGCCACGATGGAGCTGAACGAACGGCTGGAAGGGAAAGACAGCAATAATCCCACACAA
+CGCAAAGGTGCGAAGTTCTGGGGCGTGGTGACGCAAATTGTGGTACTGGACGCCATTTTC
+TCACTCGACTCAGTGATTACCGCCGTCGGGATGGTCGACCATTTACTGGTCATGATGGCC
+GCCGTGGTTATCGCTATCAGCCTGATGTTGATGGCCAGCAAGCCGTTAACGCAATTTGTT
+AACAGTCACCCGACGATCGTTATTCTCTGCTTAAGCTTCCTGTTGATGATTGGCTTTAGC
+CTGGTGGCAGAAGGTTTCGGCTTCGTCATTCCGAAAGGCTACCTGTACGCTGCCATTGGT
+TTCTCGGTGATGATCGAGGCGCTCAATCAGTTGGCTATCTTTAACCGGCGACGTTTTCTT
+TCCGCTAACCAGACGCTGCGCCAGCGGACTACCGAAGCGGTAATGCGCCTGCTTAGCGGG
+CAAAAAGAAGATGCGGAACTGGACGCCGAAACCGCGTCCATGCTGGTGGATCATGGTAAC
+CAGCAGATCTTTAATCCGCAGGAACGGCGGATGATTGAGCGGGTACTTAATCTTAACCAG
+CGTACCGTCAGCAGCATTATGACGTCGCGCCACGATATTGAGCATATCGATCTCAACGCG
+CCGGAAGAAGAAATCCGCCAGTTGCTGGAGCGAAATCAGCATACGCGGCTGGTGGTTACC
+GACGGTGATGACGCAGAAGATTTGCTCGGTGTTGTTCACGTTATCGACCTGCTACAACAG
+TCTCTGCGCGGCGAACCGCTCAACCTGCGGGTGTTGATTCGCCAGCCGCTGGTGTTCCCG
+GAAACCTTGCCGTTGTTACCTGCCCTGGAGCAGTTCCGTAATGCCCGCACGCACTTTGCT
+TTTGTGGTGGATGAGTTTGGCTCGGTGGAAGGGATTGTGACATTAAGTGACGTCACTGAA
+ACCATTGCCGGTAACTTACCGAACGAAGTGGAAGAGATCGACGCCCGCCATGATATTCAG
+AAGAATGCGGACGGTTCCTGGACGGCGAATGGTCATATGCCGCTGGAGGATCTGGTGCAA
+TATGTGCCGCTGCCGCTGGATGAAAAACGTGAATATCACACCATTGCCGGGCTGTTGATG
+GAGTATTTGCAGCGTATTCCAAAACCTGGCGAAGAAGTTCAGGTGGGGGATTATTTGCTT
+AAAACGTTGCAGGTAGAAAGCCATCGCGTGCAGAAGGTGCAGATTATACCGCTGCGTAAG
+GATGGCGAGATGGAGTACGAGGTGTGATGGTATCGGTCATTTTACCCAATAGCCGAAAGG
+AATAAGATGAGGGAACCGCGCCATCGGCGATTTACCGCCGGGAGCCCGGGTTGCCAGGGT
+GGTGGAGATTGAGCCACCCTGGCACGTTCACCGGCTTGAGCGTTCCATAGTAGCGAGGAA
+CATCAAGTGAACGGAACAGCCTTCGATCTTACATATTCAGAATATAATGATGCCGCCACG
+AACGCCTGATGCGACGCTTTACGCGTCTTATCAGGCCTACAGGACTGGTCACCTGGTAAC
+CTACATCTTCTCCAGCAACTTCTTCACATCTTTGCCATTACGGGAATCTTTATTCCGCTC
+GGCCCAGTCATTCAGGCGACGTTTCGCTTCGTCCTGTAGATGTTTGCGCAGTAACTGATC
+CACTTGCAGGCTGTAATTGAGTTGCTGCCAGTTGCCATAAACCCGCAGCGGTACTGGCGT
+TTCTTTCAGGAAATCAATCAGTTTGCTTTCCCCGTTCCAGCCACCCACGACCCGAATATC
+AAACTGGGTGTCGCAGGTTTGATCTGCCAGATTCAACATGCCTTCCCCTGTCAGCGCCAG
+CACAGGCGATTGACCTTGCATGTCGTTTAACGTCACGACGCCATCCTTCAACGTCAAATC
+GGTGGTAAAGCGGTCAAGCCGCGTCACGTTATCAAAGTTTTCAGCGGCCTTCACATCACC
+GCCATTACGCTCTACCGCTTGCTGAATCATCTGCTGGAAGTTCATCCCTTCCATGCGCGT
+GTCGGTCATTTCGACATGTGCCTGTCCTTGCCAGTTGTGGCGGAATGCGTCGGCATCTAT
+GTCAGCACCGGAGAAATCACCAGCCAGTGACATTTTTCCGGTCAACGAAATCGGATAGTT
+AAACGCCTTCAGAATGGTACCAATCTCAACGTTTTCCAGCCGTGGCTGGAAGTTTATCCG
+CGGATTTATTGATGTCGCGTCCAGCGTGCCCGGCAGTGAAACCTGTCCACCGTTAAGTTT
+GCCCTGCAGTTGAGTAATTTCCAGCAAACCCGACTTGTTGGTCATTTGCGTGGCAACATC
+TGTAAAATTCATTCCGCGCCAGCGCACGTTACTGGCCTGCAACAAAATATCAGCCGTAAA
+GCCTTGCAGTCCCTGATAGGCCGGTTCATCAATACGCGAAGAAATGACCGGGCGCGGCAA
+CGTTGATTGGCTCTGCCCCTGCTGCGCGGCACCGTTTTCACCATTCGCGGTTTCATTAAG
+CGGGATGAGGTTGTCAAGATTCAGTTGCGGGAATTGCAGCCTCAGCTGCCATTCCGGTTT
+CTCTGTCAGCGTAACCTGTGCTTGCCCGCTTAGCGTACTATCATTGGCGGTCAAACTAAT
+TTGGTTAAATGAAAGGCGTTTATGTGACTCCTGCCACTGGGCCTGGAAACTCCCCTGCCC
+CTGAATACCTTGTTTTGGTAAATCGGCACCCTGCAACTGCCAGTTAATTTGTTCAATAGC
+CGCCGTTAAATCATGCGGATAATCAGAAGCATCTACCGTACCGTTAAGGGATATCGTGAG
+ATCGCGCTGATCGCGATTAACCCGCCCGGAGAACTCAAATGAACCACGATGTTGGGGATC
+TTGTTCCATTTGCAGGCGAATATTGCGGATTGTCACCTGCTCGTCATCTTCATGCTGGAA
+CACCAGCACGCTGTCCGCCACCTTAAGACTGGATATATCAAACGACCATCCGCGATCGTC
+TGACAGATCCGGCAAGGTATTGTCGCGCGGTGCAACCGGAGCGTCTTCACTGCGCACCGC
+TTCCGTCTGCGGCGTCAGTTGGATCACTGCCCCTTTTAGCATCACCTGCTTAACGCTCAG
+TTGATGACTCAGTAGTGGTAAAAGCGCCACGTCCAGACGCATGTTGTCGGCGCGAACCAG
+TGGCTGGCTTGCGCCCTGGGCGGTGAGAGACATTCGCCCGGAGAGGATACTAAGCTGCGG
+CCAGACGTGCCAACGCAGTGGCCCGTCGAGCTGCAATTGATAACCGCTACGTGCAGCAAC
+TTGCTTGACCATATAGTCGCGGAAATCATTCGGATTCACCAGCAACACTAACGCAGATAA
+CCCGGCCACCAGCACGACCAGGAGTATCATCAGCGTCGTCAGAAATCGTCTCATGGTATC
+CTCAATGGGCCTGAATTAGTCTTTATCGATTCGGCTGGCTACCGCGCCCTGCTGGTTGCG
+ATATTTCGCATCTTCACGGCGGTTGTAAGGTCGCACCGCCGGGCCGGAAAGCGGCTCAAA
+GCTCAGCGCACCAATTAACATGCCCGGACGCAGCGCCAGCGGCAGCTTACCGGAGTTGTA
+GAACTCCAGCACAATGCAACCAGACCAGCCCGGATCGATGCGGTGCGCGGTGACGTGCAC
+CATCAGCCCCAGACGCGCCAGTGAGGAACGCCCGTCCAGCCAGCCCACCAGATCGGCTGG
+CAGCGTCACCGACTCCAGCGTCACCGCCAGCGCCAGCTCTCCTGGGTGAAGATAGAACGC
+CTCGCCCTCGTCGAGAACGATCTCATCGCTCATCACGCGGTCAAGCGCGGCGCTCACTTC
+ATCTTTGGGACCGCTCAGATCGATAAACGCTGCCGTGTGACCACGGAAGGTACGAAATTT
+ATTGCCCAGGCGTACATCCACCGTCGCGCCGTTAATACGCTCCACTGGCGGACGTGGGTT
+GATCGACAAACGGCCTTCATCAAGCCAGGCTTCAATATCTCGGTCACACAGACGCATGGC
+ATTTTCTCCTTTCGCGCATCACTCCCTTAACGCCAATTACGTCAAGGGCATACTAGGTTA
+TCACTGAACGGTACACAATTTATCAAGCTTATTCAAAGAACTGACTTATTTTCGCTTTCA
+ATATATCGATCGCGATGCGGTTTTTCCCGCCGCGCGGCACGATAATGTCCGCATATTGTT
+TAGAAGGCTCAATGAATTGCAGGAACATCGGGCGCACGGTTTTTTGATATTGCGCCATCA
+CTGAATCCATTGAACGCCCACGCTCGTTAACGTCACGCTTGATGCGGCGCATCAGGCAGA
+TATCCAGCGGGGTATCAACGAAAATGGAGAAGTTAAGTTCGTCACGCAAACGCGCATCCG
+TCAGCAACAAAATGCCTTCGAGAATGATGACCTTCTTCGGCTCAACCGTCACCGTTTCTT
+TCATACGCGTATGTTCAACATAGCTGTAAACCGGCAGGTCAATTGCCGAGCCGCGTTTCA
+ACGCTTGTAAATGCTCAAGCAGCAGACTGTGATCCATCGCGCTGGGATGGTCGTAGTTGG
+TCTTAACGCGTTCTTCCATCGACAGATGGCTTTGATCTTTGTAATAGCAGTCTTCGGGAA
+TTACGCCGATGTGTTCATCACCGACTTGCTCACGCAATTCACGATAAAGGGTACTGGCAA
+TAAGACTCTTGCCGGAAGCCGATGCGCCAGCGATACCGATAATGACGCACTGATGAGACT
+GATCAGTCATATATTTAGCGACCTGATTAACCTGGATGTTAGGAAGGGGGCGACGAAGCG
+CCAAACGCGGCAATTATAGGGATTTCATCCGTCTGATACCAGTCGAATAGCGTTGCCGCG
+CGCTCAGAGTTAATTGTTGACAAAGAATTCCCGGGGGCAAATTACGTTGATCAGTTTTAT
+GTAAGGTAAAAAATGTTAAACGCAGTTGCGCAAATTATCCGCCTTTACGTCACTTTATGA
+GCAATTCGCATATAAAATGTAAAACTTTTGTACTAGCATAAACACAGAAACGAATACTGG
+CGACCAGGTCTTGCGGATAAAGCGGTAATGAGCAAACAATCACAGCATGTATTAATTGCC
+CTGCCCCACCCGCTGCTTCACCTGGTCAGTTTAGGTTTAGTCTCGTTTATCTTTACCCTT
+TTCTCGCTTGAGCTTTCGCAGTTTGGCACCCAACTCGCCCCACTGTGGTTCCCGACGTCC
+ATCATGATGGTGGCGTTTTATCGCCATGCCGGGCGCATGTGGCCGGGAATTGCGCTGAGC
+TGTTCGCTGGGAAATATCGCCGCATCCATCCTGCTTTTTTCCACCAGCTCGCTGAACATG
+ACCTGGACGACCATCAATATTGTTGAAGCCGTGGTCGGGGCAGTGCTGCTACGTAAATTG
+CTGCCGTGGTATAACCCCTTGCAAAATCTGGCTGACTGGCTGCGTCTGGCACTCGGCAGC
+GCCATTGTTCCGCCTCTGTTGGGGGGTGTTCTGGTTGTCCTGCTGACGCCCGGAGACGAT
+CCTCTCAGGGCATTTTTGATATGGGTACTGTCAGAATCCATCGGCGCTCTGGCACTGGTG
+CCGCTGGGATTGTTATTTAAACCACACTATCTGCTGCGCCATCGCAACCCACGGTTGCTT
+TTTGAGTCGCTGCTCACGTTAGCCATCACACTGACGTTAAGCTGGCTTTCGATGCTGTAT
+CTGCCGTGGCCTTTTACTTTCATTATTGTGCTGTTGATGTGGAGCGCCGTGCGTCTGCCA
+CGAATGGAAGCCTTTTTGATCTTCCTTACCACGGTGATGATGGTGTCGCTGATGATGGCC
+GCGGATCCCTCCCTGCTTGCTACGCCGCGTACGTACCTGATGAGCCATATGCCGTGGCTA
+CCGTTTTTGCTGATCCTGCTGCCCGCCAACATCATGACCATGGTGATGTATGCCTTTCGT
+GCGGAACGCAAACACATTTCCGAAAGCGAAACCCACTTTCGGAACGCGATGGAATATTCC
+GCTATCGGTATGGCGTTAGTGGGCACCGAGGGACAATGGCTGCAAACCAACAAAGCGCTC
+TGCCAGTTTCTCGGGTACAGTCAGGAAGAGCTGCGCGGACTCACCTTTCAGCAACTGACC
+TGGCCGGAGGATCTCAATAAAGATCTCCAACAGGTTGAAAAGCTGATAAGCGGTGAAATA
+AACACCTATTCAATGGAAAAACGCTACTACAACCGCAATGGCGATGTTGTCTGGGCGTTG
+CTTGCCGTCTCACTGGTGCGCCACACGGATGGCACGCCGCTCTATTTTATCGCTCAGATT
+GAAGACATTAACGAGCTAAAACGCACCGAACAGGTCAATCAGCAACTGATGGAGCGCATC
+ACTCTGGCTAACGAAGCGGGCGGGATTGGCATCTGGGAGTGGGAGTTGAAGCCGAATATT
+TTTAGCTGGGATAAGCGGATGTTCGAGCTGTATGAAATTCCTCCACATATCAAACCGAAC
+TGGCAGGTGTGGTACGAGTGCGTGCTGCCGGAAGATCGCCAGCATGCCGAAAAAGTGATT
+CGTGATTCGTTGCAATCACGCTCGCCCTTTAAACTGGAATTTCGCATTACCGTAAAAGAC
+GGTATTCGCCATATCCGCGCCCTCGCCAACCGGGTACTGAATAAAGAAGGCGAAGTCGAA
+CGTCTCCTCGGCATCAATATGGATATGACCGAAGTGAAACAGCTTAACGAGGCATTGTTT
+CAGGAAAAAGAGCGCCTGCACATTACGCTTGATTCCATCGGTGAAGCCGTGGTCTGTATT
+GATATGGCGATGAAAATTACCTTTATGAATCCAGTGGCGGAGAAGATGAGCGGCTGGACG
+CAGGAAGAAGCGTTAGGTGTTCCGCTCCTGACGGTGTTGCATATTACTTTTGGCGACAAC
+GGACCATTAATGGAGAACATTTACAGTGCCGACACCTCACGTTCCGCGATCGAGCAAGAT
+GTGGTGTTGCACTGTCGGAGCGGCGGCAGTTACGACGTGCATTACAGTATTACGCCGTTA
+AGTACTCTGGACGGCAGCAATATTGGTTCGGTTCTGGTGATTCAGGACGTTACCGAATCA
+CGCAAAATGCTGCGCCAGCTGAGCTACAGCGCCTCCCATGATGCACTGACGCATCTCGCC
+AACCGCGCCAGTTTTGAGAAACAACTGCGTATCCTGCTGCAAACGGTAAACAGTACACAT
+CAGCGACATGCCCTGGTGTTTATCGATCTTGATCGCTTTAAAGCGGTGAATGACAGCGCC
+GGGCATGCGGCGGGTGACGCTTTGCTGCGCGAACTGGCGTCGTTAATGCTGAGTATGCTG
+CGTTCCAGCGACGTGCTGGCGCGACTCGGTGGGGATGAATTTGGTCTGCTGCTACCAGAC
+TGTAATGTTGAAAGCGCGCGTTTTATCGCTACACGCATTATCAGTGCCGTGAATGACTAT
+CACTTTATATGGGAAGGCCGTGTGCATCGGGTAGGTGCCAGTGCCGGGATTACCTTGATT
+GATGACAACAATCATCAGGCGGCAGAAGTGATGTCGCAGGCTGATATCGCCTGTTATGCC
+TCCAAAAATGGTGGCCGGGGCCGGGTGACGGTTTACGAACCGCAGCAAGCTGCCGCACAT
+AGCGAACGGGCGGCGATGTCGCTTGATGAACAGTGGCGGATGATTAAAGAGAATCAGTTG
+ATGATGCTCGCCCACGGTGTCGCTTCGCCACGGATCCCGGAAGCGCGTAATTTGTGGCTG
+ATTTCACTTAAGCTCTGGAGTTGCGAAGGCGAGATTATTGATGAACAAACATTTCGTCGT
+AGCTTCAGCGATCCGGCGCTTAGCCATGCTCTTGACCGCCGGGTATTCCACGAATTTTTC
+CAGCAGGCCGCAAAAGCGGTTGCCAGTAAAGGCATAAGCATCTCCCTCCCCCTTTCCGTT
+GCCGGTTTGAGTAGCGCCACGCTGGTGAATGATCTGCTTGAGCAGCTGGAAAATAGCCCT
+CTACCACCACGGTTATTACATCTGATTATTCCGGCTGAAGCGATTTTAGATCACGCAGAA
+AGCGTGCAAAAACTGCGGCTGGCGGGATGTCGGATAGTGCTCAGCCAGGTGGGCCGCGAT
+CTGCAAATCTTCAACTCGCTGAAAGCGAATATGGCAGATTACCTGCTACTTGATGGTGAG
+TTATGCGCCAACGTGCAGGGTAATTTGATGGATGAGATGCTGATTACGATTATTCAGGGG
+CACGCTCAGCGACTCGGGATGAAAACCATCGCCGGGCCAGTCGTTTTACCCTTAGTGATG
+GATACGCTTTCTGGCATCGGCGTCGATCTGATTTATGGTGAGGTGATTGCCGATGCCCAA
+CCGCTGGATTTGCTGGTGAATAGTAGTTATTTCGCGATTAACTGAGGCGTGCTTCCCCAT
+CGCCTGATGCGACGCTAACGCGTCTTATCATGCCTACAAATCGCTCATTCCCCAGGCCGG
+ATAAGGCGCTCGCACCGCATCCGGCGACCAACGTCATGCTTCGTCTGGTTGCCAGCCTTC
+CGTATACCAGATATGCAACAGCGCATAAGAACGCCAGGGCTTCCAGCGCTCGGCATAACG
+GCGGATTTGCGCCGGTGTCATTCCCGGAAATCGCTGTTTAATCAGATAATCATCCGGCAG
+GAAAACATCTTTCGCCTGCCAGCCACGCAAAGCAAAATAATTCGCCGTCCAGCGCCCGAT
+ACCCGGAAAAGTTTGCAGCGTTTTCATCGCCTGCTCCACATCGCCCGGTATTGTCATTGG
+TAAGGTGCCCTCCAGCGCCGCATTTGCCAGATGAATCAGCGCCTCTGCCCGTTTCAACGG
+CATACCTAACGCTTTTAATGCCTGCGGGTCTGCTGCTGCCAGCCGCTGAGGCGTCGGGAA
+GCAGATATACTCCGGAAAATCATCCAGCCGTTCGCCATAAAGCTGTGCCACTCTGGCGGT
+CAATTTTGCCGCCATCGCCACGCTCACCAGTTGGCCTAAAATCGCCCGCACGCCCTGCTC
+AAAAGCATCAACACAGCCGGGTAAACGCAATCCGGGCCGCGCCGCGCCTAACCTGCCCAA
+CGCACCGTTAACAATTTGTGGGTTACATTGCAGATCAAACAGGCGGCTCATTTTCGCCAG
+ACACTCTGCGGCAACAGGTTCTAAACCTGCACTTAAATTTATGTGCAGAGTATGGCGGGC
+TATATCCGGAATAGCAGTCACCACGCCGCGATATTCGCCCACCGCCAGACTACGGGCATA
+ATAACTGTCCGCGACCGTTTCCACACTGCTCACCGCACGGGCGGCGAGAAATCCCAACAT
+CCACGACCAGTCATACGGCGGCTGCCAGTTCAGGGTATACATCGCATCTCCTTATTCATC
+CGCTTTCAGCATAAACGTTATTCAGACGCTGCGCTTTGCTTTCATATTCCGGTTGTCGCG
+ACGGCAACATTTCGCTAAAGTCACGCCCCTTCTTCACCGGCATGGGGATTATTTCGTGTT
+TATTGGTTTTGATTACGGTACAGCAAACTGTTCAGTGGCGGTCATGCGTGACGGTAAACC
+GCATTTGCTAAAAATGGAAAACGACAGCACGCTGCTGCCTTCAATGCTTTGCGCGCCAAC
+GCGTGAAGCGGTAAGCGAATGGCTGTACCGCCATCATGATGTTCCGGCAGACGACGATGA
+AACGCAGGCGCTGTTACGTCGGGCGATTCGTTATAACCGCGAAGAAGATATCGATGTTAC
+GGCGAAAAGCGTGCAGTTCGGTCTTTCCTCACTGGCACAGTACATTGATGATCCAGAAGA
+AGTGTGGTTTGTGAAATCACCAAAATCGTTCCTCGGTGCCAGCGGCTTAAAACCGCAGCA
+GGTAGCGCTGTTTGAGGATCTGGTCTGCGCAATGATGTTGCACATTCGCCAGCAGGCGCA
+GGCACAGCTGCCAGAAGCGATTACTCAGGCGGTGATTGGTCGTCCGATCAACTTCCAGGG
+GCTGGGCGGTGATGAAGCAAACACCCAGGCGCAAGGGATTCTGGAACGCGCGGCGAAGCG
+TGCCGGATTCAGGGACGTGGTATTCCAGTACGAGCCGGTCGCGGCTGGGCTGGATTACGA
+AGCCACCTTGCAGGAAGAAAAACGGGTGCTGGTGGTGGATATCGGCGGTGGTACGACTGA
+CTGTTCATTGCTGCTGATGGGGCCGCAGTGGCGTTCGCGTCTCGATCGTGAAGCCAGCCT
+GCTGGGTCACAGTGGTTGCCGTATTGGCGGTAACGATCTGGATATCGCGCTGGCGTTTAA
+AAACCTGATGCCACTGCTGGGTATGGGTGGCGAAACCGAAAAAGGCATCGCCCTGCCGAT
+CCTGCCGTGGTGGAATGCGGTTGCCATCAACGACGTACCTGCGCAGAGTGATTTCTACAG
+TAGTGCCAACGGTCGTCTGCTTAACGATCTGGTACGCGATGCCCGCGAACCGGAAAAAGT
+GGCCCTGTTACAGAAAGTCTGGCGTCAGCGTTTAAGCTATCGCCTGGTGCGTAGCGCAGA
+AGAGTGCAAAATTGCTCTTTCAAGCGTAGCGGAAACCCGCGCCTCACTGCCGTTTATCAG
+CAATGAACTGGCTACGCTGATTAGCCAGCGAGGGCTGGAAAGCGCCCTCAGCCAGCCACT
+GACGCGGATTCTGGAACAGGTGCAACTGGCCCTGGATAACGCCCAGGAAAAACCGGACGT
+TATCTACCTGACCGGCGGTAGCGCCCGTTCTCCGCTGATTAAAAAAGCGCTGGCAGAACA
+GTTGCCGGGCATTCCGATTGCAGGCGGCGATGACTTTGGCTCCGTCACCGCCGGGCTGGC
+ACGCTGGGCGGAAGTGGTGTTTCGTTAATTGAAAAATGGCTCAGCAGCGGCTTAAATCTG
+CCTGCGCCTGAGCCAGTTTTTCTGCTGCCTGACGTAACGGTTCCATCAACGGCATGGTCC
+GTGCTGGAGCATGAAGGCGGAATCGCTGCAACTCTGTCGCGCCGACTGTCAACGCCGATT
+CCAGCCGATGTCGTTTGGCGGTCATTTTCGCCATTACCGCTTGTCTGTCTGCTGGCGTTA
+TCGCTTCATTCGGCCTGAACACAAAACGGCGTTCACAGCTCGCTTTCCAGTCGATAACCG
+CCTGGGTCAGATGGTCGCCAAACCCTTTCACTTGCTTAACGCCACGACGGGTAACATCTG
+CGGCTGTTTCAATACCAAAAGACCGTAACGCCGCTTTACGCGCAGGGCCAACGCCGGGAA
+TAGAGGCAACATCAATAAAAAATCCCTCCAGAAACTTCTGCTTCTGCCGTTCCCTTGCAG
+TGTCATGAAGTGCTGCCAGAGCGCGTTTCTCTTCTTCCGGTAACCCGAGAATTTCGTCCT
+TCATTTTTTCGAGCATCGTCCGTTTGGCGATAAAACCTTCCAGGCCGCCTACCTGCTGGA
+TCTGGCGGACTAAATGGTCATAGTCCATTTTCGCACGATTAAATGCCTCACGGCGTTGCT
+GAACTTCTGCTTTGTACGCTTTGCTTGTCAGACTGCCAATAATCCAGATAGCCGCCAGCA
+CAGGAACCAAAATAATATAACGCGGTTCTGCCTGAAGGCCGCAAAGCAGCAGCGATAATG
+CTGACAGTGCGATCTCAAGCAGAATGATGTATTCGCGCCGTAACAGGCCTAAAGGAAGCG
+GCCTGCCAGTCGGTTGGAAATGATCGGGTAATGGCAGTTGCAATGCTGGCGGTGCTACTG
+ACGCCATCACCATCGCCCAGACTTTCGCCAGCACAAAATTCCCGCCGGTGGTAATGACCT
+CTTCGCCGAGATCAATAAAATAGATAACACCTTGATTATCCAGCGCACACCACGGGCAGT
+CAGTCAAATGAGCGGGGTAAACATGCATTGCTGAAACGATACATTTCTTTAACTGTTGGC
+GTAGAGAGTCCAGTGCCGCTACCCACGCTTTAGCCGTCGGACGCCCGGTTGCCACGCCAC
+TTTCCGTGAATGCCTGCTGAAACATGGCTTCAACATCACTCGGTAACATCGATAGCGGAA
+TAGATCGTGGCGGCGGTTTTAAACCACGTCGCTGATTATCTGACGCGTAGGCATAACGGA
+AATGGGTAATATCCGTCTCCAGCGCATTACCCGCATCAGAGATAAGCGGCACACCAGAAT
+AAGGATGCCGCCCACCAAACAAGACGTGAAAAATTAGCAACGCAAGGCCAAAATTATCGT
+GATTTTCTGTGCGTTCAAAACCGACAAATGATGGCAAGGTTTGTAGCTCTGGCGGCGTAA
+AATGCGACACGCCGACTTCGCATAAATGCAGTGTGCCATTGGCGTTAATTTGAAAGGAGT
+CGCTATCAATCAGTACCACTTTGCTGTCGCGACCTACCATAAAACTGTTCTGGTTTACGT
+CACCCACGACGTGCCCGTGCTCGTGAACCGTAGCAAAAGATGAAGCAATATTGCGCGCAA
+CATAGAGTAGAAAATCCCACGCACAATGAGGGTAACTCTGGCGACGATGTGCCGGGCTAT
+AGATCATATGAATCGGTTCTTTACCAGAAACTTTTGGCATCATAAAACCGATAACTTTTC
+CGCCTCGTCCACCGTGAAGCGTTGCCTGCGGCCAGGCGACATAATTCAACAACTGCGCGT
+CAGCTGTCGCAGCCATAAAGGCAAGTTTGTCCTGTTTTAAGGCGGGTGGCGGCGTGTGAT
+AAATCTTGGCGACGCTATCGACAAACTCCTCGATATCATAAACCGCGCCTTCACCACCTT
+TGCCCAGTTCACGGCCAAGAGTGGTCAATTCACCTGTCGATGTAAATACTTTTATATTTG
+TTTTCATAATATTTCGCGGGTAGTTATATTATATTTCAATGAATAATAACAACTAACCAT
+TAAAATTATTTCTATATGGGGAAAACCCACTCAAGAATAAAAATGATAATGCAATTTTAT
+CAGGATACAATTCAATTTCGGCCTGATAATGATTAACTTCCACAGGTTTTTGCTAACTTT
+GACTACAAAGGGATTCTGGAGAAAAAATGAAAAAGATATTACTTATGTTGAGTCTGCTAT
+TTTTTACTACCGCGGGCTTTAGTGAAGTTTCGGATACGTTAGTGACGGGAGGTTATGATA
+AACAAGCGATGTCTGACGCGATTAAACATGCGCGGAAAGAAACCGATAAATTCATCGAGG
+TTATGAATAAAAAAGATGCCGATACTTTCGCAGTCAAAGCCCCGATAACCGATCACGGAA
+GAACCGAGCATTTCTGGCTTACGGATGTCACTTATTCTAACGGCATGTTTATTGGCGTAA
+TCAGCAATGACCCTGGTATTGTTACAAACGTAGAATATGGCCAGGAGTGGAAAATCAAGA
+AAGAAGATATTTCAGACTGGATGTATACGCGCGGGGATAAAATTTACGGCGGTTATACCA
+TTGATCCTTTATTGGTCACCTATCCAAAAGAAGAAGCCGACGAGCTAAGAGCAAAATTAG
+TTCGCTAATCAGCCGTTATATTTATTGTTTAAACTGGCGGTTGAATTGTTGTCTTCAACC
+GCCATGAGAAACTCACTCTGCCCACAGCGCCAGTGCCAACGTTTTATCATCATCCGTACG
+CTCGTTTACCGCCGGGCTGGACAAAAACTGCTTTAACAATTCAGGTAATAAATCGAGTTG
+TTCCTGCGTTGCTGCCGCCAGTCCATTGAAAAACGGGGTAAAGAAAGGCACATGAGGAGA
+ATTATCCAGCATATTTAACGCCAGTCGCTGGATACCATCCGTAAATGCTGCAACTTTGTG
+CGCACGCCCAGTGCTGGTGAAAGTTTCCAGTCTGGAAACGGCATCTTCGTCGGTAATGAA
+GTGCGTCATGTTGGCATATTCACCCGCCATCGGCGTGAGAGGCAATTGCAGACCGTGACC
+CAAATCTACCACCACGCCGCCATCGCCAATCTGCATAATCAAGGTGCCGTCAGGCGATGA
+AATCAGTCCCAGAAATGTGCAGGCAAAATCGCGAACCGCTAATTCTTTGGCTTCCGCCTC
+GGCAAAAAGTCGTTGACGAATGGTCAGTACCATATTTGTGGCGAGGACATCATTAAGCCC
+CAATTCCCCGCCCTGCACTTTTTGCGACATATAAGCCATCGCTTCATTGACGGCGAGCAT
+CGCGCCTTCGCCACCCTGCGAGACACTGCCTGCGCCATCAGCGACAAATACCGACAATAA
+TGGCTGCTGGTCATTTAACCAGGCAATCTGCATCTGGCAGGCATCCTGACAAGGCAAGTC
+CGCGCTGATGTGCGACGTTCCAACGGTTGATGCATAGACCAGACGCCAGCTCACACTGAC
+GTCCAGCCTTTTGGCGCTTCCAGCACAACTTCCGTTCCCGGCGTGGAGCGGGAAACCGAA
+CGCAGCGAACTGGATAACCAGCTAAACAGTTCACGGAATTGTAATCCTTGCAGAGGCAAA
+GGCTGACGAACGCTAATTTGTGCCAGCGTCTTCATATCCGCCCCCTGAACACCGATGGAA
+AAGAAAGCAAACCTTTTATCTTCTTCCCCCCGAAACACTTTGTTGGCTGCAGCCTGCCAC
+TCATCGGTTGGTGCACCATCGGTAATCAGGAAAATCCACGGGCGATAATACGAAATACCA
+TTTGCACGATACTCACGTTTCCGCTCCTCTACCATATCCAGGGCTTTGGTAATGGCCGCA
+CCCATTGGTGTATCGCCCTGGGCAAACAGGATGGGCGGAAAAAAATTAGCGGCGCTGGTA
+AAGGGTTGTTCCACATGCACCGGGCCGAACGTCACAATGCCGAGTTCCACTCTTTTTAAA
+GCCAGCGGATCAGCAAGCAGTTCATCACGAAAGGTAACCAATCCGGCGTTAAGTTCATTA
+ATAGGTCTACCGTTCATAGAACCAGAAACATCCAGCAGCAAAATGCAGGGGCAACGTGGT
+TCCGGGTTACTGGCAAAATCGCTGGTGGCAAACGTGATTTGTTCGCTCATAAGAAATCCT
+TTCTTAGAGAATTATCGAGGTCCGGTATCATACCGACTGCAATAATGAAATAAGAGCAAA
+CGAAGAAACTTTCAGAATTAGGCCCGGCGGCGCAGAAAATTTTGCTATTCGCCTCGCAAG
+AACGGAGAGCCGTCGATTGACACTAAGGGCGGAGTGACATAATTTCAGGAGTGAGGGTTA
+GGGAGAGGTTTCCCCCTCCCCCTGGTGTTCTTAGTAAGCCTGGAAGCTAATCACTAAGAG
+TATCACCAGTATGATGACGTGCTTCATCATAACCCTTTCCTTATTAAAAGCCCTCTTCTC
+CGGGAGAGGCTTTCCCGTTTCAGCGTCCCGCTGAAATCATCGGCTTACCTCCTTTCGCCC
+TGAATGCAGTCTATCGCTAACGCGTGAATAAAATAGTTTCCTCTGTGATTATTGCGTAAC
+GACTCGCAAAGAATATTTGCTGGCAGGATCGCAGACTACAAAGCCTGCGGATTGACAATC
+TTATCGTGAAGGCATACTTTCAGGAGTGAGGGTAGAGCGGGGTTTCCCCCGCCCTGGTAG
+TCTTAGTAAGCGGGGAAGCTTATGACTAAGAGCACCACGATGATGAGTAGCTTCATCATG
+ACCCTTTCCTTATTTATGGCCCCTTCCTCGGGAGGGGCTTTCCCGTTTCAGCGTCCCGCT
+GAAATCGTCGGCTTACCTCCTTTCGCCATGCAAGCAGTCTATCGCTAACGCGTAGATAAA
+ATAGTTTCCTGTGTTATTACTGGATGCGTGCTCGCAAATGTGCCCGTCATTCAGACGATT
+CCAGACAGTGTTTCATAATTCCTCCATTTTTCTCCCTTATTGGCTGGCTACACTAGTATC
+ATTCCGCGAAACGTTTCAGGAAGAGAAACTCTTAACGATGAAAGGTAGTTATAAATCCCG
+TTGGGTAATCGTAATCGTGGTGGTTATCGCCGCCATCGCCGCATTCTGGTTCTGGCAAGG
+CCGCAATGACTCCCGGAGTGCAGCCCCAGGGGCGACGAAACAAGCGCAGCAATCGCCAGC
+GGGTGGTCGACGTGGTATGCGTTCCGGCCCATTAGCCCCGGTTCAGGCGGCGACCGCCGT
+AGAACAGGCAGTTCCGCGTTACCTCACCGGGCTTGGCACCATTACCGCCGCTAATACCGT
+TACGGTGCGCAGCCGCGTGGACGGCCAACTGATAGCGTTACATTTCCAGGAAGGCCAGCA
+GGTCAAAGCAGGCGATTTACTGGCAGAAATTGACCCCAGCCAGTTCAAAGTTGCATTAGC
+ACAAGCCCAGGGCCAACTGGCAAAAGATAAAGCCACGCTTGCCAACGCCCGCCGTGACCT
+GGCGCGTTATCAACAACTGGCAAAAACCAATCTCGTTTCCCGCCAGGAGCTGGATGCCCA
+ACAGGCGCTGGTCAGTGAAACCGAAGGCACCATTAAGGCTGATGAAGCAAGCGTTGCCAG
+CGCGCAGCTGCAACTCGACTGGAGCCGGATTACCGCACCAGTCGATGGTCGCGTTGGTCT
+CAAGCAGGTTGATGTTGGTAACCAAATCTCCAGTGGTGATACCACCGGGATCGTGGTGAT
+CACCCAGACGCATCCTATCGATTTAGTCTTTACCCTGCCGGAAAGCGATATCGCTACCGT
+AGTGCAGGCGCAGAAAGCCGGAAAACCGCTGGTGGTAGAAGCCTGGGATCGCACCAACTC
+GAAGAAATTAAGTGAAGGCACGCTGTTAAGTCTAGATAACCAAATCGATGCCACTACCGG
+TACGATTAAAGTGAAAGCACGCTTTAATAATCAGGATGATGCGCTGTTTCCCAATCAGTT
+TGTTAACGCGCGCATGTTAGTCGACACCGAACAAAACGCCGTAGTGATCCCAACAGCCGC
+CCTGCAAATGGGCAATGAAGGCCATTTTGTCTGGGTGCTGAATAGCGAAAACAAGGTCAG
+CAAACATCTGGTGACGCCGGGCATTCAGGACAGTCAGAAAGTGGTGATCCGTGCAGGTAT
+TTCTGCGGGCGATCGCGTGGTGACAGACGGCATTGATCGCCTGACCGAAGGGGCGAAAGT
+GGAAGTGGTGGAAGCCCAGAGCGCCACTACTCCGGAAGAGAAAGCCACCAGCCGCGAATA
+CGCGAAAAAAGGAGCACGCTCCTGATGCAGGTGTTACCCCCGAGCAGCACAGGCGGCCCG
+TCGCGCCTGTTTATTATGCGTCCTGTGGCCACCACGCTGCTGATGGTGGCGATCTTACTC
+GCCGGGATTATCGGTTATCGCGCCCTGCCCGTTTCGGCGCTGCCGGAAGTGGACTATCCG
+ACCATTCAGGTGGTCACGCTCTACCCAGGTGCCAGCCCGGATGTCATGACCTCTGCCGTT
+ACCGCGCCGCTAGAACGCCAGTTCGGGCAGATGTCTGGCCTGAAACAGATGTCGTCGCAA
+AGTTCCGGCGGTGCGTCAGTTATCACTTTGCAGTTCCAGCTAACATTACCGCTCGATGTC
+GCCGAGCAGGAAGTGCAGGCCGCGATTAACGCTGCGACCAACTTGTTGCCGAGCGATCTG
+CCTAACCCGCCGGTTTACAGCAAAGTGAACCCGGCAGATCCGCCGATCATGACGCTCGCC
+GTCACCTCAACCGCCATGCCGATGACGCAAGTGGAAGATATGGTGGAAACCCGCGTCGCG
+CAGAAAATCTCGCAGATTTCCGGCGTCGGCCTGGTGACGCTTTCCGGCGGTCAGCGTCCG
+GCTGTTCGCGTCAAACTTAACGCTCAGGCGATTGCCGCCCTCGGCCTGACCAGCGAAACC
+GTGCGCACCGCCATTACCGGCGCTAACGTTAACTCGGCAAAAGGTAGCCTCGACGGCCCT
+TCCCGTGCGGTCACGCTTTCCGCGAACGACCAGATGCAATCCGCCGAAGAGTATCGCCAG
+CTAATCATCGCCTACCAGAACGGCGCGCCAATTCGTCTGGGCGATGTCGCAACTGTAGAG
+CAAGGTGCAGAAAACAGCTGGCTCGGCGCGTGGGCGAACAAAGAACAGGCCATTGTGATG
+AATGTTCAGCGCCAGCCCGGTGCTAACATTATCTCCACCGCCGACAGCATTCGGCAGATG
+CTGCCACAGCTCACTGAGAGTCTGCCGAAATCGGTGAAGGTGACAGTGCTTTCCGATCGC
+ACCACCAATATCCGCGCATCCGTCGATGATACTCAGTTTGAATTGATGATGGCTATCGCG
+CTGGTAGTCATGATTATCTACCTGTTTTTGCGCAATATTCCGGCGACCATCATTCCCGGT
+GTTGCTGTACCGCTGTCGTTAATCGGCACTTTCGCGGTTATGGTGTTTCTCGATTTTTCA
+ATCAATAACCTGACACTGATGGCGTTAACTATCGCCACCGGATTCGTGGTCGATGACGCC
+ATCGTGGTGATCGAAAACATTTCCCGCTATATCGAAAAAGGCGAAAAACCGTTGGCGGCG
+GCGCTCAAGGGCGCAGGTGAAATCGGCTTTACCATTATCTCGCTGACCTTCTCACTGATT
+GCGGTGTTGATCCCACTGCTGTTTATGGGCGATATCGTCGGGCGACTGTTCCGCGAATTT
+GCTATTACCCTGGCGGTAGCGATTTTGATCTCAGCGGTGGTGTCGCTGACCCTGACACCG
+ATGATGTGCGCGCGGATGCTCAGCCAGGAGTCGTTGCGTAAACAGAACCGCTTCTCCCGT
+GCCTCGGAAAAAATGTTCGACAGGATAATCGCCGCCTATGGTCGTGGACTGGCGAAAGTG
+CTGAATCATCCGTGGCTGACCTTAAGCGTGGCACTCAGCACGCTGCTGCTTAGCGTGCTG
+CTGTGGGTGTTCATTCCGAAAGGTTTCTTCCCGGTACAGGACAATGGCATTATTCAGGGC
+ACTTTGCAGGCACCGCAATCCAGCTCCTTTGCCAATATGGCCCAGCGACAACGCCAGGTC
+GCGGACGTGATTTTGCAGGATCCGGCAGTGCAAAGCCTGACCTCATTTGTTGGCGTTGAT
+GGCACTAACCCGTCGCTGAACAGTGCACGTTTACAAATCAACCTCAAACCGTTGGATGAA
+CGTGATGATCGGGTGCAAAAAGTCATCGCCCGTCTGCAAACGGCGGTAGATAAAGTGCCG
+GGCGTCGATCTCTTCCTGCAACCAACGCAGGATCTGACTATTGATACTCAGGTCAGCCGC
+ACCCAGTACCAGTTTACCTTGCAGGCCACGTCACTGGATGCGCTCAGTACCTGGGTGCCA
+CAGTTGATGGAAAAACTCCAGCAACTGCCACAGCTTTCTGATGTCTCCAGCGACTGGCAG
+GACAAAGGGCTGGTGGCGTATGTCAATGTTGATCGCGACAGCGCCAGCCGTCTGGGGATC
+AGCATGGCGGATGTCGATAACGCCCTGTACAACGCGTTTGGTCAGCGGCTGATTTCCACT
+ATTTATACTCAGGCCAACCAGTATCGCGTGGTGCTGGAGCACAACACCGAAAATACCCCA
+GGCCTCGCGGCGCTGGATACCATTCGCCTGACCAGCAGCGACGGCGGCGTGGTGCCGCTA
+AGCTCAATTGCCAAAATTGAGCAGCGTTTTGCGCCGCTCTCCATCAACCATCTGGATCAG
+TTCCCGGTAACGACCATCTCCTTTAACGTGCCGGATAACTATTCGCTGGGCGATGCGGTG
+CAGGCGATTATGGACACCGAAAAGACGCTGAATCTGCCGGTGGATATCACCACGCAGTTC
+CAGGGCAGCACCCTCGCCTTCCAGTCGGCGCTGGGCAGCACTGTCTGGCTGATTGTCGCG
+GCGGTGGTGGCGATGTATATCGTGCTCGGCATTCTGTACGAGAGCTTTATTCACCCGATC
+ACCATTCTCTCGACGCTACCCACCGCAGGGGTTGGCGCACTGCTGGCGTTGCTGATTGCT
+GGTAGCGAACTGGATGTGATTGCGATTATCGGCATTATTTTGCTGATCGGTATCGTGAAG
+AAGAACGCCATCATGATGATCGACTTCGCGCTGGCTGCTGAGCGCGAGCAAGGCATGTCG
+CCGCGCGAGGCAATCTACCAGGCTTGTCTGTTGCGTTTTCGTCCGATCCTGATGACCACT
+CTGGCGGCTCTGCTTGGCGCGCTGCCGCTGATGTTGAGTACCGGGGTCGGCGCGGAACTG
+CGTCGTCCGTTAGGTATCGGCATGGTCGGCGGTCTGATTGTCAGCCAGGTGCTGACGCTG
+TTTACCACGCCGGTGATTTATTTGCTGTTCGACCGCCTGGCATTGTGGACCAAAAGCCGC
+TTTGCCCGTCATGAAGAGGAGGCGTAAGTGAAGTTTTTTGCCCTCTTCATTTACCGCCCG
+GTGGCGACGATTTTACTGTCGGTTGCCATTACCCTGTGCGGCATACTGGGCTTCCGTATG
+CTGCCGGTCGCCCCGCTGCCGCAGGTCGATTTTCCGGTGATTATCGTCAGCGCCTCGCTG
+CCCGGTGCGTCACCAGAAACAATGGCGTCTTCCGTTGCCACGCCGCTGGAGCGCTCACTT
+GGGCGCATTGCCGGAGTCAGTGAAATGACCTCCAGCAGTTCGCTCGGCAGCACGCGTATT
+ATTTTGCAGTTTGATTTTGACCGGGATATCAACGGCGCAGCGCGTGATGTGCAGGCGGCG
+ATCAACGCTGCACAAAGTTTGCTGCCCAGTGGGATGCCCAGCCGCCCGACCTATCGCAAA
+GCGAACCCGTCGGATGCGCCAATTATGATCCTCACGCTGACGTCCGATACTTATTCGCAG
+GGTGAACTGTACGATTTCGCCTCGACGCAGCTGGCTCCGACGATTTCGCAAATCGACGGT
+GTTGGTGATGTCGATGTCGGAGGCAGCTCACTGCCCGCCGTACGCGTCGGGCTGAATCCG
+CAGGCGCTGTTTAATCAGGGCGTGTCGCTGGACGACGTACGCACCGCCGTCAGCAATGCC
+AACGTGCGTAAACCGCAGGGCGCGCTGGAAGATGGCACTCACCGCTGGCAGATCCAGACC
+AATGATGAGCTAAAAACCGCCGCTGAATATCAGCCGTTGATTATTCACTACAACAACGGC
+GGCGCGGTTCGTCTGGGCGATGTGGCGACGGTGACCGACTCAGTGCAGGATGTGCGCAAC
+GCCGGGATGACCAACGCCAAACCGGCTATTTTACTGATGATCCGCAAACTGCCGGAAGCC
+AATATTATCCAGACGGTTGACAGCATCCGGGCAAAATTACCGGAGTTGCAGGAAACCATT
+CCGGCGGCGATTGATCTGCAAATTGCCCAGGATCGCTCCCCCACCATTCGCGCCTCGCTG
+GAAGAAGTCGAGCAAACGCTGATTATCTCGGTGGCGCTGGTGATTCTGGTGGTGTTTTTA
+TTCCTGCGCTCGGGTCGCGCCACTATTATTCCCGCCGTTTCGGTGCCGGTTTCGCTGATT
+GGTACGTTTGCGGCGATGTACCTGTGCGGATTCAGTCTCAATAACCTTTCGTTAATGGCG
+CTCACCATCGCTACTGGTTTCGTGGTGGATGACGCCATCGTGGTGCTGGAAAACATTGCA
+CGTCATCTGGAAGCGGGAATGAAACCGTTGCAAGCCGCACTGCAAGGTACTCGCGAAGTC
+GGTTTTACGGTGCTGTCGATGAGTCTGTCACTGGTGGCGGTGTTCCTGCCGCTGCTGTTG
+ATGGGCGGATTGCCGGGCCGACTGTTACGCGAATTTGCCGTGACGCTTTCTGTCGCCATT
+GGTATATCGTTGCTGGTTTCTCTGACATTAACGCCAATGATGTGTGGCTGGATGCTGAAA
+GCCAGCAAGCCGCGCGAGCAAAAGCGACTGCGTGGTTTTGGTCGCATGTTGGTAGCCCTG
+CAACAAGGCTACGGCAAGTCACTAAAATGGGTGCTCAATCATACCCGTCTGGTGGGCGTG
+GTGCTGCTTGGCACCATTGCGCTGAATATCTGGCTGTATATCTCGATCCCGAAAACCTTC
+TTCCCGGAGCAGGACACTGGCGTGTTGATGGGCGGGATTCAGGCGGATCAGAGTATTTCG
+TTTCAGGCGATGCGCGGTAAGTTGCAGGATTTCATGAAAATTATCCGTGACGATCCGGCA
+GTGGATAATGTCACCGGCTTTACAGGCGGTTCGCGAGTGAACAGCGGGATGATGTTTATC
+ACCCTCAAGCCACGCGACGAACGCAGCGAAACGGCGCAGCAAATTATCGACCGTCTGCGC
+GTAAAACTGGCGAAAGAACCGGGGGCGAATCTGTTCCTGATGGCGGTACAGGATATTCGC
+GTTGGTGGGCGTCAGTCGAACGCCAGCTACCAGTACACGTTGTTATCCGACGACCTGGCG
+GCACTGCGAGAATGGGAGCCGAAAATCCGCAAAAAACTGGCGACGTTGCCGGAACTGGCG
+GACGTGAACTCCGATCAGCAGGATAACGGCGCGGAGATGAATCTGGTTTACGACCGCGAC
+ACCATGGCACGGCTGGGAATCGACGTACAAGCCGCCAACAGTCTGTTAAATAACGCCTTC
+GGTCAGCGGCAAATCTCGACCATTTACCAGCCGATGAACCAGTATAAAGTGGTGATGGAA
+GTGGATCCGCGCTATACCCAGGACATCAGTGCGCTGGAAAAAATGTTCGTTATCAATAAC
+GAAGGCAAAGCGATCCCGCTGTCGTATTTCGCTAAATGGCAACCGGCGAATGCCCCACTA
+TCGGTGAATCATCAGGGATTATCGGCGGCCTCGACCATTTCGTTTAACCTGCCGACCGGA
+AAATCGCTCTCGGACGCCAGTGCGGCGATCGATCGCGCAATGACCCAGCTTGGTGTGCCT
+TCGACGGTGCGCGGCAGTTTTGCCGGCACGGCGCAGGTGTTCCAGGAGACGATGAACTCG
+CAGGTGATCCTGATTATCGCCGCCATCGCCACGGTGTATATCGTGCTGGGTATCCTTTAC
+GAGAGTTACGTACATCCGCTGACGATTCTCTCCACCCTGCCCTCGGCGGGCGTTGGAGCG
+CTGTTGGCGCTGGAGCTGTTCAATGCCCCGTTCAGCCTAATCGCCCTGATAGGGATCATG
+CTATTAATCGGCATCGTGAAGAAAAACGCCATTATGATGGTCGATTTTGCGCTTGAAGCC
+CAACGGCACGGTAACCTGACGCCGCAGGAAGCTATTTTCCAGGCCTGTCTGCTGCGTTTT
+CGCCCGATTATGATGACTACCCTGGCGGCGCTGTTTGGTGCGCTGCCGCTGGTATTGTCG
+GGCGGCGACGGCTCGGAGCTGCGGCAACCCCTGGGGATCACCATTGTCGGCGGACTGGTA
+ATGAGCCAGCTCCTTACGCTGTATACCACGCCGGTGGTGTATCTCTTTTTCGACCGTCTG
+CGGCTGCGTTTTTCGCGTAAACCTAAACAAACGGTAACCGAGTAAATGACAGATCTTCCC
+GACAGCACCCGTTGGCAATTGTGGATTGTGGCTTTCGGCTTCTTTATGCAGTCGCTGGAC
+ACCACCATCGTAAACACCGCCCTTCCCTCAATGGCGCAAAGCCTCGGGGAAAGTCCGTTG
+CATATGCACATGGTCATTGTCTCTTATGTGCTGACCGTGGCGGTGATGCTGCCCGCCAGC
+GGCTGGCTGGCGGACAAAGTCGGCGTGCGCAATATTTTCTTTACCGCCATCGTGCTGTTT
+ACTCTCGGTTCACTGTTTTGCGCGCTTTCCGGCACGCTGAACGAACTGTTGCTGGCACGC
+GCGTTACAGGGCGTTGGCGGCGCGATGATGGTGCCGGTCGGCAGATTGACGGTGATGAAA
+ATCGTACCGCGCGAGCAATATATGGCGGCGATGACCTTTGTCACGTTACCCGGTCAGGTC
+GGTCCGCTGCTCGGTCCGGCGCTCGGCGGTCTGCTGGTGGAGTACGCATCGTGGCACTGG
+ATCTTTTTGATCAACATTCCGGTGGGGATTATCGGTGCGATCGCCACATTGCTGTTAATG
+CCGAACTACACCATGCAGACGCGGCGCTTTGATCTCTCCGGATTTTTATTGCTGGCGGTT
+GGCATGGCGGTATTAACCCTGGCGCTGGACGGCAGTAAAGGTACAGGTTTATCGCCGCTG
+ACGATTGCAGGCCTGGTCGCAGTTGGCGTGGTGGCACTGGTGCTTTATCTGCTGCACGCC
+AGAAATAACAACCGTGCCCTGTTCAGTCTGAAACTGTTCCGTACTCGTACCTTTTCGCTG
+GGCCTGGCGGGGAGCTTTGCCGGACGTATTGGCAGTGGCATGTTGCCCTTTATGACACCG
+GTTTTCCTGCAAATTGGCCTCGGTTTCTCGCCGTTTCATGCCGGACTGATGATGATCCCG
+ATGGTGCTTGGCAGCATGGGAATGAAGCGAATTGTGGTACAGGTGGTGAATCGCTTTGGT
+TATCGTCGGGTACTGGTAGCGACCACGCTGGGTCTGTCGCTGGTCACCCTGTTGTTTATG
+ACTACCGCCCTGCTGGGCTGGTACTACGTTTTGCCGTTCGTCCTGTTTTTACAAGGGATG
+GTCAACTCGACGCGTTTCTCCTCCATGAACACCCTGACGCTGAAAGATCTCCCGGACAAT
+CTGGCGAGCAGCGGCAACAGCCTGCTGTCGATGATTATGCAATTGTCGATGAGTATCGGC
+GTCACTATCGCCGGGCTGTTGCTGGGACTTTTTGGTTCACAGCATGTCAGCGTCGACAGC
+GGCACCACACAAACCGTCTTTATGTACACCTGGCTTAGCATGGCGTTGATCATCGCCCTT
+CCGGCGTTCATCTTTGCCAGAGTGCCGAACGATACGCATCAAAATGTAGCTATTTCGCGG
+CGAAAAAGGAGCGCGCAATGAAGTTCTGGCGACCCGGTATTACCGGCAAACTGTTTCTGG
+CGATTTTCGCCACCTGCATTGTCTTGCTGATCAGTATGCACTGGGCGGTGCGTATCAGTT
+TTGAGCGTGGCTTTATTGATTACATCAAGCATGGTAATGAACAGCGATTACAACTGTTAA
+GTGATGCGCTTGGCGAGCAGTATGCGCAGCATGGCAACTGGCGCTTCCTGCGCAACAATG
+ATCGCTTTGTCTTTCAGATCCTGCGTTCATTTGAACACGATAATTCGGAAGATAAACCCG
+GCCCGGGTATGCCACCGCACGGCTGGCGTACCCAGTTCTGGGTGGTTGATCAAAACAACA
+AAGTGCTGGTTGGTCCGCGAGCGCCGATTCCACCTGACGGTACACGGCGACCCATTCTGG
+TCAACGGTGCGGAAGTTGGCGCGGTGATCGCCTCCCCCGTTGAGCGGTTAACGCGCAATA
+CTGATATCAATTTCGATAAACAACAGCGGCAAACCAGCTGGTTGATTGTCGCCCTGGCAA
+CGTTACTCGCGGCACTTGCCACTTTTCTGCTGGCGCGCGGTTTACTGGCACCGGTAAAAC
+GACTTGTCGATGGCACGCACAAACTGGCGGCGGGCGATTTCACTACCCGCGTAACGCCCA
+CCAGTGAAGATGAACTGGGCAAACTGGCGCAAGACTTCAACCAGCTTGCCAGCACACTGG
+AGAAAAACCAGCAAATGCGGCGCGATTTTATGGCCGATATTTCTCACGAACTGCGTACGC
+CATTAGCGGTGCTGCGCGGTGAACTGGAAGCCATTCAGGATGGCGTGCGTAAATTCACGC
+CGGAGACGGTGGCGTCTTTACAGGCGGAGGTCGGTACACTGACCAAACTGGTTGACGATC
+TCCATCAGTTGTCGATGTCTGATGAAGGCGCTCTCGCCTATCAAAAAGCACCGGTAGATT
+TGATCCCACTGCTGGAAGTGGCGGGCGGCGCATTTCGCGAACGATTCGCCAGTCGTGGCC
+TGAAACTGCAATTTTCCCTGCCAGACAGTATTACCGTATTTGGCGATCGCGACCGTTTAA
+TGCAGTTATTCAATAACTTACTGGAAAACAGCCTGCGCTACACTGACAGCGGCGGCAGCC
+TGCAAATCTCTGCCGGGCAGCGCGACAAAACGGTGCGCCTGACCTTTGCCGACAGTGCGC
+CAGGTGTCAGTGACGATCAGCTACAAAAATTGTTTGAACGTTTTTATCGCACCGAAGGTT
+CCCGCAACCGTGCCAGCGGCGGTTCCGGGCTGGGGCTGGCGATTTGCCTGAACATTGTTG
+AAGCACATAATGGTCGCATTATTGCTGCCCATTCGCCTTTTGGCGGGGTAAGCATTACAG
+TAGAGTTACCGCTGGAACGGGATTTACAGAGAGAAGTATGACCGAGTTACCAATCGACGA
+AAACACACCGCGTATTTTGATCGTGGAAGATGAACCGAAGCTGGGGCAGTTGCTCATTGA
+TTATCTGCGTGCTGCGAGCTATGCGCCGACGCTTATCAGCCACGGCGATCAGGTACTGCC
+GTATGTGCGCCAGACACCACCGGATCTGATCCTGTTAGATCTGATGCTCCCTGGCACCGA
+TGGCCTGACGCTGTGCCGGGAAATTCGTCGTTTTTCTGACATTCCGATCGTGATGGTGAC
+GGCAAAAATCGAAGAGATCGATCGCCTGCTGGGGCTGGAGATTGGCGCAGATGATTATAT
+CTGTAAGCCGTACAGCCCACGGGAAGTGGTAGCGCGCGTCAAAACCATTTTGCGCCGTTG
+CAAACCGCAGCGCGAGTTGCAGCAACAGGATGCTGAAAGCCCGTTGATTATCGACGAAGG
+TCGTTTTCAGGCTTCATGGCGCGGTAAAATGCTTGACCTGACGCCTGCGGAATTTCGTCT
+GCTGAAAACGCTCTCTCACGAACCAGGAAAAGTGTTCTCCCGCGAGCAATTGCTCAATCA
+TCTTTATGACGACTACCGCGTAGTAACCGACCGCACCATCGACAGCCACATTAAAAACCT
+GCGCCGCAAGCTGGAATCTCTCGACGCCGAACAGTCATTTATCCGCGCCGTTTATGGCGT
+CGGTTACCGCTGGGAAGCCGACGCCTGCCGCATCGTTTAGTTTTAGCGACATTATTTTGT
+TAGCCGGAGATGGCGTTCAGACCAGATCCGGCAACATTATCCCACGCATGGTCAGCAAAC
+TGACATTATCTCTCCGCCCTGGCAGGCATCAGAAAATCGCTCATACTTTAATCGGTAAAC
+AGCACCTTTAGATGCTGTTTTCGATACACAATTTCAATCAAGGAGTCATTATGGCTGGTT
+GGTTTGAACTCAGTAAGAGCAGTGATAATCAGTTCCGGTTTGTGCTAAAAGCGGGCAATG
+GTGAGACTATCCTCACCAGCGAGCTTTATACCTCAAAAACCTCTGCGGAAAAGGGCATCG
+CGTCGGTGCGTAGCAACAGCCCGCAAGAAGAACGCTATGAGAAAAAAACGGCAAGTAACG
+GCAAATTCTATTTCAATCTGAAAGCCGCTAATCATCAAATTATCGGCTCCAGCCAGATGT
+ACGCCACCGCGCAATCTCGTGAAACCGGAATTGCCTCCGTTAAAGCCAATGGCACAAGCC
+AGACGGTGAAAGACAATACGTAATTACGATGCCGGGCGTGGGTTGTTGGCGTCCGGCGCT
+TTACCAGAGCCCCCCACAGCGCTACAATGCCCGCCCTTAAAGTGGGGGCACTCCCCTAAC
+CGCTTCATCAGGTGAAGCGGATCTGACCTGTCATCAGAACGAGAGAATTATGTTTAAACC
+GGAACTCCTTTCCCCGGCGGGAACGCTGAAAAATATGCGTTACGCTTTCGCTTATGGCGC
+AGATGCTGTTTATGCGGGCCAGCCGCGTTATTCCCTGCGTGTGCGCAACAACGAATTCAA
+CCACGAAAATCTTCAGCTCGGCATCAATGAAGCCCACGCGCTGGGGAAAAAGTTTTATGT
+CGTGGTCAACATTGCACCGCACAACGCCAAGCTGAAAACCTTTATCCGTGACCTGAAACC
+GGTGGTGGAAATGGGGCCGGATGCGCTGATTATGTCCGATCCAGGGCTGATTATGCTGGT
+GCGTGAGCACTTCCCTGAAATGCCGATCCACCTTTCGGTGCAGGCTAACGCCGTGAACTG
+GGCGACGGTGAAATTCTGGCAGCAAATGGGCCTGACCCGCGTGATCCTCTCTCGCGAGCT
+GTCGCTGGAAGAGATTGAAGAGATCCGCAATCAGGTGCCGGATATGGAGATCGAGATCTT
+CGTTCACGGCGCGCTGTGCATGGCCTACTCCGGTCGCTGCCTGCTCTCTGGCTATATCAA
+CAAGCGCGACCCGAACCAGGGCACCTGCACCAACGCCTGCCGCTGGGAGTACAACGTCCA
+GGAAGGGAAAGAAGATGATGTTGGCAACATCGTACACAAGTACGAGCCGATTCCGGTGCA
+AAATGTTGAGCCGACGCTGGGTATCGGCGCACCAACCGACAAAGTGTTTATGATCGAAGA
+GGCCCAGCGTCCGGGCGAGTATATGACCGCGTTTGAAGATGAGCACGGCACTTACATCAT
+GAACTCGAAAGATCTGCGCGCCATCGCCCATGTAGAACGCCTGACCAAAATGGGCGTGCA
+TTCGCTGAAAATCGAAGGTCGTACCAAATCTTTCTACTATTGTGCACGCACCGCACAGGT
+TTACCGCAAAGCTATCGATGACGCCGCTGCGGGAAAACCGTTCGATACCAGCCTGCTGGA
+AACTCTGGAAGGTCTGGCGCATCGTGGCTATACCGAAGGTTTCCTGCGTCGTCATACTCA
+CGACGATTATCAGAACTACGAATACGGTTATTCAGTTTCTGACCGCCAGCAGTTTGTTGG
+TGAGTTTACCGGTGAGCGCAAGGGGGACCTCGCGGCGGTAGCGGTGAAAAATAAATTCTC
+CGTTGGCGACAGCCTTGAGCTGATGACGCCGCAAGGCAACATTAATTTTACCCTTGAGCA
+CATGGAAAACGCCAAAGGCGAAGCTATGCCGATAGCACCAGGCGATGGTTATACTGTGTG
+GCTCCCGGTCCCGCAGGATCTTGAGCTCAATTACGCGCTGCTGATGCGTAATTTCTCCGG
+GGAAACCACGCGTAATCCCCACGGTAAGTGATTAATTTCGATTATTTTTCCCGGATGGAA
+AATTCTTAGAAACCGATCACATACAGCTGCATTTATTAAGGTTATCATCCGTTTCGCTGA
+AAAACATAACCCATAAAATGCTAGCTGTACCAGGAACCACCTCCTTAGCCTGTGTAATCT
+CCCTTACACGGGCTTATTTTTTACGCGTAATACAATGAAATAAAAGGATTTATTTCTGGT
+CACGTCCACACATTGACCACATCGACAAAAAAGCCCCTCGACTGAGGGGCTTCCTGTTTC
+TAATTACATCCACATAATTTGCTGCCCTGACGGCAACGGGTGCGGCCTTACGACGTGGAC
+TTCTCCCGGCTTCACAATGTATCGCTGTACCGACTCATAAGTGATGAACGTGGCGCTGCA
+ATTCACGTTCTGACACTGGTGATAACGCTCTTTTGTCGTGTCAGTGATATAGCGGCTTGT
+ACGCGCATGTGCGGCATGCTGGCATAAAGGACAATGAAACATCGCGAGCACCTCTTCCGG
+TTTTGTTGATGGTGCCATTTTAGTTAATTTACCCTTACAAAACAAACAGATAAAATAAAA
+ACATCACTCATTATCTTCTGTTTCGTACCCCACATCAGAAAGCCTGACCTCAAGCTCTAA
+TGACGTCGTGAAGCCGCTATTATTCAGAAAATGTGTCACCTTAGTGATTGTCCAGTCCTG
+CTCGTCTATGACGCGCTTAAAGCCAGACACTTTGACCGGTGTTTCCGTGTAAATATCTGC
+CCGACCGGTAGCCAGGCTGATGGAGAACTCTGCTACACGGGCTTATTTTTTTATGCATAA
+GCCCTATCTCTGGTAACCGTCTTCCATTGACCACATCGATAGAATCCTCCTTCATAGCAC
+GATGCCTTTCACTTATCGGCATCGTGCTCCCACAGGTTCCGGCTACGCACAGCCAGAACG
+CGCATATTTGACGCTTACCAAAAAATATTCTCACTCTCCACATTTGAATGTCAGACGAGC
+GACACCATGTAATCCTACACCTTCTGTCTTCAGCTCAACTATTTGCATTTTTTTGCCCTG
+AGTAACACAGAAATGAGTTGCATCATTTTTTACTATATTTTCTGCACCAGATATTCTACC
+CCTGGCTAAAGAAGCTTCGGCTTCGGTGTAGTATTGGTTATCGAGTTTACGCTGAATATT
+ACTTTTATATGCAAGACCAAATTTACCGATACTTGTCTCATCATTATGCACAGCACAACC
+AGACATAATAAAAATACTAATTAATGATATAGCAGCTATCTTTTTCATCTCACCTTCCCC
+CATTAAATACCAACGACACTCTCTAGTGTTTAAATATAATAATGGCATGATTATTATAAT
+TGAATAGGATTATAATAAATGTTCTGTACAACATTTCCTACATAAGTAGGAATTACGGAC
+ATTGAGGCCCTTCAGGGTAACTCCATGGGGGCTTTAATATATTATATTGAAGATGCCACT
+GTTTAGTTGAATATTAGGTATATGCTCTTTTTTGAAATTTATCGGTGGCAGCCGTTAGTA
+TTCGCTGTCCCCATTGCAAGCTCCTGGTGGTAACCACTGAATCCTCCATACTTGAACTGA
+CTTTTTATCCTCCGACTTTCATCCTGTTCTGACTCCACCTTTTGTTTTCTGCTCTACACT
+ATCTACAGACCAATCATAAAGGCACATACGATCATGGCAGAATTTCCCGCCAGCTTACTG
+ATTCTTAATGGCAAAAGTACTGACAATCTACCCTTGCGCGAAGCAATTATGCTGTTGCGT
+GAGGAAGGAATGACGATCCATGTGCGGGTCACCTGGGAGAAAGGCGATGCCGCACGATAT
+GTAGAGGAGGCCCGGAAGTTTGGCGTCGCAACGGTGATTGCCGGTGGTGGCGATGGCACC
+ATTAATGAAGTTTCTACGGCGTTGATTCAGTGTGAGGGGGATGACATACCCGCGCTGGGA
+ATTTTGCCATTAGGAACCGCCAATGATTTTGCCACCAGTGTAGGGATTCCTGAGGCACTG
+GATAAGGCGCTGAAACTGGCAATTGCCGGTGACGCCATTGCGATAGATATGGCGCAGGTC
+AACAAACAAACCTGTTTTATTAATATGGCGACAGGCGGATTTGGGACGCGTATTACCACA
+GAAACGCCGGAAAAATTAAAAGCCGCGCTGGGTAGCGTCTCTTACATCATTCATGGCTTA
+ATGCGTATGGATACTCTGCAACCGGACCGTTGTGAAATCCGCGGTGAAAACTTTCACTGG
+CAAGGTGACGCCCTGGTCATTGGTATTGGTAACGGGCGTCAGGCCGGTGGCGGTCAGCAA
+TTGTGTCCGAACGCGTTAATTAACGATGGCTTGCTGCAACTGCGCATTTTTACCGGCGAT
+GAAATACTTCCGGCTCTCGTATCAACCTTAAAATCTGACGAAGATAACCCGAATATTATC
+GAAGGCGCTTCGTCGTGGTTTGATATTCAGGCACCACACGACATCACCTTTAATCTTGAT
+GGCGAACCGTTGAGTGGGCAAAATTTTCATATTGAAATACTTCCGGCAGCGTTGCGTTGT
+CGATTACCACCAGATTGTCCACTGTTGCGTTAATCAAACTATTCTCTCTTGAACCAGGGA
+GAATCCGTAATGCCGGATGCGGTGTAAACACCTTATCCGGCATACAGAACAATACTACAC
+CGTAATTAATTTTACCCGCGTCTTCTGCAATGCCAGTTTATCCACCTCTGACACAGCATC
+ATCGGTAATAATAATGTCAATTTTTTCGATTGGTAGTACCTGATTAAAACCGCGACGGTT
+AAATTTCGATGAATCGAGAACGGCAATCACTTTATTAGCGGCTGTGACCATCGCACCGCT
+AATAGAATAACCTTCATTAAAGGTCGTAATACCATTAACCGCATCAATACCATCAGCACC
+GACAAACATTAAATCGGCATTAATATCCTGTAATGAACGCTCGGCAATGGAACCATGCAT
+CGAGCGCGTTTTATGGCGGACCGTGCCACCACAGACGACCAGAGTAATGTCTTTATTTTC
+GGAAAGGGCAAACGCTGCCGGGAGACTGTTGGTAATCACCGTGATATTTTTGGCGGTCAT
+TAATCCTTCGGCGATAAGCATTGTCGTACTTCCGCTGTCGAGAATAACGGTCTGATCTTA
+CCCAGCAATAGTGGACACGCGGCTAAGTGAGTAAACTCTCAGTCAGAGGTGACTCACATG
+ACAAAAACAGTATCAACCAGTAAAAAACCCCGTAAACAGCATTCGCCTGAATTTCGCAGT
+GAAGCCCTGAAGCTTGCTGAACGCATCGGTGTTACTGCCGCAGCCCGTGAACTCAGCCTG
+TATGAATCACAACTCTACAACTGGCGCAGTAAACAGCAAAATCAGCAGACGTCTTCTGAA
+CGTGAACTGGAGATGTCTACCGAGATTGCACGTCTCAAACGCCAGCTGGCAGAACGGGAT
+GAAGAGCTGGCTATCCTCCAAAAGGCCGCGACATACTTCGCGAAGCGCCTGAAATGAAGT
+ATGTCTTTATTGAAAAACATCAGGCTGAGTTCAGCATCAAAGCAATGTGCCGCGTGCTCC
+GGGTGGCCCGCAGCGGCTGGTATACGTGGTGTCAGCGGCGGACAAGGATAAGCACGCGTC
+AGCAGTTCCGCCAACACTGCGACAGCGTTGTCCTCGCGGCTTTTACCCGGTCAAAACAGC
+GTTACGGTGCCCCACGCCTGACGGATGAACTGCGTGCTCAGGGTTACCCCTTTAACGTAA
+AAACCGTGGCGGCAAGCCTGCGCCGTCAGGGACTGAGGGCAAAGGCCTCCCGGAAGTTCA
+GCCCGGTCAGCTACCGCGCACACGGCCTGCCTGTGTCAGAAAATCTGTTGGAGCAGGATT
+TTTACGCCAGTGGCCCGAACCAGAAGTGGGCAGGAGACATCACGTACTTACGTACAGATG
+AAGGCTGGCTGTATCTGGCAGTGGTCATTGACCTGTGGTCACGTGCCGTTATTGGCTGGT
+CAATGTCGCCACGCATGACGGCGCAACTGGCCTGCGATGCCCTGCAGATGGCGCTGTGGC
+GGCGTAAGAGGCCCCGGAACGTTATCGTTCACACGGACCGTGGAGGCCAGTACTGTTCAG
+CAGATTATCAGGCGCAACTGAAGCGGCATAATCTGCGTGGAAGTATGAGCGCAAAAGGTT
+GCTGCTACGATAATGCCTGCGTGGAAAGCTTCTTTCATTCGCTGAAAGTGGAATGTATCC
+ATGGAGAACACTTTATCAGCCGGGAAATAATGCGGGCAACGGTGTTTAATTATATCGAAT
+GTGATTACAATCGGTGGCGGCGGCACAGTTGGTGTGGCGGCCTCAGTCCGGAACAATTTG
+AAAACAAGAACCTCGCTTAGGCCTGTGTCCATATTACGTGGGTAGGATCAGTCATCCCTT
+CGTGGATCATTTTGACTGCCGCCTGCGCTATTCTGTTTTTTGGCGCGCTGGCGAGCTGAA
+ATCGCTCTTTAAACCCGACTTCCTGGGTCTCGGTTTCACTATTACCAGACATTATTTTCG
+CCGCACCGCCATGAAAGCGCGTAACCACGCCTTTTTGTTCGAGAAAGCGCAAATCGGCAC
+GGATTGTCGCTTCCGAGGCAGCAAATACTCCCGCCAGATCCTGAACAAGCACGGTTCCCT
+GTTCATTCACTAATTGGATGATCTTATTCCTTCGCTCGAATGAATTCATCGTCATTTACC
+CATATTCAATTGTGGCTAGTGTAAACGAAGGGGGACCATTGGTGAATGATCTGTTTTGCA
+CAATACCGGGCCAGCATCACGCTGGCCCGCGGTTTCAGGGAATGAGCAACACTTTGCCCG
+GCATAGCATTACGAGCGATGTCACGCACCGCCTGGGCGAAGCTTTCAAAGCTTCCACGGT
+GAGCGATTAATGGCTCCAGGCTTAACTTACGTTCTGTCAGCAACCGGCTCGCCGTTTCCC
+ACTCCTGCCCCGGCCAAGGGCTGGAGTAGTTCATCCAACTGCCGATAACCGTCAGCTCTT
+TACGCAATATTTTGCCAAACGTTGCCGATGTTAAATGCAGATCCTGATGCAACGTGCCCA
+CCAGCGCCAGTTGGGCATGAGGACCGGCAATCTCTACCGCCAGTTCGACAGTTTGCGGTA
+CGCCAGCCGTCTCGAGGATAAGCTGATTAAAGCGCAGTTCGCGTAAAACGCTCTGCATTT
+GCGGCGCGCTCATTTCGCTACTGTTAAATGTTTGCATCGCACCGAAAGATTTTGCCAGTG
+CCAGTTTTTCTGAACTAATGTCGATCGCCGTCACACTCTTTGCTCCCAGCGCGACAGCGC
+ACTGAATGGCCAGCAGGCCAATGGTTCCGGCACCAATAATAATAACGTTTTTATTCTCAC
+AACCTTGCGCTAAATGAAAAGCATGCAGACCAACGGTAATCGGCTCAATAAAAGCCCCAT
+CCTCAATAGGCATATCCGTGGGTAGAGCAAAGACATTTTTTCGCTTAACGACAATATATT
+CAGCAAATCCACCATCACGCCGCGAGCCAATAAAATCATATTTTGCGCACTGGGAATAAA
+ACCCTTTCAGACACTCTGGACAAGTAAAACAGGGTAATAACGGCACACAGGCAACCGCAT
+CGCCAGGGTGTAAATCATCAACACCGGATCCCACCGCATCAATATAGCCGCTAAATTCAT
+GGCCTAACGTTATTGGATAATAATGTGCACCATTTTTAAATATCCTGGGTAAATCGGAAC
+CACATAAGCCCGAGCTGGCAATTTTTACCCGCACCTCATCCTGATGTTTAATTTCAGGAA
+TGACGCTTTCTGCAACGCGCACGATACCATCAGTATCATTCACCACTGATTTCATAAAAA
+CTCCTGATTGTTAAGGGGGATAACCTCCCCCTCAGGTAAAAATTATTCTGCGAGAACGAC
+TTTCTCTTGTTTAATAAAGCCACGCGCTCTACGCCAGGTCATGAAAATACCGGTCAGATA
+AATTGCACCGATAATAATGAAACCGGGAATATTTTGCGGGGAGAAAACCTGAATCAGTAA
+CCAGGTAATGGGAGAACCGCCCTGATCCATTGAAGCCACCATACCCCCGGCTTTTAACGC
+CCCAGCATTAGCCGCCAGTTGGGTGTGCAAACCAATAGTTTGCGTCGCGATCCACAGGGT
+GATGCTCATAATGATGACACCCGAGATTAAGGTGCGGAACAGATTTCCACGATGCACGGC
+GACCGCCATCGCCACGAAGAAGCCGATGGTGGCAAGATCGCCAAACGGCAGCACCTGATT
+ACCCGGCACACAAACAGCAATTAAAATGGTGAGTGGGATAAAAATCAGGCTTGCCGATAC
+CACCGCCGTATGTCCCAGCAGCAACGCCGGATCAAGGCCAATCAGGAACTCCTGACCGCC
+GAACTTCGCCTGTAAACGACTACGAGCCTGCTTAGCGATGGGCGTTAAACCATCCATGAT
+GGGTTTAATCACCCGTGGCATTAGCAGCATCACTGCCGCCGTTTTTACCGCCAGCTGCAA
+TACACCTTTGACATCGTAACCCGCGAGGATGCCGATAATCAGCCCCATCACAAAACCCAC
+GGTGACAGGCTCGCCAAATGGACCAAATTTGCGCTGAATATCGTCGGCGCTAAATTTAAT
+TCGGTTAACGCCTGGGATTTTCTCGATGATAGCATCGACCAGCACCGCAATCGGCCCCAT
+ATACGCCGACGTACCGTGCGGAATAGCAATACCTTCCAGCTCAAAGAAATTTCGGGTATC
+GCGGGCAAACCAGTCGCCGAGCTTATAAACAAACGCCGCGTGAATTACCACACCTGCCAT
