changeset 0:dfc5a344e2c2 draft

planemo upload for repository https://github.com/deeptools/deepTools/tree/master/galaxy/wrapper/ commit b1f975422b307927bbbe245d57609e9464d5d5c8-dirty
author bgruening
date Thu, 15 Feb 2018 08:13:20 -0500
parents
children 48d08791d4f2
files alignmentSieve.xml datatypes_conf.xml deepTools_macros.xml readme.rst repository_dependencies.xml static/images/GC_bias_simulated_reads_2L.png static/images/QC_GCplots_input.png static/images/QC_fingerprint.png static/images/QC_multiBamSummary_humanSamples.png static/images/QC_plotCoverage.png static/images/bamCompare_output.png static/images/bamCoverage_output.png static/images/bamFP_galaxy_output.png static/images/bamPEFragmentSize_output.png static/images/bigwigCompare_output.png static/images/computeGCBias_output.png static/images/computeMatrix_advancedOutput.png static/images/computeMatrix_output.png static/images/computeMatrix_overview.png static/images/computeMatrix_selectRegions.png static/images/computeMatrix_selectScores.png static/images/multiBamSummary_output.png static/images/multiBigwigSummary_output.png static/images/norm_IGVsnapshot_indFiles.png static/images/plotCorrelate_RNAseq.png static/images/plotCorrelation_galaxy_bw_heatmap_output.png static/images/plotCorrelation_output.png static/images/plotCorrelation_scatterplot_PearsonCorr_bigwigScores.png static/images/plotCoverage_annotated.png static/images/plotCoverage_output.png static/images/plotEnrichment_output.png static/images/plotFingerprint_output.png static/images/plotHeatmap_example.png static/images/plotHeatmap_example02.png static/images/plotPCA_annotated.png static/images/plotProfiler_examples.png static/images/visual_hm_DmelPolII.png static/images/visual_profiler_DmelPolII.png test-data/alignmentSieve.bam test-data/alignmentSieve.bed test-data/alignmentSieve.txt test-data/alignmentSieve2.bam test-data/alignmentSieve3.bam test-data/bamCompare_result1.bg test-data/bamCompare_result2.bw test-data/bamCoverage_result1.bw test-data/bamCoverage_result2.bw test-data/bamCoverage_result3.bg test-data/bamCoverage_result4.bg test-data/bamCoverage_result4.bw test-data/bamCoverage_result5.bw test-data/bamCoverage_result6.bw test-data/bamPEFragmentSize_histogram_result1.png test-data/bamPEFragmentSize_lengths1.txt test-data/bamPEFragmentSize_result1.txt test-data/bamPEFragmentSize_table1.txt test-data/bigwigCompare_result1.bw test-data/bigwigCompare_result2.bg test-data/bowtie2 test1.bam test-data/computeGCBias_result1.png test-data/computeGCBias_result1.tabular test-data/computeMatrix1.bed test-data/computeMatrix2.bed test-data/computeMatrix2.bw test-data/computeMatrixOperations.txt test-data/computeMatrixOperations_result2.mat.gz test-data/computeMatrix_result1.gz test-data/computeMatrix_result2.gz test-data/computeMatrix_result3.gz test-data/correctGCBias_result1.bam test-data/estimateReadFiltering.txt test-data/heatmapper_result1.png test-data/heatmapper_result2.png test-data/heatmapper_result2.tabular test-data/multiBamSummary_regions.bed test-data/multiBamSummary_result1.npz test-data/multiBamSummary_result2.npz test-data/multiBamSummary_result2b.npz test-data/multiBigwigSummary_result1.npz test-data/multiBigwigSummary_result1.png test-data/paired_chr2L.bam test-data/paired_chr2L.cram test-data/phiX.2bit test-data/phiX.bam test-data/phiX.bam.bai test-data/phiX.fasta test-data/plotCorrelation_result1.png test-data/plotCorrelation_result1.tabular test-data/plotCorrelation_result2.png test-data/plotCoverage_result1.png test-data/plotCoverage_result1.tabular test-data/plotEnrichment_output.png test-data/plotEnrichment_output.txt test-data/plotFingerprint_quality_metrics.tabular test-data/plotFingerprint_result1.png test-data/plotFingerprint_result2.png test-data/plotFingerprint_result2.tabular test-data/plotPCA_result1.png test-data/plotPCA_result2.png test-data/plotPCA_result2.tabular test-data/profiler_result1.png test-data/profiler_result2.png test-data/profiler_result2.tabular test-data/sequence.2bit test-data/test.bw tool-data/deepTools_seqs.loc.sample tool-data/lastz_seqs.loc.sample tool_data_table_conf.xml.sample
diffstat 108 files changed, 39067 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/alignmentSieve.xml	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,216 @@
+<tool id="deeptools_alignmentsieve" name="alignmentsieve" version="@WRAPPER_VERSION@.0">
+    <description>Filter BAM/CRAM files according to specified parameters</description>
+    <macros>
+        <token name="@BINARY@">alignmentSieve</token>
+        <import>deepTools_macros.xml</import>
+    </macros>
+    <expand macro="requirements" />
+    <command>
+<![CDATA[
+        #import re
+        #set label = re.sub('[^\.\s\w\-]', '_', str($bamfile.element_identifier))
+        ln -s '$bamfile' one.bam &&
+        #if $bamfile.ext == 'bam':
+            ln -s '${bamfile.metadata.bam_index}' one.bam.bai &&
+        #else:
+            ln -s '${bamfile.metadata.cram_index}' one.bam.crai &&
+        #end if
+
+        @BINARY@
+        @THREADS@
+        -b one.bam
+
+        --label '$label'
+
+        #if str($filterRNAstrand) != 'no':
+            --filterRNAstrand '$filterRNAstrand'
+        #end if
+
+        $ignoreDuplicates
+
+        #if $minMappingQuality:
+            --minMappingQuality '$minMappingQuality'
+        #end if
+
+        #if $samFlagInclude:
+            --samFlagInclude $samFlagInclude
+        #end if
+
+        #if $samFlagExclude:
+            --samFlagExclude $samFlagExclude
+        #end if
+
+        #if $minFragmentLength:
+            --minFragmentLength $minFragmentLength
+        #end if
+
+        #if $maxFragmentLength:
+            --maxFragmentLength $maxFragmentLength
+        #end if
+
+        #if ' '.join( map(str, $blackListFileName) ) != 'None':
+            #set blfiles=[]
+            #for $f in $blackListFileName:
+                #silent $blfiles.append("'%s'" % $f)
+            #end for
+            #if $blfiles != ["'None'"]:
+                --blackListFileName #echo ' '.join($blfiles)#
+            #end if
+        #end if
+
+        #if $filterMetrics:
+            --filterMetrics '$filterMetricsFile'
+        #end if
+
+        #if $filteredOutReads:
+            --filteredOutReads '$outFileFiltered'
+        #end if
+
+        #if str($shift) != "":
+            #set shifts = " ".join(["'{}'".format(x) for x in $shift.split(" ")])
+            --shift $shifts
+        #elif $ATACshift:
+            --ATACshift
+        #end if
+        #if $BED:
+            --BED
+            -o '$outFile'
+        #elif str($shift) != "":
+            -o foo.bam &&
+            samtools sort -o '$outFile' -T foo.tmp -@ "\${GALAXY_SLOTS:-4}" foo.bam &&
+            rm foo.bam
+        #else:
+            -o '$outFile'
+        #end if
+]]>
+    </command>
+
+    <inputs>
+        <param name="bamfile" format="bam,cram" type="data" label="BAM file" />
+        <param name="BED" argument="--BED" type="boolean" label="Output in BEDPE format?"
+            help="Instead of producing BAM files, write output in BEDPE format (as defined by MACS2). Note that only reads/fragments passing filtering criterion are written in BEDPE format." />
+        <param argument="--shift" type="text" label="Amount to shift fragments" value=""
+            help="Shift the left and right end of a fragment. A positive
+                  value shift an end to the right (on the + strand) and
+                  a negative value shifts a fragment to the left. Either
+                  2 or 4 integers can be provided. For example, '2 -3'
+                  will shift the left-most fragment end two bases to the
+                  right and the right-most end 3 bases to the left. If 4
+                  integers are provided, then the first and last two
+                  refer to fragments whose read 1 is on the left or
+                  right, respectively. Consequently, it is possible to
+                  take strand into consideration for strand-specific
+                  protocols. Note that only properly paired reads are considered."/>
+        <param argument="--ATACshift" type="boolean" label="Shift fragment ends as appropriate for ATAC-seq" />
+        <param argument="filterRNAstrand" type="select" label="Only include reads originating from fragments from the forward or reverse strand."
+            help="By default (the no option), all reads are processed, regardless of the strand they originated from. For RNAseq, it can be useful to separately create bigWig files for the forward or reverse strands.
+                  Note that this tools assumes that a dUTP-based method was used, so fragments will be assigned to the reverse strand if the second read in a pair is reverse complemented.">
+            <option value="no" selected="true">no</option>
+            <option value="forward">forward</option>
+            <option value="reverse">reverse</option>
+        </param>
+
+        <expand macro="ignoreDuplicates" />
+        <expand macro="minMappingQuality" />
+        <expand macro="samFlags" />
+        <expand macro="fragLength" />
+        <expand macro="blacklist" />
+        <param argument="--filterMetrics" type="boolean" label="Save the total number of reads seen and remaining after filtering to a text file?" help="" />
+        <param argument="--filteredOutReads" type="boolean" label="Save alignments NOT passing the filtering criteria?" help="" />
+    </inputs>
+    <outputs>
+        <data format="tabular" name="filterMetricsFile" label="${tool.name} on ${on_string}: filtering metrics">
+            <filter>filterMetrics is True</filter>
+        </data>
+        <data format="bam" name="outFileFiltered" label="${tool.name} on ${on_string}: Filtered Out Alignments">
+            <filter>filteredOutReads is True</filter>
+        </data>
+        <data format="bam" name="outFile" label="${tool.name} on ${on_string}">
+            <change_format>
+                <when input="BED" value='true' format='bed'/>
+            </change_format>
+        </data>
+    </outputs>
+    <tests>
+        <test>
+            <param name="bamfile" value="paired_chr2L.bam" ftype="bam" />
+            <param name="minMappingQuality" value="10" />
+            <param name="filterMetrics" value="True" />
+            <output name="outFile" file="alignmentSieve.bam" ftype="bam" />
+            <output name="filterMetricsFile" file="alignmentSieve.txt" ftype="tabular" />
+        </test>
+        <test>
+            <param name="bamfile" value="paired_chr2L.bam" ftype="bam" />
+            <param name="minMappingQuality" value="10" />
+            <param name="BED" value="yes" />
+            <param name="shift" value="1 -2 3 -4" />
+            <output name="outFile" file="alignmentSieve.bed" ftype="bed" />
+        </test>
+        <test>
+            <param name="bamfile" value="paired_chr2L.bam" ftype="bam" />
+            <param name="minMappingQuality" value="10" />
+            <param name="shift" value="1 -2 3 -4" />
+            <output name="outFile" file="alignmentSieve2.bam" ftype="bam" />
+        </test>
+        <test>
+            <param name="bamfile" value="paired_chr2L.cram" ftype="cram" />
+            <param name="minMappingQuality" value="10" />
+            <param name="shift" value="1 -2 3 -4" />
+            <output name="outFile" file="alignmentSieve3.bam" ftype="bam" />
+        </test>
+    </tests>
+
+    <help>
+<![CDATA[
+
+What it does
+-------------
+
+This tool is very much the counterpart of estimateReadFiltering, in that it can filter alignments based on a variety of desired criterion. While much of this can be done with samtools, this tool can additionally filter by fragment strand and length (e.g., for RNA-seq and ATAC-seq experiments, respectively). Finally, this program can produce BEDPE files, which can be used as input into MACS2 for peak calling, where the fragment ends have been optionally shifted.
+
+Output
+--------
+
+The primary output is a BAM file with all alignments passing the desired criteria. Note that all unmapped reads are removed. Additionally, an optional text file can be produced with the following entries:
+
+ * Number of reads passing the filtering criteria
+ * Total number of initial reads
+
+Instead of producing a filtered BAM file, a BEDPE file appropriate for use with MACS2 can be used, optionally with fragment ends shifted. This is useful in cases like ATAC-seq.
+
+The ``--shift`` option can take either 2 or 4 integers. If two integers are given, then the first value shifts the left-most end of a fragment and the second the right-most end. Positive values shift to the right and negative values to the left. See below for how setting ``--shift`` to '-5 3' would shift a single fragment::
+
+         ----> read 1
+                     read 2 <----
+
+         ------------------------ fragment
+
+    -------------------------------- shifted fragment
+
+The same results will be produced if read 1 and read 2 are swapped. If, instead, the protocol is strand-specific, then the first set of integers in a pair would be applied to fragments where read 1 precedes read 2, and the second set to cases where read 2 precedes read 1. In this case, the first value in each pair is applied to the end of read 1 and the second to the end of read 2. For example, suppose "-5 3 -1 4" were given as the option to ``--shift``. The ``-5 3`` set would produce the following::
+
+         ----> read 1
+                     read 2 <----
+
+         ------------------------ fragment
+
+    -------------------------------- shifted fragment
+
+and the ``-1 4`` set would produce the following::
+
+         ----> read 2
+                     read 1 <----
+
+         ------------------------ fragment
+
+             --------------------- shifted fragment
+
+As can be seen, such fragments are considered to be on the ``-`` strand, so negative values then shift to the left on its frame of reference (thus, to the right relative to the ``+`` strand).
+
+-----
+
+@REFERENCES@
+]]>
+    </help>
+    <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/datatypes_conf.xml	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,7 @@
+<?xml version="1.0"?>
+<datatypes>
+    <registration>
+        <datatype extension="deeptools_compute_matrix_archive" type="galaxy.datatypes.binary:CompressedArchive" subclass="True" display_in_upload="True"/>
+        <datatype extension="deeptools_coverage_matrix" type="galaxy.datatypes.binary:CompressedArchive" subclass="True" display_in_upload="True"/>
+    </registration>
+</datatypes>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/deepTools_macros.xml	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,833 @@
+<macros>
+
+    <token name="@THREADS@">--numberOfProcessors "\${GALAXY_SLOTS:-4}"</token>
+    <token name="@WRAPPER_VERSION@">3.0.0</token>
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="3.0.0">deeptools</requirement>
+            <requirement type="package" version="1.7">samtools</requirement>
+        </requirements>
+        <expand macro="stdio" />
+        <version_command>@BINARY@ --version</version_command>
+    </xml>
+
+    <xml name="advancedOpt_scaffold">
+        <conditional name="advancedOpt">
+            <param name="showAdvancedOpt" type="select" label="Show advanced options" >
+                <option value="no" selected="true">no</option>
+                <option value="yes">yes</option>
+            </param>
+            <when value="no" />
+            <when value="yes">
+                <yield/>
+            </when>
+        </conditional>
+    </xml>
+
+    <token name="@PLOTWIDTHHEIGHT@">
+        --plotWidth '$advancedOpt.plotWidth'
+        --plotHeight '$advancedOpt.plotHeight'
+    </token>
+
+    <xml name="plotWidthHeight" tokens="PLOTWIDTH,PLOTHEIGHT">
+        <param argument="--plotHeight" type="float" value="@PLOTHEIGHT@" min="1.0"
+            label="Plot height"
+            help="Height in cm. The default for the plot height is @PLOTHEIGHT@ centimeters. The minimum value is 1 cm." />
+
+        <param argument="--plotWidth" type="float" value="@PLOTWIDTH@" min="1.0"
+            label="Plot width"
+            help="Width in cm. The default value is @PLOTWIDTH@ centimeters. The minimum value is 1 cm." />
+    </xml>
+
+    <token name="@ADVANCED_OPTS_READ_PROCESSING@">
+        #if $advancedOpt.doExtendCustom.doExtend == 'custom':
+            --extendReads $advancedOpt.doExtendCustom.extendReadsValue
+        #else if $advancedOpt.doExtendCustom.doExtend == 'yes':
+            --extendReads
+        #end if
+        $advancedOpt.ignoreDuplicates
+        $advancedOpt.centerReads
+        #if $advancedOpt.minMappingQuality:
+            --minMappingQuality '$advancedOpt.minMappingQuality'
+        #end if
+        #if $advancedOpt.samFlagInclude:
+            --samFlagInclude $advancedOpt.samFlagInclude
+        #end if
+        #if $advancedOpt.samFlagExclude:
+            --samFlagExclude $advancedOpt.samFlagExclude
+        #end if
+        #if $advancedOpt.minFragmentLength:
+            --minFragmentLength $advancedOpt.minFragmentLength
+        #end if
+        #if $advancedOpt.maxFragmentLength:
+            --maxFragmentLength $advancedOpt.maxFragmentLength
+        #end if
+    </token>
+
+    <token name="@ADVANCED_OPTS_GTF@">
+        $advancedOpt.metagene
+        #if $advancedOpt.transcriptID:
+            --transcriptID $advancedOpt.transcriptID
+        #end if
+        #if $advancedOpt.exonID:
+            --exonID $advancedOpt.exonID
+        #end if
+        #if $advancedOpt.transcript_id_designator:
+            --transcript_id_designator $advancedOpt.transcript_id_designator
+        #end if
+    </token>
+
+    <xml name="heatmap_options">
+        <expand macro="zMin_zMax" />
+        <expand macro="colorMap" />
+        <expand macro="plotTitle" />
+        <expand macro="plotNumbers" />
+    </xml>
+
+    <token name="@HEATMAP_OPTIONS@">
+        #if str($plotting_type.zMin) != "":
+            --zMin $plotting_type.zMin
+        #end if
+        #if str($plotting_type.zMax) != "":
+            --zMax $plotting_type.zMax
+        #end if
+        --colorMap '$plotting_type.colorMap'
+        $plotting_type.plotNumbers
+        --plotTitle '$plotting_type.plotTitle'
+    </token>
+
+
+    <xml name="includeZeros">
+        <param argument="--includeZeros" type="boolean" truevalue="--includeZeros" falsevalue=""
+            label="Include zeros"
+            help="If set, then regions with zero counts for *all* BAM/CRAM files are included. The default behavior is to ignore such regions." />
+    </xml>
+
+    <xml name="zMin_zMax">
+        <param argument="--zMin" type="text" value="" optional="true" label="Minimum value for the heatmap intensities"
+            help="If not specified the value is set automatically."/>
+        <param argument="--zMax" type="text" value="" optional="true" label="Maximum value for the heatmap intensities"
+            help="If not specified the value is set automatically."/>
+    </xml>
+
+    <xml name="region_limit_operation">
+        <param argument="--region" type="text" value=""
+            label="Region of the genome to limit the operation to"
+            help="This is useful when testing parameters to reduce the time required. The format is chr:start:end, for example &quot;chr10&quot; or &quot;chr10:456700:891000&quot;.">
+            <sanitizer>
+                <valid initial="string.letters,string.digits">
+                    <add value="|"/>
+                    <add value=":"/>
+                 </valid>
+            </sanitizer>
+        </param>
+    </xml>
+
+    <xml name="smoothLength">
+        <param argument="--smoothLength" type="integer" value="" optional="True" min="1"
+            label="Smooth values using the following length (in bases)"
+            help ="The smooth length defines a window, larger than the bin size, over which the number of reads is to be averaged. For example, if the bin size is set to 20 and the smooth length is 60, then, for each bin, its value is set to the average of it and its left and right neighbors. Any value smaller than the bin size will be ignored and no smoothing will be applied."/>
+    </xml>
+
+
+    <xml name="kmeans_clustering">
+        <conditional name="used_multiple_regions">
+            <param name="used_multiple_regions_options" type="select"
+                label="Did you compute the matrix with more than one groups of regions?"
+                help="Would you like to cluster the regions according to the similarity of the signal distribution? This is only possible if you used computeMatrix on only one group of regions.">
+                <option value="yes">Yes, I used multiple groups of regions</option>
+                <option value="no">No, I used only one group</option>
+            </param>
+            <when value="no">
+                <conditional name="clustering">
+                    <param name="clustering_options" type="select" label="Clustering algorithm">
+                        <option value="none">No clustering</option>
+                        <option value="kmeans">Kmeans clustering</option>
+                        <option value="hclust">Hierarchical clustering</option>
+                    </param>
+                    <when value="kmeans">
+                        <param name="k_kmeans" type="integer" value="0" label="Number of clusters to compute"
+                            help="When this option is set, the matrix is split into clusters using the k-means algorithm.
+                            This only works for data that is not grouped, otherwise only the first group will be clustered.
+                            If more specific clustering methods are required it is advisable to save the underlying matrix and
+                            run the clustering using other software."/>
+                    </when>
+                    <when value="hclust">
+                        <param name="n_hclust" type="integer" value="0" label="number of clusters to compute."
+                            help="WARNING: This option causes the tool to run for a very long time! When this option is
+                            set, the matrix is split into clusters using the hierarchical clustering algorithm, using ward linkage.
+                            This only works for data that is not grouped, otherwise only the first group will be clustered.
+                            Note that you must have used the '--missingDataAsZero' option within computeMatrix!
+                            If more specific clustering methods are required it is advisable to save the underlying matrix and
+                            run the clustering using other software."/>
+                    </when>
+                    <when value="none" />
+                </conditional>
+            </when>
+            <when value="yes" />
+        </conditional>
+    </xml>
+
+    <token name="@KMEANS_CLUSTERING@">
+        #if $advancedOpt.used_multiple_regions.used_multiple_regions_options == 'no':
+            #if $advancedOpt.used_multiple_regions.clustering.clustering_options == 'kmeans':
+                #if int($advancedOpt.used_multiple_regions.clustering.k_kmeans) > 0:
+                    --kmeans $advancedOpt.used_multiple_regions.clustering.k_kmeans
+                #end if
+            #end if
+            #if $advancedOpt.used_multiple_regions.clustering.clustering_options == 'hclust':
+                #if int($advancedOpt.used_multiple_regions.clustering.n_hclust) > 0:
+                    --hclust $advancedOpt.used_multiple_regions.clustering.n_hclust
+                #end if
+            #end if
+        #end if
+    </token>
+
+    <xml name="samFlags">
+        <param argument="--samFlagInclude" type="integer" optional="True" value=""
+            label="Include reads based on the SAM flag"
+            help= "For example, to get only reads that are the first mate use a flag of 64. This is useful to count properly paired reads only once, otherwise the second mate will be also considered for the coverage."/>
+        <param argument="--samFlagExclude" type="integer" optional="True" value=""
+            label="Exclude reads based on the SAM flag"
+            help= "For example, to get only reads that map to the forward strand, use --samFlagExclude 16, where 16 is the SAM flag for reads that map to the reverse strand."/>
+    </xml>
+
+    <xml name="fragLength">
+        <param argument="--minFragmentLength" type="integer" optional="True" value="0" min="0"
+            label="Minimum fragment length for inclusion."
+            help="This is primarily useful in things like ATACseq, where one would like to look specifically at mono- or di-nucleosome fragments." />
+        <param argument="--maxFragmentLength" type="integer" optional="True" value="0" min="0"
+            label="Maximum fragment length for inclusion."
+            help="A value of 0 (the default) is equivalent to no maximum." />
+    </xml>
+
+    <xml name="read_processing_options">
+        <expand macro="extendReads" />
+        <expand macro="ignoreDuplicates" />
+        <expand macro="centerReads" />
+        <expand macro="minMappingQuality" />
+        <expand macro="samFlags" />
+        <expand macro="fragLength" />
+    </xml>
+
+    <xml name="gtf_options">
+        <param argument="--metagene" type="boolean" truevalue="--metagene" falsevalue=""
+            label="Use a metagene model"
+            help="If set and a BED12 or GTF file or files is used to provide regions, only exons will be used. This is convenient for looking at coverage over mature mRNA transcripts or similar uses where introns should be ignored." />
+        <param argument="--transcriptID" optional="True" value="transcript" type="text"
+            label="trascript designator"
+            help="When a GTF file is used to provide regions, only entries with this value as their feature (column 2) will be processed as transcripts. Default: transcript" />
+        <param argument="--exonID" optional="True" value="exon" type="text"
+            label="exon designator"
+            help="When a GTF file is used to provide regions, only entries with this value as their feature (column 2) will be processed as exons. CDS would be another common value for this. Default: exon" />
+        <param argument="--transcript_id_designator" optional="True" value="transcript_id" type="text"
+            label="transcriptID key designator"
+            help="Each region has an ID (e.g., ACTB) assigned to it, which for BED files is either column 4 (if it exists)
+                  or the interval bounds. For GTF files this is instead stored in the last column as a key:value pair (e.g.,
+                  as 'transcript_id ACTB', for a key of transcript_id and a value of ACTB). In some cases it can be
+                  convenient to use a different identifier. To do so, set this to the desired key. Default: transcript_id" />
+    </xml>
+
+
+    <xml name="plotNumbers">
+        <param argument="--plotNumbers" type="boolean" truevalue="--plotNumbers" falsevalue=""
+            label="Plot the correlation value"
+            help="If set, then the correlation number is plotted on top of the heatmap."/>
+    </xml>
+
+    <xml name="extendReads">
+        <conditional name="doExtendCustom">
+            <param name="doExtend" type="select" label="Extend reads to the given average fragment size."
+                help="If selected : Single-end reads and singletons are extended to match the given length and Paired-end reads are extended to match the fragment size.
+                     By default *each* read mate is extended.
+                     This can be modified using the SAM flags (see --samFlagInclude and --samFlagExclude options) to keep only the first or the second mate.
+                     Unmated reads, mate reads that map to different chromosomes or too far apart are extended to the given value.
+                     Reads are only extended if --extendReads is set to a value greater than the read length. *NOTE*: For spliced-read data, this option is not
+                     recommended as it will extend reads over skipped regions, e.g. introns in RNA-seq data.">
+                <option value="no" selected="True">No extension. The default value and most typically appropriate.</option>
+                <option value="yes">Paired-end extension. Suitable only for paired-end datasets.</option>
+                <option value="custom">A custom length, which will be applied to ALL reads.</option>
+            </param>
+            <when value="no" />
+            <when value="yes" />
+            <when value="custom">
+                <param name="extendReadsValue" type="integer" value="300" min="1"
+                    label="Extend reads to the given average fragment size"
+                    help="Extend all reads to this length" />
+            </when>
+        </conditional>
+    </xml>
+
+    <xml name="corMethod">
+        <param argument="--corMethod" type="select" label="Correlation method">
+            <option value="spearman" selected="True">Spearman</option>
+            <option value="pearson">Pearson</option>
+        </param>
+    </xml>
+
+    <xml name="distanceBetweenBins">
+        <param argument="--distanceBetweenBins" type="integer" value="0" min="0"
+            label="Distance between bins"
+            help="By default, multiBamSummary considers consecutive bins of
+                the specified 'Bin size'. However, to reduce the
+                computation time, a larger distance between bins can
+                be given. Larger distances result in fewer bins being
+                considered."/>
+    </xml>
+
+    <xml name="centerReads">
+        <param argument="--centerReads" type="boolean" truevalue="--centerReads" falsevalue=""
+            label="Center regions with respect to the fragment length"
+            help="For paired-end data the fragment is defined by the bounds of the reads. For single-end data the bounds are defined by the read and the user-definable fragment/extension length. This option is useful to get a sharper signal around enriched regions."/>
+    </xml>
+
+    <xml name="ignoreDuplicates">
+        <param argument="--ignoreDuplicates" type="boolean" truevalue="--ignoreDuplicates" falsevalue=""
+            label="Ignore duplicates"
+            help="If set, reads that have the same orientation and start position will be considered only once. If reads are paired, the mate position also has to coincide to ignore a read." />
+    </xml>
+
+    <xml name="sortUsing">
+        <param argument="--sortUsing" type="select" label="Method used for sorting"
+            help="For each row the method is computed.">
+            <option value="mean" selected="true">mean</option>
+            <option value="median">median</option>
+            <option value="min">min</option>
+            <option value="max">max</option>
+            <option value="sum">sum</option>
+            <option value="region_length">region length</option>
+        </param>
+    </xml>
+
+    <xml name="sortRegionsComputeMatrix">
+        <param argument="--sortRegions" type="select" label="Sort regions"
+            help="Whether the heatmap should present the regions sorted. The default is to sort in descending order based on the mean value per region.">
+            <option value="no">no ordering</option>
+            <option value="keep" selected="true">maintain the same ordering as the input files</option>
+            <option value="descend">descending order</option>
+            <option value="ascend">ascending order</option>
+        </param>
+    </xml>
+
+    <xml name="sortRegions">
+        <param argument="--sortRegions" type="select" label="Sort regions"
+            help="Whether the heatmap should present the regions sorted. The default is to sort in descending order based on the mean value per region.">
+            <option value="no">maintain the same ordering as the input files</option>
+            <option value="descend" selected="true">descending order</option>
+            <option value="ascend">ascending order</option>
+        </param>
+    </xml>
+
+    <xml name="minMappingQuality">
+        <param argument="--minMappingQuality" type="integer" optional="true" value="1" min="0"
+            label="Minimum mapping quality"
+            help= "If set, only reads with a mapping quality score at least this high are considered."/>
+    </xml>
+
+    <xml name="skipZeros">
+        <param argument="--skipZeros" type="boolean" truevalue="--skipZeros" falsevalue=""
+            label ="Skip zeros"
+            help ="If set, then zero counts that happen for *all* BAM/CRAM files given are ignored. This may result in fewer considered regions." />
+    </xml>
+
+    <xml name="fragmentLength">
+        <param argument="--fragmentLength" type="integer" min="1" optional="true"
+            label="Fragment length used for the sequencing"
+            help ="If paired-end reads are used, the fragment length is computed from the BAM/CRAM file, so this is only needed for single-end data."/>
+    </xml>
+
+    <xml name="scaleFactor">
+        <param argument="--scaleFactor" type="float" value="1" label="Scaling factor"
+            help="The computed scaling factor will be multiplied by this (default 1)." />
+    </xml>
+
+    <xml name="scaleFactors">
+        <param name="scaleFactor1" type="float" value="1" label="Scale factor for treatment" help="(--scaleFactors)"/>
+        <param name="scaleFactor2" type="float" value="1" label="Scale factor for input" help="(--scaleFactors)"/>
+    </xml>
+
+    <xml name="stdio">
+        <stdio>
+            <exit_code range="1:" />
+            <exit_code range=":-1" />
+            <regex match="Error:" />
+            <regex match="Exception:" />
+            <regex match="EXception:" />
+            <regex match="Traceback" />
+        </stdio>
+    </xml>
+
+    <xml name="pseudocount">
+        <param argument="--pseudocount" type="float" value="1" label="Pseudocount" help="Small number to avoid dividing by zero."/>
+    </xml>
+
+    <token name="@REFERENCES@">
+
+.. class:: infomark
+
+For more information on the tools, please visit our `help site`_.
+
+If you would like to give us feedback or you run into any trouble, please send an email to deeptools@googlegroups.com
+
+This tool is developed by the `Bioinformatics and Deep-Sequencing Unit`_ at the `Max Planck Institute for Immunobiology and Epigenetics`_.
+
+.. _Bioinformatics and Deep-Sequencing Unit: http://www.ie-freiburg.mpg.de/bioinformaticsfac
+.. _Max Planck Institute for Immunobiology and Epigenetics: http://www3.ie-freiburg.mpg.de
+.. _help site: https://deeptools.readthedocs.org/
+
+    </token>
+    <xml name="citations">
+        <citations>
+            <citation type="doi">10.1093/nar/gkw257</citation>
+            <yield />
+        </citations>
+    </xml>
+
+    <xml name="multiple_input_bams" tokens="MIN">
+        <conditional name="multibam_conditional">
+        <param name="orderMatters" type="select" label="Sample order matters" help="By default, the order of samples given to the program is dependent on their order in your history. If the order of the samples is vital to you, select Yes below.">
+            <option value="No" selected="true">No</option>
+            <option value="Yes">Yes</option>
+        </param>
+        <when value="No">
+            <param argument="--bamfiles" type="data" format="bam,cram" min="@MIN@"
+                label="BAM/CRAM file" multiple="true"
+                help=""/>
+        </when>
+        <when value="Yes">
+            <repeat name="multibam_repeats" min="@MIN@" title="BAM/CRAM Files">
+                <param argument="--bamfiles" type="data" format="bam,cram" label="BAM/CRAM file" help="" />
+            </repeat>
+        </when>
+        </conditional>
+    </xml>
+
+    <xml name="multiple_input_bigwigs" tokens="MIN,LABEL,TITLE">
+        <conditional name="multibigwig_conditional">
+        <param name="orderMatters" type="select" label="Sample order matters" help="By default, the order of samples given to the program is dependent on their order in your history. If the order of the samples
+is vital to you, select Yes below.">
+            <option value="No" selected="true">No</option>
+            <option value="Yes">Yes</option>
+        </param>
+        <when value="No">
+            <param argument="--bigwigfiles" type="data" format="bigwig" multiple="True" min="@MIN@"
+                label="@LABEL@"
+                help="You can generate a bigWig file from a BAM/CRAM file using the bamCoverage tool."/>
+        </when>
+        <when value="Yes">
+            <repeat name="multibigwig_repeats" min="@MIN@" title="@TITLE@">
+                <param argument="--bigwigfiles" type="data" format="bigwig" label="@LABEL@" help="You can generate a bigWig file from a BAM/CRAM file using the bamCoverage tool."/>
+            </repeat>
+        </when>
+        </conditional>
+    </xml>
+
+    <xml name="plotTitle">
+        <param argument="--plotTitle" type="text" value="" size="30" optional="True"
+            label="Title of the plot"
+            help="Title of the plot, to be printed on top of the generated image." />
+    </xml>
+
+    <xml name="labelRotation">
+        <param argument="--labelRotation" type="integer" value="0"
+            label="Rotation of the X-axis labels (in degrees)"
+            help="The rotation of things like TSS or TES on the X-axis of profile plots in both plotHeatmap and plotProfile. The default is 0, positive values denome a counter-clockwise rotation." />
+    </xml>
+
+
+    <token name="@multiple_input_bams@">
+<![CDATA[
+        #set files=[]
+        #set labels=[]
+        #import re
+        #if $multibam_conditional.orderMatters == "No":
+            #for $counter, $bamfile in enumerate($multibam_conditional.bamfiles):
+                #set identifier = re.sub('[^\.\s\w\-]', '_', str($bamfile.element_identifier))
+                ln -s "${bamfile}" "./${counter}.bam" &&
+                #if $bamfile.ext == 'bam':
+                    ln -s '${bamfile.metadata.bam_index}' './${counter}.bam.bai' &&
+                #else:
+                    ln -s '${bamfile.metadata.cram_index}' './${counter}.bam.crai' &&
+                #end if
+                #silent $files.append("'%s.bam'" % $counter)
+                #silent $labels.append("'%s'" % identifier)
+            #end for
+        #else:
+            #for $counter, $f in enumerate($multibam_conditional.multibam_repeats):
+                #set identifier = re.sub('[^\.\s\w\-]', '_', str($f.bamfiles.element_identifier))
+                ln -s "${f.bamfiles}" "./${counter}.bam" &&
+                ln -s "${f.bamfiles.metadata.bam_index}" "./${counter}.bam.bai" &&
+                #if $f.bamfiles.ext == 'bam':
+                    ln -s '${f.bamfiles.metadata.bam_index}' './${counter}.bam.bai' &&
+                #else:
+                    ln -s '${f.bamfiles.metadata.cram_index}' './${counter}.bam.crai' &&
+                #end if
+                #silent $files.append("'%s.bam'" % $counter)
+                #silent $labels.append("'%s'" % $identifier)
+            #end for
+        #end if
+]]>
+    </token>
+
+    <token name="@multiple_input_bigwigs@">
+<![CDATA[
+        #set files=[]
+        #set labels=[]
+        #import re
+        #if $multibigwig_conditional.orderMatters == "No":
+            #for $counter, $bigwig in enumerate($multibigwig_conditional.bigwigfiles):
+                #set identifier = re.sub('[^\.\s\w\-]', '_', str($bigwig.element_identifier))
+                ln -f -s "${bigwig}" "${identifier}_${counter}.bw" &&
+                #silent $files.append("'%s_%s.bw'" % ($identifier, $counter))
+                #silent $labels.append("'%s'" % $identifier)
+            #end for
+        #else:
+            #for $counter, $f in enumerate($multibigwig_conditional.multibigwig_repeats):
+                #set identifier = re.sub('[^\.\s\w\-]', '_', str($f.bigwigfiles.element_identifier))
+                ln -f -s "${f.bigwigfiles}" "${identifier}_${counter}.bw" &&
+                #silent $files.append("'%s_%s.bw'" % ($identifier, $counter))
+                #silent $labels.append("'%s'" % $identifier)
+            #end for
+        #end if
+]]>
+    </token>
+
+    <xml name="blacklist">
+        <param argument="--blackListFileName" type="data" format="bed,gtf" multiple="true" optional="true" min="0"
+            label="Blacklisted regions in BED/GTF format"
+            help="One or more files containing regions to exclude from the analysis" />
+    </xml>
+
+    <token name="@blacklist@">
+<![CDATA[
+        #if ' '.join( map(str, $advancedOpt.blackListFileName) ) != 'None':
+            #set blfiles=[]
+            #for $f in $advancedOpt.blackListFileName:
+                #silent $blfiles.append("'%s'" % $f)
+            #end for
+            #if $blfiles != ["'None'"]:
+                --blackListFileName #echo ' '.join($blfiles)#
+            #end if
+        #end if
+]]>
+    </token>
+
+    <xml name="multiple_bed">
+        <param argument="--BED" type="data" format="bed,gtf" min="1" multiple="true"
+            label="Regions in BED/GTF format"
+            help="One or more files containing regions to include in the analysis" />
+    </xml>
+
+    <token name="@multiple_bed@">
+<![CDATA[
+        #set files=[]
+        #set labels=[]
+        #for $f in $BED:
+            #silent $files.append("'%s'" % $f)
+            #silent $labels.append("'%s'" % $f.display_name)
+        #end for
+        #if len($files) > 0:
+            --BED #echo ' '.join($files)#
+            --regionLabels #echo ' '.join($labels)#
+        #end if
+]]>
+    </token>
+
+    <xml name="reference_genome_source">
+        <conditional name="source">
+            <param name="ref_source" type="select" label="Reference genome">
+                <option value="cached">locally cached</option>
+                <option value="history">in your history</option>
+            </param>
+            <when value="cached">
+                <param name="input1_2bit" type="select" label="Using reference genome" help="If your genome of interest is not listed, contact the Galaxy team">
+                    <options from_data_table="lastz_seqs">
+                        <filter type="sort_by" column="1" />
+                        <validator type="no_options" message="No indexes are available." />
+                    </options>
+                </param>
+            </when>
+            <when value="history">
+                <param name="input1" type="data" format="twobit" label="Select a reference dataset in 2bit format" />
+            </when>
+        </conditional>
+    </xml>
+
+    <token name="@reference_genome_source@">
+    #if $source.ref_source=="history":
+        --genome $source.input1
+    #else:
+        --genome "$source.input1_2bit.fields.path"
+    #end if
+    </token>
+
+    <xml name="effectiveGenomeSize">
+        <conditional name="effectiveGenomeSize">
+            <param name="effectiveGenomeSize_opt" type="select" label="Effective genome size"
+                help="The effective genome size is the portion of the genome that is mappable. Large fractions of the genome are stretches of NNNN that should be discarded.
+                    Also, if repetitive regions were not included in the mapping of reads, the effective genome size needs to be adjusted accordingly.
+                    We provide a table of useful sizes here: http://deeptools.readthedocs.io/en/latest/content/feature/effectiveGenomeSize.html">
+                <option value="93260000">ce10 (93260000)</option>
+                <option value="130428560">dm3 (130428560)</option>
+                <option value="125464728">dm6 (125464728)</option>
+                <option value="2685511504" selected="true">hg19/GRCh37 (2685511504)</option>
+                <option value="2701495761">GRCh38/hg38 (2701495761)</option>
+                <option value="2304947926">GRCm37/mm9 (2304947926)</option>
+                <option value="2308125349">GRCm38/mm10 (2308125349)</option>
+                <option value="specific">user specified</option>
+            </param>
+            <when value="specific">
+                <param argument="--effectiveGenomeSize" type="integer" value="" label="Effective genome size"
+                       help="e.g. ce10: 93260000, dm3: 130428560, hg19: 2685511504, mm9: 2304947926"/>
+            </when>
+            <when value="93260000" />
+            <when value="130428560" />
+            <when value="125464728" />
+            <when value="2685511504" />
+            <when value="2701495761" />
+            <when value="2304947926" />
+            <when value="2308125349" />
+        </conditional>
+    </xml>
+
+    <xml name="skipNAs">
+        <param argument="--skipNAs" type="boolean" truevalue="--skipNAs" falsevalue="" checked="False"
+            label="Ignore missing data?"
+            help="This parameter determines if non-covered regions
+                 (regions without overlapping reads) in a bam/bigWig file
+                 should be skipped. The default is to treat those
+                 regions as having a value of zero. The decision to
+                 skip non-covered regions depends on the interpretation
+                 of the data. Non-covered regions may represent, for
+                 example, repetitive regions that should be ignored.
+                 (default: False)" />
+    </xml>
+
+    <xml name="input_save_matrix_values">
+        <param argument="--saveMatrix" type="boolean" label="Save the matrix of values underlying the heatmap"/>
+    </xml>
+
+    <xml name="input_graphic_output_settings">
+        <conditional name="output" >
+            <param name="showOutputSettings" type="select" label="Show advanced output settings" >
+                <option value="no" selected="true">no</option>
+                <option value="yes">yes</option>
+            </param>
+            <when value="no" />
+            <when value="yes">
+                <yield />
+                <param name="saveSortedRegions" type="boolean"
+                       argument="--outFileSortedRegions"
+                       label="Save the regions after skipping zeros or min/max threshold values"
+                       help="The order of the regions in the file follows the sorting order selected. This is useful,
+                       for example, to generate other heatmaps keeping the sorting of the first heatmap."/>
+            </when>
+        </conditional>
+    </xml>
+
+
+    <xml name="input_image_file_format">
+        <param argument="--outFileFormat" type="select" label="Image file format" help="Note that the plotly output can be very large and not all options are supported.">
+            <option value="png" selected="true">png</option>
+            <option value="pdf">pdf</option>
+            <option value="svg">svg</option>
+            <option value="eps">eps</option>
+            <option value="plotly">plotly</option>
+        </param>
+    </xml>
+
+    <xml name="output_dpi">
+        <param argument="--dpi" name="dpi" type="integer" value="200" size="3" optional="True"
+            label="Image dpi" help=""/>
+    </xml>
+
+    <xml name="output_image_file_format">
+        <data format="png" name="outFileName" label="${tool.name} image">
+            <change_format>
+                <when input="output.outFileFormat" value="pdf" format="pdf" />
+                <when input="output.outFileFormat" value="svg" format="svg" />
+                <when input="output.outFileFormat" value="eps" format="eps" />
+                <when input="output.outFileFormat" value="plotly" format="html" />
+            </change_format>
+        </data>
+    </xml>
+
+    <xml name="output_image_file_format_not_nested">
+        <data format="png" name="outFileName" label="${tool.name} image">
+            <change_format>
+                <when input="outFileFormat" value="pdf" format="pdf" />
+                <when input="outFileFormat" value="svg" format="svg" />
+                <when input="outFileFormat" value="eps" format="eps" />
+                <when input="outFileFormat" value="plotly" format="html" />
+            </change_format>
+        </data>
+    </xml>
+
+    <xml name="output_save_matrix_values">
+        <data format="tabular" name="outFileNameMatrix" label="${tool.name} on ${on_string}: Heatmap values">
+            <filter>
+            ((
+                output['showOutputSettings'] == 'yes' and
+                output['saveMatrix'] is True
+            ))
+            </filter>
+        </data>
+    </xml>
+
+    <xml name="output_graphic_outputs">
+        <data format="bed" name="outFileSortedRegions" label="${tool.name} on ${on_string}: sorted/filtered regions">
+            <filter>
+            ((
+                output['showOutputSettings'] == 'yes' and
+                output['saveSortedRegions'] is True
+            ))
+            </filter>
+        </data>
+    </xml>
+
+    <xml name="colorMap">
+        <param name="colorMap" type="select" label="Color map to use for the heatmap"
+               help=" Available color map names can be found here: http://matplotlib.org/examples/color/colormaps_reference.html">
+            <option value="RdYlBu" selected="true">RdYlBu</option>
+            <option value="Accent">Accent</option>
+            <option value="Spectral">Spectral</option>
+            <option value="Set1">Set1</option>
+            <option value="Set2">Set2</option>
+            <option value="Set3">Set3</option>
+            <option value="Dark2">Dark2</option>
+            <option value="Reds">Reds</option>
+            <option value="Oranges">Oranges</option>
+            <option value="Greens">Greens</option>
+            <option value="Blues">Blues</option>
+            <option value="Greys">Greys</option>
+            <option value="Purples">Purples</option>
+            <option value="Paired">Paired</option>
+            <option value="Pastel1">Pastel1</option>
+            <option value="Pastel2">Pastel2</option>
+            <option value="spring">spring</option>
+            <option value="summer">summer</option>
+            <option value="autumn">autumn</option>
+            <option value="winter">winter</option>
+            <option value="hot">hot</option>
+            <option value="coolwarm">coolwarm</option>
+            <option value="cool">cool</option>
+            <option value="seismic">seismic</option>
+            <option value="terrain">terrain</option>
+            <option value="ocean">ocean</option>
+            <option value="rainbow">rainbow</option>
+            <option value="bone">bone</option>
+            <option value="flag">flag</option>
+            <option value="prism">prism</option>
+            <option value="cubehelix">cubehelix</option>
+            <option value="binary">binary</option>
+            <option value="pink">pink</option>
+            <option value="gray">gray</option>
+            <option value="copper">copper</option>
+            <option value="BrBG">BrBG</option>
+            <option value="BuGn">BuGn</option>
+            <option value="BuPu">BuPu</option>
+            <option value="GnBu">GnBu</option>
+            <option value="OrRd">OrRd</option>
+            <option value="PiYG">PiYG</option>
+            <option value="PRGn">PRGn</option>
+            <option value="PuOr">PuOr</option>
+            <option value="PuRd">PuRd</option>
+            <option value="PuBu">PuBu</option>
+            <option value="RdBu">RdBu</option>
+            <option value="RdGy">RdGy</option>
+            <option value="RdPu">RdPu</option>
+            <option value="YlGn">YlGn</option>
+            <option value="PuBuGn">PuBuGn</option>
+            <option value="RdYlGn">RdYlGn</option>
+            <option value="YlGnBu">YlGnBu</option>
+            <option value="YlOrBr">YlOrBr</option>
+            <option value="YlOrRd">YlOrRd</option>
+            <option value="gist_gray">gist_gray</option>
+            <option value="gist_stern">gist_stern</option>
+            <option value="gist_earth">gist_earth</option>
+            <option value="gist_yarg">gist_yarg</option>
+            <option value="gist_ncar">gist_ncar</option>
+            <option value="gist_rainbow">gist_rainbow</option>
+            <option value="gist_heat">gist_heat</option>
+            <option value="gnuplot">gnuplot</option>
+            <option value="gnuplot2">gnuplot2</option>
+            <option value="CMRmap">CMRmap</option>
+            <option value="bwr">bwr</option>
+            <option value="hsv">hsv</option>
+            <option value="brg">brg</option>
+            <option value="jet">jet</option>
+            <option value="afmhot">afmhot</option>
+            <option value="Accent_r">Accent reversed</option>
+            <option value="Spectral_r">Spectral reversed</option>
+            <option value="Set1_r">Set1 reversed</option>
+            <option value="Set2_r">Set2 reversed</option>
+            <option value="Set3_r">Set3 reversed</option>
+            <option value="Dark2_r">Dark2 reversed</option>
+            <option value="Reds_r">Reds reversed</option>
+            <option value="Oranges_r">Oranges reversed</option>
+            <option value="Greens_r">Greens reversed</option>
+            <option value="Blues_r">Blues reversed</option>
+            <option value="Greys_r">Greys reversed</option>
+            <option value="Purples_r">Purples reversed</option>
+            <option value="Paired_r">Paired reversed</option>
+            <option value="Pastel1_r">Pastel1 reversed</option>
+            <option value="Pastel2_r">Pastel2 reversed</option>
+            <option value="spring_r">spring reversed</option>
+            <option value="summer_r">summer reversed</option>
+            <option value="autumn_r">autumn reversed</option>
+            <option value="winter_r">winter reversed</option>
+            <option value="hot_r">hot reversed</option>
+            <option value="coolwarm_r">coolwarm reversed</option>
+            <option value="cool_r">cool reversed</option>
+            <option value="seismic_r">seismic reversed</option>
+            <option value="terrain_r">terrain reversed</option>
+            <option value="ocean_r">ocean reversed</option>
+            <option value="rainbow_r">rainbow reversed</option>
+            <option value="bone_r">bone reversed</option>
+            <option value="flag_r">flag reversed</option>
+            <option value="prism_r">prism reversed</option>
+            <option value="cubehelix_r">cubehelix reversed</option>
+            <option value="binary_r">binary reversed</option>
+            <option value="pink_r">pink reversed</option>
+            <option value="gray_r">gray reversed</option>
+            <option value="copper_r">copper reversed</option>
+            <option value="BrBG_r">BrBG reversed</option>
+            <option value="BuGn_r">BuGn reversed</option>
+            <option value="BuPu_r">BuPu reversed</option>
+            <option value="GnBu_r">GnBu reversed</option>
+            <option value="OrRd_r">OrRd reversed</option>
+            <option value="PiYG_r">PiYG reversed</option>
+            <option value="PRGn_r">PRGn reversed</option>
+            <option value="PuOr_r">PuOr reversed</option>
+            <option value="PuRd_r">PuRd reversed</option>
+            <option value="PuBu_r">PuBu reversed</option>
+            <option value="RdBu_r">RdBu reversed</option>
+            <option value="RdGy_r">RdGy reversed</option>
+            <option value="RdPu_r">RdPu reversed</option>
+            <option value="YlGn_r">YlGn reversed</option>
+            <option value="PuBuGn_r">PuBuGn reversed</option>
+            <option value="RdYlBu_r">RdYlBu reversed</option>
+            <option value="RdYlGn_r">RdYlGn reversed</option>
+            <option value="YlGnBu_r">YlGnBu reversed</option>
+            <option value="YlOrBr_r">YlOrBr reversed</option>
+            <option value="YlOrRd_r">YlOrRd reversed</option>
+            <option value="gist_gray_r">gist_gray reversed</option>
+            <option value="gist_stern_r">gist_stern reversed</option>
+            <option value="gist_earth_r">gist_earth reversed</option>
+            <option value="gist_yarg_r">gist_yarg reversed</option>
+            <option value="gist_ncar_r">gist_ncar reversed</option>
+            <option value="gist_rainbow_r">gist_rainbow reversed</option>
+            <option value="gist_heat_r">gist_heat reversed</option>
+            <option value="gnuplot_r">gnuplot reversed</option>
+            <option value="gnuplot2_r">gnuplot2 reversed</option>
+            <option value="CMRmap_r">CMRmap reversed</option>
+            <option value="bwr_r">bwr reversed</option>
+            <option value="hsv_r">hsv reversed</option>
+            <option value="brg_r">brg reversed</option>
+            <option value="jet_r">jet reversed</option>
+            <option value="afmhot_r">afmhot reversed</option>
+        </param>
+
+    </xml>
+
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/readme.rst	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,74 @@
+========================
+Galaxy deeptools wrapper
+========================
+
+deepTools are user-friendly tools for the normalization and visualization of 
+deep-sequencing data.
