changeset 0:1638c02b28b5 draft

planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 0eeb2e1a184186ba5ac044136e71b943e2af0f09
author bgruening
date Mon, 05 Dec 2016 08:09:05 -0500
parents
children 0240a81c3ae6
files computeMatrixOperations.xml datatypes_conf.xml deepTools_macros.xml deepTools_macros.xml.orig readme.rst repository_dependencies.xml static/images/GC_bias_simulated_reads_2L.png static/images/QC_GCplots_input.png static/images/QC_fingerprint.png static/images/QC_multiBamSummary_humanSamples.png static/images/QC_plotCoverage.png static/images/bamCompare_output.png static/images/bamCoverage_output.png static/images/bamFP_galaxy_output.png static/images/bamPEFragmentSize_output.png static/images/bigwigCompare_output.png static/images/computeGCBias_output.png static/images/computeMatrix_advancedOutput.png static/images/computeMatrix_output.png static/images/computeMatrix_overview.png static/images/computeMatrix_selectRegions.png static/images/computeMatrix_selectScores.png static/images/multiBamSummary_output.png static/images/multiBigwigSummary_output.png static/images/norm_IGVsnapshot_indFiles.png static/images/plotCorrelate_RNAseq.png static/images/plotCorrelation_galaxy_bw_heatmap_output.png static/images/plotCorrelation_output.png static/images/plotCorrelation_scatterplot_PearsonCorr_bigwigScores.png static/images/plotCoverage_annotated.png static/images/plotCoverage_output.png static/images/plotEnrichment_output.png static/images/plotFingerprint_output.png static/images/plotHeatmap_example.png static/images/plotHeatmap_example02.png static/images/plotPCA_annotated.png static/images/plotProfiler_examples.png static/images/visual_hm_DmelPolII.png static/images/visual_profiler_DmelPolII.png test-data/bamCompare_result1.bg test-data/bamCompare_result2.bw test-data/bamCoverage_result1.bw test-data/bamCoverage_result2.bw test-data/bamCoverage_result3.bg test-data/bamCoverage_result4.bg test-data/bamCoverage_result4.bw test-data/bamCoverage_result5.bw test-data/bamCoverage_result6.bw test-data/bamPEFragmentSize_histogram_result1.png test-data/bamPEFragmentSize_result1.txt test-data/bigwigCompare_result1.bw test-data/bigwigCompare_result2.bg test-data/bowtie2 test1.bam test-data/computeGCBias_result1.png test-data/computeGCBias_result1.tabular test-data/computeMatrix1.bed test-data/computeMatrix2.bed test-data/computeMatrix2.bw test-data/computeMatrixOperations.txt test-data/computeMatrixOperations_result2.mat.gz test-data/computeMatrix_result1.gz test-data/computeMatrix_result2.gz test-data/computeMatrix_result3.gz test-data/correctGCBias_result1.bam test-data/heatmapper_result1.png test-data/heatmapper_result2.png test-data/heatmapper_result2.tabular test-data/multiBamSummary_regions.bed test-data/multiBamSummary_result1.npz test-data/multiBamSummary_result2.npz test-data/multiBigwigSummary_result1.npz test-data/multiBigwigSummary_result1.png test-data/paired_chr2L.bam test-data/phiX.2bit test-data/phiX.bam test-data/phiX.bam.bai test-data/phiX.fasta test-data/plotCorrelation_result1.png test-data/plotCorrelation_result1.tabular test-data/plotCorrelation_result2.png test-data/plotCoverage_result1.png test-data/plotCoverage_result1.tabular test-data/plotEnrichment_output.png test-data/plotEnrichment_output.txt test-data/plotFingerprint_quality_metrics.tabular test-data/plotFingerprint_result1.png test-data/plotFingerprint_result2.png test-data/plotFingerprint_result2.tabular test-data/plotPCA_result1.png test-data/plotPCA_result2.png test-data/plotPCA_result2.tabular test-data/profiler_result1.png test-data/profiler_result2.png test-data/profiler_result2.tabular test-data/sequence.2bit test-data/test.bw tool-data/deepTools_seqs.loc.sample tool-data/lastz_seqs.loc.sample tool_data_table_conf.xml.sample tool_dependencies.xml
diffstat 100 files changed, 35354 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/computeMatrixOperations.xml	Mon Dec 05 08:09:05 2016 -0500
@@ -0,0 +1,179 @@
+<tool id="deeptools_compute_matrix_operations" name="computeMatrixOperations" version="@WRAPPER_VERSION@.0">
+    <description>Modify or combine the output of computeMatrix in a variety of ways.</description>
+    <macros>
+        <token name="@BINARY@">computeMatrixOperations</token>
+        <import>deepTools_macros.xml</import>
+    </macros>
+    <expand macro="requirements"/>
+    <command>
+<![CDATA[
+        @BINARY@
+            #if $submodule.command == "info":
+                info
+                -m $submodule.matrixFile
+                > $outFileTxt
+            #else if $submodule.command == "subset":
+                subset
+                -m $submodule.matrixFile
+                #if $submodule.groups is not None and str($submodule.groups) != '':
+                    --groups $submodule.groups
+                #end if
+                #if $submodule.samples is not None and str($submodule.samples) != '':
+                    --samples $submodule.samples
+                #end if
+                -o $outFileName
+            #else if $submodule.command == "filterStrand":
+                filterStrand
+                -m $submodule.matrixFile
+                --strand $submodule.strand
+                -o $outFileName
+            #else if $submodule.command == "rbind":
+                #set $files=[]
+                #for $f in $submodule.matrixFiles:
+                    #silent $files.append(str($f.matrixFile))
+                #end for
+                rbind
+                -m '#echo "' '".join($files)#'
+                -o $outFileName
+            #else if $submodule.command == "cbind":
+                cbind
+                #set $files=[]
+                #for $f in $submodule.matrixFiles:
+                    #silent $files.append(str($f.matrixFile))
+                #end for
+                -m '#echo "' '".join($files)#'
+                -o $outFileName
+            #else if $submodule.command == "sort":
+                sort
+                #set $files=[]
+                #for $f in $submodule.regionsFiles:
+                    #silent $files.append(str($f.regionsFile))
+                #end for
+                -m $submodule.matrixFile
+                -R '#echo "' '".join($files)#'
+                -o $outFileName
+            #end if
+]]>
+    </command>
+    <inputs>
+        <conditional name="submodule">
+            <param name="command" type="select" label="Operation type">
+                <option value="info" selected="true">Print information (info)</option>
+                <option value="subset">Subset by samples and/or groups of regions (subset)</option>
+                <option value="filterStrand">Filter by strand (filterStrand)</option>
+                <option value="rbind">Bind matrices, top to bottom (rbind)</option>
+                <option value="cbind">Bind matrices, left to right (cbind)</option>
+                <option value="sort">Sort by region order in specified files (sort)</option>
+            </param>
+            <when value="info">
+                <param argument="matrixFile" format="deeptools_compute_matrix_archive" type="data"
+                       label="Matrix file from the computeMatrix tool" help=""/>
+            </when>
+
+            <when value="subset">
+                <param argument="matrixFile" format="deeptools_compute_matrix_archive" type="data"
+                       label="Matrix file from the computeMatrix tool" help=""/>
+                <param argument="groups" type="text" optional="true" label="Region groups to include."
+                    help="If blank, all region groups are output. Alternatively, one or more groups listed in the output of the 'info' command can be used (separate groups by a space and enclose in quotes if needed)" />
+                <param argument="samples" type="text" optional="true" label="Samples to include."
+                    help="If blank, all samples are output. Alternatively, one or more samples listed in the output of the 'info' command can be used (separate sample names by a space and enclose in quotes if needed)" />
+            </when>
+
+            <when value="filterStrand">
+                <param argument="matrixFile" format="deeptools_compute_matrix_archive" type="data"
+                       label="Matrix file from the computeMatrix tool" help=""/>
+                <param argument="strand" type="select" label="Only include regions on this strand."
+                    help="Only regions on the desired strand will be included in the output. If you desire to instead remove regions on only one strand (or the . strand), separately run this on the other strand and then use the rbind operation.">
+                    <option value="+">+</option>
+                    <option value="-">-</option>
+                    <option value=".">. (no annotated strand)</option>
+                </param>
+            </when>
+
+            <when value="rbind">
+                <repeat name="matrixFiles" title="Matrix files from computeMatrix" min="2">
+                <param argument="matrixFile" format="deeptools_compute_matrix_archive" type="data"
+                       label="Matrix file from the computeMatrix tool" help=""/>
+                </repeat>
+            </when>
+
+            <when value="cbind">
+                <repeat name="matrixFiles" title="Matrix files from computeMatrix" min="2">
+                <param argument="matrixFile" format="deeptools_compute_matrix_archive" type="data"
+                       label="Matrix file from the computeMatrix tool" help=""/>
+                </repeat>
+            </when>
+
+            <when value="sort">
+                <param argument="matrixFile" format="deeptools_compute_matrix_archive" type="data"
+                       label="Matrix file from the computeMatrix tool" help=""/>
+                <repeat name="regionsFiles" title="BED or GTF files of regions" min="1">
+                    <param name="regionsFile" format="bed,gtf" type="data" label="Regions to plot"
+                        help="File, in BED format, containing the regions to plot."/>
+                </repeat>
+            </when>
+        </conditional>
+    </inputs>
+    <outputs>
+        <data format="deeptools_compute_matrix_archive" name="outFileName" label="${tool.name} ${submodule.command} on ${on_string}">
+            <filter>
+            ((
+                submodule['command'] != "info"
+            ))
+            </filter>
+        </data>
+        <data format="txt" name="outFileTxt" label="${tool.name} info on ${on_string}">
+            <filter>
+            ((
+                submodule['command'] == "info"
+            ))
+            </filter>
+        </data>
+    </outputs>
+    <tests>
+        <test>
+            <param name="command" value="info" />
+            <param name="matrixFile" value="computeMatrix_result1.gz" ftype="deeptools_compute_matrix_archive" />
+            <output name="outFileTxt" file="computeMatrixOperations.txt" ftype="txt" />
+        </test>
+        <test>
+            <param name="command" value="rbind" />
+            <param name="matrixFile" value="computeMatrix_result1.gz" ftype="deeptools_compute_matrix_archive" />
+            <param name="matrixFile" value="computeMatrix_result1.gz" ftype="deeptools_compute_matrix_archive" />
+            <output name="outFileName" file="computeMatrixOperations_result2.mat.gz" ftype="deeptools_compute_matrix_archive" compare="sim_size" delta="100"/>
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+
+What it does
+------------
+
+``computeMatrixOperations`` can perform a variety of operations on one or more files produced by ``computeMatrix`` (N.B., the output is always written to a new file):
+
++----------------+--------------------------------------------------------------------------------------------------------------------------+
++ **Subcommand** | **What it does**                                                                                                         |
++----------------+--------------------------------------------------------------------------------------------------------------------------+
++ info           | Prints out the sample and region group names in the order in which they appear.                                          |
++----------------+--------------------------------------------------------------------------------------------------------------------------+
++ subset         | Subsets a file by the desired samples/region group names. This can also change the order of these samples/region groups. |
++----------------+--------------------------------------------------------------------------------------------------------------------------+
++ filterStrand   | Filters the file to only include regions annotated as being on a particular strand.                                      |
++----------------+--------------------------------------------------------------------------------------------------------------------------+
++ rbind          | Concatenates multiple matrices together, top to bottom.                                                                  |
++----------------+--------------------------------------------------------------------------------------------------------------------------+
++ cbind          | Merges multiple matrices, left to right.                                                                                 |
++----------------+--------------------------------------------------------------------------------------------------------------------------+
++ sort           | Sorts the given file so regions are in the order of occurence in the input BED/GTF file(s).                              |
++----------------+--------------------------------------------------------------------------------------------------------------------------+
+
+
+These operations are useful when you want to run computeMatrix on multiple files (thereby keeping all of the values together) and later exclude regions/samples or add new ones. Another common use would be if you require the output of computeMatrix to be sorted to match the order of regions in the input file.
+
+-----
+
+@REFERENCES@
+]]>
+    </help>
+    <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/datatypes_conf.xml	Mon Dec 05 08:09:05 2016 -0500
@@ -0,0 +1,7 @@
+<?xml version="1.0"?>
+<datatypes>
+    <registration>
+        <datatype extension="deeptools_compute_matrix_archive" type="galaxy.datatypes.binary:CompressedArchive" subclass="True" display_in_upload="True"/>
+        <datatype extension="deeptools_coverage_matrix" type="galaxy.datatypes.binary:CompressedArchive" subclass="True" display_in_upload="True"/>
+    </registration>
+</datatypes>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/deepTools_macros.xml	Mon Dec 05 08:09:05 2016 -0500
@@ -0,0 +1,811 @@
+<macros>
+
+    <xml name="advancedOpt_scaffold">
+        <conditional name="advancedOpt">
+            <param name="showAdvancedOpt" type="select" label="Show advanced options" >
+                <option value="no" selected="true">no</option>
+                <option value="yes">yes</option>
+            </param>
+            <when value="no" />
+            <when value="yes">
+                <yield/>
+            </when>
+        </conditional>
+    </xml>
+
+    <token name="@ADVANCED_OPTS_READ_PROCESSING@">
+        #if $advancedOpt.doExtendCustom.doExtend == 'custom':
+            --extendReads $advancedOpt.doExtendCustom.extendReadsValue
+        #else if $advancedOpt.doExtendCustom.doExtend == 'yes':
+            --extendReads
+        #end if
+        $advancedOpt.ignoreDuplicates
+        $advancedOpt.centerReads
+        #if $advancedOpt.minMappingQuality:
+            --minMappingQuality '$advancedOpt.minMappingQuality'
+        #end if
+        #if $advancedOpt.samFlagInclude:
+            --samFlagInclude $advancedOpt.samFlagInclude
+        #end if
+        #if $advancedOpt.samFlagExclude:
+            --samFlagExclude $advancedOpt.samFlagExclude
+        #end if
+        #if $advancedOpt.minFragmentLength:
+            --minFragmentLength $advancedOpt.minFragmentLength
+        #end if
+        #if $advancedOpt.maxFragmentLength:
+            --maxFragmentLength $advancedOpt.maxFragmentLength
+        #end if
+    </token>
+
+    <token name="@ADVANCED_OPTS_GTF@">
+        $advancedOpt.metagene
+        #if $advancedOpt.transcriptID:
+            --transcriptID $advancedOpt.transcriptID
+        #end if
+        #if $advancedOpt.exonID:
+            --exonID $advancedOpt.exonID
+        #end if
+        #if $advancedOpt.transcript_id_designator:
+            --transcript_id_designator $advancedOpt.transcript_id_designator
+        #end if
+    </token>
+
+    <xml name="heatmap_options">
+        <expand macro="zMin_zMax" />
+        <expand macro="colorMap" />
+        <expand macro="plotTitle" />
+        <expand macro="plotNumbers" />
+    </xml>
+
+    <token name="@HEATMAP_OPTIONS@">
+        #if str($plotting_type.zMin) != "":
+            --zMin $plotting_type.zMin
+        #end if
+        #if str($plotting_type.zMax) != "":
+            --zMax $plotting_type.zMax
+        #end if
+        --colorMap '$plotting_type.colorMap'
+        $plotting_type.plotNumbers
+        --plotTitle '$plotting_type.plotTitle'
+    </token>
+
+
+    <xml name="includeZeros">
+        <param argument="--includeZeros" type="boolean" truevalue="--includeZeros" falsevalue=""
+            label="Include zeros"
+            help="If set, then regions with zero counts for *all* BAM files are included. The default behavior is to ignore such regions." />
+    </xml>
+
+    <xml name="zMin_zMax">
+        <param argument="--zMin" type="text" value="" optional="true" label="Minimum value for the heatmap intensities"
+            help="If not specified the value is set automatically."/>
+        <param argument="--zMax" type="text" value="" optional="true" label="Maximum value for the heatmap intensities"
+            help="If not specified the value is set automatically."/>
+    </xml>
+
+    <xml name="region_limit_operation">
+        <param argument="--region" type="text" value=""
+            label="Region of the genome to limit the operation to"
+            help="This is useful when testing parameters to reduce the time required. The format is chr:start:end, for example &quot;chr10&quot; or &quot;chr10:456700:891000&quot;.">
+            <sanitizer>
+                <valid initial="string.letters,string.digits">
+                    <add value="|"/>
+                    <add value=":"/>
+                 </valid>
+            </sanitizer>
+        </param>
+    </xml>
+
+    <token name="@THREADS@">--numberOfProcessors "\${GALAXY_SLOTS:-4}"</token>
+    <token name="@WRAPPER_VERSION@">2.4.1</token>
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="2.7.10">python</requirement>
+            <requirement type="package" version="2.4.1">deeptools</requirement>
+            <yield />
+        </requirements>
+        <expand macro="stdio" />
+        <version_command>@BINARY@ --version</version_command>
+    </xml>
+
+    <xml name="smoothLength">
+        <param argument="--smoothLength" type="integer" value="" optional="True" min="1"
+            label="Smooth values using the following length (in bases)"
+            help ="The smooth length defines a window, larger than the bin size, over which the number of reads is to be averaged. For example, if the bin size is set to 20 and the smooth length is 60, then, for each bin, its value is set to the average of it and its left and right neighbors. Any value smaller than the bin size will be ignored and no smoothing will be applied."/>
+    </xml>
+
+
+    <xml name="kmeans_clustering">
+        <conditional name="used_multiple_regions">
+            <param name="used_multiple_regions_options" type="select"
+                label="Did you compute the matrix with more than one groups of regions?"
+                help="Would you like to cluster the regions according to the similarity of the signal distribution? This is only possible if you used computeMatrix on only one group of regions.">
+                <option value="yes">Yes, I used multiple groups of regions</option>
+                <option value="no">No, I used only one group</option>
+            </param>
+            <when value="no">
+                <conditional name="clustering">
+                    <param name="clustering_options" type="select" label="Clustering algorithm">
+                        <option value="none">No clustering</option>
+                        <option value="kmeans">Kmeans clustering</option>
+                        <option value="hclust">Hierarchical clustering</option>
+                    </param>
+                    <when value="kmeans">
+                        <param name="k_kmeans" type="integer" value="0" label="Number of clusters to compute"
+                            help="When this option is set, the matrix is split into clusters using the k-means algorithm.
+                            This only works for data that is not grouped, otherwise only the first group will be clustered.
+                            If more specific clustering methods are required it is advisable to save the underlying matrix and
+                            run the clustering using other software."/>
+                    </when>
+                    <when value="hclust">
+                        <param name="n_hclust" type="integer" value="0" label="number of clusters to compute."
+                            help="WARNING: This option causes the tool to run for a very long time! When this option is
+                            set, the matrix is split into clusters using the hierarchical clustering algorithm, using ward linkage.
+                            This only works for data that is not grouped, otherwise only the first group will be clustered.
+                            Note that you must have used the '--missingDataAsZero' option within computeMatrix!
+                            If more specific clustering methods are required it is advisable to save the underlying matrix and
+                            run the clustering using other software."/>
+                    </when>
+                    <when value="none" />
+                </conditional>
+            </when>
+            <when value="yes" />
+        </conditional>
+    </xml>
+
+    <token name="@KMEANS_CLUSTERING@">
+        #if $advancedOpt.used_multiple_regions.used_multiple_regions_options == 'no':
+            #if $advancedOpt.used_multiple_regions.clustering.clustering_options == 'kmeans':
+                #if int($advancedOpt.used_multiple_regions.clustering.k_kmeans) > 0:
+                    --kmeans $advancedOpt.used_multiple_regions.clustering.k_kmeans
+                #end if
+            #end if
+            #if $advancedOpt.used_multiple_regions.clustering.clustering_options == 'hclust':
+                #if int($advancedOpt.used_multiple_regions.clustering.n_hclust) > 0:
+                    --hclust $advancedOpt.used_multiple_regions.clustering.n_hclust
+                #end if
+            #end if
+        #end if
+    </token>
+
+    <xml name="samFlags">
+        <param argument="--samFlagInclude" type="integer" optional="True" value=""
+            label="Include reads based on the SAM flag"
+            help= "For example, to get only reads that are the first mate use a flag of 64. This is useful to count properly paired reads only once, otherwise the second mate will be also considered for the coverage."/>
+        <param argument="--samFlagExclude" type="integer" optional="True" value=""
+            label="Exclude reads based on the SAM flag"
+            help= "For example, to get only reads that map to the forward strand, use --samFlagExclude 16, where 16 is the SAM flag for reads that map to the reverse strand."/>
+    </xml>
+
+    <xml name="fragLength">
+        <param argument="--minFragmentLength" type="integer" optional="True" value="0" min="0"
+            label="Minimum fragment length for inclusion."
+            help="A value greater than 0 will filter out ALL single-end reads. This is primarily useful in things like ATACseq, where one would like to look specifically at mono- or di-nucleosome fragments." />
+        <param argument="--maxFragmentLength" type="integer" optional="True" value="0" min="0"
+            label="Maximum fragment length for inclusion."
+            help="As above, but the maximum length. A value of 0 (the default) is equivalent to no maximum." />
+    </xml>
+
+    <xml name="read_processing_options">
+        <expand macro="extendReads" />
+        <expand macro="ignoreDuplicates" />
+        <expand macro="centerReads" />
+        <expand macro="minMappingQuality" />
+        <expand macro="samFlags" />
+        <expand macro="fragLength" />
+    </xml>
+
+    <xml name="gtf_options">
+        <param argument="--metagene" type="boolean" truevalue="--boolean" falsevalue=""
+            label="Use a metagene model"
+            help="If set and a BED12 or GTF file or files is used to provide regions, only exons will be used. This is convenient for looking at coverage over mature mRNA transcripts or similar uses where introns should be ignored." />
+        <param argument="--transcriptID" optional="True" value="transcript" type="text"
+            label="trascript designator"
+            help="When a GTF file is used to provide regions, only entries with this value as their feature (column 2) will be processed as transcripts. Default: transcript" />
+        <param argument="--exonID" optional="True" value="exon" type="text"
+            label="exon designator"
+            help="When a GTF file is used to provide regions, only entries with this value as their feature (column 2) will be processed as exons. CDS would be another common value for this. Default: exon" />
+        <param argument="--transcript_id_designator" optional="True" value="transcript_id" type="text"
+            label="transcriptID key designator"
+            help="Each region has an ID (e.g., ACTB) assigned to it, which for BED files is either column 4 (if it exists)
+                  or the interval bounds. For GTF files this is instead stored in the last column as a key:value pair (e.g.,
+                  as 'transcript_id ACTB', for a key of transcript_id and a value of ACTB). In some cases it can be
+                  convenient to use a different identifier. To do so, set this to the desired key. Default: transcript_id" />
+    </xml>
+
+
+    <xml name="plotNumbers">
+        <param argument="--plotNumbers" type="boolean" truevalue="--plotNumbers" falsevalue=""
+            label="Plot the correlation value"
+            help="If set, then the correlation number is plotted on top of the heatmap."/>
+    </xml>
+
+    <xml name="extendReads">
+        <conditional name="doExtendCustom">
+            <param name="doExtend" type="select" label="Extend reads to the given average fragment size."
+                help="(1) Single-end reads and singletons are extended to match this length. (2) Paired-end reads are extended to match the fragment size, regardless of what is set here.
+                     By default *each* read mate is extended.
+                     This can be modified using the SAM flags (see --samFlagInclude and --samFlagExclude options) to keep only the first or the second mate.
+                     Unmated reads, mate reads that map to different chromosomes or too far apart are extended to the given value.
+                     Reads are only extended if --extendReads is set to a value greater than the read length. *NOTE*: For spliced-read data, this option is not
+                     recommended as it will extend reads over skipped regions, e.g. introns in RNA-seq data.">
+                <option value="no" selected="True">No extension. The default value and most typically appropriate.</option>
+                <option value="yes">Paired-end extension. Suitable only for paired-end datasets.</option>
+                <option value="custom">A custom length, which will be applied to ALL reads.</option>
+            </param>
+            <when value="no" />
+            <when value="yes" />
+            <when value="custom">
+                <param name="extendReadsValue" type="integer" value="300" min="1"
+                    label="Extend reads to the given average fragment size"
+                    help="Extend all reads to this length" />
+            </when>
+        </conditional>
+    </xml>
+
+    <xml name="corMethod">
+        <param argument="--corMethod" type="select" label="Correlation method">
+            <option value="spearman" selected="True">Spearman</option>
+            <option value="pearson">Pearson</option>
+        </param>
+    </xml>
+
+    <xml name="distanceBetweenBins">
+        <param argument="--distanceBetweenBins" type="integer" value="0" min="0"
+            label="Distance between bins"
+            help="By default, multiBamSummary considers consecutive bins of
+                the specified 'Bin size'. However, to reduce the
+                computation time, a larger distance between bins can
+                be given. Larger distances result in fewer bins being
+                considered."/>
+    </xml>
+
+    <xml name="centerReads">
+        <param argument="--centerReads" type="boolean" truevalue="--centerReads" falsevalue=""
+            label="Center regions with respect to the fragment length"
+            help="For paired-end data the fragment is defined by the bounds of the reads. For single-end data the bounds are defined by the read and the user-definable fragment/extension length. This option is useful to get a sharper signal around enriched regions."/>
+    </xml>
+
+    <xml name="ignoreDuplicates">
+        <param argument="--ignoreDuplicates" type="boolean" truevalue="--ignoreDuplicates" falsevalue=""
+            label="Ignore duplicates"
+            help="If set, reads that have the same orientation and start position will be considered only once. If reads are paired, the mate position also has to coincide to ignore a read." />
+    </xml>
+
+    <xml name="sortUsing">
+        <param argument="--sortUsing" type="select" label="Method used for sorting"
+            help="For each row the method is computed.">
+            <option value="mean" selected="true">mean</option>
+            <option value="median">median</option>
+            <option value="min">min</option>
+            <option value="max">max</option>
+            <option value="sum">sum</option>
+            <option value="region_length">region length</option>
+        </param>
+    </xml>
+
+    <xml name="sortRegionsComputeMatrix">
+        <param argument="--sortRegions" type="select" label="Sort regions"
+            help="Whether the heatmap should present the regions sorted. The default is to sort in descending order based on the mean value per region.">
+            <option value="no">no ordering</option>
+            <option value="keep" selected="true">maintain the same ordering as the input files</option>
+            <option value="descend">descending order</option>
+            <option value="ascend">ascending order</option>
+        </param>
+    </xml>
+
+    <xml name="sortRegions">
+        <param argument="--sortRegions" type="select" label="Sort regions"
+            help="Whether the heatmap should present the regions sorted. The default is to sort in descending order based on the mean value per region.">
+            <option value="no">no ordering</option>
+            <option value="descend">descending order</option>
+            <option value="ascend">ascending order</option>
+        </param>
+    </xml>
+
+    <xml name="minMappingQuality">
+        <param argument="--minMappingQuality" type="integer" optional="true" value="1" min="0"
+            label="Minimum mapping quality"
+            help= "If set, only reads with a mapping quality score higher than this value are considered."/>
+    </xml>
+
+    <xml name="skipZeros">
+        <param argument="--skipZeros" type="boolean" truevalue="--skipZeros" falsevalue=""
+            label ="Skip zeros"
+            help ="If set, then zero counts that happen for *all* BAM files given are ignored. This may result in fewer considered regions." />
+    </xml>
+
+    <xml name="fragmentLength">
+        <param argument="--fragmentLength" type="integer" value="300" min="1"
+            label="Fragment length used for the sequencing"
+            help ="If paired-end reads are used, the fragment length is computed from the BAM file, so this is only needed for single-end data."/>
+    </xml>
+
+    <xml name="scaleFactor">
+        <param argument="--scaleFactor" type="float" value="1" label="Scaling factor"
+            help="When used in combination with --normalizeTo1x or
+                --normalizeUsingRPKM, the computed scaling factor will
+                be multiplied by the given scale factor." />
+    </xml>
+
+    <xml name="scaleFactors">
+        <param name="scaleFactor1" type="float" value="1" label="Scale factor for treatment" help="(--scaleFactors)"/>
+        <param name="scaleFactor2" type="float" value="1" label="Scale factor for input" help="(--scaleFactors)"/>
+    </xml>
+
+    <xml name="stdio">
+        <stdio>
+            <exit_code range="1:" />
+            <exit_code range=":-1" />
+            <regex match="Error:" />
+            <regex match="Exception:" />
+            <regex match="EXception:" />
+            <regex match="Traceback" />
+        </stdio>
+    </xml>
+
+    <xml name="pseudocount">
+        <param argument="--pseudocount" type="float" value="1" label="Pseudocount" help="Small number to avoid dividing by zero."/>
+    </xml>
+
+    <token name="@REFERENCES@">
+
+.. class:: infomark
+
+For more information on the tools, please visit our `help site`_.
+
+If you would like to give us feedback or you run into any trouble, please send an email to deeptools@googlegroups.com
+
+This tool is developed by the `Bioinformatics and Deep-Sequencing Unit`_ at the `Max Planck Institute for Immunobiology and Epigenetics`_.
+
+.. _Bioinformatics and Deep-Sequencing Unit: http://www.ie-freiburg.mpg.de/bioinformaticsfac
+.. _Max Planck Institute for Immunobiology and Epigenetics: http://www3.ie-freiburg.mpg.de
+.. _help site: https://deeptools.readthedocs.org/
+
+    </token>
+    <xml name="citations">
+        <citations>
+            <citation type="doi">10.1093/nar/gkw257</citation>
+            <yield />
+        </citations>
+    </xml>
+
+    <xml name="multiple_input_bams">
+        <conditional name="multibam_conditional">
+        <param name="orderMatters" type="select" label="Sample order matters" help="By default, the order of samples given to the program is dependent on their order in your history. If the order of the samples is vital to you, select Yes below.">
+            <option value="No" selected="true">No</option>
+            <option value="Yes">Yes</option>
+        </param>
+        <when value="No">
+            <param argument="--bamfiles" type="data" format="bam" min="1"
+                label="Bam file" multiple="true"
+                help=""/>
+        </when>
+        <when value="Yes">
+            <repeat name="multibam_repeats" min="1" title="BAM Files">
+                <param argument="--bamfiles" type="data" format="bam" label="BAM file" help="" />
+            </repeat>
+        </when>
+        </conditional>
+    </xml>
+
+    <xml name="multiple_input_bams_min2">
+        <conditional name="multibam_conditional">
+        <param name="orderMatters" type="select" label="Sample order matters" help="By default, the order of samples given to the program is dependent on their order in your history. If the order of the samples 
+is vital to you, select Yes below.">
+            <option value="No" selected="true">No</option>
+            <option value="Yes">Yes</option>
+        </param>
+        <when value="No">
+            <param argument="--bamfiles" type="data" format="bam" min="2"
+                label="Bam file" multiple="true"
+                help=""/>
+        </when>
+        <when value="Yes">
+            <repeat name="multibam_repeats" min="2" title="BAM Files">
+                <param argument="--bamfiles" type="data" format="bam" label="BAM file" help="" />
+            </repeat>
+        </when>
+        </conditional>
+    </xml>
+
+    <xml name="multiple_input_bigwigs">
+        <conditional name="multibigwig_conditional">
+        <param name="orderMatters" type="select" label="Sample order matters" help="By default, the order of samples given to the program is dependent on their order in your history. If the order of the samples 
+is vital to you, select Yes below.">
+            <option value="No" selected="true">No</option>
+            <option value="Yes">Yes</option>
+        </param>
+        <when value="No">
+            <param argument="--bigwigfiles" type="data" format="bigwig" multiple="True" min="2"
+                label="Bigwig file"
+                help="A Bigwig file."/>
+        </when>
+        <when value="Yes">
+            <repeat name="multibigwig_repeats" min="2" title="BigWig files">
+                <param argument="--bigwigfiles" type="data" format="bigwig" label="Bigwig file" help="A Bigwig file."/>
+            </repeat>
+        </when>
+        </conditional>
+    </xml>
+
+    <xml name="plotTitle">
+        <param argument="--plotTitle" type="text" value="" size="30" optional="True"
+            label="Title of the plot"
+            help="Title of the plot, to be printed on top of the generated image." />
+    </xml>
+
+
+    <token name="@multiple_input_bams@">
+<![CDATA[
+        #set files=[]
+        #set labels=[]
+        #if $multibam_conditional.orderMatters == "No":
+            #for $counter, $bamfile in enumerate($multibam_conditional.bamfiles):
+                ln -s "${bamfile}" "./${counter}.bam" &&
+                ln -s "${bamfile.metadata.bam_index}" "./${counter}.bam.bai" &&
+                #silent $files.append('%s.bam' % $counter)
+                #silent $labels.append("'%s'" % ($bamfile.display_name))
+            #end for
+        #else:
+            #for $counter, $f in enumerate($multibam_conditional.multibam_repeats):
+                ln -s "${f.bamfile}" "./${counter}.bam" &&
+                ln -s "${f.bamfile.metadata.bam_index}" "./${counter}.bam.bai" &&
+                #silent $files.append('%s.bam' % $counter)
+                #silent $labels.append("'%s'" % ($f.bamfile.display_name))
+            #end for
+        #end if
+]]>
+    </token>
+
+    <token name="@multiple_input_bigwigs@">
+<![CDATA[
+        #set files=[]
+        #set labels=[]
+        #if $multibigwig_conditional.orderMatters == "No":
+            #for $counter, $bigwig in enumerate($multibigwig_conditional.bigwigfiles):
+                ln -s "${bigwig}" "${counter}.bw" &&
+                #silent $files.append('%s.bw' % $counter)
+                #silent $labels.append("'%s'" % ($bigwig.display_name))
+            #end for
+        #else:
+            #for $counter, $f in enumerate($multibigwig_conditional.multibigwig_repeats):
+                ln -s "${f.bigwig}" "${counter}.bw" &&
+                #silent $files.append('%s.bw' % $counter)
+                #silent $labels.append("'%s'" % ($f.bigwig.display_name))
+            #end for
+        #end if
+]]>
+    </token>
+
+    <xml name="blacklist">
+        <param argument="--blackListFileName" type="data" format="bed,gtf" multiple="true" optional="true" min="0"
+            label="Blacklisted regions in BED/GTF format"
+            help="One or more files containing regions to exclude from the analysis" />
+    </xml>
+
+    <token name="@blacklist@">
+<![CDATA[
+        #if ' '.join( map(str, $advancedOpt.blackListFileName) ) != 'None':
+            #set blfiles=[]
+            #for $f in $advancedOpt.blackListFileName:
+                #silent $blfiles.append("'%s'" % $f)
+            #end for
+            #if $blfiles != ["'None'"]:
+                --blackListFileName #echo ' '.join($blfiles)#
+            #end if
+        #end if
+]]> 
+    </token>
+
+    <xml name="multiple_bed">
+        <param argument="--BED" type="data" format="bed,gtf" min="1" multiple="true"
+            label="Regions in BED/GTF format"
+            help="One or more files containing regions to include in the analysis" />
+    </xml>
+
+    <token name="@multiple_bed@">
+<![CDATA[
+        #set files=[]
+        #set labels=[]
+        #for $f in $BED:
+            #silent $files.append("'%s'" % $f)
+            #silent $labels.append("'%s'" % $f.display_name)
+        #end for
+        #if len($files) > 0:
+            --BED #echo ' '.join($files)#
+            --regionLabels #echo ' '.join($labels)#
+        #end if
+]]> 
+    </token>
+
+    <xml name="reference_genome_source">
+        <conditional name="source">
+            <param name="ref_source" type="select" label="Reference genome">
+                <option value="cached">locally cached</option>
+                <option value="history">in your history</option>
+            </param>
+            <when value="cached">
+                <param name="input1_2bit" type="select" label="Using reference genome" help="If your genome of interest is not listed, contact the Galaxy team">
+                    <options from_data_table="lastz_seqs">
+                        <filter type="sort_by" column="1" />
+                        <validator type="no_options" message="No indexes are available." />
+                    </options>
+                </param>
+            </when>
+            <when value="history">
+                <param name="input1" type="data" format="twobit" label="Select a reference dataset in 2bit format" />
+            </when>
+        </conditional>
+    </xml>
+
+    <token name="@reference_genome_source@">
+    #if $source.ref_source=="history":
+        --genome $source.input1
+    #else:
+        --genome "$source.input1_2bit.fields.path"
+    #end if
+    </token>
+
+    <xml name="effectiveGenomeSize">
+        <conditional name="effectiveGenomeSize">
+            <param name="effectiveGenomeSize_opt" type="select" label="Effective genome size"
+                help="The effective genome size is the portion of the genome that is mappable. Large fractions of the genome are stretches of NNNN that should be discarded.
+                    Also, if repetitive regions were not included in the mapping of reads, the effective genome size needs to be adjusted accordingly.
+                    See Table 2 of http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0030377 or http://www.nature.com/nbt/journal/v27/n1/fig_tab/nbt.1518_T1.html for several effective genome sizes.">
+                <option value="93260000">ce10 (93260000)</option>
+                <option value="121400000">dm3 (121400000)</option>
+                <option value="2451960000" selected="true">hg19 (2451960000)</option>
+                <option value="2150570000">mm9 (2150570000)</option>
+                <option value="specific">user specified</option>
+            </param>
+            <when value="specific">
+                <param argument="--effectiveGenomeSize" type="integer" value="" label="Effective genome size"
+                       help="e.g. ce10: 93260000, dm3: 121400000, hg19: 2451960000, mm9: 2150570000"/>
+            </when>
+            <when value="2150570000" />
+            <when value="2451960000" />
+            <when value="121400000" />
+            <when value="93260000" />
+        </conditional>
+    </xml>
+
+    <xml name="skipNAs">
+        <param argument="--skipNAs" type="boolean" truevalue="--skipNAs" falsevalue="" checked="False"
+            label="Ignore missing data?"
+            help="This parameter determines if non-covered regions
+                 (regions without overlapping reads) in a bam/bigWig file
+                 should be skipped. The default is to treat those
+                 regions as having a value of zero. The decision to
+                 skip non-covered regions depends on the interpretation
+                 of the data. Non-covered regions may represent, for
+                 example, repetitive regions that should be ignored.
+                 (default: False)" />
+    </xml>
+
+    <xml name="input_save_matrix_values">
+        <param argument="--saveMatrix" type="boolean" label="Save the matrix of values underlying the heatmap"/>
+    </xml>
+
+    <xml name="input_graphic_output_settings">
+        <conditional name="output" >
+            <param name="showOutputSettings" type="select" label="Show advanced output settings" >
+                <option value="no" selected="true">no</option>
+                <option value="yes">yes</option>
+            </param>
+            <when value="no" />
+            <when value="yes">
+                <yield />
+                <param name="saveSortedRegions" type="boolean"
+                       label="Save the regions after skipping zeros or min/max threshold values"
+                       help="The order of the regions in the file follows the sorting order selected. This is useful,
+                       for example, to generate other heatmaps keeping the sorting of the first heatmap."/>
+            </when>
+        </conditional>
+    </xml>
+
+
+    <xml name="input_image_file_format">
+        <param argument="--outFileFormat" type="select" label="Image file format">
+            <option value="png" selected="true">png</option>
+            <option value="pdf">pdf</option>
+            <option value="svg">svg</option>
+            <option value="eps">eps</option>
+        </param>
+    </xml>
+
+    <xml name="output_dpi">
+        <param argument="--dpi" name="dpi" type="integer" value="200" size="3" optional="True"
+            label="Image dpi" help=""/>
+    </xml>
+
+    <xml name="output_image_file_format">
+        <data format="png" name="outFileName" label="${tool.name} image">
+            <change_format>
+                <when input="output.outFileFormat" value="pdf" format="pdf" />
+                <when input="output.outFileFormat" value="svg" format="svg" />
+                <when input="output.outFileFormat" value="eps" format="eps" />
+            </change_format>
+        </data>
+    </xml>
+
+    <xml name="output_image_file_format_not_nested">
+        <data format="png" name="outFileName" label="${tool.name} image">
+            <change_format>
+                <when input="outFileFormat" value="pdf" format="pdf" />
+                <when input="outFileFormat" value="svg" format="svg" />
+                <when input="outFileFormat" value="eps" format="eps" />
+            </change_format>
+        </data>
+    </xml>
+
+    <xml name="output_save_matrix_values">
+        <data format="tabular" name="outFileNameMatrix" label="${tool.name} on ${on_string}: Heatmap values">
+            <filter>
+            ((
+                output['showOutputSettings'] == 'yes' and
+                output['saveMatrix'] is True
+            ))
+            </filter>
+        </data>
+    </xml>
+
+    <xml name="output_graphic_outputs">
+        <data format="bed" name="outFileSortedRegions" label="${tool.name} on ${on_string}: sorted/filtered regions">
+            <filter>
+            ((
+                output['showOutputSettings'] == 'yes' and
+                output['saveSortedRegions'] is True
+            ))
+            </filter>
+        </data>
+    </xml>
+
+    <xml name="colorMap">
+        <param name="colorMap" type="select" label="Color map to use for the heatmap"
+               help=" Available color map names can be found here: http://matplotlib.org/examples/color/colormaps_reference.html"
+               multiple="true">
+            <option value="RdYlBu" selected="true">RdYlBu</option>
+            <option value="Accent">Accent</option>
+            <option value="Spectral">Spectral</option>
+            <option value="Set1">Set1</option>
+            <option value="Set2">Set2</option>
+            <option value="Set3">Set3</option>
+            <option value="Dark2">Dark2</option>
+            <option value="Reds">Reds</option>
+            <option value="Oranges">Oranges</option>
+            <option value="Greens">Greens</option>
+            <option value="Blues">Blues</option>
+            <option value="Greys">Greys</option>
+            <option value="Purples">Purples</option>
+            <option value="Paired">Paired</option>
+            <option value="Pastel1">Pastel1</option>
+            <option value="Pastel2">Pastel2</option>
+            <option value="spring">spring</option>
+            <option value="summer">summer</option>
+            <option value="autumn">autumn</option>
+            <option value="winter">winter</option>
+            <option value="hot">hot</option>
+            <option value="coolwarm">coolwarm</option>
+            <option value="cool">cool</option>
+            <option value="seismic">seismic</option>
+            <option value="terrain">terrain</option>
+            <option value="ocean">ocean</option>
+            <option value="rainbow">rainbow</option>
+            <option value="bone">bone</option>
+            <option value="flag">flag</option>
+            <option value="prism">prism</option>
+            <option value="cubehelix">cubehelix</option>
+            <option value="binary">binary</option>
+            <option value="pink">pink</option>
+            <option value="gray">gray</option>
+            <option value="copper">copper</option>
+            <option value="BrBG">BrBG</option>
+            <option value="BuGn">BuGn</option>
+            <option value="BuPu">BuPu</option>
+            <option value="GnBu">GnBu</option>
+            <option value="OrRd">OrRd</option>
+            <option value="PiYG">PiYG</option>
+            <option value="PRGn">PRGn</option>
+            <option value="PuOr">PuOr</option>
+            <option value="PuRd">PuRd</option>
+            <option value="PuBu">PuBu</option>
+            <option value="RdBu">RdBu</option>
+            <option value="RdGy">RdGy</option>
+            <option value="RdPu">RdPu</option>
+            <option value="YlGn">YlGn</option>
+            <option value="PuBuGn">PuBuGn</option>
+            <option value="RdYlGn">RdYlGn</option>
+            <option value="YlGnBu">YlGnBu</option>
+            <option value="YlOrBr">YlOrBr</option>
+            <option value="YlOrRd">YlOrRd</option>
+            <option value="gist_gray">gist_gray</option>
+            <option value="gist_stern">gist_stern</option>
+            <option value="gist_earth">gist_earth</option>
+            <option value="gist_yarg">gist_yarg</option>
+            <option value="gist_ncar">gist_ncar</option>
+            <option value="gist_rainbow">gist_rainbow</option>
+            <option value="gist_heat">gist_heat</option>
+            <option value="gnuplot">gnuplot</option>
+            <option value="gnuplot2">gnuplot2</option>
+            <option value="CMRmap">CMRmap</option>
+            <option value="bwr">bwr</option>
+            <option value="hsv">hsv</option>
+            <option value="brg">brg</option>
+            <option value="jet">jet</option>
+            <option value="afmhot">afmhot</option>
+            <option value="Accent_r">Accent reversed</option>
+            <option value="Spectral_r">Spectral reversed</option>
+            <option value="Set1_r">Set1 reversed</option>
+            <option value="Set2_r">Set2 reversed</option>
+            <option value="Set3_r">Set3 reversed</option>
+            <option value="Dark2_r">Dark2 reversed</option>
+            <option value="Reds_r">Reds reversed</option>
+            <option value="Oranges_r">Oranges reversed</option>
+            <option value="Greens_r">Greens reversed</option>
+            <option value="Blues_r">Blues reversed</option>
+            <option value="Greys_r">Greys reversed</option>
+            <option value="Purples_r">Purples reversed</option>
+            <option value="Paired_r">Paired reversed</option>
+            <option value="Pastel1_r">Pastel1 reversed</option>
+            <option value="Pastel2_r">Pastel2 reversed</option>
+            <option value="spring_r">spring reversed</option>
+            <option value="summer_r">summer reversed</option>
+            <option value="autumn_r">autumn reversed</option>
+            <option value="winter_r">winter reversed</option>
+            <option value="hot_r">hot reversed</option>
+            <option value="coolwarm_r">coolwarm reversed</option>
+            <option value="cool_r">cool reversed</option>
+            <option value="seismic_r">seismic reversed</option>
+            <option value="terrain_r">terrain reversed</option>
+            <option value="ocean_r">ocean reversed</option>
+            <option value="rainbow_r">rainbow reversed</option>
+            <option value="bone_r">bone reversed</option>
+            <option value="flag_r">flag reversed</option>
+            <option value="prism_r">prism reversed</option>
+            <option value="cubehelix_r">cubehelix reversed</option>
+            <option value="binary_r">binary reversed</option>
+            <option value="pink_r">pink reversed</option>
+            <option value="gray_r">gray reversed</option>
+            <option value="copper_r">copper reversed</option>
+            <option value="BrBG_r">BrBG reversed</option>
+            <option value="BuGn_r">BuGn reversed</option>
+            <option value="BuPu_r">BuPu reversed</option>
+            <option value="GnBu_r">GnBu reversed</option>
+            <option value="OrRd_r">OrRd reversed</option>
+            <option value="PiYG_r">PiYG reversed</option>
+            <option value="PRGn_r">PRGn reversed</option>
+            <option value="PuOr_r">PuOr reversed</option>
+            <option value="PuRd_r">PuRd reversed</option>
+            <option value="PuBu_r">PuBu reversed</option>
+            <option value="RdBu_r">RdBu reversed</option>
+            <option value="RdGy_r">RdGy reversed</option>
+            <option value="RdPu_r">RdPu reversed</option>
+            <option value="YlGn_r">YlGn reversed</option>
+            <option value="PuBuGn_r">PuBuGn reversed</option>
+            <option value="RdYlBu_r">RdYlBu reversed</option>
+            <option value="RdYlGn_r">RdYlGn reversed</option>
+            <option value="YlGnBu_r">YlGnBu reversed</option>
+            <option value="YlOrBr_r">YlOrBr reversed</option>
+            <option value="YlOrRd_r">YlOrRd reversed</option>
+            <option value="gist_gray_r">gist_gray reversed</option>
+            <option value="gist_stern_r">gist_stern reversed</option>
+            <option value="gist_earth_r">gist_earth reversed</option>
+            <option value="gist_yarg_r">gist_yarg reversed</option>
+            <option value="gist_ncar_r">gist_ncar reversed</option>
+            <option value="gist_rainbow_r">gist_rainbow reversed</option>
+            <option value="gist_heat_r">gist_heat reversed</option>
+            <option value="gnuplot_r">gnuplot reversed</option>
+            <option value="gnuplot2_r">gnuplot2 reversed</option>
+            <option value="CMRmap_r">CMRmap reversed</option>
+            <option value="bwr_r">bwr reversed</option>
+            <option value="hsv_r">hsv reversed</option>
+            <option value="brg_r">brg reversed</option>
+            <option value="jet_r">jet reversed</option>
+            <option value="afmhot_r">afmhot reversed</option>
+        </param>
+
+    </xml>
+
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/deepTools_macros.xml.orig	Mon Dec 05 08:09:05 2016 -0500
@@ -0,0 +1,639 @@
+<macros>
+
+    <xml name="advancedOpt_scaffold">
+        <conditional name="advancedOpt">
+            <param name="showAdvancedOpt" type="select" label="Show advanced options" >
+                <option value="no" selected="true">no</option>
+                <option value="yes">yes</option>
+            </param>
+            <when value="no" />
+            <when value="yes">
+                <yield/>
+            </when>
+        </conditional>
+    </xml>
+
+    <token name="@ADVANCED_OPTS_READ_PROCESSING@">
+        #if $advancedOpt.doExtendCustom.doExtend == 'custom':
+            --extendReads $advancedOpt.doExtendCustom.extendReadsValue
+        #else if $advancedOpt.doExtendCustom.doExtend == 'yes':
+            --extendReads
+        #end if
+        $advancedOpt.ignoreDuplicates
+        $advancedOpt.centerReads
+        #if $advancedOpt.minMappingQuality:
+            --minMappingQuality '$advancedOpt.minMappingQuality'
+        #end if
+        #if $advancedOpt.samFlagInclude:
+            --samFlagInclude $advancedOpt.samFlagInclude
+        #end if
+        #if $advancedOpt.samFlagExclude:
+            --samFlagExclude $advancedOpt.samFlagExclude
+        #end if
+    </token>
+
+    <xml name="heatmap_options">
+        <expand macro="zMin_zMax" />
+        <expand macro="colorMap" />
+        <expand macro="plotTitle" />
+        <expand macro="plotNumbers" />
+    </xml>
+
+    <token name="@HEATMAP_OPTIONS@">
+        #if str($plotting_type.zMin) != "":
+            --zMin $plotting_type.zMin
+        #end if
+        #if str($plotting_type.zMax) != "":
+            --zMax $plotting_type.zMax
+        #end if
+        --colorMap '$plotting_type.colorMap'
+        $plotting_type.plotNumbers
+        --plotTitle '$plotting_type.plotTitle'
+    </token>
+
+
+    <xml name="includeZeros">
+        <param argument="--includeZeros" type="boolean" truevalue="--includeZeros" falsevalue=""
+            label="Include zeros"
+            help="If set, then regions with zero counts for *all* BAM files are included. The default behavior is to ignore such regions." />
+    </xml>
+
+    <xml name="zMin_zMax">
+        <param argument="--zMin" type="float" value="" optional="true" label="Minimum value for the heatmap intensities"
+            help="If not specified the value is set automatically."/>
+        <param argument="--zMax" type="float" value="" optional="true" label="Maximum value for the heatmap intensities"
+            help="If not specified the value is set automatically."/>
+    </xml>
+
+    <xml name="region_limit_operation">
+        <param argument="--region" type="text" value=""
+            label="Region of the genome to limit the operation to"
+            help="This is useful when testing parameters to reduce the time required. The format is chr:start:end, for example &quot;chr10&quot; or &quot;chr10:456700:891000&quot;." />
+    </xml>
+
+    <token name="@THREADS@">--numberOfProcessors "\${GALAXY_SLOTS:-4}"</token>
+<<<<<<< HEAD
+    <token name="@WRAPPER_VERSION@">2.0.1.0</token>
+=======
+    <token name="@WRAPPER_VERSION@">2.1.0</token>
+>>>>>>> d56067f86089e75354a2fad266002db3730766d9
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="2.7.10">python</requirement>
+            <requirement type="binary">@BINARY@</requirement>
+<<<<<<< HEAD
+            <requirement type="package" version="2.0.1">deepTools</requirement>
+=======
+            <requirement type="package" version="2.1.0">deepTools</requirement>
+>>>>>>> d56067f86089e75354a2fad266002db3730766d9
+            <yield />
+        </requirements>
+        <expand macro="stdio" />
+        <version_command>@BINARY@ --version</version_command>
+    </xml>
+
+    <xml name="smoothLength">
+        <param argument="--smoothLength" type="integer" value="" optional="True" min="1"
+            label="Smooth values using the following length (in bases)"
+            help ="The smooth length defines a window, larger than the bin size, over which the number of reads is to be averaged. For example, if the bin size is set to 20 and the smooth length is 60, then, for each bin, its value is set to the average of it and its left and right neighbors. Any value smaller than the bin size will be ignored and no smoothing will be applied."/>
+    </xml>
+
+
+    <xml name="kmeans_clustering">
+        <conditional name="used_multiple_regions">
+            <param name="used_multiple_regions_options" type="select"
+                label="Did you compute the matrix with more than one groups of regions?"
+                help="Would you like to cluster the regions according to the similarity of the signal distribution? This is only possible if you used computeMatrix on only one group of regions.">
+                <option value="yes">Yes, I used multiple groups of regions</option>
+                <option value="no">No, I used only one group</option>
+            </param>
+            <when value="no">
+                <conditional name="clustering">
+                    <param name="clustering_options" type="select" label="Clustering algorithm">
+                        <option value="none">No clustering</option>
+                        <option value="kmeans">Kmeans clustering</option>
+                        <option value="hclust">Hierarchical clustering</option>
+                    </param>
+                    <when value="kmeans">
+                        <param name="k_kmeans" type="integer" value="0" label="Number of clusters to compute"
+                            help="When this option is set, the matrix is split into clusters using the k-means algorithm.
+                            This only works for data that is not grouped, otherwise only the first group will be clustered.