+CCCTATCATCCATGAACCGGTTGCCAGATGCAGCAACGCGCCGGTGAAGGTCATATGCCA
+GATATTCCAGATATCAACATTTACCACCCGCGTCATACGGGTCAGTAACATCGCCACGTT
+AACCAGAATCGCAATCGGAATCGCCACCAGCGCAATTTGCGACGCCCAGGTCATTGGTGA
+AGAGCCCGGCCAGCCAACATCGACCACATGCAGATTCAGGTCGAAATTTTCCGCCATCGC
+TTTCGCCGCCGGGCCAATGGAATCCAGCATTAAGCCAATCACAAGGCCAATGCCAACAAA
+GCCAATCCCGATATGCAGACCCGCTTTAAAGCAATCGCCTGCCTTCATGCCTAATATTTT
+AGAAAAAATAATGATGACAATCGGCAGCATCACCGTAGGGCCGAGGTCGAGAATATAACG
+CATGACTTCTGAAAACATAGGTCACCCCTGTAAGATAGTCAGAATTTTATTTTGTAATGC
+TTCGATACCGATACCAGAAATAAAAGGCATGCCGTGAACTAACGGAATATCGCCAAAACT
+ACGATCCACTTTGGCAGTGGTGCATATCAAATGCACACCATCCATATAGGTTTCTATTTC
+ATTAACCCGACACTGGATTAATTCAACAGGAATATTATGATTCTGACACAACTCTTTAAT
+TTCTTCCGCCGCCATCGTAGAGGTCGCAACCGCGCCTCCGCAAGCGACAATAATCTTGCG
+TTTCATAAATAGTCCTTTTTATTGTTACAGAGGGATTTATTCGTCTGAATCTAAAACATA
+CTTTGTGAAGTATTCCTTTAACTGGGTTTCAGGAAGAGTGATTAGTGTCTCGACGATATC
+GGGCTGTTGTAACTTGCCAAATAAACAGCGTAAAAGTTTCAATTGCTGCTGCGGATTTTC
+CACAATCAACGCAATAACCAACGATACCGCCACGTCGTTATCATCATCCGCTTGCTGAAA
+ATGAACTTTATTTGTTGGCCTTAACAGATAAATGGCTGACGACTTAGCATGAATCGCCTC
+ACAATGCGGTATTGCAATAGCGTGCTGCTCAAGCATTATCCCGGTAGGGAATTCTGCTTC
+TCTGGCAATTAATGCCTGTGGCCAGGTATCATGAACCACACCTTTGGCGAGCATCTCATT
+ACCGATATGGGTTAAAACTTCGCTACGATCGACAAAAGAAATTCCGCTACGAACAAACAG
+GTTAGTCATATACCGTCCTTATTCCGCACAGCCGTAGCGATAGGCGCGCAAAACATCATA
+AATTTTATCCATAATCAGCTGATGCGGTATTGCTGATAATTCCCCGGACTGAATGCGTTC
+AAATTGTTTGGGAAGATACTGACTAATCATGCCCAGTGGGATGTCCACGCCTTCAAGATT
+CACCATCATCGTTTCGACGCTATTTTTAATCCGACTATGCGGCCAGTAATAACGAATACG
+ATCCGACAGGCTGTAACGAATATCCAGTAATGAATCGTTAAAACCCGTACGATAATATTT
+TTTCCAGTATTGCGGTTCGTCGAGCATCACTTCTTCAATTACCGCCAGGCAACCGCTGCG
+ATTTTCAGGGGCGATAAGTTCCTGCTCAATTTGTGCCAGTGCAAATATCGCCTCGCGTAA
+AGCAAAGGTTAATGCGGGACCGACTTTCAATATTGCAAAGTGATCGCGGACTAATTCCCA
+ATAAGCCGTCCGGGTCTGGTAATCGGTAGAATGTGCTTCATAAACCATTCGGGTGTTTTC
+TATCCATTGCGCCAGCGGCTGCGCTTCCTGCGGCTGATAATGGATAATATTGCTGTGATC
+AAATTCCACACCCGGCTGCACCACGATGGCAATCACACGTGTTAACGCCTCTGTCAGCCC
+ACGGGCAATAAAGGCCTTTTGATGCGTACGTAAAGTATTGGCGGCATCTTCAACATGGGT
+GATGTGTACTGACTGAATGGCGCTGGCCTCACCGCCCGGAACCGGAACTTCGGTGCCAAT
+GACATAGCTCAGTTGCTCACGCTGGCAATCTGTCGCCACACTTTCCGCAGCAAAGCAAAG
+CACAGCAGCTCGTTCCGCAACCGTTTCTGGTGCTAACGGTATGGGATCCCCCGCGCAGGA
+CATTGACGCATCAAGATGAATTTTACTGAAGCCGGCACGAACATATTCCTATACCAGCTC
+GACGGATTTTTCCATCGCCGCATCCGCATTTTCTTGCTGCCAGCAGTTTGGCCCCAGATG
+ATCGCCGCCGAGAATAATGCGTTCGCGTGCAAACCCAACTTTATCGGCAATCGTAAAAAC
+AAATTCGCGAAAGTCTGCCGGTGTCATTCCGGTATAACCGCCAAATTGATTGACCTGGTT
+TGACGTTGCTTCAATCAGCACTTTGCGCGTGCTGTTGCGATCAAATGCCAGCGCCGCTTC
+GATAACCAACGGATGGGCAGAACAGACTGAACATATGCCGATATGTTCACCAGCTTTATG
+CCGGGCAATTAACGTTTTCATGTTTTTTCCTTGTTAAATGGCAGGTGCGTTATGCCCTGC
+CCTCGCAGCCACAATCGGCAATCACTTTGCTCACCACATCGCGCATTGCGGATTTAGCCG
+ACTGCAAATAATCCCGGGGATCGGTCGCTTCAGGGTGCTCGGTCAGGTAATTTTTTAACG
+CCTGCGAGAAGGCATTTTTCAGCTCCGTTGCAACGTTGATTTTGCATATCCCCAGTTTGA
+TGGTTTGCTGAATATCCTTAGTCGATAACCCTGACGCGCCATGCAGCACCAGCGGTAAGT
+TCACCCACTGGCGAATGTTCTCCAGTCTAGAAAAATCAAGCGCCGGTGCGCTGGCATACA
+TCCCATGAGCCGTGCCGATGGCGACCGCCAGGGAATCAATTCCGGTTGCCTCGGCAAATT
+CACGCGCCTGAGCGGGGTTGGTGTACAACGCATCGGCTTCATTGACTTGCACATCATCTT
+CCTGGCCGCCAAGTTGCCCCAGCTCCGCCTCGACGCTGACATCAAAGCGATGGCAAAAAT
+CCACCACCTCTTTGACCCGTGAAATATTTTGCGCAAAAGGCAAATGCGAGGCGTCAATCA
+TGACTGAGCGCACGCCAGAACGAACCTTCTGAGCGATATCGTCAAATTTCGTGTGATGGT
+CGAGATGAATTGCCAGTGGATGGTGATATTGCTTCGCCATCGCGCTGACCAGCGCCAACA
+GATTTTCTGTACCAGCATGAGTAAATGTGCCAGGCGTTCCGGCGATGATGACCGGCGCAT
+GCAGGTTGGCAGCGGTTTCTACCACCACTTGCATCGTTTCGAGATTGTGAATATTGAATG
+CCGGAACCGCATAACCGCCGCGCTGTGCGTTGTTCAGCATCTGCTTTGTCGATACCACGT
+ACATTTTCATATCCTGTCGTTTGTTTTCGATTTCAAAATATAATGAAATTATTTGTTTTT
+AAATATCGAGATAACGATCACAAAAACGACAATATGAAAATTATTCGAGGAGTGAAAGGC
+AAAAAAACGGCCTCCCGATAGGGAAGCCGTAGCAAAGTGCGCGTGTTTTTATGCCGGATG
+CGGTGTAAACATACGTGGCAGTGCTATGTAGGCATGATAAGACGCTTCAGCGTCGCATCA
+GGCATAGGTTGCCGGATGCAGCGTAAACGCCTTATCCGTCCTACGGGGTGGTGTTGTTCG
+TATAAGGCGTATCAGGCGATAGTAATTTTGCTATCGAGATAAACGTCCTGCACGGCGTTA
+ATCAGTTTCACGCCGTCAGCCATCGATTTCTTGAACGCTTTACGTCCAAGAATCAGCCCC
+ATTCCGCCTGCGCGTTTGTTGATAACCGCAGTACGCACTGCATCGCTGAGGTCAGTTTCA
+CCGCCCGCAGCACCGCCGGAGTTTATCAACCCAGCCCGACCCATATAGCAGTTAGCTAAC
+TGATAACGCACCAGATCAATCGGGTTTTCGCTGGTCAATTTGCTGTAAACACGATCGTCG
+GTGTAACCGTAATTAATTGCTTTATAGCCGCCGTTATTTTCCGCCATTTTTTGTTTGACG
+ATATCTGCACCGATGGTTGCCGCCAGATGGTTTGCCTGACCGGTCAGGTCGGCGGAAACA
+TGGTAATCAACGCCATCTTTCTTAAAGGCGGAGTTACGCAAATAGGCCCACAGCACTGTC
+ACCATACCCAGCTCGTGCGCACGTTCAAAAGCCGCAGAAATTTCTTCAATCTGGCGACGT
+GACTCTTCCGAGCCAAAATAGATAGTCGCACCAACCGCAACCGCGCCCATGTTGAACGCC
+TGCTCCACGCTGGCATACAGCGTTTGATCGTAGGTATTCGGGTAACTTAGCGTCTCGTTG
+TGATTAAGTTTGACGAGGAATGGAATGCGATGCGCATAACGCCGCGATACCGACGCCAGC
+ACGCCGTAAGTTGACGCCACACAGTTACAGCCCGCTTCGATCGCCAGTTCAACAATGTTT
+TTCGGGTCAAAGTAGAGCGGGTTAGCAGCAAATGAAGCTCCGGCAGAGTGCTCAACGCCC
+TGGTCAACCGGCAGAATAGAAAGATATCCTGTGCCAGCCAGACGCCCGGTGTTGTACAAC
+GTCTGCATATTACGTAACACCGCTGGCGGGCGATTATTGTCAATCATTACGCGGTCTACG
+TAGTCATGTCCGGGGAGATAAAGCTGGTCAGAAGGAATTGTCATACAACGGTGCTGTAAA
+AGGTTGTCGGCGTCTTTGCCAAGCAACTGCGCAATATCTGTCATTACTATGCTCCCGTAA
+ATTCCGATTGGATATCGGCTATGGATTGTCCTGGCCCGCCTTTTGCGGGCAATCATAATC
+CTGGTCGTTACGGGCGAGTTTTTCCATCTTTTGGATGTTTTTTCAGCGTTTTCTGTTGGC
+TCGATTCATCAGAAAAAATGTTAGCGCGGTCAAGTTTTCACCGCAAAGGTATTTAAAACG
+TATTATTAAGTGGTATTGTCATCGCGTACCTTACATTACCTGTCATGAAGGAATTAAAAG
+ATGAAAACAACAGCAAAGCTGTCGTTCATGATGTTTGTTGAATGGTTTATCTGGGGCGCG
+TGGTTTGTGCCATTGTGGTTGTGGTTAAGTAAAAGCGGTTTTAGTGCCGGAGAAATTGGC
+TGGTCGTATGCCTGTACCGCCATTGCGGCGATCCTGTCGCCAATTCTGGTTGGCTCCATC
+ACTGACCGCTTTTTCTCGGCGCAAAAAGTGCTGGCGGTATTGATGTTCGCAGGCGCGCTG
+CTGATGTATTTCGCTGCGCAACAGACCACTTTTGCCGGGTTCTTCCCGTTACTGCTGGCC
+TACTCGCTAACCTATATGCCGACCATTGCGCTGACTAACAGCATCGCTTTTGCCAACGTG
+CCGGATGTTGAGCGTGATTTCCCGCGCATTCGTGTGATGGGCACTATCGGCTGGATTGCC
+TCCGGTCTGGCATGTGGTTTCTTGCCGCAAATACTGGGGTATGCCGATATCTCACCGACT
+AACATCCCGCTGCTGATTACCGCCGGAAGTTCTGCTCTGCTCGGTGTGTTTGCGTTTTTC
+CTGCCCGACACGCCACCAAAAAGCACCGGCAAAATGGATATTAAAGTCATGCTCGGCCTG
+GATGCGCTGATCCTGCTGCGCGATAAAAACTTCCTCGTCTTTTTCTTCTGTTCATTCCTG
+TTTGCGATGCCACTAGCGTTCTATTACATCTTTGCCAACGGTTATCTGACCGAAGTTGGC
+ATGAAAAACGCCACCGGCTGGATGACGCTCGGCCAGTTCTCTGAAATCTTCTTTATGCTG
+GCATTGCCGTTTTTCACTAAACGCTTTGGTATCAAAAAGGTATTATTGCTTGGTCTGGTC
+ACCGCTGCGATCCGCTATGGCTTCTTTATTTACGGTAGTGCGGATGAATATTTCACCTAC
+GCGTTACTGTTCCTCGGTATTTTGCTTCACGGCGTAAGTTACGATTTTTACTACGTTACC
+GCTTACATCTATGTCGATAAAAAAGCCCCCGTGCATATGCGTACCGCTGCGCAGGGGCTG
+ATCACGCTCTGCTGCCAGGGCTTCGGCAGTTTGCTCGGCTATCGTCTTGGCGGTGTGATG
+ATGGAAAAGATGTTCGCTTATCAGGAACCGGTAAACGGACTGACTTTCAACTGGTCCGGG
+ATGTGGACTTTCGGCGCGGTGATGATTGCCATTATCGCCGTGCTGTTCATGATTTTTTTC
+CGCGAATCCGACAACGAAATTACGGCTATCAAGGTCGATGATCGCGATATTGCGTTGACA
+CAAGGGGAAGTTAAATGAAAACAGAACGTATTCTCGGTGCTCTTTATGGGCAGGCGTTAG
+GGGATGCGATGGGGATGCCCTCCGAGCTTTGGCCACGCAGCCGCGTTAAAGCACACTTTG
+GCTGGATTGACCGTTTTCTTCCTGGACCAAAGGAGAATAACGCGGCCTGTTATTTTAACC
+GCGCCGAATTCACCGACGATACCTCGATGGCGCTGTGTCTGGCGGATGCGTTACTGGAAC
+GTGAAGGCAAGATCGATCCGGATCTGATTGGGCGTAATATTCTCGACTGGGCGCTGCGTT
+TCGACGCCTTTAACAAAAACGTACTAGGTCCGACCTCGAAGATTGCGCTTAACGCCATTC
+GCGACGGTAAACCCGTTGCTGAACTGGAAAACAACGGCGTGACCAACGGCGCAGCGATGC
+GCGTCTCGCCATTAGGTTGTTTGCTTCCGGCGCGTGATGTTGATTCCTTTATTGATGATG
+TAGCGCTGGCGTCCAGCCCGACCCATAAATCCGATCTGGCGGTTGCAGGCGCGGTAGTCA
+TCGCATGGGCGATTTCTCGTGCCATTGACGGAGAAAGCTGGTCAGCGATTGTTGATTCCC
+TGCCTTCAATTGCGCGACATGCACAGCAAAAACGCATCACTACGTTCAGCGCCTCACTGG
+CGGCGCGGCTGGAGATTGCGCTGAAAATTGTGCGCAATGCCGACGGCACCGAATCCGCCA
+GCGAACAGCTTTACCAGGTCGTTGGCGCAGGTACCAGCACTATTGAGTCCGTTCCGTGCG
+CCATTGCGCTGGTTGAACTGGCACAAACCGACCCGAATCGCTGCGCCGTCCTGTGCGCTA
+ACCTTGGCGGCGACACAGACACCATCGGTGCTATGGCGACGGCAATTTGCGGCGCGTTGC
+ATGGCGTTAACGCTATCGATCCTGCGTTAAAGGCGGAACTGGATGCGGTAAATCAGCTTG
+ATTTCAACCGCTATGCCACAGCGCTGGCGAAATATCGTCAACAACGGGAGGCGGTATGAG
+CGGCGCTCGATTACACACGCTGCTGCCTGAATTAACCACGCGTCAGTCGGTGATGGTCGT
+CGGCGCGGCGGTCATTGACGTGATCGCCGACGCTTATGCCCTCCCCTGGCGTGGGTGCGA
+TATCGAACTGAAACAGCAGAGCGTTAACGTTGGCGGCTGCGCACTGAATATTGCCGTGGC
+GTTAAAGCGCCTCGGCATCGAAGCGGGTAATGCCTTGCCGCTCGGTCAGGGCGTGTGGGC
+GGAGATGATTCGCAACCGGATGGCAAAAGAGGGCTTAATCAGCCTGATCGATAACGCCGA
+AGGTGATAACGGCTGGTGTCTGGCGCTGGTTGAGCCGGATGGCGAACGCACTTTTATGTC
+ATTCAGCGGTGTTGAAAATCAGTGGAATCGCCAGTGGCTGGCGCGATTAACCGTTGCGCC
+TGGCAGCCTGCTCTATTTTTCCGGTTATCAACTGGCCTCGCCCTGCGGCGAATTGTTAGT
+GGAATGGCTGGAAGAGCTGCAAGACGTGACGCCGTTTATCGATTTTGGCCCACGTATTGG
+CGATATCCCGGATGCATTACTGGCGCGGATCATGGCCTGTCGACCTTTAGTGTCGCTCAA
+TCGTCAAGAGGCTGAGATTGCCGCCGAACGTTTTGCTTTATCCGCAGAGATAACAACACT
+TGGCAAGCAATGGCAGGAGAAATTTGCCGCGCCGTTGATCGTTCGTCTCGATAAAGAAGG
+CGCATGGTATTTCAGCAACGACGCTTCTGGCTGCATTCCGGCATTTCCAACGCAAGTTGT
+CGACACCATTGGGGCGGGCGACAGTCATGCCGGTGGCGTACTTGCCGGGCTGGCCTCTGG
+TCTGCCACTGGCGGATGCCGTATTACTGGGCAATGCAGTGGCGTCGTGGGTTGTCGGGCA
+TCGGGGCGGTGATTGTGCGCCAACGCGCGAGGAACTACTCCTCGCACACAAAAACGTATA
+GATCGCTGCGACAGTGGCTAATGCTGTACTCAATAGGCCGTTGCTGTTGGTCAAGCGCCA
+CTTGCTTGATCACCAGCACCGGTATTTTGCTATCTAACTGAATATGTGACTGAAACTCGG
+CATCCGGCATCCGGGCGCTAACGCGGGAACGCGTACGTTGTGGGTAAATGTGCTGGCTGC
+GGAAATAGTCATAAAGTGAAATCCCGATGGCATCAACATCATGAATTAAATGCGCCGGAA
+CCCACGATTCCTCAATCGATACCGCTTCTTCATCGACATAGCGAATACGCTTAAGCAAAA
+AGACATCACTTCCTGCTTCGACCGCCAGCTGCTGCGCGACTTCTTCGGGACATTTCACGA
+CACGCTTGTTAACCCATAGCGTATCGGGCTTTTTCCCGCGCAATACCACCTGCTGAGAAA
+AACCTCGCGCTTCTTTCAACGAGTATTCGAAGATGTTGTTGATCTGCGTGCCGTAACCGC
+GCGAACGCGTCACCACACCCTCTTCTTCCAGCGCCTGCATCGCCTTGCGCACCGTAATGC
+GCGAAACGCCGGTTAACTGACTTAAATCACGCTCACCGGGCAAAATATTGCCATGCTCCA
+GCACCCCGCTGCGCACGGCATTTTTTACCGTTTCGGCAAACTTAATATAAAGCGGCGTGT
+TATCCGCCGCTAAAATACGCTCGTTCAGTTGGGCAATCAGCTGGGTATGCGCTTGTTCCA
+TTTGTCTTTTTCCTGCCGGGGAGTCTGGTGGGAGTATATCACTGCTTCTTATTTAAGGCG
+TTTCTTTAATCCCATCAACGAATGCCTGCAACTCCTCCACCGTGCCATTAAATACATTAA
+AATCCACCGGACCATTGATGCCATCTACCTGTCCACGGTCGGAATGCTGCCAGAAGCGCC
+AGGCCATTCCGTCATTGTCCGGACGACGTTGATAGTAGTGAGCCACCCACCACGGATATT
+CATTGAAATAGCCCGCCAGATTGGTGTGATAAAAAACGGCTCCTGAGTAAATAATCGGCT
+TTTTCCCCGTACTTTTTTCGACCATTTTTAGCCACTGACTTACCCGCTTGCGTAATTCTT
+TTGCCGATAATTTTCCCCGTTCTTCTACGTCCAGCACGGCAGGGAAATCGCCTTGTGAGA
+AATCCACCGTTTGCAGAAATAATCTCGCCTGAACTGAAGCGGATACCGACGGGGAGAAAT
+AATGATACGCCCCACGCAGCAGGCCATTTTCGCGGCTTAGTTGCCAGTTACGCGAAAAAT
+AGGGGTCCACCAGCTTTTCGCCTTCCGTCGCCTTAATAAAAGCAAACTGTAAGCGGATAC
+CATTGTCGCGCATTTTTGCCACCCGCTGCCAGTCGATCCGCTCCTGCCAGCGCGAAACAT
+CTATTCCGTGAATGGTGTAACTGGCAGGAATGCGAATAGCGAAAGATTTAACCGGGCGAT
+AACCGTAGAAGTGGATGTAGTCTGTAATCTGAACTGCTGTCGAATAGAAAAAATTCACCG
+TCTGACGCGGATAAATTGCAACGATGGAAATTAGCCCAAGAGCGCATAATAGAGAGGTGA
+GTTTTTTTCGACTGGTAATTCTTAGCTGCATTGGTTTCATCCCTGAATGTCAGTGCCAAA
+GGCTGACAATAACCAAAGCAGCTATAGTACGGTGCTCACCACCAGGCGTGGAAGTGGTGA
+ACCGGACCAATACCGTGACCAACTTCCAGCGTGTCGGCCTGGGCTAACGCCGATGAAAGC
+CAGCTTTTTGCCTCCTGTACGGTGTCAGCCCAGTTTGTATGGCGCGGGCGTAGTGCAGCC
+AACGCCGCAGAGAGTGTACAACCAGTGCCGTGGGTGTTTTTGGTCATAATGCGCGGTGCG
+GTAAACCGTTGTTCACCCTCGCGGGTAAACAGCCAGTCCGGGCTTTGCTCATCATCCAGA
+TGACCACCTTTCATTAGCACTGCGCCACAGCCCATCGCCAACAGCGATCGCCCTTGTTCC
+AGCATTTCCTGTTCGGTGCGCGCGTGTGGCGCGTCGAGCAAGGCGGCAGCTTCGGGCAAG
+TTTGGCGTTATTAATGAAACCTGTGGCAATAATCGACTGCGCAGCGTAGCAACCGCCGAA
+GGTGAAAGCAGCGGGTCGCCGCTTTTTGCCAGCATAACGGTGTCGAGTACCACGTTTTGG
+ATCTGATAACGTTGCAACCGTTCTGCCACCGCTTCAACAATATCGGTTTCCGCCAGCATA
+CCGATTTTAGTGGTATCGATTCGCACATCGCTGAACACCGAATCGAGCTGGGCGGCGACA
+AAATCAGGCTCAATGCGATACACCGACTGTACGCCACGGGTATTTTGCGCCACCAGTGCA
+GTAATAACTGAGCAACCATAAGCGCCAAGTGCCGAGAAGGTTTTAAGATCGGCCTGAATC
+CCCGCACCACCACTCGGATCAGTACCGGCAATCGTCAGAGCGTTAATTCGTTTCATGCCT
+GCACCTCCTGCGTCAATTGCCAGAGCGCATCAAGGAAATGTGGAACAAAACTGCCTGGCC
+CCTCGCTTCTGGCGACTGCGCGTTCTCCGGCTTGTTTCATCCAGTGACAGGCAGATGCGA
+CATTTTCCAGCGTATCGCCTGGTAACGCACAGCAGGCAGCGACAACCGCCGATAATGCAC
+AGCCAGTTCCTACCACTTTGGTCATTAACGGATCACCACCGTGAATACCAATGATACGAT
+GTCCATCGGTAACATAATCCATCTCGCCAGTGACCACGACGATTGCGCCAGTTTCCCGTG
+CCAGTGTTTGTGCAGCGGGTATCGCGTTAGCTGCGGCGTCAGTGGTATCCACTCCCCGTC
+CGCCATTAGCAATGCCAGCTAATGCCATGATTTCCGAAGCATTACCACGTATCGCTGCCG
+GTTTAAAAGATAAAAGTTCATGACAAAAATGGCGGCGATAATCGAGCGCACCCACCGCTA
+CTGGATCAAGCGTCCAGGGTGTTTGAGAGCTTTTTGCTTGCTCAACGGCAGCACGCATCG
+CCTGAGCGCGTGGCTGCGTCAGTGTGCCAACGTTAATCAACAAGGCACTGGCGATAGCCG
+CAAACTGACTGGCCTCTTCGGTTTCGATAACCATCGCTGGCGATGCACCGAGCGCCAGCA
+AGGTATTGGCGGTAAAGGTTTGCACCACATCATTGGTCATGCAGTGCACAAGAGGGGAAT
+GTTGGTGAAAAAGGTGTAACGCGTGCGCAGATTGCGCTGAACCCAGCAGGTCGACTTGCA
+TAGTTTGCTCCTGCCATAACGTGAAGAAGCAATGACCTGGTGGTCCGTGACTTCCCTACG
+CTGGCATTATCCAGATCAGGTGATACGGGTATTTCTCAGCCTTCACGCAGAAGGGCACCC
+CGAGTCGTTTGGTTGCGATGATAAATCGCAGAGGAGGATGGTAATGTCCAGCGCACGCGT
+TGTAAACGAGGAAAAACGGCAGTTTTACAATCGCGTTAATAAATTATTTGATATATGAAT
+CCAGCACCTTCAGAACGACATCCAGATCTTCTTCACGTTTTAGCTCATCCCCCTGGTGAA
+CGATGTGTTCCGTCAGATGACCTTTAATCACTTCCCGCATCAGACCGTTTACCGCGCCAC
+GGATAGCAGCAATCTGTTGTAAAACTGCAGCGCATTCGTGCGGCTCGTCGAGCATTTTCT
+TGAGCGCCACGACCTGGCCCTGAATCTTACTGGCACGCGCTTTCAGTTTCTGTTTATCAC
+GGATTGTATGAGACATGGCAACACCTGGTTAACAAGAATATGAAAAATCATAGCACTATT
+AATCTACTGGGGGGTAGTATCAGGTACTGGGGGGGAGTAGAATCAGATTGCCGAATTAAT
+ACTAAGAATTATTATCATGACCGAATTTACAACTCTTCTTCAGCAAGGAAACGCCTGGTT
+CTTCATCCCCAGCGCCATCTTACTTGGTGCGCTTCATGGCCTGGAACCAGGGCACTCAAA
+AACGATGATGGCGGCGTTTATCATCGCCATCAAAGGCACCATTAAACAAGCGGTGATGCT
+CGGACTGGCAGCAACTATTTCGCATACCGCAGTGGTCTGGTTAATTGCCTTTGGCGGGAT
+GGTGATCAGCAAGCGCTTTACTGCTCAATCAGCAGAACCGTGGCTCCAGCTGATTTCCGC
+AGTGATCATTATTAGCACCGCGTTCTGGATGTTCTGGCGTACCTGGCGCGGCGAACGCAA
+CTGGCTGGAGAATATGCACGGGCATGATTATGAGCATCATCATCACGATCACGAACATCA
+CCACGACCATGGACATCATCACCATCACGAACATGGCGAGTATCAGGATGCCCATGCACG
+AGCCCATGCCAATGACATTAAACGACGCTTTGATGGTAGAGAGGTCACCAACTGGCAAAT
+TTTGTTATTTGGCTTAACCGGTGGCCTTATCCCCTGCCCGGCAGCAATTACCGTGCTGTT
+GATATGCATTCAGTTGAAAGCCCTGACACTGGGCGCAACACTGGTCGTCAGTTTCAGCAT
+TGGCCTGGCGTTAACGCTTGTCACCGTAGGCGTTGGCGCAGCAATCAGCGTTCAGCAGGT
+CGCAAAACGCTGGAGCGGATTTAACACTCTCGCTAAACGCGCCCCCTATTTTTCCAGTCT
+GTTGATTGGCTTAGTCGGTGTGTATATGGGCGTACATGGCTTCATGGGCATAATGCGATA
+ACTCAATCCTTTAGGCTTGCATGTTATCTTCAGCCCAGGATGATTCTTAAATCAGCTATT
+TCCGCTGACTCTCTGCTCGCTAAGGATGCTTTTAGGGCATCCTTTCATTTACACTTTTTA
+CGAAATCATGGGATCACTAACAAAATATCGCTTGTCAGTTATATTGTATGGCAGGAAAGA
+TATGCGACTGATATTACAGATCCCCAAAGTGGAGAGTTTATGACCATTAAAAATAAGATG
+TTGCTGGGTGCGCTTTTGCTGGTTACCAGTGCCGCCTGGGCCGCACCAGCCACCGCGGGT
+TCGACCAATACCTCGGGAATTTCTAAGTATGAGTTAAGTAGTTTCATTGCTGACTTTAAG
+CATTTCAAACCAGGGGACACCGTACCAGAAATGTACCGTACCGATGAGTACAACATTAAG
+CAGTGGCAGTTGCGTAACCTGCCCGCGCCTGATGCCGGGACGCACTGGACCTATATGGGT
+GGCGCGTACGTGTTGATCAGCGACACCGACGGTAAAATCATTAAAGCCTACGACGGTGAG
+ATTTTTTATCATCGCTAAAAAAAGCCCCCTCATCATGAGGGGGAAATGCAGACACCTTGT
+TATTTTTTATTATTAGCCACTTGCTCGTCTTGCTTGTTATTAGTCGTATTTCACGTTGAT
+TAATGCGGTTGCCTCCAGTGCGCCAGATTTAACTTTGTTTGTATCGTAGACGTAGTAACT
+GGCTGTTATCGGAATTGAAACCGTTGTATCTGTAAGTTTTGACTTCGCCGCAACTTCCTT
+TAAATTTGTATATCCTTTACTGCTGTTAGTGATATTTAAAAGTGTGACTGGCGAACCATT
+ACTTTCAAGAATAAATCCTACGCCATTATCTTCCGCACCTTTCAGTATTGTGTTGCTGTT
+GGTTAACAAGTCAGAACTTGATAAATACACCTGCATTTTCCGTGATGTTTGATTTTGTTG
+ACCTAATAAATTTTTACAACGCAGAATAATATCCCCTTGTTTACTATTTATTGTTGCTTT
+GTTACCTGTGGCTGGTAATTGTGAAACGGGAATACTGTCTAAAGTAATTAATAAATCGTC
+CGGTTTGCAGGTTGTGGTTATCGGGTTGTATGACAATGTCAGATTAAAGGAATAGACACC
+TGCATTTTGTGCCAATGCATTTCTGTAGCTATTTACACATGCATCCCATGACTTGCCACC
+TAATAAACACAGTAGAAATTGTACTGCGGCACTCCCGCGTGTCGATGATGAAGCACTGGA
+TAATGTCGCAACACCATTAATCATCACTGAACCGCCGCCCCCCGCAGAAACATTCACTTT
+TGCATTACTGGCCGCAGGTGTCACCGCAACTGAATAACCACTGGTGAAACTGGTCTGATT
+ATTTGACAACGTGATGTTGTTTTTATTGGTCCATTCAAAATGTAAATTTAATTTTATGGT
+ATCGTTATAAAGTCCAACAATAATATCCGACGGGCTCATAGGGGTGATAGTATTTGTACT
+TACGCATGACGAATCATTAAAATTATGCTCATATGTCGCCATTTGTGTTTGAGTAAGTGC
+AAAATCCCCCTGAACAACCAAGTTGTGCTGAACAGATAACTCACTATAACATGCCGCATA
+GCTCACAGGCATAACCATCATCATTAATATAAATAGCATTATGCGAATTTCCATAGAACC
+ACCTGACTATTACTGGCAAATATAATTTCTACTTTCATCAATCTCTTTACCGAAGGTGAT
+TGTGCATGAAAGTCCTTGTTGCTTATCAATTGCCACATTAACCGATGGCGGTACTTCATT
+GGTGCGAATAAATAACTGACTTCCCTGGCCGACAACGCCAATATTATGACCATGGATATC
+ATTGACTTCATAACCAAACGTTAATGATTGCCCATCTGCTCTTAACGCTTTTATAAACCA
+TGGCTTGCGCTGATCGGTATCAAAATTAACCAGTACAACCGCGCCGCGATAAGGGGCGGC
+AATTTTCCGGTTGCCACGTAATTCTGCTTCGCTATCGCTTTGCGACACATCCAGCATCAG
+GTGATTTTCCCGATAAGGTGTCATTCCGTCGTATATCACCACTCCATTACGGTTTGTTGT
+GCGATATTTTTGCCCATTGACATAAGCATCTTTAATTCCTGGCGCATTCATCACAGCAAA
+CGTTTCGGAAAGACGGTTCGCCAGATTAACGCCACCCGACCAGGCGACAATGCCCCCTGA
+AACACTGGCTCCAGCCTGTCGATAAGTACTCGACTGACTATAACTGCCATTCACTGTCGC
+AACCGGCGCGTTCCAGGTCAAATTCGCCCCAGCTGTCGTTTCATTTCCCTGATGTTGATG
+ACTCAGGTTGACACCATAATTGAACTGATCCCGACTCCCTACTGTTCCTGATAATCCCGT
+ATTATTTGAGGCAAACCCCTGATCATCAAACGTCGTTGAGTTAGACATATATATTTGCCG
+ACGAGGCGTCGAAACGTCATCACCCCAATCAAAGGGAATCGATATAAAAATATTAAAACG
+TTTCTCTTCATGATGATTCTCGTCATAAGCCTGGCTTGCCGCGAGGGTATAGCTTATCCG
+TCGCAGGTTGTTGGAATAACTCAACTGATAATCCTTACTACTGCCGCTACGCCCCCAGTA
+ATCTCGCCATAACGTACTTAATGACACAGACCCCCAACCTTCTGGCAATGACTGGCTCAT
+ATTGGCGGAAAAGCTATTTTTGCGGCCAAAATCGTTCTGGTAATAATCGGCAATGTCATA
+GACATCGTTTTCATCACGGCGATAATTATCTTTATTGTTTGCCCAAACGTGATCGTTAAA
+TGTCCGGTAATCACGCGACGAATAACGCCAGGCCGCCAGACCAAAACGCGTCGACGTTTG
+GCTCACAAATTTGTTGTAGGCAATTTGATAACTTTGCCCGTCAAACACATCGCCGTTGTC
+TTGTTTACTATGCGACTTAGTGGCATCGACGGAAATGGCACCAATGCGTGTATTCCAGCC
+AGCCCCCAAAGTAAACGCGTAATAATTATTCGCGACCATCGAGCCACCATACAGCGTCAA
+TAAATTATTAAAACCATACTGATAACCCGCCTGGACAAAATCACTTTGTTTGCTCGCCCC
+TTCAATATGGCTACGACCCGCCGCTAAATCATATTTCGACACGCCGGGTTGCAGCATATT
+TGGCACCGCTGCATAAGGCACCAGATAGGTGGTTACCGAGCCGTCCGCCTCTTTCACGCT
+GACATCAAGATCTGCTCCACCACCGGCCAACTGCAAATCTGTAATCGCGAACGGGCCAGG
+AGGAACCTCTTTCTGATAAACCACAAAACCATTCTGTTCAATAGTTACCAGCGCGTTACT
+CTGAGCAATCCCCTGCACCCGTGGCGTAAAATTTTGTTTCGAGTTAGGCAACATCTGCAT
+ATCACGAAACAACCGCACACCTCTGAAGCGAACAGAATCAAAAATATCGCTTGATGTGTA
+CATATCACCCACGCGAAGCGTGCCGAGAAGTTGGGCAAATCCACGTTCCAGATACAGGGT
+ATTGCTTTTCCACACCCCTGGATTGTTATTTGTTTTACTGAAACTGGCATCAGAATGCAG
+TTGCCACCCCAGTAAATTTAACCCGCTGTTAAAACGTACATATGTACTCTTGTTATTACC
+CGACGCTTTATAGTCGCTGTAATACTGACTCAGATAATAAGAGGTATAAAACGCATTAAT
+ACCCCGCTCCCAGTTTTCCGGTGGAACATAGCCACTTTCCAGTTCTTCCACCCAGGCCTG
+CGGGACACTGAAATCGAGACGAAAAACCCCGATATCCCAGGTATAGCTCCCACCCTGAAC
+AAGTTGCTCAAATGTTAAACATTGCTTACCGCTGGCGAAGTTATCGCTATTAATGCCTAA
+CCGCTTGATAACTTCTCTTGATAAACATGTTTCTTGCGGGTTGTCTTTAACAATAATCTC
+ATATTTCCCGCGCCATTGCTTATTGACATAAATATCGATGTCATACTGCCCCGGTAAGGG
+TTGATTATCATCAAGACGAATATTTGCAACCTGCTGGTCTTTCATTCCACCTATCATAAA
+ATGGGTATCAAAGGTTTCTTCAGCTGCATAAGCTTCAATGCCGAGCAATAACGCTACGAT
+TGCTGATGCAAGTGGGGTCATTCTCAACATAGGCAGCTCCTGCAATTAAATTTTGTCACT
+AATATAGTTGCCATGGTCATCGATAATGGTCAGATGCCAGTTATTTGCATTATTACTTTT
+GACATTAACACTCTGACTTTCTAAGGGGGCAATCATAATAGTTTCATAATTGACTTTGAC
+ATTATTAGCTTTGACATCCGAAATCGTCACCCAATTAGCTGAGTCATTTTTTATCACCAA
+ACCATTGCCACTGCGATTTACCAGCAATTTTTTAAATGTCGCTTTATTTACCGGAGCAAT
+ACCCGCTGGCCGGTAAAACAACTTAATTCTGTTTTGCATCGCAAACTTCAGTGCATTCTT
+ACCTTCTTGCTCTGGACTATTTGGTGGAATATCCAGAACATTCAGATAAAAAATGCTTTC
+TTTATTAGTGGGCAGTTTATTCGGCATAATTTTGATTTTTACTTGCTGCCCGGAATTTGC
+CCCTATTTTTGCCACTGGTGGCGTTAACATGAAAGGAACCTGAATTTTTTCTGGTGGTAA
+TGACGTATCGCCATCATCAATCCACGCCTGCAGCAGCGAAGAACGGTTTCCCTGGTTCAT
+CAACTGCACCATCACTTCTTTATTTTCTGCCGGGTAAATAATGCGCGTCCCGTAGATAAC
+AATTCCGGCATGTGCAGGAAGGACCATAGAAAAAATGAGTAAAGATAATAATCCTTTCAT
+TTTAATGCCTCTTAAATTAAAAGGCCGCCATGGGATAGCGGCCATGTTTATTACCTGGAG
+AAACTTACAATTTTATTTATTAATCCTGCGCCACACGCATAACCAGAGAAGATAACACAT
+CACCTGATTGCACTGAGTTATCTGTCAGTTTCAGGTATTTTGCTTTAAACGGAATAGCAT
+ATTGACCTTCCGCTGTTTTATAACTCTCAATGTTAAAAGGTGCAGAAACATCCAGGACAT
+CGCTGTTATCACCTAAATAGAGATAGTAACCCACGGTATCGTTGCTACTGGCTATCGCCT
+TATCGTTACCGGTTATTTTATCGTTGGTAATCAACGAGAGTTTTACACCAGCAACTTCTT
+TCGGGCAGCTAATTTTTAACATGCTGCTGGTTACACCGACTGCATCATCATAGGTAGAAT
+ATTTAGCTTTACCTTCAAAGACACTGGTTGGTACAGTCGGCATATTAATACTTACTGAAT
+CACCACCCGCTTCGAATTTACACGGAGATTCTGCAATATTCCCCTTAATAGTTAATGTTC
+CGGTATCAACGTCTGCAGCAAATACTCCAGCGCTCATAAAAAAAGAAGAAAAGACAGCGG
+CAGCAATAATTGAACGTTTCATAATATGTTCCTTAATAAAATTTATTTTTGGTTGTTAAG
+AGTCTGTATCTCTTGGAAACAAATTTCTCACATCAAAAAAGTTGCCGCAATGTAAACACA
+TTGTTTTATTGATTTAAAACAAATTAACCATTGCAATATAAATACAAAAAATATTTAAGA
+GTATTAACTATTTATCGCATCTATCAATTAATGTAGATTTATGTAAATGGTATTGTTGAT
+ATCAATAAAAAAGCCGAAATCATTTATATAAATGATTTCGGCTTTCTAAATGCAATTAAA
+ATCAGGTTGCCAAATTAATCGTAGCGATTTAACACGATTCGACGTTTGCTATCGCTACCT
+GCAACAACCACTTCTGTCGTTACACCTTTGACGGGCGAAGAAAACAGATGACGGGTGTCA
+ACATTATACGTTAACTGACCACAATGCTGTTGAGGTTGACCATTAACCATAGCCATACTG
+CATGTTGGGGGACTGATCCTGCCATTAATCGCTAATGTGGCAGTCTCTGAAGAGAATGCG
+GGAGAAGCCAATCCATAGGCAAGAAAAATAATTCCTGACAGCCAATACTTATTCATTGAA
+CGTTATCCCTGTAGTAAAGGTTATGCCTGGATAGAATGAGTGCATAACAAACTATAGCTG
+TACATCCACTACACAGCCACGAAGGATGATAATGAAGCATTGCCTGTATGATCAATCGAC
+TTTGTAGAGTTTCGGACGAAGGTCCGCAGAATATTCGCAGTATTAAATAAGTGTTCATTA
+ATGCGGCAAAAACTAATACACCGCATCAATGTAACATCTCTGCGGTGTATGAAGAATAAC
+CAGAATGGTTAATAGGCGTTAGACCGCGCGGAAGGAAATCTCGCCTGGAATGACTTCACC
+CTGCCAGTAGAGCTGAGCTGCAACGCGGTCAGCCAGCTGGCGGTAGATAGCGGTAAATTC
+GCTCTCCGGACGGCTGATAACCGTTGGCGTACCTTTATCGAGATCCTCACGTAAGGAGAT
+GTGTAACGGCATCTGCCCCAGCAGCTGTGTATGGTATTTTTCAGCCAGTTTCTCTGCACC
+ACCGGTACCGAAAATCGGTTCATGGTGACCACAGTTACTGCAAATATGCACACTCATGTT
+CTCGACAATACCGAGCACCGGAACCTCGACTTTCTCGAACATCACAATGCCTTTTTTCGC
+ATCGATCAGCGCGATGTCCTGCGGGGTGGTGACCACGACTGCACCGGTTACTGGAATGTT
+TTGCGCCAGCGTCAATTGAATGTCACCGGTGCCTGGCGGCATATCAAGCACCAGATAGTC
+GAGATCCGGCCACAAGGTTTCCTGCAACATCTGCATTAACGCCTTGCTCGCCATCGGTCC
+ACGCCACACCATCGCATTGTCGTCAGTGACCAGATAACCAATTGAATTGGTTGCCAGGCC
+ATGAGACATAATCGGTGCCATATGGGTACCGTCCGGCGAAGTTGGACGCTGATTTTCTGC
+GCCCAACATTGTTGGGATTGATGGGCCGTAGATATCGGCGTCCAGAATGCCGACTTTCGC
+CCCTTCTGCCGCCAGCGCCAGTGCCAGGTTTACCGCCGTGGACGATTTACCCACGCCGCC
+TTTACCGGAACTCACCGCGATAATGTTCTTCACACCGTTAATTCCCGGCTGATTCTTCAC
+GCGTTTCAGAGTGGCTATGTTATGCGACAGTTTCCAGTCGATAGCTTTCGCCCCGGTGAT
+GCGCAGCAGTTCGGCGCTACATTGCTCTTTTAACTCTTCGAACGCGCTATGCCAGACAAA
+CGGCATAACCAGTTCCACATGCAACGTGTCGTCCATCCAGGCGACATGGTGCAACGCTTT
+CAGCGTGGTGAGGTTATGCTTCAGGGTTGGGTGCTGAAAATTGGCCAGTGTCCCGGCGAC
+CATTGCGCGCAAGGCTTCTGGTGATTTGGCCTGGGATTGTTCGTTCATCCCGACTCCTTT
+TTTGTATAGATAAACCATCAGCTGATAGTTTACCTGAAGAATATAGAGAAGTACTTACTT
+AACATTTTCCCATTTGGTACTATCTAACCCCTTTTCACTATTAAGAAGTAATGCCTACTA
+TGACTCAAGTCGCGAAGAAAATTCTGGTGACGTGCGCACTGCCGTACGCTAACGGCTCAA
+TCCACCTCGGCCATATGCTGGAGCACATCCAGGCTGATGTCTGGGTCCGTTACCAGCGAA
+TGCGCGGCCACGAGGTCAACTTCATCTGCGCCGACGATGCCCACGGTACACCGATCATGC
+TGAAAGCTCAGCAGCTTGGTATCACCCCGGAGCAGATGATTGGCGAAATGAGTCAGGAGC
+ATCAGACTGATTTCGCAGGCTTTAACATCAGCTATGACAACTATCACTCGACGCACAGCG
+AAGAGAACCGCCAGTTGTCAGAACTTATCTACTCTCGCCTGAAAGAAAACGGTTTTATTA
+AAAACCGCACCATCTCTCAGCTGTACGATCCGGAAAAAGGCATGTTCCTGCCGGACCGTT
+TTGTGAAAGGCACCTGCCCGAAATGTAAATCCCCGGATCAATACGGCGATAACTGCGAAG
+TCTGCGGCGCGACCTACAGCCCGACTGAACTGATCGAGCCGAAATCGGTGGTTTCTGGCG
+CTACGCCGGTAATGCGTGATTCTGAACACTTCTTCTTTGATCTGCCCTCTTTCAGCGAAA
+TGTTGCAGGCATGGACCCGCAGCGGTGCGTTGCAGGAGCAGGTGGCAAATAAAATGCAGG
+AGTGGTTTGAATCTGGCCTGCAACAGTGGGATATCTCCCGCGACGCCCCTTACTTCGGTT
+TTGAAATTCCGAACGCGCCGGGCAAATATTTCTACGTCTGGCTGGACGCACCGATTGGCT
+ACATGGGTTCTTTCAAGAATCTGTGCGACAAGCGCGGCGACAGCGTAAGCTTCGATGAAT
+ACTGGAAGAAAGACTCCACCGCCGAGCTGTACCACTTCATCGGTAAAGATATTGTTTACT
+TCCACAGCCTGTTCTGGCCTGCCATGCTGGAAGGCAGCAACTTCCGCAAGCCGTCCAACC
+TGTTTGTTCATGGCTATGTGACGGTGAACGGCGCAAAGATGTCCAAGTCTCGCGGCACCT
+TTATTAAAGCCAGCACCTGGCTGAATCATTTTGACGCAGACAGCCTGCGTTACTACTACA
+CTGCGAAACTCTCTTCGCGCATTGATGATATCGATCTCAACCTGGAAGATTTCGTTCAGC
+GTGTGAATGCCGATATCGTTAACAAAGTGGTTAACCTGGCCTCCCGTAATGCGGGCTTTA
+TCAACAAGCGTTTTGACGGCGTGCTGGCAAGCGAACTGGCTGACCCGCAGTTGTACAAAA
+CCTTCACTGATGCCGCTGAAGTGATTGGTGAAGCGTGGGAAAGCCGTGAATTTGGTAAAG
+CCGTGCGCGAAATCATGGCGCTGGCTGATCTGGCTAACCGCTATGTCGATGAACAGGCTC
+CGTGGGTGGTGGCGAAACAGGAAGGCCGCGATGCCGACCTGCAGGCAATTTGCTCAATGG
+GCATCAACCTGTTCCGCGTGCTGATGACTTACCTGAAGCCGGTACTGCCGAAACTGACCG
+AGCGTGCAGAAGCATTCCTCAATACGGAACTGACCTGGGATGGTATCCAGCAACCGCTGC
+TGGGCCACAAAGTGAATCCGTTCAAGGCGCTGTATAACCGCATCGATATGAGGCAGGTTG
+AAGCACTGGTGGAAGCCTCTAAAGAAGAAGTAAAAGCCGCTGCCGCGCCGGTAACTGGCC
+CGCTGGCAGATGATCCGATTCAGGAAACCATCACCTTTGACGACTTCGCTAAAGTTGACC
+TGCGCGTGGCGCTGATTGAAAACGCAGAGTTTGTTGAAGGTTCTGACAAACTGCTGCGCC
+TGACGCTGGATCTCGGCGGTGAAAAACGCAATGTCTTCTCCGGTATTCGTTCTGCTTACC
+CGGATCCGCAGGCACTGATTGGTCGTCACACCATTATGGTGGCTAACCTGGCACCACGTA
+AAATGCGCTTCGGTATCTCTGAAGGCATGGTGATGGCTGCCGGTCCTGGCGGGAAAGATA
+TTTTCCTGCTAAGCCCGGATGCCGGTGCTAAACCGGGTCATCAGGTGAAATAATCCCCCT
+TCAAGGCGCTGCATCGACAGCGCCTTTTCTTTATAAATTCCTAAAGTTGTTTTCTTGCGA
+TTTTGTCTCTCTCTAACCCGCATAAATACTGGTAGCATCTGCATTCAACTGGATAAAATT
+ACAGGGATGCAGAATGAGACACTTTATCTATCAGGACGAAAAATCACATAAATTCAGGGC
+AGTTGAGCAACAGGGAAACGAGTTGCATATCAGTTGGGGAAAAGTTGGCACCAAAGGGCA
+AAGCCAGATAAAAAGTTTTTCAGATGCTGCGGCAGCGGCAAAAGCGGAGCTTAAGCTGAT
+TGCGGAGAAGGTGAAGAAGGGGTATGTGGAGCAAGCGAAGGATAATTCTTTGCAACCTTC
+CCAAACGGTAACGGGCTCTCTCAAGGTAGCGGACTTATCCACCATTATTCAGGAACAACC
+CTCTTTCGTAGCAGAAACCCGTGCGCCTGACAAAAATACAGATGCTGTTTTACCGTGGCT
+GGCGAAAGATATTGCTGTCGTTTTTCCGCCCGAAGTTGTACACACCACGTTAAGTCATCG
+CCGCTTTCCCGGAGTTCCTGTTCAGCAAGCAGACAAATTGCCCCAATTACGTCGCTTAGC
+CTGTAGTGTGTCGCAACGGGATAATAAAACAGCCACATTTGACTTCAGCGCCTGTTCTTT
+AGAATGGCAAAACACCGTCGCCCAGGCGATCAGTCAGATCGACGGCCTGAAAACAACACA
+GTTACCATCACCAGTAATGGCTGTACTCACGGCACTTGAAATGAAATGCACAAGATATAA
+AGTGCGTGAGGATGTTATGGATCAGATCGTCCAGGAAGGCGGTCTGGAATATGCTACTGA
+TGTAATAATACACCTTCAACAGATTGATATTGAATGGGATTATGCGAATAATGTCATTAT
+TATTCTGCCGTCTGGCATTGCACCTAGCTACTTGGAGCAATATTCCAGATTTGAATGACG
+CCTACGTAAACATTTATCACTGACGGAAGAGTCTCTCTGGCAAAAATGTGCACAAAAACT
+TATTGCCGCAATTCCACATATTCCAGAATGGCGGCAACCATTAATTGCTTTGTTATTACC
+CGAAAAACCAGAAATTGCACATGAAATTGCCCAGCGTCTACTGGGGCAAAAAAAATTACC
+CTCGCTTGAGTGGTTAAAAATAGTGGCGACTGATGAGCACATTCTTGCCTCATTAGAAAA
+ATATCACGAACCATATGCCATTTTTGATGATTACTATTGTGGTGCGATATGGTCAGCCAC
+CGTATTACAGGAGCAAGGTGTTGCAGCCCTGCCCCGATTTGCTCCCTATGCCGCAAGTGA
+CTACTGCGCCGATGTGTTGCGTCATATCAATCATCCGTTCGCATTGACACTGCTTATACG
+TGTAGCCGGGCAAACTAAACGCTGTCACGATCGGATGACGAAAGCCATTGCTGCGTTCCC
+ACATGCAGCAATGGCGGCACTGACGGAACTTCTTGGGCAAAAAGAAGAGAACAGTTGGCG
+CATTATGCTAATGACAATGCTTATCTCACAACCAGCACTGGCAGAACAGGTCATTCCCTG
+GCTCTCGACACCCGCAGTTGCCGTACTGAAATCATGCCAGCAACAACTGACACAGCCCTC
+AAACCATGCCAGCGCCGATCTACTGCCAGCCGTAGTAGTCTCCCCTCCCTGGCTTTCGAA
+AAAGAAAAAATCGCCGATTCCGGTGCTGGATTTAGCGCCATTAGGCATTGAGCCAATCTG
+TTATCTGACAGAAGAAATCAGTAATCAACTTTTGGCGAAATATATCTGGTATTCAAAACA
+CATCACGGTTAGCCATGAAGAAAGTACTACCAACCTGTTGGCAAGGATGGGTTTTCAACG
+ACGGATCGCTGGTACATATATTAAAGCTCCCGAAGCGGTAGTTGAGGCATGGCTAAATGA
+AGATTATTCAACCTTACTAAGTGAATTTAAGGTGTTTCATTCACCTACCGGGCATTATTG
+GCAGTTGGGGATTTTGACAACATTGCCGCTGGAGAAAGCAGTAAAAGCATGGAATGCCCT
+TACCCTATCTCCACATACCGATACCGAATACTCCATGTTACATTTTGGACTCAAAGGGTT
+ACCTGGGTTAGTAAACTCACTTGCACGCTATCCACAAGAAGCCTTGCCCATCACGAATTA
+CTTCGCAGCGAGTGAGCTGGCTCCTGCCGTCGCCCGTGCCTTCAACAAACTGAAAACGCT
+ACGCGAAAACGCCCGTAGCTGGCTGTTGAAATACCCGGAACATGCCCTTACCGGCCTGCT
+GCCTGCGGCGCTCGGCAAAGCCGGTGAAGCACAGGATAACGCCCGCGCTGCCTTGCGTAT
+GCTTACCGAAAACGGTCATCAGCCATTACTGCAAGAAATCGCCCGACGTTATAACCAGCC
+GGAAGTAACCGATGCGGTGAACGCTCTGCTTGCGCTCGATCCCTTAGATAATCACCCGAC
+AAAAATCCCCACTCTTCCGGCCTTTTATCAGCCATCGCTCTGGACGCGCCCGGTATTAAA
+AGCAAATGCCCAATCACTGCCAGATAGCGCCCTCCTCCACCTCGGTGAAATGCTCCGCTT
+CCCTCAGGAAGAGGCTCTGTATCCGGGATTATTGCAGGTGAAAGACGTCTGTTCCGCCGA
+CTCACTGGCGGGATTTGCCTGGGATCTGTTTACCGCCTGGCAGACCGCTGGCGCGCCGTC
+GAAAGAGAGTTGGGCGTTCACTGCGTTAGGCGTTCTCGGTAACGATGACACCGCCCGCAA
+ACTGACGCCATTAATACGCGCCTGGCCTGGTGAATCCCAGCATAAACGCGCCACCGTTGG
+GTTGGATATTCTCGCTGCTATCGGTAGTGATATCGCCCTTATGCAGCTTAACGGCATCGC
+CCAGAAACTGAAATTCAAAGCATTACAGGAGCGGGCAAAAGAAAAAATTGCCGACATTGC
+CGAGAGCCGCGAACTCACGGTGGCGGAGCTTGAAGATCGGGTTAGCACCGGATCTCGGTC
+TGGATGATAACGGTTCGCTGCTGCTGGATTTTGGCCCACGGCAGTTCACCGTCAGCTTTG
+ATGAAACCTTAAAACCGTTTGTGCGTGATGTTTCCGGCAGCCGCCTGAAAGACCTGCCCA
+AACCGAACAAAAGCGATGATGAAACGCGGGCGAACGATGCGGTTAACCGCTACAAATTGC
+TGAAAAAAGATGCGCGTACCATCGCCGCCCAGCAGGTAGCAAGGCTGGAATCCGCCATGT
+GCCTGCGCCGCCGCTGGTCGCTGGAAAACTTCCAGCTCTTCCTGGTTGAGCATCCGCTGG
+TTCGTCACTTAACCCGCCGTCTGATTTGGGGCGTTTATAGCGCCGAAAACCAGCTACTGG
+CTTGCTTTCGCGTAGCAGAAGATAACAGCTCCAGCACCGCTGACGATGATCTTTTCACCC
+TGCCGGAAGGCGATATCTCTATCGGCACTCCTCACGTTCTGGAAATATCACCAACGGATG
+CTGCCGCCTTTGGTCAGCTTTTTGCCGACTACGAACTGCTACCACCGTTCCGCCAGCTCG
+ACCGTAACAGCTACGCCCTGACAGAAGCCGAGCGCAATGCCAGTGAACTGACCCGCTGGG
+CAGGCAGAAAATGCCCGAGTGGTCGGGTCATGGGGCTGGCGAATAAAGGCTGGATAAAGG
+GCGAACCACAGGATGGAGGCTGGATCGGATGGATGATCAAACCTTTGGGTCGCTGGTCGT
+TAATCATGGAAATCGATGAAGGCTTTGCGGTAGGCATGTCGCCAGCCGAACTCAGCGCTG
+AGCAGCTCTTAAGCAAGCTGTGGCTATGGGAAGGCAAAGCAGAAAGATATGGCTGGGGGA
+GTAATTCAACACAGGAAGCGCAGTTCTCCGTAATCGATGCCATCACCGCCAGCGAGCTAA
+TTAACGATATTGAAGCCCTGTTTGAATAAGGAAAGAGCATGGACAAGGAATTACCGTGGC
+TGGCGGATAACGCCCAACTGGAACTGAAATATAAAAAAGGCAAAACGCCGCTCAGTCATC
+GTCGCTGGCCGGGCGAACCAGTGTCCGTTATCACTGGAAGTCTCATCCAGACATTGGGTG
+ATGAATTGCTACAAAAAGCTGAGAAGAAAAAAAACATTGTCTGGCGTTATGAGAATTTTT
+CACTGGAGTGGCAGTCCGCCATCACGCAGGCCATCAACTTGATCGGCGAACACAAACCCT
+CAATCCCGGCCCGGACAATGGCGGCGCTAGCCTGTATCGCGCAAAATGACAGCCAACAGT
+TGCTCGACGAAATCGTCCAACAAGAGGGGCTGGAATATGCGACTGAGGTGGTGATTGCAC
+GCCAGTTTATTGCGCGGTGTTATGAGAGTGATCCTCTGGTAGTGACATTGCAGTATCAGG
+ACGAGGATTATGGCTATGGTTATCGCTCAGAAACCTATAACGAATTCGATCTCCGACTGC
+GTAAGCATCTCTCTCTGGCAGAGGAAAGCTGCTGGCAGCGTTGCGCCGACAAACTCATTG
+CCGCACTACCAGGAATAAACAAAGTTCGCCGCCCTTTTATTGCGCTGATCCTCCCGGAAA
+AACCAGAAATAGCCAATGAGTTGGTAGGCCTTGAATGCCCGCGAACTCATTTTCATTCTA
+AGGAGTGGTTAAAAGTTGTTGCTAATGACCCCACAGCGGTGAGAAAACTCGAACACTACT
+GGAGCCAGGATATATTTAGCGATCGAGAAGCCAGCTACATGTCGCATGAAAACCACTTCG
+GCTACGCGGCCTGCGCCGCCCTTTTGCGCGAACAAGGACTGGCAGCCATTCCGCGCCTCG
+CGATGTATGCCCATAAAGAAGATTGCGGCAGTCTGCTGGTACAAATTAACCATCCGCAAG
+TCATCCGCACCTTGCTACTGGTGGCTGATAAAAACAAACCCAGCCTGCAACGTGTAGCTA
+AATACCATAAAAACTTCCCCCATGCGACGCTCGCCGCACTGGCAGAACTGCTGGCGTTAA
+CAGAACCACCAGCCCGCCCTGGTTATCCAATCATCGAAGACAAAAAGCTGCCTGCACAGC
+AAAAAGCACGCGATGAATACTGGCGTACGCTGTTACAAACGCTGATGGCATCGCAGCCAC
+AACTGGCAGCAGAAGTGATGCCGTGGTTAAGTACTCAACCCCAGTCAGTGCTGAAGAGTT
+ATTTATCGGCACCGCCCAAACCGGTTATTGATGGCACCGATAACAGCAATCTGCCAGAAA
+TCCTCGTTTCACCACCGTGGCGTAGTAAGAAAAAAATGACAGCTCCACGTCTTGATTTGG
+CACCGCTCGAATTAACTCCGCAAGTTTACTGGCAACCAGGCGAACAAGAGAGGCTTGCCG
+CCACTGAGCCTGCCCGTTATTTCAGCACGGAATCTCTTGCGCAACGCATGGAACAAAAAA
+GTGGACGAGTTGTATTACAGGAACTGGGTTTTGGGGATGATGTATGGCTGTTTCTGAATT
+ATATACTCCCCGGAAAACTGGATGCTGCACGCAATTCACTCTTTGTTCAGTGGCATTACT
+ACCAGGGGCGGGTTGAAGAGATCCTGAATGGCTGGAACTCCCCGGAAGCACAATTAGCAG
+AACAGGCGCTCCGCAGCGGTCACATAGAAGCGTTAATTAACATATGGGAAAATGACAACT
+ACTCACATTATCGTCCGGAAAAGAGTGTCTGGAACCTGTATTTATTGGCACAGTTGCCGC
+GTGAGATGGCTTTGACCTTCTGGCTGCGTATCAATGAGAAAAAGCATCTGTTCGCGGGTG
+AGGACTATTTTCTCAGTATCCTCGGATTGGATGCGCTACCAGGTCTGCTGTTGGCTTTTT
+CACATCGTCCAAAAGAAACATTTCCGTTAATTTTAAATTTTGGCGCAACAGAACTGGCGC
+TGCCTGTTGCCCACGTCTGGCGACGTTTCGCGGCGCAGCGTGATCTGGCTCGCCAGTGGA
+TTTTACAATGGCCGGAACATACGGCTAGTGCACTTATCCCTCTTGTCTTTACCAAACCCA
+GCGATAATAGCGAAGCCGCATTACTTGCCCTGCGTTTACTGTACGAACAGGGACATGGCG
+AATTGCTACAAACCGTGGCAAACCGCTGGCAGCGTACAGATGTATGGTCTGCCCTGGAGC
+AGTTGCTTAAACAGGGTCCAATGGACATTTACCCGGCACGCATTCCAAAAGCCCCTGATT
+TCTGGCATCCGCAAATGTGGTCCAGGCCGCGCCTTATCACTAATAATCAAACTGTTACCA
+ATGACGCTCTGGAAATTATCGGCGAAATGCTGCGCTTTACCCAGGGGGGACGTTTTTATA
+GCGGGCTGGAACAACTGAAAACGTTCTGCCAGCCACAAACGCTGGCAGCTTTTGCCTGGG
+ATCTCTTCACTGCGTGGCAACAAGCTGGTGCCCCCGCAAAAGACAACTGGGCATTTCTGG
+CGTTAAGTCTCTTTGGTGACGAAAGCACGGCACGGGATCTGACGACACAGATCCTCGCCT
+GGCCACAAGAAGGCAAATCTGCCCGTGCTGTCAGCGGCCTGAACATCCTTACCCTGATGA
+ATAATGATATGGCGCTGATACAGCTGCATCATATATCGCAACGGGCTAAATCCCGCCCCT
+TACGTGATAACGCGGCGGAATTTCTTCAGGTGGTCGCAGAAAATCGCGGGCTAAGCCAGG
+AAGAGCTAGCGGACAGATTAGTCCCAACCCTGGGCCTTGATGATCCGCAGGCGTTGAGTT
+TTGATTTTGGTCCCCGGCAGTTTACCGTTCGCTTCGATGAAAATCTCAACCCGGTTATCT
+TTGATCAGCAAAACGTTCGCCAGAAAAGCGTTCCCCGTTTGCGCGCCGATGACGATCAAC
+TGAAAGCGCCCGAGGCACTGGCCCGACTAAAAGGGCTAAAAAAAGATGCTACTCAGGTGA
+GCAAAAACCTGCTCCCGCGTCTTGAAACGGCCCTACGTACCACCCGACGCTGGTCGCTGG
+CAGATTTTCATTCTCTGTTTGTTAATCATCCCTTTACCCGTCTGGTTACCCAGCGATTAA
+TATGGGGGGTTTATCCGGCAAATGAACCGCGTTGTTTACTCAAAGCCTTTCGTGTGGCCG
+CAGAGGGGGAGTTCTGCAATGCGCAAGATGAGCCAATTGACCTGCCTGCGGACGCTCTGA
+TTGGCATTGCCCACCCGTTAGAAATGACAGCAGAAATGCGCAGTGAATTTGCACAGCTTT
+TTGCCGATTACGAAATTATGCCGCCTTTTCGCCAGTTGTCGCGCCGCACGGTGCTGCTCA
+CACCTGACGAGTCAACCAGTAACAGCCTGACTCGCTGGGAAGGTAAATCCGCTACCGTTG
+GGCAACTTATGGGAATGCGATACAAAGGCTGGGAGTCAGGCTATGAGGACGCATTTGTCT
+ATAACCTGGGTGAGTACCGGCTGGTCCTTAAGTTTTCACCCGGTTTTAACCACTACAATG
+TTGATAGCAAAGCGCTAATGAGCTTCCGTTCTCTTCGAGTGTACCGTGACAATAAATCCG
+TCACTTTTGCCGAACTTGATGTGTTTGATTTGAGTGAGGCGTTAAGCGCACCTGACGTCA
+TTTTCCATTAAAACACAGCGGGCAGTGATGCAACTGCCCGTTATCAACACGACTTACCAG
+CGGGGAAAGCGATGATCGTGCAAAAAGAGCTGGTTGCTATTTACGATTATGAGGTCCCTG
+TACCTGAAGATCCGTTTTCCTTCAGACTTGAGATCCATAAATGCTCTGAATTATTTACAG
+GTTCCGTCTATCGACTGGAGCGATTCCGGCTACGTCCAACATTTCATCAACGTGATCGAG
+AAGATGCTGACCCGCTAATAAATGATGCGTTGATTTATATAAGAGATGAGTGTATTGATG
+AGCGGAAATTACGAGGTGAATCACCTGAAACTGTAATAGCAATTTTTAATCGTGAACTAC
+AGAATATATTCAACCAAGAAATAGAATAATATACTCTAAATAATTCAAATTGGTCCGATC
+CGGCGCAACGTCCCAATGGCCTGGATTATAAATCTCATTATCTTAATTGCAACGGGGTCC
+AGCCGTGGTTATAATTCGTTCGTTGGAACACGATGTTGCACAGGCTGTGGTGTTAGGCCT
+GAAAATAGTAAATAAAAGAACCTGCCTCACCAGCAGGTTTTTTTATTTACTGTGATCTGC
+TTTCCAGATATTTTTCGCTCAAACAACTAATGCGCCAAACATTTATTGCGCGTAAAATAT
+CGTTTATTTCATTAATACATTTCAGGGATGAATATATGTCACCGCAGAATAATCATCTGC
+AGCGTCCGCCTGCTGCTGTGTTATACGCCGATGAACTGGCAAAATTAAAACAAAATGATA
+ACGCACCTTGCCCGCCCGGTTGGCAGTTAAGTTTGCCTGCGGCCCGTGCTTTTATCCTTG
+GCGACGAAGCGCAAAATATCAGCCGTAAAGTGGTGATTAGCCCCTCCGCTGTCGAACGTA
+TGTTAGTCACTCTTGCTACCGGCCGCGGTTTGATGTTGGTGGGGGAACCGGGTACCGCAA
+AATCTCTTCTTTCTGAATTACTGGCAACCGCTATTAGCGGCGATGCCGGGTTAACCATCC
+AGGGCGGGGCATCTACCACCGAAGATCAAATCAAGTATGGCTGGAACTACGCCCTGCTTA
+TCAATCATGGTCCGTCAACGGAAGCGCTGGTCCCTGCCCCGCTTTATCAGGGAATGCGCG
+ACGGCAAAATCGTCCGTTTCGAAGAGATAACGCGTACACCGCTGGAAGTGCAGGACTGTC
+TGTTAGGTATGCTTTCTGACAGGGTGATGACGGGGCCGGAACTCACTGGTGAAGCCAGTC
+AGCTCTATGCGCGAGAAGGCTTTAATATTATTGCCACTGCCAATACCCGCGATCGCGGCG
+TCAATGAAATGAGTGCTGCGCTAAAGCGTCGCTTCGATTTTGAAACGGTTTTTCCGATTA
+TGGATTTCGCCCAGGAGTTGGAACTGGTCGCCAGTGCTTCGGCGCGTTTGCTGGCCCATA
+GCGGTATTCCGCATAAAGTGCCTGACGCGGTACTGGAATTACTGGTCCGCACCTTCCGCG
+ATCTGCGTGCCAACGGCGAAAAGAAAACGTCAATGGATACACTGACAGCGATTATGTCCA
+CCGCTGAAGCCGTGAACGTGGCCCATGCTGTGGGCGTCCGCGCCTGGTTTTTAGCGAATC
+GCGCGGGGGAGCCTGCCGACCTGGTGGAATGTATTGCCGGAACCATCGTCAAAGATAACG
+AAGAAGATCGCGCGCGTCTGCGCCGTTACTTCGAACAGCGTGTCGCCACACATAAAGAAG
+CTCACTGGCAGGCTTATTATCAAGCCCGCCACCGCCTGCCGTGAGGAAAGATGCATGAGC
+GAGCCGTTAATTGTCGGCATCCGGCATCATAGTCCGGCCTGCGCCCGGCTGGTGAAATCG
+TTAATCGAAAGCCAGCGGCCACGATACGTGTTGATTGAAGGCCCGGCTGATTTTAATGAC
+CGGGTAGACGAACTGTTTTTAGCCCACCAGCTTCCGGTAGCTATTTACAGTTATTGCCAG
+TATCAGGACGGTGCAGCCCCCGGGCGTGGTGCCTGGACGCCATTTGCTGAATTTTCGCCG
+GAGTGGCAGGCGCTACAAGCCGCACGTCGCATTCAGGCACAAACTTACTTCATCGATTTG
+CCTTGCTGGGCGCAGAGTGAAGAAGAGGACGATTCGCCTGATACGCAAGATGAAAGCCAG
+GCCTTACTGCTGCGTGCCACCCGCATGGATAACAGCGATACCCTGTGGGATCACTTGTTC
+GAAGATGAAAGCCAGCAAACTGCATTACCCTCTGCGCTGGCGCACTATTTTGCCCAACTG
+CGGGGCGACGCCTCCGGCGATGCGCTCAATCGTCAGCGCGAAGCCTTTATGGCCCGCTGG
+ATTGGATGGGCGATGCAGCAAAATAATGGCGACGTGTTAGTTGTCTGCGGTGGCTGGCAC
+GCTCCGGCACTGGCAAAGATGTGGCGCGAATGCCCTCAGAAAATTAACAAGCCAGAATTG
+CCCTCGCTGGCAGATGCCGTTACAGGTTGTTATCTCACACCCTACAGTGAAAAGCGCCTT
+GATGTGCTGGCAGGATACCTTTCAGGAATGCCTGCCCCGGTATGGCAAAACTGGTGCTGG
+CAGTGGGGCTTGCAGAAGGCCGGTGAACAACTGCTAAAAACTATCCTTACCCGTTTGCGC
+CAGCACAAATTGCCCGCTTCTACCGCGGATATGGCTGCCGCTCATCTGCATGCGATGGCG
+CTGGCACAGTTGCGCGGTCATACACTACCGTTACGCACTGACTGGCTGGATGCCATAGCA
+GGCTCGCTGATTAAAGAAGCCCTGAACGCGCCGTTGCCGTGGAGCTATCGCGGCGTTATT
+CATCCCGATACCGATCCGATTCTGCTAACGTTGATAGACACATTAGCGGGTGACGGATTC
+GGTAAACTTGCCCCTTCTACGCCACAACCGCCTCTGCCAAAAGATGTCACCTGCGAACTG
+GAACGTACCGCAATCTCCCTTCCGGCGGAGCTTACCTTAAATCGCTTTACCCCCGATGGG
+CTGGCGCAAAGTCAGGTGTTACATCGGCTGGCAATACTGGAGATCCCTGGGATTGTACGC
+CAGCAGGGAAGTACACTGACACTTGCAGGCAACGGTGAAGAACGCTGGAAATTAACCCGC
+CCGCTTAGCCAGCATGCGGCATTGATTGAGGCCGCCTGTTTTGGTGCCACACTCCAGGAA
+GCCGCACGCAATAAATTAGAAGCCGATATGCTGGACGCGGGCGGAATCGGCAGTATCACC
+ACATGTCTTAGCCAGGCGGCGTTAGCGGGTCTGGCGTCCTTCAGTCAACAATTACTGGAG
+CAACTCACACTATTAATCGCCCAGGAAAATCAATTTGCCGAAATGGGCCAGGCGCTGGAA
+GTGCTTTATGCCTTATGGCGGCTGGATGAAATTAGCGGTATGCAAGGCGCGCAGATATTA
+CAAACGACGTTATGCGCGACTATCGATCGCACGCTGTGGCTGTGTGAATCTAACGGCAGA
+CCGGATGAAAAGGAGTTTCACGCTCACCTGCATAGCTGGCAAGCGCTTTGCCATATTCTG
+CGCGATCTACATAGCGGCGTTAATTTACCCGGCGTTTCTCTTTCTGCGGCGGTAGCCTTA
+CTGGAGCGACGCAGTCAGGCAATTCATGCCCCGGCGCTGGATCGCGGCGCGGCTCTTGGC
+GCACTAATGCGTCTGGAACATCCCAACGCCAGTGCCGAAGCGGCGCTGACGATGCTGGCG
+CAGTTATCCCCGGCACAATCTGGTGAGGCGCTGCACGGTTTGCTGGCGCTGGCCCGCCAT
+CAACTGGCCTGTCAGCCGGCATTTATCGCCGGTTTCAGCAGTCATTTAAATCAACTGAGT
+GAAGCCGATTTTATTAACGCCCTGCCCGATTTACGCGCGGCGATGGCCTGGCTACCACCA
+CGAGAACGCGGGACGCTGGCGCATCAGGTGCTTGAGCATTATCAACTGGCGCAACTTCCC
+GTTTCGGCGCTGCAAATGCCGTTGCATTGTCCACCACAGGCCATTGCACATCATCAACAA
+CTCGAACAGCAGGCACTGGCATCGCTGCAAAACTGGGGAGTTTTCCATGTCTGAACTGAA
+CGATCTTCTGACCACCCGTGAGCTACAACGCTGGCGATTAATTCTTGGCGAAGCGGCAGA
+AACGACGCTTTGTGGGCTGGATGACAACGCCCGGCAGATAGACCACGCGCTGGAGTGGCT
+GTATGGGCGCGATCCTGAACGGCTCCAGCGTGGTGAACGTTCCGGTGGATTAGGTGGCTC
+AAATCTCACCACCCCTGAGTGGATCAACAGTATTCACACGCTGTTTCCGCAGCAGGTGAT
+TGAGCGGCTGGAAAGCGATGCCGTGCTGCGCTACGGCATTGAAGATGTGGTGACGAATCT
+CGACGTGCTGGAACGTATGCAGCCTTCTGAAAGCCTGCTACGCGCTGTTTTGCACACCAA
+ACATCTGATGAACCCCGAAGTACTGGCTGCCGCCCGCCGGATAGTGTGCCAGGTTGTTGA
+AGAAATTATGGCTCGACTGGCAAAGGAAGTTCGTCAGGCTTTTTCTGGTGTCCGCGATCG
+CCGTCGCCGTTCATTTATTCCACTGGCGCGAAACTTTGATTTCAAAAGTACTCTGCGCGC
+CAACCTGCAACACTGGCACCCGCAACACGGCAAGTTGTATATCGAATCCCCCCGCTTTAA
+CAGCCGCATTAAACGCCAAAGCGAACAATGGCAACTGGTCTTACTGGTTGATCAAAGCGG
+ATCGATGGTCGATTCGGTGATCCACTCTGCGGTGATGGCGGCCTGTTTGTGGCAGTTACC
+CGGCATTCGTACCCATCTGGTGGCGTTTGACACAAGCGTCGTTGATCTCACGGCAGACGT
+TGCCGATCCGGTAGAGTTATTAATGAAAGTACAGTTGGGCGGCGGGACCAATATCGCCAG
+TGCCGTGGAGTATGGTCGGCAACTTATTGAACAACCAGCGAAAAGCGTCATTATCCTCGT
+GAGCGATTTTTACGAAGGGGGTTCATCATCATTACTGACGCATCAGGTGAAAAAGTGTGT
+CCAGAGCGGCATCAAAGTGCTGGGACTGGCAGCGCTCGATAGCACCGCAACACCTTGCTA
+TGACCGCGATACGGCCCAGGCGCTGGTTAATGTCGGCGCACAAATAGCCGCCATGACGCC
+GGGCGAGCTGGCATCATGGCTTGCGGAGAATCTTCAGTCATGAATTCACTACGTCCGGAA
+TTATTAGAACTGACACCGCAGGCCCTGACGGCGTTAAGCAATGCCGGTTTTGTTAAGCGC
+AGTCTTAAGGAACTGGAAAATGGCAACGTCCCGGAGATCAGCCATGAGAACGACGCTTTA
+ATCGCCACCTTCAGTGACGGTGTCCGTACCCAGCTGGCGAACGGCCAGGCACTGAAAGAG
+GCTCAGTGCAGTTGCGGGGCCAACGGTATGTGCCGTCATCGCGTGATGCTGGTGTTAAGT
+TATCAACGACTTTGTGCCACCACTCAGTCTACGGAAAAAGAAGAAGAGTGGGATCCGGCA
+ATCTGGCTGGAAGAACTGGCTACCCTTCCCGATGCTACCCGCAAACGCGCACAGGCGCTG