+They address the challenge of visualizing the large amounts of data that are now
+routinely generated from sequencing centers in a meaningful way. 
+To do so, deepTools contain useful routines to process the mapped reads data 
+through removal of duplicates and different filtering options to create coverage
+files in standard bedGraph and bigWig file formats. deepTools allow the creation
+of normalized coverage files or the comparison between two files 
+(for example, treatment and control). Finally, using such normalized and 
+standardized files, multiple visualizations can be created to identify 
+enrichments with functional annotations of the genome. 
+For a gallery of images that can be produced and a description 
+of the tools see our poster_.
+
+.. _poster: http://f1000.com/posters/browse/summary/1094053
+
+deeptools is developed under here:
+
+    https://github.com/deeptools/deepTools
+
+For support, questions, or feature requests contact: deeptools@googlegroups.com
+
+
+============
+Installation
+============
+
+Requirements: python-2.7
+
+Galaxy should be able to automatically install all other dependencies, such as numpy or scipy.
+
+For the best performance we recommend to install blas/lapack/atlas in your environment before
+installing deepTools from the Tool Shed.
+
+
+========
+Citation
+========
+
+deeptools are currently under review. In the meantime please refere to https://github.com/deeptools/deepTools.
+
+
+=======
+History
+=======
+
+ * v1.0:        Initial public release
+ * v1.5.8.2:    Include new citation tag, update version to 1.5.8.2 and change wrapper version
+
+
+Licence (MIT)
+=============
+
+Permission is hereby granted, free of charge, to any person obtaining a copy
+of this software and associated documentation files (the "Software"), to deal
+in the Software without restriction, including without limitation the rights
+to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
+copies of the Software, and to permit persons to whom the Software is
+furnished to do so, subject to the following conditions:
+
+The above copyright notice and this permission notice shall be included in
+all copies or substantial portions of the Software.
+
+THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
+THE SOFTWARE.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/repository_dependencies.xml	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,4 @@
+<?xml version="1.0"?>
+<repositories>
+    <repository changeset_revision="9946bc39c834" name="data_manager_twobit_builder" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" />
+</repositories>
Binary file static/images/GC_bias_simulated_reads_2L.png has changed
Binary file static/images/QC_GCplots_input.png has changed
Binary file static/images/QC_fingerprint.png has changed
Binary file static/images/QC_multiBamSummary_humanSamples.png has changed
Binary file static/images/QC_plotCoverage.png has changed
Binary file static/images/bamCompare_output.png has changed
Binary file static/images/bamCoverage_output.png has changed
Binary file static/images/bamFP_galaxy_output.png has changed
Binary file static/images/bamPEFragmentSize_output.png has changed
Binary file static/images/bigwigCompare_output.png has changed
Binary file static/images/computeGCBias_output.png has changed
Binary file static/images/computeMatrix_advancedOutput.png has changed
Binary file static/images/computeMatrix_output.png has changed
Binary file static/images/computeMatrix_overview.png has changed
Binary file static/images/computeMatrix_selectRegions.png has changed
Binary file static/images/computeMatrix_selectScores.png has changed
Binary file static/images/multiBamSummary_output.png has changed
Binary file static/images/multiBigwigSummary_output.png has changed
Binary file static/images/norm_IGVsnapshot_indFiles.png has changed
Binary file static/images/plotCorrelate_RNAseq.png has changed
Binary file static/images/plotCorrelation_galaxy_bw_heatmap_output.png has changed
Binary file static/images/plotCorrelation_output.png has changed
Binary file static/images/plotCorrelation_scatterplot_PearsonCorr_bigwigScores.png has changed
Binary file static/images/plotCoverage_annotated.png has changed
Binary file static/images/plotCoverage_output.png has changed
Binary file static/images/plotEnrichment_output.png has changed
Binary file static/images/plotFingerprint_output.png has changed
Binary file static/images/plotHeatmap_example.png has changed
Binary file static/images/plotHeatmap_example02.png has changed
Binary file static/images/plotPCA_annotated.png has changed
Binary file static/images/plotProfiler_examples.png has changed
Binary file static/images/visual_hm_DmelPolII.png has changed
Binary file static/images/visual_profiler_DmelPolII.png has changed
Binary file test-data/alignmentSieve.bam has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/alignmentSieve.bed	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,4261 @@
+chr2L	5093	5232
+chr2L	5101	5236
+chr2L	5105	5252
+chr2L	5108	5267
+chr2L	5105	5250
+chr2L	5108	5244
+chr2L	5108	5279
+chr2L	5105	5251
+chr2L	5105	5252
+chr2L	5105	5224
+chr2L	5108	5244
+chr2L	5108	5252
+chr2L	5108	5244
+chr2L	5108	5251
+chr2L	5105	5212
+chr2L	5105	5266
+chr2L	5108	5265
+chr2L	5106	5287
+chr2L	5106	5243
+chr2L	5106	5204
+chr2L	5109	5249
+chr2L	5109	5213
+chr2L	5106	5245
+chr2L	5118	5266
+chr2L	5116	5224
+chr2L	5117	5293
+chr2L	5117	5291
+chr2L	5120	5265
+chr2L	5117	5243
+chr2L	5122	5249
+chr2L	5119	5268
+chr2L	5119	5245
+chr2L	5123	5423
+chr2L	5120	5293
+chr2L	5120	5250
+chr2L	5123	5293
+chr2L	5129	5197
+chr2L	5129	5323
+chr2L	5130	5265
+chr2L	5127	5280
+chr2L	5127	5285
+chr2L	5133	5274
+chr2L	5138	5293
+chr2L	5141	5279
+chr2L	5138	5266
+chr2L	5141	5279
+chr2L	5152	5322
+chr2L	5149	5323
+chr2L	5149	5250
+chr2L	5149	5306
+chr2L	5152	5292
+chr2L	5152	5322
+chr2L	5149	5330
+chr2L	5151	5252
+chr2L	5154	5326
+chr2L	5154	5251
+chr2L	5153	5324
+chr2L	5154	5341
+chr2L	5157	5304
+chr2L	5157	5292
+chr2L	5159	5292
+chr2L	5156	5323
+chr2L	5160	5292
+chr2L	5157	5323
+chr2L	5160	5326
+chr2L	5160	5292
+chr2L	5161	5326
+chr2L	5167	5280
+chr2L	5168	5249
+chr2L	5168	5325
+chr2L	5165	5306
+chr2L	5166	5323
+chr2L	5166	5306
+chr2L	5171	5323
+chr2L	5181	5322
+chr2L	5179	5356
+chr2L	5179	5294
+chr2L	5179	5323
+chr2L	5182	5312
+chr2L	5185	5323
+chr2L	5197	5326
+chr2L	5206	5322
+chr2L	5207	5340
+chr2L	5207	5355
+chr2L	5211	5325
+chr2L	5212	5350
+chr2L	5212	5296
+chr2L	5209	5381
+chr2L	5219	5369
+chr2L	5216	5323
+chr2L	5219	5356
+chr2L	5216	5382
+chr2L	5219	5381
+chr2L	5219	5369
+chr2L	5224	5326
+chr2L	5221	5356
+chr2L	5224	5380
+chr2L	5224	5356
+chr2L	5224	5325
+chr2L	5224	5375
+chr2L	5225	5380
+chr2L	5225	5325
+chr2L	5225	5377
+chr2L	5225	5381
+chr2L	5225	5440
+chr2L	5225	5375
+chr2L	5225	5325
+chr2L	5225	5355
+chr2L	5225	5355
+chr2L	5227	5380
+chr2L	5226	5500
+chr2L	5230	5326
+chr2L	5231	5423
+chr2L	5228	5400
+chr2L	5236	5383
+chr2L	5256	5401
+chr2L	5253	5455
+chr2L	5257	5467
+chr2L	5257	5402
+chr2L	5261	5423
+chr2L	5258	5355
+chr2L	5261	5428
+chr2L	5264	5401
+chr2L	5264	5401
+chr2L	5261	5467
+chr2L	5261	5403
+chr2L	5265	5426
+chr2L	5265	5377
+chr2L	5262	5370
+chr2L	5262	5392
+chr2L	5265	5423
+chr2L	5265	5375
+chr2L	5265	5401
+chr2L	5265	5401
+chr2L	5262	5427
+chr2L	5274	5465
+chr2L	5276	5381
+chr2L	5279	5402
+chr2L	5281	5423
+chr2L	5281	5431
+chr2L	5288	5411
+chr2L	5289	5382
+chr2L	5288	5421
+chr2L	5288	5421
+chr2L	5291	5420
+chr2L	5288	5424
+chr2L	5289	5467
+chr2L	5302	5462
+chr2L	5303	5401
+chr2L	5300	5425
+chr2L	5303	5464
+chr2L	5300	5464
+chr2L	5300	5464
+chr2L	5306	5401
+chr2L	5303	5428
+chr2L	5303	5414
+chr2L	5303	5465
+chr2L	5304	5407
+chr2L	5311	5423
+chr2L	5310	5467
+chr2L	5313	5463
+chr2L	5313	5423
+chr2L	5310	5465
+chr2L	5313	5423
+chr2L	5313	5462
+chr2L	5317	5500
+chr2L	5328	5467
+chr2L	5331	5485
+chr2L	5334	5467
+chr2L	5334	5466
+chr2L	5334	5467
+chr2L	5331	5480
+chr2L	5332	5467
+chr2L	5335	5480
+chr2L	5332	5485
+chr2L	5332	5484
+chr2L	5332	5517
+chr2L	5335	5465
+chr2L	5335	5464
+chr2L	5335	5464
+chr2L	5332	5469
+chr2L	5335	5467
+chr2L	5333	5472
+chr2L	5337	5480
+chr2L	5334	5488
+chr2L	5337	5467
+chr2L	5334	5503
+chr2L	5337	5527
+chr2L	5337	5497
+chr2L	5334	5498
+chr2L	5334	5497
+chr2L	5337	5463
+chr2L	5337	5516
+chr2L	5334	5483
+chr2L	5337	5517
+chr2L	5337	5453
+chr2L	5337	5466
+chr2L	5337	5440
+chr2L	5334	5454
+chr2L	5339	5503
+chr2L	5343	5451
+chr2L	5340	5518
+chr2L	5350	5466
+chr2L	5352	5464
+chr2L	5349	5467
+chr2L	5352	5496
+chr2L	5352	5453
+chr2L	5361	5527
+chr2L	5365	5500
+chr2L	5362	5527
+chr2L	5365	5517
+chr2L	5362	5464
+chr2L	5362	5497
+chr2L	5368	5517
+chr2L	5368	5496
+chr2L	5378	5500
+chr2L	5378	5499
+chr2L	5375	5527
+chr2L	5385	5517
+chr2L	5385	5497
+chr2L	5387	5527
+chr2L	5390	5502
+chr2L	5387	5527
+chr2L	5390	5526
+chr2L	5394	5526
+chr2L	5391	5557
+chr2L	5395	5502
+chr2L	5395	5520
+chr2L	5392	5481
+chr2L	5392	5504
+chr2L	5395	5556
+chr2L	5394	5533
+chr2L	5395	5557
+chr2L	5398	5563
+chr2L	5398	5556
+chr2L	5398	5526
+chr2L	5398	5527
+chr2L	5395	5543
+chr2L	5400	5548
+chr2L	5398	5518
+chr2L	5398	5500
+chr2L	5408	5528
+chr2L	5413	5556
+chr2L	5413	5596
+chr2L	5415	5520
+chr2L	5421	5549
+chr2L	5419	5567
+chr2L	5419	5607
+chr2L	5422	5574
+chr2L	5419	5567
+chr2L	5422	5526
+chr2L	5422	5503
+chr2L	5422	5582
+chr2L	5419	5557
+chr2L	5423	5601
+chr2L	5426	5583
+chr2L	5426	5564
+chr2L	5436	5565
+chr2L	5437	5567
+chr2L	5437	5567
+chr2L	5437	5586
+chr2L	5440	5549
+chr2L	5438	5613
+chr2L	5441	5596
+chr2L	5438	5583
+chr2L	5438	5583
+chr2L	5438	5601
+chr2L	5441	5598
+chr2L	5438	5607
+chr2L	5449	5601
+chr2L	5449	5542
+chr2L	5450	5613
+chr2L	5465	5580
+chr2L	5465	5598
+chr2L	5475	5582
+chr2L	5473	5602
+chr2L	5478	5612
+chr2L	5479	5627
+chr2L	5476	5613
+chr2L	5479	5626
+chr2L	5476	5565
+chr2L	5479	5563
+chr2L	5476	5599
+chr2L	5480	5640
+chr2L	5477	5613
+chr2L	5480	5566
+chr2L	5480	5639
+chr2L	5477	5614
+chr2L	5477	5591
+chr2L	5480	5584
+chr2L	5477	5626
+chr2L	5477	5628
+chr2L	5477	5614
+chr2L	5480	5626
+chr2L	5480	5626
+chr2L	5477	5639
+chr2L	5477	5607
+chr2L	5477	5614
+chr2L	5477	5627
+chr2L	5477	5630
+chr2L	5483	5639
+chr2L	5490	5564
+chr2L	5490	5656
+chr2L	5490	5612
+chr2L	5494	5640
+chr2L	5498	5613
+chr2L	5495	5627
+chr2L	5495	5615
+chr2L	5502	5656
+chr2L	5502	5675
+chr2L	5508	5689
+chr2L	5508	5613
+chr2L	5512	5711
+chr2L	5513	5656
+chr2L	5511	5657
+chr2L	5514	5613
+chr2L	5511	5657
+chr2L	5511	5657
+chr2L	5516	5623
+chr2L	5513	5646
+chr2L	5517	5656
+chr2L	5518	5670
+chr2L	5528	5656
+chr2L	5528	5684
+chr2L	5541	5657
+chr2L	5538	5712
+chr2L	5539	5706
+chr2L	5542	5690
+chr2L	5539	5715
+chr2L	5539	5712
+chr2L	5539	5713
+chr2L	5539	5712
+chr2L	5542	5746
+chr2L	5539	5710
+chr2L	5543	5665
+chr2L	5540	5657
+chr2L	5540	5691
+chr2L	5543	5670
+chr2L	5543	5714
+chr2L	5543	5670
+chr2L	5541	5714
+chr2L	5545	5748
+chr2L	5549	5718
+chr2L	5554	5713
+chr2L	5554	5717
+chr2L	5555	5710
+chr2L	5563	5709
+chr2L	5561	5717
+chr2L	5561	5717
+chr2L	5564	5714
+chr2L	5564	5714
+chr2L	5573	5711
+chr2L	5571	5736
+chr2L	5574	5714
+chr2L	5574	5711
+chr2L	5574	5716
+chr2L	5573	5712
+chr2L	5581	5714
+chr2L	5582	5711
+chr2L	5582	5736
+chr2L	5582	5689
+chr2L	5581	5717
+chr2L	5591	5714
+chr2L	5589	5802
+chr2L	5592	5735
+chr2L	5592	5712
+chr2L	5589	5718
+chr2L	5594	5711
+chr2L	5594	5715
+chr2L	5591	5736
+chr2L	5594	5721
+chr2L	5597	5715
+chr2L	5598	5749
+chr2L	5595	5758
+chr2L	5598	5733
+chr2L	5598	5735
+chr2L	5598	5817
+chr2L	5599	5746
+chr2L	5604	5736
+chr2L	5605	5710
+chr2L	5605	5736
+chr2L	5608	5749
+chr2L	5612	5711
+chr2L	5611	5718
+chr2L	5619	5718
+chr2L	5622	5714
+chr2L	5620	5736
+chr2L	5620	5758
+chr2L	5623	5774
+chr2L	5623	5787
+chr2L	5624	5749
+chr2L	5621	5758
+chr2L	5621	5798
+chr2L	5624	5747
+chr2L	5621	5762
+chr2L	5621	5775
+chr2L	5624	5775
+chr2L	5621	5738
+chr2L	5625	5787
+chr2L	5625	5757
+chr2L	5625	5715
+chr2L	5633	5800
+chr2L	5633	5798
+chr2L	5636	5797
+chr2L	5633	5788
+chr2L	5633	5822
+chr2L	5636	5787
+chr2L	5633	5800
+chr2L	5636	5802
+chr2L	5636	5785
+chr2L	5633	5798
+chr2L	5637	5800
+chr2L	5634	5800
+chr2L	5636	5750
+chr2L	5636	5786
+chr2L	5639	5799
+chr2L	5636	5801
+chr2L	5636	5750
+chr2L	5636	5908
+chr2L	5643	5801
+chr2L	5646	5819
+chr2L	5647	5800
+chr2L	5644	5752
+chr2L	5647	5827
+chr2L	5647	5775
+chr2L	5647	5757
+chr2L	5644	5801
+chr2L	5653	5757
+chr2L	5665	5775
+chr2L	5668	5801
+chr2L	5668	5979
+chr2L	5668	5846
+chr2L	5668	5800
+chr2L	5669	5915
+chr2L	5666	5800
+chr2L	5669	5827
+chr2L	5666	5820
+chr2L	5669	5788
+chr2L	5671	5804
+chr2L	5671	5831
+chr2L	5671	5958
+chr2L	5671	5846
+chr2L	5668	5832
+chr2L	5668	5801
+chr2L	5668	5800
+chr2L	5672	5819
+chr2L	5673	5833
+chr2L	5675	5775
+chr2L	5686	5831
+chr2L	5695	5862
+chr2L	5699	5799
+chr2L	5699	5858
+chr2L	5708	5801
+chr2L	5712	5835
+chr2L	5710	5862
+chr2L	5725	5857
+chr2L	5726	5829
+chr2L	5724	5882
+chr2L	5728	5858
+chr2L	5725	5776
+chr2L	5725	5884
+chr2L	5725	5856
+chr2L	5729	5913
+chr2L	5729	5879
+chr2L	5726	5886
+chr2L	5729	5850
+chr2L	5726	5877
+chr2L	5731	5915
+chr2L	5731	5884
+chr2L	5734	5850
+chr2L	5731	5858
+chr2L	5731	5862
+chr2L	5734	5913
+chr2L	5732	5802
+chr2L	5732	5884
+chr2L	5735	5899
+chr2L	5735	5883
+chr2L	5732	5886
+chr2L	5732	5893
+chr2L	5732	5880
+chr2L	5732	5915
+chr2L	5732	5850
+chr2L	5746	5913
+chr2L	5743	5904
+chr2L	5746	5882
+chr2L	5749	5914
+chr2L	5749	5858
+chr2L	5749	5913
+chr2L	5746	5886
+chr2L	5749	5881
+chr2L	5746	5888
+chr2L	5756	5942
+chr2L	5759	5876
+chr2L	5760	5914
+chr2L	5757	5914
+chr2L	5760	5928
+chr2L	5757	5888
+chr2L	5757	5884
+chr2L	5757	5858
+chr2L	5757	5904
+chr2L	5762	5914
+chr2L	5762	5914
+chr2L	5762	5914
+chr2L	5767	5869
+chr2L	5765	5880
+chr2L	5765	5904
+chr2L	5766	5910
+chr2L	5767	5903
+chr2L	5767	5914
+chr2L	5770	5914
+chr2L	5767	5915
+chr2L	5772	5903
+chr2L	5781	5914
+chr2L	5781	5908
+chr2L	5799	5957
+chr2L	5799	5913
+chr2L	5810	5957
+chr2L	5811	5885
+chr2L	5812	5999
+chr2L	5812	5957
+chr2L	5812	5958
+chr2L	5813	5902
+chr2L	5813	5899
+chr2L	5813	5914
+chr2L	5813	5914
+chr2L	5811	5966
+chr2L	5814	5980
+chr2L	5811	5981
+chr2L	5814	5979
+chr2L	5814	5913
+chr2L	5814	5939
+chr2L	5814	5957
+chr2L	5814	5957
+chr2L	5811	5980
+chr2L	5811	5914
+chr2L	5814	5913
+chr2L	5812	5929
+chr2L	5815	5914
+chr2L	5815	5913
+chr2L	5812	5903
+chr2L	5812	5942
+chr2L	5815	5927
+chr2L	5815	5914
+chr2L	5812	5914
+chr2L	5812	5941
+chr2L	5815	5957
+chr2L	5812	6002
+chr2L	5815	5958
+chr2L	5828	5979
+chr2L	5828	5980
+chr2L	5826	6002
+chr2L	5826	6000
+chr2L	5826	6000
+chr2L	5830	5958
+chr2L	5839	5980
+chr2L	5840	5958
+chr2L	5843	6002
+chr2L	5844	5928
+chr2L	5844	5980
+chr2L	5844	5992
+chr2L	5842	6002
+chr2L	5842	5949
+chr2L	5847	5958
+chr2L	5856	5953
+chr2L	5865	6059
+chr2L	5865	6044
+chr2L	5864	5959
+chr2L	5867	5958
+chr2L	5867	6021
+chr2L	5864	6033
+chr2L	5868	6032
+chr2L	5867	5958
+chr2L	5867	6004
+chr2L	5868	6037
+chr2L	5873	6001
+chr2L	5870	5999
+chr2L	5870	5999
+chr2L	5873	6001
+chr2L	5872	6033
+chr2L	5872	6003
+chr2L	5872	5976
+chr2L	5879	6038
+chr2L	5880	6033
+chr2L	5885	6001
+chr2L	5891	5958
+chr2L	5898	6032
+chr2L	5899	6004
+chr2L	5896	6006
+chr2L	5896	6053
+chr2L	5899	6030
+chr2L	5899	6032
+chr2L	5899	6021
+chr2L	5899	6003
+chr2L	5906	6081
+chr2L	5911	6081
+chr2L	5922	6097
+chr2L	5925	6080
+chr2L	5922	6062
+chr2L	5922	6097
+chr2L	5925	6075
+chr2L	5925	6078
+chr2L	5922	6081
+chr2L	5922	6082
+chr2L	5922	6098
+chr2L	5925	6066
+chr2L	5926	6092
+chr2L	5923	6079
+chr2L	5923	6070
+chr2L	5926	6102
+chr2L	5926	6136
+chr2L	5925	6073
+chr2L	5928	6106
+chr2L	5928	6068
+chr2L	5928	6021
+chr2L	5928	6081
+chr2L	5925	6081
+chr2L	5925	6060
+chr2L	5925	6106
+chr2L	5928	6104
+chr2L	5926	6081
+chr2L	5930	6074
+chr2L	5931	6082
+chr2L	5928	6083
+chr2L	5937	6036
+chr2L	5935	6093
+chr2L	5935	6099
+chr2L	5938	6103
+chr2L	5938	6097
+chr2L	5942	6104
+chr2L	5942	6106
+chr2L	5942	6078
+chr2L	5942	6081
+chr2L	5939	6107
+chr2L	5947	6080
+chr2L	5947	6119
+chr2L	5944	6124
+chr2L	5948	6129
+chr2L	5948	6119
+chr2L	5948	6102
+chr2L	5945	6108
+chr2L	5945	6081
+chr2L	5945	6089
+chr2L	5948	6080
+chr2L	5948	6096
+chr2L	5948	6080
+chr2L	5945	6107
+chr2L	5948	6097
+chr2L	5945	6079
+chr2L	5948	6094
+chr2L	5954	6097
+chr2L	5952	6107
+chr2L	5952	6107
+chr2L	5955	6084
+chr2L	5952	6124
+chr2L	5954	6144
+chr2L	5957	6064
+chr2L	5959	6083
+chr2L	5965	6124
+chr2L	5965	6096
+chr2L	5966	6113
+chr2L	5966	6058
+chr2L	5966	6082
+chr2L	5970	6080
+chr2L	5967	6137
+chr2L	5970	6140
+chr2L	5967	6108
+chr2L	5970	6123
+chr2L	5970	6094
+chr2L	5970	6106
+chr2L	5967	6174
+chr2L	5967	6144
+chr2L	5970	6143
+chr2L	5972	6147
+chr2L	5969	6065
+chr2L	5969	6107
+chr2L	5969	6081
+chr2L	5969	6119
+chr2L	5972	6064
+chr2L	5972	6142
+chr2L	5972	6142
+chr2L	5978	6143
+chr2L	5989	6137
+chr2L	5986	6144
+chr2L	5989	6143
+chr2L	5986	6138
+chr2L	5987	6138
+chr2L	5987	6144
+chr2L	5987	6098
+chr2L	5990	6148
+chr2L	5990	6137
+chr2L	5990	6143
+chr2L	5990	6143
+chr2L	5990	6143
+chr2L	5990	6142
+chr2L	5991	6137
+chr2L	6013	6142
+chr2L	6016	6096
+chr2L	6013	6137
+chr2L	6017	6143
+chr2L	6014	6124
+chr2L	6017	6185
+chr2L	6017	6173
+chr2L	6018	6142
+chr2L	6015	6171
+chr2L	6018	6136
+chr2L	6016	6137
+chr2L	6016	6143
+chr2L	6019	6143
+chr2L	6021	6148
+chr2L	6018	6174
+chr2L	6021	6198
+chr2L	6021	6184
+chr2L	6018	6144
+chr2L	6018	6143
+chr2L	6018	6171
+chr2L	6021	6136
+chr2L	6021	6163
+chr2L	6021	6188
+chr2L	6018	6156
+chr2L	6018	6167
+chr2L	6021	6188
+chr2L	6021	6188
+chr2L	6018	6138
+chr2L	6022	6146
+chr2L	6022	6188
+chr2L	6022	6163
+chr2L	6019	6165
+chr2L	6022	6173
+chr2L	6022	6170
+chr2L	6022	6143
+chr2L	6022	6143
+chr2L	6019	6174
+chr2L	6022	6144
+chr2L	6019	6171
+chr2L	6022	6170
+chr2L	6022	6143
+chr2L	6022	6142
+chr2L	6022	6166
+chr2L	6019	6143
+chr2L	6019	6198
+chr2L	6022	6136
+chr2L	6022	6138
+chr2L	6022	6151
+chr2L	6019	6171
+chr2L	6019	6138
+chr2L	6025	6128
+chr2L	6033	6143
+chr2L	6033	6145
+chr2L	6036	6163
+chr2L	6033	6164
+chr2L	6038	6202
+chr2L	6039	6123
+chr2L	6037	6144
+chr2L	6040	6186
+chr2L	6040	6186
+chr2L	6045	6174
+chr2L	6049	6188
+chr2L	6046	6198
+chr2L	6046	6174
+chr2L	6046	6144
+chr2L	6047	6199
+chr2L	6049	6144
+chr2L	6052	6197
+chr2L	6052	6200
+chr2L	6053	6170
+chr2L	6053	6264
+chr2L	6054	6197
+chr2L	6057	6207
+chr2L	6061	6218
+chr2L	6063	6142
+chr2L	6063	6203
+chr2L	6066	6144
+chr2L	6072	6188
+chr2L	6077	6231
+chr2L	6077	6190
+chr2L	6086	6198
+chr2L	6091	6219
+chr2L	6089	6359
+chr2L	6092	6219
+chr2L	6093	6248
+chr2L	6093	6257
+chr2L	6096	6246
+chr2L	6096	6219
+chr2L	6093	6265
+chr2L	6097	6206
+chr2L	6095	6198
+chr2L	6098	6300
+chr2L	6098	6199
+chr2L	6098	6287
+chr2L	6098	6196
+chr2L	6095	6248
+chr2L	6105	6270
+chr2L	6103	6248
+chr2L	6106	6235
+chr2L	6106	6257
+chr2L	6112	6270
+chr2L	6118	6233
+chr2L	6119	6287
+chr2L	6119	6281
+chr2L	6116	6282
+chr2L	6116	6220
+chr2L	6125	6273
+chr2L	6122	6248
+chr2L	6126	6273
+chr2L	6135	6274
+chr2L	6136	6288
+chr2L	6138	6286
+chr2L	6144	6281
+chr2L	6144	6286
+chr2L	6156	6298
+chr2L	6162	6303
+chr2L	6166	6304
+chr2L	6163	6306
+chr2L	6166	6302
+chr2L	6164	6303
+chr2L	6164	6271
+chr2L	6167	6305
+chr2L	6164	6271
+chr2L	6164	6304
+chr2L	6164	6290
+chr2L	6172	6306
+chr2L	6173	6307
+chr2L	6171	6258
+chr2L	6174	6296
+chr2L	6177	6310
+chr2L	6174	6299
+chr2L	6174	6303
+chr2L	6174	6303
+chr2L	6176	6320
+chr2L	6181	6329
+chr2L	6181	6328
+chr2L	6184	6328
+chr2L	6184	6304
+chr2L	6185	6321
+chr2L	6182	6342
+chr2L	6182	6490
+chr2L	6182	6331
+chr2L	6182	6300
+chr2L	6185	6341
+chr2L	6186	6302
+chr2L	6186	6298
+chr2L	6186	6319
+chr2L	6183	6373
+chr2L	6183	6342
+chr2L	6183	6298
+chr2L	6187	6341
+chr2L	6187	6287
+chr2L	6185	6343
+chr2L	6198	6331
+chr2L	6197	6359
+chr2L	6201	6342
+chr2L	6212	6373
+chr2L	6209	6303
+chr2L	6212	6320
+chr2L	6214	6341
+chr2L	6216	6342
+chr2L	6219	6319
+chr2L	6217	6359
+chr2L	6217	6366
+chr2L	6217	6311
+chr2L	6220	6341
+chr2L	6220	6400
+chr2L	6228	6372
+chr2L	6229	6371
+chr2L	6226	6374
+chr2L	6231	6372
+chr2L	6231	6342
+chr2L	6228	6373
+chr2L	6231	6341
+chr2L	6228	6373
+chr2L	6230	6374
+chr2L	6234	6358
+chr2L	6234	6401
+chr2L	6231	6373
+chr2L	6242	6396
+chr2L	6240	6402
+chr2L	6246	6347
+chr2L	6253	6401
+chr2L	6266	6456
+chr2L	6266	6371
+chr2L	6263	6415
+chr2L	6264	6353
+chr2L	6280	6457
+chr2L	6285	6359
+chr2L	6285	6428
+chr2L	6285	6457
+chr2L	6285	6441
+chr2L	6285	6489
+chr2L	6289	6441
+chr2L	6289	6428
+chr2L	6286	6441
+chr2L	6286	6459
+chr2L	6289	6455
+chr2L	6293	6442
+chr2L	6294	6418
+chr2L	6298	6440
+chr2L	6302	6440
+chr2L	6303	6389
+chr2L	6304	6401
+chr2L	6304	6440
+chr2L	6304	6400
+chr2L	6304	6498
+chr2L	6304	6440
+chr2L	6302	6442
+chr2L	6303	6451
+chr2L	6306	6428
+chr2L	6303	6429
+chr2L	6310	6456
+chr2L	6311	6429
+chr2L	6308	6456
+chr2L	6315	6441
+chr2L	6313	6447
+chr2L	6317	6456
+chr2L	6318	6455
+chr2L	6315	6457
+chr2L	6318	6453
+chr2L	6319	6473
+chr2L	6319	6489
+chr2L	6316	6457
+chr2L	6316	6441
+chr2L	6319	6473
+chr2L	6319	6455
+chr2L	6319	6455
+chr2L	6316	6458
+chr2L	6316	6458
+chr2L	6322	6492
+chr2L	6322	6455
+chr2L	6319	6474
+chr2L	6320	6498
+chr2L	6323	6475
+chr2L	6324	6454
+chr2L	6327	6481
+chr2L	6327	6427
+chr2L	6324	6473
+chr2L	6324	6430
+chr2L	6324	6446
+chr2L	6328	6481
+chr2L	6325	6490
+chr2L	6325	6456
+chr2L	6325	6441
+chr2L	6328	6481
+chr2L	6328	6456
+chr2L	6328	6469
+chr2L	6325	6441
+chr2L	6325	6465
+chr2L	6325	6430
+chr2L	6328	6473
+chr2L	6325	6483
+chr2L	6328	6455
+chr2L	6335	6457
+chr2L	6341	6527
+chr2L	6340	6489
+chr2L	6343	6456
+chr2L	6340	6499
+chr2L	6341	6441
+chr2L	6344	6500
+chr2L	6344	6540
+chr2L	6341	6500
+chr2L	6349	6499
+chr2L	6349	6456
+chr2L	6349	6499
+chr2L	6347	6489
+chr2L	6350	6474
+chr2L	6350	6455
+chr2L	6347	6519
+chr2L	6351	6518
+chr2L	6351	6488
+chr2L	6351	6498
+chr2L	6348	6481
+chr2L	6348	6456
+chr2L	6351	6527
+chr2L	6351	6481
+chr2L	6351	6475
+chr2L	6352	6480
+chr2L	6354	6500
+chr2L	6358	6511
+chr2L	6355	6512
+chr2L	6359	6498
+chr2L	6356	6489
+chr2L	6356	6489
+chr2L	6356	6520
+chr2L	6359	6499
+chr2L	6359	6488
+chr2L	6359	6511
+chr2L	6360	6518
+chr2L	6357	6503
+chr2L	6360	6473
+chr2L	6360	6469
+chr2L	6357	6493
+chr2L	6360	6519
+chr2L	6357	6474
+chr2L	6360	6498
+chr2L	6361	6498
+chr2L	6361	6497
+chr2L	6358	6499
+chr2L	6358	6517
+chr2L	6367	6488
+chr2L	6367	6518
+chr2L	6368	6519
+chr2L	6368	6497
+chr2L	6369	6540
+chr2L	6373	6510
+chr2L	6373	6528
+chr2L	6373	6518
+chr2L	6371	6527
+chr2L	6371	6490
+chr2L	6372	6529
+chr2L	6383	6499
+chr2L	6381	6536
+chr2L	6381	6490
+chr2L	6384	6518
+chr2L	6381	6559
+chr2L	6384	6488
+chr2L	6381	6517
+chr2L	6384	6529
+chr2L	6385	6499
+chr2L	6385	6518
+chr2L	6382	6517
+chr2L	6382	6529
+chr2L	6385	6544
+chr2L	6385	6441
+chr2L	6384	6519
+chr2L	6384	6481
+chr2L	6384	6499
+chr2L	6385	6519
+chr2L	6388	6540
+chr2L	6385	6515
+chr2L	6388	6542
+chr2L	6385	6528
+chr2L	6388	6529
+chr2L	6388	6520
+chr2L	6385	6528
+chr2L	6385	6527
+chr2L	6385	6536
+chr2L	6387	6529
+chr2L	6412	6513
+chr2L	6413	6527
+chr2L	6414	6560
+chr2L	6418	6518
+chr2L	6421	6534
+chr2L	6421	6584
+chr2L	6425	6587
+chr2L	6422	6584
+chr2L	6422	6543
+chr2L	6450	6611
+chr2L	6453	6586
+chr2L	6465	6586
+chr2L	6467	6630
+chr2L	6467	6616
+chr2L	6467	6624
+chr2L	6468	6630
+chr2L	6465	6637
+chr2L	6468	6624
+chr2L	6468	6639
+chr2L	6465	6626
+chr2L	6468	6631
+chr2L	6468	6624
+chr2L	6468	6644
+chr2L	6465	6638
+chr2L	6468	6624
+chr2L	6465	6587
+chr2L	6468	6630
+chr2L	6468	6624
+chr2L	6467	6626
+chr2L	6470	6610
+chr2L	6470	6624
+chr2L	6468	6628
+chr2L	6469	6631
+chr2L	6472	6624
+chr2L	6469	6625
+chr2L	6480	6659
+chr2L	6481	6631
+chr2L	6487	6612
+chr2L	6487	6645
+chr2L	6490	6657
+chr2L	6487	6631
+chr2L	6488	6588
+chr2L	6488	6588
+chr2L	6488	6646
+chr2L	6488	6626
+chr2L	6491	6657
+chr2L	6491	6586
+chr2L	6496	6693
+chr2L	6497	6587
+chr2L	6497	6621
+chr2L	6496	6660
+chr2L	6496	6658
+chr2L	6497	6611
+chr2L	6498	6625
+chr2L	6498	6655
+chr2L	6498	6611
+chr2L	6498	6625
+chr2L	6501	6657
+chr2L	6498	6632
+chr2L	6501	6630
+chr2L	6501	6624
+chr2L	6498	6645
+chr2L	6509	6586
+chr2L	6510	6657
+chr2L	6507	6598
+chr2L	6507	6631
+chr2L	6507	6625
+chr2L	6508	6658
+chr2L	6511	6657
+chr2L	6508	6650
+chr2L	6508	6638
+chr2L	6511	6640
+chr2L	6511	6688
+chr2L	6508	6658
+chr2L	6508	6659
+chr2L	6508	6625
+chr2L	6508	6658
+chr2L	6511	6657
+chr2L	6508	6623
+chr2L	6511	6660
+chr2L	6510	6625
+chr2L	6513	6625
+chr2L	6510	6632
+chr2L	6513	6648
+chr2L	6513	6624
+chr2L	6510	6655
+chr2L	6519	6639
+chr2L	6520	6659
+chr2L	6517	6631
+chr2L	6517	6659
+chr2L	6520	6681
+chr2L	6527	6690
+chr2L	6536	6703
+chr2L	6533	6708
+chr2L	6533	6691
+chr2L	6533	6689
+chr2L	6537	6644
+chr2L	6539	6688
+chr2L	6538	6689
+chr2L	6543	6688
+chr2L	6540	6683
+chr2L	6541	6645
+chr2L	6541	6704
+chr2L	6541	6660
+chr2L	6541	6683
+chr2L	6544	6682
+chr2L	6547	6689
+chr2L	6552	6657
+chr2L	6549	6640
+chr2L	6553	6722
+chr2L	6550	6705
+chr2L	6553	6654
+chr2L	6554	6669
+chr2L	6551	6704
+chr2L	6551	6668
+chr2L	6554	6707
+chr2L	6551	6682
+chr2L	6554	6689
+chr2L	6555	6721
+chr2L	6552	6708
+chr2L	6552	6704
+chr2L	6552	6722
+chr2L	6554	6721
+chr2L	6554	6705
+chr2L	6555	6704
+chr2L	6555	6721
+chr2L	6558	6704
+chr2L	6558	6675
+chr2L	6558	6702
+chr2L	6555	6786
+chr2L	6555	6690
+chr2L	6558	6658
+chr2L	6558	6709
+chr2L	6558	6701
+chr2L	6555	6721
+chr2L	6560	6630
+chr2L	6560	6681
+chr2L	6560	6708
+chr2L	6560	6704
+chr2L	6557	6705
+chr2L	6567	6707
+chr2L	6564	6710
+chr2L	6575	6727
+chr2L	6576	6721
+chr2L	6576	6723
+chr2L	6579	6727
+chr2L	6579	6688
+chr2L	6579	6708
+chr2L	6587	6720
+chr2L	6590	6658
+chr2L	6591	6704
+chr2L	6591	6753
+chr2L	6592	6714
+chr2L	6592	6752
+chr2L	6595	6809
+chr2L	6595	6741
+chr2L	6592	6752
+chr2L	6592	6894
+chr2L	6595	6739
+chr2L	6595	6781
+chr2L	6603	6705
+chr2L	6607	6779
+chr2L	6604	6704
+chr2L	6607	6779
+chr2L	6614	6783
+chr2L	6616	6764
+chr2L	6632	6780
+chr2L	6632	6797
+chr2L	6633	6797
+chr2L	6633	6809
+chr2L	6633	6780
+chr2L	6633	6780
+chr2L	6633	6780
+chr2L	6638	6780
+chr2L	6640	6780
+chr2L	6637	6811
+chr2L	6640	6809
+chr2L	6640	6780
+chr2L	6642	6744
+chr2L	6640	6752
+chr2L	6643	6809
+chr2L	6643	6751
+chr2L	6645	6768
+chr2L	6646	6797
+chr2L	6643	6769
+chr2L	6645	6819
+chr2L	6651	6810
+chr2L	6652	6796
+chr2L	6649	6780
+chr2L	6649	6798
+chr2L	6651	6797
+chr2L	6652	6771
+chr2L	6652	6783
+chr2L	6656	6809
+chr2L	6656	6809
+chr2L	6656	6818
+chr2L	6653	6721
+chr2L	6656	6799
+chr2L	6655	6810
+chr2L	6662	6768
+chr2L	6662	6768
+chr2L	6667	6810
+chr2L	6664	6786
+chr2L	6667	6809
+chr2L	6664	6810
+chr2L	6667	6809
+chr2L	6668	6880
+chr2L	6668	6809
+chr2L	6668	6808
+chr2L	6665	6810
+chr2L	6665	6811
+chr2L	6668	6809
+chr2L	6665	6931
+chr2L	6668	6812
+chr2L	6668	6752
+chr2L	6665	6811
+chr2L	6665	6798
+chr2L	6668	6810
+chr2L	6668	6809
+chr2L	6665	6945
+chr2L	6669	6810
+chr2L	6666	6833
+chr2L	6666	6752
+chr2L	6670	6809
+chr2L	6667	6833
+chr2L	6667	6810
+chr2L	6670	6832
+chr2L	6667	6809
+chr2L	6675	6810
+chr2L	6675	6849
+chr2L	6675	6846
+chr2L	6678	6801
+chr2L	6680	6810
+chr2L	6680	6847
+chr2L	6685	6780
+chr2L	6689	6846
+chr2L	6700	6809
+chr2L	6700	6857
+chr2L	6700	6918
+chr2L	6700	6798
+chr2L	6700	6780
+chr2L	6700	6900
+chr2L	6711	6882
+chr2L	6719	6871
+chr2L	6716	6846
+chr2L	6717	6894
+chr2L	6720	6872
+chr2L	6720	6917
+chr2L	6717	6895
+chr2L	6720	6870
+chr2L	6717	6894
+chr2L	6720	6872
+chr2L	6717	6881
+chr2L	6720	6871
+chr2L	6720	6895
+chr2L	6717	6894
+chr2L	6720	6808
+chr2L	6720	6893
+chr2L	6720	6893
+chr2L	6717	6909
+chr2L	6721	6849
+chr2L	6718	6873
+chr2L	6724	6908
+chr2L	6724	6882
+chr2L	6728	6883
+chr2L	6734	6944
+chr2L	6734	6846
+chr2L	6731	6881
+chr2L	6734	6917
+chr2L	6734	6898
+chr2L	6731	6849
+chr2L	6731	6883
+chr2L	6735	6873
+chr2L	6735	6918
+chr2L	6735	6880
+chr2L	6732	6875
+chr2L	6732	6881
+chr2L	6735	6894
+chr2L	6735	6894
+chr2L	6732	6878
+chr2L	6735	6880
+chr2L	6735	6898
+chr2L	6732	6881
+chr2L	6732	6895
+chr2L	6732	6884
+chr2L	6735	6893
+chr2L	6735	6895
+chr2L	6732	6810
+chr2L	6736	6895
+chr2L	6738	6882
+chr2L	6735	6899
+chr2L	6740	6894
+chr2L	6749	6897
+chr2L	6752	6898
+chr2L	6752	6893
+chr2L	6759	6874
+chr2L	6761	6909
+chr2L	6761	6900
+chr2L	6765	6908
+chr2L	6765	6895
+chr2L	6767	6893
+chr2L	6766	6933
+chr2L	6768	6948
+chr2L	6781	6929
+chr2L	6778	6940
+chr2L	6783	6955
+chr2L	6784	6939
+chr2L	6784	6931
+chr2L	6784	6937
+chr2L	6787	6938
+chr2L	6785	6916
+chr2L	6788	6919
+chr2L	6788	6917
+chr2L	6790	6938
+chr2L	6793	6939
+chr2L	6794	6917
