view test-data/ecoli-reads.fasta @ 3:5732f959936a draft default tip

"planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/canu commit 7000c7eb839b77a0e7e91874048219bd3a3f5d47"
author bgruening
date Mon, 15 Feb 2021 12:31:26 +0000
parents 4c8f32256fa8
children
line wrap: on
line source

>fa9ad683-35c5-4dad-a3af-de7a86b1ffa8
TTGGTATGCTTCGTTCCAGTTACGTATTACTTTCTGTTGGTGCTGATGTTGCGTCTGCTGATTGTTTAACCTGGCTGGATCGCTGCTGAATAACTTCGCCGCATGGCCGCTGAAATCTTTCACCCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTTCGGCATTTCGCTCCGCTATGCTGGCACTGCTGCGGTGTGCATAGCGATCTGCTCGACCGCTGGCAGCAGCATCTCAAGCGAACTACTTGCATTCATCGCCACAGAACAGGTAACCATCGAGGCGTTCCTCGGAACATCAGATAGTCAGAATCGTTTTGTATCCGAGTGGGTACAGGCGCGGCTGACGGCGATTAACGATAAGCAACAAAAGGTAAATAGAAGATGCGGCGCTTAACCGCGAGCTCAATCTTACCTGGCAAAATACGCGGCTTGATCATGATCGATTGTAATGCCCGGTAACTGGCCGCCAAAGCCGATGAAGTGTCGATGGAAGGGGCTGGCCGAAACGCTTAAACGATTGCCCTCGGTGATACCGTGGCTTTGCGGGGCGATGCGCAGGAGTTTCCGCGCTAAAGTAGCCAGCCTGCGCAAGTGGACTGGAAAGTCACGGCCTAATTTCTATTTTATTTTTCCCTGAAGGGCATTCGTTAAGGCAACCGCAGAGCAACCACCCAGTTTCCGCTGGGAGAATGGCAACGGCATGATGACACCGGCTCTTCGCCAGTTCCCGACCATCAGCCTGATAGATATTGGCGCGATTTTTAAAACCGTCGGTCAGGTGCTGGAGCAGATGGGGTCGGGCGCTGGAAGTGATAAATTGGTACTGGTCACCGCCTGCGGTATATTTGCTGTTGCTAGCACAGGGGTACGGGCGAGACATCCAGCGTCATCAAGGCTAATTGGGTGTGGCGCACTCGGTGCGGAAAAAGGCTTTGCTGCGTACCACGTTGGCAAGTGTAGAGTTCGCCATACTTGGGTTTTGTTTTGTACCAAGTGGCCGCAAAATTAGTGCACAGAAACAGCGCTGGCGGCGGTGTGCAGGCGAAAGTGAACGATTTTCAAAGTAGGAGCCAAGACTGGCGATTGTGGATTATTCTACCGTGCAGCGGGCGGCTGCTGCTGTCGCTTTCCGGCGGCTGGCTGGGTGCGGTTGGGTAGGCGCTGTTCGAGGCAGTTTGCAGAAATGCGCAAGGTAAATAGGGGGCGTTCTGGTTTAGAATGAACGCGCCCAGCAATTTCGATGAATTCTACAATATGTTTCATTGATGATGTTATTGAATTGGTGATTTTATCTTTCTGTTGCTGTCGCTAATCACAAGATCGAGGTGGGTTTGTTGATTTTTAAATGTAGCCTACAATACTCCGTTCGTGAAATCATAAAAAGCCATATGCGTTGAATGGATGTCATCCTATGGTAATTTGTTGATGATGAATTCATCCTGTGTAAAAATGTTAGTTTAATAAAATATTAGTGACCTGTAACTAACGGTTTGTTTGTTGATTGAGAACCGTGGTTATATTGAAAAATATATAAATACATTGGCTGGTCTTGTATGTCGGTTTTATTTTTTGTTGCCTAAACACAGGGATATCGAACTAATAACTAAAGGGCACTTTATAGGCAGAAAAACCAACGCGTCGGGAGATATGAGCTCAAGTATGGCGGATCCCATTGTCCGGGGCTCGGCAGGTGTAAAATTGGCGCGCCCACCAGCGTGGCATGCTCGTTGTCGGGCGGGATGACTTCGGGCAACCCGGTAAATCCGCTGCTGGGGGCAGGTACGCTTGGCCGAGACGGACTTGCCGCTGCCCGTACGCTGCGTTCATTCTCTCCCGCACCTAAAAAGCCTTCTGGACGAAGACGCCTGCCGGTGGGCGTTTTCGGCCCCGGCACAAACGCTGATATCCGCTTACAACTGCGTGATGACGGACTGATACTCCAGCAACAACGGCAGACGAACATTCCGCTGAGCCGCTGCTGCCACATGAGGAGAGCGAAATTAATACAACCGCAGGGTACGAGTCAATGTGGCTGGTGCGGTAAGGCAGCGCAACTGGACGGCCATACTGCTAGCGCGCGGCTGTGGGGGCTATACCGCCGGATATCAGTTAAGCCCGCATCTTTACCTGGCGACCAACGCGCACAGGGGCCGTGGTGGATGCTGGGTGGTCTGAGCGGGTGCCGGGTGCTGAGGACGCTTGCTGCCAGCGCCGCTGCCGTACCAGGTGCCACCAGGATAGCGGACCGCTTCAGGCGGACGCTGACGCCTGCGGCGTAGAACATGGTGACCCTGGCCAGAAATCACCAGCGTGACGGACGGTGCCGGGCGGGGTTATTCTGATTTTGTCACGCAGGCGCGAGCGTTGCGGAAAAGGCCACTTACCTCTTCGCTATCTTAATACGACGTTCCCCGCCCTATATAGCCTCAGCGTTCCCCAACCTACCCAGTACCGAATACGGCCCCGTGGTGGCTGATCACGACCGGCATGCCAGAGAAACCCTGCCGCTGCGCCACTAGATTGCGGTACGTCTCTGGAAACCGAGTGAACTGCGGCGGTATATGAGCCGCAGCAATACGCAGGTGCGCTTTCATTATGACGCGCTTACCCGGGCAGATGTGGCGCACCGTTACACTTAGGAAAGGCCGGAGATGCGCTACCACTTCGACGATACAGGGCGGGTGGTGGAGCAACGACCAGCAGGGGTTAAGCTACACTATCTTTATAGGCAAGGACCATATCGTCACCGACGGCCTGAACCGGCGTGGGAGTGCTGCATACAGAAGGCAGGGCCGGGCTAAAACAAATTGGTGAAAAAGAACGAGCGGACGGCACAGAAGCGTTCCGCGCTGAAATTGCATCGACCGCGAAGCAGGAAGGCTCACGGCATGAACGGACGCGGCAGGGCAGGAGGATAAGTACGGTCTGAATGTGGTGTCCAGCGATATCGAATACCACCGGACGGGCGGGAGACGAAATTCCTATAACGACGGGAGCCAGCTGACGGCGGTGGTAATGCCGGACGAACTGGAGAAACCGCCAGGAATATGATGAACCGGGCAGGCTGGTGTCAGAACATCGCGCAGCGGGGACAGTACGCTACCGCTACGTGGCCGCCTGATAGTTACCGGCGACGACAACGGATGCGACGGGCGCTTACCAACAGATAATATAGACACGCTACGGGCGTTGCTGGCGTTCTGGCTTTTCGACACGGAGCCATTATGAATACGACCGCTTCGGCCAGATGACGGCGAAGTCCACCGCGAAGGCATCAAACGCTACCGCTATAATAACGTGGCGGTTAACCTCGATGAAAACCGCACAGGGCGATGAAACGCGACATGAGCCACAACGCCGCAGAGCAACCTATTTCGCCAATTATCTGCCCCGGACGCGGCCGGAGCGGAAGACACGAGGTACGATGCGTGGGGAAAGGCGGGTCAGCACCACACCAGGGCGGCTGACGCGCAGTATCATTACGGTGCTGCCGGATGTCATCGCCCTGACCAACGAGAACACGGCAGCCACGGCGTCTTCTGGTTACGATGCGCTGGACCGGCTGGTGGGACAAACACCAAGCAGACGCCGAAGATGAGAACGATGAGCAGTATACCCGTAATGACGCTTCCTC
>a403a23e-20e7-43f7-a5fa-dae8ebc59a01
TTGACTGTGCTTCGTTCGGTTACGTATTGCTTTTTCTGTTGGTGCTGATATTGCGGCGTCTGTAGGTGTTTAACCTGCCAGCATCACACGAGATTGGTCAAGTGCGGTTGGGTTTTTCAAACGGATGCGACAGCAGTTGGCATTAAAGAAGCCACCGCCGTTAGGCGCCGAGCATCTTGATGCTTCCACGAAGCTACGATACCGCCGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCCTACGGCCTGTTGAGCGAAAGTTTTAGCGCGCAGCGAATAAAAACAATTACGAAATCAACAACGCCACGGGACTAGCACCCGCGTGGTACGTAGCAGATCGACCCAGGCATTCGAGGCGTGCTCATGCTCTGGCAGATAAACACACGGATGGGGCAAAATCACCCTGTCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAGCCCGCCATCTGGCTGAAATAAACTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAACGACTGGCGGTATTCAGCTCATTTCAGCCACAGCTGCTGTGGATTAGCGGCGAATGGTGCTGACCGAGCAACATAAAAAACAGCACCGCCAGCCCCAGCGTATTTCGGGCCGGGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAGGTGCGAAAAGTACGCGCTCAACGCCCACCGTTGTACCGGGAAGAGGAATCATTAAATCTGGCCGCGCCAGCCCGCTGCTAAAGGACGCCAGCACCATTAACACCAATATAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGACACCTCCGCATTGATCGGGGCATAAACCGAATGCGGTAATAAAAGCACCAACAATGCGCCGGGTGTCGCCTGCACTCACGGTGCACCTCCGGTGGCCTAAAAGTGATACCGGAAGGGTGAATTCTGTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGTGTAAAAAGTGATATAAAAATGGCAAAAGCCTTGATTTAACTAATGTTTAATATTAATTTAACTTTATTGTAACTTAATTACAGGATGGGTAAATAAATATAATAAGCAAAAATAGAGCCGGTCGGATGAGTAGTAAAATTACACAAAAAGGCGGTGCTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGAATTGGGCAAAGGAAAGTATGGAACTCTACAGAGAATATCCTGCATGACATCTTTTACGCCATGCCTGCACGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTCTGGAAAGACGCGCCCGCTTTTTGCAATACCATCGCGTCTGATTCGAAAACCAGCGATAAACCAGGTGTGGATGGATCGGGCGAAAAGGCAACTGGTGATTTTATGATTGCTGAGTTTGAATATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTGTATCAGGAAGATGTTCAGAGGAATATTTGAACATCGTTATACCAATCGAAACGTATATTCTGCCAAATATATATAAATATTTTCTAATTGTTCTTATCTGACAGATATCTCTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCCAGCGAACAAATAACCCGATAAACAAAGGATGAGCAGTGAGCGGAAAACCGGCGGCGCGTCGGGGTGACATGACGCAGTATGGCGTGGTAATCCAGGAGTTCAGCCGGGGTACGCATCGGTGCCCCCACCGTGGCCTGTTCGGTGTGCCCCGGCGAGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCAGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCCGGACAAAAACGCCCGCGCCGGTAGAGGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACCAGTGATAGCGGCGGCAGAAGCCCTGTATTACGAGCACCTGTTTCCCGGTGAGGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGACGGCGTGAAAGCGAAACTGGATGAAGCAAGGTCTGGCTGGCCGCCTCTGGCAGGCGCTGCCGGAGAAGAACTCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCACAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGTGCTGCCTGCGCCTTTGCCGCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCGGGCAG
>ae3ab29f-07ae-4476-85eb-b212d69ce732
TTGGTATGCCTTCCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTTCTGCTTGGGTGGGTACAACCTCACCCTGCGTGTGCAGGACTTCACGGCGATTCGAGCTGTCAAGTGATAGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTGGCCTGCCGGGTTTAGCTGTTCTGTCACCGCCCGTCGCTGTCGTAACGGTAACAGATTCCGGTCAGCCCGTGTGACGGTGCGCCACCATCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCACCTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGGCGTCCAGCCATAGCGCACACCAGCGGCGCGGCAGGTAAATTCTCAGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCAGTGTAACCGGCGGGTATCAGGAAAAAGCGGACGGTTCCGTCCCGCCGGGAAATATTACCTACTGCGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCATCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCACCAGCCAGTCAGTACCCGGTACGGCGGCAGCGGCGCGGTAGCACCTCATCCGCTTCCGGCACCGCTCACACCAGCCGAGCAGCCACCACGGCCCTGCGGACTGTTTGTCGCCAGATAACGATACGGACTTAAGCGAGTTCTTCCGGCGCTGCAGGATGCGGCCAGCGGTGACCTTCATCAGTTTCGCCGCGCCGCCGCGCAGCCACGGTAGCTCGCTGCGGCTGTAACCGTCCTCACCGAAACAGGTGCTCAAAATACAGAGCTTCTGCCGCCGTTGTCACTGGTATCAGTGTGTTTATCAGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCACCGGCGCAGGCGTTTTGTCCGGTAACTGCACTGTAGGTGCGGGAGAAGAATGAACGGCCTTGGGCCGGGCAGGGCGGTCATCGGTTTTCACCGGGAAGGACCTTTACCAAACAGCGGATTGACCAGACCGGACGTCACCCGCAGGGGCACACCGAACAGGCCACGCCGGTGGGGCACCGATGGAAGTACCCCGGCTGAACCCTGGACGTACTGCCGCCATACTGCGTCATGTCCGCCCTGACGCCGCCGGGTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACGGGCAGAACCTACAGTTATAAAGAAAGCAGCCAAGTGCCGAATATCTGTCAGATAAGAACCAATTGGAAAATATTTATATATTTCGCGTAGATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTTCTGATAAAAACCGCCAGCGTTTCGCTGGCGGTTTCAATATTCAAACTCAGCAGAAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCATCCACACCGGTTTTATCGCTGGTTTTCGACCCAGACGCGATGCAGAGTAAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAGAGCGCCAGAACGCCCGCTGCAGCCGCATAAGTGCGGCGTAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAATGAATTGTTTATCTGATGAAAATAGTACCGCCTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTTGCTTATTGATGGTTTATTTGCATTCATCCTGTAATTAGAAGTTACACAAAAGTTAGTGTACTAAACGTGGATTAAATCATGGCTTTTGCCATTTTTATACTTTACACCCGCCCGCAGATTTTTGCGAAATCTTTGCAGCCAAATTCTACCCTTCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGGGCGTGATAACCGGCGTATTGCTGGTGTTTTTATTACTGGGTTATCTGGTTTGTACCTGATCATGCGGAGGCGTTCTGATGATGGCTGCGCAGGGTTCTTACTGATCGCCACGTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTGCTTTTCGCGCACTTGGCGTCTCTGACCGTGAAAGGATGAATGACTTAATATGCTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCGCTGTATCTGCCGCTTAATCCACAGCAGCGGTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTAATCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGGATTGCGGTGATTTTTGCCCTCATCCGTGCGTTTTACCCGCCAGGCATGACACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATAGGTGCTGAGTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTACGCAAAACTTTCTGCCTTATCAGGCTGTAGATACCGTTAGAAGGAGCGCAACGGCTATTCACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAGCTCGTCGCATCAGTTTGAAGGAAAACCAACCGCACTGACCAACTTCGTGCGGATGCTGGCGTCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCGTCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCATATGGCGCATTGATTGCGATGCATGATTCGTTTACACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGGTCATGGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCGTGATGATTGGTCATTACACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATGAGAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTAGCACGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTGCGCCATGCTTTCAACCCTGGCCCGCATGGTTTTTAGCGAAGTGCTGTACGCCCGTGTCATCCGCCGCTAACTAACAACAGCTGGCAGCGCCTTTGCCGGATTAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCCGGTCGCTTCGGGTGATTATCCCGGTGATGGCGATTGCCGGTTCGCTGGTGAGTAAAGGAGCCAAGCCGCCAGCTCCGGCACGCTTCGCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGCACCGTGTTGCTGGTTGGCGCATGACCTTTATCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCCTGATGATATTGAGTGAGCACTGAATGTGAGTCGTAAACAGCTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAGCGGGAAGTGAAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAAGCGCGGCCATTAGCGGTGGCTGTGGATCACCATTACTGTTCATAATTTCGCCGAGGCGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGTGTAAACTTTACCTTTGCCCTGGCTGCGTAGACCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAGGGCGATACATTGCTGGTAGAAGCTGGCGATATTATCCCTACGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCACCGGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGGTGTGGCGTGCCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCACAGCGACGCAAAGACGCCGAACGAAATTGCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTTACTGGCAACCGCCACGCTTTGTGTGTTTTCCGCGTGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCAACCACTATTGGCGGCCTGTTGTCGGCGATCGGCGTCGCCGGGATGAGCGGATGCTAGGCGCGAATGTGATTGCCACCGGCGGACGATGCAGTTGGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCCGCGCAAGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCTCCTCTCGCCAAAACGGCGTTTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGGTTAAACACCCAAGCAGACGCGCAATATCCGGCA
>88b1797f-3a41-442f-bab4-cdfedf7ec597
TTGTTATTGCTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGTGTTTAACCTCCGCCTCTTTCGCCGCCTGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGCCGGGCAATCGTTGGTGCCGTCGCCGGTCATCGCTGCCAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTTGGCCTCGGTGTCGCTTCGGCGAGAAAATCGATGAAACACCCGCTTCCGCAACAATCGCGGCGGCAGTCGGAACGGTTATCGCTGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGGCTCTTTAATACCGCGACGATATCTTTCAGCGCAATAACGCCCAGCACGAGAATACCACCACCAGCGGCGTGGCTCCTGACGCGCAACTGATCGACTTTTGATCAACATCGGTAGAGTGACCACCGTTAGCCCTCAACATGGCGACGATATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACTGCACATCGCGCTCATGCAGGTTAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTCATCCACGCCCTGCGCGGATAAACTCGCGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCCGAGCGTCAGCGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCCTGGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACGGTACCGTTACGCTGACTGCATTACCCGCCCACGCGGAAACGGCCGCAGCGTGGCGGTTGCCAGTAAAAGGTGATAGTCCAGGGCAATCAGCAGAATGGTCAGGGCAATTTTCGTTCGGCGTTTTGCGTCATGTGCGCCCTTCCACCATCGCGTCATCCGGTCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCGTGATCAGAAAGAATACGCGTGCCGCCGGTGACTGGAGGCAAAATCGCCACTCGGATTCACGGATCACCGATGCCGATTCCCCGGTGATAGCGCGCTTTCATCGACCGATGCACCTTCAATAACTTCACCATCGCAGGATAATATCGCCAGCTTCTACCAATTTTTGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGACCTTCTGCCAGCCTCGGCGAAATTAGCGAACAGTACGGTGATCAGCCAACCGCTAATGGCCGCGCTTCGGCAACGCATTGCCGGGCACATCGCCGCTTTGCCATCGCGATGCTAATACAGGTGGTCAACGAGCTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCAGAATAAGCGCCAGTTGTTTGACTCATATTCAGTGCTCACTCAATATCATCAGGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGGATAAAGGTCAGTCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCGGCTCTTTTGCTCACCAGCGAACCGGCTGGTGCCATCACCGGGATAATCGCGAAGCGACCGACAAACGCTGCAGAACGCCGGTAAACAGTTCCAGAACGGAAGGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCCCATCAACACCAGCGTCGGGGTAACCAAATTGGTGCAGTCGGATTTCATCTCGCGGCCCGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCGGCTTAATAAACACCTGCGCCAACGGGACAAGCAGCATCATGCCGTAAGACCAGACGGCACCGCCGAACACCACTTCGCAATTTGCATCAGCCACATCGGCACCATGCCACCGGAAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCTGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAGCAGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCGAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCGGAATGGCAAAATCACTGACATCATACAGCAACATGCGCCCTGGCGTGATCGCCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAGAAGAATCATAGCATCTGCACGAAGTTGGTCAATGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGCCACCGCGTTAATTGCCGAGCATCTTGATCGCTTCCTGAGAAGCTTCTGGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCTGGCCTGATAAAAGGCGAAAGTTTTAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACCTTTACCCATAACGTGATGCGTAGCGATCGGTAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATAGGGGCAAAATCACCGCGATCCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTTCACCGCTAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCGAATGGTGCTGACGACAACGCAAAAACAGCACCGCCAGCCCCAGCATGTTCCGGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTGCCGGGAAGAGATGTCATTAATCAACCGCGCCAGCCCGCTGCCTAAGGACGCGCCAGCACCATTAACACCAGTAAAACGTGGCGATCAGTGGGAGAACCGCTTGCGCAGCCATCAGAACCTCCGCATTGATCAGGGCATAAACCCAGATAACCCAGTAATAAAACACCGGCAATACGTGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGAAAGCCTCAAGAGAGTGATACCGGAAGGGTAATTCTGGCTGCAAAGATTTCCTGCAAAATCTGCGGGCAGGAATTAATAAAAAAGTATAAAAATGGCAAAAGCCATGGTTTAACTAATGTTTAGTATTAATTTAACTTTGTGTAACCCAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGGTAGTAAAATTACACAAAAGGCGGTTACTATTTTCATCAGATAAAACAAATTCATTTTCGGTGCCATTCACCGGGTAGATACAAAGGGAGAAAGGTATGAACTCTACAGAATATCCTGCATGGCTTATCTTTTTTACGCCGTACTTGTGCGGTTGCAGCGGGCGTTCTGGCGCTGCCAGCTCGTACTTTCTGGAAAGACCGCGCCCGCTTTACAGCTTCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCCAGGCCGAAAGGCAACTGATTTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTAATATCGAAGATGTTCAGAGAATTTAGACATCGTTATACCAATCAGAAACATATATTGCATGAAATATATAAATATTTTCCTAATTGTTCTTATCGTAGATATCTCGCCAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCGGGCGACATGACGCAGTATGGCGATAACGGTAATCCAGGGTTCAGCCGGTACGCATCCGGTGCCCCCACCGGCGTAGCCTGTTCGTGTGCCCCGGCGAAGTGACGTCCAGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCGCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCGCTGCCGTTCGTCTCTCCCGCACCTACCAGCGGTTACCGGACAAACGCCCGCGCGCCGGTGTAAGGAGCCACCTCGGCGGCGCGCTGGAAATGCCTGCGGATATCCGCTGGCTACGCGATAACACGCGATACTCGAGTGATAACGGCAGCAGAAGCCTGTATTTTGGGCTCTGTTTCCCGGTGAGGACGGTTTACACAGCCGCAGCAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAAGGTCACCGGCTGGCCGCACTCTGGCAGGCATGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCACAGGGGCCGGCTGCTCGGCTGGTGTGAGCGGAGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACAGACGTTCCGCCGCGAAGCCGCCGGTGAATTCAGCGGCAATCACCGGCGTGACGGATGGTGCCGAGGCGTCACTTCCGGCTGTACTAATACCGCACCAGGCGCAACGGGCAGAAAGCCCGGCAGCAGGCCATTTCAGCGGGACGGAACCGTCCGCTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCAGCCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGAACGCCCGCGGCGAACTGGCAGCGGTGTATGACCGCAGCAATACACAGGTGCCTGCAACTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGAAATCTGTTACCGTTACGACAGCGACGGGCGGTGACAGAACAGCTAAACCGGCAGGCTTGAGTTACGCATATCGATATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGCTACGCGGACAGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGATTGGGCAGGCTCAGGGCGCTGAACGGATACCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTACTATAACCACCACAGCCAGTTAACACGTCAGCCACCGGGCCTGACGGGCTGGAAATACTGAGGCCATGATGAATGGGGCCGTCTGATTCGGGAAACTGCCCTGACGGCGATATCACCCATACCGTTATGATAATCCCGCACAGTGACACCCTGCGCAGCGGAGATGCCGGCAGCGGAAAACCGTGACGTGGGCCGTTGCACGGTCAGTTGCTGACTTCACTGACTGTTCCGGTTATGCAACCCGCTATGACCATGACCGTTTTGGTCAGGCTGACGGCAGTGCACCGCGGAAGGGCTGAGTCAATTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTAAAGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCGCAAATCTATACCCCGGACGGCAGCGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATAGACCGATGCTGCTGGACGGGTCATCCGCCTGACCAGTGAAAAGCAGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGAAACCGGCTTTGACGGCCGCACGCAGCGTTATCTGCCACGACCTGACCGGCAAACTTATCCGCAGCGGGATGAGGGCTGGTCACCCACTAACACTATGACGAAGCAGACCGCCTCGCACCGCACCGTGAATGGCAAACCGCAAACGGTAGCGAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAGGGCCGCCTCGCCCAGTGAACACCTGACGGTGCATCATCCGCAGACAGATGAACTGCTCTGGCAGCATGAGACCAGACATGCATACAACGCACGGGACTGGCGAACCGCTGTATGCCGGACCTGCCGCCGTGGAATGGCTGACCTACGGCAGCAGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGAGTACACCCGCGACCGCCTGCACCGGGGAAACGCTGCGCAGCTTCGTGATTATGGGCTTCCACACCGCTTATACCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCGCTACAGCACCACCGGCAGTGACCGGCGTTCACACCACCGCAGCGGATCTGGATATCCGCATCGTATACCTGAACCCGGCGGGTAACCGCCTGCCCGACCGGAGCTACCCGGACTGGCGCCCTCAATGTAACCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAAAACCGACCTCATCGGAAGGTTATCCGCACAGATGATGATGATGAGCGCACCACCGGTACCGATACGACCAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAACGGGTATGGCAGCGTGAACGGGACCTGACGGGCTGATGTCGCTGTCACAAACCGCAAGTGACTGGTACGGCTGGGACGGCGACCATGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAATACGGGGCTTCGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCAGCGCCGCAGCTGGATACCCTTCAGCAGTCCGGTGGCGGGCAATTGGCAGTGTGGTGTTCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGAAAGTAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCCTCGTGCGGTGACCTGACGGTGGCGCAGATGCAAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCTGACCTGCCGCTGGCCATATCAGCACGGAAGGGACAACAGCGTGGTACAGAATACGATGAATGCGGAACCTGCTGAATGAAGAGAGCCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAATTATGATGAGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGGATCCGATTGGGCTGAAAGGGATGGAATTTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCATTAGGATTAGAAACACTAAAATGCATTAAGCACTGCATTCAATGGGCGGAACTGGTGAAAAGCGGTCAGATATATGGGGGGAATCGTTCTATCATCAATATCTTTGTGTCCCCAGATGTTAAGGGGACTATACCTGTAGTGGCCAGACCAGCGGGGAGAATCAAGGAGATGGTCTATGGGGCCAGGTAAAGCAAGTAATGATACAAAAGAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGGAAGTTTAAAGAGAGGTAAGACGCGTTATTCTGTATTGCCTGATATATTCGCACCTATAAATTTAGGGCTATTTAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAGATGGTCTCCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGGTGATGTAATGAAATATATTATTTTTATTCCAGGCTATATGGCTGGCTTTATCGCTTTTTTAATACTATTCTTTTCAATGCATAGACTTTCACTATTAGACTCACTCATTGATGTGACGAGTTAATTAGTCTTATGGAATGATGGTAATATGTTTTCCAACAGGCATTAAGGAGTTAAACACCCAAGCAGACGCCGAAGATAGAGCACC
>c2cfeb47-1930-4486-ba44-fb1f43519806
TTGTTATTGCTTCCGGTCAGTTACGTATTGCTTTCTGTTGGTGCTGATGTGCGGCGTCTGTTGGGGTGTTTTAACTACCCTTGCGCCAGCCATCAGAACGCCCTCCGCGATGATCAGGGCGCCAAACCAGATAACCCAGTAATAAAAACGCAAACATGCGCCGGTTATCACGCCTGCACTCACAGTGCACCTCGATGTCTTCATTGATACCGGAAGGGTAGAATTCTGGCCCAAAGATTTCCATAAAATCTGCGGGCGAGATTAATAAAAGTATAAAGCCAGCTAAAAGCCGTGGTTAACTAATGTTTGAAGTAATTCGCTTTTGTATGGCAATTACGGGATGAATGTAAATAAACCATCAATAGCAAAAATAAATTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAATTCATTTTTTCGGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAGAAGTATGGAACTCTACCAGAATATCCTGCATGGCTTATCATTTTTACGCCGTACTTTATGCGGTTACAGCGGGCGTTCTGGCGCTGCCTTTCAATAGCTTTTCTGGAAAGGCCGCGCCCGCTTTGCAGCTACCTGCATGCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGATGGATCAGGCCGAAAAGCAACTGGTGATTTTTGAAATTGATTTACCCAGGTTTTGATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTATCATCAGGAAGATGTTCAGAGAATATTTAGACATCAATTTATACCAATCGAAACATATATTCATAAAGTATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCGCCAAAGCTCTTATAAATCGCCGGGTTTCGCCTGTCAGCGAACAACTCAACGATAAAACGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACTTATGACGCAGTATGGCGAGTAGCATTGTCAGAGGAGTTCAGCCGGGGTACGCATCAGTGCCCCACCGGCGTGGTAACCTGTTCGGGGTATTAACCCCGGCGAAGTGACGTCCGACCATCCGAGTCGATCCGCTGCTCGGTGCAAAGGTCAGCTTCCCGGTGAAACCACCGACATCGCCCTGCCGGCCCGCTGCCGTTCATTCTCGCACCTGCGGCAGTTACCGGACAAAAACGCCCGCGCCGGTAAGGAGCCTCGGCCCCCGGCACAGAAAATACCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAAGCCTGTATTTTGAGCACCTGTTTTGGCGAGGACGGTTACAGCCCGCAGCGAGTCACTGTGGCTGAAGATGCGGCGTGGCGAAAACTGGATGAAGGTCACCGGCTGGCCGCCTCTGGCAGGCGCTGCCGGAAGAACTCCATGCGTCGCATCGTTATCTGGCGACAAACAGTCCACCCGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCAGATTGGAAGCGGATGAAGAGGTGCTGCCGCCGCTGCCGCCATTACCAGGTACTGACCGGGCCTGGTGGACCGCCGGGCGCACACAGACGTTCCACCGCAGAAGCCGCCGGTGAATTCGGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCATCACTTCCGGCTAGTACTGACCACGCAGGCGCTGGCGGGCAGAAGCCCGGCAGGCCATTCCGGCAGGACGGAACGTCCGCTTTCTGATACCCTGCCGGGTTACCAGATATGGCCGGGACAACGGCATCCGATCTGTCTGCCGTGTGGCTGACGCACGGCCGGAATACCCGGAGGAATTACCTGCCGCGCGCCGCTGGTGCGCTATGGCTGGGAACGCCCGCGGCGAACTGGCGGCGGTGTATGACCACCGTAATACACAGATTTGCAACTGCCCGTGATAAATACCGGGGCGGATGGTGGCGCACCGCCACACGGAGCCGACCGGAAATGTTACCGTTACGACGACGGGTTAAACGCAAGCAGACGCCGAAGATACCG
>1c935ec4-4503-44ea-be57-7201fc03eeb6
CTATCGGTAATACTTCGTTCCAGTTACGTATTGCTTTCTGTTGGTGCTGATATTGCGGCGTCTGCTTGGGTGTTTAACCTGACAACAGGCCGCCAATAGTCAGTTTAGGATCAGACGGACCAGCAGCGCCACCAGTACCGTTACGCTGACGCATTACCGCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAATATAAAGACGATAGTCAGGGCAATCAACCAGAATGGTCAGGAGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCACCATCGCGATCATCCGATCCAGAAATGTCGCCGGGGTTAACGCCACTCAATCCGCAGCCAGTCAGAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCACGCCGGATTCACGGATCACCGGTGCCGATTCACGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCAATGCTTCACCATCGCAGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCGGAACTTTGTCCGCCGCAGCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCGATTTTCACCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGCTGAAATTAGCGAACAATTACGGTGATCCACAGCCAACCGCTAATGGCCGCTTTAAACAGCCGCATTGCCGGGCATCGCACGCTGCCATCGCGATGCTAATACAGGTGGTCAACAGACTGCCGATCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCGGGGATAAAGGTCGAGTGCGCCAACCAACAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCAGCTCTTTTACTCACCAGCAGACGGCGTTGCCATCACCGGGATAAATCGCCCCGGCGACCGACAAACATGCAGAACATACGTGAAACAGTTCCAGAACGGAGTTGGCGCTTAATCCGGCAGGCGCTGCCGTTGTTGTTAGCGGCGGATAGCCCACGGCGGTAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCAGCAGCGCTACGTCCGGCGTCGTCATCATCATGGCACCTGCCGCGCCCCATCAGCACCAGCGTCAGGTAGCCAAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCCGCCAGCAGGACAAAACAACATCATGCCGTAGGAGCCAGAACCGACACCGCCGGAACACCACTTCACCGAATTTGCATCAGCCACATCGGCACCATGCCGCAGGCAGTAAACAGATCATGCATCGCAATCACCCGCGCCACAGGAAGCCGCCGTCGTCGACCACCGACAGGCTACTGACCAGCACGCCAGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCGGATGACAAAATCACTGACATCGCCCACAGCAACATACGCCCCTGGCGGCGATCGCCCATCCCGCTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCGAAGATCGCCAGCATCTGCACGAAGTTGGTCCAGTGCGGTTGGGTTTTCGACGGATGCGACCGGTTGGCATTAAAGAAGCCCACCGCCGTTAGTACCGAGCATCTTGATCGCTGCTTCCTGAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAGCGGTATTCACAACCTGCGATAAAGGCAGAAAGTTTTGCACCCGCGAATAAACAGTGCAATCAACAACGCCGGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCAGGCGTGCTCATGCTCTGGCGGGTAAGCGCACGGATGAGGGCCAAAATCACCGCAATCCGCTGGCGGCAGAAAGTTTGCACGTTAAAGCCGCCATCTGGCTGGCAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAACTGACGGCGGTGTTCAACGCCAGATCCCGACAGCCCTGGCAGCTGCTGTGGATTAAGCGGCGAATGGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATATTTCCAGGCCGAGAATGGCACAAGATGTGCTTCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCGCGCCCGTTGTACCGGGAAGAGGAATGTGGTAATCAGCGCATGGCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAGCAGTGGCGATCCAGTAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCGATGGCAAAACACCAGCAATACGCCGGTTATCGCGCCTGCACTCACAATTGCACCCCAGTGAAAGCCCTGAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAAGTATAAAAATGGCCAAAGCCATGATTTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAAGCCATCAATAAAGCAAAATAAGTGGTCGGATGAGTAGGTAAAATTACACAAAGGCGGTACTGTTTCATCAGATAAGCAAATTCCGTTTTTCCGGTGCCATTCACCCGGGTAGATTAAAAAGGGGGAGAAAGTATGGAGACTCTACAGAGAATATCTGCATGGCTTATCTTTTTACGCCGTGTGCTTAATACGGTTGCAGCGGGGCGTTCTGGCGCTACGCTTTCATGCTTTTTCTGGAAGGCCGCGCCCGCTTTTACGGCTTCTGCCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTTGAAAACCGCCAGCGGAAACTTGTAGCGGTTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAAAACGTAGTTATACCAATCAGAAACATATATTCATGAAATATATATAAATATTTTTTCTAATTGTTCTTATCGGCAGGATGTATCTCCGCACTTAAGACTTTCTTATAAATCTGGGTTTCGCCTGTCCTTGAACTAAAATAACCCGATAAAACAAGGATAGACGGATGAGCGGAAAACCGGCGGCGCGTCGGAGCGACCATGACGCAGTATGGCAATAACGTGTCAGGAGTTCAGCCGGGGAACGCATCGTGCTCCCACCGGCGTGGCCTGTTGTTATTGCCCCGGCGGTGATCCAGCCATCCAGTCAATCCGCTGCTCAGTGCAAAATTCCTTCCCGGTGAAACCGACATCGCCTACCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAACGCCCGCGCGCCGGTGGGAGCCTCGGCCAGCTGGAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACTGATATCGAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCGGTGAGGACGGTTGCAGCCACCAACTGATCACTGTGGCTGGTACTTTGCGGCGGCGTGGCGAGCGGATGAAGGTCACCGGCTGGCCGCGCTCGGCAGGCTGCCGGAAGGAACTCCGCTTAAATTCCCGCATCGTTATCTGGCGACAAACCGGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTAGGCAGGTACCCGGAAGCGGATAAGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGAGACGCACACCAGACGTTCCACCATGAAGCGCCAATTGATTCGCGGCGAAATCACCGGCGTGACGGATGGTGCCGAGCGTCACTTCCGGCTGGGTACTGACCACGCGACGCAGCGAACAGAGAAGCCCGGCAAACGGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCTGATGCCCTGCAGGTTACACCGAATATGGCCGGAACAACGGCATCCGTCAATGCCGTGTGGCTGACGCGACCAGAATACCGGAGAATTTACCGCGCGCCGCTGGTATATGGCTCGAGACGCCCGCGGCGAACTGGCGGCGATTATGACCGCAGCAATACGGGTGCGCAAAAGCTTCCCGCGCGATGATAAATGCCGGGGCGGATGGTGGCACCGTCACACGGGCCGACGGAAATCATTACCGTTACGACAGCGACGGGCGGGTGATGACAGAACAGCTAAACCCGGCAGGCTTAGTTACACGTATCGGTATGAGAAGGACCGCATCATCACCGACGGCTGAACCGCCGTGAAGTCCGCAGGGTGAAGGCAGGCTGAAACGGGTGAACGAAAAAGGAACTGCCGGACAGCATCGTCGCAGGAATCGGTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCACCAGGCAGGATATGAAGATACGATCCGGATGTGGTGACGGGCCTCATCGCGCATCCACCACGCCGGATGGCAGGGCATCGACGTTTTACTATAACCACAGCGGATTAGCGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCAGGGAATATGATGAATGGGGCCGTCTGATTCGAGCACTGGCGGCGATATATCACCCATACCGTTATGATAATCCACAGTGACTTGCCCTGCGCAACGGAAGATGCCGCAGCGGCTGGAAAACCATGATGGAGCCGTTACGGTCAGTTGCTGGAAGCTTTACTGACTGTTCCGGTTGCTGACCCGCTATGATATGACCGTTTGGTCAGGTGACGGCGATGCACCGCGAAAGGAAGGGCTGAGTCGGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTAAAGACACGCGGGCCATATGACGCAGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGAAACGGGACACAGTACGATGCTGGGAAAAGCCATCTGTACCACGCAGGGCGATCGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCATGACCAATTGAAAACGGCAACCACACCACCTTCCGTTACGATGTACTCTGACCGGCTGATGCAGAAGCCCGGCGCGACTGGCCGCACACAGCGTTATCACCACGACACGATGGCGACAAATATCCGCAGCGAGGATGAGGGCTGGTCACCCTGGCATATGACGAAACAGACCGCCTCACGCACCGCACCGTGGATGGCGAAACCTGAAACGGTGGCGAGTATGACGAACGCGGCTGGCTGACGGGCATCAGCCATATCAGCGAAGAACAGGTGACGGTGCACTATGGATTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCACCGAACCAGTGAACTGCTCTGGCATGAGGACCAGACATGCGTACAACGCACGGGACCTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCCGTGGAATGGCTGACCTACGGCAGCGGCTTCATGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCGCGACCGCCTGCACCGGGAGAGCAGCTGCGCAGCTTTCGGCCGTTATGAACTCACCACCGTATACCCTGCCGGGCAGTTACAGAACCGCGCCTGAACAGCCTGCTGTCTGACCCGCGATTACACCTGGAACGACAACGGCGAACTCCTTCGCATCAGCAGCCCGCCAGACCCGGAGTTACAGCTACAGCACCGCCAGCGACTGACCGGCGTTCACTACCGCAGCAGATCTGGATATCCGCATCCGCCATACCACAGACCCGACGGGTAACCGCCTGCCCGGCGGAGGCTTCACCCGGACAGCGCCCTCAGCATGTGGCCCGGATAACCACATATCGCCGTGACGCTACTATCTTTACCGGTATGACCGTCCGGCAGGTGACAGAAAACCGACCTCATCGGAAGGGGTTATCACGCACGGATGATGAGCGCACCACCGGTACCATTACGGCAGTCAGCACGTAGTGCACCACGCGGACTGTGTATGCAGAGCGCGCTGGTCGAAGTCCTTTATCTTTACGACCCGCTGCTGGGCCGCAGGGTGGCGAAGCAGGTATGGCGGCGTGAGCAGGACCCTACCGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTAACACGGCTGGGACGGCAGCCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCGGTGTGGTGTTCCCGCCGGTGCTGGATGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGAAAGCCGCCGCTGGCTGGCATCGATGCGGCCTGACGGTGGCGCAGATGCAAAATGAAGATGGACCCAGTATACCGCCGGCTTTGAAAAGTCACCTGTACCCTGCGACCATCGCGGCCTGCCGCTGGCCATATCAGCACGGAAGGGACAACAGCGTGGTACGCAGGAGAAATGCGATGAATGGGGGTAACCTGCTGAATGAAGAACCCGCATCAGCTGCGGCAACATCCGCCTGCCGGGGCAGCAGTATGATGGGGAATCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGCGATATATCACTCAGGATCGATTGGGCTGAAGGGGATGGAATTTTATCCGGTATCAAGTTGAATCGATCTCAAATATATAAGATCCGTGGGATTAGAAACGCTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGGAATCCGTTCTATCATCAATATCTTTGTGTTAGATGTTAGGGACTATACTTGTGGTAGCCAAGACCAGCAGGAGAATCAAGGAGATGGTCTATGGGGGCCAGGTAAACAAGTAATGATACAAAGAAGCTGCTGGCCGTTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCTGATATATTCACACCTATAGATTTAGGGCTGTTAAAAGGAAACTGCCAAGACTGGTCTAATGATTCTTTTTAGAAACATGTAAGATGAAGTGCTCGGAAATAACGTTGGACGTTTTATTAGATTTGTATTCACCGGGTGATGTAATGAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTTCCATGCATAGACTTTCACTATTAGACTCCACTCGTGATGTGAGCGAGTTAATTAGTCTCATATCTTATGGGATGGTGGTAATATGTTTTCCAACAGGCATAGTATTCTTTCATTGCTCCTAATATTTTATGGGACTGTATCAGACATTATTGGCGTAAGAGTTGATAGTAAGTATATTATGGCGATAATAATATGTTTTATTTTTCTGTCAGGAGGGGTATATTCAATGGGGTTTGTATTAAAGTAAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTGATATAATAATAACCTGGGCATTGATATCCCGTATGCCACAGACCCGGCAGGTAACCGCCTGCCCGGCCGGAGCTGCACCGGACGGCACCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCGGGCTGACGGAGAAAACCGACCTCATCGGAAGGGTCATCCGCACCGGATGATAGGCGCGCCCACCGGTACCATTACGACAGTCGGCACCGGCTGGTGCACTACACGCGGACACATGCTGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGAGCCGCAGGAGTGGCAAAACGGGTGTGGCGACGTGAACGGAGACCTGACGGGCTGGATGTCGCTGTCACGAAACCACCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACTTAAGAACCCGCATCCAGACGATTTATCAGCCGAGAACTTCACGCCACTCATCAGGGTTGGAAACCGCCACCGGTGAGCTGGCAACAACGCCGCAACCTGGCGAGATACCCTTCCAGCAGTCCGGCAGCGAACGGTGGCAGTGTGGTGTTCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGGTACAAGGAAAGCCGCCGCTGGCTGGCATCGATGCGGCCTGACGGTGGAGCAGATGCAAAACAGATGGACCGGTGATTGTACACGCCGGCGCGAAAATCACCTGTACCCACTGCGACCATCGCGGCCTGCCGCTGGCGCTTAATCAGCTGGAAGAACAACAGAATGGTGCGCAGAATACGATGAATGGGGCAACCTGCTGGGCGAAGAGAACCCGCATCAGCTGCGGCAGCTTATCCGCCTGCGGGGCGACAGTATGATAGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGAGGTATCACTCAGGATCCCGATTGGGCTGAAGGGGGATGGAATTTTATCGGTATCCGCTGAATCCGGTTCAGTATATAGATTCAATGGGACTGGCATCAAAATATGGACATAAATAATGGCGGATATGGGCAGAGACCAACAAACCGCCTACGCCCGATCAAATGAAAATTACCCGAAGGACCGCTGCTTAAAACAAATTAGACTGCCATATCCTATTGACCAGGCCAGTAGTGCGCCTAATGTTTTCAAAACATTCTTCAGAGCATTAAGCCTTACGACTACACACTGTATTGCAGGGAAGTGGGTAAAACCAAATCTGACTTGTACGCCACAGGATGATTCCCAGTATCAGGGATGGATACAAAGACAGCAAGTGGTTACCTGCGCCACGAAGACAAATTGGCCAACAGCTCAATTACCAGGATATCTTGTGCCAGAGACCCTATTTATTCCCAGACGTTAATAAACCCGATGGGCCAGCAACGGCAGGGGATAGATGATTTGGGTGAAATTTTGGCTAAGATGGAAAGAGAACATCGAGAGGGAATAAGAAAATGAAAGAGTTTTGTTCTTTTTGCTGATGATATTTGTTAGTTTTTGGTGTTATAGCTGATTGCGAAATACAAGCTAAAGATCATGATTGTTTTACTATTTTCATAAAGGGTACTATTTTTCCGCGTTTCCTGTCTTAAATAATAAAGCCATGTGGAATGGTATCAGAATGGGGACATCGGTGGTATTATTGGCAAACAGAACTGGGTACATGTAAAAATAATAAATTCACCAAAGCGGGGCGAGACTCTTAATTCGCGTCGGGTCACTACGCCTTAATGAAAATCATGCCATCAAAGGAACGTTGCAGAAGGTTGATAAATGCAGCAGAAAAACGGCGTTTCTCGGCGATCGGTTTTAGAAGTTATATAGAGCGGGTATCTATCAAAAGAGCAGTGATCCAGTTCGGTTGTTGGCAGTCGCCCGATAATTCAATCGTAGTAAAATATTTTTAAAGATGAGAAACCAGCTTATGCTCCGAATGACGCATCTCCCGAACAAAATGGAGTCTTACGAATGTTTTAATAAAATACAGCATGAACTAATTCGTAGTGAAGAGAAATAAATCTCTTCCTGAAGAAAACAAATTAATCATTGTGAAAAATTATATAACTCATGGAATAGGTGTTTATTTTGATTCCATTTGCAGGAAAGATCGTAACGCTACTTTTTGTACTAAATAATTCGAATTTAAGTTCAACAATTGAGATACTACTTATTGTCTAAAGCTGTTTTTTCATAAACTATACATGATCAAAATACTCCTTACATAAATAGGTGAACAAAACTGGAGCTTAAAAAATTGATGGAACATATTTCTATTACACCCGATTACAGACAAGCCTGGAAAGTGGTGCATAAAATTGTCAGATATTCTACTGTTATTGACTATTTGTGCCGTTATTTCTGGTGCAGAGGTTGGGAAGATATAAGAGGATTTCGGGGAAGCATCTCGATTTTTGAAGCAATATGGTGATTTTTGAAAATGGTATTCGTTAAATACCATTGCAGAGTTGTATCAGGGAAGATCGTAACGCTTCTTTTTAATGCTAAAATAATTCGCATTTTATGTTTAAAAATTGAGATATTCATATTACCTAAAGCTGTTTTTCATAGCTTACCCTTGATCCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTCTGTATTCCCGATTACAGATAAGCCTGGAAAAGTAGAGCATAAATTGTCAGGCATCTCCTACTATTGACTATTTTGCCGTTATTTCTGGTGCGAAAGTTGGGAAGATATAGAGGATTTCGGGAAACACATCTCGATTTCTTGAAGCAATATGGTGATTTTTGAAAATGGTATTCCTGTTCACGATACTATTGCCAGAGTTGTATCCTGTATCAGTCCTAGGTTAAACACCCAACAGACGCCGAAGATAGAGCGACAGGCAAAGAGCAATGCAATGAAAAAAAGA
>756abc44-d69f-46e2-8464-2f309b147a27
TTGTTGGCATACTTCGTTCAGTTACGTATTGCTACGCCTGTCGCTCTATCTTCGTCTGCTTGGTGGTTTAACCTTCAGCTTTATGCCAATACCAACTGGCAATCTTATGAGTGAAACCACGTTGGCTATTTCAGCCAGATGTGGGCTTAACGGTACAAACTTTTCTTTCTGCCGCCAGCGGGGTGCGGCGATTTTGCCCTCATCGTGCGTTTTACCCGCCCAGAGCATGGCACGCTCGGGAATGCCTGGGTCCGATCTGCTACGCATCACGTTATGGAGTGCTAGTCCCTGCGTTGTTGATTGCACCGTTTTATTCAACAAGATTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGGAATACCGTTGAAGAGGCCTGTAGCTGTTGCCCATAGGGCCTGTGGCTTCTCGGGAAGCGATCAAGATGCTCAGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTAACCCAACCACGCTGACCAGCTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGCGTAGGCGTGGTGATGTGGGCAAGTTCAGGGTAAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGCTGGTCAGTAACCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCGCCAGTTCGTTTACCGCTCTCGGTGGCATAGTGCCGATGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAATCGACGTACGCGGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGAATTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCCGGACGTAACGCCATGTCCAGCCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCCGGGGTATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAATTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCGCTGCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCTGCCCTGGCGCTTGGTCGGTGGCGGAATATCTCCCTGATGATATTGGTGAGCGCACAGATATGAGTCGTAAACAGCTGTATGGCGCTTCTTCAGACCAACGCTTGTCGCTCAGGCGCTGAAAGAAGCGGTAGAAAAATTAAACCCGCAGGCGCAATAATAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCTCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGAAGCCATTAGCGGTTGTGGATCACCATGCTGTTCGCTAATTTCGCCGAGGCGCTGGCCAGAAACGGTAAAGCGCAGGCAACAGTCTGAAAGGGTGAAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCACCGACCAACTTCGTAAAGGCGATGGCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAGGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCACCGAGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAGCGGCAGGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACAATTACCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTTACTGGCAACCGCCGCGCTGTGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCGGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGACGTGCGGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCCGCGCAGGGCGTGGATGAAAAACGTAGCTGACGCGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCGGTATTATTGATCCTCGCCAAGCAGCGTTTAACCTGCCCAGGCGCGATGCAGTCGCTCATTCACCTGCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCTACCGATGTTGATCAAAAAGTCGATCAGGTTGCGCGTCGGGGAGCCGCGCCGCTGGTGGTGGTGGAAAGGTTCTCGTGTGCTGGGCGTTATTGCTGAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGCTGCGCAAATGGGCATTAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGCGACACCGGAGGCCAAGCTGGCGTGATCCGTCAGTATCAGGCGGAAGAGGTCGTTTGGTAGCGATGACGGCGACGGCACCAACGATGCTCCGGCGCTGGCGCAGGCAAGATGTCGCAGTGGCGATGAACTCCGGCACCCAGGCGGCGAAAGGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCATGACCACCTTCAGCGTGCCAACGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGTTTATCATGTGCGCCATTCGCCCGACTCACATTCCTCGGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTTTGATTCCCCTGGCGTTAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGATGGGTGGGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACCGACCGTTTGCGGTCTGGTGTGAGTTTACCATGAGTGGATTACGTCGGCATTATCAACATTTATCTTTCTGTTGTGATTACTGGCGGCGTTTACCGCTGCTGACCCACCGTACTGGGAGCAATGGTGGTTTCCTGGCGGGTAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCCGGGCAGAATTTTACCGGCAACGGCTATTTCATGGTCGCCCGTCGGCAGCGGCAGAAATGCCCTATAATCCACAGGCTTCTGGCGGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCATGCCGGATGCCAGCGCGAGCGTTCCAGTTGAACTGGTGACGGCATCCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGTAAATCCCGCGTGGCGAAAGCGCGTAATCTCAGCGTTGAACAGCTCACGCAACTGATCATAAAATACAGCCAACAACCGCTGGTGAGATATATCAGCCAACCGGTTATCCAACATTGTTAGACTCAATCTGGCGCTGGATAAACATTGAATAACGAACCCTTACGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGGGGGAAAGCTGGATTTTCTTCGGTGCCGCAATGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCAGACGCAAAGAGGCTGGATCTTGGCAGTTGGCGTAAGTAGAAACCGGGCGAAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGAGGTTAAACACCCAAGCAGACGCCGAAGATAGAACGCCG
>6ffbbdea-7881-4ec3-b14a-e5a0c37c056d
TCGTACTTCGTTCGTTAAATATTGCTGCCCTGTCGCTCCATCTTCGGCGTCGCGGGTGTTTAACTTCACCCCCGCACTCGGGCGGCTGGCTGCGCTTTACAGCCTTTACCCAGCGCCTCGGCGAAACCAGCGAACAGTACCGATCCACCGTAACGCTTCGCCGTACTTCAGCTGCTTTAATTGCCAGGCATCACGCACCGCTTACCATCACTGATATAATACCGGTGATCGCTTGACTGCCGACCAGACGATATCGCCCATCACCCGGATTGCGCCATTGCGCCTGCGGTTAATTTTCACCGCTTCGGCGCCTGAACGGCGTCATCTCGGTTCGAATAAGCGCGCGGCCTCATATTCATTTGCTCCTCAATATCATCGGGAGAGATATTCGCCACGGACCGACGCCAGAACGGGGATGATTGATCACCCAACCAGCAACACGGTGCCGATGCAAACCCGCCAACAACGGCAGGCCGTGCGTTGCTTGCGCTGTCGCGGAAGTGGCTTGATGCTCACCAGCGAACCGGCAATTTATCCGGATAATCACCTGAAGCGACTGACAAACATGCAGAGCGCCAGTAAACAGTTTCGAGCAGGTTAACCAGCGGTAATCAAGCAAAGGCACTGCCGTTATTTCGCGGCCGGATGTTGCGGCGTACAGCGCCCTTCAAAACTTCATGCGGGCAGGTTGAGCGTAGCGCTACGTCAGCGTCGGTCATTAATCATAACGCCGCGCGCCCATCTTTCAGCGTCAGGGGTAACCAGAATTGCCGGTACAGTCAGTTTCATCTCAAAGCGTCGGTTGCAGATGATATTCCGGTGTGCGACCGATCATCGGCGGCAATAAACTGCCGCCCAGGACAAACAGCATCGCGCATAAAGACCAGAACCGACACCGCCGAACACCGCTACGATTTGCATCAGAAGCCGAAATATTTCGCGTATGCGAGGCAGTAAAGCAGATGTCAGAAATAACAATCACCGCGCACCACGAGGGGTAACTTACCGTGGTCAGCCCGCAAAAGCGGCTGCTGACCAGCTTGCGCCGAAGGCGGCTCTCTTTACGCTTCCATATTGATGCGCTGTCGCATTTGTGCCCAGCGGGTGATTACCCTGAACTTCTGCCCACATCACCCTTACGCAGATGACAAAATCACCCCGGCATCGCCCACAGCAGCATGCCGCTGGCGGCAAGTCGCCATCACTTCCGCAAAGGCAAAGCACGAAGCGCCGTTGGGGATCGATCGCCAGCATCTGCACGCAATTGGTCGGAAATTTGCGGTTGGGTTTTCAAACCGGATGCGACGGTTGGCGTAAAGAAACCACCACCGTCGTGCAAGGCATCGCCCGGTCGCTACTGAAGAAGCTACAGGCCCCATCGTGCGCGCCAACTGTTGCGCTCCTTCGCGGTATTCCCGCAGCCTGATGAAAGGCCAGAAAGTTTATGCTGTTGAGACCAAAAACGTGATTGCAATCTAACCACCGCGCCAGGGGATAACTTCCGCCAACGTGATGCGAATCGACCCGGAGGCATTACGAGCGTCTTTCGTAACTTCTGGCGGGTAAACGCACGGATGAATAAAATCACCACAATCCCTTTGGCAGAAAGTTTTGCACCGACCGACCCGCATCTGGCGAAACTAACCTCAACGTGAACTACCTTCTGCGAGATTACCAGTTGACGGTGACAAAGCTGACGGCGGTATTCCGGCGCCGCCAGATCCCGGTGGCCTATGCTTGGCTACTGTGGATTAAGCGGCGAACAATTAACTGACCGACAACATAAAAACGCTGCCAGCCCAGCATCATTTCCAGGCCGAAGAATGGTGGCACCGAACTGTTGCCTTCCCGTTCATCTCCGGTCAGAGACTGGAGTGCGAAAAGAATTACGCGCTCAGCGAACAGCCGGGAGATGTCATGAAATCAGCCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAAGCACCAAACAAAAACGTGGCGATCAATTAAAAGTACCCACCCGACCATCGAACCTCCGCATTGATCAGGGGCGCATAAGCCAGATGTGATAATAAAACACCAGCAATACGCCGGGTTGTCGCGCTGCACTCAGTGCACCTCAAATCAGCTCAGGAAATTGATACCGGGAAGGTGAATTCTGGCTGCAAAGATTTCACCAAAATCTGCGGGTGTAAAAAGAAGTATAAAATGGCAAAAGCTTCGCGGATTTAGCCTAATGTTTAATGTTAATTTAACTTTGTACGTAACTTAATTACCGTGGAATGTAAATCTCGACATCAATGCGGCAAAAAGAATAAATTTGGTCGTGGGATGGGTAATGGAATGCACAAAGGCGGTACTATTTTCATCAGACGTAAACAAATTCATTTTCGGTGCCATTCACCGAATTGGGCTACAAAGGAGAAAGTATGGAACTCTGCAGAGAATATCCTGCATGAAGAGCTTTATCTTTTTACGCCGTGCCCACATGCGGTTGCAGCGGGCGTTCTGGCTGCGCTTTCATCGCTTTCTGGAAAGAGACCGCGCCCTTTTACCGGCTACCTGCATCGCGTCTGGTCGAAAACGAAATGGCTTCAGTCGTAATGGATAAGGATCGATGAAAAGGCAACTGGTGATTTTGATTGCTGGTTTTGAACCATTTAGAAAACCGCCGGAAGTAGCGGTTTTTTCTCGGAAGATGTTCAGAGAATATTTGCGTTATCGTATACGAAATCAAACATATATTCATGAAATATAAATGTTTTCCCTAATTGTTCTTTATCGGCAGATATCTCACCCAGGCTTTCTTGGGTTTCATATATCGAAAGCAGACAAATAACCCGATAAACCGGGATGGAAGATGAGCGGAAAACCGGCGGCGTCAGGCGACTTATGACGCAGTATGGTATTAACATTGTCCAGGGTTTCTTAAATTGCGTCGGTGCCCCCACCGGCGTGAAGCTGTTCCGGTGGCTTTTTGACGCGACGTCGGCCATCCGGTCAATCCGCTGCTCGGTGAAAGGTCCTTCCCGGTAGAGCATCGCCCTGCCCGGCCCGCGCGTTCATTCTCCGCACCCTACAGCGAGTTACCGGACAAAAACGCTTACGCCACGGTGGGGGCCTCGGCAACTGGTGGAAAATGCCTGCCGGATATCCGCTTACAGCTGCTGCTGAACAACACGCTGATACTCGGTGACGCGGCGGCAGAAGCCCACATATTTCCCGAGCACCTGTTTCCCTGAGGGACGGTTGTACAGCGAGTCACTTTGTGGCCAGTGCGGCGGCGTGGCGAAGGAAACTGGATCCCCGAAGGTCTTCGGCTGGCCCACTGCTCCTGGCAACGCTTCGCCGGGAAGAACTCCCTTAAATGCGCATCTACCGTTATCTGGCGACAGGAAAAAGACGATTAAGGGGCCGGCCAAATTGGCTGCTCGGCCAGTGTGAGCGAACGCGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGAGTACTGACCAGTGGTTAACTTCGGGCGCACACAGGAACGTTCCACCATGAAAATACGCCAGGTGAATTCAGCGGCGAAATCACCGGCATGACGGATGGTGCCGAACTCACTTCAAACAGTGCACTGATGACCACCAGGCGCAGCGGGCAGAAGAAGCCGGCAACGAACCCATTCGGCGGGACGGAACCGTCCGCTTTTCTGAAATTACCTGGGTTACCGAATATGGCCAGGACAGCAGCGTCGTCTATTACCGATAACGGCTGGCGCACGAATACCCGGAGAGATTTACCTGCCGCGCTTCGGTGCGCTATGGCTGGACTGCCCGCAGCGAACTGGCGGCCAGGGTGTATGACCGCAGCAATACCTGAAGATGCCGCGGCTTTGCTTACGATGATAAATACCGGGGCCGGATGGTGGCGCGCAATCACCACGAATACGACCGAATCTGTTACCGCCGTTACGGCAAGCGACAGCGGGCGGGTGATGGAACAGCTAAACCCGACGGGCTTAAGTTCACGTATCAATTATAGAGGAAGGACGCAATACCATCACCGACAGCCCTGAACCATACAAATGAGAGTCTACCTGCACAGAGCCAGAGAGCGGGCTGACGGAAGGTGTTGAAAAAGGAACACGCGGACGGCGGCGAAAATCTGCATAAGTCGTTTGACGCGATTGGGCAGGCTCAAGAGCTGGAACTGGTCACCGCAGGCGGGACCGGCACAGAATACAGTCCGGATTAAACTGGTGACGGGCCTCATCACTGCTGCTTTCCGGATGGCAGGGCAGCGTCGGCGTTTTACTATAACACTGCAATGATTAACGTCGGTACCCAGGCCTGACGGGCTACGCCAGAAGGAATATGATGGATACGGGGCCGTCGATTCAGGAAACTGGCTGACGGCGATATCACCGCTACCGTTGATAATCACACAGTGGCTTACCCTGCACCGGCGGAAAGATACCACCCGGCGCTGGAAAACCATACGGCGATAAGAACCGTTACGGTCGGTGCTGAAACTACTGACTGTTTCGGTTAATAAACCCTTCTGAAAGCCGCGACCGTTTTGGCGGTGGAGTGACGGCGGGTGCACCACCGAAAGACTGGTCAGTACCGCATCACGACAACCGTGGATAGATTTTACCGTGGAACGGATGGGTAGCGAGGCGGCTTCGATACTACCA
>adeedf44-dbc5-401b-8b3c-07c944e12deb
TTGATGTGCTACGTTCGGTTACGTATTGCTCCGCCTGTCCTGTCTATCTTCGGCGTCATAGCGGGTGTTTAACCTCCCTTTCAGCCCAAATCGGTCCTGGTGATATATCGCCCTGCGGCGGGTCTTAATGGCGGTGGCGATTTGTAATACAGGCCGGACTCCTCATCTTACTGCTGCCCCAGCGGTGGATAGCTTCACTGCAGCTGAAGTCGCAGGTTCTCTTCATTCAGCAGGTGCCATTCTGTCGTATTCTGCGTACACCCACGCTGTTGTCCTTCCGTGCTGATAAGGGCCAGCGGCAGACGCGATGGTCGCAGTGGTACAGGTGAATTTTCGCGCCGTGGCCATACAGGTCCATCTGGCTGCATCCTGCGCCACCGTCAATTTTACTGATGCCAGCCAACTGGCAGCTTCCTCACCCTCACCGTCAGCCAGAGTTCACTTTTCCGCCGGTCGAGCATCTGCCAGCACCGGCAGGGAGCACCACCTGCCACCGTCTTCGCCACCGGACTACTGGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTATTTGGCGGTTTCAAACCCTGATGAGTGGCGTAGAAGCTCTCTCCCCGACTGATAAATCACGTCTGGATGCGGGTTCATCGTTCTGTTATCGTGGTCAGGCGGTCGCCGTCCCAGCCATTACCAGGTCACTTGCGGTTTCCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCGTTTGCCACCCTGCGGCCAGCAGGTCGTAAAAAATAACGACTTTCGACCAGCGGCTCTGCATATTGTGTCACGATGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGAACCGGTGGTGCGCTCAATCATCATGCGGATAACCCTTCCGGGATGAGGTCAGTTTTCTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCCAGGGAGCGCTGTCCGTTACAGCTCCAGGTCAGGCAGGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCGGAGGTGGTAGAACGCCGCCGGTCAGCCTGCCGGTGAACGTTATGTAGCTGTAGCTCCGGGTCCTGGCGCGGGCTGCTGATGCCAGTGAGTTCGCCGTTATCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTATTCAGGTCGCTGGCTCATAACTGCCCGGCAGGGTATAAGCAGTGAGTGGTTATAACGGCCGAAGCTGCGCAGCGTTTTCCAGTGCAGGCGGTCGCGAATTAATACTCCACCAGCGAACAATAATCGCCGAGTTCATCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCAGGCAGGCTGTCGATGCTCAGCCAGTTTCGCCAGTCCCTGTGCGTTGTACGCATCATCACCAGTCTCATGCTGCCAAGGCAGTTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCAGGCAACGCTTTACTGTCATAACCGCAGTGCCGTCACCGGTGCCCTTCGCTGATATGGCTGATGTCATGTCGGCCAGCGCGTTCGATCATGCTGCCACCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGGGGGCGGTCTGCTTCATCATGGTGCCAGTGGTGTGGCCCTCATCCTCGCTGCCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACATGTGCAGCCGTCAAAGCCGGTTTCCTGTATCCAGCCGGTCAATTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTTCACTGGTCAGGCAGGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACGCCCTGCGTGGTACAGATATTTTCCCCACGCATCGTGCTGTGTCCCGTTTCTGCTGCGTCGGGGGCAATGACGGTGGTCAGGTCACCGGCAGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGGCATGCGCGGTACAGCTCAACCCTTCTCGCGGTGCACCGCCGATCACCTGACCAAACGGTCATGGTCGCCAGCGGTTATAACCGGAACAGTCGGCAGTGAAGCTCAACTGACCGTAACGGCTCACGTCATATTTTTCGGCTGCCGGTGGCATCTTCGTTGCGCAGGGTAAGTCGCGTGTGGATTATATCATAACGGTAGCGGGTGATATCGCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCTGATAAAATCATATTCAGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGGTTATAGTAAAACGCCGTGCCCCTGCCATCCGGCGTGGTGATGCCGCGTGATGGGCCGTCACCCGCATCCGGACTGTATTCTGTTGGTCACCGCCGGCGTCGCGTCTGTGCCCTGAGCCTGCCCACCGCGATCTGACTCCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTTCACCACCCACAGCCCACTTCACCCTGCGTGTGCAGGACTTCACAGCGGTTCGACATCGGTGATGGTGATGCGGTCCTTCTCATACTGATCGTGTAACTTAAGCCTGCCGGGTTTGCTGTTCTGTCACCCGCCGTCGCTGTCGTAACGGTAACAGTTTCCGGTCGGCCCGTGTGACGGTGCGTTGCGCCACCCATCCGGCGGTATTTATCGTCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGGCGTCCGGCCATAGCGCACCAGCGGCGCGAGCAGGTAAATTCTCCGAACATTTCAGATTCGTGCGTCAACCACACGGCAGACAGACGGATGCCGTTGTCCGGCCATGTTGGTGTAACCCGGCAGGGAATTATCGGAAAAGCGGACGGTTCCGTCCGCCGGAAATGACCTGCTGCCGGGCTTCTTCTGCCCACTGCGCCTGCGTGGTCAGTACCGGTAGACGACGCCCGGCGCCATCAAATCGCCGGTGATTTCGCCATGAATTCACCGGCGGCTTCGCGGTGGGACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCGGTACCGGTACGGCAGCGGCAGCGCGGGGCAACACCTCGTCGCCCGGCCCGCTCGCACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCGCCAGCCACAGTGACTCGCTGCGGCTGTAGCCGTCCTCACCAGGAAACAGGTGCTCAAAATGCAGGCTTCTGCCGCCGTTATCACTGATCGGTGTGTTATCGCGCCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCAGCGGGGCCGGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTGGGTGGGGAGAGAGGGAATGAACGGCAGCGGGCCGGGCAGACGATGTCGGTTTCACCGGGAAGGACCTTTGCGCGAGCAGCGGATTGACCGGATGGCCCGACACCCGCCGGAGCTGCCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCGGCTGGAACCCTGGACAATGCCACCGCCGCTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTCCAGCTCATCTGCTCATCAACTTGTTTTATCGGGTTGTTGTCTGCTGACGGGCGAAACCCTGGATTTATAAGAAAGCCTTAAGTGGATATCTGTCAGATAAGAACAATTGGAAAATATTTATATATATTTCATGAATGGCATATGTTTCGATTGGTATAACGATCTAAATGTTCACTCTACGAACATCTTTACAGATACAAAACCGCCAGCGTTTCCGCTGGCGGTTTCAATCCAAAACTCAATCAATAAAAATCACCAGTTGCCCTTTTCGGTCCTGATCCATCACACCAGTTTTTATCGCGGTTTCGACCAGACTGCGATGCAGGTAGCACAACAAAAGCGGGCGCAGTCTTTCAGAAAAAGCATGAGCAGCGCCAGGGCCTTACTACAGCCGCATAATTACGGCGTAAGACAAAGCCATGCAGGATATTCTCTGTGAGTTCCATACTTTTCTCCCCTTTTTCTTATCTGCCAGTGCAGATGGCACCGGAAAATGAATTTGTTTATCGATGAAAATAGTACCCGCCTTTTGTGTAATTTTACTACTCATCCGACCATATTTTTGCTTATTGATGGTTTATTTACATTCATCATAAATTAAAGTTACAAAAGTTAAATTAATGCTAAACGTAAGTTAAATCATGGCTTTTTGCCGTTTATACTTACACCGCCCGCAATTTTGCGAAATCTTTGCAGCGTAGAATTCTCCACCTTCGGTATCACTTTTAGGCCGCGCTGGAGGTGCACTGTGAAATTGGCGTGATAACCGGCGTGGTGCTGATGTTTTATTGCTGGGTTATCCTGGTTTATGCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCGCCTGTTCGCCACGTTTTTTACTGGTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCGGCGCGGCTGATTAATGACGCATTCCTCTTCCCGGTACAACGGGCGTTGTGAGCGCCGTACTTTTTTTCGCGCTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTACAGTGCCATTCTCTGGCCTGAACGTGCTGGGGCTGGCGGTGCTGTTTTTGCTCTTTATCGGTCAGCACTATCTTGCCAGCAATCCACAGCAGTTGCCAGGGCTGTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTTGTCGCAATACCAACTGGCAATCTTATGGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACCGGTGCAAAACTTTCTTTCGCCAGCGGATTGCGGTGATTTTTGCCCTCATCCGTGCGTTTACCCGCAGAGCATGACGCGCTCGAGGAATGCACTGGGTCGATCTGCTACGCATCCGCGTTATGGGTATGGTCCTGTGGCGTTGTTGATTGCGCTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCCAGGCTGTGATGCGTTGAAGGAGGCGGCTGTTACCCATAAAGGGCCTGGCTTCTCGGAAGCGATCAAGATGCTCTCCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAACCCAACCGCACTGACCAACTTCGTTACGCAGATGCTGGCGATCTTGATCCAACGGCGCTATTGCTTTTGCCTTTGGTGAAGTGGGCGATCGCCGCCAGGGGCGCAGCATGTTGCTGTGGGCGATGTCGGTGATTTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCGAAGTTCAGGGTAATCCTCATCTCTTGGCACTGGGCACGGACGGCAACATCAATATCGGAAGGTAAAGAGCCGTTTCGGCGTGCTGGTCAGTAACCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTAAGCGCCCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGATGAATTATTCGGCGGTGTCGGTTCTGGTCTTTACGGCGCTTGATGCTGTTTGTCCTGCTGGCGGTGTTTATTACCCGGCGGGCTGATGATTGGTCGTACGCCGGAATATCTGGGTAAAAAATCTGACGTACGCCGAGATGGCTTGACTGCACTGGCGATTCAGTTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACAGCGCCATGCTCAACCCCTGGCCCGCATGGTTTAGCGAAGTGCTGTACGCCGTCATCCGCCATAACAACAACGGCAGCACTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTGTCCGGTGATAGCAATGCCAGTTCGCTGAGTGAAAAGACCGAAGCCGCCAGCTCCGGCACGCTGCCAGCTTGCCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGATGTTGCTGGATTTGGCGCCCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCAGTGGCGAATATCTCTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAGCTGGCGCTATTCGAACCAACACTTGTCGTAGGTTAAACGCAAGCAGACGCCGCAATATCGAAAAGA
>c75c8f96-eb4b-4465-9d43-024209a6a35a
TTGCTCATTTGTACTTCGTTCAGCTACGTATTGCTACTTGCTGTCGCTCTATCTTCGGCGTCCTGCTTGGGTGTTTTAACCTCTGCTGTAGGTGCGGGAGAATAGACGGCAGCGGGCCGAACGGCCTAAGGTCCATCTCGCCAGACAACACCGCCTTCGCCCCCAGCAGCCGGATTCTCAGTTGCCCGAAGTCATCCCGCCAGACACACCAGGCACGCCACGCCAGTCGTGCCCTTGGTGCCCACCTGCCGAACCACGGGCAATGGGACCCGCCATACTGAGTCATGTATCCTCCCTGACGCGCGCTGGTTTCCGCTCATATAAGTGCCACTTTTAGTTGTGTTCATATCCTGTGTTTAGCAACAAAAAAAATGAAATGACACACAAGACCAGCTAATGTATTTATGGCCCTTTCTAAGCTTATTTGTTCTCAATCAACAACAACTGGTAATACCAGGTCACTTTCAATATTTTATTAAACTAACATTTTTAGCACAGATGAATTCATCATCAACAAATTCACTATGGATAATATCCATGCTTACTGCATATGGTTTTATGATTTTATTAATTGAGTTATTTTTGTAGAGACTATATTTAAAATCAATAAACTCCACCGGTCAGATTAATATCAGCAATAGAAGATGAAATCACCAGTTCAATAACATCATCAATGAAACATATTGTAGAATTAATTTTAAACCAAGGCGTTCATTCCAGAACGCCCTTATTTACTCTCATGCCCGCAAACTGCCTGAACAGCGCCTTACCCGCCAACCAGTCGCTTCGCACCCAGCCAGCCGCCAGCGACAGCAACGGCGGCGCTCCGCTGCACGGCAGAACAATCACAATCGCCGGTCTGGCTCACGGAAAATCAAAGCACTTTCGCGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGAAACAAATAAACGCTGGCGAACTCACACCTAACGTGGTACCGGCAATTTTCCCGCACCGAGTGCCGCCACCACCAGCTCCTGATGACGCTGTTGCATTTCCACTGCACTATTGCCAGCAACGCTTTGCGCCTGCACCAGGCGGTGACCAGTACCACCATCACTTCAGCGCCCGACTTACCTGCTCCCAGCACCTGACCGACCTGTTTTAAATCGCGCCAATATCTAACGGGCTAATGGTCGAGGAACTGGCGGATGAGTTGTGTCGGGTTAAACCACCAGCAGACGCAATATCCAGCGTAG
>40aac17d-56a6-44db-934d-c0dbb853e2cd
TTGTTATTGCTTCGTTCAGTTACGTGTGCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGGCGGGTGTTTAACCTCAGGTGCTGGCTCTGTAACTGCCGGCAGGGGAGATAAGCGATGATGAGTTCATAACGGCCGAAGCTGCAGCGTTACCACGGTACGGCGGTCGCGATTAACATGCTCCACCAGCGGGTGTGCCGCCGAGTTTCATGCCTGACGGCCAGCCGCTGCCGTGGGTCAGCCATTCCCGGCGGGCAGGCTGTCCGATATGGCCGTTCGCCGATCCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCGATCGTCTGCGGATGATGCGAATCAGGTGTTCACTGGCGAGCGGCCTTTACTATCATAACCATGGTGCACCGTCACCCGGTGCCCTTCGCTGTTATGGCTGATGTCGTCAATGGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTTCGCCGTCACGGTGCGGTGCGTGGGCAGGGTCTGCTGCTTCGATCATGAATTGCCGGTGGTGACCAGCCCCTCATCCCTCGCTGCGGATAAGTTTGCCGGACCAGGTCGTGGTGATAACGCTGTGTGCAGCCCGTCAAAAGCCGGTTTCCTGTATCATGCGGTCAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCGTCCGGCAACATCGTATTCCATACTGCGGCGTCAGACCGCCCTGCGTGGCCTGAATGGCCACGCATCATCTGTACGTTTCTGCTGCCGTCGGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTAATCATACCGCGTTTCGCCTTTCATTGTCTTTCACGACGTTAACTGTCCACGGCTTGTCGTATGCGCCGGTACTTGTCAGCCCTTCCTCGCGGTGCACCGCCGTGCCACAACCAAAACGGTCATGGTCGCAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAACGCTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGTAAGTCACTGTGGATTATCACCGCTTGGTAGCGGGTGATATCGCCCGTCAGGGGCAGTTCCTGAATCAGACGGCCCCTTCATCATATTCCCGTATTTCCAGCCGTCAGGCCCGGTGGCTGGCGTTAACTGGCTATTGGTGGTTATAGTAAAACGCCGATGCCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCCACATCCGGACTGGCTATTCTGTTGTCCTGCATGCGGCATCCGTCGCGTGCTGAGCCTGCCCACCATCGGCTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCGCGCACCCGCTTCCAGCCGCCTTCACCTGCGTGTGCGGGACTTCACGGCAGTTCCGGGCTGTCGGTGATAATTTGATGCGGTCCTTCTCATACTGATACGGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGCTAAACGGTAACAGATTTCCGGTCGGCCCGTGTGACTGATGCGCCTGTCCGGCCCGGTATTTATCATGTGGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCTGCATGATTCGCCGCGGGGCATTCAGCCATAGCGCACCAGCGCGGCGGTAAATTCTCCGAATGACCGGATTAATTGCGTCAGCCACGGCGAACGAACGGATGCCCGGTTCCGGCCATTCGACGTGTTGATGGTTCCGTCCGGTTGATCCGTGTCGGTGACATCAACAATCCATCAGATGAACGTCTCCGGTATGTTGATGCCATGTCGAACGGATGCCATCGACGTAAAGTCGTCAGTTTATCCGATCTCTTCCGGGTGAAACCGGTAATCAATCGTCATCATTTTCAATCAGTGGATATATGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACAGGTGACCACGCCGATTAGGGCACCGATGCGTACTTGGCTGAACCCTGGACGATGCTACGCCATGCCGTCGTGTCGCTGACGCGCCGGTTTTCCGCTCATCTGGCTCATCTTGTTTTGTCGGGTTGTTGTCTGCTTTGACGAGCTGAAACCCTACAGTTTATAAGAAGCCTTAAGTGGATATCTGTCCGAATAAGAACAATTGGAAAATGTTTATATATGTTTCATGAATATATGTTTCGATTGGTATAACGATGTCACAAATATTCTGAACATCTTTGATGATAAAAACCGCCAGCGTTTCGCTGGCGGTTTTAATATTATTCAAACTCGGCAATCAATAAAATCACCAGTTGCCTTTTTCGGCCTGATCCATCACACCGGTTTTATCGCTGGTTTTCGACCAGACGCGATGCGAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGACGCTACTTAACTTTCACAACCGCATAGGTACGGCGTAAAAAGATAAAATGCATGCGGGATATTCTCTGTGAGTTCATACTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTGTTTATCTGATGAAAATAGTACCGCCTTTTTTGGTAACAATTTTACTACTCGTCGACCACTTATTTTTGCTTGTTATTGTTGGTTTGTTGCTTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACGTGGTTAAATCATGGCTTTTGCCATTTTTATACTTTTTACGCACCGCCCGCGTTTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCGGTATCACTTTTTAGGCCACTGGAGTTGCACTGTGAGTGCGGGCGTGATAACCGGCGTGTTATGGTGTTTTATTACTGGGTTATCTGGTTTATGCCTGATCAATGCGGAAGCGTTCGATGGCTGCGCAAGTTCTCTGATCGCCACGTTTTTACTGATTGTTAATGGTGCTGGCGCGTCCGCTGAGCGGGCTGGCGCGGCTGATCAATATTCCTCTTCCCGGTACAGCGAGCGTTGAGCGCGTACTTTTCGCGCAAATTATGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACAATGCAGGACTGGCGGTGCTGTTTTTATGTTTATAGGTCAGCATATCTGCCGCTTAATCACAACGTTGCTGCTGTCATTGGGATCTGGCTGAATGCCGCCGTCAGCTTTGTCACCAATACTAACTGGCAATCTCTGGTGAAACCGTTGACTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGATTGCGGTGATTTTGCCCTCATCCGTCACGTTTACCCACCCAGGCATGAACGCAGCTTTCGAGATGCCTGGGTCGATCTGCTACGCATCGCGTTATGGGTGCTAGTCCTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGGCGCAACAGCTATTCACCATGGGGCCTGTGGCTTCTCGAAGCGATCAGATACTCGGTACTAACGGCGGTGGCTTCTTCAATGCCAACTTTCTGTCGCATCCGTTTGAAAACCAACCACTGACCAACTTCGATGCAGATGCTGGCGATCTTCTTGATCCAACGGCGCTTTCATGCTTTGCCTTTGAATTGAAGTGATGGGCGGAAATCGCCGCCAGGCGCATGTTGCTGTGGGCGATGGTCAGTGATTTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACGGCAGCATCAATATGGAAGGTAGAAACCGTTTCGGCGTGCTGGTCAGTAACCTGTTTGCGGTCGTGACGTGGCGGCTTCCTGTGGCGCAGTGAGTTGCGATGCATAGTTCGTTTACCGCTCACTCGGTGGCATGGTGCCGATGTGGCTGATACAGTGGTGAAGTGGTGTTCCGGCGGTGTCGGTTCCTGGTCTTTACGGCATGATGCCAGTTTGTCCTGCTGGCGGTGTTTATTTGCCGGGCTGATGATTGGGTCATGCCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCGAACTAAGTTTACCCCGACGCTGGGTGCTGATGGGCGCGTTGGCGGTATTGTCGACGCCGGACAGCCAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTGCAGCGAAGTGCTGTACGCCGTAATCATCCGCCGCTTCTTTCTTTCTTGGCTTAGCACCTTTGCCGGTTCGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTTGTCGGTCGCTTCCGGGGTATTATCCCGGTGATGGCGTTGCCGGTTCGCTGGTGAGTAAAGAGCCAAACCGCCAGCTCCGGCACGCTGCCAACACGGCCCGCTGTTTGTGGCTATTCAATCGGCACCGTCATTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCCTGATATTGAGTGAGCACTGAATATGAGTCGTAAACGGCTGGCGCTTCTGTTCGAACCAGCACTTGTCGTTCAGGCGCTGAAAAACGGTGAAAAATTAAACCCACCGGGCACAATGGCGCAATCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAACATCGCGATGGCAAGCGGGTACGTGCCGGCGCAATGCGCTGTTTAGCGCGGCCATTAATGATTGGCTGTGGATCACCCGTACTGTTCGCTAATTTCGCCGGGCGCTGGCGAAGAAGGTGTGACCTGATGAAAACAGGCCAACAGTCTGAAAGGGGTGAAAAAAAACTGCTGCCCTGAAAGCTGCGTGACCGAAATATGGCGCTGCGGCGGACAAAGTTCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTGAAGAAGCTGGCGGAGTTAAACACCCAGACGCCGAGATGGGGCACGGG
>1d5ccec9-296a-4afd-ad74-010ebd3732ec
CCGGTATGCTTCGTTCGGTTACGTAATGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTTAACCCTCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCAACAGTGCAAAACTTTCTTTCTGCCGCCAGCGAAGTTGCAGTGATTTTGCCCTCATCCGTGCGTTTTACCGCCAGAGTATGCGCTCAGGAATGCCTGGGTCGATCTGCCTACGCATCACGTTATAGATTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTTTATTCCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCGGGCTGGCGGAATACCGTTGAAGGAGCGCAACAGCTGATACCATGGGGCCTGTAAGCTTCTCAGGAAGCGATCAAGATGCTCAGTACTAACGGTGGCTTCTTTAATGCCAACTCTGTCGCATCCGTTTGAAAACCCAACCGCACTGACAACTTCGTGCAGATGCTGGCGTCTTCTTGATCCCCAACGGCGCTGTGCTTTGCCTTTAGTGAAGTGATAGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTTGTCATCTGCGTAAGGCGTGGTGATGGGCAGAAGTTCAGGGTAATCCCTCATCTGCTGGCACTGGGCACGGACCTTGGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTGCGGTCGTAACGTGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTATTTATTGCCGGGCTGATGATTGGTCGTACACCGGAGATATCTGGGTAAAAATCGGCGTACGCAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCAGCGTTAGCGATGACCGACGCGGACGTAGCGCCATGCTCAACCTGGCCCGCATGGTTTTGGCAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAGCAGCAGCGCCTTTGCCGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCAGTCGCTTCCGGGGTGATTATCGGTGATGGCAGTGCCGGTTCGCTGAGTGAGTAAAGCCAAGCCGCCAGCTCCGGCACGCTGCAACGCACGGCCCGCTGTTTTGTTGGCCCTGCCAATCAGCACCGTGTTGCTGGATTTGGCGCACGGCTTTATCCTGCCCTGGCGCTTGGTCAGTGTGGAATATCTCTCCTGATGATATTGGTGAGCACTGAATACGAGTCGTAAACAACTGGCGCTAATTCAGACCAACACTTGTCGTTCAGGCGCTGAAAGAAGAAGCGTTGAAAAAATTAAACCCGCAGGCGCAAACTAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTAATAGCATCGCGATGGCAGAAGCGGTGCGATGCCCGTAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGCAACGGATCACCCGTACTGTTCGCTAATTTCGCCGGGCCTTGCAACTGAAAGCCGCAGTAAAGCGCAGGCGACTGGTCTGAAAGGGTGAAACTGCCTTTGCCCGCAAACCGTAGGCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAAAGCCTTTGATATTATCCCCTGCGATGGTGAAGTTATTGAAGAGGGTGCATCGGTCGATGAAAAGCGCCATCACCGGGAATCGGCACCCGGTGATCCGTGAATCAGCGGCGATTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTAGTGTAGCGATTAACCCGGCAGAGACATTTCTAGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAGGCGCCGAACGAGAACGCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTACTGTAGCCGCCGCGTAATACGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTATCTGATCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGGCGTCGCCGGGATGAACGCCGGATGCTAGGCGCGAATCATGATTGCCACCAGCGGACGTGCAGTTGAAGCAGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCCATCACACTCGGTAACCGTCAGGCGTCAGGTTTGTCCCCGCGCCGGGGCGTGGATGAAAAACGCTGGCTGACACACCGCACAACTGGCTTCAGCTGGCTGATGAAACGCCGGAAGGCCGCGAGTATTGTGATCCTCATAAGCAGCGTTTTAACCTGCGCGAGGCGCGATGTGCAGTCATCATGCCACCTTTATTGCCGTTTACTGCGCAAAGCCGGATAGGCAGGATCAACATCGACAACCGCATGATCCGTAAAAGGTTCTGTCGATGCCATTCATGCCATGTTAGGCTAACCGGTGGTCACTTCCCTACCGATGTTGATCAAAAGTCGATCAGAGTTGCGCGTCAGGGGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGCTGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGGTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGCGACACCAGGTAAGCTGGCATTGATCCGTCAATATCAGGCGGAAGGTCGTTTAGTAGCGATGACCGGCGACGGCATAACGATGTCCGCTGGCGCAGGCAGATGTCGCAGTGGCGATGACTCCAGCGCAGGCGGCGAAAGGCGGGGCAATATGGTCGATCTCGACTCCGCCCGACCAAGTTGATCGAGGTGAGTGCATTGGCAAACAGATGCTGATGACCCGTGTCGCTGATACGCTTCAGCGTACCAACGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGTATCCGCAGTTAGATGCGCTGAACATCATGTACCTGCATTCACCCGACTCCGCAATCCTCCAGTGCGGTGATTTTCAACATGATTATCGTCACTGATTCCCTGGCGTTAAAAGGCGTGAGTTATAAACCATACCGCTTCTGCCATATGTTGCGCCGTAACTTATGGATTTGGTCTGGGTGGGCTGCTGGTGCCGTTTATCGAGTATCGAAGCCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTAAGGAGTTTACCATGAGTGGATTACGTCGGCATTATCAACATTTATCTTTCCGTTATTGATTACTGGCGTTTACCCGCACTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGGTGCGCGGTTCGGCATTAATCAGGCAGAATTTACCAGCAGCAGCTGTTTTCATGGTCGCCCGTCAGCAGCAGCGAGAAATGCCCTATAATCACAGGCTTCTGGCAGGAGCAATCAGCAGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCAGGCGATTCCAGTTGAACTGGTGACGGCATCGGCGGCAAGCGGGCTGGACAATAATATCACCCATAAGCGGCGGCCTGGCACAAATCCCACGCGTAGCGAGAAAGCGCGTAATCTCAGCGTTAGACAGCTCACGCAACTGATCATAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTCAGCATTATTGAACTCAATCTGGCGCTGGATAAACGATGAATAACGAACCCTTACGTCCCCATCCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGAAGGAAGCTGGATTTTCTTCGGTGCGCAATGCAGGCGTCAGGAAGACCTGGGCGTGCTGGCAGAAGCCCAGCGACTGCTGAGCGCAGGGCTGGATATTGTGGTTGGCGTGGTACCCACGGGCGAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCGCACAGTAATGCGCCAGGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAACTGCTGGGAAGCTGGCGTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGAAAGTCACAGATGATGTGGTCAGCGGCGTCACACCGGAATTCAGGTGCGGAAACCGTGCCCGATCCTTTCGATGCCGCCGACGACGTGGGTGGGTGGACTTGCCCCGGACGTCTGCGCCAGCGGCTTGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGGCAGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCCCCAGTCGCCCTGCACCCAGTGGCACTGCGCCGTACTGCCGATCGCGTTGATGAGCAAATATGCGCGCCTGGCAGGGGCGTCCTGGCGAAGAGAAGTGTAGCACACGCGCGGCCGCGATCCTTTTAATACATCGGCCCATAACACCGGCAGCGAAAAACTGGTCCGCGCGGCAGCGCGAAACAGCGTCACGGCTGGGTGGCGTCTGGCACGCGGTGGTAATGTTGAAACCCTGCCCTGCCGCTTACCGGAAAAAACGTCGAACTTCTCAGCGCCTTACGTCTGGCGCAGGAACTTTGGGCGCCCCGGGGCAACAACACTTTCCGATCAGCGGAAGAGAAAGCGGTAGTCGTTATGCCCGTGAACATAATCTCGGCAAGATTATTCTCCGGTCGCCCAGCCTCGCGCCGCTGGTGGCGATCAGTGATTTGCTGACCGACTGGCGCGCATCGCCCCCAGTCTCGATCAGGTGCTGGTCGCGCTTGATGAACCACCGCCCGCACGATTAACAACGCGCCCGGATAGCCGCTCTTTTAAAGACCGTGGCATTGTACAAATTCCGGGGATACGTAGTTGCCGCCGCGTCATGCGCCGTTATCACCTTAATTGCTGCCATTACGGTGGCTGATGGCGTTGATGCCGCCAACCTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTATGGACGCTGGCCTTCAGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATCTCTTTTTATCGCCCGCGGCACGCTCATACGTCTCTGATATGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCGGGAACCTTACTGCTTTGGCGTACGTTATCAGGCGCGGGTAGCCCGTTACCGCGAGCAACGCACGGCGCCACATATGAAATGTCGAAAGCTCTGGCGGTGGGCCGCAGTCCGCAGGATATCTGCCACCAGCAGACAATTTGTGCCTCCACGTTTCATGCCCGCAGTCAGGTGTTGTTGCCCGATGGCAGCGGTAAATTGCAGCCGTTAACACATCCGCAAGGGAATGACGCCGTGGGACGATGCCATCCTTGCAGTGGAGTTTTGATAAAGGCCTGCCTGCGGGCGCGGGCACCGACGTTACCCGGTGTACCGTACCAGATTTTGCGTAAAGCGGCGAGAAAACCTACGGGCTGGTGGTGGTGGAGCCGGGGAATCTGCGCCAGTTGATGATCCCGGAACAGCAGCGCCTGCTGGAACCGTTACGCTGTTAGTCATATCACCCTTGAGCGTGACGCTAACCGCCAGCGAAGAACAGGCGCGGATGGCAAGCGAACGTGAACCAGATCCGCAATGCCCTGCTGGCGGCGCTTTCGCATGATTTACGCACGCCGCTTACGGTGCTGCGAGGTCAGGCAGAAATCTTAACCTCGATCCTACCGGCGAAGCGAGGATCACCCGCCCGCCAGGCCAGCGAGATCAGGTAGCGTATTAACTTCTTACTACCCGACTGGTGAATAATCTACTGGATATGGCGCGAATTCAGTCCGGCGGCTTTAATTTGGGGAAGAAAGAGTGGTTAACGCTGGAAAGAAGTAGTCAGCAGCGCGCTGCCGTCTGGAACCGGGTTTATCGTCGCCCATCAATCTTTCTCTGCCAGAACCGCTGACCTTAATCCACGTTGACGGGCCTCTTTGAACGGGTGCTGATTAATCTGCTGGAGAACGCGGTGAAATATGCGGGTGCGCAGGCCGAAATTAATTATCGATGCCCACGTTGAGGCGAAAATCTACAACTGGATGTCTGGGATAGCGGCGGTCTTCCGCCAGGCCAAGACAGACGATATTTGATAAGTTTGCTCGCGGGAATAAAGAGTCGGCGGCAGTACCGGGGGTAGGGCTTGGACTGGCAATTTGTCGGGCGATAGTGGATGTACACGGGGGCACTATTACCGCGTTCAACCGACCGGAAGGTGGTGCCTGTTTTTCGTGTTACACTTCCCCAACCAAACTGCCCTGAACGGAAAGATTTCAGCGGGATATGCTTGACAAACGTTCTGATTCTTGAAGATGAACAGGCTATTCGTCCTTTCTGCGCACGGCGCTGGAGGAGGCGACGGATGCGATCTTTGAGGCCGAAACGCTGCAACGCGGCTTGCTGGAAGCGGCAACCCGTAAGCCAGATTTGATTATTCTCGATCTCGGCCTGCCCGATGGTGATGGGATTGAGTTTATCACGCGACCTGCGCCAGTGGGGCGCGGTGCCGGTGATTGACTTTCCGCACGCAGCAGAAGAGCGACAAAATCGCCGCGCGCTGGATGCCAGGCGGATGATTAGCTATCTGAGTAAAGCCGTTTTGGCGTGGCAGATGCCAGGCCCGTCTGCGCGTCGCATTACGCCGCCACTCTGCCACCACCGCGCCCGATCCGCTGGTAAAATTTTTCCGATGTTACCGTCGATTTAGCCGCCCGCGTGATTCACCGGGGTGAGGAAGGTGCATCTCCACACCAATTGAGTTCCGCCTGCTGGCGGTGCTGCTCCAACAATGCCGGAAAAATTACTCACCCAGCGCCAGCTCCTTAGCAGGTGCAGGGTTAAACCCAAGCAGACGCCGAATGGGAGCGACCAGGCAAGTAGCAATACGTAACGCA
>690186f5-a384-40a4-8aae-9a99ad2322f5
ACAGTACTTCGTTCCAGTTACGTATTGCTTTTCTGTTGGTGCTGATATTGGCGTCTGCTTGGGTGTTAACCTGGCGGCAGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCCGGACGTCGCCGCCGGGCTACCGAACAGGCCACGCCGGTGGGGGCACCGATGCGTACCCCCGGCTGAACCTGGACGAAATGCTACCGCCATACTGCGCGTCATGTCGCCCTGACGCGCCGCCGGTTTCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCAGAAACCCTACCGTTATAAGCCTTAAGTGAATATCTGTCGAATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATAACTCGCTTTCGATTGGTATAACGATATCTAAATATTCCTCTAGACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTCAATATTCAAAACTCGGCAATCAATAAAATGCGCGGTTGCCTTTTCGGCTGATCATCCACCGGTTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAGGCAGCGCCAAGACGCCCGCTGCAACCGCATAAGTACGGCGTAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGGAATTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTGCTCATCGACCACTTATTTTTGCTTATTGATGGTTTTATTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTATACTTTTACACATATACAGATTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTGCAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGATTATTATTGCTGGTGTTTTTATTGCTGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAAGGGTTCGCTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCGGTACAACGGGCGTTGAGCGCATGCTTTCGCACTTAGCGTCTCTGACCGTGGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATGCCGCCGTCAGCTTTGTCGCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGAAGTTGCGGTGATTTTTGCCCTCATCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCAGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGAGTGCTAGTCCCTGTAGCGTTTGTTGATTGCACTGTTTTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCGGGCTGTATGAATACCGTTGAAGGAGCGCAACTGCTGTTCTACATGGGCCTGCTGGCTTCTCAGAGCGATCAAGATGCTCAGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCGTTTAGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACATTAGCGCTTTGCCTTTGGTGATGATGGGCGATCGCCGCCAGGGAGGCGCATGTTGCTATGGGCGATATTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGTACTTATTGATTGCGATGCGTTCGTTTACCGCTCTCCGTGGCATGGTGCCGTCTGGCTGATACAGAATTAGGTGATGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCGATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAGCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCGTCATCCGCCGCTAACAACAACGGCAGCGCGCCTTTGCCGGGTCGCCAACTCTCCATTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGGTGATTATCCCCGTATTGATGGCAGTGCCGGTTCGCTGGTGAGTAAAAAGAAGCCAGCCGCCAGCTCCGGCACCGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCGGTGGCAGATATCTCTCTGATGATATTAGTGGGCACTGAATATGAGTCGTAAACAACTGGCGCTTCTTCGAACCAACACTTGTCGTTCGGGCGCTGAAAGAAGCTGAAGTGAAAAAATTAAACCCGCAGGCGCAATGCGGCACCAATCCGGTGATGTTTATCGTCTGGATCGGCGGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAACGGCGCGATGCCCGGCAAATCTGCTGTTTAGCGCGGCCATTAACGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGAAGGCGCTGGCGAAAGGCCGCAGTAAAAGCGCAGGCCAACAGTCTGAAAGAGGTGAAAAAACTGCCTTTGCCCGCAAACTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCACCATAAACCAACTTCGTAAAGGCGATATCGTACTGGTAAGAAGCTGGCGATATTACCCCCTGCGATGGTGAAGTTATTGAAGGGTCATCGGTCGATAAGCGCCATCACCGGGAATTGGCACAGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGCGGGTGATTGGAATTGTGGCGTTAACCCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCAGATTGCCCTGACTATCATCTTTTACTGGCAGCCGCCACGCTTTGGTAGCCGTTTTTCCGCGATGGGGCGGTAATACAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCATCTGATCCCAGCCACTGGTGGCGGCCTGTTGTCGGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAGATGTGATTGCCACCAGCGGACGTGCGGTTAGCGGAAGCGGCAGGTGACGTTGAGAGCGTTAGGTTAAACGCAGAAAAACAGACGCCGAAGATAGAAGCGCG
>c7937d7b-d85f-433b-9327-7eb293974905
CGCATTCTCGTTAGTCGATCGTATCGCTATCGTCAATCATCGCGTCGATCGATATCACGGTTGTCGCCAGCGGCGATGAGGCTGATGCCTTCCTCGCGGTGGACGCGATCATCTGGCCGAAGCGGTCGTATTCATAACGGGTCTGGTAGCCCGAGCAGTCGGTGGTACGCCAGCAACTGCCGTAGCGGCTCCAGGTCATCTGCCGGAGTGCTGCCGTCGCATCCGTTGTCGTCGCCGGTAACTCACTGTGCGCGTCATCATTGGCGGTAGCGTACTGTCTCCCCGCTGCGCGGTGTCTCCGATACCAGCCTGCGGTTCATCATATTCGGCGGCTCTCCAGCCCGTCCGGGACACCACCGCCGTCAGCTGGTTCACGTCGTTATAGTAAAATTTCGTCTCCCGCCCGTCCCGGTGTGGTGATGTCCGTGATGATATCGCCGGACACCGCATTCAGACCGTACTCTGTCCTCCGTCACGCGTCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCGTTTCCAGCCCGGCCCGCCTTCTGCAATATGCAGCACCTCACGCCGGTTCAGGCTGTATCGGTGACGGTGATGCTGATCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCAGTTGCTCCACCACCCGCCCCGTATCGTCGTAGCGGTAGCGCATCTCGGCCTTCCACGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGTCATCACGTGAAAGCGCGCACCTGCGTATTGCTGCGGTCTATACCGCCAACGGTTCACCGGCTTCCGTATGCGTGTACCCGCACCAGTGGCGCAGCGGGCAGGCTCTCGGGTATGCTGGGTCGTGCATCAGCCACCGCCGAAAGGCGGATACCCCTAATCGGGGCCGTATTCGGTACCGGGCGGTGTGTCGAGGAACGCTGAAAGGGCTGAGAGAGGGCGGGAACGCTGTCAGGAAGAAGATAGCGAAGAGGTGGGCCTCTTCCGCACGCTGCGCCTGCGTGGTCAGCACCAGGTGGAACTCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCCCCAGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAACAATCCGCCCGAAGCGGTCCGCCATCCCAGTAACACCCGGTACACGGCGGCAGCGGCGCTGGCAGTACGTCCTCGGCACCCGGCACCGCTCCAGACCACCCCGAAAGTATCACCACGGCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGAAGCAACCGGATATCCGGCGGCAGCGCCCCCACAACCGCGCCAGCGCCATGGCCATCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACGATGACTCACTGCGGCTGTACACCGCCTCCCCGGCAGCAGCGGCTCGAAGTAGATACTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCCCGGATATCAGAAAGGCGCTTTCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAACGGGCCAAGACAGCGCAAGGTCAAATCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCGCCGGACACACCGAGCACGCCACGCCGGTGGGCGCCATGGTCTTACCTGCCGAACCCTGGACAATGGGACCGCCATGCTAGTCATATCTCCTGACGCGCCCGCTGGTTTCCGCTCATATAAAGTGCCCTTTTAGTTATTGTTCATATCCGCAATGTTAGCAACAAAAATAAGGAAGCACACAAGACCATTAATGTATTTATATGTCTTTTCACGCCGACTTTATTTTGTTCTCAATCAGCAACAACTGTTATTACGGTCGCTTTCAGTATTTTATTAAACTAACATTTTGCTTTAGATGGAATTCATCATCAGCAAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAATCAATAAACTCCACCGATTCAGATTAATATGTAATAGAAGATAGAAATCGCAATTCAATAACATCATCAATGCGGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTTACTCTCATCACCGCAAACTGCACAGACAGCGCCTTACCCACCTTAACCAGTCGCGCACCCAGCCAGCCGCCAGCGACAGCGGCAGCGCTCCGCTGCACATGGGGAACAATCCAATCGCAGTCTGGCTCCACGGAAAATCAAACGCTCGCCACCCAGCACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAAACAAGCCAAGCATGGCGAATCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGGTGTGCGCCACCACCAGCTCCTGATGACGCTGACGCATTTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACACCTGCTCCAGCGCACTGACCGACCTGTTTCAAAATCCAGCGCCAATATCTAACGGGCTAATGGTCGGGAACTGGCGGTTGGTGTGTCAACATGCCGTTGCCATTCTCAGCGGAAGCGGTAAGCCAGCTCTGCGGTTGCCGTCTAATGCCCCTTCAGGAAAATAAAATAGAAATTAGGCCTGGAACTTTCCCAGTCCACTTTGCTGGGCTGGCCACTTTAGCGCGGAACTCTGGGTATCGCCCATAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCTCTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCAGACGCGTATTTTGCCAGGTAGATTGAGTTCGCGGTTAAGCGCTATCATCTTCATTACCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCCACTACCGGATAAAACGATTCCAGGACTATCTGATGTTTTCGCGAGGAACCTTTTAGCAGTGCTACCTGTTCTGTGGCGATGTTGAATTAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCCGGCGGTCGAGCAGATCGCCACCAACACCAACAGCAGTGCCAGCAGCATAAAGAGCGAAAATGCCAGCTGACTTAACGTTGACCACGGCTGACGTAACGGGCGGCTAACGCCGAGCGCAAGAGCGGCAATTTCAGCGTCATGCGGCAGAAGTACATTCCAGCAGCATCCAGCCCAGCACACCGCTGCTTTCGTAGTACTACCGCGCCCGCCAGCACCGCTAAAGCAGCATGCTGCCACCCATTAATCCGGCGAGCAACAGCACAGCCACCACACTGACAATCGGCAGATAAAACTTCCAGCAGCCAGACGTTCGCTACCACATCATTACGTAATACGCGTAAAGGCTGCGTTGCCAGCAGCAAGCGATATGGTCGTAGCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCACAGCCACGGCGAGGCTGGCTGGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTTCGAACAACAGGCCTATGGCCCGGCCCCACCGGTAACGGCTGACGTCAGCACCATCAACCACTGACCGACGATTAGCTTACGCAGTTAGCTCGCCCTGCCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACGGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAGGTCAGAAGCGCCAGCAGCAGGAACTGTTACGGCGTTCCATCGATCGCCCAGCGCGCCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTTAAGCTGGTAACAACCATTTCATAGCCGTCGAGCTGGTTCTCGTTACCCGCCCAGTTTATAACGCCAGGTGACCCGACTCCCCGGCTGCTGGCTCCGGTTTTATCGACATCCGCCAGTTCATCACATCAGACCTTGGAGCCATCTGGAAGGGTTAAAACCGGAATCCGGTTCCTGAATCACCTTCTCCGGCAATCCGCAAAGGTATCGCCCACGTCAATGGTGTCGCCCGTTTTCAGGTTAAGCAGTGCCATCAGGCGTAGGGGCCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGAGTTGGTTGCAGATCGCCATACATCGGGTGAATGTCATCCACCCGCTTTGACGTTCGCCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGGCGAAAGTCAGCTTGCCGGCTTTCCAGGCCGCGCTTTGCTTCCTCCAGCCACGCTTGCGGCACTTCGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTTGCTGGCTTATTCTCCATGCGATCGCTGATGTTGCCCAGCGCCAGCACAGGCCACCGCCAGGCTTAAGCGCCAGCCAGACAATTAATAGCGACGGCGAACGCCATTCGCGCTGGGAACCAACGTGCAATCATGCTTCCTCCTGCAACTGCCCCGTTCACCAGCCCAATGGCAGCGGTCGCAGCGCCGCCAGTTGCAGGTCGTGGGTCACCATAATCAACGTGGTGCCATGTTTACGGTTGAGGAAAACAGCAGGTCGGCAATTTTATCGCCCGTCTGGCGGTCAAAGGTTGCCGGTTCGTCGGCAAACAGCATCAGGTCGACCATTAAAGGCTCGTGCCAGCATATCTTCCTCGTTGCTGTTCACCGCTGGAAAGCTGTGCCGGAAGATGATCAGACGTTTACCCAGCCCTAACTGTTTCGAGCAACGCTTTCGCCCCGTTACGACTTTCCGCTACTCTCCACCGCGCAGCAGGCCAGGAAGCTCGACGTTTTCCAGCGCGTTAAGGGTAGGAATTAACATAAATGACTGAAAAACAAAGCCGACGTGCTTCGCGCTTAACTTTGCCCGCGCTTCTTCGTCCATATTATGTGGCGGTTGTCCCTGGAGCTCACTTCGCCACTGCTGCCGTCATCAAGCCCGGCGAGGATCGCCAACAAGGTTGACTTACGATCCCGACTCGCCCACCAGTGCGATGGTCTCGCGCGTTTGACAACCAGCTCAACTCGGTGAGGATGGAGAGTTCATACTCCCTGACCGACGGACTTCTTAAGATGATGAACTTCAACAATGTTTTCGGCATTTGCCCTTCCTGTTCCTGGTCCTGTTAACCTTCCGTGCCGCCGCAGCCGTTATTGATTCTGGGTGATAGCCTGAGCCGGGTATCCAGATGTCTGCCAGCGCTGGCCTGGCCTGCCTGTTGAATGATAAGTGGCAGAGTAAACGTCGGTAATTAATGCCAGCATCAGCACGGCGACACCTCGCAACAAGGACTGGCGCCTTCCGGCTCTGCTGAAACAGCATCAGCCGCGTTGGGTGCTGGTTGAACTGGGCGGCAATGACGGTTTGCGTGGTTTTCGGCCGCAGCAAACCGGTGGCTGCGCCAGATTTTGCGGATGTCAAAGCGCCAACGCTGGACATTGTTAATGCAAAATACGTCTGCCTGCTGACGCTATGGTCGCCGTTATAATGAAGCCTTTAGCGCGCCATTTACCCCAAACTCGCCAAAGAGTTTGATGTTCCGCTGCTGCCCTTTTTTATGGAAAGGTCTGCCTCAAGCCACAATGGATGCGGGATGACCCAGGTATTCATCCCAACCGCGACGCCCAGCCGTTTATTGCCGACTGGATGGCGAAGCAGTTGCAGCCTTTAGTAAATCATGACTCATAAAGCAACGGAGATCCTGACAGGTAAAGTTATGCAAAATCATTAATTACCGGATGTTCCAGTGGAATTGACACCAGAGCGCTCGAATTAAAACGCCAGGGTTTTCATGCTGGCAGGTTGCCGGAAACCGGATGATGTTGAGCGCATGAACGGCATGGGATTTACCGGCGTGTTGATCGATCTGGATTCACCAGAAAGTGTTGATCGCGCAGCAACGAGGTGATCGCCTGACCGATAATTGTCTGTATGGGATCTTTAACAATGCCGGATTCAGCATGTATGGCCCCTTTCCTGCATCCAGCCCGTGCGCAGATGGAACAGCAGTTTCCGCCAACTTTTCGGCGCACCAGCTCTGTGCGCCTGTTACCCGCGATGTTACCGCACGGTGAGGGCGTATTGTGATGACATCATCGGTGATGGGATTAATCTCCACGCCAGGTCGTGGCGCTTACGCCGGCCAGTAAATATGCGCTGGAGGCGTGGTCAGATGCACTGCGCATGGGCTGCGCCACAGCGGAATTAAAGTCAGCCTGATCGAACCCGGTCCCATTCGTACTCGCTTCACCGACAACGTCAGCCAGACGCAAAGTGATAAACCAGTCGAAAATCCGGCAGCCGCCCGCTACGTTGTTGGGACCGGAAGCGGTGGTGGACAAAGTACGCCATGCTTTTATTAGCGAAGCCGAAGATGCGCTATCCGGTGACGCTGGTGACCTGGGCGGTAATGGTGCTTAAGCGCCTGCTGCCGGGGCGCGTAGTGGAGGTTAAACGCAAGCAGACGCCGAAGATAGAAACGT
>c65d1bb9-c11b-4d4e-bba5-c821e0eb7758
TTGGTGTGCTTCGTTCTGATTACGTATTGCTTTTCTGTTGGTCGCTGATATTGCGGCGTCTGTGGAGGTGTTTTAACCTGATGGCCGGACGTCACCCGCCAGGGCACACCGAACAGGCCACGCCAGTGGGGGCACTGATGCGTACCCAGCTGAACCTGAACAATGCTACCGCCATGCCGTCATCGCCTGACGCGCCGCCAGTTTCCGCTCGTCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGTAGGCGAAGCCTAGTTATAAAGAAAGCCTTACGGTGAGATATCTGTCAGATAAAGAACAATGGGAAAATATTTATACCTGTTTCGCTTAGATATATGTTTCGATTGGTATAACGATAATACAAATGTTCCTCTGACATCTTCACCGGTACAAAACCGCCAGCGTTTCCGCTGGCGGACAATATTCAAAACTCGGCAATAATAAATCACGGATTGCCTTTTCGGCCTGATCCATCCCTGGTTTATCGCTGGTTCAATAGACGCGATACGGAAATGCCTGTAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCACAGGGTATGCACAACCGCATAAGTGCGGCGTAAAGATAAATACAGGAATCTTCTCTGCAGAGTTCCGCCTTTCTCCCCCTTGCATCCTGCGGTGGAATGGCTGGAAAAATGAATTGTTTAATCTGATAGAAAACCAGTACCGCCTTTTGTGTAATTTATACTCATCGACCACTTATTTTGCCATTAGAGTAGTTTATTTACATTCTCATCCCGTAAACAAGACACAAAGTTAAATTAATACTAAACATTAGTTGAAATCATGGCTTTGCCATTTTTGTACTTTTACACCCCGCCCGCAGACTTTTTGCAAATCTTTACGTAATTCCTTCAGTATACTTTTAGGCCACTGGAATTTTTTCGGGGTACAGGCGTGATATTGACATGTGCTGATGTTTTTTATTACTGCGGGTTATCTGGTTTATGCCTGATGATCAATCAGAAGCGTTCAGTGTGGCTGCGCAAAGGTTCTTCACTGATCGCCACGTTTGATTTTTTACTGGTAATTGGCGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTTTGGCGCAGCAATTATATTCCTATCTTCCCGGTACAACGACGTTGACGCGTACTTTTCGCGCACTTGGCGTCTCTGACGTGAGAGATGAACTGGAAACAATATCTTTGTGCGCCATTTTCTCGGCTGAGCAACACCGGGCTGGCGATTCTTTTTATGCAACGGTCGGCACTATCTGCCGCTTAATCCCCAGCAGTTGCCAGGGCTGTCCGTAGGATCTGGCGCTGGAATACCGCCATCCAGCTTTGTATTCACCCTTCTTCGGCAATCTTATGGCGGTGAAACCACGTTGAGCTATTTCAGCGAAACCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCCAGTTGCGATTTACCGCCCTCTGTCGTTTACCCGCCAGAGCATGAAACCACTCGAATGCCTGGGTCGATCTACGCATCACGTTGGTGCTGGTCTGGCATTGTTGGTCAGGTTCAGCTTACCCGAAGCAGACGTCGAGAAGATATGACCGCA
>0d624d4b-671f-40b8-9798-84f2ccc4d7fc
CTCTTCAGTATTACTTCGTTTCAGTACGTATTGCTTCTTGCCTGTCGCTCCTATCTTCGGCGTCTGCTTGGGTGTTTTAACCTCGGCTCCAGGTCATCTGCCGGGTGCTGCCGTCGCATCCGTTGTCGTCGCCGGTAACTCACTGTGCGCGTCATCATGCTTGATGGCGATACTAATCTCCCCATGCGCGATGTCTCCGATACCAATACTGCCCGGTTCATCATATTCCGGCAGCTCTCCAGCTGATCCAGGACACCACCGCCGTCAGCTGGTTCCGTCGATTATAGTAAAATTTCGTCTCCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACGTACTCTGTCCTCCCGTCCCGCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCGCTGCGCGTGAGCGCGCATCCGCCAGTTCTTTTTTCACCGTTTCAGCCCAGTACACGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGGTCCTGCTCATAAAGATAGCGGTAAGCAACCCTGCAAGGTTCAGTTGCTCCACCACCCGCCCCGTATCGTCGCGGTGGCATCTCCGGCTTCCCGCGTAACGGTGCGCCACCATCCGGCCGGGTGCTGCGCGTCATACGTGACGCGCACCTGCGTAATGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATGCGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCAGGTATCAGGTCGATTGCATCAGCCACACCGCCGAAAGGCGGATACCCTGTCAGGGCCGTATTCAGTACCGGGCGGTGTCGGGGTGCTGAGGCTGAAGGTGGGAACTGTCAGAAGAAGATAGCGAAAGAGGTGGGCCTCTTCCGCGCTGCGCCTGCGTGGTCTTCAGACGGAACTCCCGCCCGGCACCGTCCGTCGCCGGTGATTCCCCGGCCAGGTCTGGCGGCCTCACGCCGGTACGTCAGCGTCAAGCGGTCGCCATCGGTAAGCACCGAGGTACGGCAGCAGCGGCGCTGGCAGTACGTCCTCAGCACCGGCACCCGCTCAGACCACCCCAGTATCTGGCCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCTTAACCGGATATCCGGCAGCAGCGCCCCTGGCACCGCGCCAGCCTGTAGCCGTCCGGCTGGCTTGCCTTACCACCGCGCACCAGCCACATTGACTCCTGCGGCTGTACCGCGCCTCCCCAGCAGCGGCGGCTCAGAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAGCGGATATCAGAAGGCGCTTCCAGCCGGGGCCGAAAGCGCCCACCGGTACAAGGCGTCTTCGTCCGGTAACTGCTGTAGGTGCGGGAAGATGAACGGCGGCAGCGGGCCGGGCAACGCAAGATCCCGTCTCGCCGGGCAGCACCTTCGCCCCAACAGCGGATTTACCGGGTTGCCAGAAGTCATCCCGCCCGGACGCACCGAGCACGCGCCACGCCAGTGGGCGCCTCAGTCACCACCTGCCGAACCCTGGACAATGGGACCGCCATGCTGAGTCATATCTCTGACGCGCCGCTGGTTTTCCGCTCATAAAGTGCCTTTTGGTTATTGTTCATATCCCTGTGTTGGCAACAAAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTTCACATAAACTTATTTGTTCTCAATCAACAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAGCTAACATTTTAGCACAGATGAATTCATCATCAACAAATTCACTATATGGATAATATCATTCAGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCACCGATTCAGATTAATATCAACTTAATAGAAAGATAGGAAATCACCAATTCAATAACATCATCAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAGCCAGAACGCCCTTATTTACTCATCACCGCAAACTGCCTGAACGGCGCCTTGCCTTAACCAGTCGCGCAGCCAGCCGCCGAAAAGCGACAGCAGCAGCGCTCCGCTGCACGGCCGTTTTCAATCCACAATCGCCAGTCTGAAAACCACGGAAAATCAAAACCTTTCGCCTGCAACTGCCAGCGCCGTTTCCGCGCAATTGCGGCCACCAGACCGAACAAAGCCAAGCGTGAACTCACACCCTGGCGTGAGCACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTTCCCACCTGCGCAATGCCCTTAGCAATAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCAGCGCCCGACTTACCCTGCTCAGCACCTGACCGACCTGTTTTAAAATCAGCGCCAGTATCTAACAGGCTAATGGTCGGGAACTGGCAGTTGAGTTAATGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTGAGTAAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCTTCAGGGAAAATAAAATAGAAATTAAAATACCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGCAACGTTTAAGCGTTTTCGCCAGCCCCTCTTCATCGATACTTCATCGGCTTTTGGCGTGAAGTTACCGGCGACAATCGGATTATAGATCGGGCCGCGTATTTTGCCAAATTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTACCTTCTGTCGGCTTATCGTTAATCGCCCGTCAGCCGCGCCGCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAACGCACAGCGGTGCTACCTGTTCTGTGGCGATGTTAATTAAAAATGGTTCGGGCTTTCTGGAAGTAGCTGCTGCTGCCGGCAGTCGAGCAGATCATACACGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGCGAAAATGCCAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCAGTAACCGCCAGGCGCAGAGGCAGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCACAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAACGGCGTAACGCCGCCCATTAATCCGGCGAGCAGCAGCACAAACCTACGCGGCGTCGGCAGATAAAACTTCCAGCGGCCAGACGTTCGCTGCCATCATTACGTAATACGCGTAAAGGCTGCGTTGCCAGCAACAAACGATATGGTCGTAGCCCGCAGCGAGATGACCGTCATGGTGCCAAAGCGCCCAGCCGGTAGAGGCTGAAACTGGCGGTAGTGCAGCAGGCAGAGCGGGCTTGAGCAGCACCATCAACACGTTTCGAACAACGGGCCTATGGCCTGGTAACGGCTGAAGCGTCAACTGCATCAGCCACTGACCGACGATTGGCTTACGCGGTTCATCGCCCTGCCCCCAGCGTTTGAGGATCATACCAGATCGTAGCGGCTGCGACAGTAATGATGATTCATCGCTACCGCCACCGCTGCCACTGCCAACCCAGCAAGGTCAGAAGCGCCGAAAGCAGCGGGGTTAAACGCAAGCAGACGCTTACCCAATATCCGGCAG
>d4402dd6-1f80-4d82-9ce1-f4e7326e5054