+GTCGCTAAAGGCATCACCATTGAGTTGTTCTGTGCGCCGGGTGAAATTCCCTCTGCCCGC
+TTACCGATGAGCGATGTGCGTTTTTATTCCCGCAGCAGTATTCGTTTCGCCCGTTGTGAT
+TGTATTGAAGGCACACTTTGCGAACATGTCGTACTGGCGGTACAGGCCTTCGTCGAGGCC
+AAAGCGCAGCAAGCAGAATTTAACCATTTAATCTGGCAGATGCGCAGCGAACACGTCACA
+TCATCTGACGATCCGTTTGCCAGCGAAGAAGGCAACGCGTGTCGTCAATATGTTCAGCAA
+TTAAGCCAGACATTATGGCTTGGCGGCATCAGCCAGCCGCTCATCCATTACGAGGCAGCA
+TTCAACCGCGCATTGCAGGCGGCAGAGACCTGCAACTGGCGCTGGGTGAGTGAATCGCTA
+CGGCAACTGCGCGCCAGCGTTGATGCCTTCCACGCCCGCGCCAGCCACTATAATGCCGGA
+GAATGCTTACATCAGCTTGCGGCATTAAACAGTCGATTAAATTGCGCACAAGAGATGGCC
+CGGCGCGACAGTATTGGTGAAGTTCCTCCTGTGCCGTGGCGCACGGTCGTTGGCTCTGGC
+ATTGCCGGAGAAGCAAAGCTTGATCATCTGCGGCTGGTGTCTTTAGGTATGCGTTGCTGG
+CAGGATATTGAGCATTATGGTTTACGCATCTGGTTTACCGATCCCGACACCGGCAGTATT
+TTGCACCTTTCGCGCAGTTGGCCGCGAAGTGAACAGGAAAACTCACCGGCAGCTACGCGT
+CGGCTGTTTAGTTTTCAGGCTGGCGCACTGGCGGGCGGGCAAATTGTTTCACAAGCAGCA
+AAACGCAGTGCCGATGGCGAGCTGCTGTTAGCTACCCGCAACCGCTTAAGCAGCGTTGTG
+CCGCTGTCGCCTGATGCCTGGCAAATGTTGAGCGCGCCGTTACGCCAGCCGGGCATTGTG
+GCTTTGCGGGAATATTTACGCCAGCGTCCCCCCGCCTGCATACGGCCTCTTAATCAGGTC
+GATAACTTATTTATTCTGCCGGTCGCTGAGTGTATTTCGCTCGGTTGGGACAGCAGCCGC
+CAGACGCTGGATGCGCAGGTCATTAGCGGCGAAGGGGAAGATAATGTGCTGACGTTATCA
+TTACCAGCCTCAGCCAGCGCACCTTATGCCGTTGAACGCATGGCGGCGCTTTTGCAACAA
+ACAGACGACCCCGTGTGTCTGGTTTCTGGCTTTGTCAGTTTTGTTGAAGGGCAATTGACA
+CTGGAACCACGGGTGATGATGACAAAAACCCGTGCCTGGGCGCTGGACGCAGAAACTACG
+CCTGTGGCACCGCTACCTTCTGCCAGCGTTTTGCCTGTGCCGTCTACTGCTCATCAGTTG
+CTGATACGCTGCCAGGCGTTACTTATTCAACTGCTCCATAACGGCTGGCGCTATCAGGAA
+CAGAGTGCTATTGGTCAGGCATAGTTGCTGGCGAATGACCTCACCGCGGTGGGTTTTTAT
+CGGCTGGCACATGTGTTGGGACAATTTCGTAATACAGAAAGCGAGGCACGGGTAGAAGCA
+ATGAATAACGGTGTTTTGCTTTGCGAACAATTATTCCCCATGCTTCAGCAACAAGGATGA
+AATAGTGCTTTTTACTAAGAGTTCTACTCCAGTTCCGGACTGCTCACGCCACGGTATTAG
+GCATATCCTATATAGCCCCTGGTGAGAGTCACCAGTTCCTTGATTAAATAAAATGGAGTT
+TTACATGAAGGCTTTCAATAAGCTGTTTTCCCTCGTTGTTGCATCTGTTCTGGTTTTCTC
+TCTTGCTGGCTGCGGTGACAAAGAAGAATCGAAGAAATTCAGCGCCAATCTGAACGGCAC
+TGAAATTGCCATTACCTATGTCTACAAAGGTGACAAGGTGCTTAAGCAATCTTCTGAAAC
+CAAAATTCAATTTGCCTCCATTGGTGCAACCACCAAAGAAGATGCTGCCAAGACACTTGA
+GCCGTTAAGCGCCAAATACAAAAACATCGCGGGTGTTGAAGAAAAATTAACCTATACCGA
+TACCTACGCGCAGGAAAACGTGACTATCGATATGGAAAAAGTGGATTTTAAAGCCCTGCA
+GGGTATTTCAGGAATCAACGTTTCTGCTGAAGATGCCAAAAAAGGTATCACTATGGCGCA
+AATGGAACTGGTGATGAAAGCCGCTGGTTTTAAAGAAGTGAAATAATCGGTTGGCGGTCA
+TGCTCTAAACATGACCGCCAATTTTTTAGCCTTTTTTCACATGCTGGCGCGCTGCCAGTC
+CACGCAGAAAATAACGTAAAAATTGATCGCCGCATTCGCGGAAGTTTTTATGATCCGGTG
+CGCGCATCATCGCTGTAATTTCCGGCATCGAAACGCGGAACTGCTGTTCGGTGAGGATAG
+CCAGAATGTCATCGGTTTTCAGCGAAAACGCGATGCGTAATTTTTTCAGCACGATGTTGT
+TATTAATGCGACGTTCCGGCTCCAGTGCCGGAGCAGACTCATCCTTGCCGCGTTTTTCAT
+AAATCAGGCCATTGAGGAATGACGACAAAACAATGTCCGGACAACGCTGAAAACCCTCTT
+CGTCTTCTTTACGTAGCCAGACGGCGATCTGTTCCGCGGTGGCTTCGACATTACCCAGCG
+CCAGAATACGCACCAGGTCATTATTATTGGCTTTCAAAATGTAGCGCACGCTGCGCAGAA
+TATCGTTACTTAGCATGAGGCCTTCAGGTGTTGATGAGGCAAAAAGCCATTTTAGCAGTC
+TTTTACAGGCCAATCGCCTCTTTTAAGCTTTTCAGATAACGGCGGCTGACCGGCACGGTT
+AAGCCATTACGCAAAATCAACTCGGCCTGGCCGTTATCTTCCAGACGAATCTCCTGTAAA
+TGCGCGAGGTTAACCAGATACTGACGATGGCAGCGCAGTAGTGGTGTACGACTTTCCAGG
+GTACGTAATGTCAATTCGGTAAAGCCCTCTTTCCCTTCGTGGCTGGTAACGTAGACACCG
+CTCATCCGACTGCTGACAAATGCCACATCTTTCATTTGCAGCAAATAAATCCGACTATGC
+CCCGTACAAGGGATAAATTTCAGCGCCTGTTGATTTTCCGGTAACAGCGAAACATCCTGC
+TTGCTGCGCTCCTGACGCAATCGCGCCAGCGTTTTCTCCAGTCGCGCTTCATCAATTGGC
+TTCAGCAGATAATCAAAGGCATGTTCTTCAAAGGCTTTAATTGCGTATTCGTCAAACGCA
+GTGAGAAAAACAATATACGGGCGATGTTCCGGGTCAAGCATCCCCACCATTTCCAGACCA
+CTGATGCGCGGCATCTGGATATCGAGAAACAGCACATCCGGGCGCAGTTTATGCACCGCG
+CCGATCCCTTCCACGGCGTTTGAACACTCTCCAACGATTTCAATATCGCTCTGCTCCTGC
+AAAAATACACGCAGGTTCTCCCGTGCTAACGGTTCATCATCGACAATTAAGACTTTAATC
+ATGCCTCGTCCCTCCATGGTAGTCGTAACGTTATTCGGGTGTAACTATCAGGCTCACAGG
+CGACGCTTATTCCATAGTCATCGCCAAACCGTTCACGTAAACGCTTATCCACCAGATTCA
+TCCCCAGCCCACTGGCATTGGTTACCGGTTGATACAAACCGGCATTGTCTTCGATCTCCA
+GCATCAAATGTTGCCCCTCACGTCGGGCGCTGATTGCCACTCGCCCTGTATCCAGCAGTT
+GTGATGTCCCATGTTTAATGGCGTTTTCCACTATCGGTTGCAGGGTAAACGCGGGCAATT
+GCTGCTGGGATAATTCTTGCGGAATAGCAATGTTGACCTGCAACCGCGACTGGAAGCGCG
+CCTTTTCAATTTGCAGATAAGCATTCACATGTTCAATTTCGTCGGCGAGAGTAACAAACT
+CCGAAGGCCGCTTTAAGTTTTTGCGGAAAAAAGTGGAAAGATACTGCACCAGCTGGCTGG
+CCTGTTCGCTGTCGCGGCGGATCACCGCTTTAATGGTGTTAAGCGCATTAAACAAAAAAT
+GGGGATTCACCTGGGCGTGAAGCAGTTTGATCTCTGACTGGGTGAGCATCGCTTTTTGCC
+GCTCATATTGCCCGGCAAGGATCTGCGCCGAAAGCAATTGCGCAATCCCCTCACCCAACG
+TGCGGTTGATTGAACTGAATAAACGGTTTTTGGCTTCATACAATTTGATGGTGCCCATCA
+CCCGCTGATTTTCACCACGCAACGGAATTACCAGCGTCGACCCCAGTTTGCATTGCGGAT
+GCAAAGAGCAACGGTAAGGTACTTCGTTGCCATCAGCGTAGACCACTTCACCGGTTTCAA
+TCGCTTTTAAAGTATAAGTTGAAGAAATCGGTTTGCCGGGTAAATGGTGGTCGTCACCAA
+TTCCGGTAAAGGCCAGCAATTTCTCTCGATCGGTAATCGCGACTGCACCAATATCCAGTT
+CCTGATACAGCACCTGAGCCACTTTCATGCTGTTCACTTCGTTAAACCCCTGGCGCAAAA
+TGCCTTCCGTCGAGGCTGCCACTTTCAGCGCAGTGGCAGAAAAAGCCGAAGTGTATTTTT
+CAAACATCGCGCGTTTATCGAGCAATATACGCATAAACAGCGCCGCGCCGACGGTATTGG
+TGACCATCATTGGCGCAGCAATATTACTCACCAGACGCACCGCATCTTCATAAGGTCGGG
+CGATCGCAAGGATGATCAGCATTTGCACCATTTCAGCGACGAACGTGACGGCACCGGCGG
+TAATGGGGTTAAAGACTTTATCAGTGCGCCCGCGGCGGATCAGGATGCTGTGTACCAGGC
+CACCGAGTAATCCTTCAACGATGGTCGAGATCATGCAACTTAACGCGGTCATGCCCCCCA
+TCGAATATCGATGTAAGCCGCCGGTCAGCCCAACCAGCCCACCGACGACCGGACCGCCGA
+GTAAGCCGCCCATTACCGCGCCTATCGCACGGGTATTGGCAATAGAATCGTCAATGTGCA
+ACCCAAACCAGGTGCCCATGATGCAGAAGATGGAAAAGACGATGTAGCAGAGAAATTTAT
+GCGGCAGACGAACCGTGACCTGCATTAACGGTATGAATAATGGCGTTTTACTCATTAACC
+ATGCAATGACTAAAAAAACGCACATCTGCTGAAGCAGCAGCAACACCAGATTAAAATCGT
+ACATACCCGCAAACCACACTTCCCTTTAAAACGCGTAACATACATTGCCTGCGTTTAACT
+TTCTTTGAACTCTTGCAGAAAAATGAGAATTCGTGAGTACGATCACTCAAAATCGCCTGG
+CAAAAATAAAATCACCCTATAGATGCACAAAAAACGGGCAAAACTACCTGGTTCGCAAAA
+CTGCGTCTAAAGTTAAACCGGGACCTCGCGAGCAAGGGTGAGACGATGGCGCTTTACACA
+ATTGGTGAAGTGGCGTTGCTTTGTGATATTAATCCTGTCACGTTACGCGCGTGGCAGAGG
+CGTTACGGATTGCTGAAACCGCAACGGACAGACGGCGGTCATCGGCTGTTCAACGATGCC
+GATATTGACCGGATCCGCGAGATCAAACGCTGGATCGACAACGGCGTGCAGGTCAGCAAA
+GTTAAAATGCTGCTCAGTAATGAAAATGTTGATGTGCAGAACGGCTGGCGCGATCAGCAA
+GAAACATTACTGACTTACCTGCAAAGCGGCAATCTACATAGCCTGCGAACGTGGATCAAA
+GAGCGCGGTCAGGATTACCCCGCCCAGACACTCACCACACATCTGTTTATTCCTCTGCGC
+CGACGGCTTCAGTGCCAACAACCGACTCTCCAGGCGCTGCTGGCGATCCTCGACGGCGTA
+CTGATCAACTACATCGCCATTTGTCTGGCTTCGGCACGTAAAAAACAGGGTAAAGATGCG
+CTGGTGGTTGGCTGGAATATTCAGGATACCACCCGTCTGTGGCTGGAGGGCTGGATTGCC
+AGTCAACAAGGATGGCGCATTGATGTCCTCGCCCACTCGCTCAATCAACTACGCCCTGAA
+CTATTCGAAGGCCGTACATTGCTGGTGTGGTGCGGTGAAAATCGAACCTCCGCCCAACAG
+CAGCAACTCACCAGTTGGCAAGAACAAGGCCATGATATTTTCCCACTCGGCATTTAATGA
+TTCGTTAACAAATGCGCTTTACTGTACAATCCTTTCGTTAACATAAGGAGTGCATTATGC
+GCATAGCTAAAATTGGGGTCATCGCCCTGTTCCTGTTTATGGCGTTAGGCGGAATTGGTG
+GCGTCATGCTCGCAGGTTATACCTTTATTTTGCGTGCTGGCTAAGCGCCTGCACCAGCCT
+TTCAAACAGGCGGTCTGCGATGATCGCCGCCAGTGCCACCAGTAACGCCCCCTGGATCAC
+ATACGCGGTATTAAATCCGCTAAGCCCGATGATGATGGGCGTACCCAGCGTGCTGGCCCC
+TACCGTTGAGGCGATCGTCGCCGTACCAATGTTGATAATCACCGAAGTTCGCACGCCCGC
+CAGAATCACCGGAGCCGCCAGCGGTAGCTCGACCTTACGCACTCGCTGACCACGACTCAT
+TCCCATACCTTTCGCAACTTCTGTCACGCTGGCATCAATCGCTCCCAGCCCGGCAAGTGT
+CGCCTGCAGGACGGGCAGCACACCGTAAAGGATCAAGGCGATAATCGCTGGTTGCAGACC
+AAAGCCGATCACCGGAACGGCGATCGCCAGCACTGCGACGGGCGGAAAAGTCTGTCCAAC
+GGCGGCAATAGTTTCCACCAGTGGGCGAAATTCCGCGCCCCACGGGCGAGTGACAGCAAT
+TCCGGCACCAGTGCCAATGATCACCGCAAACAAACTCGAAATTCCCACCAGCCAGAAATG
+AGCCAGTGCCAGAGCTGCAAAACTTTCTTGCTGATAAACGGGTCGTGGCAGTTGTGGGAA
+CAAGGCAGCAAACAGCGGCTGGCTGTAAGGCAGCCAGAAAATCAGCGCCACAAACAGAGC
+AATGAGCCAGAACAGCGGATCGCGCAACATCTTCATACGCTTACGCCTCCACCAGCAGAT
+CCTGAAAATGCAGCGTGCCGCAAGGCTGGCCCTGCATGTTCACCACCGGCAGCACCTCGC
+ATCCCCGCGCAACAAACAGAGAGAGCGCATCGCGTAGCGTCATCTCTTCTGCCAGTGCCT
+CACCATCTGCTCGTTCTTCGCGACGCACGTAATCCGCCACACTACGTAACGAAAGCAGGC
+GCACACCCAGTTCACTACGTCCAAAAAACTGGCGGACAAAATCATTCGCCGGACGAGTCA
+GCATCGTCAGCGGATTGCCCTGCTGCACTACTTCACCGTGATCCATCAATACCAGATGTT
+CTGCCAGCCGTAGCGCCTCATCAATATCATGAGTGACCAGCACAATGGTACGCCCCAGCA
+AACGGTGAATGCGCGTCATCTCTTGTTGCAACGCGCCGCGCGTTACCGGGTCCAGTGCGC
+CAAAAGGTTCATCCATTAGTAAGACTTGCGGATCGGCAGCCAGTGCACGCGCCACTCCCA
+CACGTTGCTGCTGACCACCGGAAAGCTGATGCGGATAACGCTCACGCAAATTTGACTCCA
+GCCCCAGTAGCGCCATTAATTCGTCGATACGATCGTCAATCCGCGCCCGCGACCATTTTT
+GTAATTGCGGCACGGTAGCGATGTTTTGCGCCACGCTCCAGTGGGGGAACAGGCCAATAG
+ATTGAATGGCATAGCCCATCCGGCGGCGCAACTCCAGTACTGGCAGCGAGCGAATTTCTT
+CTCCGGCAAAGCGGATCTCTCCGCTGTCATGCTCCACCAGGCGGTTAATCATTTTCAGGG
+TGGTGGATTTGCCGGAGCCAGATGTGCCAATCAGCACCGAAAAACTCCCTTCCTGAAAAT
+TGAGATTGAGATCGTTAACGGCTTTTTGTGCGCCGAACAGTTTGCTGACATGGCTAAATT
+CAATCATTACGTTTCACCTTCAGCAGTGCGATAAGCAAATCGAACAGCGCGTCGGTAAGC
+ACCGCCAGAACAATTACCGGGATCACCCCCAGCAACACTAAATCAATGGCGCTGCTTAGC
+AGCCCCTGGAAAACCAGCGCACCAAAACCGCCTGCGCCGATTAACGCCGCAATCACCGCC
+ATACCTACAGTTTGCACCATCACCACCCGCAGGCTGCGCAGAAATACCGGTAACGCCAGC
+GGTAACTGAACATGCAGGAAACGCTGCGCCCCGCTCATCCCCATCGCTCTGGCGCTTTCC
+AGCACATCGCGCGGGATCTGGTTCAAACCGACTACCACGCCGCGCACCAGCGGCAGCAAG
+GCATAGAGCACCAGCGCAATCAGTGCGGGTGTCATTCCGGTTCCTGCTATGCCGAGCGTC
+CCCAGCCACGGAAAGGCCGTAACCAGCGCGGCAAGCGGCGCAATCAACAGGCCAAAGAGC
+GCCACCGAAGGCACGGTCTGAATCACATTGAGCAGAGAAAAAATTGCCCCCTGCCGAGCA
+GTGGAAAAGTAGCACCAGATGCCCAACGGCACACCAATCACTAACGCAGGCAGCACCGCA
+CCAAACAGCAACGTCAGATGTTGTGCCAGCGCGTCGTCAAACACATCCTGACGGTTGGCG
+TATTCTTTCATTAGTGAGAGATCGTTAAGCGTGCCGGAGTACAGCAACCACAGCGGAATA
+ATGGCAATCTGCATATGCAACAACCAGCGCCACAGCGGATGCGTGGAGATTCGGCGGATG
+GCATCGCTACAGGCCAGCAATGCCAGCGCCGCAGCCAGCCAGAAACCACTGCCGAGGCTG
+GTACGCGCCAGCGCACTGCCATTTTGCGCCAGTTGGGTCGCCGCCTTTCCAGCTCCCCAC
+ACCAGCAATACGAAGACGAATTGCGCCAGAATGAGTGCACAAATGCTGCCTTTTTTACCG
+GGAATAAAACAGGCCGTCAGCCAGGCGCAACCAACGCCCACCAGCATCCAGATCGTTTGC
+GGCCACAGCTGCCAGAGATGACGCCCCTCACCCGAAACTAAACGATTAGGCGCGTAACTG
+ATAAACGGCAGCGCCGCTGCGATTGCCGTCAGCAACAGCAGCAGCGCCAGAACAGGATTA
+ATACGGAAATAAGTCACGGGAAATTACTTCGTCCACCCTTTTTGTTTCAGGTAGTCGGCA
+GCCACTTTTTTGGCATCCAGTCCTTCCACAGCAATGCTGGCATTCAGTTGCTGCAATGTT
+TTTGCATCGAGGCTGGCGAAGACTGGCTGTAGCCACTGTGCCATTTGCGGATACTCCCTC
+AACACCGACTCACGCACCACTGGTGCAGGCGCGTAGATAGGTTGCACACCTTGCGGATCG
+CTTAAGGTTTGCAGCCCCAGCGCCGCTACCGGGCCGTCAGTGCCGTAAGCCATTGCAGCA
+TTAACGCCAGAGGTTTGCTGGGCAGCGGCTTTGATCGTCACCGCCGTGTCGCCACCAGCC
+AGTGACAGCAACTGATCCTGACCGAGCTTAAAGCCATAGGCTTTTTCAAACGCGGGTAAC
+GCATCGGCGCGTTCGATAAACTCTGCCGAGGCTGCCAGTTTGAAGGTGCCGCCCTCTTGC
+AGATAACGACTCAGGTCGGCAAGCGAAGTGAGTTTATTTTTCTCTGCCACATCCTGACGC
+ACGGCGATAGTCCAGGTGTTATTTGCAGGCGCGGGCGTCAGCCAGATTAACTTGTTGTGC
+TCCGAATCGAGCTTTTTGACTTTCTCGTAACCTTGCTGCGCGTTTTTCCACGCTGCATCG
+TTTTCATCTTTAAAGAAGAAAGCGCCATTGCCGGTATATTCCGGATAGATATCCAGTTCA
+CCGGAAGTAATCGCCCCGCGCACCACAGGAGTCGTTCCGAGTTGCACTTTATTCACCGTC
+GGTACGCCGTGGCTTTCCAGCACCTGCAAAATGATATTGCCGAGTAGCGCACCTTCGGTA
+TCGATTTTTGAACCGACTTTAACGGGGGAAGCCGCCTGTAGCGGCAGGCTCACGGCTGCC
+AACATAACCAGTGAACCTGCCCAGAGCTTTAAGAGTGGCATGATGCTTTCCTCATTCTTT
+TACTGTTGTTTTCAGCGAATTAAGAGAAAAGCATAGTTGATAATGGCGGGGTTAGCTTGA
+GCGGAAGGATTCAGTTGCAGAATCAGATAAATACTTAAGAGGCATATTCGGTCCGGCGTT
+TCCTGCCGGATGCGGCGCGAGCGCCTTATCCGGCCTACAAAGGGCGCAAACGTCGCGCCC
+TTACTAAAGCATTACAGCAACTCAAACTCGCCTTTCTTAACGCGTGCGGAATCAGTGCCG
+ATAAAGACATTGAACTTGCCAGGCTCGGCGTCATATTTCATCTGTTGATTCCAGAACTTC
+AGCGCCTCAATATCGATCGGGAAGCTGACAGTCTGAGTTTCGCCCGGTTTCAGGGTGATT
+TTCTCAAAGCCTTTCAGCTGTTTCACAGGGCGACTCATGGAAGCCGTCACATCCTGCAAG
+TACATCTGCACTACCGTGGCACCCTCGCGCTTACCGGTGTTCGTCACCTGCACGCTGGCA
+GTCACTTTGCCGTCACGCTTCATGGTCGGCGCAGAAAGTTTCACATCAGAGACGGTGAAA
+GTGGTGTAGCTCAGCCCATAGCCGAACGGATACAACGCCCCGTTAGCTTCATCAAAATAA
+CGCGAAGTGTATTTGTTCGGCTTGTCGGCATTATACGGGCGACCGGTATTCAGATGGCTG
+TAGTACACCGGGATCTGCCCGACAGAACGCGGGAAGGACATTGGCAGCTTGCCGGACGGG
+TTGTAATCGCCAAACAATACATCGGCAATTGCATTACCGCCTTCAGTCCCCGCAAACCAG
+GTTTCCAGAATCGCATCAGCCTGCTGATCTTCTTTCACCAGCGCCAGCGGACGCCCGTTC
+ATCAGCACCAGCACCAGCGGTTTACCGGTGGCTTTCAGCGCCGCAATCAAGTCACGTTGG
+CTTTGCGGAATAGTGATATCGGTCCGGCTGGAGGCTTCGTGCGCCATCCCCTGTGCTTCA
+CCGACTACAGCCACCACCACATCAGATTGTTTCGCCGTCTGCACCGCTTCATCAATCATC
+TCTTGCGGCGAACGCGGATCGACTTTGACCGCTTCTTCATACTGATTCAGGAAATCGATA
+ATGCCTTTGTCACTGGTAACGTTCGCCCCTTTGGCATACAGCACTTTACCGTTTTCACCG
+ACGGCATTTTTAATCCCGGTCAGTACGGTCACGGATTGATCGGCAACACCGGCTGCGGAC
+CAGCTGCCCATCACGTCACGTTTACTGTCCGCCAGTGGCCCAACCACCGCAATGGTGGCC
+GATTTTTTCAGCGGTAACGTTTCGAGACGGTTTTTCAGCAACACCAAGCTTTCGCGCGCC
+ACTTCACGCGCTTCTTTACGGTGCAGGCGGCTTTCGGCATTGGTATCCACCGGGTCAGAC
+TCTTTCGGCCCCAAATGGCTGTATGGGTCGTTAAACAACCCCATATCATATTTAACGTTC
+AGTACATGGCGGGCAGCATCGTCCAGCTCTGCCATCGTCACTTTGCCGGATTTAATCAAC
+CCAGGCAGATACTTCGAGTAGTACTCGTCGCTCATGCTCATGTTGATTCCGGATTTCAGC
+GCCACGCGCACCGCATCTTCCGGGTCTGCCGCCGTGCCATGTTTAATCAGCTCTTTGATT
+GCACCGTGATCGGAAACGGTGATGCCTTTAAAGCCCCACTGGTCGCGCAGAACATCTTTC
+AGCAGCCAGGAATCGGAGGTGGCTGGCGTGCCGTTCAGCGAGTTCAGCGCCACCATCACC
+GCGCCGCTGCCTGCGTCCAGCCCCGCTTTGTACGGCGGCATATAATCATTAAACAGGCGC
+TGCGGACTCATATCGACGGTGTTGTACTCTTTACCGCCTTCTACCGCGCCGTATGCGGCA
+AAGTGTTTGACGCTGGTCATCACCGAGTAGCGATCTGCCGGGCTTTTACCCTGCATCGCT
+TCCACCATGGTTTTACCCATTGTTGAGGTGAGATACGTATCTTCGCCAAAACCTTCGGAA
+GCACGTCCCCAGCGCGGATCGCGCGAGACATCGACCATCGGTGCCCAGGTCATATTCAGG
+CCATCATCTGCCGCTTCATAAGCAGAGACACGTCCGACCGTTTTCACTGCATCGAGGTTA
+AAAGACGAGGCCAGACCGAGGCTAATCGGGAACACCGTGCGCTGACCGTGCAGCACGTCG
+TAAGCAAAGAAAAGAGGAATTTTCAGGCGGCTTAATTCCATCACCTGATCCTGCATGGCG
+CGGATATCCTGACGGGTTACGGTGTTGAAAATCGCCCCAACCTGACCGTCTTTGATCATC
+TCGCGGATCGCCTCTTTCGGGTTATCCGGGCCGACGCTGATTAAGCGCAGCTGACCAATT
+TTCTCATCAACTGTCATTTTCTTAAGCAGTTCGGTGACGAACGCATCCCGCGCTTCGGGC
+GTTAATGGATGGTTGCCGAATAAATCATCCGCCAGTGCTGGCTGCAGGGCCAGACTCACC
+GCGATTCCTACTGAACATAGCCATTTCATATGGATTTTTCTTCCTTTGTTGCCCGACGTG
+GCAGCGAAAATGGTGCAAAAACCGTAGTTTGCCATAAGCATGATGGAGAGAGAAAAAGAA
+TGCTCAGTTTATTGTCTGAATTTTCAAAATATTCACTCGCTGAATTGTTATACAAGGCGC
+TATTCTAGTTTGTGATATTTTTTCGCCACCACAAGGAGTGGAAAATGTCTTCCATGACAA
+CAACTGATAATAAAGCCTTTTTGAATGAACTTGCTCGTCTGGTGGGTTCTTCACACCTGC
+TCACCGATCCCGCAAAAACGGCCCGCTATCGCAAGGGCTTCCGTTCTGGTCAGGGCGACG
+CGCTGGCTGTCGTTTTCCCTGGCTCACTACTAGAATTGTGGCGGGTGCTGAAAGCCTGCG
+TCACCGCCGACAAAATTATTCTGATGCAGGCCGCCAATACAGGCCTGACCGAAGGATCGA
+CGCCAAACGGTAACGATTATGATCGCGATGTCGTTATCATCAGCACCCTGCGTCTCGACA
+AGCTGCACGTTCTTGGCAAGGGCGAACAGGTGCTGGCCTATCCGGGCACCACGCTCTATT
+CGCTGGAAAAAGCCCTCAAACCGCTGGGACGCGAACCGCACTCAGTGATTGGATCATCGT
+GTATAGGCGCATCGGTCATCGGCGGTATTTGTAACAACTCCGGCGGCTCGCTGGTGCAAC
+GTGGCCCGGCGTATACCGAAATGTCGTTATTCGCGCGTATAAATGAAGACGGCAAACTGA
+CGCTGGTGAACCATCTGGGGATTGATCTGGGCGAAACGCCGGAGCAGATCCTTAGCAAGC
+TGGATGATGATCGCATCAAAGATGACGATGTGCGTCACGATGGTCGTCACGCCCACGATT
+ATGACTATGTCCACCGCGTTCGTGATATTGAAGCCGACACGCCCGCACGTTATAACGCCG
+ATCCTGATCGGTTATTTGAATCTTCTGGTTGCGCCGGGAAGCTGGCGGTCTTTGCAGTAC
+GTCTTGATACCTTCGAAGCGGAAAAAAATCAGCAGGTGTTTTATATCGGCACCAACCAGC
+CGGAAGTGCTGACCGAAATCCGCCGTCATATTCTGGCTAACTTCGAAAATCTGCCGGTTG
+CCGGGGAATATATGCACCGGGATATCTACGATATTGCGGAAAAATACGGCAAAGACACCT
+TCCTGATGATTGATAAGTTAGGCACCGACAAGATGCCGTTCTTCTTTAATCTCAAGGGAC
+GCACCGATGCGATGCTGGAGAAAGTGAAATTCTTCCGTCCGCATTTTACTGACCGTGCGA
+TGCAAAAATTCGGTCACCTGTTCCCCAGCCATTTACCGCCGCGCATGAAAAACTGGCGCG
+ATAAATACGAGCATCATCTGCTGTTAAAAATGGCGGGCGATGGCGTGGGCGAAGCCAAAT
+CGTGGCTGGTGGATTATTTCAAACAGGCCGAAGGCGATTTCTTTGTCTGTACGCCGGAGG
+AAGGCAGCAAAGCGTTTTTACACCGTTTCGCCGCTGCGGGCGCAGCAATTCGTTATCAGG
+CGGTGCATTCCGATGAAGTCGAAGACATTCTGGCGTTGGATATCGCTCTGCGGCGTAACG
+ACACCGAGTGGTATGAGCATTTACCGCCGGAGATCGACAGCCAGCTGGTGCACAAGCTCT
+ATTACGGCCATTTTATGTGCTATGTCTTCCATCAGGATTACATAGTGAAAAAAGGCGTGG
+ATGTGCATGCGTTAAAAGAACAGATGCTGGAACTGCTACAGCAGCGCGGCGCGCAGTACC
+CTGCCGAGCATAACGTCGGTCATTTGTATAAAGCACCGGAGACGTTGCAGAAGTTCTATC
+GCGAGAACGATCCGACCAACAGCATGAATCCGGGGATCGGTAAAACCAGTAAACGGAAAA
+ACTGGCAGGAAGTGGAGTAAAAATTACGGATGGCAGAGTATCGCCATCCGAATTCACTTA
+ATCGTTCTGTGCCGTCTGCCCCGCCGCCGCCATTTGGGCGGCTTTTTGTTTTTTATAGCT
+CAACGCTGCTGCCGGCACAGGCATCACTTTACCGGTTTCAATCCAGGTACGCAGGCGGCT
+GGCATCGGCAAAATGGGTATATTTGCCAAACGCGTCCATCACTACCAGCGCCACCGGTTT
+ATTATTGATAACCGTACGCATCACCAGACAATGGCCCGCCGCATTGGTAAAGCCGGTTTT
+GGTTAACTGAATATTCCAGTTATCGCGATACACCAGATGATTAGTATTGCGGAACGGCAG
+CGTATACGTCGGATTAGAGAAGGTTGCCATATCTTCCCGGGTAGTACTTAACTGCCCGAT
+CAACGGATATTGTTTGCTGGCAATGAGCAGTTTGGTTAAGTCACGGGCAGTTGAAACGTT
+ATGCACCGACAATCCGGTAGGTTCAACAAAGCGCGTGTTGTTCATTCCGAGCGATTTCGC
+TTTCGCATTCATTGCCTTAATAAAGGCTTTGTAACCACCGGGATAATGGTGCGCAAGGCT
+TGCCGCCGCGCGGTTTTCTGAAGACATCAGCGCCAGCAACAGCATATCTTTACGGCTGAT
+TTCGCTATTCAGTCGTACGCGCGAATAGACCCCTTTCATCTCCGGCGTCTGGCTGATATC
+CACTTTTAGTTTTTCATCCAGCGGCAGTCGTGCATCCAGCACAACCATCGCGGTCATTAA
+TTTGCTGATAGACGCAATCGGACGCACCAGATCCGGGTGGTTCGAATAGATCACTTTGTT
+GGTATTCAGATCAACAATCATCGCGCTACCGGAGGCAATTTCCGGTTGTGAAGCGGTGGT
+AGCGGCTGCCGTTTTCGCAACGGCCTGCGGTGCAAAAGGCACAGCCAGCATCAGGGCCAG
+GCTAAATAAAGAAACTCGAAATTTCGGCATGATGAGCATTCAGATAGTGGTTCACGCGCA
+CGGGTTGCGCACCGCCGGAGTAAGGATTTACTGAGGCTAGCGACGCCATCATAACGAGCA
+AAAAGTGCGATCGTCAAAGGAGAATCGTGAGGAAATGCTGCATTGCTGACATTTACGCCA
+GCAATGCAACGTCAAAGAACTTTCTAGAACAAACGATAACCGTAGCCCCATAGTATAACG
+GTTAGGGCGAGCAGCACTTCCAGTACCAGCACGCCAATCGCCAGCGTCGAACTAGAGAAG
+CTAAGGCCTTCCTCTTTGTTGATATTCAGGAAGCTCGGAATACCAAGGTAAAGCAGGTAG
+CCGGTGTAAAACAGCGCCACCGTGCCGACCAGCGCACACAACCAGACCAGTGGATAAAGC
+GCCACCAGACCGCTTAAAAACAGCGGAGTTGCAACGTAGCCCGCGAAGACCATGCAGTGC
+GCAAGTGACGGACGCTGCGGATAATTACGCGCCATCCACCAGATGACCCGCCCCATCACC
+GCGACCCCAGCCAGCATAACGCCGTAAAACAAGACAGCCAGCGCCAGTCCGGTAAACCAG
+GATAACTTCAGGATAGTGCCATCGCCAAAATTCCAGCCAATCTGTGTAGTGCCAATGAAG
+GCGCAAATCACCGGAATCGCCGCCATCAGCAAAACGTGGTGGGTGTAATGGTGAGAAATC
+GTTTCGTTTTCGCGATTAATCACCTGCATTTCACGATCGGGATGGGAAAACAGTCCCCAG
+ACATGGCTCATACCGCCCCCTTGTTGTGAGTTCATGAACCTGACAGTTCAAGTATAAGTC
+AGCTTGTGATTATTTTTTGTTCGCCCATGTAATTTTCACTGTCTGATGAACGTCCTTTTT
+CAGCGTGAATGATTCACAGGGTGTATGCTTACTGGCAACCAAAGGGAGACAGACTGGCCT
+ATGGATCTCAATACACTTATCTCACAATATGGTTATGCCGCGCTGGTGATCGGTAGCCTG
+GCGGAAGGTGAAACCGTGACTTTGCTGGGAGGCGTTGCGGCGCATCAGGGGCTATTAAAG
+TTCCCGCTGGTGGTACTTTCTGTGGCGCTTGGCGGCATGATTGGCGACCAGGTGCTCTAT
+CTGTGCGGGCGGCGGTTTGGCGGCAAGCTGTTACGCCGTTTCTCGAAACATCAGGATAAA
+ATTGAGCGGGCGCAGAAACTTATCCAACGCCATCCGTATCTGTTTGTCATTGGTACGCGC
+TTTATGTATGGCTTTCGGGTGATTGGCCCGACGCTGATTGGTGCCAGCCAGCTGCCGCCG
+AAAATCTTTCTGCCGCTGAATATTCTCGGCGCATTTGCCTGGGCGTTGATTTTTACCACT
+ATTGGTTACGCTGGTGGTCAGGTGATTGCGCCGTGGTTGCACAATCTCGACCAGCATTTG
+AAGCACTGGGTCTGGTTGATTCTGGTCGTGGTTCTGGTGGTGGGCGTGCGCTGGTGGCTG
+AAACGACGCGGGAAGAAAAAGCCGGATCATCAGGCGTAAAACCATTGCCCTGGATAAGGC
+GTTCGCGCCGCATCCGACATCCGGAGTACCATGCCTGATACGACGCTTGTGCGTCTTTTC
+ATGCCGACCAAAATATTACCCAATGAAATATCCACGCACCTCACTGCGCTATTCTGGGTT
+GAACTGTGGATTCGCCAACATAAAGCCGCCATCCACTATCAACGACTGCCCGGTGGTGTA
+ATTTGCGCCCTCCGAACAAAGCCACACCACCAGGCTGGCAATCTCATGCGTTGCGCCAAA
+ACGCCGCAAGGGAATCGAAGGCTCCGCGTCGGGCTTCACGTCGCTGTCATCCATGCCATT
+CATTGGCGTGGCGATCGCCCCAGGCGCGACTGCGTTCACCAAAATCTTATGCCTGACCAG
+CTCCAGCGCCATCGCTTTGGTTAACCCACCGAGCGCATGTTTAGCGGCTGTGTAGGCGCT
+GGCATCCGGCAGCGGCGTATGTTCATGTACCGACGTAATGTTGATGATGCGACCGCCCTG
+CCCTTGTTTCACCATCTGACGAGCCGCAATTTGCGAGCATAAGAATGCACCATCGACATC
+AACGGTAAAAATCTTGCGCCACTCATCAAAAGCCATATCAAGAAACGGCGCTTTGGTCAT
+TGCACCCGCATTATTCACCAGCACATCAATGCGCCCCAGCCGTTGAATGAGTTTCTCCAG
+CGCCAGTGCCCCTTCTGGTAGATTGCCGAGATCCAGCTGCACGATCTCCGCACGTACGCC
+GTGGCTAACTACCTCACGCGCGGTATCTTTTGCCCCTTCTTCATCTGAGTGCCAGGTAAT
+ACCAATATCAAACCCCTGCTGCGCCAGTAATAACGCGCACTCTTTGCCGATCCCCGAATC
+GGAGGCGGTAATAATCGCAACCTGTGCCATCGAGTTCTCCACTTAACGCTGAATAAACGT
+TAAGTATAGAAGGCGCATATCATCAGCGTTTGTACCCCCCGCCCAACGCACCAGTGAGTT
+GAATGGAGGCATCCAGCCACTGCCCTTGCAATAACAGGCCATTGGCCCGCTCACGCAGCG
+CGGGGATTCTGGCTTCGCTGACGCGGGAACCAGCAATGATGCCCGCGTTAAAGCGCGCCT
+GCGCAAGACCTACCACACGCAAGGCATCGCGCTCAATTTGCGCCTGATGCTGGTTTTTCT
+CCGCCAGTGTCTGAACCTGACTGGCTGCCCGCGCCACGTCATTCACCGCTTCAACCACCG
+CTTTGTTGTAGCTGGCGATAGACAAGTTGCTTTCGGCTTTTGCGATATCGAGATTGGCGT
+TAAGACGACCACTATCGAAAATGGGTAGCGTCAGGCCTGCCGTAACGCCCATTTGCTGCG
+CGGAATGACGGAACAGATCGCTTAAGTGCAACGCATCCTGTTGCAGGAAGGCCATCAGGT
+TGATGTCAGGATAAAATGCCGCTTTTGCCGCATCAATGGTGCTTAGCGATGACTCAACGT
+ACCAGTGCGCCGCCTGCAAATCTGCCCGCCGGGCCAGTAAGGAGTACCCCAGTTCATCAG
+GAAGCTGGCTTGCCACTTTCGGCAACGCGACCGGTTTAAGCTTCAATGACTTTGTCTGGT
+TATTTGTAAGTGCGCTTAACCGTGCCTCAATAATTTTCATTTTCCCCGCGACATCGTTGA
+GCTGCTGCCGGGTTTTGCTGGCATTAATATCGGTTTCCACACCTTCAACTGAAGAAGTAA
+TCCCGTTCTGATATAGCTGGCGATCGGTCGCGATAATGGTGTTCTGCTCTTTTTCTATTT
+GCTGCAAGACCGTGTTTAACGCCGCCTGGGTTTGCCACTCCCAGTACAGGCGGGCTACGC
+TGCCAGCCAGCAATTGGCGGGTTTGCTCGCGTTCCGCCGCCCGTGCTTTAACCGTACCCA
+GGCGGGCAGTAACCTCCGCCCGATTCTTTCCCCAGATATCGAGATGCCAGCCCGCCGTTA
+AGCCAAAAGTACCGTTGGTGTACCACGGGCCGGTCGTACCTGCGGCCGGATCGTTCAGAG
+CAAACGGCCCCATTAAGCCTTCTGCCGACATTTTTTGCCGCTCCATATCCGCCGAAAAGT
+CGATCTGCGGACCATCCTGAGTGGCAACTGCCTTCGCCTGGGCTTCAGCTAGCTGAATGC
+GCTGTTCAGCCACCTGCATATCCGGTGCGTTCTGTAGTGCATTGTTAATTAAGGAAGTGA
+GTTGATTATCGTGATACTCCAGCCACCATTGGCTGTCTGGCCAACCATTTTCAGCGCCGT
+GGGTAATGCGGTGTCAACTTGTGCAGCGGGCGTTTGCTGGCTTAACGCCTGGCGGGTTTC
+ATGCATAGGCGCACACCCGGCCAGCATCAGTAACAGCGGAAAACAGGCGATGGCTGGATA
+AAAGGAATCACGATTCATGGGGGAATAATCAGGTAAGAAAAGGTGCGCGGAGATTACCGT
+GTGTTGCGATATATTTTTTAGTTTCGCGTGGCAATACATCAGTGGCAATAAAACGACATA
+TCCAGAAAAATATACACTAAGTGAATGATATCTTCCGATTTATCTTAATCGTTTATGGAT
+AACGGCAAAGGGCTTCGTTTTTTCCTATACTTATTCAGCACTCACAAATAAAGGAACGCC
+AATGAAAATTATACTCTGGGCTGTATTGATTATTTTCCTGATTGGGCTACTGGTGGTGAC
+TGGCGTATTTAAGATGATATTTTAAAATTAATTAATGTCATCAGGTCCGAAAATAACGAG
+AATATTTCAGTCTCTCATCCTGTTGCGCTCCTGTCATGTGCATTGCTTCATATAATCACT
+GGCGCAAGGAGCGCGCAGGGGGCGGCCAATCGCCGCCGCCCCCTGCACCCCCGGGCTCTG
+GCGAACAAAATCGCCGCTGCGCGGTGCCCTCGGCTTATCCCTTACGGCTACCGGGTCGGG
+CGCGAGGTAACATCCCTGTAAAACGCGCCCTCAGCCCACATCCATGTGGGCTGCCCCGGC
+CTTCAGGGAACGCCTCGGCAATTTTGACGCCACCAAACAACCGTGCGGCCTATTGATAAA
+GAGCTAACACATTGTCAAAAAACATCACTATGGTTTTTTAGAGTTTCTCGATATCAATTG
+CCTGAATAGCCCTTGCAATATCAGGGGAATTATTCAACACCCGAACATGCTGAAATAATT
+CCGTTGCTTCATCGTATTCTTTACGCAAATAACTCAACCACTGTTTAATCCGCGCAACGT
+GATATAACCCGGTATCGCCCTGCTTTTCCAGACGGGTATATTTTTGCAGCAAAGCAACCA
+CCTCCGGCCACGGCATTCGCGGTTCGTTATATTTTACCACCCGGCTCAGGTTGGGAATAT
+TGAGCGCCCCGCGACCAATCATCACTGCGTCGCAGCCGCTGATCGCCATGCATTGTTGCG
+CGCTCTGCCAGTCCCAGATTTCACCGTTGGCAATCACCGGAATATTCAGCCGCTGGCGAA
+TATCGCCAATCGCCTGCCAGTCAATATGCTCCGCGCGGTAACCCTGCTCTTTCGTCCGCC
+CATGCACCACCAGCTCCGTAGCGCCAGCCTGTTGAACCGCATCGGCGATTTCAAATTTCT
+TCTCACCGCTGTCCCAGCCCAGACGCACTTTCACGCTGACGGGCAAATGCGCCGGTACAG
+CTTCACGCATCGCTTTTGCACCCTGGTAGATGAGTTCAGGATCTTTGAGTAACGTCGCCC
+CGCCGCCGCTACCGTTAACCGTTTTCGACGGGCAGCCGCAATTGAGATCCACGCCCCAGG
+AACCTAACTCCACCGCACGGGCGGCGTTCTCTGCCAGCCATTGTGGGAACTGACCTAACA
+ACTGCACGCGCACCAGCGTACCAGATGGTGTCCGGCTGGCGTTTTGTAGCTCAGGGCAAA
+TGCGATGAAAGACTTTTACCGGCAGCAGTTGATCCACCACGCGGACAAACTCGGTGATGC
+ACAGATCGTAGTCGTTAACTTCGGTCAGCAATTCACGCACCAGAGAGTCAAGCACTCCCT
+CCATCGGTGCCAGTAACACACGCATATCATCACCCGCAAAAAAATGAGGCGCTATGTTAG
+CGCCTATGGTCAGCGGATTAAAGGTCTGCAAAGAGGGATTGCTGCAAACTGCAATCCCTC
+TCTATGCTTGATGTATGCCTGAGTTCGCTGCGCATTGCGTAATGCCGGGGAGCGAAAAAA
+TAAGCGCTGATTTCTTAATGTGATCGGTAGCACGTTTTACGAATTAATTGTATGATGAAT
+CCATCTCATCTGGGGTGTTGATTATGAGTAAGACACTGAACATTATCTGGCAATATTTAC
+GCGCTTTCGTCCTGATTTATGCCTGCCTGTATGCAGGCATTTTCATTGCTTCCCTGCTAC
+CGGTAACCATTCCGGGCAGCATCATCGGGATGCTGATCCTGTTTGTCCTGCTGGCCTTGC
+AAATTCTTCCGGCAAAATGGGTCAATCCGGGGTGCTACGTACTGATTCGCTATATGGCGC
+TATTGTTTGTGCCGATTGGCGTAGGCGTCATGCAATATTTTGATTTGCTCCGCGCACAGT
+TTGGCCCGGTAGTGGTTTCCTGTGCAGTCAGTACGCTGGTGGTTTTTCTGGTGGTGAGCT
+GGAGTTCGCAACTGGTACACGGTGAACGTAAAGTCGTAGGTCAGAAAGGATCAGAAGAAT
+GATGGCGAATATCTGGTGGTCATTACCGCTGACATTGATTGTCTTTTTTGCCGCCCGCAA
+ACTGGCGGCACGGTATAAGTTTCCCTTGCTTAACCCGTTGCTGGTAGCAATGGTGGTGAT
+CATTCCTTTTTTAATGCTGACTGGCATCTCTTACGACAGCTACTTTAAAGGTAGCGAAGT
+GCTAAACGATCTGCTGCAACCGGCGGTCGTCGCGCTGGCCTATCCTTTATATGAGCAGCT
+ACACCAGATCCGCGCGCGCTGGAAATCGATCATCACCATCTGTTTTATCGGCAGCGTGGT
+TGCGATGGTGACGGGGACTTCCGTGGCATTGTTGATGGGCGCTTCACCGGAAATCGCCGC
+GTCAATCCTGCCGAAATCAGTCACCACGCCTATTGCAATGGCGGTTGGCGGCAGTATTGG
+CGGTATTCCGGCAATCAGCGCAGTTTGCGTGATTTTCGTCGGCATCCTCGGCGCGGTATT
+TGGCCATACATTGCTTAATGCGATGCGTATTCGTACCAAAGCTGCGCGCGGTCTGGCAAT
+GGGGACTGCCTCGCACGCCCTCGGTACGGCGCGCTGCGCCGAGCTGGATTATCAGGAAGG
+TGCATTTAGTTCGCTAGCGCTGGTGTTATGCGGGATAATTACTTCGCTGATCGCACCGTT
+CCTTTTCCCGATTATTCTGGCAGTAATGGGCTAAAATTTGCGATGCGTCGCGCATTTTTG
+ATGTATGTTTCACGCGTTGCATAATTAATGAGATTCAGATCACATATAAAGCCACAACGG
+GTTCGTAAACTGTTATCCCATTACATGATTATGAGGCAACGCCATGCATCCACGTTTTCA
+AACCGCTTTTGCCCAACTTGCGGATAACTTGCAATCTGCACTGGAACCTATTCTGGCAGA
+CAAGTACTTCCCCGCTTTGTTGACCGGGGAGCAAGTCTCATCGCTGAAGAGCGCAACGGG
+GCTGGACGAAGACGCGCTGGCATTCGCACTACTTCCGCTGGCGGCGGCCTGTGCGCGTAC
+GCCATTGTCGAATTTTAATGTTGGCGCAATTGCGCGCGGTGTGAGCGGAACCTGGTATTT
+CGGTGCCAATATGGAATTTATTGGTGCGACAATGCAGCAAACCGTTCATGCCGAACAAAG
+CGCGATCAGCCACGCCTGGTTGAGTGGTGAAAAAGCGCTTGCAGCCATCACCGTTAACTA
+CACGCCTTGTGGTCACTGCCGTCAGTTTATGAATGAACTGAACAGCGGTCTGGATCTGCG
+TATTCATCTGCCGGGCCGCGAGGCACACGCGCTGCGTGACTATCTGCCAGATGCCTTTGG
+GCCGAAAGATCTGGAGATTAAAACGCTGCTGATGGACGAACAGGATCACGGCTATGCGCT
+GACGGGTGATGCGCTTTCTCAGGCAGCGATTGCGGCGGCAAACCGTTCGCACATGCCTTA
+CAGTAAGTCGCCAAGCGGTGTCGCGCTGGAATGTAAAGACGGTCGTATTTTCAGTGGCAG
+CTACGCTGAAAACGCCGCATTCAACCCGACTCTGCCACCGTTGCAGGGAGCGTTAATTCT
+GTTGAATCTCAAGGGTTATGATTACCCGGATATCCAGCGCGCGGTTCTGGCAGAAAAAGC
+CGATGCGCCGTTGATTCAGTGGGATGCCACCTCCGCAACGCTGAAAGCTCTCGGCTGTCA
+CAGTATCGACCGAGTGCTTCTCGCTTAAGCCTGGTGCCGGATGCGGCGTGAACGCCTTGT
+CCGGCTTGCCAGCCCTCTCCTGGTGTCGAAATTCCCGGCAAACAGTTTGCCGTTTCTTGC
+GCAAAACCAGCGGGTAAAGTAGCCTGATGGAAATTTTCCTTAGATCGAGTCTCCTGCATG
+TTAAAGCGCGTGTTCCTCAGCCTGTTAGTCCTGATCGGCTTGCTGCTGTTGACTGTGCTC
+GGCCTCGATCGCTGGATGAGCTGGAAAACCGCGCCTTATATCTACGACGAATTGCAGGAT
+CTCCCCTACCGCCAGGTCGGTGTGGTGCTCGGAACAGCAAAATATTATCGTACTGGCGTA
+ATTAATCAGTATTATCGCTACCGCATTCAAGGAGCGATTAATGCCTATAACAGCGGTAAG
+GTAAATTATCTATTACTGAGCGGCGATAACGCATTGCAAAGTTATAATGAGCCGATGACC
+ATGCGCAAAGATTTAATCGCTGCTGGTGTCGACCCATCAGATATTGTTCTCGATTACGCA
+GGCTTTCGTACGCTGGATTCCATCGTGCGTACACGCAAAGTTTTCGATACTAATGATTTC
+ATTATTATCACCCAACGTTTCCACTGTGAGCGAGCATTATTTATTGCGCTGCATATGGGG
+ATTCAGGCTCAGTGTTATGCCGTACCGTCACCGAAAGATATGCTGTCAGTACGTATTCGT
+GAATTTGCCGCCCGTTTCGGTGCGCTGGCTGACCTTTATATTTTTAAACGTGAACCGCGT
+TTTTTAGGGCCGCTGGTCCCTATTCCGGCTATGCACCAGGTACCGGAAGATGCGCAGGGG
+TATCCCGCCGTCACACCCGAACAGTTACTTGAATTACAAAAGAAACAAGGAAAGTAGTTA
+TGGATGTACAGCAGTTTTTTGTCGTTGCCGTTTTTTTCCTTATCCCGATATTTTGTTTCC
+GCGAAGCATGGAAAGGCTGGCGCGCAGGCGCGATTGATAAACGGGTTAAAAATGCACCGG
+AACCGGTGTATGTCTGGCGAGCAAAAAATCCCGGACTCTTTTTCGCTTATATGGTGGCAT
+ATATCGGCTTCGGAATTTTATCTATCGGCATGATTGTTTATCTTATTTTCTATCGTTAAT
+ATTCCCCTCTCCAGTTAATTATTGAGAATAATTATTACTTCACCTGATAAGCTGCGGATA
+TCACATTCCTAACCGCAGCTATTTGTGAATCTTTTCACAGTTTAAATTCCCCCGCACGCT
+TAGCCTTAATATCAGTACATTATTATTTACTAAACGCTCGCCTTAATTACCTATAGCATT
+AAGGAAGATCACATGCCGCAACAAAATTATCTGGATGAACTCACTCCGGCTTTTACGTCT
+TTACTGGCGATTAAAGAAGCCTCTCGCTGTTTATTATGTCACGACGCTCCCTGTAGTCAG
+GCTTGCCCGGCACAGACCGATCCGGGGAAATTTATTCGCTCAATCTACTTTCGTAATTTT
+AAAGGCGCTGCCGAGACAATTCGCGAAAATAATGCCCTCGGTGCCGTTTGTGCCAGAGTG
+TGCCCGACGGAGAAATTATGCCAAAGCGGTTGTACCCGTGCCGGTGTTGATGCTCCCATT
+GATATCGGCCGCTTACAGCGTTTTGTTACTGATTTTGAACAACAAACCGGAATGGAAATT
+TATCAGCCCGGTACTAAAACGCTCGGCAAAGTCGCGATTATTGGCGCAGGTCCTGCCGGA
+TTGCAGGCCAGTGTGACACTGACAAACCAGGGTTATGACGTCACGATTTATGAGAAAGAA
+GCGCACCCCGGTGGCTGGTTGCGTAACGGTATTCCGCAATTCCGGTTACCGCAATCAGTG
+CTGGATGCAGAGATCGCCCGTATTGAAAAAATGGGCGTGACCATTAAGTGCAACAACGAA
+GTCGGTAACACACTCACCCTTGAGCAGCTGAAAGCAGAAAACCGCGCGGTACTGGTCACC
+GTGGGGTTATCAAGCGGTTCCGGGCTACCGCTGTTTGAGCATAGTGACGTTGAGATTGCC
+GTCGACTTCTTGCAACGTGCACGACAGGCGCAAGGCGATATCAGCATTCCACAAAGCGCA
+TTAATTATCGGCGGCGGTGATGTCGCGATGGACGTAGCCAGCACGCTGAAAGTTCTCGGC
+TGTCAGGCGGTAACTTGCGTAGCGCGTGAAGAGTTAGATGAGTTTCCGGCAAGCGAAAAA
+GAGTTTACCAGCGCCCGGGAGCTGGGCGTTTCGATCATCGATGGATTCACGCCAGTAGCC
+GTGGAAGGCAATAAAGTCACGTTTAAGCATGTACGGTTATCGGGCGAACTGACGATGGCG
+GCAGATAAAATTATTCTCGCCGTCGGTCAGCATGCCAGACTAGATGCCTTTGCGGAGTTA
+GAGCCGCAGCGTAACACCATCAAAACACAAAATTACCAGACCCGCGACCCGCAAGTCTTT
+GCTGCTGGCGATATTGTTGAGGGTGACAAAACCGTGGTCTATGCCGTGAAAACCGGGAAA
+GAAGCCGCCGAGGCGATTCATCACTATTTAGAGGGAGCTTGCTCATGTTAACGAAAGATC
+TTTCGATTACTTTTTGCGGCGTGAAGTTTCCCAACCCGTTCTGCCTCTCTTCTTCGCCGG
+TAGGCAACTGCTATGAGATGTGTGCCAAAGCCTACGACACAGGTTGGGGCGGTGTGGTGT
+TTAAAACGATCGGCTTTTTTATCGCCAACGAAGTCTCGCCGCGTTTTGATCATCTGGTGA
+AAGAAGATACCGGTTTTATCGGCTTCAAAAATATGGAGCAGATTGCTGAACATCCGTTGG
+AAGAGAATCTGGCCGCCCTGCGTCGGCTGAAGGAAGATTACCCGGACAAAGTATTGATCG
+CTTCGATCATGGGGGAAAATGAGCAGCAATGGGAGGAGCTGGCGCGCCTGGTGCAAGAAG
+CTGGCGCGGATATGATCGAGTGTAACTTCTCCTGTCCGCAAATGACTTCTCATGCGATGG
+GTAGCGATGTCGGGCAAAGCCCGGAGCTGGTAGAAAAATATTGTCGGGCAGTGAAACGGG
+GTTCCACGCTGCCAATGCTGGCGAAGATGACGCCGAATATCGGTGATATGTGCGAAGTGG
+CGCTGGCGGCGAAGCGCGGCGGCGCAGATGGCATTGCGGCGATTAACACCGTTAAATCCA
+TCACCAATATCGATCTTAATCAGAAAATCGGTATGCCGATCGTTAACGGAAAATCGAGTA
+TTTCCGGATATTCCGGTAAAGCGGTAAAACCGATCGCCCTGCGCTTCATTCAGCAAATGC
+GCACCCATCCAGAACTGCGCGATTTCCCAATCAGCGGTATCGGCGGCATTGAAACCTGGG
+AGGATGCGGCTGAGTTTTTATTGCTCGGCGCAGCAACGTTACAGGTGACCACCGGCATCA
+TGCAGTACGGGTATCGGATAGTGGAAGATATGGCAAGCGGGTTGTCGCATTATCTCGCCG
+ATCAGGGATTTGATTCGCTGCAGGAGATGGTAGGTCTGGCGAATAACAATATTGTCCCGG
+CGGAAGATTTAGACCGCAGTTATATTGTCTATCCCCGTATCAATCTTGATAAATGTGTTG
+GCTGTGGACGCTGTTATATTTCCTGTTACGACGGCGGTCACCAGGCGATGGAATGGAGCG
+AGAAAACCCGCACACCGCATTGTAATACCGAGAAATGTGTGGGTTGTCTGCTTTGTGGTC
+ACGTCTGCCCGGTGGGTTGTATTGAGCTCGGGGAAGTGAAGTTTAAGAAAGGCGAGAAAG
+AACACCCGGTAACGTTGTAAAACCAGAGACGCATCCGGCATTTGGTTCCTGTCGCCGGAT
+GCGGCTTGAACGCCTTATCCGGCCTACAAAACCATACAAATCAGTATGTTGAGCTTATTG
+TAGGCCGGATAAAACGCGCCAGCGTTGCATCCGGCATTTGGCTCCTGTTGCCGGATGCGG
+CGTGAACGCCTTATCCGGCCTACAAAACCACACAGATCATGATGTTATGTGCGTTTATGA
+CCGAATGCGGACCACATTCACATCATTTCTTACGCGCGTATTTCAGTGAATCCAGCGCTA
+CGGCGAAGATAATAATCGCCCCTTTGATGATGTACTGCCAGTATGGGTTTACGCCGATAT
+ACGTCAGGCCATAGTTGATGACGGTAAAAATAATTACCCCGGTCACCACGCCAATCACCG
+TCCCCACACCGCCGCTGAACGATACACCGCCTACCACGCACGCCGCGATAGCATCCAGCT
+CATACATAAAGCCGAGGTTGTTGGTGGCAGAGCCGATACGTCCGGCTTCTAACATCCCGC
+CAAAGGCATAGAACACGCCAGACAACGCGTAGATCATCAGCAGGTTCAGGCCGACGTTGA
+CACCAGATACTTTTGCCGCTTCCGGGTTACCGCCAATGGCAAAAATGTTCTTACCGAAGC
+GGGTTTTGTTCCACAACACCCAGACGAACGCCACCGCAATCAACGCGTAGAAGGTGATGT
+AAGAGAGACGGAAACTCCCCAGCGCGACAAAGCCCTGAGCAAAGGTAGAGAAGCCACTGT
+CAAAACCAGAAATTGGCGACGCCCCGACAAAGTCGTAATAGAGCGAGTTGATGCCATAGA
+CGATGATCATCGTGCCGAGCGTGGTAATGAACGGCGTCACGTTGAGATAAGCGATAATCA
+GACCGTTGATCAAACCGATCACCGCACCAATGGCACAGACAATCAGAATAACCAGCGCAA
+TCGGCATCGTCGCCATTTCCGGGAACACTTTGTTGGCGTTATCCATGGACTGCAATAATG
+TCGCAGCCACCACTGCCGCCAGCCCTACCTGACGACCAGCAGAAAGATCGGTCCCCTGGG
+TGACAATTAACCCTGCCACACCGAGCGCGATAATAATACGCACCGATGACTGGGTGAGAA
+TATTACTTAAGTTCAACAGACTTAAAAATGTTGGGTCCTGGAAAATAATAATCGCCAGCA
+AAACTAAAAGAACGACGTAAATACCGCCCTCTTTCAGGTAAGTAAGAAAACTTTTCTTAT
+TTAACGCACTCATGGGAAGCCCCTAATCTTAAAGGTGCAAAGACGCAAGACGCAGAATTT
+CGTTTTGCGTTGTTGTTTTTGTATCGACAATTCCGGAAACGAGACCATTGCTCATGACCA
+GAATACGGTCTGTTATCCCTAACAACTCAGGCATTTCAGAGGAGATAATAATAATCCCCT
+TGCCTTTCTTCGCCAGTTCGGCAATTAACTGATAAATTTCAAACTTCGCCCCGACATCAA
+TACCGCGCGTCGGTTCATCGAGCATTAATATTTCTGGTTGCGTTAGTAGCCAGCGACCAA
+TAATCACCTTTTGCTGATTACCACCGGAGAGCGAACCAATTTGCGTCCGATGACCCGGCG
+TTTTTACCCGCATCGAATCAATCACCCACTGGGTATCGCTTTTCATCCGCGAGTTATCCA
+GTAAACCAACTTTATTTTTGTAGTTGCGAATATTGGAAATTAACGAGTTAAAACCAATAT
+CCAGATAGGCATAAATTCCCGTTGAGCGGCGCTCCTCAGTTACCAGTGCAAATCCATGGT
+TTATGGCTTCGTTGGCATTATGGTTATTGATCTGTTTGCCGTGCAACGTTATGGTGCCAG
+CCGATTTCTCGCGAATACCAAATAACGTCTCAACAATATCGGTACGTTTCGCCCCCACCA
+GACCGGCAATACCGAATCAAACGAGACATCGCGAATCGACGGCTGGCGCAGTGACGTCAG
+GTTACGTACCTCGAGGATGACTTCGCCCGGTTTGTTTTCTTTGTCAGGGAAACGCTGGTT
+AAGAGAACGCCCAACCATCATGGCGATGATCTTGTCCATCGTCAGTCCTGCCAGCGGTTC
+GGTGGCGATCCACTGACCGTCGCGCAATACGGTAACTTCATCACATAACTGGAAGATTTC
+TTCCATTTTATGCGAGATATAAACAATACCGCAGCCGCGCTCTTTTAATTTACGAATAAT
+AGTGAACAGATGATTGACCTCTTTTTCGGTTAACGAAGAAGTCGGTTCATCCATAATCAC
+AATTTTCGCGTTATAGGAAAACGCTTTGGCGATTTCGATCATCTGCATTTGCGAAACGGA
+TAATGTGCCGACGCGCGCACGCGGATCGATATCAATATCCAGTTCGTCAAAAATCGCTTT
+GGTTTCGCGGTACATTTTGTCCTGATCGACAAACATGCCTTTGGTGGGATATCGCCCCAG
+CCACATGTTATCCATCACCGAACGTTGTAATACCAGGTTTAACTCCTGGTGTACCATCGA
+AATACCATTTTCCAGGGCTTCTTTTGCAGAATGGAAATCGATCTCTTTACCCTGGAATAA
+AATGGTGCCGGAGTCTTTTTGATAAATACCAAACAGGCATTTTAATAATGTCGATTTTCC
+TGCACCGTTTTCCCCCATTAATGCATGGATAGAATGTGGCCGGACTTTTAAATTAACGTT
+ATCAAGTGCCTTAACACCAGGAAAGGACTTGTTGATACCGCTCATTTCCAACAAGTATTC
+CCCGGAGGACGGAGTCGTTGAGCTGACCATATAATTTTACCTTGTTGGCCATACAATAAG
+GGCGCAGTAATAGACTGCGCCCAATCAGTCTTATTTCTTGCTGAATTCAGCCAGGTTGTC
+TTTATCTACGCCAACATAAGGTACGCGGACCACTTTGTTGTCGATTTTCCAGTTGGTGCC
+ATCAGCCGCACCTTTACCATCGGCCAGGTTTTTCGCCAGATCAAAGGTCGCTTTCGCCTG
+GTTGTTAGCATCGTTCAGTACGGTGCCCGCCAGTGCACCGGATTTCACCAGCGCCAGCGC
+TTCTGGCAGCGCATCGACGCCAAACACCGGAATGCTGGACTTGTTGTGTGCTTTCAGCGC
+TTCAACCGCGCCCATTGCCATCGCATCGTTGTTGGCGATAACCACTTCGATTTTGTTGGC
+GTTCGGGCCAGACAGCCAGGCGTCCATCTTATCTTTCGCCTGAGCGGTGTCCCACATTGC
+GGTATCTAACTGTAACTGTTCAGTTTTGATGCCTTTATCGTTCAATTCTTTAATCACGTA
+AGTGGTACGTGCTTCTGCATCCGGATGGCCCGGTTCACCTTTCAGCAGTACGAACTGAAT
+CTGACCGTCTTTGTTCAGATCCCAACCCTGATTCGCCGCCCAGTGTTTAGCAATCAAATC
+GCCTTGAATAATGCCGGACTCTTTGGAGTCAGTGCCAACGTAGTAGGCTTTGTCGTAGCT
+ATCCAGCGCCTTACGAGACGGTTCTTTGTTGAAGAAAACCACCGGCACGTTTTGCCCACG
+CGCTTTCTCAATCACCGTACCCGCAGCTGCCGGGTCAACCAGGTTGATTGCCAGTGCCTT
+CACCCCTTTCGCCAGCAATACGTCGATCTGATCGTTCTGCTTGGACTGGTCATTCTGAGA
+ATCATTCATCAGCAGCTGAACATCTGGCGCGGCTTTCGCATCTTGCTCAATAGCCTTGCG
+CACTACAGACATAAAGTTATCGTCGTACTTATAGATTGTTACACCAATGCGAGTATCAGC
+AGCGTGTGCAGCGGCACCGAATAACATGCTGGCCATCACAGCAGACAGGGTTAACACCTT
+CTTATTCATGGTATCTCCGGTTTTTCTTATGCAGGGTAGTGCTTGAGATAAATGCTCGGC
+GGGGCAGTAGAGTTAATGAAGTGTTACTGAACGCCGAAGCTCACTTTTTAAAATTCGTTC
+TTCCATGCCCGGTAACGCTCCAGAAAACGGCTTTAATTGTTGTTATGACGCTGTTACCTC
+GGCAAAAGTGATTATTCACTGTTACATACGGGTTACAACGTTAAAACGGTGCAATCATAG
+CTATCACATTGTTAAGATACTGTGAAATCACTCACAGATTGAAAGCGGTTACATCGCCTG
+ATTTGTTGAGTTAGTGATCGCCGCCGCATTCTGGCGTGTTGCGACAGAATGGCGACGCAC
+TAACGTCGGCATAAAACAGTGGCTGGCACGAGGATCAATATTGCCTGCTGCCCCCTGCAA
+GGCCAGTTCGGTGGCTAATTTCGCCATTGAAGCAATGGGATAACGCACGGTCGTTAATTG
+CGGGTCGGTGTAACGGGCGATGGGAATATCATCGAAACCGATGATTGAGAGATGTAACGG
+AATCGCAATGCCATTATCTTTTAATGCTGTCAGTGCGCCAGCGGCCATATTGTCGTTATA
+AGCAAATACAGCGGTAAGTTGTAGATTGCGCCCCAGCAGTTCAACCATCGCCGCCTCACC
+GCCCGGCATGTCCGGCGTACCAGCGCCAATCCAGCTTTCCGGCGGAATAATATCCTGCTC
+TTTCAACGCACTCATCCAGCCTGCTTTACGCATGGCGTCATCTTCAATGCCGTGGCTGGA
+AGAAAGATAACCAATACGTTGATGACCGTTATTCAGCAACATGCGCGTCGCCATTCGGGC
+ACCGCTGAGATTATCCAGGCAAACGCAACGATGGGCGTACCCCGGCACAACGCGGTTGAT
+TAACACCATACCGGGAATGTTATCCATAAATTGCGCCAGTTCATCGTCACTCAATGCTTT
+TGAGTGAACAATCAACGCATTACAACGCTGGCGAATTAACACCTCAATGGCGTGACGCTC
+TTTTTCCGCTTCATGATAGCTATTGCCGATTAGCACGTATTTCTGATGCTGCTGAGCGAC
+CAGATCCACCGCTTTTACCAGCGCGCCGAAAAACGCATCAGAAACGTCCATCACCACCAC
+GCCAATGGTGTCGCTAACCTGAGTTGCCAGCGCCTGGGCATTGGCGTTTGGCCGATAATC
+CAGCTCACTCACGGCTTTCATTACTGCTTCACGCGTGTCGGCACTGACCAGCGTGCTGTT
+ATTGAGCACCCGGGAAACCGTTGCCACAGAGACGCCAGCCTGACGCGCTACATCACGAAT
+GGTGATCATATTCACTACCTGTTATGAGATTGCAGTAAATGACTGCTTGCTGGCGGCTAT
+TTTGTCAGCACTGAATACAGGACTTCGTGAATCGAGTCACAGCAATGGAAACGGTTACAG
+CCGTTTTGTTAACGAATGTGATCCAGATCGTTATCTTGATGTTTTAGATATTGCCGGTCC
+GGCAGCACGCAAAGTTAACTGACGCCAGAGCCATTCCACCGGCCCCTGGCGGAAGTAACG
+CAGCCAGATAACAGAGAAGAGGATATTCGCCAGCCATACCGGAATAACAAACGCCAGCAG
+CTCCAGGCGGTCAAAATGCATAAACAAACCGAGGTGGTAAAAAAGCGTGGTACAAATCAG
+CGTTTGCAATAGATAGTTGGTCAGCGCCATCCGTCCGACGCAGGCGATCGCAAGCACCAG
+CTTAAAGCGGCTCAATTGCGGCCAGAAGCCATAAAACAGCGACGCATAGCCAATCGCCTG
+AAACGGCGCACTCAGTTCCCGCGGCATTTGAAGTAAGAAGGCACACCAGCGATACGCCCA
+GTCCAGCTGCCATTGCAGGGCGATGGCAGGAAGGTTAATGGTCACCCCAATCGCCACCAG
+CACAAAACCAGTACGACGATAGTGACGTAAGCTGAACTGCCCTTTCAGCCAGCCGCTGCG
+CATCAGCGCCGCACCAATGAGCATCATCCCTGCCAGTTGCCAGCCATACTGTGCGCCCAG
+TGCCAGTAAACTGTTGCCAACACCATCGGCACGATTACTGATCGCTTCAACGCCGCCGTG
+AAGCTTCCAGTATTTTTCATACAAAATAGCCGATGCATCCGGCGTCCAGGCGCGGCTGGT
+CTGGCTGTCGGAAATCAGCCCCAATAACAGCAAAACGCCAAGCCCCACCAGATAAAGCAT
+GACGCCTGTATTAAACAGGCTTTTTACCGATGGCGCATCGCGCACCAGCCGCCAGCAGAT
+TAAGCCCACCAGCCCGTAAGCCAGCAAAATATCGCCGTCCCAGAACAATAAACCGTGAAT
+AAAGCCCAACAAGACTAACAGCGTTAACCGCGACTGGATCCAGCGTCTGCCACGGGGCAG
+CAACATTTGCAGGCCCGCACCAAACAGTAGCGCAAAAAGCGTGAGGAATTTCACCTGGCC
+GATGAGATCAAGAAATGCCCAAGTCCATGCATCCCGCGGCGTAATAGCACCGTACCAGGC
+GGGATTGAGATAAGCCGCCTTTGGTAGCCCAAAGGCGCTGATGTTTAATAGCAGGATCCC
+CAGAATGGCGACGCCGCGAACAAAATCGAGCGTGACGTTGCGCTCCATGGTTCCTGCCTT
+TTAATCAGTTGTGATGACGCACAGCGCGCAGAAACTCGTGGCGCGTATTCTGACTGGATT
+TGAACAATCCACCAAGAGAGGTCGTTGTCGTGGCACTGGTTGCATCGCGGATGCCACGCG
+CCTTCACGCAGTAATGCACCGCGTCGATCGAGACAGCCACGTTATTGGTGCCCAGCAGCG
+TTTGTAGCGCAATAAGAATTTGCTGCGTCAGACGTTCCTGCACCTGCGGACGCTGGGCAA
+AGAACTGCACAATGCGGTTAATTTTTGACAGACCGATCACCGAATCTTTCGGGATATAGG
+CCACCGTCGCTTTGCCATCGATGGTAACAAAATGGTGTTCACAGGTGCTGGTCAGAGTGA
+TATCGCGCACGGTGACCATTTCATCGACCTTCATTTTGTTTTCAATGAGGGTGATTTTCG
+GGAAATTGGCGTAATCCAGACCGGAGAAAATTTCATCGACATACATTTTAGCGATGCGAT
+GCGGCGTTTCCATCAAACTGTCATCAGCCAGGTCGAGATTCAGCAGCTGCATGATTTCGG
+TCATATGACCAGCAATAAGGCTTTTGCGCGTTTCGTTATCCATTTCATGCACGGGCGGGC
+GCAGCGGTGTTTCCAGTCCTCGCGCAACTAACGCTTCATGAACCAGGGCCGCTTCTTTAC
+TGAGTGATGGCATTTATGATTTCTCCTGCAGGTGTGACGCCTCCGCCCTGCGTGGGGGCA
+AAGTTATTAAGCTGATTTACAGCCTGATTATTGTGCGTGAGGCGGCGCACATAATCCAGT
+ATTCACAGCGATAATTATTGTAATTGCCGCTGCCTTTCATCAGCAGATGTTAAAACATCG
+TTATGCAAATACGGAAGTGAAAGTTACTCACAGCACATTGAATAAACGGTATGATGAAGA
+AATTGCAAACAACACAACAAGGAGCCACGCATGGAAATGCTCGAAGAGCACCGCTGTTTT
+GAAGGCTGGCAGCAACGCTGGCGACACGACTCCAGTACCTTAAACTGCCCGATGACGTTC
+AGTATCTTTCTCCCTCCACCTCGTGATCACACTCCGCCACCAGTGCTGTACTGGCTTTCC
+GGATTAACCTGCAATGACGAGAACTTCACCACCAAGGCGGGTGCCCAGCGGGTAGCGGCG
+GAACTGGGGATTGTACTGGTGATGCCAGACACCAGCCCGCGCGGCGAAAAGGTTGCCAAC
+GACGATGGCTACGATTTAGGCCAGGGCGCAGGCTTTTATCTTAATGCCACGCAACCGCCG
+TGGGCGACGCATTACCGGATGTATGATTATCTGCGCGATGAATTACCGGCGCTGGTTCAG
+TCGCAATTTAATGTCAGCGACCGCTGCGCCATTAGCGGTCACTCAATGGGTGGTCACGGT
+GCGCTGATTATGGCGCTGAAAAATCCGGGTAAATACACCAGCGTTTCGGCCTTTGCGCCA
+ATTGTGAATCCGTGCAGCGTCCCGTGGGGAATCAAAGCGTTTAGCAGCTATTTAGGTGAG
+GACAAAAATGCATGGCTGGAATGGGACAGTTGCGCACTGATGTATGCCAGTAACGCGCAG
+GATGCGATCCCGACGCTTATCGATCAGGGCGATAATGATCAGTTTCTTGCCGACCAGTTG
+CAACCTGCGGTACTGGCAGAAGCCGCGCGCCAGAAAGCGTGGCCGATGACGCTGCGTATT
+CAGCCGGGATATGATCACAGTTACTACTTCATCGCCTCTTTTATAGAGGATCACCTGCGC
+TTCCATGCGCAGTATTTACTGAAGTGAAAGTCCGCCCGGTTCGCCGGGCATCTTCTCATC
+AGAAGCGATAATCCACTGCCATAAAGTAACGACGTCCGTCTTCGTTATAGCTGTAGTCGT
+CACGACTGAGATCCTTGTCGCCAAGGTTCAGCACGCCTGCGCGCAGTTTGACGTCTTTAG
+TCACCTGCCAGGCCGCGCCGGTATTCCAGATGGTATAACCGCCCGGTGTTTTAGCCGTCG
+CGCTGTCGGCGCGTTTCTGCCCGGTATAGTGCCCAGAAACATAGAATGACCAGTCTTCCA
+GCGCCAGCGGTTTCCAGTCCAGCGTACCGTTAGCAGTATGGAACGGCAGATCGGATAGCG
+GTTTGTTTTCGCCGTTGCTGACATCACGACCATCGTTGTAGGTGTAGTTGATCGACAGTT