+chr2L	6794	6938
+chr2L	6794	6931
+chr2L	6794	6929
+chr2L	6791	6897
+chr2L	6794	6939
+chr2L	6791	6937
+chr2L	6807	6895
+chr2L	6805	6994
+chr2L	6805	6947
+chr2L	6807	6931
+chr2L	6807	6991
+chr2L	6820	6939
+chr2L	6818	6950
+chr2L	6821	6945
+chr2L	6824	6940
+chr2L	6824	7002
+chr2L	6822	7004
+chr2L	6826	6938
+chr2L	6823	6940
+chr2L	6825	6939
+chr2L	6829	6966
+chr2L	6826	6991
+chr2L	6826	6910
+chr2L	6829	6950
+chr2L	6829	6929
+chr2L	6826	6956
+chr2L	6826	6952
+chr2L	6829	6938
+chr2L	6829	6947
+chr2L	6826	6945
+chr2L	6829	6929
+chr2L	6830	6938
+chr2L	6830	6939
+chr2L	6827	6919
+chr2L	6827	6946
+chr2L	6827	6964
+chr2L	6830	6938
+chr2L	6830	6938
+chr2L	6827	6991
+chr2L	6830	6938
+chr2L	6830	6945
+chr2L	6830	6959
+chr2L	6827	6971
+chr2L	6840	6930
+chr2L	6841	7003
+chr2L	6841	6943
+chr2L	6843	6961
+chr2L	6854	7014
+chr2L	6854	7003
+chr2L	6854	7036
+chr2L	6857	7016
+chr2L	6855	6987
+chr2L	6858	7002
+chr2L	6858	7016
+chr2L	6870	7017
+chr2L	6879	7034
+chr2L	6877	7027
+chr2L	6877	7036
+chr2L	6883	7002
+chr2L	6890	7035
+chr2L	6894	7026
+chr2L	6909	7016
+chr2L	6910	7054
+chr2L	6907	7056
+chr2L	6915	7086
+chr2L	6915	7059
+chr2L	6919	7054
+chr2L	6921	7035
+chr2L	6922	7085
+chr2L	6925	7005
+chr2L	6925	7019
+chr2L	6928	7067
+chr2L	6929	7071
+chr2L	6932	7053
+chr2L	6933	7084
+chr2L	6930	7084
+chr2L	6930	7088
+chr2L	6933	7083
+chr2L	6934	7054
+chr2L	6936	7083
+chr2L	6933	7004
+chr2L	6935	7085
+chr2L	6936	7059
+chr2L	6939	7098
+chr2L	6939	7121
+chr2L	6937	7075
+chr2L	6937	7056
+chr2L	6937	7057
+chr2L	6939	7077
+chr2L	6942	7034
+chr2L	6947	7053
+chr2L	6945	7086
+chr2L	6945	7086
+chr2L	6951	7036
+chr2L	6960	7144
+chr2L	6960	7107
+chr2L	6965	7094
+chr2L	6965	7088
+chr2L	6969	7144
+chr2L	6966	7055
+chr2L	6966	7085
+chr2L	6969	7144
+chr2L	6967	7129
+chr2L	6970	7084
+chr2L	6970	7144
+chr2L	6967	7095
+chr2L	6974	7107
+chr2L	6974	7115
+chr2L	6975	7066
+chr2L	6972	7116
+chr2L	6972	7115
+chr2L	6972	7116
+chr2L	6975	7145
+chr2L	6973	7122
+chr2L	6976	7131
+chr2L	6976	7145
+chr2L	6973	7089
+chr2L	6976	7107
+chr2L	6973	7122
+chr2L	6979	7116
+chr2L	6982	7172
+chr2L	6980	7124
+chr2L	6984	7093
+chr2L	6984	7144
+chr2L	6985	7124
+chr2L	6985	7124
+chr2L	6985	7118
+chr2L	6985	7147
+chr2L	6985	7107
+chr2L	6989	7172
+chr2L	6987	7145
+chr2L	6987	7153
+chr2L	6987	7145
+chr2L	6987	7125
+chr2L	6994	7164
+chr2L	6996	7172
+chr2L	6998	7118
+chr2L	6998	7118
+chr2L	7000	7175
+chr2L	7003	7145
+chr2L	7000	7096
+chr2L	7000	7175
+chr2L	7005	7147
+chr2L	7017	7145
+chr2L	7015	7175
+chr2L	7016	7109
+chr2L	7017	7149
+chr2L	7017	7175
+chr2L	7020	7152
+chr2L	7017	7148
+chr2L	7017	7120
+chr2L	7017	7175
+chr2L	7017	7145
+chr2L	7023	7176
+chr2L	7027	7162
+chr2L	7027	7198
+chr2L	7027	7174
+chr2L	7024	7199
+chr2L	7027	7164
+chr2L	7027	7174
+chr2L	7027	7164
+chr2L	7024	7199
+chr2L	7025	7173
+chr2L	7028	7152
+chr2L	7025	7165
+chr2L	7031	7145
+chr2L	7031	7176
+chr2L	7031	7175
+chr2L	7034	7119
+chr2L	7034	7145
+chr2L	7032	7199
+chr2L	7035	7175
+chr2L	7032	7175
+chr2L	7032	7145
+chr2L	7040	7144
+chr2L	7039	7173
+chr2L	7039	7189
+chr2L	7039	7189
+chr2L	7039	7146
+chr2L	7042	7330
+chr2L	7039	7199
+chr2L	7039	7188
+chr2L	7042	7174
+chr2L	7042	7164
+chr2L	7042	7174
+chr2L	7043	7197
+chr2L	7043	7174
+chr2L	7043	7209
+chr2L	7040	7210
+chr2L	7043	7229
+chr2L	7040	7173
+chr2L	7043	7198
+chr2L	7040	7219
+chr2L	7040	7189
+chr2L	7051	7174
+chr2L	7051	7210
+chr2L	7051	7198
+chr2L	7051	7199
+chr2L	7052	7209
+chr2L	7055	7206
+chr2L	7052	7219
+chr2L	7063	7246
+chr2L	7068	7172
+chr2L	7068	7152
+chr2L	7065	7145
+chr2L	7065	7206
+chr2L	7066	7189
+chr2L	7067	7200
+chr2L	7070	7203
+chr2L	7067	7199
+chr2L	7075	7219
+chr2L	7076	7129
+chr2L	7077	7187
+chr2L	7077	7262
+chr2L	7077	7175
+chr2L	7075	7230
+chr2L	7078	7164
+chr2L	7078	7183
+chr2L	7076	7202
+chr2L	7079	7193
+chr2L	7079	7200
+chr2L	7077	7229
+chr2L	7083	7240
+chr2L	7080	7241
+chr2L	7084	7197
+chr2L	7085	7206
+chr2L	7085	7218
+chr2L	7085	7174
+chr2L	7086	7218
+chr2L	7092	7240
+chr2L	7096	7240
+chr2L	7093	7200
+chr2L	7095	7241
+chr2L	7099	7263
+chr2L	7102	7242
+chr2L	7105	7218
+chr2L	7105	7245
+chr2L	7107	7262
+chr2L	7105	7240
+chr2L	7108	7232
+chr2L	7108	7205
+chr2L	7105	7246
+chr2L	7105	7224
+chr2L	7108	7214
+chr2L	7105	7264
+chr2L	7108	7212
+chr2L	7107	7230
+chr2L	7110	7196
+chr2L	7107	7233
+chr2L	7110	7228
+chr2L	7111	7241
+chr2L	7112	7246
+chr2L	7127	7270
+chr2L	7127	7263
+chr2L	7130	7285
+chr2L	7130	7241
+chr2L	7131	7271
+chr2L	7131	7199
+chr2L	7131	7246
+chr2L	7131	7310
+chr2L	7132	7241
+chr2L	7135	7270
+chr2L	7135	7327
+chr2L	7132	7272
+chr2L	7132	7271
+chr2L	7135	7295
+chr2L	7132	7242
+chr2L	7139	7233
+chr2L	7142	7302
+chr2L	7143	7252
+chr2L	7143	7329
+chr2L	7143	7284
+chr2L	7143	7263
+chr2L	7142	7285
+chr2L	7145	7327
+chr2L	7145	7277
+chr2L	7152	7250
+chr2L	7156	7302
+chr2L	7153	7330
+chr2L	7158	7327
+chr2L	7158	7302
+chr2L	7156	7328
+chr2L	7156	7330
+chr2L	7156	7330
+chr2L	7159	7330
+chr2L	7161	7270
+chr2L	7162	7329
+chr2L	7160	7287
+chr2L	7163	7329
+chr2L	7160	7314
+chr2L	7163	7327
+chr2L	7163	7302
+chr2L	7165	7330
+chr2L	7162	7325
+chr2L	7162	7316
+chr2L	7165	7263
+chr2L	7162	7316
+chr2L	7168	7322
+chr2L	7170	7305
+chr2L	7173	7329
+chr2L	7171	7256
+chr2L	7172	7315
+chr2L	7175	7330
+chr2L	7172	7330
+chr2L	7180	7329
+chr2L	7185	7359
+chr2L	7182	7350
+chr2L	7186	7330
+chr2L	7186	7307
+chr2L	7186	7376
+chr2L	7189	7349
+chr2L	7189	7327
+chr2L	7186	7333
+chr2L	7189	7335
+chr2L	7187	7338
+chr2L	7190	7349
+chr2L	7187	7333
+chr2L	7187	7315
+chr2L	7187	7369
+chr2L	7194	7284
+chr2L	7192	7352
+chr2L	7192	7351
+chr2L	7196	7330
+chr2L	7196	7359
+chr2L	7194	7350
+chr2L	7197	7352
+chr2L	7206	7330
+chr2L	7211	7327
+chr2L	7211	7359
+chr2L	7212	7405
+chr2L	7220	7329
+chr2L	7218	7330
+chr2L	7226	7405
+chr2L	7227	7405
+chr2L	7227	7330
+chr2L	7230	7395
+chr2L	7230	7376
+chr2L	7227	7383
+chr2L	7230	7376
+chr2L	7227	7330
+chr2L	7228	7376
+chr2L	7228	7377
+chr2L	7228	7353
+chr2L	7231	7376
+chr2L	7231	7371
+chr2L	7228	7332
+chr2L	7228	7351
+chr2L	7228	7372
+chr2L	7228	7391
+chr2L	7241	7393
+chr2L	7238	7330
+chr2L	7241	7376
+chr2L	7238	7330
+chr2L	7238	7376
+chr2L	7238	7406
+chr2L	7238	7349
+chr2L	7238	7383
+chr2L	7241	7370
+chr2L	7242	7419
+chr2L	7242	7399
+chr2L	7239	7371
+chr2L	7242	7376
+chr2L	7242	7404
+chr2L	7239	7394
+chr2L	7239	7351
+chr2L	7239	7330
+chr2L	7246	7395
+chr2L	7259	7448
+chr2L	7259	7407
+chr2L	7259	7407
+chr2L	7259	7384
+chr2L	7259	7409
+chr2L	7260	7401
+chr2L	7263	7375
+chr2L	7263	7426
+chr2L	7260	7376
+chr2L	7260	7427
+chr2L	7260	7406
+chr2L	7271	7456
+chr2L	7272	7375
+chr2L	7272	7412
+chr2L	7272	7397
+chr2L	7272	7405
+chr2L	7272	7362
+chr2L	7272	7405
+chr2L	7273	7463
+chr2L	7270	7426
+chr2L	7273	7405
+chr2L	7273	7632
+chr2L	7276	7414
+chr2L	7279	7384
+chr2L	7280	7405
+chr2L	7277	7406
+chr2L	7280	7419
+chr2L	7277	7394
+chr2L	7280	7425
+chr2L	7280	7516
+chr2L	7280	7405
+chr2L	7280	7406
+chr2L	7283	7426
+chr2L	7280	7383
+chr2L	7280	7406
+chr2L	7281	7447
+chr2L	7281	7376
+chr2L	7284	7443
+chr2L	7281	7426
+chr2L	7281	7427
+chr2L	7281	7376
+chr2L	7285	7469
+chr2L	7293	7412
+chr2L	7300	7394
+chr2L	7303	7405
+chr2L	7301	7473
+chr2L	7304	7447
+chr2L	7304	7463
+chr2L	7304	7443
+chr2L	7305	7505
+chr2L	7302	7465
+chr2L	7308	7433
+chr2L	7311	7405
+chr2L	7312	7425
+chr2L	7318	7485
+chr2L	7315	7470
+chr2L	7320	7476
+chr2L	7320	7469
+chr2L	7320	7472
+chr2L	7317	7457
+chr2L	7317	7469
+chr2L	7318	7470
+chr2L	7321	7468
+chr2L	7323	7451
+chr2L	7320	7457
+chr2L	7323	7447
+chr2L	7328	7473
+chr2L	7327	7473
+chr2L	7338	7426
+chr2L	7342	7469
+chr2L	7339	7489
+chr2L	7339	7470
+chr2L	7339	7470
+chr2L	7340	7470
+chr2L	7340	7457
+chr2L	7344	7446
+chr2L	7342	7465
+chr2L	7342	7496
+chr2L	7345	7499
+chr2L	7346	7506
+chr2L	7346	7516
+chr2L	7346	7448
+chr2L	7343	7517
+chr2L	7343	7497
+chr2L	7343	7506
+chr2L	7346	7486
+chr2L	7343	7495
+chr2L	7343	7539
+chr2L	7343	7500
+chr2L	7343	7506
+chr2L	7348	7489
+chr2L	7348	7506
+chr2L	7348	7491
+chr2L	7345	7497
+chr2L	7345	7496
+chr2L	7345	7487
+chr2L	7348	7495
+chr2L	7345	7494
+chr2L	7348	7556
+chr2L	7345	7497
+chr2L	7349	7495
+chr2L	7346	7490
+chr2L	7346	7506
+chr2L	7346	7471
+chr2L	7346	7490
+chr2L	7346	7507
+chr2L	7349	7438
+chr2L	7349	7494
+chr2L	7346	7535
+chr2L	7346	7495
+chr2L	7349	7516
+chr2L	7349	7446
+chr2L	7346	7496
+chr2L	7349	7495
+chr2L	7349	7496
+chr2L	7351	7495
+chr2L	7349	7508
+chr2L	7358	7516
+chr2L	7359	7493
+chr2L	7360	7496
+chr2L	7358	7523
+chr2L	7358	7529
+chr2L	7358	7492
+chr2L	7361	7503
+chr2L	7361	7469
+chr2L	7361	7477
+chr2L	7361	7506
+chr2L	7358	7503
+chr2L	7361	7469
+chr2L	7361	7499
+chr2L	7358	7496
+chr2L	7358	7506
+chr2L	7360	7497
+chr2L	7364	7470
+chr2L	7368	7508
+chr2L	7365	7496
+chr2L	7368	7517
+chr2L	7368	7498
+chr2L	7369	7535
+chr2L	7372	7499
+chr2L	7372	7508
+chr2L	7372	7517
+chr2L	7372	7538
+chr2L	7373	7517
+chr2L	7376	7530
+chr2L	7377	7516
+chr2L	7377	7534
+chr2L	7374	7496
+chr2L	7374	7504
+chr2L	7374	7518
+chr2L	7374	7536
+chr2L	7378	7505
+chr2L	7375	7504
+chr2L	7375	7506
+chr2L	7375	7518
+chr2L	7385	7505
+chr2L	7386	7495
+chr2L	7386	7516
+chr2L	7383	7517
+chr2L	7383	7549
+chr2L	7383	7517
+chr2L	7383	7535
+chr2L	7386	7495
+chr2L	7394	7488
+chr2L	7391	7506
+chr2L	7391	7507
+chr2L	7391	7536
+chr2L	7394	7516
+chr2L	7391	7538
+chr2L	7394	7506
+chr2L	7391	7535
+chr2L	7396	7535
+chr2L	7393	7549
+chr2L	7394	7536
+chr2L	7400	7506
+chr2L	7402	7509
+chr2L	7400	7561
+chr2L	7403	7534
+chr2L	7403	7534
+chr2L	7400	7538
+chr2L	7403	7550
+chr2L	7405	7538
+chr2L	7405	7551
+chr2L	7406	7550
+chr2L	7409	7528
+chr2L	7409	7528
+chr2L	7415	7556
+chr2L	7415	7559
+chr2L	7416	7566
+chr2L	7418	7566
+chr2L	7422	7534
+chr2L	7423	7495
+chr2L	7423	7597
+chr2L	7423	7539
+chr2L	7426	7551
+chr2L	7426	7537
+chr2L	7423	7535
+chr2L	7423	7535
+chr2L	7426	7593
+chr2L	7427	7557
+chr2L	7427	7557
+chr2L	7427	7580
+chr2L	7425	7594
+chr2L	7425	7551
+chr2L	7428	7527
+chr2L	7426	7585
+chr2L	7432	7562
+chr2L	7433	7577
+chr2L	7438	7534
+chr2L	7438	7563
+chr2L	7437	7593
+chr2L	7445	7623
+chr2L	7445	7602
+chr2L	7446	7538
+chr2L	7454	7618
+chr2L	7454	7551
+chr2L	7455	7633
+chr2L	7463	7623
+chr2L	7470	7617
+chr2L	7471	7633
+chr2L	7468	7594
+chr2L	7468	7618
+chr2L	7477	7633
+chr2L	7477	7626
+chr2L	7477	7624
+chr2L	7480	7855
+chr2L	7483	7602
+chr2L	7483	7623
+chr2L	7481	7642
+chr2L	7484	7602
+chr2L	7483	7633
+chr2L	7486	7617
+chr2L	7483	7624
+chr2L	7487	7641
+chr2L	7484	7568
+chr2L	7487	7632
+chr2L	7484	7633
+chr2L	7487	7632
+chr2L	7484	7661
+chr2L	7487	7660
+chr2L	7484	7661
+chr2L	7487	7636
+chr2L	7484	7675
+chr2L	7489	7632
+chr2L	7489	7666
+chr2L	7494	7623
+chr2L	7494	7668
+chr2L	7495	7660
+chr2L	7492	7633
+chr2L	7492	7661
+chr2L	7495	7660
+chr2L	7497	7660
+chr2L	7495	7634
+chr2L	7505	7661
+chr2L	7505	7633
+chr2L	7506	7714
+chr2L	7511	7598
+chr2L	7514	7660
+chr2L	7513	7678
+chr2L	7517	7677
+chr2L	7514	7675
+chr2L	7517	7662
+chr2L	7514	7664
+chr2L	7514	7679
+chr2L	7514	7663
+chr2L	7514	7663
+chr2L	7517	7662
+chr2L	7514	7661
+chr2L	7517	7699
+chr2L	7517	7653
+chr2L	7518	7713
+chr2L	7515	7600
+chr2L	7515	7663
+chr2L	7515	7664
+chr2L	7515	7721
+chr2L	7515	7721
+chr2L	7518	7666
+chr2L	7521	7662
+chr2L	7521	7634
+chr2L	7521	7669
+chr2L	7524	7663
+chr2L	7524	7691
+chr2L	7524	7663
+chr2L	7524	7669
+chr2L	7521	7662
+chr2L	7521	7662
+chr2L	7521	7714
+chr2L	7525	7714
+chr2L	7522	7663
+chr2L	7525	7718
+chr2L	7525	7632
+chr2L	7522	7637
+chr2L	7522	7633
+chr2L	7522	7662
+chr2L	7522	7666
+chr2L	7522	7714
+chr2L	7525	7713
+chr2L	7522	7669
+chr2L	7525	7718
+chr2L	7522	7662
+chr2L	7526	7697
+chr2L	7530	7662
+chr2L	7527	7663
+chr2L	7530	7713
+chr2L	7527	7707
+chr2L	7544	7677
+chr2L	7545	7663
+chr2L	7542	7714
+chr2L	7542	7698
+chr2L	7546	7662
+chr2L	7546	7737
+chr2L	7543	7664
+chr2L	7546	7672
+chr2L	7549	7719
+chr2L	7550	7712
+chr2L	7550	7716
+chr2L	7547	7621
+chr2L	7548	7714
+chr2L	7548	7714
+chr2L	7551	7713
+chr2L	7551	7713
+chr2L	7551	7699
+chr2L	7548	7717
+chr2L	7551	7713
+chr2L	7551	7713
+chr2L	7552	7713
+chr2L	7549	7700
+chr2L	7552	7716
+chr2L	7552	7718
+chr2L	7555	7751
+chr2L	7558	7677
+chr2L	7558	7699
+chr2L	7556	7714
+chr2L	7556	7707
+chr2L	7559	7735
+chr2L	7559	7704
+chr2L	7559	7700
+chr2L	7563	7714
+chr2L	7560	7714
+chr2L	7561	7714
+chr2L	7561	7736
+chr2L	7561	7717
+chr2L	7561	7719
+chr2L	7564	7735
+chr2L	7561	7672
+chr2L	7564	7713
+chr2L	7561	7734
+chr2L	7564	7718
+chr2L	7561	7734
+chr2L	7564	7716
+chr2L	7565	7735
+chr2L	7566	7733
+chr2L	7566	7716
+chr2L	7563	7736
+chr2L	7568	7712
+chr2L	7569	7713
+chr2L	7569	7719
+chr2L	7569	7736
+chr2L	7572	7733
+chr2L	7569	7715
+chr2L	7573	7733
+chr2L	7573	7690
+chr2L	7573	7735
+chr2L	7570	7714
+chr2L	7573	7758
+chr2L	7571	7734
+chr2L	7574	7718
+chr2L	7572	7735
+chr2L	7575	7735
+chr2L	7572	7719
+chr2L	7575	7737
+chr2L	7575	7713
+chr2L	7575	7719
+chr2L	7576	7736
+chr2L	7585	7734
+chr2L	7588	7719
+chr2L	7592	7718
+chr2L	7599	7735
+chr2L	7599	7736
+chr2L	7603	7759
+chr2L	7603	7773
+chr2L	7603	7706
+chr2L	7606	7713
+chr2L	7603	7720
+chr2L	7606	7771
+chr2L	7609	7785
+chr2L	7609	7770
+chr2L	7606	7760
+chr2L	7610	7759
+chr2L	7607	7771
+chr2L	7607	7736
+chr2L	7610	7807
+chr2L	7607	7783
+chr2L	7607	7734
+chr2L	7610	7759
+chr2L	7607	7793
+chr2L	7610	7759
+chr2L	7608	7717
+chr2L	7608	7759
+chr2L	7618	7735
+chr2L	7620	7720
+chr2L	7626	7770
+chr2L	7623	7772
+chr2L	7627	7785
+chr2L	7630	7782
+chr2L	7627	7785
+chr2L	7631	7782
+chr2L	7628	7783
+chr2L	7628	7780
+chr2L	7631	7759
+chr2L	7629	7783
+chr2L	7642	7797
+chr2L	7639	7772
+chr2L	7641	7805
+chr2L	7644	7807
+chr2L	7644	7770
+chr2L	7642	7816
+chr2L	7648	7819
+chr2L	7645	7774
+chr2L	7648	7819
+chr2L	7646	7798
+chr2L	7646	7832
+chr2L	7646	7818
+chr2L	7651	7758
+chr2L	7669	7826
+chr2L	7669	7796
+chr2L	7669	7798
+chr2L	7669	7811
+chr2L	7669	7818
+chr2L	7677	7817
+chr2L	7674	7845
+chr2L	7678	7854
+chr2L	7675	7818
+chr2L	7675	7842
+chr2L	7678	7797
+chr2L	7678	7841
+chr2L	7675	7824
+chr2L	7675	7842
+chr2L	7675	7824
+chr2L	7684	7879
+chr2L	7684	7879
+chr2L	7681	7786
+chr2L	7684	7857
+chr2L	7681	7872
+chr2L	7684	7782
+chr2L	7694	7858
+chr2L	7705	7859
+chr2L	7707	7879
+chr2L	7707	7859
+chr2L	7707	7879
+chr2L	7709	7855
+chr2L	7712	7857
+chr2L	7712	7854
+chr2L	7716	7885
+chr2L	7727	7859
+chr2L	7729	7855
+chr2L	7726	7818
+chr2L	7730	7877
+chr2L	7731	7880
+chr2L	7728	7860
+chr2L	7731	7880
+chr2L	7729	7855
+chr2L	7730	7895
+chr2L	7730	7928
+chr2L	7733	7857
+chr2L	7733	7910
+chr2L	7733	7879
+chr2L	7733	7899
+chr2L	7730	7887
+chr2L	7730	7880
+chr2L	7732	7868
+chr2L	7740	7877
+chr2L	7740	7900
+chr2L	7740	7881
+chr2L	7740	7903
+chr2L	7743	7841
+chr2L	7743	7910
+chr2L	7743	7899
+chr2L	7740	7928
+chr2L	7743	7899
+chr2L	7743	7893
+chr2L	7744	7926
+chr2L	7744	7926
+chr2L	7744	7867
+chr2L	7741	7856
+chr2L	7744	7885
+chr2L	7742	7910
+chr2L	7743	7855
+chr2L	7763	7927
+chr2L	7763	7927
+chr2L	7768	7926
+chr2L	7766	7928
+chr2L	7766	7928
+chr2L	7766	7928
+chr2L	7769	7899
+chr2L	7766	7927
+chr2L	7769	7927
+chr2L	7770	7888
+chr2L	7777	7928
+chr2L	7777	7927
+chr2L	7777	7910
+chr2L	7777	7958
+chr2L	7777	7928
+chr2L	7781	7886
+chr2L	7781	7951
+chr2L	7781	7927
+chr2L	7779	7966
+chr2L	7782	7965
+chr2L	7783	7887
+chr2L	7789	7990
+chr2L	7792	7966
+chr2L	7793	8224
+chr2L	7793	7952
+chr2L	7793	7952
+chr2L	7793	7926
+chr2L	7793	7952
+chr2L	7793	7902
+chr2L	7790	7889
+chr2L	7790	7909
+chr2L	7792	7953
+chr2L	7792	7950
+chr2L	7792	7962
+chr2L	7793	7953
+chr2L	7796	7951
+chr2L	7793	8158
+chr2L	7795	7966
+chr2L	7802	7928
+chr2L	7805	7965
+chr2L	7811	8205
+chr2L	7811	7954
+chr2L	7810	7960
+chr2L	7816	7965
+chr2L	7816	7927
+chr2L	7818	8003
+chr2L	7822	7997
+chr2L	7827	8005
+chr2L	7826	7997
+chr2L	7829	8033
+chr2L	7832	8002
+chr2L	7832	8005
+chr2L	7829	8005
+chr2L	7829	8003
+chr2L	7834	8015
+chr2L	7834	8005
+chr2L	7849	8004
+chr2L	7852	8053
+chr2L	7853	8004
+chr2L	7853	8005
+chr2L	7854	7996
+chr2L	7851	8003
+chr2L	7857	7997
+chr2L	7866	8002
+chr2L	7863	8016
+chr2L	7864	8034
+chr2L	7866	8016
+chr2L	7869	8032
+chr2L	7869	8033
+chr2L	7870	8036
+chr2L	7870	8069
+chr2L	7874	8060
+chr2L	7883	8068
+chr2L	7883	8033
+chr2L	7887	8004
+chr2L	7887	8021
+chr2L	7884	8034
+chr2L	7887	8069
+chr2L	7887	8005
+chr2L	7894	8037
+chr2L	7895	8034
+chr2L	7892	8050
+chr2L	7895	8049
+chr2L	7892	8052
+chr2L	7892	8032
+chr2L	7908	8053
+chr2L	7908	8053
+chr2L	7905	8089
+chr2L	7913	8094
+chr2L	7914	8089
+chr2L	7914	8070
+chr2L	7917	8053
+chr2L	7917	8075
+chr2L	7917	8068
+chr2L	7916	8071
+chr2L	7916	8069
+chr2L	7916	8077
+chr2L	7916	8070
+chr2L	7916	8102
+chr2L	7919	8089
+chr2L	7921	8068
+chr2L	7924	8075
+chr2L	7930	8069
+chr2L	7934	8109
+chr2L	7934	8095
+chr2L	7931	8070
+chr2L	7934	8074
+chr2L	7931	8110
+chr2L	7934	8088
+chr2L	7931	8129
+chr2L	7934	8102
+chr2L	7934	8097
+chr2L	7931	8089
+chr2L	7931	8084
+chr2L	7932	8033
+chr2L	7935	8109
+chr2L	7932	8092
+chr2L	7932	8116
+chr2L	7935	8074
+chr2L	7935	8068
+chr2L	7935	8037
+chr2L	7933	8069
+chr2L	7933	8116
+chr2L	7936	8117
+chr2L	7933	8117
+chr2L	7936	8090
+chr2L	7937	8056
+chr2L	7947	8116
+chr2L	7957	8091
+chr2L	7954	8110
+chr2L	7954	8076
+chr2L	7958	8116
+chr2L	7955	8116
+chr2L	7955	8115
+chr2L	7955	8089
+chr2L	7961	8110
+chr2L	7958	8076
+chr2L	7958	8108
+chr2L	7961	8139
+chr2L	7961	8156
+chr2L	7963	8106
+chr2L	7962	8117
+chr2L	7965	8116
+chr2L	7968	8127
+chr2L	7965	8117
+chr2L	7970	8115
+chr2L	7970	8107
+chr2L	7977	8156
+chr2L	7974	8129
+chr2L	7977	8125
+chr2L	7974	8157
+chr2L	7974	8117
+chr2L	7974	8146
+chr2L	7974	8140
+chr2L	7978	8116
+chr2L	7978	8107
+chr2L	7979	8106
+chr2L	7984	8117
+chr2L	7987	8146
+chr2L	7984	8103
+chr2L	7987	8130
+chr2L	7993	8140
+chr2L	8003	8156
+chr2L	8005	8164
+chr2L	8007	8299
+chr2L	8013	8156
+chr2L	8014	8157
+chr2L	8014	8173
+chr2L	8014	8190
+chr2L	8014	8115
+chr2L	8011	8158
+chr2L	8014	8142
+chr2L	8012	8165
+chr2L	8012	8157
+chr2L	8012	8158
+chr2L	8013	8241
+chr2L	8013	8157
+chr2L	8016	8184
+chr2L	8016	8181
+chr2L	8016	8184
+chr2L	8014	8124
+chr2L	8014	8157
+chr2L	8021	8184
+chr2L	8022	8135
+chr2L	8020	8174
+chr2L	8020	8186
+chr2L	8023	8207
+chr2L	8020	8175
+chr2L	8020	8185
+chr2L	8020	8157
+chr2L	8023	8206
+chr2L	8023	8156
+chr2L	8020	8207
+chr2L	8023	8228
+chr2L	8020	8107
+chr2L	8023	8174
+chr2L	8020	8174
+chr2L	8020	8158
+chr2L	8024	8173
+chr2L	8025	8158
+chr2L	8028	8173
+chr2L	8029	8184
+chr2L	8029	8184
+chr2L	8030	8184
+chr2L	8040	8139
+chr2L	8045	8184
+chr2L	8042	8186
+chr2L	8046	8184
+chr2L	8043	8225
+chr2L	8046	8156
+chr2L	8043	8175
+chr2L	8043	8208
+chr2L	8046	8184
+chr2L	8047	8184
+chr2L	8047	8207
+chr2L	8061	8233
+chr2L	8058	8246
+chr2L	8062	8206
+chr2L	8062	8207
+chr2L	8081	8233
+chr2L	8079	8247
+chr2L	8079	8273
+chr2L	8083	8233
+chr2L	8080	8229
+chr2L	8083	8275
+chr2L	8082	8231
+chr2L	8085	8275
+chr2L	8082	8234
+chr2L	8085	8275
+chr2L	8082	8276
+chr2L	8082	8229
+chr2L	8089	8235
+chr2L	8089	8257
+chr2L	8091	8246
+chr2L	8096	8271
+chr2L	8099	8240
+chr2L	8100	8234
+chr2L	8100	8256
+chr2L	8102	8273
+chr2L	8105	8273
+chr2L	8105	8273
+chr2L	8112	8272
+chr2L	8113	8276
+chr2L	8115	8273
+chr2L	8115	8295
+chr2L	8115	8308
+chr2L	8115	8273
+chr2L	8118	8275
+chr2L	8124	8273
+chr2L	8122	8250
+chr2L	8126	8230
+chr2L	8128	8235
+chr2L	8132	8273
+chr2L	8133	8323
+chr2L	8133	8299
+chr2L	8133	8277
+chr2L	8136	8272
+chr2L	8137	8298
+chr2L	8134	8274
+chr2L	8137	8297
+chr2L	8134	8273
+chr2L	8134	8294
+chr2L	8137	8298
+chr2L	8134	8274
+chr2L	8137	8272
+chr2L	8137	8307
+chr2L	8135	8273
+chr2L	8138	8294
+chr2L	8138	8297
+chr2L	8138	8272
+chr2L	8138	8272
+chr2L	8135	8278
+chr2L	8139	8297
+chr2L	8139	8294
+chr2L	8139	8298
+chr2L	8139	8273
+chr2L	8147	8298
+chr2L	8144	8273
+chr2L	8144	8294
+chr2L	8144	8286
+chr2L	8144	8273
+chr2L	8147	8298
+chr2L	8144	8298
+chr2L	8147	8307
+chr2L	8148	8275
+chr2L	8148	8256
+chr2L	8145	8242
+chr2L	8145	8278
+chr2L	8148	8239
+chr2L	8145	8294
+chr2L	8145	8274
+chr2L	8145	8299
+chr2L	8148	8272
+chr2L	8146	8276
+chr2L	8146	8280
+chr2L	8149	8298
+chr2L	8154	8308
+chr2L	8154	8331
+chr2L	8156	8275
+chr2L	8158	8320
+chr2L	8165	8298
+chr2L	8165	8273
+chr2L	8165	8320
+chr2L	8162	8441
+chr2L	8166	8298
+chr2L	8166	8346
+chr2L	8166	8320
+chr2L	8167	8345
+chr2L	8164	8390
+chr2L	8164	8321
+chr2L	8167	8320
+chr2L	8164	8298
+chr2L	8164	8298
+chr2L	8164	8321
+chr2L	8164	8298
+chr2L	8164	8321
+chr2L	8167	8335
+chr2L	8164	8358
+chr2L	8164	8336
+chr2L	8167	8323
+chr2L	8167	8325
+chr2L	8164	8336
+chr2L	8173	8256
+chr2L	8170	8277
+chr2L	8173	8277
+chr2L	8174	8327
+chr2L	8181	8336
+chr2L	8184	8272
+chr2L	8185	8308
+chr2L	8185	8335
+chr2L	8185	8369
+chr2L	8185	8298
+chr2L	8182	8346
+chr2L	8186	8350
+chr2L	8190	8309
+chr2L	8190	8330
+chr2L	8190	8300
+chr2L	8191	8346
+chr2L	8191	8356
+chr2L	8194	8345
+chr2L	8191	8347
+chr2L	8194	8388
+chr2L	8191	8330
+chr2L	8193	8344
+chr2L	8193	8340
+chr2L	8196	8343
+chr2L	8193	8341
+chr2L	8193	8356
+chr2L	8196	8355
+chr2L	8210	8347
+chr2L	8214	8355
+chr2L	8214	8389
+chr2L	8214	8377
+chr2L	8211	8390
+chr2L	8214	8355
+chr2L	8214	8389
+chr2L	8223	8369
+chr2L	8223	8388
+chr2L	8220	8391
+chr2L	8223	8344
+chr2L	8227	8377
+chr2L	8224	8336
+chr2L	8225	8396
+chr2L	8229	8390
+chr2L	8234	8369
+chr2L	8234	8388
+chr2L	8234	8398
+chr2L	8233	8379
+chr2L	8233	8358
+chr2L	8239	8417
+chr2L	8239	8389
+chr2L	8244	8399
+chr2L	8244	8390
+chr2L	8247	8716
+chr2L	8247	8388
+chr2L	8248	8390
+chr2L	8248	8388
+chr2L	8248	8389
+chr2L	8248	8388
+chr2L	8248	8390
+chr2L	8248	8395
+chr2L	8252	8398
+chr2L	8252	8395
+chr2L	8249	8399
+chr2L	8249	8426
+chr2L	8262	8387
+chr2L	8265	8417
+chr2L	8265	8416
+chr2L	8262	8431
+chr2L	8265	8388
+chr2L	8262	8563
+chr2L	8266	8399
+chr2L	8266	8417
+chr2L	8279	8418
+chr2L	8283	8430
+chr2L	8284	8451
+chr2L	8283	8399
+chr2L	8286	8462
+chr2L	8283	8436
+chr2L	8285	8435
+chr2L	8285	8418
+chr2L	8286	8441
+chr2L	8289	8454
+chr2L	8289	8429
+chr2L	8286	8425
+chr2L	8286	8389
+chr2L	8289	8424
+chr2L	8289	8377
+chr2L	8289	8430
+chr2L	8289	8416
+chr2L	8286	8436
+chr2L	8289	8435
+chr2L	8289	8441
+chr2L	8289	8441
+chr2L	8289	8421
+chr2L	8289	8418
+chr2L	8289	8470
+chr2L	8289	8451
+chr2L	8289	8416
+chr2L	8288	8441
+chr2L	8288	8651
+chr2L	8288	8400
+chr2L	8288	8452
+chr2L	8288	8436
+chr2L	8290	8436
+chr2L	8294	8454
+chr2L	8294	8389
+chr2L	8294	8440
+chr2L	8291	8438
+chr2L	8294	8405
+chr2L	8294	8451
+chr2L	8295	8405
+chr2L	8300	8471
+chr2L	8306	8452
+chr2L	8306	8481
+chr2L	8307	8438
+chr2L	8307	8465
+chr2L	8307	8455
+chr2L	8307	8441
+chr2L	8307	8463
+chr2L	8310	8454
+chr2L	8310	8471
+chr2L	8310	8469
+chr2L	8310	8470
+chr2L	8307	8456
+chr2L	8307	8418
+chr2L	8313	8447
+chr2L	8311	8442
+chr2L	8313	8501
+chr2L	8328	8442
+chr2L	8337	8435
+chr2L	8338	8690
+chr2L	8338	8623
+chr2L	8335	8490
+chr2L	8340	8508
+chr2L	8340	8500
+chr2L	8345	8499
+chr2L	8345	8500
+chr2L	8342	8501
+chr2L	8346	8499
+chr2L	8346	8531
+chr2L	8343	8519
+chr2L	8346	8464
+chr2L	8354	8490
+chr2L	8357	8530
+chr2L	8357	8435
+chr2L	8354	8496
+chr2L	8357	8471
+chr2L	8357	8522
+chr2L	8355	8500
+chr2L	8355	8525
+chr2L	8358	8506
+chr2L	8358	8500
+chr2L	8355	8523
+chr2L	8355	8471
+chr2L	8355	8500
+chr2L	8358	8524
+chr2L	8358	8499
+chr2L	8355	8500
+chr2L	8358	8501
+chr2L	8360	8520
+chr2L	8360	8500
+chr2L	8360	8530
+chr2L	8366	8499
+chr2L	8363	8532
+chr2L	8366	8532
+chr2L	8371	8472
+chr2L	8384	8500
+chr2L	8387	8554
+chr2L	8385	8571
+chr2L	8386	8502
+chr2L	8396	8499
+chr2L	8397	8555
+chr2L	8394	8502
+chr2L	8396	8500
+chr2L	8396	8555
+chr2L	8402	8555
+chr2L	8402	8561
+chr2L	8402	8556
+chr2L	8402	8555
+chr2L	8402	8562
+chr2L	8403	8588
+chr2L	8403	8562
+chr2L	8403	8556
+chr2L	8406	8561
+chr2L	8406	8576
+chr2L	8408	8540
+chr2L	8408	8554
+chr2L	8409	8555
+chr2L	8406	8561
+chr2L	8409	8530
+chr2L	8406	8596
+chr2L	8411	8531
+chr2L	8408	8558
+chr2L	8411	8598
+chr2L	8412	8568
+chr2L	8412	8588
+chr2L	8412	8594
+chr2L	8409	8561
+chr2L	8409	8578
+chr2L	8409	8555
+chr2L	8409	8574
+chr2L	8409	8569
+chr2L	8411	8578
+chr2L	8411	8574
+chr2L	8411	8563
+chr2L	8414	8555
+chr2L	8415	8561
+chr2L	8423	8598
+chr2L	8424	8562
+chr2L	8421	8577
+chr2L	8427	8562
+chr2L	8427	8598
+chr2L	8427	8576
+chr2L	8425	8579
+chr2L	8425	8579
+chr2L	8430	8578
+chr2L	8435	8598
+chr2L	8433	8589
+chr2L	8436	8590
+chr2L	8433	8600
+chr2L	8433	8595
+chr2L	8433	8599
+chr2L	8433	8599
+chr2L	8438	8598
+chr2L	8438	8598
+chr2L	8438	8555
+chr2L	8441	8598
+chr2L	8440	8588
+chr2L	8443	8556
+chr2L	8443	8587
+chr2L	8444	8587
+chr2L	8441	8562
+chr2L	8445	8577
+chr2L	8446	8651
+chr2L	8446	8590
+chr2L	8446	8598
+chr2L	8447	8575
+chr2L	8447	8657
+chr2L	8450	8598
+chr2L	8447	8598
+chr2L	8447	8623
+chr2L	8447	8599
+chr2L	8450	8598
+chr2L	8447	8563
+chr2L	8450	8531
+chr2L	8447	8600
+chr2L	8447	8580
+chr2L	8447	8562
+chr2L	8447	8599
+chr2L	8447	8623
+chr2L	8450	8598
+chr2L	8450	8589
+chr2L	8450	8597
+chr2L	8450	8598
+chr2L	8447	8596
+chr2L	8450	8650
+chr2L	8447	8596
+chr2L	8451	8598
+chr2L	8450	8599
+chr2L	8450	8599
+chr2L	8450	8599
+chr2L	8450	8600
+chr2L	8453	8648
+chr2L	8455	8577
+chr2L	8458	8623
+chr2L	8458	8598
+chr2L	8458	8622
+chr2L	8455	8602
+chr2L	8461	8595
+chr2L	8458	8589
+chr2L	8458	8590
+chr2L	8459	8623
+chr2L	8459	8624
+chr2L	8462	8622
+chr2L	8462	8573
+chr2L	8462	8597
+chr2L	8459	8624
+chr2L	8462	8597
+chr2L	8460	8588
+chr2L	8460	8648
+chr2L	8465	8646
+chr2L	8465	8602
+chr2L	8470	8597
+chr2L	8471	8598
+chr2L	8468	8623
+chr2L	8471	8622
+chr2L	8471	8597
+chr2L	8468	8668
+chr2L	8471	8597
+chr2L	8476	8651
+chr2L	8477	8598
+chr2L	8478	8633
+chr2L	8481	8607
+chr2L	8483	8600
+chr2L	8486	8613
+chr2L	8498	8658
+chr2L	8501	8648
+chr2L	8498	8625
+chr2L	8498	8623
+chr2L	8501	8657
+chr2L	8501	8650
+chr2L	8507	8649
+chr2L	8508	8647
+chr2L	8508	8668
+chr2L	8505	8657
+chr2L	8508	8633
+chr2L	8507	8691
+chr2L	8507	8674
+chr2L	8510	8657
+chr2L	8513	8667
+chr2L	8516	8666
+chr2L	8516	8658
+chr2L	8516	8708
+chr2L	8513	8599
+chr2L	8517	8688
+chr2L	8517	8690
+chr2L	8514	8657
+chr2L	8517	8657
+chr2L	8516	8675
+chr2L	8519	8716
+chr2L	8519	8647
+chr2L	8516	8657
+chr2L	8519	8647
+chr2L	8518	8650
+chr2L	8521	8688
+chr2L	8522	8667
+chr2L	8528	8659
+chr2L	8529	8650
+chr2L	8532	8681
+chr2L	8533	8647
+chr2L	8534	8693
+chr2L	8538	8657
+chr2L	8536	8717
+chr2L	8539	8702
+chr2L	8539	8707
+chr2L	8541	8693
+chr2L	8538	8708
+chr2L	8538	8708
+chr2L	8541	8707
+chr2L	8541	8651
+chr2L	8538	8677
+chr2L	8543	8707
+chr2L	8540	8658
+chr2L	8540	8708
+chr2L	8540	8716
+chr2L	8552	8717
+chr2L	8563	8648
+chr2L	8564	8690
+chr2L	8565	8666
+chr2L	8565	8666
+chr2L	8571	8707
+chr2L	8571	8715
+chr2L	8571	8692
+chr2L	8568	8688
+chr2L	8568	8723
+chr2L	8571	8692
+chr2L	8569	8659
+chr2L	8569	8719
+chr2L	8569	8708
+chr2L	8573	8666
+chr2L	8574	8717
+chr2L	8571	8679
+chr2L	8574	8755
+chr2L	8573	8749
+chr2L	8584	8750
+chr2L	8587	8736
+chr2L	8587	8909
+chr2L	8584	8717
+chr2L	8588	8717
+chr2L	8588	8749
+chr2L	8588	8717
+chr2L	8587	8750
+chr2L	8596	8735
+chr2L	8593	8747
+chr2L	8596	8717
+chr2L	8607	8751
+chr2L	8611	8716
+chr2L	8611	8749
+chr2L	8613	8758
+chr2L	8610	8719
+chr2L	8611	8756
+chr2L	8611	8802
+chr2L	8614	8787
+chr2L	8614	8716
+chr2L	8611	8737
+chr2L	8614	8755
+chr2L	8611	8759
+chr2L	8614	8773
+chr2L	8614	8800
+chr2L	8614	8718
+chr2L	8614	8738
+chr2L	8619	8788
+chr2L	8616	8776
+chr2L	8617	8790
+chr2L	8621	8804
+chr2L	8621	8750
+chr2L	8626	8772
+chr2L	8630	8767
+chr2L	8632	8757
+chr2L	8634	8758
+chr2L	8635	8801
+chr2L	8633	8813
+chr2L	8636	8815
+chr2L	8636	8787
+chr2L	8641	8822
+chr2L	8638	8823
+chr2L	8668	8814
+chr2L	8668	8801
+chr2L	8668	8821
+chr2L	8668	8786
+chr2L	8665	8813
+chr2L	8665	8815
+chr2L	8668	8747
+chr2L	8665	8815
+chr2L	8668	8821
+chr2L	8665	8830
+chr2L	8665	8774
+chr2L	8668	8821
+chr2L	8666	8822
+chr2L	8666	8823
+chr2L	8669	8773
+chr2L	8666	8813
+chr2L	8666	8772
+chr2L	8669	8812
+chr2L	8669	8822
+chr2L	8669	8821
+chr2L	8666	8822
+chr2L	8669	8802
+chr2L	8672	8790
+chr2L	8676	8822
+chr2L	8679	8815
+chr2L	8682	8812
+chr2L	8682	8822
+chr2L	8682	8822
+chr2L	8684	8821
+chr2L	8684	8813
+chr2L	8685	8822
+chr2L	8685	8830
+chr2L	8689	8849
+chr2L	8690	8802
+chr2L	8690	8869
+chr2L	8690	8815
+chr2L	8690	8888
+chr2L	8688	8879
+chr2L	8694	8822
+chr2L	8701	8821
+chr2L	8701	8852
+chr2L	8698	8888
+chr2L	8698	8888
+chr2L	8702	8869
+chr2L	8703	8822
+chr2L	8703	8822
+chr2L	8708	8871
+chr2L	8710	8871
+chr2L	8712	8897
+chr2L	8712	8870
+chr2L	8716	8871
+chr2L	8716	8821
+chr2L	8716	8865
+chr2L	8713	8870
+chr2L	8713	8871
+chr2L	8716	8822
+chr2L	8716	8821
+chr2L	8716	8869
+chr2L	8713	8870
+chr2L	8713	8870
+chr2L	8716	8870