TTGGTACTTCGTTCAGTTATTGCTACTTGCCTGTATCGCTCTTCGGCGTCTGCGCGCGGGTGTTTAACCTCACCGCTTCTTTCAGCGCCTGAACGACCGACTGTTGAATTCGGAATAGCGCCAGTTGTTGTTTACGGCGGCTCATATTCGGTGCTCACTTCAATATCATCGGGAGAGAATGTCTTCGCCGGTGCCGAACGGGGATAAGGTCACGGTGCGCCAACCAACGCAGGTGCCCGGTCGCCAGGCTTAATGGCTGTAGGCCGTCCGTTGTGATGCCGGAATGGCAGCAGCTCTTTTGCACCACCAGCAGATGCGGCAGACGTTGCCATCACCGGGATAATCACCCGAAGCGACCATTCATAAACATGCAGAACGCCAAACGGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCATTGTTGTTAGCGGCGGATGACACGGCGATACCGCCGCCCTTCGGCTCATGCGGGCCAGGGTTGACATGGCGCGTCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCCAGCACAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCGGTTTCATCTCGCGTGCGTCGATTTTTTTTACCCAGATATTCAGTGCGACCAATCATCCAGCCCGACAATAAGCTTACACCGCCAGCAGGACAAAACTGGCATCATGCCGTAGGGCGAACCGATACCGCCGAACACCACTTCGCAATTTGCATCGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCTGCATCCTGTCACCGCGCCACGAGCCGCAAATCGTCACGACCTGAAGCAGGCTACTGACCAGCACGCCAGGCAGCTCTCTTTACCTTCCATAAACGATGCTGTCCGTGCCCCGATGCCAACGAATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCGTGACATCGCCCACAACATGCGCCTGGCGGCAGCGATCGCCCTCACTTCACCAAGGCAAAACTGGCGCCGTTGGGATCAGAAGATCGCCAGCATCCTGCACCCGAAGTTGAAGTCAGGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCGTTAAAGAAATACCGCCGTTAGTACCGAGCTTATCTTGATCTCGCTTCCTGAGAAGCTGCCAGGCCCCCAGGTAACAGCTGTTGCGCTCCTTCAACGGTATTACAGCCTGACGGGCAGAAAGTTTTACGCGCAGCGGTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAACGCACCCATAACGTGATGCGTAGCAATGCTGGCGATGTCGCTGCACGGATGAGGGCAAAATCACCGCAATCCGCTGGCGGCAGAAGAAGTTTGCACCGTAAATGGCCCGCCGCTCCTGGCTGAAGCAAGCTCAACGTGGTTTCACCGCTATGGATTGCCAGTTAATTATTGGTAATAATGACGGTATTCAGCTTCAGATCCCACGACAACCTGGCAACTGCTGTGGATTAAGCGGCGAATAGTGCTGACCGACAACATAAAAACAGCACCGCCAGCCCCAGCATGTTGGGCCGAGAATGGCACAAAGATGTTAACCAGTTCATCTCACGGTGGGAACCAGAACGAAAAGTACGCGCTCAACGCCCGGCCAATACCGGGAAGAATGTCATTAATCAACCGCGTGCTGCTAAAAGGACGCCAGCACCATTAACACCAGTAAAACGTGGCGATCCAGTAGAACCCTTGCGCAGCCATCAGAACGCCTCCATTGATCGGGGGCGCCAACCAGATAACGAAAACCACCATAATACGCCGGTTAGCGCCTGCGCCACCGTGCCTCCAGTGGCCTAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCACTGCAAAAATCTGCGGGCGGTGTAAAAAGTATATAAAATGGCAACCATGATTTAACAATGTTTAGGTATTAATTTGCTTTTGTGTAGCAATTACAGGATGAATATGAATATCAATAAGCATAAAGTGGTCGGATGGTAGTAAATTACTGCAAAAGGCGGTACTTATTTCATCAGATAAAACAAATTCATTTTTCGGTGCTTCGCAGGTAGATACAAGGAGAAAATTGTGGAACTCTACACAGAGAATATCCTGCATGGCTTATCTTTACGCCGTACTTATACGGTGCAGCGAGCGTTCTGGCGCTGCCTTTCATCGCTTTCTGGAAAGACCGCGCCCGCTTTTACCTTCTGCCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGCTGGATCGAACGAAAAAGGCAACTGATTTTATTGATTGCTGGATTTTGAATACGTGTTGAAAACCGCCGAAACGCTGGCGGTTTTCAAAGATGTTCAAGAGGAATGGCCCGAACATCGATTATACCAATCGAAACATATATTCATGAAATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATAATACTCGCTTAAGGCTTTCTTATAAATCTCGCGGGTTTCGCTAAGACAAATAACCGTCGAAAACAAGGATGAGCAGATGAGCGGAAAAACCAGCGGCGCGTCGAACATGACGCAATGCGCCAGCGTGTAATCCGAAGAGTTCAGCCGGGGTATCGGTGCCCCGGCGTGGCCTGTTCGGTGTGCCCGGCAGTGACGTCAGCCATCGGTCAATCCGCTGCTCGATTACCAGGTCCTTCCCGGTGAAACCGGCATCTTCTACCCGGCCGCTGCCGTTCATTCTCTCCGCACCTACAGCGGTTACGGACAAAAACGCCGCGCCGGTGAAGAGCCTCGGCCCCGGCTGGAAAATACTGCAGACAATCGCTTGGCTGCGCGATAACACGCTGATATCCGGCGGTGATTAACGGCGGCAGAAAGCCTGTATTTTGAACCTGTTTCCGGTGAGGGCGGTTGGCCGCAGCGGGTCGCGCTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGCTGAAGGTCACCTGGCCACTCTGGCGAACCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACCGCCAGTCCGCAGGGGGCCGTGGTGGCTATCGGCACCAGGTAATGAGCGAGTGCCGGAAAGCGGATGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGATAGCCGGGCTGGTGGACCGCTTCGGGCGCACAGACGTTTACGCCGCAAGCCGCCATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGGCAATGCGGCTGGTACTGCCTGATACACCAGGCGCAGCGGGCAGAAGAAGCCCAGCAGCAGACCATTTCCGGCAGGACGGAATATAACTTTTCACAATGCCTGCCGGGTTACACCGAATATGTGGCAGGACAAGCGGCATCCGTCTATGCCGTGTGGCTGTGCGACCCGGAATACCGGAGAATTTGCCATACCGCGCCGCTTTGGTGCATATCGGCTGGACGCCCGCAGCGAACTGGCGGCGGTGTATGACCGCAACAATACACAGGTGCGCAACTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGTACCTGCCGTCCACGGGCCGACCGGAAATCATTACCGTTACGACGGCGACAGCGGGCGGGTGACCGAACAGCTAACCGGCAGGCTTAAGTTACGTATCAGTATGGATAACCGCATCCGCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCGCACGCAGGGTGAAGGCGGAACAATGGTGAAAAAGGAACTGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCGAACTCTCGGGGCACAGACGGATGCGCAGGCAGGATAACAGAATACAATGATCCGGATGTGGTGACGGGCCTCATCGCATCACCGCACACTCCGGATAAGCGGGGCATCAGCGTTTATATCTTTAATAGCCAGTTAACGTCGGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCTGACGGCGATATCACCCGCTACCGTTAGATAATCCACACAGTGACTTACCTGCGCAACGGAAGATGCCACCGGCAGCGGAAAACCATGACGTGGAGCCGTTACGGGTGCTGAGTACTGACTGTTCAGTTGTAACCGCTGACCATGACCGTTTTGGTGGAAGTGACGGCGGTGCACCGCGAGGAAAGGCTGATCAGTATTACCGCGCCACGACTAGCCGTGGACGGTTAATTTGCGTGAAAGACGCAGGGCCGCGAAACGCGGTATGAATACAGCATACCGCCGGTGACTGACCACCGTCATTGCCCGGACGGCAGCAAAGCGGGACACAGTACGATGCGTGGGGAGAAAACCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTGTATGGAATACGATGCTGCGGACGATCACCCTGACCAGCGTGAAAACAGCAGCCACACCGCCTTCGTTACGATGTACTCGACCGGCTGTTGGAAACCGGCGACGGCCGCACACAACGTTATACCACGACTGACCGGCAAACTTATCCGCAGCGAGGATGGGGGCTGATCACCCTAACATATGACGAAGAGCAGACCGCCTCACGCACCGCACCGTGAATAGCGAAACCGGTAAACGCGTATGACGAACGCGGCTGGCTGATGAACATGTCAGCCGCCATCGGCGAAGGAACACCGGGTGACGGTCTATGGTTATGACGAAGTAAAGGCCGCCTCGCCGGTGAACACCTGACGGTTGCATCCGCAAGACGATGAACTGTACTCACGGCGGCGGACCTTGAACATGCGTACAACGCACGGGACTGACGAACCGCTGTATACCGGACAGCCGCCGTGGAATGGCTACGACCTACGGCAGCGGCTGGCTGTCGACGCTCAAACGTACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGAAACGCTGCGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCTGCCGAGCGGTTACAGAACCAGCACCTGAACAGCCTGCTGTCTGATACGATTACACCTGGAACGATGACGCTCATCCCTCAGCAGCCGCGCCAGACCGGGTTACAGCTTCTGGCACCACCAAACAGGCAGGCCGGCGTTCTACACCACAGCGAATCTGGATATCCGCATCCCGTATGCCACAACCCGGCAGGTAACCTGCCGAGCCAGAACTGCGCGGACGGCGCCCTCAGCGACAATGACCGGATAACCGTATCTCGCCCGTGACGCGCACTATCTTTACCGGTAGCATGACCGTCACGGCAGGCTGACGGAAAACCGACCTCATCCCGGAAGGTTATCCACGCACGGATGATGACGCACCCACCGGTACCATTATTACGACAGTCAGCGCTTCGGCCGGTGCACCGCAGACCTAATGCCGACCGCTGGTCGAAAGTCGTATCTTTACGTCCGCTGGGCGCAGGGTGGCAAAACGGGTATAATGGCGAGGTTAAACGCCGCAAACGGACATATGCCGAAGATAGGCGG
>723b3ed8-ede7-42bd-89c3-d269619eea3d
TTGTTGTACTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTCTATCTTCGGCGCGTCTGCTTGGGTGTTTAACCTTGCCGATCAGCGGAATATCAATACAACAATGCATACAGCTGGCGGCGATACTTCGACGCCAGTGCATCACCCGTACCCAGCGCAGGGATCTCCTGGAACGTTTTACGCGTCTGACCGTCTGCGGCGGTAGAGATCTTTACGCAGATGCCGAACAACAACTCCAGCGCCTCTTCATTGCGCCCAACCTGATGCAGTTGCAGCGCCCGGTTTGCGTCGCCAGTGCGGCATCTTCTGGATCTCCGCCACCTGCTGTTACAGCTGTTGAGATTTCCGGCGTATCAGCCGCCTGCTGGCACCAGTTCGGTTTGCGCCACCAGCCCCTGGCTGTAGGTGTCCTGATCCTGCAACGGAATGGTTTTCCAGCACCGCTTCCGCATCTTCAGAACGGTTCAGCGCAATCCAGCGTTTCTGCCAGCAGCAGGCCGATCTCCCCGTTCTGATTCGACAACTGCCGGGCGTCTTTCAGCAATAGCGGGGCATCGGTGTAATTGCTTTCCTGCATCAGTTGCATCGCCTGCTGCGCTTTCATTCTTCTTCGCGCAGCAGCACTTTATCCAACAGGGCGCGGATCGCCTCTTCCGGTTGCGGGCCTGGAAGCCATCCACCGGTTGCCGTTCTGGAACCGAATGCACGAGGTCGGAATCGCGCAGACCAAACTGCGCGGCAATCATCTGCTCCGTCGCAGTCAACTTCGCCAGAATAAATTGCCCGTTGTACTGCGCCGCGAGGCACCAGGAGTAGGTTAACTTTACCGTAGTGCTGGCTACGTTCAGACCAAAATAGAACAGCACCGGAGTGGTCATCGACTGTTCAGAACCTGTTGCAGGTTAGATTCGTTAATGTTGACAATATTTTCTACGGACATGGAGTCGCTCTCTGTTGTCGATATTTTCTTTGACATGGGGGCTTAAGCGCGCGCTTCAACTCACCTGCAATATTTTGTCCATCACGCGCCCCGGCAGCAGGCGCTGCGCTTTCATTACCGCCCAGGTCACCAGCGTCACCGGATAGCGCATCTTCGGCTTCTCGCTAATAAAAGCATGGCGTACTTTGTCCTACCGCTACCGGTCCCAACGTAAAGCGGGCGGCGATGCCGGGATTTTCGACTGGTTTATCACTTTTGCGTCTGGTTGACGTTGTCGGTGAAACGAGTACGAATGGGACCGGGTTCGATCAGAGCTGACTTTAATTCCGCTGTGGCGCAGCTCCATGCGCAGTGCATCTGACCACGCCTCCAGCGCATATTTACTGGCCGCGTAAGCGCCACGACCCGGCATTGAAGTTAATCCCATCACCATTGATGTCATCACAATACGCCCTTCACCGTGCGGTAACATCGCGGGTAACAGGCGCATGGTGACGCTGGTGTGCGCCGAAAAGTTGGCGGAGAACTGCTGTTCCATCTGCGCACGGCTGATGTTAATTGGAAAGGGCCATACATACCCGAATCCGGCATTGTTAAAGATCCCATACAGGAACCAGGTATCGGTCGGGGCGATCACCTCGTCGGCTGCGCGATCCAGCACTTTCTGGTGAATCCAGATCGATCCAACCGCGCCGAGGCTGGAATCCCATGCTGTTCGTACGCTCAACATCATCCGGTTTCCAGCAACCTGCCAGCTTTACTTAAGAAAACCCTGGCGTTTTAATTCGAGCGCGCGCTTTCCAGGCCAATTCCACTGGAACATCCGGTAATTAAGACCGATTTTTGCATAACTTTACCTGTCGCGGGATCTCCGTTGCTTTATGAGTCATGATTTACTAAGGCTGCAACTTTCTTCGCCATCAGTCGGCAATAAACGGCTGGGCGTCGCCAGTTGGGATGAATACCGTATCCTGCATCCCGGTAATGGCAAAGTGGAGCCTCTTCCATAAAAAGGGCAGCAGCGGAACATCAAACTCTTTGGCGAGTTTGGGGTAAATGGCGCTAAAAGGCTTCATTATAACGGCGACCATAGTTTGCAGGCAGACGTATTTGCATTAACAATGGTTCAGCGTTGGCGGCTTTGACATCCTGCAAAATCTGGCGCAGCGTTTGCTCGGTTGCTGTGGCTGAAAACCACGCAAACCGTCGTACCATAGTTCAGCCAACAACGCGGCTGATGCTGTTTCAGCAGAGCCGGAAGGCGCATGATCCTTGTTGCAGGTGTCGCCGCTGGTACTGGCATTAACTACCGACGTTTTTACTCTGCCGCCCATCATTCAACAAGGCCAGGCCAGGCCGCGCTGGCAGACATTCGATACCCGGCGCTCAGGCTATCACCAGATCAATAACGTGTCCTGCGGCGTACGGGAAGGTGCTGGGACCGAAGACAGGAAGGGCAAATGCCAGCGGAAAACATTGTTGAAGTTCGTCATCTTAAAGAAGTCCGTCGGTCGGGAGCATGAACTCTCATCCTCACCGGAGTTGAGCTGGTTGTCAAACGTGGCGAGACCATCGCACTGGTGGGCGAGTGGGATCGGAAATAAATCAACCTTGCTGGCGATCCTCTCGCCGGGCTTGATGACGGCAGCAGTGGCGAAGTGAGTCTGGTGGACAACCGCTACATAATATGGATTGAAAGCGCGGGCAAAGTTGCGCGCGCGAAGCCGTCGGCTTTGTTTTCAGTCATTTATGTTAATTCCTACCCTTAACGCGCTGGAAAACGTCGAGCTTCCGGCTCTGCTGCGCGATGAGTAGCGCGGAAAGTCGTAACGGGGCGAAAGCGTTGCTCGAACAGTTAGGGCTGGATAAACGTCTGGATCATCTTCCGGCTTTAGCTTTCCGGCGGTGAACAGCAGCGGTAGCGCTGGCACGAGCCTTTAATAGTCATTCCTGATGTTATTGCTGTTTGCCGACAGACCCACGGCAACCTTGACCGCCAGACGGGCGATAAAATTGCCGACCTGCTGTTTCCCTCAACCGTGAACATGGCACCACGTTGATTATGGTGACCCACGACCTGCAACTGGCGGCACGCTGCGACCACGCTGCTTACGGCTGGTGAACGGGCAGTTGCAGGAGGAAAGCATGATTGCACGTTGGTTCTATGGCGCGAATGGCGTTCGCCGTCGCTATTAATTGTCTGGCTGGCGCTAAGCCTGGCGGTGGCCTGCGTGCTGGCGCTGGGCAATATCGGCGATCGCATGGAGAAGGGCTTAAGCCAGCAAGAAGCCGTGAAGTTTACTGGCGGGCGATCGGGCGTTGCGCAGTTCACGCGAAGTGCCGCAAGCGTGGCTGGGAGGAAGCGCAAAAGCGCGGCCTGAAAGTCGGCAAAGCTGACTTTATACAATGAACCTTGCAGGCGACACACCGCGGCTGGCGAACTTGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAATAATCCCTGGCCTGAAACCGCAGGCGGGCAGCGTATTACTGGCCCCACGCCTGTCGCTTTCTTAACCTGAAAACGGGCGACACCATTGGCGTGGGCGATGCCACCTTGCGGATTGCGGAGAAGTGATTTAGGAACCGGATTCCCGGTTTTAACCCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGAACCATACGGCCGGAGTCGGGTCACCTGGCGTTATAAATTCGGCAACAGCGAGGCCAGCTCGACGGCTATGAGGAAATGGATTTGTTACCCCTCAGCAAAGCCCGAACAACGCTGGTACGGTCTGGAACAGGACGAAGAGAAGGCGCGCTGGGGCGATCGATGGAACGCTCACCAACAGTTCCTGCTGCTGGCGCTTCTGACCCAGCACTGCTGGCAGTGGCAGCGGTGGCGGTAGCGATGAATCATTACTGTCGCAGTCGCTGATCTGGTGGCGATCCTCAAAACGCTGGGGGGCAGGGCAGGCGCAACTGCGCGTAAGCTAATCGTCGGTCAGTGGTTGATAGTGCTGACGCTTTCCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAACGTGTTGATGGTGCTGCTTCCGGCCGTTCTGCCTGCTTTACTACCGCCAGCCAGCTCTGTGGCCGTGGCGCTGGGCGCCAGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATAATCGCTTGTTGCTGGCAGCGCAGCCTTTACGCGTATTACGTAATGATGTGGTAGCAGAACGTCTGACCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCCAGTTAATGGGTGGCGGCATGCTGCTTTGGGCAGTGCGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGGCTGGATGCTGCTGAATGTATACTTCGCCGCATGACGCTGAAATCGCTGCCTCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAATTGACTTTCGGCATTTTCGCTCTCCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCAAGAAGCGAACTACTTTTTAATTAACATCGCCACCAGAACAGGTAGCACCATAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGGTGGTGCGGGCGCGGCTGACGGCGATTAACGATAAACCGACAGAAGGTAATGAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCAGCCCGATCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCAAACGTTGCCCTCGATGATACCGTGACTTTATGGGCGATACCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTTATTTTCCCTGAAGGGGGCATTAGACGGGCAACCGCAGAACTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATTAGCCTGTTAGATATTGGCGCGATTTTGCAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGGTGGTACTGGTCACCGCCTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCGGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGAAAAACTGCTGCATTACCACGTTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGAATGCGGAAACGGCGCTGGCAGTGTGTTACAGGCGAAAGTGTTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCAGGCGCTACTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAAGAGAGTAAAGGCGCTGTTCAGGCAGTTTGCGGGGTGATGAAGTAAATAAGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAATATGTTTCGTGATGATGTTATTGAATTGGTGATTTCCTATCTTTCTATTGCTGATATTATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAAATAACTCAGACTAATAAATCATAAATCATATGCGTTGAATGGATATTATCCATATGGTGAATTTGTTGATGATGAATTCATCTGTGCTAAAAATGTTAGTTTAATAAAATATTGAAAGTGACCTGTAATAACCGGTTGTTGATTGAGAACAAATGGTTATTAATGAGAAAAATATATAAATACATTAGCTGGTCTTGTATTGTCATTTTATTTTTTGTTGCTAACACAGGGATATGAACAATAACTAAAGGGCACTTTATAGAGCGGAAAACCAGCGGCGCGTCGGGAGATATGACTCAGTATGGCGGTCCCCATTGTCCAGGTTCAGCAGGTGTAAATTGGCGCGCCCACCGGCGTGGCGTACTCGAAGTGTGTCCGGGCGGGATGACTTCAGGCAACCCGGTAAATCCACTGCTGAGGCAGAAGGTGCTGCCGGCAGGACGGACCTTACGCTGCCAGCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAGACATGCACCGGTAGGCGTTTTCGGCCCCAGCCTGAAGCGCCTTCTGATATCCGCTTTACAGCTACGTGATGACGGACTGATACTCAACGACAACGGCGGGCAGACATTCACTTTGAGCCGCTGCTGCCGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAGGCAGCACAGCCGGACGGCCCATACGCTGGCGCGGCTGTGGGGGCGCTACCGCCGGATATCCAGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGTGGATACTGGGGTGGTCTGAGCGGGTGCCGGGTGCCGAGGACGTACACCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCAGGCGGACGCTGACGTACCGGCATTGAGGCCGCCGGTGACCACAGCCGAGAAATCACCGGCGGCGACGGACAGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCACGCAGGCGCAGCGTGGAAGAATTTTACCTCTTCGCTATCTTCTTCTGACAGTTCCCGCCCTCTCAGCCTCAGCGTTCCCCGACACTGCCCGGTACGGAATACGGCCCCCGACAGGGTATCGCCTTTCGGCGGTGTGAAGCGATGCACGACCCGGCATACCCGGAAACCACGCTGCGCCACTGGTGCGGTACACGTATACGGAAGCCGGTGAACTGCTGGCGGTATATGACCCGCAGCAATACGCAGGTGCGCGCTTTCGTATGACGCGCAGCACGGGCCGGATGGTGGCGCACCGTTACGCGGGAAGGCCGGAGTCTGCGCTACCGCTACGACGATACGGGGCAGGTGGTGGAGCAACTGAACCCGGCGGGGTTAGCTACCGCTATCTTTATGAGCAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGTGCTGCATACAGAAACGAGGCCGGGCTACAGAACAGGTGGTGAAAAAGAACTGGCGGACGGCAGCGTCACGGCACCTTGGTATGACGCGGCAGGAGAGCTCGGCTTTCTGAAAACGGACGCGGCAGGACGGAGGACGGAAATTGCGGTGAATGTGGTGTCCGGCGATATCACGGACATCACCACCGGACAGGCGGGAGACGAAATTTTACTATAACGACAGGGAACCAGCTGACGGTGAATTGTCCCCGGACGAATACGGAGAAACCGCCGGGAATATGATGAACCGGGCAGGCTGGTATCGGAGACGCATCGCGCAGCGGGGAGACAATACGCTACCGCTACGATGACGCGCACAGTGAGTTACCGGCGACGACAACGGATGCGACGGGCAGCACCAACAGATGACCTGGAGCCGCTACGGGCAGTTGCTGGCGTTCACCGACTGCTCAGGCTACCAGACCCGTTAGATACGACCCTTCGGCGGATGACGGCGGTCCACCGCGAGGCATCAGCCTTTACCGCCGCTATGACAACCGTAGCCGGTTAACCTCGGTGAAGACGCACAGGGCCGTGAAACGCGGTATGAATACCTTGCCGCAGGCGACCCTGACTACCGTTATCACCCCGGACGGCAACCGGGCGAGACACAGTACGATGCGTGGGGAAAGGCGGTCAGCACCACGCAGGGAGCGGGCTTTGACGCGCAGTATGGAATTACGATGCTGCCGGACGTGTCATCAACTGACCAACGAAGACAGCAGCCACAGCGTCTTCAGTTACGATGCGCTGGACCGGCAATTTTACAGCAGGGCGGCTTTGACGCGGGCGGACGCAACGTTATCATTATGACCTGACCGGAAAACTCACACCAGAGTGAGGATGAGGACTTGTCATCCTCTGGTACTACGATGAATCGGACCGTATCACTCACCGCACGGTGAACGGCGAACCGGCAGAGCAGTGGCAGTATGATGGCCACAGCTGGCTGACCAGACATCAGCCACCTGAGCGAAGACCACCGTGTTGCCGTCCACTATGCTATGACGATAAGGCCGCCTGACCGTAGATGCCAGACGAGTGGAGAACCGGAGACGGGGAACTGCTGTGGCAGCATGAGACGAAAACACGCATACAACGAGCTGGGCTGGCAAACCGCGTCACGCCGGACAGCCTGCCGCCGGTGGAGTGGCTGACGTATGGCAGCGGTTACCTGGCAGAGATGAGCTGGGCAGGACGCGCTGGTCAGTATACGCGGGACAGGCTGCACCGTGAGACGGTGCGCAGCTTCGGCAGCATGGCAGGCAGTAATGCGCATACGAGCAAACCAGCACATACACCCCGCAGGCCAGTTACAGAGCCAGCACCTGAACAGCCTGGTATATGACCGTGACTACGGGTGGGTGACAACGGCGACCTGGTGCGCATCAGCTGGCCCGCGACAGACGCGGGAATACGGCCACCACAGCGCCACAGCGGGCAGGCTGGAAATTATGCGCACCCTCGCACCAGACCTGGACATCCGCATCCCGTATGCCCACGGACCCGGCAGACAGCCGGCTGCGGACCCGGAGCTACGCGGACGGAAGCCCCGCCTCTGATGTGGCCGGATAACCGCATCGCGGAGGATTACTATGTCTACCGCCACGATGAATACAGCAGGCTGACGGAAGAAGACGGACCATCCCGGCGGGTGTGATACGGACGGACGACGAGCGGACCCACCACTACCACTACGACAGCCAGCACCGCCTGGTGTTCTACGCGGATACAGCGCTGGCGAGCCACTGATTAGAGAGCCGCTACCTCTACGACCCGCTGGAGTTGGCGAATTGGCAAAAACAGGTCTGGCGGCGGAGCGTGACCTGGCAAGGGGTGGATGTCGCTGTCACGTAAACCGGAGTGATGGTATGAAACAGGACGGAGACAGGCTGACGACGGTGCAGACTGACACCACGCATATCCAGACGGTATACGAGCCGGGAAGCTTCACGCCGCTCATCAGGTCGAGACAGAGAACGGCGAGCGGAAAAAGCGCGCAACGGCGCAGCCTGGCAAGAGACGCTCCAGCAGGAAGGAGTGAGAACGGCCACGGCGTGGTGGTTTCCCAGCTGAACTGGTGCAGCTGCTGGGCAGGCTGGAGGAAGAAATCCGGAGCGAACCGCGTGAGCAGTAGAAAGCCGGGCGTGGCTGCACAGTGCGGGCTGACGGTGGAGCAACTGGCCAGACAGGTGGAGCGGAATACACACCGGCGCGAAAAGCTCATCTTTATCACTGCGACCACCGGGGACTGCCGCTGGCGCTTATCGCGAAGACGGCAATACGGCGTGCTGCGCGGAATATGATGAAATTAGGGCAACCAACTTAATGAAAGGAGAACCCGCATCATGTGTATCCCAGCGTACCGTCTGCCAGGGCAGCAGCATGATGAGAATCAGGGCTATTATATAACCGTCACCGGTACTACGATCCGTTGCAGGGGCGGTATATTACTCAGGACCCGATGGGGTTGAAGGGGATGGAATTTATATCAGTATCTTTAAATCAGGTTAAACACCCAAAGCAGACGCCGAAGATAAGAGGCGACAGGCAAGTAGCAATACGTAACCCACCACC
>98eef8ef-3499-4c27-9191-9420b864869c
TTGTTATTACTTCGTTCCAGTTACGTATTGCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGTTGGGTGTTAACCTTTTTCGCCCCAGCTCACGGTGGCGGTTTCAACCTGATGAGTGGCGTGAAGCTCCCCGGCTGATGGAAATCGTCTGGATTCTGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGATTCGCCGTCCCAGCCATACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCGTTTTGCCACCCTGCGGCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTGCATATTGTGTCCGCGTGGCGAATTGCCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAAAACGCTTCCGGGATAAGGGTCAGTTTTCTCTGTCAGCCACCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGTGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCAGGTCACCTTCCGGGTCGAACGACGGTTACCTGCCGGGTCTGTAGTATACGGGATGCGGATATCAGATTCGCTGCGGTGGTGTGAGCGCCGGTCAGCCTGCCGGAGTAGTGCTGTAGCTGTAACTCGGGTCTGGCGCGGGCTGCTGATTAACGGATGAGTTCGCCGTTGTCGTTCCAGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGAACATAAGCAGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGGCTGTCTGGCGGTCGCGGGTGTACTCCACCAGCGGTGGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGATCAGCCATTCCACGGCGGGCAGGCTGTCATTATACAGCGGTTCGCCAGTCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCAGGAGGCAGCCTTTACTGTCATAACCATAGTGCGATCACCCGGTGCTTCCCTTCGCTGATATGGCTGATGTCCGTCAGCCAGCCGCGTTCGTCATGCTGCCACCGCCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCATTAGTGATAACGCGCTGTGTGCGGCCGTCAAAGCCGGTCCTGTATCAGCCGGTCGAAATTACATCGTAACGGAAGGTGGTGTGGCCTTGTTTTCACTGGTCAGGCGGATGAACCCGTCAGCAGCATCGCATTCCCACTACTAACGCGTCAGGCCGCCCTGCGTGGTACAGATGGCTTTCCCCACGCATCGTACTGTATTCCCGTTTCTGCTGCCGTCCGGGAGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCACTGCATGGCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGGCCGTATGCGCGGTACTGACTCAACCCTTCCTCGCGGTGCACCGCCGTCCACCTGACAAAACGGTCATGGTCATAGCGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCGCAGGGTAAGTCACTGCGTGGATTATCATAGCACCGGTAGCGGGTGATATCGCCCGTCAGGGCAGTTCCTGAATCAGACGGCCCCATTCATCGCATATTCCCGGCGTATTTCCAATACGTCAGGCCCAGTGTGGCGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCCTGCACCATCCGGCGTGGTGATGCTGCGTGATGGGCCCGTCGCATCCGGACTGTATTCTGTTGTCCTGCTGCGGCATCCGTCGCAATGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCGGGACTTCACGGCGGTTCGGGCTGTCGGTGATGGTGATGCGGTCATCTCATACTGATACGTGTAACTTTAAGCCCTGCCGGGTTTTAGCTGTTCTGTCACCCGCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCCTGTGTATTGCTGCGGTCTACACCGCCGCTTCGCCGCGGGGCGTCAGCCATAGCGCGCCAGCGGCGCAACAGGAGTAAATTCTCCGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCATTGTCCCGGCCATATTCGGTGTAACCCGGCGGGGTATCAGGAAAAGCGGACGGTTCGATCCGCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCTTTCGCCTGCGTGGTCAGCCGAGTGACGCCCGGCACCATCGATCACGCCGGTGATTTCGCCGCTGATTCACCGGCGGCTTCGCGGTGGAGCGATCTGTGTGCGCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCGGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACCAGCCGAGCAGCCACCACGGCCTGCGGGCTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGGTTCTTCCGGCAGCAGCGCCTGCCGGAGTGCGTGGCCGGTGACCAGCCTTCATCCGGTTCGCCACGCCGCCGCGCCAATACAGTGACTCGCTGCGGCAACCGTCCTCACCGAGAAACCGTGCTCAAAATACAGGCTTCGCCGCCGTTATCACTGGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGGGCTCCCCACCGGCGCGGGCGTTTTGTCCAGTAACTGCTGTAGGTGCGGGGAAGTGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCAGGAAGGACCTTTACCGAGCAGCCGGACGACCGGATGGCGGACGTCACCCGCCGGGGCACACCAGACTGGAAGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGGACCCCTGGACGAATGCTACCGCCGGCATACTGCGTCATCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCCAGATAGAACAATTAGGAAAATATTTTATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCGGCGTTCCGTGGCCGGTTTTCAATATTCAAAACTCAGCAATCAATAAAAATCACCGGATTGCCTTTTCGGCCTGATCCATCACCGGTTTATCGCTGGTTTTGACCCAGACGCGCGATGCAGGTAGCTGTAAGCGGGCGCGGTCTTTCCAGAGAAAACGCCGAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTGCGGCGTAAAGATAAGCCATGCAGGATATTCTCTGGAGTTCATACTTTCTCCCCTTTTATCTCCACCCGGTGAATGGCACCGGAAAAATGAATTCGTTTTATCTGATGAAGAAAATGGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCCACTTATTTTTGCTTATTGACCGTTTATTTACATTCATCCTGTAATTAAATTTACACAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTGCCACTTTTACACCCCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAGAATTCTACCTTCCGGTATCACTTTAGGCCACTGGGTGCACTGTAGTGGGCGTGATAACCGGCGTATTACTGGTGTTTTATTACTGCGGGTTATCTGGTTTATGCCCTGATCAATGCGGGCGTTCTGATGTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGTAATGAAGATTGGCCGTGAACTGGCGCGTCCTTTAGGTCAAACACCGGCAGACGCCGAGATGGAGCACACGCA
>0a238451-b9ed-446d-a152-badd074006c4
TTAAAAACTCGGTATGCTTCGTTCGGTTACGTATTACTACTTGCCTGTCGGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAGCTCAATGACCTTTGCAGGCGACACGCAACTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGCTGGCGATCCTGCCAAGCTAATCCCCTGGCCTGAAACCGCAGGCGGGCAGCGTATTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGGCGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAATTGATTAGGAACGAGTTCGGTTTAACCCCTTCCAGATAAGCTCCGCATCCTGATGATGGAATCTGGCGGATGTCGTCAAAACCGGAGCCGTGCAGCCGAGAGTCAGGGTCACCTGGCGTTATAGATTCGGCAGCAACGAAATTAGCTCGACGGCGAAATGGTTGTTACCTCGGCTTAAGCCGGGCACAACGCTGGTACGGTCTGGAACAGGACGAGAAGGCGCGCTGGGGCGATCAATGGAACGCTCTGTAGCAGTTCCTGCTCGCTTTCGGCGCTCTGACCTTGCTGCTGTGGCGGTGGCGGTGGCGGTAGCGATGAATCATTACTGTCGCGGTCGCGCTTTACGATCGTCACGAGTGCGGCGATCCTCAAAACGCTGTGGGGGGCAGGGCGAGCGCAACTGCGTGGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAACCGTTACCGGTGGGGCCATAGGCCTGTTGTTCAGCTTGTCTGTTGATGGGTGCTGCTCGAACCCGTTCTGCCTGCTGCACTACCGTAATGGCCTCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTGTTGCTGGCAGCACCCAGCCTTTACGTATTATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAAATTGGCTGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTGGGCAGTGCTTGCGGGCGCGGTAGTACTGGCTGCTGTGTGCGGTGTGCTGGAGGCTGGATGCTGCTGAATGTACTTCGCCGCGCGCGGTAGCTGAAATCGCTGCCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCATTTCGCTCTCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCCAGCCCGGGCTTTACTTTTTAATTAACATCGCCTGGAACAGGTAGCACCGCTAAAGAAGGCGTTCCTCGCGGAACCAGATAGTCGGAATCGTTTTATCCGGTGGTACGGGCTGCCGCGGCGAGCGGCGATTAACGATAAGCCGACAGAGGTAAATGAATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGATCATGAAATCCGGTGTCGCCGGTAACTGGCCTTAAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCTAAACGTTGCCCTCGGTGATACCGTGACTTTTATGGGCGATACCCAGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAGAGTGGACTGGGGAAAGTCACGCCCTAATTTCTATTTTATTTTCCCTGAAGGGGAGATGATAAGACGAACAGCAACCGCAGAACTAGAAACTGCACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACCGCTCAACCAGTTCCCGACCATTGGCCGCAGGTATTAGATATTGGCGCGATTTTAAAACCATAGTCGGTCGGGTGCTGGGAACGCGGGTAAGTCGGGCGCTGCGGTGATGGTGGTGCTGGTCACCCGCCTGCGGTATGTTGCTATTTGCTGGCACAGGTGCAGATGCAGAGAGATGCGTCAGCATCATCAAGGCGGTGGTGTGGCGCACCTCGGATGCGGGAAAAACTGCTGCGCGCCACGTTGTGGTGTGATTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCATAATTGGTGCGGAAACGGCGCTGGCAGTGTGTTGCAGGCGAAAGTGTTTGCGATTTTTCCGTGGGAGCCAGACGGCGATTATTACGGATTGTTCTGCCGTGCAGCGGAGCGCTGCTGCTGTCGCTTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAAGGGTAGGCGCTGTTCAGGCGGTTGCGGGGGTGATGAAATTAAATAAGGGCGTTCTGGTTGAATGGAACGCCTTGTTTCGTAATTCTACAATATGTTTCACGGCTGATGATATTTATTGAATTGGTGATTTCTATCGCTCTATTGCTGATAATAATCTGCGTCGGTGGAGTTTATTGATTTTAAATATAACCCTACAAAATAACTCGGACTAATAAAAATCATAATCGCCTTCGTTTGAATGGATATTATCCATATAATTGAACTGTTGATGAATTCATCTGTGTAAAAATGTTAGTTTAATAAAATATTGAAAGTGACCTGTAATAACGAGTTGTTGTTGATTTGAGAACAAAATAGAGTTTGTAACGAAAAATATATAAAATACATTAGCTGGTCTTGTGTGTCATTTTATTTTTGTTGCTAACACAGGGATATGAACAATAATAACTAAAGGCACTTTATGGCAGGAAAACCAGCGGCGCGTCGGGAGGCCATGACTCGATACTGGCGGTCAGCTGTCCAGGTTCGGCAGGTGTAAATTGGCGCGCCCACCGGCGTGGCGTTAATAAATATGTCGGGCGGGATGACTTCCGGGCGGCCCGAAGGTAAATCCGCTGCTGGGAGCAAGGTGCTGCCCGGCAGAACGGACCTTGCGCTGCTGCCGGCCCGCCGCCGTTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAGACGCTTGCCGGTGGGCGTTTTCACGGCCCCCGGCTGGAAAAGCGCCTTCTGATAATCCGCTTACAGCTACGTGATGACGGACTGATGCTCAACGACCAACGGCGGGCAGACATTCACTTTGAACCGCTGCTGCCGGGAGGCGATTGTACAGCCGCAGTAGATCAATGTGGCTGGTGCGCGGTGAAGTAAAGGCAGCTTACAACCGGACAGCGGCCATACGCTGGCGCGGCGCAACGCTACCGCCGGATATCCCGGTAAGCCCGCATCGCACCTGGCGATAACAGCGCACCGGGGGCCGTGGTGAATGCTGGGGTGTGGTCTGAAGGCAGCAGGAGTGCAGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGTGCTTTACCGGGATGGCGGACCACTCGGGCGGACGCTGTTATTTCGGCGTGAGGCCGCCGGTGACCACAGCCAGGGAAATCACCGGCGTGACGGACGGTGCCGGAGCGGGAGTTCCGCCTGAAGTGCTGACACGCAAGAGCTTGGCGAACTGCGGAAGAGGCCCACACCTCTTCGCTATCTTCAACTTCTGACGGTTCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACACTGCCCGGTACCGGAAATACGGCTACGACAGGTAATCCGCCGCCTCGGCAGTATTGGCTGATATACGACCCGGCATACCCGGAGAACCTGCCGCTACCGCAATTCGGTACACGTATGCAAACCGGTGAACTGCTGGCGGTATATGACCGCAACAATACGCAGGTGCGCTTTCACGTAAGCGCGCAGCACCCGGGCCGGATGGTGGCTGGGCCGCAGGAAGCGGAGATGCGCTACCATGACGATACGGGGCGTTGAAGGTGGAACAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAGCAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCTACAGAAAGGCGGGGCCAGGCTGAAACGGGTGGTGAAAAAGAACTGGCGGTTAACTTGGCGTCGCGCAGCAGGTGACGCGGCAGGGAAGGCTCACGGCACAGGAAACGGACGCGGCGGACGGAGGACAGAGTAGGTCTGAATGGTGGTGTCCGGCGATATCACGGAATCACCACACCGGACGGAGCAGGGCAATTTTACACTATAACGGCGGGAACCAGCTGACGGCGGTGGTGTCCCCGGACGGAGCTGGAGAGCACCGGGAATGGAAGACCGGGCAGGCGGTGTCGACATCGCGCAGCGGGGGGCAATTACGCTACCGCTACGATGACGCACAGTGAGTTACCGGCAACGACAACGGATGCGACGAACGCGCAACTTAGATGACCTGGAGCCACTACGGGCGGTTGCTGGCGTTCACCATTGCTCGACTACCGGGCGCCCGTTCATGAATACGACCCTTTCGGCCCGGATGACGGCGGTCCACCGAGAAGGCATCAGCTTACCGCCGCTATGATAACCGTGGCGGGTCAACCTCGTGAAAGACGCACAGGGCGTAACGCAATTATGAATATAACCGCGGTACAGCTACCGTTATCACCCCGGACGGCAGCGAACTGAACTTTAAGAGTACGATGCGTGGGGAAAGGCGGTCAACTTTCCGCAGGGCGAGCTGACGCGCGGTATCAGGAGTACGATGCTGCCGGACGTGTCATCAGCCTGACCAGCGAGAACGGCAGCCCACAGCGTCTTCAGTTACGATACGCTGGACCGGCTGGTACTGTGGGGCGGCTTTGACGGGCGGGCCTGGCGATATCATTATGACTGAGCCGGAAAACTCACTGGAGAGTGAGGATGAGGGACTTGTCATCCTCTGGTACTGATGAATCGGACGGCCAGCTATCACTCTGCACGGTGAACGTGGAAACCAACGACAGTGATGGCGATATGATGGCCACGGCTGGCTGAAGCGACATCATGCACAGGCGAAGATACCGTGTTGCCGTCCACTATAACTGCATGACGATAAAGGCCACTGACCGGCGATACGGGGGCGGTGAAACCGGAACAGGGGAACTGCTGTGTAAGCATGGGAGACGAAAGAAACGCGCATACAGCGAGCAGAGGCTGGCAAAACCATCACGCCGACAGCCTGCCGCCGGTGGAATGGCTGACAATAACGGCGTTACCTGGCAAAGGAATCAGAAGCTGGAGCGGACGCCGCTGAATTAAATGCGGGTTCAGGCTGCACCGACGGACGCGGTGCGCAACTTCAAGCATGGCAGGCAGTAAATGCCTACGAACTGACCAGCTGCTGTACACACCCCCGCAAACCAGTGCGAACCGCACCTGAACTGCGACTGTTGCCAGCGTATTCACGGGTGGGGTGACAACGGCGACCTGGTGCGCATCAGCGGCCACGACGAAGACGCGGGAATACGGCTACAGCGCCACAGGCAGGCTGGAGAGTGTGCGCACCCTCCACACCAGACCTGGACATCGCATCATCATGCACGGACCCGGCGGGCAACCAGCTGCCGGACGGGGCTGCACACCCGGACAGTACACTCACAGTGTGGCCGGATAACCGCATCGCGGAGGATGCGCCTATTTCACCGCCACGATGAATACGGCAGGCTGACAGCGGAGAAGACGGACCGCATCCCGGCGAGGTGTGATACGGACGGACGACGAGCGAGACCCACCACTACCACTACGACAGCCAACTTTCGCCTGGTGTTCTACACCGCGGATACAGCATGGCGAGCCGCTGGTCGAAACCGCTACCTCTACGACCGCTGGGACGGCATGAATGGCAAAACAGGTCTGGCGGCGGGGCGTGACTGGCCAGGGTGGATATCGCTGTCGCGCGCGTAAACCGGAGAGTGACGTGGTATGGCTGGGACGGGGAGACAGGCTTTGGCGGCAGTGCAGACTGACACCACGATATCAGACGAAGTATATACGAGGCAGAACTTCCGCCCATCATCGGGTCGAGCAAGAGAACTGACGAGCGGGAAAAGCGCGGCGGCAGCCTGGCTGAGAGACGCTCAGCAGGAAGGAGTGAGAACGGCTTACGGCGTGGTGTTCCCGGCTGAACTGGTGCGGCTGCTGGACAGGCTGGAGGAGAAGAAATCCGGGCAGACCGCGTGGGCAGTGAAAGCCGGGCGTGGCTGCGCAGTGCGGGCTGACGGTGGAACGTTGGAGCCGGAATACACACCGGCGCGAAAAGCTCATCTTTCACTGCATGCAGGGGACTGCCGCTGGCGCTTATCAGCGAAGACGTACGGCGTGGAGCGCGGAATATGATGGAATGGGGCAACCAGCAATGAGGAGAACCCGCATCGTAATGTATCAGCCGTACCGTCTGCCAGGGCAGCAACGCGGTGAGGAATCGGGGCTGTACTATAAGCAAATACCGGTACTACGATCGGTGCAGAGGCGGTATATTACTCCAGGACCGATGGGGTTGAAGAGGGATGGGGCGCTGTCGGTATCCTTTAAATCCACTACAACAAATTGACCTATGGGATTATTGCCGAACTTGGGATGATGCCAGATCTGGAGCATCGCAGAGGAAGTTTGTAGGTATTCTTTTCCCATCTCATCGGACCAATGCGAGGTGAAATGAAATGCACGGAGTCTGCATTCGTCTTTAGAAAACGCAGAATAGATCTCTGTCGTAAAAATGATATGGAATCTCTGTTGTCTGTAAAGATACTAATGGAAAATATTTTTGCATCTAAAGGCAACCTGATAATTTAAGAAGGAGTCATATCCTCTGAAAGAAAATGTCCCACAGGTACAGATGAGTTGCTGCTTATCATACTCACGGTACGAATAGATCATGGCAATTATGTTGATGAATTTTTCAAAATGGCGATAAAACTCTTGTAAAGTAAAGATAATAATCTTGAAGCATTTTATCTCACCAGCACCTGATGGACGGGTGGGAGGCACTTAATAATAAAGGAGAATATATTTTTATCAGAAATAGTGTCCCAGGATTAGGTCAGTATGCATACCGTATCATGATTAATTTTAGTGCTTTTAATTGGGGCCTATGGAGATTCAATGAAATATAGTTCAATATTTTCGATGCTTTCATTTTTATACTATTTGCCTGTAAATGAGACAGCTGTTTGCGGTTCTGATGGCAATTATTTTATGAGGTATGTGGAAAATTACATTTAGATAAACCTCTGGCCAAAAATACGGCAAAAGCGAAACAATGAAACAATTAGCTTCGAAATATATGTTAGGCAATTGCATCATATGGCGAACGGATTGCAGAAAAGAAGAAAACCACCATTTAATTGGAACTTACAGATAGTTGGGTTGTTGAGAGCAAAGTTACCTTATGAAGTTGCGGGTGGTGTATTTGATATATAGAAATTAATAAGAAAAATGGATGTTTTGAATTTCCTACATGGTAAATAATAATGCAGCGCTGATGGATGCGGATGGAGACATTGCGTGGAGCGGGGATATGATGAGTGGGGCAACCAGCTGAATGAAGAGAACGCATCACCTGCACCAGCCATTACACCGGCTGCAGGGCAGCAGTATATGATGAGAGTCGGGGCTGTACTACAGCCGGAACCGGTACTACCCGATCCGTTGCAGGGCAGTACTATCACTCAGGGCCGATAGGCTGGAGAGGATGGAGTCCTGTATGTGCGTATCCGCTGAATCCAGGTGAATGGTATTGATCCATTAAAGTTTAAATTCCCGCAGATGTAGCGCTAATATAAGAAGAAAAGATCAACTAAACCATCAAAGAGCATGGGATATGTTATCTGATACTTATGAAGATATGAAGAGACTAAATTTAGGTGGGACTGATCAATTTTCCATTGTATGGCATTTTTGTCGAGTGTCTAAAATTAAATGATGACGCTGGTCAATTAGCCGATCGGCGAAAGAGGGCTGGGTTATGAAAAGAGATTAGAGATTACGGAGTTAAATCTGTTCGAATTGTACGGCAGAAAAGTAAAAGCTATCCCATTCTGAAATGATTGAAGATAATAAAAAAGACTTGGCTGTAAATGACCATGGGTTGACATGTCCATCAACAACAATTGCTCCAGATAGATCTTAGTGATTATGATAATCCAGAGCATAAAAAACGATAAAGGCTTTACAGATGCTGAAGCTATCTCAAGTAATCTATCAAAGATGATAATATTTATTTTTGCTATTATAAGTATTCTTGACATGCGTAATTGCCTTATTTATAAAAGATGGTCTCTTGTAAATATAAACATTACACTTAAGCTATGTAGCAATACCAGAAAATGATGGAGTTTTACGCCAGCTCCCAGATTTTTCCTTTTGTAGCGGTGGATATATCAATATATACCTAAATCTGAAAGACGAAGTGCTTTTCTTATTTTCCCCTAACTTCGTGATGATGGGGTGAGTTTGAAAACATTGACCAGTGAGACCCAGGAACAGATGGCGAAATCAACCATCAAAGAATGATCGATACAAAAATTATTGGTGTAAATATGAGTAGATGCCAGGGCAAGGGGACAATTGGCAAACCTTTTTTTGTTGTTGGTGAAACAATGTTACGCATTATTTTATAACAAATATTGGAGCTGGATTGCCTGATGGTACTTTATACTGCGATAATTCGCTTGAATTAAGAGTCTATCCCATATCGAAGTCCGTCAGCCGTAGTGGGAAAAGTAAAATTCTGAAGCTGAGAAAAGAACATGTCGGCTATTGTGTAAAAGCCATATAGCTCGAGCGATGAATATCCTCGTGATAGTTGTTTTGTGAGGGTGAGTTCCGACCCTCGGCAACAAAATAAAATGAACAGTCAGAGAGTTTACGCCGATTGCACTAATCTCAATGATATCTTCGCCATATTCCAGCCGAAACAAATGAAAATGTTACGTGTTTAATGCGGAGTCTATCTGAAATAAATAATCCTTCGGATTAGAAATAAATTCTTGCCGGGAAAGAAAAGGAAATAAACCATTAGCGGAAAACCAGCGGCACGCCGGTGACATGCCCCAGTACGGCGGCGATAATTAGGAAATTTCAGCGGGGAACACTGATAGTCGCGCCGACTGCATCGAGAACTCCTTACAACTTTTTACAGAACGTCACTGTCGTTGTTCGATATCGTCTTTTTGAATTCTCCAGGTTATGGAGCTGGCAACCCGACGAACGGACACCACTGTCGATAAAAACCCTGTTTACGCAGCTCGTTGCTGGCCCGGTGCTGACCATGTCGGGAAAGCGACGTATTAACAACAGCCTGTTCAGTTGCCTCATCGGTTTTGGTTCTTAAGGTTAGGAGCGCGGCGACTACTGATTAATCTGCGCATCCACCGCCTTCAGCGACCAGTTCGCGGTAACGATAAAACGTATCACATGGCTTTCAGTTACAGGCTTTTGATACGTTGCTGAGTTCTTCCAGCCAGATTGAACAAACCGGCTTTGTGTTTGATGACGGGATTGGCAGTATGAAGCATGAGGTTACCTCTTGTTTTGGATAAAGTTCGACACTCATATCAAAACCGGTAACTCTCAACCTTTCAGAGGTTAAACACCCAAGCAGACGCCGAAGATGAGCACC
>ac1527fd-d73e-4721-95f5-b7d270cae783
TTCGGTATTGCTTCGTTCAGTTACGTATTGCTGCCTGTCGCTCCTATCTTCGGCGTCTGGCGGGTAACCTATCGCGGTCAGACAGCAGGCTGTTCAGGTGTAATATGTAACTGCCGGCAGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCGGTACAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCTGACAGCCAGCCGCTGCCGTAAGTCAGCCATTCCACGGCAGGCAGGCTGTCCATTATAAACGTTTCGCCAGTCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCGACCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGTGAGGCGGCCTTTACTGTCATAACCATAGTGCACGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAAGCCAGCTGGCGTCGTCTGCCACCGCTCTTACGGTTCGCCATTCACGATTGCGGTGCGTAGGGCGGTCTGCTTCGTCCATGAGTGCCAGTGGGTGAGCCCTCATCCTCGCTGCGGATAAAGTTTGCGGTCGGGTCATTGGTGATAACGCTGTGTGCGGCCGCCAAAACCGGTTTCCTGTATCAGCCGGTCCGGGTACATCGTAACGGGTAGATTGTGGCTGCGGTTTTTCACTGGTCAGGCGGATGGCCAGAATCCGGCGGCATCATGGTATTCCATACTGCGCGTCAGACCGCCTGCGTGAACGCAGATGGCTTTTCCCCGCGCATCGTACTGTGTCGTTTCTGCTGCCGTCCGGGGCAATGGCCGGTGGTCAGGTCACAGCGGCGTTGTATTCACCGCGTTTCATGGCCCTGCATTAGTATGCGGCAATTAACTGTCCACGGCGCTGTCGGCATCGCGGTACTGACTCAGCCAGCTTCCTCGCGGTGCACCGCTTCACCCTGACAAAACGGTGTATAGTTTAGCAGGTTATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTCCGGCTGCCGGTGTCTTCCGTTGCGCAGGAGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGCAGTTTCCTGAATCGGAACGGCCCCATTCATCTCTTCGGCGTATTTCCAGCCCGTCAGGCCGGTGGCTGACGTTAGCGGCTTTAATGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCGGCGTGGTGATGCGCGTAGATGGGGGTAATCACCATCCGGACTAATATTCTGTTGTCCTGCCTGCGGCATCGTCACAATGCCCTGGAGCCTGCCCACCGTCAAACTGTTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTTCACCACCCGCTGTACGCCTTCACTTATGCGTGCAGGACTTCGGCAGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACATTCATGGCAAGCCTGCCAGGTTTAGCTGTTCCTGTCACCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGGTAACGACCCGTGCCACCATCCGGCGGTATTTTATCATCGTAAGTAAGAAGCTGCGCACCTGTGTGTATTGCTGCGGTCATACACCGCCAGCAGTTCGCCGCGGGGCGTCAGCCATAATAGCGCACCAGCGGCGCGAGCAGGTAAATTCTCGATTATTCCGGGTCGTGCGTCAGCCACACGGCGAACAGACGGATGCCGTTGTCGACCCTTCGGTGTATTGGCAGAGATATCAGGAAAAGCGGACGGTTCCGTCCGCCGGAAATAGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCAGAGTGACGCCCAGCACCATCCGTCGCGCCGGTGATTTCGCGCCGCTGGAATTCACCGGCGGCTTCGCGGTCGGAACGTCTGTGTGCGCCGAAGCGGTCCACCAGCAGTCAGTACCGGTACCGGCAGCGGCAGCGCAGGCAGCACCTCATCACTTCCCGGCACCCGCTCACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAGTGAGTTCTTCCGGCAGCGCCTGCCGAGTGCGGCCAGCCGGTGACCTTCATCAGTTTCGCCACGCCGCCCGCGCAGCCACATGATGACTCGCTGCGGCTGTATTACCGTCCTCACCGGGAAACAGGTGCTCAAAATACCAGGCTTCTGCCGCGGTATCACTGAGTATCAGTGTGTTATCCTTGCAGCTGTAAGCGGATATCGCAGGCGATTTTCCAGCCGGGCCGAGGCTCCCCCATAGCGCGGGCGTTTCATCGGTAACTGCTGGCGGTGCAGAGAATGAACGGCAGCAGGCCGGGCGGGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCCGGATTGACCGGATCGGCGGACGTCTGCCCGCGGGGCGCGAACAGGCCACGCCGTGGGGCTTTTTCGATGCGTACCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTGCTGACGCGCCGCCGGTTTTTCCGCTCATCTGTAATCGCTTGTTTATCGGGTTGTTTGTCTGCTGACAGGCAGAAACCCTACAGATTTATAAGAGAAAGCCTTGAGAGTGAGATATCTGTCAGATAAGAACAATTGGAGGAAATATTTTATATATGTTCGCTGAATATATGTTTCGATTGGTATAACGATGCGTAAAATGTTCCATCTGAACATCTTCCTGATGCAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATATTATTCAAACTCAGCAATCAATAAAGTCGCAGTTGCCTTTTCGGCCTGATCCGTCCACCGGTTTATCGCTGGTTTTCGAAGCCAGACGCGATGCAGAGTAGCGCAACGAAAGCGGGCGCAGTCTTTCAGAAAAGCATGAAAGGCAGCGCCGGAACGCCGCTGCAACCGCGAAGTGCGGCGTAAAGATAAATATGCAGGATATTCTCTGTAGAGTTCATACTTTTCTCCCCTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGGATTATTTATCTGGTAAATAATGCCGCCCTTTTGTGTAATTTTACTACTCAGCCAGTACTTATTTTGCTTATTGATGTTGTTTTGTTACATTCATCCTGTAATTAAGTTACGAAGTTAAATTAATACTAAACATTAGTTAAATCACTTGGCTTTGCCATTTTTACTTTTACCCGCAGATTTTGCGAAAATCTTTGCAGCAAAAATTCTACCCTTCCGGTATCACTTTTGGAAATACTGGAGGTGCACTGTGGTACGGCGTGATAACCGGCATATTGCTGGTGGTACTATTACTGGGTTATCTGGTTTTATGCCTGATCAAATGCGGAGGCGTTCTGATGGCTGCGCAAGGTTCTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCAGGCTGGCACGCGGCGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCTTCGCGCTGGCGTCTGACCATTGAATGAACTGGAAGCAATATCTTTGTTGCCATTCTCGGCTGAGCGCAATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCCAATCAGCAGTTACCGGGCTGTCGTGGGATCGCTGAATACCGCCGTCGGCTTTGTCACCAACACCAACTGGCAATCCCATGGCGGTGGAAACCATTGAGCCTATTTCAGCCAGATGGCGGGCTTAACGTTGCAAACTTTCTTTCTCTGCGCCAGCGGGATTTTGCGGTGATTTTGCCTCATCCGTGCGGTGCACCGCGAGCATAAGGCACGCTCAGGATGCCTGGGTCGATCTGCTGCGCATCGCGTTATGGAGTGTAGTCCCGCAATGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAAACTTTCGCATATCGGGCTGTGAATACCGTGAAGACGCAGCACAATTGCCATGGATTTATAGCAACTTCTCAGGAAGCGATCAGATCTTTCGATTACTAACGGCGGTAAATATTTAATGCCAATAATTAGCATCCGTTTAACCAACCATATGACCAACTTCTGGTACAGATGCTGGCGATCTTCGCCAGTCCCAACGGCGCTGGCGCTTTGCGCTGGTGAAGTGATGGGCGATCGCGCCACCAGGGCGCAATGTTGCTGTGGAGCGATGTCGGTGATTTTGTCATCTGCATGCGGCGGCGTGGTGATGTAGGCAGAGATTCAGGGTAATCCTCATGCTGGCACTGGGCACGGACAGCAGCATCAATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGCTCGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCATTGATTGCGATGCATGGTTAGTTTACCGCTCTCGGTGGCATGAATGCGCCGATGTGGCTGGTAAATTGGTGAAGTGGTATTCGTGGTGTCGGTTCTGTTAGGATTCAAACACCCAAGCAGACGCCGCAATATCAGCACCAACAGAAAGCAATGCGTAACGCAG
>2a021335-d1c5-4881-93fc-a673d8960075
TGCTTCGGTATTGCTTCGTTCCAGTTACGTATTGCTTTTTCTGTTGGTGCTGATGTTGCGGCGTCTGCTTGGGTGTTTAACCTTGGCGCTGGGCAATATCAGCGATCTGGAAGGGCTTAAGCCAGCAAAGCCGTGAAGTTTATGGCGGGCGATCGGGCGTTGCGCGAGTTCACGCGAAGTGCCGCAAGCGTGAAGCTGGAGGAAGCGCAAAGCGCGGCCTGATCGGCAAACAGCTGACTTTCATACAATGACCTTTGCAGGCGACACACCGCAGCTGGCGAACGTCAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACCTTTAATCCCCTGGCCTGAAGCCGCAGGCGGGCGGCGTATTGCTGGCCCCACGCCTGATGGCACTGCCAACCTGAAAACGGGCGACACACCATTGACGTGGGCGATACCACCTTGCGGATTGCCGGAGAGTGATTCAGGAACCGGATTCCGGTTTAGCTTCAGATGGCTCGCGTCTGATGATGAATCGGATGTCGATAAAACCAGGTCGATTACGGCCGAAGTCAGGTCACCTGGCGTTATAAATTCGGCGGCAGCAGAGACCAGCTCGACGGCTATGAGAAATGGATTTGTTACCTCCGGCTTAGAAACCCGAACAACACTGGTACGGTCTGGAACAGGACGAAGGCGCGCTGCAGGGCGATCAGTGGAACGCTCGCAGCGAAGTTCACTGCTGCTTTCGGCGCTTCCTGACCTTGCTGCTGCTGGCAGTGGCGAAGCGGTGGCGGTAGCGATGAATCGGTATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACCTTTAAGGGGCAGGGCGAGCGCAACTGCGTAAAGAGCCCAATCGTCAGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGTATAGGCCTGTTGTTGTTCGAAAACGTGTTGATGAATTGCTGCTCAAGAAGCCGTTCTGCCTGCTGCACTACCGCCAGCCAGCCTGGCCGTGGCTGTGGGCGCTTAACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTGTTGCTGGCAACGCAGCGCTACGCGTATTACGTAATGATGTGGTAGCGAACGTCCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTTGGGCGTGCTGGCGGGCGCGGTAATTACTGGCTTTGCTGTGCGGTGTGTGCTGGGCTGGATGCTGCTGAATGTACTTCGCCGCATGACACTGAAATCAGCTGCCCCTCTGCGCCTGGCAGTTATACCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCATTTTTCGCTCTCTCCTATGCTGCTGGCTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCGGCAGCGACTACCACATCAAGCCGAACTACTTTTTTAATTAACATCGCCACAGAACGGAATTGCTAGCACCGCTAAAGCGTTCCTCGCGCGGAACATCAGATAGTCCGGAATCGTTTTATCCGGTGGTGCGGGCGCGGCTGACGGCGATTAACGATAAACCGACAGAAGGTAATGAAGATGGGCGCTTAACCGCCGAACTCAATCTTACCTGGCAAAATGCGCGGCCCGATCATAATAATCCGATTGTCTCGCCGGTAACTGGCCGCCAAAGCCGATGAAGTGTCGATGGAAGAGGGGGCTGGCAAAGAAACGCTTAAACGTTGCCCTCGGTGATACCGTGACTTTTATGGGCGATACCCAGGGTTTCCGCGCTAAAGTGACCAGCCTGCACAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTATTTTCCCTGAAGGGGGCATTAGACGGGCAACCACAGAACTGGCTTACCGGTTTCCGCTGGGAGATAGCAGCGGCATGTTGACACAACTCAACCATAGTTCCCGACCATTAGCCTGGTATTGAATATTGGCGCGATTTTTAAAACAGGTCAGTCCGGGTGCTGGAGCAGGTAAAGTCGGGCGCTGGAAGTGATGGTGTAGTACTGGTCACCGCCTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGGAGCTGGTGGTGTGGCGCACGCGCGGTGCGGAAAAACTGCTGCGTACCACGTTGTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCTGGTGGTGCGGAAACGGCGCTGGCGGTGTTGCGAGCGAAGTGTTTGATTTTCCGTGGGGAGCCAGACTGGCGATTGTGGATTATTCTGCCACCGTGCAGCAGGCGCTTTCTGCTGTCGCTTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAGGGTAAGGCGCTGTTCAGGCGGTTGCGGGGTGATGAGAGTAAATAAGGGGGCGTTCTGGTTGAATGGAACGCTGAACAAATTAATTCCACCACAATATGTTTCATTGATGATGTTATTGAATTGGTGATTTCCTATCTTTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAATATAAAGCCCCTACAAAAATAACTCAGACTAATAAAATCATAAATCATATACGTTGAATGGATATTATCCATATAGTGGGCCCCGATTGATGATGAATTCATCTGTGCTAAAAATGTTAGTTTAATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATAATGAAAATATATAAATACATTAGCTGGTCTTGTGTGTCATTTTATTTTTTGTTGCTAACACAGGGATATGAACAATAATAACTAAAAGGAGCACTTTATGAGCGGAAAACCAGCGGCGCGTCAGGGAGATATGACTCAGTATGGCGGTCCCATTGTCCAGGGGTTCGGCAGGTGTAAATTAGCGCGCCCACCGGCGTGGCGTGCTCGGTGATGTCCGGGCGGAAGGATGACTTCAGGCAGCCCGGTAAATCCACAGGGGCGAGGTGCTGCCCGGCGAAGGGCTTGGACCTTGCGCTGCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCGGTAGCTGCTGTAGGTGCAGGAGAGAATGAACGGCAGCGGGCCGGGCAGCGCAGGTCATCTCGCCGGGCAGCACCTTCGCCCCAGCAGCGGATTTACCGGGCTGCCCAGTCATCCGCCCGGACGCACCGAGCACGCCACGCCGATTGGGCGCGCCACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTTAGTTATTGTTCCTTATCCCGCAATGTTAGCAACAAAAAAATGGAAAGCACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAACTGTTCTCAGTAACCCAACAACTGTTATTACCAGGTCCTCTCAATATTTTTTATTAAACTAACATTTTACTTAGCACAAGATGGTCATCATCAACAAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTGGCTTTAGTCTGAGTTATTTTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAATAGAAAGATAGGAAATCCCACCAATTCAATAACATCATCAATGAAACATATTATAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCATTTACTCTCATCACCCCGCAAACTGCCTGAACAGCGCCTTACCCGCTTAACCAGTCGCGCACCCAGCCAGCCGCCGAAAGCGACAGCAGCAGCGCTCCGCTGCACGGCGCAATCCACAATCGCCGGTCTGGCTCCCGCGATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAAACAAACAAGCATGGCAGAGACTCACACCACAACGTGGTACGCAGCAGTTTTTTTCCCCGCACCGAGTGTGCGCACACCACCAGCTCCCTGTGTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCATACCTGCTCAACACCTGACCGACCTGTTTTAAATCCCGCGCCAATATCTAACAGGCTAATGGTCGAGAACTGGCCCGGTTGAGTTGTCAGCATGCCGTTGCCATTCTCCCCGGCGGAAGCTGGTAAGCCAGCTCTGCGATTTGCCCGATCTAATGGGGGAAAATAAAATAGAAATTAGGCCAGACTTTTTCCCAGTCCACTTTGGTACAGGCTGGTCACTTTAGCGCGGAACTCCACCAGGTATCGCCCATAAAGTACATTGTATCACCCATCAATCGATTATGATGTTAATTATCAATCGTTCGGATGATGTTCCTGTTCTGTGGCGATGTTAATTAAAGAAGTAGTTCGGGCTTTCTGGGGAGTAGCTGCTGCTTGCTGCCAGCGGTCGAGCAGATCGCCGCGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGGCGAAATGCCGAAAGCTGACAACGTTGACCACGGCTGACGTAACGGGCGGTAACCGCCAGGCGCAGAGGCGATTTCCGGTCATGCGGCGAAGTACGTTCAGCAGCATCAGCCCAGCACACCGCACAGCCAGTACAGTACTACCGCGCCCGCCAGCACCGCCCAAAACGGCATTAATCGGCGAGCAGCGGCACAGCCACCACACACTGACAATCCGGCAGATAAAACTTCCTTGACCAGACGTTCGCTACCACATCATTACGTAATACGCGTAAAGAGGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCACAGCCACGGCCAGAGGCTGGCTGGCGGTAGTGCAGCAGGTAAGAACCGGGCGAGCAGCACCATCAACACGTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCGGCGTCAGCACCATCAACCACTGGCCGACGATTGGCTTACGCGGTAGCTCGCCCTGCTAGCGTTTGAGGGATCGCCACCAGATCGTAGCGACTGCGACAGTAATGATTCATCATTTACCGCCACCGCTGCCACTGCCAGCGAAAGCAAGGTCAGAAGCTGCCGAAAGCAGCGGGAACTGTTGCGAGCGTTCCATCGATCGCCCCAGCGCGCCTTCGTCTGTTCCAGACCGTATTTACCAGCGTTGTTCGGGTTTAAGCTGAGGTAACAACCATTTCTCATAGCCGTCGAGCTGGTTCTCGTTGCCGCCGAATTTATAACGCCAGGTGACCCGACTCCCCGGCTGCACGACTCGGTTTTATCGACATCCGCCAGATTCATCATCAGACGCGGAGCCATCTGGAAGGGTTAAAACCGGAATCGGTTCCTGAATCACTTCTCCGGCAATCCGCAGGTGGCATCGCCCACGTCAATGGTGTCGCCCGCCGGGTAAAGCAGTGCCATCAGGCGGGGCCAACAATACTGCGCTGCCCGCCTGCGGTTTTCAGGCCAGGGGATTAGTTTGCAGATCGCCATACATCGGGTAGATATATCATCCACCGCTTTGACGTTCGCCAGCTGCGGTGTGTCGCCTCACAAAGGTCATTTGTGGCGAAATTGGCTGCTTGCCGACTTTTTCAGGCCGCGCTTTTGCGCTTCCTCCAGCCACGCTTGCGGCACTTCGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTTGCTGGCTTAAGCCCTTCTCCGTACGATCGCTGATATTGCCAGCACCAGGTTAAACGCAAGCAGACGCCGCAATATCAGCACCAACAGAAAAAGCAATGCGTAATGACACGGG
>8b55f8dd-3fcb-478c-8384-6df32ed6400b
CCCCATCGGTATGCTTCGTTCCGGTTACGTATTGCTACTTGCCTGCTCGCTCTATCTTCGGCGTCTGCCCGGGTGTTTAACCTTTGCAGGCAGACGTATTGCATTAACAATGGTTCAGCGTTGGCGGCTTTGACATCCTGCAAAATCTGGCGCAGCGTTTGCTCGGTTTGCTGTGGCTGAAAACCACGCAAACCGTCATTACCGCCAGTTCAACCAGCGCAACTTGCCGCGGCTGATGCTGTTCAGCAGAGCCGGAAGGCGCGCCAGTCCTTGATACGAGTGTCGCCGCTGATGCTGGCATTAACTACCGACGTTTTACTCTGCCACTTATCATTCAACAAGGCAGGCCAGGCCGCGCTGAACATTCGATACCCGGCGCTCAGGCTATCACCCAGAATCAATAACGTGTCCGCTGCGGGCGCTACGGAAAGTTAACTGGGACCAGGAACGGAAGGGCAAATGCCAGCGGAAAGTATTGGGATTCACCATCTTAAGAAGTCCGTCGGTCAGGGGCATGAACTCTCCATCCTCACCGGAGTTGGTGGTTGTCAAACGGCGAGACCATCGCACTGGTGGGCGAGTCGGAATCAGGTAAGTCAACCTTGCTGGCGATCCTCGCCGGGCTTGATGACAGCAGCAGTGGCGAAGTGAGTCTGGTGGGACAACCGCTTCACATAATATGGACGAAGCGCGGGCAAGATTGCGCGCGAAGCACGTCGGCTTTGTTTTCAGTCATTTATGTTAATTCCTACCGCCAACGCGCTGGAAAACGTCGAGCTTCCAATGCTGCTGCGCGGTGAGTAGCGCGGAAAGTCGCTAACGGGGCGAAAGCGTTGCTCGAACAGTTAGGGCAGGGGCAAACGTCTGGATCATCTTCCGGCACAGCTTTCCGGCGGTGAACAGCAACGAGTGGCGCTGGCACGAGCCTTTAATGGTCGACCTGATGTGTGCTGTTTGCCGACGAACCCACCGGCAACCTTGACCGCCAGACGGGCGATAAAATTGCCGACCTGCTGTTTTCCCTCAACCGTGAACATGGCACCACGTTGATTATGGTGACCCGACCTGCAACTGGCAGCACGCTGCGACCGCTGCTTACGGCTGGTGAACAGGCAGTTGCAGGAGGAAGCATGATTGCACGTTGGTTCTGGCGCGAATGGCGTTCGCCGTCATATTAATTGTCTGGCTGGCGCTAAGCCTGGCGGTGGCCTGCGATGCTGGCGCTGGGCAATCAGCGATCGCATGGAGAAGGGCCAGCCAGCAAAACCGTGAAAGTTTATGGCGGGCGATCGGGCGTTGCGCAGTTCACGCGAAGTGCCGCAAGCGTGGCTGGAGGAAGCGCAAAAGCGCGGCCTGAAAGTCGGCAAGCAGCTGACTTTCGCCACAATGACCTTGCAGGCGACACACCGCAGCTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCCTGGCCTGAAACCGCAGGCGGGCAGCGTATTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACACCATTGACGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAGTGATTCAGGAACGGATTCCGGTTTTAACCCCTTCAGATGGCTCCGCGTCTGATGATGAATCCTGGCGGATGTCGATAAAACCGGAGCCATTACAGCCGAAGTCAGGTCACCTGGCGTTATAAATTCCGGCGGCAACGAGAACCAGCTCGACGGCTATGAGAAATAGTTGTTACCTCGGCTTAAACCCGAACAACGCTGGTACGGTCTGGAACAGGACGAAGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCTTGCTGCTGGCAGTGGCAGCGGTGGCGGTAGCGATGAATCGTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCAGGCGCAACTGCGTAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGAGACCCATAGGCCTGTTGTTCGAAAACGTGTTGATGGTGCTGCTCAAGCCCGTTTCGCCTGCTGCACTACCGCCAGCCAGCCTCTGGCCATTAACGTGGGCGCTTGGCACCATGGCGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTATTTGCTGGCCTTGCCAGCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCTTGGCGGATTAATGGGTGGCAGCATGCTGCTTTAGGCAGTGGTGCTGGCTTGGGCGCGGTAGTACTGGCTGCTGTGCGGTGTGCTGGGCTGGATGCTGCTGAATATTGCTTCGCCGCATGACTGAAATCGCTGCCTCTGCGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCATTTTTCGCTCTCAGCATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCGCTACCTCAAGCCCAGACTACTTTTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAGATCGTTTTATCCGGTGGTGCGGGCGCGGCTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAAACTCAATCTTACCTGGCAAAATACGCTGGCCCGATCATAATCCGGTGTCGCCGGTAACTGGCCGCCAAAGCCGATGAAGTGTCGATGGAAGAGGGCTGGCAAGCAGCAAACGTTGCCCTCGGTGATACCGTGACTTTTATGGGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAGAAGGTCTGGCCCTAATTTCTATTTTTATTTTCCCTGAAGGGCATTGAACGGGCAACCGCAGGACTGGCTTACCAGTTTCCGCTGGAGAATGGCAACGGCATGTTGACGCAACTCAACCGCAAGTTCCCGACCATTAGCCTGTTAGGTATTGGCGCGATTTTTAAAACAGGTCGGTCAGGTGCTGGAGCAAAGATGCGTCGGGCGCTGGAAGTGATGAATGGTACTGGTCACCGCCTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGAGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCGTGTACCACGTTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCGGTCTTGCAGGCGAGTGTTTGATTTTCCGTAGGAGCCAGACGGCGATTGTGGATTGTTCTGCCGTGCACGGCAGGCGCTGCTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAAGGGTAAGGCGCTGTTCAGGCGAAGTTTGCGGGGGTGATGAGTAAAATAAGGGGCGTTCTGGTTGGATATGGAACGCCTTGTTTAAATTAATTCTACAATATGTTTCATTGATGATGTTATTGAATTGGTGATTTCCTATCTTTTCTATTGCTGATATTGTAATCTGAATCGGTGGGTTTATTGATTTTAAATATAGCCCTACAAAAATAACTCAGACTAATAAAATCATAAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGAATTCATCGTGCTAAAATGTTAGTTTAATAAAATATTGAAAGTATTACTGTAATAACAGTTTAATTTGTTGATTGAGAACAAATAAGTTTATGTGAAAAATATGTAAATCACATTATGGTCTTGTGTGTCATTTTATTTTTTGTTGCTAACACAGGATATGAACAATAACCTAAAGGGCACTTTATGAGCGGAAAACCAGCGGCGCGTCAGGGAGATATGACTCAGTATAGCGGTCCCATTGTCCGAGGTTCGGCAGGTGTAAGAATTAGCGCGCCCACCGGCGTGCGTGCTCAGTATTGTCGGGCAGGGATGACTTCGGAACGGCCGGTAAATCCGCTGCTGGGGGCGAAGGTGCTGCCCGGCTTTGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAACGCCTGCACCGGTAAGGCGTTTTCGGCCCCGGCTGAAAACGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTTTCAACGCGACAACGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGGAGGCGGTGTACAGCCGCAATGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAACACAGCCGGACGGCCATACGCTGGCACGCGGCTGTGGGGGGCGCACCGCCGGATATCCAGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGTGACTGGGGTGGTCTGGTGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCATTACCGGAGTGCTTACCGGGATGGCGGACCGCTTCGGGCGGACGCTGACGTACCGGCGTGAGGCCGCTGGTGACTGACCGGGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCACGCAGGCGCAGCGATGCGCGGAAAAGGCCCACACCTCTTCGCTATCTCCTTCTGACAGTTCCCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACACTGCGGTACCGAATACGGCCTTCGACAGAGTATCCGCCTTTCGGCGGTGTGAAGCTGTCACGACCCGGCATACCGGAGAGCCTGCCGCTGCGCCACTGGTGCAGTACACGTATACGGAAGCCGGTGAACTGCTGGCGGTATATGACCACCAATACGCAGGTACGCCTTTCCACGTATGACGCGCAGCACCCGGGCCGGATGGTGGCGCACCGTTACGCGGGAAGGCCGGAGATGCCGCTACCGCTACGATGATACGGGGCGGGTGGTGGAACAACTGAACTTCCAGCGGGTTAAGCTACCGCTATCTTTATGAAACGGGACCGCATCACCGTCACCGTGGCCTGAACCGGCGTGAGGGTGCTGCATACAGAAGGCGGGGCCGGGCTGAAACGAATTGGTGAAAAAGAACTGGCGGACGGCAGCGTCGCGCAGCGGGAGTTAAGCTGCAAGCAGACGCCGAAGATAGAGCGGC
>f163818d-019b-4937-b07d-023528a6cbea
TTGTTGTACTTCGTTCAGTTCGTATTGCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGCTTGGGTGTTTAACCTAACACCGCCAGCAAGGACAAACAGCATCATGCCATTAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAACCACATCGGCACCATGCCACCGAGAGCGGTAAACCGGATCATGCATCCGCAATCACCGCGCCACAGAAGCCGCCGTCGTCGACCGCAAACAGGCTGCGAAACCAGCGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCGACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGTGCCGTTGGGATCAAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAATTACGGTTAGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAATACCGCCGTTAGTACCGAGCATCTTGATCGCTTTCCTGAAGCTACAGGCCCCATGGGTAGCTGTTGCGCTCCTTCAACAGTATTCACAGCCTGATAAGGCAGAAAGTTTACAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACGGGGACTAGCACCCGCCAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGAGTAAACGCACGGATGAGGGGCAAAAATCACCGCAATCCCGCTGGCGGCAGAAGAAAGTTTTACACCGTTAAGCCCGCCATCTGGCTGGAAATAGCTCAACGTGGTTTCACCGCTATGGTGCCAGTTGGTATTGGTATTGACCAGCTGACGGCGGTATTCAGCGCCAGATCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGAATAATTTTGACCGAGCAACATAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTTGCTTCAGTTCATCTCCACGGTCAGAGACGCCAAATTAGCGAAAAGTACGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAACCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAACTTCATTAACACCAGTAAACGTGGCGATCAGTAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCGCGCCTGCACTTCTACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAAGAATATAAAAATGGCAAAGCCATGGTTGCTAATGTTTAGTATTAATTTAACTTTATTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCCGGATGGTGATAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTCAGTGCCATTCACCGGTAGATACAAAAGGGGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGAGTTAAAACACCCAAGCAGACGCCGAAGATGAAACGT
>fb405411-031d-4447-8096-b603693b1fe7
TTGTTATTGCTTCGTTCCAGTTGCATTGCTTTTCTGTTGGTGCTGATATTGCAGCGTCTGGCGGGTGTTTAACCTCGAAAGTCCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTTCATCCACGCCCTGCGCGGATAAACTCAAACGCCTGACGGTTACCGAGGTGATGGTGCCGGTTTTATCCAGTAGCAAACGTCAACGTCACCCTGCCGCGCTTCTGCGTCCGCTACAGGTGGCAATCACATTTCGCGCCTAGCATCGGCTCCTCCCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACGAGCCAGCAGCGCCACCAGTACCGTTGTGACTGCATTACCGCCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAATAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGAACGGAGAATTTCGTTTCGGCGTTTTGCGCCTGTGCGCCTTAACTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGGTACCCCTTCAATAACTTCACCATCGCAGGATAATATCGCCAGCTTCTACCGGTGATATCGCGCTTTACGAAGTTGGTCGGCAGGGCTTTGTCGCCGCAGCGCCATCATTTCGGCTCGCGCGGCTTGCGGGCAAAGGCAGTTTTTCACCCCCCTTTCAGACTGTTGGCCTGCGCTTTGCGGCCTTCTGCCAACGCCTCGGCGAAATTGTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATGCAATTGGTCGGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCGAGTGCTCCTCAATATCATCGGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGGATAAAGGTCCAGTGCGCCAACCAGCACAGTGCCGATTAACGGGCCAACAAACAGCCGGGCCGTGCGTTCGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAACGAACCGGCAATTGCCATCCACCAGGGGATAATCACCCCAGAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCCTTCGCCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCGGCGTCGGTCATCATCGTAACGCCGCGCCCATCAACACCAGCGTCAGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCGCGTACGTCGATTTTTTTACCCAGATATTCCGGTGTACACGACCAATCTCAGCCCGGCAATAAACACCGCCAGCAGGACAAACTGGCATCATGCCGTAAGACCAGAACCATTACCGCCGAACACCCACTTCGCAATTTGCATCAGCCACATCGGCACCATGCCGCGAGGCGATGAAGCAGATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACTGGGCTACTGACCAGCGCGAAACGGCTCTCTTTACCTTCATATTGATGCTGCTGTCCGTGCCCGGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGTTGTTAAAAATCACTGACATCGCCCACGGCAACATGTGCGCCCCTGGCGTGATCGCCCATCACTTCACCAAAGGCAAGCGCAGCGTCGTTGGGATCAAGAAGATCGCCAGCATCTGCACAGGGTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTATATAACGTGATGCGTAACAGATCGACCCAGGCATTCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAAATCACCACAATCCCGCTGGCGGCAGAAGTTTTACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTAATTATTGGTGACAAAGCTGACGGCGGTAATTCAGCGCCAGATCCCACGACAGCTGGCAGCTGCTGTGGATTAAGCGGCAGATGAATTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAACGTGTTCAGGCCGAGAATGGCACAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAAGTACGCGCTCAACGCCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCGGCCCGCTGCCTAAAGGACGCGCCGGCACCATTAACACCAGTAAAGCAATGGCGTCAGTACAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGGCATAAACCAGATAACCCAGTAATAAAAGCACCAGCAATACGCCGGTTATCGCCTCACCGGTGCACCTCAGTGGCCTAAAAAGTGATACCGGGTAGAATTCTGGCTGCGCAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAGAATATAAAATGTAAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATGGTGGTCGGATGGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAAACAAATTCATTTTCGGTGCCATTCACCGGAATTACAGATACAAAAGAGGGAGAAAAGTATGGAACTCTACAAGAGATATCCTGCATGGCTTATCTTTTTACGCCATTACTTATGCAGTTTGCAGCGGGCGTTCTGGCGCTGCGCTCATACTTTTCTGGAAAGACCGCGCCCGCTTTTGGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTTATTGATTGCTGAGTTTGAATGCATTTATGAAAACCGCCAGCGGAAACGCTGGCGGTTTTATCGAGGAAGATGTTCAGAGGAATATTTGAACTTGTCGTTATATACCAGTCGAAACGCTATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTACAGGCTTTCTTATAAATCACCAGCGGGGTTTCACCTGTCCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGGAGCGGAAACCGGCGGCGGCGCGTCGGGGCGACATGACGCAGTATGGCCGGTAGCATTGTCAGGAGGTTCAGCCGGGGTACGCATCCGGTGCCCACCGGCGTGGCCTGTTCGGTGCCCGGCGAGTTGACGTCCGGCAATCCGGTCAATCCGCTGCTCTCGGTGCAAAGGTCCTTCCAGTGGAAACCGACATCGCCTACCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAAACGCCCGCGCCGGTGTTGGGAGCCTCGGCTGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAACCTGTATTTTTGAGCACCTGTTTCCCGAGTGAGGACGGTTTACAGCCGCAGCGAGTCACATGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCAGCCGCCTCTGGCGAGCGCTGCCGGAAGAACTCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCGAGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCACCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACCAGACGTTCCACCGCGAAGCCGCCGGTGGTCAGCGGCGAAATCGCAACGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCACCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCCAGGCCATTTCCGGCGGACGGAACCGTCCGCTTTTCCTGATACCCTGCTGCGGGTTACACCGAATATGGCCGGAACAGCGGCATCCATCTGTCTGCCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCTTTGGTGCGCTGCTGGCTGGAACGCCCGCGAACTGGCGGCGGTGTATGACCACCCAGCAACACAGGTGCGCAACTTTACTTACGGTGATGATAAATACCGGGGCCGGATGGGCGCACCGTCACACGGGCCGACCGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCGGGCTTAAGTTACGTATCAGTATGAGAAGGACCGCATCACCATCTGCCGACAGCCTGAACCGCCGTGAAGTCTGCTGCACACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACGCGCGCGGACGGCAGCGTCACGCAGAGTCAGTTTGCTGACGCGGTGGAGGCAGGCTCAGAGGCGCAGACGGATGCCGCAGGCGGGACAACGAATACAGTCCGGATGTGGTGACGGGCCTGTCACGCGCATCACCACGCCGGATGGCAGGGGCATCGGCGTTTTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCTGACTGGGCTGGAAATACGCCGGGAATACTGATGAATGGGGCCGTCTGATTAGGAAGGCTGCCCCTGACGGCGATATCACCCACTACCGTTATGATGTCCACGGTGAGCTTACCTGCGCAACGGAAGATGCCACCGGCGGCGGAAAACCATGACGTGACCGTACGGTCAGTTGCTGGCTTCACTATTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGGAGCACGCAGGGCCATGAGCGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTACCCCGGACGGCAGCAGAAACAGGACACAGTACGGTACGTGGGGAAAAGCCATCTGTACCACACCCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTTACCGGATTTGGGTCATCCCGCCTGACCAGTGAAACAGCAGCCACCACCTTCCGTTACGATGTACTCTCGACCGGCTGATACAGAAACCGGCGGCACGACGGCCGCGCACAGCGTTATCACCCACGACCTGACGGCAAACTTATCCGCAGCAGCGAGGATGAGGGCTGAACCACCCACTGGCACTATGACGAGCAGACCGCCTCGCACCGCACCGTGAATGGCGAAACCGCAGAGCAGTTGGCAGTATGACGAACGCGGCTGGCTGACGGACATCAGCCATATCTGGCAGAAGGGCACCGGGCGGTGCACTATGGATTATGACAGTAAGGAGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACAGATAGACTGCTCTGGCAGCGTAAAGAGACCAGACATGCGTACAGCGCACGGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCGTGACCTACGGCAGCGGCTGGCTGTCGGGCATGAAACTCAGCGACTACACCGCTGGTGGAGTACGCGACCGCCTGCACCGGGAAACGCTGCACCCAGCTTCGGCCGTTATGAACTCACCACCCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCGGAGTTACAGCTACGGCACCACCGGCAGGCTGACCATTTCACCACCGCAGCAGATCTGGATATCCGCATCCCGTATACCACAGACCGGCAGGTAACCGCCTGCCCGACCCGGAACTGCACCCGGACAGCACCCTCAGCGTAATGGCCGGATAACCGTATCGCCCGTGACGCACTATCTTTACCGGTATGACCGTCGGCAGGCTGACAGAAAACCGACCTCATCAGGAGGGTTATCCGCGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACGCGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTAGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGAGCTGGATGTCGCTGTCACGGAAACCGCCGTGACCTGGTACGGCTGGGACGGCGACCGCCGAGCCACGATACAGAACGACAGAACCGCATCCAGACGATTTATCAGCCGGGGAGCCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGGACTGGCGAAAACGCAGCGCCACCTTCGGCGGATACCCTTCCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCCGCCGGTGCTGGTGCGAATCTTTCGACCGGCTGGAAGAAGTGAAATCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCCGCAGCGCCACTGCGACCATCGCGGCCTGCCGCTGGCTGGCCCGCTATCAGCACGGAAGGGACAACAGCGTGAGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCGGCAACATCCGCCTGCCGGGGCAGCAAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCGCTGCGGGGGCGATATATCACTCAGGATCCGATTGGGCTGAAGGGGATGAATTTTATCAGTATCCGTTGAATCGATCTCAAATATAGATCCATTACTGGGATTAGAAACGCTAAAACCGTTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAAGCGGTCCAGATATATGGGGAATCCGTTCTATCAATATCTTTGTGTCCCAGATGGTAAAGGGGACTATACTGTGGTGGCCAAGACCAACGGGGAGAATCAAAAGGAGAGATGGTCTATAGAGGGGCCAGGTAGAAACCAAGTAATGATACAAAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATTCACACCGATTTAGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAATAGCAAGATGAAGTGCTCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGAGTGATGTAATGAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTTCACTATTAGACTCCACTCGTGATGTGAGCGAGTTAATTAGTCTCATGTCTTATGGAATGATGATGGTAATATGTTTTCCAACAGGCGCAGGTATTCTTTATTGCTCTAATATTTATAGGGACTGTATCAATTTATTATTGGCGTAAGTTGATGAAATAAGTATATATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGGAGGGTATATTCAATGGTTTGTATTAAGTGGCGCATTATAAACAAATAAATTAAAGTTAATTGCTCTTATTATGGGTTAAACTTGCAAGCAGACGCCGAAGATAGAGCGACAGGCAAAGAGCAATACGTAACTGG
>5e348aa0-252a-4ba2-b659-f460207d0f86
TTGGTATGCTTCGTTCAGTTGCGTATTGCTACTTGCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTAACTAGATGGCTTTCCCGCATCGTACTGTGTCCCGTTTCTGCTGCGTCGGGAGCAGCCAGCCGACGGTGGTCAGGTCACCGGCAGCTGTATTCATCACCGCGTTTCATGGCCCTGCGTGTCTTTCTGACAATTAACTGTCCACGGCTGTCGTATGCGCCGGTACTGACTCAGCCCAGCGCTTCCTCGCGCGGTGCACCGCCGTCCACCTGACCGAAACGGTCATGGTCGCGGGTTACATAACCGGAACAGTCGTGAAGCTCAACCTTTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAGAGTCGCAATGTGGATTATCATAACTGGTATGGGTGATATCGCCGTCAGGGCAGTTTCCCTGAATCAGACGGCCCCATTCATCATATTCCGGCGTATTTCCAGCCCGTCAGGTGGTGGCTGGCGATTAGCTTCGCTGGTGGTTATGGTAAAACGCCGATGCCCTGCCATCGGCGTGGTGATGCACGTGATAGAGGCCCGTCACACCACATCGGACTGTATTATTGTCCTGCCTGCGGCATCCGTCTGTGCCTGGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCACTGTTCCTTTTTCACCGCTTCAGCCCGCCTTCACCCTGTACGTGCAGGACTTCACGGCGGTTCAGGCTGTCAGTGATGGTGATGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCAGGTTTGGCTGTTCTGTCACCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCAGCCCGTGTGACAGTGCGCCACCATATCCGGCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTGCTGCGGTCATACCACCGCCTGCCAGTTCGCCGCGGGGCGATCAGCCATAGCGCACCAGCGGCGCAGCGGTAAATTCTCAGGTATTCCGGGTCGTGTCCAGCCACGGCAGACCAGACGGATGCCGTTGTCAGCCATATTCGGTGTAACCCGGCAAATTATCAGGCGGACGGTTCCGTCCCGCCGGAAATAACTTCTTTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCGGTACCAGCCGATGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTTCGTTACAGCGGCTTCGCGATGGAACGTCTGTTATTGCGCCCGAAGCGGTCCATAGCCCGATCAGTACCCGGTACGGCGGCAGCGGCACCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCGAGCAGCCACCGGCCTACGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCAGTTCGCCACGCCGCCGCGCGCCAGCCGCAGTGACTCCTTTAAGCAAACAATCTCTCACCGGAATTGCAAAAGCCAGTAGACTGCCGCCATTATCACTGGTATCAGTGTGTTATCGCCTGGCTATGTAAGCTGGATATCCATAGGCATTTTCCAGCCAGGGCCGAGGCTCCCCACCGGCGCAGGCGTTTTTGATCCGGTAACTGCTGTAGGTGCGGGAAGAATGAACGGCAGCGGGCCAGGCAGGGCGATGTCGGTTTTCACCGGGAAGGACCTTTGCACCGAGCAGCCGGTTGACCCGGATGGCGGACATCACCCCGCCGGGGCACACCGAACCAGGCCACGCCGGTGGGGGCGCGATGCGTACCCAGCTGAAGACCCTGGACAATGCTACCGCCATACTGCGTCATTGTCGCCCTGACGCGCCGCCGGTTTTCGCTCATCTGCTCATCATCCTTGTTTTATCGGGTTGTTTGTCTGTGACAGGCCAGAACCCTACAGATTTATAAAGAAAGCCCAGCAGAATTGCAGGATATCTGTCAGATAGAACAATTAGGAAAATATTTATATATGTTTCGCTTGAATATATATGTTTCGATTGGTATGACGATGTCTAAATATTCCTCTAGACATCTTCCTGATGCAAAAAACCATAAGCGTTTCCGCTGGCGGTTTTCAATAATATTCAAAACTCAATAGTAAATAAAAATCACCAGTTGCCTTTTCGTACAGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAATAAAGCGGGCGCGGTCTTTCAGAAAAGCATGAAAGGCAAGCGCCAGAGACGCCCATGCAAGCCGCATGAAATTGACATCAAAAGATAAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGCTGTCTGCCCGGTGATGGCACCGGAAAAATGAATTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCGTCGATACTTATTTTTTGCTTATTGATGGTTTGTTTACATTCATCACCGCCAGTGCAAGTTACACAAAGTTAAATTAATACTAAGCATTAGTTAAATCTGGCTTTTGCCATTTTATGTCTTTTACCCCGCCCGCAATTTTTGCCGAAATCTTTTGCAGCAAAATTCTACCCTTCCGGTATCACTTTTGGCCGCCAGGTGCATGAGTGCAGGCATGATAACCGGCGTATTGCTGGTGTTTTTATTACTGGGTTATCTGGTTTTATGCCCTGGCGTCAATGCGGAGGCGTTCTGATGGCTTTGCCAAAGGGTTAATACTGATCGCCACGTTTTACTGGTGTTGAATTTTGGCGTCCTTTAGGCAGCGGGCTGGCGCGGCGCTGATTAATGACATTCCACTCTTCCGGTACAACGGGCGTTGAGCGCGTACTTTCGCCTTGGCGTACTCTGACCGTGAGGATGAACTGGAAGCAATATCTTTTGTGCCGTTCTCGGCCTGGTTTATGCTGGGGCTGGCGGTGCTGTTTTATGATGTTGCTCAGTCCAGCACTATCTTGCCAGCAATCACAGCTTGCGGTTGCCAGGGCTGTCGTGCGGATCTGGCGCTGAATACCGCCGTCGGCTTTGTCACCAATACCAGCGAAAGCAGTCTTATGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGGCTTAACGTTATGGCTTTCTTTCTGCCGCCAGCAGAGTTGCGGTGATTTTTGCCCTCATCGTGCGTTTACCCGCCAGGCATGAGCACGCTCGGGAATGCACCAGATCGATCTGCTACGCATCACGTTATGGGTTACTGGTCCTGTGGCGTTATTGGTTGCTGTTTTTTATTCAACAAAGAATTTGCGCTGCAAAACTTTCTGCCTTATCGGGCTGGCGAATACCGTTGAAGAGGCGCAACAGCTGTTGCACCATGGGGCCTGTAGCTTCTCAAGGAAGCGTCAGATCTCGGTACTAACAGCGTTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTTGAAAACCAACCACGCGAAGCCAGCCGTGCGGATGCTGGCGTCTTCGCCAGTCAACGGCGCTGTACTTTGCTTTGGTGAAGTGAGGTTAAACACCCAAACAGACGCCGCAATATCCAGCACC
>f3bfcfc6-b5f3-4573-a280-2718d104f8d4
TTGGTATGCTTCGTTCAGTTGCATTGCTGCTTGCACCGCTCTATCTTGGCGTCTGGCGGAATTGTTTAACTATCTGGCACCAGCGTCAGAGGTAACCAAATTACCAGTGCAGTCAGTTTCATCGCGTACATCGATTTTTACCCAGATATTCGGTGTACGACCAATCATCCAGCCCGGCAAATGAAAACACATAACCGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCCGCTTCACCAATTTGCATCAGCCCACATCGGCACCATGCCAGAGCGATAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCATGCGCCGAAACGGCTCTTTGCACCTTCCATATTGATGCTGCTGTCCATTACTTGGTGCCAGCAGATAGGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCTGGCGGCGATCGTATCACTTCACCAAAGGCAAAGCACGGCGCCGTTGGGATGAAGATCGCCAGCATCTGCACGAAGTTGGTCAATGCGGTTGGGTTTCAACGGATGTGAGTTGGCATTAAAAAGCCACCGCCATTTGGTACCGAGCATCTTTGATCGCTTCCTGAAGCTACGGGCCCATAATTGCAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAAGACAGAAAGTTTACAGCGCAGCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGATACGCACCCATATAGCGTGATGCGTAACCTTAGATCGACCCAGGCATTCCGAGCGTGCTCGTACTCTGGCGGGTAAACGCCGCACGGATGAGGGGCAAAATCACCGCAATCCGCTGGCGAAAGTTTGCACCGTTAAAGCCCGCCGTCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTAAGATTGCCAGTTGGTATTGAGTACAGACCAGCTGACGGCGGTATTCAGCGCCAGATCCCGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACGCCAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGGAATGGCACAAAGACGTATTGCTTCCAGTTCATCCCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAGATGTCGTAATCAGCCGCGCCAGCCCGCTGCCTAAAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATGTTAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAGCCAGTAATAAACACAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAGATTTGCAAAAATCTGCGGGCGAGGGTGTAAAAAGTATAAAATGGCAAAGCCATGATTTAACTTCATCGCAGTAACAATTTAACTTTTGTGTAACCCAATTACAGGATGAATGTAAATAGAAGCATCAATAGCAAAAATAAATTGGTCGGATGGTGATAAGAGCCACCGAAGGCGGTACTATTTTTCTGGATAAACAAATTCATTTTCGGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAAGTATGCTACAGAATATCTGCCATGGCATCTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATCTTTCTGGAAAGACCGCGCCCGCTTACGGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCGAGCCGAAAAGGCTGGTGATTTTATTGATTGCTGAGTTTGAACCGTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCAGTTACCAATCGAAACATATATTCGCTGATATATATAAATATTTTCCTAATTGTTTCTTATCGGAATATCTCACTTAAGGCTTTCTTATATAAATCTGTGAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGCGACATGACGCAGCGGTAAGCATTGTCAGGGTTCAGCCGGTACGCATCCGGTGCCCCCCACCGGCGTGGCCTGTTCCGGTATTAACCCCGGCGGGGCGACGTCCGGCCATCCGGTCAATCCGCTGCTCGTTACCAGGTCAGCTTCCCGGTGAAACCGACATCGCCCTGCTGACCGCTGCCGTTCGTTCTCTCCGCACCTACGGCAGTTACCGGACAAAACGCCCGCGCCGGTGAGGAGCCTCATTTGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACCTGATACTCGGTGATAACGGCGGCCAGAAGCCTGTATTTTGAGCACCTGCCGGTGAGGTTGATTTAGCCACAGCGAGTCATGGCTGATGCGCGGCGGCGTGGCGAAACTGGATAAAGGTCACCGGCTGGCCGCCTCTGGCAGGCGCTGCGGAAGAACTCCAGCAGAAGTCCGCATCGTTATCCACGGCGACAAACATAGTCCTGGGGGCCGTAGGTGGCTGCTCGGCTGGAATTGAGCAGGTGCCAGGAAGCGGATGAGGTGCCACCTGCGCCGCTGCCGCCGTACCGGGTACTGAAACCGGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACCCCGATACGCAGGCACCAGCGGGCAGAAGAAGCCCGGCAACGGGCCATTTCAGCCAGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCGGGACGAAAGCGGCATCCGTCTGTCTGCCATTGTGGCTGACTGGAAACCCGGAATACCCGGAGGGAATTTACCGCCGCCGCTGGTGCGCGCTATGGCTGGAACGCCCGCAGCGAACTGGCGGTGTATGACCGCAACCATACACGACCTGCCGCACCCAGCTTTACTTACGATGATAAATACCGGTGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGGCGAAAGCGCGACGGGCCGACAGAACAGCTAAACCCGGCGACTGGTTACGTATCACGACATGGAAGGACCGCATCTGCATACCGACCAGCCTGAACCGCCGTGAAGTCCTGCACGCAGGGGTGAAGGCAGGCTTCGGCGCTGGTGGTGAAAAGATACCTGCGGGCAGCGTCACGCGAAGTCAGTTTGACGCGTGCAGGCAGGCTCAGGGCTGGAGCGGATGCGCAGGCAGGACAACGAATACAGTCCGGATGTGACGGAGCTCATCACGCGCATCACCACGCCAGTGGCAGGGCATCAGCGTTTTACTATAACCACCACAGCCAGTTAACGTCGTACCGGCCTGACGGGCTGGAAACTCTGCCGAATATGATGATGGATGGGGTGCGTCTGATTCGAAACTGCCCTGACGGCGATATCACCCTTACCGTATGATAATCCCACACGGCTTACTGCGCAACGGAAGATGCACGGCGGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTACTGATTTTCGGTTGTATGGCAACCCGCTTCATGACCGCCTGACCGTTTTGGTCAGGTGACGGCGAGATTGCACCGCGAGGAAGAGGGCGCGGTCAGTACCGCGCCACGGCGTGGACAGTTAATTGCCGTGAAGACACGCAGGGCCGCCGAAACGCGGCCTGAATACAGCGCCGCCGGTGACCTGACCACCGTCGTGCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAGCCATCCTGTACCGCAGAGCGGTCTGGCGCGCAGTATGGAATACGATGCTGCCGGACATATCCGCGCCTGACCAGTGAAAACAGCAGCCACCACCTTCCGTTACGATGTACTCTGACCCGACCCGATACGGAAACCGGCTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGCGGGATGGGGGCTGGTCACCACTGACACTACTGGCCAGAAGCAGACCGCCTCGCACCCACTGCGTGAATGGCGAAACTGCAGAAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCATAGTTATGACGACAAAGCCGCCTCGCCAGTGAACACTGACGGTGCATCATCACCAGACGAATGAACTGCTCTGGCAGCATAGAGACCAGACATGCGTACAACACCAAAGGGACGAACCGCTGTATATGCGGACAATACCGCACCAGCGAATGGCTGACCTACAGCAGCGGCTGGCTGTGTCAGGCATAATCTGGCGACACCGCTGGTGGGTACACGACCGCCGCCGCAGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCTTATACCCTGCCGGGGCGGTTACAGAGCCAGCACCCTGGAGCAGCCTGCTGTCTGACCGCAGTGCACCTGGAACGACAACGGCGAACTCATCCGCATCAGCTTATTGCGCCAGACCCAGGTTACAGCTACCGCTGCACCGGCAGGCTTTGACCGGCGTTCACACCACCACGGCGAATCTGGATATCCGTCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCGACCGGAACTTCACCCGGACAGCGCCCTCAGCATGTCGGCGGATAACCGTATCTGCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAAACCGACCTCGTCCAGAAGGGAGTTATCGCACGGATGATGTTTTTACCGGTACCGTCAGCACCGGCTGGTGCACTACGCCGGTTTGTATGCAGAGCCGCTGGACGAATAATATCTTTACGACCCACGCGGAGCGCAAGGTGGCAAAACGGGTATGGCGGCGTGAACGGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCTGACCACGATACGGAACGACGAACCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACAGCGCCGCGGCTGGCGGATACCCTTCAACCGCTGGTCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCGATGCTCGACCGGCTGGAAGAATGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGTACGGATGCAAAGCCAGATGGACCCGGTACTGCACGCCGGCGCGAAAAGTTCACCTGTACTACGCTGCGACCATCTTTGGCCTGCCGCTAGCCCATATCAGCACGGAAGACAACAGCGTGGTACGCAGGGTAATACGATGAATGGGGTAACCTGCTGAATGGAAGAACCCGCATCAAGCTGCCCGGCAAAGCTTATCCGCCTGCCGGGGGCAGCAATGCATGATGATGGAGGTCCGGCCTGTATTACAACCGCCACCGCTATTGACCGCTGCAGGGGCGATATATCACTCAGGATCCGATTGAACGAAGGGGATGGAGATTTTATCAGTATCCGTTGAATCCGATCTCAAATATATAGATCCATTAGGATTGAAACACTAAAATGCATTAAGCCACTGCGTTCAATGGAATAGGTTGGTGAAAGAAGCGGTCCAGATGTAGCTGGGGGAATCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATGCTTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAAGAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAGGGAAGTTTAAAGAGGTAAAGGCCGCGTTATTCTGTATTGCCTGATATATTCCACACCTATAAATTTAGAATTATTTAAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGTTTGTATTCGCCGGGTGATGTAATGAAATATATTGAGTTAAACACCCAAACGCCGAAGATGAGGCATA
>3221ccdb-0395-4983-8a44-e5558664096f
TGGTAACACTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCCCGGGTGTTTAACCTGGCGACCATAAAATTCTCGTGCAGATTCGCAATTCTCAAAGACACCCGAAATACAGGGCAAATACTCTGCGAATTACACACGTTCTGATTTTCGGTAGCAATAAATGCCGGGATGCCATAACCCGTGGCATCGATTTCATCGGGGATTTCCGCCATAACATCGTTGAACTGATAAAACTATTGCCGCCACATCGATATTACGACTTTCATTAATGTAGATACATTCTCGCTGCGTGGTAAAACGGTCCGGGCAAGAATCTAACTAACCGCAATTTTTAATTTTGGCATTTTCATCTCTTTATTTTAGGTAATAGCAGGTCCTCAATTTCTCGAATGAGAAATCGATCGTGCTGAAAAAGCAAAATTACCCCGCTGATAAATAAATCAGGTGATTGCTTTTTCTGAGAATCTGAGAGCCTGGTCAGGTGGCTGATAATGGGGTTAACAGAGAATGAGCACTGCGGAGCTAAGGCATATACCTGTAGCCTGAAAGTCAGGAAGACTGTACGCTGAAGTGCCTGAGTCGGTAGACTAACGGGCATTGAAAGTGAAGATCGAAGCTATTGCGATGAGCAAACTTCATAATATGGAGTTGTCCGCCTTATATGGGAGCATAAACGGCTGTTATTTTCCATTTAATTTACCTTTCCTGATGATGTGGAATGAAGGTGAAGATATTATCAGGAAATACCTGGTTGAATGTGAAATTGATCAATAAAAATGATCAAATCTTAATTTATTTAATGGTAAGGCTTTTTACTCAAGTAATACTAAAATATTGAATTGTTATTTTGTGTGTTGTTTTAAGATAAAGCCGGCAATGTTATTAATACGGCACAATTAATAAAAAGGCAGGCTGTATTAAAATTAATATTCAAAGCATAAACCGATAGCCAATACCCGGTTTCAGTAATGAAATGGCGTGGGCGGGCGGGATCCTGTTCAGTTTTTGTCGCAGATGTCCCATATAAATACGCAAATGGTGACTGTGTTTCGACCGCGTTTATTTACCTGGTTAAGGCTGGCGCTGGGTGAGTACTTTCCGGCGTATTGAGCAGCACCGCCGGCGGGCGGAACTCAATTGGTGTGAGATGCACCTCTTCTCCACCCATTCTGAGATCACGCGGGCGGCTAAATCGACGGTAACATCGGAAAATTTACCAGCGGATCGGGCGCGGTGGTGGCAGAGTGTAGCGGCATGTCACGACCGCGCAGACCGGGCCTGCAATTCGCCAATGCCAAACGGCCTCGATAATCATCCGCTCCGGCATCCAGCGCGGCGATTTTGTCGCTCTCTTGCTGCGCACGTGCGGGAAAGCGCAATCACCGGCACCGCGCTCCACTGGCACTGGGTCGCGGATAAACTCAATCCCATCACCATCGGGCAGGCCGAGGATCGGGGAATAATCAAATCTGGCTTACGGGTTGCCGCTTCCAGCAAGCCGCGTTGCAGCGTTTCGGCCTCAAAGACGCGCATCCGTCGCCCTCCAGCGCCGTGCGCGAAAGCGACGAATAGCCTGTTCATCTTCAACAATCAGAACGTTTGTCACATATCCTCATGAAATTCTTCAAGTTCAGGGGCAGTTTGCTGGGAAGTGTAACACGAAAACAGGCACCACCTTCCGGTCGGTTGAACGCGGTAATAGTGCCCCCGTGTGTACATCCACTATCGCCCGACAAATTGCCAGTCAAGCCCCTACCCCAGTACTGCCGACTCTTTTATTCCGCGAACAAACATCGATATCGTCTGCTCCTGGCCTGGCGGAAGACGGGGCCGTTATCCCAGACATCCAGTTGTAGATTTTCACCGCCCTCCAGCATTAGTGCTCGATGCCAATTTCGGCCTGCGCACCGCATATTTCACCGCGTTCTCCAGCAGATTAATCAGCGCACCCGTTCAAGAGTGGCCCGTCAACGTGGATTAAGGTCAGCGGTTCTGGCAGAGAAAGATTGATGGGCGACGATAAGAGCGTTCCAGCATTTGCAGCGCTGCCGACTACTTCAGCGTTAACTTCCTCTTTCTAACGAATTAAAGCCGCCGGACTGAATTCGCGCCATATCCAGAGTAAGATTATTCACCGGTCGGGTAGTGTTCGGCATGCTGACGGATCTCGCGCTGGCCTGGCGGGCGTGGGGTGGTGATCGCTTAAACGCAGATCCGAGGCGTTAAGATTTCTGCCTGATAAAACTGGCACCGTAAGCGGCGTGCGTAAATCATGCGAAAGCGCCGCCAGCAGGGCGTTGCGGATCTGTTCCACGTTCGCTTGCCATCGCGCCTGTTCTTCGCTGGCGGTTAGCGTCCAGCCGCTCAGAGCATTGGCGACTAACCCAGCGTAAACGTCTCCAGCAGGCGCTGCTGTTCAGGATCATCAACTGGCGCAGTCCCCAGCTCCACCACCACCAGCCCGTAGGTTTTTCTCGCCGCTTTTTAGCGGCAAAATCTGTGCAATTTACACCCGGGTAACGTGTCGGTGCCGCGCCCGCAAGGCAGGCCTTTATCAAAACTCCGCACTGCGCGATGGCATCGTCCCACGGCGTCATTCCTTGCGGATGTGTTAACGGCTGCAGTTACCGTTGTCATCGGGCAAACAACACCTGACTGCGGGCGAAACGTGGAGGCAATAAATTGTTCGCTGGTGGCAGCGATATCCTGGACTGCGGCCCACCGCCAGAGCTTTCGACATTTCATATAAGTGCCGTGTGCGTGCTCGCGGTAACGGAGCTGCCACCCTGATAACGCCGGCAGTAAGGTTCCCCTCACCAGCCCGACGGTTAACATCACCGCGAAAGGTCAGCAGATATTGCACATCAGAGACGGCGAGCGTGCCGCGTGGGGCGATAAAAGAGATCGAAACTCACTGCATTAATGACGGTGGCAACCACTGAGGCCAGCGTCCATAAAATGGCGCCACCACCACCATAAGCCGGTACAGCATCACCAGGTTGGCGGCATCAAACGCCATCAGCCACTGCATGGCAATTAAAGGTGATAACGGCGCATAACGCGGCGGCAACCGCATCCTGAATTGTACACGCCATGTCTTTAAAAACGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTGGTTCATCAAGCGCGACCAGCACCTGATCGAGATCAGGGCGATGCGCGCCAGTCGGTCAGCAAACGTTTCCCCGACGCGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAATAATCTTGCCGAGATTATGTTCACGGGCATAACGCACTACCGCTTTCTCTTCCGCTGGATCGAAGTATTGCGTCTCGCGCCCGGTTCACGCCAGACGTAAGGCGCTGAGAATTGCCCGACGTTTTTCCGGTAAGCGGTGCAGGGCAGGGGTTTCAACATACACCGCGTGCCAGACGCTACCAACCGTGACGCCAGCCGCGCCGCTGCGCAGCCAGTTTTCGCTGCCGGTGTTATGGCCGATGCATAAAAAGGATCGCGTCGCGCGTGTGCCACACTTTCTCTTCGCCAGGATGCCCCGCCAGGCGCGCATTTGCTCATCAACGCGATCAAGCGGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCCAGCTACGGAAAAATGTTTGTCGCGCGCTCCGCCTGCCCGGCAATATGAGCTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGGGGCAAAGTCACCAGCACCACGTCGTCAGCGGCATCGAAAAGGATCGGGCACGGTTTCCGTGCCTGAATTCCGGTGACGCCGCTGACCACATCATTCGAACTTTCCAGATGCTGAACGTTGACGGTAGTGAAAACATCAATGCCAGCTTCAGCAGTTCTTCGATATCTGCCAGCGTTTGGATGACGGGAACACCAACATTACTGTGCGCCAGTTCGTCCATTAAAGATCAGCGCCGGGCGGCGGGCGAGGGGCAGCATCGAGATCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTAAACGGCACAGAACAGCCAGCCCTTCCAGCGTAGCGGCGGTATCTTTCGCCCGTGGGTTTCACCACGCCAACCACAATATCAGCCCTTGCGCCCGCCGGTCGCTGAACTTCTGCCAGCATCGCCCAGGTCTTCCCGACGCCTGCTGGGCACCGAAACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCAGCAGACGATCAGGGTCGGGACGTAAAGGGTTCGTTATTCATCAAGTTTATCAGCGCCAGGTGGGTTCAACAATGTTGACGCCGGCTGGCCGATATATTTCACCGAAAGCAGTTTATTTGGCTGTATTTTGCGATCAGTTGCGTAGGCTGTTCCAGCGCGCTGAGATTACGCTTTCGCCACGCGTGGGATTTGCCAGGCCGCCGCTTGCGGTGATATTATTGTCAACCCTTGCCGATGCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCAATAAATGCAGCTTAACGCGTGCAGCTGTGGTTATCCAGCTCAGGGTTACTGACCGCCAGATTGCTCCCGCCAGAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAGATAGCCGTTGCCGAGTGCATTCTGCCCGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCCACATTGGCCTGCCAGAAGCCACCTATTGCTGATACGGTGGTCAGCAGCGGGTAAACGCCGCCAGTAATCAATAAGAAAGATAAATGTTGATAATGCCGGACGCCAATCCTCGCGGTAAACCTCCACCAGACGCAAAACGGTCAGCGGTAAATCAATGACTTTGATACCGATAAACAGCGCCAGCGGCCCACGGAACCGTAAATCCGCCAAGTTACGGCGCAACATGGCAAAGAAGCGGTAAGCGGTTTATAACTCACGCCTTTAACGCCAGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGTCGGGCGAATGCAGGCACATGATGTTCCAGCGCATTTAACTGCGGATACGTTACGCGAATGCCGCCGGAATAATGGCGAGTATTTCGCCACATCTGGTCAACAATGCTGAAGGTGGTCAACGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAATTCGGATCGACCATATTGCCCGCCTCTTTCGCCGCCACAGATTGCCGGAGTTCATCGCACCGCGACATCTGCCTGCGCCAGCTTCCAGGCATCGGTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCCACAGTACTGACGGATCAATGCCAACGGCCTCGGTGTCGCTCCGGCGAGAAAAATCATCGACACCACCCGCGCAACGATAGCGGCGGCAGTCAGACGGTTATCGCCATTAATCATCACCGTTTTAATACCCATTTTGCGCAGCTGGGCGAGCGCTCTTTAGCCACCGCCTTTGACGATATCTTTAGCGCAATAACGCCTTTACGAGCCTTTACACCACCACCAGCGGCGTGGCTCCTGACGCGCAACCTGACGTCGACTTTTTGATCAGCGCATCGGTAGGGAAGTGACCACCGTTAACTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCGGCTTTGCGCAGTAACCGGTACAAAGGTGGCGCTTCAGGCGACTGCACATCGCGCTCGCGCAGGATTCCGCTTAACTTCGCCCGGCGGGATCACAATGCTGCGGCCCTTTCCGGCGTTTCATCAGCCAGCAGAAGCCAGTTATTGCGGCGTCAGCCAGCGTTTTCATCCGCCCTGCGCGGATAAACTCCGACGCTGACGGTTACCGAGTGTGATGGTGCGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCGTCCGCTGGTAATCCACATTCGCGCCAGCATCCGGCTCATCCCGGCGACGCCGTCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAACGCACCACCAGTACCGTTACGCTGACTGCGTACCTTGCGCAGCGAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAAATCAGCAGAATGGTCAGAACGAATTTCGTTTCAGCGTTTGCGTCAGCATTGCGCCTTCCACCATCGCGATCATCCGATCAAACTCGCCGGGGTTAACGCTGCACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGACGGAGGCAAAATCGCCGCCAGTTCACGGTCCCGCCGGTGCCGATTCTGATGATGGCGCTTTCATCGACCGATCACCCCTTCAATACTTCACCATCACCAGGGGATAATATCGCCGCTTCTACAATTACGATATCGCCTTTGAAGTTGGTCGGCGAACTTTGTCCGCCGCGGCGCTATATTTCAGCTCACGCAGCTTGCGGGCAAAGGCAAGTTTTCACCCCTTTCAGACTGTTGGCCTGCGCTTTACCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTGCGGTGATCCGCAGCCAACCGCTAATGGCCGCTAAACAGCGCATTGCCGGGCATCAGCACCGCTGCCATCGCGATGCTCGCTAGCCACAGGTGGTCAGCAGACTGCCGATCCGAACCCGATAAACATCGCCGGATTGCGCCACATTGCGCCTGCGGGTTTAATTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTTCCGAATAGCGCCAGTTGTTTGACTCATGTTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAAGGATAAAGGTCAGTGCGCCAACCAACAACACGGTGCCGGTCAACAGGCCAACAAACAGCGGGCCATGCGTTTAGCGCTTCGATGCCGGAACGGCGGCAGCTCTTACTCACCAGCGAACCTACGGCAATTGCCATCACCGGGATAATCACCCCGGCGACCAGAGCAAACATGCAGAACGCCAGTAAACGGTTCCAGAACGGAGTTGGCGCTAATCCGGCAAAGGCGCTGCCGTTGTTTGTTAGCGACGGATGACACGGCGTACAACACTTCAGCACTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCAGGGAGTAACCAGAATTGCCAGTGCGAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCGGTGTACGACCAATCATCAACCGGCAATAAACACCGCCAGCAGGATAGACAGCATCATGCCGTAAAGACCAGGGCCATTACCGCCGAACACCACTTCACCAATTTGCATCAATACATCGGCACCATGCCACCGAGGCGATAGAAGCAGATCATGCATCGCAATCCACCGCGCCACAGAAGCCCGCCGTCGTCACGACCAAACAGGCTACTGACCAGCGCGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGGCTTCCGTGCCCAGTCTCAACAGATGAAGTTACCCTGAACCTGCCCACATCACCACGCCTACGCAGATGACAAAATCATGACATCGCCCACAGCAACATGCGCCCTGGCGACGATCGCCCATCACTTCACCAAAGGCAAGCACAGCGCCGTTGGGATCAAGATCGTATCTCTGCACGAAGTTGGTCAGTGCTGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCGCCGCCGTTAGTACCGAGCATCTTGATCGCTTCACGCAAAGCTGGGCCCCATGGTGACAGCTGTTGCGCTCTTCAGCAGTATTCACAGCCTGATAAGGCAGAAAGTTTGCAGCGCACCTTGTTGAATAAAACGGTGCAATCCAACAACGCCACAGGGACTAGCACCCGCCAACGTGATGCGTAGCAGATCGGTAAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACCGCACGGATGAGGGCAAAAATCACCACCAATCCCGCTGGCGGCAGAAGAAAGTTTTGCCGTTAAGCCCGCCATCTGGCTGAAATGACTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTGTTGTTGACAAACTGACGGCGGTATTCAGCGCCAGATCCACGACAGCCTGGCAGCTGCGCAATGGATTAAGCGGCAGATAGTGCTGACCAGGCAACGCAAAACGGCACCATAGCCCCAGCATGTTCGGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAGTGCGCGAAAAGAGTACGCGCTCAACGCCCGTTGTACCGGGAAGGAATGTCATTAATCAACCGCCAGCCGCTGCCTAAGGACGCGCCAGCACCATTAACACAGTAAAACGGCGATCAGTAAGAACCTTGCGCAGCCATCAAGAGAACCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAGCACCAGCAATACGCCGGTTATCACGCCCGCACCTCACAGTGCGCCTCCATTGGCCTAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAAAGTATCAAAATGCCAAAAGCCATGAGTTAGCTTAATGTTTAATGTTAGAATTTAACTTTTATGGCAAATTACAGGATGAATGTAAATATAAACCATCAATATAAGCAAAAATAAAGTGGTCGGATGAGTAGTAAAATTACACAAAAAGGCGTTACTATTTCATCAGATAAAGCAAATTCATTTTTCCGGTGCCATTCACCGGTGGAGTACAAAGGGGAAAAGTATGGAACTCTACCAGAGAATATCACCATGGCTTATCTTTTTTACGCCGTACTTATGCGGTTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATCTTTTCTGGAAAGACCGCGCCCTTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGATTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATGTCGAAACGCCATAATTCCTGAAATATGCCATAAATATTTTTCCTAATTGTTCTTATCTGGCCAGATATCTCGCAAAGGCTTTCATAAATCTGTAGGGTTTCGCCTGTCGGAACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCGATATGGCGGTAGCATTGTCAAGGTTCAGCCGGGTGCGCATCAGTGCCCCCACCGGCGGTAGCCTGTTCGGTGTGCCCCGGCGGAAGTTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCACGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATAACCGCTTACAGCTGCGCGATAACACACTGATACTCGAAGTGATAACGGCGGCAAGCCTGTATTTTGACACCTGTTTCCCGGTGAGGACAGTTTACAGCCGCAGCGGAGAGTCGCAATGGCACAAATTGCGCGCAGCGGCGTGGCGAAACTGGATGAAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGCCGTGGTACGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCATTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAACCGCCAGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACGCACTGACCGCAGGCGCAGCGGTAGAAGAAGCCCGGCAGCAGGCCATTTCGGCGGGACGGAACCGTCCGCTTTCCTGATACCCTGCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCACCATCTGCCGTGTGGCTGACGCACGACCCGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGATTAATATGACCGCAACCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACGGGGGCCGGATGGTGGCACTTACCGTCACACACGGGCCGACCGAATCATTACCCATTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCGGCAGGCTTAAGTTACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCTGCGTGAAGTCCTGCACACTTGGTGAAGGCAGGCTGAAGCGAGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCGAAGTTTGACGCGGTGGGCAGGCTCGGGCACAGACGGATGCCGCAGGCAGGACAACAAAATTACAGTCCGGATATTGGTACGGGCCTCATCGCGCATCACCACGCCGGATGGCGGGGCATCGGCGTTTTACTATAACACCACAGCCAGTTAACGTCGGCCACCGGGCCTGACGGCGGGTACGGAAATACGCCGGGAATATGATGAATGGGGCCGTCACAGTTCAGGAAACTGCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACAGTGACTTACCCACCTGCGCAACGGAAGATGCCACCGGCAACGGAAAACCATGACGTGGAGCCGTTACCCGCGGTCAGTTGCTGAGCTTCACTGACTGTTCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTACACCGCAGGAAAGAGGCTGGAGTCAGTACCGCGCATACGACAATACGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATAGAATACAACGCCGCCGGTAGCCCTGACCACCGTCATTGCCCCGGACGGCAGCGAAACGGGACACAGTACGATGCGTGAGGAAAAGCCATCCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCGTGAAACGGCAGCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGGGGATGAGGGGCTGATCACCCACTAACACTATGGCGAAGCAGACCGCCTCACGCACCGCACGTGAATGGCGGAAACCGCAGAGCAATTGTAGCAACGAACGCGGCTGGTTGACAGACATCAATACATATCAGCAGAGGCACCGGGTGACGGTGCACTGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGATTGCATCATCGCAGACAAGATGAACTGCTCACAGCGGCATGAGACGAACATGCATGCAACGCACAGGGACTGGCGAACCGCTTTGTATACCAGGCAGCCTGCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGTATGAAGCTCGGCGACACACCGCTGGTGGAGTACACCGCGACCGCCTGCACCGGAAACGCTGCACGCTTCGGCCGTTATGAACTCACCGCTTATGCCCCTGCCGGGCAGTTACGGAGAGCCAAGCACACCTGAACAGCCTGCTGTCTGACGCGATTACACTGGAACGACAACGGCGAACTCATCCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCGGCAGGCTGACCGGCACGTTCACACCACCGCAGCGAATCTGGATATCACGTCCGTATGCCACGAGACCCGGCGGGTAACCGCCTGCTTGACCGAGCTTCACCCGGACAGCGCCCACTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCGGGCTGACGGAAAACCGACCTCATCCCGGAAGGGTTATCACACAGATGATAGAGCGCACCACCGGTACCATTACGACGATCAGCACCGGCTGGTGCACTACACGCCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAAACGGGTATGCTTGGCATGAACTTGGACCTGACGGGCTGGATGTCGCTGTCACGGGAAACCGCAAGTGACCTGGTACAGCTGGGACAGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGGTTTATCAACCGGGGAGCTTCGCCACTCCCATCGGGGTTGAAACCGCCACCGGTGAGCTGGCGCTTAAAGGTTAAACGCAAACGGACGCGCCGAAGATGAAGGCACC
>71408c92-f605-49e0-9230-1809837ae8c8
TTGGTATGCTTCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGGCAGGTGTTTAACCTCCAGTACACGGCGAACGATAGAATTTTGGTCGCGCTCGTTTACCGCCAGATGGTGTCAACGCTATCGATGGAGTATCAACAATAACGCGGTGACGATCAGCCCGCGCACGCCCCAGCAGCAGTCATCTTGTGGAACAGCAAATTGTTCGATATACCGCTGGAATAACATCGCCAGTAGCAGGGCAGAAAGTTGGCAAAAATAAAGTGACGTAACTGAATGTGACGTCGGAAAACATAGGAAAAGCGGCGAAAGCGCAAAAACAACGGCAACCAGCGGCACTAATGAGAGAGCAACGACACATAGGCAAGGTTACCTGCCAGGGTTGTCATGTTGTCCTCGTAATGCGTTAAGTGAACACCAGCCAGGCCCTTAGTGGACCGGAGTACGGTGCCTGGCTTTGTCCTGAATGGTTTTAGCATAACACCTTCGCGAAATAGTCCGGGATGGTGGTTTTATCTTTCACCAGAATACTGGTAATGCTGCCCAGCTGATTGGCTCCTTCTATATTATCGGCGTTATCGTCGAAAAAGACCATATCGCTGGGTGAAAAACCAGCTCCGCCTGCAAAACATGCTGGTAAATTCGTGCTTCAGGTTTACGCATCCCCAGATCTTGCGACAGATAGATGGTCAGCAGCATCACGAATTTCCGAATTCTTCCGGCCGAAGGTGGTATGCAGGCGGTTGGTAAGAAAACACCACCACGCGATGCCCCTGCTCACGCAGTTTATGCATGATGGCGATCACTTCGGGCGCAGCGCAACAAACACCGCCTGCCAGCCATTGAAGGCTGCTCGTAGCAGCGAGTGAGAGCCATCTCATAACCACAGCGCCTGCGACGCTTCGTCGCCTAATTTCCCGCTCATGCTGGTGAAACGCCTCCCCATGAAAACTCTTCTTAAGCGATGCCAGCCGGAATACGCGTTAAATCGCTCCAGGCTCCCAGCACACGGTTAAAGTCGATATCGACAATCACATTACCTAAATCAAAGATATAGAGCATTTTTTACCTCCTTTCGCGCCACAAAGAAGTGCTATGCGGCGGGAAAGGATGGGTTTAACTGTATGTGGCCAATTATGAAGCCAGGTTAACGGTCACAAAATCTACGCGTCTTCCTGGGAAGAATGATTTCAAGTGGCTGTCTTGTAAGCGTGATTTTTAGCGCAGCGAGCGGCAGCTCGTCGGTAAAGAGCGCAGTGACCTGTGCCACGTTACCAATTTCAACCGCGCCGAAGCATGATACTTAGATGTGATCGGCGACCGGCAAATATTTCTCGCGTGCGCCATCATCGTTTTCACCACGTTAGCCGTTTACATCAAACTCCATCAACGCGCCATCATCTCCAATCGCCTGACGCTTGTACAGATAATCAGCACGAAAATCAGCCACAAAGGACGCCGCTGGGGCCAATGATCCCGCGCTATTGTAGAGAGCGCAACGTACCGCCGAACCATCACTTCAAAGCGCGGGTTGTGGTAAAGAATATGCGCCACGCAGGCTGTTGGTGATTATCCGCAAATGATTATGGTTAAAGTAACGCCCGGGCAACATGCTCAACAGTCGTACCAATGGTGATAAATATTGTTGAACCATCAGGAATATATCAGTCTGCCACCGCTACGGCAATCGCTTTTTCCTCGGTTTGCGAAACCTCGCTGCTCGAACGCCGTATTAACGACGCTTCATTGACCCGCGCCACCGTGATGGCATCATCGAACCTGCTCAGCAATTTACGAATAACCGGCGGACCGTCTGCGTGAGACATCCAACAGATTTGCCAGGCTCATCAATATTCATATACCCACGCTCGGCGATCAGCATGAGTTAGTCGTGCCGCGGGACACCGGTTAGTTCGGTAAGGCTCACGAAAATTCCTCGAAAACCACCATCACCCGGCATTTTATACAAAAGTGACAAAAGATCGGGTTTGATCACAGTCAGGATCTGGCTCCGTCCGCAGGACGTGTGCATTTTAACGCCGCCGCTACACCGCTGGCGAAGCGGACTGACTCCATAAATCCCCACTTGTTTAGCGCCACCGCCAAAGCGCCGTGAAAAACATCACACCCGCACCTGTGGTATCTACCACATCAACTTTGAGGCAGAGTTGATGCTGACGCCCACCATTTTCCAGCCAGTCGCGGCCTGCGCTTACCCTGGTCACGCAGACGCTGACCATTTTGTGACGTTTGTGCCTGTTTTTAGCGCTGGCATCTCTTTCACGCCGTTAAGCGCACCAGACCCGGTTCTGAAAGGCCGCGTGATCCGGCAATGCCACCACCAGCTCACTGATATCCTGCGGCGTAATGTCCCCAGTCCAGAACGGTCATCACCCGCCCTGACGGGCCAGGAGTGAAGGCTTTTTCGCGCCGTCATTACCAGCGTACATCTGCCAGCACAACATCCCACTGAGAGAAATCAATTTCCTCCAACCACTCTGCGTCAGGCAGCAGATCCGACTGGGGTAATGGTTAATGATTAATCAACTCGCCTTTGGCAGGTATCCGCCATGATGGCGGATGCGAAGATTTCGCCTGGTTATACCGTTTGGTGTAACGGGTGTTAACGCCCCAGGATTCCAGCTCTGCCAGCAGGCTGTTGCCATCGTCATCACCTACGCGATAATAAAATCGACCTGCGCCCCCAGCCTTGCCGCCGCAACCTCTGCCATCGCCACTGGCCGCCACCAACTTCGTATAATTTCATACGTATTTACCGCTCTCCGTCGGTAACCTTCCACATGTCGATGCGATCCATCACGGTTATACCTACACAAACACTTACAAGATCATGGTCATTCCTTAAACATTTTTGGGATGCGTTCATTTTAATTCACCAATTGTTTAAAAAGCGGCAGCTGTCAATTTTGACGATAAATTACAAATACGATCAAAACGAACAAACAAAGCGTATCATAAATGACAAAAGTGACATAACTGTATTCAGGAGAGGTTATGGCAGCAATCGCGTTTATCGGTTAGGACAAATGGGTTCGCCAATGGCGGCAATTTATTACCCAGCAAGGGCATCAACTTCGCGTCTTTGATGCTTGAACGCCGAAGCTGTGCGGCATCTGGTAGACAAGGTGCGGCTCCGCCGCCAACCAGCGCAGACGCTAAAAGATGCCGAATTTATCATTACCATGTTGCCGAATGGCGATCTGGTGCGCAACGTGTTGTTCGGTGAAAACGGCGTTTGCGAAGGCTTATCTACCGATGCGCTGGTCATTGATATATCCACCATCCATCCGCTGCAAACCGATAAGTGATTGCCGATAATATACTAAACAAGGCTTCAGCATGATGGATGTTCGGTAAGGCCGTACTTCTGCAAATGCCATTACCGGTACTCTGTTACTGCTGGCTGGCGCTGCTGAACAAGTTGAATGCCACCGATCCTGATGGCGATGGGCAGTGAGTTGATCAACGCAGCGGTCCGGGCATGGGGATCCGCGTTAAGCTCATCAACAGCTTCGCCAGGCATCGCGCGCTCAATGCGCTTTCGGCAGAAGCCGCCGTTTTATTGCGAAGCCTGAATCTTCCTTCGATGTTGCCGTCAAAGTGATGGCGACGGTACCGCCGCCGGTAAAGGTCACTTCACCACTTCCTGTGAAACAAAGTCCTCAGCGGAGATCTTTCTCCCGCCTTCATGATCGTTGCCCATAGGATCTTGGCATCGCCCTTGATGTCGCCAACCAGCTTCCGTATGAAATGCCGCTGGGGCATCTGAGGTTTTATAGCCAGGCGCGCGCAACTTGGCGGTCGCGGTCGCCAGATGGTCCGCCATTCTGGGACAGGTCCGTGTCGAATGCCGGGATGACTGCCAAAGTAAAAATGTAACGACTGGATAAAGGAATAAATGAATGGGCAAACACATCCTTTGACATTACGCGCGCATCCGGGCGGTTTTGCCATGCTGGCGGTCGATCAGCGCGAAACCATGCGCGCCGATGTTTTGCCGCGGCTGGGCACCCGCTCGGTAGCCGATAGCGTTTTAACTGATTTCAAAGTTAACGCTGCAAAGGCCCTCTCGCCCCTTATGCCTCCGGCGATTCTGGTGATCAACAATTCTGCTACCGCCAGGTGGTTGAGCAAAACGCGATTGCCAAAAGTTGCGCCATGATTGTCGCCGCCGGTAGGTTCATTCCTGGCAACGGTATTCGGTCGATAGCGTGGTTATTGACCGCAAAATCAATCGCTAAGATCAAACAAGACGGTGCTGAAGCCAAAACTGCTGGTGCTGTGGCGTAGTGATGAAGATGCGCAGCAACGTCTGGATATGGTGAAAGAGTTCAACGAACTGTGCCACTCACGCGGTCTGGTAAAGCATCATTGAGCCGGTGATGCGCCCACCGCGTCGTGGCGATAAATTCGATCGCGAACAAGCGATCATCGATGCCATAAAGAGCTGGGCGACAATTGGCGCTATCTAAGTTGAAATGCCGCTTTTGGCAAAGGTCCGCAACAAGAGCTTCTCGTAGCTTCTGGCATCTGAATGACCATATCAATATGCCATGGGTGATCCTCTCTTCCGGTGTCGACGAAAAACTGTTTCCCGCGTGCCCGTACGCGTGGCTTGTGACAGCGGGCGCATCAAGTTCCTGGCAGGCCGTGCAGTCTGGGCATCGGTCGTCGGTTTACCGAACCGCAGGCTGATGTAGCGGCGTTTGCGCACCGAAATTACAGCAACGGCGTATTGTCCTGACGAAATGATGTAAAAGCACCGCTAAGATGAGGATAAAAGGAATGAAATGGTTTACTAAGCCACAACCGTGGCTGGAACGAAATCAAATGCATCTTTGATTTTGGTAAAAAATTTCCGTAGTGCCGACTGGTTTTGGCTGGTTTAGGTAATAAAGGGCAAATCAAAGAAGAGATGGGCACCCATCTGCATGGATCTGCTAAATATATTGCGTTTATTCCGTTGCTGCGGCGATGGGTCGACCTGGCGCTTACTCGTTGGTTGATCACGGTATCAAAGCCATATTTAAGCGCACGTGATAAAATATGGCGGTTGGTATGCCTGCGTGAATGGCGAGGGCGTGGTGGATGCCTCCAAACAGGGCTATCAACACTTCTTTGCTCTGCTGGTGCCATGGCATACGTCTGCTGCAGATCACCAGGAAGCGCGCAAATAACTCGGTGCCGCCGTGGAAATTATCGAGAAATGTTCTGGGCGAAGAGCAGATGTGCCTGGAATCCTCAGGACGAAGCCTTCCAGCAAAACCGAAAGTACCGCGGCGGCAATGCCAATATGCGCGGTGGAAGCCTCTTGATTGTTTATGACGTCACTCACGACAAAAATGGGCTGGATCGCGCATTCGCGTGGCTTCCGTGATTATCGACGTCGCCGAAATAATCATTATCGCGTTAACGAACACTTCGTACCAGTGGAATCCGCTGCGGATTTATACAAAGATATTGACGCATCCTTCCGCGCGTTCGGAAGTACCTGAGCCACTGGATCAGATGGGGCCGTTTAATGCTGCTTTTATCCATGCTGCCCTGGAAGCCCGTTGCGAACAACCACCAGCATGGCTGCTAGAAGATGCAAAGGTCTGTTTAACGCCACCGTGCGCGCGATGCCTGGGCACCACGATGGCGCGGACGGGATTGTTTATACCGTTGACTGGGAAGGAAAACCGGTGGTCCGCGAACGTGTACGTTGGCCTATCGTCGAAGCAATGGGCTGGCCTACGCGCTCTACACCGTCACTGGCGTCGCCAGTAAACCTGATCAAACATGGTGGGAGTACTGCATTAAGTACTGATGGACTATGAAAATGGGTTTCTGGTGGCAGGAGCTGGATGCGGACAATAAGATTTCACAAAGTCTGGGACGGCAAACAGGATATTCACCTGCTGCATTGCCTGGTGATCACGCGTATCTACGTTAGCGCCCGGCATGGCTCCAGCGGTTGCGGCGGGTCTGCTGGATGTGCAGAAATAACTGATCTGAAAATAGGGTGCGGGTTTCCCCTCTCCTAACCCCTCTCCCAAAGGGGTGAGGACCGTCAGTGCAGTTTTTGGGTTTGACATCAGCTCACGGGAGGCTGTATGTCAGATGATGCGTGCAATGCAGAAATCACCAGCTGCCGTGCAGTGGACAGACCGTTTCGCGCCGCGGGGATTATCCGCGACCATTAGCGACCGTCGGTGCTGTCACCGTGAATTAACCTTCCAGGGTTATCATTTAGTCATCGCACAAACCCGAAGAGATGCCGCTGGCGCATCTGGTAAAGTGCTTATTCCGGTATGAACCGGATCGCCAACTGGCCCAGTTCATCTCACGGTCAGAGACGCCAAAGTGCGCCGAAAAATTACGCGCTCAACGCCCGTTGTACCGGGAAAGAATTCGTCATTAATCCCGGCCGCAACCCGCTGCCTAAAGGACGCGCCAGCACCAGTAACACAGTAAAACGTGGCGATCGAGTAAGAACCCTTGCGCGGCCATCAGGAACGCCTCCCGTGATCAGGGCATAAACCAGATAACCCAGTAATAAAAACAGGTTAAACACCCGAAGCAGACGCCAAGATAGAACGCCG
>67ee25a0-86c1-44be-9b64-5a0db853eaf2
TCGGTACTTCGTTCCAGTTACGTATTGCTGCCCCTTGCAATCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTCGGCGTTTCCATCAGCCAGCAGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTTCATCCACGCCCTGCGCGTGGATAAACTCGACGCCTGACGGTTACCGAGGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCGTCACCCGCCGCCTCAACTGCGTCCGCTGGTAGCAATCACATTCGCGCCTAGCATCAGCTCATCCGGCGACACTGTCGCTGACAACAGGCCGCCAATGGTGGTTGGGATCAGACAGACCAGCAGCACCACCAGTACCGTTACGCTGACTGCGTACCGCCCCACGCGGAAAACGGCCACAACGTGGCGATTTGCCAGTAAAAGACGATAGTCGGGGCAAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTGCGTCGCTTGTGCGCGCTACCATCGCGATCATCCGATCCAGAAGTATCTCGCCAGGGTTAACACCACATAAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAAGTAGAAATCGCCGCCAGTTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCATTAACTTCACCATCGCGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCTTTGCGAAGGACGGTCGGCAGGAGCTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAACCAGTTTTCACCTTTACAGACTGTTGGCCTGCGCTGCTGCGGCCTTCTGCCAGCGCCTCGGCGAAGGCTGGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACGGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGGTACTAATACCAGACGGTCAGCAGACTGCCGATCCAGACGATAAATCACCCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTTGTTTACGGCTCATATTCAGTGCTCACTCAATATCATCAGGAGATATTCCGCCACCGGATAAAGCGCCAGGGCAGGGGATAAAGGTCAATTCGCCAACCAACGGCTTACGGTGTGCCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTTACCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCGAACGCAATGGTTGAACGGAAGTGGCGCTTAAATCGGCGAAACGCTACCGTTGTTAGCGGCGGATGACGGCGTACAGCGCTTCGCTAAAACCATGCGGGCAGGGTTGGTATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAAATTGCCAGTGCAGTCGGTTTCATCTATTGCGATTTTTTTACCCCAGATAATGTTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACACCGCCAGCAGGACAAACGGCATCATGCCGTAAAGACCAAGAACCGACACCGCCGAACGCCGCCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGGCGATGAAGCAGATCATGCATCGCAATCACCCGCGCCACAGGAAACCGCCGTCGTCACGACCAAGGCAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCGGTACAGCAGATGAGTTCCCTGAACTTCTGCCCACATCACCACGCCTACGCGGATGACAAAATCACTGACATCGCCCACAGCAACGCTGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAAGAAGATCCGCCAGCATCTGCACGGGGATTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGCCACCGCAAATTAGTACCGAGCGAAGCGATTCGCTTCCTGAAAGGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAACCTGATAAAGGCAGAAAGGTTTTACAGCGCACCTTTGTTGAATAAAAACAGTGCAATCAACAACGCCACGGGGATAGCACCCTGCGGCGATGCGTAGCAGATCGACCCAGGCATTCCCAGGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGCCAAAAAATCACCGCAATCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAAAAACCAACGTGGTTTCACCGCTATAAGATTGCCGAGTTGGTATTGGTGACCGAAGCTGACGGCGGTGATTCAGCGCCAGATCCTGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCGGATAGTTAGCGACCGAGCAATAAAAAACAGCACCGCCAGCCCCAGCGTATTCGGGCCGAGAATGGCACAAGATATTGCTTCCAGTTCATCACGGTCCAGAGACGCAGGGTGCGCGAAAAGAGTACGCTATCTAACGCCCGTTGTACCGGGAAGAGTGTCATTAATCAACCGCGCCAGCCCGCTGCCTAAAAAGGACGCGCCAGCACCATTAGCACCAATTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCGGTAATAAAGCACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCGAGTAGCCTAAAGGCGATACCACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCAGGCGGTGTAAAAAAGTATAAAAATGGCAAAGCCGTGGTTGTAACTAATGTTTTGTCATTAAATTTAACTTTTGTGTAACTTAATTACGGATGAATGTAAATAAACCGTAATGGCAAAAATAAGTGGTCGGATGGTAGTAAAATTGCACAAAAAGGCGGTACACTATTTTCATCAGATAAACAAATTCGTCCGGTGCATTCACCGGGTAGATACAAAAAGGGGAGAAAGTATGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTGCCCATGCGGATTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTCTGGAAGACCGCGCCCGCTTTTACACAGCTACCATCGCGTCTGGTGAAACCGGCGATAAACCGGTGTGGATGGATCAGGCCGAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTAGTCACATTAGAAACCGCCAGCGGAAACGCTGGCGGTTTTTTATATATCAAGGAAGATCTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAATATATATTCATGAAATATATATAAATATTTTTCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCCTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAACAAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACTATGACCGCAGTATGGCGGTAACGTGTCCAGGAGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGTGTTGACGTCCGGCCATCGGTCAATCCGCTGCTCAGTGCAAAGGTCCCGGTGAAACCGACATCGCCCTGCACCCGGCCCTTTGCCGTTCATTTCTCTCCCGCACCTACAGCAGTTACCGGACAAAAACGCCCCGCGCCGGTAGAGGCCTCGGCCAGCACAAAATGCCTACGGATATCCGCTTACAGCTGCGCGATAACACTGATACTCCGAGTGATAACGGCGGCAGAAGCCTGTATTTTGAAGGTTAAACTTACCCAAGCAGACGCCGCAATATCAGCACAACTTGCCTGTCGCTCATCTTCGGCGTCTGCTTGGGTGGTGCAACCTGCGGCTCCAAAGTAGATGCTCCGCCCGCCGTTGTCGTTGGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCACTTTCCAGCCGGGCCGAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCAGAGAATGAACGGCAGCCAGGCGGGCAGCGCAAAGATCCATCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAGATATCATCCCGCCGGACACACCGAGCACGCGCCACGCCGGTAGGCGCGCCAATTCTTACACCTGCCGAACCCTGGACAATGGGACCACACGCCATACTGAGTCATATCTCCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTTAGTTATTGTTCATATTATCCCTGTGTTGAAAAGCAAAAAAAATAAAATGACACAAGACCAGCTAATGTATTTATATATTTTCACATAAACTTGTTGTTCTCAATCAACAACGCTGTTATTACAGGTCACTTTCAATATTTTATTAAAGCTAACATTTTAGCACAGATGGTCATCATCCAACGAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTTGTAGGGCTATATTTAGAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAATAGAAAGATAGGAAATCACCGATTCAATAACATCATCAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCAATTTCAACCGAACTGCCCTTATTTACTCTCATCACCCGCAAACTGCCTGAACAGCGCCTTACCCTTAACCAGTCGCGCACCCAGCCAGCCGCCGAAAGCGACGGCAGCGGCGCTCCGCGCACGGCAGAACAATCCACAATCACCAGTCTGGCTCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCTGGCGCAGTTTCCGCACCAATTGCGGCCACCGGGCCGGAAACAAATTAAGCATGGCGAACTCACACCCACAACGTGGTACGCAGCAGTTTTTCCCCGCACCGGGTGTGCGCCACACCACCAGCTCCTGGTGACGCTTTGGCGCATTCCACCTGCACCTGCCGTAACAACAACATACCGCAGGCGGTGACCAGTACCATCACTTCCAGCGCCCGACCTGCCAGCACCTGACCGACCTGTTTCAAAATCGCGCCAATATCTAACGATAATGGTCAAAGGAACTGGCGGTTGAGTTAAATGATAATGCCGTTGCCATTCTCCCAGCGAAACTGGTAAAGCCAGCTCTGCGGTTCCGTCTAATACACTAGGGGAAAATAAAATAAGTGGTATAGACTTTCCCAGTCCGCTTTGCGCAAGGCTGGTCACTTTAGCGCGGAGAACTCACCGGTATCGCCATAAAAGTCAGGTATCACCGAGGGCAACGTTTAAGCGTTTTGCTTAAGCCTCTTCCATCCCGACACTTCCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGTACGTATTTTGCCAGGAGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTTCTGTCGGCTTATCATTAATCGCCATCAGCCGCGCCCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAGGAACGCGCACCTTGGTGCTACCTGTTCTGCAATGGCGATGTTGAATTAAAAAGTAGTTGGGCTTTCTGGAGTAGCTGCTGCTGGCGGTCGGTGATCGCCCACACCAAACGCAAACAGTACAGCTTGGCATAAAGGAGCGAAAATGCCAGCTGACTTAAACGTTGACCACGGCTGGCGTAACAGGCGGCTAACCGCCAGGCACCGAGGCAGCGATTTCAGCGTCATGCGGCGAAATGCGTTCAGCAACATCAAGCCCAGCACACCGCACAGCAAACCGATACTACCGCGCCCATGGCACCACCCGCCCAAAGCAGCATGCACCACCCATTAATCCGGCGAGCAGCGGCACAACTACCACACTGACAATCGGCAGATAAAACTTCCAGCAGCCAGGGCGTTCTTCCACCACATCATTACGTAATACGCGTAAAGAGGCTGCGTTGCCAGCAACAACGATATGGTCGTAGCCCACCAGCAGCAGAGATGACCGTCATGGTGCTAAGCGCCCACAGCCGGCCAGAGGCTGGCTGGCGGTAGTGCAACGGAGCAGAACAGGCGAGCAGCACCATCAACGTTTTCGAACAACGGGCCTATGGCCCCACCGGTAACGGCTGGCATCGGCACCATCAACCGCTGACCGACGATTGGCTTACGCGAAGTTGCGCTCGCCTGCCCCCAGCATTTTGAGGATCATACCGGATCGTAGCGGCTGCACGACGGTAATGATTCATCGCTACCGCCACGCACCACTGCCAGCAGCGGTCAAGCGCCGAAAGCAGCGGAACTGTTTGACGTTCCATCGATCGCCCAAACGCGCCTTCGTCCTGTTCAGGCCGTACCAGCGTTGTTCGGGTTTAAGCTGAGGTAACAACCATTTCTCGCCTTAGGTAAGAGCTGGTTCTCGTTGCGCCAATTTATAACGCCAGGTGACCCGACTCCCGGCTGCGGCTCGGGTTTATCGACATCCGCAGATTCGTCATCAGACGCGGGCCATCTGGAAGGTTAAAGGCAAGATCCGGTTCCTGAATCATACTCCGGCAATCGCCCGGAGCAGACGCCGCAATATCAGCACCAACAGAAAAGCAATACGTAACCCGCA
>ce4d48fa-9112-4aa8-b655-10c5064129db
TTGGTATGCTTCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTGAAACAGTGCAATCAACAGCATACGGGGACTAGCACCCATAACGTGATGCATGTAGATCGACCCAGAGCATTCCAGGCGTGCTCATGCTCTGGCGGAGTAAACGCGCACGGATGAGGGCAAAATCACCGCAATCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAAGCCCCGCCATCTGGCTGAAATAAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCGGCAGCCCTGGCAGCTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAGATATTGCTTCCAGTTCATCTGCGGTCAGAGACATAAGTGCGCGCCCAATGCGCTCAACGCCCGTTGTACCGGGAAGAGATGTCATTAATCAGCCGCGCCAACCCGCTGCCTAAAGGACGCGCCAGCACCATTAGCACCAGTAAAAACGTGGCGATCAGTAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAGCCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCTAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAGATTTCAAAAATCTGCGGGCGGGGTGTAAAAAGAAATATAAAAAATGGCAAAAGCCATGATTTAAACTAATGTTTAGTAATTTAACTTTTGTGTAACCCAATTGCAGGATGGATAAAATAAACCACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAAATTACACAAAGGCGGTACACTATTTCATCAGATAAACAAATTCATTTTCAGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAGTATGGAACTCTACAGAATAATATCCTGCATGAAAACATCTTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCATGCCTTTCATGCTTTCTGGAAAGACCGCGCCCGCTTACCTTCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTTATTGATTGCTGAGTTTTGAATACATTTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTAATATCAGGAAAATCATTTCAGAGGAATATTTTGGAGCATCGTTATACCAATCAAAACATATATTCATAGAGAAATATATATAAAATATTTCCTAATTGTTCTTATCTGACAGATATCTCATAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCGGGGCGACATGTTGCCAGTATGGCATTAGCATTGTCAGGAGTTCAGCCAGGGTACGCATCAGTGCCCCCACCGGCATGGCCTGTTCGGTGTGCCCCCGGCAGGGTGACGTCCGACCATCCGGATCAATCCTTGCTCCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTACCCGGCCCGCTGCCGTTGTTCTCTCCGCACCTACGGCAGTTACCGGACAAAACGCCCGCGCCGGTAGAGCCTCGGCCCCGGCGCTGGAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCGAGTGATAACGGCGGCAAGCCTGTATTTTGAGCACCTGTTTCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCAACGTGGCAGAAACTGGATGAAGGTCACCGGCTGGCCACCTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAAGGCGGGTGCCGGAAAGCGGATGAGGTGCTACCGCCGCTGCCGCCGTACCGGGTACTGACCGGACTGGTGGACCGCTTCGGGCGCACACAGACGTTCACCGCGAAGCCGCCGGTGAATTCAGCGGCAGAAATCACCGGCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACAAGACCGTCCGCTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGATCTGTCTGCCGTGTGGCTGACGCACGACGGAATACCCGGAGGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCCGCGGCAGCGAACTGGCGGCGGTGTATGACCGCAACAATACACCAGAGTGCGCAGCTTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGAGCCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCGGCGGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAGTCCTGCACACGCAAGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCGGGCTCAGGGCACAGACGGATGCCGCAGGCGGGACAATGGTCACAGTCCGGATGTGGTGACGGGCCTCATCCCGCGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGAGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGAGGAAACTGCCTGACGGCATTATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCGGCGGCGGAAAACCATGACGATGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGATAACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAAGGCTGAGTCAGTACCGCGCATACGACCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATAGATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCGGACGGCTTGTAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGAAGGGCGGTCTGACGCGCAGTATGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAGCAGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACGAAACCGGCACGACGGCCGCACACAGCGATTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGGGGGGCTGGTCACCCACTGTACTATGACAGAAGCAAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCGCTATGGTTATGACAGTAAGGCGCCTCGCCAGTAAGACACCTGACGGTGCATCATCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAACCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCAATGGCTGTCGGAGCATGAAATCAGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTAATAGACCACCACCGCTTATACCCCTGCCGGGCGGTTTAAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCGCATCAGCAGCCCGCGCAGACCCGGAGTTGCTTCACAGCACCACCGGCAGGCTGACGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCGTATACCACAGACCCGGCGGTAACCGCCTGCCCGACCGGAGCTGCACCGGACAGCGCCCTCAGCGTAATGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAAACCGACCTCATCCGGAAGGGGTTATCCCGCGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGCAGACACAATATGCCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTTAAGAACCGCCACCGGTGAGCTGGCGAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGATGGCGAGGCCGGTGGCAGTGTAGATTATTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGGTGAAATCCTGGCTGACCGGGTGAGTAGGGAAAGCGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCGGTATACCACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCATATCAGCACGGAAGGGACAACAGCGTGGTACGCACCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAAGAGTCCGGCCTGTGTACAACCGCCACCGCTTCATATGACCCGCTGCAGGGGGCGATATCACTCAGGATCCGATTGGTGGGCTGAAAGGGGGATGGAATTTTATCGGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAAGAAACGCACTAAAATGCATTAAGCCACTGCGATCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTCCCAGATGGTAAAGGGGACTATACTTGTGGTAGCCAAGACCAACGGGGAGAATCAAAAAGGGAGATGGTCTATGGGGGCCAGACAAAGCAAGTAAATGATACAAAGAAGCTGCTGGCCGTTGTGACCTCGTTGAAACTTCGATAATGGTTGTGTGGAGAACTGTTTTAAAGGGAAGTTTAAAGAGGTAAGGCCGCGTTATTGTATTGCCTGATATATTCCGCACCTATAAATTTAGGGCTATTTAAAAACTGCAAGACTGGTCTAATGATTCTTTAAAAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTGATTTGTATTCACGGAGTGATGTAATGAAATATATTATTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTAATACTATTCTTTTCCATGCATAGACTTTCACTAAGGTTAAACGCAAGCAGACGCCGAAGATAGAGCGACAGGCAAGTAGCAATACGTAACCCCGCA
>3048e786-5b3d-4587-b5d0-714b40192268
CTGTTGTACTTCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGTGTTTAACCTCCGGCTGGCCGATATATTTCCTAGCGGTTGTTGGCTGTATTTTGCGATGGTGCGCTGGGCTGTTCAACGCTGAGATTACGCCCTTTCGCCACGCGTGGGATTTGCCAGGCCGCCGCGCGCGTGATATTGTCCAGCCCGCTTGCCGATGCCGTCACCAGTTCAACCGGAACGCTCGCGCTTCAGCATCCGGGTTAGCGGCCCATCCGTACAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTACTGGCCGCCAGATTGCTCGCAAAGCTGTGGATTATAGGGCGACTTCTGCCGATTTGCCGACAGGCGACCGAAAATAGCCGTTGCCGGTAAATTCTGCCCGATTAATGCAGACGCGCACCGTATCACCTTCACGAATCGGCAGACCATTGGCCTGCCAGAAACCACCATTGCCCCCAGTACGGTGAGATTAAGCGGCGGGTAAACGCCGCCAGTAATCAATAACAGAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAGCCTCACACCGGACCTGACGGTCAGCGGTAAAATCAATGACTTTGATACCGATGGCAGCAGCAATACAGACCGTAAATCCGCCAGTTACGGCGCAACATAGCAGAAGCGGTAGCGGTTTATAACTCACGCCTTTTTAAACGCCAGAGGAATCAGGGCAAATAATCAAGGCGTTGAAATCTTACTGGTTGGAGTCGGGCAGATACGGGCGCATGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCATACATCGTTAGCAATGCTGAAGGTGGTCAGCGAGCCACGGGTCATCAGCGTCTGTTGCCAATATTGCCCACCTCGATCAACTTGGTCGGGTTGAGTCGAGATCGACCATATTGCCTCTTTCGCCGCCTGGGTGCCGGAGTTCATCGCCACCGCGGCATCTGCCTGCGCCAGCGCCAGGAGCATCGTTGAATTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTGATACCTGACGGATCAATGCCAGCGGCACTCCGGTATCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGCTTAAAGTCAGACCAGTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGACGCTCTTTAATACCGCCTTTGACGATATCTTAAGCGCAATAACGCCCAGCACACGAAATTTCCACCACCACCAGCGGCGTGGCTCCTGACGCACACGCAACCTGATCGACTTTTGATCCAACATCATTTGGGAAGTGACCACCGTTAGCCTCAACACGCCAGCGACAGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCAGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGGCGACGCTGCATCCTTGCTCGCGCAGGTTAAAAACGCTGCTTGGCGAGGATCACAATATATTCCGGCGTTTCATCGGCCAGCAAAGCCAGTTGTGCGGCGTCAGTAGCATTTTTCATCCACGCCTGCGCAGCGATAAACTCCGACGCCCTGACGGTTACCGAGTGTGATAGAGTGCTGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCGCGTCCGCTGGTGCAGCAATCACATTCGCGCCTAGCATCCGGCTCATCCAGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGGTTGGGATCAGACAGACCAGCAGCCATAGTACGTTACGCTGACTGCATTACCGCGCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCGTAAAGACGATAACGTCGGGGCAATCAACCCAGAATGGTCAGGAGCCATTTCGCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCACCATCGCGATCATCCGATCCGAAATGTCTCGCCGGGGTTAACGCTACACTCCAATGCCAGCCAGTCAGAAGAATGCGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCGGATTACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTTCATCGACCGATGCCGCTTCAATAACTACACCATCGCGGGGATAATATCGCCAGCTTCTGCCAGTACGATATCCGCCTTTGCAGAAGTTGGTCAGCAGGAACTGTCCGCCGCAGCGCCATATTTCAGCTCCGCAGCTTGCGGGCAAAGGCAGTTTTCGCCCCTTCCAGACTGTTGGCCTGCGCTTTACCGGCCTTCTGCTAGCCTCGGCGAAATTAGCGAACAGTACGGTGATCACAGCCAACCGCTAATGTACGCTAAACAGCGCATCGCCGGGCATCACCGCCGCTTGCCATCGCGATGCTAATACAGGTGGTCAACAGACTGCCGATCGAATAAACATCACCGGATTGCCATTGCGCCTGCGGGTTTTAATTTTTCACTTCTGGCGCCTGAACGACAAATATTTGGTTCGAATAAGCGCCGGTGTTTACGACTCATATTCAGTTGCTCATATTATCACATCCAGGAGAGATGTTCCGCCACCCGGACCAGCGCCAGGGCGGGGACAAAGGTCAGTGCGCCAACCAGCAACACGAATTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGATGCCGGAGCTGGCGGCTTGGCTCTTTACTCACCAGCAGACCGGCAATTGCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCGAACATGATAAACGGTTCCAGAACGGAAGTTGGCGCTTAATCCGGCAAAGCGCTGCCGTTGACTGTGCTTACAGCACTTCCTTCAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGATCGGCGTCGGTCATCATCGCGCCGCGCCCATCAACACCAGCGTCGGGAAGTAACCAAATTGCCAGTGCAGTCAGTTTCATCGCGTACGTCGATTTTTTACCCCAGAATGTTCCGGTCTTACGACAATCATCAGCCCGGCAATAAAGCACCGCCAGCAGGACAAACCAGCATCATGCCAGCAAGACCAGAACCGACACCGCCAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCGCGAGCGGTAAACAGATCATGCATCGCAATGCCGCTTTCACAGGAAGCCGCCGTCGTCGACCGCCGACAGGCTACTGACCAGCGCGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCCAGATGAAGTTACCTGAACTACCCACATCACCACGCCTACGCAGATGACCAAAATCACTGACATCGCCCACAGCAACATGCGCCAAACCGATCGCCCATCCGCCACAGGCAAAGCACAGCGCCGTTAAGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCCGCCACCGTTAGTACCGAGCATCTTGATCGCTTCTGAGAAGCTACAGGCCCCATGGGTAACAGCCGTTGCCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCGAAAAGATTTTACAGCACGCTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGATTTTACCCATAACGTGATGCATGTAGATCGATGACATTCCAGGCGTGCTCGTATCTGGCGGGTAAACGCACGGATGAGGGCAAAAAATCACCCGCAATCCCGCTGGCGGCAGAGAAAGAAAAGTTTGCGCAGTGGCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCCCCGAGCTGGCGGTATTAGCGCCAGATCCCGTAGCCACTGGCAACTGCTGTGGATTAAAGCGGCAGATGAACTGACCGGTAACATAAAAACATACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAAGACGCCAAGTGCGCGAAAAAGTACGCGCTCAACGCCCGTTGTACCGGAAGAGGAATGTCATTAATCAACCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACACCATTAACACCAGTAAAAGCGTGGCGATCAGTGATAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAAGAATGGCAATAATAAAAGCACCAGCAATACGCCGGTTATCACGCCTGCTACTCACAGTGCACCTCCAATTGGCCTAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAAAAGTATAAAATGCGCCCAAAAAGCCATGATTTAACTAATGTTTATTATTAATTTAACTTTTGTGTAACTTAATTGCAGGATGGATGTAAAATAAACCATCAATAAGCAAAAATAAAGTGGTCGGATGAGTATTAAAATGCACAAAGGCGGTACTGTTTACTGCATCAGATAAACAAATTCATTTTCCAGTGCCATTCACCGGGTAGATACAAAGGGGGAGAAAAGTGCATGGAACTCTGCAGAATATCTGCATGGCTTATCTTTTACGCCATTACTTATGCTGCGGTTACGCGGGCGTTCTGGCGCTGCCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTGCAATACCTGCATCGCGTCTGGCAGAAAACCGGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAAGCGGCTGGTGATTTTATTGATTGCTGAGTTTGAATGCATTGAAAACCGCCAGCCCAGCTGGCGGTTTTCATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATCATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCGACAGATATCTCGCCAGGCTTTCTTATAAATCTGTAGGGTTTCGCCCTGTCGGATAAAATAACCCGATAAAGTAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGGCCGCAGTATGGCGGTAGCATTGTCCCAGGGTTCAGCCAGGGTACGCATCAGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCGGCGGGGTGACGTCGGCCATCCGGTCAATCCGCTGTACTCGGTGCAAAGGTCCTTCCGGTGAAACCGACATCGCCCTGCCCGGCCGCTGCCGTTCATTTCTCTCCACTAGCGGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAGCTGGATAGAAGGTCACCGGCTGGCCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTTTCGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCTGATGGGGTGCTGCCTGCGCCGCTGCCTTAAATACCGGGTACTGACCGGGCTGGTGGACGCTTCGGGCGCACACGAGACGTTCCACCGCGAAGCCGCGGTGAATTCAGCGGCGAAATCACCAGCCCGTGACGGATGGTGCCAGGCGTCACTTCGGCTGGTACTGACCGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGGCCATTTCCGGCAGGGACGGAACCGTCCGCTTTCCTGATACCTGCGGGTTACACCCGGAATATGGCCGGGACAGCGGCATCCGTCTGTCTGCCGTGTGGCTGACCCCGCACGACCCGGAATACCCGGAGAATTTACCCCTGCCGCACCGCTGGTGCGCTATGGCTGGACGCCCGCGAACTGGCGGCAGTGTATGACCGCAGCAATACACAGGTGCACCGCCTGATGATAAATGCCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCCTGTTACCGTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCAGCGGAGAAGCAAGTTACACGTATCCAGTATGAAGGACCGCATCACCATCACCGGCAACCCTGAACCGCCGTGAAGTCCTGCACGCAGGGTGAAGGCAAGGCTGGTGGTGGTGAAAAGAACACGCGGACGGCGTCACGCGGAGTCAGTTTGGCGCGGTGTTGGGCAGGCTCAGGCACCAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCGGATGTGGTGACGAGCCTCATCACGCGCATCCACCACGCCGGATGGCGGGGCATCGGCGTTTTACTATAACCACACAGCTGATTAACGTCAGCCACCCGGGCCTGACGAACGGAAATACGCCGGAATATGATGAATGGGGCCGTCTGAGTTGAAACTGCCCCTGGCGGCGATATCACCGCTAGGTTAAACGCAGAAAACGGAGCCGCCGAAGATGAAACCGTA
>d7bbdb5c-225f-4910-a264-6444e1ace544
TTGTTGTACTTCGTTTCAGTTACGTATTGCTACTTGCCTGTCATCATCTTCGGCGTCATAGCGATTTTAACCTATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCACCTCTTTCGCCGCCTGGGTGCCGGGAGTTCATCACCACCGCGACATCTGCCTGCGCCAGCTGGAGCATCGCTGGTGCCGTCGCCGGTCATCACCAAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAAAATCATCGACACCCGCTTCCCGCAGCAATCGCGGCGGCAATCGAACGGTTATCGTCAGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCAACTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCCAGCACGAACCACCACCAGCGGCGTGAAAACCCTGACGCGCAACCTGATCAACTTTTGATCAACATCGGTGAGGAAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCGGCTTTGCGCAGTAAAACGGTACAAAAGGTGGCATGGAGCGACTGCACATCGCGCTCGCGCGGGTTAAAACGCTGCTTAGCGGGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTTTCATCCACGCCCTGCGCGGATAAACTCCGACGCACCTGACGGTTTACCGGGTGTGATGGTGCCGGTTTTATCCAGTAACCAGGGCAATCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGTTCCAGCAGCGCCACCACCAGTACCGTTACGCTGACTGCATTACCGCCCACGCGGGGAAAACGGCCACAGCAGTAGCGATTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTAGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGTTAACGCTACACTCAATCACCAGCCAGTCCAGAAGAAAGAATACGCGTGCCGCCGGTGACCTTTGAGCAAAATCGCCCGCCAGTTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCCAATAACTTCACCATCGCAGGGGATAATATCGCCAGCTACCAGTACGATATCCAGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGAGCAAAGGCAGTTTTCACCCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCCAACGCCTCAGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTTACCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGACGGTCAGCAGACTGCCGATCCAGACGATAAGCTTATCACGGATTGCGCCATTGCGCCTGCGGAGTTTAATTTTCACCGCTTCTTTCAGCGCCTGAGCGACAGAGTGTTGGTTCGAATAGCGCCAGTTGTTTCGACTCATATTCAGTGCTCGTATCATCGGAGAATGTTCCGCCACCGGACCAAGCGCCAGGGCGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAATAAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTACTCACCAGCGAATAACCGGCAATTGCCATCACCGGGATAAATCACCCCAGAAGCGACCGACAAACATGCAAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACCGGCTGCAGCACTTCGCTAAAACCATGCGGAGCCAGGGTTGAGCATGGCGCTACTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCGCTCAACACCAGCACGTCAGGGTAACCAAATTGCCAGTGCAGTCAGTTTCATCTCGCGCGTACGTCGTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACCAAACAGCATCATGCCGTAAAGACCAGAACCGGCACCGCCGAACACCACTTCACCAATTTGCATCAGCCATCGGCACCATGCCACCGAGCGATAAACGAATCATGCATCGCAATCACCGCCACAGGAAGCCGCCGTCGTCACGATACAAACAGGCTACTGACCAGCACGCCGAAACAGCTCTCTTTACCTTCCATATTGATGCTGCTGTCATTGCCCGGTGCCAGCGGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAAATCACTGACATCGCCCACAGCAACATGCGCCCTGGCGGCCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCATTGAGTTGGCATTAAAGCCACCGCCATTTAGTACCGAAACATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACAGTATTCTCACAGCCTGATAAGGCAGAAAGTTTTACCCAGCGCAGCGTTGTGAATAAAAACGGTGGCTTAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCAGAGCGTGCTCATGCTCTGGCGGAGTAAACAGGTTAAACGCGAAGCAGACGCCGCAATATCCAGCACC
>c39789a3-7c1c-4b1e-bc6d-dc0df49e969c
TTGCGCATTGTGCTTCGTTCAGTTACGTATTGCTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGAGTGTTTAACCTGATGCCCCCGCCAGGCACGCATTTGCTCATCAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAATGTTCAATGGCGCGCTCTCGCCTGCCCGGCTAATAGGCTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCGGGGCAAGTCCACCAGCACCACGTCGTCGGCATCGAAAAAGGATCAGGCACGGTTTCCCGTACCTGAATTCCGGTGACGCCATGACCACATCATTCAGACTTCCAGATGCTGAACGTTGACGGTGGTAAACATCAATGCCAGCTTCAGCAGTTCTTCGATATCCTGCCAGCGTTTGGGATGACGGAACCTGGCGCATTACTGTGCGCGCCAGTTCGTCAATAAGATCAGCGCCGGGCGGCCCGGCGAGGGCGGCATCGAGATCAAACTCGCTGATACCGCCCGCGGTACGCCTGGCGTTTTAACGGCAGAACAGCCAGCCGCTTCAGCATGGCGTGAGCGTCTTTTCGCCCGTGGGTTTCTGCCACGCCAACCACAATGTCAGCCTTGCGCCCGCGGTCAGCTGGGCTTTCTGCCAGCATCGCCCAGGTCTTCCCGACGCCTGCACAGGCACCGAAGAAAAACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCAGCTGAACTGATCGGGGGTCGGGACTAATGAGGTTCGTTATTCATCAAGTTTATCCAGCGCCAGATTAGGTTCAACAATGGTGAAGGCAAGCCGGCTGGCCGATATATTTCACCGGTTGTTGGCTTGTATTTTGCGATCGGTTGCGTGAGCTGTTCAACGCTGAATTACGCGCTTTCGCCATTAGAGTTTGCCGAGCCGCCGCTTGCGGGTGATATTATTGTGTCAGCCAGCTTGCCGATGCCGTCACCAGTTAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGTTACTGACCTTGATTGCTCCGCCAGAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAAATTCTGCCCGGTGTACCGAACCGCGCGCCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTGCCCCAGTACGTTGGTCAGCAGCGGGTAAACGCCGCCAGTAATCAATAACAGAAGAAGATAAATGTTGATAATGCCGGACGTAAATCCACTCATGTAGTAAACCTCACCAGACCGCAAACGGTCAGCAGTAAATCAATGACTTTGATACCAGATAAACGGCACAACATTACAGACCGTAAATCCATAGAAGTTACGGGCGCAACATGGCCAGAAGCAGTGGCGGTTTATAACTCACGCCTTTACAACGCCAGGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCACATGATGTTCAGCGCGTTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTAGCAATGCTGAAGGTGGTCGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCCAGCGGTCGGGTTAGGTCGAGATCGACCATGTTATGCCCATACTCTTTCGCCGCCTGGGTGCCGGGTTCATCATACCGCGACATCTGCCTGCGCCAGCGCTGCCAGACATCGTTGGATTGCCGTCGCCGGTCATCGCACCAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTTGGCCTCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACGGTTATCGCCGGTAATCATCACCGTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCCAGCGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCCTGACGCGCAACCTGATCGACTTTTGATCAACATCGGTAGAGAGTGACCACCGTTAGCCTCAGCATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCACATCATCCGGCTTTTGCGCAGTAAACGGTACAAAGGTGGCGTAAGGCGACTGCACATCGCGCTCGCGCAGGTTAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTCATCCACGCCTGCGCGGATAAACTCCGACGCCTGACGGTTACCGAGTGTAGTAAGTGCCGGTTTTATCCAGTAGCAGAACGTTAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCGGCGACGCCGATCGCTGACAACAGGCGCCAATGGTGGTTGGGATCGAGACAGACCAGCAGCGCAGCGCCACCGGTATTGCCGTTACGCTGACTGCATTACCGCTTACGCGGAAAACGGCCACAGCGTGGCGGTTGCCGAAATAAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGAACCAATTTCGTTCGGCGTTTCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCGAAATGTCTCGCCGGGTTAACGCCACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGAAACCGCAAATCGCCCGCCGGATTCACACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCTTCAATAACCTTCACCATCACGGGGATAATATCGCCAGCTTCTACCAGTACCGATATCGCCTTTACAGAAGTTGGTCGGCAGGAACTGTCCGCCGCAGCGCCATGTTCGAAGCTCACGCGGCTTGCGGGCAAAGGCAGTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTGGCGAACAGTACGGTGATCACAGCCAACCGCTAATGGCCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCCGCGATGCTAATACCGCGGGTAGTCAACAGACTGCCGATCAGACGGAAAGTAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTTCACCTTTGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTGACTCATATTCAGTACTCCTCAATATCATCAGGAGATATTCCGCCACCGGACCAGAAAGCGCCAGAACAGGGATAAAGGTCCAGTGCGCCAACCAGCAACACGATTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGTGGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTCGCCATCACCGGATAATCACCCCGAAGCGACCGACAAACGCACGGAACGCCGGTAAACGGTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTATTTGTTAGCGGCGGATGACACGGCTGCAGCACTTCGCTAAAACCATACGGGCCAGAATTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCGCTTTCCAGCGTCAGGGTAACCAGAATTGCCAGTGCAGTCCATTTCATCTCGCGTACGTCGATTTTTACCCAGATATTCGGTGTACGACCAATCATCAGCCGGCAATAAACACCGCCAGCGGGACAAGCAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGGAACACCCGCTTCACCAGTTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCCGTGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCGAGATGACAAAATCACTGACATCGCCCACACAGCAGCATGCGCCCCTGGCGTGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAGAAGATCGCGCCAGCATCTGCACAGCGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGCCACCGCCGTTAGTACCGAGCATCTTGATCCTTCCTGAGAAGCTACAGGCCCCATGGTGGCTGGCTGTTGCGCTCCTTCAGCAGTATTCACAGCCTGATAAGGCCAGTTTTACAGCGCACCTTGTTGAATAAAAACGGTGCAATCAACAACGCCACAGGGATAGCACCCATAACGTGATGCGTAACCAGATCCGGCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACTACTTACGGATAGGGGCAAAATGCCGCAATCCGCTGGCGGCGAAAGTTTTGCCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCGCCCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCGACGGCATTATTCAGCGCCAGATCCCACGACAGCCAGCAACTGCTGTGGATTAAGCGGCGAATGTAGTGCTGACGAGCAACGCAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCGGGGAATGGCACAAAGATATTGCTTCCAGTTCATCTCGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTTATTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCGGCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAGCGTGGCGATCAGTAGAACCGCTGCGCAGCCATCAAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAAACACCAGCAATGCACGCCGGTTATCACGCCTGCGCTCACAGTGCGCCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAAGTATAAAAATGGCAAAAGCCATGATTTGCTAATGTTTAGTATTAGTTGGCACGGTAGCTTAATTACAGGATGAATGTAAATAAACCATCAATAGCAAAAATAAGTGGTCGGATGAGTAGTAAATTACACAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCGGTGCCATTCACCGGGTAGATACAAAAGGGGGAGAAAAGTATGGAACTCTACAGAATATCCTGCGCGAAGCATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCCAACGTCTGGTCGAAAACCAGCGATAAACCGATTGTGGATGGATCGGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCCGGTTTTACGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCAAAGAGCATATATTCATGAAATATATATAAATATTTTTCCTAATTGTTCTTATCTGACAGATATCTCCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCTACGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGAAGCGGCGGCGCGTCAGGCGACATGAAGGCGCAGTATGGCGGTAGCATTGTCAGGGTTCAGCCGGGGTACATCCAGTGCCCCCACCGGCGTGGCCCTGTTCGGTGTGCCCCGGCGAAGTGACGTCCGGCCATCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCAGGTGAGCCGACATCGCCCTACTTGGCCGCTGCCGTTCATTCTCTCCGCACCTACGGCAGTTACCGGACAAAACGCCCGCGCCGGTGAGGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATACCCGCTTACAGCTGCGCGATAACGCACTGATACTCGAGTGATAGCGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGGAAAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGATCACCGGCTGGCGCACTCTGGCGAAACGCTGCGGAAGAACTCCACGCTTAAGTCCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTTCTGCGCCGCTGCCGCCATTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCCCACCCGCGAAACCGCCGGTGAATTCAGCGGCAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGAGCTGCGACCGCGCAGCAGGCGCAACGGTAGAAAGCCCGGCAGCAGGCCATTTCCGGCAGGACAGGAACCGTCGCTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAGCGGCATCCGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCTGAGATTTTACTGCCGCGCCGCTGGTGCACTGTAACTGGACGCTAGGTTTAAACACCCAAACGAACGCCGAAGATAGAGCGACAGGCAGAAGTAGCAATGCGTATTGGCCCGCA
>9388888e-4344-4e51-a44c-54c3b3c62b8b
CGGTATACTTCGTTTGCCAGTTGCGTGATGGCTGCCTGTCGCTCTATCTTCGGCGTCTGCGGGTGTTTAACCTACTTGTCTTTAAAGAGCGTATCGGCGCGTTGGTAATCGGCGTGCGGGCGGGTGGTTCATCAAGCGCGACCAGCACCTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCAACAAACGTTTCCCGACGCCACCAGCGGCGCGGGCCGAACGACCGAGAATAATCTTGCCGGTTATGTTCACGGGCATAACGCACTACCGCTTTCTCTTCCGCTGGATCAAAGATGTTGCCAAATATCGCGCCCAGTTCACCGCCAGACGTAAGGCGCTGAAATTGCCCGACGTTTTTCCGGTAAGCGGGTGCAGGGCAGGGGTTTCAACACACCGCGTGCCAGACGCTACCAGCCAATGACGCCAGCCGCGCCGCTGCGCAGCGACGTAGTTTTCGCTGCCGGTGTTATGGCCGATGCCATAAAGAGATCGCGTCGCGCGTGGCCACACTTTTCTCTTCGCCAGGATGCCCCGCCAGGCTGCGCATTTGCTCATCAGCGCGATCGGCAGTACGGCGCAGTGCCAGTTCAGCGCAGGGCGATCAGATTACCTTTGCGGAAAAATGTTCAATGGCGCGCTCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGAATCGTCCGAGGACAAGTCCACCCAGCACCACGTCGTCGGCGGCATCGAAAAAGGATGAGCACAGTTCCCCGTACCTGAATTCCGGTGACGCCGCTGACCACATCATTCCAGCAGGCTTTCCAGATGCTGAACGTTGACGGTAGTGAAAACATCAATGCCAGCTTCAGTTCTTCGATATCCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCAAATAGATCAGCGCCGGAGCGGCGGGCAGGGGGCAGCATCGAGATCAAATAAGCGTGTAACGCCCACGGTACGCCTGGCGTTTTAACAACGGCAGAACAGCCAGCCCTTCCAGCATGGCGGCGGTATCTTTTCGCCCGTGGGTTTCTACCATAACCACAATATCCAGCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCAGGTCTTCCCGACGCCTGCTGAGCACCGAAAGAAAACTTTCCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAACCAGACGATCAGGGGTCAGGTTATCAGGGTTCGTTATTCATCAAAGTTTATCAGCGCCAGATTGGTCAACAATGTTGACAACCGACTGGCCGATATATTTCACCAGCAGGTTGTTGGCTGTATTTTGCGATCAGTTGCGTGAGCTGTTCAACGCTGGTGCCTTTCGCCACGCACGTAAGGATTTGCCAGGCCCGCCGCGCGGGGTGATATTATTGTCCAGCCCGCTTGCGTGCCGTCACCAGTTCAGCCGGAACGCTCGCGCTGGCATCCGGGTTGGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTACTGACCGCCAGATTGCTCCCGCCAGAAGCCGCAACTGGATTATAGGGCATTTCTACCGTTGCCGACAGGTGATACCAAAATAGCCGTTGCCGGTAAAGAATTTCTGCCCGATTAATGCCGAACCGCTTGCCGTATCACGCCGCGAATCAACGAACCATTGGCCCAGAAACCACCATTGCTAAGTACGGTGGTCAGCGGCGGGTAAACGCCCTTGATAATCAATAACAGAAGATAAATGTTGATAATACGGACGTAATCACTCATGGTAAACCTCACCGGATACTGAAGCGGTCAGCCCAGTAAATCCATTTGTAAACTTTGATGATACCGATAAACGGCACCAACAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAAAACGGTAAGCGGTTTATAACTCACGCCTTTAACGCCAGAGGAATCAAAGACGATAATCAGGCGGTTGAAATCCACCGCTACTGAGAGTTGCGGAGTCGGGCGAATGCGGGCACATGATGTTCCAGCGCATTTAACTGCGGATGCGTTGCCACCGCCGGAATAATGCGTGGCTTCGCCACATCGCAACAATGCTGAAGGTGAATTCAGCGAGCCACGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACCCGGTCGGGTTAAGTCGAGATCGACCATATGCCCCTTACTCTTTCGCCGCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGCCGGGCCTCGTTGCCGTCTACTTCGGTCATCGCTACCAGGCGACCTTCCGCCTGATACTGACCGGATCAATGCCGAAACGGCCTCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCGCAACATTGCAGCGGCAGTCAGACGGTTATCGCCGGTAATCATCTCACCGTTTTAATGCCCATTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGGTGATATCTTTCAGCGCAATAACGCCTTTGCAGAACCTTCCACCACCAGCGTGGCTCCTGACGCGCAACCTGATCAAACTTTTTTGATCCAGCATCGGTAGGGAAGTGACCACCGTTAGCCTCTTGCCAGCGACAGATGGCATCGACAGAACGCTTTACGGATCCTTACAGTTTGTCGATGTTGATCCCATCATCGGCTTTGCGCAGTAAACGGTACAAAGGTAGCGTAGACGACTGCACATCGCTCGCGCAGGTTAAAACGCTGCTTAGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTCATCACACGCCCTGCGCGGATAAGCTCCGACGCCCTGACGGTTACCGAGTGTGATGCCGGTTTTAATCAGTAGCCAGAACGTCAGCAGCGTCTATACCGCTTCAACTGCACGTCCGCTGGCGTGTAATCACATTCGCGCCTAGCACATCCGGCTCATCCGGCGGCATGATCGCTGACAACAGGCCGCCAATATGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCGCGCGGAAAACGGCCACAGCGTGGCGGTTATAATCAAAAAGACGATGATAATTCAGGGGCAATCAGCAGAATAGTCAGGGCAATTTCGTTCGGCGTTTGCGTCGCTGTGCGCCCTTCCACCATCGCGATCATCCGATCCAGAAATGCTCGCCGGTAACGCTACACTCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCAGTTCACGGATCACCGGTGCCGATTCCCGGTGATGGCGCTTTCATCGACTTCACCCCTTCAATAACTTCACCATCGCAGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAGTTGGTCGGCAGGAACTGTCCGCCGCAGCCTTCGGCCCACGCAGCTTGCGGGCAAGGCAGTTTTCACCCCTTTCAGACTTTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCCGCCTCGGCAGCGAGTGGCGAACAGTGCGGTGATCCACAGCCAACGCTAATGGCGCGCTAAACAGCGCATTGCCGGGCATGTACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCAATTGCGCCTGCGGGTTTTAATTTTTTCACCGCTTCTTTCAGCGCCTGAGCGACAAGTGTTGGTTCCGAATAAGCGCCAGTTGTTTGCGACTCGCATATTCGGTGCTCCTCAATATCATCGGGAGATGTTCCGCCACCGGACCAAGCGCCAGAACTGAGATAAAGGTCAGTGCGCCAACCAACGCAGTTGCCTAACGCAGGCCAACAAACAGCGGGCCGTGCGTTGGCCAGCGATGCCGGGCTGGCGGCTGGCTCTTTACTCACCAGCGAACCGGCAGTGCCATCACCGGGATAATCCTTGAAGCGACCGACAGAGCATGCAGAACGCCGGTAAACGAGTTCCCAGAGACGGAGTTGGCGCCCAATCCGGCTGAGCACTTTGCCGTTGTTGTTAGCGGATGACGGCAGTACAGCACTTCGCTTCGCCATGCCGTTGGCAGGGTTGAGCGTAGCGCCGATCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAACACCAGCGTCAGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCATTTTTTGCAGATATTCCGGTGTACGACCAATCATCAACCGGCAATAAGCTTACCGCCAGCGGGACAAACATCGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCCACATCGGCACCATGCCACCGAGCGATGACGAATCATCGCAATCACCGCGCCACGAAGAGCCGCCGTCGACCGCGACCGCAAACAGGCTGCAGCAGCACGCCGAAACGGCTCTCTTTACCTTCCGCCATTGATGCTGCTGTCGTGCCCAGTGCCAGCAGATGAGGATTACCTGAACTTCTACCCACATCACCACGCCTACGCAGATGACAAAAATCGCGGCATCGCCCACAGCAACGTATGCGCCCCTGGCAGCGATCGCCCATCACTTCACCAAAGGTAAAGCGCAGCGCCGTTGGGATCAAAGAAGATCGCCAGCATCTGCTGAAGTTGGTCGAATGCGGTTGGGTTTTCAAACGGATGCGACGGTTGGCATTAAAGCCACCGCCGTTAGTACCGGTATCTTGATCGCTTCTGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCTTCAGCGGTATTCACAGCCTGATAAGGCGAAAGTTTTGCAGCGCAGCGTTTAGATCCAAAAACAGTGCAATCGTAACAACGCCACAGGGACTAGCACCATAACGCGTGATGCGTAGCAGATCGGCCCAGGCATTCGAGCGTGCTCATGCTCCTGGCGGAGTAAACGCACGGATGAGGGCAAAAGGAAAAATCACCGCAATCCCGCTGGCGGCAGAAGAAAGTTTTGCGCGTTAAGCCCGCCATCCTGGCTGAAATAGCTCAACGTGGTTCTGCCGCTATAAGATTGCCAGTTGGTATTGGTGATAAAGCTGACGGCGGTATTCAGCGCCAGATCCCTGACAGCCCACAGCAACTGCTGTGGATTAAGCAGATGGTGCTGACTGAGCAACATAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCGGTTCATCTCACGGTCAGAGGCCTTAAGTGCCCGAAAAAGTACGCTCAACGCCCGTGCCAGGAGAGATGTCGTTAATCAGCCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCAGCCATCAGAACTGCCTCCCGCGTGATCAGGGGCATAACCAGATAACAGTAATAAAACACCAGCAATACGCCGGTTATCCGCCTGCACTCATTGCACTCAGTGGCTAAAAGGTGATACCGGAAGGGTAAATTCTGGCTGCAAGATTTCGCAAAATCTGCGGGCGGGGAGTCTAAAGAAATATAAAAATGCGCCCAGAAGCCGTAATTTTAACTAATATTTGAAGTATTAATTTAACTTTGTGTGGCAATTACAGGATGAATGTAAATAAACCATCAATAGCAAAATAAGTGGTCGGATGGTAGTAAAATTACACAAAGGCGGTACTAAACTCATCAGATAAACCGATTCATTTTCAGTGCCATTCACCGGGTGGAGGTAAAGGGAGAAAAGTATGGAACTCTGCAAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCTTTTACGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGGTGTGGATGGATCAGGCCGAAGAGCGGCTGGTGATTTTTGTTGATTGCTGAGTTTTGAATACATTGAAAACGCCAGCGGAAACGCTGGCGGTTTTTGCTATCAGGAAGATGTTCAGAGGAATGTTTGAACATCGTTATGCCGTCGAAACATATTCATGAAATATATATAAATATTTTTCCTAATTGTTCTTATATGAATATCTCGCCAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCCTTGAACAAATATTGATAAAACAAGGATGAACAGATGACGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAACGTATCAGGGTTCAGCCGGTACATCCGGTGCCCCCACCGGCGTGGCCTGTTCGGTATTATGCCCCGGCAGGTGACGTCAATCGGTCAATCACTGCTCGGTGCAAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCGGCCCGCGCCGTTCATTCTCCTCCGCACTGACGATTACCGGACAAAACGCGCGCACGCCGGTGGGAGCCTCGGCTTCAGCTGGAAAATGCCTGCGGATATCGCTTACAATTTCGCGATAACACACTGATACTCAGTGATAACGGCGAAAAGCAGAAAGCTATTTTGAGCACCTGTTTCCCGGTAGAGACGGTTACAGCCGCAACGAGTCACTGTGGCTGGTGCGCATGCGAAGCGTGGCGAAAAGCTGGATGAACAGCTGGCACGCACTCAGCGACGCTGCCGGAACTTTCGCCAAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCGTGGTGGCTGCTCGTACCGTGTGAGCGGTGCCGGAAGCGGAGTGGTGCTGCTGCTACGCCGCTGCCGCGCCAATACCGAATTGCTGACCGGCTGGTGGACCCTTCGAGCATACGGGCCGTTCCACCGAAGCCGCCGGGTAAATTCAGCGGCGAAATCGCCGGCGTGACGGATGATGCCGGGCGCCACTTCCGGCTGGTGCGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAATTGCGACTTCCGACGGGACGGAACCGTCGCTTTCTGATACCCTGCCGGAACGCACCGAATATGGCCAGGACAACGCCAATCTATCTGCCGTGTGAAAGCTGACGCACATTCCAGGAATACCGGAGAATTTACCTGCCGCGCCGCTGGTGCATATGGCTATGGACGCCCGCGGCGAACTGGCAGCGGTGTATATTGACCGCAGCAATGCGATTAACGCAACTGCCCGATATTAATCGCATGCAGGGGCCGGATGGTGGCGCACGTCGCACGGTGACCGGAAATCTATTACCGTTACAATGGCGACGGGCGGGTGAACAACAAACCAGCGGAAGCAAGTTACACGTATCAGTATAGAAGGACCGCATGCCATCACCGACAGCCTGAACCGCCGTGAGAGTGCAGGGTGAAGACTGGGCTGAAATAGTGGTGAAAAAGGTACGCGGACGGCAGCGTCACGCCAGAGTCAGTTTGACGCGTGGGCGAATGAGGCACAGACGGATTCACCGCGAAGGACAACATGAAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTACTACAACCACCACAGCCAGTTGACGTCAGCCACCGGGCCTGACAGCGGGCTGGAATACGCCGGGAATATGATGAATGGGGCCGTCGTTCGAAACTGCTGACGGCGGTATCACCGCTACCGTTGAATTAATCCACTGTTGACTTTACCTGCGCAGCGGAAGATGCACCGGCAACGGAAAACATGACGTGGGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTACTGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGAGCTGAGTCAATTACCGCGCATACGACCGTGGACGGATTAATTACCGATATGAAAGACACGCAGGGCCGCGCCAGAAGCGCGGTAGATACAGAAACGCCGCCAGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACGCAGTACATTCGTGGGGAAAAAGCCATCTGTACCGTA
>c30b48fc-11eb-4d3d-9c89-58ad29b2631d
TTGGTATGCTTCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTACCCTTGCGCAGCCATCGAACGCCTCCGCATTGATCAGGGCGCAAACCAGATAACCCAGTAATAAGAACACCAGCAATACACTTGGGTTATCACGCCTGCACTCTGGTGCACCTCAAATTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGTGTAAAAAGTATAAAATGCTTAAAAGCCATGGTTAACTAATATTTATCAGTAATTTAACTTTGTGTAACAATACAGGATGAATGTAAAATAAACCATCAATAAGCAAAATGGTGATCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATCAAGCTCATTCATTTTTCAGTGCCATTCACCGGGTAGATACAAGGGGAGAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCGGCAGGCGTTCTGGCGCTGCCTTTCATGCTTTCTGGAAAGAAGACCGCGCCCGCTTTTACAGCTACTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTATATCAGGAAGATGTTCAGAGAATATTTAGACATCGTTATACCAATCGAAACCTTATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAAACTTTCTTACAAATCGCCAGGGTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCGGGCGACACTGACGCGGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGTGCATCAGTGCCCCCACCGGCGTGGCCTGTTCGGTGTGTGCCCCGGCAGGTGACGTCGGCCATCCGAGTCAATCCGCTGCTCAGTGCAAAGGTCTTCCCGGTGAAACCGACATCGCCCTGCCGGCCGCTGCCGTTCATTCTCTCCGCACCTACAACCACCGGACAAAAACGCGCCCGCGCCGGTAGAGCCTCGGCCCCGGCTGGAAAAGTGCCTGCGGATATCCGCTTACAGCTGCGCGATAACGCACTGATACTCAGTGATAACGGCGGCGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGATCACTGTGGCTGGTGCGCGGCGGCGTGTGAAGCTTTGGATGAAGGTCACCGGCTGGCCGCCTCTGGCGACGCTGCGAAGAACTCAACAAGTCCGCGTCGTTATCTGGCAGCAAACAGTCACAGGAGGCCGTGGTGGCTGCTCTGGCTGGTGTGAGCGGGTGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCCGGGTACTGACCAGACTGGTGGACCGCTTCCGGAGAAACCTGAACGTTCCACAGCAAGCCGCCATTTAATTCAGCGGCAAAATCTGGCATGACAGACGGGCGTCGCTTCCGGCTGGTACTGACCACACCAGGCGCAACGGGCAGAAGAAGCCCGGCAACTGAGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCTGATACCTGCCGGGTTACACCGAATATAGCGGGACAACGGCATCCGTCTGTCTACCGTGTGGCTGACGCGACGGAATACCCGGAGGAATTTACCTGCCGCGCGCCGCTGGTGCATATGGCTGGACGCCCCGCGGCGAACTGGCGGCGGTGTATGTGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATATGCAGGGCCGGATGGTGGCGCACCGTCCACACGGGCCGACCAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACGTATCAGTATGAGAAGAATTTGCATCACTGTCACCGACAGCCTGGGCCGCTGTGAAGTCCTGCACGCAGGGTGAAGGCGGGCTGAAACTGGCGGGTGGTGAAAAGGAACACGCGGACAGCGGCGTCACGCCAAGTCAGTTTGGCACGGTGGGCGGAAACAAATTTTGAACGGATGCTGCAGGCAAGAGACAACAGGAATACAGTCCGGATCTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATAACGAAGAACATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAATACGCCGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCGCTACCGTTATGATGTCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCGGCAACGGGAAAACCATGACGCGTGGAGCCATTACGGTCAGTTGCTGAGCTTCACTGACTGTTCAGTTATGTAACCCGCTATGAAACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGTTGATTAATTGCCGTGAAAGACACGCGGGCCATGAAGCACGGTATGTATAGATACAACGCCGCCGGTGACCCTGACCACCGTCATTGCCCCGGACGGCAGCAGGAAACGGGACACAGTACGATGCGTGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAATACCACCTTCCGTTACGATAACATCTCGACCGGCTGATACGGAAACCGGCACGGCGGCCCGCACACAGCGATTATCACCACGACCCTGACCGGCAAACATCCGCAGCGAGGATGAGGAATGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCGATATGACAAAGACATGGCTGGCTGACAGACATCAGCCACCATATCAGCGAAAGGGACACCGAATTTGACGGTACTATGGTTATGAACAGTAAAACCGCCTCGCCAGTGAACACCTGACGGTGCTGCATCATCCACTGAACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCATGTATGCCGGACAGCCTGCCCACGCCGTGGTCGCGATACGGCAGCGGCGGCCGTCGACATCGAACTCGGCGAGCACACCGCTGGTGGAGTACACCCGCGACCACCTGCACGGGAAACGCTGCGCGGCTTTCGGTCGTTATGAACTCACCTGCCATACTTGCCGGGCAGTTACAAGAGCCAACTACGAACAGCCTGCTGTCTGATACGATTACACACCGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTGGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCACGGATATCCGCATCCATTACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAAACACCCGGACGGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCGTGAGCGCACTATCTTTACCGGTATGACCGTGCGGCAGGCTGACAGAAAACCGGCCTCATCCCGGAAGGGGTTATCACACGGATGATGAGCGCACCCACCAGTACCATTACGACGGTGGCACCGGCGGTGCACCACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCTTTGGGCCGCAGGGTAATGAAACGGGTATGACGGCGTGAACGGGACTGACGGGCTGGATATCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCAGACGGTTTATCAGCCGGGAGCTTCCGCCGCTCATCAGGGTTGAAACCGCCACCGGTTAAACGCAGAAGCAGACGCCGAAGATAGGAGCCGCA
>237f1f8e-b267-437b-b8d0-464a8f838fc0
TTCGTGTATGCGCTGGTTTCAGTTACGTATTTGCTACGCCTGTCGCTCTATCTTCGGCGTCTGCCCGGGTGTTTAACCTGTTATCGCATGAGCCATCAGTGCCATTTATCGCGCCAACTCGCCACCAGGCATTTTCCAGCCAGGGCCAGGCTCCCCACGGCGCAGGCGTTTTGTCCGGTAACTGCTGCGCCGGTGCAGGAGAGAATGTATGAACGGCAGCCCAGGTAGGCAGGAGCGATATCGGATTTCACCAGGAAGGACCTTTACCACCGAGCAGCGGATTCGACCGGATGGCGGAAATCACCCCGCCGGGAGCACCGATAGGCCACGCCGGTGAATTTTCGACCGTACCCCGGCTGAACCCTGGAACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCAGAACTTCTAATCACCATCGCATCCTTGTTGTTTATCGGGTTATTTGTCGCCTTTGTGGGCAAAAGCCCTACAGATTACTCGAAAGCCGCCAAAGGTGAATATCTGTCGATTAAGAACGAATTGGGAAAATATTTATATATGTTCGCCGGGCTCCATGTTTCGGTGGTATAACGATGTCTAAATATTCCTCCTGAACATCTTCCACCGATGCAAAAACGCCAGCGTTTTCCGCTGGCGGACTCAATATTAAAACTCAGCAATCAATAAAATCACCAGTTACTTTTTCAGTACAGATCCATCCCACCCGGTTTTATCCGCTGGTTTCGACAGACGCGATGCGGAAGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAACGCTGAAGGCAGCGCCGGAACATGCTACAACCGCATAATTACGGCGTAATAAGCCATGCGAGATATTCTCTAGCAGAGTTCATACTTTTCTCCTCCTTTTGCTTATCTACCCGATGAATGGCACCGGAAAATGGAATTACTGTTTATCTATTGATGAAAATAAGTACGCCCTTTTGTGTAATTTTACTGCTCATCCAAACCGCTTATTTTTGCTTTATTGATGGTTTTATTTACATTCATCCGCCATATTCAAGTTACAAAGGTTAAATTAATACTAAACGTGGATTAAATCATAAAAACTTTTGCCATTTTTATACTTGCCCGCGATTTTTGCGAAATCTTTGCAACCAGGTCTACCTTCCGGTATCACTTTTAGGCCGCAAAATTGCACTGTAGTACAGGCGTGATAACCGGCAACCTTCGTGTTTTTATTATTACTGGGTTATCTGGTTTATGCCTGATCAAATGCGGAGGCGTTCTGATGGCTGCACTGGGGATATACTGATCGCCACGTTTTTGCAGGTGTTAATGGTGCTGGCGATCGCTTTGAGCGGCGGGCTGGCGCAGCTGATTGACATTTCACTCTTCCCCGGTACAACGGGCGTTAGGCGCGTACTTTTTTCGCGCATGGCGTCTGACGTGAGATGAACTGGAAGCAGTATGCTGTGCCATTCTCATTTTCGTTATGCTGGGGCTGGCGGTGCTGTTTTCATGTTGCTCGGTCGGCATATCGCCGCTTAATCCACAGCAGTTGCCAGAATTTCAATGGTAGGATCTGGCGCTGAATACCGCCGTCAGCTTTATGCAATACCAGCTAACGTCTTATGGCAGTGGCTTGGGTAGGCTATTTCAACAGCCAGATGGCAGCGGGCTTAACGGTGCAAACTTTCTTTCTGCCGCTAAGCAGGATTGCGTGATTTTGCTCATCCGACCGTTTACCGCCAGAACATGAGCACGCTCAGGAATGCCGCAATTCGATCTGCTACGCGTCACGTTAGCAGGTGCTTCAGTCCTGTGGCATTGTTGATTGCACTGTTTTTATTCAACAAAGGTGCGCTGCAAACTTTCGCCTTATCAGGCTGTGAATACCGTTGGAAGGCACGCAACAAGCTGTACCCATGGGGCCTATGGCTTCTTTCAGGAAGCGATCAAGATACTCAGTACTAACGGCGGTGGCTTCGCTGTACCAACTCATCGCATCGTTTGAAAACTAGCCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCACAATAACTTTGCACTGGGTGAAGTGATGGGCGATCGCGCCAGGGGCGCATGTTGCTATTAAGGCAACCAAAGTGATTTTTACGTAATCTGTGAGCGTGATGTGGGCAGAAGTTCAGGGTAATCCACTCATCTGCCAGCACTGGGCACGGACAGCAGCATCAATATGGAAGACAAAGAGGCCGTTTCGCTGTCTTTGGTCAATGTATGTTTGCGGTCGTGACGACGGCGGCTATAATGGCGCGGTGATTGCGATATATGATTTCGTTTACCCAAAGCTCTCGGTATCAGTTACGTCGTATTTGATAAAATTGGTACGAGTGAATTGTTCGGCGGTGTCGGTTCTGTGCTTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTGTTGCCAGCGGGGCTGATGGTTGATTCATTACACCGGAATTTCTGGGTAAAAATCGACGTACGCGAGATGAAACCCGACTGCACAGCGAATTACCGTTTACCCCCGACGCTATGGTGCTGATGAACGCGGCGGTGGCGATGATGACCGACGCCCGGCGGACGTAGCGCCATGCTCAGCCCTGGCCCGCATAAGGTTTTAGCAGTGCTGTACGCTTAAAATGTCATCCGCCGCGCTAACAACAACGACGGCGCCTTTGCCCGGATTAAGCGCAACTCTCCGTTCTGGAATATTTTACTGGCGTTCTGCATGTTTCATCGGTCACTTCGGGGTGATTATCCCGGCCGATGGCAATTACGCCGGTTCTTCGGTGTAAAGAGGCCAGAAGCCGCCAGCAGCTTCCGGCACGCTGCCAACACTTTACGGCCCGCTGTTTTGTTGGCTGTTAATCGGCACCGTTGCTGGATTTGGCGCACTGACCTTTATCCTGCCTGGCACTGGTCGGTGGAATATCTCTCCTGATGATATTGGTGAGCGCACAGATATGAGTCGTAAAGCAACTGGCGCTATTGAATTAACGCATCGTTCGGCGCTGAAAAACTGGTGAAATTAAACCCGCAAGGCACCAGTAAGCAATCCGGTGATGTTTATCCGATACCGGATCGGCAGTCTGCTGATATTATAACATTAACATCGCGATGGCAAACGGTTACGTCGCGGCAATGCGTGTTAACGACCATTAGCAGTTGGCACAATATGGATCACCCAGCACTGTTCGCTAATAATAATTTCGCCGGGCGCTGGCAGAAGGCCGCGGTAAGCGCAGGCCAACAGTCTGAAAAGGATAAACTGCCTTTGCCCGCGAGCGCGTGAGCCAATATATGGCGCTGCGGCCAGACCAAAATACCGACCAACAATAAAAGGCGATATATCGTACTTTTGTTAGAAGCTGGCGTCAGTATCCCTGCGATGGTGAGTTATTGGAAGGGTCATCGGTCGGTAAGCGCCATCACCGGGAATCGGCACGGTGATCCGTGAATCAGCGGCGATTTGCCTTGTCACCGGCGGCGCGTATTCTTTCTGACTGGCTGGTGATTGAATTGGCGTTAACCCCGGCGGAACATTTCTGGATCGGATGATCGCGATGGTGGAAGCGCACAGCAGCGCAAAACGCCGAACAAAAGTACCCTGACCGTTCTACCGTTGCCTGACTATCGTCTTTTTACTGGCAACCCGCACGCTGTACATTTCCGCGTGGGGCGGTAATGCCGTCAGCGGCAACGGTACTGTCGGTGGCACTGCTGGTCTATTCTGATCCCAACCACTATTGGCGGCCTGTTTGTCAGCGATCGGCATCGCCGGGATGAGCGGATGCTGCGACGCGAATGTGATTGCCACCAGCGGACGTGCGGATTTGAAGCGACGCGGCGTTGACGTTCTGCTGCTGGTCAAAACCGGCACCATCACACTCGGCAACCGTCAGGCGTCGGAGTTTATCCCCGCGCGGGGCGTGGATAAAACGCTGGCTGACGCCGCTTTATGGCTTCGCTGGCTGATATGAAACGCCGGAAGGCCGCAGTATTGTGATCTCCACCAAGCAGCGTTTTAACCTGCGCGAGCGCGTCAATGCAGTCGCTCCATACACCTTTGCTGCGTTTACTGCGCAAAACCGGATGAGCGGGATCAACATCGACAACCGCATGATCCGTAAAGTTCTGTCGTGCCATTGTTCGATACGCCATCATTTAGCAGAGGCTAACGGTGGTCGCCCCTACCCGATGTTGATCAAAGTCGATCAGGTTGCGCGATCGGGGTACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTTACTGGGCGTTATTGCGCTGAAAGATATCGTCGAGGCGGTGTAAAGGCGCTTCGCCCGAGCTGCGCAAAATGGGCATTAAAACATTGATGATTACAGCGATAAGCTTTGCCTGCCGTCTGACTGCCACCGCGATTACCGCGGAAGCAGGTGTCGATGATTTTCTCATGAAAGCGACACACGCAGGCCAAGCTGGCATTGATCCGTCGAGTATTATCAGGCGCGGAAGGTCGTTTGTGACTGGCGATATTAGGCCCGGCGACAACAACCAACGTGCTCCGGCGCTGGCGCAAACGGATCATAGTGAGCGATGAACTCCGGCACCAGGCGGCGAAAGGCAGGCAATATGAAGGTCGATCTCGACTCTATTGACAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCTGCGATGACCCGTGGCTCATGACCACCTTCAGCATTGCCGCAAACGATGTGGCGAAATGCTTCGCCTATTCCAGCGGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCGCTCCGCAATCCTCAGTGCGGTGATTTTTAACGCCTTGATTATCGTCTTTTGATTCCCCTGGCGTTAAAAATGAGTTATAAACCATACCGCTTCTGCCATGTTGCGCCCGTAACTTATGGATTTACGGTGCGTTGGGCTACGGTGCCGTTTATCGGTATCAAAGTCATTGATTTGATTTACTGCTTGTTTGCGGTCTGGTGTAAGGAGTTTTACCATGATGGGATTACGTCCATCAACATTTATCTTTCTGTTGACAGGTGCGATTTAAACGCACCCAAGCAGACGCCGCAATATCAACCGCG
>463d6152-c15a-4ad9-b4b6-a85be09d62c3
TTGTTGTACTTCGTTCAGTTGTGCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGCTTGGGTGTTTTAACCTATCGTTATACCAATCGAAACATATATTCATGGTATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAGGCTTTCCATATAAATCTGCTTAAGGGTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCAGCGGCGTCAGGGCGACGCCGACGCAATGGCAGTAGCAGCATTGTCCAGAGGTTCAGCCGGGGTACGCATCAGTTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGTGATCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGTCCTTCCCGGTGAAACCGACATCGCCCTACCCGGCCCGCTGCCGTTCATTTCTCTCCCGCACCTGGCAGTTACCGGACAAAAACGCCCGCGCCGGTGGGAGCCTCGAAGCCCCGGCTGGAAAATGCCTGCGGATATCCCGCTTACAGCTGCGCGATAACACACTGATACTCGATAACGGCGGCAAGCCTGTATTTTGACACCTGTTTCCCGGTGAGGACGGTTTACCCAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCGGAAGAACTCCACTTAAGTCCGCATCGTTATCTGGCGACAAACAGCAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGACAGGTGCCGGAAAGCGGATGAGGTGCTACCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCACAATTGGACCGCTTCGGGCGCACACAGACGTTCCACCACTGAAGCCGCCAGTGAATTCAACCAGCGAAATCACCAGCGTGACGGATGGTGCCGAATCACTTCCGGCTGGTACTGACCGCAGGCGCAGCGACTGAAAGCCCGGCAGCAGGCCATTTCGGCGGAACGATTCGTCCACTTTTCACGATACCCTGCCGGGTTACACGAATATAGCCGGGACAACGGCATCGATCTGTATCTGCCATGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCATATGGCTGGACGCCCGCGGCGAACTGGCGGTATATGACCGCAGCAATACCTGGAATGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCGCAAATCACACGGGCCGACCGGAAATCTGTTACCGTTACACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCGGCAGGCTTAAAGTTACGTATCCAGTATGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCAGGTGAGCGAGTGGTGAAAAAGAACTACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGCACAGACGGATGCCACCAGGCAGGACAGCAGAATACAGTCCGGATGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCGGGAGCATCGGCGTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGAAATACGCCAGGAATATGCTGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGGCGATATGCTGCCGCTACCGTTATGATAATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCGGAAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGGCTGAGTCAGTACCGCGCATGCGACAGCCGTGGACAGTTAATTGCCGTGAAGGAACGCAGGGGCCGTAGAGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCGGACGGCAGAAGCCAGGACACAGTACGATGCGTGGGAAAAGCCATCTGTACCGCAGGGCGGTCTGACGCAGTATGGAATGCGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCGAAAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATGCAGGGAAACCGGCACGGCGGCCGCACGCAACGTTATCACCACGACCTGACCGGCAAACTTAGCCGCAGCGAGGATGAGGGCTGGTCACCCACTATTTTACTATGGCAAAACAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCGAAACGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCACCTCGCCAGTGAACACCTGACGGGTGCATCATCCTGAACCGATGAACTGCTCTGGCGGCATGAGACCAGACATGCGTACAACGCACGGGGACTGGCGAACCGCTGTATACCGGACAACCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACCGCTGGTGCGTGCACCCGCGACCGCCTGCACCGAGGAAACGCTGCGCAACTCGGCCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACGGAAACCGGCACACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGCGAACGTGGCAGACTCATCCCGCATCAATGACCGCGCCAGGCCAGATTTTAGCTACAGCACCGCCGGCGAGCTGACCGGCGTTCACACCACCGCAGCAGATCTGGATATCCACGTCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGAAACTGCACCCGGACAGCACCCTCAGCGTAATGGCCGGATAACCGTATCGCCCGTGACGCGCACTGGGTTAAACACCCAAGCAGACGCCGAAGATAAGAACGCGGCA
>be16c798-0278-462a-b65b-6e77e03c7432
TTGGTAGCCCTTGCTTCGTTTCAGTTGCATTGCTGCTTGCCTGTCATCTATCTTCGGCGTCTGCTTGGGTGTTAACTGGGTCGGTATCGCACCAGCACCGGCGGGAACGCCACACTGCCACCGTCGCTTCGCCGCCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCAGTTTCAACCTGATGAGTGGCGTGGCTCCCGGCTGATAAATCATCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCGGGTCACTTGTGGTTCCGACAGCGACATCAGCCCGTCAGGTCCCCGTTCACGTCGCCACACCCGTTTGCCGCACGGTAGCGGGTCATTAAGATAGCGGCTTTCGACCAGCGGCTCTGCATATTGTGTCCGTAGTAGTGCACCAGCCCGGTGCTGACTGTCATGTGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCCTTCCGGGATGGTCGGTTTTCTCCGTCAGCCTGCCGTGACGGTCATGCCGGTAAAGATAATTCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGTGCTGTCGGGTGCAGCTCGGGTCGGGTGACAGTTACCTGCAGGTCTGTAGGCATACGGGATATCAATGCAGGTTACATATAATAATAAGGCAATTAACTTAATTTATTTGTTTATAATGCGCTCGCACTTAATACAAACCATTGAATATACCACTCCTGACGGAAAATAAAGCCATATTATTATCGCCATAATATACTTACTATCGAAATCCTTACGCCAATAATGTCGTCTGAGTCCCTATAAATATTAGAGCAATAAGAGAATGCTATGTTGGAAAACATATTACCATCATTCCATAAGACATGAGACGAATTAACTCGCTCACATCACGGAGTGGAGTCTAATAGTGAAAGTCTATGCATGGAAAAGAATAGTGATAAAAGCGATAAAATGACCATGGCTCTGAACAAAAATAATATATTTCATTCACATCCTCCGGTGAATACAAATCTAATAAAACGATCAATGTATTTTCCGGAGCACTTCATCTTACATGTTTCCTGAGAATCCACATTAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAATTTATAGGTGTGTGAATATATCCAGGCAATACCAGAATAACATGACCTTACCTCTTTAAACTTCCTTTTAAACAGTTCTCCACACAACTATTATCTGGTTTCAACGAGGGTCACAACGGCCAGCAGCTTCTTTTGTATCATTACTTCCTTTACCTGGCTACATAGACCATCTCCTTTTGATTCTCCCCGTTGGTCTTGGCACACAAGTATAGTCCCTTTACCATCTGGGACACAAAGATATTGATGATGAACCGGATTCCCCATATATCTGGACCGCTTCTTTCACCAGTTCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTTCTAATCTAATGGATCTATATTTGAGATCGGATTCAGCGGATACTGATAAAATTCCATCCCCCTTTCAGCCCAATCGGATCTGAGTGATATATCGCCCCTGCAGCGGGTCATAGCGGTGGCGGTTGTAATACCAGGCCGGACTCCTCATCATGCTGCTGCCCCGGCAGGTATCGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAACAGGTTACCCCATTCATCGTATTCTGCGTACCACGCTGTTATTCCTTCCGTGCTGATAAGGGCCAGCGGCGGGCCGCGATAGTCGCCAGTGGTACGGGTGAATTTTTCGCGCCGGCGTGTATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAACGGCAACTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCAGAACACCACTGCCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGGGTTTTCGCCAGCTCACCGGTGGCGGTTTTTAACCCTGATGAGTGGCGTGGCTCCCCGGCTGATAAATCGTCTGGATGGTTCTGTCGTTCTGTATCGTGGTCAGGCGATTCGCCGTCCCAGCCATGCCAGGTCTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATGCCCGTTTTGCCACCCTGCGGCCCAGCCCAGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCATCAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCCGGGATGAGGTCGGTTTTTCTCATCAGCCGTGACGGTCATACCAGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGCGCTGTCCGGGTGCAGCTCCGGGTCAGACGAGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCAGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGGTTCGCGTTATTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCGGCAGGTATAAGCGGTGGTGAGTTCACCAACGGCCGAAGCTGCGCAGCGCTTCCCCGGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGGTGTGTCACCAGTTTCATGCCTGACGGCCAGCCGCTGCCGTAGGTCAGCCACGGCGGGCAGGCTGTCCGGTGCTCACAGCGGTTCGCCAGTCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCTACTGGCAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGCGATGCTTGTCAGCCAGCCGCGTTCGTCATACTGCCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCACCAGCTGAAGTCGCCAGTGCCAGTGGGTGACCAGCCCCTCATCCTCGCTGCCGGATAAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAAGCCGGTTCCTGTATCAGCCGGTCCAGAAATTACATCGGCGTAACAGCGGAAGGTGGTGTGGCTGCTTGCCGTTTTCACTGGTCAGGCGGATGACCGTCCGGCATCGTAATTCCATACTGCGTCAGACCGCCCTGCGTGAGCGCAGATGGCTTTCCCCACGCATCGTACTGTGTCCGTTTCTGCTGCCGTCCGGGAGGCAATGACGGTGGTCAGGTCACCGGCAGCGTTGGCGTATTCATACCGCGTTTCATGGCCTGCGTGTCTTTCACGGCAATTAACATCCCACGGCTGTCGTATGCGCAGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAGCGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCTGAATCAGACGGCCCCATTCATCATATTCCGGCGTATTTCCAGCCGTCAGGCCGGTGGCTGACGTTAACTGGCTATTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGAGGCCCGTCACCACATCGGGCTGTATTCTGTTGTCCTGCCTGCGGCGTCGTCTGTGCCCTGGGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCAGTTCAGGCTGTCGGTGATGCGGTCCTTCTCATACTGATACGTGTAACCCAAGCCTGCCGGGTTTTGGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCGGTCGTACGTGTGACGGTCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCTGTGTGTGCTGCGGTCATACCGCCGCCAGTTCGCCGCAGAGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCCGCGGCGAACAGACGGATGCCGTTGTCCGGCCATATTCGGTATGTAACCCGGCAGGGTAATCAGGAAAAGCGGACGGCTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCAGGATGACGCCCGGCACCATCCATCGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCAGTGGAACGTCTGTGCGCCCGAAGCGGTCCACCAACCCGGTCGTACCCGGTACGGCGGCGGCGGCATGAGCGGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACTGGCTTCATCCGGTTCGCCACGCCGCCGCGCCAGCCACAGTGAAGCTCACTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATGCAGGCTTCTGCCGCCGTTATCACTGAGTATCGGTGTTATCGCGCAGCTGTAAGCGGATATCACCAGGCATTTTTCCAGCCGGGGCCGAGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGAAGATAAAGACAGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGACCTTTACCGAGCAGCCCGGATAGTTGACCGGATGGCCGGACGTCACCCCGCCGGGGCACACCAGACAGGCCGCCGATTGGGGCACCGATGCGTACCCCGGCTGAACCTGGACAATGCTACCGCCATACTTCCGTCATGTCGCCCTGACGCGCCCGCCGGTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCCTTGAATATATGTTTCGATTGGTATAACGATGTCTAAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTCATCTATCAAAACTCGGCAATCAATAAAAATCACCAGTTGCCTTCCGGCCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCGAATGCTTCTGTAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAGGCAGCGCCAGAGCGCCCGCTGCAACCGCATAAATTACGGCGTAAAAGATAAGCCATGCAGGATATTCTCCTGTAGAGGGGACATACTTTTCTCCCCTTTTATCCTACCCGGTGAATGGCACCGGAAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTTTGTGTAATTTTACTACTCATCCGACCCATATTTTTGCTTATTGATGGTTTATTTACATTCATCCCATGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTTGCGAAATCTTTGCAGCCAGGAATTCTACCCTTCCGGTATCACTTTGGGCCACTGGAAGTGCTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTTATTACTGGGTTATCTGGTTTATGCCCTGACCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCGGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAGCAGGCGTTGAGCGCATACTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAATGGAAGCAATATCTTTGTGCCATTCGGCCTGAACATGCTGGGGCTGGCGGTGCTTTCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCCCAATCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATGGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGAGAAACTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTGCACGCATCACGTTATGGGTACTTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCGGGCTGTGAATACCGTTGAAGGAGCGCAACGGCTGTTACCATAGGTTAAACCCCACCCAAGCAGACGCCGAAGATAGAGCGACAGGCAAGTAGCAATACGTAACTGG
>8d9d3bb4-cec7-4960-a3c6-9c3e59aab4a7
TTGGTATTGCTTCGTTCAGTTACGTATTGCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGTAGGGTGTTTAACCTAGACATCAGTTATGCAATCAGAAACATATATTCATAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCCTTAAGGCTTTCTTATAAATCTGTACAGGGTTTTCGCCTGTCAGCAGACAAATAACCCGATAAAAACAAGGATAAAGCAGATGGAGGCGGAAAAACCAGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGATAGCGGTAATCCAAAGTTCCAGCCGGGTACGCATCAGTGCCCCCACCGGCGTGGCCTGTTGGTGATACCCCGGCGAAAGTGACGATCCGGCCATCAGTCAATCCGCTTTCTTCAGTGCAAAGATGCCAGGTGAAATAAACTTATCGCCCCTACCGGCCCGCTGCGATTAAATTATCCCACCTACAGCAGTTACCGGACAACGCCCGCGCCGGTGAGCCTCAGCGGCTGAAAATGCCTGCGGATATCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTAAGGGACCAGTTTAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGATACCCGGCTGGCCCGCGCACTCTGGCAGGCGCGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACGAAGTCCACCTGGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGGTACTTTCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCACCGCGCGTAACCGGTGAATTCAGCGGCGAGAATCACCATGACGGATGGTGCCGAGGCATCACTTCCCGGCTGTTTGACCACGCAGGCGCAGCGGGCAGAAAGAAGCCAAGCAGCAGGCCATTTTCCGGCGGGACGAGACCGTCACTTTTACCGATACCCTGCCGGGTTACCGAATATGGCCAGGACAACGGCATCCATCTGTCTGCCGTAGCTGGTACGACTGCACGACCGAATACCCGGAATTTACCTGCCGCCGCTGGTACTTATGGCTCTGAACCGCCCGCGGCGAACTGGCGGTAATATGACCGCAGCAATACACAGGTGCACAGCTTTACACCTGATATTAAATACGGGGCCGGATGGCGCACCGTCACACGGGCCGACCGATATTTACCGTTGACAGCGACGGGCGGTGACAGAACAGCTAAACAGCAGGCTTAAAGTACGTATCGGTAGCCGAAGGACCGCATCACCATGCCGACAGCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCAGGTGGTGAAAAATTCCGCGGACAACGGCGTCACGCCAGAGTCAGTTTGAAGCGCGTGGGCAGGCTCAGGGCACAGACGATTCTGCCAGGCAAGTTAGAATCTGGTCGGGATGTGGTGACGGAGCTCATCACGCGCATCACCACGCCGGATAACAGAGAACATCGAAAGCGTTTTACTATAACCACCCTGGCCAGTTAACGTCAGCCACCGGGCTGACGGGCTGGAAATACGCCAGGAATATGATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCGCTTCTGTGCCGATAATCCACACGGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCGGCAGAGAAAACCATGACGATAGACCGTACGGTCAGTTGCTTCCAGGCTTCACTGAAGCTGTTCCGGTTATGTAACCGCTATGACCATGACCGTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCGGTACCGCGCGCCACGACAGCCGTGGATTAATTGCCGTGAAAGACACGCGGGGCCATGAAACGCCGTATGGATACCAGCGCCGCGGTGGCCTGACCACCGTCATTCACGGGCGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGGCGGCAGCCACACACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCGACGGCCGCACAGCATTCATCACGACCTGACCGGCTTGACTTATCCGCAGCGAGGATGAGGGCTGGTCACCCACTATGACGAAGCAGACCGCCTCACGCGTCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGTGGCTGTTAAGACGTAAGCCATATCAGCGAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCCCTCGCCAGTAGACACCTGACTGGTGCATCATCCGCAGACAGATCGACTGCTCTGGCAGCATGAGACCAGACATGCGTACGCTTGCGGGGACTGGCGAACCGCTGTATACCGGACCAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCGACTGGCTGTCGGAAGGAAAACTCGGCAACACACCGCTGGTGGAATTTTACCGCGACCGCCTGCACCGGGGAAACGCTGCGCAACTTTCGGCCGTTATGAACTCACCACCCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCCGCGATTACACCTGGAACGACAACGGCGAACTCATCGCATCAGCAGCCGCGCCAGACCGGAGTTACAGCTACAGCACCACCAGCAGGCTGACCGGCGTTCACACCACCACCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAAGGTAACCGCCTGCCCGACCGGAGCGCTGCGCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAAACCGACCTCATCCCGGAAGGGGTTGGCATCCGCACGGATGATGGGCGCACCACCGGTACCATTACGACAGTCAGCACCGGCGAGTGCACTACGCGGACACAATGGCAGAGCCGCTGGTCGAAAGTCGCTTCTTTACGACCGCTGGAACGCAGGGTGGCAAAACGGGTATGGCAGCGTAGACGGGACCTGACGGGCTGGATAATCGCTGTCACGGAAACCGCAAGTGACCTGGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCAGACGATTTATCAGCCGGGGCTTCACGCCCTCATCAGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCACCCAGCTAACTGGATACCCTTCAACAGTCCGGTGGCGAAGACGGTGGCGGTGTGGTGTTTGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCTGGCTGACCGGGTGATGGGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAGCCAGATGGACCCGGTATACCGCCGGCGCGAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCATATCAGCACGGAAGGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGGATAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAATTATGATGAGGAGTCCGGCGTATTACAGCCACCACCATAATATGACGCTGCAGGGGCGATATATCCTCAGGATCCGATTGGGCTGAAGGGGATGGAATTTTATCGAGTATCCGTTGAATCCGATCTCAAATATAGAATCCATTAGAGTTAGAAACGCTAAAATGCATTGTTCAGCCACTGCATTCAATGGGCGGAACTGGTGAAAAGCGGTCCAGATATATGGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCCAGATGGTAAAGGGGACTATACTTGTGGTGGCCAAGACCAGCAGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCTGCTGAAAGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAAGGGAAGTTTAAAGAGATAAGGCCGCGTTATTCTGTATTGCCTGATATTCCGCACCTATAAATTTAGGGCTGTTAAAACTGCCAAGACTAGGTTAAACGCAAGCAGACGCGCCGAAGATAGAGCGACAGGCAAGAGCAATACACGTAACACGA
>a724164e-c45d-4870-8cc1-b5973253fe9c
ATCGGTAGCCTTCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTCTGCACGTCGCTGGTGGCAATCCACGGTCGCGCCACAAGATCCGGCTCATCCGGCGACGCCGATCGCTGACAACAGGCCATAATAGTGGTTGGGATCCAGGCAGACCAGCAGCGCCACCAGTACTCGTTACGCTGACATTACCGCCCCCACGCGGAAAGCAGCCACAGCGTGGCGGTTGTAATAAAAGACGATAGTCAGGGCAATCAACCAGAATGGTCAGGGCAAGATTTCGTTCGGCGTTTTGCGTCTTGTGCTTATTCCACCATCGCGATCATCCGATCGAAATGTCTCATGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATGCGCGTGCCGCCGGTGACGAGCAAAATCGCCGCCAGTTCACGGATCTGCCAGTGCCGATTCCCGGTGATGGCGCTTTCATCGACCGATACACCCCTTCAATGCTTCACCATCGCGGGGATAATATCGCCAGCTTCTACCGGTACGATATCGCCTTTACAGGGGATTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATCACAAACTCACGCAGCTTGCGGGCAAAGGCAGTTTTCACCTTTCAGCGGACTGCTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAGTGGCGAACAGTACGGTGATCTGGCCAACCGCTAATGGCCGCTAAACAGCGCATTGCCGGGCATCACCGCTTGCCATCGCGATGCTAATACAGGTGTCAGCAGACTGCCGATCAGACGATAAACATCACCGGTTGCGCCATTGCGCCTGCGGGTTTAATTTTTTCACCGCTTCTTTCAGCGCCCTGAACGGCAAGTGTTGGTTCGAATAGCGCCAGTTATTTACGACTCATATTCAGTGCTCCTCAATATCATCAGGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAGCTTACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGACCCGGAGCTGGCAGCGGCTCTTTTACTCACCAGCGAACCCGGCAATTGCCATCACCGGATAATCACCCCAGCGACCGACAAACATGCAGAACGCCGGTAAACGGTTTCCAGAACGGAGAGTTGGCGCTTAATCGGCAAAAGGCGCTGCGCCGTTGTTGTTAGCGGCGGATGTTACGGCGTACAACACTTCGCTTCTAAAACCATGCGGGTGGGGTTGAGCATGGCGCTTTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCCAGCACCAGCGTCAGGGGTAACCAGAGATTGCCAGTGCAGTCAGTTTCATCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCGGGACCGACAGCATCATGCCGTAAAGGCCAGAACCGACACCGCGAACACCGCTTCACCAGATTTGCATCAGCCCACATCGGCACCGTACCGCAGGCGAGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAGAGCAGACTGCTGACCAGCACGCCCGAGCAGCTCTCTTTGCCTTCCATATTGATGCTGCTGTCATTCGCGGCGCAGCGAATGAGGATTCCTGAACTTCTGCCCATCGCCACGCCTGCGGATGACAAAAATGCTGACATCGCCCACAGCAACGCCTGCGCCTGGCGGCTCGATCGCCCATCACTTCACCAAAGGCAAGCGCCACAGCGCCGTTGGGATCAAAGAAGATCGCCAGCATCTCTGCACGAAGTTGGTCGAGTGCGGTTGGGTTTCAAACGGATGCGACGGGGTTGGCATTAAAGAAGCCACCGCCGTTAGTGCCGAGCATCTTGATCGCTTCTGAAGCTACAGGCCCATGGGTAACAGCTGTTGCGCTCCTTCAGCAGTATTCACAGCACAATCAGGCAGAAAGGTTTTGCAGCGCACCTTGTTGAATAAAAAACAGTGCAATCAGCAGCAACGCCACCAGGGACCTAGCACCCATGGCGTGATGCGTAGCAGATCGACCCAGGCATTCCGGCATAACCATGCTCTGGCGGAGTAAACGCACGGATGAGGCAAAATCACCCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTACCTGTACCGTTAAGCCGCCATCACGGCTGAAATGACTCAGCGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGTTGGCGGTATTCAGCGCCAGATCCCCACGACAGCCCTGGCAACTGCTGTGGATAAGCGGCAGATGGTGGCGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCCGGGCGTGGCACAAAGATATTGCGCTTCCAGTTCATCTCACGTTCAGAGACGCCCAGTGCGCGAAAAGTGATGCGCTCAGCGCCCGTTATTGCCGGGAAGGAATATCTCGATAATCAATACGCGCCAGCCCGCTGCCTAAAGGACGCCGCCAGCACCATTAACACCGAATAAAAAGCAATGGCGATCAGTAAGAACCCATGCGCAGCCATCAGAACCTCCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAAACACCAGCCAATACGCCGGTTATCGCCTGCTCACGGTACACCTCCAGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCGCAAGATTTCGCAAAAATCTGCGGGCGGGGACAAAAAAGTAAAATGGCAAAGCCGCCGTTTAACTAATGTTTGAGTAATTTAACTTTTGTGTAACCAATTACAGGATGAATAATAAATAAACCATCAATAACTTAAAATAAGTGGTCGGATGGTGGTAAAATTACACAAAGGCGGTACTATTTTCATCAGATAAACAATTCATTTTCGGTACATTCACCGGGTGAATACAAAGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTACGCCGTACTTATGCGGTTACGCCCGGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCTTTTGCAATACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACGGTGACCGGATGGATCAGGCCGAGGCAACCTGGTGATTTTTATTGATGGGTTAAACTACCCAAGCAGACGCCGCAATATCACGGG
>cdf5b34b-6170-45bb-9691-6fcdaadb4713
TTGATGTACTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTACCATGATTAGTTATCAGGACGCAACAACTGAACTGGATCACTGCTCTTTTTTTGATAGATACCCGCTCTTATATAACTTCTAAACCGATCGCCGAGAAACGCCGTTTTTTCTGCTGTTTATCAACTCCTGCAACGTTCCTTTGATGGCATGATTTCATTGAGCGTAGTGACTGACGCGAATTAAGAGTCTCGCCCGCTTGGTGAATTTATTATTTTTTACATGTGCAGTTCTGTTTGCGCCAATAGCTTCTCACCGATGTCCTCATTCTGATACCATCTCCATGGCTTTATTGGCTAAGACCAGGAAACGCGGAAAAATGGTACCCTTAGCGAAAATAGTAAAACAATCATGATCTTTTAGCTTGTATTTCGCAATCAGCTATAACACCAAAACTAACAAATATCATCGGCAAAAGAGAACAAAACTCTTTTCATTTTTCTTATTCCTCTCGATGTTCTCTGTTTCATCTTAGCTAAAACTTCACCCCAAATCATCTATCCCTGCTGTTGCTGGCCCATCAGGTTTATTAATGTCTAAAGGAATAAATGGGGTTCTGCACAAGTATATCCTGGTGGTAATTGAGTTGTTGGCCAGTTGTCTGTGGCGGGTAATCACTTGCTGTCTTTGCATCCATCCCTGGATACTGGGAATCATCCTGTGGCGTACAAAGTCAGATTTGGTTTTACCCACTTCCTGCAATACAGTGTGTAGTCGTAGGGCTTAATGCTCTGAAGAATGTTTTGAAAACATTAGGCGCACTACTGGCCTGGTCAATAGGATGGCAGTCTTAATTGTTTCGCCTTGTCCCGGCAATTTACACTTGGATCGGGCGTAGGCGGTTTTGTTGGGTCTCGCTCCATATCGCCATTATTTAGAGATGTCCATGACTTACGATGCAGTCCCATTGAATCTATATACTGAACCGGATTCAGCGGATGCTGATAAAATTCCATCCCCCCTTCCAGCCCAATCGGATCCTGGTGATATACACTCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCCTGCTGCTGCCCCGGCAGGCGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTTGCCCCTTCCGTGCTGACAAGCGCCAGCGGCAGGCCGCGATGGTCGCAGTGGTACAGGTGGATTTTTCGCGCCGGCGTGTACACCGGGTCCATCTGTGGTTTTGCATCTGCTCCACCGTCCAGGCCGCACGATGCCAGCCAGCGGCAGCTTTCCTCACTCACCCGGTCAGCCAGTTTCGCTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACCTACCACCATCTTCGCCGCCGGACTGCTGAAGAATTTATCCGCCAGGCTGCGGCGCTGCGTTTCGCCAGCTCACCGGTGGCGGTTTCAGCCCTGATGAGTGGCGTGGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCTAGCCGTACCGGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTGGGTCCGTTCACGTCGCCACACCCGTTTTTGCCTGCGGCCCAGCGGTCGTAAAGATAGCGGCTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTGAGTGCACCAGCCGGTGCTGACTGTCGTAATGGGTACTGGTGGGTGCGCTCATCATCCGATGCGGATAACCCCTTCCGGGATGAGGTCGGTTTTCTCGTCAGCCTGCCGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACACATGCTGAGATTGCTGTCCGGGTGCAGCTCCAGGTCGGGCCAGGCGGGGATTTACCTGCCGGGTCTGTGGCATACGGGATATCAATGCCCAGGTTACATATAATAATAAGAGCAATTAGCAATTTGTTTGTTTATAGTAAACACTTAATACAAACCATTGAATATACCCTCCTGACAGAAAATAAAGCCATATTATTATCGCCATAATATGCTTACTATCCAATCCTTACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGAGCAATAAAAGGAATACTATGCCTGTTGGAAGCATATTACCATCATTCCATAAGACATGGAGCTAATTAACTCAGCTCCACATCCCACGAGTGGAGGTCTAATGGTGAAAGTCTATGCATGGAAAGAATAGTATTAAAGCGATCGAGAAACCAGCCATATAGCTCTGAATAAAAAATAATATATTTCATTACATCACTCCGGTGAATACAAATCCCTAATAAAGAGCGATCAATGTTATTTCCGGAGCACTTCATCTTACATGTTTCTAAAGAATCATTAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAGTTTATAGGTAATGAATATCAGGCAATACAGAATAACGCGTATACCTCTTTAAGCTTCCTTTTAAAACGGTTCTCACACAGCTATTATCGGTTTCAACGAGGTCTGGCAACCCATGGCTTCTTTTGTATCATTACTTGCTTTACCTGGCCCCATAGACCATCTCCTTTTGATTCTCCCCGTTGGTCTTGGCCACCACAAGTATAGTCCCTTTACCATCTGGGACTTCAAGATATTGATGATGAAACCCGGATTCCCCATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCAATGCATTTTGAGTGTTTCTATCTAATGGATCTATATTTGGATCGGATTCAACGGATACTGTTAAAAATTCCATCCCCTTTCAGCCCAATCAGTCCTGGTGATATATCGCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGGCCACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGTGGATAAGCTGCTGCAGCTGATGCAGGTTCTCTTCATTCAACAGGTTACCCCATTCATCATATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATAAGGGCCAGCGGCAGAGCCGCGATGGTCGCGGTGGTACGAATTGAATTTTTCGCGCCGGCGTGTATACCCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCTAACGGCTTTCCTCACTCACCCGGTCAGCCAGAGTTTCACTTTCAGCCGGTCGAACTCTGCACCAGCACCGGCGGGAACACCACCTACCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCCGGTGGCGGTTCAACTGATAGTGGCGTGAAGCTCCCGGCTGATAAATCGTCTGGATGCGGAGTTCTGTCGTTCTGTGTCGTGGTCAGGCGGTCGCCGTCCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCGGCCCGTCAGGTCCCGTTCACGCCACCATACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTGTCCGCGTGTGGTGCACCAGCCGGTGCTGACTGTCGTAATGGTGCCGGTGGGTGCGCTCATCATCCGTGCGGATAGCCCCTTCGGGATGAGGTCAGTTTCTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCGGCCACATGCTGGGGCGCTGTCCGGGTGCAGCTCCGGGTCCGGGCAGGCGGTTACCTGCCGGGTCTGGCAATTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTGGCGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGGGTCAGACAGCAGGCTGTTCAGGTGCTAGCTCTGTAACTGCCAGCGAGGGGTATAAGCGGTGGTGAGTTCATAACGGCTGACTGCCTGGCGTTTCCCGAGTGCAGAGCGGTCGCGGGTGTACTCCTGGCGGTGTGTCGCCAGTTTCATGCCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCTTACAGCAGGCAGGCTGTCGGTATCACAACCGGTTCGCCAGTCCTGTGCGTTGTACGCATGTCTCTGGTCTCATGCTGCCAGGCAGTTCGTTCGTCTGCGGATGATGCCGTCAGGTGTTCACTGGCAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACGGTGCTCCTTCGCTGATATGGCTGATGTCTGTCCAGCCAATACGCGTTCGTCATACTGCCACCGCTCTGCGGTTTTCGCCATTCGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCCTCATCCTCGCTGCCGGATAAGTTTGCCGGTCAGGTCGTGTGTTGATAACGCTGTGTGCGGCCGTCAAGCCGGTTTCCTGTATCCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGATTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACACCGCGCGTCAGACCGCCCTGCATTAGTTACAGATGGCTTTTCCCCGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCAAAGGTCACCGGCGGCGTGTGTCATACCGCGTTTCATGGCCCTGCGTATGCTTTCACGGCAATTAACTGTCACGGCTGTCGTATGCGCGGTGCAGCTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCGCGGGTTATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACAGCTCCACGTCCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAATTTCCTGATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCGTCGACCCGGTGGCTGACGTTAACGGCTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGGGGCCGTCGCACATCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCCGTCCGCGTGTTCCTTTTTTTTCACCACCCTGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACAGCAGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTTAGCTGTTCTGTCGCCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGAAGCTGCGCACCTGTGTATTGCTGCGGTCATGCACACCGCCATGGTCGCCACCAGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTGGTCTCCGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGAACAGACGGATGCCAATTTGTCCCCGGCCATATTCGGTGCTTGGCAACCCGGCAGGGTATCAGGAAAAACGGACGGTTCCGTCCCGCCGGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCGAGTACCAGCGGAAGTGACGCCCAGCTGCCATCCGTCCGCAGTGATTTCGCCGCTGAATTACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAACCAGTCAGTACCCGGTACGGCGGCGGCAGCGGCACGAACGGCACCTCATCCGCTTCCGGCACCCGCTCACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGGATTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCAGCCACAGTGACTCGCTGCGGCAGCAACCGTCCTCACCGAAACAGGTGCTCAAAGAAATACAGGCTTCTGCCCGCCGTTATCACTGAGCATCAGTGTGTTATCGCTGGCTAATAAGCGGATATCCGCAGGCATTTTCCAGCCAGGGGCCGAGGGCTCCCCACCGGCGCAGGCGTTTTGTCAGTAACTGCTGTAGGTGCGGGAGAATGAACAGCAGCAGGCCGGGCAGGGCGATGTCGGTTTTCACCGGGAAGGACCTTTACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCCGCCGGGGCACCGAACAGGCCACGCCGGTGGGGGCACCGATAAGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATGCTGCGTCATGTCGCCCTGACGCGCCGCCAGTTTTCCGCTCATCTGCTCATCCTTGTTTTGTATCCGGGGTTGTTGTCTGCTGACAGGCGGAACCCTACAGATTTATAAAGAAACTGTAATTGAGATATCTGTCAGATAGAACAATTAGGAAAAATATTTATATATATTTCATGGATATATGTTTCGATTGAGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAACCGCCAGCGTTTCCGCTGGCGGTTTCAATATTCAAAACTCAGCAATCAATAAAATCACCGGTGCCTTTTTCGGCTGATCCATCCACACCGGTTTATCGCTGGTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCAGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAACCAGAACGCCGCTACGAAAAGCCGCACATAGAATTACGGCGTAAAAGATAAGCCATGCAGGATATTCTCTGTGAGAGTTCCATCACACTTTCTCCCCCTTTTGTATCTACCCGGTGAATGGCACGGAAAAATGGTATTGTTTATCTGATGAAAATAGTACCGCCTTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTTGCTTATTGATGGGTTTATTTACATTCATCCTGTAATTAAGTTACTGAAAGAGTTAAATTAATACTAAACATTGGATTAAATCATGGCTTTTTGCCATTTTATACTTTTACACCGCCCGCAGATTTTGCGAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGTTACCACTGTAGTGCAGGCGTGATAACCGGCGTATTGCTGAGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGGAGGCGTTCTGATGGCTGCGCAAAGGGTTCATACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCGGCAGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTTCGCGCACTTGGCGTCTCGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCGGCACTATCTGCCCGTAATCCACAGCAGTTGCCAGGGCTGTCATTGGGATCTGGCGCTGAATACCGCCATCGGCTTTGTCACCAATACCAACTGGCAATCTTATGGTGAAACCACGTTGAGCTATTTCAGCAGATGGCGGGCTTAACGATTACCGGCTTTCTTTCTGCCGCCAGCGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATACCTGGGGCGATCTGCTGCGCATCACGTTATGGGTGCTAGTCCTGTGGCGTTGATTGCACTGTTTTTTATTCAACAAGGTCGCTGCAAAACTTTCTGCCTTATCAGGCTGAATACCGTTGAAGGAGCGCAGCTTGGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGGAAGCGATCAGATGCTCACGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCGTTTGAAGAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACAGCGGCTTCCACCAATGGCGCAGTGATTACGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGGTGTTCGGCGGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGGCGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTAGGTTAAACACCCAAGCAGACGCCGAAGATGGAGCGACAGGCGAAATTGCGCAATGGCTCTATCGGCGTCTGAAATGTTCTTCCGCAATGTGTTATGCGGGGGCCGCATCGTTACCCGGCACTAAGCCCTGGCTGAAACGGGTGGTGCCGTCAGCGCCTTAACCCCGCGTGAGCACCTTGTGTTATGTCAACCAACTGTAACGTTTCTCCTTGAGATACCGCGTGCACGGCAAGCTGGCAACAGGCAGCGGAAAGGTACGTCAACTGGCAGTGCTCCTGAACCACAGGGGACGCGTATGAACCTGGTGGATATCGCCGTTCTTGTCTCAAACCCATTGTTTGCAGCGCCGCGGCTTCCTTGATGCTGTTCTGGAAATACCTGAAGTAATTCAGATTCAAGTCGCACCAAGGGGCAAACCGCTCCTTTTATATTAGCGATGCGGGTTGGTGTCGGATGCGATGCTGACGCGTCTTATCCGCCCTACCATCTCCAGCAGCATTTATTGCCGCTTTTGTTTTATATTCTGCCCGCTAAACAATTCCCCATTTCACCAGCGTATACCTGGCTAACATTCATCAATGTGATAGATTCCTCTCCCGCATTTATGAGATGCGTAGTGACTTATTCTAATTATTTTTATAAAGCATCCGTGATAATGAAAAAGGCAAAGAAACGTCAATTTGTTATTGATGTTGGTATTACTCGTGGCCGTCGGTCAGATGGCGCAAACCGATTTATATTCCAGCTATTGCCGATATGGCGCGCGATCTCAACGTCCGTGAAGGGCGGTGCAGGGCGTAATGGGCGCTTATCTGCTGACTTACGATTCTCACAGCTGTTTTATGGCCCGATTTCCGACCGCGTGGGCCGCCGACCGGTGATCCTCGTCGGAATGTCCATTTTATGCTGTAACGCTGGTCGCGGTCACGACCTCCAGTTTGACGGTGTTGATTGCCGCCAGCGCGATGCGGGGATGGGCACCGGCGTTGGCAGCATAATGGCGCGTAATGCTTTACCGCGAGATTTATATGAACGGACACAGTTGCGCCATGCTAACAGCCTGTTAAACATATGGGGATTCTCGTCAGTCGTTGCTCGCACCGCTAATCGGCGGTCTGCTGGATGCGATGTGGAACTGGCGCGCCTGTTATCTCTTTTTGTTGGTTCTTTGTGCTGGTGTGACTGTATGGCCCGCTGGATGCCGGAAACGCGTCCGGTCGATGCACCGCGCACGCGCGCCTGCTTACCAGTTATAAAACGCTTTTCGGTAACAGCGGTTTTAACTGTTATTTGCTGATGCTGATTGGCGGGTCTGGCCGGGATTGCCGCCTTTGAAGCCCTGCTCGGCGCGTGCTGATGGGCGCGGTGTTAGGGCTGAGCAGTATGACGGTCAGTATTTTGTTGTTTATTCTGCCGATTCCGGCAGCGTTTTTGGCGCATGGTTTGCCGGACGTCCCCAATAAACGCTTCTCCCACGTTAATGTGGCAGTCGGTTATCTGCTGCCTGCTGGCTGGCTTGCTGATGTGGATCCCCGACTGGTTTGGCGTGATGAATGTCTGGACGCTGCTCGTTCCCGCCGCGCTGTTCTTTTCCGGTGCCGGGATGCTGCTGTTTCCGCTGGCGGCCAACGGCGCGATGAACCGTTCCCCTTCCTGGCGGGCACGGCTGGCGCGCGCTGGTCGGCGGTCCGCAAAACATTGGTTCCGGCGTGCTGGCGTCGCTCTCTGCGATGTTACCGCAAACCGGTCAGGGCAGCCTGGGGTTGTTGATGACCTTAATGGGATTGTTGATCGTGCTGTGCTGGCTGCCGCTGGCGGCGCGGATGTCGCGTAGGGGCAGCCCGTTTTAAGCGCACGTCACCACCCAGCATCATCAGCTCCGTGGGAGAACGATGCTGCTTTATCAGATCACATCACCCGCATATGCGGTGCCCGGAGTAAGAATAAAACGCCTGATAGCCGCACAAAGCACTGTCTGGCGTCTCCTGCCGAGCGATGCGGGCACAGGCGATGCCAGTCGCACGCCTGGCAGTCACAACGCGGTTGCGGGTTTTTCGCTGCCACACCATTTTTTGTAAGGTGGCGTCAAAAGCTCAATCGAGATACGACTGATATCTGCCCGCACCCAACACTCGAACAGGGCAGTGCAAAATTTCCCCACGAAGCTCTGCTGTCACGAAGCGGCCGTCCAGATCGCCCGGTCGTAAATTCAAGATAGGGGAATGGGCTGTACGGGCGGATGCCCGCTGTTTGAAATTATTGATAAAATCGGCGGGTTGCAGAGCATCCTTGTACTCTACAACCAGTTTATGCCCCGCAATCTCTTCAGCATCAATGACCTGACTTCCTGCCATGCGACTCTCAATAAATACGATAAGAAGTTGATGTATGCGTTACGGCAAACGTATTGCGAGATAACACCGCGAGGAGATCAAAAATTTGTCACGGACTACGTGAAATTGGGAAAATCGCTATTCATTGACATCCATTAGAAGTGCGATTACGTTAGCGAATCGCGGAAGGATCAGCGCCACGATGGCGAAATGCCAATCGAAATCAGAATAACATGCCCGCCTGGTACCCAGTTGTGTTTGATAGCCAACGCCATCAACGCCGTAGCCAGCGTGGTACGAAACCACGCCGGTGATATTGCGCTCCGGCTGCAGTCCTGGGTCGGCAATGCGTCTGGCTTTGCGGCTATCCGGCATACAACGCCAGTCCATAACGATCACCGCCACGACCATCAATATTAAGCTAATGATTAATGGCTGTTGGTGTAGGAGCGGATCCTCTTTCAGACGCATCGCTTTTTCATTGCGCGCCAGCGCAAGTAGCCATACATCGCTAACCGCCGGAAAACAGACACAACAACAACGCCAGCAGTTCGCGAATGACGGGCGTGGCGAAATCCTGGCGCAAGTTGATTGAAGCCCAACCCCGCCGCCAGAAATCCTGGTGCAGTACGGATCCACGCCAGAAAAGTACGCTCATTAGCCAGCGAGAAGCGGTAATCAGGCGCTTCTCCGGGCGGGAAAATTTTCATTGTTGCTCCTTTGCAATTTCACTAACGCGCTCTACCTTTAGCGGTTTTTAAAATTTCCGTCCGCCCGTTTCCTGATATGCTTTTGCCATCCGCTACAAAGGGAGGTCAGATGGGTATCATGGCTCAAAATAAAATCCAGTTCATTGGGCATGCTGTTCGGTGCCATCGCTTTAATGATGGGGATTATCCACTTTTCATTCGGCGCTTTCTCCGCACCATAACGTTTGAAAGCATCGTGGCGAGACCGAAACGGCGAAATTAAAGGGTCTTCTCGCCGGAATAAAAGGCAGAAAAAATTACCACCGTGGAGAAAAAAGAGGACGTAGATGTCGATAAAATCCTCAATCAAAGCGGTATCGCACTGGCCATTGCTGCGCTACTGCGCATTTATTGGCGGTATGCGTAAGGAGAAAATCCTTCTGGGGCATTCGCGGCTGCGCTGGTTTTGGCGGCGGGACGCTGGCTTTCCATACCTTGCTTTTGGTATCGGCATCGTGTGCGGCGATTTTGCTGATATTCCTTATCTTTTTCCTTCCTGACCGGCGGTTCACTGGTTTAAACAGCCTGAATAATTGCCCGCCGGGTGATCATCAGCGGGCATTATCGTCAGAACTTCTGTTTTTCTCCTCACCTTCACCCTTGTGTCCGGTAGGCCGGTGTCATAGTCGCGTACAGCTGGCGAATAGCGGGTTAAACGCCTAGCAGACGCCGCAATATCAGCACCGCA