+TCCATTCATCGTTGAACGGAATTTTCAGTTCGGTTTCCACGCCCTGAATACGAGCTTTGT
+TAACGTTGTAGTAGCTAAATACCGGTATGCGCCGTCCGTTAGCGCCCGTCTCAAAACCAA
+CAAAGTTTTGGTAGCCCGGTGCAGCGTTGACGTCAGACGTACGGCTGATGCTGATACGAT
+CTTTCACATCGTTACGGAAAACGGTAACGCTGGATTCAACCCCTTCCAGCCAGCCTTCTT
+CACCCATGTAGTAAAGCCCCAGCTCCCAACTTTCGCTGGTTTCTGGTTTCAGATCCGGGC
+TACCCACAATCTTACATGCGCCACGGCAGGAATTGCTCGTCCAGTCAGGGCTAAGTTGCA
+ACAGAGAAGGTGCTTTAAATGCCGTCGCCCAGCCCCCTTTCACCGTTACGGTGTCGGTGG
+CGTTATAAACCAGGTAGGCACGCGGACTCCAGTGTTCACCGTAGGTTTCGTGATCGTCCA
+TACGCACGCCGGTCGTCAGCGCCAGCGGCTCGAAGATCCGCCATTCATCTTCCACAAACA
+GCGCGTACTGGCTGGCAGACGTTTTGGAGCTGGTTCCCCCGGTCAGGTTCACCGCATCGC
+TAAGTTTGTCGTGACGCCATTCACCGCCAACCGTGAGAAACTGATTAATCGCCGTCAGCG
+GCAACGTGTATTTGCCGTCGACCGTATTGCTTTCGGAAGTTATCGGGCTGCTGTTGCCAG
+GGTTTTTGTTCTCGACTTTCTCACCGTAGTATTTCAGTTCGCTGGTGCCGTAATCCCAAC
+GCCCATTATGGCTGACGGAGTAGTTCTGGCGTTCCAGGCGGTTTTTGTCCAGCGAGTCGG
+AATCACGATCCTGACGGTCGAAACCGTATCCGGCAGTAAAATCGTGATTTTGATTCGGTG
+TCCAGGCAAATTCGACATTGCCGTCGCGGCTGGAGAATCCTTCAATACGCGGCGTTTCTC
+CGGTATCGGTGGTCGTTGAGTTTTGCGGGTCATCCTTTTCACGTTTTGCCAGGCTGCCGT
+AAGCTTTCATTCCCAGCACACCATCAATTAATGGTCCACTGGTAAAGAACTGACCGTTAT
+AGGTGTCACCGCGATCGCGATGTTCCTGAATGGTGGTATCGACGGTAACGGTACCCGACC
+ATTTCTGACCGATTTTTTTGGTGATGATATTCACTACACCGCCGAGCGCATCGGAACCGT
+ACAGCGACGACATCGGGCCACGGACCACTTCAATACGTTCGATGGAATCGACCGGGATCC
+AGTTCAGATCGAAATCATTGTGGCGGAAGACGGCATTGCGGGAGTTCACGCGTTTACCGT
+CGACGAGAATCAGGGTATAGCTGCTGTCCAGACCACGAATACTAACGCCCTTACGGTTAT
+CCCCTTCGTTCGTCAGTTGTACGCCAGGCACTTCTTTGAGGACATCCTTCAGATTCTGTA
+CCGGTTTTCGCTGCAGGTCTTCCTGGGTAATGACGCTGATACTGGCAGGTGCATCTTTAA
+GATTTTGTTCCACGGAAGATGCAGTGACAACCATCGTTTCGCCATCATCATCGACCGCTA
+ACACAGGCCATGCACAAGAAATAGCGGACAAACACAGCCCGACCCGTACGAAAGGGTTCA
+ACCTAAACATTCCATATCTCCATGAGGTAACTACGAAAATAAAATGGGTTATCGCTCACA
+TCTTCTTCACGTCCCCTTGCGTACGGCAGCATCGCGGTGGACTTATTTTTTATGCAGGTG
+ATCATCCCAGAAAGCCGGAACAGCCTCTGATTTGTCAGCCTTTTTTGATTGCGGCGTAAC
+GATAATGCAAACGATAACAATTATCAATCCAAATGTTAAATTTTATATCCGCATGATTTG
+TCAGGGAAATGGAATTGAAAAAGCCCTCTCGGTTGAGAGGGCTTAGCAAGGAAGGGAGGA
+AACTTATTTCTTATCGTTCTGCGGGAACTTCATTTCGCTGTAGCGTACGAAGTGAGTTCC
+TTTnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
+nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnTTCCTGCCTTTTAATCA
+GTTGTGATGACGCACAGCGCGCAGAAACTCGTGGCGCGTATTCTGACTGGATTTGAACAA
+TCCACCAAGAGAGGTCGTTGTCGTGGCACTGGTTGCATCGCGGATGCCACGCGCCTTCAC
+GCAGTAATGCACCGCGTCGATCGAGACAGCCACGTTATTGGTGCCCAGCAGCGTTTGTAG
+CGCAATAAGAATTTGCTGCGTCAGACGTTCCTGCACCTGCGGACGCTGGGCAAAGAACTG
+CACAATGCGGTTAATTTTTGACAGACCGATCACCGAATCTTTCGGGATATAGGCCACCGT
+CGCTTTGCCATCGATGGTAACAAAATGGTGTTCACAGGTGCTGGTCAGAGTGATATCGCG
+CACGGTGACCATTTCATCGACCTTCATTTTGTTTTCAATGAGGGTGATTTTCGGGAAATT
+GGCGTAATCCAGACCGGAGAAAATTTCATCGACATACATTTTAGCGATGCGATGCGGCGT
+TTCCATCAAACTGTCATCAGCCAGGTCGAGATTCAGCAGCTGCATGATTTCGGTCATATG
+ACCAGCAATAAGGCTTTTGCGCGTTTCGTTATCCATTTCATGCACGGGCGGGCGCAGCGG
+TGTTTCCAGTCCTCGCGCAACTAACGCTTCATGAACCAGGGCCGCTTCTTTACTGAGTGA
+TGGCATTTATGATTTCTCCTGCAGGTGTGACGCCTCCGCCCTGCGTGGGGGCAAAGTTAT
+TAAGCTGATTTACAGCCTGATTATTGTGCGTGAGGCGGCGCACATAATCCAGTATTCACA
+GCGATAATTATTGTAATTGCCGCTGCCTTTCATCAGCAGATGTTAAAACATCGTTATGCA
+AATACGGAAGTGAAAGTTACTCACAGCACATTGAATAAACGGTATGATGAAGAAATTGCA
+AACAACACAACAAGGAGCCACGCATGGAAATGCTCGAAGAGCACCGCTGTTTTGAAGGCT
+GGCAGCAACGCTGGCGACACGACTCCAGTACCTTAAACTGCCCGATGACGTTCAGTATCT
+TTCTCCCTCCACCTCGTGATCACACTCCGCCACCAGTGCTGTACTGGCTTTCCGGATTAA
+CCTGCAATGACGAGAACTTCACCACCAAGGCGGGTGCCCAGCGGGTAGCGGCGGAACTGG
+GGATTGTACTGGTGATGCCAGACACCAGCCCGCGCGGCGAAAAGGTTGCCAACGACGATG
+GCTACGATTTAGGCCAGGGCGCAGGCTTTTATCTTAATGCCACGCAACCGCCGTGGGCGA
+CGCATTACCGGATGTATGATTATCTGCGCGATGAATTACCGGCGCTGGTTCAGTCGCAAT
+TTAATGTCAGCGACCGCTGCGCCATTAGCGGTCACTCAATGGGTGGTCACGGTGCGCTGA
+TTATGGCGCTGAAAAATCCGGGTAAATACACCAGCGTTTCGGCCTTTGCGCCAATTGTGA
+ATCCGTGCAGCGTCCCGTGGGGAATCAAAGCGTTTAGCAGCTATTTAGGTGAGGACAAAA
+ATGCATGGCTGGAATGGGACAGTTGCGCACTGATGTATGCCAGTAACGCGCAGGATGCGA
+TCCCGACGCTTATCGATCAGGGCGATAATGATCAGTTTCTTGCCGACCAGTTGCAACCTG
+CGGTACTGGCAGAAGCCGCGCGCCAGAAAGCGTGGCCGATGACGCTGCGTATTCAGCCGG
+GATATGATCACAGTTACTACTTCATCGCCTCTTTTATAGAGGATCACCTGCGCTTCCATG
+CGCAGTATTTACTGAAGTGAAAGTCCGCCCGGTTCGCCGGGCATCTTCTCATCAGAAGCG
+ATAATCCACTGCCATAAAGTAACGACGTCCGTCTTCGTTATAGCTGTAGTCGTCACGACT
+GAGATCCTTGTCGCCAAGGTTCAGCACGCCTGCGCGCAGTTTGACGTCTTTAGTCACCTG
+CCAGGCCGCGCCGGTATTCCAGATGGTATAACCGCCCGGTGTTTTAGCCGTCGCGCTGTC
+GGCGCGTTTCTGCCCGGTATAGTGCCCAGAAACATAGAATGACCAGTCTTCCAGCGCCAG
+CGGTTTCCAGTCCAGCGTACCGTTAGCAGTATGGAACGGCAGATCGGATAGCGGTTTGTT
+TTCGCCGTTGCTGACATCACGACCATCGTTGTAGGTGTAGTTGATCGACAGTTTCCATTC
+ATCGTTGAACGGAATTTTCAGTTCGGTTTCCACGCCCTGAATACGAGCTTTGTTAACGTT
+GTAGTAGCTAAATACCGGTATGCGCCGTCCGTTAGCGCCCGTCTCAAAACCAACAAAGTT
+TTGGTAGCCCGGTGCAGCGTTGACGTCAGACGTACGGCTGATGCTGATACGATCTTTCAC
+ATCGTTACGGAAAACGGTAACGCTGGATTCAACCCCTTCCAGCCAGCCTTCTTCACCCAT
+GTAGTAAAGCCCCAGCTCCCAACTTTCGCTGGTTTCTGGTTTCAGATCCGGGCTACCCAC
+AATCTTACATGCGCCACGGCAGGAATTGCTCGTCCAGTCAGGGCTAAGTTGCAACAGAGA
+AGGTGCTTTAAATGCCGTCGCCCAGCCCCCTTTCACCGTTACGGTGTCGGTGGCGTTATA
+AACCAGGTAGGCACGCGGACTCCAGTGTTCACCGTAGGTTTCGTGATCGTCCATACGCAC
+GCCGGTCGTCAGCGCCAGCGGCTCGAAGATCCGCCATTCATCTTCCACAAACAGCGCGTA
+CTGGCTGGCAGACGTTTTGGAGCTGGTTCCCCCGGTCAGGTTCACCGCATCGCTAAGTTT
+GTCGTGACGCCATTCACCGCCAACCGTGAGAAACTGATTAATCGCCGTCAGCGGCAACGT
+GTATTTGCCGTCGACCGTATTGCTTTCGGAAGTTATCGGGCTGCTGTTGCCAGGGTTTTT
+GTTCTCGACTTTCTCACCGTAGTATTTCAGTTCGCTGGTGCCGTAATCCCAACGCCCATT
+ATGGCTGACGGAGTAGTTCTGGCGTTCCAGGCGGTTTTTGTCCAGCGAGTCGGAATCACG
+ATCCTGACGGTCGAAACCGTATCCGGCAGTAAAATCGTGATTTTGATTCGGTGTCCAGGC
+AAATTCGACATTGCCGTCGCGGCTGGAGAATCCTTCAATACGCGGCGTTTCTCCGGTATC
+GGTGGTCGTTGAGTTTTGCGGGTCATCCTTTTCACGTTTTGCCAGGCTGCCGTAAGCTTT
+CATTCCCAGCACACCATCAATTAATGGTCCACTGGTAAAGAACTGACCGTTATAGGTGTC
+ACCGCGATCGCGATGTTCCTGAATGGTGGTATCGACGGTAACGGTACCCGACCATTTCTG
+ACCGATTTTTTTGGTGATGATATTCACTACACCGCCGAGCGCATCGGAACCGTACAGCGA
+CGACATCGGGCCACGGACCACTTCAATACGTTCGATGGAATCGACCGGGATCCAGTTCAG
+ATCGAAATCATTGTGGCGGAAGACGGCATTGCGGGAGTTCACGCGTTTACCGTCGACGAG
+AATCAGGGTATAGCTGCTGTCCAGACCACGAATACTAACGCCCTTACGGTTATCCCCTTC
+GTTCGTCAGTTGTACGCCAGGCACTTCTTTGAGGACATCCTTCAGATTCTGTACCGGTTT
+TCGCTGCAGGTCTTCCTGGGTAATGACGCTGATACTGGCAGGTGCATCTTTAAGATTTTG
+TTCCACGGAAGATGCAGTGACAACCATCGTTTCGCCATCATCATCGACCGCTAACACAGG
+CCATGCACAAGAAATAGCGGACAAACACAGCCCGACCCGTACGAAAGGGTTCAACCTAAA
+CATTCCATATCTCCATGAGGTAACTACGAAAATAAAATGGGTTATCGCTCACATCTTCTT
+CACGTCCCCTTGCGTACGGCAGCATCGCGGTGGACTTATTTTTTATGCAGGTGATCATCC
+CAGAAAGCCGGAACAGCCTCTGATTTGTCAGCCTTTTTTGATTGCGGCGTAACGATAATG
+CAAACGATAACAATTATCAATCCAAATGTTAAATTTTATATCCGCATGATTTGTCAGGGA
+AATGGAATTGAAAAAGCCCTCTCGGTTGAGAGGGCTTAGCAAGGAAGGGAGGAAACTTAT
+TTCTTATCGTTCTGCGGGAACTTCATTTCGCTGTAGCGTACGAAGTGAGTTCCTTTAATC
+AGCTTGTAGCCGAACCAAATAATCAGGAACAGCGGGATACCAATATACGTTGCCGCTACG
+CCGCCCCAGTCAATAGTATCTTTCAGGAACGCTTCGTAGTTCTGGCCCAAAGTGATAATC
+AGACACAGAATGAATGCGAAGATCGGCCCCAGTGGGAAGAAACCTGAACGGTACGGCAGA
+TCGTTAATGTCGTGTCCCTGCAATACGTAACCGCGACGGAAGCGATAGTGGCTAATGGCA
+ATCCCCAGCCAGGCGATAAAACCCGTCATCCCGGAGGTGTTCAGCAGCCACAGGTATACC
+GTCTGGTTGCCAAACATGGAGGTCAGGAAGCACAGACCGGCAATCACCGTCGTCGCATAC
+AGCGCATTACGCGGCACGCCACCACGCGACAGTTTAGCGAAAATGCGCGGCGCTTTACCG
+TCACACGCCAGGGTGTACAGCATACGAGTAGACGCATACATACCGGAGTTACCCGCTGAC
+AGCACCGCCGTCAGAATAACTGCGTTCATCACCGCCGCCGCAGAGAGCAGACCCGCGTGC
+TGGAACACCAGGGTGAACGGACTAACGCTGATGTCTTTAACATCGTTACGCAGCAGGCTC
+GGATCGGTGTACGGAATAATCAGGCTGATAATCAGGATCGCGAACACATAGAACAACAGG
+ATTCGCCAGAACACCTGACGTACCGCGCGTGGAATGTTTTTCGCCGGATCTTCGGACTCG
+CCTGCAGCAATACCGATCAGCTCGGTTCCCTGGAAAGAGAAGCCGACAATCATAGCTACG
+CCGATCATCGCCGCAAAACCACCAGCAAACGGCGCTTCGCCGATTGTCCAGTTGCTCCAG
+CCCGCAGGCTGCGCGCCTTTGAAGATACCGATAATCATCAGCACGCCAACGATGATAAAG
+ACAATAACTGTCGTGACTTTGATCAGTGAGAACCAGTATTCCGCTTCACCAAAGCCACGA
+ACTGAGATGTAGTTCAGCAGGAAGATAACGCCGAGGAACAACGCACTCCAGATCCAGCCC
+GGTGTATCCGGGAACCACCAGCTCATGACCAGCTGAGCTGCAACCAGGTCAACGGCGATA
+GTCACCGCCCAGTTGTACCAGTAGTTCCAGCCCAGCGCGAAGCCAAAGCCTTCTTCAACA
+TAGTTCTGACCGTAAGTGGCAAACGAACCGGAAACCGGCATATATGCAGCCAGTTCACCG
+AGACTGGTCATCAGGAAGTAAACCATCAGGCCAATCAGCATATACGAGAGCAATGCCCCG
+CCCGGACCTGCCTGAGAAATCGTTGCGCCAGAGGCAACAAAAAGACCTGTACCGATGGAA
+CCGCCAATGGCAATCATCGTCAGGTGACGCGCCTTTAATTCACGGCGTAAGCCCGGCGCT
+TCTGTGGTTTTAGTTTCGGAAACCATACAAAAATGCTATCCATCTTAAAAATGAGGCGCG
+ATTGTAGCAGACGATTGGCAATCCTTCCGGCAGAAATACACGGTTATAAGACACCTTCAT
+GATCGCCCAGGGATTATAAGTAAAGCAGCCAATCTCTTTTCTGGCGAATGCATGCTGAAG
+GCGCTGCGTCACGAAATCGACACAGCACCAGCATGTTCTTGTACAGCAACTTAACGCGGC
+ACATTTGCGGGATCGCAATAGTCCAGAAAGCGCCGTAGCGCGTTGGAAAGGTGTTTTTGC
+CGATGATGTATACGCCACAACGTACGCATCAGGCGCGGCAGAGGGACCGCAACTTCACTT
+AATGTGCCTGCCTGCAATTGATCTTCAATCACACGTCGCGACAGGCAACTAATTCCCAAC
+CCATGACGCACCGCATGTTTGATTGCCTCGGAGTTACCTAATTCCATCGCCATCTCAAAC
+TTCGGTAAATGTGACAGCAACAGATAATCGACAATCTCCCGCGTGCCGGAACCGCGTTCA
+CGCAGGATCCACGGCGCAGCGGCCAGCTGTTCTAAGGTGACCGGACCACGGGCCAACGGC
+GAAGTCGGCGCGGCGAAAACCACCAGCTCGTCTTCCAGCCACGGTTCAGAAATGATTTCA
+GTGCTGTGGCACGGTCCTTCAATAAAGCCAATATCAACGCGGAAATCCAGCACCGCTTGC
+ATCACGTCCTGGCTATTCCCAACGCTAAGTTCAATCGGCAACTGCGGATAATCATGGCGA
+TAACGGGCGATAACTGCAGGCAGAATGTAGTTACCGATGGTACTACTGGCATAGATACGA
+ATCGCGCCGTTGTCTTCGCGAAACAGTTGTTCGATTTCAACCGCCTGTTCAAGCAATGCC
+AACGCACGCGGATAGAGCAGCCGCCCGTGTTCATTAACAACCAGTCTTTTCCCCACGCGA
+TCAAACAGTTGCACGCCAAGCTGCCCTTCCAGGTCGGTCAAGGCTGCGCTCACTGCTGAT
+TGCGACAACGCCAGCATCACCGACGCCTGGGTGGTTGATCCACTTTTCAATACTTCTGCA
+AAAACTTCCAACTGCCGGAGGGTGATGTGCATAGTCGCTTACCACTTATAAAGATTAATT
+ATAAATATATAATCAATTTTATTTTTAAACCAGTTAGTCGTAACCTTATGCCCGGTTAAA
+GGAGAGGGTTATGACGAATATCACCTTACAGAAACAACATCGTACACTGTGGCATTTTAT
+TCCGGGGTTAGCCCTGAGTGCAGTTATCACCGGGGTCGCCCTGTGGGGTGGTTCCATTCC
+CGCGGTTGCGGGTGCCGGGTTTAGTGCCCTCACCCTCGCAATCTTGTTGGGGATGGTTTT
+AGGCAACACCATCTATCCGCACATCTGGAAAAGCTGTGACGGTGGTGTGCTGTTTGCCAA
+GCAATATTTATTACGTCTGGGTATCATTCTTTATGGCTTCCGTCTGACGTTCTCGCAAAT
+TGCCGATGTCGGTATCAGTGGGATCATCATTGACGTGTTGACGCTGTCCAGTACCTTCCT
+GCTGGCTTGCTTCCTGGGGCAGAAAGTGTTTGGTCTGGATAAGCACACCAGCTGGTTGAT
+CGGTGCCGGTAGCAGTATCTGTGGTGCTGCCGCGGTACTGGCGACTGAGCCGGTAGTGAA
+AGCGGAAGCCAGTAAAGTAACCGTGGCTGTTGCAACCGTTGTTATCTTCGGGACCGTCGC
+GATTTTCCTCTACCCGGCGATATATCCGCTGATGTCTCAATGGTTTAGTCCGGAAACTTT
+CGGTATCTACATTGGTTCTACTGTGCACGAAGTGGCGCAGGTGGTGGCGGCAGGTCATGC
+CATCAGCCCGGATGCGGAAAACGCAGCAGTTATTTCCAAAATGCTGCGCGTGATGATGCT
+GGCTCCGTTCCTCATCCTGCTGGCGGCGCGTGTTAAACAGCTGTCTGGGGCGAACAGCGG
+CGAGAAAAGCAAAATCACTATTCCGTGGTTTGCCATCTTGTTCATCGTAGTTGCCATCTT
+TAACTCGTTCCACCTGTTACCGCAGAGCGTGGTGAACATGCTGGTAACGCTGGATACCTT
+CCTGCTGGCAATGGCGATGGCGGCGCTGGGTCTGACCACTCACGTCAGCGCGCTGAAAAA
+AGCTGGGGCGAAACCTCTGCTGATGGCACTGGTACTGTTTGCCTGGCTGATTGTTGGTGG
+TGGTGCGATTAACTATGTGATTCAAAGCGTCATCGCATAAACCACTACATCTTGCTCCTG
+TTAACCCGCTATCATTACCGTTTTCCTCCAGCGGGTTTAACAGGAGTCCTCGCATGAAAT
+ACATTGGAGCGCACGTTAGTGCTGCTGGCGGTCTGGCAAATGCCGCAATTCGCGCCGCCG
+AAATCGACGCAACCGCGTTTGCCTTGTTCACCAAAAACCAACGTCAGTGGCGTGCCGCAC
+CGCTCACGACGCAAACCATCGATGAATTCAAAGCCGCCTGTGAAAAATATCACTACACAT
+CGGCGCAAATTCTTCCCCACGACAGTTATCTGATTAACCTCGGACATCCGGTCACTGAAG
+CTCTGGAAAAATCGCGCGATGCCTTTATAGATGAAATGCAGCGTTGCGAACAGCTGGGGC
+TTTCTTTGCTCAACTTCCACCCTGGCAGCCATCTGATGCAGATTTCAGAAGAGGATTGCC
+TTGCGCGTATTGCCGAATCCATCAACATTGCGCTGGATAAAACTCAAGGTGTGACAGCGG
+TGATAGAAAACACCGCCGGTCAGGGCAGTAACTTAGGGTTTAAATTCGAACATCTCGCGG
+CGATTATCGACGGCGTGGAAGATAAATCCCGCGTCGGCGTCTGCATTGATACCTGCCATG
+CTTTCGCTGCCGGGTATGATTTGCGTACTCCAGCCGAATGCGAGAAAACATTCGCGGATT
+TTGCCCGTACTGTCGGCTTTAAGTATCTGCGCGGGATGCACCTTAACGATGCGAAAAGCA
+CCTTTGGCAGCCGCGTTGACCGCCATCATAGCCTCGGTGAAGGCAATATCGGTCATGATG
+CGTTCCGCTGGATCATGCAGGACGACCGTTTCGACGGCATTCCGCTGATCCTCGAAACCA
+TCAACCCGGATATCTGGGCAGAAGAGATCGCCTGGCTGAAAGCGCAACAAACTGAAAAAG
+CGGTAGCCTGAAGATGAATAACCGGGAAAAGGAGATCCTTGCAATTTTACGGCGTAACCC
+GCTGATTCAGCAGAACGAAATTGCGGACATGCTGCAAATCAGCCGTTCGCGCGTTGCGGC
+GCATATTATGGATTTAATGCGCAAAGGCCGGATTAAAGGCAAAGGTTACATTCTCACCGA
+GCAGGAATACTGCGTAGTGGTGGGGACAATCAATATGGATATTCGCGGGATGGCGGATAT
+CCGTTACCCGCAATCGGCTTCTCATCCCGGTACAATTCATTGCTCAGCGGGCGGCGTGGG
+ACGCAACATCGCCCACAATCTGGCGCTGTTAGGCCGTGACGTCCATTTGCTTTCAGTGAT
+TGGCGATGACTTTTATGGCGAAATGCTCCTGGAAGAAACGCGCCGTGCCGGCGTGAATGT
+CTCCGGCTGCGTTCGTTTGCATGGTCAAAGCACATCGACGTATCTGGCAATTGCCAATCG
+AGACGATCAAACCGTGCTGGCGATTAACGATACCCATCTGCTGGAACAGTTGACACCGCA
+ACTACTGAACGGGTCGCGCGATTTACTTCGTCATGCGGGCGTGGTACTGGCTGATTGCAA
+CCTGACAGCCGAGGCGCTGGAATGGGTCTTTACCCTCGCTGATGAAATCCCGGTGTTTGT
+CGATACCGTTTCAGAATTCAAAGCGGGCAAAATCAAACACTGGCTGGCGCATATTCACAC
+CCTGAAACCCACTTTACCGGAGCTGGAAATTTTATGGGGACAGGCGATCACCAGCGATGC
+TGACCGTAATACCGCAGTGAATGCATTGCATCAGCAAGGTGTTCAGCAACTGTTTGTTTA
+TTTGCCCGATGAGTCAGTTTATTGCAGCGAAAAGGATGGAGAACAATTTTTGCTGACCGC
+GCCAGCGCATACGACAGTAGACAGTTTTGGTGCTGACGATGGTTTTATGGCGGGCCTGGT
+ATATAGCTTTCTTGAAGGATACAGTTTCCGCGACAGCGCCCGTTTTGCGGTAGCCTGCGC
+GGCAATTTCGCGCGCCAGCGGCAGCTTAAACAACCCTACCCTGTCTGCCGATAACGCGCT
+TTCATTAGTGCCAATGGTGTAACAATGTTGCCGGATGCGACGCTTAACGCGTCTTATCCG
+GCCTACAAATCAGGCAATTTCAGCAAGTAAATGTAGGCCTGATAAGCTTGCGCATCAGGC
+AATGACACTCAAGCTAAACCAATAAAGAACCCGGCAATGGTCGCACTCATCAAGTTGGAA
+AGCGTCGCCGCCGCCAGCGCCCGTAAACCAAGCTGGGCGATTTCCGGCGCACGGTGTGGC
+GCAACCGCAGAAAACGCCCCCACCACCACCCCGATAGAACCAAAGTTAGCGAAACCGCAC
+AACGCGAAGGAAATAATCGCCACAGTTTTAGCATCGAGAGTGCCAGCCGTTTGCAGATAG
+GGTGAGAAATTGAGATAAGCGACAAATTCATTTATTGCCAGTTTCTGTCCAATCAAACTC
+CCGGCAAGATTCGCATCACTCCAGTCCACACCCATCACCCACGCCAGTGGAGCCAGCAGG
+TAACCTAAAATGGACTCCAGCGAGGCATGTTCAAAACCAAACCAGCCACCAACGCCGCCG
+ATAATACCGTTAATCAACGCAATTATTGCAACAAATGCCATCACCACTGTTGCCACACCT
+GCGGCGATTTTCAGCCCGGTCATTGCCCCTGTCGCAGCGGCTTCAATAATGCTTTTTGGC
+GGTGTTTCGGTGAAAGAGAGGTTATTAAAGGAAACCTGCGAAGATTCCGTTGCCGGGCTT
+AACAGGCGGGCAAACAAGATCCCGCCAGGGATCGCCATTAATGATGCCGCCAGCAGATAT
+TCCACAGGCACGCCCAGTGCGGCGTAACCAATCATTGTCGAACCAGCAATCGAGGCCATG
+CCACTACAAATCGCTGTAAATAATTCATTGCGATTCAGACGATCGATAAAGGGTTTGACG
+ATTGCCGGAATTTCGTTTTGCCCGAGGAAAATGGTGGTGACCGCGACGAATGACTCGATC
+TTGCTGATATTTAATGCTTTCTGGAAGATACCGCCGAGAATTCGAATTAAAATCCCCATC
+ACACCGATGTAGTAGAGAATACTCACCAGCGCGGTGACGAAGATAATTGCCGGTAACACC
+CTGAAACCAAAGATAAATCCTGCACCATCAAATAAGGTATCCATTTTCGGTCCGACCAGA
+GAACCGAAGATAAATGCGCTACCCGCGTCGCTGTACGCCATCACTTTATGCACGCCAAAA
+GCGACTTTTTCAGCGACCCAACGCCCTGGCGGTAACCAAAGCATAATGCCGCCAATCACG
+ACCTGTAACACTAACGCCGCGCCAACGGTACGCAGGCTGATCTTCTTCTTGTTTACTGAC
+AGTAAAAACGCAATCGTCAGCAATACCACCATTCCCAGAACACTTCTCATGACATCCATA
+GTGATTATCTCTTCATGTCATATTGGGCGACGGCTTTCTGCCCATCAGAAATAGCCAGGC
+CTGCATCTTGCGATACCGGCCCGGCTTGTTATCAACACTTAATGGGTTTTGATGTAGCCG
+CGCACGCACTCTTCGACTAATCCCCAGAACCAGTCTGTATCAATAGTGATGCCGACTTTG
+GTATTGGCGGGCTTGCCAAGAACGCCCAGCTCGTCGCAGACGGTACGCCCATAGCAAGGG
+CCACTGTTGACGTCCACTTCGACGTACATCTCCTGGGTTTTAATGCCATCAGGGTTAATC
+AGATAACCGATGCAGGTGGCGTCGTGCACCGGGCCGCCAGCAAGGCCGTAGTTTTCGAAC
+TGCGTTTTGAGAGTGAAGTTCATGATGTCGCTGAACAGCTCTCCGGCGGGGCCGCCTGCC
+CTTTCCATCCGAGCAATCACGTCCGGGGTGCAAACGGTCTGGTTGGTGAGATCGAGGCCC
+ATCATCACTAATGGAACGCCGGAGGTGAACACTACGCGTGCGGCTTCCGGGTCGGCAAAG
+ATGTTGAACTCGGCAGATGGCGTGAAGTTGCCTGTACCGTAAGCGCCGCCCATTAGCACA
+ATTTCACGGATTTTGGGCAGGATCGCGGGTTGCATACGCATTGCCACCGCGATATTTGAA
+AGCGGACCAACCGGCACCAGAGTGATATCGCCATCGCTTGCCATCAGGGTATCAATGATA
+TATTTCACCGCATGAGTGCTTTCTGCCTGGCGGGTCAGCGGCTCGAATACCGGGCCATCC
+AGTCCGGTTTCACCGTGAATATTATCGGCAACGATTTGTTGACGCATAATGGGCTGCGGC
+ATCCCCGCATAAACCGGAACATTAATCTCCAGTTTCTGGCAAACATTCAGGCCATTAATT
+AATGTTTTATCAAGCGTCTGATTACCCGCTACAATAGTGATGCCTAATAAATCTATTGCC
+GGATGTTTCGCCGCCATCATTATAGCAATAGCATCATCATGACCCGGATCACAATCCAGA
+ATAATTTTTCTCTTTTCCATTGTTTATTTCCTCTGTTTCCAGTTGCGTTATTTTTTCTAC
+AGCAAAGAAAATTCGACCGGGCCGATGATTGAATCTTAACAACAGCGTACGTATGCTAAA
+TATGAGAAATCTCATAGCGGATAAACATCGTGAAAGAAATCCACAATAATGATCTTAAGC
+AGCAATTGATGAGTGAATCCGCGTTTAAGGATTGCTTTTTAACGGATGTTTCAGCCGATA
+CGCGGCTGTTTCATTTTTTAGCGCGTGACTACATTGTGCAGGAAGGGCAACAGCCGTCCT
+GGCTGTTTTACCTGACGCGAGGCCGCGCCAGGCTTTACGCCACGCTAGCTAATGGTCGCG
+TGTCGCTGATCGATTTCTTTGCCGCCCCCTGTTTTATTGGCGAGATTGAGTTAATCGATA
+AAGACCATGAACCGCGTGCGGTGCAGGCTATTGAAGAGTGTTGGTGCCTTGCGCTCCCTA
+TGAAACATTACCGTCCGCTGTTATTAAACGACACGCTATTTTTACGAAAACTCTGCGTCA
+CCTTAAGTCATAAAAATTATCGTAATATTGTTTCTTTAACTCAGAATCAATCATTTCCGT
+TAGTGAATCGCCTGGCAGCATTTATATTACTCTCGCAGGAAGGTGATCTTTATCACGAAA
+AGCATACGCAAGCGGCAGAGTATTTAGGCGTTTCTTATCGACATCTTTTATATGTTCTCG
+CGCAGTTCATTCACGACGGTTTATTAATTAAAAGCAAGAAAGGGTATCTCATTAAAAACA
+GAAAGCAGTTGTCAGGACTGGCGCTGGAGATGGACCCGGAGAATAAATTCTCCGGGATGA
+TGCAGTAAAAATTATTTTCAATAGCGCGATTGCCGGATGCAACGCTTAATACGTTTTATC
+CGGTCTACAAATCGAGCATTACGCCAGACCAATAAAGAACCCGGCAATAGTCGCACTCAT
+CAGGTTGGAAAGCGTTGCTGCTGCCAGCGCCCGTAAACCAAGCTGGGCGATTTCCGGCGC
+GCGTTTTGGCGAAATAGCCGAAAATGCGCCAACGACAACACCGATAGAACCAAAGTTAGC
+AAAACCACAAAGCGCAAAGGAGATAATCGCAATGGTTTTCACTTCCAGCGTGCCGCCCGT
+TTGCAGGTATGGGGAGAAACTCAGGTAAGCGACGAATTCGTTAATCGCCAGTTTCTGCCC
+AATCAGGCTACCCGCAAGATTGGCATCACTCCAGTCCACACCCATGATCCACGCCAGCGG
+TGCCAGCACATAGCCAAAAATACTTTCCAGAGAGGCATTGGCGAAACCAAACCAGCCGCC
+AATTCCGCCGATAATGCCGTTGATCAGCGCAATAATTGCGACAAACGCCATTACCACCGT
+CGCCACACCAGCGGCGATTTTTAGCCCGGTCATCGCACCGCTCGCCGCCGCTTCGATAAA
+GCTTTTTGGCGGCGTTTCGCTGAACGACAGATTTTCAAATGTGACCTGCGAAGGCTCGGT
+TGCCGGGCTAAGAATACGTGCAAACAAAATCCCGCCAGGGATCGCCATCAGCGATGCCGC
+TAACAGGTAGTCAATTGGTACGCCCATTCCGGCATAACCAATCATCATCGAACCAGCAAT
+GGACGCCATCCCGCTACAAATTGCGGTAAACAACTCGTTGCGATTCATGCGATCGATAAA
+CGGTTTAACGATCGCCGGGATCTCATTTTGCCCGAGGAAAATAGTAGTAACCGCAACAAA
+AGATTCGATTTTGCTGATGTTGAGGGCTTTCTGGAAAATGCTGCCAAGGATGCGAATCAG
+CAGCCCCATCACGCCAATGTAGTACAGCAGACTGATGAGCGCAGTAACGAAAATAATCGC
+CGGAAGTACGCGAAAGGCGAAGATAAAACCCGCACCGTCAAACAGGACATCCATTTTCGG
+CCCAACCAGCGAACCAAAAATGAAGGCGCTACCGGCATCACTGTAAGACATCACTTTATG
+AACGCCTAATGCCGCCTGTTCTACTGCCCATTTTCCCGGTGGGAAGTAGAGCATGATGCC
+ACCAATAGCGATTTGCAGCAGCAGTGCGGCTCCAACCGTGCGCAAACTGATGCTCTTTTT
+ATTCACTGACAACAGAAATGCTATTGCCAGTAACACCACCATCCCCACAACACTTCTCAT
+TATATCCATAATGATTTTCCCTTCATGCCGGTAAACCCGGCGTCAGCGCCAGGTTTTGGT
+ATGCTTGATGAGTACGGGCGACGGCTTTCTGCCCGTCAGAAATTAACCCGCGAGACGCTG
+ATATTCTTTGGCAATTTCGCTCGCCAGAATGGCGTTGTTGAACACCAGCTGGATGTTGGA
+TTTCAGGCTGTCACCGCCGGTCAGTTCAGCAACGCGCGCCAGCAGGAATGGCGTACTTTC
+TTTACCAATGACTCCCTGAGCTTCAGCTTCAGCTACCGCCTGATCGATCGCCGCATTGAT
+AGTGTGTTCCGGCATAGCAAACTGTTCCGGGATCGGGTTCGCTACCACGAGGCCACCGTT
+CAGACCGCTTTGCCATTTCACCACCATTGCACGGGCAATTTCGCTGGCGCTGTCGAGACG
+AATGCTGACGTCAAACGGGCTGGTGCGGCAGAAAAACGCAGGCAGCGCTTTAGTCTGATA
+GCCAATTAACGGCACACCGAAGGTTTCTAAATACTCAGTGGTTAATCCTAAATCGAGAAT
+AGATTTCGCCCCGGCACAAACAACGGTGACATTAGTATTTGCCAGTTCTTGCAAATCGGC
+AGAAATATCGAAGGTATGTTCCGCCCCGCGATGCACACCACCAATTCCCCCGGTGGCAAA
+TACTTTAATTCCGGCAAGCGCCGCAATAATCATCGTTGAAGCCACAGTGGTTGCGCCATT
+TTTTCCGGCGGCAACAACAAAAGGTAAATCGCGACGACTAACTTTGGTCACGTTATGCCC
+TTCACGACCCAGTAATTCAATTTCTTCTTTGCTTAACCCCACTTTCATCACGCCGCCAAT
+AATGGCGATCGTGGCAGGTACAGCGCCCTGTTTACGAATAGTTTCTTCAACTTCAATTGC
+GGTCTGGGCATTTTGTGGGAACGGCATCCCGTGAGAAATAATGGTCGATTCCAGCGCCAC
+AACCGGTTTTTTGTTTTTTAAAGCGTCCTGCACTTCCGGGGAAATTTGTAATAATTCAGG
+GGAAATTTTTAATTCAGACATTCTGCGTTCTCCACTAACGATATAACGTTGGCAATCGAT
+AAATCGGGGTTATTGGTGTATTCACAGGAGAGCGCCATTGACGAACATCCCTGTGCGAAA
+CGAACAGATTCGGCAAACGGCATTCCGTCTACCCAACACGAAGCAAGTCCCGCCATCATG
+GCATCGCCCGCTCCGGTAACATTAATAACATTGGTTTTGATCGGCGCAGACCAGCCACTT
+TCACCGCTGATATCGCTGTAATAAACGCCGTCGCCGCCCATGCTCAATACCAGTCGGTTC
+AGGCCATGTTGATGGAACCAGGCAGCAACTTTTGCCACATCTTCACGCCCTGACAGCGCA
+ATCCCACTCAGGGTTTCCGCTTCAAGGCGGTTTGGCTTGAGAGTGTGGATCTGATTTAGA
+CGGTCGCGCACTTTGACACATTTCCATGCCGAAACCGGATCGACAAATACGGGTACGTTG
+GCGGCATTATCCAGAATCCATGCCAGTGCCTCTTCACTGATATTACAGTCCGCGACAATG
+ACCTTTGCCCTCTGAATAAATTCACCGTGCTGTGCGAGATATTCAGCTGTAATAGCGTTG
+CTAATATTCATGTCATTTATAGCAACCAGCATTTCACCGGTATTATCGAGTAATGATAAA
+TAACTCGACGTATTTTCTCCCGGCACAATCAGGCATTTATCGACATAAACGCCAGATTGA
+TTGGTTTGCGTTAGCAGCGATTGACCATAAAAATCACTGCCTACGGCGCTCAGTAGCCAG
+GCTTTGTTACCCAGCAACGCCAGGTTTTGTGCAATATTGCGCCCTACTCCACCAGGCGTA
+AATTTTATTTTACCTGGATTTGAATCCGCATAATTTAATGATTCATGTGAATATCCGGCG
+ACATCAATATTCGCCGAACCTATAATTACGACATAATCCTTTTCGCGCATAGCACGTCCT
+CTGGTAAAAAATTACCAACCCTGTCAATCCACAAGAATATAGATACTGCAAAGACGGTTT
+AAACATGTGTTCATATTTAAACATGTGCTCATAGTATGCATGTTTTACGTAAAGTAAATT
+ACCGCCAGAGAGGCAAAATGGGCAGATTTGAGCAGGCTCACAAAATGCGATTAAATGCCT
+GAATTACAAAAGCGAGGAATTTGTGACGGGATGCACAGAACAGAACAATAAAAAAGGGCA
+GAAAATAATCTGCCCTTGAGGAAATAACCTGAGTGTTTGATGAACGTTTGAAGTTTCTAC
+TGAAAGATAAAACCATTTAAATTCATAAAATTACATTCACAAACCGGTCATTCTCTTTGC
+GCTCATCAAATGTTACAGGACAGGAAATTTCTGCCCTGTAACACACCTTTTATTACGCTG
+CTTTCGCTACTGCGTCCACTTCCGGACGTTTCAGGAAGGCATAGGCCAAACCCGCCACCA
+GCGTACCGGCAATAATTGCTACCAGGTAACCCAATACCGGCGTAATAGCGCCAGGGATCA
+GCAGAACAAACAGACCACCGTGCGGTGCCATCAGTTTCGCACCAATCGCCATTGAGATTG
+CGCCAGTCAGCGCCCCACCCACGATACAGCACGGCAGCACACGCATCGGATCACGAGCAG
+CAAACGGAATTGCACCTTCCGAAATGAAGCACAGTCCCAATACCAGAGCGGCTTTGCCAC
+CTTCCTGCTGCGCTTTGTCGAATTTGCGACGCGCCACCATTGTTGCCAGACCCATTGCCA
+GCGGTGGCACCATACCTGCCGCCATAATCGCCGCCATCGGGCCATAGGTTTGAGTACTCA
+GCAGACCCACACCGAATGCGTACGCTGCTTTGTTTACCGGACCGCCCATGTCAGTACACA
+TCATGCCACCGAGGATCGCCCCCAGCAGAACCGCATTCGCAGTCCCCATGGTCTGCAGCC
+AGTGAGTCAGCCCTTCGAGAATGCCAGCAACTGGTTTACCGATCAGGTAGATCATCGCCA
+GACCGACCACCAGACTGGAAATTAGCGGAATGATCAGGATCGGTTTCAGCGCCTCCATAC
+TCTGTGGCAGTTTCAATTGCGTACTGATTAACTTCGCAATGTAACCAGCCAGGAAGCCCG
+CAATAATACCACCAATGAAGCCAGAACCGGTGCTGACCGCCAGCATACCGCCAATCAGAC
+CCGGAGTGAGGCCCGGACGATCGGCAATGGAAAAGGCAATATAACCTGCCAGTACCGGCA
+CCATCAGCGCAAAGGCTGAACCACCACCAATCTGCATCAGCGCCGCAGCCAACGTACCCG
+GCTCTTTAAACGCTTCGATACCAAAAGCAAAAGAAAGCGCGATACACAGACCACCTGCAA
+CGACCATCGGCAGCATGTAAGAAACGCCCGTCAGCAAGTGACGGTATGCGCCTGCACTCT
+CTTTCTTACTTTCAGTGGTCGCCGTTTGAGCTTTGCCCGCCGGTTCATACGGCGTTGCTT
+CAGCAACCGCTTTATCCAGTTCCTGCGCGGTTTTCTTCAGCGCCAGACCGGTAGAGGTAC
+GATACATCGGTTTACCAGCAAATTTCGCCAGATCCACTTCGATATCTGCCGCCACAATCA
+CCAGATCCGCTGCTGCGACTTCTTCGGGAGTGATTGCATTACCCGCGCCAACAGAACCAC
+GGGTTTCAACTTTCACCCACCAGCCACGTTTTTTCGCTTCGGTTTCAATGGCTTCAGCCG
+CCATAAAGGTGTGTGCTACGCCAGTCGGGCAAGCAGTCACCGCAACTACGCGTTTCGGAC
+CGCTGGCGGCAACTGGTGCTGTCGCAGCGACCGGCGCAGTGTAAGGTTTCGCATGGCCTT
+TGGCTTCACTCAGGAACAGCTCAGGGTGCGCAACTGCCCGGGAAATATCGCCCAGCCAGA
+CATTTTTACCGTTCAGCGCGCTGTCGTTCGGGATGGAATCACCGAGAACAATCGCCATTT
+CAGCGTCGTTCGGATTGTCGATGATTTCCAGTTTTGCTTTTCGCGCCGCCGCGCCCAGCA
+GGGTCTTCGCCATATAGGCGCGTGCCTGACCGAGATTAGCGTCAATAATCAGCAGCGTTT
+TCATTATGCCTCTCCTGCTGTCAGTTAAAAGGTTGTAAGTCGACGCGCGCCATCATTGCG
+GCCAACTGCGGACGATCGGTAATACCCACATTGCTTTGACTTACCGCCAGGGCTGCAACA
+GCTGTCGCCAGACGCAGTGTGTGTTCACTGGATTCACGCATCAGCAAGCCATAAATCAGG
+CCACCAACCATAGAATCCCCTGCGCCAACGGTGCTTACGACATCGACTGACGGTGGTTTG
+GCGATCCATTCGCCGGAGGCATTAACCCAAAGCGCGCCTTCGGCACCCAGTGAAATAACA
+ACATGCGCGATGCCTTGTTCACGTAGCGCATGTGCAGCTTCAATCACATCTTTCATTTCA
+GGCAGTTTACGGCCTGCCCAGATTTCCAGCTCGCGGCGGTTAGGTTTCACCAGCCACGGT
+GCCGCTTTCAAACCTGCTACTAACGCTTCACGGCTACTATCAAAGATAATGCAAGGACAC
+TGACTACGCAGGCGAGTCATCCAGTCGGTGAACGCTTCCGGGCTGACGCCTGACGGTAAG
+CTTCCGCTGACACAGACCATATCGAACTGACCGAGCCAGCTCAGAGAATCAGTCACAAAG
+CGTTCCCAGTCGGCGGGGGTGACTTCAAAACCCGAGAAGTTGAAGTCGGTCACTTCGCCG
+TCTTTTTCCGTCAGCTTAACGTTAATTCGGGTGCGCCCCTGTACAACCTGGAAACGGTTG
+GCAATGCCCAGCTCGCTGAACAGTTGCTGAAAACCATCCTGATTGTCTTTACCCAGGAAG
+CCGCCAACGGTGACATCAATTCCCAGGTCTTTTAATACTTTGGCCACGTTGATGCCTTTA
+CCCGCCGCATGCAGACCGGTGGTTTTCACCAGGTTCACTTCGCCGCGTTCAATTTCCGGG
+CAGAAACCAACAAGGTCATAAGCCGGATTAAGGGTGATAGTAGCAACACGTCTGCTCATT
+ATGCGCCCTCCCCAAGACCAGCAGCGATAGCGTCGCCGATTGCTTTCAGCGCCTGTTCAG
+CATCTGCACCCTGGGCGGTAAAGCGTAGGCGATGACCTTTCTTAACGCCAAGTGCCACAA
+CTTTCATCAGACTACGTCCGTTTGCCGGTTTGCCGGTACCATCAAGGTTTGTCACGGTAA
+TATCACTGTTAAATTGTTTAATGGTATTGACCAGCATGGTACCTGGACGAGCATGCAGGC
+CGTGTTCATTGCGCACCACAAACTCCGCGCTTAACACGTCGTCGGTCGGCGCATCATCGC
+TGGTCAGCAGCGCCAGCAACGTTGCCGCATCCGCTTTCAGCAAGCGGTCAGCTTTATTGT
+CGAGCAATAAATCAGCGAGACGCTTAAGAACCGCGATGGGCTGATCGTCATTCATCGCCA
+CACTCACCAGCATGGCTGCCGTTTCGCCGTCCACATCAAAAGCATTTGCCGCACGGCTTA
+CCGCAATCGCGCTACGCAGATTGCCTTCGGCGCTATCGCTCAGCCAGATACCCTGTCCGA
+GATTCAGCGGTTGTTCATTGATGGCTTTGGTGACGAAAGTGGCGTCAACTGCCCCCGCCT
+CTTTCAGACGCGCAGCGTTCAGCGCCTGAAGAGTCAGCAGATCGCTGGCGACGATATCCA
+GTGTCAGCATTTCGTTGTCGAGCTTCAGCTGCTCACTCTGCTTTTCGCCCATCAGTAATG
+CGCGAAGTTCTTCTGCTGTTGTTGCTGACTTCAGTTGTTCAGCAACGGAATCATCGCTCA
+GTACGTGGGTCAGCTGGCGTAGCAGGCCCAGATGTTCATCCGAGCTGGCAGCAATACCGA
+TTGCCACGTACGCTACCTGACCGTCACCCCAGGTGACGCCTTCCGGGAACTGAAATACCT
+GAACGCCGGTTTTCAGCACCTGATCGCGGGTGTCGGTAGTGCCGTGTGGAATAGCAATAC
+CATTGCCGAGGAACGTTGAGGTTTGCTGTTCGCGCGCCAGCATGCCATTGACGTAGCCTT
+CTGCTACATTACCGGCCTGCACCAGCGCCGCAGCGACCTGGCGAATCGCCTCTTTTTGTC
+TCCGGCCTTTTCGCCCGGATGGATGTCCTGTACGGATAACTGGAACATAGTTCTCCTCTC
+TTGCTGAATTGAAACGATTCAGCCTCTATGAGAAAAAAAGCGCCAACCTGGCTTAGGGTT
+AAAGACAAGATCGCGCTGAAACGTTTCAAGAAAGCATAATACTTCTGTTTCAGCACGCAA
+GGAAAGCCGTAAAGTTATGAGCAAAAGTTTGATGTGCTGCACAATTTTTTGCCATTTTTC
+CTAATTGCTGATGGGAAAATCCGTTATCAGCAATTTCATTTCAGCAGCGTCAGCAGCCAA
+TCAGCAACAGTGAAATGGCATTTTGACTATTCGTGGCGCTTTTGATTTCGCTGTCTGTTT
+ATTTTCTGACAAGCAGCGTAAACTCCGCGTCTTCCTCTTCCAGTGATCGACCAGCATGCA
+TAACTCCCCCGCAGTCTCCAGCGCGAAATCGTTTGACCTGACCTCGACGGCGTTTTTAAT
+CGTTGCCTTTCTCACCGGTATTGCGGGCGCTCTGCAAACCCCGACACTCAGTATTTTTCT
+TACCGATGAAGTACATGCCCGTCCGGCGATGGTGGGATTCTTCTTTACCGGCAGCGCTGT
+CATTGGGATTCTGGTAAGTCAGTTTCTCGCCGGGCGCTCTGATAAGCGCGGCGATCGCAA
+ATCGCTGATTGTCTTTTGCTGCCTGTTAGGCGTGCTGGCCTGCACCCTTTTTGCCTGGAA
+TCGCAACTACTTTGTTTTGCTATTCGTTGGCGTCTTTCTTAGCAGCTTTGGCTCGACCGC
+TAACCCGCAAATGTTTGCCCTTGCCCGTGAACATGCCGACAAAACCGGACGTGAGGCGGT
+GATGTTCAGCTCTTTTTTACGCGCTCAGGTTTCACTGGCATGGGTCATTGGCCCACCGCT
+GGCTTATGCCTTAGCGATGGGTTTCAGCTTTACGGTAATGTATCTGAGCGCAGCGGTAGC
+GTTTATTGTTTGCGGTGTGATGGTGTGGCTGTTTTTACCGTCGATGCGAAAAGAGCTTCC
+GCTGGCGACCGGCACGATCGAAGCGCCGCGCCGTAACCGTCGCGATACGCTGCTGCTGTT
+TGTCATTTGTACATTGATGTGGGGCTCGAACAGCCTGTACATCATCAACATGCCGCTATT
+TATTATCAACGAACTGCATCTTCCCGAGAAACTGGCCGGTGTGATGATGGGGACCGCCGC
+CGGGCTGGAAATCCCGACGATGTTGATTGCCGGATATTTCGCCAAACGTCTGGGTAAGCG
+TTTCTTAATGCGCGTTGCTGCCGTGGGTGGCGTCTGTTTTTACGCAGGAATGCTGATGGC
+GCATTCACCTGTCATTCTGTTGGGCTTGCAGCTGCTAAATGCTATTTTTATTGGCATTCT
+GGGCGGCATCGGGATGCTCTATTTTCAGGATCTGATGCCCGGTCAGGCGGGTTCAGCCAC
+CACGCTCTATACCAACACTTCGCGCGTGGGCTGGATCATCGCAGGATCAGTGGCGGGCAT
+CGTCGCCGAGATCTGGAATTATCACGCTGTGTTCTGGTTTGCGATGGTGATGATTATCGC
+CACTCTGTTTTGCTTACTGCGGATTAAAGATGTTTAAGGCGCGGTCAGCATTTCCAGATC
+GATAAGCCAGGTCATGGCCTGCTGACGCGAGTTACCGCACATTTCAGCGCTGGCTTGTAA
+GCCTGCACAGACTTTCGGTCGCAGTGGCGAGGTGAAAATTTTACAGCGTTGCTGTTCATC
+AAGCTGAATGCAGGGCGTATTGGCGGGCTTGCCATCTGGCATACCGGGAATAGGGCTGGA
+AATTGAAGGGGCAGTGCAACACGCCCCGCAACCCGGACGGCATTCCATACGTTGTTCTCT
+TAAGGTTAACCACCGGATTGATGAGCGCGCACAGTACCACCTTTTTTGCACCAGCAAAAG
+TGCGAATACCACTTGCCCGAAAGGCCCGTCGCGAGTACTTTGTCGCGATATTTTTGACAT
+TTTCGACTACAGGAATTTTTCGATGCCAAGAGCGAACGAAATTAAAAAAGGTATGGTACT
+GAATTACAACGGCAAACTGCTGCTGGTTAAGGATATTGATATTCAGTCGCCCACTGCCCG
+CGGTGCCGCTACGCTGTACAAAATGCGTTTTTCTGATGTCCGTACCGGGCTGAAAGTAGA
+AGAGCGTTTCAAAGGTGATGATATCGTTGACACCGTGACGCTGACCCGCCGTTACGTTGA
+CTTCTCCTATGTCGATGGCAACGAATATGTCTTTATGGATAAAGAAGACTATACCCCGTA
+TACCTTCACCAAAGATCAGATTGAAGAAGAGTTGCTGTTTATGCCAGAGGGCGGCATGCC
+GGACATGCAGGTGCTGACCTGGGACGGTCAACTGCTGGCGCTTGAGCTGCCGCAGACCGT
+TGATCTGGAAATCGTTGAAACCGCACCAGGCATCAAAGGGGCATCTGCCAGCGCCCGTAA
+CAAACCGGCGACATTGAGCACTGGTCTGGTGATTCAGGTACCAGAATACTTAAGCCCGGG
+CGAAAAAATTCGTATCCATATCGAAGAACGCCGTTATATGGGGCGTGCTGACTAACTTCA
+GCCGCATGCAGAAAAGGGATAGCTCAGGCTGTCCCTTTTTTAATTTATTATACCAATCTT
+CTATTTTGCGCTTCCTGAACACCTTACGCCCTCAATTTTCACTCGTTGATTGATCGCCCT
+CACACTTCATCGCATTAACAATCCAGACCAATTTCAATTGCTGTCATATAACTTTACACT
+GTCGTTGTTAATTAATCGTTACTAAGACGTGACTCCTATGAATACAATCGCCTCCGTTAC
+GCTCCCGCATCATGTACACGCTCCACGCTATGATCGCCAGCAGTTGCAATCACGTATCGT
+TCATTTTGGCTTTGGAGCCTTTCACCGCGCTCATCAGGCGTTACTGACCGATCGTGTGCT
+GAATGCCCAGGGCGGCGACTGGGGGATCTGTGAAATCAGCTTGTTCAGCGGTGATCAACT
+GATGAGCCAGCTCCGCGCACAGAACCATTTATATACCGTGCTGGAGAAAGGTGCGGACGG
+CAATCAGGTGATAATTGTCGGTGCCGTTCACGAATGCCTTAATGCAAAACTGGATTCCTT
+AGCGGCAATTATTGAGAAATTTTGCGAGCCACAGGTGGCAATTGTTTCCCTGACGATTAC
+CGAAAAAGGCTATTGTATTGACCCGGCCACCGGTGCACTCGACACCAGTAATCCGCGGAT
+TATTCACGATCTACAAACCCCTGAAGAACCTCACTCCGCACCGGGTATTCTCGTCGAAGC
+ACTGAAACGCCGCCGTGAGCGCGGCCTTACACCGTTTACCGTGCTCTCCTGCGACAATAT
+TCCCGACAATGGTCATGTGGTGAAAAACGCGGTGCTGGGAATGGCAGAAAAACGTTCGCC
+AGAACTCGCCGGGTGGATAAAAGAGCACGTCAGTTTTCCGGGAACCATGGTCGACCGCAT
+TGTTCCGGCTGCAACCGACGAATCACTGGTGGAAATCAGCCAGCATCTGGGGGTGAATGA
+TCCCTGCGCGATTAGCTGCGAACCGTTTATCCAGTGGGTGGTGGAAGATAACTTCGTCGC
+TGGGCGTCCTGCCTGGGAAGTCGCAGGTGTACAAATGGTGAATGATGTCCTGCCATGGGA
+AGAGATGAAACTGCGGATGCTTAATGGCAGCCACTCTTTTCTCGCTTATCTGGGTTACCT
+CTCAGGATTCGCCCATATCAGTGATTGCATGCAGGATCGCGCATTTCGCCATGCCGCCAG
+AACATTAATGCTGGATGAGCAAGCGCCGACACTGCAAATTAAAGATGTCGATTTAACACA
+ATATGCGGATAAGTTAATTGCACGTTTTGCTAATCCGGCGCTGAAACATAAGACCTGGCA
+AATCGCGATGGATGGCAGCCAGAAATTACCGCAACGCATGCTGGCAGGTATTCGCATACA
+TCAGGGGCGCGAAACGGACTGGTCGTTGCTGGCATTAGGCGTTGCAGGCTGGATGCGTTA
+CGTCAGCGGCGTTGATGATGCCGGAAATGCCATTGATGTTCGCGATCCGCTTAGCGATAA
+AATTCGCGAACTTGTTGCGGGCAGCAGCAGTGAACAACGCGTAACCGCCCTGCTTTCCCT
+GCGTGAAGTTTTCGGTGATGATCTGCCAGATAACCCGCATTTTGTGCAGGCCATCGAACA
+AGCCTGGCAACAAATCGTACAATTCGGCGCACATCAGGCGCTATTAAACACCCTCAAAAT
+TTAACGATTTCTGCGGTTAAAGCGGATGAAGCTCACCTTCGTCCGCTCTCCCCTTCTCTT
+TTCTGCCTTTTTTAGCCAGGATTAACGCTCAGTTAACTTACCAGAGTATTGCGGAGCCGT
+TGTGACCAGGACCAACCTCATCACCGGTTTTCTCGGCAGCGGGAAAACCACGTCGATTCT
+TCATCTGTTAGCCCATAAAGATCCCAACGAAAAATGGGCGGTACTGGTTAATGAATTTGG
+GGAAGTCGGAATTGATGGTGCTTTGCTCGCCGATAGCGGCGCATTGCTGAAAGAGATCCC
+CGGCGGCTGCATGTGCTGCGTTAATGGTTTACCCATGCAGGTAGGGTTGAATACCTTACT
+GCGTCAGGGAAAACCAGACCGCTTGTTGATAGAGCCGACCGGGCTGGGCCATCCGAAACA
+GATCCTCGATCTGTTAACCGCACCAGTCTATGAACCGTGGATAGATCTGCGCGCCACCTT
+GTGCATTCTCGATCCGCGCTTGCTGCTGGACGAAAAAAGCGCCAGCAATGAAAACTTCCG
+TGACCAGCTGGCTGCCGCAGACATCATTGTCGCCAATAAATCCGACCGTACGACGCCCGA
+AAGTGAGCAAGCGCTACAGCGTTGGTGGCAGCAAAATGGTGGCGATCGACAATTAATTCA
+CAGTGAGCATGGGAAAGTTGACGGTCATCTTCTGGATTTGCCGCGTCGCAATTTAGCCGA
+GTTGCCCGCCAGCGCCGCGCATTCTCATCAGCATGTCGTGAAAAAAGGGTTAGCAGCGTT
+AAGCCTGCCAGAGCATCAACGCTGGCGTCGCAGTCTGAACAGCGGGCAAGGATATCAGGC
+CTGCGGCTGGATATTCGACGCTGATACGGTATTCGACACCATTGGCATTCTGGAATGGGC
+GCGACTTGCACCGGTGGAACGCGTCAAAGGCGTGCTGCGTATTCCCGAAGGGCTGGTGCG
+AATCAACCGTCAGGGCGATGACCTGCACATTGAAACGCAAAACGTTGCGCCACCGGACAG
+CCGTATTGAGCTGATTTCCAGCAGCGAAGCTGACTGGAATGCCTTGCAGAGCGCGCTGTT
+GAAGCTTCGTTTAGCGACTACCGCGTAAGGTTGCCTGCGTTTTTCAGTAAGATAATTAGA
+GAAAATATGATTAAAAATTTGCCGCAAATAGTGTTGTTGAATATTGTCGGCCTCGCGCTG
+TTTCTTTCCTGGTATATCCCCGTTAATCATGGATTCTGGTTGCCGATTGATGCGGATATT
+TTTTATTTCTTTAATCAGAAACTGGTCGAAAGTAAGGCCTTTTTGTGGCTGGTTGCATTG
+ACCAACAATCGCGCCTTCGACGGTTGTTCACTGCTGGCGATGGGTATGTTGATGCTGAGT
+TTCTGGCTGAAAGAAAACGCCCCTGGCAGACGACGTATCGTGATTATTGGTCTGGTCATG
+CTATTAACTGCAGTGGTATTAAACCAGCTGGGTCAGGCATTAATTCCTGTAAAACGGGCC
+AGCCCAACATTGACTTTTACCGATATTAACCGCGTCAGCGAACTGCTCTCTGTTCCCACG
+AAAGATGCCTCACGAGATAGCTTTCCCGGCGATCACGGCATGATGCTGCTTATTTTTTCG
+GCATTCATGTGGCGTTATTTCGGCAAAGTTGCAGGCCTTATCGCCCTTATTATTTTTGTG
+GTTTTTGCATTTCCCAGAGTAATGATTGGCGCACACTGGTTTACTGACATCATTGTCGGT
+TCGATGACCGTGATATTGATCGGTTTGCCCTGGGTGTTGCTGACGCCATTAAGTGATCGA
+TTAATCACCTTTTTTGACAAATCACTACCAGGAAAAAACAAACATTTCCAAAACAAATAA
+CTCACAGTAATTAACATCATCAGGGTTATTTTTATAGTGAGGATAATCCTGATGATGCGC
+ACCGTGCTTTCATCTATCGAACGCAAAAATCATTCTCTAAGTAAATGAATGGATTGCATG
+CGTTTCACTCAATTGTACTTTAATTGACCAACCCCGCTTATTAACTTTCTGTATCACTTT
+TTCTTATAAAAAATCATGTAAAACCGCTCGCCAAGACCGCACCAATCGGGTAATCTCGAA
+CTCGTTTTGCCTCGGCGGTAGATTATCCTCACAGCATATAATTTTGTGCGTTAGTCCACA
+GATTTGGCCTTAAGGAATTGTTTCAACATGCCCAGGTAATTAGTCTCGTGTCGCTTGGCA
+TTTTTTTATAACGATATTTGTCGTTAAGGACTTCAAGGGAAAACAAACAACATGGTCAAA
+TCTCAACCGATTTTGAGATATATCTTGCGCGGGATTCCCGCGATTGCAGTAGCGGTTCTG
+CTTTCTGCATGTAGTGCAAATAACACCGCAAAGAATATGCATCCTGAGACACGTGCAGTG
+GGTAGTGAAACATCATCACTGCAAGCTTCTCAGGATGAATTTGAAAACCTGGTTCGTAAT
+GTCGACGTAAAATCGCGAATTATGGATCAGTATGCTGACTGGAAAGGCGTACGTTATCGT
+CTGGGCGGCAGCACTAAAAAAGGTATCGATTGTTCTGGTTTCGTACAGCGTACATTCCGT
+GAGCAATTTGGCTTAGAACTTCCGCGTTCGACTTACGAACAGCAGGAAATGGGTAAATCT
+GTTTCCCGCAGTAATTTGCGTACGGGTGATTTAGTTCTGTTCCGTGCCGGTTCAACGGGA
+CGCCATGTCGGTATTTATATCGGCAACAATCAGTTTGTCCATGCTTCCACCAGCAGTGGT
+GTTATTATTTCCAGCATGAATGAACCGTACTGGAAGAAGCGTTACAACGAAGCACGCCGG
+GTTCTCAGCCGCAGCTAATAAACCGTTTGGATGCAATCCCTTGGCTATCCTGACGAGTTA
+ACTGAAAGCACTGCTTAGGCAGTGCTTTTTTGTTTTCATTCATCAGAGAAAATGATGTTT
+CCGCGTCTTGATCCAGGCTATAGTCCGGTCATTGTTATCTTTTAAATGTTGTCGTAATTT
+CAGGAAATTAACGGAATCATGTTCATACGCGCTCCCAATTTTGGACGTAAGCTCCTGCTT
+ACCTGCATTGTTGCAGGCGTAATGATTGCGATACTGGTGAGTTGCCTTCAGTTTTTAGTG
+GCCTGGCATAAGCACGAAGTCAAATACGACACACTGATTACCGACGTACAAAAGTATCTC
+GATACCTATTTTGCCGACCTGAAATCCACTACTGACCGGCTCCAGCCGCTGACCTTAGAT
+ACCTGCCAGCAAGCTAACCCCGAACTGACCGCCCGCGCAGCGTTTAGCATGAATGTCCGA
+ACGTTTGTGCTGGTGAAAGATAAAAAAACATTCTGTTCATCTGCGACCGGTGAGATGGAC
+ATTCCACTCAATGAATTGATTCCGGCGCTCGACATTAATAAAAACGTCGATATGGCGATC
+TTACCCGGCACGCCGATGGTGCCGAACAAACCCGCAATCGTCATCTGGTATCGCAACCCT
+TTGCTGAAAAATAGCGGCGTCTTTGCCGCTCTGAATCTCAACCTGACGCCTTCACTCTTT
+TATAGTTCACGGCAGGAAGATTACGATGGCGTCGCCCTCATTATTGGCAATACTGCGCTA
+TCTACCTTTTCTTCACGTTTGATGAACGTTAACGAATTAACCGACATGCCAGTCCGTGAA
+ACTAAAATTGCGGGCATTCCTCTGACCGTTCGGCTTTATGCAGATGACTGGACATGGAAC
+GATGTGTGGTACGCATTTTTACTGGGCGGCATGAGTGGAACTGTCGTTGGCCTGCTCTGC
+TATTACCTGATGAGCGTACGTATGCGCCCCGGCAGAGAAATCATGACCGCCATCAAGCGC
+GAACAATTTTACGTGGCGTATCAACCGGTGGTGGATACACAAGCTTTGCGAGTAACGGGC
+CTGGAAGTACTGCTACGCTGGCGGCATCCTGTCGCGGGAGAAATTCCCCCGGATGCCTTC
+ATTAACTTTGCCGAATCGCAAAAGATGATTGTGCCGCTGACTCAGCACCTGTTTGAGTTA
+ATTGCCCGCGATGCCGCAGAATTAGAAAAAGTGCTGCCGGTAGGCGTCAAATTTGGTATT
+AACATTGCGCCGGACCATCTGCACAGCGAAAGCTTTAAAGCAGATATCCAGAAACTGCTC
+ACTTCCCTGCCCGCACACCATTTCCAGATTGTGCTGGAAATTACCGAGCGCGATATGTTG
+AAAGAGCAAGAAGCCACACAACTCTTCGCCTGGCTGCACTCGGTCGGCGTAGAAATTGCT
+ATTGATGACTTCGGCACCGGGCACAGCGCGCTTATCTATCTTGAGCGTTTTACGCTCGAT
+TATCTGAAAATTGACCGTGGATTTATCAACGCCATCGGTACGGAAACGATCACTTCCCCC
+GTACTTGACGCGGTGCTGACGCTGGCGAAACGCCTCAATATGCTGACGGTTGCTGAAGGG
+GTCGAAACGCCGGAACAGGCGCGATGGCTAAGCGAACGCGGCGTTAATTTCATGCAAGGC
+TACTGGATTAGCCGCCCGTTACCGCTGGACGATTTTGTTCGCTGGCTAAAGAAACCGTAT
+ACGCCGCAGTGGTAAGGTGTGCTTACGTCCCTTATTATTCATAGTGAAAGCATGCCGGAT
+TGCGGCTAATGATGAGTAAAAGGAAATCCGTTGCAGATGATTGTGCGCATACTGCTGCTG
+TTTATCGCTCTGTTCACCTTTGGTGTGCAGGCGCAGGCTATCAAGGAAAGCTATGCCTTT
+GCCGTGCTGGGCGAACCCCGGTACGCGTTTAATTTCAACCATTTTGATTATGTGAACCCC
+GCCGCGCCAAAAGGTGGGCAGATAACGTTGTCAGCCCTCGGCACCTTCGATAATTTCAAC
+CGCTATGCACTGCGCGGCAACCCGGGCGCACGCACCGAGCAGCTGTACGACACGCTATTT
+ACGACTTCCGATGACGAACCAGGCAGTTATTACCCGCTGATTGCTGAAAGCGCACGCTAT
+GCTGACGATTATTCCTGGGTGGAGGTCGCTATTAATCCGCGCGCCCGTTTTCATGATGGT
+TCGCCCATTACTGCCCGCGATGTAGAGTTTACTTTTCAAAAATTTATGACCGAAGGCGTG
+CCGCAATTTCGTCTGGTCTACAAAGGCACCACCGTCAAAGCCATTGCACCGTTAACCGTG
+CGCATTGAGTTAGCTAAACCCGGCAAAGAAGATATGCTGAGTCTGTTTTCGCTGCCGGTA
+TTTCCAGAAAAGTACTGGAAGGATCACAAACTTAGCGACCCGCTCGCCACGCCTCCGCTT
+GCCAGTGGTCCGTACCGCGTTACGTCCTGGAAAATGGGGCAAAATATTGTCTATTCCCGT
+GTGAAAGATTACTGGGCAGCAAACTTACCGGTAAACCGTGGACGCTGGAATTTCGACACC
+ATTCGCTACGATTATTACCTCGATGATAATGTCGCCTTTGAAGCGTTTAAAGCAGGTGCC
+TTTGATTTGCGTATGGAAAACGACGCCAAAAACTGGGCCACGCGTTATACCGGTAAAAAT
+TTCGATAAAAAATACATCATCAAAGATGAGCAAAAGAACGAATCAGCCCAGGATACGCGT
+TGGCTGGCGTTTAATATCCAACGTCCGGTATTCAGCGATCGCCGGGTCCGGGAAGCTATC
+ACTCTCGCCTTTGACTTTGAATGGATGAACAAGGCGTTGTTTTACAATGCCTGGAGTCGC
+ACGAACAGTTATTTTCAGAATACCGAATACGCGGCCAGAAATTACCCCGACGCCGCGGAG
+CTGGTGCTTCTGGCACCAATGAAAAAAGATCTACCGTCAGAAGTCTTCACACAAATCTAC
+CAGCCGCCGGTATCCAAAGGCGATGGCTACGATCGTGACAACCTGTTAAAAGCCGACAAA
+CTTCTCAACGAAGCGGGCTGGGTGCTGAAGGGTCAGCAACGCGTTAATGCCACAACGGGT
+CAGCCACTCAGCTTTGAATTATTGCTTCCCGCAAGCAGCAATAGTCAGTGGGTATTGCCG
+TTCCAGCACAGCCTGCAACGGCTGGGTATCAACATGGACATTCGCAAGGTGGATAACTCG
+CAAATCACTAACCGCATGCGCAGTCGCGACTATGACATGATGCCGCGCGTATGGCGGGCG
+ATGCCGTGGCCCAGTTCCGATTTACAGATTTCCTGGTCATCGGAATATATCAATTCCACT
+TATAATGCCCCCGGCGTGCAAAGCCCGGTTATCGACTCGCTGATCAACCAAATTATTGCC
+GCGCAGGGAAATAAAGAAAAATTACTGCCGTTGGGGCGAGCACTGGATCGCGTATTAACG
+TGGAATTATTACATGCTGCCAATGTGGTACATGGCGGAAGACCGTCTCGCCTGGTGGGAT
+AAATTCTCCCAGCCGGCCGTGCGCCCCATCTATAGCCTCGGTATCGATACCTGGTGGTAT
+GACGTCAATAAAGCGGCCAAACTGCCGTCCGCCAGCAAACAGGGAGAGTAGATGGGCGCT
+TACCTGATTCGCCGTCTGTTGCTGGTGATCCCAACATTATGGGCGATTATCACCATCAAC
+TTTTTCATCGTGCAAATTGCGCCTGGCGGTCCGGTCGACCAGGCCATCGCCGCCATTGAG
+TTTGGTAATGCCGGAGTATTACCCGGCGCAGGCGGTGAAGGTGTTCGTGCCAGCCATGCG
+CAAACGGGTGTCGGCAATATCAGCGACAGTAATTACCGTGGCGGACGCGGATTAGATCCA
+GAAGTGATCGCTGAGATCACTCATCGCTACGGTTTTGATAAGCCGATCCACGAACGTTAC
+TTCAAAATGCTCTGGGACTACATCCGCTTTGATTTTGGCGATAGCCTGTTTCGCAGCGCC
+TCGGTGCTGACGCTGATTAAAGACAGTCTGCCGGTTTCCATCACCCTCGGATTGTGGAGC
+ACGCTGATTATCTATCTGGTGTCGATTCCGTTAGGCATTCGCAAAGCTGTTTATAATGGG
+AGCCGCTTTGACGTCTGGAGTAGCGCATTTATCATCATCGGCTACGCCATTCCGGCCTTT
+TTGTTTGCCATCCTGCTGATTGTCTTCTTCGCGGGCGGCAGCTATTTCGACCTGTTCCCT
+CTACGCGGCCTGGTTTCCGCTAACTTTGATTCGCTGCCGTGGTATCAGAAAATCACCGAT
+TATCTGTGGCATATCACGCTGCCGGTGCTGGCGACAGTGATTGGTGGCTTTGCGGCGCTG
+ACCATGCTGACAAAAAACTCATTCCTTGATGAAGTGCGCAAGCAATACGTGGTGACCGCG
+CGTGCGAAAGGGGTAAGTGAAAAAAATATTCTCTGGAAACATGTGTTCCGCAACGCCATG
+CTGCTGGTGATTGCCGGTTTTCCGGCGACGTTTATCAGCATGTTTTTTACCGGCTCGCTG
+CTGATTGAGGTGATGTTTTCACTCAATGGTCTGGGCTTACTGGGCTACGAAGCGACCGTC
+TCGCGCGATTATCCTGTAATGTTTGGTACCTTGTATATTTTCACCCTGATTGGCCTGCTG
+CTGAATATTGTCAGTGATATCAGCTATACGCTGGTTGATCCGCGTATTGATTTTGAGGGA
+CGTTAATGTCGCGACTCAGCCCCGTCAATCAGGCCCGTTGGGCGCGTTTTCGTCATAACC
+GTCGCGGCTACTGGTCGTTATGGATTTTCCTCGTCTTGTTTGGTTTGAGTTTGTGTTCTG
+AACTTATCGCCAACGATAAACCGTTGCTGGTGCGTTATGACGGCAGTTGGTATTTCCCGT
+TATTGAAAAACTACAGCGAAAGCGATTTTGGCGGCCCGCTGGCAAGTCAGGCTGATTATC
+AGGACCCGTGGCTGAAACAACGGCTGGAAAATAACGGCTGGGTACTGTGGGCACCGATTC
+GCTTTGGTGCTACCAGTATCAACTTTGCTACCAATAAGCCCTTCCCTTCTCCACCCTCCC
+GGCAAAACTGGCTGGGAACGGATGCCAACGGCGGCGATGTGCTGGCACGCATTCTCTATG
+GCACGCGGATCTCGGTTCTGTTTGGCCTGATGCTGACTCTCTGTTCCAGCGTGATGGGCG
+TGCTGGCGGGGGCGCTACAAGGCTATTACGGCGGTAAAGTCGATCTCTGGGGACAACGCT
+TTATTGAAGTATGGTCGGGGATGCCGACGCTGTTTTTGATTATTTTACTTTCCAGCGTCG
+TACAGCCTAACTTCTGGTGGCTGCTGGCAATTACTGTCTTGTTTGGCTGGATGAGTCTGG
+TCGGCGTGGTGCGGGCGGAGTTTTTACGTACTCGTAATTTCGACTACATTCGTGCGGCAC
+AGGCGCTTGGCGTCAGCGATCGCAGTATCATCCTGCGTCATATGTTGCCTAATGCCATGG
+TCGCGACCCTCACCTTTTTACCGTTTATTTTATGTAGTTCGATAACCACCCTGACCTCGC
+TCGATTTCCTCGGCTTCGGTCTACCGCTCGGTTCACCGTCACTCGGTGAACTGCTGTTAC
+AAGGGAAAAATAACCTTCAGGCCCCGTGGCTTGGGATCACCGCCTTCTTGTCGGTGGCGA
+TATTATTGTCTTTGCTGATCTTTATTGGTGAAGCCGTCCGCGACGCATTTGATCCTAATA
+AGGCGGTGTAGCATGACGCAAACTCTGTTAGCGATTGAAAATTTGTCGGTGGGTTTTCGC
+CATCAGCAAACCGTACGTACAGTAGTCAATGATGTTTCACTACAGATTGAGGCTGGCGAA
+ACGCTGGCGCTGGTGGGTGAGTCAGGTTCAGGCAAAAGCGTTACCGCGCTGTCAATTTTA