+chr2L	8716	8870
+chr2L	8716	9038
+chr2L	8722	8870
+chr2L	8725	8870
+chr2L	8726	8854
+chr2L	8726	8888
+chr2L	8729	8829
+chr2L	8726	8888
+chr2L	8727	8882
+chr2L	8727	8888
+chr2L	8730	8887
+chr2L	8730	8878
+chr2L	8727	8913
+chr2L	8730	8852
+chr2L	8727	8862
+chr2L	8727	8888
+chr2L	8730	8911
+chr2L	8730	8865
+chr2L	8730	8887
+chr2L	8727	8888
+chr2L	8730	8896
+chr2L	8727	8871
+chr2L	8733	8912
+chr2L	8736	8911
+chr2L	8736	8897
+chr2L	8734	8888
+chr2L	8737	8897
+chr2L	8734	8912
+chr2L	8734	8926
+chr2L	8734	9061
+chr2L	8739	8847
+chr2L	8740	8889
+chr2L	8744	8897
+chr2L	8745	8912
+chr2L	8742	8889
+chr2L	8744	8898
+chr2L	8755	8912
+chr2L	8755	8870
+chr2L	8756	8888
+chr2L	8764	8896
+chr2L	8764	8909
+chr2L	8762	8913
+chr2L	8765	8887
+chr2L	8765	8925
+chr2L	8762	8894
+chr2L	8765	8925
+chr2L	8764	8897
+chr2L	8767	8911
+chr2L	8765	8897
+chr2L	8768	8960
+chr2L	8768	8912
+chr2L	8768	8945
+chr2L	8765	8912
+chr2L	8765	8960
+chr2L	8768	8936
+chr2L	8768	8959
+chr2L	8768	8911
+chr2L	8765	8906
+chr2L	8767	8912
+chr2L	8767	8898
+chr2L	8770	8959
+chr2L	8773	8925
+chr2L	8774	8959
+chr2L	8771	8870
+chr2L	8777	8959
+chr2L	8779	8945
+chr2L	8781	8962
+chr2L	8783	8990
+chr2L	8780	8913
+chr2L	8781	8961
+chr2L	8781	8960
+chr2L	8782	8964
+chr2L	8785	8962
+chr2L	8792	8978
+chr2L	8796	8983
+chr2L	8801	8989
+chr2L	8802	8974
+chr2L	8802	8960
+chr2L	8799	8960
+chr2L	8808	8963
+chr2L	8808	8960
+chr2L	8821	8959
+chr2L	8819	8960
+chr2L	8819	8983
+chr2L	8822	8963
+chr2L	8829	8959
+chr2L	8829	8977
+chr2L	8830	8988
+chr2L	8827	8975
+chr2L	8830	8977
+chr2L	8831	8982
+chr2L	8828	8978
+chr2L	8831	8977
+chr2L	8831	8989
+chr2L	8831	8959
+chr2L	8828	8978
+chr2L	8831	8989
+chr2L	8829	9054
+chr2L	8830	8961
+chr2L	8833	8987
+chr2L	8830	8991
+chr2L	8832	8960
+chr2L	8833	9177
+chr2L	8837	8989
+chr2L	8834	8991
+chr2L	8837	8990
+chr2L	8839	8996
+chr2L	8839	8989
+chr2L	8837	8989
+chr2L	8840	8959
+chr2L	8840	8992
+chr2L	8837	8960
+chr2L	8840	9033
+chr2L	8837	8989
+chr2L	8837	8992
+chr2L	8837	8989
+chr2L	8841	9020
+chr2L	8841	8990
+chr2L	8843	8990
+chr2L	8840	8993
+chr2L	8855	8982
+chr2L	8867	9026
+chr2L	8865	9013
+chr2L	8868	9039
+chr2L	8878	8982
+chr2L	8875	9053
+chr2L	8875	9037
+chr2L	8875	9036
+chr2L	8875	9062
+chr2L	8875	9022
+chr2L	8879	9039
+chr2L	8876	9061
+chr2L	8876	9036
+chr2L	8876	9041
+chr2L	8879	9041
+chr2L	8876	9027
+chr2L	8878	9039
+chr2L	8894	9041
+chr2L	8894	9041
+chr2L	8892	9095
+chr2L	8892	9042
+chr2L	8897	9053
+chr2L	8897	9036
+chr2L	8897	9055
+chr2L	8894	9042
+chr2L	8894	8997
+chr2L	8903	9032
+chr2L	8900	9057
+chr2L	8906	9060
+chr2L	8903	9061
+chr2L	8906	9056
+chr2L	8908	9096
+chr2L	8909	9036
+chr2L	8909	9054
+chr2L	8909	9042
+chr2L	8909	9054
+chr2L	8909	8991
+chr2L	8913	9073
+chr2L	8914	9001
+chr2L	8919	9073
+chr2L	8919	9073
+chr2L	8916	9040
+chr2L	8920	9042
+chr2L	8920	9074
+chr2L	8920	9096
+chr2L	8917	9081
+chr2L	8918	9083
+chr2L	8918	9097
+chr2L	8921	9041
+chr2L	8921	9035
+chr2L	8918	9096
+chr2L	8921	9060
+chr2L	8921	9063
+chr2L	8918	9102
+chr2L	8918	9088
+chr2L	8921	9062
+chr2L	8921	9080
+chr2L	8918	9059
+chr2L	8921	9033
+chr2L	8921	9116
+chr2L	8922	9058
+chr2L	8919	9096
+chr2L	8922	9081
+chr2L	8925	9083
+chr2L	8929	9038
+chr2L	8931	9095
+chr2L	8928	9097
+chr2L	8938	9116
+chr2L	8935	9096
+chr2L	8942	9096
+chr2L	8940	9118
+chr2L	8953	9118
+chr2L	8950	9097
+chr2L	8950	9114
+chr2L	8953	9102
+chr2L	8957	9117
+chr2L	8966	9094
+chr2L	8969	9102
+chr2L	8966	9132
+chr2L	8969	9118
+chr2L	8966	9155
+chr2L	8966	9119
+chr2L	8967	9103
+chr2L	8970	9119
+chr2L	8970	9116
+chr2L	8967	9117
+chr2L	8970	9116
+chr2L	8970	9101
+chr2L	8970	9095
+chr2L	8970	9118
+chr2L	8970	9118
+chr2L	8969	9104
+chr2L	8974	9101
+chr2L	8971	9117
+chr2L	8974	9119
+chr2L	8974	9102
+chr2L	8972	9117
+chr2L	8972	9130
+chr2L	8972	9139
+chr2L	8972	9096
+chr2L	8975	9084
+chr2L	8972	9102
+chr2L	8975	9179
+chr2L	8981	9154
+chr2L	8981	9179
+chr2L	8989	9120
+chr2L	8988	9179
+chr2L	8994	9147
+chr2L	8996	9179
+chr2L	8996	9153
+chr2L	8996	9095
+chr2L	8996	9154
+chr2L	9000	9094
+chr2L	9000	9086
+chr2L	9000	9103
+chr2L	8997	9096
+chr2L	8997	9177
+chr2L	8999	9177
+chr2L	8999	9120
+chr2L	8999	9180
+chr2L	8999	9168
+chr2L	9003	9176
+chr2L	9001	9102
+chr2L	9006	9153
+chr2L	9004	9168
+chr2L	9004	9158
+chr2L	9004	9148
+chr2L	9004	9117
+chr2L	9004	9119
+chr2L	9007	9154
+chr2L	9007	9176
+chr2L	9008	9217
+chr2L	9008	9178
+chr2L	9005	9177
+chr2L	9005	9180
+chr2L	9005	9156
+chr2L	9010	9178
+chr2L	9013	9181
+chr2L	9014	9167
+chr2L	9011	9177
+chr2L	9016	9136
+chr2L	9017	9180
+chr2L	9018	9177
+chr2L	9029	9176
+chr2L	9029	9199
+chr2L	9041	9189
+chr2L	9042	9176
+chr2L	9039	9180
+chr2L	9042	9219
+chr2L	9044	9198
+chr2L	9050	9206
+chr2L	9047	9199
+chr2L	9050	9180
+chr2L	9053	9178
+chr2L	9050	9219
+chr2L	9062	9169
+chr2L	9070	9229
+chr2L	9071	9179
+chr2L	9068	9179
+chr2L	9071	9198
+chr2L	9068	9219
+chr2L	9068	9168
+chr2L	9070	9199
+chr2L	9070	9236
+chr2L	9073	9217
+chr2L	9073	9176
+chr2L	9070	9316
+chr2L	9074	9246
+chr2L	9074	9178
+chr2L	9074	9206
+chr2L	9074	9206
+chr2L	9079	9236
+chr2L	9086	9219
+chr2L	9086	9219
+chr2L	9087	9184
+chr2L	9092	9198
+chr2L	9093	9178
+chr2L	9093	9249
+chr2L	9093	9198
+chr2L	9091	9323
+chr2L	9094	9229
+chr2L	9094	9246
+chr2L	9092	9236
+chr2L	9092	9249
+chr2L	9097	9297
+chr2L	9097	9206
+chr2L	9111	9212
+chr2L	9111	9278
+chr2L	9108	9281
+chr2L	9108	9220
+chr2L	9108	9253
+chr2L	9108	9228
+chr2L	9108	9297
+chr2L	9111	9264
+chr2L	9113	9297
+chr2L	9112	9297
+chr2L	9115	9198
+chr2L	9115	9264
+chr2L	9115	9241
+chr2L	9119	9279
+chr2L	9123	9287
+chr2L	9124	9307
+chr2L	9127	9271
+chr2L	9128	9315
+chr2L	9125	9276
+chr2L	9129	9268
+chr2L	9129	9313
+chr2L	9129	9296
+chr2L	9126	9307
+chr2L	9130	9279
+chr2L	9127	9252
+chr2L	9132	9297
+chr2L	9129	9282
+chr2L	9135	9275
+chr2L	9137	9318
+chr2L	9141	9296
+chr2L	9138	9309
+chr2L	9140	9298
+chr2L	9140	9298
+chr2L	9140	9309
+chr2L	9141	9310
+chr2L	9141	9314
+chr2L	9144	9308
+chr2L	9144	9275
+chr2L	9144	9313
+chr2L	9144	9280
+chr2L	9151	9297
+chr2L	9158	9269
+chr2L	9160	9314
+chr2L	9161	9314
+chr2L	9165	9341
+chr2L	9163	9272
+chr2L	9166	9315
+chr2L	9167	9275
+chr2L	9170	9297
+chr2L	9174	9331
+chr2L	9174	9309
+chr2L	9186	9357
+chr2L	9186	9357
+chr2L	9184	9323
+chr2L	9188	9355
+chr2L	9185	9314
+chr2L	9185	9358
+chr2L	9186	9331
+chr2L	9189	9355
+chr2L	9186	9315
+chr2L	9186	9351
+chr2L	9189	9374
+chr2L	9189	9313
+chr2L	9189	9331
+chr2L	9186	9317
+chr2L	9189	9340
+chr2L	9189	9340
+chr2L	9186	9358
+chr2L	9187	9331
+chr2L	9187	9355
+chr2L	9190	9341
+chr2L	9187	9327
+chr2L	9187	9379
+chr2L	9190	9331
+chr2L	9190	9319
+chr2L	9187	9358
+chr2L	9187	9365
+chr2L	9190	9315
+chr2L	9191	9330
+chr2L	9188	9340
+chr2L	9191	9350
+chr2L	9188	9380
+chr2L	9191	9296
+chr2L	9193	9374
+chr2L	9190	9374
+chr2L	9190	9351
+chr2L	9195	9341
+chr2L	9192	9355
+chr2L	9194	9379
+chr2L	9198	9354
+chr2L	9198	9364
+chr2L	9198	9308
+chr2L	9195	9365
+chr2L	9195	9355
+chr2L	9197	9365
+chr2L	9200	9317
+chr2L	9207	9430
+chr2L	9207	9308
+chr2L	9204	9355
+chr2L	9208	9373
+chr2L	9208	9378
+chr2L	9206	9379
+chr2L	9210	9366
+chr2L	9210	9380
+chr2L	9213	9378
+chr2L	9213	9339
+chr2L	9210	9375
+chr2L	9213	9339
+chr2L	9211	9380
+chr2L	9211	9380
+chr2L	9211	9374
+chr2L	9211	9374
+chr2L	9215	9378
+chr2L	9215	9378
+chr2L	9218	9308
+chr2L	9220	9350
+chr2L	9227	9375
+chr2L	9227	9379
+chr2L	9229	9354
+chr2L	9232	9378
+chr2L	9232	9378
+chr2L	9229	9420
+chr2L	9232	9379
+chr2L	9233	9379
+chr2L	9233	9379
+chr2L	9233	9316
+chr2L	9235	9313
+chr2L	9235	9379
+chr2L	9236	9418
+chr2L	9236	9383
+chr2L	9234	9420
+chr2L	9234	9420
+chr2L	9238	9418
+chr2L	9245	9414
+chr2L	9242	9419
+chr2L	9242	9419
+chr2L	9244	9380
+chr2L	9244	9438
+chr2L	9247	9427
+chr2L	9248	9419
+chr2L	9245	9428
+chr2L	9245	9420
+chr2L	9248	9459
+chr2L	9252	9379
+chr2L	9251	9407
+chr2L	9254	9405
+chr2L	9251	9419
+chr2L	9252	9405
+chr2L	9255	9420
+chr2L	9259	9418
+chr2L	9256	9419
+chr2L	9260	9404
+chr2L	9260	9418
+chr2L	9257	9405
+chr2L	9257	9418
+chr2L	9260	9427
+chr2L	9270	9451
+chr2L	9272	9419
+chr2L	9277	9430
+chr2L	9277	9418
+chr2L	9277	9419
+chr2L	9279	9430
+chr2L	9278	9459
+chr2L	9281	9452
+chr2L	9284	9420
+chr2L	9284	9444
+chr2L	9285	9419
+chr2L	9288	9418
+chr2L	9288	9432
+chr2L	9288	9478
+chr2L	9289	9440
+chr2L	9287	9440
+chr2L	9287	9440
+chr2L	9290	9458
+chr2L	9289	9483
+chr2L	9289	9440
+chr2L	9289	9420
+chr2L	9289	9448
+chr2L	9292	9464
+chr2L	9294	9449
+chr2L	9291	9433
+chr2L	9307	9478
+chr2L	9304	9430
+chr2L	9307	9432
+chr2L	9307	9449
+chr2L	9304	9440
+chr2L	9304	9462
+chr2L	9307	9604
+chr2L	9304	9495
+chr2L	9307	9451
+chr2L	9306	9479
+chr2L	9306	9460
+chr2L	9306	9459
+chr2L	9306	9480
+chr2L	9309	9458
+chr2L	9313	9479
+chr2L	9313	9448
+chr2L	9317	9458
+chr2L	9316	9483
+chr2L	9323	9481
+chr2L	9320	9419
+chr2L	9320	9458
+chr2L	9323	9447
+chr2L	9324	9478
+chr2L	9324	9479
+chr2L	9324	9479
+chr2L	9327	9464
+chr2L	9331	9528
+chr2L	9333	9489
+chr2L	9330	9452
+chr2L	9333	9464
+chr2L	9333	9418
+chr2L	9331	9490
+chr2L	9334	9479
+chr2L	9334	9494
+chr2L	9333	9445
+chr2L	9333	9479
+chr2L	9335	9482
+chr2L	9339	9488
+chr2L	9342	9478
+chr2L	9342	9427
+chr2L	9339	9648
+chr2L	9342	9461
+chr2L	9340	9502
+chr2L	9343	9504
+chr2L	9344	9488
+chr2L	9344	9517
+chr2L	9346	9493
+chr2L	9344	9457
+chr2L	9346	9505
+chr2L	9349	9528
+chr2L	9346	9463
+chr2L	9346	9506
+chr2L	9350	9516
+chr2L	9351	9493
+chr2L	9350	9506
+chr2L	9353	9465
+chr2L	9356	9505
+chr2L	9357	9506
+chr2L	9366	9526
+chr2L	9366	9478
+chr2L	9366	9526
+chr2L	9363	9504
+chr2L	9366	9479
+chr2L	9363	9516
+chr2L	9363	9529
+chr2L	9363	9527
+chr2L	9368	9479
+chr2L	9373	9529
+chr2L	9374	9528
+chr2L	9374	9528
+chr2L	9374	9523
+chr2L	9373	9504
+chr2L	9377	9527
+chr2L	9380	9546
+chr2L	9380	9569
+chr2L	9381	9531
+chr2L	9378	9529
+chr2L	9385	9527
+chr2L	9388	9524
+chr2L	9389	9583
+chr2L	9393	9563
+chr2L	9393	9506
+chr2L	9396	9569
+chr2L	9396	9516
+chr2L	9396	9488
+chr2L	9396	9526
+chr2L	9396	9554
+chr2L	9397	9546
+chr2L	9394	9518
+chr2L	9397	9494
+chr2L	9397	9547
+chr2L	9397	9541
+chr2L	9397	9569
+chr2L	9397	9570
+chr2L	9396	9559
+chr2L	9399	9569
+chr2L	9396	9517
+chr2L	9396	9524
+chr2L	9399	9548
+chr2L	9399	9548
+chr2L	9409	9570
+chr2L	9410	9531
+chr2L	9413	9582
+chr2L	9413	9562
+chr2L	9410	9531
+chr2L	9412	9529
+chr2L	9412	9564
+chr2L	9415	9569
+chr2L	9415	9558
+chr2L	9415	9526
+chr2L	9415	9559
+chr2L	9424	9531
+chr2L	9424	9564
+chr2L	9427	9583
+chr2L	9431	9565
+chr2L	9431	9574
+chr2L	9434	9615
+chr2L	9432	9601
+chr2L	9438	9532
+chr2L	9438	9583
+chr2L	9438	9583
+chr2L	9441	9562
+chr2L	9441	9582
+chr2L	9443	9562
+chr2L	9443	9560
+chr2L	9444	9596
+chr2L	9447	9579
+chr2L	9450	9616
+chr2L	9447	9621
+chr2L	9448	9619
+chr2L	9451	9583
+chr2L	9451	9546
+chr2L	9451	9575
+chr2L	9448	9621
+chr2L	9451	9614
+chr2L	9448	9589
+chr2L	9451	9600
+chr2L	9448	9527
+chr2L	9448	9616
+chr2L	9448	9592
+chr2L	9451	9569
+chr2L	9452	9604
+chr2L	9450	9597
+chr2L	9454	9597
+chr2L	9457	9603
+chr2L	9458	9582
+chr2L	9456	9615
+chr2L	9459	9603
+chr2L	9459	9603
+chr2L	9456	9615
+chr2L	9456	9605
+chr2L	9459	9638
+chr2L	9456	9605
+chr2L	9456	9595
+chr2L	9461	9582
+chr2L	9461	9582
+chr2L	9462	9615
+chr2L	9459	9588
+chr2L	9459	9616
+chr2L	9459	9622
+chr2L	9465	9630
+chr2L	9467	9582
+chr2L	9464	9604
+chr2L	9465	9583
+chr2L	9468	9603
+chr2L	9468	9622
+chr2L	9472	9631
+chr2L	9470	9588
+chr2L	9473	9591
+chr2L	9470	9597
+chr2L	9474	9597
+chr2L	9476	9582
+chr2L	9474	9649
+chr2L	9474	9647
+chr2L	9478	9621
+chr2L	9478	9620
+chr2L	9475	9616
+chr2L	9478	9583
+chr2L	9475	9647
+chr2L	9478	9595
+chr2L	9476	9633
+chr2L	9476	9638
+chr2L	9479	9590
+chr2L	9476	9632
+chr2L	9479	9615
+chr2L	9476	9631
+chr2L	9479	9638
+chr2L	9479	9603
+chr2L	9479	9647
+chr2L	9476	9669
+chr2L	9479	9614
+chr2L	9479	9643
+chr2L	9476	9604
+chr2L	9479	9631
+chr2L	9476	9668
+chr2L	9479	9630
+chr2L	9484	9647
+chr2L	9484	9614
+chr2L	9481	9594
+chr2L	9482	9616
+chr2L	9482	9648
+chr2L	9482	9631
+chr2L	9489	9639
+chr2L	9493	9604
+chr2L	9492	9669
+chr2L	9495	9643
+chr2L	9495	9630
+chr2L	9496	9630
+chr2L	9493	9640
+chr2L	9496	9668
+chr2L	9493	9636
+chr2L	9496	9647
+chr2L	9493	9647
+chr2L	9493	9584
+chr2L	9496	9646
+chr2L	9496	9629
+chr2L	9493	9626
+chr2L	9499	9668
+chr2L	9502	9639
+chr2L	9499	9647
+chr2L	9499	9632
+chr2L	9502	9657
+chr2L	9500	9669
+chr2L	9500	9615
+chr2L	9500	9647
+chr2L	9507	9621
+chr2L	9513	9682
+chr2L	9513	9664
+chr2L	9516	9668
+chr2L	9516	9659
+chr2L	9516	9667
+chr2L	9513	9669
+chr2L	9513	9663
+chr2L	9516	9688
+chr2L	9516	9644
+chr2L	9516	9639
+chr2L	9516	9667
+chr2L	9514	9644
+chr2L	9514	9686
+chr2L	9514	9663
+chr2L	9514	9668
+chr2L	9517	9662
+chr2L	9514	9658
+chr2L	9517	9651
+chr2L	9521	9669
+chr2L	9521	9668
+chr2L	9524	9668
+chr2L	9526	9668
+chr2L	9538	9646
+chr2L	9535	9682
+chr2L	9536	9678
+chr2L	9540	9664
+chr2L	9542	9668
+chr2L	9539	9681
+chr2L	9545	9693
+chr2L	9546	9729
+chr2L	9546	9640
+chr2L	9550	9709
+chr2L	9547	9660
+chr2L	9550	9682
+chr2L	9547	9655
+chr2L	9553	9680
+chr2L	9554	9701
+chr2L	9551	9686
+chr2L	9551	9700
+chr2L	9551	9663
+chr2L	9554	9687
+chr2L	9551	9731
+chr2L	9551	9729
+chr2L	9551	9686
+chr2L	9552	9695
+chr2L	9555	9684
+chr2L	9552	9664
+chr2L	9555	9695
+chr2L	9555	9702
+chr2L	9555	9709
+chr2L	9554	9685
+chr2L	9554	9672
+chr2L	9554	9700
+chr2L	9555	9647
+chr2L	9561	9709
+chr2L	9561	9699
+chr2L	9568	9696
+chr2L	9568	9712
+chr2L	9568	9742
+chr2L	9571	9711
+chr2L	9568	9702
+chr2L	9569	9710
+chr2L	9572	9709
+chr2L	9572	9722
+chr2L	9577	9678
+chr2L	9583	9759
+chr2L	9580	9724
+chr2L	9583	9715
+chr2L	9583	9741
+chr2L	9580	9732
+chr2L	9580	9703
+chr2L	9580	9749
+chr2L	9580	9748
+chr2L	9583	9712
+chr2L	9580	9711
+chr2L	9580	9749
+chr2L	9580	9731
+chr2L	9591	9765
+chr2L	9595	9737
+chr2L	9595	9742
+chr2L	9598	9748
+chr2L	9595	9712
+chr2L	9598	9893
+chr2L	9599	9720
+chr2L	9599	9747
+chr2L	9596	9695
+chr2L	9599	9760
+chr2L	9602	9740
+chr2L	9605	9711
+chr2L	9606	9750
+chr2L	9606	9739
+chr2L	9606	9741
+chr2L	9603	9745
+chr2L	9606	9711
+chr2L	9606	9742
+chr2L	9609	9760
+chr2L	9611	9731
+chr2L	9614	9742
+chr2L	9611	9742
+chr2L	9612	9787
+chr2L	9612	9795
+chr2L	9612	9741
+chr2L	9615	9712
+chr2L	9615	9740
+chr2L	9613	9723
+chr2L	9616	9759
+chr2L	9613	9760
+chr2L	9613	9745
+chr2L	9616	9874
+chr2L	9616	9768
+chr2L	9613	9771
+chr2L	9616	9792
+chr2L	9613	9787
+chr2L	9613	9742
+chr2L	9613	9761
+chr2L	9613	9788
+chr2L	9616	9883
+chr2L	9613	9787
+chr2L	9618	9759
+chr2L	9621	9744
+chr2L	9621	9744
+chr2L	9619	9741
+chr2L	9623	9792
+chr2L	9623	9760
+chr2L	9624	9761
+chr2L	9625	9777
+chr2L	9626	9787
+chr2L	9626	9771
+chr2L	9629	9787
+chr2L	9629	9792
+chr2L	9627	9769
+chr2L	9631	9792
+chr2L	9631	9770
+chr2L	9628	9772
+chr2L	9628	9787
+chr2L	9628	9787
+chr2L	9628	9793
+chr2L	9628	9787
+chr2L	9628	9723
+chr2L	9628	9788
+chr2L	9629	9771
+chr2L	9632	9777
+chr2L	9629	9794
+chr2L	9632	9787
+chr2L	9629	9748
+chr2L	9638	9786
+chr2L	9635	9840
+chr2L	9638	9722
+chr2L	9638	9844
+chr2L	9641	9806
+chr2L	9638	9773
+chr2L	9643	9788
+chr2L	9652	9815
+chr2L	9654	9806
+chr2L	9654	9770
+chr2L	9657	9789
+chr2L	9654	9816
+chr2L	9657	9797
+chr2L	9654	9841
+chr2L	9654	9814
+chr2L	9658	9806
+chr2L	9655	9834
+chr2L	9655	9834
+chr2L	9655	9841
+chr2L	9655	9742
+chr2L	9655	9742
+chr2L	9655	9788
+chr2L	9657	9855
+chr2L	9657	9807
+chr2L	9660	9794
+chr2L	9662	9765
+chr2L	9663	9810
+chr2L	9663	9816
+chr2L	9668	9771
+chr2L	9669	9806
+chr2L	9667	9816
+chr2L	9670	9840
+chr2L	9671	9792
+chr2L	9671	9809
+chr2L	9671	9853
+chr2L	9668	9816
+chr2L	9668	9816
+chr2L	9677	9816
+chr2L	9677	9815
+chr2L	9675	9784
+chr2L	9676	9832
+chr2L	9677	9835
+chr2L	9677	9751
+chr2L	9677	9826
+chr2L	9679	9788
+chr2L	9679	9788
+chr2L	9679	9874
+chr2L	9684	9837
+chr2L	9684	9809
+chr2L	9681	9851
+chr2L	9681	9832
+chr2L	9684	9809
+chr2L	9684	9837
+chr2L	9685	9816
+chr2L	9684	9874
+chr2L	9684	9834
+chr2L	9687	9835
+chr2L	9687	9855
+chr2L	9687	9805
+chr2L	9687	9840
+chr2L	9690	9882
+chr2L	9690	9838
+chr2L	9688	9790
+chr2L	9692	9844
+chr2L	9695	9853
+chr2L	9692	9816
+chr2L	9692	9842
+chr2L	9695	9884
+chr2L	9697	9835
+chr2L	9701	9833
+chr2L	9701	9837
+chr2L	9698	9888
+chr2L	9698	9838
+chr2L	9699	9840
+chr2L	9699	9851
+chr2L	9704	9839
+chr2L	9701	9834
+chr2L	9704	9833
+chr2L	9701	9807
+chr2L	9705	9850
+chr2L	9702	9851
+chr2L	9702	9832
+chr2L	9705	9849
+chr2L	9707	9794
+chr2L	9711	9831
+chr2L	9711	9831
+chr2L	9711	9815
+chr2L	9708	9857
+chr2L	9712	9815
+chr2L	9715	9838
+chr2L	9718	9850
+chr2L	9715	9870
+chr2L	9718	9883
+chr2L	9719	9858
+chr2L	9716	9883
+chr2L	9721	9875
+chr2L	9718	9826
+chr2L	9719	9893
+chr2L	9719	9838
+chr2L	9719	9851
+chr2L	9720	9883
+chr2L	9723	9882
+chr2L	9720	9883
+chr2L	9720	9871
+chr2L	9723	9882
+chr2L	9720	9874
+chr2L	9723	9850
+chr2L	9720	9883
+chr2L	9720	9832
+chr2L	9724	9839
+chr2L	9721	9881
+chr2L	9721	9884
+chr2L	9724	9890
+chr2L	9725	9883
+chr2L	9728	9882
+chr2L	9729	9882
+chr2L	9726	9854
+chr2L	9729	9882
+chr2L	9729	9893
+chr2L	9730	9834
+chr2L	9730	9840
+chr2L	9730	9861
+chr2L	9727	9876
+chr2L	9730	9850
+chr2L	9730	9868
+chr2L	9727	9876
+chr2L	9730	9873
+chr2L	9727	9847
+chr2L	9731	9928
+chr2L	9739	9883
+chr2L	9739	9882
+chr2L	9745	9857
+chr2L	9748	9883
+chr2L	9748	9881
+chr2L	9748	9893
+chr2L	9754	9851
+chr2L	9758	9880
+chr2L	9758	9874
+chr2L	9759	9839
+chr2L	9756	9923
+chr2L	9760	9895
+chr2L	9757	9925
+chr2L	9757	9869
+chr2L	9760	9884
+chr2L	9760	9932
+chr2L	9760	9893
+chr2L	9757	9881
+chr2L	9758	9893
+chr2L	9758	9906
+chr2L	9758	9923
+chr2L	9758	9855
+chr2L	9758	9925
+chr2L	9758	9884
+chr2L	9761	9886
+chr2L	9758	9893
+chr2L	9763	9869
+chr2L	9767	9926
+chr2L	9770	9882
+chr2L	9770	9882
+chr2L	9768	9923
+chr2L	9768	9936
+chr2L	9771	9941
+chr2L	9771	9924
+chr2L	9771	9943
+chr2L	9768	9926
+chr2L	9781	9948
+chr2L	9778	9917
+chr2L	9781	9892
+chr2L	9781	9942
+chr2L	9787	9948
+chr2L	9784	9923
+chr2L	9784	9926
+chr2L	9787	9948
+chr2L	9793	9958
+chr2L	9793	9924
+chr2L	9795	9948
+chr2L	9793	9939
+chr2L	9799	9949
+chr2L	9799	9925
+chr2L	9802	9941
+chr2L	9803	9948
+chr2L	9800	9942
+chr2L	9803	9953
+chr2L	9800	9926
+chr2L	9803	9973
+chr2L	9803	9959
+chr2L	9806	9946
+chr2L	9806	9949
+chr2L	9803	9891
+chr2L	9806	9958
+chr2L	9806	9958
+chr2L	9803	9942
+chr2L	9803	9949
+chr2L	9803	9956
+chr2L	9806	9948
+chr2L	9803	9942
+chr2L	9804	9954
+chr2L	9807	9958
+chr2L	9808	9953
+chr2L	9813	9912
+chr2L	9816	10018
+chr2L	9813	9950
+chr2L	9820	9978
+chr2L	9823	9949
+chr2L	9823	9975
+chr2L	9827	9949
+chr2L	9827	9955
+chr2L	9828	9936
+chr2L	9832	9954
+chr2L	9832	9971
+chr2L	9833	9942
+chr2L	9833	9953
+chr2L	9830	9942
+chr2L	9833	9973
+chr2L	9830	9950
+chr2L	9833	9942
+chr2L	9833	9932
+chr2L	9830	10006
+chr2L	9830	9974
+chr2L	9830	9946
+chr2L	9833	9971
+chr2L	9833	9932
+chr2L	9834	9960
+chr2L	9844	9953
+chr2L	9849	9973
+chr2L	9850	9974
+chr2L	9853	9972
+chr2L	9850	9955
+chr2L	9853	9997
+chr2L	9850	9972
+chr2L	9853	10029
+chr2L	9854	10017
+chr2L	9851	10003
+chr2L	9851	9938
+chr2L	9853	9959
+chr2L	9854	10005
+chr2L	9854	9973
+chr2L	9862	10010
+chr2L	9861	10031
+chr2L	9866	10039
+chr2L	9868	10017
+chr2L	9869	10018
+chr2L	9867	10011
+chr2L	9867	10022
+chr2L	9867	10025
+chr2L	9871	10024
+chr2L	9871	10075
+chr2L	9871	10004
+chr2L	9868	10025
+chr2L	9868	9959
+chr2L	9868	9957
+chr2L	9871	9975
+chr2L	9875	9961
+chr2L	9872	10030
+chr2L	9875	10009
+chr2L	9875	9961
+chr2L	9876	10017
+chr2L	9876	10024
+chr2L	9883	10018
+chr2L	9880	10025
+chr2L	9883	10004
+chr2L	9884	10046
+chr2L	9884	10030
+chr2L	9884	10144
+chr2L	9884	10018
+chr2L	9886	10017
+chr2L	9891	10018
+chr2L	9894	9972
+chr2L	9896	10054
+chr2L	9896	10050
+chr2L	9898	10077
+chr2L	9900	10050
+chr2L	9903	10055
+chr2L	9903	10049
+chr2L	9903	10056
+chr2L	9900	10064
+chr2L	9903	10067
+chr2L	9903	10067
+chr2L	9900	10076
+chr2L	9903	10062
+chr2L	9904	10018
+chr2L	9901	10030
+chr2L	9904	10063
+chr2L	9904	10073
+chr2L	9901	10019
+chr2L	9901	10018
+chr2L	9904	10046
+chr2L	9904	10055
+chr2L	9904	10072
+chr2L	9901	10051
+chr2L	9904	10029
+chr2L	9904	10017
+chr2L	9904	10068
+chr2L	9904	10050
+chr2L	9904	10072
+chr2L	9904	10049
+chr2L	9904	10067
+chr2L	9904	10049
+chr2L	9901	10047
+chr2L	9905	10050
+chr2L	9907	10049
+chr2L	9904	10047
+chr2L	9904	10030
+chr2L	9907	10067
+chr2L	9907	10036
+chr2L	9904	10026
+chr2L	9914	10068
+chr2L	9914	10017
+chr2L	9916	10048
+chr2L	9919	10068
+chr2L	9916	10064
+chr2L	9918	10019
+chr2L	9919	10068
+chr2L	9924	10069
+chr2L	9921	10056
+chr2L	9927	10019
+chr2L	9931	10067
+chr2L	9929	10090
+chr2L	9932	10072
+chr2L	9931	10089
+chr2L	9935	10100
+chr2L	9935	10072
+chr2L	9935	10067
+chr2L	9933	10089
+chr2L	9935	10088
+chr2L	9936	10045
+chr2L	9939	10094
+chr2L	9937	10030
+chr2L	9942	10135
+chr2L	9957	10049
+chr2L	9958	10095
+chr2L	9958	10106
+chr2L	9961	10088
+chr2L	9958	10086
+chr2L	9962	10089
+chr2L	9962	10100
+chr2L	9964	10108
+chr2L	9967	10088
+chr2L	9964	10073
+chr2L	9968	10134
+chr2L	9965	10068
+chr2L	9968	10107
+chr2L	9968	10067
+chr2L	9966	10089
+chr2L	9966	10074
+chr2L	9969	10089
+chr2L	9971	10089
+chr2L	9969	10103
+chr2L	9969	10142
+chr2L	9969	10094
+chr2L	9970	10106
+chr2L	9973	10132
+chr2L	9973	10121
+chr2L	9973	10116
+chr2L	9973	10095
+chr2L	9971	10280
+chr2L	9974	10113
+chr2L	9971	10088
+chr2L	9974	10116
+chr2L	9974	10088
+chr2L	9974	10117
+chr2L	9974	10134
+chr2L	9974	10104
+chr2L	9972	10141
+chr2L	9972	10073
+chr2L	9977	10101
+chr2L	9980	10118
+chr2L	9981	10125
+chr2L	9985	10135
+chr2L	9985	10134
+chr2L	9982	10133
+chr2L	9982	10237
+chr2L	9985	10113
+chr2L	9985	10134
+chr2L	9986	10362
+chr2L	9983	10146
+chr2L	9986	10132
+chr2L	9983	10141
+chr2L	9986	10149
+chr2L	9986	10141
+chr2L	9983	10142
+chr2L	9986	10100
+chr2L	9986	10134
+chr2L	9983	10136
+chr2L	9983	10108
+chr2L	9986	10141
+chr2L	9987	10121
+chr2L	9987	10134
+chr2L	9984	10141
+chr2L	9987	10089
+chr2L	9989	10171
+chr2L	9989	10099
+chr2L	9989	10141
+chr2L	9992	10134
+chr2L	9989	10158
+chr2L	9992	10150
+chr2L	9993	10147
+chr2L	9990	10108
+chr2L	9990	10142
+chr2L	9993	10170
+chr2L	9990	10135
+chr2L	9993	10091
+chr2L	9994	10135
+chr2L	9991	10145
+chr2L	9991	10101
+chr2L	9991	10145
+chr2L	9991	10133
+chr2L	9999	10134
+chr2L	10000	10173
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/alignmentSieve.txt	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,3 @@
+#bamFilterReads --filterMetrics
+#File	Reads Remaining	Total Initial Reads
+paired_chr2L.bam	8440	12644
Binary file test-data/alignmentSieve2.bam has changed
Binary file test-data/alignmentSieve3.bam has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamCompare_result1.bg	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,1 @@
+chrM	0	16569	1
Binary file test-data/bamCompare_result2.bw has changed
Binary file test-data/bamCoverage_result1.bw has changed
Binary file test-data/bamCoverage_result2.bw has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamCoverage_result3.bg	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,7 @@
+chrM	0	210	9.76876e+06
+chrM	210	220	9.56092e+06
+chrM	220	230	7.6903e+06
+chrM	230	240	5.19615e+06
+chrM	240	250	3.32554e+06
+chrM	250	260	623538
+chrM	260	16569	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamCoverage_result4.bg	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,472 @@
+phiX174	0	10	16038.5
+phiX174	10	20	48115.4
+phiX174	20	70	144346
+phiX174	70	80	192462
+phiX174	80	90	176423
+phiX174	90	100	160385
+phiX174	100	120	112269
+phiX174	120	140	144346
+phiX174	140	150	160385
+phiX174	150	160	128308
+phiX174	160	170	160385
+phiX174	170	180	176423
+phiX174	180	200	208500
+phiX174	200	210	192462
+phiX174	210	220	240577
+phiX174	220	230	272654
+phiX174	230	240	336808
+phiX174	240	250	320769
+phiX174	250	260	288692
+phiX174	260	270	336808
+phiX174	270	280	400962
+phiX174	280	300	417000
+phiX174	300	310	352846
+phiX174	310	320	320769
+phiX174	320	330	368885
+phiX174	330	340	352846
+phiX174	340	350	288692
+phiX174	350	360	256615
+phiX174	360	370	224538
+phiX174	370	380	240577
+phiX174	380	390	304731
+phiX174	390	400	256615
+phiX174	400	410	240577
+phiX174	410	420	224538
+phiX174	420	450	288692
+phiX174	450	460	304731
+phiX174	460	470	336808
+phiX174	470	490	417000
+phiX174	490	510	497192
+phiX174	510	520	465115
+phiX174	520	530	561346
+phiX174	530	540	497192
+phiX174	540	550	529269
+phiX174	550	560	545308
+phiX174	560	570	641538
+phiX174	570	580	625500
+phiX174	580	590	561346
+phiX174	590	600	609462
+phiX174	600	610	545308
+phiX174	610	630	625500
+phiX174	630	640	577385
+phiX174	640	650	513231
+phiX174	650	660	545308
+phiX174	660	670	561346
+phiX174	670	680	593423
+phiX174	680	690	657577
+phiX174	690	700	641538
+phiX174	700	710	561346
+phiX174	710	730	593423
+phiX174	730	740	513231
+phiX174	740	760	593423
+phiX174	760	770	497192
+phiX174	770	780	513231
+phiX174	780	790	529269
+phiX174	790	800	545308
+phiX174	800	810	449077
+phiX174	810	820	433038
+phiX174	820	830	368885
+phiX174	830	840	320769
+phiX174	840	850	352846
+phiX174	850	860	304731
+phiX174	860	870	336808
+phiX174	870	880	256615
+phiX174	880	890	352846
+phiX174	890	900	384923
+phiX174	900	910	465115
+phiX174	910	920	545308
+phiX174	920	930	561346
+phiX174	930	940	545308
+phiX174	940	950	577385
+phiX174	950	960	593423
+phiX174	960	970	513231
+phiX174	970	980	481154
+phiX174	980	990	433038
+phiX174	990	1000	417000
+phiX174	1000	1010	449077
+phiX174	1010	1030	577385
+phiX174	1030	1040	753808
+phiX174	1040	1050	785885
+phiX174	1050	1060	817962
+phiX174	1060	1070	866077
+phiX174	1070	1080	834000
+phiX174	1080	1090	866077
+phiX174	1090	1100	769846
+phiX174	1100	1110	737769
+phiX174	1110	1120	657577
+phiX174	1120	1130	641538
+phiX174	1130	1140	625500
+phiX174	1140	1150	673615
+phiX174	1150	1160	625500
+phiX174	1160	1170	593423
+phiX174	1170	1180	609462
+phiX174	1180	1190	577385
+phiX174	1190	1200	513231
+phiX174	1200	1210	481154
+phiX174	1210	1220	561346
+phiX174	1220	1230	481154
+phiX174	1230	1240	449077
+phiX174	1240	1250	352846
+phiX174	1250	1260	336808
+phiX174	1260	1270	400962
+phiX174	1270	1280	352846
+phiX174	1280	1290	368885
+phiX174	1290	1300	320769
+phiX174	1300	1310	384923
+phiX174	1310	1320	513231
+phiX174	1320	1330	497192
+phiX174	1330	1340	513231
+phiX174	1340	1350	481154
+phiX174	1350	1370	497192
+phiX174	1370	1390	465115
+phiX174	1390	1400	352846
+phiX174	1400	1410	449077
+phiX174	1410	1430	481154
+phiX174	1430	1450	545308
+phiX174	1450	1460	561346
+phiX174	1460	1470	577385
+phiX174	1470	1480	609462
+phiX174	1480	1490	593423
+phiX174	1490	1500	545308
+phiX174	1500	1510	657577
+phiX174	1510	1520	625500
+phiX174	1520	1540	785885
+phiX174	1540	1550	721731
+phiX174	1550	1570	753808
+phiX174	1570	1580	769846
+phiX174	1580	1590	673615
+phiX174	1590	1600	625500
+phiX174	1600	1610	561346
+phiX174	1610	1620	529269
+phiX174	1620	1630	497192
+phiX174	1630	1640	465115
+phiX174	1640	1650	481154
+phiX174	1650	1660	497192
+phiX174	1660	1670	529269
+phiX174	1670	1680	593423
+phiX174	1680	1690	513231
+phiX174	1690	1700	529269
+phiX174	1700	1710	593423
+phiX174	1710	1720	545308
+phiX174	1720	1730	529269
+phiX174	1730	1740	577385
+phiX174	1740	1750	529269
+phiX174	1750	1760	433038
+phiX174	1760	1770	417000
+phiX174	1770	1780	368885
+phiX174	1780	1790	352846
+phiX174	1790	1810	336808
+phiX174	1810	1820	320769
+phiX174	1820	1830	465115
+phiX174	1830	1860	705692
+phiX174	1860	1870	801923
+phiX174	1870	1880	737769
+phiX174	1880	1890	673615
+phiX174	1890	1900	705692
+phiX174	1900	1910	609462
+phiX174	1910	1920	400962
+phiX174	1920	1930	465115
+phiX174	1930	1940	545308
+phiX174	1940	1950	449077
+phiX174	1950	1960	481154
+phiX174	1960	1970	529269
+phiX174	1970	1980	673615
+phiX174	1980	1990	641538
+phiX174	1990	2000	657577
+phiX174	2000	2010	673615
+phiX174	2010	2020	641538
+phiX174	2020	2030	657577
+phiX174	2030	2050	673615
+phiX174	2050	2060	481154
+phiX174	2060	2070	513231
+phiX174	2070	2080	481154
+phiX174	2080	2100	513231
+phiX174	2100	2110	529269
+phiX174	2110	2120	513231
+phiX174	2120	2130	529269
+phiX174	2130	2140	545308
+phiX174	2140	2150	513231
+phiX174	2150	2160	545308
+phiX174	2160	2170	417000
+phiX174	2170	2180	352846
+phiX174	2180	2190	433038
+phiX174	2190	2200	449077
+phiX174	2200	2210	433038
+phiX174	2210	2220	481154
+phiX174	2220	2230	545308
+phiX174	2230	2240	593423
+phiX174	2240	2250	625500
+phiX174	2250	2260	721731
+phiX174	2260	2270	625500
+phiX174	2270	2290	593423
+phiX174	2290	2300	609462
+phiX174	2300	2310	737769
+phiX174	2310	2320	769846