>84c0329b-2fe2-4fd8-ae10-f17ed9b2e0f9
TTCGTGCTGCTGCGTTTAGTTACGTATTGCTACTTGCCTGTCGCTCTATCGCTACGTCTGCTTGGGTGTTTAACCTACACCGCCGCCAGTTCGCCGCGGGCGTCAGCCGCCAGCGCACCAGCGGCGCGGCGAATTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAACCACGGCGAACATGGGCAGATGCCGTTATCAGCCATATTCGGTATAACCGGCAGGGTATCAGAGCGGACGGTTCGACCCGTCAGGAAATAATACTGCCCGGGCTTCTTCTGCCCACTGCGCCTGCCGTAATTCCAGTACCAGCGGAAGTGACGCCCGGCACCATCCATCCACGCCGGTAGTTTCGCCGCTAGATTACCAGCGGCCGTGGGAACGTCTGGCCATGCGCAAAGCGGTGGTCCACCAGCCCGGTCAGTACCCGGTACATGGCGGCAGCGGCGCGAGCAGCACCTCATCCGCTTCGGCACCCGCTCACACCAGCCGAGCCACCGGCCTACGTTGTTTGTCGCCGATAGCGATGCCGGACTTTAAGCGGGTTCTTCCGGCAGCGCCTGCAAGTCGACCAGCCGGTGACCTTCATCCAGTTCGCCACGCCGCCGCGCATAATACAGTGACTCATGCGGCGCCAGCAAATCTCACCAGGCTGGGTGCTCAAATAAACGGGCTTCTGCCACTGGTCAGTGTGTTATAACGCTACGTATGGCCGGATATCACCGAGCATTTTTCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTCATCCCGGTAACTGCTGGCAGGTGCGGGAGAAGAATGAGCGGCAACCCGGGCGAACGGGGCGATCGGTTTCACCGGGAAGGACCTTTGCACCGAGTGGCGGATTGACCGGATAAGCCCGGACGATCACCCCGCCGGGGCACACGAACAAACCCCGCGCCGGTGAGGCACCGATGCGTACTGGCTGAACTTCCCTGGACAATGCCGCCGCCATGCGTCATATCGCCTGACGCGCCGCCGGTTTTCCGCTCATCTCGCTCCATCAACATCAGGTTATTTGTCTGCTGACGGAAACCGAATTTATAAAGAAAGCTGAGGCGAGATATCTGTCAGATAGAACAATTGGAATATTTACTATGTTCATGAATATATGTTTCGATTAATTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATGCAAAAACCGCCAGCGTTTCCGCTGGCGGTTTCATATTCAAACTCGGCAATCAATAAAATCACCAGTTGCCTTTTTCGGCCTGATCAAATTCCACACCGGGTTTATCGCTGGTTTTCTGACCAGACGCGATGCAGGTAGCTGCAAAAAGCGGGCGCAGTCTTTCCAGAAAAAGCGCCAGAAGAGCTGGCGCCAGAACGCCGCTGCAACGCATGAGAATGCCTGACGTAAAAGATAAACCGTGGGATATTCTCTGTAGAGTTCCATACTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTGTTTGCTCTGATGAAAAATGGTACCGCCTTTTTGTGTAATTTTCTCATCCGACCACTTATTTTGCAACGTGATGGTTTATTTACATTCATCCTGCCTTAATTAAATTTACAAAGTTAAATTAATATAAACGATGGATTAAATCATGTTTTGCCATTTTATACTTTTACACCCCGCCCTGATTTTTGCGAAATCTTTGCCGTAATTCTACTTCGGTATCGCGCAGGCCGGAGATTTTCTTGAGTGAGCGTGATAACGGCATTGCTGGTGTTTTTATTACTGCGGGTTATCTGGTTTATACCCTGGTACGTCAATGCGGAGGCGTTCTGGTGGCTGCGCAAGGGTTCTTCTGATCGCGCCGATTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCGGCGGGCTGGCGCGGCTTTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTTCGCGCCTTGGCGTCCTCTGACCGTGGATGAACTGGAAGCAATATCTTTATTGCCATTCTCCTTCGACATGCTGGGGCTGGCAGTTACTGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCCCAGCGGATTTACTAGGGCTGTCGTGGGATCTGGCGCGCTGAATACCGCCGTCTTTGTCACCAATACCAGCTGGCAATCTTATAGCAGGTGAAACCACGTTGGGCTATTTCCGTAAGATGGCGAAGGCTAACGGTGCAAAGCTTTCTTTCTACCGCCAGCGAGTTGCGGTGATTTTTGCCTCATCCGTGCGTTTACCCGGAAACGCCGAGCACGCTCGAGATGCCTGGTCGATCTGCTACGCATCGTTATGGTGCTAAGTCCTGTGGCGTTGTTGGTGCACTGTTTTTATTCAGCAAAGGTGCGCTGCAAAACTTTCTGCCTTATCGGGCTGTGAATACCGGGTGGAAGGAGCGCAACGGCTGATACCATGGACCTGCTGGCTTCTCAGGAAACGATCAAGATGCTCGGTACTAACGGCGGTGGCTGTATTTTAATGCCAACTCGTCGCATCAGTTTTGAAAACCCAACCGCTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGTATGCTGCCTTTGGTGAAGTGATGGGCGATCGCCAGGGCGCATGTTGCTATGGGCGATGCTCGGTGATTTTGTCATCTGCGTAGGCGTGTTGATGTAGGCGGTTCGAATTAATCCTCATCTACTGGCACTGGGCACGGACAGCGCATCAATATGGAAGGTAAAGCCGTTCGGCGTGCTGGTCAATGCGCCTGTTTGCGGTCGCGGCGGCTTCCTGCTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCGGTGGCATATAGTGCAAATGCATGGCTGTCACAAAATTGGTGATGGTGTTCGGCGATTGACTGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGTGTTTATTACCGGGCTGATGATTGGTCGTACACCGAATATCGGGTAAAAAATCGACGTACACAGATGAAACTGGCGGCTGCACTGGCAATTCTGGTTACCCTGACGCTGGTGCTGATGGGCGCAACGTTAAGCGATATTAATGAAACGCCGGACGTAGCGCCATGCTCGCTATGGCCCACATGGCGGTTTTAACAGTGCTGTACGCCGTGTCTCCGCCGCTAACAACAACGGCAGCGCCGCGCCGCGGCGGATCAGCGCCAACTCTCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGATCCTTCGAATTTGATTATCCCGGTGATAGCAGTGCGGTTCGCTGGTGATAAAAGGCAAACCGCCAGCTCCGGCGCGCTGCCAACGCACGTAACTGTTTGTTGGCCTGTTAAATCCGGCACCGTATTTGCGGGGTTAAACACCCAACGAACGCCGCAATATCGGCGGG
>2c469631-125c-4046-b1c0-677322b0f3a3
TTGAGCGCGCTGACCAGTTGCATATTGCTTTTCTGTTTGGTGCTGATATTGCGGCGTCTGGCAGGTGTTGTAGCCTGGGGGCGCTGCCGCCGGATATCCGGTTAAGCGCATCTTTACCTGGCGACCAGCAGCGCACAGGGGCCGTGTTGCCACGGATACTGGGGTGGTCTGAGCGGAGGTGTGCCGGGTCACGAGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCGGACGCTGACGTACCGGCGTGGGCGCCAGTGACCACAAGCCGGGGAAATCACCGGCGTGACGGACAGTGCCGGGCAGGAGTTCCGTCAATTGCCGAGCCACACCGGGCGCGTGATGCAGAAGGGCCGCACCTCTTCGCTATCTTCTTCTGACGGTTTACGCCCTCTCAGCCCTCAAGCGTTTCCCCGACACACCGGTGCCGATACGGCCCCGGCAGGTAATCGCCTTCTGGCGGTGTAAGCTACGGCCGGCATACCCGGAAGCCACCCGCTGCCCACTGGTGCGGTACCCGCGGG
>c0789440-f511-4522-8231-d4d179a7a487
TTGTTGTACTTCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTAGGTGTTTAACCTATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAAGTACGCTCAACGCCCGTTGTACCAGGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAGAGACAGCGCCAGCGCACCATTAACACCAGTAAAACGTGGCGATCAGTAGAACCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAGCAGTAATAAAGCACCAACCAATACGCCGGTTATCACGCCTGCACTCTAGTGCACCTCCAGTGGCCTAAAAGTATTCCGGAAGGGTAGAATTCTGGCTGCAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAAAGTATAAAATGGCAACCATGGTTAACTAATGTTGAGTATTAATTTAACTTTTATTAGCAATTACAGGATGAATGTAAATAAACCATCCAATAAAGCAAAATAAGTGGTCGGATGGTAGTAAAATTACACAAAGGCGGTGTACTATTTTCATCAAGATAAACAAATTCATTTTCGGTGCCATTCACCGGGTAGATACAAAGGGGGAGAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTACGCCTTAGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACCTTCTACCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGTAGAAAAGACAGCTGGTGATTTTTGACTGATTGCTGAGTTTGAAGATACATTGAAATACGCCAGCGAAACGCTGGCGGTTTTATATCAAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATGCAATCGAAACTATATATTCTGAAATATATATAAATATTTTCCTAATTGTTCTTATCGATAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCGAATAAATAACCCGATAAAACAAGGATAGGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGTATCATTGTCCAGAGTTCAGCCGGGGTACGCATCAGTGCCCCCACCGGCGTATTGGCCTGTTGGGGTAATGCCCGGCAGGGTGACGTCCAGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCAGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCGTTCATTCTCTCCCGCACCTACAGCGGTTACCGGACAAAAACGCCCGCGCCGGTGAATTATCAGCCCGGCTGAAAATGCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTAACGGCAGCAGAAGCCTGTATTTTGAGCACCCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGCATGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGGTCACCGGCTGGCCGCCTCTGGCAAACGCTAACCGGAAGAAATCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCAGGTGCCGGAAGCGGATGAGTGCTGCCTGCCACCGCTGCCGCCGTACCGATTGACCGGGCTGGTGGACCGCTTCAGGCGCACACAGACGTTCCACCGCAACGAAGCCGCCGGTGATTGGCAATCACCGGCGTGACGGATGGTGCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCGAAGAAAGCCCGGCAGCAGGCCATTTCCGGCAGGACGGAACAAATCCGCTTTTCCTGTTCACCCTGCTGGGTTACACCGAATATGGCCAGGACAGCGGCATCCATCTGTCTGCCATGTGGCTGACACGACCCAGAATACCCGGAGAATTTTACCTGCCGCGCCGCTGGGTACGCTATGGCCTGAACGCCCGCGGCGAACTGGCGGCGGTGTGAAGCCGCAGCAATACACAGGTGCGCAGCTTTTACTTACGATGGTAAATGCCGGGGCGGATGGTGGCGCACCAATCACAGATGACCGAAATCTAAATTGCCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCAGCAGGCTTAATTTACGTATCAGTGAAGGACCATCATATCACCGACAGCTGGGCCATGGTCCTGCACACGCAGGTGAAGGCGGGCTGAAACAGGTGGTGAAAGAACTACGCGGACGGCAGCGTCACGCAGGAATCAGTTTGACACGGTGGGCAGGCTCAGGCTGAACTGGATGCCGCAGGCAGGACAACAGAGCCACAGTCCGGATGTGGTGGCCGGGCTCATGCGCGCATCACCCGCCGGATGGCAGGGCATCCGGCGTTTACTGCATAACCACACAGCCAGTTAACGTCAGCCACCGGGCCTGAAGCTGAACAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCACAGTGACTTCCCTGCGCAACGGAAGATGCCGGCGGCGGAAAATACGACGTGGAGCCGTTACGGTCGGTTGCTGAGCTTCACTGACTGTTCGGTTATGTATTACGCTATGACCATGACCGTTTTGGTGGTGACGGCAGTGCACCGCGAAGAACTGTATTACGCGCATGCGACGGCCGTGGACAGTTAATTGCCGTAGAAAGACACGCAGACCGCCAAACGCGAATATGAATACAACGCCGCCGGTGACCTGACCGCAATCATTTACCCCGGACGGCAGCAGAAACAGGACCTGATACGATGCGTGGGAAAAATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCTGACCAGTGAAAACGGCAGCCACACCACCTTTGTTACGAATAGCACTCGACCGGCTGATACGGAAACCGGCTTTGACGGCGCACGGCGTTATCACCACGACTTACAGCCGTAAACTCCGCAGCGAGGATGGTTAAACACCAGCAGACGCCCGCAATATCGGCA
>7caaf6c8-af5c-484f-ad5f-981112218eb0
CTGTTATGCTTCGTTCCGGTTACGTATTGCTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTAGGTGTTTAACCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCATCGCGTCTGGTCGAAAACCAGCGATAAGCCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATGATTTTTATTGATTGCTGAGTTTGAATACGGTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTAATATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAGAAATCGAAACATATATGAAATATATATAAATATTTTCTAATTGTTCTTATCGACAGATATCTCACTTAAGGCTTTCTTATAAATGGGTTTCGCCTGTCCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAAACCGGCAACGCGTCAGGCGACATGACGCAGTATGGCGGTAACGTTAATCCAGGAGTTCAGCCGGGGTACGCATCGGTGCCCCCACCGGCGGCGTGGCCTGTTCGGTGTGCCCCGGCGAGTGTGACGTCCAGCCATCCGGTCAATCCGCTGCTCGGTGCAAGGTCCTTCCCATTGAAACCGACATCGCCCTGCCGGCCGCGCGTTCATTCTCTCCCGCACCTACAGCAGTTGCGGACAAAAACGCCCGCGCCGGTGGGAGCCTCGGCCCCGGCAGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACGCACTGATACTCAGTGATAACGGCGGCAAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGAAAACTGGATGAAGGTCACCGGCTGGCCGCCTCTGGCAGGCGCTGCCGGAAGAACTCCCTTAAGTCCGCATCGTTATCTGGCGTCACAAACAGTCCACAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGAGTGCCGGAAGCGGATGAGGTGCTGCTGCGCCGCTGCCGCCGTACCGAATTACTGACCGGGCTGGTGGACCGCTTCAGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTAGATTCAGCGGCGAAATCACCAGCGTGACCGGATGGTGCCAGGCGTCACTTCCGGCTGGTACTGACCACGCGAGCGCAGCGGGCAGAAAAGAAGCCCGGCAACAGGCCATTTCCAGCAGGACGGAACCGTCCGCTTTCTGATACCTGCCGGGTTACACCGAATATGGCCAGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACACGACCGGAATACCCGGAGGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCAGCTTTACTTACGATGATAAATGCCGGGGCCGGATGGTGACGCACCGTCCGCACGGGCCGACCGGAAATCTGTTACCGTTACGACCTTGGCGACGGGCGGGTGACGAACAGCTAAACCCGGCGGGCTTAAGTTACGTATCAGTATGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGAGTGAAGGCAGGCTGAAGCGGAGTGGTGAAAAAGGAACTACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCGGGACAACAGAATACCAGTCCGGATGTGGTGACGGGCCTCATCGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGAAGATGGAAATACGCCAGGAATATGATGAATGGGGCCGTCTGATTCGAAACTGCTGACGGCGATATCACCCGCTACCACCGTTATGATAATCCGCACAGTGACTTACCCTGCCAACGGAAGATGCACCGGCGGCGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATATGACCATGACCGTTTTGGTCGAGTGACGGCAGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCATGCGACAGCCGTGGACAGTTAATTGCCGTAGAGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCGGCAAACGGGACTGCAGTACGTGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATCTGATGCTGCCGGACAGATGCATCCGCTGACCAGTGAAACGGCAGCCACCACCTTCCGTTACGGTACTCGACCGTGATACGAAACCGGCACGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACATCCGCAGCGGGATGAGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCATGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCAGAAAGGGCACCGGGTGACGGTGCACTATGGATATGACAGTAAGAGCCGCCTCGCCGAAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACGGGGACTGGCAGACCGCTGTATACCGGACAACCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGGGCATGAAACTCGGCGACACACCGCTGGTGAGTGATACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTTCGGCCATTATGAACTCACCACCGCTTATACCCCTGCCGGGCGGTTACGAACCAGCACCTGAACAGCCTGCGTCTGACCGCGATTACCTGGAACGACAACGGCGAATAAATCGCATCAGCAGCCGCCAGACCCGGAGTTACAGCTACAGCACCACCAGCGGGCTGATAAGCGTTCCACACCACCGCAGCGAATCTGGATATCACATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCGCCCTCAGCATAGCGGATAACCGTATCGCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGTGACAGAAAACCGACCTCATCCCGGAAGGGGTTATCCGCACAGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCCTTTCTGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGATACCAGGGTGGCAAAACAGGTATGGCGGCGTGAACGGGACCTGACGAACGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGATGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCGGGGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATGCCATCTAACAGTCAGTGGCGAAGACGTTGGCGGTGTGGTGTTCCCGCCGGTGCGGTGCAGATGTCGACCGGCGGAAAGTGAAATCCTGGCTGACCGGGTGAGTAGAGCTTCCGCCGCTGGCTGGCATCGATGCGGCCTGACGGTGGCGCAATTAAAGCCAGATGGACCCGGTATACCACGCCGACTTGAAAATTCACTGTACCACTGCATTCGCGCGGCCTGCCGCTGGCCCATATCAGCACGGAAGGGACAACAGCGTGGTACGCAGGAATACGATGAATGGGGTAACCTGCTGAATGGAAAGGAGCCGCATCAGCTGCAACATCCGCCTGCCGGGGGCAGCAGTATGATGAGGAGTCCGGCCTGGCCAGCCACCACCGCTGTATGACCCGCTGCGGGGGCGATATATCCTCAAGGATCCATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCATTGAATCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCGCATTAAGCACCATTCAATGGGCGGAACTGGTGAAAAGCGGTCCAGTATGTGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCAAGACCAACGGGAGAATCAAAGGGAATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAACTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGGAAGTTTAAAGTGAAAGCCGCGTTATTCTGTATTGCCTGATATATTCACCTATAAATTTAGGGCCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGAGTGATGTAATGAAATATATTATTTTTATTCAGGGGCTATATGGCTGGCTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTTCACTATTGGGCTCCCTCGTGATGTGAGCGAGTTAATTAGTCATCTATGGAATGATGGTAATATGTTTTCCAACAGGCATAAATATTCTTTGTGCTCCTAATATTTATGAGGACTGTATCAGACATTATTGGCGTAAGTTGATGGTAAGTATATTATGGCGATAATAATGGCTTTATTTTCTGTCGGGTATATTCAATGGTTTGTATTAAGTAAGCGCATTATAAACAAATAAATTAAAGTTAATTGCTCTTATTGTGCCTGTCGCAACCTGGGCATTGATATCCCGTATGCCTGAACCCGGCAGATAACCGCCTGCCCGACCGGAACTGCCGGACAGCACCCTCGGCATGACCCGATTAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGAGCGGAGATAACCGACCTCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCACGGTACCGCTACGACAGTCAGCACCGGCTGGTGCACTACCGCAGGGCCTTTAATATGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGGCCGCAGGTGGCAAAACGAAGATTGTGGCGACGTGAACGGGACCTGACGAGGCTGGATGTCGCTGTCACGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGGCGAACCCGCATCAGACGGTTATCGGCCGAGGCTTCACGCCCTCATCAGGGTTGAAACCGCCACCGGTGAGCTATGGCGAAAACACAGCGCCATGACCTGGCGGATACCCTTCAACAGTCCAGCGGCAGACGGTGACAGTGTAAAGTGTTCCCGCCGGTACTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTAGTGAGAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGAGCAGATGCAAAACCAGATGGACCCGGTGTACACGCCGGCGCGAAAAATCCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCGCTTGTCAGCACAGAAGGGGCAACAGAATGGTGCTGGAAATACGATGAATGGGAACAACCTGCTGAATGAAGAACCCGCATCAGCTGCAGCAGCTTATCCCGCCTGCCGGGGCAGCTGGTATGATGAGTCCGGCCTGTATTACAACCGCCACCCGCTATTATGACCCGCTGCAGGAGGTATATCACTCCAGGATCGATTGGGCGAAGGGGATGGAATTTTTATCAGTATCCGCTGAATCGGTTCCGTATATGCAGATTCAATGGGACTGGCATCAAAATATGGACGCCAAATAATAGGCGAGATGGGCGAGACCCAACAAACCGCCGCCCGATCCAAGTAGAATTGCCGGACGCAGCGAAACAATTAAGACTGCCATATCCTATTGACCAGGCCAGTAGTGCGCCTAATGTTTCAAAGAAAGAAACGTTCTTCCAGAGCATTAAGCCCACTTGACTACACACTGTATTGCAGGAAGTGGGTAAAACCAAATCTGACTTGTACGCCACAGGATGATTCCCTGATATCCAGGGATGGATACAAAGACAGCAAAAGAAGTGATTACACTGCCACAGACAAATTGGCCCAACAAACTCAATTACCACCAGGATATGCGTACAGAACCCTACTTATTCCAGACATTTAATAAACCCGATGGGCTGGCAACGGGGATAAGATGATTTGGGTGAAATTTTAGTAAGATGGAAGCAGAACATCGAGAGGAATAAAGAAAATGAAAAGAAATTTTGTTCTTTTTGCTGATGATATTTGTAGTTTTGGTAATTGCATATTGATTGCGAGAATACAAGCTAAAGATCATACGTTGTTTTACTATTTTCCTTCGGGTACTATTTTTCCGCGTTCCTGTCTTAAATAATAAAGCCATGTGGAGATGGTATCAGAATGAGGACATCGGTGAGTATTGATAGCGAAACAGAACTGGGTACATGTAAAATATTAAAATTCACACCAAGCGGGGCGAGACTCTTAATTCGCGTCGGGTCACTACCGCCTTAATGAAAAATCATGCCATCAAAGGAACGTTGCAGGAGTTGATAAATACAACCAGAAAAAACGGCGTTTCTCGGCGATCGGTTTTAGGGATTATAAGAGCGGGTATCTATCAAAAGAGCAGTAGTCAAGTTCAGTTGTTGCAGCAGTCCTTGATAATTCAATCATGGTAAAATATTTAAAGATGAGAAACCAACCCTTCTCGAATGACAGCATCTCCCGAACAAAATATGAGTCTTACGAATGTTTAATAAAGATACAGCATGAACTAATTCGTAGTGAAGAGAAATAAATCTCTTCCTGAAAACAAATTAATCATTGTGAAAATTGTAACTCATGGAATAGAGGTGTTTGTTTTGCGTTCCATTTGCAGGAAAGATCACGTAACGCTACTTTTTGTACTAAATAATTCAATTTTAAAGTTCAACAATTGAGATACTTGTTGTCTAAAGCTGTTTTCCTTAAACATACGCTGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTCACAATTACACCCGATTACAGACAAGCCTGGAAAGTGGTGCATAAATTGTCAGATATTCTACTGTTGACTATTTGTGCCATTGGCTATAGTGCAGAAGGTTGGGAAGATATAAGAGGATTTCGAAACACATCTCGATTTTTTTGAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACCATTGCCAGAGTTGTATCAGGGAAAAGATCACGTAACGCTACTTTTTGTACTAAATAATTCGCATTTTATGTTTTAAAAATTGATATTCCTTATTACCTAAAGCTGTTTTCATAAGCATACATGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTCTATTATTCCCGGTCTAGATAAGCCTGGAAAGTAGAGCATAAATTGTCCAGGCATCCTACTATTGACTATTTTGCCGTTATTTCTAATTACCCAGTTAAGGAAAGATATAGAGGATTTCGAAACATCTCGTTCTTGAGCAATATGGTGATTTTGAAATGGTATTCCTGTTCACGATACTGTGCCAGGTTGTATCCTGTATCAGTCCTGCAAAATTTCACGAGTGCTTTATTAACTGGATGCGTGATTGCCATTCATCAAATGATAAAAGACGTCATTGCAATTGATGGAAAAAACGCTCCGGCACTCTTATGACAAGAGTCGCCACGGGAGCGGTCATGTCATTAGTGCGTTCTCAACAATGCACAGTCTGGTCATCGGGCAGATCAAGACGGATAAGAAATCAATGAGATCACAGCTATCCTGAACTTCTTAACATGCTGGATATTAAAGGAAAAATCATCACAACTGATGCGATGGGTTGCCAGAAAGATATTGCAGAGAAGATGCAAAAACAGGGAGGTGATTGGTTAAACTTACCAAGCAGACGCGCCGCAATATCAGCACCGCA
>b098b785-7ccd-41af-8980-f2894d700284
TCGCTGGCATCGGTATGCGCTACGTTCCAGTTACGTATTGCTCTGGCGGGTGTTTAATACCAAGCTCAGCGCCTGGGCGACAAGTGTTAGTTCGGGCAGCGCCGGTTGTTTACGACTCATATTCAGTGCTCCTCAATATCAAATGGGAGAGATATTCCGCCACGCCGGACTGACGCCAGGGCAGGGATAAAGGTCAGTTACATAGCCAGCAGCACGTTGCCGATTAACGGGCCAACCGACAACGGGCCGTACGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTTACTCACCAGCGGGCCGGCCAATTGCCATCGCAGGATAATCACTTTGAAGCGACCGGCAAACATGCAGAGCCTTGATAAACAGTTCCAGAACGGAGAGTTTGGCGCTTAATCGGCAAAGCGCTGCCGTTGTTGTTAGCAGCCGGATGACGGCGGCGTTTAGCCGCCCTTTAAAACCATGCGGGCAGGGTTGTAGACATGGCGCTACGTCCGGCGTCAGGTCATCATCGCCAACGCCGCGCCCATCAACACCAGCGTCAGGGTAACCAGAATTGCCAGTACGGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTTGATGCACGACCAATCATCCAGCCCGGCAATAAACACCGCCAGCGGGACAAACAGCATCATGCCGTAGAGACCAGAACCATTGCCGCCGAACACCGCTTCTGGTGCATCAATACATCGGCACCATGCCACCGAGCATTAGAGCAGATCATGCGTAAATCCACCGCGCACAGGAAGCCGCCGTCGTCACGACCGCAAAACAGGCTGCGACCAGCACGCCAGAGCAATGTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGGGGATTACCCTGAACTTCTGCCCATCACCACGCCTACGCAGATTGACAAAATCCTGACATCGCCCACAGCAACATGCGCCCTGGCGGCGATCGCCCATCACTTCACCAAGGTAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACAGAAGTTGGTCAGTGCGGTTGGTTTTCAAACGGATCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAAGCTACAGGCCCCATGGTGGCAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGAAGGTTGTACCCAAACGGGCATACCAATATCGCGCG
>cc70a582-d0ee-47f5-890d-9d097df3619a
CTGTTGCCCCGTTTCCAGTTGTGTTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTTTAACCTCGGATATCCGCAGGCATTTTCCAGCCAGGGCCAGAAGCTCCCCACCAGCGCAGGCGTTTTGTCAATAACTGCTGTAGGTGCAGGAGAGAATGAACGGCAACGGGCCGGGCAGGGCGATATCAGTTTCACCGGGAAAGGACCTTTGCACCGAGCAGCCCAGTTGACCAGACGGTGATCACCCGCCAGGGCACCGAACAGGCCACGCCGGTAGAGGCACCGGTACGTACCCCAGCTGAACCCTGGACAATGCTACCACCGCCATACTGCGTCATGTCGCCTGACGCGCCGCCCGGTTTCGCTCATCTATACTCATCCCTTGTTTTTATCCGGGTTGTTGTCTGCTGACCAGGCGAAACCCTACAGATTTATAAGAAGCCTTCGTGAGATATCTGTCCAAAGATAAGAACAATTAGGAAAAGAAATATTTATATATATATTTCATGAATATATCGATGTTTCGATTGGTATAACGATGTCGTATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCGCTGGCGGTTTTCTAATATTCAAGCTCAGCAATCAATAAAAATCACCAGTTGCCTTTTCAGGCCTGATCCATCCACCGGTTTATCGCTGGTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAAGACGCCCGCTGCAACCGCATGAAATTACGGCGGCAGATAAAGCCATGCGGATATTCTCTGTAGGTTCCCACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCGCCGGAAAAATGAATTGTTTATCTGATGAAAATAGTACCGCCTTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTTATCTACAATCATCCGTAATTAAGTTACACAAAGTTAAATTAATACTAAACGTGGATTCATCATGGCTTTTGCCATTTTATGCACACCCGCCCACCAGATTTTTGCGAAATCTTTACGTAGAATTCTACCCTTCGGTATCACTTTTAGGCCACTGGAGTGCACTGTGAGTGCAGGCGTGATAAACCGGCGTATTGCTGAGAATATTTTATTACTGGGTTATCTGGTTTATGCCTGATCAATGCAGGTGGCGTTCTGATGGCTGCGCAAAGGGTTCTTACTGATCGCCACGTTTTACTGAATTGTTAATGGTGCTGGCGCGTCCTTTAAGGGCAGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCTGCGTGCTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTTCGGAAGCTTATCTTTGTGCCATTCTCTGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCCAGCACTATCTGCCGCTTAATCCCACAGCAGCAGTTGCCAAGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTGTCACCAATACCAGCTGGCAATCTTATAGCGGGTGGGGAAACCACGTTGAGCTTCTTTCAGCCAGATGGCGGGCTTAACAGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGGGAGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCAGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCACCAATGGCGTTGTTGATTACTGTTTTTATTCAACAAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGCCACCCGTGGGGCCTGTGGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCGATGCCAGCGTCTTCTTGATCCCAACGGCGCTGTGCTGCCTTTAATTTAGAAGTGATGGGCGACCGCCGCCAGGGCATGTTGCTGTGGGCGATGTCAGTGATTTTTGTCATCTGCGTAAGCGTGTTGATGTGGGCAGAAGTTCAGGGGTAATCCTCAATCTGCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCCAGTAAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTACGATGCATGATTCGTTTACACCGCTCTCGGTATGGTGCCGAATGTGGCTGATGCAAATTGGTGAAGTGGTGAATTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGATTTTAATGCCAGGCGGCTGAAGTAGTTAAGGTCCGTACCACCAGAATGTCTGGGTAAAAAATCGAGCCCGTACGCGAGATGCAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGTGCTGATGGAAGCGCAAGCGCTAGCGTGATGACCGACGCCGGACCCGAAATCAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTATCATCCGCCGCTAACAACAACGGCAAGGTTAAACGCAGAAGCAGACGCCGTATCAGCACCAACAGAAGCAATACGTAACG
>eaa48d4e-1945-4011-8bae-ded748af1fca
TTGTTATGCTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGTATCTTCGGCGTCTGCTTGGGAACTGTTTAACCTAGTCGGTCGCCAAGCGTTTCCCAGCGCCACCAACTGGCGGCGAACCGGGCGACCGAGAATAATCACCGAGGTGTATTCCGGGCATAACGCACTACACTTTTCTCTTCACTGGGATCAGAAAGTGTTGCCGTCTCGCGCCCAGTTCCTGCGCAAGACGCTAAGGCGCTGAGAATTACTTCGTTTTTCCGGTGGCGGTACAGGGCAGGGTTTAAGCATACACGTTGCAGGGCCTTTACCCAGCCGTGACGCAAACCGCGCCGCTGCGCGGACCAGTTTTTCATACCGGTGTTATAAGCGATGCATAAAGGGATCGCGTCGCGCGCGTGTACCACACTTTCTCTTCGCCAGGATGCCCCGCCAGTACGCATTTGCTCACCAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCAGCGCAGGGCGATCAGATTACCTTTGGAAAAAAATGTTCAATGGCGCGCGCTCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTCGGCGCTGGCGCCGTCCATTCAGGCCGATCCGCCGGCACCACGTCGTCGGCGGCATCGAAAAAGGATCGGGCGGTTTTACGTACCTGAATTCCAGTGACGCCGCTGGGCCATCGTTAGACTCCAGATGCTGGAGCAGTTGACGGTAGTGAAAACATCAATGCCAGCTTCCAGCAGTTCTTCGATATCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCCCATTAAGATCAGCGCCGGAGCGGCGGCGAGGACGGCATCGAGATCAAACTCGCTGATATACGCCACGTTACGCCCAGCGTTTTAACGATAAGAACAGCCAACCCTTCCAGCATGGCGGCGGTATCTTTTTCGCCCGTGGTTTCTACCGCCAACCACAATATCCAGCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCCAGGTCTTCCCGGCATACACCCACTTTTGTTTCAAGCTTTCAGCTTCCCCGATGCGGCGCGGCGGTTTGTTCCAGCAGACGAATCGGGGTCGGGACGTAAGGGTTCGTTATTCATCAGGTTGTCGCGCCGAATTGGGTTCAACAATGGCTGACCAACCGGCTGGCCGATATATTCCTGGCGGTTGTTGGCTGTATTTTGCGATCAGTTGCGTGAGCTGTTCAACTTCCGCTGAAGTTACGCGCTTTCACCACGCGTGGGATTTATAAGGCCGCCGCGCGGTGATATTATTCAGCCGCTTACTGCCGTGCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGTACGGCTATTAGTTATCCAGCTCAGGATTTCGCCGCCAGATTGCTCCCGCCAAGCCTGTGGATTGCCGGGGCGTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGTAAATTCTGCAATTAATGCCGGAACACGCACCGTATCGCCTTCACGAATCAACGAACCATTGGCCTGGAAACCACCATTGCCCCAGTACGGTGGTCAGCAGCGAAATTAAGCGCGCCAGTAATCAAATAACAGAAGAAAGATAAATGTTGATAATACCGGACGTAATCCACTCATGGTGAAACCACTCACACCAGACCGCAAACGGTCAGCGGTAAAATCAATGACTTTGTTACCAAATAAACGGCACCAACGGCCCCACCCAGACCGTAAATCCGCCAGTTACGGCGCAACGCCAGCGAAGCGGTAAGCGGTTTCCTGCTTCCACGCCTTTTAACGCCAGAGAATCAAAGACGATATCCAAGGCGATTGAAAATCTACCGCTGAGGATTGCGGAGTCGGGCGGAATGCAGGCACGATGTTCAGCGCATTTAACTGCCGGATACGTTGCCGCGATGCCGCCGGAATAATGGCGAAGTATTTCCATACATCGTTGGCAATGCTGAAGGTCAGCGAGCCGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAGCTTGGTCCGGGTTAAGAGTCGAGATCGACCATAACGCCCTTACTCTTTCGCCGCCTGGGTGCGCCAGGTTCATCGCCACCGCGACATCTGCTACGCCAGCTGGGTATCGATTGGGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTGATACTTGACGGATCGAAATTGCCAGCGGCCTCCGGTGTCGCTTCGGCGAGAAAGTCATCGACACCGCTTCCGCAGCAATGCGCAGCGGCAGTCGAACGGTTATCGCCGGTAATCATCACTGTTTTAATGCCATTTTGCGCAGCTGGGCAGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCCAGCGCAATAACGCCCAGCACGAGAACCTTCCACCACCACCAGCGAAAGTAAAACCACGACCGCGCAACCTGATCGACTTTTTTGATCAACATCGGTAGGGAAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGATTTGTCGATGTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTTACAAAGTGGCATGGAGCGACGCTGCACATCGCGCTCGCGCCTGGGTTAAACCTTTGTAGCGAGGATCACAATACAAAGCCTTCGGCGTTTCATCAGCCAGCAGAAGCCGGTTAGTACGGCGTCAATAACGTTTTCATCCACGCCTGCGCGTGATAAACTCCGACGCCTGACGGTTACCGGGTGTGATGGGCGCGGTTTATCCAGTGGCAGGGCAGTCAGCAAATCACCTGCCTTCAACTGCACGTCGCTGGTGGCAAATCCGCATTCGCCCTGGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAATGACCGCTTCAATGAGTGGTTCGGGATCAGACAGACCAGCGCCACCGAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGGCCACAACGTGGCGGTTGCCAGTAAAAGACGATGATCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAGGAAATGTCTCGCTTGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAGAATGCGCGTACCGCCGGTGACGAGCAAAATCGCCAGATTCACGGATCCACCAGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATACCCCCTTCAATAACTTCACCATCGCGGGGATAATATCGCCAGCTTCTACCAGTACGATATCCTTGCCCACGAAGTTGGTCAGCAGGAACTTTGTCGCCGCAGCGCCATATTTCAAAGCACGCAGCTGCGGGCAAAGGCAGTTTTTCACCCCCTTTCAGACTGTTGGCCTGCGCTTTGCCTGCGGCCTTCTGCCAGCCTTATCGGCGAAATTAGCGAACAGTGCACGGTGATCACAGCCAACCGCTGTGGCCGCGCTAAACAGCATTGCCGGGCATCGCGCCACCGCTTGCCATCGCGATGATGCTAATACAGGTGATCAGCCAGACTGCCCGATCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTCAGCGCCTGAACGATAAAGTGTTGGTTCGAATAAGCGCCAGTTGTTTACGGCTTCATATTCAGTGCTCACTCAATATCATCAGGAGATGTTCCGCCACCAGGACTGAAGCGCCAGGGCAGGATAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACGGCGGGCCGTGCGTTGGCAGCGATGCCGGAGCTGGCGGCGGCTTGCTCTCACCAGCGGACCGGCAATTTACTTATCACCGGGATAATCACTTGAAGCGACCGACAAACATGCAGAACGCCGGTAAACGGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAGGCGCTGCCGTTGTTGTGCTTATTGATGACACGGCGTACAGCACTTCGCCAAAACCATGCGGGCCAGGGTTGAGCAGCGCTACGTCCGGCGTCGGTCATCATCTGTAACGCCGCGCCCATCAACTTCCAGCGTCAGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCCCGATTTTTTGCAGATATTCCGGTGTACGACCAATCATCAACGACGAAATAAATTTACCGCCAACCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCCGGCACCATGCCACCAGGCGGTAAAGCAGATCATGCATCGCAATCACCGCACCACAGAGGAAACGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACCAAAACGGCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCGCTGACATCGCCCACAGCAACATGCGCCCCTGGCGCCGATCATATCCACTTCACCCAAAGGCAAAGCAGCGCCGTTGGGATCAAAGAAGATCGCCAGCATCTGCAGAAATTGGTCAGTGCCGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAAGCCACCGCCGTTGTACCGAACATCTGATCGCTTCCTGAGAAGCTACAGGCCCCCATGGGTAACAGCTGTTGCGCTCCTTCAGCAGTATTCACAGCCTGATGGGCAGAAAGTTTTGCAGCGCACACCTTGTTGAATAAAAAACGGTGCAATCAACAACGCCGCAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCAGGCGATGCTCATGCTCTGGCGGGTAAACGCACGGATGAGAGGCAAAATCACCGCAATCCGCTGGCGGCAGAAAGAAGGTTTGCACCGTTAAGCCCGCTTCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTAAGATTGCAGTTGGTAGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCACAACTGACTGCTGTGGATTAAGCGGCGAATGGTGCTGACCGAGCAACATAAAACAGCACCGCCAGCTAGCATGTTCAGGCCGAGAATGGCACAAAGTGTTAGCTTCCAGTTCATCTCACGGTCAAGAGCGCCAAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAACCGCGCCAGCCCGCTGCCTAAAAGGACGCGCCAGCACCATTAACACCAGTAAAACGGCGTCGGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCACGGTAGTCAGGGCATAAACCAGATAACCCGGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCGCTCACAGTGCACCTCTAAATTCAAATCTGCGGGCGGGGTGTAAAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTGAAATATGATTTAACTTTGTGTAGCAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTCGGTGCCATTCACCGGGTAGATACAAAAAGGGGGAAAAGTATGGAACTCTACAGAATATCCTGCATGGCTTATCTTTTACGCCGTACTTATGCGGTTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTACTGGAAAGACCGCGCCCGCTTTGCAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGGCAGATGGATCAGGCCGAAAAGGCAACTGGTGAATTTTTATTGATTGCTGATTTTGAATACATTGAAAGCCGCCAGCAAAACGCTGGCGGTTTTCTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGATATGTATAAATATTTTCCTAATTGTTCTTATCTGACGGTCATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCACCGCCTGTCAGCAGACAAACTAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCGGGGCGACATGACGCAGTATGGCGGTAACGTACCAGTTCCAGCCGGGGTACGCATCGGTACTTTACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGAGTGTTGACGTCCGGCCATCGGTCAATCCGCTATGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTACGGCCCGCTGCCATTTCATTCTCTCCGCACCTACAGCGGTTACCGGACCAAAAACGCCCGCGCCGGTGGGAGCCTCGGCCCCGGCTGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACTGATACTCGAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACTGTTTCCCGGTGAGGACAGTTGCAACCGCGGCGAGTCCACTGTGGCTGGTGCGCGGCAGCGTGGCGAGCGGATGAAGGTCACCCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCACGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGTTGTGAGCAGGTGCCGGAAGCGGATGGTGCTGCCTGCGCCGCTGCCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCAGGCGCACACAGACGTTCCACCGCGAAGCCGCCAATTGAATTCAGCGAATCACCGGCATGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCACCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCGGCAGGACGGAACCGTCCACTTTCCTGATACCCTGCCGGTTACACCGAATATGGCCGGGACAACGGCATCCCGTCTGTCTGCCGTATTGGCTGACGCACGACCGGAATACCGGAGAATTTACCTGCCGCGCCGCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACGCAGCAATACACAGGTACGCAGCTTTACTTACGATGATAAATACGGGGCCGGATGGTGGCGCACCGTCACGGGCCGACCAATCTGTTACCATTACGGCAGCGACGGGCGGGTGACAGAACAAGCTAAACCCGGCAGGCTTAAGTTACGTATCGGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCATCACGCAGAGTCAGTTTGTTGACGCGGTGGGCAGGCTCAGGAGGCACAGACGGATGCCGCAGGCAGGACCAACAGAATACAGTCCGGATGTGAGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCTTCAGTTAACGTCAGCCACCACCGGGCCTGACGGGCTGGAAATACGCCAGGAATATGATGAATGGGGCCGTCTGGTTCAGGGAAACTGCCCCTGACGGCGATATCGCCGCTACCGTTATGATAATCACACAGTGACTACCCTGCGCAACGGAAGATGCCACCGGCAACGAAAACCATGACGATGGAGCCGTTACGGTCGTTGCTGAGCTTCATACGGCTGTTCCGGGTTATCATGACCCGCTATGACCATGACCGTTTTGGTCAGGCAGTTACCACGAGGAAGGGCTGAATTAATTACCGCGTAGCCGTGGACGGATTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCATGATGACCTGACCACCGTCATTGCCCCGGACGGCTTGGCAAAACGGGACACAGTACGTGCGTGGGGAAAAACCGTATACCCGCAAGGGCGGTCTGACGCGCAGTATGGAATACGATGATGCTGCCGGACGGTCCATCCGCCTGACCAGTGAAAACGGCAGCCACACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCACGGCGGCCGCACACAGCGATTATCCGCCCACGACCTGACCGGCAAACTTATCGCAGCGAGGATGAGGGGCTGGTCACCACTAACACTATGACGAAGCAGACCGCCTCACGCACCGCACACGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAAGACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAAGGCACCGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGGAAACACCTGACGGGTGCATCATCCCGCAGACGAATGGAACTGCTTAAGCGGCGCTGAGACCGAACTGTGCGTACAACGCAGGGACTGGCGAACCGCTGTATACGGACAACCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTAGAAACATCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACGCGACCGCCTGCAGGAAACTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCCTGCCGGGCGGGTTACAGAGTAGCACCTGAACGGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCCGCATCAGCGGCCGCGCCAGACCGGAGTTACAGCTTCACAGCACCACACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCATCCCGTATACCACAGACCCGGCAAGATGCCCTGCCGAAGCCAGAACTGCGCCCGGACAGCGCCCTCCATGTGGCCGGATAACCACCGTATCACCCGTGACGCGCACTATCTTTACCGGTATGATACCGTCACGGCGGGCTGACAGAAAACCGACCCTCATCCGGAAGGGTTATCCGCACGGATGTTGGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTACGCCACAGACACAATATGCAGAGCCGCTGGTCGAAGTCGCTATCTTTACGACCGCTGGGCCGCAGGGTAGCAAAACGAACATCGGCGGCGTAGACGGGACCTGACGGGCTGGATAATGCTGTCACGGAAACCGCAAAGTGACCTGGTACGGCTGGGACGGCGACGCCTGACCTGATACAGAACGACGGACCCGCATCAGACGATTTATCAGCCGGGGGAGCTTCACGCCACTCATCAGGGTTTGAAGCCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAACCTGGCGGATACCTTCCAGCAGTCCGGTGGTGAAGGCGGTGGCGGTATGTCGGTGTTCCCGCCGGTGCTGGTACCAGATGTCGCTCGACCGGCTGGAAGGAACGAAATCCTGGCTGACCAGATTGAGTGAGGGAAAGCCGCCGCTGGCTGGCATCGATGCGACTGACGGTGGCGCAGATGCAAAACCAGATGGACCGGTATACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCGCCGCGGCCTGCCGCACAAAGCCATATCAACTGGAAGGGACAACAACAGCGTGGTACGCAGAATACGATGAATGGGGTATTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTATCCGCCTGCCGGGGCAGCAATTATGATGAGGAGTCCGGCATATTACCAGCCGCCACCGCTATTATAGGCCACTGCAGGGGGCGATATATCACTCAGGATCCGATTGGGCTGAAAGGGGATGGAATTTTTTATCAGTATCGACGAATCCGATCTCAAATATAGATCAATGGGATTAAATTCTAAAATGCATTAAGCCACCATTCCGTGGGCGGAACTGGTGAAAAGCGGTCCAGATATATGGGGGAATCCGTTCTATCGTCAATATCTTTGTGTCCCAGATGGTAAAGGGGACTATACTTGTAGGTGGCCGAAAGACCAACGGAAGGAGATGGTCTATAGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCTAGGTTAAACACCCAAGCAGACGCCGCAATATCAAAAAAGA
>95ff70e7-2b87-42d1-a957-21f9f276595c
TTGGTAGCGCTACGTTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTTAACCTGAGTGCCGGGCGTTTTCCATCAATTGCAATGACGTCTTTATCATTTGATGAATGGCAATCACGCATCCAGTTAATAAAGCACTCGTGAAATTTTGCAGGACTGATACAGGATACAACTCTGGCAATAATTATCGTGAACAGAATACCATTTTCAAAATCACCATATTGCTTCAGAAAATCGAGATGTGTTTCCCCGTCCTCTATATCTTCCCAACTTTCTGCACCAGAAATAACGGCAAAATAGTCAATAGTAGGATGCCTGACAATTTTGTCTCCTACCAGGCTTATCTGTAATCGGGAATAATAGAAATATGTTCCATCAATTTTTTAAGTTCATTTGTTCACCTTATTTATGTAAGGAGTATTTGATCATGTATAAGCTATGAAAAACAGCTTTAGGTAATAAGATATCTCAATTTTTAAACATAAAATGCGAATTATTTAGTACAAAATGGCGTTGCGTGATCTTTCCTGGGATACAACTCTGGCAATGGTATCGTGAACAGGGCCATTTTCAAAATCACCATATTGTACAAAATCGAGATGTGTTTCCCCGAAATCCTCTATATCTTCCAACCCTTCTGCAGAAATAGCAGCACAAATGATCCAACAGTAGAGATATCTGACCGTTTATGCACCGCACAGGCTTGTCTGTAATCAGATTAATAATGAAATATGTTCCATCAATTTTTTAAGTTCCATTTGTTCACCTTATTTATGTAAAGGGTATTTGATCATGTATAAGCTATGAAAAAACAGCTTTAGACAATAGTAATGTCTCAATTGTTGAACTTAAATTCGAATTATTTAGTACAAAAGTAGCGTTACGTGATCTTTCCTGCAAATGGAACGCAAAATAAACACCTATTCCATAGGTTATATAATTTTCACAATGATTAATTTGTTTTTCTCAGGAAGAGATTTTATTTCTCTTCACGAATTAGTTCTTGTATCTTTATTAAACATTCGTAAAGGCTCATTTTTGTTCGGGAGATGTGCTTGTCATTCGAGCATAAGTTGGTTTCTCATCTTTAAAATATTTTACCATGATTGGATTATCAAGGACTGCTTAACAACTGAACTGGATCACTGCTCTTTTGATAGATACCCGCTCTTATACTTCTAAACCGATCGCCGAGAAACGCCGTTTTTCTGCTGTATTTATCAACTCCTGCAACGTTCCTTTGATGGCATATTTCATTAAGGCGTAGTGACCCGACGCAGATTGAGTCTCGCCCCGCTTGGTGTGAATTTAGTATTTTACATGTGCAGTTCTGTTTGCCAATAATACTCACCGATGTCCTCATTCTGATACCATCTCATGGCTTTATTATTTAAGACAGAAACCTTGGAAAAAATAGTACCCATAGCGAAAATAGTAAAACAATCCATGATCTTTAAAGCTTGTATTTCGCAATCAGCTATAACACCAAAACTAACAAATATCATCAGCAAAAAGAACAAAGCTCTTTTTCATTTTCTTATTCCTCTCGATGTTCTCTCTGTTTCATCTTAGCTAAAATTTCACCCAAATCATCTATCCTGCCGTTGCTGGCCCATCGGGTTTATTAATGTCCTGGGGAATAAATAGGGTTCTGCACAAGTATATCCTGGTGAGCCAATTGAGTTGTTGGCCAATTTGTCTGTGGCAGGTATTGCCCTTGCTGTCTTTGTATCCATCCCTGGATACCAGGAATCATCCTGTGGCGTACAAGTCCAGATTTGGTTTTACCCACTTCCTGCAATACAGTGTGTGGTCATGGGGCTTAATGCTCTGAAGAATGTTTTGAAAACATTAGGCGCACTACTGGCCTGGTCAATAGGATGTAAGCGGTCTTAATTGTTTCGCTATGTCCGGCAATTTTACTTGGATCGAAGTAGGCGGTTTGTTTTGAGTCTCGCTCCGCCCATCCGCCATTATTTAAGTGTCCATATTTTGATGCCAGTCCCATTGAATCTATATACTGAACCGGATTCAGCGGATGCTGATAAATTCCATCCCCCTTCAGCCCAATCGGATCTGAGTGATATACCACCTCCCCTGCAGCGGGTCATAATGGCGGTGGCGGTTGCTATTACGGGCCGGACTCCTCGTCATGCTGCTGCCCCGGCGAATGGATAAGCTGCTGCAGCTGATGCGGTTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCCTGCGCACCATTCTGTTGCCCCTTCCGCTGACAAGCGCCAGCGGCTGAGCCGCGATGGTCGCAATTAGTACAGGTGGATTTTTCGCGCCGGCATTGTACACCGGGGTCCATCTGGTTTGCATCTCTCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCAACTTTTCCTCCTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCAGACACCACGCCACCGCCTTCGCCGCCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTCGCCAGCTCACCGGTGGCGGTTTCAACCTGATAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCAGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGTCGCGCCACACCCGTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATATCTTGGCTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAATTACCAGCCGGTGCTGATGTCGTAATGTTACCGGTGGGTGCGCTCATCATCGAATGCGGATAACTGGCGGGATGAGTCGGTTTTCTCCGTCAGCCTGCCCAGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGGGGTGCTGTCAGGTCTGGCTTCCGGGTCGGGCGAGCGGTTACCTGCCGGGTCTGTGGCATACGGGATATCCAATGCCCAGGTTACATATAATAATAAGAGCAATTAACCCAATTTATTTGTTTATAATGCGCTTATAGCCACAAACCACAGATATATACCCTCCTGACGAAGAAATAAAGCCATATTATTATCGCCATAATATACTTCTATCAATCCCTTGCATAATAATGTCTGATGCAGTCCTATAAATATTAGAGCAATAAAGAATACTTGTGCCTGTTGGAAAACGTACCATCATTCCATAAGACATGAGACCTAGTTAACTCATCACATCACGAGTGGAGTCTAATGGTGAAAGTCTATGCATGGAAAAGAATAGTATTAAAAGCGATAAAAGCCAATATAGCTCTGAATAAAAAAATAATATGTTCGTACATCCTCCGGTGAATACAAATCCTAATAAAACGATCCGATGTTATTTCCGGAGCACTTCATCTTACATGTTTCTAAAGAATCCCAAAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAATTTATGGGTGTGAATATATCAGGCAATACAGAATAACGCGGCCTTACCTCTTTTAAACTTCCCTTTTAAACAGTTCTTACACAACTATTATCGGTTTCAACGAGGTCTGGCGGCCAGCAGCTTCTTTTGTATCATTACTTGCTACCTGGCCCCATAGACCATCTCCTTTTAGGTCTCCCCGTTGGTCTTGGCCACCACAGGTATAGTCCCTTTACCATCTGGGACACAAGATATTGATGATAGAACGGATTCCCCATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTAGTGTTTCCTAATCTAATGGATCATATTTGAGATCGGATTCAACGGATACTGATAAAATTCCATCCCCCTTTCAGCCCAATCGGATCCTACCAGGTGATATATCGCCCCTGCAGCGGAGTCATAATAGCGGTGGCGGTTGTGACACAGGCCGGACTCCTCATCATACTGCTGCTGACGAATGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTACCCCATTCATCGTATTCTGCATACCACGCTGTTGTCCCTTCCGGTATGATAAGGGCCGGCGGCAGGCGCGATGGTCACGTGGTACAGGTAAGATTTTCAGCGCCAACGTGTATACCCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCGGGCCGCGTGCCAGCCAGCGGCAGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCGCACCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGAACACCCACACTGCCACCGTCTTCGCCCACCCCGGACTGCTGAAGGGGTATCCGCCGGGCTGCGGCGCTGCGTTTTTCGCCAGCTCACCGGTGAAAGCGGTTTCAACCCTGATGAGTGGCGTGAAGGCTCCCCGGCTGATAAATCCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCCAGCCGTACCAGGTCGCGGTTTCCGTGACAGCGGTATCCAGCCCGTCAGGTCCGTTCACGCCGCCATACCCGTTTGCCACCCTGCGGCCCGGCAGATCGTACCAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTATCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAGCAGCGCTTCCGGGATAAGTCGGTTTCTCTGTCAACCTGCCGTGACGGTCATACCGGTAAAAGATAGTGCGCGTCACGGGCGATACACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGTACAGCTCAGGTCGGAGCAGGCGGGTTACCTGCCGGGTCTGTGGCTTATACGGGATGCGGATATCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTACCGGTAGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCGGGTGCTGGCTCTGTAACTGCCCGGCAGGGGGAGCATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCAGTGCAGGCGGTCAGGTGTACTCCACCAGCGGTGTGTCGCCGAAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGAGCAGGCTGTCCGGCCTCTGGCGGTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCAGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACCGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCGGTGGTGACCAGCCCCTCATCCTCACCGCTGCGGATAAGTTTGCCGGTCGGGTCGTGGTGTTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCAGGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCAATTGGCCGTCCGGCAGCATCGTATTCCATACTGCGTCAGACCGCCCTGCGTGGTACCGAATGGCTTTCCCCGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTCATATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCTTCCTCGCGAGGGTGCACCGCCGTCACCTGACAAAACGGTCATGGTCGCGGGTTATAACCGGAACAGTCAGGTAAAGCTCAGCAGCGGCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCGGTGGGAGTCACTGTGTGGATTATCATAACTTGTTGGCAGGTGATATCGCCGTCAGGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATGTTACGGCGTATTTCCAGCCCGTCCAGGCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATGAAGCAAAACGCCGATGCCTGCCATCCGGCGTGGTGATGCGCGTGATGGGCCGTCACCACATCGGACTGTATTGTTATGTCCTGCCTGCGGCATCCGTCATGCCCTATGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCACTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTACACGGCGGTTCCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACACGTGTAACCGTACCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGATGATTTCCGGTCGGCCCGATGTGACGGTGCGCCACCATCAGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCATGCGGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCGATCAAATTCTCCGAACATTCCGGGTCGTGCGTCAGCCACGGCAGACAGACGGATGCCGTTGTCAGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCCGGCGGCTTCGCGGTGGAACGTCTGTATTGTGCGCCCGAAGCGGTCCACCAACCCGGTCAGTACCGGTACGGCGGCAGCGGCGCAGGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACGCAGCCGAGCAGCCACCCACGGCTACGGACTGTTTGTCGCCAGATAACGATGCGGATAGCGGAGTTCTTCCGGCAGCGCCTGCCAGTGCGGCCAGCCGGTGACCTTCATCCAGTTCGCCACGCCGCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCACCGGGAAACAGGTGCTCAAAATACGGGCTTCTGCCGCCGTTATCACCTGGTATCCGGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCAGCCGGGGCCGAGGCTCCCCCACCGGCGCAGGCGTTTTGTCGGTAACTTCTGCTGTAGGTGCGGAGAGGAATGGTGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGGCACCGAACAGGCCACGCCGGTGCGGGGCACCGATGCGTACCCCGGCAGACCCTGGACAATGCTACCGCCATGCTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTACGATGCCTTTGACGGGCGAGAACCCTGGATTTATAAGAAACTGGCAAATTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCCTTGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAACTATTCAAACTCAGCAATCAATAAAAATCACCAGTTGCCTTTTCGTACGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCTGATGCAGGTAACAAAAGCGAACGCGGTCTTTCCGAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTTTCGCCCGCATAATTACGGCGTAAAAAGATAAGCCATACAGGATATTCTCTGTAGAGTTCATATTTTCTCCCCTTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGGGTGTTTATCTGATGAAAATGGTACCGCCTTTTGTGAATTTTACTACTCATCCGACCACTTATTTTTTGCTTATTGATGGTTTGTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACGTGGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCGCCCGCAGATTTTGCGAAATCTTTGCAGCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCTGATCAATGCGGGCGTTCTGATGGCTGCGCAAGGGTTCTTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTGGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCATGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTATTGCCATTCTCAGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCGGCACTATCTGCCGCCAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCAGCATCGGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAAGGCTATTTCCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCAGGATTGCGGTGATTTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGTCTGCTACGCATCGTTATGGGTGCTGGTCCCACGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACGGCGCTGTGCCCATGGGGCCTGTGGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGAAGCTAGCTAATGCCAACTCGTCGCATCCGTTTGAAAACCAACCGCACTGACCAACTTCATTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCAGGGGCACATCATTGCTTTAATGGGCGATGTCAGTGATTTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAACAGCATCAATATGGAAGGTAAAAGGCCGTTTCAGCGTGCTGGTCAATGCTTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCAGTTCGTTTACCGCTCTCAGTGGCATGTATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGCGGGGTATGGTTCTGGTCTTTGGCATGATGCTGTTTGTCCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACCGGAATATCTGGGTAAAAATCGACGTACGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCGACGCTGGTGCTGATGGAAGGCGCGGCGTTAGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTAGCCCGCATGGTTTTGTGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAATAACGGCAGCGCGCTTTGCCGGATAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCACATGTTTTGTCCGGTCGCTTCAGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGATTGAGTAAAAAGAGCCAAGCCGCCAGCCGGCACGCTGCTGCTGCACGGCCCGCTGTTTTGTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCATGACCTTTATCCCTGCCCTGGCGGTCCGGTGGCGGAATATCTCTCCTGATGATGACAGGTGAGCACTGAATATGAGTCGTAAAACAACTGGCGCTATTCGAAGACCAACACTTGTCGTTCAGGCGCTGAAGAAGCGGTAGAAAAATTAAACCCGCAGGCGCAGTAACAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAACATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCACGCTTTGTTTAGCGCGGCCATTATGGTTGGCTGTGGATCACCGTACTGTTCACGCTAATTTCGCCGAGGCGCTGGCAAGTTAAACACCCAAGCAGACGCCGAAGATAGGTAG
>3ecfda3a-811b-4250-b282-811bffe581d5
TTGTTGTACTTCGTTCAGTTGCGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGGCGGGTGTTTAGCCTTATTTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCGGCAATTAGCTGTCCACGGCTGTCGTATGCGCGGTACTGAGCTCAGCCCTTCCTCGCGGTGCACCGCCGATCACCTGACCAAAACGGTCATGGTCATAGCGGAGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGGCCGTAACGGCTCCACGTCATGGTTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGTGGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCCGGTAAAGCTGACGTTAACTGGCTTCAATGGTGGTTATAGTAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGGGCCTGCCCACCCCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTGGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCAGTTCAGGCTGTCGGTGATGGTGATGCAGTCCTTCTCATACTGATACGTAATAACTTAAGCCTGCCGGGTTTTAGCTGTTCTGTCACCCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTAATGATGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTTGTGTATTGCTGCGGTCATACACCGCTAACCAGTTCGCCATGAGGGCGTCCAGCCATAGCGCACCAGCGGCACGCGGCAGGTAGAAATTCTCCAGGTATTCCGGGTCGTTAGGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCCGGTGCCAACCCGGCGGTATCAGGAAAAGCGGACAGTTCCGTCCCGCCGATAAGCCTGCTGCCGGGCTTCTTCTGCCCACTGCGCCTGCGTAGTCGAAGTACCAGCCGGAAGTGACGCGGCACCATCCAAATCACGCCGGTGGTTTCGCCGCTGAATTCACCGGCGGCGCGGTGGAACGTCTGTGTGCTTGAAGCGGTCACCAACCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCCGTACCGCTCACACCAGCCGAGCAGCCTACGGCCCCTGCGCGGACTGTTTGTCGCCAGACGCGATGCGGACTTAAGCGGGTTCTTCCGGCAGCGCCTGCCAGAGTGCGCGGCCAGCCGGTGACGCTTCATCCAGTTTCTAGCCGCCGCGCGCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGAAACAGGTGCTCAAATACAGGCTTCCTGCCGCCGTTATAAGGTTAAACACCGGCAGACGCCGCAATAATGGCA
>f58173f7-dbfb-4c47-92c1-0124626bf4c2
TTGGTAGCACTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTGAAAAATGATTTGTTTATCTGATGAAAATAGTGCCGCCTTTTGTGTAATTTTACTACTCATCCGACCCTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCACCTTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTGCAGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCCTTTTTAGGCCACTGGAGGTGCACTGTGGTGAGCGTGATAACCGGCGTATTGCTGGTGTTTTATTGCTGGGTTATCTGGTTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAGTGCTGGCGCGTCCTTTGGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTTCGCGCACTTGGCGTCTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTGGCATCACCCTTCCATAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAGCGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTTGCCCTCATCCGTGCGATTTTACCCGCCAGAGCATGAGCACGCTCAGGAATGCCTGGAGTCGATCTGCTACGCATCACGTTATGGGTGTTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCGAACCTTGAATACCGTTGAAGGAGCGCAGCAGCTGTTACCCATGGAACCTGTGGCTTCTCAGGAAACGATCAAGATGTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAGCTCGTCGCATCCGTTTGAAAACCCAACCGCGCGGTAACTTGTTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTACCGCTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCACAATGGGCGATGTCAGTGATTTTGTCTCTGCGTAGGCGCGTGGTGATGTGGGCGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGAATTAAAGAGAGCCGTTTCGGCGTGTGCTGGTCAGTAACCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCACCCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGAGTGGCATGGTGCCGATAATGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGAAGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTGTGCCGGGCTGATGATTGGTCGTACCGGAATATCGGGTAAAAATCCGACGTACGCGAGATGAAACTGACTGCGCTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACTGGCGCCATGCTCAACCCTGGCCCACATGGTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCACCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAGTGCCGGTTCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCGCTGCTGTACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCGGTGTGGAATATCTCTCCTGATGATATTGGTGAGCACTGAATGTAGTCGTAAACAACTGGCGCTATTCCAGGCCAACACTTGTCGTTCGGGCGCTGAAAGAAGCTGATGAAAAAATTAAACCCGCAGGCGCAATGGCGCGATCCGGTGATGTTTATCGTCTGGGATCGGCAGTCTGCTGACCACCTGTATTAGCAGCATCGCGATGGCAAGCGGTGCGATGCCCGACAATGCGCTGTTTTAGCGCGGCCATTAACGGTTGGCTGTGGATCACCATTGCTGTTCGCTAATTTCGCCGAGGCGCTAAGCCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAGGGGTAAAAACTGCGCTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACTCCAACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGTGCATCGGTCGATGAAAGCGCCATCACCGGGGAATCGGCACCGATGATCCGTGATCCGGCGATTTTGCCTCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAGCAAAATTGCCCTGACCATTCCTGCTGATTGCCCTGACTATCGTCTTTTTACTGGCAACCGCCACGCTGGCAGCCGTTTTCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCATGTTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCGGCGATCGGCGTCGCCGGGATGAGCCGGATGCTGAGCGCGAATGTGATTGCCACCAGCGGACGTGCGAAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGTACCATCACACTCGGTAACCCGTCGGGCGTCGAGTTTATCCCCGCGCAGGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGATACGGTATTGTGATCCTCGTAAACGGCGTTTAACCTGCGCGAGCGCGATGTACGATATCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAGCATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCTACCGATGTTGATCAAAAGTCGATCCCGGGTTGCGCGTCAGGAGCCGCCGCTGGTGGTGGTGAGTTCTCGTGTTAGCTGGGCGTTATTGCGCTGAAGATGTCGTCAAGGCGGTATTAAAGAGCGCTTCGCCCAGCTGCAAAATAGGCATTAAAACAGTGATGATTACCGGCGATAACCGTCTGACTTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGCGACACCGGGGCCAAGCTGGCATTGATCCATCCCAGTATCAGGCGGAAGGTCGTTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCGGCGCTGGCGCAGGCGAATGTCGCGGTGGCGATGGGCGCTCCGGCGCGCAGGCGGCGAAGAAGGCGGGCAATATGGTCGATCTCGACTCTAGCCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAGCGTACCAACTTGATGTGGCAGGAAATACTTCGCCGGTATTCCGGCGGCATTCGCGGCAACGCTGTCCGCAGTTAAATGCGCTGAACATCATGTTATTGCTGCATTCGCCCGACTCCCGCAATCCTCGGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTTGACCAGTTCCCCTGGCGTTAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCATGTATGGATTTACGGTCTGGGTGGGCTGCTGGTGCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGTTTACCATGAGTGGATTACGTCCGGCATTATCAGCATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTGCCGCTGCTGACCACCGTACTGGAGCAATGGTGGTTTCCCTGGCAGGCCAATGGTTCGTTGATTCGTAGAAGGTGATACGGTGCGCGGTTCGGCGTAATCGGGCGGAATTTTACCGGCAGCTGTTTTCATGGTCGCCCGTCGGCAACAGCAGAAATACCTATAATCCACAGGCTTCTGGCGGGGAGCAATCTGGCAGTCAGTAACCTGAGCTGGATAAACTAATAGCCGCACGCATTGCTGCATTACGGGCCGCTTCGCCCGGATGCCAGCGTGAGCGTTCAGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGGCAAATCCACGCGTGGCGAAAGCGCGTAATCTCAGCGTTAGACAGCTCACGCAACTGATCATAAATACAGCCAACAACCGCCGGTGAAATATATCGGCCAGCCGGTTTGTCAACATTGTTAGTCAATCTGGCGCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCCGACCCGATCTGCTGGAACAAACCGCCACCGCGCCCGCATCGGGAAGCTGAAAAGTTTCTTCGGTGCCTGTGCAGGCGTCAGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCAAAGGGCTGAATATTGTGGTTGGCGTGGTAGAAACCCACGGGCGAAAGATACCGCCGCCATGGAAGGGCTGGCTGTTCTGCCGTTGAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCACTCGCCAGCGCTGATCTTAATGGGCGAACTGGCGCACAATGTACGCCAGGTTGCATCCCAAACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTCACTACCGTCAACGTTCCCGGCAGCATCTGGAAGATCACGAATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGAGGAAACCGTGCCCGATCCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTAGACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAGCTGGCACTGCGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGCATCCTGGCGAAGAAAGTGTAGCACGCGCGACGCGATCGCTTTATGCATCGGCCATAACACCGGCAGCGAAAACTGGTCCGCGCAGCTTCGCGGCCTGGCGTCGGCTGGGTAGCGTCTGGCACGCGGTGTATGTTGAAAACCCTGCCCTGCACCGCTTACCGGAAAAAACGTCCGGGCAATTCTCAGCGCCTTACGTCTGGCGCAGGAACTGGGCGCGGGGCAGCAGCACTTTCTGATCCAGCGGAAAGCGGTAGTGCGTTATGCCCGTAGACATAATCTCGGCAAGATTATTCTCGGTCGCCCGGCCTCGCGCCGCTGGTGGCGTCGGGAAACGTTTGCTGACCGACTGGCGCGCATCGCCTGATCTCGATCAGGTGCTGGTAAGCGCTTGATGGATCACCACGCCCGCACGTTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAAGTGGCGTGTACTAATTCAGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTTGATGCCGCCAACCTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTTATGAACTGGCCTTCGGTGGTTGCCACCGTCATTAATGTGAAGTGAGTTTCGATCTCTTTTTTATCGCCCACGCGGCACGCTCGCCGTCTCGATGTGCAATATCCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCAGAACCTTACTGCTGGCGTGATTATCAGGCGCGGGTAGCCCGTTACCGCGAGCAACGCACGGCACTTATATGAAATGTCAGCTCTGGCGGTGGGCCCGCAGTCCGCGAGATATCGCTGCCACCAGCGAACAATTTATTGCCTCCACGTTTCATACCCGCAGTCAGGTGTTGTTGCCGATGACAACGGTAAATTGCAGCCGTTAACACATCCGCAAGGAATGAGCGCGTGGGACGGTACCATCGCGCAGTGGGTTTGATAAAGGCCTGCCTGCGGGCGCGAACTTTCGACACGTTACGGTGTGCCATGCAGATTTTGCCGTAAAAGCGGCGGAAAACCACGGGCTGGTGGTGGTGGAGCCGGGAATCTGCGCCAGTTGATGATCGGAACAGCAGCGCCTGCTGGAGACGTTACGCTGTTAGTCGCCAATGCCCATGAGCGGCTGACGCTAACCGCAACGAAAAAGAACAGGCGCGGATGGCAAAGCGAACGTGAACAGATCCCGCAACGCCTGCTAGCGGCGCTTTCGCATAATTTACGCACGCCGCTTACGGTGCTGTTTTGGTCAGGCAGAAATCTTAACGCTCGATCTGGCAAGCGAGGATCACCCCGCCCGCCAGGCCAGCGAGATCCGTCAGCATGTGCTGAACACTACCCGACTGGTGAATAATCTACTGGATATGGCGCGCGAATTCAGTCCGGCGGCTTTAATTTGAAGAAAGTGGTTAACGCTGGAAGAAGTAGTCGGCAGCGCTGCAAATCTGGAACCGGGTTTATCGTCGCCTCAATCTTTCTCTGCCAGAACCGCTGACCTTAATCCCGTTGACGGGCCTCTTTGAACGGGTGCTGATTAATCTGCTGGAACGCGGTGAAATATGCGGGTGCGCGGGCCGAAATTGGTATCGATGCCCACGTTGAGGCGAAAATCTACAACTGGATGTCTGGGATAGCAGGCCCCGGTCTTCCGCCAGGCCAGGAGCGAACGATATTTGATAAGTTTGCTCTCGCGAAGTAAAAGAGTCGGCAGTACCGGGGGTAGAGGGCTTGGACTGGCAATTTGTCGGGCGATAGTGGATGTACACGGGGCACTATTACGCGTTCGACCGACCGGAAGGTGGTGCCTGTTTTCGTGTTACTTCCCCAGCAAACTGCCCCTGAACGGAAGAATTTCATGAGGATATGTGACAAACGTTCTGATTGTTGAAGATGAACAGGCTATTCGTCGCTTTCTGCGCACAGGTTAAACACCCAAGCAGACGCCGAAGATAGAGCGACGAGCAGAGCAATGCTT
>745b1774-6cd3-42d6-b574-a26fb2065d9c
TTGGTAATGCTTCGTTCCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCAGCGTCTGGCAGGTGTTTAACCTCTGCGCGGGGTAAACTCCGACGCCTGATTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAATCAGCGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCGCCTGGCATCTGGCTCTCCGGCGACGCCGATCGCTGGCAACAGGCCGCCAATAGTGGTTGAAGTCAGACAGACCAGCAACGCCACCAGTACCGTTACGCTGACTGCATTACCTTACGCGGAAAACGGCCACAGCGTGGCGGTTATAATCAAAAGGCGATAGTCAGGGCAATCAGCAAATGGTCAGGGCAATTTCGTTTCGAAGCGTTTTGCGTCGCTAATTGCGCCTTCCACCATCGCGATCATCCGATCAGAAATGCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAAGAAAGAATACGCGTGCCCGCCGGTTACGGCGGAAGTAAAATCGCCGCCGGATTCACGGTTCTACCGGTGCCGATTCCCCGGTGATGGCGCTCATCGACCGATGCACCTTTAATAACTTCACCATCGCGGGATAATATCGCCAGCTTCTACCAGTACAATCACCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCATATTTCGGCTCCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCACAGCCAATACGCTAATGGCCGCGCTAAACCAGCGCATTACCGGGCATCGCACCCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCAGACGATAAACATCACCCGGATTGCGCCATTTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCTCGGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGGCTCATATTCGAGTGCTCCTCCAATATCATCAGGAGATATTCCGCCGCTGCCGGACCAAAGCGCCAGAACGAGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCGGCAGCGTGCCGGAACTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTACCATCACCGGGATAATAATAATCACCCCGAAGCGACCGACGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAGAGCGCTGCCGTTGTTAGCGGCGGATGACGGCGTACAGCACTTCGCTAAAACCATACGGTGGGGTTGAGCATGGCGCTACGGCGTCGGTCATCATCGCCAACGCCGCGCCATCAGCACCAGCGTCAGGGTAACCAAGTGCCAGTTGGTCAGTTTCATCTCTCGCGTACGTCGATTTTTACAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAGAAAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCGCCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGGCGATAAAGCAGATCCATGCATCGCAATCACCGCGCCACAGGAAATACCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTATTGATGCTGCTGTCCGTGCTAGTGCCAGCAGATGAGGATTACCTGAACTTCTGCTTACATCACCACGCCTACGCAGATGACAAAAATCACTGACATCGCCCACAGCAACATGCGCCCTGGCGTGATCGCCCACATCACTTCACCAAAGGCAAAGCGCAGCGCCGTTGCCCGGATCAAGAAGATCGCATCTCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTTCAAACGGATTCACGACGAGTTGGCGATAAAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATTTGCTTCTGAGGCTTCTGAGCCCCATGGGTAACGGCTGTTGCGCTCCTTCAGCGGTATTCACAGCCCGATAAGGCAGAAGTTTGCAGCGCACTGTGTTGAATAAAACAGTGCAATCAACAACGCCACAGGGATAGCACCCATAATAACGTGATGCGTAACCTTGCCGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGGGGCAAAAATCACCGCAATCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGGAAATGGCTCAACGTGGTTTCACCGCTATAAGATTGCCGGATTAATTGTGGTGACAAAGCTGACGGCGGTATTCGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGTGGATTAAGCGGCAGATGGTGCTGACCGAGCAACGCAAAACAGCACCGCCAGCCCCAGCATGTTTCGAATACATGTGGCACAAGATATTTAGCTTCCAGTTCATCTCACGGTCAGAGACGCCAGAGTGCGCGAAAAGTACGCGCTCAACGCCCGTGTACCGGGAAGAGGAATGTCATTAATCAATGCGCCAGCCCGCTGCCCTAAAAGGACGCGCCAGCACCATTAACGGGTTAAACACCCAAGCAGACGCCGCAATCAACGTAG
>6a470b8f-d316-4d8c-b93f-ea7bd154775d
ATGTTGTACTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTCCGCCAAGAACATGAGCACGCTCCGCGCGAGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCACCAGCGTTGATTGATTACTGTTTTTTATTCAACAAGGTGCGCGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAAGGCGCAACAGCTGTTATTACCCATGGGGCCTGTAGCTTCTCAGGGAAGCGATCAAGATGCTCGTACTAACGGCGGTGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCAACCGCACTGACCAACTTCGTGCCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCACCGCCAGGGGCACTTGTATTTGCTAATGGGCGATGTCAGTGATTTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCGGTGTCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATAGGTAAAGGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCAGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGATTGATGGTGTTCCGGCGGTGTCGGTTCTGGTCTTTGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTGTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAGTTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGACCGACGCCGGACGTGGCACTCATGTCAACCCTGGCCGCATGGTTTTGGCGAAGTGCTGTACGCCGTGTCATCCGCCATAACAACAGCAGCAGCGCCTTTGCCGGATTAAGCATATCTCCGTTCTAAGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCAGGTGATTATCCCGGTGATGGCAGTGCCGGTTCGCTGGTGAGTAAAAGGCCAAGCCGCCAGCTCCGGCGCTGCCAACGCACGGCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCGGTGGCGGAATATTTATCTCTCCTGATGATATTGAGTGAGCACTGGATATGAGTCGTAAACAACTGGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCACAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGGCCGCTAATAATTTCGCCGAGGCGCTGGCGAAGGCCGCAGTAAAAGCGCAGGCCAACAGTCTGAAGGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCCGATATGGCGCTGCGGCGGACATTCCTGCCGACCAATACGTAAAAAGGCGATATCGTACTGGTAAGCTGGCGATATTATCCCCTGCGATGGTGGTTAGTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCACCGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGTTGATTGAGTGTAGCGTTATTGGCGGCGAGGCATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACAGAAATTGCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGTAGCCGTTTTCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTAGTGGCGCTGCTGGTCTGTCTGATCCCAACCACACTATTGGCGGCCTGTTGTCGGCGATCGGCGTCGCCGGGATGAACCGGATGCTGAGCGCGCGAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGTTCTGCTACTGGATAAAACCGTACCATCACACTCCGGTAACCGTCAGGCGTCAATTTATCCCCGCGCAGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACACCGGAAGGCCGCAGTATTGGCGATCCTCGCCAAGCAGCGTTTAACCTGCATAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTGCGCAAAGCCGGATAAACGGGATCAACATCGGCAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGAGGCTAACGGTGGTCACTTCCTACCGATGTTGATCAAAAGCCGATCAGGTTGCGCATTAAAGGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAGATATCGTCAAAGGCGGTATTAAAGAGAGCGCTTCATAGCTGCGCAAAATGGGCATTAAACGGTGATGATTACCGGCGATAGCCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGAAGCGACACGGAGTAAGCTGGCGATGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCACTGGCGCAGGCGAATCGCAGTGGCGATGAACTCCGGCGCAGGCGGCGAAAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGGTGGTGCACATTGGCAAACAGATGCTGATGACCGTGGCTCATGACCACCTTCAGCGTACTGTGGCAGAAATACTTCGCCATTATTCGGCGGCATTCGCGGCAACGTATCCGCAGTTAATGCATACAGACATCATGTGCCTGCATTCGCCCGACTCCGCAAATCACTCGGGTGCGGTGATTTTCCAGCTTTGTGATTATCGTCTTTTTGATTCCCTGGCGTTAAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATATTTGCGCCGTAACCTTACGGTTACGGTCTGGGTGGGCTGCTGGTGCCGTTTATCGTATCAAAGTCATTGATTTACTGCGGCCGTTTGCGGTCTGGTGTGAGGGACTTTACCATAGTGGATTACGTCCGGCATTATCGCATTTATGCTTTCTGTTATTGATTACTGGCGTTTACCGCTTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCGAACCAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCAGGCAGAATTTTACCGGCAACGGCTGTATTTTTCATGGTGCCCGTCAGCAGCAGCAGAAATGCCCTATAATCCACAGGCTTCTGGCAGAACAATCTGGCGGTCAGTAACCCTGAGCTGGATAAATTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCAGGCGTTCGGATGAACTGGTGGCGGCATCGGCAAGCGGGCTGAATAATATCGCCCGCAAGCGGCGGCCTGGCAAATCCCACGCGTGGCAGCGCCATAATCTCAGCGTTGAACAGCTCACTGCCAACTGATCGCAAAATATTTGTAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTCAACGTGTGAAACTCAATCTGGCGCTGGATAAACTCGATGAATGTAACGAACCCTTACGTCCGACCCCGATCGTCTGCTGGAACAAACTGCGCGCCGCATCGGGAAGCTGATTTTCTTCGGTGCCTGTGCAGGCGTCAAAGGGAAGACCTGGAGCGATGCTGGCAGAAGCCCAGCGACTGCGAGCGCAAAGGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCACGGGCGAAAGATACCGCCGCCATGCTGGAAGGTGGCTGTTCTGCCGTTAAAACCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATGCCGCCACTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTAATGCGCGGAGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAGGCGCTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAGCGTTCAGCATCTGGAAAGTCTGAATGATGGTCAGCGGCGTCACCGGAATTCAGGTACGGGGAAACCGTGCCCGATCCTTTTCGATGCCGCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAGAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTTCCGCAAAGGTAATCTGGTCGCCCTGCATGAACTGGCACTACGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGGCGTCTGGCAGAAGAGAAAGTGGCACACGCGACGCGATCCTTTATGCATCGGCCATAACACCGGCGGCGAAAAACTGGTCCGCGCAGCTGCGGCTGGCGTCACGGCTGGGTGGCGTCTGGCGCGGTGTTATGTTGAAACCCCTGCCCTGCACCGCTTACCGGAAAAAACGTCGGGCAATTCTCAGCGCGCCCGTCTGGCGCAGGAACTGGGCTGGAGACGGCAACACTTTCTGTTGATCCAGCGGAAGAGAGAAAGCGGTAGTGCGTTATGCCCGTGAACATAATCTCGTAAGATTATTCTCAGTCGCGGCCTCGCGCCGCTGGTGGCGTCGGGAGACGTTTGCTGACCGACTGGCGCGCATCGCCCCGATCTCGATCAGGTGCTGGTCGCGCCCGATGACCACCCGCCCGCACGATTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAAGTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCTCTTGTAATTGCCATGCAGTGGCTGATGGCGTTGATGCGCCAACCTGGTGATGCTGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTATGGACGCTGGCCTTCAGTGGTTGCCACCGTCATTAATGTAGTGAGTTCGATCTCTTTTTTATCGCCCCACGCAGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCAGGAACCTTACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCGAACGCGCACACGGCACTTATATGAAATGTCGAAAGCTCTGGCGGTGGTGCAGTCCGCAGGATATCGCTGCCACCAGCAGACAATTTATTGCCTCCGTTTCATGCCCGCAGTCGGGTGTTGTTGCCCGATGACAACGGTAAATTGCAGCCGTTAACATCCGCAGGAATGACGCCGTGGGACGATGCCATCGCCGCGAGTGGAGTTTGATAAAGGCCTGCCTGCGGGCGCGGGCACCGACACGTTACCCGGTGTACCGTACCAGATTTTGCCATAAAAAGCGGCGAAAACTACCCTGGGCTGGTGGTGGTGGAGCCGGGAATCTGCGCCAGTTGATGATCCCGGAACAGCAGCGCCTGCTGGAAGACGTTACGCTGTTGGTCGCCAATGCCCTTGAGCGGCGGCGCGTAACCACCGCCAGCGAAGAACAGGCGCGGATGGCAAGCGGGCATTGAACAGATCCGCAACGCCTGCTGGCAGCGCTTTTCGCGGTTACGCGCCGCTTACGGTGCTGTTTGGTCAGGCAGAAATCTTAACGCTCGGTCTGGCAAGCGAAGGATCACCCCGCCCGCCAGGCCAGCGGATCCGTCAGCATGTGCTGAACACTACCGACTGAATTGAATAATCTACTGGAGTATGGCGCGAATTCCAGTCCGGCGGCTTTTAATTTGAAGAAAGAGTGGTTAACGCTGGAAGAAGTAGTCGGCAGCGCGCTGCAAATGCTGGAACCGGGTTTATCGTCGCCCATCAATCTTTCTCTGCCAGAACCATGACCTTAATCCACGTTGACGGGCCCTCTTTGAACGGGTGCTGATTAATCTGCTGGAGAACGCGGTGAAATATGCGGGTGCGCAGGCCGAAATTGGTATCGATGCCCACGTTGAGGGCGAAAATCTACAACTGGATGTCTGGGATAACGGCCCCGGTCTTCCGCCAGGCCAGGAGCAGACGATATTTGATAAGTTTGCTCGCGGGAATAAAGAGTCGGCAGTACCGGGGTAGGGCTTGGACTGGCAGTTTGTCGGGCGATAAGTGGATGTACACGGGGCACTATTACCCACGTTCAACCGACCGGAAGGTGGTGCCTGTTTTCGTGTTACCGCTTCCCCAGCAAACTGCCCCTGAACTGAAGAATTTCAGCGAGGATATGTGACAAACGTTCTGATTGTTGAAGAAGATGAACAGGCTATTCGTCGCTTTCTGCGCACGGCGCTGGAGGGCGACAGGATGCGCGTCTTTGAGCCGAAACGCTGCAACGCGGCTTGCTGGAAGCAGCGGCAACCCGTAAGCCAGATTTGGTTATTCTCGATCTCCGAAGCCTGCCCGATGGTGATGGGATTGAGTTTATCCGCGACCTGCGCCAGTGGAGCGCGGTGCCGGTGTTAATGCTTTCCGCGCAGCGAAAACGACAAAATCGCCGCGCTGGATGCCGGAAACGGATGATTATCTGGAAGTAAGCCGTTTGGCATTGGCGGAATTGAGCCCGTCTGCGCGTCGCATTACGCCGCCACTCTGCACCACCGCGCCCGATCGCTGGTAAAATTTTCCGATGTTACCGTCGATTTAGCCGCCCGCGTGATTCACCGGGGTGAGGAAGGTTAAACACCCAAGCAGACGCCGAAGATAGAGCACGCA
>1896c369-b7d0-4e98-aa23-830f7a9f001f
ATTGCATCGGTATTGCTTCCCGTTCGAAGTTACGTATTGCTCTTCGGCGTCTGGCGGGTGTTTAACCTTCCGACTCGCTGATATACCGCCACGGTACGCCAGCGTTTTAACGGCAGAACGACCAGCCCTTCCAGCATGGCGGCGTATCTTTTCGCCCGATAGGTTTCTACCACGCCAACCACAATATCAGCCCTTGCGCCCGCCGTCCGCTGGAGCTGCCAGCATCGCCCAGGTCTTCCCGACGCCTGCGCGAACAAGAAAACTTTCGGCTTCCCCGATGCAGCGCGGCGGTTTGTTCCAGGCAGCAGACGATCAGGGTCCGGGACGTAAAGGTTCGTTATTCATCAAGTTTATCCAGCAGATTAGGTTCAGCAAGTAACGACAACCAGCTGGCCGATATATTCACCAACGGTTGTTGGCTGTATTTTGCGATCAGTTGCGTGAGCTGTTCAACGCTGAGATTGCCCTTTCGCCACGCATTAAGTTTACCAGGCCGCCGCGCGGGTGATATTATTGTCCAGCCCGCTTGCCGATGCCGTCGCAGTTCAACCAGGAACGCTCGCGCTGGCATCCGGGTAGCGGCGTAATGCAATAACGCGTGCGGCTATTAGTTTATCAGCTCAGGGTTACTGACCGCCAAGATTGCTCCCGCCAAGCCTGTGGATTATAGAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCGGTGCCGGTAAATTCTGCCCGAAGAGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGAAACCACCATTGCCCCAGTACGGTGGTCAGCGGCGGGGTAAACGCCGCAGTAATATTAACAGAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACTGGAACCGCAAACGGTCAGCAGTAAATCAATGACTTTGTCACGATAAACGGCACCAGCAGCCCACCCAGACCATGAAATCACTAAGTTACGGCGCAACCTCGCGGCAGAAGCGGTAAGCGGTTTATAGCTCACGCCTTTTTAACGCCGGGAGATCAAAGACGATAATCCAAGGCGTTGAAAATGCCGCACTGAGGATTGCCGGAGTCCGGGCGAATGCAGGCACATGATGTTCAGCGCATTTAACTGCCGATACGTTGCAGGTTGCCGGAATAATGGCGAAACCATTTCGCCACATCGTTAACAATGCTGAAGGTGGTCAGAGCCACGGGTCATCCAGCATCTGTTTGCCAATGTACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCCGCCGCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCACCTGCGCCAGCGCTGGGCATCGTTGGTGCCGTCGCCGGTCATCATACCAAACGACCTTCCGCGCCTGATACTGACGGATCAATGCCAGCTTGGCGGTGTCGCTTCGGCGAAAAATCATCGACACCCGCTTCCCGCAGCTGATGCTAACGCGGCAGCAGTCAGACTGGTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGGGAAATAGCTCTTTAATGCACCGCCGCTGACGATATCTTTCAGCGCAATAACGCCCAGCACGAGAACCTTCCACCACCACCAGCGGCGTATACGACGCGCAACCTGATCGACTTTTTGATCAACATCGGTAGAGTGACCACCGTAGCCTCAACATGGCGACAGATGGCATCGAATAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCACCGGGCGACTTCTGCATCCGCGCTCGCTAAAACGCTGCTTGGCGAGGATCACAATACAAGCCTTCCGGCGTTTCATCAATAGCAAATGGCGCCAGTTGTTGGCGTCAATGGCAGTTTTCATCCACGCCGCGGCGGATAAACTCCGACGCCACGAAGCGGTTGCCGAAGTGTGATGTTGCCGGTTTTATCAAAGTAGCGAGCGTCAATCCTGCCGCTTCAACTGCACGTCACTGATTGGCAATCACGTTCTTTACTTCGCATCCGGCTCATCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCGTGGGGCATAGACCAGCAGCGCCACAATTGCCGTTACGCTGACTGCATTACCGCCCGCGGAAACGGCCTGGCGTGGCGGTTGCCAATCAAAAGACGATAGTCAGGGCAATCAGCCAGAATGGTCAGGAACCAGTTTCGTTCCAGCGTTTTGCGTCGCTGTGCCTTCCACCATCCTTGATCATCGGTCCAGAAATGTCTCGCCAGGGTTAATACCTCCGTCACCAGCCAGTCAGAAGAATGCGCATTACCGCGGTGACGGAGAACCCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGGTTGTTCGGTGATGGCGCTTTCATCGACCAAAGTGCCCCGCTTCAATAGCACTTCACCATCGCAGGATAATATCGCCAGCTTTACAGTACGATATCGCTGCTTTACGAGGATTCAGTCGGCGCAGGAACTTTGTCCGCCGCAGCGCCATATTCGGCTCACGCGGCTTGCGGGCAAAGGCAGTTTTTCACCTTTCAGACTGTTGGCCTGCGCTGCTGCGGCATTGCTTATCGGCGAAATTAGCGGAATTAGTGGTGATCCAGCCAACCTTCGTGGCTGCGCTAAACCAGCGCATTACCGGGCATCGCACCACTTGCATCACTGATGTACTAATACAGGTGGTCAGCGAACTGCCGCCGATCCAGACGATAAGCTTATCACCCGGATTGCGCCATTGCGCCTGCGGTTTAATTTTTTCACGCTTCTTTCAAACGATATGAAGTGTTGGTTTCGAATAGCACCGGTTGTTTGACTCATATTCGGTGCCTCACTCAATATCATGGGAGAGAGATATTCCGCCACCGGACCGAAGGCGCCAGGGGCAGGATAAAGGTCGAACGCCAACCAACGCTTACGGTGCCGATTAACCGACCCAACAAACAGCGGGCCGTACGTTTGGCGGCGATGCCGTTACTACCAGCGAACGGCAATTTATCGCCGGTGTCACCCGGCGACCGATAAACGTGAACATGGTAACAGTTCCAGAACGGAGTTACGGCGCTTAATCCGGCAGGCGCTGCCATTGTTAGCGGCGGATGACGCGGCGTACGCGCTATTATTAATGCAGGCCAGGTTGGTACTGGCGCTACGTCAGCACGATGGTCATCATCGCCAACGCCACTTCATCCAGCGCCAGCGATCGGGTAACCCGGAACACCCGTTAAAGGTCGGTTTTCATCTCGCGTACGATAATTTTTACCCAGATATTCCGGTGCACGATAATCCTCAAGCCAGCAATAAGCACGCCAGCAGGATGACAGCATCATGCCGTAGGAATTAGGGAGCCGTTACCGCCGAACACCGCCCACCAATTTATGTCAATACATCCGGCACCACTTACACCCAGGAAGCTGACCAGCAGATCCATGCATCATAATCACCGCCACAGAAGCCGCCGTCGTCACGACCGCAAACAGGCTGCAACCAGCACGCCAGTGGCTCTCTTTACCCAACCATATTGGTGCTGCTGCTGTCCATTGCCGGTACTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAGTCGCTGACCTCGCCCGCAGCAACGCGCCCCTGGCGTGATGCTTATCCGCTTCACCAAAAGGCAAAGCACACAGCGCCGTTACAGGATCAAAGAAGGTCGCCAGCATCTGCACGAAGTTAGTCAGGTGCGGTTGGGTTTTCAAACGGATGCGACAGGGTTGGCATTAAAGAAGCCACCGCGGTGGTACCCGGCTATCTTGATCGCTTCCTGGCTTTATTCCACGCTGGGTAACAGCTGTTGCGCTCCTTCAGCATTATTCACAGCTGAAATGGGGCAGAAGTTTACTGGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACGGGGATAGCACCATAACGTGAGTAAAGTCGACCCGAAGACATTCAGGCGTGCTCATGCTCTGGCATTAAACGCACGGATGAGGGCAAAAATCACCTGGAAATCCCGCTGGCGGCAGAAAAGTTTGCTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACTGCTTCTCAGATTACCCGGTTGTGGTGACAAAGCTGACGCGGTATTCGAAAGCATAGATCCGGTGAAGCTGGCAACTGCTGGCGATTAGCGGCAGATGGCTGACCGGCTGGCATAAAAAGAGCATACCGCCAGCCCCAGCATATTCCAGGCCGAGAATGGCACGAAGATTGCTTCCAGTTTCATCTACGATTCAGAGGGCGCCGTGCGCGAAAGTACGCTTCAACGCCGTTCGCCAGGAGAACCATCATTAATCAATAACGCCAGCCGCTGCCTAAAGGACGCGCGCCAGCGCACCATTAACCACCATTAAACGTAGCGATCAGGTAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAGCAGTAATAAAGCACCAGCATTACGCCGGTTATCACGCCTGCTCTGATGCACCTCCAGTGGCTAAAGAAATTGACCGGGTGGGAATTCGGCTGCGGAATTCCATAAAAATCTGCGGGCGAATTAAAAAAGTATAAAATGGCAAAAGCCATGATTTAACTAATGCGTTTAAGTATTAATTTAACTTTTGTTGTAACCCAATTACCGGGATGGATATAAATAAACCATCAATAAGCAAAATAAGTGGTCGGATGGTAGTAAGAATTACACAAAAGGCGGGAATTTCAAACAAATCAGATAAACAAAATTCATTTTTCCGGGGTGCCATTCACCGGGTAGATAAAAGGGGAAAAGAATGGAACTCTACAGAGATATCCTGCATGGCTTATCTTTTTACGCCGTGCTTATGCAGTTACGGGCGTTCTGGCGCTGCACCTTTCATGCTTTCTGGAAGGACCGCGCCCGCTTTTGGCTACCATCGCGTCTGAATGAAAACCAGCGATATCCGGTGTGGATGGATCGGAATGAAAAGGCAACTGAGTTTTTATTGATTGCTGGAGTTTTGAATACGGCTGAGAGCCGCCAGCGGGTTAAACGCAAACGGACCGCTATCAGCACCAACAGAAAAGCAGTAAATGAAAAAAGAAAAAGA
>c1709263-8322-4cbd-86de-5f40eb0457c1
TGCTGTACTTCGTTCGGTACGTATTACTGCCTGCCTGTCGCTCTATCGCCGGCGGCGTCTGCGGGTGTTAACCTTGCCAGGCCGCCGCTTGCCGAGGTGATATTGTTGGTAAGCCCGCTTGCCGATGCCATGCCAGTTCAACCGGAACGCTCGCGCTGGCATCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCAGCTCAGGGTTACTGACCCGTAGTTACTCCCGCCAGAAGCTGTGGATTATAGGCATTTCTGCCGTTGCCGACGAGCGACCATGAAATAGCCGTTGCCGGTAAATTCTGCCCGATTAATGCCGAAACCGCGCACCGTATCACCTTCACGAATCAACAGACCATTGGCCTGCCAGAAACCACCATTGCCCAGTACGGTGGTCAGCAGCGGGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGATATTACCGGACATGTCACTCGCTAATTAAACCTCACCAGACCGCAAACGGTCAGCAGTAAATCAATGACTTTGTCCTACCGATAAAGCAGCACCAGCAGCCCCAGACCGTAAATCCATAAGTTACGGCTGTATGGCAGAAGCGGTAGGTTTATAACTCACGCTTTTTAACGCCAGAGGATCAAAAGGCGATAATCAAGAACGTTGAAAATCACCGCGCACTGAGGATTGCGAGTCGGGTGAAATGCAGGCATGATGTTCAGTACAACTGCCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCATCGTTGGCAATGCTGAAGGTGGTCAGCCGTGCGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCCGTCAGCAGGTCGGGTTAGAGTCGAGATGACCATATTGCCCGCCTCTTTCGCCGCCTGGGTGCGGGTTTCATCGCCACCGCGACGTCTGCCTGCGCCAGCTGGAGCATCGTTGGTGCCGTCGCCAGTCGTCGCTACCGGCGACCCTTCCGCCTGATACTGACGGATCCAATGCCAGCGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCACCAGCAATCTGCTGGCAGCAGTCGAACGGTTATCGCCAGTAATCATCACCGTTTTAATCGCCCATTTGCGCGAAAACTGGGCAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAACAATAACGCCCAGCACGAGACCTTCCTACCACCAGCGGCGCGGCTCCCCTGACGCGCAACCCTGATCGACTTTTTGATCAACATCGGTAGAGATGACACCGTTAGCCTCAACATGGCGACGAATGGCATCAAACAGAACGCTTGCGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCGGCTTTGCGCGATAAGCAGTACAAAGGTAGCCGACGACCGCATCGCGCTCGCACAGGTTAAAAAACGCTGCTTGGCGGGATCACAATGCACGGCCTTCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAATAGCGTTTTCATCCACGCCCTGCGCGGCGTTAAACTCCGACGCCTGACGGTTACGCGAGGTGTGATGGTGCGGTTTATCCGGCGGCAGAACGTCAACGTCACCTGCCACGCTTCGCTGCGTCGCTGGTGGCAATCACATTCGCGCCTGGCATCCGGCTCATCCGGCGACGCCGATACGCTGACAACAGGCGCCAATGATGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGATTACGCTGACTGCATTGCCGCCCACTGCCGGAAACGGCCTGGCGTGGCGGTTGCCAGTAAAAAGACGATAGTCAAGGCCAATCCAGCAGAATGGTCAGGGCAATTTCGTTCCGGCGTTTGCGTCGCTGTGCGCCTTCACCATCGCGATCATCGATCCAGAAATGTCTCCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCGAAGAATGCGCGTGCCGCCGGTGACGGAGGCAAAATCATACCGGATTCACGGATCGCCGATTACCGATTCCCCGGTGATGGCGCTGCATCGACCGATGCACCTTCAATGCTTCACCATCGCGGGATAATATCGCCAGCTTCACCGGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACGTCGCCGCAGCGTATATTTCGGCTCACGCAACGCGGGCAAGGCAGTTTTCACTTGCCTTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCGCTTGCAGCGCTATCAGCGAAATTGGCGAACAGTACGGTGATCACATCAGCCGCTAATGGCCGCTAAACAGCGCATTGCCGGGCATCGCACACTTGCCATCGCGATGCTAATTACAGGTGGTCAACCGGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTAATTTTTTCACCGCTTCTTTCGCGCCTGAACGACAAGTGTTGTTCGAATAGCATGATTGTTTGACTCATATTCGGTGCTCACTCCAGCCGTATCATCGGAGAGATATTCCGCCACCGGACCAGGGCAGGGATAAAGGTCAGTGCGCCAACCCCAACGCACGATTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGATGCCGGAAACTGGCAGCAGCTCTTTTACTCACCAACCAGACCGGCAATTGCCATCACCGGGATAATCGCGAAGCAATACCGACAAACGCTGCAGAACGCCAGTAAACGGTTCAAGACGGAGGTTGGCGCCATCCGTAAAGCGCTACCGTTGTTGTTATGACGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCAGACGGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACTTGCCGCGCCCATCAGCACCAGCGTCGGGGGTAAACCAGAATTGCCAGTACGGTCAGTTCCATCTCGCATGCGTCGATTTTTTACCCAGATATTCCGGTGTACGATAATCATCAGCTACGGCAATAAGCACCGCCAGCGGGACAAACAGCATCATGCCGTAAGAATGAACCGGTACGCGAACACCGCTTCATAATTTGCATCAGCGTGGCACCATGCCACCGAGGCAGTAACCGATCATGCATCGCAATCACCGCGCCAGAAACCCGCCGTCGTCACGACCGCAAACGAGCTACTGACCCAGCACACGCCAGGAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCGTGCCCGGTGCCAGCAGATGGGGATTCACCCTGAACTTCTGCCCACATCACCACGCCTACGCGGATGACCAAAATCGCTGACGCTCCCTTACAACGTATGCGCCCCTGGCGTAGTCGCCCATCATACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAAGAAGATCGCCAGCATCTGCACGAAGTTAGTCCAGTGCGGTTTGGTTTTCAAACCGGATGCGACGAGTTGGCGACAAGAAGCCACCGCCAAAGGTGGTACCGAGCATCTTGATCGCTTCCTGAAACTGGGCCCCCATGGGGTAACAGCTGTTGCGCTCCTTCAGCAGTATTCACGGCCTGATAAGGCGAAAGTTTTACAGCGCACCATTGTTGAATAAAACGGTGCAATCAAGCAACGCCACGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCGAGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAAGCCGCCATCTGGCTGAAATAGCTCAGCGTGGTTTCACCGCTATAAGATTGCCAGTTAATTGGTGATGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCGGCAGCCCTGGCAACTGCTGTGGATTAAACTGCGGCGAATAGTGCTGACCGAGCAACGCAAAAACAGCACCGCCAGCTGGCATATTCCGGGCCGAGAATGGCACAAGATATTTACTTCCAGTTCATCTCACGGTCAGAGCGCCAAGTGCGCGCGAAAAGTACGCGCTCAACATACGTTGCCGGGAAGAGGAATGTCGTTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCCAGCACCATTAACCTACCAGTAAAAGCGTGGCGATCAGTAGAACCCTTGCGCAGCCATCAGAACGCCTCCCGCATTGATCCGGGCATAAACTGAATAACCCGGTAATAAAAGCACCAGCAATACGCCGGTTATCACGCCTGCACTCTGAGTGCACCTCAGTATTCAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAGGTATAAAAATGGCAAAGCCATGATTTAACTAATGTTTGAGTATTAATTTAACTTTTTGTGTAGCTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAATAAGTGGTCGGATGGTGGTAAAAATTACACAAAGGCGGTACTATTTTCATCAGATAAAACAAATTCATTTTCGGTGCCATTCACGGTGAAGATACAAAGGGGAGAAAGTGTATGGAACTCTACGGAGAATATCCTGCGTGGCTTATCTTTTACGCCGTGCTTGCGGTTGCAGCGGGCGTTCTGGCGCGCCTTTCGTACTTTTCTGGAAAGACCGCGCCCGCTTTTTACGGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAAACCGGTGTGGATGGATCAGGCCGAAGGCAACTGGTGATTTTTATTGATTGCTTGAGTTTTGGATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTAATCGGAAGATGTTCAGAGGAATATTTGACATCGTTATACCAATCCGAAACATATATTCATGAAATATATAAATATTTTCCTGGTGTTCTTATCTGACGGATATCTCATAAAGGCTTTCTTATAAATCCTTGTAGGGTTTCGCCTGTCGGCGGACAAATAACCCGATAAAACAAGGATGAGCAGATGGGCGGGAAAACCGGCGGCGCGTCGGGGCGACATGACGCAGTATGTGACCAACGCATTGTCAGAGTTCAGCCGGGGTACGCATCAATTGCCCCACCGGCGTAGCCTGTTCGGTGTGCCCCGGCAGTGCGACGTCGGCCATCGGTCAATCCGCTGCTCAATTGCAAAGGTCCTTCAGTGAAACCGACATCGCCCTGCCGGCCGCTACCGTTCATTGTCTCCGCACCTACAGCGATTACCGGACAAAACGCCCGCGCCGGTAGAGACCTCAGCCCCCGGCTGGAAAATGCCTGCGGAATATCCCGCTTACAATACGCGATAACACACTGATACTCAGTGATAACGGCAAGCCTGTATTTTGACACCTGTTTCCCGGTGAGGACCAGTTTGGCCGCAGCGAGTCACTGGCTGGTGCGCAGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCGAGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGATGGAAACAGTCCGCAGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCAGTTGCCGGAAGCGGATGAAGTGCTGCCTGCGCGCCGCTGCCGTACCGGAGTACTGACCGGGCTGGTGGACCGCTTCAGGCGCACACAGACGTTCCACCGCAAGCCACCGGTAGATTGGCGGCGAAATCACCGGCGTGACGGATGGTGCGGAGGCGTCCGCCAGCTGGTACTGACCACGCGGAAGCAGCGGGCGAAGAAGCGGCAGCGAGCCGGCATTTCCGAAGCGGGACGGAACGTCAACTTTTCCTGATACCGGGTTACGAATATGGCGGGACAACGGCATCCGTCTGTCTGCCGATAGCCGGCTGACGCACGACCGGAATACCCGGAGGATTTGCCTGCCGCGCCTTTGGTGCGCTATGGCTGGAACGCCCGCGGCGAACAGCAGCGGTGTATGACCACCAGCAATACACGGGTGCGCAGCTTTGCTGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTGCACAGGCCGACGGAAATCTGTTACCGTTACGACGGCGACGGGCGGGTGACAAGAACAGCTAAGCCAGCGGGCTTAAGTTACGTATCAGTAGAGGACGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAAGGGCGCGGACGACAGCGTCACGCAGAGTCCAGTTTATTGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCACCAGGCAGGACAAGCAGAACCTGATCCGGATGTGGTGAGCGGGCCTCATCGCGCATCACCGCCGGATGGCAGGGCATCGGCGTTTACTAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGAAGCTCGCCAGAGATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCTGACGGCGATAATACCCGCTACCGTTATGTCGTCACAGTGACTTACCCTGCGCAGCGGAAGATGCCACCGGCGGCGGAAAACCATGACGTGGAGCCGTTGCGGTCAGTTGCTGGGCTTCTGACTGTTCCGGTTATGTAACCCGCTGAAGCCATGACCGTTTGGTCAGGTGGCGGCAGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCAGTGGACGGTTAATTGCCGTGAAAGACCGCAGGGCCGTAGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCGGACGGCAGCAGAAACGGGACACAGTACGTGCGTGGGGAAAAGCCATCTGTACCACGCAGGGGCGTCTGACGCGATATGGGGCTCACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTAGCAGCAGCCACACCACGCTTCCACGTTACCGTGTACTCGACCGGCTGATGGAAACCACGGCTGACGGCCGCCTGGCGATTATCACCACGACCACAGCCAGCAAACTTATCCGCAGCGAGGATGAGGCTGGTCACCCTGGCACTATGACCAAACGAATACGCCTCACGCATTAATGGCGAAACCGCAAACGGTGGCAGTGACGAACGCGGCTGGCTGACGAACATCAGCCATATCAGCGAAAGGCACCGGAGTACGGCGGTGCACTATGGTTATGACAGTAAAGCCGCCTCGCCAGTGAACACCGAGCGGTGCATCATCCGCAGACAGATGAACTGCTCTGGCAGCGCAGGATGAACATGCGTACAACGCACAGGAACTGGCAATTGCTGTACCGGACAGCCTGCCCGCCGTGGAATGAGCTGACACGGCAGCGGCTGGCTGTCAGGCATGAAGCTCAACACCGCTGGTGGAGTACACCGCGACCGCCTGCAGGAAACGCTGCGCTGGCCGTTATGAACTCACCGCCGCTTATGCCCCCTGCCGGGCGGTTACCGTTAACTGAACAGCCTGCTGTCTGACCCGCGATTACACGCCTGGGCAACCAACGTGAACTCATCCGCATCAGCAGCCCACGCGCCGGGCAGGGCCTGGCTACAGCACCACCGGCAGGCCTGACCGGCGTTCCACACCACGCAGCGAATCTGGATATCGCATCCGTATACCACGGGCGGCAGGTAACCGCCTGCCGAGCTGAGCTGCGCGGACGCCCTCAGCACTGTGGCCCGGATAGCCGTATCGCCCGTGACGCACTATCTTTATGGTATGACCGTCACGGCAGGCTGACAGAGAAAATGACCTCATCGGAAGGGTTAATCACACCGGATGATGCGACGCACCACCGGTTACCATTACGACAGTCAGCACCGGCTGGTGCACTACCGCAGACACAATATATGCAGAGCCGCTGGTCGAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGAGATTGGCAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCTGCGGAAGCCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCTGACCGATAGAACGGCAGAACCCGCATCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCATGGGGGTTGAAACCGCCACCGGTGAGCCGGCGAAAACCGCAGCGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGGCAGTGTGAATTGACCCGCCGGTACTGGTGCGGATGCTCGACCGGCTGGAAAATTGAAATCCTGGCTGACCGGGTGGTGAGGAAAGCCGCCGCTGGCTGGCGTCGTGCAGCTGACGGTGGCGCAGGTCGCCAGATGGACCCAGTATACACGCCGGCGGAAGAAAAATTCACCTGTACCGCCGAAGGAAGACCGTCGCGACCTGCCGCTGGCCCTTATCAACGCACCGGAAGGGACAACGGCGTGGTACACCAGAATACGATGAATGGGGTAACCTGCCGAATGAAGAGAGCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGCAGTATGATGAGGAGTCCGGCCTGTATTACAGCCGCCACCGCTATTGACCCGCTGCGGGGCGTATATGCTCAGGATCGGTTGGGCTGAAAGGGGATGGAATTTTTATCAATCCGTTGAATCCGTCTCAAATGGATCCATTAGGATTGAAAACACTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATGGAGAATCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATGCTTGTGGTGGCCAGACCAGCAGGGGAGAATCAAAGGAGATGGTCTATGGGGGCGGAGTAAAGGCAAATGATACAAAGAAGCTGGCCGTTTGTGACCTCGTTGAAACCGATAATGGTTGTGTGGAGCTGTTTAAAGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGGCTGTTGCCTGATATATTCACCTATAAATTTAGGGCTATTTAAAACTGCAAGACTGGTCTAATGATTCTTTAGAAACATAACAGATGAGTGCTCCGGGAAATAACATTGGACGTTTTATTAGATTTGTGATACCGGGTGATGTAATGAAATATATTATTTTTTTTATTCAGGCTATATGAAAAAGGCTTTATCGCTTTTAATGCTATTCTTTTCCGGCCATAGACTTTCATATTAGACTCCACTCGTGATGTAGGCGGAGTTAATTGATCTCATGTCTTGGCAGATGATGGTAATATGTTTCCAACAGGCATAGTATTCTTTATTGCTCTAATATTTATGAGTTTGTATCGAACATTATTGGCGTAAGGATTGATAAATAAAGTATATTATAGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGGTATATTCAATGGTTTGTATTAAAGTAAGCGCATATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGGCATTTGATATCCCGTATACCTGGGGCCAACGAGTAACCATACTGACCAGAGCTGCACCCGGGCCAGCACCCTCAGCATATGGCCGGATAAACCACGTAATATCGCCCGTGACGCGCGCACTATCTTCCACCGGTATGACCGTCACGGCAGGCTGACAGATGACCTCATCCCGGAAGAGTTATCCGCGGATGATGAGCGCACCCACGGTACCAATACGACGGTCCAGCACCGGCACCAGATTGCACTACGCAGACCACAATATGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCGGCAAAACAGGTGTGGCGTTATTGGAGCAGGACCTGACCCGGGCTGGATGTCGCTGTCACGGAAACCACCGGTGACCTGGGCACGGCTGGGACCGGCGACCGCCTGACCACGATAGAACGACAGAACCATCCAGACGATTTGTCGGCTACGGGGCTTCCACGCCACTCATCAGGTTAAAGAGCCGCCACCGGTCGACTGGCGAAAACGCAACGCCGCAGCCTGGCGGATACCTTCAGCGGTCCGGCGGCGAGACGGTGGCAGTGTGGTGTTCCGCCGGTGCTGATGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAATGAGGAAAACCGCCGCTAGCTGGCATCGTGCAGCTGACGGTGGAGCAGATACAAAACCGATGGACTGCGGTGTACACGCCGGCGCATCCACCTGGCCGCCACGACCATCGCGAGCTGCCGCTGGCGCTTATCAGCACGGAAGGGGCAACAGAATGGTGCGCAGACTCACGATGAATGGAACAGCCTGCTGGATAGAAGACCCGCATCAGCTACAGCAGCTTATCCGCCGCCGGGGCAGCAATTATGATAGAGAGTCCGGCCTATTACAACCGCCACCGCTATTATGACCCGCTTTGCAGGGGTATATCACTCAGGATCCGATTGGGCTGAAGGGGATGGAGATTTTATCGGTATCCGCTGAATCGGTTCGTATATAGATTCAATGGGACTGGCATCAAAATATGGACGCCAAATAATGGCGGATATGGGCGAGGACAACAAACCGCTACGCCCGATCCGTAGTGCCGGACATGGCGACAATTAAGACTGCCATATCCTAATGACCGGGCCAGTGGTGCCTAATGTTTCAAAACATTCTTCCAGGCATTAAGCCCTTACGACTGCACTGTATTGCAGAGTGGGTAAAACCAAATCTGACTTGTACGCCACAGGATGATTCCCCGGTATCAGGAGTGGATACCAAAGGGCTGTGATGATTACCTGCCGCGGAACCAAATTGGCCAACAACTCAATTACCACCAGGATATACTTGTACGGGGAACCCTACTTTGTTAGACATTAATAAACCCGATGGGCCAGCAACGAAAGCAGGGATGGTGATTTAGATTGAAATTTTATGGAATGGAACAGAGAACATCAGGGTAGAAAAATGAAAAGAGGTTTTGTTCTGCTGATGATATTTGTTAGTTTGGTGTCATAGCTGATTGCGAAATACCAGCTAAAGATCATGATTGTTTTACTATTTTCGCTAAAGGGCTGCTATTTTTTCGCGTTTCTATATTTAAATAATAAAGCCATGTGGAGATGGTATTATCAGAATGGGGACATCGGTGAGTATTATTGGCAAACAGGAACTGGGTACATGTAAAATAATAAATTCCACAAGCGGGGCGAGACTCTTAATTCGCGTCGGGTCACATACGCCTTAATGAAAAGTCATGCCATCAAAGACGTTGCAGGAGTTGATAAATGCAGCGAAAAAACGGCGTTTCTCGGCGATCGGTTTAGAGTTATATATAAAGGCGATTGTCTATCAAAAGAGCGGTGATCCAGTTCCAGTTGTTGGCAGTCCTTGATAATTCAATCATGGTAAAATATTTTAAAGATGAGAAACCAACTTATGCTCGAATGACGGCACATCTCCCGAACAAAATGAGTCTTACAGATGTTTAATAAAGATACAGCATGAAGACTAATTCATAGTGAAGAGAAATAAAAAGGTTAAACACCCAAGCAGACGCGAAGATAAAGGA