+CGCCTGCTCCCTTCCCCGCCGGTTGAATATCTCTCCGGCGATATTCGTTTTCATGGCGAA
+TCGCTGCTTCACGCCAGCGATCAAACGTTGCGCGGTGTACGCGGTAATAAGATCGCCATG
+ATTTTTCAGGAACCGATGGTGTCGTTAAATCCATTGCATACCCTGGAAAAACAGCTTTAT
+GAAGTGCTTTCACTCCACCGCGGGATGCGTCGGGAAGCGGCTCGTGGCGAAATTCTTAAC
+TGCCTTGATCGCGTTGGTATCCGCCAGGCGGCAAAACGGCTGACAGATTATCCGCATCAG
+CTCTCCGGCGGCGAACGGCAGCGGGTGATGATTGCGATGGCGCTGTTAACGCGACCGGAA
+TTATTAATTGCCGATGAACCGACCACCGCACTGGACGTCTCTGTCCAGGCGCAGATTTTA
+CAGCTGTTGCGCGAACTGCAAGGCGAGCTGAATATGGGCATGCTGTTTATTACTCATAAC
+CTCAGCATTGTCAGAAAACTGGCCCACCGCGTGGCGGTAATGCAAAACGGTCGCTGTGTC
+GAGCAAAATTACGCCGCTACGCTATTTGCATCACCCACTCATCCTTACACACAAAAGCTA
+CTCAACAGTGAACCGTCAGGCGATCCAGTGCCGTTGCCAGAACCTGCCTCAACGTTGCTG
+GATGTTGAACAGCTTCAGGTTGCCTTCCCCATTCGCAAAGGGATTTTGAAGCGCATTGTG
+GATCATAATGTGGTGGTGAAAAACATCAGTTTTACGCTACGAGCGGGTGAAACACTGGGT
+TTAGTGGGCGAGTCCGGTTCCGGGAAAAGTACGACGGGACTGGCGCTGCTGCGACTGATT
+AATTCTCAGGGCAGCATCATCTTTGACGGTCAGCCACTGCAAAATTTAAATCGCCGCCAG
+CTGTTACCTATTCGTCATCGCATTCAGGTGGTATTTCAGGATCCAAACTCCTCGCTCAAC
+CCACGACTCAACGTTTTGCAGATTATTGAGGAAGGCTTACGGGTTCACCAGCCGACGCTT
+TCTGCCGCACAACGCGAACAACAAGTGATAGCCGTGATGCATGAAGTGGGATTAGATCCT
+GAAACACGCCACCGTTATCCGGCGGAGTTCTCTGGTGGTCAGCGACAACGTATTGCGATT
+GCCAGGGCATTAATTCTTAAGCCCTCGCTGATCATACTTGATGAACCGACATCATCACTC
+GACAAAACGGTACAGGCGCAAATATTGACGCTATTGAAATCATTGCAACAAAAGCATCAA
+CTGGCCTATTTGTTTATCAGCCACGATTTGCACGTTGTCCGCGCGTTATGTCATCAGGTT
+ATCATACTGCGACAAGGGGAAGTAGTGGAACAAGGACCGTGCGCGCGCGTGTTTGCCACA
+CCGCAGCAGGAGTATACGCGTCAGCTACTGGCGTTGAGCTGACGCTTAAAAAGGATTGTA
+GTTTGAAAAGGGTTCGGCAATTGCCACACCAAAATTTTTCAATCGGCATGTTGCAGCAAA
+CTCGTCCTGGCGATTTACAAACAGGCACGGCTCACCTTCACACTCCAGCACCGAACATGG
+AACTTCGATGTCGCTTAACGCCTGGCTTAGTTTATACATCACCGACCATGCATTATCACC
+ATCCGGGCTAAGCAATTTAAGCGCCACCAGGCTGTTGTCACCGCACGGTCCATTTTGCGG
+AATCGGTTCAACCTTCGAACCTGCGAAACCAGCAGACCAGCGATAGTTCTGCGGCAGTCG
+ATGGACGATTGAGAGTTGTAATGAAGTCACTTATTTTCCCCGGAAGCACATTCACTTCAC
+AATTTGTTTACATCAATTTTAACACATCATCAACAATCCGTCTTTATACAGATCGTAAAG
+ATTGATGCCTCGCCTGCGTGGCCTCTATGGCTCTGATTTAAGTAATATCTGCGGGCGTGG
+TCACGTTTGCGGGGCTATATGTACCCGTTTCTGCGATCTAACTCAACCTTTTTAACTACA
+ATGATGTGACTTTTTACATAAATTGATTTTACATAAAATAAACATATATCGGGGGAATGA
+TAGATTTGTGGTTGACATGCATCAACAAAGGAAGCCTTTTAGCTTCCTCGTTGTGCAATA
+GATCACCGTTTTTTCGGCCGACTGGCGTACAGACAGAAGAGAATGGAGCTGGTTGCGCAG
+AATGCAATTGACCAAATCATCGGCCATGCAGAGTTAAAGGTCGCAAGAGAAAGCAATGCG
+CCAACAATTGCCCCTATGCCAAAACGGAAGGTTCCTGCCAGCGAAGATGCCGTTCCCGCC
+ATATGGGGAAACTCATCAAGAATGACCGCCATCGCATTGGATGACACCATCGACACGCAG
+CCCACAAACGCCGCAACGCCAACCACCAGCGACCAAAATCCCAGCCCCAGCAGCGCACTG
+ATGACCATCCACGCTGCCATAATAAATTGTATCCACAACCCCGAGCGGAACATATTTAAC
+GCGCCAATGCGGCGGACGAAGCGGCTGTTAAAGATGGTCATCACGAACAGAAAAACAATG
+TTTAGCGCAAAGTAATAACCAAAGTTTTCCGGCGCGACGTGGTTAATTTCAATATAAACA
+AACGGTCCGGCGCTTAAGAATGAGAACATCCCGGCAAAGCTGAAACCACTGGCAAGCATG
+TAGCTCAGGACACGTTTATGGCGGAACAGCGCCGCAAAGTTACCAATAGTGGTACGAATG
+TGAAATGGCTGACGACGCTCCGGTGGTAAGGTTTCTTTAATCAGGAAGAAAATCATTGCC
+GAAGCCAGAATCGCCGCTAATGCCAGGATCCAGAAGATGTAATGCCAGCTCAGCCACACC
+AGCACCCAGCCGCCAACTATCGGTGCCATCAGCGGTGCAATGGTTGTCACCAGCATGACA
+AACGACATCATCCGCGAGAACTCTTCTTTCGGGTAAATATCGCGCATCAGGGCGTTAATG
+ACCACGCTGGCCGCAGCCGCAGCCAGCCCGTGGAAGAAACGCATCACAATCAGCTGATCG
+ATGGTGTTTGCCAACGCACACGCCACCGCGGCGGCGGCAAACACCAGCGTACCGCCGAGC
+ACCACCGGCTTACGCCCGAAGCTGTCTGCCATCGGCCCGTAGATTAACTGCCCCAACGCA
+AAGCCCAGAATATAAGTACTGAGGGTCATCTGCGTACTGCCCGCCGGTACGCCAAACTGC
+GCTGAAATTACCGGTAGCGCGGGCAGATACATATCAATCGACAGCGGCATCAACATGGCC
+AGCAGGCCAAGGATAAAAACAATAGCAAACGACGAATGCTGTCGGGTGGTCACAACGGGC
+TCCTGAAAGTCATTGAAAAGTTAGACGACGCTGGCAATTTCTTCTTCAGTTAACGGACGA
+TATTCACCGGGGGCTAAATCAGCATCCAGCGTAATACCGCCAATACGTTCACGATGCAGC
+TCAACCACGTGGTTACCCACGGCGGCGAACATGCGTTTCACCTGATGATAACGCCCTTCG
+CTGATGGTCAGACGAACCTGCGTTGGGGTAATCACTTCCAGCACCGCAGGCTTAGTGAGA
+TCTTTTTCGTTATGCAGCTGCACGCCTTTAGCAAATTGCTCTGCCGTATCGTCAGCTACA
+GGTGATTCCAGTGTCACCAGATAGGTCTTCTCGCAATGATGGCGCGGAGAAGTAATGCGG
+TGCGACCACTGACCATCATCAGTCATCAGCACCAGACCGGTGGTATCAATATCCAACCGC
+CCCGCCGCATGCAGTTTCCACGCTACCGGTTCATCAAGAAAATAGAGCACCGTTGGGTGA
+TCAGGGTCGTCCGTGGAGCAAACATAGCCCTGAGGCTTATTGAGCATGAAGTAACGTGGA
+CCGTGTTGCTGCGCCAGCGGGTTGCCATCGTAAGCGACATCATGTTCAGGAAGCAGTTTG
+AACGCTGCATTACGGACGATTTCGCCATCGACGGTGACACGATTGCCGCGGATTTCACGC
+CCGGCAATAGCACGGCTAACGCCGAGTTGCTGTGCGATAAATTTATCAAGTCGCATGTGT
+GTGATTTTGCCTGTAAAAACGGAGGTCGGGCATTGACCCGAAAATCTGAACTGTTGTCTG
+CCCAGTATAGCGGTCTAATAACATCCCTCAAGGGAAAAAGATCCATGGCATACTATTAGC
+AGAATAATCTACCTACGCGAGACCATGATTTTTACACTTCGCCCATATCAGCAAGAAGCC
+GTGGATGCCACGCTCAACCATTTTCGTCGTCATAAAACCCCTGCCGTTATCGTGCTGCCC
+ACCGGCGCAGGTAAAAGCCTGGTGATAGCGGAACTGGCACGGCTGGCTCGTGGTCGCGTG
+CTGGTGCTGGCACACGTTAAAGAACTGGTGGCGCAAAACCATGCAAAGTATCAGGCGCTG
+GGGCTGGAAGCCGATATTTTTGCCGCCGGGCTAAAGCGCAAAGAGAGCCACGGTAAAGTG
+GTATTTGGCAGCGTGCAGTCTGTCGCCCGTAATCTTGATGCCTTTCAGGGTGAATTTTCG
+CTGTTGATTGTCGATGAATGTCACCGTATTGGTGACGATGAAGAGAGCCAGTATCAGCAA
+ATCCTCACTCACCTGACAAAAGTGAATCCCCACTTACGCCTGCTGGGGCTGACTGCCACG
+CCTTTTCGATTGGGCAAAGGCTGGATCTACCAGTTTCATTATCACGGCATGGTACGCGGC
+GATGAGAAAGCCCTTTTCCGTGACTGCATTTATGAGCTGCCGCTGCGTTATATGATTAAA
+CACGGCTATCTGACGCCGCCAGAACGACTGGATATGCCAGTAGTGCAATACGATTTCAGC
+CGCTTGCAGGCACAGAGTAACGGGCTGTTCAGCGAAGCCGATCTCAACCGTGAGCTGAAA
+AAACAACAACGTATTACCCCGCACATCATCAGCCAGATTATGGAGTTTGCTGCAACGCGC
+AAAGGGGTGATGATTTTTGCCGCGACGGTTGAACACGCAAAAGAGATTGTGGGATTACTG
+CCTGCCGAAGATGCAGCACTGATTACTGGCGACACCCCCGGCGCTGAGCGCGATGTGTTA
+ATTGAAAATTTTAAAGCCCAGCGTTTTCGCTATCTGGTCAACGTCGCGGTACTGACCACC
+GGATTTGACGCCCCGCACGTCGATCTTATCGCCATTCTGCGCCCTACCGAATCAGTGAGT
+CTTTACCAACAAATTGTCGGGCGCGGTCTGCGTCTCGCTCCGGGCAAGACTGATTGCTTA
+ATTCTTGATTATGCGGGTAATCCTCACGATCTCTACGCGCCGGAAGTTGGTACACCAAAA
+GGCAAAAGTGACAACGTTCCGGTACAGGTTTTCTGCCCTGCCTGCGGTTTTGCCAACACC
+TTTTGGGGGAAAACGACCGCCGACGGGACATTGATTGAACACTTTGGTCGTCGCTGTCAG
+GGATGGTTTGAAGATGACGACGGTCATCGCGAACAATGTGACTTCCGTTTCCGTTTTAAA
+AATTGCCCGCAATGTAACGCGGAAAACGATATTGCCGCCCGCCGCTGCCGCGAATGTGAC
+ACCGTACTGGTTGATCCGGACGATATGTTAAAAGCGGCGCTACGACTGAAAGACGCGCTG
+GTATTACGCTGTAGCGGCATGTCTTTGCAACATGGGCACGACGAGAAAGGCGAATGGTTG
+AAAATCACCTATTACGATGAAGACGGCGCGGATGTGAGTGAGCGTTTCCGTCTGCAAACA
+CCTGCCCAGCGTACCGCCTTCGAGCAGCTTTTTATCCGCCCGCATACGCGCACACCGGGC
+ATCCCGCTGCGCTGGATCACCGCCGCCGATATCCTCGCCCAGCAAGCCTTATTGCGACAC
+CCGGATTTTGTCGTCGCCCGCATGAAAGGCCAGTACTGGCAGGTGCGTGAAAAAGTGTTC
+GATTACGAAGGTCGTTTTCGTCTGGCGCACGAATTACGCGGTTAATGGTAGTTTTGATTG
+ATGTATAAGGCGATTGAGTATAGAATCTCGCCCGCTTTTGCATACGCAAAGCAGATCACT
+TACCTGTTGCTGGGTCGCCTGTAGCAGGATTAATTTAAGAGAGAAAGAAATGTTTACTAT
+CAACGCAGAAGTACGTAAAGAGCAGGGTAAGGGTGCGAGCCGCCGCCTGCGTGCCGCTAA
+CAAGTTCCCGGCAATCATCTACGGTGGCAAAGAAGCGCCGCTGGCTATCGAGCTGGATCA
+CGACAAAGTCATGAACATGCAAGCTAAAGCTGAATTCTACAGCGAAGTTCTGACCATCGT
+TGTTGACGGTAAAGAAATCAAAGTTAAAGCTCAGGACGTACAGCGTCACCCGTACAAACC
+GAAGCTGCAGCACATCGACTTCGTTCGCGCTTAATTGCTGAATAAGTTGTAAAAAACCCC
+GCTCCGGCGGGGTTTTTTGTATCTGCAGATTATGCCTGATTACGGTATTGCTATTTTTTG
+CAGGCCAGATAAGGCGTTCACGCCGCATCTGGCATTCAGAACACAAAACCGATTAATTGC
+CGCCAGACGTCCGGCGCTGCAATTGGTCGCGCAAATTCGGCGGCGTGCCTTTAATGGTCA
+AGGTATCGGTTGCTGGATCCCAGAAGATGCGTTCACCTAACAGCATCGCATCAAAGTTAA
+TAGTCAAGCCACCGCCGCTACCGGCAAACTTCGTCAACTGACGCAGTGTGCTACGGTCTG
+CCGGGAAGCTCTCTTCCAGTTCGTAGCCTTTTTCAGCCGCAAACTCCGTGAAGCTCACTT
+CGCTTACGCCTGCCAGCTCTTTCGACAGCGATTTCAGTTCGATCTCTTCGCCTGCCTGCA
+GCTGCTCATTACAGTAGCTATAAACCTGCTGGCGCACGTTCTGTCGCTCTGCTTTATCCA
+GTTGTGCTTCGGCAGTGAAATCATCAACCGCTTGCAACAGCCCACGGTTTTGCGCTTTCG
+CGTTTAACCCTTCGCTGGCCCCGAGGAAATCCATAAAGAAATCCGCCACTTTGCGCCCTA
+CTCGCCCTTTCAGGAAAGTGAGATAGCGGGTGGACTCTGGATTGGTTTCCCATTCGGTTA
+AATCGATACGCGCAACAATATCCGCATGATTGATATCAAGATAATGGGTTGGGTTGATGT
+CGAGATTTTCGTTAACGCGCATACTGCTCAGGTTGCTCAGAACTGCCACCAGCAAATACT
+CCACCGCCAGATAGCGATAGTGGCAAAACAGCACGAATCCACCGTCAGCAAAAGGATATT
+TCGCTAATTCGTCACGCAGGCGGCCGGTTGCCGCGCGGCTAAATGCCAGGAAGTCCTCTT
+CGCCCTGACGCTGTAAGCGCAGCGTCTGCGCCAGTTCACTCTCTTCGCTAAACAAGCCGT
+AAGCTTTATTTTTGGCGCTATAGACCCGATGCAGTTCTGCCACCATCTCAACGACGGTTT
+CTGTCGGTTCCAGCAATGAATCGCGCAACACCAGCTCAAGGTTCTGCTCATCACGCTTGA
+TAAGCTGGTGCAGAGCAATCTGGTTGATATCCAGACTCATGATAAACTCTCCTTTAAGAC
+CGGGCGGTATTCAACCACCGCCGGTTAAGCGACGCAATAAAAGATGGCGGTCATTTTACA
+GAAGGCAGCGTAACGAGAATGATTTAACGCATAAAAAAGCAGAAAAAAAACCGTTGCTAC
+GGTAATATGTTGCCCTTTCATCAACTAACTGATTTCGATTTATGCCACAAATTTCCCGCT
+ACAGTGATGAACAGGTTGAACAATTGCTCGCAGAGCTGCTCAACGTACTGGAAAAACATA
+AGGCTCCGACCGACCTTTCCCTGATGGTGTTAGGCAACATGGTCACTAACCTTATCAACA
+CCAGCATTGCCCCGGCCCAACGCCAGGCAATTGCCAACTCTTTTGCCCGCGCCTTACAGT
+CCTCTATCAACGAAGACAAAGCGCACTAAGGGAAACAGATAACAGGTTATGGTAACTCAT
+CGTCAGCGCTACCGTGAAAAAGTCTCCCAGATGGTCAGTTGGGGGCACTGGTTTGCACTG
+TTCAATATTCTGCTTTCGCTCGTCATTGGCAGCCGTTACCTGTTTATCGCCGACTGGCCG
+ACAACGCTTGCTGGTCGCATTTATTCCTACGTAAGCATTATCGGCCATTTCAGCTTCCTG
+GTGTTCGCCACCTACTTGCTGATCCTCTTCCCGCTGACCTTTATCGTCGGCTCCCAGAGG
+CTGATGAGGTTTTTGTCCGTCATTCTGGCAACGGCGGGAATGACGCTATTACTGATCGAT
+AGCGAAGTCTTTACTCGTTTCCATCTCCATCTTAATCCCATCGTCTGGCAACTGGTTATC
+AACCCAGACGAAAATGAGATGGCGCGCGACTGGCAGCTGATGTTCATCAGCGTGCCGGTT
+ATTTTATTGCTTGAACTGGTGTTTGCGACGTGGAGCTGGCAAAAGCTGCGCAGCCTGACG
+CGTCGTCGACGCTTCGCGCGCCCGCTGGCCGCATTCTTATTTATCGCCTTTATCGCCTCG
+CATGTGGTGTATATCTGGGCCGATGCCAACTTCTATCGCCCGATCACCATGCAGCGCGCT
+AACCTGCCGCTTTCGTACCCGATGACGGCGCGACGTTTTCTTGAGAAGCATGGTCTGCTT
+GATGCGCAGGAGTATCAACGCCGTCTTATTGAGCAAGGTAATCCAGACGCCGTTTCCGTT
+CAGTATCCGTTAAGCGAACTGCGCTATCGCGATATGGGCACCGGGCAGAATGTGCTGTTG
+ATTACTGTCGATGGCCTGAACTACTCACGCTTCGAGAAGCAGATGCCTGCGCTGGCAGGT
+TTTGCTGAGCAAAATATTTCGTTCACGCGCCATATGAGCTCCGGCAACACTACAGACAAC
+GGCATCTTTGGCCTGTTCTATGGCATCTCGCCGAGCTATATGGACGGCATTCTGTCGACC
+CGTACGCCTGCGGCATTAATTACTGCGCTTAATCAGCAAGGCTATCAGCTGGGGTTATTC
+TCATCAGATGGCTTTACCAGCCCGCTGTATCGCCAGGCATTGTTGTCAGATTTCTCGATG
+CCGAGCGTACGCACCCAATCCGACGAGCAGACCGCCACGCAGTGGATCAACTGGCTGGGA
+CGCTACGCACAAGAAGATAACCGCTGGTTCTCGTGGGTTTCTTTCAATGGTACTAACATT
+GACGACAGCAATCAGCAGGCATTTGCACGGAAATATAGCCGGGCGGCAGGCAATGTCGAT
+GACCAGATCAACCGCGTGCTCAATGCACTGCGTGATTCTGGCAAACTGGACAATACGGTG
+GTGATTATCACTGCCGGTCGGGGTATTCCACTGAGCGAAGAGGAAGAAACCTTTGACTGG
+TCCCACGGTCATCTGCAGGTGCCATTAGTGATTCACTGGCCAGGCACGCCGGCGCAGCGT
+ATTAATGCTCTGACTGATCATACCGATCTGATGACGACGCTGATGCAACGCCTGCTACAT
+GTCAGCACACCTGCCAGCGAATATTCGCAAGGTCAGGATTTGTTCAACCCTCAACGCCGT
+CATTACTGGGTTACCGCAGCGGATAACGATACGCTGGCAATTACCACCCCGAAAAAGACG
+CTGGTACTGAACAATAACGGTAAATACCGCACTTACAACTTACGTGGTGAAAGAGTGAAA
+GATGAAAAACCACAGTTAAGTTTGTTATTGCAAGTGCTGACAGACGAGAAGCGTTTTATC
+GCTAACTGATTAATTATAAATCAGTTAGCGAAATATCTTACTTGCAATCGGTGTGGAAAA
+CGGTAGTATTAGCAGCCACGAGTCGGCACGTAGCGCAGCCTGGTAGCGCACCGTCATGGG
+GTGTCGGGGGTCGGAGGTTCAAATCCTCTCGTGCCGACCAAAAATCCCAAGAAAAAACCA
+ACCCTTACGGTTGGTTTTTTTATATCTGCAATTAATTCGATAAACAGACCGTGACACATC
+ACAGCCTGTTTATTTTCTGTTATCAGAACGTCCAGACCACACCCGCCTGAGTATTCCACG
+GCGATTCTACCCCTGCGCCATTGCCATAGCTGACTGACAAATGACCGCTTAACGTCGGGG
+TAAACGATGACCTTATACCAGCCTGATAAACGCCACTGGTTCCAGCCACATCATTATTAA
+ATTTGCCATCGTCATTAACTTTCACCTGGTTAGAATCGGCGTATTCCTGACGCACGGCCG
+CTTTCAGCCAGGGTTCCAGCGTCGTACCGTTTTGCAGGTCCATGTGATAGCTTACCGCCG
+TTCCCGCTTCAGCGCGTAATATCCGGGTATTTCCCACATCCGCGCGCATGCCGTTTGATA
+ACGTGTAGTCCTGACCATCTGTGGTAAAGCCGGTAAAGGCCAGATAGGGTCTAACACTCC
+ACAATCCGTCAACCCAACGGAACCCGCTCTCAACATGAGCACCCGCGCCGTTACTATTGT
+AATCGCCAAACGCTGTTGCCCCATTACTCATCTTGCCATGGATGGTGTTGGCAAAACGGT
+CAACTTTCACCACCCCATCAACATAGGCACCGTTCTGATGCTCCCAACCGGCATAAGCCC
+CCAGGGTATAGCTATCGATATTACCTTTGCCGCCGCGATCAAAACCAATATCAGAATGAG
+AGTAACCAAAGATCAAGCCGCGAATTGTACTGCTTTCTTCACGGGAGAAACGGCTATCGA
+TACCGAGCGTCAGGCCCGTCAATGTTTGCTCAAAACCAGCTCCCGCATCAGTGGTCACGT
+TGTTGCGGGTGTTAATTGCCGAACTCCACATCGCCGTATCGTAACTAACGCCTTTTACGC
+TACCAAGACGCTCACGCACGGTGTCCAGTTCTGCATCAAATACCAGCGGTTGTGCGGCCG
+CCATATTCAGCACATCAGTGGTTGAAGGGGTAATTTGCGCGCGATTCTCTGCCAGACTCC
+AGCTATGGTTGCCATTATCCAGCAAGGTATATTCATACGTACCGATATCAACAACGCCTC
+CGGCATTGCCCAACGTAAATGCAGCATCACCGCCGCCCGTTGTTACCAGTGTAAGGCTAT
+CTCCTGCTGCCGGGCTGGCACCGGTGTCCGTCACGAATATTTTGAAATCACCTGTTGCCT
+GACCGGTGACGTTGAGCTGATCGCTCTGATGATTAGCCATATCGGTACGCATATAAAAAT
+TGCCGTTTCCCGACAGGGTATTGGTGGTCAACGTAATGAAATTTTCCGCACTTGCCGTCA
+CTGATGAACGAGTCACTGGCTCATCCATCATAATCACATTTGCGTCAGACATCGCAAGGT
+TGGCTAAGTTGAGGAGGGTGTTTTGGTTCGTCGTAGTGATATCGGCAATGATGGTCCATA
+CGCTATTTTCGAGCGAAACGTCCGCTTTGCTGGTATCCACGGCACCATGCGTTCTAAAAG
+AAGCGCCCTCAGAAACCACTACCTTACCCACCAACATTGCGGGTGCATAATTTATTTGCG
+GCTTCATGACCTCAAGAATGCCATCATTCCCTCTGACTGAAACGTTAACCATTGTGCCAG
+CCCAGACGTTAGCGCGGCCATTGTTGATAACCATATTTTCAGAGATGGCTTTTGAGGAAT
+ACGTGATACTTCCATTCTGATATGATCGACCGAGATCATATACCGCATTTGCCTGCACTT
+TCGTACCAGTATCCTTTCCCAGCGATTGCATAGTGGCATGCTTATCAAGGATAGTATCAA
+TGGCCTGCGTGTCCTCCATAACAATGAGCCCGGAACCATCATCCAGTTCATAATTTTTTG
+ACACACCATCTTTTATACTAAATTGGCCTTTACTGTTTGGACCACTCACTTCCAGCGCAT
+TCGTTGAGACAATTAATTTTCCGCCTGCTTTTTTATCAACGCCAGTTACAGTCCCGCCAT
+CCATAACCTCCAGTAAGCCGCCACTATCTACAGTGGTATTATAAGCGAAGTCATTTTCTT
+CAACTCGCAAACTTCCGCCGTTTTCCAACAACATATTATTAGCAATACCATTCTTGATAT
+CGAACTGACCGAGACGGTTTGTTCCGAATACCTCCATGGCCCGCGTGGTTGTTTTAATAG
+CACCGCCTGCTTTCTGATCTACCGCAAATGCAAATCCCCCCTCTTTAACCTCCAGTAGTC
+CTCCCTTTTCGATAGCGACAAAGACGGCCCCCCCATCTTTTTCAACGATTAAGCGCCCGC
+CTTTAATCGTGGTATCATTCGCTGCGCCATAAACCTGTAGCACACCATTATTGAGCGTAG
+TCTGGTTTGCCGCGCCACCCATTTGAACAATTTGATAACCGTCATTTAATACTGAGTATT
+CTGCGGCGCCATTCATTTCAATGTACTGATACCCTCCGTTAATTTCAGTATTATTACTTA
+CACCAAATTCTTTTATATGCTGTTCTCCGCCAGGATTGATTTTCGTATTATTGGCGGTCC
+CATAAACCAGCTGGATATCTTTTTCCAGGACAACACCATCAACTGTCTCACCATACTCAA
+CAGTTGATGCCAATGCTATGGGTGAATATAAGGAAGGTGCGAATAAGCGGGGAAATTCTT
+CTCGGCTGACTCAGTCATTTCATTTCTTCATGTTTGAGCCGATTTTTTCTCCCGTAAATG
+CCTTGAATCAGCCTATTTAGACCGTTTCTTCGCCATTTAAGGCGTTATCCCCAGTTTTTA
+GTGAGATCTCTCCCACTGACGTATCATTTGGTCCGCCCGAAACAGGTTGGCCAGCGTGAA
+TAACATCGCCAGTTGGTTATCGTTTTTCAGCAACCCCTTGTATCTGGCTTTCACGAAGCC
+GAACTGTCGCTTGATGATGCGAAATGGGTGCTCCACCCTGGCCCGGATGCTGGCTTTCAT
+GTATTCGATGTTGATGGCCGTTTTGTTCTTGCGTGGATGCTGTTTCAAGGTTCTTACCTT
+GCCGGGGCGCTCGGCGATCAGCCAGTCCACATCCACCTCGGCCAGCTCCTCGCGCTGTGG
+CGCCCCTTGGTAGCCGGCATCGGCTGAGACAAATTGCTCCTCTCCATGCAGCAGATTACC
+CAGCTGATTGAGGTCATGCTCGTTGGCCGCGGTGGTGACCAGGCTGTGGGTCAGGCCACT
+CTTGGCATCGACACCAATGTGGGCCTTCATGCCAAAGTGCCACTGATTGCCTTTCTTGGT
+CTGATGCATCTCCGGATCGCGTTGCTGCTCTTTGTTCTTGGTCGAGCTGGGTGCCTCAAT
+GATGGTGGCATCGACCAAGGTGCCTTGAGTCATCATGACGCCTGCTTCGGCCAGCCAGCG
+ATTGATGGTCTTGAACAATTGGCGGGCCAGTTGATGCTGCTCCAGCAGGTGGCGGAAATT
+CATGATGGTGGTGCGGTCCGGCAAGGCGCTATCCAGGGATAACCGGGCAAACAGACGCAT
+GGAGGCGATTTCGTACAGAGCATCTTCCATCGCGCCATCGCTCAGGTTGTACCAATGCTG
+CATGCAGTGAATGCGTAGCATGGTTTCCAGCGGATAAGGTCGCCGGCCATTACCAGCCTT
+GGGGTAAAACGGCTCGATGACTTCCACCATGTTTTGCCATGGCAGAATCTGCTCCATGCG
+GGACAAGAAAATCTCTTTTCTGGTCTGACGGCGCTTACTGCTGAATTCACTGTCGGCGAA
+GGTAAGTTGATGACTCATGATGAACCCTGTTCTATGGCTCCAGATGACAAACATGATCTC
+ATATCAGGGACTTGTTCGCACCTTCCATAACGCTGTAGCCACCAGAACAGATATTGCGGA
+ACGACAAAGAGAAACAGAACCAGATTGATGCATTGAGCTTTCATCCTATGAAATTAATTG
+CTGTTAAAAGCATTGGGTACAGAAAATACCCATAGCTCCATACCCGGAGTCAGTTTTTAA
+AAACTGTTTAAAGAAATGCACAAGTATTGTGATTGATTTTTTAGTTGTTTTTCTTGATGA
+GAAGCTGATGCAAAATTCCGTCTTTATAATGAAAATGATGCCAAAGCGAACGACAAGGTT
+GTAGTTTTCACTACATGTCCATACATAAAATGGGGTAACATTCACGCGCCTGGTAGCGTT
+ACCAACGCTACGCTCAAACATAATGATTCTAATAAAACCTCAGGAGACTACTATGCCTGA
+AGCAACACCTTTTCAGGTGATGATTGTGGATGATCATCCACTTATGCGACGCGGTGTTCG
+TCAGTTACTGGAGCTTGATCCTGGCTCTGAAGTGGTCGCCGAAGCGGGCGACGGCGCGAG
+CGCTATCGATCTGGCGAATAGACTGGATATCGACGTGATCTTGCTGGATCTCAATATGAA
+AGGTATGAGTGGCCTGGATACTCTCAATGCCTTGCGCAGGGATGGCGTTACCGCGCAAAT
+TATTATCCTGACCGTATCCGATGCCTCCAGCGATGTCTTTGCGCTGATAGACGCAGGCGC
+AGACGGTTATCTGTTGAAAGACAGCGACCCGGAAGTATTGCTGGAAGCGATTCGTGCCGG
+AGCGAAAGGCAGCAAAGTCTTTAGCGAACGCGTCAATCAGTACTTACGTGAACGTGAAAT
+GTTTGGCGCGGAAGAAGATCCCTTCAGCGTGCTGACGGAGCGCGAGCTGGATGTTCTGCA
+CGAGCTGGCACAGGGGCTGTCAAATAAACAGATTGCCTCGGTGTTGAATATTTCCGAGCA
+GACAGTAAAAGTACATATTCGCAATCTGCTGCGTAAACTCAATGTCCGCTCACGCGTGGC
+GGCCACCATTCTGTTCCTGCAACAACGCGGGGCACAATAAAAATAGCCCGATGGATTTAT
+CATCGGGCTGAGATTTATGACAAACGCAAAACTGCCTGATGCGCTACGCTTATCAGGCCT
+ACGTGGATCGATCAATTTATTGAATTTACACAATTTTGTAGGCCGGATAAGGCGTTCACG
+CCGCATCCGGCATAAACTAAGCGCACTTTGTCAACAGTCTAGCCCGATGGCATCACCATC
+GGGCCTCTTTTTATTTACTCTCCTGCGGCGACAAATGTTGCATCGCCTGCGCGATACTAC
+GTTCAATCACCGCACGGCGAGTATCGTTGGCAGGTAAGAGTTTCAACATCATCTCCCACG
+CGGCAACGGCTTCGCCAAATCGCTGCTGCTCAAAGGCATTAAACGCATACATGCTTAGCA
+CACGGATATTGCTATGGTCCGTTCTCACCAGCTGACGTAGCAGTTCACCGCCGAGGCGGT
+TGTCGTTGGGATCAGATGAACGAGTCAACGCTTCAGCGTATCCCAGTGCAGCATCACTGT
+TTTTCGGATCGAGGCGATACGCAGTGGCGTATGCATCGGTGGCGATACTGGCGTTACCCA
+GCGCCATGCCAACGCGGCCCAACATAATCCAGCCTTCTATATCTCCCGGATTTTTTTGCA
+GTTGAGTACGCATCCCCAGCGCAAGACGCGACATCTCTTCTTCGTTGAGCGGATCGGCTT
+TCGGATCCAGCGCCCTGTCCAGCAACGCCGGAGCCTGTGCCGTGGCCTGCTGCCAGATTT
+TCACCTGCTGATAATTGCCAGTCTGGTAGTAGCTGACGCCAGCCACAATTAACGCCACCA
+CAATACCCGGCAGATAAACAACATATCCGGCACGCTTACCTTCCGGCACGCTTTGTTCAG
+GAAACGCTTCCGGCACCACGCGTACCCGACGCCGCGAGCGGGCGTATATGACCCAACCGC
+CAATGCCAATAGCCACTACTGGCAGCACCCACAGCAGCACGGTCAGCGGCGTTAACGGCG
+GATCGTAAGTGACGAAGTTGCCGTAACGCGCCACCATATAATCGACAATCTCTTTTTTAC
+TTTTACCTTCCTGCATCAGTTCATACACTTTCTGACGCAGGTCGGTGGCAATCATCGAGT
+TGGAATCGGCAATGCTGTTGTTCTGGCATTTCGGGCAGCGCAGTTCTTCAGTGAGCTGAC
+GGAACTGTTGTTCCTGTGCTTCATCTTTAAACTGCAACACATCGATGGTCGCCAGCGCTG
+AGCCGGAGATCATCAGCATCAGCACGCCCAATAAAAACCTCATTGTGCGGCCTCCTTACT
+GTATTTCTCCCACAGCGGCTTGATCTCTTCTTCCCAGACGCGAGGATTCAGATCGCCCGC
+ATGGCGATAGCGAATGATGCCGTTGCCGTCAATAAGAAACGTTTCTGGCGCGCCATAGAC
+ACCGAGATCCAGCCCTAACATGCCATCGCCATCAAACAGGCTTAGCGCGTAAGGATTGCC
+CAGCTCTTTCAGCCAGCTGATTGCCTTCTGGCGATCGTCTTTATAGTTCATGCCGACCAC
+GCGGATGCCCTGCGCAGAAAGCTGATTCAGATATTGATGTTCCGCACGGCAGGTCGGACA
+CCAGGTCGCCCAGACGTTAAGCAGTACTGGTTTGCCCTGAGTCAGCACATCCGCCTGATA
+AAACTGCCCCGGATTGTCCAGTGATTCGAGACGAAACTTCGGCACAGGCTTGCCAATGAG
+CGCCGATTCCAGATTGGTCGGATCATCCCCTTCGGCATTACGCGCCAGCTGCCACAGCAG
+CGCCGCGGCAATCGCCAGGAAGATAATCAACGGAATTAACAATACTTTGCGCTTCATACG
+GCCTCCGGCGCAGTTTTTTGCGGACTCACGCGCTTACGATAGCGAGGATCAAACAGACAC
+AGCAGTCCGCCCAACGCCATCATCAGCCCGCCCGCCCAAATCCAGCGAACAAATGGTTTG
+TAGTAAAGACGCACGGCCCACGCGCCGTTTTCCAGCTCTTCACCGAGGGCCGCGTACAGG
+TCACGCGTGATGCCGCCGTCAATTGCCGCTTCGGTCATCATCGACCCGGCAGTGTTGTAA
+TAACGTTTTTCCGCATACAGCACCGTTTCCGGCTTGCCATCGCGCGTTACGCCGATAGTC
+GCCACACCGCCACGCCAGTTCGGGCCAGTCACCTCTTTGACATCACGGAAGGTGAAGCGA
+TATTCATGAATATCGACGCTATCGCCGGACTTCATGCGCACATCACGCTCAACGCTATAG
+TTCTGGCTAAAGGCAATGCCAACAATTGTCACTGCCAGCCCAAGGTGAGCCGCCACCATC
+CCCCAATAACTGAAGGTGGTTTTCGTGCCGCGTGAAATACGTAGCGCAGCTTCCGCAATT
+GCCAGCACCGCAATCCAGCAGGCCATTGCCAGGCCGAGCACCGTCATCGCCACAACTTTG
+CTTTCGAACAGCCACGGCAACAGCAGCGACAGCACCAGCGTAGAGATGAAGGCGATAATC
+AATAAATTGCGGATCTTACGCGGGCGATCCCGCCCCCAGCGCACCAGAGGACCGACACCA
+AGCAGTAGCGCAAACGGCACCATCAGCCAGGTAAACATGGTGTTGAAGAACGGTTCGCCA
+ATCGAAATACTGCCCAGTCCCAGTTGCTTATGCACCAACGGCAGCAGCGTCCCCAGCAAC
+ACCACCAGCATCGCAGCGACCAGCAAAACATTGTTCGCTAACAGCAAAGATTCCCGCGAC
+CACAGCGCATTGTTTACGCGTGAGCGAACTTTGTGTCCACGCGCGGCAAACAGCAGCAGC
+GAACCGCCAATCACCAGCACCATAAAGGCGAGGATAAACATACCGCGCGCCGGATCAGAC
+GCAAACGCGTGTACCGATACCAGCACGCCGGAACGCACGAGGAAAGTCCCCAACAGACAC
+AACGAGAAGGCACTGATTGCCAGCAGTAATGTCCACGCTTTGAAGCTGGCGCGTTGTTCA
+GTGACCGCCAGTGAGTGCATCAGCGCAGTCCCCACCAGCCACGGCATAAACGAGGCGTTT
+TCTACCGGATCCCAGAACCACCAGCCACCCCAGCCGAGTTCGTAATAGGCCCATGCGGAA
+CCGAGCACGATGCCGAGCGTCAGGAAGATCCACGCTGCCAGCGTCCACGGACGAGTAAAA
+CGCGCATAAGTGCTGTCCAGACGCCCGCTCAGCAAAGAAGCAATGGCAAAAGCAAACGCC
+ACCGAGAAACCCACGTACCCCATATAAAGCAGAGGCGGATGGAAGATCAGCCCCGGATCC
+TGCAATAGCGGGTTAAGATCGCGACCTTCAATCGGGAAGTTCGGCAACGTGCGAGAGAAC
+GGGTTAGAGGTAAAGAGAATGAACAGCAAAAAGCCGACACTGACCATCCCCATTATCGCC
+AGTACACGGGCCACAATATCCAGCGGAATACGCTGACTAAAAATCGCCACCGCAAAGGTC
+CAGCCGCTCATCAGCAGCACCCACAGCAGTAGCGAGCCTTCATGCGCGCCCCAGGTAGCC
+GCCACGCGATACCACACCGGAAGCTGGGTATTGGAGTTGCTGGCAACATAGGTGACGGTG
+AAGTCGTTGACCACGAAAGCATTGACCAGCACCAGAAATGCGCCAGCCACAGACATAAAC
+AGCAGCCAGGCAAACAAGCGGGAAGACGCCATCATGCGCGCATCTCCGCGCGCCACGCCC
+CATAGCGGATACACGGACAGCAGCAGCGCAATTCCCAGCGCCAGGCACAGCAGTCCGTTA
+CCAATTTCTGGCATCATGATGCTGGGTCCTTATAAACACTCGCCGGGCGACGGTGGTTAG
+CTTCCATCGCTTTCTCAACTTCTGGCGGCGTATAGTTTTCATCGTGTTTCGCCAGCACTT
+CTTTCGCGAGGATATGATTGCCTTTTTCCAGTTCGCCCTGCACCACAACGCCCTGCCCTT
+CACGGAACAGATCCGGCAAAATGCCTTCGTAAGAGACATCCACTGAGCCTTCAGCATCGT
+AAATGGTGAAGGTCACTTTCAGCGAATTGGGATCGCGCTGCACACTACCCGGCATCACCA
+TCCCGCCAACGCGCAGACGCTGACCGACTTCCGGCATTTGCTGAGTTTCACGCTTGCCGT
+AGAGAATTTCCCCCGGCGTATAAAAGAGATCGATATTCGAGCGCAGCGCATATAGCACCA
+GACCGATAGTCAGCGCCAGCCCTGCCAACACGGCACAGGCAATCCACAAGCGGTTTTTAC
+GGCGAATATTCATGCAGCCTCCTGCTGTTGCGCAGCACGTAAACGCGCCTCACGCGCCCG
+CTGTTGCGCCACGCCACGCAGAATTGCGCGATGTTGCATCACCGAGTGCACGACCAAAAC
+CACCAGCGGAATAACGGTCATCACCACCGCCAGCCAGACAAAAAAGGCGTAACCGCCCAT
+TGCGAAAAATTCATTCCAGGAAGCAAATGCAGGGGTCATTTACGGCCTCTTTTCAGTATC
+AGTTCACTCACCCACGGACGGCGTTTTTCCATCAGCAAAATCAAATTACGCATCCGCATC
+AGCGTCAGCGTGGCAGACAGGAGCAGGAAGCCAAAAATCGACCAGCGCAGCGGCGAACGC
+ATCGCCGGATCGATACTTTGCTGCATCCGCGTTGATCCCTGATGCAGGGTGTTCCACCAC
+TCCACGGAGTAATGAATAATCGGCAGATTCACCACGCCAATCAGCACCAGGATACCTGCC
+GCACGGCCCGCCAGACGGCGGTCGTCGAAGGCGTGCCACAGGGCAATCACACCCACATAC
+AAAAACAGCAGCACCAGTTCAGAAGTCAGACGTGCATCCCATACCCACCAGGTGCCCCAC
+ATCGGTTTTCCCCATGCAGAGCCGGTAACCAGGGCAATAAAGGTAAACACGGCACCAATG
+GGGGCCATCGCCGCCACCGCCAGGTTGGCCATTTTCATCTGCCAGACAAGGCCAATAAAC
+GCTGCCACTGCCATTGATGCATAAATGCCCATCGACCAGATCGCCGCAGGCACATGCAGG
+TAGATAATGCGGTAGCTATTTCCCTGCTGATAATCAGCCGGAGCAAAGCCGAATCCCCAG
+ATCCAGCCGACGGTAAGCACGACCACACTGGCAATTGCCAGCCACGGTATAAACCAGCCA
+CAGATTTGATACAGCCGTGGTGGGATCGCCAGTTGATGCAGTGTTTTCCACATAGTTTCG
+ATACCAGACTCGAACAAAAATCAGTAATCCAGCGTTATTGAATGCTGATTCGTAACGCTG
+CCGCCGTCGCAAAAGGACTTAATGTCGCGGTGCCTGCCAGCAACGCGCCTAAAATTGCCA
+GATACCCGTCAACGGGCAAATGCATAGAAGCCGCGTCCATCGCGGCGGTGGCAAAGATGA
+GTAATGGGATAGTCAGCGGTAACACCAGTATGCTGAGCAGCACACCACCGCGCTTAAGTC
+CCACTGTCAGCGCCACGCCCGGTGCACCGAGAAAGCCAAGCGTAGGCGTTCCCAGCAGCA
+GCGTCAGCGCCATCACTTGCCAGCCATAAACATCCATTCCCAGTAGCATTGCTACCAGTG
+GCGAAAGGATGAGTAACGGCAGACCGGTTACCATCCAGTGCGCCATCACCTTCGCCAGCA
+CAACGGCGGGCAAGGGTAACGGCAACAACATCAATTGTTCAAGACTGCCGTCCTGCAAAT
+CGTCACGGAACAGTCGTTCCAGCGCCAGCAAGGATGAAAGCAGCGCAGCAACCCAGATAA
+TGCCCGGTGCAATACGCGCCAGCAGTTGCGGCTCCGGACCGATACTGAGCGGAAAAAGGG
+TAATTACAATCAGGAAGAACCACAGCGGGTTGGCGATTTCGGCGCTATGGCGAAACGCTA
+CACGCAGCTCAAGACGGAAAATGCGCCAGAACATCATGCGGCCCTCGTTTGCGTCAGTGA
+AATGCGGCGAATTTTACTTTCAGCAACGTTGAGCGGCTGGTGGGTAGTCAGAATCACAAT
+CCCCCCCTGCTCCGTATGCTGCGCCATACGCTGGGTCAGACGATCGACACCGTTAACGTC
+AATCGCGGTAAAAGGCTCGTCGAGGATCCATAACGTGGCACGGGTCAGCCACAGACGCGC
+TAAAGCGACGCGGCGTTGTTGCCCGGCCGAGAGCTGATTTACAGGAATATCTTCGAATCC
+GGCAAGCCCGGCCTGCGCCAGGGCTTCCAGACATTGTGCGGTATCGCCATCGCGATGATA
+AAAGTGCAGATTTTCTAACGCCGTCAGCCGGGTTTTGATCCCCGGCTGATGGCCTATCCA
+TAACAGGTTTTGATGGTAGCTGTCGCGTACCTGATGCAAGGGCTGCCCTTGCCAGAGAAC
+CTCGCCTGCGTCAGGGCGAGACAACCCCGTCAGCAAACGGAGAAGCGTTGTCTTCCCCGC
+GCCGTTGCTACCGGTGATTTGTACCCACTCTCCTGCGTTCAGCGTAAATGACAAGCCACT
+AAATAAGGTTCGTTCATCCCGCTCACAAAGTAACTCTCTGGCTTCAAGCATACCCACGCA
+ATAACCCTGTTAAAAACCTGGCTCGACTTCACGCATATCGGGCAGCTTGTGCGCTATCCC
+TTTATGGCAATCAATACAGGTTTGCCCATCTTTCACCGCCTGGTCATGCATCTTCGCGGC
+AACCGATTTCTGGGCGGTTGTATCCATATACTCGAAGTTGTGACAGTTACGGCACTCCTG
+CGAGTTATTGTCCTTCATGCGCCGCCACTCATTCTGTGCCATCGTCAGACGATGAGCTTC
+AAATTTCTGCGGCGTGTCAATAACGCCAAAAATTTTACCATACAGCTCTTTACTTGCTTT
+GAGCTTGCGTATCATCTTCGGCACAAACTCGTGCGGAACGTGACAATCCGGACAGGTCGC
+ACGGACGCCGCTACGGTTGTTGTAGTGCACGGAATCCATGTATTCCTGATACACCGTGTT
+GCGCATTTCGTGGCAGCTAATGCAGAACTCTTCGGTATTGGCTTTTTCCATCCCGGTGTT
+AAAGCCACCCCAGAAGACGATGCCGCCAACAAAACCGATCAACAGCAGCGTCCCCAGCGC
+CAGACGGCTGGGGGTACGCCACCATTTCCACAGGCGCTTAATCAGACCAGGCTTACGGTC
+AGAATTTCCCATAATAACCTCTTATTTCCCGTAACCTTTTGATGGGGTAAAGGTATTCCC
+CACGATTGGCGCGGTATCGGCCTGCGGTACGTGACATTGCAGACAGAAATAACGACGCGG
+AGCCACTTCCGCGCCCACTTTGCCGTCGCTGTCCATAAAGTGAGTAGGACTGATACGCGG
+CGCGCCAGTGGTGCGATAGCTTTCGACACCGTGGCACTGCAAGCAGCGATTGGTATTGGT
+CGTTACCTGATAACCTTCAACGCTATGCGGGATCATTGGCGGCTGATTCACATAGTTCAG
+CGGCATCCGATCCTGCTCTTTTGGCATCCGAATGGCCCCTTCCTGTGTCCCGGATACTTC
+CGGCGACTGGCTAAAATCGACGCCATTAGCCGCCCAAACCGCGCCGCTTACCACCAGGGC
+CAGCATCGCCGTCCATTGACACAGCGCTTTCTTCAGGTCATGGCTTTTCATGATTTCGCT
+CCCGAACTCCATCGTGTAGTTATTGTAAATACATCCTCAGAACAGACATCCACGCAGCGA
+CCGCACGTCATGCAATCGCGGCTGGTGACCTGCACCGGGCTTTGTTCATCCAGCACCGGG
+GCACGTAGCACATGCGGTTCCGGGCAAACATGAAAACAATCCATACAGCGGTTACATTTC
+TGCCGATCGGTGGCCGCAACGGTAATCACACCTTTGCTACCCAGCACGCCATACAGCGCG
+CCAACCGGACAAATGTGCCCGCACCAGCCGTGTTCAACGACCAGTAGATCAAATAAAAAC
+AGCGCGAGAATAAGCAGCGCGCCGCTGCCGAAGCCCATTACCAGGCTACGCCCCATCAGA
+GAAACGGGGTTGATCCATTCCCAAATGAGCGTGCCAGTTAAGGCTGATCCCACCAGAATG
+ACCACCAACAGCACGTAGCGAATGTGGCGAGGGATCGTCGCAGACTGATTGAGGTCAAAG
+CGCCTGCGTAACCAGTTCGCTAAGTCGGTAATCGGGTTCAGCGGGCAGACCCAGCTGCAA
+AATAATCGCTTTCCCGCCAGGGCGTAGAGCACGGTGATAATCACCGCACCGGTCAACGCC
+ACCGTGGCAGGCAGATGACCACTGGCAAGACTTTGCAGCGTCATCAGCGGATCGGTCAGC
+GGAACGGTGTCGAATAACAGGCTACTGCTGTAGTTGCCGTGCAAGATCCACACACCAAAC
+CATGGACCGCTCAAAAACATCCCCAGCACGAAGAACTGACAAAGGCGACGTAACACCAGC
+CAACGGTGACTGCGCCACCAGCCTTTTTTCTCCAGCGCCTCGCGCCCGGCGTCACGTTTA
+CGATTTGCCATTGTTCCCCTCCAGCCAGCCGAAGCGGTAATGGTGACCTAACTCCCCTTT
+CGCCAGTGACAGCGGTAACACCTTGATTGCCGGTTGTTCCAGCACGCATACTTTTTCGCA
+CTTACCGCAACCGGTACAGGCGTCGCTGTGAACCGTCGGCAGAAAGCGGGCGTGCTTACC
+GGTACGCGTGTTGCGCTCCAGCTCCAGGGTGATGGCCTCATCAATTTTCGGGCATTCGCG
+ATAACAAACATCGCAGCGCAGCCCCTGAAAGTTGAGACAGTTTTCCTGGTCCACCAGTAC
+CGCCAGCCCCATCCGCGCGTCGTCGATCGATTCAATCTCACGATCCAGCGCACCGCTTGG
+GCACACTTTGGCGCACGGAATGTCCTCACACATTTCGCAAGGAATATCCCGTGCGACAAA
+ATATGGCGTGCCCGCCGACAGACCAGAGGCCAGCGTCGCCAGTTTTAAGGTGTCGTAAGG
+GCAAGCCTGAACACACTGACCGCAACGCACACAGGCACTGGCAAAGGCGTTCTCGTTTAT
+GGCTCCGGGCGGGCGCAACCGCACGCCAGATGCGCGTGCGGTTTGCTGTTGTAACCCCAG
+CGCCACACCCACGGCAGCCAGCCCGCCTGCTGTGCGAACGACATCGCGCAGAAAGCGGCG
+GCGACCATTTTGAGGTTTCGCTGACCGGGACATAATGGCTTACACCTTCTCCAGTTTGAC
+CGCGCACTTCTTGAAGTCCGTCTCTTTCGAGAGCGGATCGGTCGCATCCAGCGTCAGTTT
+GTTAACCAACTGTGCGGCGTCGAAGAACGGCATGTACACCAGGCCCTGTGGCGGACGGTT
+ACGACCGCGCGTTTCAACAATCGAGATCACTTCGCCACGGCGAGAAACCACTTTCACTTT
+GTCGCCACGGCGCAGATCGCGCGCTTTCGCATCCAGCGGGTGAATAAACAGGACCGCTTC
+CGGGAAGGCGCGGTGCAGTTCTGGTACACGGCGAGTCATACTGCCGGTGTGCCAGTGCTC
+CAGAACGCGTCCGGTAGAGAGCCACAGGTCGTACTCTTCATCCGGTGCTTCCGCCGCCGG
+TTCGAATGGCAGTGCGAAGATCACCGCTTTGCCATCCGGTTTACCGTAGAACTTATAGCC
+TTCGCCCGCTTTCACGTACGGGTCGTTACCTTCGCTGTAACGCCACTGCGTTTCTTTACC
+GTTCACCACCGGCCAGCGCAGACCGCGCGCTTTGTGGTAGTCATCGAACGGTGCCAGATC
+GTGACCGTGACCGCGACCAAACCATGCGTACTCTTCGAACAGCCCTTTTTGCAGATAGAA
+GCCCAGCTCGCGGGATTCATCGTTCAGCTGATCTTCCGCCAGTTCGGATACCGGGAATTT
+GCTCACTTCCGGTGTGGCATACAGCACTTCGTACAGCGTTTTGCCACGCAGTTCCGGTTT
+CTTCGCCAGCAGATCTTCCGGCCATACTTCTTCAGTTTTGAAGCGGCGGGAGAACTGGAC
+TAACTGCCAGAGATCCGATTTCGCTTCGCCCGGTGCCTGTACCTGTTGACGCCAGAACTG
+AGTACGGCGTTCGGCGTTACCGTAAGCGCCCTCTTTCTCTACCCACATTGCGGTCGGCAG
+GATCAAGTCGGCGGCCAGCGCACTGACTGTCGGATACGGATCGGAGACGATGATGAAGTT
+GCGCGGATCGCGCCAGCCCGGCATACGCTCTTCATTGATGTTCGGCCCGGCCTGCATGTT
+GTTGGTACACATGGTCCAGTAAACATTCAGTTTGCCGTCTTTCAGCGCACGGTCTTGTGC
+CACCGCGTGCAGACCGATTTTCGCCGGAATGGTGCCGCTCGGGATATTCCACTTCTTCTC
+GCAGATATCACGGTGTTTCTCGTTGGTCACCACCATGTCCGCAGGCAGACGGTGAGCAAA
+GGTGCCCACTTCACGCGCAGTACCACACGCAGAAGGTTGCCCGGTCAGGGAGAACGGACC
+GCAACCCGGCTGGGAAATTTTGCCGGTCAGCAGGTGCAGGTTGTAGACCAGGTTGTTAGC
+CCACACGCCACGAGTATGCTGGTTGAAGCCCATCGTCCAGTAGGAGATGACTTTCTTGTT
+CGGATCGGCATACAGCTGCGCCAGTTGTTCTAACTGGTCTTTCGGCACGCCGGTCATTTC
+GGCAGTTTTTTCCAGCGTATACTCGGCAACGAAGGCTTTGTAATCTTCAAAGCTCATCGG
+TTCGGAGGCGTCAGAACCCGGATTCTTCGCTGCTTTTTCCAGCGGATGGGTCGGACGTAA
+ACCGTAGCCGATGTCCGTCGCCCCTTTGCGCAGGTTAACGTGCTTGCTGAAGAAGTCCTG
+ATTTATCGCATTGTTTTGAATGATATAGTTGGCGATGTAGTTCAGGATCACCAGGTCAGA
+TTGCGGCGTAAAGATGATGCCGTTATCCGCCAGCTCGAAGCTACGATGCTGGTAGGTAGA
+AAGCACCGCCACGGTGACGTTCTGGTTAGAGAGACGACGGTTAGTGATGCGCGACCAGAG
+GATCGGGTGCATTTCCGCCATGTTTGCGCCCCACAGCACAAACGCGTCAGCCTGCTCGAT
+GTCGTCATAGCAGCCCATCGGCTCATCCATACCAAAGGTACGCATAAAGCCAACTACTGC
+CGACGCCATACAGTGACGCGCGTTCGGGTCGATGTTGTTCGAACGGAAGCCCGCTTTAAA
+CAGCTTGGACGCGGCATAACCTTCCCAGATAGTCCACTGACCAGAACCGAACATACCGAT
+CGATTCCGGCCCTTTTTCTTTCAGGGCGGTTTTGAATTTCTCTTCCATCACATCGAAGGC
+CTGATCCCAGGTGATTGGGGTAAATTCGCCTTCTTTGTCATATTTACCGTTTTTCATACG
+CAGCAGCGGCTGCGTCAAACGGTCTTTACCGTACATGATTTTGGGCAGGAAATAGCCCTT
+AATGCAGTTCAGGCCACGGTTAACCGGTGCGTCCGGGTCGCCCTGACAGGCCACCACACG
+TCCCTGCTGCGTTCCGACCAGAACGCCGCAACCAGTACCGCAGAAACGGCACGGCGCTTT
+ATCCCATTTGATGGCTTCCTGCTGACCAACAACGGCGCGGGCAACGCCCGGCACGCTGAG
+ACCGGCAGCCGCCGCAGCGGCCGCAACGGCGTTAGCTTTCATAAAGCTACGACGACTGAG
+TTTCATGGTGTTTCCTCACCTTGCTCTTCCTGCTGGTGATAAACCAGCGACACCGCCAGC
+ACGCCCTCTACGTTGCGTACTGACTCAATGGTTTGGATCAGCGTTTCGCTGTCTTCTGCT
+TCCACCACCACAATCAACTGACCGCTCGGCGCGTCGCTGACAGCAACTTCACAGCCGGGA
+AAGGCGTTCAGTTGGGTGCTGATGTCTGAAATTCGTTCGCTTTTGGCCTGCACGACCAGG
+CTGCAAACTTGCCAGTTAGTGTGCATGGAGATACTCCGCAGTTATGGCTGATACCGGACA
+GCTGGCTGCACATGCTCCACATCCGTTGCAAAGTTGGCTATTAAGTTGCGGCTGGTAGAT
+CCCGGAGAGCGTCGGGCGAAAGATAATTGCCATTGGCTCACAGCTATCCTGACAGCGGCG
+GCATTCAACTGACTGATACGCCAGGCACGCGTCCCCGATGGTGAACTGCAAATCCCAGGC
+CCTGGTGTGGCGCGGAGAAAATAGCGATTCGGGGCAAGCCTGCGCGCAGGCGTAACAGAA
+GCTGCACTCGTTATTTTTGAAATTAACGCTCGGATAGCCGCCCGCGCCGCGTTGCAGAAT
+GTTGTTTTCACAAGCATTAATACAGGCGTCGCAGCGGGTGCAATGGGTCAGAAAATGAGA
+TTCATCACCGGACCAGGGCGGACGGATACCGTTACTGGCTTTGCGCCAGCGACCAGTGAG
+TATGCCCCGACGGGATGCATCAATCTTCACATTGACCTTCCATCATTAACGCGCTCTGAA
+AATTGAGAGCGACCAAATAAACCGCATAATTAATAAGCCATTTTTATAGCCGCTAAGATA
+TTAAAGGATGTGTCAAAGATGCATACCCCGATCGGGGTAAAACCTGTAGCAGGATCAAAA
+GAGTGGCGGGAAGCGTGGCAAAAACGGGCTTTTGCTCACATTTCAAATGGTTATAAATAT
+ATTTATATAGCGATTGATTCACCAGAGATATTTCTGCTGGTTTGCTCTCTCATTAGAATT
+TAACACTAAAAGAGCAGGTAAAATTGTCTGAATGTTCTTTAAGTTATTCATAAAGCAAAT
+TAATAAATCTGATGAATATGTTAACCTTCAGCGACATCATCGGTGAAAACCTATAAATGA
+AGAAGGAAAGCAAAAAAATGAAGACCATTCTACCTGCAGTATTGTTTGCCGCTTTCGCTA
+CCACTTCCGCCTGGGCGGCAGAAAGCGTCCAGCCACTGGAAAAAATCGCGCCTTATCCAC
+AAGCTGAAAAAGGGATGAAGCGTCAGGTGATTCAGTTAACCCCGCAAGAAGATGAATCTA
+CCCTGAAAGTAGAACTGTTAATCGGTCAGACGCTGGAAGTCGATTGCAATTTGCATCGTC
+TCGGCGGGAAGCTGGAAAACAAAACGCTGGAAGGCTGGGGCTATGATTATTATGTCTTTG
+ATAAAGTCAGTTCCCCGGTTTCAACGATGATGGCCTGCCCGGATGGCAAGAAAGAGAAGA
+AATTTGTCACCGCGTATCTGGGCGATGCTGGAATGCTGCGTTACAACAGCAAGCTGCCGA
+TCGTGGTGTATACGCCAGACAATGTAGATGTGAAGTACCGCGTCTGGAAGGCGGAAGAGA
+AAATTGACAACGCGGTAGTTCGCTAAACTGCCGTGAAGTGCGGCACCCCGTAGGTCAGAC
+AAGGCGGTCACGCCGCATCCGACATCCAACGCCCGAGCCGGTTGCCTGATGCGACGCTGG
+CGCGTCTTATCAGGCCTACACCGCTGTGAAGTGCGGCACCCCGTAGGTCAGACAAGGCGG
+TCACGCCGCATCCGACATCCAACGCCCGAGCCGGTTGCCTGATGCGACGCTGGCGCGTCT
+TATCAGGCCTACACCGCTGTGAAGTGCTCCACCCCGTAGGTCGGATAAGGCGGTTACGCC
+GCATCCGACATCTAACGCCCAAGCCGGTTGCCTGATGCGACGCTGGCGCGTCTTATCAGG
+CCTACACCGCTGTGAAGTGCTCCACCCCGTAGGTTGGATAAGGCGGTTACGCCGCATCCG
+ACATCCAACGTCCGAGCCGGTTGCCTGATGCGACGCTGGCGCGTCTTATCAGGCCTACAC
+CGCTGTGAAGTGCTCCACCCCGTAGGTCGGATAAGGCGGTTACGCCGCATCCGACATCTA
+ACGCCCAAGCCGGTTGCCTGATGCGACGCTGGCGCGTCTTATCAGGCCTACACCGCTGTG
+AAGTGCTCCACCCCGTAGGTTGGATAAGGCGGTTACGCCGCATCCAACATCTAACGCCCG
+AGCCGGTTGCCTGATGCGACGCTGGCGCGTCTTATCAGCATACGCCACATCCGGCATACC
+ATGCCGGATGTGGCGTATCATTACAACGCAATATCCGCCACTTCTTTTTGAACGGGTTGC
+GGTTTCAACTGCGGTTTCGGCGTACTATCTGCTGCCTGCGGCTTGTCGTAGTTCAACCCC
+AGCACTTCGCTGGTGTACTGCAACTCGCGTTCTGTTGCCGCTACATCACCGTTCAGCTTG
+CGTCCATAAGACGGAACGATCGCTTTCAACGTAGCCTGCCATTGCGGGCTGGAAACACGA
+TCGCCAAATACTTTTTCCAGCAGATTCAACATAATCGGCGCGGCGGTTGACGCCCCTGGC
+GATGCCCCCAGGAGCGCGGCAATGGTTCCTTGCTGGTCACTGACGACTTCAGTACCCAGA
+CGCAGTACGCCACCTTTCTCGGCATCACGCTTGATAATCTGCACGCGCTGCCCCGCTTGC
+CACAAACGCCAGTCCTCTTTTTTCGCCTGCGGATAGTACTCTTTCAACGCTTCAAAACGA
+TCCTCTTCACTCAACATCACCTGACTCACCAGATATTTCACCAGATCGAAATTATCCAGC
+CCGACGTGCATCATCGGCATCACGTTAGAGGTGGTGGTGGAACTCATTAGATCCCACAAT
+GAACCGTTTTTGAGGAATTTGGTTGAGAAGGTGGCAAATGGCCCAAACAGCACTACGCGT
+TTACCGTCCAGAACGCGGGTATCGATATGCGGAACCGACATCGGTGGTGCGCCAACGGAT
+GCTTTACCGTAAACCTTCGCCAGATGGTGATTAACCACGTCCGGGTTTTCCGAAACAAGG
+AACTGTCCGCCCACCGGGAAACCGGCGTAGTCTTTCGCTTCCGGAATCCCCGATTCCTGT
+AACAGCTTCAGCGCCGCACCGCCCGCGCCGATAAAGACAAATTTGGCACGAATGTTCTGT
+GCAGTGCCATTTTTCAGATCGGCAACGGTAACGGTCCAGGTGTTATCGTCATTACGCTTT
+AGGGCGCGGACTTCGCTGCTGAGTTGCAGCGAGAAGTTAGATTTCTTCTGCAAGGAAGCA
+ATTAACTGGCGGGTGATCTCGCCGTAGTTCACATCGGTACCAATTTCCGTACGCGTGGCT
+GCCACTTTCTGTTGCGGATCGCGCCCTTCCATCACTAACGGTGCCCACTCTTTGATCTGC
+GCGTGATCTTCAGAGTAACGCATACCGCGAAACAGCGAGCTTTGTTGCAACGCGGCGTAA
+CGGGCGCGCAGGAAATTGACGTTATCCTCGCCCCAGACAAAGCTCATATGCGGAACGGTA
+TTGATAAATGAACGCGGAGTACGCAGCACGCCGCGCTCAACCTGGTGCGCCCAGAACTGG
+CGGGAAATCTGAAATGCTTCGTTAATGGCGACTGCTTTTTCAATACTGATGCTGCCATCG
+GCGTTTTGCGGGGTGTAGTTCAGTTCCATCAGTGCAGAATGCCCGGTTCCGGCGTTATTC
+CAGCCGTTCGAACTCTCCTGCGCGACACCCTCCAGGCGCTCCACCATGGTCATCGACCAT
+TCAGGCTCCAGCTCGCGTAAATAGGTCCCCAACGTGGCGCTCATAATGCCGCCGCCAATC
+AACAGTACATCAGTTTCCTGCTCCTCGGACGCTTTCGCTTTTGCCGCCATCGAAACGGCA
+TTAAGCCCCACGGCCATCGAGAAGAGCATGGCAGTCACTTTTTTCATCTTGTTAATGCCT
+TACTTTTAGTCGCTTTATTGCAGGTGAGATTTGCGCGGCATCAACGGTAACACTTAAGTA
+ACAACATTTAAATAATGTTTATAAATTATATTCTAATTTTAGAAACATTATAATTTCGTT
+GATTAATTATAGGGTTATTAGAAATGAAGGGATTTTTAGCATATTGACCTGACGGCAGCA
+GTCCGCCAGGTCAGCGTCGTAATATTATGCCGTCCGGGCAACGGCATCACGCGAAGCGGC
+ATCGCGCTCTTCGCCCGTCAGCTCGCTAAGTTGCCCATTGCGCATTTCCAGCAGGCGGTC
+GGCGTGGATAAAGTAATGATCATCATGACTGATAGCGAAAATAGTTTTACCCATCTCCTG
+CATCAGCGGCAGCAACACCTGATAAAACTCACGACGGAAGTGTGGATCCTGATCCGCCGC
+CCATTCATCCAGCAGGATAATATCGCGTTCTTCTGCCAGCGCCAGCAACAGCGCCACGCG
+TTTTTTCTGCCCTTTTGATAACTTCAGGTTAACAATACGCCCGTTGCTTAACTCAAGCTT
+ATGAGCCATTTTCAGCTGCGCCAGCCACTTCTCAACCAGTTGCGGGTTAGCGGGTTTACC
+CTCCGGCCCCAGCAGTTGATCAAACAGCCAGACATCGGTAAACACTGCCGAAAACAGTTT
+GCGATAATCTTCCGGTTGTTCGCCGCTGACAGGTTTGCCATCCAGCAAGATTTCGCCGCT
+TTGTGGCTGATACAAGCCCGTCAACAACATCGCCAGCGTCGATTTTCCGCTACCGTTGCC
+GCCAATCAGAAACAGCAGCTCGCCACGTTTGATGGTGAGATTAATCGGACCAACGGAAAA
+CGCGTTATCCTGATAAGCAAACGTCACGTTACGCAGCTCCAGCGTTTGCCAGTTGGGAAA
+CGCCTGCGGGCGCGGAAACTCTGCTTTGAAAGGCGCGAGCGCGAATTTGTTCAGCTTGTT
+AAACGCCACCTGCGCCGTCAGCAGCGTCGGCAATGCGCCAACCGCCGAAAGCAGCGGCGT
+ACGCAGGAATAAAAGCGTCAACGAATAGGTCGCGGCAACGTTGGTATCAGCCCAACCGAG
+GCTGTTCGCCATCCAGAACACCAGGCCGATTGCGCCCAGCATCATGATGTTTGACCAGTT
+CACGGCACTAAGATGGAAGGTGTCTGCGCGAATAATATGGTGGCGATACTCTTGCGCATC
+AGGAATGTAGAGGTTGTTAAACACATACTCGGCGCGTTCCCGGTTCAGAGTCAGCTCTTT
+GCGCCCTTCAAGTACAGTTTGAAAATCCGTGTACAGCTTGTCTTCGGTTTCACGCAGGGT
+CGCCATATGTTTGTACACCCGCGCCACCAGCACAAAACCGCCCCAGATGGTGATCGCCAT
+CCAGATAGCCGTTACCAGCAACATTTTGCCCGACAGCATCCACAGATACGCCGCTGAACC
+GATAGTGAGAATGATCCCCTGCACCAGTTCCGGCAGACGCACAAAAGCAATGGTGATATT
+GCGCACATCGCTGGTTAACCCCGCCAGCAACGAGGCGCTACCGAGTTGTTCAATGCGCTC
+GACGTGAGTATCCAGAATCCGCTTGATAAATTCACTACGCAGTCGGTAAACGAAGTGATG
+CCCCAAAGTGGTGAGCGCCAGTTGCGATCCGAGAGTGACTGCCATCAACAGCAGCAATAA
+TCCCAGAAACTCCGGCAACACCAGCAGACTGGTATCCGCCGTTTCGATAAGGCGCTGATT
+GATAAAAGCAATTAAGCCAATGCCTAATGCCGCACTGGCGAGGCTTAGCGCCATCACACT
+GATAAATGGCCAGCGATACTGCCGCCAGACAAGTACAAGAAGTTCCATGCAGAAAACCCG
+GACAATGAATTACAGCCCGCAGTTTAAACATCTTCGCGCGCACAGCAATAATAATTCTTA
+TTTTTATTCTTTTTTACCTGCCTGACGGAATGTCAGGTTGTAGCGGCAGTCGATGGTGAG
+TGGATGAAACCCCGCTTTCAACGGTTGAATACCGTGATAAAACAGCCGCGATTCACCGCC
+CCATACCACCACATCGCCATGTTCCAACAACAAACGTTTGAGCGGATCATTTCGTTTCAG
+GCCGCCAAATTGAAAAATCGCGGGTAAGCCCAGAGAAACAGAAACAATTGGCGCGCGCAG
+ATCCGGTTCGTCTTTATCCTGATGCAGCGACAGTTTCGCGCCAGGAGCGTAGCGGTTGAT
+AAGACAAGCATCTGGCTGGAAATCTGGATAGCCCGCCGCCGTAGCCGCACGTTGACATAA
+ATTATGAAAACTCTGTGGCATGGCGGGCCACGGTTTATTTGTTTGCGGATCAATGGGCGA
+ATAGAGATAACCTTGCCGATGGGTCGTCCAGCCCAGATGCCCACAGTTGGTCATCGCCAC
+CGACATGGTATATCCCCCGGGGGTGACCATCTGGCGAAACGGCGACTGGCTGGCAACGTC
+ATTAATATCGCGGATCAGTTGCTCCGCAGCGTTAAAAGCAAAACGCCGTAAAATTACCGC
+ACCAGCCGCCAGTGGCTCTTGCCACGGTTCAGCATCGGCAAACAGATCCAACATTACCTC
+TCCTCATTTTCAGCTTCGCGGCGCAGCAGTTGCGCTTTACGCGACACGCCCCAGCGGTAA
+CCGGAAAGTGTGCCATCACCACGGACCACCCGATGACAGGGTATTATGATAGCCAGCTTG
+TTGGCGGCACAGGCGCTGGCAACGGCCCGTACCGCTTTCGGTTTGCCGATGGCGTTAGCC
+AGTTGCTGATAACTGACGGTTTCACCGCAAGGTATCGTGCGCAGTGCCTGCCAGACTTGT
+TGCTGAAAAGCAGTGCCGCGAATGTCCAGCGGTAACGTCAGCGGCGTATCGCGTTGATTG
+AGGCTGGCGATCACTTCACGCACATGTTGCTGAAACATCAGATCGGCAGGCGCGTTGTCG
+GCAGCGGGAAACATCTGCTGCAACTCGCTGATTAGTGTCGCGTCATCATCGCCCAGCAAT
+ATCGCGCAAATCCCCCGCTCGCTTTCTGCCACCAGGCAACGACCCAGCTCACAATCAGCC
+AGCGCGTAACGCACCGCCAGATTTTCGCCACCGTGACGGAATTGTTTAGCCGTCATGCCC
+AGCGTTTCGTCAGCTTTGCGATAGTAACTGCTGCTGTCGGGGAATCCGGCGTTAAGAATA
+GACGTCGTCACGCTCTCCCCTTTCGCCAGCGATTCGCGCAAACGGCGAGCGCGCCAGGCC
+TGTTGCCAGGCTTTAGGCGTCATTCCGGTAGTCGCTTTAAACAACCGATGTAGATGAAAT
+GGACTCATCGCCACCTGGTCGGCTAAGGCTTCCAGCGTTACAGGCGTTTCCTGTTCCAGC
+AGTCGACACGCGTGGGTGATTTTATCCAACCGATGTTGCTGGGCATTGGCTTTTTCTGGC
+TGACAACGTTTGCAGGGGCGAAAGCCAGCGGCGAGTGCCTCGCTGGCATTTGCGTAGAAG
+GAGACGTTTTCCCGCAAAGCATGTCTGGCGCGGCAAGACGGACGGCAAAAGATGCCTGTG
+GTACGCACGGCGAAAACGAATTCGCCGTCGGCATTCGGGTCGCGGGCTAAGACAGATTGC
+CAGCGTTGATCGTCAGTTAAGCATGTGGCTTTTTTCATAATCAGCTCCCTGGTTAAGGAT
+AGCCTTTAGGCTGCCCGGTCACCATCACGCAAAAACCAACAATCTTGCGCTTTAATTTTT
+TTCGCTGACAAGGAAGCTTTTAAACTGTGGTGACATCCAGGTTTTAAAGCTATCGCCTTC
+TTTGGTGATCATATAAACCGCCAGCCCTTCCCGGCGAACAACCTCTTTAGCTTTCTCCGG
+CCCGAGTACCATCAAGCCAGTATCCCAGGCATCGGCTTCCAGCGCCGTCGGAGCAATCAC
+CGTCACGGATACCAGATTGTGTTCGATGGGACGCCCGGTTTGCGGATCGATAACATGGGA
+AAGACGTTTGCCGTCCAGTTCGTAATAGTTACGGTAGCTGCCAGAGGTGCTAATCCCATG
+ACCGTTGATATCCACCACAGCCTGAACCGCGTTTTCTTTATCGGTTGGTTTTTGAATCGC
+TACCCGCCACGGCAGGCCTTCACCGTTCATACCACGGCTGTTCAGCGCGCCGCCCACCGA
+CACCAGATAGCGGGAAATCCCTTCCTGCTCCATCAAGCGTGCCAAATGATCGGCCGCATA
+GCCTTCGCCGACGGTGGAGAGATCGACATATAAATCCGGCAGGTCTTTTTGCAGATATTG
+CTGATGCGACTGATTGATGACCGTCAGGTGCTGTAAGCCGGTTTTGGCTTTCATCGCATC
+GATCTGTTCCTGGCTCGGAATTTGAACCGGCTGTTGTTCCGGGCCAAAGCCCCACAGATT
+CACCAGCGGCCCGACGGTTATATCCATCGCGCCATCGGTCTTCGCGCCAATGCGCAGCGA
+GGTGGTGACGATATCGGCCATCGCTTCACTTACCGGCCACGGCGATAAACTTTGCGAGTC
+GTTAAAGCGCATCAGCGCGGAATCTTTTTTATAGGTCGAAAGCAGCTGATCGTCGGCGTC
+CAGTTGGGTCTGAATCTTTTCTTTAAGTTCGGCGCTGCGTTTGGCGTCAATGCCCGGGAT
+GCTGGCACGCCAGAAGGTACCCATAGTTTTGCCTTCAAGAACGGTAACTTCAGTAGCGTG
+GGTTTTGGCGGGTTGTGGTTTTTGATCGCAACCAACAAAGAAGAGCGCGGCAGCCAGCAG
+TGCCACGCGGGTAAAGCTTATTTCCATACGTGATTATCCTCATGCGAACGGTCGCAAGAG
+TACACCAAAAAACTGAGTTTGTACGCTGAAAACAATGAAAAAAGGGCCCGCAGGCCCTTT
+GTTCGATATCAATCGAGATTAGAACTGGTAAACCAGACCCAGAGCTACGATGTTATCAGT
+GTTGATGCCAGCGTCACGAGTGAACTGGTTGTCGTCCAGCAGGTTGATTTTGTAGTCAAC
+GTAGGTGGACATGTTTTTGTTGAAGTAGTAGGTAGCACCAACATCAACATATTTCAGGAT
+ATCTTCGTCGTCGTAGCCACGACCCAGGTTTTTACCTTTAGACTGCAGGTAAGCCAGGGA
+CGGACGCAGACCGAAGTCGAACTGGTACTGAGCAACAGCTTCGAAGTTCTGTGCTTTGTT
+CGCCCAACCCAGGGAACCTACGCGAGTTGCGTTGTAGGTCTGGGTGTACTGAGCAGCCAG
+GTAGATGTTGTTAGCGTCGTATTTCAGACCACCAGTGTAGGTTTCAGCACGGTCGCCGTT
+ACCGATGTAAGCAGCGGTGTTCTGAGCATCAGTACGTTTGGAGCTGGAGATCGCACCACC