+phiX174	2320	2330	866077
+phiX174	2330	2340	850038
+phiX174	2340	2350	898154
+phiX174	2350	2360	801923
+phiX174	2360	2370	914192
+phiX174	2370	2380	801923
+phiX174	2380	2390	641538
+phiX174	2390	2400	593423
+phiX174	2400	2410	417000
+phiX174	2410	2420	400962
+phiX174	2420	2430	352846
+phiX174	2430	2440	481154
+phiX174	2440	2450	449077
+phiX174	2450	2460	609462
+phiX174	2460	2470	673615
+phiX174	2470	2480	737769
+phiX174	2480	2490	753808
+phiX174	2490	2500	769846
+phiX174	2500	2510	785885
+phiX174	2510	2520	641538
+phiX174	2520	2530	657577
+phiX174	2530	2540	529269
+phiX174	2540	2550	465115
+phiX174	2550	2560	384923
+phiX174	2560	2570	433038
+phiX174	2570	2590	465115
+phiX174	2590	2600	449077
+phiX174	2600	2620	529269
+phiX174	2620	2630	545308
+phiX174	2630	2640	689654
+phiX174	2640	2650	625500
+phiX174	2650	2660	561346
+phiX174	2660	2670	545308
+phiX174	2670	2680	609462
+phiX174	2680	2700	657577
+phiX174	2700	2710	625500
+phiX174	2710	2720	593423
+phiX174	2720	2740	657577
+phiX174	2740	2750	817962
+phiX174	2750	2760	866077
+phiX174	2760	2770	850038
+phiX174	2770	2780	882115
+phiX174	2780	2790	962308
+phiX174	2790	2800	817962
+phiX174	2800	2810	834000
+phiX174	2810	2820	801923
+phiX174	2820	2830	673615
+phiX174	2830	2840	705692
+phiX174	2840	2860	625500
+phiX174	2860	2870	609462
+phiX174	2870	2880	705692
+phiX174	2880	2890	657577
+phiX174	2890	2900	609462
+phiX174	2900	2910	657577
+phiX174	2910	2930	561346
+phiX174	2930	2940	513231
+phiX174	2940	2950	561346
+phiX174	2950	2960	497192
+phiX174	2960	2970	577385
+phiX174	2970	2980	593423
+phiX174	2980	2990	513231
+phiX174	2990	3000	529269
+phiX174	3000	3010	561346
+phiX174	3010	3020	513231
+phiX174	3020	3030	465115
+phiX174	3030	3040	433038
+phiX174	3040	3050	417000
+phiX174	3050	3060	545308
+phiX174	3060	3070	561346
+phiX174	3070	3080	625500
+phiX174	3080	3100	577385
+phiX174	3100	3110	721731
+phiX174	3110	3120	673615
+phiX174	3120	3130	641538
+phiX174	3130	3140	609462
+phiX174	3140	3160	673615
+phiX174	3160	3180	769846
+phiX174	3180	3190	705692
+phiX174	3190	3200	657577
+phiX174	3200	3210	673615
+phiX174	3210	3220	737769
+phiX174	3220	3230	657577
+phiX174	3230	3240	705692
+phiX174	3240	3250	625500
+phiX174	3250	3260	545308
+phiX174	3260	3270	593423
+phiX174	3270	3280	625500
+phiX174	3280	3290	577385
+phiX174	3290	3300	529269
+phiX174	3300	3310	513231
+phiX174	3310	3320	529269
+phiX174	3320	3330	609462
+phiX174	3330	3340	657577
+phiX174	3340	3370	641538
+phiX174	3370	3390	657577
+phiX174	3390	3400	577385
+phiX174	3400	3430	481154
+phiX174	3430	3440	513231
+phiX174	3440	3450	609462
+phiX174	3450	3460	577385
+phiX174	3460	3480	673615
+phiX174	3480	3490	721731
+phiX174	3490	3500	834000
+phiX174	3500	3510	801923
+phiX174	3510	3520	898154
+phiX174	3520	3530	769846
+phiX174	3530	3540	753808
+phiX174	3540	3550	785885
+phiX174	3550	3560	753808
+phiX174	3560	3570	689654
+phiX174	3570	3580	497192
+phiX174	3580	3590	465115
+phiX174	3590	3610	433038
+phiX174	3610	3620	417000
+phiX174	3620	3630	400962
+phiX174	3630	3640	384923
+phiX174	3640	3650	352846
+phiX174	3650	3660	433038
+phiX174	3660	3680	400962
+phiX174	3680	3690	417000
+phiX174	3690	3700	336808
+phiX174	3700	3710	384923
+phiX174	3710	3720	433038
+phiX174	3720	3730	625500
+phiX174	3730	3740	593423
+phiX174	3740	3750	705692
+phiX174	3750	3760	673615
+phiX174	3760	3780	657577
+phiX174	3780	3790	625500
+phiX174	3790	3800	497192
+phiX174	3800	3810	417000
+phiX174	3810	3820	449077
+phiX174	3820	3830	433038
+phiX174	3830	3840	545308
+phiX174	3840	3850	625500
+phiX174	3850	3860	769846
+phiX174	3860	3870	801923
+phiX174	3870	3880	769846
+phiX174	3880	3890	721731
+phiX174	3890	3900	673615
+phiX174	3900	3910	641538
+phiX174	3910	3920	593423
+phiX174	3920	3930	449077
+phiX174	3930	3950	400962
+phiX174	3950	3960	433038
+phiX174	3960	3970	529269
+phiX174	3970	3980	593423
+phiX174	3980	3990	561346
+phiX174	3990	4000	641538
+phiX174	4000	4010	625500
+phiX174	4010	4020	609462
+phiX174	4020	4030	641538
+phiX174	4030	4040	657577
+phiX174	4040	4050	545308
+phiX174	4050	4060	481154
+phiX174	4060	4070	449077
+phiX174	4070	4080	400962
+phiX174	4080	4090	433038
+phiX174	4090	4100	529269
+phiX174	4100	4110	400962
+phiX174	4110	4120	368885
+phiX174	4120	4130	304731
+phiX174	4130	4150	368885
+phiX174	4150	4160	336808
+phiX174	4160	4170	384923
+phiX174	4170	4180	272654
+phiX174	4180	4190	336808
+phiX174	4190	4200	352846
+phiX174	4200	4210	368885
+phiX174	4210	4230	320769
+phiX174	4230	4250	336808
+phiX174	4250	4260	384923
+phiX174	4260	4280	481154
+phiX174	4280	4290	449077
+phiX174	4290	4300	465115
+phiX174	4300	4310	529269
+phiX174	4310	4320	609462
+phiX174	4320	4330	577385
+phiX174	4330	4340	465115
+phiX174	4340	4350	417000
+phiX174	4350	4360	433038
+phiX174	4360	4380	513231
+phiX174	4380	4390	481154
+phiX174	4390	4400	449077
+phiX174	4400	4410	529269
+phiX174	4410	4420	657577
+phiX174	4420	4430	705692
+phiX174	4430	4440	785885
+phiX174	4440	4450	817962
+phiX174	4450	4460	801923
+phiX174	4460	4470	769846
+phiX174	4470	4480	785885
+phiX174	4480	4490	689654
+phiX174	4490	4500	625500
+phiX174	4500	4510	609462
+phiX174	4510	4520	465115
+phiX174	4520	4540	433038
+phiX174	4540	4550	497192
+phiX174	4550	4560	481154
+phiX174	4560	4570	433038
+phiX174	4570	4580	465115
+phiX174	4580	4590	417000
+phiX174	4590	4600	433038
+phiX174	4600	4610	529269
+phiX174	4610	4620	513231
+phiX174	4620	4630	577385
+phiX174	4630	4640	609462
+phiX174	4640	4660	689654
+phiX174	4660	4670	721731
+phiX174	4670	4680	673615
+phiX174	4680	4690	609462
+phiX174	4690	4700	689654
+phiX174	4700	4720	481154
+phiX174	4720	4730	400962
+phiX174	4730	4740	465115
+phiX174	4740	4760	561346
+phiX174	4760	4780	593423
+phiX174	4780	4790	609462
+phiX174	4790	4800	689654
+phiX174	4800	4810	673615
+phiX174	4810	4820	657577
+phiX174	4820	4830	593423
+phiX174	4830	4850	625500
+phiX174	4850	4860	577385
+phiX174	4860	4870	513231
+phiX174	4870	4880	497192
+phiX174	4880	4890	593423
+phiX174	4890	4900	513231
+phiX174	4900	4910	481154
+phiX174	4910	4920	417000
+phiX174	4920	4930	384923
+phiX174	4930	4950	352846
+phiX174	4950	4960	272654
+phiX174	4960	4970	176423
+phiX174	4970	4980	240577
+phiX174	4980	4990	208500
+phiX174	4990	5020	288692
+phiX174	5020	5030	352846
+phiX174	5030	5040	336808
+phiX174	5040	5050	368885
+phiX174	5050	5060	304731
+phiX174	5060	5070	288692
+phiX174	5070	5080	240577
+phiX174	5080	5090	304731
+phiX174	5090	5100	272654
+phiX174	5100	5110	224538
+phiX174	5110	5120	256615
+phiX174	5120	5130	320769
+phiX174	5130	5140	417000
+phiX174	5140	5160	497192
+phiX174	5160	5170	481154
+phiX174	5170	5180	577385
+phiX174	5180	5190	561346
+phiX174	5190	5200	529269
+phiX174	5200	5210	465115
+phiX174	5210	5220	449077
+phiX174	5220	5230	400962
+phiX174	5230	5240	449077
+phiX174	5240	5250	368885
+phiX174	5250	5260	272654
+phiX174	5260	5270	304731
+phiX174	5270	5280	336808
+phiX174	5280	5290	272654
+phiX174	5290	5300	192462
+phiX174	5300	5310	144346
+phiX174	5310	5340	96230.8
+phiX174	5340	5350	64153.8
+phiX174	5350	5386	32076.9
Binary file test-data/bamCoverage_result4.bw has changed
Binary file test-data/bamCoverage_result5.bw has changed
Binary file test-data/bamCoverage_result6.bw has changed
Binary file test-data/bamPEFragmentSize_histogram_result1.png has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamPEFragmentSize_lengths1.txt	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,5 @@
+#bamPEFragmentSize
+Size	Occurrences	Sample
+241	1	bowtie2 test1.bam
+242	1	bowtie2 test1.bam
+251	1	bowtie2 test1.bam
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamPEFragmentSize_result1.txt	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,46 @@
+
+
+Sample label: bowtie2 test1.bam
+Sample size: 3
+
+Fragment lengths:
+Min.: 241.0
+1st Qu.: 241.5
+Mean: 244.66666666666666
+Median: 242.0
+3rd Qu.: 246.5
+Max.: 251.0
+Std: 4.496912521077347
+MAD: 1.0
+Len. 10%: 241.20000000000002
+Len. 20%: 241.4
+Len. 30%: 241.6
+Len. 40%: 241.8
+Len. 60%: 243.8
+Len. 70%: 245.6
+Len. 80%: 247.4
+Len. 90%: 249.2
+Len. 99%: 250.82
+
+
+Read lengths:
+Sample size: 3
+
+Min.: 251.0
+1st Qu.: 251.0
+Mean: 251.0
+Median: 251.0
+3rd Qu.: 251.0
+Max.: 251.0
+Std: 0.0
+MAD: 0.0
+Len. 10%: 251.0
+Len. 20%: 251.0
+Len. 30%: 251.0
+Len. 40%: 251.0
+Len. 60%: 251.0
+Len. 70%: 251.0
+Len. 80%: 251.0
+Len. 90%: 251.0
+Len. 99%: 251.0
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamPEFragmentSize_table1.txt	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,2 @@
+	Frag. Sampled	Frag. Len. Min.	Frag. Len. 1st. Qu.	Frag. Len. Mean	Frag. Len. Median	Frag. Len. 3rd Qu.	Frag. Len. Max	Frag. Len. Std.	Frag. Med. Abs. Dev.	Frag. Len. 10%	Frag. Len. 20%	Frag. Len. 30%	Frag. Len. 40%	Frag. Len. 60%	Frag. Len. 70%	Frag. Len. 80%	Frag. Len. 90%	Frag. Len. 99%	Reads Sampled	Read Len. Min.	Read Len. 1st. Qu.	Read Len. Mean	Read Len. Median	Read Len. 3rd Qu.	Read Len. Max	Read Len. Std.	Read Med. Abs. Dev.	Read Len. 10%	Read Len. 20%	Read Len. 30%	Read Len. 40%	Read Len. 60%	Read Len. 70%	Read Len. 80%	Read Len. 90%	Read Len. 99%
+bowtie2 test1.bam	3	241.0	241.5	244.66666666666666	242.0	246.5	251.0	4.496912521077347	1.0	241.20000000000002	241.4	241.6	241.8	243.8	245.6	247.4	249.2	250.82	3	251.0	251.0	251.0	251.0	251.0	251.0	0.0	0.0	251.0	251.0	251.0	251.0	251.0	251.0	251.0	251.0	251.0
Binary file test-data/bigwigCompare_result1.bw has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bigwigCompare_result2.bg	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,3 @@
+ch1	0	400	1
+ch2	0	400	1
+ch3	0	400	1
Binary file test-data/bowtie2 test1.bam has changed
Binary file test-data/computeGCBias_result1.png has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/computeGCBias_result1.tabular	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,301 @@
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+5.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+01
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/computeMatrix1.bed	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,8 @@
+phiX174	1000	1500	CG11023	0	+
+phiX174	150	1750	cda5	0	-
+phiX174	150	177	cda8	0	-
+phiX174	75	1500	cda9	0	+
+phiX174	101	175	C11023	0	+
+phiX174	125	150	ca5	0	-
+phiX174	450	1750	ca8	0	+
+phiX174	80	1500	cda9	0	+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/computeMatrix2.bed	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,6 @@
+ch1	100	150	CG11023	0	+
+ch2	150	175	cda5	0	-
+ch3	100	125	cda8	0	+
+ch1	75	125	C11023	0	+
+ch2	125	150	ca5	0	-
+ch3	75	100	ca8	0	+
Binary file test-data/computeMatrix2.bw has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/computeMatrixOperations.txt	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,4 @@
+Groups:
+	genes
+Samples:
+	bamCoverage_result4_bw_0
Binary file test-data/computeMatrixOperations_result2.mat.gz has changed
Binary file test-data/computeMatrix_result1.gz has changed
Binary file test-data/computeMatrix_result2.gz has changed
Binary file test-data/computeMatrix_result3.gz has changed
Binary file test-data/correctGCBias_result1.bam has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/estimateReadFiltering.txt	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,3 @@
+Sample	Total Reads	Mapped Reads	Alignments in blacklisted regions	Estimated mapped reads filtered	Below MAPQ	Missing Flags	Excluded Flags	Internally-determined Duplicates	Marked Duplicates	Singletons	Wrong strand
+paired_chr2L.bam	12644	12589	0	1395.9	4149.0	0.0	0.0	0.0	0.0	55.0	0.0
+paired_chr2L.bam	12644	12589	0	1395.9	4149.0	0.0	0.0	0.0	0.0	55.0	0.0
Binary file test-data/heatmapper_result1.png has changed
Binary file test-data/heatmapper_result2.png has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/heatmapper_result2.tabular	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,3 @@
+bin labels		-0.0Kb	0.0Kb
+bins		1	2
+file_0	genes	2477942.34473	2610259.65234
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/multiBamSummary_regions.bed	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,3 @@
+chrM	1	10
+chrM	5	15
+chrM	10	20
Binary file test-data/multiBamSummary_result1.npz has changed
Binary file test-data/multiBamSummary_result2.npz has changed
Binary file test-data/multiBamSummary_result2b.npz has changed
Binary file test-data/multiBigwigSummary_result1.npz has changed
Binary file test-data/multiBigwigSummary_result1.png has changed
Binary file test-data/paired_chr2L.bam has changed
Binary file test-data/paired_chr2L.cram has changed
Binary file test-data/phiX.2bit has changed
Binary file test-data/phiX.bam has changed
Binary file test-data/phiX.bam.bai has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/phiX.fasta	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,79 @@
+>phiX174
+GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT
+GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA
+ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG
+TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA
+GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC
+TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT
+TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT
+CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT
+TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG
+TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC
+GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA
+CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG
+TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT
+AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC
+CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA
+TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC
+TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA
+CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA
+GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT
+GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA
+ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC
+TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT
+TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC
+ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC
+CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT
+GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC
+CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC
+TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG
+TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT
+TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA
+AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT
+TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT
+ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC
+GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC
+TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT
+TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA
+TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG
+TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC
+CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG
+AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC
+CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT
+TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG
+CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA
+AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT
+GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG
+GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA
+TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT
+CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG
+TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA
+GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC
+CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA
+TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA
+AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC
+TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT
+CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA
+TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG
+TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT
+CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT
+TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC
+ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG
+TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA
+ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG
+GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC
+CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT
+GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG
+GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT
+ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG
+CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC
+CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC
+GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT
+CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG
+CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA
+TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT
+TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG
+TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC
+AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC
+TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA
+
Binary file test-data/plotCorrelation_result1.png has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/plotCorrelation_result1.tabular	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,4 @@
+#plotCorrelation --outFileCorMatrix
+	'bowtie2 test1.bam'	'bowtie2 test1.bam'
+'bowtie2 test1.bam'	1.0000	1.0000
+'bowtie2 test1.bam'	1.0000	1.0000
Binary file test-data/plotCorrelation_result2.png has changed
Binary file test-data/plotCoverage_result1.png has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/plotCoverage_result1.tabular	Thu Feb 15 08:13:20 2018 -0500
@@ -0,0 +1,16571 @@
+#plotCoverage --outRawCounts
+#'chr'	'start'	'end'	'bowtie2 test1.bam'	'bowtie2 test1.bam'
+chrM	0	1	23.0	23.0
+chrM	1	2	35.0	35.0
+chrM	2	3	35.0	35.0
+chrM	3	4	35.0	35.0
+chrM	4	5	35.0	35.0
+chrM	5	6	35.0	35.0
+chrM	6	7	35.0	35.0
+chrM	7	8	35.0	35.0
+chrM	8	9	35.0	35.0
+chrM	9	10	35.0	35.0
+chrM	10	11	35.0	35.0
+chrM	11	12	35.0	35.0
+chrM	12	13	35.0	35.0
+chrM	13	14	35.0	35.0
+chrM	14	15	35.0	35.0
+chrM	15	16	35.0	35.0
+chrM	16	17	35.0	35.0
+chrM	17	18	35.0	35.0
+chrM	18	19	35.0	35.0
+chrM	19	20	35.0	35.0
+chrM	20	21	35.0	35.0
+chrM	21	22	35.0	35.0
+chrM	22	23	35.0	35.0
+chrM	23	24	35.0	35.0
+chrM	24	25	35.0	35.0
+chrM	25	26	35.0	35.0
+chrM	26	27	35.0	35.0
+chrM	27	28	35.0	35.0
+chrM	28	29	35.0	35.0
+chrM	29	30	35.0	35.0
+chrM	30	31	35.0	35.0
+chrM	31	32	35.0	35.0
+chrM	32	33	35.0	35.0
+chrM	33	34	35.0	35.0
+chrM	34	35	35.0	35.0
+chrM	35	36	35.0	35.0
+chrM	36	37	35.0	35.0
+chrM	37	38	35.0	35.0
+chrM	38	39	35.0	35.0
+chrM	39	40	35.0	35.0
+chrM	40	41	35.0	35.0
+chrM	41	42	35.0	35.0
+chrM	42	43	35.0	35.0
+chrM	43	44	35.0	35.0
+chrM	44	45	35.0	35.0
+chrM	45	46	35.0	35.0
+chrM	46	47	35.0	35.0
+chrM	47	48	35.0	35.0
+chrM	48	49	35.0	35.0
+chrM	49	50	35.0	35.0
+chrM	50	51	35.0	35.0
+chrM	51	52	35.0	35.0
+chrM	52	53	35.0	35.0
+chrM	53	54	35.0	35.0
+chrM	54	55	35.0	35.0
+chrM	55	56	35.0	35.0
+chrM	56	57	35.0	35.0
+chrM	57	58	35.0	35.0
+chrM	58	59	35.0	35.0
+chrM	59	60	35.0	35.0
+chrM	60	61	35.0	35.0
+chrM	61	62	35.0	35.0
+chrM	62	63	35.0	35.0
+chrM	63	64	35.0	35.0
+chrM	64	65	35.0	35.0
+chrM	65	66	35.0	35.0
+chrM	66	67	35.0	35.0
+chrM	67	68	35.0	35.0
+chrM	68	69	35.0	35.0
+chrM	69	70	35.0	35.0
+chrM	70	71	35.0	35.0
+chrM	71	72	35.0	35.0
+chrM	72	73	35.0	35.0
+chrM	73	74	35.0	35.0
+chrM	74	75	35.0	35.0
+chrM	75	76	35.0	35.0
+chrM	76	77	35.0	35.0
+chrM	77	78	35.0	35.0
+chrM	78	79	35.0	35.0
+chrM	79	80	35.0	35.0
+chrM	80	81	35.0	35.0
+chrM	81	82	35.0	35.0
+chrM	82	83	35.0	35.0
+chrM	83	84	35.0	35.0
+chrM	84	85	35.0	35.0
+chrM	85	86	35.0	35.0
+chrM	86	87	35.0	35.0
+chrM	87	88	35.0	35.0
+chrM	88	89	35.0	35.0
+chrM	89	90	35.0	35.0
+chrM	90	91	35.0	35.0
+chrM	91	92	35.0	35.0
+chrM	92	93	35.0	35.0
+chrM	93	94	35.0	35.0
+chrM	94	95	35.0	35.0
+chrM	95	96	35.0	35.0
+chrM	96	97	35.0	35.0
+chrM	97	98	35.0	35.0
+chrM	98	99	35.0	35.0
+chrM	99	100	35.0	35.0
+chrM	100	101	35.0	35.0
+chrM	101	102	35.0	35.0
+chrM	102	103	35.0	35.0
+chrM	103	104	35.0	35.0
+chrM	104	105	35.0	35.0
+chrM	105	106	35.0	35.0
+chrM	106	107	35.0	35.0
+chrM	107	108	35.0	35.0
+chrM	108	109	35.0	35.0
+chrM	109	110	35.0	35.0
+chrM	110	111	35.0	35.0
+chrM	111	112	35.0	35.0
+chrM	112	113	35.0	35.0
+chrM	113	114	35.0	35.0
+chrM	114	115	35.0	35.0
+chrM	115	116	35.0	35.0
+chrM	116	117	35.0	35.0
+chrM	117	118	35.0	35.0
+chrM	118	119	35.0	35.0
+chrM	119	120	35.0	35.0
+chrM	120	121	35.0	35.0
+chrM	121	122	35.0	35.0
+chrM	122	123	35.0	35.0
+chrM	123	124	35.0	35.0
+chrM	124	125	35.0	35.0
+chrM	125	126	35.0	35.0
+chrM	126	127	35.0	35.0
+chrM	127	128	35.0	35.0
+chrM	128	129	35.0	35.0
+chrM	129	130	35.0	35.0
+chrM	130	131	35.0	35.0
+chrM	131	132	35.0	35.0
+chrM	132	133	35.0	35.0
+chrM	133	134	35.0	35.0
+chrM	134	135	35.0	35.0
+chrM	135	136	35.0	35.0
+chrM	136	137	35.0	35.0
+chrM	137	138	35.0	35.0
+chrM	138	139	35.0	35.0
+chrM	139	140	35.0	35.0
+chrM	140	141	35.0	35.0
+chrM	141	142	35.0	35.0
+chrM	142	143	35.0	35.0
+chrM	143	144	35.0	35.0
+chrM	144	145	35.0	35.0
+chrM	145	146	35.0	35.0
+chrM	146	147	35.0	35.0
+chrM	147	148	35.0	35.0
+chrM	148	149	35.0	35.0
+chrM	149	150	35.0	35.0
+chrM	150	151	35.0	35.0
+chrM	151	152	35.0	35.0
+chrM	152	153	35.0	35.0
+chrM	153	154	35.0	35.0
+chrM	154	155	35.0	35.0
+chrM	155	156	35.0	35.0
+chrM	156	157	35.0	35.0
+chrM	157	158	35.0	35.0
+chrM	158	159	35.0	35.0
+chrM	159	160	35.0	35.0
+chrM	160	161	35.0	35.0
+chrM	161	162	35.0	35.0
+chrM	162	163	35.0	35.0
+chrM	163	164	35.0	35.0
+chrM	164	165	35.0	35.0
+chrM	165	166	35.0	35.0
+chrM	166	167	35.0	35.0
+chrM	167	168	35.0	35.0
+chrM	168	169	35.0	35.0
+chrM	169	170	35.0	35.0
+chrM	170	171	35.0	35.0
+chrM	171	172	35.0	35.0
+chrM	172	173	35.0	35.0
+chrM	173	174	35.0	35.0
+chrM	174	175	35.0	35.0
+chrM	175	176	35.0	35.0
+chrM	176	177	35.0	35.0
+chrM	177	178	35.0	35.0
+chrM	178	179	35.0	35.0
+chrM	179	180	35.0	35.0
+chrM	180	181	35.0	35.0
+chrM	181	182	35.0	35.0
+chrM	182	183	35.0	35.0
+chrM	183	184	35.0	35.0
+chrM	184	185	35.0	35.0
+chrM	185	186	35.0	35.0
+chrM	186	187	35.0	35.0
+chrM	187	188	35.0	35.0
+chrM	188	189	35.0	35.0
+chrM	189	190	35.0	35.0
+chrM	190	191	35.0	35.0
+chrM	191	192	35.0	35.0
+chrM	192	193	35.0	35.0
+chrM	193	194	35.0	35.0
+chrM	194	195	35.0	35.0
+chrM	195	196	35.0	35.0
+chrM	196	197	35.0	35.0
+chrM	197	198	35.0	35.0
+chrM	198	199	35.0	35.0
+chrM	199	200	35.0	35.0
+chrM	200	201	35.0	35.0
+chrM	201	202	35.0	35.0
+chrM	202	203	35.0	35.0
+chrM	203	204	35.0	35.0
+chrM	204	205	35.0	35.0
+chrM	205	206	35.0	35.0
+chrM	206	207	35.0	35.0
+chrM	207	208	35.0	35.0
+chrM	208	209	35.0	35.0
+chrM	209	210	35.0	35.0
+chrM	210	211	35.0	35.0
+chrM	211	212	35.0	35.0
+chrM	212	213	35.0	35.0
+chrM	213	214	35.0	35.0
+chrM	214	215	35.0	35.0
+chrM	215	216	35.0	35.0
+chrM	216	217	33.0	33.0
+chrM	217	218	33.0	33.0
+chrM	218	219	33.0	33.0
+chrM	219	220	33.0	33.0
+chrM	220	221	33.0	33.0
+chrM	221	222	33.0	33.0
+chrM	222	223	33.0	33.0
+chrM	223	224	33.0	33.0
+chrM	224	225	33.0	33.0
+chrM	225	226	33.0	33.0
+chrM	226	227	33.0	33.0
+chrM	227	228	33.0	33.0
+chrM	228	229	27.0	27.0
+chrM	229	230	25.0	25.0
+chrM	230	231	24.0	24.0
+chrM	231	232	21.0	21.0
+chrM	232	233	20.0	20.0
+chrM	233	234	19.0	19.0
+chrM	234	235	19.0	19.0
+chrM	235	236	19.0	19.0
+chrM	236	237	17.0	17.0
+chrM	237	238	17.0	17.0
+chrM	238	239	15.0	15.0
+chrM	239	240	15.0	15.0
+chrM	240	241	15.0	15.0
+chrM	241	242	10.0	10.0
+chrM	242	243	7.0	7.0
+chrM	243	244	7.0	7.0
+chrM	244	245	7.0	7.0
+chrM	245	246	7.0	7.0
+chrM	246	247	6.0	6.0
+chrM	247	248	5.0	5.0
+chrM	248	249	5.0	5.0
+chrM	249	250	5.0	5.0
+chrM	250	251	3.0	3.0
+chrM	251	252	0.0	0.0
+chrM	252	253	0.0	0.0
+chrM	253	254	0.0	0.0
+chrM	254	255	0.0	0.0
+chrM	255	256	0.0	0.0
+chrM	256	257	0.0	0.0
+chrM	257	258	0.0	0.0
+chrM	258	259	0.0	0.0
+chrM	259	260	0.0	0.0
+chrM	260	261	0.0	0.0
+chrM	261	262	0.0	0.0
+chrM	262	263	0.0	0.0
+chrM	263	264	0.0	0.0
+chrM	264	265	0.0	0.0
+chrM	265	266	0.0	0.0
+chrM	266	267	0.0	0.0
+chrM	267	268	0.0	0.0
+chrM	268	269	0.0	0.0
+chrM	269	270	0.0	0.0
+chrM	270	271	0.0	0.0
+chrM	271	272	0.0	0.0
+chrM	272	273	0.0	0.0
+chrM	273	274	0.0	0.0
+chrM	274	275	0.0	0.0
+chrM	275	276	0.0	0.0
+chrM	276	277	0.0	0.0
+chrM	277	278	0.0	0.0
+chrM	278	279	0.0	0.0
+chrM	279	280	0.0	0.0
+chrM	280	281	0.0	0.0
+chrM	281	282	0.0	0.0
+chrM	282	283	0.0	0.0
+chrM	283	284	0.0	0.0
+chrM	284	285	0.0	0.0
+chrM	285	286	0.0	0.0
+chrM	286	287	0.0	0.0
+chrM	287	288	0.0	0.0
+chrM	288	289	0.0	0.0
+chrM	289	290	0.0	0.0
+chrM	290	291	0.0	0.0
+chrM	291	292	0.0	0.0
+chrM	292	293	0.0	0.0
+chrM	293	294	0.0	0.0
+chrM	294	295	0.0	0.0
+chrM	295	296	0.0	0.0
+chrM	296	297	0.0	0.0
+chrM	297	298	0.0	0.0
+chrM	298	299	0.0	0.0
+chrM	299	300	0.0	0.0
+chrM	300	301	0.0	0.0
+chrM	301	302	0.0	0.0
+chrM	302	303	0.0	0.0
+chrM	303	304	0.0	0.0
+chrM	304	305	0.0	0.0
+chrM	305	306	0.0	0.0
+chrM	306	307	0.0	0.0
+chrM	307	308	0.0	0.0
+chrM	308	309	0.0	0.0
+chrM	309	310	0.0	0.0
+chrM	310	311	0.0	0.0
+chrM	311	312	0.0	0.0
+chrM	312	313	0.0	0.0
+chrM	313	314	0.0	0.0
+chrM	314	315	0.0	0.0
+chrM	315	316	0.0	0.0
+chrM	316	317	0.0	0.0
+chrM	317	318	0.0	0.0
+chrM	318	319	0.0	0.0
+chrM	319	320	0.0	0.0
+chrM	320	321	0.0	0.0
+chrM	321	322	0.0	0.0
+chrM	322	323	0.0	0.0
+chrM	323	324	0.0	0.0
+chrM	324	325	0.0	0.0
+chrM	325	326	0.0	0.0
+chrM	326	327	0.0	0.0
+chrM	327	328	0.0	0.0
+chrM	328	329	0.0	0.0
+chrM	329	330	0.0	0.0
+chrM	330	331	0.0	0.0
+chrM	331	332	0.0	0.0
+chrM	332	333	0.0	0.0
+chrM	333	334	0.0	0.0
+chrM	334	335	0.0	0.0
+chrM	335	336	0.0	0.0
+chrM	336	337	0.0	0.0
+chrM	337	338	0.0	0.0
+chrM	338	339	0.0	0.0
+chrM	339	340	0.0	0.0
+chrM	340	341	0.0	0.0
+chrM	341	342	0.0	0.0
+chrM	342	343	0.0	0.0
+chrM	343	344	0.0	0.0
+chrM	344	345	0.0	0.0
+chrM	345	346	0.0	0.0
+chrM	346	347	0.0	0.0
+chrM	347	348	0.0	0.0
+chrM	348	349	0.0	0.0
+chrM	349	350	0.0	0.0
+chrM	350	351	0.0	0.0
+chrM	351	352	0.0	0.0
+chrM	352	353	0.0	0.0
+chrM	353	354	0.0	0.0
+chrM	354	355	0.0	0.0
+chrM	355	356	0.0	0.0
+chrM	356	357	0.0	0.0
+chrM	357	358	0.0	0.0
+chrM	358	359	0.0	0.0
+chrM	359	360	0.0	0.0
+chrM	360	361	0.0	0.0
+chrM	361	362	0.0	0.0
+chrM	362	363	0.0	0.0
+chrM	363	364	0.0	0.0
+chrM	364	365	0.0	0.0
+chrM	365	366	0.0	0.0
+chrM	366	367	0.0	0.0
+chrM	367	368	0.0	0.0
+chrM	368	369	0.0	0.0
+chrM	369	370	0.0	0.0
+chrM	370	371	0.0	0.0
+chrM	371	372	0.0	0.0
+chrM	372	373	0.0	0.0
+chrM	373	374	0.0	0.0
+chrM	374	375	0.0	0.0
+chrM	375	376	0.0	0.0
+chrM	376	377	0.0	0.0
+chrM	377	378	0.0	0.0
+chrM	378	379	0.0	0.0
+chrM	379	380	0.0	0.0
+chrM	380	381	0.0	0.0
+chrM	381	382	0.0	0.0
+chrM	382	383	0.0	0.0
+chrM	383	384	0.0	0.0
+chrM	384	385	0.0	0.0
+chrM	385	386	0.0	0.0
+chrM	386	387	0.0	0.0
+chrM	387	388	0.0	0.0
+chrM	388	389	0.0	0.0
+chrM	389	390	0.0	0.0
+chrM	390	391	0.0	0.0
+chrM	391	392	0.0	0.0
+chrM	392	393	0.0	0.0
+chrM	393	394	0.0	0.0
+chrM	394	395	0.0	0.0
+chrM	395	396	0.0	0.0
+chrM	396	397	0.0	0.0
+chrM	397	398	0.0	0.0
+chrM	398	399	0.0	0.0
+chrM	399	400	0.0	0.0
+chrM	400	401	0.0	0.0
+chrM	401	402	0.0	0.0
+chrM	402	403	0.0	0.0
+chrM	403	404	0.0	0.0
+chrM	404	405	0.0	0.0
+chrM	405	406	0.0	0.0
+chrM	406	407	0.0	0.0
+chrM	407	408	0.0	0.0
+chrM	408	409	0.0	0.0
+chrM	409	410	0.0	0.0
+chrM	410	411	0.0	0.0
+chrM	411	412	0.0	0.0
+chrM	412	413	0.0	0.0
+chrM	413	414	0.0	0.0
+chrM	414	415	0.0	0.0
+chrM	415	416	0.0	0.0
+chrM	416	417	0.0	0.0
+chrM	417	418	0.0	0.0
+chrM	418	419	0.0	0.0
+chrM	419	420	0.0	0.0
+chrM	420	421	0.0	0.0
+chrM	421	422	0.0	0.0
+chrM	422	423	0.0	0.0
+chrM	423	424	0.0	0.0
+chrM	424	425	0.0	0.0
+chrM	425	426	0.0	0.0
+chrM	426	427	0.0	0.0
+chrM	427	428	0.0	0.0
+chrM	428	429	0.0	0.0
+chrM	429	430	0.0	0.0
+chrM	430	431	0.0	0.0
+chrM	431	432	0.0	0.0
+chrM	432	433	0.0	0.0
+chrM	433	434	0.0	0.0
+chrM	434	435	0.0	0.0
+chrM	435	436	0.0	0.0
+chrM	436	437	0.0	0.0
+chrM	437	438	0.0	0.0
+chrM	438	439	0.0	0.0
+chrM	439	440	0.0	0.0
+chrM	440	441	0.0	0.0
+chrM	441	442	0.0	0.0
+chrM	442	443	0.0	0.0
+chrM	443	444	0.0	0.0
+chrM	444	445	0.0	0.0
+chrM	445	446	0.0	0.0
+chrM	446	447	0.0	0.0
+chrM	447	448	0.0	0.0
+chrM	448	449	0.0	0.0
+chrM	449	450	0.0	0.0
+chrM	450	451	0.0	0.0
+chrM	451	452	0.0	0.0
