changeset 8:e27815e82dd4 draft

"planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit 7bec5df9cb30dd196ae99565d77547e12d05fa48"
author bgruening
date Wed, 30 Jun 2021 20:02:51 +0000
parents 8d4f03b5fe9d
children 276f5d8712d5
files flye.xml macros.xml test-data/ecoli_01.fastq.gz test-data/ecoli_02.fastq.gz test-data/ecoli_03.fastq.gz test-data/ecoli_04.fastq.gz test-data/ecoli_05.fastq.gz test-data/ecoli_06.fastq.gz test-data/ecoli_07.fastq.gz test-data/ecoli_hifi_01.fastq.gz test-data/ecoli_hifi_02.fastq.gz test-data/ecoli_hifi_03.fastq.gz test-data/ecoli_hifi_04.fastq.gz test-data/ecoli_hifi_05.fastq.gz test-data/ecoli_hifi_06.fastq.gz test-data/ecoli_hifi_07.fastq.gz test-data/ecoli_hifi_08.fastq.gz test-data/ecoli_hifi_09.fastq.gz test-data/nanopore.fasta test-data/nanopore.fasta.gz test-data/result1.log test-data/result1_assembly.fasta test-data/result1_assembly_graph.dot test-data/result1_assembly_graph.gfa test-data/result1_assembly_info.txt test-data/result2_assembly.fasta test-data/result2_assembly_graph.dot test-data/result2_assembly_graph.gfa test-data/result2_assembly_info.txt test-data/result3_assembly.fasta test-data/result3_assembly_graph.dot test-data/result3_assembly_graph.gfa test-data/result3_assembly_info.txt test-data/result4_assembly.fasta test-data/result4_assembly_graph.dot test-data/result4_assembly_graph.gfa test-data/result4_assembly_info.txt
diffstat 37 files changed, 7783 insertions(+), 3182 deletions(-) [+]
line wrap: on
line diff
--- a/flye.xml	Mon Jun 21 08:37:37 2021 +0000
+++ b/flye.xml	Wed Jun 30 20:02:51 2021 +0000
@@ -1,146 +1,390 @@
-<tool id="flye" name="Flye assembly" version="2.8.2+galaxy0">
-    <description>of long and error-prone reads</description>
+<tool id="flye" name="Flye" version="@TOOL_VERSION@+galaxy@SUFFIX_VERSION@" profile="20.01">
+    <description>de novo assembler for single molecule sequencing reads</description>
     <macros>
         <import>macros.xml</import>
     </macros>
     <expand macro="requirements" />
+    <expand macro="edam_ontology"/>
     <version_command>flye --version</version_command>
-    <command detect_errors="exit_code">
-    <![CDATA[
-
-    #for $counter, $input in enumerate($inputs):
-
-        #if $input.is_of_type('fastqsanger', 'fastq'):
-            #set $ext = 'fastq'
-        #elif $input.is_of_type('fastqsanger.gz', 'fastq.gz'):
-            #set $ext = 'fastq.gz'
-        #elif $input.is_of_type('fasta.gz'):
-            #set $ext = 'fasta.gz'
-        #elif $input.is_of_type('fasta'):
-            #set $ext = 'fasta'
+    <command detect_errors="exit_code"><![CDATA[
+        #for $counter, $input in enumerate($inputs):
+            #if $input.is_of_type('fastqsanger', 'fastq'):
+                #set $ext = 'fastq'
+            #elif $input.is_of_type('fastqsanger.gz', 'fastq.gz'):
+                #set $ext = 'fastq.gz'
+            #elif $input.is_of_type('fasta.gz'):
+                #set $ext = 'fasta.gz'
+            #elif $input.is_of_type('fasta'):
+                #set $ext = 'fasta'
+            #end if
+            ln -s '$input' ./input_${counter}.${ext} &&
+        #end for
+        flye
+        $mode
+        #for $counter, $input in enumerate($inputs):
+            ./input_${counter}.$ext
+        #end for
+        -o out_dir
+        -t \${GALAXY_SLOTS:-4}
+        -i $iterations
+        #if $hifi_error:
+            --hifi-error $hifi_error
         #end if
-        ln -s '$input' ./input_${counter}.${ext} &&
-    #end for
-
-    flye
-    $mode
-    #for $counter, $input in enumerate($inputs):
-        ./input_${counter}.$ext
-    #end for
-
-    -o out_dir
-    -t \${GALAXY_SLOTS:-4}
-    -i $i
-    #if $m:
-        -m '$m'
-    #end if
-    #if str($asm.asm_select) == "true":
-        --asm-coverage '$asm.asm'
-        -g '$asm.g'
-    #end if
-    ${plasmids}
-    ${meta}
-    ${no_trestle}
-    2>&1
+        #if $min_overlap:
+            -m $min_overlap
+        #end if
+        #if $asm.asm_select == 'true':
+            --asm-coverage $asm.asm_coverage
+            -g '${asm.genome_size}'
+        #end if
+        $plasmids
+        $meta
+        $trestle
     ]]></command>
     <inputs>
         <param name="inputs" type="data" format="fasta,fasta.gz,fastq,fastq.gz,fastqsanger.gz,fastqsanger" multiple="true" label="Input reads" />
         <param name="mode" type="select" label="Mode">
             <option value="--nano-raw">Nanopore raw</option>
             <option value="--nano-corr">Nanopore corrected</option>
+            <option value="--pacbio-hifi">PacBio HiFi</option>
             <option value="--pacbio-raw">PacBio raw</option>
             <option value="--pacbio-corr">PacBio corrected</option>
-            <option value="--subassemblies">high-quality contig-like input</option>
+            <option value="--subassemblies">High-quality contig-like input</option>
         </param>
-        <param argument="-i" type="integer" value="1" label="number of polishing iterations" />
-        <param argument="-m" type="integer" optional="true" label="minimum overlap between reads (default: auto)" />
-
+        <param argument="--iterations" type="integer" value="0" label="Number of polishing iterations" 
+            help="Polishing is performed as the final assembly stage. By default, Flye runs one polishing iteration. Additional iterations 
+                might correct a small number of extra errors (due to improvements on how reads may align to the corrected assembly). If the 
+                parameter is set to 0, the polishing is not performed."/>
+        <param argument="--min-overlap" type="integer" optional="true" label="Minimum overlap between reads" 
+            help="This sets a minimum overlap length for two reads to be considered overlapping. By default it is chosen 
+                automatically based on the read length distribution (reads N90) and does not require manual setting. Typical 
+                value is 3k-5k (and down to 1k for datasets with shorter read length). Intuitively, we want to set this 
+                parameter as high as possible, so the repeat graph is less tangled. However, higher values might lead to assembly gaps.
+                In some rare cases it makes sense to manually increase minimum overlap for assemblies of big genomes with long reads and high coverage." />
+        <param argument="--hifi-error" type="float" min="0" max="1" optional="true" label="Expected HiFi reads error rate" help="Default: 0.01"/>
+        <param argument="--plasmids" type="boolean" truevalue="--plasmids" falsevalue="" checked="False" label="Rescue short unassembled plasmids" />
+        <param argument="--keep-haplotypes" type="boolean" truevalue="--keep-haplotypes" falsevalue="" checked="False" label="Keep haplotypes"
+            help="By default, Flye collapses graph structures caused by alternative haplotypes (bubbles, superbubbles, roundabouts) to produce longer 
+                consensus contigs. This option retains the alternative paths on the graph, producing less contigouos, but more detailed assembly."/>
+        <param argument="--trestle" type="boolean" truevalue="--trestle" falsevalue="" 
+            checked="False" label="Enable Trestle" 
+            help="Trestle is an extra module that resolves simple repeats of multipicity 2 that were not bridged by reads. Depending on the datasets, it might 
+                resolve a few extra repeats, which is helpful for small (bacterial genomes). On large genomes, the contiguity improvements are usually minimal, 
+                but the computation might take a lot of time" />
+        <param argument="--meta" type="boolean" truevalue="--meta" falsevalue="" checked="False" label="Perform metagenomic assembly" 
+            help="It is designed for highly non-uniform coverage and is sensitive to underrepresented sequence at low coverage (as low as 2x).
+                In some examples of simple metagenomes, we observed that the normal mode assembled more contigious bacterial 
+                consensus sequence, while the metagenome mode was slightly more fragmented, but revealed strain mixtures"/>
         <conditional name="asm">
-            <param name="asm_select" type="select" label="description" help="">
+            <param name="asm_select" type="select" label="Reduced contig assembly coverage">
                 <option value="true">Enable reduced coverage for initial disjointing assembly</option>
                 <option value="false" selected="true">Disable reduced coverage for initial disjointing assembly</option>
             </param>
             <when value="true">
-                <param name="asm" argument="--asm-coverage" type="integer" optional="true" label="reduced coverage for initial disjointing assembly" />
-                <param argument="-g" type="text" label="estimated genome size (for example, 5m or 2.6g)">
+                <param argument="--asm-coverage" type="integer" min="0" value="30"
+                    label="Reduced coverage for initial disjointing assembly" 
+                    help="Typically, assemblies of large genomes at high coverage require a hundreds of RAM. For high coverage assemblies, 
+                        you can reduce memory usage by using only a subset of longest reads for initial contig extension stage (usually, the memory bottleneck). 