+GATACCGAAACCTTCGTAATCATAAGTGATAGAACCGCCGACGCCGTCGCCGTTTTGACG
+CAGTGCGTCACGACCGTTGTTAGTTACGCCACTAGTAAAGCCTTCACCAGATGGGTTGCC
+GTTTTTACCCTGGTACTGAACAGCAAAGTTCAGGCCGTCAACCAGACCGAAGAAGTCAGT
+GTTACGGTAGGTCGCGAAGCCGTTACCACGCTGCTGCATGAAGTTGTCAGAACCGTAGGT
+GTCACCACCGAATTCTGGCAGTACGTCGGTCCAGGAAGTTACGTCATAAACAACGCCGTA
+GTTACGACCGTAGTCGAAAGAACCCACATCCTGGAATTTCAGACCTGCGAATGCCACACG
+GGTCCAGGAGTTGTTTTCGTTTTCAGCGCTGTTGCCCTGGATCTGATATTCCCACTGGCC
+GTAACCGGTCAGCTGGTCAGTAACCTGAGTTTCACCTTTGAAGCCAAGACGCATGTAGGT
+CTGGTCGCCATCTACATCTTTGTTGTCAGAGAAATAGTGCAGGCCGTCTACTTTACCGTA
+CAGATCTAATTTGTTGCCGTCTTTGTTGTAAACTTCAGCAGCGTTTGCTGCGCCTGCTAC
+CAGCAGAGCTGGGACCAGGAGGGACAGTACTTTAACTTTCATGTTATTAACCCTCTGTTA
+TATGCCTTTATTTGCTTTTTTATGCCACTGCATACTGATTAACCCTCATTAATCAGTCGG
+CAAGTCCATTCTCCCCAAAAATGCAGAATAATCCAACACGAATATGATACTAAAACTTTT
+AAGATGTTTCATTTATCGCTATAGATGTTTCAAAATGTAAATGCAAGGGAACTTTTTAAG
+ATTATTGCGGAATGGCGAAATAAGCACCTAACATCAAGCAATAATAATTCAAGGTTAAAA
+TCAATAACTTATTCTTAAGTATTTGACAGCACTGAATGTCAAAACAAAACCTTCACTCGC
+AACTAGAATAACTCCCGCTATCATCATTAACTTTATTTATTACCGTCATTCATTTCTGAA
+TGTCTGTTTACCCCTATTTCAACCGGATGCCTCGCATTCGGTTTTTTTTACCCTTCTTTA
+CACACTTTTCATTATTCTGTGCTACCACAGAAAAACTATAACGCTTGTTAACTATTTCAC
+AAATAATTAACATCCGCATAATTTCCAGCAATCTTTGTTTATTTGCAATTATTTTTGTTG
+GGCTTTTTGTAGGTTATTTGTACAGCAAAATGGCGCTTGTACATCTATTTCCCCCAATGC
+AGGATGATAAATATCACGGGAGAATAGAGAATCATCAATCAGGTAAGAGTCTGGAATTTC
+ACACTGTACCCTTTATACTGCCCTATCACTTCGCGAAGTTTTAACAGGTCATAAACACGA
+ATGCGTCAGAAAGAGACAACGGCCACGACCCGCTTTTCACTCCTACCGGGGAGCATTACC
+CGCTTCTTTTTACTGTTGATCATTGTGTTACTGGTGACGATGGGTGTAATGGTACAAAGC
+GCCGTTAACGCCTGGCTGAAAGATAAAAGTTACCAGATTGTCGACATTACCCATGCTATC
+CAAAAGCGCGTCGATAACTGGCGTTACGTGACCTGGCAGATCTACGACAACATTGCCGCG
+ACGACCTCCCCCTCCTCCGGCGAAGGTTTACAAGAGACGCGCCTGAAACAGGATGTCTAC
+TATCTGGAGAAACCACGCCGCAAAACGGAAGCGTTAATCTTTGGCTCTCACGACAACTCA
+ACGCTTGAGATGACTCAGCGGATGTCCACTTATCTGGATACATTGTGGGGCGCAGAAAAT
+GTACCGTGGTCGATGTATTACCTGAATGGTCAGGATAACAGTCTGGTGCTGATCTCAACC
+CTACCCCTTAAAGATCTCACCTCCGGATTTAAAGAATCGACCGTCAGCGACATTGTTGAT
+TCACGTCGTGCAGAGATGTTGCAACAGGCCAACGCCCTCGATGAACGCGAAAGCTTTTCT
+AACATGCGCCGCCTGGCCTGGCAGAACGGTCATTACTTTACATTGCGTACTACCTTTAAC
+CAGCCAGGACATCTGGCAACGGTCGTGGCTTTTGATCTGCCGATTAATGATTTGATCCCA
+CCGGGTATGCCGCTGGACAGTTTCCGCCTTGAGCCAGACGCGACGGCAACGGGAAACAAT
+GATAATGAGAAAGAAGGGACGGATAGCGTCAGTATCCACTTTAACAGTACGAAGATTGAA
+ATCTCCTCGGCACTCAACTCTACCGATATGCGCCTGGTCTGGCAGGTTCCTTATGGCACC
+TTATTGCTGGATACGTTGCAAAACATTCTGCTGCCACTGCTGCTGAACATCGGTTTGCTG
+GCGCTGGCGTTATTTGGCTATACCACATTCCGCCATTTCTCCAGCCGCAGTACAGAAAAC
+GTCCCCAGCACGGCGGTCAATAACGAATTGCGCATTTTACGGGCAATCAATGAAGAGATA
+GTCTCACTGCTGCCGCTCGGCCTGCTGGTTCACGATCAGGAATCGAACCGCACTGTCATA
+AGTAACAAAATTGCCGATCATTTGCTGCCGCATTTGAATCTGCAAAACATCACCACCATG
+GCGGAACAGCATCAGGGGATTATTCAGGCGACGATCAATAACGAGCTGTATGAGATCCGC
+ATGTTCCGCAGCCAGGTCGCGCCGCGCACACAAATTTTCATTATTCGCGATCAGGATCGC
+GAAGTGCTGGTAAACAAGAAACTCAAGCAGGCGCAGCGTCTGTATGAGAAAAACCAGCAG
+GGGCGGATGATCTTTATGAAAAACATTGGCGATGCGCTGAAAGAACCCGCACAGTCCCTG
+GCGGAGAGCGCGGCTAAACTCAACGCCCCGGAAAGCAAACAACTGGCGAATCAGGCAGAT
+GTGCTGGTGCGGCTGGTTGATGAAATACAGTTAGCGAACATGCTTGCGGATGATAGCTGG
+AAAAGTGAGACGGTGCTGTTCTCCGTGCAGGATTTAATTGATGAAGTTGTGCCTTCAGTG
+TTGCCTGCCATCAAGCGTAAAGGTCTGCAACTGCTGATTAACAATCATCTGAAAGCACAC
+GATATGCGCCGCGGCGATCGCGATGCCTTACGACGTATTTTGCTGCTACTGATGCAATAT
+GCCGTGACCTCAACGCAATTGGGAAAAATCACCCTTGAGGTTGATCAGGATGAGTCCTCC
+GAAGACCGCCTGACGTTCCGCATTCTGGACACGGGAGAAGGCGTAAGTATTCATGAAATG
+GATAATTTGCACTTCCCGTTTATCAACCAGACCCAAAACGATCGCTATGGCAAGGCGGAC
+CCGCTGGCATTCTGGCTGAGCGATCAACTGGCACGTAAACTGGGCGGTCATTTAAACATC
+AAAACGCGGGATGGGCTTGGTACACGCTACTCTGTGCATATCAAAATGCTCGCAGCTGAC
+CCGGAAGTTGAAGAGGAAGAAGAGCGTTTACTGGATGATGTCTGCGTAATGGTGGATGTT
+ACTTCGGCAGAAATTCGGAATATTGTCACTCGCCAGTTAGAAAATTGGGGTGCAACCTGT
+ATCACACCCGATGAAAGATTAATTAGTCAAGATTATGATATCTTTTTAACGGATAATCCG
+TCTAATCTTACTGCCTCTGGCTTGCTTTTAAGCGATGATGAGTCTGGCGTACGGGAAATT
+GGGCCTGGTCAATTGTGCGTCAACTTCAATATGAGCAACGCTATGCAGGAAGCGGTCTTA
+CAATTAATTGAAGTGCAACTGGCGCAGGAAGAGGTGACAGAATCGCCTCTGGGCGGAGAT
+GAAAATGCGCAACTCCATGCCAGCGGCTATTATGCGCTCTTTGTAGACACAGTACCGGAT
+GATGTTAAGAGGCTGTATACTGAAGCAGCAACCAGTGACTTTGCTGCGTTAGCCCAAACG
+GCTCATCGTCTTAAAGGCGTATTTGCCATGCTAAATCTGGTACCCGGCAAGCAGTTATGT
+GAAACGCTGGAACATCTGATTCGTGAGAAGGATGTTCCAGGAATAGAAAAATACATCAGC
+GACATTGACAGTTATGTCAAGAGCTTGCTGTAGCAAGGTAGCCTATTACATGAACAATAT
+GAACGTAATTATTGCCGATGACCATCCGATAGTCTTGTTCGGTATTCGCAAATCACTTGA
+GCAAATTGAGTGGGTGAATGTTGTCGGCGAATTTGAAGACTCTACAGCACTGATCAACAA
+CCTGCCGAAACTGGATGCGCATGTGTTGATTACCGATCTCTCCATGCCTGGCGATAAGTA
+CGGCGATGGCATTACCTTAATCAAGTACATCAAGCGCCATTTCCCAAGCCTGTCGATCAT
+TGTTCTGACTATGAACAACAACCCGGCGATTCTTAGTGCGGTATTGGATCTGGATATCGA
+AGGGATCGTGCTGAAACAAGGTGCACCGACCGATCTGCCGAAAGCTCTCGCCGCGCTGCA
+GAAAGGGAAGAAATTTACCCCGGAAAGCGTTTCTCGCCTGTTGGAAAAAATCAGTGCTGG
+TGGTTACGGTGACAAGCGTCTCTCGCCAAAAGAGAGTGAAGTTCTGCGCCTGTTTGCGGA
+AGGCTTCCTGGTGACCGAGATCGCTAAAAAGCTGAACCGCAGTATTAAAACCATCAGTAG
+CCAGAAGAAATCTGCGATGATGAAGCTGGGTGTCGAGAACGATATCGCCCTGCTGAATTA
+TCTCTCTTCAGTGACCTTAAGTCCGGCAGATAAAGACTAATCACCTGTAGGCCAGATAAG
+ACGCGTTAGTGTCTTATCTGGCATTTGCACCGATTGCCGGATGCGGCGTAAACGCCTTAT
+CCGGCCTACGATTCCCATTATTTCAACAAATTACATTAAAGTAGGCCAGATAAGACGCGT
+CAGCGTCGCATCTGGCATTTGCACTGAATGCCGGATGCGGCGTAAACGCCTTATCCGTCC
+TACGAATCCCGCGATTTCCTGACCCTCTCGGCATATAACGTCAGCGTCTGTTTTATCACA
+TCCAGCGTTACCGGCTTCGACAGGCAGCTGTCCATACCGGACTCCAGACACCGCTGCTTC
+TCTTCAGCCAACGCATTAGCAGTTACTCCGATTACCGGCAACGTCAGTCCCAACTGACGA
+ATGCGTTGCGTCAAGCGGTAACCATCCATATTTGGCATGTTGACGTCGCTAAGCACGATA
+TCAATATGATTCTTGCTAAGTACATTAAGCGCATCGACGCCATCATTCGCGGTTTTACAT
+TGATAGCCCAACGATCCCAACTGATCTGCCAGCAAACGCCGGTTAATCGGATGATCATCC
+ACGACCAGAATCATCATATCGTCATTATCGCTGACCGCTTTGTCCGTTGACGGCAGAGCG
+TTAGCAGGATCGTCGCTCTCCATCTCGATCAAATAAATACGCGCCAACAATGCCGGTAGC
+TCATGCGGAGCAGCCACACTGTGTACCCACTCCCCTGGCGCTTTCTCCAGCGGAATACCA
+ATATGGCGACGACAGAAGGTCACTACCGCTCTGCCCTGCCATTTTTTACTCACTACCTCG
+TCAGTGATCAACACATCTTCGGGAGTCGGTTCCTGCCCTTCGTATGTTGTAACGACGATG
+CCGCTGCGCTGCAAACTGGTTTCCAGGAACTGACAGAGCGACGCATTGCGGACCGCCAGC
+CAGCAGCGTTTACCACTCAACCCTTCCACGCCTTTTTTCTGCGGGTACTGAGCGCCGTAC
+AACGGAATACGCACGGTAAACTGGCTGCCCATTCCCGGTTCTGAATCTACCGAGATATCG
+CCGTCCATCATGCTGATCAGTTTTTCACAAATCGCCAGACCCAGACCGGTCCCCTGGAAA
+TTACGCTGTACGCCCGTTCCGACCTGGAAGAAGGGATCAAACAAGCGCACCACTTCTTTC
+GCCGGTATCCCCACGCCGGTATCGCGAACACGGATAGAGAGATAATCGCCATCCGCGCGA
+ACATGCAAAACTATACAGCCGGTATCGGTGAATTTTATGGCGTTACTCAACAGGTTGGAG
+ATGACCTGCTGTAAACGCATCGGGTCGCCATTTAAGGCCACTGGCACATCCGGTTCAATA
+AAGCAGTACAAGCCTAACTGCTTGCGTACCACCAGCGGTAAATAGTTGGCGGTGATGTGG
+TTCATCACTTCACGCGGTGAAAACTCACGCGGTTCGATCTTCAACTGTTCCGATTCAATC
+TTCGAGAAATCGAGAATATCGCTGATAATTTTCAACAACAGGCTGGAAGAGTTGTTCATT
+GCCGTCACCAGCCGATCGACGCCTTTCGGTAACTCTTTGGTTTGCAACAGATCCAGGTTA
+CCGATAATGCCATACAGCGGCGTTCGCAGCTCATGACTGACGGTGGCAAGGAACATCGAT
+TTTGACTGGCTCGCCTGTTCCGCTGCTTGTGCCATCTCCTGCAACGACTCTTCCATCTTC
+ACGCGCGAAGAAACATCCACCAGCACACAAATGGCCACGTTTTCATTACGATAGCGCGAA
+TGGACGAAGCTGATTTGCAGATTGGTATTGTTGCTGGTCAGGACATCAACAAAATTGACC
+TGCTGCCCACAGATAATTTGCGTCAGTCGTTGGCGGTCCTCATGCGTAAGCATATTGAGA
+TAGGTATGCGCCAGTTCGTTACTTAAAATATTGACGCCATCAGCGGTACGCAAAATGCAG
+ATACCCACTGGCGCGGAGGCGACAATCTTGCGATTGAACTGCTCATGTTCTTCCAGTCGC
+AGGGCGTCGCTTTCCGCCGGAATGAAAATACGTCGCTCGTACATCCGTGCGAGAGTAAAC
+AATGCAGCTCCGGCAAGCACATTCAGCAAAATTGCGTTAAGGATCAACATGCGAATGCGT
+TCCAGCACCTTATCAACCGGCACCGAATACACGATGCTTAGCGATGAGGGTGGCAGATTT
+TTCTTCAGCACCAGCTCCCGGAACCCTTCCGTATAGCCAAACCAGGAGCGTTCCTGCATC
+CAGCGAGGATCGCCCTTAATTTTACTTTCTGGTCCGGTAAGCGAAATCAGGGTATGACCA
+TTTTCATCAAGAATGGTAACCCCCATCGGCAACGTACCCGGTAAGAAAAAGTTCTCCATC
+CGGATGGTCTGCTCGACACCCAAAAGCGCCTGCAACCGGTTCGCCAGATAAACTGGCGTC
+AACGCGTAAAAATACCCGACGCCAGGGCGCGGACCTTCGCTGATCCAGTAGAGGTTACTG
+CCGCTATCATCTTGTGGTGCATTTCGATATTTATTGATGCGTTCATGCAAAGCTTTCAAC
+GCGGTATCGCGTTCCACTGGCATATCACGCAGACCGAAATTGGCCATGCAGAGGTTATCG
+CTGCCGATTAAAAATACCCGGTTTAGATCGTAAGCCGCAGAAAAATTATCGCGCCAGTAG
+CGCATAAACCACGCCAATGACTCCAGAGAACCTCGCCAGGTGTTACTCATTGCGGAACAA
+TCGGAGTCGGCAAACAGCGGTTCAAACGCAGGCACATCCGCCTGCGTTTCTCGTCCACGC
+GGGGAAAGCACACCGTTTTCTGCCGATAAGCGATTTTCGGCGATGTACTTCAGCTCTTTC
+ATCACATCAGAGGTGCGTTGAATAAAGCGCTGAGCCTGATCGGAACTCAGATTAAATTCC
+TGACGAATTTCCGATTCTCGCTGATGTAACGCATTAACGATGTAAAAAACGGATGAAAAA
+GCAATCAACAGCCAGAGCACTAACGCCAATGCTCTGAACATGTAGCGCGAGGCTTTCAGG
+GTTGTACGAAAAGAAGCAAGGTATTTCAAAGGGGCGAAGCTCCGCCTCAGGTGACCGATG
+GAGTGTGGTTAAGGTAGCGGTAAAAGCGTGTTACCGCAATGTTCTCTCTTCTCTGGAATA
+TGATACACCGCCGAGAAATCATCACCTTAACCTCTGATAATCGTCATATACCGGACAAGA
+CTAGTGGATTTCAGCATGCATTATATGAAGTGGATTTATCCACGCCGCTTACGCAATCAA
+ATGATCCTGATGGCAATCCTGATGGTCATTGTCCCAACGCTTACTATTGGTTATATCGTA
+GAAACGGAAGGACGTTCAGCAGTCTTATCTGAAAAAGAGAAAAAACTTTCTGCCGTGGTC
+AACCTGCTTAATCAGGCACTAGGCGATCGCTATGATCTCTACATCGACTTACCACGTGAG
+GAGCGTATCCGCGCATTAAATGCAGAACTTGCCCCCATTACCGAAAATATCACTCACGCC
+TTCCCTGGCATCGGTGCTGGTTATTACAACAAAATGCTGGATGCGATAATCACCTACGCG
+CCTTCAGCGCTATATCAGAATAATGTCGGCGTTACCATTGCCGCAGATCACCCTGGTCGC
+GAAGTGATGCGTACAAATACCCCTTTAGTTTATTCAGGCAGGCAGGTGCGCGGCGATATT
+TTGAATTCAATGCTCCCCATTGAGCGTAATGGTGAAATCCTCGGCTATATCTGGGCCAAT
+GAATTAACCGAAGATATTCGCCGCCAGGCCTGGAAAATGGATGTGAGGATTATCATTGTG
+CTCACCGCTGGTTTGCTGATAAGCCTGCTGTTGATTGTCCTTTTCTCCCGTCGCCTGAGC
+GCCAATATTGATATCATCACCGATGGCCTCTCGACTCTGGCACAAAATATTCCCACTCGA
+TTACCACAATTGCCCGGTGAAATGGGGCAAATCAGTCAGAGTGTTAATAACCTCGCCCAG
+GCACTGCGTGAAACGCGGACACTTAACGATCTGATTATTGAAAACGCTGCCGATGGCGTC
+ATTGCCATTGACCGCCAGGGTGATGTAACCACCATGAACCCAGCAGCAGAAGTTATCACT
+GGCTATCAACGCCATGAACTGGTAGGGCAGCCTTACTCCATGTTGTTCGACAATACTCAG
+TTCTACAGTCCAGTACTGGATACGCTGGAACATGGCACCGAACATGTGGCGCTGGAGATC
+AGTTTTCCAGGTCGTGACCGCACCATTGAACTCAGTGTCACTACCAGTCGTATTCATAAC
+ACGCACGGTGAAATGATAGGTGCTTTGGTGATTTTCTCTGATTTAACTGCCCGCAAAGAA
+ACCCAGCGCCGCATGGCGCAAGCAGAACGCCTCGCCACACTGGGTGAGCTGATGGCTGGC
+GTCGCGCATGAAGTACGTAATCCGTTAACGGCTATTCGTGGTTATGTACAGATCTTGCGC
+CAACAAACCAGTGACCCAATACATCAGGAATATCTGTCCGTAGTACTCAAAGAAATCGAT
+TCAATTAACAAAGTTATTCAGCAATTGCTCGAATTTTCACGTCCACGCCACAGTCAATGG
+CAACAAGTCAGCCTCAATGCATTGGTTGAAGAAACTCTGGTACTGGTACAAACCGCCGGC
+GTACAAGCGCGGGTCGACTTCATAAGCGAACTGGATAATGAATTAAGCCCGATTAACGCC
+GATCGTGAACTGCTCAAACAGGTACTACTGAATATCCTGATCAATGCCGTCCAGGCTATC
+AGCGCACGAGGGAAAATTCGCATTCAAACCTGGCAATACAGCGACTCACAACAGGCCATT
+TCGATAGAGGACAACGGCTGTGGCATTGATCTCTCGCTGCAAAAAAAGATCTTCGATCCC
+TTTTTCACCACCAAAGCCTCAGGAACCGGGCTTGGTCTGGCGTTAAGTCAACGCATCATT
+AATGCCCATCAGGGTGATATTCGCGTCGCCAGTTTGCCGGGCTACGGCGCAACCTTCACG
+CTTATTTTACCGATCAACCCGCAGGGAAATCAGACTGTATGACTGCTATTAATCGCATCC
+TTATTGTGGATGATGAAGATAATGTTCGCCGTATGCTGAGCACCGCTTTTGCACTACAAG
+GATTCGAAACACATTGTGCGAACAACGGACGCACAGCATTACACCTGTTTGCCGATATTC
+ACCCTGATGTGGTGTTGATGGATATCCGCATGCCAGAGATGGACGGCATCAAGGCACTAA
+AGGAGATGCGCAGCCATGAGACCCGGACACCCGTTATTCTGATGACGGCCTATGCGGAAG
+TGGAAACCGCCGTCGAAGCGCTACGCTGCGGAGCCTTCGACTATGTTATTAAACCGTTTG
+ATCTCGATGAGTTGAATTTAATCGTTCAGCGCGCTTTACAACTCCAGTCAATGAAAAAAG
+AGATCCGTCATCTGCACCAGGCACTGAGCACCAGCTGGCAATGGGGGCACATTCTCACCA
+ACAGCCCGGCGATGATGGACATCTGCAAAGACACCGCCAAAATTGCCCTTTCTCAGGCCA
+GCGTCTTGATTAGCGGTGAAAGCGGCACCGGGAAAGAGTTGATTGCCAGAGCGATTCACT
+ACAATTCGCGGCGGGCAAAGGGGCCGTTCATTAAAGTCAACTGCGCGGCGCTGCCGGAAT
+CGTTGCTCGAAAGTGAACTGTTTGGTCATGAAAAAGGTGCATTTACTGGTGCACAAACCT
+TGCGTCAGGGATTATTTGAACGAGCCAACGAAGGTACTCTGCTCCTCGACGAAATTGGCG
+AAATGCCGCTGGTACTACAAGCCAAATTACTACGCATTCTACAGGAACGGGAATTTGAAC
+GGATTGGCGGCCATCAGACCATAAAAGTTGATATCCGCATCATTGCTGCCACCAACCGCG
+ACTTGCAGGCAATGGTAAAAGAAGGCACCTTCCGTGAAGATCTCTTTTATCGCCTTAACG
+TTATTCATTTAATACTGCCGCCTCTGCGCGATCGCCGGGAAGATATTTCCCTGTTAGCTA
+ATCACTTTTTGCAAAAATTCAGTAGTGAGAATCAGCGCGATATTATCGACATCGATCCGA
+TGGCAATGTCACTGCTTACCGCCTGGTCATGGCCGGGAAATATTCGAGAGCTTTCCAACG
+TTATTGAACGCGCCGTCGTGATGAATTCAGGCCCGATCATTTTTTCTGAGGATCTTCCGC
+CACAGATTCGTCAGCCAGTCTGTAATGCTGGCGAGGTAAAAACAGCCCCTGTCGGTGAGC
+GTAATTTAAAAGAGGAAATTAAACGCGTCGAAAAACGCATCATTATGGAAGTGCTGGAAC
+AACAAGAAGGAAACCGAACCCGCACTGCTTTAATGCTGGGCATCAGTCGCCGTGCATTGA
+TGTATAAACTCCAGGAATACGGTATCGATCCGGCGGATGTATAACACCAAAACTTGCTAT
+GCAGAAATTTGCACAGTGCGCAATTTTCTGCATAGCCGCTCATTCTCCTTATAAATCCCC
+ATCCAATTTATCCCTTCATATTCAATTAGTTAAATAACTAAATCCAATAATCTCATTCTG
+GCACTCCCCTTGCTATTGCCTGACTGTACCCACAACGGTGTATGCAAGAGGGATAAAAAA
+TGAAAACAAAATTGATGACATTACAAGACGCCACCGGCTTCTTTCGTGACGGCATGACCA
+TCATGGTGGGCGGATTTATGGGGATTGGCACTCCATCCCGCCTGGTTGAAGCATTACTGG
+AATCTGGTGTTCGCGACCTGACATTGATAGCCAATGATACCGCGTTTGTTGATACCGGCA
+TCGGTCCGCTCATCGTCAATGGTCGAGTCCGCAAAGTGATTGCTTCACATATCGGCACCA
+ACCCGGAAACAGGTCGGCGCATGATATCTGGTGAGATGGACGTCGTTCTGGTGCCGCAAG
+GTACGCTAATCGAGCAAATTCGCTGTGGTGGAGCTGGACTTGGTGGTTTTCTCACCCCAA
+CGGGTGTCGGCACCGTCGTAGAGGAAGGCAAACAGACACTGACACTCGACGGTAAAACCT
+GGCTGCTCGAACGCCCACTGCGCGCCGACCTGGCGCTAATTCGCGCTCATCGTTGCGACA
+CACTTGGCAACCTGACCTATCAACTTAGCGCCCGCAACTTTAACCCCCTGATAGCCCTTG
+CGGCTGATATCACGCTGGTAGAGCCAGATGAACTGGTCGAAACCGGCGAGCTGCAACCTG
+ACCATATTGTCACCCCTGGTGCCGTTATCGACCACATCATCGTTTCACAGGAGAGCAAAT
+AATGGATGCGAAACAACGTATTGCGCGCCGTGTGGCGCAAGAGCTTCGTGATGGTGACAT
+CGTTAACTTAGGGATCGGTTTACCCACAATGGTCGCCAATTATTTACCGGAGGGTATTCA
+TATCACTCTGCAATCGGAAAACGGCTTCCTCGGTTTAGGCCCGGTCACGACAGCGCATCC
+AGATCTGGTGAACGCTGGCGGGCAACCGTGCGGTGTTTTACCCGGTGCAGCCATGTTTGA
+TAGCGCCATGTCATTTGCGCTAATCCGTGGCGGTCATATTGATGCCTGCGTGCTCGGCGG
+TTTGCAAGTAGACGAAGAAGCAAACCTCGCGAACTGGGTAGTGCCTGGGAAAATGGTGCC
+CGGTATGGGTGGCGCGATGGATCTGGTGACCGGGTCGCGCAAAGTGATCATCGCCATGGA
+ACATTGCGCCAAAGATGGTTCAGCAAAAATTTTGCGCCGCTGCACCATGCCACTCACTGC
+GCAACATGCGGTGCATATGCTGGTTACTGAACTGGCTGTCTTTCGTTTTATTGACGGCAA
+AATGTGGCTCACCGAAATTGCCGACGGGTGTGATTTAGCCACCGTGCGTGCCAAAACAGA
+AGCTCGGTTTGAAGTCGCCGCCGATCTGAATACGCAACGGGGTGATTTATGATTGGTCGC
+ATATCGCGTTTTATGACGCGTTTTGTCAGCCGGTGGCTTCCCGATCCACTGATCTTTGCC
+ATGTTGCTGACATTGCTAACATTCGTGATCGCGCTTTGGTTAACACCACAAACGCCGATC
+AGCATGGTGAAAATGTGGGGTGACGGTTTCTGGAACTTGCTGGCGTTTGGTATGCAGATG
+GCGCTTATCATCGTTACCGGTCATGCCCTTGCCAGCTCTGCTCCGGTGAAAAGTTTGCTG
+CGTACTGCCGCCTCCGCCGCAAAGACGCCCGTACAGGGCGTCATGCTGGTCACTTTCTTC
+GGTTCAGTCGCTTGTGTCATCAACTGGGGATTTGGTTTGGTTGTCGGCGCAATGTTTGCC
+CGTGAAGTCGCCCGGCGAGTCCCCGGTTCTGATTATCCGTTGCTCATTGCCTGCGCCTAC
+ATTGGTTTTCTCACCTGGGGTGGCGGCTTCTCTGGATCAATGCCTCTGTTGGCTGCAACA
+CCGGGCAACCCGGTTGAGCATATCGCCGGGCTGATCCCGGTGGGCGATACTCTGTTCAGT
+GGTTTTAACATTTTCATCACTGTGGCGTTGATTGTGGTGATGCCATTTATCACCCGCATG
+ATGATGCCAAAACCGTCTGACGTGGTGAGTATCGATCCAAAACTACTCATGGAAGAGGCT
+GATTTTCAAAAGCAGCTACCGAAAGATGCCCCACCATCCGAGCGACTGGAAGAAAGCCGC
+ATTCTGACGTTGATCATCGGCGCACTCGGTATCGCTTACCTTGCGATGTACTTCAGCGAA
+CATGGCTTCAACATCACCATCAATACCGTCAACCTGATGTTTATGATTGCGGGTCTGCTG
+CTACATAAAACGCCAATGGCTTATATGCGTGCTATCAGCGCGGCAGCACGCAGTACTGCC
+GGTATTCTGGTGCAATTCCCCTTCTACGCTGGGATCCAACTGATGATGGAGCATTCCGGT
+CTGGGCGGACTCATTACCGAATTCTTCATCAATGTTGCGAACAAAGACACCTTCCCGGTA
+ATGACCTTTTTTAGTTCTGCACTGATTAACTTCGCCGTTCCGTCTGGCGGCGGTCACTGG
+GTTATTCAGGGACCTTTCGTGATACCCGCAGCCCAGGCGCTGGGCGCTGATCTCGGTAAA
+TCGGTAATGGCGATCGCCTACGGCGAGCAATGGATGAACATGGCACAACCATTCTGGGCG
+CTGCCAGCACTGGCAATCGCCGGACTCGGTGTCCGCGACATCATGGGCTACTGCATCACT
+GCCCTGCTCTTCTCCGGTGTCATTTTCGTCATTGGTTTAACGCTGTTCTGACGGCACCCC
+TACAAACAGAAGGAATATAAAATGAAAAATTGTGTCATCGTCAGTGCGGTACGTACTGCT
+ATCGGTAGTTTTAACGGTTCACTCGCTTCCACCAGCGCCATCGACCTGGGGGCGACAGTA
+ATTAAAGCCGCCATTGAACGTGCAAAAATCGATTCACAACACGTTGATGAAGTGATTATG
+GGTAACGTGTTACAAGCCGGGCTGGGGCAAAATCCGGCGCGTCAGGCACTGTTAAAAAGC
+GGGCTGGCAGAAACGGTGTGCGGATTCACGGTCAATAAAGTATGTGGTTCGGGTCTTAAA
+AGTGTGGCGCTTGCCGCCCAGGCCATTCAGGCAGGTCAGGCGCAGAGCATTGTGGCGGGG
+GGTATGGAAAATATGAGTTTAGCCCCCTACTTACTCGATGCAAAAGCACGCTCTGGTTAT
+CGTCTTGGAGACGGACAGGTTTATGACGTAATCCTGCGCGATGGCCTGATGTGCGCCACC
+CATGGTTATCATATGGGGATTACCGCCGAAAACGTGGCTAAAGAGTACGGAATTACCCGT
+GAAATGCAGGATGAACTGGCGCTACATTCACAGCGTAAAGCGGCAGCCGCAATTGAGTCC
+GGTGCTTTTACAGCCGAAATCGTCCCGGTAAATGTTGTCACTCGAAAGAAAACCTTCGTC
+TTCAGTCAAGACGAATTCCCGAAAGCGAATTCAACGGCTGAAGCGTTAGGTGCATTGCGC
+CCGGCCTTCGATAAAGCAGGAACAGTCACCGCTGGGAACGCGTCTGGTATTAACGACGGT
+GCTGCCGCTCTGGTGATTATGGAAGAATCTGCGGCGCTGGCAGCAGGCCTTACCCCCCTG
+GCTCGCATTAAAAGTTATGCCAGCGGTGGCGTGCCCCCCGCATTGATGGGTATGGGGCCA
+GTACCTGCCACGCAAAAAGCGTTACAACTGGCGGGGCTGCAACTGGCGGATATTGATCTC
+ATTGAGGCTAATGAAGCATTTGCTGCACAGTTCCTTGCCGTTGGGAAAAACCTGGGCTTT
+GATTCTGAGAAAGTGAATGTCAACGGCGGGGCCATCGCGCTCGGGCATCCTATCGGTGCC
+AGTGGTGCTCGTATTCTGGTCACACTATTACATGCCATGCAGGCACGCGATAAAACGCTG
+GGGCTGGCAACACTGTGCATTGGCGGCGGTCAGGGAATTGCGATGGTGATTGAACGGTTG
+AATTAATCAATAAAAACACCCGATAGCGAAAGTTATCGGGTGTTTTCTTGAACATCGACG
+GCGAAGGTAACCCCATTAATCACCAGTCAAAACTTTTCACCAGCGTCAGCTCGCCAGCAT
+TACGCATCGGTACAATAAATGTTTCCTGTTTCTCATTGACCGATCCTTCATCGGTGATCA
+GCGTCAGTTGGGCGGTGGTTAATTCCGTTTCGCTGCGCCCACCATAGTAGTTGATATACA
+CCTGATAGCGCCCGTGAATTGGCGCGGGCATGGCGAAAATCTCGGGTCCGTACCCCGTCG
+TGACATCCATATCCAGTGCACCACTGTTTTTCAGCACGGTGTTACCGTACCAGGCGTGTT
+CGCCATCGGGCGTAACAACGTGAAGGTCGAGGTCGGTATTGTCCGTATCCCACGAGAGAA
+CCAGCCGTAAACGTGCACGAATCGTTCCTGTACCCGGCGTTGAGTAAAACTGCATTTTTT
+GTCGGCTTTGCCCATCCGGGCTGATGACCTGCACGCTGTTGCTGCCTTCAGTGAAAATAT
+AAGGGCGTGCAAATGAACCATCGGATTCAATTCTCTGCGGCATACTGGCACCGTTGACCA
+CCAGCCGGCCCTGCTGAACTTTACCCGCCGCAGCATAATTCTTTATTTTGCCGCGGATCT
+GCGCTGAGATATTTTGATCATCTGCCATGTTGACGGACGACGCCGGGTAATTGATCGATT
+GTGAAAAACTGGCATCTTCGCCCTCTGCCGGATGCCAGCCTGAGAGCGGTGCATCAATCT
+CGACTTCCTGCACACCTTCACTGTGAGCGACAGGCGAAAGCGCCACCAGTAACAACGGAA
+GAAAAATCTTTCGCATAGCATTAGTCCATTAATAATTGTCGGGTCAGCGTTTCGATATAG
+TTCTCATCAAGCCCGGTGGGATAACCATCAAAGGCCAGGTGCAGATACTCATGGGTTAAA
+TCCAGCCGATCCTGAAGCGTAAAGAAGTTACGAATAAACAGCCGTTTCTGCTGCCGATCG
+GTATAGGGGAAACCTGAGACTAAACGGCAAACCGCAAACACGTCTGGTTCGTTGTACCCC
+GTCTCAGCTTGTAATATACGCCGCCACTGCGGCATTTTTTTCGCCAGCCAGGCTTTCGCT
+TTGGGTAATAACTGGCAGGTTGAGCGTGGCGCTCCCCAGCGGCTAAGACTGTTGTCGGGA
+TAAGCAAACGCGAGTATCTGATCGTAACGCTCTCCCTGCCCCGCCTGGGCCGTGGCTTGC
+CGCCAGGAAAGTGTCCCTTCGGTAGCGCGACTGCCATGATAATGAACCGGATCGCCTGCA
+TAGATGAGATCCTGCGTCCAGGCGGTCATCGTTCGCGCCCCCGTGGTCGCTGGCGAAGCA
+GAAACACGCTGCGTGGCGCTGCTGTCGGGGATGGTCAGGCAATCGCCTTCCCGATTGGCG
+TTTTGCTGTAAAAAAGTGCGAATCGCCACGGTCATGGCTTTCGCTGCCTCAGGGGGCGTA
+CTTTTCGCCTCGCGATCCAGAACTCTGGCAACGTACTCTTCACGATCGAGATGCGACTGC
+AATTTCAGTTTGCCCTTTTCGCTCAGTAAGGTCGTCTCACCGTGGCTGACAAACGTAATG
+TGGTTACCATTAGTAAACGTCACACGATAGCGCCCATTAAGTACGCCGGGATTTACTGCC
+GTCGTACTCTTTTCCGCTGTGATTTTCTTCAGCGGATAGCGGGCAAACAGCTCCACCTCT
+ACACATTGCCCACTGGCAACCTGCGTCGGCACTGGCAAAACCCGATTAAGCACCGTCGCA
+TAACGGGTTAGTACCGTTTTGCTGGTGCCACTGCCAGTAACCCACAGCGGTGTACCATCG
+GTTAACCAGCCAGCAAAACCACCCTGACGGATTTCCTGTTTATCATCGGCAAACCAGCTC
+CAGGTTTTCACCCGTACCCGACTACCGAGCATGGATGCGACACCGATTTTCGCCTCGTCC
+AGCACCACATCCAGTAAGACTTCCTGAGCTTTGTTTTGCGCGGGTAACGTCGCTAATGAA
+TCAAGCAGCGATTTAACCGTTACCGAGGTTTCTGGCTTCAGCGTAGTCAGAGACGCTAAC
+CACGCAGGTGCCTGACGCTGTTGCCAGTATTGCCCCCACACATCTGCGCCAATATGCAAC
+CGCTGCGGCGCAAAATAGAGCCCACAGGAACGTACCAGCGCGGTATCGCGCGTTATGCTC
+TCCCCAGCCTGACAACAATAAACCTCTTCCGGGGAGTTTCCGCGACACTGGTAGGGCTGC
+TCCGGTTGATGGGTATCCTCCAGCCAGGCGTAAACATACAGTTTCCACAAACTCCCTAAC
+GGCGTGGTGAGCGAGTCAGGTAATGCTGAGACTTTGGTCACGCCTGATGACGACAGCTGA
+TACAGTTGATCGTGCTGCGCACCGCGCAGCACCAGTTGTAACGGCGTCTCCTCCGCAAGT
+GTTGGCAGAGTAACCAACGCCAATAGCCAGACGATTCTGCGCCAGTTCACTTATTTCACC
+TGCATCCCGGTCCATTCACTCCCTGCCGCAACACTTTGCTGCGCAGGTGCATAGGAACGC
+ACATAACGAGCAGGAGGCAGAACGAATTGCCCTTTTTGCGAGAAGCGCAGCAAATGGCGG
+AAAGTGACCGTTCCCGTCAGTTCTTTCACCGGCACCATATAGGCCAGTTCGCCCATTTCA
+TTTCGCGCTTTTTCCAGCAATTGCCCCTGCTGTTTCGCGGCGTTGGGTTTATTGACCGAA
+ATGCCCCATGTTGTGCGCTCAACGTCGGCTCCCGGTGGCAGCGGTACTTCCACCTGACCG
+TAGCGCAGAACTGCATCCTGCTCGCTGGTAAGCGTGATTTCATCGAGATACAGCGCATCG
+CTGTCAATCTCATTGCTGGTCACCGGTTGCAGAATAAAGCTCATCTCTTCTTCACCAGGG
+ATAAGCCGATACAACTGGCGTTCAACGGTCACCGGAATGTTACTTTGTTGAGCCATTTTT
+GCCGGCTCACGTCAGCGGACCTGCACATTTTGCGGCGATAATTCGTCACCAAAAGAGAGA
+ATGTCCGGCACGCCCTGACCAACCCAACGCCAGTCTTCGCCCCCTCCAGTTAACTTATGT
+TTAGCCCATGCGCCCGCAGGCGCAGGCAAAACAACTGGAGGCATTGTCGCCATATATTTC
+GCCAGCCAGTTCATGGCCAGCGCGCGCTCAATAGTGGATTGCTCAGCGGTCAAACCACTT
+AAAATAGCGGCCGTCTGGGTAGCGTCGCCACCGCTATTAAGCAGCACAACCGTGTGCGCC
+AGCGGCTGATTGCTGTTTGCCGCTTTATCCCACGCATATTGCTGAACCTGTGGCATCACC
+GTGGACTTCAACTGCGCTTTTTTCAGCAACGTCATGGTTAAGACGTTTGCCACCGCATCT
+GCCAGTGGAGACTCCGGTGTATCGAGGATCAGGCTATCATTGATATCGCGGGTGTCTTCC
+TCAGAGAAATCTTCAGTTTTAGTTCCGCGCCGGGCGATAGCTTCATCCAACCCTTTCAAC
+AACGTTTTGCACGGCAAATTCATCTCCTGCGCCCATGCCAGCACCAGCGCCCGATGCAAT
+AACGGCATGTTATCTGCCTGCTCCGCGTAGCTGTCGAGCATATGCTGCCAGTATTCCGGT
+TGTTGCGTTACGCCGATCGCCTGGCTGGCCTGCCAGTCGGCGTACCATGCCCATGCCGTA
+AGGAAGGCGTCACCATTGCCATCTTCACCCCACCAGGTAAAGCGCGCTCCGGGCCCCGCC
+AGTTGCATCAGCCGCAGACGGTTATCCTGAATCATCTGACGAATGTCGTTAGCGGCGGCA
+CTTTGATGATCGGCAAGCGAACGCCAGGCGAGACTGAGCGGGATCAGACGGCTACCGGTG
+TTGATTACGCCACCCCACGGTTCATCGACTAACGCATCAAGATTGTTGCGGAAAATCTCC
+TGCGGCGTTTCACTACTTTGTAGCCGGATATTGCTCGCCTGCTCGGGCAACATCAGCGCG
+TTATCGCCACCACCGAGCATGACATTTTTCTGCTGTTCAACGGGCCAGCTGTTATCCACA
+AAAGACAGTTTTGTGCTAATGCTGTCCTGCACTTGCCCATTTTGTTGCAGTTCTGCACTT
+AACAAGCCAGATTGCTGAATATTCTGCGTCAGCGAAATATAATTCGCCCCTTTGTGCAGC
+GTCAGCGTCTGGCGCATCTCAGCGCCTGCAAATTTAGTCACCAGCGCCACCGGTTCGTTA
+TCCTGCTGACTGAAGATAAACAGTCCTGCCGCCGGTTTGTCGCCCACGCGATACACCGTT
+GGCATACTCCACTTCATGTAGAGATTTTTTTCCGAACGCAGATAAGCACGCCCCTGCCCG
+ACCAGCCCGTCGCCGTTCATCCCACGCGCGGTGATACGCCAGCGGGTTAACGAATCAGGC
+ATCAGGAACGTGAAATACGCTTTGCCTTGTTTATCGGTTGTGAGTGACGGCATCCATGCC
+GCGGTATCCACCTCTTCACGCCGTGGACGTTCAAGCATTTTTACTCGCCGCTCGCTGCGG
+TTAGTTGCGCCAGGCGCAACCGGCTCGCTGGAGAGCGCCTGGTCGTAGCTGATAAACGAC
+AGACTGGAGCTGGTACGCACATTGTTACGCCCCAGCGGATAGAAAAATTTGCCGATATTC
+GGCGCGATTTCTGGTTGCAGCGCGTAGATCATTTCATCGACCACGCCTACCGTTAGCTGC
+GCAGAAACAGGTTTACCTTTCAGCGACGAGGTTAATTCGACATTGACCAGTTCACCAGGC
+TGGTAATGGGTTTTGTCCGTTTTCACCCGGATATCCAGCTGGGGAACGGCAACTTTGATC
+CCGGCGTTCTGAAAACTGTACTGACCGTTACGGGTATACAGCACCGAAAAAGTGATGTTA
+GGCGCAAAGGAATTGCTCACTGGAACCCGGGCTTCATACTGGGTATCGTTTAAACGTTGT
+AGCGTTAGCCAGTTTGCCGGATGCGAAAGCAGCGACTGCTGTTCCACGCGATCGCGTTCC
+AGCGTCAATAATGCTTCATCAATTGGCTCCGGAAAGGTAATCAGCATCTTCGCGGTTTCG
+CCTGGCTGGTACAGCGTTTTATCCGCCACGATATCTACCGTACCAGTATGCGCCGTGCTG
+CCCTTACCGCTGACGGCATGACTTAACCCAGCGAGAATTAAGCCGTCTTTATCGCGTAAT
+GTCAGATTGTAGTTGCCAGGTTTAGCGAAATTGACGGTAAAGGATTTGCCGCCTGACGGT
+AGCTCTCCGCTATGGCTCGTGCGGTCTTCGAGACGCAACCATTCATACGTAACAGGAACC
+TGTTTTGAAGATTCCAGCGCGGCATAACGGAACACAACCGACTCGCCGCTATTACTGTAT
+TGTGCGGCAGTACTTAATGAGTAATGCGCCAGACCGCGTTCAATGAGGATCTCTTTGGTG
+GTGGTGACGCGATACGCCGCGCCGTCACTGGCGGAGACGGTTAACAAATAGCGGCTCGGT
+TTATCGGCGGCGGGGAGATTTAACGCCACATGACCGCTGGCGTCGGACACCGTTTCGCTG
+CCTTCCAGCGACACGGGGAAACGTCCGGCATAACGCAAATCGTTACCGACCATTGATAAT
+TGCTGAGCGCGCAAACTTAACTGCACGCGGGCATTTTTTACCGGCTCGCCATCCGGGTAG
+AGCAGTTGCAGTTTGCCGCTGACCGCTTCGCCAGTTTTGAACTCTTTTTTGGCGAGAGCT
+AAACCAATCTCGAAATGTGGCTTGATGTAGTTTGCCACGCGAAAACTGCTGCTATAGACC
+TGATTGCGGTAAGCAAGACGTAACTCATAACCTCCGGCTACGGCATTTTCTGGCAGGCGG
+AAACTTCCCTGCCCGCCATTGCGCGCATCCAGCGTGACATTGACGGTTTGCAACAGACTG
+CCGTTGGCGTCCAGCACCGAAAGCTTCGCCGGGGCGCTGACGATGGGGGATGAATGCAAC
+GGATCGTGGAACTCGCGGCCGATCACTTTAACATCGACACGATCGCCTGCGCGATATAGC
+GGGCGATCGGTAAAAATATACAAGCGGGTGTTGTAGATTTCGCTTTCGTAGAAGAAGTTC
+TCGGAGACAAAAACGCCGCCTTCAGCATCCTTACCCAGAATGTATGAACGTTCTGGCGAT
+ATATGTTGTAACTGCAAGGTACCGCTGTCATCGGTCACACCGCGGGTCATCACGCCAAGA
+CCGTCAGTCCACAAGATCTCTGAGCCGGGCTTCGCTTCACCCTGTTTTTTACCCGCGGTC
+CACACCAGAAGCTCTTTGCCTGACACTTTGCTAAGCGCCACGGTATCGGAAACAAACACC
+ACCGTCGTCGCCCGATACCCACCAACCATCGCCTCGACGAGGTACAGTCCCGGCTCTTGT
+TGGCCGAGAGGAATATAAATGTTACCCGGCTGCGGCGAGATGAAATTGCTGGATGCGCCT
+TCCAGTTTTACCCCTTGCTGCGGCTCGAACGGTTTAGCCTGCCATAGTGGATAACGGAAC
+TGTTTCACCAGGGGATATTTTTTCAGCGGGGAAAACTGGTTGTTCTGTACATAACGGGAA
+GGTTTAATAATGGCATTGCCGAGCTGTAATTCGGGTAACGCCTGAGTCACATTCTGCCGT
+GACTGAGAAGAGAAAGTACGCTGCATCACGCGGCGAGATTTGCCGTACCAGTTATCCCAC
+AGCCAGGTTAGCGTATTGTTCAGCCCGTCGCCCAGATATTGCGGTTGCACCACAATGCGA
+TGCAGGTTTTTCTGCTGGCGCAAAAATGCCATCGGGTCAGGAATACGATACAGGCGAACG
+TCCACGCCGCCGTACTCTTCCATCTGATAGCGCCGATAATCACGCCCCGGCGCTTCCAGT
+CGCACTTTCGCCTCTTCACTGCTGCTAAAACTGCTGTCAGCAAGCAAAAAGAATGTTCCC
+CCGGCAGGCGGCGCATAGTTGCTGGAAGGAAGCGAATCATCAGCATTAGCAAGCCCTGTT
+CCCACAAGAGACAGGGACAAGCACGCTGCTATCGCGCCAGAAAATTTAAACGATAAATGC
+CAATGAAATTGGGATTGGAATCGTTGGGTATCCATCGGGTGTCCTTCCATGTCATAAGTT
+GTTGCAGACTGACTGCGCGCATTCCGTTGTCAGTTTTCGTGGCGCTTCCGGTGTGGTAGA
+TGACGTAACGCCCCATCCAGACCATTAAGTGCTGGGCATCGCCCTGATCGAAAAAAATCA
+TATCGCCAGGCAGCGCCTGGTTTATGTCCTGGCCAATAAACTGGCTGTTGTACTGAATCA
+AATTAATCGCGGTCACATAGGGGCCGGTTTTCCCGTTCCCCTGATTCCAGTTTTGCGCCA
+GTTGACGCTGTTCAGGTGTTAGCGTCATCTCTGGCGGCAAATACTGGCTAGATAAACCGT
+TACTTTTTAGCCATTTACTGTCGTGAACTTTCAGCGTCTCGTTCGCCGCAAATCGCACCA
+GGCCCGCACAATCCTGCTGATACCAGCGTGGACTTGGCCCCTGGCGGAGCTGTTCTTGTG
+CAATGCGTACAAACCAGGCGCGAAACAGCCCGGATTGTTCGACATTCAGCATTTCGCTAT
+GGGCAACAACACAACACAGCCAGCAAATCAGCGCCAGCAGCCCGTGCCTCATAGCGGCTG
+CCAGGTTATGGGTAGCCACTGCCAGGCGGCACCGGGTTCCATCTGGGCCAGCTTCATGAC
+ATAACGCGGTTGTTGAGATAAAGCGTCCAGCTTCGGCATTAATAAAGTTTGTGCGGCGTT
+ATAAAAAACCGGTTCGAGATTCTTCGGCAGACTGGTCAACGTTTCGTTACGCAGCAGTTT
+CGCTATTCCTTGTGGATTGATATAGAGCGGAACGATGCCATCAGTGGGTATTACATCCAC
+CATTGCCGGGCGGGTTTTATTCAGTGTTTGCAGCGCGTTATTAACCAGCGTGTCATCGAG
+GGAGAAAAGCAGCGTTTTGTTTTGCATCGCCAGCGACACACGGAAAAAATAATCCGACAT
+TAATTGATCGGGTTGCGCCGCCTGCGCTTTCGGATACTGGCCGTATCGGGAACTCACTTC
+GCGACGCCAGATTTGCGCTTCGCCCTGCTGAGTCTGGCTTACCGGCAAAACACCTTCTGG
+CGCTTTGCTTTCGTGCGCACCAATATTTTGCGTAAACAGTTTCCCTGGCAATTGCGCCTG
+TTCGGCAGTGCCATCAAACTGACCGACAAACAGCGGGGTTTGCAATTTTGAGTCTTCATA
+CCAGCACAGCCCCGCGGCACCGTCTAACGCCCCATTCAGCTTGTCGTTTTCCTGGCTGAT
+GTGCGAAAGCATCTCTTCGGCAATACCGTGTGAATACGGCACCGCCACACAGAAGCTGGC
+TCCGGCAGGCATACTGTTCCATACCGGCGTAAAATCGAAACTGGCATCTACGCTGGCGGA
+TTCATCATTTAACGCCACAAAACTGTGCCAGCCGTCGTTACCCATTTCGAAGCGTACGCC
+AGCAAAAGAAGGCATTAACCGCTGGTAGCCAAACCCCAGCCACCTGGCGCTGACTACGAT
+GCGCTGGCGTACTGGCGTTTTTTCGGCAGTACGCTCTTCCAGGCCAAAGCTTGCTTGCCA
+GCGTTTTTTGCCGCTCAACAAATCACCTGCGATCGCCGTGGCTTCGGTATCCTGCTGATC
+ATCTTTAAACAACATATCCGTGCTGGAAAACACCAGCATCTTGTCCTGATAAGTCGCGAA
+CATCAGGGCGTTATTGCCGTTATAGCGCAACTGATAAACAGGAACAGTTTCACTATTTAT
+CTTGATGCTACTGATTTCCGTTTTGCTTAACTGGCTGTCGCTGGTAGCGGCAAACAACAA
+TGGCTCCAGCAGTTTGCTTAAACCACTGCGCTGGATCAGCACCATATAATGTGAAAGATG
+GCCTTGTTTATCGTGCCACAGCGCTGCCTGCGCGGGCTGATCTAAGAGTGACGAAAAGAG
+CTTATCTTTCAGCGTGAGATCGTGTTCATAGACAATACGACGAATGCTGCCTTCAATGCC
+CAGACGATCGGCATGATTCTGATAATAGAAAACGAAATCTTCGCTCAGAACATCGTGGAG
+AAACGGAATGGTGAGGAGATCTTTGGGAAGCTGGCTCAGAGAGTCGCTGTCGAGAAAGAG
+GTCCGGCTCATTGAGATCGATTTGCAGATTGTTGTGCACCACCAGCGGCGACAACGTTTT
+TTCTGGCCCACTGCCAGCATATTGCAACGCCCAGACGCCAGCGGAAAGCAGTGCTATTGC
+GCCAAAACCTACAAGACCATAGAACCGCCAGCCTTTCGCCTTTTTTTCACCACTCATTGC
+CACATTCCTTGTGTATAGCCAGCCATTTTTTACGGGCACAGCCAAACTTTACCGTGCCCT
+AATACGACAAAAGCCCAGACTTTGCAGCCTGGACTTTTCAATTCAAACAAGGGAGATAGC
+TCCCTTTTGGCATGAAGAAGTAAAATTATTCTTCTTCTGGCTCGTCGTCAACGTCCACTT
+CCGGAGCGATTTCATCGTCCCCTTCCGCGGCACTGCCGTCGATGGTATCCAGATCTTCCT
+CGTCAACCGGTTCAGCAACACGTTGCAGACCCACTACGTTTTCATCTTCCGCAGTACGGA
+TGAGGATCACGCCCTGGGTGTTACGGCCCACGATGCTGATTTCCGAAACGCGAGTACGTA
+CCAGCGTACCGGCATCGGTGATCATCATGATCTGGTCGCAGTCATCTACCTGTACCGCGC
+CAACAACTAAACCGTTACGTTCGGTAACCTTGATGGAGATAACCCCTTTCGTCGCACGCG
+ACTTGGTTGGGTATTCCGCCACTGCGGTACGTTTACCGTAACCGTTTTGCGTTGCGGTGA
+GGATTGCGCCATCGCCACGAGGCACGATCAGAGAGACGACTTTATCGCCTTCACCTAAGC
+GAATACCGCGAACACCGGTGGTGTTGCAGCCCATCGCACGGACAGAAGACTCTTTAAAGC
+GCACCACTTTACCTTCAGCGGAGAACAGCATTACTTCGTCTTCGCCGCTGGTCAGGTCAA
+CGCCGATCAGCTCATCGCCGTCAACCAGTTTGATCGCCACTTTACCGGCGGTACGCAGAC
+GGTTGAACTCGGTGAGGACAGTTTTCTTCACGGTACCGTTAGCGGTCGCCATGAAGACTT
+TCACGCCTTCTTCAAACTCGGTCACTGGCAGGATCGCAGTGATACGTTCGTCCTGCTCCA
+GCGGCAGCAGGTTGACGATCGGACGACCGCGCGCGCCACGAGTGGCTTCCGGCAACTGAT
+AAACTTTCATCGAATAGACGCGACCACGGCTGGAGAAGCACAGAATATGGTCGTGAGTGT
+TCGCCACCAGCAGTCGGTCGATAAAGTCTTCTTCTTTAATACGTGCGGCAGATTTACCTT
+TCCCGCCACGACGCTGCGCTTCGTATTCAGAAAGCGGCTGATACTTAACGTAGCCCTGGT
+GAGAGAGCGTCACGACCACATCTTCCTGGGTGATCAGATCTTCCAGGTTGATGTCTGCGC
+TGTTGGCGGTGATTTCAGTACGACGTTTGTCACCGAACTGTTCACGAACCAGCTCCAGCT
+CTTCACGGATCACTTCCATCAGACGATCGGCGCTACCAAGAATACGCAACAGTTCCGCGA
+TCTGATCCAGCAGCTCTTTGTATTCGTCGAGCAGTTTTTCGTGCTCAAGACCGGTCAGTT
+TCTGCAAACGCAGATCCAGAATCGCCTGAGCTTGCTGTTCGGTCAGGTAGTACAGACCAT
+CACGCACGCCGAACTCTGGCTCCAGCCATTCCGGACGCGCAGCATCGTCGCCAGCACGTT
+CGAGCATCGCGGCAACGTTGCCCAGCTGCCACGGATTAGCAACCAGCGCAGTTTTCGCTT
+CTGCAGGCGTCGGCGCATGACGGATCAGTTCGATGATCGGGTCGATGTTCGCCAGCGCCA
+CGGCTAATGCTTCAAGGATATGAGCACGATCGCGAGCTTTACGCAGTTCGAAAATAGTAC
+GACGGGTCACCACTTCACGGCGGTGACGAACAAACGCCGCGATGATGTCTTTCAGGTTCA
+TGATCTTCGGCTGACCATGGTGCAATGCCACCATGTTGATACCGAAAGAAACCTGCAACT
+GGGTCTGGGAGTAGAGGTTGTTGAGCACAACTTCACCGACCGCATCGCGTTTCACTTCAA
+TCACGATGCGCATACCGTCTTTGTCAGACTCGTCACGCAGCGCGCTGATGCCTTCCACGC
+GTTTTTCTTTTACCAGTTCCGCAATCTTCTCGATCAGGCGCGCTTTGTTTACCTGATACG
+GAATTTCGTGGACGATAATGGTTTCACGACCGGTTTTGGCGTCAACTTCCACTTCTGCGC
+GAGCGCGGATATACACCTTGCCGCGACCGGTACGGTAAGCTTCTTCAATACCGCGACGAC
+CGTTAATGATTGCCGCCGTCGGGAAGTCCGGCCCCGGGATGTGTTCCATCAGCCCTTCAA
+TGCTGATGTCTTCATCATCAATATACGCCAGACAACCGTTGATGACTTCCGTCAGGTTGT
+GCGGCGGGATGTTGGTTGCCATACCTACGGCGATACCGGAAGAACCGTTCACCAGCAGGT
+TAGGAATTTTGGTTGGCATGACGTCCGGAATTTTTTCCGTGCCGTCATAGTTATCAACGA
+AATCGACCGTCTCTTTTTCGAGATCGGCCATCAGTTCATGGGCAATTTTCGCCAGACGGA
+TTTCCGTATAACGCATTGCCGCCGCAGAGTCGCCGTCGATAGAACCGAAGTTACCCTGAC
+CGTCTACCAGCATATAACGCAGCGAGAATGGCTGCGCCATGCGGACGATCGTGTCATAGA
+CCGCCGAGTCACCATGGGGATGGTATTTACCGATTACGTCACCAACGACACGGGCAGATT
+TTTTATAGGCTTTGTTCCAGTCATTGCCTAGTACGTTCATGGCGTAAAGTACGCGACGGT
+GTACCGGCTTCAGGCCATCTCGGACATCTGGCAGCGCACGGCCAACAATGACCGACATCG
+CATAATCCAGATAGGAGCTCTTCAGCTCTTCCTCAATGTTGACCGGTGTAATTTCTCTCG
+CAAGGTCGCTCATCTAACCGCTATCCCTCTACTGTATCCCGGATTCAAAGGTCGCAAATT
+ATAACACAGCCGCGCAGTTTGAGGTAAACCTATACGCTTTATTCACATCCAATGCCTGAT
+ATACTCGTTTGTCTTGCCAATTACGGAGTAGAAGTGCCAATGAATGCCGAAAAATCGCCG
+GTAAACCATAACGTAGACCACGAAGAGATCGCTAAATTTGAAGCCGTCGCCTCCCGCTGG
+TGGGATCTGGAAGGTGAGTTCAAACCGCTGCACCGCATTAACCCGCTGCGTCTGGGCTAT
+ATTGCCGAGCGTGCTGGCGGTTTATTTGGCAAAAAGGTGCTCGATGTCGGTTGTGGCGGC
+GGCATTCTGGCCGAGAGTATGGCGCGCGAAGGCGCGACGGTGACCGGTCTGGATATGGGC
+TTTGAGCCATTGCAGGTGGCAAAACTGCACGCACTGGAAAGCGGCATTCAGGTGGATTAC
+GTGCAGGAAACCGTGGAAGAGCACGCGGCAAAACATGCCGGGCAGTATGATGTGGTGACC
+TGCATGGAGATGCTGGAGCACGTCCCCGATCCGCAGTCAGTGGTCAGAGCCTGTGCGCAA
+CTGGTGAAACCAGGCGGCGATGTCTTTTTCTCGACACTTAACCGCAACGGCAAGTCATGG
+CTGATGGCGGTGGTTGGTGCGGAATATATTTTGCGCATGGTGCCCAAAGGCACGCATGAT
+GTGAAGAAGTTTATTAAACCGGCAGAATTGCTGGGCTGGGTGGATCAGACCAGTTTAAAA
+GAGCGGCATATCACTGGGCTGCATTACAACCCGATCACTAATACTTTTAAACTCGGCCCC
+GGCGTGGATGTGAACTATATGCTGCACACGCAGAATAAGTGAGGTTGATGTTTGGCCGCG
+CCAATGCCTGATGCGACGCTTGCCGCGTCTTATCAGGCCTACAAATGCTCCCCGTAGGCC
+GGATAAGGCGTTTACGCCGCATCCGGCAACCGTGCCGACTAGACAGTGATTACCATTTCA
+CCGTCATCGACAAAAACCCTGCCGTCTGGGCAAAATCATCACTCCCTTTCTGCCACGCCA
+CGCTGCCGCGCAGGGACACTCGCTGACTGATATTGCCCGTGACTCCCACTTTTATTTCAC
+CCCGTTGCTTCACCGCATCGTCACTGATAGTGCTGCCATCCTCTTCAATTTCCGTCGAAT
+GGGGATCGTGATAATAATTCAGATCTAATGTTGGTATGACATGAACAGCGGTACGCCATT
+CGCTGTGTAAACCCAGCCGCGTCTGAATATCATCACCCTGCGATTGTGACACGCGCGCAC
+GGTTAGCGGCGGTAAAATCATCCTGCTGCACGCCCTGATAAATCACCTGCGCCTGCGGTT
+CAATCACCACACCACGCCCCGGTAACCACTGATACCCCGCCTCCAGCGAGGCGATAATCC
+CCGACGAGTGGTAATGATCTGTGCCATCTTCTTGTTCGGAAACATCATTGCTAAACCACG
+CGTATTGCAGCCAGCTATCCAGCCAGGCCCCTTGCTTCTGATTACCGTGCTGAAACCAGC
+TTGATGTCAGCCCAACGGCATAACCGTGGTTCTGGTTATCGGCGCGAGTTCCGGTCATAT
+TCGAGCGGCTGTCGCCCTGGTTATCGCTGTAGCCACCAACAATCCCAAGCATCCACTCGC
+CATCCGTGCCCCAGCGCCCGCTAAACAGATCGCCGCTAAGTTGCACCGTAGAAGTGTCTT
+CATGTTGAGCCAGTTGCCCCGCTGCTGTGTAATGATAATCTCCGCCGATAACACGTAAAT
+TCAGCGTCTGACCATCGCCACCTGCGTGATCGCGTCGCTCCATCATAAACGCCTGATTTG
+CCGCCCGCAGGTTATTAAGATAACCGCCAACTTTGGCATTCAACACCGGCTGGTAAGCAG
+GCGTAGGTTCCGGGTCGGGTGTTGGATCAGGATCCGGCGTGGGATCAGGATCGGGAGTCG
+GGTCTGGATCAGGTGGCGATGGCGGCGTTACTTCTTGCGATCGCAGATACCAGTCGTTGT
+TATCTTCCACCAGCGTGTAGTCATACGCTCCCATATTGACGTAGCCGCTGCCTGCCAGAC
+TGAACTGCGCATTGTTTTGAAACTGCGTGGGATCAGCTGCGAAATCAACCACTTTAATGC
+CTGTCGATGTCGGCTCACCAATCCCTGTAATGGAGTTAACCACCACAGTTGTGTTGCCAG
+CAGTATTACCGTTCATCACCAATTGATCGCTTACCGAGTCATCGCCGTTTAATTCGCTAT
+CGAGCAGTAGCGTACCGCCGCCGGTATAATCACCGTTTACCGTCAGCGTATCGCCAGCGA
+CGCCATTTTGCAGGCTAACCGCACCGGACGTATTGGTCAGATTGCCATTAACCGTCACGT
+TGGAAAGATAAGTCAGGCTGTCAGTTTCAAGGTTGGTATTAAGCTCACCTGTCAACGTCA
+CACCATCGGTGGCATTCACCAGCGTCCCATCGCCGTTAAATAGTGAGGCATTAAGGGCGA
+CGGAAGTATCCTGCCCGGTCAGGCGCAAAACCGTACCATCGCTGATGTCGATAGTGCCGC
+TGGAAATAGCATCAATTGACTGAATATCCTGATCCGCGCCAGTAACGAACGTTGCCCCAT
+CACCAACCCACAGTGACGAAGCATAAGGAAGGATATCAGCAACATCACCTTTCAGGGTGC
+CTTCTTCGACACGTACCGCCGACTGCGTTGTACCGCTGGCGGTCAGCTCCAGTGTACCAG
+CCCCCGTTTTAGTCAATGTGCTACCCTCATCCTGATGCTGCCCGCTGCTGTCAGCCATCA
+GTGCGCCCCACTGCGTGTCTACCCCCGCATCAACTGCCACTTCACCGTCGGCGCGCATTT
+CAATATCACGTCCGTGGCCTGCCGCATCTGAACGCGTGTCAACGTCGGAGGTAATCTCCA
+TCACGCTTTCTTGTTGCTTATCGGTAAAGATAACCTGGCGGTTATAGTGGGTATCTCCAA
+GCTGCGAGTTGTCGCTCACCATCAGCGTACCGGAGGCGATTTGTGTTGTGCCCAAATAAC
+TATTATTGTTTGCCAGACTTACCTGCCCGTCGCTCGCATCGACCACCACGTAGACGCCAT
+CTTTCCCGTCGCCGCCGATATGCAAATTGTCGCCACCTGCAAGATCTACCACATCCTGAC
+TGCCGATAACCGTTCCGCTGCTGCCACTGACTTCAAGGCCATCGTTGTATGATGTGCCGC
+TCTGCCAGGTGGAGAAATCAGAGAGATCGAGCACACCGCCGTTTAACACGATCGACTGCG
+GATCGTCCTGGAGAGCGGTAAGATCTGCCGCGTCGCCTTCCAGCGAAAGCACCGCACCAT
+CATCAACGACTATATCGCCGGTTAGCGCCATCGACTGCGCCCCTGCCAGCACGTAGCTGC
+CGTTTTGCGCAATGGTGAGCTGACCAGCACCTTCGATGATGCCAGCAAAACTGCCCTGAT
+TAACAGTAACGTTGCCACCAGCATCGATATTTAAAGTGCCATTCTGAAAGCCCGTCAATG
+CGTGCACAAAAGTTTGTTGGGTCGAGCCAACGTTTAGCTCAGCCTGATTCTGATACTGAT
+CAATACTCCCTATCGTCAGACCGTAGCAGTCTTGCGGATCGTCCTGGCAATGCGTATCGC
+CGACATTCATCAGGGAGTTGCTGCGGCCCAGGGTAACTTCACCGTTTTCAATCTGCATCT
+CACCAGTAAAGTCATTGTTATCTGCATTAAGTACCAGATCGCCGGAACCTGTTTTGGTGA
+TTAACCCGGTACCAGCAATAGAGTCAACAGCTCCGTCATTCTCTGTATTGCCAATAACCA
+GCGTTTTTCCGTCGGCAATATCAAAGGTAACTTCACTTAAGCCGAGATACATAAAGCCAC
+CCGCCGCAGAGGAAGGACCATCTCCATAGCCTGCTGCGCTATTGTTCTCATCGACTAACA
+CGCCTCCGTTCTGGCTGTAGCTGTCATCAACAGAAATATCAATAAGATAGGGAGCCGTCA
+CGCTATTGGTATATATCGCCCCGCCATAACCTTCGGCAGTGTTATTTGTAAAGGCAGTGT
+TATTTACTATCGTATAACCTGAAGGATGCTTGCTGTCGCTATTATTATCGGTAACATCGA
+TTGCCCCGCCATCGCCATCACTGTAACTTGTTGATGTATATGCCTGGTTGTTATCAAAAA
+TAACATCACTTAAATAAACGTCATTATTAATGGTATAAATTGCGCCACCTTTGCCATCAT
+TAGCGATGTTATTGCGAAACATGGCGTTAGTGACACGTAAATCGACGGCACCAGTATCGT
+TAGTACCAGAAGAATAGATTGCGCCACCATAGCCGCCTGCGACGTTACCGGAAAAAATAA
+CATCAGTAAGATTCAGCGTTGAGTTTTCTTTAGCAAATATGGCCCCGCCGTTATTATATT
+CTCCTGTAACGGTGTTATTGGCAAACAGAGTCATTCCAGTTTCATTTTCTGGTAATAGTG
+AAAATTCCGCTCCTTGTTGCAAAAATACGGCCCCACCGCTGGCGTTATTGGTCATATCCG
+AAAAAACCAGCCATTGCCCATCAGCGATACTCCAGTCCTGCGTAATGCCTGAAAGGCTTT
+GCCTGCTGGCCTGACAACTCGCTTTGACATCATATCCCTGGCATGAATCAGTGACCGCCG
+CGACACCGTTAGCAGAGAAAAGAGATGCAATCATTGACGGGAGTAAAGATAAATACTCCT
+TGCGTAGAAAGATAATCCGCATATTAATCTAACCATCATTTTCTATAAGACGGCGTATTT
+AATCGCATTATACGATATGGAATATCTTTCTTTTGTAAATTGTTCAACCCGGTGCAATGG
+CTATTTTGTTATTATTTGATGAATAATATCAGTGCGTCATAATTCAAGTTAATAACCTTC
+AGGGATATCAGTTATATTTAAACTAAATTAAAGTCATGAATAATTTTCTTATAATATAAG
+GTAAATTAACAAAATGGCTTAGCATTTAACAATAACCGAATAGAAAACAACCATTTCGCC
+ATCAACAATCTCTTACATTCGCTTATATATTGACCACAACTGATACATCAGATTATGTGA
+TGACTCGTGCTTAGATCAATTTTTGCAATCATTAGCAAAAAGATTAATAAGCCATCTATA
+TCAATTTATCTAACCTATTATGCCGTTCAAGAAATCGCCGAACAGTTATTTTTAACAAAT
+TTTTCTCTTCCCATTGACTTTCCCGGACACCTTGTCTGACCTAAGGTGCGCGAAAGCCAC
+TTTTTCCTTCCTGAGTTATCCACAAAGTTATGCACTTGCAAGAGGGTCATTTTCACACTA
+TCTTGCAGTGAATCCCAAACATACCCCCTATATATAGTGTTCTAAGCAGCTTCCCGTACT
+ACAGGTAGTCTGCATGAAACTATTGCGGAAAGAATTCCAAAAACAGGTACGACATACATG
+AATCAGAATCTGCTGGTGACAAAGCGCGACGGTAGCACAGAGCGCATCAATCTCGACAAA
+ATCCATCGCGTTCTGGATTGGGCGGCAGAAGGACTGCATAACGTTTCGATTTCCCAGGTC
+GAGCTGCGCTCCCACATTCAGTTTTATGACGGTATCAAGACCTCTGACATCCACGAAACC
+ATTATCAAGGCTGCCGCAGACCTGATCTCCCGTGATGCGCCGGATTATCAGTATCTCGCC
+GCGCGCCTGGCGATCTTCCACCTGCGTAAAAAAGCCTACGGCCAGTTTGAGCCGCCTGCG
+CTGTACGACCACGTGGTGAAAATGGTCGAGATGGGCAAATACGATAATCATCTGCTGGAA
+GACTACACGGAAGAAGAGTTCAAGCAGATGGACACCTTTATCGATCACGACCGTGATATG
+ACCTTCTCTTATGCTGCCGTTAAGCAGCTGGAAGGCAAATATCTGGTACAGAACCGCGTG
+ACCGGCGAAATCTATGAGAGCGCCCAGTTCCTTTATATTCTAGTTGCCGCGTGCTTGTTC
+TCGAACTACCCGCGTGAAACGCGCCTGCAATATGTGAAGCGTTTTTACGACGCGGTTTCC
+ACATTTAAAATTTCGCTGCCGACGCCAATCATGTCCGGCGTGCGTACCCCGACTCGTCAG
+TTCAGCTCCTGCGTACTGATCGAGTGCGGTGACAGCCTGGATTCCATCAACGCCACCTCC
+AGCGCGATTGTTAAATACGTTTCCCAGCGTGCCGGGATCGGCATCAACGCCGGGCGTATT
+CGTGCGCTGGGTAGCCCGATTCGCGGTGGTGAAGCGTTCCATACCGGCTGCATTCCGTTC
+TACAAACATTTCCAGACAGCGGTGAAATCCTGCTCTCAGGGCGGTGTGCGCGGCGGTGCG
+GCAACGCTGTTCTACCCGATGTGGCATCTGGAAGTGGAAAGCCTGCTGGTGTTGAAAAAC
+AACCGTGGTGTGGAAGGCAACCGCGTGCGTCATATGGACTACGGGGTACAAATCAACAAA
+CTGATGTATACCCGTCTGCTGAAAGGTGAAGATATCACCCTGTTCAGCCCGTCCGACGTA
+CCGGGGCTGTACGACGCGTTCTTCGCCGATCAGGAAGAGTTTGAACGTCTGTATACCAAA
+TATGAGAAAGACGACAGCATCCGCAAGCAGCGTGTGAAAGCCGTTGAGCTGTTCTCGCTG
+ATGATGCAGGAACGTGCGTCTACCGGTCGTATCTATATTCAGAACGTTGACCACTGCAAT
+ACCCATAGCCCGTTTGATCCGGCCATCGCGCCAGTGCGTCAGTCTAACCTGTGCCTGGAG
+ATAGCCCTGCCGACCAAACCGCTGAACGACGTCAACGACGAGAACGGTGAAATCGCGCTG
+TGTACGCTGTCTGCTTTCAACCTGGGCGCAATTAATAACCTGGATGAACTGGAAGAGCTG
+GCAATTCTGGCGGTTCGTGCACTTGACGCGCTGCTGGATTATCAGGATTACCCGATCCCG
+GCCGCCAAACGTGGAGCGATGGGTCGTCGTACGCTGGGTATTGGTGTGATCAACTTCGCT
+TACTACCTGGCGAAGCACGGTAAACGCTACTCCGACGGCAGCGCCAACAACCTGACGCAT
+AAAACCTTCGAAGCCATTCAGTATTACCTGCTGAAAGCCTCTAATGAGCTGGCGAAAGAG
+CAAGGCGCGTGCCCGTGGTTTAACGAAACCACTTACGCGAAAGGGATCCTGCCGATCGAT
+ACCTATAAGAAAGATCTGGATACCATCGCTAATGAGCCGCTGCATTACGACTGGGAAGCT
+CTGCGTGAGTCAATCAAAACGCACGGTCTGCGTAACTCCACGCTTTCTGCTCTGATGCCG
+TCCGAGACTTCTTCGCAGATCTCTAACGCCACTAACGGTATTGAACCGCCGCGCGGTTAC
+GTCAGCATCAAAGCGTCGAAAGACGGTATTTTGCGCCAGGTGGTGCCGGACTACGAGCAC
+CTGCACGACGCCTATGAGCTGCTGTGGGAAATGCCGGGTAACGATGGTTATCTGCAACTG
+GTGGGTATCATGCAGAAATTTATCGATCAGTCGATCTCTGCCAACACCAACTACGATCCG
+TCACGCTTCCCGTCAGGAAAAGTGCCGATGCAGCAGTTGCTGAAAGACCTGCTCACCGCC
+TACAAATTCGGGGTCAAAACACTGTATTATCAGAACACCCGTGACGGCGCTGAAGACGCA
+CAAGACGATCTGGTGCCGTCAATCCAGGACGATGGCTGCGAAAGCGGCGCATGTAAGATC
+TGATATTGAGATGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACGGCTCGGTTTGTAG
+GCCTGATAAGACGCGCCAGCGTCGCATCAGGCTCCGGGTGCCGGATGCAGCGTGAACGCC
+TTATCCGGCCTACGGCTCGGATTTGTAGGCCTGATAAGACGCGCCAGCGTCGCATCAGGC
+ACAGGATGCGGCGTAAAATGCCTTATCCGGCATTAAACTCCCAACAGGACACACTCATGG
+CATATACCACCTTTTCACAGACGAAAAATGATCAGCTCAAAGAACCGATGTTCTTTGGTC
+AGCCGGTCAACGTGGCTCGCTACGATCAGCAAAAATATGACATCTTCGAAAAGCTGATCG
+AAAAGCAGCTCTCTTTCTTCTGGCGTCCGGAAGAAGTTGACGTCTCCCGCGACCGTATAG
+ATTACCAGGCGCTGCCGGAGCACGAAAAACACATCTTTATCAGCAACCTGAAATATCAGA
+CGCTGCTGGATTCCATTCAGGGTCGTAGCCCGAACGTGGCGCTATTGCCGCTTATTTCTA
+TTCCGGAACTGGAAACCTGGGTCGAAACCTGGGCGTTCTCAGAAACGATTCATTCCCGTT
