annotate test-data/phiX.fasta @ 17:be95d48dd27f draft default tip

"planemo upload for repository https://github.com/deeptools/deepTools/tree/master/galaxy/wrapper/ commit 9308cb7fc910dba348d48fd0dce77a90264b7bdb"
author bgruening
date Fri, 11 Feb 2022 15:57:22 +0000
parents 1638c02b28b5
children
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
0
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
1 >phiX174
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
2 GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
3 GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
4 ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
5 TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
6 GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
7 TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
8 TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
9 CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
10 TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
11 TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
12 GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
13 CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
14 TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
15 AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
16 CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
17 TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
18 TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
19 CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
20 GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
21 GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
22 ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
23 TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
24 TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
25 ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
26 CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
27 GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
28 CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
29 TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
30 TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
31 TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
32 AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
33 TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
34 ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
35 GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
36 TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
37 TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
38 TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
39 TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
40 CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
41 AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
42 CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
43 TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
44 CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
45 AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
46 GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
47 GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
48 TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
49 CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
50 TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
51 GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
52 CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
53 TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
54 AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
55 TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
56 CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
57 TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
58 TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
59 CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
60 TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
61 ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
62 TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
63 ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
64 GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
65 CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
66 GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
67 GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
68 ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
69 CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
70 CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
71 GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
72 CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
73 CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
74 TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
75 TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
76 TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
77 AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
78 TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA
1638c02b28b5 planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
bgruening
parents:
diff changeset
79