+                            If more specific clustering methods are required it is advisable to save the underlying matrix and
+                            run the clustering using other software."/>
+                    </when>
+                    <when value="hclust">
+                        <param name="n_hclust" type="integer" value="0" label="number of clusters to compute."
+                            help="WARNING: This option causes the tool to run for a very long time! When this option is
+                            set, the matrix is split into clusters using the hierarchical clustering algorithm, using ward linkage.
+                            This only works for data that is not grouped, otherwise only the first group will be clustered.
+                            Note that you must have used the '--missingDataAsZero' option within computeMatrix!
+                            If more specific clustering methods are required it is advisable to save the underlying matrix and
+                            run the clustering using other software."/>
+                    </when>
+                    <when value="none" />
+                </conditional>
+            </when>
+            <when value="yes" />
+        </conditional>
+    </xml>
+
+    <token name="@KMEANS_CLUSTERING@">
+        #if $advancedOpt.used_multiple_regions.used_multiple_regions_options == 'no':
+            #if $advancedOpt.used_multiple_regions.clustering.clustering_options == 'kmeans':
+                #if int($advancedOpt.used_multiple_regions.clustering.k_kmeans) > 0:
+                    --kmeans $advancedOpt.used_multiple_regions.clustering.k_kmeans
+                #end if
+            #end if
+            #if $advancedOpt.used_multiple_regions.clustering.clustering_options == 'hclust':
+                #if int($advancedOpt.used_multiple_regions.clustering.n_hclust) > 0:
+                    --hclust $advancedOpt.used_multiple_regions.clustering.n_hclust
+                #end if
+            #end if
+        #end if
+    </token>
+
+    <xml name="samFlags">
+        <param argument="--samFlagInclude" type="integer" optional="True" value=""
+            label="Include reads based on the SAM flag"
+            help= "For example, to get only reads that are the first mate use a flag of 64. This is useful to count properly paired reads only once, otherwise the second mate will be also considered for the coverage."/>
+        <param argument="--samFlagExclude" type="integer" optional="True" value=""
+            label="Exclude reads based on the SAM flag"
+            help= "For example, to get only reads that map to the forward strand, use --samFlagExclude 16, where 16 is the SAM flag for reads that map to the reverse strand."/>
+    </xml>
+
+    <xml name="read_processing_options">
+        <expand macro="extendReads" />
+        <expand macro="ignoreDuplicates" />
+        <expand macro="centerReads" />
+        <expand macro="minMappingQuality" />
+        <expand macro="samFlags" />
+    </xml>
+
+    <xml name="plotNumbers">
+        <param argument="--plotNumbers" type="boolean" truevalue="--plotNumbers" falsevalue=""
+            label="Plot the correlation value"
+            help="If set, then the correlation number is plotted on top of the heatmap."/>
+    </xml>
+
+    <xml name="extendReads">
+        <conditional name="doExtendCustom">
+            <param name="doExtend" type="select" label="Extend reads to the given average fragment size."
+                help="(1) Single-end reads and singletons are extended to match this length. (2) Paired-end reads are extended to match the fragment size, regardless of what is set here.
+                     By default *each* read mate is extended.
+                     This can be modified using the SAM flags (see --samFlagInclude and --samFlagExclude options) to keep only the first or the second mate.
+                     Unmated reads, mate reads that map to different chromosomes or too far apart are extended to the given value.
+                     Reads are only extended if --extendReads is set to a value greater than the read length. *NOTE*: For spliced-read data, this option is not
+                     recommended as it will extend reads over skipped regions, e.g. introns in RNA-seq data.">
+                <option value="no" selected="True">No extension. The default value and most typically appropriate.</option>
+                <option value="yes">Paired-end extension. Suitable only for paired-end datasets.</option>
+                <option value="custom">A custom length, which will be applied to ALL reads.</option>
+            </param>
+            <when value="no" />
+            <when value="yes" />
+            <when value="custom">
+                <param name="extendReadsValue" type="integer" value="300" min="1"
+                    label="Extend reads to the given average fragment size"
+                    help="Extend all reads to this length" />
+            </when>
+        </conditional>
+    </xml>
+
+    <xml name="corMethod">
+        <param argument="--corMethod" type="select" label="Correlation method">
+            <option value="spearman" selected="True">Spearman</option>
+            <option value="pearson">Pearson</option>
+        </param>
+    </xml>
+
+    <xml name="distanceBetweenBins">
+        <param argument="--distanceBetweenBins" type="integer" value="0" min="0"
+            label="Distance between bins"
+            help="By default, multiBamSummary considers consecutive bins of
+                the specified 'Bin size'. However, to reduce the
+                computation time, a larger distance between bins can
+                be given. Larger distances result in fewer bins being
+                considered."/>
+    </xml>
+
+    <xml name="centerReads">
+        <param argument="--centerReads" type="boolean" truevalue="--centerReads" falsevalue=""
+            label="Center regions with respect to the fragment length"
+            help="For paired-end data the fragment is defined by the bounds of the reads. For single-end data the bounds are defined by the read and the user-definable fragment/extension length. This option is useful to get a sharper signal around enriched regions."/>
+    </xml>
+
+    <xml name="ignoreDuplicates">
+        <param argument="--ignoreDuplicates" type="boolean" truevalue="--ignoreDuplicates" falsevalue=""
+            label="Ignore duplicates"
+            help="If set, reads that have the same orientation and start position will be considered only once. If reads are paired, the mate position also has to coincide to ignore a read." />
+    </xml>
+
+    <xml name="sortUsing">
+        <param argument="--sortUsing" type="select" label="Method used for sorting"
+            help="For each row the method is computed.">
+            <option value="mean" selected="true">mean</option>
+            <option value="median">median</option>
+            <option value="min">min</option>
+            <option value="max">max</option>
+            <option value="sum">sum</option>
+            <option value="region_length">region length</option>
+        </param>
+    </xml>
+
+    <xml name="sortRegions">
+        <param argument="--sortRegions" type="select" label="Sort regions"
+            help="Whether the heatmap should present the regions sorted. The default is to sort in descending order based on the mean value per region.">
+            <option value="no">no ordering</option>
+            <option value="descend" selected="true">descending order</option>
+            <option value="ascend">ascending order</option>
+        </param>
+    </xml>
+
+    <xml name="minMappingQuality">
+        <param argument="--minMappingQuality" type="integer" optional="true" value="1" min="1"
+            label="Minimum mapping quality"
+            help= "If set, only reads with a mapping quality score higher than this value are considered."/>
+    </xml>
+
+    <xml name="skipZeros">
+        <param argument="--skipZeros" type="boolean" truevalue="--skipZeros" falsevalue=""
+            label ="Skip zeros"
+            help ="If set, then zero counts that happen for *all* BAM files given are ignored. This may result in fewer considered regions." />
+    </xml>
+
+    <xml name="fragmentLength">
+        <param argument="--fragmentLength" type="integer" value="300" min="1"
+            label="Fragment length used for the sequencing"
+            help ="If paired-end reads are used, the fragment length is computed from the BAM file, so this is only needed for single-end data."/>
+    </xml>
+
+    <xml name="scaleFactor">
+        <param argument="--scaleFactor" type="float" value="1" label="Scaling factor"
+            help="When used in combination with --normalizeTo1x or
+                --normalizeUsingRPKM, the computed scaling factor will
+                be multiplied by the given scale factor." />
+    </xml>
+
+    <xml name="scaleFactors">
+        <param name="scaleFactor1" type="float" value="1" label="Scale factor for treatment" help="(--scaleFactors)"/>
+        <param name="scaleFactor2" type="float" value="1" label="Scale factor for input" help="(--scaleFactors)"/>
+    </xml>
+
+    <xml name="stdio">
+        <stdio>
+            <exit_code range="1:" />
+            <exit_code range=":-1" />
+            <regex match="Error:" />
+            <regex match="Exception:" />
+            <regex match="EXception:" />
+            <regex match="Traceback" />
+        </stdio>
+    </xml>
+
+    <xml name="pseudocount">
+        <param argument="--pseudocount" type="float" value="1" label="Pseudocount" help="Small number to avoid dividing by zero."/>
+    </xml>
+
+    <token name="@REFERENCES@">
+
+.. class:: infomark
+
+For more information on the tools, please visit our `help site`_.
+
+If you would like to give us feedback or you run into any trouble, please send an email to deeptools@googlegroups.com
+
+This tool is developed by the `Bioinformatics and Deep-Sequencing Unit`_ at the `Max Planck Institute for Immunobiology and Epigenetics`_.
+
+.. _Bioinformatics and Deep-Sequencing Unit: http://www.ie-freiburg.mpg.de/bioinformaticsfac
+.. _Max Planck Institute for Immunobiology and Epigenetics: http://www3.ie-freiburg.mpg.de
+.. _help site: https://deeptools.readthedocs.org/
+
+    </token>
+    <xml name="citations">
+        <citations>
+            <citation type="doi">10.1093/nar/gku365</citation>
+            <yield />
+        </citations>
+    </xml>
+
+    <xml name="multiple_input_bams">
+        <param argument="--bamfiles" type="data" format="bam" min="2"
+            label="Bam file" multiple="true"
+            help="The BAM file must be sorted."/>
+    </xml>
+
+    <xml name="multiple_input_bigwigs">
+        <param argument="--bigwigfiles" type="data" format="bigwig" multiple="True" min="2"
+            label="Bigwig file"
+            help="A Bigwig file."/>
+    </xml>
+
+    <xml name="plotTitle">
+        <param argument="--plotTitle" type="text" value="" size="30" optional="True"
+            label="Title of the plot"
+            help="Title of the plot, to be printed on top of the generated image." />
+    </xml>
+
+
+    <token name="@multiple_input_bams@">
+<![CDATA[
+        #set files=[]
+        #set labels=[]
+        #for $counter, $bamfile in enumerate($bamfiles):
+            ln -s "${bamfile}" "./${counter}.bam" &&
+            ln -s "${bamfile.metadata.bam_index}" "./${counter}.bam.bai" &&
+            #silent $files.append('%s.bam' % $counter)
+            #silent $labels.append('%s' % ($bamfile.display_name))
+        #end for
+]]>
+    </token>
+
+    <token name="@multiple_input_bigwigs@">
+<![CDATA[
+        #set files=[]
+        #set labels=[]
+        #for $counter, $bigwig in enumerate($bigwigfiles):
+            ln -s "${bigwig}" "${counter}.bw" &&
+            #silent $files.append('%s.bw' % $counter)
+            #silent $labels.append('%s' % ($bigwig.display_name))
+        #end for
+]]>
+    </token>
+
+    <xml name="reference_genome_source">
+        <conditional name="source">
+            <param name="ref_source" type="select" label="Reference genome">
+                <option value="cached">locally cached</option>
+                <option value="history">in your history</option>
+            </param>
+            <when value="cached">
+                <param name="input1_2bit" type="select" label="Using reference genome" help="If your genome of interest is not listed, contact the Galaxy team">
+                    <options from_data_table="lastz_seqs">
+                        <filter type="sort_by" column="1" />
+                        <validator type="no_options" message="No indexes are available." />
+                    </options>
+                </param>
+            </when>
+            <when value="history">
+                <param name="input1" type="data" format="twobit" label="Select a reference dataset in 2bit format" />
+            </when>
+        </conditional>
+    </xml>
+
+    <token name="@reference_genome_source@">
+    #if $source.ref_source=="history":
+        --genome $source.input1
+    #else:
+        --genome "$source.input1_2bit.fields.path"
+    #end if
+    </token>
+
+    <xml name="effectiveGenomeSize">
+        <conditional name="effectiveGenomeSize">
+            <param name="effectiveGenomeSize_opt" type="select" label="Effective genome size"
+                help="The effective genome size is the portion of the genome that is mappable. Large fractions of the genome are stretches of NNNN that should be discarded.
+                    Also, if repetitive regions were not included in the mapping of reads, the effective genome size needs to be adjusted accordingly.
+                    See Table 2 of http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0030377 or http://www.nature.com/nbt/journal/v27/n1/fig_tab/nbt.1518_T1.html for several effective genome sizes.">
+                <option value="93260000">ce10 (93260000)</option>
+                <option value="121400000">dm3 (121400000)</option>
+                <option value="2451960000" selected="true">hg19 (2451960000)</option>
+                <option value="2150570000">mm9 (2150570000)</option>
+                <option value="specific">user specified</option>
+            </param>
+            <when value="specific">
+                <param argument="--effectiveGenomeSize" type="integer" value="" label="Effective genome size" help="e.g. ce10: 93260000, dm3: 121400000, hg19: 2451960000, mm9: 2150570000"/>
+            </when>
+            <when value="2150570000" />
+            <when value="2451960000" />
+            <when value="121400000" />
+            <when value="93260000" />
+        </conditional>
+    </xml>
+
+    <xml name="skipNAs">
+        <param argument="--skipNAs" type="boolean" truevalue="--skipNAs" falsevalue="" checked="False"
+            label="Ignore missing data?"
+            help="This parameter determines if non-covered regions
+                 (regions without overlapping reads) in a bam/bigWig file
+                 should be skipped. The default is to treat those
+                 regions as having a value of zero. The decision to
+                 skip non-covered regions depends on the interpretation
+                 of the data. Non-covered regions may represent, for
+                 example, repetitive regions that should be ignored.
+                 (default: False)" />
+    </xml>
+
+    <xml name="input_save_matrix_values">
+        <param argument="--saveMatrix" type="boolean" label="Save the matrix of values underlying the heatmap"/>
+    </xml>
+
+    <xml name="input_graphic_output_settings">
+        <conditional name="output" >
+            <param name="showOutputSettings" type="select" label="Show advanced output settings" >
+                <option value="no" selected="true">no</option>
+                <option value="yes">yes</option>
+            </param>
+            <when value="no" />
+            <when value="yes">
+                <yield />
+                <param name="saveSortedRegions" type="boolean" label="Save the regions after skipping zeros or min/max threshold values" help="The order of the regions in the file follows the sorting order selected. This is useful, for example, to generate other heatmaps keeping the sorting of the first heatmap."/>
+            </when>
+        </conditional>
+    </xml>
+
+
+    <xml name="input_image_file_format">
+        <param argument="--outFileFormat" type="select" label="Image file format">
+            <option value="png" selected="true">png</option>
+            <option value="pdf">pdf</option>
+            <option value="svg">svg</option>
+            <option value="eps">eps</option>
+        </param>
+    </xml>
+
+    <xml name="output_image_file_format">
+        <data format="png" name="outFileName" label="${tool.name} image">
+            <change_format>
+                <when input="output.outFileFormat" value="pdf" format="pdf" />
+                <when input="output.outFileFormat" value="svg" format="svg" />
+                <when input="output.outFileFormat" value="eps" format="eps" />
+            </change_format>
+        </data>
+    </xml>
+
+    <xml name="output_image_file_format_not_nested">
+        <data format="png" name="outFileName" label="${tool.name} image">
+            <change_format>
+                <when input="outFileFormat" value="pdf" format="pdf" />
+                <when input="outFileFormat" value="svg" format="svg" />
+                <when input="outFileFormat" value="eps" format="eps" />
+            </change_format>
+        </data>
+    </xml>
+
+    <xml name="output_save_matrix_values">
+        <data format="tabular" name="outFileNameMatrix" label="${tool.name} on ${on_string}: Heatmap values">
+            <filter>
+            ((
+                output['showOutputSettings'] == 'yes' and
+                output['saveMatrix'] is True
+            ))
+            </filter>
+        </data>
+    </xml>
+
+    <xml name="output_graphic_outputs">
+        <data format="bed" name="outFileSortedRegions" label="${tool.name} on ${on_string}: sorted/filtered regions">
+            <filter>
+            ((
+                output['showOutputSettings'] == 'yes' and
+                output['saveSortedRegions'] is True
+            ))
+            </filter>
+        </data>
+    </xml>
+
+    <xml name="colorMap">
+        <param name="colorMap" type="select" label="Color map to use for the heatmap" help=" Available color map names can be found here: http://www.astro.lsa.umich.edu/~msshin/science/code/matplotlib_cm/">
+            <option value="RdYlBu" selected="true">RdYlBu</option>
+            <option value="Accent">Accent</option>
+            <option value="Spectral">Spectral</option>
+            <option value="Set1">Set1</option>
+            <option value="Set2">Set2</option>
+            <option value="Set3">Set3</option>
+            <option value="Dark2">Dark2</option>
+            <option value="Reds">Reds</option>
+            <option value="Oranges">Oranges</option>
+            <option value="Greens">Greens</option>
+            <option value="Blues">Blues</option>
+            <option value="Greys">Greys</option>
+            <option value="Purples">Purples</option>
+            <option value="Paired">Paired</option>
+            <option value="Pastel1">Pastel1</option>
+            <option value="Pastel2">Pastel2</option>
+            <option value="spring">spring</option>
+            <option value="summer">summer</option>
+            <option value="autumn">autumn</option>
+            <option value="winter">winter</option>
+            <option value="hot">hot</option>
+            <option value="coolwarm">coolwarm</option>
+            <option value="cool">cool</option>
+            <option value="seismic">seismic</option>
+            <option value="terrain">terrain</option>
+            <option value="ocean">ocean</option>
+            <option value="rainbow">rainbow</option>
+            <option value="bone">bone</option>
+            <option value="flag">flag</option>
+            <option value="prism">prism</option>
+            <option value="cubehelix">cubehelix</option>
+            <option value="binary">binary</option>
+            <option value="pink">pink</option>
+            <option value="gray">gray</option>
+            <option value="copper">copper</option>
+            <option value="BrBG">BrBG</option>
+            <option value="BuGn">BuGn</option>
+            <option value="BuPu">BuPu</option>
+            <option value="GnBu">GnBu</option>
+            <option value="OrRd">OrRd</option>
+            <option value="PiYG">PiYG</option>
+            <option value="PRGn">PRGn</option>
+            <option value="PuOr">PuOr</option>
+            <option value="PuRd">PuRd</option>
+            <option value="PuBu">PuBu</option>
+            <option value="RdBu">RdBu</option>
+            <option value="RdGy">RdGy</option>
+            <option value="RdPu">RdPu</option>
+            <option value="YlGn">YlGn</option>
+            <option value="PuBuGn">PuBuGn</option>
+            <option value="RdYlGn">RdYlGn</option>
+            <option value="YlGnBu">YlGnBu</option>
+            <option value="YlOrBr">YlOrBr</option>
+            <option value="YlOrRd">YlOrRd</option>
+            <option value="gist_gray">gist_gray</option>
+            <option value="gist_stern">gist_stern</option>
+            <option value="gist_earth">gist_earth</option>
+            <option value="gist_yarg">gist_yarg</option>
+            <option value="gist_ncar">gist_ncar</option>
+            <option value="gist_rainbow">gist_rainbow</option>
+            <option value="gist_heat">gist_heat</option>
+            <option value="gnuplot">gnuplot</option>
+            <option value="gnuplot2">gnuplot2</option>
+            <option value="CMRmap">CMRmap</option>
+            <option value="bwr">bwr</option>
+            <option value="hsv">hsv</option>
+            <option value="brg">brg</option>
+            <option value="jet">jet</option>
+            <option value="afmhot">afmhot</option>
+            <option value="Accent_r">Accent reversed</option>
+            <option value="Spectral_r">Spectral reversed</option>
+            <option value="Set1_r">Set1 reversed</option>
+            <option value="Set2_r">Set2 reversed</option>
+            <option value="Set3_r">Set3 reversed</option>
+            <option value="Dark2_r">Dark2 reversed</option>
+            <option value="Reds_r">Reds reversed</option>
+            <option value="Oranges_r">Oranges reversed</option>
+            <option value="Greens_r">Greens reversed</option>
+            <option value="Blues_r">Blues reversed</option>
+            <option value="Greys_r">Greys reversed</option>
+            <option value="Purples_r">Purples reversed</option>
+            <option value="Paired_r">Paired reversed</option>
+            <option value="Pastel1_r">Pastel1 reversed</option>
+            <option value="Pastel2_r">Pastel2 reversed</option>
+            <option value="spring_r">spring reversed</option>
+            <option value="summer_r">summer reversed</option>
+            <option value="autumn_r">autumn reversed</option>
+            <option value="winter_r">winter reversed</option>
+            <option value="hot_r">hot reversed</option>
+            <option value="coolwarm_r">coolwarm reversed</option>
+            <option value="cool_r">cool reversed</option>
+            <option value="seismic_r">seismic reversed</option>
+            <option value="terrain_r">terrain reversed</option>
+            <option value="ocean_r">ocean reversed</option>
+            <option value="rainbow_r">rainbow reversed</option>
+            <option value="bone_r">bone reversed</option>
+            <option value="flag_r">flag reversed</option>
+            <option value="prism_r">prism reversed</option>
+            <option value="cubehelix_r">cubehelix reversed</option>
+            <option value="binary_r">binary reversed</option>
+            <option value="pink_r">pink reversed</option>
+            <option value="gray_r">gray reversed</option>
+            <option value="copper_r">copper reversed</option>
+            <option value="BrBG_r">BrBG reversed</option>
+            <option value="BuGn_r">BuGn reversed</option>
+            <option value="BuPu_r">BuPu reversed</option>
+            <option value="GnBu_r">GnBu reversed</option>
+            <option value="OrRd_r">OrRd reversed</option>
+            <option value="PiYG_r">PiYG reversed</option>
+            <option value="PRGn_r">PRGn reversed</option>
+            <option value="PuOr_r">PuOr reversed</option>
+            <option value="PuRd_r">PuRd reversed</option>
+            <option value="PuBu_r">PuBu reversed</option>
+            <option value="RdBu_r">RdBu reversed</option>
+            <option value="RdGy_r">RdGy reversed</option>
+            <option value="RdPu_r">RdPu reversed</option>
+            <option value="YlGn_r">YlGn reversed</option>
+            <option value="PuBuGn_r">PuBuGn reversed</option>
+            <option value="RdYlBu_r">RdYlBu reversed</option>
+            <option value="RdYlGn_r">RdYlGn reversed</option>
+            <option value="YlGnBu_r">YlGnBu reversed</option>
+            <option value="YlOrBr_r">YlOrBr reversed</option>
+            <option value="YlOrRd_r">YlOrRd reversed</option>
+            <option value="gist_gray_r">gist_gray reversed</option>
+            <option value="gist_stern_r">gist_stern reversed</option>
+            <option value="gist_earth_r">gist_earth reversed</option>
+            <option value="gist_yarg_r">gist_yarg reversed</option>
+            <option value="gist_ncar_r">gist_ncar reversed</option>
+            <option value="gist_rainbow_r">gist_rainbow reversed</option>
+            <option value="gist_heat_r">gist_heat reversed</option>
+            <option value="gnuplot_r">gnuplot reversed</option>
+            <option value="gnuplot2_r">gnuplot2 reversed</option>
+            <option value="CMRmap_r">CMRmap reversed</option>
+            <option value="bwr_r">bwr reversed</option>
+            <option value="hsv_r">hsv reversed</option>
+            <option value="brg_r">brg reversed</option>
+            <option value="jet_r">jet reversed</option>
+            <option value="afmhot_r">afmhot reversed</option>
+        </param>
+
+    </xml>
+
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/readme.rst	Mon Dec 05 08:09:05 2016 -0500
@@ -0,0 +1,74 @@
+========================
+Galaxy deeptools wrapper
+========================
+
+deepTools are user-friendly tools for the normalization and visualization of 
+deep-sequencing data.
+They address the challenge of visualizing the large amounts of data that are now
+routinely generated from sequencing centers in a meaningful way. 
+To do so, deepTools contain useful routines to process the mapped reads data 
+through removal of duplicates and different filtering options to create coverage
+files in standard bedGraph and bigWig file formats. deepTools allow the creation
+of normalized coverage files or the comparison between two files 
+(for example, treatment and control). Finally, using such normalized and 
+standardized files, multiple visualizations can be created to identify 
+enrichments with functional annotations of the genome. 
+For a gallery of images that can be produced and a description 
+of the tools see our poster_.
+
+.. _poster: http://f1000.com/posters/browse/summary/1094053
+
+deeptools is developed under here:
+
+    https://github.com/fidelram/deepTools
+
+For support, questions, or feature requests contact: deeptools@googlegroups.com
+
+
+============
+Installation
+============
+
+Requirements: python-2.7
+
+Galaxy should be able to automatically install all other dependencies, such as numpy or scipy.
+
+For the best performance we recommend to install blas/lapack/atlas in your environment before
+installing deepTools from the Tool Shed.
+
+
+========
+Citation
+========
+
+deeptools are currently under review. In the meantime please refere to https://github.com/fidelram/deepTools.
+
+
+=======
+History
+=======
+
+ * v1.0:        Initial public release
+ * v1.5.8.2:    Include new citation tag, update version to 1.5.8.2 and change wrapper version
+
+
+Licence (MIT)
+=============
+
+Permission is hereby granted, free of charge, to any person obtaining a copy
+of this software and associated documentation files (the "Software"), to deal
+in the Software without restriction, including without limitation the rights
+to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
+copies of the Software, and to permit persons to whom the Software is
+furnished to do so, subject to the following conditions:
+
+The above copyright notice and this permission notice shall be included in
+all copies or substantial portions of the Software.
+
+THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
+THE SOFTWARE.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/repository_dependencies.xml	Mon Dec 05 08:09:05 2016 -0500
@@ -0,0 +1,4 @@
+<?xml version="1.0"?>
+<repositories>
+    <repository changeset_revision="74b09c8e5f6e" name="data_manager_twobit_builder" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" />
+</repositories>
Binary file static/images/GC_bias_simulated_reads_2L.png has changed
Binary file static/images/QC_GCplots_input.png has changed
Binary file static/images/QC_fingerprint.png has changed
Binary file static/images/QC_multiBamSummary_humanSamples.png has changed
Binary file static/images/QC_plotCoverage.png has changed
Binary file static/images/bamCompare_output.png has changed
Binary file static/images/bamCoverage_output.png has changed
Binary file static/images/bamFP_galaxy_output.png has changed
Binary file static/images/bamPEFragmentSize_output.png has changed
Binary file static/images/bigwigCompare_output.png has changed
Binary file static/images/computeGCBias_output.png has changed
Binary file static/images/computeMatrix_advancedOutput.png has changed
Binary file static/images/computeMatrix_output.png has changed
Binary file static/images/computeMatrix_overview.png has changed
Binary file static/images/computeMatrix_selectRegions.png has changed
Binary file static/images/computeMatrix_selectScores.png has changed
Binary file static/images/multiBamSummary_output.png has changed
Binary file static/images/multiBigwigSummary_output.png has changed
Binary file static/images/norm_IGVsnapshot_indFiles.png has changed
Binary file static/images/plotCorrelate_RNAseq.png has changed
Binary file static/images/plotCorrelation_galaxy_bw_heatmap_output.png has changed
Binary file static/images/plotCorrelation_output.png has changed
Binary file static/images/plotCorrelation_scatterplot_PearsonCorr_bigwigScores.png has changed
Binary file static/images/plotCoverage_annotated.png has changed
Binary file static/images/plotCoverage_output.png has changed
Binary file static/images/plotEnrichment_output.png has changed
Binary file static/images/plotFingerprint_output.png has changed
Binary file static/images/plotHeatmap_example.png has changed
Binary file static/images/plotHeatmap_example02.png has changed
Binary file static/images/plotPCA_annotated.png has changed
Binary file static/images/plotProfiler_examples.png has changed
Binary file static/images/visual_hm_DmelPolII.png has changed
Binary file static/images/visual_profiler_DmelPolII.png has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamCompare_result1.bg	Mon Dec 05 08:09:05 2016 -0500
@@ -0,0 +1,1 @@
+chrM	0	16569	1