+CCTATACTCATATCATTCGTAATATCGTTAACGATCCGTCTGTTGTGTTTGACGATATCG
+TCACCAACGAGCAGATCCAGAAACGTGCGGAAGGGATCTCCAGCTATTACGATGAGCTGA
+TCGAAATGACCAGCTACTGGCATCTGCTGGGCGAAGGTACCCACACCGTTAACGGTAAAA
+CTGTGACCGTTAGCCTGCGCGAGCTGAAGAAAAAACTGTATCTCTGCCTGATGAGCGTTA
+ACGCGCTGGAAGCGATTCGTTTCTACGTCAGCTTTGCTTGTTCCTTCGCATTTGCAGAAC
+GCGAATTGATGGAAGGCAACGCCAAAATTATTCGCCTGATTGCCCGCGACGAAGCCCTGC
+ACCTGACCGGCACCCAGCATATGCTGAATCTGCTGCGCAGCGGCGCGGACGATCCTGAGA
+TGGCGGAAATTGCCGAAGAGTGTAAGCAGGAGTGCTATGACCTGTTTGTTCAGGCAGCTC
+AACAGGAGAAAGACTGGGCGGATTATCTGTTCCGCGACGGTTCGATGATTGGTCTGAATA
+AAGACATTCTCTGCCAGTACGTTGAATACATCACCAATATCCGTATGCAGGCAGTCGGTT
+TGGATCTGCCGTTCCAGACGCGCTCCAACCCGATCCCGTGGATCAACACTTGGCTGGTGT
+CTGATAACGTGCAGGTTGCTCCGCAGGAAGTGGAAGTCAGTTCTTATCTGGTCGGGCAGA
+TTGACTCGGAAGTGGACACCGACGATTTGAGTAACTTCCAGCTCTGATGGCCCGCGTTAC
+CCTGCGCATCACTGGCACACAACTGCTGTGCCAGGATGAACACCCTTCCCTTCTGGCGGC
+GCTGGAATCCCACAATGTGGCGGTTGAGTACCAGTGTCGCGAAGGTTACTGCGGCTCCTG
+TCGCACACGCCTGGTTGCAGGTCAAGTTGACTGGATTGCCGAACCGTTAGCCTTTATTCA
+GCCGGGGGAAATTTTGCCCTGTTGTTGCCGGGCAAAAGGCGATATTGAAATCGAGATGTG
+AATTGGTTGTAGTGCCAGATACAACGCTTATGCGTCTTATCTGGCCTACAACGATTACAT
+GGCGTAGTAATACGCTTTCACCTGCTCCCAGTCCGCTTTGGGGATTGGCTCCAGATATTT
+TTCCAGCTGGCGGAAGTCATGATTAATCGCTTTATCGCGACGCAAGCGGCGACGACTTTT
+CTCCAGGTCAAGAAAACCAGCTTCTGCATTACCTTCTGTTTTCACATAGATATGGCGAAC
+ATAACAACAGCCATGCTGACGATTAATGCTATGCATTTTCTTAAACGCCAGCGCCACTGC
+TTTCAACATGGCTTGCCGTACTTCGTCAGAATAAGGCGATACTGCATGCTGGGCATACCA
+GTCAGCAATGCTGATGAACCCCGCCATATCTTCAGTCACCAGCAACGCTCGCCATTCACC
+CTCAATTTTCACCGCTTCACCAAAAACGATCTTCGGCACGATGACACCGGCCCGTTCCAG
+TTCTTTAATTACCGCAACCTCACGGACAATCGTTGGTCGGCCGAACGGATAACGTACGGA
+ATGAAACAGATGATGCGTCATGCGCTTTACATACAGCTTTTTGCCGTTGCGCTCGACGCA
+TTGCACCCCGCTCATACCATTACGGCGATAGTTAGGCTCTTCAACCCAGTCGCCCTCTGT
+TGCCCACCAGTGATTAAATTCGTCGTACTTTGCTGAAACTGCCATACCCTATCGCCTGTC
+ATTTTTATTAACGACAATGACTATAGGTGGTTACCTGAGGAAAATCTTAATGAAACGTGT
+CGTATTAATGAATTTCTTTTGCCACTACTAGCTTGACACCGCTTTTACCCTTCATTTGCA
+GCGCATAGATTCCACCAGCCACTACCACTAATAGTGCGCCCAGCAGATAAAATGTGAATT
+TAATCAGGCGGATACAGCGATGAATTTTATTCGACAGGGATTAGGCATCGCCTTACAACC
+AGAGTTAACGCTGAAAAGCATTGCAGGTGAATTGTGTTCCGTTCCTCTCGAACCAACTTT
+CTATCGACAGATTTCGTTGCTGGCTAAAGAAAAGCCGGTAGAAGGCAGTCCACTGTTTTT
+ACTACAAATGTGCATGGAACAATTAGTGGCGATTGGAAAAATTTGATATGAGACAGGATG
+GCGCATGAACGCCATCCTGCAGTAACATTACTCTTTATTAAGAAATTTTACTGCCTTATC
+AGGGAAATCAGTAAACAGCCCATTTACACCCGCTTTGTTATACAGAGCATCATATAACTG
+ATTCACATCAGGAGTGTATTCAGGCAGTTTATCTGACCGCACGGTATAAGGATGCACTAC
+CAGTTTATTCTGCTGAGCATCTTGCACCATGCCAGTGAGTTTGATATTACCCGGCTGCGA
+TGTCTCCTCAATCAACATATGGTAATCCGGACCAATACCATCTGCATATTCCGCCACCTG
+TTTCATGGCACCCGGCTTAAACATCCAGTCGTAGTTGTAATTAACCCAGCTTCCATCCGG
+CTGTTTCTGCTGCGTTTCATTCCAGTCGGTATAGGCAATCAGCTGTACCAGATTGAGCTC
+CATGCCCATTTTGGGTTCCAGCTCATTCTTAATACGCTTCAGCTCATCAGCATCAAAACA
+TTGCAAATAAACTTTATCGTCTTTACCGGTGTAACCATATTTCTTCAGCACTTCCAGCGT
+TTTTGCCGCAATATCCTTCCCTTCCTGATGATGGAACCACGGCGCTTTGATTTCTGGATA
+AATACCGATATTTTTCCCGGTAGAGTGATTTAACCCCTGAACAAATTCAATCTCTTCTTC
+AAAGGTGTGCACCCGGAAGTCGGACTTACCCATTGGGAAACGCCCCGGATAAGTCTGCAC
+TTTTTTACCGTTTTCAATATCGAAACCTTCGGTAAATTTCAACGACTTAATTTCATCCAG
+CGTGAAATCTATCGCGTAGTAACGACCGTCTTTGCGCGCCCGATCCGGGAAACGATCGGC
+AACATCAGTAACACGATCGAGGTAATGGTCATGCAGAACAACCAGATTGTCGTCTTTGGT
+CATCACCAAATCCTGTTCCAGATAATCCGCTCCCTGCGCATACGCCATCGCTTTTGCTGG
+CAGCGTATGCTCCGGCAAATATCCACTGGCACCGCGATGGGCGATGACTATTTTTTCGTT
+GCTGTCCGCCGCCATTGCACTGCTTCCCATGACTATAGTGCTCATCATGATCGCCATGCT
+AAGGTTTTTCAGCGTCAATTTCATGCCATTAGCCTCCGTTGCGTTCTTGCAGTAATTGTT
+CATGGCGACGTTTTTCGCCAATCATCACAACAATCAACAAGATAACCGCCAGAATGCTGC
+CGCCAATCATTACCATAAAGCCGCCATCCCAGCCGAAGAAGTCCACGGTGTAGCCAACAA
+TCGCGCTCGCCGCCACCGAACCGCCCAGGTAACCAAACAGCCCGGTAAAGCCCGCTGCCG
+TACCTGCCGCTTTTTTCGGTGCCAGTTCCAGCGCATGCAGACCGATCAGCATCACAGGAC
+CGTAGATCAGGAAGCCGATAACAATCATACAAATCATATCGACGGTTGGGTTACCTGCCG
+GGTTCATCCAGTAAACGATAGTCGCGATGGTCACCAGTGTCATAAAGAAAACGCCGGTTG
+CCCCACGGTTGCCACGGAAGACTTTATCCGACATCCAGCCGCACAGCAGAGTGCCCGGAA
+TACCTGCATATTCATAAAGGAAGTAGGCCCAGGAGGATTTATCTAGCGCGAAATGCTTAA
+CCTCTTTCAGATAAGTCGGTGACCAGTCGAGGATGCCGTAACGCAGCAGATAAACGAACA
+CGTTGGCGATGGCGATATACCACAGCAGTTTGTTCGGCAGTACGTACTGCATGAAGATTT
+GCTTCGCCGTCAGCTCCTGTTCCGCTTTTTCGTTATAGTCGTCCGGATAATCATTTTTGT
+ACTCTTCGATCGGCGGCAAGCCACAGGATTGCGGGGTATCGCGCATCATCGCAAAGGCGA
+ATAATGCCACCAGAATGGCGCAGAAAGCAGGCATATAGAGCGCCGCATGCCAGTCATTGA
+ACCAGGCCATCCCCAGCAGGAACAGCAGCGGCGGAATACCACCACCGACGTTGTGCGCAC
+AGTTCCACACTGACACAATGCCGCCACGTTCTTTCTGCGACCACCAGTGCACCATAGTAC
+GACCACACGGCGGCCACCCCATCCCCTGGAACCAACCGCAGAGGAACAACAGTACAAACA
+TCACCGCAATGCTCGACGTCGCCCATGGCACAAAGCCCATAAACAACATCACTGCCGCCG
+CCAGAATCAAACCTGCGGGCAGGAAAACGCGCGGATTCGAGCGATCCGATACCGAACCCA
+TGATGAATTTCGAAAATCCATAAGCAATCGAGATCCCCGAAAGGGCAAAACCTAAATCAC
+CGCGTGAGAATCCCTGCTCAACCAGATAAGGCATAGCAAGCGCAAAGTTCTTACGAACCA
+AATAGTAAGCCGCATAGCCAAAGAATATCCCCAGGAAAATTTGCCAGCGCAATCGACGAT
+AAGTCGGATCGATCTCCGCGGCAGGTAAGCGCGCTTTGTGTGGCGCTGGTTTAAAAATAC
+TCAACATTGATAGCCTCCGTGGCCCGTGGTCTTATTTATGATTAACAGCCTGATTCAGTG
+AGAGAACCTGCCGTTTCTTGAGTTGCCGCGATGTTAAGAAAACATTCATAAATTAAATGT
+GAATTGCCGCACACATTATTAAATAAGATTTACAAAATGTTCAAAATGACGCATGAAATC
+ACGTTTCACTTTCGAATTATGAGCGAATATGCGCGAAATCAAACAATTCATGTTTTTACT
+ATGGCTAAATGGTAAAAAACGAACTTCAGAGGGATAACAATGAAAACTCGCGACTCGCAA
+TCAAGTGACGTGATTATCATTGGCGGCGGCGCAACGGGAGCCGGGATTGCCCGCGACTGT
+GCCCTGCGCGGGCTGCGCGTGATTTTGGTTGAGCGCCACGACATCGCAACCGGTGCCACC
+GGGCGTAACCACGGCCTGCTGCACAGCGGTGCGCGCTATGCGGTAACCGATGCGGAATCG
+GCCCGCGAATGCATTAGTGAAAACCAGATCCTGAAACGCATTGCACGTCACTGCGTTGAA
+CCAACCAACGGCCTGTTTATCACCCTGCCGGAAGATGACCTCTCCTTCCAGGCCACTTTT
+ATTCGCGCCTGCGAAGAAGCAGGGATCAGCGCAGAAGCTATAGACCCGCAGCAAGCGCGC
+ATTATCGAACCTGCCGTTAACCCGGCACTGATTGGCGCGGTGAAAGTTCCGGATGGCACC
+GTTGATCCATTTCGTCTGACCGCAGCAAACATGCTGGATGCCAAAGAACACGGTGCCGTT
+ATCCTTACCGCTCATGAAGTCACGGGGCTGATTCGTGAAGGCGCGACGGTGTGCGGTGTT
+CGTGTACGTAACCATCTCACCGGCGAAACTCAGGCCCTTCATGCACCTGTCGTGGTTAAT
+GCCGCTGGGATCTGGGGGCAACACATTGCCGAATATGCCGATCTGCGCATTCGCATGTTC
+CCGGCGAAAGGATCGCTGCTGATCATGGATCACCGCATTAACCAGCATGTGATCAACCGC
+TGCCGTAAACCTTCCGACGCCGATATTCTGGTGCCTGGCGATACCATTTCGCTGATTGGT
+ACCACCTCTTTACGTATTGATTACAACGAGATTGACGATAATCGAGTGACGGCAGAAGAG
+GTTGATATTCTGCTGCGTGAAGGGGAAAAACTGGCCCCCGTGATGGCGAAAACGCGCATT
+TTGCGGGCCTATTCTGGCGTGCGCCCGCTGGTTGCCAGCGATGACGACCCGAGCGGACGT
+AACGTCAGCCGTGGCATCGTGCTGCTCGACCATGCTGAACGCGATGGTCTGGACGGATTT
+ATCACCATCACCGGTGGCAAACTGATGACCTATCGGCTGATGGCTGAATGGGCTACCGAC
+GCGGTATGCCGCAAACTGGGCAACACGCGCCCCTGTACGACTGCCGATCTGGCACTGCCT
+GGTTCACAAGAACCCGCTGAAGTTACCTTGCGTAAAGTCATCTCCCTGCCTGCCCCGCTG
+CGCGGTTCTGCGGTTTATCGTCATGGCGATCGCACGCCTGCCTGGCTGAGCGAAGGCCGT
+CTGCACCGTAGCCTGGTATGTGAGTGCGAAGCGGTAACTGCGGGTGAAGTGCAGTACGCG
+GTAGAAAATTTAAACGTTAATAGCCTGCTGGATTTACGCCGTCGTACCCGTGTGGGGATG
+GGCACCTGCCAGGGCGAACTCTGCGCCTGCCGCGCTGCCGGACTGCTGCAACGTTTTAAC
+GTCACGACGTCCGCGCAATCTATCGAGCAACTTTCCACCTTCCTTAACGAACGCTGGAAA
+GGCGTGCAACCCATCGCCTGGGGAGATGCACTGCGCGAAAGCGAATTTACCCGCTGGGTT
+TATCAGGGATTGTGTGGTCTGGAGAAGGAGCAGAAAGATGCGCTTTGATACTGTCATTAT
+GGGCGGCGGCCTCGCCGGATTACTCTGTGGCCTGCAACTGCAAAAACACGGCCTGCGCTG
+TGCCATTGTCACTCGTGGTCAAAGCGCACTGCATTTCTCATCCGGATCGCTGGATTTGCT
+GAGCCATCTGCCAGATGGTCAACCGGTGACAGACATTCACAGTGGACTGGAATCTTTGCG
+TCAGCAGGCACCAGCCCATCCTTACTCCCTTCTCGAGCCACAACGCGTGCTCGATCTCGC
+TTGCCAGGCGCAGGCATTAATCGCTGAAAGCGGTGCGCAATTGCAGGGCAGCGTAGAACT
+TGCTCACCAGCGGGTTACGCCGCTCGGCACTCTGCGCTCTACCTGGCTAAGTTCGCCAGA
+AGTCCCCGTCTGGCCGCTGCCCGCGAAGAAAATATGTGTAGTGGGAATTAGCGGCCTGAT
+GGATTTTCAGGCGCACCTTGCGGCAGCTTCGTTGCGTGAACTCGGCCTTGCCGTTGAAAC
+CGCAGAAATAGAGCTGCCGGAACTGGATGTGCTGCGCAATAACGCCACCGAATTTCGCGC
+GGTGAATATCGCCCGTTTCCTTGATAATGAAGAAAACTGGCCGCTGTTACTTGATGCGCT
+TATTCCTGTCGCCAATACCTGCGAAATGATCCTGATGCCCGCCTGCTTCGGTCTGGCCGA
+TGACAAACTGTGGCGTTGGTTGAATGAAAAACTACCTTGTTCACTGATGCTTTTGCCAAC
+GCTGCCGCCTTCCGTGCTGGGCATTCGTCTGCAAAACCAGTTACAGCGCCAGTTTGTGCG
+CCAGGGTGGCGTGTGGATGCCGGGCGATGAAGTGAAAAAAGTGACCTGTAAAAATGGCGT
+AGTGAACGAAATCTGGACCCGCAATCACGCCGATATTCCGCTACGTCCACGTTTCGCGGT
+TCTCGCCAGCGGCAGTTTCTTTAGTGGCGGACTGGTAGCGGAACGTAACGGCATTCGAGA
+GCCGATTCTCGGCCTTGATGTGCTACAAACCGCCACGCGGGGTGAATGGTATAAGGGAGA
+TTTTTTTGCGCCGCAACCGTGGCAGCAGTTCGGTGTAACCACTGATGAGACGCTACGCCC
+GTCACAGGCAGGGCAAACCATTGAAAACCTGTTTGCCATCGGTTCGGTGCTGGGCGGATT
+TGATCCCATCGCCCAGGGATGCGGCGGCGGTGTTTGTGCCGTCAGTGCTTTACATGCCGC
+TCAACAGATTGCCCAACGCGCAGGAGGCCAACAATGAATGACACCAGCTTCGAAAACTGC
+ATTAAGTGCACCGTCTGCACCACCGCCTGCCCGGTGAGCCGGGTGAATCCCGGTTATCCA
+GGGCCAAAACAAGCCGGGCCGGATGGCGAGCGTCTGCGTTTGAAAGATGGCGCACTGTAT
+GACGAGGCGCTGAAATATTGCATCAACTGCAAACGTTGTGAAGTCGCCTGCCCGTCCGAT
+GTGAAGATTGGCGATATTATCCAGCGCGCGCGGGCGAAATATGACACCACGCGCCCGTCG
+CTGCGTAATTTTGTGTTGAGTCATACCGACCTGATGGGTAGCGTTTCCACGCCGTTCGCA
+CCAATCGTCAACACCGCTACCTCGCTGAAACCGGTGCGGCAGCTGCTTGATGCGGCGTTA
+AAAATCGATCATCGCCGCACGCTACCGAAATACTCCTTCGGCACGTTCCGTCGCTGGTAT
+CGCAGCGTGGCGGCTCAGCAAGCACAATATAAAGACCAGGTCGCTTTCTTTCACGGCTGC
+TTCGTTAACTACAACCATCCGCAGTTAGGTAAAGATTTAATTAAAGTGCTCAACGCAATG
+GGTACCGGTGTACAACTGCTCAGCAAAGAAAAATGCTGCGGCGTACCGCTAATCGCCAAC
+GGCTTTACCGATAAAGCACGCAAACAGGCAATTACGAATGTAGAGTCGATCCGCGAAGCT
+GTGGGAGTAAAAGGCATTCCGGTGATTGCCACCTCCTCAACCTGTACATTTGCCCTGCGC
+GACGAATACCCGGAAGTGCTGAATGTCGACAACAAAGGCTTGCGCGATCATATCGAACTG
+GCAACCCGCTGGCTGTGGCGCAAGCTGGACGAAGGCAAAACGTTACCGCTGAAACCGCTG
+CCGCTGAAAGTGGTTTATCACACTCCGTGCCATATGGAAAAAATGGGCTGGACGCTCTAC
+ACCCTGGAGCTGTTGCGTAACATCCCGGGGCTTGAGTTAACGGTGCTGGATTCCCAGTGC
+TGCGGTATTGCGGGTACTTACGGTTTCAAAAAAGAGAACTACCCCACCTCACAAGCCATC
+GGCGCACCACTGTTCCGCCAGATAGAAGAAAGCGGCGCAGATCTGGTGGTCACCGACTGC
+GAAACCTGTAAATGGCAGATTGAGATGTCCACAAGTCTTCGCTGCGAACATCCGATTACG
+CTACTGGCCCAGGCGCTGGCTTAAACTCCTTTCTGATGCCCGGTAAGCATGTGGTTACCG
+GGCATTTTTGCGTACACGATTCCGTGCCCAATGTATGCGTTGCAACGCAGTGAAAATTCC
+TCTGAAAACGTCTCGCAAAGGCTGAAACTGGCAGATGTCAAAGGCCTGGGATAACCGTAA
+TGTCGCGTCATCATAAATATCAGGTGACGGACAACCATGACCGAATCAACAACCTCCTCC
+CCGCATGATGCGGTATTTAAAACCTTTATGTTCACACCCGAAACCGCACGGGATTTTCTC
+GAAATACATTTACCAGAACCACTGCGCAAGCTTTGCAACCTGCAAACCTTACGCCTGGAA
+CCCACTAGTTTTATTGAAAAAAGTTTACGCGCTTACTACTCGGATGTTTTGTGGTCCGTG
+GAAACCAGCGACGGTGACGGCTATATCTACTGCGTGATTGAACATCAAAGCTCTGCAGAA
+AAGAATATGGCTTTTCGGCTAATGCGCTATGCCACTGCCGCCATGCAGCGTCACCAGGAC
+AAAGGCTATGACAGAGTCCCGCTGGTGGTGCCGTTGCTGTTTTATCATGGCGAAACCTCG
+CCTTACCCGTACTCACTCAACTGGCTGGATGAGTTTGACGATCCGCAACTTGCCCGGCAG
+TTGTACACCGAAGCTTTTCTGTTGGTGGATATCACCATCGTACCTGACGATGAGATCATG
+CAACATCGGCGTATAGCTCTGCTGGAACTGATTCAAAAGCATATTCGCGACCGCGATTTA
+ATCGGCATGGTCGACAGGATCACCACGCTTTTGGTTAGAGGCTTCACTAATGACAGCCAG
+CTACAAACACTGTTTAATTATCTGCTGCAATGCGGCGATACCTCCCGTTTCACCCGTTTT
+ATTGAGGAGATTGCCGAACGTTCACCACTACAAAAGGAGAGATTAATGACTATTGCTGAA
+CGGCTACGGCAGGAAGGGCATCAAATTGGCTGGCAGGAAGGTATGCATGAACAAGCCATT
+AAAATTGCTTTGCGCATGCTGGAGCAGGGCTTTGAACGTGAGATTGTGCTGGCGACAACC
+CAACTCACTGATGCTGATATTCCGAACTGTCATTAAAAGGAGAGATTAATGACTATTGCT
+GAACGGCTGCGGCAGGAAGGACATCAAATTGGCTGGCAGGAAGGTAAATTAGAAGGTTTG
+CATGAACAAGCCATTAAAATTGCTTTGCGCATGCTGGAACAGGGCTTTGATCGTGACCAG
+GTGCTCGCGGCCACCCAGCTAAGCGAAGCCGATCTGGCAGCGAATAACCACTAATTAACA
+CAGGCCCACAGCCGATCCCCATGGGCCTTTGATATCAATAACTACCTTTTATGCGTGGCC
+CATTTTTGCCTGATTTAAACATCGCCAGTCGTTGATCCAGGGCATCGCTGTAGAGCATCG
+TGTCAACGCCAACAGCGACAAAGTTCGCTCCCCACGCCAGGCATTGCTGCGCCATATCAG
+GAGCCACAGCCAGAAAACCAGCCGCTTTACCCGCAGCACGGATCCGCCGAATACTGGTTT
+CAATAATTCGCTGCACTTCCGGGTGCCCGGCGTTATCCGGGTAGCCCAACGACGCAGAAA
+GATCCGCAGGTCCAATAAACACGCCATCAATCCCTTCGACGTCGAGGATTTCGTCCAGGT
+TATCCAGTGCCGTTTTACTTTCCACCTGCACCAACAGACAAAGCGAATCGTTAACTTGCG
+CCATGTAATTCTCAATGCGTCCCCAGCGCGCAGCCCGTGCCACACTGGCCCCGACACCAC
+GCTCACCGTAGGGAGGATAGCGCGTGGCAGACACCACCTGACGTGCCTGTTCGGCAGTAT
+CGACCATCGGGATCAGTAGAGTTTGCGCGCCAATATCCAGGACTTGTTTAATCAGCGGTT
+TACTGCCTTCCACCGGACGGATCACGGGTTGGCTGGCATAGGGCGCTACCGCCTGTAGCT
+GATGATAAAGATCCTGAATGGTGTTTGGCGCGTGCTCCCCGTCAATCAGCAACCAGTCAT
+AACCAGAAGTGGCGGCAATTTCTGCCATATAGGCAGTCGTTGAGCTTAACCACAGACCAA
+TTTGCACTTCGCCCTTGCGTAAACGTTCTTTAAAGGGATTGCTTAATAATGCGTTCATCG
+TGTTCCTTAACCTATTTAATGATGTGCCACGTCGGTCTGCGCAACAGTGCGATTTACACG
+CAGAGTGAAAATAATCAGCGAACCGATGACCGCCACCGCTGCCAGCGTCAGTAATCCCGC
+CGCATCGCTGGCAAATAACGTTTCTGCTTTCACGCGCAGGATCGGGGCAATAAACCCGCC
+CACTGCACCAAACAGGTTTACAAAACCAATTCCCGCAGCCAGCGCCGTACCGGAAAGCAG
+TTGTGTCGGCATCGTCCAGAACACTGGCTGCACGGCAATAAACCCGATAGCTGCAACACA
+CAGCGCTACGATCGCCATTACTGGAGAAAGCAGCCCGGACAGACCAATACCAATGCCCGC
+CGCCAGTAATGTCAGCGCTGCGACATTACGCCGTTCGCCGGTTTTATCGGAATAGCGCGG
+AATAAGCCAGGTCCCAAACAAGGCCGCAACCCACGGAATGGCGGTGACCACCGACGCTGT
+AAAGCCCACTTTTGTTCCCAGCAATGCCGCAACCTGGGTCGGCAGGAAGAAAATTAATCC
+GTAAACCGCCACCTGAATGGTCAGGTAGATAATCGCTAGTTGCCAGACTCGGCCATTACG
+CAGCGCATCGCTCAGCCGAGAAGTCACTTTCTGTTGTTCTTCACTTGCCAGTTGATTGAT
+AAGCAACGTTTTTTCTTGTTTACTCAGAAAACGTGCCTGCTCCGGTGTGTCATCAAGCCA
+AAAGAATGTGAATACCCCAGCACCGACTGCCAACAATCCTTCAATCACAAACATCCAGAA
+CCAGCCGGGATGCCCCATAAATCCATGCATCTCCAACAGCGCGCCGGAAAGCGGTGATCC
+CAGTGTTAACGCCAGCGGTGCGCCCATATAGAACAGCCCCATAATGCTGGCGCGATTACG
+CTGCGGAAACCATTGCGAGGTGAGATAAATCATACCAGGGAAAAATCCGGCCTCCGCAGC
+ACGAAGCAGAGTGCGAACTATCAGAAATTTCGCTTCAGTATCGGCCCATGCCATGGCTGC
+CGAAAGAAATCCCCACAGCAGTGTTGTCGTACCAATCCAGGTTCTGGCCCCCAGTTTGCG
+CATCAAAAGATTCGCCGGAACACCCAGAAACGCATATACCACAAAGAAAATGCCTGCTCC
+CAGCGCATAAGCTTCATTACTCAACCCGGTATCAATCTGGTAGGTCTGTTTGGCAAAACC
+GATATTCGAACGGTCGAGAAACGCCAGCACATACAGCGCCAACATAAACGGAATTAAACG
+CACACGGTTTTTCTTCACCACGGCGTCAAGCAAAGCGGTGCTCATAAAAAGCTCCTTAGA
+ATATGTGGGCGTTACCGTTGTCACAGCAACGCCCGGAGTGATTAGTGGCTGTAGGGGCGT
+TTCAAATTGCAGTCACGATTGAGTTCGACGCCAAAACCGGGTTTATCAAGCACTGATTTA
+TGAATACGACCATTCACCGGAACCGGCTCATTGAGCAGAATCGGGTCAAACTGCGGACGC
+ATCGTTGAACAATCCGGGCTGGTCATCAGGAATTCGCTGAATGGCGTATTGGTGAAGGTG
+ATCACCGCATGGTGAGAGTAAACAGACGAACCGTGCGGCACCACCAGTTGCCCCCTGGAT
+TTGGCGATTGCGGCAATTTCCACCAGCGTGGTTAAACCACCGCACCAGCCAACATCCGGC
+TGCATAATGTCGATACCGGTTTCTGAAAGCGTACGAAAAGATTGCAGTGTGCCGTGGTGC
+TCACCGCTGGTGACCATCATTCCGACTGGCGCGTTGCGTTTCAGTTCGCGATAACTTTCA
+TACTGCTGTGGCGGCAGGCACTCTTCGATCCATTTCAGGTTATAGGGCGCGCAAGCGTGG
+GCCAGTTTGGTCGCATAGTTCACGTCCTGACTCATCCAGCAGTCGAGCATTAACCAGAAA
+TCCTCACCGCATTTTTCACGCATATCCGCGACCATAGCGGCATCTTTGCGGATCCCCGCA
+TCGCCATCATGTGGCCCCCAGTGCGTCGGCATTTTGCCACCGATAAAGCCCATCTCTTTT
+GCCAGATCCGGACGCGCACCTGTGGCGTAGAACTGAATCTCATCACGAACAGCGCCGCCT
+AAAAGTTTATAAACCGGAAGCCCGACCACTTTGCCGAACAGATCCCACAGAGCCAGATCG
+ACACAAGAAATCGTATTCATCACCAGGCCACCAGAGCCGGAGTAATACAGGGTGGCACTG
+AGCATTTGATCGTGGATCAGTTTGATATCACTGACACATTTACCCTCAATGAAACGGTTA
+AGATGTTTTTCGACAATAAAACAGCCCATTTCACCGGCTGTCGAAACGGCGAATCCGGTC
+TGGCCGTTTTCTGCTTCGACTTCAACAACCAACGTGCCAAGAACGTTAATGCCAAATGAC
+TGGCGTGACTGCTCGTAATCGCGGTATTTACTCATCGGGGTGGCAATATGATCGTCTATC
+CAGTGATTCGCCCCCTGGTCGTGATAATCACCGCCGCCAGCGCCTTTTTCTGCTGTCGCA
+CCGCCAGTAAACCAGGCGCGAACCTGTTTAATTTTTGGTAGGGTCATGATGTTCTCCATT
+GTTATGAGGCTTGTAAGTCAAAGGGACTTTTCCATCCCAACAGACGTGAAATATCCCTGG
+CGCAGGCAATGGCCTTGCCCGCCAGATAATCACGGTATTCTTCATTGATTTGTAAGCGGG
+TACCGACCACCGAGATCGCAGCGGTAAGCTCGTTATTGGCGTTAAACACCGGCGCAGCGA
+CACAACGGACATCGGCGTAATCTTCGCCGTTGTCATAGCTCCAGCCCTGACGGCGAATAC
+GCGCCAGTTCTTCGTGAAGTTGCTGTGGATGAGTAATCGTTGTGGGTGTCGCCTGCTCCC
+AGACCAGCCCTTCGATAATACTTTGCTGTACCGCTGCAGGTTGCCAGGCAAGCAGGCATT
+TACCTATTCCGGAGCGATAAAGCGAAAGGCTTTTTCCTTCATGGGAACGCACGCTGATAG
+TGGCTGATGACTCCACTTTCAAAATGTAATAAGCGCTGCCGTTATCAATAATCCCCAGGT
+GACATAACAGCCCGGTGGTATCCATCAGTTGCGTCAAACGCGGTCGAGCCAGTTCCCGGA
+GATCCATCTTGCTTAACGCATGACCGGAAAGCTCCACCAGCCTGGTCCACAAACAAAAAT
+TTTCCTGGTGATCAAGGCTAAGAAAACGCTGACGCCTGAGTTCATTAAGCAGCAAATAGG
+CCGTGCTTTTAGGGATTCCCAATGTGTCAATGATCGTCGCAGCACTACAGGGGCCAATGC
+GGGCAATCAAATTGAGAATATCAATAGCCCGTGTCAGGGCGGGAACTTTGCTTGATTCCA
+ACATACTGGACTCCAGTCTTAGATACTGGAATCAGTCTCGTTGCTCAGGGGGAGTAAAAT
+TGTGAAGCGCATCAAATCCCGCTCCTCGTCCAGCAGACTGGAGAAATTACGCACAAATTT
+GTGAATCAGCGCACGGATTTTTTCTTATTGAGTACAACAGGTTGGACAAATTTTGCCGGA
+GGGGGAATGTGCCGGTGCAGTAAACCGGCACAGAGTGGCGGAATCAGACAGATAAGGTCA
+TGGACTCAACAACCTCAATCCAGCCATGCTCACTGGCGATATCCTGGCCGTTTAACCAAC
+GGCGCAGCATATTCAGTGCCATCATTGCGCACACTTCCTGACGGATAGCCAGGCTGTAGC
+GCGTAGTGCTGAAACGCACACGCAGAGCGAAAGTGCCGTCTGGCGTGGCTAGCGCAAAGT
+TGAGATGCTCGTTCTCGAAACCCGAAACAGCCAGTGCCAGCCCGGCAAAATGGTTGGCCC
+GCCGTTCTGTAATCCAGTGCGCAGTTTGCGCCAGGGTTTCCTCCTGTGAAGGAACCACTT
+CACACGCCAGCAATGGAGCACCTGCGCGAGAAAGTTGCAAAGCCAATAAACCACCGGTGA
+ATTGCTCGCTCAACGTCAGGCTGAACTGGCGGTTTTGCAATTCGCGACTGATCTGCGCGG
+GCAGTCCTTCAGTGCCTTCGAAAATCACGCTCTGTCCGGCAACACGTTTAACATCCAGCC
+ACAGTTTTTCCATCGCCTGTTGCTCGCTTGCCGGTCCGGTGAGTTTCAGTTCGATGATAG
+GCATTGAGGAGCGATAGCCCATTGTTACGCCCGGCGGCAGTTGTAGAGTGTCCAGGCTTT
+GTGCCAGATCGCTTTCCGAACGACCAAAAGTAGTCAAACGCAGACAAACCGGCGGCTGCG
+GTAAAGAAAAACGCTCGCGCAGGCGCGGCAGGATTTCGTGCTCGACCATCACCTTAAATT
+CTGACGGTACGCCGGGAGTAAAGAACATCAGGCAACGATTAAGCTGCACGGCAAAACCAC
+AGGCGGTGCCTACCGGGTTATTGATAAATTCAGCACTGGCAGGCAGCTCCGCTTGTTTAC
+GGTTGCTCGGTGCCATTACTCGTCCACGTTCGTGGAAATAGCGTTCCATCTCTTTGAGCC
+AGGCTTCATGCAGCACCAGGCCTTCACCTTTTGCTGTCGCAGCGGCGAGTGCGCTTAAAT
+CATCGCTGGTCGGTCCCAGCCCGCCGTTAACGATCAGCACATCGGCGTGCTGACTACGTT
+CGCGAAGAATGGTGACTAAGTCATCAAGGTTATCCCCCACCGTATTGCGGCGAGATAATG
+GCAACCCCTGATGAAAGAAAAAATCGGCCAGCCAGGCAGCGTTAGTGTCAACGATTTGCC
+CGTGTAACACTTCATCCCCGGTGGATAACATTTCCACTTTTAACATGGTTATCTCCTGCT
+TTTGTTATCGAATCACTATAACGCAAAGGGAGATAAGGCGTAGTAAGAAACTGAATGGCG
+CGACAGAATGCCGCGCCGGAAGGGATCAGAAACTGGCGTTAACCCCAACATACGGGCCGT
+CAGCCACGGCGTTGTCGCGGTTACCGTCTTTACCCGACAGATTCAGGTAGCGATAACCCG
+CCTCAATACTGACTGGACGCATAATGGTGTAACGCGCGCCAGCATTCGCTTCTTCATAAC
+TTTGAATACCGCTGGAGAGCGAATCCGGAGAGTAGTAATACTCGCCAAACAAACGGAAGC
+TGTTGCCAATTTTCCACTGCAAACCACCTCCTACCGCTGCGGCATAACCTTCATCGCCGT
+AATTCGGGTTGGTGTAAACGCCTTTTCCGCCAACGGTCGCCATTAACGGCCCGAGAGGCA
+GATTCAACCCCAGCCCCACGCCAGCGACATCACCGTCGTCGTCGTTATGTGTCCAGTTAC
+CGCTTAACGCCAGGCCCGTCGTTTCAGTCCCAAAACCGACACCAATATTGGTGTATTCTT
+TACCCGCCTGACCGCTGATGCTCATTGCATTGACCGATGCAGAAACCAACAGCATTCCGG
+CCAGACCTGCTAGCGCAATTTTTTTCATTATCCCCTTTCCCACAAGCAATTAATCAAAAT
+TCCCAAAGCTGCGGGATTGTACTGCCTGGCACAGAGGATTCAATGAGCGAAAAAAAGGAT
+CTAGTCACTTATTGTAACTAAATACTTCTTAAATAATTAAATGCCGAAAAAATAAACACA
+CTTTATCGATACACACAAAAATAATAATAAGTACAGTTATCATCGCAAAAGAGATTACTG
+TCACTTTCACATATTTGTGAGTTACCGTATTCTCATGGTTTCTTTTTATTTATAAGGAAT
+ATCCCTGTGCGACAACGGACTATTGTATGCCCTTTGATTCAAAATGATGGTGCTTATTTG
+CTGTGTAAAATGGCCGACGATCGCGGCGTTTTCCCCGGTCAATGGGCGATTTCGGGTGGC
+GGCGTGGAGCCTGGCGAACGAATTGAAGAGGCACTACGCCGCGAAATTCGCGAAGAACTG
+GGAGAACAGCTGCTTTTGACAGAAATCACGCCGTGGACCTTCAGCGATGATATTCGCACC
+AAGACGTATGCAGATGGTCGCAAGGAAGAGATTTATATGATTTACCTGATTTTTGACTGC
+GTTTCTGCCAACCGAGAAGTGAAAATAAACGAAGAGTTTCAGGACTACGCGTGGGTAAAA
+CCTGAAGATCTGGTGCATTATGATTTGAATGTCGCCACCCGAAAAACGTTACGTTTGAAA
+GGTCTTCTGTAACAATGATGACAGCCATTACTGGCTGTCAGATTGAAAATTTAGTGGTTA
+ACGAATTCCCCATCCAGATAAACTTTGCCTTTTTCCACATGCATGACTAAACCATCCAGA
+TAATCAGGTTTAAATGTCGCGTCACGCTTATCTTTAGCAATATATGTCAGGCAATGATTA
+TGGGTGAAAATAACGATATTTTTATCAGGCGCTTTGCTTTGTAAGTCCTTAATTGCACTA
+TAAATCTCATTACCGCACTGAAGAAGTCGTTTATCTACCGTCAATTTTTTACCCGCTGAA
+AACCAGGTAGCCGACTGAATGGTCCGGACGGTATTACTGGAATAAAGATCGAAATCAGGG
+ATATCAGCACTAAAAGCGTTGCCCAGTTCACGGGCATCCTGGGTACCTTTAACCGTAATA
+CCTGTTTTATCTGACAAGCATTGATTGGTTGAACGGTCGCAACGTTCAGCATGACGAAAC
+AAAACGACAACCGGGTGCTGCTGTGCCAGTCTGGCCAGTGTTTTATTGTCGATACGTGGC
+AAACCATTGCTACTCCAGGCGGCATGAGTACCCAGTCCGGCAATTGCAGCGAGCGCCAGT
+AAAATGATGATATATTTTTTTGACTTCAACGAAGAGCGGCAAAAAGCTAACACGTAAACT
+CCACCTATAGACAAGCGCAACCAGACAATTACCGTGAAATTGAGCTACATTTCTGGCGAT
+AATTCGCAGTTGGTGTAATATTAAAAATCCTACGATGTCGGCAAAATGCCTCAAAATTTT
+GCCAAATGCAAAGCCTAAATAAGAAAAAATATAAAAATTTCAATATTTACGTCTAATATT
+AGTTTCTTAAGGTTAAGTTAATATTCTATCCTTAAAATTTCGCTCCAAATGGCAAAATAT
+ACACAACACTCTTTATAGCAAATATAAGTGGACAGGTATTCAATGGCGGAAGGAAAAGCA
+ATGTCAGAATTTTTGCCTTTTTCGCGACCAGCAATGGGCGTGGAGGAACTCGCTGCAGTT
+AAAGAGGTTCTCGAATCCGGTTGGATCACAACCGGTCCGAAGAATCAGGCGCTTGAGCAA
+GCTTTTTGCCAGTTGACGGGAAATCAGCATGCCATCGCGGTCAGTTCAGCCACCGCCGGA
+ATGCATATCACGCTAATGGCGTTGAAAATTGGCAAGGGCGATGAAGTGATTACGCCTTCC
+CTGACCTGGGTTTCAACCCTCAATATGATTTCCTTGTTGGGTGCAACGCCGGTAATGGTG
+GATGTCGACCGCGATACGCTGATGGTCACGCCTGAAGCTATCGAGTCAGCCATTACGCCA
+CGCACTAAAGCCATCATTCCGGTGCATTATGCCGGTGCGCCAGCAGATATTGACGCCATT
+CGCGCCATTGGCGAACGTTACGGCATCGCAGTTATCGAAGATGCTGCCCATGCCGTCGGT
+ACGTATTACAAAGGGCGACATATTGGCGCAAAAGGTACCGCTATTTTTTCATTTCATGCC
+ATTAAAAATATTACCTGTGCTGAAGGTGGCCTGATTGTAACTGATAATGAAAACCTTGCC
+CGCCAGCTACGGATGCTGAAATTTCACGGTCTGGGTGTCGATGCCTATGACAGACAAACC
+TGGGGCCGTGCACCGCAGGCTGAAGTCTTAACACCGGGCTATAAGTACAATCTGACCGAT
+ATTAACGCCGCGATTGCCCTGACACAGTTAGTCAAATTAGAGCACCTCAACACCCGTCGG
+CGCGAAATTGCCCAGCAATATCAGCAAGCACTGGCAGCTCTCCCCTTTCAGCCATTAAGC
+CTTCCCGCCTGGCCGCACGTTCACGCCTGGCATCTGTTTATTATTCGTGTCGATGAACAA
+CGTTGTGGTATCAGTCGCGATGCGTTGATGGAAGCGTTAAAAGAAAGAGGCATTGGTACC
+GGGTTACATTTCCGCGCCGCTCACACACAAAAATATTATCGCGAGCGTTTTCCCACGCTG
+TCGTTACCGAATACCGAATGGAATAGCGAACGCATCTGTTCTTTGCCGCTGTTCCCGGAT
+ATGACTACCGCCGATGCCGACCATGTCATCACAGCCCTTCAGCAACTCGCAGGACAATAA
+GCCATGTTTGAAATCCACCCTGTTAAGAAAGTCTCGGTGGTTATTCCCGTTTATAACGAG
+CAGGAAAGCTTACCGGAATTAATCAGGCGCACCACCACAGCCTGTGAATCGTTGGGGAAA
+GAGTATGAGATCCTGCTGATTGATGACGGCAGTAGCGATAATTCCGCGCATATGCTGGTC
+GAAGCCTCACAAGCGGAGAACAGCCATATTGTGTCTATTTTGCTTAACCGCAATTACGGG
+CAACATTCAGCGATTATGGCGGGATTCAGTCACGTTACTGGCGACTTAATTATTACCCTT
+GATGCCGATCTCCAGAATCCGCCAGAAGAAATCCCCCGCCTGGTGGCAAAAGCCGATGAA
+GGTTACGACGTGGTAGGGACTGTACGCCAGAACCGCCAGGACAGCTGGTTTCGTAAAACC
+GCTTCGAAGATGATTAACCGGCTTATTCAGCGCACCACTGGCAAAGCGATGGGTGATTAC
+GGTTGTATGCTGCGCGCCTATCGCCGTCATATTGTCGATGCGATGTTGCACTGCCATGAA
+CGCAGCACCTTTATCCCGATTCTGGCGAATATCTTCGCCCGCCGTGCCATTGAAATTCCA
+GTACATCATGCCGAGCGTGAGTTTGGTGAATCCAAATACAGTTTTATGCGCCTGATTAAT
+TTGATGTACGACCTGGTGACCTGCCTTACCACAACGCCGCTACGTATGCTGAGTCTGCTC
+GGCAGCATTATTGCGATTGGAGGTTTTAGCATTGCGGTGCTGCTGGTGATTTTACGCCTG
+ACCTTCGGACCACAATGGGCGGCAGAAGGCGTCTTTATGCTATTTGCCGTGCTGTTTACT
+TTTATTGGCGCTCAGTTTATCGGCATGGGATTACTCGGTGAATATATCGGCAGGATCTAC
+ACCGATGTCCGCGCCCGCCCCCGCTATTTTGTTCAGCAAGTTATCCGTCCATCCAGCAAG
+GAAAATGAATAATGAAAACCGTCGTTTTTGCCTACCACGATATGGGATGCCTCGGTATTG
+AAGCCCTGCTGGCTGCCGGTTACGAAATTAGCGCCATTTTTACCCATACTGATAATCCCG
+GTGAAAAAGCCTTTTATGGTTCGGTGGCTCGTCTGGCGGCGGAAAGAGGCATTCCGGTTT
+ATGCGCCGGATAACGTTAATCATCCGCTGTGGGTGGAACGCATTGCCCAACTGTCGCCAG
+ATGTGATTTTCTCTTTTTATTATCGCCATCTTATTTACGACGAAATTTTGCAGCTCGCTC
+CCGCAGGTGCATTTAATCTGCATGGTTCGCTGTTACCAAAATATCGTGGTCGCGCGCCGC
+TGAACTGGGTGCTGGTCAACGGTGAAACGGAAACTGGCGTTACATTGCACCGAATGGTGA
+AACGTGCCGATGCCGGGGCCATTGTGGCGCAACTGCGCATTGCCATTGCGCCAGACGATA
+TCGCTATTACGCTGCATCATAAATTGTGCCATGCCGCGCGCCAGCTACTGGAACAGACAT
+TACCCGCCATTAAACACGGTAATATTCTGGAAATCGCCCAGCGCGAAAACGAAGCCACCT
+GTTTTGGTCGCAGAACGCCGGATGACAGTTTCCTTGAATGGCATAAACCGGCATCCGTAC
+TGCACAACATGGTACGTGCCGTTGCCGATCCGTGGCCGGGTGCCTTCAGCTATGTTGGCA
+ATCAGAAATTCACCGTCTGGTCGTCGCGTGTTCATCCTCATGCCAGCAAAGCACAGCCGG
+GGAGCGTGATTTCTGTTGCGCCACTGCTGATTGCCTGTGGCGATGGCGCGCTGGAAATCG
+TCACCGGACAGGCGGGCGACGGCATTACTATGCAGGGCTCGCAATTAGCGCAGACGCTGG
+GCCTGGTGCAAGGTTCACGCTTGAATAGCCAGCCTGCCTGCACCGCCCGACGCCGTACCC
+GGGTACTCATCCTCGGGGTGAATGGCTTTATTGGCAACCATCTGACAGAACGCCTGCTGC
+GCGAAGATCATTATGAAGTTTACGGTCTGGATATTGGCAGCGATGCGATAAGCCGTTTTC
+TGAATCATCCGCATTTTCACTTTGTTGAAGGCGATATCAGTATTCATTCCGAATGGATTG
+AGTATCATGTCAAAAAATGTGATGTCGTCTTGCCGCTGGTGGCGATAGCCACGCCGATTG
+AATATACCCGCAACCCGCTGCGCGTATTTGAACTCGATTTTGAAGAGAATCTGCGCATTA
+TCCGCTACTGCGTGAAGTACCGTAAGCGAATCATCTTCCCGTCAACTTCAGAAGTTTATG
+GGATGTGTAGCGATAAATACTTCGATGAGGACCATTCTAATTTAATCGTCGGCCCGGTGA
+ATAAACCACGCTGGATTTATTCGGTATCAAAACAATTACTTGATCGGGTGATCTGGGCCT
+ATGGCGAAAAAGAGGGTTTACAGTTCACCCTCTTCCGCCCGTTTAACTGGATGGGACCAC
+GACTGGATAACCTTAATGCAGCGCGAATTGGCAGCTCCCGCGCTATTACGCAACTCATTC
+TCAATCTGGTAGAAGGTTCACCGATTAAGCTGATTGATGGCGGAAAACAAAAACGCTGCT
+TTACTGATATTCGCGATGGTATCGAGGCGTTATACCGCATTATCGAAAATGCGGGAAATC
+GCTGCGACGGTGAAATTATCAACATTGGCAATCCTGAGAACGAAGCGAGCATTGAGGAAC
+TGGGCGAGATGCTGCTGGCGAGCTTCGAAAAACATCCGCTGCGCCATCATTTCCCACCGT
+TTGCGGGCTTTCGCGTTGTCGAAAGTAGCAGCTACTACGGCAAAGGATATCAGGACGTAG
+AGCATCGTAAACCGAGCATCCGCAATGCCCACCGCTGCCTGGACTGGGAGCCGAAAATTG
+ATATGCAGGAAACCATCGACGAAACGCTGGATTTCTTCCTGCGCACCGTTGATCTTACGG
+ATAAACCATCATGACCAAAGTAGGCTTACGCATTGATGTCGATACCTTTCGTGGCACCCG
+TGAAGGCGTGCCGCGTCTGCTGGAAATCTTGAGTAAGCATAATATTCAGGCCAGCATTTT
+TTTCAGCGTCGGCCCGGACAATATGGGCCGCCATCTCTGGCGACTGGTGAAGCCACAGTT
+TTTGTGGAAGATGCTGCGCTCAAACGCGGCATCGCTTTATGGCTGGGATATTTTACTGGC
+AGGTACGGCCTGGCCAGGTAAAGAGATTGGTCATGCCAATGCCGATATCATTCGTGAAGC
+GGCTAAACATCACGAAGTCGGCCTGCACGCCTGGGATCACCATGCCTGGCAAGCCCGTAG
+CGGTAACTGGGATCGGCAAACAATGATCGACGATATTGCACGCGGTCTTCGCACTCTGGA
+AGAGATTATCGGTCAACCGGTAACCTGTTCTGCCGCTGCGGGCTGGCGTGCCGACCAGAA
+GGTGATCGAAGCAAAAGAAGCGTTCCATTTGCGCTACAACAGCGATTGTCGTGGGGCCAT
+GCCGTTCCGTCCATTGCTCGAATCAGGAAACCCTGGCACTGCGCAAATTCCGGTGACCTT
+ACCCACCTGGGATGAAGTGATTGGTCGGGATGTGAAAGCAGAAGATTTTAACGGTTGGTT
+ACTCAACCGCATCCTGCGAGATAAAGGCACGCCGGTTTATACCATTCATGCAGAAGTTGA
+AGGCTGCGCTTATCAGCATAATTTTGTGGATCTCCTCAAACGCGCAGCTCAGGAAGGCGT
+GACATTTTGCCCTTTAAGCGAACTGTTATCAGAGACGTTGCCGCTCGGACAAGTTGTTCG
+CGGAAATATTGCCGGACGTGAAGGCTGGCTGGGTTGCCAACAAATTGCGGGTAGTCGCTG
+ATGAAATCGGTACGTTACCTTATCGGCCTCTTCGCGTTTATTGCCTGCTATTACCTGTTA
+CCGATCAGCACGCGTCTGCTCTGGCAACCCGATGAAACGCGTTATGCGGAAATCAGTCGA
+GAAATGCTGGCATCCGGCGACTGGATTGTGCCCCATCTGTTAGGGCTACGTTATTTCGAA
+AAACCCATTGCCGGATACTGGATTAACAGCATTGGGCAATGGCTATTTGGCGCGAATAAC
+TTTGGTGTGCGGGCAGGCGTTATCTTTGCGACCCTGTTAACTGCCGCGCTGGTGACCTGG
+TTTACTCTGCGCTTATGGCGCGATAAACGTCTGGCTCTACTCGCCACAGTAATTTATCTC
+TCATTGTTTATTGTCTATGCCATCGGCACTTATGCCGTGCTCGATCCGTTTATTGCATTC
+TGGCTGGTGGCGGGAATGTGCAGCTTCTGGCTGGCAATGCAGGCACAGACGTGGAAAGGC
+AAAAGCGCAGGATTTTTACTGCTGGGAATCACCTGCGGCATGGGGGTGATGACCAAAGGT
+TTTCTCGCCCTTGCCGTGCCGGTATTAAGCGTGCTGCCATGGGTAGCGACGCAAAAACGC
+TGGAAAGATCTCTTTATTTACGGCTGGCTGGCGGTTATCAGTTGCGTACTGACGGTTCTC
+CCTTGGGGACTGGCGATAGCGCAGCGGGAGCCTAACTTCTGGCACTATTTTTTCTGGGTT
+GAGCATATTCAACGCTTTGCACTGGATGATGCCCAACATAGAGCTCCGTTCTGGTACTAC
+GTGCCGGTCATCATTGCCGGTAGCCTGCCGTGGCTGGGATTACTCCCCGGTGCACTGTAC
+ACAGGCTGGAAAAACCGCAAGCATTCCGCAACCGTCTATTTGTTGAGCTGGACGATAATG
+CCGCTGCTGTTTTTCTCCGTCGCTAAAGGTAAATTGCCCACCTATATTCTTTCCTGCTTT
+GCATCTCTGGCAATGCTGATGGCGCATTACGCTTTGCTGGCAGCAAAAAATAATCCTCTG
+GCGCTGCGGATTAATGGCTGGATTAACATCGCTTTTGGCGTCACTGGCATTATTGCCACA
+TTTGTGGTCTCCCCGTGGGGACCAATGAACACGCCGGTGTGGCAAACCTTCGAGAGCTAT
+AAAGTCTTTTGTGCCTGGTCGATTTTTTCGCTATGGGCATTTTTCGGCTGGTACACCTTA
+ACAAACGTCGAAAAGACCTGGCCTTTTGCCGCGCTTTGCCCGCTGGGGCTGGCGTTGCTG
+GTAGGATTTTCAATTCCTGACAGAGTTATGGAAGGAAAACATCCGCAATTTTTTGTCGAG
+ATGACACAAGAATCACTTCAGCCAAGCCGCTATATTCTTACTGATAGCGTCGGTGTTGCC
+GCAGGTCTGGCATGGAGCCTGCAACGCGATGACATCATCATGTATCGCCAGACAGGTGAG
+TTGAAATACGGCCTTAATTATCCGGATGCGAAAGGGAGATTTGTCAGCGGTGATGAGTTC
+GCAAACTGGCTTAATCAACATCGTCAGGAGGGGATTATTACTCTCGTGCTTTCGGTTGAC
+CGCGATGAAGATATCAACAGTCTCGCCATTCCGCCCGCAGATGCCATCGATCGTCAGGAG
+CGTCTGGTGCTGATTCAGTATCGTCCCAAATGATCTGGCTAACATTAGTCTTTGCCAGCT
+TGCTTAGCGTTGCCGGGCAGTTGTGTCAGAAACAGGCAACCTGCTTTGTGGCGATAAACA
+AACGGCGCAAACATATCGTGCTGTGGCTGGGACTGGCGCTGGCTTGTCTTGGTCTTGCCA
+TGGTGCTCTGGCTGCTGGTCTTGCAGAACGTACCGGTAGGCATTGCTTACCCGATGTTAA
+GTCTGAATTTTGTCTGGGTGACGCTGGCTGCAGTAAAACTGTGGCACGAACCGGTATCGC
+CGCGTCACTGGTGTGGGGTGGCGTTCATTATTGGCGGCATTGTGATCCTCGGGAGTACGG
+TGTAATGGGCCTGATGTGGGGATTATTCAGCGTCATTATTGCCTCAGTTGCGCAATTAAG
+CCTGGGTTTTGCGGCGAGTCATCTGCCGCCGATGACGCACTTATGGGATTTTATCGCGGC
+TCTGTTAGCTTTTGGCCTGGATGCCCGGATACTGTTACTCGGGCTGCTGGGTTATCTGCT
+TTCCGTTTTTTGTTGGTATAAAACGCTTCATAAACTTGCGCTAAGCAAAGCCTATGCCTT
+GCTCAGTATGAGTTATGTGCTGGTATGGATTGCTTCAATGGTACTTCCCGGCTGGGAAGG
+GACTTTTTCGCTGAAAGCACTACTGGGAGTAGCCTGTATTATGAGCGGGTTGATGCTGAT
+TTTCCTGCCCACGACAAAACAACGTTACTGAGTTTTCCCTGCCACTTTACACTGCCGTTC
+CCACTCATCGGGGCTATAACTGCTTGCCGAGAGGACTTTCACCGTATGCAGCTTTTCACG
+ATTAATACAATAAAGCGCATTCTGCAAAGGCGAGAGTAAATCCCCCACTTTCACGGCGAA
+GTCACTCTTCACTTCGGCGATCATTTTTATCGCGCCGCCAGCATCGCAGAGCATAAGTAC
+ATGTCTGTTATCTTGTTTATTGCAGCACGATTTTTTGACCAGCCATTCCATTGCATTATC
+CTGTTTGCTAAGAGTTTTCACATCAATTTACAGATTAACAGATAAACTCTTTATCAACGG
+CAATGGAATGGCAGAAATGAGAAGTGAAACGGAGGGTTAATTATTGCTGACGTTGCACCC
+ACTCTTTTAGCGCCTGACGTGAAATTTTAATACCGCCGTTTTTCAGCTCCGGCGGCAGAG
+TTAGCCAGCGCACCGGTTGTTGAAAACGGGCCAGCTTATCTTTCACCCATTCACTAAGAT
+CAACGCTCTCGTGGTCATACTCCATCACCGCCACCGGTCGATGACCAAACTCCTTGTCGG
+CAACGGGGACGATAAACACCTGCAAAACCGCAGGATGTGCAGCAATTACGCGCTCGACTT
+CTTCCGGCTGAATACCCTCTCCGCCACTGAAGAATAGATTGTCTAAACGTCCGACAATGG
+TCAGCTTGCCATTATGCATCTCACCGCGATCGCGCGTAGCGTACCAGCCTTCGTCATTAA
+CCAGTGAAACCAGTTGCCCGTTACGCCAGTAACCTTCTGCCATACTGGCAGCCCGCAGCC
+ACACTTCATTATTAACGATTTTCACTTCCCGACCCGGCAGCGGCGAACCAACGTCTGCCA
+GGCCGTCGGCTTCTTTCGCACACACCGTGGAGGCAAACTCGGTCAGACCATAGCCGCAAA
+AGCAACGAATCCCCTGCTCGCGCGCCTGTTCCGTCAACTCGACCGGGATAGCCGCGCCGC
+CAAGTAACACCGCTTTCAGGGAAACGGAACTACGGTTAACCAGCAAACGCCAGAGTTGTG
+TTGGCACCAGTGAAGCGTGAGTACAGCCTGCCAGCATTTGCTCCAATGGCTGTTTATCAC
+GTACCGTCATCCGCGCACCAGCGTATAACCAGCGCCACATAATTCCCTGACCGGAGACGT
+GAAACAGCGGTAAAGAGAGCAACCAATCATCGTGATCGCCAAACGGAATCAGCGATAACA
+CACCTTGCGCACTGGCAAGATGGGCCTGATAAGTATGGACAGCGGCTTTCGGCAAACCGG
+TAGAACCCGAGGTCAACGTCATTGAGCACAGACGCGTCGGCTGCCACGTAGCGGCATGTG
+CGCCTTCAACCAGCTGAATGTGCAGCGACGTTAATGCCGGAAACGTGTTTTCCCCATCCG
+GCACCAGAGCAAATTGCAGCGTCAGATTGGGCAGCAATTCTTCAAGCAACGGTTGCGGCA
+GCTGAGGGTTCACGGGCAACACCCGCGCCCCGCATTGCAGTAACGCCAGCCAGGCGAGCA
+GCGTTTGCGGCGTATTCCACGCCCGCAACATCACGCCGCTGCCCTCAACCACCCCCTGCA
+CCGCAAATCCGGAGGCTAATTCATCGACGCGAGCACAAAGCTCGCGCCAGTTGAGTTGCT
+CGTCATTAAGACGTAAGGCGATGGTTTCTCCCCGCACTTGCCGCCAGTGACGCCACGGCC
+AGTCAGAGAAGATCATAACAACCGCTCCAGTGCATCAACTTCCACGACAGGCAGCGTGCT
+ACCCGGCCAGCGACGTACCTGCTGCGCCTGCATCAGATCCAGCGTGTCCAGCCCTGGAAT
+GGTGTCCGGCGTTAACCAGGCGGCAATCCGCGCCAGTTGCGTTAAGCCTAAGCTCGATTC
+AATGGAAGAACTGATCACCGCCGTCAGCCCCAGCGCGTGCGCCGCCTGTACCTGCTCGCG
+TACTTTTTCCAGACTGCCCGTGAGCGTGGGTTTGATAACTACCGCGCGCACGCCCTCTTC
+AGCCACAAAGGCAAAATCCGGCTCGCGCAGGCTTTCATCCCAGGCAATGGCAATGCCGGT
+TTCACGGGCAAACGCTCGCGAATCATCGCGGGTTTTGCACGGCTCTTCGAGAAACGCGAT
+GCGGTCGCGATAATCCGGGTTAACGTATTTGGCAAACTGCTGACCTTTCAGCGGTGTCCA
+GGCGCGATTTGCGTCAAGACGCAAATGCAGATCCGGAATTGCCTCCAGCAACAGATTCAC
+CACCATGCCGTCGCGCACCGCTTCGTACAATCCCACTTTGACCTTCGCCACTTTCTCGCC
+TGGCATATCTGCAAGTTTGAGGATCAGATCGTCCGGATCGCCATTACACAGCGGTGCCGC
+ACGGTAGTTGGCTGCTTGCGGCAACGTATCTGTCAGTTCTGCCAATGCACAGCTTACGCC
+AAAGGCCACGGAAGGCATCTGCGGTAGCTCGCAATCGCCTGCCAGCCAGTTATTTACCCA
+GGCAAGCAGCACACTTTGCGCCTCTTCCCAGGTTTCCTGACTGAAGCCCGGCAGTGGGGA
+GATCTCCCCCCACCCTTCGCGCTCGCCTTCACGCAGGCAAACATACAGCCCGTCGCGGGT
+TTTTAACCGCCTGTCGCGCAGAACCACCCCCGCGTCCATGGGGATCTGCCAGCGGTATAC
+CTGCGCGCTACGCATTACGGATTCCGTTTGAATTTGCTGAAGTCAGGCTGACGTTTCTGG
+TTGAAGGCGTTGCGACCTTCCTGACCTTCTTCCGTCATGTAGAACAGCATGGTGGCGTTG
+CCCGCCAGCTCCTGCAGCCCCGCCTGCCCGTCACAGTCGGCGTTCAGTGCAGCTTTCAGG
+CAGCGCAGCGCCATCGGGCTGTTTTGCAGCATTTCGCGGCACCAACGGACGGTTTCTTTT
+TCCAGATCCGCCAGCGGTACCACGGTGTTCACAAGGCCCATATCCAGCGCCTGTTTTGCG
+TCGTACTGACGGCACAGGAACCAGATTTCACGCGCTTTTTTCTGCCCGACGATGCGAGCC
+ATGTAGGAAGCGCCCCAGCCGCCGTCGAAGGAACCGACTTTCGGGCCAGTCTGACCGAAG
+ATGGCATTATCTGCCGCGATAGTCAGGTCGCACATCATGTGCAGAACGTGACCGCCGCCG
+ATGGAGTAGCCAGCCACCATCGCGACAACCGGTTTCGGACAGGTACGGATCTGACGCTGG
+AAGTCCAGCACATTCAGGTGATGTACGCCGGAATCATCTTTATAGCCGCCGTAATCACCA
+CGCACTTTCTGGTCACCACCGGAGCAGAACGCTTTATCGCCTGCACCAGTCAGAATGATC
+ACGCCGATGTTGTCGTCATAACGCGCATCTGCCAGCGCCTGGATCATCTCTTTTACCGTC
+AGAGGACGGAAGGCATTGCGCACCTGCGGACGATTAATGGTGATTTTTGCGATACCGTCG
+GTGGATTTTTCATAACGAATGTCCTCGAAACCTTCGGAGCAGTCGTGCCATTCAACCGGT
+GCGTAAAGCATTGCTTCATCAGGATAAATCATATTGTGTCCTTTAGTCAGAAACGCAAGA
+TCTGCGCCAGACTTGCGATTACGCCAGCGGGATTTTCCCGATGCGCGTTATGTCCGGCGC
+GAGGAATGACATGGCAGTCGGCAGCCAGTTCCGCCGCCAGGGCGCGGAATTTGCTGTCAC
+GTTCACCACATAAATAATAAAACGCAAATGTGCGGGCGCTAAGGTTAGCACGTAAATCAG
+GCTGGACGGCGAGAGAAGTCGCCTCCAGCATGGCGGCAAGCGTTGCGCCATTATTGTTGC
+TGCGCAGCGCCACCAGCTCCCGGCGTTGATCGTCATTGAGTGAGGCAAAAACAGGCTGTT
+GATACCAGTCGGCAAATACCGCCGTTAACGGTTCTGTGAGAAAACGCTGCACCCATTGGC
+GATCGGAACGCTGACGTTCCGCACGTTGTTCAGCATTTTGCAGCCCCGGATGCCCGCCTT
+CGACAATAACCCCACAAAGCCCCGCCAGCCCCTGGCAAGCCGCCATCATCGCCACCCGTC
+CACCAAGCGAGTACCCCACCAGCCAGAAGTCAAGGATGTTGTAACTAACCAAGGTTTTAC
+GCAGTAAGTCGGTGACATCATCAAATCCATCGACGCTAATCGCCGCCGAACCACCGTGAC
+CTGGGAGATCAACATACAACCGTGAGTAGTCGGCAAACGCCTCGCCCACTTCTTGCCATT
+CGTGGCAATCGCCGGAAAAACCGTGCAAAAACACCAGCCAGGGTAAACCTGGTTTTCCGT
+GTTTTGCCTGCGCGTGCAGGATCATAAATGGCTTACCTGCGCCAGAAGTTGCTGGAGCGT
+TTGCGCACCATCGGTGTCGTTAACCACCATTTCAATCACCGTGGTGGTTGGCGTGCGCCA
+GGCGTCGGCAAATGCCGTTTCAAGTTCCTGCCAGTTTTGCGGACGATGATATTTCAGCTC
+GAACATCGCGGCGGCGTGCTCAAAATGGACGTTTTGCGGCATCAGATAGAAACGCTCACG
+CTCGCTTTGCGGCGTTGGCAACAGCGAGAAAATTTGCCCGCCGTTGTTGTTCACCACAAT
+TAATACCAGCGGCGCAGAAACCTGACGCAATAACGCCAGCGCGTTGAGATCGTAAAGTGC
+GGAGAGATCGCCCACAATCGCCAGCGTCGGTTTGCCGCTTGCCCGCTGAACGCCGGCGGC
+GGTCGAAAGCAGCCCGTCGATACCGCTGGCCCCACGGTTGCTGTACACCGGGTAACCTGC
+CGGAAGTTGCGAAAGCGCATCAATCAGACGTACCACCAGGCTGTTACCAACAAACAATTG
+CCCCTGTTCAGGCAGATAGTCGCAGATGCGATGCGCCAGTTGCGCTTCGCCAAACGCATC
+ACGGCGGGCAATAACCGCCTGCATTGCCTGTTCCGCCAGGCGCGGGATTTCAACGCACCA
+GGGCTGGCGTTTTTCTGCCGGATGCAGCTCCAGCCAGTCGGCAATATTGGCAATTAAGCG
+ACGTCCGCGATGGTGTGCCGGATCAAGTCGCCCTTCAATGTCATCAACAATCCAGTACTC
+TTCTGGTTCACAGCTTGCCTGCCATTGCAGGAGCCGTTTCCCCGTCAGGCTGCTTCCCAG
+TTGCACCACAATTTGCGCCTGCTGCAGCTCGCTGGTCGCTTTGGCATTGCCTAACCAAAG
+ATCGGCACACGGCAGCGGCTGCCCGGTTTGTGACAGCACATCGCCAATCAGCGGCCAGCC
+AAGAGTTTGCGCCCACAGGGCAACTTTTTTGCCCTCTTCCGCACTCATGCGCCCGGCAAC
+CACCACGCCGCGCTTTTGTCGCCAGAAGAACCAGTCGCGCTGTTTTTCACTTTCCAGACG
+AGGCGCTTCACGCAGCCACGGTTTGTCGTCCTGCCACCAGTCACCCAGACGCTGTTGCCA
+GCTAAGCCCGGTATCGTCCATTTCGCCATACAGCGGTTCAGCAAACGGGCAGTTGATATG
+GACTCCCCCCGCATGAAGCGTACCGAGAGCGTGGTCGATGGTAGAAACCAGCCAACGTGC
+GGGGATATCCTGGGTCGGGCGCGGCAATGAAATACTGTGCGTGGGGTGAGAGGCGAACAT
+TCCCGGCTGGCGAATTGCCTGATTCGCGCCGCAGTCAATTAGCTCCGGCGGGCGATCGGC
+GGTTAAGAGAATCAGTTTTTCTCCGGTTAACCCGGCTTCAATCAGTGCCGGATAGAGATT
+TGCCACCGCCGTGCCGGAGGTCACAATCACCGCCACCGGCTGCTTGCTGACTTTCGCCAG
+CCCCAGCGCCAGATGCCCCAACCCACGCTCATCGAAATGGGTGTGGTGAATGAATGCGGA
+ATTCTCCGCCGCCGCTAACGTTAACGGTGTAGAACGCGAGCCTGGGGCGATACAGATGTG
+TCTGACGCCGTGACGCGTTAATGCTTCCAGAATGACCGCCGCCCAGCGTCGGTTAAATGC
+GCTTACTGACATGAGTTTGTCCGGTATCAATATTGCGGCTAAGTATAAGGAGCTACAAAA
+ATAGATTATTGATATGAATCGGTAATGATGCGACTCATTACTATTCCATTTGTAATAAAG
+TACGCAGCCCTGCCGCTTTGTTGTCGATTTCCTGCCACTCTTGCTCGGGGTCGGAACCAC
+GGACAATGCCCGCGCCAGCATATAATCGCACGACATTGCCGCTAATTTTTGCTGAGCGCA
+GGGAAACGCAGAATTCGCTTTGTTGTAATGAGAGATAGCCCGCAGAACCGGCGTACCATT
+CTCGGGTGAACGGTTCGTGACGGGCGATAAACTGTCGCGCCAGATCGCGCGGTAAGCCAG
+CAACTGCTGCCGTTGGCTGCAACTGATGTAAACAGATCACATCATCCGCTTTGTTGAGTG
+AAGTCCAGATACAGCGGCGAAGATGCTGCACTTTACGCAGACGCAGTACCTGCGGCGGTA
+AAACATCCAGCGTCTGGGTATCGGCCTGTAATCGTTGACAGATATCTTCCACCACCAGCA
+TGTTCTCGCGCTGGTTTTTATCATCCGCCATCAGCCACTCTCCTAACTGCTGCGCCTGCT
+TATCATCAGGATTATTTGCTACTGTTCCCGCCAGCGCTTCAGTACGCAGCGCTTTGTCAC
+GCCGCCGCCATAACCGTTCCGGTGAAGAGCCAAGAAAAGCATTTTCGCCATCAAAGGCCA
+TGTAAAAATGGTAGCAATTCAGATTCAGTCGACGACTGGCAGCCATCATCGCCGCCGCGT
+TGACCGGACTTGCGAAATGCAGGTCAGTTGCCCGAGCGAGCACCACTTTGTCGAGCTCAC
+CTTCGGCGATGGTTTTCGTTGCCAGTTCGATTAATTGCGTCCAGCCCGTTTTGTCCGGCC
+AGTGTTGTTCTCGCGTGGTGGTTAAATGTAACCCAGGCAAGGGCTTGATACTCACCAGTG
+TGGCGATAAATTCTTTTGCCTGAATCGCATCGTGCTGAAGGGAGCTTTCGCTGAATAGCG
+TCAGCCGCAGCGTGGCTTTACCGCCACAGCGTCGCCATTCCAGGCGGGGTAAAAGTAAAT
+TGCCCTGCGACGGGTCAAAAGCATTCAGCCCCCAAATGCGTAAGTCGGCGTGTTCCGGGT
+GCTGGCGAAGAAAACGTTGTGCCTGGTCCAACGACGTAAAACGGGTAATCGCGCCCAGGA
+CGACAGCTTCTTCATCACCATTACGTTGTTGCCAGTAGAATTGCGGGTATGTTTGCTGAC
+TGGCCAGCCAGCTCAAGGCATCAAAAGCGTCTTTGAGAGGGAAAGGAATATCGATAACCC
+GAATGCCGGGTGTCGCCGGAATCTCTTGCGACAAATGGCGCAGTAGATTTTCCAGCGCCG
+TAGTAAGTGATTGCACGCGGACCTCTCCCTGTTAAAAGCCTCACATTATACGGGGTACTA
+CAAAAAAAATGCAGTACCCCGGTGTAGGGAGGTTTTAACGGCGTGCCAGCAACAGTCCTA
+GTACCAGCCCAACGGCCGCGCCCACACCAATTCCTTGCCAGGGTTTTTCGTGGACGTAGT
+CATCAGCACGATAAACTGCCTGCTTCGCCCGATAGTAATAACTGTCTGAAGCCTGGCTAA
+CCCGTTTTTTCACATCATCCAGCGCTTTTTCTGCACGCGCTTTCAGCTCAACATATTTCT
+GATCGGCGGGATCGCCAGAGGAGCGGAGCACCTCTTCCAGTGTTTCACTAAGCAGCGTCA
+GGTCGTCATCGATACGTGTATCACCAAACTGATTAGACATTCTCGTTCTCCATTTGCGTA
+AAACCTGTCACTAACTATAGACAAGGGTTGTTGATTACGCCTGAATTACCTCGCGTGCCA
+TCCCAATGTGTGGGATACCATCTTCTTCATAGACCTCCGTCACAGGGATAAAACCGAAAC
+TCTGGTAGAAGTTTTGCAGATGCGCCTGCGCCCCGAGGTAAACAGGCTTATCAGGCCAGT
+GATGCGTACATGTTTCGAGTGTTTTACTCATCAGCTGCTGCCCCACTTTTTCGCCACGCA
+ACGCTTCACTGACAATCACCCGACCTATAACGACCGGCTCAAGATCATCATCACTTTTCA
+GAATCCTCGCATACGCCACCAGTTCATCATTTTTCCAACCGAGAATATGGCGATTATCCC
+CCGTCAAATCATCACCATCGATATCCTGATAAGGGCAATTCTGCTCGACAACAAACACCG
+CGCAACGCAGTTGTAATAAGGCATAAAGCTGGGAAACCGATAATTCAGAGTGATGCAGAT
+CTTGCCATTCAATCATAATGCTCTCCTTTTAGATGTATGCCTTATACTAGCCGGAATATT
+TTTTGAAACGTGATGAACTCATGGAATTAATTTTTTTAGGTACTTCAGCCGGTGTGCCAA
+CCCGCACGCGCAATGTCACGGCAATATTGCTTAACCTGCAACATCCGACCCAGAGCGGAC
+TTTGGTTGTTTGACTGCGGTGAAGGCACCCAGCATCAGCTACTGCATACCGCCTTTAACC
+CTGGAAAACTGGACAAGATTTTTATCAGTCACCTTCATGGCGATCATCTTTTTGGTTTAC
+CCGGCTTGCTGTGCAGTCGTTCTATGTCAGGCATTATCCAACCCTTAACGATTTATGGTC
+CGCAAGGTATCCGTGAATTTGTGGAAACCGCGCTGCGGATTAGCGGCTCATGGACCGATT
+ATCCGCTGGAAATTGTCGAAATTGGCGCTGGCGAAATTCTCGATGATGGCCTGCGCAAAG
+TAACCGCTTATCCGCTGGAACACCCACTGGAATGTTATGGCTATCGTATTGAAGAACATG
+ATAAACCGGGTGCATTAAATGCCCAGGCATTAAAAGCTGCTGGCGTGCCGCCTGGCCCAC
+TGTTTCAGGAATTAAAAGCGGGCAAAACAATCACGCTGGAAGATGGAAGGCAGATTAACG
+GCGCAGATTACTTAGCTGCTCCAGTGCCAGGTAAAGCGCTCGCTATTTTCGGCGATACCG
+GCCCCTGCGATGCCGCACTTGACCTGGCTAAAGGTGTCGATGTCATGGTGCACGAAGCGA
+CGCTGGATATAACCATGGAAGCCAAAGCCAATAGTCGCGGCCATAGCTCTACACGCCAGG
+CTGCGACACTAGCCCGTGAGGCTGGAGTCGGCAAGCTAATCATTACCCACGTCAGCTCGC
+GCTATGATGACAAAGGTTGTCAGCACCTGTTACGTGAATGCAGGTCAATTTTCCCGGCGA
+CTGAACTGGCGAATGATTTCACCGTGTTGGTGATGCTGCCAACTTACTGATTTAGTGTAT
+GATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAG
+CTACTGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCTATCTCTGCT
+CTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGC
+ACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACAGCCCGCATTA
+TGGGCGTTGGCCTCAACACGATTTTACGTCACTTAAAAAACTCAGGCCGCAGTCGGTAAC
+CTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGG
+CTATGTCGGGGCTAAATCGCGCCAGCGCTGGCTGTTTTACGCGTATGACAGTCTCCGGAA
+GACGGTTGTTGCGCACGTATTCGGTGAACGCACTATGGCGACGCTGGGGCGTCTTATGAG
+CCTGCTGTCACCCTTTGACGTGGTGATATGGATGACGGATGGCTGGCCGCTGTATGAATC
+CCGCCTGAAGGGAAAGCTGCACGTAATCAGCAAGCGATATACGCAGCGAATTGAGCGGCA
+TAACCTGAATCTGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCAAA
+ATCGGTGGAGCTGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATA
+AGTTGGAGTCATTACCCACCGTGTTTAACGTTTAACTCTGCTTATTATTAAAAACAGGGC