+                        The parameter --asm-coverage specifies the target coverage of the longest reads. For a typical assembly, 30x is enough to produce good 
+                        initial contigs. Regardless of this parameter, all reads will be used at the later pipeline stages."/>
+                <param argument="--genome-size" type="text" optional="true" label="Estimated genome size"
+                    help="For example, 5m or 2.6g. No longer required as input. However, it must be used in conjunction with --asm-coverage option.">
                     <validator type="regex" message="Genome size must be a float  or integer, optionally followed by the a unit prefix (kmg)">^([0-9]*[.])?[0-9]+[kmg]?$</validator>
                 </param>
             </when>
             <when value="false" />
         </conditional>
-
-        <param argument="--plasmids" type="boolean" truevalue="--plasmids" falsevalue="" checked="False" label="rescue short unassembled plasmids" />
-        <param argument="--meta" type="boolean" truevalue="--meta" falsevalue="" checked="False" label="perform metagenomic assembly" />
-        <param name="no_trestle" argument="--no-trestle" type="boolean" truevalue="--no-trestle" falsevalue="" checked="False" label="skip trestle stage" />
+        <param name="generate_log" type="boolean" truevalue="true" falsevalue="false" checked="false" label="Generate a log file"/>
     </inputs>
     <outputs>
-        <data name="consensus" format="fasta" from_work_dir="out_dir/assembly.fasta" label="${tool.name} on ${on_string} (consensus)"/>
-        <data name="assembly_graph" format="graph_dot" from_work_dir="out_dir/assembly_graph.gv" label="${tool.name} on ${on_string} (assembly_graph)"/>
-        <data name="assembly_gfa" format="txt" from_work_dir="out_dir/assembly_graph.gfa" label="${tool.name} on ${on_string} (Graphical Fragment Assembly)"/>
-        <data name="assembly_info" format="tabular" from_work_dir="out_dir/assembly_info.txt" label="${tool.name} on ${on_string} (assembly_info)"/>
-        <data name="flye_log" format="txt" from_work_dir="out_dir/flye.log" label="${tool.name} on ${on_string} (log)"/>
+        <data name="consensus" format="fasta" from_work_dir="out_dir/assembly.fasta" label="${tool.name} on ${on_string}: consensus"/>
+        <data name="assembly_graph" format="graph_dot" from_work_dir="out_dir/assembly_graph.gv" label="${tool.name} on ${on_string}: assembly graph"/>
+        <data name="assembly_gfa" format="txt" from_work_dir="out_dir/assembly_graph.gfa" label="${tool.name} on ${on_string}: graphical fragment assembly"/>
+        <data name="assembly_info" format="tabular" from_work_dir="out_dir/assembly_info.txt" label="${tool.name} on ${on_string}: assembly info"/>
+        <data name="flye_log" format="txt" from_work_dir="out_dir/flye.log" label="${tool.name} on ${on_string}: log">
+            <filter>generate_log</filter>
+        </data>
     </outputs>
     <tests>
-        <test>
-            <param name="inputs" ftype="fasta" value="nanopore.fasta"/>
+        <!--Test 01-->
+        <test expect_num_outputs="5">
+            <param name="inputs" ftype="fastq.gz" value="ecoli_01.fastq.gz,ecoli_02.fastq.gz,ecoli_03.fastq.gz,ecoli_04.fastq.gz,ecoli_05.fastq.gz,ecoli_06.fastq.gz,ecoli_07.fastq.gz"/>
             <param name="mode" value="--pacbio-raw"/>
+            <param name="generate_log" value="true"/>
             <output name="assembly_info" file="result1_assembly_info.txt" ftype="tabular" compare="sim_size"/>
             <output name="assembly_graph" file="result1_assembly_graph.dot" ftype="graph_dot" compare="sim_size"/>
             <output name="assembly_gfa" file="result1_assembly_graph.gfa" ftype="txt" compare="sim_size"/>
             <output name="consensus" file="result1_assembly.fasta" ftype="fasta" compare="sim_size"/>
+            <output name="flye_log" file="result1.log" ftype="txt" compare="sim_size"/>
         </test>
-        <test>
-            <param name="inputs" ftype="fasta" value="nanopore.fasta"/>
+        <!--Test 02-->
+        <test expect_num_outputs="4">
+            <param name="inputs" ftype="fasta.gz" value="nanopore.fasta.gz"/>
             <param name="mode" value="--nano-raw"/>
-            <output name="assembly_info" file="result2_assembly_info.txt" ftype="tabular" compare="sim_size"/>
-            <output name="assembly_graph" file="result2_assembly_graph.dot" ftype="graph_dot" compare="sim_size"/>
-            <output name="assembly_gfa" file="result2_assembly_graph.gfa" ftype="txt" compare="sim_size"/>
-            <output name="consensus" file="result2_assembly.fasta" ftype="fasta" compare="sim_size"/>
+            <output name="assembly_info" ftype="tabular">
+                <assert_contents>
+                    <has_size value="95" delta="100"/>
+               </assert_contents>
+            </output>
+            <output name="assembly_graph" ftype="graph_dot">
+                <assert_contents>
+                    <has_size value="803" delta="100"/>
+               </assert_contents>
+            </output>
+            <output name="assembly_gfa" ftype="txt">
+                <assert_contents>
+                    <has_size value="35047" delta="100"/>
+               </assert_contents>
+            </output>
+            <output name="consensus" ftype="fasta">
+                <assert_contents>
+                    <has_size value="35573" delta="100"/>
+               </assert_contents>
+            </output>
         </test>
-        <test>
-            <param name="inputs" ftype="fasta" value="nanopore.fasta"/>
-            <param name="mode" value="--nano-corr"/>
-            <param name="i" value="2"/>
+        <!--Test 03-->
+        <test expect_num_outputs="4">
+            <param name="inputs" ftype="fastq.gz" value="ecoli_hifi_01.fastq.gz,ecoli_hifi_02.fastq.gz,ecoli_hifi_03.fastq.gz,ecoli_hifi_04.fastq.gz,ecoli_hifi_05.fastq.gz,ecoli_hifi_06.fastq.gz,ecoli_hifi_07.fastq.gz,ecoli_hifi_08.fastq.gz,ecoli_hifi_09.fastq.gz"/>
+            <param name="mode" value="--pacbio-hifi"/>
+            <param name="iterations" value="1"/>
             <conditional name="asm">
                 <param name="asm_select" value="true" />
-                <param name="asm" value="40"/>
-                <param name="g" value="10000"/>
+                <param name="asm" value="100"/>
+                <param name="genome_size" value="3980000"/>
             </conditional>
-            <output name="assembly_info" file="result3_assembly_info.txt" ftype="tabular" compare="sim_size"/>
-            <output name="assembly_graph" file="result3_assembly_graph.dot" ftype="graph_dot" compare="sim_size"/>
-            <output name="assembly_gfa" file="result3_assembly_graph.gfa" ftype="txt" compare="sim_size"/>
-            <output name="consensus" file="result3_assembly.fasta" ftype="fasta" compare="sim_size"/>
+            <output name="assembly_info" ftype="tabular">
+                <assert_contents>
+                    <has_size value="286" delta="100"/>
+               </assert_contents>
+            </output>
+            <output name="assembly_graph" ftype="graph_dot">
+                <assert_contents>
+                    <has_size value="2135" delta="100"/>
+               </assert_contents>
+            </output>
+            <output name="assembly_gfa" ftype="txt">
+                <assert_contents>
+                    <has_size value="114351" delta="100"/>
+               </assert_contents>
+            </output>
+            <output name="consensus" ftype="fasta">
+                <assert_contents>
+                    <has_size value="116191" delta="100"/>
+               </assert_contents>
+            </output>
         </test>
-        <test>
-            <param name="inputs" ftype="fasta" value="nanopore.fasta"/>
+        <!--Test 04-->
+        <test expect_num_outputs="4">
+            <param name="inputs" ftype="fastq.gz" value="ecoli_01.fastq.gz,ecoli_02.fastq.gz,ecoli_03.fastq.gz,ecoli_04.fastq.gz,ecoli_05.fastq.gz,ecoli_06.fastq.gz,ecoli_07.fastq.gz"/>
             <param name="mode" value="--pacbio-raw"/>
-            <param name="i" value="1"/>
+            <param name="iterations" value="1"/>
             <param name="meta" value="true"/>
             <param name="plasmids" value="true"/>
-            <param name="no-trestle" value="true"/>
-            <output name="assembly_info" file="result4_assembly_info.txt" ftype="tabular" compare="sim_size"/>
-            <output name="assembly_graph" file="result4_assembly_graph.dot" ftype="graph_dot" compare="sim_size"/>
-            <output name="assembly_gfa" file="result4_assembly_graph.gfa" ftype="txt" compare="sim_size"/>