>f20007a8-a22e-47c3-87d7-7c0f9744f792
TTCGTGCTTACAGGTTTACGTATTGCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGGCGGGTGACAACCGCGTTGGTGTTCGCTGGCAGTGGGCAGGCGCGGCTGTCATGGGCAGGTGCGCAGATGCCCGGTGCCCTTCGCTGAATGGCGATAATCACTGTCAGCCAGCGCGTTCGTCAGCCACCACCCGCTCTGCGGTTTCGCCGCATTCGATTGCGTTGCGTGGCAGGGCGGTCGCAATAAAATCGCAGTACTGGTGGGCGTGACCTCATCCTCGCTGCCGGATAAGTTTGCGCGGTCAGGTGCTGGTGATAACGCTGTGTGCAGCCGTCAAAGCCGGGTTTCAATGATTGAAATTTTGTCGTAACGGAAGATGGTGGCTGCCGTTTTCACTGGTCAGCGGATGGGCCGTCATTTGGCACATCGTATTCCATACTGCGCGTCAGACCGCCTGCGTGGTACAGATGGGCTTTCCCGTAATGTTCTGTCCATTTCTGCGCTGCCGTCCGGGGCAATGACGGTGGTCGGTCACCGGCGGCGTTGTCGCCGCGTTTCATGGCGCCCTGCCGTGTCTTTCGACGATTAACTGTCCGCGGCTTTATCGTATGCCAGTACTGACTCAGCCCTTCCGCAGGTGCACCGTTACCTATTAAAGCAGTAGCGGACAACATGGAGTTATAACGGAACAGTCGAATGGGCCAGCGCAACTGCCGTAACGAACCACGTCATATGGTTTTCCGGCTGCGGTGGCATCTTCCGTTGCGCAAATTGAGAATCTTTCCCGTGGATTCTCTTTCGGTAGCAGGGTGTTCGCCGTCAAGGGCAGTTCCTGAATCAGGCGACCCCATTCGTATCAATTCCAGCGTATTTCCAGCCCGTCAGGCCCGGTAGCCCGACGTTAACTGGCTGGTGGTTATAGTAAAACGCCGATGCCCCTGCCATCCGTGGGCCGGTGTGAATGCGCGTGATGGGCCGATACATCCGGAATAGCCTTCTGTTGTCACGCCTGCGGCATCGTCTATGCCCTGGCCTACTGCAAAACAAACTGACTCTGCATTGACGCCCATCCCGCGTGTTCCTTTTCTGCACCGCTTCAGCCCGCCTTCGCGTGCGCAGGAACTGGCGGTTCAGGCTGTCGGTGATGGTGATGCAGGTCAGCTCTCATGCGGCCGATATTAACCGGCACTGCCGGGTTTTAGCTGTTCTGCCGCCATTCGCTGTCATTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCGCTCCGGCCGGTATTTATCATCGTAAGTAAAACTGCGCTGTATTGCTGCGGTCATACACGCCGCAGTTCGCCGCGGGGCGTCCAGCCATAGCGCACCAACTGGCGTGACGGGTAGAATTCTCCGGATATTCCGGGTCATGCGTCAGCCACGGCAGCGAACCGGGCTGGATGCCGTTAACGACCATATTCGGTGTAACCAGCAGGGTATCAGGGCGCCGGACGGTTCCGTCCGCCGGAAATGGCCTGCTGCCGGCTTCTTCTGCCCGCTGTGCCTGCGTGGTCCAGTACCAGCCGTGACGCGGCATATCCGTCACCAGTGTTTAGCCGCTGAATTCTGCGTTCGCGGTCGGAACGATATTGTGCTTTGCGAAGCGGTCCACCAACCGATTCAGTATTCCCGTGCGACGGCGCAGGCAGCACCTCATCAACCGACACCCGCTCACGCCAGCCGAGCAGCCACCACGGCCCTGCGGACTGTCGCCAGATAACGATGCGGACTTAAGCAGGTTCTTCCGGCAGCGCCTGGCAGAGTGCACGCGGCCAGCCGGTGACCGCTATCCAGTTTCGCCGCCGCCGCGCAGCCACAGTGACTCGCTGCGGCGCAACCGTCGCCGAAACAGATTGCGCTAATAAAGGCTTCTGCCGCCGCGTTGTCACTGAGTATCAGTGTGTTATCATACTGGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCAGGCCAGCGCGGGCGTTTTGTGCGGCACTGTAGTGCGGGAAGAATGTTGACAGCGGTAAGGGCAGGCGATGTCAGGTTTCACCGGAGGACCTTTGCACCGAGCGGCAGATTGACCGGATGGCCGGACGTCTTTGGCTGCGGGCACACCGAACCGAGCGCCGGTGGGGCACCGATGCATTACCCGGCTGAACCCTGTGGACAAATGCTACCCGCCATACTGCGATATGTCGCCTGTGCGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTATTCGGGTTGTTTGTCGCTTTGACGGTGAAACCCTGGGTTGTAAAGCAACAAGATGAGATATCTGTCAGATAGAACAATTGGAAAATGTTTACTGTATTTCATGAATATATGTTTCCGATTGGTATAACGATAAAATGTTCCTGCAGACATCTTCACAATGCACAAAAACCATGACGGCGTTTTCCGCTGGCGGTTTTCAATATTCAAAATCAACAATCAATAAAATCACCAGTTGCTGCTTTTCGGCCTGATCCATCCGCAGTTTATCGCTGGTTTTCGACCAGACGCGGAATGCCGTGGCACAAAGAAAGCGGGACGCAGTCTTTCCCAGAAAAGCATGAAAGGCAACCGGAACGCCCGCGCTGCGGGTTTATTTAAACAGACGCCGAAGACGAAGAAGAGGGGT
>c2ba4328-d217-4343-a959-874cf5addce4
TCGGTAATACTTCGTTCAGTTACGTATTGCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGCTTGGGTGTTTAACCTTGAGTGACGCCCGGCACCATCCGTCACGCCAGTGATTTCGCCGCTGAATTCACCAGCGGCTTCGCCATTCAGAACGTCTGGCATGCGCCCGAAGCGGTCCACCAACCAGTCAATTACCCGGTACGGCAGCGGCGGCGCAGGCAGCACCTCATCCTTCCGGCGCCCGCTCACCAGCCGAGCAGCCTGCAGCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCAGAAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCAACCGTCCTCACCGGGGAAACAGGTGCTCAAAATGCAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCCCTTGCAACTGGCGGATATCCACCAGGCATTTCCAGCCAGGCCAGGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAAGAGATGAACGGCAACGGGCCGGAGCAGGGAACTGATGTCGGTTTCACCAGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGTGGGCGTCACCCCCGCCAGGCACACCGAACAGGCCACGCCAGTGGGGCTTCGATGCGTACCCCGGCTGAACCCTGGACAATGCCGCACCGCCATACCGCGTCATGTCGCTGACGCACCGGTTTCCGCTCATCTGCTCATCCTTGTTTATCAGGTTGTTGTCTGCTGACAGGCGAAGGCCTACAAGATTTATAAAGAAAGCCTTAAGTGCCAGAGATATCTGTCAGATAAGAACAATTAGGAAAAGAAATATTTATGCTATATTTCATGAATATGTTTCGATTGGTATAACGATGTCTAATGTTCTCAGACATCTTCCTGATACGAAAACCGCCAGCGTTTCCGCGGCGGAACTGTATTCAAACTCGCTTAATCAATAAAATCGCAGTTGCCTTTTCGGCTGATCCATCCACACCGGTTTTATCTTTGGTTTTCGACCAGACGCAGTACGGAAGTGAAAGCTGTAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCGGCGCGCCAGGTGCCCGCTACCAACCGCATAAGTACGGCGTAAAAAGTAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCCCCTTTTGTATCTACCCGGTGGATGGCACCGGAAAAAATGGGATTTGTTTATCTGGTGAAAATAGTGCCTTTTGTGTATTTTACTACTCATCCGACCACTTATTTTGCTTATTGATGGTTTATTTATTCATCCTGTAATTAAGTTACACAAGGTTAAATTAATGCCGCAAACATTAGTTAAATCATGGCTTTTTGCCATTTTTATACTTTTTACACCCCGCCCGCAGATTTTGCCGAAATCTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTTAGGCCGCTGGAGGTGCTGTATGAGTGCAGGCGTGATAACCGGCATATTGCTGGTGTTTTTATTGCTGGGTTATCTGGTTTATGCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAGGGTTCTTACTGATCGCCACGTTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAACCGATACCACTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTCGCGCGCCGGCGTCTCTGACCGTAAGAGATGAACTGGAAACAATATCTTTATTCTCGGCACAGAACGACCAGGGCTGGCGGTGCTGTTTTATCGGCATTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTAGGATCTGGCGCTGAATACCGCCGTCAGCTTGTCACCAATACCAACTGGCAATCTTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGAACTTAACGGTGCAAAACCAACCTGCCGCCAGCGGGATTGCGGTGATTTTGCCTCATCATTGCGTTTACCCGCCAGAGCATGAGCACGGCTTCAGGGTCACCTGGGTCGATCTGCTCGCATCACGTTATGGGTGCTGGTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAAGGTGCGCTGCAAAACTTGTATCAGGCTGTGAATACCGTTGAAGGGCGCAGCAGCTGTTACCATGGGGCCTGCTTCTCGGGAAGCGGTCAAGATGCTCGGTACTTAACGGCGGTGGCTTCTTTAGTAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGAAGCCAACTTCGTGCGATGCTGGCGATCTTCATGATCCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCCATGTTGCTGTATGGGCGATGTCGGTGATTTTGTCATCTCTGCGTAGGCGTGGTGATGTGGGCCAGAAGTTCAGGGTAATCCTCATCTGTTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAAACCGTTTTCGGCGTGCTGGTCAGTAACCTGTTTGCGGTCGTAGCGACGGCGGCTTCCGCAATGGCGCGGTGATTGCGATGCATGTTCGTTTACCGCTCCTCGGTGGCATATTAGTGCCGATGCGGCTGATGCAGTGGTGAAGTGGTGTTCAGCGGTGTCGGTTCTGGTCTTTGGCATGATGCTGTTTTGTCCTGCGGCGGTGTTGTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAATCGACGTACGCGAAGACGAAACTGACTGCTGGCAATTCAGTTTGCCCCGACGCTGGTACTGATGGGCGCGACGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAGCAGCGGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGGCATTTTACTGGCGTTCTGCATGTTTGTCCAGTCGCTTCGGGGTGATTATCCCGGTGATAGCAATTGCCGATCGCTAAGGTGAGTAAAAAGGCAAACCGCCAGCTCCGGCACGCTGCTTAACCACGGCCCGCTGTTTGTTGGCCTGTTAATCAACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCTGCCCTGGCGCTTGGTCCGGTGGCGGTCTCTCTCTGATGATATTGAGTGAGCGCTGAATATGAGTCGTAGCAACTGGCGCTATTCGAACCAACACTTGTCGTTTCAGGCGCTGAAAGAAGCGGTGAAAAAATTGAAGCCCACCAGGCGCAATGGCACCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAACGGTGCGATGCCCGGCTGTCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCCGTACTGTTCGCTAATTTCTAGCCAGAGGCGCTGGCGAAGGCCGCGGTAAAGCGCAGGCCAACAGTCTGAAAGGGTGAAAAAAACTGCTTTGCCCGCAAGCTGCGTGAGCGAAATATGGCGCTGCGGCAGACCAAAGTTCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGTGCATCGGTCGATGCCAGCGCCATCACCGAGAATCAGCACCGGTGATCCGTGAATCGGCGGCGATTTTGCCTCCCGTCACCCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGGGTGTAGCGTTAACCCCGGCGAGACATTTCTGGATCGGATGAGTCTGCTGATGGTGGAAGGCGCACAGCGACGCAAACGCGAACAAAATTGCCCCGGCCATTCTGCTGATTGCCCCTGACTATCGCGTCTTTTTTACTGGCAGCCGCCACGCGCTGTATGCGTTTTCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTAGCTGCTGGTCTATGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCAGCGTCGCCGGGATGAGAGCCGGATGCTAGCAGGCGCGAAGTGTGGTGCCACCAGCGGACGATGCGGTTGAAGCGGCGAGTGGCGTTGACGTTCTGCTGCTGGATAAAACCAGCACCATCACACTCCGGTAACCGTCAGGCGTCGGGTTTATCCCCGCGCAGGGCGTGGATGAAAAAACGCTGGCTGACCTTACTGTAGCTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCGGTATTGTGATCCTCGCCAAACGGCGTTTTAACCTGCGCAGGCGCGATATTGCAGTCGCTCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAGCATCGACAACCGCATGATCCGTAAAAGGTTCTGTCGTGCCATTCGTCGCCATGTTAGGGCTAACGGTGGTCACTTCCCTACCGTGTTGATCAAAAAGTCGATCAGGTTGCGCGTCAGGGAGCCGCTTGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGCGGTAAGAGCGCTTCGCCTTTACTTAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCATGAAAGCGACACCGGAGGCCAAACTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTGGCGATGACCGGCGACGGCACCAACGATGCTCCGGCGCTGGCGCAGGCAGATGTCGCGGTAGCGATGAACTCCGGCACCCGGGCGGCGAAAGGCGGGCAATATGGTCGATCTCGACTCTAGCGACAAGTTGATCGAAAAGGTGGTGCACATTGGCAAACAGTGCTGATGACCCGGTGGCTCGCTGACCACCGGCATTGCCAACTTGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGCGTATCCACGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTTTGATTCCCCTGGCGTTAAAAGGCGTGGAGTTACAACCGCTTACCGCTTCTGCCATGTTGCCATGTATGGATTTACGGTCTGGGTGGAGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGTTTACCATGGTGGATTACGTCCGGCATTATCAGCATTTGTCTTTCTGTTATTGATTGCTGGCGGCGTTTACCCGCTACTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCAGGCAGAATTTTACCGGCAGCAGCTATTTTCATGGTCGCCCGTCGGCAACGCCGAAATGCCTATAATCCACAGGCTTCTGGCGGGAGCAATCTGGCGGTCAGTAACCACCAGGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTGGCGGATGCCGGCGCAGGCGTTCGGGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCCGCAAGCGGCGGCACAGCAAAATCCCACGCGTGGCGAAAGCGCATGTATCTCAGCGTTGAACAGCTCACACAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCAGCCAGCCAGTTTGTCAACATTGATGAACTCAATCTGGCGCTGGATAAACTTGATGAATAGCGAACCCTTACGTCCGGCCCCGATCGTCTGCTGGAGACAAACTGCACCGCGCCGCATCGGGAAGCTGAAAGTTTCTTCGGTGCCTGTGCAGGCGTCAGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCTGACTGGGAAGACTGGATATTGTGGTTGGCGTGGTAAAGGAAACCCACGGGCGAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGAGCGTACCGTGGGCACGGCATATCAGCGAGTTGATCTCGATGCCGCCCTCGCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACGGTAATAGCGCCCGGGTTCCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTTAGCGTCTGGAAAGTCTGAATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGGGAAACCGTGCCCGATCCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAAGAAGGCAAAGTCTATATTGCCGGAGCAGGCGGGCGCGCCATGAACATTTTTCATAAAGGTGAAATCCCAGTCGCCCCGCGCGAGTGGCACTGCGCCGTACTGCCGATCGCGTTGATGACAAATGCGCGCCTGGCGGGGGGCATCTGGCGAAGAGAAAGTGTAGCACACGCGACGCGATCGCTTTTATGCATCGGCCGCACCGGCGGCGAAAAACTGGTCGCGCGGGAGGCGCTATTAGCGTCACAGCTGGGTGGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCACCGCTACCGGAAAAAAACGTCAGACGTTCTCAGCGCCCGTCCTGGCGCAGGAACTGGGCGCGGAGACAGCAACACTTTCTGATCCAGCGGGAAGAGAAAGCGGTAAGTGCGTTATGCCCGTGAACATAAATCCTCAGCAAGATTATTCTCCGGTCGCCCGGCCTCGCGCCGCTGGTGGCGTCGAAACGTTTGCTGACCGACTGAAAAGCTTGCATCACTGATCTCGATCAAAGTGCTGGTCGCGCTTGATGAACCGCCCGCCCGCACGATTAATAACGCGCCGGATAACCGCTCTTTTAAAGACAAATTGGCGTGTACAAATTCAGGGATGCGTAGTTTGCCGCCGCGTTATGCGCCGTTATCACCTTACGTGCCATGCAGTGGCTGATGGCGTTGATGCCGCCAACCTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTTATGGACAGGTTAAACACCGGCAGACGCCGAAGATAGGCGACAGGCAAGTAGCAATACGTAACCG
>bbe44e2d-c0b1-4a30-997b-7a077a66c189
CCCCTCGGTATTGCTTCGTTCAGTTACGTATTGCGCTGCGCGCATAAACTCTATCTTCGGCGTCTGCTTGGGTGACAACCTCCGACGCCCAGCCCGGTTACCGAAGTGTGATGGTGCCGGTTTATCCAGTAGCAGAACGTCAACGTCTGCCGCTTCAGCTGCGTCCGCTGGTAGCGAATCACATTCGCGCCTAACATCCGGCTCCATCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGGATCAGACAGACCAGCAACGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCGATAAAAAGACGATAGTCAGGGCAATCCAGCCCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTTAGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGAGTGCCGGTTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCTTCAATAACTTCACCATCGCGGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTGGTTGGTCGGCGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGGCTTGCGGGCAAAAGGCGGTTTTACCTTTCCGGAACTGTTGGCCTGCGCTTGCGCCGCGGCACTTCTGCCAACGCCTCCACGGCGAAATTAGCAAGAACAGTACGGTGATCCACAGCCAACCGCTGTGGCCGCGCCTTAAACAGCGCATTGCCGGAGCATCGCACCTTTATCGCGATGCTAATACAGGTGGTCAACGGGCTGCCGATCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGCAGTTCATTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTTCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAATAACTTTGATTGCCGATTAACGGCCAACAAACAGCGGGCCGTGCGTTTGGCATGATACGAACTGGCGGCAATGCACCAGCAGACGGTTACCATCCGCAGGATAATCACCCAGAAGCGACCGACAAACATGCAGAACGCCAGTAAACGGTTCCAGAACGGAGGTGGCGCTTAATCCGGCAAAGCGCTGCCGTTGTTGTTAACCCGGCGGATGACACGGCGTACAACACCTCGCTAAAACCATGCAGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCACCAACGCCGCGCCCATCAGCACCAGCGTCGGGGCCTTAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTGCAGATGTTCGAATTGTACGACCAATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGGCAAGACCAAGGGCCGACACCGCCGAACACCACTTCACCCAATTTGCATCAGCCACATCGGCACCATGCACCGAGAGCAGTAAAACGAATCATGCATCACCCAATCACCGCGCCACAGGAAGCCGCCGTCATCACGACCGCAAACTGGGCTACTGACCAGCACGCTTGAAACAGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAAATCACTGATGACATCGCTACAGCAACATGCGCCCCTGGCGTGATCGTATCACTTCTGCAAAGGCAAAGCACAGCGCCGTTGGGATCAAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGCCGCCGTTAATTGCAGGCATCTTGATCGCTTCTGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCGAAAGAAGTTTTGCAGCGCACATTGTTGAATAAAAACAGTGCAATCAACAACGCCACGGGGACTAGCACCCATAACGTGATGCGTAGCCAGATCGACCAGGCATTCCCGAAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGGCAAAAATCACCGCAATCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAAGCCGCCATCTGGCTGGAAATGGCTCAACGTGAACTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGGTAAAGCTGACGGCGGTATTCAGCGCCAGATCACGACAGCTGGCAGCTGCTGGATTAAGCGGCGGATAGTGCTGACCGAGCAACGCAAAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGGGGAATAGCACAAAAGATATTGCTTCCAGTTCATCTTACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTATTGCCGGGAAGAGAATGTCATTAATCAACCGCGCCAACCCGCTGCCTAAGGACGCGCCAGCACCATTAACACCAGTAAAGCAATGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGGAACGCCTCCGCATTGATCAGGGGCATAAACCAGATAACCCAGTAATAAAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCAGTGGCCTAAAAGAAGTGATACCGGAAGGGGTAAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAGTATAAAATGGCAAAGCCATGATTTAACTAATGTTTGAAGTATTAATTTAACTTTTGTGTAGCAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAATAGAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCGGTGCCATTCACCGGGTAGATACAAGGGAGAAAAGTATGGAACTCTACAGAGGAATATCGCCAAGCAAACTATCTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTGCAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAAGGCGACTGGTGATTTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTTCTCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGCGAAACGCCATGAAATATATAAATATTTTCCTAATTGATTTCTTATCTGACGGAATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACTCGATAAAACAAGGATGAGCAGATGAGCGGAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCGTCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCCACCGGCGTGGCCTGATCGGTGTGCCCCGGCGGGGTGACGTCAGCCATCCGTCAATCAACTCAGTGCAAAGGGTCCTTCCCGAGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCATTCATTCTCCGCACCTACAGCAGTTACCGGACAAAAACGCCCGCGCCGGTGGGGCCTCGGCTTCGGCTGAAAATGCCTGCGAGATATCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAAAGCCTGTACTGACACCTAACGTGAGGACGGTTACGGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGCGTGGCGAAGAACTGGATGAAAGGTCACCAGCTGGCCGCGCTCTGAGCGCTGCCGGAAAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGTGGTGTGAGCGGGTGCCGGAAGCGGATGAAGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCCGGGCGCACACAGACGTTCAAAGAAACGCCGGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGGCGTCACTCCGGCTGGTACTGACCACGCAGGCGCAGCGGCAGAAGCCCGGCAACAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCTGTTCTACCGGGTTACACCGAATATGGCCGGAACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCAGCGGTGTATGATACAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCACCGTTACGACAGCGACGGGCGGGTGACGAACAACTAAACCGGCAGGCTTAGTTACGCGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCATACTTACGCAAGGGTAGAAGGCAGGCTGAAGCGGGTGATGAAAGGAACACGCGGACGGCAGCGTCACGCAGAGGAATCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCGCAGGCAGGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCGCGCGCATCCGCCGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGAACCAGGCTCGCCGGGAATATGATGAATGGGGCCGTCTGATTCGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCGGCAGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCATGACTGTTCCGGTTATGTAACCCGCTATGGCCGTAACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGCTGAGTCAGTACCGCGCCACGACAGCCGTGGACAGTTAATTGCCGTGAGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACAGGTTAAACACCGGCAGACTCCGCAATATCAGCGTAG
>b070b35d-1771-4ec6-9fde-9d52b973d2d5
TTGTTGGCACTTCGTTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTGGGTGTTAACCTAACCAGGCTGCAAGCCAGCACGCCGACAGCTCTTACCTTCCATATTGATGCTGCTGTCATTGCCCAGTGCCAGCAGATGAGGATTCACCCTGAACTTCGCATCACCACGCCTACGCAGATGACAAATCACTGACATCGCCCACAGCAACGCGTACGCCCCTGGCGTGATCGCCCATCTACTTCACCAAAATGCGAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATCAAAGAAGCCACCGCCGTTAGTACCAAGCATCTTGATCGCTTCCTGGCTACAGGCCCCACATAGGTACTTTAGCTATTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAAGGCCAGAAAAGTTTCGCAGCCGCACGCTTGTTGAATAAAAAACGGTGTGCAATCAACAACGCCACAGGACTAGCACCCTTAACGTGATGCGTAGCAGATCATTGAGCATTCCAGGCGTGCTCTGGCGGGTAAACTGCCACGGATGAGGCAAAATGCCGCAATCCCGCTGGCGGCAGAAGAAAGGATTTTACCGTTAAGCCCGCCATCTGGCAAATAGCTCAACGTGGTTTCACCGCTATAAGGTGCCAGTTGGTATTGGTATTAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCTGGCAGCTGCTGTGGATGGCGGCGAATGGTGCTGACCGAGCAACGTAAAAAGCAGCACCGCCAGCTGGCATGTTCGGGCAGAATGGCACAGATATTGCTTCCAGTTCATCTCACGGTCAGGACGCCAGTGCGCGAAGAAATTGCGCGCTCAACGCCCGTTGTACCGGGAAGGAGGAATGTCGGTAATCAGCGCATAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAATGCAGGCCTTGCGCAGCCATCAGAACCGCCTCCCGCATTGATCAGGGCATAAGCCAGATATTGATAATAAAAACACCAGCAATACGCCGGTTATCACGCCTGCCTCTGAGTGCACTCAATTAGCCTAAAAGTGATACCGGAAGGGTAGAATTCAAACACCAAGATTTCGCAAAAATCTGCGGGCGAAGTGTAAAAAGTATAAAATGGCAAAGCCGCGGTTTAACTAATGTTTGGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAAATAAACCATCAATAAGCAAAAATAAGTGGTCCGGATGAGTAGTAAAATTACACAAAAAGGCGGTGGCTTTTTCATCAGATAAACAAATTCGTTGCCGGTGCCATTCACCGGTAGATAAAGGGGAGAAAATATGGAACTCTACAGAGAATATCTGCACCGACATCTTTTTCGCCGTACTTATGCAGTTGCAGCGGGCGTTCTGGCGCTGCGCTTTCATGCTTTTCTGGAAAGACCGCCCGCTTTACAGCTACCCATCGCGCGTCACGAATAAAAGAAAACCGCTGATAAACCGGTGACGGATGGATCAGGCCGAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGGGCCGGGCGAAAGCCGCCAGCGGAAACGCTGGCGGTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTGTTGCTCCCGTTATGCCAATCGAAACATATATTCATGAAATGTATATAAATGTTACCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCCATGGGGTTTCGCCTGTCGGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACGCGCGGCGCCTCAGTATGGCGATAGCATTATTCAGGGTTCAGCCGGGGTACGCATCAGTGCCCCCACCAGCCGTGGCCTGTTCGAATTGACCGCTGGCAAGTGTGACATCCGGCCATCCGGTCAAATCCGCTGCTTTCGGTGCAAAGGTCCTTCGGTGAAATACGGCATCGCCCTGCCCGGCCCGCTGCGTTCATTCTCTCCGCACCTGGCAGTTACACCGGACAAAAACGCGCGCCGGTGGGGAGCCTCGGCTCCAGCTGGAAAAATGCACGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACAGCGGCAAACGCAATATTTTGAGCACCCTGTTTCCGGTGAGGACGGTTACAGCCAGCGCGTCCTGCTGTGGCTGGTGCGCGGCGTGGCGAAACTGGATGAGTCTGGCTTTATTTTATCGGCAGGCGCTGCCGGAAGAACTCCACTTAAGTCGCATCGTTATCTGGCGACCGACAGTCCGCAGGGGCTGGTGGCTGCTCCGGCTGGTGTGAGCAGATTGCCGGAAGCGGATGGTGCTGCCTGCGCCCACTGCCGTACCAGGTACTGACCGGGCTGGTGGACGCTTCAGGCTGGGCGTTTGTTCCACCATAAAGCCACCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCAGAGCGTCTTTTCAGCTGGTACCCCACGACCCGCGCAGGCGCAGCGGGCGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGGACGGAACCGTCCGCTTTCCTGATACCCTGCGGGTTACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCGCACGACCGGAATACGGAAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAACAATACACAGGTGCGCAGCTTTACTTACGATGATAATGCCGGGCCGGATGGTGGCGCACCGTCACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCAGTTACGCATCGGTATGGAAAGGACCGCATCACCATCACCGACAGCCTGAGCCGCCGTGAGAGTCCTGCACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAAGGAACACGCGGACGGCAGCGTAAACGAAGTCAGTTTGACGCGGTGGGCGGGCTCGGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCGGATAATGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATTGGCATTTTATATAACCACCACAGCCAGTTAACGTCGGCCACCGGGCCTGACGGCGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAAACTGCCCTGACGGCGATATCACCCGCTACCGTTATGATATCCACACGGTAACACCCTGCGCAACGGAAGTGCCACCGGCGGCGGGAAAACCATGACGTGGAACCGTTACGGTCAATTCTGAGCTTCACCGACTGTTCCGGTTGTAAACCCGCTATGACCATGATACGTTTTGGTCAGGTGACGGTGCACCGCGAGGAAGGGGCTGGTCAGTACCGCGCATACGACAGCCGTGGACGGTTAATTGCCGCTGAAGAAAGACACGCAGGGGGCCATGAGCATGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCGGACAGCCCTTGAAACGGGACAATTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATGCGATGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAACGGCAGCCACCACCTTCCGTTACGATGTACTCGACCGGCTGATGCAAGAGTCGGCTTTGACGGCGCACACAGCGTTATCACCGACCTGACCGGCAAACTTATCCGCAGCGGGGATGAGGGCTGGTCACCCACTAACTATGACGAAGCAGACCGCCTCACGCACCGCTGCATGAATGGCGAAACCGCAGAGCGGTGGCAGAGTATGACGAACGCGGCGCTGGCTGACGGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCGCTATGGTATGACAGTAAAGGCGCCTCGCCCGGTGAGCACCTGACCGGTGCATCATCACCAGGCAGAATGAACTGCTCTGGCAGCGCCAAAGGGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAACCTGCCCGCCGTGGAATGGCTGACCTACGGCGGCTGGCTCAGGCATGAAACTCGGCGACACACCGCTGGTGGGTACACCCGCGACCGCCTGCACCGAAACGCTGCGCAGCTTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCGGGTGATTTACAGAACCAGCACCTGAACAGCTGCTGTCTGACCACCCGATTACACCTGGAACGGTAACGGCGAACTCATCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCATCCGTATACACAGACCAGCAGGTAACCGCCTGCCCGACCGGAGCACACCCGGACAGCGCCCTCAGCGTAATGGCCGGATAACCATTATCGCCGTGACGCGCACTATCTTTACCGGTATGACCGTCGGCAGGCTAATGAGAAAACCGACCTCATCCCGGAAGGGGTTATCCGCACGGATGATGGGCGCACCACCGGTACCATTACGACAGTCAGCACCGGCTGGTACCACGCGGACACAATATGCAGAGCCGCTGGTCGAAGTCGCTATCTTTACGACCCGCTGGGCCTGGTGGCAAAACAGGTATGGCGGCGTGAACGGGACCACAAACCGGGCTGGATGTCGCTGTCTGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCTGACCACGATACCAGAACGACAGAACCCGCATCAGACCCGATTTATCAGCGGGGGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAACCTGGATACCTTCAGCAGTCCGGTGGCGAAGACGGGGTGGCGGTGTGGTGTTCCGCCGGTGCTGGTTGCAGATGTCGACCGGCTGGAAGTGAAATCCTGGCTGACCGGGTGGTAAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCGAGATCACCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGGCACTGCGACCATCGCGGCCTGCCGCTGGCCATATCAACACGGAAGGGGACAACAGCGTGGTACGCAGAATACGATGAAGGTTAAACACCCAAGCAGACGCCGCAATATCACGGCA
>29fcf315-e502-472c-8e1f-80e65e5b4972
GGTATACGCCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTAGCTGCGCAGCGTTTTCCCAGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGACGGCCAGCCGCTGCCGTAGGTCAGCCATTCCGGCAGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTATTCACTGGCAGGCGGCCTTTACTGTCACCAACCATGGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCCAGCCAGCCGCGTTCGATCATACTGCCACCGCTCTGCGGTTTCGCCGACTCACGGTGCGGTGCGTGAGGGCGGTCTGCTTCGTCGCCAGTGCCCGGTGGTGATGGCCTCATCCTCGCTGCGGATAAAGTTTGCCCGGGTCAGGTCGTGGTGATAACGCTGTATTGTGCGGCCGTCAAAGAAGCCGGTTTCCTGTATCAGCCGGTCAGGTACATCGTAACGGAGGTGGTGTGGCTGCCGTTTTCTGGTCAGGCGGATGACCCGTCCGGCATCATTATTCCATACTGCGCATCAGACCGCCTGCGTGGTACAGATCAGCTTTCCCCGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGCTGATCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCTGGCAATTAACTGTCCACGGCTGTCATATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATGGCAGGTTACATAACCGGGAACAGTCAGTGGCTCAGCAGCTATTGTAACGATACACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATAACATCGCCGTCAGGGGCGGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCATGGTGGTTACTGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCGCCTTCACCCTGCGTGCGCAGGACTTTACGGCGGTTCAGGCTGTCGGTGGTGGTGATGCAGTCCTTCTCATACTGATACGTTAACCAAGCCTGCCGGGTTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCGGTCGGCCGTGTGACAGTGCGCCACCATCAGCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGATTCATACACCGCCGCCAGTTCGCCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTTAATACACGGCAGACAGACGGATGCCGTCGGCCGTATTCGGTGTAACCCGGCGGGGTATCAGGAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCGATTACCAGCCAGGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGGACGATCTGTGTGCGCCAGGCGGTCCACCAACCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCACCAGATAACGATGCGGACAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCGGATTTCGCCACGCCGCCGCGCGCCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGGAAACGGAATTGCTCAAAATGCAGGCTTCTGCCGCCGTTATCACTGGTATCAGTGTGTTATCGCGCAGCTGTAAGCCGGATATCCGCAGGCATTTTCAGCCGGGGCCGAGGCTCCCCACCGGCGCAGGCGTTTTTGTCGGTAACTGCTGTGGGTGCGGGAGAATGAACGGCAGCGGGCCGAACGCGGGGCGATCGGTTTTCACCAGGAAGGACCCTTTACCGAGCAGCGGATTGACCCGGATGGCCCGGACGTCACCCGCCGGGGCACACCGAACAGGCCGCCGGTGGGGCACCGATGCGTACGGCTGAACCCTGGACAATGCTACCGCCATGCTGCGTCATGTCGCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAAGAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTATAGAATATTTATATATTTCATGAATATATGTTTTCCGATTAGTATAACGATGTCTAAAATATTCTCTGTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTCATTCAAAATCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTTTGATCATACACACCGGTTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATGAAGTGCGGCGTAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATGCTTTTCTCCCCTTTTGTATCTGCGATTATGAATGGCACCGGAAAAATGAATTGTTTATCTGATGAAAATGAGCACCGCCTTTTATTGTAATTTTACTGCTCATCCGACCATATTTTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTATGAATTAAGTTACACAAAAAGTTAAATTAGTACTAAACATTAGTTAAATCGGCTTTTGCCATTTTTATACTTTTACACACCCCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAAATTCTACCCTTCGGTATCGCGCAGGCCACTGGAGGTGCCACTGTGGAGTGCAGGCGTAACAACCGGCATATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCTGATCAATGCGGAGGCATTCTGATGGCTGCGCAAAGGGTTCTTACTGATCGCCACGTTTTTACTGTGGTGTTAATGTGGTGCTGGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCATGCTTTTTCGCGCACTTGGCGTCGTCTCTGACCGTGGGATGAACTGGAAACCCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATATTTGCTCGGTCTTTATCTGCCGCTTAATCCACAGCAGTTACCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTAATTTCTTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACACTGTCACGTTATGGGTGCTAGTCCTGTGGCGTTGTTGATTGCACTGTTTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCGGGCTGTGAATACCGTTGAAGGAGCGCAACGGCTGTTATTACCCGCGTGGGGCCTGTAGCTTCTCAGGAAGCGGTCAAGATGCTCGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCACGCTATTAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGATGGGCGATCGCCGCCAGGGGCACCATGTTGCTGTGGGCGATGTCAGTGATTTTTGTCATCTGCGTAGGCGTGGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGAATTAAAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCCATGATTGATTGCGATGCATGATTCGTTTACCGCTCTCAGTGGCATGGTGCCGATGTGGCTGATGCAAGTGGTGAAGTGGTGTTCGGCAGTGTCGGTTCTGGTCTTTACGGCGCGTGCTGTTTGTCCTGCTGGCGGTGTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAAAATCGACGTACGCGGATGAAACTGACTGCGCAGCAATTCTGGATTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGTGCTCAACCTAGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCACCGTATTAATCCGCCATGCTGCTTAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACATTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACCCCGCTTTCTGCCAACACGGCCCGCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACTATCCCTGCCCTGGCGCTTGGTCGGTGGCGGAATATCTCTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAAGAAGCAACTGGCGCTATTCGAACCAGCACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAACGGTGCGATGCCCGGCACAATGCGCTGTTTAAGCGCGGCCATTATGATTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGACCCAACAGTCTGAAGGGGTGAAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGAACAAAGTTCCGCAACGACCAACTTCGTAAAGGCGATATCGTACTGGTAAACTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGGAAGGGGTGCATCGGTCGATAAGCGCCATCACCGGGGAATCGGCACCGGTGATCAAGTGAATCCGGCGGCGTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGGTGTGGCGTTAACTGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGAAGCACAGCGACGCAAAACGCCGAGCAAATTGCCCTGATAATTCTGCTGATTGCCCTGACTATCGTCTTTTTACTGGCAACCGCCACGCTGTATGCGTTTTCGCGTGGGGCGGTAATGCAGTCAACGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATAGACCGGATGCTAGGCGCGATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACGCTCGGTAACCGTCAGGCGTCGGAGTTTATCCCGCGCAGGGCGTGGATGAAAAAAACGCTGGCTGACGCCGCACAACTGGCAACTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCTCGCCAGCAGCGTTTTAACCTGCGCGAGCGCGATGTTACCGTCGCTCCATACGCTTTGTACCGTTTACTGCGCAAAGCCGGATAAGGCAGGATCAACATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCCCTTAATGTTGAGACTGGTGGTCACTTCCCCGTGTTGATCAAAAGTCGATCAGGTTGCGCGTCAGGGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGTATTAGAGAGCGCTTCGCCCAGCTGCGCAAAGGTTAAACACCCAAGCGAACGCCGAAGATAAAGAAGTG
>baeacbab-db71-4be4-a4ac-c2fe5e26570d
TTGTTATTGCTTCGTTCCAGTTACGTATTGCTGCCTGTCGCTCTATCTTCGGCGTCTGCTTAACGTTATTTAACCTCAGGTGTAATCGCAGAGTCGAACAGGCACAGGCCGGGTGCTGGCTCTGCTTTGCCCGGCAGGGAGTATGGCGGTGATGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGTGCAGGCGGTCATGGTGTCCTCCACCAGCGGGCATATCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCGCCATTCACAGCAGGCAGAGGCTGTCCGGTATACGGCAGTTCTCCAGTCCCTGTGCTGCGTTATGCGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCGTTCGTCTGCAGGATGATGATGCCACCGTCAGCAGGTGTTCACTGTAGAAACGGCCTTTGCATGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCCTTCTGCAGTTTCGCCATTCACGTTGCGTTTTGAGGCGGTCTGCTTCGTCATAGTGGAGCGACCCGGCCCTCATCCTCTGCGGGTTAAGTTTGCCGGTCGGGTCGTGGTGATAACGGCCGTCAAAGCCGGTTTCACCAACATCAGCCGGTCGAATTACGCTCGTAACGGAAGGTGGTGGCTGCCATTTTTCACTGGTCAGGCGGATGACCAAATCCGGCAGCATCATTCCATACTGCGCGTCAGACCGCCCTGCCGTGATACGAATGGCTTTCCCCGCATCGTACTGTGTCCGTTTGCTGCCGTCGGGGAATGGCGTGACGGTGGTCAGGTCCTGGCGGCGTTGTATTCATACCGCGTTTTTCATGGCCCTGCGTTATCTTCCGGCAGTGCTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCTGCCGTCACCTGACAAACGGTCATGGTCATAGCGGGTTACATAAGCAGGAACGATCGGTGAAGCTCGGCAACTGACCGTAACGGCTCCGATCGCGGTTTTCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGGTGATATCGCCGGTATCGGGGGCAATTTCCGTCAGACGGCCCCATTCATCATATTCCCGGCGTATTTTCCAGCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATACTGCCATCCGGCGTGGTGATGCGCGTAGTGGGCCGTCACCACATCCGGACTGTATTCTGTTGTCATACCTGCGGCATCCGTCTGTGCCCTAGAGCCTTACCGCGTCAACTGACTCTGCGTGGCTGCCCGTCCGCGTGTTCCTTTTTCACCACCTGGCCCGCCTTCACCCTGCCGTGTTGTGCAGGCTTCACGGCAGTTCAGGCTGCATCGGTGATGGTGATGCAGTTCCTTCTCATACTGATACGTGTAACCGTACTGCCGGGTTTAGCTGTTTCTGTCACCCGCCCGTCTTTGTCGTAACGGTAACAGATTTCCGGTCGGCCCATGTGACGGTTACGCCACCATCCGGCTTGGTATTTGTATCTATCGTAAGTAAAGCTGCGCACCTGTATTGCTGGTCGCCACCGCCGCCAGTTCCGCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCGGGTAAATTCTCCGGTATTCCGGGTCGTGCGTCGGCCACGCCTGAACCAGACGGATGCCGTTGTCCCGGCATATTCCGGTGTAACCGGCAGGGTATCTGGGAAAAGCGGACGGTTTCCGTCCGCCGGAAATATTACTGCTGCCGGGCTTCTTCCTGCCCGCTGCCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCGCATGCCGGTGTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTATTGCGCCGAAGCGGTTCCAGCCGATCCCTGAGTACCAGGGTACGGCGGCAGCGGCGCAGGCAGCACCTCGTATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGACTACGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTGCGGCAGCGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCCGCGCACCAGCCACAGTGACTCATGCGTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGGTATCAATTAATGGTATCATGCAGCTGTAAGCCCGGATATCCCGCAGGCATTTTCCAGCCGGGGCCGTCCCCACCGGCGCGGGCGTTTTGTCCGATGGCACTGCTGTGGTGCGGGAGATGAACGGCAACCGGGCCGGGCGGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACTGAGCAGCAGTTGACCCGGATGGCCGGACGTCACCCGCCGGGGCACCACCGAACAATTACGCCGGTAGCAGGGAATACCGATGCGTACCCCGGGCTGAACCCTGTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGGCGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTTATTTGATGCCTTTGACGGGCGAGCCTGGATTTATAGAGAAATAGCCAGGGTGGCGGGATATCTGTCGGATAAGAACAATTAGGAAAATATTTATATATATTTCCATGAATATATGTTTCGGTGGTATAACGATACAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCACTGGCGGTTTCAATGTAAAAACTCAGCAATCAATAAAAATCCCCGCCGGTTACCTTTTCGGCCTGATCAAATACACCGGTTTATCGCTGGTTTCGACCAGACGCGATGCAGGTAGCTGTAAAGCGGGCGCGAGTCTTTCCAGAAAAGCATGAAACTGGCGCCAGAACGCCGCTGCAACCGCATAAGTGCAGCGTAAAGATAAGCCAGCTGGGGATATTCTCTGTAAGGTTCATACTTTTCCCCTTTTTTATCTGCCGGTGAATGGCACCGGAAAAATGAATTTGTTTATCTGATGAAGAAATGGTACTTACTTTTGTGTGATTTTTACTACTCGGCTCGACCACTTATTTTTGCTTATTGATGGTTTATTTGCATTCATCCTGTAATTAAGTTACACAAAGTTAAATTAATACTAAACATTAAGTTAAATCATGGCTTTTTTGCCATTTTTATACTTTTACCGCCCGCAGATTTTGCGAAATCTTTACGTAGAATTCTACCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAAGGCGGCGATAACCGGCGTATTGCTGGTGTTTTTTAATACTGGGTTATCTGGTTTATGCCTGATCAATGCGGAGGCGTTCTGATGAAACGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGAAAGCGCGTCCTTTAGGCGGCAGGCTGGCGCAGTTAATGACATTCCTCTTCCGGTACAGCGGGCGTTGAGCGCGTACTTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGCGTTAATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATCATGTTGCTCGGTCGGCACTATCACAGCAGCAATCCACAGCCAGTTGCCAGAATTTTGTCGTGGGATCTGGCGCTGAATGCCGTCAGCTTTGTCGCAATACCAACTGGCAATCTCCTGGCGGTGAAACCACGTTGACTATTTCAGCCAGATGGCGGGCTTAACGGTACAAAACTTTCTTTCTGCCGCCAGCGGGGTTGCGGTGATTTTTGCCCTCATCCGTGCGTTTTACCCGCCAGAGCATGACGCGCTCGAGGAATCTCTCAGGTCGATCTGCTACGCGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCCAACAGGTGCGCTGCAAACTTTCTGCCCATCGGGCTGTGAATTGCCGTTGAAGAGCGCAACAGCTGTTACCATAGAGACTATTCTCAGGAAGCGATCAAGATCTTTCAGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCTTAACCGCACTGACCAACTTCAAAATTACGGGTACTGGCGATCTTCTTGATCCCAACGGCGCTGCGCTTTGCCTTCTTGGTGAAGTGATGGGCGATCCGCCGCCAGGGCGCATGTTAATGTGGGCGATGTCGGTGATTTTGTGTCATCTACGTAGGCGTGGTGATGTGGGCGAAGTTCGGTAATCCTCATCTACTGGCACTGGGCTGGACAGCAGCATCAATATGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAACCTGTTTGCGGTCGTGACGGCGGCTTCCTGTGGCAGTGATTGCGTGCATGATTCGTTACCTCGGTGGCATGGTGCCGATGTGGCTGATCACAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCACGGTCTTTACGGCATGATGTTTGTCCGCTGGCGGTGTTTAATGCCGGGCGATGGTGGTCCGTACACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATAAAACTGACTGCACTGGCGAATTTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGACTGATGACGCCGGACGTAGCGCCATCTCGCCTAGCCCACATGGTTTAGCGAAGTGCTGTAGCCGCCGTGTCATCCGCCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTGGGTGATTATCCCGGTGATGGCGGTGCCGGTTCGCTGGTGAAATAAAAAGAGCCAAACCGCCAGCTCCGGCACGCCAGCAACGCACGGCCCGCTGTTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTTGGCGCACTGACTATCCCTGCCCTGGCGCTTGGTCGGTGGCGGAATATCTCTGATGATATTGGTGAGCACTGAATATAGTCATAAACAGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAAGCGGTGCGATGCGGCAATGCCCCAGCGCGAGCCATTGTAGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGCTGGCCAGAAGGCCGCAGTAAAGCGCAGGCCAACGATGCAAAGGGTGAAAAAACTGCGCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGATGAAGTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTGTTAGAAGCTGGCGATATTATCCCTGCGATGGTGCGAAGTTATTGAAGGTTAAACACCCAGCAGACGCCGAAGATAGAGCGACAGGCAAGTAGCAATACGTAACGCGGG
>7f343574-f2bc-4388-91b9-84b99e39256a
TTGGTATGCGCTTCGTTCCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTTCTGTCAGATGAACAATTAGGAAAATATTTATATATATATTTCACATGAATATATGTTTCGTTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCACGATACAAAAAACCGCCAGCGTTTCCTTTAGCTGGTTTTCAATCAAAACTCAGCAATCAATAAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATACTGCGAATAATATGCGTCAGTATCTATGATTATTATCGATAAAATAGATACCATATCGCTTTTGTGTAATTTTACTACTCATCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCCTGTAATTAAGTTACACAAAAAGTTAAATTAATACTAAACGTGGATTAAATCATGGCTTTTGCCATTTTATACTTTTACACCGCCCGCAGATTTTTGCGAAATCTTTGCAGCAGAATTCTACCTTCCGGTATCACTTTTAGGCCTGGAAGTTACACTGTGAGTAGGCGCTGAAGTAACCGACGTATTGCTGGTGTTTTTATTACTGGGGTTATCTGGTTTATGCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTAATGGTGCTGGCGCGTCGCTTTGGGCAGCGGGCTGGCGCTGACTGATTAATGACATTCTCTTCCCGGTACAGCGGGCGTTGAAGGCGCGTACTTTTCGCGCACTTGGCGTCTTCTGACCGTGAGATGAAACTGGAAGCAATATCTTTGCCATTTCTCGGCCTGAACATACTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATGGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGATTGCAAAACTTTTCTTCCTGCCGCCAGCGGGATTGCGGTGATTTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATATGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAGGTGCGCTGCAAAACTTTCTGCCTTATCGAACTGTGAATGCCGTTGGAAGGGCGCAACAGCTTTCAGTACCCATGGGGCCTGTAGCTTCTCGGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCAACCGCACTGACCAACTTCGTGCGGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGCGCATGTTGCTATTAGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACGGCAACATCAATATGGAAGGTAAAGGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCATGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATATGGCTGATGCAAATTGGTGAAGTAATGGTGTTCGGCGAAGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTATTGCCGGAGCTGATGATTGGTCATTTTACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAACAATTCTGATTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTGCAGCGAAGTGCTGTACGCCGTGTCGCCGCTGCTAACAACGGCAGCGCCTTTGCCGGATTAACGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGTGATTATCCCGGTGATGTAATTGCCGGTTCGCTGGTGAGTATTAAAAGAGCAAACCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGGTAATCGGCACCGTGTTGCTGGATTTGGCGCACTGACCTTTATCCTGCCCTGGCGCGGTCGGTGGCGGAATATCTCCCTGATGATATTGGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAGGCAGCACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCAGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCTGTGAGGCGCTGGCGAAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGGTGAAAACCGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCATGCGGCGGACAAAGTTCCTGCCAAACCAACTTCGTAAAAGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTGATGAAGTTGCATCGGTCGATAAGCGCCATCACCACCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCAGCGATTTTGCCTCCGTCACCGGCAGCGCGTATTCTTTCTGACTGGCTGGTGATTGGTGTAGCGTTAACCCGGGCTTGAACCCATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACAATTGCCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGATGAGGCGATATTGCAGTCAGCAGCTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATAAGCGTCGCCGGAATGGAACCGGATGCTAGGCGCGAATGTGATTGCCACCAACGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCGGGCGTCGGAGTTTATCCCCGCGCGGGGCGTGGATGAAAAACGCTGGCTGACGCCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTATGATCCTCTGAAGCAGCGTTTTAACCTGCGCGGCGCGATGCAGTCGCTCCATGCCACCTTTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCATGATCCGTAAAAGGTTCGCCGATGCCATTCGTCGCCATGTTAGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAGTCCAGTCAGGTTGCGCGTCGAGGCCACGCCGCTGGTAATTGGTGGAAGGTTCTCGTGTGCTGGGCGTTGTTATTGCGCTGAAGATATCGTCAAAGGCGGTATTAAGAGCGCTTCGCCCAGCTGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCACCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTTCTCGCCGAGCGACACCGGAGGCCAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCGCTGGCGCAGGCAAGATCGCGGTGGCGATGAACTCCGGCACCCAGGCGGCGAAAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACGGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAACGTACCAACGATGTGGCGAAATACTTCGCCATTATTCCGGCAGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACGCGCTTGATTATCGTCTTTGATTCCCCTGGCGTTAAAGGCGTGGGTTATGAGAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTGGGCTCAACGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGGTTTACCATGAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCTATTTATTGATTACTGGCGGCGTTTACCCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCGGGCAGAATTTTACCGGCAGCTATTTTCATAGTCGCCCGTCGGCAACGGCAAAATGCCTATAATCCACAGGCTTCTGGCGGGAGCAATCCTGGCAGTCCAGTAACCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCAGGCATTCCAGATTCAAGACTGTTGGCATCGGCAAGCGGGCTGGACAATAATATCACCCCGCAAGCGGCGGCCTGGCAAATCCACGCGTGGCGAAAGCGCGTAATCTCAGCGTTGAACAGCTCCGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCAGCCAGCCGGTTGTCAGTGATGAACTCAATCTGGCGCTGGATAAACGATGAATAGCAGACCGCCCGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGGGGAAGCTGAAAAGTTTTCTTCGGTGCCTGTGCAGGCGTCAGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCAGGCGCAAGGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCACGGGCGAAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGGGGTTTGATCGATGCCGCCCTCGCCCGCCGCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTAATGCGCCAGGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAACGCTGGAAGCTGGCATTGATGTTTCACTACCGTTAGCGTTCAGCATCTGGAAAGTCTGAATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGGGAAACCGTGCCCGATCCTTTTTCGATACCGCCGACGCGACGTGGTGCTGGTGGACTTGCCCCCGGACGATCTGCGCCAGCGGCTGGAAAAGAAGGCAAAGTCTATATTGCCGGGCGGGCGGGTGCGCCATTGAACATTTTCCGCAAAGGCTGTCAGTCGCCCTGCGCAGACGCTGGCACTGCGCCATACTGCCGATCGCGTTGATGAGCAAATGCGCCTGGCGGGGCATCCTGGCGAAGAGAAAGTGGCACACGACGCGATCGCTTTTATGCATCGGCCATAACACCGGCAGCGAAAACTGGTCGCGCAGCTGGCTAGCGTCACGGCTGGGTAGCGTCTCTCACAGCACGCAGTGTATGTTAGAAACTGCCCTGCACCTTTACCGGAAAAAAACGTCGGGCAATTCTGGCGCCTTACCATTCTGGCGCAGGAACTGGAAGCGCGGAGACGGCAACACTTTTCTGATCCAGCGGAAGAGAAAGCGGTAGTGCGTTATGCCCGTGGAGCATAATCTCGGCAGATTATTCTCCCGAGTCGCCCGGCCTCGCGCCGCTGGTGGCGATCGGGAAACGTTTGCTGACCGACTGGCGCGCGCATCACGCCCCCGATCTCGATCAGGTGCTGGTCGCATGATGAACCACCCTTACACGATTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAAATTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTTGTGCGCCGTTATCACCTTAATCGCCATGCAGTGGCTGATGGCGTTTTGATGCCGCCAACCTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTTATGGACAGCGCTGGCCTTCGGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATCTCTTTTTTATCGCCCCACGCGGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCGGGAACCTTACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCGAGCAACGCACGGCACTTATGAAATGTCAGCTCAGGCGGTGGGCCGCAGTCCGCAGGATATCGCTGCCACCAGCGAACATTTATTGCCTCCACGTTTTCATGCCCGCAGTCAGGGTGTTGTTGCCCGATGACGGCGGTAAGTGCAGCCGTTAACACATCGCAAGGAATGACGCCGTGGGACGATGCCATCGCGCGGTGGAGTTTTGATAAAGGCCTGCTGCGGGCGCGGGGGCACCGACACGTTACCCGTTATTGCCGTACCGAGATTTTGCCGCTAAAAGCGTGAAGAACTCGGGCTGGTGGTGGTGGGCAAGGGGGAATCCTGCGCCAGTTGATGATCCCGGAACAGCAGCGCCTGCTGGAACGTTACGCTGTTAGTAGGTTAAACACCCAAACAAGACGCCGAAGATAGAGCACCG
>e109fef1-6ea0-4bf1-b293-2d5d5a6ed906
TCAGTACTTCGTTCCGGGAATTTACATATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTGAAAAGTATGGAACTCTACAGAATATCCTGCATGAAACATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGAGCGTTCTGGCGCTGCCTTTCGTGCTTTTCTGGAAAAGACCGCGCCCGCTTTACCTTCTGCATCGCGTCTGTGAGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAGGCAACTGGTGATTTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTCTTATCGAGGCTTCAGAGGAATATTTGAACATCGTTATACCAATCGAAACATATATTCGCCAAAATATATATAAAATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGGCAGGGTTTCCTTGTCAGCGACAAATAACGATAAAACAAGGATGACAGATGAGCGGAAAACCGGCGGCGCGTCAGTGGCGACATGACGCAGTATGGCGTAGCATTGTCCAGGAGTCCAGCCGGGGTACGTGGTGCCCCACCGGCGTAATGTTCCGGGTGTGCCCGGCGGTGACGTCAACCATCCGGTGAAATCCGCTGCTCGGTGCAAAGGTCCTTCCGGAGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCATTCATTCTCCACCTGGCAGTTACCGGACAAAAACGCCCGCGCCGGTAGAGCCTCGGCCCCGGCGGCAAATGCCTGCGGATATCCGCTTACAGCTGCGCAATGTACTGATACTCAGTGATAACGGCGGCAGAAGCTGTATTTTGAGCACCTGTTTCCTGTGAGGACGGTTACAGCCGCAGCAGTCACTGTGGCTGGTGCGCGCGGCAACGTGGCGAAACTGGATGAAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAATCCATAGAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGAATTGCCGGAAGCGGATGAGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGAAGCCAGGCACAATTGGACCGCTTCAGGGCGCACAGACGTTCCACCGCCGAAACCGCCGGTGAATTCAGCGAAAATCACCAGCGTGACGGATGAGGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCGCACCAGGCGCAGCCCAGGCAGAAGAAACCCGGCAGCAGGCCATTTCCGGCAGGACGGAACCGTCCTTTCCTGAAACCACCCTGCCGAGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGATATTGGCTGACGCACGACGGAGATACGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGAACGCCCCGCGGCGCGAACTGGCAGCGGTGTATGGCCACTGGCAATACGAGTGCGCAACTTTAACACGATGATAAATACCGGGGCCGGATGGTGGCGCTTGCACCGTCACGCGCGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGAGTGGTGGCGGAACGCGGACAGGTTAAACGCAGAAGCAGACGCCGCACC
>d69c6ac9-3c79-4ee4-a3d2-92762f8b7433
TTGGTATGCTTCGTTCAGTTACGTATTGCTTTCCTGTTGGTACGATATTGCGGCGGCGTCTGCTGATTGTTTAACCTAGCTCAGCAACTGGCCATGTGGCTCCACGTCATGGTTTCCGGCTGCCGCTCTTCCATTGCGCAGGGTAAGTCACTGTGTGGATTATCGCCAACGGTAGCAGGTGATAACATCGCCGTCAGGGGCGGATTTCCTGAATCAGACGGCCCACATTCATCATATTCAGCGTATTTCCGGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTCGGTGGTTATGTTAAAACGCCGATAACACCGCCATCCGGCGTGGTACATTCGCGCGTGATGGGAGCCCGTCACCACATCGGGCTGTATTCTGCTGTCACCTGCGGCATCGTGTATGCCCTAGGCCTGCCACCGCGTCAGGCTCTGCGTGGCCTTGCCCGTCCCGCGTGTTCGCCTTTTCACCACCGCTGCGGCCCACCGTGGCGGGGCTTCACGGCAGTTCAGGCTGTCGGTGATGAACGATCTGGTCCTTCATACTGATACGTATAGCTTAAGCCTGCCGGGTTTTGGCTGTTCTCACCGCCCGTCGCTGTCAGCCAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCAGCCAGTGTATCATCGCCTGATAAGCTGCGCACCTGCTCATTGCGGTCATGCCTGCGCCAGTTCGCCGCAGGGCGCGATCCAATATAGCGCACCAGCAGCGCGGCAGGTAAATTCTCCGTTATTCCGGGTCGTGCGTCGCCACGCGGCGAATGAAGACAGATGCCGTTATCCAGCCATATTCGGTGTAACCCGGCGGGGTATCTGGGAAAAGCTGGCGGGTTCCGTCCCTTGATAAGCCCTGCCAGGCTTCTTCTGCCTTTGCATACGCCGTGGTCAGTACCAGCCGGAAGTGACGCAGCACCCATCAAATCCGCCGGTGAGATTTCGCCGCTTTCAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTTATGCGCCAGAAGCGGTCCACCAGCTGATCAGTACCGGTACGGCGGCACAGCGGCATGGCGTACCTCATCCCGCTTCCGGCACCGCTTCCCGCCCAATGCGGCAGCCTGCCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAGCGGAGTTCTTCCGGCAGCGCCTGCCGATGCGGCCAATACCGGTATTATTCATCCAGTTTCGCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTTATGCCGTCACCGAACAGGGTGCTCAAATGCAATTCTGCCGCCGTTATCACTGAGTATCCGGTGTATCCAGCAGCTGTAGCGGATCGCAGGCATTTTCCAGCCGGGGCCAGAAACCACCGGCGCGGGCGTTTTGTCAGTAACTGCTGTAGGTGCAGGAAGATAGACGGCAGCGGGCCGGGCAGGGCGATATCGGTTTCACCGGGAAGGACCTTTGCGCGAGCAGCGGATTGACCGGATGGCCGGACGATACCCCGCCGGGGCACCAGACAGGCCACGCCGGTGGGAGCTCGATACGTACTGGCTGAACCCTGGACAATCTACCGCCATACTGCGTCCGTATCGCCCTGACGCGCCGCCGGTTTCCGCTCATCCTCATCCTTGTTTTATCGGGTTGTATTTTGTCTTAACGACAGGCGAAACCCTACAGATTTATAAAGCCAGTGAGATATCTGTCAGATAAGAACAATTAGAAAATGTTTATATATATTTCGCGGATAGCAATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTAGACATCTTCCTGGTGCAAAAACCGCCAGCGTTTCGCTGTCAGTTTCATCATTCAAAACTCAGCAAATCAATAAAAATCACTGGTTGCCCTTTTCAGCCACATGATCCATCCACACCGGTTTTGTCATTGGTTTTCGACCAGACGCGATGCAGGTAAGCTGTAAAAGCGGGCGCGGTCTTTTCCAGAAAAGCAACAGAAGGCAGCCTTAGAACGCCCGCTGCAACCGCGCCAAGTGCGGCGTAAAAAGATAAGCCATGGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTGCCCGGTGAATGGCACCGGAAAATGAATTGTTTATCTGATGAAAATAGTACCGCCCTTTGTGCTAATTTTACTGCTCATCGACCACTTATTTTTGAACTTATTGATGGTTTGTACATTAATCCTGTGATTAAGTTACACAAAAAGTTAAATTAATACTAAACATTAGATTTAAATCATGGCTTTTGCCATTTTTATCTTTTTTGCACCCCGCCCGCAGATTTTTGCGAAATCTTTGCAGCTTCGAAATTCTACCTTCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAAGCAAAGCGTATTGCTCAGTGTTTTATTACTGGGTTATCTGGTTTATGCCTGATCAATGCGGAGGCGTTCTGAGTGGCTGCGCAAAGGGTTCTTACCCAGTCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGCGTCCTTTGGGCAGCGGGCTGGCGCCCGGCTGATTAATGACATTCCTCTTCCCGGTACAGCGGGCGTTGAGCGCGTGCGCCATACGCGCCAGCGTCTCTGACCGTGGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTGCATATTTGCTCGGTCTTTATCTGCCGCTTAAATCACAGCGGTGCCAGGGCTGTCATAGGATCTGGCGCTGGAGCCGCCGTCAGCTTTGTCGCAATACCAACTGGCAGCAATCTTATAGCGGGTGAAACCACGTTAGACTCTTCAACCAGATGGCAGGCTTAACGGTGCAAACTTTCTTTCTGCCTTGCGCTAAACTAAGATTTGCGGTGATTTTTGCCCTCGTCATTGCGTTTACCCGCCGGAGCATAGGCACGCTCGAGATATAGATTAGTCTGCTACGCATCACGTTATGATTACTTTAGTCCTGTGGCGTTGTTAGATTGCACTGTTTTTATTAACAAAGGTGCGCTGCAAACTTTCTGCTGCCATCAGGCTGTGAATGCCGTTGAAGGGCACGCAACTGGCTATTTTATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCAGTACTAACAGCGGTGGCTTCTTCGCTTCGACTCTTCGCATCCGTTTAACCCAACCGCGACCAACTGTGCAGATGCTGGCGATCTTCTTGATCCCAGCGGCGCTGTCTTTGGTGAAGTGATGGGCGATCGCCGCCAGAGGGCGCATGTTCACCATGGGCGATGTCGATGATTTTGTCATCTGCGTAGGCGTGGTGGTATGGGTTAAACACTGAAGCAGACGCCGGGCTGAGCGACGGAACGTAATGCGTAACTGGG
>fa215e11-ce27-464d-9a53-f0186fea1dc9
TGTGTACTTCGTTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCCGGCGTCTGCTTGGGTGTTTTAACCTGTATTTCCAGCCCGTGGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCACACCATCCAGCGTGGTGATGCGCGTGATGAGGCCCACGTCACCACATCGGACTGTATTCTGTTGTCCTGCCCTGCGGCATCCGTCTGTGCCCTGGGCCTGCCCACGCGTCAAACTGACTCCTGCGTGACGCTGCCGTCGCGTGTTCCTTCACCACCACTTCAGCCCGCCGCCTGCGTGCAGGACTTCGGCGGTTGAGCTGTATCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTGGCCTGCCAGGTTTAGCAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACCAGAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCGATATTTTATCATCGTAAAGCTGCGCACCTGTATTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCACGGAAGTAATGCGCAGCGCACCAGCGGCGCGGCGAATTAATTCTCCGGGTATTCCGGGTCGTGCGTCCAGCCACACGGCAGACAGACGGATGCCGTTGTCCAGCCATATTCGGTGTAACCCGGCAGGGTATCAGAAAAGCGGACGGTTCCGTCCCGCCGGAAATAACCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCTGCGTGGTCGTACCAGCCGGAAGTGACGCGCCCGGCATAACCGTCACGCCGGTGATTTCTGCCGCTGAATTCACCAGCGGCTTCGCGGTGGAACGTCTGTCATTGCGCTTGAAGCGGTCCACCAGCCGGTCATTACCGGTACGGCGACGGCGGCGCAGGCAGCGCTTTACCTCATCCGCTTCGGCACCCGCCACCAGCCGAGCAGCCACCGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATACGGACTTTAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCGGATTTCGCCACGCCGCCGCTTTTGCCAGCACGGTGACTCCGCTGCGGCTGTAGCCGTCCTCACCGGGAAACAGGTGCTCAAATACAGGCTTCTGCCGCCGTTCATCACTGAGTATCGTGTTTATCGCCGTATGGCGGATATCCGCAGGCATTTTCAGCGGGGCCAGAGGCTCCTGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCGGGGCGATCGGTTTCACCGGGAAGGACCTTTACTGAGCAGCGGATTGACCCGGATGGCCGGACGTCACCCCGCCGGGAGCTTACACCAGACAGGCCACGCCGGTGGGGCACCGATGCATTACTGACTGAACCTGTGGACAATGCTACCGCCATACTAAATCCCTTAACATCGCTTCAGCGCGCCGCCGGTTTCCGCTCATCTGCTCGCCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACTGGGCAAAGCCCTGATTTATAAAGAAAGCCTTAGAGGTGAGGATATCTCTGTCGGATAAGAACAATTAGGAAAATATTTATATATACCGCGGATATAACAGTTGGTATAATAACGATGTCTAAATGTTCCTCTGAACATCTTCACCATTGAAACCGCCAGCGTTTTGCGCTGTCGGTTTTCAATCGTATTCAAAACTCAGCCAATCAATAAAATCTTAGTTGCCTTTTCGACACAGTCCATCCACACCGGTTTGTCATACGGAACCACCGATGAGACGCGATGCAGGTAGCTGTAAAAGCAGGCGCGGTCTTTCCAGAAAAGCATGAAGGCGGCATGGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAGATAAATACATGCCGGGATATTCTCTGTAGAGGTTCCATGCTTTTCTCCCCGCTTTAGCCTCTGCGACGAATGGCACCGGAAAAATGAATTGTTTATCTGATGAAATAGTACTGTAGCCTTGCTGGCTTTACTCGTAAATCCTTATTTTTTGTGATGGTTTATTTTACATTTCATCTGTAGTAAGTTACACAGTTAATTAATACTAAACATTGATTAAATCATGGCTGTTTTATACTTTTACACCCGCCCACGGATTTTGCGAAAATCTTTGCAGCGAATTCTACCTTCAGGTATCGCTTTTGGGCTGCAGGTGCCACTGTGAGTGCAGGCGTGATGAACTGGCGTATATGCTACTCGCGATGCTTTTTTTTTTTATTACTGGGTTATCTGGTTTTGCATGCCCTGATCAGCAGGCGTTCTGATGTAGCTGCACATAAGGTTCTTCTGAAATCGCCATTTTTACCAAGTTATTGGCAATGGGTGCTGCGCGTCCTTTAGGCAGCAGGCTGGCAGCTGATTAATATGACATTCCTCTTTGGTACAGCAGGCGTGAGCGCGTACTTTTCGCACTTGGCGTCTCAGCCGTGAAATTGAACCGACTTCAATATCTTTTGTACCATTCTCGGCCTGAACATACTGGGTGGCGGTGCTGTTTTTATGTTGCTCGGTCTGGCACTATCTGCTGCTGTCCACGCAGCGGTTGCTGGGGCTGTCATTGGGATCTGGCGCTGAATACCGCCGTGTTTGTCACCTGCTGGCAATCCCATGGCGGTGAAACCACGTTGGCTATTTCAATGATGGAAACCAACGGTACCGAAACTTTCTTTCTGCCGCCAACGAGACACGTTGATTTTTGCCCTCTCCGTGCGTTACCCGCCAGAACGCTGAGCACGCTGGAGATGCTGGGTCGATCTGCTACCGCATCGTTAACCAGATTACTTCTAGTCCTATTGGCGTTGACAGTTACACTGGCTTTTTATTCAACAAGGTGCTTTGAAACTCACTATCAAGGTGAATACCGTTGAAGGAGCGCAGCGGCTGCTACCGGAACTGTAAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAAACACCAACTCTGGTCGCATCAGTTTTGGCTTCGCTACTGACCAACTTCGTGCGGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTGCGCTGGCGGTGATGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCGGTGATTTTGTATAAATCTGCGTAGGCGTGGTGATGCTGGGCAGAAGTTCAAAGTCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCGTGGCATGGTGCTGATGTGGCTGATTAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGCGGTGTTTATTGCCGGGCGATTCGACCGTACACCGGAATATCGTTAAAAAAAATCGACGTACGCGAGACAAACTGACTGCACTGGCAATTCTGGTTACCCCATTGCTGGTGCTTTGATGGGCGGCGTGGCGATATTGACGCCAGATAGCGCCATGCTCAACCCTGGCCCGCATGGTTTAGCGGAAGTACTACGCACACGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCCTGGAACTGTTTACTGGCGTTCTGCATGTTTTGTCGGTCGCTTCGGGAATTCCGGTATCGGTGGTAATTGGTTCGCTTCAATTAATTAAAAAGAGCCAAAGCCGCCGAAACGGCACGCTGCCAACGCACGGCGGCCCGCTGTTTGTTGGCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCCTATCTGCCTGGCGCCTTGGTCGGTCCGGTGGCAGGAATATCTCCTGATGATATTGGTGAGCACTGGATATGAGTCGTAAACAACTGGCGCTATTGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCCGGTGAAAAGAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGATCTGGATCGGCGGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAAAACCCGATTGCGATGCCCGGCTTTAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAAGGCGCAGTAAAGCGCAGGCCAACAGAGATATTGAAAGGGGTGGGGTTAAACACCCAAACAGACGCCGCCAGATGGGGCAG
>4148f43d-5b21-441b-a6cf-d4044e318987
TCGTGCTTTGAACCGAAGTTGCACGCTGTCGGCTCTATCTTCGGCGTCTGCTTGGGTGTTGTATCGCGAGTGTCGATCGAAATGTCTCTGCCGGGAGTTAACGCTTCCTCAATCCTAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACAGGCAAATCATACTGGATTCACGGATCACCGAGTGCCGATTCCCCGGTGATAGCGCTTTCGTCAGCCGATGCACCCTTCAATAACTTCATATCGCGGGATAATGTCGCCAGCTACCAGTACGATATCGCCTTTACGGGGATTTGGTCGGCACAAGACTTTGTCACCATAGCGCCTATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCCCCTTTTCAGACTGTTGGTACCACGCTTTGCGGCCTTCTGCCAGCACCTCGGCAAAGTGGCAAGAACAATTTGTTGATCCACAGCCAACCGCTAATGGCCGCGCTGACAGCGCATTGCCGGGCATCACCGCTTGCCTCGCGATACTAACCACAGGTGGTCAGCGACTGCCGATCGGACAGTAAACATGCGGATTGCGCCATTGCGCCTGCGGGGTTTAATTTTTTCACCCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTTCGAATAGCGCCAGTTGTTTGACTCATATTAGTGCTCTCAATATCAATGGGAAGTGTTCGCCACCGGACCAAGCGCCAGGGCGGGGATGATAAGGTCAGTGTAACCAACAACACGGTGCCGATTAACAGGCCAACAAACAGCAGGCCGTGCGTTGGCAGCGATGCCGGAGCTGGCGGCGGCTCTTTTTACTCACCAGCGGGCAAGCGAAAATTGCCATCCGGGATAATCACCCCGTGACCGACAAACCTGCAGAACGCCATTAAACCAGTTCCAGAACAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTTGTTAGCGGCGGATGACGGCGTACGGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTTCGTCCGGCGTCGGTCATCATCGCCAACGCCGCCCATCAGCACCAGCGTCAGGGTATTAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCTGTCGCTTCACCGCCAGCAGGACAAACAGCATCATGCCGTAAGACCAGAGACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACGTCGGCACCATGCCACAGGCGGTAAACGGATATGCATCGCAATCCACCGCGCCACGGAAGCCGCCCGTCGTCACGACCGCAAACAGGCTATTATGCGCCAGGTGGCTCTCTTTACCTTCCATATTGATGCTGCTGCTGTCAGGTACTGGTGCCGGCAGATGATTACCCTGAACTGCTACACATCCACCACGCCTACGCCAGATGACAAAATCTGACATCGCCCACAGCAACATGCGCCCCGGCGTGATCGCCCATCACTTCACCAAAGGCAAGCACAGCGCCGTTGGGATCAGAAGATCGCCAGCATCTGCGCGAAGTTGGTCAGTGCGGTTTGGGTTTCATGGATGCGACGGTTGGCGGTAAAGAAGCCACCGCCGTTAATTTTCCGAACATCTTGATCGCTTCCTGAGAAGCTACAGGCTATGGTAACAGCTGTTGCGCTCCTTCAGCGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACGGTGCAATCAGCAACGCCACAGGGACTAGCACCCATAACGTGATGTAACGAATCGACCCAGAGCATTCCCGAGCGATGCTCATGCTCTGGCGGAGTAAACGCGCGGATGCGGTAAAAATCACCGCAATCGCTGGCGGCAGAAAGAAAAGGATTTTGCACCAATTAAAGCCCATACCATCTGGCTGAAATAGCTCAATGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGGTAATGACGGCGGTGGCGCCAGATCCCACGACAGCCTGGCAACTGCTGTGGATTAAGCGGCAGATGGTGCTGACCGGAGCAACGCAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGGAATGGCACCAAAGATGTAGCCAGTTCATCACGGTCAGGGCGCCAAGTGCGCGAAAAATGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATATCATTAAATCAACCGCGCCAGCCCGCTGCCTAAAGGGTAGCGCCAGCACCGAAGCTAACACCAGTAAAAACGTGGCGATCGAAGTAAGAACCGCCCGCGCAGCCATCAGAACGCCTCCCGCATTGATCGGGAACAAGCAGATATAACCCAGTAATAAAACGCAACAATACGCCGGTTATCGCGCCTGCGCTCACAGTGCTGCACCTCAGTGGCCCTAAAAGTGATGCCGGAAGGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGCGGTGTAAAAAGTATAAAAATGGCAAAAGCCGCCGTTTAACTAATGTTTAGTATTAATTTGGCTTTTATTGTGTAACCCAATTTACGGATGAATGTAAATAAAACCATCAATAAGCAAAATAAGTGGTCGGATGGGTAGTAAAATTACACAAAAGGCAATTTCTTTCCATCAGATAAACAAATTCATTTTCCGGTGCCATTCACCGGAGTAGATACGGGGAGAGAAAGTATGGAACTCTACAGAATATCACCGCTGGCCTATCTTTTTACGCTGCGTACTTATGCGGTTTAGCGGGCGTTGGCGCTGCCTTTCATCCTTTTCTGGAAGGAACCGCGCCCGCTTTTGGCTACCTGCATCGCGTCTGGTGAAAACCAGCGATAAATAAACCTTGGATGGATCCAGGCCGAAAAAGCCAACTGGTGATTTTTATTGGTTGCTGGTTTGAGATACGTTGAAACCATAAGCGGAAACGCTGGCGGTTTTTATCGGAAGATCTTCAGAGGAATATTTGAACATCGTTATACCAATCAGGAAGCATATATTTGTAGAATATGCTCATAAATATTTTCCTAATTGTTCTTATCTGACCAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTATCATGGGGCAAATAACCCGATAAAACAGGATGAGCAGATGAGCGACCAGCGGCGCGTCAGGCGACATGACGCAATTATGGCGATAGCATTGTCCAGGTTCAGCCGGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTTCTTGGCCCGGGGGTGACGTCGGCCATCAGGGTCAATCCCGCTGCTCGGTGCAAGGTCCTTCCGTGACCGACATCGCCCTGCCCGACCCGCTGCCGTTCATTCTCTCCCGCACCTACGGCAGTTACCGGTAAAAACGCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGAAAATGCCTGCGGATATCCGCTTACAGCTGCCGCGATAACACACTGATACTCAATGATAACGGCGGCAGAAGCCTGTATTTTGACACCTGTTTCCCGGTGGACGGTTACACAGCCTGGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATAGAGGTCACCCACCGGCTGGCCGCCTTTCTGGCGACGCTGCCGGAAGAACTCCGCTTAAAGATCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCAGTTGGTGTGAGCCGGGTGCCAGGAAACGGATGAGGTGCTGCCTGCGCCGCTGCCCGCCGTACCAGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACAGACGTTCCACCGCCGAAGCCGCCGGTGAATTCAGCGGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGTACAATTACTGACCGCAGGCGCAGCGGTGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTCCTGTCCCTGCCGGGTTACACCGAATATGGCCGGGACAGCGGCATCCGTCTATCTGCCGTGTGGCTGGCACGACCCGGAATACCCGGAGGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCTTGCGCGGCAAGACTGGCGGCGGTGTGACCGCAGCAATACACGAATTTTGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCTTTTGCCGTCACACGGGCCGACCGGAAATCTCAATTACCGTTACACGACAGCGACGGGCGGGTGACAGAACAGCTAAAGCCAGCTGGGCTTAAGTTACACGTATCAGTGAAGGACACCTCCACCCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCCGCAGGGTGAAGGCGGGCTATGGAGTGGTGAAAAGGAACACCTGGCGTTGGCAGCGTCACGCGAGTCAGTTTGACGCGGTGGGCAGGCTCGGGCTGAACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGGTGACGGGCCTCATCACGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTACTATAACCACCACAGCCAGTTAACGTCAGCCGGGCCTGACGGGCTGGAAATACGCCAGGGAATATGATGGATAGGACGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCGCCGCTACCGTTGCTGATAAATCCACACGGTGACTTACCCTGCGCAACGGAAGATGCAGCGGAAAACCAGGCGTGGAGCCGTTACGGTCCAGTTGCTGGGCTTCACTGGCTGTTTCCGGTTATGTAACCGCTATGACCATGACCGTTTTTGGTCAGGTGACGGCGGTGCACCGCGAAGGGCTGAATCAGTACCGCGCATACACGACAGCCGTGGACGGTTAATTGCCGTGAAAGACCTACGCAGGGCCATAGAGCGGGTATGATACAACACCGCCAGTGACCTGCCGTCATTGCCCCGGACGGCAGCGAAACGGGACACAAGGTTAAACACGAAGCAGACGCCGAAGATGGGCACC
>8f548fb1-92c4-43a0-a032-74593f3988d4
ATCATTGTACTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTAGCTTCGGCGTCTGCTTGGGTGTTTAACCTATAACGGCAAAAATAGTCAATAGTAGGATGCCTGACAATTTATGCTCTACTTTCCAGGCTTATCTGTAATCAGGAATAATAGAAATATGTTCATCAATTTTTAAGTTCCATTTGTTCACCTTATTTATGCAAGGAGTGTTGATCATGTATAAGCTATGAAAAACAGCTTTAGGTAATAAAGGAATATCTCAATTTTTAAACATAAAATGCAGGTATTTGGTACAAAAAGTAGCGTTACGTGATGATCTTTCCTGGGATACAACTCTGGCAATGGTATCGTGAACAGGAATACCATTTTCAAAATCATATATTGCTTCAAAAAATCGAGATGCGTTTCCCGAAATCCTCTATATCTTCCCAACCTTCTGCACCAGAAATAACGGCACAAATAGTCAACAGTAGAATAATATCTGACAATTTATGCCACTTTCCAGGCTTGTCTCTGTAATCGGTGTAATAGAAATATGTTCCATCAATTTTTTTTTTAGTTTCCATTTGTTCACCTTATTTATGTAAGGGTATTTGATCATGTATAAGCTATAGAAAAACAGCTTTAGACAATAAATGTATCTCAATTGTTGAACTTAAAATTCGAAGATTATTTAGTACAAAAAGTAGCGTTACGTGATCTTTCCTGCAAAGTAGACGCAAAATAAACACCTATTCATGAGTTTATATAATTTTTTCACAATGATTAATTTGTTTTCTCCAGGAAGAGATTTTTATTTCTCTTTCACTACGAATTAGTTCATGCTGTATCTTTATTAAACATTCGTAAGACTCATTTTTGTTCGGAAGATGTGCTTGTCATTCGAGCATAAAGTTGGTTTTCTCATCTTTAAAATATTTTACCATGATTGGATTATCAGGACTGTAACAACTGAACTGGATCACTGCTCTTTTTTGATAGATGCATGTATATAGCTTCCTAAACCGATCGCCGAGAAACGCCGTTTTCTGCCTGTATTTATCAACTCCTGCAACGTTCCTTTGATGGCATGATTTTCATTAAAAGGCGTAGTGACCCGACGCGAATTAAGAGTCTCGCCCGCTTGGTGTGAATTTATTATTTTTACATGTACGCAGTTCTGTTTGCCAATAATGCTCACCGATGTCCTCATTCACAATGCCATCCCACATGGCTTTTATTGTTAAGACGGGAAACGCGGAAAAAATAGTACCCTTAGCGAAATAGTAAAACAATCATGATCTTTGGCAATATTTCGCAATCAATATAACACAAAAACTAACAAATATCATCAGCAAAAGAACAAAACTCTTTTCATTTTTTTCTTATTCCTCTCGATGTTCTCTGTTTTTCATCTTAGCTAAAATTTCACCCAAATCATCTATCCTGCTGTTGCTGCCCATCGGGTTTATTAATGTCTGGGAATAAATGAGGTTCTGCACAGAGTATATCCTGGTGGTGGTGAGGTTGTTGGCCAATTTGTCTGTAGCGGGTAATCCACTTGCTGTCTTTGTATCCATCCCTGGATGCTGGGAATCCTGTGGCGTACAAGTCAGATTTGGTTTTACCCACTTCCTGCAATACAGTGTATTAATAGTCGTAGGGCTTAATGCTCTGAAGAATGTTTTGAAAACATTAGGCGCACTACTGGCCCTGTGGTCAATAGGATGGCGGTAATTGTTCATATGTCCGGCAATTTACTTGGATCGGGCGTAGGCGGTTTTGTTAGGTCTCGCTCCACTTATCCGCCATTATTTAAGTGTCCATATTTTGATGCCAGTCCCCATTGAATCTATATACTGAACCGGATTCAGCGGATACTGATAAAATTCCATCCCCCTTCAGCCCAATCGGATCCTGAGTGATATACCTCCTGCAGCCCGGGTCATAATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGTGGATAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTTGCCCCTTCCATTACTGACCAGCGCCAGCGTGCGTGAGCCGCGATGGTCGCAGTGGTACAGGTGGATTTTCGCGCCGGCGTGTGTACACCGGGTCCCATCTGGTTTTACATCTGCTCCACCGTCAGGCCGCACGGTACCAGCCAGCGGCAGCTTTCCTCACTCACCCGGTCAGCCAAGTTTCACTTTCCAACCGGTCGGCATCTGCACCAGCACCGGCAGGAACACCACTGCCACCGTCTTCGCCGCCGGACTGCTTGAAGGTATCCGCCAGGCTGCGGCGCTGCGTTCGCCAATCGCGGTGGCGGTTTCAACCCTGATGGGTGGTGGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCATTGGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCAGCCCGTCAGGTCCCGTTCACGTCGCCACACCCGTTTTGCCACCCTGCGGCCCAGCGGTCGTAAAGATAACTGGCTTTCATTAGCGGCTCTGCATGGTAATGTCCATCTGGTGCACCCGCCGGTGCTGACTGTCATGGCGTGATACCGGTGGGTGCGCTCATCATCGTGCGGATAACCCCTTCAGGATGAGTCGGTTTTTCTCCGTCAGCCTGCCGTGACAGTCATACCAGTAAAAGATAGTGCGCGTCACCGGGCGATACGGTTATCAGCCCACATGCTGAGGTGCTGTCAGGTGCAGCTCCGGGTCGGGCAGGCGGTTACCTGCCGGGTCGGCATACGGGATGTAATGCCCAGGTTACATATAATAATAAGAGCAATTAACTGTTGTTGTTTAGCAATGTGCGCTTACTTAATACAAACCATTGAATATACCCTCCTGACAGAAAGTAAAGCCATATTATTATCGCCATAATATACTTACTATCAACCCTTACGCCAATAATATCTGATGCAGATCCCTATAAATATTAGAGCAATAAGAATACTATGCCTGTTGGAAAACATATTACCATCATTCCAAGACATGCAGGACTAATTAACTCGCTCACATCACGAGTGGAGTCTAATAGTGAAGATCTATGCATGGAAAAAGAATAGTATTAAAAGCGATAAAGCCAGCCATATAGCTCACGGAATAAAAAAAATAATATATTTCATTACATCACTCCGGTGAATACAAATCTAATAAAACGTCAATGTTATTTCCGGAGCACTTCATCTTACATGTTTCACAAGGTATTAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAATTTATAGGGGTGCGACTATATCCAGGCAATACCGAATAACGCGGCTGCCCACTCTTTAAACTTCCTTTTAAACGTTCTCCACACAACTATTATCCCCGGTTTCAAGCAGTGCACTAACGGCCAACAGCTTCTTTATTATCATTACTTGCTACCTGGCCCCTAGACCATCTCCTTTTGATTCTCCCCGTTGGTCTTGGCCACCACAAATATAGTCCCCTTTACCATCTGGGACACAAAGATATTGATGATAGAACGGATTCCCCATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCGGATTCAACGGATACTGATAAAATTCCATCCCCCTTTCAAGCCCAATCGGATCCTGAGTATATCGCCCCTGCAGCGGTCATAATAGCGGTGGCGGTTGTAATACAGGCGGGCTCTCATCATACTGCTGCCCGGCAGGTATGGATAAGCTGCTGCAACTGATGCGGAGTTCTCTTCATTCAGCAGGTTACCCCATTCATCGTATTCTGCGTACCACGCTGTTGGCTCCTTCCGTGCTGATAAAGGGCCAGCGGCAGGCCGCGATGGTCGCGGTGGTACAGGTGAATTTTTCGCGCCGGCGTATTATACCGGGTCAATCGGCTTTGCATCTGCGCCACCACCGTCAGGCCGCACGATGCCAGCCAGCGGCTCCTCACCTCACCCGGTCAGCCAGGATTTCGCACCAGCCGGTCGAGCATCTGCACCAGCACCGGCAGAACACTACTGCCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCATGAGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACTGATGTGGCGTGGCGGCTCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTGTATCGTGGTCAGGCGGTCGCCGTCCCAACCGTACCAGGTCACTTGCGGTTCCGTGACAGCGACATCAGCCCGTCAGGTCCGTTCACGCCGCCATACCCGTTTTGCCACCCTGCATTGTAGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATGTTCAATGTCGCGTAAGTGCACCAACCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCCTTCGGGATGAGGTCGGCTTTCTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAGATAATTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGGTGCAGCTCCAGGTCGGGCAAGGCGGTTACCTGCCGGGTCTGTGGTATGCAGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCAGATTGAGTTCGCGGTGTTGTCGTTCCAGGTGTAATCGCGGTCAGACCAGCAGGCTGTTCAGGTGCTGGCTCGTAACTGCCCGGCAGAATATAAGCATTGGTGAGGATTCATAACGGCCAGAAACTGCTGGCGTTTCCAGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCGAGTTTCATACCTGACAGCCAGCCGCTACCCGGTAATACATTCCACGGCAGACAGGCTGTCCGGTATACAGCGGTTCGCCAGTCACAATGCCGTTGTACGCATGTCCTGGTCTCATGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACGCTGGCGAAGGCGCTACTGTCATAACCGCGGAGTGCACCGTCACCCGGTGCCCTTCGCTATTATGGCTGATGTCACTTCAAGCCAGCCGCGTTCGTCATACTGCCACGCTCTGCAGTTTCGCGTCACGGTGCGGTGCGTGGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCAGTTTCCTGTATCAACCGGTCAGTACATCGGCGCGGAAGGTGAATTGTGGCTGCCGTTTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAATCAGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTGGGGCAATGACGGTGGGTAAGTCACCGGCGGCGTTGTCATACCGCGTTTCATGGCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTTGTCAGCCCTTCCTCGCCTTACGGTGCACCGCCGTCACCTGACCAAACGGTCATGGTCATAGCGGAGTTATATTAGACAGTCAATTAAAGAAGCTCAACAACGCTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCATTGGCATCTTCCGTTGCGCAGGAATTAGCAGTCACTGTGTGGATTTATGTAACGGTAGCGGGTGATATCGCCGTCAGGGGCGGTTTCCTGAATCAGGGCGGCCCATTCATCATATTGTCCCGGCGTATTTCCAGCCCGAGTAGGCCCGGTATTTGACGTTGGCTTTAGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCGGCATCCGTCTGTGCTTCGGTTGCCCACCGCGTCCGACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTTCACCACCCGCCTCAGCCGCCTTCACCCTGCGTATTGCAGGACTTCACGGCGGTTCCAGGCTGTCGGTGATGGTGATGCAGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCAGGTTTGTTTCTACTTGCCATCCTTCCATCATGTAACAGTAGTAGATTTCCGGTCGGCCCGATGGTGCCCACCATCCGGCCCCCGGTGTTTATCATCAGCTAAATGGCTGCACCTGTGTATTGCTGCGGTCGCTTTACACGCCTGCCAGGTTCGCCGCAGGGCGTCCAGCCAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGTGTTCACAATTGCGTCAACCACGGCAAGACAGACGGATTACGTTTGTCCCAGCCATATTCAGTGTAACCCGGCAGGAGTATCGGAAAAGCGGACGGTTGCGTCGCGATAAGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCGTAAATCACGCCGGTGATTTCATACTTCGAATTCACCGGCGGCCTTCGCGGTGGAACGTCTGTGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGCGGCAGCGGCTGGGGCAGCACCTCATCCCGCTTCGGCACCCGCTCCTTTCCAGCCGAGCAGCCACCACGGCCCCTACGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTGTTCGGCAGCGCCTGCGAAGTGCGGCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCGCACCAGCCACAGTGACTCGCTGCGGCAACCGTCCTCACGGGAAACCGATTACTCAAAATGAGCTTCTGCCATACGTTATCACTGATATCAGTGTGTTATCGCTGCCAAAGCGGATATCACCCAGGCGGTACCAGCCGGGCCAGAGCTCCCCACCGGCGCAGGCGTTTTTGTCCGGTAGCTTTGCTGTAGGTGCGGGGAGAATGGGCGGCAACCCGGGCCGGGGCTAAGGGCGTCATCAGTTTCGCAGGACCTTTACTTCGAGCAGCGGTTGACCGGATGGCCCGGACGTCACCCGCCGGGGCACCAGAACAAAGGCCACGCCGGTGGGGGCACCGATGCATTACCCCGGCTGAACCCTGGACAATGCTACCGCCATGCCGTCATGTCGCCCACAGAGCGCGCCGCCAGTTTTTCCGGCTCATCTGCTCATCTTGATGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAGAACCCTGATTTATAAGCCTTAAGTGAGATATCTGTCAGATAAAGAACAATTAGGAAAATATTTATATATATTTCGCTGAATATATGTTTCGATTGGTATAACGATGTCCCCGCAATATTCCTCCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTCGCTGGCGGTTTTTCAATAATATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTTCGGCCCACAAGTCCATCACACCGGTTTATCGCTGGTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCAGTCTTTCCAGAAAACGAAGGCAGCTTAGAACGCCCACTGCAACCGCATAAGTACGGCGTAAAGATGGCCATGCAGGATATTCTCTGTGAGTTCCATGCTTTTCTCGCGCATCTACCCGGTGAATGGCACGGAAAAATGAATTGTTTGCATCTGATGAAAATAGTACCGCGCCTTTTGTGTAATTTACTACTCATCCGACCACTTATTTTTTGCTTATTGTTCGGTTTTATTTGTTCATCCTGTAATTGAGGTTACACAAAGTTAAATTAATACTAAACGTGGATTAAATTATGGCTGCCATTTTATACTTTTACACCCCGCCCGCAGATTTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCGGTATCACTTTAGGCCACTGGAGGTGCACTTTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGAAGTTCTTACTGATCGCACGTTTTTTGCTGGTGTTGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCGGTACAACGGGCGTTGAGCGCGTACTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCAGGGCTGTCGTGGGATCTGGCGCTGAATATATACCGTCAGCTTTGTCACCAATACTAACAGCAATCTTATAACGGGTGAAACCACGTTGAGCTTCTTTCAGCCAGATGGCGGGTAACGGTGAAACTTTCTTTCTGCCGCCAGCGGATTTGCGGTGATTTTGCCCTCTGTCGATGCGTTTACCCGCCAGAGCATGAGCACGCTCAGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTGCCGGGGTACACTTTGGTCCTGTGGCGTTGTTGATTGCATATTTTTTATTCAACAAGGTATAGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTATTACCCATGGGGCCTGTAGCTTCTCGAAGCGATCAAGGATGCTCGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAGCCAACCACTGAAAAGGCAGCTTCGTTGCAGATGCTGGCGTCTTCGCCCGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGCGCATGTTGCTGTGGGCGATGTCGGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGGCCGTTTCGGCGTGCTGGTCAATGCTGTTTGCGGTCATTGACGACGGCAACCATAATGGCGCGGTGATTGCGGTGCCATGATTCAGTTTACCGCTCTCAGGTGGCATGGTGCCGTGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGCGGTGTGTCGGTTCTGGTCTTTACGGCGCTGATGCTACGACATCCCTGCTGGCGGTGTGTTTGTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGGATGAAACTGACTGCACTGGCGTTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACAGCCGGCGCCATGCTCAATACAGCCCGCGGACAGCGAAGTGCTGTACGCCGTGTCGTCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCGCCAACTCTCGTTCTGGAAGACTGTTTGCGGCGTTAGGTTAAACGCAAGCAGACGCCGAAGGCTCACCGCA
>280af896-8e53-4427-89d3-a554c87269fd
TTGTTGTACTTCGTTCGGTTACGTGTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTTATTTAACCTGTCGGGAACGCTACGCAGGAGCTGAGAGGGGCAGGGAACTATCGAAGAGGTAGCGAAGAGGTGCGGGCCTCTTCCGCCACGCTGCGCCTGCGTGGTCAGCACCAGACGGACTCCGCCCGGCACCGCGTCCGTCCGCGGTGATTTCCCCGGCGGTCACCGGCGGCCTCACGCCAGTACGTCAGCGTCCGCCCGAAGCGATCCGCCATCCCGGTAAGCACCCGGTACGGCAGCGGCGGCGCTGGCAGTACGTCCTCAACACCAGCTTATAGACCGCAGTATCCACCGGCCCTGGCGCTGTTGGTCGCCAGGTAAGATGCGGGCTTAACCGGATATCCGGCGGCAGCGCCCAGCCGCGCCAGCGTATGGCCCGATCCGGCTGTGCTGCCTTACCACCGCGCACCAACCACATTGACTCCCCACTGCGTGCACACCGCCTCCCCGGCAGCAGAGGCTCAAAGTGGAATACTCCGCCCGCCGTTGTCGTTGAGTATCAATTCCGTCATCACGTAGCTGTAGGCGCGGATATCAGAAGGCGCTTTCCAGCCGGGCGGCACCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAAGATGAACGGCAACGGGCCGGGCAGCCTGAGTCCGTCTCGCCGGGCAGCACCTTCGCCCCCAGCGGCGGATTTACCAGGTTGCTGAAGTCATCCCGCCCGGACGCACCGAGCACGCCACGCCGGTGGGCGCGCCAGGTCTTACACCTGCCAGACCCTGGACAATGGGACCGCCATACTGAATTCATATCTCCTGACGCGCCGCTGGTTTCCGCTATGCGCCAAGGTACCTTTTGAGTTATTGTTCATCCTGTGGTAGCAGCAAAAAAAAATCAAAATGACACACAAGAGACCGGCTAATGTGTTTATATATTTTCACATAAACTTATTTGTTCTCAATCAACGTAACTGTTATTACAGGTCGCTTTCAATATTTTATTAAACTGCTGTTTTTAGCACAGATGAATTCATCATCAACAAATTCACTATATGGATAATCCATTCAGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTTGTGGGCTATATTTAAAATCAATAAACTCCACCGATTCCAGATTAATATCAGCAATAGAGAAGATGGAAATCACCAATTCAATAACATCATCAATGAAACATATTGTAAATTAATTTAAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTCCTCTCATCACCCACCAAACTGCACCTGGAACAGCGCCCACCCGCAACCAGTCGCGCACCCAGCCAGCCGCCGAAAGCGACAGCAGCAGCTCCCGCTGCACGGCAGGTTTTCAATCCACAATCGCCGGTCGGCTCCACGGAAAAATCGAAACACTTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGAAACAAACCAAAGCATGGCGAATTTCACACCAACGTGGTACGCAGCAGTTTTTCCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGAGCGCTGACGCATTTCCCACCTGCACCTGTGCCCTTAAGCAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTGGTTAAACACCCAGCAGACGCCGCAATATCGGCAG
>4205dba9-c9b2-4574-a9e3-25b8f7bfc601
ATCGGTATTACTTCGTTCAGTTACGGCGTATTGCTTTTCTGTGTTGGTGCTGATATTGCGGCGTCTGCTTGGGTGTTTAACCTGTACAGCGTGGCGGTTGCCAGTGAACTGATGGTCAGGACCAATCAGCAGAATGGATCAGGGCAATTTCACCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGTCATCCGATCCGAAATGTCTCGCCGGGGTTAACGCTACACTGTCACCAGCCAGTCCAGAAAGAATACGCGTGCCGCCGGTGACGGAGAGCCCAAAATCGCTTCGCCAGTTCACGGATCTGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCCTTCAATAACTTCACCATCGCAGGGGATAATGTCGCCCTTCTACCAGTACGATATCGCCTTTACGAGTTGGTCGGCAGGAACTTTGTCGCCGCAGCGCCATATTTCGGCTCACGCGGCTTGCCGGGCAAGGCGGTTTTTCACCCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCAAAATTAGCGAACAATTACGGTGATCCACAGCCAACCGCTAATGGCCACCGCATAAACAGCGCATTGCCGGAGCATCGCACCGCTTGCCATCTTGATGCTAATGGAGTAGTCAACAGACTGCCAATCAGACGATAAACATCACCCGGATTGCGCCATTGCGCCTGCGGGTTTATTTTTCACCGCCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAGAATAAGCGCCAGTTGTTTGACTCATGATGGTGCTCGCTCAATATCATCAGGAGAGATATTCCGCCCACCGGACCAAGCGCCAGGGCAGGGATAAGGTCAGTGCGCCAGCCAGCAACACGGTGCCGATTAACAGGCCAACAAACGGCGGGCCATTCGTTGGCAGCGTGCCAGAGCTGGCGAAAGCGGCTCTTTTACTCACCAACGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATACCCAGAACGCCGGTAAACGGTTCAGAACGGAGTTGGCACTTAATCCAGCAAGGGCGCTGCCGTTGTTGGTAGCGGCGGATGACACGGCATACAGCACTTCCGCTAAAACCATGCAGGCCAGGGTTGAGCATGGCGCCACGTCCGGCGTCGGTCATCATCGCCAACGCCGCCCATCAGCACCAGCGTCGGGGTATAGGTGCCAGTGCAGTCGGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCGGGACAAACAGCATCATGCCGCAAGACCAGAACCGACACCGCCGAACACCGCTTCGCAATTTGCATCAGCCACATCGGCACCGTACTGCCGAGAGCGATAAACGAATCATGCATCATAATCACCGCTTACGGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTTGCCCGGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCGCCTACGCAGATGACCCAAATGCTGACATCGCCCACGGCAGCATGCGCCCTGGCGTGATCGCCCATCCCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGTAAAGAAGCCACCGCCGTTGGTACGAGCATCTTGTTCGCTCACAAAGCTACGGGCTACGCGGGTAACAGCTGTTGCGCTCCTTCCAGCAGCAGTATTCACAGCCTGATAAGGCAGAAAGTTTTACATGCCTGTATTTGAATAAAAAAACAGTGCAATCAACAACGCCACAGGGACTAACACCCATAACGTGATGCGTAGCAGATCGACAGGCATTCCAGAGCGTGCTCATGCTCCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTATGCAAAGCTGACGGCGGTATTCAGCGCCAGATCCACGACAGCCCTGGCAGCTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCGAAGCAGGCCGAGAATGGCACAAAGATATTGCTTCCAAGGTTAAACGCGAAGCAGACGCCGAAGATAGAGCGACAGGCAAAGAGCAATACGTAACTACCA
>fb54982a-a9ad-4aeb-82e8-a4eea0e527a1
TTGGTAACACTTCGTTCAGTTACGTAACCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGGCGGGTGTTTTAGCCTGCCAGCTCACCGGTGGCGGTTTCAGCCTGATAGTGGCGTAGAAGCTCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCGGGCCACGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTCCGTGACGACATCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCGTTTTGCCACCCTGCGGCCCAGCCAGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTAATGTCCGCGTGTAGTGCACCAGCCGGTGCGGTATCATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCCTTCAGGATGAGGTCGGTTTCTCTGTCAAGCCTGCCGTGACGGTCATACCGGTAAAGATGAACCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCGGAGATGCAGCTCCGGGTCGGGCGAGCGAGTTACCCTGCCGGGTCTGTGAGCTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTATGAACGCCGGTCAGCCTGCCGGTGTGCTGGCAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGATTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGTCTGTAACTGCCCGGCAGGGAATTATAAAGCGGTGGTGAGTTCGCAACGGCCGAAACTGCGCAGCGTTTCCAGTGCAGGCGGTCACGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCGGTATACAGCAGTTCGCCAGTCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCAGGCGGCCTTTACTGTGCATAACCATAGTGCAAATCGCCGGTGCCGCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGTTCGTCGCCGCTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATGGAAGTGCCAGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCCAGCCGGTCGAGTACATCATGTAACGGAAGGTGGTGTGGCTGCCGTTTCACTGGTCGGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGTACAGATGAAAGCACTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCGGGAACGTGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTTTAATCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCCTCCCTCGCGGTACACCGCCGTCACTGAAACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCCAGTGGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCGGCGTATTTCCAGCCCGTCAGGCGGTGGCTGACGTTAACTGGCTATGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGTCAAACTGACTCTGCGTAGCGCTGCCGTCCGCGTGTTCCTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGTGCGCAGGACTTCACGGCAGTTCCGGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTTTAGCTGTTCTGTCACCGCCCGTCGCTGTCGTAACGACAGATTTCCGGTCGGCCCGATGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTACTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGGCGTCCAGCCATCAGCGCACCAGCGGCGCGGCGGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAACCACGGCAGACGAGCGGATGCCATTGTCCCGGCGCCATATTCGGTGTAACCCGGCAGGGTATCAACGGAAAAGCGGACGGTTCCGTCCCGCCGGAAATAATGCTGCCGGGCTTCTTCCTGCCCGCTGCGCCTGCGTGGTCGGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAGCGTCTGTGTGCGCCCGAAGCGGTCCACCAACCCGGTCAATTTACCCGGTACGGCGGCTTGGCAGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCGCGCCTGCCAGTGCGGCCAGCCGGTGACCTTCATCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGAAACAGGTGCTCAAAATGCAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCCGGATATCCGCAGGCATTTTCGAAACCGGGGCCGGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAGAATGAACAGCAGCGGGCCGGGCAGGGCGATGTCCGGTTTCACCGGGAAGGACCTTTGCACCGAGCGGCCAGTTGACCGGATGGCCGGACTGTCACCGCCGGGGCACACCCGGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCGGCTGAACCCTGGACAATGCTGCCGCCACATGCTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCGCTCATCTGCTCATCCTTGTTTTTGTGGGTTGTTGTCTGCTGGTTAAACGCGAAGCAGACGCCGAAGATAGAGCGACAGGCAAGTGGCAATACGTAACGGCA
>a6ec2107-dc02-44f1-96cc-704dfe885902