+GAAACTTGCCCTGTTATCGCAACCCGCGCTACATATATCCACCCACACAGGCATATTGAG
+CGATTTTTGATATTTATTCATCTCCTTACGCACTATATTCAGAGCAATAAGTTGCCTCTT
+TTCATCTTGATTCAGCACAACCTTTGCAACTAAAAGGAGCCCATGATGGTTACAGTTGTC
+AGCAATTATTGTCAATTATCTCAAACGCAACTCAGTCAGACATTTGCAGAAAAATTTACT
+GTGACCGAGGAATTACTGCAGTCTTTAAAAAAAACAGCGTTATCCGGAGATGAAGAAAGC
+ATTGAGTTACTGCATAATATTGCGTTAGGTTATGATAAATTTGGGAAAGAAGCTGAAGAT
+ATTCTTTACCATATTGTTAGAACCCCAACAAATGAGACCCTATCGATTATCCGACTTATC
+AAAAATGCTTGTTTAAAATTATATAATCTGGCACATATCGCAACCAACTCCCCCCTCAAA
+TCACATGATTCAGATGATCTCCTGTTCAAAAAACTATTCTCCCCTTCGAAATTAATGACA
+ATTATCGGTGATGAAATTCCTCTTATATCTGAAAAACAGTCGCTTTCAAAGGTGCTTTTA
+AATGATGAGAATAATGAACTGAGTGATGGTACAAACTTCTGGGATAAAAATCGTCAATTA
+ACCACAGATGAAATAGCTTGCTATCTTCAGAAGATCGCCGCTAATGCAAAAAATACTCAA
+GTCAATTATCCTACTGGTCTCTACGTCCCCTACTCCACCAGAACTCACCTGGAAGACGCT
+CTCAATGAAAATATTAAGAGCGATCCATCATGGCCGAATGAAGTCCAGTTATTCCCCATA
+AATACTGGCGGACACTGGATATTAGTTTCGCTACAGAAAATAGTAAATAAAAAAAATAAT
+AAACTACAAATAAAATGCGTCATATTCAACTCATTGCGTGCACTAGGCTATGATAAAGAA
+AATTCACTTAAGCGTGTCATTAATAGTTTTAATTCTGAACTCATGGGAGAAATGTCGAAT
+AATAATATAAAAGTTCATTTAAATGAACCAGAGATAATATTTTTACATGCCGATCTTCAG
+CAATACTTAAGCCAAAGTTGCGGTGCATTTGTGTGCATGGCAGCCCAGGAAGTGATTGAA
+CAAAGGGAAAGCAATTCTGACAGCGCCCCCTATACGTTATTAAAAAACCATGCTGACAGA
+TTTAAAAAATATTCAGCAGAAGAGCAGTACGAAATTGATTTTCAACATCGACTGGCAAAC
+AGAAATTGTTATTTAGATAAATATGGCGATGCAAATATCAATCATTATTATAGAAACTTA
+GAAATAAAACACTCACAACCCAAAAATAGAGCATCCGGCAAAAGAGTGAGTTAACATCAT
+TGTTAATTAATTCGACCAGTCAGCAAATATGCTGACTGGTCGAACATAGTTTGCTAAACA
+GTCATCACTGACTGATGTCAGTCACACCATCCGCCAGTTCAATCAGGCGAATAAATTCCG
+CCCTGTAACCCTGTGGATCTTCCCCTTTTGCCTGCTGAGCCCACTGTTTGATCTGCTGCC
+AGGAGGTATTGTTCAGGTATTCAGAACCGCGTAACTTTTGCCCATATGCAGCTACTGCTG
+CGCGAAAACGCATATCTTCAGAGGGCGCGTTTATTGTTGGCCCCAGCGGGAATTCAACTA
+ACTGACTTTCTTTTCCCTGCGGGTATTTCCAGCGAATTTTTAACCAGGCCAGTTCTTTCG
+TTTTGTCCGATTTCGCTAATTTGTTATCCGGGGCATAGCGTAACTTATCAATTGATGCTT
+TTTGCCCGTTCAGCGTTAATTCGAATAACAACGTTATATGTTTGCCTGCGCCTATATCCC
+CTGCATCAACGTTGTCGTTATTAAAATGTTCCACCCGAAGTTGGCGCTTTTCATAACCAA
+TCTGACGGTATTCCGTTACCCACGCGGGGTTAAACTCAATTTGCGCTTTGACATCTTTTG
+CTACGGTAATCAACATCTGCCGCATTTCACTATTCAATACTTTCTGCGCTTCAGAGAGGG
+TATCAATGTAGCTGTAGTTGCCGTTACCAACATCGGCAATTCGCACCATCATTGCCTCGT
+TGTAATTGCTATTCCCCACGCCAAACGTCGACAGAGTAACACCAGACTCCCGCTGTTTTT
+TGACCATTGATTCAATCGATTTTGGATCGTCAATGCCAACGTTAAAGTCACCGTCAGTGG
+CTAATAAAATGCGATTGATGCCGCCCTTAATAAACCCTTTCGTCGCCTGCTGATAAGCCA
+GTTCCAGCCCGGCACCGCCATTGGTACTGCCTTCGGCATCCAGCGAATCAATTGCGGCAT
+TAATTTCCGCCTTATGACTCCCGGAGATAGAAGGCAATGCAATACGGGAGTCGCCAGCGT
+AGGTCACGATGGCAATGTTATCCTGCTCACGAAGTTCTTTGACCAATAATTTCAACGAAG
+ACTGGATAAGTGGCAAACGTTCATCAGAAATCATTGAACCAGAAGTGTCGATAAGAAAGA
+CCAGATTAGAAGCTGGTAACTCTTCACTTTTGCGATCTTTCGCCAGGATATCAACTTTCA
+GCAATGTTCGCTGTTCATTCCATGGTGCAGGTGCCAATTCGTAGCGCATAGCGAAAGGTA
+TTGGCTTAGAGGCCGGAATAGATTGTTTGTCTTTGATATCCCAATCAGACGGGAAATAAT
+TGACTATCTCCTCCACCCGCACAGCGTCTGGCGGAGGTAACAGCCCTTGATTGAGGAAAC
+GCCTTACATTCGCATAACTGCCAGTGTCAACGTCAAGACTAAACGTCGCCAACGGATTTT
+GCGCTACCTGCTTAACCGGATTATCATCGAACTGCTGGTAGCGAGCGGTTCCTGGATTTG
+CGATATGTGTAGCTTTTGCTTTAGCCGCTCTTGCAAATGTTGGCGCTTCCTGCAATCGCC
+CCTGTAAAGCCTGTTTGTCTGAATATTGTTGCACTTCTTGCTGGGCCAAGGCTTTCGCGG
+CGGCGGCGCTTTGCTCAGCCTCTTTTATTGCAGCTTGCTGCGCGGCAAGCACTTGCTGCT
+CTGTGGGAGTACTGGGTTGTTGTTGCTGACTTTCCTTATTCTCAGGTTGCGGCCCACATC
+CTGACAAAATCAAACTACTCATAAGCAACATGATTATATTTTTATTTCGCATATAAAATC
+CTTTTAAATAAACTCAGGCACCAGACATAAAATATACTCTTTGTATAATCCTGCTAATCT
+TAATAAAATACAATATCGAAACCCATAGCAAATAATGATTCAACAACGCAACCCATTAAT
+AATTTGCATATGAAAAAAATAATCTTTGCTTTTATTATATTATTTGTGTTTTTACTCCCT
+ATGATTATTTTTTACCAACCCTGGGTCAATGCATTACCGTCAACGCCCCGACACGCAAGT
+CCTGAGCAATTAGAAAAAACAGTTCGTTATCTTACACAAACTGTGCATCCACGTAGTGCC
+GACAATATTGATAATCTGAATAGGTCCGCAGAATATATAAAAGAGGTCTTTGTCAGTAGC
+GGTGCCAGAGTTACCTCGCAGGACGTCCCCATTACGGGTGGCCCCTACAAAAACATTGTT
+GCTGATTATGGTCCTGCCGATGGACCGCTGATTATTATTGGTGCGCATTATGACTCTGCC
+AGCAGTTATGAAAACGATCAATTGACCTATACGCCGGGCGCGGATGATAACGCCAGCGGT
+GTGGCAGGATTACTCGAACTGGCACGTTTGTTACATCAGCAAGTACCGAAAACAGGCGTG
+CAGCTGGTCGCCTATGCGTCGGAAGAACCGCCCTTCTTTCGTAGCGATGAAATGGGGAGC
+GCGGTGCATGCAGCTTCGCTTGAGCGTCCAGTGAAATTAATGATAGCACTGGAGATGATT
+GGCTATTACGACTCTGCGCCTGGAAGCCAGAATTACCCTTACCCGGCAATGTCCTGGCTT
+TATCCCGATCGGGGAGACTTTATTGCCGTGGTCGGCAGAATACAGGATATCAACGCCGTT
+CGTCAGGTAAAAGCGGCATTGTTGTCATCTCAGGATTTATCTGTTTATTCTATGAATACC
+CCAGGGTTTATTCCCGGTATTGATTTCTCTGACCACCTGAATTATTGGCAACACGATATT
+CCCGCCATAATGATTACTGACACCGCTTTTTATCGTAATAAACAATACCACTTGCCCGGT
+GATACCGCAGACAGATTGAATTATCAGAAAATGGCTCAGGTAGTGGATGGTGTTATAACT
+TTGTTATACAACAGTAAATAATAAAAATTTCTCGAGGCGGGTCCAGAAAAAGCGACATGC
+ACATTTTATTTTCCCTCATCTGTTTTAAGATGCGAAACATGAAATTCAACGGAGGAAAAA
+TAAATGGGAATGATTGGCTATTTTGCAGAAATTGACTCAGAAAAGATTAACCAACTGCTT
+GAGTCTACTGAAAAACCTTTGATGGATAATATACATGACACGCTTTCAGGATTACGCCGA
+CTGGATATTGATAAACGCTGGGATTTTTTACACTTTGGGCTGACAGGCACCTCTGCTTTT
+GATCCCGCGAAGAATGATCCGCTGAGTCGTGCCGTGCTTGGTGAACACAGCCTCGAAGAT
+GGCATAGATGGCTTCCTTGGATTGACCTGGAATCAGGAGTTAGCCGCGACAATCGACCGA
+CTGGAATCACTGGATCGAAATGAACTGCGTAAACAGTTTTCCATTAAGCGACTCAATGAA
+ATGGAGATTTATCCGGGAGTGACCTTTTCAGAAGAGTTAGAGGGGCAACTCTTTGCCTCG
+ATCATGCTTGATATGGAAAAGCTGATTAGCGCGTATCGACGTATGCTGCGACAAGGGAAT
+CATGCGCTGACGGTTATTGTTGGGTGATATAGCTTGATGCCTGGGGGAGAAAGACCCATT
+AGTTAAGATTTACGCCAGGATCATCTTGAAAAAATCTTTAACCATGGTCCGGTTTTTATC
+CCCTTGTATAAATATTACTAAATGCTTGCTTAGTCGCATTGTTAAATGCAATACCGTATA
+TTCGGTATGTAACAGCGATATCCTCTGTGCTGGCAACGATCTGTCATGCTTGATGAAAAC
+GGAATTGAACCTGTCATTACCAGGTAGATAAAAAGCCTGTTCAATTTTGGGATTATTTTT
+TATAACTCGTGTCTGTTATGGCGACACGGGAAAACATCAATATTGTCCTTCACAAATTGC
+AGTAATATAGAATCAACCTCTCTTGCAAGTTGGTCACAATGTATTATAAGCATTTTGAAT
+ATGTCATCCTCTGTAATCTCGTGAAAATTTTCGGCCTTGTCTTTTAGCTCATCATATCGG
+ATTCTTGCAGTAACCATTTTTTGGGCGAGTTCTAATAACCCCAAAGCTTGCAATTGCTGG
+TGAGTATGATCACTTTCAAAAAATATCCCACACTCCATTCCTTCCCAACCAACATATTCA
+TGCCATTCATAAACCAGCATAAATGTTTGTAAAACTGGCGGTAATAATTGGATATCTGCA
+AAACCAAACCAAAACTTACGCTTGAGATCCCACTCATATTCAATCGCCAATGCTATATTG
+TTTAAGGCATCTCCGGCATCCTTATTTTTACGCAAAATCAATTCCGTCAGTGTATAGCGT
+TGTTCATCAATACGCCGAAGAGCTTCTGCAATATCATAGTTTGTAGCCAACAAAACATTC
+TCTGCTTCCTGATGAGTGACGTCTGCTTTTGCCGTCAATATATTGATTTGGTCAATATGA
+AACAACTTGATGGCTTCATCAACATCACCGCCAGTCCTCTCTAACAAACGTCTGGCAACC
+TGGATACCGACAGGTACGTTCTTCCGAAGTTTACGAATTTCACTTAACCATTCCATGTCA
+AACCCCTTTAAATATTTATGATATTAAATATAACAACGTCTGGATAACGACCCGGCCTGA
+CTGAATATCTCACGTTTTCCTGCTTAACATTCATGTTATGATGCTCTTGAAACTAATAAT
+ACGTATGGAATTGTCACTATTTATCTGCTAATGAATTCAAACAATGTCATTCGTTTGATG
+AATATATTATTTCAGGGAATAATTATGACACCTTTAGAACGCATTACCCAACTTGTTAAT
+ATCAATGGTGATGTTAATAATCCTGATACTCCTCGTCCATTGTTATCTCTTGAGGATTTT
+TTTATTGACAATAATATCCATGGTTCAATATGTTGCAATGTGATTCCAGAACAATCTCCG
+CAAGCTATCTATCACCATTTTCTGAAAATACGTGAGCGTAACAATGTTAGTGATGTTTTG
+GTAGAAATTACGATGTTCGATGACCCAGACTGGCCCTTTAGTGAAAGTATTTTAGTTATC
+ACCACTGCTTCACCAGAAGAAGTTCAGAGCTGGTTTGTAGAAGAAATTGCCCCTGATGAG
+TGCTGGGAAGGATGGTCAGAAGATACGGAGCATGGATGGGTTGAAGTCCCTGTGGGTATG
+CATCCGGTTACTTGTTGGTGGGATTAAAACATTTATATAAACAGATAAGCGGATGTTTAC
+ATAAATTTTTATGTGAAGGAACATGATGAAACTTATTCCTCGCAGTAGTGATATTTCACC
+TGGCATTGATGGAATTTGCCCGGGGCCTTTTCCTCCGAACGGATTTACCGTACTTACAGA
+TGCAGCATATGGTAACGGAGACTGTTTCGGTTTGTACTGGCCTATTGGTCAGGAGCATAA
+ACTACCTATAGTGTGCGAAACGTACCATGACGAATGGCGAATCGTACCTGCCTTTTCCAG
+CATTAAGAAGTTCGAAGAATGGCTGGAAGTGAATGATGATGATCCCCATGAAAATGGCAT
+CAGCATCGAAGATCAAGACTTTGCAGCAAATCTCTTCCGTGTTGCTCGGAAATGTCTTTC
+AACGGGAAGGCTTGATGACGCACTGCCACTGTTACAGCGAGCAACAGAACAATTGCCTGA
+AGTCAGCGAATATTGGTTAGCACTGGCAATCCAGTATCGCCGATGTAAAAAAACAGAAGC
+TGCAGCACAGGCTGCGCTTAATGCTTATCTTGGCAATTGGGCATTTGGTGTTCCTGACAA
+TAAAGTCATTCATTTGCTGTCACAGGCCGCAGATGTCCCGAATTTCCAGGATGATCCTGT
+GATTCAGTGCATTAAAGAACAAGGATTAGATCTTAGCTTTGGAGGAACAAAGGAAAATAA
+TAATTACCCCTTGATGCAGATGTGTGTTGATACTTATTTTGCGCAGAGAAAACCGCTTCA
+GGCATTAACCCTGTTACATAATTATGCCTGGATAATGTCCAGTGAAACGACTGCATTTCA
+GGAACGCTATGATTTTAATATCGATGAATGGCGGGCAAAATTCAGGCAGTTATGTTTAGA
+GTATTTTGGCGATAGTCGTACACAGTTCACTTAACGCTCTGCGTCTATCTACTATCCCTT
+CTTTTTCAGAAAAACCGCCGAGCATGTCGGCGGCTTTCTGACTTACAAAGTAACAGATTA
+CATCAGCGGCATTGCCAAACGCACAATGCTAATCAGCGGTTGTGGCCATACACCCAGCAC
+CAGTACCAACAGTGCAGAGATCAGCACAACGATACCGCCCGCGCTGTACTGCCAGTTTGA
+TGGTGCATCGCGACCCGGTTGTTCCGGGGCGTGAAGATACAGGCTCACCGCCACGCGCAG
+GTAGTAGTAGAGGCCGATTGCCGAACCGACAACCACGGCACCCACCAGCCACCACAAGTG
+TGCCTGGACACCGACCGCCAGCACGTAGAACTTACCGATAAAGCCCAGCGTCATCGGGAT
+ACCGGCCAGAGACAGCATCATCACCGTCATCACTGCCGCGAGGATCGGACGATGCCAGAA
+CAGACCGCGGTAAGAGAACAGGGAATCAGCATCCGGGCCACGATACGGGCTGGACATCAG
+GCTGACCACGCCGAACGCGCCGAGGCTGCTGAACAGATAACCGGCCAGGTAAACCCCTAC
+CGCTTCCATCGACATCTCGCCGGTTTGCAGCGCAATCAGCGCTACCAGCAGATAGCCGAG
+GTGAGAGATAGATGAGTAACCGAGCAGACGTTTGATATTGGTCTGGCTCAGCGCCATCAG
+GTTACCGAAGATGATGGAGGCAAAGGCGATAATCGCCAGCACCACGCGAATCGCTTCGCT
+GTCACCCACCGGTGCGTAGAGGAACAGACGCATCACCACACCGAAGATAGCGATTTTGCT
+CGCCGTCGCCAGGAAAGTGGAAACCGGCGCAGGCGCGCCCTGGTATACGTCTGGCGTCCA
+CAGGTGGAACGGCACCAGAGAGAGTTTGAAGCCGAGGCCAACAATCATCAGGCCGAAACC
+TGCCAGCAACAGCGGCTCGTTGAGCATACCGTCGCCAAGGTTTTTACCCAACGCGACAAA
+CGACAGGTCGCCAGACTGCGCATACACCAGCGCCATACCAAACAGCAGGAAAGAAGACGC
+TGCGGCAGAAAGGATGGTGTATTTGATACTGGCTTCCAGTGAACGTTTCTGGCGGAAAGC
+GTAACCGACCAGGCCAAACAGCGGCAAAGAGATCAGTTCGATACCGAGGAACAGAGACGC
+CAGATGGTTGGCATTCGCCAGCAGGATCCCGCCCAGCGCGGCAATTAACACCAACAGGTA
+GAACTCATCCTTGTTGTCGTTATAGCCTTCAAGCCACGGGTAGGCGAAAGTACAGGTGGC
+GAGGCTCGCCAACAATACCAGCCCGGTGTAAAGCATGGCGAAACCATCAACGCGCATCAG
+CGGCGTAACGTCCATAGCGCCCGCCTGGCCAACAAACCAGAGCGAAACCAGCGCCGCGTT
+AAGCCCAATAACCGAGAGCGTAGCGTTGAGGAAATGATTGCGTCGCCACGCAATGGAGAG
+CATCACAACCACCACCGTCAAGCCGACGATCAGCAACGGTAGCAGTGCGATCAGGTTTTG
+TGGAGTTATTGTCATGGCGATTTACGGCCTTGTAGTAGTAACGGAATTAACAAACCACTG
+CTGGATATTGCCAATCGCGGAGTGCGAGGTATCCAGAATCGGCTGCGGATAGAAGCCCAG
+CAGTACCAGCAGCACCACCAGCAACAGGATCATAAACAGCTCACGCAGCGACATCCCTGG
+CAGTTCCTGGCTGGCAATCTGGCTTTTCGCTTTACCGAAGTAAGCGCGATGTAACATCGC
+CAGCGAATAAACAGATGCAAAGACCAGCCCAAAGGTAGAGATAACGGTAATCACCGGTAC
+AACCTGGAAGCTGCCGAACAGAATCATAAATTCGCCGACGAAGTTACCGGTGCCAGGCAT
+CCCAAGCGTTGCCACCGCAAAGAACAGCGACAGTGCTGGCAGCCATTTCATCTTGCTCCA
+CAGACCGCCCATCATGCGCATGTCGCGGGTATGGATACGTTCATAAAGCTGACCACAAAG
+AATAAACAGACCCGCCGCCGACAAACCGTGCGCAATCATCTGGATTACCGCGCCCTGGTA
+GGCCAACTGGCTGCCGGTGTAGATAGCAATCAGCACGAAGCCCATGTGGGAAACCGAGGT
+GTAGGCGATCAGACGTTTGATATCGGTCTGGGCGAAGGCCATCCACGCACCGTAGAAGAT
+GCCGATAACACCCAGCCACATAGCAATTGGCGCGAACTCTGCCGACGCGTTCGGGAACAG
+CGGCAGGGAGAAACGCAGCAAACCGTAAGCGGCAGTTTTCAGCAAGATCCCCGCGAGGTC
+AACGGAACCGGCGGTCGGAGCCTGGGAGTGCGCATCCGGCAGCCAGCCATGCAGCGGAAC
+CACCGGCATTTTGACTGCGAAGGCGATGAAGAAGCCCAGCATTAACAGGTATTCCACACC
+ACTGGACATTGGCGTATTCAGCAGCTCTTCATAGTTGAAGGTCCAGACGCCGGTCGCATT
+GTAGTGAACAAAAACCAGCGCCAGGATGGCAATCAACATCACCAGGCCACTCGCCTGGGT
+GTAAATGAAGAACTTGGTTGCCGCCGTGATACGCGTTTTACCGTCAGAGGCTTTATGCCC
+CCACAGTGCGATCAGGAAGTACATCGGCACCAGCATCATTTCCCAGAAGAAGAAGAACAG
+GAACATGTCGATGGCAAGGAACACGCCGATAACGCCGCCCAGGATCCACATCAGGTTGAG
+GTGGAAGAAGCCCTGATATTTTTCGATCTCTTTCCACGAACATAGTACCGCCAGCACACC
+GAGCAGACCGGTCAGCACGACCATCAGCAGCGACAGCCCGTCAATGGCGAGATGAATAGA
+GATACCAAAACGCGGGATCCACGGCATGTCGAATTCAGACTGCCACTGCGGAATTCCGGC
+GGATTGCGTCAGTGAATAACCGCCCTGCAACCACAGTTGCAGCGACAGCGCCAGCGTCAA
+TCCCATGGTGATCAGCGCGATCCAGCGTGGCACCTTGACGCCAAAGCGTTCGGTCTGCCA
+GCACAGGAAGCCGCCAATAAAGGGAATTAATATTAGCCAGGGTAGTAACATGGCGATCTT
+TATTCCTTGTAAAAGTCCCGTCAGGACCGGATTTTCAACGAATTCTCACGACAGAAAATT
+CTCTTCGGACTGGGGGTAGTGTCGGATGCACCGCGAAGGCGGCTTATCCGACCTACGTTC
+TTATATGCCCAGGGGCAATCCCACAATCCTTAACTCAACGCAGTACCATCAACAGTGCCA
+GCACCACGACCGCACCGATGCTCATGGATGCCACATACCAGCGCAGATAGCCGTTCTCAC
+TTAACAGCAGACCTTTACCTGCAAAGCGGGAAAGGACAGCCGGGATGTTCATCATTGAGT
+TCAGCGGATCGCGTTTCAGCAACCAGGCAATACCCAGGAACGGCTTGACGAACACTTTGT
+CATACAGCCAGTCAAATCCCCAGGCGTTGTACCACCAGGTGCCCAGCAGACGGCCCGGCG
+CACTGTTGGCGATGGAGGTCACCAGAGTACGTTTACCCAGCCACAGCCAGGCTGCCAGCA
+GAATGCCGACCACCGCGACCACGCCAGAGGTAATTTCCAGGGTCAACATGCTGCCGTGCG
+CCAGTTCCGTCGTTTGCGGAAGCACGCCCTGCAGCGGCGGTACAATCAGTGCGCCAACGA
+AGGTGGAAAGGATCAGCAGCACAATCAGCGGCAGGCTGTGAGTTACCCCTTTCACGGCGT
+GAGCGTGAATTTGTTCTTTTCCGTGGAAGACGATGAAAATCATACGGAAGGTGTAGAGCG
+AGGTCATAAACGCACCGACCAGACCTGCCACCATCAGATTGATATGACCATTCGCCATCG
+CACCCGCGAGGATCTCATCCTTACTGAAGAAGCCCGCAGTGACCAGCGGTAGTGCCGACA
+GTGCTGCGCCGCCCACCAGGAAGCAGAGATAAACCAGCGGAATAGATTTACGCAGACCGC
+CCATCTTGAAGATGTTCTGTTCGTGATGGCAGGCCAGAATGACGGAACCGGATGCCAGGA
+ACAGCAGCGCTTTAAAGAACGCGTGGGTCATCAAGTGGAAAATCGCCGCATCCCATGCCT
+GCACGCCAAGCGCGAGGAACATGTAGCCAATCTGGCTCATGGTAGAGTAAGCGAGAACAC
+GTTTGATGTCGGTCTGTACCAGCGCGGCAAAACCGGCCAGCAGCAGCGTAACCGCCCCGA
+CAATACCCACCAGATGCAGAACTTCCGGCGTCATCAGGAACAGGCCGTGGGTACGGGCGA
+TCAGGTAGACACCCGCGGTTACCATGGTTGCGGCGTGGATCAGCGCGGAGACAGGCGTCG
+GGCCCGCCATCGCGTCGGCAAGCCATGTCTGCAACGGCAACTGCGCAGATTTACCGACCG
+CACCGCCCAGCAGCATCAGCGTCGCCCACATCAGCATGTTATTGCCGTCAGCAAAGTGCG
+CTGGTGCCAGTTCCACCATTTCGCGGAAGTTCAGGGTGCCCAGTTCGTTGTAAAGAATGA
+ACAGTGCGAAAGCGAGGAACACGTCACCCACACGGGTCACGACGAACGCTTTCATTGCCG
+CTGCGCCATTCTTCGGATCGGTGTAATAGAACCCGATCAGCAGATAGGAGCACAGGCCCA
+CGCCTTCCCAGCCGAGGTACATCAGCAGCAGGTTGTCGGCAAGCACCAGAACCACCATGC
+TGGCGATGAACAGGTTGGTGTAAGCGAAGAAGCGAGAGTAGCCCTCTTCACCGCGCATAT
+ACCAGGAGGCGTACATGTGAATAAGGAAACCCACACCAGTGACCACCGAGAGCATGGTCA
+GCGACAGGCCGTCCAGCACCAGGTTAAAACCGATGTTAAAGTCGCCTACCGACATCCACG
+TCCACAGCGGCTGGCTGTATGTCTGCTCGCCGTTAGCGAAGAAATCAACGCCGATAAAGG
+CGGTTACCAGCGCCGCCAGGCCCACAGAGCCTACGCCGACGATCGCCGAGACGTTTTCAG
+ACCAGCGCCCACGGGAGAATGCCAGCAGGACGAAGCCAATCAATGGCAAAATAATGGTTA
+AGGCAAGCATGTTCATCCGCGCATCTCACTTACTGAATCGATGTTCAGGTTCTGGCGACG
+ACGGTGAAGTTGCAGCAGCAGCGCAAGGCCGATACTCGCTTCTGCCGCCGCGAGGCTGAT
+GGCGAGAATGTACATCACCTGACCGTCGGTCTGGCCCCAGTAGCTTCCGGCGACCACGAA
+GGCCAGCGCGGAGGCGTTAATCATGATTTCCAGACCAATCAACATAAACAGCAGATTGCG
+ACGGATAACCAGACCGGTTAAGCCAAGAACGAATAAGATTGCCGCGAGGATCAGTCCATG
+TTGTAAGGGGATCATGCGTGCTCCTCCGTTTTTCTTTTCGCGCTGTCGTCTTTACGATTG
+CTCAGCACTTCACCCGCACGCTCTTCACGACCGACGTGGAAGGCCACAACCAGACCTGCG
+AGCAGCAGCATAGAAGCCAGTTCCACCGCCAGTACGTAAGGCCCGAACAGCGTAATACCC
+ACTGCTTTAGCACTGATTGGCGTACCGTCGATACCCTGATCGTTAACACCGAGGATGGCG
+TAAACAATCACCACCAGCATGATGGCCGACAAAATTGCCGGACCAATCCACACCTGCGGT
+TTCAGCCACTGGCGTTCCTGTTCGATTTCTGAACCGCCCAGGTTGAGCATCATCACCACG
+AACACGAACAGCACCATAATGGCACCCGCGTAGACGATAATTTCCAGCGCACCGGCGAAG
+TAAGCGCCCAGTGAGAAGAACACCCCGGAAATCGCCAGCAGCGAAATAATCAGGTACAGC
+AGTGCGTGTACCGGATTGGTATGGGTGATCACTCGCAAGGTCGCAAGTATGGCTATCAGG
+CCACAGATATAAAAAGCGAACTCCATTGCCCCTCTCCTTACGGTAACAGGCTCTTGACGT
+CGATAGGCTTGGCTTCGTTCTCTGCTTCGCCCTTATCTTTGCCGTCGATTGCCATACCTG
+CCATCCGGTAGAAGTTATATTCCGGGTATTTGCCCGGACCGGAGATCAGCAGATCCTCTT
+TCTCGTAAACCAGATCCTGGCGCTTGTATTCCCCCATTTCGAAATCCGGGGTTAACTGAA
+TCGCCGTGGTCGGACAGGCTTCTTCGCACAGACCACAGAAAATGCAGCGTGAGAAGTTGA
+TGCGGAAAAATTCCGGGTACCAGCGACCGTCTTTGGTTTCTGCTTTTTGCAGCGAGATAC
+AGCCGACCGGGCAGGCTACCGCGCAGAGGTTACAGGCTACGCAACGCTCTTCGCCGTCCG
+GGTCGCGGGTCAGAACGATACGACCACGATAACGGGGCGGCAGATAGACCGGCTCTTCCG
+GGTACATTCGCGTTTCGCGTTTGGCGAACGCGTGCAGGCCGATCATCCAGATACTACGAA
+CCTGGGTGCCGAAACCTACTAACAATTCTTTTAAGGTCATGGTCTTATTGCCCCTTATTG
+CGCCTGCCAGAGAATGACAGCCGCCGTTACCAGCAAGTTGATCAGCGTCAGCGGCAGGCA
+GATTTTCCAGCCGAAGGACATTACCTGGTCATAACGCGGACGCGGTAACGACGCACGAAT
+CAAAATGAACATCATCATAAAGAACGCGGTTTTCAGCGCGAACCAGATGAATGGCGGTAA
+CAACGGGCCTTGCCAGCCACCGAAGAACAGCGTCACCATCAATGCAGAGATGGTCACAAT
+CCCGATGTACTCACCCACGAAGAACAGACCGAACTTCATACCGGAATATTCAATGTGGTA
+ACCATCCGCCAGTTCCTGCTCGGCTTCCGGCTGGTCAAACGGGTGACGGTGACATACCGC
+CACGCCCGCGATGGCAAAGGTAATAAAACCAAAGAATTGCGGGATAACGTTCCACACATG
+CGCCTGGCTGTTGACGATGTCGGTCATGTTGAATGAACCGGCCTGCGCCACCACGCCCAT
+CAAGGAAAGCCCGAGGAACACTTCGTAGCTCAGGGTCTGCGCAGAAGCACGCATCGCACC
+CAGCAACGAGTATTTGTTGTTACTTGACCAGCCCGCAAACAGCACCGCGTAAACCGCCAG
+ACCTGCCATCATCAGGAAGAACAAAATCCCGATGTTCAGGTCGGCAACCACCCAACCCGG
+ACTGACTGGCACAATCGCAAAGGCCAGCAGCAGCGAGGTAAAGGCAATCATCGGTGCCAG
+GGTAAAGATGACGCGATCCGAGAATTTCGGGATCCAGTCTTCTTTAAAGAACATTTTGAT
+CATGTCCGCAACCAGCTGGAGCGAACCGCCCCAGCCAACACGGTTAGGTCCGTAACGGTT
+CTGGAACAGACCCAGCAGGCGACGTTCGCCAAAGCTCATGAATGCCCCGCAGGTGACAAC
+CACCAGCAGGATCACCACCGCTTTGAGGATGGTCAGCAGGATCTCAATCAGTTCCGGTGA
+TATCCAACTCATTGTTGTGCCTCCTTGAGATCCTCAAGATGCGCGCCAGCCAGCACCGGA
+GCAATGCCGGACATACCCATCGGCAAGCCCACCTGCCCTGCCGTCAGTCCTTCGGCGATT
+TCAACCGGCAGCGTGACCGTGTTGCCATCGTAACTAAAGGAGACGCGTGTACCTGCGTTC
+ACACCCAACTTCGCGGCATCCGCTGGGTTGAGTTTGATGTACGGCTGCGGCATACGGCTC
+TGGAAGACCGGAGCACGCTGTGACAATTCATCGCTGCCAAACAGGTGGTAATACGGCGCG
+ATACGCCATTTCCCGTCCTGCGGCTGGAAGCGTGCCGGTACGCTGGTGAAGTAATCCAGA
+CCATTTTCGCTGGTTTCAAACAGACGCACGCCCGGATCGCCAAAGCGCAGTTTGCCGCCC
+ACTTCGTCCTGGAATTTGTTCCACGCCTGCGGGGAGTTCCAGCCCGGCGCCCAGGCAAAC
+GGCACTTGCGAACGGTGCGCAGTCGGCTGGTTGTTACCTTCCATCGAGAAGGTGAACATG
+GTGTCAATATCCTGCGGCTGACGCGGCTCATGAACGCTGATATTGGCGCGCATGGCGGTA
+CGACCGCTGTAACGGTGCGGTTCACGGGCCAGTTTCTGCCCACGAATACGGAATGTCGCA
+TCCGGCGCAGCATCTTTGATACCTGCCAGTTCCGGGATTTTCGCCACAACAGCGTCAATC
+ACATGGTCGAGCTGCGTCCAGTCCACTTCACGGCTCAGCAGGGTGCTGTGCAGCGAGTGT
+AACCAGCGCCAGCTTTCCAGCATGACAGTTTTGCTGTCGTAATAAGCAGGATCGTAAACC
+TGGAAGAAACGTTGGGCGCGGCCTTCGTTGTTGATCACCGTACCGTCGCTTTCAGCAAAG
+CTGGCAGCAGAAAGTACCAGATGGGCGTTTTCCATAATCGCTGTGCGTTGATGATCAACC
+ACCATCACCAGCGGTGCTTTAGCCAGCGCAGCATTCACGCGGATAGCAGAAGCGTGACGA
+TGCAGATCGTTTTCCAACACCACCACCGCGTCGGCGCGTCCGGTTTCCAGTTCGGTTAAC
+GCTTCTTCAAGCGAACCGCCACCCATAATGCCCAGCCCCATGCTGTTGACGGAACGGGCA
+ATCATGGTGATACCGACGTCAGCGCCGCGACCTTTCAGGGCTTTCGCGACGTTAGCCGCC
+GCCTGAATCACCTCTAAGCTACCGGCGTTCGTCCCGGAGATAATCAACGGTTTCTTCGCA
+CCTGCCAGTGCCTGCACGATGACGTCGATTTTGCTTTGCAGCTCAGGTTCGATACCGTCA
+ACCGCTGGTGCAGAGTTATCCAGCGCATGGGCGATGGCAAAACCTAAACGCGCCTGATCT
+TCAACCGGTGCGCGGTAAGTCCACGCCGCGATATCATCCAGACGGGTGTCATCAACGTTG
+GTAACAAACAGCGGATGCTTCGCACGTTGACCGATGTTGAGGATTGCCGCAATCTGCCAG
+TCAGCCACTTTCTGTGCTGCCGCCATTTCGCGCGCTTTACCTTTCACAGCCTGACGCACT
+GCCAGCGCGACGCGCGCGCCGGTCTGGGTAACGTCTTCGCCCAGCACCAGTACCGCATCG
+TAAGATTCGATTTCGCGCAGAGCCGGAGTATAAATGCCGCCTTCACGCAGCACTTTCAGC
+GCCAGTTGCAGACGTTCCTGCTCACCGTGAGCGATACCGGTGTAGAAGTTTTCTTCGCCC
+ACCAGTTCACGCAGCGCAAAGTTGCTTTCCACGCTGGCACGCGGAGAACCAATACCGATC
+ACTTTCTTCGACTGACGCAGAATATCTGCCGCGCCCTGCATTGCCTGTTCGGCGTTGAGG
+GTAATGAAATCATCGCCACGACGCTGTACTGGCTGACGCGGACGATCCTTCAGGTTGACG
+TAACCGTAACCGAAACGACCACGGTCGCAGAGGAAGTAGTGGTTTACCGTACCGTTGTAA
+CGGTTTTCGATACGACGCAGTTCGCCGTAACGTTCACCGGGGCTGATGTTACAGCCGATG
+GAACATTGCTGGCAGATGCTCGGCGCAAACTGCATATCCCATTTACGGTTGTAACGCTCG
+GAGTGCGTTTTGTCGGTAAATACGCCGGTCGGGCAAATTTCGACCAGGTTACCGGAAAAT
+TCGCTTTCCAGCGTGCCGTCTTCCGGGCGACCGAAGTAGACGTTGTCGTGCGCACCGTAA
+ACGCCCAGATCTGTACCGTCAGCGTAATCTTTGTAGTAACGCACACAGCGGTAGCAGGCG
+ATGCAGCGGTTCATTTCGTGAGAGATGAATGGCCCCAAATCCTGATTACGGTGGGTACGT
+TTGGTGAAACGGTAGCGACGGAAGCTGTGTCCGGTCATCACAGTCATATCCTGAAGATGG
+CAGTTACCGCCCTCTTCACATACCGGACAGTCGTGCGGGTGGTTGGTCATCAACCACTCG
+ACCACGCTTTCACGGAACTGTTTCGCTTCTTCGTCGTCAATGGAAATAAAGGTGCCATCG
+GAAGCCGGTGTCATACAGGACATCACCAGGCGACCACGCGTGTCTTCCGCGTTTTGGTAT
+TGCTTCACCGCACACTGGCGGCAAGCACCGACACTTCCCAGCGCCGGATGCCAGCAAAAG
+TAAGGAATATCAAGGCCCAGAGACAGACAAGCTTCCAGCAGGTTGTCCGCTCCGTTGACC
+TCGTATTCTTTGCCGTCTACATGAATTGTAGCCATTAGCATGCTTCCAGTTTTCTCAGTC
+AGAGACTGAGCGTTAATCGAAATTCGGTTACCAGCGCTCTTTCAGCAGGTTCGGCTGAAT
+CCCATTAATCAAATGGGTATTGCTGAACGGCTGTTTGATTCCCGCCTCAAATTCTTCGCG
+GAAATATTTGATGGCGCTCTGTAACGGCTCCACTGCACCAGGTGCGTGGGCACAGAAAGT
+TTTACCCGGGCCTAAGAATCGACACAGTTGCTCAAGTGTTTCGATATCGCCCGGCTGACC
+TTCACCACGCTCCAGCGCACGCAGAATTTTCACGCTCCACGGCAGACCGTCGCGGCACGG
+CGTACACCAGCCGCAGGACTCACGGGCGAAAAACTCTTCCAGGTTACGCACCAGCGACAC
+CATGTTGATCTCATGGTCAACCGCCATCGCCAGCGCCGTACCCAGACGGCTGCCCGCTTT
+ACCGATACTTTCGAATTCCATCGGCAGATCAAGGTGCGCTTCGGTCAGGAAGTCAGTCCC
+CGCGCCGCCTGGCTGCCAGGCTTTAAATTTCAGACCATCACGCATACCACCGGCGTAATC
+TTCGAGGATCTCGCGTGCGGTGGTGCCGAACGGCAGTTCCCACAGTCCCGGATTTTTCAC
+CCGACCGGAGAAGCCCATCAGCTTGGTGCCAGCATCTTTACTTTTCGAGATGTTCTGATA
+CCACTCCACGCCGTTAGCGAGGATCGCCGGAACGTTACACAGGGTTTCGACGTTGTTGAC
+ACAGGTCGGTTTACCCCATGCGCCGGAGGTTGCCGGGAAGGGTGGCTTCGAGCGTGGGTT
+AGCACGACGTCCTTCCAGGGAGTTGATTAACGCTGTTTCTTCCCCGCAGATGTAGCGCCC
+TGCCCCGGTATGGACGAACAGTTCGAAATCGAAACCTGTTCCCATAATGTTTTTGCCAAG
+CAGACCCGCTTCGGTGGCTTCGGCAATGGCACGGCGCAGATTAACTGCCGCTTCGATATA
+TTCGCCACGCAGGAAGATGTAGCCACGGTAAGCTTTCAGCGCAAACGCGGAGATGAGCAT
+ACCTTCCACCAGCAGGTGCGGCAGTTGCTCCATCAACAGGCGGTCTTTATAGGTGCCCGG
+CTCCATTTCATCGGCATTACACAGCAGGTAACGGATGTTCATGGATTCGTCTTTCGGCAT
+CAGGCTCCATTTCAGGCCAGTCGAGAAGCCCGCGCCGCCGCGCCCTTTCAGACCAGCGTC
+TTTTACCTGATTAACGATTTCGTCCGGAGACAGCCCGGTCAGCGCCTTACGCGCGCCTTC
+GTAACCGTTTTTGCTGCGGTATTCGTCCAGCCACACTGGCTGTTTGTCATCGCGCAGACG
+CCAGGTCAGCGGATGCGTTTCGGGAGTACGGATAATGTTTTTCATTTATACCGCTCCAGC
+AGTTCAGGGATCGCTTCCGGGGTCAGATGCGCGTGAGTGTCCTCATCGATCATCATGTTT
+GGCCCTTTATCACAGTTCCCCAGGCAGCAAGTTGGCAGCAGCGTAAAGCGGCCATCAAAT
+GTCGTTTGCCCTGGTTTGATGTTCAGCTTTTTCTCGAGCGCCGCCTGAATACCCTGATAA
+CCGTTGATATGACAGACCACGCTGTCACAATAACGGATCACATGGCGACCAACCGGCTGG
+CGGAAGATCTGACTGTAGAACGTTGCCACACCTTCGACGTCGCTTGCCGGAATACCCAGC
+ACATCGGCGATCGCGTGGATCGCACCATCCGGCACCCAGCCACGCTGCTTCTGAACGATT
+TTCAGCGCTTCAATGGACGCCGCACGCGGGTCTTCGTAGTGGTGCATCTCGTGCTCGATC
+GCTTCACGCTCTGCCGCACTCAGCTCAAAAGCCTCGGTTTGTGGTTGTTGATTCTCGTGC
+ATAATTAGCGGTCCACATCTGACATAACAAAATCGATACTGCCCAGATAAACAATCAGGT
+CAGACACCAGGCTGCCGCGGATCGCCGCCGGAATTTGCTGCAAATGCGCAAAGCTCGGGG
+TACGAACACGGGTGCGGTAACTCATGGTGCTGCCGTCGCTGGTCAGGTAGTAACTGTTGA
+TCCCTTTGGTCGCCTCAATCATCTGGAAAGATTCATTGGCAGGCATCACCGGACCCCACG
+ACACTTGCAGGAAGTGGGTGATCAGGGTTTCGATATGTTGCAGCGTGCGCTCTTTCGGCG
+GCGGCGTGGTCAGCGGGTGATCCGCTTTGAACGGGCCTTCCGGCATGTTGTTGAGGCACT
+GCTCAAGAATGCGCAGACTCTGGCGCAGCTCTTCCACTTTAAGCATTACGCGGGTGTAGC
+AGTCAGAAACGCCACCACCCACCGGGATTTCAAAGTCGAAGTTTTCATAGCCAGAATAAG
+GACGCGCCTTACGCACGTCGAAGTCGATCCCGGTAGCACGCAGGCCCGCGCCAGTGGTGC
+CCCACTCCAGCGCCTCTTTCGCGCCATAGGCGGCAACGCCCTGGGAACGACCTTTCAGAA
+TGGTGTTTTGCAGCGCCGCTTTCTCGTAAGACGCCAGACGTTTCGGCATCCAGTCGAGGA
+ACTCACGCAGCAGGCGATCCCAGCCGCGCGGCAGGTCGTGCGCTACGCCGCCAATACGGA
+ACCACGCCGGGTGCATACGGAAACCAGTGATTGCTTCCACCAGATCGTAAATTTTCTGAC
+GATCGGTAAAGGCGAAGAACACTGGCGTCATTGCGCCGACGTCCTGAATAAAGGTCGAGA
+TATACAGCAGGTGACTGTTGATGCGGAACAGTTCGGAGAGCATAACGCGAATGACGTTAA
+CGCGATCCGGCACGGTGATCCCGGCCAGTTTCTCTACCGCCAGCACGTAAGGCATTTCGT
+TAACGCAGCCGCCGAGGTATTCGATACGGTCAGTATACGGAATGTAGCTGTGCCAGGACT
+GGCGTTCGCCCATTTTCTCCGCACCACGGTGGTGGTAACCGATGTCTGGTACGCAGTCGA
+CAATCTCTTCGCCATCGAGTTGCAAAACGATACGGAAAGCCCCGTGCGCCGACGGGTGGT
+TCGGACCGAGGTTGAGGAACATGAAGTCCTCGTTTTCGGTGCCGCGCTTCATCCCCCACT
+CTTCCGGTTTGAAGGTCAGGGCTTCCATCTCCAGATCCTGTTTGGCTTTGGTCAGCTCAA
+ACGGCGAGAATTCGGTAGCGCGCGCCGGATAATCTTTACGCAGCGGGTGACCTTTCCAGG
+TTTGCGGCATCATGATGCGTCGCAGGTTCGGGTGACCGTCGAAAGTAATGCCAAACAGAT
+CCCAGGTTTCACGCTCATACCAGTTAGCGTTCGGGAACAGTTTGGTGAAGGTCGGTACGT
+GCAGGTCGTTTTCTGCCAGCGCCACCTTCAGCATGATGTCGCGGTTACGATCGATAGAAA
+TCAGATGGTAGAAAACGGAAAAATCCGCGGCAGGTAACCCTTCGCGGTGTGTGCGCAGAC
+GTTCGTCCATGCCGTGTAAGTCAAACAGCATGACGTAAGGTTTCGGCAGTTTCTTTAAGA
+AATCGCCAACTTCCAGTAATTGTTCACGCTTGATCCACACAACGGGAACCCCGGTGCGAG
+TCGCCTGAACAGTAAAGGCATCCGGCCCAAAACGGTTGCGCAGTTCGCCAATCACCGGAT
+CATCAAGATGATCGCGGGTCTGCCAGGCGGGTTCTTGCGCGGTTAAGTCGGTCATATTGT
+TCACCATTGCAAATGGTCCGTGGTGACTGTCGGCGCAGTAAGCTTCGCGAAATAGATTTA
+GGAATAAGCGAAGAAAAATCCCTTTGCCGACAGGCGCAAATTAAATCTCGTCAGGTGTAC
+GCAGGTTAGTTACGGCAATGCGTTCACCGCGCTTGCGTTCGCGCTCTGATTGCATATTGG
+CGCGATAAACGCCCTGATCGCCAACCACCCAGGAGAGCGGACGACGTTCTTTGCCGATAG
+ATTCCTGCAACAGCATCAGTGCCTGCATGTACGCTTCAGGACGCGGCGGGCAGCCCGGGA
+TATACACATCAACCGGGATGAATTTATCGACGCCCTGCACAACGGAATAAATATCGTACA
+TACCACCAGAGTTGGCACAGGCACCCATTGAGATAACCCATTTTGGTTCCAGCATCTGGT
+CATACAGACGCTGAATAACCGGTGCCATTTTGGTAAAGCAGGTTCCTGCAACCACCATCA
+GGTCAGCCTGACGCGGCGAAGCACGCAATACTTCTGCGCCAAAACGCGCCACGTCATGCA
+CCGCGGTAAACGAAGTCACCATCTCAACGTAACAGCAGGAAAGACCGAAGTTATACGGCC
+AAATTGAGTTTTTACGACCCCAGTTAACCATGTCATTGAGCTTGCCCATAAACACGTTTT
+TGTTAACTTCTTGCTCCAGAGGGTCGGTTACGATCTCCTGCTTTTGCAGGGGGTAACGGT
+CGTTCTCACCGTTGGGATCTATGCGGGTGAGCGTATAATCCATCTTAATGCCTCGCGGTT
+AGCGTTGACGATTAGCGATACTGTTCGTTTCCGGGTTCATACGCTCGCGGCGTGAACGCG
+CGGGCGTCCAGTCCAGCGCGCCAATACGCACCAGATAAACCAGACCTGCCAGTAACACAA
+AAATAAAAATTGCAGCTTCCACAAAGCCTACCCAGCCGCTTTCGCGGATAGAGGTTGACC
+ATGCGAACAGATACAGCGCTTCAACGTCGAAGATAACGAAGAACATGGCCACCAGATAAA
+ACTTGGCGGACAGGCGTAAGCGGGCGGAGCCGACCGAGTCGATACCGGATTCAAACGGCA
+CGTTTTTCGACCTCGCGCGTGCGCGACCGCCTAAAAACCAACCGCCTACCAGCATCAGGC
+AACACAGGCCAATGGCAACGATAAGAAAGATAGCGAATGCCCAGTGATGAGCGATGACTT
+CAGTGGATGTTGACATACTCATTGCTTACTCATCAAAAGTAGCGCCAGATTCACTGCTCT
+TCACGGCAGATGGACGCCACATCGATTCATGGGGAGGAATAAAAAAAACCTTACAATCAC
+TGTAGAAATTCTTTTATACAGCTAATTGATGTGGTTTTTTACTCCTTTCTATAACCTTTT
+GTCAACTTTAACAAAAGTTTCTTCACATTAGTTTACATAATATCAACACCATTAGCATTT
+AATGCCCTTTCACCCCAGATCCTTGACGACTCCAGGATAATTAGATGTTGTTGAATCGTG
+TCCGTTGTGAAGCAATGGAAAAAATACGGGTCTATTTTGACAGGAATTTGTGTCGATTCC
+TCCCCCCAAAAGAGAGTATTTTCTTGATCTGTGACACGCTTTTGTCATTCCATAACAAAA
+ACGCAGCAACAAATTTACGTATTTTTTAACATCATTGTAGCAGGTGATTTTTTTCAGGCG
+ATTATTTGTGCGTTCGGGACGTGAATCTCTGGTGGTTGAAAAATGAACAGTTTTGTACGT
+TCTGCACTATGCGATGAAGGATTTTTACTAAAAAAAAGCCGCTGGGGTTTAAAACACCCC
+CAGCGGCTCGTTTTTTACACTATTGTCTCAGGAATTATCTATCGTCCGTCGATTACTCGA
+TATCCCTTTCAATCAACAATGAATCATCCCCTTCCGGAGCAGACATTGGGCTGTATTGCC
+ACGGATTATGGTAGCTCTCCATCGCCTGATAGATCACCTGGGCCAGCTCATTATTACTGG
+ACGGATCATAGCACAGCAAATATTCGGTATCAGGTAGCGGCGGTAAGCCATCTACTCCAC
+TCAGCACACGCAGGTCCGGGCTCATCATCTCAACCGGCCTTGCCGTCACGCCAAGACCGG
+CTTTCACTGCCGCACGAACGGCCGGAAGCGTCGAGGCGACATAAGCCAGTCGCCATGGAA
+TATCTGCTTTATTAAGCGTCGCCAGCACCATATCGCGAAACGGGCTAGGATCATCCAGCA
+ATACAAGAGGGATCGGCTCGCCTTTTTGCAATATGTATTCCGCTGCGCAGTACCAGTGTG
+TTGGCGAGGTACGCAGGTTCAATGCCTTAAACGCTGAAGGACGATGGGTGGTTACCATCA
+AATCCACTTCCTGGGATTCCAGCATTTCTGCCATATAGGCATTACGTTTAACGCGGACAT
+CCAGCGCTAATTTCGGATAAACCGAACTCACGCGATTTAACAGGAAAGGTAAGATCGTAT
+CGGCAGATTCATCTGAAGCACCGATAGTTAATACGCCCTGAAGATTACTGAACATTAATG
+ATGAGCAGGCCTCATCATTAAAACGCAGGATTTTCCTGGCGTAACCAAGAAGTTGAATGC
+CATGTTCAGTTAACAGTTTGTTGCGACCGTGACGAGCGAACAGTTCTTTCCCAACGAGTT
+GTTCCAGACGCTGCATTTGCTGACTTACGGCGGACTGAGTACGACACACAGCGGCAGCTG
+CGGCAGCAAAAGTGTTCAGATCGGCAACAGCAACAAATGTTCTCAGCAGATCGAGGTCGA
+GGTTAATTATCGGACGATTTGCACTTATCATATATTATCACTTACTGGCGGCTCATACTG
+AGCTGGTTAATGCTGTGCACACACAAACAAGCAATTCCATTTGTAATGTGCCTCCCTGGC
+AGTTTCATCCGGAACCCGGACGAAAGTAAAAATGCATATGAGTTGCACTAAAAAAGCGAC
+TCACATTGTTCCGTTATAATGCCTGAAGTAGATCACAGAATATATCTTCAGGGATCGCAT
+ATCTATTAAGTTACTCACTCTTTTCTATTTATGACATGCGCGTGTTTGTATAAATGTAAA
+TGTGAGTCCTTGTTCCACTCTCGTGCAGCATCGCTGGTCATACGCGAACACGTACCAACA
+GCAATGGTGAGGCGGCATCAAGAGCAGGGATCCGTCATTTATCCGAGCATTTTACCCCAA
+AAACCTTTTATTTATAAGGGTCATTGCGAATTATCTGATGCAAAGTTATGTTATGTTAGG
+CAAAGTAATCTTCTATTATTAATAAGCACATCAAAACCTTTTTGAATATTAAATAATAAT
+TAATTAGCATCATCCTCATTCATTAATTCCGCTTAACAATAGTTTCACACCTTGCCCCCA
+TTGCGACACCTCGGAAATCATCACGCAGTTAAACTCTCCGTAATGAGGAAATATCATCAT
+CGCGTTTCATTAGTGAATTCTTAAATGAGGCATTTTCACACAATTATCTTACAGATAAAA
+AAACCAGACTTACAATTAAGAATCAGAACAATTCACTATATAACATTGCATGTAAAGCAT
+ATACACCTCATTATTTTGTCATTATTAAGTTATTAACAGCACAATCGAGCCTTCCCCTCT
+GGCAAAATCTTATTCTGCAGACCTTCAAAACACCGTCCTGGGGGAGTACATTGTTCTAAG
+CTGACTTCCACGGCAGGGAGTGGCGATAACAGCAAAAAAGGTCAAGATTCATGTCCCCCA
+TTGAAAAATCCAGCAAATTAGAGAATGTCTGTTATGACATCCGTGGTCCGGTGCTGAAAG
+AAGCAAAACGCCTGGAAGAAGAAGGTAACAAGGTACTGAAACTGAACATCGGCAACCCAG
+CCCCGTTCGGTTTTGACGCGCCAGATGAAATCCTCGTTGACGTGATACGCAACCTGCCTA
+CCGCTCAAGGGTATTGCGATTCCAAAGGTCTTTACTCCGCGCGTAAAGCCATCATGCAGC
+ACTACCAGGCTCGTGGCATGCGTGATGTTACCGTGGAAGATATTTACATCGGCAATGGTG
+TATCGGAGCTTATCGTTCAGGCAATGCAGGCATTGCTGAACAGCGGGGACGAAATGTTGG
+TTCCTGCACCAGATTACCCACTCTGGACCGCGGCGGTTTCGCTTTCCAGCGGTAAAGCGG
+TGCATTATCTTTGCGATGAATCCTCTGACTGGTTCCCGGACCTCGATGATATTCGCGCTA
+AAATTACGCCTCGTACGCGTGGGATCGTTATTATCAACCCAAATAACCCAACCGGCGCGG
+TATATTCCAAAGAGCTTTTAATGGAGATTGTGGAGATTGCACGTCAGCATAATCTCATTA
+TCTTCGCCGATGAAATTTATGACAAAATTCTCTACGACGACGCTGAGCATCACTCAATTG
+CGCCGCTGGCACCTGACCTGCTGACCATTACCTTTAACGGACTGTCGAAAACGTACCGCG
+TTGCAGGCTTCCGTCAGGGGTGGATGGTGTTGAACGGGCCGAAAAAACACGCCAAAGGCT
+ACATCGAAGGTCTGGAAATGCTGGCTTCAATGCGCCTGTGTGCTAACGTTCCTGCGCAAC
+ACGCCATTCAGACCGCGCTAGGTGGTTATCAGAGCATCAGTGAATTTATTACCCCTGGCG
+GTCGTCTTTATGAGCAGCGTAACCGCGCGTGGGAACTGATCAACGATATTCCGGGCGTTT
+CCTGCGTGAAACCTCGTGGTGCGCTGTATATGTTCCCGAAAATCGACGCCAAACGCTTTA
+ACATTCACGACGATCAGAAAATGGTGTTGGATTTCCTGTTGCAGGAAAAAGTTCTGTTGG
+TGCAAGGGACGGCATTCAACTGGCCGTGGCCGGATCACTTCCGCATTGTCACGCTACCGC
+GTGTCGATGATATCGAGCTGTCTTTGAGCAAGTTCGCGCGTTTCCTTTCTGGTTATCATC
+AGCTGTAATCTTAATTTCACTGCCGGAGATTGCATCCGGCAGCGTTATCCCGCCACAATG
+ACCTGATGATGTCATCATACGTAAGGTCACTATGAAACAGAGCCATTTTTTTGCCCATCT
+CTCCCGCCTGAAACTCATTAACCGCTGGCCGCTCATGCGCAACGTGCGGACGGAAAATGT
+GTCCGAACACAGTTTGCAGGTAGCGATGGTCGCCCATGCGCTGGCAGCTATCAAAAATCG
+AAAATTTGGCGGTAATGTCAACGCCGAACGTATCGCTTTACTGGCGATGTACCACGATGC
+CTCAGAAGTGCTCACCGGCGATCTCCCTACTCCGGTGAAATACTTCAATTCGCAAATCGC
+TCAGGAGTACAAGGCTATTGAAAAAATCGCTCAGCAAAAACTGGTCGATATGGTTCCGGA
+AGAGCTGCGGGATATCTTTGCGCCGTTAATTGACGAGCATGCATATAGCGATGAAGAAAA
+ATCGCTGGTGAAACAGGCAGATGCACTGTGTGCATATCTGAAATGTCTGGAAGAACTCGC
+GGCCGGAAATAATGAATTCTTGCTGGCAAAAACGCGACTGGAAGCGACGCTTGAAGCGCG
+TCGCAGCCAGGAGATGGACTACTTCATGGAAATATTTGTTCCCAGCTTCCATCTTTCGCT
+CGATGAGATTAGCCAGGATTCACCGCTGTAAGCAGCCGGAGTCTGCGTCGCATCAGGCAA
+TAAGCGCCGGATGCGACATCAGGCTCTTGTCAAAACGGAAACAGCATCGGGATCATCACC
+ACACAAACCGCCATCACGATAATGGTGAACGGTACCCCCAACTTCACAAAGTCACTGAAG
+CTGTAATTTCCCGGACCTAAAACCAGTGTGTTAACAGGTGAAGAAACCGGTGTCATAAAG
+GCGGCGGATGCTGCCATCGCCACGACCATCGCGAATGGATAAGGCGACACCCCCATCGTT
+TTGGCAGCAGCCAGCGCAATCGGAGCCATCAACACCGCCGTCGCGGTATTAGAGATAAAT
+AGCCCAATAACCGCCGACAAGACAAACAAACACCCCAGCATCATATGTGGCCCGTAACCA
+CCGCCAATGTCCATCAGCCCTTTCACCGCCAGCGCGACACCTCCCGTTTTCTGTAATGCC
+ACAGCAAACGGCATCATCCCAACGATCAAAATAATGCTCGGCCAGTGAATGGATTTATAG
+GCGCTTTCAGCATCTATACAGCGGAATTTCCCCATCAGCAGGCAGGCGATGATAGCGGCA
+ACAGGATTAGGAATTTCATCTGTCAGCATTAACGCCACCATTAGCACCAGACAGAAAATG
+GCATGGGGTGCCTGGCTGTGCGCGGGTGATGCTTCACTCACCTCTTCCGGTAAGTTCAGC
+GCTACGAAGTCGCGGCCCTGTTTGGCCAGCATACCGATCAGTTTCCAGTTACCCACAACC
+AGGATGATATCGCCCAGCAGCAGAGGCTCATCCGCCAGCGAACCTTCCAGCGCCACGCCA
+TTGCGCTTTAGCCCCACCACATTCAGTCCGTAGCGGGTACGAAAACCAATTTCGCGCACC
+GATTTACCAATCAGTTCTGACTCAGGAATTAATGAAATCTCTGCCATGCCCACATCAAGG
+GCCTGGTCAGAAAAATACTCGCCGCGCAATACCATCGGCTCCAGCAATTGCTCACTACAA
+AATTGCCGGAGATCGACATCAGCCGCAGACATATCAATAAGCAAAACGTCACGCGCGCGA
+AATTCAGAAACCCCATTAACGTTCACGATAACGCGACGAAAACGCCGCCAGCGTTCAACA
+CCGATGACGTTAGCGCCATAACGCTCACGTAATTTGAGATCATCCAGCCGTTGACCAATC
+ATTGGCGATCCGGGGCGAATAGCCAGACGTCGCGCACGCCCGGTCAGTCGATATTCACGG
+ATAAGATCGCGAAAGGTTCGACGCGTCCAGCCTTCGCGCTGCGGGGTCTGGGTATCCCCT
+TTCAGCATGAAACGCATCACTAACATATACAAAATACCCAGCACCAGCACGACCAGGCCA
+ATAGGTGTTACGCTAAAGAAACTGAAGCCGTGATAGCCTTCACGCAGCAATTCACTGTTG
+ACTACCAGGTTCGGCGGCGTCGCCACCAGCGTCATCATGCCGCTAATCAGCCCGGCAAAA
+CTTAACGGCATCATCAGACGTGACGGCGACGTTTGCATACGCATGGCAACGCTTAACACC
+ACGGGAATAAAGATAGCGACAACGCCGGTTGAACTCATAAACGCGCCAAGCCCCGCGACG
+GTCAGCATCAACAAAACCAACATTTTGATTTCACTATTGCCCGCAACTTTGACCAGCCAT
+GTTCCCATTACGGTGGCAACACCGGTACGGACCAAACCATCGCCAATAATAAACAAGGCG
+GCAATCAGGACAACGTTAGGATCAGAAAAGCCGGAAAATACTTCTGGGACTGTCAGCGTT
+CCGCTTAATGCAAACGCGACAATAACAAACAAAGCGACCGCATCCATACGCACTCTGCCC
+GTCGCAAACAAGACGATGGCAACGGCCAGTAATGAAAGAACCCAAATCAATTCACCGTTC
+ACAACTTATCCTTGTTAATTGAGGGGGATGACTTGATTCTGCCATAAAAAAGCCCCGACG
+AGACGGGGCTAAATCATGATCAGGTGTTTCACTGAATAATAACATCGCCATTTGGCTGTT
+TGGTCACAGTAATTTGCTCCAGACTGTGGAGGACCAAATCGACCTCATTCAGGCGCGGGG
+TATCTGCCGGAGCGTTAACCGCAATGACATGACAACCCGCCGCCAGGCCAGAAAGCACGC
+CAGCGGGAGCATCTTCCACCACCACACACTCCTGCGGCGCAAGCCCCAGCAGCTGCGCGC
+CTAACAGATACGCATCAGGTTCTGGTTTTCCGCGCTTCACTCGCTCAGCGGTTACAAACA
+CCTCTGGTGCGGGAAGCCCAGCTATTTTATGGCGCGCTCGCGCTACCGGCATGGAGCCAG
+AAGTCACAATGGCCCACGGAATACCTGCTTTATTCAAATGACTGAGTAAGGCGATTGCCC
+CCGGAAGCGCGGTAATACCTTCGGTTTCCGTGGCCTCGATGTGCTCCAGACGCGTAAACT
+CGGCGGCAATATCAGCCTCGGATTTGCCCGCCATAAAATGGCGCAGAGAGGTGATCGCCT
+GTTTACCGTGAATGAAAGCCAGCACCTCTTCCGGCGCTAACCCATGACGTCTGGCCCAGT
+TGCTCCACGCCCGTTCTACCGCAGGCAGGGAATCCACCAGCGTTCCATCAAGATCAAACA
+GAAAACCTTTGCACCGCACGCGGGCCTCCTCAGGCATTGATAATTTGATTAATTTCGTTG
+GCGCTCAAATGGTACTGACGCGGGCAGGCATGCCACACATTAAGCATGCGCTGATATTTT
+TCCCACATTGGCGTCTGGGCGTTAAAACCGTGAGTTCCGGCGTCAAAATGGGTATAGCGC
+CCTTCCACATTAACCATAAAGCGGACATAACCGAGGTAACGTGCTTCAGTGGCGGCGTCA
+AAGCCGAGGAAGGTGACACGACGTTCATCGATGGATTGCTGGTCCTGCAAATTAGACCAG
+GAAACATGCAACGCATGATACATCTCCATAATGTCGATGATAGTGCGGCAGGTTTCTTCT
+TTCAGCTCGCCAAACTCGCGATCCAATTCACGCATCTGTAATCCGTAACCACGCTCAATA
+ATTGTTTGCAGGCGACGGTAACGTTCAGCATTTGCCGGATCGAGCATAGTCATCATCTTG
+TACTGATTAGACAAAATAAGACGTTGCGCGTTGGTCATTTCCATTGTTGACTCCTGTATC
+ACTCTACTACGGTGAAAAAAAAGAAGGCTGAGTATGCCTTCTTTTATATGCGTAATCAGG
+GGTCAATTACAAATCATCAAGGAAAGTTTTATCCAGTTGTTTGAAGGCGCGCTTAAGCGT
+GTCAGCTAATGCCTGGTAATCAGGCTTGCCTTCAACGGGTGCCAACACCTGTCCAGACTC
+CTGCAATTTACCGCGAACTTCATAAAACCAGTTAAGGATTGCAGGGGGTAATGGCGTGAC
+AGAACGCTTGCCCAGCCACCACAATCCCTGCATGGGTAAACTTAAGGCGAACAGGGCAGT
+GGCAACTGCCGGCCCAAGCTGACCGCCCAGGGCAATCTGCCAGCAGAGAGTAAATACGGC
+GATCGGCGGCATAAAACGGATCGCATAACGCGTCATCTTGATAACGCGATTTTCGACAAA
+GACCGGGGCAAGGCGTTTTTCCAGCGGCCACGTCTTTGAGTAATGCTGTCCCCGGCGAAA
+CAAGCTAAAAAAATTAACAGAACGATTATCCGGCGTTGACATGCTTCACCTCAACTTCAC
+ATATAAAGATTCAAAAATTTGTGCAAATTCACAACTCAGCGGGACAACGTTCAAAACATT
+TTGTCTTCCATACCCACTATCAGGTATCCTTTAGCAGCCTGAAGGCCTAAGTAGTACATA
+TTCATTGAGTCGTCAAATTCATATACATTATGCCATTGGCTGAAAATTACGCAAAATGGC
+ATAGACTCAAGATATTTCTTCCATCATGCAAAAAAAATTTGCAGTGCATGATGTTAATCA
+TAAATGTCGGTGTCATCATGCGCTACGCTCTATGGCTCCCTGACGTTTTTTTAGCCACGT
+ATCAATTATAGGTACTTCCATGTCGAGTAAGTTAGTACTGGTTCTGAACTGCGGTAGTTC
+TTCACTGAAATTTGCCATCATCGATGCAGTAAATGGTGAAGAGTACCTTTCTGGTTTAGC
+CGAATGTTTCCACCTGCCCGAAGCACGTATCAAATGGAAAATGGACGGCAATAAACAGGA
+AGCGGCTTTAGGTGCAGGCGCCGCTCACAGCGAAGCGCTCAACTTTATCGTTAATACTAT
+TCTGGCACAAAAACCAGAACTGTCTGCGCAGCTGACTGCTATCGGTCACCGTATCGTACA
+CGGCGGCGAAAAGTATACCAGCTCCGTAGTGATCGATGAGTCTGTTATTCAGGGTATCAA
+AGATGCAGCTTCTTTTGCACCGCTGCACAACCCGGCTCACCTGATCGGTATCGAAGAAGC
+TCTGAAATCTTTCCCACAGCTGAAAGACAAAAACGTTGCTGTATTTGACACCGCGTTCCA
+CCAGACTATGCCGGAAGAGTCTTACCTCTACGCCCTGCCTTACAACCTGTACAAAGAGCA
+CGGCATCCGTCGTTACGGCGCGCACGGCACCAGCCACTTCTATGTAACCCAGGAAGCGGC
+AAAAATGCTGAACAAACCGGTAGAAGAACTGAACATCATCACCTGCCACCTGGGCAACGG
+TGGTTCCGTTTCTGCTATCCGCAACGGTAAATGCGTTGACACCTCTATGGGCCTGACCCC
+GCTGGAAGGTCTGGTCATGGGTACCCGTTCTGGTGATATCGATCCGGCGATCATCTTCCA
+CCTGCACGACACCCTGGGCATGAGCGTTGACGCAATCAACAAACTGCTGACCAAAGAGTC
+TGGCCTGCTGGGTCTGACCGAAGTGACCAGCGACTGCCGCTATGTTGAAGACAACTACGC
+GACGAAAGAAGACGCGAAGCGCGCAATGGACGTTTACTGCCACCGCCTGGCGAAATACAT
+CGGTGCCTACACTGCGCTGATGGATGGTCGTCTGGACGCTGTTGTATTCACTGGTGGTAT
+CGGTGAAAATGCCGCAATGGTTCGTGAACTGTCTCTGGGCAAACTGGGCGTGCTGGGCTT
+TGAAGTTGATCATGAACGCAACCTGGCTGCACGTTTCGGCAAATCTGGTTTCATCAACAA
+AGAAGGTACCCGTCCTGCGGTGGTTATCCCAACCAACGAAGAACTGGTTATCGCGCAAGA
+CGCGAGCCGCCTGACTGCCTGATTTCACACCGCCAGCTCAGCTGGCGGTGCTGTTTTGTA
+ACCCGCCAAATCGGCGGTAACGAAAGAGGATAAACCGTGTCCCGTATTATTATGCTGATC
+CCTACCGGAACCAGCGTCGGTCTGACCAGCGTCAGCCTTGGCGTGATCCGTGCAATGGAA
+CGCAAAGGCGTTCGTCTGAGCGTTTTCAAACCTATCGCTCAGCCGCGTACCGGTGGCGAT
+GCGCCCGATCAGACTACGACTATCGTGCGTGCGAACTCTTCCACCACGACGGCCGCTGAA
+CCGCTGAAAATGAGCTACGTTGAAGGTCTGCTTTCCAGCAATCAGAAAGATGTGCTGATG
+GAAGAGATCGTCGCAAACTACCACGCTAACACCAAAGACGCTGAAGTCGTTCTGGTTGAA
+GGTCTGGTCCCGACACGTAAGCACCAGTTTGCCCAGTCTCTGAACTACGAAATCGCTAAA
+ACGCTGAATGCGGAAATCGTCTTCGTTATGTCTCAGGGCACTGACACCCCGGAACAGCTG
+AAAGAGCGTATCGAACTGACCCGCAACAGCTTCGGCGGTGCCAAAAACACCAACATCACC
+GGCGTTATCGTTAACAAACTGAACGCACCGGTTGATGAACAGGGTCGTACTCGCCCGGAT
+CTGTCCGAGATTTTCGACGACTCTTCCAAAGCTAAAGTAAACAATGTTGATCCGGCGAAG
+CTGCAAGAATCCAGCCCGCTGCCGGTTCTCGGCGCTGTGCCGTGGAGCTTTGACCTGATC
+GCGACTCGTGCGATCGATATGGCTCGCCACCTGAATGCGACCATCATCAACGAAGGCGAC
+ATCAATACTCGCCGCGTTAAATCCGTCACTTTCTGCGCACGCAGCATTCCGCACATGCTG
+GAGCACTTCCGTGCCGGTTCTCTGCTGGTGACTTCCGCAGACCGTCCTGACGTGCTGGTG
+GCCGCTTGCCTGGCAGCCATGAACGGCGTAGAAATCGGTGCCCTGCTGCTGACTGGCGGT
+TACGAAATGGACGCGCGCATTTCTAAACTGTGCGAACGTGCTTTCGCTACCGGCCTGCCG
+GTATTTATGGTGAACACCAACACCTGGCAGACCTCTCTGAGCCTGCAGAGCTTCAACCTG
+GAAGTTCCGGTTGACGATCACGAACGTATCGAGAAAGTTCAGGAATACGTTGCTAACTAC
+ATCAACGCTGACTGGATCGAATCTCTGACTGCCACTTCTGAGCGCAGCCGTCGTCTGTCT
+CCGCCTGCGTTCCGTTATCAGCTGACTGAACTTGCGCGCAAAGCGGGCAAACGTATCGTA
+CTGCCGGAAGGTGACGAACCGCGTACCGTTAAAGCAGCCGCTATCTGTGCTGAACGTGGT
+ATCGCAACTTGCGTACTGCTGGGTAATCCGGCAGAGATCAACCGTGTTGCAGCGTCTCAG
+GGTGTAGAACTGGGTGCAGGGATTGAAATCGTTGATCCAGAAGTGGTTCGCGAAAGCTAT
+GTTGGTCGTCTGGTCGAACTGCGTAAGAACAAAGGCATGACCGAAACCGTTGCCCGCGAA
+CAGCTGGAAGACAACGTGGTGCTCGGTACGCTGATGCTGGAACAGGATGAAGTTGATGGT
+CTGGTTTCCGGTGCTGTTCACACTACCGCAAACACCATCCGTCCGCCGCTGCAGCTGATC
+AAAACTGCACCGGGCAGCTCCCTGGTATCTTCCGTGTTCTTCATGCTGCTGCCGGAACAG
+GTTTACGTTTACGGTGACTGTGCGATCAACCCGGATCCGACCGCTGAACAGCTGGCAGAA
+ATCGCGATTCAGTCCGCTGATTCCGCTGCGGCCTTCGGTATCGAACCGCGCGTTGCTATG
+CTCTCCTACTCCACCGGTACTTCTGGTGCAGGTAGCGACGTAGAAAAAGTTCGCGAAGCA
+ACTCGTCTGGCGCAGGAAAAACGTCCTGACCTGATGATCGACGGTCCGCTGCAGTACGAC
+GCTGCGGTAATGGCTGACGTTGCGAAATCCAAAGCGCCGAACTCTCCGGTTGCAGGTCGC
+GCTACCGTGTTCATCTTCCCGGATCTGAACACCGGTAACACCACCTACAAAGCGGTACAG
+CGTTCTGCCGACCTGATCTCCATCGGGCCGATGCTGCAGGGTATGCGCAAGCCGGTTAAC
+GACCTGTCCCGTGGCGCACTGGTTGACGATATCGTCTACACCATCGCGCTGACTGCGATT
+CAGTCTGCACAGCAGCAGTAATCTCGTCATCATCCGCAGCTTTGCGCTGCGGATATCTGA
+ACCGGAAATAATCACTATTTCCGGTTTTTTATTCTCTTAATTTGCATTAATCCTTTCTGA
+TTATCTTGCTTAACTGCGCTGCATCAATGAATTGCGCCATCCCACTTTGCATACTTACCA
+CTTTGTTTTGTGCAAGGGAATATTTGCGCTATGTCCGCAATCACTGAATCCAAACCAACA
+AGAAGATGGGCAATGCCCGATACGTTGGTGATTATCTTTTTTGTTGCTATTTTAACCAGC
+CTTGCCACCTGGGTAGTTCCGGTGGGGATGTTTGACAGTCAGGAAGTGCAGTATCAGGTT
+GATGGTCAAACAAAAACACGCAAAGTCGTAGATCCACACTCATTTCGCATTCTGACTAAC
+GAAGCAGGCGAACCTGAGTATCACCGCGTACAGCTGTTCACGACGGGCGATGAACGCCCG
+GGCCTGATGAACTTCCCGTTTGAAGGATTAACCTCAGGATCGAAATACGGGACAGCCGTT
+GGCATCATCATGTTTATGCTGGTGATTGGCGGCGCGTTTGGCATTGTGATGCGTACAGGA
+ACCATTGATAACGGTATCCTGGCGCTTATTCGCCATACCCGCGGGAATGAAATTCTCTTT
+ATTCCTGCGCTGTTTATTCTGTTTTCACTTGGCGGCGCGGTATTTGGTATGGGAGAAGAG
+GCCGTCGCCTTTGCCATTATCATCGCACCGCTAATGGTCCGGCTGGGCTATGACAGTATT
+ACCACCGTCCTGGTGACCTATATTGCCACGCAAATCGGTTTTGCCAGTTCGTGGATGAAC
+CCGTTTTGTGTGGTCGTTGCTCAGGGGATTGCCGGCGTTCCGGTGCTTTCTGGCTCCGGG
+TTGCGCATCGTGGTGTGGGTTATCGCCACTCTGATTGGCCTGATCTTTACCATGGTGTAC
+GCCTCACGAGTGAAAAAGAATCCTCTTCTGTCACGCGTGCATGAGTCCGACCGCTTCTTT
+CGTGAAAAGCAGGCTGATGTTGAACAACGTCCGTTTACCTTTGGTGACTGGCTGGTATTG
+ATTGTCCTGACCGCCGTAATGGTCTGGGTGATTTGGGGCGTGATCGTTAATGCCTGGTTT
+ATTCCAGAAATTGCCAGCCAGTTCTTCACCATGGGTCTGGTGATTGGCATCATCGGCGTT
+GTTTTCCGCCTTAACGGCATGACGGTTAATACCATGGCTTCATCCTTTACCGAAGGGGCG
+CGAATGATGATCGCCCCTGCCCTGCTGGTGGGTTTCGCCAAAGGGATTTTGCTGCTGGTC