Binary file test-data/bamCompare_result2.bw has changed
Binary file test-data/bamCoverage_result1.bw has changed
Binary file test-data/bamCoverage_result2.bw has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamCoverage_result3.bg	Mon Dec 05 08:09:05 2016 -0500
@@ -0,0 +1,7 @@
+chrM	0	210	9.76876e+06
+chrM	210	220	9.56092e+06
+chrM	220	230	7.6903e+06
+chrM	230	240	5.19615e+06
+chrM	240	250	3.32554e+06
+chrM	250	260	623538
+chrM	260	16569	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamCoverage_result4.bg	Mon Dec 05 08:09:05 2016 -0500
@@ -0,0 +1,472 @@
+phiX174	0	10	16302.8
+phiX174	10	20	48908.5
+phiX174	20	70	146725
+phiX174	70	80	195634
+phiX174	80	90	179331
+phiX174	90	100	163028
+phiX174	100	120	114120
+phiX174	120	140	146725
+phiX174	140	150	163028
+phiX174	150	160	130423
+phiX174	160	170	163028
+phiX174	170	180	179331
+phiX174	180	200	211937
+phiX174	200	210	195634
+phiX174	210	220	244542
+phiX174	220	230	277148
+phiX174	230	240	342359
+phiX174	240	250	326057
+phiX174	250	260	293451
+phiX174	260	270	342359
+phiX174	270	280	407571
+phiX174	280	300	423874
+phiX174	300	310	358662
+phiX174	310	320	326057
+phiX174	320	330	374965
+phiX174	330	340	358662
+phiX174	340	350	293451
+phiX174	350	360	260845
+phiX174	360	370	228240
+phiX174	370	380	244542
+phiX174	380	390	309754
+phiX174	390	400	260845
+phiX174	400	410	244542
+phiX174	410	420	228240
+phiX174	420	450	293451
+phiX174	450	460	309754
+phiX174	460	470	342359
+phiX174	470	490	423874
+phiX174	490	510	505388
+phiX174	510	520	472782
+phiX174	520	530	570599
+phiX174	530	540	505388
+phiX174	540	550	537993
+phiX174	550	560	554296
+phiX174	560	570	652113
+phiX174	570	580	635810
+phiX174	580	590	570599
+phiX174	590	600	619508
+phiX174	600	610	554296
+phiX174	610	630	635810
+phiX174	630	640	586902
+phiX174	640	650	521691
+phiX174	650	660	554296
+phiX174	660	670	570599
+phiX174	670	680	603205
+phiX174	680	690	668416
+phiX174	690	700	652113
+phiX174	700	710	570599
+phiX174	710	730	603205
+phiX174	730	740	521691
+phiX174	740	760	603205
+phiX174	760	770	505388
+phiX174	770	780	521691
+phiX174	780	790	537993
+phiX174	790	800	554296
+phiX174	800	810	456479
+phiX174	810	820	440176
+phiX174	820	830	374965
+phiX174	830	840	326057
+phiX174	840	850	358662
+phiX174	850	860	309754
+phiX174	860	870	342359
+phiX174	870	880	260845
+phiX174	880	890	358662
+phiX174	890	900	391268
+phiX174	900	910	472782
+phiX174	910	920	554296
+phiX174	920	930	570599
+phiX174	930	940	554296
+phiX174	940	950	586902
+phiX174	950	960	603205
+phiX174	960	970	521691
+phiX174	970	980	489085
+phiX174	980	990	440176
+phiX174	990	1000	423874
+phiX174	1000	1010	456479
+phiX174	1010	1030	586902
+phiX174	1030	1040	766233
+phiX174	1040	1050	798839
+phiX174	1050	1060	831444
+phiX174	1060	1070	880353
+phiX174	1070	1080	847747
+phiX174	1080	1090	880353
+phiX174	1090	1100	782536
+phiX174	1100	1110	749930
+phiX174	1110	1120	668416
+phiX174	1120	1130	652113
+phiX174	1130	1140	635810
+phiX174	1140	1150	684719
+phiX174	1150	1160	635810
+phiX174	1160	1170	603205
+phiX174	1170	1180	619508
+phiX174	1180	1190	586902
+phiX174	1190	1200	521691
+phiX174	1200	1210	489085
+phiX174	1210	1220	570599
+phiX174	1220	1230	489085
+phiX174	1230	1240	456479
+phiX174	1240	1250	358662
+phiX174	1250	1260	342359
+phiX174	1260	1270	407571
+phiX174	1270	1280	358662
+phiX174	1280	1290	374965
+phiX174	1290	1300	326057
+phiX174	1300	1310	391268
+phiX174	1310	1320	521691
+phiX174	1320	1330	505388
+phiX174	1330	1340	521691
+phiX174	1340	1350	489085
+phiX174	1350	1370	505388
+phiX174	1370	1390	472782
+phiX174	1390	1400	358662
+phiX174	1400	1410	456479
+phiX174	1410	1430	489085
+phiX174	1430	1450	554296
+phiX174	1450	1460	570599
+phiX174	1460	1470	586902
+phiX174	1470	1480	619508
+phiX174	1480	1490	603205
+phiX174	1490	1500	554296
+phiX174	1500	1510	668416
+phiX174	1510	1520	635810
+phiX174	1520	1540	798839
+phiX174	1540	1550	733627
+phiX174	1550	1570	766233
+phiX174	1570	1580	782536
+phiX174	1580	1590	684719
+phiX174	1590	1600	635810
+phiX174	1600	1610	570599
+phiX174	1610	1620	537993
+phiX174	1620	1630	505388
+phiX174	1630	1640	472782
+phiX174	1640	1650	489085
+phiX174	1650	1660	505388
+phiX174	1660	1670	537993
+phiX174	1670	1680	603205
+phiX174	1680	1690	521691
+phiX174	1690	1700	537993
+phiX174	1700	1710	603205
+phiX174	1710	1720	554296
+phiX174	1720	1730	537993
+phiX174	1730	1740	586902
+phiX174	1740	1750	537993
+phiX174	1750	1760	440176
+phiX174	1760	1770	423874
+phiX174	1770	1780	374965
+phiX174	1780	1790	358662
+phiX174	1790	1810	342359
+phiX174	1810	1820	326057
+phiX174	1820	1830	472782
+phiX174	1830	1860	717325
+phiX174	1860	1870	815142
+phiX174	1870	1880	749930
+phiX174	1880	1890	684719
+phiX174	1890	1900	717325
+phiX174	1900	1910	619508
+phiX174	1910	1920	407571
+phiX174	1920	1930	472782
+phiX174	1930	1940	554296
+phiX174	1940	1950	456479
+phiX174	1950	1960	489085
+phiX174	1960	1970	537993
+phiX174	1970	1980	684719
+phiX174	1980	1990	652113
+phiX174	1990	2000	668416
+phiX174	2000	2010	684719
+phiX174	2010	2020	652113
+phiX174	2020	2030	668416
+phiX174	2030	2050	684719
+phiX174	2050	2060	489085
+phiX174	2060	2070	521691
+phiX174	2070	2080	489085
+phiX174	2080	2100	521691
+phiX174	2100	2110	537993
+phiX174	2110	2120	521691
+phiX174	2120	2130	537993
+phiX174	2130	2140	554296
+phiX174	2140	2150	521691
+phiX174	2150	2160	554296
+phiX174	2160	2170	423874
+phiX174	2170	2180	358662
+phiX174	2180	2190	440176
+phiX174	2190	2200	456479
+phiX174	2200	2210	440176
+phiX174	2210	2220	489085
+phiX174	2220	2230	554296
+phiX174	2230	2240	603205
+phiX174	2240	2250	635810
+phiX174	2250	2260	733627
+phiX174	2260	2270	635810
+phiX174	2270	2290	603205
+phiX174	2290	2300	619508
+phiX174	2300	2310	749930
+phiX174	2310	2320	782536
+phiX174	2320	2330	880353
+phiX174	2330	2340	864050
+phiX174	2340	2350	912959
+phiX174	2350	2360	815142
+phiX174	2360	2370	929261
+phiX174	2370	2380	815142
+phiX174	2380	2390	652113
+phiX174	2390	2400	603205
+phiX174	2400	2410	423874
+phiX174	2410	2420	407571
+phiX174	2420	2430	358662
+phiX174	2430	2440	489085
+phiX174	2440	2450	456479
+phiX174	2450	2460	619508
+phiX174	2460	2470	684719
+phiX174	2470	2480	749930
+phiX174	2480	2490	766233
+phiX174	2490	2500	782536
+phiX174	2500	2510	798839
+phiX174	2510	2520	652113
+phiX174	2520	2530	668416
+phiX174	2530	2540	537993
+phiX174	2540	2550	472782
+phiX174	2550	2560	391268
+phiX174	2560	2570	440176
+phiX174	2570	2590	472782
+phiX174	2590	2600	456479
+phiX174	2600	2620	537993
+phiX174	2620	2630	554296
+phiX174	2630	2640	701022
+phiX174	2640	2650	635810
+phiX174	2650	2660	570599
+phiX174	2660	2670	554296
+phiX174	2670	2680	619508
+phiX174	2680	2700	668416
+phiX174	2700	2710	635810
+phiX174	2710	2720	603205
+phiX174	2720	2740	668416
+phiX174	2740	2750	831444
+phiX174	2750	2760	880353
+phiX174	2760	2770	864050
+phiX174	2770	2780	896656
+phiX174	2780	2790	978170
+phiX174	2790	2800	831444
+phiX174	2800	2810	847747
+phiX174	2810	2820	815142
+phiX174	2820	2830	684719
+phiX174	2830	2840	717325
+phiX174	2840	2860	635810
+phiX174	2860	2870	619508
+phiX174	2870	2880	717325
+phiX174	2880	2890	668416
+phiX174	2890	2900	619508
+phiX174	2900	2910	668416
+phiX174	2910	2930	570599
+phiX174	2930	2940	521691
+phiX174	2940	2950	570599
+phiX174	2950	2960	505388
+phiX174	2960	2970	586902
+phiX174	2970	2980	603205
+phiX174	2980	2990	521691
+phiX174	2990	3000	537993
+phiX174	3000	3010	570599
+phiX174	3010	3020	521691
+phiX174	3020	3030	472782
+phiX174	3030	3040	440176
+phiX174	3040	3050	423874
+phiX174	3050	3060	554296
+phiX174	3060	3070	570599
+phiX174	3070	3080	635810
+phiX174	3080	3100	586902
+phiX174	3100	3110	733627
+phiX174	3110	3120	684719
+phiX174	3120	3130	652113
+phiX174	3130	3140	619508
+phiX174	3140	3160	684719
+phiX174	3160	3180	782536
+phiX174	3180	3190	717325
+phiX174	3190	3200	668416
+phiX174	3200	3210	684719
+phiX174	3210	3220	749930
+phiX174	3220	3230	668416
+phiX174	3230	3240	717325
+phiX174	3240	3250	635810
+phiX174	3250	3260	554296
+phiX174	3260	3270	603205
+phiX174	3270	3280	635810
+phiX174	3280	3290	586902
+phiX174	3290	3300	537993
+phiX174	3300	3310	521691
+phiX174	3310	3320	537993
+phiX174	3320	3330	619508
+phiX174	3330	3340	668416
+phiX174	3340	3370	652113
+phiX174	3370	3390	668416
+phiX174	3390	3400	586902
+phiX174	3400	3430	489085
+phiX174	3430	3440	521691
+phiX174	3440	3450	619508
+phiX174	3450	3460	586902
+phiX174	3460	3480	684719
+phiX174	3480	3490	733627
+phiX174	3490	3500	847747
+phiX174	3500	3510	815142
+phiX174	3510	3520	912959
+phiX174	3520	3530	782536
+phiX174	3530	3540	766233
+phiX174	3540	3550	798839
+phiX174	3550	3560	766233
+phiX174	3560	3570	701022
+phiX174	3570	3580	505388
+phiX174	3580	3590	472782
+phiX174	3590	3610	440176
+phiX174	3610	3620	423874
+phiX174	3620	3630	407571
+phiX174	3630	3640	391268
+phiX174	3640	3650	358662
+phiX174	3650	3660	440176
+phiX174	3660	3680	407571
+phiX174	3680	3690	423874
+phiX174	3690	3700	342359
+phiX174	3700	3710	391268
+phiX174	3710	3720	440176
+phiX174	3720	3730	635810
+phiX174	3730	3740	603205
+phiX174	3740	3750	717325
+phiX174	3750	3760	684719
+phiX174	3760	3780	668416
+phiX174	3780	3790	635810
+phiX174	3790	3800	505388
+phiX174	3800	3810	423874
+phiX174	3810	3820	456479
+phiX174	3820	3830	440176
+phiX174	3830	3840	554296
+phiX174	3840	3850	635810
+phiX174	3850	3860	782536
+phiX174	3860	3870	815142
+phiX174	3870	3880	782536
+phiX174	3880	3890	733627
+phiX174	3890	3900	684719
+phiX174	3900	3910	652113
+phiX174	3910	3920	603205
+phiX174	3920	3930	456479
+phiX174	3930	3950	407571
+phiX174	3950	3960	440176
+phiX174	3960	3970	537993
+phiX174	3970	3980	603205
+phiX174	3980	3990	570599
+phiX174	3990	4000	652113
+phiX174	4000	4010	635810
+phiX174	4010	4020	619508
+phiX174	4020	4030	652113
+phiX174	4030	4040	668416
+phiX174	4040	4050	554296
+phiX174	4050	4060	489085
+phiX174	4060	4070	456479
+phiX174	4070	4080	407571
+phiX174	4080	4090	440176
+phiX174	4090	4100	537993
+phiX174	4100	4110	407571
+phiX174	4110	4120	374965
+phiX174	4120	4130	309754
+phiX174	4130	4150	374965
+phiX174	4150	4160	342359
+phiX174	4160	4170	391268
+phiX174	4170	4180	277148
+phiX174	4180	4190	342359
+phiX174	4190	4200	358662
+phiX174	4200	4210	374965
+phiX174	4210	4230	326057
+phiX174	4230	4250	342359
+phiX174	4250	4260	391268
+phiX174	4260	4280	489085
+phiX174	4280	4290	456479
+phiX174	4290	4300	472782
+phiX174	4300	4310	537993
+phiX174	4310	4320	619508
+phiX174	4320	4330	586902
+phiX174	4330	4340	472782
+phiX174	4340	4350	423874
+phiX174	4350	4360	440176
+phiX174	4360	4380	521691
+phiX174	4380	4390	489085
+phiX174	4390	4400	456479
+phiX174	4400	4410	537993
+phiX174	4410	4420	668416
+phiX174	4420	4430	717325
+phiX174	4430	4440	798839
+phiX174	4440	4450	831444
+phiX174	4450	4460	815142
+phiX174	4460	4470	782536
+phiX174	4470	4480	798839
+phiX174	4480	4490	701022
+phiX174	4490	4500	635810
+phiX174	4500	4510	619508
+phiX174	4510	4520	472782
+phiX174	4520	4540	440176
+phiX174	4540	4550	505388
+phiX174	4550	4560	489085
+phiX174	4560	4570	440176
+phiX174	4570	4580	472782
+phiX174	4580	4590	423874
+phiX174	4590	4600	440176
+phiX174	4600	4610	537993
+phiX174	4610	4620	521691
+phiX174	4620	4630	586902
+phiX174	4630	4640	619508
+phiX174	4640	4660	701022
+phiX174	4660	4670	733627
+phiX174	4670	4680	684719
+phiX174	4680	4690	619508
+phiX174	4690	4700	701022
+phiX174	4700	4720	489085
+phiX174	4720	4730	407571
+phiX174	4730	4740	472782
+phiX174	4740	4760	570599
+phiX174	4760	4780	603205
+phiX174	4780	4790	619508
+phiX174	4790	4800	701022
+phiX174	4800	4810	684719
+phiX174	4810	4820	668416
+phiX174	4820	4830	603205
+phiX174	4830	4850	635810
+phiX174	4850	4860	586902
+phiX174	4860	4870	521691
+phiX174	4870	4880	505388
+phiX174	4880	4890	603205
+phiX174	4890	4900	521691
+phiX174	4900	4910	489085
+phiX174	4910	4920	423874
+phiX174	4920	4930	391268
+phiX174	4930	4950	358662
+phiX174	4950	4960	277148
+phiX174	4960	4970	179331
+phiX174	4970	4980	244542
+phiX174	4980	4990	211937
+phiX174	4990	5020	293451
+phiX174	5020	5030	358662
+phiX174	5030	5040	342359
+phiX174	5040	5050	374965
+phiX174	5050	5060	309754
+phiX174	5060	5070	293451
+phiX174	5070	5080	244542
+phiX174	5080	5090	309754
+phiX174	5090	5100	277148
+phiX174	5100	5110	228240
+phiX174	5110	5120	260845
+phiX174	5120	5130	326057
+phiX174	5130	5140	423874
+phiX174	5140	5160	505388
+phiX174	5160	5170	489085
+phiX174	5170	5180	586902
+phiX174	5180	5190	570599
+phiX174	5190	5200	537993
+phiX174	5200	5210	472782
+phiX174	5210	5220	456479
+phiX174	5220	5230	407571
+phiX174	5230	5240	456479
+phiX174	5240	5250	374965
+phiX174	5250	5260	277148
+phiX174	5260	5270	309754
+phiX174	5270	5280	342359
+phiX174	5280	5290	277148
+phiX174	5290	5300	195634
+phiX174	5300	5310	146725
+phiX174	5310	5340	97817
+phiX174	5340	5350	65211.3
+phiX174	5350	5386	32605.7
Binary file test-data/bamCoverage_result4.bw has changed
Binary file test-data/bamCoverage_result5.bw has changed
Binary file test-data/bamCoverage_result6.bw has changed
Binary file test-data/bamPEFragmentSize_histogram_result1.png has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bamPEFragmentSize_result1.txt	Mon Dec 05 08:09:05 2016 -0500
@@ -0,0 +1,22 @@
+
+
+BAM file : 0.bam
+Sample size: 3
+
+Fragment lengths:
+Min.: 241.0
+1st Qu.: 241.5
+Mean: 244.666666667
+Median: 242.0
+3rd Qu.: 246.5
+Max.: 251.0
+Std: 4.49691252108
+
+Read lengths:
+Min.: 251.0
+1st Qu.: 251.0
+Mean: 251.0
+Median: 251.0
+3rd Qu.: 251.0
+Max.: 251.0
+Std: 0.0
Binary file test-data/bigwigCompare_result1.bw has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bigwigCompare_result2.bg	Mon Dec 05 08:09:05 2016 -0500
@@ -0,0 +1,3 @@
+ch1	0	400	1
+ch2	0	400	1
+ch3	0	400	1
Binary file test-data/bowtie2 test1.bam has changed
Binary file test-data/computeGCBias_result1.png has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/computeGCBias_result1.tabular	Mon Dec 05 08:09:05 2016 -0500
@@ -0,0 +1,301 @@
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+5.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+01
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
+0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/computeMatrix1.bed	Mon Dec 05 08:09:05 2016 -0500
@@ -0,0 +1,8 @@
+phiX174	1000	1500	CG11023	0	+
+phiX174	150	1750	cda5	0	-
+phiX174	150	177	cda8	0	-
+phiX174	75	1500	cda9	0	+
+phiX174	101	175	C11023	0	+
+phiX174	125	150	ca5	0	-
+phiX174	450	1750	ca8	0	+
+phiX174	80	1500	cda9	0	+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/computeMatrix2.bed	Mon Dec 05 08:09:05 2016 -0500
@@ -0,0 +1,6 @@
+ch1	100	150	CG11023	0	+
+ch2	150	175	cda5	0	-
+ch3	100	125	cda8	0	+
+ch1	75	125	C11023	0	+
+ch2	125	150	ca5	0	-
+ch3	75	100	ca8	0	+
Binary file test-data/computeMatrix2.bw has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/computeMatrixOperations.txt	Mon Dec 05 08:09:05 2016 -0500
@@ -0,0 +1,4 @@
+Groups:
+	genes
+Samples:
+	file_0
Binary file test-data/computeMatrixOperations_result2.mat.gz has changed
Binary file test-data/computeMatrix_result1.gz has changed
Binary file test-data/computeMatrix_result2.gz has changed
Binary file test-data/computeMatrix_result3.gz has changed
Binary file test-data/correctGCBias_result1.bam has changed
Binary file test-data/heatmapper_result1.png has changed
Binary file test-data/heatmapper_result2.png has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/heatmapper_result2.tabular	Mon Dec 05 08:09:05 2016 -0500
@@ -0,0 +1,3 @@
+bin labels		-0.0Kb	0.0Kb
+bins		1	2
+file_0	genes	2477942.34473	2610259.65234
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/multiBamSummary_regions.bed	Mon Dec 05 08:09:05 2016 -0500
@@ -0,0 +1,3 @@
+chrM	1	10
+chrM	5	15
+chrM	10	20
Binary file test-data/multiBamSummary_result1.npz has changed
Binary file test-data/multiBamSummary_result2.npz has changed
Binary file test-data/multiBigwigSummary_result1.npz has changed
Binary file test-data/multiBigwigSummary_result1.png has changed
Binary file test-data/paired_chr2L.bam has changed
Binary file test-data/phiX.2bit has changed
Binary file test-data/phiX.bam has changed
Binary file test-data/phiX.bam.bai has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/phiX.fasta	Mon Dec 05 08:09:05 2016 -0500
@@ -0,0 +1,79 @@
+>phiX174
+GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT
+GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA
+ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG
+TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA
+GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC
+TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT
+TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT
+CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT
+TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG
+TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC
+GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA
+CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG
+TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT
+AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC
+CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA
+TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC
+TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA
+CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA
+GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT
+GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA
+ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC
+TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT
+TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC
+ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC
+CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT
+GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC
+CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC
+TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG
+TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT
+TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA
+AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT
+TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT
+ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC
+GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC
+TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT
+TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA
+TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG
+TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC
+CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG
+AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC
+CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT
+TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG
+CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA
+AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT
+GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG
+GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA
+TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT
+CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG
+TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA
+GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC
+CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA
+TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA
+AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC
+TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT
+CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA
+TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG
+TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT
+CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT
+TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC
+ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG
+TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA
+ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG
+GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC
+CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT
+GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG
+GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT
+ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG
+CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC
+CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC
+GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT
+CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG
+CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA
+TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT
+TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG
+TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC
+AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC
+TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA
+
Binary file test-data/plotCorrelation_result1.png has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/plotCorrelation_result1.tabular	Mon Dec 05 08:09:05 2016 -0500
@@ -0,0 +1,3 @@
+	'bowtie2-test1.bam'	'bowtie2-test1.bam'
+'bowtie2-test1.bam'	1.0000	1.0000
+'bowtie2-test1.bam'	1.0000	1.0000
Binary file test-data/plotCorrelation_result2.png has changed
Binary file test-data/plotCoverage_result1.png has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/plotCoverage_result1.tabular	Mon Dec 05 08:09:05 2016 -0500
@@ -0,0 +1,16570 @@
+#'chr'	'start'	'end'	'bowtie2 test1.bam'	'bowtie2 test1.bam'
+chrM	0	1	23.0	23.0
+chrM	1	2	35.0	35.0
+chrM	2	3	35.0	35.0
+chrM	3	4	35.0	35.0
+chrM	4	5	35.0	35.0
+chrM	5	6	35.0	35.0
+chrM	6	7	35.0	35.0
+chrM	7	8	35.0	35.0
+chrM	8	9	35.0	35.0
+chrM	9	10	35.0	35.0
+chrM	10	11	35.0	35.0
+chrM	11	12	35.0	35.0
+chrM	12	13	35.0	35.0
+chrM	13	14	35.0	35.0
+chrM	14	15	35.0	35.0
+chrM	15	16	35.0	35.0
+chrM	16	17	35.0	35.0
+chrM	17	18	35.0	35.0
+chrM	18	19	35.0	35.0
+chrM	19	20	35.0	35.0
+chrM	20	21	35.0	35.0
+chrM	21	22	35.0	35.0
+chrM	22	23	35.0	35.0
+chrM	23	24	35.0	35.0
+chrM	24	25	35.0	35.0
+chrM	25	26	35.0	35.0
+chrM	26	27	35.0	35.0
+chrM	27	28	35.0	35.0
+chrM	28	29	35.0	35.0
+chrM	29	30	35.0	35.0
+chrM	30	31	35.0	35.0
+chrM	31	32	35.0	35.0
+chrM	32	33	35.0	35.0
+chrM	33	34	35.0	35.0
+chrM	34	35	35.0	35.0
+chrM	35	36	35.0	35.0
+chrM	36	37	35.0	35.0
+chrM	37	38	35.0	35.0
+chrM	38	39	35.0	35.0
+chrM	39	40	35.0	35.0
+chrM	40	41	35.0	35.0
+chrM	41	42	35.0	35.0
+chrM	42	43	35.0	35.0
+chrM	43	44	35.0	35.0
+chrM	44	45	35.0	35.0
+chrM	45	46	35.0	35.0
+chrM	46	47	35.0	35.0
+chrM	47	48	35.0	35.0
+chrM	48	49	35.0	35.0
+chrM	49	50	35.0	35.0
+chrM	50	51	35.0	35.0
+chrM	51	52	35.0	35.0
+chrM	52	53	35.0	35.0
+chrM	53	54	35.0	35.0
+chrM	54	55	35.0	35.0
+chrM	55	56	35.0	35.0
+chrM	56	57	35.0	35.0
+chrM	57	58	35.0	35.0
+chrM	58	59	35.0	35.0
+chrM	59	60	35.0	35.0
+chrM	60	61	35.0	35.0
+chrM	61	62	35.0	35.0
+chrM	62	63	35.0	35.0
+chrM	63	64	35.0	35.0
+chrM	64	65	35.0	35.0
+chrM	65	66	35.0	35.0
+chrM	66	67	35.0	35.0
+chrM	67	68	35.0	35.0
+chrM	68	69	35.0	35.0
+chrM	69	70	35.0	35.0
+chrM	70	71	35.0	35.0
+chrM	71	72	35.0	35.0
+chrM	72	73	35.0	35.0
+chrM	73	74	35.0	35.0
+chrM	74	75	35.0	35.0
+chrM	75	76	35.0	35.0
+chrM	76	77	35.0	35.0
+chrM	77	78	35.0	35.0
+chrM	78	79	35.0	35.0
+chrM	79	80	35.0	35.0
+chrM	80	81	35.0	35.0
+chrM	81	82	35.0	35.0
+chrM	82	83	35.0	35.0
+chrM	83	84	35.0	35.0
+chrM	84	85	35.0	35.0
+chrM	85	86	35.0	35.0
+chrM	86	87	35.0	35.0
+chrM	87	88	35.0	35.0
+chrM	88	89	35.0	35.0
+chrM	89	90	35.0	35.0
+chrM	90	91	35.0	35.0
+chrM	91	92	35.0	35.0
+chrM	92	93	35.0	35.0
+chrM	93	94	35.0	35.0
+chrM	94	95	35.0	35.0
+chrM	95	96	35.0	35.0
+chrM	96	97	35.0	35.0
+chrM	97	98	35.0	35.0
+chrM	98	99	35.0	35.0
+chrM	99	100	35.0	35.0
+chrM	100	101	35.0	35.0
+chrM	101	102	35.0	35.0
+chrM	102	103	35.0	35.0
+chrM	103	104	35.0	35.0
+chrM	104	105	35.0	35.0
+chrM	105	106	35.0	35.0
+chrM	106	107	35.0	35.0
+chrM	107	108	35.0	35.0
+chrM	108	109	35.0	35.0
+chrM	109	110	35.0	35.0
+chrM	110	111	35.0	35.0
+chrM	111	112	35.0	35.0
+chrM	112	113	35.0	35.0
+chrM	113	114	35.0	35.0
+chrM	114	115	35.0	35.0
+chrM	115	116	35.0	35.0
+chrM	116	117	35.0	35.0
+chrM	117	118	35.0	35.0
+chrM	118	119	35.0	35.0
+chrM	119	120	35.0	35.0
+chrM	120	121	35.0	35.0
+chrM	121	122	35.0	35.0
+chrM	122	123	35.0	35.0
+chrM	123	124	35.0	35.0
+chrM	124	125	35.0	35.0
+chrM	125	126	35.0	35.0
+chrM	126	127	35.0	35.0
+chrM	127	128	35.0	35.0
+chrM	128	129	35.0	35.0
+chrM	129	130	35.0	35.0
+chrM	130	131	35.0	35.0
+chrM	131	132	35.0	35.0
+chrM	132	133	35.0	35.0
+chrM	133	134	35.0	35.0
+chrM	134	135	35.0	35.0
+chrM	135	136	35.0	35.0
+chrM	136	137	35.0	35.0
+chrM	137	138	35.0	35.0
+chrM	138	139	35.0	35.0
+chrM	139	140	35.0	35.0
+chrM	140	141	35.0	35.0
+chrM	141	142	35.0	35.0
+chrM	142	143	35.0	35.0
+chrM	143	144	35.0	35.0
+chrM	144	145	35.0	35.0
+chrM	145	146	35.0	35.0
+chrM	146	147	35.0	35.0
+chrM	147	148	35.0	35.0
+chrM	148	149	35.0	35.0
+chrM	149	150	35.0	35.0
+chrM	150	151	35.0	35.0
+chrM	151	152	35.0	35.0
+chrM	152	153	35.0	35.0
+chrM	153	154	35.0	35.0
+chrM	154	155	35.0	35.0
+chrM	155	156	35.0	35.0
+chrM	156	157	35.0	35.0
+chrM	157	158	35.0	35.0
+chrM	158	159	35.0	35.0
+chrM	159	160	35.0	35.0
+chrM	160	161	35.0	35.0
+chrM	161	162	35.0	35.0
+chrM	162	163	35.0	35.0
+chrM	163	164	35.0	35.0
+chrM	164	165	35.0	35.0
+chrM	165	166	35.0	35.0
+chrM	166	167	35.0	35.0
+chrM	167	168	35.0	35.0
+chrM	168	169	35.0	35.0
+chrM	169	170	35.0	35.0
+chrM	170	171	35.0	35.0
+chrM	171	172	35.0	35.0
+chrM	172	173	35.0	35.0
+chrM	173	174	35.0	35.0
+chrM	174	175	35.0	35.0
+chrM	175	176	35.0	35.0
+chrM	176	177	35.0	35.0
+chrM	177	178	35.0	35.0
+chrM	178	179	35.0	35.0
+chrM	179	180	35.0	35.0
+chrM	180	181	35.0	35.0
+chrM	181	182	35.0	35.0
+chrM	182	183	35.0	35.0
+chrM	183	184	35.0	35.0
+chrM	184	185	35.0	35.0
+chrM	185	186	35.0	35.0
+chrM	186	187	35.0	35.0
+chrM	187	188	35.0	35.0
+chrM	188	189	35.0	35.0
+chrM	189	190	35.0	35.0
+chrM	190	191	35.0	35.0
+chrM	191	192	35.0	35.0
+chrM	192	193	35.0	35.0
+chrM	193	194	35.0	35.0
+chrM	194	195	35.0	35.0
+chrM	195	196	35.0	35.0
+chrM	196	197	35.0	35.0
+chrM	197	198	35.0	35.0
+chrM	198	199	35.0	35.0
+chrM	199	200	35.0	35.0
+chrM	200	201	35.0	35.0
+chrM	201	202	35.0	35.0
+chrM	202	203	35.0	35.0
+chrM	203	204	35.0	35.0
+chrM	204	205	35.0	35.0
+chrM	205	206	35.0	35.0
+chrM	206	207	35.0	35.0
+chrM	207	208	35.0	35.0
+chrM	208	209	35.0	35.0
+chrM	209	210	35.0	35.0
+chrM	210	211	35.0	35.0
+chrM	211	212	35.0	35.0
+chrM	212	213	35.0	35.0
+chrM	213	214	35.0	35.0
+chrM	214	215	35.0	35.0
+chrM	215	216	35.0	35.0
+chrM	216	217	33.0	33.0
+chrM	217	218	33.0	33.0
+chrM	218	219	33.0	33.0
+chrM	219	220	33.0	33.0
+chrM	220	221	33.0	33.0
+chrM	221	222	33.0	33.0
+chrM	222	223	33.0	33.0
+chrM	223	224	33.0	33.0
+chrM	224	225	33.0	33.0
+chrM	225	226	33.0	33.0
+chrM	226	227	33.0	33.0
+chrM	227	228	33.0	33.0
+chrM	228	229	27.0	27.0
+chrM	229	230	25.0	25.0
+chrM	230	231	24.0	24.0
+chrM	231	232	21.0	21.0
+chrM	232	233	20.0	20.0
+chrM	233	234	19.0	19.0
+chrM	234	235	19.0	19.0
+chrM	235	236	19.0	19.0
+chrM	236	237	17.0	17.0
+chrM	237	238	17.0	17.0
+chrM	238	239	15.0	15.0
+chrM	239	240	15.0	15.0
+chrM	240	241	15.0	15.0
+chrM	241	242	10.0	10.0
+chrM	242	243	7.0	7.0
+chrM	243	244	7.0	7.0
+chrM	244	245	7.0	7.0
+chrM	245	246	7.0	7.0
+chrM	246	247	6.0	6.0
+chrM	247	248	5.0	5.0
+chrM	248	249	5.0	5.0
+chrM	249	250	5.0	5.0
+chrM	250	251	3.0	3.0
+chrM	251	252	0.0	0.0
+chrM	252	253	0.0	0.0
+chrM	253	254	0.0	0.0
+chrM	254	255	0.0	0.0
+chrM	255	256	0.0	0.0
+chrM	256	257	0.0	0.0
+chrM	257	258	0.0	0.0
+chrM	258	259	0.0	0.0
+chrM	259	260	0.0	0.0
+chrM	260	261	0.0	0.0
+chrM	261	262	0.0	0.0
+chrM	262	263	0.0	0.0
+chrM	263	264	0.0	0.0
+chrM	264	265	0.0	0.0
+chrM	265	266	0.0	0.0
+chrM	266	267	0.0	0.0
+chrM	267	268	0.0	0.0
+chrM	268	269	0.0	0.0
+chrM	269	270	0.0	0.0
+chrM	270	271	0.0	0.0
+chrM	271	272	0.0	0.0
+chrM	272	273	0.0	0.0
+chrM	273	274	0.0	0.0
+chrM	274	275	0.0	0.0
+chrM	275	276	0.0	0.0
+chrM	276	277	0.0	0.0
+chrM	277	278	0.0	0.0
+chrM	278	279	0.0	0.0
+chrM	279	280	0.0	0.0
+chrM	280	281	0.0	0.0
+chrM	281	282	0.0	0.0
+chrM	282	283	0.0	0.0
+chrM	283	284	0.0	0.0
+chrM	284	285	0.0	0.0
+chrM	285	286	0.0	0.0
+chrM	286	287	0.0	0.0
+chrM	287	288	0.0	0.0
+chrM	288	289	0.0	0.0
+chrM	289	290	0.0	0.0
+chrM	290	291	0.0	0.0
+chrM	291	292	0.0	0.0
+chrM	292	293	0.0	0.0
+chrM	293	294	0.0	0.0
+chrM	294	295	0.0	0.0
+chrM	295	296	0.0	0.0
+chrM	296	297	0.0	0.0
+chrM	297	298	0.0	0.0
+chrM	298	299	0.0	0.0
+chrM	299	300	0.0	0.0
+chrM	300	301	0.0	0.0
+chrM	301	302	0.0	0.0
+chrM	302	303	0.0	0.0
+chrM	303	304	0.0	0.0
+chrM	304	305	0.0	0.0
+chrM	305	306	0.0	0.0
+chrM	306	307	0.0	0.0
+chrM	307	308	0.0	0.0
+chrM	308	309	0.0	0.0
+chrM	309	310	0.0	0.0
+chrM	310	311	0.0	0.0
+chrM	311	312	0.0	0.0
+chrM	312	313	0.0	0.0
+chrM	313	314	0.0	0.0
+chrM	314	315	0.0	0.0
+chrM	315	316	0.0	0.0
+chrM	316	317	0.0	0.0
+chrM	317	318	0.0	0.0
+chrM	318	319	0.0	0.0
+chrM	319	320	0.0	0.0
+chrM	320	321	0.0	0.0
+chrM	321	322	0.0	0.0
+chrM	322	323	0.0	0.0
+chrM	323	324	0.0	0.0
+chrM	324	325	0.0	0.0
+chrM	325	326	0.0	0.0
+chrM	326	327	0.0	0.0
+chrM	327	328	0.0	0.0
+chrM	328	329	0.0	0.0
+chrM	329	330	0.0	0.0
+chrM	330	331	0.0	0.0
+chrM	331	332	0.0	0.0
+chrM	332	333	0.0	0.0
+chrM	333	334	0.0	0.0
+chrM	334	335	0.0	0.0
+chrM	335	336	0.0	0.0
+chrM	336	337	0.0	0.0
+chrM	337	338	0.0	0.0
+chrM	338	339	0.0	0.0
+chrM	339	340	0.0	0.0
+chrM	340	341	0.0	0.0
+chrM	341	342	0.0	0.0
+chrM	342	343	0.0	0.0
+chrM	343	344	0.0	0.0
+chrM	344	345	0.0	0.0
+chrM	345	346	0.0	0.0
+chrM	346	347	0.0	0.0
+chrM	347	348	0.0	0.0
+chrM	348	349	0.0	0.0
+chrM	349	350	0.0	0.0
+chrM	350	351	0.0	0.0
+chrM	351	352	0.0	0.0
+chrM	352	353	0.0	0.0
+chrM	353	354	0.0	0.0
+chrM	354	355	0.0	0.0
+chrM	355	356	0.0	0.0
+chrM	356	357	0.0	0.0
+chrM	357	358	0.0	0.0
+chrM	358	359	0.0	0.0
+chrM	359	360	0.0	0.0
+chrM	360	361	0.0	0.0
+chrM	361	362	0.0	0.0
+chrM	362	363	0.0	0.0
+chrM	363	364	0.0	0.0
+chrM	364	365	0.0	0.0
+chrM	365	366	0.0	0.0
+chrM	366	367	0.0	0.0
+chrM	367	368	0.0	0.0
+chrM	368	369	0.0	0.0
+chrM	369	370	0.0	0.0
+chrM	370	371	0.0	0.0
+chrM	371	372	0.0	0.0
+chrM	372	373	0.0	0.0
+chrM	373	374	0.0	0.0
+chrM	374	375	0.0	0.0
+chrM	375	376	0.0	0.0
+chrM	376	377	0.0	0.0
+chrM	377	378	0.0	0.0
+chrM	378	379	0.0	0.0
+chrM	379	380	0.0	0.0
+chrM	380	381	0.0	0.0
+chrM	381	382	0.0	0.0
+chrM	382	383	0.0	0.0
+chrM	383	384	0.0	0.0
+chrM	384	385	0.0	0.0
+chrM	385	386	0.0	0.0
+chrM	386	387	0.0	0.0
+chrM	387	388	0.0	0.0
+chrM	388	389	0.0	0.0
+chrM	389	390	0.0	0.0
+chrM	390	391	0.0	0.0
+chrM	391	392	0.0	0.0
+chrM	392	393	0.0	0.0
+chrM	393	394	0.0	0.0
+chrM	394	395	0.0	0.0
+chrM	395	396	0.0	0.0
+chrM	396	397	0.0	0.0
+chrM	397	398	0.0	0.0
+chrM	398	399	0.0	0.0
+chrM	399	400	0.0	0.0
+chrM	400	401	0.0	0.0
+chrM	401	402	0.0	0.0
+chrM	402	403	0.0	0.0
+chrM	403	404	0.0	0.0
+chrM	404	405	0.0	0.0
+chrM	405	406	0.0	0.0
+chrM	406	407	0.0	0.0
+chrM	407	408	0.0	0.0
+chrM	408	409	0.0	0.0
+chrM	409	410	0.0	0.0
+chrM	410	411	0.0	0.0
+chrM	411	412	0.0	0.0
+chrM	412	413	0.0	0.0
+chrM	413	414	0.0	0.0
+chrM	414	415	0.0	0.0
+chrM	415	416	0.0	0.0
+chrM	416	417	0.0	0.0
+chrM	417	418	0.0	0.0
+chrM	418	419	0.0	0.0
+chrM	419	420	0.0	0.0
+chrM	420	421	0.0	0.0
+chrM	421	422	0.0	0.0
+chrM	422	423	0.0	0.0
+chrM	423	424	0.0	0.0
+chrM	424	425	0.0	0.0
+chrM	425	426	0.0	0.0
+chrM	426	427	0.0	0.0
+chrM	427	428	0.0	0.0
+chrM	428	429	0.0	0.0
+chrM	429	430	0.0	0.0
+chrM	430	431	0.0	0.0
+chrM	431	432	0.0	0.0
+chrM	432	433	0.0	0.0
+chrM	433	434	0.0	0.0
+chrM	434	435	0.0	0.0
+chrM	435	436	0.0	0.0
+chrM	436	437	0.0	0.0
+chrM	437	438	0.0	0.0
+chrM	438	439	0.0	0.0
+chrM	439	440	0.0	0.0
+chrM	440	441	0.0	0.0
+chrM	441	442	0.0	0.0
+chrM	442	443	0.0	0.0
+chrM	443	444	0.0	0.0
+chrM	444	445	0.0	0.0
+chrM	445	446	0.0	0.0
+chrM	446	447	0.0	0.0
+chrM	447	448	0.0	0.0
+chrM	448	449	0.0	0.0
+chrM	449	450	0.0	0.0
+chrM	450	451	0.0	0.0
+chrM	451	452	0.0	0.0
+chrM	452	453	0.0	0.0
+chrM	453	454	0.0	0.0
+chrM	454	455	0.0	0.0
+chrM	455	456	0.0	0.0
+chrM	456	457	0.0	0.0
+chrM	457	458	0.0	0.0
+chrM	458	459	0.0	0.0
+chrM	459	460	0.0	0.0
+chrM	460	461	0.0	0.0
+chrM	461	462	0.0	0.0
+chrM	462	463	0.0	0.0
+chrM	463	464	0.0	0.0
+chrM	464	465	0.0	0.0
+chrM	465	466	0.0	0.0
+chrM	466	467	0.0	0.0
+chrM	467	468	0.0	0.0
+chrM	468	469	0.0	0.0
+chrM	469	470	0.0	0.0
+chrM	470	471	0.0	0.0
+chrM	471	472	0.0	0.0
+chrM	472	473	0.0	0.0
+chrM	473	474	0.0	0.0
+chrM	474	475	0.0	0.0
+chrM	475	476	0.0	0.0
+chrM	476	477	0.0	0.0
+chrM	477	478	0.0	0.0
+chrM	478	479	0.0	0.0
+chrM	479	480	0.0	0.0
