comparison dotknot.xml @ 0:42d20ff5da1b draft default tip

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna/dotknot commit 1973f3035c10db80883d80847ea254289f5cce2a-dirty

0:42d20ff5da1b

<tool id="dotknot" name="DotKnot" version="1.3.1">
    <description>pseudoknot prediction in a given RNA sequence</description>
    <requirements>
        <requirement type="package" version="1.8.5">vienna_rna</requirement>
        <requirement type="package" version="1.3.1">dotknot</requirement>
    </requirements>
    <stdio>
        <exit_code range="1:" />
        <exit_code range=":-1" />
        <regex match="Error:" />
        <regex match="Exception:" />
    </stdio>
    <version_command>dotknot version 1.3.1</version_command>
    <command><![CDATA[
        cp \$DOTKNOT_ROOT_PATH/* ./ -R &&
        dotknot.py
        $input
        $k
        $l
        $g
        > ./output.txt
        #if $g:
            &&
            mv ./*.ct ./globalstructure.ct
        #end if
    ]]></command>
    <inputs>
        <param name="input" type="data" format="fasta" label="Upload your FASTA file with RNA sequences:"
            help="The FASTA file must contain a comment line starting with > followed by the sequence.
                It can also contain several consecutive sequences and DotKnot will be executed for each sequence in the file."/>

        <param argument="-k" type="boolean" checked="false"
            truevalue="-k" falsevalue=""
            label="Include kissing hairpins?"
            help="Kissing hairpins are complex and biologically relevant types of pseudoknots.
                Inclusion of kissing hairpins will lead to increased run time,
                yet produce more meaningful results."/>

        <param argument="-l" type="boolean" checked="false"
            truevalue="-l" falsevalue=""
            label="Include near-optimal local pseudoknots?"
            help="Shows top five near-optimal local pseudoknots in terms of two criteria: 
                estimated free energy to length ratio and lowest estimated free energy.
                This can help to identify promising pseudoknot foldings and may
                compensate for the limitations of the energy parameters."/>
                
         <param argument="-g" type="boolean" checked="false"
            truevalue="-g" falsevalue=""
            label="Include global structure?"
            help="Shows predicted global structure in addition to predicted pseudoknots."/>

    </inputs>
    <outputs>
            <data name="output" format="txt" from_work_dir="./output.txt" 
                label="${tool.name} on ${on_string} (output file)">
            </data>
            <data name="outfile_globalstructure" format="txt" from_work_dir="./globalstructure.ct" 
                label="${tool.name} on ${on_string} (output global structure)">
                <filter>g == True</filter>
            </data>
    </outputs>
    <tests>
        <test>
            <param name="input" value="TMV.fasta" ftype="fasta"/>
            <param name="k" value=""/>
            <param name="l" value=""/>
            <param name="g" value=""/>
            <output name="output" file="test1_output.txt" ftype="txt"/>
        </test>
        <test>
            <param name="input" value="HCoV229E_short_KISSINGHAIRPINS.fasta" ftype="fasta"/>
            <param name="k" value="-k"/>
            <param name="l" value="-l"/>
            <param name="g" value="-g"/>
            <output name="output" file="test2_output.txt" ftype="txt"/>
            <output name="outfile_globalstructure" file="test2_output2.ct" ftype="txt"/>
        </test>
    </tests>
    <help><![CDATA[

**WHAT IT DOES**

DotKnot is a heuristic method for pseudoknot prediction in a given RNA sequence.

DotKnot extracts stem regions from the secondary structure probability dot plot calculated by RNAfold. Recursive H-type pseudoknots and intramolecular kissing hairpins are constructed and their presence in the sequence is verified. The detected pseudoknots can then be further analysed using bioinformatics or laboratory techniques.

-----

**INPUT**

The FASTA file must contain a comment line starting with > followed by the sequence. It can also
contain several consecutive sequences and DotKnot will be executed for each sequence in the file.

Please ensure that only bases A,C,G,U,T (a,c,g,u,t) are used.

*Example*::

    > Arc-Ful-SRP short
        GGGGGGUUCGGCGUCCCCUGUAACCCGAAACCGCCGAUACGCGGG
    > MMTV
        AAAAAACUUGUAAAGGGGCAGUCCCCUAGCCCCGCUCAAAAGGGGGAUG
        
-----

**OPTIONAL ARGUMENTS**

*Kissing hairpins*::
    Kissing hairpins are complex and biologically relevant types of pseudoknots.
    Inclusion of kissing hairpins will lead to increased run time, yet produce more meaningful
    results.
    
*local pseudoknots*:: 
    Shows top five near-optimal local pseudoknots in terms of two criteria: estimated free energy
    to length ratio and lowest estimated free energy. This can help to identify promising pseudoknot
    foldings and may compensate for the limitations of the energy parameters.
*global structure*:: 
    Shows predicted global structure in addition to predicted pseudoknots

-----

**OUTPUT**

Each pseudoknot is displayed in dot-bracket notation. Unpaired bases are indicated by dots. Base
pairs are written as bracket pairs. The first stem of a pseudoknot is indicated by round brackets , i.e. ( and ). The second stem of a pseudoknot is indicated by square brackets, i.e. [ and ]. 

We also give the start and end positions of the pseudoknot with respect to the input sequence. If the global structure option is chosen (-g:), a CT file will be created which contains the global
structure. The file name will start with the identifier given in the FASTA file.

-----

**dotknot** is a Free and Open Source Software, see more details and background information on the dotknot dotknot_ Website.

.. _dotknot: http://dotknot.csse.uwa.edu.au/

    ]]></help>
    <citations>
        <citation type="doi">10.1093/nar/gkq021</citation>
        <citation type="doi">10.1261/rna.2394511</citation>
    </citations>
</tool>