TTGGTATGCTTCGTTCAGTTACGTATTGCTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGCCTTCCATCCCCTTTTCAGCCCAATCGGATCTGGTGATATATCGCGCCCCTGCGGCGGGTCATAATAGCGGTGGCGGTTGTAATGCAGGCCGGACTCCTCATCCTTACTGCTGCTGGCAGTGGACAAAGCTGCTTTGGCTGATGCGGGTTCTCTTCATTCAGCAGGTTACCCATTCATCGTATTCTGCGTACCCGCGCTGTTGTCCCTTCCGTGCTGATAGGGCCAGCGGCGGCGCGATGGTCTGCCAGTGGTACAGGTGATTTTCGCCGGCATATTATGCCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCAGGTCGAGCATCTGCACCAGCACCGGCGAACGCCACACTACCACCGTCTTCGCCACCGGACTGCTGGAGATTATCCGCCAGGCTGCGGCGCTGCGTTTTCTCGCCAGCTCACCGGTGGCAGTTTCAATGATGAGTGGCGTATGACTCCCAGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCAGCCGTACCAGATCCCTTGCGGTTCCGTGACAGCGACATCCAGCCCGTCGTCCCGTTCACGCCGCCATACCGTTTGCCACCTGCGGCCAGCAGATAAGTAAAGATAGCGACTTTTCGACCAGCGGCTCTGCATATTGTGTCGCGTGGTGCACCAGCCGGTGCTGATGTCGGCAATGGTACCGGTGATTTGCGCTCATCATCCCGTGCGGATAACCCTTCGGGATGAGGTCGGTTTTCTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATGAATGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGCGCTAATCCAGGTGCAGCTCCGGGTCAGACGAGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCAGTGTAAGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTGGCGCTGTAACTCCGGGTCTGGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCAGGTGTAATCGCGGCCAGACCTTAGGCTGTTCGGTGCTGAAACATAACTGCCAGCAGAGTATAAGCGGTGGTGAGTTCATAACGGCGAAGCTGCGCAGCGTTTCCCGGTGCAGGCGGTCGCCGGGTATGCTCACCAGCGGTATCTTTCAGTTTCATGCCTGACAACCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACTGTAGTTCATAGCCAGTCCCTGTGCGTTGTACATGTCTGGTCTCATGCTGCCCGGCAGTTCATTCGTCTGCGGATGATACCGTCAGGTGTTCACTGGCAGGCGGCCTTTACTGTCACATAACCATGGTGCACCGTCGCGGTGCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCCGGTTTCGCCATTCACGATTGCGGTGCGTGAGGCGAGGTCTGCTTCGATCATAGTGCCAGTGGGTATTAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTAGGTGATAACGCTGTGTGCGTAGATCAAAAGCCGGTTTCCTGTATCAGCCGGTCCGGTACATCATGTCAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCCAGTGGCCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCCAGACCGCCCTGCGTGGTACAGATGGCTTTCCCCGCATCGTACTGTGTCCGTTTCTGCTGCCGTCCGGGAGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCACGGCTGTCGTATGCGCGGTACTGACTCGGCCCTTCCTCAGGGGTACCGCCGTCACCTGACCAATGGTCATGGTCATGGCAGGTTACATAACCGGAACAGTCAGTGAAGCTCGGCAACTGACCGTAACGGCTCCGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGGTGATATCGCCATTGGGGGCAGTTTCCTGAATCAGACGGCCCATTCATCACATTCGGCGTATTTCCAGCCCGTCAGGCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGTGCCCTGCTACCATCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCGCGTGACGCTGCCGTCCGTGTTCATTTTTCACCACCCGCTTCAATGCCTTCACCCTGCGCGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTGGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCAGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCGCAGCTATTATTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCGGGTCGTGCGTCAGCCACACGGCGAACAGACGGATGCCGTTGTCAGCCATATTCGGTGTAACCGGCGAATTATCAGGGAAAAAGCAGACGGTTCCGTCCGCCGGAAATAACCTGCTGCCGGGCTTCTTCATTACGCTTCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCAGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCACCAACCCGGTCAATTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCGCCCGGCACCCGCTCACACCAGCCGAGCAGCCACCGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAATGGTGACCTTCATCCGGTTTCATACGCCGCCGCGCCAGCCAGTGACTCGCTGCGGCAACAGCCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCGGTGTGTTATCGCGCAACTGTAAGCGGATATCCGCAGGCATTTCCAACCGGGGCCGGGCTCCCCACCGGCGCGGAGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAAGAATGAACAGCAGCGGGCCGGGCAGAGACGATCAGGATTTCACCGGGAAAAGGACCTTTGCGCCGAGCAGCGGATTGGCCGGATGGCCGGACATCACCCGCCGGGGCACCGAACAGGCCACGCCGGTGGGGAGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATGCCGTCATGTCGCCCTGACGCGCCCGCCGGTTTTCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACCCAAGGCGAAACCCTGAATTTATAAGAAAGCCAGAAATTAGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCCTGAACATCTTCACGGTAAAAACCATAGCGTTTCCGCTGGCGGTTTTCTAATATTCAAAACTCAGCAATCAATAAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACCGGTTTATCGCTGGTTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCAGGCGCGGTCTTTCCAGAAAAGCATGAAGACAGCCAGAACGCCCGCTGCAACCGCATGGTAAAGCGTAAAGATAAACCATGCAGGATATTCTCTGTAGGAGTTCGCACTTTTTCTCCCCCTTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGGAATTGTTTATCTGATGAAAATAGTACCGCCTTTTATGAATTTTACTGCTCATCCGACCCACTTATTTTTGTATTGATGGTTTATTTACATTCATCCATGTAATTAAGTTACACAAAAGTTAAATTAATACTACATTAATAGTTAAATCATGGCTAGGTTAAACGCAAGCAGACGCAATATCAGCACCAACAGAAAAGCAATACGTAACTGG
>38f657d9-0701-44bb-8c13-d9446f8fe441
TCTCGGTGGCTGCTTCGTTTCAGTTACGTATTGCTACTTGCCCTGTCGCTCTCTATCTTCGGCGTCTGCTTGGTCATTTAACCTCACTTTCTCTTCGTCAGGATGCCCCCGCCAGGCGCGCGCATTTTGCTCATCAACGCGATCAGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAAATGTTCAATGGCGCTCGCCGGCAATATAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGAGGGCAGTCCATAACACCACGTCGTCGGCGGCATCGAAAAAGGATCGGGCACGGTTTCCCGTACCTGAATTCCATTGACGCCCGCTGATACATCATTCAGACTCCAGATGCTGAGCGATTGACGGTAGTGAAAACATCAATGCAACTTCCAGCAGTTCTTCGATATCCTGCCAGCGTTTGGATGGCTGGGAACCTGGCACATTACAATGCCAGTTCGTCATTAAGATCAGCGCCGGGCGGCGAGCGAGGGCGGCATCGAGATCAAACTCGCTGATATACCGCCCACGGTACGCCTAATTTTAACGGCAGAACAGCCAGCCCTTCAGCATGGCGACGGTATCTTTTCGCCGTGGGTTTCTACCACGCCAACCCACAATATCCAGCCGCCGCCCGCAGTCGCTGGGCTTCTGCCAACATCGCCCAGGTCTTCCCGGCCTGCACAGGCTGAAAAACTTTCAAAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAGCAGACGATCGGGGTCCGGGACGTAGGGTTCGTTATTCATCAAAGTTTATCCAGCGCCAGATTGAGTTCAACAATGTTGGCAATGACTGTACGATATATTTCGCAAGCGGTTGTTGGCTGTATTTTGCGATCAGTTGCGTAGGCTGTTCCAACGCTGAATTACGCACTTTCGCCACGCGTGGATTTGCTGAGGCCGCCGCTTGCGAGGTAGTATTATTAACCAGCCGCTTGCCGATGCCGTGCCAGATTCAGCGGAACGCTCGCGCTGGCATCCGGGTTCAGCGGCCCGTAATGCAACGCGTGCGGCTATTAGTTTATCAGCTCAGGGTTGCCGACCGCCAGATTGCTCCCGCCAGAAGCCACCAATGGATTATAGGGCATTTCTCACCGTTGCCGACGGGCGACCATGAAAATAGCGTTGCCGGTAGATTGCCCGGTAATGCTGGAACGCGCACCGGCGTATCACCTTCTGAATCAACGAACCATTGGCCTGCCAGAGGAAACCACCATTGCCCCAGTACGGTGAATTCAGCGGCGGGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTTGATAATGCCGGACTCAAATCCTCATGGTAAACCTCCACACCAGACCGCAAACGGTCAGCGGTAAATCAATGGCTTTGATACCGATAAACTGGCACCAGCAGCCCACAGACCGTAAATCCATAAGTTACGGCGCAACATAGCCAGAAGCGGTAAAGCGGTTTATAACTCCGCCTTTTAACGCCAGAGTCAAAGACGATAATCAAGGCGTTTGAAAATCACCACACTGAGGATTGCGGAGTCGGGCAGATGCAGGCACATAGTGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATATGGCGAAATGTTCACTTCACATCGTTAACAATGCTGAAGGTGGTCAGCGAGCCACAGGTCATCAACATCTGTTTGCCAATGTACCCTCGATCAACTTGGTCAGGGTTAAGTCGAGATCGACCATATTGCCGCCTCTTTCACCGCCTGGGGTGCCGGAGTTCATCATACTGCGACATCTGCCTGCGCCAGCGCCAAGACATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTGATACTGACAGGATCAATGCCAACGGCCTCCGGTGTCCTTCGGCGAGAAAATCATCGGAAAGACACCCGCTTCCGCAGCAATCGCGGCAGCAGTCAGACGGTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAACTGGGCGAAACGCTCTTCAATACCGCCTTTGACAAATATCATTTCAGCGCAATGCGCCCAGCACGAGGAACCTTCCACCACCACCAGCGGCGTAAAACTCCTGACGCTTTAGCCTGATCGACTTTTTGATCAACATCGGTGCGAGTGACCACCGTTAGCCTCAGCATGGCGACAGATGGCATCCGACTAGAACCTTTACGAATCATGCGGTTGTCGATGTTGATCCATCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGATTTCACGCTCCGCGCTCGCGCAGGTTTAAAACGCTGGCGGGGATCCGCAATACTGCGCCTTCCGGCGTTTAAACAATAGCGAAGCCAGTTGTGCGGCGTCAATAGCATTTTTCATCACGCCCTGCGCAGATAAACTCCGACGCTGACGGTTACCGGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAGCACGTCACCTGCCGCTTCAACTGCGTCCGCTGGTGCGAAATCACATTCAGCACCTAGCATCCGGCTCATCCGGCGACGCCGATCGCTGACTTTCAGGCCGCCAATAGTGGTTGGGATCAGACCAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGGAAAAACGGCCTGGCAGTAGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAACAAGAATGGTCAGGGAACCGTTTCGTTCCGGCGTTTTGCGTCGCTGTACGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGTTAACGCTGCACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAAGCAAAATCGCCGCCGGATTCACGGATCGCCGGTACCGATTCCCCGGTGATGGCGCTTTCATCGACGATACACCCAGCTAATAACTTCACCATCGCGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCGGAACTTTGTCCGCCGCAGCGCCATATTCGGCTCCACGCAGCTTGCGGGCAAAGGCAGTTTTCACCCTTTCAGACTGTTGGCCCCTGCGCTTTACTGCACGGCCTTCTGCAGCCTCGGCGAAATTAGCTGGCGAACGAGTACGGTGATCCACAGCCAACCTTTAATGTACGCGCTAAACAGCATTGCCGGGCATCCTTACCGCTGCCATCGCGATGCTAATACAGAATTCAGTCCAACAGACTGCCGATCAGACGATAAACATCACCCGGATTGCGCCATTGCGCCTGCGGAACGTTAAATTTTTTCACCGCTTCTTTCAGCGCCTATTGAACGACAAATGTTTGGTTCGAATAGCGCCAGTTGTTTACGACTCTTCAGTGCTCACTCCAATATCATCAGGAGATAGGTATTCCGCCACCGGACCAAGCCAGGGCAGGGATATTAAAGGTCGATGCGCCAACCAGCAACTGGTGCCGATTAACAGGCCAACAAACAGCAGGCCGTGCATTCTGGCTTGGCGTGCCGGAGCTGGCGTGGCTCTTTTACTCACCTTGAACCGTAGTACCCATCTGGGATAATCACCCAAACGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGAGGATGACGGCGTAACACTTCGCTAAAACCATGAACGGGTTGAACGCCGGCGCTACATCCAGCGTCGAAGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAGCAGATTGCCAGTGCAGTCAGTTTCATCTCTGCGTACGTCGTTTTTTTGCAGATATTTCGGTGTACGACCAATCAATCAGCCGGCAATAAACGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCTGAACACCACTTCACCAATTTGCATCAGCCATCAACCATGCCAGGCGGTAAACAGATCATGCATCGCAATCTGCCGCGCCCACGGGAAGCCGCCCGTCGTCACGACATAAACTGGGCTACTGACCAGCACGCCAGTATCTTTACGCCTTCCATATTGGTCGCTGCTGTCCGCCCGGAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCTTACGCCTACGCGAGATGACAAAAATCTGGCATCGCCCACAGCAACATGCGCCTGACGATCGCCCATCCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCCGAAGATCGCCAGCATCTGCACGAGACAGTCCAGAGTACGGTTGGGTTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTTAATTACCGAGCATCTTGATCGCTTCCTGGCTACAGGCCCCATGGAGCAACAGCTGTTGCAGCTCCTTCAACGAGTATTCACAGCCTGATAAGGCAGAAAGTTTCAGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGATAGCACCCATAACGTGATGCATGCCGAATCGGCCCAGGCATTCCCGAGCGTGCTTTCATGCTCTGGCAGATAAACTTGCACGGATGAGGGGCAAAATCACCCGCAATCCGCTGGCGGCAGAAGAAGTTTTGCACCGTTATTACGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCTGGATTGTTGTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCGGCAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATGGTGCTGACCGAGCAACACAAAAACAGCACCGCCAGCCCAGCATGTTCAGGCCGAGAATGGCACAGATATTGCTTCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAAGTACGCGCTCAACGCCGTTGTACCGAAGAGATATCATTAATCAGCCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCGAGTAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATGGCAGTAATAAAAACACCAGCAATACGCCGGTTATCACGCCTACACTCACAGTGCACCTCCAGTGGCTAAAGTGATACCGGAAGGGGTAGAATTCTGGCTGGGTTACCATAAAAATCTGCGGGCGGGGTGTAAAAATATAAAATGTGAAAGCCATGGTTAACTAATGTTTAGTGAATTGCTTTTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAATAAGTGGTCGGATGGGTAATTAAAATTACACAAAAGGCATTTATTTTCATCAGATAAACCAAATTCATTTTTCAGTGCCATTCATGGTAGATACAAAGGGAGAAAATTATGGAACTCCTGCAGAATATCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTCGCGGCGGGCGTTCTGTGGCGCTGCCTTTCATGCTTTTCTGGAAAGGCCGCGCCCGCTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGGAGTTTGAATACATTGAAAACCGCCAGCGGAAACTGGCGGTTTTTATCAGGAAGATGTTCAGAGGAATATTTGAACTATCGTTATACCAATCCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTATTATCGACAGATATCTCACTTAAAACAAAGCCCCATAAATCTGTAGGGTTTCGCCTGGCATCAGCAGATAAATAACCCGATAAAACAAGGATGAGCAGATGGGCGGAAAACCGGCGGCGCGTCGGGGCGACATGACGCGGTATGGCTGACCAGCATTAATCCAGGGTTCAGCCGGGGTACGCATCAGTGCCCCCACCGGCGTGGCCTGTTCGGTGTGCCCGGCGGGGCGGCGCGATGGCCATCGGTCAATCCGCTGCTCAGTGCAAGATCCTTCCAGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTTCTCTCCCGCACCTACAGCAGTTACCGGACAAAAACGCCGCGCCGGTGAGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGTTCTCAATGATAGCAGCGGCAAGCCTGTATTTTGAGCACCTGTTTCCCGGTAAGGGACAATGATTACAGCCACGGCGAGTCACTGTGGCTGGTGCGCGGCAACGTGGCAGGAAACTGGATGAAAGGTCACCGGCTGGCGCACTCTGTAGCGCTGCCGGAAAACTCCCGCTTAAGTCCGCATCGTTATCTGGCGGCAAACGGTCCGCCAGGGCCAATGGTAGCTGCTCGGCTGGTGTGAGCGGGTGGAAGCGGATGAGGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGGGACCGCTTCGGGCGCACACAGACGTTCCACGAAGCCGCCGGTGAATTCAGCGGCGAAATCACTAACGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCGAAGAAGCCCGGCAGCAGGCCATTTCCGGCAGGACAGAACCGTCCCGCTTTCTGATACCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCGGAATACCGGAGGAATTTACACCTGCCACGCCGCTGGTGCACTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACGCAACCAAAATACAGGTGCGAAGCTTTACTTACGATGATAAATACCGGAAGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGCCCTGCACACGCAAATTGAAGGCGGGCTGAAGCTGAGTGGTGAAAAAGAGAACTACGCGGACGGCAGCGTCACGCCAGAGTCAGTTTGACGCGGTGGAGCAGGCTCAGAACTGAACGGATGCCGCAGGCAGGACAACGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACATGGATGGCGGGGCATCGGCGTTTACTATAACCACCACAGCCGGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACTCCAGGAATATAGTGATACGATTGCGTCTGATTCGAAACCGCCCCTGACAGCGATATCACCCGCTACCGTTATGATAATCCACACGGTGGCTTACCCTGCGCAACGGAAGATGCCACCGGCGGCGGAGAAAACCATGACGATGGAGCCGTTACGGTCAGTTGCTGGGCTTCACTGACTGTTCCGGTATGTAACCCGCTATGACCATGACCGTTTTGAGTCGGGTGACGGCGGTCACCGCGAGGAAAGGGCTGAGTCAGTACCGCGCATACATTGGCCGTGGACGGATAGTGCCGTGAAAAGCACGCCAGAGACCGTAAAGAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAGAAAACCATCATACCACGCAGGGCGGTCTGACGCGCAGTATATGGAATACGATGCGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGACCACAGGAAACCGGCTTTGACGGCCGCACACCGCGTTATCACCACGACCTGACCGACAAACTTATCGCAACCCGAGGGATGAGGGCAGTCACCCACTAACATATGACCAAACAGACCGCCTCGCACCGCACCGTGAATGGCGAAACCACGCAGAGCAGTGGCGATGCGCAACCGAACGCGGCTGGCTGACAGACATCAGCCATATCGGCGAAGGGCACCGGGTGACGGTGCACTATGGAATTATGACAGTAAAGGCCGCCTCGCCAGTGAGCACCTGACGATTGCATCATCCGCAGACGAATGAACTGCTCTGGCGGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATGCCGGACAGCCTGCCCGCCGTGGGATGAATGGCTGACCTACGGCAGCGGCTGGCTGTCGGCATGAGCTCGGCGACTTACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCAGGGAAACGCTGCGCAGCTTTCGGCCGTTATGGACGCTCACCACCGCTTATACCCCCTGCGGAGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGGAACCACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCGCCAGACGGAGTTACGGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAAAGGTTAAACGCAGCAGACGCCGAAGATGGGGAGCGACAGGCAAGAGTAGCAATACGTGAAAAAGA
>ff281c20-4a4b-4775-9b8a-552530cf0b30
TTGTTGTACTTCGTTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCAGCGTCTGCTTGGGTGTTTAACCTACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCGGCAGTGTTATCGCGCAGCTGGCGGATATCCGCAGGCATTTTCAATAGAGCCGAGGCTCCCCACCGGCGCGGAGCGTTTTTGTCAGCTCGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGAACGTCATCGGTTTTCACCGGGGAGGACAGCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCCGCCGGGGCACGGTGGAAGGCCACGCCGGTGGGGCACCGATGCATTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCGCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAAGATAAGAACAATTAGAAAATACTTATATATATTTCCTTGAAGGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCGAACATCTTCCTGTTAAAACGCCCAGCGTTTCCGCTGGCGGTTTTCAATATTCAAAACTCAGCAATCAATAAAAATCACCAGTTGCCTTTTCGGCCTGATCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACATCCACTGCAACCGCATAAATACGGCGTAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCGCACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCGCGGAAAAATGGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTGTGTGAATTTTTACTACTCATCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACGTGGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTACGCGAAATCTTTGCGTAGATTCTACCGGTATCGCGCAGGCCACTGGAGTTGCACTGTAGTGCAGGCGTGATAACCGGCGGCCATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTTATGCCCTGATCAATGCGGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTACTGGCGCGTCCGCTTTAGGCAGCAGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCCACAGCAGTTGCCAGGGCACGATAAATCCGGATCTGGCGCTGAATACCGCCGTAAGCTTGTCACCAATACCAATAGCAATCTTATAGCGGTGAAACCACGTTGAACTATTTCAGCCAGATGGCGGGCAACGGTGCAACTTTCTTTCCTACCATAGCGGATTGCGGTGATTTTGCCCATCGTGCGTTTACCCGCCAGGTATGGTACGCTCGGGAATGCCTGAGTCGATCTGCTCGCATCACGTTATGGAGTGCTAGTCCTGTGGCGTTATTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCGGGCTGTGAATACCGTTGAAGGAGCGCAGCAGCTGTGCCATAGATTTCTTCTCAGGAAGCGATCAAGATGCTCGGTACTTAACGGCGGTGGCCTCTTTAATGGGTTAAACGCGAAGCGAACGCCGCAATATCAGCACC
>912e1555-f5ff-4eee-8431-e133aad618c5
TTGTTATGCTTCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCCGGCGTCTGCCCGGGTGTTTTAACCTCGGATGCCGTTGTCCCGGCACCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAAGCAGTTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGAGCTTCTTCTGCCCGCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCAGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTATTGCGCCCAGAAGCGGTCCACCAGCCAGTCAGTACCCGGTACGGCGGCAGCGGCACAGAGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACACCAGCCGAGCAGCCACCACGGCCTACCCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCTTCCAGTTTCGCCACGCGGCCGCTATCTGCCAGCCACGAGCTCGCTGCGGCTGTAACCGTCCTCACCGGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCGCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGAGGCCGAGGCTCCCCACCGGCGCGGGCGTTTCCCGTCCGGTAACTGCTGTAGGTGCAGAATGAACGGCAGCGGGCCGGGCAGGGGCGATGTCAGTTTCACCGGGAAGGACCTTTGCGCAGGCAGCCTGGTTGACCAGGGTGGCCGGACGTCACCCCGCCGGGAGCACCGAACAGCAGGCCACGCCGGTGGGGCACCGATGCTGCGTACCCGGCTGAACCCTGGACAATGCCGCCATGCTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTGTTGTCTGCTGGCAGGCGAAACCCTACCAGGTTATGAAAGCCTTAAGAAGTGAGATATCTGTCAGATAAAATTGAATTGGAAAATGTTGCTCATATATTTCCTTGAATATATGTTTCGATTGGTATAACGATGTCTAAATGTTCACCACAGACATCTTCCTGATACAAAAAAACCTGCCAGCGTTTCCGCTGGCCAGTTTCAATAATATTCAAACTCGGCAATCAATAAAAAAATCACCAGTTGCCTTTTCGGCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGCGATGCAGGTAGCTGTAAAAGCGGGCGGTCTTTCCAGAAAACGCCGAAAGGCAGCACATAGAGACGCCCGCTGCAGCCGCATAATTGCAGCGTAAAAGATAAGCCATGCGGGATATTCTCTGTAGAGTTCCATGCTTCTCCCCCGCCTTTGTATCTACCCGGTGAATGGCACCGGAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTGCTCATCCGACCATATTTTTGCTTATTGATGGTTTATTTACATTCATCCGCGAATTGGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCCTTGGCTTTTTTGCCATTTTATACTTACACACCCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAAATTCTACCCTTCGGTATCGCGCAGGCCGCAGATTGCACTGTAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTTAGGTTAAACGCACCGGCGAACGCCGCAATATCAGCACGCA
>d1ecaa6c-a911-4cd4-86ab-f16ed29ddfde
TTGGTATGCTTCGTTCCGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTCTGCTTGGGTGTTTAACCTGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCAGGTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTCGTTGGTTCAGATAAGCGCCAGTTGTTTACGACCTCATATTCAGTGCTCACTCAATATCATCGGAGAGATATTCCGCCACCGGATGGCGCCAGGGCGAGGATAAAAGTCAGTGCGCCAACCAGCAACGCACGGTGCCGTTAACAGGGGCAACAAACAGCGGGCCGTGCGTTGGCAGCGATGCCGAACTGGCAGCGGCTCTTTTTGCTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTAATCCGGCAAAGGCGCTGCCGTTATTTGTTAGCGGCAGATGGCGGCGTACAGCACTTCGCTTCGCCATGCGGGCCAGGGTTGAGCATATGTACTACGTCTGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAACACGTCAGGTATAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCCGCGTACGTCGATTTTTGCAAGATATTCCGGTGTACGACCAATCATCAGCCGTAATAAACACCGCCAGCAGGACAAACGGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCGCTTCGCAATTTGCATCAGCCCATCGGCACCACATGCCACCGAGGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACGAATACTGACCAGCACGCCGAGCAATACTCTTTACCTTCCATATTGATGCTGCTGGTCGTGCCCAGTGCCAGCAGATGAGTTATGAACTGCCCACATCACCACGCGCCTGCGCAGATGACAAAATCGCTGACATCGCCCACAGCAACGCGCCCCTGGCGGCGATCGCTATCACTTCACCAAAGGCAAAGCACAGCGCCGTGGGATCAAGAAGATCGCCAGCATCATGCACGAAGTTGGTCGTGCGGTTGGGTTTTCAAACGGATGCGACGAGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCTGAGAAGCTACAATTTATAAGGTAACAGCTGTTGCGCTCCTTCAGCGAGTATTCACAGCCTGATAAGGCAGAAGTTTTACAGCAGCGCACCTTGTTGAATAAAACAGTGCAATCAACAACGCCACGGGGACTACTTACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACCTTTACGGATGAGGCAAAATCACCACCAATCCGCTGGCGGCAAGAGAAAGTTTTACCGTTAAACCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTTAACCAGATCCCACGACAGCCTGGCGGCTGCTGTGGATTCAGCGGCAGATGGTGCTGACCGAGCAACGCAAAAACAGCACCAACTGGCATGTTCAGGCCGAGAATGGCACAAAGATGTTACTTCCAGTTCATCACTCACGGTCAGAACCTTGAAGTGCGCGAAAAGTACGCGCTCAACGCGCCCGTTATTGCCGGGAAGAGGAATGTCATTAATCAACCGCATATTACGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGCGTAGTAAAGCCGTGGCGATCAGTAGAACCCTTGCGCAGCCATCAGAACGCCTCCCGCATTGATCAGGGCATAAACCAGATAGCCAGTAATAAAACGCCAGCAATACGCCAGTTTATCGCCTGCACTCTGGTGCGCCTCCGGTGGCCTAAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAGTATAAAAATGGCAAAGCCATGATTTAAACTAATGTTTAGTATTAATTTTAACTTTGTGTAACTTAAATTGCAGGATGAATGTAAAATAAACCATCAATGGCAAAAAATAAGTGGTCGGATGGGTAGTAAAATTACACAGACTGGTACTATTTTCATCAGATAAACAAATTCATTTTTTTCGGTGCCATTCTACCCGGGTGAACACAAAAGAGGGGAGAAAAGTATGGAACTCTACGAGAGATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGACGTTCTGGCGCTGCCCTTTCATGTACTGGAAAGACCGCGCTTTGCTTTTTACGGCTACCTGCGCGCGTCTGGTCGAAAACCGGCGATAAACCGGTGTGTGGATGGATCAGGCCGAAAGGCAACTGGTGATTTTTGATTGCTGGAGTTTTGAATACGCATTTGAAAACCGCCAGCGGAAAACGCTGGCGGTTTTAATATCAGGAAGATGTTCGGAGATATTTAGACATCGTGCCAATCCGAAACATATATTCATGAAATATATATAAACATTTTCCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTGGGTTTCTACGCCTGTCAATGAACAAATAACCCGATAAAACAAGGATGAGCGGATGAGCGGAAAACCGGCGGCGCGTCGGGGCGACATATGACGCGTCATGGCGGTAACGTTAATCAGGTTCAACCGGGGTACGCATCGAAGGGTGCCCCACCGGCGTGAAAGCCTGTTCGATTGATACCCCGGCGGTGACGTCAGCCATCCGGTCAATCCACTACTCGGTACAGGTCCTTCGGTGAAACCGACATCCCGCTTCTGCCCGGCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCGCCGGTGGGGCCCTCGGCCAGCTGGAAAATGCCTGCGGATATCCGCTTACGGCTGCGCGATAACGCACTGATCTCAGTGATAAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTTGGTGAGGACGGTTACACAGCCGCAGCGAGTCACGCAATGGCCGTTGCGCGGCGGCATAGCGAAACTGGATGAAAGGTCAGCTGGCCCGCGCTCTGGCGGAAGCTGGAAGAACTCAGCAAGTCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGCCGTGGTGGCTGCTCCGGCTGGTGTGAGCGAATTGCCGAAGCGGATGAGGTGCTGCCTGCGCTGCTGCCGTACCGAGGTACTGACCGGGCTGGTGGACCGCTTCCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCGGCTGGTACTGACCACGCAGGCGGGCGGAAGCCGGCAGCAGGCCATTTCAGCGGCGGGACGGAACCGTCCGCTTTTCTGATACCCTGCCGGATTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCGGAATATGCCGGAGGAATTTACCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCAGACGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATATTGATAAATACGGGGCCGGATGGTACGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAACGACGGGCGGGTGACAGAACAACAAACCCGGCAGAAGCAAGTTACGCGTATCCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACGCAGGGTGAAGGCAATTTCAAACCGGAGTGTAGTGAAGGAACACGCCGGACGGCAGCGTCACGCAAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACAGTTCACGCCAGGTGGGACAGCAGAATACAGTCCGGATGTGGTGACTATCACGCATCACCACGCGCCGGATGGCAGGACGTCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCGGGAATATGATGGAATGAAGTTGCGTCTGATTCGGAAACTGCCTGACGGCGATCACCCGCTACCGTTATGATATCCACACAGTGACTTACCTGCGCAGCGGAAGATGCCACTGCGGCGGCAGGAGAAGAAACCATGACGTGCAGGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAGCCCGCTTCATGACCGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGGAAAGGGCTGAGTCGGTACCGCGCGCTTCGACAGCAAAACGGACAGTTAATTGCCGTGAAAGACGCAGGGCCATGAAACGCGGTATGAATGCTTGCCGCCGAGCCTGACCGCCGTCATTTGCCCCGGACGGCGGCGAAACGGACACAGTATTGCCTGATGCATTAAGAAGGGAAAAGCCATCTCTGTACCCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGGTGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACACCGCAGCCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACGACCTGACCGGCAAACTTGTCCGCAGCGAGGATGGGGGCTGGTCACCCACTGGCTATGACGAAGCAGACCGCCTCCACCACCGCACCGTAATGGCGAAAACCGCAAACGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAAGGGCACCGGGTGGCAGTGCATATGGTTATGACAGTAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCGGCATGAGACCAGACATGCGTACAACGCACGGGGACTGGCAGACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCACTACGGCAGCGGCTGGCTGTCGAGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCTGCAGGAAACGCTGCGCAGCTTCGGCCGATTATGAACTCACCACTTATGCCTGCCGGGCGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCACCCGATTACACCTGGAACGTGGCAGACTCATCCGCATCAGCGGCCCGCCGAACCGGAGTTACAGCTACAGCACCACCGGCGACTGACCGTTCACCACCGCAGCGAATCTGGATATCCCGCGTCGCGCATACCTGGGCCAGCGGGTAACCGCCTGCCCGACCGGGCACTGCCGGACAGCGCCCTCAGCGTAACGGCCGGATAACCGTATCGCCCGTGACACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAAAAACCGACCTCATCGGGAAGGGGTTATCACGCACCGGATGATGAGCGCACCCACCGAACCATTGACAGTCGGCACCGGCTGATTGCACCTGGACAATATGCAGAGCCCGCTGGTCGAAAGTCTTCTCTTTACGACCCGCTGGGCCGCAGGGTGTAAAACGGGTATGGCGGCGTGAACAGGACCTGACGGGCTGGGTAACCGCTGTCACGGAAACCGCAAGTGACCTGGTACAGCTGGGACGGCGACCGCTGATATTCACAGAACGACGGAACCCGCATCCAGACGATTTAATATTCCGAGGCTTCACGCCATCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACACAGCGCGCCACCAGCCTGGCGGATGCCCAGCTGGCGATCCGGTGGCGAAGACGGTGGCAGGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATCATCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGCGGTGAGAAAGCCGCCGCTGGCTGGCATCGATGCGGCTGACGGTGGCGCAGATCGCAAACCAGATGGACCAGGCGATACACGCCCGGCGCGAAAAATTCACCTGTACCACCGACCATGCGGCTGCCGCTGGCCATATCAGCACGGAAGGGACAACGGCGTGAGCGCAGAATGCGATGAATGGGTAACCTGCTGGATAGAAGAACCCGCATCTGGCTGCAGCGGCTTATCCGCCTGCCAGGGCAACCAATTATGATGAGGAGTCCGGCCTGTAATACAACCTGCCGCTATTATGACTACCGGGGTGATATATCCTCGGGGATCCGTTGGGCTGAAAGGGGATGGGAATTTTATCGGTAATCCCGGATCGATCTCAAATATAGATCCATTGGATTGAAACACTACAAAATGCATTAAGCCACTACATTCAATGGTGGAACTGGTGAAGAAGCGGTCCAGATATGTGGGGGATCGTTCCTATCATCCAATATCGCTGTGTCCCCAGATGGTAAAGGACTATACTTGTGGTGGCCAAGACCAACGGGGAGAATCAAGGGAATGGTCTATGGGGGCCAGGTAAAACAGTAATGATACAAAGAAACACTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGGAACTGTTTAAAAGGGAAGTTTAAAGGTAGAGGTAGCGTTATTCTCATGCTGCCTGATATATTCCGCACCTATAAAGTTTAGGGCTATTTAAAAACTGCAAGACTGGTCTAATGATTCTTTAGAAACATGTAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGAGTGATGTAATAGAATATATTATTTTTTATTCAGGAGCTATATGGCTGGCTTATCAGCTTTTTTAATACTATTCTTTCCGTGCATAGACTTTCACTGTGGAGCTCCTCGTGATGTAGGCGAGTTAATTAGTCTCATGTCTTATGAATGATGGTAATATATTTTTCCAACAGGCATAGTATTCTTTATTGCTCCTATTTATAGGGACTGTATCAGACATTATTGGCGTAAAGTTGATAGTAAGTATATTATGGCGATAATATGGCTGTTTTTCTGTCGGGGGTATATTCAATGGTTTGTATTAAGTAACATTATAAACAAATAAATTAAAGTTAATTTATGTATTATTATATGTGCCTGGGCATTGATATCCCGTATGCCTGAAACCAAACGCGGGTAACCACCTGCCCGACCGGAAACTGGACGGCACCCCTCAGCATGTGGCGGATAACCGTATCGCCCGTGACGCGCTATCTTTGCCGGTATGACCGTCGGCAGACTGGTGGAAAACCGACCTCCATCCCGGAGGGTTATCACTGGATGATGAGCGCACCACCGGCCTGCATTACGACAGTCAGCACCGGCTGGTGCACTACTTACGCGGACACAATAAAGGCCGCTGGTCGAAGCCGCTATCTTTACGACCCGCTGGAGCGCAGGGTGGCAAAACGGGTGTGGCGGCGTGAACGGGATGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACTGGTACGGCTGGGACGGCGCGACCGCCTGACCGCGATACAGAACGGCAGAACCCGCATCGAACGATTTATCAGCCAGGGGAGCTTCGCCACTCATCAGGGTTGAAACCGCCACCGGTAGGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTGGTTAAACCTTGCAAGCAGACGCCGAAGATGAGGCGGCAGGCGGGACAATGCACGCGGCA
>4dbe677b-04b0-4738-8777-a15ee6cd652b
TCGGTACTTCGTTCCGGTTACGTATGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTGCCACAGCGTGGCGGTTTGCCAGTAAAGACGTCGTCCAGGGCAATCCAGCAGAATGGTCAGAACTTAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCCACCATCGCGATCATCCGATCAGAAATGTCTCGCCGGTTAACGCTACCTCAATCACCAGCCAGTCAGAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCAGTTCACGGATCACCGATTACTTGATTCCCCGGTGATGGCGCTGCATCGACCGATGCACCCCCTTCAATAACTTCACATCGCAGGGGATAATATCGCCAGCTTCTACCAGTACGATATCTGCTGCAGTTGGTCGGCAGGAACTTGTCGCCGCAGCGCCATATTTCGGCTCTTGCGGGCAAGAGAGCAGCGGTTTTTCACCTTCAGACTGGTGGCCTGCGCTGCTGCGGCACTTCTGCCAGCGCCTCCGGCGAAATTAACCCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTTCAAACAGCGTGCCAGGCGCATCACCGCTTGCCATCGCGATGCTAATACGGGTGGTCAACCGGACTGCCGATCCGGACGATAAACATCGCGGATTGCGCCATTGCGCCTGCGACAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCATTGTTTGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGGTATTCCGCCACCGGACCAAGCGCCGGGCAGGGATAAAGGTCAGTGCGCCAACCAACAGCACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGATGCCGGAGCTGGCAACGGCTCTTTTTTACTCCACCAGCAGACCGGCAATTGCCATCACCGGGATAATCACCCCAGAAGCGACCGACAAACGCTGGGAGACGCCGGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCATTACAGCACTTCGCTAAAACCATGCGGGCTGGGGTTGAGCATGGCGCTACGTCCGGCGTCAGTCATCATCGTAACGCCGCGCCCATCCAGCGCCAACGTCAGGGGGTAACCAGGATTGCCAGTGCAGTCGGGTTTCATCTCGCGCGTCGATTTTTGCCAGATATTCCGGTGTACGACCAATCCATCAGCCGGCAATAAACACCGCCAGCGGGACAAACAGCATCATGCCGTAGGAGCCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCGCAAAGGCGGTAAACGAATCATGCATCGCAATCACCCACCGCGCCACAGGGAAGCCGCCGTCGTCACGACGCAAACAGGCTACTGACCAGCGCCGAAACGGCTCTACCTTCCATATTGTGATGCTGCTGTCCGTGCCCGAGATGCCAGCCAGATGAGTTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACCAAATCGCGACATCGCCCACAGCAACATGCGCCCCTGGCGGCTTAGATCGCCCATCCACTTCACCAGAGCCAAAGCACAGCGCCGTTGGGATCAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCTCCTTCAGCAGTATTCTGGCCTGATAAAGGCCAGAAAGTTTTACCCAGCGCACCATTGTTGAATAAAAACAGTGAAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACACGCGGATGAGGGCAAAAATCACCGCAATCCCGCTGAGGTTAAACACCCAAGCGAACATGCCAATATCCCGGCACC
>3fa4862f-bf61-4f3d-a13e-18b24be3b2a2
TTGATATGCTTCGTTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTCGTGCGTTGGCAGCATGCCGGAGCTGGCGGCTTGGCTCTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACATAAACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTAAACAATATGGCAACCCGAGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCGTAGCGCCCCGATCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCCAGCACCAGCGTCAGGAGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTTACCCAGATGTTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCCTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGATAAACAGATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCAATCACGACCGCAAACAGGCTACTGACCAGCACGCGAAACGGCTCTCTTTACCTTCATATTGATGCTGCTGTCCGTGCCCAGTGCCGGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCGGATGACAAAAATCACTGACATCGCCCACAGCAACATGCGCCTGGCGGCATCGCCCATCACTTCACCAAAGGCAAAAGCACAGCGCCGTTGGGATCAAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTCAAACGGATGCGACGAGTTGGCATTAAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCTGATAAGGCAGAAAGTTTCACAGCGCACCTTGTTGAATAAAAAAACAGTGCAATCAACAACGCCACAGGGATAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCGAGCGTGCTCATGCTCTGGCGGAGTAAACCTTGCACGGATAGGGGCAAAATCACCACCAATCCGCTTTGGCGGCAGAGAAAGTTTTGCCGTTAAGCCCGCCATCTGGCTGAAATAAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCAGCATGTTCAGGCCGAGAATGGCACAAGATATTGCTTCAGTTCATCTCACGGTCAGAGACATGAAGTGCGCGAAAAATTACGCGCTCAACGCCCGTTATTACCGGGAAGATAATCATTAATCCAGCCGCGCCAGCCCGCTGCCACAAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCGAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCGCCAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCAGTGGCCTAAAGGTGATACCGGAATTAGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAGGTTAAACGCAAGCAGACGCCATGGCGCGAAGCGGG
>9b070b44-f197-4952-8863-7e27e04ff558
ATTGCATCGGTAGCCGCTTCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGGCAGGTGTTTAACCTCATGGCACCACGTTGATTATGTGAAAGGTGACCCACGACCTGCCACAACTGGCGGCGCTGCGACCGCTGCTTACGGCTGGTGAACGGGCAGTTGCAGGAGGAAGCATGATTACACGGTGGTTCTGGCGCGAATGGCGTTCACCGTCGCTATTCAATTATCTGGCTGGCGCTAAGCCTGGCGGTGGCCTGCGTGCTGGCGCTGGGCAATATCAGCGATCGCATGGAGAAGGGGCTTAAGCCAGCATTAAAGCCGTGAGTTTATGGCGGGCGATCGGGCGTTGCGCAGTTCACGCGAAGTGCCGCAAGCGTGGCTGGAAGCGCAAGAGCGCGGCCTGAGAATCAGCAAGCGGCTTGACTTTCGCCACAATGACCTTGCAGGCGACACACCGCAGCTGGCGAGCGTCAAGCGGTGGATGATATCTACCGATGTAGCGGCGATCTGCAAACTAATCCCCTGGCCTGAAACCGCAGGCAGGCAGCGTATTACTGGCCCACCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGGCGGTAGACGATGCCACCTTGCGGATTGCCGGAGAAGTGATTCAGGAACCAGTTCCGGTTTAACCCTTCAGATGGCTTTCCGCGTCTGATGATGAATCGGATGTCGATAAAACCGGAGCCGTGCAGCCGAGGGAGTCAGGTCACCTGGCGTTATAAATTCAGCGGCAACGAGAACCAGCTCGACGGCCTATGAGAATGGTTGTTACTGCCTCAGCTTAAACCCGAACAACGCTGGTACGGTCTGGAACAGGACGAAGAGGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCGCTGCTGCTGGCAGTGGCGAAAGCGGTGGCAGTAGCGATGAACTCATTACTGTCATGATCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGAACTGAGCGCAACTTCCGTAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAACGTGTTGATGTTGCTTTCTTCAAGCCCAGTTCTGCCCTGCTGCACCGCCAAAGCCAGCCTCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGGTCATCGCTGCTGGTGGGGCTACGGCCCATATCGCTTGTTGCTGGCAACGCAGCGCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAGGTTTTAATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTGTAGACGGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGCTGGATGCTGCTGAATGGCCTGCTTCGCCGCATGACGCTGAAATCGCTTCCACCTCTGCGCCTGGCGGTTATGCGCGCCTGTTGCGTCGTAAACGGGTCAACGTTAAGTCGGCTTTTCGGCATTTTCGCTCTCCTTTATGCTGCTGGCGCTGCTGCTGGTGTTGCGTAAGCGTCTGCTCGACCGCTGGCAGCAGCAACTACCTCCAGAGAAAGCCCGAACTACTTTTAATTAACATCGCCACAGGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACGCATCAAGATGGTCGGAATCGTTTATCCGGTGGTGCGCGGGCGCGTGACGGCAGTTAACGATAAGCCGACAGAGGTAATGAAGATGGGCGGCAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCGATCATAATCCGATTGTCGCCAGTAACTGGCCATAAAAAGCCGATGAAGTGTCGATGGAGAGGGGCTGTGAAACAGCAAACGTTGCCCTCGGTGATACCGTGACTTTTATGGGCGATACCCAAGGTTCCGCGCTAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTCTATTTTATTTTCCCTGAAGGGCATTGAACGGAGCAACCGCAAACTGGCTTACCGGTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATAGCCTGTTAGATATTGGCGCGATTTTAAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGAGCGCTGGAAGTGATGGGTAATTACTAGTCACCGCCGGTATGTTGCTGTTGCTGGCACGGAAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGGTGTGGCGCACACTCGGTGCGGGGAAAAAACTGCTGCGTACCACGTTGTGGTGTAGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCTGGTGAAGTGCCCAAGGAAACGGCGCTGGCGATGTTGCAGGCGAAGGTGTTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAACTGAGCGCTGCTGCTGTCGCTTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAAGAGCAAAGGCGCTGTTCGAGCCGGTTTACTTGCGGGGTGATGAGAGTAAATAAGGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAGAAATAATTCTACAATATATGTTTCGTGATGAAGTGTTATTGAATTGGTGATTTCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAATTAATTTGTTGATGATGAATTCATCTGTGTGCTAAAGTAGTTTAATAAAATATTAGAAAGAAATTGACCACCAACAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGTGAAAAATATATAAATACATTAGCTGGTCTTGTGTGTCATTTTATTTTTTGTGCTAACAGGGATATGAACAATAACTAAAAGGGCACTATGAGCGGAAAACCAGCGGCGCGTCAGGAGATATGACTCAGTATGGCGTCCCATTGTCCAGGGTTCGGCAGGTGTAAAATTGGCGCGCCCACCGGCGGTAGCGTGCTCGGTGTCCGGGCGGGATGACTTCCGGGCAACCCGGTAAATCGCTGCTGAGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTTACTGCCGGCCCGCTGCCACCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAGGGCGCCTGCACCGGTGGGCGTTTTCGGCTGGCTGAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGACAACGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGAGGCGGTGTGCAGCCGCAGTGAGTCAATGTGGCGGTGCGCGGTGAAATAAAGAACAGCACACAGCCGGACGGCCCTCTGCTAACGCGGCTATTAGAGCGCTGCCGCCGGATATCCCGGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGCCGTGGTGGATACTGGGTGGTCTGAGCGGGTGCGCACCGGAGTGCTGAGGACATTACTGCCAGCGCCGCGCGCTGCTGCCATTACCAGGTGCTTACCGGGATGGCGGACCGCCGGACGCTGACGTACCGGCGTAAGGCCGCCGGTGACTGGCGAAATCACCGGCGTGACGGACGGTGCCGGGTGAGTTCCGTCTGGTGCTGACCACGCAGGCGCAGCGTGCGGAAGAAGGCCACACCTCTTCGCTATCTTCTTCTGACAGTTCCGCCCTCTCTCGGCCTCAGCGTTTCCCGACACACTGCCCGGTACCGAATGCGGCGGCCCGACAGAATATCCGCCTTTCGGCGGTGTGGCTGTCACGACCCGGCATACCCGGAGGCCTGCCCGCTGCGCGCCACTGGTGCGGTACACGTATGAAGCCGGTGAACTGCTGTGTATGACCGCAGCAATACGCAGGTGCGCGCTTTCACGTATGACGCGCAGCACCAGGCCGGATAATTGGCGCACCGTTACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGAGCCCGGGTGGTGGAACAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAGCAGGACCGCATCACCGTCACCGACAGCCCTGAACCGGCGTGAGGTGCTGCAGCCTGAAAGGCGGGGCCGGGCTGGAAACGGGTGGTGAAAAAAGCGGCGGACGGCAGCGTCACGCGCAGCAGGTATGACGCGGCAGGAAGGCTCACAGCGCAGACGGACGCGGCGGGACGGAGGACGTGCGGTCTGAATGTGGTGTCCGGCGATATCACGGACATCACCACACCAACAGGCAGGAGACGAAATTTTACTATAACGTGAGACCAGCTGACGGCGGTGAATTGTCCCCGGACGAATGGAGAGCCGCCGAGAATATGATGAACCAGGCGGGCTGGTATCGGAGACATCGCGCAGCAGGAGCAGTACGCTACCGCTACGATGACGCGCACAGTGAGTTACCGGCGACGACAACGGATGCGACGGGCGGCACCGGCAACAGATGACCTGGAGCCGCTACGGAGCGGTGCTGGCGTTCACCGACTTGCTCAGGCTACCAGACCCGTTATGAATACGACCGCTTCGGCCAGATGACGGCGGTCCGCCGCGAGAGAGCATCAGCCTTTACCGCCACTATGACAACCGTGGCCGGTTAACCTCGGTGAAGACGCACAGGGCCGTGAAGCGCGGTATGAATACAACGCCGCAGAGCGACCTGACTGCCGTTATCACCCGGACGGCAACCGGGCGAGACACAGTACGATGCGCATTGGGAAAGGCGGTCAGCACCACGCAGGGCGGGCTGACGCGCAGTATAGATTACGATGCTGCCGGACGTGTCATCAGCCTGACCAACGAGAACGGCAACCACAACGTCTTCAGTTACGATGCGCTGGACCGGCTGGTACGGCGGGGCGGCTTTGACGGGCGGACACCCAACGTTATCATTGTAACCTGAGCCGGAAGAACTCACACAGAGTGGGGATGAGGACTTGTCATCCTCTGGTACGCTACGATGAATCGGACCGTATCACTCACCGCACGGTGAACGGCAACCGGCAGAGCGGTGGCAGTATGATAATACGGCTGGCTGACAGACATCAGCCACCTGAGCGAAAGGCCACCGTGTTGCCGTCCACTATGGCTATGACGATAAAAGGCCGCTGACCGGCGAATGCCGAACCCGGTGGAGAACCCGGAGACAGGGGAACTGCTGTGGCGGCATGGGGCGAAACACGCATACAACGAGCAGGGGCTGGCAAACCGCGCGTCGCCGGACAGCCTGCCGCCGGTGGAGTGGCTGACGTATGGCGTTACCTGGCGGGAATGAAGCTGGGCGGGACGCCGCTGGTCGATATACTTGGAACAGGCTACCGTGAGACGGTACGCAGCTTCGGCAGCATGGCGAGGCAGTATGCCGCATACGAACTGACCCTTTGCCACCCCGCAGGCCAGTTACAGAGCCAGCACCTGAACAGCCTGGTATGACCGTGACTACGGGTGGAGTGACAACCGGCGACTGGTGCGCATCAGCGGCCGCGACAGACGCGGGGCCGGCTACAGCGCCACGGGCGGGCTGGAGGTGTGCGCGCCTCGCACCAGACCTGGACATCCGCATCCCGTATGCCACGGACCCGGCGGGCAACCGGCTGCGGGCCAGAGCTGCACCCGGACGGTACACTCACAGTGTGGCCGGATAACCGCATCTGGAGGATGCGCACTATGTCTACCGCCACGATGAATACGGCAGGCTGACGGAGAAGAAGACGGACCGCATCCGGCGGGTGTGATACGGACGAGGGACGACGACGGACCCACCACCACTACGACAGCCAGCACCGCCTGGTGTTACTGCACGCGGATACAGCATGGCGAGCCACTGGTCGAGAGCCGCTACCTCTACGACCCGCTGCAGGACGGCGAATGGCAAAACGGGTCTGGCGGCAGGGCGTGACCTGGCAAGTGGATGTCGCTGTCGCGTAAACCGGAGGTGACGTGGTATGGCTGGGACGGGAGACGGGCTGACGACAGTGCAGACTGACACCACACGTATCAGACGGTATACGAGCCGGGAAGCTTCACGCCGCTCATCCGGGTCGAGACGAACGGAAGGCGGGAAAAACGGGTTAAAGCAAGCAGACGCCGAATGAAACGT
>70a6e1ac-2b52-46e4-83ac-0a49cdc637d4
ATCGGTATGCTTTGGTTTCAGTTACGTATTACTGCTGCCGCAATCGCTCTATATTCCGGCTCTCTTTAAGATTGTTTAACCTGGGTCATCAGCATCATTTTGCAATATTACCCTCGTCGCCAGGTCAGAGATTTAGGGTCAGGTCGGCCATAATGCCTCTTTCGCCGCTGGGTGCCAGGTTCATCGCCACCGGCATCTGCCTCGCGCCTTTCCGAATCGTTGGTGCCGTCGCCAGAATATGCAAACGACCTTCCGCCTATTGGCCGGATCGAAGTAAAACCCGGCCTCCGGCGGTGTCGCTTCGGCGAAAATCATCGACACCCACTTCCCGCAGCAATCGCGGCAACGGTCGAACAGACGCTTCGCCGATAATCATCACCATTTTAATGCCCATTTTGCCGCTGGGCGGAAATACTATTTTGCTGTGACGATATCTTTCAGCACAATAACGCCCAGCACACGGGGCAGCTTCACCACCACCAGCGGCGTGAAACCACGACGCGCAACCTGATCGAACTTTTGATCAACATTCGGCGGGAAGTGACCACCGTTAGCCTCGCTGCCGGCGTGAAATGGCATCGACAGACGCTTTACGGATCGTGCGATTTGCCGATGTTGATCCCATCATCCGGCTTTGCACGTATTGCCAGGTTCGGGAGTGGCATGGAGCGACTGCACATCGCGCTCGCTGAGTTAAAACGCTTTGCTTGGCGAGATCACAATACTGCGGGCTTATTCCGGCGCTTCATCAGCCAGCAAAGCCAAGTTATTATCAGCCAGCGTTTTCATCCACGCCCTGCGCAGCGGATAAGCTCCGGAGAAACGCCCTGACGGTTACCAGAGTGTGATGTTGCGGTTTATCCGAGTAGCAGAACGTCAACGTCACACTACCGCTTCAACTGCACGTCCGCTGGTAGCAATCATTTAACGCCTAACGCATCCGGCCATCCAGCGACGCCGATCACTGACAACAGACTTGCGCCAATAGTGGTTGGGATAGACAGACCGTAAGCGCCACAATTACCGTTGCTGACTGCATTACCGCCCCACGCGGGAAAACAGCTGGCGAAATGGCGGTTTATAAATCAAAAGACGGCTCTAGTCATGGCGCAATCAGCGTCGTCAGGGCAATTTCGTTCGGCGTTTTGCGTGCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATCTTCTCGCCGGGGTTAACGCCACTCAATCACCAGCCAGTCCAGAAAGACCGCGTGCCGCCGACGGCGGAAACAAAATCGCACCGGATTCACGGATCCACCGTACCGATTCCGGTGATGGCGCTTTCATCGTCGTCACCCCGCTCTTCACCGCTCGCAGGATAGCCTCGCCAGCTTCTACCAGTACCGATATCGCGCTTTTACAGGACAGGTGGCCAGGAACTTTGTCCGCCTGCAGCGCCATCATTCGGCTCACGCAGCTTGCGAACAAAGGCAGTTTCACCCTTTCAGACTTCGGCCTGCGCTTTGCACGGCCTTCTGCCTTTCAACGAAATTAGCGAATTAAGTACGGTGATCCCCTGGCCAACCGCTAATGGCCGCACTAAAGCAGCATTGCTGACATCGCACCGCTTACCATCGCGATGCTAATACAGGTGAATCAACGACTTCACCGATCCAGACGATGGCATCACCGGATTGCGCATTGCGCTTCACGGTTTAATTTTCTGCCGCTAAGCACCAGCGCCTGAACGGCAAGGGTATGTTGTTCGAATAGCGCCGGTTATTTGACTCATATTCAGTGCTCCTCAATATCATCAGGAGAGATATTTCACTTCCGGGACCAAGCGCCAGGCGGGGCAAAAGAGGTCGGTCGCCAACCAGCAACACGGACACCGATTAGCAACAGGCCAACAAACAGCGAGGCGACGGGTGAAAGCGGCATCACCGGTGTTATCGACCGACCAAACATGCGAGCGCCGACAAACGGTTCCAGGGCTGCAGGAGGTTGGCGCCAATCGGCAAAAGCGCTTTACCCGTTGTTGTGCAACGGCGGATGGAAACTTGCGGCATTACCGGCACTTCATCAAAACCATGCGGGCCAGAGGTTGAGGCATGGCGCCCATTCCGGCGTCGATTTCTGCGTATCATAACGCCGCGCCCATCAACACCAGCGTCGGTAACCGATTACGCCGAGTGCGGTCGGTTTCATCTCGCGTGCGTCGATTTTTTGCAGATCATTCCGGTCCGCTGCACGACCAATCATCAATACCCGGCGCAATAAACACCGCCAGCAGGGACCGACAGCGTCATGCCGTAAAGACCAGAACCGACACCGCCGAACTTACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCAAAGGCGATAAACAGATCATGCATCGCAATCCACTTACGCCACAGAGGAAGCCGCCAAATCGTCTGGGCGCAAAACCGGAGCTGCACTGAAGCCAAAGCACGCCGAAACGGCTTATAACTTTACAGCCTTCCATAACAGGTGCGCTTATTCGACACTTTGAACGCCCGGCAGATGAGGATTACACGAACTTCTGCCCACATCACCACTTCGCAGATGACCAAAATCACTGACATCACCCACAACAGCATGCGCCTGGCGTGATCGCCCATCACTTCACCAAAGGCAAAACTTGCACAGCGCCGTTGGGATCAGAAGATCGCCAGCGGCATCGAAGTTAGTCGATGCGGTTGGGTTTTCAAGCGGATCACGGCAGGATGGCGATTAAAGAAGCCACCGCCATTGAGCACCGAGAACATCTTGATCAGCTCACCAGAAACTGAAGCCCCGCCGAACAGCATTCTTCACTTCCTTCAGCGGTATTCACAACCACCGATGCGGTAGAAGTTTCTGGCAGCGCACCTTGTTGAATAAAAACAAACCGCAATCAACTTAACGCCACGGGGACTAGCACCATAACGGCGATGCGGCAGCAGATCGGCCAAAGGCATTCAGGCGGTGCTCATGCTCTGGCGGGTAAACTGCCGCACGGATGGGGGGCAAAATCACCGCAATCCGCTGGCGGCAGAAAGAAGGTTTTGCACCGTTAAATGCCATCTGGCTGGAAATAAACTCAGCGATGGTTTACCGCTATAAGTTGCCGTTGGTATTGGTGACCGAAGCTTGACGATTGGTATTCGGCGCGCCAGATCCCGCGGCGCCTGGCAATATGGATTAAACGGCAGATGGTGCTGACCGAGCAACGCAAAAAACAACTTCGCCAGCCCCAGCATGTTCCGGGGCTTACGAGAATGGCACAAAGAATTCAACTGCTTCCAGTTCATCACGGTCCAAAGAGACTTTGCCAAATTGCGAAAAAGAATACGCTCAGCACTTATTATGCCGGGAAGAATATCGTTAATCAGCCGCGCCAACCCGCTAAAAAGGACGCGCCAGCACCATTAACTTCCAGTAAAGCATGGCGACCGACAGAACCCTTGCGCAGCGTCAGAACCTTCCCGCATTGATCAGGCATAAAGCCAATCTTAAGCAATAAAGCACAGCACAATACGCCGGTTATCCGCGCACCACTCCCGATGCACCTCCAGTGGCTTCAAAGTGATACCGGAAGGGTAGGTCTGGCTGCAAGATTTCACCAAAATCTGCGGGCAGGTGCCAAAAAATGCAAAATGGCAAAAGCCAGCGGTTTAACTAATATTTAATTGATAATTTAACTTTTGGCACAATTACAGGATGGTCTTCAAATATAAACCGTCAATAATAAAAATGAGTGGTCGGATCGAACAAAATTACACAAAAGGCGGTACCATCAGATAAACAAATTCATTTTCCCGGTGCCATTCACCGGGTGGAGTAAAGGGGAAAAGTATGGAACTCTACAGAGGAATATCCTGCATGAGCTTATCTTTTGCCGTACTTATGCGGTTTACTGCCGGAACAGTTTCTGGCGCTGCCTTTCATGCTTTCTGGAAAGGCCGCGCCCGCTTTACAACTACCTGCATCATCTGGTCGAAAGCAACGATAAGAAGCCATTGATGGATGGATCAGGCGAAAAGGCAACTGGTGATTTTTATTGATTGCTTTGGTTTTGAATACATTGAAAACCGCCAGCCCGGAACGCTGGCGGTTTTTCTATCAGGAAGATGTTCAGAGGAATGTTGGGCATCGTTATACCAGTAGAAACATATGTTCGCCAAATATATACTCGCTATTTCCCTGAGCCGGCTGTGACAGATATCTTCGCCAAAGGCTTTCTTTATAAATCTTTAGGGTTTCGCCTGTCAGCGCAGGCAAATAACCCGATAAAGCTGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGAGTGTGACAGCATGACTTAGACATGGCGTGGCATTGTCCAGGGTTCAGCAGCCGGAGGTACGCATCAGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCGGCGGGTGGGCGATCCGGCCATCCGGTCAATCCACGCTCCGGTGCAAAAGGTCTTCGGGTAGGCTTCGACATCGCCTTTCTCTTGACGCTACCGTTCATTCTCTGCTCCACACCTACAGCGGTTACCGGACCCCCGCGCCAGGTGGGAACTCGGCAGCTGAAAATGCCACGGAATATCCACTTTCTGGCTGCGCGTGATAACACACTTTGTTCTCGATGATAGCGGCGGCAGCTTACTATTTTGAGCACCTGTTTCCGGGCAGGGGACGGTTACAGCCCGCAGCGAGTCACTGGCTGGTGTCCGCGGCAGCATGGCAAAACTGGATGAGTCACCAGCTGGCCGCACTCCGGCGGGCGCTGCCGAGAGAACTCCGCTTCAGATCCGCTCGGCCCATCTGGCGACCAGCAGTCCGCAGGAGCAAAGCGGTGGCTACGCTCAGCTGGTGGCAGGCGGGTGCAGAAGCGGATGAAGATTTTCACCACCGCCGCTGCCGCCGTACCGAATTTTCTTCCAGAGCTGGTGGACGCCGCTTCAGGCGCACACAGAACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCTTCCAGCAGCGACCAGGATGGTGCCGGGCGTCTTCCGGCTGAATTTTGACCACGCAGGCGCAACCGGGCAGAAAAGCCCGGCAACGAGCCATTTCAGCGGGACGAAGACCACTTTCCTGATACCCTGCCGGGTTACCGAATATAGCCGGGACAACAGCGCTCCGTCATGCAAAAGTCGCGGCGACGCACGACCCGAATACCCGGAGGGCTACCCGCCGCTGGGGCGTATGGCTGGACACCCGCAGCGAGCTGGCGGCGATTCATATTGCTTCACAAAGCCACACGAGTACAGCTTTTGCCCGATATTTCGTACGGGCCGGATGGTGGCGCACGATCACGGGCCGACCGGAAATCTGTTACCGTACGGCAACGTGGGCGGTGAACCAGAACAAATAAACCAACGGGCTTAGATTTTTGCGTGTCAGTACCGAGAAGACCCGCATCCACTCACCGACAACCTGAACCGCTGGTATTGAAGTCCACGCACGCAGAATTGAGCCGGTAAAAATGGTGAAGAAAAGATACACGGACAGCAACGTCACGCAAAGTCAGGTTCTGACGCGGTGGAGCGAAACAAGGCACAGACTGGATGCACCAGGCAGGACAATGGGAAATACAGTCGGGTAACGGTGACGGGCCTCATCACGCGCATCACCACGCCGGACGCGGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGAGCACAGCACGGCGGGCTGGAAAGCTCACCGGGAATGCTGATGAATGGGGCCGTCAGTTCGAAACTACTGACGGCGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCTGCGCAACTGGAAAGCCACCGGCAGCCGGAAAAACCGCGGCGTAGATTTTTGATTCCGTTGCTGGAAGCTACGCCTAAATATTTCCGGTTATGTAACCCGCTATGATGCCGACCGTTTGAACCAGGTGACGGCAGGTGCACCGCGAGGAAGACTGTGAGTCAATTACCGCGCATACGACAGCCGTCGGACAAGTTAATTGCCGTGAAAGACACGCAGAGCCGCCAAAACGCGGTATGAATACAACGCCGCCGGTGACTACGACCACCGTCATTTTTGGACGGCAGCAGAAACGGGACCCAGAAGTACGATCAGTAACGGAAAAACCATCAACGCACCACAGGGCGGTCTGACGCGCAGTATGAATAGGTATGCCGGATTATCCACTGACCGAGCGAAAAGCAGCAGCCACCACCTTCCGTTACGATGTACCGACCGGCTGATACAGGAAACGGCACGGCGGCACGCGTTATCACCGACCTGACCGGCGAACTTATCCGCAGCGAGGATGAGGGGCTGGTCACCCACTGCTTGACGAAGCAGACCGCCTCCGCACCACTGCGTGAATGGCGAAACCCGTTCCGGCAATTGAAACATGACCGAACACGCGGCTGGCTGACAGACGCTCAGCCATATCCTGGCGAAAGGCGCAGAGGTGACGGTGCACTATCGATTGAGCAGTAAAGGCGCCTCGCCAGTGAACACCGACGGTGCATCATCAAGACGAATGGACTTCTCCGGCGGCATGAGACCAGAGGCATGCGATACACAACGCACAGGGACTGGCGAACCGCTTAATAACTCCTGGACAACAACCTGCCGCCGATGAATGGCTGACTTCAGCGGCAAGCTTTGGCCTCGGGCATGAAACTTCGGCGACACCGCTGGTGCGTTACACCCGCGATGCCTGCACCGGAAGCACGCTGCGCAGCTTCGGCCGTTATGGAACTCTACCGCTTATACCCCTGCCGGGCGGTTACAAAGGCCAGCACCGGGCTTCGGCCCTGCTGTTCCGATGCGGTGTTCACCTGGAGCGACAACACGGCGAAACTCATCCGCATCGTAGCCCGCATAGACCAGGGTTAGCTGCAGCACCACCGGCAGGTGACCGGCGTTACACCACCATAACAGATCTGCGGATATCCGCATCCCGTATACACAGACCGGCAGGTAACCACCCGACCAGGCACCGCACCCGGACAGCGCCCACATCAGCATGTGGCTTGGATAACCGTATCGCCCGTAACGCGCACTATCTTTACCGGTATGACCGTCACGGCGAACGAGCCCAGAAAACGGAAACCTCATCCGGAAGGTTATCCACTTTGGATGATAGGCACACCGCCGGTACCGTACGACGGTCAACCGGCTGGTACTACCCACGCCGGACCTAATATGCCGTGCCGCTGAACCGAAAGTCGCTATCACGACCCGCTGGGCCTCGAATTAGCTTCGCTGGAACATGGCGGCGTGACGGGACCCTGACAGGCTGGCGGATAATGCTGTCACGACTTCGCAAGTGATACGGTACGGCTGGGACGGCGACCGCCCACAATACGATACAGAACGACAGAACCCGCCAAGACCGATTTATCAACCGGGGCTTCACGCCGCTCTCAGGGTTGAAACCGCCACCGGGTGAGCTGGCGAAACAGCGCTGCAGCCTGGCGGATACTATTTAGTCCGGTGGCGAGGCCGGTGGCGGTGTGATGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCAAACTGGAAAATTAAAATCCTGGCTGACCGGTGGTCGAGGAAAGCCGCGCTGGCTGGCATCATGCGGCGCCTGACGGTGGCGCAGATGCGAAAGCCAGATGGATGACATACGCGGCGCGAAAAGAGTCACCTTTTTACCTTGCCGCACGCACACACACACACACACGGGACGACCATGCGGCCTGCAACTGGCCCGCTATCAGCACAGGAAGGGACAACTGGCGTGACACTGGAAGGCGATAAAATGTTAACCTGCGGATAGAGAGAACCCGCATCGGCACGTAAAGCTTTATCCGCCTGCCGGGGCAACCAGTGATGAGGTCCGGCCTGTATTACAGCTCCGCCACCGCTATTATGACCCGCTGCCGGGGGCATTATGCGCATCACTCAAAAGGATGATTCCGGGCTGAAGGGAACAGTTTTATCAGTATCCGTTGAATCCGATCTGAAATATAGATCCGACTAGGACAAGAAACACTAAAATGCATTAAATACTGCATTCAATGGGCGGGCGGTGAAGGAAGCGGTCCAGATATGTAAGGGGAATCCGTTCTATCGTAATATCTTTGTCCCAGGATGGTAAAGGGGATTATATGGTGGCCAAAGTGTGGGAGAATCAAAGGAGATGTTCCTGGGGGCCGAATTAAAAGCAAGTAATGACCCTACAAAAGAGCTGCTTGTGGTGACATCGTTGAAACCGATAATGGTGTGGAGAACTGTTTGAAGGGAAGTTTAAAGAAGTGCAAGGCAAAGATTATTCTATATTACCTGATATATTAGGTTAACCACCCAGCAGACTTCGAATGAAGAACAG
>7baacba0-bf17-4cee-98b8-2d382f7eb308
TTGGTAACACTTCGTTGCTGCGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTGGGTTTCGCCTGTCAGCAGACAAATAGCCCGATAAACGGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCCAGTATGGCGTGGCATTGTCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGTGGCCTGTTCGGTGTGCCCCGGCGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCGGGTAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTCCATTCTCTCCGCACCTACAGCAGTTACGGGGACAAAGCGCGCCCGCGCCGGTAAAGGGCCTCGGCCCCGGCTGGAAATGCCTGCGTTATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCATGAAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCACCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCAAGCTGGATGAAGATCTCGGCTGGCCGCACTCTGGCGAGCGCTGCCGGGAGAAGAACTCCCTTAAGTCCCGCATCGTTATCTGGCGAGCAAACCTGGTCCGCAGAGACCGTGGTGGCTGCTCGCTGGGTGTGAGCGGGTGCCGGAAGCGGATGAGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCATAGCAGAAGCCGCCGGTAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCAGCGTCACTTCCGGCTGGTACGCTGACCACGCAGGCGCAGCGGGCAAGCAGCCCGGCAGCAGGCCATTTCCGGCAGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTTTGTCTGCCGTGTGGCTGACGCACGGCCAGATACCCGGAGAATTTTCCTGCCGCGCCGCTGGTGCACTATGGCCTGAACGCCCCGCAGCAAACTGGCGGCAGTGTATGACCACCAGCAATACACAGTGCGCAGCTTTACTTACGATGATGATAAATGCCAGGGGCCGGATGGTGGCTTTACCGTCACACGGGCCGACCGGAAATCTGTTGCAGGCCACGACGGCGACGGGCGGGTGACAGAACAGCTAAACCGGCGAGCCAAGTTACACGTATCGGTATGAGAAGGACCGCATCCACCATCACCGACAGCACGAACCGCCGTGAAGTCCTGCACGCAGGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACAGAGTCAGTTTGACGCGATTATGAGCCGGGCTCAGGGCACAGACGGATACGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCGCCGGATGGCAGGGGCATCGGCGTTTTATAACCACCACAGCCAGTTAACGTCCGGCCACCGGGCTGGCAGACTGGGCGCCAGGAATATGATGAATGGGGCCCGTCCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCGCTACCGTTATGATAATCCACGGTGACTTACCCTGCGCAACGGAAGATGCCACCAGCGGCGGAAAACCATGACGTGGAGCCGTTGCGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTGGTCGGGTGACGGCGGTGCACCGCGAGGAAGGGCTGGTCAGTACCGCGCATGCGACAGCCGTGGACAGTTAATTGCCGTGAAAGACCTTACGCAGGGCCATGAAACGCAGTATGGACCACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGAAAAGCCATCTGTGCCACGCAGGGCGAATCCCAGACGCACCGGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGATGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCTGACCGGCGATACAGGGAAACCGGCTGACGGCCGCACACAGCGTTATCACCACGACCCGGCCATGAAGCTTATCCGCAGCGAGGATGAGGGGCTGGTCACCCACTAACTATGACAGAAGCAGACCGCCCCACGCACCGCACCGTGAATGGCGAAACCGCGGAGAGCGGTGGCGAATTATGACGAACGCGGCTGGCTGACGGAACGCATCAATACCGCGCATATCGGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGTTAAATACCCAGAAGCGGGCATACCAATATCGCGTAG
>bc5615d7-dc94-4315-9cf1-5112555c19d5
TCGGTATTACTTCGTTCAGTTACGTATTGCTGCTTGCCTGTCGCTCTATCTTCGGCGTGGGTGTTTAACCTGTCTGTGGCATACGGGATATCAATCTTGGAATTTACATATAATAATGAAACAATTAACTTAATTTTATTTGTTTATAATGCGCTTACTTAATACAAACCGTGAATATACCTCCTGACAGAAAATAAAGCCATATTATCGCCATAATATACTTACTATCAATCTACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGGCAATAAAAGGAATATATGCCTGTTGGAAAACATATTACCATCATTCATAAGACATGAGACTAATTAGCTCGCTCATCACGAGTGGAGTCTAATGATGAAAAGTCTATGCATGGAAAAGAATAGTATTAAAGCGATAAAGCCAGCCATATAGCTCTGAATAAAAAAATAATATATTTCATTACATCCTCCGGTGAATACAAATCTAATAAAACGTCAATGTTATTTCCGAACACTTCATCTTACATGTGTTTCTAAAGAATCATTAGACCAGTCTTGGCAGTTTTTAATGGCCCTAAATTTATAGGTGTGAATATATCAGGCAATACAGAATAACACTTGGCCTTACCTCTTTAAACTTCCCTTTTAAACGATTCTCCACACAACTATTAATCGGTTTCAACGGGGTCACAACGGCCAGCAGCTTCTTTTGTATCGTGCCTTTACCTGGCTATAGACCATCTCCTTTTTGATTCTCCCCGTTGGTCTTGTTACCACAAGGCATAGTCCTTTACCATCTGGGACACAAAGATATTGATGATAGAACGGATTCCCCATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCGGATTCAACGGATACTGATAAGAAATTCATCCCCTTTCAGCCCAATCGGATCTGGTGATATATCGCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACCAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGTGGATAAGCTGCTGCAGCTGATGCAGGTTCTCTTCATTCAGCAGGTTACCCCATTCATCGTATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATAAAGGGCCAGCGGCAGGCCGCGGTGATAGTCACTGATGGTACAGGTGATTTTTCGCGCCGGCGATAATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCAGCGGCTTTTCATCACTCACGGTCAGCCAGAGTTTTCACTTTCCATGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACACTGCCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCACAACGTTTTCGCCAGCTCACCGGTGGCGGTTTCAGCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGATCTGGATGCAGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCATGTCCCAGCCGTACCAGTCCTTGCGGTTTCCCGTGACAGCGACATCCAGCCGTCAGGTCCCGTTCACGCCGCCATGCCCGTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAACGACTTCCGACCAGCGGCTCTGCATATTGTGTCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCATGTCGTACCGGTAGATTGCGCTCATCATCCGTGCGGATGCCCTTCCGGGATGAGGTCGGTTTCTCTGTCAGCCTGCCGTGACGGTCGCTACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGCGCTGTCGATTACTGCAGCTCCGGGTCGGGCAGGCGGTTACCTGCCGGAGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGATGGTGCTGCTGTAGCTCCAGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTTTGCCCGGCAGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCAGCGTTCCCAGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCACTCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTGTCGGTATACAGCGATTTCGCCAGTCCATTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCAGGCGGCCTTTACTGTCATAACCATAATTGCACCGTCACCCGGTGCCAGCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCCTGCGAGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCTCATAGTGCCAGTGGGCGATGGCCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCGGAGTCATTGGTGATAACGCTGTGTGCGGCCGTCAAAACCGGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGTGGGTGTAGCCGCCGTTTTCACTGAATCAGGCGGATGACCCGATCAGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCGCCGTGGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCGTTTCTGCTGCCGTCCGGGAGCGTGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAGTGCTGTCACGGCTGTCGTATGCGCGGTACTGACTCAGCGCTTCATCGCGGTGCCGCCATCACCTGACCGAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCCAGAGTGAAGCTCAGCAGCTGACCATCAACGGCTCCACGTCATAATGGTTTCCGGCTGCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCATAATGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCGATTTCCTGAATCAGACGGCCCCATTCATCATATTCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATGGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCAGTTCCAGGCTGTCGGTGATGATGATGCAGTCCTTCATACTGACCATGTAACCAAGCCTGCCGGGTTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGCCAACGACAACAGATTTCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTATTATTGCTGCGGTCGTTTTACCGCCGCCAGTTCGCCGCAGGGCGGTAATATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAACCACGGCAGACAGACGGATGCCGTTGTCAGCCATATTCAGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCGTCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGCTTCACTGATGGAACGTCTGTGTGCGCCCGAAGCGGTCCGCAACCCGGTCAATTGCCAGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAACCACCACGGCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCCGGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCGCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGAAACAGGTGCTCAAAATGCAGGCTTCTGCCGCCGTTATCACTGAGTATCGGTGTGTTATCGCGCAGCTGGCGGATATCCGCAGGCATTTTCAGCCGGGGCCGAGAGCTCCCCACCGGCGCGGGCGTTTTTGTCGGTAACTGCTGTAGGTGCGGGAAGAATGAGCGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGAGGACCTTTGCACCGAGCAGTTGACCGGATGGCCGGACGTCACCCCGCCGGGGCACCAGAACGAGCCACGCCGGTAGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATGCTGCGTCGCTGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCCTGCTCATCCTTGTTTTATCGGGTTTATTTGTCTGCTTTGACAGGCGAAACCCTACAGATTTATAAAGAAAGCCTTAAGTGAGATATCTGTCAGATGAACAATTAGGAAAATGTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCTGGTCTAAAAACCGCCCAGCGTTTCGCTGGCGGTTTTTTCAATATTCAAAACTCAGCAAATCGTAAAAATCCCGCAGTTGCCTTTCATTTTCGATCCATCCACCGGTTTATCGCTGGTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGAGTCTTTTCCGAAAAGCATGAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAATTGCACGGCGTAAAAAGATAAGCCATGCGGGATATTCTGGGGTTCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAATGAATTGTTTATCTGATGAAAATAGTAGTACCGCCTTTGTGTAGTTTTACTACTCATCCGACCACTTATTTTGCTTATTGATGGTTTTATTTACATTTCATCCATAAATTAAAGTTACACAAAGTTAAATTAATACTAAGCATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCGCCCGCAGATTTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCGGTATCACTTTTTAGGCCACTGGGTGCTGTGAGTGCAGGCGGCGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCTGATCAATGCGGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTTCCCTCTTCCGGGTACAGCGGGCGTTGAGCGCGTACTTTTCGCGCGCTTGGCGTCTGACCGTGGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCTTCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCGCAATACCAACTGGCAATCTTATGGCGTTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGGTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTGGTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGATTATAGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTGGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTAATAGCCGCACTGATAGCCGTGCAGATGCTGGCGATCTTCTTGATCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGAGCCGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAAGAGGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCAGTGATTGCGACATGATTCGTTTACCGCTCTCGGTGGCCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCGCGTGATGCTGTTTTGTCCTGCTGGCGGTGTTTGTGCCGGGCTGATGATTGGTCGTACACCCAGATATCTGGAGTCAAAAAATCGACGTACGCGAGATGAAACTGACTGCTGGCGAATTCTGGATTTACCCGACGCTGGTGCTGATGGGCGCAGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAATTGCTGTACGCGTGTCATCCGCCGCTAACAACAACAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGAGTGAGTAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCAGCACCGTGTTGCTGGTTGGCGCTGACGCTATCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCCTGATGATATTGAGTGAGCACTGAATATGAGTAGGTTAAACACCCAAGCAGACGCCGAAGATGAAGAACGCG
>5c46f248-1989-4a1e-bdf7-265af033510b
TTGGTATGCTTCGTTCCGGTTACGTATTGCTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCAGTGGTGTGAACGCCAGTCAGCCTACCGGTGGTGCTGTAGCTGTAACCCGGGTCTGGCGCGGAGCTGCTGATGCCGTGGAGTTCGCCGTTGTCGTTCCCGGGTGTAATCGCGGTCAGACAGCAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCGGCAGGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCTGGCGTTTCCCCTGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCATCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCTTCCACGGCAGGCAGGCTGTCCGGTATACCCAGCGGTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCGACGGATTCGTTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCCGGGTGCCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCAGTTGCGTGAGGGCGGTCTGCTTCGTCATAGTGCCCGGTGGGTGACCAGCCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCCAGCCGGTCAGGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAACATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGCATTAGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCGTTTCTGCTGCCGTCGGGGCAATGACGGTGTGGTCAGGTCACCGGCGGCGTTGTGATCGCCACCGCGTTTCATGGCCCTGCGTATCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGAATTTACATAACCGGAGACAGTCAGTGAAGCTCAACAAAACCGTAACAGCTTATCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGAGTAAAGTCACTGTGTAGTTATCATAACGGTAGCGGGTGATATCGCCGTCAGAGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTATGGTGGATTGAAGTAAAACGCCGATGCCTGCATCCGGCGTGGTGATGCGCGTGGTAGGCCGTCACCACATCCGGACTGTATTCTGTTGTCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCGCTGCCGTCGCGTGTTCCTTTTTGCCACCCGCTGGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACAGCGGTTCAGGCTGTCGGTGATGGTGATGGATCCATTCTCATACTGATACATTAACTTCAGCCTGCCGGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACAGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCGGTCATACACGCCGCCAGTTCCGCCGCAGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACGGCAGACAGACCGAGGATGCCGTTATCCCGGCACCATATTCGGTGTAACCGGCAGGGAGTATCAGGAAAACGGACGGTTCCGTCCCGCCGGAAATAATGGCCTGCTGCCGGGAGCTATGCCGCTGCGCCTGCGTGGTCAGTGACAGCCGGAAGTGACGCCCGGCACCATCCATCCGCCGATGATTTCATACGCTAATTCACCGGCGGCGGCTTCCGCGGTGGAACGTCTGTGTGCGCCGAAGCTGATTCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTTCCACACCAATGAGCAGCACCACGGCCCCTGCGGACTGCTGACCATGATAACGATGCGGACTTAAGCGGGTTCTTCCGGCAGCGCCTGCCAGTGCGTATGGTGACCTTCATCGATTTCGCCACGCCGCCGCCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCCAAGTACAGGCTTCTGCCGCCGATTTATCACTGATATCCGTGTGTTATCAGCGCAGCTGTAAGCGGATATCCGCAGGCAGCATTTTCCAGCCGGGGCCGAATCCCCCACCGGCACCGGGCGTTTTGTCAGTAACTGCTGTACCGTGGGCGGTGCCAAACACCGGCAGACCGCCGCAATATCGGCACCAACAGAAAAGCAATACGTAACTGGG
>b1594985-30ce-4f59-9230-dff6ec966710
TTGTTATTGCTTCGTTCAGTTACGTATTGCTGCTTGCGCAATAACTCTATCTTCGGCGTCTGCTTGGGTGTTTAAGCCTGTAGCGGTATGCTGTCTCCCCGCTTTGCGCGATGTCTCGATACCAGCCTGCCCGGTTCATCATATTCCCCGGCGGCTCTCAGCCCGTCAGGGGACACCACCGCAAATCAGCTGGTTCGTCGTTATAGTAAAATTTCGTCTCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCGGACACCACATTCAGACCATTACTCTGTCCTCCGTCGCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCCGCTGCGCGTGACGCTGCCAAATCCGCCATTCTTTTTCACCACCCACGTTTCAGCCCGGCCCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATACGGTCCTGCTCATAAAGATAGCGGTAACCCAACCTACCGGGTTCAGTTGCTCCACCACCGCCCCGTATCCACGTCGTGGCAGCGCATCTCCGGCCTTCCCGTAACGGTGCGCCACCATCCGGCCAGGTGCTGCACGTCATGCAGTGAAAGCGCGCACCTGCGTATTGCTGCGGTCATATACCTTCAGTTCACCGGCTTCCCGACATGCGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCGGGTCGTGCATCAGCCACACCGCCGAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCAGTGTCGAGGGAACGCTGAGGCTGAGAGAGGGCGGGAACTGTCAGAAGAGGAATGGCGAAGAGGTCGGGCCTCTTCCGCACGCTACGCCTGCGTGGTCAGCACCAGACGGAACTCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCCCCGGCCAAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGATCCGCCAAGCGGTCCGCCATCCCGAACAGCACCCGGTACGGCGAGCAGCGGCGGCGCTGGCAGTGCGATATCAGCACCCGGCACCCGCTCAGACCACCCCAGTATCCACCACATTTTGTGCGCTGTTGGTCGCCAGGTAAGATGCGGATAACCGGATATCCGGCGGCAGCGCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACGTGTTTCCTGCGTGGTACACCGCCTCTGGCAGCAGCGGCTCAGTGAATGCTCCGCCCGCCGTTGTCGATTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCCTTGGATATCAGAAGGCGCTTTCTCCAGCCGGGCCAGCAGCCCACCGGTGCAGAGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCGGCTATGAGTCCGTCTCGCCGGGCAACACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCGGACACACCAGGCACGCCACGCCGGTGGGCGCGCCAGTCTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGGGTCATATCTCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCTGCCCGCTTTTAGTTATTGTTCATATCCTGTGTTGGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTGCTCTCTTTTCATAAACTTATTTTGTTCTCCAATCAACAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAGCTAACATTTTTTAGCACAGATGAATTCATCATCCAGCAAATTCACTATATGGATAATATCCATTCAGCACATTATGATTTATGATTTTATTAGTCTGAGTTATTTTGTAGGGCTATATTTAAATCAATAAAACTCCACCGATTCAGATTAATATCAGCAATAGAAGATGAAATCACCAATTCAATAACATCATCAATGAAGAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAAGAACGCCCCTTATTTACTCTCATCACCCGCAAACTGCCTGAACAGCGCCTTACCCTTAACCAGTCGCGCACCCAATAAGCCGCCAGCGACAGCAGCAGCGCGCTCCGCTGCACGGCAGAACAATCCACAATCGCCAGTCTGGCTTCACGGAAAATCGACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCAAAACAAACGAAGCATGGCGAACTCACACCTGGCGTGGTACGCAGCAGTTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGCACCTGACCGACCTGTTTTAAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGGTTAATGTCAGCTTATACCGTTGCCATTCTCAGCGGAAACTGGTAAGCCAGCTCTGCGGTTGTTGCCCGTCTAATGCCCCTTCGGGAAAATAAAATAGAAATTGGGCCGCAGACTTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTTCCCTGGGTATCGCCCATACAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCCTCTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCCGGGCCGCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTACACCTTCTGTCGGCTTGTCGTTAATCGCCGTCAGCCGCCCGCACCACCGGATAAAACGATTCGGGACTATCTGATGTTCCGCGAGGAACGCTTTAGCGGTGCTACCTGTTCTGTGGCGATGTTAATTAAAAGTAGTTCGGGAACTTTCTGGGGTAGCTGCTGCTGCCTGCAGCGGTCGAACAGATCGCCACGCAACACCAACAGCAGTGCCAGCAGCATAAGGAAACGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGACGGCTAACCGCCAGACGCAGAGGCAGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCGGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCGGCATGCTGCTGATAATCCGGCAGGCAGCAGCACCAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTTCGCTACCACATCATTACGTAATACGCGTAAGGCTGCGTTGCCGAAGCCAGCAAGCGATATGGTCGTAGCCCCCACCAGCAGCAGGATGACCGTCGTAGTTGCCAAGCGCCCTGGCCACGGCCAGAGGCTGGCTGGCGGTAGTGCAACAGGCAGAACGGAGAAAGGAGGCGGGCAGCACCATCAACACGTTTTTCGAACAACGGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGTCAGCACCATCAACCACTGACCGACGATTGGCTTACGCAGTTGCGCTCGCCCTGCCCCAGCGTTTGAGGATCGCCACAGATCGTAGCGACTGCGACAGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCAGCAGCAGGAACTGTGCGACGTTCCATCGATCGCCCAGCGCGCCTTCGTCCTGTTCAGACCGTACCAGCGTTGATTTCGGGTTTAAGCTGGGGTAACGTAACCATTTCTCATAGCCGTCGAGCTGGTTCTCATTTGCCGCCGAATTTATAACGCCAGGTGACCCGACTCCCCGGCTGCACGGCTCCGGTTTTTTATCGACATCCGCCAGATTCATCATCAGACGCGGAGCCATCTGGAAGGGTTAAAACCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCGCAGGTGGCGTCGCCCGTCAATGAGGAATTGTCGCCCGTTTTTTCCGGGTTAAAAAAGCAGAAGTGCCATCAGGCGTGGGCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGGGGATGGTTGCAGATCGCCATACATCGGGTAGATATCATCCACCGCTGACGTTCGCCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTGGCGAAAGTCCGGCTGCTGCCGACTTTCAGGCCGCGCTTTGCGCTTCCTCCAGCCACGCTGCGGCACTTCACGCGTGAACCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTTGCTGGCTTAAGCCCTTCTCCATGCGATCGCTGATATTGCCCCAGCGCCAGCACGCAGGCCACCGCCGGAAGCTTAGCGCCAGCCAGACAATTAATAGCGACGGCGAACGCCATTCGCGCCAGAACCAACGATGCAATCATGCTTCCTCTGCAACTGCCCGTTCACCAGCCATGAAAGCAGCGGTCGCAGCGTGCCGCCAGTTGATTGCGGTGTGGAGTCACCATAATCAACGTGGTGCCATGTTCACGGTTGAGGAAAACAGCAGGTCCGGCAATTTTATCGCCCGTCTGGCGGTCAAGGTTGCCAGTGGGTTCAAATCGGCAAACAGCATCAGGTCGACCATTAAAGGCTCGTGCCAGCTCTTCCTCGTTGCTGTTCTGCGCCGGAAAGCTGTGCCGGAAGATGATCAGACGTTTACCCAGCCCTAACTGTTCGAGCAACGCTTTCGCCCCGTTACGACTTTCCGCACTTTCTCACCGCGCAGCAGGGCGGAAGCTCGACGCGTTTTCAACGCGTTAAGGTGGGAATTAACATAAATGACTGAAAAACAAAGCCGACGTGCTTCGCGCGCAACTTTGCCCGCTTCTTCGTCCATATTAATGGCGGTTGTCCCACCAGACTCACTTCGCCACTGCTGCCGTCATCAAGCCCGGCGAGGATCGCCAGCAGCAGGTTGACTTACCCGATCCCGACTCGCCCACCAGTGCGATGGTCTCGCCGTTTGATAACCAGCTCAACTCCGGTGAGGATGGAGAGTTCATGCTCCCCTGACCGACGGACCTTAAGATGATGAACCAGCAATGTTTTCCCGCTGGCATTTGCCCTTCCTGTTCCTGGTCACCATTAACCTTCCGTGCCGCCGCAGCGGCCGTTATTGATTCTGGGTGATAGCCTGAGCGCCGGGTATCGAATGTCTGCCAGCGCGGCTGGCCTGCCTTGTTGAATGATAAGTGGCAGAGTAAAGAGCATCGGTAGTTAATGCCAGCATCAGCGGCGACACCTCGCAACAAGGACTGGCGCGCCTTCCGGCTCTGCTGAAACAGCATCAGCCACGTTGGGTGCTGGTTGAACTAATGGGCAATGACGGTTTGCGTGGTTTCAGCCACAGCAAACCGAGCAAACGCTGCGCCCGGATTTTGCAGGATGTCAAAGCCGTAACGCTGAACCATTGTTAATGCAAATACGTCTGCCTGCAAACTATGGTCGCCGTTATAATGGAAGCCTTTAGCGCCATTTACCCCAAACTCGCCAAAAGAGTTTGATGTTCCGCTGCTGCCCATTTTTATGGAAGAGGTCTACCTCAAGCCACAATGGATGCAGGATGACGGTATTCATCCCAACCGCGACGCCCAGCCGTTTATTGCCGACTGGATGGCAGAAGCAGTTGCAGCCTTTAGTAAATCATGACTCATAAAGCAACGGAGATCCTGACAGGTAAAGTTATGCAAAAATCGGTCTTAATTACCGGATGTTCCAGTGGAATTGGCCTGGAAAGCGCGCTCGAATTAAAACGCCAGGGTTTCATGTGTGCTGGCAGGTTGCCGGAAACCGGATGATGTTGAGCGCGCGCAGACAGCATGGGATTTACCGGCGTGATCGATCTGGATTCACCAGAAAGTGTTGATCGCGCAGCCGACAGGAGGTGATCGCCCTGACCGATAGTGTCTGTATCGGGATCTTTAACAATGCCGGATTCGGCATGTATGGCTACTTTCCACCATCAGCCGTGCGCAGATGGAACAGCAGTTTCCGCCAACTTTTTCGGCGCACACCAGCTCACCATGCGCTGTTACCCGCGATATTACCGCACGGTGAAGGGCGTATTGTGATGACATCATCGGTGATGGGATTAATCTCCCGCCGGGTCGTGGCGCTTACGCGGCAATAAATATGCGCTGGGCGTGGTCAGATGCACGCATGGAGCTGCGCCACAGCGGAATTAAAGTCAACCTGATCAGACGGTCCCATTCATTGCTCGCTTCACCGACAACGTCAACCAGACGCAAAGTGATAAACCAGTCGAAAATCCAGCATCGCCGCCGCTACGTTGGGACCGGAAGCGGTGGTGGACAAAGTACGCCATGCTTTTATTAGCGAAGCCGAAGATGCGCTATCCGAGGCGGCGCTGTTGACCTGGGCGGTAATGTGCTTAAGCGCCTGCTGCAGGGCGCGTGATGGACAAAATATTGCAGGGGTGAAGGTTGGAAGCGCGCTTAAAGCCCCATGTCAAAGAAAATATCGACAACAGAGAGCGACTCCATGTCCGTAGAAAATATTGTCAACATTAACGAATCTAACCTGCAGCAGGTTTCTTGAACAGTCGATGACCACTCCGGTGCTGTTTCTGTTTTGTAGTCGAACATGTAGCACTGTTTGCAGTTAACCCAATTCTGGAAAGCCTCGGCGCGAACCGCAACGAACCAGCTATTCTGGCGAAGCTGGACTGCGACGCGGAGCAGATGATTGCCGCGCAGTTTGGTCTGCGTGCGATTCCGACCGTGTCTGTTCCCAGAACGGGCAACCGGTAGATGGCTTCCAGGGGCCGCAACCGGTTGCCCGTTCTGGAACAGATACGGTGGAATCGCACGCAGACCAAACTGCGCGGCAATCATCTGCTCCGCGTCGCAGTCCAGCTTCGCCAGAATAAATTGCCCGTTGTACTGCCGCGAGGCACCAGAATTGGGGTTAACTGCAAACGGTGCTGGCGTTCAGACCAAAAACAGAACAGCACCGGGTGGTCATCATTGTTCAGAACCTGTTGCGGGTTAGATTCGTTAATGTTGACAATATTTTCTGCGGACGTAGGTCGCTCTCTGTTGTCGTGTTGCCTAACGACATGAGAGAAACTAACGCTCACCCTACCCGGCTGAGCGCTCATACCGCGCCAGGCTGGCGTACATCACCAGATAACACCATCGCTTCTCACAATAAACATGGCGTCGTAATCACCACCGATTCTGGCGCAACGGCGGCTGTCTCGAACTGGTTATCACTTGCGTCTGTTGATTGTCGGTAAGTACAGGCAGAGACCGAATTCGATCGAGCTGACTTTATTCGCCAATGACTTTATCCTGTTTACGCCTCCATATTACTGACCGCGTAACATACACGACTTAACGATGAAGATATCCATCACCGACTGATAAATGCAATACGCCCTTTCATAAATTATCGCGGTAATGGCACGTAATTAACTGTTATGCGCCGAACCGGCGGCTGCGCACGGCCGAATCCACGTACATTGATCCCATACAGGCACGTCGGGAACGATAACTGCGCGATCAACTACTCTGTGAATCGAATCGTCGGCACCGGTAAATCATTCATGCGGCACAACATCATCCGATTTCCGGCTGCTCTACCAACATGGCGTTCGTCGAACGCTTCCTGGTGATAATTGAACCGTTACCATATTTACCTGTCGAGATAACTCCGTTGCTGTAATTACTAAAGGCTGCAACTTTCGCCATCGATCAAACCGTGGCTGGGCATTCTCCGGTGATTGAATGAATACCGTCTTCCGGCTCCGACCCGGCGAAGGCTCTTTCCAGCAAAAAGAACGGCAACGAACATCCAGTTTGAAATGGCAGCTAAAATTTCATTATAACGGCGACATATTTCAACAATGGTTCGGCGTTGGCGGCGCTGACGTCTGCAAAATCTGGCGCGGCGTTTGCTTTCGGTTTTAGCGTGGCTGGCTCGCGCAAACGCCCGGTCAACGGCACCCAACGCGGCTGATGCTGTTTCAGCTTGAGTCGCATTAACAACACTGGGCGTTTTTCACTCTGCCGCCCATCATTCACTGAGCATTTCCTTACGCGACGAGACGTCGACACCCGCGTATCTCGCGATAACTCAACGTGTCGCTGCTGTTGTCTGAAGGTGCTTTGGACCGAAGGCGAAGAGGCGAAATGCCAGCGAACCGCTGTTGAAGTTCGTCGTCTTGAAGTCGTCGGTCGAGAATGAACTCCGTCACCGGAGACGCGTAACGAACATCGACCAGATCATGCTGGCGTCTCACCGGGCTTGACTGTTTGGCGGCGTGGCGAGAAATCTGGTGGTTTCTTCGCTACGCCAATGGACGGCGCGAACTGGCGGCTTACGTCGACTTTGTTTTCGTCATTTATGTTAATTCTACCCATGCACGCTGAGCGTCAAGGCGGCTGCTGCGCGCGGAAGGAATAAACGACGGGCAGCCTTAACTCGGCACGGTGAAACTGGTGGATATCTTCGGCAGTGACGCTGGCTGGCTGATATTAACTGTTGCCGACGAAGACCACCGGCGGCCTTGACCGAACGGCATTAAACCACCGACTACTTCATTTTCCCTCGACAGAAATAACCGCGTTATCGACGACCCACGACACGGCTTCGGCACCTTTTGACGACATGTACACGTTAAGCCGTCATCAACAGTGAAACGGCGCTAACCTGACGCGTTGACGGCGCTGGTATCATCTGCGAGGGCAAGCATGAAAACCGTGGCGGGCGTCGGCGTTGCTACGCGAGAGACGCGCAACGTGGCTGGAGAAAGCGACCTGAAACGAAGCAGCGATTTCGCCGTTTCTGGCTGCTTTGCGGCGACACGTTCCGGTGAATATTGATAACGACGTCTGCAAACTAATCCCCTGACCTGGCGTGCGCGCTGATGGCATAACCTGAGCGAACGTGCGTGAGCGTGCTACACGCTGCCGTTGCCGGGCTGTTCGAACAGCCGGTGCCCTTCCGGATGGCTCCGCGTCTGACGACCGTACGGCCAGTCGTCTGGCGTCGGCGACGGCGAATTTCAGCTCGACGACAAATGATTTGTTACCTCGGCAAACCGGTATCTGTGCGATGCTGGAATTGGACGAAGAAATGCCTTTGGCGATCGATGGAACATTCTGTTGCTGGCAGTGTTTAACGATGACGGCAACAGTCATTACTGTCGCGGTCTGCGTCCTGAAAACGCTGAGAACGAAGTTTGCTGCCTGGTAATCGATATTAACGACGCTTTCGGCGTTGCCGTGAGACCGCCAGGCCTGACGATTGAAAACTTTCGTTGATGTTCAAGCCTGCTACCTGCTGCACTACCGCTCGGCCTGGCCGTGATGGCATGACGTGCTGATGAATTACGACCGCTATCTTCGTTGTAACGGCAACACTTTATTACATGACCGATATTGATGACGAACGTCTGGCACTGAGGCTGTCTGCCGATTATTGATGATTATGCTACGCTCGCCGAACAATGGTGACGGCTCTTTAACTTTGAACAGTAACTTTGCTGTTAGCGTGTGCTGGTGGTGCTGCTGGTACTTCGCCGCATGTCGCTGAAATCGCTCGCCTGGCGGTTAACCGCCTGTTCCGTCGTGATCCCGTCGGCTTTCGACACTACTTCTCGCTTATTAACGGCACTTTAACTGCTGATGATCTCAACTCGACGCTGACGGCGGCTTACCTCCAGAAAACCGAACTGCACCAGGTGGCGGCTCATGCGGAACGGTAACGCCGCCGCGTATCGCGGAGACATCGAATGATCGGGATCGTTATCCGATGATGCTGGCGCGACTTTGACGTCAGCAGCTTCGACAGGCGCGCTTATTCCTGTCTTACCGGCGAAAATACGCGATACGATCATAAATGTCGGTGTCATGGCCGCCGCCGATAATGTCGATGAAGGGCTGACGGCTGCAAACGTTAACCTCATTGATACTGCGTGACTTTCGATGCCGGAGTTCGCGCTAAAGCCGGCCTTATGGCGCATTCTTCCTTTTGTACAGTGAACGGGCAACCACTGACTTTGACTGCAGTTTCCGCTGGGCGGCGGCATGTTGACTGGCTGCTGCCGGTTCGACCGTTAACCTGGGCCAGATATTGGCGCGATTTCGCGCAGGTCGGTCGATCTTCATGAAGTGATGATACTATTCTGCCGCGATATGTTGTTGGCGAAAACCGTCATCGAAACTGTTGTTGTGGCACGCGAACTGCTGCGCTTGATGATTCGTGGCGAATTTTGTTCCGACACAGTGTGGTGGGCTGGCGCTGGCGTGTTACGAAGACATCGATTTCCGTGGAGCCGGGCTTGGCGACGGCTGGTGCTGGGCAACGGAGCGCGCTGCTCTTGGTATATTCGGTGGTGGGCGCTGTTCAGTTTGCGAAGACGATGAAATGAGGGCGTTACCGGTTGATGGGGCGCTGTTTGAGTAATTCTGCAATATGTTTCATTGATGATGATTGTTGCTGATGTAATCTGAATATTCCGACCGATTTTAAATACAAAAATAACTTTCGAACTATTAATCTCCGTCGACAGACGGATGATATTATCCTATAGTAATTGATTGTTCATCGCATTATTAAAATCGGTTTATCGTGTTAATGGCGGTTGATTGCCCGATTGGTAAACTGGTTTATGTGAAAAATATATAAATACGTGTGATGTGATGATGTCGTTGTACACTGTTCACGGATATGAACGGCGTAACTAAAAGGGGCATATGAGCGGAAAACCGGCGGCGCGTCGGTATGACTTCGGTAATAAACGGTCCCCGTTGTCGAAGTCATTGAATACCGGCGCGCCCGCCGGTGGCGTTATTCGACGACGATAAATCTAACGAGCGAAATTTCGGTTGCTTATCTCCCGCATACAGCGCAACTTACCGTTGGCACCGATGAACGTTGCCCGGCTGGAAAGCGCCTTCTGATATCGCTTACGGCTTACGTGATGAACGGACTGATACTCGACTGACTTCGCTACCGAGGCGATTATTACGGCCGCGATGATGCTTCGATATTAACGACTTCCTTCGCTGGCGCATTTTGCTGCGGTCGTTAACTTCCGCATCTTCCTGACCAACAGCTTTACGAAGGCCGTGGTATTCACTGATTGATCTCGATTAACGTTACTGGTGCCGGCACGCCGCCGCCGTACCGACCAGCCGGATGACGGTCGCCGACGTTTGCTGCGTTACGAACCTCGGCGAATCGGCGAACGGTGCCGAGCGAATCACCGGTGCTACGAGCTTTTGGCGAGCCGCACCCTCTTCGTATCTTCTGACGGTTCCGCCTCTCTCTCGACGCATCGTTCCCCGGTACTAACCCGATACGCCGAATACGACTTACGACAGCGGCCTTTCGACGGGAGGTATTCGGCTGATGCACGACCCGGCATTACCGAAACCTGCCCGCTGTATATGCGAAACCGATGAACTGCTGGCGACATATGTTACCGGCAACTCACGGATACGCTTTCGTATGACGCGTACGCAGACCGGCACCGTTACATGAACGATCCATACCGCTACGACGCAATACGGGCGAACAGTAAACTACCTTCTCTTCGGTTGAGTTCGTCGCCGACAGCCTGAACCGGCGTCGATGCTGCTACGAAGGCGGTAAACTGAAGCGCAATTGATGAACTTCGGCGGACGGCAACTCGCGCGGCGCTGACATGTTTGATACTGATCTGATGGGGGTGATCGACGTTATCACGGACATCTACGCCGAATTACTATGGCGGAACCAATGACGACGTGTTTAATCGGCGGGCTGGAAGCTTGCGCCGAGATATATTGAACCGGGCGAGCTTATTATCGGCGGCAATACATGCCGCTACGAGTTTAAACACCCAGAGCGACGACAATGGCAATACGTAACACGGCA
>d5943c57-7a5d-4b70-9db0-78c47b331a56
TTGGTATTGCTTCGTTCAGTTACGTATTGCTGCGCCTGTCGCTCATCTTCGGCGTCTGCTTGGGTGTTTAACCTCAGGAAGAGATGTCATTAATCAGCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCACGCGCAGCCATCAGAACCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCCTGATGCACCTCCGTGGCCTAAAAGTGATACCGGAAGGTAGAATTCTGGCTGCAAGATTTCGCAAAATCACCCGGGCAGGGTGTAAAAAGTATAAAAATAGCCAAAGCCATGATTTAACTAATGTTTGAAGTATTAATTTAGCTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGGTAGTAAAATTACAAAAGGCGGGTACTATTTTCATCAGATAAACAAATTCATTTTCCGGTGCCATTCACCGGGTAGATACAAAAGGGGAGAAAGTATGGAACTCTACAGAGAATATCCTGCATGAAAAACTATCTTTTTACGCCGTACTTATGCAGTTTAAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTCTGGAAGAATTCGCGCCCGCTTTTGCAGCTTCTGCATCGCGTCTGATTCGAAAACCAGCGATAAACCCGGTGTGGATGGATCAGGCCGAAAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTGAATACGTGAAAACCGCCAGCGAAACGCTGGCGGTTTTATCAGGAAGATGTTCAGAGAATATTTGAACATCGTTATACCAATCAGAAACATATATTCATGAAATATATATAAATATTTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGAGAAACTCTTATAAATCTGTAGGTTCGCCTGTCCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAATATGGCTATTAGCATTGTCCAGGAGGTTCAGCCGGGGTACATCAGTGCCCCACCGGCGTGTAGCCTGTTCGGTGTGCCCCGGCGGTGACGTCCAGCCATCCGGTCAATCCGCTATACTCGATTGCAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCAGCCGCTGCCGTTCATTTCTCTCCGCACTACAGCAGTTACCGGACGAAAACGCCCACGCGCCGGTGGGAGCCTCGGCCCCGGCTGCCCGTGAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACGCTGATACTCAGTGATAACGGCGGCAGAAGCGCAATTTTATCGTGGATATCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTAAACTGCTCGGCTGGGTGTGAGCGGAGTGCCGGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCAGAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGTTGGGCGTCACTTCCGGCTGGTACTGACCACGCAATTTTGGCGAACTGAAGAAGCCGGCAGCAGGCCATTTTCCGGCGGGACGGAACCGTCCGCTTTCCTGATACCTGCCGGGTTACACCGAATATGGCCGGGACAGCGGCGTCCGTCTGTCTCTGCCGTGTAGTGACGCACGACCGGAATACCGGAGAGATTTACCTGCCACGCGCCGCTGGTGCGCTATGAAGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAACTGCGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGAAATCTGTTACCGTTACGACAGCGACGGGCGAATTTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACGCGTATCGGTATGAAGGTTGCATCACCATCACCGACAGCCTGAGCCGCCATTGAAGTCCTGCACGCAGGAGTAAGAAGGCCCGGGCTGGGCGCCAGGTGGTGAAAAGGCTACCTGGACGGCAGCGCGTCCGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCCAGGCAGGGCAACAGAATACCGTCCGGATGTGGTGACGGGCGCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTCTTGTCAGCCACCGGGCCTGACGAACGAATACGCCGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCGCGCTACCCGTTATGATAATCCACACAGTGACTTGCCACGCACGCAACGGAGATGCCACCGGCAGCGGAAAACCATGACGTGGAGCCGTTACGGTGGATTGCTGAGCTTCTGACTGTTCCGGTTATGTAACCCGCTATGACCACTTGACCGTTTTGGTCAGGTGACGGCAATTGCACACCGCGAGGAAAGGCTGAGTCAGTACCGCGCATGCGACAGCCGTGGACGGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCGTACGCGGACGGCAACGAAACAGGACACAGTACGATGCGCGGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGAGATACGATGCTGCCGGACGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCACGACGGCCGCACACAGCGTTATCACCACGACCTGACCGACAAACATCCACCCGGCGAGGATGAGGGGCTGGTCACCCACTAACACTATGACGAAACTGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGGCTGGCTATTGAACATCAGCCATATCAGCGAAGGAACACCGGGTGACGTTTTATGGTTATGACAAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGGCTACCGCGGGGACTGGCGAACCGCTGTATACCGGACAGCCACCGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCGGCTATCAGGCATGGAAACTCGGCGACACCGCTGGTGGAGTACCTGACCGCCTGCACCGAGGAAACGCTGCGCAGCTTCGGCCGTGCCGAACTCACCACCGCTTATGCCCCTGCCGGGCGGTTACAGAGCCAGCACCTGAACAGCCTGCTGACCGCATTACACCTGGAGACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACCAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCGCGGACAGCGCCCTCAGCGTAATGGCGGATAATATGTCGCCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAAAGCCGACCTCATCCCGGAAGAGTTATCCGCACGGATGATGGCGCCACCGAGCCTGCGCTGACAGTCAGCACCGGCTGGTGCACTACGCAGACACAATATGCAAGGCCCGCTTTGGTCGAAAGTCGCTATCTTTACGACCCGCTTCTGGCAGGTACCAGAATTGTAAAACGGGTATGGCGGCGTAGAACGGGACCTGACCCAGGCTGGATGTCGCTGTCACGGAAACCACCGTGACACAGGTACGGCTGGGACGGCGACCGCCACAGCCACGATAAGAACGACAGAACCCGCATCAGACGATTTATCAGCCGGGAGCTTCGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCAAACACAGCGCCGCAGCTGGCGGGCCACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCATTGGTCGCTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGAGTGAAATCCTGGCTGACCGGGTGAGTGGGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCGCGACCATCGCGGCCGCTGGCCTTATCGGCACGGAAGGGACAACTTGGCGTGGTACGCAGAATACGATGGTCGGGTAACCTGCTGGATAAGAGAGACGCATCGGCTGCAGCAGCTTATCCGCCTGCCGGGCAACGGTATGATGAGAGTCCGGCCTGTATTACGAAAACCGCCACCGCTATTATGACCGCTGCGAGGGGCGATATATCACTCAGGATCCGATTGGGCTGAAAGGGGGATGGAATTTTATCGAAATCCGTTTGAATCCGATCTCAAATATAAGATCCATTAGGATTAGAAACACTAAAATGCGGTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAACGGTCCAGATATATGGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCCAGATGGTAGGGACTATGCTTGTAGTGGCCAGACCAGCAGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAAGCTGCTGGCCGTTTGTGACCTCGTTGAAACCGATAATGGTTATGTGGAGAACTGTTTTAAAGGAAGTTTAAGAGGTAAGGCCGCGTTATTCTGTATTGCTGATATATTCCACCTATAAATTTGAGGCCTGTTAAAACTGCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCGGAAATAACATTGGACGTTTTATTAGATTTATTCACCGGGTGATGTAATAAAATATATTATTTTTTATTCAGAGGCTATATGGCTGGCTTTATCGCTTTTAGCCACTATTCTTTTCCATGCATAGACTTTCACTATTAGACTCTCCACTCGTGATGTGAGCGAGTTAATTAGTCTCATGTCTATGGAATGATGGTAATATGTTTTCCAACAGGCATAGTATTCTTTATTGCTCTAATATTTATAGGGGACTGTATCAGACATTATTGGCGGCGTAAGGGATTGATAGCAAGTATATTATAGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGGTATATATTCAATGGTTTGTGATGGTAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGGCATTGATATCCCGTATACCGCAGACCCGGCGAGGTAACCGCCTACCCGACCCGGAGGCTGCACCCGGACAGCACCCTCAGCGTGGCCCGGATAACCATTATCGCCGTGACGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACGGAAAAACCAGGCCTCGTCCGGAGGGTTATCCGCACGGATGATGAGCGCACCACCGGTACCATTACGACAGTCCAGCACCGGCTGGTGCACTACACGCCGGACACAATATGCAGGCCGCTTCTGGTCGAAAAGCCGCTATCTTTGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTGTGGCGACGTGAACAGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAACGACCTGGTACGGCTGGGACGGCGACCGCCTGGCCACGATACCAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCAACAGCGCCGCAGCCTGGCGGATACCTTCAGCAGTCCGGCGGCGAAGACGGTGGCGGTGTGTGTTCCCGCCGGGGTGCTGGTCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGGAAAGCCGCCGCTGGCTTCGGCATCGTGCGGCCTGACGGTGGAGCAGATGCTGAAACCAGATGGACCCGGTGCACGCCGGCGCGAAAAATCCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCAACGTCAGCCTGGAAGGGGCAACAGAGATGGTGCGCAGAATACGATGAATGGGCAACCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTTGGCCTGTATTACAACCGCCACCGCTATTATATGACCCGCTGCAGGAGGTATATCACTCCAGGGGATCCGGTGGGCTGAAGGGGATGGAATTTTTATCGGTATCCGCGCTGAATCCGGTTCAGTATAGATTCAATGGGACTGGCATCAAATATGGACACTTAAATAATGGCGGATATGGGCGGACCCAACAAACCGCCTACGCCCGATCCAAAGTAAATTGCCGGACATAGCAGAAACAATTAAGACTGCCATATCTATTGACCAGGCCAGTAGTGCGCTAATGTTTTAAAACATTCTTCCAGAGCAGTAAGCCCGACTTCACACACTGTATTGCAGAATTAAGGTAAAACCAAATCTGACGTACGCCACAGGATGATTCCCGGTATCGAGGATGGTTAAGACAGCAAGTGATTACCTGCCACAGTGGAATTGGCCAACAACTCAATTACCACCAGGGATACTTGGCCAGAACCTATTTATTCCCAGACATTAATAAACCCGATGGGCCAGCAACTAGCAGGGATAAGATGATTTGGGTGAAATTTTGGCTAAAGATGAAACAGAAAGGTTAAACGCAAGCAGACGCCGAAGATGAAACGT
>8a553dac-a603-4a38-ab2b-4c9cc41bd7ac
TCGTGTACTTCGTTCGGTTACGTATTGCTAGTAAAATTTCGTCTCCCGCCCGTCTGGTGTGGTGATGTCCGTGATATCGCCGGGCCACCACATTCCAGACCATTACTCTGTCCTCCGTCCGCCGCGTCCGTCTGCGCCGTAGGCCTTCCTGCCGCGTCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTTCACCACCCGTTTCAGCCCGGCCCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCGGGCGCAGCCGGTGACGGTGATGCGGTCCTGCCATAAAGATAGCGGTAAAACTAACCCTGCCGGGTTCAGTTGCTCCACCCGCCCGTATCGTCATTAGCGGTAGCGCATCTCCAGCCTTCCCGCGTAACGGTGCGCCACCATCAGCCGGGTGCTGCGTCATACGTGAAAGCGCGCACCTGCGTATTACTGCGGTCATATATACCGCCAGCAGTTCACCGGCTTCCGTATACGTGTACCGCACCGGTGGCGCAAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCATCAAGCCACACCGCCGAGGCAGATACCCTAATCGGGGCCGTATTCGGTACCGGGCGGTGTGTCGGGGAACGCTGAAGGCTGAGGGCGGGAACTGTCGAAGAAGATAGCGAAGTCGGGCCTCTTCCGCGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCCCAGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCACCATCAATGCGCTTACCCAATTGCAGCGGCAGCGGCGCTGGCAGTACGATCCTCAACACCCAGCACCCACTCAGACCACGGTATCACCACGGCCTGTGCGCTGTTGGTCGCCAGGTAAAAGATGCGGGCAACCGGATCCGGCGGCAGCGCCCCCACAATACCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACGCGCACCAGCCATTGGCTCACTGCGGCTGTACCGCCTCCCCGGCAGCAGCGGCTCAAAGTGAATGCTCGCCCGCCGTTGTCGTTGAGTATCAGTCCGCGTCATCACGTGGCTGTAAGCGGATATCAGAAGGCGCTTTCCAGCCGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCAGGAGAGAATGAACGGCTTGGCCGGGCAGCGCAGATCCCGTCTCGCCGGGCGGCACCTTCGCTGGCAGCGGATTTACCAGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCGCCGATTGGGCGCCGCATAATTCTTACGCCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCCTGGCGCGCCGCTGGTTTTCCCGCTCATATAAAGTGCTCTTTTTGGTTATTGTTCATATCCCTGTGTTAGCAGCAAAAAAATAAAATGACACAAAGACCAGCTAATGTATTTATATTTTTTTCACATAAGCTTATTTGTTCTCAATCAACAACTTCATTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTTGGCCTTGATGAATTCATCATCAGCAAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTGTAAGGTCTGAGTTATTTTGTAGAGATATATTTAAAATCAATAAGCTCCACCGATTCGGATTAATGTCAATAATGAAGATCACCAATTCCAATAACATCATCAAGTAAGAGCATGGCTAAATTAATTTAAACAAGGCGTTCCCATTCAACCAGAACGCCCCTGTTCTCTCATCACCCCCACCATTTACTGAACAGCGCCTTGCCCGCCAACCAGTCGCGCGCAGCCAGCCGCCGAAAGCGACAGCAGCAGCGCTCGCTGCACGTAGAACAATCCACAATCGCCAGTCTGGCTCCCACGGAAAATCCAAACCTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAGCGTTGCGGCCTGGAATGAAACAAATTAAGCATAGCGGAACTCACACCACAACGTGGTACGCAGCGGTTTTTCCCCGCGCACCGGTGTGCGCCACCACCAGCTCCTGATGGCTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCGCCAGCGCCCGACTTACCTGCTCCAGCTGACCGACCTGTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTTGCCATTCTCCCAGCGGAAACTGGTAAGCCAGCTCTGCAGTTGCCCGTCCTAATGCCTTCAGGGGAAAATAAAATGAAATTAGGCCGCAGACTTTCCAAGATCCACTTTGCGCAGGCTGGTCGCTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTGGCGTTTCGCCAGCCCTCTTCCATCGACTTCATCGGCTTTTGTGGCGGCCAGTTACCGGCGACAATCAGCGGATTATGATCGGGCCGCGTATTTTGCGGGTAAGATTAGGGTTCGCGGTTAAGCGCCTCATCTTCATTACACCTTCTGTCGGCTTATCGATTTAATCGCCGTCAGCCGCGCCGCCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAGGAACCTTTTAGCAATGCTACCTGTTTCTGGCGATGTTAATTAAAAAGTAGTTCCGGGCTCTGGAGGTAGCTGCTGCCCGGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGGCGAAAATGCCGAAAGCTGACTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCACCGCCAGGCGCAGAGGCAGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCATCCAGCCAGCACACCGCACAGCAAAGCCAGTATTACTACCGCGCCCAGCTTCCGCCCAAAGCAGCATGCTGCCATTAATCCGGCGAGCAGCAGCACAAGCCACCACACTGACAATCCCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCATCATTACGTAATACGCGTAAGGCTGCGTTGCCAGCAACAAAGCGATATGGTCAGCCCCACCAGCAGCGAGATGACCGTCATGGTGCCGGCGCCTAGCCACGGCCAGAGGCTGGCTGGCGGTAGCAGATGCAACAGGCAGAACGGGCTTGAGCAGCACCATCAACGTACGTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGTCAGCGCCATCAGCCACACTGACCGACGATTAAACGCAGTTGCATCGCCCTGCCCCAGCGCGTTTTGAGGATCGCCACAGATCGTAGCGACTGCGACCCAGTGGCAGTTCATCACTACCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCGAAAGCAGCAGGAACTGTTTGCGAGCGTTCCATCGATCGCCCCAGCGCGCCTTCGTCCTGTTCAAATACGTACCAGCATTGCCGGGTTTAAGCTGGGGGTAACAACCATTTCTCGCCGTCTGAGCTGGTTCTCGTTGCCCTTGAATTTATAACGCCAGGTGACCCGGCTCCCCGGCTGCGGCTCCGGTTTTATCGACATCCGCCAGATTCATCATCAGACGGAATGGCCATCTGGAAGAGGTTAAAACCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCACCGCAATTAGCATCGCCCGCATCAATGGTGTCGCCGTTTTTCCCGGGTTAAACAGTGCCATCAGGCGTGGGGCCAGCAACTCGCGCTGCCCCGCCTTACTGCGGTTTCAGGCCAGGGGATTAGTTTGCGGATCGCCATACATCAGGCAGATATCAATCCACCGCTTTGACGTTCGCCAGCTGCGGTGTGTGTCGCTATACAAAGGTCTATTTGTGGCGAGAAAGTCAGCTGCTTGCCGACTTTCAGGCCGCGCTTTGCGCTTGCCAACCGCTTGCGGCACTTCGCGTGGTTGCGCAACGCCCGATCGCCCCGCCATAAACTCACGGCTTTGTGGCCAGCCCTTCTCCATGCGATCAGCAATTATTGCCCAGCGCCAGCACGCAGGCCACCACCAGGCTTAGCGCCAATGAACAATTAATAGCGACGGCGAACGCCATTCGCGCCAGAACCAACGTGCAATCATGCTTCCTCCTGCAGCTGCCCGTTCGCAGCCGTAAAGCGGCGGTTTGTAGCGTGCCGCCAGTTGCGGGTCGTGGAATCACCATAATCAACGTGGTGCCATGTTCACGGTTGAAGGGAGAGACAGCAGGTCGGCAATTTTATCGCCGTCTGGCGGTCAAAGGGTTGCCGGTGGGTTCGTCGGCAAACAGCACATCAGGTCGACCATTAAAGTCGTGCCCGGCCTCACTCGTTGCTGTTCACCGCCGGAAAGCTAATGCCGGAAGATGATCAGACGTTTACCCAGCCCTGCTTTATTCGAACAACGCTTTCGCCCCGTTACGACTTTCCGCTTCTCTCACCGCGCAGCCAGAAGGTTAAACACGAAGCAGACGCCGCAATATCCAGCGGG