+chrM	480	481	0.0	0.0
+chrM	481	482	0.0	0.0
+chrM	482	483	0.0	0.0
+chrM	483	484	0.0	0.0
+chrM	484	485	0.0	0.0
+chrM	485	486	0.0	0.0
+chrM	486	487	0.0	0.0
+chrM	487	488	0.0	0.0
+chrM	488	489	0.0	0.0
+chrM	489	490	0.0	0.0
+chrM	490	491	0.0	0.0
+chrM	491	492	0.0	0.0
+chrM	492	493	0.0	0.0
+chrM	493	494	0.0	0.0
+chrM	494	495	0.0	0.0
+chrM	495	496	0.0	0.0
+chrM	496	497	0.0	0.0
+chrM	497	498	0.0	0.0
+chrM	498	499	0.0	0.0
+chrM	499	500	0.0	0.0
+chrM	500	501	0.0	0.0
+chrM	501	502	0.0	0.0
+chrM	502	503	0.0	0.0
+chrM	503	504	0.0	0.0
+chrM	504	505	0.0	0.0
+chrM	505	506	0.0	0.0
+chrM	506	507	0.0	0.0
+chrM	507	508	0.0	0.0
+chrM	508	509	0.0	0.0
+chrM	509	510	0.0	0.0
+chrM	510	511	0.0	0.0
+chrM	511	512	0.0	0.0
+chrM	512	513	0.0	0.0
+chrM	513	514	0.0	0.0
+chrM	514	515	0.0	0.0
+chrM	515	516	0.0	0.0
+chrM	516	517	0.0	0.0
+chrM	517	518	0.0	0.0
+chrM	518	519	0.0	0.0
+chrM	519	520	0.0	0.0
+chrM	520	521	0.0	0.0
+chrM	521	522	0.0	0.0
+chrM	522	523	0.0	0.0
+chrM	523	524	0.0	0.0
+chrM	524	525	0.0	0.0
+chrM	525	526	0.0	0.0
+chrM	526	527	0.0	0.0
+chrM	527	528	0.0	0.0
+chrM	528	529	0.0	0.0
+chrM	529	530	0.0	0.0
+chrM	530	531	0.0	0.0
+chrM	531	532	0.0	0.0
+chrM	532	533	0.0	0.0
+chrM	533	534	0.0	0.0
+chrM	534	535	0.0	0.0
+chrM	535	536	0.0	0.0
+chrM	536	537	0.0	0.0
+chrM	537	538	0.0	0.0
+chrM	538	539	0.0	0.0
+chrM	539	540	0.0	0.0
+chrM	540	541	0.0	0.0
+chrM	541	542	0.0	0.0
+chrM	542	543	0.0	0.0
+chrM	543	544	0.0	0.0
+chrM	544	545	0.0	0.0
+chrM	545	546	0.0	0.0
+chrM	546	547	0.0	0.0
+chrM	547	548	0.0	0.0
+chrM	548	549	0.0	0.0
+chrM	549	550	0.0	0.0
+chrM	550	551	0.0	0.0
+chrM	551	552	0.0	0.0
+chrM	552	553	0.0	0.0
+chrM	553	554	0.0	0.0
+chrM	554	555	0.0	0.0
+chrM	555	556	0.0	0.0
+chrM	556	557	0.0	0.0
+chrM	557	558	0.0	0.0
+chrM	558	559	0.0	0.0
+chrM	559	560	0.0	0.0
+chrM	560	561	0.0	0.0
+chrM	561	562	0.0	0.0
+chrM	562	563	0.0	0.0
+chrM	563	564	0.0	0.0
+chrM	564	565	0.0	0.0
+chrM	565	566	0.0	0.0
+chrM	566	567	0.0	0.0
+chrM	567	568	0.0	0.0
+chrM	568	569	0.0	0.0
+chrM	569	570	0.0	0.0
+chrM	570	571	0.0	0.0
+chrM	571	572	0.0	0.0
+chrM	572	573	0.0	0.0
+chrM	573	574	0.0	0.0
+chrM	574	575	0.0	0.0
+chrM	575	576	0.0	0.0
+chrM	576	577	0.0	0.0
+chrM	577	578	0.0	0.0
+chrM	578	579	0.0	0.0
+chrM	579	580	0.0	0.0
+chrM	580	581	0.0	0.0
+chrM	581	582	0.0	0.0
+chrM	582	583	0.0	0.0
+chrM	583	584	0.0	0.0
+chrM	584	585	0.0	0.0
+chrM	585	586	0.0	0.0
+chrM	586	587	0.0	0.0
+chrM	587	588	0.0	0.0
+chrM	588	589	0.0	0.0
+chrM	589	590	0.0	0.0
+chrM	590	591	0.0	0.0
+chrM	591	592	0.0	0.0
+chrM	592	593	0.0	0.0
+chrM	593	594	0.0	0.0
+chrM	594	595	0.0	0.0
+chrM	595	596	0.0	0.0
+chrM	596	597	0.0	0.0
+chrM	597	598	0.0	0.0
+chrM	598	599	0.0	0.0
+chrM	599	600	0.0	0.0
+chrM	600	601	0.0	0.0
+chrM	601	602	0.0	0.0
+chrM	602	603	0.0	0.0
+chrM	603	604	0.0	0.0
+chrM	604	605	0.0	0.0
+chrM	605	606	0.0	0.0
+chrM	606	607	0.0	0.0
+chrM	607	608	0.0	0.0
+chrM	608	609	0.0	0.0
+chrM	609	610	0.0	0.0
+chrM	610	611	0.0	0.0
+chrM	611	612	0.0	0.0
+chrM	612	613	0.0	0.0
+chrM	613	614	0.0	0.0
+chrM	614	615	0.0	0.0
+chrM	615	616	0.0	0.0
+chrM	616	617	0.0	0.0
+chrM	617	618	0.0	0.0
+chrM	618	619	0.0	0.0
+chrM	619	620	0.0	0.0
+chrM	620	621	0.0	0.0
+chrM	621	622	0.0	0.0
+chrM	622	623	0.0	0.0
+chrM	623	624	0.0	0.0
+chrM	624	625	0.0	0.0
+chrM	625	626	0.0	0.0
+chrM	626	627	0.0	0.0
+chrM	627	628	0.0	0.0
+chrM	628	629	0.0	0.0
+chrM	629	630	0.0	0.0
+chrM	630	631	0.0	0.0
+chrM	631	632	0.0	0.0
+chrM	632	633	0.0	0.0
+chrM	633	634	0.0	0.0
+chrM	634	635	0.0	0.0
+chrM	635	636	0.0	0.0
+chrM	636	637	0.0	0.0
+chrM	637	638	0.0	0.0
+chrM	638	639	0.0	0.0
+chrM	639	640	0.0	0.0
+chrM	640	641	0.0	0.0
+chrM	641	642	0.0	0.0
+chrM	642	643	0.0	0.0
+chrM	643	644	0.0	0.0
+chrM	644	645	0.0	0.0
+chrM	645	646	0.0	0.0
+chrM	646	647	0.0	0.0
+chrM	647	648	0.0	0.0
+chrM	648	649	0.0	0.0
+chrM	649	650	0.0	0.0
+chrM	650	651	0.0	0.0
+chrM	651	652	0.0	0.0
+chrM	652	653	0.0	0.0
+chrM	653	654	0.0	0.0
+chrM	654	655	0.0	0.0
+chrM	655	656	0.0	0.0
+chrM	656	657	0.0	0.0
+chrM	657	658	0.0	0.0
+chrM	658	659	0.0	0.0
+chrM	659	660	0.0	0.0
+chrM	660	661	0.0	0.0
+chrM	661	662	0.0	0.0
+chrM	662	663	0.0	0.0
+chrM	663	664	0.0	0.0
+chrM	664	665	0.0	0.0
+chrM	665	666	0.0	0.0
+chrM	666	667	0.0	0.0
+chrM	667	668	0.0	0.0
+chrM	668	669	0.0	0.0
+chrM	669	670	0.0	0.0
+chrM	670	671	0.0	0.0
+chrM	671	672	0.0	0.0
+chrM	672	673	0.0	0.0
+chrM	673	674	0.0	0.0
+chrM	674	675	0.0	0.0
+chrM	675	676	0.0	0.0
+chrM	676	677	0.0	0.0
+chrM	677	678	0.0	0.0
+chrM	678	679	0.0	0.0
+chrM	679	680	0.0	0.0
+chrM	680	681	0.0	0.0
+chrM	681	682	0.0	0.0
+chrM	682	683	0.0	0.0
+chrM	683	684	0.0	0.0
+chrM	684	685	0.0	0.0
+chrM	685	686	0.0	0.0
+chrM	686	687	0.0	0.0
+chrM	687	688	0.0	0.0
+chrM	688	689	0.0	0.0
+chrM	689	690	0.0	0.0
+chrM	690	691	0.0	0.0
+chrM	691	692	0.0	0.0
+chrM	692	693	0.0	0.0
+chrM	693	694	0.0	0.0
+chrM	694	695	0.0	0.0
+chrM	695	696	0.0	0.0
+chrM	696	697	0.0	0.0
+chrM	697	698	0.0	0.0
+chrM	698	699	0.0	0.0
+chrM	699	700	0.0	0.0
+chrM	700	701	0.0	0.0
+chrM	701	702	0.0	0.0
+chrM	702	703	0.0	0.0
+chrM	703	704	0.0	0.0
+chrM	704	705	0.0	0.0
+chrM	705	706	0.0	0.0
+chrM	706	707	0.0	0.0
+chrM	707	708	0.0	0.0
+chrM	708	709	0.0	0.0
+chrM	709	710	0.0	0.0
+chrM	710	711	0.0	0.0
+chrM	711	712	0.0	0.0
+chrM	712	713	0.0	0.0
+chrM	713	714	0.0	0.0
+chrM	714	715	0.0	0.0
+chrM	715	716	0.0	0.0
+chrM	716	717	0.0	0.0
+chrM	717	718	0.0	0.0
+chrM	718	719	0.0	0.0
+chrM	719	720	0.0	0.0
+chrM	720	721	0.0	0.0
+chrM	721	722	0.0	0.0
+chrM	722	723	0.0	0.0
+chrM	723	724	0.0	0.0
+chrM	724	725	0.0	0.0
+chrM	725	726	0.0	0.0
+chrM	726	727	0.0	0.0
+chrM	727	728	0.0	0.0
+chrM	728	729	0.0	0.0
+chrM	729	730	0.0	0.0
+chrM	730	731	0.0	0.0
+chrM	731	732	0.0	0.0
+chrM	732	733	0.0	0.0
+chrM	733	734	0.0	0.0
+chrM	734	735	0.0	0.0
+chrM	735	736	0.0	0.0
+chrM	736	737	0.0	0.0
+chrM	737	738	0.0	0.0
+chrM	738	739	0.0	0.0
+chrM	739	740	0.0	0.0
+chrM	740	741	0.0	0.0
+chrM	741	742	0.0	0.0
+chrM	742	743	0.0	0.0
+chrM	743	744	0.0	0.0
+chrM	744	745	0.0	0.0
+chrM	745	746	0.0	0.0
+chrM	746	747	0.0	0.0
+chrM	747	748	0.0	0.0
+chrM	748	749	0.0	0.0
+chrM	749	750	0.0	0.0
+chrM	750	751	0.0	0.0
+chrM	751	752	0.0	0.0
+chrM	752	753	0.0	0.0
+chrM	753	754	0.0	0.0
+chrM	754	755	0.0	0.0
+chrM	755	756	0.0	0.0
+chrM	756	757	0.0	0.0
+chrM	757	758	0.0	0.0
+chrM	758	759	0.0	0.0
+chrM	759	760	0.0	0.0
+chrM	760	761	0.0	0.0
+chrM	761	762	0.0	0.0
+chrM	762	763	0.0	0.0
+chrM	763	764	0.0	0.0
+chrM	764	765	0.0	0.0
+chrM	765	766	0.0	0.0
+chrM	766	767	0.0	0.0
+chrM	767	768	0.0	0.0
+chrM	768	769	0.0	0.0
+chrM	769	770	0.0	0.0
+chrM	770	771	0.0	0.0
+chrM	771	772	0.0	0.0
+chrM	772	773	0.0	0.0
+chrM	773	774	0.0	0.0
+chrM	774	775	0.0	0.0
+chrM	775	776	0.0	0.0
+chrM	776	777	0.0	0.0
+chrM	777	778	0.0	0.0
+chrM	778	779	0.0	0.0
+chrM	779	780	0.0	0.0
+chrM	780	781	0.0	0.0
+chrM	781	782	0.0	0.0
+chrM	782	783	0.0	0.0
+chrM	783	784	0.0	0.0
+chrM	784	785	0.0	0.0
+chrM	785	786	0.0	0.0
+chrM	786	787	0.0	0.0
+chrM	787	788	0.0	0.0
+chrM	788	789	0.0	0.0
+chrM	789	790	0.0	0.0
+chrM	790	791	0.0	0.0
+chrM	791	792	0.0	0.0
+chrM	792	793	0.0	0.0
+chrM	793	794	0.0	0.0
+chrM	794	795	0.0	0.0
+chrM	795	796	0.0	0.0
+chrM	796	797	0.0	0.0
+chrM	797	798	0.0	0.0
+chrM	798	799	0.0	0.0
+chrM	799	800	0.0	0.0
+chrM	800	801	0.0	0.0
+chrM	801	802	0.0	0.0
+chrM	802	803	0.0	0.0
+chrM	803	804	0.0	0.0
+chrM	804	805	0.0	0.0
+chrM	805	806	0.0	0.0
+chrM	806	807	0.0	0.0
+chrM	807	808	0.0	0.0
+chrM	808	809	0.0	0.0
+chrM	809	810	0.0	0.0
+chrM	810	811	0.0	0.0
+chrM	811	812	0.0	0.0
+chrM	812	813	0.0	0.0
+chrM	813	814	0.0	0.0
+chrM	814	815	0.0	0.0
+chrM	815	816	0.0	0.0
+chrM	816	817	0.0	0.0
+chrM	817	818	0.0	0.0
+chrM	818	819	0.0	0.0
+chrM	819	820	0.0	0.0
+chrM	820	821	0.0	0.0
+chrM	821	822	0.0	0.0
+chrM	822	823	0.0	0.0
+chrM	823	824	0.0	0.0
+chrM	824	825	0.0	0.0
+chrM	825	826	0.0	0.0
+chrM	826	827	0.0	0.0
+chrM	827	828	0.0	0.0
+chrM	828	829	0.0	0.0
+chrM	829	830	0.0	0.0
+chrM	830	831	0.0	0.0
+chrM	831	832	0.0	0.0
+chrM	832	833	0.0	0.0
+chrM	833	834	0.0	0.0
+chrM	834	835	0.0	0.0
+chrM	835	836	0.0	0.0
+chrM	836	837	0.0	0.0
+chrM	837	838	0.0	0.0
+chrM	838	839	0.0	0.0
+chrM	839	840	0.0	0.0
+chrM	840	841	0.0	0.0
+chrM	841	842	0.0	0.0
+chrM	842	843	0.0	0.0
+chrM	843	844	0.0	0.0
+chrM	844	845	0.0	0.0
+chrM	845	846	0.0	0.0
+chrM	846	847	0.0	0.0
+chrM	847	848	0.0	0.0
+chrM	848	849	0.0	0.0
+chrM	849	850	0.0	0.0
+chrM	850	851	0.0	0.0
+chrM	851	852	0.0	0.0
+chrM	852	853	0.0	0.0
+chrM	853	854	0.0	0.0
+chrM	854	855	0.0	0.0
+chrM	855	856	0.0	0.0
+chrM	856	857	0.0	0.0
+chrM	857	858	0.0	0.0
+chrM	858	859	0.0	0.0
+chrM	859	860	0.0	0.0
+chrM	860	861	0.0	0.0
+chrM	861	862	0.0	0.0
+chrM	862	863	0.0	0.0
+chrM	863	864	0.0	0.0
+chrM	864	865	0.0	0.0
+chrM	865	866	0.0	0.0
+chrM	866	867	0.0	0.0
+chrM	867	868	0.0	0.0
+chrM	868	869	0.0	0.0
+chrM	869	870	0.0	0.0
+chrM	870	871	0.0	0.0
+chrM	871	872	0.0	0.0
+chrM	872	873	0.0	0.0
+chrM	873	874	0.0	0.0
+chrM	874	875	0.0	0.0
+chrM	875	876	0.0	0.0
+chrM	876	877	0.0	0.0
+chrM	877	878	0.0	0.0
+chrM	878	879	0.0	0.0
+chrM	879	880	0.0	0.0
+chrM	880	881	0.0	0.0
+chrM	881	882	0.0	0.0
+chrM	882	883	0.0	0.0
+chrM	883	884	0.0	0.0
+chrM	884	885	0.0	0.0
+chrM	885	886	0.0	0.0
+chrM	886	887	0.0	0.0
+chrM	887	888	0.0	0.0
+chrM	888	889	0.0	0.0
+chrM	889	890	0.0	0.0
+chrM	890	891	0.0	0.0
+chrM	891	892	0.0	0.0
+chrM	892	893	0.0	0.0
+chrM	893	894	0.0	0.0
+chrM	894	895	0.0	0.0
+chrM	895	896	0.0	0.0
+chrM	896	897	0.0	0.0
+chrM	897	898	0.0	0.0
+chrM	898	899	0.0	0.0
+chrM	899	900	0.0	0.0
+chrM	900	901	0.0	0.0
+chrM	901	902	0.0	0.0
+chrM	902	903	0.0	0.0
+chrM	903	904	0.0	0.0
+chrM	904	905	0.0	0.0
+chrM	905	906	0.0	0.0
+chrM	906	907	0.0	0.0
+chrM	907	908	0.0	0.0
+chrM	908	909	0.0	0.0
+chrM	909	910	0.0	0.0
+chrM	910	911	0.0	0.0
+chrM	911	912	0.0	0.0
+chrM	912	913	0.0	0.0
+chrM	913	914	0.0	0.0
+chrM	914	915	0.0	0.0
+chrM	915	916	0.0	0.0
+chrM	916	917	0.0	0.0
+chrM	917	918	0.0	0.0
+chrM	918	919	0.0	0.0
+chrM	919	920	0.0	0.0
+chrM	920	921	0.0	0.0
+chrM	921	922	0.0	0.0
+chrM	922	923	0.0	0.0
+chrM	923	924	0.0	0.0
+chrM	924	925	0.0	0.0
+chrM	925	926	0.0	0.0
+chrM	926	927	0.0	0.0
+chrM	927	928	0.0	0.0
+chrM	928	929	0.0	0.0
+chrM	929	930	0.0	0.0
+chrM	930	931	0.0	0.0
+chrM	931	932	0.0	0.0
+chrM	932	933	0.0	0.0
+chrM	933	934	0.0	0.0
+chrM	934	935	0.0	0.0
+chrM	935	936	0.0	0.0
+chrM	936	937	0.0	0.0
+chrM	937	938	0.0	0.0
+chrM	938	939	0.0	0.0
+chrM	939	940	0.0	0.0
+chrM	940	941	0.0	0.0
+chrM	941	942	0.0	0.0
+chrM	942	943	0.0	0.0
+chrM	943	944	0.0	0.0
+chrM	944	945	0.0	0.0
+chrM	945	946	0.0	0.0
+chrM	946	947	0.0	0.0
+chrM	947	948	0.0	0.0
+chrM	948	949	0.0	0.0
+chrM	949	950	0.0	0.0
+chrM	950	951	0.0	0.0
+chrM	951	952	0.0	0.0
+chrM	952	953	0.0	0.0
+chrM	953	954	0.0	0.0
+chrM	954	955	0.0	0.0
+chrM	955	956	0.0	0.0
+chrM	956	957	0.0	0.0
+chrM	957	958	0.0	0.0
+chrM	958	959	0.0	0.0
+chrM	959	960	0.0	0.0
+chrM	960	961	0.0	0.0
+chrM	961	962	0.0	0.0
+chrM	962	963	0.0	0.0
+chrM	963	964	0.0	0.0
+chrM	964	965	0.0	0.0
+chrM	965	966	0.0	0.0
+chrM	966	967	0.0	0.0
+chrM	967	968	0.0	0.0
+chrM	968	969	0.0	0.0
+chrM	969	970	0.0	0.0
+chrM	970	971	0.0	0.0
+chrM	971	972	0.0	0.0
+chrM	972	973	0.0	0.0
+chrM	973	974	0.0	0.0
+chrM	974	975	0.0	0.0
+chrM	975	976	0.0	0.0
+chrM	976	977	0.0	0.0
+chrM	977	978	0.0	0.0
+chrM	978	979	0.0	0.0
+chrM	979	980	0.0	0.0
+chrM	980	981	0.0	0.0
+chrM	981	982	0.0	0.0
+chrM	982	983	0.0	0.0
+chrM	983	984	0.0	0.0
+chrM	984	985	0.0	0.0
+chrM	985	986	0.0	0.0
+chrM	986	987	0.0	0.0
+chrM	987	988	0.0	0.0
+chrM	988	989	0.0	0.0
+chrM	989	990	0.0	0.0
+chrM	990	991	0.0	0.0
+chrM	991	992	0.0	0.0
+chrM	992	993	0.0	0.0
+chrM	993	994	0.0	0.0
+chrM	994	995	0.0	0.0
+chrM	995	996	0.0	0.0
+chrM	996	997	0.0	0.0
+chrM	997	998	0.0	0.0
+chrM	998	999	0.0	0.0
+chrM	999	1000	0.0	0.0
+chrM	1000	1001	0.0	0.0
+chrM	1001	1002	0.0	0.0
+chrM	1002	1003	0.0	0.0
+chrM	1003	1004	0.0	0.0
+chrM	1004	1005	0.0	0.0
+chrM	1005	1006	0.0	0.0
+chrM	1006	1007	0.0	0.0
+chrM	1007	1008	0.0	0.0
+chrM	1008	1009	0.0	0.0
+chrM	1009	1010	0.0	0.0
+chrM	1010	1011	0.0	0.0
+chrM	1011	1012	0.0	0.0
+chrM	1012	1013	0.0	0.0
+chrM	1013	1014	0.0	0.0
+chrM	1014	1015	0.0	0.0
+chrM	1015	1016	0.0	0.0
+chrM	1016	1017	0.0	0.0
+chrM	1017	1018	0.0	0.0
+chrM	1018	1019	0.0	0.0
+chrM	1019	1020	0.0	0.0
+chrM	1020	1021	0.0	0.0
+chrM	1021	1022	0.0	0.0
+chrM	1022	1023	0.0	0.0
+chrM	1023	1024	0.0	0.0
+chrM	1024	1025	0.0	0.0
+chrM	1025	1026	0.0	0.0
+chrM	1026	1027	0.0	0.0
+chrM	1027	1028	0.0	0.0
+chrM	1028	1029	0.0	0.0
+chrM	1029	1030	0.0	0.0
+chrM	1030	1031	0.0	0.0
+chrM	1031	1032	0.0	0.0
+chrM	1032	1033	0.0	0.0
+chrM	1033	1034	0.0	0.0
+chrM	1034	1035	0.0	0.0
+chrM	1035	1036	0.0	0.0
+chrM	1036	1037	0.0	0.0
+chrM	1037	1038	0.0	0.0
+chrM	1038	1039	0.0	0.0
+chrM	1039	1040	0.0	0.0
+chrM	1040	1041	0.0	0.0
+chrM	1041	1042	0.0	0.0
+chrM	1042	1043	0.0	0.0
+chrM	1043	1044	0.0	0.0
+chrM	1044	1045	0.0	0.0
+chrM	1045	1046	0.0	0.0
+chrM	1046	1047	0.0	0.0
+chrM	1047	1048	0.0	0.0
+chrM	1048	1049	0.0	0.0
+chrM	1049	1050	0.0	0.0
+chrM	1050	1051	0.0	0.0
+chrM	1051	1052	0.0	0.0
+chrM	1052	1053	0.0	0.0
+chrM	1053	1054	0.0	0.0
+chrM	1054	1055	0.0	0.0
+chrM	1055	1056	0.0	0.0
+chrM	1056	1057	0.0	0.0
+chrM	1057	1058	0.0	0.0
+chrM	1058	1059	0.0	0.0
+chrM	1059	1060	0.0	0.0
+chrM	1060	1061	0.0	0.0
+chrM	1061	1062	0.0	0.0
+chrM	1062	1063	0.0	0.0
+chrM	1063	1064	0.0	0.0
+chrM	1064	1065	0.0	0.0
+chrM	1065	1066	0.0	0.0
+chrM	1066	1067	0.0	0.0
+chrM	1067	1068	0.0	0.0
+chrM	1068	1069	0.0	0.0
+chrM	1069	1070	0.0	0.0
+chrM	1070	1071	0.0	0.0
+chrM	1071	1072	0.0	0.0
+chrM	1072	1073	0.0	0.0
+chrM	1073	1074	0.0	0.0
+chrM	1074	1075	0.0	0.0
+chrM	1075	1076	0.0	0.0
+chrM	1076	1077	0.0	0.0
+chrM	1077	1078	0.0	0.0
+chrM	1078	1079	0.0	0.0
+chrM	1079	1080	0.0	0.0
+chrM	1080	1081	0.0	0.0
+chrM	1081	1082	0.0	0.0
+chrM	1082	1083	0.0	0.0
+chrM	1083	1084	0.0	0.0
+chrM	1084	1085	0.0	0.0
+chrM	1085	1086	0.0	0.0
+chrM	1086	1087	0.0	0.0
+chrM	1087	1088	0.0	0.0
+chrM	1088	1089	0.0	0.0
+chrM	1089	1090	0.0	0.0
+chrM	1090	1091	0.0	0.0
+chrM	1091	1092	0.0	0.0
+chrM	1092	1093	0.0	0.0
+chrM	1093	1094	0.0	0.0
+chrM	1094	1095	0.0	0.0
+chrM	1095	1096	0.0	0.0
+chrM	1096	1097	0.0	0.0
+chrM	1097	1098	0.0	0.0
+chrM	1098	1099	0.0	0.0
+chrM	1099	1100	0.0	0.0
+chrM	1100	1101	0.0	0.0
+chrM	1101	1102	0.0	0.0
+chrM	1102	1103	0.0	0.0
+chrM	1103	1104	0.0	0.0
+chrM	1104	1105	0.0	0.0
+chrM	1105	1106	0.0	0.0
+chrM	1106	1107	0.0	0.0
+chrM	1107	1108	0.0	0.0
+chrM	1108	1109	0.0	0.0
+chrM	1109	1110	0.0	0.0
+chrM	1110	1111	0.0	0.0
+chrM	1111	1112	0.0	0.0
+chrM	1112	1113	0.0	0.0
+chrM	1113	1114	0.0	0.0
+chrM	1114	1115	0.0	0.0
+chrM	1115	1116	0.0	0.0
+chrM	1116	1117	0.0	0.0
+chrM	1117	1118	0.0	0.0
+chrM	1118	1119	0.0	0.0
+chrM	1119	1120	0.0	0.0
+chrM	1120	1121	0.0	0.0
+chrM	1121	1122	0.0	0.0
+chrM	1122	1123	0.0	0.0
+chrM	1123	1124	0.0	0.0
+chrM	1124	1125	0.0	0.0
+chrM	1125	1126	0.0	0.0
+chrM	1126	1127	0.0	0.0
+chrM	1127	1128	0.0	0.0
+chrM	1128	1129	0.0	0.0
+chrM	1129	1130	0.0	0.0
+chrM	1130	1131	0.0	0.0
+chrM	1131	1132	0.0	0.0
+chrM	1132	1133	0.0	0.0
+chrM	1133	1134	0.0	0.0
+chrM	1134	1135	0.0	0.0
+chrM	1135	1136	0.0	0.0
+chrM	1136	1137	0.0	0.0
+chrM	1137	1138	0.0	0.0
+chrM	1138	1139	0.0	0.0
+chrM	1139	1140	0.0	0.0
+chrM	1140	1141	0.0	0.0
+chrM	1141	1142	0.0	0.0
+chrM	1142	1143	0.0	0.0
+chrM	1143	1144	0.0	0.0
+chrM	1144	1145	0.0	0.0
+chrM	1145	1146	0.0	0.0
+chrM	1146	1147	0.0	0.0
+chrM	1147	1148	0.0	0.0
+chrM	1148	1149	0.0	0.0
+chrM	1149	1150	0.0	0.0
+chrM	1150	1151	0.0	0.0
+chrM	1151	1152	0.0	0.0
+chrM	1152	1153	0.0	0.0
+chrM	1153	1154	0.0	0.0
+chrM	1154	1155	0.0	0.0
+chrM	1155	1156	0.0	0.0
+chrM	1156	1157	0.0	0.0
+chrM	1157	1158	0.0	0.0
+chrM	1158	1159	0.0	0.0
+chrM	1159	1160	0.0	0.0
+chrM	1160	1161	0.0	0.0
+chrM	1161	1162	0.0	0.0
+chrM	1162	1163	0.0	0.0
+chrM	1163	1164	0.0	0.0
+chrM	1164	1165	0.0	0.0
+chrM	1165	1166	0.0	0.0
+chrM	1166	1167	0.0	0.0
+chrM	1167	1168	0.0	0.0
+chrM	1168	1169	0.0	0.0
+chrM	1169	1170	0.0	0.0
+chrM	1170	1171	0.0	0.0
+chrM	1171	1172	0.0	0.0
+chrM	1172	1173	0.0	0.0
+chrM	1173	1174	0.0	0.0
+chrM	1174	1175	0.0	0.0
+chrM	1175	1176	0.0	0.0
+chrM	1176	1177	0.0	0.0
+chrM	1177	1178	0.0	0.0
+chrM	1178	1179	0.0	0.0
+chrM	1179	1180	0.0	0.0
+chrM	1180	1181	0.0	0.0
+chrM	1181	1182	0.0	0.0
+chrM	1182	1183	0.0	0.0
+chrM	1183	1184	0.0	0.0
+chrM	1184	1185	0.0	0.0
+chrM	1185	1186	0.0	0.0
+chrM	1186	1187	0.0	0.0
+chrM	1187	1188	0.0	0.0
+chrM	1188	1189	0.0	0.0
+chrM	1189	1190	0.0	0.0
+chrM	1190	1191	0.0	0.0
+chrM	1191	1192	0.0	0.0
+chrM	1192	1193	0.0	0.0
+chrM	1193	1194	0.0	0.0
+chrM	1194	1195	0.0	0.0
+chrM	1195	1196	0.0	0.0
+chrM	1196	1197	0.0	0.0
+chrM	1197	1198	0.0	0.0
+chrM	1198	1199	0.0	0.0
+chrM	1199	1200	0.0	0.0
+chrM	1200	1201	0.0	0.0
+chrM	1201	1202	0.0	0.0
+chrM	1202	1203	0.0	0.0
+chrM	1203	1204	0.0	0.0
+chrM	1204	1205	0.0	0.0
+chrM	1205	1206	0.0	0.0
+chrM	1206	1207	0.0	0.0
+chrM	1207	1208	0.0	0.0
+chrM	1208	1209	0.0	0.0
+chrM	1209	1210	0.0	0.0
+chrM	1210	1211	0.0	0.0
+chrM	1211	1212	0.0	0.0
+chrM	1212	1213	0.0	0.0
+chrM	1213	1214	0.0	0.0
+chrM	1214	1215	0.0	0.0
+chrM	1215	1216	0.0	0.0
+chrM	1216	1217	0.0	0.0
+chrM	1217	1218	0.0	0.0
+chrM	1218	1219	0.0	0.0
+chrM	1219	1220	0.0	0.0
+chrM	1220	1221	0.0	0.0
+chrM	1221	1222	0.0	0.0
+chrM	1222	1223	0.0	0.0
+chrM	1223	1224	0.0	0.0
+chrM	1224	1225	0.0	0.0
+chrM	1225	1226	0.0	0.0
+chrM	1226	1227	0.0	0.0
+chrM	1227	1228	0.0	0.0
+chrM	1228	1229	0.0	0.0
+chrM	1229	1230	0.0	0.0
+chrM	1230	1231	0.0	0.0
+chrM	1231	1232	0.0	0.0
+chrM	1232	1233	0.0	0.0
+chrM	1233	1234	0.0	0.0
+chrM	1234	1235	0.0	0.0
+chrM	1235	1236	0.0	0.0
+chrM	1236	1237	0.0	0.0
+chrM	1237	1238	0.0	0.0
+chrM	1238	1239	0.0	0.0
+chrM	1239	1240	0.0	0.0
+chrM	1240	1241	0.0	0.0
+chrM	1241	1242	0.0	0.0
+chrM	1242	1243	0.0	0.0
+chrM	1243	1244	0.0	0.0
+chrM	1244	1245	0.0	0.0
+chrM	1245	1246	0.0	0.0
+chrM	1246	1247	0.0	0.0
+chrM	1247	1248	0.0	0.0
+chrM	1248	1249	0.0	0.0
+chrM	1249	1250	0.0	0.0
+chrM	1250	1251	0.0	0.0
+chrM	1251	1252	0.0	0.0
+chrM	1252	1253	0.0	0.0
+chrM	1253	1254	0.0	0.0
+chrM	1254	1255	0.0	0.0
+chrM	1255	1256	0.0	0.0
+chrM	1256	1257	0.0	0.0
+chrM	1257	1258	0.0	0.0
+chrM	1258	1259	0.0	0.0
+chrM	1259	1260	0.0	0.0
+chrM	1260	1261	0.0	0.0
+chrM	1261	1262	0.0	0.0
+chrM	1262	1263	0.0	0.0
+chrM	1263	1264	0.0	0.0
+chrM	1264	1265	0.0	0.0
+chrM	1265	1266	0.0	0.0
+chrM	1266	1267	0.0	0.0
+chrM	1267	1268	0.0	0.0
+chrM	1268	1269	0.0	0.0
+chrM	1269	1270	0.0	0.0
+chrM	1270	1271	0.0	0.0
+chrM	1271	1272	0.0	0.0
+chrM	1272	1273	0.0	0.0
+chrM	1273	1274	0.0	0.0
+chrM	1274	1275	0.0	0.0
+chrM	1275	1276	0.0	0.0
+chrM	1276	1277	0.0	0.0
+chrM	1277	1278	0.0	0.0
+chrM	1278	1279	0.0	0.0
+chrM	1279	1280	0.0	0.0
+chrM	1280	1281	0.0	0.0
+chrM	1281	1282	0.0	0.0
+chrM	1282	1283	0.0	0.0
+chrM	1283	1284	0.0	0.0
+chrM	1284	1285	0.0	0.0
+chrM	1285	1286	0.0	0.0
+chrM	1286	1287	0.0	0.0
+chrM	1287	1288	0.0	0.0
+chrM	1288	1289	0.0	0.0
+chrM	1289	1290	0.0	0.0
+chrM	1290	1291	0.0	0.0
+chrM	1291	1292	0.0	0.0
+chrM	1292	1293	0.0	0.0
+chrM	1293	1294	0.0	0.0
+chrM	1294	1295	0.0	0.0
+chrM	1295	1296	0.0	0.0
+chrM	1296	1297	0.0	0.0
+chrM	1297	1298	0.0	0.0
+chrM	1298	1299	0.0	0.0
+chrM	1299	1300	0.0	0.0
+chrM	1300	1301	0.0	0.0
+chrM	1301	1302	0.0	0.0
+chrM	1302	1303	0.0	0.0
+chrM	1303	1304	0.0	0.0
+chrM	1304	1305	0.0	0.0
+chrM	1305	1306	0.0	0.0
+chrM	1306	1307	0.0	0.0
+chrM	1307	1308	0.0	0.0
+chrM	1308	1309	0.0	0.0
+chrM	1309	1310	0.0	0.0
+chrM	1310	1311	0.0	0.0
+chrM	1311	1312	0.0	0.0
+chrM	1312	1313	0.0	0.0
+chrM	1313	1314	0.0	0.0
+chrM	1314	1315	0.0	0.0
+chrM	1315	1316	0.0	0.0
+chrM	1316	1317	0.0	0.0
+chrM	1317	1318	0.0	0.0
+chrM	1318	1319	0.0	0.0
+chrM	1319	1320	0.0	0.0
+chrM	1320	1321	0.0	0.0
+chrM	1321	1322	0.0	0.0
+chrM	1322	1323	0.0	0.0
+chrM	1323	1324	0.0	0.0
+chrM	1324	1325	0.0	0.0
+chrM	1325	1326	0.0	0.0
+chrM	1326	1327	0.0	0.0
+chrM	1327	1328	0.0	0.0
+chrM	1328	1329	0.0	0.0
+chrM	1329	1330	0.0	0.0
+chrM	1330	1331	0.0	0.0
+chrM	1331	1332	0.0	0.0
+chrM	1332	1333	0.0	0.0
+chrM	1333	1334	0.0	0.0
+chrM	1334	1335	0.0	0.0
+chrM	1335	1336	0.0	0.0
+chrM	1336	1337	0.0	0.0
+chrM	1337	1338	0.0	0.0
+chrM	1338	1339	0.0	0.0
+chrM	1339	1340	0.0	0.0
+chrM	1340	1341	0.0	0.0
+chrM	1341	1342	0.0	0.0
+chrM	1342	1343	0.0	0.0
+chrM	1343	1344	0.0	0.0
+chrM	1344	1345	0.0	0.0
+chrM	1345	1346	0.0	0.0
+chrM	1346	1347	0.0	0.0
+chrM	1347	1348	0.0	0.0
+chrM	1348	1349	0.0	0.0
+chrM	1349	1350	0.0	0.0
+chrM	1350	1351	0.0	0.0
+chrM	1351	1352	0.0	0.0
+chrM	1352	1353	0.0	0.0
+chrM	1353	1354	0.0	0.0
+chrM	1354	1355	0.0	0.0
+chrM	1355	1356	0.0	0.0
+chrM	1356	1357	0.0	0.0
+chrM	1357	1358	0.0	0.0
+chrM	1358	1359	0.0	0.0
+chrM	1359	1360	0.0	0.0
+chrM	1360	1361	0.0	0.0
+chrM	1361	1362	0.0	0.0
+chrM	1362	1363	0.0	0.0
+chrM	1363	1364	0.0	0.0
+chrM	1364	1365	0.0	0.0
+chrM	1365	1366	0.0	0.0
+chrM	1366	1367	0.0	0.0
+chrM	1367	1368	0.0	0.0
+chrM	1368	1369	0.0	0.0
+chrM	1369	1370	0.0	0.0
+chrM	1370	1371	0.0	0.0
+chrM	1371	1372	0.0	0.0
+chrM	1372	1373	0.0	0.0
+chrM	1373	1374	0.0	0.0
+chrM	1374	1375	0.0	0.0
+chrM	1375	1376	0.0	0.0
+chrM	1376	1377	0.0	0.0
+chrM	1377	1378	0.0	0.0
+chrM	1378	1379	0.0	0.0
+chrM	1379	1380	0.0	0.0
+chrM	1380	1381	0.0	0.0
+chrM	1381	1382	0.0	0.0
+chrM	1382	1383	0.0	0.0
+chrM	1383	1384	0.0	0.0
+chrM	1384	1385	0.0	0.0
+chrM	1385	1386	0.0	0.0
+chrM	1386	1387	0.0	0.0
+chrM	1387	1388	0.0	0.0
+chrM	1388	1389	0.0	0.0
+chrM	1389	1390	0.0	0.0
+chrM	1390	1391	0.0	0.0
+chrM	1391	1392	0.0	0.0
+chrM	1392	1393	0.0	0.0
+chrM	1393	1394	0.0	0.0
+chrM	1394	1395	0.0	0.0
+chrM	1395	1396	0.0	0.0
+chrM	1396	1397	0.0	0.0
+chrM	1397	1398	0.0	0.0
+chrM	1398	1399	0.0	0.0
+chrM	1399	1400	0.0	0.0
+chrM	1400	1401	0.0	0.0
+chrM	1401	1402	0.0	0.0
+chrM	1402	1403	0.0	0.0
+chrM	1403	1404	0.0	0.0
+chrM	1404	1405	0.0	0.0
+chrM	1405	1406	0.0	0.0
+chrM	1406	1407	0.0	0.0
+chrM	1407	1408	0.0	0.0
+chrM	1408	1409	0.0	0.0
+chrM	1409	1410	0.0	0.0
+chrM	1410	1411	0.0	0.0
+chrM	1411	1412	0.0	0.0
+chrM	1412	1413	0.0	0.0
+chrM	1413	1414	0.0	0.0
+chrM	1414	1415	0.0	0.0
+chrM	1415	1416	0.0	0.0
+chrM	1416	1417	0.0	0.0
+chrM	1417	1418	0.0	0.0
+chrM	1418	1419	0.0	0.0
+chrM	1419	1420	0.0	0.0
+chrM	1420	1421	0.0	0.0
+chrM	1421	1422	0.0	0.0
+chrM	1422	1423	0.0	0.0
+chrM	1423	1424	0.0	0.0
+chrM	1424	1425	0.0	0.0
+chrM	1425	1426	0.0	0.0
+chrM	1426	1427	0.0	0.0
+chrM	1427	1428	0.0	0.0
+chrM	1428	1429	0.0	0.0
+chrM	1429	1430	0.0	0.0
+chrM	1430	1431	0.0	0.0
+chrM	1431	1432	0.0	0.0
+chrM	1432	1433	0.0	0.0
+chrM	1433	1434	0.0	0.0
+chrM	1434	1435	0.0	0.0
+chrM	1435	1436	0.0	0.0
+chrM	1436	1437	0.0	0.0
+chrM	1437	1438	0.0	0.0
+chrM	1438	1439	0.0	0.0
+chrM	1439	1440	0.0	0.0
+chrM	1440	1441	0.0	0.0
+chrM	1441	1442	0.0	0.0
+chrM	1442	1443	0.0	0.0
+chrM	1443	1444	0.0	0.0
+chrM	1444	1445	0.0	0.0
+chrM	1445	1446	0.0	0.0
+chrM	1446	1447	0.0	0.0
+chrM	1447	1448	0.0	0.0
+chrM	1448	1449	0.0	0.0
+chrM	1449	1450	0.0	0.0
+chrM	1450	1451	0.0	0.0
+chrM	1451	1452	0.0	0.0
+chrM	1452	1453	0.0	0.0
+chrM	1453	1454	0.0	0.0
+chrM	1454	1455	0.0	0.0
+chrM	1455	1456	0.0	0.0
+chrM	1456	1457	0.0	0.0
+chrM	1457	1458	0.0	0.0
+chrM	1458	1459	0.0	0.0
+chrM	1459	1460	0.0	0.0
+chrM	1460	1461	0.0	0.0
+chrM	1461	1462	0.0	0.0
+chrM	1462	1463	0.0	0.0
+chrM	1463	1464	0.0	0.0
+chrM	1464	1465	0.0	0.0
+chrM	1465	1466	0.0	0.0
+chrM	1466	1467	0.0	0.0
+chrM	1467	1468	0.0	0.0
+chrM	1468	1469	0.0	0.0
+chrM	1469	1470	0.0	0.0
+chrM	1470	1471	0.0	0.0
+chrM	1471	1472	0.0	0.0
+chrM	1472	1473	0.0	0.0
+chrM	1473	1474	0.0	0.0
+chrM	1474	1475	0.0	0.0
+chrM	1475	1476	0.0	0.0
+chrM	1476	1477	0.0	0.0
+chrM	1477	1478	0.0	0.0
+chrM	1478	1479	0.0	0.0
+chrM	1479	1480	0.0	0.0
+chrM	1480	1481	0.0	0.0
+chrM	1481	1482	0.0	0.0
+chrM	1482	1483	0.0	0.0
+chrM	1483	1484	0.0	0.0
+chrM	1484	1485	0.0	0.0
+chrM	1485	1486	0.0	0.0
+chrM	1486	1487	0.0	0.0
+chrM	1487	1488	0.0	0.0
+chrM	1488	1489	0.0	0.0
+chrM	1489	1490	0.0	0.0
+chrM	1490	1491	0.0	0.0
+chrM	1491	1492	0.0	0.0
+chrM	1492	1493	0.0	0.0
+chrM	1493	1494	0.0	0.0
+chrM	1494	1495	0.0	0.0
+chrM	1495	1496	0.0	0.0
+chrM	1496	1497	0.0	0.0
+chrM	1497	1498	0.0	0.0
+chrM	1498	1499	0.0	0.0
+chrM	1499	1500	0.0	0.0
+chrM	1500	1501	0.0	0.0
+chrM	1501	1502	0.0	0.0
+chrM	1502	1503	0.0	0.0
+chrM	1503	1504	0.0	0.0
+chrM	1504	1505	0.0	0.0
+chrM	1505	1506	0.0	0.0
+chrM	1506	1507	0.0	0.0
+chrM	1507	1508	0.0	0.0
+chrM	1508	1509	0.0	0.0
+chrM	1509	1510	0.0	0.0
+chrM	1510	1511	0.0	0.0
+chrM	1511	1512	0.0	0.0
+chrM	1512	1513	0.0	0.0
+chrM	1513	1514	0.0	0.0
+chrM	1514	1515	0.0	0.0
+chrM	1515	1516	0.0	0.0
+chrM	1516	1517	0.0	0.0
+chrM	1517	1518	0.0	0.0
+chrM	1518	1519	0.0	0.0
+chrM	1519	1520	0.0	0.0
+chrM	1520	1521	0.0	0.0
+chrM	1521	1522	0.0	0.0
+chrM	1522	1523	0.0	0.0
+chrM	1523	1524	0.0	0.0
+chrM	1524	1525	0.0	0.0
+chrM	1525	1526	0.0	0.0
+chrM	1526	1527	0.0	0.0
+chrM	1527	1528	0.0	0.0
+chrM	1528	1529	0.0	0.0
+chrM	1529	1530	0.0	0.0
+chrM	1530	1531	0.0	0.0
+chrM	1531	1532	0.0	0.0
+chrM	1532	1533	0.0	0.0
+chrM	1533	1534	0.0	0.0
+chrM	1534	1535	0.0	0.0
+chrM	1535	1536	0.0	0.0
+chrM	1536	1537	0.0	0.0
+chrM	1537	1538	0.0	0.0
+chrM	1538	1539	0.0	0.0
+chrM	1539	1540	0.0	0.0
+chrM	1540	1541	0.0	0.0
+chrM	1541	1542	0.0	0.0
+chrM	1542	1543	0.0	0.0
+chrM	1543	1544	0.0	0.0
+chrM	1544	1545	0.0	0.0
+chrM	1545	1546	0.0	0.0
+chrM	1546	1547	0.0	0.0
+chrM	1547	1548	0.0	0.0
+chrM	1548	1549	0.0	0.0
+chrM	1549	1550	0.0	0.0
+chrM	1550	1551	0.0	0.0
+chrM	1551	1552	0.0	0.0
+chrM	1552	1553	0.0	0.0
+chrM	1553	1554	0.0	0.0
+chrM	1554	1555	0.0	0.0
+chrM	1555	1556	0.0	0.0
+chrM	1556	1557	0.0	0.0
+chrM	1557	1558	0.0	0.0
+chrM	1558	1559	0.0	0.0
+chrM	1559	1560	0.0	0.0
+chrM	1560	1561	0.0	0.0
+chrM	1561	1562	0.0	0.0
+chrM	1562	1563	0.0	0.0
+chrM	1563	1564	0.0	0.0
+chrM	1564	1565	0.0	0.0
+chrM	1565	1566	0.0	0.0
+chrM	1566	1567	0.0	0.0
+chrM	1567	1568	0.0	0.0
+chrM	1568	1569	0.0	0.0
+chrM	1569	1570	0.0	0.0
+chrM	1570	1571	0.0	0.0
+chrM	1571	1572	0.0	0.0
+chrM	1572	1573	0.0	0.0
+chrM	1573	1574	0.0	0.0
+chrM	1574	1575	0.0	0.0
+chrM	1575	1576	0.0	0.0
+chrM	1576	1577	0.0	0.0
+chrM	1577	1578	0.0	0.0
+chrM	1578	1579	0.0	0.0
+chrM	1579	1580	0.0	0.0
+chrM	1580	1581	0.0	0.0
+chrM	1581	1582	0.0	0.0
+chrM	1582	1583	0.0	0.0
+chrM	1583	1584	0.0	0.0
+chrM	1584	1585	0.0	0.0
+chrM	1585	1586	0.0	0.0
+chrM	1586	1587	0.0	0.0
+chrM	1587	1588	0.0	0.0
+chrM	1588	1589	0.0	0.0
+chrM	1589	1590	0.0	0.0
+chrM	1590	1591	0.0	0.0
+chrM	1591	1592	0.0	0.0
+chrM	1592	1593	0.0	0.0
+chrM	1593	1594	0.0	0.0
+chrM	1594	1595	0.0	0.0
+chrM	1595	1596	0.0	0.0
+chrM	1596	1597	0.0	0.0
+chrM	1597	1598	0.0	0.0
+chrM	1598	1599	0.0	0.0
+chrM	1599	1600	0.0	0.0
+chrM	1600	1601	0.0	0.0
+chrM	1601	1602	0.0	0.0
+chrM	1602	1603	0.0	0.0
+chrM	1603	1604	0.0	0.0
+chrM	1604	1605	0.0	0.0
+chrM	1605	1606	0.0	0.0
+chrM	1606	1607	0.0	0.0
+chrM	1607	1608	0.0	0.0
+chrM	1608	1609	0.0	0.0
+chrM	1609	1610	0.0	0.0
+chrM	1610	1611	0.0	0.0
+chrM	1611	1612	0.0	0.0
+chrM	1612	1613	0.0	0.0
+chrM	1613	1614	0.0	0.0
+chrM	1614	1615	0.0	0.0
+chrM	1615	1616	0.0	0.0
+chrM	1616	1617	0.0	0.0
+chrM	1617	1618	0.0	0.0
+chrM	1618	1619	0.0	0.0
+chrM	1619	1620	0.0	0.0
+chrM	1620	1621	0.0	0.0
+chrM	1621	1622	0.0	0.0
+chrM	1622	1623	0.0	0.0
+chrM	1623	1624	0.0	0.0
+chrM	1624	1625	0.0	0.0
+chrM	1625	1626	0.0	0.0
+chrM	1626	1627	0.0	0.0
+chrM	1627	1628	0.0	0.0
+chrM	1628	1629	0.0	0.0
+chrM	1629	1630	0.0	0.0
+chrM	1630	1631	0.0	0.0
+chrM	1631	1632	0.0	0.0
+chrM	1632	1633	0.0	0.0
+chrM	1633	1634	0.0	0.0
+chrM	1634	1635	0.0	0.0
+chrM	1635	1636	0.0	0.0
+chrM	1636	1637	0.0	0.0
+chrM	1637	1638	0.0	0.0
+chrM	1638	1639	0.0	0.0
+chrM	1639	1640	0.0	0.0
+chrM	1640	1641	0.0	0.0
+chrM	1641	1642	0.0	0.0
+chrM	1642	1643	0.0	0.0
+chrM	1643	1644	0.0	0.0
+chrM	1644	1645	0.0	0.0
+chrM	1645	1646	0.0	0.0
+chrM	1646	1647	0.0	0.0
+chrM	1647	1648	0.0	0.0
+chrM	1648	1649	0.0	0.0
+chrM	1649	1650	0.0	0.0
+chrM	1650	1651	0.0	0.0
+chrM	1651	1652	0.0	0.0
+chrM	1652	1653	0.0	0.0
+chrM	1653	1654	0.0	0.0
+chrM	1654	1655	0.0	0.0
+chrM	1655	1656	0.0	0.0
+chrM	1656	1657	0.0	0.0
+chrM	1657	1658	0.0	0.0
+chrM	1658	1659	0.0	0.0
+chrM	1659	1660	0.0	0.0
+chrM	1660	1661	0.0	0.0
+chrM	1661	1662	0.0	0.0
+chrM	1662	1663	0.0	0.0
+chrM	1663	1664	0.0	0.0
+chrM	1664	1665	0.0	0.0
+chrM	1665	1666	0.0	0.0
+chrM	1666	1667	0.0	0.0
+chrM	1667	1668	0.0	0.0
+chrM	1668	1669	0.0	0.0
+chrM	1669	1670	0.0	0.0
+chrM	1670	1671	0.0	0.0
+chrM	1671	1672	0.0	0.0
+chrM	1672	1673	0.0	0.0
+chrM	1673	1674	0.0	0.0
+chrM	1674	1675	0.0	0.0
+chrM	1675	1676	0.0	0.0
+chrM	1676	1677	0.0	0.0
+chrM	1677	1678	0.0	0.0
+chrM	1678	1679	0.0	0.0
+chrM	1679	1680	0.0	0.0
+chrM	1680	1681	0.0	0.0
+chrM	1681	1682	0.0	0.0
+chrM	1682	1683	0.0	0.0
+chrM	1683	1684	0.0	0.0
+chrM	1684	1685	0.0	0.0
+chrM	1685	1686	0.0	0.0
+chrM	1686	1687	0.0	0.0
+chrM	1687	1688	0.0	0.0
+chrM	1688	1689	0.0	0.0
+chrM	1689	1690	0.0	0.0
+chrM	1690	1691	0.0	0.0
+chrM	1691	1692	0.0	0.0
+chrM	1692	1693	0.0	0.0
+chrM	1693	1694	0.0	0.0
+chrM	1694	1695	0.0	0.0
+chrM	1695	1696	0.0	0.0
+chrM	1696	1697	0.0	0.0
+chrM	1697	1698	0.0	0.0
+chrM	1698	1699	0.0	0.0
+chrM	1699	1700	0.0	0.0
+chrM	1700	1701	0.0	0.0
+chrM	1701	1702	0.0	0.0
+chrM	1702	1703	0.0	0.0
+chrM	1703	1704	0.0	0.0
+chrM	1704	1705	0.0	0.0
+chrM	1705	1706	0.0	0.0
+chrM	1706	1707	0.0	0.0
+chrM	1707	1708	0.0	0.0
+chrM	1708	1709	0.0	0.0
+chrM	1709	1710	0.0	0.0
+chrM	1710	1711	0.0	0.0
+chrM	1711	1712	0.0	0.0
+chrM	1712	1713	0.0	0.0
+chrM	1713	1714	0.0	0.0
+chrM	1714	1715	0.0	0.0
+chrM	1715	1716	0.0	0.0
+chrM	1716	1717	0.0	0.0
+chrM	1717	1718	0.0	0.0
+chrM	1718	1719	0.0	0.0
+chrM	1719	1720	0.0	0.0
+chrM	1720	1721	0.0	0.0
+chrM	1721	1722	0.0	0.0
+chrM	1722	1723	0.0	0.0
+chrM	1723	1724	0.0	0.0
+chrM	1724	1725	0.0	0.0
+chrM	1725	1726	0.0	0.0
+chrM	1726	1727	0.0	0.0
+chrM	1727	1728	0.0	0.0
+chrM	1728	1729	0.0	0.0
+chrM	1729	1730	0.0	0.0
+chrM	1730	1731	0.0	0.0
+chrM	1731	1732	0.0	0.0
+chrM	1732	1733	0.0	0.0
+chrM	1733	1734	0.0	0.0
+chrM	1734	1735	0.0	0.0
+chrM	1735	1736	0.0	0.0
+chrM	1736	1737	0.0	0.0
+chrM	1737	1738	0.0	0.0
+chrM	1738	1739	0.0	0.0
+chrM	1739	1740	0.0	0.0
+chrM	1740	1741	0.0	0.0
+chrM	1741	1742	0.0	0.0
+chrM	1742	1743	0.0	0.0
+chrM	1743	1744	0.0	0.0
+chrM	1744	1745	0.0	0.0
+chrM	1745	1746	0.0	0.0
+chrM	1746	1747	0.0	0.0
+chrM	1747	1748	0.0	0.0
+chrM	1748	1749	0.0	0.0
+chrM	1749	1750	0.0	0.0
+chrM	1750	1751	0.0	0.0
+chrM	1751	1752	0.0	0.0
+chrM	1752	1753	0.0	0.0
+chrM	1753	1754	0.0	0.0
+chrM	1754	1755	0.0	0.0
+chrM	1755	1756	0.0	0.0
+chrM	1756	1757	0.0	0.0
+chrM	1757	1758	0.0	0.0
+chrM	1758	1759	0.0	0.0
+chrM	1759	1760	0.0	0.0
+chrM	1760	1761	0.0	0.0
+chrM	1761	1762	0.0	0.0
+chrM	1762	1763	0.0	0.0
+chrM	1763	1764	0.0	0.0
+chrM	1764	1765	0.0	0.0
+chrM	1765	1766	0.0	0.0
+chrM	1766	1767	0.0	0.0
+chrM	1767	1768	0.0	0.0
+chrM	1768	1769	0.0	0.0
+chrM	1769	1770	0.0	0.0
+chrM	1770	1771	0.0	0.0
+chrM	1771	1772	0.0	0.0
+chrM	1772	1773	0.0	0.0
+chrM	1773	1774	0.0	0.0
+chrM	1774	1775	0.0	0.0
+chrM	1775	1776	0.0	0.0
+chrM	1776	1777	0.0	0.0
+chrM	1777	1778	0.0	0.0
+chrM	1778	1779	0.0	0.0
+chrM	1779	1780	0.0	0.0
+chrM	1780	1781	0.0	0.0
+chrM	1781	1782	0.0	0.0
+chrM	1782	1783	0.0	0.0
+chrM	1783	1784	0.0	0.0
+chrM	1784	1785	0.0	0.0
+chrM	1785	1786	0.0	0.0
+chrM	1786	1787	0.0	0.0
+chrM	1787	1788	0.0	0.0
+chrM	1788	1789	0.0	0.0
+chrM	1789	1790	0.0	0.0
+chrM	1790	1791	0.0	0.0
+chrM	1791	1792	0.0	0.0
+chrM	1792	1793	0.0	0.0
+chrM	1793	1794	0.0	0.0
+chrM	1794	1795	0.0	0.0
+chrM	1795	1796	0.0	0.0
+chrM	1796	1797	0.0	0.0
+chrM	1797	1798	0.0	0.0
+chrM	1798	1799	0.0	0.0
+chrM	1799	1800	0.0	0.0
+chrM	1800	1801	0.0	0.0
+chrM	1801	1802	0.0	0.0
+chrM	1802	1803	0.0	0.0
+chrM	1803	1804	0.0	0.0
+chrM	1804	1805	0.0	0.0
+chrM	1805	1806	0.0	0.0
+chrM	1806	1807	0.0	0.0
+chrM	1807	1808	0.0	0.0
+chrM	1808	1809	0.0	0.0
+chrM	1809	1810	0.0	0.0
+chrM	1810	1811	0.0	0.0
+chrM	1811	1812	0.0	0.0
+chrM	1812	1813	0.0	0.0
+chrM	1813	1814	0.0	0.0
+chrM	1814	1815	0.0	0.0
+chrM	1815	1816	0.0	0.0
+chrM	1816	1817	0.0	0.0
+chrM	1817	1818	0.0	0.0
+chrM	1818	1819	0.0	0.0
+chrM	1819	1820	0.0	0.0
+chrM	1820	1821	0.0	0.0
+chrM	1821	1822	0.0	0.0
+chrM	1822	1823	0.0	0.0
+chrM	1823	1824	0.0	0.0
+chrM	1824	1825	0.0	0.0
+chrM	1825	1826	0.0	0.0
+chrM	1826	1827	0.0	0.0
+chrM	1827	1828	0.0	0.0
+chrM	1828	1829	0.0	0.0
+chrM	1829	1830	0.0	0.0
+chrM	1830	1831	0.0	0.0
+chrM	1831	1832	0.0	0.0
+chrM	1832	1833	0.0	0.0
+chrM	1833	1834	0.0	0.0
+chrM	1834	1835	0.0	0.0
+chrM	1835	1836	0.0	0.0
+chrM	1836	1837	0.0	0.0
+chrM	1837	1838	0.0	0.0
+chrM	1838	1839	0.0	0.0
+chrM	1839	1840	0.0	0.0
+chrM	1840	1841	0.0	0.0
+chrM	1841	1842	0.0	0.0
+chrM	1842	1843	0.0	0.0
+chrM	1843	1844	0.0	0.0
+chrM	1844	1845	0.0	0.0
+chrM	1845	1846	0.0	0.0
+chrM	1846	1847	0.0	0.0
+chrM	1847	1848	0.0	0.0
+chrM	1848	1849	0.0	0.0
+chrM	1849	1850	0.0	0.0
+chrM	1850	1851	0.0	0.0
+chrM	1851	1852	0.0	0.0