-            <output name="consensus" file="result4_assembly.fasta" ftype="fasta" compare="sim_size"/>
+            <output name="assembly_info" ftype="tabular">
+                <assert_contents>
+                    <has_size value="95" delta="100"/>
+               </assert_contents>
+            </output>
+            <output name="assembly_graph" ftype="graph_dot">
+                <assert_contents>
+                    <has_size value="367" delta="100"/>
+               </assert_contents>
+            </output>
+            <output name="assembly_gfa" ftype="txt">
+                <assert_contents>
+                    <has_size value="418051" delta="100"/>
+               </assert_contents>
+            </output>
+            <output name="consensus" ftype="fasta">
+                <assert_contents>
+                    <has_size value="425000" delta="100"/>
+               </assert_contents>
+            </output>
+        </test>
+        <!--Test 05-->
+        <test expect_num_outputs="4">
+            <param name="inputs" ftype="fastq.gz" value="ecoli_hifi_01.fastq.gz,ecoli_hifi_02.fastq.gz,ecoli_hifi_03.fastq.gz,ecoli_hifi_04.fastq.gz,ecoli_hifi_05.fastq.gz,ecoli_hifi_06.fastq.gz,ecoli_hifi_07.fastq.gz,ecoli_hifi_08.fastq.gz,ecoli_hifi_09.fastq.gz"/>
+            <param name="mode" value="--pacbio-hifi"/>
+            <param name="iterations" value="1"/>
+            <output name="assembly_info" ftype="tabular">
+                <assert_contents>
+                    <has_size value="286" delta="100"/>
+               </assert_contents>
+            </output>
+            <output name="assembly_graph" ftype="graph_dot">
+                <assert_contents>
+                    <has_size value="2135" delta="100"/>
+               </assert_contents>
+            </output>
+            <output name="assembly_gfa" ftype="txt">
+                <assert_contents>
+                    <has_size value="114351" delta="100"/>
+               </assert_contents>
+            </output>
+            <output name="consensus" ftype="fasta">
+                <assert_contents>
+                    <has_size value="116191" delta="100"/>
+               </assert_contents>
+            </output>
+        </test>
+        <!--Test 06-->
+        <test expect_num_outputs="4">
+            <param name="inputs" ftype="fastq.gz" value="ecoli_hifi_01.fastq.gz,ecoli_hifi_02.fastq.gz,ecoli_hifi_03.fastq.gz,ecoli_hifi_04.fastq.gz,ecoli_hifi_05.fastq.gz,ecoli_hifi_06.fastq.gz,ecoli_hifi_07.fastq.gz,ecoli_hifi_08.fastq.gz,ecoli_hifi_09.fastq.gz"/>
+            <param name="mode" value="--pacbio-hifi"/>
+            <param name="iterations" value="1"/>
+            <param name="hifi-error" value="0.02"/> 
+            <output name="assembly_info" ftype="tabular">
+                <assert_contents>
+                    <has_size value="286" delta="100"/>
+               </assert_contents>
+            </output>
+            <output name="assembly_graph" ftype="graph_dot">
+                <assert_contents>
+                    <has_size value="2135" delta="100"/>
+               </assert_contents>
+            </output>
+            <output name="assembly_gfa" ftype="txt">
+                <assert_contents>
+                    <has_size value="114351" delta="100"/>
+               </assert_contents>
+            </output>
+            <output name="consensus" ftype="fasta">
+                <assert_contents>
+                    <has_size value="116191" delta="100"/>
+               </assert_contents>
+            </output>
+        </test>
+        <!--Test 07-->
+        <test expect_num_outputs="4">
+            <param name="inputs" ftype="fastq.gz" value="ecoli_hifi_01.fastq.gz,ecoli_hifi_02.fastq.gz,ecoli_hifi_03.fastq.gz,ecoli_hifi_04.fastq.gz,ecoli_hifi_05.fastq.gz,ecoli_hifi_06.fastq.gz,ecoli_hifi_07.fastq.gz,ecoli_hifi_08.fastq.gz,ecoli_hifi_09.fastq.gz"/>
+            <param name="mode" value="--pacbio-hifi"/>
+            <param name="iterations" value="1"/>
+            <param name="keep-haplotypes" value="true"/>
+            <output name="assembly_info" ftype="tabular">
+                <assert_contents>
+                    <has_size value="286" delta="100"/>
+               </assert_contents>
+            </output>
+            <output name="assembly_graph" ftype="graph_dot">
+                <assert_contents>
+                    <has_size value="2135" delta="100"/>
+               </assert_contents>
+            </output>
+            <output name="assembly_gfa" ftype="txt">
+                <assert_contents>
+                    <has_size value="114351" delta="100"/>
+               </assert_contents>
+            </output>
+            <output name="consensus" ftype="fasta">
+                <assert_contents>
+                    <has_size value="116191" delta="100"/>
+               </assert_contents>
+            </output>
         </test>
     </tests>
     <help><![CDATA[
 
-Input reads could be in FASTA or FASTQ format, uncompressed
-or compressed with gz. Currenlty, raw and corrected reads
-from PacBio and ONT are supported. The expected error rates are
-<30% for raw and <2% for corrected reads. Additionally,
---subassemblies option performs a consensus assembly of multiple
-sets of high-quality contigs. You may specify multiple
-files with reads (separated by spaces). Mixing different read
-types is not yet supported.
+.. class:: infomark
+
+**Purpose**
+
+Flye is a de novo assembler for single molecule sequencing reads, such as those produced by PacBio and Oxford Nanopore Technologies. 
+It is designed for a wide range of datasets, from small bacterial projects to large mammalian-scale assemblies. The package represents 
+a complete pipeline: it takes raw PacBio/ONT reads as input and outputs polished contigs. Flye also has a special mode for metagenome 
+assembly.
+
+----
+
+.. class:: infomark
+
+**Quick usage**
+
+Input reads can be in FASTA or FASTQ format, uncompressed or compressed with gz. Currently, PacBio (raw, corrected, HiFi) and ONT reads 
+(raw, corrected) are supported. Expected error rates are <30% for raw, <3% for corrected, and <1% for HiFi. Note that Flye was primarily 
+developed to run on raw reads. Additionally, the *--subassemblies* option performs a consensus assembly of multiple sets of high-quality 
+contigs. You may specify multiple files with reads (separated by spaces). Mixing different read types is not yet supported. The *--meta* o
+ption enables the mode for metagenome/uneven coverage assembly.
+
+Genome size estimate is no longer a required option. You need to provide an estimate if using *--asm-coverage* option.
+
+To reduce memory consumption for large genome assemblies, you can use a subset of the longest reads for initial disjointig assembly by 
+specifying *--asm-coverage* and *--genome-size* options. Typically, 40x coverage is enough to produce good disjointigs.
+
+----
+
+.. class:: infomark
+
+**Outputs**
+
+The main output files are:
+
+    ::
+
+        - Final assembly: contains contigs and possibly scaffolds (see below).
+        - Final repeat graph: note that the edge sequences might be different (shorter) than contig sequences, because contigs might include multiple graph edges.
+        - Extra information about contigs (such as length or coverage).
+
+Each contig is formed by a single unique graph edge. If possible, unique contigs are extended with the sequence from flanking unresolved repeats on the graph. Thus, 
+a contig fully contains the corresponding graph edge (with the same id), but might be longer then this edge. This is somewhat similar to unitig-contig relation in 
+OLC assemblers. In a rare case when a repetitive graph edge is not covered by the set of "extended" contigs, it will be also output in the assembly file.
+
+Sometimes it is possible to further order contigs into scaffolds based on the repeat graph structure. These ordered contigs will be output as a part of scaffold in 
+the assembly file (with a scaffold prefix). Since it is hard to give a reliable estimate of the gap size, those gaps are represented with the default 100 Ns. 
+assembly_info.txt file (below) contains additional information about how scaffolds were formed.
+
+Extra information about contigs/scaffolds is output into the assembly_info.txt file. It is a tab-delimited table with the columns as follows:
 
-You must provide an estimate of the genome size as input,
-which is used for solid k-mers selection. The estimate could
-be rough (e.g. withing 0.5x-2x range) and does not affect
-the other assembly stages. Standard size modificators are
-supported (e.g. 5m or 2.6g).