+chrM	452	453	0.0	0.0
+chrM	453	454	0.0	0.0
+chrM	454	455	0.0	0.0
+chrM	455	456	0.0	0.0
+chrM	456	457	0.0	0.0
+chrM	457	458	0.0	0.0
+chrM	458	459	0.0	0.0
+chrM	459	460	0.0	0.0
+chrM	460	461	0.0	0.0
+chrM	461	462	0.0	0.0
+chrM	462	463	0.0	0.0
+chrM	463	464	0.0	0.0
+chrM	464	465	0.0	0.0
+chrM	465	466	0.0	0.0
+chrM	466	467	0.0	0.0
+chrM	467	468	0.0	0.0
+chrM	468	469	0.0	0.0
+chrM	469	470	0.0	0.0
+chrM	470	471	0.0	0.0
+chrM	471	472	0.0	0.0
+chrM	472	473	0.0	0.0
+chrM	473	474	0.0	0.0
+chrM	474	475	0.0	0.0
+chrM	475	476	0.0	0.0
+chrM	476	477	0.0	0.0
+chrM	477	478	0.0	0.0
+chrM	478	479	0.0	0.0
+chrM	479	480	0.0	0.0
+chrM	480	481	0.0	0.0
+chrM	481	482	0.0	0.0
+chrM	482	483	0.0	0.0
+chrM	483	484	0.0	0.0
+chrM	484	485	0.0	0.0
+chrM	485	486	0.0	0.0
+chrM	486	487	0.0	0.0
+chrM	487	488	0.0	0.0
+chrM	488	489	0.0	0.0
+chrM	489	490	0.0	0.0
+chrM	490	491	0.0	0.0
+chrM	491	492	0.0	0.0
+chrM	492	493	0.0	0.0
+chrM	493	494	0.0	0.0
+chrM	494	495	0.0	0.0
+chrM	495	496	0.0	0.0
+chrM	496	497	0.0	0.0
+chrM	497	498	0.0	0.0
+chrM	498	499	0.0	0.0
+chrM	499	500	0.0	0.0
+chrM	500	501	0.0	0.0
+chrM	501	502	0.0	0.0
+chrM	502	503	0.0	0.0
+chrM	503	504	0.0	0.0
+chrM	504	505	0.0	0.0
+chrM	505	506	0.0	0.0
+chrM	506	507	0.0	0.0
+chrM	507	508	0.0	0.0
+chrM	508	509	0.0	0.0
+chrM	509	510	0.0	0.0
+chrM	510	511	0.0	0.0
+chrM	511	512	0.0	0.0
+chrM	512	513	0.0	0.0
+chrM	513	514	0.0	0.0
+chrM	514	515	0.0	0.0
+chrM	515	516	0.0	0.0
+chrM	516	517	0.0	0.0
+chrM	517	518	0.0	0.0
+chrM	518	519	0.0	0.0
+chrM	519	520	0.0	0.0
+chrM	520	521	0.0	0.0
+chrM	521	522	0.0	0.0
+chrM	522	523	0.0	0.0
+chrM	523	524	0.0	0.0
+chrM	524	525	0.0	0.0
+chrM	525	526	0.0	0.0
+chrM	526	527	0.0	0.0
+chrM	527	528	0.0	0.0
+chrM	528	529	0.0	0.0
+chrM	529	530	0.0	0.0
+chrM	530	531	0.0	0.0
+chrM	531	532	0.0	0.0
+chrM	532	533	0.0	0.0
+chrM	533	534	0.0	0.0
+chrM	534	535	0.0	0.0
+chrM	535	536	0.0	0.0
+chrM	536	537	0.0	0.0
+chrM	537	538	0.0	0.0
+chrM	538	539	0.0	0.0
+chrM	539	540	0.0	0.0
+chrM	540	541	0.0	0.0
+chrM	541	542	0.0	0.0
+chrM	542	543	0.0	0.0
+chrM	543	544	0.0	0.0
+chrM	544	545	0.0	0.0
+chrM	545	546	0.0	0.0
+chrM	546	547	0.0	0.0
+chrM	547	548	0.0	0.0
+chrM	548	549	0.0	0.0
+chrM	549	550	0.0	0.0
+chrM	550	551	0.0	0.0
+chrM	551	552	0.0	0.0
+chrM	552	553	0.0	0.0
+chrM	553	554	0.0	0.0
+chrM	554	555	0.0	0.0
+chrM	555	556	0.0	0.0
+chrM	556	557	0.0	0.0
+chrM	557	558	0.0	0.0
+chrM	558	559	0.0	0.0
+chrM	559	560	0.0	0.0
+chrM	560	561	0.0	0.0
+chrM	561	562	0.0	0.0
+chrM	562	563	0.0	0.0
+chrM	563	564	0.0	0.0
+chrM	564	565	0.0	0.0
+chrM	565	566	0.0	0.0
+chrM	566	567	0.0	0.0
+chrM	567	568	0.0	0.0
+chrM	568	569	0.0	0.0
+chrM	569	570	0.0	0.0
+chrM	570	571	0.0	0.0
+chrM	571	572	0.0	0.0
+chrM	572	573	0.0	0.0
+chrM	573	574	0.0	0.0
+chrM	574	575	0.0	0.0
+chrM	575	576	0.0	0.0
+chrM	576	577	0.0	0.0
+chrM	577	578	0.0	0.0
+chrM	578	579	0.0	0.0
+chrM	579	580	0.0	0.0
+chrM	580	581	0.0	0.0
+chrM	581	582	0.0	0.0
+chrM	582	583	0.0	0.0
+chrM	583	584	0.0	0.0
+chrM	584	585	0.0	0.0
+chrM	585	586	0.0	0.0
+chrM	586	587	0.0	0.0
+chrM	587	588	0.0	0.0
+chrM	588	589	0.0	0.0
+chrM	589	590	0.0	0.0
+chrM	590	591	0.0	0.0
+chrM	591	592	0.0	0.0
+chrM	592	593	0.0	0.0
+chrM	593	594	0.0	0.0
+chrM	594	595	0.0	0.0
+chrM	595	596	0.0	0.0
+chrM	596	597	0.0	0.0
+chrM	597	598	0.0	0.0
+chrM	598	599	0.0	0.0
+chrM	599	600	0.0	0.0
+chrM	600	601	0.0	0.0
+chrM	601	602	0.0	0.0
+chrM	602	603	0.0	0.0
+chrM	603	604	0.0	0.0
+chrM	604	605	0.0	0.0
+chrM	605	606	0.0	0.0
+chrM	606	607	0.0	0.0
+chrM	607	608	0.0	0.0
+chrM	608	609	0.0	0.0
+chrM	609	610	0.0	0.0
+chrM	610	611	0.0	0.0
+chrM	611	612	0.0	0.0
+chrM	612	613	0.0	0.0
+chrM	613	614	0.0	0.0
+chrM	614	615	0.0	0.0
+chrM	615	616	0.0	0.0
+chrM	616	617	0.0	0.0
+chrM	617	618	0.0	0.0
+chrM	618	619	0.0	0.0
+chrM	619	620	0.0	0.0
+chrM	620	621	0.0	0.0
+chrM	621	622	0.0	0.0
+chrM	622	623	0.0	0.0
+chrM	623	624	0.0	0.0
+chrM	624	625	0.0	0.0
+chrM	625	626	0.0	0.0
+chrM	626	627	0.0	0.0
+chrM	627	628	0.0	0.0
+chrM	628	629	0.0	0.0
+chrM	629	630	0.0	0.0
+chrM	630	631	0.0	0.0
+chrM	631	632	0.0	0.0
+chrM	632	633	0.0	0.0
+chrM	633	634	0.0	0.0
+chrM	634	635	0.0	0.0
+chrM	635	636	0.0	0.0
+chrM	636	637	0.0	0.0
+chrM	637	638	0.0	0.0
+chrM	638	639	0.0	0.0
+chrM	639	640	0.0	0.0
+chrM	640	641	0.0	0.0
+chrM	641	642	0.0	0.0
+chrM	642	643	0.0	0.0
+chrM	643	644	0.0	0.0
+chrM	644	645	0.0	0.0
+chrM	645	646	0.0	0.0
+chrM	646	647	0.0	0.0
+chrM	647	648	0.0	0.0
+chrM	648	649	0.0	0.0
+chrM	649	650	0.0	0.0
+chrM	650	651	0.0	0.0
+chrM	651	652	0.0	0.0
+chrM	652	653	0.0	0.0
+chrM	653	654	0.0	0.0
+chrM	654	655	0.0	0.0
+chrM	655	656	0.0	0.0
+chrM	656	657	0.0	0.0
+chrM	657	658	0.0	0.0
+chrM	658	659	0.0	0.0
+chrM	659	660	0.0	0.0
+chrM	660	661	0.0	0.0
+chrM	661	662	0.0	0.0
+chrM	662	663	0.0	0.0
+chrM	663	664	0.0	0.0
+chrM	664	665	0.0	0.0
+chrM	665	666	0.0	0.0
+chrM	666	667	0.0	0.0
+chrM	667	668	0.0	0.0
+chrM	668	669	0.0	0.0
+chrM	669	670	0.0	0.0
+chrM	670	671	0.0	0.0
+chrM	671	672	0.0	0.0
+chrM	672	673	0.0	0.0
+chrM	673	674	0.0	0.0
+chrM	674	675	0.0	0.0
+chrM	675	676	0.0	0.0
+chrM	676	677	0.0	0.0
+chrM	677	678	0.0	0.0
+chrM	678	679	0.0	0.0
+chrM	679	680	0.0	0.0
+chrM	680	681	0.0	0.0
+chrM	681	682	0.0	0.0
+chrM	682	683	0.0	0.0
+chrM	683	684	0.0	0.0
+chrM	684	685	0.0	0.0
+chrM	685	686	0.0	0.0
+chrM	686	687	0.0	0.0
+chrM	687	688	0.0	0.0
+chrM	688	689	0.0	0.0
+chrM	689	690	0.0	0.0
+chrM	690	691	0.0	0.0
+chrM	691	692	0.0	0.0
+chrM	692	693	0.0	0.0
+chrM	693	694	0.0	0.0
+chrM	694	695	0.0	0.0
+chrM	695	696	0.0	0.0
+chrM	696	697	0.0	0.0
+chrM	697	698	0.0	0.0
+chrM	698	699	0.0	0.0
+chrM	699	700	0.0	0.0
+chrM	700	701	0.0	0.0
+chrM	701	702	0.0	0.0
+chrM	702	703	0.0	0.0
+chrM	703	704	0.0	0.0
+chrM	704	705	0.0	0.0
+chrM	705	706	0.0	0.0
+chrM	706	707	0.0	0.0
+chrM	707	708	0.0	0.0
+chrM	708	709	0.0	0.0
+chrM	709	710	0.0	0.0
+chrM	710	711	0.0	0.0
+chrM	711	712	0.0	0.0
+chrM	712	713	0.0	0.0
+chrM	713	714	0.0	0.0
+chrM	714	715	0.0	0.0
+chrM	715	716	0.0	0.0
+chrM	716	717	0.0	0.0
+chrM	717	718	0.0	0.0
+chrM	718	719	0.0	0.0
+chrM	719	720	0.0	0.0
+chrM	720	721	0.0	0.0
+chrM	721	722	0.0	0.0
+chrM	722	723	0.0	0.0
+chrM	723	724	0.0	0.0
+chrM	724	725	0.0	0.0
+chrM	725	726	0.0	0.0
+chrM	726	727	0.0	0.0
+chrM	727	728	0.0	0.0
+chrM	728	729	0.0	0.0
+chrM	729	730	0.0	0.0
+chrM	730	731	0.0	0.0
+chrM	731	732	0.0	0.0
+chrM	732	733	0.0	0.0
+chrM	733	734	0.0	0.0
+chrM	734	735	0.0	0.0
+chrM	735	736	0.0	0.0
+chrM	736	737	0.0	0.0
+chrM	737	738	0.0	0.0
+chrM	738	739	0.0	0.0
+chrM	739	740	0.0	0.0
+chrM	740	741	0.0	0.0
+chrM	741	742	0.0	0.0
+chrM	742	743	0.0	0.0
+chrM	743	744	0.0	0.0
+chrM	744	745	0.0	0.0
+chrM	745	746	0.0	0.0
+chrM	746	747	0.0	0.0
+chrM	747	748	0.0	0.0
+chrM	748	749	0.0	0.0
+chrM	749	750	0.0	0.0
+chrM	750	751	0.0	0.0
+chrM	751	752	0.0	0.0
+chrM	752	753	0.0	0.0
+chrM	753	754	0.0	0.0
+chrM	754	755	0.0	0.0
+chrM	755	756	0.0	0.0
+chrM	756	757	0.0	0.0
+chrM	757	758	0.0	0.0
+chrM	758	759	0.0	0.0
+chrM	759	760	0.0	0.0
+chrM	760	761	0.0	0.0
+chrM	761	762	0.0	0.0
+chrM	762	763	0.0	0.0
+chrM	763	764	0.0	0.0
+chrM	764	765	0.0	0.0
+chrM	765	766	0.0	0.0
+chrM	766	767	0.0	0.0
+chrM	767	768	0.0	0.0
+chrM	768	769	0.0	0.0
+chrM	769	770	0.0	0.0
+chrM	770	771	0.0	0.0
+chrM	771	772	0.0	0.0
+chrM	772	773	0.0	0.0
+chrM	773	774	0.0	0.0
+chrM	774	775	0.0	0.0
+chrM	775	776	0.0	0.0
+chrM	776	777	0.0	0.0
+chrM	777	778	0.0	0.0
+chrM	778	779	0.0	0.0
+chrM	779	780	0.0	0.0
+chrM	780	781	0.0	0.0
+chrM	781	782	0.0	0.0
+chrM	782	783	0.0	0.0
+chrM	783	784	0.0	0.0
+chrM	784	785	0.0	0.0
+chrM	785	786	0.0	0.0
+chrM	786	787	0.0	0.0
+chrM	787	788	0.0	0.0
+chrM	788	789	0.0	0.0
+chrM	789	790	0.0	0.0
+chrM	790	791	0.0	0.0
+chrM	791	792	0.0	0.0
+chrM	792	793	0.0	0.0
+chrM	793	794	0.0	0.0
+chrM	794	795	0.0	0.0
+chrM	795	796	0.0	0.0
+chrM	796	797	0.0	0.0
+chrM	797	798	0.0	0.0
+chrM	798	799	0.0	0.0
+chrM	799	800	0.0	0.0
+chrM	800	801	0.0	0.0
+chrM	801	802	0.0	0.0
+chrM	802	803	0.0	0.0
+chrM	803	804	0.0	0.0
+chrM	804	805	0.0	0.0
+chrM	805	806	0.0	0.0
+chrM	806	807	0.0	0.0
+chrM	807	808	0.0	0.0
+chrM	808	809	0.0	0.0
+chrM	809	810	0.0	0.0
+chrM	810	811	0.0	0.0
+chrM	811	812	0.0	0.0
+chrM	812	813	0.0	0.0
+chrM	813	814	0.0	0.0
+chrM	814	815	0.0	0.0
+chrM	815	816	0.0	0.0
+chrM	816	817	0.0	0.0
+chrM	817	818	0.0	0.0
+chrM	818	819	0.0	0.0
+chrM	819	820	0.0	0.0
+chrM	820	821	0.0	0.0
+chrM	821	822	0.0	0.0
+chrM	822	823	0.0	0.0
+chrM	823	824	0.0	0.0
+chrM	824	825	0.0	0.0
+chrM	825	826	0.0	0.0
+chrM	826	827	0.0	0.0
+chrM	827	828	0.0	0.0
+chrM	828	829	0.0	0.0
+chrM	829	830	0.0	0.0
+chrM	830	831	0.0	0.0
+chrM	831	832	0.0	0.0
+chrM	832	833	0.0	0.0
+chrM	833	834	0.0	0.0
+chrM	834	835	0.0	0.0
+chrM	835	836	0.0	0.0
+chrM	836	837	0.0	0.0
+chrM	837	838	0.0	0.0
+chrM	838	839	0.0	0.0
+chrM	839	840	0.0	0.0
+chrM	840	841	0.0	0.0
+chrM	841	842	0.0	0.0
+chrM	842	843	0.0	0.0
+chrM	843	844	0.0	0.0
+chrM	844	845	0.0	0.0
+chrM	845	846	0.0	0.0
+chrM	846	847	0.0	0.0
+chrM	847	848	0.0	0.0
+chrM	848	849	0.0	0.0
+chrM	849	850	0.0	0.0
+chrM	850	851	0.0	0.0
+chrM	851	852	0.0	0.0
+chrM	852	853	0.0	0.0
+chrM	853	854	0.0	0.0
+chrM	854	855	0.0	0.0
+chrM	855	856	0.0	0.0
+chrM	856	857	0.0	0.0
+chrM	857	858	0.0	0.0
+chrM	858	859	0.0	0.0
+chrM	859	860	0.0	0.0
+chrM	860	861	0.0	0.0
+chrM	861	862	0.0	0.0
+chrM	862	863	0.0	0.0
+chrM	863	864	0.0	0.0
+chrM	864	865	0.0	0.0
+chrM	865	866	0.0	0.0
+chrM	866	867	0.0	0.0
+chrM	867	868	0.0	0.0
+chrM	868	869	0.0	0.0
+chrM	869	870	0.0	0.0
+chrM	870	871	0.0	0.0
+chrM	871	872	0.0	0.0
+chrM	872	873	0.0	0.0
+chrM	873	874	0.0	0.0
+chrM	874	875	0.0	0.0
+chrM	875	876	0.0	0.0
+chrM	876	877	0.0	0.0
+chrM	877	878	0.0	0.0
+chrM	878	879	0.0	0.0
+chrM	879	880	0.0	0.0
+chrM	880	881	0.0	0.0
+chrM	881	882	0.0	0.0
+chrM	882	883	0.0	0.0
+chrM	883	884	0.0	0.0
+chrM	884	885	0.0	0.0
+chrM	885	886	0.0	0.0
+chrM	886	887	0.0	0.0
+chrM	887	888	0.0	0.0
+chrM	888	889	0.0	0.0
+chrM	889	890	0.0	0.0
+chrM	890	891	0.0	0.0
+chrM	891	892	0.0	0.0
+chrM	892	893	0.0	0.0
+chrM	893	894	0.0	0.0
+chrM	894	895	0.0	0.0
+chrM	895	896	0.0	0.0
+chrM	896	897	0.0	0.0
+chrM	897	898	0.0	0.0
+chrM	898	899	0.0	0.0
+chrM	899	900	0.0	0.0
+chrM	900	901	0.0	0.0
+chrM	901	902	0.0	0.0
+chrM	902	903	0.0	0.0
+chrM	903	904	0.0	0.0
+chrM	904	905	0.0	0.0
+chrM	905	906	0.0	0.0
+chrM	906	907	0.0	0.0
+chrM	907	908	0.0	0.0
+chrM	908	909	0.0	0.0
+chrM	909	910	0.0	0.0
+chrM	910	911	0.0	0.0
+chrM	911	912	0.0	0.0
+chrM	912	913	0.0	0.0
+chrM	913	914	0.0	0.0
+chrM	914	915	0.0	0.0
+chrM	915	916	0.0	0.0
+chrM	916	917	0.0	0.0
+chrM	917	918	0.0	0.0
+chrM	918	919	0.0	0.0
+chrM	919	920	0.0	0.0
+chrM	920	921	0.0	0.0
+chrM	921	922	0.0	0.0
+chrM	922	923	0.0	0.0
+chrM	923	924	0.0	0.0
+chrM	924	925	0.0	0.0
+chrM	925	926	0.0	0.0
+chrM	926	927	0.0	0.0
+chrM	927	928	0.0	0.0
+chrM	928	929	0.0	0.0
+chrM	929	930	0.0	0.0
+chrM	930	931	0.0	0.0
+chrM	931	932	0.0	0.0
+chrM	932	933	0.0	0.0
+chrM	933	934	0.0	0.0
+chrM	934	935	0.0	0.0
+chrM	935	936	0.0	0.0
+chrM	936	937	0.0	0.0
+chrM	937	938	0.0	0.0
+chrM	938	939	0.0	0.0
+chrM	939	940	0.0	0.0
+chrM	940	941	0.0	0.0
+chrM	941	942	0.0	0.0
+chrM	942	943	0.0	0.0
+chrM	943	944	0.0	0.0
+chrM	944	945	0.0	0.0
+chrM	945	946	0.0	0.0
+chrM	946	947	0.0	0.0
+chrM	947	948	0.0	0.0
+chrM	948	949	0.0	0.0
+chrM	949	950	0.0	0.0
+chrM	950	951	0.0	0.0
+chrM	951	952	0.0	0.0
+chrM	952	953	0.0	0.0
+chrM	953	954	0.0	0.0
+chrM	954	955	0.0	0.0
+chrM	955	956	0.0	0.0
+chrM	956	957	0.0	0.0
+chrM	957	958	0.0	0.0
+chrM	958	959	0.0	0.0
+chrM	959	960	0.0	0.0
+chrM	960	961	0.0	0.0
+chrM	961	962	0.0	0.0
+chrM	962	963	0.0	0.0
+chrM	963	964	0.0	0.0
+chrM	964	965	0.0	0.0
+chrM	965	966	0.0	0.0
+chrM	966	967	0.0	0.0
+chrM	967	968	0.0	0.0
+chrM	968	969	0.0	0.0
+chrM	969	970	0.0	0.0
+chrM	970	971	0.0	0.0
+chrM	971	972	0.0	0.0
+chrM	972	973	0.0	0.0
+chrM	973	974	0.0	0.0
+chrM	974	975	0.0	0.0
+chrM	975	976	0.0	0.0
+chrM	976	977	0.0	0.0
+chrM	977	978	0.0	0.0
+chrM	978	979	0.0	0.0
+chrM	979	980	0.0	0.0
+chrM	980	981	0.0	0.0
+chrM	981	982	0.0	0.0
+chrM	982	983	0.0	0.0
+chrM	983	984	0.0	0.0
+chrM	984	985	0.0	0.0
+chrM	985	986	0.0	0.0
+chrM	986	987	0.0	0.0
+chrM	987	988	0.0	0.0
+chrM	988	989	0.0	0.0
+chrM	989	990	0.0	0.0
+chrM	990	991	0.0	0.0
+chrM	991	992	0.0	0.0
+chrM	992	993	0.0	0.0
+chrM	993	994	0.0	0.0
+chrM	994	995	0.0	0.0
+chrM	995	996	0.0	0.0
+chrM	996	997	0.0	0.0
+chrM	997	998	0.0	0.0
+chrM	998	999	0.0	0.0
+chrM	999	1000	0.0	0.0
+chrM	1000	1001	0.0	0.0
+chrM	1001	1002	0.0	0.0
+chrM	1002	1003	0.0	0.0
+chrM	1003	1004	0.0	0.0
+chrM	1004	1005	0.0	0.0
+chrM	1005	1006	0.0	0.0
+chrM	1006	1007	0.0	0.0
+chrM	1007	1008	0.0	0.0
+chrM	1008	1009	0.0	0.0
+chrM	1009	1010	0.0	0.0
+chrM	1010	1011	0.0	0.0
+chrM	1011	1012	0.0	0.0
+chrM	1012	1013	0.0	0.0
+chrM	1013	1014	0.0	0.0
+chrM	1014	1015	0.0	0.0
+chrM	1015	1016	0.0	0.0
+chrM	1016	1017	0.0	0.0
+chrM	1017	1018	0.0	0.0
+chrM	1018	1019	0.0	0.0
+chrM	1019	1020	0.0	0.0
+chrM	1020	1021	0.0	0.0
+chrM	1021	1022	0.0	0.0
+chrM	1022	1023	0.0	0.0
+chrM	1023	1024	0.0	0.0
+chrM	1024	1025	0.0	0.0
+chrM	1025	1026	0.0	0.0
+chrM	1026	1027	0.0	0.0
+chrM	1027	1028	0.0	0.0
+chrM	1028	1029	0.0	0.0
+chrM	1029	1030	0.0	0.0
+chrM	1030	1031	0.0	0.0
+chrM	1031	1032	0.0	0.0
+chrM	1032	1033	0.0	0.0
+chrM	1033	1034	0.0	0.0
+chrM	1034	1035	0.0	0.0
+chrM	1035	1036	0.0	0.0
+chrM	1036	1037	0.0	0.0
+chrM	1037	1038	0.0	0.0
+chrM	1038	1039	0.0	0.0
+chrM	1039	1040	0.0	0.0
+chrM	1040	1041	0.0	0.0
+chrM	1041	1042	0.0	0.0
+chrM	1042	1043	0.0	0.0
+chrM	1043	1044	0.0	0.0
+chrM	1044	1045	0.0	0.0
+chrM	1045	1046	0.0	0.0
+chrM	1046	1047	0.0	0.0
+chrM	1047	1048	0.0	0.0
+chrM	1048	1049	0.0	0.0
+chrM	1049	1050	0.0	0.0
+chrM	1050	1051	0.0	0.0
+chrM	1051	1052	0.0	0.0
+chrM	1052	1053	0.0	0.0
+chrM	1053	1054	0.0	0.0
+chrM	1054	1055	0.0	0.0
+chrM	1055	1056	0.0	0.0
+chrM	1056	1057	0.0	0.0
+chrM	1057	1058	0.0	0.0
+chrM	1058	1059	0.0	0.0
+chrM	1059	1060	0.0	0.0
+chrM	1060	1061	0.0	0.0
+chrM	1061	1062	0.0	0.0
+chrM	1062	1063	0.0	0.0
+chrM	1063	1064	0.0	0.0
+chrM	1064	1065	0.0	0.0
+chrM	1065	1066	0.0	0.0
+chrM	1066	1067	0.0	0.0
+chrM	1067	1068	0.0	0.0
+chrM	1068	1069	0.0	0.0
+chrM	1069	1070	0.0	0.0
+chrM	1070	1071	0.0	0.0
+chrM	1071	1072	0.0	0.0
+chrM	1072	1073	0.0	0.0
+chrM	1073	1074	0.0	0.0
+chrM	1074	1075	0.0	0.0
+chrM	1075	1076	0.0	0.0
+chrM	1076	1077	0.0	0.0
+chrM	1077	1078	0.0	0.0
+chrM	1078	1079	0.0	0.0
+chrM	1079	1080	0.0	0.0
+chrM	1080	1081	0.0	0.0
+chrM	1081	1082	0.0	0.0
+chrM	1082	1083	0.0	0.0
+chrM	1083	1084	0.0	0.0
+chrM	1084	1085	0.0	0.0
+chrM	1085	1086	0.0	0.0
+chrM	1086	1087	0.0	0.0
+chrM	1087	1088	0.0	0.0
+chrM	1088	1089	0.0	0.0
+chrM	1089	1090	0.0	0.0
+chrM	1090	1091	0.0	0.0
+chrM	1091	1092	0.0	0.0
+chrM	1092	1093	0.0	0.0
+chrM	1093	1094	0.0	0.0
+chrM	1094	1095	0.0	0.0
+chrM	1095	1096	0.0	0.0
+chrM	1096	1097	0.0	0.0
+chrM	1097	1098	0.0	0.0
+chrM	1098	1099	0.0	0.0
+chrM	1099	1100	0.0	0.0
+chrM	1100	1101	0.0	0.0
+chrM	1101	1102	0.0	0.0
+chrM	1102	1103	0.0	0.0
+chrM	1103	1104	0.0	0.0
+chrM	1104	1105	0.0	0.0
+chrM	1105	1106	0.0	0.0
+chrM	1106	1107	0.0	0.0
+chrM	1107	1108	0.0	0.0
+chrM	1108	1109	0.0	0.0
+chrM	1109	1110	0.0	0.0
+chrM	1110	1111	0.0	0.0
+chrM	1111	1112	0.0	0.0
+chrM	1112	1113	0.0	0.0
+chrM	1113	1114	0.0	0.0
+chrM	1114	1115	0.0	0.0
+chrM	1115	1116	0.0	0.0
+chrM	1116	1117	0.0	0.0
+chrM	1117	1118	0.0	0.0
+chrM	1118	1119	0.0	0.0
+chrM	1119	1120	0.0	0.0
+chrM	1120	1121	0.0	0.0
+chrM	1121	1122	0.0	0.0
+chrM	1122	1123	0.0	0.0
+chrM	1123	1124	0.0	0.0
+chrM	1124	1125	0.0	0.0
+chrM	1125	1126	0.0	0.0
+chrM	1126	1127	0.0	0.0
+chrM	1127	1128	0.0	0.0
+chrM	1128	1129	0.0	0.0
+chrM	1129	1130	0.0	0.0
+chrM	1130	1131	0.0	0.0
+chrM	1131	1132	0.0	0.0
+chrM	1132	1133	0.0	0.0
+chrM	1133	1134	0.0	0.0
+chrM	1134	1135	0.0	0.0
+chrM	1135	1136	0.0	0.0
+chrM	1136	1137	0.0	0.0
+chrM	1137	1138	0.0	0.0
+chrM	1138	1139	0.0	0.0
+chrM	1139	1140	0.0	0.0
+chrM	1140	1141	0.0	0.0
+chrM	1141	1142	0.0	0.0
+chrM	1142	1143	0.0	0.0
+chrM	1143	1144	0.0	0.0
+chrM	1144	1145	0.0	0.0
+chrM	1145	1146	0.0	0.0
+chrM	1146	1147	0.0	0.0
+chrM	1147	1148	0.0	0.0
+chrM	1148	1149	0.0	0.0
+chrM	1149	1150	0.0	0.0
+chrM	1150	1151	0.0	0.0
+chrM	1151	1152	0.0	0.0
+chrM	1152	1153	0.0	0.0
+chrM	1153	1154	0.0	0.0
+chrM	1154	1155	0.0	0.0
+chrM	1155	1156	0.0	0.0
+chrM	1156	1157	0.0	0.0
+chrM	1157	1158	0.0	0.0
+chrM	1158	1159	0.0	0.0
+chrM	1159	1160	0.0	0.0
+chrM	1160	1161	0.0	0.0
+chrM	1161	1162	0.0	0.0
+chrM	1162	1163	0.0	0.0
+chrM	1163	1164	0.0	0.0
+chrM	1164	1165	0.0	0.0
+chrM	1165	1166	0.0	0.0
+chrM	1166	1167	0.0	0.0
+chrM	1167	1168	0.0	0.0
+chrM	1168	1169	0.0	0.0
+chrM	1169	1170	0.0	0.0
+chrM	1170	1171	0.0	0.0
+chrM	1171	1172	0.0	0.0
+chrM	1172	1173	0.0	0.0
+chrM	1173	1174	0.0	0.0
+chrM	1174	1175	0.0	0.0
+chrM	1175	1176	0.0	0.0
+chrM	1176	1177	0.0	0.0
+chrM	1177	1178	0.0	0.0
+chrM	1178	1179	0.0	0.0
+chrM	1179	1180	0.0	0.0
+chrM	1180	1181	0.0	0.0
+chrM	1181	1182	0.0	0.0
+chrM	1182	1183	0.0	0.0
+chrM	1183	1184	0.0	0.0
+chrM	1184	1185	0.0	0.0
+chrM	1185	1186	0.0	0.0
+chrM	1186	1187	0.0	0.0
+chrM	1187	1188	0.0	0.0
+chrM	1188	1189	0.0	0.0
+chrM	1189	1190	0.0	0.0
+chrM	1190	1191	0.0	0.0
+chrM	1191	1192	0.0	0.0
+chrM	1192	1193	0.0	0.0
+chrM	1193	1194	0.0	0.0
+chrM	1194	1195	0.0	0.0
+chrM	1195	1196	0.0	0.0
+chrM	1196	1197	0.0	0.0
+chrM	1197	1198	0.0	0.0
+chrM	1198	1199	0.0	0.0
+chrM	1199	1200	0.0	0.0
+chrM	1200	1201	0.0	0.0
+chrM	1201	1202	0.0	0.0
+chrM	1202	1203	0.0	0.0
+chrM	1203	1204	0.0	0.0
+chrM	1204	1205	0.0	0.0
+chrM	1205	1206	0.0	0.0
+chrM	1206	1207	0.0	0.0
+chrM	1207	1208	0.0	0.0
+chrM	1208	1209	0.0	0.0
+chrM	1209	1210	0.0	0.0
+chrM	1210	1211	0.0	0.0
+chrM	1211	1212	0.0	0.0
+chrM	1212	1213	0.0	0.0
+chrM	1213	1214	0.0	0.0
+chrM	1214	1215	0.0	0.0
+chrM	1215	1216	0.0	0.0
+chrM	1216	1217	0.0	0.0
+chrM	1217	1218	0.0	0.0
+chrM	1218	1219	0.0	0.0
+chrM	1219	1220	0.0	0.0
+chrM	1220	1221	0.0	0.0
+chrM	1221	1222	0.0	0.0
+chrM	1222	1223	0.0	0.0
+chrM	1223	1224	0.0	0.0
+chrM	1224	1225	0.0	0.0
+chrM	1225	1226	0.0	0.0
+chrM	1226	1227	0.0	0.0
+chrM	1227	1228	0.0	0.0
+chrM	1228	1229	0.0	0.0
+chrM	1229	1230	0.0	0.0
+chrM	1230	1231	0.0	0.0
+chrM	1231	1232	0.0	0.0
+chrM	1232	1233	0.0	0.0
+chrM	1233	1234	0.0	0.0
+chrM	1234	1235	0.0	0.0
+chrM	1235	1236	0.0	0.0
+chrM	1236	1237	0.0	0.0
+chrM	1237	1238	0.0	0.0
+chrM	1238	1239	0.0	0.0
+chrM	1239	1240	0.0	0.0
+chrM	1240	1241	0.0	0.0
+chrM	1241	1242	0.0	0.0
+chrM	1242	1243	0.0	0.0
+chrM	1243	1244	0.0	0.0
+chrM	1244	1245	0.0	0.0
+chrM	1245	1246	0.0	0.0
+chrM	1246	1247	0.0	0.0
+chrM	1247	1248	0.0	0.0
+chrM	1248	1249	0.0	0.0
+chrM	1249	1250	0.0	0.0
+chrM	1250	1251	0.0	0.0
+chrM	1251	1252	0.0	0.0
+chrM	1252	1253	0.0	0.0
+chrM	1253	1254	0.0	0.0
+chrM	1254	1255	0.0	0.0
+chrM	1255	1256	0.0	0.0
+chrM	1256	1257	0.0	0.0
+chrM	1257	1258	0.0	0.0
+chrM	1258	1259	0.0	0.0
+chrM	1259	1260	0.0	0.0
+chrM	1260	1261	0.0	0.0
+chrM	1261	1262	0.0	0.0
+chrM	1262	1263	0.0	0.0
+chrM	1263	1264	0.0	0.0
+chrM	1264	1265	0.0	0.0
+chrM	1265	1266	0.0	0.0
+chrM	1266	1267	0.0	0.0
+chrM	1267	1268	0.0	0.0
+chrM	1268	1269	0.0	0.0
+chrM	1269	1270	0.0	0.0
+chrM	1270	1271	0.0	0.0
+chrM	1271	1272	0.0	0.0
+chrM	1272	1273	0.0	0.0
+chrM	1273	1274	0.0	0.0
+chrM	1274	1275	0.0	0.0
+chrM	1275	1276	0.0	0.0
+chrM	1276	1277	0.0	0.0
+chrM	1277	1278	0.0	0.0
+chrM	1278	1279	0.0	0.0
+chrM	1279	1280	0.0	0.0
+chrM	1280	1281	0.0	0.0
+chrM	1281	1282	0.0	0.0
+chrM	1282	1283	0.0	0.0
+chrM	1283	1284	0.0	0.0
+chrM	1284	1285	0.0	0.0
+chrM	1285	1286	0.0	0.0
+chrM	1286	1287	0.0	0.0
+chrM	1287	1288	0.0	0.0
+chrM	1288	1289	0.0	0.0
+chrM	1289	1290	0.0	0.0
+chrM	1290	1291	0.0	0.0
+chrM	1291	1292	0.0	0.0
+chrM	1292	1293	0.0	0.0
+chrM	1293	1294	0.0	0.0
+chrM	1294	1295	0.0	0.0
+chrM	1295	1296	0.0	0.0
+chrM	1296	1297	0.0	0.0
+chrM	1297	1298	0.0	0.0
+chrM	1298	1299	0.0	0.0
+chrM	1299	1300	0.0	0.0
+chrM	1300	1301	0.0	0.0
+chrM	1301	1302	0.0	0.0
+chrM	1302	1303	0.0	0.0
+chrM	1303	1304	0.0	0.0
+chrM	1304	1305	0.0	0.0
+chrM	1305	1306	0.0	0.0
+chrM	1306	1307	0.0	0.0
+chrM	1307	1308	0.0	0.0
+chrM	1308	1309	0.0	0.0
+chrM	1309	1310	0.0	0.0
+chrM	1310	1311	0.0	0.0
+chrM	1311	1312	0.0	0.0
+chrM	1312	1313	0.0	0.0
+chrM	1313	1314	0.0	0.0
+chrM	1314	1315	0.0	0.0
+chrM	1315	1316	0.0	0.0
+chrM	1316	1317	0.0	0.0
+chrM	1317	1318	0.0	0.0
+chrM	1318	1319	0.0	0.0
+chrM	1319	1320	0.0	0.0
+chrM	1320	1321	0.0	0.0
+chrM	1321	1322	0.0	0.0
+chrM	1322	1323	0.0	0.0
+chrM	1323	1324	0.0	0.0
+chrM	1324	1325	0.0	0.0
+chrM	1325	1326	0.0	0.0
+chrM	1326	1327	0.0	0.0
+chrM	1327	1328	0.0	0.0
+chrM	1328	1329	0.0	0.0
+chrM	1329	1330	0.0	0.0
+chrM	1330	1331	0.0	0.0
+chrM	1331	1332	0.0	0.0
+chrM	1332	1333	0.0	0.0
+chrM	1333	1334	0.0	0.0
+chrM	1334	1335	0.0	0.0
+chrM	1335	1336	0.0	0.0
+chrM	1336	1337	0.0	0.0
+chrM	1337	1338	0.0	0.0
+chrM	1338	1339	0.0	0.0
+chrM	1339	1340	0.0	0.0
+chrM	1340	1341	0.0	0.0
+chrM	1341	1342	0.0	0.0
+chrM	1342	1343	0.0	0.0
+chrM	1343	1344	0.0	0.0
+chrM	1344	1345	0.0	0.0
+chrM	1345	1346	0.0	0.0
+chrM	1346	1347	0.0	0.0
+chrM	1347	1348	0.0	0.0
+chrM	1348	1349	0.0	0.0
+chrM	1349	1350	0.0	0.0
+chrM	1350	1351	0.0	0.0
+chrM	1351	1352	0.0	0.0
+chrM	1352	1353	0.0	0.0
+chrM	1353	1354	0.0	0.0
+chrM	1354	1355	0.0	0.0
+chrM	1355	1356	0.0	0.0
+chrM	1356	1357	0.0	0.0
+chrM	1357	1358	0.0	0.0
+chrM	1358	1359	0.0	0.0
+chrM	1359	1360	0.0	0.0
+chrM	1360	1361	0.0	0.0
+chrM	1361	1362	0.0	0.0
+chrM	1362	1363	0.0	0.0
+chrM	1363	1364	0.0	0.0
+chrM	1364	1365	0.0	0.0
+chrM	1365	1366	0.0	0.0
+chrM	1366	1367	0.0	0.0
+chrM	1367	1368	0.0	0.0
+chrM	1368	1369	0.0	0.0
+chrM	1369	1370	0.0	0.0
+chrM	1370	1371	0.0	0.0
+chrM	1371	1372	0.0	0.0
+chrM	1372	1373	0.0	0.0
+chrM	1373	1374	0.0	0.0
+chrM	1374	1375	0.0	0.0
+chrM	1375	1376	0.0	0.0
+chrM	1376	1377	0.0	0.0
+chrM	1377	1378	0.0	0.0
+chrM	1378	1379	0.0	0.0
+chrM	1379	1380	0.0	0.0
+chrM	1380	1381	0.0	0.0
+chrM	1381	1382	0.0	0.0
+chrM	1382	1383	0.0	0.0
+chrM	1383	1384	0.0	0.0
+chrM	1384	1385	0.0	0.0
+chrM	1385	1386	0.0	0.0
+chrM	1386	1387	0.0	0.0
+chrM	1387	1388	0.0	0.0
+chrM	1388	1389	0.0	0.0
+chrM	1389	1390	0.0	0.0
+chrM	1390	1391	0.0	0.0
+chrM	1391	1392	0.0	0.0
+chrM	1392	1393	0.0	0.0
+chrM	1393	1394	0.0	0.0
+chrM	1394	1395	0.0	0.0
+chrM	1395	1396	0.0	0.0
+chrM	1396	1397	0.0	0.0
+chrM	1397	1398	0.0	0.0
+chrM	1398	1399	0.0	0.0
+chrM	1399	1400	0.0	0.0
+chrM	1400	1401	0.0	0.0
+chrM	1401	1402	0.0	0.0
+chrM	1402	1403	0.0	0.0
+chrM	1403	1404	0.0	0.0
+chrM	1404	1405	0.0	0.0
+chrM	1405	1406	0.0	0.0
+chrM	1406	1407	0.0	0.0
+chrM	1407	1408	0.0	0.0
+chrM	1408	1409	0.0	0.0
+chrM	1409	1410	0.0	0.0
+chrM	1410	1411	0.0	0.0
+chrM	1411	1412	0.0	0.0
+chrM	1412	1413	0.0	0.0
+chrM	1413	1414	0.0	0.0
+chrM	1414	1415	0.0	0.0
+chrM	1415	1416	0.0	0.0
+chrM	1416	1417	0.0	0.0
+chrM	1417	1418	0.0	0.0
+chrM	1418	1419	0.0	0.0
+chrM	1419	1420	0.0	0.0
+chrM	1420	1421	0.0	0.0
+chrM	1421	1422	0.0	0.0
+chrM	1422	1423	0.0	0.0
+chrM	1423	1424	0.0	0.0
+chrM	1424	1425	0.0	0.0
+chrM	1425	1426	0.0	0.0
+chrM	1426	1427	0.0	0.0
+chrM	1427	1428	0.0	0.0
+chrM	1428	1429	0.0	0.0
+chrM	1429	1430	0.0	0.0
+chrM	1430	1431	0.0	0.0
+chrM	1431	1432	0.0	0.0
+chrM	1432	1433	0.0	0.0
+chrM	1433	1434	0.0	0.0
+chrM	1434	1435	0.0	0.0
+chrM	1435	1436	0.0	0.0
+chrM	1436	1437	0.0	0.0
+chrM	1437	1438	0.0	0.0
+chrM	1438	1439	0.0	0.0
+chrM	1439	1440	0.0	0.0
+chrM	1440	1441	0.0	0.0
+chrM	1441	1442	0.0	0.0
+chrM	1442	1443	0.0	0.0
+chrM	1443	1444	0.0	0.0
+chrM	1444	1445	0.0	0.0
+chrM	1445	1446	0.0	0.0
+chrM	1446	1447	0.0	0.0
+chrM	1447	1448	0.0	0.0
+chrM	1448	1449	0.0	0.0
+chrM	1449	1450	0.0	0.0
+chrM	1450	1451	0.0	0.0
+chrM	1451	1452	0.0	0.0
+chrM	1452	1453	0.0	0.0
+chrM	1453	1454	0.0	0.0
+chrM	1454	1455	0.0	0.0
+chrM	1455	1456	0.0	0.0
+chrM	1456	1457	0.0	0.0
+chrM	1457	1458	0.0	0.0
+chrM	1458	1459	0.0	0.0
+chrM	1459	1460	0.0	0.0
+chrM	1460	1461	0.0	0.0
+chrM	1461	1462	0.0	0.0
+chrM	1462	1463	0.0	0.0
+chrM	1463	1464	0.0	0.0
+chrM	1464	1465	0.0	0.0
+chrM	1465	1466	0.0	0.0
+chrM	1466	1467	0.0	0.0
+chrM	1467	1468	0.0	0.0
+chrM	1468	1469	0.0	0.0
+chrM	1469	1470	0.0	0.0
+chrM	1470	1471	0.0	0.0
+chrM	1471	1472	0.0	0.0
+chrM	1472	1473	0.0	0.0
+chrM	1473	1474	0.0	0.0
+chrM	1474	1475	0.0	0.0
+chrM	1475	1476	0.0	0.0
+chrM	1476	1477	0.0	0.0
+chrM	1477	1478	0.0	0.0
+chrM	1478	1479	0.0	0.0
+chrM	1479	1480	0.0	0.0
+chrM	1480	1481	0.0	0.0
+chrM	1481	1482	0.0	0.0
+chrM	1482	1483	0.0	0.0
+chrM	1483	1484	0.0	0.0
+chrM	1484	1485	0.0	0.0
+chrM	1485	1486	0.0	0.0
+chrM	1486	1487	0.0	0.0
+chrM	1487	1488	0.0	0.0
+chrM	1488	1489	0.0	0.0
+chrM	1489	1490	0.0	0.0
+chrM	1490	1491	0.0	0.0
+chrM	1491	1492	0.0	0.0
+chrM	1492	1493	0.0	0.0
+chrM	1493	1494	0.0	0.0
+chrM	1494	1495	0.0	0.0
+chrM	1495	1496	0.0	0.0
+chrM	1496	1497	0.0	0.0
+chrM	1497	1498	0.0	0.0
+chrM	1498	1499	0.0	0.0
+chrM	1499	1500	0.0	0.0
+chrM	1500	1501	0.0	0.0
+chrM	1501	1502	0.0	0.0
+chrM	1502	1503	0.0	0.0
+chrM	1503	1504	0.0	0.0
+chrM	1504	1505	0.0	0.0
+chrM	1505	1506	0.0	0.0
+chrM	1506	1507	0.0	0.0
+chrM	1507	1508	0.0	0.0
+chrM	1508	1509	0.0	0.0
+chrM	1509	1510	0.0	0.0
+chrM	1510	1511	0.0	0.0
+chrM	1511	1512	0.0	0.0
+chrM	1512	1513	0.0	0.0
+chrM	1513	1514	0.0	0.0
+chrM	1514	1515	0.0	0.0
+chrM	1515	1516	0.0	0.0
+chrM	1516	1517	0.0	0.0
+chrM	1517	1518	0.0	0.0
+chrM	1518	1519	0.0	0.0
+chrM	1519	1520	0.0	0.0
+chrM	1520	1521	0.0	0.0
+chrM	1521	1522	0.0	0.0
+chrM	1522	1523	0.0	0.0
+chrM	1523	1524	0.0	0.0
+chrM	1524	1525	0.0	0.0
+chrM	1525	1526	0.0	0.0
+chrM	1526	1527	0.0	0.0
+chrM	1527	1528	0.0	0.0
+chrM	1528	1529	0.0	0.0
+chrM	1529	1530	0.0	0.0
+chrM	1530	1531	0.0	0.0
+chrM	1531	1532	0.0	0.0
+chrM	1532	1533	0.0	0.0
+chrM	1533	1534	0.0	0.0
+chrM	1534	1535	0.0	0.0
+chrM	1535	1536	0.0	0.0
+chrM	1536	1537	0.0	0.0
+chrM	1537	1538	0.0	0.0
+chrM	1538	1539	0.0	0.0
+chrM	1539	1540	0.0	0.0
+chrM	1540	1541	0.0	0.0
+chrM	1541	1542	0.0	0.0
+chrM	1542	1543	0.0	0.0
+chrM	1543	1544	0.0	0.0
+chrM	1544	1545	0.0	0.0
+chrM	1545	1546	0.0	0.0
+chrM	1546	1547	0.0	0.0
+chrM	1547	1548	0.0	0.0
+chrM	1548	1549	0.0	0.0
+chrM	1549	1550	0.0	0.0
+chrM	1550	1551	0.0	0.0
+chrM	1551	1552	0.0	0.0
+chrM	1552	1553	0.0	0.0
+chrM	1553	1554	0.0	0.0
+chrM	1554	1555	0.0	0.0
+chrM	1555	1556	0.0	0.0
+chrM	1556	1557	0.0	0.0
+chrM	1557	1558	0.0	0.0
+chrM	1558	1559	0.0	0.0
+chrM	1559	1560	0.0	0.0
+chrM	1560	1561	0.0	0.0
+chrM	1561	1562	0.0	0.0
+chrM	1562	1563	0.0	0.0
+chrM	1563	1564	0.0	0.0
+chrM	1564	1565	0.0	0.0
+chrM	1565	1566	0.0	0.0
+chrM	1566	1567	0.0	0.0
+chrM	1567	1568	0.0	0.0
+chrM	1568	1569	0.0	0.0
+chrM	1569	1570	0.0	0.0
+chrM	1570	1571	0.0	0.0
+chrM	1571	1572	0.0	0.0
+chrM	1572	1573	0.0	0.0
+chrM	1573	1574	0.0	0.0
+chrM	1574	1575	0.0	0.0
+chrM	1575	1576	0.0	0.0
+chrM	1576	1577	0.0	0.0
+chrM	1577	1578	0.0	0.0
+chrM	1578	1579	0.0	0.0
+chrM	1579	1580	0.0	0.0
+chrM	1580	1581	0.0	0.0
+chrM	1581	1582	0.0	0.0
+chrM	1582	1583	0.0	0.0
+chrM	1583	1584	0.0	0.0
+chrM	1584	1585	0.0	0.0
+chrM	1585	1586	0.0	0.0
+chrM	1586	1587	0.0	0.0
+chrM	1587	1588	0.0	0.0
+chrM	1588	1589	0.0	0.0
+chrM	1589	1590	0.0	0.0
+chrM	1590	1591	0.0	0.0
+chrM	1591	1592	0.0	0.0
+chrM	1592	1593	0.0	0.0
+chrM	1593	1594	0.0	0.0
+chrM	1594	1595	0.0	0.0
+chrM	1595	1596	0.0	0.0
+chrM	1596	1597	0.0	0.0
+chrM	1597	1598	0.0	0.0
+chrM	1598	1599	0.0	0.0
+chrM	1599	1600	0.0	0.0
+chrM	1600	1601	0.0	0.0
+chrM	1601	1602	0.0	0.0
+chrM	1602	1603	0.0	0.0
+chrM	1603	1604	0.0	0.0
+chrM	1604	1605	0.0	0.0
+chrM	1605	1606	0.0	0.0
+chrM	1606	1607	0.0	0.0
+chrM	1607	1608	0.0	0.0
+chrM	1608	1609	0.0	0.0
+chrM	1609	1610	0.0	0.0
+chrM	1610	1611	0.0	0.0
+chrM	1611	1612	0.0	0.0
+chrM	1612	1613	0.0	0.0
+chrM	1613	1614	0.0	0.0
+chrM	1614	1615	0.0	0.0
+chrM	1615	1616	0.0	0.0
+chrM	1616	1617	0.0	0.0
+chrM	1617	1618	0.0	0.0
+chrM	1618	1619	0.0	0.0
+chrM	1619	1620	0.0	0.0
+chrM	1620	1621	0.0	0.0
+chrM	1621	1622	0.0	0.0
+chrM	1622	1623	0.0	0.0
+chrM	1623	1624	0.0	0.0
+chrM	1624	1625	0.0	0.0
+chrM	1625	1626	0.0	0.0
+chrM	1626	1627	0.0	0.0
+chrM	1627	1628	0.0	0.0
+chrM	1628	1629	0.0	0.0
+chrM	1629	1630	0.0	0.0
+chrM	1630	1631	0.0	0.0
+chrM	1631	1632	0.0	0.0
+chrM	1632	1633	0.0	0.0
+chrM	1633	1634	0.0	0.0
+chrM	1634	1635	0.0	0.0
+chrM	1635	1636	0.0	0.0
+chrM	1636	1637	0.0	0.0
+chrM	1637	1638	0.0	0.0
+chrM	1638	1639	0.0	0.0
+chrM	1639	1640	0.0	0.0
+chrM	1640	1641	0.0	0.0
+chrM	1641	1642	0.0	0.0
+chrM	1642	1643	0.0	0.0
+chrM	1643	1644	0.0	0.0
+chrM	1644	1645	0.0	0.0
+chrM	1645	1646	0.0	0.0
+chrM	1646	1647	0.0	0.0
+chrM	1647	1648	0.0	0.0
+chrM	1648	1649	0.0	0.0
+chrM	1649	1650	0.0	0.0
+chrM	1650	1651	0.0	0.0
+chrM	1651	1652	0.0	0.0
+chrM	1652	1653	0.0	0.0
+chrM	1653	1654	0.0	0.0
+chrM	1654	1655	0.0	0.0
+chrM	1655	1656	0.0	0.0
+chrM	1656	1657	0.0	0.0
+chrM	1657	1658	0.0	0.0
+chrM	1658	1659	0.0	0.0
+chrM	1659	1660	0.0	0.0
+chrM	1660	1661	0.0	0.0
+chrM	1661	1662	0.0	0.0