+chrM	1852	1853	0.0	0.0
+chrM	1853	1854	0.0	0.0
+chrM	1854	1855	0.0	0.0
+chrM	1855	1856	0.0	0.0
+chrM	1856	1857	0.0	0.0
+chrM	1857	1858	0.0	0.0
+chrM	1858	1859	0.0	0.0
+chrM	1859	1860	0.0	0.0
+chrM	1860	1861	0.0	0.0
+chrM	1861	1862	0.0	0.0
+chrM	1862	1863	0.0	0.0
+chrM	1863	1864	0.0	0.0
+chrM	1864	1865	0.0	0.0
+chrM	1865	1866	0.0	0.0
+chrM	1866	1867	0.0	0.0
+chrM	1867	1868	0.0	0.0
+chrM	1868	1869	0.0	0.0
+chrM	1869	1870	0.0	0.0
+chrM	1870	1871	0.0	0.0
+chrM	1871	1872	0.0	0.0
+chrM	1872	1873	0.0	0.0
+chrM	1873	1874	0.0	0.0
+chrM	1874	1875	0.0	0.0
+chrM	1875	1876	0.0	0.0
+chrM	1876	1877	0.0	0.0
+chrM	1877	1878	0.0	0.0
+chrM	1878	1879	0.0	0.0
+chrM	1879	1880	0.0	0.0
+chrM	1880	1881	0.0	0.0
+chrM	1881	1882	0.0	0.0
+chrM	1882	1883	0.0	0.0
+chrM	1883	1884	0.0	0.0
+chrM	1884	1885	0.0	0.0
+chrM	1885	1886	0.0	0.0
+chrM	1886	1887	0.0	0.0
+chrM	1887	1888	0.0	0.0
+chrM	1888	1889	0.0	0.0
+chrM	1889	1890	0.0	0.0
+chrM	1890	1891	0.0	0.0
+chrM	1891	1892	0.0	0.0
+chrM	1892	1893	0.0	0.0
+chrM	1893	1894	0.0	0.0
+chrM	1894	1895	0.0	0.0
+chrM	1895	1896	0.0	0.0
+chrM	1896	1897	0.0	0.0
+chrM	1897	1898	0.0	0.0
+chrM	1898	1899	0.0	0.0
+chrM	1899	1900	0.0	0.0
+chrM	1900	1901	0.0	0.0
+chrM	1901	1902	0.0	0.0
+chrM	1902	1903	0.0	0.0
+chrM	1903	1904	0.0	0.0
+chrM	1904	1905	0.0	0.0
+chrM	1905	1906	0.0	0.0
+chrM	1906	1907	0.0	0.0
+chrM	1907	1908	0.0	0.0
+chrM	1908	1909	0.0	0.0
+chrM	1909	1910	0.0	0.0
+chrM	1910	1911	0.0	0.0
+chrM	1911	1912	0.0	0.0
+chrM	1912	1913	0.0	0.0
+chrM	1913	1914	0.0	0.0
+chrM	1914	1915	0.0	0.0
+chrM	1915	1916	0.0	0.0
+chrM	1916	1917	0.0	0.0
+chrM	1917	1918	0.0	0.0
+chrM	1918	1919	0.0	0.0
+chrM	1919	1920	0.0	0.0
+chrM	1920	1921	0.0	0.0
+chrM	1921	1922	0.0	0.0
+chrM	1922	1923	0.0	0.0
+chrM	1923	1924	0.0	0.0
+chrM	1924	1925	0.0	0.0
+chrM	1925	1926	0.0	0.0
+chrM	1926	1927	0.0	0.0
+chrM	1927	1928	0.0	0.0
+chrM	1928	1929	0.0	0.0
+chrM	1929	1930	0.0	0.0
+chrM	1930	1931	0.0	0.0
+chrM	1931	1932	0.0	0.0
+chrM	1932	1933	0.0	0.0
+chrM	1933	1934	0.0	0.0
+chrM	1934	1935	0.0	0.0
+chrM	1935	1936	0.0	0.0
+chrM	1936	1937	0.0	0.0
+chrM	1937	1938	0.0	0.0
+chrM	1938	1939	0.0	0.0
+chrM	1939	1940	0.0	0.0
+chrM	1940	1941	0.0	0.0
+chrM	1941	1942	0.0	0.0
+chrM	1942	1943	0.0	0.0
+chrM	1943	1944	0.0	0.0
+chrM	1944	1945	0.0	0.0
+chrM	1945	1946	0.0	0.0
+chrM	1946	1947	0.0	0.0
+chrM	1947	1948	0.0	0.0
+chrM	1948	1949	0.0	0.0
+chrM	1949	1950	0.0	0.0
+chrM	1950	1951	0.0	0.0
+chrM	1951	1952	0.0	0.0
+chrM	1952	1953	0.0	0.0
+chrM	1953	1954	0.0	0.0
+chrM	1954	1955	0.0	0.0
+chrM	1955	1956	0.0	0.0
+chrM	1956	1957	0.0	0.0
+chrM	1957	1958	0.0	0.0
+chrM	1958	1959	0.0	0.0
+chrM	1959	1960	0.0	0.0
+chrM	1960	1961	0.0	0.0
+chrM	1961	1962	0.0	0.0
+chrM	1962	1963	0.0	0.0
+chrM	1963	1964	0.0	0.0
+chrM	1964	1965	0.0	0.0
+chrM	1965	1966	0.0	0.0
+chrM	1966	1967	0.0	0.0
+chrM	1967	1968	0.0	0.0
+chrM	1968	1969	0.0	0.0
+chrM	1969	1970	0.0	0.0
+chrM	1970	1971	0.0	0.0
+chrM	1971	1972	0.0	0.0
+chrM	1972	1973	0.0	0.0
+chrM	1973	1974	0.0	0.0
+chrM	1974	1975	0.0	0.0
+chrM	1975	1976	0.0	0.0
+chrM	1976	1977	0.0	0.0
+chrM	1977	1978	0.0	0.0
+chrM	1978	1979	0.0	0.0
+chrM	1979	1980	0.0	0.0
+chrM	1980	1981	0.0	0.0
+chrM	1981	1982	0.0	0.0
+chrM	1982	1983	0.0	0.0
+chrM	1983	1984	0.0	0.0
+chrM	1984	1985	0.0	0.0
+chrM	1985	1986	0.0	0.0
+chrM	1986	1987	0.0	0.0
+chrM	1987	1988	0.0	0.0
+chrM	1988	1989	0.0	0.0
+chrM	1989	1990	0.0	0.0
+chrM	1990	1991	0.0	0.0
+chrM	1991	1992	0.0	0.0
+chrM	1992	1993	0.0	0.0
+chrM	1993	1994	0.0	0.0
+chrM	1994	1995	0.0	0.0
+chrM	1995	1996	0.0	0.0
+chrM	1996	1997	0.0	0.0
+chrM	1997	1998	0.0	0.0
+chrM	1998	1999	0.0	0.0
+chrM	1999	2000	0.0	0.0
+chrM	2000	2001	0.0	0.0
+chrM	2001	2002	0.0	0.0
+chrM	2002	2003	0.0	0.0
+chrM	2003	2004	0.0	0.0
+chrM	2004	2005	0.0	0.0
+chrM	2005	2006	0.0	0.0
+chrM	2006	2007	0.0	0.0
+chrM	2007	2008	0.0	0.0
+chrM	2008	2009	0.0	0.0
+chrM	2009	2010	0.0	0.0
+chrM	2010	2011	0.0	0.0
+chrM	2011	2012	0.0	0.0
+chrM	2012	2013	0.0	0.0
+chrM	2013	2014	0.0	0.0
+chrM	2014	2015	0.0	0.0
+chrM	2015	2016	0.0	0.0
+chrM	2016	2017	0.0	0.0
+chrM	2017	2018	0.0	0.0
+chrM	2018	2019	0.0	0.0
+chrM	2019	2020	0.0	0.0
+chrM	2020	2021	0.0	0.0
+chrM	2021	2022	0.0	0.0
+chrM	2022	2023	0.0	0.0
+chrM	2023	2024	0.0	0.0
+chrM	2024	2025	0.0	0.0
+chrM	2025	2026	0.0	0.0
+chrM	2026	2027	0.0	0.0
+chrM	2027	2028	0.0	0.0
+chrM	2028	2029	0.0	0.0
+chrM	2029	2030	0.0	0.0
+chrM	2030	2031	0.0	0.0
+chrM	2031	2032	0.0	0.0
+chrM	2032	2033	0.0	0.0
+chrM	2033	2034	0.0	0.0
+chrM	2034	2035	0.0	0.0
+chrM	2035	2036	0.0	0.0
+chrM	2036	2037	0.0	0.0
+chrM	2037	2038	0.0	0.0
+chrM	2038	2039	0.0	0.0
+chrM	2039	2040	0.0	0.0
+chrM	2040	2041	0.0	0.0
+chrM	2041	2042	0.0	0.0
+chrM	2042	2043	0.0	0.0
+chrM	2043	2044	0.0	0.0
+chrM	2044	2045	0.0	0.0
+chrM	2045	2046	0.0	0.0
+chrM	2046	2047	0.0	0.0
+chrM	2047	2048	0.0	0.0
+chrM	2048	2049	0.0	0.0
+chrM	2049	2050	0.0	0.0
+chrM	2050	2051	0.0	0.0
+chrM	2051	2052	0.0	0.0
+chrM	2052	2053	0.0	0.0
+chrM	2053	2054	0.0	0.0
+chrM	2054	2055	0.0	0.0
+chrM	2055	2056	0.0	0.0
+chrM	2056	2057	0.0	0.0
+chrM	2057	2058	0.0	0.0
+chrM	2058	2059	0.0	0.0
+chrM	2059	2060	0.0	0.0
+chrM	2060	2061	0.0	0.0
+chrM	2061	2062	0.0	0.0
+chrM	2062	2063	0.0	0.0
+chrM	2063	2064	0.0	0.0
+chrM	2064	2065	0.0	0.0
+chrM	2065	2066	0.0	0.0
+chrM	2066	2067	0.0	0.0
+chrM	2067	2068	0.0	0.0
+chrM	2068	2069	0.0	0.0
+chrM	2069	2070	0.0	0.0
+chrM	2070	2071	0.0	0.0
+chrM	2071	2072	0.0	0.0
+chrM	2072	2073	0.0	0.0
+chrM	2073	2074	0.0	0.0
+chrM	2074	2075	0.0	0.0
+chrM	2075	2076	0.0	0.0
+chrM	2076	2077	0.0	0.0
+chrM	2077	2078	0.0	0.0
+chrM	2078	2079	0.0	0.0
+chrM	2079	2080	0.0	0.0
+chrM	2080	2081	0.0	0.0
+chrM	2081	2082	0.0	0.0
+chrM	2082	2083	0.0	0.0
+chrM	2083	2084	0.0	0.0
+chrM	2084	2085	0.0	0.0
+chrM	2085	2086	0.0	0.0
+chrM	2086	2087	0.0	0.0
+chrM	2087	2088	0.0	0.0
+chrM	2088	2089	0.0	0.0
+chrM	2089	2090	0.0	0.0
+chrM	2090	2091	0.0	0.0
+chrM	2091	2092	0.0	0.0
+chrM	2092	2093	0.0	0.0
+chrM	2093	2094	0.0	0.0
+chrM	2094	2095	0.0	0.0
+chrM	2095	2096	0.0	0.0
+chrM	2096	2097	0.0	0.0
+chrM	2097	2098	0.0	0.0
+chrM	2098	2099	0.0	0.0
+chrM	2099	2100	0.0	0.0
+chrM	2100	2101	0.0	0.0
+chrM	2101	2102	0.0	0.0
+chrM	2102	2103	0.0	0.0
+chrM	2103	2104	0.0	0.0
+chrM	2104	2105	0.0	0.0
+chrM	2105	2106	0.0	0.0
+chrM	2106	2107	0.0	0.0
+chrM	2107	2108	0.0	0.0
+chrM	2108	2109	0.0	0.0
+chrM	2109	2110	0.0	0.0
+chrM	2110	2111	0.0	0.0
+chrM	2111	2112	0.0	0.0
+chrM	2112	2113	0.0	0.0
+chrM	2113	2114	0.0	0.0
+chrM	2114	2115	0.0	0.0
+chrM	2115	2116	0.0	0.0
+chrM	2116	2117	0.0	0.0
+chrM	2117	2118	0.0	0.0
+chrM	2118	2119	0.0	0.0
+chrM	2119	2120	0.0	0.0
+chrM	2120	2121	0.0	0.0
+chrM	2121	2122	0.0	0.0
+chrM	2122	2123	0.0	0.0
+chrM	2123	2124	0.0	0.0
+chrM	2124	2125	0.0	0.0
+chrM	2125	2126	0.0	0.0
+chrM	2126	2127	0.0	0.0
+chrM	2127	2128	0.0	0.0
+chrM	2128	2129	0.0	0.0
+chrM	2129	2130	0.0	0.0
+chrM	2130	2131	0.0	0.0
+chrM	2131	2132	0.0	0.0
+chrM	2132	2133	0.0	0.0
+chrM	2133	2134	0.0	0.0
+chrM	2134	2135	0.0	0.0
+chrM	2135	2136	0.0	0.0
+chrM	2136	2137	0.0	0.0
+chrM	2137	2138	0.0	0.0
+chrM	2138	2139	0.0	0.0
+chrM	2139	2140	0.0	0.0
+chrM	2140	2141	0.0	0.0
+chrM	2141	2142	0.0	0.0
+chrM	2142	2143	0.0	0.0
+chrM	2143	2144	0.0	0.0
+chrM	2144	2145	0.0	0.0
+chrM	2145	2146	0.0	0.0
+chrM	2146	2147	0.0	0.0
+chrM	2147	2148	0.0	0.0
+chrM	2148	2149	0.0	0.0
+chrM	2149	2150	0.0	0.0
+chrM	2150	2151	0.0	0.0
+chrM	2151	2152	0.0	0.0
+chrM	2152	2153	0.0	0.0
+chrM	2153	2154	0.0	0.0
+chrM	2154	2155	0.0	0.0
+chrM	2155	2156	0.0	0.0
+chrM	2156	2157	0.0	0.0
+chrM	2157	2158	0.0	0.0
+chrM	2158	2159	0.0	0.0
+chrM	2159	2160	0.0	0.0
+chrM	2160	2161	0.0	0.0
+chrM	2161	2162	0.0	0.0
+chrM	2162	2163	0.0	0.0
+chrM	2163	2164	0.0	0.0
+chrM	2164	2165	0.0	0.0
+chrM	2165	2166	0.0	0.0
+chrM	2166	2167	0.0	0.0
+chrM	2167	2168	0.0	0.0
+chrM	2168	2169	0.0	0.0
+chrM	2169	2170	0.0	0.0
+chrM	2170	2171	0.0	0.0
+chrM	2171	2172	0.0	0.0
+chrM	2172	2173	0.0	0.0
+chrM	2173	2174	0.0	0.0
+chrM	2174	2175	0.0	0.0
+chrM	2175	2176	0.0	0.0
+chrM	2176	2177	0.0	0.0
+chrM	2177	2178	0.0	0.0
+chrM	2178	2179	0.0	0.0
+chrM	2179	2180	0.0	0.0
+chrM	2180	2181	0.0	0.0
+chrM	2181	2182	0.0	0.0
+chrM	2182	2183	0.0	0.0
+chrM	2183	2184	0.0	0.0
+chrM	2184	2185	0.0	0.0
+chrM	2185	2186	0.0	0.0
+chrM	2186	2187	0.0	0.0
+chrM	2187	2188	0.0	0.0
+chrM	2188	2189	0.0	0.0
+chrM	2189	2190	0.0	0.0
+chrM	2190	2191	0.0	0.0
+chrM	2191	2192	0.0	0.0
+chrM	2192	2193	0.0	0.0
+chrM	2193	2194	0.0	0.0
+chrM	2194	2195	0.0	0.0
+chrM	2195	2196	0.0	0.0
+chrM	2196	2197	0.0	0.0
+chrM	2197	2198	0.0	0.0
+chrM	2198	2199	0.0	0.0
+chrM	2199	2200	0.0	0.0
+chrM	2200	2201	0.0	0.0
+chrM	2201	2202	0.0	0.0
+chrM	2202	2203	0.0	0.0
+chrM	2203	2204	0.0	0.0
+chrM	2204	2205	0.0	0.0
+chrM	2205	2206	0.0	0.0
+chrM	2206	2207	0.0	0.0
+chrM	2207	2208	0.0	0.0
+chrM	2208	2209	0.0	0.0
+chrM	2209	2210	0.0	0.0
+chrM	2210	2211	0.0	0.0
+chrM	2211	2212	0.0	0.0
+chrM	2212	2213	0.0	0.0
+chrM	2213	2214	0.0	0.0
+chrM	2214	2215	0.0	0.0
+chrM	2215	2216	0.0	0.0
+chrM	2216	2217	0.0	0.0
+chrM	2217	2218	0.0	0.0
+chrM	2218	2219	0.0	0.0
+chrM	2219	2220	0.0	0.0
+chrM	2220	2221	0.0	0.0
+chrM	2221	2222	0.0	0.0
+chrM	2222	2223	0.0	0.0
+chrM	2223	2224	0.0	0.0
+chrM	2224	2225	0.0	0.0
+chrM	2225	2226	0.0	0.0
+chrM	2226	2227	0.0	0.0
+chrM	2227	2228	0.0	0.0
+chrM	2228	2229	0.0	0.0
+chrM	2229	2230	0.0	0.0
+chrM	2230	2231	0.0	0.0
+chrM	2231	2232	0.0	0.0
+chrM	2232	2233	0.0	0.0
+chrM	2233	2234	0.0	0.0
+chrM	2234	2235	0.0	0.0
+chrM	2235	2236	0.0	0.0
+chrM	2236	2237	0.0	0.0
+chrM	2237	2238	0.0	0.0
+chrM	2238	2239	0.0	0.0
+chrM	2239	2240	0.0	0.0
+chrM	2240	2241	0.0	0.0
+chrM	2241	2242	0.0	0.0
+chrM	2242	2243	0.0	0.0
+chrM	2243	2244	0.0	0.0
+chrM	2244	2245	0.0	0.0
+chrM	2245	2246	0.0	0.0
+chrM	2246	2247	0.0	0.0
+chrM	2247	2248	0.0	0.0
+chrM	2248	2249	0.0	0.0
+chrM	2249	2250	0.0	0.0
+chrM	2250	2251	0.0	0.0
+chrM	2251	2252	0.0	0.0
+chrM	2252	2253	0.0	0.0
+chrM	2253	2254	0.0	0.0
+chrM	2254	2255	0.0	0.0
+chrM	2255	2256	0.0	0.0
+chrM	2256	2257	0.0	0.0
+chrM	2257	2258	0.0	0.0
+chrM	2258	2259	0.0	0.0
+chrM	2259	2260	0.0	0.0
+chrM	2260	2261	0.0	0.0
+chrM	2261	2262	0.0	0.0
+chrM	2262	2263	0.0	0.0
+chrM	2263	2264	0.0	0.0
+chrM	2264	2265	0.0	0.0
+chrM	2265	2266	0.0	0.0
+chrM	2266	2267	0.0	0.0
+chrM	2267	2268	0.0	0.0
+chrM	2268	2269	0.0	0.0
+chrM	2269	2270	0.0	0.0
+chrM	2270	2271	0.0	0.0
+chrM	2271	2272	0.0	0.0
+chrM	2272	2273	0.0	0.0
+chrM	2273	2274	0.0	0.0
+chrM	2274	2275	0.0	0.0
+chrM	2275	2276	0.0	0.0
+chrM	2276	2277	0.0	0.0
+chrM	2277	2278	0.0	0.0
+chrM	2278	2279	0.0	0.0
+chrM	2279	2280	0.0	0.0
+chrM	2280	2281	0.0	0.0
+chrM	2281	2282	0.0	0.0
+chrM	2282	2283	0.0	0.0
+chrM	2283	2284	0.0	0.0
+chrM	2284	2285	0.0	0.0
+chrM	2285	2286	0.0	0.0
+chrM	2286	2287	0.0	0.0
+chrM	2287	2288	0.0	0.0
+chrM	2288	2289	0.0	0.0
+chrM	2289	2290	0.0	0.0
+chrM	2290	2291	0.0	0.0
+chrM	2291	2292	0.0	0.0
+chrM	2292	2293	0.0	0.0
+chrM	2293	2294	0.0	0.0
+chrM	2294	2295	0.0	0.0
+chrM	2295	2296	0.0	0.0
+chrM	2296	2297	0.0	0.0
+chrM	2297	2298	0.0	0.0
+chrM	2298	2299	0.0	0.0
+chrM	2299	2300	0.0	0.0
+chrM	2300	2301	0.0	0.0
+chrM	2301	2302	0.0	0.0
+chrM	2302	2303	0.0	0.0
+chrM	2303	2304	0.0	0.0
+chrM	2304	2305	0.0	0.0
+chrM	2305	2306	0.0	0.0
+chrM	2306	2307	0.0	0.0
+chrM	2307	2308	0.0	0.0
+chrM	2308	2309	0.0	0.0
+chrM	2309	2310	0.0	0.0
+chrM	2310	2311	0.0	0.0
+chrM	2311	2312	0.0	0.0
+chrM	2312	2313	0.0	0.0
+chrM	2313	2314	0.0	0.0
+chrM	2314	2315	0.0	0.0
+chrM	2315	2316	0.0	0.0
+chrM	2316	2317	0.0	0.0
+chrM	2317	2318	0.0	0.0
+chrM	2318	2319	0.0	0.0
+chrM	2319	2320	0.0	0.0
+chrM	2320	2321	0.0	0.0
+chrM	2321	2322	0.0	0.0
+chrM	2322	2323	0.0	0.0
+chrM	2323	2324	0.0	0.0
+chrM	2324	2325	0.0	0.0
+chrM	2325	2326	0.0	0.0
+chrM	2326	2327	0.0	0.0
+chrM	2327	2328	0.0	0.0
+chrM	2328	2329	0.0	0.0
+chrM	2329	2330	0.0	0.0
+chrM	2330	2331	0.0	0.0
+chrM	2331	2332	0.0	0.0
+chrM	2332	2333	0.0	0.0
+chrM	2333	2334	0.0	0.0
+chrM	2334	2335	0.0	0.0
+chrM	2335	2336	0.0	0.0
+chrM	2336	2337	0.0	0.0
+chrM	2337	2338	0.0	0.0
+chrM	2338	2339	0.0	0.0
+chrM	2339	2340	0.0	0.0
+chrM	2340	2341	0.0	0.0
+chrM	2341	2342	0.0	0.0
+chrM	2342	2343	0.0	0.0
+chrM	2343	2344	0.0	0.0
+chrM	2344	2345	0.0	0.0
+chrM	2345	2346	0.0	0.0
+chrM	2346	2347	0.0	0.0
+chrM	2347	2348	0.0	0.0
+chrM	2348	2349	0.0	0.0
+chrM	2349	2350	0.0	0.0
+chrM	2350	2351	0.0	0.0
+chrM	2351	2352	0.0	0.0
+chrM	2352	2353	0.0	0.0
+chrM	2353	2354	0.0	0.0
+chrM	2354	2355	0.0	0.0
+chrM	2355	2356	0.0	0.0
+chrM	2356	2357	0.0	0.0
+chrM	2357	2358	0.0	0.0
+chrM	2358	2359	0.0	0.0
+chrM	2359	2360	0.0	0.0
+chrM	2360	2361	0.0	0.0
+chrM	2361	2362	0.0	0.0
+chrM	2362	2363	0.0	0.0
+chrM	2363	2364	0.0	0.0
+chrM	2364	2365	0.0	0.0
+chrM	2365	2366	0.0	0.0
+chrM	2366	2367	0.0	0.0
+chrM	2367	2368	0.0	0.0
+chrM	2368	2369	0.0	0.0
+chrM	2369	2370	0.0	0.0
+chrM	2370	2371	0.0	0.0
+chrM	2371	2372	0.0	0.0
+chrM	2372	2373	0.0	0.0
+chrM	2373	2374	0.0	0.0
+chrM	2374	2375	0.0	0.0
+chrM	2375	2376	0.0	0.0
+chrM	2376	2377	0.0	0.0
+chrM	2377	2378	0.0	0.0
+chrM	2378	2379	0.0	0.0
+chrM	2379	2380	0.0	0.0
+chrM	2380	2381	0.0	0.0
+chrM	2381	2382	0.0	0.0
+chrM	2382	2383	0.0	0.0
+chrM	2383	2384	0.0	0.0
+chrM	2384	2385	0.0	0.0
+chrM	2385	2386	0.0	0.0
+chrM	2386	2387	0.0	0.0
+chrM	2387	2388	0.0	0.0
+chrM	2388	2389	0.0	0.0
+chrM	2389	2390	0.0	0.0
+chrM	2390	2391	0.0	0.0
+chrM	2391	2392	0.0	0.0
+chrM	2392	2393	0.0	0.0
+chrM	2393	2394	0.0	0.0
+chrM	2394	2395	0.0	0.0
+chrM	2395	2396	0.0	0.0
+chrM	2396	2397	0.0	0.0
+chrM	2397	2398	0.0	0.0
+chrM	2398	2399	0.0	0.0
+chrM	2399	2400	0.0	0.0
+chrM	2400	2401	0.0	0.0
+chrM	2401	2402	0.0	0.0
+chrM	2402	2403	0.0	0.0
+chrM	2403	2404	0.0	0.0
+chrM	2404	2405	0.0	0.0
+chrM	2405	2406	0.0	0.0
+chrM	2406	2407	0.0	0.0
+chrM	2407	2408	0.0	0.0
+chrM	2408	2409	0.0	0.0
+chrM	2409	2410	0.0	0.0
+chrM	2410	2411	0.0	0.0
+chrM	2411	2412	0.0	0.0
+chrM	2412	2413	0.0	0.0
+chrM	2413	2414	0.0	0.0
+chrM	2414	2415	0.0	0.0
+chrM	2415	2416	0.0	0.0
+chrM	2416	2417	0.0	0.0
+chrM	2417	2418	0.0	0.0
+chrM	2418	2419	0.0	0.0
+chrM	2419	2420	0.0	0.0
+chrM	2420	2421	0.0	0.0
+chrM	2421	2422	0.0	0.0
+chrM	2422	2423	0.0	0.0
+chrM	2423	2424	0.0	0.0
+chrM	2424	2425	0.0	0.0
+chrM	2425	2426	0.0	0.0
+chrM	2426	2427	0.0	0.0
+chrM	2427	2428	0.0	0.0
+chrM	2428	2429	0.0	0.0
+chrM	2429	2430	0.0	0.0
+chrM	2430	2431	0.0	0.0
+chrM	2431	2432	0.0	0.0
+chrM	2432	2433	0.0	0.0
+chrM	2433	2434	0.0	0.0
+chrM	2434	2435	0.0	0.0
+chrM	2435	2436	0.0	0.0
+chrM	2436	2437	0.0	0.0
+chrM	2437	2438	0.0	0.0
+chrM	2438	2439	0.0	0.0
+chrM	2439	2440	0.0	0.0
+chrM	2440	2441	0.0	0.0
+chrM	2441	2442	0.0	0.0
+chrM	2442	2443	0.0	0.0
+chrM	2443	2444	0.0	0.0
+chrM	2444	2445	0.0	0.0
+chrM	2445	2446	0.0	0.0
+chrM	2446	2447	0.0	0.0
+chrM	2447	2448	0.0	0.0
+chrM	2448	2449	0.0	0.0
+chrM	2449	2450	0.0	0.0
+chrM	2450	2451	0.0	0.0
+chrM	2451	2452	0.0	0.0
+chrM	2452	2453	0.0	0.0
+chrM	2453	2454	0.0	0.0
+chrM	2454	2455	0.0	0.0
+chrM	2455	2456	0.0	0.0
+chrM	2456	2457	0.0	0.0
+chrM	2457	2458	0.0	0.0
+chrM	2458	2459	0.0	0.0
+chrM	2459	2460	0.0	0.0
+chrM	2460	2461	0.0	0.0
+chrM	2461	2462	0.0	0.0
+chrM	2462	2463	0.0	0.0
+chrM	2463	2464	0.0	0.0
+chrM	2464	2465	0.0	0.0
+chrM	2465	2466	0.0	0.0
+chrM	2466	2467	0.0	0.0
+chrM	2467	2468	0.0	0.0
+chrM	2468	2469	0.0	0.0
+chrM	2469	2470	0.0	0.0
+chrM	2470	2471	0.0	0.0
+chrM	2471	2472	0.0	0.0
+chrM	2472	2473	0.0	0.0
+chrM	2473	2474	0.0	0.0
+chrM	2474	2475	0.0	0.0
+chrM	2475	2476	0.0	0.0
+chrM	2476	2477	0.0	0.0
+chrM	2477	2478	0.0	0.0
+chrM	2478	2479	0.0	0.0
+chrM	2479	2480	0.0	0.0
+chrM	2480	2481	0.0	0.0
+chrM	2481	2482	0.0	0.0
+chrM	2482	2483	0.0	0.0
+chrM	2483	2484	0.0	0.0
+chrM	2484	2485	0.0	0.0
+chrM	2485	2486	0.0	0.0
+chrM	2486	2487	0.0	0.0
+chrM	2487	2488	0.0	0.0
+chrM	2488	2489	0.0	0.0
+chrM	2489	2490	0.0	0.0
+chrM	2490	2491	0.0	0.0
+chrM	2491	2492	0.0	0.0
+chrM	2492	2493	0.0	0.0
+chrM	2493	2494	0.0	0.0
+chrM	2494	2495	0.0	0.0
+chrM	2495	2496	0.0	0.0
+chrM	2496	2497	0.0	0.0
+chrM	2497	2498	0.0	0.0
+chrM	2498	2499	0.0	0.0
+chrM	2499	2500	0.0	0.0
+chrM	2500	2501	0.0	0.0
+chrM	2501	2502	0.0	0.0
+chrM	2502	2503	0.0	0.0
+chrM	2503	2504	0.0	0.0
+chrM	2504	2505	0.0	0.0
+chrM	2505	2506	0.0	0.0
+chrM	2506	2507	0.0	0.0
+chrM	2507	2508	0.0	0.0
+chrM	2508	2509	0.0	0.0
+chrM	2509	2510	0.0	0.0
+chrM	2510	2511	0.0	0.0
+chrM	2511	2512	0.0	0.0
+chrM	2512	2513	0.0	0.0
+chrM	2513	2514	0.0	0.0
+chrM	2514	2515	0.0	0.0
+chrM	2515	2516	0.0	0.0
+chrM	2516	2517	0.0	0.0
+chrM	2517	2518	0.0	0.0
+chrM	2518	2519	0.0	0.0
+chrM	2519	2520	0.0	0.0
+chrM	2520	2521	0.0	0.0
+chrM	2521	2522	0.0	0.0
+chrM	2522	2523	0.0	0.0
+chrM	2523	2524	0.0	0.0
+chrM	2524	2525	0.0	0.0
+chrM	2525	2526	0.0	0.0
+chrM	2526	2527	0.0	0.0
+chrM	2527	2528	0.0	0.0
+chrM	2528	2529	0.0	0.0
+chrM	2529	2530	0.0	0.0
+chrM	2530	2531	0.0	0.0
+chrM	2531	2532	0.0	0.0
+chrM	2532	2533	0.0	0.0
+chrM	2533	2534	0.0	0.0
+chrM	2534	2535	0.0	0.0
+chrM	2535	2536	0.0	0.0
+chrM	2536	2537	0.0	0.0
+chrM	2537	2538	0.0	0.0
+chrM	2538	2539	0.0	0.0
+chrM	2539	2540	0.0	0.0
+chrM	2540	2541	0.0	0.0
+chrM	2541	2542	0.0	0.0
+chrM	2542	2543	0.0	0.0
+chrM	2543	2544	0.0	0.0
+chrM	2544	2545	0.0	0.0
+chrM	2545	2546	0.0	0.0
+chrM	2546	2547	0.0	0.0
+chrM	2547	2548	0.0	0.0
+chrM	2548	2549	0.0	0.0
+chrM	2549	2550	0.0	0.0
+chrM	2550	2551	0.0	0.0
+chrM	2551	2552	0.0	0.0
+chrM	2552	2553	0.0	0.0
+chrM	2553	2554	0.0	0.0
+chrM	2554	2555	0.0	0.0
+chrM	2555	2556	0.0	0.0
+chrM	2556	2557	0.0	0.0
+chrM	2557	2558	0.0	0.0
+chrM	2558	2559	0.0	0.0
+chrM	2559	2560	0.0	0.0
+chrM	2560	2561	0.0	0.0
+chrM	2561	2562	0.0	0.0
+chrM	2562	2563	0.0	0.0
+chrM	2563	2564	0.0	0.0
+chrM	2564	2565	0.0	0.0
+chrM	2565	2566	0.0	0.0
+chrM	2566	2567	0.0	0.0
+chrM	2567	2568	0.0	0.0
+chrM	2568	2569	0.0	0.0
+chrM	2569	2570	0.0	0.0
+chrM	2570	2571	0.0	0.0
+chrM	2571	2572	0.0	0.0
+chrM	2572	2573	0.0	0.0
+chrM	2573	2574	0.0	0.0
+chrM	2574	2575	0.0	0.0
+chrM	2575	2576	0.0	0.0
+chrM	2576	2577	0.0	0.0
+chrM	2577	2578	0.0	0.0
+chrM	2578	2579	0.0	0.0
+chrM	2579	2580	0.0	0.0
+chrM	2580	2581	0.0	0.0
+chrM	2581	2582	0.0	0.0
+chrM	2582	2583	0.0	0.0
+chrM	2583	2584	0.0	0.0
+chrM	2584	2585	0.0	0.0
+chrM	2585	2586	0.0	0.0
+chrM	2586	2587	0.0	0.0
+chrM	2587	2588	0.0	0.0
+chrM	2588	2589	0.0	0.0
+chrM	2589	2590	0.0	0.0
+chrM	2590	2591	0.0	0.0
+chrM	2591	2592	0.0	0.0
+chrM	2592	2593	0.0	0.0
+chrM	2593	2594	0.0	0.0
+chrM	2594	2595	0.0	0.0
+chrM	2595	2596	0.0	0.0
+chrM	2596	2597	0.0	0.0
+chrM	2597	2598	0.0	0.0
+chrM	2598	2599	0.0	0.0
+chrM	2599	2600	0.0	0.0
+chrM	2600	2601	0.0	0.0
+chrM	2601	2602	0.0	0.0
+chrM	2602	2603	0.0	0.0
+chrM	2603	2604	0.0	0.0
+chrM	2604	2605	0.0	0.0
+chrM	2605	2606	0.0	0.0
+chrM	2606	2607	0.0	0.0
+chrM	2607	2608	0.0	0.0
+chrM	2608	2609	0.0	0.0
+chrM	2609	2610	0.0	0.0
+chrM	2610	2611	0.0	0.0
+chrM	2611	2612	0.0	0.0
+chrM	2612	2613	0.0	0.0
+chrM	2613	2614	0.0	0.0
+chrM	2614	2615	0.0	0.0
+chrM	2615	2616	0.0	0.0
+chrM	2616	2617	0.0	0.0
+chrM	2617	2618	0.0	0.0
+chrM	2618	2619	0.0	0.0
+chrM	2619	2620	0.0	0.0
+chrM	2620	2621	0.0	0.0
+chrM	2621	2622	0.0	0.0
+chrM	2622	2623	0.0	0.0
+chrM	2623	2624	0.0	0.0
+chrM	2624	2625	0.0	0.0
+chrM	2625	2626	0.0	0.0
+chrM	2626	2627	0.0	0.0
+chrM	2627	2628	0.0	0.0
+chrM	2628	2629	0.0	0.0
+chrM	2629	2630	0.0	0.0
+chrM	2630	2631	0.0	0.0
+chrM	2631	2632	0.0	0.0
+chrM	2632	2633	0.0	0.0
+chrM	2633	2634	0.0	0.0
+chrM	2634	2635	0.0	0.0
+chrM	2635	2636	0.0	0.0
+chrM	2636	2637	0.0	0.0
+chrM	2637	2638	0.0	0.0
+chrM	2638	2639	0.0	0.0
+chrM	2639	2640	0.0	0.0
+chrM	2640	2641	0.0	0.0
+chrM	2641	2642	0.0	0.0
+chrM	2642	2643	0.0	0.0
+chrM	2643	2644	0.0	0.0
+chrM	2644	2645	0.0	0.0
+chrM	2645	2646	0.0	0.0
+chrM	2646	2647	0.0	0.0
+chrM	2647	2648	0.0	0.0
+chrM	2648	2649	0.0	0.0
+chrM	2649	2650	0.0	0.0
+chrM	2650	2651	0.0	0.0
+chrM	2651	2652	0.0	0.0
+chrM	2652	2653	0.0	0.0
+chrM	2653	2654	0.0	0.0
+chrM	2654	2655	0.0	0.0
+chrM	2655	2656	0.0	0.0
+chrM	2656	2657	0.0	0.0
+chrM	2657	2658	0.0	0.0
+chrM	2658	2659	0.0	0.0
+chrM	2659	2660	0.0	0.0
+chrM	2660	2661	0.0	0.0
+chrM	2661	2662	0.0	0.0
+chrM	2662	2663	0.0	0.0
+chrM	2663	2664	0.0	0.0
+chrM	2664	2665	0.0	0.0
+chrM	2665	2666	0.0	0.0
+chrM	2666	2667	0.0	0.0
+chrM	2667	2668	0.0	0.0
+chrM	2668	2669	0.0	0.0
+chrM	2669	2670	0.0	0.0
+chrM	2670	2671	0.0	0.0
+chrM	2671	2672	0.0	0.0
+chrM	2672	2673	0.0	0.0
+chrM	2673	2674	0.0	0.0
+chrM	2674	2675	0.0	0.0
+chrM	2675	2676	0.0	0.0
+chrM	2676	2677	0.0	0.0
+chrM	2677	2678	0.0	0.0
+chrM	2678	2679	0.0	0.0
+chrM	2679	2680	0.0	0.0
+chrM	2680	2681	0.0	0.0
+chrM	2681	2682	0.0	0.0
+chrM	2682	2683	0.0	0.0
+chrM	2683	2684	0.0	0.0
+chrM	2684	2685	0.0	0.0
+chrM	2685	2686	0.0	0.0
+chrM	2686	2687	0.0	0.0
+chrM	2687	2688	0.0	0.0
+chrM	2688	2689	0.0	0.0
+chrM	2689	2690	0.0	0.0
+chrM	2690	2691	0.0	0.0
+chrM	2691	2692	0.0	0.0
+chrM	2692	2693	0.0	0.0
+chrM	2693	2694	0.0	0.0
+chrM	2694	2695	0.0	0.0
+chrM	2695	2696	0.0	0.0
+chrM	2696	2697	0.0	0.0
+chrM	2697	2698	0.0	0.0
+chrM	2698	2699	0.0	0.0
+chrM	2699	2700	0.0	0.0
+chrM	2700	2701	0.0	0.0
+chrM	2701	2702	0.0	0.0
+chrM	2702	2703	0.0	0.0
+chrM	2703	2704	0.0	0.0
+chrM	2704	2705	0.0	0.0
+chrM	2705	2706	0.0	0.0
+chrM	2706	2707	0.0	0.0
+chrM	2707	2708	0.0	0.0
+chrM	2708	2709	0.0	0.0
+chrM	2709	2710	0.0	0.0
+chrM	2710	2711	0.0	0.0
+chrM	2711	2712	0.0	0.0
+chrM	2712	2713	0.0	0.0
+chrM	2713	2714	0.0	0.0
+chrM	2714	2715	0.0	0.0
+chrM	2715	2716	0.0	0.0
+chrM	2716	2717	0.0	0.0
+chrM	2717	2718	0.0	0.0
+chrM	2718	2719	0.0	0.0
+chrM	2719	2720	0.0	0.0
+chrM	2720	2721	0.0	0.0
+chrM	2721	2722	0.0	0.0
+chrM	2722	2723	0.0	0.0
+chrM	2723	2724	0.0	0.0
+chrM	2724	2725	0.0	0.0
+chrM	2725	2726	0.0	0.0
+chrM	2726	2727	0.0	0.0
+chrM	2727	2728	0.0	0.0
+chrM	2728	2729	0.0	0.0
+chrM	2729	2730	0.0	0.0
+chrM	2730	2731	0.0	0.0
+chrM	2731	2732	0.0	0.0
+chrM	2732	2733	0.0	0.0
+chrM	2733	2734	0.0	0.0
+chrM	2734	2735	0.0	0.0
+chrM	2735	2736	0.0	0.0
+chrM	2736	2737	0.0	0.0
+chrM	2737	2738	0.0	0.0
+chrM	2738	2739	0.0	0.0
+chrM	2739	2740	0.0	0.0
+chrM	2740	2741	0.0	0.0
+chrM	2741	2742	0.0	0.0
+chrM	2742	2743	0.0	0.0
+chrM	2743	2744	0.0	0.0
+chrM	2744	2745	0.0	0.0
+chrM	2745	2746	0.0	0.0
+chrM	2746	2747	0.0	0.0
+chrM	2747	2748	0.0	0.0
+chrM	2748	2749	0.0	0.0
+chrM	2749	2750	0.0	0.0
+chrM	2750	2751	0.0	0.0
+chrM	2751	2752	0.0	0.0
+chrM	2752	2753	0.0	0.0
+chrM	2753	2754	0.0	0.0
+chrM	2754	2755	0.0	0.0
+chrM	2755	2756	0.0	0.0
+chrM	2756	2757	0.0	0.0
+chrM	2757	2758	0.0	0.0
+chrM	2758	2759	0.0	0.0
+chrM	2759	2760	0.0	0.0
+chrM	2760	2761	0.0	0.0
+chrM	2761	2762	0.0	0.0
+chrM	2762	2763	0.0	0.0
+chrM	2763	2764	0.0	0.0
+chrM	2764	2765	0.0	0.0
+chrM	2765	2766	0.0	0.0
+chrM	2766	2767	0.0	0.0
+chrM	2767	2768	0.0	0.0
+chrM	2768	2769	0.0	0.0
+chrM	2769	2770	0.0	0.0
+chrM	2770	2771	0.0	0.0
+chrM	2771	2772	0.0	0.0
+chrM	2772	2773	0.0	0.0
+chrM	2773	2774	0.0	0.0
+chrM	2774	2775	0.0	0.0
+chrM	2775	2776	0.0	0.0
+chrM	2776	2777	0.0	0.0
+chrM	2777	2778	0.0	0.0
+chrM	2778	2779	0.0	0.0
+chrM	2779	2780	0.0	0.0
+chrM	2780	2781	0.0	0.0
+chrM	2781	2782	0.0	0.0
+chrM	2782	2783	0.0	0.0
+chrM	2783	2784	0.0	0.0
+chrM	2784	2785	0.0	0.0
+chrM	2785	2786	0.0	0.0
+chrM	2786	2787	0.0	0.0
+chrM	2787	2788	0.0	0.0
+chrM	2788	2789	0.0	0.0
+chrM	2789	2790	0.0	0.0
+chrM	2790	2791	0.0	0.0
+chrM	2791	2792	0.0	0.0
+chrM	2792	2793	0.0	0.0
+chrM	2793	2794	0.0	0.0
+chrM	2794	2795	0.0	0.0
+chrM	2795	2796	0.0	0.0
+chrM	2796	2797	0.0	0.0
+chrM	2797	2798	0.0	0.0
+chrM	2798	2799	0.0	0.0
+chrM	2799	2800	0.0	0.0
+chrM	2800	2801	0.0	0.0
+chrM	2801	2802	0.0	0.0
+chrM	2802	2803	0.0	0.0
+chrM	2803	2804	0.0	0.0
+chrM	2804	2805	0.0	0.0
+chrM	2805	2806	0.0	0.0
+chrM	2806	2807	0.0	0.0
+chrM	2807	2808	0.0	0.0
+chrM	2808	2809	0.0	0.0
+chrM	2809	2810	0.0	0.0
+chrM	2810	2811	0.0	0.0
+chrM	2811	2812	0.0	0.0
+chrM	2812	2813	0.0	0.0
+chrM	2813	2814	0.0	0.0
+chrM	2814	2815	0.0	0.0
+chrM	2815	2816	0.0	0.0
+chrM	2816	2817	0.0	0.0
+chrM	2817	2818	0.0	0.0
+chrM	2818	2819	0.0	0.0
+chrM	2819	2820	0.0	0.0
+chrM	2820	2821	0.0	0.0
+chrM	2821	2822	0.0	0.0
+chrM	2822	2823	0.0	0.0
+chrM	2823	2824	0.0	0.0
+chrM	2824	2825	0.0	0.0
+chrM	2825	2826	0.0	0.0
+chrM	2826	2827	0.0	0.0
+chrM	2827	2828	0.0	0.0
+chrM	2828	2829	0.0	0.0
+chrM	2829	2830	0.0	0.0
+chrM	2830	2831	0.0	0.0
+chrM	2831	2832	0.0	0.0
+chrM	2832	2833	0.0	0.0
+chrM	2833	2834	0.0	0.0
+chrM	2834	2835	0.0	0.0
+chrM	2835	2836	0.0	0.0
+chrM	2836	2837	0.0	0.0
+chrM	2837	2838	0.0	0.0
+chrM	2838	2839	0.0	0.0
+chrM	2839	2840	0.0	0.0
+chrM	2840	2841	0.0	0.0
+chrM	2841	2842	0.0	0.0
+chrM	2842	2843	0.0	0.0
+chrM	2843	2844	0.0	0.0
+chrM	2844	2845	0.0	0.0
+chrM	2845	2846	0.0	0.0
+chrM	2846	2847	0.0	0.0
+chrM	2847	2848	0.0	0.0
+chrM	2848	2849	0.0	0.0
+chrM	2849	2850	0.0	0.0
+chrM	2850	2851	0.0	0.0
+chrM	2851	2852	0.0	0.0
+chrM	2852	2853	0.0	0.0
+chrM	2853	2854	0.0	0.0
+chrM	2854	2855	0.0	0.0
+chrM	2855	2856	0.0	0.0
+chrM	2856	2857	0.0	0.0
+chrM	2857	2858	0.0	0.0
+chrM	2858	2859	0.0	0.0
+chrM	2859	2860	0.0	0.0
+chrM	2860	2861	0.0	0.0
+chrM	2861	2862	0.0	0.0
+chrM	2862	2863	0.0	0.0
+chrM	2863	2864	0.0	0.0
+chrM	2864	2865	0.0	0.0
+chrM	2865	2866	0.0	0.0
+chrM	2866	2867	0.0	0.0
+chrM	2867	2868	0.0	0.0
+chrM	2868	2869	0.0	0.0
+chrM	2869	2870	0.0	0.0
+chrM	2870	2871	0.0	0.0
+chrM	2871	2872	0.0	0.0
+chrM	2872	2873	0.0	0.0
+chrM	2873	2874	0.0	0.0
+chrM	2874	2875	0.0	0.0
+chrM	2875	2876	0.0	0.0
+chrM	2876	2877	0.0	0.0
+chrM	2877	2878	0.0	0.0
+chrM	2878	2879	0.0	0.0
+chrM	2879	2880	0.0	0.0
+chrM	2880	2881	0.0	0.0
+chrM	2881	2882	0.0	0.0
+chrM	2882	2883	0.0	0.0
+chrM	2883	2884	0.0	0.0
+chrM	2884	2885	0.0	0.0
+chrM	2885	2886	0.0	0.0
+chrM	2886	2887	0.0	0.0
+chrM	2887	2888	0.0	0.0
+chrM	2888	2889	0.0	0.0
+chrM	2889	2890	0.0	0.0
+chrM	2890	2891	0.0	0.0
+chrM	2891	2892	0.0	0.0
+chrM	2892	2893	0.0	0.0
+chrM	2893	2894	0.0	0.0
+chrM	2894	2895	0.0	0.0
+chrM	2895	2896	0.0	0.0
+chrM	2896	2897	0.0	0.0
+chrM	2897	2898	0.0	0.0
+chrM	2898	2899	0.0	0.0
+chrM	2899	2900	0.0	0.0
+chrM	2900	2901	0.0	0.0
+chrM	2901	2902	0.0	0.0
+chrM	2902	2903	0.0	0.0
+chrM	2903	2904	0.0	0.0
+chrM	2904	2905	0.0	0.0
+chrM	2905	2906	0.0	0.0
+chrM	2906	2907	0.0	0.0
+chrM	2907	2908	0.0	0.0
+chrM	2908	2909	0.0	0.0
+chrM	2909	2910	0.0	0.0
+chrM	2910	2911	0.0	0.0
+chrM	2911	2912	0.0	0.0
+chrM	2912	2913	0.0	0.0
+chrM	2913	2914	0.0	0.0
+chrM	2914	2915	0.0	0.0
+chrM	2915	2916	0.0	0.0
+chrM	2916	2917	0.0	0.0
+chrM	2917	2918	0.0	0.0
+chrM	2918	2919	0.0	0.0
+chrM	2919	2920	0.0	0.0
+chrM	2920	2921	0.0	0.0
+chrM	2921	2922	0.0	0.0
+chrM	2922	2923	0.0	0.0
+chrM	2923	2924	0.0	0.0
+chrM	2924	2925	0.0	0.0
+chrM	2925	2926	0.0	0.0
+chrM	2926	2927	0.0	0.0
+chrM	2927	2928	0.0	0.0
+chrM	2928	2929	0.0	0.0
+chrM	2929	2930	0.0	0.0
+chrM	2930	2931	0.0	0.0
+chrM	2931	2932	0.0	0.0
+chrM	2932	2933	0.0	0.0
+chrM	2933	2934	0.0	0.0
+chrM	2934	2935	0.0	0.0
+chrM	2935	2936	0.0	0.0
+chrM	2936	2937	0.0	0.0
+chrM	2937	2938	0.0	0.0
+chrM	2938	2939	0.0	0.0
+chrM	2939	2940	0.0	0.0
+chrM	2940	2941	0.0	0.0
+chrM	2941	2942	0.0	0.0
+chrM	2942	2943	0.0	0.0
+chrM	2943	2944	0.0	0.0
+chrM	2944	2945	0.0	0.0
+chrM	2945	2946	0.0	0.0
+chrM	2946	2947	0.0	0.0
+chrM	2947	2948	0.0	0.0
+chrM	2948	2949	0.0	0.0
+chrM	2949	2950	0.0	0.0
+chrM	2950	2951	0.0	0.0
+chrM	2951	2952	0.0	0.0
+chrM	2952	2953	0.0	0.0
+chrM	2953	2954	0.0	0.0
+chrM	2954	2955	0.0	0.0
+chrM	2955	2956	0.0	0.0
+chrM	2956	2957	0.0	0.0
+chrM	2957	2958	0.0	0.0
+chrM	2958	2959	0.0	0.0
+chrM	2959	2960	0.0	0.0
+chrM	2960	2961	0.0	0.0
+chrM	2961	2962	0.0	0.0
+chrM	2962	2963	0.0	0.0
+chrM	2963	2964	0.0	0.0
+chrM	2964	2965	0.0	0.0
+chrM	2965	2966	0.0	0.0
+chrM	2966	2967	0.0	0.0
+chrM	2967	2968	0.0	0.0
+chrM	2968	2969	0.0	0.0
+chrM	2969	2970	0.0	0.0
+chrM	2970	2971	0.0	0.0
+chrM	2971	2972	0.0	0.0
+chrM	2972	2973	0.0	0.0
+chrM	2973	2974	0.0	0.0
+chrM	2974	2975	0.0	0.0
+chrM	2975	2976	0.0	0.0
+chrM	2976	2977	0.0	0.0
+chrM	2977	2978	0.0	0.0
+chrM	2978	2979	0.0	0.0
+chrM	2979	2980	0.0	0.0
+chrM	2980	2981	0.0	0.0
+chrM	2981	2982	0.0	0.0
+chrM	2982	2983	0.0	0.0
+chrM	2983	2984	0.0	0.0
+chrM	2984	2985	0.0	0.0
+chrM	2985	2986	0.0	0.0
+chrM	2986	2987	0.0	0.0
+chrM	2987	2988	0.0	0.0
+chrM	2988	2989	0.0	0.0
+chrM	2989	2990	0.0	0.0
+chrM	2990	2991	0.0	0.0
+chrM	2991	2992	0.0	0.0
+chrM	2992	2993	0.0	0.0
+chrM	2993	2994	0.0	0.0
+chrM	2994	2995	0.0	0.0
+chrM	2995	2996	0.0	0.0
+chrM	2996	2997	0.0	0.0
+chrM	2997	2998	0.0	0.0
+chrM	2998	2999	0.0	0.0
+chrM	2999	3000	0.0	0.0
+chrM	3000	3001	0.0	0.0
+chrM	3001	3002	0.0	0.0
+chrM	3002	3003	0.0	0.0
+chrM	3003	3004	0.0	0.0
+chrM	3004	3005	0.0	0.0
+chrM	3005	3006	0.0	0.0
+chrM	3006	3007	0.0	0.0
+chrM	3007	3008	0.0	0.0
+chrM	3008	3009	0.0	0.0
+chrM	3009	3010	0.0	0.0
+chrM	3010	3011	0.0	0.0
+chrM	3011	3012	0.0	0.0
+chrM	3012	3013	0.0	0.0
+chrM	3013	3014	0.0	0.0
+chrM	3014	3015	0.0	0.0
+chrM	3015	3016	0.0	0.0
+chrM	3016	3017	0.0	0.0
+chrM	3017	3018	0.0	0.0
+chrM	3018	3019	0.0	0.0
+chrM	3019	3020	0.0	0.0
+chrM	3020	3021	0.0	0.0
+chrM	3021	3022	0.0	0.0
+chrM	3022	3023	0.0	0.0
+chrM	3023	3024	0.0	0.0
+chrM	3024	3025	0.0	0.0
+chrM	3025	3026	0.0	0.0
+chrM	3026	3027	0.0	0.0
+chrM	3027	3028	0.0	0.0
+chrM	3028	3029	0.0	0.0
+chrM	3029	3030	0.0	0.0
+chrM	3030	3031	0.0	0.0
+chrM	3031	3032	0.0	0.0
+chrM	3032	3033	0.0	0.0
+chrM	3033	3034	0.0	0.0
+chrM	3034	3035	0.0	0.0
+chrM	3035	3036	0.0	0.0
+chrM	3036	3037	0.0	0.0
+chrM	3037	3038	0.0	0.0
+chrM	3038	3039	0.0	0.0
+chrM	3039	3040	0.0	0.0
+chrM	3040	3041	0.0	0.0
+chrM	3041	3042	0.0	0.0
+chrM	3042	3043	0.0	0.0
+chrM	3043	3044	0.0	0.0
+chrM	3044	3045	0.0	0.0
+chrM	3045	3046	0.0	0.0
+chrM	3046	3047	0.0	0.0
+chrM	3047	3048	0.0	0.0
+chrM	3048	3049	0.0	0.0
+chrM	3049	3050	0.0	0.0
+chrM	3050	3051	0.0	0.0
+chrM	3051	3052	0.0	0.0
+chrM	3052	3053	0.0	0.0
+chrM	3053	3054	0.0	0.0
+chrM	3054	3055	0.0	0.0
+chrM	3055	3056	0.0	0.0
+chrM	3056	3057	0.0	0.0
+chrM	3057	3058	0.0	0.0
+chrM	3058	3059	0.0	0.0
+chrM	3059	3060	0.0	0.0
+chrM	3060	3061	0.0	0.0
+chrM	3061	3062	0.0	0.0
+chrM	3062	3063	0.0	0.0
+chrM	3063	3064	0.0	0.0
+chrM	3064	3065	0.0	0.0
+chrM	3065	3066	0.0	0.0
+chrM	3066	3067	0.0	0.0
+chrM	3067	3068	0.0	0.0
+chrM	3068	3069	0.0	0.0
+chrM	3069	3070	0.0	0.0
+chrM	3070	3071	0.0	0.0
+chrM	3071	3072	0.0	0.0
+chrM	3072	3073	0.0	0.0
+chrM	3073	3074	0.0	0.0
+chrM	3074	3075	0.0	0.0
+chrM	3075	3076	0.0	0.0
+chrM	3076	3077	0.0	0.0
+chrM	3077	3078	0.0	0.0
+chrM	3078	3079	0.0	0.0
+chrM	3079	3080	0.0	0.0
+chrM	3080	3081	0.0	0.0
+chrM	3081	3082	0.0	0.0
+chrM	3082	3083	0.0	0.0
+chrM	3083	3084	0.0	0.0
+chrM	3084	3085	0.0	0.0
+chrM	3085	3086	0.0	0.0
+chrM	3086	3087	0.0	0.0
+chrM	3087	3088	0.0	0.0
+chrM	3088	3089	0.0	0.0
+chrM	3089	3090	0.0	0.0
+chrM	3090	3091	0.0	0.0
+chrM	3091	3092	0.0	0.0
+chrM	3092	3093	0.0	0.0
+chrM	3093	3094	0.0	0.0
+chrM	3094	3095	0.0	0.0
+chrM	3095	3096	0.0	0.0
+chrM	3096	3097	0.0	0.0
+chrM	3097	3098	0.0	0.0
+chrM	3098	3099	0.0	0.0
+chrM	3099	3100	0.0	0.0
+chrM	3100	3101	0.0	0.0
+chrM	3101	3102	0.0	0.0
+chrM	3102	3103	0.0	0.0
+chrM	3103	3104	0.0	0.0
+chrM	3104	3105	0.0	0.0
+chrM	3105	3106	0.0	0.0
+chrM	3106	3107	0.0	0.0
+chrM	3107	3108	0.0	0.0
+chrM	3108	3109	0.0	0.0
+chrM	3109	3110	0.0	0.0
+chrM	3110	3111	0.0	0.0
+chrM	3111	3112	0.0	0.0
+chrM	3112	3113	0.0	0.0
+chrM	3113	3114	0.0	0.0
+chrM	3114	3115	0.0	0.0
+chrM	3115	3116	0.0	0.0
+chrM	3116	3117	0.0	0.0
+chrM	3117	3118	0.0	0.0
+chrM	3118	3119	0.0	0.0
+chrM	3119	3120	0.0	0.0
+chrM	3120	3121	0.0	0.0
+chrM	3121	3122	0.0	0.0
+chrM	3122	3123	0.0	0.0
+chrM	3123	3124	0.0	0.0
+chrM	3124	3125	0.0	0.0
+chrM	3125	3126	0.0	0.0
+chrM	3126	3127	0.0	0.0
+chrM	3127	3128	0.0	0.0
+chrM	3128	3129	0.0	0.0
+chrM	3129	3130	0.0	0.0
+chrM	3130	3131	0.0	0.0
+chrM	3131	3132	0.0	0.0
+chrM	3132	3133	0.0	0.0
+chrM	3133	3134	0.0	0.0
+chrM	3134	3135	0.0	0.0
+chrM	3135	3136	0.0	0.0
+chrM	3136	3137	0.0	0.0
+chrM	3137	3138	0.0	0.0
+chrM	3138	3139	0.0	0.0
+chrM	3139	3140	0.0	0.0
+chrM	3140	3141	0.0	0.0
+chrM	3141	3142	0.0	0.0
+chrM	3142	3143	0.0	0.0
+chrM	3143	3144	0.0	0.0
+chrM	3144	3145	0.0	0.0
+chrM	3145	3146	0.0	0.0
+chrM	3146	3147	0.0	0.0
+chrM	3147	3148	0.0	0.0
+chrM	3148	3149	0.0	0.0
+chrM	3149	3150	0.0	0.0
+chrM	3150	3151	0.0	0.0
+chrM	3151	3152	0.0	0.0
+chrM	3152	3153	0.0	0.0
+chrM	3153	3154	0.0	0.0
+chrM	3154	3155	0.0	0.0
+chrM	3155	3156	0.0	0.0
+chrM	3156	3157	0.0	0.0
+chrM	3157	3158	0.0	0.0
+chrM	3158	3159	0.0	0.0
+chrM	3159	3160	0.0	0.0
+chrM	3160	3161	0.0	0.0
+chrM	3161	3162	0.0	0.0
+chrM	3162	3163	0.0	0.0
+chrM	3163	3164	0.0	0.0
+chrM	3164	3165	0.0	0.0
+chrM	3165	3166	0.0	0.0
+chrM	3166	3167	0.0	0.0
+chrM	3167	3168	0.0	0.0
+chrM	3168	3169	0.0	0.0
+chrM	3169	3170	0.0	0.0
+chrM	3170	3171	0.0	0.0
+chrM	3171	3172	0.0	0.0
+chrM	3172	3173	0.0	0.0
+chrM	3173	3174	0.0	0.0
+chrM	3174	3175	0.0	0.0
+chrM	3175	3176	0.0	0.0
+chrM	3176	3177	0.0	0.0
+chrM	3177	3178	0.0	0.0
+chrM	3178	3179	0.0	0.0
+chrM	3179	3180	0.0	0.0