>0e56d03e-268c-42cc-a0f3-90d688115d07
TTGTTGCTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTTCCATTTGTTCACCTTATTTATGTAAGGAGTATTTGATCATGTATAAGCTATGAAAACGGCTTTGGTAATAGGAATATCTCAATTTTAAACATAAAATGCGGTGTTGGTACAAAAGTAGCGTTACGTGATCTTTCCTGGGACTAGCTCTGGCAGTAATCGTGAACAGGGAATACCATTTCAAAATCACCATATTGCTTCAAAATCGAGGTGTTTCCCCGAAATCCTCTATCTTCCCAACCTTCTGCACCAGAAATGGCACAAATAGCCAACAGTAGAATATCTGACAATTTATGCACCACTTTCCAGGCTTGTCTGTAATCCCGGGTGTAATAGAAATATGTTCATCAATTTTAAAGTTCCATTTGTTCACCTTATTTATGTAAGAGTATTTGATCATGTATAAGCTATGAAAAACAGCTTTAGACAATAAGTAGTATCTCAATTGTTGAACAGAAATTCGAATTATTTAGTACAAAAGAAGTAGCGTTACGTGATCTTTCCTGCAAATGGAACGCAAAATAAACACCTATTCCATGAGTTATATAATTTTCACAATGATTAATTTGTTTTCTCCAGGAAGAGATTTTATTTCTCTTCACTACGGAGAATTTAGTTCATGCTGTATCTTTATTAAGCATTCGTAAGACTCATTTTGTTTCGAGGAGATGTGCTGTCATTTCAGGCATAAGTTGGTTTCTCATCTTTTAAAATATTTTACCATGATTGAATTATCAGGACTGCCAACAACTGAACTGGATCACTGCTCTTTTTGATAGATGATACCCGCTCTTATATAACTTCTAAACCGATCGCCGAGAAACGCCGTTTTCTGCTGTATTTATCCAACTCCTGCAACGTTCCTTTGATGGCATGATTTTCATTAAGGCGTAGTGACCGGCACCAGATAAGAGTCTCGCCCGCTTGGTGTGAATTTATTATTTTACATGTACCCAGTTCTGTTTGCCAATAATGCTCACCGATGTCCTCATTCTGATACCATCTCCACATGGCTTTACATTATTTAAGACAGGAAACGCGGAAAAATAGTACCCATAGCGAAAATAGTAAAACAATCATGATCTTTAAGCTTGTATTTCGCAATCAGCTATAACACCAAAACTAACAAATGTCATCAGCAAAGAACAAAACTCTTTTTCATTTTCTTATTCCTCTCGATGTTCTCTGTTTGCATCACCAGCTAAATTTCACCCAAATCATCTATCCCTGCTGTTGCTGGCCCATCAGGTTTATTAATGTCTGAGAATAAATAGGGGTTCTGCACAAGTATATCTGGTAGTAATTGAGTTGTTAGCCCAATTTGTCTGGCGAATTAATCACTTGCTTCTTTGTATCCATCCTGGATACTGGGAATCATCCTGTGGCGTACAAGTCAGATTTGGTTTTACCCGCTTCCTGCAATACGGTGTGTAGTCGTGGGGCTTAATGTGCTCTGAAGAATGTTTTGTGAAAACATTAGGCACTACTGGCTGGTCAATAGGATATGGCGGTCTTAATTGTTTCGCTATGTCGGCAATTTACTTACTTGGATCGGGTAGGCGGTTTATTTGAGTCTCGCTCCATATCCGCCATTATTTAAATTGTCCATATTTTGATGCCAGTCCCATTGAATCTATATACTGAACCGGATTCAGCGGATGCTGATAAAAATTTCCATCCCCCTTCAGCCCAATCGGATCCTGGTGATATACCTCCCCTGCAGCGGGTCATAGTAGCGTGGCAGTTGTAATACAGGCGGACTCCTCATCATACTGCCCCGGCAGTGGATAAGCTGCTGCGGCTGATGCGGGTTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTTGCCTTCCGTGCTGACAAGCGCCAACTTTGAGCCGCGATGGTCGCAGTGAGGTACAGGTGGATTTTCCGCGCCGGCGTGTACACCGGGTCCATCTGGTTTTGCATCTGCTCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCAGCTCTCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCAGGCATCTGCCAGCACCGGCGGGAACACCACTACTACCACCGTCTTCGCCGCCCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTCGCCAGCTCACCGGTGGCGGTTTCAACTTCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCGTGACAGCGACATCCAGCCCGTCAGGTCCGTTCACGTCGCCACACCCGTTTTGCCACCCGCGGCCCAACGGGTCGTGAATAGCGGCTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGAAGCTGGCTGTCGTAATGGTACACCGGTGGGTGCGCTCATCATCCGATGCGGATAACCCCTTCCGGGATGAGGTCAGTTTCTCCGTCAACCTGCCGTGACGGTCATACCGACAAGATGAATGCGCGTCACGGGCGACCACGGTTATCCGGCCACATGCTGGGGAGGTGCTGTCCGGAGTGCAGCTCAGGTCGGGCAGGCGGTTTACCTACTGGCGGGTCTGCTGGCATACGGGATATCAAATGCGGAGTTACATATAATAATAAAACAGTGGCAATTTGTTTGTTTATATTGCGCTTGCTTAATACAAACCATTGAATATACCTCCTGACGAAAATAAAAACCATATTATTATCGCCATAATATATGCTTATATCCAATCCTTACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGAGCAATAAAAGATGCATGCCTGTTGGAAAACATATTACCATCATTCCATGGACAGCCGGAGACTGATTAACTCGCTCACATCACGAGTGGAGTCTAATAGTGAGAAAGTCTATGCATGGAAAAGAATGGTAAAACAAAAGCGATAAAGCCAGCCATATGGCTGAATAAAAATAATATATTTCATTACATCCTCCGGTGAATACAAATCTAATAAGAGCGATCCAATGTTATTATTTCCGGAGCACTTCATCTTACATGTTCCTAAAGAATCATTAGACCAGTCTTGGCGGTTTAAATAGCCCTAAATTTATGAATTATTGAATATATCAGGCAACTACAGAATAACTATGACCTTACCTCTTTAAACTTCCCTTTTACCAAACAGTTCTCCACACAACTATTATCGGTTTCAACGAGGTCACAACGACCAGCAGCTTCTTTTCTTTATCATTGCTTGCTTTACCTGGCCCCATAGACCATCTCCTTTGGATTCTCCCCGTTGGTCTTGGCCACCACAAGTATAGTCCTTTACCATCTGGGACACAAAGATATTGATGATGAACGGATTCCCCATATGCTCTGGACCGCTTCTTTCGCAGTTCCGCCCATTGAATGCAGTAACCCAATGCATTTTAGTGTTTCTAATCCTAATGGATCTATATTTGGATCCGGATTCAACGGATACTGATAAAATTCCCATCCCCTTTCAGCCCAATCGGATCCTGAGTGATATATCGCTTCTGGCAGGTCATAATAGCGGTGGCGGAGGTTGTAATACAGGCCGGACTCCTCATACATACTGCTGCCCCGGCGAATGGATAGCTTCTGCTGATGCGGGTTCTCTTCATTCAGCAGGTTACCCCATTTCATCGTATTCTGCGTACCACGCTGTTGTCCTTCCGCTGATAAGAAGGGCCAGCGGCGGGCGCGACGGTCACCAGTGGTACAGGTGAATTTTCGCGCCGGCGTGTATACCGGGTCCCTCCCGGCACATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCAACGGCTTTCCTCACTTTCACCCGATCAGCCGAGTTTCGCTTTCCAGCCGGTCGGGCATCTGCACCAGCACCAGCGGAACACCGCTACCGTCTTCGCCACCGGACTGCTGGAAGGAGGTATCGCCAGGCTGCGGCGCTGCGTTTTCACCAGCTCACCGAGCAGTTTCAACCGATGGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCGGGCGGTCGCCGTCCCAGCCGTACCAGGTCTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCGTTCACGCCGCCATACCCGTTTTATACCCTGCGGCCCAGCGGAATCGTAAAATTAGCGACTTTCAGCCAGCGGCTCTGCATATTGTATCGCGTGGCATGAGTACCAGCCGGTGCTGACTGTAATAATAAGTACCGGTGGGTGCGCTCATCATCCGATACCCGGATAACCCTTCCGGGATGAGGTCGGTTTCTCTGTCAGCCTGCGTGACGGTCGCCACCGGTAAAAGAGATAGTGCGCGTCACGGGCGATACGGTTATCCCGGCCGCTGCTGGGCGCGCTAATCAGGTGCAGCTCAGATCGAACTGAGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGGTTCGCCGTTGTCGTTCCAGGTAATCCGCGGTCAGACAGCAGAGCTGTTCGGTCTTTGGCTCTGTAACTGCAGCAGGGAAGTATAAGCGGTAGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCAGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCAGGCTGTCGACCTGACGGTTCGCCAGTCCCTGTGCGTTGTACATGTCTGGTCTGCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAAAGGTGTTCACTGGCAGGCCTTTACTGTCCATAACCATGATGCACCGTCACCCGGTGCCCTTCGCTATTCTGGCTGATATGTCAGCCAGCCGCATTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTACGCGGTGCGTGAGGGCGGTCTGCTTCGTCATAAGTGCGCCGGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCACGGTCAGGTCGTGTTGATAACGCTGTGTGCGGCCGTCAAAAGCCGGTTTCCTGTATCCAGCCAGTCAGTACATCAACGGAAGGTGGTGTGGCTGCCGTTTCACTGGTCAGGCGGATGACCGTCCGGCGGCAGCATCATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATTGGCTTTCCCCGCATCGTACTGTGTCCGTTTCTCTGCTGCCGTCAGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCACCGCGTTTCATGGCCCGCGTGTCTTTCACGGCAATTAGCTGTCCACGGCTGTCGTATGCGCAGTACTGATAGCCCTTCCTCGCGGTGCACCGCCGTCCGCACCTGACCAAAACGGTCATGGTCATGGCGGGTTATGGCGCCGGAACAGTCAGTGAAGCTCAGCAGCTGGCTTGACCGTAACGGCTCCACGTCATGGTTTCGGCTGCCGGTGGCATCGCTGTTGCGCAGGGTAAGTCACTGTGGATATCGCATAACGTGTGGTGATATCGCCGTCGGGGCAGTTTCTGAATCAGACGGCCCCATTCATCCCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACACATCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAACCCTGCCCACCGCGTCAAACTGACTCTGCGTGAGCGCTGCGCAATCCGCGTGTTCCTTTCACCACCCGCTTCAATCCGCCTTCCTGCCCCTACGTGTGCAGGGCTTCACGGCGGTTCAAGCTGTCGGTGATGGTGATGCGGTCATATCTCGCTTTGTTACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTGGCTCAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCTCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCAGGGCGTCAGCCATAGCGCACCAGCGGCGCGACGGGTAATTCTCCGAAGGTATTCCGGGTCGTGCGTCCAGCCGAGCGAACGGGCGGATGCCGTATACGGCATATTCGGTGTAACCGGCAGGGTATCAGGAGAAAACGGACGGTTCCGTCCCGCCGGAAATGGCCTGCCGGGCTTCTTCTGCCTTTGCGCCTGCGTGGTCAGTACCAGCCAGGAAGTGACGCCAGCACCATCCGTCACGCCGGTGATTTCGCCGCTGGATTACCGGCGGCCTTCGCCAGTGGAACGTCTGTGTGTGCGCCTTGAAGCGGTCCACCAACCCAGTCAGTACGGTACGGCGGCAGCGACGCAGGCAGCACCTCATCCGCTTCCGGCACCGCTCACACCAGCCGAGCATTACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACAAGCGGAGTTCTTCGAAGCAGCGCCTGCCGGGATGCGGCCAACTGGTGACCTTCATCCAGTTTCGCCACTTCGCCGCGCAGCCACAGTGACTCATGCGGCTGTAACAAATCACCGGGAAACAGGTGCTCAAAATGCGACTTCTGCCGCCGTTATCACTGGTATCGGTGTGTTGTTGTTATCGCGCAGCTGTAAAGCCCGGATATCGCAGGCATTTCCCAGCCGGGGCCGAGGCTCCCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGCAGCAGGTGCGGGGAGAGAATGAACGGCAGCGGGCCGGGCGGGGCGATGTCGGTTTCACCGGGAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCTGCGCAGGGCACCGAACAGGCCACGCCGGTGGAGGCACAATCCATTTTTAGCTGAACCCTGAGCAATGCTACCGCCGCTACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCTCACTCCATCTGCTATCGCTTGTTTTTATCCGGGTTGGTTGTTGTCTGCTGACAGCAGGCAGAAACCCACAGATTTATAAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAAGAACAGTTAGGAAAATATTTATATATATTTCATGAATATATGTTTTCGATTGGTATAACGATGTCTAGAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTTCGCTGGCTGATTTTCAATCTTCATTCAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTGTATCGCTGGTTTTCGACCAGACGCGATGCGGAGTAGCTGTAAAAGCGGGCGCGGTCTTTCAGAAAGCATGAAGGCAGCGCCAGAACGCCCGCTGCAACCTGGGGTACGCGGCGTAAAAAGATAAGCCATGCAGGATGTTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGGATTGTTTATAAGACGGCTTTAAACGAACGCCGCAATATCGGCA
>bdfab7a9-1792-4c9a-9428-261e109cdfae
TTGATAGCCGTCGGTTACGTATTGCTGCTGCGCAATGTCTATCTTCGGCGTCTTGGGTGTTTAACCTGCGGCTGATTAATGACATTCCTCACCCCGGTACAGCGTTAGGCCGCGTACTTTTTCGCGCATAGCGTCTCTGACCGTGGGGATGAACTGGAAGCAATATCTTTGCCATTCTCGGCCTGAACATGCTGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCGCCTGTAATCCACAGCGGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCACCGTCGCTTTGTCACAATACCAACTGGCAATCACCCTGTGGTGAAACCACGTTGACTATTTCTGCAGCCAGATGGCGAACAACGATTTAAACTTTCTTTCTGCCCGCCAGCAGATTTAAATTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCAGGAATCACCTGGGTCGATCTGCTGCAATATCACGTATGGGTGCTGGTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGATTGCGCGCTGCAAAACTTTCTGCCTTATCGGGCTGTGAATACCGTTGAAGGGCGCAACTGGCTGTTACCATGGGGCTTTCATAGCTTCTGGAAGCGATCACGAATCATCAGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCTGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGGTGCAGATGCGTCTTCTTGATCCCAGCGCTGTCGCTTTTGCGCTGGTGATGATGGGCGATCTCGCCGCCAGAAGTGTTGCTGTGGGCGATGTCCGGTGGTGTTTTGTCGCCCGTGGAAAGCGTGGTGATGTGGGCGAAGTTCAAATTAATCCTCATCTCTGCTGGCACTGGGCACGGACAAGCAGCATCAATATGGAAGATGCAAAGAAACCCGTTTCGGCGTGCTGGTCAATTAACGCCTGTTTGCGGTCGTGACGACGGCGACTTCCGCAATAGGCGCAGTGATTACGATGCATGATTCGTTTACCGCTCTCAGTGGCATGGTGCCGATGCGCTGATGCAAATTAGTGAAGTGTTCGGCGGTGTCGATTCTGCCGTCTTCTTTGACATGATGCTGTTTGTCCTGCTGGCGGTGTTTGTGCCGGGCTGATGATTGGTCATACACCGGAATATCTGAGTAAAATCGACGTACGCGGATGAAACTGACTGCACTGGCAGATTCTGGATTTACCCCGGCCTTTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACATGAACAGCGCCATGCTTTCAACCCTGGCCCGCATGGTTTGGCGAAGTGCTGTACGCCGTAATCATCCATAACAACAACGGCAGCGCGCTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGTCGGTCGCGCTTTCGGGGTGATTATCCGGTGATGGCAATTGCCGGTTCGCTGGGCGAGTAAAGGCCAAACCCATAGCTCCGGCACTGCAACGCACGGCCTGTTTATTGGCCTGTTAATCTCGGCACCATGTTGCTGGATTTAGCGCTGACCTTTATCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCTGATGATATTGGTGAGCACTGAATACCAGGTCGTAAACGCTGGCGCTATTCAGACCAACGCCTTGTCGTTCAGGCGCTGAAGCGGGTAGAATTAAACCGCAGGCGCAATGGCGCAATCGGTGATGTTTATCGTCTGGATCGGCACGGTCTGCTGATACTGTAACGCGATGTGGCATTGCGATGCCCGGCAATGCGCTTTCATTGCTTTTGGCCGTATGATTGGCTGTGGATCACCGTACTGTTCGCGCTAATTTCACGCCGGGCGCTGGCAGAAGAGCCGCAGTAAGCAGAGGCCAACAGTCTGAAGGTGAAAAACACGCTGCCCTGCGGCTGCGTGAGCCGAAATATGGCGCTGCGGTAACGAGTTCTGCCGACTAACTTCGTAAAGGCGATACGTACTGGTAAAGGCCTGACGTCATGTCACGATGGTAGAGTTCGCCCAGAGGGGTACATCGGTCGATAAGCGCCATCCACCGGGAATCGGCACCGGTGATCCATGAATCGGCGGCGATTTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCGGCTGGCTGGTGATTAGATTGCTTGGCGTTAACCCCGGCGAGACATTTCTGGATCGAATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCAGGCGAAATTGCGCTGACCAAATTCTGCTGATTGCCTGACTATCGTCTTTTACTGGCAACCGCCACGCTGTAGTCGTTTTCCGCATTGGGGAGCGGTAATGCAGTCAGCGTAACGGTACTGGTATGGCGCTGCTGGTCTGCATCTGATCAACTCACTATTCAGCGGCTATTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGACCGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCACTACTGGATAAAACCGGCACCATCACACTCGGCCATCAGGCGTCGGGTTTATCCCGCGCAGGGCGTGGATGGCGCTGGCTGACGCCGCACAACTATTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCTCATAAGCAGCGTTTTAACCTGCGCGAGCACGATCTTCTGATCGCTCCATGCCGCCGCTGCCGTTTACTGCGCAAAAGCCGGATGAGCAGGATCCAACATCGACAACCCATGATCCATAAAGGTTCTGTCGGTACCATTCGTCGCCATGTTGGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCCGTCGATCAGGTTGCGCGTCAGGGGCTTCACCGCTGGTGGTGGTGGAAGGTTCTCGTATTGCGCAGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGTTATTAAAGAGCGCTTCGCCCAGCCACCAAAATAGACATTAAAACGGTGATGATTACCGGCGATAACCATCTGACTGCCTGCCGCGATTGCTGCGGAAGCAGGTGTCGACGAATTTTCTCGCCGAAGCGACGCAGGAGCCAAACTGGCATGATCCGTCAGTATCAGGCGGAAGGTCGTTTATTTAGCGATGACCGGCGACGCTTTAACGATGCTCCGGCACTGGCGCGAGCAGATATCGCGGTGACACGATAGACTCCAGCACCCAGGCGGCGAAAAGGAGGCCAGACAATATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGGTGGTGCACGTTGGCAAACAGATACTGATGGCCGTGTGGCTCATGACCACCTTCAGCGTACTAACGTCGGCGAAATGCGCCGCCGGTATTCCGGCAGCATTCAGCAACGTATCCACCGGATAAAAATGCGCTGAACATCTGTGCCTACATTCGCTTGACTCCGCAATCCTCAGTGCGGTGATTTTCAACCTTATGATTATCGTCTTTTGATTCCCCTGGCGTTAAAAGGCGTGAGTTATAAACCGCTTACCGCTGCCATGTGCGCCGTAACTTATGGATTTACGGTCTACGGTGGGCTGCCGGGTGCGCGACATATCGGTATCAAAGTCGTTGATTTACTGTGACGTTTACGGTCTGGTAGTTTACATGAGTGGATTACGTCCGGCATTATCAACATTTATCTTTTCTGACAATTGATTACTGGCGGCGTTTGCCGCTGCTGACCGTACTTCAGAACGTGGTGGTTTCCCTGGCAGGCCAATGGTTCGTTGATTCGTAAGGTGATACGGTAGCGGTTCGGCATTAATCGGGCAGGTATTTACCGTAGCAGCTGTTTTCATGATAAGCGCCCGTCGGCGGCGGCTGTGCCTATAATCCACAGGCTTCTGGCGAAGGAGCAATCCTGGCGGTCAGTAACCCTGGCTGGATAAACTAATATGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCGAGCATTCGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACTTACGCAAGCAGCGGCCTGGCAAATCCCACGCGTGGCGAAAGCGCGTAATCTCGGCGTTGACAGCTCGCAACTGATCCACAAAATACGGCCAACAACCGCTGGTGAAATATATCAGCCAGCGGTTGTCAACATTATTGAACTCAATCTGGCGCTGGATAAACTTGATGAATAACGGGCGCCACGTCGGCCCGATCGTCTGCTGGAACAAACTGCCGCTGCCACGTCGGAAGCTGAGTTTTTCTTCGGTGCCTGTGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCGAAGCCCAACGACTGCGGGCGCAAAGGGCTGGTGATCATTATGGTTGGCGTGGTAGAAACCCACGGGCGAAAAGATACCGCCGCCATGCTGGAAGGCTGGCTGTTTCTGCCGTTAAACGCGCCAGGCGTACCGTGGGCGGCATATCGGCGAGTTTGATCTCGATGCCGCCCTCGCCCGCCGCCAGCGCTGATCTTAATGGACGAACTGGCGCACGGTAAATGCGCCAGGTTCCCGTCATCCCAAACGCTGGCGGGATATCGAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGGGAAAGTGGATGATGTGGTCGGCGGCGTCACCGGAATTCAGGTAAGGGGAAACCGTGCCCGATCCTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACGCTGGTTGATCTGCGCCAGCGGCTGAAGAGAGCAAGGTCTGTATTGCCGGGCAGGCGGGCGCCTTTCATTGAACATTTTCCGCAAGGTAATTGATCGCCTGCGCGAACTGGCACTGCTTAATGCTGCCGATCGCGTTGATGAGCAAATACGCGCCTGGCGGGGGCATCCTGGCGAAGAGGTGGCTGGCACGCGCGACGCGATCCTTTTATGCATCGGCCATAACACCGGCGCGGCGAAAAACTGGTCCGCAGCTACTTGACCAGCGTCACGGCGCTGGGTAGCGTCTGGCGCGGTGTAAATGTTGAAACCTGCCCTGCACGCTTACGGAAAAAAACGTCGGGCGTTCTCGGCGCCTTACGTCTGGCGGAACTGGGCACGGGAGACGGCAACACTTTCTGATCAGCGGAAAGCGGTAGTGCGTTATGCCGTGAACATAATAAACGCGATTGGCTGCTGATCGCCCGTACTCCGCGCCGCTGGTGGCGTCGGGAAACTTGCTGACCGACTGGCGCGCGCATCGCCTGATCTCGATCAGGTGCTGGTCGCGCTTGATGGAACCACCCGCCCGCACGATTAACAACGCGCCGGATAACTATCTTTAAAGACAAGTGGCGTGTACAAATTCAGGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACCTTAATTGCCATGCGTGGCTGATGGCGTTGATGCCGCCAACCTGGTAACAGCAATATCTGCTTGGCGTGGTGTGTGGTGGCGCTATTTTATGGACTGCTGGCCTTCAGTGGTTGCCGCCGTCGTGTGTAGTGAGTTTCGATCTCTTTTATCGCCCACACGGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACGCTTCGCGGTGTTAACCGTCAGGCTGATCAGAACCTTACTGCTGGCGTGCGTTATCAGGCGCGGAGGTAGCCCGTTACCGCAGGCAACGCACGCGGCACCATATGAAATCATCAGCTCTGGCGGTGGGCCGCAGTCCGCAGGGATATCTTCACCAGCGAACAATTTACGCCTCCACGTTTCATGCCCGCAGTCGGGTGTTGTTGCCCGATGACAACGGTAGAAATTGCAGCCGTTAACATCCTGGGAATGACGCCAGTGGGGACAAAGTACCATCGCGCAGTGGAGGTTTGCGGTAAAGGCCTGCCTGCGGGCGCGGGCACTGACGCGTTACCCGGTGTACCGTGCCAGATTTTCGCCGCTAAAAGCGGCGAAAGCTCTACGGGCTGTTGGTGTGGTGGAGCCGGGGAGTCTGCGCCAGTTGATGATCCGGAACCAGCAGCGCTGCTGGAACGTTCGCTGTTGGTCTCTTATCATGGGCGGCTGACGCTAACCGCCAGCAGCGAAGAACAGGCGGATGGCAAACGAACGTGAACAGATCGCAACGCCCACTGGCAGCGCTGCACATGATTTACGCACGCCGCTTACGGTGCTGTTTGGTCAGGCCAATCGCCCAGCTTGTCGATCTGGCAAACGCAGAGGATCACCCCACGCCCGCCAAGGCCGGCGAGATCCGTCCAGCATAGTAGCGAACACTACCGACTGGTGAATAATCTACTGGAGTATGGCGCGAATTCAGTCCGGCGGCTTTAATTTGGAAAAGTGGTTAACGCTACGGAAAGAAGTAGTCGGCAGCGCTGCAAATGCTGGAACCGGGTTTTATCGTCTACCCATCAATCTTTCTCTGCCGAACCATGACCTCGATCCACGTTGACAGGCCGCACTCTTTTGAACGAGGTGCTGATTAATCTACAGAGAACGCCCGGGTGAAATATGCGGATTGCGCAGGCCGAATTGGTATCGTGCCCACGTTGAGGGCGAAAATCTGCAACTGGATGTCTGGGATAATACTTGGCCCCGGTCTTCCGCCAGGCCAGGAGCGGACTTTGATATTTGATAAGTTTGCTCGCGGGAATAAAGAGTCGAAGCGGAAGTACCAGAGTGGGGCGGACTGGCAATTTGTCAGGCGATAGTGGATGTACACGAAGGGCACTATTACCTGCGTTCAACCATTGGAAGGTGGTGCCTGTTTTTCATTATTACGCTTCACAGCCAAACTGCCCTGAACTGAAGAATTTCGCGGGATATATGACAAACGTTCTGGTTATTCGAATGAACAGGCGTATTCGTCGCTTTCTGCGCGCACGCGCTGGAGAACGACGGGATGCACGATCTTTGAGGCCGAAACGCTGCAACGCGGCTTATGGAAGCAGCAACCCGTAAGCCAGATTTGATTATTCTCGATCTCGGCGGCCTGCCCGATGGTGATGAGATTGGTTTATCCGCGACCTGCGCCAGTGGAGCGCAGTGCCGCAGTTGTGCTTTCCGCACGCAGCGAAGAGCGACCAAAATCGCCGCTGGATGCCGGAGCGGATGATTCTCTGAGTAAACCGTTTGGCGTGGCGAATTACGGGCCCGTCTGCGCGTCGCATTACACCTATACTCTGCCACCACCGCGCCCGATCCGCTGCTGTAAAATTTTCCGATGTTACCGTCCGGTTAACCGCCGCGTGATTGCCAGGGTGAGGAAGAGGTGCATCTCACACCAATTGAGTTCCGCCTGCTGGCGGTGCTGTAACAATGCCGGAAGAAGTACTCACCCAGCGCCAGCTTTCCTTAACCAGGTGTGGGGGCCAAACGCGGTCGAACACAGTCACTATTTGCGTATTTATATGGGACATCTGCGACAAAAACTGGAACAGGATCCCGCCCGCCCGCCATTTCATTACTGGGAAACCGTATTGAAAACATCGGTTTATGCTTTTGAATATTAATTTTAATACAGCTGCCTTTATTAATTAAAGCCGTAATAATAAAGCGGCTTTTATCTTCACAAAACAACACACAAAAGCTAACAATTCAATATTTTTATATTACTGAGTAAAAAGCTCATCATTAAATAAATTAAAAGATTGATCATTTTTATTGATCACCTTCACGGTTCAACCGCTATTTCTGGATAGAATATCTTCACCTTCATGGACAAACACCCAAGCAGACGCCGAAGATAGGCGACAGGCAAGTAGCAATACGTAACCGCG
>480b21b8-8901-4db2-939d-ed2eb1fb0a64
TTGTTCTTCGTTCAGTTACGTATTGTCTCACCTGTCTAGCTCTATCTTCGCGTCAGCGGGTGTTGTATGACCCGCTCGCCCACTCAAAACTTGCCTGTCGCTCTATCCTTCGGCGCGTCTGGCGGGTGTTTTAACCTATCCCCGCTGGCGGCAGAAAGAAAGTTTTGCCGTTAAAGCCCGCCATCAAACGAAATAAGCTCAACATTATGGTTTCACCGCTACCAAATTTGCCAGTTGGTATTGGTGATAAAGCTGGGCGGTATTCAGCATGAATCCCACGACAACCCTTAACGCTGCTGTGGATTAGGCGGCAGATGGTGCTGTCGAGCAGCATAAAAACAGCACCTTCCAGCCCAGCAATATTCGGGCCGAGAATGGCGCTGCGCAAAGATGTTAGCCAGTTCATCTCGGTCAGAACGCCAAGTGCGCGAAAGTACGCTCAGCGCCCGTTATTGCCGGGAAGGTCATCGTTAATCAGCCGCGCCAGCCCGCTGCCTAGAGGACGCGCCAGCGCAATAACACCAGCAGTAAAAAGCGTGGCGTCAGTAGAACCCTCGCGCAGCCATCAGAACGCCTCCCATTGATCAGGAGCGCAAACCCAGATAACTGATGAAAACACCAATAATACGCCGAGTTATCACGCCTGCACTCTGGTCCGCACCTCCAGTGGCCTAAAGAAATTGATACCGGAAGGGTAGAATTTCTGGCTGCAAGATTTCGCAAAATCTGCGGGCAGGGGTGTAAAAAAGTATCTTAAAAGCCATGATTTAACTAATGTTTGAAGTATTAATTTGCTTTTGTTAACTTAATTTACAGGATGAATAAATAAAACCGTAATAAAGCAAAAATAAGTGGTCGGATGGTAGTAAAATTACTGCAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCTACATTTTTTCGATTGCCATTCACCGGGTGGAAATACAAAAGGAGAAAAGTATGGAACTCTACAGAGAATATCTGCGCCGAAACTTGTCTTTTTACGCCGTACTTATGCCACCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATCACTTTCTGGAAAGATAACGCCCGCTTTTACAGCTTCTGCATCGCGCGTCTGGTCAGAAAACCGGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAAAGGCAACTGGTGATTTTATTGAGTTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTATATCAGAAGATGTTCCAGAGGAATATTTAGACATCGTTATGCAATCCGACATACATTCATGAAATATATATATAAATATTTTCCTAATTGTTTCTTATCGACAGATATCTCACTTAAAGACTTTCTTATAAATCTGTAGGGTTTCTTCTGTCAGACAAATAACCCGTCGCATCGGGATGAACGATGGGCGGAAAACCGGCGGCGCGTCTGAAGCGACATGACGCAGTATGGCGGTAGCGATAATCAGGGTTCAGCCGGGGTACGCATCAGTTGCCCCACCGGCATTAACCTGTTCGGGTGTGCCCCGGCGGTGACGTCAGCCATCGGTCAATCCGCTGCTCGGTGCAAGGTCCTTCCCGGTGAAACCGACGTCGCCCTGCCCGGCCCGCTGCCGTTCTTCTCCCGCACCTACAGCAGTTACCGGTTAAAACGCCCGCGCCGGTGGGGCCTCGGCCCCGGCTGAAAATGCTACGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCTGTATTTTGAGCACCTGTTTCCCGGTGAGGCGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGGGAAACTGGATGAAGGTCACCGGCTGGCCACACTCTGTGAGCGCTGTGAACTCGCTTAAGAATCCGCATAAGTTATCAGCGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAAGACGTTCACCGCAAGCCGCCGGTGAATTCAGCGGCGAAATCGCCAGCATTGACGGATGGTGCCAGGCGTCACTTCCGACTGGTACTGACCACGCAGGCGCAGCGGAAGAAGCCCGGCAACAGGCCATTTCCGGCGGGACAGAACCATCCGCTTTTCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACTGCCTGACGGAATACCCGGAGAGGAATTTACCTGCCGCGCCGCTGGTGCATATGGCTGGACGCCGCGAGCGAACTGGCAGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGCCGGATGGTGGCGCACCGTCACGGGCCGACCGGAAATGTTGCCGTTACGACAGCGACGGGCGAGGGTGACAGAACAAGCTAAACCAGCAGGCTTAAGTTACGTATCGGTATGAAAGGACCGCATCACCATCACCGGTAGCCTGAACCGCCATGTTACCGCACACTGCGGTGAGCGGGCTGAAGCCAGGTGGTGAAAAAGAACACGCGGACGGCAGCGTCACATGAGTCAGTTTGACGCCGGTGGGCAGGCTCGGGGCACAGACGGATGCCACCAGGCAGGACTGGCAGAATACAGTCGGATGTGACGGGCCTCATCACGCGCATCACACCGCCGGATGGCGAAATCGGCGTTTCACTATAACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGAACATGGAAATACGCCGGGAGATATGATGTATGAATGGGGCCGTCTGATTCGGGAAACTGCCCTGACGGCGATATCACCCGCTGGTGCGATAATCCACGATGACTTACCCTGCAACGGAAGATGCACACCGGCAACGGAAAAACCATGACGCGTGGAGCCGTTACGGTCAGTTGCTGACTTCCTTGACTGTTCCGGTTATACTTAACCCGCTATGACCATGACCGTTTGGTCGGAAGTGACGGCGGTGCACCGCGAGGAAGAGGGCTGAGTCAGTACCGCATACGACGGCCGTGGACAGTTAATTGCCGTGAAAAGACACAGGGCCATGGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCACCGTCATTGCCCCGGACGGCAACGAAACGGGACGCTGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGATCCTGACGCACCAGTATGGAATACGATGCTGCCGGACAGGTCATCCACCCTGACCAGTGAGCAGCGGCCACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGAAACCGGCTTTGGCGGCCGCACACATACCTATCACCGACCTGACCAGCGAAACTTATCGCAGCGAGGATGAGGGGCTGGTCACCCGCAGCTTTACTATGACAAACAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGAGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCCAGCCATAACTTCAGCGAAGGGCACCGGGTGACGTGCACTATAGTTCTATGACAGTAAAGGCCGCCTCGCCGAGTGAACACCTGACGGTGCATCATCCGCAGACCGATGAACTGCTCTGGCAGCGCCGAGACCAGACCATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCCGGACAACCTGCCGCCGTGGAATGGTGACCGCCGGCAGCGGCTGGCTGTCAGGCGCCAGAACTCGGCGACGACACACCGCTGGTAGATGCACGCGACCTGCACCGCGCGGAAACGCTGCGCAGCTTCGGCCGTTAGACTCACCGCAACATACCCTGCCGGGCAGTTTACAGAGCCAGCACCCTGAACAGCCCTGCTGTCTGACCGCGATTACCTGGAACGACAACGGCGAACTCATCCCGCATCAAACGGCCCGCGCCAGACGGAGTTACAGCTACAGCACCACCAGCAGGCTGACCAGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTACCACAGACCCGGCGGGTAACCATACCGACCCGGGACTGCTGCCGGACAGCGCCCTCAGCATGGCCCGGATAACCATGTCATACGTGACGCACTATCTTTGCCGGTATGACCGTCGGCAGGCTGACAGAAAACCGACCTCATCCCGGAAGGGTTATCCACACGGATAGAGTAAGGCGCGCACCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACCGCGGACACAATAACATGCAGAGCCGCTGGTCGAAGATCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACAGGTATGGCGGCGTAGACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCACAAGTGACCTGGTACGGCTGGGATGGCGACCGCCTGACCTGATACAGAACGACAAGAACCCGCATCCAGACGGGATTTATCTATTCACGCGCAAACCGGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGGAGCTGGCGAAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCAGTGGCGGCGAAGACGGTGGCAGTGTGTTCCCGCCGGTGCTGGTTGCAGATGCTCGAACCGGCTGGAAGGTGAAATCCTGGCTGACCGGGTGGTGAAAACTCGCCGCTGGCTGACATCGATGCGGCCCTGACTGGTGGCACCGGATAAACCAGATGGACCGGTATACACGCCGGCGCGAAAATTCACCTGTACCGCCACGACCATCGCGACCGCCACTGGCCCTTATCGGCACGGAAGGACAACGGCGTGGTACGCAGAATACGATGGTTAATTGTGCTGGATAGAGAACCCGCATCAGCTACCCCGGCGAAACATCGCCTGCCGGAGACGTAATGCGCATGATGAGAGGTCCGGCCTGTATTACAACCCGCCACCGCTATTATATGACCCGCTGCAGGGCGTGCTATCGCCTCAACGGGATCGATTAGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCGATCTCGCAAATAGCACTGAATCCATTAGGACAGAAACGCCAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAAGCGGTCCAGATATGGAATCCGTTTATCATCAATATCTTTGTGTCCCCAGATGTTAAAGGGGACTATACTTGTGGTGGCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAACAAGTAATGATACAAAAGAAACGCGGCCCGTTGTGACCCCATCGTTGAAACCGATAATAGTTGTAGGTTAAATTACACCCAAACGGAACGCCGAAGATAGAGAGCGACAGGCAGAGCAATACGTAAAAAAAGA
>44b26523-eaf0-4f28-87ad-4cca044fabc8
ATGTTGCCTCGATGATGCTTCGTTCCGGTTACGTATTACTGCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTCGACATTTCATATAAGTGCCGTGTGCGTTGCTCGCGGTAACATTTCCCGCGCCTGATAACGCGCACGCCAGCAGTAAGGTTCCCGATCACCAGCCCGACGGTTAACATCACCGCGAAGAAGGTCAGCAGATGTGCACATCAGAGACGGCAGGCGTGCCGCGTGGGGCGATAAAAAGAATCGAAACTGCTACGTGTAATGACGGTGGCAACCACTGAAGGCCAGCGTCCGCAAAATCGCGCCACCACCACCACGCCAAGCAGATACAGCATCACCAGGTTGGCGGCATCAAACGCCATCCCAGCCACTGCATGGCAATTAAGGTGATAACGGCGCATAACGCGGCGGCAACCACGCATCCTGAATTTGTACACCACTTGTCTTTTAAAAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTGGTTCATCCAGCGCGACCAGCACCTGATCGAGATCGGGGGCGATGCGCGCCAGTCGGTCAACGACGTTTCCCGACGCGCCACCAGCGGCGCGAGGCCAGGCGACCGAATAATCTGCCGAGATTATGTTCACGGGCATAACACTACCGCTTTCTCTTCCGCTGGATCAGAAAGTGTTGCCGTCTCGCGCCCAGTTCCTGCGCCAGACGTAAGGCGCTGAAAATTGCCGACATTTTTTTTCCGACCAGACGGTGCAGGGCAGGGGTTTCAACATACACCGCGTGCCGGAACTTTACCAGCCGTGACGCCAGCCCGCGCCGCTGCGCAGACCAGTTTTTCGCTGCCGGCCATGGCCGATGCATAAAGAATCGCGTCGCGCGGTATTGCCACACTTTCTCTTCGCCAGGATGCCCCGCCAGGCGCATTTGCTCATCAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAATGTTCAATGGCGCGCTCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGGGGCAAGTCCACCAGCACCACGTCGTCAGCGGCATCGAGAAAAGGATCGGGCACGGTTTCCCGTACCTGGCAAGATTCCGGTGACGCCGCTGACCACATCATTCAGACTTTCCAGATGCTGAACGTTGACGGTAGTGAAACATCAATGCAGCTTCAGCAGTTCTTCGATATCCTGCCAGCGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCCGATAAGATCAGCACGCCGGGCGGCGGGCGAGGGGCGGCATCGAGATCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCTTAGAACAGCCAGCCCTTCCAGCATGGCGGCGGTATCTTTAAGCCCGTGGGTTTCTACCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCATCGCCAGGTCTTCCCGACGCCTGCACAGGCTTCGAAAACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAGCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTATTCATCAAGTTTATCCAGCGCCAGATTGAGTTCAGCAATGTTGACAACCGGCTGTGATATATTCACCGGCGGTTGTTGGCTGTATTTTGCGATCCAGTTGCGTGCCAACGCTGAGATTACGCGCTTTCGCCACGCGTGAGTTTATGAGCCGCCGCTTGCGGGTGATATTATTGTCCAGCCGCTTGCCGCGATGCCGTCACCAGTTCAACCGGAACGCTCGCGCTGTCCGGGTTAGCGGCCCGTAATGCAATAACGCGTGCGGCTATTAGTTTATCAGCTCAGGTTACTGACCGCCGTTGCTCCCGCCAGAAGCCTGTATGGATTATAGGGCATTTCCTGCCGTTGCCGACAGGCGACCATGAAAATAGCCGTTGCCGGTAAATTCTGCCCGATTAATGCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTGCCCCAGTACGGTGTTGGTCAGCGGCGGGTAGAAACGCCGCCAGTAATCAATAACAGAAGATAAATGTTACGATGAAATGCGCGGACGTAATCCACTCATGGTAAACCTCGCAGACCGCAAACGGTCAGCCGGTAATCAATGACTTTGATACCGATAAACGGCACCAGCAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAGCGGTAAGCGGTTTATAACTCCACGCCTTTTTAACGCCAGAGATCAAAGACGGAATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCGGGCACATGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCATGGAATAATGGCGAAATATTTCGCCACATCGTTGGCAATGCTGAAGGTGGTCAGCGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAGCTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCGCCGCCTGGGTGCCGGGTTCATCGCCACGCGACATCTGCCTGCGCCAGCGCCGAACATCGGTGCCGTCGCCGGTCATCGCTGCAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAAAATCATCGACACCCGCTTCCGCAGCAATCCCGCGGCGGCAGTCAGACGGTTATCGCCGGTAATCATCACCGTTTTAATGCCATTTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCCAGCACACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCCTGACGCGCAACCTGATCGACTTTTGATCCAGCATCGGTAGGGAAGTGACCACCGTTAGCCTAAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACTGCACATCGCGCTCGCGCAGAGTTAAAACGCTGCTTGGCGGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCAAAGCCAGTTGGCTGCGGCGTCAGCCAGCGTTTTCATCCACGCCCTGCGCGTCGCTTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAGCGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCTACGCTCGCGCCTAACATCCGGCTCATCCCGGCGACGCCCGTCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCGAGTACCGTTACGCTGACTTTGCATTACCGCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAATAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCCAGGGCAATTTCGTTCGGCGTTTTGCGATCATGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGTTAACGCCACCCTCAATCACCAGCCAGTCAGAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCAGTTCTGCGGATCACACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCAGTACACCTTCAATAACTTCACCATCGCAGGATAGCTATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCAGCGGGAACTTTGTCCGCCGCAGCGCCATGTTCGGCTCACGCAGCTTGCGAGGCAAAGGCAGTTTTTTCACCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCGCCTCGGCAGAATTAAGCAGAACAATTGCGGTGATCCACAGCCAACCATATTGGCCGCGCTAAACAGCACATTGCCGGGCATCACTTGCCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCCAGACTGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGAGTTTTAATTTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACACGACTCGCCAGTGCTCCTCAATATCATCAGGAGATATTCCGCCACCGGACCAAGCGCCAGAACGGGGATAAAGGTCAGTGCGCCAACCAACCCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCGATTGCCAGCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACGGTTCCAGAACGGAGAGTTGGCGTAATCCGGCAAGGCGCTGCCGTTGTTGTTAACCCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGAGCCAGGGACGGAGCATGGCGCTACGATCCGGCGACCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTTGCAGATGTTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACATCATGCCGTGAGACCAGAACCGACACCGCCGAACACCACTTCACCGATTTGCATCAGCCACATCGGCACCATGCCACCGAGCGGTAAACCGTCATGCATCGCAATCACCGCGCCACGGAAGCCGCCATCGTCGACCGCAAACGGGCTACTGACCAGCACGCCGAAACAGCTCTCTTTACCTTATATTGATGCTGCTGTCGTGCCAGTGCCAGCAGATGAGGATACCCTGAACTTCTGCCCACATCACCACGCGCCTGCACGGATGACCAAATCACTGACATCGCCCACAGCAACATGCGCCCTGGCGGCGATCGCCCATCCCACTTCGCAAAGGCGAAGCACAGCGCCGTTGGGATCAAAGAGATCGCCAGCATCTGCGAAGTTGGTCGAGGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCTATGGGTAACATGTTGCGCTCCTTCAGCGAATTCACAGCCTGATGGGCGAAAGTTTTACAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGGCCCAGGCATTCCCAGGCGTGCTCATTATCTGGCGGGTAAACGCAGTTAAAGGGGTAAAAATCACCGCAATAATCCCGCTGGCGGCGAAGAAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGTTGGCGGTATTCAAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAACGGCAGATAGTGCTGACCGAGCAACGCAAAACAGCACCGCCAGCCCAGCATGTTCCGGGCCGAGAATGGCACGAATGTTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGCGAAAAATGCGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCGTTAATCAGCCGCGCCAGCCCGCTGCCACAAAGGACGCGCCAGCACCATTAACACCAGTAAAAGCGTGGCGATCAGTGGAGAACCACTTGCGCAGCCATCAGAACCTCCGCATTGATCGGGCATAAACCCAGATAACCCAAAGGTTAAACGCAAGCAGACGCCGAAGATAAGAGCGACGGGCAAGTGGCAATACGTAATA
>380cc868-0f9e-478b-b1df-70cbe6602339
CGGTATTGCTTCGTTCGGGTTACGTGCCGCAGTTGCTGATACTTTGGCGTCTGGCGGGTGTTTAACCTGCGGATGCCGTTGTCCGGCCATATTCGGTGTTCGACGACGGGAATTATCAGAGCGAAGACGGTTCCGTCCGCCGAAATGGCCTGCTGCCGGGCTATTCTGCCCGCTGCCTGCGTGGTCAGTATAGCCGGAAGTGACGCCCGGCATATCCATCACGCCGGTGATTTCGCCGCTGAATTCACCGGCAGCGCTGGCGGAACGATACCAGCAATGCGCGAAGCGGTCCACCAGCCAGTCGAGTACCCGGTACGGCAGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACGCTCACACCAGCCAGAGCAGCCACCGGCTACGGACTGTTTGTCGCCAGATAACGATGCGGGCTTAAGGTTCTTCCGGCAAGCGCCTGCCAGAATTTGACCAGCGGTGACCTTCATCCAGTTTCGCCACCACCGCGCAGCCACCGGCCCAGCTCGCTGCAACCGTCCTCACCGGGAAACGGGTGACCAAATCTGGGCTTCTGCCGCCGTTATCCACTGAGTATCAGTGTGTTATCCTTACTGCTGTAAGCCGGATATCCGCAGGCATTTTCCAGCCAGGGCCAGAGCTCCCCACCGGCGCGACGTTTCGTCGGTAACTATAGCCGGTGCGGGAAGATGAACGGCAACGGGCCGGGCAAGGGCGATATCGGTTTCACCGGGAAGGACCTTTACCGAGCAGCGGATTGACCGTTGGCGGACGTCACCCGCCAGGCTACCGAACAAGGCCACGCCGGTCAGGGGCACCGATGCGTACCCCAGCTGAACCCTGGACAATGCGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGATTTTCCATCATCATAACAAATGTGTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAAGAGAGCCTTGGTGAGATATCTGTCCAAGATAGAACAATTGGAAAATATTTATATCTCTTTCGCGCCAGATATATGTTTCGATTGGTACTAAAACGATGTCTAAATATTCCTCGAACATCTTCCTGATACAAAAACCATGGCGTTTCCGCACGGCTGATTTCCAATATTCAACTCAAAATCAATAAAATGCTGGTTGCCTTTTCGGCCTGATCCATCCACCCGGTTTATCGCTGGTTTTCGATGAACACGATGCAGTAGCTGTAAAAGCGAACTTGGTCTTTCCAGAAAAGCATGAAGGGCAGCGCCGAGCGCCACTGCAACCCGCAAAGAGTACGGCGTAAAGATAAAATATGCAGGATATTCTCTGTAAAGAGTTCCATGCTTTCTATACCTTTTGTATCACCGGTGAATGGCACCGGAAAAATGGAGGAATTGTTTATCTGATGAAAAGTAGTACCGCCTTTTGTATAATTTTACTACTCGATATTCACTTATTTTTTGGCAGTGATGGACTGTTACATTTCATCCTGTAATTAAAGTTACACAAAGTTAAATTAATACTAAACATTCGTTTAAATCATGGCTTTTACCATTTTATACTTTTTACACCCCGCCGCGTTTTTGCAGAAATCTTTTACGTAATTCTACCCTTCGGTATCACTTTTGGCCACTGGGGTGCACTGTGAGTGCAGGCGTGATAACCAGCGTAACTGGTGTTTTATTGCCGGTTATCGGTTTTATGCCTGATCGAAATGCGGAGCGTTCTGATGGCTGCGCAGGGTTCTTACAATCGCCACGTTTTGCTGCAGGTGTTGGCGGTGCTGGCGCGTCCTTTGGGCAGCGGGCTGGCGCCCCGGCTGATTAATATTGTCCCCTCTTCCCGGTACAGCGGGCGTTGGTACGTGCTTTTTTCTGCCCGGCGTCTCTGACCGTGGGAGATGAACTGGAAGCCAATATCTTTGTGCCATTCTCGGCCTGAACATATGCGGGGCTGGCGGTGCTGTTTTATGTTGCTCGATTAAAGCTTTACTATCCACCTTCAGCAAATCCACAGCAGTTGCCAGGGCTGCCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATGGCGGTGAAACCACGTTGAGCTTCTTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTTACCCGCCAGAGCATGCGAGCACGCTCAGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCTGTGGCGTTGTTGATTGCACTGTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCGGGCTGTGAATACCGTTGAAGGAGCGCAGCAGCTGTTACCCATGGGGCCTGTGGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGTGGCTTCTTTAATGCCAACTCGTCATCCGTTTGAAAACAACCGCACTGACCAACTTCGATTGCGGAATGCAGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCGAGGCATCATTGCTGGGCGATGTCCGGTGATTTTTATTATCTACGTAGGCGTGGTGATGTGGGCGAAGTTCAGGGTAATCCTCCGTCTGCAACGGGCGCGGACAGCAGCATCAATATGGAAGGTAAAGAGGCGTTTCGGCGTGCTGGTCAGTAACCTGTTTGCGGTCGTGACGGCCCGGCGGCTTCCTGTGGCGCGGTGATTTGCGATGCATGGTTGTTTACGCTCTCCGGTGGCATCGTTGCCGAATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGATTATTGTCGGTTCTGGTCTTTACAGCATGATGCTGTGTTTTATTCTGCTGGCGGTGGTTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATAGAAACTGACTGCACTGGCAATTCTGGTTACCCATTGCTTCGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAGCCACAGCCCGCATGGTTTTAATGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCAGCGCCTTTGCCCGGATTAAGCGCCAACTCTCCGTTCTGGGCTGTTTACTGGCGTTCTGCCATGTTTGTCGGTCGCTTCGGTGATTATCCAGTGATGGCAATTGCCGGTTCGCTGATGATAAAGAGCCAAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGTCGATAAGCACCGTGTTGCTGGTTGGCGCACTGGCCTTTATCCCTGCCCTGGCGCGGGTCCGGTGGCTTGGGGCCATCTCCTGATGATATTGGTAGGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCAGCCAACACTAGTCATCCAGGCGCTAGAAAGAAGCCAATTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCAGGTGATGTTTATCGATGCGGATCGGCAGTCCTGCTGACCACCTGTATTATCGCGATGGCGGCAGAGATTGCGATGCGTAATGCGCTGTTTAACGGCCATTAGCGGTTGGCTGTGGATCACCCATGCTGTTCCTTCATTTCGCCGAGATGACGAAGGCCGCAGTAAAGCGCAGGCCAACCAGTCTGAAAGGGGTGAAAAAACTGCCTTTGCCGCAAGCTGCGTGAGCGAAATATGGCGCTGCGGCGGACAAAATTCCTGCCGACAGCGTAAAGGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCCTGCGATGAACAGCGAAGTTATTGAAGAAGTTGCATCGGTCGATAAGCGCCATCACCGGGAATCGGCACCATTGATCCATTGATCCGGCGGCGGTGCCTCGTCACCGGCGGCGCGTATTCTTTCTGACTGGCTGGTGGATTGAGTGTAGCATTAACCCCGGCGAGACATTTTCTGGATCGGATAGTCGCGATGGTGGAAGGCGCACAGCGACACCGAACGCCGAACAGAAATTGCCTGACCGTTCTGCTGATTGCTGGCTATCCGTCTTTTACTGGCAACCGCCACGCTGTGCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCCAACGGTACTGGTGGCGCTGCTGGTCTATCCTGATCCCAACCACTGTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGGATGGAGCCGGATGCTAGGCGCGATAGTTGCCATAACCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACTGTTCTACTTCACTGGATAAAACCGGCACCATCACACTCCGGTAACCGTCAGGGCGTCGGGTTTATCCCCGCGCAGGGCGAATTGAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAAAGCAGCGTTTTAACCTGCGCGAGCGCGGTACGGTCCGCTCATGCCGCAGCTTTGTACCGTTTACTGCCGAAGCCGGATGAGCGGGATCAGCATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCATTCGCCATCATTGAGGCTAACGTTGCGGTCACTTCCTACCGATGTTGATCAAAAAGTCCCGATCAGGTTGCGTCAGGGAGCCACGCGCCGCTGGTGGTGGTAGGAAGAGGTTCTCGTGTGCTGGGCGTGTGCGCTGAAAGATATCGTCAAAGGCGGTATTAAAGGAAGCGCTTCGCCCAGCTGCGCAAATAGACATTAAACGGTGATGATTGCCAGCGATAACCGTCTGACTGCCGCCACGGTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGGCGACACCGGAGGCTTAAGCTGGCATTGATCCGTCCAGTATTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCTTTTAAGCGATGCTCGGCGCTGGCGCAGGCAGATGTCGCGGTGGCGATGAACTCCGGCGCAGGCGGCGAAAGAGGCGGGCAGCCATGGTCGATCGCCGACTCTAACCTGACCAGAAGTTGATGATCGAGGTGATTGCACATTGGCAAACAGATGCTGATGACCGTGGCTCATGACCCACCTTCAGCATTGCCAACGATGTGGCGAAATACTTCGCCATTCCGGCGGCATTCGCGGCAACGTACATCCGCAAAGTTAAATGCGCTGAACATCATGTGCCTGCGAATTCTTGACTCCGCAAATCCTCAGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTTTGATTCCCCTGGCGTTAAAGGCGTGAGTTTATAAACGCTTACCGCTTCTGCCATGTTGCGCCATGTATGGGTTACGGTCTGGGTGGGGCTGCTGGTGCCGTTTATCGGTATCAAGGAATATCATTGGTTACTGCGACCGTTTGCGGTCTGGTGTAGAAGGTTTACCATAGGTGGATTACGTCCGGCATTATCAATATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTACCACTATGACCACCGCCATACTGGGGCAATGGTGGTTTCCCTGGCAGGCCAATGGTTTCGTTGATTCGTAGAAGGGTGATACGGTGCGCAGTTCGGCATTAATCGGGCAGAAATTTTACCGGCAACGGCTATTTTCATGGTCGCCCGTCAGCAACGTAGAAATACCTATAATCCACAGGCTTCTGGCGGGAGCAAATCGGCGGTCAGTAACTGAGCTGGTTCGGCTTTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCGAGCGTTCCAGTTGAACTGGTGACTGGCATCGACGGCGGGCTGGACAATAGCATATCACCCGCAAGCGGCGGCCTGTAGCAAATCCACGCGTGGCGAAGCGCGTAAATCTCAGCGTTAGAACGGCTCACGCAACTGATCGCAAATACAGCCAACAACCACGCTGAGGTGAAATATATCGGCCAGCCGGTTGTCAACGTGTTGAATCAATCTGGCGCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCGACCCCGATCGTCCTGCTGGAACAAACTGCCGCGCCGCATCGGGGAAGCTGGTTTTCTTCGGTGCCTGTGCAGGCGTCAGGAAGACCTGGGCGATGCTGGCGGAAGCCAGCGACTGCGGGCGCAAAGGCTGGATATTGTGGTTGGCGTGGTAAAACCACGGGCGAAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCATTACCGTGGTGGCATATCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCGCCACCCGGCGCTGATCTTAATGGACAGGAACTGGCGCACGGTAATGCGCCAGGTTTCCGTCATCCCAAACGCTGGCGGGATATCAGAAGAACTGCTGGAGCTGGCATTGATGTTTTCACTACCGTCAGCATTCAGCATCTGGAAAGTCTGGAATGATGTGGTCAGCAGCGTCACCGGAATTCCAGGTACGGGAGACCGTGCCCGATCCTTTTCGATACCGCCGACACGACGTGGTGCGGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAGAAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTCCCGCAAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTCGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGGCATCCTGGCGAGAAAATTGTGGCACACGCGCGACGCGATCCTTTTATGCATCAGCCATAACACCGGCAGCGAAAACTGGTCCGCGCAGCGCGGCTGGCGTCACGGCTGGGTAGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCACCGCTTACCGGAAAAAAACGTCCGGGCAATTCTCAGCGCCTTGCCCACGTCTGGCGCAGGAACTGGGCGCCGGAGACGCTTAACCACTTTCTGATCCAGCGGAAGAAAGCGGTAGTGCGTTATGCTTCGTGAACTATAATCTCAGCCAAGATTATTCTCGGTCCTTGACCTCGCGCCACTGGTGGCGATCGGGAAACGTTGCTGACCGACTGGCGCGCATCGCCCCGATCTCCGATCGAGTGCTGGTCGCGCTTGATGAATCACCCGCCCGCACGATTAACAACTGGCACCGGATAACCGCTCTTTAAAGACAAGTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTTGATGCCGCCAGCGGTGATGCTGTATCTGCTTGGCGTGGTGGTGAATGGCGCGCTATTTATGGACGCTGGCCTTCGGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATCTCTTTTTATCGCCCACGCGGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGTTGGGGAACCTTACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCGAGCAACGCACGGCACTTATGAAATGTCGAAAGCTAGGTTAAACACCCGAAGCAGACGCCGAAGATAGAGCGACAGGCAAATGCTGTACGTGAAAAGCGTC
>60664444-cccc-41e7-b7a6-5c4c14343658
TTGTGTACTTCGTTCCAGTTACGTATTGTTTTCTGTTGGTGCTGATGTTGCAGCGTCTGGCGGGTGTTTAACCTCTCATCATCCGTGCGGATAACCCCTTCCGGGATGAGGTCGGTTTTCTCTGTCAGCCTGCCGTTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCGACACATGCTGAGGGCGCTGTCCGGGATACGCTCCGGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCAGTGGTGTGAACGCCGGTCAGCCTGCCAGTGGTGCTATGGCTGTCAGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCCGGAATTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGCGGTGCTGGCTCTGTAACTGCCCGGCAGGGTATAAGCGATTGGTAGTTCGCAACGGCCAGCTGCGCAGCGTTTCCAGTGCGGGCGGTCGCGGGTGGCTCCACCAGCGGTGTGTCGCCAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGAACTGACTGTCCGGTATACAGCAGTTCGCCAGTCCTGTGCGTTGTACGTGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCCGGATGATACCGTCAGGTGTTCACTGGCAGAGGCAGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCATGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATGCTGCCACCGCTCTGCAGTTTCGCCATTCACGGTGCGGTGCGTAGAGGCGGTCTGCTTCATCATAGTGCCAGTGGTGGCCAGCCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCGGGTCGAGGTGATAACGCTGTATTTTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGATTAATTACGCGCATCGTAACGGAAGGTGGTGTAATACCGTTTTCACTGGTCAGGCGGATGACCCGTCCAGCGGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCGCATCGTACTGTGTCCCGTTTCTGCTGCTGCCGTCCGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGCTTCACGACGATTAAACTGTCGGCTGTCATGCACGGTACTGACTCAGCCTTCCTCGCGGTGCACCGCCGTCACCCTGACCAAAACGGTCGCATGGTCGCAGCGGGTTACATAACCGAACAGTCGGTGAAGCTCAGCCAACTGACCGTAACGGCTCCACGTCGTTTTCCGGCTGCCGGTGCTTCCGTTGCGCAGGGTAAGTCCTGTGGATTGTCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCGGCGTATTTCCAGCCCGTGGAGCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGTGCCCACCGCATCCGGCGTGGTGATGCGCGCGTATTAAGGGCCCGTCACCCACATCGGACTGTATTCTGTTGTCCTGCACCTGCGGCATCCAGATGCAACCTTTCAGGAGCCTGCCCACCGCGTCAAACTGACTCACTGACGCTGCCGTCGCGTGTTCCTTTTCACCACCCGCTGTGCCTACCCTGCGTGTGCGGACTTCACGGCAAAGTTCAGGCTGTCAGTGATGGTATTGCGGTCCTTCTCATACTGATTAACTTAAACTGCCGGGTTTAGCTGTTTGTCGCCCGCCCGTCATGTCGTAACGGTAACTGAATTTCCGGTCGGCCCGGTGTGACGGTGCACTTACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTATTGCTGCGGTCGCCCGCCACTATCCAGTTCGCCGCGGGGCGTCCAGCTTCGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACGGCAGACAGACGGATGCCGTTGTCGACCATATTCGGTGTAACCCGGCAGGGTATCAGGAACGGACGGTTCCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGTTCAGTACCAGCCGGTGACGCCCGGCACCATCCTCTGCCGGTGAGAGGATTTCGCTGAATTCACCGGCGGCTTCGCAGTGGAACGTCTGTGTGCGCCCGGCGGTCCACCAACGGTCAATTACCCGGTACGGCAGCTGGCAGCGGCTGGGCAGCACCTCATCCGCTTCCGGCGCCGCTCACACCAGCCAGAGCAGCCACCACGGCTGCGGACTGTTTGTCGCCAGATAACGATGCCGGACTTAAGCCGGGTTCTTCCGGCAGCGCCTGCCAGAACTGCGGCCGGCAGTGACCTTCATCCAGTTTCATACGCCGCCGCGCACCGGCCAGTGGCTCGCTGCGGCCAACCCGTCCTCACGGAAACGGAACTCAAATACAGGCTTCTGCCGCCGTTATCACTGGTATCGGTGTGTTATCCGCTGGCTGTAAGCGGATAATCGCAGGCATTTTCCAGCCGGGGCCAGGGCTCCCCCACCACCGGCGCGGGCGTTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAAGGATGAACGGCAGCAGGCAGACGGGAGACGTCTCGGTTTCACCAGGAAGGACCCTTTGCACCGAGCAGCGTTGACCGGATGGCGGATCACCCGCCGGGGCACACCGGAACAATTACGCCGGTGGGGGCACCGATGCGCCCCGGCTGAACCCTGGACAATGCTACGCCATACTGCGTCATAATCGCCCTGACGCGCCGCCGGTTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTGTTGTCTGCTGACAGGCCCGAAATTCCCTACAGATTTATAAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAGTGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATGTTCCTCACAGACATCTTCCTGATACAAAAAACCGCCAGCGTTTCCTTTAGCCGGTTTCAATAATATTCAAAACTCAGCAATCAATAAAAATCACCAGTTGCCTTTCGGCCTGATCCATCCACACCGGTTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCAGGCGCGGTCACCAGAAGAAGAAAAACGCAGAAAGGCAGCGCCAGAACGCCCGCTGCAGCCGCATAAATTGCAGCGTAAAAGATAAACCATGCAGGATATATTCTCTGTAGGTTCCATACTTTTTCTCCCCTTTTGTATCTACCGGTGAATGGCACCGGAAAAATGAATTGTTTATCTGATGAAAATAGTACCGCCTTTGTGTAATTTTGCACTCGCCGACCACTTATTTTGCTTGGCTGATGGTTTTATTTACATTCATCCTGTAATTAAGTTACACACAAAAGTTAAAATTAATACTAAGCATTAGTTAATCATGAAACTTTTGCCATTTTATACGCACACCCCGCCCGCAATTTTTTTTGAAATCTTTGTAAATTCTACCCTTCCGAGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAGCGGCGTATTGCTGGTGTTTTATTGCTGGGTTATCCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGAATTGTTAATGGTGCTGGCGCGTCAGCGCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAGCGGGCGTTGAAGGCGCGTACTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTTGTGCCATTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCCCAGCAGTTACCCGGGGCTGTCGTGGGATCTGTGGCGCTGAATACCGCCGTCAGCTTTGTCGCAATACCAGCTGGCAATCTTATAGCGGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACAGTGCAAAACTCTTTCTGCCGCCAGCAGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCATTATGGGTGCTGATCCTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAAGGGTGCGCTGCAAAACTTTCCTGCCTTATCAGGCTGTGAATGCCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGAAGCTTCTTTAATGCCAACTCGTCGCATCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGCTTTGCCTTTGGTGAAGTGATGAGCGATCGCCGCCAGGGGCGCATGTTACTGTGGGCGATGTCAGTGATTTTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTACTGCTGGCACTGGGCACGGACAGCAGCATCAATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGGCGACTGGCGGCTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCGTCTTTACGGCGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGATACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGGCTGCACTGGCAATTCTGGTTACCCGACGCTGTGATTGCTGATGGGCGCGGCGTTGGCGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTGGCAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATAGCAGTGCCGGTTCGCTGAGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCCACGGCCCGCTGTTTGTTACAGCCTGTTAATCGGCACCGTGTTGCTGGATTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCAGTGGCGGAATATCTTCTCCTGATATTGGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAATTAAACCCACCAGGCGCAATGAAAGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGCGCTTATTAGCATCGCGATGGCAAGCGGTACGATGCCCGGCTTAATGCGCGCTGTTTGGCGCGGCCATTAGCAGTTGGCTGTGGATCACCATTACTGTTCGCTAATTTCGCCGAGGCGCTAATGAAGCCGCGAAGAAGTAAAGCGCAGGCCAACAGTCTGAAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGACCGAAATATGGCGCTGCGGCGGACAAAGTTCGCCGACCAACTTCGTAAAAGGCGATATCATTTTGGTAAGAAGCTGGCGATATTATCCCTGCGATGGTGAAGTTATTGAAGGTGCATCGGTCGATGAAAGCGCCATCGCAGGGAATCGGCACCGGTGATCCGTGAATCAAGTTAAGCAAGCAGACGCCGAAGATGGAGCGACAGACGAAGTAGCAATGCAATGAAAAAAAAAGA
>e744ac28-518e-4933-b2a9-e59adecd6512
TTGGTATTACTTCGTTCAGTTGCGTATTGCTACTTGCGCAACCGGCTCTATCTTCGGCGTCTGGCAGGTGTTTAACCTTGCTTTTCCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAACCAGCGATAAACCGGTGTGGATCGGATCAGGCCGAAAGGCAACTGGTGATTTTATTGATTGCTGGGTTTGAATACATTGAAAACCGCCAGCGGAAACGGCAGTTTCTCATCAGGAAGATGTTCAGAGAATGGCCCAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAGAAACTCTTATAAATCAGGGTTTCGCCTGTCAGCAGACAAACCAACCCGATAAAACAAGGATGAGCAGATGAGCAGAAACCGGCGGCGCGTCAGGCGACATGACGCCGTATGGCGATAACATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTCAGCATTCCGTTAATGCCCGGCGGGTATTGACGTCCGACCATCCGGTCAATCCGCTGCTCAGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCGGCCCGCGCGTTCATTCTCTCCGCACCTACAGCGGTTACACGGACAAAACGCCCGCGCCGGTGAGGAGTCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCGAGTGATAGCGGCGAAGCTGTATTTTGAAACCTGTTTCCCGGTGAGGGACGGTTACAGCCGCAACGAAGTCACTATTTCGGCTGGTGCGCGGCGGCGTGGCAGAAAACTGGATGAAGATCACCGGCTGGCCGCGCACTCTGGCAGAGCGCTACCGGAAAAGAACTCTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACGGTGCACCGAAGTGGTGGCTGCTCGGCTGGTGTGAGCGAATTCCGGAAGCGGATGAGGGTGCTACCTGCGCCGCTGCCGCCGTACCGAATTTTGACCGGGCTGGTGGACCGCTTCGGGCGCCACACAGACCGTTCCACCGCAAAGCCGCCGGTGAATTCAGCGGCAATCACCGGCGTGACGGATGGTGCCAGGCGTCACTCCGGCTGGTACTGACCGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAACCACAGGCCATTTCCGGCGGGACTGGAACCGTCCGCTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCGGGGTTGGCAGCTCATCTGTCTGCCGTCATGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCCGCTGGTGCGCGCGCTTATTTCAGACGCCCCGCGGCGGGAGCTGGCGGCGGTGTATGACCGCAGCAGCTGGAGTGCGCAGCTTTACTTACGATGTTAAATACCGGGGCCGGATGGTGGCGCACCGTCACGCACGGAGCCGGCAAATCTGTTACCGTTGACGGCGACCGGGCGGGTGACCAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCGGCTGAAGTCCTGCACACGCAGGGTGAAGGCAGGCTGAAGCAGGTGGTGAAAAAGGAACTACGCCGGACAGCGTCGCATGAGTCAGTTTGACGCGGTGGGCGAGGCTCAGAGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCCCGCGCATCACCACGCCGGATAGCAGGGCATCGACGTTTCACCTATCGCCACCACAGCCAATTAACGTCAGCCCACCGGGCCTGACGGGCTGGAAATACGCCGAATATATGATGAATGGGGCCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCGCTACCGTTATGATAATCCACGGTATGACTTACCCTGCGCAGCGGAAGATGCCACCGGCGGCCGGAAAACCATGATAGACGTACGGTCGTTGCTGGTGAAACTTCACTGATGTTTCGAGTTTATGGCCCGCTATGACGCGACCGTTTTGGTCAGGTGACGGCAGCCGTGCACCGCGAGGAAGGGCTGAGTCGGTACCGCGCGCATCAGCGGCCGCTGGACAGTTAATTGCTGCGTGAATACGCAGGGCCATGAAACGCGGTATGAATACACAACACCGCCGGTGACCTGACCACCCGTCATTTGCCCCGGACGGCAGCGAGCACGGGGACACGGTACGTGCGTGGGGAAAAGCCATCTGCTTTACGCAGAGGCGGTCTGACGCGCAATTAGCCGGAATACGGACAGGTCATCCGCCTGTGGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGGCGCTCGACCGGCTGATACGGAAACCACCGGCTTTGACGGCCGCACCGTTATCACCACGACCTGACCGACTGAAACTTATCCGCAGCGAGGATGAGGGGCTGGTCACCCACTAACACTATGACGAAACAGACGCCTCCGCGCACCGTAGATGGCGAAACCGCAGAGCGGTAGCGAGTATGACGAACGCGGCTGGCTGACGGACATCAGCCATATCGGCAGGGAGCACGGGTGACGGTGCACTATGGTTACTCGACAGTAAAGGCCACTTCTCGCCCACCGACACCTGACGGTGCATCCGCAGACGAATGAACTGCTCTGGCGGCATGAGACCAGGCAATGCGTACCTTGCCCACGGGGACTAACGAACCGCTGTATACCGGTAGCTGCCGCCATTCAGAATGGCTGACCACAGCGGCGGCGTATCAGGCGCTGGAAACTCGGCGACACACCGCTGGTGGAGTACCCGCGACCGCCTGCACCGAAGTACTGCGCAGCTTCTGATAATTATGAACTCTGCCACCGCTATGCCTGCCGGGCGATTACAGAATAAACACCTGAACAGCCTGCTGTCGATACGGTACACCTGGAACGACCAACGGCGAACTCATCCGCATCCGGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGACGGAAGCTGACCGGCGTTCCACACCACCGCAGCAGATGGGATATCGCATCCATATACCCACAGACCCGGCAGGTAACGCCACCCGACCGGAAACTGCACGGCGGACAGCGCCTGGCGTAATGGATAACCATATCGCCCGTGACGCGCACTTCTCTTTACCGGTATGATATCACGGCAGGCTGACTGAGAAAACCGACCTCATCCCGGAAGGTATCGCACGGATGATGGGCACCACCGGTACCGGTACGACGATCAAGCGCAAGCGTTCGCACTACATGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGCGCGGGCCGCAAATTCAACAAAAACGCCAGGGTATGGCGGCGTGAACGGACCACGGCGAATGGTGTCTTCGCTGTCGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCTGAAACCACGATACGAACGACAGGGCCCGCATCCGGATTGATTTATCAGCCGGGGAGCTTCACGCCCATCATCAGGGTTGAAACCGCCACCGGTGAAGCTGGCGAAACCACCAGCGCCGCAGCCTGGCGGATACCCTTCAACGGTCGTCGGTGGCGAGAACCTTGATGCGGCGGTGTGGTGTTCCCGCCGGTGTAGTGCAGATGCTCGACCGGCTGGAAGTGAAATCCCTGGCTGACGGGTGGTGAGGAAAGCCGCCGCTGGCTACGCATCGATGCGGCCTGACGTTGGCGCAGATGCAAAGCCAAGATGGACCGGTATACACGCCAGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGCGTACCGCTGGCCCGCTATCGGCACCGGAAGGACCAACAGCATTAGTGCGCAGATATCACGATGAATGGTACGCCTCTTACGATGAAGAACCGCATCCGGCGAGCTGCAGCAGCCCTCCGCCGGGGCAGCAGGTATGATGGGGAGTCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATCCTCAGGATCCGGTGGAACGAAGGGGATGGAATTTTTATCGGTATCCGTTGAATCGATCTCAAATATAGATCCGTGGGATTAGAAACACTAAAATGCATTCACTGCATTCAATGGGCGGAACGCTGGTGAAGAAGCGGTCCAGATATGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATACTTGTGGTAGCCAAGACCAAGCGGGGAGAATCAAAGGAGATGGTCTGGGGGCCGATTAAAGCAAGTAATGATACAAAGGCTGCTGGCCGTTGTGACCTCGTTAAAACCGATAATGGTTATTGGCGGAGAACTGTTTAAAGGGAAGTTTAAAGAGGTAAGACCGCGTTGATAATGTTCCCTGATGCTCATTCCACACCTACCTCGATTTGGAACTGTTAAAAACTGCAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGAGTGATCTAAATGAAATATATTATTTTTTATTCAGAGCTACCTGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTTGCTAATTAGGGCTCCACTCGTGATGGGCAGTTAAATTAGTGTCTTTATGAATGATGGTAATATCTGTTTCCAACGGGCATAGTATTCTTTATTGCTCTAATATTTATAGAGGTTATCAGACGTGCAATGAAGTTGATGGTAAGTATATTATGGCGATAATAATGTAAACTTATTTTCTGTCAGGGTATATTCAATGGTTTGTATTAAATGGCGCATTATAAGCTCGATAAATTAAGTTATTGCTCTTATTGGTATATGCAAACACCTGGCGTTGATATCCGTATACCACAGACCAACGATGTAACCGCCTACCACTTGACCCGGAGCTACGCGGACAACCCTCAAAGCATGGCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTAGCAATAAATAATGCAGCGGGTGACGGAAAACCGAGCCTCATCCGGGAGTTATCGCACGGATGATGACACCACCACCGGTACCGTACGACAGTCAGCACCGGCTGGTACGCACGCGGACACAATATGCGGGGCCAGCCGCTGGTCGAAGCCGCTATCTTTACGACCCGCTGGGCCGCCAGTTGTAAAGGTTAAAACACCCAGACGCCGCAATATCAGCACCAACAAGTAATACGTAAAAAAGA
>2c468ad4-194a-4af0-93d4-3fcbe17a9be7
TTGTTGTGCTTCGTTCCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTCACTTGTCTTTAAAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTGGTTCATCAAGCGCGACCAGCACCTGGAAATCGAGATCGGGGGGCGATGCGCGCCAGTCGGTCAGCAAACGTTTCCCGACGCCACCAGCGGCGGCGCGAGGCCAGGCGACCGAGAATATCTTGCCGAGATTAGCATGTTCACGGGCATAACGCACTACCGCTTTCTCTTCCGCTGGATCAGAAAGTGTTGCCGTCTCCGCGCCCAGTTCCTGCGCCAGACGGCAGGCGCTGAAAATTGCCCGACGTTTTTCCGGTAAGCGGTGCAGGGCGGGGGTTTCAACGCCACCGCGTGCCAGACGCTACCCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACAGTTTTCGCTGCCGGTGTATGGCCGATGCATAAAAGGATCGCGTCGCGCGTGCCACACTTTCTCTTCGCCAGGATGCCCCGCCGAACGCGCATTTGCTCATCAACGCGATCGGCGAGTACGGCGCAGTGCCAGTTCGCGCAGAACTGATCGGATTACCTTGCGGAAAAAATGTTCAATGGCGCGCTCCGCCTGCCCCGGCAATATAGGCTTGCCTTCTTTCAGCCGCTGGCACCAGATCGTCCAGGGCAAGTCCACCAGCACCACGTCGTCGGCGGCATCGAAAAGGATCGAGGCACGGTTTCCCGTACCTGAATTCCGGTGACGCCGCTGACCACATCATTCAGACTTTCCAGATGCTGAACGTTGACGGTAGTGGCTTTATCAATGCCAGCTTCAGCAGTTCTTCCGATATCCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGCAATGCGCCAGTTCGTCCATTAAGATCAGCGCCGGGCGGCGGGCGAGGCGGCATCGAGATCCAACTCGCTGATATGCCGCCCACGGTACGCCCTGGCGTTTAACGGCAGAACAACCAGCCCTTGGCATGGCGGCGGCGGTATCTTTCGCCCGTGAACTCTGCCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCCTTTGGGCTTCTGCCAACATCGCCCAGGTCTTCCCGACGCCTGCACAGGCACCGGCTTTCGGCTTCCCCGATGCGGCGCGGCGGTTTGTTCCAGCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTATTCATCAAGTTTATCCAGCGCCAGATTGAGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAACGGTTGTTGGCTGTATTTTGCGATCAGTTGCGTGAGCGCTGTTCAACGCTGAGATTACGCGCTTTCGCCACGCATTAAGTTTGCCAGGCCGCCGCTTGCGAGGTGATATTGTCCAGCCCGCTTGCCGATGCCGTCACCAGTTCAACCGGAACCTCCGCGCTGGCATCGGGTTAGCGGCCCGTAATGCAACAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTACTGACCGCCGATTGCTCCGCCAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACATGAAAATAGCCGTTGCCGGTAAAATTCTGCCCGATTAATGCCGAACCGCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGAACCACCATTGCCCCAGTACGGTGGTCGGCAGCGGGTAAACGCCGCCAGTAATCAATAACAGAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACGCAGACCGCAAACGGTCAGCAGTAAATCAATGACTTTGATGCGATAAACGGCGCAACGGCCCACCCAGACCGTAAATCCATAAGTTGCAGCAACATGTGAAGCGGTAAGCGGTTTATAACTCACGCCTTTTAACGCCAGGAGATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATACGGCACATGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTCAATAATGCTGAAGGTGGTCCAGCGAGCCACGGGTCATCAACATCTGTTTGCCAAATGTGCCACCTCGATCAGCTTGGTCCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCGCCGCCTGGGTGCCGGGTTCATCGCCACCGCGACGTCTGCCTGCGCCAGCTTCGAATCGTTGGTGCCGTCGCCGGTCATCGCTACCGTGACCTTCCGCCTGATGCGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAAAATCATCGACACCCGCTTCGCAACAATCGCGGCGGCAGTCGAACCCGGTTATCGCCGGTAATCATCACCACCGTTTTAATGCCCATTTTTGCGCAGCTGGGCGAAGCGCTCGCTAATACCGCCTCTGACTTGATATCTTTCAGCGCAATAACGCCCTTTTGCGAGAACCTTCCACCACCACCAGCGGCGTGAAACCACCGACGCGCAACCCTGATCGACTTTTTGATCAACATCTGGTAGGGAAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACTGCATCGCGCTCGCGCAGGTAAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAACCAGCAAGAAGCTGGTTGCGGCGTCAATAACGTTTTTCATCCACGCCCTGCGCAGCGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGAGTGCCGGTTTATCCGGTAGCAGAACGTCAACGTCACCTGCCGCTTCAGCTGCGTCCGCTGGTGGCAATCGCATTCGCGCCTAGCATCCGGCTCATCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATGGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCACGCGGAAGCGGCCTGGCAGCGTGGCGGTTGCTTGATAAAAGACGATAGTCAGGGCAATCCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGGTCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAGAATACGCGTACCGCCGGTGACGGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATAGCGCTTTCATCACGACCGATGCACCTTCAATACTTCACCATCGCGGGGGATAATATCGCCAGCTTCTACCAATACGATATCGCCTTTACAGAAGTTGGTCGGCCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCGGATTTTTCACCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAACGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCTACCGCTAATGGCCGCGCTAAACAGCAGCGCATTGCCGGGCATCGCACCGCTTTGCCATCACCCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCGGACGATAAAACATCACCGGATTGCGCCATTGCGCCCTGCGGAGTTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATGGCGCCAGTTGTTTACGGCTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGGATAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGATGCCGGAGCTGGCGGCTTGGCTCTTTTACTCGCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACTGCAGAACGCCAGTAAACAGTTCCAGAACGGAGGTTGGCGCTTAATCCGACTTTAAAAGCGCTGCCGTTGTTGTTGACAGCGGCGGATGACGGCGTACAACACTTCGCCAGAAACCATACGGGCCAGGGTTGAGCATGGCGCTACATCCGGCGTCGGTCTTTCATCATCGCCAACGCCGCTGCATCAGCACCAGCGTCAGGGTAACCAGAATTGCCAGTGCAGTCGGTTTCATCTCGCGTGCGTCGATTTTTACCCGGATATTCGATTATTCGCGACCAATCATCCAGCCCGGCAATAAACACCGCCAGCAGGACAAACGGCATCATGCCGTAAGGGCCAGAACCGACACCGCCAGACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAAACAGGCCTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATGGTGATTAACGCTGTCCGTGCCCAGTGCCAGCAGATGGGGATTACCTGAACTTCTGCCCACATCACCACGCCTACGCGAATGACAAAATCACTGACATCGCCCACGGCAACATGCGCCCCTGGCGTGATCGCCATCCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTCTGCTGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCACCGCCGTTAGTACCGAGCATCTGATCGCTTCCTGAGAAATACAGGCCCCGCATGGGTAACAGCTGTTGCGCTCAGCTAACGGTATTCCACAGCCTGATAAAGGCAGAAAGTTTTGGCACGCAGCGGTGAATAAAAAACAGTGCAATCAACAACCACGGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGACATTCCAGGCGTGCTCATGCTCTGGCGGAGTAAACGCACGGATGAGGGCAAAAATCACCACCAATCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAGGTTAAATACCCAAGCAGACGCCGCAATATCAGCACCAACAGAAAGCAATACGTAACGCACC
>ead9981c-1001-491b-8db1-e0c05553899a
TTGGTAGCCTTCGTTCGATTTACATGTTGCTTCTTGCCTGTCATCTATCTTCCGGCGTCTTTAGCGGGTGTTTAACCTAGAGGAATATTTGGGTATCATTATACCAATCGAAACATATATTCGCTGAAATATATATAAATATTTTCCTAATTGTTCTTATCGGCGAATATCTCACTTAAGGCTTTCTTATAAATCTGTAGAGTTTCGCCTGTCAGCAGACAATAACCCAAATAAAACAAAAGTTGAGCAGATGAGCGGAAAACCGGCGGCGGCGCGTCAGGGCGACATGACCTGATATGGCGTGTCAGGAGTTCAGCCGGGGTACGCATCAGTTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCGGCGGTGAGCGATCGGCAATCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGACCGACATCGCTTCACCCGGCCCGCTTGCCGTTGTTCTCTCCACACCTGGCAGTTACCGGACAAAACGCGCCCGCGCGCCGGTGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAGCGGCGGCAGAAGCCCTGTATTTTGACACCTGTTTTCCCGGTGAGGACAGTTTACAGCCACCCAGCGAGTCACTGTGGCTGGTGCGCGGCAACGTGGCAGAAACTGGATGAAGGTCACCGACTGGCGCACTCCTGGCAGGCATGCCGGAAGAACTCCGCTTAAGTCACGTAATTTATCTGGCGACAAACAGTCACAGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCAGATTGCCGAGAAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCAGTGCTGACCGGGCTGGTGGACCGCTTCGAGGCGCACACAGACGTTCCACCGCAGAAGCCGCCGGTGAATTCAGCGGCGGAAATCACCAACGTGACGGATGGTGCCAGGCGTCACCCGGCTGGTACCCCAGCCACGCAGGCGCAGCGGGCCAGAGGCCCGGCAGCGGAATATGCATTTCCGGCGGGATGGAACCGTCCGCTTTTCGATACCCTGCCGGGTTACACCGGAATATGGCGGGACAGCGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGGCCAGAATACCCGGAGGAATTTACCTGCCGCGCCGCTGGTTGCGCTAATGGCCTGGACGCCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGAATCTGTTACCGTTACGACAGCGACGGGCGGTACGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACATATCAGTATGAAGGGACCGCATCACCATCACCGACAGCCCTGAACCGCCGTGAAGTCCTGCACGCAGGGTGAAGGCGGGCTGAGCAGGTGTGAAAGGAGGTACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCGGGCTCAGGGCACAGGGCGGATGCCGCAGGCAGGACAACAAGGCCTGATCGGATGTGGTGACGGGCCTCATCCGCGCATCACCACGCCGGATGGCAGGGCATCAGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACATGGGGAATATGATGAATGGGGCCGTCTGATTCGAAACCGCCCCTGACGGCGATATCACCGCTACCGTTATGATGAAATCCACGGTGACACCCTGCGCAACGGAAAGTACCGGCAGCGAAAACCATGACGATGGAGCCAAATTTACGGTCAGTTGCTGACTTCACCCTGACTGTTTCGGTTATGTAACCCGCTAAAGATATGACCGTTTTGGTCAGGTGACCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACCTTGGCCGTGGACAGTTAATTGCCGTAGAAGACACGCAGGGCCATGAAACGCGGTATAGATACAACGCCAGGTGACCTGACCACCGTCATTTGCCCCGGACGGCAGCAGAAACCGGGACACAGTACGATGCGTGGGAAGCCATCTGTACCGCGGGGCGGTCTGACGCGCAGTATGGAATACGATGCTACCGGACGGGTCATCCGCCTGACCAATTCAGAAACGGCAGCCACACCACCTCCGTTACGATGTACTCGACCGGCTGATACAGAAACCGACTTTGACGGCCGCACACAGCGTTATCACGGCCGGCCGGCAAACTTATCCGCAGCGAGGATGGGGGAACAGTCACCCGCTAACACTATGGCCAAACAGATACGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCAACGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAAGGGCACCGGGTGACGGTGCGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACAGATGAACTGCTCTGGCAGCATGAGACCAGACATGCATTAAACGCACAGGAGGACTGGCGAACCGCTGTATGCCGGACAGCCTGCCCATGCGTGGATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACCGGCGACACACCGCTGGTGGAATTACTGCGAGCCGCCTGCACCGGGAAACGCTGCGGCATGGCCCGATTATGAACTCACCACCGCTTATACCCTGCCGGGCAGTTACAGAGCCAGCACCTGGATGGCCTGCTTTGTCTGACCGCGATTACACCTGGAACGACAGCGAACTCCATCGCATCAGCAGCCCGCGCCAGACCCGGTTACAATACGGCACCACCAACCGCTGACCGGCGTTCACACCACCACCAGCGAATCTGGATAACTCGCATCCCGTATACCACAGACCCGGCGGGTAACCGCCTGCCGACCCAGGCACCCGGACAGCGCCCTCAGCACTGTGGCCCGGATAACCGTATCGCCGTGACGCGCATATCTTCACCACGGTATGACCGTCACGGCAGGCTGACAAACCGACCTCATCCGGAAGAGGTTATCCGCACGGATGATGAGCGCGCCCACCGGTACCATGCGACAGTCAGCACCGGCTGGTGCACTCGCGGACACAATATGCAGAGCCGCTGGTCGAGAGTCGCTATCTTTGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCACCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCGATACGGGCAACAGAACCCGCATCAGACGATTTATCAGCCGGGGGCTTGCGCACTCATCAGGGTTGAAACGCCACCGGTGAGCTGGCCGCAGCGCCGCTGGATACCCTTCAGCAGTCGTGGCGAAGACGGTGGCAGTGTGGTGTTCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGGTGAGTGAGGAAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATACAACCAGATGGACCCAGTATACACGCTGGCACTGAAAAATTCACCTGCCCTGCGACCATCGCGGCCTGCCGCTGGCCCGCTATCAGCACGGAAGGACAACAGCGCCGGTACGCGAATGATGAATGGGGTAACCTGCTGAATAGAGAACCCGCATCAGCTGCAGCAGCTTAATCCATACCGGGGCAGCAGTATGATGAGGAGTCCGGCCCGCATGTTAACCGCCACCCGCTATGACCCGCTGCAGGGCGATATATCATCAGGATCCGGTGGGCTGAAAGGGGATGGAATTTTATCAGTATCGTTGAATCCGATCTCAAATAGATCCATTGGGATTAGAAACACTAAAATGCATTAAAGCACTGCATTCAATGCAGGGCGGAACTGGAGTGAAAAGCGGTCCAGATATATGGGGGAATCGTTCTATGTCAATATCTTTGTGTCCCAGATGAGCAAGGGACTATACTTGTAGTAGCCAAGACCAGCAGGGGAGAATCAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAAATGTCATGATACAAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGGAGAACTGTTTAAAGAATTTAAAGAGGTGGGCGATTATTCTGTATTGCCGATATATTCACACCTATAAATTTGGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCCGGAAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGGTGATGTAGTAATGAAATATATTATTTTTTATTCAGGTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTTCACTGTGGAGCTCCACTCGTGATGTGAGCAGAGTTAATTAGTCTCATGTCTTATGGAATGATGATAATATGTTTTCCAACAGGCATAGTATTCTTTATTGCTCTAATATTTATGGGGACTGTATCCAGACATTATTAATGGGATTGATAGTAAGTATATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGGTATATTCAATGGTTTTGTGATAAGTAAGCGCGTATAAACAGAGCAAATAAATTAAGTTAATTGCTCTTATTATTATGTAACCTGGGCATTGTTATCCCGTATGCCACAGACCCAGCAGGTAACCGCCCGACCAGGCTACACCTGGACAGCACCCTCGGCGTAATGGCCGGATAATACATATCGCCGTGACGCGCACTATCTTTACCGGTATGACGATGCGGCAGGCTGACGGAAAACCGACCACCATCGGAAGGGTTATCCCGCACGGATGATGAGCGCACCACCGGTACCATTACGACAGTCCCAGCGCAGACTGGTGCACTACACGCGGACACAATATGCCGACCACCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGAAGCGCAGGAGTGGCAAACGGAATTGGCGACGTGAACGGGACCCTGACGGGCTGGATGTCGCTGTCACGGGAAACCACCAAGTGACCTGGTACGGCTGGGACGGCGATAAAAAACTGACCACGATACCAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGAGCTTCGCCCTCATCGAGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCTTGATCCGGCGGCGAGACGCGGTGGCAGTGTGGTGTTCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGAGCAGATGCAAAACCAAAGATGGACCGGTGTACACGCCGGCGCGAAAAATCCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCGCTTGTCAGCACAGGAAGGGGCAACAGAATGGTGCGCAGAATACGATGAATGGGGCAACCTGCTGAATGAAGAAGAACCCGCATCAGCTGCAGCGAAACATCCGCCTGCCGGGGCAGCTTATGGTATGATGAGAGTCGTACCAATATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGAATTATGTCACTCAGGATCGATTGGGCTGAAGGGGATGGAATTTTATCAGTATCCGCTGGTCCGGTTCAGTATATAGATTCAATGGGACTGGCATCAAAATATGGGCATAAATAATGGCGGATATGGAGCGAGGACCCAACAAACCTACGCCCGATCCAAGTAATTGCGGACATAGCGAAACAATTAAGACTGCCATATCCTATTGACCAGGCCAGTAGTGCGCCTAATGTTTTCAAAACATTCTTCCAGAGCATTAAGCCCTTACGACTACACACTGTATTTGCAGGAAGTGGGTAAACCAAATCTGACTTACTTGTACGCCACAGGATGATTCCCAGTATCAGGATGGATACAAGACAGCAAGTGATTACCTGCCACAGACAAATTGGTATATCAATTACCACCGGATATGCTTGTGCAGAACCTATTTGTTCCCAGACATTAATAAACCCGATGGGCCAGCAACGCTTGGGGACCGATGATTTGGGTGAAATTTTAGCTAAGATGAAACAGAGAGAACATCGGAGGAATAAGAAAATGAAAAGAGTTTTGTTCTTTTTGCTGATGATATTTGTTAGTTTTGGTGTTATGGCTGATTGCGAAATAAGGTTAAACACCCAAGCAGACGCCGAAGATAGAGCGGG
>bd76fe67-db4b-4d72-95df-e23f07aea51a
CTGATGTGCTTCGGACAGTTGCGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCCCGTTGTTTAACCTGTTCCACCCCAGCGGGCGGCGAGCGGCCGTCAGGATGTAAACATGCCACCACTCCAACCCAGCCAGCCGAACCCCACCAGGCCGGTAATCTGCCGCTGCCGCCGCTCCACAACAAACTATACTTCACTTCCAGCATCTCGGCGCAGCGGCAAACCGCCGAGACTGAGCCCAGAAAATATGTGGATGAACGACCATTAACGCCATCGCTGGCTGAGGTCCGTTTAATTTGGCTTCCATCTTTCCGCCAGCTCGGCAATCCGGCAATCGACCCATCAGGCTGCTGGCCTCAGCCATCATCACTACTTTGCTGTTACTGGAGGAACCGATCTGCTGTAACGCTTCGGTTATTTCTGCGCTACAGAGAAGTTCACCGCCTGAATATCACGGGGCGATAGCTCGAACACACACCATTTGGTGGCGCGGGCTTCTCGCCAGGCGGAACGTTCACGCGCTTCAGCCTGTAAAAACGCCGACTGACGTTTTCGCCTTCCTTTCAGGATTTGACTGTTTTCACCTTCGGCACGAAGTTTCCGCCTGACGGATCCCTTCCGCTTCCGATATAGCCTTGACGGTACCGTTCAACTTTCATCTGCGCGTTCATTGAAGAGATAAGCTCTGCCGGTGGGCGCACGTCGCGAATTTCAATACGAGCTTTAATCCCCACGGGTTGGTGAAAGCTACCATCAAGGCAATACACCCCAGCGGGCGGAGTTGATGCTGTCGCGCTGAAACATTTTGTCAAAGTTCCATTAGACCCAGCACGGTACGGATGTTAATTAACGGTCAGGTTGATGATGCCAGCTCAGGTTGCTGGCCATAGCCGCGCGTCGATCACCTGAATAAAGCACAGCGTCGATGGTAACGTTGGCGTTTATCTTCGGATAACTTCTCTGGGAAGGGATATCGACGCGCTCCATCATATTGATCTTGCGGCAATGCGATCCATAAGCGGCACCACCAGACTGGGCCCCGTACCAACGTTTGGTATAGCGACCGGCGTTCTACTGTCCACTGATGGCCTGCGAGTACGATTTGACACCCGCGCCGGCAATGACCAGCGCGGCAAAATGAATCGGGATAAAGGTAAGCATGGAAAAACCTCATTACCGTCAATCCAGCAGGCCTGCTTGATTAAATAAATTATACCTGATTACTGAAGAGGTTCCCCTTATTCCTGCGAAGGATGAAGCTGTTTTAGTAAATCAGAAAGGGAACAGCGATGGGGAAAATGAAGATCGCTTTAGCTTCAGCCGCTTGTGGATATCTGGCGTTGATGCGAAGTGCTGGCAACATCAATTTTTCATACGTGCTGGCGAATTTAAGTTCATTACTGTTCCTTCTGGTTTGGCAAAGTACGCTGCTAAAAATAGTTGCTTCATTGATAAGCTATGCTTCCGGAACATTCTGTTGAAAATTGAGGATGTCAGCGCAAAGCCGAAATCACCGCCAATGAAGTCTCTTTTTTCGCCCGGGCACCGACGCTGTTGGCGATACGGTATCCACGATATCTGAGTCTTTCACCGGCAGATCCGTAGCGGCATTGACCAGCCATTTTTTCTCGGTTATATCAGACGCTTTAGCGCGGACAGCATTTTGACGAAGAATATCGCCGAGCTATCTGGTGGTGAAAAACAACGCATCTCATTGATTCGTAACCTGCAATTTATGCCAGAAAGGTTTTATTACCGGATGAAATAACCAGTCGCTGGATGAAAGTAATAAACATAACGTCAATGAGATGATCCATCGTTATTGCGCACGGCAAAATATTGCCGATGCTGTGGGTGATACGATAAAGACAGGAAATTAATCATGGATAAAATTGATTACACTGCAACCACGCCGGGCATCAGGAAGCACGCTAGCAGACTCGCATAATATTGCTAACGATCGACCGCACTGGCATTAATCTTAGTGGTGAGGTGGCAATCAATTAGCCATAAAGAAAAACTGGCGCTGGAAAAGATGTCTCTGAATCCGGGGCAGCGATAATTCAGCTGATTATTGTCGGCTATGCTGAAGTATATTTTCAGCGTGATACCAGCCTGGTATTCTGTAAGTGGGTGTTATTTATCGCTTTATTTTGGCGTGGAACGCATAAAAAGCAATCATCTCATTGCGCTAAGCACTATCTCCATCGTTTAACACCATTGCGGTCAGGCTGAAATTACCCTGGCGTGCTGATTCTCTCAGGGTCGATTGATTTATCGATGCGATGATCCCTATCGCCGGATAAATTACGCCGGTAACGCCATGGTAGCGGTGGGGATTATGTTGCAACAAAATTTGCAGGGGCAACGGGTCAGCCGAACAACAACAGATTCAGAAACTGAGTCGCCCGGTGCGACGCCGGCAAACTTCAGCGATATTGATTCACTGGCGCAGTAATTGTACGCGGCGCAATTCCGACGAATTGAATTCGTAAAAACGGATTTGGCCAGTGAGTTTACCAGAGATGATGTCCAGGGCTAAGTATTTGCAGGATGGTCGGTGAAGGCGATTATCTCAAGATTATGGTGACCTTTAATGTGCGCCAACCGCCAGCTTATGGGCAACAACGCACTGCTATTTAACTTCATCAACAGTTTATAATTCCGCTTACCAGTTGGTGGTGACTAAATTCAGAAAGAAATGATGCGATGCCGGGTGCCAGCATCATCGGTAGCGGTTATGTGCCGATCAGCAGATATCCGTAAATGCATACAGCTGGCGGCGATACTTCGACGCCAATTATCATGCCAACGGCGAGGATCTTCTGGAACATTTTGCGCGTCTGAAGCTGTCCGGCGGTGAGATCCTGCAGATGCCCGAACGGCAACTCAGCGCTTCTTCGTTGCGCCCAACCTGATGCAGGTGCAGCGCAGTTTGCATCGCCGGTGAAGCATCTTTGATTCTCACCTGCCATTTGCAACTGTTGAATTTCAGCATCAGCGCCTACGCTTCCAACAGTTCATTGCCACCAGCCCTGGTAGCGCGGAACGTCCTGATCACCAACGGAATGGTTTTCAGCACCGCTGCATCGCCAAGACGGTTCAGCGCGTCAATACGTTTCTGCTGGCAACAATTTAGATCTCCCCGTTCTGTTCGACGCTGCCAGAGCGTCGCTCCAGCAGCCAACGAGGGCATCCTGGTATGTGCTTTTTCCTGCATCGATTTATCGCTGCGCGCTTTCAGCTCTTCTTTAGCGGCAACGCACATCAGCACGGGGCGCGGATCACCTCTTCCGGTTGCGGCCTGACCTACATCCGGTTGCCGATTCTGGAACGAATACGCGGTCGGAATCACCAGACCAAACTGCGCGGCAAATCATCACTCCGCGTCGCAGTCAGCTTCACTTAGAATCAGTACCCGTTAATGCCGCCGCAGGGCTTTTCAAGTGGGTTGCTGCGACAGTGCTGGCTGCGTTCAGACCAAATAAGAACAGCGCGAATTGGTAGCCGACTGTTCAGAACCTACGCACGGATAATTCGTTAAATATTGACAATATTTTACCACCACGGACATGGAATGCGCTCTCTGCATCGATATTTTCTTTGACATACAGAAGATAGCGCACTTCAGCTCACCTAAATATTTTGTCATCACGCGCCCCAGCAGCAGGCGCTTAAAGCACCAATACCAAGGTCACCGGCATCACCGGACCAACGCATCTTCGGCTTCTCGCTAATAAAAAGCTGTAATACTTTATTCCACCACCGCTTCCGGTCCCAGCGTAAAGCGGGCGGCGATGCCAGGATTTTCATTTGGTTATCACTTTGCGTCTGAGTTGACGTTGTCGGTGGGCAAATTACAGATGGGTTCCAGGTTCGTCAGGCTGGCTTTATTCCGCTTGTGGCACCGCTCCGTACGCAGGCCATCGACCACCTATCAGCGCATATTTACTGGCCGCATCGCCTCCATTCCAACATTGGGGAGATTAATCCACTCTCGTGATATCCTCCGCAATACGCCCTTCTGCGTGTTTATCGCTGATGCTGAGCGCATATGATGAGCTGGTGTGCGCCAAAAAAAGTTGGCGAGCTTTGCTGTTATTTCATCTGCGGCTGATGGTTGGAAAGTCGCCATGCCGGTCGGCGTTGTTAAAATCCATACAAAGATGGTATCGGTCAGGCGATCGTCAGCTGCGATCAACACTGGTGATCCAGATCGATCAACACGCCAGGTAATCCAGCCGTGGCCGCTTCAACATATCATCCGGTTTCAGCAGCCGCAACGCGAAAACCGAGTTTCAATTCAGGCGCTTTCCGGTAATTCTTTGGGTATCCGGTAATTAATTCCGGTGCGCCAACTTTACCATCCAGGATCTCCGTTGCTTTCATGATTTTCAAAGGCTGCCATTGCTTCACCATCGATCGGCAACAATAACGGCTGGGCATGCGTTAAGGATGATCTGTCATCCTACATCCATTCAATGGCAGGGTGGGCCTCTTCCACCATAAAGGGCAGCGGCGGAACATCGGCGTTTGCGATTAGAAATAAGCGCAAAACTTCCATTATAACGGCGACCATAGTTTAGAACCAGACCTATTTGCGGCTAACAATGGGTTTGGACGGCGGCTGCGGTATCTGCAAAATCTAGCGCAGCGTTGCCCGGTTGCTGTAAAACCACATAAACCGTCGTGCCTGAGTTCAGCCTTTTAACGCGGCGATGCTGTTTTCAATAGAGCCGGAAGCCTTTGCCTCAGTCACTTGTGCAGAGATTATTCGCCGCTGATGTCTGCCAGCATTAACACCGTTTACACTCGCTTATCATTTAATAAAGGCAGGCCGGTACTTCAGCGGGCATTTAAATGCCAGCATCAGGCGCTATCCTTGAATCAACATGTCGCTGCGTTGCTGGAAGGTTAATGGGGTTAGGGAAGGGCAAAATGCCGGCGGAAAACGTTGTTTGAGTTTATCATCTTAGAAGTCGCGAAAATCGGTCAGGGGGTATAGACTCATCATCCCTCACCAGGTTGACTGGTTGTATCCAAACGTGAGACCATCGCCTGGTGGGCAGTCAGGATCAGGTAAGAATCGACTGCAACGATCACCTGTCGGCGATGGCGTAATTGGCGAAGTGAGTCCGTTGGGACAACCGCCATAATATGGGATGGCGCGAGCCATTGCGCGAAACGCTGCCGTCGCTTTGTTTTTCAGTCATTTATTGTTCCTGCCTTAACGCCGCTGGAAACGTCAGGCTTCCAGCTTCACTGCGCGATGAAGTAACAGCGCGCGGAAAAGTCGTAACAGGGCAGCGTTGCTCGAACAGTTAGGGCTGGGTGGCGTCTGGATCATCTTCCACGGCACAGCTTTCAGCGGTGAACGCTTGAAACTGGCACGACGCTTCAATATGATCTGACTTGAGTATTGCTGTTTGCGACAGGCCACCGGCAACCTTGAAGCGCCAGACGGAACGTCCGTGCCGACCTGCTGTTTTCCTCGACCGTGAACGCGCTTACGGTCATGGTGACCCTGACCCTGCAACTGGCGGCACTGCGACCCGCTGCTTACGGCTGGTGAACAGGCGATTGGAGGAAGCATGGTACACGATTGGTTCTGGCGCGAATAATATTAATTATCTCTGGCTGGCGCTAAGCCTGTGGCCTGCGTGCTGGCGCTGAATATCAGCGATCGCATGGAGAAGAGGGCTTAAGCCAGCGAAAACTACGTAGGTTATGGCGATCAGGCGTTGCGCAATTCCACGCAATGCCATAGCGTATGTGGAAGGAAGCGCAAAAGCGCGGCTGAAAGTCAAGCAAAGCAGCTGACTTTCGCCACAATATTGCCAGGCGACCGCAGCTGGCGAGCGATCAAGCGGTGGATGATATCTACCGATGCATACGATCTGAAACTAATCTGGCGCAAACCGCAGGCGGGCGGCGTGTCGCCGCTGGCCCCGCCTGTGCTTTTCATAGCACAAAGCAGGCCTGTTGGCGTGGGCGATGCCACCTTGCGGATTACCCGGAGAATTGATTCAGAATCGGATTCCGGTTTTGCCCAGCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATGAGCCAGGCCGTGCAGCCAGAAGTCCAGGTCACCTACAATTTTATAAATTCCAGCAACCGCCGAGAGACCCATCGCGCTGCTGAAATGGTTATACCTCGGCAAACCCGAACAACTGCCGATACGGTCTGGGCCGGGACGAAGAAGGCGCGCTGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCACCTTTCAGCGCACTTCTGACCCTTGCTGCTGGCGTTAAGCAGCGGTGGCGGCGCGCGATGAATCATTATCGCAGTCGCTACGATCTGGTGGCGATCCTCAAACGCTGGGGGCAGGGCGAGCCTGCTTTGCGTAAGCTAATCGTCGGTCGATGTGGTTGATGGTGCTGTTGCTTTCAACCGTTACCGTGCAGACTGACCTGTTGTTCGAAAACGTGTTGATGGTACGCTCCGGCCCGTTCGCCTGCTGCCACTACCGCCAGCCAGCCTCTGGCGTGGCTGTAACCTGGCACCATGACGGTCATCTCGCTGCGGGGGCTACGACCATAATCGCTTATTGCTGGCAGCACTGGCGCTTCTGCGTACCAATGATGGCTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCGATATGGTGGTTGTGCTGCCACTCGCCGGATTAATGCGGGTGACGCGCATGCTGCTTTGGGCGGTGCTGGCGGGCGCGGTAGTACTGGCACATGCGGTGTGCTGGGCTGGATGCTTATGGATAACCTTCGCCGCATGACGCTTCAATCGCTGCCTCTGCTGGCGGCGGTTAACCGCCTGCATCAGCCATGGTCAGCGATTAAATCCCAGCTTTTCGGCATTTTCGCTCTCCTTTATCTGCTGGCTGCTGCTGGTGTTGCGTGGCGATCTGCTGATGCCACTGGCAACCTTCTCTCAGCCGACTACTTTTTATTCGCATCGCCACAGAACAGGTACTTCGCGCTTAAAAGCGTTCTCAGACATCAGATAGTCCCGGAATCGTTTATCCGATTGGTGCGGGCGCGGCTGACGGCGATTAACGATAAGCCAAGCAGAGGAAGTAATGAAGATGGGCGCTTAAACGCAGTCAATCTTACAACGCAAATGCGCGGCCCAGTCATCCGGTGTGCGGTAACTGGCCGCCAAAGCCTGATATGATGTCGATGGGAAGAGGGCTGGCGGAAGCAGCGCTTAAACGTTACCTCGGTGATACCGTGACTTTATGGGCGTCACCCAGGAGTTCCACTTCAAAGTGACCCGTATACCACTGAAAATTGGACTGGGAAAGTCTGGCTAATTTCTACTATTTCCTGAAGGAACCAGACGGGCAACCCGCGGAGCTGACACCAGTTTTCCGCTGGGGGAGAATGGCAGCGGCATTGTTGACACAACTCGCCGCCAGTTCCACGACCAATTAACCTGTTAGATATTGGCATGATTTTAAAAACGGATCGGTTGGGTGCTGGAGCAGGTAGTCCGGGCTTCTGGAAGTGATGGTGTACTGGTCACTTATACCACGTTATCTTTATATTGCTAGCGCCAAGTGCAGGTGGGAATGCGTCAGCGATCATCAGGAGCTACCCAATTGGGGTGTTAGCTTTTTACTCAGTGCGGAAAAACTGCTGCATTACCACGTTTGTGTTGTGGTTCATATGGCAGGTTTGTTTCCAGCCTGGGTGACCACCATTGGTGCGGAAAACGCTGGCAGTGTTGCAGGCGAAGTGATTTTCCGTGGGGCCAGACTGGCGATTGTGGATTGTTCTGCCGTACGCTGGAGCGCTTTCTGCAATGGCACTGGCGGCTGGCTGGGTGCGCGACTGGTTGAGGGTAAAGGGCGCTATTCTTCGAACAGTTTGCGGGAGATTGGTAAGAGGAGTAATGAGGCATTGTTGGAATGGAACGCCTTGTTGAAGTAATTCTGTATGTTTTGATGATATTTGGTGAATTGGATTTCCCTGTCTTTCTATTTACTGATGTGTCTGAATCGGTGGAGGTTATTGATTTTAAATATAGCCCCATCATGAACTAATAAATCCATAAAATCTGCTGGTTGAATGAATCATATCTGCTGTGAATTTGTTGATGATGAATTCGTCATTATACAAAATATTAGTTTAATAAAATATTGAAGGCGTGACCTGTAATAACGGTTATTTGTTGATTGAACCATCAGTTTATATGAAAATATGTAAATCACATTGGCTGGTCGCGTATTGTCATTTTGTTTTTGTTTGCTTCAACACGGGATAGAACAATAACTAAAGGGCACACTTTATGAGCGGAAAACCAGCGGCGCGTCAGGAATATATGGCTCAGTGGCGGTCATTTGGTCGGGGTTTAAACATGGTGTAAAATTGGCGCGCCCACCAGCGTGGCGTGCTCGGTGTTCCGGGCGGATGATGACTTCAGACGGCCAGGCAAATCACTGCTGAAGCTGGTGCTGCCCGGCGAGACGGACTTAGCTGCCCGGCCCACGCTGCCGTTCGTTCTCTCCCCGCACCTACCTTCTGGACGAAGACGCCTGCACCGGTGGGCGTTTCGGCTGGCTGAAAGCGCCACTTCTGATATCCGCCACAGCTACGTGATGACGAGGACTGATACTCAGCGACATAGCAGCGAACATTCACTTTGAGCCGCTGCTGCCAGGAGGCGGTGTACAACCACCAGTGTTAGATCAGTAATATGGCTGGTGCGCGGTGACGAAACCTTTACAACCGGAACGCTTATACCGCTGGCGCGGCTGGCGGGGCGCTGCCGCGGATATCCGGTTAAATACTTATCGCTACCCTGGCGACCAGCAGCGCACAGGGGCCGTATGCTGGATGTCTGGGGTGGTCTGCAGGCTGGATTATACCAGTTGCTGAGGGACGTACCACCAGCGCCATACTTACCGCCATTTTCCGGGTGCTTTACCGGGATGGCGGACCACTTCGATGGACGCGCTATGACGATATGGCGATGAAACGCCGAACCGAAATCCGGCGTATTGGACGGTGCCAGGCGGGAAGTTCAATCACGGTGCTGATACAGGCGCAGCGTTGGAAGGGCCTGTATCATTCTGACAGTTCCCGCCCTCTCAGCCTCGCGTTCCACAGCGACCTGCGGTACCAGGCCGCAGGCCCCGACAAATTATCCTGCTGGCGGCTGATACTGACCCATGCCGACCTGCCGCTGCGCCACTGGTGCGTTTGCATGTACCGGAAGCCGTTGACTGCTGGCGATATGTACGTAATACGCTGATTACTTTCTACGTATGACACCAGACCCGGATGGTGGCGCACCGTGCGGAAGAACAGAATGCGCTACCGCTTCTACGACGACCAGGGCGGTGGTGGCGGGCAACTGAACCGGCGGGGTTCGTACCTATCTGCCGGGCCGGACCGCATCACCGTCACCGACCAGCTACCGAACCGGCGTGAAGTTTCGCTGAAGGCGGTAGGCGAAGCAGATGGTGAAAAAGAGCTGGCGGACGCGGCGTGCGCAGCCAGTATGTTGCGGCGGAGAACTCTGACATGGATGAACGCGGCAACGGACAGAGGACTTGATACGGTCTGAATGTGGGTATCCGGCGATGTCACTGGACATCACCACCAGTTCGACGGAGACGAAATTCTCAACGTGAGAGACCGGCAGGCGGCGGTGAACATCTGGACGGTGGAAACCTACCGGTCGATGAACCGGGCAGGCTGACATCCAGCGTAACGTGGGGAGATGAAACCACTTCGACGACGGTTCGCTGCCGAAGCGGGCGCCGCAATTAACCGGCA
>f1b306de-8038-46af-b38f-7cf0d4c292ad
ATCAGTATGCTTCGTTCAGTTACGTATTGCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGCTTGGGTGTTTAACCTAATAAAAACACCAGCAATACGCCGATTTATCCGCCTGCACTCGGGTACACCTCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTGCAAAATCTGCGGGCGGGGTGTAAAAGTATAAAATATGGCAAAAGCCATGATTTAACTAATGTTTAGTAATTTAACTTTGTGTAACTTAATTACAGGATGAATAATAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAGGCGGTACTATTTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATATAAAGGGGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCAGTTGCAGCGGGCGTTCTACTGGCGCTGCCTTTTCATGCCTGGAAAGACCGCGCCCGCTTTACAGCTACCTGCATCGCGTCTGGTCGAAACCGGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGAAACGCTGGCGGTTTTAATATCAGGAAAGTCATTCAGAGGAATATTTAGACATCGTTGCCACCAATCGAAACATATGTTATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGGCCAGATATCTCACTTAAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCGGCAGACAAATAACCCGATAAACAAGGATGAAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACGCGATGACGCAATTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTCTTGACGTGACGTCAACCATCCGGTCGATCCGCTGCTCGGTGCAAAGGTCCTTCCGGTGAAACCGACATCACCTACGGCCCGCTGCCGTTCATTCTCTCCCACTTTTCTGGCAGTTACCGGACAAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCAGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACTGATACTCAGTGATAACGGCGGCAAGCCTGTATTTTGAGCACCTGTTTCCGGTGAGGACGGTTACAGCCGCAACGAGTCTACTGTGGCTGGTGCGCGGCGGCGTGGCCGAAACTGGATGAAGGTCACCCGGCTGGCCGCCTCATGGCAGGCGCTGCCAGGAAGAACTCCCTTAAGTCCGCATCGTTATCCGGCGACAAACAGTCCCGCAGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGAGTGCTGCCTGCGCCGCTGCCGCCATGCCAGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACAAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCATCACTTCCGGCTGTTACTTACTGACCACGCAGGCGCAGCGGGCAAGCCCGGCAACAGGCCATTTCCGGCAGGACGGAACCATCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCAGATACCCGGAGGAATTTACCTGCCGCGCCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACGGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCGGTATGAAGGGCCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGAGTGGTGAAAAGGCTACGCGGACGGCAGCGTCACGCCAGGTCAGTTTGACGCGGTGGGCGGGCTCAGGGCACAAGACGGATGCCGCGAGCAGGACAACAGGGCTGATCCGGATGTGTGGTGACGGGCCTCATCACGCGCGCATCACCGCACGCCGGATGGCGGGGCATCTGGCGTTTTACTACCTTCACCACAGCCAGTTAACGTCATACCGGGCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGAAACTACCCTGACGGCGATATCGCACCCATACCGTTATGATAATCCACACGGTAGTACCCTGCGCAGCGGAGATGCCACCGGCAGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAAGCTTCACTGACTGTTCCGGTTTATGTAACCCGTATGACCATGACCGTTTGGTCAGGTGACGGCGATTGCGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACGGCAAACTGGACGGATTAATTGCCGTGAAGACACAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCAAATCCATTTGCCCCGGACAGCAGAAACGGGACACAGTACGATGCGTGAGGGAAAAGCCATCTGTACCGCAGGGCGGTCGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGAAGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCACCAGCGGATGAGGGGCTGGTCACCCACTAACACTTATGACAGAAGCAGACCGCCTCACGCACCACCGTGAATGGCGAAACCGCAGAGCGGTGGCGAATATGACGAACGCGGCTGGCTGACGAGATTTATCCAGCCATATCAGCGAAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACAGATAGACTGCTCTGGCAGCATGAGACCAGACGCGTACAACGCACAGGGACTGGCGAACCGCTGTATCTCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCAGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTTTGGTGGAATTACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCTGCCGGGCAGTTACAGAGCCAGCACCTGAACGGCCTGCTGTCTGACCGCGATTACACCTGGAACGAAGCAGCGGCGAACTCATCCGCATCAACTGGCCACGCCAGACCGGGTTACAGCTACAGCACCACCGCCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATCATCCGCATCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACGAACTGCACCCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCGCTACCGGTATGACCGTCGGCAGGCTGACAGAAAACCAAGGCCTCATCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCACCATTACCATTACGACCCAGTCAGCACCACAAACGGTGCACTACGCGGACACAATAATGCCGGGCGCTGGTCGAAAGTCGCTATCTTTACGACCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGAAACGGAATGTCGCTGTCACGGAAACCGCAAAGTGACCTGGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCGGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCGGGGTTGAAACCGCCACCGAGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTAGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGGTAGAAATCCACCAAGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCGTATACACGCCGGCGCGAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCATATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCAGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATGTATCACTCAGGATCGATTGGGCTGAAAGGGGATGGGTACATCGGTATCCGTTGAATCGATCTCAAATATAGATCAGTAGGATTAGAAACACTAAAATGCATTCAAGCCCACTGCATTCAATGGGCGGAACTGGTGAAAAGCGGTCCAGATATGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCAAGACCAGCAGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCTGCTGGCCGTTTGTGATATCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGAAGTTTAAAGAGGTAAAGCCGCGTTATTCTGTATTGCCTGATATATTCACACCTATAAGTTGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTCCCAGAAACATGTAAGATGAAGTGCTCGGAAATAACATTGGACGTTTTATTAGATTTTATTCACCGGGTGAATAGCAATGAAATATATTATTTTTTATTCAGGGGCTATGGCTGGCTTTGTCGCTTTTAATGCTACTCTTTTTCCATGCATGAACTCACTATTAAGGACTCCACTCGTGATGTGGGCAGGTTAATTAGTCTCATGTCTTATGGAATGATGGTAATATGTTTTCCAACAGGCATAGTATTCTTTATTGCTCTAATATTTATAGGGACTGTATCAGGGCATTTATTAGCGTAAAGTTGATAGTAAGTATAATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGGCATATTCAATGGTTTGTATTAAGTAAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGGCATTGATATCCGTATGCCACAGACCCGGCAGGTAACCGCCTGCCCCGACCGGAAACTGCACCGGACAGCACCCTCAGCATGTGGCCAGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACCGGAAAACCGACCTCGCTCCGGAAGGGGTTATCCGCAGGATGATGAGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCTACACGCGGACACAACTATGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTGTGGCAGCGTGAACAGGACCTGACCCGGGCTGGATGTCGCTGTCACGGAAACCACCGAAGTGACCTGGTACGGCTGGGACGGCGACCATGACCACGATAGAACGGCAGAACCCGCATCCAGACGATTTATCAGCCGGGGGCTTCACGCCACTCATCAGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACAGCGCCGCAGCCTGGCGGATACTTCAGCAGTCCGGCGGCGAAGACGGTGGCAGTGTAGTGTTCCGCCGGTGCTGGTGCAGATCTCGACCGGCTGGAAAATTGAAATTTCAATGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGGTGGAGCAGATGCAAAACCAGATGGACCCGGTGTACGCCGGCGCGAAAATCCACCTGTACCACTGCGACCGTCGCGGCCTGCCGCTGGCGCTTGTCAGCACAGGAAGGGGCAACAGAGATGGTGCGCAGATACGATGAATGGGGCAACCTGCTGAATGAAGAGAAGAACCGCATCAGCTGCGGCAGCTTATCCGCCTGCCGGGGGGCAGCAATTATGATGAGGAGTCGGCCTGTATTACAACCGCCACCGCTAACGAAGGCCCGCTGCGGGGAGGTATATCACTCAGGATCGATTGGGCTGGAAAGGGGATGGAATTTTATCATTATCCGCTAGTCCGGTTCAGTATAGATTCAATGGACTGGCATCAAAATATGGACACTTAAATATGGCGGATATGGGCGAGACCCAACAAACCGCCGCCCGATCCAAATGAATTGCGGACCATGGCGAAACAATTAAGACTGCGCCGTATCCTGTGAGCCAGGCTGATGGTGCGCTAATGTTTTCAAGCATTCTTCAGAGCATTAAGCCCTTACGACTACACACTGTATTGCGAGATGGGTAAAACCAAATCTGACTTGTACGCCACGGGATGATTCCCAGTATCAGGGATGGATACAAAAGACAGCAAATTACCTGCCATGAACAAAATTGGCCAACAACTCAATTACCACCAGGATATGCTTGTGCGGAACCTATTTATTCCCAGACATTAATAAACCCGATGGGCCAGCAACAGCAGGGATGAATGATTTGGAATTGAAGTACAGCTAAGATCGACAGAGAACATCGAGGAGAATAGAAAATGAAAAGAGTTTTGTTCTATTTTTGCTGATGATGTTGTTGGTTTGGTGTTATAGCTGATTGCGAAATACAAGCTAAAGATCATGATTGTTTTACTATTTTCGCTAAAGGGTACTATTTTTCCGTTTCTGTGTAAATAATAAAGCCATGTGGAGATGGTATCCAGAATGAGGACATCGGTGAGTATTATTAGCAAACAGAACTGGGTACATGTAAAAATAATAAATTCACCAAGCGAGGCGAGACTCTTAATTCGCGTCGGTCACTACGCTAATGAAAATCCTTATCAAAGGAACGTTGCAGGGTGTCATCACAGCAGAAAAACGGCGTTCTCGTGATCGGTTTAGAAGTTATATAAGAGCGGGTATCTATCAAAAGAGCAGTGATCCAGTTCAGTTGTTGGCAGTCCTTGATAAATTCAATCATGGTGAAATATTTTTTAAGATGAAAGCAACATGCTCGAATGACAGCACATCCCGAACAAAAGAATGAGTCTTACGAATGTTTAATAAAGATACAGCATGAACTAATTCGTAGTGAGAAATAAAATCTCTTCCTGAGAAAACAAATTAATCATTGTGAAAAATTAACATAACTCATGGAATAGGTGTTTATTTTGCGTTCCATTTGCGGGAAAAGATCACGTAACGCTACTTTTTTTGTACTAAATAATTCAGATTTTAAGTTCAACAATTGAGATACTACTTATTGTCCTAAAGCTGTTTCATAGCTTATACATGATCAAATACTCCTTATAAATAGGAGTGAACAAATGGAACTTAAAAATTGATGGAACGTATTTCTATTACACCCGATTACAGACAAGCCTGGAAAGTGAATTGCATAAATTGTCAGATATTCTACCATTTGACTATTTGTGCCGTTATTTCTGGTGCAGAAGGTTGGGAAGATATAAGAGGATTTCGGAAACACATCTCGATTTTTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACCATTTAGGTTATCAAGGAAAGATCACGTAACATACTTTTGTACTAAATAATTCGCATTTTATGTTTAAAATTGAGATATTCCTTATTACCTAAACTGTTTTCATAAAGCATACCTTGATCAAATACTCCTTACATAAATCCGGGTGAACAAATGGAACTAAAAATTGATGGAACATATTTCTATTATTCCCGATTACAGATAAGCCTGGAGAGTAGAGCATAAATTGTCCAGGCATCAGGTTAAACACCAAGCAGCAGACGCCGAAGATAGAGCATA
>f432cb50-8c47-4c54-825f-ab04a38b5225
