changeset 3:5732f959936a draft default tip

"planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/canu commit 7000c7eb839b77a0e7e91874048219bd3a3f5d47"
author bgruening
date Mon, 15 Feb 2021 12:31:26 +0000
parents c5b7390290b1
children
files canu.xml test-data/ecoli_canu_contigs_result1.fa test-data/ecoli_canu_contigs_result2.fa test-data/ecoli_canu_corrected_reads_result1.fa.gz test-data/ecoli_canu_corrected_reads_result2.fa.gz test-data/ecoli_canu_corrected_reads_result3.fa.gz test-data/ecoli_canu_trimmed_reads_result1.fa.gz test-data/ecoli_canu_trimmed_reads_result2.fa.gz test-data/ecoli_canu_trimmed_reads_result4.fa.gz test-data/ecoli_canu_unassembled_result1.fa test-data/ecoli_canu_unassembled_result2.fa test-data/ecoli_canu_unitigs_result1.fa test-data/ecoli_canu_unitigs_result2.fa
diffstat 13 files changed, 884 insertions(+), 2611 deletions(-) [+]
line wrap: on
line diff
--- a/canu.xml	Sun May 26 10:52:09 2019 -0400
+++ b/canu.xml	Mon Feb 15 12:31:26 2021 +0000
@@ -1,7 +1,14 @@
-<tool id="canu" name="Canu assembler" version="1.8">
-    <description>Assembler optimized for long error-prone reads such as PacBio, Oxford Nanopore </description>
+<tool id="canu" name="Canu assembler" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@">
+    <description>Assembler optimized for long error-prone reads such as PacBio, Oxford Nanopore</description>
+    <xrefs>
+        <xref type="bio.tools">canu</xref>
+    </xrefs>
+    <macros>
+        <token name="@TOOL_VERSION@">2.1.1</token>
+        <token name="@VERSION_SUFFIX@">0</token>
+    </macros>
     <requirements>
-        <requirement type="package" version="1.8">canu</requirement>
+        <requirement type="package" version="@TOOL_VERSION@">canu</requirement>
     </requirements>
     <version_command>canu --version</version_command>
     <command detect_errors="exit_code">
@@ -19,11 +26,10 @@
             $stage
         #end if
         -p canu
-        -d out_dir
+        -d ./out_dir
         #if $s:
             -s '$s'
         #end if
-        genomeSize=$genomeSize
         #if $rawErrorRate:
             rawErrorRate=$rawErrorRate
         #end if
@@ -33,6 +39,12 @@
         minReadLength=$minReadLength
         minOverlapLength=$minOverlapLength
         corOutCoverage=$corOutCoverage
+        #if $stopOnLowCoverage
+            stopOnLowCoverage=$stopOnLowCoverage
+        #end if
+        #if $minInputCoverage
+            minInputCoverage=$minInputCoverage
+        #end if
         contigFilter='
             ${contigFilter.minReads}
             ${contigFilter.minLength}
@@ -40,9 +52,12 @@
             ${contigFilter.lowCovSpan}
             ${contigFilter.lowCovDepth}
         '
-        genomeSize=$genomeSize
+
+        genomeSize='$genomeSize'
         minThreads=\${GALAXY_SLOTS:-4}
         maxThreads=\${GALAXY_SLOTS:-4}
+        redMemory=\${GALAXY_MEMORY_MB:-4096}M
+        redThreads=\${GALAXY_SLOTS:-4}
         obtovlThreads=\${GALAXY_SLOTS:-4}
         utgovlThreads=\${GALAXY_SLOTS:-4}
         batThreads=\${GALAXY_SLOTS:-4}
@@ -50,11 +65,23 @@
         cormhapMemory=\${GALAXY_MEMORY_MB:-4096}M
         obtovlMemory=\${GALAXY_MEMORY_MB:-4096}M
         utgovlMemory=\${GALAXY_MEMORY_MB:-4096}M
-        gfaThreads=\${GALAXY_SLOTS:-4}
         corThreads=\${GALAXY_SLOTS:-4}
+        corMemory=\${GALAXY_MEMORY_MB:-4096}M
         cnsThreads=\${GALAXY_SLOTS:-4}
+        cnsMemory=\${GALAXY_MEMORY_MB:-4096}M
+        oeaMemory=\${GALAXY_MEMORY_MB:-4096}M
+        oeaThreads=\${GALAXY_SLOTS:-4}
         useGrid=false
-        $mode
+
+        #for $haplotype in $haplotypes:
+            -haplotype${haplotype.haplotype_name} '${haplotype.haplotype_input}'
+        #end for
+
+        $technology
+        #if $processing:
+            $processing
+        #end if
+
         #for $counter, $input in enumerate($inputs):
             #if $input.ext in ['fastq.gz', 'fasta.gz']
                 ./input_${counter}.gz
@@ -63,57 +90,60 @@
             #end if
         #end for
         2>&1
-        &&  
-        echo "Check echo"
+
     ]]>
     </command>
     <inputs>
-        <param name="inputs" type="data" format="fasta,fasta.gz,fastq,fastq.gz" multiple="true" label="Input reads" />
-        <param name="mode" type="select" label="Mode">
-            <option value="-nanopore-raw" selected="true">Nanopore raw</option>
-            <option value="-nanopore-corrected">Nanopore corrected</option>
-            <option value="-pacbio-raw">PacBio raw</option>
-            <option value="-pacbio-corrected">PacBio corrected</option>
+        <param name="inputs" type="data" format="fasta,fasta.gz,fastq,fastq.gz" multiple="true" label="Input reads"/>
+        <repeat name="haplotypes" min="0" max="2" title="Haplotypes for Trio Binning Assembly" help="Canu has support for using parental short-read sequencing to classify and bin">
+            <param name="haplotype_input" type="data" format="fasta,fastq" multiple="true" label="Haplotype input reads"/>
+            <param name="haplotype_name" type="text" label="Shot name to identify your haplotype"/>
+        </repeat>
+        <param name="technology" type="select" label="Technology">
+            <option value="-nanopore" selected="true">Nanopore</option>
+            <option value="-pacbio">PacBio</option>
+            <option value="-pacbio-hifi">PacBio HiFi</option>
+        </param>
+        <param name="processing" type="select" optional="true" label="Processing">
+            <option value="-corrected">Corrected</option>
+            <option value="-trimmed">Trimmed</option>
         </param>
         <param name="stage" type="select" label="To restrict canu to only a specific stage, use">
             <option value="all" selected="true">all</option>
+            <option value="-haplotype">generate haplotype-specific reads</option>
             <option value="-correct">generate corrected reads</option>
             <option value="-trim">generate trimmed reads</option>
             <option value="-assemble">generate an assembly</option>
             <option value="-trim-assemble">generate trimmed reads and then assemble them</option>
         </param>
-        <param argument="genomeSize" type="text" label="Estimated genome size (e.g. 80m, 15k, 2g)">
-            <validator type="empty_field" />
+        <param argument="genomeSize" type="text" label="Estimated genome size (e.g. 8.0m, 15k, 2g)">
+            <validator type="empty_field"/>
+            <validator type="expression" message="Only values similar to 8.0m, 15k or 2g are allowed.">value.replace('.', '').isalnum() and value[-1] in ['m', 'k', 'g'] and float(value[:-1])</validator>
         </param>
-        <param argument="rawErrorRate" type="float" value="" optional="true" min="0" max="1"
-            label="Maximum raw overlap mismatch" help="The defaults are 0.300 for PacBio reads and 0.500 for Nanopore reads." />
-        <param argument="correctedErrorRate" type="float" value="" optional="true" min="0" max="1"
-            label="Maximum corrected overlap mismatch" help="The allowed difference in an overlap between two corrected reads.  Assemblies of
-                low coverage or data with biological differences will benefit from a slight increase
-                in this.  Defaults are 0.045 for PacBio reads and 0.144 for Nanopore reads." />
-        <param argument="minReadLength" type="integer" value="1000" min="1" label="Minimum read length" />
-        <param argument="minOverlapLength" type="integer" value="500" min="1" label="Minimum overlap" />
-        <param argument="corOutCoverage" type="integer" value="40" min="1" label="Target coverage for corrected reads" />
-        <param argument="-s" type="data" format="txt" optional="true" label="Additonal options" help="Additional specifications provided in a canu spec file." />
-
+        <param argument="rawErrorRate" type="float" value="" optional="true" min="0" max="1" label="Maximum raw overlap mismatch" help="The defaults are 0.300 for PacBio reads and 0.500 for Nanopore reads."/>
+        <param argument="correctedErrorRate" type="float" value="" optional="true" min="0" max="1" label="Maximum corrected overlap mismatch" help="The allowed difference in an overlap between two corrected reads.  Assemblies of                 low coverage or data with biological differences will benefit from a slight increase                 in this.  Defaults are 0.045 for PacBio reads and 0.144 for Nanopore reads."/>
+        <param argument="minReadLength" type="integer" value="1000" min="1" label="Minimum read length"/>
+        <param argument="minOverlapLength" type="integer" value="500" min="1" label="Minimum overlap"/>
+        <param argument="minInputCoverage" type="integer" value="" min="1" optional="true" label="Minimum Input Coverage"/>
+        <param argument="corOutCoverage" type="integer" value="40" min="1" label="Target coverage for corrected reads"/>
+        <param argument="-s" type="data" format="txt" optional="true" label="Additonal options" help="Additional specifications provided in a canu spec file."/>
+        <param argument="stopOnLowCoverage" type="integer" value="10" min="1" label="Stop the assembly if read coverage is too low to be useful" help="Coverage is checked whene when input sequences are initially loaded into the sequence store, when corrected reads are generated, and when read ends are trimmed off."/>
         <section name="contigFilter" title="Contig Filters">
-            <param argument="minReads" type="integer" value="2" min="0" label="Minimum reads" />
-            <param argument="minLength" type="integer" value="0" min="0" label="Minimum length" />
-            <param argument="singleReadSpan" type="float" value="1.0" min="0.0" max="1.0" label="Maximum single read span (fraction)" />
-            <param argument="lowCovSpan" type="float" value="0.5" min="0.0" max="1.0" label="Low coverage span (fraction)" />
-            <param argument="lowCovDepth" type="integer" value="5" min="0" label="Low coverage depth" />
+            <param argument="minReads" type="integer" value="2" min="0" label="Minimum reads"/>
+            <param argument="minLength" type="integer" value="0" min="0" label="Minimum length"/>
+            <param argument="singleReadSpan" type="float" value="1.0" min="0.0" max="1.0" label="Maximum single read span (fraction)"/>
+            <param argument="lowCovSpan" type="float" value="0.5" min="0.0" max="1.0" label="Low coverage span (fraction)"/>
+            <param argument="lowCovDepth" type="integer" value="5" min="0" label="Low coverage depth"/>
         </section>
     </inputs>
     <outputs>
+        <data name="report" format="txt" from_work_dir="out_dir/canu.report" label="${tool.name} on ${on_string} (report)"/>
         <data name="contigs" format="fasta" from_work_dir="out_dir/canu.contigs.fasta" label="${tool.name} on ${on_string} (contigs)">
             <filter>stage == 'all'</filter>
         </data>
         <data name="unassembled" format="fasta" from_work_dir="out_dir/canu.unassembled.fasta" label="${tool.name} on ${on_string} (unassembled)">
             <filter>stage == 'all'</filter>
         </data>
-        <data name="unitigs" format="fasta" from_work_dir="out_dir/canu.unitigs.fasta" label="${tool.name} on ${on_string} (unitigs)">
-            <filter>stage == 'all'</filter>
-        </data>
         <data name="corrected_reads" format="fasta.gz" from_work_dir="out_dir/canu.correctedReads.fasta.gz" label="${tool.name} on ${on_string} (corrected reads)">
             <filter>'-correct' in stage or stage == 'all'</filter>
         </data>
@@ -121,45 +151,100 @@
             <filter>'-trim' in stage or stage == 'all'</filter>
         </data>
     </outputs>
-     <tests>
-       <test expect_num_outputs="5">
+    <tests>
+        <test expect_num_outputs="5">
             <param name="inputs" ftype="fasta" value="ecoli-reads.fasta"/>
-            <param name="genomeSize" value="4.6m" />
-            <param name="minReadLength" value="2000" />
+            <param name="technology" value="-nanopore"/>
+            <param name="genomeSize" value="20k"/>
+            <param name="stopOnLowCoverage" value="1"/>
+            <param name="minInputCoverage" value="1"/>
+            <param name="minReadLength" value="2000"/>
             <output name="contigs" ftype="fasta" file="ecoli_canu_contigs_result1.fa"/>
-            <output name="unitigs" ftype="fasta" file="ecoli_canu_unitigs_result1.fa"/>
             <output name="unassembled" ftype="fasta" file="ecoli_canu_unassembled_result1.fa"/>
             <output name="corrected_reads" ftype="fasta.gz" decompress="True" file="ecoli_canu_corrected_reads_result1.fa.gz"/>
             <output name="trimmed_reads" ftype="fasta.gz" decompress="True" file="ecoli_canu_trimmed_reads_result1.fa.gz"/>
+            <output name="report">
+                <assert_contents>
+                    <has_n_lines n="488"/>
+                    <has_text_matching expression="[UNITIGGING/CONTIGS]"/>
+                    <has_text_matching expression="-- Contig sizes based on genome size 20kbp:"/>
+                </assert_contents>
+            </output>
         </test>
         <test expect_num_outputs="5">
             <param name="inputs" ftype="fasta" value="ecoli-reads.fasta"/>
-            <param name="genomeSize" value="4.6m" />
-            <param name="minReadLength" value="2000" />
-            <param name="minOverlapLength" value="800" />
-            <param name="rawErrorRate" value="0.2" />
-            <param name="correctedErrorRate" value="0.05" />
-            <param name="corOutCoverage" value="2" />
+            <param name="technology" value="-nanopore"/>
+            <param name="genomeSize" value="20k"/>
+            <param name="stopOnLowCoverage" value="1"/>
+            <param name="minInputCoverage" value="1"/>
+            <param name="minReadLength" value="2000"/>
+            <param name="minOverlapLength" value="800"/>
+            <param name="rawErrorRate" value="0.2"/>
+            <param name="correctedErrorRate" value="0.05"/>
+            <param name="corOutCoverage" value="2"/>
             <output name="contigs" ftype="fasta" file="ecoli_canu_contigs_result2.fa"/>
-            <output name="unitigs" ftype="fasta" file="ecoli_canu_unitigs_result2.fa"/>
             <output name="unassembled" ftype="fasta" file="ecoli_canu_unassembled_result2.fa"/>
             <output name="corrected_reads" ftype="fasta.gz" decompress="True" file="ecoli_canu_corrected_reads_result2.fa.gz"/>
             <output name="trimmed_reads" ftype="fasta.gz" decompress="True" file="ecoli_canu_trimmed_reads_result2.fa.gz"/>
+            <output name="report">
+                <assert_contents>
+                    <has_n_lines n="464"/>
+                    <has_text_matching expression="[UNITIGGING/CONTIGS]"/>
+                    <has_text_matching expression="-- Contig sizes based on genome size 20kbp:"/>
+                </assert_contents>
+            </output>
         </test>
-        <test expect_num_outputs="1">
+        <test expect_num_outputs="2">
             <param name="inputs" ftype="fasta" value="ecoli-reads.fasta"/>
+            <param name="technology" value="-nanopore"/>
+            <param name="genomeSize" value="20k"/>
             <param name="stage" value="-correct"/>
-            <param name="minReadLength" value="2500" />
-            <param name="genomeSize" value="4.6m" />
+            <param name="stopOnLowCoverage" value="1"/>
+            <param name="minReadLength" value="2500"/>
             <output name="corrected_reads" ftype="fasta.gz" decompress="True" file="ecoli_canu_corrected_reads_result3.fa.gz"/>
-        </test> 
-        <test expect_num_outputs="1">
+            <output name="report">
+                <assert_contents>
+                    <has_n_lines n="187"/>
+                    <has_text_matching expression="[TRIMMING/READS]"/>
+                    <has_text_matching expression="--   Found 89 reads."/>
+                </assert_contents>
+            </output>
+        </test>
+        <!--trimming test - it does currently not trim anything due to the input data -->
+        <test expect_num_outputs="2">
             <param name="inputs" ftype="fasta" value="ecoli-reads.fasta"/>
+            <param name="technology" value="-nanopore"/>
+            <param name="genomeSize" value="3.4m"/>
             <param name="stage" value="-trim"/>
-            <param name="minReadLength" value="2500" />
-            <param name="genomeSize" value="4.6m" />
-            <output name="trimmed_reads" ftype="fasta.gz" compare="sim_size" delta="12000" file="ecoli_canu_trimmed_reads_result4.fa.gz"/>
-        </test>  
+            <param name="minReadLength" value="500"/>
+            <output name="report">
+                <assert_contents>
+                    <has_text_matching expression="[TRIMMING/READS]"/>
+                    <has_n_lines n="6"/>
+                    <has_text_matching expression="Found 0 reads."/>
+                </assert_contents>
+            </output>
+        </test>
+        <!--test expect_num_outputs="5">
+            <param name="inputs" ftype="fasta" value="ecoli-reads.fasta"/>
+            <param name="technology" value="-pacbio"/>
+            <repeat name="haplotypes">
+                <param name="haplotype_name" value="K12"/>
+                <param name="haplotype_input" ftype="fasta" value="ecoli-reads.fasta"/>
+            </repeat>
+            <repeat name="haplotypes">
+                <param name="haplotype_name" value="K13"/>
+                <param name="haplotype_input" ftype="fasta" value="ecoli-reads.fasta"/>
+            </repeat>
+            <param name="genomeSize" value="20k"/>
+            <param name="stopOnLowCoverage" value="1"/>
+            <param name="minInputCoverage" value="1"/>
+            <param name="minReadLength" value="2000"/>
+            <output name="contigs" ftype="fasta" file="ecoli_canu_contigs_result5.fa"/>
+            <output name="unassembled" ftype="fasta" file="ecoli_canu_unassembled_result5.fa"/>
+            <output name="corrected_reads" ftype="fasta.gz" decompress="True" file="ecoli_canu_corrected_reads_result5.fa.gz"/>
+            <output name="trimmed_reads" ftype="fasta.gz" decompress="True" file="ecoli_canu_trimmed_reads_result5.fa.gz"/>
+        </test-->
     </tests>
     <help>
     <![CDATA[
--- a/test-data/ecoli_canu_contigs_result1.fa	Sun May 26 10:52:09 2019 -0400
+++ b/test-data/ecoli_canu_contigs_result1.fa	Mon Feb 15 12:31:26 2021 +0000
@@ -1,162 +1,215 @@
->tig00000001 len=16089 reads=72 covStat=-49.03 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-GGTTGAACCGTGAAGGTGATCAATAAAAATGATCAATCTTAATTTATTTAATGATGAGCTTTTTACTCAGTAATATAAAATATTGAATTGTTATTTTGTG
-TGTTGTTTTAAGATAAAAGCCGCTTTATTAATACGGCTTTAATTAATAAAAAGGCAGGCTGTATTAAAATTAATATTCAAAGCATAAACCGATGCCAATA
-CCGGTTTCAGTAATGAAATGGCGTGGGCGGGCGGGATCCTGTTCCAGTTTTTGTCGCAGATGTCCCATATAAATACGCAAATGGTGACTGTGTTCGACCG
-CGTTTGGCCCCCACCTGGTTAAGGAGCTGGCGCTGGGTGAGTACTTTCCGGCATTGTTGAGCAGCACCGCCAGCAGGCGGAACTCAATTGGTGTGAGATG
-CACCTCTTCTCACCCCGGTGAATCACGCGGGCGGCTAAATCGACGGTAACATCGGAAAATTTTACCAGCGGATCGGGCGCGGTGGTGGCAGAGTGGCGGC
-GTAATGCGACGCGCAGACGGGCCTGCAATTCGCCAATGCCAAACGGCTTACTCAGATAATCATCCGCTCCGGCATCCAGCGCGGCGATTTTGTCGCTCTT
-CTGCTGCGTGCGGAAAGCACAATCACCGGCACCGCGCTCCACTGGCGCAGGTCGCGGATAAACTCAATCCCATCACCATCGGGCAGGCCGAGATCGAGAA
-TAATCAAATCTGGCTTACGGGTTGCCGCTTCCAGCAAGCCGCGTTGCAGCGTTTCGGCCTCAAAGACGCGCATCCGTCGCCCTCCAGCGCCGTGCGCAGA
-AAGCGACGAATAGCCTGTTCATCTTCAACAATCAGAACGTTTGTCACATATCCTCATGAAATTCTTCAGTTCAGGGGCAGTTTGCTGGGGAAGTGTAACA
-CGAAAACAGGCACCACCTTCCGGTCGGTTGAACGCGGTAATAGTGCCCCCGTGTACATCCACTATCGCCCGACAAATTGCCAGTCCAAGCCCTACCCCCG
-TACTGCCGACTCTTTTATTCCCGCGAGCAAACTTATCAAATATCGTCTGCTCCTGGCCTGGCGGAAGACCGGGGCCGTTATCCCAGACATCCAGTTGTAG
-ATTTTCGCCCTCAACGTGGGCATCGATACCAATTTCGGCCTGCGCACCCGCATATTTCACCGCGTTCTCCAGCAGATTAATCAGCACCCGTTCAAAGAGA
-GGCCCGTCAACGTGGATTAAGGTCAGCGGTTCTGGCAGAGAAAGATTGATGGGCGACGATAAACCCGGTTCCAGCATTTGCAGCGCTGCCGACTACTTCT
-TCCAGCGTTAACCACTCTTTCTTCAAATTAAAGCCGCCGGACTGAATTCGCGCCATATCCAGTAGATTATTCACCAGTCGGGTAGTGTTCAGCATGCTGA
-CGGATCTCGCTGGCCTGGCGGGCGTGGGTGATCCTCGCTTGCCAGATCGAGCGTTAAGATTTCTGCCTGACCAAACAGCACCGTAAGCGGCGTGCGTAAA
-TCATGCGAAAGCGCCGCCAGCAGGGCGTTGCGGATCTGTTCACGTTCGCTTGCCATCCGCGCCTGTTCTTCGCTGGCGGTTAGCGTCAGCCGCTCAGGGC
-ATTGGCGACTAACAGCGTAACGTCTCCAGCAGGCGCTGCTGTTCCGGGATCATCAACTGGCGCAGATTCCCGGCTCCACCACCACCAGCCCGTAGGTTTT
-CGCCGCTTTTAGCGGCAAAATCTGGTACGGTACACCGGGTAACGTGTCGGTGCCCGCGCCCGCAGGCAGGCCTTTATCAAAACTCCACTGCGCGATGGCA
-TCGTCCCACGGCGTCATTCCTTGCGGATGTGTTAACGGCTGCAATTTACCGTTGTCATCGGGCAACAACACCTGACTGCGGGCATGAAACGTGGAGGCAA
-TAAATTGTTCGCTGGTGGCAGCGATATCCTGCGGACTGCGGCCCACCGCCAGAGCTTTCGACATTTCATATAAGTGCCGTGTGCGTTGCTCGCGGTAACG
-GGCTACCCGCGCCTGATAACGCACGCCAGCAGTAAGGTTCCCGATCACCAGCCCGACGGTTAACATCACCGCGAAGGTCAGCAGATATTGCACATCAGAG
-ACGGCGAGCGTGCCGCGTGGGGCGATAAAAAGAGATCGAAACTCACTACATTAATGACGGTGGCAACCACTGAAGGCCAGCGTCCATAAAATAGCGCCAC
-CACCACCACGCCAAGCAGATACAGCATCACCAGGTTGGCGGCATCAAACGCCATCAGCCACTGCATGGCAATTAAGGTGATAACGGCGCATAACGCGGCG
-GCAACCACGCATCCCTGAATTTGTACACGCCACTTGTCTTTAAAAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTGGTTCATCAAGCGCGA
-CCAGCACCTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCAGCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAATAATCTTG
-CCGAGATTATGTTCACGGGCATAACGCACTACCGCTTTCTCTTCCGCTGGATCAGAAAGTGTTGCCGTCTCCGCGCCCAGTTCCTGCGCCAGACGTAAGG
-CGCTGAGAATTGCCCGACGTTTTTTCCGGTAAGCGGTGCAGGGCAGGGGTTTCAACATACACCGCGTGCCAGACGCTACCCAGCCGTGACGCCAGCCGCG
-CCGCTGCGCGGACCAGTTTTCGCTGCCGGTGTTATGGCCGATGCATAAAAGGATCGCGTCGCGCGTGTGCCACACTTTCTCTTCGCCAGGATGCCCCGCC
-AGGCGCGCATTTGCTCATCAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAATGTTCAATGGCGCGC
-TCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGGGGCAAGTCCACCAGCACCACGTCGTCGGCGGCATCGAAAAG
-GATCGGGCACGGTTTCCCGTACCTGAATTCCGGTGACGCCGCTGACCACATCATTCAGACTTTCCAGATGCTGAACGTTGACGGTAGTGAAAACATCAAT
-GCCAGCTTCCAGCAGTTCTTCGATATCCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCCATTAAGATCAGCGCCGGG
-CGGCGGGCGAGGGCGGCATCGAGATCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAGAACAGCCAGCCCTTCCAGCATGGCGG
-CGGTATCTTTTCGCCCGTGGGTTTCTACCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCCAGGTCTTCCC
-GACGCCTGCACAGGCACCGAAGAAAACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAGCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
-TCATCAAGTTTATCCAGCGCCAGATTGAGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAGCGGTTGTTGGCTGTATTTTGCGATCAGTT
-GCGTGAGCTGTTCAACGCTGAGATTACGCGCTTTCGCCACGCGTGGGATTTGCCAGGCCGCCGCTTGCGGGTGATATTATTGTCCAGCCCGCTTGCCGAT
-GCCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTAC
-TGACCGCCAGATTGCTCCCGCCAGAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAAATTCTG
-CCCGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTGCCCCAGTACGGTGGTCAGCAGCG
-GGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACACCAGACCGCAAACGGTCAGC
-AGTAAATCAATGACTTTGATACCGATAAACGGCACCAGCAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAGCGGTAAGCGGTT
-TATAACTCACGCCTTTTAACGCCAGGGGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCACA
-TGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTGGCAATGCTGAAGGTGGTCAG
-CGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCGCC
-GCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCG
-CCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACG
-GTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACG
-CCCAGCACACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCCTGACGCGCAACCTGATCGACTTTTTGATCAACATCGGTAGGGAAGTGACCACCGT
-TAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-AAAGGTGGCATGGAGCGACTGCACATCGCGCTCGCGCAGGTTAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGC
-GAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTCATCCACGCCCTGCGCGGGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTA
-TCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGA
-TCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGG
-CCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCA
-CCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGC
-AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCAATAACTTCACCATCGCAGGGGA
-TAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCG
-GGCAAAGGCAGTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCAC
-AGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGA
-CGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGT
-TGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACC
-AGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGC
-AATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAG
-GCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCA
-TCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATAT
-TCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTT
-CACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGAC
-CGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGA
-ACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAA
-GGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTA
-AAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAG
-CCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGA
-TCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTG
-CACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGC
-GCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAG
-GCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAG
-GAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGC
-CATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCT
-CCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAGTATAAAAATGGCAAAAGCCA
-TGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGA
-GTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAAGTATG
-GAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAG
-ACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTAT
-TGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACC
-AATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTT
-CGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCAT
-TGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCT
-CGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCG
-CGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAG
-CCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCAC
-CGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCG
-GCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACA
-GACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCG
-CAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACA
-ACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGC
-GAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCC
-GACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCAT
-CACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCA
-CGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCAC
-GCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGG
-GAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAA
-CGGAAGATGCCACCGGCAGCCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCA
-TGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACG
-CAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGG
-GAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACAC
-CACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGC
-AGCGAGGATGAGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGA
-CGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACAC
-CTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACA
-GCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCA
-CCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGAC
-CGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCG
-TTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCGCCCT
-CAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAACCGACCTCATCCCGGAAG
-GGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTC
-GAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAAC
-CGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCC
-ACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGT
-GTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGT
-GCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCT
-GGCCCTATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTA
-TCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGATCC
-GATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACT
-GCATTCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATAC
-TTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCTGCTGGCCGTTGTGACCT
-CGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATATTCACACCTATAAA
-TTTAGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTG
-TATTCACCGGAGTGATGTAATGAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTT
-CACTATTAGACTCCACTCGTGATGTGAGCGAGTTAATTAGTCTCATGTCTTATGGAATGATGGTAATATGTTTTCCAACAGGCATAGTATTCTTTATTGC
-TCTAATATTTATAGGGACTGTATCAGACATTATTGGCGTAAGGATTGATAGTAAGTATATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGG
-TATATTCAATGGTTTGTATTAAGTAAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGGCATTGATATCCCGTATG
-CCACAGACCCGGCAGGTAACCGCCTGCCCGACCGGAGCTGCACCCGGACAGCACCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTAT
-CTTTACCGGTATGACCGTCACGGCAGGCTGACGGAGAAAACCGACCTCATCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTAC
-GACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAA
-AACGGGTGTGGCGACGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCAC
-GATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGC
-AGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGCGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGA
-AAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGAGCAGATGCAAAACCAGATGGACCCGGTG
-TACACGCCGGCGCGAAAAATCCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCGCTTGTCAGCACGGAAGGGGCAACAGAATGGTGCGCAGAAT
-ACGATGAATGGGGCAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTA
-TTACAACCGCCACCGCTATTATGACCCGCTGCAGGGAGGTATATCACTCAGGATCCGATTGGGCTGAAGGGGATGGAATTTTATCAGTATCCGCTGAATC
-CGGTTCAGTATATAGATTCAATGGGACTGGCATCAAAATATGGACACTTAAATAATGGCGGATATGGAGCGAGACCCAACAAACCGCCTACGCCCGATCC
-AAGTAAATTGCCGGACATAGCGAAACAATTAAGACTGCCATATCCTATTGACCAGGCCAGTAGTGCGCCTAATGTTTTCAAAACATTCTTCAGAGCATTA
-AGCCCTACGACTACACACTGTATTGCAGGAAGTGGGTAAAACCAAATCTGACTTGTACGCCACAGGATGATTCCCAGTATCCAGGGATGGATACAAAGAC
-AGCAAGTGATTACCTGCCACAGACAAATTGGCCAACAACTCAATTACCACCAGGATATACTTGTGCAGAACCCTATTTATTCCCAGACATTAATAAACCC
-GATGGGCCAGCAACAGCAGGGATAGATGATTTGGGTGAAATTTTAGCTAAGATGAAACAGAGAACATCGAGAGGAATAAGAAAATGAAAAGAGTTTTGTT
-CTTTTTGCTGATGATATTTGTTAGTTTTGGTGTTATAGCTGATTGCGAAATACAAGCTAAAGATCATGATTGTTTTACTATTTTCGCTAAAGGGTACTAT
-TTTTCCGCGTTTCCTGTCTTAAATAATAAAGCCATGTGGAGATGGTATCAGAATGAGGACATCGGTGAGTATTATTGGCAAACAGAACTGGGTACATGTA
-AAAATAATAAATTCACACCAAGCGGGCGAGACTCTTAATTCGCGTCGGGTCACTACGCCTTAATGAAAATCATGCCATCAAAGGAACGTTGCAGGAGTTG
-ATAAATACAGCAGAAAAACGGCGTTTCTCGGCGATCGGTTTAGAAGTTATATAAGAGCGGGTATCTATCAAAAGAGCAGTGATCCAGTTCAGTTGTTGGC
-AGTCCTTGATAATTCAATCATGGTAAAATATTTTAAAGATGAGAAACCAACTTATGCTCGAATGACAGCACATCTCCCGAACAAAATGAGTCTTACGAAT
-GTTTAATAAAGATACAGCATGAACTAATTCGTAGTGAAGAGAAATAAAATCTCTTCCTGAGAAAACAAATTAATCATTGTGAAAAATTATATAACTCATG
-GAATAGGTGTTTATTTTGCGTTCCATTTGCAGGAAAGATCACGTAACGCTACTTTTTGTACTAAATAATTCGAATTTAAGTTCAACAATTGAGATACTAC
-TTATTGTCTAAAGCTGTTTTTCATAGCTTATACATGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTC
-TATTACACCCGATTACAGACAAGCCTGGAAAGTGGTGCATAAATTGTCAGATATTCTACTGTTGACTATTTGTGCCGTTATTTCTGGTGCAGAAGGTTGG
-GAAGATATAAGAGGATTTCGGGGAAACATCTCGATTTTTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACCATTGCCAGAGTTGT
-ATCAGGAAAGATCACGTAACGCTACTTTTTGTACTAAATAATTCGCATTTTATGTTTAAAAATTGAGATATTCCTTATTACCTAAAGCTGTTTTTCATAG
-CTTATACATGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTCTATTATTCCCGATTACAGATAAGCCT
-GGAAAGTAGAGCATAAATTGTCCAGGCATCCTACTATTGACTATTTTGCCGTTATTTCTGGTGCGAAAGTTGGGAAGATATAGAGGATTTCGGGAAACAC
-ATCTCGATTTCTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACTATTGCCAGAGTTGTATCCTGTATCAGTCCT
+>tig00000001 len=15501 reads=77 class=contig suggestRepeat=no suggestBubble=no suggestCircular=no trim=0-15501
+TGAATCACGCGGGCGGCTAAATCGACGGTAACATCGGAAAATTTTACCAGCGGATCGGGCGCGGTGGTGGCAGAGTGGCGGTGTAATGCGACGCGCAGAC
+GGGCCCAATTCGCCATGCCAAACGGCTTACTCAGATAATCATCCGCTCCGGCATCCAGCGCGGCGATTTTGTCGCTCTTCGCTGCGTGCGGAAAGCACAA
+CACCGGCACCGCGCTCCACTGGCGCAGGTCGCGGATAAACTCAATCCCATCACCATCGGGCAGGCCGCCGAGATCGAGAATAATCAAATCTGGCTTACGG
+GTTGCTGCTTCCAGCAAGCCGCGTTGCAGCGTTTCGGCCTCAAAGACGCGCATCCCGTCGCCCTCCAGCGCCGTGCGCAGAAAGCGACGAATAGCCTGTT
+CATCTTCAACAATCAGAACGTTTGTCACATATCCTCATGAAATTCTTCAGTTCAGGGGCAGTTTGCTGGGGAAGTGTAACACGAAAAACAGGCACCACCT
+TCCGGTCGGTTGAACGCGGTAATAGTGCCCCGTGTACATCCACTATCGCCCGACAAATTGCCAGTCCAAGCCCTACCCCCGGTACTGCCGACTCTTTATT
+CCCGCGAGCAAACTTATCAAATATCGTCTGCTCCTGGCCTGGCGGAAGACCGGGGCCGTTATCCCAGACATCCAGTTGTAGATTTTCGCCCTCAACGTGG
+GCATCGATACCAATTTCGGCCTGCGCACCCGCATATTTCACCGCGTTCTCCAGCAGATTAATCAGCACCCGTTCAAAGAGGGCCCGTCAACGTGGATTAA
+GGTCAGCGGTTCTGGCAGAGAAAGATTGATGGGCGACGATAAACCCGGTTCCAGCATTTGCAGCGCGCTGCCGACTACTTCTTCCAGCGTTAACCACTCT
+TTCTTCAAATTAAAGCCGCCGGACTGAATTCGCGCCATATCCAGTAGATTATTCACCAGTCGGGTAGTGTTCAGCACATGCTGACGGATCTCGCTGGCCT
+GGCGGGCGGGGTGATCCTCGCTTGCCAGATCGAGCGTTAAGATTTCTGCCTGACCAAACAGCACCGTAAGCGGCGTGCGTAAATCATGCGAAAGCGCCGC
+CAGCAGGCGTTGCGGATCTGTTCACGTTCGCTTGCCATCCGCGCCTGTTCTTCGCTGGCGGTTAGCGTCAGCCGCTCAGGGCATTGGCGACTAACAGCGT
+AACGTCTCCAGCAGGCGCTGCTGTTCCGGGATCATCAACTGGCGCAGATTCCCGGCTCCACCACCACCAGCCCGTAGGTTTTCGCCGCTTTTAGCGGCAA
+AATCTGGTACGGTACACCGGGTAACGTGTCGGTGCCCGCGCCCGCAGGCAGGCCTTTATCAAAACTCCACTGCGCGATGGCATCGTCCCACGGCGTCATT
+CCTTGCGGATGTGTTAACGGCTGCAATTTACCGTTGTCATCGGGCAACAACACCTGACTGCGGGCATGAAACGTGGAGGCAATAAATTGTTCGCTGGTGG
+CAGCGATATCCTGCGGACTGCGGCCCACCGCCAGAGCTTTCGACATTTCATATAAGTGCCGTGTGCGTTGCTCGCGGTAACGGGCTACCCGCGCCTGATA
+ACGCACGCCAGCAGTAAGGTTCCCGATCACCAGCCCGACGGTTAACATCACCGCGAAGGTCAGCAGATATTGCACATCAGAGACGGCGAGCGTGCCGCGT
+GGGGCGATAAAAAGAGATCGAAACTCACTACATTAATGACGGTGGCAACCACTGAAGGCCAGCGTCCATAAAATAGCGCCACCACCACCACGCCAAGCAG
+ATACAGCATCACCAGGTTGGCGGCATCAAACGCCATCAGCCACTGCATGGCAATTAAGGTGATAACGGCGCATAACGCGGCGGCAACCACGCATCCCTGA
+ATTTGTACACGCCACTTGTCTTTAAAAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTGGTTCATCAAGCGCGACCAGCACCTGATCGAGAT
+CGGGGCGATGCGCGCCAGTCGGTCAGCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAATAATCTTGCCGAGATTATGTTCACGG
+GCATAACGCACTACCGCTTTCTCTTCCGCTGGATCAGAAAGTGTTGCCGTCTCCGCGCCCAGTTCCTGCGCCAGACGTAAGGCGCTGAGAATTGCCCGAC
+GTTTTTTCCGGTAAGCGGTGCAGGGCAGGGGTTTCAACATACACCGCGTGCCAGACGCTACCCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACCAGTT
+TTCGCTGCCGGTGTTATGGCCGATGCATAAAAGGATCGCGTCGCGCGTGTGCCACACTTTCTCTTCGCCAGGATGCCCCGCCAGGCGCGCATTTGCTCAT
+CAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAATGTTCAATGGCGCGCTCCGCCTGCCCGGCAATA
+TAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGGGGCAAGTCCACCAGCACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCC
+GTACCTGAATTCCGGTGACGCCGCTGACCACATCATTCAGACTTTCCAGATGCTGAACGTTGACGGTAGTGAAAACATCAATGCCAGCTTCCAGCAGTTC
+TTCGATATCCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCCATTAAGATCAGCGCCGGGCGGCGGGCGAGGGCGGCA
+TCGAGATCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAGAACAGCCAGCCCTTCCAGCATGGCGGCGGTATCTTTTCGCCCGT
+GGGTTTCTACCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCCAGGTCTTCCCGACGCCTGCACAGGCACC
+GAAGAAAACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAGCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTATTCATCAAGTTTATCCAGC
+GCCAGATTGAGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAGCGGTTGTTGGCTGTATTTTGCGATCAGTTGCGTGAGCTGTTCAACGC
+TGAGATTACGCGCTTTCGCCACGCGTGGGATTTGCCAGGCCGCCGCTTGCGGGTGATATTATTGTCCAGCCCGCTTGCCGATGCCGTCACCAGTTCAACC
+GGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTACTGACCGCCAGATTGCTCC
+CGCCAGAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAAATTCTGCCCGATTAATGCCGAACC
+GCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTGCCCCAGTACGGTGGTCAGCAGCGGGTAAACGCCGCCAGTAA
+TCAATAACAGAAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACCAGACCGCAAACGGTCAGCAGTAAATCAATGACTTTGAT
+ACCGATAAACGGCACCAGCAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAGCGGTAAGCGGTTTATAACTCACGCCTTTTAAC
+GCCAGGGGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCACATGATGTTCAGCGCATTTAAC
+TGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTGGCAATGCTGAAGGTGGTCAGCGAGCCACGGGTCATCAGCA
+TCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCGCCGCCTGGGTGCCGGAGTTCAT
+CGCCACCGCGACATCTGCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTGATACTGACGGATCAAT
+GCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACGGTTATCGCCGGTAATCATCA
+CCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCCAGCACACGAGAACCTTC
+CACCACCACCAGCGGCGTGGCTCCCTGACGCGCAACCTGATCGACTTTTTGATCAACATCGGTAGGGAAGTGACCACCGTTAGCCTCAACATGGCGACGA
+ATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACT
+GCACATCGCGCTCGCGCAGGTTAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTC
+AGCCAGCGTTTTCATCCACGCCCTGCGCGGGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAAC
+GTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCA
+ATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCA
+GTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCC
+AGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCAC
+GGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCAATAACTTCACCATCGCAGGGGATAATATCGCCAGCTTCTACC
+AGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACC
+CTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGC
+GCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTG
+CGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAG
+TGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAA
+CAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAA
+TCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGC
+GGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCC
+ATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCAT
+CAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCAC
+ATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCA
+GCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCAC
+GCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTG
+GGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGT
+ACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTT
+TGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAG
+CGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCT
+GGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCC
+TGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGAT
+ATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGC
+GCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATT
+GATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATA
+CCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGT
+ATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAG
+GCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAAGGGGAGAAAAGTATGGAACTCTACAGAGAATATC
+CTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAG
+CTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAAT
+ACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCAT
+GAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAAT
+AACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGG
+GTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCC
+GGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGG
+CCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTG
+TTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGC
+AGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCC
+GGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCC
+GCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCC
+GGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGC
+CGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATG
+ACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCG
+TTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTG
+AACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGC
+GGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGAT
+GGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCC
+GTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAG
+CCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTG
+ACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGT
+ATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCAC
+GCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTA
+CTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGCTGGT
+CACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACA
+GACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGC
+AGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATG
+GCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGC
+TTCGGCCGTTATGAACTCACCACCGCTTATACCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGA
+CAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAAT
+CTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCGCCCTCAGCATGTGGCCGGATAACC
+GTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAACCGACCTCATCCCGGAAGGGTTATCCGCACGGATGATG
+AGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACC
+CGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTG
+GGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCC
+ACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGG
+TGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGAT
+GCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCCTTATCAGCACGGAAGGG
+ACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGT
+ATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGATCCGATTGGGCTGAAAGGGGATGG
+AATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGG
+TGAAAGAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCAAGACCAACG
+GGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTG
+TGTGGAGAACTGTTTAAAGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATATTCACACCTATAAATTTAGGGCTATTTAAAACTGC
+CAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGAGTGATGTAAT
+GAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTTCACTATTAGACTCCACTCGTG
+ATGTGAGCGAGTTAATTAGTCTCATGTCTTATGGAATGATGGTAATATGTTTTCCAACAGGCATAGTATTCTTTATTGCTCTAATATTTATAGGGACTGT
+ATCAGACATTATTGGCGTAAGGATTGATAGTAAGTATATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGGTATATTCAATGGTTTGTATTA
+AGTAAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGGCATTGATATCCCGTATGCCACAGACCCGGCAGGTAACC
+GCCTGCCCGACCGGAGCTGCACCCGGACAGCACCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCAC
+GGCAGGCTGACGGAGAAAACCGACCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGT
+GCACTACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTGTGGCGACGTGAA
+CGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCC
+GCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGAT
+ACCCTTCAGCAGTCCGGCGGCGAAGACGGTGGCAGTGTGGTGTTCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCG
+GGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGAGCAGATGCAAAACCAGATGGACCCGGTGTACACGCCGGCGCGAAAAATC
+CACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCGCTTGTCAGCACGGAAGGGGCAACAGAATGGTGCGCAGAATACGATGAATGGGGCAACCTGC
+TGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTA
+TGACCCGCTGCAGGGAGGTATATCACTCAGGATCCGATTGGGCTGAAGGGGATGGAATTTTATCAGTATCCGCTGAATCCGGTTCAGTATATAGATTCAA
+TGGGACTGGCATCAAAATATGGACACTTAAATAATGGCGGATATGGAGCGAGACCCAACAAACCGCCTACGCCCGATCCAAGTAAATTGCCGGACATAGC
+GAAACAATTAAGACTGCCATATCCTATTGACCAGGCCAGTAGTGCGCCTAATGTTTTCAAAACATTCTTCAGAGCATTAAGCCCTACGACTACACACTGT
+ATTGCAGGAAGTGGGTAAAACCAAATCTGACTTGTACGCCACAGGATGATTCCCAGTATCCAGGGATGGATACAAAGACAGCAAGTGATTACCTGCCACA
+GACAAATTGGCCAACAACTCAATTACCACCAGGATATACTTGTGCAGAACCCTATTTATTCCCAGACATTAATAAACCCGATGGGCCAGCAACAGCAGGG
+ATAGATGATTTGGGTGAAATTTTAGCTAAGATGAAACAGAGAACATCGAGAGGAATAAGAAAATGAAAAGAGTTTTGTTCTTTTTGCTGATGATATTTGT
+TAGTTTTGGTGTTATAGCTGATTGCGAAATACAAGCTAAAGATCATGATTGTTTTACTATTTTCGCTAAGGGTACTATTTTTCCGCGTTTCCTGTCTTAA
+ATAATAAAGCCATGTGGAGATGGTATCAGAATGAGGACATCGGTGAGTATTATTGGCAAACAGAACTGGGTACATGTAAAAATAATAAATTCACACCAAG
+CGGGGCGAGACTCTTAATTCGCGTCGGGTCACTACGCCTTAATGAAAATCATGCCATCAAAGGAACGTTGCAGGAGTTGATAAATACAGCAGAAAAACGG
+CGTTTCTCGGCGATCGGTTTAGAAGTTATATAAGAGCGGGTATCTATCAAAAGAGCAGTGATCCAGTTCAGTTGTTGGCAGTCCTTGATAATTCAATCAT
+GGTAAAATATTTTAAAGATGAGAAACCAACTTATGCTCGAATGACAGCACATCTCCCGAACAAAATGAGTCTTACGAATGTTTAATAAAGATACAGCATG
+AACTAATTCGTAGTGAAGAGAAATAAAATCTCTTCCTGAGAAAACAAATTAATCATTGTGAAAAATTATATAACTCATGGAATAGGTGTTTATTTTGCGT
+TCCATTTGCAGGAAAGATCACGTAACGCTACTTTTTGTACTAAATAATTCGAATTTAAGTTCAACAATTGAGATACTACTTATTGTCTAAAGCTGTTTTT
+CATAGCTTATACATGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTCTATTACACCCGATTACAGACA
+AGCCTGGAAAGTGGTGCATAAATTGTCAGATATTCTACTGTTGACTATTTGTGCCGTTATTTCTGGTGCAGAAGGTTGGGAAGATATAAGAGGATTTCGG
+GGAAACATCTCGATTTTTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACCATTGCCAGAGTTGTATCAGGAAAGATCACGTAACG
+CTACTTTTTGTACTAAATAATTCGCATTTTATGTTTAAAAATTGAGATATTCCTTATTACCTAAAGCTGTTTTTCATAGCTTATACATGATCAAATACTC
+CTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTCTATTATTCCCGATTACAGATAAGCCTGGAAAGTAGAGCATAAATTGT
+C
+>tig00000002 len=5688 reads=13 class=contig suggestRepeat=no suggestBubble=no suggestCircular=no trim=0-5688
+TTCATCATCTTAAGAAGTCCGTCGGTCAGGGGAGCATGAACTCTCCATCCTCACCGGAGTTGAGCTGGTTGTCAAACGGCGAGACCATCGCACTGGTGGG
+CGAGTCGGGATCGGTAAGTCAACCTTGCTGGCGATCCTCGCCGGGCTTGATGACGGCAGCAGTGGCGAAGTGAGTCTGGTGGGACAACCGCCACATAATA
+TGGACGAAGAAGCGGGCAAAGTTGCGCGCGAAGCACGTCGGCTTTGTTTTTCAGTCATTTATGTTAATTCCTACCTTAACGCGCTGGAAAACGTCGAGCT
+TCCGCCCTGCTGCGCGGTGAGAGCGCGGAAAGTCGTAACGGGGCGAAAGCGTTGCTCGAACAGTTAGGGCTGGGTAAACGTCTGATCATCTTCCGGCACA
+GCTTTCCGGCGGTGAACAGCAACGAGTGGCGCTGGCACGAGCCTTTAATGGTCGACCTGATGTGCTGTTTGCCGACGAACCCACCGGCAACCTTGACCGC
+CAGACGGGCGATAAAATTGCCGACCTGCTGTTTTCCTCAACCGTGAACATGGCACCACGTTGATTATGGTGACCCACGACCTGCAACTGGCGGCACGCTG
+CGACCGCTGCTTACGGCTGGTGAACGGGCAGTTGCAGGAGGAAGCATGATTGCACGTTGGTTCTGGCGCGAATGGCGTTCGCCGTCGCTATTAATTGTCT
+GGCTGGCGCTAAGCCTGGCGGTGGCCTGCGTGCTGGCGCTGGGCAATATCAGCGATCGCATGGAGAAGGGCTTAAGCCAGCAAAGCCGTGAGTTTATGGC
+GGGCGATCGGGCGTTGCGCAGTTCACGCGAAGTGCCGCAAGCGTGGCTGGAGGAAGCGCAAAGCGCGGCCTGAAAGTCGGCAAGCAGCTGACTTTCGCCA
+CAATGACCTTTGCAGGCGACACACCGCAGCTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTG
+AAACCGCAGGCGGGCAGCGTATTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGACGTGGGCGATGCCACCTTGCGGA
+TTGCCGGAGAAGTGATTCAGGAACCGGATTCCGGTTTTAACCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGGAGCC
+GTGCAGCCGGGGAGTCGGGTCACCTGGCGTTATAAATTCGGCGGCAACGAGAACCAGCTCGACGGCTATGAGAAATGGTTGTTACCTCAGCTTAAACCCG
+AACAACGCTGGTACGGTCTGGAACAGGACGAAGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCTTGCT
+GCTGGCAGTGGCAGCGGTGGCGGTAGCGATGAATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCGAGCGCAA
+CTGCGTAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAACGTGTTGATGGTGCT
+GCTCAAGCCCGTTCTGCCTGCTGCACTACCGCCAGCCAGCCTCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTA
+CGACCATATCGCTTGTTGCTGGCAACGCAGCCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCA
+GTGTGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTGGGCGGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGT
+GCTGGGCTGGATGCTGCTGAATGTACTTCGCCGCATGACGCTGAAATCGCTGCCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACG
+TTAAGTCAGCTTTCGGCATTTTCGCTCTCCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTC
+AGAAAGCCCGAACTACTTTTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTAT
+CCGGTGGTGCGGGCGCGGCTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATA
+CGCGGCCCGATCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCTTAAACGTTGCCCT
+CGGTGATACCGTGACTTTTATGGGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTAT
+TTTATTTTCCCTGAAGGGCATTAGACGGGCAACCGCAGAGCTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCA
+GTTCCCGACCATTAGCCTGTTAGATATTGGCGCGATTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTG
+GTCACCGCCTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAA
+AAACTGCTGCGTACCACGTTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTTGC
+AGGCGAAAGTGTTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCGGAGCGCTGCTGCTGTCGCTTTCGGCGGCTGGCTG
+GGTGCGCGACTGGTTAAGGGTAAGGCGCTGTTCAGGCAGTTTGCGGGTGATGAGAGTAAATAAGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTA
+ATTCTACAATATGTTTCATTGATGATGTTATTGAATTGGTGATTTCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAAT
+ATAGCCCTACAAAAATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGATGAATTCATCTGT
+GCTAAAAATGTTAGTTTAATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGTGAAAAATATATAAATACAT
+TAGCTGGTCTTGTGTGTCATTTTATTTTTTGTTGCTAACACAGGGATATGAACAATAACTAAAAGGGCACTTTATGAGCGGAAAACCAGCGGCGCGTCAG
+GAGATATGACTCAGTATGGCGGTCCCATTGTCCAGGGTTCGGCAGGTGTAAGATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATG
+ACTTCGGGCAACCCGGTAAATCCGCTGCTGGGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCA
+CCTACAGCAGCTACCGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGGAAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGG
+ACTGATACTCAACGACAACGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGGAGGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCG
+GTGGTAAGGCAGCACAGCCGGACGGCCATACGCTGGCGCGGCTGTGGGGGCGCTGCCGCCGGATATCCGGTTAAGCCCGCATCTTTACCTGGCGACCAAC
+AGCGCACAGGGGCCGTGGTGATACTGGGGTGGTCTGAGCGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGG
+GATGGCGGACCGCTTCGGGCGGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGGCCGGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGT
+TCCGTCTGGTGCTGACCACGCAGGCGCAGCGTGCGGAAGAGGCCCACCTCTTCGCTATCTTCTTCTGACAGTTCCCGCCCTCTCTCAGCCTCAGCGTTCC
+CCGACACACTGCCCGGTACCGAATACGGCCCCGACAGGGTATCCGCCTTTCGGCGGTGTGGCTGATGCACGACCCGGCATACCCGGAGAGCCTGCCCGCT
+GCGCCACTGGTGCGGTACACGTATACGGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCACGTATGACGCGCAGC
+ACCCGGGCCGGATGGTGGCGCACCGTTACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGGCGGGTGGTGGAGCAACTGAACCCGGCAGG
+GTTAAGCTACCGCTATCTTTATGAGCAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAGGCGGGGCCGGGCTGAAA
+CGGGTGGTGAAAAAGAACTGGCGGACGGCAGCGTCACGCGCAGCGGGTATGACGCGGCAGGAAGGCTCACGGCGCAGACGGACGCGGCGGGACGGAGGAC
+AGAGTACGGTCTGAATGTGGTGTCCGGCGATATCACGGACATCACCACACCGGACGGGCGGGAGACGAAATTTTACTATAACGACGGAACCAGCTGACGG
+CGGTGGTGTCCCCGGACGGGCTGGAGAGCCGCCGGAATATGATGAACCGGGCAGGCTGGTATCGGAGACATCGCGCAGCGGGGAGACAGTACGCTACCGC
+TACGATGACGCGCACAGTGAGTTACCGGCGACGACAACGGATGCGACGGCAGCACCGGCAGATGACCTGGAGCCGCTACGGCAGTTGCTGGCGTTCACCG
+ACTGCTCGGGCTACCAGACCCGTTATGAATACGACCGCTTCGGCCAGATGACGGCGGTCCACCGCGAGAAGGCATCAGCCTTTACCGCCGCTATGACAAC
+CGTGGCCGGTTAACCTCGGTGAAAGACGCACAGGGCCGTGAAACGCGGTATGAATACAACGCCGCAGGCGACCTGACTGCCGTTATCACCCCGGACGGCA
+ACCGAGCGAGACACAGTACGATGCGTGGGGAAAGGCGGTCAGCACCACGCAGGGCGGTGACGCGCAGTATGGAATACGATGCTGCCGGACGTGTCATCAG
+CCTGACCAACGAGAACGGCAGCCACAGCGTCTTCAGTTACGATGCGCTGGACCGGCTGGTACAGCAGGGCGGCTTTGACGGGCGGACACAACGTTATCAT
+TATGACCTGACCGGAAAACTCACCAGAGTGAGGATGAGGACTTGTCATCCTCTGGTACTACGATGAATCGGACCGCCTCATCACCGCACGGTGAACGGCG
+AAACCGGCAGAGCGGTGGCAGTATGATGGCCACGGCTGGCTGACAGACATCAGCCAATTGAGCGAAGGCCACCGTGTTGCCGTCCACT
--- a/test-data/ecoli_canu_contigs_result2.fa	Sun May 26 10:52:09 2019 -0400
+++ b/test-data/ecoli_canu_contigs_result2.fa	Mon Feb 15 12:31:26 2021 +0000
@@ -1,155 +1,114 @@
->tig00000001 len=15307 reads=47 covStat=-31.76 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-AAAATAGTCAATAGTAGGATGCCTGACAATTTATGCTCTACTTTCCAGGCTTATCTGTAATCGGGAATAATAGAAATATGTTCCATCAATTTTTAAGTTC
-CATTTGTTCACCTTATTTATGTAAGGAGTATTTGATCATGTATAAGCTATGAAAAACAGCTTTAGGTAATAAGAATATCTCAATTTTTAAACATAAAATG
-CGAATTATTTAGTACAAAAAGGCGTTACGTGATCTTTCCTGGGATACAACTCTGGCAATGGTATCGTGAACAGGAATACCATTTTCAAAATCACCATATT
-GCTTCAAAAAATCGAGATGTGTTTCCCCGAAATCCTCTATATCTTCCCAACCTTCTGCACCAGAAATAACGGCACAAATAGTCAAACAGTAGAATATCTG
-ACAATTTATGCACCACTTTCAGGCTTGTCTGTAATCGGGTGTAATAGAAATATGTTCCATCAATTTTTTAAGTTCCATTTGTTCACCTTATTTATGTAAG
-GGTATTTGATCATGTATAAGCTATGAAAAAACAGCTTTAGACAATAAGTAGTATCTCAATTGTTGAACTTAAATTCGAATTATTTAGTACAAAAAGTAGC
-GTTACGTGATCTTTCCTGCAAATGGAACGCAAAATAAACACCTATTCCATGAGTTATATAATTTTTCACAATGATTAATTTGTTTTCTCAGGAAGAGATT
-TTATTTCTCTTCACTACGAATTAGTTCATGCTGTATCTTTATTAAACATTCGTAAGACTCATTTTTGTTCGGGAGATGTGCTGTCATTCGAGCATAAGTT
-GGTTTCTCATCTTTAAAATATTTTACCATGATTGAATTATCAAGGACTGCCAACAACTGAACTGGATCACTGCTCTTTTGATAGATACCCGCTCTTATAT
-AACTTCTAAACCGATCGCCGAGAAACGCCGTTTTTCTGCTGTATTTATCAACTCCTGCAACGTTCCTTTGATGGCATGATTTTCATTAAGGCGTAGTGAC
-CCGACGCGAATTAAGAGTCTCGCCCCGCTTGGTGTGAATTTATTATTTTTACATGTACCCAGTTCTGTTTGCCAATAATACTCACCGATGTCCTCATTCT
-GATACCATCTCACATGGCTTTATTATTTAAGACAGGAAACGCGGAAAAATAGTACCCTTAGCGAAAATAGTAAAACAATCATGATCTTTAGCTTGTATTT
-CGCAATCAGCTATAACACCAAAACTAACAAATATCATCAGCAAAAAGAACAAAACTCTTTTCATTTTCTTATTCCTCTCGATGTTCTCTGTTTCATCTTA
-GCTAAAATTTCACCCAAATCATCTATCCCTGCTGTTGCTGGCCCATCGGGTTTATTAATGTCTGGGAATAAATAGGGTTCTGCACAAGTATATCCTGGTG
-GTAATTGAGTTGTTGGCCAATTTGTCTGTGGCAGGTAATCACTTGCTGTCTTTGTATCCATCCCTGGATACTGGGAATCATCCTGTGGCGTACAAGTCAG
-ATTTGGTTTTACCCACTTCCTGCAATACAGTGTGTAGTCGTAGGGCTTAATGCTCTGAAGAATGTTTTGAAAACATTAGGCGCACTACTGGCCTGGTCAA
-TAGGATATGGCAGTCTTAATTGTTTCGCTATGTCCGGCAATTTACTTGGATCGGGCGTAGGCGGTTTGTTGGTCTCGCTCCATATCCGCCATTATTTAAG
-TGTCCATATTTTGATGCCAGTCCCATTGAATCTATATACTGAACCGGATTCAGCGGATACTGATAAAATTCCATCCCCCTTCAGCCCAATCGGATCCTGA
-GTGATATACCTCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTG
-CAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTTGCCCCTTCCGTGCTGACAAGCGCCAGCGGCAGG
-CCGCGATGGTCGCAGTGGTACAGGTGGATTTTCGCGCCGGCGTGTACACCGGGTCCATCTGGTTTTGCATCTGCTCCACCGTCAGGCCGCACGATGCCAG
-CCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGAACACCACACTGCCACCGT
-CTTCGCCGCCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTCGCCAGCTCACCGGTGGCGGTTTCAACCTGATGAGTGGCGTGAAGCTCCC
-CGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGC
-GACATCCAGCCCGTCAGGTCCCGTTCACGTCGCCACACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGGCTTTCGACCAGCGGCTCTG
-CATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGG
-TCGGTTTTCTCCGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGTGCTGTCCG
-GTGCAGCTCCGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGCATACGGGATATCAATGCCCAGGTTACATATAATAATAAGAGCAATTAACTTAATTT
-ATTTGTTTATAATGCGCTTACTTAATACAAACCATTGAATATACCCTCCTGACAGAAAATAAAGCCATATTATTATCGCCATAATATACTTACTATCAAT
-CCTTACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGAGCAATAAAGAATACTATGCCTGTTGGAAAACATATTACCATCATTCCATAAGACATG
-AGACTAATTAACTCGCTCACATCACGAGTGGAGTCTAATAGTGAAAGTCTATGCATGGAAAAGAATAGTATTAAAAGCGATAAAGCCAGCCATATAGCTC
-TGAATAAAAAATAATATATTTCATTACATCACTCCGGTGAATACAAATCTAATAAAACGTCCAATGTTATTTCCGGAGCACTTCATCTTACATGTTTCTA
-AAGAATCATTAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAATTTATAGGTGTGAATATATCAGGCAATACAGAATAACGCGGCCTTACCTCTTTAAAC
-TTCCTTTTAAACAGTTCTCCACACAACTATTATCGGTTTCAACGAGGTCACAACGGCCAGCAGCTTCTTTGTATCATTACTTGCTTTACCTGGCCCCCAT
-AGACCATCTCCTTTGATTCTCCCCGTTGGTCTTGGCCACCACAAGTATAGTCCCTTTACCATCTGGGACACAAAGATATTGATGATAGAACGGATTCCCC
-ATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCGG
-ATTCAACGGATACTGATAAAATTCCATCCCCTTTCAGCCCAATCGGATCCTGAGTGATATATCGCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTA
-ATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTACCCCATTCATCG
-TATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATATGGGCCAGCGGCAGGCCGCGATGGTCGCAGTGGTACAGGTGAATTTTTCGCGCCGGCGTGT
-ATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACT
-TTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACACTGCCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGC
-TGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTA
-TCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCG
-TTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTG
-TCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGGTCGGTTTTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAA
-GATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGGTGCAGCTCCGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTG
-GTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGC
-TGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGGTATAAGC
-GGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGAC
-AGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCAT
-GCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTG
-CCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCT
-GCTTCGTCATAGTGCCAGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCC
-GGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCC
-ATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCA
-GGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAG
-CCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAA
-CGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGT
-CAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTT
-ATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCC
-GTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTG
-CGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCT
-GTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGC
-TGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTAT
-TCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCG
-TCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGT
-GATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGC
-GCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTA
-AGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCG
-GCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATA
-TCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCC
-GGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACACCGAACAGGCCA
-CGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATC
-TGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAAT
-TAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGC
-GTTTCCGCTGGCGGTTTTCAATGTATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTT
-TTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTAC
-GGCGTAAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTG
-TTTATCTGATGAAAATAGTACCGCCTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTA
-AGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTTGCGAAATCTTT
-GCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTG
-GGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGC
-GCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTG
-ACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTG
-CCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTG
-AAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCG
-TTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGT
-TTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCT
-CAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGC
-AGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTC
-AGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAG
-GTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTAC
-CGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTG
-CTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTG
-GTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAG
-TGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCAT
-GTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGC
-ACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCT
-CTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAA
-ATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCG
-ATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTA
-AAGCGCAGGCCAACAGTCTGAAAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCA
-ACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCA
-CCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAG
-CGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTG
-ATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCT
-GGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGA
-CGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCCGCGC
-AGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGCGT
-TTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGA
-TCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAGTCGATCAGGTTGCGCGTCAG
-GGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGC
-TGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGA
-AGCGACACCGGAGGCCAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCGCTG
-GCGCAGGCAGATGTCGCGGTGGCGATGAACTCCGGCACCCAGGCGGCGAAAGAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCG
-AGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAGCATTGCCAACGATGTGGCGAAATACTTCGCCATTATTCCGGC
-GGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACGCCTTG
-ATTATCGTCTTTGATTCCCCTGGCGTTAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTG
-GGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGAGGTTTACCATGAGTGGATTACGTCCGGCATTATC
-AACATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTACCCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGA
-TTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCGGGCAGAATTTTACCGGCAACGGCTATTTTCATGGTCGCCCGTCGGCAACGGCAGAAATGCC
-CTATAATCCACAGGCTTCTGGCGGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAAC
-CCGGATGCCAGCGCGAGCGTTCCGGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGGCAAATCCCACG
-CGTGGCGAAAGCGCGTAATCTCAGCGTTGAACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTC
-AACATTGTTGAACTCAATCTGGCGCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCAT
-CGGGGAAGCTGAAAGTTTTCGGTGCCTGTGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCGGGCGCAAGGGCTGGATATTGT
-GGTTGGCGTGGTAGAAACCCACGGGCGAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATA
-TCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTAATGCGCCAGGTTCCCGTCATCCCAA
-ACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGAAAGTCTGAATGATGTGGTCAGCGGC
-GTCACCGGAATTCAGGTACGGGAAACCGTGCCCGATCCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGC
-TGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTGCGC
-CGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGCATCCTGGCGAAGAGAAAGTGGCACACGCGCGACGCGATCCTTTTATGCATCGGCC
-ATAACACCGGCAGCGAAAACTGGTCCGCGCAGCGGCGCGGCTGGCGTCACGGCTGGGTAGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCAC
-CGCTTACCGGAAAAACGTCGGGCAATTCTCAGCGCCTTACGTCTGGCGCAGGAACTGGGCGCGAGACGGCAACACTTTCTGATCCAGCGGAAGAGAAAGC
-GGTAGTGCGTTATGCCCGTGAACATAATCTCGGCAAGATTATTCTCGGTCGCCCGGCCTCGCGCCGCTGGTGGCGTCGGGAAACGTTTGCTGACCGACTG
-GCGCGCATCGCCCCGATCTCGATCAGGTGCTGGTCGCGCTTGATGAACCACCCGCCCGCACGATTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAA
-GTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTTGATGCCGCCAAC
-CTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTTATGGACGCTGGCCTTCAGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATC
-TCTTTTTATCGCCCCACGCGGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCGGGAACCTT
-ACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCGAGCAACGCACACACGGCACTTATATGAAATGTCGAAAGCTCTGGCGGTGGGCCGCAG
-TCCGCAGGATATCGCTGCCACCAGCGAACAATTTATTGCCTCCACGTTTCATGCCCGCAGTCAGGTGTTGTTGCCCGATGACAACGGTAAATTGCAGCCG
-TTAACACATCCGCAAGGAATGACGCCGTGGGACGATGCCATCGCGCAGTGGAGTTTTGATAAAGGCCTGCCTGCGGGCGCGGCACCGACACGTTACCCGG
-TGTACCGTACCAGATTTTGCCGCTAAAAAGCGGCGAGAAACCTACGGGCTGGTGGTGGTGGAGCTGGGAATCTGCGCCAGTTGATGATCCCGGAACAGCA
-GCGCCTGCTGGAGACGTTACGCTGTTAGTCGCCAATGCCCTGAGCGGCTGACGCTAACCGCCAGCGAAGAACAGGCGCGGATGGCAAGCGAACGTGAACA
-GATCCGCAACGCCTGCTGCTGGCGGCGCTTTCGCATGATTTACGCACGCCGCTTACGGTGCTGTTTGGTCAGGCAGAAATCTTAACGCTCGATCTGCAAG
-CGAAGATCACCACGCCCGCCAGGCCAGCGAGATCCGTCAGCATGTGCTGAACACTACCCGACTGGTGAATAATCTACTGGATATGGCGCGAATTCAGTCC
-GGCGGCTTTAATTTGAAGAAAGAGTGGTTAACGCTGGAAGAAGTAGTCGGCAGCGCGCTGCAAATGCTGGAACCGGGTTTATCGTCGCCCATCAATCTTT
-CTCTGCCAGAACCGCTGACCTTAATCCACGTTGACGGGCCACTTTTGAACGGGTGCTGATTAATCTGCTGGAGAACGCGGTGAAATATGCGGGTGCGCAG
-GCCGAAATTGGTATCGATGCCCACGTTGAGGGCGAAAATCTACAACTGGATGTCTGGGATAACGGCCCCGGTCTTCCGCCAGGCCAGGAGCAGACGATAT
-TTGATAAGTTTGTTCGCGGAATAAAAGAGCAGTACCGGGGGTAGGGCTTGGACTGGCAATTTGTCGGGCGATAGTGGATGGTACGGGGGCACTATTACCG
-CGTTCAACCGACCGGAAGGTGGTGCCTGTTTTCGTGTTACACTTCCCCAGCAAACTGCCCCTGAACTTGAAGAATTTCATGAGGATATGTGACAAACGTT
-CTGATTGTTGAAGATGAACAGGCTATTCGTCGCTTTCTGCGCACGGCGCTGGAGGGGCGATGCGCGTCTTTGAGGCCGAAACGCTGCAACGCGGCTTGCT
-GGAAGCGGCAACCCGTAAGCCAGATTTGATTATTCTCGATCTCGGCCTGCCCGATGGTGATGGGATTGAGTTTATCCGCGACCTGCGCCAGTGGAGCGCG
-GTGCCGG
+>tig00000001 len=11230 reads=14 class=contig suggestRepeat=no suggestBubble=no suggestCircular=no trim=0-11230
+CCCCGCCAGGCGCGCATTTGCTCATCAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAATGTTCAAT
+GGCGCGCTCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGGGGCAAGTCCACCAGCACCACGTCGTCGGCGGCAT
+CGAAAAGGATCGGGCACGGTTTCCCGTACCTGAATTCCGGTGACGCCGCTGACCACATCATTCAGACTTTCCAGATGCTGAACGCTGACGGTAGTGAAAA
+CATCAATGCCAGCTTCCAGCAGTTCTTCGATATCCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCCATTAAGATCAG
+CGCCGGGCGGCGGGCGAGGGCGGCATCGAGATCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAGAACAGCCAGCCCTTCCAGC
+ATGGCGGCGGTATCTTTCGCCCGTGGGTTTCTACCACGCCAACCACAATATCCAGCCCTTTGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCCAGGTC
+TTCCTGACGCCTGCACAGGCACCGAAGAAACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAGCAGACGATCGGGGTCGGGACGTAAGGGTTCG
+TTATTCATCAAGTTTATCCAGCGCCAGATTGAGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAGCGGTTGTTGGCTGTATTTTGCGATC
+AGTTGCGTGAGCTGTTCAACGCTGAGATTACGCGCTTTCGCCACGCGTGGGATTTGCAGGCCGCCGCTTGCGGGTGATATTATTGTCCAGCCCGCTTGCC
+GATGCCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGTT
+ACTGACCGCCAGATTGCTCCCGCCAGAAGCCTGTGGATTATAGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAAATTCT
+GCCCGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTGCCCCAGTACGGTGGTCAGCAGC
+GGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACACCAGACCGCAAACGGTCAGC
+AGTAAATCAATGACTTTGATACCGATAAACGGCACCAGCAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAGCGGTAAGCGGTT
+TATAACTCACGCCTTTAACGCCAGGGGAATCAAAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCAC
+ATGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTGGCAATGCTGAAGGTGGTCA
+GCGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTTTCGCCG
+CCTGGGTGCCGGAGTTCATCGCCACCGCGACATCGCCTGCGCCAGCGCCGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCT
+GATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACGGTT
+ATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCC
+AGCACACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCCTGACGCGCAACCTGATCGACTTTTTGATCAACATCGGTAGGGAAGTGACCACCGTTAG
+CCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAA
+GGTGGCATGGAGCGACTGCACATCGCGCTCGCGCAGGTTAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAA
+GCCAGTTGTGCGGCGTCAGCCAGCGTTTTCATCCACGCCCTGCGCGGGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCC
+AGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCG
+CTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGGCCA
+CAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCA
+TCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAA
+ATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCAATAACTTCACCATCGCAGGGGATAA
+TATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGC
+AAAGGCAGTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGC
+CAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGA
+TAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTG
+TTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAG
+CAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAA
+TTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGC
+GCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATC
+ATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTACCCAGATATTCC
+GGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCAC
+CAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGC
+AAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACT
+TCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGC
+AAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAG
+AAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCT
+GATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCG
+ACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTGCAC
+CGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCC
+AGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCC
+GAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGA
+ATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCA
+TCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCC
+AGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAGTATAAAAATGGCAAAAGCCATG
+ATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGT
+AGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAAGGGGAGAAAGTATGGA
+ACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGAC
+CGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTG
+ATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAAT
+CGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGC
+CTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGT
+CCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGT
+GCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCC
+GGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTG
+TATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGC
+TGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTG
+GTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACG
+TTCCACCGCGAAGCCGCCGGTGATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCG
+GGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGC
+ATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTG
+GCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGG
+AAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCAT
+CACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAAGGAACACGCGGACGGCAGCGTCACGCAG
+AGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCA
+TCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATA
+TGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAG
+ATGCCACCGGCAGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGT
+TTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCC
+ATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGC
+CATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTC
+CGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGG
+ATGAGGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACG
+CGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACG
+GTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGC
+CCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGGA
+AACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGAT
+TACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACA
+CCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCGGAGCTGCACCCGGACAGCGCCCTCAGCATG
+TGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAAAACCGACCTCATCCCGGAAGGGTTATCC
+GCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCT
+ATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGAC
+CTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGG
+GTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCC
+CGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGAC
+GGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCCTATCAG
+CACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCG
+GGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGATCCGATTGGGCTGA
+AAGGGGATGGAATTTTATCAGTATCCGTTGAATCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACTGCATTCAATGGG
+CGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCA
+AGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGA
+TAATAGTTGTGTGGAGAACTGTTTAAAGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATATTCACACCTATAAATTTAGGGCTATT
+TAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGAG
+TGATGTAATGAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTTCACTATTAGACT
+CCACTCGTGATGTGAGCGAGTTAATTAGTCTCATGTCTTATGGAATGATGGTAATATGTTTTCCAACAGGCATAGTATTCTTTATTGCTCTAATATTTAT
+AGGGACTGTATCAGACATTATTGGCGTAAGGATTGATAGTAAGTATATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGGTATATTCAATGG
+TTTGTATTAAGTAAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGGCATTGATATCCCGTATGCCACAGACCCGG
+CAGGTAACCGCCTGCCCGACCGGAGCTGCACCCGGACAGCACCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTAT
+GACCGTCACGGCAGGCTGACGGAGAAAACCGACCTCATCCCGGAAGGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGC
+ACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTGTG
+GCGACGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAAC
+GACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAACGCAGCGCCGCAG
+CCTGGCGGATACCCTTCAGCAGTCCGGCGGCGAAGACGGTGGCAGTGTGGTGTTCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCC
+TGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGAGCAGATGCAAAACCAGATGGACCCGGTGTACACGCCGGC
+GCGAAAATCCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCGCTTGTCAGCACGGAAGGGGCAACAGAATGGTGCGCAGAATACGATGAATGGG
+GCAACCTGCTGAATGAAGAGAACCCGCATC
Binary file test-data/ecoli_canu_corrected_reads_result1.fa.gz has changed
Binary file test-data/ecoli_canu_corrected_reads_result2.fa.gz has changed
Binary file test-data/ecoli_canu_corrected_reads_result3.fa.gz has changed
Binary file test-data/ecoli_canu_trimmed_reads_result1.fa.gz has changed
Binary file test-data/ecoli_canu_trimmed_reads_result2.fa.gz has changed
Binary file test-data/ecoli_canu_trimmed_reads_result4.fa.gz has changed
--- a/test-data/ecoli_canu_unassembled_result1.fa	Sun May 26 10:52:09 2019 -0400
+++ b/test-data/ecoli_canu_unassembled_result1.fa	Mon Feb 15 12:31:26 2021 +0000
@@ -1,1162 +1,173 @@
->tig00000007 len=3514 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-GGCTGGATCGCTGCTGAATGTACTTCGCCGCATGACGCTGAAATCGCTGCCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTA
-AGTCAGCTTTCGGCATTTTCGCTCTCCTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCATACTCCAGAGCCC
-GAACTACTTTTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGGTGGTGC
-GGGCGCGGCTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGA
-TCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGCTGGCGAAACGCTTAAACGTTGCCCTCGGTGATACCG
-TGACTTTTATGGGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCC
-TGAAGGGCATTAGACGGGCAACCGCAGAGCTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCA
-TTAGCCTGTTAGATATTGGCGCGATTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGCCTG
-CGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCG
-TACCACGTTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTTGCAGGCGAAAGTG
-TTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCGGAGCGCTGCTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGGTTGG
-GTAAGGCGCTGTTCAGGCAGTTTGCGGGGATGAGAGTAAATAAGGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAATATGTTTCAT
-TGATGATGTTATTGAATTGGTGATTTCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAATAACT
-CAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGATGAATTCATCTGTGCTAAAAATGTTAGTTTAAT
-AAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGTGAAAAATATATAAATACATTAGCTGGTCTTGTGTGTCAT
-TTTATTTTTTGTTGCTAACACAGGGATATGAACAATAACTAAAGGGCACTTTATAGAGCGGAAAACCAGCGGCGCGTCGGGAGATATGACTCAGTATGGC
-GGTCCCATTGTCCAGGGTTCGGCAGGTGTAAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCGGGCAACCCGGTAAA
-TCCGCTGCTGGGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACG
-AAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGAAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGACAACGG
-CGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGGAGGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCACAGCCGG
-ACGGCCATACGCTGGCGCGGCTGTGGGGGCGCTGCCGCCGGATATCCGGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGTGA
-TACTGGGGTGGTCTGAGCGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCGGGCGGAC
-GCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGGCCGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCACGCAGGC
-GCAGCGTGCGGAAGAGGCCCACCTCTTCGCTATCTTCTTCTGACAGTTCCCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACACTGCCCGGTACCGAATA
-CGGCCCCGAGGTGGGCGGTGATGCACGACCCGGCATACCCGGAGAGCCTGCCCGCTGCGCCACTGGTGCGGTACACGTATACGGAAGCCGGTGAACTGCT
-GGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCACGTATGACGCGCAGCACCCGGGCCGGATGGTGGCGCACCGTTACGCGGGAAGGCCGGAG
-ATGCGCTACCGCTACGACGATACGGGGCGGGTGGTGGAGCAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAGCAGGACCGCATCACCGTCA
-CCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAGGCGGGGCCGGGCTGAAACGGGTGGTGAAAAAGAACTGGCGGACGGCAGCGTCACGCGCAGC
-GGGTATGACGCGGCAGGAAGGCTCACGGCGCAGACGGACGCGGCGGGAGGAGGACAGAGTACGGTCTGAATGTGGTGTCCGGCGATATCACGGACATCAC
-CACACCGGACGGGCGGGAGACGAAATTTTACTATAACGACGGGACCAGCTGACGGCGGTGGTGTCCCGGACGGGCTGGAGAGCCGCCGGAATATGATGAA
-CCGGGCAGGCTGGTATCGGAGACATCGCGCAGCGGGGAGACAGTACGCTACCGCTACGATGACGCGCACAGTGAGTTACCGGCGACGACAACGGATGCGA
-CGGGCGCACCAACAGATGACCTGGAGCCGCTACGGGCGTTGCTGGCGTTCACCGACTGCTCGGGCTACCAGACCCGTTATGAATACGACCGCTTCGGCCA
-GATGACGGCGGTCCACCGCGAAGGCATCAGCCTTTACCGCCGCTATGACAACCGTGGCCGGTTAACCTCGGTGAAAGACGCACAGGGCCGTGAAACGCGG
-TATGAATACAACGCCGCAGAGCGACCTACTGCCGTTATCACCCCGGACGGCAACCGGAGCGAGACACAGTACGATGCGTGGGGAAAGGCGGTCAGCACCA
-CGCAGGGCGGGCTGACGCGCAGTATCATTACGATGCTGCCGGATGTCATCAGCCCTGACCAACGAGAACAGGCAGCCACAGCGTCTTCAGTTACGATGCG
-CTGGACCGGCTGGT
->tig00000008 len=2220 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-AGTGCGGTTGGGTTTTTCAAACGGATGCGACAGCAGTTGGCATTAAAGAAGCCACCGCCGTTAGGCGCCGAGCATCTTGATGCTTCCACGAAGCTACGAT
-ACCGCCGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCCTACGGCCTGTTGAGCAGAAAGTTTTGCAGCGCAGCGAATAAAAACAGTGCAATCAACAA
-CGCCACGGGACTAGCACCCATAACGTGGTGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGGGGCAAA
-ATCACCCTGTCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGT
-TGGTATTGGTGACAAACGACGGCGGTATTCAGCTCCATTTCAGCCACAGCTGCTGTGGATTAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCA
-CCGCCAGCCCCAGCATGTTTCGGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAGGTGCGAAAAAGTACGCGCTCA
-ACGCCCGTTGTACCGGGAAGAGGAATCATTAATCTGGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGAT
-CAGTAAGAACCCTTGCGCAGCCATCAGACACGCTCCGCATTGATCGGGGCATAAACCAGAATGCGGTAATAAAACACCAGCAATGCGCCGGGTATCGCCT
-GCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTGAATTCTGTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAAGT
-ATAAAAATGGCAAAAGCCTTGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACATCAATAAGCAA
-AAATAGAGTGGTCGGATGAGTAGTAAAAATTACACAAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGAATTGG
-GCAAAGGAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTACGCCGTATGCCTGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCAT
-GCTTTCTGGAAAGACGCGCCCGCTTTTTGCAATACCATCGCGTCTGATTCGAAAACCAGCGATAAACCAGGTGTGGATGGATCGGGCGAAAAGGCAACTG
-GTGATTTTATTGATTGCTGAGTTTGAATATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTGTATCAGGAAGATGTTCAGAGGAATATTTGAACA
-TCGTTATACCAATCGAAACGTATATTCTGCCAAATATATATAAATATTTTCTAATTGTTCTTATCTGACAGATATCTCTTAAGGCTTTCTTATAAATCTG
-TAGGGTTTCGCCTGTCAGCGAACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGTGACATGACGCAGTATGGC
-GTAGCATTGTCCAGGAGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGAGTGACGTCCGGCCATCCGGTCAAT
-CCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAA
-AAACGCCCGCGCCGGTAGAGGCCTCGGCCCCGGCTGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCG
-GCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGACGGCGTGAAAGCGAAACTGGA
-TGAAGCAAGGTCTGGCTGGCCGCCTCTGGCAGGCGCTGCCGGAGAAGAACTCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCACAGGGGCCGT
-GGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGTGCTGCCTGCGCCTTTGCCGCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCT
-TCGGGCGCACACAGACGTTC
->tig00000009 len=4261 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-TGGCCTGCGCTTTACTGCGGCCTTTGCCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTTCGCCGCGCTTCAGCGCTTTA
-ATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCC
-TGCGGGTTTAATTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGGCGACTCATATTCAGTGCTCACTCAATATCATCA
-GGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCACGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCG
-TGCGTTGCAGCGCTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCATCACCGGGATAATCACCCGAAGCGACCGACAAACA
-TGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCAC
-TTCAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACAGCGTCGGGGTAACCAGAA
-TTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTATGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACA
-AACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACACATGCACATGCGAGAGCGGTAAACGAATCA
-TGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGA
-TGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCAC
-AGCAACATGCGCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGT
-CAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGC
-CCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTAGCGCAGTTGAAATAAAAACAGTGCAATCAACAACGC
-CACAGGGGACTAGCACCCATAACGTGATGCGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACC
-GCAATCCCGCTGGCGGCAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATT
-GGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACCAGCTGGCTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAG
-CACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGAAAAAAGTACGCGCT
-CAACGCCCGTTGTACCGGGAAGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGAT
-CAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCAC
-GCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGTAAAAAAAGT
-ATAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAA
-AATAAGTGGTCGGATGAGTAGTAAAATTACACAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAA
-AAGGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTACGCCGTACTTACATGCGGTTGCAGCGGGCGTTCTGGCGCTGCTTT
-CATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAA
-GGCAACTGGTGATTTTGATTGCTGAGTTTTGAATATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTTATCAGGAAGATGTTCAGAGGAATATTTAGA
-CATCGTTATACCAATCGAAACATATATTCATGAAATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATC
-GCCTTTCGCCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGC
-ATTGTCCAGGGTTCAGGGGGTACGTCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGT
-GCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCG
-GTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGT
-ATTTTGAGCACCTGTTTCCCTGAGGACGGTTACACAGCGAGTCACTGTGGCTGGTGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCAC
-TCTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAG
-CGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACC
-GCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAA
-GAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCTGATATACCGGGTTACACCGAATATGGCCGGACAACGGCATCCGTCTGTCT
-GCCGTGTGGCTGACGCACGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCG
-CAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTAC
-GACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACC
-GCCGTGAAGTCCTGCACAAGCAGAAGCGGGCTGAAGGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGG
-CTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCATCACCACGCCGGATGGCAGGGCATCG
-GCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTG
-CCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGC
->tig00000010 len=6489 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-CGTCATCTGGCCGAAGCGGTCGTATTCATAACGGGTCTGGTAGCCCGAGCAGTCGGTGAACGCCAGCAACTGCCCGTAGCGGCTCCAGGTCATCTGCCGG
-GTGCTGCCGTCGCATCCGTTGTCGTCGCCGGTAACTCACTGTGCGCGTCATCGTAGCGGTAGCGTACTGTCTCCCCGCTGCGCGATGTCTCCGATACCAG
-CCTGCCCGGTTCATCATATTCCGGCGGCTCTCCAGCCCGTCCGGGGACACCACCGCCGTCAGCTGGTTCCGTCGTTATAGTAAAATTTCGTCTCCCGCCC
-GTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCGTACTCTGTCCTCCGTCCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCG
-TCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCGTTTCAGCCCGGCCCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGG
-CTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCAGTTGCTCCACCACCCGCCCCGTATCGTCGTAGCGGT
-AGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGTCATACGTGAAAGCGCGCACCTGCGTATTGCTGCGGTCATATA
-CCGCCAGCAGTTCACCGGCTTCCGTATGCGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCATCAGCCACACCGCCGA
-AAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCGGTGTGTCGGGGAACGCTGAGGCTGAGAGAGGGCGGGAACTGTCAGAAGAAGATAGCGAAG
-AGGTGGGCCTCTTCCGCACGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCCCCGGCCAGGTCAC
-CGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGGTAAGCACCCGGTACGGCGGCAGCGGCGCTGGCAGTACGTCCTCAGC
-ACCCGGCACCCGCTCAGACCACCCCAGTATCACCACGGCCCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCTTAACCGGATATCCGGCGGCAGCG
-CCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCCGGCA
-GCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTTCAGCCGGGG
-CCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAGGTCCGTCTCGC
-CGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCCATTCTT
-ACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTTAGTTATTGT
-TCATATCCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAACTTATTTGTTCTCAATCAACAAC
-AACTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTGCACAGATGAATTCATCATCAACAAATTCACTATATGGATAATATCCATTCAA
-CGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAATAGAAAG
-ATAGAAATCACCAATTCAATAACATCATCAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTTACTCTCAT
-CACCCGCAAACTGCCTGAACAGCGCCTTACCCTTTAACCAGTCGCGCACCCAGCCAGCCGCCGAGCGACAGCAGCAGCGCTCCGCTGCACGGCAGAACAA
-TCCACAATCGCCAGTCTGGCTCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAAACA
-AACCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATT
-CCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGCACCTGACCGA
-CCTGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTGGT
-AAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTT
-TAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCCTCTTCCATCGACACTTCATCGGC
-TTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTACCTT
-CTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAGGAACGCTTTTAGCGGTGCTA
-CCTGTTCTGTGGCGATGTTAATTAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCCAGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGTGCC
-AGCAGCATAAAGGAGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATTTCA
-GCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCATGCTGC
-CACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTAATAC
-GCGTAAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCACAGCCACGGCCAGAGG
-CTGGCTGGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGT
-CAGCACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCTCGCCCTGCCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACAGTA
-ATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCGAAAGCAGCAGGAACTGTTGCGAGCGTTCCATCGATCGCCCCAGC
-GCGCCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTAAGCTGGGTAACAACCATTTCATAGCCGTCGAGCTGGTTCTCGTTGCCGCCGAATT
-TATAACGCCAGGTGACCCGACTCCCCGGCTGCACGGCTCCGGTTTTATCGACATCCGCCAGATTCATCATCAGACGCGGAGCCATCTGGAAGGGTTAAAA
-CCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCGCAAGGTGGCATCGCCCACGTCAATGGTGTCGCCCGTTTTCAGGTTAAGCAGTGCCATCAGGC
-GTGGGGCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGGGGATTAGTTTGCAGATCGCCATACATCGGGTAGATATCATCCACCGCTTTGACGTTC
-GCCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTGGCGAAAGTCAGCTTGCCGACTTTCAGGCCGCGCTTTGCGCTTCCTCCAGCCACGCTTGCGGCAC
-TTCGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTTGCTGGCTTAAGCCCTTCTCCATGCGATCGCTGATATTGCCCAGCGCCAGC
-ACGCAGGCCACCGCCAGGCTTAGCGCCAGCCAGACAATTAATAGCGACGGCGAACGCCATTCGCGCCAGAACCAACGTGCAATCATGCTTCCTCCTGCAA
-CTGCCCGTTCACCAGCCGTAAGCAGCGGTCGCAGCGCCGCCAGTTGCAGGTCGTGGGTCACCATAATCAACGTGGTGCCATGTTCACGGTTGAGGAAAAC
-AGCAGGTCGGCAATTTTATCGCCCGTCTGGCGGTCAAGGTTGCCGGTTCGTCGGCAAACAGCATCAGGTCGACCATTAAAGGCTCGTGCCAGCGCCACTC
-GTTGCTGTTCACCGCCGGAAAGCTGTGCCGGAAGATGATCAGACGTTTACCCAGCCCTAACTGTTCGAGCAACGCTTTCGCCCCGTTACGACTTTCCGCG
-CTCTCACCGCGCAGCAGGCCGGAAGCTCGACGTTTTCCAGCGCGTTAAGGGTAGGAATTAACATAAATGACTGAAAAACAAAGCCGACGTGCTTCGCGCG
-CAACTTTGCCCGCGCTTCTTCGTCCATATTATGTGGCGGTTGTCCCCGGAGCTCACTTCGCCACTGCTGCCGTCATCAAGCCCGGCGAGGATCGCCAGCA
-AGGTTGACTTACGATCCCGACTCGCCCACCAGTGCGATGGTCTCGCCGTTTGACAACCAGCTCAACTCCGGTGAGGATGGAGAGTTCATGCTCCCTGACC
-GACGGACTTCTTAAGATGATGAACTTCAACAATGTTTTCCGCTGGCATTTGCCCTTCCTGTTCCTGGTCCCAGTTAACCTTCCGTGCCGCCGCAGCCGTT
-ATTGATTCTGGGTGATAGCCTGAGCGCCGGGTATCGAATGTCTGCCAGCGCGGCCTGGCCTGCCTTGTTGAATGATAAGTGGCAGAGTAAACGTCGGTAG
-TTAATGCCAGCATCAGCGGCGACACCTCGCAACAAGGACTGGCGCCTTCCGGCTCTGCTGAAACAGCATCAGCCGCGTTGGGTGCTGGTTGAACTGGGGG
-CAATGACGGTTTGCGTGGTTTTCAGCCACAGCAAACCGAGCAAACGCTGCGCCAGATTTTGCAGGATGTCAAAGCCGCCAACGCTGAACCATTGTTAATG
-CAAATACGTCTGCCTGCAAACTATGGTCGCCGTTATAATGAAGCCTTTAGCGCCATTTACCCCAAACTCGCCAAAGAGTTTGATGTTCCGCTGCTGCCCT
-TTTTTATGGAAGAGGTCTACCTCAAGCCACAATGGATGCAGGATGACGGTATTCATCCCAACCGCGACGCCCAGCCGTTTATTGCCGACTGGATGGCGAA
-GCAGTTGCAGCCTTTAGTAAATCATGACTCATAAAGCAACGGAGATCCTGACAGGTAAAGTTATGCAAAAATCGGTTAATTACCGGATGTTCCAGTGGAA
-TTGGCCTGGAGCGCTCGAATTAAAACGCCAGGGTTTTCATGCTGGCAGGTTGCCGGAAACCGGATGATGTTGAGCGCACGAACGGCATGGGATTTACCGG
-CGTGTTGATCGATCTGGATTCACCAGAAAGTGTTGATCGCGCAGCCGACGAGGTGATCGCCTGACCGATAATTGTCTGTATGGGATCTTTAACAATGCCG
-GATTCGGCATGTATGGCCCCTTTCCACCATCAGCCGTGCGCAGATGGAACAGCAGTTTCCGCCAACTTTTCGGCGCACACCAGCTCACCATGCGCCTGTT
-ACCCGCGATGTTACCGCACGGTGAGGGCGTATTGTGATGACATCATCGGTGATGGGATTAATCTCCCGCCGGGTCGTGGCGCTTACGCGGCCAGTAAATA
-TGCGCTGGAGGCGTGGTCAGATGCACTGCGCATGGAGCTGCGCCACAGCGGAATTAAAGTCAGCCTGATCGAACCCGGTCCCATTCGTACTCGCTTCACC
-GACAACGTCAACCAGACGCAAAGTGATAAACCAGTCGAAAATCCGGCATCGCCGCCCGCTACGTTGGGACCGGAAGCGGTGGTGGACAAAGTACGCCATG
-CTTTTATTAGCGAAGCCGAAGATGCGCTATCCGGTGACGCTGGTGACCTGGGCGGTAATGGTGCTTAAGCGCCTGCTGCCGGGGCGCGT
->tig00000011 len=3677 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-CGGCTCCAGGTCATCTGCCGGGTGCTGCCGTCGCATCCGTTGTCGTCGCCGGTAACTCACTGTGCGCGTCATCGTAGCGGTAGCGTACTGTCTCCCCGCT
-GCGCGATGTCTCCGATACCAGCCTGCCCGGTTCATCATATTCCGGCGGCTCTCCAGCCCGTCCGGGGACACCACCGCCGTCAGCTGGTTCCGTCGTTATA
-GTAAAATTTCGTCTCCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCGTACTCTGTCCTCCGTCCCGCCGCGTCCGTC
-TGCGCCGTGAGCCTTCCTGCCGCGTCATACCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTTCACCGTTTCAGCCCGGCCCCGCCTTCTGTATGC
-AGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCAGTTGCTCCACCACCC
-GCCCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGCGTCATACGTGACGCGCACCTG
-CGTATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATGCGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCG
-TGCATCAGCCACACCGCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCGGTGTCGGGGAACGCTGAGGCTGAGAGGGGGGAACTGTCAG
-AAGAAGATAGCGAAGAGGTGGGCCTCTTCCGCGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCC
-CGGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGGTAAGCACCCGGTACGGCGGCAGCGGCGCTGGCAG
-TACGTCCTCAGCACCCGGCACCCGCTCAGACCACCCCAGTATCACGGCCCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCTTAACCGGATATCCG
-GCGGCAGCGCCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCC
-TCCCCGGCAGCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTT
-CCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAGG
-TCCGTCTCGCCGGGCAGCACCTTCGCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTGGGCGC
-GCCAATTTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCTGACGCGCCGCTGGTTTTCCGCTCATAAAGTGCCTTTTAGT
-TATTGTTCATATCCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAACTTATTTGTTCTCAATC
-AACAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTAGCACAGATGAATTCATCATCAACAAATTCACTATATGGATAATATC
-CATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAA
-TAGAAAGATAGGAAATCACCAATTCAATAACATCATCAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTT
-ACTCATCACCCGCAAACTGCCTGAACAGCGCCTTACCTTAACCAGTCGCGCAGCCAGCCGCCGAAAGCGACAGCAGCAGCGCTCCGCTGCACGGCAGAAC
-AATCCACAATCGCCAGTCTGGCTCCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAA
-ACAAACCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGC
-ATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGCACCTGAC
-CGACCTGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACT
-GGTAAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCA
-CTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCCTCTTCCATCGACACTTCATC
-GGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTA
-CCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCGCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAACGCTTTAGCGGTGCT
-ACCTGTTCTGTGGCGATGTTAATTAAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCTGCCAGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCA
-GTGCCAGCAGCATAAAGGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATT
-TCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCAT
-GCGCCACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTA
-ATACGCGTAAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCAGCCACGGCCAGAGGCTG
-GCTGGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGTCAG
-CACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCGCTCGCCCTGCCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACAGTAA
-TGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCGAAAGCAGCGGGAACTGTTGCGA
->tig00000012 len=8727 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-AGTGCTGGCTACGTTCAGACCAAAATAGAACAGCACCGGAGTGGTCATCGACTGTTCAGAACCTGTTGCAGGTTAGATTCGTTAATGTTGACAATATTTT
-CTACGGACATGGAGTCGCTCTCTGTTGTCGATATTTTCTTTGACATGGGGGCTTAAGCGCGCTTCAACTCACCTGCAATATTTTGTCCATCACGCGCCCC
-GGCAGCAGGCGCTTAAGCACCATTACCGCCCAGGTCACCAGCGTCACCGGATAGCGCATCTTCGGCTTCTCGCTAATAAAAGCATGGCGTACTTTGTCCA
-CCACCGCTTCCGGTCCCAACGTAAAGCGGGCGGCGATGCCGGGATTTTCGACTGGTTTATCACTTTGCGTCTGGTTGACGTTGTCGGTGAAGCGAGTACG
-AATGGGACCGGGTTCGATCAGGCTGACTTTAATTCCGCTGTGGCGCAGCTCCATGCGCAGTGCATCTGACCACGCCTCCAGCGCATATTTACTGGCCGCG
-TAAGCGCCACGACCCGGCATTGAGATTAATCCCATCACCGATGATGTCATCACAATACGCCCTTCACCGTGCGGTAACATCGCGGGTAACAGGCGCATGG
-TGAGCTGGTGTGCGCCGAAAAGTTGGCGGAAACTGCTGTTCCATCTGCGCACGGCTGATGGTGGAAAGGGCCATACATGCCGAATCCGGCATTGTTAAAG
-ATCCCATACAGACAGGTATCGGTCAGGGCGATCACCTCGTCGGCTGCGCGATCAACACTTTCTGGTGAATCCAGATCGATCAACACGCCGGTAAATCCCA
-TGCTGTTCGCGCGCTCAACATCATCCGGTTTCCGGCAACCTGCCAGCGACGAAAACCCTGGCGTTTTAATTCGAGCGCGCTTTCCAGGCCAATTCCACTG
-GAACATCCGGTAATTAAGACCGATTTTTGCATAACTTTACCTGTCAGGGATCTCCGTTGCTTTATGAGTCATGATTTACTAAGGCTGCAACTGCTTCGCC
-ATCCAGTCGGCAATAAACGGCTGGGCGTCGCGGTTGGGATGAATACCGTCATCCTGCATCCATTGTGGCTTGTGGAGCCTCTTCCATAAAAAGGGCAGCA
-GCGGAACATCAAACTCTTTGGCGAGTTTGGGGTAAATGGCGCTAAAGGCTTCATTATAACGGCGACCATAGTTTGCAGGCAGACGTATTTGCATTAACAA
-TGGTTCAGCGTTGGCGGCTTTGACATCCTGCAAAATCTGGCGCAGCGTTTGCTCGGTTTGCTGTGGCTGAAAACCACGCAAACCGTCATTGCCGCCAGTT
-CAACCAACCCAACGCGGCTGATGCTGTTTCAGCAGAGCCGGAAGGCGCGCCAGTCCTTGTTGCGAGGTGTCGCCGCTGATGCTGGCATTAACTACCGACG
-TTTTTACTCTGCCACTTATCATTCAACAAGGCAGGCCAGGCCGCGCTGGCAGACATTCGATACCCGGCGCTCAGGCTATCACCCAGAATCAATAACGTGT
-CCTGCGGCGTACGGGAAGGTTAATGGGACCAGGAACAGGAAGGGCAAATGCCAGCGGAAAACATTGTTGAAGTTCATCATCTTAAGAAGTCCGTCGGTCA
-GGGAGCATGAACTCTCATCCTCACCGGAGTTGAGCTGGTTGTCAAACGTGCGAGACCATCGCACTGGTGGGCGAGTCGGATCGGTAAGTCAACCTTGCTG
-GCGATCCTCGCCGGGCTTGATGACGGCAGCAGTGGCGAAGTGAGTCTGGTGGACAACCGCTACATAATATGGACGAAGCGCGGGCAAAGTTGCGCGCGAA
-GCACGTCGGCTTTGTTTTTCAGTCATTTATGTTAATTCCTACCCTTAACGCGCTGGAAAACGTCGAGCTTCCGGCTCTGCTGCGCGGTGAGTAGCGCGGA
-AAGTCGTAACGGGGCGAAAGCGTTGCTCGAACAGTTAGGGCTGGGTAAACGTCTGATCATCTTCCGGCACAGCTTTCCGGCGGTGAACAGCAACGAGTGG
-CGCTGGCACGAGCCTTTAATGGTCGACCTGATGTGCTGTTTGCCGACGAACCCACCGGCAACCTTGACCGCCAGACGGGCGATAAAATTGCCGACCTGCT
-GTTTTCCTCAACCGTGAACATGGCACCACGTTGATTATGGTGACCCACGACCTGCAACTGGCGGCACGCTGCGACCGCTGCTTACGGCTGGTGAACGGGC
-AGTTGCAGGAGGAAGCATGATTGCACGTTGGTTCTGGCGCGAATGGCGTTCGCCGTCGCTATTAATTGTCTGGCTGGCGCTAAGCCTGGCGGTGGCCTGC
-GTGCTGGCGCTGGGCAATATCAGCGATCGCATGGAGAAGGGCTTAAGCCAGCAAAGCCGTGAGTTTATGGCGGGCGATCGGGCGTTGCGCAGTTCACGCG
-AAGTGCCGCAAGCGTGGCTGGAGGAAGCGCAAAGCGCGGCCTGAAAGTCGGCAAAGCTGACTTTCGCCACAATGACCTTTGCAGGCGACACACCGCAGCT
-GGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTGAAACCGCAGGCGGGCAGCGTATTGCTGGCCC
-CACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGACGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAGTGATTCAGGAACCGGATTC
-CGGTTTTAACCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGGAGCCGTGCAGCCGGAGTCGGGTCACCTGGCGTTAT
-AAATTCGGCGGCAACGAGAACCAGCTCGACGGCTATGAGAAATGGTTGTTACCCCTCAGCTTAAACCCGAACAACGCTGGTACGGTCTGGAACAGGACGA
-AGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCTTGCTGCTGGCAGTGGCAGCGGTGGCGGTAGCGATG
-AATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCGAGCGCAACTGCGCGTAAGCTAATCGTCGGTCAGTGGTT
-GATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAACGTGTTGATGGTGCTGCTCAAGCCCGTTCTGCCTGCTGCACTAC
-CGCCAGCCAGCCTCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTGTTGCTGGCAACGCA
-GCCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCCGGA
-TTAATGGGTGGCAGCATGCTGCTTTGGGCGGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGCTGGATGCTGCTGAATGTACTTC
-GCCGCATGACGCTGAAATCGCTGCCTCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCATTTTCGCTC
-TCCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCAAGAAAGCCCGAACTACTTTTTAATTA
-ACATCGCCACAGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGGTGGTGCGGGCGCGGCTGACGGCG
-ATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGATCATAATCCGATTGTCG
-CCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCTTAAACGTTGCCCTCGGTGATACCGTGACTTTTATGGGCGA
-TACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCTGAAGGGCATTAGACG
-GGCAACCGCAGAGCTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATTAGCCTGTTAGATAT
-TGGCGCGATTTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGCCTGCGGTATGTTGCTGTT
-GCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCGTACCACGTTGTGGTG
-TGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTGTGCAGGCGAAAGTGTTTGATTTTCCGTG
-GGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCGGGCGCTGCTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAGGGTAAGGC
-GCTGTTCAGGCAGTTTGCGGGGTGATGAGAGTAAATAAGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAATATGTTTCATTGATGA
-TGTTATTGAATTGGTGATTTCCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAAATAACTCAGA
-CTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGATGAATTCATCTGTGCTAAAAATGTTAGTTTAATAAAA
-TATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGAAAAAATATATAAATACATTAGCTGGTCTTGTGTGTCATTTTAT
-TTTTTGTTGCTAACACAGGGATATGAACAATAACTAAAGGGCACTTTATGAGCGGAAAACCAGCGGCGCGTCAGGAGATATGACTCAGTATGGCGGTCCC
-ATTGTCCAGGGTTCGGCAGGTGTAAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCGGGCAACCCGGTAAATCCGCT
-GCTGGGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAGACG
-CCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGGAAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGACAACGGCGGGC
-GGAGCATTCACTTTGAGCCGCTGCTGCCGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCACAGCCGGACGGCCATACG
-CTGGCGCGGCTGTGGGGGCGCTGCCGCCGGATATCCGGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGTGATACTGGGGTGG
-TCTGAGCGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCGGGCGGACGCTGACGT
-ACCGGCGTGAGGCCGCCGGTGACCTGGCCGGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCACGCAGGCGCAGCGT
-GCGGAAGAGGCCCACCTCTTCGCTATCTTCTTCTGACAGTTCCCGCCCTCTCAGCCTCAGCGTTCCCCGACACTGCCCGGTACCGAATACGGCCCCGACA
-GGGTATCCGCCTTTCGGCGGTGTGGCTGATGCACGACCCGGCATACCCGGAGAGCCTGCCCGCTGCGCCACTGGTGCGGTACACGTATACGGAAGCCGGT
-GAACTGCTGGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCGTATGACGCGCAGCACGGGCCGGATGGTGGCGCACCGTTACGCGGGAAGGCC
-GGAGATGCGCTACCGCTACGACGATACGGGGCGGTGGTGGAGCAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAGCAGGACCGCATCACCG
-TCACCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAGGCGGGGCCGGGCTGAAACGGGTGGTGAAAAAGAACTGGCGGACGGCAGCGTCACGCGC
-AGCGGGTATGACGCGGCAGGAAGGCTCACGGCGCAGACGGACGCGGCGGGACGGAGGACAGAGTACGGTCTGAATGTGGTGTCCGGCGATATCACGGACA
-TCACCACACCGGACGGGCGGGAGACGAAATTTTACTATAACGACGGGAACCAGCTGACGGCGGTTGTCCCCGGACGGGCTGGAGAGCCGCCGGGAATATG
-ATGAACCGGGCAGGCTGGTATCGGAGACATCGCGCAGCGGGGAGACAGTACGCTACCGCTACGATGACGCGCACAGTGAGTTACCGGCGACGACAACGGA
-TGCGACGGGCAGCACCAACAGATGACCTGGAGCCGCTACGGGCAGTTGCTGGCGTTCACCGACTGCTCAGGCTACCAGACCCGTTATGAATACGACCGCT
-TCGGCCAGATGACGGCGGTCCACCGCGAGGCATCAGCCTTTACCGCCGCTATGACAACCGTGGCCGGTTAACCTCGGTGAAAGACGCACAGGGCCGTGAA
-ACGCGGTATGAATACAACGCCGCAGGCGACCTGACTGCCGTTATCACCCCGGACGGCAACCGGGCGAGACACAGTACGATGCGTGGGGAAAGGCGGTCAG
-CACCACGCAGGGCGGGCTGACGCGCAGTATGGAGTTACGATGCTGCCGGACGTGTCATCAGCCTGACCAACGAGAACGGCAGCCACAGCGTCTTCAGTTA
-CGATGCGCTGGACCGGCTGGTACAGCAGGGCGGCTTTGACGGGCGGACGCAACGTTATCATTATGACCTGACCGGAAAACTCACACCAGAGTGAGGATGA
-GGACTTGTCATCCTCTGGTACTACGATGAATCGGACCGTATCACTCACCGCACGGTGAACGGCGAACCGGCAGAGCAGTGGCAGTATGATGGCCACGGCT
-GGCTGACAGACATCAGCCACCTGAGCGAAGGCCACCGTGTTGCCGTCCACTATGGCTATGACGATAAGGCCGCCTGACCGGCGATGCCAGACGGTGGAGA
-ACCGGAGACGGGGAACTGCTGTGGCAGCATGAGACGAAAACACGCATACAACGAGCAGGGCTGGCAAACCGCGTCACGCCGGACAGCCTGCCGCCGGTGG
-AGTGGCTGACGTATGGCAGCGGTTACCTGGCGGAGATGAAGCTGGGCGGACGCCGCTGGTCAGTATACGCGGGACAGGCTGCACCGTGAGACGGTGCGCA
-GCTTCGGCAGCATGGCAGGCAGTAATGCCGCATACGAACTGACCAGCACATACACCCCGCAGGCCAGTTACAGAGCCAGCACCTGAACAGCCTGGTATAT
-GACCGTGACTACGGGTGGGTGACAACGGCGACCTGGTGCGCATCAGCGGCCCGCGACAGACGCGGGAATACGGCTACAGCGCCACAGGGCAGGCTGGAGA
-GTATGCGCACCCTCGCACCAGACCTGGACATCCGCATCCCGTATGCCCACGGACCCGGCGGGCAACCGGCTGCGGACCCGAGCTGCACCCGGACGGAAGC
-ACTCCTCACAGTGTGGCCGGATAACCGCATCGCGGAGGATGCGCACTATGTCTACCGCCACGATGAATACGGCAGGCTGACGGAAGAAGACGGACCGCAT
-CCCGGCGGGTGTGATACGGACGGACGACGAGCGGACCCACCACTACCACTACGACAGCCAGCACCGCCTGGTGTTCTACGCGGATACAGCATGGCGAGCC
-ACTGGTCGAGAGCCGCTACCTCTACGACCCGCTGGGACGGCGAATGGCAAAACAGGTCTGGCGGCGGAGCGTGACCTGGCAAGGGTGGATGTCGCTGTCG
-CGTAAACCGGAGGTGACGTGGTATGGCTGGGACGGAGACAGGCTGACGACGGTGCAGACTGACACCACACGTATCCAGACGGTATACGAGCCGGGAAGCT
-TCACGCCGCTCATCAGGTCGAGACAGAGAACGGCGAGCGGAAAAAGCGCGCAACGGCGCAGCCTGGCAAGAGACGCTCCAGCAGGAAGGAGTGAGAACGG
-CCACGGCGTGGTGGTTTCCCGGCTGAACTGGTGCGGCTGCTGGACAGGCTGGAGGAAGAAATCCGGAGCGAACCGCGTGAGCAGTAGAAAGCCGGGCGTG
-GCTGCACAGTGCGGGCTGACGGTGGAGCAACTGGCCAGACAGGTGGAGCGGAATACACACCGGCGCGAAAAGCTCATCTTTATCACTGCGACCACCGGGG
-ACTGCCGCTGGCGCTTATCGCGAAGACGGCAATACGGCGTGCTGCGCGGAATATGATGAAATTAGGGCAACCAACTTAATGAAAGGAGAACCCGCATCAT
-GTGTATCCTCAGCGTACCGTCTGCCAGGGCAGCAGCATGATGAGAATCAGGGCTATTATATAACCGTCACCGGTACTACGATCCGTTGCAGGGGCGGTAT
-ATTACTCAGGGACCCGATGGGGTTGAA
->tig00000013 len=6252 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-GCAGCTGACTTTCGCTCAATGACCTTTGCAGGCGACACACCGCAGCTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAA
-CTAATCCCCTGGCCTGAAACCGCAGGCGGGCAGCGTATTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGACGTGGGC
-GATGCCACCTTGCGGATTGCCGGAGAAGTGATTCAGGAACCGGATTCCGGTTTTAACCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGT
-CGATAAAACCGGAGCCGTGCAGCCGAGAGTCGGGTCACCTGGCGTTATAAATTCGGCGGCAACGAGAACCAGCTCGACGGCTATGAGAAATGGTTGTTAC
-CTCGGCTTAAACCCGAACAACGCTGGTACGGTCTGGAACAGGACGAAGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTTTCGGC
-GCTTCTGACCTTGCTGCTGGGCAGTGGCGCGGTGGCGGTAGCGATGAATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGG
-GCAGGGCGAGCGCAACTGCGTAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAA
-CGTGTTGATGGTGCTGCTCAAGCCCGTTCTGCCTGCTGCACTACCGCCAGCCAGCCTCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGGTCATCTCG
-CTGCTGGTGGGGCTACGACCATATCGCTTGTTGCTGGCAACGCAGCCTTTACGCGTATTATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTG
-CCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTGGGCGGTGCTGGCGGGCGCGGTAGTACTGGCTTTGC
-TGTGCGGTGTGCTGGGCTGGATGCTGCTGAATGTACTTCGCCGCATGACGCTGAAATCGCTGCCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCC
-GTGGTCAACGTTAAGTCAGCTTTCGGCATTTTCGCTCTCCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAG
-CAGCTACCTCCAGCCCGAACTACTTTTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAGGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATC
-GTTTTATCCGGTGGTGCGGGCGCGGCTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGG
-CAAAATACGCGGCCCGATCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCTTAAACG
-TTGCCCTCGGTGATACCGTGACTTTTATGGGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAA
-TTTCTATTTTATTTTCCCTGAAGGGCATTAGACGGGCAACCGCAGAGCTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCA
-ACCGCCAGTTCCCGACCATTAGCCTGTTAGATATTGGCGCGATTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGT
-GGTACTGGTCACCGCCTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGT
-GCGGGAAAAACTGCTGCGTACCACGTTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCA
-GTGTGTGCAGGCGAAAGTGTTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCGGAGCGCTGCTGCTGTCGCTTTCGGCG
-GCTGGCTGGGTGCGCGACTGGTTAAGGGTAAGGCGCTGTTCAGGCAGTTTGCGGGGGTGATGAGAGTAAATAAGGGCGTTCTGGTTGAATGGAACGCCTT
-GTTTAAATTAATTCTACAATATGTTTCATTGATGATGTTATTGAATTGGTGATTTCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATT
-GATTTTAAATATAGCCCTACAAAAATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGAATT
-CATCTGTGCTAAAAATGTTAGTTTAATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGTGAAAAATATATA
-AATACATTAGCTGGTCTTGTGTGTCATTTTATTTTTTGTTGCTAACACAGGGATATGAACAATAATAAAAAGGCACTTTATGAGCGGAAAACCAGCGGCG
-CGTCAGGAGATATGACTCAGTATGGCGGTCCCATTGTCCAGGGTTCGGCAGGTGTAAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGC
-GGGATGACTTCGGGCAACCCGGTAAATCCGCTGCTGGGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCT
-CCCGCACCTACAGCAGCTACCGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGGAAAGCGCCTTCTGATATCCGCTTACAGCTACGTGA
-TGACGGACTGATACTCAACGACAACGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGAGGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGT
-GCGCGGTGGTAAGGCAGCACAGCCGGACGGCCATACGCTGGCGCGGCTGTGGGGCGCTGCCGCCGGATATCCGGTAAGCCCGCATCTTTACCTGGCGACC
-AACAGCGCACAGGGGCCGTGGTGGATACTGGGGTGGTCTGAGCGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGTGCTTAC
-CGGGATGGCGGACCGCTTCGGGCGGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGGCCGGGGAAATCACCGGCGTGACGGACGGTGCCGGGCGG
-GAGTTCCGTCTGGTGCTGACCACGCAGGCGCAGCGTGCGGAAGAGGCCCACACCTCTTCGCTATCTTCTTCTGACAGTTCCCCCTCTCTCAGCCTCAGCG
-TTCCCCGACACACTGCCCGGTACCGAATACGGCCCCGACAGGGTATCCGCCTTTCGGCGGTGTGGCTGATGCACGACCCGGCATACCCGGAGAGCCTGCC
-CGCTGCGCCACTGGTGCGGTACACGTATACGGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCACGTATGACGCG
-CAGCACCCGGGCCGGATGGTGGCGCACCGTTACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGGCGGGGGTGGAGCAACTGAACCCGGC
-AGGGTTAAGCTACCGCTATCTTTATGAGCAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAGGCGGGGCCGGGCTG
-AAACGGGTGGTGAAAAAGAACTGGCGGACGGCAGCGTCACGCGCAGCGGGTATGACGCGGCAGGAAGGCTCACGGCGCAGACGGACGCGGCGGACGGAGG
-ACAGAGTAGGTCTGAATGTGGTGTCCGGCGATATCACGGACATCACCACACCGGACGGGCGGGAGACGAAATTTTACTATAACGACGGGAACCAGCTGAC
-GGCGGTGGTGTCCCCGGACGGGCTGGAGAGCCGCCGGGAATATGATGAACCGGGCAGGCTGGTATCGGAGACATCGCGCAGCGGGGAGACAGTACGCTAC
-CGCTACGATGACGCGCACAGTGAGTTACCGGCGACGACAACGGATGCGACGGGCGCGCACCAGATGACCTGGAGCCGCTACGGGCGGTTGCTGGCGTTCA
-CCGACTGCTCGGGCTACCAGACCCGTTATGAATACGACCGCTTCGGCCAGGATGACGGCGGTCCACCGAGAAGGCATCAGCCTTTACCGCCGCTATGACA
-ACCGTGGCCGGTTAACCTCGGTGAAAGACGCACAGGGCCGTGAAACGCGGTATGAATACAACGCCGCAGGCGACCTGACTGCCGTTATCACCCCGGACGG
-CAACCGGGCGAGACACAGTACGATGCGTGGGGAAAGGCGGTCAGCACCACGCAGGGCGGGCTGACGCGCAGTATGGAGTACGATGCTGCCGGACGTGTCA
-TCAGCCTGACCAACGAGAACGGCAGCCACAGCGTCTTCAGTTACGATGCGCTGGACCGGCTGGTACAGCAGGGCGGCTTTGACGGGCGGACGCAACGTTA
-TCATTATGACCTGACCGGAAAACTCACACAGAGTGAGGATGAGGACTTGTCATCCTCTGGTACTACGATGAATCGGACCGTATCACTCGCACGGTGAACG
-GCGAACCGGCAGAGCAGTGGTGGCAGTATGATGGCCACGGCTGGCTGACAGACATCAGCCACAGAGCGAAGGCCACCGTGTTGCCGTCCACTATGGCTAT
-GACGATAAAGGCCGCCTGACCGGCGATGCCGGGGCGGTGGAGAACCGGAGACAGGGGAACTGCTGTGGCAGCATGAGACGAAACACGCATACAACGAGCA
-GGGCTGGCAAAACCGTCACGCCGGACAGCCTGCCGCCGGTGGAGTGGCTGACGTATGGCAGCGTTACCTGGCAAAGGAATGAAGCTGGGCGGACGCCGCT
-GGTCGAATGCGGGACAGGCTGCACCGTGAGACGGTGCGCAGCTTCGGCAGCATGGCAGGCAGTAATGCCGCATACGAACTGACCAGCACATACACACCCC
-GCAGGCCAGTTACAGAGCCAGCACCTGAACAGCCTGGTATATGACCGTGACTACGGGTGGAGTGACAACGGCGACCTGGTGCGCATCAGCGGCCACGACG
-ACAGACGCGGGAATACGGCTACAGCGCCACAGGCAGGCTGGAGAGTGTGCGCACCCTCGCACCAGACCTGGACATCCGCATCCCGTATGCACGGACCCGG
-CGGGCAACCGGCTGCCGGACCCGGCTGCACCCGGACAGTACACTCACAGTGTGGCCGGATAACCGCATCGCGGAGGATGCGCACTATGTCTACCGCCACG
-ATGAATACGGCAGGCTGACGGAAGAAGACGGACCGCATCCCGGCGGGTGTGATACGGACGGACGACGAGCGGACCCACCACTACCACTACGACAGCCAGC
-ACCGCCTGGTGTTCTACACGCGGATACAGCATGGCGAGCCACTGGTCGAGAGCCGCTACCTCTACGACCCGCTGGGACGGCGAATGGCAAAACAGGTCTG
-GCGGCGGGGCGTGACCTGGCAAGGGTGGATGTCGCTGTCGCGTAAACCGGAGGTGACGTGGTATGGCTGGGACGGAGACAGGCTGACGACAGTGCAGACT
-GACACCACATATCAGACGGTATATACGAGCCGGAAGCTTCACGCCCATCATCGGGTCGAGCAAGAGAACGGCGAGCGGGAAAAGCGCGGCGGCGCAGCCT
-GGCAAGAGACGCTCCAGCAGGAAGGAGTGAGAACGGCCACGGCGTGGTGGTTTCCCGGCTGAACTGGTGCGGCTGCTGGACAGGCTGGAGGAAGAAATCC
-GGGCAGACCGCGTGAGCAGTGAAAGCCGGGCGTGGCTGCGCAGTGCGGGCTGACGGTGGAGCAACTGGCCAGACAGGTGGAGCCGGAATACACACCGGCG
-CGAAAAGCTCATCTTTCACTGCGACCAGGGGACTGCCGCTGGCGCTTATCAGCGAAGACGGCAATACGGCGTGGAGCGCGGAATATGATGGAATGGGGCA
-ACCAGCAATGAGGAGAACCCGCATCATGTGTATCAGCCGTACCGTCTGCCAGGGCAGCAGCATGATGAGGAATCAGGGCTGTACTATAACCGTCACCGGT
-ACTACGATCCGTTGCAGGGGCGGTATATTACTCCAGGACCGATGGGGTTGAA
->tig00000014 len=4278 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-TGGCGCTGGGCAATATCAGCGATCGCATGGAGAAGGGCTTAAGCCAGCAAAAGCCGTGAAGTTTATGGCGGGCGATCGGGCGTTGCGCAGTTCACGCGAA
-GTGCCGCAAGCGTGGCTGGAGGAAGCGCAAAAGCGCGGCCTGATCGGCAAACAGCTGACTTTCGCCACAATGACCTTGCAGGCGACACACCGCAGCTGGC
-GAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTGAAACCGCAGGCGGGCAGCGTATTGCTGGCCCCAC
-GCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGGCGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAGTGATTCAGGAACCGGATTCCGG
-TTTAACCCCTTCAGATGGCTCCGCGTCTGATGATGAATCGGCGGATGTCGATAAAACCGGAGCCGTGCAGCCGAAGTCAGGTCACCTGGCGTTATAAATT
-CGGCGGCAGCGAGACCAGCTCGACGGCTATGAGAAATGGTTGTTACCTCGGCTTAAACCCGAACAACGCTGGTACGGTCTGGAACAGGACGAAGGCGCGC
-TGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCTTGCTGCTGCTGGCAGTGGCGAGCGGTGGCGGTAGCGATGAATC
-ATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCGAGCGCAACTGCGTAAGCTAATCGTCGGTCAGTGGTTGATGGT
-GCTGACGCTTTCAGCCGTTACCGGTGTATAGGCCTGTTGTTCGAAAACGTGTTGATGGTGCTGCTCCGAAGCCGTTCTGCCTGCTGCACTACCGCCAGCC
-AGCCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTGTTGCTGGCAGCGCAGCGCTACGCG
-TATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGG
-CAGCATGCTGCTTTGGGCGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGCTGGATGCTGCTGAATGTACTTCGCCGCATGACGC
-TGAAATCGCTGCCCCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCATTTTCGCTCTCCTTATGCTGC
-TGGCTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCACTACCTCTCAAGCCGAACTACTTTTTAATTAACATCGCCACAGAACAGGT
-AGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGGTGGTGCGGGCGCGGCTGACGGCGATTAACGATAAGCCGACAG
-AAGGTAATGAAGATGGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGATCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAG
-CCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCTTAAACGTTGCCCTCGGTGATACCGTGACTTTTATGGGCGATACCCAGGAGTTCCGCGCTAA
-AGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCTGAAGGGCATTAGACGGGCAACCGCAGAACTGGCTTA
-CCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATTAGCCTGTTAGATATTGGCGCGATTTTTAAAACAGG
-TCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGTAGTACTGGTCACCGCCTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTG
-GGAATGCGTCAGCGTCATCAGGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGAAAAACTGCTGCGTACCACGTTGTGTGTGTGAGTTCGCCATGCTTGG
-GTTTGTTTCCGGCCTGGTGGCCGGTGGTGCGGAAACGGCGCTGGCGGTGTTGCAGGCGAAGTGTTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGA
-TTGTTCTGCCGTGCAGCAGGCGCTGCTGCTGTCGCTTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAGGGTAAGGCGCTGTTCAGGCGGTTTGCGGGG
-TGATGAGAGTAAATAAGGGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATAATTCTACCACATATGTTTCATTGATGATGTTATTGAATTGGTGATT
-TCCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAAATAACTCAGACTAATAAAATCATAAATCA
-TATGCGTTGAATGGATATTATCCATATAGTGGGCCTGTTGATGATGAATTCATCTGTGCTAAAAATGTTAGTTTAATAAAATATTGAAAGTGACCTGTAA
-TAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATAATGAAAAATATATAAATACATTAGCTGGTCTTGTGTGTCATTTTATTTTTTGTTGCTAACACA
-GGGATATGAACAATAATAACTAAAGGGCACTTTATGAGCGGAAAACCAGCGGCGCGTCAGGGAGATATGACTCAGTATGGCGGTCCCATTGTCCAGGGGT
-TCGGCAGGTGTAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCAGGCAGCCCGGTAAATCCACTGCTGGGCGAGGTG
-CTGCCCGGCGAGGGCGGACCTTGCGCTGCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAGACGCCTGCACCGGTGGGCG
-TTTTCGGCCGGTAGCTGCTGTAGGTGCAGGAGAGAATGAACGGCAGCGGGCCGGGCAGCGCAGGTCATCTCGCCGGGCAGCACCTTCGCCCCAGCAGCGG
-ATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTTGGGCGCGCCACCTGCCGAACCCTGGACAATGGGACCGCCATA
-CTGAGTCATATCTCCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTTAGTTATTGTTCATATCCCGTGTTAGCAACAAAAAAATAAAATG
-CACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAACTGTTCTCAATCAGCAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAACTA
-ACATTTTTTAGCACAGATGAATTCATCATCAACAAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTT
-TTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAATAGAAGATAGGAAATCACCAATTCAATAACATCATCAATGAAAC
-ATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCATTTACTCTCATCACCCGCAAACTGCCTGAACAGCGCCTTACCCTTAACCA
-GTCGCGCACCCAGCCAGCCGCCGAAAGCGACAGCAGCAGCGCTCCGCTGCACGGCGCAATCCACAATCGCCAGTCTGGCTCCCGGAAAATCAAACACTTT
-CGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGAAACAAACCAAGCATGGCGACTCACACCACAACGTGGTACGCAGCAGT
-TTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTG
-ACCAGTACCACCATCACTTCCAGCGCCCGATACCTGCTCCAGCACCTGACCGACCTGTTTTAAATCCCGCGCCAATATCTAACAGGCTAATGGTCGGGAA
-CTGGCGGTTGAGTTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTGGTAAGCCAGCTCTGCGGTTGCCCGTCTAATGCAGGGAAAATAAAATAGAA
-ATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCTGGGTATCGCCCATAAA
->tig00000015 len=5128 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-TTTGCAGGCAGACGTATTTGCATTAACAATGGTTCAGCGTTGGCGGCTTTGACATCCTGCAAAATCTGGCGCAGCGTTTGCTCGGTTTGCTGTGGCTGAA
-AACCACGCAAACCGTCATTGCCGCCAGTTCAACCAGCACCCAACGCGGCTGATGCTGTTTCAGCAGAGCCGGAAGGCGCGCCAGTCCTTGTTGCGAGGTG
-TCGCCGCTGATGCTGGCATTAACTACCGACGTTTTACTCTGCCACTTATCATTCAACAAGGCAGGCCAGGCCGCGCTGGCAGACATTCGATACCCGGCGC
-TCAGGCTATCACCCAGAATCAATAACGTGTCCGCTGCGGCGCTACGGAAAGTTAACTGGGACCAGGAACAGGAAGGGCAAATGCCAGCGGAAAACATTGT
-TGATTCATCATCTTAAGAAGTCCGTCGGTCAGGGGCATGAACTCTCCATCCTCACCGGAGTTGAGCTGGTTGTCAAACGGCGAGACCATCGCACTGGTGG
-GCGAGTCGGAATCGGTAAGTCAACCTTGCTGGCGATCCTCGCCGGGCTTGATGACGGCAGCAGTGGCGAAGTGAGTCTGGTGGGACAACCGCTCACATAA
-TATGGACGAAGCGCGGGCAAAGTTGCGCGCGAAGCACGTCGGCTTTGTTTTTCAGTCATTTATGTTAATTCCTACCCCAACGCGCTGGAAAACGTCGAGC
-TTCCGGCTGCTGCTGCGCGGTGAGTAGCGCGGAAAGTCGTAACGGGGCGAAAGCGTTGCTCGAACAGTTAGGGCTGGGTAAACGTCTGATCATCTTCCGG
-CACAGCTTTCCGGCGGTGAACAGCAACGAGTGGCGCTGGCACGAGCCTTTAATGGTCGACCTGATGTGCTGTTTGCCGACGAACCCACCGGCAACCTTGA
-CCGCCAGACGGGCGATAAAATTGCCGACCTGCTGTTTTCCTCAACCGTGAACATGGCACCACGTTGATTATGGTGACCCGACCTGCAACTGGCGGCACGC
-TGCGACCGCTGCTTACGGCTGGTGAACGGGCAGTTGCAGGAGGAAGCATGATTGCACGTTGGTTCTGGCGCGAATGGCGTTCGCCGTCGCTATTAATTGT
-CTGGCTGGCGCTAAGCCTGGCGGTGGCCTGCGTGCTGGCGCTGGGCAATCAGCGATCGCATGGAGAAGGGCTTAAGCCAGCAAAGCCGTGAGTTTATGGC
-GGGCGATCGGGCGTTGCGCAGTTCACGCGAAGTGCCGCAAGCGTGGCTGGAGGAAGCGCAAAGCGCGGCCTGAAAGTCGGCAAGCAGCTGACTTTCGCCA
-CAATGACCTTGCAGGCGACACACCGCAGCTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTGA
-AACCGCAGGCGGGCAGCGTATTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGACGTGGGCGATGCCACCTTGCGGAT
-TGCCGGAGAAGTGATTCAGGAACCGGATTCCGGTTTTAACCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGGAGCCG
-TGCAGCCGAAGTCGGGTCACCTGGCGTTATAAATTCGGCGGCAACGAGAACCAGCTCGACGGCTATGAGAAATGGTTGTTACCTCGGCTTAAACCCGAAC
-AACGCTGGTACGGTCTGGAACAGGACGAAGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCTTGCTGCT
-GGCAGTGGCAGCGGTGGCGGTAGCGATGAATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCGAGCGCAACTG
-CGTAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAAACGTGTTGATGGTGCTGC
-TCAAGCCCGTTCTGCCTGCTGCACTACCGCCAGCCAGCCTCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACG
-ACCATATCGCTTGTTGCTGGCAACGCAGCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTG
-TGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTGGGCGGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCT
-GGGCTGGATGCTGCTGAATGTACTTCGCCGCATGACGCTGAAATCGCTGCCTCTGCGCGCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTT
-AAGTCAGCTTTCGGCATTTTCGCTCTCCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCAA
-GCCCGAACTACTTTTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGGTG
-GTGCGGGCGCGGCTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGC
-CCGATCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCTTAAACGTTGCCCTCGGTGA
-TACCGTGACTTTTATGGGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATT
-TTCCCTGAAGGGCATTAGACGGGCAACCGCAGAGCTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCC
-GACCATTAGCCTGTTAGATATTGGCGCGATTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACC
-GCCTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTG
-CTGCGTACCACGTTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTTGCAGGCGA
-AAGTGTTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGGAGCGCTGCTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGCG
-ACTGGTTAAGGGTAAGGCGCTGTTCAGGCAGTTTGCGGGGTGATGAGTAAATAAGGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACA
-ATATGTTTCATTGATGATGTTATTGAATTGGTGATTTCCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCC
-TACAAAAATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGATGAATTCATCTGTGCTAAAA
-ATGTTAGTTTAATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGTGAAAAATATATAAATACATTAGCTGG
-TCTTGTGTGTCATTTTATTTTTTGTTGCTAACACAGGGATATGAACAATAACTAAAGGGCACTTTATGAGCGGAAAACCAGCGGCGCGTCAGGGAGATAT
-GACTCAGTATGGCGGTCCCATTGTCCAGGGTTCGGCAGGTGTAAGAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCG
-GAACCCGGTAAATCCGCTGCTGGGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGC
-AGCTACCGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGAAAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATAC
-TCAACGACAACGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGGAGGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAG
-GCAGCACAGCCGGACGGCCATACGCTGGCGCGGCTGTGGGGGCGCTGCCGCCGGATATCCGGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACA
-GGGGCCGTGGTGACTGGGGTGGTCTGAGCGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGGGATGGCGGAC
-CGCTTCGGGCGGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGGCCGGGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGG
-TGCTGACCACGCAGGCGCAGCGTGCGGAAGAGGCCCACACCTCTTCGCTATCTTCTTCTGACAGTTCCCGCCCTCTCTCAGCCTCAGCGTTCCCCGACAC
-ACTGCCCGGTACCGAATACGGCCCCGACAGGGTATCCGCCTTTCGGCGGTGTGGCTGATGCACGACCCGGCATACCCGGAGAGCCTGCCCGCTGCGCCAC
-TGGTGCGGTACACGTATACGGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCACGTATGACGCGCAGCACCCGGG
-CCGGATGGTGGCGCACCGTTACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGGCGGGTGGTGGAGCAACTGAACCCGGCAGGGTTAAGC
-TACCGCTATCTTTATGAGCAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAGGCGGGGCCGGGCTGAAACGGGTGG
-TGAAAAAGAACTGGCGGACGGCAGCGTC
->tig00000016 len=3468 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-GCATCGTACTGTGTCCCGTTTCTGCTGCCGTCGGGGCAGCCATGACGGTGGTCAGGTCACCGGCGGCTTGTATTCATACCGCGTTTCATGGCCCTGCGTG
-TCTTTCTGGCAATTAACTGTCCACGGCTGTCGTATGCGCCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCCACCTGACCAAAACGGTCATGG
-TCGCGGGTTACATAACCGGAACAGTCGTGAAGCTCAACCTTTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCA
-GGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCGGCGTA
-TTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGC
-CCGTCACCACATCCGGACTGTATTCTGTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCC
-GTCCGCGTGTTCCTTTTTCACCACTTCAGCCCGCCTTCACCCTGCGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGTCCTTCTCAT
-ACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTG
-CGCCACCATCCGGCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGGCGTCAGCCATAGC
-GCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCCAGCCACGGCAGACAGACGGATGCCGTTGTCCCGCCATATTCGGTGTAAC
-CCGGCAGGGTATCAGGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGT
-GACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCC
-GGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTG
-TTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGC
-CGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAG
-TGTGTTATCGCCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTTGTCCGGTAACTGCTGTAGG
-TGCGGGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCA
-CCCCGCCGGGGCACACCGAACAGGCCACGCCGGTGGGGGCACCGATGCGTACCCCGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCC
-TGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCATCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTT
-AAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTG
-AACATCTTCCTGATGCAAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATGTATTCAAACTCAGCAATCAATAAAAATCACCAGTTGCCTTTTCGGCC
-TGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCC
-AGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCC
-GGTGAATGGCACCGGAAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCGACCACTTATTTTTGCTTATTGA
-TGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTATATACTTTTACAC
-CCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGAGTGCAGGCGTGATAACCGGC
-GTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTT
-TTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTAC
-TTTTCGCGCTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATG
-TTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCGGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCA
-ACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGATTGCGGTGA
-TTTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCTGTG
-GCGTTGTTGATTGCACTGTTTTTATTCAACAAAGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACC
-ATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCAACCGC
-GACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCAACGGCGCTGTGCTTTGCTTTGGTGAAGTGA
->tig00000017 len=3253 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-TACACCGCCGCCAGTTCGCCGCGGGCGTCAGCCGCCAGCGCACCAGCGGCGCGGCGAGGTAAATTCTCCGGTATTCCGGGTCGTGCGTCAACCACGGCGA
-ACAGACAGATGCCGTTGTCCCGCCATATTCGGTGTAACCGGCAGGGTATCAGAAAAGCGGACGGTTCCGTCCCGCCGGAAATAATACTGCCCGGCTTCTT
-CTGCCCGCTGCGCCTGCCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCATCCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCG
-CGGTGGAACGTCTGGATGCGCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGCAGCACCTCATCCGCTTCCGGCACCCGC