+chrM	3180	3181	0.0	0.0
+chrM	3181	3182	0.0	0.0
+chrM	3182	3183	0.0	0.0
+chrM	3183	3184	0.0	0.0
+chrM	3184	3185	0.0	0.0
+chrM	3185	3186	0.0	0.0
+chrM	3186	3187	0.0	0.0
+chrM	3187	3188	0.0	0.0
+chrM	3188	3189	0.0	0.0
+chrM	3189	3190	0.0	0.0
+chrM	3190	3191	0.0	0.0
+chrM	3191	3192	0.0	0.0
+chrM	3192	3193	0.0	0.0
+chrM	3193	3194	0.0	0.0
+chrM	3194	3195	0.0	0.0
+chrM	3195	3196	0.0	0.0
+chrM	3196	3197	0.0	0.0
+chrM	3197	3198	0.0	0.0
+chrM	3198	3199	0.0	0.0
+chrM	3199	3200	0.0	0.0
+chrM	3200	3201	0.0	0.0
+chrM	3201	3202	0.0	0.0
+chrM	3202	3203	0.0	0.0
+chrM	3203	3204	0.0	0.0
+chrM	3204	3205	0.0	0.0
+chrM	3205	3206	0.0	0.0
+chrM	3206	3207	0.0	0.0
+chrM	3207	3208	0.0	0.0
+chrM	3208	3209	0.0	0.0
+chrM	3209	3210	0.0	0.0
+chrM	3210	3211	0.0	0.0
+chrM	3211	3212	0.0	0.0
+chrM	3212	3213	0.0	0.0
+chrM	3213	3214	0.0	0.0
+chrM	3214	3215	0.0	0.0
+chrM	3215	3216	0.0	0.0
+chrM	3216	3217	0.0	0.0
+chrM	3217	3218	0.0	0.0
+chrM	3218	3219	0.0	0.0
+chrM	3219	3220	0.0	0.0
+chrM	3220	3221	0.0	0.0
+chrM	3221	3222	0.0	0.0
+chrM	3222	3223	0.0	0.0
+chrM	3223	3224	0.0	0.0
+chrM	3224	3225	0.0	0.0
+chrM	3225	3226	0.0	0.0
+chrM	3226	3227	0.0	0.0
+chrM	3227	3228	0.0	0.0
+chrM	3228	3229	0.0	0.0
+chrM	3229	3230	0.0	0.0
+chrM	3230	3231	0.0	0.0
+chrM	3231	3232	0.0	0.0
+chrM	3232	3233	0.0	0.0
+chrM	3233	3234	0.0	0.0
+chrM	3234	3235	0.0	0.0
+chrM	3235	3236	0.0	0.0
+chrM	3236	3237	0.0	0.0
+chrM	3237	3238	0.0	0.0
+chrM	3238	3239	0.0	0.0
+chrM	3239	3240	0.0	0.0
+chrM	3240	3241	0.0	0.0
+chrM	3241	3242	0.0	0.0
+chrM	3242	3243	0.0	0.0
+chrM	3243	3244	0.0	0.0
+chrM	3244	3245	0.0	0.0
+chrM	3245	3246	0.0	0.0
+chrM	3246	3247	0.0	0.0
+chrM	3247	3248	0.0	0.0
+chrM	3248	3249	0.0	0.0
+chrM	3249	3250	0.0	0.0
+chrM	3250	3251	0.0	0.0
+chrM	3251	3252	0.0	0.0
+chrM	3252	3253	0.0	0.0
+chrM	3253	3254	0.0	0.0
+chrM	3254	3255	0.0	0.0
+chrM	3255	3256	0.0	0.0
+chrM	3256	3257	0.0	0.0
+chrM	3257	3258	0.0	0.0
+chrM	3258	3259	0.0	0.0
+chrM	3259	3260	0.0	0.0
+chrM	3260	3261	0.0	0.0
+chrM	3261	3262	0.0	0.0
+chrM	3262	3263	0.0	0.0
+chrM	3263	3264	0.0	0.0
+chrM	3264	3265	0.0	0.0
+chrM	3265	3266	0.0	0.0
+chrM	3266	3267	0.0	0.0
+chrM	3267	3268	0.0	0.0
+chrM	3268	3269	0.0	0.0
+chrM	3269	3270	0.0	0.0
+chrM	3270	3271	0.0	0.0
+chrM	3271	3272	0.0	0.0
+chrM	3272	3273	0.0	0.0
+chrM	3273	3274	0.0	0.0
+chrM	3274	3275	0.0	0.0
+chrM	3275	3276	0.0	0.0
+chrM	3276	3277	0.0	0.0
+chrM	3277	3278	0.0	0.0
+chrM	3278	3279	0.0	0.0
+chrM	3279	3280	0.0	0.0
+chrM	3280	3281	0.0	0.0
+chrM	3281	3282	0.0	0.0
+chrM	3282	3283	0.0	0.0
+chrM	3283	3284	0.0	0.0
+chrM	3284	3285	0.0	0.0
+chrM	3285	3286	0.0	0.0
+chrM	3286	3287	0.0	0.0
+chrM	3287	3288	0.0	0.0
+chrM	3288	3289	0.0	0.0
+chrM	3289	3290	0.0	0.0
+chrM	3290	3291	0.0	0.0
+chrM	3291	3292	0.0	0.0
+chrM	3292	3293	0.0	0.0
+chrM	3293	3294	0.0	0.0
+chrM	3294	3295	0.0	0.0
+chrM	3295	3296	0.0	0.0
+chrM	3296	3297	0.0	0.0
+chrM	3297	3298	0.0	0.0
+chrM	3298	3299	0.0	0.0
+chrM	3299	3300	0.0	0.0
+chrM	3300	3301	0.0	0.0
+chrM	3301	3302	0.0	0.0
+chrM	3302	3303	0.0	0.0
+chrM	3303	3304	0.0	0.0
+chrM	3304	3305	0.0	0.0
+chrM	3305	3306	0.0	0.0
+chrM	3306	3307	0.0	0.0
+chrM	3307	3308	0.0	0.0
+chrM	3308	3309	0.0	0.0
+chrM	3309	3310	0.0	0.0
+chrM	3310	3311	0.0	0.0
+chrM	3311	3312	0.0	0.0
+chrM	3312	3313	0.0	0.0
+chrM	3313	3314	0.0	0.0
+chrM	3314	3315	0.0	0.0
+chrM	3315	3316	0.0	0.0
+chrM	3316	3317	0.0	0.0
+chrM	3317	3318	0.0	0.0
+chrM	3318	3319	0.0	0.0
+chrM	3319	3320	0.0	0.0
+chrM	3320	3321	0.0	0.0
+chrM	3321	3322	0.0	0.0
+chrM	3322	3323	0.0	0.0
+chrM	3323	3324	0.0	0.0
+chrM	3324	3325	0.0	0.0
+chrM	3325	3326	0.0	0.0
+chrM	3326	3327	0.0	0.0
+chrM	3327	3328	0.0	0.0
+chrM	3328	3329	0.0	0.0
+chrM	3329	3330	0.0	0.0
+chrM	3330	3331	0.0	0.0
+chrM	3331	3332	0.0	0.0
+chrM	3332	3333	0.0	0.0
+chrM	3333	3334	0.0	0.0
+chrM	3334	3335	0.0	0.0
+chrM	3335	3336	0.0	0.0
+chrM	3336	3337	0.0	0.0
+chrM	3337	3338	0.0	0.0
+chrM	3338	3339	0.0	0.0
+chrM	3339	3340	0.0	0.0
+chrM	3340	3341	0.0	0.0
+chrM	3341	3342	0.0	0.0
+chrM	3342	3343	0.0	0.0
+chrM	3343	3344	0.0	0.0
+chrM	3344	3345	0.0	0.0
+chrM	3345	3346	0.0	0.0
+chrM	3346	3347	0.0	0.0
+chrM	3347	3348	0.0	0.0
+chrM	3348	3349	0.0	0.0
+chrM	3349	3350	0.0	0.0
+chrM	3350	3351	0.0	0.0
+chrM	3351	3352	0.0	0.0
+chrM	3352	3353	0.0	0.0
+chrM	3353	3354	0.0	0.0
+chrM	3354	3355	0.0	0.0
+chrM	3355	3356	0.0	0.0
+chrM	3356	3357	0.0	0.0
+chrM	3357	3358	0.0	0.0
+chrM	3358	3359	0.0	0.0
+chrM	3359	3360	0.0	0.0
+chrM	3360	3361	0.0	0.0
+chrM	3361	3362	0.0	0.0
+chrM	3362	3363	0.0	0.0
+chrM	3363	3364	0.0	0.0
+chrM	3364	3365	0.0	0.0
+chrM	3365	3366	0.0	0.0
+chrM	3366	3367	0.0	0.0
+chrM	3367	3368	0.0	0.0
+chrM	3368	3369	0.0	0.0
+chrM	3369	3370	0.0	0.0
+chrM	3370	3371	0.0	0.0
+chrM	3371	3372	0.0	0.0
+chrM	3372	3373	0.0	0.0
+chrM	3373	3374	0.0	0.0
+chrM	3374	3375	0.0	0.0
+chrM	3375	3376	0.0	0.0
+chrM	3376	3377	0.0	0.0
+chrM	3377	3378	0.0	0.0
+chrM	3378	3379	0.0	0.0
+chrM	3379	3380	0.0	0.0
+chrM	3380	3381	0.0	0.0
+chrM	3381	3382	0.0	0.0
+chrM	3382	3383	0.0	0.0
+chrM	3383	3384	0.0	0.0
+chrM	3384	3385	0.0	0.0
+chrM	3385	3386	0.0	0.0
+chrM	3386	3387	0.0	0.0
+chrM	3387	3388	0.0	0.0
+chrM	3388	3389	0.0	0.0
+chrM	3389	3390	0.0	0.0
+chrM	3390	3391	0.0	0.0
+chrM	3391	3392	0.0	0.0
+chrM	3392	3393	0.0	0.0
+chrM	3393	3394	0.0	0.0
+chrM	3394	3395	0.0	0.0
+chrM	3395	3396	0.0	0.0
+chrM	3396	3397	0.0	0.0
+chrM	3397	3398	0.0	0.0
+chrM	3398	3399	0.0	0.0
+chrM	3399	3400	0.0	0.0
+chrM	3400	3401	0.0	0.0
+chrM	3401	3402	0.0	0.0
+chrM	3402	3403	0.0	0.0
+chrM	3403	3404	0.0	0.0
+chrM	3404	3405	0.0	0.0
+chrM	3405	3406	0.0	0.0
+chrM	3406	3407	0.0	0.0
+chrM	3407	3408	0.0	0.0
+chrM	3408	3409	0.0	0.0
+chrM	3409	3410	0.0	0.0
+chrM	3410	3411	0.0	0.0
+chrM	3411	3412	0.0	0.0
+chrM	3412	3413	0.0	0.0
+chrM	3413	3414	0.0	0.0
+chrM	3414	3415	0.0	0.0
+chrM	3415	3416	0.0	0.0
+chrM	3416	3417	0.0	0.0
+chrM	3417	3418	0.0	0.0
+chrM	3418	3419	0.0	0.0
+chrM	3419	3420	0.0	0.0
+chrM	3420	3421	0.0	0.0
+chrM	3421	3422	0.0	0.0
+chrM	3422	3423	0.0	0.0
+chrM	3423	3424	0.0	0.0
+chrM	3424	3425	0.0	0.0
+chrM	3425	3426	0.0	0.0
+chrM	3426	3427	0.0	0.0
+chrM	3427	3428	0.0	0.0
+chrM	3428	3429	0.0	0.0
+chrM	3429	3430	0.0	0.0
+chrM	3430	3431	0.0	0.0
+chrM	3431	3432	0.0	0.0
+chrM	3432	3433	0.0	0.0
+chrM	3433	3434	0.0	0.0
+chrM	3434	3435	0.0	0.0
+chrM	3435	3436	0.0	0.0
+chrM	3436	3437	0.0	0.0
+chrM	3437	3438	0.0	0.0
+chrM	3438	3439	0.0	0.0
+chrM	3439	3440	0.0	0.0
+chrM	3440	3441	0.0	0.0
+chrM	3441	3442	0.0	0.0
+chrM	3442	3443	0.0	0.0
+chrM	3443	3444	0.0	0.0
+chrM	3444	3445	0.0	0.0
+chrM	3445	3446	0.0	0.0
+chrM	3446	3447	0.0	0.0
+chrM	3447	3448	0.0	0.0
+chrM	3448	3449	0.0	0.0
+chrM	3449	3450	0.0	0.0
+chrM	3450	3451	0.0	0.0
+chrM	3451	3452	0.0	0.0
+chrM	3452	3453	0.0	0.0
+chrM	3453	3454	0.0	0.0
+chrM	3454	3455	0.0	0.0
+chrM	3455	3456	0.0	0.0
+chrM	3456	3457	0.0	0.0
+chrM	3457	3458	0.0	0.0
+chrM	3458	3459	0.0	0.0
+chrM	3459	3460	0.0	0.0
+chrM	3460	3461	0.0	0.0
+chrM	3461	3462	0.0	0.0
+chrM	3462	3463	0.0	0.0
+chrM	3463	3464	0.0	0.0
+chrM	3464	3465	0.0	0.0
+chrM	3465	3466	0.0	0.0
+chrM	3466	3467	0.0	0.0
+chrM	3467	3468	0.0	0.0
+chrM	3468	3469	0.0	0.0
+chrM	3469	3470	0.0	0.0
+chrM	3470	3471	0.0	0.0
+chrM	3471	3472	0.0	0.0
+chrM	3472	3473	0.0	0.0
+chrM	3473	3474	0.0	0.0
+chrM	3474	3475	0.0	0.0
+chrM	3475	3476	0.0	0.0
+chrM	3476	3477	0.0	0.0
+chrM	3477	3478	0.0	0.0
+chrM	3478	3479	0.0	0.0
+chrM	3479	3480	0.0	0.0
+chrM	3480	3481	0.0	0.0
+chrM	3481	3482	0.0	0.0
+chrM	3482	3483	0.0	0.0
+chrM	3483	3484	0.0	0.0
+chrM	3484	3485	0.0	0.0
+chrM	3485	3486	0.0	0.0
+chrM	3486	3487	0.0	0.0
+chrM	3487	3488	0.0	0.0
+chrM	3488	3489	0.0	0.0
+chrM	3489	3490	0.0	0.0
+chrM	3490	3491	0.0	0.0
+chrM	3491	3492	0.0	0.0
+chrM	3492	3493	0.0	0.0
+chrM	3493	3494	0.0	0.0
+chrM	3494	3495	0.0	0.0
+chrM	3495	3496	0.0	0.0
+chrM	3496	3497	0.0	0.0
+chrM	3497	3498	0.0	0.0
+chrM	3498	3499	0.0	0.0
+chrM	3499	3500	0.0	0.0
+chrM	3500	3501	0.0	0.0
+chrM	3501	3502	0.0	0.0
+chrM	3502	3503	0.0	0.0
+chrM	3503	3504	0.0	0.0
+chrM	3504	3505	0.0	0.0
+chrM	3505	3506	0.0	0.0
+chrM	3506	3507	0.0	0.0
+chrM	3507	3508	0.0	0.0
+chrM	3508	3509	0.0	0.0
+chrM	3509	3510	0.0	0.0
+chrM	3510	3511	0.0	0.0
+chrM	3511	3512	0.0	0.0
+chrM	3512	3513	0.0	0.0
+chrM	3513	3514	0.0	0.0
+chrM	3514	3515	0.0	0.0
+chrM	3515	3516	0.0	0.0
+chrM	3516	3517	0.0	0.0
+chrM	3517	3518	0.0	0.0
+chrM	3518	3519	0.0	0.0
+chrM	3519	3520	0.0	0.0
+chrM	3520	3521	0.0	0.0
+chrM	3521	3522	0.0	0.0
+chrM	3522	3523	0.0	0.0
+chrM	3523	3524	0.0	0.0
+chrM	3524	3525	0.0	0.0
+chrM	3525	3526	0.0	0.0
+chrM	3526	3527	0.0	0.0
+chrM	3527	3528	0.0	0.0
+chrM	3528	3529	0.0	0.0
+chrM	3529	3530	0.0	0.0
+chrM	3530	3531	0.0	0.0
+chrM	3531	3532	0.0	0.0
+chrM	3532	3533	0.0	0.0
+chrM	3533	3534	0.0	0.0
+chrM	3534	3535	0.0	0.0
+chrM	3535	3536	0.0	0.0
+chrM	3536	3537	0.0	0.0
+chrM	3537	3538	0.0	0.0
+chrM	3538	3539	0.0	0.0
+chrM	3539	3540	0.0	0.0
+chrM	3540	3541	0.0	0.0
+chrM	3541	3542	0.0	0.0
+chrM	3542	3543	0.0	0.0
+chrM	3543	3544	0.0	0.0
+chrM	3544	3545	0.0	0.0
+chrM	3545	3546	0.0	0.0
+chrM	3546	3547	0.0	0.0
+chrM	3547	3548	0.0	0.0
+chrM	3548	3549	0.0	0.0
+chrM	3549	3550	0.0	0.0
+chrM	3550	3551	0.0	0.0
+chrM	3551	3552	0.0	0.0
+chrM	3552	3553	0.0	0.0
+chrM	3553	3554	0.0	0.0
+chrM	3554	3555	0.0	0.0
+chrM	3555	3556	0.0	0.0
+chrM	3556	3557	0.0	0.0
+chrM	3557	3558	0.0	0.0
+chrM	3558	3559	0.0	0.0
+chrM	3559	3560	0.0	0.0
+chrM	3560	3561	0.0	0.0
+chrM	3561	3562	0.0	0.0
+chrM	3562	3563	0.0	0.0
+chrM	3563	3564	0.0	0.0
+chrM	3564	3565	0.0	0.0
+chrM	3565	3566	0.0	0.0
+chrM	3566	3567	0.0	0.0
+chrM	3567	3568	0.0	0.0
+chrM	3568	3569	0.0	0.0
+chrM	3569	3570	0.0	0.0
+chrM	3570	3571	0.0	0.0
+chrM	3571	3572	0.0	0.0
+chrM	3572	3573	0.0	0.0
+chrM	3573	3574	0.0	0.0
+chrM	3574	3575	0.0	0.0
+chrM	3575	3576	0.0	0.0
+chrM	3576	3577	0.0	0.0
+chrM	3577	3578	0.0	0.0
+chrM	3578	3579	0.0	0.0
+chrM	3579	3580	0.0	0.0
+chrM	3580	3581	0.0	0.0
+chrM	3581	3582	0.0	0.0
+chrM	3582	3583	0.0	0.0
+chrM	3583	3584	0.0	0.0
+chrM	3584	3585	0.0	0.0
+chrM	3585	3586	0.0	0.0
+chrM	3586	3587	0.0	0.0
+chrM	3587	3588	0.0	0.0
+chrM	3588	3589	0.0	0.0
+chrM	3589	3590	0.0	0.0
+chrM	3590	3591	0.0	0.0
+chrM	3591	3592	0.0	0.0
+chrM	3592	3593	0.0	0.0
+chrM	3593	3594	0.0	0.0
+chrM	3594	3595	0.0	0.0
+chrM	3595	3596	0.0	0.0
+chrM	3596	3597	0.0	0.0
+chrM	3597	3598	0.0	0.0
+chrM	3598	3599	0.0	0.0
+chrM	3599	3600	0.0	0.0
+chrM	3600	3601	0.0	0.0
+chrM	3601	3602	0.0	0.0
+chrM	3602	3603	0.0	0.0
+chrM	3603	3604	0.0	0.0
+chrM	3604	3605	0.0	0.0
+chrM	3605	3606	0.0	0.0
+chrM	3606	3607	0.0	0.0
+chrM	3607	3608	0.0	0.0
+chrM	3608	3609	0.0	0.0
+chrM	3609	3610	0.0	0.0
+chrM	3610	3611	0.0	0.0
+chrM	3611	3612	0.0	0.0
+chrM	3612	3613	0.0	0.0
+chrM	3613	3614	0.0	0.0
+chrM	3614	3615	0.0	0.0
+chrM	3615	3616	0.0	0.0
+chrM	3616	3617	0.0	0.0
+chrM	3617	3618	0.0	0.0
+chrM	3618	3619	0.0	0.0
+chrM	3619	3620	0.0	0.0
+chrM	3620	3621	0.0	0.0
+chrM	3621	3622	0.0	0.0
+chrM	3622	3623	0.0	0.0
+chrM	3623	3624	0.0	0.0
+chrM	3624	3625	0.0	0.0
+chrM	3625	3626	0.0	0.0
+chrM	3626	3627	0.0	0.0
+chrM	3627	3628	0.0	0.0
+chrM	3628	3629	0.0	0.0
+chrM	3629	3630	0.0	0.0
+chrM	3630	3631	0.0	0.0
+chrM	3631	3632	0.0	0.0
+chrM	3632	3633	0.0	0.0
+chrM	3633	3634	0.0	0.0
+chrM	3634	3635	0.0	0.0
+chrM	3635	3636	0.0	0.0
+chrM	3636	3637	0.0	0.0
+chrM	3637	3638	0.0	0.0
+chrM	3638	3639	0.0	0.0
+chrM	3639	3640	0.0	0.0
+chrM	3640	3641	0.0	0.0
+chrM	3641	3642	0.0	0.0
+chrM	3642	3643	0.0	0.0
+chrM	3643	3644	0.0	0.0
+chrM	3644	3645	0.0	0.0
+chrM	3645	3646	0.0	0.0
+chrM	3646	3647	0.0	0.0
+chrM	3647	3648	0.0	0.0
+chrM	3648	3649	0.0	0.0
+chrM	3649	3650	0.0	0.0
+chrM	3650	3651	0.0	0.0
+chrM	3651	3652	0.0	0.0
+chrM	3652	3653	0.0	0.0
+chrM	3653	3654	0.0	0.0
+chrM	3654	3655	0.0	0.0
+chrM	3655	3656	0.0	0.0
+chrM	3656	3657	0.0	0.0
+chrM	3657	3658	0.0	0.0
+chrM	3658	3659	0.0	0.0
+chrM	3659	3660	0.0	0.0
+chrM	3660	3661	0.0	0.0
+chrM	3661	3662	0.0	0.0
+chrM	3662	3663	0.0	0.0
+chrM	3663	3664	0.0	0.0
+chrM	3664	3665	0.0	0.0
+chrM	3665	3666	0.0	0.0
+chrM	3666	3667	0.0	0.0
+chrM	3667	3668	0.0	0.0
+chrM	3668	3669	0.0	0.0
+chrM	3669	3670	0.0	0.0
+chrM	3670	3671	0.0	0.0
+chrM	3671	3672	0.0	0.0
+chrM	3672	3673	0.0	0.0
+chrM	3673	3674	0.0	0.0
+chrM	3674	3675	0.0	0.0
+chrM	3675	3676	0.0	0.0
+chrM	3676	3677	0.0	0.0
+chrM	3677	3678	0.0	0.0
+chrM	3678	3679	0.0	0.0
+chrM	3679	3680	0.0	0.0
+chrM	3680	3681	0.0	0.0
+chrM	3681	3682	0.0	0.0
+chrM	3682	3683	0.0	0.0
+chrM	3683	3684	0.0	0.0
+chrM	3684	3685	0.0	0.0
+chrM	3685	3686	0.0	0.0
+chrM	3686	3687	0.0	0.0
+chrM	3687	3688	0.0	0.0
+chrM	3688	3689	0.0	0.0
+chrM	3689	3690	0.0	0.0
+chrM	3690	3691	0.0	0.0
+chrM	3691	3692	0.0	0.0
+chrM	3692	3693	0.0	0.0
+chrM	3693	3694	0.0	0.0
+chrM	3694	3695	0.0	0.0
+chrM	3695	3696	0.0	0.0
+chrM	3696	3697	0.0	0.0
+chrM	3697	3698	0.0	0.0
+chrM	3698	3699	0.0	0.0
+chrM	3699	3700	0.0	0.0
+chrM	3700	3701	0.0	0.0
+chrM	3701	3702	0.0	0.0
+chrM	3702	3703	0.0	0.0
+chrM	3703	3704	0.0	0.0
+chrM	3704	3705	0.0	0.0
+chrM	3705	3706	0.0	0.0
+chrM	3706	3707	0.0	0.0
+chrM	3707	3708	0.0	0.0
+chrM	3708	3709	0.0	0.0
+chrM	3709	3710	0.0	0.0
+chrM	3710	3711	0.0	0.0
+chrM	3711	3712	0.0	0.0
+chrM	3712	3713	0.0	0.0
+chrM	3713	3714	0.0	0.0
+chrM	3714	3715	0.0	0.0
+chrM	3715	3716	0.0	0.0
+chrM	3716	3717	0.0	0.0
+chrM	3717	3718	0.0	0.0
+chrM	3718	3719	0.0	0.0
+chrM	3719	3720	0.0	0.0
+chrM	3720	3721	0.0	0.0
+chrM	3721	3722	0.0	0.0
+chrM	3722	3723	0.0	0.0
+chrM	3723	3724	0.0	0.0
+chrM	3724	3725	0.0	0.0
+chrM	3725	3726	0.0	0.0
+chrM	3726	3727	0.0	0.0
+chrM	3727	3728	0.0	0.0
+chrM	3728	3729	0.0	0.0
+chrM	3729	3730	0.0	0.0
+chrM	3730	3731	0.0	0.0
+chrM	3731	3732	0.0	0.0
+chrM	3732	3733	0.0	0.0
+chrM	3733	3734	0.0	0.0
+chrM	3734	3735	0.0	0.0
+chrM	3735	3736	0.0	0.0
+chrM	3736	3737	0.0	0.0
+chrM	3737	3738	0.0	0.0
+chrM	3738	3739	0.0	0.0
+chrM	3739	3740	0.0	0.0
+chrM	3740	3741	0.0	0.0
+chrM	3741	3742	0.0	0.0
+chrM	3742	3743	0.0	0.0
+chrM	3743	3744	0.0	0.0
+chrM	3744	3745	0.0	0.0
+chrM	3745	3746	0.0	0.0
+chrM	3746	3747	0.0	0.0
+chrM	3747	3748	0.0	0.0
+chrM	3748	3749	0.0	0.0
+chrM	3749	3750	0.0	0.0
+chrM	3750	3751	0.0	0.0
+chrM	3751	3752	0.0	0.0
+chrM	3752	3753	0.0	0.0
+chrM	3753	3754	0.0	0.0
+chrM	3754	3755	0.0	0.0
+chrM	3755	3756	0.0	0.0
+chrM	3756	3757	0.0	0.0
+chrM	3757	3758	0.0	0.0
+chrM	3758	3759	0.0	0.0
+chrM	3759	3760	0.0	0.0
+chrM	3760	3761	0.0	0.0
+chrM	3761	3762	0.0	0.0
+chrM	3762	3763	0.0	0.0
+chrM	3763	3764	0.0	0.0
+chrM	3764	3765	0.0	0.0
+chrM	3765	3766	0.0	0.0
+chrM	3766	3767	0.0	0.0
+chrM	3767	3768	0.0	0.0
+chrM	3768	3769	0.0	0.0
+chrM	3769	3770	0.0	0.0
+chrM	3770	3771	0.0	0.0
+chrM	3771	3772	0.0	0.0
+chrM	3772	3773	0.0	0.0
+chrM	3773	3774	0.0	0.0
+chrM	3774	3775	0.0	0.0
+chrM	3775	3776	0.0	0.0
+chrM	3776	3777	0.0	0.0
+chrM	3777	3778	0.0	0.0
+chrM	3778	3779	0.0	0.0
+chrM	3779	3780	0.0	0.0
+chrM	3780	3781	0.0	0.0
+chrM	3781	3782	0.0	0.0
+chrM	3782	3783	0.0	0.0
+chrM	3783	3784	0.0	0.0
+chrM	3784	3785	0.0	0.0
+chrM	3785	3786	0.0	0.0
+chrM	3786	3787	0.0	0.0
+chrM	3787	3788	0.0	0.0
+chrM	3788	3789	0.0	0.0
+chrM	3789	3790	0.0	0.0
+chrM	3790	3791	0.0	0.0
+chrM	3791	3792	0.0	0.0
+chrM	3792	3793	0.0	0.0
+chrM	3793	3794	0.0	0.0
+chrM	3794	3795	0.0	0.0
+chrM	3795	3796	0.0	0.0
+chrM	3796	3797	0.0	0.0
+chrM	3797	3798	0.0	0.0
+chrM	3798	3799	0.0	0.0
+chrM	3799	3800	0.0	0.0
+chrM	3800	3801	0.0	0.0
+chrM	3801	3802	0.0	0.0
+chrM	3802	3803	0.0	0.0
+chrM	3803	3804	0.0	0.0
+chrM	3804	3805	0.0	0.0
+chrM	3805	3806	0.0	0.0
+chrM	3806	3807	0.0	0.0
+chrM	3807	3808	0.0	0.0
+chrM	3808	3809	0.0	0.0
+chrM	3809	3810	0.0	0.0
+chrM	3810	3811	0.0	0.0
+chrM	3811	3812	0.0	0.0
+chrM	3812	3813	0.0	0.0
+chrM	3813	3814	0.0	0.0
+chrM	3814	3815	0.0	0.0
+chrM	3815	3816	0.0	0.0
+chrM	3816	3817	0.0	0.0
+chrM	3817	3818	0.0	0.0
+chrM	3818	3819	0.0	0.0
+chrM	3819	3820	0.0	0.0
+chrM	3820	3821	0.0	0.0
+chrM	3821	3822	0.0	0.0
+chrM	3822	3823	0.0	0.0
+chrM	3823	3824	0.0	0.0
+chrM	3824	3825	0.0	0.0
+chrM	3825	3826	0.0	0.0
+chrM	3826	3827	0.0	0.0
+chrM	3827	3828	0.0	0.0
+chrM	3828	3829	0.0	0.0
+chrM	3829	3830	0.0	0.0
+chrM	3830	3831	0.0	0.0
+chrM	3831	3832	0.0	0.0
+chrM	3832	3833	0.0	0.0
+chrM	3833	3834	0.0	0.0
+chrM	3834	3835	0.0	0.0
+chrM	3835	3836	0.0	0.0
+chrM	3836	3837	0.0	0.0
+chrM	3837	3838	0.0	0.0
+chrM	3838	3839	0.0	0.0
+chrM	3839	3840	0.0	0.0
+chrM	3840	3841	0.0	0.0
+chrM	3841	3842	0.0	0.0
+chrM	3842	3843	0.0	0.0
+chrM	3843	3844	0.0	0.0
+chrM	3844	3845	0.0	0.0
+chrM	3845	3846	0.0	0.0
+chrM	3846	3847	0.0	0.0
+chrM	3847	3848	0.0	0.0
+chrM	3848	3849	0.0	0.0
+chrM	3849	3850	0.0	0.0
+chrM	3850	3851	0.0	0.0
+chrM	3851	3852	0.0	0.0
+chrM	3852	3853	0.0	0.0
+chrM	3853	3854	0.0	0.0
+chrM	3854	3855	0.0	0.0
+chrM	3855	3856	0.0	0.0
+chrM	3856	3857	0.0	0.0
+chrM	3857	3858	0.0	0.0
+chrM	3858	3859	0.0	0.0
+chrM	3859	3860	0.0	0.0
+chrM	3860	3861	0.0	0.0
+chrM	3861	3862	0.0	0.0
+chrM	3862	3863	0.0	0.0
+chrM	3863	3864	0.0	0.0
+chrM	3864	3865	0.0	0.0
+chrM	3865	3866	0.0	0.0
+chrM	3866	3867	0.0	0.0
+chrM	3867	3868	0.0	0.0
+chrM	3868	3869	0.0	0.0
+chrM	3869	3870	0.0	0.0
+chrM	3870	3871	0.0	0.0
+chrM	3871	3872	0.0	0.0
+chrM	3872	3873	0.0	0.0
+chrM	3873	3874	0.0	0.0
+chrM	3874	3875	0.0	0.0
+chrM	3875	3876	0.0	0.0
+chrM	3876	3877	0.0	0.0
+chrM	3877	3878	0.0	0.0
+chrM	3878	3879	0.0	0.0
+chrM	3879	3880	0.0	0.0
+chrM	3880	3881	0.0	0.0
+chrM	3881	3882	0.0	0.0
+chrM	3882	3883	0.0	0.0
+chrM	3883	3884	0.0	0.0
+chrM	3884	3885	0.0	0.0
+chrM	3885	3886	0.0	0.0
+chrM	3886	3887	0.0	0.0
+chrM	3887	3888	0.0	0.0
+chrM	3888	3889	0.0	0.0
+chrM	3889	3890	0.0	0.0
+chrM	3890	3891	0.0	0.0
+chrM	3891	3892	0.0	0.0
+chrM	3892	3893	0.0	0.0
+chrM	3893	3894	0.0	0.0
+chrM	3894	3895	0.0	0.0
+chrM	3895	3896	0.0	0.0
+chrM	3896	3897	0.0	0.0
+chrM	3897	3898	0.0	0.0
+chrM	3898	3899	0.0	0.0
+chrM	3899	3900	0.0	0.0
+chrM	3900	3901	0.0	0.0
+chrM	3901	3902	0.0	0.0
+chrM	3902	3903	0.0	0.0
+chrM	3903	3904	0.0	0.0
+chrM	3904	3905	0.0	0.0
+chrM	3905	3906	0.0	0.0
+chrM	3906	3907	0.0	0.0
+chrM	3907	3908	0.0	0.0
+chrM	3908	3909	0.0	0.0
+chrM	3909	3910	0.0	0.0
+chrM	3910	3911	0.0	0.0
+chrM	3911	3912	0.0	0.0
+chrM	3912	3913	0.0	0.0
+chrM	3913	3914	0.0	0.0
+chrM	3914	3915	0.0	0.0
+chrM	3915	3916	0.0	0.0
+chrM	3916	3917	0.0	0.0
+chrM	3917	3918	0.0	0.0
+chrM	3918	3919	0.0	0.0
+chrM	3919	3920	0.0	0.0
+chrM	3920	3921	0.0	0.0
+chrM	3921	3922	0.0	0.0
+chrM	3922	3923	0.0	0.0
+chrM	3923	3924	0.0	0.0
+chrM	3924	3925	0.0	0.0
+chrM	3925	3926	0.0	0.0
+chrM	3926	3927	0.0	0.0
+chrM	3927	3928	0.0	0.0
+chrM	3928	3929	0.0	0.0
+chrM	3929	3930	0.0	0.0
+chrM	3930	3931	0.0	0.0
+chrM	3931	3932	0.0	0.0
+chrM	3932	3933	0.0	0.0
+chrM	3933	3934	0.0	0.0
+chrM	3934	3935	0.0	0.0
+chrM	3935	3936	0.0	0.0
+chrM	3936	3937	0.0	0.0
+chrM	3937	3938	0.0	0.0
+chrM	3938	3939	0.0	0.0
+chrM	3939	3940	0.0	0.0
+chrM	3940	3941	0.0	0.0
+chrM	3941	3942	0.0	0.0
+chrM	3942	3943	0.0	0.0
+chrM	3943	3944	0.0	0.0
+chrM	3944	3945	0.0	0.0
+chrM	3945	3946	0.0	0.0
+chrM	3946	3947	0.0	0.0
+chrM	3947	3948	0.0	0.0
+chrM	3948	3949	0.0	0.0
+chrM	3949	3950	0.0	0.0
+chrM	3950	3951	0.0	0.0
+chrM	3951	3952	0.0	0.0
+chrM	3952	3953	0.0	0.0
+chrM	3953	3954	0.0	0.0
+chrM	3954	3955	0.0	0.0
+chrM	3955	3956	0.0	0.0
+chrM	3956	3957	0.0	0.0
+chrM	3957	3958	0.0	0.0
+chrM	3958	3959	0.0	0.0
+chrM	3959	3960	0.0	0.0
+chrM	3960	3961	0.0	0.0
+chrM	3961	3962	0.0	0.0
+chrM	3962	3963	0.0	0.0
+chrM	3963	3964	0.0	0.0
+chrM	3964	3965	0.0	0.0
+chrM	3965	3966	0.0	0.0
+chrM	3966	3967	0.0	0.0
+chrM	3967	3968	0.0	0.0
+chrM	3968	3969	0.0	0.0
+chrM	3969	3970	0.0	0.0
+chrM	3970	3971	0.0	0.0
+chrM	3971	3972	0.0	0.0
+chrM	3972	3973	0.0	0.0
+chrM	3973	3974	0.0	0.0
+chrM	3974	3975	0.0	0.0
+chrM	3975	3976	0.0	0.0
+chrM	3976	3977	0.0	0.0
+chrM	3977	3978	0.0	0.0
+chrM	3978	3979	0.0	0.0
+chrM	3979	3980	0.0	0.0
+chrM	3980	3981	0.0	0.0
+chrM	3981	3982	0.0	0.0
+chrM	3982	3983	0.0	0.0
+chrM	3983	3984	0.0	0.0
+chrM	3984	3985	0.0	0.0
+chrM	3985	3986	0.0	0.0
+chrM	3986	3987	0.0	0.0
+chrM	3987	3988	0.0	0.0
+chrM	3988	3989	0.0	0.0
+chrM	3989	3990	0.0	0.0
+chrM	3990	3991	0.0	0.0
+chrM	3991	3992	0.0	0.0
+chrM	3992	3993	0.0	0.0
+chrM	3993	3994	0.0	0.0
+chrM	3994	3995	0.0	0.0
+chrM	3995	3996	0.0	0.0
+chrM	3996	3997	0.0	0.0
+chrM	3997	3998	0.0	0.0
+chrM	3998	3999	0.0	0.0
+chrM	3999	4000	0.0	0.0
+chrM	4000	4001	0.0	0.0
+chrM	4001	4002	0.0	0.0
+chrM	4002	4003	0.0	0.0
+chrM	4003	4004	0.0	0.0
+chrM	4004	4005	0.0	0.0
+chrM	4005	4006	0.0	0.0
+chrM	4006	4007	0.0	0.0
+chrM	4007	4008	0.0	0.0
+chrM	4008	4009	0.0	0.0
+chrM	4009	4010	0.0	0.0
+chrM	4010	4011	0.0	0.0
+chrM	4011	4012	0.0	0.0
+chrM	4012	4013	0.0	0.0
+chrM	4013	4014	0.0	0.0
+chrM	4014	4015	0.0	0.0
+chrM	4015	4016	0.0	0.0
+chrM	4016	4017	0.0	0.0
+chrM	4017	4018	0.0	0.0
+chrM	4018	4019	0.0	0.0
+chrM	4019	4020	0.0	0.0
+chrM	4020	4021	0.0	0.0
+chrM	4021	4022	0.0	0.0
+chrM	4022	4023	0.0	0.0
+chrM	4023	4024	0.0	0.0
+chrM	4024	4025	0.0	0.0
+chrM	4025	4026	0.0	0.0
+chrM	4026	4027	0.0	0.0
+chrM	4027	4028	0.0	0.0
+chrM	4028	4029	0.0	0.0
+chrM	4029	4030	0.0	0.0
+chrM	4030	4031	0.0	0.0
+chrM	4031	4032	0.0	0.0
+chrM	4032	4033	0.0	0.0
+chrM	4033	4034	0.0	0.0
+chrM	4034	4035	0.0	0.0
+chrM	4035	4036	0.0	0.0
+chrM	4036	4037	0.0	0.0
+chrM	4037	4038	0.0	0.0
+chrM	4038	4039	0.0	0.0
+chrM	4039	4040	0.0	0.0
+chrM	4040	4041	0.0	0.0
+chrM	4041	4042	0.0	0.0
+chrM	4042	4043	0.0	0.0
+chrM	4043	4044	0.0	0.0
+chrM	4044	4045	0.0	0.0
+chrM	4045	4046	0.0	0.0
+chrM	4046	4047	0.0	0.0
+chrM	4047	4048	0.0	0.0
+chrM	4048	4049	0.0	0.0
+chrM	4049	4050	0.0	0.0
+chrM	4050	4051	0.0	0.0
+chrM	4051	4052	0.0	0.0
+chrM	4052	4053	0.0	0.0
+chrM	4053	4054	0.0	0.0
+chrM	4054	4055	0.0	0.0
+chrM	4055	4056	0.0	0.0
+chrM	4056	4057	0.0	0.0
+chrM	4057	4058	0.0	0.0
+chrM	4058	4059	0.0	0.0
+chrM	4059	4060	0.0	0.0
+chrM	4060	4061	0.0	0.0
+chrM	4061	4062	0.0	0.0
+chrM	4062	4063	0.0	0.0
+chrM	4063	4064	0.0	0.0
+chrM	4064	4065	0.0	0.0
+chrM	4065	4066	0.0	0.0
+chrM	4066	4067	0.0	0.0
+chrM	4067	4068	0.0	0.0
+chrM	4068	4069	0.0	0.0
+chrM	4069	4070	0.0	0.0
+chrM	4070	4071	0.0	0.0
+chrM	4071	4072	0.0	0.0
+chrM	4072	4073	0.0	0.0
+chrM	4073	4074	0.0	0.0
+chrM	4074	4075	0.0	0.0
+chrM	4075	4076	0.0	0.0
+chrM	4076	4077	0.0	0.0
+chrM	4077	4078	0.0	0.0
+chrM	4078	4079	0.0	0.0
+chrM	4079	4080	0.0	0.0
+chrM	4080	4081	0.0	0.0
+chrM	4081	4082	0.0	0.0
+chrM	4082	4083	0.0	0.0
+chrM	4083	4084	0.0	0.0
+chrM	4084	4085	0.0	0.0
+chrM	4085	4086	0.0	0.0
+chrM	4086	4087	0.0	0.0
+chrM	4087	4088	0.0	0.0
+chrM	4088	4089	0.0	0.0
+chrM	4089	4090	0.0	0.0
+chrM	4090	4091	0.0	0.0
+chrM	4091	4092	0.0	0.0
+chrM	4092	4093	0.0	0.0
+chrM	4093	4094	0.0	0.0
+chrM	4094	4095	0.0	0.0
+chrM	4095	4096	0.0	0.0
+chrM	4096	4097	0.0	0.0
+chrM	4097	4098	0.0	0.0
+chrM	4098	4099	0.0	0.0
+chrM	4099	4100	0.0	0.0
+chrM	4100	4101	0.0	0.0
+chrM	4101	4102	0.0	0.0
+chrM	4102	4103	0.0	0.0
+chrM	4103	4104	0.0	0.0
+chrM	4104	4105	0.0	0.0
+chrM	4105	4106	0.0	0.0
+chrM	4106	4107	0.0	0.0
+chrM	4107	4108	0.0	0.0
+chrM	4108	4109	0.0	0.0
+chrM	4109	4110	0.0	0.0
+chrM	4110	4111	0.0	0.0
+chrM	4111	4112	0.0	0.0
+chrM	4112	4113	0.0	0.0
+chrM	4113	4114	0.0	0.0
+chrM	4114	4115	0.0	0.0
+chrM	4115	4116	0.0	0.0
+chrM	4116	4117	0.0	0.0
+chrM	4117	4118	0.0	0.0
+chrM	4118	4119	0.0	0.0
+chrM	4119	4120	0.0	0.0
+chrM	4120	4121	0.0	0.0
+chrM	4121	4122	0.0	0.0
+chrM	4122	4123	0.0	0.0
+chrM	4123	4124	0.0	0.0
+chrM	4124	4125	0.0	0.0
+chrM	4125	4126	0.0	0.0
+chrM	4126	4127	0.0	0.0
+chrM	4127	4128	0.0	0.0
+chrM	4128	4129	0.0	0.0
+chrM	4129	4130	0.0	0.0
+chrM	4130	4131	0.0	0.0
+chrM	4131	4132	0.0	0.0
+chrM	4132	4133	0.0	0.0
+chrM	4133	4134	0.0	0.0
+chrM	4134	4135	0.0	0.0
+chrM	4135	4136	0.0	0.0
+chrM	4136	4137	0.0	0.0
+chrM	4137	4138	0.0	0.0
+chrM	4138	4139	0.0	0.0
+chrM	4139	4140	0.0	0.0
+chrM	4140	4141	0.0	0.0
+chrM	4141	4142	0.0	0.0
+chrM	4142	4143	0.0	0.0
+chrM	4143	4144	0.0	0.0
+chrM	4144	4145	0.0	0.0
+chrM	4145	4146	0.0	0.0
+chrM	4146	4147	0.0	0.0
+chrM	4147	4148	0.0	0.0
+chrM	4148	4149	0.0	0.0
+chrM	4149	4150	0.0	0.0
+chrM	4150	4151	0.0	0.0
+chrM	4151	4152	0.0	0.0
+chrM	4152	4153	0.0	0.0
+chrM	4153	4154	0.0	0.0
+chrM	4154	4155	0.0	0.0
+chrM	4155	4156	0.0	0.0
+chrM	4156	4157	0.0	0.0
+chrM	4157	4158	0.0	0.0
+chrM	4158	4159	0.0	0.0
+chrM	4159	4160	0.0	0.0
+chrM	4160	4161	0.0	0.0
+chrM	4161	4162	0.0	0.0
+chrM	4162	4163	0.0	0.0
+chrM	4163	4164	0.0	0.0
+chrM	4164	4165	0.0	0.0
+chrM	4165	4166	0.0	0.0
+chrM	4166	4167	0.0	0.0
+chrM	4167	4168	0.0	0.0
+chrM	4168	4169	0.0	0.0
+chrM	4169	4170	0.0	0.0
+chrM	4170	4171	0.0	0.0
+chrM	4171	4172	0.0	0.0
+chrM	4172	4173	0.0	0.0
+chrM	4173	4174	0.0	0.0
+chrM	4174	4175	0.0	0.0
+chrM	4175	4176	0.0	0.0
+chrM	4176	4177	0.0	0.0
+chrM	4177	4178	0.0	0.0
+chrM	4178	4179	0.0	0.0
+chrM	4179	4180	0.0	0.0
+chrM	4180	4181	0.0	0.0
+chrM	4181	4182	0.0	0.0
+chrM	4182	4183	0.0	0.0
+chrM	4183	4184	0.0	0.0
+chrM	4184	4185	0.0	0.0
+chrM	4185	4186	0.0	0.0
+chrM	4186	4187	0.0	0.0
+chrM	4187	4188	0.0	0.0
+chrM	4188	4189	0.0	0.0
+chrM	4189	4190	0.0	0.0
+chrM	4190	4191	0.0	0.0
+chrM	4191	4192	0.0	0.0
+chrM	4192	4193	0.0	0.0
+chrM	4193	4194	0.0	0.0
+chrM	4194	4195	0.0	0.0
+chrM	4195	4196	0.0	0.0
+chrM	4196	4197	0.0	0.0
+chrM	4197	4198	0.0	0.0
+chrM	4198	4199	0.0	0.0
+chrM	4199	4200	0.0	0.0
+chrM	4200	4201	0.0	0.0
+chrM	4201	4202	0.0	0.0
+chrM	4202	4203	0.0	0.0
+chrM	4203	4204	0.0	0.0
+chrM	4204	4205	0.0	0.0
+chrM	4205	4206	0.0	0.0
+chrM	4206	4207	0.0	0.0
+chrM	4207	4208	0.0	0.0
+chrM	4208	4209	0.0	0.0
+chrM	4209	4210	0.0	0.0
+chrM	4210	4211	0.0	0.0
+chrM	4211	4212	0.0	0.0
+chrM	4212	4213	0.0	0.0
+chrM	4213	4214	0.0	0.0
+chrM	4214	4215	0.0	0.0
+chrM	4215	4216	0.0	0.0
+chrM	4216	4217	0.0	0.0
+chrM	4217	4218	0.0	0.0
+chrM	4218	4219	0.0	0.0
+chrM	4219	4220	0.0	0.0
+chrM	4220	4221	0.0	0.0
+chrM	4221	4222	0.0	0.0
+chrM	4222	4223	0.0	0.0
+chrM	4223	4224	0.0	0.0
+chrM	4224	4225	0.0	0.0
+chrM	4225	4226	0.0	0.0
+chrM	4226	4227	0.0	0.0
+chrM	4227	4228	0.0	0.0
+chrM	4228	4229	0.0	0.0
+chrM	4229	4230	0.0	0.0
+chrM	4230	4231	0.0	0.0
+chrM	4231	4232	0.0	0.0
+chrM	4232	4233	0.0	0.0
+chrM	4233	4234	0.0	0.0
+chrM	4234	4235	0.0	0.0
+chrM	4235	4236	0.0	0.0
+chrM	4236	4237	0.0	0.0
+chrM	4237	4238	0.0	0.0
+chrM	4238	4239	0.0	0.0
+chrM	4239	4240	0.0	0.0
+chrM	4240	4241	0.0	0.0
+chrM	4241	4242	0.0	0.0
+chrM	4242	4243	0.0	0.0
+chrM	4243	4244	0.0	0.0
+chrM	4244	4245	0.0	0.0
+chrM	4245	4246	0.0	0.0
+chrM	4246	4247	0.0	0.0
+chrM	4247	4248	0.0	0.0
+chrM	4248	4249	0.0	0.0
+chrM	4249	4250	0.0	0.0
+chrM	4250	4251	0.0	0.0
+chrM	4251	4252	0.0	0.0
+chrM	4252	4253	0.0	0.0
+chrM	4253	4254	0.0	0.0
+chrM	4254	4255	0.0	0.0
+chrM	4255	4256	0.0	0.0
+chrM	4256	4257	0.0	0.0
+chrM	4257	4258	0.0	0.0
+chrM	4258	4259	0.0	0.0
+chrM	4259	4260	0.0	0.0
+chrM	4260	4261	0.0	0.0
+chrM	4261	4262	0.0	0.0
+chrM	4262	4263	0.0	0.0
+chrM	4263	4264	0.0	0.0
+chrM	4264	4265	0.0	0.0
+chrM	4265	4266	0.0	0.0
+chrM	4266	4267	0.0	0.0
+chrM	4267	4268	0.0	0.0
+chrM	4268	4269	0.0	0.0
+chrM	4269	4270	0.0	0.0
+chrM	4270	4271	0.0	0.0
+chrM	4271	4272	0.0	0.0
+chrM	4272	4273	0.0	0.0
+chrM	4273	4274	0.0	0.0
+chrM	4274	4275	0.0	0.0
+chrM	4275	4276	0.0	0.0
+chrM	4276	4277	0.0	0.0
+chrM	4277	4278	0.0	0.0
+chrM	4278	4279	0.0	0.0
+chrM	4279	4280	0.0	0.0
+chrM	4280	4281	0.0	0.0
+chrM	4281	4282	0.0	0.0
+chrM	4282	4283	0.0	0.0
+chrM	4283	4284	0.0	0.0
+chrM	4284	4285	0.0	0.0
+chrM	4285	4286	0.0	0.0
+chrM	4286	4287	0.0	0.0
+chrM	4287	4288	0.0	0.0
+chrM	4288	4289	0.0	0.0
+chrM	4289	4290	0.0	0.0
+chrM	4290	4291	0.0	0.0
+chrM	4291	4292	0.0	0.0
+chrM	4292	4293	0.0	0.0
+chrM	4293	4294	0.0	0.0
+chrM	4294	4295	0.0	0.0
+chrM	4295	4296	0.0	0.0
+chrM	4296	4297	0.0	0.0
+chrM	4297	4298	0.0	0.0
+chrM	4298	4299	0.0	0.0
+chrM	4299	4300	0.0	0.0
+chrM	4300	4301	0.0	0.0
+chrM	4301	4302	0.0	0.0
+chrM	4302	4303	0.0	0.0
+chrM	4303	4304	0.0	0.0
+chrM	4304	4305	0.0	0.0
+chrM	4305	4306	0.0	0.0
+chrM	4306	4307	0.0	0.0
+chrM	4307	4308	0.0	0.0
+chrM	4308	4309	0.0	0.0
+chrM	4309	4310	0.0	0.0
+chrM	4310	4311	0.0	0.0
+chrM	4311	4312	0.0	0.0
+chrM	4312	4313	0.0	0.0
+chrM	4313	4314	0.0	0.0
+chrM	4314	4315	0.0	0.0
+chrM	4315	4316	0.0	0.0
+chrM	4316	4317	0.0	0.0
+chrM	4317	4318	0.0	0.0
+chrM	4318	4319	0.0	0.0
+chrM	4319	4320	0.0	0.0
+chrM	4320	4321	0.0	0.0
+chrM	4321	4322	0.0	0.0
+chrM	4322	4323	0.0	0.0
+chrM	4323	4324	0.0	0.0
+chrM	4324	4325	0.0	0.0
+chrM	4325	4326	0.0	0.0
+chrM	4326	4327	0.0	0.0
+chrM	4327	4328	0.0	0.0
+chrM	4328	4329	0.0	0.0
+chrM	4329	4330	0.0	0.0
+chrM	4330	4331	0.0	0.0
+chrM	4331	4332	0.0	0.0
+chrM	4332	4333	0.0	0.0
+chrM	4333	4334	0.0	0.0
+chrM	4334	4335	0.0	0.0
+chrM	4335	4336	0.0	0.0
+chrM	4336	4337	0.0	0.0
+chrM	4337	4338	0.0	0.0
+chrM	4338	4339	0.0	0.0
+chrM	4339	4340	0.0	0.0
+chrM	4340	4341	0.0	0.0
+chrM	4341	4342	0.0	0.0
+chrM	4342	4343	0.0	0.0
+chrM	4343	4344	0.0	0.0
+chrM	4344	4345	0.0	0.0
+chrM	4345	4346	0.0	0.0
+chrM	4346	4347	0.0	0.0
+chrM	4347	4348	0.0	0.0
+chrM	4348	4349	0.0	0.0
+chrM	4349	4350	0.0	0.0
+chrM	4350	4351	0.0	0.0
+chrM	4351	4352	0.0	0.0
+chrM	4352	4353	0.0	0.0
+chrM	4353	4354	0.0	0.0
+chrM	4354	4355	0.0	0.0
+chrM	4355	4356	0.0	0.0
+chrM	4356	4357	0.0	0.0
+chrM	4357	4358	0.0	0.0
+chrM	4358	4359	0.0	0.0
+chrM	4359	4360	0.0	0.0
+chrM	4360	4361	0.0	0.0
+chrM	4361	4362	0.0	0.0
+chrM	4362	4363	0.0	0.0
+chrM	4363	4364	0.0	0.0
+chrM	4364	4365	0.0	0.0
+chrM	4365	4366	0.0	0.0
+chrM	4366	4367	0.0	0.0
+chrM	4367	4368	0.0	0.0
+chrM	4368	4369	0.0	0.0
+chrM	4369	4370	0.0	0.0
+chrM	4370	4371	0.0	0.0
+chrM	4371	4372	0.0	0.0
+chrM	4372	4373	0.0	0.0
+chrM	4373	4374	0.0	0.0
+chrM	4374	4375	0.0	0.0
+chrM	4375	4376	0.0	0.0
+chrM	4376	4377	0.0	0.0
+chrM	4377	4378	0.0	0.0
+chrM	4378	4379	0.0	0.0
+chrM	4379	4380	0.0	0.0
+chrM	4380	4381	0.0	0.0
+chrM	4381	4382	0.0	0.0
+chrM	4382	4383	0.0	0.0
+chrM	4383	4384	0.0	0.0
+chrM	4384	4385	0.0	0.0
+chrM	4385	4386	0.0	0.0
+chrM	4386	4387	0.0	0.0
+chrM	4387	4388	0.0	0.0
+chrM	4388	4389	0.0	0.0
+chrM	4389	4390	0.0	0.0
+chrM	4390	4391	0.0	0.0
+chrM	4391	4392	0.0	0.0
+chrM	4392	4393	0.0	0.0
+chrM	4393	4394	0.0	0.0
+chrM	4394	4395	0.0	0.0
+chrM	4395	4396	0.0	0.0
+chrM	4396	4397	0.0	0.0
+chrM	4397	4398	0.0	0.0
+chrM	4398	4399	0.0	0.0
+chrM	4399	4400	0.0	0.0
+chrM	4400	4401	0.0	0.0
+chrM	4401	4402	0.0	0.0
+chrM	4402	4403	0.0	0.0
+chrM	4403	4404	0.0	0.0
+chrM	4404	4405	0.0	0.0
+chrM	4405	4406	0.0	0.0
+chrM	4406	4407	0.0	0.0
+chrM	4407	4408	0.0	0.0
+chrM	4408	4409	0.0	0.0
+chrM	4409	4410	0.0	0.0
+chrM	4410	4411	0.0	0.0
+chrM	4411	4412	0.0	0.0
+chrM	4412	4413	0.0	0.0
+chrM	4413	4414	0.0	0.0
+chrM	4414	4415	0.0	0.0
+chrM	4415	4416	0.0	0.0
+chrM	4416	4417	0.0	0.0
+chrM	4417	4418	0.0	0.0
+chrM	4418	4419	0.0	0.0
+chrM	4419	4420	0.0	0.0
+chrM	4420	4421	0.0	0.0
+chrM	4421	4422	0.0	0.0
+chrM	4422	4423	0.0	0.0
+chrM	4423	4424	0.0	0.0
+chrM	4424	4425	0.0	0.0
+chrM	4425	4426	0.0	0.0
+chrM	4426	4427	0.0	0.0
+chrM	4427	4428	0.0	0.0
+chrM	4428	4429	0.0	0.0
+chrM	4429	4430	0.0	0.0
+chrM	4430	4431	0.0	0.0
+chrM	4431	4432	0.0	0.0
+chrM	4432	4433	0.0	0.0
+chrM	4433	4434	0.0	0.0
+chrM	4434	4435	0.0	0.0
+chrM	4435	4436	0.0	0.0
+chrM	4436	4437	0.0	0.0
+chrM	4437	4438	0.0	0.0
+chrM	4438	4439	0.0	0.0
+chrM	4439	4440	0.0	0.0
+chrM	4440	4441	0.0	0.0
+chrM	4441	4442	0.0	0.0
+chrM	4442	4443	0.0	0.0
+chrM	4443	4444	0.0	0.0
+chrM	4444	4445	0.0	0.0
+chrM	4445	4446	0.0	0.0
+chrM	4446	4447	0.0	0.0
+chrM	4447	4448	0.0	0.0
+chrM	4448	4449	0.0	0.0
+chrM	4449	4450	0.0	0.0
+chrM	4450	4451	0.0	0.0
+chrM	4451	4452	0.0	0.0
+chrM	4452	4453	0.0	0.0
+chrM	4453	4454	0.0	0.0
+chrM	4454	4455	0.0	0.0
+chrM	4455	4456	0.0	0.0
+chrM	4456	4457	0.0	0.0
+chrM	4457	4458	0.0	0.0
+chrM	4458	4459	0.0	0.0
+chrM	4459	4460	0.0	0.0
+chrM	4460	4461	0.0	0.0
+chrM	4461	4462	0.0	0.0
+chrM	4462	4463	0.0	0.0
+chrM	4463	4464	0.0	0.0
+chrM	4464	4465	0.0	0.0
+chrM	4465	4466	0.0	0.0
+chrM	4466	4467	0.0	0.0
+chrM	4467	4468	0.0	0.0
+chrM	4468	4469	0.0	0.0
+chrM	4469	4470	0.0	0.0
+chrM	4470	4471	0.0	0.0
+chrM	4471	4472	0.0	0.0
+chrM	4472	4473	0.0	0.0
+chrM	4473	4474	0.0	0.0
+chrM	4474	4475	0.0	0.0
+chrM	4475	4476	0.0	0.0
+chrM	4476	4477	0.0	0.0
+chrM	4477	4478	0.0	0.0
+chrM	4478	4479	0.0	0.0
+chrM	4479	4480	0.0	0.0
+chrM	4480	4481	0.0	0.0
+chrM	4481	4482	0.0	0.0
+chrM	4482	4483	0.0	0.0
+chrM	4483	4484	0.0	0.0
+chrM	4484	4485	0.0	0.0
+chrM	4485	4486	0.0	0.0
+chrM	4486	4487	0.0	0.0
+chrM	4487	4488	0.0	0.0
+chrM	4488	4489	0.0	0.0
+chrM	4489	4490	0.0	0.0
+chrM	4490	4491	0.0	0.0
+chrM	4491	4492	0.0	0.0
+chrM	4492	4493	0.0	0.0
+chrM	4493	4494	0.0	0.0
+chrM	4494	4495	0.0	0.0
+chrM	4495	4496	0.0	0.0
+chrM	4496	4497	0.0	0.0
+chrM	4497	4498	0.0	0.0
+chrM	4498	4499	0.0	0.0
+chrM	4499	4500	0.0	0.0
+chrM	4500	4501	0.0	0.0
+chrM	4501	4502	0.0	0.0
+chrM	4502	4503	0.0	0.0
+chrM	4503	4504	0.0	0.0
+chrM	4504	4505	0.0	0.0
+chrM	4505	4506	0.0	0.0
+chrM	4506	4507	0.0	0.0
+chrM	4507	4508	0.0	0.0
+chrM	4508	4509	0.0	0.0