TCGGTACTTCGTTCGGTTACGTATTGCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTTAACCTCTGGCATTCGCCGGTCAGGCGGCAACATCGTCATAGCCATAGTGGACGGCAACACGGTGGCCTTCGCTCAATTGGCTGATGTCTGTCAGCCAGCCGTAGCCATCATACTGCCACTAACTCTGCCGGTTCGCCGTTCACCGTGCGGTGATGATGCAGTCCGATTCATCGTAGTACCCAGGATGACAAGTCCTCATCCTCACTCTGTGTCGGTTTCCGGTCAGGTCATAATGATAACGTTGCGTCCGCCCGTCAAAGCCACCGCCCTGCTGTACCAGCCGGTCCAGCGCGCATCGTAACCTTCAGAAGACGCTGTGGCTGCCGTTCTCGTTGGTCGAATTTGATGACGTCCGGCAGCATCGTACTCCATACTGCGCGTCAGCCTGCTGGTGCTGACCGCCTTTCCTACGCATCGTACTGTGTCTCGCTCGGTTGCCGTCCGGGGTGATAACGGCAGTCAGGTCGCCTGCGGCGTTGTATTCATACCGCGTTTCACGGCCCTGTGCGTCTTTCACCGAGTTAACCGGCCACGGTTGTCATAGCGGCGGTAAAGGCGATGCCTTCCTCGCGGTGGATTACGCCGTCCTCATCTGGCCGAAGCGGTCGTATTCATAGCGGGTCTGGTAGCCCGAGCAGTCGGTGAACGCCAGCAACGCTGCCGTAGCGGCTCGGGTCATCTGCCGGGTGCTGCCGTCGCATCCGTTATCGTCGCCAGTAACTCACTGTGCGCGTCATCGTAACCCGGTAGCATACTGTCTCCCCGCTGCGCGATGTCTCCGATACCAGCCTGCCCGGTTCATCCTGTTCCGGCGGCTCTCCAGCCCGTCCGGGGACACCACCGCCGTCAGCTGGTTCCGTCGTTATAGTAAAATTTCGTCTCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCGTACTCTGTCCTCCCGTCCCGCCGCATTCCATTCTGCGCCGTGGGCCTTCCTGCCGCGTCATACCGCTGCGTGACGCTGCCGTCCGCCAGTTCTTTTCACCACCCGTTTCAGTGGCCCGCCTTCTGTATGCAGCACCTCGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAAGTAACCCTGCCGGAGTTCAGTTGCTCCACCACCGCCCCGTATCGTCGTAGCGGTAGCGCGCATCTCCAGCCTTCCCGCGTAACGGTGCGCCTACCATCCGGCCCGGGTGCTGCGCGTCATACGTGAAAGCGCGCACCTGCATATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATACGTGTACCGCACCGGTATGGCGCAGCAGGCAGGCTCTCCGGGTATGCCGGTCGTTATCAACCACACCACCGAAGGCGGATACCCCTGTCGAGGGCCGTATTCGGTACCGGGCGGTGTGTCGAGGAACAGGCTGAGAGGGCGGGAACTTCTCAGAAAGAAGATAGCGAAGAGGTGCGGGCCTCTTCCGCACGCTGCGCCGTGGTCAACACCAGACGGAACTCCGCCCGGCACCGTCCGTCACGCCGGTGTTCCCCGGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGATCGCCGAAGCGGTCCATAACCGGTAAAGCACCCGAATTTGCGGCAGCAGCGGCGCTGGCAGTACGTCCTCAGCACCGGCACCCGCTCAGACCACCCCGGTATCACCGGCCCTGTGCTGTTGGTCGCCAGATGCGGGCTTAACCGGATATCCGGCGGCAGCGCCCCACAGCCGCGTAATATGGCCGTCCGGCTGTGCTGCCTTACCCACCGCGCACCAGCCACGATTGACTCTGCGGCTGTACACCGCCTCCCCGGCAACGGCGGCTCGAGTGAATGCTCCGCCCGCCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTGGCCCGGATATCAGAAGGCGCTTTCCAGCCGGGGCCGAAAACGCCCACCGGTGCGGGCGTCTTCGTCCGATAGCTGCTGTAGATTTTCGCGGGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAAGTCCGTCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTGAAGCGCGCTTAATTCTTACACCTGCCGAACCCTGGTTAATGGACCGCCATACTGAGTCATATCCTGACGCGCCGCTGGTTTAGGTTAAACACCCAAGACGCCGTATCGCCGCG
>d57afb7d-903e-46cf-a43d-0e17fb0949d8
TTGGTATGCTTCGTTCAGTTGCATGCCTGCTGCTTGCCTGTCGCTCTATCTTCGAGCGATCTCAGCGGGTGTTTAGCCTGCGTTAATGCCATTTACACACAATCCATCCACACATATTACGACCGCTGACACCTTCATGCCATTTTGGCGTTGATGTTCGGTGCGGCAAACAGCAGATCAGAACGGGCTGGTGGAAGCGTACATCCATAAAGGCGTGTTCATGCGTTTGTGCGGTATAACTGTTGCCTTCCAGTGTGGCTGTCTTTTATGAATTTGCCGAAGTCTGAAAGAAAACAGCTGTTGTTTGCTCACCAATTGCGCCAAGCAGAATACCGGATCGTTCTCTCATTAAAGATCCCAGCAACAGCAGCGAACAGTCCCGCCATCATCGAATAAACTGTTCATAGCCGACCCATGCTGAGTCAAACAGGATCGCCAGTCACACCGGATGACCCATTTTATCCACCATGGCGGGCGTTGCAAATCGTGCGTCGGCCAGGTTTAACTGAATCACCATGACGGAAGGACGAGCCTCACGCCCGCTGCGGTGCGACTTCCGCGATCGCTCACGCAAAGCCAGCTTTCTTTAAAACGGTGCGCATCCAGTACCACCGATAAAGCCATACGGGTTACATTACGTTTCCAGATAAACCCAAATTATTTTCAGCCTGGCAACACGCTCCGTGGTGGATTTACGTTGTGGTTGTGCGATCAAACAGCACCAGATCACGGTATTGGCAGGGCGTTAAAACCACTTTGTTTAGAAGATGAGTGCCATTTAAACGAAGTAGGTTTTATCGGCATTAAACACACCGCAGCTGTTGCTGTGCAATGCACGGCGCACCTTCGTGAATCAGCAGATCGCCCATCGCTACGTCGGCGTTGCTGGAATCGGCACGGAACAACTGCCTCACCAAAAGTATTCCCAAACTGATTCCCCACCACCGGATGGCGCTGGAAAATTCGCCCTGATGACCAGGGCAATCAAATGCCGCTGTTACCTTGGTTGACATAATCGATATGATGCGCCGGAAGAAAAGGTGGGCGCAGTTGGTTTCATAATGGCTGGCGGCGGTTTCCAGCTGGCGACCGCAAAATTCTCGATGCGTTCACCAGTTCTCAAAGACCCCGAAATAAGGGCAAATACTCTCACGGTGCGATTCTTGATTTTCAGTAGCAATAAATACGAAAGGATTACGCAACCGTGGCATCGATTTCATGTCGATTTTCGCATGCCAACATCGTTGGCGATAAAACTATTGCGCCATGCGATATTACGACTTTTTCGTAATGTAGATGCAATTCTCGCTGCGTGGTAAAACAGTCCGGGCCGCAAGAATCACTAACCTGCTTTTAATTTGTTGTTTTTCATCTCTTTAGTACAGGAGTAACGGTCATAATTTCTCAGATAGAAATCAGTCGATGCCGGAAAAAAGCAAATTCTTTCCCCGCTGATAAATAAATCAGAGTGGAGTGCTTTTTCAGAATGCGAGCCCTTACCAGTCAGGTGGCTGATAAATGCAAGGTTAACAGAGAGAATGAGCACCACGGAATACAGGCCTCACCTGCTAATACAGAGAGAGTCAGAAGGAAGACCTGTACGCTGAAGTGCCCTTAGTCCGGTGACTAACGGGCGATGAAGAAATGCTGAAGATCAAGCCCTATGCGTTAGGCAAACTTCATAATATGATTGTCACTTTGCTTATATGGGGCGCCAAATTGGCTGGTATTTTCCATTTAATTGCTTTCCTGAGTCTCTTGAATGAAGGTGAGAATATTCTATCCGGGAAGCTGAGTTTGAACCATGAAGGTGATCAATAAAAAAATGATCAATCTTAATTTATTTAATGATGAGCTTTTTACTCAGTAATATAAAATATTGAATTGTTATTTTGTGTGTTATTGCAAGATAAAAAAGCCGTATTTTATTCTATTGGCTTTAATTAATAAAAGAGCGGGCTGTATTAAAATTATCTTCAGCATAGCGCAAGCCGTGGCAATACCGGTTTCAATGCAATGTGAAATGGCGACTGGGCGGGCGGGATCCTGTTCCAGTTTTGTCGCAGATGTCCATATAAATACGCAAATGGCATTGACGACTGTTCAGGCCGCGTTTGGCCCCCACACCTGGTTAAAGGAGCTGGCGCTGGGTGAAATTACTTGCACAGCATTGTTGAGCGGCACCGCCCCAGCAGAGCCCGGAACTCAATGGTGGCGGGTGCACCTCTTCTCCCCAGTACTGAATCACGCGGGCGGCTAAATCGACGGTAACATCGGGAAGATTGCCCCACCGCTGGATCAGGCGCAGTGGTGGCAGAGTAGCGGCTTGTGTCGACGCGAACCGGGCCTGTTGTAATGCCGACGGCTTATCGGATAATCATCCGCTCCGGCATCCAGCGCGGCGATTTTTATCAGCTCATAACTGCTGCGTGCGGAAAGCAATCACCCGGCACCGCGCTCCACTGGCGCAGGTCGCGAGATAAACTCAATCCATCACCATCAGACGATGAGATCGAAATAATCAATCCCGACACGGGTTGCCCTTCCGGCAAACCCGGTTCGCGTTTCGGCCTCAAAGACGTAAATCGCCCTCCAGCGCCGTGCGCAGAAAGCGACAACGAATAGCCTGTTCATCTTCAGCAATCCGAACGTTTTGTCACGCCATCCTCATGAAATTCTTCAAGTTCGGGGCGGTTTGCTGAAATTAAACACGAAGCAAATACCCACCTTCGGTCGGTTGAACGCGGTAATAGATGCTTTAGTAGCCATCCACTATCACCCGACAAATTGCCAGTCCAAAGCCCTACCCCCGGTACAGCTCTTTTATTCCGCGAACAAACATCCGATATCGTCTTTCCTGGCCTGGCGGAAGAGACCGGAGGCCGTTATCCCAGACATCCGGTTGTAGATTTTCGCCCTCAACGTGGGCATCGATACCAATTTCGGCCTGCGCACCGCATATTTCACCGCCGTTCCTCAGCAGATTAATCAGCACCCGTTCAAAAGTGGCCCGTCAACGTGGATTAAGGTCAACCCGGTTCTGGCAGAGAAAGATTAGTGACGACGATAAACCCGGTTCCAGCATTTGCAGCGCGCTGCCGACTACTTCTTCCAGCGTTAACCACTCTTTCTTCAAATTAAAATACCGCCGGACTGAATTCGCGCCATATCAGTAGATTATTCACCAGTCAGGTGAGTGTTCCTTTATGCTGACGGATCTCGCTGGCCTGGCGGGCGTGGAAATTTGATCTTCGCTTGCAGATCGAGCGTTAAGATTTCTGCTGACCAAACAGCACCGTAAGCGGCGTGCGCGTAAATCAATGCAGAAAGCGCCGCCAATAAGAAGGCGTTGCGGATCTGTTCACGTTCGCTTGCCATCCGCGCCTGTTCTTCGCTGGCGGTTGGCGTCAGCCGCTCAGAACATTGGCGATAACAGCGTAAACGTCTCCAGCGAGCGCTGCTGTTTCGGGATCATCAACTGGCGCAGATTCCCAGCTCCACCCACCAGCCCGTAGGTTTCTCGCCGCTTTTTAGCGGCAAAATCCTGGTACGTTACTGCCGGGTAACGTGTCGAACCGCGCCGCGAACGGGCAGCTATCAAAGCTCCACTGCGCGATGGCATCGTCCCACGGCGTCATTCCTCGCGGATGTGTTAAACGGCTGCAATTTACCGTTGTCATCGAACGCAACACCTGACTGCGGGCATGAAGCGTGGGCAATAGAATTTGTTCGCTGGTGGCAGCGATATCCTGCGGACTGCGGCCCACCGCCAGAGCTTTCGACATTTCGCCTAAGTGCCGTGTGTGCGTTGCTCGCGCGGTAACGGGCTTTACGCGCGCCTGATAACGCACACGCCAGCGAGTAAGGTTCCCCGATCACCAGCCCGACGGTTAACATCACCGCGAGGTCAGCAGATATTGCATCAGAGACGGCAGGCGTGCCGCGTGGGGCGATAAAAAGAGATCGAAACTCACCATTAATGACGGTGGCCACTGAAGGCCAGCGTCCATAAAATAGCGCCACCACCCACCCGCCAAAGCAGATACAGCATCACCAGGTTGGCGGCATCAAAGCCTCATCAGCCACTGCGCGGCAATCAAAAGGTGATGGCAGCGCATAACGCGGCAGCAACCACGCATCCCTGAATTTACCGCCGCTTGTCTTTTAAAAGAGCGGATTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTGGTTTCATCAAAGCGCGACCAGCACCCTGATCGAGATCGGGGCGATGCGCGCCAGTCGGACAACAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGAACGACCGAGAATAATCTTGCCAAGATTATGTTCACGGGCATAACGCACTACCGCTTTCTCTTCCGCTGGATCAGAAAGTGTTGCCGTCTCCACGCCGCCCAGTTCCTGCGCCAGACGTAAGGGCGCTGAGTACTTGACGTTTTCCGGTAAGCGGTGCGGAACGGGGGTTTCAAACATACACCCGCGTGCCAGGCCTTCTGGCCATGACGCCAGCCGCGCCGCTGCGCAGACCGGTTACCGCTGCCGGTGTTATGGCCGATTACATAAAAGGATCGCGCGTCGCGCGTGTGCCACTTCCCTTCGCGGATGCCCCGCCAGGCGCGCATTTAACTATCAGCGCGATCAACCCGGGTACGAGCGCCGAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAAATGTTCAATGGCGCGCTCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTTCAGCCATAGCGCCGTCGTCCAGGGGCAGAGTCCACCAACACCACGTCGTCGGCGGCATCGAAAAAGGATCGGGCACGGTTTCCGTACCTGAATTCCGGTGACGCCGCCAGCCACATCATTCAGACTTTCCAGATGCTGAACGTTGACGGTAGTGAAAACATCAATGCCGGCTTCCAGCAGTTCTTCGATATCCTGCCAGCGTTTGGGGTGGCGGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCCATTAAGATCAGCGCCGGGCGGCGGGCGAGGGTAAACATCGAGATCAAACTCGCTGATATACCGCCCACGGTACGCCTGGCGTTTTAACGGCAGAACAACCAGCCCTTCCAGCATGGCGGCGGTATCTTTTCGCCGTGGGTTTCTGCCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCCAGGTCTTTGGCGCGCTGCACAGGCACCAGAAAACTTTCAGCTTCCCCCGATGCGGCGCGCGGCAGTTTGTTCCAGCAGTTGATCGGGGTCGGGACGTAAGGGTTCGTTTATTCATCAAGTTTATCCAGCGCCAGATTGGGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAGTTTGTTGGCGGCTGTATTTTACGCGATCCGGTGCGTGAGCTGTTCAACGCTGGAATTACGCGCTTTCGCCACGCGTGGGTTTGCCAGGCCGCCGCTTGCGGGTGATATTATTGTCCAGCCCGCTTGCCGATCTGCCCGTCCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCTTAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTACTGACCGCCAGATTACTCCCGCCAAGCCTGTAGTTATAGGGCATTTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAAATTCTGCCCGATTAATGCCGAACCATGCCGTATCACCTTCACAGATCAACGAACCATTGGCCTGCCGGGAAACCACCATTTGCCCCAGTACGGTGGTCAGCGGCGAATAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGAGTAATGCCGGACGTAATCCACTCATGGTAAACCTCACCAGACCGCAAACGGTCAGCGGTGATAATGGCTTTGACGCGATAAACGGCACCAGCAGCCTGACCGTAAATCCGCAAGTTACGGCTTTTAACATGCGCCAGAAGCGGTAAGCGGTTTATAGCTCGCCTTTAACGCCAGGGGAATCAAAGATGATAATCAGGCGTTAGAAAATCCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCACATGATGTTCAGCGCATTCGCTGCGGATACGTTGCCGCGAATGCGCCGGAATAATGGCGAAATGGCTTCGCCACATCGTTCTTAATGCTGGAAGATTGGTCAGCGGCCACGGGTCGTAGCATCTGTTTGCCAATGTTACTACCTCAGTCAACTTGGTCGAGTTTAGAGGTCGAATCGACCATATTGCCCGCCTCTTTCGCCGCCTAGGTGCCGGGTTCATCGCCACCACCGGCATCTGCACCTGCATAGCGCCAGACATCCGTTGGTGCAAATCGCCGGTCTTCGCTTTAAAACGACCTTCCGCCTGATACTGACGGATCAATGCCATGGCCTCGGTGTCGCTTCGGCGAGAAAATCATCTGACACCCGCTTCCGCAGCAATCGCGGCAGCGAGTCAGACCAGTTATCGCCGGTAATGCAAGTTTTAATGCCCATTTTGCGCAGCTGGGCGGCAACTACTAATACCGCCAGCGGCGTCATCTTTCAGCACTAATAACCCAGCTACGAACCTTCCACCACCACCAGCGGCGTGGCTCCCTGACGCGCAACCTGATCGACTTTTTTGATCCAACATCGGTGAGAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTGGATCGGCACGGTTTATTGATGTTGATCCCTTCATCCGGCTTTGTCAAACGGTACAAGGTGGCATGGGCGACTGCGTCGCGCTCGCGCGCAGGTTAAAGCAACTGCTTGGCGGGGATACAATGCTGCGGCCTTCCGGCGTTTCATCAGCCAGCAGAAGCCAGTTGTGCAGCGTCAGCCAGCGTTTTCATCCACGCCCTGCGCGGGATAAACTCTGACGCCTGACGGTTACCGGGTGTGATGGTGCCGGTTTATCCAGTAGCCAGGGCAATCCGGCGTCACCTGCCGCTTCAACTGCGTCCGCTAGTGGCAATCACATTCGCGCCTAGCTGCCCGGCTCATCGGCGGCGCCGTCGCGACAACGGGCCGCCAATAGTGGTTGGGATCGAACAGACCAGCGCCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCCTTTGCGGAAAACGGCCACAGCGTGGCGGTTGCCAATCAAAAACGATAGTCAGAACCGAAATCAACAGAATGGATCAGGGCAATTTCGTTCGGCGTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCCGCCGGGTTACAACGCTACACTCAATCACCAGCCGAAGTCAGAAGAATACGTGCCGCCGGTGACGGAAGCAAAATCGCCCCGCCGGATCCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTAAATCGACCACGATCGCCCCGCTTTCAACTAACTTCCACCCATCGCAGGGATATCGCCAGCTTCTACCGAGCACGATATCGCCTTTACGAAGTTGGCGGAATTCGGCAGGAACTTTGTCGCCGCAGCGCCATATTAGCTCACGCAACGCGGGCAAGGCGGATTTTCACCCTTTCGGACTGTTGGCCTGCGCTTTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTGGCGAACAGTACGGTGATCCACAGCCGCCACTAATGGCCGCGCTAAACAGCGCATTGCGGGCATCACTGCTTGCCATCGCGATGCTAACAGGTGGTCAGCAGACTGCCGATCAGACGATAAACATCACCCGGATTGATTGCGCCATTGCGCCTACGGGTTAAATTTTTTCACCGCTGCTCAGCGCCCTGAACGACAAGTGTTGGTTCGAATGGCGCTGAGTTGTTTACGACTCATATTCGGTGCTCACTCAATATCGCTCAGGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCATGCGTTGGCAGCGATGCCGGAGCTGGCGGCAGCTCTTTTGCTCTGCTTGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCGGAACGCCAGTAAACGGTTCCAGAAGAGACGGGGTTGGCGCTTAATCCGGCAAAACGCTGCCGTTGTTGTTATGGCGGATGACACGGCGTACGCCTTCGCTAAAACCATGCGGGCCAGGGTGAGCATAGCGCCTACGATCAGCGTCAGTCTGTCATCGCCAACGCCGCGCCCTCAGCACCAGCGTCAGGGGTAACCAGAATTGCCGAACAGTCAGTTTCATCTCGCGTACGTCTGATTTTTTTTACCGATATTCCGATTGTACGACAATCATCGGCCCGGCAGCGTAAGCACCGCCAGCAGGACAAACAGCATCATGCCGTAGGGCCAGGGCCGACACCGCCAGAACACCGCTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGGCATTAAAGCAGATCATACATCGCAATCACCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACCGGGCTACTGACCAGCGCCGAAACGGCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTCACCCGGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCGGATGACCAAAAATCACTGACATCGCCCACAGCAACGCGCCGCCCTGGCGTGATCATATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTCTGCACGAAGTTGGTCGAAAGTGTGGTTGGGTTTCAAACCGGATGCACGACGAATTGGCATTAAAGCCACCACCGTTAGTACCGGTATCATGATCGCTTCCTGAGAAGCTACAGGCCCCTATGATGCTTCATTGCATCGCTAATTATCCACAGCCACAAATCAGGCGAAAGAGTTTTGCAGCGCACCTTGTTGAATAAAAAGCAGGTACGTCAACAACGCCACGGGGACTAGCACCCATAACGTGATGCGTGGCAGATCGACCCGAAGCCGTTCCAGAGCGTGCTCGTATGCTCTGGCGGGTAAACGCCTTGCGGATAGGGCAAAATCACCACAATCCGCTGGCGGCAGAGAAAGTTTTGCGCCGGTGCGGCCCGCCATCGGCTGAAATAGCTCAACGGTTTCACCGCTATAAGATTGCCAGTTGGGTATTGGTGACCGAAGCTGACGGCGTGTTCGGCGCCAGATCCCACGACAACCCTGGCAACTGCTTCCATTGGACCAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCGCATGTTCAGGCCGAGAATGTACAAGATATTGCTTCCAGTTCATCACGGTCGAGACGCCAAGTGCGCGAAAAAGTACGCGCTCAACGCCCATTGCCGGGAAGAGGAATGTCATTAATCAGCGCGCCAGCCGCTGCCTAAAGGACGCACCAGCACCGGCTAACACCAGTAAAAACGTGGCGATCAGTAGAACCCTTGCGCAGCCATCAAGACGCCTCCGCATTGATCAGGGGGCATAAACCAGATAACCCGAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCCTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGGAATTCTGGCTGCAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAAGTATAAAAATGGCAAAAGCCATGATTTGGCTAATGTTTGAGTAATGAATTTAAGGTTCGCTTACCCAAGCAGACGCCAGAAGATGGAGCACCGCA
>f51c19c0-2613-48a7-a9a1-ec59658cbd2d
TTGTTATACTTCGTTCAGTTACGTATTTAGCCGCTCATCTTCGGCGTCTGGCAGGTGTTTTTAACCTATGCGTACTGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTCGCTCATCTGCTCATCCTTGTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATGTTCGCTTGAATATATGTTTCGATTGGTATAACGATGTCTAAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATATTCAAAACTCAAGCAATCAATAAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTTATCGCTGGTTTTCGATAGACGCGATGCAGGTAACTCATAAAAGCAGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAGCCGCATGAAGTACGGCGTAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCACCCGGTGAATGGCACCGGAAAAATGAATTGTTTATCACAGTGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTTGCGAAATCTTTGCAATAGGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTACTATTGCTGGGTTATCTGGTTTATGCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAAGGGTTCTTACTGATCGCCGTTTTACTGGTGTTAATGGTGCTGGCGCGTCTTTAGGCGGCGGGCTGGCGCAGCTGATTAATATTGTTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTTCGCGCCAGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGTGCTGTTTTTTATGTTGCTCGGTCGGCACTATCCTGCCGCTTAATCCGCCCGTTGCCAGGGCTGTCGTGGGATCTGGCATGAATACCGCCGTCAGCTTTATCACCAATACCAACGCTAGCGATCTTATAGCGGTGAAACCGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCAGCGGGATTGCGATGATTTTGCCTCATCCGTGCGTTTACCCGCCAGGCATGAGCACGCTCGGGAATGCAGGTCGATCTGCTACGCATCACGTTATGGGTGCTGGTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAAGATTGCGCTGCGACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCTGGACCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCGTTGAAAAACTAACCACGCGAAATAGCTTCGTGCAGATGCGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTAATTGAAGTGATGAGGCGGTCGCCGCCAGGGGCGCATGTTGCTATGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACCTTCAGCATCAATATATGGAAGAGTAAAGAGAGCCATTTCGGCGTGCTGGTCAGTAACCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTAACGCAGTGGTTGCGATGCATAGTTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATACAAATTAGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCGCTGATGATTGGTCGTACACCGGAATATCTGGTAAAAATCGACGTACGCGAGATGAAACTGGCTGCACTGGCAATTCTGGTTACCCCCGACGCTGAATTACTGATGGGCGCAGCGTTGGCGATGATGACCGACACCGGACGCGCTTGCCATGCTCAACCCTGGCCCGCATGGTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCCATTCGCTTCGGGGTGATTATCCCGGTGATGGCAGTGCCGGTTCGCTGGTGAGTAAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACCTCACGGCCGCTGTTTGTTGGCCTGCAATCGGCACCCGTGTTGCTGGTTGGCGCACTGAAGCCTTTATCTGCCCTGGCGCTGAGATACGGTGGCGGAATATCTCTGATGATATTGAGTGAGCACTACAGATATGAGTCGTAAACAACTGGCGCTGTCCAGACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAGCCCGCAGGCGCAATGGCGCAATCGGTGATGTTTATCGTCTGGATCAGCAGCAGTCTACTGACCACCTGTCGTAGCATCTGATGGCAAAAGCCGTGCGATGCCCGACAATGCGCTGTTTAGCGCAGCCATTAACGGTGGCTGTGGATCACCATACTGTTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAAGGCGCAGTAAACACCAGGCCAACAGTCTGAAAGGGGTGAAAAAAACTGCCTTTGCCCGCAAACTGCGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCTGCGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATAAGCCGTACCATCACCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGATTTGCCTCCGTCACCAAACGGCGCATATTCTTTCTATTGGCTGGTGATTGAGTGTAGCGTTAACCCCAGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACACCAGGCGAAATTGCCCTGACCATTCTGCTGGCGTTGCCCTGACTATCGTCCTTTTACTGGCAACCGCCACGCTGGCCGTTTTCGCGATGGGGCAATGTACAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCCTGATTAGCCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAAACCGGATGCTAGGCGCGAATGTGATTGAGGTTAAACACCAAGCAGACGCCGAAGATGGGGAGCGGG
>fea3d3b3-af6c-451a-b862-6043d17ec775
TTGTTGTGCTTCGTTCGGTTACGTATTGCTACCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGAACAACCTCAGCTGATGCAGGTTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTTGCCCCTTCCGTGCTGACCAAGCGCCAGCGTAGGCCGCGATGGTCGCAGTGGTACAGGTGGATTTTTCGCGCCGGCGTGTACACCGGGTCCATCTGGTTTCTCTGCTCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCGCCTCCTCACCCGGTCCGGCCAGGGATTTCGCCAATAGCCGGTCGAGGCATCACCAGCACCGGCTTACCACACACTGCCACCGTCTTCGCCGCCGGACTGCTGAAGGGTATCCCGCCAGGCTGCGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCTGATGAGTGGCATTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGATCCTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCGTTCACGTCTTACACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGGCTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTACTTTGACTGTCAATAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCCTTCCGGGATGGTCGGTTTTCTCCGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGTGCTGTCCGGGTGCAGCTCAGGTCGAGCGGGTGGTTACCTGCAGGTCTGTGGCATGCAGGATATCAATGCCAGGTTACATATAATAAGAGCAATTAACTTAATTTATTTGTTTATAATGCGCTACTTAGCCACAAACCATTGAATATACCCTCTGACAGAAAATAAGAAAGCCATGTTATTATCGCTATAATATACTTACTATCAATCCTTACGCCAATAATGTCTGTTGATCCCTATAAATATTAGAGCAATAAAGAATACTATGCCTGTTGGAAAACATATTACCATCATTCCGCCAAGACTGTGAGACTAATTAACTCGCTCACATCACGAGTGGAATCTAATAGTGAAGAGAATCTATGCATGAAAGAATAGTATTAAAGCGATAAAGCCAGCCATATAGCTCTGAATAAAAAATAATATATTTCGTTACATCACTCCGGTGAATACAAAATCCTAATAAAACGTCCAATGTTATTTCCGGAGCACTTCATCTTACATGTTTCTAAAGAATCGATAGACCAGTCTTGGCGGTTTAAATAGCCCTAAATTTATGATTGTGAATATATCAGGCAATACAGAATAGCAGTATACCTCACTTTAGCTTCCTTTTAAACAGTTCTCCACACAACTATTATCGGTTCCAGCGAGGTCACAACGGCCAGCAGCTTCTTTGTATCATTACTTGCTTTACCCTATTTTATAAGACCATCTCAGCAGTTCTCCCGTTGGTCTTGGCCACCACAAGTATAGTCCCCTTACCATCTGGGACACAAAGATATTGATGATAGAACGGATTCCCCATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCGGATTCAGCAGATGCTGATAAAATTCCATCCCCTTTCAGCCCAATCGGATCTGAGTGATATATCGCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCTCATCATACTGCTGCCCCGGCGAACGGATAAGCTGCTGCAGCCTGATGCGGGTTCTCTTCCGTTCAGCAGGTTGCCCCCCATTCATCGTATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATGAGGCCAGCGGCGGGCGCGATGGTCGCAGTGGTACAGGTGAATTTTCGCGCCGGCGTGTATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCCGAGCATCTGCACCAGCACCGGCAGAACACCTGCCACCGTCTTCGCCACCGGACTGCTGGGGTGATATCCGCCAGGCTGCGGCGCTGCGTTTCGCCAGCTCACCGGTGGTTTCAGCCCTGATGAGTGGCATTAGCTCCCCGGCGCTGATAAATCATCTGGATGCGGGTTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCGTCAGATTCCACGTTCACGCCGCCATACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTATGAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCAGGATAACCCTTCCCGGGATGAGTCGGTTTTCTCTGTCAGCCTGCCGTGACGGTCACCACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCCGGCCACATGCTGAGGGCGCTGTCGGGTGCAGCTCAGGTCGGGCAGGCGGTTACCTGCCGGGTCTGGCGGTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCGGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTTCAGGTCTGGCTCTAACTTTGCCCGGCAGAGGTATAAGCGGTGACAGGTCATAACGGCCCGAAGCTGCGCAGCGTTTCCCGATGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCCACGGCGGGCAGGCTGTCGAAGCTATACAGCGGTTCGCCAGTCCACAATGCGTTGTACGCATGTCGGTCTCCATGCTGCCAGAGCAGTTCATTCATCTGCGGATGATGATGATGCACCGTCAGGTGTTCACTGGCAGGCGGCCTTCTGTCATAACCATAGTGCACCATCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCCAGCCAGCCGCGCGTTCGATCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTTGGTAAGATTTGACCGGCCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCGGAGTCGTGGTGATAACTGTTGTGTGCGGCCGTCAAAGCCGGTTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCTGCGTGTACAGATGGCTTTTTCCCCACGCATCGTACTGTGTCCACGTTTCTGCCGTCCGGGGCAATGAGCGGTGGTCAGGTCACCGGCGACGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGCGCCGCGGTACTGACTCAGCCTTCCTCGCGGTGCACCGCCGTCCCGCACGAAACCAAAACGGTCATGGTCATGGCAGGTTACATAGCCGGAACAGTCAGTGAAGCTCAACAGCCCCGGTGCGTAACGGCTCCCGTCATGTGGTTTTTCCGGCTGCCGGTGGCATCTTCCATTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATGATATCGCCGTCAGGGGCAGTTCCACAATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCATCCAGGCCCGGTGGCTGGCGTTAACTGGCGCTGTGGTGGTTATAGTAAAAACGCCGATGCCCTGCCATCCGGCTATTGGTGATGCGCGTGATGGGCCCGTCACCACATCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCCAAACTGGCTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTTCACCACCCGCTGTGCCTTCACCCTGCGTGTGCAGGACTTCACGGCAGTTCAGGCTATCGGTAGTGGTGATGCGAAGTCCTTCTCATGCTGATACGTGTAACCCAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGGTCGGCCCGATAATGACAGTGCGCCACCATCGGCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCCAGGGCGAGTCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAATACACGGCAGACAGACGGATGCCGTTGATAACCACATATTCGGTGTAACCCGGCAGGGTGTCAGGAAAACGGACGGTTCCGTCCACCGATGGCCCTGCTGCCGAGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCGGAAGTGACGCCCGGCACCATCCGTCGCCGGTGATTTCGCCGCTGGTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCGGCGGCGCGGGCAGCACCTCATCATCACTTCCCGGCTTATCACACCAGCCGAGCAGCCACCGGCCCCTGCGGATTTGTTTGTCCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCGAGTGCAGCCAGCCGGTGACCTTCGTCCAGTTTCGCCACGCCGCCGCGCAGCCACAGTGACTCGCTGCGGCTGTAACCAAATCCTCACCGGGAAACAGATTACTCAAATACCAGGCTTCTGCCGCCGTTATCACTGGTATCAGTGTGTTATCCCAGCGCAGCTGTAAGCGGATATCACCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGGTTTCACCGGGAAGGACCTTTGCCGAGCGGCGGATTGACCGGATGGCCGGACGTCACCCCGCCGGGCACACCGAACAGGCCACGCCGATGGGGCACCGATACATTGCCCCGGCTGAACCCTGGCGATACTACGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCCCGGGTTATTTGTCTGCTGACGGGCGAAACCCTACAGATTTACCGAAAGCCTTAAATTGAGATATCATCAGATAAGAACAATTGGGAAAATATTTATATATATTTCGCCAGATATATGTTTCGATTGGTATAACGATGTCTAAAATATTCCTCTGAACATCTTCCTGATACAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATCTGTTAAACTCCCAGCAATCAATAAAATCACCAGTTGCCTTTCGGCCTGATCCATCCCACCGGTTTATCGCTGGTTTTCGACCAGACGAGGTTAAACTTGCCAAAGCAGACGCCGAAGATTAGAGCACGCA
>dbe28df8-d40f-4a1a-9666-9e8bc64c6204
CTGGTACTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCATCTTCGGCGTCTGCTTGGGTGTTTAACCTGCGCAGCTGGAGCGCGAAGCGCTCACTAATACCGCCTTTGACGAATATCTTTCAGCGCAATAACGCCTTTACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCTGACGCAGCCTGATCGACTTTTTGATCCAGCATCGGTAGAAGTGACCGTTAGCCTCAACATGACGGCGACGAATGGCATCGACAGAACCTTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTCGCAAACGGTACAAAGGTGGCGGGCAGTGACTGCACAATCGCCGCTCGCGCAGGTTAAAACGCTGCTGGCGGGATCACAATACTGCGGCCTTCCGGCGTTTCATCGGCAGCAGAAGCCAGTTGTGCGGCGTCAGCCAACGTTTTCATCCACGCCCTGCGCGGATAAACTCCGACGCCTGACGGTTACCGGTGTGATGGTGCCGGTTTATCCAGTAGCAGAACGTCAGCGTCACCGCTTCAACTGCGTCCGCTGGTGGCAATCACATTCGCGCCCTAGCATCCGGCTCCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAGGTGGTTTGGGATCAGACAGACCAACAACGCCATAGTACCGTTACGCTGACCATTACCGCCCGCGGAAAACGGCCACAGCGTGGCGGTTTAATAAAAAGACGATAGTCGGGCAATCAACAGAATGGTCCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGATCATCCGATCGAAATCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCGAAGAATACGCGTGCCGCCGGTGACGGAGCAAAATCGCCGCCAGTTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCCATCGACCGATGCACCCCTTCAATAACTTCCTGCATCGCGGGGATAATATCGCCAGCTTCACCAGTACGATATCGCCTTTACAGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATCTATTTCGGCTCACGCGGCTTGCGGGCAAAGGCGGTTTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCAATTAGCCGGAACAGTACGGTGATCCACAGCCAGCCGCTAATGGCCGCTAAACCGGCATTGCCGGGCATGCTGCCTGCCATCGCGATGCTATTACGAATTCGGTCAAGCGATTGCCGATCCAGACGATAAACACCTCCTGCCGGATTGCCATTGCGCCTGCCGGAATTAATTTTTTCACCGCTTCAACACCGGCGCCTGAACGACAAGTGTTGGTTCCGAATAGCGCCAGTTGTTTACGACTCATATTCCGATAACAAAACCAATATCATCAGGAGAGATATTCACCACCGGACCAAGCGCCGGGCAGGGATAAAGGTCAGTCACGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCGACGTGCAGGAGCTGGCGGCTGGCTCTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATAATCGCGAAGCGACCGACAAACGCAGAACGCCGGTAAACGGTTCCAGACGGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAACCTTCGCTAAAACCATGCGGGCCAGGGACGAGCATGGCGCTACGATCCGGCGTCGTCCATCATCGCCAACGCCATGCCTCCAGCACCAGCGTCGGTAAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCTGTGGGATAAACAGCATCATGCCGCGAAGACAGAGACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGCCGGTAAACGAATCGTACATCGCCGTCACGCGCCACGAGAGCCGCCGTCGTCACGACCGCAAACGAGGCTACTGACCAGCACGCGCCAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGCAATGTCCGTGCCCAGTGCAGCAGATGCGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAAATCACTGACATCGCCAGCAACATGCGCCCTGGCGACGATCGCCCATCCTTCACCAAAGGCAAAGCGCACAGCGCCGTTGGGATCAGAAGATCATCAGCATCTGCACGAAGTTGGTCGGTGCGGTTGGGTTTTCAAACGGATGACGAGTTGTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAGCGAGTATTCACAGCCTGATAAAGGCCGAAAGTTTGCAGCGCACCTTGTTGAATAAAAGCAGTGCAATCGAAAAGCAGCGCCACGGGGACTAGCACCCATAACGTGATGCGTAACCAGATCGACCCAGGCATTCGAGCGTGCTCATGCTCTGTGGCAGTGCTTGCGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAATCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGTTGTATTGTTCAGCGCGCCAGATCCACGACAGCCTGGCAACTGCTGTGGATTAAGCGGCGAATGAGTGCTGACCGAACAACACTAAAAACAGCACCGCCAGCCCCAGCATGTTCCGGGCCGAGAATGGCACAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTAATACCGGGAAGAGGAATGTCATTAAAAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCGGCTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAATACAGAACCTCCCGCATTGATCGGGGCATAAACCAGATATTAACCCAGTAATAAAAACGCAACCAATGCACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGAAGTGATACCCGGAAGGGTAAAATTCTGGCTGCAAGATTTATAAAAATCTGCGGGCGGGGTGTAAAAAGTAAAATAGCCAAAAGCCATGATTTAACTAATCATTTTAAATATTAATTTAACTTTTGTGTAACTTAATTACAGGATGGATAAAATAAACCATCAATAAGCAAAATAAGTGGTCCGGATGAGTGGTAAATTACGCAAAAAGGCGACTGTACCATCAGATAAACAAATTCCATTTTTTCGGTGCCATTCACCGGGTAGATACAAAAGGGGAAAAGTATGGAACTCTACAGAATATCCTGCATGAAAGGCATCTTTTTACGCCGTGCCCATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTGTCTTTTCTGGGGAAAGACCACGCCCCGCCCGCTTTACGGCTACCTGGGTTAAACGAAACAGACGCCGAAGATAGAGCGACAGGCAAGTGGCAATACGTAACCCC
>458e15d1-ec66-4e53-a4c8-97593504bf11
TTGTTGTGCTTCGTTCGGTTACGTATTGCTGCGCCTGTCGCTCTATCTTCGGCGTCTGGCAGGTGTTTAACCTTCACGACCGCAAGCAGGCTACGACCAGCACGCCGAAACGGCTCTCTTTACCTTCATATTGATGCTGCTGTCATTGCCCGGTGCCAGCGGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAGCATGCGCCCTGGCGTGATCATACATCACTTCACCAAGGCAAAGCACAGCGCCATTGGGATCAAAGAAGATCGCCAGCATCGCACGAAGTTGGTCAGTGCGTTTGGGTTGGTTTTCAAACGGATGCGGCAGGTTGGCATTAAAGCCTACCGCCGTTGGTACCCAATCATGATCGCTTCTGAAGCTACAGGCCCCATGGGTAACAGCGCAAACTCCTTCAGCGGTATTCACAGCCTGATAAAGACAGAAAGTTTTGCAGCGCATTGTTGAATAAAAACAGTGCAATCAGCAACGCGCCACAGGGACCTAGCACCCATAACAACGTGATGTGCGTAACCAGATCATTAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAAAATCTACCCGCAATCCCGCTGGCGGCGAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTCACCGCTATAAGATTATGGTGGTATTGGTGACCAAAGCTGACGGCGGTAATTCAGCGCCAGATCCACGACAGCCACAGCGGCTGCTGTGGATGGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAACACCGCCAGCCCCAGCATGTTCCGGGCGAGAATGGCACAAAGATGTTACTTCAGTTCATCTACGGTCAGAGACGCCAGTGCGAAAAAGTGGCGCTCAACCGTTGTACCGGGAAGGAGAATGTCGTGGCTGCCAGCCCGCTGCCTAAAGGACAGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCGCCTCCACATTGATCGGGGCGCTCGCCAGTAATGTAAAACACCAGCAATACGCCGGTATCCGCCTGCATCACAGTGCACCTTCAATTAACTAAAAGTGATACCGGAAGGGTAAAATTCTGGCTGCAAAGATTTCCATAAAAAATCTGCGGGCGCGGGGAATTGTAAAAAGTATAAAATGGCAAAAGCCATGTGATTTAACTATCATTTAGTGTTAATTTAGCTTTTGTGCCAACTTAATTACAAGATGAATGTAAATAAACATCAATAAGCAAAAATAGAGTGGTCGGATAGTGGTAAAGAATTACACAAAGGCGGTACATTTCCATCAGATAAACAAATTCATTTTCGGTGCCATTCACCGGTGAATCTCAAGGGGGAGAAAAGTATGAATCTACAGAGAATATCCTGCATGGCTTATCTTTTGCCGCCGTATGCCAATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCTTTCCTTGAGCGCTTACCCTGCAGTGAAAGCCAGCTTGTTGATAAGCCGGTAATGGATGGATCGGTAAAGGCAACTGGTGATTTTATTGGTGCTGAGTTTGAATACATTGCTGAAAACCGCCAGCGGCTTTGGCGGTTTTTATGGAGAGATGTTCAGAGATATTTGAACATCGTTATACCAATCCAGAAACGCTTATATTCATGAAATATATAAATATTTTCCTAATTGTTCTTATCGACAGATATATCTTTCGCCAAGGCTTTCTTATATAAAATAGCGGGTTTCGCCTGTCGAATAATAACCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCAGCGGCGCGTCAGGGCATGAACGCATGACGCAGTATGTGACTGTAGCATTGTCCAGAGGTTCAGCCGGGTACGCATCAGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCGGCGGTGTCAACCATCAGTCAATCCGCTGCTCGGTGCAGGCCTTCCCGGTGAAACCGACATCGCCCTGCCAGCCCGCTGCCCGTTCATTCTGGCAGTTACCGGACAAAAACGCCCGCGCCGGAGGTTAAGCGCACCCAAGCGGACGCCGCAATACCGGCA
>77635ef8-3824-401c-8442-7fdec33235a8
TCGTGCTTCGTTCAGTTACATTGCTGCCGCGCAATATTATCACCGGCGTCTCTCTGGCGGTGTTCGCCTGGCGGTGCAGTGCGTAGAGCGGGTGCTTCACATCATAATTGGTGTTGACCAGCCCTCATCCTCGCTGCGGATAAGTTGCCGGTCAGGTCGTGGTATGCCCGCTGTGTGCCGGCCGTCAAAGCCGGTTCTCATATCAACCGGTCGAGAGTACATCGCCAACGGAAGGTGGTGTGGCTGCCGTTTTCACTTTTGGTCAGGCGGATGACCCGTCAGCAGCATCTATTCCGCCTGCGCGTCAGACCGCCCCTGCGTGGTACAGATGGCTTTTCCCCGCATCGTGCTGTAATCCCGTTTCTGCTGCTGCCGTCCGGGCAGCGGTGGTCGGTCACCACAGCGGCGTTATCATACCGCACTGCGCGAAACACCGTGTCTTTCCGCTTGATAACTGTCAGCTGTAATATGCCAATTTTGTCGCCCTTCACCAGGTGCACCGCCGGCACCTGACCAAAACGGTCATGGTCAGCGGAGTTACATAACCGGAGCGATCGGTGGCTAAGCAACAACTGACCGTAACGGCTCCCGATGTGGTTTTCGGCTGCCGGTGGCACTCTTCCGTGCGCGAGGAGTAGAATCACTGTGTGCCGGATATCAACAGTGGCAGGGTGGCGTCGCCGTCGGGGCAGTTCTGAATCAGACGGCCCATTCATCCTTCGGCATATTTCAAGCCCGTCAGGCCCGGTGGCTGACGCGTTAACCGGCATGGTGGTTGCCGTGTAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGCGTGATGGGGCCCAATGCCATCAGGACGTATTCTATTGTCACCACCGGCATAAGTGCCAGCAGGCATACGCGCGTCAAACTGACTCTGCATGTTGCTGCAATGCACTGTGTTGCACCACCCGCACCGCTTCAGCCCGCCTTCACCTGCATATTGCAGGACTTCACGGCAATTCAGGCTGTCGGCGGTGATGATGGATCCTTCTCCGCCACTGATACGTGTAACTTAAGCCGCCGCCGGGTTTAGCTGTTCATGTCACCGCCCATGCTTTCATAATAACGGTAACGAATTTCCGGTAGTCAGCGTGTGACGGTGCGCCACCATCAACTGATGAAATTTATCATCGCAAAGTAAAGGCTGCGCACCTGCATATTATGCGATCTTACACCGCCGCCAGTTCCGCCGCAGGGCGTCAGCCATAGCTTTTCGCGGCACGGCAAGACCAGATATCGATATTCCGGGGTCGTGCGTCAGCCACGGCGAACAAGGCGGATGCCGTTATGCAACCATATTCGGTGATTGTAACCCGGCAGGTACTCAGGAAACGGACGGTTGTCCGCCGGAAATAACCTGCTGCGGGCTTCTTCTGCCGCTGCTTATGCGTGGTCAGTACCAAGCCAGGAAGTGACGCCCGGCACCATCCATTCACGCCGGTGATTTCGCCGCTGGTCCTGCCGGCGGCTTCGCGTTCGGGAACGATCTAATGTGCGCCAGGCGGTCCACCAGCCAGTCAGTACCCGTACGGCGGCAGCGGCGCAGGCAGCTTCATCACTTCCGGCACCTCACACCAGCCGAGCAGCCACCGCAGCCCCTGGGGCTGTTTTGTCGCCAGATCGCGATGATGTGCGGATAAGCGGAGTTCTTCCGGCGCTTTCCTGCCGGTGCAGCCAGCCGGTGACCTTATCCAGTTTCGCCGCCGCGCACCAGCCAGTAATCTGCTGCGGCGCAACCGTCTCACAACAGGTATAAAATGCAGGCTTCGCCGGGGTGTCACTGATATCGATGTTTATCGCGCAGCCAATAAGCGGATCCGCGAGCATTTTCCAACAGGGCGAACTCCCCACCAACGGTTTTTCGTCATTAACGCTGCTGCCGGGTGCGGGAAGACGAACGGCAGCCGGGCCGGGCAGGGCGACGTCGGTTTCACAGGAAGGATAGCCTTTGCACCGAGCAGCGGCGTTGACCAGATGGCCGGACGTCACCCGCAGGGCACCGCCGAACAGGCCACGCCGGTGAGCTGTACGTGCCCCGGCTGAACCTGGACAATGCTACCGCCATACTTCCGTCATGTGCCTGACGCGCCGCCGGTTTTCCGCTCATCTCCGTCCTTGTTTTATCAAGGGTTGTTTACCATCTGCTGACAGGCAACCCTGGATTTATAAGAAAGCGCCGTGAGATATCTGTCAGATAAGAACAATTCGGAAAATATTTTCTCCATATTTCGCGAATCCTGTTTCGATTGGTGCGATAAATATCTTCCTGGAACATCTTCTGATACAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATATTCAAAACTCGGCAATCAATAAAGATGCCAGGATTGCCTTTCGGCCTGATCATCCACCGGTTTATGCTTCGGTTTTCGACCGGGCACGCGATGCAAGTGGCTGTAAAGCAGGCGCGGTCTTTCAGAAAACATGAAAGGCAGCGCTTAAAACGCAGCCGCATAGTACGGCGTAAAAAAGATCGAAGCCATGCGGATATTCTCTGGCTAAGGGTCATGCTTTTCTCCCCTTTGTATCTGCCAGGTAGATGGCACCGGAAAATGAAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTGAATTTTCCTCGTCGACCCGCCTTTTGCTTTATTGATGGTTTATTTACACGTTCATCACCGCCAATTCGATTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCCGCTGGCACGCCGTTTATCACGCACCTGCCGCCACGCAGATTTTGCGAAAATCTTTTAAGCCATCGATATCCGCTTTTTAGGCCACTGGAGGTGCACTGTGGTACAGGCGTATTAACCGGCGTGCTGGTGTTTTATTACTTTCGGTTATCTGGTTTATGCCTGTTGATCGGTGAGCGTTCTGATGGCTGCGCAAAGGGGTTTCTTACGATCCGCCGTTTTTACTGGTATTGGTGCTGGCGCGTCGCTTTGAGCAGCAGGCTGGCGCATGGATAATGACATTCCTCTTCCCCGGTACAACACGGCGTTGAGCGCGTATGCCTGCCGCGGCGTCTCGACCGTGAGATGAACTGGAAGCAATATCTTTGTATTTTATTCTCGACCTGAACAATGCTTTAGGCTGGCGGTGCTGGTATTTTTATGTTGCTCGGTCAGCACTATCTGCGCCAATCCACAGCAAGTTGCCAGGGCTGTCGTAGGATCGCGCGAATACCGCCGTCAGCTGTCGCAACACCAACTGGCAATCTTATAGCCAGTGTAGAAACCGTTGAGCTATTTCGGCGACCAGATGGCGGGCTTAACGATTTCCGCTTTCATCGCTTTCTGCCATAGCGAGATTGCGGTGATTTTGCCTCATCCGTGCGGTTTACCCGCAGAGCATATGAGCACGCTCAAGGTACTGGGTCGATCTGCTACGCACCGATAGCGGTGCTAGTCCCGCAATGGCGTTGTTGTTGTTGATTGCACTGTTTTTTATTCAACAAGGTGCATACCAAAGGCTTTCTGCCTTATCGGGCTGTGAATACCGTTGAAGGAGCGCAACGTATTCCCCATGGGGCCTGTGGCTTCTCGGGAAGCGATCAAGTGCTCGACACCTAACGACGGTGGCTTCTTTTTAATGCAACTCGTGCATCCGTTTGAAAACCCAACCGCACTATTAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTTGCGAGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTAACAATGGGCGATGTCGCGTGATTTTATGTCTGCGTAGGCGTGGCCGATGTGGGCGAAGTTCGGGTAATCACCTCATCTGCTTTGCTGGGCACGGACAGCAACATCAATAGATCAAAGGCCGTTTCGGCGTGCTGGTCAGTAACTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGGTATGATCGTTTACCGCTCTCTCCTGGCATGGTGCCGATGTGGCTGATGGAATTGGTGAAGTGGTGTTCGGCGGTGTCGGGTTCTGGTCTTTACGGCGGCGCGATGCTGTTTGTCTGCTGGCGGTGTTTGTGCGGGCTGATGATTGGAATATCTGAATTAAAAAATCGACGCGTACGCGAGATGGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCAGCGTTGGCGATGACCGACGCCGGACGCGCCATGCTCGCCCTGGCCCGCCGGTTTTTAGCGAAGTGCTGTACGCAAAATGTCATCGCCGCTACTTAACGGCAGCGCCTTGCCGGATTAAGCGCCAGCTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCCGGGTGATTATCCGGTGATGGCAGTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCGCTTTGCTACCCAACGCACGGCCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTCATTGCTGGTTGGCGCACTGATGACCTTTATCCTACCCTGGCGCCCGGGTCCGGTGGCGGAATATCTCTGATGATATTGGTGAGCTTTTGAAGATATGAGTCGTAAACGAAGCTGGCGCTATTCGAAGACCAGCTTGCGGCATCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTCAGCCACCAGGCGCAGTAACAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAACGGTGCATTCTGTCACGCTGTTTGCTTTTTGCTGGCCATTAGCGGTTGGCTGGATCACCGTACTGTTCCTTCAATTTCGCCAGGAGGCGCTGGCAGAAGGCCGCAATCGCGCGAATGATCAAAGGTGAAAAAACTGCGCTTTGCCCTGGCTGCGTGAGCCAGAAATAGCGCTGCGGCGTTCGATTCACCGACCAACTTCGTAAAGCGATATCAGTACTACAGGTAAAATGGCGATATCCCTGCGATGGTGAAGTTATTGAAGGGGCATCGGTCGATAGCCGCCATCACCGGGAATCCCGGCACAGGCGATCGTGAATCAGCGGCGATTTTGCCTCCGTCACCGGCAGCGCACGCGTATTTCTTTCGGCAAGCTGGTGATTGATTAGCAGCGTTAACTGACGAGACATTTCTGGATCAAGGATGATCGCGCATTGGTGGAAGGCGCACGCGGCCGCAAAACATGAAATTGCCCTGTTAATGCTGGAATTGCTGGCTATCGTCTTTTCGCCGCCGCCGTTTTCCGCGTGGGCGGTAACCGATCAGCAACAACGGTACTGGTGGCGCCTGGTCTGTCTGATCCCAACCTGGCGGCGGCCTGTTATGGCGATCTAATCGCCCGGGATGGAGCCGGATGCCAAACGATATTGGTGCCACCTGGACGTCAGTTGAAGCGACGGTGACGTTGGCGTTCTGCTACTGGACAAAACCAGCACCATACCTCCGGTAACCGTCGAATCGATTTCATCCGCGCAGGCGCGGATGGCGCTAAAGCGGCGCCACAACCAGCCCCCGCTGGCTGGTAAACCGAGTACGGTATTCCATGATCCTCGCCAAGCGTTTTAACCTGCGCGACGCGATACTGATCATCATGCCATTGCTGCACTTAAAGCCGGATGACGGATCCGCATCGACCCATGATCCGTAAAGGTTCTGTCGTGCATTCGTCGCCATGTTGACTAACGGTGATGCGCTTCCCTACCGATGTTGATCCGCGTCGATCAGGTTGCGCGATCAGGCCGCACCGCTGGTAGGTGGAAGTTCCTCGGTAATGCTGGGCGTTATTGCTTCGAAAGAATATCGTCAAGAGCGGTATTCAGAGCGCTTCACTTAGCTATAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAGCAAAATCTGACTGCCGCCACCCGATTGCGGAAGCGATCATCGATGATTTTCGCCGAAACTGGCACCGGAAGTGCAATGGCGATGATCGATGATATCAGGAAGGTCATTTGATGGCTGACTTGGCGACGCTTTAACGATGCTCCGGCGCTGGCGCGAGCAGATGTCGCGTGGCGATGAACTCCAACACCGGAGCGGCGAAAAGAGGCGAGGCAATATGGTCGATCATCTCAACCCGACCAAGTTGATCAGGGTGGTTTGTTAAGCAAACCACGATGCTGATGACCCGTGGCTCCGCCTGGCCCACCTTTCAGCATTGCCGAAGCGATGTGGCGGCTTCTTTAAAATTCCGGCGGCATTCGCGGCATCCTCCATGATTAAATGCGCTGAACATCAATGCCTCCGACTAGCCCGGCTCCGCAAATCTCGATGCGGTGATTTCAACGCTAACGACTTCTCAATCTTTGATTCCCCACGAACCGATTATAAACCGCTTACCGCTGCCATGTTGCGCCATCAACAACCTTCAGTTTACGGTCTGGGTGGGCCTGCTGGTGCCGTTTATCGGTATCAGAGTGTCATTGATTTACCGCTGACCCATTTGCGGTCAGTTGTAGTTTACCATGGTGGATACGTCGCGCTATCTTTCGTATTGATTACTGGCGTTTACCCGCTAACGACCACCGTACTTCGGGCAATGGTGAAGTTTCCTGGCAGGCCAATACGTTCAGTTCGTAGAGGTGAAACCACGGTGCGGTTACAAAGCGGTGTTAATCGGGCGAATTTTGCCGTAGCAGCTGTTTCATCTTCATGGTCGCGTCGTAGCGGCAACCTAAATCCTGACTTCCGGCAGGAGCAATCAGCGGTCAACAACCTGGGCTGGATAAACTAATAGCGCACGTTGCCGTACGGGCCGCCGGATGCCAGCGCAGTTCGTTAATTTAATTTGGCGGCGAAAGCGTAAACCGGCAGAACGGTTTCAAATAATATCACCCTGCAGCGGCGGCCTGGCAAATCCCGCGTGGCGGCGTAATCTCAGCGATTGAACAGCTCCCGCACAGCGAGTGCCAAAATACGTAGCAGCCGCTGGTGAAATATCAAAGCTGTGGTTGTCAACGTCGATGAACTCAATCTGGCGCTGGTCTTTTGGTGAACCAACGAAGACCCTTGCGTCCCCGACGATCATCACTGGAACAAACTGCCGCCGCATCGAGAGCTGAAAGGATTTTCGCCGGTGCTGTAAGGCGTCGGGAAGAGACCTGGGCGATGAAAGCCGCTGACTACGAACTGGATATTCAATGGTTGGCGGTAGAAACCCACGGCGAAAAGATACCGCCGCCATACCGAAGGCTGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGGGTTGATCTGTTTACGCCACCGCCCGCTCGATAATGGACCGCTGGTAATAGCAGGTTCCGTCATCCCCAAACGCTGGCGGATATCAGAGCGCTGCGAGCTGGCGTGATCTTTCGTCAACGTTCAGCATCTGGAAAGTCTGAATGATGCTGATTCGGCGGCGTCACGGAATTCAGGTACGGTATGCCCGATCCTTTTCGATGCATAAACGACGTGGTACTTCGGTGGACTTGCCCCGACTGATCCGCCAGCAGCGAAGAAAGGCAAAGTCCTCATTGCTGGGCGAGCGAACTTTACCGTCACGCCGCAAAGGTAATCTGATCGCGGCGCCCTGCGCGAACTGGCTGCACCGTACTGCCGATCGCATTGATGGAACAAATGCACGCCTGGCGAGCATCTGGCGAAGAAGAGTCATGCAGCACACGCGCGGCGCGATCGCTTTTAACCATCGATATACCGGCGGCGAAAAACTGGTCCGCGCAGCGTATTAAACGTCACGGCTGGTGGCGTCTGGCACGGTGTCATGTTGAAACCCTGCCCTGCACCGCTTACCGGAAAAAACGTCAGGGCAATTCTCGGCGCCTTACGTCTGGCACGCAGGAACTGGGCGGGGCGACAACACTTTCTGGTCAGCCGGAAGAAAGCGTGGTACGTTATGCCCGTGAACATAATCCTCGGCAAAGGATTATTTCTCGGTCGCGGCCTCCGCACTGGTGGCGTCGGGAAGCGATTTGCCGTGAGCTGGCGCGCATCGCCCGATCGTCAGAGTGCTGGTCGCGCTTGATGAATACCGCCCGCACGATTAAGCAACGCGCCGGATCGCCGCTCTTTTAGAATAGTGGCGTGTGTGGTTAAACAACACAAACCAGACGCCGAAGATACGAAAGCGGG
>0eb7ac67-e215-4aa1-958a-7cd320d229a4
TTAGTACTTCCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTCGAATTTAACCTAGGCTGTCCGGCGTGACGCGGTTGCCAGCCCCTGCTCGTTGTATGCGTGTTTCGTCTCATGCCCACCTTAGTTCCCCGTCTCGGGTTCTCCACCGTCTGGCATTCGCCAGTCGGGCGGCAGCTTTATCGTCATATGCGCAGTGGACGGCAACACGGTGGCCTTCGCTCGGAGTGGCTGATGTCTGTCCAGTAGCCGTGGCGTATCATACTGCCACTGCTCTGCCGGTTCGCCGTTCACCGTGCGGTGAGTACGGTCCGATTCATCGTAGTACCAGAAGGGATGACAAGTCCTCATCCTCACTCTGTGTCGATTTTCCGGTCAGGTCATAATGATAACGTTGCGTCCGCCCGTCAAACCGCCCTGCTGTACCAGCCGGTCAGCGCATCGTAACTGAAGACGCTGGCTGCCGTTCTCGTTAGTCAGGCTGATGACACGTCCGGCAGCATCGTACTCCATACTGCGCGTCAGCCGCCCTGCGTGAGTGCTGACCGCCCTTTCTACGCATCATTATATGTCTCATCGGTTGCCGTCAGGGGTGATAACGGCAATCCAGGTCGCCCTGCGGCGTTGTATTCATGCCGCGTTTCACGGCCCTGTACGTCTTTCACCGGGAGTTAACCAGCCACGGTTGTCATAGCGGCGGTAAAGGCTGATGCCTTCCTCGCGGTGGACCGCCGATCATCCTGGCCGAAGCGGTCGTATTCATAACGGGTCCTGGTAGCCCGAGCAGTCGATGAACGCCAGCAACTGCCGTAGCGGCTCCAGGTCATCTGCCAGGTGCTGCCCGTCGCATCCGTTGTCGTCGCCATTATCCTGTGCGCGTCATCGTAGCGGTAGCGTACTGTCTCCCGCTGCGCGATGTCTCCGATACCAGCCTGCGGTTCATCATATTCCCGGCGGCTCTCCAGCCCGTCGAGGACCGCCGTCAGCTGGTTCCCGTCGTTATAGTAAAATTTCGTCTCCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGAACACCACGTCAGACCGTACTCTTGTCTCCGTCGCCGCGTCCGTCTGCGCCAATGAGCCTTCCATAACGCGTCATACCCATGCGCGTGACGCTGCCGTCCATATTCTTTTTCACCACCACGTTTCAGCCAGCCACCTTCTGGCCAGCCAGCACCTCACGCCGGTTCAGGCTGTCATTGACGGTGATGCAGTCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCGGATTTATCCACCACCGCCCGGTATCGTCGTAGCGGTAGCGCATCTCACCATCAACCCGGGTGCTGCGCGTCGTACGTGAAAGCGCACCTACGTATTGCTGCGGTCATATACCGCCAGCGTTCACCGGCTTCCGTATTCGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCGGGTATGCCGGGTCGTGCGTAATACACCGCCGGCGGGAATTACCTGTCAGGGGCCGTATTCGGTACCGGAGCGTGTGATCGAGAACGCTGAGGCTGAGAGAGGGCGGGAACTATCAGAAGAAGATAGCGAAGGTGCGGGCCTCTTCCGCACGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACGTCGTCCGCCGGTGATTTCCCCGGCCAGGTCACCCAACGACACCTCGCCGGTACGTCAGCAATCCGCCCAGAAGCGGTCCGCCATCCGGTAGCTTCCGGTACGGCGGCAGCAGCGCTGGCAATTACGTCCTCAGCACCCGGCACCGCTCGGAACCACCCCAATTATCCACCACGGCCTGTGCGCTGTTGGTCATGAGTAAAGATGGGCTTAACCGGATATCCGGCAGCGCGCCCACAACCGCGCCAGCTATGGGTTAAACACCCGAAGCAGACGCCGCAATATCAGCAACGCCG
>10df3a9d-60a4-4cb5-ab3d-46483be7bb59
TTGCTCGGTACTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCGATCCAGAAATGTCTCTCGCCGGTTAACGCTACGCTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAAGGCAAAATCGCCACCGGATTCACGGATCACCGGTGCCGATTCCCCAGTGATGCTTTCATCGACCGATACCCCCTTCCAATAACTTCACCATCGCGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCCCGCACGGCTTGCGGGCAAAGGCAGTTTTTCACCCCTTTCAGACTGTTGGTACCTTGCGCTTTACCTGCGGCCTTCTGCCAACGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAATAGCTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAATATTCCGCCACCGGACCAAGCGCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAACAACACGGTGCCGATTAACAGGCCAACAAACAGCCCGGGCCGTGCGTTCCCGGCAGCGTGCCGGAGCTGGCGGCAGCTCTTTACTCACCAACGAACCGGCAATTGCCATCACCGGGATAATCACTGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCCTTAATCCGGCAAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAACACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGTAACCAGAATTGCCAGTGCAGTCCGATTTCATCTCGCGTACGTCGATTTTTACCCAGATATTCCGGTGTACGATAATTTCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGATAAGAACCGACACCGCCGAACCACCGCTTCCGCAATTTGCATCCAGCCACACTCGAGCACCATGCCACCGAGGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACGGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAAAGTTACCCTGAACTTCTGCCCACATCACCCGCCTACGCAGATGACAAAATCACTGACATCGCCACAACGCTTATGCGCCCCCTGGCGGCGATCATATCCTTCACCAAAAGTAAAGCACAGCGCCGTTGGGATCAAGAAGATCATAACGTATCTACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACAGTTGGTAAAGCCACCGCCGTTGAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTTCTGGGCCCCATGGGTAACAACATTTGCGCTCCTTCAACGGTATTCTGGCCTGATAAGGCAGAAAGTGCTACAGCGCACGCTTGAGATAAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAAGATCCGGCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAAAGCCCGCCATCTGGCTGGAAATAAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTAGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCGGTAGCCCTGGCAACTGCTGTGGATTAACGGCAGATAGTGCTGAGCCGAGCAACGCAAAAACAGCACCGCCAGCCCAGCATGTTCCGGGCCGAGAATGGCACAAAGATATTTCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAAAAGTACGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCCAGCCCGCTGCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCGCTTGCGCAGCCATCAGAACGCCTCCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCTGATGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTGCAGATTCACAACACCGGAATTTCGCAAAATCTGCGGGCAGGGTGTAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAGCTTTTGGTGTGAGCAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAATTACACAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTCCGGTGCCATTCACCGGGTAGATACAAAGGGGGAGAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCGGCGGGCGTTCTGGCGCTGCCTTTCGTACTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAAGGCAACTGGTGATTTTTATTGATTGCTGAGTTTGAATACGGCTGAAAACCGCCAGCGGAAACGCTGGCGGTTTACTATCAAAGAAGCTGTTTCAGAGGAATATTTAGACATCGTTATACCAATCCGAAACATATATTCATGAAATATATATAAATATTTTCTAATTGTTCTTATCTGACAGATATCTCCACTTAAGGCTTTCTTATAAATCTGTGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGGCGACATGACGCAGTATGGCCCCTGATAGCATTGTCAAGGGTTCAGCCGGGGTACGCATCGGTGCCCCCACCGGCGTGGCTTACTGTTCGGTGTGCCCCGGCGGAAATTGGGCGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCGCTTCAATTGAAACCGACATCGCCCTGCCCAGCCCGCTTTGCCGTTCATTCTCTCCCGCACCTACAGCCAGCAGTTACCGGACAAAACGCCCGCGCCGGTAGAACCTCGGCCCCAGCTGGAAAATTGCTATACCGGATATCCGCTTACAATAACGCGATAACACACTGATACTCGGTAGTAACGGCGGCAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGGAATCACTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCGCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACCATAAACAGTCCACCAGGGGCCGTGGTGGCTGCTCGGCTGTGGTGTGAGCGAATTGCCGGAAGCGAATTGAGGTGCTACTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTAATTGGACCGCTTCGAGCACTTACACACAGACGTTCCACCGCGAAGCCGCCGGTGGTCAGCAGCGAAATCACCGCGTGACGGATGGTGCCGAGTCGCTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAAACCCGGCAGCAGGCCATTTCGGCAGGACCCGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCACCCGTCTGTCTGCCGTGTGTGACGCACGACGGAATACCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGCAGGTGCTGGCTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACCGGGCCGACCGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACCGCAGGGTGAAGGCAGGCTGAAGCATGAGTGGTGAAAAGGAATTTTACGCGGACGGCGGCGTCACGCCAGAGTCAGTTTAGCGCGGTGGGCAGGCTCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACCAAATTACAGTCGGATTGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGGCGTACGGCGTTTTACTATAACCACCACAATAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCAGGAATATGATGGAATGGGGCCGTCTGATTCAGGAAACTGCCCTGACGGTATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCAGCGGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACGCACCCAGGGGCCGTAGAGCTTTGCGCGGTATGGATACAATGGCTTGCGCCACGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAGGTTAAACGCAAGCAGACGCCGAAGATAGAGCATAG
>a46ed4fe-5181-4a9d-ad1a-9e7ac83a0f95
TTGGTATACGTTCAGTTACATTATTGCTGCGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTCTGTGCTGCCTTACCACGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCCGGCATCGAAGTGAATCTCCGCCCGCCGTTGTCGTTGATGCTCAGTCGTCATCACGCGCTGTAAAGCGGATATCGAAGGCGCTTTCCAGCCGGGGCAAAAGAAAACGCCCACCAGTGCAGGCATCTTCGTCAGTAGCTGCTGCTGGGTGCAGGAGAATGAACAGCAGGCCGGGCAGCGCAAGGTCCGTCTCGCCGGGCAGCACCTTCATAACAGCGGATTACCGTTGCCGAAGTCATCCCGCCGGACACACCGAGCACGCCGCCAGTACGGCGCTGGTCTTACACCTGCCGGGCCTGGACAATGGACCACGCCATGCAGATCGCCATCTTCTGTACGCCGCTGGTTTTAGCTCATGTAAAGTGCCCTTTAGTTATTGTTCACTATCCTGTGTTAGCAGCAAAAAAATAAAATGACCTGAAGACCAGCCTAATGTATTTGCTATCTTTTCTCATGACTTATTTGTTCTCAATCAGCAACAGCGGCTTCGTTATTACAGGTCACTTTCAATATTTTATTTAGCAACATTTTAGCACAGATGAATTCATCATCAACAAATTCACTATGTGGATATCATTAACATATATGATTTGCCAGGTTGCGGCATTAGTCACCGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCCTGTTAAGATTAATATCAACCAGCAATAGAAGATGGAAATCACCAATTAATAACATCATCAAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTTACTCATCACCCGCAAACTGCCTGAACAGCGCCGCTACCCTTAACCAGTCGCGCACCCAGCCAGCCGCCAGCGGCAACAGCAGCGCTCCGCTGCTGACAGAACAATCACAATCGCCAGTCTGTCCACGGAAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCCGCGCAATTGCGGCCTGGGCGAAACAAGCCTGGCGACTCGCACCACAACATGGTACGCAGCAATTTTTCCCGCACCGAGGTGTGCGCGCCACACCACCAGCTCCTGATGACGCTGGCGCCTCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAATACCATCACTTCGCGCCCGGCTCCAGCACCTGACGACCTGTTTAAAATCAGCGCCAATATCTAACAACGGCTGTGGTCAGGGAACTGGCGGTTGAGTTAATGTCCAGCGATGCCGTTGCCATTCTCCCAGCGAAACTGGTGCATTCAGCTCTGCGGTTGCCGTCTAATGCCCTTCAGGAAAATAGGCATGAAATCGGCCGCAGACTTTCCCGTCCGCTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCTGGGTATCGCCATAAAAGTCACGCATCACCGAGGCAACGTGCCAGCGTTTCGCCAGCCCCTCTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACCGTCAGTTATGATCGACGCAATATTTTGCCAGTGGGTGAGTTCGCGGTTAAGCCTTCATTACCTTCTGTCGGCTTATCGTTGTCGCCGTCAGCCGCGCCCACACCACCAGATAAAACGATTCCGGGACTATCTGATGTTCCGCAGGAACGCTTTTAGCAGTGCTACCTGTTCTGTGGCGTGCAATTAAAAAGTGATTTCGGGCTTTCTGGGTAGCTGCTGCTGCCTTGGCGGTCGGTAGATCGCCACGCAACACCAGCAACAGTGCCAGCAGCATAAAGGAGAGCGAAAATGCCGAAAGCTGAAGCAACGTTGACCACGGCTGACGTAATGGGCGGCTAACCGCCAGGCACAGAGGCAACTGATTTAAGCGTCATGCGGCTGAAGTACATTCAGCAGCATCCAGCCGTACCGCACATAAAGCCAGTACTGCCGCCATAGCACCATGAAACGGCATACTTAATCACGGCGAACGGCCTGCAACCACCACACTGGCAATCGGCAGGTAAAACTTCAGCGGCCAGACGTTCGCTACCACATCGTGCGTAATGCGGCGTAAAGAAGGCTGCGTTGCCAGCAACCAGCGGTATGGTCATAGCCCACCAGCAGCAGGATGACCGTCGCGTTGCCCAAGCGCTTACAGCCACGGCCAGAGGCTGGCTGTGGCGGTAGTGCAGCAGGCAGAACGAGGCTTGTGCTTTATCAACGTTTTTCGAACAACAGGCCTATGTTACCGGTAACAGCTGAAGCGTCAGCACCGTCAACCACTGATAAGAGCGTTAAACGCGCAGTTAAATAAACCTGCCCCCAACGTTTACGGATCGCCCTGCAGATCGTGCTTGACTGCGACAGTAATGATTCATCTTTACGCCACCGCTGCCTACCAGCAGCAAAGGTCAAAGCGCGAAAACGCCAGGAACTGTTGCGAGCGTTCCATCGATCGCGCATATCGTCCTGTTCCAGACCATTGCCAGCGTTGTTCGGGTTTAAGTAGAGGTAACAACATTTCTCACAGCCGTCAGAGCTGGTTCTCGTTGCCGCCAATTTATAACGTAAGGTGACCCGACTCTGGCTGCGGCTCCGTGGTTTTTATCAACATCATAGTTCATCATCAGACGGAGCCGTATCTGGAAGGGTTCGACTTCGAGGTCGGTTTCTCGAATCACTTCAGCGATCCGCAAGGTGGCATCGCCCACGTTAATGGTGTCGCCGTTTTTCCGGGTTATGAGTGCCATCAGGCGTGGAAGGATAACTTCATCACGCTGCCGCCTGAAGGTTTCAGGCCGAGGATTGGATTTGCAGATCGCCATACATCAGGTAGATATCATTACCGCTTTGACGTTCGCCAGCGTACGGTGTGTCGCTTCTCTAAAAGGTCATTGTGGCGAAAGTCAAGCTGCGCAAACTTTTCGACCGCGCTTTGCGCTTCCCTCCAGCCACGCTTGCGGCGGCACTTCGCGTGACTGCGCAACGCCGATCGCTGCCGCAAACTCCTGCGGCTTTGCTGGCTTAAAGCGCTTCAATGCACGATCGCTGATGGCGTACTTTAGCGCCAGCGCAGGCCACCGCGCCAAAACCCAGCGCCAATATTAATGACAACGACGGCGACCCAGAGACAACGATAATGCTTCTCCACTGCAACTGCCCGTTCACCAGCGCTTAGCCATGGCAGCGATTCGCAGCGATGCGCCAGTTGCAGGTCGTGGTCACCACTGAAATCAGCGTGGTGCCATCGTGTTCGTTGAGAGCCATGGTCAGCAGCCTGCTCTCGCCCGATCTGGCGGGTCAAAGTTTGCCGATGGGACTCAATCTAAAACTTGACAGCACATCAGGTCGACTATTAAAGAATCGTGCCAGCGCCACTCGATTGCTGTTCACCGCCGGAAGCTGTGCCGGAAGATGATCAGACGTTTACCCAGCCTAACTGTTTCGAGCAACGCTTTCGCTTTATTCCGACATATGCTTCTCTCACCGCGCAGCAGGGCAGCCAGAGCTCGACGTTTTCCAGCACGCGTGGGGTAGGAATTAACATAATGACTGAAAAACAAAATGAGCGCTTTGCGCGCGCAACTGCCCTTCTTCGTCATATGTAGCAGTTGTCCCCGCGATTCTTCCTTTTCTGCTGCGTCATCAAACCCGGCGAGGATCGCAACAAAGGTTGACTGCGATCCGACTCGCCCGCCAATTGGTGATATCGCCACGTTTTATTAGCTCTCCAGCTCCGATGAGGATGGAGTTCATGCTCCCCTGGTGGAAACGGACTTCTTAAGATGATGAACTTCAACAAATGTTTTTCAGGTTTAACCCCAAGCAGACGCCGAAGATGGGCACGCGGG
>9a1776fd-9328-408e-9d54-e16535cbe064
TTGTTGCTTCCTGGTTTCGGGACGGTTGCTGCTGTCATCTCTCGTCTGCTTGGGTGTTTAACCTCATGCACTGAAATAACGGCACAAATAATTCAACAGTAGAATATCGACCAATTTATGCCACCACTTTCCCAAACTTTTGTCTGTAATCAGATTAATAATAAAATATGTTCCATGGTTTTCCAGTTCCATTTGTTCACCTGTATGTAAAGATGCTGATCATCCATAGCTATGAAAACAACTTTATGAACAATATTAGTATGTTGAACACAAATTCGAATTCTATTGGTACACAAAAAGTAAGCGTTTAAATGATCTTTCCTGTGGAACTGCCAAATAACTATTCCATGTGAGTTATCTCAATTTTTCACCACAGTAGATTAATTTGTTTTCTCAGGAGGAGATTTTATTTCTCTTCACTTTCTGACAATTCTAGTTCATTCTGTATCTTTGTTCAAAACATTCTTAGACTCATTTTTTGTTCAGGAGATGGTGGCATCATTCGAGGCATAGTTGGTTTTCTCATCTTCGTATCACCTGCATGATTGGATTATCAAGGACTGCCAACAGCTAGACTGGATCACTGCTCTTTTGATAGATACTTGCTCTCCCATATAACTTCTAAACTGATCATGAGAAACGCCGTTTTCTGCTGTATTTATCAGCTCCTGCAACGTTCCTTTGATGATAATGATTTTCATTAAGGCATGTGACCCGACGCAAGATTAGAGTCTCTTGCCAGCAGGTGTGAATTTATTATTTTTACGTGTACCGGTTCTGTTTGCCATGTACTCATGATGTCCTCATTCTGATACCATCTCCCGCTGGCTTTATTATTTGAACTGAAGGCTTTTGGAAAAAATAATTTTGCTCTTGAAATAGTAAAATGAAATCATAGATCATCTTTAACATGTTCGCAATCATCTATAACACCGAAAACAACAAATATATCAGCAAAAAGAACAGCTCTCTGTTTTCTTATTCTCGTGTTCTCTTCATCTTGGCTAAATTTCACCCAATCGTATCCCTGTTGGCCATCAGGTTTAGCAATGTCTCTGGGAATAATGGGAGTTCTGCAAGTATATCCTGGTGGTAATTGGTTGTTGTCCCGATTTGTCTGTGGCAGGTAATCACTTATATCTTTGTATCCATCCCACGGATACAGAATCATTCCTGGCATTACCTGAATCCAGATTTGGTTTTACCTTCCTGCAATACGGTGTGTAGCGTCGGCAATGCTCTGAAGAATGTTTGGCATTAAATGAAACACTGGCGCTAAATCGGTATGGATATGGCGGTCTTAATTGTTTAACTGCTGTCCAGCAATTTGCTTGGATCGGGCGTGGCGGTTTGTTGGTCTCTAACTCCATATCTCTGTTATTTAAGTGTCCATATTTTGATACCAGTCCCATTGAATCTATATATGAACCAGTTCAGCGGATGCACCGTGTAAATTCATCCCCTTCAGCCCAATCGGATCCTGTAGTGATATACCTCCCTGCAGCGGGTCATAATAGCGTTGTGGCGGTTGTAATACCAGGCCAGACTCCTCTTCCGCCTGCCCCGGCGGCGCGATGGATAAACTGCCGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTGCCCCCATTAAATGTTCGCACTTTTCATTCTGTTGCCTTCCGTGCCGTAGAAAGCATAGCGGCTGAACTGAGCCGCGATGGTCATAAGTGGCTGGAGTGGATTTTCGCCGGCGACGCACCACCAGGTCCATCTGGTTTTGCATCACCTGCTCCCACCGTCAGGCCGCATTACCAGCCAGCGGCGGCTTTCCTCCTCACCCGGTCAGCAAAGTTTCCTTTCAATATGGTCAGGCATCTGCACCCAGCACCGGCGAGACACCACTACCACCGTCTTCGCCGCCGGACGCTGAGGGTATCCGCCAGGCTGCAGCGCTGCGTTTTCGCCAGCTCTGGTGGCGGTTTCAATGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGATTGCCGGGTTCTGTCGTTTCCTGTATCGTGGTCGGGCGGTGTTGCCACGTCCCAATACCAGGTCGCGCGGTTCTTTCCGTGACAGCGACATCGTCGGGTCCGTTCACGTCATTCATACACCCATTTTACCCACCCTATAAACAGCAGCGGGTCATTGAATAGCAGCTTTCGACTGGCAGCTCTTGCATATTGTCGCGTCGTAATTACTTTATAATACAGTGCGACTGGCGTAATAATTTCGGTGGACGCTCATCATATCATCGATGGATAACGCTTCAGGATGAATGGTTTCTCCGTCAGCCGCGTGACGGTCATACCGGTAAAGATGAATGCGCGTCACGAGGCGATGGATTTATCTGGCCACATGCTGAAGTGCTGTCCGGGTGCAGCTCGGGTCAGACAGGCAGGTTACCTGCCGGCGGGATACAGCAGCATGCGGGATATCAGTAATGCCCGGGTTATAATAATAAGGCAATTAACCAATTGCGCGTATTTGTTTATAATGCGCCCGCCTGGCCTGCGACCTTGAGATATGCCCTCACAATGAAATAAAGCCATGTTATTATCGCCGTATACTTACTATCGAAATCACTTACGCCAATAATGTCACCGATACAGTCCCTATAAATATTACCAGAGCAATGAGAATACTGCTACTGTTTGGAAAACCTGTTACCATCATTCCATAAGACAGGACGTAACTCCTCACATCACGGTGGAGGGTCTAATAATGATGAAAGTCGCCATGGAAAAAGATAAGCAATGCAAAGCGATAAAGCCAATAGCATATCCCTGAATCTAAAAATAATATGTTTCATTACATCCGCCGGTGAATACAAATCCTAATATAAACGTCAATATTGTACCGGAACGCTTCATCTTACATGTTCTACAAAAGATCATTATAGACCAGTCTTGGCAGTTTTGAAATAGCCTGAATTTATATGAATGGCCGAATATATCAGGCAATGCTTCAGAATAACGCGCGGCCTTACCTCTTTTCGCTTCCTTTTAAACGGTTCTCCACACAGCTATTATCTGGTTCAGCGAGTCACAGCGATAGCAGCTTCTTTTGTATCATTGCGCTTGCCTGTATTTATAGACCATCTCCTTTTTGAATTCTCCCCGTTGGTGCAACACCACTACAATTATAGTCCCTTTACCACCATCTGGTTCTAGATATTGATGAGCCGTTCCCCATATCTGGACCACTTCTTTCACCCAGTTCCGCCATTGAATGCAGTGGCTTAAGCCATTTTTCTTAAGTGTTTCATCTAATGATCTATATTGAGATCGGATTCAACGGACCAATCAAAATTCATCCCCTTTCGAACCCAATCAGTCCTGGTGATATATGGCCCTGCCGGCGGGTCATAATAGCGGTGGTTGCCAATACAGGCCGGACTCCTCATCGCCTGCTTACGGCGATGGATATAAGCTACTGCAGCGCCGTGCGGGTTCTCTTCATTCAGCAGGTTTATTCGTAAGTATTCTGCCGTACCACGCTGTTGTCCCTTCCGTGCTGATAGGGGCCAGCGGCAGGCTGATAGTCGCAGTGGTACGGGTGAATTTTTCGCGCCACCGGCGGTATGCAGGTCCATCTGGCTTTGCATCTCGCCACCGTCAGGTGCGATGCCAGCCAGCAACGGCTTCCTCCACTCTACTGAGTCAGCCGAGTTTCGCGCCAGCCGGTCGAGCATCTGCCAGCGCTGCGGCGAGAACACCACTACCACCGTCTTTATACCCGGTTTCTGGAAGAGGGTGGCCTTCCGCCAGGCTCCGCGGCGCTGCGTGCCGCCAGCGCTCACCGATGGCGGTTTCAGCCTGATAGTGGCGTGAAGGCTCCCCCAGCTGGTAAATCGTCTGGATACGGGTTCATGTTCTTCTTCGTGGTCAGGCGGTCGCTTCGTCTAACCATGCCAGGTCACTTACGGTTTCCGTGACAGCGACATCCAGCCCGTCGTCCCGTTCACGCCATATACCGTTTGCCACCACCTGCGGCCTTAGTAAGTAAAGATAACGACTTTCGGCCAGCGGCTCTGCCTGGTAATGTCATGCGTGTAGTGGTACCAGCCAGTGCTGGCTATCATAATGGTACGTTGCCAGTGGTGCGCTCATCGTGCGGATAACCCCCCTTCCGGATGGTCGGTTTCTCTGTCAGCCTGCGTGACGGTCGCGCCCGGTAAAGATAGTGCGCGTCACGGGCGATACGATTTGCTCCGGCCACATGCGCTGAGGCGCTGTCAGGTGCAGCTCCGGGTCGGGCAGGCGTTTACCTGCCGGGTCGCAATGGGCATACGGAAGGATGGATATCCAGATTCGCTGCAGAATTGACGAACGCCGGTCCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCGCCTTTGCAGGCTGCTGTTCTGCGGATGAGTTCTGCATTGCGTATTCTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCGATGCTGGCTCTGTAACTGCCCGGCAGGGAGTCGCGGTGTGGTGAGTTCATAACGTGACGCCGCAGCGTTTCCCGGTGCGGGCGGTCGCGGGTGTACTCAGCGGTGTGTCTGAAGTTCGTACGACAGCCAGCCGCTGCGTAGATCAAGCCTGATGCAGCGAACTGGCTGTCCGTCTTCTAGCGGTTCGCCAGTCCTGTGCGTTTATGTGCCGCATGTCTGGTCTCATGCTGCAGAGCAGTTTGTTGTCGTCACGGATGATGCACCGTCAGGTGTTCGCACCAGCGAGCGGCCTGTCATAATGCTCCGTTACCGTCACCCGGCGGTGCCCTTCGCTGATACAAGCTGTGTCTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCTGCTCTGCGATTCGCGCATCACGGTGCGGCCGTGAGGCGGCGGTCTTCGTCACTGGTGATGGGTATTGGCCCTCATGCTCGCTGCGGATAAGTTTTGCGGTGAGTCGTGGTGATAACGCTGTGCGTACGTCCGTGGTTCCTCATCAGCCGGTCATTATCGTAACGGAAGGTGGTGTACCGTTTTCCTGTTCGGCGGATGACCCCGTCCGGCAGCATCGTATTCCATGCTACCGTCGTGCGCCCTGCGTGGTACAGATGGCTTTTCCCGCATCGCTGTATTCACGTTTATACGCCGTCAGGGCAGCCGGCGGTGAATTAAAGGTCACCACGGCGGCGTTGTATTCCCTATACCGCGTTCCATGGCCCTGCGTGTCTTTCCACGGCAATTAACATCACGGCGCTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCTTCCCTGTTAAAACATTGCTTCAATTCTTAGCGGATTACATAACTTCTTGGAACAGTCGAAGGTGGCTCAACAGCTGACCGTAACGGCTCCGTCATGGTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGAATTGCGTACTATTGTGTGGATTAACATAACGGTAGCGGGTGATATCGCTGCCATCAGGGGCAGTTCCTGAATCAGACATTTATTCATCACTGTTTCCCGGCGGCGTATTTTTACCAGCCCGTGGAGCCCCGGTGGCTGGCAATTAAGCGCAATGATGTGGTTATGGTAAAACGCCGATGCTAAACCGGCGTGGTGATGCGCGTGATGATTGCAATCGCACATCCCGGACGCAATATTCTGTTGTCAACCTGCCCGCCACGGCATCCGTCTGCCCTGACCTGCCACCGCGTCAGCCTGTCTGCGTGACGCTGCGTCCGCGTGTTCTTTTCACCACCTTCGCTTCAGCCCCTTTCACCCACCGATGGCCGCGCGGGGACTACGCAGCGGTTCGAACATTCTCATTTGATGGTGATGCGGTCCTTCTCATGCTGATACGTGCCTTATTAAGCCACCGCCGGGTTTAGCGCTGTTCTGTCACCCGCCGTCTTTCTCAATAACGGTAACAGATTCCGGTCAGCCCAACCGCTGACGAGTGCGCCACCATCCGGCCCTATGATGGTATTTATCATCGTAATGTTAAGCTGCGCACCTATGTAATGTGCTGCGGTCACCGCCAGTTCGCCATAGGGCGTCAGCTCGCTTTTCAGCGGCGCGGCAGGTAAATTCTCCCAGATATTGTTGTTCCGGTGTCGTGCGTCAGCCACCTGAACAGACGGATGCGTTGTCGGCCATATTCAATTTGTAACCCGGCGAGTATCAGGAAAAACTGGACCGGTTCGATCCCGCCACAAAATAAGCTGCTGCCGGGCTTCTTCTGCCGCCCACTCACGCCTGCGTGGTCAGGCTGGCAACCGGAAGCGCCCGGCACCATCCGTCGCCGGTGATTTCGCCACAACTGAATTCACCAGCGGCTTTGCTGATGGAACGTCTGTGCGCCCGAAAGCGGTCCGCAGCCAGTCCATGTACTGTGCAGCGGCAGCAGCACGCAGGCGGCTTTACTCATCGCTTCGGCACCACTTTCCACCAATGAGCAATACGCATTTCGGGACTGTTTATTCTCTTTCAGATGTGATGGACTTAAGCGGAGGTTTCTTAAAACCTGCAGAGTACGGCAACCGGTGACGCCTCCATCGTTCGCCCGCCGCCGCGCACGTACGGTGATAACGGCTGCCATCACGGGAAGCGATTCGCTCGAAATACCGACTGCCGCTGATGCGCGCTGAGTGTGTGTGTTTATCGCTGCTATGGCCGGATATCCGCAGAAGCATTTTCCAGCCCGAAGGCCGAGGCTCCCCGGCGCGGCGTTTTATCGTAACTGCTGTAGGTGCGGAGAAAGTGAACAGCAGCTGGGCCGGAGCAGAACGTCTCGGTTTCGCAGGACCTTGCCGGCGCGGATTCGCCCGGATGTTGGTTCACCGCAGGCACCTAAATTGACCCCACGCCAGGCAGGGGCTGATGTACCCGGCGAACCCCACCGGACCGTGCTATACTGCGTGCTTCTTTGGCGCGCGCCCGCCGGTTTTCACTTCATCCGCCATCGCCGAACATCTCGTTTCTGCTGTGGGCGAAGCCGGAATTTTAAGAAAGCGCAAAGGTAGAGATATCTGTCGAATAGAACAATAATTGGG
>44442ba9-9951-4bac-90ab-2acc8d1c4015
CTGGTAACCGCCCGTTTCAGATTTACGTGTTGCTGCTTGCCTGTCCGCTCTGTCGCTGACGTCTCGCCGGTGTTTAACAACTTCTTCCGTTTGCGCAAGGTAAGTCACTGCAATGGATTATCATAACGGTAGCGGGTGATAATATCGCCGTCAGGGGCGGTTCCTGGTCAGACGGCCCCATTCATCCCATAATTCCCCAGCGTATTTCCAGCCCGTCGGGCCCGGTGGCTGACGTTAACTGGCCTATGGTGAACATAGTAAAAACGCCAGTGCCCTGCCATCCGGCGTGGTGATGCGCGTGAGCAGGGCCAAATCACCACATCGGTTCTTCATTCTGTTGTCCTGCCTGCGGACATCAAGTCATAATGCCCTAAAACCCTGCCCACCGCGTCAAGCTGACTCTGCGTGACACTGCCGTCCGCGATGTTGCTTTTTCACCACCCGCTTGTACCTTTACCTGCGTGTGCGGACTTCACAGCAGTTCGATATCATTGATGGTGATCTGGTCCTTCTCATACTACGTCCCCGTGTAACTTAACCTGCCGGGTTTAGCTTCTTCTGTCGCCGCCGTCGCTGTCGTAACTATTTAACCGTTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCATCCCCGGTATTTATCTCATCGTAAAGTAAAGCTGCACTGTGTATTGCTGGAAGTCATACCGCCGCCAGTTCGCCGCGGACGTCAGCCAAAAGCGCAGCGGCGCGGCAAATTATTCTCCGGGTGTTGGGTCGTGCGTCAACCACACGGCGAACAGACGGATGCGGTATTCGGCCGCCTATTTCGGGCAGCAACCCGGCGGTATAGAAACGGACAGTTCAAATCCCGCCAGAAATAAGCCTGCTGCCGGGCTTCTTTCTGCTTGCTGCCTCGTGGTCAGTACCAGCGGAAGTGACGCCCGGCACCGCATCCGTCACCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCCTGATGGAACGTCTGTGTGCGCCCGAAGCGGAAGTCCGCCAGCCCAGGTCAATTACCCGGGTACGCGGCAGCGGCGCAGGCGACATATCATCCGCTTCCGGCACCCGCTCACCAGCCGAGCGGCCACCACGGCCCCTGCGGACTGTTTTGTCGCCAGATAACGTGCGGACTTAGCGGGTTCTTCCGGCAGCGCCTGCCGGAGTGCGGCCAGCCAGTGACCTTCATCAGATTTCGCCCACGCCGCCGCGCAGCCAGTGACTCGCTGCGGCTGTAACCCAGGTATCACCGGGAAACAGGTGCTCCAAATACAGAGCTTCCTGCCGCCGCATTTATCACTGGTATCAGTGTGTTATCTGCAAGCTGTAGCGGATATCCGCAGGCATTTCCAGCCGGGGCCAGAAGGCTCCCCACCAGCGCAGGCGTTTATCCAGTAACTGCTGCTTAGGTTGCAGGAGAAGAATAGACAGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGACCTTGCCGAGCGGCGGATTGACCAGATGGCCGGACGCGTCACTTGCCAGGGGCACCGAACAGGCCACGCCACGGTGGGGCTTCCGTGCAGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGCTCGCCCTGACGCGCCAGTTCCGTAATCTCATCCTTGTTTCATCCAGTTTATTTGATGCTGCTGACAGGCGAAACCTGATTCCTCGAAAGCCTTAAGTGGATATCTGTCGGATAAGAACAATTAGAGAAGATGTTATACCTCTTTGTAAGATATATGTTTTGGTTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCATGGCGAGTTTTTCAATATTCAAAGCTCAGCAATCAATAAAAATCACCAGTTGCCTTTTCGGCTGAATCCATCCACACCGGTTTTGTCTTGGTTTTCGACCAGACGCGATGCTGGAGTAGCTGTAAAAGCGGGCAGATCTTTCCAGAAAAAACGCTGACAGCGCCAGAACCCGCTGTACATAGTCTGACGTAAAAGATAAAAGCCATGCAGAATATTCTCCTGTAGAGTTCCATACTTTTCTCCCCTTTTTAGTATCTACCCGGTGAATGGCACGGAAAATGATTTGTTTATCTGAGTAGAAAATAGTACCATACTTTGTGGCAATTTTACTGCTCATCCGACCCTTATTTTTTGCTTATTGATGGTTTATTTACATTCATATAACAATTTAGGATTTACTTTTAAAAGTTGATAATACTAAAGGCGCGTGAATTAAAATCCTTGGCTTTTGCCATTTATACTTTTACACCCCGCCCATAAGATTTTTGCGAGAATCTTTGTGGGAATTCACCTTCCGGTATCATGCCAGAGCCCACTGGGGGTGCCGCTGTGAGGTGCGGGCGTGAATGTAGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAGTACTGGAGGCGTTCTGATGGCTGTAAGGGTTCTACTGATCGCCACGTTTTACTGGGTATTAATGGTGCTGCTTGCGTCTTTAGGCGGCGGGCTGGCGCGGCTGATTAATATTATTCCCTCTTCCCGATTACAGCGGGCGTTGAGCGCAATGCTGCATGCCGCCAGGCGTCTGACCGTGAGATGAGCAAACAATCTTGTGCCATTCTCATTTTACCAGTTAATGCTGGAGCTGGCAGTGCGCCTGTTTTTATATTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGGTTGCCAGGGCTGTCATTAAGGGTCTGGCGCTGAATACCGCCGATCAACTTTATCACCAATACCAACTGGCAATCTTATGGCGGTGAAACCGTTGAGCTATTTCAGCCGGAATAAATGGAGCTTAACGGGTGCAAACTTTCTTCCTGCCATAGCGAGATTGCGGTGGTGCCCTCATCATTGCGTTGCCGCCAAACAGAGCACACTCGAAATCACCTGGGTCGATCTTTTCACCACTTATCCCCGTTAATGGGTGCGAACCACCATGGCGTTGTTGATTGCACTGTTTTATTCATGAGTGCGCTGCAGAGCTTTCCTACTTATATCAGGCTGGCGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGACTATGCTTCTCAGGAAGCGATCAGAATGCTCGGTACTAACGGCGCAATGCCAACTCGTACATCCGTTTTGAAAACCAACCACTGACCACTTCGTGCGGATGCTGATCTTCTTGCGATCCCAACGGCGCTTAATGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGAGCTTGCATGTTGCTCGTGGGCGTGTATTGATTTTGTCGTCTCGCGTAAAGGCGTAATTGATGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATCAGGAGAAAGTAAAGGCCGTTTCAAGCGTGCTGGTCAATCGCCTATTTGCAGTCGTGACGACTGGCGGCTTCATAATGGCGCGGTTACCGTCGCCGGTTCGTTTACCGCTCTCAGTACTTTGTGCGTGCCGATATTTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTTAATCGAGTTCTGGTCTTTGGCATGATGCTGTTTGTCCTGCTGGTGGCGGTGTTTGTGCCGGGCTGATAGTTGGTCATTACACCAGGAATATCTGGGTAAAATCGACGAGATGAAACTGGCTGCACTGGCAATTCTGGTTACCCCAAACGCTGTTCTTTAATCGGCGCGAAGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCAGCCCGCATGGTTTTAGCGGTGCTGCCGCTTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGTTAAGCGCCAACTCCGTTCTGGAACTGTTTACTGGCGTTCTGCCGTTTATCGGTCGCTTCGGGGTGATTATCGGTGATGTGATGCCGGTTCGCTGAATTGAGTAAAGAGCCAGAAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTATTGGCTATTCATCCAACACCGTAATTTGCTGGATGGCGCACTGACCTTTATCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCTGATGATATTAGTGAGCACTGAATACTGGGTATAAATGAAGCAACTGGCGCTATTCAGGCCAAACACTTATCGTTCAGGCACCGAAGCGGTGAAAAATTAAGCCCGCAGGCGCAATGGCGCAATCGATGTTATCGTCTGGATCGGCAGTCTGCTGACACCTGTATTAGCATGCGATAAAACGGTGCGATGCCCCATTCATGCGTAATTTTATGCGGTGCCAGTAACGAGTTGGCTGTGGATCACGCATTACTGTTCGCTGAATTTCGCCAGGGCGCTGGCAGAAGGCCGCAGTAAGCGCAGGCCAACAGTCTCGAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCAAAATATGGCTTGCGGCAGACGCAGGTTCCTGCCAGCCAGCTTCGTAAAGGCGATATCATTACTGGTAAACTGGCGGTATTACTCCTGATGGTGAAGTTATTGGAAGAGGTCATCGGTCGATGAAAGCGCCATCACCGAGGGAATCAGCACCGGTGATCCGTGAATCGGCAGCGATTTTGCTTACTCGTCACCGGCGCGCTTTGCGAAATATTCTCTGAAGCTGGCTGGTGATTGGAGTGTAGCGATTAACCCCCGACGAGAGACATTTCTGGATCGGATGATCACCTGATAAATTAAGAAGAGCGCTGGCACAAAACGCCGAACGAACGCCCTGACCATTCCTGCTGATTGCCCTGACCATCGTCTTTTGCTGGCAACCCGCCGCACTGTAACGTTTTCACGTGGGGCGAGTAAAAATGCAGTCAGCGTAACGTACTGAACGGCGCTGCTGGTGTCTGATCCCAGCCACTATTGGCGGCCTGTTGTCGGCGATCCTGGCATCCGCCGGGATGAAACCGGATGCTTTTCGGCACGATATGACCACCACACCAACGGACGCTTCGTTAAACAGCCGACGTGGCGATTCTGCTCACCTGGATCCCGTCGGCGCCATCTACCTCGAACGTCCAGCGTCGATTCTCCCCGCGCAGGGCAGACCGAAAACATGGCTGACGCACAACTAACTTCGCTGGCTGGTGAAACGCCGGAAGGCCGCAGTCATTGTGATCCTCATAAAACGCGTTTTAACCTGCGCGAAGAGCGCAATCATCCTGATCGCTCCATGCATACCGTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGATCCGTAAAGTTTCTGTCGATGCCATTCATCCTCATGTTAGAGTAACGGTGGTCACTTCCCTACCAAATCAGCCCCAGTCAAAAAGTCAATCAAGTTTGCGTGGGAGCCCTTTACCACTTCAGTAGGTGGTGGAAGAGTTCTCGTACTGCGGCGATTGTGCGCTGAAGATATCGTCAAAGGCGAAGGTATTAAAGAAGCGCTGTAGCTGCGCAAAATAGACATTAAAACGGTGATGATTACCGGCGATAACGTCTGACTGCCGCCGCGGTACTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGCGACACCAGGCCAAGCTGGCAATTGATCCGTCGGTATCAGGCGGAAGGTCTGTTTGAAGTAGCGATGACCGGCGGCAGCACCAACGATGCTCCGGCGCTGGCGCAGGCAGATGTCGCGGTGGCGATGAACTCCGGCGCAGGCGGCGAAAGAAGGCCAGGCAATATAGGTCGATCGAGCTCGCCCGACCAAGTTGATCGAGAGTGGGTGCACATTAGCAAACAGATGCTGATAGGCCCGTGGCTCGCTGTTACCACTACAGCAATTTGCCAGCGATATGGCAATAACCGCCATTAGCCCGGCGGCATTTCGCGGCGGCAATCCGCAGTTAAATGCGCTGAACATCGTATTGCCTGCATTCGCCCGACTCGCAATCTCAGTGCGGTGGTTTCGCTGCCGTTATGTCTTTTTGATTCACAGTTAAAGAGGCGTAGAGTTATAACGCTTTACCGCTTCTGCCATGTTGCGCCGTAACTATGGATTTACAGTCATAGGTGGGCTGCTGGTGCGTTTATCGGTATCAAAGTCATTGATTCTGCGGCCGTTTGCACGGTCCTGGTGTGGGGATTTACCATAGGTGGATTACGTCAGCATTATGCTTATTTATCTTTCTATTTATTGATTGCGGCGTTTAACGACTACCGGCTGGGGCAATGGGTGGTTTCCTGGCGGGTAATGGTTCGTTGAGTTCGGTAGAAAAGGTGATACGGTGCGCGGTTTCAGCGTTAATCGGGCGAATTTTGCAAAGCGGCGACTGTTTTTCATAGTCGCCGTCGGCAACGGCAGAAATGCCCTATGATCCACAGCGGGCTTCTGGCGGGAGCAATCTGGCGGTCGTAACTTCAGAGCTGGATAAGCTAACCGCCCGCACGCGTTGCTGCATTTACAGACCGCTAACCCGGATGCGGCGCGAGCGTTCGGATGAACTAAGTGACAGCGTCAAACCGTGGGCTGGATAAATAAATATCACCCTGCGGCGGCGCAACCGGAAATCCCGCAGCTGGCGAAAGCGGCATGTCTCGGCGTTTAAGACAGCTCACGCAACAGTCGCAAAATGCAGCCAACAACCGCTGGTGAAATATATCCCGGCCAGCCGGTTTGTGTATTATTGAACTCAATCTGGCACTGGATAAACTTGATGGAATAACGAACCCTTACGTCCGACCCGTCGTCTGCTGGAACAAACCGCGCCGCCACATCAGAGCTGAAGGATTTTTCTTCGGTTGTAATGCGGGTGATCGGAAGACCTGGGCGATGCTGGCAGAAGCCCAAACGAGCCTACGCAGGCGCAAAGAGAACTGGATATTTGGTGGTTGAAAAAGCATTGGTAAAAGAAACCCGGGCGAAAAATCACCGCCAATGCTGGAAGGGGCTGGCTGTTCGTTAAAGAGCGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCGTGCGCACCTCGCCCGCCGCCCGCTATGATCTTAATAGTTGAACTGGCGCACGATAAATGCGCCGGGTTCCCGTCATCGGAAACGCTGGCAGGATATCAGAAAGAACTGCGGAAGCTAGCGATGATCATTTCACTACCGTCAACGTTCATCTGGAAGGTCACAGATGATGTGGTCAGCGGCGTCACCGAATTCCGGGTACGCGAAGCCGATGCCCGATCCTTTTTCGATACCGCCACGACGACGTGGTGCTGGTGGACTTGCCCCCGGACGATGCTGCGCTGGCGGCTGAAGAAACAAAGATCCTATCATGCCAGAGCAGGCGGAGCGCGCCATTGAACATTTTTTCGCAAAGAAATTAATCCCGTGATCGCCTGCGCAGAACTGGCTTTTCGCCATTGCTGCCGATCCGCATTAATTGAGCAAATGCGCGCCTGGCGAACATCCCCAGCAGAAGAGAGAACATGGCACACACGCGCGGCGCGATCCTTTTATGCATCAGCCCATAACGCAGCGGCAAAACGTTCGGCTGCAACTGCAGCCTGGCAATCACGGCTGGAATAGCGTCAGCGCGCCCGGTGTGTTAAAACTACACCGCGCTTGCCGACGTCGAACATTCTCAAGCACCCGTCTGGCTGGGAACTGAGCGCGGGGCGGCAACACTTTCCTGATCAAGCGGGAAGAAAGCGGTGGTGCGTTATGCCCGTGAACAATCTCGGCAAGATTGGGTTAAACACCCAAAGCAGACGCCGAGAGATGAGCATA
>bec0a1f3-2776-4ace-b372-0a76a9cbed6b
TTGTTGCCTTCGTTCAGTTACGTATTGCTACTTACTTTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTTACTAAACATTAGTTAAATCATGGCTTTGCCATTTATACTTACACCCGCCCATAGATTTTTGCGAAATCTTTGCAGCCAAATTCTACCCTTCGATTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTGCAGGTTATCTGGTTTATGCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAAGGGTTCTTACTGATCGCCACGTTTACTGGTGTTAATGGTGCTGGCGCGTCTTTAGGCAGCGGGCTGGCGCAGCTGATTAATGACATTCCTCTTCGGTACAACGGGCGTTGAAGGCGCGTACTTTTCGCGCACTTGGCGTCTCGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCGGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAATGAATAGCGGGCTTAACGATTTTAAAACTTTCTTTGCCGCCAGCGGGTGCGGTGATTTTGCCCTCATCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGTCTGCTACGCATCGTTATGGTGCCTGAATTCCCTGTGGCGTTGTTGATTGCACTATTTTTGTTCAACAAGGTGCGCTTTACAAAACTTTCTGCCTTATCAGGCTGTGAATACCATTGAAGGCGCAGCAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAGATGCTCAGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTAGAAAACCAACCGCACTGACCAACTTCGCGCAGATCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTCCGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGCTATGTTGCTATTGGGCGATGTCAGTGATTTTTGTCATCTGCGTAGGCGATAATGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAAGGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCATAATGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGGTCTTTACGGCATGATGCTTCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATGGAAACTGGCTGCACTGGCAATTCTACTGGTTACCCCGACGCTGGTGCTGATGGGCGCAGCGTTGGCGATGATGACCGACGCCGGACGTAACTTTCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACCAGCGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGTGATTATCCCGGTGAGTGAAAACGCGATGCCGGTTCGCTGAGTGGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCGCTGCCAACGCAGCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCGGTGGCGGAATATCTCTCGATGATATTGAGTGAGCACTGAATATGGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTCGCCAATTAGCATCGCGATGGCAAAGCGAGTGCGATGCCCGGCGCTTTAATCGCTGTTTAGCGCGGCCATTGCTGATTTGGCTATGGATCACCGTACTGTTCATAATTTCGCCGAGGGCGCTGGCAGAAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGGTAGAAAAAACTGCCTTTGCCCGCAAGCTGCGTGGCCGAAATATGGCGCTGCGGCAGACCAAAGGGATTCCTGCCGACCAACTTCGTAAAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCTGCGATGGTGAAGAGTTATTGAAGAGGTGCATCAGTCGATGAAAGCGCGCCATCACCGGGGGAATCGGCACCGGTGATCCGTGGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGTTTGGTGTGGCATTAACCCCGGCTTGAGACATTTCTGGATCGGATAGTCGCGATGGTGGAAGGCGCACAGCGACGCAAAACACGCCGAACAGAAATTGCCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTTTACTGGCAACCGCCACGCGCAGCCCGAAGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGAGATGAGCGGATGCTGAAGCGCGGAGAAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGCGTTCTGCTACTGGATAAAACCAGCACCATCACACTCGGCCCGGCAATCCGGGCGTCAGGTTTATCCCGCGCAGGGCGTGGATGAAAAACGCTGGCTGACGCCACTGGCTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAACGGCGTTTTAACCTGCGCGAGCGCGATGTGCAATCGCTCCATGCCACCTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCACGCTGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGGGGCTAACGGTGAGTCACTTCCCTACCGATGTTGATCAAAAAGTCGATCAGGTTGCGCGTCAAGGGAGCCGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAGATATCGTCAAGGCGGTATTAAGAGCGCTTCGCCCAGCTACGCAAAATAGACATTAAAACAGGTGATGATTACCGGCACGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGAGTGTCGATGATTTTCTCGCCAAGCGACACCGGAGGCCAAAGCTGGCATTGATCCGTCAGTAGTAGGCGGAAGGTCGTTTTAGTAGCGATGATAAGGCGACGGCACCAGCGATGCTCCGGCGCTGGCGCAGGCGAAGATCGCCTGGTGGCGATGAACTCCGGCACCAGGCGGCGAAAGGGGCGGGTAATATGGTCGATCTCGACTCTGCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAGCATTGCCAACGATGTGGCAATGCTTCGCCATTATTCCACAACGGCATTCAGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCGTTCGCCCGACTCCCGCAATCCTCAGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTTGATTCCCCTGGCGTTAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGCGGGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGGTTTACCATGAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTACCGCTATGACCACCGTACTGGGGCAATGGTGGTTTCCCTGGCAGGCCAATGGTTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCGGGCAGAATTTACCGGCAACGGCCTATTTTCATGGTCGCCGTCGGCTTACAGCAGCGAAATGCCCTATAATCCACAGGCTTCTGGCAGGAGCAATGGCGGTCAGTAACCTTACAGAGCTGGATAAACTAATAGCCGCACGTTGCTGCATTACGGGCCATAACCCGGATGCCAGCGCGAGCGTTCGATTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATATCACCCGCAAGCGGCGGCCTGTAAAATCCCACGCGTGGCGAAAGCGCGTAATCTCGGCGTTGAACATCACGCAACTGATCATAGTAATGTAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTCAACATTGTTGAACTCAATCTGGCGCTGGATAAACTTGATGAAGAACTGGCGTGGCGGCGTATTATTCTTTCTTCATATTAATATAACAACGAATTGCCGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGGAAGCTGAAAGTTTTCTTCGGTGCCTGTGCGGGCGTCGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCGGAGCGCAAAGGGCTGAATATTGGTTGGCGTGGTAGAAACCCACGGGCGAAAGATACCGCCGCCATGCTGCAGGAAGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCCAGCGAGGTTTGATCCTCGATGCCGCCCTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTATTGCGCCAGGTTCCGTCATCCCAAACGCTGGCAGGATATCGAGAAGAACTGCTGGAAGCTGGCATTGATGTTTTTCACTACCCGTCGGCGTTCAGCATCTGGAAAGTCACAGATGATGTGGTCAGCGTCACCGGAATTCAGGTACGGAAGCAAATTGCCCGATCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCGGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTTTCCGCAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTGCGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGGCGTCCTGGCGAAGAGAATTAGCCAGCACACGCGCACGACGCGATCCTTTTATGCATCGGCCATAACACCGGCGGCGAAAACTGAGTTAAACGCAAGCAGACGCCGAAGATAGAGCGACAGGCAAACAATACGTAAGCGAAAA
>56b8515b-fc38-4531-bb1e-757449205298
ATTGCGCTCGACCGCCGTTCAGTTACGTATTTATTTCTGCCTGTCGCTCCTGCTTCGGCGTCTGCTTGGGTGTTAACCTAATCCCGCCGGTCGAATTTGTTGTAGTGGTTCAGGATACTGATAAATTCCATGCCCCTTTCAACCCATCCGGGTCCCTGAGTAATATACCGCCCCTGCAACGGATCGTAGTACCGGTGACGGTTATAGTACAGCCTGATTCCTCATCATGCTGCTGCCCTGGCAGACAATTTTGGCTGATGATACCACACATGATCACGGGTTCTCCCCTCATTCCAGCTGGATTTGCCCCATTCATCATATTCCGCGCTCCACGCCGTATTTGCCGTCTTCGCTGATAAGCGCCAGCGTGATCCCAGTGGTCGCGAGTGATGAATGAGCTTTTCGCGCCGGTGTGTATTCCGGCTCCACCTGTCTGGCCAGTTGCTCCACCGTCAGCCCGCACTGCGCAAGCCGCGCCCGGCTTTCACTGCTCACGCGGTCTGCCCAGTTTCTTCCTCCAGCCTGTCCAGCAGCCGCACCAAGTTCAGCCGGGAACACCACCACGCCGTGGCCGTTCACCACTCCCTTCCTGCTGGAGCGTCTCTGCCAGGCTGCGCCGCTGCGCTTTTCCGCTCGCCGTTCTCTGTCCTGACCCGGATGGTGGCGTGGGCTCCCCGGCTCATGTATACCGTCTGGATACGTGTGGTGTCCGAATCTGCACCGTCGTCAACCTGTCTCCGTCAACCATACCACGTCACCTCCGGTTTACGCGACAGCGGTATCCACCCGTCAGGTCACGCTCCCGCCGCCCAGACCCGTTTGCCATTCGCCGTCCCAGCGGGTCGTGGGAGTAGCGGCTCTCGTCAGTGGCTCGCCATGCTGTATCCGCGTGTAGAACACCAGGCGGTGCTGGCTGTCGTAATTAGTATTGGTGGGTCCGCTCGTCGTCCGTCCGTATCACACCCGCCGGGATGCGGTCCGTCTTCTCCGTCGGCCTGCCGTATTCATCGTGGCGGTAGAACATAGTGCGCATCCTCCGCGATGCGGTTATCAACCACACTGTGAGATATTGCTGTCCGGGTGCAGCTCAGGTCCGGCAGCCGGTTGCCCGCCAGGTCCGTGGCGCTACGGGATGCGGATGTCAGGTCTGGTGCGAGGTGCGCACTCTCCAGCCTGCCCGTGACGCTGTAGCCGTATTCCCGCGTCTGTCGCCCAGACCGCTGATCGCGCACCAGGTCGCCGTTGTCCTCCACCCGTAGTCACGGTCATATACCAGGCTGTTCAGATTACTGGCTCTGTAACTGGCCTGCGGGGGTGTATGTGCTGATCAGTTCGTATGCGGCATTACTGCCGCCTGCCATGCTGCCGAAGCTGTACCATCTCACGGTGCAGCCTGTCCCGCGTATGCTCGACCGGCGGCGTCGCCCAGCTTCATTCCGCCAGGTAACCGCTGCCATACGTCAGCCTCCACCGGCGGCAGGCTGTCCGGCGTGACGCGGTTTTGCAACCCTGCTCGTTGTATGCGTGTTTCGTCTCATGCTGCCACAGCAGTTCCCCGTCTCCGGGTTCTCCACCGTCTGGCATTCTGCGCCAGTCCAGGCGAAACGCTATCGTCGCCGCCATAGTGGACTGGCAACACGGTGGCCTTCGCTCAATTGGCTGATGTCTGTCAGCCAGCCATGTGCATCGCTCGCTGCCACTGCTCTGCTGGTTCGCCGTTCACCGTGCGGTGGTGATACGGTCCGATTCATCCAGTAGTACCAGAGGATGACAAGTCCTCATCCTCACTCTGGTGGTGAGTTTTCCGGTCAGGTCATAATGATAACGTTGCGTCCGCCCGTCAAAGCCGCTGCTGTACCAGCCGGTCCAGCGCATCGTAACTGAAGACGCTGTGGCTGCCGTTCTCGTTGGTCGGGCTGATGACGTCCAGCGGCATCGACGCCATACTGCGCGTCAGCCCGCCCTGCGTGGTGCTGACCGCCTTTCTACGCATCGTACTGTGTCTCGCTCCGGTTGCCGTCAGAATTTGATAACGGCAGTCAGGTCGCCTGCGGCGGTGTATTCATACCGCGTTTCACGGCCCTGTGCGTCTTTCACCGGAGTTAATGGCCACGGTTGTCATAGCGGCAGTAAAGGCTGATGCCTTCCTCGGTGGACCGCCGAATCCGTCTGGCCGAAACGGTCATTATTCATAACGGGTCTGGTAGCCCGAGCAGTCGGTGAACGCCAGCGCTGCCCGTAAGCAGCTCCAGGTCATCTACCGGTGCTGCTTACGTCCGCATCCGTTGTCGTCGCCGGTAACTCACTGTGCGCGTCATCGTAGCGGTAAGCGTACTGTCTCCCCGCTGCGCGATGTCTCCGATACCAGCTGCGGTTAATCATATTCCAGCGGCTCTCCAGCCCGTCCGGGACACCACGCCGTCAGCTGGTTCCGTCGTTATAGTAAATTTCGTCCGCCCGTCGGTGTGGTGATGTCCGTGGTATCGCCGGACGCATTCAGACCATCACTCTGTCCTCCGTCCCGCCGCGTCCGTCTGCGCCCGTGAGCCTTCCTGCCGCGTCATACCCGCTGCGCGTGACGCTGCCGATCCCGCCAGTTCTCTTTTCACCACCGTTTCAGCCCGGCCCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCATTGACGGTGATGCGGTCCTGCTCATAAAGATGGCGGTAAACTAACCCTGCCGGGTTCCAGTTGCTCCACCCGCCCCGTATCGTCGTAGCGGTAGCGCATCTCAGCCCGCGTAACGGTGCGCCACCATCCCAACCCGGGTGCTGCGCGTCATGCGAAGCGCGCACCTGCCGTACTGCGGTCATATACCGCCAGCAGTTCCACCGGCTTCCGTATGCGTGGCACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCATCAGCCACACCGCCGAAGGCGGATACCTAATCGGGGCCGTATTCGGTACCGGGCGGTGTCGGGGAACGCTGAGGTTGAGAGAGGGCGGAACTGTCAGAAGAAGATAGCCGAGGTGCAGGCCTCTTCCGCACGCTGCGCCTGCGTGGTCAGCACCAGACCGGAACTCCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCTGGCAGGTCACGGCGACTCACGCCGGTACGATAAGCGTCCGCCCGAAGCGGTCCGCCATCCCAGTAAGCGCAGTACGGCGGCAGCGGCGCTGGCAGTACGATATCAGCACCCGGCACCCGCTCAGACCACCCCGGTATCACCACGGCCCCTGTGCGCTGTTGGTCGCCGGGTAAGATGCGGAACCGGATATCCGGCAGCGCCCACAACCGCGCCAGCGTATGGCCAATCCGGCTGTATGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCGCCTCCCGGCAACAGCGGCTCAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTGGCGGATATCGAAAGGCGCTTTCCAGCCGGGGCCGAAAACGCCCACCAGTGCAGGCGTCTTCGTCAGTGGCGCTGCTGTAGGTGCGGGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAGTCCAGTCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCCGGTTACCAGGTTGCTTGAAGTCATCCCGCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCCAGATCTTGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCCTGACGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTTAGTTGTTCATATCCTGTGTTAGCAACAAAAAAAAATAAAATGACACACAAGACCAGCTAATGTGTTTATATATTTTCACATAAACTTATTTGTTCTCAATCAGCAACAGCTTCATTGGCCACAGGTCACTCAATATTTTATTCGAAGCTAACATTTTTTAGCACAGATGAATTCATCATCCAACAAATTCACTATGGATAATATCCATTCAACGCATATGATTTGTGATTTTTATTGAAGGTCTGAGTTATTTTTGTGAATATATTTAAAATCAATAAACTCCACGATTCAGATTAATATCAGCAATGAAGATGAAAATCACCAATTCAATAACATCATCAATAGAAACTTATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCCTTATTTACTCATCACCCCACCGACTGCTTACGAACAGCGCCTTACCGTAACAATCGCGCATGGCCAGCCGCCGAAAGCGACAGCAGCAGCGCTCGCTGCACGGCAATTTCAATCCACAATCATGGTCTTAAACCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGAAACAAACCAAGCATGGCAGACTCACACCGCAACGTGGTACTTGCGGCGTTTTTCCCCGCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGTGCCAGCAGCAGCAACATACCGCCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGCACCCTGACCATTTTCGTTTTAAAATCCTTAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTGGTAAAGCCAGCTCTGCGGTTGCCGATCTAATGCCTTCAGGAAAATAAAATAGAAATTAGGCCGCAGACTTTTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCTATTATCTTCCCGTCGGCTTCTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCCGGGCCGCGTATTTTGCCAGGTAGATTGAGTTCGCGGTTAAAGCGCCTCATCTTCATTACCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCCACCACCACCGGATAAAGAAACGATTCCGGGATTCATCCTGAGTGTTCGCGAGGAACGCTTTTAGCAGTGCTACTGTTCTGTGGCGATGTGGGTAAAAAGTAGTTCGGGCTTTCTGGGTAGCTGCTGCTGCCAGCCGGTCGAGCAGACGCCACGCAACACCAGCAGCGTAGTGCCAGCGGCACAAAGGAGAGCAGCAAAATGCCGAAAGCTGACAACGTTATTACGGCTGACGCCAACAGGCAGTAACCGCCAGGCGAGGCAACGATTTCAGCGTCATGCGGCAGAGAATGCATTCAGCATCCAGCCAGCACACCGCCAGCCAGTACTTGCCGCGCGCCCGCCAGCACCGCCCAGCAGCATGCCTTACCCATTAATCCGGCGAGCAGCAGCACATTCACCACTGACAATCGGCAGATAAAACTTCAAGCGGCCGGACGTTTCGCTACCACATCATTACGTAATGCGCGCTAAAGGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCCACCGGCGAGATGACCGTCATGGTGCCAAGCCACAAGCGCGGCCAGAGGCTGGCTGGCGGTAGTGCGAAAGCAGAGGTTGGCTTTAAACAGACGCCGAAGATGGGAACGCA
>4b09492e-1e14-4c2a-9719-4cd4f1434703
TTGTTGTAGCGTTCAGTTACGTATTATTGCTCTGTTGGTGCTGATATTGCGGCGTCTGCTTGGGTGTAACCTGCTTCTTTCACGGCAATTAACTGTCACGGCTGTCGTATGCGCAGGTACTGACTCGCTTCTCGCGGTACTGCGCCGTCACCTGACCAAAACGGTCATGATGCATGGCAGGTTATAACTGGAACAGTCAGTGAAGCTCAACAGCAATACCTTAACGGCTCCACGTCATAGCTGGTTTTCCGGCTGCCAGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCACCAACGGTAGCGGGTGATATCGCCGTCAGGGGCGGTTTCCTGAATCGAACGGCCCCCATTCATCATATTCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTTATAATCGCCGCGATGCCCTGCCATCCGGCGCGTGGTGATGCGCGTGATGAGGCCCGTCACACATCGGACTCGCATTCTGTTATCTGCCTGCGGCATCCGTCTGTGTGCCTGTTTACCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCACGCTGTGTTCCTTTTTCACCGCCCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTACGGCAGTTTCAAGGCTGTCGGTGATGGTGATGCGGTCCTTCATACTGATACGTGTAACTTAAGCCTGCAGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTACGCCACCATCCGGCCCCAGTATTTTATCATCGTAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACGCCGCCGGTTCGCCGCAGAGGCGTCAGCCATAGCGCACCAGCGGCGCGACAGGTAAATTCTCCGGGTATTTGTTGTTATTCGGGTCGTGCGTCAGCCACGGCAGACAGACGGATGCCGTTGTCGGCCATATTCAGTGTAACCCGGCAGGGTATCGGGAAAAGCGGACGGTTCCGTCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCGAACAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCTGGCGGCTTCGCGGTGGAACGTCTGTAATGCGCCAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCGGCACCTCATCGCTTCCGGCACCGCTCACGCAGCCGAGCAGCCACCACGGCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGGTTCTTCCGGCAGCGCCTAGCAGAAGTGCGGCCAGCCGGTGACCTTCATCAGTTTCGCCACGCCGCGCGCATAATACAGTGACTCGCTGCGGCAACCGTCCTCACCGGAAACAGGTGCTCAAATGCAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCCTTGCAACTGTAAGCGGATATCCGCAGGCATTTCCAGCCGGGGCTGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAAAGACGGCAGCAGGCCGGGGCAGGGGGCGTCAGTTTCACCAGGAAGGACCTTTACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCGGGGCACCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTGCCGCCATACCGTCATGTCGCCCTGACGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAACTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCCTTGAATATATGTTTCGATTGGTATAACGATGTCACAAATATTCCTCTGAACATCTTCCTGTTAAAAAACCGCCAGCGTTTCCCGCTGGCGGTTTCAATAATATTCAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCGCACCGGTTTATCATGGTTTCGATGGAGCGCGATGCAAGGTAGCTGTAAAGCGGGCGCGGTCTTTCCAGAAAAGCATAAGAAAAGAGCCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACAGCGTAAAGATAAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTATCTACCCGATTATGAATGGCACCGGAAAAATGAATTGTTTATCTGATGAAAATAGTACCGCCAGCACGTAGTTTTACTACTCATCCGACCACTTATTTTGCTTATTGATGGTTTATTTACATTCATCCGCAATTAAGTTACACAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTACACCCCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAGGTCTACCTTCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCATTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTGTAACCTGATCCAAATGCGGAGCGTTCTGATGGCTGCGCAAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTATGGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCAGCTGATTAATGACATTCCCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTTCCTTTGCCCAGCGTCTCTGACCGTGAGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTATCAGTCAGCACTATCTGCCGCCAATCCACAGCAGTTGCCAGGGCTGTCATTGGGATCTGGCGCTGAATACCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGACTTCTTCAGCCAGATGGCGGGCTTAACGGTGCAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCTCATCCGTGCAGTTTACCCGCCAGGTATGAGCACGCTCAAGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGATTGCTAGTCCTGTGGCGTTGTTGATTGCGCTGTTTTTATTCAGCAAGGTGCGCTGCAAACTTTCTGCCTTATCGGGCTGTGAATACCGTTGAAGAGGCGCAACAGCTGTTACCATGGGGCCTGCTGCTTCTCAGGAAGCAGTCAAGATGCTCAGTACTAGCGAAGGCGGTGGCCTAACAATGCCAGCTCAAAATCGCATCCGTTTGAAAACAACCGCGCGGCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGGTAATACTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCGAGAGCATGTTGCTTATGTGGGCGATGTCGGTAATTTTTTGTGTCATCTCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACGCTTGTATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAACCTGTTTGCGGTCGACGGCTGACGGCTTCCTGTGTTGCAGTGATTACGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCTAAATTGGTGGTGGTAATTTCGGCGGTGTCGGTTCTGGTCTTTGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTTGTGCCGGGCTGATGATTGGGGTCGTACACCGGAATATCTGGGTAAAAAAATCGACGTACGCGAGATGAAGCTGACTGCGCACAGCAGTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGTGATATTGACCGACGCCGGACGTAGCGCCATGCTCAACCCCTGGCCCGCATGGTTTTAGCGAAGTGCTGCTACGCCATGTCATCACCGCCGCTAACAACAACGGCAGCGCCTTTGCCAGTTCGCGCCAACTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTTGTCGGTCCTTCGGGGTGATTATCCCGGTGATGGCAGTGCCGGTTCGCTGGTGATAAAAAGAGCCAAACCGCCAGCTCGGCACGCTGCCAGCACACGGCCCGCTGTTTGTTGGCCTGTTAATCGCTGCTGTGTTGCTGGTTGGCACTGAAGCCTTTATCTGCTGGCGGTCAGTGGCGGGAATATCTCTCCTGATGATGTTGGTGAGCACTGGATATGAGTCGTAAACAAACTTCCGGCTATTCAAGACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAAAGCAGGTGCGATGCCCGGCAATGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGGATCACCGTACTGTTCCTTCAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAGCCTGGGTAACAGTCTGAAGGTGAAAAAACTGCGCTTTGCCCACCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCAGACCAAAGTTCCTGCGACCAACTTCGTAAAGGCGATATCATGCTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGAAATTGCATCGGTCGATAAACTATGCATCACTGCGAGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGTTTTGCCTCGATCACCGGCGGCGCATATTCTTTCTGACTGGCTGGTGATTGGGTGTAGCGTTAACTTGGCAGACATTTCTGGATCGGATGATCGCGATGGTGGAAAGGCGCACAGCGGCGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTGATTGCCCTGACTATCGTCACTGCTGGCAACCGCCGCACGCTGTAACCGTTTTCGCGTAGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAAAAGCCACTATTGGCGGCCTGTTGTCAGCAGTCGTCGCCGGGATGAGCCGGATGCTAGGCGCCGAATGTGATTGCCACCAGCGGACGATGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCAGCACCATCACACTCGGTAACCGTCAGGCGTCGAGTTTATCCCACGCAGAGGGCGTGGATGAAAAAACGCTGGCTGACGCCGCTGGCAGCTTCGCTGGCTGATGAAACGCGGAAGGCCGCAGTATTGATCCTCGCCAAGCAGCGTTTTAACCTGCGCGAGCGCGATGTGCAGTCATCATGCCACCCTTTGTACCGTTTGCAAGCCGGATGAAGCCAGGATCAGCATCGACAACCGCAGGTTAAACACCCAAGCAGACGCCGAAGATGGGGAAACCGTA