+    ::
+
+        - Contig/scaffold id
+        - Length
+        - Coverage
+        - Is circular, (Y)es or (N)o
+        - Is repetitive, (Y)es or (N)o
+        - Multiplicity (based on coverage)
+        - Alternative group
+        - Graph path (graph path corresponding to this contig/scaffold).
+
+Scaffold gaps are marked with ?? symbols, and * symbol denotes a terminal graph node. Alternative contigs (representing alternative haplotypes) will have the same alt. 
+group ID. Primary contigs are marked by *.
+
+----
+
+.. class:: infomark
+
+**Algorithm Description**
+
+This is a brief description of the Flye algorithm. Please refer to the manuscript for more detailed information. The draft contig extension is organized as follows:
+
+    ::
 
-    ]]></help>
+        - K-mer counting / erroneous k-mer pre-filtering
+        - Solid k-mer selection (k-mers with sufficient frequency, which are unlikely to be erroneous)
+        - Contig extension. The algorithm starts from a single read and extends it with a next overlapping read (overlaps are dynamically detected using the selected solid k-mers).
+
+Note that we do not attempt to resolve repeats at this stage, thus the reconstructed contigs might contain misassemblies. Flye then aligns the reads on these draft 
+contigs using minimap2 and calls a consensus. Afterwards, Flye performs repeat analysis as follows:
+
+    ::
+
+        - Repeat graph is constructed from the (possibly misassembled) contigs
+        - In this graph all repeats longer than minimum overlap are collapsed
+        - The algorithm resolves repeats using the read information and graph structure
+        - The unbranching paths in the graph are output as contigs
+
+If enabled, after resolving bridged repeats, Trestle module attempts to resolve simple unbridged repeats (of multiplicity 2) using the heterogeneities between repeat copies. 
+Finally, Flye performs polishing of the resulting assembly to correct the remaining errors:
+
+    ::
+
+        - Alignment of all reads to the current assembly using minimap2
+        - Partition the alignment into mini-alignments (bubbles)
+        - Error correction of each bubble using a maximum likelihood approach
+
+
+The polishing steps could be repeated, which might slightly increase quality for some datasets.
+
+
+  ]]></help>
     <expand macro="citations" />
 </tool>
--- a/macros.xml	Mon Jun 21 08:37:37 2021 +0000
+++ b/macros.xml	Wed Jun 30 20:02:51 2021 +0000
@@ -1,23 +1,31 @@
 <macros>
+    <token name="@TOOL_VERSION@">2.8.3</token>
+    <token name="@SUFFIX_VERSION@">0</token>
     <xml name="requirements">
         <requirements>
-        <requirement type="package" version="2.8.2">flye</requirement>
-            <yield/>
+            <requirement type="package" version="@TOOL_VERSION@">flye</requirement>
         </requirements>
     </xml>
+    <xml name="edam_ontology">
+        <edam_topics>                                                                                  
+            <edam_topic>topic_0196</edam_topic>
+        </edam_topics>
+        <edam_operations>
+            <edam_operation>operation_0525</edam_operation>
+        </edam_operations>
+    </xml>
     <xml name="citations">
         <citations>
             <citation type="doi">10.1073/pnas.1604560113</citation>
             <citation type="bibtex">
-@misc{githubFlye,
-  author = {LastTODO, FirstTODO},
-  year = {TODO},
-  title = {Flye},
-  publisher = {GitHub},
-  journal = {GitHub repository},
-  url = {https://github.com/fenderglass/Flye},
-}</citation>
-            <yield />
+                @misc{githubFlye,
+                author = {Kolmogorov, Mijhail},
+                year = {2021},
+                title = {Flye},
+                publisher = {GitHub},
+                journal = {GitHub repository},
+                url = {https://github.com/fenderglass/Flye}}
+            </citation>
         </citations>
     </xml>
 </macros>
Binary file test-data/ecoli_01.fastq.gz has changed
Binary file test-data/ecoli_02.fastq.gz has changed
Binary file test-data/ecoli_03.fastq.gz has changed
Binary file test-data/ecoli_04.fastq.gz has changed
Binary file test-data/ecoli_05.fastq.gz has changed
Binary file test-data/ecoli_06.fastq.gz has changed
Binary file test-data/ecoli_07.fastq.gz has changed
Binary file test-data/ecoli_hifi_01.fastq.gz has changed
Binary file test-data/ecoli_hifi_02.fastq.gz has changed
Binary file test-data/ecoli_hifi_03.fastq.gz has changed
Binary file test-data/ecoli_hifi_04.fastq.gz has changed
Binary file test-data/ecoli_hifi_05.fastq.gz has changed