+chrM	4509	4510	0.0	0.0
+chrM	4510	4511	0.0	0.0
+chrM	4511	4512	0.0	0.0
+chrM	4512	4513	0.0	0.0
+chrM	4513	4514	0.0	0.0
+chrM	4514	4515	0.0	0.0
+chrM	4515	4516	0.0	0.0
+chrM	4516	4517	0.0	0.0
+chrM	4517	4518	0.0	0.0
+chrM	4518	4519	0.0	0.0
+chrM	4519	4520	0.0	0.0
+chrM	4520	4521	0.0	0.0
+chrM	4521	4522	0.0	0.0
+chrM	4522	4523	0.0	0.0
+chrM	4523	4524	0.0	0.0
+chrM	4524	4525	0.0	0.0
+chrM	4525	4526	0.0	0.0
+chrM	4526	4527	0.0	0.0
+chrM	4527	4528	0.0	0.0
+chrM	4528	4529	0.0	0.0
+chrM	4529	4530	0.0	0.0
+chrM	4530	4531	0.0	0.0
+chrM	4531	4532	0.0	0.0
+chrM	4532	4533	0.0	0.0
+chrM	4533	4534	0.0	0.0
+chrM	4534	4535	0.0	0.0
+chrM	4535	4536	0.0	0.0
+chrM	4536	4537	0.0	0.0
+chrM	4537	4538	0.0	0.0
+chrM	4538	4539	0.0	0.0
+chrM	4539	4540	0.0	0.0
+chrM	4540	4541	0.0	0.0
+chrM	4541	4542	0.0	0.0
+chrM	4542	4543	0.0	0.0
+chrM	4543	4544	0.0	0.0
+chrM	4544	4545	0.0	0.0
+chrM	4545	4546	0.0	0.0
+chrM	4546	4547	0.0	0.0
+chrM	4547	4548	0.0	0.0
+chrM	4548	4549	0.0	0.0
+chrM	4549	4550	0.0	0.0
+chrM	4550	4551	0.0	0.0
+chrM	4551	4552	0.0	0.0
+chrM	4552	4553	0.0	0.0
+chrM	4553	4554	0.0	0.0
+chrM	4554	4555	0.0	0.0
+chrM	4555	4556	0.0	0.0
+chrM	4556	4557	0.0	0.0
+chrM	4557	4558	0.0	0.0
+chrM	4558	4559	0.0	0.0
+chrM	4559	4560	0.0	0.0
+chrM	4560	4561	0.0	0.0
+chrM	4561	4562	0.0	0.0
+chrM	4562	4563	0.0	0.0
+chrM	4563	4564	0.0	0.0
+chrM	4564	4565	0.0	0.0
+chrM	4565	4566	0.0	0.0
+chrM	4566	4567	0.0	0.0
+chrM	4567	4568	0.0	0.0
+chrM	4568	4569	0.0	0.0
+chrM	4569	4570	0.0	0.0
+chrM	4570	4571	0.0	0.0
+chrM	4571	4572	0.0	0.0
+chrM	4572	4573	0.0	0.0
+chrM	4573	4574	0.0	0.0
+chrM	4574	4575	0.0	0.0
+chrM	4575	4576	0.0	0.0
+chrM	4576	4577	0.0	0.0
+chrM	4577	4578	0.0	0.0
+chrM	4578	4579	0.0	0.0
+chrM	4579	4580	0.0	0.0
+chrM	4580	4581	0.0	0.0
+chrM	4581	4582	0.0	0.0
+chrM	4582	4583	0.0	0.0
+chrM	4583	4584	0.0	0.0
+chrM	4584	4585	0.0	0.0
+chrM	4585	4586	0.0	0.0
+chrM	4586	4587	0.0	0.0
+chrM	4587	4588	0.0	0.0
+chrM	4588	4589	0.0	0.0
+chrM	4589	4590	0.0	0.0
+chrM	4590	4591	0.0	0.0
+chrM	4591	4592	0.0	0.0
+chrM	4592	4593	0.0	0.0
+chrM	4593	4594	0.0	0.0
+chrM	4594	4595	0.0	0.0
+chrM	4595	4596	0.0	0.0
+chrM	4596	4597	0.0	0.0
+chrM	4597	4598	0.0	0.0
+chrM	4598	4599	0.0	0.0
+chrM	4599	4600	0.0	0.0
+chrM	4600	4601	0.0	0.0
+chrM	4601	4602	0.0	0.0
+chrM	4602	4603	0.0	0.0
+chrM	4603	4604	0.0	0.0
+chrM	4604	4605	0.0	0.0
+chrM	4605	4606	0.0	0.0
+chrM	4606	4607	0.0	0.0
+chrM	4607	4608	0.0	0.0
+chrM	4608	4609	0.0	0.0
+chrM	4609	4610	0.0	0.0
+chrM	4610	4611	0.0	0.0
+chrM	4611	4612	0.0	0.0
+chrM	4612	4613	0.0	0.0
+chrM	4613	4614	0.0	0.0
+chrM	4614	4615	0.0	0.0
+chrM	4615	4616	0.0	0.0
+chrM	4616	4617	0.0	0.0
+chrM	4617	4618	0.0	0.0
+chrM	4618	4619	0.0	0.0
+chrM	4619	4620	0.0	0.0
+chrM	4620	4621	0.0	0.0
+chrM	4621	4622	0.0	0.0
+chrM	4622	4623	0.0	0.0
+chrM	4623	4624	0.0	0.0
+chrM	4624	4625	0.0	0.0
+chrM	4625	4626	0.0	0.0
+chrM	4626	4627	0.0	0.0
+chrM	4627	4628	0.0	0.0
+chrM	4628	4629	0.0	0.0
+chrM	4629	4630	0.0	0.0
+chrM	4630	4631	0.0	0.0
+chrM	4631	4632	0.0	0.0
+chrM	4632	4633	0.0	0.0
+chrM	4633	4634	0.0	0.0
+chrM	4634	4635	0.0	0.0
+chrM	4635	4636	0.0	0.0
+chrM	4636	4637	0.0	0.0
+chrM	4637	4638	0.0	0.0
+chrM	4638	4639	0.0	0.0
+chrM	4639	4640	0.0	0.0
+chrM	4640	4641	0.0	0.0
+chrM	4641	4642	0.0	0.0
+chrM	4642	4643	0.0	0.0
+chrM	4643	4644	0.0	0.0
+chrM	4644	4645	0.0	0.0
+chrM	4645	4646	0.0	0.0
+chrM	4646	4647	0.0	0.0
+chrM	4647	4648	0.0	0.0
+chrM	4648	4649	0.0	0.0
+chrM	4649	4650	0.0	0.0
+chrM	4650	4651	0.0	0.0
+chrM	4651	4652	0.0	0.0
+chrM	4652	4653	0.0	0.0
+chrM	4653	4654	0.0	0.0
+chrM	4654	4655	0.0	0.0
+chrM	4655	4656	0.0	0.0
+chrM	4656	4657	0.0	0.0
+chrM	4657	4658	0.0	0.0
+chrM	4658	4659	0.0	0.0
+chrM	4659	4660	0.0	0.0
+chrM	4660	4661	0.0	0.0
+chrM	4661	4662	0.0	0.0
+chrM	4662	4663	0.0	0.0
+chrM	4663	4664	0.0	0.0
+chrM	4664	4665	0.0	0.0
+chrM	4665	4666	0.0	0.0
+chrM	4666	4667	0.0	0.0
+chrM	4667	4668	0.0	0.0
+chrM	4668	4669	0.0	0.0
+chrM	4669	4670	0.0	0.0
+chrM	4670	4671	0.0	0.0
+chrM	4671	4672	0.0	0.0
+chrM	4672	4673	0.0	0.0
+chrM	4673	4674	0.0	0.0
+chrM	4674	4675	0.0	0.0
+chrM	4675	4676	0.0	0.0
+chrM	4676	4677	0.0	0.0
+chrM	4677	4678	0.0	0.0
+chrM	4678	4679	0.0	0.0
+chrM	4679	4680	0.0	0.0
+chrM	4680	4681	0.0	0.0
+chrM	4681	4682	0.0	0.0
+chrM	4682	4683	0.0	0.0
+chrM	4683	4684	0.0	0.0
+chrM	4684	4685	0.0	0.0
+chrM	4685	4686	0.0	0.0
+chrM	4686	4687	0.0	0.0
+chrM	4687	4688	0.0	0.0
+chrM	4688	4689	0.0	0.0
+chrM	4689	4690	0.0	0.0
+chrM	4690	4691	0.0	0.0
+chrM	4691	4692	0.0	0.0
+chrM	4692	4693	0.0	0.0
+chrM	4693	4694	0.0	0.0
+chrM	4694	4695	0.0	0.0
+chrM	4695	4696	0.0	0.0
+chrM	4696	4697	0.0	0.0
+chrM	4697	4698	0.0	0.0
+chrM	4698	4699	0.0	0.0
+chrM	4699	4700	0.0	0.0
+chrM	4700	4701	0.0	0.0
+chrM	4701	4702	0.0	0.0
+chrM	4702	4703	0.0	0.0
+chrM	4703	4704	0.0	0.0
+chrM	4704	4705	0.0	0.0
+chrM	4705	4706	0.0	0.0
+chrM	4706	4707	0.0	0.0
+chrM	4707	4708	0.0	0.0
+chrM	4708	4709	0.0	0.0
+chrM	4709	4710	0.0	0.0
+chrM	4710	4711	0.0	0.0
+chrM	4711	4712	0.0	0.0
+chrM	4712	4713	0.0	0.0
+chrM	4713	4714	0.0	0.0
+chrM	4714	4715	0.0	0.0
+chrM	4715	4716	0.0	0.0
+chrM	4716	4717	0.0	0.0
+chrM	4717	4718	0.0	0.0
+chrM	4718	4719	0.0	0.0
+chrM	4719	4720	0.0	0.0
+chrM	4720	4721	0.0	0.0
+chrM	4721	4722	0.0	0.0
+chrM	4722	4723	0.0	0.0
+chrM	4723	4724	0.0	0.0
+chrM	4724	4725	0.0	0.0
+chrM	4725	4726	0.0	0.0
+chrM	4726	4727	0.0	0.0
+chrM	4727	4728	0.0	0.0
+chrM	4728	4729	0.0	0.0
+chrM	4729	4730	0.0	0.0
+chrM	4730	4731	0.0	0.0
+chrM	4731	4732	0.0	0.0
+chrM	4732	4733	0.0	0.0
+chrM	4733	4734	0.0	0.0
+chrM	4734	4735	0.0	0.0
+chrM	4735	4736	0.0	0.0
+chrM	4736	4737	0.0	0.0
+chrM	4737	4738	0.0	0.0
+chrM	4738	4739	0.0	0.0
+chrM	4739	4740	0.0	0.0
+chrM	4740	4741	0.0	0.0
+chrM	4741	4742	0.0	0.0
+chrM	4742	4743	0.0	0.0
+chrM	4743	4744	0.0	0.0
+chrM	4744	4745	0.0	0.0
+chrM	4745	4746	0.0	0.0
+chrM	4746	4747	0.0	0.0
+chrM	4747	4748	0.0	0.0
+chrM	4748	4749	0.0	0.0
+chrM	4749	4750	0.0	0.0
+chrM	4750	4751	0.0	0.0
+chrM	4751	4752	0.0	0.0
+chrM	4752	4753	0.0	0.0
+chrM	4753	4754	0.0	0.0
+chrM	4754	4755	0.0	0.0
+chrM	4755	4756	0.0	0.0
+chrM	4756	4757	0.0	0.0
+chrM	4757	4758	0.0	0.0
+chrM	4758	4759	0.0	0.0
+chrM	4759	4760	0.0	0.0
+chrM	4760	4761	0.0	0.0
+chrM	4761	4762	0.0	0.0
+chrM	4762	4763	0.0	0.0
+chrM	4763	4764	0.0	0.0
+chrM	4764	4765	0.0	0.0
+chrM	4765	4766	0.0	0.0
+chrM	4766	4767	0.0	0.0
+chrM	4767	4768	0.0	0.0
+chrM	4768	4769	0.0	0.0
+chrM	4769	4770	0.0	0.0
+chrM	4770	4771	0.0	0.0
+chrM	4771	4772	0.0	0.0
+chrM	4772	4773	0.0	0.0
+chrM	4773	4774	0.0	0.0
+chrM	4774	4775	0.0	0.0
+chrM	4775	4776	0.0	0.0
+chrM	4776	4777	0.0	0.0
+chrM	4777	4778	0.0	0.0
+chrM	4778	4779	0.0	0.0
+chrM	4779	4780	0.0	0.0
+chrM	4780	4781	0.0	0.0
+chrM	4781	4782	0.0	0.0
+chrM	4782	4783	0.0	0.0
+chrM	4783	4784	0.0	0.0
+chrM	4784	4785	0.0	0.0
+chrM	4785	4786	0.0	0.0
+chrM	4786	4787	0.0	0.0
+chrM	4787	4788	0.0	0.0
+chrM	4788	4789	0.0	0.0
+chrM	4789	4790	0.0	0.0
+chrM	4790	4791	0.0	0.0
+chrM	4791	4792	0.0	0.0
+chrM	4792	4793	0.0	0.0
+chrM	4793	4794	0.0	0.0
+chrM	4794	4795	0.0	0.0
+chrM	4795	4796	0.0	0.0
+chrM	4796	4797	0.0	0.0
+chrM	4797	4798	0.0	0.0
+chrM	4798	4799	0.0	0.0
+chrM	4799	4800	0.0	0.0
+chrM	4800	4801	0.0	0.0
+chrM	4801	4802	0.0	0.0
+chrM	4802	4803	0.0	0.0
+chrM	4803	4804	0.0	0.0
+chrM	4804	4805	0.0	0.0
+chrM	4805	4806	0.0	0.0
+chrM	4806	4807	0.0	0.0
+chrM	4807	4808	0.0	0.0
+chrM	4808	4809	0.0	0.0
+chrM	4809	4810	0.0	0.0
+chrM	4810	4811	0.0	0.0
+chrM	4811	4812	0.0	0.0
+chrM	4812	4813	0.0	0.0
+chrM	4813	4814	0.0	0.0
+chrM	4814	4815	0.0	0.0
+chrM	4815	4816	0.0	0.0
+chrM	4816	4817	0.0	0.0
+chrM	4817	4818	0.0	0.0
+chrM	4818	4819	0.0	0.0
+chrM	4819	4820	0.0	0.0
+chrM	4820	4821	0.0	0.0
+chrM	4821	4822	0.0	0.0
+chrM	4822	4823	0.0	0.0
+chrM	4823	4824	0.0	0.0
+chrM	4824	4825	0.0	0.0
+chrM	4825	4826	0.0	0.0
+chrM	4826	4827	0.0	0.0
+chrM	4827	4828	0.0	0.0
+chrM	4828	4829	0.0	0.0
+chrM	4829	4830	0.0	0.0
+chrM	4830	4831	0.0	0.0
+chrM	4831	4832	0.0	0.0
+chrM	4832	4833	0.0	0.0
+chrM	4833	4834	0.0	0.0
+chrM	4834	4835	0.0	0.0
+chrM	4835	4836	0.0	0.0
+chrM	4836	4837	0.0	0.0
+chrM	4837	4838	0.0	0.0
+chrM	4838	4839	0.0	0.0
+chrM	4839	4840	0.0	0.0
+chrM	4840	4841	0.0	0.0
+chrM	4841	4842	0.0	0.0
+chrM	4842	4843	0.0	0.0
+chrM	4843	4844	0.0	0.0
+chrM	4844	4845	0.0	0.0
+chrM	4845	4846	0.0	0.0
+chrM	4846	4847	0.0	0.0
+chrM	4847	4848	0.0	0.0
+chrM	4848	4849	0.0	0.0
+chrM	4849	4850	0.0	0.0
+chrM	4850	4851	0.0	0.0
+chrM	4851	4852	0.0	0.0
+chrM	4852	4853	0.0	0.0
+chrM	4853	4854	0.0	0.0
+chrM	4854	4855	0.0	0.0
+chrM	4855	4856	0.0	0.0
+chrM	4856	4857	0.0	0.0
+chrM	4857	4858	0.0	0.0
+chrM	4858	4859	0.0	0.0
+chrM	4859	4860	0.0	0.0
+chrM	4860	4861	0.0	0.0
+chrM	4861	4862	0.0	0.0
+chrM	4862	4863	0.0	0.0
+chrM	4863	4864	0.0	0.0
+chrM	4864	4865	0.0	0.0
+chrM	4865	4866	0.0	0.0
+chrM	4866	4867	0.0	0.0
+chrM	4867	4868	0.0	0.0
+chrM	4868	4869	0.0	0.0
+chrM	4869	4870	0.0	0.0
+chrM	4870	4871	0.0	0.0
+chrM	4871	4872	0.0	0.0
+chrM	4872	4873	0.0	0.0
+chrM	4873	4874	0.0	0.0
+chrM	4874	4875	0.0	0.0
+chrM	4875	4876	0.0	0.0
+chrM	4876	4877	0.0	0.0
+chrM	4877	4878	0.0	0.0
+chrM	4878	4879	0.0	0.0
+chrM	4879	4880	0.0	0.0
+chrM	4880	4881	0.0	0.0
+chrM	4881	4882	0.0	0.0
+chrM	4882	4883	0.0	0.0
+chrM	4883	4884	0.0	0.0
+chrM	4884	4885	0.0	0.0
+chrM	4885	4886	0.0	0.0
+chrM	4886	4887	0.0	0.0
+chrM	4887	4888	0.0	0.0
+chrM	4888	4889	0.0	0.0
+chrM	4889	4890	0.0	0.0
+chrM	4890	4891	0.0	0.0
+chrM	4891	4892	0.0	0.0
+chrM	4892	4893	0.0	0.0
+chrM	4893	4894	0.0	0.0
+chrM	4894	4895	0.0	0.0
+chrM	4895	4896	0.0	0.0
+chrM	4896	4897	0.0	0.0
+chrM	4897	4898	0.0	0.0
+chrM	4898	4899	0.0	0.0
+chrM	4899	4900	0.0	0.0
+chrM	4900	4901	0.0	0.0
+chrM	4901	4902	0.0	0.0
+chrM	4902	4903	0.0	0.0
+chrM	4903	4904	0.0	0.0
+chrM	4904	4905	0.0	0.0
+chrM	4905	4906	0.0	0.0
+chrM	4906	4907	0.0	0.0
+chrM	4907	4908	0.0	0.0
+chrM	4908	4909	0.0	0.0
+chrM	4909	4910	0.0	0.0
+chrM	4910	4911	0.0	0.0
+chrM	4911	4912	0.0	0.0
+chrM	4912	4913	0.0	0.0
+chrM	4913	4914	0.0	0.0
+chrM	4914	4915	0.0	0.0
+chrM	4915	4916	0.0	0.0
+chrM	4916	4917	0.0	0.0
+chrM	4917	4918	0.0	0.0
+chrM	4918	4919	0.0	0.0
+chrM	4919	4920	0.0	0.0
+chrM	4920	4921	0.0	0.0
+chrM	4921	4922	0.0	0.0
+chrM	4922	4923	0.0	0.0
+chrM	4923	4924	0.0	0.0
+chrM	4924	4925	0.0	0.0
+chrM	4925	4926	0.0	0.0
+chrM	4926	4927	0.0	0.0
+chrM	4927	4928	0.0	0.0
+chrM	4928	4929	0.0	0.0
+chrM	4929	4930	0.0	0.0
+chrM	4930	4931	0.0	0.0
+chrM	4931	4932	0.0	0.0
+chrM	4932	4933	0.0	0.0
+chrM	4933	4934	0.0	0.0
+chrM	4934	4935	0.0	0.0
+chrM	4935	4936	0.0	0.0
+chrM	4936	4937	0.0	0.0
+chrM	4937	4938	0.0	0.0
+chrM	4938	4939	0.0	0.0
+chrM	4939	4940	0.0	0.0
+chrM	4940	4941	0.0	0.0
+chrM	4941	4942	0.0	0.0
+chrM	4942	4943	0.0	0.0
+chrM	4943	4944	0.0	0.0
+chrM	4944	4945	0.0	0.0
+chrM	4945	4946	0.0	0.0
+chrM	4946	4947	0.0	0.0
+chrM	4947	4948	0.0	0.0
+chrM	4948	4949	0.0	0.0
+chrM	4949	4950	0.0	0.0
+chrM	4950	4951	0.0	0.0
+chrM	4951	4952	0.0	0.0
+chrM	4952	4953	0.0	0.0
+chrM	4953	4954	0.0	0.0
+chrM	4954	4955	0.0	0.0
+chrM	4955	4956	0.0	0.0
+chrM	4956	4957	0.0	0.0
+chrM	4957	4958	0.0	0.0
+chrM	4958	4959	0.0	0.0
+chrM	4959	4960	0.0	0.0
+chrM	4960	4961	0.0	0.0
+chrM	4961	4962	0.0	0.0
+chrM	4962	4963	0.0	0.0
+chrM	4963	4964	0.0	0.0
+chrM	4964	4965	0.0	0.0
+chrM	4965	4966	0.0	0.0
+chrM	4966	4967	0.0	0.0
+chrM	4967	4968	0.0	0.0
+chrM	4968	4969	0.0	0.0
+chrM	4969	4970	0.0	0.0
+chrM	4970	4971	0.0	0.0
+chrM	4971	4972	0.0	0.0
+chrM	4972	4973	0.0	0.0
+chrM	4973	4974	0.0	0.0
+chrM	4974	4975	0.0	0.0
+chrM	4975	4976	0.0	0.0
+chrM	4976	4977	0.0	0.0
+chrM	4977	4978	0.0	0.0
+chrM	4978	4979	0.0	0.0
+chrM	4979	4980	0.0	0.0
+chrM	4980	4981	0.0	0.0
+chrM	4981	4982	0.0	0.0
+chrM	4982	4983	0.0	0.0
+chrM	4983	4984	0.0	0.0
+chrM	4984	4985	0.0	0.0
+chrM	4985	4986	0.0	0.0
+chrM	4986	4987	0.0	0.0
+chrM	4987	4988	0.0	0.0
+chrM	4988	4989	0.0	0.0
+chrM	4989	4990	0.0	0.0
+chrM	4990	4991	0.0	0.0
+chrM	4991	4992	0.0	0.0
+chrM	4992	4993	0.0	0.0
+chrM	4993	4994	0.0	0.0
+chrM	4994	4995	0.0	0.0
+chrM	4995	4996	0.0	0.0
+chrM	4996	4997	0.0	0.0
+chrM	4997	4998	0.0	0.0
+chrM	4998	4999	0.0	0.0
+chrM	4999	5000	0.0	0.0
+chrM	5000	5001	0.0	0.0
+chrM	5001	5002	0.0	0.0
+chrM	5002	5003	0.0	0.0
+chrM	5003	5004	0.0	0.0
+chrM	5004	5005	0.0	0.0
+chrM	5005	5006	0.0	0.0
+chrM	5006	5007	0.0	0.0
+chrM	5007	5008	0.0	0.0
+chrM	5008	5009	0.0	0.0
+chrM	5009	5010	0.0	0.0
+chrM	5010	5011	0.0	0.0
+chrM	5011	5012	0.0	0.0
+chrM	5012	5013	0.0	0.0
+chrM	5013	5014	0.0	0.0
+chrM	5014	5015	0.0	0.0
+chrM	5015	5016	0.0	0.0
+chrM	5016	5017	0.0	0.0
+chrM	5017	5018	0.0	0.0
+chrM	5018	5019	0.0	0.0
+chrM	5019	5020	0.0	0.0
+chrM	5020	5021	0.0	0.0
+chrM	5021	5022	0.0	0.0
+chrM	5022	5023	0.0	0.0
+chrM	5023	5024	0.0	0.0
+chrM	5024	5025	0.0	0.0
+chrM	5025	5026	0.0	0.0
+chrM	5026	5027	0.0	0.0
+chrM	5027	5028	0.0	0.0
+chrM	5028	5029	0.0	0.0
+chrM	5029	5030	0.0	0.0
+chrM	5030	5031	0.0	0.0
+chrM	5031	5032	0.0	0.0
+chrM	5032	5033	0.0	0.0
+chrM	5033	5034	0.0	0.0
+chrM	5034	5035	0.0	0.0
+chrM	5035	5036	0.0	0.0
+chrM	5036	5037	0.0	0.0
+chrM	5037	5038	0.0	0.0
+chrM	5038	5039	0.0	0.0
+chrM	5039	5040	0.0	0.0
+chrM	5040	5041	0.0	0.0
+chrM	5041	5042	0.0	0.0
+chrM	5042	5043	0.0	0.0
+chrM	5043	5044	0.0	0.0
+chrM	5044	5045	0.0	0.0
+chrM	5045	5046	0.0	0.0
+chrM	5046	5047	0.0	0.0
+chrM	5047	5048	0.0	0.0
+chrM	5048	5049	0.0	0.0
+chrM	5049	5050	0.0	0.0
+chrM	5050	5051	0.0	0.0
+chrM	5051	5052	0.0	0.0
+chrM	5052	5053	0.0	0.0
+chrM	5053	5054	0.0	0.0
+chrM	5054	5055	0.0	0.0
+chrM	5055	5056	0.0	0.0
+chrM	5056	5057	0.0	0.0
+chrM	5057	5058	0.0	0.0
+chrM	5058	5059	0.0	0.0
+chrM	5059	5060	0.0	0.0
+chrM	5060	5061	0.0	0.0
+chrM	5061	5062	0.0	0.0
+chrM	5062	5063	0.0	0.0
+chrM	5063	5064	0.0	0.0
+chrM	5064	5065	0.0	0.0
+chrM	5065	5066	0.0	0.0
+chrM	5066	5067	0.0	0.0
+chrM	5067	5068	0.0	0.0
+chrM	5068	5069	0.0	0.0
+chrM	5069	5070	0.0	0.0
+chrM	5070	5071	0.0	0.0
+chrM	5071	5072	0.0	0.0
+chrM	5072	5073	0.0	0.0
+chrM	5073	5074	0.0	0.0
+chrM	5074	5075	0.0	0.0
+chrM	5075	5076	0.0	0.0
+chrM	5076	5077	0.0	0.0
+chrM	5077	5078	0.0	0.0
+chrM	5078	5079	0.0	0.0
+chrM	5079	5080	0.0	0.0
+chrM	5080	5081	0.0	0.0
+chrM	5081	5082	0.0	0.0
+chrM	5082	5083	0.0	0.0
+chrM	5083	5084	0.0	0.0
+chrM	5084	5085	0.0	0.0
+chrM	5085	5086	0.0	0.0
+chrM	5086	5087	0.0	0.0
+chrM	5087	5088	0.0	0.0
+chrM	5088	5089	0.0	0.0
+chrM	5089	5090	0.0	0.0
+chrM	5090	5091	0.0	0.0
+chrM	5091	5092	0.0	0.0
+chrM	5092	5093	0.0	0.0
+chrM	5093	5094	0.0	0.0
+chrM	5094	5095	0.0	0.0
+chrM	5095	5096	0.0	0.0
+chrM	5096	5097	0.0	0.0
+chrM	5097	5098	0.0	0.0
+chrM	5098	5099	0.0	0.0
+chrM	5099	5100	0.0	0.0
+chrM	5100	5101	0.0	0.0
+chrM	5101	5102	0.0	0.0
+chrM	5102	5103	0.0	0.0
+chrM	5103	5104	0.0	0.0
+chrM	5104	5105	0.0	0.0
+chrM	5105	5106	0.0	0.0
+chrM	5106	5107	0.0	0.0
+chrM	5107	5108	0.0	0.0
+chrM	5108	5109	0.0	0.0
+chrM	5109	5110	0.0	0.0
+chrM	5110	5111	0.0	0.0
+chrM	5111	5112	0.0	0.0
+chrM	5112	5113	0.0	0.0
+chrM	5113	5114	0.0	0.0
+chrM	5114	5115	0.0	0.0
+chrM	5115	5116	0.0	0.0
+chrM	5116	5117	0.0	0.0
+chrM	5117	5118	0.0	0.0
+chrM	5118	5119	0.0	0.0
+chrM	5119	5120	0.0	0.0
+chrM	5120	5121	0.0	0.0
+chrM	5121	5122	0.0	0.0
+chrM	5122	5123	0.0	0.0
+chrM	5123	5124	0.0	0.0
+chrM	5124	5125	0.0	0.0
+chrM	5125	5126	0.0	0.0
+chrM	5126	5127	0.0	0.0
+chrM	5127	5128	0.0	0.0
+chrM	5128	5129	0.0	0.0
+chrM	5129	5130	0.0	0.0
+chrM	5130	5131	0.0	0.0
+chrM	5131	5132	0.0	0.0
+chrM	5132	5133	0.0	0.0
+chrM	5133	5134	0.0	0.0
+chrM	5134	5135	0.0	0.0
+chrM	5135	5136	0.0	0.0
+chrM	5136	5137	0.0	0.0
+chrM	5137	5138	0.0	0.0
+chrM	5138	5139	0.0	0.0
+chrM	5139	5140	0.0	0.0
+chrM	5140	5141	0.0	0.0
+chrM	5141	5142	0.0	0.0
+chrM	5142	5143	0.0	0.0
+chrM	5143	5144	0.0	0.0
+chrM	5144	5145	0.0	0.0
+chrM	5145	5146	0.0	0.0
+chrM	5146	5147	0.0	0.0
+chrM	5147	5148	0.0	0.0
+chrM	5148	5149	0.0	0.0
+chrM	5149	5150	0.0	0.0
+chrM	5150	5151	0.0	0.0
+chrM	5151	5152	0.0	0.0
+chrM	5152	5153	0.0	0.0
+chrM	5153	5154	0.0	0.0
+chrM	5154	5155	0.0	0.0
+chrM	5155	5156	0.0	0.0
+chrM	5156	5157	0.0	0.0
+chrM	5157	5158	0.0	0.0
+chrM	5158	5159	0.0	0.0
+chrM	5159	5160	0.0	0.0
+chrM	5160	5161	0.0	0.0
+chrM	5161	5162	0.0	0.0
+chrM	5162	5163	0.0	0.0
+chrM	5163	5164	0.0	0.0
+chrM	5164	5165	0.0	0.0
+chrM	5165	5166	0.0	0.0
+chrM	5166	5167	0.0	0.0
+chrM	5167	5168	0.0	0.0
+chrM	5168	5169	0.0	0.0
+chrM	5169	5170	0.0	0.0
+chrM	5170	5171	0.0	0.0
+chrM	5171	5172	0.0	0.0
+chrM	5172	5173	0.0	0.0
+chrM	5173	5174	0.0	0.0
+chrM	5174	5175	0.0	0.0
+chrM	5175	5176	0.0	0.0
+chrM	5176	5177	0.0	0.0
+chrM	5177	5178	0.0	0.0
+chrM	5178	5179	0.0	0.0
+chrM	5179	5180	0.0	0.0
+chrM	5180	5181	0.0	0.0
+chrM	5181	5182	0.0	0.0
+chrM	5182	5183	0.0	0.0
+chrM	5183	5184	0.0	0.0
+chrM	5184	5185	0.0	0.0
+chrM	5185	5186	0.0	0.0
+chrM	5186	5187	0.0	0.0
+chrM	5187	5188	0.0	0.0
+chrM	5188	5189	0.0	0.0
+chrM	5189	5190	0.0	0.0
+chrM	5190	5191	0.0	0.0
+chrM	5191	5192	0.0	0.0
+chrM	5192	5193	0.0	0.0
+chrM	5193	5194	0.0	0.0
+chrM	5194	5195	0.0	0.0
+chrM	5195	5196	0.0	0.0
+chrM	5196	5197	0.0	0.0
+chrM	5197	5198	0.0	0.0
+chrM	5198	5199	0.0	0.0
+chrM	5199	5200	0.0	0.0
+chrM	5200	5201	0.0	0.0
+chrM	5201	5202	0.0	0.0
+chrM	5202	5203	0.0	0.0
+chrM	5203	5204	0.0	0.0
+chrM	5204	5205	0.0	0.0
+chrM	5205	5206	0.0	0.0
+chrM	5206	5207	0.0	0.0
+chrM	5207	5208	0.0	0.0
+chrM	5208	5209	0.0	0.0
+chrM	5209	5210	0.0	0.0
+chrM	5210	5211	0.0	0.0
+chrM	5211	5212	0.0	0.0
+chrM	5212	5213	0.0	0.0
+chrM	5213	5214	0.0	0.0
+chrM	5214	5215	0.0	0.0
+chrM	5215	5216	0.0	0.0
+chrM	5216	5217	0.0	0.0
+chrM	5217	5218	0.0	0.0
+chrM	5218	5219	0.0	0.0
+chrM	5219	5220	0.0	0.0
+chrM	5220	5221	0.0	0.0
+chrM	5221	5222	0.0	0.0
+chrM	5222	5223	0.0	0.0
+chrM	5223	5224	0.0	0.0
+chrM	5224	5225	0.0	0.0
+chrM	5225	5226	0.0	0.0
+chrM	5226	5227	0.0	0.0
+chrM	5227	5228	0.0	0.0
+chrM	5228	5229	0.0	0.0
+chrM	5229	5230	0.0	0.0
+chrM	5230	5231	0.0	0.0
+chrM	5231	5232	0.0	0.0
+chrM	5232	5233	0.0	0.0
+chrM	5233	5234	0.0	0.0
+chrM	5234	5235	0.0	0.0
+chrM	5235	5236	0.0	0.0
+chrM	5236	5237	0.0	0.0
+chrM	5237	5238	0.0	0.0
+chrM	5238	5239	0.0	0.0
+chrM	5239	5240	0.0	0.0
+chrM	5240	5241	0.0	0.0
+chrM	5241	5242	0.0	0.0
+chrM	5242	5243	0.0	0.0
+chrM	5243	5244	0.0	0.0
+chrM	5244	5245	0.0	0.0
+chrM	5245	5246	0.0	0.0
+chrM	5246	5247	0.0	0.0
+chrM	5247	5248	0.0	0.0
+chrM	5248	5249	0.0	0.0
+chrM	5249	5250	0.0	0.0
+chrM	5250	5251	0.0	0.0
+chrM	5251	5252	0.0	0.0
+chrM	5252	5253	0.0	0.0
+chrM	5253	5254	0.0	0.0
+chrM	5254	5255	0.0	0.0
+chrM	5255	5256	0.0	0.0
+chrM	5256	5257	0.0	0.0
+chrM	5257	5258	0.0	0.0
+chrM	5258	5259	0.0	0.0
+chrM	5259	5260	0.0	0.0
+chrM	5260	5261	0.0	0.0
+chrM	5261	5262	0.0	0.0
+chrM	5262	5263	0.0	0.0
+chrM	5263	5264	0.0	0.0
+chrM	5264	5265	0.0	0.0
+chrM	5265	5266	0.0	0.0
+chrM	5266	5267	0.0	0.0
+chrM	5267	5268	0.0	0.0
+chrM	5268	5269	0.0	0.0
+chrM	5269	5270	0.0	0.0
+chrM	5270	5271	0.0	0.0
+chrM	5271	5272	0.0	0.0
+chrM	5272	5273	0.0	0.0
+chrM	5273	5274	0.0	0.0
+chrM	5274	5275	0.0	0.0
+chrM	5275	5276	0.0	0.0
+chrM	5276	5277	0.0	0.0
+chrM	5277	5278	0.0	0.0
+chrM	5278	5279	0.0	0.0
+chrM	5279	5280	0.0	0.0
+chrM	5280	5281	0.0	0.0
+chrM	5281	5282	0.0	0.0
+chrM	5282	5283	0.0	0.0
+chrM	5283	5284	0.0	0.0
+chrM	5284	5285	0.0	0.0
+chrM	5285	5286	0.0	0.0
+chrM	5286	5287	0.0	0.0
+chrM	5287	5288	0.0	0.0
+chrM	5288	5289	0.0	0.0
+chrM	5289	5290	0.0	0.0
+chrM	5290	5291	0.0	0.0
+chrM	5291	5292	0.0	0.0
+chrM	5292	5293	0.0	0.0
+chrM	5293	5294	0.0	0.0
+chrM	5294	5295	0.0	0.0
+chrM	5295	5296	0.0	0.0
+chrM	5296	5297	0.0	0.0
+chrM	5297	5298	0.0	0.0
+chrM	5298	5299	0.0	0.0
+chrM	5299	5300	0.0	0.0
+chrM	5300	5301	0.0	0.0
+chrM	5301	5302	0.0	0.0
+chrM	5302	5303	0.0	0.0
+chrM	5303	5304	0.0	0.0
+chrM	5304	5305	0.0	0.0
+chrM	5305	5306	0.0	0.0
+chrM	5306	5307	0.0	0.0
+chrM	5307	5308	0.0	0.0
+chrM	5308	5309	0.0	0.0
+chrM	5309	5310	0.0	0.0
+chrM	5310	5311	0.0	0.0
+chrM	5311	5312	0.0	0.0
+chrM	5312	5313	0.0	0.0
+chrM	5313	5314	0.0	0.0
+chrM	5314	5315	0.0	0.0
+chrM	5315	5316	0.0	0.0
+chrM	5316	5317	0.0	0.0
+chrM	5317	5318	0.0	0.0
+chrM	5318	5319	0.0	0.0
+chrM	5319	5320	0.0	0.0
+chrM	5320	5321	0.0	0.0
+chrM	5321	5322	0.0	0.0
+chrM	5322	5323	0.0	0.0
+chrM	5323	5324	0.0	0.0
+chrM	5324	5325	0.0	0.0
+chrM	5325	5326	0.0	0.0
+chrM	5326	5327	0.0	0.0
+chrM	5327	5328	0.0	0.0
+chrM	5328	5329	0.0	0.0
+chrM	5329	5330	0.0	0.0
+chrM	5330	5331	0.0	0.0
+chrM	5331	5332	0.0	0.0
+chrM	5332	5333	0.0	0.0
+chrM	5333	5334	0.0	0.0
+chrM	5334	5335	0.0	0.0
+chrM	5335	5336	0.0	0.0
+chrM	5336	5337	0.0	0.0
+chrM	5337	5338	0.0	0.0
+chrM	5338	5339	0.0	0.0
+chrM	5339	5340	0.0	0.0
+chrM	5340	5341	0.0	0.0
+chrM	5341	5342	0.0	0.0
+chrM	5342	5343	0.0	0.0
+chrM	5343	5344	0.0	0.0
+chrM	5344	5345	0.0	0.0
+chrM	5345	5346	0.0	0.0
+chrM	5346	5347	0.0	0.0
+chrM	5347	5348	0.0	0.0
+chrM	5348	5349	0.0	0.0
+chrM	5349	5350	0.0	0.0
+chrM	5350	5351	0.0	0.0
+chrM	5351	5352	0.0	0.0
+chrM	5352	5353	0.0	0.0
+chrM	5353	5354	0.0	0.0
+chrM	5354	5355	0.0	0.0
+chrM	5355	5356	0.0	0.0
+chrM	5356	5357	0.0	0.0
+chrM	5357	5358	0.0	0.0
+chrM	5358	5359	0.0	0.0
+chrM	5359	5360	0.0	0.0
+chrM	5360	5361	0.0	0.0
+chrM	5361	5362	0.0	0.0
+chrM	5362	5363	0.0	0.0
+chrM	5363	5364	0.0	0.0
+chrM	5364	5365	0.0	0.0
+chrM	5365	5366	0.0	0.0
+chrM	5366	5367	0.0	0.0
+chrM	5367	5368	0.0	0.0
+chrM	5368	5369	0.0	0.0
+chrM	5369	5370	0.0	0.0
+chrM	5370	5371	0.0	0.0
+chrM	5371	5372	0.0	0.0
+chrM	5372	5373	0.0	0.0
+chrM	5373	5374	0.0	0.0
+chrM	5374	5375	0.0	0.0
+chrM	5375	5376	0.0	0.0
+chrM	5376	5377	0.0	0.0
+chrM	5377	5378	0.0	0.0
+chrM	5378	5379	0.0	0.0
+chrM	5379	5380	0.0	0.0
+chrM	5380	5381	0.0	0.0
+chrM	5381	5382	0.0	0.0
+chrM	5382	5383	0.0	0.0
+chrM	5383	5384	0.0	0.0
+chrM	5384	5385	0.0	0.0
+chrM	5385	5386	0.0	0.0
+chrM	5386	5387	0.0	0.0
+chrM	5387	5388	0.0	0.0
+chrM	5388	5389	0.0	0.0
+chrM	5389	5390	0.0	0.0
+chrM	5390	5391	0.0	0.0
+chrM	5391	5392	0.0	0.0
+chrM	5392	5393	0.0	0.0
+chrM	5393	5394	0.0	0.0
+chrM	5394	5395	0.0	0.0
+chrM	5395	5396	0.0	0.0
+chrM	5396	5397	0.0	0.0
+chrM	5397	5398	0.0	0.0
+chrM	5398	5399	0.0	0.0
+chrM	5399	5400	0.0	0.0
+chrM	5400	5401	0.0	0.0
+chrM	5401	5402	0.0	0.0
+chrM	5402	5403	0.0	0.0
+chrM	5403	5404	0.0	0.0
+chrM	5404	5405	0.0	0.0
+chrM	5405	5406	0.0	0.0
+chrM	5406	5407	0.0	0.0
+chrM	5407	5408	0.0	0.0
+chrM	5408	5409	0.0	0.0
+chrM	5409	5410	0.0	0.0
+chrM	5410	5411	0.0	0.0
+chrM	5411	5412	0.0	0.0
+chrM	5412	5413	0.0	0.0
+chrM	5413	5414	0.0	0.0
+chrM	5414	5415	0.0	0.0
+chrM	5415	5416	0.0	0.0
+chrM	5416	5417	0.0	0.0
+chrM	5417	5418	0.0	0.0
+chrM	5418	5419	0.0	0.0
+chrM	5419	5420	0.0	0.0
+chrM	5420	5421	0.0	0.0
+chrM	5421	5422	0.0	0.0
+chrM	5422	5423	0.0	0.0
+chrM	5423	5424	0.0	0.0
+chrM	5424	5425	0.0	0.0
+chrM	5425	5426	0.0	0.0
+chrM	5426	5427	0.0	0.0
+chrM	5427	5428	0.0	0.0
+chrM	5428	5429	0.0	0.0
+chrM	5429	5430	0.0	0.0
+chrM	5430	5431	0.0	0.0
+chrM	5431	5432	0.0	0.0
+chrM	5432	5433	0.0	0.0
+chrM	5433	5434	0.0	0.0
+chrM	5434	5435	0.0	0.0
+chrM	5435	5436	0.0	0.0
+chrM	5436	5437	0.0	0.0
+chrM	5437	5438	0.0	0.0
+chrM	5438	5439	0.0	0.0
+chrM	5439	5440	0.0	0.0
+chrM	5440	5441	0.0	0.0
+chrM	5441	5442	0.0	0.0
+chrM	5442	5443	0.0	0.0
+chrM	5443	5444	0.0	0.0
+chrM	5444	5445	0.0	0.0
+chrM	5445	5446	0.0	0.0
+chrM	5446	5447	0.0	0.0
+chrM	5447	5448	0.0	0.0
+chrM	5448	5449	0.0	0.0
+chrM	5449	5450	0.0	0.0
+chrM	5450	5451	0.0	0.0
+chrM	5451	5452	0.0	0.0
+chrM	5452	5453	0.0	0.0
+chrM	5453	5454	0.0	0.0
+chrM	5454	5455	0.0	0.0
+chrM	5455	5456	0.0	0.0
+chrM	5456	5457	0.0	0.0
+chrM	5457	5458	0.0	0.0
+chrM	5458	5459	0.0	0.0
+chrM	5459	5460	0.0	0.0
+chrM	5460	5461	0.0	0.0
+chrM	5461	5462	0.0	0.0
+chrM	5462	5463	0.0	0.0
+chrM	5463	5464	0.0	0.0
+chrM	5464	5465	0.0	0.0
+chrM	5465	5466	0.0	0.0
+chrM	5466	5467	0.0	0.0
+chrM	5467	5468	0.0	0.0
+chrM	5468	5469	0.0	0.0
+chrM	5469	5470	0.0	0.0
+chrM	5470	5471	0.0	0.0
+chrM	5471	5472	0.0	0.0
+chrM	5472	5473	0.0	0.0
+chrM	5473	5474	0.0	0.0
+chrM	5474	5475	0.0	0.0
+chrM	5475	5476	0.0	0.0
+chrM	5476	5477	0.0	0.0
+chrM	5477	5478	0.0	0.0
+chrM	5478	5479	0.0	0.0
+chrM	5479	5480	0.0	0.0
+chrM	5480	5481	0.0	0.0
+chrM	5481	5482	0.0	0.0
+chrM	5482	5483	0.0	0.0
+chrM	5483	5484	0.0	0.0
+chrM	5484	5485	0.0	0.0
+chrM	5485	5486	0.0	0.0
+chrM	5486	5487	0.0	0.0
+chrM	5487	5488	0.0	0.0
+chrM	5488	5489	0.0	0.0
+chrM	5489	5490	0.0	0.0
+chrM	5490	5491	0.0	0.0
+chrM	5491	5492	0.0	0.0
+chrM	5492	5493	0.0	0.0
+chrM	5493	5494	0.0	0.0
+chrM	5494	5495	0.0	0.0
+chrM	5495	5496	0.0	0.0
+chrM	5496	5497	0.0	0.0
+chrM	5497	5498	0.0	0.0
+chrM	5498	5499	0.0	0.0
+chrM	5499	5500	0.0	0.0
+chrM	5500	5501	0.0	0.0
+chrM	5501	5502	0.0	0.0
+chrM	5502	5503	0.0	0.0
+chrM	5503	5504	0.0	0.0
+chrM	5504	5505	0.0	0.0
+chrM	5505	5506	0.0	0.0
+chrM	5506	5507	0.0	0.0
+chrM	5507	5508	0.0	0.0
+chrM	5508	5509	0.0	0.0
+chrM	5509	5510	0.0	0.0
+chrM	5510	5511	0.0	0.0
+chrM	5511	5512	0.0	0.0
+chrM	5512	5513	0.0	0.0
+chrM	5513	5514	0.0	0.0
+chrM	5514	5515	0.0	0.0
+chrM	5515	5516	0.0	0.0
+chrM	5516	5517	0.0	0.0
+chrM	5517	5518	0.0	0.0
+chrM	5518	5519	0.0	0.0
+chrM	5519	5520	0.0	0.0
+chrM	5520	5521	0.0	0.0
+chrM	5521	5522	0.0	0.0
+chrM	5522	5523	0.0	0.0
+chrM	5523	5524	0.0	0.0
+chrM	5524	5525	0.0	0.0
+chrM	5525	5526	0.0	0.0
+chrM	5526	5527	0.0	0.0
+chrM	5527	5528	0.0	0.0
+chrM	5528	5529	0.0	0.0
+chrM	5529	5530	0.0	0.0
+chrM	5530	5531	0.0	0.0
+chrM	5531	5532	0.0	0.0
+chrM	5532	5533	0.0	0.0
+chrM	5533	5534	0.0	0.0
+chrM	5534	5535	0.0	0.0
+chrM	5535	5536	0.0	0.0
+chrM	5536	5537	0.0	0.0
+chrM	5537	5538	0.0	0.0
+chrM	5538	5539	0.0	0.0
+chrM	5539	5540	0.0	0.0
+chrM	5540	5541	0.0	0.0
+chrM	5541	5542	0.0	0.0
+chrM	5542	5543	0.0	0.0
+chrM	5543	5544	0.0	0.0
+chrM	5544	5545	0.0	0.0
+chrM	5545	5546	0.0	0.0
+chrM	5546	5547	0.0	0.0
+chrM	5547	5548	0.0	0.0
+chrM	5548	5549	0.0	0.0
+chrM	5549	5550	0.0	0.0
+chrM	5550	5551	0.0	0.0
+chrM	5551	5552	0.0	0.0
+chrM	5552	5553	0.0	0.0
+chrM	5553	5554	0.0	0.0
+chrM	5554	5555	0.0	0.0
+chrM	5555	5556	0.0	0.0
+chrM	5556	5557	0.0	0.0
+chrM	5557	5558	0.0	0.0
+chrM	5558	5559	0.0	0.0
+chrM	5559	5560	0.0	0.0
+chrM	5560	5561	0.0	0.0
+chrM	5561	5562	0.0	0.0
+chrM	5562	5563	0.0	0.0
+chrM	5563	5564	0.0	0.0
+chrM	5564	5565	0.0	0.0
+chrM	5565	5566	0.0	0.0
+chrM	5566	5567	0.0	0.0
+chrM	5567	5568	0.0	0.0
+chrM	5568	5569	0.0	0.0
+chrM	5569	5570	0.0	0.0
+chrM	5570	5571	0.0	0.0
+chrM	5571	5572	0.0	0.0
+chrM	5572	5573	0.0	0.0
+chrM	5573	5574	0.0	0.0
+chrM	5574	5575	0.0	0.0
+chrM	5575	5576	0.0	0.0
+chrM	5576	5577	0.0	0.0
+chrM	5577	5578	0.0	0.0
+chrM	5578	5579	0.0	0.0
+chrM	5579	5580	0.0	0.0
+chrM	5580	5581	0.0	0.0
+chrM	5581	5582	0.0	0.0
+chrM	5582	5583	0.0	0.0
+chrM	5583	5584	0.0	0.0
+chrM	5584	5585	0.0	0.0
+chrM	5585	5586	0.0	0.0
+chrM	5586	5587	0.0	0.0
+chrM	5587	5588	0.0	0.0
+chrM	5588	5589	0.0	0.0
+chrM	5589	5590	0.0	0.0
+chrM	5590	5591	0.0	0.0
+chrM	5591	5592	0.0	0.0
+chrM	5592	5593	0.0	0.0
+chrM	5593	5594	0.0	0.0
+chrM	5594	5595	0.0	0.0
+chrM	5595	5596	0.0	0.0
+chrM	5596	5597	0.0	0.0
+chrM	5597	5598	0.0	0.0
+chrM	5598	5599	0.0	0.0
+chrM	5599	5600	0.0	0.0
+chrM	5600	5601	0.0	0.0
+chrM	5601	5602	0.0	0.0
+chrM	5602	5603	0.0	0.0
+chrM	5603	5604	0.0	0.0
+chrM	5604	5605	0.0	0.0
+chrM	5605	5606	0.0	0.0
+chrM	5606	5607	0.0	0.0
+chrM	5607	5608	0.0	0.0
+chrM	5608	5609	0.0	0.0
+chrM	5609	5610	0.0	0.0
+chrM	5610	5611	0.0	0.0
+chrM	5611	5612	0.0	0.0
+chrM	5612	5613	0.0	0.0
+chrM	5613	5614	0.0	0.0
+chrM	5614	5615	0.0	0.0
+chrM	5615	5616	0.0	0.0
+chrM	5616	5617	0.0	0.0
+chrM	5617	5618	0.0	0.0
+chrM	5618	5619	0.0	0.0
+chrM	5619	5620	0.0	0.0
+chrM	5620	5621	0.0	0.0
+chrM	5621	5622	0.0	0.0
+chrM	5622	5623	0.0	0.0
+chrM	5623	5624	0.0	0.0
+chrM	5624	5625	0.0	0.0
+chrM	5625	5626	0.0	0.0
+chrM	5626	5627	0.0	0.0
+chrM	5627	5628	0.0	0.0
+chrM	5628	5629	0.0	0.0
+chrM	5629	5630	0.0	0.0
+chrM	5630	5631	0.0	0.0
+chrM	5631	5632	0.0	0.0
+chrM	5632	5633	0.0	0.0
+chrM	5633	5634	0.0	0.0
+chrM	5634	5635	0.0	0.0
+chrM	5635	5636	0.0	0.0
+chrM	5636	5637	0.0	0.0
+chrM	5637	5638	0.0	0.0
+chrM	5638	5639	0.0	0.0
+chrM	5639	5640	0.0	0.0
+chrM	5640	5641	0.0	0.0
+chrM	5641	5642	0.0	0.0
+chrM	5642	5643	0.0	0.0
+chrM	5643	5644	0.0	0.0
+chrM	5644	5645	0.0	0.0
+chrM	5645	5646	0.0	0.0
+chrM	5646	5647	0.0	0.0
+chrM	5647	5648	0.0	0.0
+chrM	5648	5649	0.0	0.0
+chrM	5649	5650	0.0	0.0
+chrM	5650	5651	0.0	0.0
+chrM	5651	5652	0.0	0.0
+chrM	5652	5653	0.0	0.0
+chrM	5653	5654	0.0	0.0
+chrM	5654	5655	0.0	0.0
+chrM	5655	5656	0.0	0.0
+chrM	5656	5657	0.0	0.0
+chrM	5657	5658	0.0	0.0
+chrM	5658	5659	0.0	0.0
+chrM	5659	5660	0.0	0.0
+chrM	5660	5661	0.0	0.0
+chrM	5661	5662	0.0	0.0
+chrM	5662	5663	0.0	0.0
+chrM	5663	5664	0.0	0.0
+chrM	5664	5665	0.0	0.0
+chrM	5665	5666	0.0	0.0
+chrM	5666	5667	0.0	0.0
+chrM	5667	5668	0.0	0.0
+chrM	5668	5669	0.0	0.0
+chrM	5669	5670	0.0	0.0
+chrM	5670	5671	0.0	0.0
+chrM	5671	5672	0.0	0.0
+chrM	5672	5673	0.0	0.0
+chrM	5673	5674	0.0	0.0
+chrM	5674	5675	0.0	0.0
+chrM	5675	5676	0.0	0.0
+chrM	5676	5677	0.0	0.0
+chrM	5677	5678	0.0	0.0
+chrM	5678	5679	0.0	0.0
+chrM	5679	5680	0.0	0.0
+chrM	5680	5681	0.0	0.0
+chrM	5681	5682	0.0	0.0
+chrM	5682	5683	0.0	0.0
+chrM	5683	5684	0.0	0.0
+chrM	5684	5685	0.0	0.0
+chrM	5685	5686	0.0	0.0
+chrM	5686	5687	0.0	0.0
+chrM	5687	5688	0.0	0.0
+chrM	5688	5689	0.0	0.0
+chrM	5689	5690	0.0	0.0
+chrM	5690	5691	0.0	0.0
+chrM	5691	5692	0.0	0.0
+chrM	5692	5693	0.0	0.0
+chrM	5693	5694	0.0	0.0
+chrM	5694	5695	0.0	0.0
+chrM	5695	5696	0.0	0.0
+chrM	5696	5697	0.0	0.0
+chrM	5697	5698	0.0	0.0
+chrM	5698	5699	0.0	0.0
+chrM	5699	5700	0.0	0.0
+chrM	5700	5701	0.0	0.0
+chrM	5701	5702	0.0	0.0
+chrM	5702	5703	0.0	0.0
+chrM	5703	5704	0.0	0.0
+chrM	5704	5705	0.0	0.0
+chrM	5705	5706	0.0	0.0
+chrM	5706	5707	0.0	0.0
+chrM	5707	5708	0.0	0.0
+chrM	5708	5709	0.0	0.0
+chrM	5709	5710	0.0	0.0
+chrM	5710	5711	0.0	0.0
+chrM	5711	5712	0.0	0.0
+chrM	5712	5713	0.0	0.0
+chrM	5713	5714	0.0	0.0
+chrM	5714	5715	0.0	0.0
+chrM	5715	5716	0.0	0.0
+chrM	5716	5717	0.0	0.0
+chrM	5717	5718	0.0	0.0
+chrM	5718	5719	0.0	0.0
+chrM	5719	5720	0.0	0.0
+chrM	5720	5721	0.0	0.0
+chrM	5721	5722	0.0	0.0
+chrM	5722	5723	0.0	0.0
+chrM	5723	5724	0.0	0.0
+chrM	5724	5725	0.0	0.0
+chrM	5725	5726	0.0	0.0
+chrM	5726	5727	0.0	0.0
+chrM	5727	5728	0.0	0.0
+chrM	5728	5729	0.0	0.0
+chrM	5729	5730	0.0	0.0
+chrM	5730	5731	0.0	0.0
+chrM	5731	5732	0.0	0.0
+chrM	5732	5733	0.0	0.0
+chrM	5733	5734	0.0	0.0
+chrM	5734	5735	0.0	0.0
+chrM	5735	5736	0.0	0.0
+chrM	5736	5737	0.0	0.0
+chrM	5737	5738	0.0	0.0
+chrM	5738	5739	0.0	0.0
+chrM	5739	5740	0.0	0.0
+chrM	5740	5741	0.0	0.0
+chrM	5741	5742	0.0	0.0
+chrM	5742	5743	0.0	0.0
+chrM	5743	5744	0.0	0.0
+chrM	5744	5745	0.0	0.0
+chrM	5745	5746	0.0	0.0
+chrM	5746	5747	0.0	0.0
+chrM	5747	5748	0.0	0.0
+chrM	5748	5749	0.0	0.0
+chrM	5749	5750	0.0	0.0
+chrM	5750	5751	0.0	0.0
+chrM	5751	5752	0.0	0.0
+chrM	5752	5753	0.0	0.0
+chrM	5753	5754	0.0	0.0
+chrM	5754	5755	0.0	0.0
+chrM	5755	5756	0.0	0.0
+chrM	5756	5757	0.0	0.0
+chrM	5757	5758	0.0	0.0
+chrM	5758	5759	0.0	0.0
+chrM	5759	5760	0.0	0.0
+chrM	5760	5761	0.0	0.0
+chrM	5761	5762	0.0	0.0
+chrM	5762	5763	0.0	0.0
+chrM	5763	5764	0.0	0.0
+chrM	5764	5765	0.0	0.0
+chrM	5765	5766	0.0	0.0
+chrM	5766	5767	0.0	0.0
+chrM	5767	5768	0.0	0.0
+chrM	5768	5769	0.0	0.0
+chrM	5769	5770	0.0	0.0
+chrM	5770	5771	0.0	0.0
+chrM	5771	5772	0.0	0.0
+chrM	5772	5773	0.0	0.0
+chrM	5773	5774	0.0	0.0
+chrM	5774	5775	0.0	0.0
+chrM	5775	5776	0.0	0.0
+chrM	5776	5777	0.0	0.0
+chrM	5777	5778	0.0	0.0
+chrM	5778	5779	0.0	0.0
+chrM	5779	5780	0.0	0.0
+chrM	5780	5781	0.0	0.0
+chrM	5781	5782	0.0	0.0
+chrM	5782	5783	0.0	0.0
+chrM	5783	5784	0.0	0.0
+chrM	5784	5785	0.0	0.0
+chrM	5785	5786	0.0	0.0
+chrM	5786	5787	0.0	0.0
+chrM	5787	5788	0.0	0.0
+chrM	5788	5789	0.0	0.0
+chrM	5789	5790	0.0	0.0
+chrM	5790	5791	0.0	0.0
+chrM	5791	5792	0.0	0.0
+chrM	5792	5793	0.0	0.0
+chrM	5793	5794	0.0	0.0
+chrM	5794	5795	0.0	0.0
+chrM	5795	5796	0.0	0.0
+chrM	5796	5797	0.0	0.0
+chrM	5797	5798	0.0	0.0
+chrM	5798	5799	0.0	0.0
+chrM	5799	5800	0.0	0.0
+chrM	5800	5801	0.0	0.0
+chrM	5801	5802	0.0	0.0
+chrM	5802	5803	0.0	0.0
+chrM	5803	5804	0.0	0.0
+chrM	5804	5805	0.0	0.0
+chrM	5805	5806	0.0	0.0
+chrM	5806	5807	0.0	0.0
+chrM	5807	5808	0.0	0.0
+chrM	5808	5809	0.0	0.0
+chrM	5809	5810	0.0	0.0
+chrM	5810	5811	0.0	0.0
+chrM	5811	5812	0.0	0.0
+chrM	5812	5813	0.0	0.0
+chrM	5813	5814	0.0	0.0
+chrM	5814	5815	0.0	0.0
+chrM	5815	5816	0.0	0.0
+chrM	5816	5817	0.0	0.0
+chrM	5817	5818	0.0	0.0
+chrM	5818	5819	0.0	0.0
+chrM	5819	5820	0.0	0.0
+chrM	5820	5821	0.0	0.0
+chrM	5821	5822	0.0	0.0
+chrM	5822	5823	0.0	0.0
+chrM	5823	5824	0.0	0.0
+chrM	5824	5825	0.0	0.0
+chrM	5825	5826	0.0	0.0
+chrM	5826	5827	0.0	0.0
+chrM	5827	5828	0.0	0.0
+chrM	5828	5829	0.0	0.0
+chrM	5829	5830	0.0	0.0
+chrM	5830	5831	0.0	0.0
+chrM	5831	5832	0.0	0.0
+chrM	5832	5833	0.0	0.0
+chrM	5833	5834	0.0	0.0
+chrM	5834	5835	0.0	0.0
+chrM	5835	5836	0.0	0.0
+chrM	5836	5837	0.0	0.0
