Mercurial > repos > bgruening > dotknot
diff dotknot.xml @ 0:42d20ff5da1b draft default tip
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna/dotknot commit 1973f3035c10db80883d80847ea254289f5cce2a-dirty
| author | bgruening |
|---|---|
| date | Thu, 17 Sep 2015 17:10:07 -0400 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/dotknot.xml Thu Sep 17 17:10:07 2015 -0400 @@ -0,0 +1,140 @@ +<tool id="dotknot" name="DotKnot" version="1.3.1"> + <description>pseudoknot prediction in a given RNA sequence</description> + <requirements> + <requirement type="package" version="1.8.5">vienna_rna</requirement> + <requirement type="package" version="1.3.1">dotknot</requirement> + </requirements> + <stdio> + <exit_code range="1:" /> + <exit_code range=":-1" /> + <regex match="Error:" /> + <regex match="Exception:" /> + </stdio> + <version_command>dotknot version 1.3.1</version_command> + <command><![CDATA[ + cp \$DOTKNOT_ROOT_PATH/* ./ -R && + dotknot.py + $input + $k + $l + $g + > ./output.txt + #if $g: + && + mv ./*.ct ./globalstructure.ct + #end if + ]]></command> + <inputs> + <param name="input" type="data" format="fasta" label="Upload your FASTA file with RNA sequences:" + help="The FASTA file must contain a comment line starting with > followed by the sequence. + It can also contain several consecutive sequences and DotKnot will be executed for each sequence in the file."/> + + <param argument="-k" type="boolean" checked="false" + truevalue="-k" falsevalue="" + label="Include kissing hairpins?" + help="Kissing hairpins are complex and biologically relevant types of pseudoknots. + Inclusion of kissing hairpins will lead to increased run time, + yet produce more meaningful results."/> + + <param argument="-l" type="boolean" checked="false" + truevalue="-l" falsevalue="" + label="Include near-optimal local pseudoknots?" + help="Shows top five near-optimal local pseudoknots in terms of two criteria: + estimated free energy to length ratio and lowest estimated free energy. + This can help to identify promising pseudoknot foldings and may + compensate for the limitations of the energy parameters."/> + + <param argument="-g" type="boolean" checked="false" + truevalue="-g" falsevalue="" + label="Include global structure?" + help="Shows predicted global structure in addition to predicted pseudoknots."/> + + </inputs> + <outputs> + <data name="output" format="txt" from_work_dir="./output.txt" + label="${tool.name} on ${on_string} (output file)"> + </data> + <data name="outfile_globalstructure" format="txt" from_work_dir="./globalstructure.ct" + label="${tool.name} on ${on_string} (output global structure)"> + <filter>g == True</filter> + </data> + </outputs> + <tests> + <test> + <param name="input" value="TMV.fasta" ftype="fasta"/> + <param name="k" value=""/> + <param name="l" value=""/> + <param name="g" value=""/> + <output name="output" file="test1_output.txt" ftype="txt"/> + </test> + <test> + <param name="input" value="HCoV229E_short_KISSINGHAIRPINS.fasta" ftype="fasta"/> + <param name="k" value="-k"/> + <param name="l" value="-l"/> + <param name="g" value="-g"/> + <output name="output" file="test2_output.txt" ftype="txt"/> + <output name="outfile_globalstructure" file="test2_output2.ct" ftype="txt"/> + </test> + </tests> + <help><![CDATA[ + +**WHAT IT DOES** + +DotKnot is a heuristic method for pseudoknot prediction in a given RNA sequence. + +DotKnot extracts stem regions from the secondary structure probability dot plot calculated by RNAfold. Recursive H-type pseudoknots and intramolecular kissing hairpins are constructed and their presence in the sequence is verified. The detected pseudoknots can then be further analysed using bioinformatics or laboratory techniques. + +----- + +**INPUT** + +The FASTA file must contain a comment line starting with > followed by the sequence. It can also +contain several consecutive sequences and DotKnot will be executed for each sequence in the file. + +Please ensure that only bases A,C,G,U,T (a,c,g,u,t) are used. + +*Example*:: + + > Arc-Ful-SRP short + GGGGGGUUCGGCGUCCCCUGUAACCCGAAACCGCCGAUACGCGGG + > MMTV + AAAAAACUUGUAAAGGGGCAGUCCCCUAGCCCCGCUCAAAAGGGGGAUG + +----- + +**OPTIONAL ARGUMENTS** + +*Kissing hairpins*:: + Kissing hairpins are complex and biologically relevant types of pseudoknots. + Inclusion of kissing hairpins will lead to increased run time, yet produce more meaningful + results. + +*local pseudoknots*:: + Shows top five near-optimal local pseudoknots in terms of two criteria: estimated free energy + to length ratio and lowest estimated free energy. This can help to identify promising pseudoknot + foldings and may compensate for the limitations of the energy parameters. +*global structure*:: + Shows predicted global structure in addition to predicted pseudoknots + +----- + +**OUTPUT** + +Each pseudoknot is displayed in dot-bracket notation. Unpaired bases are indicated by dots. Base +pairs are written as bracket pairs. The first stem of a pseudoknot is indicated by round brackets , i.e. ( and ). The second stem of a pseudoknot is indicated by square brackets, i.e. [ and ]. + +We also give the start and end positions of the pseudoknot with respect to the input sequence. If the global structure option is chosen (-g:), a CT file will be created which contains the global +structure. The file name will start with the identifier given in the FASTA file. + +----- + +**dotknot** is a Free and Open Source Software, see more details and background information on the dotknot dotknot_ Website. + +.. _dotknot: http://dotknot.csse.uwa.edu.au/ + + ]]></help> + <citations> + <citation type="doi">10.1093/nar/gkq021</citation> + <citation type="doi">10.1261/rna.2394511</citation> + </citations> +</tool>