+chrM	1662	1663	0.0	0.0
+chrM	1663	1664	0.0	0.0
+chrM	1664	1665	0.0	0.0
+chrM	1665	1666	0.0	0.0
+chrM	1666	1667	0.0	0.0
+chrM	1667	1668	0.0	0.0
+chrM	1668	1669	0.0	0.0
+chrM	1669	1670	0.0	0.0
+chrM	1670	1671	0.0	0.0
+chrM	1671	1672	0.0	0.0
+chrM	1672	1673	0.0	0.0
+chrM	1673	1674	0.0	0.0
+chrM	1674	1675	0.0	0.0
+chrM	1675	1676	0.0	0.0
+chrM	1676	1677	0.0	0.0
+chrM	1677	1678	0.0	0.0
+chrM	1678	1679	0.0	0.0
+chrM	1679	1680	0.0	0.0
+chrM	1680	1681	0.0	0.0
+chrM	1681	1682	0.0	0.0
+chrM	1682	1683	0.0	0.0
+chrM	1683	1684	0.0	0.0
+chrM	1684	1685	0.0	0.0
+chrM	1685	1686	0.0	0.0
+chrM	1686	1687	0.0	0.0
+chrM	1687	1688	0.0	0.0
+chrM	1688	1689	0.0	0.0
+chrM	1689	1690	0.0	0.0
+chrM	1690	1691	0.0	0.0
+chrM	1691	1692	0.0	0.0
+chrM	1692	1693	0.0	0.0
+chrM	1693	1694	0.0	0.0
+chrM	1694	1695	0.0	0.0
+chrM	1695	1696	0.0	0.0
+chrM	1696	1697	0.0	0.0
+chrM	1697	1698	0.0	0.0
+chrM	1698	1699	0.0	0.0
+chrM	1699	1700	0.0	0.0
+chrM	1700	1701	0.0	0.0
+chrM	1701	1702	0.0	0.0
+chrM	1702	1703	0.0	0.0
+chrM	1703	1704	0.0	0.0
+chrM	1704	1705	0.0	0.0
+chrM	1705	1706	0.0	0.0
+chrM	1706	1707	0.0	0.0
+chrM	1707	1708	0.0	0.0
+chrM	1708	1709	0.0	0.0
+chrM	1709	1710	0.0	0.0
+chrM	1710	1711	0.0	0.0
+chrM	1711	1712	0.0	0.0
+chrM	1712	1713	0.0	0.0
+chrM	1713	1714	0.0	0.0
+chrM	1714	1715	0.0	0.0
+chrM	1715	1716	0.0	0.0
+chrM	1716	1717	0.0	0.0
+chrM	1717	1718	0.0	0.0
+chrM	1718	1719	0.0	0.0
+chrM	1719	1720	0.0	0.0
+chrM	1720	1721	0.0	0.0
+chrM	1721	1722	0.0	0.0
+chrM	1722	1723	0.0	0.0
+chrM	1723	1724	0.0	0.0
+chrM	1724	1725	0.0	0.0
+chrM	1725	1726	0.0	0.0
+chrM	1726	1727	0.0	0.0
+chrM	1727	1728	0.0	0.0
+chrM	1728	1729	0.0	0.0
+chrM	1729	1730	0.0	0.0
+chrM	1730	1731	0.0	0.0
+chrM	1731	1732	0.0	0.0
+chrM	1732	1733	0.0	0.0
+chrM	1733	1734	0.0	0.0
+chrM	1734	1735	0.0	0.0
+chrM	1735	1736	0.0	0.0
+chrM	1736	1737	0.0	0.0
+chrM	1737	1738	0.0	0.0
+chrM	1738	1739	0.0	0.0
+chrM	1739	1740	0.0	0.0
+chrM	1740	1741	0.0	0.0
+chrM	1741	1742	0.0	0.0
+chrM	1742	1743	0.0	0.0
+chrM	1743	1744	0.0	0.0
+chrM	1744	1745	0.0	0.0
+chrM	1745	1746	0.0	0.0
+chrM	1746	1747	0.0	0.0
+chrM	1747	1748	0.0	0.0
+chrM	1748	1749	0.0	0.0
+chrM	1749	1750	0.0	0.0
+chrM	1750	1751	0.0	0.0
+chrM	1751	1752	0.0	0.0
+chrM	1752	1753	0.0	0.0
+chrM	1753	1754	0.0	0.0
+chrM	1754	1755	0.0	0.0
+chrM	1755	1756	0.0	0.0
+chrM	1756	1757	0.0	0.0
+chrM	1757	1758	0.0	0.0
+chrM	1758	1759	0.0	0.0
+chrM	1759	1760	0.0	0.0
+chrM	1760	1761	0.0	0.0
+chrM	1761	1762	0.0	0.0
+chrM	1762	1763	0.0	0.0
+chrM	1763	1764	0.0	0.0
+chrM	1764	1765	0.0	0.0
+chrM	1765	1766	0.0	0.0
+chrM	1766	1767	0.0	0.0
+chrM	1767	1768	0.0	0.0
+chrM	1768	1769	0.0	0.0
+chrM	1769	1770	0.0	0.0
+chrM	1770	1771	0.0	0.0
+chrM	1771	1772	0.0	0.0
+chrM	1772	1773	0.0	0.0
+chrM	1773	1774	0.0	0.0
+chrM	1774	1775	0.0	0.0
+chrM	1775	1776	0.0	0.0
+chrM	1776	1777	0.0	0.0
+chrM	1777	1778	0.0	0.0
+chrM	1778	1779	0.0	0.0
+chrM	1779	1780	0.0	0.0
+chrM	1780	1781	0.0	0.0
+chrM	1781	1782	0.0	0.0
+chrM	1782	1783	0.0	0.0
+chrM	1783	1784	0.0	0.0
+chrM	1784	1785	0.0	0.0
+chrM	1785	1786	0.0	0.0
+chrM	1786	1787	0.0	0.0
+chrM	1787	1788	0.0	0.0
+chrM	1788	1789	0.0	0.0
+chrM	1789	1790	0.0	0.0
+chrM	1790	1791	0.0	0.0
+chrM	1791	1792	0.0	0.0
+chrM	1792	1793	0.0	0.0
+chrM	1793	1794	0.0	0.0
+chrM	1794	1795	0.0	0.0
+chrM	1795	1796	0.0	0.0
+chrM	1796	1797	0.0	0.0
+chrM	1797	1798	0.0	0.0
+chrM	1798	1799	0.0	0.0
+chrM	1799	1800	0.0	0.0
+chrM	1800	1801	0.0	0.0
+chrM	1801	1802	0.0	0.0
+chrM	1802	1803	0.0	0.0
+chrM	1803	1804	0.0	0.0
+chrM	1804	1805	0.0	0.0
+chrM	1805	1806	0.0	0.0
+chrM	1806	1807	0.0	0.0
+chrM	1807	1808	0.0	0.0
+chrM	1808	1809	0.0	0.0
+chrM	1809	1810	0.0	0.0
+chrM	1810	1811	0.0	0.0
+chrM	1811	1812	0.0	0.0
+chrM	1812	1813	0.0	0.0
+chrM	1813	1814	0.0	0.0
+chrM	1814	1815	0.0	0.0
+chrM	1815	1816	0.0	0.0
+chrM	1816	1817	0.0	0.0
+chrM	1817	1818	0.0	0.0
+chrM	1818	1819	0.0	0.0
+chrM	1819	1820	0.0	0.0
+chrM	1820	1821	0.0	0.0
+chrM	1821	1822	0.0	0.0
+chrM	1822	1823	0.0	0.0
+chrM	1823	1824	0.0	0.0
+chrM	1824	1825	0.0	0.0
+chrM	1825	1826	0.0	0.0
+chrM	1826	1827	0.0	0.0
+chrM	1827	1828	0.0	0.0
+chrM	1828	1829	0.0	0.0
+chrM	1829	1830	0.0	0.0
+chrM	1830	1831	0.0	0.0
+chrM	1831	1832	0.0	0.0
+chrM	1832	1833	0.0	0.0
+chrM	1833	1834	0.0	0.0
+chrM	1834	1835	0.0	0.0
+chrM	1835	1836	0.0	0.0
+chrM	1836	1837	0.0	0.0
+chrM	1837	1838	0.0	0.0
+chrM	1838	1839	0.0	0.0
+chrM	1839	1840	0.0	0.0
+chrM	1840	1841	0.0	0.0
+chrM	1841	1842	0.0	0.0
+chrM	1842	1843	0.0	0.0
+chrM	1843	1844	0.0	0.0
+chrM	1844	1845	0.0	0.0
+chrM	1845	1846	0.0	0.0
+chrM	1846	1847	0.0	0.0
+chrM	1847	1848	0.0	0.0
+chrM	1848	1849	0.0	0.0
+chrM	1849	1850	0.0	0.0
+chrM	1850	1851	0.0	0.0
+chrM	1851	1852	0.0	0.0
+chrM	1852	1853	0.0	0.0
+chrM	1853	1854	0.0	0.0
+chrM	1854	1855	0.0	0.0
+chrM	1855	1856	0.0	0.0
+chrM	1856	1857	0.0	0.0
+chrM	1857	1858	0.0	0.0
+chrM	1858	1859	0.0	0.0
+chrM	1859	1860	0.0	0.0
+chrM	1860	1861	0.0	0.0
+chrM	1861	1862	0.0	0.0
+chrM	1862	1863	0.0	0.0
+chrM	1863	1864	0.0	0.0
+chrM	1864	1865	0.0	0.0
+chrM	1865	1866	0.0	0.0
+chrM	1866	1867	0.0	0.0
+chrM	1867	1868	0.0	0.0
+chrM	1868	1869	0.0	0.0
+chrM	1869	1870	0.0	0.0
+chrM	1870	1871	0.0	0.0
+chrM	1871	1872	0.0	0.0
+chrM	1872	1873	0.0	0.0
+chrM	1873	1874	0.0	0.0
+chrM	1874	1875	0.0	0.0
+chrM	1875	1876	0.0	0.0
+chrM	1876	1877	0.0	0.0
+chrM	1877	1878	0.0	0.0
+chrM	1878	1879	0.0	0.0
+chrM	1879	1880	0.0	0.0
+chrM	1880	1881	0.0	0.0
+chrM	1881	1882	0.0	0.0
+chrM	1882	1883	0.0	0.0
+chrM	1883	1884	0.0	0.0
+chrM	1884	1885	0.0	0.0
+chrM	1885	1886	0.0	0.0
+chrM	1886	1887	0.0	0.0
+chrM	1887	1888	0.0	0.0
+chrM	1888	1889	0.0	0.0
+chrM	1889	1890	0.0	0.0
+chrM	1890	1891	0.0	0.0
+chrM	1891	1892	0.0	0.0
+chrM	1892	1893	0.0	0.0
+chrM	1893	1894	0.0	0.0
+chrM	1894	1895	0.0	0.0
+chrM	1895	1896	0.0	0.0
+chrM	1896	1897	0.0	0.0
+chrM	1897	1898	0.0	0.0
+chrM	1898	1899	0.0	0.0
+chrM	1899	1900	0.0	0.0
+chrM	1900	1901	0.0	0.0
+chrM	1901	1902	0.0	0.0
+chrM	1902	1903	0.0	0.0
+chrM	1903	1904	0.0	0.0
+chrM	1904	1905	0.0	0.0
+chrM	1905	1906	0.0	0.0
+chrM	1906	1907	0.0	0.0
+chrM	1907	1908	0.0	0.0
+chrM	1908	1909	0.0	0.0
+chrM	1909	1910	0.0	0.0
+chrM	1910	1911	0.0	0.0
+chrM	1911	1912	0.0	0.0
+chrM	1912	1913	0.0	0.0
+chrM	1913	1914	0.0	0.0
+chrM	1914	1915	0.0	0.0
+chrM	1915	1916	0.0	0.0
+chrM	1916	1917	0.0	0.0
+chrM	1917	1918	0.0	0.0
+chrM	1918	1919	0.0	0.0
+chrM	1919	1920	0.0	0.0
+chrM	1920	1921	0.0	0.0
+chrM	1921	1922	0.0	0.0
+chrM	1922	1923	0.0	0.0
+chrM	1923	1924	0.0	0.0
+chrM	1924	1925	0.0	0.0
+chrM	1925	1926	0.0	0.0
+chrM	1926	1927	0.0	0.0
+chrM	1927	1928	0.0	0.0
+chrM	1928	1929	0.0	0.0
+chrM	1929	1930	0.0	0.0
+chrM	1930	1931	0.0	0.0
+chrM	1931	1932	0.0	0.0
+chrM	1932	1933	0.0	0.0
+chrM	1933	1934	0.0	0.0
+chrM	1934	1935	0.0	0.0
+chrM	1935	1936	0.0	0.0
+chrM	1936	1937	0.0	0.0
+chrM	1937	1938	0.0	0.0
+chrM	1938	1939	0.0	0.0
+chrM	1939	1940	0.0	0.0
+chrM	1940	1941	0.0	0.0
+chrM	1941	1942	0.0	0.0
+chrM	1942	1943	0.0	0.0
+chrM	1943	1944	0.0	0.0
+chrM	1944	1945	0.0	0.0
+chrM	1945	1946	0.0	0.0
+chrM	1946	1947	0.0	0.0
+chrM	1947	1948	0.0	0.0
+chrM	1948	1949	0.0	0.0
+chrM	1949	1950	0.0	0.0
+chrM	1950	1951	0.0	0.0
+chrM	1951	1952	0.0	0.0
+chrM	1952	1953	0.0	0.0
+chrM	1953	1954	0.0	0.0
+chrM	1954	1955	0.0	0.0
+chrM	1955	1956	0.0	0.0
+chrM	1956	1957	0.0	0.0
+chrM	1957	1958	0.0	0.0
+chrM	1958	1959	0.0	0.0
+chrM	1959	1960	0.0	0.0
+chrM	1960	1961	0.0	0.0
+chrM	1961	1962	0.0	0.0
+chrM	1962	1963	0.0	0.0
+chrM	1963	1964	0.0	0.0
+chrM	1964	1965	0.0	0.0
+chrM	1965	1966	0.0	0.0
+chrM	1966	1967	0.0	0.0
+chrM	1967	1968	0.0	0.0
+chrM	1968	1969	0.0	0.0
+chrM	1969	1970	0.0	0.0
+chrM	1970	1971	0.0	0.0
+chrM	1971	1972	0.0	0.0
+chrM	1972	1973	0.0	0.0
+chrM	1973	1974	0.0	0.0
+chrM	1974	1975	0.0	0.0
+chrM	1975	1976	0.0	0.0
+chrM	1976	1977	0.0	0.0
+chrM	1977	1978	0.0	0.0
+chrM	1978	1979	0.0	0.0
+chrM	1979	1980	0.0	0.0
+chrM	1980	1981	0.0	0.0
+chrM	1981	1982	0.0	0.0
+chrM	1982	1983	0.0	0.0
+chrM	1983	1984	0.0	0.0
+chrM	1984	1985	0.0	0.0
+chrM	1985	1986	0.0	0.0
+chrM	1986	1987	0.0	0.0
+chrM	1987	1988	0.0	0.0
+chrM	1988	1989	0.0	0.0
+chrM	1989	1990	0.0	0.0
+chrM	1990	1991	0.0	0.0
+chrM	1991	1992	0.0	0.0
+chrM	1992	1993	0.0	0.0
+chrM	1993	1994	0.0	0.0
+chrM	1994	1995	0.0	0.0
+chrM	1995	1996	0.0	0.0
+chrM	1996	1997	0.0	0.0
+chrM	1997	1998	0.0	0.0
+chrM	1998	1999	0.0	0.0
+chrM	1999	2000	0.0	0.0
+chrM	2000	2001	0.0	0.0
+chrM	2001	2002	0.0	0.0
+chrM	2002	2003	0.0	0.0
+chrM	2003	2004	0.0	0.0
+chrM	2004	2005	0.0	0.0
+chrM	2005	2006	0.0	0.0
+chrM	2006	2007	0.0	0.0
+chrM	2007	2008	0.0	0.0
+chrM	2008	2009	0.0	0.0
+chrM	2009	2010	0.0	0.0
+chrM	2010	2011	0.0	0.0
+chrM	2011	2012	0.0	0.0
+chrM	2012	2013	0.0	0.0
+chrM	2013	2014	0.0	0.0
+chrM	2014	2015	0.0	0.0
+chrM	2015	2016	0.0	0.0
+chrM	2016	2017	0.0	0.0
+chrM	2017	2018	0.0	0.0
+chrM	2018	2019	0.0	0.0
+chrM	2019	2020	0.0	0.0
+chrM	2020	2021	0.0	0.0
+chrM	2021	2022	0.0	0.0
+chrM	2022	2023	0.0	0.0
+chrM	2023	2024	0.0	0.0
+chrM	2024	2025	0.0	0.0
+chrM	2025	2026	0.0	0.0
+chrM	2026	2027	0.0	0.0
+chrM	2027	2028	0.0	0.0
+chrM	2028	2029	0.0	0.0
+chrM	2029	2030	0.0	0.0
+chrM	2030	2031	0.0	0.0
+chrM	2031	2032	0.0	0.0
+chrM	2032	2033	0.0	0.0
+chrM	2033	2034	0.0	0.0
+chrM	2034	2035	0.0	0.0
+chrM	2035	2036	0.0	0.0
+chrM	2036	2037	0.0	0.0
+chrM	2037	2038	0.0	0.0
+chrM	2038	2039	0.0	0.0
+chrM	2039	2040	0.0	0.0
+chrM	2040	2041	0.0	0.0
+chrM	2041	2042	0.0	0.0
+chrM	2042	2043	0.0	0.0
+chrM	2043	2044	0.0	0.0
+chrM	2044	2045	0.0	0.0
+chrM	2045	2046	0.0	0.0
+chrM	2046	2047	0.0	0.0
+chrM	2047	2048	0.0	0.0
+chrM	2048	2049	0.0	0.0
+chrM	2049	2050	0.0	0.0
+chrM	2050	2051	0.0	0.0
+chrM	2051	2052	0.0	0.0
+chrM	2052	2053	0.0	0.0
+chrM	2053	2054	0.0	0.0
+chrM	2054	2055	0.0	0.0
+chrM	2055	2056	0.0	0.0
+chrM	2056	2057	0.0	0.0
+chrM	2057	2058	0.0	0.0
+chrM	2058	2059	0.0	0.0
+chrM	2059	2060	0.0	0.0
+chrM	2060	2061	0.0	0.0
+chrM	2061	2062	0.0	0.0
+chrM	2062	2063	0.0	0.0
+chrM	2063	2064	0.0	0.0
+chrM	2064	2065	0.0	0.0
+chrM	2065	2066	0.0	0.0
+chrM	2066	2067	0.0	0.0
+chrM	2067	2068	0.0	0.0
+chrM	2068	2069	0.0	0.0
+chrM	2069	2070	0.0	0.0
+chrM	2070	2071	0.0	0.0
+chrM	2071	2072	0.0	0.0
+chrM	2072	2073	0.0	0.0
+chrM	2073	2074	0.0	0.0
+chrM	2074	2075	0.0	0.0
+chrM	2075	2076	0.0	0.0
+chrM	2076	2077	0.0	0.0
+chrM	2077	2078	0.0	0.0
+chrM	2078	2079	0.0	0.0
+chrM	2079	2080	0.0	0.0
+chrM	2080	2081	0.0	0.0
+chrM	2081	2082	0.0	0.0
+chrM	2082	2083	0.0	0.0
+chrM	2083	2084	0.0	0.0
+chrM	2084	2085	0.0	0.0
+chrM	2085	2086	0.0	0.0
+chrM	2086	2087	0.0	0.0
+chrM	2087	2088	0.0	0.0
+chrM	2088	2089	0.0	0.0
+chrM	2089	2090	0.0	0.0
+chrM	2090	2091	0.0	0.0
+chrM	2091	2092	0.0	0.0
+chrM	2092	2093	0.0	0.0
+chrM	2093	2094	0.0	0.0
+chrM	2094	2095	0.0	0.0
+chrM	2095	2096	0.0	0.0
+chrM	2096	2097	0.0	0.0
+chrM	2097	2098	0.0	0.0
+chrM	2098	2099	0.0	0.0
+chrM	2099	2100	0.0	0.0
+chrM	2100	2101	0.0	0.0
+chrM	2101	2102	0.0	0.0
+chrM	2102	2103	0.0	0.0
+chrM	2103	2104	0.0	0.0
+chrM	2104	2105	0.0	0.0
+chrM	2105	2106	0.0	0.0
+chrM	2106	2107	0.0	0.0
+chrM	2107	2108	0.0	0.0
+chrM	2108	2109	0.0	0.0
+chrM	2109	2110	0.0	0.0
+chrM	2110	2111	0.0	0.0
+chrM	2111	2112	0.0	0.0
+chrM	2112	2113	0.0	0.0
+chrM	2113	2114	0.0	0.0
+chrM	2114	2115	0.0	0.0
+chrM	2115	2116	0.0	0.0
+chrM	2116	2117	0.0	0.0
+chrM	2117	2118	0.0	0.0
+chrM	2118	2119	0.0	0.0
+chrM	2119	2120	0.0	0.0
+chrM	2120	2121	0.0	0.0
+chrM	2121	2122	0.0	0.0
+chrM	2122	2123	0.0	0.0
+chrM	2123	2124	0.0	0.0
+chrM	2124	2125	0.0	0.0
+chrM	2125	2126	0.0	0.0
+chrM	2126	2127	0.0	0.0
+chrM	2127	2128	0.0	0.0
+chrM	2128	2129	0.0	0.0
+chrM	2129	2130	0.0	0.0
+chrM	2130	2131	0.0	0.0
+chrM	2131	2132	0.0	0.0
+chrM	2132	2133	0.0	0.0
+chrM	2133	2134	0.0	0.0
+chrM	2134	2135	0.0	0.0
+chrM	2135	2136	0.0	0.0
+chrM	2136	2137	0.0	0.0
+chrM	2137	2138	0.0	0.0
+chrM	2138	2139	0.0	0.0
+chrM	2139	2140	0.0	0.0
+chrM	2140	2141	0.0	0.0
+chrM	2141	2142	0.0	0.0
+chrM	2142	2143	0.0	0.0
+chrM	2143	2144	0.0	0.0
+chrM	2144	2145	0.0	0.0
+chrM	2145	2146	0.0	0.0
+chrM	2146	2147	0.0	0.0
+chrM	2147	2148	0.0	0.0
+chrM	2148	2149	0.0	0.0
+chrM	2149	2150	0.0	0.0
+chrM	2150	2151	0.0	0.0
+chrM	2151	2152	0.0	0.0
+chrM	2152	2153	0.0	0.0
+chrM	2153	2154	0.0	0.0
+chrM	2154	2155	0.0	0.0
+chrM	2155	2156	0.0	0.0
+chrM	2156	2157	0.0	0.0
+chrM	2157	2158	0.0	0.0
+chrM	2158	2159	0.0	0.0
+chrM	2159	2160	0.0	0.0
+chrM	2160	2161	0.0	0.0
+chrM	2161	2162	0.0	0.0
+chrM	2162	2163	0.0	0.0
+chrM	2163	2164	0.0	0.0
+chrM	2164	2165	0.0	0.0
+chrM	2165	2166	0.0	0.0
+chrM	2166	2167	0.0	0.0
+chrM	2167	2168	0.0	0.0
+chrM	2168	2169	0.0	0.0
+chrM	2169	2170	0.0	0.0
+chrM	2170	2171	0.0	0.0
+chrM	2171	2172	0.0	0.0
+chrM	2172	2173	0.0	0.0
+chrM	2173	2174	0.0	0.0
+chrM	2174	2175	0.0	0.0
+chrM	2175	2176	0.0	0.0
+chrM	2176	2177	0.0	0.0
+chrM	2177	2178	0.0	0.0
+chrM	2178	2179	0.0	0.0
+chrM	2179	2180	0.0	0.0
+chrM	2180	2181	0.0	0.0
+chrM	2181	2182	0.0	0.0
+chrM	2182	2183	0.0	0.0
+chrM	2183	2184	0.0	0.0
+chrM	2184	2185	0.0	0.0
+chrM	2185	2186	0.0	0.0
+chrM	2186	2187	0.0	0.0
+chrM	2187	2188	0.0	0.0
+chrM	2188	2189	0.0	0.0
+chrM	2189	2190	0.0	0.0
+chrM	2190	2191	0.0	0.0
+chrM	2191	2192	0.0	0.0
+chrM	2192	2193	0.0	0.0
+chrM	2193	2194	0.0	0.0
+chrM	2194	2195	0.0	0.0
+chrM	2195	2196	0.0	0.0
+chrM	2196	2197	0.0	0.0
+chrM	2197	2198	0.0	0.0
+chrM	2198	2199	0.0	0.0
+chrM	2199	2200	0.0	0.0
+chrM	2200	2201	0.0	0.0
+chrM	2201	2202	0.0	0.0
+chrM	2202	2203	0.0	0.0
+chrM	2203	2204	0.0	0.0
+chrM	2204	2205	0.0	0.0
+chrM	2205	2206	0.0	0.0
+chrM	2206	2207	0.0	0.0
+chrM	2207	2208	0.0	0.0
+chrM	2208	2209	0.0	0.0
+chrM	2209	2210	0.0	0.0
+chrM	2210	2211	0.0	0.0
+chrM	2211	2212	0.0	0.0
+chrM	2212	2213	0.0	0.0
+chrM	2213	2214	0.0	0.0
+chrM	2214	2215	0.0	0.0
+chrM	2215	2216	0.0	0.0
+chrM	2216	2217	0.0	0.0
+chrM	2217	2218	0.0	0.0
+chrM	2218	2219	0.0	0.0
+chrM	2219	2220	0.0	0.0
+chrM	2220	2221	0.0	0.0
+chrM	2221	2222	0.0	0.0
+chrM	2222	2223	0.0	0.0
+chrM	2223	2224	0.0	0.0
+chrM	2224	2225	0.0	0.0
+chrM	2225	2226	0.0	0.0
+chrM	2226	2227	0.0	0.0
+chrM	2227	2228	0.0	0.0
+chrM	2228	2229	0.0	0.0
+chrM	2229	2230	0.0	0.0
+chrM	2230	2231	0.0	0.0
+chrM	2231	2232	0.0	0.0
+chrM	2232	2233	0.0	0.0
+chrM	2233	2234	0.0	0.0
+chrM	2234	2235	0.0	0.0
+chrM	2235	2236	0.0	0.0
+chrM	2236	2237	0.0	0.0
+chrM	2237	2238	0.0	0.0
+chrM	2238	2239	0.0	0.0
+chrM	2239	2240	0.0	0.0
+chrM	2240	2241	0.0	0.0
+chrM	2241	2242	0.0	0.0
+chrM	2242	2243	0.0	0.0
+chrM	2243	2244	0.0	0.0
+chrM	2244	2245	0.0	0.0
+chrM	2245	2246	0.0	0.0
+chrM	2246	2247	0.0	0.0
+chrM	2247	2248	0.0	0.0
+chrM	2248	2249	0.0	0.0
+chrM	2249	2250	0.0	0.0
+chrM	2250	2251	0.0	0.0
+chrM	2251	2252	0.0	0.0
+chrM	2252	2253	0.0	0.0
+chrM	2253	2254	0.0	0.0
+chrM	2254	2255	0.0	0.0
+chrM	2255	2256	0.0	0.0
+chrM	2256	2257	0.0	0.0
+chrM	2257	2258	0.0	0.0
+chrM	2258	2259	0.0	0.0
+chrM	2259	2260	0.0	0.0
+chrM	2260	2261	0.0	0.0
+chrM	2261	2262	0.0	0.0
+chrM	2262	2263	0.0	0.0
+chrM	2263	2264	0.0	0.0
+chrM	2264	2265	0.0	0.0
+chrM	2265	2266	0.0	0.0
+chrM	2266	2267	0.0	0.0
+chrM	2267	2268	0.0	0.0
+chrM	2268	2269	0.0	0.0
+chrM	2269	2270	0.0	0.0
+chrM	2270	2271	0.0	0.0
+chrM	2271	2272	0.0	0.0
+chrM	2272	2273	0.0	0.0
+chrM	2273	2274	0.0	0.0
+chrM	2274	2275	0.0	0.0
+chrM	2275	2276	0.0	0.0
+chrM	2276	2277	0.0	0.0
+chrM	2277	2278	0.0	0.0
+chrM	2278	2279	0.0	0.0
+chrM	2279	2280	0.0	0.0
+chrM	2280	2281	0.0	0.0
+chrM	2281	2282	0.0	0.0
+chrM	2282	2283	0.0	0.0
+chrM	2283	2284	0.0	0.0
+chrM	2284	2285	0.0	0.0
+chrM	2285	2286	0.0	0.0
+chrM	2286	2287	0.0	0.0
+chrM	2287	2288	0.0	0.0
+chrM	2288	2289	0.0	0.0
+chrM	2289	2290	0.0	0.0
+chrM	2290	2291	0.0	0.0
+chrM	2291	2292	0.0	0.0
+chrM	2292	2293	0.0	0.0
+chrM	2293	2294	0.0	0.0
+chrM	2294	2295	0.0	0.0
+chrM	2295	2296	0.0	0.0
+chrM	2296	2297	0.0	0.0
+chrM	2297	2298	0.0	0.0
+chrM	2298	2299	0.0	0.0
+chrM	2299	2300	0.0	0.0
+chrM	2300	2301	0.0	0.0
+chrM	2301	2302	0.0	0.0
+chrM	2302	2303	0.0	0.0
+chrM	2303	2304	0.0	0.0
+chrM	2304	2305	0.0	0.0
+chrM	2305	2306	0.0	0.0
+chrM	2306	2307	0.0	0.0
+chrM	2307	2308	0.0	0.0
+chrM	2308	2309	0.0	0.0
+chrM	2309	2310	0.0	0.0
+chrM	2310	2311	0.0	0.0
+chrM	2311	2312	0.0	0.0
+chrM	2312	2313	0.0	0.0
+chrM	2313	2314	0.0	0.0
+chrM	2314	2315	0.0	0.0
+chrM	2315	2316	0.0	0.0
+chrM	2316	2317	0.0	0.0
+chrM	2317	2318	0.0	0.0
+chrM	2318	2319	0.0	0.0
+chrM	2319	2320	0.0	0.0
+chrM	2320	2321	0.0	0.0
+chrM	2321	2322	0.0	0.0
+chrM	2322	2323	0.0	0.0
+chrM	2323	2324	0.0	0.0
+chrM	2324	2325	0.0	0.0
+chrM	2325	2326	0.0	0.0
+chrM	2326	2327	0.0	0.0
+chrM	2327	2328	0.0	0.0
+chrM	2328	2329	0.0	0.0
+chrM	2329	2330	0.0	0.0
+chrM	2330	2331	0.0	0.0
+chrM	2331	2332	0.0	0.0
+chrM	2332	2333	0.0	0.0
+chrM	2333	2334	0.0	0.0
+chrM	2334	2335	0.0	0.0
+chrM	2335	2336	0.0	0.0
+chrM	2336	2337	0.0	0.0
+chrM	2337	2338	0.0	0.0
+chrM	2338	2339	0.0	0.0
+chrM	2339	2340	0.0	0.0
+chrM	2340	2341	0.0	0.0
+chrM	2341	2342	0.0	0.0
+chrM	2342	2343	0.0	0.0
+chrM	2343	2344	0.0	0.0
+chrM	2344	2345	0.0	0.0
+chrM	2345	2346	0.0	0.0
+chrM	2346	2347	0.0	0.0
+chrM	2347	2348	0.0	0.0
+chrM	2348	2349	0.0	0.0
+chrM	2349	2350	0.0	0.0
+chrM	2350	2351	0.0	0.0
+chrM	2351	2352	0.0	0.0
+chrM	2352	2353	0.0	0.0
+chrM	2353	2354	0.0	0.0
+chrM	2354	2355	0.0	0.0
+chrM	2355	2356	0.0	0.0
+chrM	2356	2357	0.0	0.0
+chrM	2357	2358	0.0	0.0
+chrM	2358	2359	0.0	0.0
+chrM	2359	2360	0.0	0.0
+chrM	2360	2361	0.0	0.0
+chrM	2361	2362	0.0	0.0
+chrM	2362	2363	0.0	0.0
+chrM	2363	2364	0.0	0.0
+chrM	2364	2365	0.0	0.0
+chrM	2365	2366	0.0	0.0
+chrM	2366	2367	0.0	0.0
+chrM	2367	2368	0.0	0.0
+chrM	2368	2369	0.0	0.0
+chrM	2369	2370	0.0	0.0
+chrM	2370	2371	0.0	0.0
+chrM	2371	2372	0.0	0.0
+chrM	2372	2373	0.0	0.0
+chrM	2373	2374	0.0	0.0
+chrM	2374	2375	0.0	0.0
+chrM	2375	2376	0.0	0.0
+chrM	2376	2377	0.0	0.0
+chrM	2377	2378	0.0	0.0
+chrM	2378	2379	0.0	0.0
+chrM	2379	2380	0.0	0.0
+chrM	2380	2381	0.0	0.0
+chrM	2381	2382	0.0	0.0
+chrM	2382	2383	0.0	0.0
+chrM	2383	2384	0.0	0.0
+chrM	2384	2385	0.0	0.0
+chrM	2385	2386	0.0	0.0
+chrM	2386	2387	0.0	0.0
+chrM	2387	2388	0.0	0.0
+chrM	2388	2389	0.0	0.0
+chrM	2389	2390	0.0	0.0
+chrM	2390	2391	0.0	0.0
+chrM	2391	2392	0.0	0.0
+chrM	2392	2393	0.0	0.0
+chrM	2393	2394	0.0	0.0
+chrM	2394	2395	0.0	0.0
+chrM	2395	2396	0.0	0.0
+chrM	2396	2397	0.0	0.0
+chrM	2397	2398	0.0	0.0
+chrM	2398	2399	0.0	0.0
+chrM	2399	2400	0.0	0.0
+chrM	2400	2401	0.0	0.0
+chrM	2401	2402	0.0	0.0
+chrM	2402	2403	0.0	0.0
+chrM	2403	2404	0.0	0.0
+chrM	2404	2405	0.0	0.0
+chrM	2405	2406	0.0	0.0
+chrM	2406	2407	0.0	0.0
+chrM	2407	2408	0.0	0.0
+chrM	2408	2409	0.0	0.0
+chrM	2409	2410	0.0	0.0
+chrM	2410	2411	0.0	0.0
+chrM	2411	2412	0.0	0.0
+chrM	2412	2413	0.0	0.0
+chrM	2413	2414	0.0	0.0
+chrM	2414	2415	0.0	0.0
+chrM	2415	2416	0.0	0.0
+chrM	2416	2417	0.0	0.0
+chrM	2417	2418	0.0	0.0
+chrM	2418	2419	0.0	0.0
+chrM	2419	2420	0.0	0.0
+chrM	2420	2421	0.0	0.0
+chrM	2421	2422	0.0	0.0
+chrM	2422	2423	0.0	0.0
+chrM	2423	2424	0.0	0.0
+chrM	2424	2425	0.0	0.0
+chrM	2425	2426	0.0	0.0
+chrM	2426	2427	0.0	0.0
+chrM	2427	2428	0.0	0.0
+chrM	2428	2429	0.0	0.0
+chrM	2429	2430	0.0	0.0
+chrM	2430	2431	0.0	0.0
+chrM	2431	2432	0.0	0.0
+chrM	2432	2433	0.0	0.0
+chrM	2433	2434	0.0	0.0
+chrM	2434	2435	0.0	0.0
+chrM	2435	2436	0.0	0.0
+chrM	2436	2437	0.0	0.0
+chrM	2437	2438	0.0	0.0
+chrM	2438	2439	0.0	0.0
+chrM	2439	2440	0.0	0.0
+chrM	2440	2441	0.0	0.0
+chrM	2441	2442	0.0	0.0
+chrM	2442	2443	0.0	0.0
+chrM	2443	2444	0.0	0.0
+chrM	2444	2445	0.0	0.0
+chrM	2445	2446	0.0	0.0
+chrM	2446	2447	0.0	0.0
+chrM	2447	2448	0.0	0.0
+chrM	2448	2449	0.0	0.0
+chrM	2449	2450	0.0	0.0
+chrM	2450	2451	0.0	0.0
+chrM	2451	2452	0.0	0.0
+chrM	2452	2453	0.0	0.0
+chrM	2453	2454	0.0	0.0
+chrM	2454	2455	0.0	0.0
+chrM	2455	2456	0.0	0.0
+chrM	2456	2457	0.0	0.0
+chrM	2457	2458	0.0	0.0
+chrM	2458	2459	0.0	0.0
+chrM	2459	2460	0.0	0.0
+chrM	2460	2461	0.0	0.0
+chrM	2461	2462	0.0	0.0
+chrM	2462	2463	0.0	0.0
+chrM	2463	2464	0.0	0.0
+chrM	2464	2465	0.0	0.0
+chrM	2465	2466	0.0	0.0
+chrM	2466	2467	0.0	0.0
+chrM	2467	2468	0.0	0.0
+chrM	2468	2469	0.0	0.0
+chrM	2469	2470	0.0	0.0
+chrM	2470	2471	0.0	0.0
+chrM	2471	2472	0.0	0.0
+chrM	2472	2473	0.0	0.0
+chrM	2473	2474	0.0	0.0
+chrM	2474	2475	0.0	0.0
+chrM	2475	2476	0.0	0.0
+chrM	2476	2477	0.0	0.0
+chrM	2477	2478	0.0	0.0
+chrM	2478	2479	0.0	0.0
+chrM	2479	2480	0.0	0.0
+chrM	2480	2481	0.0	0.0
+chrM	2481	2482	0.0	0.0
+chrM	2482	2483	0.0	0.0
+chrM	2483	2484	0.0	0.0
+chrM	2484	2485	0.0	0.0
+chrM	2485	2486	0.0	0.0
+chrM	2486	2487	0.0	0.0
+chrM	2487	2488	0.0	0.0
+chrM	2488	2489	0.0	0.0
+chrM	2489	2490	0.0	0.0
+chrM	2490	2491	0.0	0.0
+chrM	2491	2492	0.0	0.0
+chrM	2492	2493	0.0	0.0
+chrM	2493	2494	0.0	0.0
+chrM	2494	2495	0.0	0.0
+chrM	2495	2496	0.0	0.0
+chrM	2496	2497	0.0	0.0
+chrM	2497	2498	0.0	0.0
+chrM	2498	2499	0.0	0.0
+chrM	2499	2500	0.0	0.0
+chrM	2500	2501	0.0	0.0
+chrM	2501	2502	0.0	0.0
+chrM	2502	2503	0.0	0.0
+chrM	2503	2504	0.0	0.0
+chrM	2504	2505	0.0	0.0
+chrM	2505	2506	0.0	0.0
+chrM	2506	2507	0.0	0.0
+chrM	2507	2508	0.0	0.0
+chrM	2508	2509	0.0	0.0
+chrM	2509	2510	0.0	0.0
+chrM	2510	2511	0.0	0.0
+chrM	2511	2512	0.0	0.0
+chrM	2512	2513	0.0	0.0
+chrM	2513	2514	0.0	0.0
+chrM	2514	2515	0.0	0.0
+chrM	2515	2516	0.0	0.0
+chrM	2516	2517	0.0	0.0
+chrM	2517	2518	0.0	0.0
+chrM	2518	2519	0.0	0.0
+chrM	2519	2520	0.0	0.0
+chrM	2520	2521	0.0	0.0
+chrM	2521	2522	0.0	0.0
+chrM	2522	2523	0.0	0.0
+chrM	2523	2524	0.0	0.0
+chrM	2524	2525	0.0	0.0
+chrM	2525	2526	0.0	0.0
+chrM	2526	2527	0.0	0.0
+chrM	2527	2528	0.0	0.0
+chrM	2528	2529	0.0	0.0
+chrM	2529	2530	0.0	0.0
+chrM	2530	2531	0.0	0.0
+chrM	2531	2532	0.0	0.0
+chrM	2532	2533	0.0	0.0
+chrM	2533	2534	0.0	0.0
+chrM	2534	2535	0.0	0.0
+chrM	2535	2536	0.0	0.0
+chrM	2536	2537	0.0	0.0
+chrM	2537	2538	0.0	0.0
+chrM	2538	2539	0.0	0.0
+chrM	2539	2540	0.0	0.0
+chrM	2540	2541	0.0	0.0
+chrM	2541	2542	0.0	0.0
+chrM	2542	2543	0.0	0.0
+chrM	2543	2544	0.0	0.0
+chrM	2544	2545	0.0	0.0
+chrM	2545	2546	0.0	0.0
+chrM	2546	2547	0.0	0.0
+chrM	2547	2548	0.0	0.0
+chrM	2548	2549	0.0	0.0
+chrM	2549	2550	0.0	0.0
+chrM	2550	2551	0.0	0.0
+chrM	2551	2552	0.0	0.0
+chrM	2552	2553	0.0	0.0
+chrM	2553	2554	0.0	0.0
+chrM	2554	2555	0.0	0.0
+chrM	2555	2556	0.0	0.0
+chrM	2556	2557	0.0	0.0
+chrM	2557	2558	0.0	0.0
+chrM	2558	2559	0.0	0.0
+chrM	2559	2560	0.0	0.0
+chrM	2560	2561	0.0	0.0
+chrM	2561	2562	0.0	0.0
+chrM	2562	2563	0.0	0.0
+chrM	2563	2564	0.0	0.0
+chrM	2564	2565	0.0	0.0
+chrM	2565	2566	0.0	0.0
+chrM	2566	2567	0.0	0.0
+chrM	2567	2568	0.0	0.0
+chrM	2568	2569	0.0	0.0
+chrM	2569	2570	0.0	0.0
+chrM	2570	2571	0.0	0.0
+chrM	2571	2572	0.0	0.0
+chrM	2572	2573	0.0	0.0
+chrM	2573	2574	0.0	0.0
+chrM	2574	2575	0.0	0.0
+chrM	2575	2576	0.0	0.0
+chrM	2576	2577	0.0	0.0
+chrM	2577	2578	0.0	0.0
+chrM	2578	2579	0.0	0.0
+chrM	2579	2580	0.0	0.0
+chrM	2580	2581	0.0	0.0
+chrM	2581	2582	0.0	0.0
+chrM	2582	2583	0.0	0.0
+chrM	2583	2584	0.0	0.0
+chrM	2584	2585	0.0	0.0
+chrM	2585	2586	0.0	0.0
+chrM	2586	2587	0.0	0.0
+chrM	2587	2588	0.0	0.0
+chrM	2588	2589	0.0	0.0
+chrM	2589	2590	0.0	0.0
+chrM	2590	2591	0.0	0.0
+chrM	2591	2592	0.0	0.0
+chrM	2592	2593	0.0	0.0
+chrM	2593	2594	0.0	0.0
+chrM	2594	2595	0.0	0.0
+chrM	2595	2596	0.0	0.0
+chrM	2596	2597	0.0	0.0
+chrM	2597	2598	0.0	0.0
+chrM	2598	2599	0.0	0.0
+chrM	2599	2600	0.0	0.0
+chrM	2600	2601	0.0	0.0
+chrM	2601	2602	0.0	0.0
+chrM	2602	2603	0.0	0.0
+chrM	2603	2604	0.0	0.0
+chrM	2604	2605	0.0	0.0
+chrM	2605	2606	0.0	0.0
+chrM	2606	2607	0.0	0.0
+chrM	2607	2608	0.0	0.0
+chrM	2608	2609	0.0	0.0
+chrM	2609	2610	0.0	0.0
+chrM	2610	2611	0.0	0.0
+chrM	2611	2612	0.0	0.0
+chrM	2612	2613	0.0	0.0
+chrM	2613	2614	0.0	0.0
+chrM	2614	2615	0.0	0.0
+chrM	2615	2616	0.0	0.0
+chrM	2616	2617	0.0	0.0
+chrM	2617	2618	0.0	0.0
+chrM	2618	2619	0.0	0.0
+chrM	2619	2620	0.0	0.0
+chrM	2620	2621	0.0	0.0
+chrM	2621	2622	0.0	0.0
+chrM	2622	2623	0.0	0.0
+chrM	2623	2624	0.0	0.0
+chrM	2624	2625	0.0	0.0
+chrM	2625	2626	0.0	0.0
+chrM	2626	2627	0.0	0.0
+chrM	2627	2628	0.0	0.0
+chrM	2628	2629	0.0	0.0
+chrM	2629	2630	0.0	0.0
+chrM	2630	2631	0.0	0.0
+chrM	2631	2632	0.0	0.0
+chrM	2632	2633	0.0	0.0
+chrM	2633	2634	0.0	0.0
+chrM	2634	2635	0.0	0.0
+chrM	2635	2636	0.0	0.0
+chrM	2636	2637	0.0	0.0
+chrM	2637	2638	0.0	0.0
+chrM	2638	2639	0.0	0.0
+chrM	2639	2640	0.0	0.0
+chrM	2640	2641	0.0	0.0
+chrM	2641	2642	0.0	0.0
+chrM	2642	2643	0.0	0.0
+chrM	2643	2644	0.0	0.0
+chrM	2644	2645	0.0	0.0
+chrM	2645	2646	0.0	0.0
+chrM	2646	2647	0.0	0.0
+chrM	2647	2648	0.0	0.0
+chrM	2648	2649	0.0	0.0
+chrM	2649	2650	0.0	0.0
+chrM	2650	2651	0.0	0.0
+chrM	2651	2652	0.0	0.0
+chrM	2652	2653	0.0	0.0
+chrM	2653	2654	0.0	0.0
+chrM	2654	2655	0.0	0.0
+chrM	2655	2656	0.0	0.0
+chrM	2656	2657	0.0	0.0
+chrM	2657	2658	0.0	0.0
+chrM	2658	2659	0.0	0.0
+chrM	2659	2660	0.0	0.0
+chrM	2660	2661	0.0	0.0
+chrM	2661	2662	0.0	0.0
+chrM	2662	2663	0.0	0.0
+chrM	2663	2664	0.0	0.0
+chrM	2664	2665	0.0	0.0
+chrM	2665	2666	0.0	0.0
+chrM	2666	2667	0.0	0.0
+chrM	2667	2668	0.0	0.0
+chrM	2668	2669	0.0	0.0
+chrM	2669	2670	0.0	0.0
+chrM	2670	2671	0.0	0.0
+chrM	2671	2672	0.0	0.0
+chrM	2672	2673	0.0	0.0
+chrM	2673	2674	0.0	0.0
+chrM	2674	2675	0.0	0.0
+chrM	2675	2676	0.0	0.0
+chrM	2676	2677	0.0	0.0
+chrM	2677	2678	0.0	0.0
+chrM	2678	2679	0.0	0.0
+chrM	2679	2680	0.0	0.0
+chrM	2680	2681	0.0	0.0
+chrM	2681	2682	0.0	0.0
+chrM	2682	2683	0.0	0.0
+chrM	2683	2684	0.0	0.0
+chrM	2684	2685	0.0	0.0
+chrM	2685	2686	0.0	0.0
+chrM	2686	2687	0.0	0.0
+chrM	2687	2688	0.0	0.0
+chrM	2688	2689	0.0	0.0
+chrM	2689	2690	0.0	0.0
+chrM	2690	2691	0.0	0.0
+chrM	2691	2692	0.0	0.0
+chrM	2692	2693	0.0	0.0
+chrM	2693	2694	0.0	0.0
+chrM	2694	2695	0.0	0.0
+chrM	2695	2696	0.0	0.0
+chrM	2696	2697	0.0	0.0
+chrM	2697	2698	0.0	0.0
+chrM	2698	2699	0.0	0.0
+chrM	2699	2700	0.0	0.0
+chrM	2700	2701	0.0	0.0
+chrM	2701	2702	0.0	0.0
+chrM	2702	2703	0.0	0.0
+chrM	2703	2704	0.0	0.0
+chrM	2704	2705	0.0	0.0
+chrM	2705	2706	0.0	0.0
+chrM	2706	2707	0.0	0.0
+chrM	2707	2708	0.0	0.0
+chrM	2708	2709	0.0	0.0
+chrM	2709	2710	0.0	0.0
+chrM	2710	2711	0.0	0.0
+chrM	2711	2712	0.0	0.0
+chrM	2712	2713	0.0	0.0
+chrM	2713	2714	0.0	0.0
+chrM	2714	2715	0.0	0.0
+chrM	2715	2716	0.0	0.0
+chrM	2716	2717	0.0	0.0
+chrM	2717	2718	0.0	0.0
+chrM	2718	2719	0.0	0.0
+chrM	2719	2720	0.0	0.0
+chrM	2720	2721	0.0	0.0
+chrM	2721	2722	0.0	0.0
+chrM	2722	2723	0.0	0.0
+chrM	2723	2724	0.0	0.0
+chrM	2724	2725	0.0	0.0
+chrM	2725	2726	0.0	0.0
+chrM	2726	2727	0.0	0.0
+chrM	2727	2728	0.0	0.0
+chrM	2728	2729	0.0	0.0
+chrM	2729	2730	0.0	0.0
+chrM	2730	2731	0.0	0.0
+chrM	2731	2732	0.0	0.0
+chrM	2732	2733	0.0	0.0
+chrM	2733	2734	0.0	0.0
+chrM	2734	2735	0.0	0.0
+chrM	2735	2736	0.0	0.0
+chrM	2736	2737	0.0	0.0
+chrM	2737	2738	0.0	0.0
+chrM	2738	2739	0.0	0.0
+chrM	2739	2740	0.0	0.0
+chrM	2740	2741	0.0	0.0
+chrM	2741	2742	0.0	0.0
+chrM	2742	2743	0.0	0.0
+chrM	2743	2744	0.0	0.0
+chrM	2744	2745	0.0	0.0
+chrM	2745	2746	0.0	0.0
+chrM	2746	2747	0.0	0.0
+chrM	2747	2748	0.0	0.0
+chrM	2748	2749	0.0	0.0
+chrM	2749	2750	0.0	0.0
+chrM	2750	2751	0.0	0.0
+chrM	2751	2752	0.0	0.0
+chrM	2752	2753	0.0	0.0
+chrM	2753	2754	0.0	0.0
+chrM	2754	2755	0.0	0.0
+chrM	2755	2756	0.0	0.0
+chrM	2756	2757	0.0	0.0
+chrM	2757	2758	0.0	0.0
+chrM	2758	2759	0.0	0.0
+chrM	2759	2760	0.0	0.0
+chrM	2760	2761	0.0	0.0
+chrM	2761	2762	0.0	0.0
+chrM	2762	2763	0.0	0.0
+chrM	2763	2764	0.0	0.0
+chrM	2764	2765	0.0	0.0
+chrM	2765	2766	0.0	0.0
+chrM	2766	2767	0.0	0.0
+chrM	2767	2768	0.0	0.0
+chrM	2768	2769	0.0	0.0
+chrM	2769	2770	0.0	0.0
+chrM	2770	2771	0.0	0.0
+chrM	2771	2772	0.0	0.0
+chrM	2772	2773	0.0	0.0
+chrM	2773	2774	0.0	0.0
+chrM	2774	2775	0.0	0.0
+chrM	2775	2776	0.0	0.0
+chrM	2776	2777	0.0	0.0
+chrM	2777	2778	0.0	0.0
+chrM	2778	2779	0.0	0.0
+chrM	2779	2780	0.0	0.0
+chrM	2780	2781	0.0	0.0
+chrM	2781	2782	0.0	0.0
+chrM	2782	2783	0.0	0.0
+chrM	2783	2784	0.0	0.0
+chrM	2784	2785	0.0	0.0
+chrM	2785	2786	0.0	0.0
+chrM	2786	2787	0.0	0.0
+chrM	2787	2788	0.0	0.0
+chrM	2788	2789	0.0	0.0
+chrM	2789	2790	0.0	0.0
+chrM	2790	2791	0.0	0.0
+chrM	2791	2792	0.0	0.0
+chrM	2792	2793	0.0	0.0
+chrM	2793	2794	0.0	0.0
+chrM	2794	2795	0.0	0.0
+chrM	2795	2796	0.0	0.0
+chrM	2796	2797	0.0	0.0
+chrM	2797	2798	0.0	0.0
+chrM	2798	2799	0.0	0.0
+chrM	2799	2800	0.0	0.0
+chrM	2800	2801	0.0	0.0
+chrM	2801	2802	0.0	0.0
+chrM	2802	2803	0.0	0.0
+chrM	2803	2804	0.0	0.0
+chrM	2804	2805	0.0	0.0
+chrM	2805	2806	0.0	0.0
+chrM	2806	2807	0.0	0.0
+chrM	2807	2808	0.0	0.0
+chrM	2808	2809	0.0	0.0
+chrM	2809	2810	0.0	0.0
+chrM	2810	2811	0.0	0.0
+chrM	2811	2812	0.0	0.0
+chrM	2812	2813	0.0	0.0
+chrM	2813	2814	0.0	0.0
+chrM	2814	2815	0.0	0.0
+chrM	2815	2816	0.0	0.0
+chrM	2816	2817	0.0	0.0
+chrM	2817	2818	0.0	0.0
+chrM	2818	2819	0.0	0.0
+chrM	2819	2820	0.0	0.0
+chrM	2820	2821	0.0	0.0
+chrM	2821	2822	0.0	0.0
+chrM	2822	2823	0.0	0.0
+chrM	2823	2824	0.0	0.0
+chrM	2824	2825	0.0	0.0