+chrM	5837	5838	0.0	0.0
+chrM	5838	5839	0.0	0.0
+chrM	5839	5840	0.0	0.0
+chrM	5840	5841	0.0	0.0
+chrM	5841	5842	0.0	0.0
+chrM	5842	5843	0.0	0.0
+chrM	5843	5844	0.0	0.0
+chrM	5844	5845	0.0	0.0
+chrM	5845	5846	0.0	0.0
+chrM	5846	5847	0.0	0.0
+chrM	5847	5848	0.0	0.0
+chrM	5848	5849	0.0	0.0
+chrM	5849	5850	0.0	0.0
+chrM	5850	5851	0.0	0.0
+chrM	5851	5852	0.0	0.0
+chrM	5852	5853	0.0	0.0
+chrM	5853	5854	0.0	0.0
+chrM	5854	5855	0.0	0.0
+chrM	5855	5856	0.0	0.0
+chrM	5856	5857	0.0	0.0
+chrM	5857	5858	0.0	0.0
+chrM	5858	5859	0.0	0.0
+chrM	5859	5860	0.0	0.0
+chrM	5860	5861	0.0	0.0
+chrM	5861	5862	0.0	0.0
+chrM	5862	5863	0.0	0.0
+chrM	5863	5864	0.0	0.0
+chrM	5864	5865	0.0	0.0
+chrM	5865	5866	0.0	0.0
+chrM	5866	5867	0.0	0.0
+chrM	5867	5868	0.0	0.0
+chrM	5868	5869	0.0	0.0
+chrM	5869	5870	0.0	0.0
+chrM	5870	5871	0.0	0.0
+chrM	5871	5872	0.0	0.0
+chrM	5872	5873	0.0	0.0
+chrM	5873	5874	0.0	0.0
+chrM	5874	5875	0.0	0.0
+chrM	5875	5876	0.0	0.0
+chrM	5876	5877	0.0	0.0
+chrM	5877	5878	0.0	0.0
+chrM	5878	5879	0.0	0.0
+chrM	5879	5880	0.0	0.0
+chrM	5880	5881	0.0	0.0
+chrM	5881	5882	0.0	0.0
+chrM	5882	5883	0.0	0.0
+chrM	5883	5884	0.0	0.0
+chrM	5884	5885	0.0	0.0
+chrM	5885	5886	0.0	0.0
+chrM	5886	5887	0.0	0.0
+chrM	5887	5888	0.0	0.0
+chrM	5888	5889	0.0	0.0
+chrM	5889	5890	0.0	0.0
+chrM	5890	5891	0.0	0.0
+chrM	5891	5892	0.0	0.0
+chrM	5892	5893	0.0	0.0
+chrM	5893	5894	0.0	0.0
+chrM	5894	5895	0.0	0.0
+chrM	5895	5896	0.0	0.0
+chrM	5896	5897	0.0	0.0
+chrM	5897	5898	0.0	0.0
+chrM	5898	5899	0.0	0.0
+chrM	5899	5900	0.0	0.0
+chrM	5900	5901	0.0	0.0
+chrM	5901	5902	0.0	0.0
+chrM	5902	5903	0.0	0.0
+chrM	5903	5904	0.0	0.0
+chrM	5904	5905	0.0	0.0
+chrM	5905	5906	0.0	0.0
+chrM	5906	5907	0.0	0.0
+chrM	5907	5908	0.0	0.0
+chrM	5908	5909	0.0	0.0
+chrM	5909	5910	0.0	0.0
+chrM	5910	5911	0.0	0.0
+chrM	5911	5912	0.0	0.0
+chrM	5912	5913	0.0	0.0
+chrM	5913	5914	0.0	0.0
+chrM	5914	5915	0.0	0.0
+chrM	5915	5916	0.0	0.0
+chrM	5916	5917	0.0	0.0
+chrM	5917	5918	0.0	0.0
+chrM	5918	5919	0.0	0.0
+chrM	5919	5920	0.0	0.0
+chrM	5920	5921	0.0	0.0
+chrM	5921	5922	0.0	0.0
+chrM	5922	5923	0.0	0.0
+chrM	5923	5924	0.0	0.0
+chrM	5924	5925	0.0	0.0
+chrM	5925	5926	0.0	0.0
+chrM	5926	5927	0.0	0.0
+chrM	5927	5928	0.0	0.0
+chrM	5928	5929	0.0	0.0
+chrM	5929	5930	0.0	0.0
+chrM	5930	5931	0.0	0.0
+chrM	5931	5932	0.0	0.0
+chrM	5932	5933	0.0	0.0
+chrM	5933	5934	0.0	0.0
+chrM	5934	5935	0.0	0.0
+chrM	5935	5936	0.0	0.0
+chrM	5936	5937	0.0	0.0
+chrM	5937	5938	0.0	0.0
+chrM	5938	5939	0.0	0.0
+chrM	5939	5940	0.0	0.0
+chrM	5940	5941	0.0	0.0
+chrM	5941	5942	0.0	0.0
+chrM	5942	5943	0.0	0.0
+chrM	5943	5944	0.0	0.0
+chrM	5944	5945	0.0	0.0
+chrM	5945	5946	0.0	0.0
+chrM	5946	5947	0.0	0.0
+chrM	5947	5948	0.0	0.0
+chrM	5948	5949	0.0	0.0
+chrM	5949	5950	0.0	0.0
+chrM	5950	5951	0.0	0.0
+chrM	5951	5952	0.0	0.0
+chrM	5952	5953	0.0	0.0
+chrM	5953	5954	0.0	0.0
+chrM	5954	5955	0.0	0.0
+chrM	5955	5956	0.0	0.0
+chrM	5956	5957	0.0	0.0
+chrM	5957	5958	0.0	0.0
+chrM	5958	5959	0.0	0.0
+chrM	5959	5960	0.0	0.0
+chrM	5960	5961	0.0	0.0
+chrM	5961	5962	0.0	0.0
+chrM	5962	5963	0.0	0.0
+chrM	5963	5964	0.0	0.0
+chrM	5964	5965	0.0	0.0
+chrM	5965	5966	0.0	0.0
+chrM	5966	5967	0.0	0.0
+chrM	5967	5968	0.0	0.0
+chrM	5968	5969	0.0	0.0
+chrM	5969	5970	0.0	0.0
+chrM	5970	5971	0.0	0.0
+chrM	5971	5972	0.0	0.0
+chrM	5972	5973	0.0	0.0
+chrM	5973	5974	0.0	0.0
+chrM	5974	5975	0.0	0.0
+chrM	5975	5976	0.0	0.0
+chrM	5976	5977	0.0	0.0
+chrM	5977	5978	0.0	0.0
+chrM	5978	5979	0.0	0.0
+chrM	5979	5980	0.0	0.0
+chrM	5980	5981	0.0	0.0
+chrM	5981	5982	0.0	0.0
+chrM	5982	5983	0.0	0.0
+chrM	5983	5984	0.0	0.0
+chrM	5984	5985	0.0	0.0
+chrM	5985	5986	0.0	0.0
+chrM	5986	5987	0.0	0.0
+chrM	5987	5988	0.0	0.0
+chrM	5988	5989	0.0	0.0
+chrM	5989	5990	0.0	0.0
+chrM	5990	5991	0.0	0.0
+chrM	5991	5992	0.0	0.0
+chrM	5992	5993	0.0	0.0
+chrM	5993	5994	0.0	0.0
+chrM	5994	5995	0.0	0.0
+chrM	5995	5996	0.0	0.0
+chrM	5996	5997	0.0	0.0
+chrM	5997	5998	0.0	0.0
+chrM	5998	5999	0.0	0.0
+chrM	5999	6000	0.0	0.0
+chrM	6000	6001	0.0	0.0
+chrM	6001	6002	0.0	0.0
+chrM	6002	6003	0.0	0.0
+chrM	6003	6004	0.0	0.0
+chrM	6004	6005	0.0	0.0
+chrM	6005	6006	0.0	0.0
+chrM	6006	6007	0.0	0.0
+chrM	6007	6008	0.0	0.0
+chrM	6008	6009	0.0	0.0
+chrM	6009	6010	0.0	0.0
+chrM	6010	6011	0.0	0.0
+chrM	6011	6012	0.0	0.0
+chrM	6012	6013	0.0	0.0
+chrM	6013	6014	0.0	0.0
+chrM	6014	6015	0.0	0.0
+chrM	6015	6016	0.0	0.0
+chrM	6016	6017	0.0	0.0
+chrM	6017	6018	0.0	0.0
+chrM	6018	6019	0.0	0.0
+chrM	6019	6020	0.0	0.0
+chrM	6020	6021	0.0	0.0
+chrM	6021	6022	0.0	0.0
+chrM	6022	6023	0.0	0.0
+chrM	6023	6024	0.0	0.0
+chrM	6024	6025	0.0	0.0
+chrM	6025	6026	0.0	0.0
+chrM	6026	6027	0.0	0.0
+chrM	6027	6028	0.0	0.0
+chrM	6028	6029	0.0	0.0
+chrM	6029	6030	0.0	0.0
+chrM	6030	6031	0.0	0.0
+chrM	6031	6032	0.0	0.0
+chrM	6032	6033	0.0	0.0
+chrM	6033	6034	0.0	0.0
+chrM	6034	6035	0.0	0.0
+chrM	6035	6036	0.0	0.0
+chrM	6036	6037	0.0	0.0
+chrM	6037	6038	0.0	0.0
+chrM	6038	6039	0.0	0.0
+chrM	6039	6040	0.0	0.0
+chrM	6040	6041	0.0	0.0
+chrM	6041	6042	0.0	0.0
+chrM	6042	6043	0.0	0.0
+chrM	6043	6044	0.0	0.0
+chrM	6044	6045	0.0	0.0
+chrM	6045	6046	0.0	0.0
+chrM	6046	6047	0.0	0.0
+chrM	6047	6048	0.0	0.0
+chrM	6048	6049	0.0	0.0
+chrM	6049	6050	0.0	0.0
+chrM	6050	6051	0.0	0.0
+chrM	6051	6052	0.0	0.0
+chrM	6052	6053	0.0	0.0
+chrM	6053	6054	0.0	0.0
+chrM	6054	6055	0.0	0.0
+chrM	6055	6056	0.0	0.0
+chrM	6056	6057	0.0	0.0
+chrM	6057	6058	0.0	0.0
+chrM	6058	6059	0.0	0.0
+chrM	6059	6060	0.0	0.0
+chrM	6060	6061	0.0	0.0
+chrM	6061	6062	0.0	0.0
+chrM	6062	6063	0.0	0.0
+chrM	6063	6064	0.0	0.0
+chrM	6064	6065	0.0	0.0
+chrM	6065	6066	0.0	0.0
+chrM	6066	6067	0.0	0.0
+chrM	6067	6068	0.0	0.0
+chrM	6068	6069	0.0	0.0
+chrM	6069	6070	0.0	0.0
+chrM	6070	6071	0.0	0.0
+chrM	6071	6072	0.0	0.0
+chrM	6072	6073	0.0	0.0
+chrM	6073	6074	0.0	0.0
+chrM	6074	6075	0.0	0.0
+chrM	6075	6076	0.0	0.0
+chrM	6076	6077	0.0	0.0
+chrM	6077	6078	0.0	0.0
+chrM	6078	6079	0.0	0.0
+chrM	6079	6080	0.0	0.0
+chrM	6080	6081	0.0	0.0
+chrM	6081	6082	0.0	0.0
+chrM	6082	6083	0.0	0.0
+chrM	6083	6084	0.0	0.0
+chrM	6084	6085	0.0	0.0
+chrM	6085	6086	0.0	0.0
+chrM	6086	6087	0.0	0.0
+chrM	6087	6088	0.0	0.0
+chrM	6088	6089	0.0	0.0
+chrM	6089	6090	0.0	0.0
+chrM	6090	6091	0.0	0.0
+chrM	6091	6092	0.0	0.0
+chrM	6092	6093	0.0	0.0
+chrM	6093	6094	0.0	0.0
+chrM	6094	6095	0.0	0.0
+chrM	6095	6096	0.0	0.0
+chrM	6096	6097	0.0	0.0
+chrM	6097	6098	0.0	0.0
+chrM	6098	6099	0.0	0.0
+chrM	6099	6100	0.0	0.0
+chrM	6100	6101	0.0	0.0
+chrM	6101	6102	0.0	0.0
+chrM	6102	6103	0.0	0.0
+chrM	6103	6104	0.0	0.0
+chrM	6104	6105	0.0	0.0
+chrM	6105	6106	0.0	0.0
+chrM	6106	6107	0.0	0.0
+chrM	6107	6108	0.0	0.0
+chrM	6108	6109	0.0	0.0
+chrM	6109	6110	0.0	0.0
+chrM	6110	6111	0.0	0.0
+chrM	6111	6112	0.0	0.0
+chrM	6112	6113	0.0	0.0
+chrM	6113	6114	0.0	0.0
+chrM	6114	6115	0.0	0.0
+chrM	6115	6116	0.0	0.0
+chrM	6116	6117	0.0	0.0
+chrM	6117	6118	0.0	0.0
+chrM	6118	6119	0.0	0.0
+chrM	6119	6120	0.0	0.0
+chrM	6120	6121	0.0	0.0
+chrM	6121	6122	0.0	0.0
+chrM	6122	6123	0.0	0.0
+chrM	6123	6124	0.0	0.0
+chrM	6124	6125	0.0	0.0
+chrM	6125	6126	0.0	0.0
+chrM	6126	6127	0.0	0.0
+chrM	6127	6128	0.0	0.0
+chrM	6128	6129	0.0	0.0
+chrM	6129	6130	0.0	0.0
+chrM	6130	6131	0.0	0.0
+chrM	6131	6132	0.0	0.0
+chrM	6132	6133	0.0	0.0
+chrM	6133	6134	0.0	0.0
+chrM	6134	6135	0.0	0.0
+chrM	6135	6136	0.0	0.0
+chrM	6136	6137	0.0	0.0
+chrM	6137	6138	0.0	0.0
+chrM	6138	6139	0.0	0.0
+chrM	6139	6140	0.0	0.0
+chrM	6140	6141	0.0	0.0
+chrM	6141	6142	0.0	0.0
+chrM	6142	6143	0.0	0.0
+chrM	6143	6144	0.0	0.0
+chrM	6144	6145	0.0	0.0
+chrM	6145	6146	0.0	0.0
+chrM	6146	6147	0.0	0.0
+chrM	6147	6148	0.0	0.0
+chrM	6148	6149	0.0	0.0
+chrM	6149	6150	0.0	0.0
+chrM	6150	6151	0.0	0.0
+chrM	6151	6152	0.0	0.0
+chrM	6152	6153	0.0	0.0
+chrM	6153	6154	0.0	0.0
+chrM	6154	6155	0.0	0.0
+chrM	6155	6156	0.0	0.0
+chrM	6156	6157	0.0	0.0
+chrM	6157	6158	0.0	0.0
+chrM	6158	6159	0.0	0.0
+chrM	6159	6160	0.0	0.0
+chrM	6160	6161	0.0	0.0
+chrM	6161	6162	0.0	0.0
+chrM	6162	6163	0.0	0.0
+chrM	6163	6164	0.0	0.0
+chrM	6164	6165	0.0	0.0
+chrM	6165	6166	0.0	0.0
+chrM	6166	6167	0.0	0.0
+chrM	6167	6168	0.0	0.0
+chrM	6168	6169	0.0	0.0
+chrM	6169	6170	0.0	0.0
+chrM	6170	6171	0.0	0.0
+chrM	6171	6172	0.0	0.0
+chrM	6172	6173	0.0	0.0
+chrM	6173	6174	0.0	0.0
+chrM	6174	6175	0.0	0.0
+chrM	6175	6176	0.0	0.0
+chrM	6176	6177	0.0	0.0
+chrM	6177	6178	0.0	0.0
+chrM	6178	6179	0.0	0.0
+chrM	6179	6180	0.0	0.0
+chrM	6180	6181	0.0	0.0
+chrM	6181	6182	0.0	0.0
+chrM	6182	6183	0.0	0.0
+chrM	6183	6184	0.0	0.0
+chrM	6184	6185	0.0	0.0
+chrM	6185	6186	0.0	0.0
+chrM	6186	6187	0.0	0.0
+chrM	6187	6188	0.0	0.0
+chrM	6188	6189	0.0	0.0
+chrM	6189	6190	0.0	0.0
+chrM	6190	6191	0.0	0.0
+chrM	6191	6192	0.0	0.0
+chrM	6192	6193	0.0	0.0
+chrM	6193	6194	0.0	0.0
+chrM	6194	6195	0.0	0.0
+chrM	6195	6196	0.0	0.0
+chrM	6196	6197	0.0	0.0
+chrM	6197	6198	0.0	0.0
+chrM	6198	6199	0.0	0.0
+chrM	6199	6200	0.0	0.0
+chrM	6200	6201	0.0	0.0
+chrM	6201	6202	0.0	0.0
+chrM	6202	6203	0.0	0.0
+chrM	6203	6204	0.0	0.0
+chrM	6204	6205	0.0	0.0
+chrM	6205	6206	0.0	0.0
+chrM	6206	6207	0.0	0.0
+chrM	6207	6208	0.0	0.0
+chrM	6208	6209	0.0	0.0
+chrM	6209	6210	0.0	0.0
+chrM	6210	6211	0.0	0.0
+chrM	6211	6212	0.0	0.0
+chrM	6212	6213	0.0	0.0
+chrM	6213	6214	0.0	0.0
+chrM	6214	6215	0.0	0.0
+chrM	6215	6216	0.0	0.0
+chrM	6216	6217	0.0	0.0
+chrM	6217	6218	0.0	0.0
+chrM	6218	6219	0.0	0.0
+chrM	6219	6220	0.0	0.0
+chrM	6220	6221	0.0	0.0
+chrM	6221	6222	0.0	0.0
+chrM	6222	6223	0.0	0.0
+chrM	6223	6224	0.0	0.0
+chrM	6224	6225	0.0	0.0
+chrM	6225	6226	0.0	0.0
+chrM	6226	6227	0.0	0.0
+chrM	6227	6228	0.0	0.0
+chrM	6228	6229	0.0	0.0
+chrM	6229	6230	0.0	0.0
+chrM	6230	6231	0.0	0.0
+chrM	6231	6232	0.0	0.0
+chrM	6232	6233	0.0	0.0
+chrM	6233	6234	0.0	0.0
+chrM	6234	6235	0.0	0.0
+chrM	6235	6236	0.0	0.0
+chrM	6236	6237	0.0	0.0
+chrM	6237	6238	0.0	0.0
+chrM	6238	6239	0.0	0.0
+chrM	6239	6240	0.0	0.0
+chrM	6240	6241	0.0	0.0
+chrM	6241	6242	0.0	0.0
+chrM	6242	6243	0.0	0.0
+chrM	6243	6244	0.0	0.0
+chrM	6244	6245	0.0	0.0
+chrM	6245	6246	0.0	0.0
+chrM	6246	6247	0.0	0.0
+chrM	6247	6248	0.0	0.0
+chrM	6248	6249	0.0	0.0
+chrM	6249	6250	0.0	0.0
+chrM	6250	6251	0.0	0.0
+chrM	6251	6252	0.0	0.0
+chrM	6252	6253	0.0	0.0
+chrM	6253	6254	0.0	0.0
+chrM	6254	6255	0.0	0.0
+chrM	6255	6256	0.0	0.0
+chrM	6256	6257	0.0	0.0
+chrM	6257	6258	0.0	0.0
+chrM	6258	6259	0.0	0.0
+chrM	6259	6260	0.0	0.0
+chrM	6260	6261	0.0	0.0
+chrM	6261	6262	0.0	0.0
+chrM	6262	6263	0.0	0.0
+chrM	6263	6264	0.0	0.0
+chrM	6264	6265	0.0	0.0
+chrM	6265	6266	0.0	0.0
+chrM	6266	6267	0.0	0.0
+chrM	6267	6268	0.0	0.0
+chrM	6268	6269	0.0	0.0
+chrM	6269	6270	0.0	0.0
+chrM	6270	6271	0.0	0.0
+chrM	6271	6272	0.0	0.0
+chrM	6272	6273	0.0	0.0
+chrM	6273	6274	0.0	0.0
+chrM	6274	6275	0.0	0.0
+chrM	6275	6276	0.0	0.0
+chrM	6276	6277	0.0	0.0
+chrM	6277	6278	0.0	0.0
+chrM	6278	6279	0.0	0.0
+chrM	6279	6280	0.0	0.0
+chrM	6280	6281	0.0	0.0
+chrM	6281	6282	0.0	0.0
+chrM	6282	6283	0.0	0.0
+chrM	6283	6284	0.0	0.0
+chrM	6284	6285	0.0	0.0
+chrM	6285	6286	0.0	0.0
+chrM	6286	6287	0.0	0.0
+chrM	6287	6288	0.0	0.0
+chrM	6288	6289	0.0	0.0
+chrM	6289	6290	0.0	0.0
+chrM	6290	6291	0.0	0.0
+chrM	6291	6292	0.0	0.0
+chrM	6292	6293	0.0	0.0
+chrM	6293	6294	0.0	0.0
+chrM	6294	6295	0.0	0.0
+chrM	6295	6296	0.0	0.0
+chrM	6296	6297	0.0	0.0
+chrM	6297	6298	0.0	0.0
+chrM	6298	6299	0.0	0.0
+chrM	6299	6300	0.0	0.0
+chrM	6300	6301	0.0	0.0
+chrM	6301	6302	0.0	0.0
+chrM	6302	6303	0.0	0.0
+chrM	6303	6304	0.0	0.0
+chrM	6304	6305	0.0	0.0
+chrM	6305	6306	0.0	0.0
+chrM	6306	6307	0.0	0.0
+chrM	6307	6308	0.0	0.0
+chrM	6308	6309	0.0	0.0
+chrM	6309	6310	0.0	0.0
+chrM	6310	6311	0.0	0.0
+chrM	6311	6312	0.0	0.0
+chrM	6312	6313	0.0	0.0
+chrM	6313	6314	0.0	0.0
+chrM	6314	6315	0.0	0.0
+chrM	6315	6316	0.0	0.0
+chrM	6316	6317	0.0	0.0
+chrM	6317	6318	0.0	0.0
+chrM	6318	6319	0.0	0.0
+chrM	6319	6320	0.0	0.0
+chrM	6320	6321	0.0	0.0
+chrM	6321	6322	0.0	0.0
+chrM	6322	6323	0.0	0.0
+chrM	6323	6324	0.0	0.0
+chrM	6324	6325	0.0	0.0
+chrM	6325	6326	0.0	0.0
+chrM	6326	6327	0.0	0.0
+chrM	6327	6328	0.0	0.0
+chrM	6328	6329	0.0	0.0
+chrM	6329	6330	0.0	0.0
+chrM	6330	6331	0.0	0.0
+chrM	6331	6332	0.0	0.0
+chrM	6332	6333	0.0	0.0
+chrM	6333	6334	0.0	0.0
+chrM	6334	6335	0.0	0.0
+chrM	6335	6336	0.0	0.0
+chrM	6336	6337	0.0	0.0
+chrM	6337	6338	0.0	0.0
+chrM	6338	6339	0.0	0.0
+chrM	6339	6340	0.0	0.0
+chrM	6340	6341	0.0	0.0
+chrM	6341	6342	0.0	0.0
+chrM	6342	6343	0.0	0.0
+chrM	6343	6344	0.0	0.0
+chrM	6344	6345	0.0	0.0
+chrM	6345	6346	0.0	0.0
+chrM	6346	6347	0.0	0.0
+chrM	6347	6348	0.0	0.0
+chrM	6348	6349	0.0	0.0
+chrM	6349	6350	0.0	0.0
+chrM	6350	6351	0.0	0.0
+chrM	6351	6352	0.0	0.0
+chrM	6352	6353	0.0	0.0
+chrM	6353	6354	0.0	0.0
+chrM	6354	6355	0.0	0.0
+chrM	6355	6356	0.0	0.0
+chrM	6356	6357	0.0	0.0
+chrM	6357	6358	0.0	0.0
+chrM	6358	6359	0.0	0.0
+chrM	6359	6360	0.0	0.0
+chrM	6360	6361	0.0	0.0
+chrM	6361	6362	0.0	0.0
+chrM	6362	6363	0.0	0.0
+chrM	6363	6364	0.0	0.0
+chrM	6364	6365	0.0	0.0
+chrM	6365	6366	0.0	0.0
+chrM	6366	6367	0.0	0.0
+chrM	6367	6368	0.0	0.0
+chrM	6368	6369	0.0	0.0
+chrM	6369	6370	0.0	0.0
+chrM	6370	6371	0.0	0.0
+chrM	6371	6372	0.0	0.0
+chrM	6372	6373	0.0	0.0
+chrM	6373	6374	0.0	0.0
+chrM	6374	6375	0.0	0.0
+chrM	6375	6376	0.0	0.0
+chrM	6376	6377	0.0	0.0
+chrM	6377	6378	0.0	0.0
+chrM	6378	6379	0.0	0.0
+chrM	6379	6380	0.0	0.0
+chrM	6380	6381	0.0	0.0
+chrM	6381	6382	0.0	0.0
+chrM	6382	6383	0.0	0.0
+chrM	6383	6384	0.0	0.0
+chrM	6384	6385	0.0	0.0
+chrM	6385	6386	0.0	0.0
+chrM	6386	6387	0.0	0.0
+chrM	6387	6388	0.0	0.0
+chrM	6388	6389	0.0	0.0
+chrM	6389	6390	0.0	0.0
+chrM	6390	6391	0.0	0.0
+chrM	6391	6392	0.0	0.0
+chrM	6392	6393	0.0	0.0
+chrM	6393	6394	0.0	0.0
+chrM	6394	6395	0.0	0.0
+chrM	6395	6396	0.0	0.0
+chrM	6396	6397	0.0	0.0
+chrM	6397	6398	0.0	0.0
+chrM	6398	6399	0.0	0.0
+chrM	6399	6400	0.0	0.0
+chrM	6400	6401	0.0	0.0
+chrM	6401	6402	0.0	0.0
+chrM	6402	6403	0.0	0.0
+chrM	6403	6404	0.0	0.0
+chrM	6404	6405	0.0	0.0
+chrM	6405	6406	0.0	0.0
+chrM	6406	6407	0.0	0.0
+chrM	6407	6408	0.0	0.0
+chrM	6408	6409	0.0	0.0
+chrM	6409	6410	0.0	0.0
+chrM	6410	6411	0.0	0.0
+chrM	6411	6412	0.0	0.0
+chrM	6412	6413	0.0	0.0
+chrM	6413	6414	0.0	0.0
+chrM	6414	6415	0.0	0.0
+chrM	6415	6416	0.0	0.0
+chrM	6416	6417	0.0	0.0
+chrM	6417	6418	0.0	0.0
+chrM	6418	6419	0.0	0.0
+chrM	6419	6420	0.0	0.0
+chrM	6420	6421	0.0	0.0
+chrM	6421	6422	0.0	0.0
+chrM	6422	6423	0.0	0.0
+chrM	6423	6424	0.0	0.0
+chrM	6424	6425	0.0	0.0
+chrM	6425	6426	0.0	0.0
+chrM	6426	6427	0.0	0.0
+chrM	6427	6428	0.0	0.0
+chrM	6428	6429	0.0	0.0
+chrM	6429	6430	0.0	0.0
+chrM	6430	6431	0.0	0.0
+chrM	6431	6432	0.0	0.0
+chrM	6432	6433	0.0	0.0
+chrM	6433	6434	0.0	0.0
+chrM	6434	6435	0.0	0.0
+chrM	6435	6436	0.0	0.0
+chrM	6436	6437	0.0	0.0
+chrM	6437	6438	0.0	0.0
+chrM	6438	6439	0.0	0.0
+chrM	6439	6440	0.0	0.0
+chrM	6440	6441	0.0	0.0
+chrM	6441	6442	0.0	0.0
+chrM	6442	6443	0.0	0.0
+chrM	6443	6444	0.0	0.0
+chrM	6444	6445	0.0	0.0
+chrM	6445	6446	0.0	0.0
+chrM	6446	6447	0.0	0.0
+chrM	6447	6448	0.0	0.0
+chrM	6448	6449	0.0	0.0
+chrM	6449	6450	0.0	0.0
+chrM	6450	6451	0.0	0.0
+chrM	6451	6452	0.0	0.0
+chrM	6452	6453	0.0	0.0
+chrM	6453	6454	0.0	0.0
+chrM	6454	6455	0.0	0.0
+chrM	6455	6456	0.0	0.0
+chrM	6456	6457	0.0	0.0
+chrM	6457	6458	0.0	0.0
+chrM	6458	6459	0.0	0.0
+chrM	6459	6460	0.0	0.0
+chrM	6460	6461	0.0	0.0
+chrM	6461	6462	0.0	0.0
+chrM	6462	6463	0.0	0.0
+chrM	6463	6464	0.0	0.0
+chrM	6464	6465	0.0	0.0
+chrM	6465	6466	0.0	0.0
+chrM	6466	6467	0.0	0.0
+chrM	6467	6468	0.0	0.0
+chrM	6468	6469	0.0	0.0
+chrM	6469	6470	0.0	0.0
+chrM	6470	6471	0.0	0.0
+chrM	6471	6472	0.0	0.0
+chrM	6472	6473	0.0	0.0
+chrM	6473	6474	0.0	0.0
+chrM	6474	6475	0.0	0.0
+chrM	6475	6476	0.0	0.0
+chrM	6476	6477	0.0	0.0
+chrM	6477	6478	0.0	0.0
+chrM	6478	6479	0.0	0.0
+chrM	6479	6480	0.0	0.0
+chrM	6480	6481	0.0	0.0
+chrM	6481	6482	0.0	0.0
+chrM	6482	6483	0.0	0.0
+chrM	6483	6484	0.0	0.0
+chrM	6484	6485	0.0	0.0
+chrM	6485	6486	0.0	0.0
+chrM	6486	6487	0.0	0.0
+chrM	6487	6488	0.0	0.0
+chrM	6488	6489	0.0	0.0
+chrM	6489	6490	0.0	0.0
+chrM	6490	6491	0.0	0.0
+chrM	6491	6492	0.0	0.0
+chrM	6492	6493	0.0	0.0
+chrM	6493	6494	0.0	0.0
+chrM	6494	6495	0.0	0.0
+chrM	6495	6496	0.0	0.0
+chrM	6496	6497	0.0	0.0
+chrM	6497	6498	0.0	0.0
+chrM	6498	6499	0.0	0.0
+chrM	6499	6500	0.0	0.0
+chrM	6500	6501	0.0	0.0
+chrM	6501	6502	0.0	0.0
+chrM	6502	6503	0.0	0.0
+chrM	6503	6504	0.0	0.0
+chrM	6504	6505	0.0	0.0
+chrM	6505	6506	0.0	0.0
+chrM	6506	6507	0.0	0.0
+chrM	6507	6508	0.0	0.0
+chrM	6508	6509	0.0	0.0
+chrM	6509	6510	0.0	0.0
+chrM	6510	6511	0.0	0.0
+chrM	6511	6512	0.0	0.0
+chrM	6512	6513	0.0	0.0
+chrM	6513	6514	0.0	0.0
+chrM	6514	6515	0.0	0.0
+chrM	6515	6516	0.0	0.0
+chrM	6516	6517	0.0	0.0
+chrM	6517	6518	0.0	0.0
+chrM	6518	6519	0.0	0.0
+chrM	6519	6520	0.0	0.0
+chrM	6520	6521	0.0	0.0
+chrM	6521	6522	0.0	0.0
+chrM	6522	6523	0.0	0.0
+chrM	6523	6524	0.0	0.0
+chrM	6524	6525	0.0	0.0
+chrM	6525	6526	0.0	0.0
+chrM	6526	6527	0.0	0.0
+chrM	6527	6528	0.0	0.0
+chrM	6528	6529	0.0	0.0
+chrM	6529	6530	0.0	0.0
+chrM	6530	6531	0.0	0.0
+chrM	6531	6532	0.0	0.0
+chrM	6532	6533	0.0	0.0
+chrM	6533	6534	0.0	0.0
+chrM	6534	6535	0.0	0.0
+chrM	6535	6536	0.0	0.0
+chrM	6536	6537	0.0	0.0
+chrM	6537	6538	0.0	0.0
+chrM	6538	6539	0.0	0.0
+chrM	6539	6540	0.0	0.0
+chrM	6540	6541	0.0	0.0
+chrM	6541	6542	0.0	0.0
+chrM	6542	6543	0.0	0.0
+chrM	6543	6544	0.0	0.0
+chrM	6544	6545	0.0	0.0
+chrM	6545	6546	0.0	0.0
+chrM	6546	6547	0.0	0.0
+chrM	6547	6548	0.0	0.0
+chrM	6548	6549	0.0	0.0
+chrM	6549	6550	0.0	0.0
+chrM	6550	6551	0.0	0.0
+chrM	6551	6552	0.0	0.0
+chrM	6552	6553	0.0	0.0
+chrM	6553	6554	0.0	0.0
+chrM	6554	6555	0.0	0.0
+chrM	6555	6556	0.0	0.0
+chrM	6556	6557	0.0	0.0
+chrM	6557	6558	0.0	0.0
+chrM	6558	6559	0.0	0.0
+chrM	6559	6560	0.0	0.0
+chrM	6560	6561	0.0	0.0
+chrM	6561	6562	0.0	0.0
+chrM	6562	6563	0.0	0.0
+chrM	6563	6564	0.0	0.0
+chrM	6564	6565	0.0	0.0
+chrM	6565	6566	0.0	0.0
+chrM	6566	6567	0.0	0.0
+chrM	6567	6568	0.0	0.0
+chrM	6568	6569	0.0	0.0
+chrM	6569	6570	0.0	0.0
+chrM	6570	6571	0.0	0.0
+chrM	6571	6572	0.0	0.0
+chrM	6572	6573	0.0	0.0
+chrM	6573	6574	0.0	0.0
+chrM	6574	6575	0.0	0.0
+chrM	6575	6576	0.0	0.0
+chrM	6576	6577	0.0	0.0
+chrM	6577	6578	0.0	0.0
+chrM	6578	6579	0.0	0.0
+chrM	6579	6580	0.0	0.0
+chrM	6580	6581	0.0	0.0
+chrM	6581	6582	0.0	0.0
+chrM	6582	6583	0.0	0.0
+chrM	6583	6584	0.0	0.0
+chrM	6584	6585	0.0	0.0
+chrM	6585	6586	0.0	0.0
+chrM	6586	6587	0.0	0.0
+chrM	6587	6588	0.0	0.0
+chrM	6588	6589	0.0	0.0
+chrM	6589	6590	0.0	0.0
+chrM	6590	6591	0.0	0.0
+chrM	6591	6592	0.0	0.0
+chrM	6592	6593	0.0	0.0
+chrM	6593	6594	0.0	0.0
+chrM	6594	6595	0.0	0.0
+chrM	6595	6596	0.0	0.0
+chrM	6596	6597	0.0	0.0
+chrM	6597	6598	0.0	0.0
+chrM	6598	6599	0.0	0.0
+chrM	6599	6600	0.0	0.0
+chrM	6600	6601	0.0	0.0
+chrM	6601	6602	0.0	0.0
+chrM	6602	6603	0.0	0.0
+chrM	6603	6604	0.0	0.0
+chrM	6604	6605	0.0	0.0
+chrM	6605	6606	0.0	0.0
+chrM	6606	6607	0.0	0.0
+chrM	6607	6608	0.0	0.0
+chrM	6608	6609	0.0	0.0
+chrM	6609	6610	0.0	0.0
+chrM	6610	6611	0.0	0.0
+chrM	6611	6612	0.0	0.0
+chrM	6612	6613	0.0	0.0
+chrM	6613	6614	0.0	0.0
+chrM	6614	6615	0.0	0.0
+chrM	6615	6616	0.0	0.0
+chrM	6616	6617	0.0	0.0
+chrM	6617	6618	0.0	0.0
+chrM	6618	6619	0.0	0.0
+chrM	6619	6620	0.0	0.0
+chrM	6620	6621	0.0	0.0
+chrM	6621	6622	0.0	0.0
+chrM	6622	6623	0.0	0.0
+chrM	6623	6624	0.0	0.0
+chrM	6624	6625	0.0	0.0
+chrM	6625	6626	0.0	0.0
+chrM	6626	6627	0.0	0.0
+chrM	6627	6628	0.0	0.0
+chrM	6628	6629	0.0	0.0
+chrM	6629	6630	0.0	0.0
+chrM	6630	6631	0.0	0.0
+chrM	6631	6632	0.0	0.0
+chrM	6632	6633	0.0	0.0
+chrM	6633	6634	0.0	0.0
+chrM	6634	6635	0.0	0.0
+chrM	6635	6636	0.0	0.0
+chrM	6636	6637	0.0	0.0
+chrM	6637	6638	0.0	0.0
+chrM	6638	6639	0.0	0.0
+chrM	6639	6640	0.0	0.0
+chrM	6640	6641	0.0	0.0
+chrM	6641	6642	0.0	0.0
+chrM	6642	6643	0.0	0.0
+chrM	6643	6644	0.0	0.0
+chrM	6644	6645	0.0	0.0
+chrM	6645	6646	0.0	0.0
+chrM	6646	6647	0.0	0.0
+chrM	6647	6648	0.0	0.0
+chrM	6648	6649	0.0	0.0
+chrM	6649	6650	0.0	0.0
+chrM	6650	6651	0.0	0.0
+chrM	6651	6652	0.0	0.0
+chrM	6652	6653	0.0	0.0
+chrM	6653	6654	0.0	0.0
+chrM	6654	6655	0.0	0.0
+chrM	6655	6656	0.0	0.0
+chrM	6656	6657	0.0	0.0
+chrM	6657	6658	0.0	0.0
+chrM	6658	6659	0.0	0.0
+chrM	6659	6660	0.0	0.0
+chrM	6660	6661	0.0	0.0
+chrM	6661	6662	0.0	0.0
+chrM	6662	6663	0.0	0.0
+chrM	6663	6664	0.0	0.0
+chrM	6664	6665	0.0	0.0
+chrM	6665	6666	0.0	0.0
+chrM	6666	6667	0.0	0.0
+chrM	6667	6668	0.0	0.0
+chrM	6668	6669	0.0	0.0
+chrM	6669	6670	0.0	0.0
+chrM	6670	6671	0.0	0.0
+chrM	6671	6672	0.0	0.0
+chrM	6672	6673	0.0	0.0
+chrM	6673	6674	0.0	0.0
+chrM	6674	6675	0.0	0.0
+chrM	6675	6676	0.0	0.0
+chrM	6676	6677	0.0	0.0
+chrM	6677	6678	0.0	0.0
+chrM	6678	6679	0.0	0.0
+chrM	6679	6680	0.0	0.0
+chrM	6680	6681	0.0	0.0
+chrM	6681	6682	0.0	0.0
+chrM	6682	6683	0.0	0.0
+chrM	6683	6684	0.0	0.0
+chrM	6684	6685	0.0	0.0
+chrM	6685	6686	0.0	0.0
+chrM	6686	6687	0.0	0.0
+chrM	6687	6688	0.0	0.0
+chrM	6688	6689	0.0	0.0
+chrM	6689	6690	0.0	0.0
+chrM	6690	6691	0.0	0.0
+chrM	6691	6692	0.0	0.0
+chrM	6692	6693	0.0	0.0
+chrM	6693	6694	0.0	0.0
+chrM	6694	6695	0.0	0.0
+chrM	6695	6696	0.0	0.0
+chrM	6696	6697	0.0	0.0
+chrM	6697	6698	0.0	0.0
+chrM	6698	6699	0.0	0.0
+chrM	6699	6700	0.0	0.0
+chrM	6700	6701	0.0	0.0
+chrM	6701	6702	0.0	0.0
+chrM	6702	6703	0.0	0.0
+chrM	6703	6704	0.0	0.0
+chrM	6704	6705	0.0	0.0
+chrM	6705	6706	0.0	0.0
+chrM	6706	6707	0.0	0.0
+chrM	6707	6708	0.0	0.0
+chrM	6708	6709	0.0	0.0
+chrM	6709	6710	0.0	0.0
+chrM	6710	6711	0.0	0.0
+chrM	6711	6712	0.0	0.0
+chrM	6712	6713	0.0	0.0
+chrM	6713	6714	0.0	0.0
+chrM	6714	6715	0.0	0.0
+chrM	6715	6716	0.0	0.0
+chrM	6716	6717	0.0	0.0
+chrM	6717	6718	0.0	0.0
+chrM	6718	6719	0.0	0.0
+chrM	6719	6720	0.0	0.0
+chrM	6720	6721	0.0	0.0
+chrM	6721	6722	0.0	0.0
+chrM	6722	6723	0.0	0.0
+chrM	6723	6724	0.0	0.0
+chrM	6724	6725	0.0	0.0
+chrM	6725	6726	0.0	0.0
+chrM	6726	6727	0.0	0.0
+chrM	6727	6728	0.0	0.0
+chrM	6728	6729	0.0	0.0
+chrM	6729	6730	0.0	0.0
+chrM	6730	6731	0.0	0.0
+chrM	6731	6732	0.0	0.0
+chrM	6732	6733	0.0	0.0
+chrM	6733	6734	0.0	0.0
+chrM	6734	6735	0.0	0.0
+chrM	6735	6736	0.0	0.0
+chrM	6736	6737	0.0	0.0
+chrM	6737	6738	0.0	0.0
+chrM	6738	6739	0.0	0.0
+chrM	6739	6740	0.0	0.0
+chrM	6740	6741	0.0	0.0
+chrM	6741	6742	0.0	0.0
+chrM	6742	6743	0.0	0.0
+chrM	6743	6744	0.0	0.0
+chrM	6744	6745	0.0	0.0
+chrM	6745	6746	0.0	0.0
+chrM	6746	6747	0.0	0.0
+chrM	6747	6748	0.0	0.0
+chrM	6748	6749	0.0	0.0
+chrM	6749	6750	0.0	0.0
+chrM	6750	6751	0.0	0.0
+chrM	6751	6752	0.0	0.0
+chrM	6752	6753	0.0	0.0
+chrM	6753	6754	0.0	0.0
+chrM	6754	6755	0.0	0.0
+chrM	6755	6756	0.0	0.0
+chrM	6756	6757	0.0	0.0
+chrM	6757	6758	0.0	0.0
+chrM	6758	6759	0.0	0.0
+chrM	6759	6760	0.0	0.0
+chrM	6760	6761	0.0	0.0
+chrM	6761	6762	0.0	0.0
+chrM	6762	6763	0.0	0.0
+chrM	6763	6764	0.0	0.0
+chrM	6764	6765	0.0	0.0
+chrM	6765	6766	0.0	0.0
+chrM	6766	6767	0.0	0.0
+chrM	6767	6768	0.0	0.0
+chrM	6768	6769	0.0	0.0
+chrM	6769	6770	0.0	0.0
+chrM	6770	6771	0.0	0.0
+chrM	6771	6772	0.0	0.0
+chrM	6772	6773	0.0	0.0
+chrM	6773	6774	0.0	0.0
+chrM	6774	6775	0.0	0.0
+chrM	6775	6776	0.0	0.0
+chrM	6776	6777	0.0	0.0
+chrM	6777	6778	0.0	0.0
+chrM	6778	6779	0.0	0.0
+chrM	6779	6780	0.0	0.0
+chrM	6780	6781	0.0	0.0
+chrM	6781	6782	0.0	0.0
+chrM	6782	6783	0.0	0.0
+chrM	6783	6784	0.0	0.0
+chrM	6784	6785	0.0	0.0
+chrM	6785	6786	0.0	0.0
+chrM	6786	6787	0.0	0.0
+chrM	6787	6788	0.0	0.0
+chrM	6788	6789	0.0	0.0
+chrM	6789	6790	0.0	0.0
+chrM	6790	6791	0.0	0.0
+chrM	6791	6792	0.0	0.0
+chrM	6792	6793	0.0	0.0
+chrM	6793	6794	0.0	0.0
+chrM	6794	6795	0.0	0.0
+chrM	6795	6796	0.0	0.0
+chrM	6796	6797	0.0	0.0
+chrM	6797	6798	0.0	0.0
+chrM	6798	6799	0.0	0.0
+chrM	6799	6800	0.0	0.0
+chrM	6800	6801	0.0	0.0
+chrM	6801	6802	0.0	0.0
+chrM	6802	6803	0.0	0.0
+chrM	6803	6804	0.0	0.0
+chrM	6804	6805	0.0	0.0
+chrM	6805	6806	0.0	0.0
+chrM	6806	6807	0.0	0.0
+chrM	6807	6808	0.0	0.0
+chrM	6808	6809	0.0	0.0
+chrM	6809	6810	0.0	0.0
+chrM	6810	6811	0.0	0.0
+chrM	6811	6812	0.0	0.0
+chrM	6812	6813	0.0	0.0
+chrM	6813	6814	0.0	0.0
+chrM	6814	6815	0.0	0.0
+chrM	6815	6816	0.0	0.0
+chrM	6816	6817	0.0	0.0
+chrM	6817	6818	0.0	0.0
+chrM	6818	6819	0.0	0.0
+chrM	6819	6820	0.0	0.0
+chrM	6820	6821	0.0	0.0
+chrM	6821	6822	0.0	0.0
+chrM	6822	6823	0.0	0.0
+chrM	6823	6824	0.0	0.0
+chrM	6824	6825	0.0	0.0
+chrM	6825	6826	0.0	0.0
+chrM	6826	6827	0.0	0.0
+chrM	6827	6828	0.0	0.0
+chrM	6828	6829	0.0	0.0
+chrM	6829	6830	0.0	0.0
+chrM	6830	6831	0.0	0.0
+chrM	6831	6832	0.0	0.0
+chrM	6832	6833	0.0	0.0
+chrM	6833	6834	0.0	0.0
+chrM	6834	6835	0.0	0.0
+chrM	6835	6836	0.0	0.0
+chrM	6836	6837	0.0	0.0
+chrM	6837	6838	0.0	0.0
+chrM	6838	6839	0.0	0.0
+chrM	6839	6840	0.0	0.0
+chrM	6840	6841	0.0	0.0
+chrM	6841	6842	0.0	0.0
+chrM	6842	6843	0.0	0.0
+chrM	6843	6844	0.0	0.0
+chrM	6844	6845	0.0	0.0
+chrM	6845	6846	0.0	0.0
+chrM	6846	6847	0.0	0.0
+chrM	6847	6848	0.0	0.0
+chrM	6848	6849	0.0	0.0
+chrM	6849	6850	0.0	0.0
+chrM	6850	6851	0.0	0.0
+chrM	6851	6852	0.0	0.0
+chrM	6852	6853	0.0	0.0
+chrM	6853	6854	0.0	0.0
+chrM	6854	6855	0.0	0.0
+chrM	6855	6856	0.0	0.0
+chrM	6856	6857	0.0	0.0
+chrM	6857	6858	0.0	0.0
+chrM	6858	6859	0.0	0.0
+chrM	6859	6860	0.0	0.0
+chrM	6860	6861	0.0	0.0
+chrM	6861	6862	0.0	0.0
+chrM	6862	6863	0.0	0.0
+chrM	6863	6864	0.0	0.0
+chrM	6864	6865	0.0	0.0
+chrM	6865	6866	0.0	0.0
+chrM	6866	6867	0.0	0.0
+chrM	6867	6868	0.0	0.0
+chrM	6868	6869	0.0	0.0
+chrM	6869	6870	0.0	0.0
+chrM	6870	6871	0.0	0.0
+chrM	6871	6872	0.0	0.0
+chrM	6872	6873	0.0	0.0
+chrM	6873	6874	0.0	0.0
+chrM	6874	6875	0.0	0.0
+chrM	6875	6876	0.0	0.0
+chrM	6876	6877	0.0	0.0
+chrM	6877	6878	0.0	0.0
+chrM	6878	6879	0.0	0.0
+chrM	6879	6880	0.0	0.0
+chrM	6880	6881	0.0	0.0
+chrM	6881	6882	0.0	0.0
+chrM	6882	6883	0.0	0.0
+chrM	6883	6884	0.0	0.0
+chrM	6884	6885	0.0	0.0
+chrM	6885	6886	0.0	0.0
+chrM	6886	6887	0.0	0.0
+chrM	6887	6888	0.0	0.0
+chrM	6888	6889	0.0	0.0
+chrM	6889	6890	0.0	0.0
+chrM	6890	6891	0.0	0.0
+chrM	6891	6892	0.0	0.0
+chrM	6892	6893	0.0	0.0
+chrM	6893	6894	0.0	0.0
+chrM	6894	6895	0.0	0.0
+chrM	6895	6896	0.0	0.0
+chrM	6896	6897	0.0	0.0
+chrM	6897	6898	0.0	0.0
+chrM	6898	6899	0.0	0.0
+chrM	6899	6900	0.0	0.0
+chrM	6900	6901	0.0	0.0
+chrM	6901	6902	0.0	0.0
+chrM	6902	6903	0.0	0.0
+chrM	6903	6904	0.0	0.0
+chrM	6904	6905	0.0	0.0
+chrM	6905	6906	0.0	0.0
+chrM	6906	6907	0.0	0.0
+chrM	6907	6908	0.0	0.0
+chrM	6908	6909	0.0	0.0
+chrM	6909	6910	0.0	0.0
+chrM	6910	6911	0.0	0.0
+chrM	6911	6912	0.0	0.0
+chrM	6912	6913	0.0	0.0
+chrM	6913	6914	0.0	0.0
+chrM	6914	6915	0.0	0.0
+chrM	6915	6916	0.0	0.0
+chrM	6916	6917	0.0	0.0
+chrM	6917	6918	0.0	0.0
+chrM	6918	6919	0.0	0.0
+chrM	6919	6920	0.0	0.0
+chrM	6920	6921	0.0	0.0
+chrM	6921	6922	0.0	0.0
+chrM	6922	6923	0.0	0.0
+chrM	6923	6924	0.0	0.0
+chrM	6924	6925	0.0	0.0
+chrM	6925	6926	0.0	0.0
+chrM	6926	6927	0.0	0.0
+chrM	6927	6928	0.0	0.0
+chrM	6928	6929	0.0	0.0
+chrM	6929	6930	0.0	0.0
+chrM	6930	6931	0.0	0.0
+chrM	6931	6932	0.0	0.0
+chrM	6932	6933	0.0	0.0
+chrM	6933	6934	0.0	0.0
+chrM	6934	6935	0.0	0.0
+chrM	6935	6936	0.0	0.0
+chrM	6936	6937	0.0	0.0
+chrM	6937	6938	0.0	0.0
+chrM	6938	6939	0.0	0.0
+chrM	6939	6940	0.0	0.0
+chrM	6940	6941	0.0	0.0
+chrM	6941	6942	0.0	0.0
+chrM	6942	6943	0.0	0.0
+chrM	6943	6944	0.0	0.0
+chrM	6944	6945	0.0	0.0
+chrM	6945	6946	0.0	0.0
+chrM	6946	6947	0.0	0.0
+chrM	6947	6948	0.0	0.0
+chrM	6948	6949	0.0	0.0
+chrM	6949	6950	0.0	0.0
+chrM	6950	6951	0.0	0.0
+chrM	6951	6952	0.0	0.0
+chrM	6952	6953	0.0	0.0
+chrM	6953	6954	0.0	0.0
+chrM	6954	6955	0.0	0.0
+chrM	6955	6956	0.0	0.0
+chrM	6956	6957	0.0	0.0
+chrM	6957	6958	0.0	0.0
+chrM	6958	6959	0.0	0.0
+chrM	6959	6960	0.0	0.0
+chrM	6960	6961	0.0	0.0
+chrM	6961	6962	0.0	0.0
+chrM	6962	6963	0.0	0.0
+chrM	6963	6964	0.0	0.0
+chrM	6964	6965	0.0	0.0
+chrM	6965	6966	0.0	0.0
+chrM	6966	6967	0.0	0.0
+chrM	6967	6968	0.0	0.0
+chrM	6968	6969	0.0	0.0
+chrM	6969	6970	0.0	0.0
+chrM	6970	6971	0.0	0.0
+chrM	6971	6972	0.0	0.0
+chrM	6972	6973	0.0	0.0
+chrM	6973	6974	0.0	0.0
+chrM	6974	6975	0.0	0.0
+chrM	6975	6976	0.0	0.0
+chrM	6976	6977	0.0	0.0
+chrM	6977	6978	0.0	0.0
+chrM	6978	6979	0.0	0.0
+chrM	6979	6980	0.0	0.0
+chrM	6980	6981	0.0	0.0
+chrM	6981	6982	0.0	0.0
+chrM	6982	6983	0.0	0.0
+chrM	6983	6984	0.0	0.0
+chrM	6984	6985	0.0	0.0
+chrM	6985	6986	0.0	0.0
+chrM	6986	6987	0.0	0.0
+chrM	6987	6988	0.0	0.0
+chrM	6988	6989	0.0	0.0
+chrM	6989	6990	0.0	0.0
+chrM	6990	6991	0.0	0.0
+chrM	6991	6992	0.0	0.0
+chrM	6992	6993	0.0	0.0
+chrM	6993	6994	0.0	0.0
+chrM	6994	6995	0.0	0.0
+chrM	6995	6996	0.0	0.0
+chrM	6996	6997	0.0	0.0
+chrM	6997	6998	0.0	0.0
+chrM	6998	6999	0.0	0.0
+chrM	6999	7000	0.0	0.0
+chrM	7000	7001	0.0	0.0
+chrM	7001	7002	0.0	0.0
+chrM	7002	7003	0.0	0.0
+chrM	7003	7004	0.0	0.0
+chrM	7004	7005	0.0	0.0
+chrM	7005	7006	0.0	0.0
+chrM	7006	7007	0.0	0.0
+chrM	7007	7008	0.0	0.0
+chrM	7008	7009	0.0	0.0
+chrM	7009	7010	0.0	0.0
+chrM	7010	7011	0.0	0.0
+chrM	7011	7012	0.0	0.0
+chrM	7012	7013	0.0	0.0
+chrM	7013	7014	0.0	0.0
+chrM	7014	7015	0.0	0.0
+chrM	7015	7016	0.0	0.0
+chrM	7016	7017	0.0	0.0
+chrM	7017	7018	0.0	0.0
+chrM	7018	7019	0.0	0.0
+chrM	7019	7020	0.0	0.0
+chrM	7020	7021	0.0	0.0
+chrM	7021	7022	0.0	0.0
+chrM	7022	7023	0.0	0.0
+chrM	7023	7024	0.0	0.0
+chrM	7024	7025	0.0	0.0
+chrM	7025	7026	0.0	0.0
+chrM	7026	7027	0.0	0.0
+chrM	7027	7028	0.0	0.0
+chrM	7028	7029	0.0	0.0
+chrM	7029	7030	0.0	0.0
+chrM	7030	7031	0.0	0.0
+chrM	7031	7032	0.0	0.0
+chrM	7032	7033	0.0	0.0
+chrM	7033	7034	0.0	0.0
+chrM	7034	7035	0.0	0.0
+chrM	7035	7036	0.0	0.0
+chrM	7036	7037	0.0	0.0
+chrM	7037	7038	0.0	0.0
+chrM	7038	7039	0.0	0.0
+chrM	7039	7040	0.0	0.0
+chrM	7040	7041	0.0	0.0
+chrM	7041	7042	0.0	0.0
+chrM	7042	7043	0.0	0.0
+chrM	7043	7044	0.0	0.0
+chrM	7044	7045	0.0	0.0
+chrM	7045	7046	0.0	0.0
+chrM	7046	7047	0.0	0.0
+chrM	7047	7048	0.0	0.0
+chrM	7048	7049	0.0	0.0
+chrM	7049	7050	0.0	0.0
+chrM	7050	7051	0.0	0.0
+chrM	7051	7052	0.0	0.0
+chrM	7052	7053	0.0	0.0
+chrM	7053	7054	0.0	0.0
+chrM	7054	7055	0.0	0.0
+chrM	7055	7056	0.0	0.0
+chrM	7056	7057	0.0	0.0
+chrM	7057	7058	0.0	0.0
+chrM	7058	7059	0.0	0.0
+chrM	7059	7060	0.0	0.0
+chrM	7060	7061	0.0	0.0
+chrM	7061	7062	0.0	0.0
+chrM	7062	7063	0.0	0.0
+chrM	7063	7064	0.0	0.0
+chrM	7064	7065	0.0	0.0
+chrM	7065	7066	0.0	0.0
+chrM	7066	7067	0.0	0.0
+chrM	7067	7068	0.0	0.0
+chrM	7068	7069	0.0	0.0
+chrM	7069	7070	0.0	0.0
+chrM	7070	7071	0.0	0.0
+chrM	7071	7072	0.0	0.0
+chrM	7072	7073	0.0	0.0
+chrM	7073	7074	0.0	0.0
+chrM	7074	7075	0.0	0.0
+chrM	7075	7076	0.0	0.0
+chrM	7076	7077	0.0	0.0
+chrM	7077	7078	0.0	0.0
+chrM	7078	7079	0.0	0.0
+chrM	7079	7080	0.0	0.0
+chrM	7080	7081	0.0	0.0
+chrM	7081	7082	0.0	0.0
+chrM	7082	7083	0.0	0.0
+chrM	7083	7084	0.0	0.0
+chrM	7084	7085	0.0	0.0
+chrM	7085	7086	0.0	0.0
+chrM	7086	7087	0.0	0.0
+chrM	7087	7088	0.0	0.0
+chrM	7088	7089	0.0	0.0
+chrM	7089	7090	0.0	0.0
+chrM	7090	7091	0.0	0.0
+chrM	7091	7092	0.0	0.0
+chrM	7092	7093	0.0	0.0
+chrM	7093	7094	0.0	0.0
+chrM	7094	7095	0.0	0.0
+chrM	7095	7096	0.0	0.0
+chrM	7096	7097	0.0	0.0
+chrM	7097	7098	0.0	0.0
+chrM	7098	7099	0.0	0.0
+chrM	7099	7100	0.0	0.0
+chrM	7100	7101	0.0	0.0
+chrM	7101	7102	0.0	0.0
+chrM	7102	7103	0.0	0.0
+chrM	7103	7104	0.0	0.0
+chrM	7104	7105	0.0	0.0
+chrM	7105	7106	0.0	0.0
+chrM	7106	7107	0.0	0.0
+chrM	7107	7108	0.0	0.0
+chrM	7108	7109	0.0	0.0
+chrM	7109	7110	0.0	0.0
+chrM	7110	7111	0.0	0.0
+chrM	7111	7112	0.0	0.0
+chrM	7112	7113	0.0	0.0
+chrM	7113	7114	0.0	0.0
+chrM	7114	7115	0.0	0.0
+chrM	7115	7116	0.0	0.0
+chrM	7116	7117	0.0	0.0
+chrM	7117	7118	0.0	0.0
+chrM	7118	7119	0.0	0.0
+chrM	7119	7120	0.0	0.0
+chrM	7120	7121	0.0	0.0
+chrM	7121	7122	0.0	0.0
+chrM	7122	7123	0.0	0.0
+chrM	7123	7124	0.0	0.0
+chrM	7124	7125	0.0	0.0
+chrM	7125	7126	0.0	0.0
+chrM	7126	7127	0.0	0.0
+chrM	7127	7128	0.0	0.0
+chrM	7128	7129	0.0	0.0
+chrM	7129	7130	0.0	0.0
+chrM	7130	7131	0.0	0.0
+chrM	7131	7132	0.0	0.0
+chrM	7132	7133	0.0	0.0
+chrM	7133	7134	0.0	0.0
+chrM	7134	7135	0.0	0.0
+chrM	7135	7136	0.0	0.0
+chrM	7136	7137	0.0	0.0
+chrM	7137	7138	0.0	0.0
+chrM	7138	7139	0.0	0.0
+chrM	7139	7140	0.0	0.0
+chrM	7140	7141	0.0	0.0
+chrM	7141	7142	0.0	0.0
+chrM	7142	7143	0.0	0.0
+chrM	7143	7144	0.0	0.0
+chrM	7144	7145	0.0	0.0
+chrM	7145	7146	0.0	0.0
+chrM	7146	7147	0.0	0.0
+chrM	7147	7148	0.0	0.0
+chrM	7148	7149	0.0	0.0
+chrM	7149	7150	0.0	0.0
+chrM	7150	7151	0.0	0.0
+chrM	7151	7152	0.0	0.0
+chrM	7152	7153	0.0	0.0
+chrM	7153	7154	0.0	0.0
+chrM	7154	7155	0.0	0.0
+chrM	7155	7156	0.0	0.0
+chrM	7156	7157	0.0	0.0
+chrM	7157	7158	0.0	0.0
+chrM	7158	7159	0.0	0.0
+chrM	7159	7160	0.0	0.0
+chrM	7160	7161	0.0	0.0
+chrM	7161	7162	0.0	0.0
+chrM	7162	7163	0.0	0.0
+chrM	7163	7164	0.0	0.0
+chrM	7164	7165	0.0	0.0
+ch