-TCACACCAGCCGAGCAGCCACCACGGCCTACGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCAGAGTGCGG
-CCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCATGCGGCGTAACCCGTCTCACCGGGAAACAGGTGCTCAAATA
-TACGGGCTTCTGCCGCTGGTATCAGTGTGTTATAACGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGG
-CGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAAGAATGAACGGCAGCGGGCCGGGCAGGGCGATCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAG
-CGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACACCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACTGGCTGAACCCTGGACAATGCTAC
-CGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACGGAAACCGAATT
-TATAAAGAAAGCCTGAGGCGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCT
-AAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATATTCAAACTCAGCAATCAATAAAATCACCAGTTGCC
-TTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGA
-AGGCAGCGCCAGAACGCCCGCTGCAACCGCATGAGTGCGGCGTAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTCTCCCCTTTTGT
-ATCTACCCGGTGAATGGCACCGGAAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTT
-TGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTTACAAAGTTAAATTAATACTAAACATGGATTAAATCATGGCTTTTGCCATTTTATACT
-TTTACACCCCGCCCGCAGATTTTTGCGAAATCTTTGCAGCCAAATTCTACCTTCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTG
-ATAACCGGCGTATTGCTGGTGTTTTTATTACTGGGTTATCTGGTTTATGCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATC
-GCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTG
-AGCGCGTACTTTTCGCGCCTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGC
-TGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTTGCTAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTC
-ACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCG
-GGATTGCGGTGATTTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGAGATGCCTGGGTCGATCTGCTACGCATCGTTATGGTGCTA
-GTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACG
-GCTGTTACCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAA
-ACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGTGTGCTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGCGC
-ATGTTGCTGTGGGCGATGTCGGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGA
-CAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATT
-GCGATGCATGATTCGTTTACCGCTCGGTGGCATGGTGCCGATGTGGCTGTCACAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGC
-ATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACT
-GACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGAATGACGCCGGACGTAGCGCCATGCTCGCTATGGCC
-CGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCGGCGGATTAGCGCCAACTCTCGTTCTGGAACTG
-TTTACTGGCGTTCTGCATGTTTGTCGATCGCTTCGAATGATTATCCCGGTGAT
->tig00000018 len=7912 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-TGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTCTGGAAAGACCGCGCCCGCTTTTACAGCT
-ACCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATT
-GAAAACCGCCAGCGGAAACGCTGGCGGTTTTAATATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAAT
-ATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGGGTTTCGCCTGTCAGCAGACAAATAACCCGAT
-AAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCAT
-CGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGTGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAA
-CCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGAGCCTCGGCCCCGGCT
-GGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGG
-TGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTG
-CCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGG
-ATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGA
-ATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAG
-GCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGC
-TGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGC
-AATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACA
-GCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTG
-AAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGG
-CTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCAT
-CGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCA
-GGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCCGGAAAACC
-ATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGC
-ACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAA
-CGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGT
-CTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGC
-TGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGCTGGTCACCCACTGG
-CACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCC
-ATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGA
-ACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTAC
-GGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTT
-ATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGA
-ACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATC
-CGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCC
-GTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAACCGACCTCATCCCGGAAGGGGTTATCCGCACGGATGATGAGCGCACC
-CACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGC
-CGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCG
-ACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGC
-TGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCT
-CGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGA
-TGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCCTTATCAGCACGGAAGGGACAACAGCGTG
-GTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAG
-TCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGATCCGATTGGGCTGAAAGGGGATGGAATTTTATCAG
-TATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAGAAGCG
-GTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCAAGACCAACGGGGAGAATCAA
-AGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACT
-GTTTAAAGGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATATTCACCTATAAATTTAGGGCTATTTAAAACTGCCAAGACTGGTCT
-AATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGAGTGATGTAATGAAATATATTAT
-TTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTTCACTATTAGACTCCACTCGTGATGTGAGCGAGT
-TAATTAGTCTCATGTCTTATGGAATGATGGTAATATGTTTTCCAACAGGCATAGTATTCTTTATTGCTCTAATATTTATAGGGACTGTATCAGACATTAT
-TGGCGTAAGTTGATAGTAAGTATATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGGTATATTCAATGGTTTGTATTAAGTAAGCGCATTAT
-AAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGGCATTGATATCCCGTATGCCACAGACCCGGCAGGTAACCGCCTGCCCGACCGG
-AGCTGCACGGACAGCACCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACGGAGA
-AACCGACCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGCGGACAC
-AATATGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTGTGGCGACGTGAACGGGACCTGACGGGCTG
-GATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTAT
-CAGCCGGGGCTTCACGCCACTCATCAGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGCG
-GCGAAGACGGTGGCAGTGTGGTGTTCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGC
-CGCTGGCTGGCATCGTGCGGCCTGACGGTGGAGCAGATGCAAAACCAGATGGACCCGGTGTACACGCCGGCGCGAAAAATCCACCTGTACCACTGCGACC
-ATCGCGGCCTGCCGCTGGCGCTTGTCAGCACGGAAGGGGCAACAGAATGGTGCGCAGAATACGATGAATGGGGCAACCTGCTGAATGAAGAGAACCCGCA
-TCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGAGGTATA
-TCACTCAGGATCCGATTGGGCTGAAGGGGATGGAATTTTATCAGTATCCGCTGAATCCGGTTCAGTATATAGATTCAATGGGACTGGCATCAAAATATGG
-ACACTTAAATAATGGCGGATATGGGCGAGACCCAACAAACCGCCGCCCGATCCAAGTAAATTGCCGGACATAGCGAAACAATTAAGACTGCCATATCCTA
-TTGACCAGGCCAGTAGTGCGCCTAATGTTTTCAAAACATTCTTCAGAGCATTAAGCCCACGACTACACACTGTATTGCAGGAAGTGGGTAAAACCAAATC
-TGACTTGTACGCCACAGGATGATTCCCAGTATCCAGGGATGGATACAAAGACAGCAAGTGATTACCTGCCACAGACAAATTGGCCAACAACTCAATTACC
-ACCAGGATATACTTGTGCAGAACCCTATTTATTCCCAGACATTAATAAACCCGATGGGCCAGCAACGGGGATAGATGATTTGGGTGAAATTTTAGCTAAG
-ATGAAAGCAGAACATCGAGAGGAATAAGAAAATGAAAAGAGTTTTGTTCTTTTTGCTGATGATATTTGTTAGTTTTGGTGTTATAGCTGATTGCGAAATA
-CAAGCTAAAGATCATGATTGTTTTACTATTTTCGCTAAGGGTACTATTTTTCCGCGTTTCCTGTCTTAAATAATAAAGCCATGTGGAGATGGTATCAGAA
-TGAGGACATCGGTGAGTATTATTGGCAAACAGAACTGGGTACATGTAAAATAATAAATTCACACCAAGCGGGGCGAGACTCTTAATTCGCGTCGGGTCAC
-TACGCCTTAATGAAAATCATGCCATCAAAGGAACGTTGCAGGAGTTGATAAATACAGCAGAAAAACGGCGTTTCTCGGCGATCGGTTTAGAATATATAAG
-AGCGGGTATCTATCAAAAGAGCAGTGATCCAGTTCAGTTGTTGGCAGTCCTTGATAATTCAATCATGGTAAAATATTTTAAAGATGAGAAACCAACTTAT
-GCTCGAATGACAGCACATCTCCCGAACAAAATATGAGTCTTACGAATGTTTAATAAAGATACAGCATGAACTAATTCGTAGTGAAGAGAAATAAAATCTC
-TTCCTGAGAAAACAAATTAATCATTGTGAAAAATTATATAACTCATGGAATAGGTGTTTATTTTGCGTTCCATTTGCAGGAAAGATCACGTAACGCTACT
-TTTTGTACTAAATAATTCGAATTTTAAGTTCAACAATTGAGATACTTTATTGTCTAAAGCTGTTTTTCTAGCTTATACATGATCAAATACTCCTTACATA
-AATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTCTATTACACCCGATTACAGACAAGCCTGGAAAGTGGTGCATAAATTGTCAGATATT
-CTACTGTTGACTATTTGTGCCGTTATTTCTGGTGCAGAAGGTTGGGAAGATATAAGAGGATTTCGAAACACATCTCGATTTTTTGAAGCAATATGGTGAT
-TTTGAAAATGGTATTCCTGTTCACGATACCATTGCCAGAGTTGTATCAGGGAAAGATCACGTAACGCTACTTTTGTACTAAATAATTCGCATTTTATGTT
-TAAAAATTGAGATATTCCTTATTACCTAAAGCTGTTTTCATAGCTTATACATGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAA
-TTGATGGAACATATTTCTATTATTCCCGATTACAGATAAGCCTGGAAAGTAGAGCATAAATTGTCAGGCATCCTACTATTGACTATTTTGCCGTTATTTC
-TGGTTACGAAGTTGGGAAGATATAGAGGATTTCGAAACACATCTCGATTCTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACTGT
-TGCCAGGTTGTATCCTGTATCAGTCCTGCAAAATTTCACGAGTGCTTTATTAACTGGATGCGTGATTGCCATTCATCAAATGATAAAAGACGTCATTGCA
-ATTGATGGAAAA
->tig00000019 len=2559 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-CGGATATCCGCAGGCATTTTCCAGCCAGGGCCAGAAGCTCCCCACCAGCGCAGGCGTTTTGTCAATAACTGCTGTAGGTGCAGGAGAGAATGAACGGCAA
-CGGGCCGGGCAGGGCGATATCAGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCAGATGGTGATCACCCGCCAGGGCACCGAACAGGCCA
-CGCCGGTGGGGCACCGATGCGTACCCCAGCTGAACCCTGGACAATGCTACCACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTC
-ATCTGCTCATCCCTTGTTTTATCGGGTTATTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTCGTGAGATATCTGTCAAGATAAGAAC
-AATTAGGAAAATATTTATATATATTTTCATGAATATATCGATGTTTCGATTGGTATAACGATGTCGTATTCCTCTGAACATCTTCCTGATAAAAACCGCC
-AGCGTTTCGCTGGCGGTTTTCTAATATTCAAACTCAGCAATCAATAAAAATCACCAGTTGCCTTTTCAGGCCTGATCCATCCACCGGTTTATCGCTGGTT
-TCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATGAAATACG
-GCGGCAAGATAAGCCATGCAGGATATTCTCTGTAGGTTCCCACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCGCCGGAAAAATGAATTTGTTTAT
-CTGATGAAAATAGTACCGCCTTTTTGTGTAATTTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTTATTTACATTCATCCTGTAATTAA
-GTTACACAAAAGTTAAATTAATACTAAACGTGGTTAAATCATGGCTTTTGCCATTTTATACTTTTACACCCCGCCCACCAGATTTTTGCGAAATCTTTGC
-GTAGAATTCTACCCTTCGGTATCACTTTTAGGCCACTGGAGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTAT
-CTGGTTTATGCCTGATCAATGCGGTGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCT
-TTAGGGCAGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCTGTGCTTTTCGCGCACTTGGCGTCTCTGACCGTGAG
-ATGAACTGGAAGCTTATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAAT
-CCCACAGCAGCAGTTGCCAAGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTGTCACCAATACCAGCTGGCAATCTTATAGCGGTGAAACCAC
-GTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGAGATTTTGCCCTCATCCGTGCGTTTACCC
-GCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTC
-AACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCGTGGGGCCTGTGGCTTCTCAGGAAGC
-GATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCGATGCCAG
-CGTCTTCTTGATCCCAACGGCGCTGTGCTGCCTTTAATTTAGAAGTGATGGGCGACCGCCGCCAGGGCATGTTGCTGTGGGCGATGTCAGTGATTTTTGT
-CATCTGCGTAAGCGTGTTGATGTGGGCAGAAGTTCAGGGGTAATCCTCAATCTGCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAG
-AGAGCCGTTTCGGCGTGCTGGTCCAGTAAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTACGATGCATGATTCGTTTACACCG
-CTCTCGGTATGGTGCCGAATGTGGCTGATGCAAATTGGTGAAGTGGTGAATTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCT
-GGCGGTGATTTTAATGCCAGGCGGCTGAAGTAGTTAAGGTCCGTACCACCAGAATGTCTGGGTAAAAAATCGAGCCCGTACGCGAGATGCAACTGACTGC
-ACTGGCAATTCTGGTTACCCCGACGCTGTGCTGATGGAAGCGCAAGCGCTAGCGTGATGACCGACGCCGGACCCGAAATCAGCGCCATGCTCAACCCTGG
-CCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTATCATCCGCCGCTAACAACAACGGCA
->tig00000020 len=10292 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-TTTTCCATCAATTGCAATGACGTCTTTATCATTTGATGAATGGCAATCACGCATCCAGTTAATAAAGCACTCGTGAAATTTTGCAGGACTGATACAGGAT
-ACAACTCTGGCAATAGTATCGTGAACAGGAATACCATTTTCAAAATCACCATATTGCTTCAGAAAATCGAGATGTGTTTCCCCGTCCTCTATATCTTCCC
-AACTTTCTGCACCAGAAATAACGGCAAAATAGTCAATAGTAGGATGCCTGACAATTTATGCTCTACTTTCCAGGCTTATCTGTAATCGGGAATAATAGAA
-ATATGTTCCATCAATTTTTAAGTTCCATTTGTTCACCTTATTTATGTAAGGAGTATTTGATCATGTATAAGCTATGAAAAACAGCTTTAGGTAATAAGAA
-TATCTCAATTTTTAAACATAAAATGCGAATTATTTAGTACAAAAAGGCGTTACGTGATCTTTCCTGGGATACAACTCTGGCAATGGTATCGTGAACAGGA
-ATACCATTTTCAAAATCACCATATTGCTTCAAAAATCGAGATGTGTTTCCCCGAAATCCTCTATATCTTCCCAACCTTCTGCACCAGAAATAACGGCACA
-AATAGTCCAACAGTAGAATATCTGACAATTTATGCACCACTTTCCAGGCTTGTCTGTAATCGGGTGTAATAGAAATATGTTCCATCAATTTTTTAAGTTC
-CATTTGTTCACCTTATTTATGTAAGGAGTATTTGATCATGTATAAGCTATGAAAAACAGCTTTAGACAATAAGTAGTATCTCAATTGTTGAACTTAAATT
-CGAATTATTTAGTACAAAAAGTAGCGTTACGTGATCTTTCCTGCAAATGGAACGCAAAATAAACACCTATTCCATGAGTTATATAATTTTTCACAATGAT
-TAATTTGTTTTCTCAGGAAGAGATTTTATTTCTCTTCACTACGAATTAGTTCATGCTGTATCTTTATTAAACATTCGTAAGACTCATTTTTGTTCGGGAG
-ATGTGCTGTCATTCGAGCATAAGTTGGTTTCTCATCTTTAAAATATTTTACCATGATTGAATTATCAAGGACTGCCAACAACTGAACTGGATCACTGCTC
-TTTTGATAGATACCCGCTCTTATATAACTTCTAAACCGATCGCCGAGAAACGCCGTTTTTCTGCTGTATTTATCAACTCCTGCAACGTTCCTTTGATGGC
-ATGATTTTCATTAAGGCGTAGTGACCCGACGCGAATTAAGAGTCTCGCCCCGCTTGGTGTGAATTTATTATTTTTACATGTACCCAGTTCTGTTTGCCAA
-TAATACTCACCGATGTCCTCATTCTGATACCATCTCCACATGGCTTTATTATTTAAGACAGAAACGCGGAAAAATAGTACCCTTAGCGAAAATAGTAAAA
-CAATCATGATCTTTAGCTTGTATTTCGCAATCAGCTATAACACCAAAACTAACAAATATCATCAGCAAAAAGAACAAAACTCTTTTCATTTTCTTATTCC
-TCTCGATGTTCTCTGTTTCATCTTAGCTAAAATTTCACCCAAATCATCTATCCCTGCTGTTGCTGGCCCATCGGGTTTATTAATGTCTGGGAATAAATAG
-GGTTCTGCACAAGTATATCCTGGTGGTAATTGAGTTGTTGGCCAATTTGTCTGTGGCAGGTAATCACTTGCTGTCTTTGTATCCATCCCTGGATACTGGG
-AATCATCCTGTGGCGTACAAGTCAGATTTGGTTTTACCCACTTCCTGCAATACAGTGTGTAGTCGTAGGGCTTAATGCTCTGAAGAATGTTTTGAAAACA
-TTAGGCGCACTACTGGCCTGGTCAATAGGATATGGCAGTCTTAATTGTTTCGCTATGTCCGGCAATTTACTTGGATCGGGCGTAGGCGGTTTGTTGGGTC
-TCGCTCCATATCCGCCATTATTTAAGTGTCCATATTTTGATGCCAGTCCCATTGAATCTATATACTGAACCGGATTCAGCGGATACTGATAAAATTCCAT
-CCCCTTCAGCCCAATCGGATCCTGAGTGATATACCTCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCT
-GCCCCGGCAGGCGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTTGCCCCTTC
-CGTGCTGACAAGCGCCAGCGGCAGGCCGCGATGGTCGCAGTGGTACAGGTGGATTTTTCGCGCCGGCGTGTACACCGGGTCCATCTGGTTTTGCATCTGC
-TCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCA
-CCGGCGGAACACCACTGCCACCGTCTTCGCCGCCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCGGTTTC
-AACCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACC
-AGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGTCGCCACACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAG
-ATAGCGGCTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCC
-GTGCGGATAACCCTTCCGGGATGAGTCGGTTTTCTCCGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCC
-GGCCACATGCTGAGGGTGCTGTCCGGTGCAGCTCCGGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGCATACGGGATATCAATGCCCAGGTTACATAT
-AATAATAAGAGCAATTAACTTAATTTATTTGTTTATAATGCGCTTACTTAATACAAACCATTGAATATACCCTCCTGACAGAAAATAAAGCCATATTATT
-ATCGCCATAATATACTTACTATCAATCCTTACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGAGCAATAAAGAATACTATGCCTGTTGGAAAAC
-ATATTACCATCATTCCATAAGACATGAGACTAATTAACTCGCTCACATCACGAGTGGAGTCTAATAGTGAAAGTCTATGCATGGAAAAGAATAGTATTAA
-AAGCGATAAAGCCAGCCATATAGCTCTGAATAAAAAAATAATATATTTCATTACATCACTCCGGTGAATACAAATCTAATAAAACGTCCAATGTTATTTC
-CGGAGCACTTCATCTTACATGTTTCTAAAGAATCATTAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAATTTATAGGTGTGAATATATCAGGCAATACA
-GAATAACGCGGCCTTACCTCTTTAAACTTCCTTTTAAACAGTTCTCCACACAACTATTATCGGTTTCAACGAGGTCACAACGGCCAGCAGCTTCTTTGTA
-TCATTACTTGCTTTACCTGGCCCCCATAGACCATCTCCTTTGATTCTCCCCGTTGGTCTTGGCCACCACAAGTATAGTCCCTTTACCATCTGGGACACAA
-AGATATTGATGATAGAACGGATTCCCCATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTCTAA
-TCCTAATGGATCTATATTTGAGATCGGATTCAACGGATACTGATAAAATTCCATCCCCTTTCAGCCCAATCGGATCCTGAGTGATATATCGCCCCTGCAG
-CGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCATGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTC
-ATTCAGCAGGTTACCCCATTCATCGTATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATATGGGCCAGCGGCAGGCCGCGATGGTCGCAGTGGTAC
-AGGTGAATTTTTCGCGCCGGCGTGTATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCAC
-TCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGAACACCACACTGCCACCGTCTTCGCCACCGGACTGCTGA
-AGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCT
-GGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAG
-GTCCCGTTCACGCCGCCATACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTG
-TAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGGTCGGTTTCTCTGTCAGC
-CTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGGTGCAGCTCCGGTCGGG
-CAGGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTG
-TAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCT
-GTAACTGCCCGGCAGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTG
-TGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCCTGTGC
-GTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAA
-CCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCA
-CGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATA
-ACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATG
-ACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCGCATCGTACTGTGTCCCGTTTCTGCTGCCG
-TCCGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGT
-CGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGT
-GAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAA
-CGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGA
-CGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCT
-GTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCG
-CTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACCTGCC
-GGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTAT
-CATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGG
-TAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGA
-AAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCAC
-CATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCG
-GTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGA
-TAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCAC
-AGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCA
-GCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGAGAGAATGA
-ACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCAC
-CGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTT
-TTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAG
-ATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAA
-AAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTA
-TCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCAT
-AAGTACGGCGTAAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATG
-AATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCT
-GTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTGCGAA
-ATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTA
-TTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGT
-GCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCG
-TCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACT
-ATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAG
-CGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCC
-GTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGC
-ACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAG
-CTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTT
-CGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCG
-ATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATAT
-GGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCG
-TTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTG
-TCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCA
-ATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTA
-GCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTT
-CTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGC
-CAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGA
-ATATCTCTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGT
-GAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCG
-GTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCA
->tig00000021 len=2468 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-CCCGGTGCCCTTCGCTGATATGGCGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGG
-CGGTCTGCTTCGTCATAGTACTGGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTC
-AAAGCCGGTTTCCTGTATCAGCCGGTCGAGTCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATT
-CCATACTGCGCGTCAGACCGCCTGCGTGGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCATTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCA
-GGTCACCGGCGGCGTTGTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGCATGCGCGGTACTGACTCAGCCC
-TTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCGCAACTGACCGTAAC
-GGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAG
-GGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCTGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAG
-TAAAACGCCGATGCCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTC
-TGTGCCCTGAGCCTGCCCACCGCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTG
-CAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTCTCATACTGATACGATATTAACCGGCCTGCCGGGTTTAGCTGTTCTGTCACCC
-GCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCTG
-TATTGCTGCGGTCATACACGCCGCCAGTTCGCCGCGGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGC
-GTCAGCCACGGCAGCGACAGAGATGCCGTTGTCCCGACCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAACGGACGGTTCCGTCCGCCGGAAATGGC
-CTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCGGCACCATCCGTCACCCGGTGATTTCGCCGCTGAATTCC
-GGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCT
-TCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTG
-CCAGAGTGCGCGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAG
-GTGCTCAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGA
-GGCTCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGA
-CCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCGCCGCCGGGCACACCGAACAGGCGCCGGTGGGGCACCGATGCGTACCCCGGCTGAA
-CCCTGGGACAATGCTACGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGC
-TGACGGCGAAACCCTGGGATTTAAAGCAACAAGTGAGATATCTGTCAGATAAGAACAATTGGAAAATATTTATATATATTTCATGAATATATGTTTCGAT
-TGGTATAACGATAAAATGTTCCTGCTGAACATCTTCCAATGCACAAAACCATGACGGCGTTTCCGCTGGCGGTTTTCAATATTCAAACTCAACAATCAAT
-AAAATCACCAGTTGCCTTTCGGCCTGATCCATCCGCACCGGTTTATCGCTGGTTTTCGACCAGACGCG
->tig00000022 len=3248 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-TCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCGCCAACGGTAGCGGGTGATACATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATT
-CATCATATTCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGG
-TGATGCGCGTGATGAGGCCCGTCACCACATCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCGTCTGTGCCCTGGAGCCTGCCCACCGCGTCAAACTGA
-CTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTTCACCACCGCTGCAGCCCACCCTGCGTGCAGGACTTCACGGCAGTTCAGGCTGTCGGTGATGGTGA
-TGCGGTCCTTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGGCTGTTCTGTCACCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGC
-CCGTGTGACGGTGCGCCACCATCCGGCCCGTATATCATCGCCGATAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGG
-CGTCATCCATATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCGCCACACGGCGAGAAGACGGATGCCGTTGTCCAGC
-CATATTCGGTGTAACCCGGCAGGGTATCAGAAAAGCGGACGGTTCCGTCCCGCCGATAAGCCCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGTGGTCAGT
-ACCAGCCGGAAGTGACGCCCGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCG
-GTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCACGGCGGCAGGCAGCACCTCATCCGCTTCCGGCACCGCTCACACCAGCGAGCAGCCACCACGGCCC
-CTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGATGCGGCCAGCCGGTGACCTTCATCCAGTTTCG
-CCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAGCCGTCACCGAAACAGGTGCTCAAATACAGGCTTCTGCCGCCGTTATCACTGAGTAT
-CAGTGTGTTATCCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCACCGGCGCGGGCGTTTTTGTCCGGTAACTGCTGTAG
-GTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACG
-TCACCCCGCCGGGGCACCCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGC
-CCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAGCCAGTG
-AGATATCTGTCAGATAAGAACAATTAGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATC
-TTCCTGATGCAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATAATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCAT
-CCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAGAAGGCAGCGCCAGAAC
-GCCCGCTGCAACCGCATAAGTACGGCGTAAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGA
-ATGGCACCGGAAAAATGAATTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTT
-TATACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTTTCACCCCGCC
-CGCAGATTTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCG
-TATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTT
-TACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACT
-TTTTCGCGCCTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATG
-TTGCTCGGTCAGCACTATCTGCCGCTTAATCACAGCAGTGCCAGGGCTGTCATTGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAAC
-TGGCAATCTTATAGCGGTGAAACCACGTTGACTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATT
-TTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGAGATGCCTGGGTCGATCTGCTACGCATCACGTTATGATTACTAGTCCTGTGGCGT
-TGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCGGGCTGTGAATACCGTTGAAGGAGCGCAACTGGCTGTTTATGGG
-GCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCACTCTTCGCATCCGTTTGAACCCAACCGCGACCAAC
-TTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGT
-CGGTGATTTTGTCATCTGCGTAGGCGTGGTGATATGGGCAGAAGTTCA
->tig00000023 len=6093 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-TCAACCGTGAACATGGCACCACGTTGATTATGGTGACCCACGACCTGCAACTGGCGGCACGCTGCGACCGCTGCTTACGGCTGGTGAACGGGCAGTTGCA
-GGAGGAAGCATGATTGCACGTTGGTTCTGGCGCGAATGGCGTTCGCCGTCGCTATTAATTGTCTGGCTGGCGCTAAGCCTGGCGGTGGCCTGCGTGCTGG
-CGCTGGGCAATATCAGCGATCGCATGGAGAAGGGCTTAAGCCAGCAAAGCCGTGAGTTTATGGCGGGCGATCGGGCGTTGCGCAGTTCACGCGAAGTGCC
-GCAAGCGTGGCTGGAGGAAGCGCAAAGCGCGGCCTGAAAGTCGGCAAGCAGCTGACTTTCGCCACAATGACCTTGCAGGCGACACACCGCAGCTGGCGAA
-CGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTGAAACCGCAGGCGGGCAGCGTATTGCTGGCCCCACGCC
-TGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGGCGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAGTGATTCAGGAACCGGATTCCGGTTT
-TAACCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGGAGCCGTGCAGCCGAGAGTCGGGTCACCTGGCGTTATAAATT
-CGGCGGCAACGAGAACCAGCTCGACGGCTATGAGAATGGTTGTTACCTCAGCTTAAACCCGAACAACGCTGGTACGGTCTGGAACAGGACGAAGGCGCGC
-TGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCTTGCTGCTGGCAGTGGCAGCGGTGGCGGTAGCGATGAATCATTA
-CTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCGAGCGCAACTGCGTAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTG
-ACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAACGTGTTGATGGTGCTGCTCAAGCCCGTTCTGCCTGCTGCACTACCGCCAGCCAG
-CCTCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTGTTGCTGGCAACGCAGCCTTTACGC
-GTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTG
-GCAGCATGCTGCTTTGGGCGGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGCTGGATGCTGCTGAATGTACTTCGCCGCATGAC
-GCTGAAATCGCTGCCCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCATTTTCGCTCTCCTTTATGCT
-GCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCAGAAAGCCCGAACTACTTTTTAATTAACATCGCCACAG
-AACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGGTGGTGCGGGCGCGGCTGACGGCGATTAACGATAAG
-CCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGATCATAATCCGATTGTCGCCGGTAACTGGC
-CGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCTTAAACGTTGCCCTCGGTGATACCGTGACTTTTATGGGCGATACCCAGGAGTT
-CCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCTGAAGGGCATTAGACGGGCAACCGCAGA
-GCTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATTAGCCTGTTAGATATTGGCGCGATTTT
-AAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGCCTGCGGTATGTTGCTGTTGCTGGCACAGGT
-GCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCGTACCACGTTGTGGTGTGAGTTCGCCAT
-GCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGCGGAAACGGCGCTGGCAGTGTTGCAGGCGAAAGTGTTTGATTTTCCGTGGGAGCCAGACTGGCGA
-TTGTGGATTGTTCTGCCGTGCAGCGGAGCGCTGCTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAGGGTAAGGCGCTGTTCAGGCAGTT
-TGCGGGGTGATGAGAGTAAATAAGGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAATATGTTTCATGATGATGTTATTGAATTGGT
-GATTTCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAAATAACTCAGACTAATAAAATCATAAA
-TCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGATGAATTCATCTGTGCTAAATGTTAGTTTAATAAAATATTGAAAGTGACCTGTA
-ATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGTGAAAAATATATAAATACATTAGCTGGTCTTGTGTGTCATTTTATTTTTTGTTGCTAACACA
-GGGATATGAACAATAACTAAAAGGGCACTTTATGAGCGGAAAACCAGCGGCGCGTCAGGAGATATGACTCAGTATGGCGGTCCCATTGTCCAGGGTTCGG
-CAGGTGTAAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCGGGCAACCCGGTAAATCCGCTGCTGGGGGCGAAGGTG
-CTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAGACGCCTGCACCGGTGGGCG
-TTTTCGGCCCCGGCTGAAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGACAACGGCGGGCGGAGCATTCACTTTGAG
-CCGCTGCTGCCGGGAGGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCACAGCCGGACGGCCATACGCTGGCGCGGCTG
-TGGGGGCGCTGCCGCCGGATATCCGGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGTGATACTGGGGTGGTCTGAGCGGGTG
-CCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCGGACGCTGACGTACCGGCGTGAGGCCGC
-CGGTGACCTGGCCGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCACGCAGGCGCAGCGTGCGGAAGAGGCCCACCTC
-TTCGCTATCTTCTTCTGACAGTTCCCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACACTGCCCGGTACCGAATACGGCCCCGACAGGGTATCCGCCTTT
-CGGCGGTGTGGCTGATGCACGACCCGGCATACCCGGAGAGCCTGCCCGCTGCGCCACTGGTGCGGTACACGTATACGGAAGCCGGTGAACTGCTGGCGGT
-ATATGACCGCAGCAATACGCAGGTGCGCGCTTTCACGTATGACGCGCAGCACCCGGCCGGATGGTGGCGCACCGTTACGCGGGAAGGCCGGAGATGCGCT
-ACCGCTACGACGATACGGGGCGGGTGGTGGAGCAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAGCAGGACCGCATCACCGTCACCGACAG
-CCTGAACCGGCGTGAGGTGCTGCATACAGAAGGCGGGGCCGGGCTGAAACGGGTGGTGAAAAAGAACTGGCGGACGGCAGCGTCACGCGCAGCGGGTATG
-ACGCGGCAGGAAGGCTCACGGCGCAGACGGACGCGGCGGGACGGAGGACAGAGCGGTCTGAATGTGGTGTCCGGCGATATCACGGACATCACCACACCGG
-ACGGGCGGGAGACGAAATTTTACTATAACGACGGAACCAGCTGACGGCGGTGGTGTCCCCGGACGGGCTGGAGAGCCGCCGGAATATGATGAACCGGGCA
-GGCTGGTATCGGAGACATCGCGCAGCGGGGAGACAGTACGCTACCGCTACGATGACGCGCACAGTGAGTTACCGGCGACGACAACGGATGCGACGGGCAG
-CACCGGCAACAGATGACCTGGAGCCGCTACGGGCGGTGCTGGCGTTCACCGACTGCTCAGGCTACCAGACCCGTTATGAATACGACCGCTTCGGCCAGAT
-GACGGCGGTCCACCGCGAGAGGCATCAGCCTTTACCGCCGCTATGACAACCGTGGCCGGTTAACCTCGGTGAAGACGCACAGGGCCGTGAAACGCGGTAT
-GAATACAACGCCGCAGGCGACCTGACTGCCGTTATCACCCCGGACGGCAACCGGGCGAGACACAGTACGATGCGTGGGGAAAGGCGGTCAGCACCACGCA
-GGGCGGGCTGACGCGCAGTATGGATTACGATGCTGCCGGACGTGTCATCAGCCTGACCAACGAGAACGGCAGCCACAGCGTCTTCAGTTACGATGCGCTG
-GACCGGCTGGTACAGCAGGGCGGCTTTGACGGGCGGACGCAACGTTATCATTATGACCTGACCGGAAAACTCACACAGAGTGAGGATGAGGACTTGTCAT
-CCTCTGGTACTACGATGAATCGGACCGTATCATCACCGCACGGTGAACGGCGAACCGGCAGAGCAGTGGCAGTATGATGGCCACGGCTGGCTGACAGACA
-TCAGCCACCTGAGCGAAGGCCACCGTGTTGCCGTCCACTATGGCTATGACGATAAAGGCCGCCTGACCGGCGAATGCCAGACCCGGTGGAGAACCCGGAG
-ACAGGGGAACTGCTGTGGCAGCATGGGACGAAACACGCATACAACGAGCAGGGGCTGGCAAACCGCGCGTCGCCGGACAGCCTGCCGCCGGTGGAGTGGC
-TGACGTATGGCGTTACCTGGCGGGAATGAAGCTGGGCGACGCCGCTGGTCGATATACGCGGGACAGGCTGCACCGTGAGACGGTACGCAGCTTCGGCAGC
-ATGGCAGGCAGTAATGCCGCATACGAACTGACCAGCTTTGCACCCCGCAGGCCAGTTACAGAGCCAGCACCTGAACAGCCTGGTATGACCGTGACTACGG
-GTGGAGTGACAACGGCGACCTGGTGCGCATCAGCGGCCGCGACAGACGCGGGAATACGGCTACAGCGCCACGGGCAGGCTGGAGGTGTGCGCACCTCGCA
-CCAGACCTGGACATCCGCATCCCGTATGCCACGGACCCGGCGGGCAACCGGCTGCGGGCCAGAGCTGCACCCGGACGGTACACTCACAGTGTGGCCGGAT
-AACCGCATCGCGGAGGATGCGCACTATGTCTACCGCCACGATGAATACGGCAGGCTGACGGAGAAGAAGACGGACCGCATCCCGGCGGGTGTGATACGGA
-CGGACGACGAGCGGACCCACCACTACCACTACGACAGCCAGCACCGCCTGGTGTTCTACACGCGGATACAGCATGGCGAGCCACTGGTCGAGAGCCGCTA
-CCTCTACGACCCGCTGGGACGGCGAATGGCAAAACGGGTCTGGCGGCGGGGCGTGACCTGGCAAGTGGATGTCGCTGTCGCGTAAACCGGAGGTGACGTG
-GTATGGCTGGGACGGAGACAGGCTGACGACAGTGCAGACTGACACCACACGTATCAGACGGTATACGAGCCGGGAAGCTTCACGCCGCTCATC
->tig00000024 len=6552 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-CTGTCTCCCCGCTGCGCGATGTCTCCGATACCAGCCTGCCCGGTTCATCATATTCCGGCGGCTCTCCAGCCCGTCCGGGGACACCACCGCCGTCAGCTGG
-TTCCGTCGTTATAGTAAAATTTCGTCTCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCGTACTCTGTCCTCCGTCCG
-CCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCCGTTTCAGCCCGGCC
-CCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCA
-GTTGCTCCACCACCGCCCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGTGCTGCGCGTCATACG
-TGAAAGCGCGCACCTGCGTATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATGCGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTC
-CGGGTATGCCGGGTCGTGCATCAGCCACACCGCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCAGTGTCGGGGAACGCTGAGGCTGAG
-AGAGGGCGGGAACTGTCAGAAGAAGATAGCGAAGAGGTGGGCCTCTTCCGCACGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCG
-TCCGTCACGCCGGTGATTTCCCCGGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGAAAGCACCCGGTA
-CGGCGGCAGCGGCGGCGCTGGCAGTACGTCCTCAGCACCCGGCACCCGCTCAGACCACCCCAGTATCCACCACGGCCTGTGCGCTGTTGGTCGCCAGGTA
-AAGATGCGGGCTTAACCGGATATCCGGCGGCAGCGCCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACA
-TTGACTCACTGCGGCTGTACACCGCCTCCCGGCAGCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCT
-GTAAGCGGATATCAGAAGGCGCTTTCCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAA
-CGGCAGCGGGCCGGGCAGCAAGGTCCGTCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACAC
-CGAGCACGCCACGCCGGTGGGCGCGCCAATCTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCTGACGCGCCGCTGGTTT
-TCCGCTCATATAAAGTGCCCTTTTAGTTATTGTTCATATCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTT
-CATAAACTTATTTGTTCTCAATCAACAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTTAGCACAGATGAATTCATCATCAA
-CAAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCC
-ACCGATTCAGATTAATATCAGCAATAGAAAGATAGAAATCACCAATTCAATAACATCATCAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCC
-ATTCAACCAGAACGCCCCTTATTTACTCTCATCACCCGCAAACTGCCTGAACAGCGCCTTACCCTTAACCAGTCGCGCACCCAGCCAGCCGCCGAGCGAC
-AGCAGCAGCGCTCCGCTGCACGGCAGAACAATCCACAATCGCCAGTCTGGCTCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTC
-CGCACCAATTGCGGCCACCAGGCCGGAAACAAACCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCA
-CACCACCAGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGC
-GCCCGACTTACCTGCTCCAGCACCTGACCGACCTGTTTTAAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAAC
-ATGCCGTTGCCATTCTCCCAGCGGAAACTGGTAAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACT
-TTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTC
-GCCAGCCCCTCTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCCGCGTATTTTGCCAGGTAAGATTGA
-GTTCGCGGTTAAGCGCCTCATCTTCATTACCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCGCACCACCGGATAAAACGATTCCGGGACTATC
-TGATGTTCCGCGAGGAACGCTTTTAGCGGTGCTACCTGTTCTGTGGCGATGTTAATTAAAAAGTAGTTCGGGCTTTCTGGGGTAGCTGCTGCTGCCAGCG
-GTCGAGCAGATCGCCACGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAAC
-AGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTA
-CTACCGCGCCCGCCAGCACCGCCCAAAGCAGCATGCTGCCACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTT
-CAGCGGCCAGACGTTCGCTACCACATCATTACGTAATACGCGTAAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCCACCAGCAGCGAGATG
-ACCGTCATGGTGCCAAGCGCCCACAGCCACGGCCAGAGGCTGGCTGGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTCGAA
-CAACAGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGTCAGCACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCGCTCGCCCTGCCCCCAGC
-GTTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACAGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCGAAA
-GCAGCAGGAACTGTTGCGAGCGTTCCATCGATCGCCCCAGCGCGCCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTAAGCTGAGGTAACAA
-CCATTTCTCATAGCCGTCGAGCTGGTTCTCGTTGCCGCCGAATTTATAACGCCAGGTGACCCGACTCCCCGGCTGCACGGCTCCGGTTTTATCGACATCC
-GCCAGATTCATCATCAGACGCGGAGCCATCTGGAAGGGTTAAAACCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCGCAAGGTGGCATCGCCCAC
-GTCAATGGTGTCGCCCGTTTTCAGGTTAAGCAGTGCCATCAGGCGTGGGGCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGGGGATTAGTTTGCA
-GATCGCCATACATCGGGTAGATATCATCCACCGCTTTGACGTTCGCCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTGGCGAAAGTCAGCTGCTTGCC
-GACTTTCAGGCCGCGCTTTGCGCTTCCTCCAGCCACGCTTGCGGCACTTCGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTTGCT
-GGCTTAAGCCCTTCTCCATGCGATCGCTGATATTGCCCAGCGCCAGCACGCAGGCCACCGCCAGGCTTAGCGCCAGCCAGACAATTAATAGCGACGGCGA
-ACGCCATTCGCGCCAGAACCAACGTGCAATCATGCTTCCTCCTGCAACTGCCCGTTCACCAGCCGTAAGCAGCGGTCGCAGCGTGCCGCCAGTTGCAGGG
-TCGTGGGTCACCATAATCAACGTGGTGCCATGTTCACGGTTGAGGAAAACAGCAGGTCGGCAATTTTATCGCCCGTCTGGCGGTCAAGGTTGCCGTGGGT
-TCGTCGGCAAACAGCATCAGGTCGACCATTAAAGGCTCGTGCCAGCGCTTCCTCGTTGCTGTTCACCGCCGGAAAGCTGTGCCGGAAGATGATCAGACGT
-TTACCCAGCCCTAACTGTTCGAGCAACGCTTTCGCCCCGTTACGACTTTCCGCGCTTTCTCACCGCGCAGCAGGGCGGAAGCTCGACGTTTTCCAGCGCG
-TTAAGGTAGGAATTAACATAAATGACTGAAAAACAAAGCCGACGTGCTTCGCGCGCAACTTTGCCCGCTTCTTCGTCCATATTATGGCGGTTGTCCCACC
-AGACTCACTTCGCCACTGCTGCCGTCATCAAGCCCGGCGAGGATCGCCAGCAAGGTTGACTTACCCGATCCCGACTCGCCCACCAGTGCGATGGTCTCGC
-CGTTTGACAACCAGCTCAACTCCGGTGAGGATGGAGAGTTCATGCTCCCCTGACCGACGGACTTCTTAAGATGATGAACTTCAACAATGTTTTCCGCTGG
-CATTTGCCCTTCCTGTTCCTGGTCCCATTAACCTTCCGTGCCGCCGCAGCGACACGTTATTGATTCTGGGTGATAGCCTGAGCGCCGGGTATCGAATGTC
-TGCCAGCGCGGCCTGGCCTGCCTTGTTGAATGATAAGTGGCAGAGTAAAACGTCGGTAGTTAATGCCAGCATCAGCGGCGACACCTCGCAACAAGGACTG
-GCGCGCCTTCCGGCTCTGCTGAAACAGCATCAGCCGCGTTGGGTGCTGGTTGAACTGGGGGCAATGACGGTTTGCGTGGTTTTCAGCCACAGCAAACCGA
-GCAAACGCTGCGCCAGATTTTGCAGGATGTCAAAGCCGCCAACGCTGAACCATTGTTAATGCAAATACGTCTGCCTGCAAACTATGGTCGCCGTTATAAT
-GGAAGCCTTTAGCGCCATTTACCCCAAACTCGCCAAAGAGTTTGATGTTCCGCTGCTGCCCTTTTTATGGAAGAGGTCTACCTCAAGCCACAATGGATGC
-AGGATGACGGTATTCATCCCAACCGCGACGCCCAGCCGTTTATTGCCGACTGGATGGCGAAGCAGTTGCAGCCTTTAGTAAATCATGACTCATAAAGCAA
-CGGAGATCCTGACAGGTAAAGTTATGCAAAAATCGGTCTTAATTACCGGATGTTCCAGTGGAATTGGCCTGGAAAGCGCGCTCGAATTAAAACGCCAGGG
-TTTCATGTGTGCTGGCAGGTTGCCGGAAACCGGATGATGTTGAGCGCGCGAACAGCATGGGATTTACCGGCGTGTTGATCGATCTGGATTCACCAGAAAG
-TGTTGATCGCGCAGCCGACGAGGTGATCGCCTGACCGATAGTGTCTGTATGGGATCTTTAACAATGCCGGATTCGGCATGTATGGCTACTTTCCACCATC
-AGCCGTGCGCAGATGGAACAGCAGTTTCCGCCAACTTTTCGGCGCACACCAGCTCACCATGCGCTGTTACCCGCGATGTTACCGCACGGTGAAGGGCGTA
-TTGTGATGACATCATCGGTGATGGGATTAATCTCCCGCCGGGTCGTGGCGCTTACGCGGCCAGTAAATATGCGCTGGAGGCGTGGTCAGATGCACTGCGC
-ATGGAGCTGCGCCACAGCGGAATTAAAGTCAGCCTGATCGAACCCGGTCCCATTCGTACTCGCTTCACCGACAACGTCAACCAGACGCAAAGTGATAAAC
-CAGTCGAAAATCCAGCATCGCCGCCCGCTACGTTGGGACCGGAAGCGGTGGTGGACAAAGTACGCCATGCTTTTATTAGCGAAGCCGAAGATGCGCTATC
-CGGGCGGCGCTGTTGACCTGGGCGGTAATGTGCTTAAGCGCCTGCTGCAGGGGCGCGTGATGGACAAAATATTGCAGGTGAGGTTGAAGCGCGCTTAAAG
-CCCCATGTCAAAGAAAATATCGACAACAGAGAGCGACTCCATGTCCGTAGAAAATATTGTCAACATTAACGAATCTAACCTGCAGCAGGTTCTGAACAGT
-CGATGACCACTCCGGTGCTGTTCTGTTTTGGTCTGAACGTAGCCAGCACTGT
->tig00000025 len=4554 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-GGTTCCGTCGTTATAGTAAAATTTCGTCTCCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCATACTCTGTCCTCCGT
-CCCGCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCCGTTTCAGCCC
-GGCCCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGG
-TTCAGTTGCTCCACCACCCGCCCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGCGT
-CATACGTGAAAGCGCGCACCTGCGTATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATACGTGTACCGCACCAGTGGCGCAGCGGGCAG
-GCTCTCCGGGTATGCCGGGTCGTGCATCAGCCACACCGCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCGGTGTGTCGGGGAACGCTG
-AGGCTGAGAGGGCGGGAACTGTCAGAAGAAGATAGCGAAGAGGGGCCTCTTCCGCGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCAC
-CGTCCGTCACGCCGGTGATTTCCCGGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGGCACCCAATACG
-GCGGCAGCGGCGCTGGCAGTACGTCCTCAGCACCCGGCACCCGCTCAGACCACCCCAGTATCACCACGGCCCCTGTGCGCTGTTGGTCGCCAGGTAAAGA
-TGCGGGCTTAACCGGATATCCGGCGGCAGCGCCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACATTGA
-CTCACTGCGGCTGTACACCGCCTCCCCGGCAGCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTA
-AGCGGATATCAGAAGGCGCTTTCCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGG
-CAGCGGGCCGGGCAGCGCAAGGTCCGTCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACC
-GAGCACGCCACGCCGGTGGGCGCGCCAATTCTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCCTGACGCGCCGCTGGTT
-TTCCGCTCATATAAAGTGCCCTTTAGTTATTGTTCATATCCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTT
-TTCACATAAACTTATTTGTTCTCAATCAACAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTTACACAGATGAATTCATCAT
-CAACAAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAAC
-TCCACCGATTCAGATTAATATCAAATAGAAAGAAGATCACCAATTCAATAACATCATCAATAACACATATTGTAGAATTAATTTAAACAAGGCGTTCCAT
-TCAACCAGAACGCCCCTATTTCTCATCACCCCCAAACTGCCTGAACAGCGCCTTACCCTTAACCAGTCGCGCACCCAGCCAGCCGCCGAAAGCGACAGCA