+chrM	2825	2826	0.0	0.0
+chrM	2826	2827	0.0	0.0
+chrM	2827	2828	0.0	0.0
+chrM	2828	2829	0.0	0.0
+chrM	2829	2830	0.0	0.0
+chrM	2830	2831	0.0	0.0
+chrM	2831	2832	0.0	0.0
+chrM	2832	2833	0.0	0.0
+chrM	2833	2834	0.0	0.0
+chrM	2834	2835	0.0	0.0
+chrM	2835	2836	0.0	0.0
+chrM	2836	2837	0.0	0.0
+chrM	2837	2838	0.0	0.0
+chrM	2838	2839	0.0	0.0
+chrM	2839	2840	0.0	0.0
+chrM	2840	2841	0.0	0.0
+chrM	2841	2842	0.0	0.0
+chrM	2842	2843	0.0	0.0
+chrM	2843	2844	0.0	0.0
+chrM	2844	2845	0.0	0.0
+chrM	2845	2846	0.0	0.0
+chrM	2846	2847	0.0	0.0
+chrM	2847	2848	0.0	0.0
+chrM	2848	2849	0.0	0.0
+chrM	2849	2850	0.0	0.0
+chrM	2850	2851	0.0	0.0
+chrM	2851	2852	0.0	0.0
+chrM	2852	2853	0.0	0.0
+chrM	2853	2854	0.0	0.0
+chrM	2854	2855	0.0	0.0
+chrM	2855	2856	0.0	0.0
+chrM	2856	2857	0.0	0.0
+chrM	2857	2858	0.0	0.0
+chrM	2858	2859	0.0	0.0
+chrM	2859	2860	0.0	0.0
+chrM	2860	2861	0.0	0.0
+chrM	2861	2862	0.0	0.0
+chrM	2862	2863	0.0	0.0
+chrM	2863	2864	0.0	0.0
+chrM	2864	2865	0.0	0.0
+chrM	2865	2866	0.0	0.0
+chrM	2866	2867	0.0	0.0
+chrM	2867	2868	0.0	0.0
+chrM	2868	2869	0.0	0.0
+chrM	2869	2870	0.0	0.0
+chrM	2870	2871	0.0	0.0
+chrM	2871	2872	0.0	0.0
+chrM	2872	2873	0.0	0.0
+chrM	2873	2874	0.0	0.0
+chrM	2874	2875	0.0	0.0
+chrM	2875	2876	0.0	0.0
+chrM	2876	2877	0.0	0.0
+chrM	2877	2878	0.0	0.0
+chrM	2878	2879	0.0	0.0
+chrM	2879	2880	0.0	0.0
+chrM	2880	2881	0.0	0.0
+chrM	2881	2882	0.0	0.0
+chrM	2882	2883	0.0	0.0
+chrM	2883	2884	0.0	0.0
+chrM	2884	2885	0.0	0.0
+chrM	2885	2886	0.0	0.0
+chrM	2886	2887	0.0	0.0
+chrM	2887	2888	0.0	0.0
+chrM	2888	2889	0.0	0.0
+chrM	2889	2890	0.0	0.0
+chrM	2890	2891	0.0	0.0
+chrM	2891	2892	0.0	0.0
+chrM	2892	2893	0.0	0.0
+chrM	2893	2894	0.0	0.0
+chrM	2894	2895	0.0	0.0
+chrM	2895	2896	0.0	0.0
+chrM	2896	2897	0.0	0.0
+chrM	2897	2898	0.0	0.0
+chrM	2898	2899	0.0	0.0
+chrM	2899	2900	0.0	0.0
+chrM	2900	2901	0.0	0.0
+chrM	2901	2902	0.0	0.0
+chrM	2902	2903	0.0	0.0
+chrM	2903	2904	0.0	0.0
+chrM	2904	2905	0.0	0.0
+chrM	2905	2906	0.0	0.0
+chrM	2906	2907	0.0	0.0
+chrM	2907	2908	0.0	0.0
+chrM	2908	2909	0.0	0.0
+chrM	2909	2910	0.0	0.0
+chrM	2910	2911	0.0	0.0
+chrM	2911	2912	0.0	0.0
+chrM	2912	2913	0.0	0.0
+chrM	2913	2914	0.0	0.0
+chrM	2914	2915	0.0	0.0
+chrM	2915	2916	0.0	0.0
+chrM	2916	2917	0.0	0.0
+chrM	2917	2918	0.0	0.0
+chrM	2918	2919	0.0	0.0
+chrM	2919	2920	0.0	0.0
+chrM	2920	2921	0.0	0.0
+chrM	2921	2922	0.0	0.0
+chrM	2922	2923	0.0	0.0
+chrM	2923	2924	0.0	0.0
+chrM	2924	2925	0.0	0.0
+chrM	2925	2926	0.0	0.0
+chrM	2926	2927	0.0	0.0
+chrM	2927	2928	0.0	0.0
+chrM	2928	2929	0.0	0.0
+chrM	2929	2930	0.0	0.0
+chrM	2930	2931	0.0	0.0
+chrM	2931	2932	0.0	0.0
+chrM	2932	2933	0.0	0.0
+chrM	2933	2934	0.0	0.0
+chrM	2934	2935	0.0	0.0
+chrM	2935	2936	0.0	0.0
+chrM	2936	2937	0.0	0.0
+chrM	2937	2938	0.0	0.0
+chrM	2938	2939	0.0	0.0
+chrM	2939	2940	0.0	0.0
+chrM	2940	2941	0.0	0.0
+chrM	2941	2942	0.0	0.0
+chrM	2942	2943	0.0	0.0
+chrM	2943	2944	0.0	0.0
+chrM	2944	2945	0.0	0.0
+chrM	2945	2946	0.0	0.0
+chrM	2946	2947	0.0	0.0
+chrM	2947	2948	0.0	0.0
+chrM	2948	2949	0.0	0.0
+chrM	2949	2950	0.0	0.0
+chrM	2950	2951	0.0	0.0
+chrM	2951	2952	0.0	0.0
+chrM	2952	2953	0.0	0.0
+chrM	2953	2954	0.0	0.0
+chrM	2954	2955	0.0	0.0
+chrM	2955	2956	0.0	0.0
+chrM	2956	2957	0.0	0.0
+chrM	2957	2958	0.0	0.0
+chrM	2958	2959	0.0	0.0
+chrM	2959	2960	0.0	0.0
+chrM	2960	2961	0.0	0.0
+chrM	2961	2962	0.0	0.0
+chrM	2962	2963	0.0	0.0
+chrM	2963	2964	0.0	0.0
+chrM	2964	2965	0.0	0.0
+chrM	2965	2966	0.0	0.0
+chrM	2966	2967	0.0	0.0
+chrM	2967	2968	0.0	0.0
+chrM	2968	2969	0.0	0.0
+chrM	2969	2970	0.0	0.0
+chrM	2970	2971	0.0	0.0
+chrM	2971	2972	0.0	0.0
+chrM	2972	2973	0.0	0.0
+chrM	2973	2974	0.0	0.0
+chrM	2974	2975	0.0	0.0
+chrM	2975	2976	0.0	0.0
+chrM	2976	2977	0.0	0.0
+chrM	2977	2978	0.0	0.0
+chrM	2978	2979	0.0	0.0
+chrM	2979	2980	0.0	0.0
+chrM	2980	2981	0.0	0.0
+chrM	2981	2982	0.0	0.0
+chrM	2982	2983	0.0	0.0
+chrM	2983	2984	0.0	0.0
+chrM	2984	2985	0.0	0.0
+chrM	2985	2986	0.0	0.0
+chrM	2986	2987	0.0	0.0
+chrM	2987	2988	0.0	0.0
+chrM	2988	2989	0.0	0.0
+chrM	2989	2990	0.0	0.0
+chrM	2990	2991	0.0	0.0
+chrM	2991	2992	0.0	0.0
+chrM	2992	2993	0.0	0.0
+chrM	2993	2994	0.0	0.0
+chrM	2994	2995	0.0	0.0
+chrM	2995	2996	0.0	0.0
+chrM	2996	2997	0.0	0.0
+chrM	2997	2998	0.0	0.0
+chrM	2998	2999	0.0	0.0
+chrM	2999	3000	0.0	0.0
+chrM	3000	3001	0.0	0.0
+chrM	3001	3002	0.0	0.0
+chrM	3002	3003	0.0	0.0
+chrM	3003	3004	0.0	0.0
+chrM	3004	3005	0.0	0.0
+chrM	3005	3006	0.0	0.0
+chrM	3006	3007	0.0	0.0
+chrM	3007	3008	0.0	0.0
+chrM	3008	3009	0.0	0.0
+chrM	3009	3010	0.0	0.0
+chrM	3010	3011	0.0	0.0
+chrM	3011	3012	0.0	0.0
+chrM	3012	3013	0.0	0.0
+chrM	3013	3014	0.0	0.0
+chrM	3014	3015	0.0	0.0
+chrM	3015	3016	0.0	0.0
+chrM	3016	3017	0.0	0.0
+chrM	3017	3018	0.0	0.0
+chrM	3018	3019	0.0	0.0
+chrM	3019	3020	0.0	0.0
+chrM	3020	3021	0.0	0.0
+chrM	3021	3022	0.0	0.0
+chrM	3022	3023	0.0	0.0
+chrM	3023	3024	0.0	0.0
+chrM	3024	3025	0.0	0.0
+chrM	3025	3026	0.0	0.0
+chrM	3026	3027	0.0	0.0
+chrM	3027	3028	0.0	0.0
+chrM	3028	3029	0.0	0.0
+chrM	3029	3030	0.0	0.0
+chrM	3030	3031	0.0	0.0
+chrM	3031	3032	0.0	0.0
+chrM	3032	3033	0.0	0.0
+chrM	3033	3034	0.0	0.0
+chrM	3034	3035	0.0	0.0
+chrM	3035	3036	0.0	0.0
+chrM	3036	3037	0.0	0.0
+chrM	3037	3038	0.0	0.0
+chrM	3038	3039	0.0	0.0
+chrM	3039	3040	0.0	0.0
+chrM	3040	3041	0.0	0.0
+chrM	3041	3042	0.0	0.0
+chrM	3042	3043	0.0	0.0
+chrM	3043	3044	0.0	0.0
+chrM	3044	3045	0.0	0.0
+chrM	3045	3046	0.0	0.0
+chrM	3046	3047	0.0	0.0
+chrM	3047	3048	0.0	0.0
+chrM	3048	3049	0.0	0.0
+chrM	3049	3050	0.0	0.0
+chrM	3050	3051	0.0	0.0
+chrM	3051	3052	0.0	0.0
+chrM	3052	3053	0.0	0.0
+chrM	3053	3054	0.0	0.0
+chrM	3054	3055	0.0	0.0
+chrM	3055	3056	0.0	0.0
+chrM	3056	3057	0.0	0.0
+chrM	3057	3058	0.0	0.0
+chrM	3058	3059	0.0	0.0
+chrM	3059	3060	0.0	0.0
+chrM	3060	3061	0.0	0.0
+chrM	3061	3062	0.0	0.0
+chrM	3062	3063	0.0	0.0
+chrM	3063	3064	0.0	0.0
+chrM	3064	3065	0.0	0.0
+chrM	3065	3066	0.0	0.0
+chrM	3066	3067	0.0	0.0
+chrM	3067	3068	0.0	0.0
+chrM	3068	3069	0.0	0.0
+chrM	3069	3070	0.0	0.0
+chrM	3070	3071	0.0	0.0
+chrM	3071	3072	0.0	0.0
+chrM	3072	3073	0.0	0.0
+chrM	3073	3074	0.0	0.0
+chrM	3074	3075	0.0	0.0
+chrM	3075	3076	0.0	0.0
+chrM	3076	3077	0.0	0.0
+chrM	3077	3078	0.0	0.0
+chrM	3078	3079	0.0	0.0
+chrM	3079	3080	0.0	0.0
+chrM	3080	3081	0.0	0.0
+chrM	3081	3082	0.0	0.0
+chrM	3082	3083	0.0	0.0
+chrM	3083	3084	0.0	0.0
+chrM	3084	3085	0.0	0.0
+chrM	3085	3086	0.0	0.0
+chrM	3086	3087	0.0	0.0
+chrM	3087	3088	0.0	0.0
+chrM	3088	3089	0.0	0.0
+chrM	3089	3090	0.0	0.0
+chrM	3090	3091	0.0	0.0
+chrM	3091	3092	0.0	0.0
+chrM	3092	3093	0.0	0.0
+chrM	3093	3094	0.0	0.0
+chrM	3094	3095	0.0	0.0
+chrM	3095	3096	0.0	0.0
+chrM	3096	3097	0.0	0.0
+chrM	3097	3098	0.0	0.0
+chrM	3098	3099	0.0	0.0
+chrM	3099	3100	0.0	0.0
+chrM	3100	3101	0.0	0.0
+chrM	3101	3102	0.0	0.0
+chrM	3102	3103	0.0	0.0
+chrM	3103	3104	0.0	0.0
+chrM	3104	3105	0.0	0.0
+chrM	3105	3106	0.0	0.0
+chrM	3106	3107	0.0	0.0
+chrM	3107	3108	0.0	0.0
+chrM	3108	3109	0.0	0.0
+chrM	3109	3110	0.0	0.0
+chrM	3110	3111	0.0	0.0
+chrM	3111	3112	0.0	0.0
+chrM	3112	3113	0.0	0.0
+chrM	3113	3114	0.0	0.0
+chrM	3114	3115	0.0	0.0
+chrM	3115	3116	0.0	0.0
+chrM	3116	3117	0.0	0.0
+chrM	3117	3118	0.0	0.0
+chrM	3118	3119	0.0	0.0
+chrM	3119	3120	0.0	0.0
+chrM	3120	3121	0.0	0.0
+chrM	3121	3122	0.0	0.0
+chrM	3122	3123	0.0	0.0
+chrM	3123	3124	0.0	0.0
+chrM	3124	3125	0.0	0.0
+chrM	3125	3126	0.0	0.0
+chrM	3126	3127	0.0	0.0
+chrM	3127	3128	0.0	0.0
+chrM	3128	3129	0.0	0.0
+chrM	3129	3130	0.0	0.0
+chrM	3130	3131	0.0	0.0
+chrM	3131	3132	0.0	0.0
+chrM	3132	3133	0.0	0.0
+chrM	3133	3134	0.0	0.0
+chrM	3134	3135	0.0	0.0
+chrM	3135	3136	0.0	0.0
+chrM	3136	3137	0.0	0.0
+chrM	3137	3138	0.0	0.0
+chrM	3138	3139	0.0	0.0
+chrM	3139	3140	0.0	0.0
+chrM	3140	3141	0.0	0.0
+chrM	3141	3142	0.0	0.0
+chrM	3142	3143	0.0	0.0
+chrM	3143	3144	0.0	0.0
+chrM	3144	3145	0.0	0.0
+chrM	3145	3146	0.0	0.0
+chrM	3146	3147	0.0	0.0
+chrM	3147	3148	0.0	0.0
+chrM	3148	3149	0.0	0.0
+chrM	3149	3150	0.0	0.0
+chrM	3150	3151	0.0	0.0
+chrM	3151	3152	0.0	0.0
+chrM	3152	3153	0.0	0.0
+chrM	3153	3154	0.0	0.0
+chrM	3154	3155	0.0	0.0
+chrM	3155	3156	0.0	0.0
+chrM	3156	3157	0.0	0.0
+chrM	3157	3158	0.0	0.0
+chrM	3158	3159	0.0	0.0
+chrM	3159	3160	0.0	0.0
+chrM	3160	3161	0.0	0.0
+chrM	3161	3162	0.0	0.0
+chrM	3162	3163	0.0	0.0
+chrM	3163	3164	0.0	0.0
+chrM	3164	3165	0.0	0.0
+chrM	3165	3166	0.0	0.0
+chrM	3166	3167	0.0	0.0
+chrM	3167	3168	0.0	0.0
+chrM	3168	3169	0.0	0.0
+chrM	3169	3170	0.0	0.0
+chrM	3170	3171	0.0	0.0
+chrM	3171	3172	0.0	0.0
+chrM	3172	3173	0.0	0.0
+chrM	3173	3174	0.0	0.0
+chrM	3174	3175	0.0	0.0
+chrM	3175	3176	0.0	0.0
+chrM	3176	3177	0.0	0.0
+chrM	3177	3178	0.0	0.0
+chrM	3178	3179	0.0	0.0
+chrM	3179	3180	0.0	0.0
+chrM	3180	3181	0.0	0.0
+chrM	3181	3182	0.0	0.0
+chrM	3182	3183	0.0	0.0
+chrM	3183	3184	0.0	0.0
+chrM	3184	3185	0.0	0.0
+chrM	3185	3186	0.0	0.0
+chrM	3186	3187	0.0	0.0
+chrM	3187	3188	0.0	0.0
+chrM	3188	3189	0.0	0.0
+chrM	3189	3190	0.0	0.0
+chrM	3190	3191	0.0	0.0
+chrM	3191	3192	0.0	0.0
+chrM	3192	3193	0.0	0.0
+chrM	3193	3194	0.0	0.0
+chrM	3194	3195	0.0	0.0
+chrM	3195	3196	0.0	0.0
+chrM	3196	3197	0.0	0.0
+chrM	3197	3198	0.0	0.0
+chrM	3198	3199	0.0	0.0
+chrM	3199	3200	0.0	0.0
+chrM	3200	3201	0.0	0.0
+chrM	3201	3202	0.0	0.0
+chrM	3202	3203	0.0	0.0
+chrM	3203	3204	0.0	0.0
+chrM	3204	3205	0.0	0.0
+chrM	3205	3206	0.0	0.0
+chrM	3206	3207	0.0	0.0
+chrM	3207	3208	0.0	0.0
+chrM	3208	3209	0.0	0.0
+chrM	3209	3210	0.0	0.0
+chrM	3210	3211	0.0	0.0
+chrM	3211	3212	0.0	0.0
+chrM	3212	3213	0.0	0.0
+chrM	3213	3214	0.0	0.0
+chrM	3214	3215	0.0	0.0
+chrM	3215	3216	0.0	0.0
+chrM	3216	3217	0.0	0.0
+chrM	3217	3218	0.0	0.0
+chrM	3218	3219	0.0	0.0
+chrM	3219	3220	0.0	0.0
+chrM	3220	3221	0.0	0.0
+chrM	3221	3222	0.0	0.0
+chrM	3222	3223	0.0	0.0
+chrM	3223	3224	0.0	0.0
+chrM	3224	3225	0.0	0.0
+chrM	3225	3226	0.0	0.0
+chrM	3226	3227	0.0	0.0
+chrM	3227	3228	0.0	0.0
+chrM	3228	3229	0.0	0.0
+chrM	3229	3230	0.0	0.0
+chrM	3230	3231	0.0	0.0
+chrM	3231	3232	0.0	0.0
+chrM	3232	3233	0.0	0.0
+chrM	3233	3234	0.0	0.0
+chrM	3234	3235	0.0	0.0
+chrM	3235	3236	0.0	0.0
+chrM	3236	3237	0.0	0.0
+chrM	3237	3238	0.0	0.0
+chrM	3238	3239	0.0	0.0
+chrM	3239	3240	0.0	0.0
+chrM	3240	3241	0.0	0.0
+chrM	3241	3242	0.0	0.0
+chrM	3242	3243	0.0	0.0
+chrM	3243	3244	0.0	0.0
+chrM	3244	3245	0.0	0.0
+chrM	3245	3246	0.0	0.0
+chrM	3246	3247	0.0	0.0
+chrM	3247	3248	0.0	0.0
+chrM	3248	3249	0.0	0.0
+chrM	3249	3250	0.0	0.0
+chrM	3250	3251	0.0	0.0
+chrM	3251	3252	0.0	0.0
+chrM	3252	3253	0.0	0.0
+chrM	3253	3254	0.0	0.0
+chrM	3254	3255	0.0	0.0
+chrM	3255	3256	0.0	0.0
+chrM	3256	3257	0.0	0.0
+chrM	3257	3258	0.0	0.0
+chrM	3258	3259	0.0	0.0
+chrM	3259	3260	0.0	0.0
+chrM	3260	3261	0.0	0.0
+chrM	3261	3262	0.0	0.0
+chrM	3262	3263	0.0	0.0
+chrM	3263	3264	0.0	0.0
+chrM	3264	3265	0.0	0.0
+chrM	3265	3266	0.0	0.0
+chrM	3266	3267	0.0	0.0
+chrM	3267	3268	0.0	0.0
+chrM	3268	3269	0.0	0.0
+chrM	3269	3270	0.0	0.0
+chrM	3270	3271	0.0	0.0
+chrM	3271	3272	0.0	0.0
+chrM	3272	3273	0.0	0.0
+chrM	3273	3274	0.0	0.0
+chrM	3274	3275	0.0	0.0
+chrM	3275	3276	0.0	0.0
+chrM	3276	3277	0.0	0.0
+chrM	3277	3278	0.0	0.0
+chrM	3278	3279	0.0	0.0
+chrM	3279	3280	0.0	0.0
+chrM	3280	3281	0.0	0.0
+chrM	3281	3282	0.0	0.0
+chrM	3282	3283	0.0	0.0
+chrM	3283	3284	0.0	0.0
+chrM	3284	3285	0.0	0.0
+chrM	3285	3286	0.0	0.0
+chrM	3286	3287	0.0	0.0
+chrM	3287	3288	0.0	0.0
+chrM	3288	3289	0.0	0.0
+chrM	3289	3290	0.0	0.0
+chrM	3290	3291	0.0	0.0
+chrM	3291	3292	0.0	0.0
+chrM	3292	3293	0.0	0.0
+chrM	3293	3294	0.0	0.0
+chrM	3294	3295	0.0	0.0
+chrM	3295	3296	0.0	0.0
+chrM	3296	3297	0.0	0.0
+chrM	3297	3298	0.0	0.0
+chrM	3298	3299	0.0	0.0
+chrM	3299	3300	0.0	0.0
+chrM	3300	3301	0.0	0.0
+chrM	3301	3302	0.0	0.0
+chrM	3302	3303	0.0	0.0
+chrM	3303	3304	0.0	0.0
+chrM	3304	3305	0.0	0.0
+chrM	3305	3306	0.0	0.0
+chrM	3306	3307	0.0	0.0
+chrM	3307	3308	0.0	0.0
+chrM	3308	3309	0.0	0.0
+chrM	3309	3310	0.0	0.0
+chrM	3310	3311	0.0	0.0
+chrM	3311	3312	0.0	0.0
+chrM	3312	3313	0.0	0.0
+chrM	3313	3314	0.0	0.0
+chrM	3314	3315	0.0	0.0
+chrM	3315	3316	0.0	0.0
+chrM	3316	3317	0.0	0.0
+chrM	3317	3318	0.0	0.0
+chrM	3318	3319	0.0	0.0
+chrM	3319	3320	0.0	0.0
+chrM	3320	3321	0.0	0.0
+chrM	3321	3322	0.0	0.0
+chrM	3322	3323	0.0	0.0
+chrM	3323	3324	0.0	0.0
+chrM	3324	3325	0.0	0.0
+chrM	3325	3326	0.0	0.0
+chrM	3326	3327	0.0	0.0
+chrM	3327	3328	0.0	0.0
+chrM	3328	3329	0.0	0.0
+chrM	3329	3330	0.0	0.0
+chrM	3330	3331	0.0	0.0
+chrM	3331	3332	0.0	0.0
+chrM	3332	3333	0.0	0.0
+chrM	3333	3334	0.0	0.0
+chrM	3334	3335	0.0	0.0
+chrM	3335	3336	0.0	0.0
+chrM	3336	3337	0.0	0.0
+chrM	3337	3338	0.0	0.0
+chrM	3338	3339	0.0	0.0
+chrM	3339	3340	0.0	0.0
+chrM	3340	3341	0.0	0.0
+chrM	3341	3342	0.0	0.0
+chrM	3342	3343	0.0	0.0
+chrM	3343	3344	0.0	0.0
+chrM	3344	3345	0.0	0.0
+chrM	3345	3346	0.0	0.0
+chrM	3346	3347	0.0	0.0
+chrM	3347	3348	0.0	0.0
+chrM	3348	3349	0.0	0.0
+chrM	3349	3350	0.0	0.0
+chrM	3350	3351	0.0	0.0
+chrM	3351	3352	0.0	0.0
+chrM	3352	3353	0.0	0.0
+chrM	3353	3354	0.0	0.0
+chrM	3354	3355	0.0	0.0
+chrM	3355	3356	0.0	0.0
+chrM	3356	3357	0.0	0.0
+chrM	3357	3358	0.0	0.0
+chrM	3358	3359	0.0	0.0
+chrM	3359	3360	0.0	0.0
+chrM	3360	3361	0.0	0.0
+chrM	3361	3362	0.0	0.0
+chrM	3362	3363	0.0	0.0
+chrM	3363	3364	0.0	0.0
+chrM	3364	3365	0.0	0.0
+chrM	3365	3366	0.0	0.0
+chrM	3366	3367	0.0	0.0
+chrM	3367	3368	0.0	0.0
+chrM	3368	3369	0.0	0.0
+chrM	3369	3370	0.0	0.0
+chrM	3370	3371	0.0	0.0
+chrM	3371	3372	0.0	0.0
+chrM	3372	3373	0.0	0.0
+chrM	3373	3374	0.0	0.0
+chrM	3374	3375	0.0	0.0
+chrM	3375	3376	0.0	0.0
+chrM	3376	3377	0.0	0.0
+chrM	3377	3378	0.0	0.0
+chrM	3378	3379	0.0	0.0
+chrM	3379	3380	0.0	0.0
+chrM	3380	3381	0.0	0.0
+chrM	3381	3382	0.0	0.0
+chrM	3382	3383	0.0	0.0
+chrM	3383	3384	0.0	0.0
+chrM	3384	3385	0.0	0.0
+chrM	3385	3386	0.0	0.0
+chrM	3386	3387	0.0	0.0
+chrM	3387	3388	0.0	0.0
+chrM	3388	3389	0.0	0.0
+chrM	3389	3390	0.0	0.0
+chrM	3390	3391	0.0	0.0
+chrM	3391	3392	0.0	0.0
+chrM	3392	3393	0.0	0.0
+chrM	3393	3394	0.0	0.0
+chrM	3394	3395	0.0	0.0
+chrM	3395	3396	0.0	0.0
+chrM	3396	3397	0.0	0.0
+chrM	3397	3398	0.0	0.0
+chrM	3398	3399	0.0	0.0
+chrM	3399	3400	0.0	0.0
+chrM	3400	3401	0.0	0.0
+chrM	3401	3402	0.0	0.0
+chrM	3402	3403	0.0	0.0
+chrM	3403	3404	0.0	0.0
+chrM	3404	3405	0.0	0.0
+chrM	3405	3406	0.0	0.0
+chrM	3406	3407	0.0	0.0
+chrM	3407	3408	0.0	0.0
+chrM	3408	3409	0.0	0.0
+chrM	3409	3410	0.0	0.0
+chrM	3410	3411	0.0	0.0
+chrM	3411	3412	0.0	0.0
+chrM	3412	3413	0.0	0.0
+chrM	3413	3414	0.0	0.0
+chrM	3414	3415	0.0	0.0
+chrM	3415	3416	0.0	0.0
+chrM	3416	3417	0.0	0.0
+chrM	3417	3418	0.0	0.0
+chrM	3418	3419	0.0	0.0
+chrM	3419	3420	0.0	0.0
+chrM	3420	3421	0.0	0.0
+chrM	3421	3422	0.0	0.0
+chrM	3422	3423	0.0	0.0
+chrM	3423	3424	0.0	0.0
+chrM	3424	3425	0.0	0.0
+chrM	3425	3426	0.0	0.0
+chrM	3426	3427	0.0	0.0
+chrM	3427	3428	0.0	0.0
+chrM	3428	3429	0.0	0.0
+chrM	3429	3430	0.0	0.0
+chrM	3430	3431	0.0	0.0
+chrM	3431	3432	0.0	0.0
+chrM	3432	3433	0.0	0.0
+chrM	3433	3434	0.0	0.0
+chrM	3434	3435	0.0	0.0
+chrM	3435	3436	0.0	0.0
+chrM	3436	3437	0.0	0.0
+chrM	3437	3438	0.0	0.0
+chrM	3438	3439	0.0	0.0
+chrM	3439	3440	0.0	0.0
+chrM	3440	3441	0.0	0.0
+chrM	3441	3442	0.0	0.0
+chrM	3442	3443	0.0	0.0
+chrM	3443	3444	0.0	0.0
+chrM	3444	3445	0.0	0.0
+chrM	3445	3446	0.0	0.0
+chrM	3446	3447	0.0	0.0
+chrM	3447	3448	0.0	0.0
+chrM	3448	3449	0.0	0.0
+chrM	3449	3450	0.0	0.0
+chrM	3450	3451	0.0	0.0
+chrM	3451	3452	0.0	0.0
+chrM	3452	3453	0.0	0.0
+chrM	3453	3454	0.0	0.0
+chrM	3454	3455	0.0	0.0
+chrM	3455	3456	0.0	0.0
+chrM	3456	3457	0.0	0.0
+chrM	3457	3458	0.0	0.0
+chrM	3458	3459	0.0	0.0
+chrM	3459	3460	0.0	0.0
+chrM	3460	3461	0.0	0.0
+chrM	3461	3462	0.0	0.0
+chrM	3462	3463	0.0	0.0
+chrM	3463	3464	0.0	0.0
+chrM	3464	3465	0.0	0.0
+chrM	3465	3466	0.0	0.0
+chrM	3466	3467	0.0	0.0
+chrM	3467	3468	0.0	0.0
+chrM	3468	3469	0.0	0.0
+chrM	3469	3470	0.0	0.0
+chrM	3470	3471	0.0	0.0
+chrM	3471	3472	0.0	0.0
+chrM	3472	3473	0.0	0.0
+chrM	3473	3474	0.0	0.0
+chrM	3474	3475	0.0	0.0
+chrM	3475	3476	0.0	0.0
+chrM	3476	3477	0.0	0.0
+chrM	3477	3478	0.0	0.0
+chrM	3478	3479	0.0	0.0
+chrM	3479	3480	0.0	0.0
+chrM	3480	3481	0.0	0.0
+chrM	3481	3482	0.0	0.0
+chrM	3482	3483	0.0	0.0
+chrM	3483	3484	0.0	0.0
+chrM	3484	3485	0.0	0.0
+chrM	3485	3486	0.0	0.0
+chrM	3486	3487	0.0	0.0
+chrM	3487	3488	0.0	0.0
+chrM	3488	3489	0.0	0.0
+chrM	3489	3490	0.0	0.0
+chrM	3490	3491	0.0	0.0
+chrM	3491	3492	0.0	0.0
+chrM	3492	3493	0.0	0.0
+chrM	3493	3494	0.0	0.0
+chrM	3494	3495	0.0	0.0
+chrM	3495	3496	0.0	0.0
+chrM	3496	3497	0.0	0.0
+chrM	3497	3498	0.0	0.0
+chrM	3498	3499	0.0	0.0
+chrM	3499	3500	0.0	0.0
+chrM	3500	3501	0.0	0.0
+chrM	3501	3502	0.0	0.0
+chrM	3502	3503	0.0	0.0
+chrM	3503	3504	0.0	0.0
+chrM	3504	3505	0.0	0.0
+chrM	3505	3506	0.0	0.0
+chrM	3506	3507	0.0	0.0
+chrM	3507	3508	0.0	0.0
+chrM	3508	3509	0.0	0.0
+chrM	3509	3510	0.0	0.0
+chrM	3510	3511	0.0	0.0
+chrM	3511	3512	0.0	0.0
+chrM	3512	3513	0.0	0.0
+chrM	3513	3514	0.0	0.0
+chrM	3514	3515	0.0	0.0
+chrM	3515	3516	0.0	0.0
+chrM	3516	3517	0.0	0.0
+chrM	3517	3518	0.0	0.0
+chrM	3518	3519	0.0	0.0
+chrM	3519	3520	0.0	0.0
+chrM	3520	3521	0.0	0.0
+chrM	3521	3522	0.0	0.0
+chrM	3522	3523	0.0	0.0
+chrM	3523	3524	0.0	0.0
+chrM	3524	3525	0.0	0.0
+chrM	3525	3526	0.0	0.0
+chrM	3526	3527	0.0	0.0
+chrM	3527	3528	0.0	0.0
+chrM	3528	3529	0.0	0.0
+chrM	3529	3530	0.0	0.0
+chrM	3530	3531	0.0	0.0
+chrM	3531	3532	0.0	0.0
+chrM	3532	3533	0.0	0.0
+chrM	3533	3534	0.0	0.0
+chrM	3534	3535	0.0	0.0
+chrM	3535	3536	0.0	0.0
+chrM	3536	3537	0.0	0.0
+chrM	3537	3538	0.0	0.0
+chrM	3538	3539	0.0	0.0
+chrM	3539	3540	0.0	0.0
+chrM	3540	3541	0.0	0.0
+chrM	3541	3542	0.0	0.0
+chrM	3542	3543	0.0	0.0
+chrM	3543	3544	0.0	0.0
+chrM	3544	3545	0.0	0.0
+chrM	3545	3546	0.0	0.0
+chrM	3546	3547	0.0	0.0
+chrM	3547	3548	0.0	0.0
+chrM	3548	3549	0.0	0.0
+chrM	3549	3550	0.0	0.0
+chrM	3550	3551	0.0	0.0
+chrM	3551	3552	0.0	0.0
+chrM	3552	3553	0.0	0.0
+chrM	3553	3554	0.0	0.0
+chrM	3554	3555	0.0	0.0
+chrM	3555	3556	0.0	0.0
+chrM	3556	3557	0.0	0.0
+chrM	3557	3558	0.0	0.0
+chrM	3558	3559	0.0	0.0
+chrM	3559	3560	0.0	0.0
+chrM	3560	3561	0.0	0.0
+chrM	3561	3562	0.0	0.0
+chrM	3562	3563	0.0	0.0
+chrM	3563	3564	0.0	0.0
+chrM	3564	3565	0.0	0.0
+chrM	3565	3566	0.0	0.0
+chrM	3566	3567	0.0	0.0
+chrM	3567	3568	0.0	0.0
+chrM	3568	3569	0.0	0.0
+chrM	3569	3570	0.0	0.0
+chrM	3570	3571	0.0	0.0
+chrM	3571	3572	0.0	0.0
+chrM	3572	3573	0.0	0.0
+chrM	3573	3574	0.0	0.0
+chrM	3574	3575	0.0	0.0
+chrM	3575	3576	0.0	0.0
+chrM	3576	3577	0.0	0.0
+chrM	3577	3578	0.0	0.0
+chrM	3578	3579	0.0	0.0
+chrM	3579	3580	0.0	0.0
+chrM	3580	3581	0.0	0.0
+chrM	3581	3582	0.0	0.0
+chrM	3582	3583	0.0	0.0
+chrM	3583	3584	0.0	0.0
+chrM	3584	3585	0.0	0.0
+chrM	3585	3586	0.0	0.0
+chrM	3586	3587	0.0	0.0
+chrM	3587	3588	0.0	0.0
+chrM	3588	3589	0.0	0.0
+chrM	3589	3590	0.0	0.0
+chrM	3590	3591	0.0	0.0
+chrM	3591	3592	0.0	0.0
+chrM	3592	3593	0.0	0.0
+chrM	3593	3594	0.0	0.0
+chrM	3594	3595	0.0	0.0
+chrM	3595	3596	0.0	0.0
+chrM	3596	3597	0.0	0.0
+chrM	3597	3598	0.0	0.0
+chrM	3598	3599	0.0	0.0
+chrM	3599	3600	0.0	0.0
+chrM	3600	3601	0.0	0.0
+chrM	3601	3602	0.0	0.0
+chrM	3602	3603	0.0	0.0
+chrM	3603	3604	0.0	0.0
+chrM	3604	3605	0.0	0.0
+chrM	3605	3606	0.0	0.0
+chrM	3606	3607	0.0	0.0
+chrM	3607	3608	0.0	0.0
+chrM	3608	3609	0.0	0.0
+chrM	3609	3610	0.0	0.0
+chrM	3610	3611	0.0	0.0
+chrM	3611	3612	0.0	0.0
+chrM	3612	3613	0.0	0.0
+chrM	3613	3614	0.0	0.0
+chrM	3614	3615	0.0	0.0
+chrM	3615	3616	0.0	0.0
+chrM	3616	3617	0.0	0.0
+chrM	3617	3618	0.0	0.0
+chrM	3618	3619	0.0	0.0
+chrM	3619	3620	0.0	0.0
+chrM	3620	3621	0.0	0.0
+chrM	3621	3622	0.0	0.0
+chrM	3622	3623	0.0	0.0
+chrM	3623	3624	0.0	0.0
+chrM	3624	3625	0.0	0.0
+chrM	3625	3626	0.0	0.0
+chrM	3626	3627	0.0	0.0
+chrM	3627	3628	0.0	0.0
+chrM	3628	3629	0.0	0.0
+chrM	3629	3630	0.0	0.0
+chrM	3630	3631	0.0	0.0
+chrM	3631	3632	0.0	0.0
+chrM	3632	3633	0.0	0.0
+chrM	3633	3634	0.0	0.0
+chrM	3634	3635	0.0	0.0
+chrM	3635	3636	0.0	0.0
+chrM	3636	3637	0.0	0.0
+chrM	3637	3638	0.0	0.0
+chrM	3638	3639	0.0	0.0
+chrM	3639	3640	0.0	0.0
+chrM	3640	3641	0.0	0.0
+chrM	3641	3642	0.0	0.0
+chrM	3642	3643	0.0	0.0
+chrM	3643	3644	0.0	0.0
+chrM	3644	3645	0.0	0.0
+chrM	3645	3646	0.0	0.0
+chrM	3646	3647	0.0	0.0
+chrM	3647	3648	0.0	0.0
+chrM	3648	3649	0.0	0.0
+chrM	3649	3650	0.0	0.0
+chrM	3650	3651	0.0	0.0
+chrM	3651	3652	0.0	0.0
+chrM	3652	3653	0.0	0.0
+chrM	3653	3654	0.0	0.0
+chrM	3654	3655	0.0	0.0
+chrM	3655	3656	0.0	0.0
+chrM	3656	3657	0.0	0.0
+chrM	3657	3658	0.0	0.0
+chrM	3658	3659	0.0	0.0
+chrM	3659	3660	0.0	0.0
+chrM	3660	3661	0.0	0.0
+chrM	3661	3662	0.0	0.0
+chrM	3662	3663	0.0	0.0
+chrM	3663	3664	0.0	0.0
+chrM	3664	3665	0.0	0.0
+chrM	3665	3666	0.0	0.0
+chrM	3666	3667	0.0	0.0
+chrM	3667	3668	0.0	0.0
+chrM	3668	3669	0.0	0.0
+chrM	3669	3670	0.0	0.0
+chrM	3670	3671	0.0	0.0
+chrM	3671	3672	0.0	0.0
+chrM	3672	3673	0.0	0.0
+chrM	3673	3674	0.0	0.0
+chrM	3674	3675	0.0	0.0
+chrM	3675	3676	0.0	0.0
+chrM	3676	3677	0.0	0.0
+chrM	3677	3678	0.0	0.0
+chrM	3678	3679	0.0	0.0
+chrM	3679	3680	0.0	0.0
+chrM	3680	3681	0.0	0.0
+chrM	3681	3682	0.0	0.0
+chrM	3682	3683	0.0	0.0
+chrM	3683	3684	0.0	0.0
+chrM	3684	3685	0.0	0.0
+chrM	3685	3686	0.0	0.0
+chrM	3686	3687	0.0	0.0
+chrM	3687	3688	0.0	0.0
+chrM	3688	3689	0.0	0.0
+chrM	3689	3690	0.0	0.0
+chrM	3690	3691	0.0	0.0
+chrM	3691	3692	0.0	0.0
+chrM	3692	3693	0.0	0.0
+chrM	3693	3694	0.0	0.0
+chrM	3694	3695	0.0	0.0
+chrM	3695	3696	0.0	0.0
+chrM	3696	3697	0.0	0.0
+chrM	3697	3698	0.0	0.0
+chrM	3698	3699	0.0	0.0
+chrM	3699	3700	0.0	0.0
+chrM	3700	3701	0.0	0.0
+chrM	3701	3702	0.0	0.0
+chrM	3702	3703	0.0	0.0
+chrM	3703	3704	0.0	0.0
+chrM	3704	3705	0.0	0.0
+chrM	3705	3706	0.0	0.0
+chrM	3706	3707	0.0	0.0
+chrM	3707	3708	0.0	0.0
+chrM	3708	3709	0.0	0.0
+chrM	3709	3710	0.0	0.0
+chrM	3710	3711	0.0	0.0
+chrM	3711	3712	0.0	0.0
+chrM	3712	3713	0.0	0.0
+chrM	3713	3714	0.0	0.0
+chrM	3714	3715	0.0	0.0
+chrM	3715	3716	0.0	0.0
+chrM	3716	3717	0.0	0.0
+chrM	3717	3718	0.0	0.0
+chrM	3718	3719	0.0	0.0
+chrM	3719	3720	0.0	0.0
+chrM	3720	3721	0.0	0.0
+chrM	3721	3722	0.0	0.0
+chrM	3722	3723	0.0	0.0
+chrM	3723	3724	0.0	0.0
+chrM	3724	3725	0.0	0.0
+chrM	3725	3726	0.0	0.0
+chrM	3726	3727	0.0	0.0
+chrM	3727	3728	0.0	0.0
+chrM	3728	3729	0.0	0.0
+chrM	3729	3730	0.0	0.0
+chrM	3730	3731	0.0	0.0
+chrM	3731	3732	0.0	0.0
+chrM	3732	3733	0.0	0.0
+chrM	3733	3734	0.0	0.0
+chrM	3734	3735	0.0	0.0
+chrM	3735	3736	0.0	0.0
+chrM	3736	3737	0.0	0.0
+chrM	3737	3738	0.0	0.0
+chrM	3738	3739	0.0	0.0
+chrM	3739	3740	0.0	0.0
+chrM	3740	3741	0.0	0.0
+chrM	3741	3742	0.0	0.0
+chrM	3742	3743	0.0	0.0
+chrM	3743	3744	0.0	0.0
+chrM	3744	3745	0.0	0.0
+chrM	3745	3746	0.0	0.0
+chrM	3746	3747	0.0	0.0
+chrM	3747	3748	0.0	0.0
+chrM	3748	3749	0.0	0.0
+chrM	3749	3750	0.0	0.0
+chrM	3750	3751	0.0	0.0
+chrM	3751	3752	0.0	0.0
+chrM	3752	3753	0.0	0.0
+chrM	3753	3754	0.0	0.0
+chrM	3754	3755	0.0	0.0
+chrM	3755	3756	0.0	0.0
+chrM	3756	3757	0.0	0.0
+chrM	3757	3758	0.0	0.0
+chrM	3758	3759	0.0	0.0
+chrM	3759	3760	0.0	0.0
+chrM	3760	3761	0.0	0.0
+chrM	3761	3762	0.0	0.0
+chrM	3762	3763	0.0	0.0
+chrM	3763	3764	0.0	0.0
+chrM	3764	3765	0.0	0.0
+chrM	3765	3766	0.0	0.0
+chrM	3766	3767	0.0	0.0
+chrM	3767	3768	0.0	0.0
+chrM	3768	3769	0.0	0.0
+chrM	3769	3770	0.0	0.0
+chrM	3770	3771	0.0	0.0
+chrM	3771	3772	0.0	0.0
+chrM	3772	3773	0.0	0.0
+chrM	3773	3774	0.0	0.0
+chrM	3774	3775	0.0	0.0
+chrM	3775	3776	0.0	0.0
+chrM	3776	3777	0.0	0.0
+chrM	3777	3778	0.0	0.0
+chrM	3778	3779	0.0	0.0
+chrM	3779	3780	0.0	0.0
+chrM	3780	3781	0.0	0.0
+chrM	3781	3782	0.0	0.0
+chrM	3782	3783	0.0	0.0
+chrM	3783	3784	0.0	0.0
+chrM	3784	3785	0.0	0.0
+chrM	3785	3786	0.0	0.0
+chrM	3786	3787	0.0	0.0
+chrM	3787	3788	0.0	0.0
+chrM	3788	3789	0.0	0.0
+chrM	3789	3790	0.0	0.0
+chrM	3790	3791	0.0	0.0
+chrM	3791	3792	0.0	0.0
+chrM	3792	3793	0.0	0.0
+chrM	3793	3794	0.0	0.0
+chrM	3794	3795	0.0	0.0
+chrM	3795	3796	0.0	0.0
+chrM	3796	3797	0.0	0.0
+chrM	3797	3798	0.0	0.0
+chrM	3798	3799	0.0	0.0
+chrM	3799	3800	0.0	0.0
+chrM	3800	3801	0.0	0.0
+chrM	3801	3802	0.0	0.0
+chrM	3802	3803	0.0	0.0
+chrM	3803	3804	0.0	0.0
+chrM	3804	3805	0.0	0.0
+chrM	3805	3806	0.0	0.0
+chrM	3806	3807	0.0	0.0
+chrM	3807	3808	0.0	0.0
+chrM	3808	3809	0.0	0.0
+chrM	3809	3810	0.0	0.0
+chrM	3810	3811	0.0	0.0
+chrM	3811	3812	0.0	0.0
+chrM	3812	3813	0.0	0.0
+chrM	3813	3814	0.0	0.0
+chrM	3814	3815	0.0	0.0
+chrM	3815	3816	0.0	0.0
+chrM	3816	3817	0.0	0.0
+chrM	3817	3818	0.0	0.0
+chrM	3818	3819	0.0	0.0
+chrM	3819	3820	0.0	0.0
+chrM	3820	3821	0.0	0.0
+chrM	3821	3822	0.0	0.0
+chrM	3822	3823	0.0	0.0
+chrM	3823	3824	0.0	0.0
+chrM	3824	3825	0.0	0.0
+chrM	3825	3826	0.0	0.0
+chrM	3826	3827	0.0	0.0
+chrM	3827	3828	0.0	0.0
+chrM	3828	3829	0.0	0.0
+chrM	3829	3830	0.0	0.0
+chrM	3830	3831	0.0	0.0
+chrM	3831	3832	0.0	0.0
+chrM	3832	3833	0.0	0.0
+chrM	3833	3834	0.0	0.0
+chrM	3834	3835	0.0	0.0
+chrM	3835	3836	0.0	0.0
+chrM	3836	3837	0.0	0.0
+chrM	3837	3838	0.0	0.0
+chrM	3838	3839	0.0	0.0
+chrM	3839	3840	0.0	0.0
+chrM	3840	3841	0.0	0.0
+chrM	3841	3842	0.0	0.0
+chrM	3842	3843	0.0	0.0
+chrM	3843	3844	0.0	0.0
+chrM	3844	3845	0.0	0.0
+chrM	3845	3846	0.0	0.0
+chrM	3846	3847	0.0	0.0
+chrM	3847	3848	0.0	0.0
+chrM	3848	3849	0.0	0.0
+chrM	3849	3850	0.0	0.0
+chrM	3850	3851	0.0	0.0
+chrM	3851	3852	0.0	0.0
+chrM	3852	3853	0.0	0.0
+chrM	3853	3854	0.0	0.0
+chrM	3854	3855	0.0	0.0
+chrM	3855	3856	0.0	0.0
+chrM	3856	3857	0.0	0.0
+chrM	3857	3858	0.0	0.0
+chrM	3858	3859	0.0	0.0
+chrM	3859	3860	0.0	0.0
+chrM	3860	3861	0.0	0.0
+chrM	3861	3862	0.0	0.0
+chrM	3862	3863	0.0	0.0
+chrM	3863	3864	0.0	0.0
+chrM	3864	3865	0.0	0.0
+chrM	3865	3866	0.0	0.0
+chrM	3866	3867	0.0	0.0
+chrM	3867	3868	0.0	0.0
+chrM	3868	3869	0.0	0.0
+chrM	3869	3870	0.0	0.0
+chrM	3870	3871	0.0	0.0
+chrM	3871	3872	0.0	0.0
+chrM	3872	3873	0.0	0.0
+chrM	3873	3874	0.0	0.0
+chrM	3874	3875	0.0	0.0
+chrM	3875	3876	0.0	0.0
+chrM	3876	3877	0.0	0.0
+chrM	3877	3878	0.0	0.0
+chrM	3878	3879	0.0	0.0
+chrM	3879	3880	0.0	0.0
+chrM	3880	3881	0.0	0.0
+chrM	3881	3882	0.0	0.0
+chrM	3882	3883	0.0	0.0
+chrM	3883	3884	0.0	0.0
+chrM	3884	3885	0.0	0.0
+chrM	3885	3886	0.0	0.0
+chrM	3886	3887	0.0	0.0
+chrM	3887	3888	0.0	0.0
+chrM	3888	3889	0.0	0.0
+chrM	3889	3890	0.0	0.0
+chrM	3890	3891	0.0	0.0
+chrM	3891	3892	0.0	0.0
+chrM	3892	3893	0.0	0.0
+chrM	3893	3894	0.0	0.0
+chrM	3894	3895	0.0	0.0
+chrM	3895	3896	0.0	0.0
+chrM	3896	3897	0.0	0.0
+chrM	3897	3898	0.0	0.0
+chrM	3898	3899	0.0	0.0
+chrM	3899	3900	0.0	0.0
+chrM	3900	3901	0.0	0.0
+chrM	3901	3902	0.0	0.0
+chrM	3902	3903	0.0	0.0
+chrM	3903	3904	0.0	0.0
+chrM	3904	3905	0.0	0.0
+chrM	3905	3906	0.0	0.0
+chrM	3906	3907	0.0	0.0
+chrM	3907	3908	0.0	0.0
+chrM	3908	3909	0.0	0.0
+chrM	3909	3910	0.0	0.0
+chrM	3910	3911	0.0	0.0
+chrM	3911	3912	0.0	0.0
+chrM	3912	3913	0.0	0.0
+chrM	3913	3914	0.0	0.0
+chrM	3914	3915	0.0	0.0
+chrM	3915	3916	0.0	0.0
+chrM	3916	3917	0.0	0.0
+chrM	3917	3918	0.0	0.0
+chrM	3918	3919	0.0	0.0
+chrM	3919	3920	0.0	0.0
+chrM	3920	3921	0.0	0.0
+chrM	3921	3922	0.0	0.0
+chrM	3922	3923	0.0	0.0
+chrM	3923	3924	0.0	0.0
+chrM	3924	3925	0.0	0.0
+chrM	3925	3926	0.0	0.0
+chrM	3926	3927	0.0	0.0
+chrM	3927	3928	0.0	0.0
+chrM	3928	3929	0.0	0.0
+chrM	3929	3930	0.0	0.0
+chrM	3930	3931	0.0	0.0
+chrM	3931	3932	0.0	0.0
+chrM	3932	3933	0.0	0.0
+chrM	3933	3934	0.0	0.0
+chrM	3934	3935	0.0	0.0
+chrM	3935	3936	0.0	0.0
+chrM	3936	3937	0.0	0.0
+chrM	3937	3938	0.0	0.0
+chrM	3938	3939	0.0	0.0
+chrM	3939	3940	0.0	0.0
+chrM	3940	3941	0.0	0.0
+chrM	3941	3942	0.0	0.0
+chrM	3942	3943	0.0	0.0
+chrM	3943	3944	0.0	0.0
+chrM	3944	3945	0.0	0.0
+chrM	3945	3946	0.0	0.0
+chrM	3946	3947	0.0	0.0
+chrM	3947	3948	0.0	0.0
+chrM	3948	3949	0.0	0.0
+chrM	3949	3950	0.0	0.0
+chrM	3950	3951	0.0	0.0
+chrM	3951	3952	0.0	0.0
+chrM	3952	3953	0.0	0.0
+chrM	3953	3954	0.0	0.0
+chrM	3954	3955	0.0	0.0
+chrM	3955	3956	0.0	0.0
+chrM	3956	3957	0.0	0.0
+chrM	3957	3958	0.0	0.0
+chrM	3958	3959	0.0	0.0
+chrM	3959	3960	0.0	0.0
+chrM	3960	3961	0.0	0.0
+chrM	3961	3962	0.0	0.0
+chrM	3962	3963	0.0	0.0
+chrM	3963	3964	0.0	0.0
+chrM	3964	3965	0.0	0.0
+chrM	3965	3966	0.0	0.0
+chrM	3966	3967	0.0	0.0
+chrM	3967	3968	0.0	0.0
+chrM	3968	3969	0.0	0.0
+chrM	3969	3970	0.0	0.0
+chrM	3970	3971	0.0	0.0
+chrM	3971	3972	0.0	0.0
+chrM	3972	3973	0.0	0.0
+chrM	3973	3974	0.0	0.0
+chrM	3974	3975	0.0	0.0
+chrM	3975	3976	0.0	0.0
+chrM	3976	3977	0.0	0.0
+chrM	3977	3978	0.0	0.0
+chrM	3978	3979	0.0	0.0
+chrM	3979	3980	0.0	0.0
+chrM	3980	3981	0.0	0.0
+chrM	3981	3982	0.0	0.0
+chrM	3982	3983	0.0	0.0
+chrM	3983	3984	0.0	0.0
+chrM	3984	3985	0.0	0.0
+chrM	3985	3986	0.0	0.0
+chrM	3986	3987	0.0	0.0
+chrM	3987	3988	0.0	0.0
+chrM	3988	3989	0.0	0.0
+chrM	3