-GCAGCGCTCCGCTGCACGGCAGAACAATCCACAATCGCCAGTCTGGCTCCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGC
-ACCAATTGCGGCCAGGCCGGAAACAAACCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCAC
-CAGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGA
-CTTACCTGCTCCAGCTGACCGACCTGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGC
-CATTCTCCCAGCGGAAACTGGTAAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCC
-ACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCCT
-CTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTT
-AAGCGCCTCATCTTCATTACCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCGCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCG
-CGAGGAACGCTTTTAGCGGTGCTACCTGTTCTGTGGCGATGTTAATTAAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCTGCCAGCGGTCGAGCAG
-ATCGCCACGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTA
-ACCGCCAGGCGCAGAGGCAGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTACTACCGCGC
-CCGCCAGCACCGCCCAAAGCAGCATGCTGCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACG
-TTCGCTACCACATCATTACGTAATACGCGTAAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCCACCAGCAGCGAGATGACCGTCATGGTGC
-CAAGCGCCCAGCCACGGCCAGAGGCTGGCTGGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTCGAACAACAGGCCTATGGC
-CCCACCGGTAACGGCTGAAAGCGTCAGCACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCATCGCCCTGCCCCCAGCGTTTTGAGGATCGCCA
-CCAGATCGTAGCGACTGCGACAGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCGAAAGCAGCAGGAACTGTTG
-CGAGCGTTCCATCGATCGCCCCAGCGCGCCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTAAGCTGAGGTAACAACCATTTCTCATAGCCG
-TCGAGCTGGTTCTCGTTGCCGCCGAATTTATAACGCCAGGTGACCCGACTCCCCGGCTGCGGCTCCGGTTTTATCGACATCCGCCAGATTCATCATCAGA
-CGCGGAGCCATCTGGAAGGGTTAAAACCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCGCAAGGTGGCATCGCCCACGTCAATGGTGTCGCCCGT
-TTTCAGGTTAAGCAGTGCCATCAGGCGTGGGGCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGGGGATTAGTTTGCAGATCGCCATACATCGGGT
-AGATATCATCCACCGCTTTGACGTTCGCCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTGGCGAAAGTCAGCTGCTTGCCGACTTTCAGGCCGCGCTT
-TGCGCTTCCTCCAGCCACGCTTGCGGCACTTCGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTTGCTGGCTTAAGCCCTTCTCCA
-TGCGATCGCTGATATTGCCCAGCGCCAGCACGCAGGCCACCGCCAGGCTTAGCGCCAGCCAGACAATTAATAGCGACGGCGAACGCCATTCGCGCCAGAA
-CCAACGTGCAATCATGCTTCCTCCTGCAACTGCCCGTTCACCAGCCGTAAGCAGCGGTCGCAGCGTGCCGCCAGTTGCAGGTCGTGGGTCACCATAATCA
-ACGTGGTGCCATGTTCACGGTTGAGGGAAACAGCAGGTCGGCAATTTTATCGCCCGTCTGGCGGTCAAGGTTGCCGGTGGGTTCGTCGGCAAACAGCACA
-TCAGGTCGACCATTAAAGGCTCGTGCCAGGCCTCACTCGTTGCTGTTCACCGCCGGAAAGCTGTGCCGGAAGATGATCAGACGTTTACCCAGCCCTAACT
-GTTCGAGCAACGCTTTCGCCCCGTTACGACTTTCCGCTTCTCTCACCGCGCAGC
->tig00000026 len=6347 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-ACAGTGCTGGCTGCGTTCAGACCAAATAAGAACAGCACCGGAGTGGTCATCGACTGTTCAGAACCTGTTGCAGGTTAGATTCGTTAATGTTGACAATATT
-TTCTACGGACATGGAGTCGCTCTCTGTTGTCGATATTTTCTTTGACATGGGGAAGATAAGCGCGCTTCAACTCACCTGCAATATTTTGTCCATCACGCGC
-CCCGGCAGCAGGCGCTTAAGCACCATTACCGCCCAGGTCACCAGCGTCACCGGATAGCGCATCTTCGGCTTCTCGCTAATAAAAGCATGGCGTACTTTGT
-CCACCACCGCTTCCGGTCCCAACGTAAAGCGGGCGGCGATGCCGGATTTTCGACTGGTTTATCACTTTGCGTCTGGTTGACGTTGTCGGTGAAGCGAGTA
-CGAATGGGACCGGGTTCGATCAGGCTGACTTTAATTCCGCTGTGGCGCAGCTCCATGCGCAGTGCATCTGACCACGCCTCAGCGCATATTTACTGGCCGC
-GTAAGCGCCACGACCATTGCGGGAGATTAATCCCATCACCGATGATGTCATCACAATACGCCCTTCACCGTGTTTATCGCGGGTAACAGGCGCATGGTGA
-GCTGGTGTGCGCCGAAAAGTTGGCGGAAACTGCTGTTCCATCTGCGCACGGCTGATGGTTGGAAAGTCGCCATACCGGAATCCGGCATTGTTAAAGATCC
-CATACAGACATGGTATCGGTCAGGCGATCGTCGGCTGCGCGATCAACACTTTCTGGTGAATCCAGATCGATCAACACGCCGGTAATCCCATGCCGTTCGC
-CGCTCAACATCATCCGGTTTCCGCAACCTGCCACGCATGAAAACCCTGGCGTTTTAATTCGAGCGCGCTTTCCAGGCCAATTCCACTGGAACATCCGGTA
-ATTAAGACCGATTTTTGCATAACTTTACCTGTCAGGATCTCCGTTGCTTTATGAGTCATGATTTACTAAAGGCTGCAACTGCTTCGCCATCCAGTCGGCA
-ATAAACGGCTGGGCGTCGCGTTGGGATGAATACCGTCATCCTGCATCCATTGTGGCTTGAGGTGGACCTCTTCCATAAAAAGGGCAGCAGCGGAACATCA
-AACTCTTTGGCGAGTTTGGGGTAAATGCGCTAAAGGCTTCCATTATAACGGCGACCATAGTTTGCAGGCAGACGTATTTGCATTAACAATGGTTCAGCGT
-TGGCGGCTTTGACATCCTGCAAAATCTGGCGCAGCGTTTGCTCGGTTGCTGTAAAACCACGCAAACCGTCGTTGCCTGAGTTCAGCCAGCACCCAACGCG
-GCTGATGCTGTTTCAGCAGAGCCGGAAGGCGCCAGTCCTTGTTGCAGAGGTGTCGCCGCTGATGCTGGCATTAACTACCGTTTACTCTCGCTTATCATTC
-AACAAGGCAGGCCAGGCCGCGCTGGCAGACATTCGATACCCGGCGCTCAGGCTATCACCCAGAATCAATATGTCGCTGCGGCGGCACGGAAGGTTAATGG
-GACCAGGGAAGGGCAAATGCCAGCGGAAAACATTGTTGAAGTTCATCATCTTAGAAGTCCGTCGGTCAGGGAGTATGAACTCTCATCCTCACCGGAGTTG
-AGCTGGTTGTCAAACGTGAGACCATCGCACTGGTGGGCGAGTCGGGATCGGTAAGAATCAACTGCTGGCGATCCTCGCCGGGCTTGATGACGGCAGCAGT
-GGCGAAGTGAGTCCGGTGGGACAACCGCCATAATATGGACGAAGGCGCGGGCAAAGTTGCGCGAAAGCACGTCGGCTTTGTTTTTCAGTCATTTATGTTA
-ATTCCTACCTTAACGCGCTGGAAAACGTCGAGCTTCCAGCTGCTGCTGCGCGGTGAGTAAGCGCGGAAAGTCGTAACGGGGCGAAAGCGTTGCTCGAACA
-GTTAGGGCTGGGTAAACGTCTGGATCATCTTCCGGCACAGCTTTCCGCGGTGAACAGCAACGAAACTGGCACGAGCCTTTAATGGTCGACCTGATGTGTG
-CTGTTTGCCGACAACCCACCGGCAACCTTGACCGCCAGACGGGCGATAAAATTGCCGACCTGCTGTTTTCCTCAACCGTGAACATGGCACCACGTTGATT
-ATGGTGACCCACGACCTGCAACTGGCGGCACGCTGCGACCGCTGCTTACGGCTGGTGAACGGGCAGTTGCAGGAGGAAGCATGATTGCACGTTGGTTCTG
-GCGCGAATGGCGTTAATTATTGTCTGGCTGGCGCTAAGCCTGGCGGTGGCCTGCGTGCTGGCGCTGGGCAATATCAGCGATCGCATGGAGAAGGGCTTAA
-GCCAGCAAAGCCGTGAGTTTATGGCGGGCGATCGGGCGTTGCGCAGTTCACGCGAAGTGCCGCAAGCGTGGCTGGAGGAAGCGCAAAGCGCGGCCTGAAA
-GTCGGCAAGCAGCTGACTTTCGCCACAATGACCTTTGCAGGCGACACACCGCAGCTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCG
-ATCTGCAAACTAATCCCCTGGCCTGAAACCGCAGGCGGGCAGCGTATTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATT
-GGCGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAGTGATTCAGGAACCGGATTCCGGTTTTAACCCTTCCAGATGGCTCCGCGTCTGATGATGAATCT
-GGCGGATGTCGATAAAACCGGAGCCGTGCAGCCGGAAGTCAGGTCACCTGGCGTTATAAATTCCAGCAACAGCAGAACCAGCTCGACGGCTATGAAATGG
-TTGTTACCTCGGCTTAAACCCGAACAACGCTGGTACGGTCTGGAACAGGACGAAGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGC
-TTTCGGCGCTTCTGACCTTGCTGCTGGCAGTGGCAGCGGTGGCGGTAGCGATGAATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAAC
-GCTGGGGGCAGGGCGAGCGCAACTGCGTAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTG
-TTCGAAAACGTGTTGATGGTGCTGCTCAAGCCCGTTCTGCCTGCTGCACTACCGCCAGCCAGCCTCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGG
-TCATCTCGCTGCTGGTGGGCTACGACCATATCGCTTGTTGCTGGCAACGCAGCCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTG
-AAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTGGGCGGTGCTGGCGGGCGCGGTAG
-TACTGGCTTTGCTGTGCGGTGTGCTGGGCTGGATGCTGCTGAATGTACTTCGCCGCATGACGCTGAAATCGCTGCCTCTGCTGGCGGCGGTTAGCCGCCT
-GTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCATTTTCGCTCTCCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGAC
-CGCTGGCAGCAGCAGCTACTCAGCCCGAACTACTTTTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAAGCGTTCCTCGCGGAACATCAGATAG
-TCCCGGAATCGTTTTATCCGGTGGTGCGGGCGCGGCTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAA
-TCTTACCTGGCAAAATACGCGGCCCGATCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAA
-CGCTTAAACGTTGCCCTCGGTGATACCGTGACTTTTATGGGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTC
-TGCGGCCTAATTTCTATTTTATTTTCCCTGAAGGGGGCAGACGGGCAACCGCAGAGCTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGA
-CACAACTCAACCGCCAGTTCCCGACCATTAGCCTGTTAGATATTGGCGCGATTTTAAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGG
-AAGTGATGGTGGTACTGGTCACCGCCTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCG
-CACACTCGGTGCGGGAAAAACTGCTGCGTACCACGTTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAAC
-GGCGCTGGCAGTGTTGCAGGCGAAAGTGTTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCGGAGCGCTGCTGCTGTCG
-CTTTGGCGGCTGGCTGGGTGCGCGACTGGTTAAGGGTAAGGCGCTGTTCAGGCAGTTTGCGGGGATGATAGAGTAGTAAGGGGCGTTCTGGTTGAATGGA
-ACGCCTTGTTTAAATTAATTCTACAATATGTTTCATGATGATGTTTTGAATTGGTGATTTCCTATCTTTCTATTGCTGATATTATCTGAATCGGTGGAGT
-TTATTGATTTTAAATATAGCCCTACAAAAATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGAT
-GATGAATTCATCTGTGCTAAAAATGTTAGTTTAATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGTGAAA
-ATATATAAATACATTAGCTGGTCTTGTGTGTCATTTTATTTTTGTTGCTAACACAGGGATATGAACAATAACTAAAGGGCACTTTATGAGCGGAAAACCA
-GCGGCGCGTCAGGAGATATGACTCAGTATGGCGGTCCCATTGTCCAGGGTTCGGCAGGTGTAAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGT
-CCGGGCGGGATGACTTCGGGCAACCCGGTAAATCCGCTGCTGGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCAT
-TCTCTCCCGCACCTACAGCAGCTACCGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGAAAGCGCCTTCTGATATCCGCTTACAGCTAC
-GTGATGACGGACTGATACTCAACGACAACGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGAGGCGGTGTACAGCCGCAGTGAGTCAATGTGGC
-TGGTGCGCGGTGGTAAGGCAGCACAGCCGGACGGCCATACGCTGGCGCGGCTGTGGGGCGCTGCCGCCGGATATCCGGTTAAGCCCGCATCTTTACCTGG
-CGACCAACAGCGCACAGGGGCCGTGGTGATACTGGGGTGGTCTGAGCGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGGTG
-CTTACCGGGATGGCGGACCGCTTCGGGCGGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACCGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAG
-TTCCGTCTGGTGCTGACCACGCAGGCGCAGCGTGCGGAAGAGGCCTCTTCGCTATCTTTCTGACAGTTCCCGCCCTCTCAGCCTCAGCGTTCCCCGACAC
-CTGCCCGGTACCGAATACGGCCCCGACAGGGTATCCGCCTTTCGGCGGCTGATGCACGACCCATACCCGGAGAGCCTGCCCGCTGCGCCACTGGTGCGGT
-ACACGTACGGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCATACGCAGGTGCGCGCTTTCACGTATGACGCGCAGCACCCGGATGGTGGCGCACC
-GTTACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGGCGGTGGTGGAGCAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAG
-CAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAGGCGGGGCCGGGCTGAAACGGGTGGTGAAAAAGAACTGGCGGA
-CGGCAGCGTCACGCGCAGCAGTATGACGCGGCAGGAAGGCTCACGGCGCAGACGGACGCGGCGGGACGGAGGACAGAGTACGGTCTGAATGTGGTGTCCG
-GCGATATCACGGACATCACCACACCGGACGGGCGGAGACGAAATTTT
->tig00000027 len=2253 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-TCTGGCATTCGCCGGTCAGGCGGCCTTTATCGTCATAGCCATAGTGGACGGCAACACGGTGGCCTTCGCTCAATTGGCTGATGTCTGTCAGCCAGCCGTG
-GCCATCATACTGCCACTGCTCTGCCGGTTCGCCGTTCACCGTGCGGTGATGATACGGTCCGATTCATCGTAGTACCAGAGGATGACAAGTCCTCATCCTC
-ACTCTGTGTGAGTTTTCCGGTCAGGTCATAATGATAACGTTGCGTCCGCCCGTCAAAGCCGCCGCCCTGCTGTACCAGCCGGTCCAGCGCATCGTAACTG
-AAGACGCTGTGGCTGCCGTTCTCGTTGGTCAGGCTGATGACACGTCCGGCAGCATCGTAATCCATACTGCGCGTCAGCCTGCGTGGTGCTGACCGCCTTT
-CCCCACGCATCGTACTGTGTCTCGCTCGGTTGCCGTCCGGGGTGATAACGGCAGTCAGGTCGCCTGCGGCGTTGTATTCATACCGCGTTTCACGGCCCTG
-TGCGTCTTTCACCGAGGTTAACCGGCCACGGTTGTCATAGCGGCGGTAAAGGCTGATGCCTTCCTCGCGGTGGACCGCCGTCATCATCTGGCCGAAGCGG
-TCGTATTCATAACGGGTCTGGTAGCCCGAGCAGTCGGTGAACGCCAGCAACGCTGCCGTAGCGGCTCCAGGTCATCTGCCGGTGCTGCCGTCGCATCCGT
-TGTCGTCGCCGGTAACTCACTGTGCGCGTCATCGTAGCGGTAGCGTACTGTCTCCCCGCTGCGCGATGTCTCCGATACCAGCCTGCCCGGTTCATCATAT
-TCCGGCGGCTCTCCAGCCCGTCCGGGGACACCACCGCCGTCAGCTGGTTCCGTCGTTATAGTAAAATTTCGTCTCCCGCCCGTCCGGTGTGGTGATGTCC
-GTGATATCGCCGGACACCACATTCAGACCGTACTCTGTCCTCCGTCCCGCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCGCTGCGCGT
-GACGCTGCCGTCCGCCAGTTCTTTTTCACCACCCGTTTCAGCCCGGCCCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGA
-TGCGGTCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCAGTTGCTCCACCACCCGCCCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCT
-TCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGCGTCATACGTGAAAGCGCGCACCTGCGTATTGCTGCGGTCATATACCGCCAGCAGTTCA
-CCGGCTTCCGTATACGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCATCAGCCACACCGCCGAAAGGCGGATACCCT
-GTCGGGGCCGTATTCGGTACCGGGCGGTGTGTCGGGGAACGCTGAGGCTGAGAGGGGCGGGAACTGTCAGAAGAAGATAGCGAAGAGGTGTGGGCCTCTT
-CCGCACGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCCCGGCCAGGTCACCGGCGGCCTCACGC
-CGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGGTAAGCACCCGGTACGGCAGCAGCGGCGCTGGCAGTACGTCCTCAGCACCCGGCACCCGCT
-CAGACCACCCCAGTATCACCACGGCCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCTTAACCGGATATCCGGCGGCAGCGCCCCCACAGCCGCGC
-CAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCCGGCAGCAGCGGCTCAAAGT
-GAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTTCCAGCCGGGGCCGAAAACGCCCAC
-CGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAGGTCCGTCTCGCCGGGCAGCACCTTC
-GCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCCAATTCTTACACCTGCCGAAC
-CCTGGACAATGGGACCGCCATACTGAGTCATATCTCTGACGCGCCGCTGGTTT
->tig00000028 len=3886 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-GCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCCGGCAGCGAAGTGAAT
-GCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTTCCAGCCGGGGCCGAAAACGCCCACCGGT
-GCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAGGTCCGTCTCGCCGGGCAGCACCTTCGCCA
-GCAGCGGATTTACCGGGTTGCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCCAATCTTACACCTGCCGAACCCTGGACAA
-TGGGACCGCCATACTGAGTCATATCTCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTAGTTATTGTTCATATCCTGTGTTAGCAACAAA
-AAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTCACATAAACTTATTTGTTCTCAATCAACAACAACTGTTATTACAGGTCACTTTCAA
-TATTTTATTAAACTAACATTTTAGCACAGATGAATTCATCATCAACAAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTATTA
-GTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAATAGAAAGATGGAAATCACCAATTCAATAACA
-TCATCAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTTACTCATCACCCGCAAACTGCCTGAACAGCGCC
-TTACCCTTAACCAGTCGCGCACCCAGCCAGCCGCCGAGCGACAGCAGCAGCGCTCCGCTGCACGGCAGAACAATCCACAATCGCCAGTCTGGCTCCACGG
-AAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAAACAAACCTGGCGAACTCACACCACAACGTG
-GTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATA
-CCGCAGGCGGTGACCAGTACCATCACTTCCAGCGCCCGACGCTCCAGCACCTGACCGACCTGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCG
-GGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTGGTAAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCTTCAGGGAAA
-ATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTAT
-CACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCCTCTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGG
-CCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCATTACCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCCGCACCACC
-GGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAGGAACGCTTTTAGCGGTGCTACCTGTTCTGTGGCGATGTTAATTAAAAAGTAGTTCGGGCTTT
-CTGGGTAGCTGCTGCTGCCAGGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGAGCGAAAATGCCGAAAGCTGACTT
-AACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCA
-GCACACCGCACAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCATACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGAC
-AATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTAATACGCGTAAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGC
-CCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCACAGCCACGGCCAGAGGCTGGCTGGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCA
-TCAACGTTTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGTCAGCACCATCAACCACTGACCGACGATTAGCGCGCAGTTGCGCTCG
-CCCTGCCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACAGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTC
-AGAAGCGCCGAAAGCAGCAGGAACTGTTGCGAGCGTTCCATCGATCGCCCCAGCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTAAGCTGA
-GGTAACAACCATTTCTCATAGCCGTCGAGCTGGTTCTCGTTGCCGCCGAATTTATAACGCCAGGTGACCCGACTCCCCGGCTGCGGCTCCGGTTTTATCG
-ACATCCGCCAGATTCATCATCAGACGCGGAGCCATCTGGAAGGGTTAAAACCGGAATCGGTTCCTGAATCACTTCTCCGGCAATCCGCAAGGTGGCATCG
-CCCACGTCAATGGTGTCGCCCGTTTTCAGGTTAAGCAGTGCCATCAGGCGTGGGGCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGGGGATTAGT
-TTGCAGATCGCCATACATCGGGTAGATATCATCCACCGCTTTGACGTTCGCCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTGGCGAAAGTCAGCTGC
-TTGCCGACTTTCAGGCCGCGCTTTGCGCTTCCTCCAGCCACGCTTGCGGCACTTCGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCT
-TTGCTGGCTTAAGCCCTTCTCCATGCGATCGCTGATATTGCCCAGCGCCAGCACGCAGGCCACCGCCAGGCTTAGCGCCAGCGCCAATAATAATGACGGC
-GACGGCGACGCCAGAGACCAACGTGCAATCATGCTTCTCCTGCAACTGCCCGTTCACCAGCCGTAAGCAGCGGTCGCAGCGTGCCGCCAGTTGCAGGTCG
-TGGTCACCATAATCAACGTGGTGCCATGTTCACGGTTGAGAAAACAGCAGGTCGGCAATTTTATCGCCCGTCTGGCGGTCAAGGTTGCCGGTGGGTTCGT
-CGGCAAACAACAGCACATCAGGTCGACCATTAAAGGCTCGTGCCAGCGCCACTCGTTGCTGTTCACCGCCGGAAAGCTGTGCCGGAAGATGATCAGACGT
-TTACCCAGCCCTAACTGTTCGAGCAACGCTTTCGCCCCGTTACGACTTTCCGCGCGCTCTCACCGCGCAGCAGGGCAGCCGGAGCTCGACGTTTTCCAGC
-GCGTTAAGGGTAGGAATTAACATAAATGACTGAAAAACAAAGCCGACGTGCTTCGCGCGCAACTTTGCCCTTCTTCGTCCATATTATGTAGCGGTTGTCC
-CCCAGACTCACTTCGCCACTGCTGCCGTCATCAAGCCCGGCGAGGATCGCCAGCAAGGTTGACTTACGATCCGACTCGCCCACCAGTGCGATGGTCTCGC
-CACGTTTGACAACCAGCTCAACTCCGGTGAGGATGGAGTTCATGCTCCCTGACCGACGGACTTCTTAAGATGATGAACTTCAACAA
->tig00000029 len=5498 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-TTCAACCCCATCGGGTCCTGAGTAATATACCGCCCCTGCAACGGATCGTAGTACCGGTGACGGTTATAGTACAGCCCTGATTCCTCATCATGCTGCTGCC
-CTGGCAGACAATACGGCTGGGATACACACATGATCACGGGTTCTCCCCTCATTCCAGCTGGTTGCCCCATTCATCATATTCCGCGCTCCACGCCGTATTT
-GCCGTCTTCGCTGATAAGCGCCAGCGGCATCCCAGTGGTCGCAGTGATGAATGAGCTTTTCGCGCCGGTGTGTATTCCGGCTCCACCTGTCTGGCCAGTT
-GCTCCACCGTCAGCCCGCACTGCGCAAGCCGCGCCCGGCTTTCACTGCTCACGCGGTCTGCCCGGTTTCTTCCTCCAGCCTGTCCAGCAGCCGCACCAGT
-TCAGCCGGGAACACCACCACGCCGTGGCCGTTCTCCACTCCTTCCTGCTGGAGCGTCTCTGCCAGGCTGCGCCGCTGCGCTTTTCCGCTCGCCGTTCTCT
-GTCCTCGACCCGATGGTGGCGTGGGCTCCCCGGCTCATGTATACCGTCTGGATACGTGTGGTGTCAGTCTGCACCGTCGTCAACCTGTCTCCGTCCCAGC
-CATACCACGTCACCTCCGGTTTACGCGACAGCGGTATCCACCCGTCAGGTCACGCTCCCGCCGCCAGACCCGTTTTGCCATTCGCCGTCCCAGCGGGTCG
-TAGAGGTAGCGGCTCTCGACAGTGGCTCGCCATGCTGTATCCGCGTGTAGAACACCAGGCGGTGCTGGCTGTCGTAGTGGTAGTGGTGGGTCCGCTCGTC
-GTCCGTCCGTATCACACCCGCCGGGATGCGGTCCGTCTTCTCCGTCAGCCTGCCGTATTCATCGTGGCGGTAGACATAGTGCGCATCCTCCGCGATGCGG
-TTATCCGGCCACACTGTGAGTGTTGCTGTCCGGGTGCAGCTCCGGTCCGGCAGCCGGTTGCCCGCCGGGTCCGTGGCGCTACGGGATGCGGATGTCCAGG
-TCTGGTGCGAGGTGCGCACTCTCCAGCCTGCCCGTGGCGCTGTAGCCGTATTCCCGCGTCTGTCGCCCAGCCGCTGATGCGCACCAGGTCGCCGTTGTCC
-TCCACCCGTAGTCACGGTCATATACCAGGCTGTTCAGGTGCTGGCTCTGTAACTGGCCTGCGGGGGTGTATGTGCTGGTCAGTTCGTATGCGGCATTACT
-GCCGCCTGCCATGCTGCCGAAGCTGTACCGTCTCACGGTGCAGCCTGTCCCGCGTATACTCGACCGGCGGCGTCGCCCAGCTTCATTCCGCCAGGTAACC
-GCTGCCATACGTCAGCCTCCACCGGCGGCAGGCTGTCCGGCGTGACGCGGTTTTGCCAGCCCTGCTCGTTGTATGCGTGTTTCGTCTCATGCTGCCACAG
-CAGTTCCCCGTCTCCGGGTTCTCCACCGTCTGGCATTCTGCGCCAGTCAGGCGGCGCTATCGTCATAGCCATAGTGGACGGCAACACGGTGGCCTTCGCT
-CAATTGGCTGATGTCTGTCAGCCAGCCATGTGCCATCATACTGCCACTGCTCTGCCGGTTCGCCGTTCACCGTGCGGTGGTGATACGGTCCGATTCATCG
-TAGTACCAGAGGATGACAAGTCCTCATCCTCACTCTGGTGTGAGTTTTCCGGTCAGGTCATAATGATAACGTTGCGTCCGCCCGTCAAAGCCGCTGCTGT
-ACCAGCCGGTCCAGCGCATCGTAACTGAAGACGCTGTGGCTGCCGTTCTCGTTGGTCAGGCTGATGACGTCCGGCAGCATCGTAATCCATACTGCGCGTC
-AGCCCGCCCTGCGTGGTGCTGACCGCCTTTCCCCACGCATCGTACTGTGTCTCGCTCCGGTTGCCGTCCGGGGTGATAACGGCAGTCAGGTCGCCTGCGG
-CGTTGTATTCATACCGCGTTTCACGGCCCTGTGCGTCTTTCACCGAGGTTAACCGGCCACGGTTGTCATAGCGGCGGTAAAGGCTGATGCCTTCCTCGGT
-GGACCGCCGTCATCTGGCCGAAGCGGTCGTATTCATAACGGGTCTGGTAGCCCGAGCAGTCGGTGAACGCCAGCAACTGCCCGTAGCGGCTCCAGGTCAT
-CTGCCGGTGCTGCCCGTCGCATCCGTTGTCGTCGCCGGTAACTCACTGTGCGCGTCATCGTAGCGGTAGCGTACTGTCTCCCCGCTGCGCGATGTCTCCG
-ATACCAGCCTGCCCGGTTCATCATATTCCGGCGGCTCTCCAGCCCGTCCGGGACACCACCGCCGTCAGCTGGTTCCGTCGTTATAGTAAAATTTCGTCTC
-CGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCATACTCTGTCCTCCGTCCCGCCGCGTCCGTCTGCGCCGTGAGCCTTC
-CTGCCGCGTCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCGTTTCAGCCCGGCCCCGCCTTCTGTATGCAGCACCTCACGCC
-GGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTAACCCTGCCGGGTTCAGTTGCTCCACCACGCCCCGTATCGTCGTA
-GCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGCGTCATACGAAAGCGCGCACCTGCGTATTGCTGCGGTC
-ATATACCGCCAGCAGTTCACCGGCTTCCGTATACGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCATCAGCCACACC
-GCCGAAGGCGGATACCTGTCGGGGCCGTATTCGGTACCGGGCGGTGTCGGGGAACGCTGAGGCTGAGAGAGGGCGGGAACTGTCAGAAGAAGATAGCGAA
-GAGGTGCGGGCCTCTTCCGCACGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCTGGCCAGGTCA
-CCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGGTAAGCACCGGTACGGCGGCAGCGGCGCTGGCAGTACGTCCTCAGC
-ACCCGGCACCCGCTCAGACCACCCCAGTATCACCACGGCCCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGAACCGGATATCCGGCAGCGCCCACAA
-CCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCGGCAGCAGCGGCTC
-AAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTTCCAGCCGGGGCCGAAAACG
-CCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAAATGAACGGCAGCGGGCCGGGCAGCGCAAGTCCGTCTCGCCGGGCAGCACC
-TTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCCAATCTTGCCGAACCCTG
-GACAATGGGACCGCCATACTGAGTCATATCTCCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTTAGTTATTGTTCATATCCCTGTGTTA
-GCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAACTTATTTGTTCTCAATCAACAACAACTTTATTACAGGTC
-ACTTTCAATATTTTATTAAACTAACATTTTAGCACAGATGAATTCATCATCAACAAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGA
-TTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAATAGAAAGATAGAAAATCACCAAT
-TCAATAACATCATCAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTTACTCATCACCCCAAACTGCCTGA
-ACAGCGCCTTACCCTTAACCAGTCGCGCACCCAGCCAGCCGCCGAAAGCGACAGCAGCAGCGCTCCGCTGCACGGCAGAACAATCCACAATCGCCAGTCT
-GGCTCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAAACAAACCAAGCATGGCGAAC
-TCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGTGCC
-AGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGCACCTGACCGACCTGTTTTAAAATCGCGC
-CAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTGGTAAGCCAGCTCTGCGGTTG
-CCCGTCTAATGCCCTTCAGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCTGGGT
-ATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCTCTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTACCGG
-CGACAATCGGATTATGATCGGGCCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTACCTTCTGTCGGCTTATCGTTAAT
-CGCCGTCAGCCGCGCCCGCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCGCGAGGAACGCTTTTAGCGGTGCTACCTGTTCTGTGGCGATGT
-TAATTAAAAAGTAGTTCGGGCTTTCTGGGTAGCTGCTGCTGCCAGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGA
-GCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGCAGCGATTTCAGCGTCATGCGGCGAAGT
-ACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCATGCTGCCACCCATTAATCCGGCGAG
-CAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTAATACGCGTAAAGGCTGCGTTGCC
-AGCAACAAGCGATATGGTCGTAGCCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCAGCCACGGCCAGAGGCTGGCTGGCGGTAGTGCAG
+>tig00000003 len=5660 reads=1 class=unassm suggestRepeat=no suggestBubble=no suggestCircular=no trim=0-5660
+AGTCCGTCGGTCAGGGAGCATGAACTCTCATCCTCACCGGAGTTGAGCTGGTTGTCAAACGTGCGAGACCATCGCACTGGTGGGCGAGTCGGATCGGTAA
+GTCAACCTTGCTGGCGATCCTCGCCGGGCTTGATGACGGCAGCAGTGGCGAAGTGAGTCTGGTGGACAACCGCTACATAATATGGACGAAGCGCGGGCAA
+AGTTGCGCGCGAAGCCGTCGGCTTTGTTTTTCAGTCATTTATGTTAATTCCTACCCTTAACGCGCTGGAAAACGTCGAGCTTCCGGCTGCTGCTGCGCGG
+TGAGTAGCGCGGAAAGTCGTAACGGGGCGAAAGCGTTGCTCGAACAGTTAGGGCTGGGTAAACGTCTGGATCATCTTCCGGCACAGCTTTCCGGCGGTGA
+ACAGCAACGAGTGGCGCTGGCACGAGCCTTTAATGGTCGACCTGATGTGCTGTTTGCCGACGACCCACCGGCAACCTTGACCGCCAGACGGGCGATAAAA
+TTGCCGACCTGCTGTTTCCCTCAACCGTGAACATGGCACCACGTTGATTATGGTGACCCACGACCTGCAACTGGCGGCACGCTGCGACCGCTGCTTACGG
+CTGGTGAACGGGCAGTTGCAGGAGGAAGCATGATTGCACGTTGGTTCTGGCGCGAATGGCGTTCGCCGTCGCTATTAATTGTCTGGCTGGCGCTAAGCCT
+GGCGGTGGCCTGCGTGCTGGCGCTGGGCAATATCAGCGATCGCATGGAGAAGGGCTTAAGCCAGCAAAGCCGTGAAGTTTATGGCGGGCGATCGGGCGTT
+GCGCAGTTCACGCGAAGTGCCGCAAGCGTGGCTGGAGGAAGCGCAAAGCGCGGCCTGAAAGTCGGCAAAGCTGACTTTCGCCACAATGACCTTGCAGGCG
+ACACACCGCAGCTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTGAAACCGCAGGCGGGCAGC
+GTATTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGGCGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAGTGATTC
+AGGAACCGGATTCCGGTTTTAACCCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGGAGCCGTGCAGCCGGAGTCGGG
+TCACCTGGCGTTATAAATTCGGCGGCAACGAGAACCAGCTCGACGGCTATGAGAAATGGTTGTTACCCCTCAGCTTAAACCCGAACAACGCTGGTACGGT
+CTGGAACAGGACGAAGGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCTTGCTGCTGGCAGTGGCAGCG
+GTGGCGGTAGCGATGAATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCAGCGCAACTGCGCGTAAGCTAATC
+GTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAACGTGTTGATGGTGCTGCTCAAGCCCGTTCT
+GCCTGCTGCACTACCGCCAGCCAGCCTCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTG
+TTGCTGGCAACGCAGCCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGC
+TGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTGGGCGGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGCTGGATGCT
+GCTGAATGTACTTCGCCGCATGACGCTGAAATCGCTGCCTCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTT
+CGGCATTTTCGCTCTCCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCAAGAAAGCCCGAA
+CTACTTTTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGGTGGTGCGGG
+CGCGGCTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGATCA
+TAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCTTAAACGTTGCCCTCGGTGATACCGTG
+ACTTTTATGGGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCTG
+AAGGGCATTAGACGGGCAACCGCAGAGCTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATT
+AGCCTGTTAGATATTGGCGCGATTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGCCTGCG
+GTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCGTA
+CCACGTTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTGTGCAGGCGAAAGTGT
+TTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCGGGCGCTGCTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGCGACTGG
+TTAAGGGTAAGGCGCTGTTCAGGCAGTTTGCGGGGTGATGAAGTAAATAAGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAATATG
+TTTCATTGATGATGTTATTGAATTGGTGATTTCCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAA
+AAATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGATGAATTCATCTGTGCTAAAAATGTT
+AGTTTAATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTATATGTGAAAAATATATAAATACATTAGCTGGTCTT
+GTGTGTCATTTTATTTTTTGTTGCTAACACAGGGATATGAACAATAACTAAAGGGCACTTTATGAGCGGAAAACCAGCGGCGCGTCAGGGAGATATGACT
+CAGTATGGCGGTCCCATTGTCCAGGGTTCGGCAGGTGTAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCGGGCAAC
+CCGGTAAATCCGCTGCTGGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTA
+CCGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGGAAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAAC
+GACAACGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCACAGCC
+GGACGGCCATACGCTGGCGCGGCTGTGGGGGCGCTGCCGCCGGATATCCGGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGT
+GATACTGGGGTGGTCTGAGCGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCGGG
+CGGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGGCCGGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCAC
+GCAGGCGCAGCGTGGAAGAGGCCCACCTCTTCGCTATCTTCTTCTGACAGTTCCCGCCCTCTCAGCCTCAGCGTTCCCCGACACTGCCCGGTACCGAATA
+CGGCCCCGACAGGGTATCCGCCTTTCGGCGGTGTGGCTGATGCACGACCCGGCATACCCGGAGAGCCTGCCGCTGCGCCACTGGTGCGGTACACGTATAC
+GGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCGTATGACGCGCAGCACGGGCCGGATGGTGGCGCACCGTTACG
+CGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGGCGGTGGTGGAGCAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAGCAGGAC
+CGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAGGCGGGGCCGGGCTGAAACAGGTGGTGAAAAAGAACTGGCGGACGGCAG
+CGTCACGCGCAGCAGGTATGACGCGGCAGGAAGGCTCGGCGCAGAAGACGGACGCGGCGGGACGGAGGACAGAGTACGGTCTGAATGTGGTGTCCGGCGA
+TATCACGGACATCACCACACCGGACGGGCGGGAGACGAAATTTTACTATAACGACGGGAACCAGCTGACGGCGGTTGTCCCCGGACGGGCTGGAGAGCCG
+CCGGGAATATGATGAACCGGGCAGGCTGGTATCGGAGACATCGCGCAGCGGGGAGACAGTACGCTACCGCTACGATGACGCGCACAGTGAGTTACCGGCG
+ACGACAACGGATGCGACGGGCAGCACCAACAGATGACCTGGAGCCGCTACGGGCAGTTGCTGGCGTTCACCGACTGCTCAGGCTACCAGACCCGTTATGA
+ATACGACCCTTCGGCCAGATGACGGCGGTCCACCGCGAGGCATCAGCCTTTACCGCCGCTATGACAACCGTGGCCGGTTAACCTCGGTGAAAGACGCACA
+GGGCCGTGAAACGCGGTATGAATACAACGCCGCAGGCGACCTGACTACCGTTATCACCCCGGACGGCAACCGGGCGAGACACAGTACGATGCGTGGGGAA
+AGGCGGTCAGCACCACGCAGGGCGGGCTGACGCGCAGTATGGAATACGATGCTGCCGGACGTGTCATCAGCCTGACCAACGAGAACGGCAGCCACAGCGT
+CTTCAGTTACGATGCGCTGGACCGGCTGGTACAGCAGGGCGGCTTTGACGGGCGGACGCAACGTTATCATTATGACCTGACCGGAAAACTCACACCAGAG
+TGAGGATGAGGACTTGTCATCCTCTGGTACTACGATGAATCGGACCGTATCACTCACCGCACGGTGAACGGCGAACCGGCAGAGCAGTGGCAGTATGATG
+GCCACGGCTGGCTGACAGACATCAGCCACCTGAGCGAAGGCCACCGTGTTGCCGTCCACT
+>tig00000004 len=11393 reads=1 class=unassm suggestRepeat=no suggestBubble=no suggestCircular=no trim=0-11393
+TGAATCACGCGGGCGGCTAAATCGACGGTAACATCGGAAAATTTTACCAGCGGATCGGGCGCGGTGGTGGCAGAGTGTAGCGGCGTAACGACGCGCAGAC
+GGGCCTGCAATTCGCCAATGCCAAACGGCTTACTCGATAATCATCCGCTCCGGCATCCAGCGCGGCGATTTTGTCGCTCTTTGCTGCGCGTGCGGAAAGC
+ACAATCACCGGCACCGCGCTCCACTGGCGCAGGTCGCGGATAAACTCAATCCCATCACCATCGGGCAGGCCGAGATCGAGAATAATCAAATCTGGCTTAC
+GGGTTGCCGCTTCCAGCAAGCCGCGTTGCAGCGTTTCGGCCTCAAAGACGCGCATCCGTCGCCCTCCAGCGCCGTGCGCAGAAAGCGACGAATAGCCTGT
+TCATCTTCAACAATCAGAACGTTTGTCACATATCCTCATGAAATTCTTCAGTTCAGGGGCAGTTTGCTGGGGAAGTGTAACACGAAAACAGGCACCACCT
+TCCGGTCGGTTGAACGCGGTAATAGTGCCCCCGTGTACATCCACTATCGCCCGACAAATTGCCAGTCCAAGCCCTACCCCCGTACTGCCGACTCTTTTAT
+TCCCGCGAGCAAACTTATCAAATATCGTCTGCTCCTGGCCTGGCGGAAGACCGGGGCCGTTATCCCAGACATCCAGTTGTAGATTTTCGCCCTCAACGTG
+GGCATCGATACCAATTTCGGCCTGCGCACCGCATATTTCACCGCGTTCTCCAGCAGATTAATCAGCACCCGTTCAAGAGTGGCCCGTCAACGTGGATTAA
+GGTCAGCGGTTCTGGCAGAGAAAGATTGATGGGCGACGATAAACCCGGTTCCAGCATTTGCAGCGCTGCCGACTACTTCTTCCAGCGTTAACCACTCTTT
+CTTCAAATTAAAGCCGCCGGACTGAATTCGCGCCATATCCAGTAGATTATTCACCAGTCGGGTAGTGTTCAGCATGCTGACGGATCTCGCTGGCCTGGCG
+GGCGTGGGTGATCCTCGCTTCGCCAGATCGAGCGTTAAGATTTCTGCCTGACCAAACAGCACCGTAAGCGGCGTGCGTAAATCATGCGAAAGCGCCGCCA
+GCAGGGCGTTGCGGATCTGTTCACGTTCGCTTGCCATCCGCGCCTGTTCTTCGCTGGCGGTTAGCGTCAGCCGCTCAGGGCATTGGCGACTAACAGCGTA
+ACGTCTCCAGCAGGCGCTGCTGTTCCGGATCATCAACTGGCGCAGATCCCCGGCTCCACCACCACCAGCCCGTAGGTTTTCTCGCCGCTTTTAGCGGCAA
+AATCTGGCACGGTACACCGGGTAACGTGTCGGTGCCCGCGCCCGCAGGCAGGCCTTTATCAAAACTCCACTGCGCGATGGCATCGTCCCACGGCGTCATT
+CCTTGCGGATGTGTTAACGGCTGCAATTTACCGTTGTCATCGGGCAACAACACCTGACTGCGGGCATGAAACGTGGAGGCAATAAATTGTTCGCTGGTGG
+CAGCGATATCCTGCGGACTGCGGCCCACCGCCAGAGCTTTCGACATTTCATATAAGTGCCGTGTGCGTTGCTCGCGGTAACGGGCTACCCGCGCCTGATA
+ACGCACGCCAGCAGTAAGGTTCCCGATCACCAGCCCGACGGTTAACATCACCGCGAAGGTCAGCAGATATTGCACATCAGAGACGGCGAGCGTGCCGCGT
+GGGGCGATAAAAAGAGATCGAAACTCACTACATTAATGACGGTGGCAACCACTGAAGGCCAGCGTCCATAAAATAGCGCCACCACCACCACGCCAAGCAG
+ATACAGCATCACCAGGTTGGCGGCATCAAACGCCATCAGCCACTGCATGGCAATTAAGGTGATAACGGCGCATAACGCGGCGGCAACCACGCATCCCTGA
+ATTTGTACACGCCACTTGTCTTTAAAAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTGGTTCATCAAGCGCGACCAGCACCTGATCGAGAT
+CGGGGCGATGCGCGCCAGTCGGTCAGCAAACGTTTCCCGACGCCCACCAGCGGCGCGAGGCCGGGCGACCGAGAATAATCTTGCCGAGATTATGTTCACG
+GGCATAACGCACTACCGCTTTCTCTTCCGCTGGATCAGAAAGTGTTGCCGTCTCGCGCCCAGTTCCTGCGCCAGACGTAAGGCGCTGAGAATTGCCCGAC
+GTTTTTTCCGGTAAGCGGTGCAGGGCAGGGGTTTCAACATACACCGCGTGCCAGACGCTACCCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACCAGTT
+TTCGCTGCCGGTGTTATGGCCGATGCATAAAAGGATCGCGTCGCGCGTGTGCCACACTTTCTCTTCGCCAGGATGCCCCGCCAGGCGCGCATTTGCTCAT
+CAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAATGTTCAATGGCGCGCTCCGCCTGCCCGGCAATA
+TAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGGGGCAAGTCCACCAGCACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCC
+GTACCTGAATTCCGGTGACGCCGCTGACCACATCATTCAGACTTTCCAGATGCTGAACGTTGACGGTAGTGAAAACATCAATGCCAGCTTCCAGCAGTTC
+TTCGATATCCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCCATTAAGATCAGCGCCGGGCGGCGGGCGAGGGCGGCA
+TCGAGATCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAGAACAGCCAGCCCTTCCAGCATGGCGGCGGTATCTTTCGCCCGTG
+GGTTTCTACCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCCAGGTCTTCCCGACGCCTGCACAGGCACCG
+AAGACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAGCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTATTCATCAAGTTTATCCAGCGCCA
+GATTGAGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAGCGGTTGTTGGCTGTATTTTGCGATCAGTTGCGTGAGCTGTTCAACGCTGAG
+ATTACGCGCTTTCGCCACGCGTGGGATTTGCCAGGCCGCCGCTTGCGGGTGATATTATTGTCCAGCCCGCTTGCCGATGCCGTCACCAGTTCAACCGGAA
+CGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTACTGACCGCCAGATTGCTCCCGCC
+AGAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAATTCTGCCCGATTAATGCCGAACCGCGCA
+CCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTGCCCCAGTACGGTGGTCAGCAGCGGGTAAACGCCGCCAGTAATCAAT
+AACAGAAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACACCAGACCGCAAACGGTCAGCAGTAAATCAATGACTTTGATACC
+GATAAACGGCACCAGCAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAGCGGTAAGCGGTTTATAACTCACGCCTTTAACGCCA
+GGGGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCACATGATGTTCAGCGCATTTAACTGCG
+GATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTACAATGCTGAAGGTGGTCAGCGAGCCACGGGTCATCAGCATCTGT
+TTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCGCCGCCTGGGTGCCGGAGTTCATCGCCA
+CCGCGACATCTGCCTGCGCCAGCGCCGGGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGC
+TTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACGGTTATCGCCGGTAATCATCACCGTTT
+TAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCCAGCACGAGAACCTTCCACCACCA
+CCAGCGGCGTGGCTCCTGACGCGCAACCTGATCGACTTTTTGATCAACATCGGTAGGGAAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCG
+ACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACTGCACATCGC
+GCTCGCGCAGGTTAAAACGCGCTTGGCGGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTT
+TTCATCCACGCCCTGCGCGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGC
+TTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGG
+ATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAGACGATA
+GTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGC
+CGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGC
+CGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCAATAACTTCACCATCGCAGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGC
+CTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTCACCCCTTTCAGACTGTT
+GGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCA
+TTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCT
+GCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATA
+TCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAAC
+AGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCG
+ACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACG
+GCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCG
+TCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATA
+AACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGC
+CACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACG
+GCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATG
+ACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGAT
+CGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTG
+ATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTT
+GTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTC
+TGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCT
+CAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGT
+GGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTT
+CATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGC
+CTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAA
+ACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGA
+ATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACT
+TTTGTGTAAAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCA
+TCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTT
+TTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCT
+GGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAG
+CGGAAACGCTGGCGGTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATAT
+TTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGG
+ATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCC
+ACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGC
+CCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGC
+CTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGG
+TTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAA
+CTCCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTG
+CCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCG
+AAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGG
+CGGGACGGAACCGTCCGCTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACC
+CGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTG
+CGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGG
+TGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACA
+CGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAG
+ACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACT
+ATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCC
+TGACGGCGATATCACCCGCTACCGTTATGATAATCCACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCGGAAAACCATGACGTGGAGCCGT
+TACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGC
+TGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCT
+GACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATG
+GAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCG
+GCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGGCTGGTCACCCACTGGCACTATGACGAAGC
+AGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGG
+CACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGC
+ATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCT
+GTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCG
+CTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAG
+CAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACA
+GACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTT
+ACCGGTATGACCGTCACGGCAGGCTGACAGAAAACCGACCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAG
+TCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGG
+GTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATAC
+AGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAA
--- a/test-data/ecoli_canu_unassembled_result2.fa	Sun May 26 10:52:09 2019 -0400
+++ b/test-data/ecoli_canu_unassembled_result2.fa	Mon Feb 15 12:31:26 2021 +0000
@@ -1,758 +1,240 @@
->tig00000005 len=6788 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-CAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCAACAGTGCAAAACTTTCTTTCTGCCGCCAGCGAATT
-GCAGTGATTTTGCCCTCATCCGTGCGTTTTACCCGCCAGAGCATGAGCACGCTCAGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAG
-TCCCTGTGGCGTTGTTGATTGCACTGTTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCGGGCTGTGAATACCGTTGAAGGGCGCAACAG
-CTGATACCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCAGTACTAACGGCGGCTTCTTTAATGCCAACTCTGTCGCATCCGTTTGAAAACC
-CAACCGCACTGACCAACTTCGTGCAGATGCTGGCGTCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGG
-CGCATGTTGCTGTGGGCGATGTCAGTGATTTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCA
-CGGACAAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCTGTGGCGCGGT
-GATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTT
-TACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGAT
-GAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCT
-GGCCCGCATGGTTTTGGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAGCAGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGA
-ACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCCGGGGTGATTATCCCGGTGATGGCAGTGCCGGTTCGCTGGTGAGTAAAGCCAAGCCGCCAGC
-TCCGGCACGCTGCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGATTGGCGCACTGACCTTTATCCTGCCCTGGCGCTTGG
-TCCGTGGCGGAATATCTCTCCTGATGATATTGGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCAGACCAACACTTGTCGTTCAGGCGCTGA
-AAGAAGAAGCGTTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTAATAGCATC
-GCGATGGCAGGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGGGCGCT
-GGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGTGAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAA
-AGTTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAAAGCCTGATATTATCCCCTGCGATGGTGAAGTTATTGAAGAGGGTGCATCGGTCGAT
-GAAAGCGCCATCACCGGGAATCGGCACCGGTGATCCGTGAATCAGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTG
-ATTAGTGTAGCGTTAACCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAGAACGCCTGACCA
-TTCTGCTGATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGTAGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCG
-CTGCTGGTCTGTCTGATCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGC
-GGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGGTTTATCCCCGC
-GCAGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCATAAGCAGCG
-TTTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATAGCAGGATCAACATCGACAACCGCATGA
-TCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAGTCGATCAGGTTGCGCGTCAG
-GGGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGC
-TGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGA
-AGCGACACCAGGTAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCATAACGATGCTCCGGCTGGCGCAG
-GCAGATGTCGCAGTGGCGATGACTCCAGCGCAGGCGGCGAAAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGTGGTGCAC
-ATTGGCAAACAGATGCTGATGACCCGTGTCGCTGACCACCTTCAGCGTACCAACGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAA
-CGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACATGATTATCGTCTTTGATTC
-CCTGGCGTTAAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTGGGCTGCTGGTGCCGTTT
-ATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTAGGTTTACCATGAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCCG
-TTATTGATTACTGGCGTTTACCCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGT
-GCGCGGTTCGGCATTAATCAGGCAGAATTTACCGGCAGCAGCTGTTTTCATGGTCGCCCGTCAGCAGCAGCAGAAATGCCCTATAATCCACAGGCTTCTG
-GCAGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCAGGCGTTC
-CAGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCATAAGCGGCGGCCTGGCAAATCCCACGCGTGGCGAAAGCGCGTAATCTC
-AGCGTTGACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTCAACATTATTGAACTCAATCTGGC
-GCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCCACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGGGAAGCTGGATTTTCTTCGGT
-GCCTGTGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCGGAGCGCAAAGGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCA
-CGGGCGAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATG
-CCGCCCTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTAATGCGCCAGGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGA
-ACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGAAAGTCACGATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGG
-AAACCGTGCCCGATCCTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAAAGAAGGCAAAGTCTATATT
-GCCGGGCAGGCGGGCGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTGCGCCGTACTGCCGATCGCGTTGATG
-AGCAAATGCGCGCCTGGCGGGGGCGTCCTGGCGAAGAGAAAGTGTGGCACACGCGCGACGCGATCCTTTTATGCATCGGCCATAACACCGGCAGCGAAAA
-ACTGGTCCGCGCAGCAGCGCGCAGCGTCACGGCTGGGTGGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCACGCTTACCGGAAAAAACGTCG
-GGCAATTCTCAGCGCCTTACGTCTGGCGCAGGAACTGGGCGCGGGGACGGCAACACTTTCTGATCAGCGGAAGAGAAAGCGGTAGTGCGTTATGCCCGTG
-AACATAATCTCGGCAAGATTATTCTCCGGTCGCCCGCCTCGCGCCGCTGGTGGCGTCGGGGATTTGCTGACCGACTGGCGCGCATCGCCCCGATCTCGAT
-CAGGTGCTGGTCGCGCTTGATGAACCACCCGCCCGCACGATTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAAGTGGCGTGTACAAATTCAGGGGA
-TGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTGATGCCGCCAACCTGGTGATGCTGTATCTGCTTGG
-CGTGGTGGTGGTGGCGCTATTTATGGACGCTGGCCTTCAGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATCTCTTTTATCGCCCGCGGCACGCTC
-GCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCAGGAACCTTACTGCTGGCGTGCGTTATCAGGCGCGGG
-TAGCCCGTTACCGCGAGCAACGCACACGGCACTTATATGAAATGTCGAAAGCTCTGGCGGTGGGCCGCAGTCCGCAGGATATCTGCCACCAGCAGACAAT
-TTATTGCCTCCACGTTTCATGCCCGCAGTCAGGTGTTGTTGCCCGATGACAACGGTAAATTGCAGCCGTTAACACATCCGCAAGGGAATGACGCCGTGGG
-ACGATGCCATCGCGCAGTGGAGTTTTGATAAAGGCCTGCCTGCGGGCGCGGGCACCGACGTTACCCGGTGTACCGTACCAGATTTTGCCGCTAAAAAGCG
-GCGAGAAAACCTACGGGCTGGTGGTGGTGGAGCCGGGGAATCTGCGCCAGTTGATGATCCCGGAACAGCAGCGCCTGCTGGAACGTTACGCTGTTAGTCG
-CCAATGCCCTTGAGCGGCTGACGCTAACCGCCAGCGAAGAACAGGCGCGGATGGCAAGCGAACGTGAACAGATCCGCAACGCCCTGCTGGCGGCGCTTTC
-GCATGATTTACGCACGCCGCTTACGGTGCTGTTTGGTCAGGCAGAAATCTTAACGCTCGATCTGGCGAAGCGAGGATCACCCCACGCCCGCCAGGCCAGC
-GAGATCCGTCAGCATATTAACTTCACTACCCGACTGGTGAATAATCTACTGGATATGGCGCGAATTCAGTCCGGCGGCTTTAATTTGGAAGAAAGAGTGG
-TTAACGCTGGAAAGAAGTAGTCGGCAGCGCGCTGCAAATGCTGGAACCGGGTTTATCGTCGCCCATCAATCTTTCTCTGCCAGAACCGCTGACCTTAATC
-CACGTTGACGGGCCTCTTTGAACGGGTGCTGATTAATCTGCTGGAGAACGCGGTGAAATATGCGGGTGCGCAGGCCGAAATTGGTATCGATGCCCACGTT
-GAGGGCGAAAATCTACAACTGGATGTCTGGGATAACGGCCCCGGTCTTCCGCCAGGCCAGGAGCAGACGATATTTGATAAGTTTGCTCGCGGGAATAAAG
-AGTCGGCAGTACCGGGGTAGGGCTTGGACTGGCAATTTGTCGGGCGATAGTGGATGTACACGGGGGCACTATTACCGCGTTCAACCGACCGGAAGGTGGT
-GCCTGTTTTTCGTGTTACACTTCCCCAGCCAAACTGCCCTGAACTGAAGAATTTCAGCGGGATATGTGACAAACGTTCTGATTGTTGAAGATGAACAGGC
-TATTCGTCGCTTTCTGCGCACGGCGCTGGAGGGCGACGGATGCGATCTTTGAGGCCGAAACGCTGCAACGCGGCTTGCTGGAAGCGGCAACCCGTAAGCC
-AGATTTGATTATTCTCGATCTCGGCCTGCCCGATGGTGATGGGATTGAGTTTATCCGCGACCTGCGCCAGTGGAGCGCGGTGCCGGTG
->tig00000006 len=6499 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-CGTCATCTGGCCGAAGCGGTCGTATTCATAACGGGTCTGGTAGCCCGAGCAGTCGGTGAACGCCAGCAACTGCCCGTAGCGGCTCCAGGTCATCTGTTGG
-AGTGCTGCCCGTCGCATCCGTTGTCGTCGCCGGTAACTCACTGTGCGCGTCATCGTAGCGGTAGCGTACTGTCTCCCCGCTGCGCGATGTCTCCGATACC
-AGCCTGCCCGGTTCATCATATTCGGCGGCTCTCCAGCCCGTCCGGGGACACCACCGCCGTCAGCTGGTTCACGTCGTTATAGTAAAATTTCGTCTCCCGC
-CCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCGCACTCTGTCCTCCGTCCCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCC
-GCGTCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCCGTTTCCAGCCCGGCCCCGCCTTCTGTATGCAGCACCTCACGCCGGT
-TCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCAGTTGCTCCACCACCCGCCCCGTATCGTCGTA
-GCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGTCATACGTGAAAGCGCGCACCTGCGTATTGCTGCGGTC
-ATATACCGCCAGCAGTTCACCGGCTTCCGTATGCGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCATCAGCCACACC
-GCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCAGTGTGTCGAGGAACGCTGAGGCTGAGAGAGGGCGGGAACTGTCAGAAGAAGATAG
-CGAAGAGGTGGGCCTCTTCCGCACGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCCCCGGCCAGG
-TCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGGTAAGCACCCGGTACGGCGGCAGCGGCGCTGGCAGTACGTCCT
-CAGCACCCGGCACCCGCTCAGACCACCCCAGTATCCACCACGGCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCAACCGGATATCCGGCGGCAGC
-GCCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCGGCA
-GCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTTCAGCCGGGG
-CCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGCAGCGCAAGGTCCGTCTCGCC
-GGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCCAATTTACA
-CCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTTAGTTATTGTTCA
-TATCCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAACTTATTTTGTTCTCAATCAACAACAA
-CTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTGCACAGATGAATTCATCATCAGCAAATTCACTATATGGATAATATCCATTCAACG
-CATATGATTTATGATTTTATTAGTCTGAGTTATTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAATAGAAGATAG
-AAATCACCAATTCAATAACATCATCAATGCGGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTTACTCTCATC
-ACCCCGCAAACTGCCTGAACAGCGCCTTACCCTTTAACCAGTCGCGCACCCAGCCAGCCGCCGAAAAGCGACAGCAGCAGCGCTCCGCTGCACGGCAGAA
-CAATCCACAATCGCCAGTCTGGCTCCCACGGAAAATCAAACACTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAAA
-CAAACCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCA
-TTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGCACCTGACC
-GACCTGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTG
-GTAAGCCAGTTCTGCGGTTGCCCGTCTAATGCCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCA
-CTTTAGCGCGGAACTCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCCTCTTCCATCGACACTTCATCG
-GCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTACC
-TTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCCACCACCGGATAAAACGATTCCGGACTATCTGATGTTCCGCGAGGAACGCTTTAGCGGTGCTA
-CCTGTTCTGTGGCGATGTTAATTAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCTGCCAGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGT
-GCCAGCAGCATAAAGAGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATTT
-CAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCATG
-CTGCCACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTA
-ATACGCGTAAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCACAGCCACGGCCA
-GAGGCTGGCTGGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAA
-GCGTCAGCACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCGCTCGCCCTGCCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCG
-ACAGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAGGTCAGAAGCGCCAGCAGCAGGAACTGTTACGAGCGTTCCATCGATCGCCCCA
-GCGCGCCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTAAGCTGGTAACAACCATTTCATAGCCGTCGAGCTGGTTCTCGTTGCCCGCCGAA
-TTTATAACGCCAGGTGACCCGACTCCCCGGCTGCACGGCTCCGGTTTTATCGACATCCGCCAGATTCATCATCAGACGCGGAGCCATCTGGAAGGGTTAA
-AACCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCGCAAGGTGGCATCGCCCACGCCAATGGTGTCGCCCGTTTTCAGGTTAAGCAGTGCCATCAG
-GCGTGGGGCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGGGTTAGTTGCAGATCGCCATACATCGGGTAGATATCATCCACCGCTTTGACGTTCG
-CCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTGCGAAAGTCAGCTTGCCGACTTTCAGGCCGCGCTTTGCGCTTCCTCCAGCCACGCTTGCGGCACTT
-CGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTTGCTGGCTTAAGCCCTTCTCCATGCGATCGCTGATATTGCCCAGCGCCAGCAC
-GCAGGCCACCGCCAGGCTTAGCGCCAGCCAGACAATTAATAGCGACGGCGAACGCCATTCGCGCCAGAACCAACGTGCAATCATGCTTCCTCCTGCAACT
-GCCCGTTCACCAGCCGTAAGCAGCGGTCGCAGCGCCGCCAGTTGCAGGTCGTGGGTCACCATAATCAACGTGGTGCCATGTTTACGGTTGAGGAAAACAG
-CAGGTCGGCAATTTTATCGCCCGTCTGGCGGTCAAGGTTGCCGTGTTCGTCGGCAAACAGCATCAGGTCGACCATTAAAGGCTCGTGCCAGCGCTTCCTC
-GTTGCTGTTCACCGCCGGAAAGCTGTGCCGGAAGATGATCAGACGTTTACCCAGCCCTAACTGTTCGAGCAACGCTTTCGCCCCGTTACGACTTTCCGCT
-ACTCTCCACCGCGCAGCAGGCCGGAAGCTCGACGTTTTCCAGCGCGTTAAGGGTAGGAATTAACATAAATGACTGAAAAACAAAGCCGACGTGCTTCGCG
-CGCAACTTTGCCCGCGCTTCTTCGTCCATATTATGTGGCGGTTGTCCCTGGAGCTCACTTCGCCACTGCTGCCGTCATCAAGCCCGGCGAGGATCGCCAG
-CAAGGTTGACTTACCGATCCCGACTCGCCCACCAGTGCGATGGTCTCGCGCGTTTGACAACCAGCTCAACTCCGGTGAGGATGGAGAGTTCATGCTCCCT
-GACCGACGGACTTCTTAAGATGATGAACTTCAACAATGTTTTCCGCTGGCATTTGCCCTTCCTGTTCCTGGTCCCATTAACCTTCCGTGCCGCCGCAGCC
-GTTATTGATTCTGGGTGATAGCCTGAGCGCCGGGTATCGAATGTCTGCCAGCGCGGCCTGGCCTGCCTTGTTGAATGATAAGTGGCAGAGTAAACGTCGG
-TAGTTAATGCCAGCATCAGCGGCGACACCTCGCAACAAGGACTGGCGCCTTCCGGCTCTGCTGAAACAGCATCAGCCGCGTTGGGTGCTGGTTGAACTAT
-GGGCAATGACGGTTTGCGTGGTTTTCAGCCACAGCAAACCGAGCAAACGCTGCGCCAGATTTTGCAGGATGTCAAAGCGCCAACGCTGAACCATTGTTAA
-TGCAAATACGTCTGCCTGCAAACTATGGTCGCCGTTATAATGAAGCCTTTAGCGCCATTTACCCCAAACTCGCCAAAGAGTTTGATGTTCCGCTGCTGCC
-CTTTTTTATGGAAGAGGTCTGCCTCAAGCCACAATGGATGCAGGATGACGGTATTCATCCCAACCGCGACGCCCAGCCGTTTATTGCCGACTGGATGGCG
-AAGCAGTTGCAGCCTTTAGTAAATCATGACTCATAAAGCAACGGAGATCCTGACAGGTAAAGTTATGCAAAAATCGGTCTTAATTACCGGATGTTCCAGT
-GGAATTGGCCTGGAAAGCGCGCTCGAATTAAAACGCCAGGGTTTTCATGCTGGCAGGTTGCCGGAAACCGGATGATGTTGAGCGCACGAACAGCATGGGA
-TTTACCGGCGTGTTGATCGATCTGGATTCACCAGAAAGTGTTGATCGCGCAGCCGACGAGGTGATCGCCTGACCGATAATTGTCTGTATGGGATCTTTAA
-CAATGCCGGATTCGGCATGTATGGCCCCTTTCCTGCATCAGCCGTGCGCAGATGGAACAGCAGTTTCCGCCAACTTTTCGGCGCACACCAGCTCACCATG
-CGCCTGTTACCCGCGATGTTACCGCACGGTGAAGGGCGTATTGTGATGACATCATCGGTGATGGGATTAATCTCCACGCCGGGTCGTGGCGCTTACGCGG
-CCAGTAAATATGCGCTGGAGGCGTGGTCAGATGCACTGCGCATGGAGCTGCGCCACAGCGGAATTAAAGTCAGCCTGATCGAACCCGGTCCCATTCGTAC
-TCGCTTCACCGACAACGTCAACCAGACGCAAAGTGATAAACCAGTCGAAAATCCGGCATCGCCGCCCGCTACGTTGGGACCGGAAGCGGTGGTGGACAAA
-GTACGCCATGCTTTTATTAGCGAAGCCGAAGATGCGCTATCCGGTGACGCTGGTGACCTGGGCGGTAATGGTGCTTAAGCGCCTGCTGCCGGGGCGCGT
->tig00000007 len=3672 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-CGGCTCCAGGTCATCTGCCGGTGCTGCCCGTCGCATCCGTTGTCGTCGCCGGTAACTCACTGTGCGCGTCATCGTAGCGGTAGCGTACTGTCTCCCCATG
-CGCGATGTCTCCGATACCAGCCTGCCCGGTTCATCATATTCCGGCGGCTCTCCAGCTGATCCGGGGACACCACCGCCGTCAGCTGGTTCCGTCGTTATAG
-TAAAATTTCGTCTCCCGCCTGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACGCACTCTGTCCTCCGTCCCGCCGCGTCCGTCTG
-CGCCGTGAGCCTTCCTGCCGCGTCATACCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTTCACCGTTTCAGCCCGGCCCCGCCTTCTGTATGCAG
-CACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCAGTTGCTCCACCACCCGC
-CCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCGGGTGCTGCGCGTCATACGTGACGCGCACCTGCGT
-ATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATACGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGC
-ATCAGCCACACCGCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCGGTGTCGGGGAACGCTGAGGCTGAGAGGGGGGAACTGTCAGAAG
-AAGATAGCGAAGAGGTGTGGCCTCTTCCGCGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCGCCGGTGATTTCCCGGC
-CAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCAAGCGGTCCGCCATCCCGGTAAGCACCCGGTACGGCAGCAGCGGCGCTGGCAGTACGTCCTCA
-GCACCCGGCACCCGCTCAGACCACCCCAGTATCCACCACGGCCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCTTAACCGGATATCCGGCGGCAG
-CGCCCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTTGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCC
-AGCAGCGGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTCAGCCG
-GGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAGGTCCGTCT
-CGCCGGGCAGCACCTTCGCCCCAGCAGCGGATTTACCGGGTTGCCAGAAGTCATCCCGCCCGGACACACCGAGCACGCACGCCGGTGGGCGCGCCAATTT
-TACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCTGACGCGCCGCTGGTTTTCCGCTCATAAAGTGCCCTTTAGTTATTGTTCA
-TATCCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAACTTATTTGTTCTCAATCAACAACAAC
-TGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTAGCACAGATGAATTCATCATCAACAAATTCACTATATGGATAATATCCATTCAACG
-CATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCACCGATTCAGATTAATATCAGCAATAGAAAGATA
-GGAAATCACCAATTCAATAACATCATCAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTTACTCATCACC
-CCGCAAACTGCCTGAACAGCGCCTTGCCTTTAACCAGTCGCGCACCCAGCCAGCCGCCGAAAAGCGACAGCAGCAGCGCTCCGCTGCACGGCAGAACAAT
-CCACAATCGCCAGTCTGGCTCCCACGGAAAATCAAACACCTTTCGCCTGCAACTGCCAGCGCCGTTTCCGCGCAATTGCGGCCACCAGGCCGGAAACAAA
-CCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTCC
-CACCTGCACCTGTGCCAGCAGCAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGCACCTGACCGACC
-TGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTGGTAA
-GCCAGTTCTGCGGTTGCCCGTCTAATGCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTA
-GCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTGCGTTTCGCCAGCCCCTCTTCATCGACACTTCATCGGCTTTTG
-GCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTACCTTCTGT
-CGGCTTATCGTTAATCGCCGTCAGCCGCGCCCGCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAGGAACGCTTTAGCGGTGCTACCT
-GTTCTGTGGCGATGTTAATTAAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCTGCCAGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGTGC
-CAGCAGCATAAAGGAGCGAAAATGCCGAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATTTCAGCG
-TCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCATGCGCCA
-CCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTAATACGC
-GTAAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCAGCCGGCCAGAGGCTGGCT
-GGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGTCAGCAC
-CATCAACCACTGACCGACGATTAGCTTACGCGGTTGCGCCTGCCCTGCCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACAGTAATGA
-TTTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCGAAAGCAGCAGGAACTGTTA
->tig00000008 len=7086 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-ACGCGCCCCGGCAGCAGGCGCTTAAGCACATTACCGCCCAGGTCACCAGCGTCACCGGATAGCGCATCTTCGGCTTCGCTAATAAAAGCATGGCGTACTT
-TGTCCACCACCGCTTCCGGTCCCAACGTAGCGGGCGGCGATGCCGGATTTTCGACTGGTTTATCACTTTGCGTCTGGTTGACGTTGTCGGTGAAGCGAGT
-ACGAATGGGACCGGGTTCGATCAGGCTGACTTTAATTCCGCTGTGGCGCAGCTCCATGCGCAGTGCATCTGACCACGCCTCCAGCGCATATTTACTGGCC
-GCGTAAGCGCCACGACCCGGCGTTGAGATTAATCCCATCACCGATGATGTCATCACAATACGCCCTTCACCGTGCGGTAACATCGCGGGTAACAGGCGCA
-TGGTGAGCTGGTGTGCGCCGAAAAGTTGGCGGAAACTGCTGTTCCATCTGCGCACGGCTGATGTTGGAAAGGGCCATACATGCCGAATCCGGCATTGTTA
-AAGATCCCATACAGACCACTATCGGTCAGGGCGATCACCTCGTCGGCTGCGCGATCAACACTTTCTGGTGAATCCAGATCGATCAACCGCGCCGGTAAAT
-CCCATGCTGTTCGCGCGCTCAACATCATCCGGTTTCCGGCAACCTGCCAGCACACTTGAAAACCCTGGCGTTTTAATTCGAGCGCGCGCTTTCCAGGCCA
-ATTCCACTGGAACATCCGGTAATTAAGACCGATTTTTGCATAACTTTACCTGTCAGGATCTCCGTTGCTTTATGAGTCATGATTTACTAAAGGCTGCAAC
-TGCTTCGCCATCCAGTCGGCAATAAACGGCTGGGCGTCGCGGTTGGGATGAATACCGTCATCCTGCATCCATTGTGGCTTGAGGAGACCTCTTCCATAAA
-AAGGGCAGCAGCGGAACATCAAACTCTTTGGCGAGTTTGGGGTAAATGGCGCTAAAGGCTTCATTATAACGGCGACCATAGTTTGCAGGCAGACGTATTT
-GCATTAACAATGGTTCAGCGTTGGCGGCTTTGACATCCTGCAAAATCTGGCGCAGCGTTTGCTCGGTTTGCTGTGGCTGAAAACCACGCAAACCGTCATT
-GCCGCCAGTTCAACCAGCACCCAACGCGGCTGATGCTGTTTCAGCAGAGCCGGAAGGCGCGCCAGTCCTTGTTGCGAGGTGTCGCCGCTGATGCTGGCAT
-TAACTACCGACGTTTTTACTCTGCCACTTATCATTCAACAAGGCAGGCCAGGCCGCGCTGGCAGACATTCGATACCCGGCGCTCAGGCTATCACCCAGAA
-TCAATAACGTGTCCTGCGGCGGCACGGAAGGTGCTGGGACCAGGAACAGGAAGGGCAAATGCCAGCGGAAAACATTGTTGAAGTTCATCATCTTAAGAAG
-TCCGTCGGTCAGGGAGCATGAACTCTCCATCCTCACCGGAGTTGAGCTGGTTGTCAAACGGCGAGACCATCGCACTGGTGGGCGAGTCGGGATCGGTAAG
-TCAACCTTGCTGGCGATCCTCGCCGGGCTTGATGACGGCAGCAGTGGCGAAGTGAGTCTGGTGGACAACCGCTACATAATATGGACGAAGCGCGGGCAAA
-GTTGCGCGCGAAGCACGTCGGCTTTGTTTTCAGTCATTTATGTTAATTCCTACCCTTAACGCGCTGGAAAACGTCGAGCTTCCGGCCTGCTGCGCGGTGA
-GTAGCGCGGAAAGTCGTAACGGGGCGAAAGCGTTGCTCGAACAGTTAGGGCTGGGTAAACGTCTGGATCATCTTCCGGCACAGCTTTCCGGCGGTGAACA
-GCAACGAGGAAGCGCTGGCACGAGCCTTTAATGGTCGACCTGATGCTGTTTGCCGACGAACCCACGGCAACCTTGACCGCCAGACGGGCGATAAAATTGC
-CGACCTGCTGTTTTCCTCAACCGTGAACATGGCACCACGTTGATTATGGTGACCCACGACCTGCAACTGGCGGCACGCTGCGACCGCTGCTTACGGCTGG
-TGAACGGGCAGTTGCAGGAGGAAGCATGATTGCACGTTGGTTCTGGCGCGAATGGCGTTCGCCGTCGCTATTAATTGTCTGGCTGGCGCTAAGCCTGGCG
-GTGGCCTGCGTGCTGGCGCTGGGCAATATCAGCGATCGCATGGAGAAGGGCTTAAGCCAGCAAAAGCCGTGAGTTTATGGCGGGCGATCGGGCGTTGCGC
-AGTTCACGCGAAGTGCCGCAAGCGTGGCTGGAGGAAGCGCAAAAGCGCGGCCTGAAAGTCGGCAAAGCTGACTTTCGCCACAATGACCTTGCAGGCGACA
-CACCGCAGCTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTGAAACCGCAGGCGGGCAGCGTA
-TTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGACGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAGTGATTCAGG
-AACCGGATTCCGGTTTTAACCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGGAGCCATGCAGCCGGGGAGTCGGGTC
-ACCTGGCGTTATAAATTCGGCGGCAACGAGAACCAGCTCGACGGCTATGAGAAATGGTTGTTACCCCTCAGCTTAAACCCGAACAACGCTGGTACGGTCT
-GGAACAGGACGAAGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTGGCGCTTCTGACCTTGCTGCTGGCAGTGGCAGCGGTGGCG
-GTAGCGATGAATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCAGGCGCAACTGCGTAAGCTAATCGTCGGTC
-AGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAAACGTGTTGATGGTGCTGCTTCAAGCCCGTTCTGCCTG
-CTGCACTACCGCCAGCCAGCCTCTGGCCGTGGCGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTGTTGCTG
-GCAACGCAGCCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGC
-TCGCCGGATTAATGGGTGGCAGCATGCTGCTTTAGGCGGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGCTGGATGCTGCTGAA
-TGTACTTCGCCGCATGACGCTGAAATCGCTGCCTCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCAT
-TTTCGCTCTCCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCAAGAAAGCCCGAACTACTT
-TTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGGTGGTGCGGGCGCGGC
-TGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGATCATAATCC
-GATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCAAACGTTGCCCTCGGTGATACCGTGACTTTATG
-GGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCTGAAGGGGCAT
-TAGACGGGCAACCGCAGAGCTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATTAGCCTGTT
-AGATATTGGCGCGATTTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGCCTGCGGTATGTT
-GCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCGTACCACGTT
-GTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTGTTGCAGGCGAAAGTGTTTGATT
-TTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCAGGCGCTGCTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAAG
-GGTAAGGCGCTGTTCAGGCAGTTTGCGGGGTGATGAGAGTAAATAAGGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAATATGTTT
-CGTTGATGATGTTATTGAATTGGTGATTTCTATCTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAAATA
-ACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGATGAATTCATCTGTGCTAAAAATGTTAGTTT
-AATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGTGAAAAATATATAAATACATTAGCTGGTCTTGTGTGT
-CATTTTATTTTTTGTTGCTAACACAGGGATATGAACAATAACTAAAAGGGCACTTTATATGAGCGGAAAACCAGCGGCGCGTCAGGAGATATGACTCAGT
-ATGGCGGTCCCATTGTCCAGGGTTCGGCAGGTGTAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCGGGCAACCCGG
-TAAATCCGCTGCTGGGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCG
-GACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGACAA
-CGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCACAGCCGG
-ACGGCCATACGCTGGCGCGGCTGTGGGGGCGCTGCCGCCGGATATCCGGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGTGG
-ATACTGGGGTGGTCTGAGCGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCGGGC
-GGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGCCGGGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCACG
-CAGGCGCAGCGTGCGGAAGAGGCCCACCTCTTCGCTATCTTCTTCTGACAGTTCCCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACTGCCCGGTACCGA
-ATACGGCCCCGACAGGGTATCCGCCTTTCGGCGGTGTGGCGATGCACGACCCGGCATACCCGGAGAGCCTGCCCGCTGCGCCACTGGTGCGGTACACGTA
-TACGGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCGTATGACGCGCAGCACGGGCCGGATGGTGGCGCACCGTT
-ACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGGCGGTGGTGGAGCAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAGCAG
-GACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAGGCGGGGCCGGGCTGAAACGGTGGTGAAAAAGAACTGGCGGACGGC
-AGCGTCACGCGCAGCGGGTATGACGCGGCAGGAAGGCTCACGGCGCAGACGGACGCGGCGGGACGGAGGACAGAGTGCGGTCTGAATGTGGTGTCCGGCG
-ATATCACGGACATCACCACACCGGACGGGCGGGAGACGAAATTTTACTATAACGACGAACCAGCTGACGGTGAATTGTCCCCGGACGGGCTGGAGAGCCG
-CCGGGAATATGATGAACCGGGCAGGCTGGTATCGGAGACATCGCGCAGCGGGGAGACAGTACGCTACCGCTACGATGACGCGCACAGTGAGTTACCGGCG
-ACGACAACGGATGCGACGGGCAGCACCAACAGATGACCTGGAGCCGCTACGGGCAGTGCTGGCGTTCACCGACTGCTCAGGCTACCAGACCCGTTATGAA
-TACGACCCTTCGGCCAGATGACGGCGGTCCACCGCGAGGCATCAGCCTTTACCGCCGCTATGACAACCGTGGCCGGTTAACCTCGGTGAAGACGCACAGG
-GCCGTGAAACGCGGTATGAATACCTTGCCGCAGGCGACCTGACTGCCGTTATCACCCCGGACGGCAACCGGGCGAGACACAGTACGATGCGTGGGGAAAG
-GCGGTCAGCACCACGCAGGGCGGGCTGACGCGCAGTATGGAATTACGATGCTGCCGGACGTGTCATCAGCTGACCAACGAGAACGGCAGCCACAGCGTCT
-TCAGTTACGATGCGCTGGACCGGCTGGTACAGCAGGGCGGCTTTGACGGGCGGACGCAACGTTATCATTATGACCTGACCGGAAAACTCACACCAGAGTG
-AGGATGAGGACTTGTCATCCTCTGGTACTACGATGAATCGGACCGTATCACTCACCGCACGGTGAACGGCGAACCGGCAGAGCAGTGGCAGTATGATGGC
-ACAGCTGGCTGACAGACATCAGCCACCTGAGCGAAGGCCACCGTGTTGCCGTCCACTATGGCTATGACGATAAGGCCGCCTGACCG
->tig00000009 len=2712 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-TACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCGTTTTGCCACCCTGCGGCCAGCGGGTCGTA
-AAGATAGCGACTTTCGACCAGCGGCTGCATATTGTGTCCGCGTGGCGAATTGCCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCAT
-CCGTGCGGATAAAACGCTTCCGGGATAAGGGTCAGTTTTCTCTGTCAGCCACCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGTGATACGGT
-TATCCGGCCACATGCTGAGGGCGCTGTCAGGTCACCTTCCGGGTCGAACGACGGTTACCTGCCGGGTCTGTAGTATACGGGATGCGGATATCAGATTCGC
-TGCGGTGGTGTGAGCGCCGGTCAGCCTGCCGGAGTAGTGCTGTAGCTGTAACTCGGGTCTGGCGCGGGCTGCTGATTACGGATGAGTTCGCCGTTGTCGT
-TCCAGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGC
-GCAGCGTTTCCCGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCC
-ACGGCAGGCAGGCTGTCCGGTATACAGCAGTTCGCCAGTCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATG
-ATGCACCGTCAGGTGTTCACTGGCAGAGGCAGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAG
-CCAGCCGCGTTCGTCATGCTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGC
-CCTCATCCTCGCTGCGGATAAGTTTGCCGGTCGGGTCATTAGTGATAACGCGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCGAATTA
-CATCGTAACGGAAGGTGGTGTGGCCTTGTTTTCACTGGTCAGGCGGATGACCCGTCAGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGG
-TACAGATGGCTTTCCCCGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGAGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCG
-CGTTTCATGGCCCTGCGTGTCTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCT
-GACAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCG
-GTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCC
-ATTCATCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGC
-GTGGTGATGCGCGTGATGGGCCCGTCACCATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCGCAATGCCCTGAGCCTGCCCACCGCGTCAAA
-CTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTGCCCGCCTTCACCCTGCGTGTGCGGGACTTCACGGCAGTTCAGGCTGTCGG
-TGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTTAAGCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGAT
-TTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTATTGCTGCGGTCTACACCGCCGCT
-TCGCCGCGGGGCGTCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCG
-TTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCGTCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTG
-CGCCTGCGTGGTCAGCCGAGTGACGCCCGGCACCATCCGTCGCGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCG
-CCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCGGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACCAGCCGAGCAGCCAC
-CACGGCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGGTTCTTCCGGCAGCGCCTGCCGGAGTGCGGCCGGTGACCTTCATCCAGTTCG
-CCACGCCGCCGCGCACCATACAGTGACTCGCTGCGGCAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGGTAT
-CAGTGTGTTATC
->tig00000010 len=4686 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-CAATGACCTTTGCAGGCGACACACCGCAGCTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTG
-AAACCGCAGGCGGGCAGCGTATTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGGCGTGGGCGATGCCACCTTGCGGA
-TTGCCGGAGAAGTGATTCAGGAACCGGATTCCGGTTTTAACCCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGGAGC
-CGTGCAGCCGAGGAGTCGGGTCACCTGGCGTTATAAATTCGGCGGCAACGAGAACCAGCTCGACGGCGAGAATGGTTGTTACCTCAGCTTAAACCCGAAC
-AACGCTGGTACGGTCTGGAACAGGACGAAGAGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCTTGCTG
-CTGTGGCAGTGGCGGTGGCGGTAGCGATGAATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCGAGCGCAACT
-GCGTAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAACGTGTTGATGGTGCTGC
-TCAAGCCCGTTCTGCCTGCTGCACTACCGCCAGCCAGCCTCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACG
-ACCATATCGCTTGTTGCTGGCAACGCAGCCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGT
-GTGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTGGGCGGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGC
-TGGGCTGGATGCTGCTGAATGTACTTCGCCGCATGACGCTGAAATCGCTGCCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTT
-AAGTCAGCTTTCGGCATTTTCGCTCTCCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCCA
-GCCCGAACTACTTTTTAATTAACATCGCCAGGAACAGGTAGCACCGCTAAAGGGCGTTCCTCGCGGAACATCAGATAGTCGGAATCGTTTTATCCGGTGG
-TGCGGGCGCGGCTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCG
-ATCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCAAACGTTGCCCTCGGTGATACCG
-TGACTTTTATGGGCGATACCCAGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCT
-GAAGGGGAGATTAGACGGGCAACCGCAGAACTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACC
-ATTAGCCTGTTAGATATTGGCGCGATTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGCCT
-GCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGCTGGTGGTGGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCG
-TACCACGTTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTGTTGCAGGCGAAAG
-TGTTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCGGAGCGCTGCTGCTGTCGCTTTTCGGCGGCTGGCTGGGTGCGCG
-ACTGGTTAAAGGGTAAGGCGCTGTTCAGGCGGTTTGCGGGGGTGATGAGAGTAAATAAGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCT
-ACAATATGTTTCGTGATGATGTTATTGAATTGGTGATTTCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCC
-CTACAAAATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGAATTCATCTGTGTAAAAATGT
-TAGTTTAATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTGTGTGAAAAATATATAAATACATTAGCTGGTCTT
-GTGTGTCATTTTATTTTTGTTGCTAACACAGGGATATGAACAATAACTAAAAAGGCACTTTATGAGCGGAAAACCAGCGGCGCGTCGGGAGATATGACTC
-AGTATGGCGGTCCCATTGTCCAGGGTTCGGCAGGTGTAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCCGGGCAAC
-CCGGTAAATCCGCTGCTGGGAGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCT
-ACCGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGAAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAAC
-GACAACGGCGGGCAGACATTCACTTTGAGCCGCTGCTGCCGGGAGGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCAC
-AGCCGGACGGCCCATACGCTGGCGCGGCGTGGGGGCGCTGCCGCCGGATATCCCGGTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGCCGTG
-GTGAATACTGGGGTGGTCTGAGGCAGCGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGTGCTTACCGGGATGGCGGACCGCT
-TCGGGCGGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGGCCGGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTG
-ACCACGCAGGCGCAGCGTGCGGAAGAGGCCCACACTCTTCGCTATCTTCTTCTGACAGTTCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACACTGCCCG
-GTACCGAATACGGCCCCGACAGGGTATCCGCCTTTCGGCGGTGTGGCTGATGCACGACCCGGCATACCCGGAGAACCTGCCCGCTGCCGCCACTGGTGCG
-GTACACGTATACGGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCACGTATGACGCGCAGCACCCGGGCCGGATG
-GTGGCGCACCGTTACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGGCGGTGGGTGGAGCAACTGAACCCGGCAGGGTTAAGCTACCGCT
-ATCTTTATGAGCAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAAGGCGGGGCCGGGCTGAAACGGGTGGTGAAAA
-AGAACTGGCGGACGGCAGCGTCACGCGCAGCAGGTATGACGCGGCAGGAAGGCTCACGGCGCAGACGGACGCGGCGGACGGAGGACAGAGTAGGTCTGAA
-TGTGGTGTCCGGCGATATCACGGACATCACCACACCGGACGGGCGGGAGACGAAATTTTACTATAACGACGGGAACCAGCTGACGGCGGTGGTGTCCCCG
-GACGAAGCTGGAGAGCCGCCGGGAATATGATGAACCGGGCAGGCTGGTATCGGAGACATCGCGCAGCGGGGAGACAATACGCTACCGCTACGATGACGCG
-CACAGTGAGTTACCGGCGACGACAACGGATGCGACGGGCGCACAACAGATGACCTGGAGCCGCTACGGGCGGTTGCTGGCGTTCACCGACTGCTCGGCTA
-CCAGACCCGTTATGAATACGACCCTTCGGCCAGGATGACGGCGGTCCACCGCGAAGGCATCAGCCTTTACCGCCGCTATGACAACCGTGGCCGGTTAACC
-TCGGTGAAGACGCACAGGGCCGTGAACGCGGTATGAATATAACCGCAGGCGACCTGACTACCGTTATCACCCCGGACGGCAACCGGGCGAGACACAGTAC
-GATGCGTGGGGAAAGGCGGTCAGCACCACGCAGGGCGGGCTGACGCGCAGTATAGGAGTACGATGCTGCCGGACGTGTCATCAGCCTGACCAACGAGAAC
-GGCAGCCACAGCGTCTTCAGTTACGATGCGCTGGACCGGCTGGTACTGCGGGGCGGCTTTGACGGGCGGACCTGGCGTTATCATTATGACCTGAGCCGGA
-AAACTCACACCAGAGTGAGGATGAGGACTTGTCATCCTCTGGTACTACGATGAATCGGACCGTATCACTCACCGCACGGTGAACGG
->tig00000011 len=5118 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-TTTGCAGGCAGACGTATTTGCATTAACAATGGTTCAGCGTTGGCGGCTTTGACATCCTGCAAAATCTGGCGCAGCGTTTGCTCGGTTTGCTGTGGCTGAA
-AACCACGCAAACCGTCATTGCCGCCAGTTCAACCAGCACCCAACGCGGCTGATGCTGTTTCAGCAGAGCCGGAAGGCGCGCCAGTCCTTGTTGCGAGGTG
-TCGCCGCTGATGCTGGCATTAACTACCGACGTTTTACTCTGCCACTTATCATTCAACAAGGCAGGCCAGGCCGCGCTGGCAGACATTCGATACCCGGCGC
-TCAGGCTATCACCCAGAATCAATAACGTGTCCGCTGCGGCGCTACGGAAAGTTAACTGGGACCAGGAACAGGAAGGGCAAATGCCAGCGGAAAACATTGT
-TGAAGTTCATCATCTTAAGAAGTCCGTCGGTCAGGGGCATGAACTCTCCATCCTCACCGGAGTTGAGCTGGTTGTCAAACGGCGAGACCATCGCACTGGT
-GGGCGAGTCGGGATCGGTAAGTCAACCTTGCTGGCGATCCTCGCCGGGCTTGATGACGGCAGCAGTGGCGAAGTGAGTCTGGTGGGACAACCGCCACATA
-ATATGGACGAAGCGCGGGCAAAGTTGCGCGCGAAGCACGTCGGCTTTGTTTTCAGTCATTTATGTTAATTCCTACCCTTAACGCGCTGGAAAACGTCGAG
-CTTCCGCCCTGCTGCGCGGTGAGTAGCGCGGAAAGTCGTAACGGGGCGAAAGCGTTGCTCGAACAGTTAGGGCTGGGTAAACGTCTGGATCATCTTCCGG
-CACAGCTTTCCGGCGGTGAACAGCAACGAGGAAGCGCTGGCACGAGCCTTTAATGGTCGACCTGATGCTGTTTGCCGACGAACCCACGGCAACCTTGACC
-GCCAGACGGGCGATAAAATTGCCGACCTGCTGTTTTCCCTCAACCGTGAACATGGCACCACGTTGATTATGGTGACCCACGACCTGCAACTGGCGGCACG
-CTGCGACCGCTGCTTACGGCTGGTGAACGGGCAGTTGCAGGAGGAAGCATGATTGCACGTTGGTTCTGGCGCGAATGGCGTTCGCCGTCGCTATTAATTG
-TCTGGCTGGCGCTAAGCCTGGCGGTGGCCTGCGTGCTGGCGCTGGGCAATCAGCGATCGCATGGAGAAGGGCTTAGCCAGCAAAGCCGTGAGTTTATGGC
-GGGCGATCGGGCGTTGCGCAGTTCACGCGAAGTGCCGCAAGCGTGGCTGGAGGAAGCGCAAAAGCGCGGCCTGAAAGTCGGCAAAGCTGACTTTCGCCAC
-AATGACCTTGCAGGCGACACACCGCAGCTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAACCAATCCCTGGCCTGAAAC
-CGCAGGCGGGCAGCGTATTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGACGTGGGCGATGCCACCTTGCGGATTGC
-CGGAGAAGTGATTCAGGAACCGGATTCCGGTTTTAACCCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGGAGCCATT
-ACAGCCGGGGAGTCGGGTCACCTGGCGTTATAAATTCGGCGGCAACGAGAACCAGCTCGACGGCTATGAGAAATGGTTGTTACCTCAGCTTAAACCCGAA
-CAACGCTGGTACGGTCTGGAACAGGACGAAGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTGGCGCTTCTGACCTTGCTGCTGG
-CAGTGGCAGCGGTGGCGGTAGCGATGAATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCAGGCGCAACTGCG
-TAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAAACGTGTTGATGGTGCTGCTC
-AAGCCCGTTCTGCCTGCTGCACTACCGCCAGCCAGCCTCTGGCCGTGGCGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACC
-ATATCGCTTGCTGCTGGCAACGCAGCCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTG
-GTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTAGGCAGTGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCT
-GGGCTGGATGCTGCTGAATGTACTTCGCCGCATGACGCTGAAATCGCTGCCTCTGCGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGT
-TAAGTCAGCTTTCGGCATTTTCGCTCTCCTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCGCTACCTC
-AAGCCCGAACTACTTTTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGG
-TGGTGCGGGCGCGGCTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCT
-GGCCCGATCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGCTGGCGAAACGCAAACGTTGCCCTCGGTGA
-TACCGTGACTTTATGGGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGGCCCTAATTTCTATTTTTATTT
-TCCCTGAAGGGGCATTAGACGGGCAACCGCAGACTGGCTTACCAGTTTCCGCTGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGAC
-CATTAGCCTGTTAGATATTGGCGCGATTTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGC
-CTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCT
-GCGTACCACGTTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTTGCAGGCGAGTGT
-TTGATTTTCCGTGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCGGAGGCGCTGCTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGCGACTG
-GTTAAAGGGTAAGGCGCTGTTCAGGCAGTTTGCGGGGGTGATGAGTAAATAAGGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAAT
-ATGTTTCATTGATGATGTTATTGAATTGGTGATTTCCTATCTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTAC
-AAAAATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGAATTCATCTGTGCTAAAATGTTAG
-TTTAATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGTGAAAAATATATAAATACATTAGCTGGTCTTGTG
-TGTCATTTTATTTTTTGTTGCTAACACAGGATATGAACAATAACTAAAGGGCACTTTATATGAGCGGAAAACCAGCGGCGCGTCAGGGAGATATGACTCA
-GTATGGCGGTCCCATTGTCCAGGTTCGGCAGGTGTAAGACTTAGCGCGCCCACCGGCGTGGCGTGCTCAGTGTGTCCGGCGGGATGACTTCGGGCAACCC
+>tig00000002 len=3943 reads=1 class=unassm suggestRepeat=no suggestBubble=no suggestCircular=no trim=0-3943
+TCTCCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCGCACTCTGTCCTCCGTCCCCGCGTCCGTCTGCGCCGTGAGCC
+TTCCTGCCGCGTCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCCGTTTCCAGCCCGGCCCCGCCTTCTGTATGCAGCACCTC
+ACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCAGTTGCTCCACCACCCGCCCCGTA
+TCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGTCATACGTGAAAGCGCGCACCTGCGTATTG
+CTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATGCGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCATCA
+GCCACACCGCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCAGTGTGTCGAGGAACGCTGAGGCTGAGAGAGGGCGGGAACTGTCAGAA
+GAAGATAGCGAAGAGGTGGGCCTCTTCCGCACGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCCC
+CGGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGGTAAGCACCCGGTACGGCGGCAGCGGCGCTGGCAG
+TACGTCCTCAGCACCCGGCACCCGCTCAGACCACCCCAGTATCCACCACGGCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCAACCGGATATCCG
+GCGGCAGCGCCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCC
+TCCCGGCAGCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTTC
+AGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGCAGCGCAAGGTCC
+GTCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCC
+AATTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTTAGTT
+ATTGTTCATATCCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAACTTATTTTGTTCTCAATC
+AACAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTGCACAGATGAATTCATCATCAGCAAATTCACTATATGGATAATATCC
+ATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAATA
+GAAGATAGAAATCACCAATTCAATAACATCATCAATGCGGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTTA
+CTCTCATCACCCCGCAAACTGCCTGAACAGCGCCTTACCCTTTAACCAGTCGCGCACCCAGCCAGCCGCCGAAAAGCGACAGCAGCAGCGCTCCGCTGCA
+CGGCAGAACAATCCACAATCGCCAGTCTGGCTCCCACGGAAAATCAAACACTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAG
+GCCGGAAACAAACCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACG
+CTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGC
+ACCTGACCGACCTGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGC
+GGAAACTGGTAAGCCAGTTCTGCGGTTGCCCGTCTAATGCCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAG
+GCTGGTCACTTTAGCGCGGAACTCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCCTCTTCCATCGACA
+CTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCT
+TCATTACCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCCACCACCGGATAAAACGATTCCGGACTATCTGATGTTCCGCGAGGAACGCTTTAG
+CGGTGCTACCTGTTCTGTGGCGATGTTAATTAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCTGCCAGCGGTCGAGCAGATCGCCACGCAACACCA
+GCAGCAGTGCCAGCAGCATAAAGAGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGC
+AGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAA
+GCAGCATGCTGCCACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATC
+ATTACGTAATACGCGTAAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCACAGC
+CACGGCCAGAGGCTGGCTGGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTCGAACAACAGGCCTATGGCCCCACCGGTAAC
+GGCTGAAAGCGTCAGCACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCGCTCGCCCTGCCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAG
+CGACTGCGACAGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAGGTCAGAAGCGCCAGCAGCAGGAACTGTTACGAGCGTTCCATCGA
+TCGCCCCAGCGCGCCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTAAGCTGGTAACAACCATTTCATAGCCGTCGAGCTGGTTCTCGTTGC
+CCGCCGAATTTATAACGCCAGGTGACCCGACTCCCCGGCTGCACGGCTCCGGTTTTATCGACATCCGCCAGATTCATCATCAGACGCGGAGCCATCTGGA
+AGGGTTAAAACCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCGCAAGGTGGCATCGCCCACGCCAATGGTGTCGCCCGTTTTCAGGTTAAGCAGT
+GCCATCAGGCGTGGGGCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGGGTTAGTTGCAGATCGCCATACATCGGGTAGATATCATCCACCGCTTT
+GACGTTCGCCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTG
+>tig00000003 len=3074 reads=1 class=unassm suggestRepeat=no suggestBubble=no suggestCircular=no trim=0-3074
+TGCACTACCGCCAGCCAGCCTCTGGCCGTGGCGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTGTTGCTGG
+CAACGCAGCCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCT
+CGCCGGATTAATGGGTGGCAGCATGCTGCTTTAGGCGGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGCTGGATGCTGCTGAAT
+GTATGCTTCGCCGCATGACGCTGAAATCGCTGCCTCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCA
+TTTTCGCTCTCCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCAAGAAAGCCCGAACTACT
+TTTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGGTGGTGCGGGCGCGG
+CTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGATCATAATC
+CGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCAAACGTTGCCCTCGGTGATACCGTGACTTTAT
+GGGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCTGAAGGGCAT
+TAGACGGGCAACCGCAGAACTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATTAGCCTGTT
+AGATATTGGCGCGATTTTGAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGGTGGTACTGGTCACCGCCTGCGGTATGTT
+GCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCGTTACCACGT
+TGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTGTTGCAGGCGAAAGTGTTTGAT
+TTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCAGGCGCTGCTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAA
+GAGGTAAGGCGCTGTTCAGGCAGTTTGCGGGGTGATGAGAGTAAATAAGGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAATATGT
+TTCGTTGATGATGTTATTGAATTGGTGATTTCCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAA
+AATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGATGAATTCATCTGTGCTAAAATGTTAG
+TTTAATAAAATATTGAAAGTGACCTGTAATAACAGGTTGTTGATTGAGAACAAATAAGTTTATGTGAAAAATATATAAATACATTAGCTGGTCTTGTGTG
+TCATTTTATTTTTTGTTGCTAACACAGGGATATGAACAATAACTAAAAGGGCACTTTATATGAGCGGAAAACCAGCGGCGCGTCAGGGAGATATGACTCA
+GTATGGCGGTCCCATTGTCCAGGGTTCGGCAGGTGTAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCAGGCAACCC
 GGTAAATCCGCTGCTGGGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTAC
-CGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGAAAACGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGA
-CAACGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGGAGGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCAC
-AGCCGGACGGCCATACGCTGGCGCGGCTGTGGGGGCGCACCGCCGGATATCCAGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGT
-GGTGACTGGGGTGGTCTGGCGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCGGG
-CGGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGGCCGGGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCA
-CGCAGGCGCAGCGTGCGGAAGAGGCCCACCCTCTTCGCTATCTCCTTCTGACAGTTCCCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACTGCCCGGTAC
-CGAATACGGCCCCGACAGGGTATCCGCCTTTCGGCGGTGTGAAGCTGATGCACGACCCGGCATACCCGGAGAGCCTGCCCGCTGCGCCACTGGTGCGGTA
-CACGTATACGGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCACGTATGACGCGCAGCACCCGGGCCGGATGGTG
-GCGCACCGTTACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGGCGGGTGGTGGAGCAACTGAACCCGGCGGGTTAAGCTACCGCTATCT
-TTATGAGCAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAGGCGGGGCCGGGCTGAAACGAGGTGGTGAAAAAGAA
-CTGGCGGACGGCAGCGTC
->tig00000012 len=2176 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-AACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCG
-AAAAAGTACGCGCTCAACGCCCGTTGTACCGGAAGAGGAATGTCATTAATCAACCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACACCATTAACAC
-CAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAAGCACCA
-GCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATC
-TGCGGGCGGGGTGTAAAAGTATAAAAATGGCAAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTGTGTAACTTAATTGCAGGATGAATGT
-AAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATGCACAAAGGCGGTACTATTTCTGCATCAGATAAACAAATTCATTTTTCCGG
-TGCCATTCACCGGGTAGATACAAAGGGGGAGAAAAGTATGGAACTCTGCAGAGAATATCTGCATGGCTTATCTTTACGCCATTACTTATGCGGTTGCAGC
-GGGCGTTCTGGCGCTGCCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTACAGCTACCTGCATCGCGTCTGGCAGAAACCAGCGATAAACCGGTGT
-GGATGGATCAGGCCGAAAAGGCGGCTGGTGATTTTATTGATTGCTGAGTTTGAATGCATTGAAACCGCCAGCGGAAACGCTGGCGGTTTTTTATCAGGAA
-GATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGGAAATATATATAAATATTTTCCTAATTGTTCTTATCGACAGATATC
-TCGCCAGGCTTTCTTATAAATCTGTAGGGTTTCGCCCTGTCGGCATAAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGT
-CAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCCAGGGTTCAGCCAGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCGGCGG
-GTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCGGTGAAACCGACATCGCCCTGCCCGGCCGCTGCCGTTCATTTCTCTCCAC
-TAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCAAGATAACACACTGA
-TACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGG
-CGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTC
-CGCAGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCTGATGGGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTG
-GTGGACCGCTTCGGCGCATTACAGACGTTCCACCGCGAAGCCGCGGTGAATTCAGCGGCGAAATCACCGGCCCGTGACGGATGGTGCCGGGCGTCACTTC
-CGGCTGGTACTGACCGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGCCATTTCCGGCGGACGGAACCGTCCGCTTTTCCCGATACCCTGCGGGTTAC
-ACCGGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGGGCTGACCCCGCACGACCCGGAATACCCGGAGAATTTACCCCTGCCGCGCCGCTGGT
-GCGCTATGGCTGGACGCCCGCGAACTGGCGGCAGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTGATGATAAAATACCGGGGCCGGATGGTG
-GCGTACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACC
->tig00000013 len=6987 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-AATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTGCTGGGTTATCTG
-GTTTTATGCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTGGTGCTGGCGCGTCCTTTGGGC
-AGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAGCGGGCGTTGAGCGCGTACTTTTTCGCGCACTTGGCGTCTCTCTGACCGTGAGAT
-GAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTGGCATCACCCTTCCAT
-AATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCA
-CGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTTGCCCTCATCCGTGCGTTTTA
-CCCGCCAGAGCATGAGCACGCTCAGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTT
-ATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCGAACTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGG
-AAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCAACCGCACTGACCAACTTCGTGCAGATG
-CTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTAATGGGCGATGTCAGTG
-ATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAA
-AGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCT
-CTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGG
-CGGTGTTGTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTAC
-CCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTGCGAAGTGCTGT
-ACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGT
-CGGTCGCTTCGGGTGATTATCCCGGTGATGGCAGTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCG
-CTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCGGTGTGGAATATCTCTCCTGATGA
-TATTGGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAGGCCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAAATTAAACCCG
-CAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGACA
-ATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCGAAGGCCGCAGTAAAGCGCAGGCC
-AACAGTCTGAAGGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAG
-GCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGTGCATCGGTCGATGAAAGCGCCATCACCGGGAATCGGC
-ACCGGTGATCCGTGAATCCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCCGGCGAG
-ACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACAAAATTGCCTGACCATTCTGCTGATTGCCCTGACTATCGT
-CTTTTACTGGCAACCGCCACGCTGGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAAC
-CACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCA
-GGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCGGGCGTCGAGTTTATCCCCGCGCAGGGGCGTGGATGAAAAAC
-GCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGTAAAGCAGCGTTTTAACCTGCGCGAGCGC
-GATGTACGAGTATCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGATCCGTAAAGGTTCTGTCGA
-TGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCTACCGATGTTGATCAAAAGTCGATCAGGTTGCGCGTCAGGAGCCACGCCGCTGGTGGTG
-GTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGCTGCGCAAAATGGGCATTAAAAC
-GGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGCGACACCGGGGCCAAGCTGG
-CATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCGGCGCTGGCGCAGGCGAATGTCGCGGTGGCG
-ATGAACTCCGGCGCAGGCGGCGAAAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCT
-GATGACCCGTGGCTCGCTGACCACCTTCAGCGTACCAACGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGTATCCGCAGTTAA
-ATGCGCTGAACATCATGTGCTGCATTCGCCCGACTCCGCAATCCTCGGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTTTGATTCCCCTGGCGTTA
-AAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTGGGCTGCTGGTGCCGTTTATCGGTATCAA
-AGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGGTTTACCATGAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCTGTTATTGATTA
-CTGGCGGCGTTTACCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGT
-TCGGCATTAATCGGGCAGAATTTTACCGGCAGCTGTTTTCATGGTCGCCCGTCAGCAACAGCAGAAATGCCTATAATCCACAGGCTTCTGGCGGGAGCAA
-TCTGGCAGTCAGTAACCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCAGGCGTTCCAGTTGAAC
-TGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGGCAAATCCACGCGTGGCGAAAGCGCGTAATCTCAGCGTTAGAA
-CAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTCAACATTGTTGACTCAATCTGGCGCTGGATAA
-ACTTGATGAATAACGAACCCTTACGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGGGAAGCTGAAAAGTTTCTTCGGTGCCTGTG
-CAGGCGTCAGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCAAAGGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCACGGGCGAAAGATAC
-CGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCGC
-CGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAATGTGCGCCAGGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGG
-CATTGATGTTTTCACTACCGTCAGCGTTCAGCATCTGGAAAGTCTGAATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGGGAAACCGTGCCCGAT
-CCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGA
-GCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAGCTGGCACTGCGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCT
-GGCGGGGCATCCTGGCGAAGAGAAGTGTAGCACGCGCGACGCGATCCTTTTATGCATCGGCCATAACACCGGCAGCGAAAACTGGTCCGCGCAGCTGCGG
-CTGGCGTCACGGCTGGGTAGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCACCGCTTACCGGAAAAAACGTCGGGCAATTCTCAGCGCCTTA
-CGTCTGGCGCAGGAACTGGGCGCGGGGCGGCAACACTTTCTGATCCAGCGGAAGAGCGGTAGTGCGTTATGCCCGTGAACATAATCTCGGCAAGATTATT
-CTCGGTCGCCCGGCCTCGCGCCGCTGGTGGCGATCGGGAAACGTTTGCTGACCGACTGGCGCGCATCGCCCCGATCTCGATCAGGTGCTGGTCGCGCTTG
-ATGATCACCACGCCCGCACGATTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAAGTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTT
-ATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTTGATGCCGCCAACCTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTA
-TTTATGGACGCTGGCCTTCGGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATCTCTTTTTTATCGCCCACGCGGCACGCTCGCCGTCTCTGATGTG
-CAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCAGGAACCTTACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCG
-AGCAACGCACGGCACTTATATGAAATGTCGAGCTCTGGCGGTGGGCCGCAGTCCGCAGGATATCGCTGCCACCAGCGAACAATTTATTGCCTCCACGTTT
-CATGCCCGCAGTCAGGTGTTGTTGCCCGATGACAACGGTAAATTGCAGCCGTTAACACATCCGCAAGGAATGACGCCGTGGGACGATGCCATCGCGCAGT
-GGAGTTTGATAAAGGCCTGCCTGCGGGCGCGGGCACCGACACGTTACCCGGTGTACCGTACCAGATTTTGCCGTAAAAGCGGCGAAAACCACGGGCTGGT
-GGTGGTGGAGCCGGGAATCTGCGCCAGTTGATGATCCCGGAACAGCAGCGCCTGCTGGAACGTTACGCTGTTAGTCGCCAATGCCCTTGAGCGGCTGACG
-CTAACCGCCACGAAAAAGAACAGGCGCGGATGGCAAGCGAACGTGAACAGATCCGCAACGCCTGCTGGCGGCGCTTTCGCATAATTTACGCACGCCGCTT
-ACGGTGCTGTTTGGTCAGGCAGAAATCTTAACGCTCGATCTGGCAAGCGAGGATCACCCCGCCCGCCAGGCCAGCGAGATCCGTCAGCATGTGCTGAACA
-CTACCCGACTGGTGAATAATCTACTGGATATGGCGCGAATTCAGTCCGGCGGCTTTAATTTGAAGAAAGAGTGGTTAACGCTGGAAGAAGTAGTCGGCAG
-CGCGCTGCAAATCTGGAACCGGGTTTATCGTCGCCCATCAATCTTTCTCTGCCAGAACCGCTGACCTTAATCCACGTTGACGGGCCTCTTTGAACGGGTG
-CTGATTAATCTGCTGGAGAACGCGGTGAAATATGCGGGTGCGCAGGCCGAAATTGGTATCGATGCCCACGTTGAGGCGAAAATCTACAACTGGATGTCTG
-GGATAGCGGCCCCGGTCTTCCGCCAGGCCAGGAGCAGACGATATTTGATAAGTTTGCTCGCGGGAATAAAGAGTCGGCAGTACCGGGGGTAGGGCTTGGA
-CTGGCAATTTGTCGGGCGATAGTGGATGTACACGGGGCACTATTACGCGTTCAACCGACCGGAAGGTGGTGCCTGTTTTCGTGTTAC
->tig00000014 len=6644 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-GAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTTATTCAACAAGGTGCGCTGCAAAAC
-TTTCTGCCTTATCAGGCTGTGAATACCGTTGAAAGGCGCAACAGCTGTTATTACCATGGGGCCTGTAGCTTCTCAGGGAAGCGATCAAGATGCTCGTACT
-AACGGCGGTGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAAC
-GGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCACTTGTTGCTGTGGGCGATGTCAGTGATTTTTGTCATCTGCGTAGGCGTG
-GTGATGTGGGCAGAAGTTCAGGTGTCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTC
-AGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCT
-GATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATT
-GGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGC
-GGCGTTGGCGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTGGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAAC
-AGCAGCAGCGCCTTTGCCGGATTAAGCATATCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCAGGGTGATTATCCCGGTGA
-TGGCAGTGCCGGTTCGCTGGTGAGTAAAAGCCAAGCCGCCAGCTCCGGCGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTT
-GCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCGGTGGCGGAATATCTCTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAA
-CAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTA
-TCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTG
-GCTGCGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAGGGGTGAAAACTGCCTTTG
-CCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACATTCCTGCCGACCAATACGTAAAAGGCGATATCGTACTGGTAAAGCTGGCGATATTATC
-CCCTGCGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCACCGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCT
-CCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCGGCGAGGCATTTCTGGATCGGATGATCGCGATGGTGGAA
-GGCGCACAGCGACGCAAAACGCCGAACAGAAATTGCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGTAGCCGTTTTC
-GCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCG
-CCGGGATGAACCGGATGCTGAGCGCGCGAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACC
-GTACCATCACACTCGGTAACCGTCAGGCGTCAGGTTTATCCCCGCGCAGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTG
-ATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGCGTTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTG
-CGCAAAGCCGGATAGGCGGGATCAACATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGAGGCTAACGGTGGTCAC
-TTCCCTACCGATGTTGATCAAAAGTCGATCAGGTTGCGCGTCAAAGGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGC
-TGAAGATATCGTCAAAGGCGGTATTAAAGAGAGCGCTTCATAGCTGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCC
-GCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGAAGCGACACCGAGTAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTT
-TGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCACTGGCGCAGGCAGATGTCGCAGTGGCGATGAACTCCGGCGCAGGCGGCGAAAGGCGGGC
-AATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCATGACCACCTTCAGCGT
-ACTGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGTATCCGCAGTTAATGCGCAGACATCATGTGCCTGCATTCGCCCGACTCCGCA
-ATCCTCGGGTGCGGTGATTTTCAAGCTTTGATTATCGTCTTTGATTCCCTGGCGTTAAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATATTTG
-CGCCGTAACTTACGGATTACGGTCTGGGTGGGCTGCTGGTGCCGTTTATCGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGGA
-CTTTACCATAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCTGTTATTGATTACTGGCGTTTACCCGCTTGCTGACCACCGTACTGGGGCAATGG
-TGGTTTCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCAGGCAGAATTTACCGGCAACGGCTGTATTTTT
-CATGGTCGCCCGTCAGCAGCAGCAGAAATGCCCTATAATCCACAGGCTTCTGGCAGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAATTAATAG
-CCGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCAGGCGTTCGGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGACAATAATATCA
-CCCGCAAGCGGCGGCCTGGCAAATCCCACGCGTGGCGAGCGCCATAATCTCAGCGTTGAACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGC
-TGGTGAAATATATCGGCCAGCCGGTTGTCAACATGTTGAAACTCAATCTGGCGCTGGATAAACTCGATGAATAACGAACCCTTACGTCCGACCCCGATCG
-TCTGCTGGAACAAACTGCCGCGCCGCATCGGGAAGCTGATTTTCTTCGGTGCCTGTGCAGGCGTCAGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGC
-GACTGCGAGCGCAAGGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCACGGGCGAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTA
-AAACGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATGCCGCCACTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCAC
-AGTAATGCGCGGAGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATC
-TGGAAAGTCTGAATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGGAAACCGTGCCCGATCCTTTTCGATGCCGCGACGACGTGGTGCTGGTGGAC
-TTGCCCCGGACGATCTGCGCCAGCGGCTGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTG
-GTCGCCCTGCATGAACTGGCACTGCGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGGCGTCCTGGCGAAGAGAAAGTGTGCACAC
-GCGACGCGATCCTTTTATGCATCGGCCATAACACCGGCAGCGAAAAACTGGTCCGCGCAGCTGCGCGCTGGCGTCACGGCTGGGTGGCGTCTGGCACGCG
-GTGTTATGTTGAAACCCCTGCCCTGCACCGCTTACCGGAAAAAACGTCGGGCAATTCTCAGCGCCTTACGTCTGGCGCAGGAACTGGGCTGGAGACGGCA
-ACACTTTCTGATCCAGCGGAAGAGAAAGCGGTAGTGCGTTATGCCCGTGAACATAATCTCGGCAAGATTATTCTCAGTCGCGGCCTCGCGCCGCTGGTGG
-CGTCGGGAGACGTTTGCTGACCGACTGGCGCGCATCGCCCCGATCTCGATCAGGTGCTGGTCGCGCTTGATGAACCACCCGCCCGCACGATTAACAACGC
-GCCGGATAACCGCTCTTTTAAAGACAAGTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACTTTAATTGCCATGCAG
-TGGCTGATGGCGTTGATGCCGCCAACCTGGTGATGCTGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTATGGACGCTGGCCTTCAGTGGTTGCC
-ACCGTCATTAATGTAGTGAGTTTCGATCTCTTTTTATCGCCCCACGCAGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTT
-AACCGTCGGGCTGGTGATCAGGAACCTTACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCGAGCACGCACACGGCACTTATATGAAATGT
-CGAAAGCTCTGGCGGTGGGCCGCAGTCCGCAGGATATCGCTGCCACCAGCAGACAATTTATTGCCTCCACGTTTCATGCCCGCAGTCAGGTGTTGTTGCC
-CGATGACAACGGTAAATTGCAGCCGTTAACACATCCGCAAGGAATGACGCCGTGGGACGATGCCATCGCCGCAGTGGAGTTTTGATAAAGGCCTGCCTGC
-GGGCGCGGGCACCGACACGTTACCCGGTGTACCGTACCAGATTTTGCCATAAAAAGCGGCGAGAAAACCTACGGGCTGGTGGTGGTGGAGCCGGGAATCT
-GCGCCAGTTGATGATCCCGGAACAGCAGCGCCTGCTGGAAGACGTTACGCTGTTAGTCGCCAATGCCCTTGAGCGGCGGCGCTAACCGCCAGCGAAGAAC
-AGGCGCGGATGGCAAGCGAACGTTGAACAGATCCGCAACGCCCTGCTGGCGGCGCTTTCGCATGATTTACGCACGCCGCTTACGGTGCTGTTTGGTCAGG
-CAGAAATCTTAACGCTCGGTCTGGCAAGCGAAGGATCACCCCGCCCGCCAGGCCAGCGGATCCGTCAGCATGTGCTGAACACTACCCGACTGGTGAATAA
-TCTACTGGATATGGCGCGAATTCAGTCCGGCGGCTTTAATTTGAAGAAAGAGTGGTTAACGCTGGAAGAAGTAGTCGGCAGCGCGCTGCAAATGCTGGAA
-CCGGGTTTATCGTCGCCCATCAATCTTTCTCTGCCAGAACCGCTGACCTTAATCCACGTTGACGGGCCCTCTTTGAACGGGTGCTGATTAATCTGCTGGA
-GAACGCGGTGAAATATGCGGGTGCGCAGGCCGAAATTGGTATCGATGCCCACGTTGAGGGCGAAAATCTACAACTGGATGTCTGGGATAACGGCCCCGGT
-CTTCCGCCAGGCCAGGAGCAGACGATATTTGATAAGTTTGCTCGCGGGAATAAAGAGTCGGCAGTACCGGGGTAGGGCTTGGACTGGCAATTTGTCGGGC
-GATAGTGGATGTACACGGGGGCACTATTACCGCGTTCAACCGACCGGAAGGTGGTGCCTGTTTTCGTGTTACACTTCCCCAGCAAACTGCCCCTGAACTG
-AAGAATTTCAGCGAGGATATGTGACAAACGTTCTGATTGTTGAAGATGAACAGGCTATTCGTCGCTTTCTGCGCACGGCGCTGGAGGGCGACGGATGCGC
-GTCTTTGAGGCCGAAACGCTGCAACGCGGCTTGCTGGAAGCGGCAACCCGTAAGCCAGATTTGATTATTCTCGATCTCGGCCTGCCCGATGGTGATGGGA
-TTGAGTTTATCCGCGACCTGCGCCAGTGGAGCGCGGTGCCGGTG
->tig00000015 len=3097 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-GACAGCCTGGCAACTGCTGTGGATTAAGCGGCAGATGGTGCTGACCGAGCAACGCAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCA
-CAGATATTGCTTCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGAATATCATTAATCAA
-CCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCAT
-TGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAGTGATA
-CCGGAAGGGGTAGAATTCTGGCTGCCAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAATATAAAATGTGAAAAGCCATGGTTAACTAATGTTTAGTG
-AATTGCTTTTGTAACTTAATTACAGGATGAATGTAAATAAAACCATCAATAAGCAAAATAAGTGGTCGGATGGGTAGTAAAATTACACAAAAGGCATTTA
-TTTTCATCAGATAAACCAAATTCATTTTTCAGTGCCATTCACCGGTAGATACAAAGGGAGAAAAGTATGGAACTCTACAGAATATCACCATGGCTTATCT
-TTTTACGCCGTACTTATGCGGTTTGCGGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGGCCGCGCCCGCTTTACAGCTACCTGCATCGCGT
-CTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGGAGTTTGAATACATTGAAAACCGCC
-AGCGGAAACGCTGGCGGTTTTTATCAGGAAGATGTTCAGAGGAATATTTGAACATCGTTATACCAATCCGAAACATATATTCATGAAATATGCCATAAAT
-ATTTTCCTAATTGTTCTTATCTGACCAGATATCTCACTTAAAACAAAGCTTTCATAAATCTGTAGGGTTTCGCCTGGCATCAGCAGATAAATAACCCGAT
-AAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCGATATGGCTGATAGCATTGTCCAGGTTCAGCCGGGGTACGCAT
-CAGTGCCCCCACCGGCGTGGCCTGTTCGGTGTGCCCGGCGGGGGGTGACGTCGGCCATCGGTCAATCCGCTGCTCGGTGCAAGGTCCTTCCAGTGAAACC
-GACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAAACGCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTG
-GAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAATGATAACGGCGGCAAGCCTGTATTTTGACACCTGTTTCCCGGTAAG
-GACAGTGATTACAGCCACGGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAAGGTCACCGGCTGGCCGCACTCTGGCAGCGCTGC
-CGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGCCGTGGTAGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGAT
-GAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGAAGCCGCCGGTGAATTC
-AGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGTAGAAGAAGCCCGGCAGCAGGCCAT
-TTCCGGCGGGACGGAACCGTCCGCTTTCCTGATACCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCA
-CGACCGGAATACCCGGAGGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAACCAATACA
-CAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGAC
-GGGCGGGTGACAGAACAGCTAAACCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGT
-CCTGCACACGCAAATTGAAGGCGGGCTGAAGCGAGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCG
-GGCACTGAACGGATGCCGCAGGCAGGACAACGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCGGGGCATCGGCG
-TTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCAGGAATATAGTGATACGATTGCGTCTGATTCAGGAAA
-CTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACGGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCGGCGGAAAACCATGACG
-TGGAGCCGTTACGGTCAGTTGCTGGGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTCACCGCGA
-GGAAAGGGCTGAGTCAGTACCGCGCATACACGGCCGTGGACGGTTAATTGCCGTGAAAAGCACGCAGGGCCATAAAGACGCGGTATGAATACAACGCCGC
-CGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCGAAACGGGACACAGTACGATGCGTGGGGAGAAAACCATCATACCACGCAGGGCGGTCTGACGC
-GCAGTATATGGAATACGATGCGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGA
->tig00000016 len=5147 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-CATGGCACCACGTTGATTATGGTGACCCACGACCTGCAACTGGCGGCGCTGCGACCGCTGCTTACGGCTGGTGAACGGGCAGTTGCAGGAGGAAGCATGA
-TTGCACGTTGGTTCTGGCGCGAATGGCGTTCGCCGTCGCTATTAATTGTCTGGCTGGCGCTAAGCCTGGCGGTGGCCTGCGTGCTGGCGCTGGGCAATAT
-CAGCGATCGCATGGAGAAGGGGCTTAAGCCAGCATTAAGCCGTGAGTTTATGGCGGGCGATCGGGCGTTGCGCAGTTCACGCGAAGTGCCGCAAGCGTGG
-CTGGAAGCGCAAGAGCGCGGCCTGAGAATCAGCAAGCGGCTGACTTTCGCCACAATGACCTTGCAGGCGACACACCGCAGCTGGCGAACGTCAAAGCGGT
-GGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTGAAACCGCAGGCGGGCAGCGTATTACTGGCCCCACGCCTGATGGCACTGC
-TTAACCTGAAAACGGGCGACACCATTGGCGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAGTGATTCAGGAACCGGTTCCGGTTTAACCCTTCCAGAT
-GGCTCCGCGTCTGATGATGAATCGGATGTCGATAAAACCGGAGCCGTGCAGCCGAGGGAGTCAGGTCACCTGGCGTTATAAATTCGGCGGCAACGAGAAC
-CAGCTCGACGGCTATGAAATGGTTGTTACCCTCAGCTTAAACCCGAACAACGCTGGTACGGTCTGGAACAGGACGAAGAGGCGCTGGGGCGATCGATGGA
-ACGCTCGTAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCTGCTGCTGGCAGTGGCAGCGGTGGCGGTAGCGATGAATCATTACTGTCGCAGTCGCTACG
-ATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCGAGCGCAACTGCGTAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTAC
-CGGTGGGGCCATAGGCCTGTTGTTCGAAACGTGTTGATGGTGCTGCTTCAAGCCCGTTCTGCCTGCTGCACCGCCAGCCAGCCTCTGGCCGTGGCTGTGG
-GCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTGTTGCTGGCAACGCAGCCTTTACGCGTATTACGTAATGATGTGG
-TAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTAGCG
-GTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGCTGGATGCTGCTGAATGTACTACTTCGCCGCATGACGCTGAAATCGCTGCCCT
-CTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCATTTTCGCTCTCCTTTATGCTGCTGGCACTGCTGCTGG
-TGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCCAGAGAAGCCCGAACTACTTTTAATTAACATCGCCACAGAACAGGTAGCACCGCT
-AAAGCGTTCCTCGCGGAACCATCAGATAGTCGGAATCGTTTTATCCGGTGGTGCGCGGGCGCGTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGA
-AGATGGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGATCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAG
-TGTCGATGGAAGAGGGGCTGGCGAAACGCAAACGTTGCCCTCGGTGATACCGTGACTTTATGGGCGATACCCAGAGAGTTCCGCGCTAAAGTGACCAGCC
-TGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCTGAAGGGCATTAGACGGGCAACCGCAGAACTGGCTTACCAGTTTCCGC
-TGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATTAGCCTGTTAGATATTGGCGCGATTTTAAAAACAGGTCGGTCAGGTG
-CTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGCCTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGC
-GTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCGTACCACGTTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCC
-TGGTGGCCGCAATTGCGGAAACGGCGCTGGCAGTGTTGCAGGCGAAAGTGTTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTG
-CAGCGGAGCGCTGCTGCTGTCGCTTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAAGAGTAAAGGCGCTGTTCAGCAGGTTTGCGGGGTGATGAGAGT
-AAATAAGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAATATGTTTCGTGATGATGATGTTATTGAATTGGTGATTTCTATCTTTCT
-ATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAAATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAAT
-GGATATTATCCATATAATGAATTTGTTGATGATGAATTCATCTGTGTGCTAAATGTTAGTTTAATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTG
-TTGATTGAGAACAAATAAGTTTATGTGAAAAATATATAAATACATTAGCTGGTCTTGTGTGTCATTTTATTTTTTGTTGCTAACAGGGATATGAACAATA
-ACTAAAAGGGCACTTTATGAGCGGAAAACCAGCGGCGCGTCAGGAGATATGACTCAGTATGGCGGTCCCATTGTCCAGGGTTCGGCAGGTGTAAATTGGC
-GCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCCGGGCAACCCGGTAAATCGCTGCTGAGGGCGAAGGTGCTGCCCGGCGAGACGG
-ACCTTGCGCTGCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGA
-AAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGACAACGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGAGG
-CGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAAGCAGCACACAGCCGGACGGCCCATACGCTGGCGCGGCTGTGGGGGCGCTGCCG
-CCGGATATCCCGGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGTGGATACTGGGGTGGTCTGAGCGGGTGCCGGGTGCTGAG
-GACGTACTGCCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCGGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGGC
-GAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCACGCAGGCGCAGCGTGCGGAAGAGGCCACACCTCTTCGCTATCTTC
-TTCTGACAGTTCCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACACTGCCCGGTACCGAATACGGCCCCGACAGGTATCCGCCTTTCGGCGGTGTGGCTG
-ATGCACGACCCGGCATACCCGGAGGCCTGCCCGCTGCGCCACTGGTGCGGTACACGTATACGGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCAA
-TACGCAGGTGCGCGCTTTCACGTATGACGCGCAGCACCCGGCCGGATGGTGGCGCACCGTTACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATA
-CGGGGCGGGTGGTGGAACAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAGCAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGA
-GGTGCTGCATACAGAAAGGCGGGGCCGGGCTGGAAACGGGTGGTGAAAAAGAACTGGCGGACGGCAGCGTCACGCGCAGCAGGTATGACGCGGCAGGAAG
-GCTCACGGCGCAGACGGACGCGGCGGGACGGAGGACAGAGCGGTCTGAATGTGGTGTCCGGCGATATCACGGACATCACCACACCGACGGGCAGGAGACG
-AAATTTTACTATAACGACGAGAACCAGCTGACGGCGGTGGTGTCCCCGGACGGGCTGGAGAGCCGCCGGGAATATGATGAACCGGCAGGCTGGTATCGGA
-GACATCGCGCAGCGGGGAGACAGTACGCTACCGCTACGATGACGCGCACAGTGAGTTACCGGCGACGACAACGGATGCGACGGGCAGCACCGGCAACAGA
-TGACCTGGAGCCGCTACGGGCAGTTGCTGGCGTTCACCGACTGCTCAGGCTACCAGACCCGTTATGAATACGACCGCTTCGGCCAGATGACGGCGGTCCA
-CCGCGAGAGAGCATCAGCCTTTACCGCCGCTATGACAACCGTGGCCGGTTAACCTCGGTGAAGACGCACAGGGCCGTGAAACGCGGTATGAATACAACGC
-CGCAGGCGACCTGACTGCCGTTATCACCCCGGACGGCAACCGGGCGAGACACAGTACGATGCGTGGGGAAAGGCGGTCAGCACCACGCAGGGCGGGCTGA
-CGCGCAGTATGGATTACGATGCTGCCGGACGTGTCATCAGCCTGACCAACGAGAACGGCAGCCACAGCGTCTTCAGTTACGATGCGCTGGACCGGCTGGT
-ACAGCAGGGCGGCTTTGACGGGCGGACGCAACGTTATCATTATGACCTGAGCCGGAAAACTCACACCAGAGTGAGGATGAGGACTTGTCATCCTCTGGTA
-CTACGATGAATCGGACCGTATCACTCACCGCACGGTGAACGGCGAACCGGCAGAGCAGTGGCAGTATGATGGCCACGGCTGGCTGACAGACATCAGCCAC
-CTGAGCGAAGGCCACCGTGTTGCCGTCCACTATGGCTATGACGATAA
->tig00000017 len=6305 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-CTGTCTCCCCGCTGCGCGATGTCTCCGATACCAGCCTGCCCGGTTCATCATATTCCGGCGGCTCTCCAGCCCGTCCGGGGACACCACCGCCGTCAGCTGG
-TTCGTCGTTATAGTAAAATTTCGTCTCCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCATTACTCTGTCCTCCGTCC
-GCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCCGTTTCAGCCCGGC
-CCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTAACCCTGCCGGGTTCA
-GTTGCTCCACCACCGCCCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGCGTCATAC
-GTGAAAGCGCGCACCTGCGTATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATACGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCT
-CCGGGTATGCCGGGTCGTGCATCAGCCACACCGCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCAGTGTGTCGAGGGAACGCTGAGGC
-TGAGAGAGGGCGGGAACTGTCAGAAGAAGATAGCGAAGAGGTCGGGCCTCTTCCGCACGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCGCCCGGC
-ACCGTCCGTCACGCCGGTGATTTCCCCGGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGAAAGCACCC
-GGTACGGCGGCAGCGGCGGCGCTGGCAGTACGTCCTCAGCACCCGGCACCCGCTCAGACCACCCCAGTATCCACCACGGCCTGTGCGCTGTTGGTCGCCA
-GGTAAAGATGCGGGCTTAACCGGATATCCGGCGGCAGCGCCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGC
-CACGTGACTCACTGCGGCTGTACACCGCCTCCCCGGCAGCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGT
-AGCTGTAAGCGGATATCAGAAGGCGCTTTCCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAA
-TGAACGGCAGCGGGCCGGGCAGCGCAAGGTCCGTCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGG
-ACACACCGAGCACGCCACGCCGGTGGGCGCGCCAATTCTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCTGACGCGCCG
-CTGGTTTTCCGCTCATATAAAGTGCCCTTTTAGTTATTGTTCATATCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTAT
-ATCTTTTCATAAACTTATTTGTTCTCAATCAACAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTTAGCACAGATGAATTCA
-TCATCAGCAAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAAT
-AAACTCCACCGATTCAGATTAATATCAGCAATAGAAGATAGAAATCACCAATTCAATAACATCATCAATGAAGACATATTGTAGAATTAATTTAAACAAG
-GCGTTCCATTCAACCAGAACGCCCCTTATTTACTCTCATCACCCGCAAACTGCCTGAACAGCGCCTTACCCTTAACCAGTCGCGCACCCAGCCAGCCGCC
-GAAAGCGACAGCAGCAGCGCCTCCGCTGCACGGCAGAACAATCCACAATCGCCAGTCTGGCTCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCA
-GCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAAACAAACCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGA
-GTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCAT
-CACTTCCAGCGCCCGACTTACCTGCTCCAGCACCTGACCGACCTGTTTTAAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAG
-TTGTGTCAACATGCCGTTGCCATTCTCAGCGGAAACTGGTAAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCCTTCAGGGAAAATAAAATAGAAATTAGG
-CCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTT
-GCGTTTCGCCAGCCCTCTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCCGCGTATTTTGCCAGGTAA
-GATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTACCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCGCACCACCGGATAAAACGATTCCGGG
-ACTATCTGATGTTCCGCGAGGAACGCTTTAGCGGTGCTACCTGTTCTGTGGCGATGTTAATTAAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCTG
-CCGCAGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCT
-GACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAA
-AGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCATGCTGCCACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGA
-TAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTAATACGCGTAAGGCTGCGTTGCCAGCAAGCAAGCGATATGGTCGTAGCCCCACCAGCA
-GCGAGATGACCGTCATGGTGCCAAGCGCCCACGCCACGGCCAGAGGCTGGCTGGCGGTAGTGCAACAGGCAGAACGGGCTTGAGCAGCACCATCAACACG
-TTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGTCAGCACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCGCTCGCCCTG
-CCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACAGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAG
-CGCCAGCAGCAGGAACTGTTGCGAGCGTTCCATCGATCGCCCCAGCGCGCCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTAAGCTGGGGT
-AACAACCATTTCTCATAGCCGTCGAGCTGGTTCTCGTTGCCGCCGAATTTATAACGCCAGGTGACCCGACTCCCCGGCTGCTGGCTCCGGTTTTATCGAC
-ATCCGCCAGATTCATCATCAGACGCGGAGCCATCTGGAAGGGTTAAAACCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCGCAAGGTGGCATCGC
-CCACGTCAATGGTGTCGCCCGTTTTCAGGTTAAGCAGTGCCATCAGGCGTGGGGCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGGGGATTAGTT
-TGCAGATCGCCATACATCGGGTAGATATCATCCACCGCTTTGACGTTCGCCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTGGCGAAAGTCAGCTGCT
-GCCGACTTTCAGGCCGCGCTTTGCGCTTCCTCCAGCCACGCTTGCGGCACTTCGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTT
-GCTGGCTTAAGCCCTTCTCCATGCGATCGCTGATATTGCCCAGCGCCAGCACGCAGGCCACCGCCAGGCTTAGCGCCAGCCAGACAATTAATAGCGACGG
-CGAACGCCATTCGCGCCAGAACCAACGTGCAATCATGCTTCCTCCTGCAACTGCCCGTTCACCAGCCGTAAAGCAGCGGTCGCAGCGTGCCGCCAGTTGC
-AGGGTCGTGGGTCACCATAATCAACGTGGTGCCATGTTCACGGTTGAGGAAAACAGCAGGTCGGCAATTTTATCGCCCGTCTGGCGGTCAAGGTTGCCGT
-GGGTTCGTCGGCAAACAGCATCAGGTCGACCATTAAAGGCTCGTGCCAGCGCTTCCTCGTTGCTGTTCACCGCCGGAAAGCTGTGCCGGAAGATGATCAG
-ACGTTTACCCAGCCCTAACTGTTCGAGCAACGCTTTCGCCCCGTTACGACTTTCCGCGCTTTCTCACCGCGCAGCAGGGCGGAAGCTCGACGTTTTCCAG
-CGCGTTAAGGTAGGAATTAACATAAATGACTGAAAAACAAAGCCGACGTGCTTCGCGCGCAACTTTGCCCGCGCTTCGTCCATATTATGTGGCGGTTGTC
-CCACCAGACTCACTTCGCCACTGCTGCCGTCATCAAGCCCGGCGAGGATCGCCAGCAAGGTTGACTTACCCGATCCCGACTCGCCCACCAGTGCGATGGT
-CTCGCCGTTTGACAACCAGCTCAACTCCGGTGAGGATGGAGAGTTCATGCTCCCTGACCGACGGACTTCTTAAGATGATGAACCAACAATGTTTTCCGCT
-GGCATTTGCCCTTCCTGTTCCTGGTCCCATTAACCTTCCGTGCCGCCGCAGCGGCACGTTATTGATTCTGGGTGATAGCCTGAGCGCCGGGTATCGAATG
-TCTGCCAGCGCGGCCTGGCCTGCCTTGTTGAATGATAAGTGGCAGAGTAAAGACGTCGGTAGTTAATGCCAGCATCAGCGGCGACACCTCGCAACAAGGA
-CTGGCGCGCCTTCCGGCTCTGCTGAAACAGCATCAGCCGCGTTGGGTGCTGGTTGAACTAATGGGCAATGACGGTTTGCGTGGTTTTCAGCCACAGCAAA
-CCGAGCAAACGCTGCGCCAGATTTTGCAGGATGTCAAAGCCGCCAACGCTGAACCATTGTTAATGCAAATACGTCTGCCTGCAAACTATGGTCGCCGTTA
-TAATGAAGCCTTTAGCGCCATTTACCCCAAACTCGCCAAAGAGTTTGATGTTCCGCTGCTGCCCATTTTTATGGAAGAGGTCTACCTCAAGCCACAATGG
-ATGCAGGATGACGGTATTCATCCCAACCGCGACGCCCAGCCGTTTATTGCCGACTGGATGGCGAAGCAGTTGCAGCCTTTAGTAAATCATGACTCATAAA
-GCAACGGAGATCCTGACAGGTAAAGTTATGCAAAAATCGGTCTTAATTACCGGATGTTCCAGTGGAATTGGCCTGGAAAGCGCGCTCGAATTAAAACGCC
-AGGGTTTTCATGTGTGCTGGCAGGTTGCCGGAAACCGGATGATGTTGAGCGCGCGAACAGCATGGGATTTACCGGCGTGATCGATCTGGATTCACCAGAA
-AGTGTTGATCGCGCAGCCGACGAGGTGATCGCCCTGACCGATAGTGTCTGTATGGGATCTTTAACAATGCCGGATTCGGCATGTATGGCCCTTTCCACCA
-TCAGCCGTGCGCAGATGGAACAGCAGTTTCCGCCAACTTTTCGGCGCACACCAGCTCACCATGCGCCTGTTACCCGCGATGTTACCGCACGGTGAAGGGC
-GTATTGTGATGACATCATCGGTGATGGGATTAATCTCCCGCCGGGTCGTGGCGCTTACGCGGCCAGTAAATATGCGCTGGAGGCGTGGTCAGATGCACTG
-CGCATGGAGCTGCGCCACAGCGGAATTAAAGTCAGCCTGATCGAACCCGGTCCCATTCGTACTCGCTTCACCGACAACGTCAACCAGACGCAAAGTGATA
-AACCAGTCGAAAATCCAGCATCGCCGCCCGCTACGTTGGGACCGGAAGCGGTGGTGGACAAAGTACGCCATGCTTTTATTAGCGAAGCCGAAGATGCGCT
-ATCCG
->tig00000018 len=4534 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-ACGTCGTTATAGTAAAATTTCGTCTCCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCATTACTCTGTCCTCCGTCCG
-CCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCCGTTTCAGCCCGGCC
-CCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTAACCCTGCCGGGTTCAG
-TTGCTCCACCACCCGCCCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGTCATACGT
-GAAAGCGCGCACCTGCGTATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATACGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCC
-GGGTATGCCGGGTCGTGCATCAGCCACACCGCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCAGTGTGTCGGGGAACGCTGAGGCTGA
-GAGAGGGCGGGAACTGTCAGAAGAAGATAGCGAAGTCGGGCCTCTTCCGCGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCC
-GTCACGCCGGTGATTTCCCCGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGGTAAGCACCCGGTACAG
-CGGCAGCGGCGCTGGCAGTACGTCCTCAGCACCCGGCACCCACTCAGACCACCCCAGTATCACCACGGCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGC
-GGGCAACCGGATATCCGGCGGCAGCGCCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCATTGACTCACTG
-CGGCTGTACCGCCTCCCCGGCAGCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATAT
-CAGAAGGCGCTTTCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCG
-GGCAGCGCAAGGTCCGTCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCA
-CGCCGGTGGGCGCGCCAATTCTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCCTGACGCGCCGCTGGTTTTCCGCTCAT
-ATAAAGTGCCCTTTTTGGTTATTGTTCATATCCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTCACATA
-AGCTTATTTGTTCTCAATCAACAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTTGGCACAGATGAATTCATCATCAGCAAA
-TTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCG
-ATTCAGATTAATATCAATAGAAAGATAGAAATCACCAATTCAATAACATCATCAATAAGAACATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACC
-AGAACGCCCCTATTCTCTCATCACCCCCAAACTGCCTGAACAGCGCCTTACCCTCCAACCAGTCGCGCACCCAGCCAGCCGCCGAAAGCGACAGCAGCAG
-CGCTCCGCTGCACGGCAGAACAATCCACAATCGCCAGTCTGGCTCCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCA
-ATTGCGGCCACCAGGCCGGAAACAAACCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACC
-AGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGAC
-TTACCTGCTCCAGCACCTGACCGACCTGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTT
-GCCATTCTCCCAGCGGAAACTGGTAAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAG
-TCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTGGCGTTTCGCCAGCCC
-TCTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGT
-TAAGCGCCTCATCTTCATTACCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCGCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCC
-GCGAGGAACGCTTTTAGCGGTGCTACCTGTTCTGTGGCGATGTTAATTAAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCTGCCAGCGGTCGAGCA
-GATCGCCACGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAA
-CCGCCAGGCGCAGAGGCAGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTACTACCGCGCC
-CAGCACCGCCCAAAGCAGCATGCTGCCACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACG
-TTCGCTACCACATCATTACGTAATACGCGTAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCCACCAGCAGCGAGATGACCGTCATGGTGCC
-AAGCGCCCAGCCACGGCCAGAGGCTGGCTGGCGGTAGTGCAACAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTTCGAACAACAGGCCTATGGC
-CCCACCGGTAACGGCTGAAAGCGTCAGCACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCGCCGCCCTGCCCCAGCGTTTTGAGGATCGCCAC
-CAGATCGTAGCGACTGCGACAGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCAGCAGCAGGAACTGTTGCGAG
-CGTTCCATCGATCGCCCCAGCGCGCCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTAAGCTGGGGTAACAACCATTTCTCATAGCCGTCGA
-GCTGGTTCTCGTTGCCCCGAATTTATAACGCCAGGTGACCCGACTCCCCGGCTGCGGCTCCGGTTTTATCGACATCCGCCAGATTCATCATCAGACGCGG
-AGCCATCTGGAAGGGTTAAAACCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCGCAAGGTGGCATCGCCCACGTCAATGGTGTCGCCCGTTTTCA
-GGTTAAGCAGTGCCATCAGGCGTGGGGCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGGGGATTAGTTTGCAGATCGCCATACATCGGGTAGATA
-TCATCCACCGCTTTGACGTTCGCCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTGGCGAAAGTCAGCTGCTTGCCGACTTTCAGGCCGCGCTTTGCGC
-TTCCTCCAGCCACGCTTGCGGCACTTCGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTTGCTGGCTTAAGCCCTTCTCCATGCGA
-TCGCTGATATTGCCCAGCGCCAGCACGCAGGCCACCGCCAGGCTTAGCGCCAGCCAGACAATTAATAGCGACGGCGAACGCCATTCGCGCCAGAACCAAC
-GTGCAATCATGCTTCCTCCTGCAACTGCCCGTTCACCAGCCGTAAAGCAGCGGTCGCAGCGTGCCGCCAGTTGCAGGTCGTGGGTCACCATAATCAACGT
-GGTGCCATGTTCACGGTTGAGGGAAACAGCAGGTCGGCAATTTTATCGCCCGTCTGGCGGTCAAGGTTGCCGGTGGGTTCGTCGGCAAACAGCACATCAG
-GTCGACCATTAAAGGCTCGTGCCAGCGCCTACTCGTTGCTGTTCACCGCCGGAAAGCTGTGCCGGAAGATGATCAGACGTTTACCCAGCCCTAACTGTTC
-GAGCAACGCTTTCGCCCCGTTACGACTTTCCGCT
->tig00000019 len=2223 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-CGGTCAGGCGGCCTTATCGTCATAGCCATAGTGGACGGCAACACGGTGGCCTTCGCTCAATTGGCTGATGTCTGTCAGCCAGCCGTAGCCATCATACTGC
-CACTGCTCTGCCGGTTCGCCGTTCACCGTGCGGTGAGTGATACGGTCCGATTCATCGTAGTACCAGAGGATGACAAGTCCTCATCCTCACTCTGTGTGAG
-TTTTCCGGTCAGGTCATAATGATAACGTTGCGTCCGCCCGTCAAAGCCGCCCTGCTGTACCAGCCGGTCCAGCGCATCGTAACTGAAGACGCTGTGGCTG
-CCGTTCTCGTTGGTCAGTTGATGACGTCCGGCAGCATCGTAATCCATACTGCGCGTCAGCCCGCCCTGCGTGGTGCTGACCGCCTTTCCTACGCATCGTA
-CTGTGTCTCGCTCGGTTGCCGTCCGGGGTGATAACGGCAGTCAGGTCGCCTGCGGCGTTGTATTCATACCGCGTTTCACGGCCCTGTGCGTCTTTCACCG
-AGTTAACCGGCCACGGTTGTCATAGCGGCGGTAAAGGCTGATGCCTTCCTCGCGGTGGACCGCCGTCCTCATCTGGCCGAAGCGGTCGTATTCATAACGG
-GTCTGGTAGCCCGAGCAGTCGGTGAACGCCAGCAACGCTGCCGTAGCGGCTCCAGGTCATCTGCCGGTGCTGCCGTCGCATCCGTTGTCGTCGCCGGTAA
-CTCACTGTGCGCGTCATCGTAGCGGTAGCGTACTGTCTCCCCGCTGCGCGATGTCTCCGATACCAGCCTGCCCGGTTCATCATATTCCGGCGGCTCTCCA
-GCCGTCCGGGGACACCACCGCCGTCAGCTGGTTCCGTCGTTATAGTAAAATTTCGTCTCCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACA
-CCACATTCAGACCGTACTCTGTCCTCCGTCCCGCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCGCTGCGCGTGACGCTGCCGTCCGCC
-AGTTCTTTTCACCACCCGTTTCAGCCCGGCCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAA
-GATAGCGGTAAGCTAACCCTGCCGGGTTCAGTTGCTCCACCACCCGCCCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGC
-CACCATCCGGCCCGGGTGCTGCGCGTCATACGTGAAAGCGCGCACCTGCGTATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATACGTG
-TACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCATCAGCCACACCGCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGT
-ACCGGGCGGTGTCGGGGAACGCTGAGGCTGAGAGGGCGGGAACTGTCAGAAGAAGATAGCGAAGAGGTGCGGGCCTCTTCCGCACGCTGCGCCTGCGTGG
-TCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCCCGGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCGA
-AGCGGTCCGCCATCCCGGTAAGCACCCGAATGCGGCAGCAGCGGCGCTGGCAGTACGTCCTCAGCACCCGGCACCCGCTCAGACCACCCCGGTATCACCA
-CGGCCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCTTAACCGGATATCCGGCGGCAGCGCCCCACAGCCGCGCCATATGGCCGTCCGGCTGTGCT
-GCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCGGCAGCAGCGGCTCAAGTGAATGCTCCGCCCGCCGTTGTCGTTGA
-GTATCAGTCCGTCATCACGTAGCTGTGGCGGATATCAGAAGGCGCTTCCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGC
-TGTAGGTGCGCGGGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAAGTCCGTCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCC
-CGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCCAATTTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCA
-TATCTCTGACGCGCCGCTGGTTT
+CGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGAC
+AACGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGGAGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCACAG
+CCGGACGGCCATACGCTGGCGCGGCTGTGGGGGCGCTGCCGCCGGATATCCAGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTG
+GTGATACTGGGGTGGTCTGAGCGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCG
+GGCGGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACTGGCCGAGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCA
+CGCAGGCGCAGCGTGCGGAAGAGGCCCACACTCTTCGCTATCTTCTTCTGACAGTTCCCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACTGCCCGGTAC
+CGAATACGGCCCCCGACAGGGTATCCGCCTTTCGGCGGTGTGAAGCGATGCACGACCCGGCATACCCGGAGAGCCTGCGCTGCGCCACTGGTGCGGTACA
+CGTATACGGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCGTATGACGCGCAGCACGGGCCGGATGGTGGCGCAC
+CGTTACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGGCGGGTGGTGGAGCAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATG
+AGCAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAGGCGGGGCCGGGCTG
+>tig00000004 len=3934 reads=1 class=unassm suggestRepeat=no suggestBubble=no suggestCircular=no trim=0-3934
+CGACACACCGCAGCTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTGAAACCGCAGGCGGGCA
+GCGTATTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGGCGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAGTGAT
+TCAGGAACCGGATTCCGGTTTTAACCCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGGAGCCGTGCAGCCGAGGAGT
+CGGGTCACCTGGCGTTATAAATTCGGCGGCAACGAGAACCAGCTCGACGGCGAGAATGGTTGTTACCTCAGCTTAAACCCGAACAACGCTGGTACGGTCT
+GGAACAGGACGAAGAGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCTTGCTGCTGTGGCAGTGGCGGT
+GGCGGTAGCGATGAATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCGAGCGCAACTGCGTAAGCTAATCGTC
+GGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAACGTGTTGATGGTGCTGCTCAAGCCCGTTCTGCC
+TGCTGCACTACCGCCAGCCAGCCTCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTGTTG
+CTGGCAACGCAGCCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGC
+TGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTGGGCGGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGCTGGATGCTGCT
+GAATGTACTTCGCCGCATGACGCTGAAATCGCTGCCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCA
+TTTTCGCTCTCCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCCAGCCCGAACTACTTTTT
+AATTAACATCGCCAGGAACAGGTAGCACCGCTAAAGGGCGTTCCTCGCGGAACATCAGATAGTCGGAATCGTTTTATCCGGTGGTGCGGGCGCGGCTGAC
+GGCGATTAACGATAAGCCGACAGAAGGTAATGAATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGATCATAATCCGATTGT
+CGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCAAACGTTGCCCTCGGTGATACCGTGACTTTTATGGGCGA
+TACCCAGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCTGAAGGGGAGATTAGAC
+GGGCAACCGCAGAACTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATTAGCCTGTTAGATA
+TTGGCGCGATTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGCCTGCGGTATGTTGCTGTT
+GCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGCTGGTGGTGGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCGTACCACGTTGTGGTGT
+GAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTGTTGCAGGCGAAAGTGTTTGATTTTCCGTG
+GGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCGGAGCGCTGCTGCTGTCGCTTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAAGGGTAA
+GGCGCTGTTCAGGCGGTTTGCGGGGGTGATGAGAGTAAATAAGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAATATGTTTCGTGA
+TGATGTTATTGAATTGGTGATTTCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAATAACTCAG
+ACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGAATTCATCTGTGTAAAAATGTTAGTTTAATAAAATAT
+TGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTGTGTGAAAAATATATAAATACATTAGCTGGTCTTGTGTGTCATTTTATTT
+TTGTTGCTAACACAGGGATATGAACAATAACTAAAAAGGCACTTTATGAGCGGAAAACCAGCGGCGCGTCGGGAGATATGACTCAGTATGGCGGTCCCAT
+TGTCCAGGGTTCGGCAGGTGTAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCCGGGCAACCCGGTAAATCCGCTGC
+TGGGAGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAGACGCC
+TGCACCGGTGGGCGTTTTCGGCCCCGGCTGAAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGACAACGGCGGGCAGA
+CATTCACTTTGAGCCGCTGCTGCCGGGAGGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCACAGCCGGACGGCCCATA
+CGCTGGCGCGGCGTGGGGGCGCTGCCGCCGGATATCCCGGTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGCCGTGGTGAATACTGGGGTGG
+TCTGAGGCAGCGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGTGCTTACCGGGATGGCGGACCGCTTCGGGCGGACGCTGAC
+GTACCGGCGTGAGGCCGCCGGTGACCTGGCCGGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCACGCAGGCGCAGC
+GTGCGGAAGAGGCCCACACTCTTCGCTATCTTCTTCTGACAGTTCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACACTGCCCGGTACCGAATACGGCCC
+CGACAGGGTATCCGCCTTTCGGCGGTGTGGCTGATGCACGACCCGGCATACCCGGAGAACCTGCCCGCTGCCGCCACTGGTGCGGTACACGTATACGGAA
+GCCGGTGAACTGCTGGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCACGTATGACGCGCAGCACCCGGGCCGGATGGTGGCGCACCGTTACG
+CGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGGCGGTGGGTGGAGCAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAGCAGGA
+CCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAAGGCGGGGCCGGGCTGAAACGGGTGGTGAAAAAGAACTGGCGGACGGC
+AGCGTCACGCGCAGCAGGTATGACGCGGCAGGAAGGCTCACGGCGCAGACGGACGCGGCGGACGGAGGACAGAGTAGGTCTGAATGTGGTGTCCGGCGAT
+ATCACGGACATCACCACACCGGACGGGCGGGAGA
+>tig00000005 len=3960 reads=1 class=unassm suggestRepeat=no suggestBubble=no suggestCircular=no trim=0-3960
+TCTCCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCATACTCTGTCCTCCGTCCCGCCGCGTCCGTCTGCGCCGTGAG
+CCTTCCTGCCGCGTCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCCGTTTCAGCCCGGCCCCGCCTTCTGTATGCAGCACCT
+CACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAACTTAACCCTGCCGGGTTCAGTTGCTCCACCACCGCCCCGTA
+TCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGCGTCATACGTGAAAGCGCGCACCTGCGTAT
+TGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATGCGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCAT
+CAGCCACACCGCCGAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCGGTGTGTCGGGGAACGCTGAGGCTGAGAGAGGGCGGGAACTGTCAGA
+AGAAGATAGCGAAGAGGTCGGGCCTCTTCCGCACGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCACGCCGGTGATTT
+CCCCGGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGTAAGCACCCGGTACGGCGGCAGCGGCGGCGCT
+GGCAGTACGTCCTCAGCACCCGGCACCCGCTCAGACCACCCCAGTATCACCACGGCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCTTAACCGGA
+TATCCGGCGGCAGCGCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACATTGACTCCTGCGGCTGTACAC
+CGCCTCCCCGGCAGCAGCGGCTCAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCT
+TTCCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGCGCAA
+GGTCCGTCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTGGG
+CGCGCCAATCTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCCC
+TTTTAGTTATTGTTCATATCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTCATAAACTTATTTGTTCTCA
+ATCAACAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTTTAGCACAGATGAATTCATCATCAGCAAATTCACTATATGGATA
+ATATCCATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCA
+GCAATAGAAGATAGAAATCACCAATTCAATAACATCATCAATGAAGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCC
+TTATTTACTCTCATCACCCGCAAACTGCCTGAACAGCGCCTTACCCTTAACCAGTCGCGCACCCAGCCAGCCGCCGAAAGCGACAGCAGCAGCGCTCCGC
+TGCACGGCAGAACAATCCACAATCGCCAGTCTGGCTCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCC
+ACCAGGCCGGAAACAAACCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGAT
+GACGCTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTC
+CAGCACCTGACCGACCTGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCC
+CAGCGGAAACTGGTAAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGC
+GCAGGCTGGTCACTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCTCTTCCATC
+GACACTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCT
+CATCTTCATTACCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCGCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAGGAAC
+GCTTTTAGCGGTGCTACCTGTTCTGTGGCGATGTTAATTAAAAAGTAGTTCGGGCTTTCTGGGGTAGCTGCTGCTGCCTGCAGCGGTCGAGCAGATCGCC
+ACGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCC
+AGGCGCAGAGGCAGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTACTACCGCGCCCGCCA
+GCACCGCCCAAAGCAGCATGCTGCCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGC
+TACCACATCATTACGTAATACGCGTAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCG
+CCCACAGCCACGGCCAGAGGCTGGCTGGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTCGAACAACAGGCCTATGGCCCCA
+CCGGTAACGGCTGAAAGCGTCAGCACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCGCTCGCCCTGCCCCCAGCGTTTTGAGGATCGCCACCA
+GATCGTAGCGACTGCGACAGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCGAAAGCAGCAGGAACTGTTGCGA
+GCGTTCCATCGATCGCCCCAGCGCGCCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTAAGCTGAGGTAACAACCATTTCTCATAGCCGTCG
+AGCTGGTTCTCGTTGCCGCCGAATTTATAACGCCAGGTGACCCGACTCCCCGGCTGCACGGCTCCGGTTTTATCGACATCCGCCAGATTCATCATCAGAC
+GCGGAGCCATCTGGAAGGGTTAAAACCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCGCAGGTGGCATCGCCCACGTCAATGGTGTCGCCCGTTT
+TCCGGGTTAAGCAGTGCCATCAGGCGTGGGGCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGGGGATTAGTTGCAGATCGCCATACATCGGGTAG
+ATATCATCCACCGCTTTGACGTTCGCCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTG
+>tig00000006 len=3817 reads=1 class=unassm suggestRepeat=no suggestBubble=no suggestCircular=no trim=0-3817
+CCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCCGTTTCAGCCCGGCCCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGT
+CGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTAACCCTGCCGGGTTCAGTTGCTCCACCACCCGCCCCGTATCGTCGTAGCGGTAGCGC
+ATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGTCATACGTGAAAGCGCGCACCTGCGTATTGCTGCGGTCATATACCGCC
+AGCAGTTCACCGGCTTCCGTATACGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCATCAGCCACACCGCCGAAAGGC
+GGATACCCTGTCGGGGCCGTATTCGGTACCGGGCAGTGTGTCGGGGAACGCTGAGGCTGAGAGAGGGCGGGAACTGTCAGAAGAAGATAGCGAAGTCGGG
+CCTCTTCCGCGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCCCCGCCAGGTCACCGGCGGCCTC
+ACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGGTAAGCACCCGGTACAGCGGCAGCGGCGCTGGCAGTACGTCCTCAGCACCCGGCACC
+CACTCAGACCACCCCAGTATCACCACGGCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCAACCGGATATCCGGCGGCAGCGCCCCCACAGCCGCG
+CCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCATTGACTCACTGCGGCTGTACCGCCTCCCCGGCAGCAGCGGCTCAAAGTGAA
+TGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTTCAGCCGGGGCCGAAAACGCCCACCGGT
+GCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAGGTCCGTCTCGCCGGGCAGCACCTTCGCCC
+CCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCCAATTCTTACACCTGCCGAACCCTG
+GACAATGGGACCGCCATACTGAGTCATATCTCCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTTTGGTTATTGTTCATATCCCTGTGTT
+AGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAGCTTATTTGTTCTCAATCAACAACAACTGTTATTACAGG
+TCACTTTCAATATTTTATTAAACTAACATTTTTGGCACAGATGAATTCATCATCAGCAAATTCACTATATGGATAATATCCATTCAACGCATATGATTTA
+TGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAATAGAAAGATAGAAATCACCAATT
+CAATAACATCATCAATAAGAACATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCCTATTCTCTCATCACCCCCAAACTGCCTGAA
+CAGCGCCTTACCCTCCAACCAGTCGCGCACCCAGCCAGCCGCCGAAAGCGACAGCAGCAGCGCTCCGCTGCACGGCAGAACAATCCACAATCGCCAGTCT
+GGCTCCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAAACAAACCCAAGCATGGCGA
+ACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGTG
+CCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGCACCTGACCGACCTGTTTTAAAATCGC
+GCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTGGTAAGCCAGCTCTGCGGT
+TGCCCGTCTAATGCCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCT
+GGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTGGCGTTTCGCCAGCCCTCTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTAC
+CGGCGACAATCGGATTATGATCGGGCCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTACCTTCTGTCGGCTTATCGTT
+AATCGCCGTCAGCCGCGCCGCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAGGAACGCTTTTAGCGGTGCTACCTGTTCTGTGGCGA
+TGTTAATTAAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCTGCCAGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGTGCCAGCAGCATAAA
+GGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATTTCAGCGTCATGCGGCG
+AAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTACTACCGCGCCCAGCACCGCCCAAAGCAGCATGCTGCCACCCATTAATCCG
+GCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTAATACGCGTAAGGCTGCGT
+TGCCAGCAACAAGCGATATGGTCGTAGCCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCAGCCACGGCCAGAGGCTGGCTGGCGGTAGTGC
+AACAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGTCAGCACCATCAACCAC
+TGACCGACGATTAGCTTACGCAGTTGCGCCGCCCTGCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACAGTAATGATTCATCGCTACC
+GCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCAGCAGCAGGAACTGTTGCGAGCGTTCCATCGATCGCCCCAGCGCGCCTTCGTCCTGTTCCA
+GACCGTACCAGCGTTGTTCGGGTTTAAGCTGGGGTAACAACCATTTCTCATAGCCGTCGAGCTGGTTCTCGTTGCCCCGAATTTATAACGCCAGGTGACC
+CGACTCCCCGGCTGCGGCTCCGGTTTTATCGACATCCGCCAGATTCATCATCAGACGCGGAGCCATCTGGAAGGGTTAAAACCGGAATCCGGTTCCTGAA
+TCACTTCTCCGGCAATCCGCAAGGTGGCATCGCCCACGTCAATGGTGTCGCCCGTTTTCAGGTTAAGCAGTGCCATCAGGCGTGGGGCCAGCAATACGCT
+GCCCGCCTGCGGTTTCAGGCCAGGGGATTAGTTTGCAGATCGCCATACATCGGGTAGATATCATCCACCGCTTTGACGTTCGCCAGCTGCGGTGTGTCGC
+CTGCAAAGGTCATTGTG
+>tig00000007 len=4334 reads=1 class=unassm suggestRepeat=no suggestBubble=no suggestCircular=no trim=0-4334
+CACTTTCTCTTCGCCAGGATGCCCCGCCAGGCGCGCATTTGCTCATCAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTAC
+CTTTGCGGAAAAATGTTCAATGGCGCGCTCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGGGGCAAGTCCACCA
+GCACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCGTACCTGAATTCCGGTGACGCCGCTGACCACATCATTCAGACTTTCCAGATGCTG
+AACGTTGACGGTAGTGAAAACATCAATGCCAGCTTCCAGCAGTTCTTCGATATCCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGTGCGCC
+AGTTCGTCCATTAAGATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGATCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCA
+GAACAGCCAGCCCTTCCAGCATGGCGGCGGTATCTTTCGCCCGTGGGTTTCTACCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCGCTGGGCT
+TCTGCCAGCATCGCCCAGGTCTTCCTGACGCCTGCACAGGCACCGAAAACTTTCAGCTTCCCGATGCGGCGCGGGCAGTTTGTTCCAGCAGACGATCGGG
+GTCGGGACGTAAGGGTTCGTTATTCATCAAGTTTATCCAGCGCCAGATTGAGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAGCGGTTG
+TTGGCTGTATTTTGCGATCAGTTGCGTGAGCTGTTCAACGCTGAGATTACGCGCTTTCGCCACGCGTGGGATTTGCCAGGCCGCCGCTTGCGGGTGATAT
+TATTGTCCAGCCCGCTTGCCGATGCCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTAT
+TAGTTTATCCAGCTCAGGGTTACTGACCGCCAGATTGCTCCCGCCAGAAGCCTGTGGATTATAGGGCATTTCTGCTGTTGCCGACGGGCGACCATGAAAA
+TAGCCGTTGCCGGTAAAATTCTGCCCGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTG
+CCCCAGTACGGTGGTCAGCAGCGGGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTC
+ACCAGACCGCAAACGGTCAGCAGTAAATCAATGACTTTGATACGATAAACGGCACCAGCAGCCCACGACCGTAAATCCATAAGTTACGGCGCAACATGGC
+AGAAGCGGTAAGCGGTTTATAACTCACGCCTTTAACGCCAGGGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGG
+GCGAATGCAGGCACATGATGTTCAGCGCATTTACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTGGTACGC
+TGAAGGTGGTCAGCGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCC
+CGCCTCTTCGCCGCCTGCGCCGGAGTTCATCGCCACCGCGACATCTGCCCTGCGCCAGCGCCAGACATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAA
+CGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTGGCCTCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCA
+GTCAGACGGTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTCAGCGC
+AATAACGCCCAGCTACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCTGACGCGCAACCTGATCGACTTTTGATCAACATCGGTAGAAGTGACCACC
+GTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAACGGTA
+CAAAGGTGGCATGGGCGACTGCACATCGCGCTCGCGCAGGTTAAAGCGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGC
+AGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTTCATCCACGCCCTGCGCGGGGATAAACTCTGACGCCTGACGGTTACCGAGTGTGATGGTGCGGTTTT
+ATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCG
+ATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGAAAACGG
+CCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTGCGTCGCTGTGCGCCTTCCAC
+CATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGTTAAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCA
+AAATCGCCGCCGGATCCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCCCCCTTCAATAACTTCACCATCGCAGGGGATA
+ATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGCTCACGCAGCTTGCGGGC
+AAAGGCAGTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAA
+CCGCTAATGGCCGCGCTAAACAGCGCATTGCGGGCATCGCACCGCTTGCCATCGCGATGCTAACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACA
+TCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACG
+ACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACG
+GTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGATGCCGGAGCTGGCGGCTTGCTCTTTTACTCACCAGCGAACCGGCACTGCCATC
+ACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGACGGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCC
+GTTGTTGTTATGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCCTACGTCCGCGTCGGTCATCATCGCCA
+ACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTA
+CGACCAATCATCAGCCCGGCAATAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTG
+CATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGG
+CTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCC
+ACATCACCACGCCTACGCAGATGACAAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCA
+CAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGCCACCG
+CCGTTAGTACCGAGCATCTTGATCGCTTCCTGAG
--- a/test-data/ecoli_canu_unitigs_result1.fa	Sun May 26 10:52:09 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,162 +0,0 @@
->tig00000001 len=16089 reads=72 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-GGTTGAACCGTGAAGGTGATCAATAAAAATGATCAATCTTAATTTATTTAATGATGAGCTTTTTACTCAGTAATATAAAATATTGAATTGTTATTTTGTG
-TGTTGTTTTAAGATAAAAGCCGCTTTATTAATACGGCTTTAATTAATAAAAAGGCAGGCTGTATTAAAATTAATATTCAAAGCATAAACCGATGCCAATA
-CCGGTTTCAGTAATGAAATGGCGTGGGCGGGCGGGATCCTGTTCCAGTTTTTGTCGCAGATGTCCCATATAAATACGCAAATGGTGACTGTGTTCGACCG
-CGTTTGGCCCCCACCTGGTTAAGGAGCTGGCGCTGGGTGAGTACTTTCCGGCATTGTTGAGCAGCACCGCCAGCAGGCGGAACTCAATTGGTGTGAGATG
-CACCTCTTCTCACCCCGGTGAATCACGCGGGCGGCTAAATCGACGGTAACATCGGAAAATTTTACCAGCGGATCGGGCGCGGTGGTGGCAGAGTGGCGGC
-GTAATGCGACGCGCAGACGGGCCTGCAATTCGCCAATGCCAAACGGCTTACTCAGATAATCATCCGCTCCGGCATCCAGCGCGGCGATTTTGTCGCTCTT
-CTGCTGCGTGCGGAAAGCACAATCACCGGCACCGCGCTCCACTGGCGCAGGTCGCGGATAAACTCAATCCCATCACCATCGGGCAGGCCGAGATCGAGAA
-TAATCAAATCTGGCTTACGGGTTGCCGCTTCCAGCAAGCCGCGTTGCAGCGTTTCGGCCTCAAAGACGCGCATCCGTCGCCCTCCAGCGCCGTGCGCAGA
-AAGCGACGAATAGCCTGTTCATCTTCAACAATCAGAACGTTTGTCACATATCCTCATGAAATTCTTCAGTTCAGGGGCAGTTTGCTGGGGAAGTGTAACA
-CGAAAACAGGCACCACCTTCCGGTCGGTTGAACGCGGTAATAGTGCCCCCGTGTACATCCACTATCGCCCGACAAATTGCCAGTCCAAGCCCTACCCCCG
-TACTGCCGACTCTTTTATTCCCGCGAGCAAACTTATCAAATATCGTCTGCTCCTGGCCTGGCGGAAGACCGGGGCCGTTATCCCAGACATCCAGTTGTAG
-ATTTTCGCCCTCAACGTGGGCATCGATACCAATTTCGGCCTGCGCACCCGCATATTTCACCGCGTTCTCCAGCAGATTAATCAGCACCCGTTCAAAGAGA
-GGCCCGTCAACGTGGATTAAGGTCAGCGGTTCTGGCAGAGAAAGATTGATGGGCGACGATAAACCCGGTTCCAGCATTTGCAGCGCTGCCGACTACTTCT
-TCCAGCGTTAACCACTCTTTCTTCAAATTAAAGCCGCCGGACTGAATTCGCGCCATATCCAGTAGATTATTCACCAGTCGGGTAGTGTTCAGCATGCTGA
-CGGATCTCGCTGGCCTGGCGGGCGTGGGTGATCCTCGCTTGCCAGATCGAGCGTTAAGATTTCTGCCTGACCAAACAGCACCGTAAGCGGCGTGCGTAAA
-TCATGCGAAAGCGCCGCCAGCAGGGCGTTGCGGATCTGTTCACGTTCGCTTGCCATCCGCGCCTGTTCTTCGCTGGCGGTTAGCGTCAGCCGCTCAGGGC
-ATTGGCGACTAACAGCGTAACGTCTCCAGCAGGCGCTGCTGTTCCGGGATCATCAACTGGCGCAGATTCCCGGCTCCACCACCACCAGCCCGTAGGTTTT
-CGCCGCTTTTAGCGGCAAAATCTGGTACGGTACACCGGGTAACGTGTCGGTGCCCGCGCCCGCAGGCAGGCCTTTATCAAAACTCCACTGCGCGATGGCA
-TCGTCCCACGGCGTCATTCCTTGCGGATGTGTTAACGGCTGCAATTTACCGTTGTCATCGGGCAACAACACCTGACTGCGGGCATGAAACGTGGAGGCAA
-TAAATTGTTCGCTGGTGGCAGCGATATCCTGCGGACTGCGGCCCACCGCCAGAGCTTTCGACATTTCATATAAGTGCCGTGTGCGTTGCTCGCGGTAACG
-GGCTACCCGCGCCTGATAACGCACGCCAGCAGTAAGGTTCCCGATCACCAGCCCGACGGTTAACATCACCGCGAAGGTCAGCAGATATTGCACATCAGAG
-ACGGCGAGCGTGCCGCGTGGGGCGATAAAAAGAGATCGAAACTCACTACATTAATGACGGTGGCAACCACTGAAGGCCAGCGTCCATAAAATAGCGCCAC
-CACCACCACGCCAAGCAGATACAGCATCACCAGGTTGGCGGCATCAAACGCCATCAGCCACTGCATGGCAATTAAGGTGATAACGGCGCATAACGCGGCG
-GCAACCACGCATCCCTGAATTTGTACACGCCACTTGTCTTTAAAAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTGGTTCATCAAGCGCGA
-CCAGCACCTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCAGCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAATAATCTTG
-CCGAGATTATGTTCACGGGCATAACGCACTACCGCTTTCTCTTCCGCTGGATCAGAAAGTGTTGCCGTCTCCGCGCCCAGTTCCTGCGCCAGACGTAAGG
-CGCTGAGAATTGCCCGACGTTTTTTCCGGTAAGCGGTGCAGGGCAGGGGTTTCAACATACACCGCGTGCCAGACGCTACCCAGCCGTGACGCCAGCCGCG
-CCGCTGCGCGGACCAGTTTTCGCTGCCGGTGTTATGGCCGATGCATAAAAGGATCGCGTCGCGCGTGTGCCACACTTTCTCTTCGCCAGGATGCCCCGCC
-AGGCGCGCATTTGCTCATCAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAATGTTCAATGGCGCGC
-TCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGGGGCAAGTCCACCAGCACCACGTCGTCGGCGGCATCGAAAAG
-GATCGGGCACGGTTTCCCGTACCTGAATTCCGGTGACGCCGCTGACCACATCATTCAGACTTTCCAGATGCTGAACGTTGACGGTAGTGAAAACATCAAT
-GCCAGCTTCCAGCAGTTCTTCGATATCCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCCATTAAGATCAGCGCCGGG
-CGGCGGGCGAGGGCGGCATCGAGATCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAGAACAGCCAGCCCTTCCAGCATGGCGG
-CGGTATCTTTTCGCCCGTGGGTTTCTACCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCCAGGTCTTCCC
-GACGCCTGCACAGGCACCGAAGAAAACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAGCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
-TCATCAAGTTTATCCAGCGCCAGATTGAGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAGCGGTTGTTGGCTGTATTTTGCGATCAGTT
-GCGTGAGCTGTTCAACGCTGAGATTACGCGCTTTCGCCACGCGTGGGATTTGCCAGGCCGCCGCTTGCGGGTGATATTATTGTCCAGCCCGCTTGCCGAT
-GCCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTAC
-TGACCGCCAGATTGCTCCCGCCAGAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAAATTCTG
-CCCGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTGCCCCAGTACGGTGGTCAGCAGCG
-GGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACACCAGACCGCAAACGGTCAGC
-AGTAAATCAATGACTTTGATACCGATAAACGGCACCAGCAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAGCGGTAAGCGGTT
-TATAACTCACGCCTTTTAACGCCAGGGGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCACA
-TGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTGGCAATGCTGAAGGTGGTCAG
-CGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCGCC
-GCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCG
-CCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACG
-GTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACG
-CCCAGCACACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCCTGACGCGCAACCTGATCGACTTTTTGATCAACATCGGTAGGGAAGTGACCACCGT
-TAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-AAAGGTGGCATGGAGCGACTGCACATCGCGCTCGCGCAGGTTAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGC
-GAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTCATCCACGCCCTGCGCGGGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTA
-TCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGA
-TCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGG
-CCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCA
-CCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGC
-AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCAATAACTTCACCATCGCAGGGGA
-TAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCG
-GGCAAAGGCAGTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCAC
-AGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGA
-CGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGT
-TGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACC
-AGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGC
-AATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAG
-GCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCA
-TCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATAT
-TCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTT
-CACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGAC
-CGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGA
-ACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAA
-GGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTA
-AAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAG
-CCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGA
-TCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTG
-CACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGC
-GCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAG
-GCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAG
-GAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGC
-CATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCT
-CCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAGTATAAAAATGGCAAAAGCCA
-TGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGA
-GTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAAGTATG
-GAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAG
-ACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTAT
-TGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACC
-AATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTT
-CGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCAT
-TGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCT
-CGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCG
-CGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAG
-CCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCAC
-CGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCG
-GCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACA
-GACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCG
-CAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACA
-ACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGC
-GAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCC
-GACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCAT
-CACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCA
-CGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCAC
-GCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGG
-GAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAA
-CGGAAGATGCCACCGGCAGCCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCA
-TGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACG
-CAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGG
-GAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACAC
-CACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGC
-AGCGAGGATGAGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGA
-CGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACAC
-CTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACA
-GCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCA
-CCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGAC
-CGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCG
-TTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCGCCCT
-CAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAACCGACCTCATCCCGGAAG
-GGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTC
-GAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAAC
-CGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCC
-ACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGT
-GTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGT
-GCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCT
-GGCCCTATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTA
-TCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGATCC
-GATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACT
-GCATTCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATAC
-TTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCTGCTGGCCGTTGTGACCT
-CGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATATTCACACCTATAAA
-TTTAGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTG
-TATTCACCGGAGTGATGTAATGAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTT
-CACTATTAGACTCCACTCGTGATGTGAGCGAGTTAATTAGTCTCATGTCTTATGGAATGATGGTAATATGTTTTCCAACAGGCATAGTATTCTTTATTGC
-TCTAATATTTATAGGGACTGTATCAGACATTATTGGCGTAAGGATTGATAGTAAGTATATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGG
-TATATTCAATGGTTTGTATTAAGTAAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGGCATTGATATCCCGTATG
-CCACAGACCCGGCAGGTAACCGCCTGCCCGACCGGAGCTGCACCCGGACAGCACCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTAT
-CTTTACCGGTATGACCGTCACGGCAGGCTGACGGAGAAAACCGACCTCATCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTAC
-GACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAA
-AACGGGTGTGGCGACGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCAC
-GATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGC
-AGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGCGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGA
-AAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGAGCAGATGCAAAACCAGATGGACCCGGTG
-TACACGCCGGCGCGAAAAATCCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCGCTTGTCAGCACGGAAGGGGCAACAGAATGGTGCGCAGAAT
-ACGATGAATGGGGCAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTA
-TTACAACCGCCACCGCTATTATGACCCGCTGCAGGGAGGTATATCACTCAGGATCCGATTGGGCTGAAGGGGATGGAATTTTATCAGTATCCGCTGAATC
-CGGTTCAGTATATAGATTCAATGGGACTGGCATCAAAATATGGACACTTAAATAATGGCGGATATGGAGCGAGACCCAACAAACCGCCTACGCCCGATCC
-AAGTAAATTGCCGGACATAGCGAAACAATTAAGACTGCCATATCCTATTGACCAGGCCAGTAGTGCGCCTAATGTTTTCAAAACATTCTTCAGAGCATTA
-AGCCCTACGACTACACACTGTATTGCAGGAAGTGGGTAAAACCAAATCTGACTTGTACGCCACAGGATGATTCCCAGTATCCAGGGATGGATACAAAGAC
-AGCAAGTGATTACCTGCCACAGACAAATTGGCCAACAACTCAATTACCACCAGGATATACTTGTGCAGAACCCTATTTATTCCCAGACATTAATAAACCC
-GATGGGCCAGCAACAGCAGGGATAGATGATTTGGGTGAAATTTTAGCTAAGATGAAACAGAGAACATCGAGAGGAATAAGAAAATGAAAAGAGTTTTGTT
-CTTTTTGCTGATGATATTTGTTAGTTTTGGTGTTATAGCTGATTGCGAAATACAAGCTAAAGATCATGATTGTTTTACTATTTTCGCTAAAGGGTACTAT
-TTTTCCGCGTTTCCTGTCTTAAATAATAAAGCCATGTGGAGATGGTATCAGAATGAGGACATCGGTGAGTATTATTGGCAAACAGAACTGGGTACATGTA
-AAAATAATAAATTCACACCAAGCGGGCGAGACTCTTAATTCGCGTCGGGTCACTACGCCTTAATGAAAATCATGCCATCAAAGGAACGTTGCAGGAGTTG
-ATAAATACAGCAGAAAAACGGCGTTTCTCGGCGATCGGTTTAGAAGTTATATAAGAGCGGGTATCTATCAAAAGAGCAGTGATCCAGTTCAGTTGTTGGC
-AGTCCTTGATAATTCAATCATGGTAAAATATTTTAAAGATGAGAAACCAACTTATGCTCGAATGACAGCACATCTCCCGAACAAAATGAGTCTTACGAAT
-GTTTAATAAAGATACAGCATGAACTAATTCGTAGTGAAGAGAAATAAAATCTCTTCCTGAGAAAACAAATTAATCATTGTGAAAAATTATATAACTCATG
-GAATAGGTGTTTATTTTGCGTTCCATTTGCAGGAAAGATCACGTAACGCTACTTTTTGTACTAAATAATTCGAATTTAAGTTCAACAATTGAGATACTAC
-TTATTGTCTAAAGCTGTTTTTCATAGCTTATACATGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTC
-TATTACACCCGATTACAGACAAGCCTGGAAAGTGGTGCATAAATTGTCAGATATTCTACTGTTGACTATTTGTGCCGTTATTTCTGGTGCAGAAGGTTGG
-GAAGATATAAGAGGATTTCGGGGAAACATCTCGATTTTTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACCATTGCCAGAGTTGT
-ATCAGGAAAGATCACGTAACGCTACTTTTTGTACTAAATAATTCGCATTTTATGTTTAAAAATTGAGATATTCCTTATTACCTAAAGCTGTTTTTCATAG
-CTTATACATGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTCTATTATTCCCGATTACAGATAAGCCT
-GGAAAGTAGAGCATAAATTGTCCAGGCATCCTACTATTGACTATTTTGCCGTTATTTCTGGTGCGAAAGTTGGGAAGATATAGAGGATTTCGGGAAACAC
-ATCTCGATTTCTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACTATTGCCAGAGTTGTATCCTGTATCAGTCCT
--- a/test-data/ecoli_canu_unitigs_result2.fa	Sun May 26 10:52:09 2019 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,155 +0,0 @@
->tig00000001 len=15307 reads=47 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-AAAATAGTCAATAGTAGGATGCCTGACAATTTATGCTCTACTTTCCAGGCTTATCTGTAATCGGGAATAATAGAAATATGTTCCATCAATTTTTAAGTTC
-CATTTGTTCACCTTATTTATGTAAGGAGTATTTGATCATGTATAAGCTATGAAAAACAGCTTTAGGTAATAAGAATATCTCAATTTTTAAACATAAAATG
-CGAATTATTTAGTACAAAAAGGCGTTACGTGATCTTTCCTGGGATACAACTCTGGCAATGGTATCGTGAACAGGAATACCATTTTCAAAATCACCATATT
-GCTTCAAAAAATCGAGATGTGTTTCCCCGAAATCCTCTATATCTTCCCAACCTTCTGCACCAGAAATAACGGCACAAATAGTCAAACAGTAGAATATCTG
-ACAATTTATGCACCACTTTCAGGCTTGTCTGTAATCGGGTGTAATAGAAATATGTTCCATCAATTTTTTAAGTTCCATTTGTTCACCTTATTTATGTAAG
-GGTATTTGATCATGTATAAGCTATGAAAAAACAGCTTTAGACAATAAGTAGTATCTCAATTGTTGAACTTAAATTCGAATTATTTAGTACAAAAAGTAGC
-GTTACGTGATCTTTCCTGCAAATGGAACGCAAAATAAACACCTATTCCATGAGTTATATAATTTTTCACAATGATTAATTTGTTTTCTCAGGAAGAGATT
-TTATTTCTCTTCACTACGAATTAGTTCATGCTGTATCTTTATTAAACATTCGTAAGACTCATTTTTGTTCGGGAGATGTGCTGTCATTCGAGCATAAGTT
-GGTTTCTCATCTTTAAAATATTTTACCATGATTGAATTATCAAGGACTGCCAACAACTGAACTGGATCACTGCTCTTTTGATAGATACCCGCTCTTATAT
-AACTTCTAAACCGATCGCCGAGAAACGCCGTTTTTCTGCTGTATTTATCAACTCCTGCAACGTTCCTTTGATGGCATGATTTTCATTAAGGCGTAGTGAC
-CCGACGCGAATTAAGAGTCTCGCCCCGCTTGGTGTGAATTTATTATTTTTACATGTACCCAGTTCTGTTTGCCAATAATACTCACCGATGTCCTCATTCT
-GATACCATCTCACATGGCTTTATTATTTAAGACAGGAAACGCGGAAAAATAGTACCCTTAGCGAAAATAGTAAAACAATCATGATCTTTAGCTTGTATTT
-CGCAATCAGCTATAACACCAAAACTAACAAATATCATCAGCAAAAAGAACAAAACTCTTTTCATTTTCTTATTCCTCTCGATGTTCTCTGTTTCATCTTA
-GCTAAAATTTCACCCAAATCATCTATCCCTGCTGTTGCTGGCCCATCGGGTTTATTAATGTCTGGGAATAAATAGGGTTCTGCACAAGTATATCCTGGTG
-GTAATTGAGTTGTTGGCCAATTTGTCTGTGGCAGGTAATCACTTGCTGTCTTTGTATCCATCCCTGGATACTGGGAATCATCCTGTGGCGTACAAGTCAG
-ATTTGGTTTTACCCACTTCCTGCAATACAGTGTGTAGTCGTAGGGCTTAATGCTCTGAAGAATGTTTTGAAAACATTAGGCGCACTACTGGCCTGGTCAA
-TAGGATATGGCAGTCTTAATTGTTTCGCTATGTCCGGCAATTTACTTGGATCGGGCGTAGGCGGTTTGTTGGTCTCGCTCCATATCCGCCATTATTTAAG
-TGTCCATATTTTGATGCCAGTCCCATTGAATCTATATACTGAACCGGATTCAGCGGATACTGATAAAATTCCATCCCCCTTCAGCCCAATCGGATCCTGA
-GTGATATACCTCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTG
-CAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTTGCCCCTTCCGTGCTGACAAGCGCCAGCGGCAGG
-CCGCGATGGTCGCAGTGGTACAGGTGGATTTTCGCGCCGGCGTGTACACCGGGTCCATCTGGTTTTGCATCTGCTCCACCGTCAGGCCGCACGATGCCAG
-CCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGAACACCACACTGCCACCGT
-CTTCGCCGCCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTCGCCAGCTCACCGGTGGCGGTTTCAACCTGATGAGTGGCGTGAAGCTCCC
-CGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGC
-GACATCCAGCCCGTCAGGTCCCGTTCACGTCGCCACACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGGCTTTCGACCAGCGGCTCTG
-CATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGG
-TCGGTTTTCTCCGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGTGCTGTCCG
-GTGCAGCTCCGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGCATACGGGATATCAATGCCCAGGTTACATATAATAATAAGAGCAATTAACTTAATTT
-ATTTGTTTATAATGCGCTTACTTAATACAAACCATTGAATATACCCTCCTGACAGAAAATAAAGCCATATTATTATCGCCATAATATACTTACTATCAAT
-CCTTACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGAGCAATAAAGAATACTATGCCTGTTGGAAAACATATTACCATCATTCCATAAGACATG
-AGACTAATTAACTCGCTCACATCACGAGTGGAGTCTAATAGTGAAAGTCTATGCATGGAAAAGAATAGTATTAAAAGCGATAAAGCCAGCCATATAGCTC
-TGAATAAAAAATAATATATTTCATTACATCACTCCGGTGAATACAAATCTAATAAAACGTCCAATGTTATTTCCGGAGCACTTCATCTTACATGTTTCTA
-AAGAATCATTAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAATTTATAGGTGTGAATATATCAGGCAATACAGAATAACGCGGCCTTACCTCTTTAAAC
-TTCCTTTTAAACAGTTCTCCACACAACTATTATCGGTTTCAACGAGGTCACAACGGCCAGCAGCTTCTTTGTATCATTACTTGCTTTACCTGGCCCCCAT
-AGACCATCTCCTTTGATTCTCCCCGTTGGTCTTGGCCACCACAAGTATAGTCCCTTTACCATCTGGGACACAAAGATATTGATGATAGAACGGATTCCCC
-ATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCGG
-ATTCAACGGATACTGATAAAATTCCATCCCCTTTCAGCCCAATCGGATCCTGAGTGATATATCGCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTA
-ATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTACCCCATTCATCG
-TATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATATGGGCCAGCGGCAGGCCGCGATGGTCGCAGTGGTACAGGTGAATTTTTCGCGCCGGCGTGT
-ATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACT
-TTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACACTGCCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGC
-TGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTA
-TCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCG
-TTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTG
-TCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGGTCGGTTTTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAA
-GATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGGTGCAGCTCCGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTG
-GTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGC
-TGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGGTATAAGC
-GGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGAC
-AGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCAT
-GCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTG
-CCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCT
-GCTTCGTCATAGTGCCAGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCC
-GGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCC
-ATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCA
-GGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAG
-CCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAA
-CGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGT
-CAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTT
-ATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCC
-GTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTG
-CGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCT
-GTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGC
-TGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTAT
-TCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCG
-TCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGT
-GATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGC
-GCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTA
-AGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCG
-GCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATA
-TCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCC
-GGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACACCGAACAGGCCA
-CGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATC
-TGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAAT
-TAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGC
-GTTTCCGCTGGCGGTTTTCAATGTATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTT
-TTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTAC
-GGCGTAAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTG
-TTTATCTGATGAAAATAGTACCGCCTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTA
-AGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTTGCGAAATCTTT
-GCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTG
-GGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGC
-GCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTG
-ACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTG
-CCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTG
-AAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCG
-TTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGT
-TTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCT
-CAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGC
-AGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTC
-AGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAG
-GTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTAC
-CGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTG
-CTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTG
-GTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAG
-TGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCAT
-GTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGC
-ACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCT
-CTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAA
-ATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCG
-ATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTA
-AAGCGCAGGCCAACAGTCTGAAAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCA
-ACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCA
-CCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAG
-CGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTG
-ATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCT
-GGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGA
-CGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCCGCGC
-AGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGCGT
-TTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGA
-TCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAGTCGATCAGGTTGCGCGTCAG
-GGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGC
-TGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGA
-AGCGACACCGGAGGCCAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCGCTG
-GCGCAGGCAGATGTCGCGGTGGCGATGAACTCCGGCACCCAGGCGGCGAAAGAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCG
-AGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAGCATTGCCAACGATGTGGCGAAATACTTCGCCATTATTCCGGC
-GGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACGCCTTG
-ATTATCGTCTTTGATTCCCCTGGCGTTAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTG
-GGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGAGGTTTACCATGAGTGGATTACGTCCGGCATTATC
-AACATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTACCCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGA
-TTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCGGGCAGAATTTTACCGGCAACGGCTATTTTCATGGTCGCCCGTCGGCAACGGCAGAAATGCC
-CTATAATCCACAGGCTTCTGGCGGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAAC
-CCGGATGCCAGCGCGAGCGTTCCGGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGGCAAATCCCACG
-CGTGGCGAAAGCGCGTAATCTCAGCGTTGAACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTC
-AACATTGTTGAACTCAATCTGGCGCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCAT
-CGGGGAAGCTGAAAGTTTTCGGTGCCTGTGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCGGGCGCAAGGGCTGGATATTGT
-GGTTGGCGTGGTAGAAACCCACGGGCGAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATA
-TCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTAATGCGCCAGGTTCCCGTCATCCCAA
-ACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGAAAGTCTGAATGATGTGGTCAGCGGC
-GTCACCGGAATTCAGGTACGGGAAACCGTGCCCGATCCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGC
-TGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTGCGC
-CGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGCATCCTGGCGAAGAGAAAGTGGCACACGCGCGACGCGATCCTTTTATGCATCGGCC
-ATAACACCGGCAGCGAAAACTGGTCCGCGCAGCGGCGCGGCTGGCGTCACGGCTGGGTAGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCAC
-CGCTTACCGGAAAAACGTCGGGCAATTCTCAGCGCCTTACGTCTGGCGCAGGAACTGGGCGCGAGACGGCAACACTTTCTGATCCAGCGGAAGAGAAAGC
-GGTAGTGCGTTATGCCCGTGAACATAATCTCGGCAAGATTATTCTCGGTCGCCCGGCCTCGCGCCGCTGGTGGCGTCGGGAAACGTTTGCTGACCGACTG
-GCGCGCATCGCCCCGATCTCGATCAGGTGCTGGTCGCGCTTGATGAACCACCCGCCCGCACGATTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAA
-GTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTTGATGCCGCCAAC
-CTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTTATGGACGCTGGCCTTCAGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATC
-TCTTTTTATCGCCCCACGCGGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCGGGAACCTT
-ACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCGAGCAACGCACACACGGCACTTATATGAAATGTCGAAAGCTCTGGCGGTGGGCCGCAG
-TCCGCAGGATATCGCTGCCACCAGCGAACAATTTATTGCCTCCACGTTTCATGCCCGCAGTCAGGTGTTGTTGCCCGATGACAACGGTAAATTGCAGCCG
-TTAACACATCCGCAAGGAATGACGCCGTGGGACGATGCCATCGCGCAGTGGAGTTTTGATAAAGGCCTGCCTGCGGGCGCGGCACCGACACGTTACCCGG
-TGTACCGTACCAGATTTTGCCGCTAAAAAGCGGCGAGAAACCTACGGGCTGGTGGTGGTGGAGCTGGGAATCTGCGCCAGTTGATGATCCCGGAACAGCA
-GCGCCTGCTGGAGACGTTACGCTGTTAGTCGCCAATGCCCTGAGCGGCTGACGCTAACCGCCAGCGAAGAACAGGCGCGGATGGCAAGCGAACGTGAACA
-GATCCGCAACGCCTGCTGCTGGCGGCGCTTTCGCATGATTTACGCACGCCGCTTACGGTGCTGTTTGGTCAGGCAGAAATCTTAACGCTCGATCTGCAAG
-CGAAGATCACCACGCCCGCCAGGCCAGCGAGATCCGTCAGCATGTGCTGAACACTACCCGACTGGTGAATAATCTACTGGATATGGCGCGAATTCAGTCC
-GGCGGCTTTAATTTGAAGAAAGAGTGGTTAACGCTGGAAGAAGTAGTCGGCAGCGCGCTGCAAATGCTGGAACCGGGTTTATCGTCGCCCATCAATCTTT
-CTCTGCCAGAACCGCTGACCTTAATCCACGTTGACGGGCCACTTTTGAACGGGTGCTGATTAATCTGCTGGAGAACGCGGTGAAATATGCGGGTGCGCAG
-GCCGAAATTGGTATCGATGCCCACGTTGAGGGCGAAAATCTACAACTGGATGTCTGGGATAACGGCCCCGGTCTTCCGCCAGGCCAGGAGCAGACGATAT
-TTGATAAGTTTGTTCGCGGAATAAAAGAGCAGTACCGGGGGTAGGGCTTGGACTGGCAATTTGTCGGGCGATAGTGGATGGTACGGGGGCACTATTACCG
-CGTTCAACCGACCGGAAGGTGGTGCCTGTTTTCGTGTTACACTTCCCCAGCAAACTGCCCCTGAACTTGAAGAATTTCATGAGGATATGTGACAAACGTT
-CTGATTGTTGAAGATGAACAGGCTATTCGTCGCTTTCTGCGCACGGCGCTGGAGGGGCGATGCGCGTCTTTGAGGCCGAAACGCTGCAACGCGGCTTGCT
-GGAAGCGGCAACCCGTAAGCCAGATTTGATTATTCTCGATCTCGGCCTGCCCGATGGTGATGGGATTGAGTTTATCCGCGACCTGCGCCAGTGGAGCGCG
-GTGCCGG