Binary file test-data/ecoli_hifi_06.fastq.gz has changed
Binary file test-data/ecoli_hifi_07.fastq.gz has changed
Binary file test-data/ecoli_hifi_08.fastq.gz has changed
Binary file test-data/ecoli_hifi_09.fastq.gz has changed
--- a/test-data/nanopore.fasta	Mon Jun 21 08:37:37 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,418 +0,0 @@
->bf06004a-705a-4fe9-942a-2dcabf04766e
-CTCCATTGTACTTCACCAGTTGCATTATTGTTGCTAGAGACAGCGCTGTGACATAGCCTGCAGCACTTATTTCCTTCGTATCTTATATATGTATATATATGTGCAATGTCATGTGATAGTGCTGGAGGAGGTATAGGCACACATATAAGCGATCAGCAGCCAGCAGGAGAACGCGACCAGGCAATTAGCTGCAAGAGTGGGTGCTCGTATTGCAATAATACACTTGTGCTGGATGTTTATGTACACATTACAGCAAGTGCACAATTATGAATACACATAGGTACAGTGCTTAACCGATATGTGTGCATACTACAATGAGTGAAAATTTGTATTCTAGGAGGTCGCAGAATCGCGGTACTTCTTCAACTGTTAAAGAAGTGCCGTCACAAAGAGACCAAAAAACTCAATGCTGTGCAAAGGTTAATCTAACAGGCTTGGAGCCGCGCAATCCCCTGGTGCGGAGACCAGTCTACATCGCCGTGAAGACGGATGTAAATTACGCGACCGCCAGACCATAGAAGTTGTGTCGTTATTGTGCGGCAAACTGGCAAAAAATCACACACAGTGAGTCGCGCCATAGTTCTGCTGTCACGCGAATTGTGCGCCTGTTTCATGTAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAGCTGGCAATGCTTGCAGCGAACGATCTGGAGGGAGGCGTTGCCAGATCAACCATTAATGATCAATGTTGATAGTACGTGGGCGAAATTCATTAAAATTTAAAATTAGGCAAATTTAATTTAATTTAATTTTGATTGGTAACTGGGGCGCACAAGTCTTTAAGAAAGGGAAAGGCACAAAGGTCCGGACAGATAAGCTCATCTCACCGTGTAACAGTTGCCTAAGCAGAGGCTCTGGTGTGTCCGAGTCAGTGCAAACCTCCATCCGTAAAAGCCGGAAATCCGTATTTGCGGCTGACCCTGGAAACAGCAGGCCATCCTTCAGTTGATGGACAGCCTGCCAGTGGGGCGATTTCGATCGCAGCGACGTTCAGAATCCCCGACTTTCGAGATCGGAGTCAACCCGACCCATGGTGATCGGTCCCGTCGGTAATGGCAAAGGGGTGAGCTTTACGCAGGCCCCAGCCGCCGTTGACGCTATCGACCCAGCGATGCGGAATTGAAACCGGCATCACATTTTGGCTCTAAGTCGAAGACGATGGACCCATCGCCATTACCATCACCAAAAAAGACGGGAGGAGATCCCCAGCTGGTTCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCCAGAACGAGGACCTGAGGCGCGCACCAGGATGAATGAATCCAGCCCCCCTTCTATCCACGTGAGACCCAACGACACACGCGCACTTAACACGGGGCCAAGGCACGCCGCTGAACTCTATTAACAACGGGCGATAGAACATGCAGAAGGTACTACTGGCAGCACCGCTTGAAGAGCAGCGCTTGCAGACGGAGGGTACACAAAAAAGCCACCAAAGGCTCCACAAAATGCGCAGGTACACCCACGTTGCGGATTGTAAAGTCAGGCATACAGAGCAACCCGTTGGATGGCAACGGTGAGCGTGGCATCCACAACAGGTCCAAATGAGCAGCTAATGCATCTGTCGCCAGAATGCTAGCACGGGTGCAGAGGCACTCATCATTAAGCAGGAGAGGCTTCGTACGCAGAGATGCTACCGGAAGCTAAGATCGAGCCTTAGCGAACTGGTTGAAAAAAATCCGGAAGAGAGCAGAAGTGATCCTCTGTTGCTTGGCAGGTGGGGAAAGCTTCGGAAAGCGTTCCGTTTAAAACGACCTGGAAGCGGCGCTCAATGACTTAGCCTCTGTGTGTGCTGGAGCTGAAAGAATAATGGCGCTATCTTGGCGGATTAGGACGAAGTACGACAATCCCACAGCTGCTTGGTCGCCCAATTCAGGGCCTGCGAATCCTGAAGATATCAGGGGCCTTCGCGGTATATGCAGATTGCAAATAGCCTCAGTGCTGCTGAACGCGAACGTTGCGATACCAATCCTTAAACAGGGCACCATAATCGTTGGATGGTCAGATGTCGTATTCACCCGGGACCTCCGACCCACGAGATGCTACAGGTGTGCGGCTTTGCTTAACGGGCATCGATCAGCAACCTGCAAGGACACTGACAGGGCAGACTGCTGTCTTAGATGCGTGGGCGTGGGCACAAGGCAAAGGGGTGCGTTGCTGCGCAAAATATATACCTGATCTGCAGCAGCGAGAAGGGTGGACGAAACGCGGCAGGAGGGTAGCTTTGCGTGCCCGACTTACAGAGCGACACTAAAAGATGCCAAGAGCCACATGCACGCTCATATTGGCGTAGTACGGCATGTCAATCATTGCGCAGCAACTCAGAGCATACTGGCGAACTGCGGTGTATCACTCCTAAGCGAACCACCGCGATACCATTTGGTGGACGAAAATCGTCCCGCGATCCTTGACCTTGAGGCGGAAGCAGCATCAAATGCTGCGAAACCTATACAAGTCGGGCTGGCTGCTGCGGGGTGTATAAGCATGCGAAGTTAAAACACGTGCACATGTACAGCTGCTATACGCTCCGCCGGTAAACGCAGTTCGAGAACTTCTGGAGGCGCTTTCCATTGGACCATGCACGAGAAGGGCGAAGCCCGAAGGTCGTACCGGCGACACAATGCTGGACAGTGGAATGGGGCGGCATCCAGCACCAGAAGACGGAAGCTGTGATTGACGCCGGCTGGACTCATACTGGGCGATGATGGACGGAAAGGCGACGTTTGCTAACGATACGTCCTTTATTGACGACCGCTTTGTCGCGGGCTGGTAGACAACAACAACTGGATGGTCCATGACGTCATGACGTAGCGACCATGCCCTGATGCCTTGCTTCTCCCCGGAGGTGTATGCAGCGAACAGCCGGAAGCGGGACCTGGAGGAAGATCGATGAAATTACATGCTGGCCTATCAGATCAATTCGCAAAAATCCCAGACGCAAGAGTATGGCGGCAGGCCTCATGCTGGAAGAATGTCTGGGCGCAATCTGCCAGGAAAAAAAATAAGGCTGGCTGCAAACCACCCGTTTACTGGTGGAACGCCAACTACGGTGCGGAGTTGCCTCGGGAGAACGGCACGAGCCAGAGGCGGTACCCACCACGCGGAACTCTTGGGGAGGCTTTCCAGGAAACGGCACTTAGAGTTCCAAGCACGGCATCGCGCGGCTGCAGGGACGCGGTGGGCAGGCACAGGATGGCGTGGGCAATATCTGGAGACGCACTCGCCTACAAGCGCAGCGGAAGGCCCCACAGGAGGAGAGCAGCCAGCCCATCCGACCCGACAACAACATACTGGGGCTGTTTAAGCAGACCACTATGGAGGCCGGTAGCCCTGCCCAGATTTGCCGTGCGTCGGGGCAAGTCGTCGAGGCAGCGCTGACGATGTGGCAATCACAGCCGGCGGAGCTAGCAGCAATAGCGTACAAGACCGAAGCAGTCCTACTAAGCAGCAGGAAAAAGATGGAGAACATGCTGGTCTCCGTCGAAGTCAAGGGAGGACTCTGCGAGAGTCCCCTAAAGTACCTGGGGGTGAATCGCAGACTATGGTTCAGGAGACCACCAGTACACGCCAGCAGAGAGCCAGCAGTCACATCCTCTTCGTTGGCGGGAGGCTTATGCCCCGTCAGGCCCAGGTACCGGCGAAACTTGCGCGCTGGTATGCAGTAGCAAAGAGCTTCGCTGCTATACGCTGCACCAGTCTGAACGAAATGCCACTTGCAGGGGTCTCGCCACCTGAAAGGAGCTGATTGCTACCAATGGCCCTCAGGCTCATTGTAGGGATTCAGGTTCATATCCAGACGCGGCGCGCTGGCGCTGACAGGCCGATTGATCTGGAGATCAGGCTCTCAAGCGCTTATGCGGGTGGCTTCCAGGCAAGAGGCACAGTGGCTGTGGGTCTTGGAAAGATGGCAAACGCGCGCCCGTCGCGACGGGAGGTGGATATCAGCTCATCATCCAGAGATGGTTTGAACGATGACCTCTCAAAGATTAATTAATGAAGCTTGGAATTTGTTATTTATTTTCTTGTATATTTGATATTTGAATTTGTTTTATTTATAAGGTAAATATATTGTTTTGGTATATTTCATACAAAAAAGGAGTTTTAATCAAGCAAATATGAAGACGTTAATTTGACCTTTGAAGTCAAAAAGAAATTCCAACTTATTTCACGATTGACGACTGTAGCATGCCAGATTTTTAATTTCAAGTTAACGACCGTTTCTACATTGCTTTACTTTGCTTTCATTTTGCATATTGACAGGAGACACGAACCTACCTTGCAACAGCGTGGCAAATAACTTCCAGCAAAGCATATTTCTCCTGTCATCCTTGTCAAGCTCACACACGGACCAGTCAAGGTATTTCATCGGTATTGAGCAGGATGTGAATTATAAGTTGCACCATGTTTCTTTGGTCTGGCGCCACGATAACTGAGCGTACCAGTCGTAGAGTTCTTGCCCGCTGTATCTATAGTTCAGATTAAATAGTGCCTGGACACGCTTCATCATGGTGACGATGATGATTGACCCCCATCCCAAACATTTGTCCACGCCATCATAGCAGCAGCTAAACCTCTCGGGCTGAGAGGTGACCAGCAGAGCCTTATTGCGCCCTCATCGGCAGACGGAGCAGTTAAGAGTAAAATTGCTCTGCGGTTTCCACTGCGTCTGGCGTGAGGCGCTGGGCTGCCAGTATCCACGTGGCCCGAACTACATGATTGCCGCCGAAAACAGCCATGGTCCGTGAGGGCTGGTCGTAATGTGGTAGTCCGTTTTGTTGACGCTCGCAATCAGCCCACTCGTTAGTTGCGCGGAATGAGTTTGTAAGGATCAGCGTCCCCGTTGTGACTCTTGCCACCTGGTCTGCTCTCGATCCACTCTTTGATCTGGTGGAGGTGTATTACCACTCACCAAGGTATTTGCCCTTTATGTCCAGGTCAATGGGTGTAATGCTGCGTGGAAGGCGTTATGCGCTGCGTCGTCCGATGGTTCTAAAGCCTCTATTAGCCTGAAGGCCATTGTCGTGATACTGCGCAGGCTTTCATGAATCTGCGCATGGAAGCCGCAATAGGCGCAGCATAAAGCGGTGTTACTGAAACCATATCTTTCTGTTAGTCTCTAGCCGGCAGTCTGGGTCCTCCACGTTGAATACTCGCCATGCTGCGCTGTCCATTACTTCGCTGCATGCATGAACGTGATTATTAGAACACCAAGTGTATTTCAACGTTTCTATACTGAGGCGATTTCTCGCGCTGACTTGCGCTCAACGGACTTTCTGCTGTTCAGCGGGACGCTGCTGATCTTATGCGCAACTGACCGATCCAGACTTTAACCATTGTGCCGTGTTTCCCGTTATGTCCTGGAGCTCCGGTATTGTCTTGGCGACCGCTTTATCGCGTCGTCGGCGAAGCAGTTGGCGCTCTCCTGAGCTTGCTAATGCTCGATATTCCATCATATAATGTTCCACAAGATCGATTCTAGTACCAAGGCCAGCGGGAACGCCACCAGAAGACTTGGTGGCTTCTTGGACCAATGTTCTGTTGCATTACCATAGCACGGTCCCTGGAAGTTGCCAGAATTACGCTTTCCGTATGTGGTCGGGAACGCCCAAGTTTTTTTATAGCCCCGAGGATATTGCATCTCGCTGTATTGAATGCGTTCTTGACGTCTAGCGTGTGATGATGGCACAGTACTGCTTACGCCGCCCAACCATCGGTTACCGTCGGTTGCCTGGCAGCGTCTGTTGCGGATTTGAGGCGTCGAGCTGCTTACCCTTTCTTTGGAAGCCATACTGTTATTTGGCGCCCTGAAGGCCTGTGGACTTCAGTGATTAATGCGCGTACGGTATGCGCTCAAAGAGCTTACCAGCAATGTTAACGGACACAACGGTCGGTAACTGCGTACTGGAACATTTGCGGGCCCCTTTCGGCAGAAAAAAGTTGCTTCATCTTTCCAGCGCTTGGAAGAACAATGCGTTTTGTTGGAATGTATCCCTGAAATACTCCCCGGTCTTTATTTGCGGTGGCGGCACAGCGACGATCACGCCAGGGATACCGGCGGCATGCCGGGAGCTGTTCGGTCTGATGATCCTCTTCGACGACTTCGCGCCTTGTTGATGATGCACACGGAAGTCAGAAGGCGGGGGGGGGGGGGGTCAACAGCGGGTTTATAACGATGTGTGTTAGCGGAAATAGTTCCACACACACGATCGATGGCCAGACGTACAGGTCCTGGAAGTCTACTTACCAGCGGGTGAGTTTTCGACTGTAGGTAAATGCGTCGTCTCTACGCTATCAATCAGGTCGCCATTCGCCTTTGCTGATATGCGCTTAAGCTCCAGTTCTAAGCTTCGCTTTATATACCTCAATGCACCGGGGTGGTGCATTTGCCCTGCTGCGCTTCTCCTTGATGCACTCGAAACTGGTGCAATGATCCCTCCACACCAGTAGACAGGGGGCTTTCGTTTCGTGGTGTTCCTTTTCTCGGCATACCGCATCACACACATTGCTCTAAGGCCTATCCATGAGCGCCACCGGATTCTCCGCGCGTGTCCAATTATGGACTCAATGCCTCGATCTGGTACCAGCATGGGTTCTAATGTCCTTACCGGACCTGGCATCTTCGCTGTTTTGGGTGAGCGGCCTGCCTCATTGAACAGAACCGGGCGTAGGTGTTGTGAATGCTCGGCGTTGTACTCGCCGGACATCAGTTCAACCCGACTCTACCACTAACAAAGGTGACATCGAAGATGTACTGCCTCTGTCATTGATATTAATCGGTTTGAACCGTCGTTTAGCAATACCACGAATCAGAGCAGGTTCTGTATGGCATCGATCACTGCTCGTTATCGTGTTAAAATGGAAACTATACATTCATGGCGGTGGAGGTCACCTCCGATGACTGTTGTCGCACTTGCATGGTAACCAGCTTTCGGTATGTCTCAGGTATTGTTCGGGACTATTCGGCAGGTGGAGTACACTAGCTAATGAAATTAAGATTCATAATTTTGGCGTATGCTATGCCACTTTTATAGGCGTTATCCCTTCCTCTACCAATAGCCTGGATGCTATTTTAATGGCCGCGCTATCGTCCCGATTTTAGGTAGGTATGGTTTAAAAAAGCACTACGTTATAGCATGGCGCTCCTTCGCTGTTTGAGTCACTCAGGAGGTTCTGTGCTGCTGCCTGTGGTTAACGTTGAGCTGGATGATGTTATTAATTTCTTCTGGCATCATTTTGACGGCTATTAACTTTCCTTTGGTGTTGTATTTGGCTTTTGTAAGGTGCAAAACTACACACCGTCGGCTGTGTCCACGTCACTGCTGCAGATCAGCAGGCATCTTGAACGAATTCCACGCGGCAGCGCATATATATATACCGTGAAGGCAGCTTATTGTGGTCAGAGCGATCGACTGACTTGCAGTATTGCCAGGGGCTCGGTGGCGAGGCATCTGAAACATCGCAGACATGCTGGGCTATGCGGCAGCGCGACCGCCACAGTTACAACGCCCGGTTGATGACCCGCAATATCGTTCGCGCACGACGTGCCTGACTATCTGGTGCATCGCATCACGAGGCCTCTTATCTCTGGTTCCCGGGCGGATGCACAAAATTGATTGAAGAGATTATATGGCTGAGCCAGATTTCATCTCTTTGTCCGCTTTGAATTAGCGCAAAGTCCCTATATCGCGCCGATGAACCGGTATCTCTTTGATAAACAAACTGCGCTGGGGATGACCTCCGGGCGCTGTTCGGAAGCCGTTCCTGTTGCGTCACTCCTTATTTTTGCACGTGCTTGCCTTATGGTCAGACTCGGTTCTGCTTTCCGAAGCATATCCAGTGGCTAACACCGTTTTTTTTTTTTTCAGGATTAGCGCACCTCAGGTTTTGCAGGCGCGGAAAAGATTTCACAGCCATTCACTGGTACAACAAACGGCGACAGACGCCAGTCAGCCGTGTACCGGTGTAGTTCGCGATCGATGGTTGGTTTGTTTGCCGGACCTGCACATTCGACCAATGCCTGTCTGGGTAGCGCCACCTGGCGCACCACCTCGGCCCAGTCTGCTGTGTGGCGAGTCTGGTGGGGGCTTCTTGTTGATACCCTCCTGTAACTCAATCGCGCTCTCTGTTATTGAGCGCCGTGGTCCACTAGCACGCCCCTAATATCCTCTTTGGTTGCTTCGAACGAGAGGATGGCGGTGACAGCTCATCATGTTGGGATGCCCTGCGGGTCTCATTCTGGAGCGTCGTCCAGTTCTGGCGAGCGATGCGATCCTGATGTCGACGCCGGGCCGGCACGCTGATGGTAATGTGACTTTGTATTGTGGCTGTCATTATGGCGGTGTGGCCAGTGCCACCTCCACAGCTGCACTGCAGTCGCCTTTCGGCCTTTCGACAACTCCTGGGATCATTAGCCATAAACGTTTCGTTGGGGTCAGCACTGCCCCATATCCATCAATAAAGGGGGACTTTGATTCTGGCGCTCCGTGGGAAGCCAGGTAGCGGTTCTGGGTTATATTTAAAATTTTTGTTCAACAGGTGGTTTAAAATTTGTGATTTTGAATTCGATTTCGCTAACAACGCGGCCGAATGACGGGTAACGCACGCTGATCACAACGCGCCAGTCTTACCGATCGCTGCGAAGCGGCCTTCAGCTCTGGTGATGCAGCTGATCTGATTTATTACCAGTTTACTGGATCTGGTCCGGAACACCGTGACGCTCAAACGCAAACCCAGAGTGGATTTGCAGCGGGTTTATGTTGCAGTTTACGGCTGACCGGACTCGTATATGACGAAAGTAGCCTGTAGCAGACATAGGGAACTCGATTCTATCCACCATGCCATATTTGAGTGATGAATTATTGTTATTGGGTGAAGTAAGTCTCAAAGAGATGTGTGTTTGTTGCGGGCAGGTTCTACGCATTATTATTGCAACGTTCTGCATTAGGTTTTGATCGCCATCAACCGTCCAGAAAACGTTACGACTGACGGGTGGGGAAGTGATGCTGGTGAGTATAAGTGATTCCACATGCCAATGCAAATAGGGTTTATTTTCAACTTTTTCTATTGTAAAATGATATTTTGTCGTATTATGCAATTCTCTTGTGGCAAGTTGGGTTATTGCAATACTAATGCAACCTGGACCTTTTAATTCCCTGGACTTCTACCAATAAAGAAGAAACTTGAATATAAAATATCAAATAAAGCCATGTATGATATAGCGCTTCGATTAGTGAAATACAGCTTGATTTTTGGCACATTGTGTTTCCATGAAATTAAACAACTTTCAAACGGTTTAAATAAATATCCAGTAGTGCCTTGCTTCGTCTGTCATGTCTTTCCTGCCCAATGGAATGTCAGCATCCAATAGTCTACTAAACTGTACACTTTTTTCTCATATTTGATAAATTAACAGTTCCTTTTAAAATACGCTTAAGACTCTTTTAAGGCATAGCCATAATTCCTTATTGTTGTTATTCGAATATCGACTTCCTGCAAATACTTATTGATCAAAAGTTTCACCACATGCCTCACATGATACGATTAGTAGAGCCTGGATTTTAGTTTGCTTGGAAAGTACTAACACTGCATTACGTCTTTATAAGCTTTTCAACACGGTATTCAGCATATATATGCGGGTCTTTAGAACTTATGACTTTATTTCATCAATTTTAATTCCGATAAAATATCGAACTTCCTTCAAATAAGTCATTTTAAATTTGGTATTATGGTTAAATTTAGACCTAGTTCGGTTTACTAATTGTGGTGTTGCATCGATCTCTAGATGTCGGTATATTTTATCTAATATAATAGATTTTCAAATACAACATCTTTTCACATTTTCAAAACGGAAGCCAGCATCTTGCACTGCATATTTTGCTTTTATTAAGCGCATTCTGCATTCTCATCGCAATAGCGGCAACCCTTTTGGAACAACTCATGCAGATTTCATCTTGCTCCAAGAATGCTGTTCTCACACATCCATGTTGTAAATTTTATTGGACTTTGAAAGGTAAAAAACCAACTTCGTTTGGTGGCTGGTTGCAAATGTCTCATCAGTCACATATTGTAAAACCTCGTGTATAGCAAATTAGCTGGGTTTTAGATAGTGCTGCTAAACCCATTTACAATCTACTATGCTTTTGTTATTAGGCTTCGCAAACTCCACGTTTCTTTCTGTGGTCTGAACCAAGTTCATCTTGTATAGCACTTTCCCAAAGATCTGTCATCCACGAAATTCAATTTCATCAGAGATATCAATATCTATATACGATGTTTAGGTTTATCTTTGTCCAAGTTACGAGAATTTGGCTGTCTCCGCTCCCTTTACTCTCCGCGCTCTTTACCACAGAGTCTCAAAGGAGTCTCCACTGCCTTGGAAGAGCCTAACTAATAGAATATGGCACCAGTGTCAAAACCTTTCGCCAGATAAATAATATATACATATGCCGGTCGCGCCATTACGAAAGTCTAGTGTTCGCTTTTCTTCGGTTTGCTGTAAACATATTTGGAATTCGGGACCTATTATCATTTTTTATTTCTTTCACCGTCCTAGTTTCTTGCTCACTTTTGCTATCATTTTATTTCATCACCAGTTTAACTGGATCATTCTTTAGGGTAGAATTTTTATGTTTATTTTTTCTACAGAATCAACAGATTCATCATTTTCCACCACCACGGAAGGACTCATTAAAGAATCATAAATATGTGTTGAGACAACTGGCGAGTCTTCTTCATGTTTTCGTTTGTCATCTCGATCACCAGATGGCATCCTCATCTCTTTTAGACGCTGCTCATTTTCTTAGGAGCGGAACAGACTCTAAATTTCGCCGGAACCGATATATGTTCAGGGGGTCGCGAAAAAAAGAGCAATAACGACATTGCCACTCGTTTCTCGTGTCGTGGTCGTTTATTAACTTCACACATGGAATCAGTTCGCTTTACCAGCATTATATCCTCCTCATAAAAATTTGTGAGGAGTTTGTCAAGCGTGGGGAGATCGAAAAAGTGTGGCTGGAAACTGACTGGTTAGAGTACCCAATATGGTCTCTTGCTTTTAAGGAGCCACAGATGTTGGTTTTTTTAATGCAGAGCACGAGAGGAGGGATGTCGTGATAAATTACAATACCG
->106a7186-c3b0-43dd-8289-34f8a0494fcf
-CTCATTGTACTTCGTTCAGTTACATTATTGCTTAAGAAATGAGCAGCGATCTAAAAGAGATGAGGCTAGCGAAAGCGAGATTACGATTCAGGTGATCGAGATGACAAACAGGTATTAAAACATGAAAGACTCGAAGGTTCAACATAAAAGTATTTATGATTCTTTTTTAATAAGAGATAATGTAGAGTCGGTTACCAATGGTGGAAATGATGAATCTGTTGATTCTAGAAAAAATGTACAACATAGTAAAAAAAAATTCCACATGTCTAAAGAATGCCGATCAGTTAAAGAAACTGGTGATGATAGCAAAGTGAGTAAATCAGACGCAGTGAAAGAAATAAAATGATGGGTTGTAGGTGCTGTCCTGGAATTTCAAATATGCTGAAAAGAAACTCTCGAAGAGAAACTGAGCACTAGACTTTCGTAGTAATTGCGCGACCGGGCGTATATTTATTCTGCGAAGTGGTTTTGACACTGGTGCTTATTCTGATTAGTTAGGCTCTTCCAAGAAGCGCAGCGGAGACTCATGGAGACTCTGTGGTGAAGAGCGGAGGCGTAAAGGGAGCGGAGGCAGTTGACAGTCCAACCCCGTAACTTGGACAAGATAAACCCTAAACTATCATAGATACGATATTCCCAATAGATTTGATGGGGGTGAATTTCGTGATGACAGATCTTTTGGGGAGAAAAGCTATACAAGATGAACTTGGTTCACATTCAGAGAAAATAAAACGTGGGTTTGGTGCAGAAGCCCAGCCTAATAATAAAAGCATAGTATGGGTGTAAAATGGGTTTTTAGTAGCACTAACAAGATGAGTTTGGAAACTTAGTAAAGAAGCACGGCTAGTAGCACGAGGTTTACACAAGGGGTATGTGACTGATTATGATGAGACATTTGCACCAGTTGCACGAATTTCCAGTTTCGGTTTTTTGGCTCTTTCAAATCAATAAAATTTACAAGTCCATCGCTTATGGATGTGAGAACAACATTCTTGAGCAAGATGAAATCTACATGAAGGTTCAAAAGGGTTGCCATATTGCGATGAGAATGCAGAATGCAAACTTAATAAAGCAAAATATGGCAGTAAACAACTGCAAGATGCTGGTTTGAAGTTTTTTGAAAATGTGCGAAAGATGTTTGTATTTGAAAATCTAATATTATATATTAGATAAAAGGAAAATTCTTAGATAATATCTATATTTTTTGTTATATGTGGACGATGTAATAATTGCCTAGTAAATCCGAAACTAGGTCTAAATTTAAATCATACCTTCTAAATAAATTTAAAATGACTTGTTGAAGGAAGTTCGATGTTTTATCGGAATTAAATTGATAGAAATAAAGTCAGATATGTCTCAGTTAATCTGCATATATAAAGAATGTGTTGAAAAAAAGTTTAATATGGAAGACTGTAGCCAATGCAGTTGGTACACCTCTTCCAAACAAACTAAACTGAAGTCTGATCTGTAGAATCATGTGAGGCACCATGTAGAAACTTGATCAATAAGTATTTTAAGTCGATGATATTCGAATAACAACAATAAGGAATTATGGCTATGCAGCAAAAAAGGTTTTAAGATTTAAAGGAACTGTTGATTTGAGATTGAAAAGTGTACAGTTTAATTATTATTCTTATTGGACATGCTGATTCTGATTGGGCGGGAAATGAGACAGACAGACTGAAGTACTACTGGATATTTATTTATTTAAACTGTTTGAAAGTTGTTTTAATTTCATGGAACACAATATGAAGCAAAAATCAGTTGCGGCTTCATCCACCAGAAACAGATTACATGGCCTTGTTGAAGGTTTTAGAGCCTTATGGCTCAAGTTTTTTATTGGTAGAAATTAAACTAGAATTAAAAGGTCAGGTTGCATTAGTATTGCAAATAACCCAACTTGCCACAAAGAGGGTAAAGCACATAGACATAAATATCATTTTACAATAGAAAAAGTTGAAAATAAACTTATTTGCGTGGTATGTGGGATCTGAATCATACTCAGCATCACTCTCTACCGTCGTCGTAACGTTTTCTGACGCGTTTAATTCGGGGAGCGAGGCATGTCTGTCTTCTTCGGCGATCAAAACTTAGTAACGAACGTTGCAATGATACGTAGAACCCAAGTCTACCGCAATCAAACACACTTTGGAGACTTGCGCTTCACTCCACACACACACTAATACCAACACATTATGGCGGATAGTGAATCGAGTTCCCGCGTATTTCATACGTCTTTTGCTGCGCTGCGCGAATTTCGTCATGCCACGAGTCCGGTCAGCCGTAGGCTTTGCAACATAAACAAATCCACTCCTGGGGTTTTGCGCCGCGTTCTGAGCGTCACGGTGTCGTTCCCTTCACGAGTGATCCAGTAAACTGGTAATAAATCAGATCAACTGCATCAGACAATACAGCTGATAGCATTCAACCTTTCGCAGTCGACGAGCTGGTAAGACTGGCGTTGCCAGATCAGCGGTGCGATCGTCATTCGGCCGCGCGCTCGTTGGGCGCGAAATTCGAAATTCAAAATTCAAATTTGAACTAATTAAGTTGAACAAAAAATTTTAAATATAACCGGAACTGAAGCTAGTTCTATTTCCCGCAGGCGCTGGGGACCAATGAAGCCAAAGTCCCAGCACATATCGATGGACGGCACGGGGAACTGTGCCCCGACCCCAAACGACCCGTTTAGGGTGGTAGGCTATCGAGATCCTATAAGAGGAGTCGGAACCCCAATCCAGAGTGGGAGGTGAGCAAACAGGCCCGCCGAAGCTGGCGACGGTGCATGTGGAGGTGGAGACTCTGGCCACTACAGTCTCTCCACGACAGCCACAAACTGAAGACAATGGATTTCATCAGCGTGCCGGCCCAAAGGGCGGGAGCAGGGGAGATCCCATCCAGGATCGCCGCATCGCTCGCAGAACTGACCACGACGCTCCAGAATGAGGACCTGCAGGGCATCCTGGACATGATGAAAGCCAAGATCACCGCCATTCTATCCTCGTTCGAGACTAGGCGTCACAACCAGCGAGGATAGGAGCTGATGCTAGTGGACTATCGGCGCTCAATAACAGAGCGATTGTGAGTTACGGGGTATCAACAAAGCCCCCCCACCAAGTGCTGCCACAGACTGAGGCAGAAAAACAAGCGTAGCCGAGGTGGCGCCACAGACAGGCATTACCGAATGTTGCGGGTCCGCAAAACGGACCAAAACCATCGATCTGCCGCGAAATCCACCAGTAAGGCGTTACCGACGGCTGACTCCAAACCGGAAAGTTATGCGTCTGTCGCCAAAAGGACGCTAACAAGGACGAGGAATGGGCTAAGGTGAAGCCCAAGCGCCTGCGCAAAAAACCTGAGCGCTAATCCTGAAACGGGTGAGTTACGTACTCGGATATGCTTCGGAAGATGAAAGCAGAACCGAGTCTGACCAGTCGGCAACACGATGCGTAAAATAAGGAGGGACGCAACAGGAGAACTACTTCTTGAATTAGAGAGCCAAAGCCTCGGAGGTCATCCCCAACTTTAAAAATGAGCTAAACGACGCTCAAAGATTGCTTCGGTTCGCACCAGGCGCACTAGGACTGCGCTAATCTGCAGCCCAATTTAGACGAGACAACGACGGCCTCAGGACCTTCATAATTCCTGGTCTCCCCAATTTCAGGGCATCCGCCTGGAACCAGAGGATGTAAAGAGGCCTTCGCGGGATGCGTGACGGGACAGATAGCCTCTGTGCTTTAATGTTAGCGCGAACGATGTGCCATTGCGGTCATCAACCGGGGGGCGTTGTAACTGTGGGATGGTCGCGTTGCCGCATATAGCCCAAGACGTCCGCCCAATAAGATGCTTCCAGATGCCTCGAATTCGGCCACCGAGAGCTCCCCAAAGTCAGTCGATCGCTCTGACTGCTGCCTACGGTGCGGCGAGCATGGGCATAAGGTAAGGCTGCATGTACCAAGATATACCTGATCTGCAGCAGTGACGTGGACAGAACCACGCGACGGTGGTTTTATGCCCTACAAAGCCAACACCAAAGGGCCTTAGCCGTCAAAATGATGCCAGAAGAAATTAACATCATCAGCTCAACGTTAACCATTGCGCAGCAACACAGAACCTCCTGACTCAAACGGCGGAAGGAGCGCCATGCGGACGTAGTGCTTTTGAGTGAACCATACCTGGTGTGGGTAACTCAGGAGTGCTACTCGATGAAGGCAGCCATTAAATGTACATCAGCGGGCTATTGGTAGAGGTGGGATACCGTACCAATGCTGACATAGCATACGCCAAAATTAGAGGAATCCCACTTCTACAGCTGCTTATGCTCCCACCTAGCGACAGTCCCGAACAATTCGAGGACATGCTCGAAAGCTGGTTAACCGTACAGGGGGGTGGGCAGACCAACAGTCATCGGAGGTGACCTTGCCTCAATGCCTGGGCTACAGAATGGAGACAGTCAGTCTCTCACAACACAAGAGGACGAGCAGTGATCGATGCCATGAACCGCAGATCTCGTATTGCTAAACGACGGGTTCAAACCGACGTTCAATAATGACAGAGGTATTACATCTTTCATTGATGTCACCTTTGTTAGCAGGTTCTAGTGGCTAGCTCGAACTGGATGGTCCATGAGGACATAACGCTGGCGACCACAACTAATCACGTTCGGTGCCCGAACAATGAGGCCGTCACCCAAACAGCAGATGTGCGCTAGGTCGGTATGGGACATTAGGAAACTGGATGAGCAATGCTGGCATATACCAGATCCGAGGCATGGAGTCCATAATTGGACACGCGGAGACAAGGTGGCAACTCGTATGGATAGGCTTAGAGCAATGTGTGATGCGGTGATGCCGAGACACGAAACGAAAGCCTGTCTACTGGTGGAGTGACTCGGTACCAGCTTCGGACGGGAGGAATGCATCAAGGCGAGGAGGCAAGCGCAGCAATCTAGAGAACAACCGCACCACTCCCGGTACATTGAGAAATTTATATAAAGCAGAAGCGAACTGAGCAGAACGGCATAGCTATCAACAGCAAAAGGCGAAGATACATTTTAAGGACCTGATTGATAGCGTGAACGCTGACGACCCCTGGGGTCTCGCCACAAAGTCGTAAGGAAAAACTCAATTCCGCTGGTGCAGGATCTCCTCGGGACCCAGCCGCCCTGGCCAACATCGTGTCGGAACTATTTCCAAACCAGCACACGTTATGGCGACGCTGTTGACCCCCCGCCTCTGACTTCCCGTGCATCACGTCATGCGAAGTCGTCAGGCAACAAAGAGGGATCCAGACCGAACAAAGCTCCGGCATTGATGGTATCCCGGGCGTGATCGTCAAAGCCACCACCGGAGGTCTTCAGGGGCTCCCTACATTCCAACGGTGTCTGCTGGACGGAGTCTTCCCAAGCTGGAAAAGATGAAGCTGGTCGCTTCTGCCGAAGGCAAGGGGCCCACAAATGTTCAAGTTACCGTTTCGTTGTCTGTTGGACATTGTTGGCAAAACAACTTTGAGCGCATACTGTACGCGCGCATTGAGCTAATCACTGAAGATCCCACCTACAGGCCTTCAGGGTAACAGTATGGCTTCAGGGTAAAATTGCGCTCGACGCTCTCAAATCCGTAACAGACGCTGCCAGGAAGCGCTCGACGGTAACCGATGGTTAGGCGGCGGTAAATTATTGCCATCATCACGCTAGACGTCAAGAACACTTCAATACAGCGAGATGGCCCATTATCCTCGGGGCTATGCGCAACTTGGGCGTTCCCGACTACATACGAGGCGTAATTGGCAACTACTTCAGGGACCGTGTGTTATGGTACGTAACGAAGATGGTCAAGAAGCCGCAGAGTACAGGCGTTCCCCAAAGGGGTCGGTAGGACCGATCTTGTGGAACATTATGTATGATGGAATACTGGTATTAAGCCCAGAGGTGTGGGCTGCACTGCTTCGCCGACGACGTTGCGATAACAGCGATCGCCAAAATACCGAGACTCCAGGACGCTTAAAGTAACGTATGTGGCAATCACGGCGACCGCTTAAATGGCTCGAAGTCCGGACTTAAAATAGCTGCGCATAACAAGACCGAAGTAGTCCTGCTGAACAGCAGAAAGTCCGTCTGGTACATGCGTTATTGGAAGTCAAAGGAGTTGAGAATATATCAGCAGAAACGTTGAAATACCTTGGTGTTCTAATAGACCGAAGGCTCTCGTTCAAGGCTCACGCAAGGTATGCCAGCAAAAAAGCAATGACAGCAGCAGCCTTGGCGAGAATCATGCTTAACGATGGGAGGACCCAGACTGCCGGCTAGGAGACTGTTAGTGGCGGTTTCAAAGAGCAACACTTTTATGCGCCTATCTGGAGCTGCGTTTCCACAAAACCTATCTAGATAGTGCCGCACCACAGTATCACGGACAATGGCTCTCCATAGCGACCTAATCCGGCTTTAAGAACCATATCAGGACGACACTGGCACGCTCTGTCGAGCATTACATGACTGAAGCCCACCTGGTATAAAGGGCAAATACCTTGCGAGTGGGGATACGCCAATTAGAGATCAAAGTGGATTCGAGGTATGGCAGACCAGGTGGCAAGAGTCACAGCAGGGGACGCTGGACTTAAACTCGATTTCCACCAACTAACGGGTGGGCTGATTGCAGTACAAAACGGGTGGACTACCACATGACCCAGTTCCTCACGGACCATGGCTGTTTCGAGGGTACCTATGTAGGTTCCGCCACGTGGATACAGCCAGTACGCATTGCACAGACGCAGTGAAACCGCCAGAGCACATCCCTGCTGCACTGCTCCAGGTTCGCCGAGGAGAGGGCGCAACTCGTGGCGCTCGCTGGGTCACCTCTCAGCCCGAAGGCTTGGATTTGCTGCCATGATTAATGGCGGACAAAATCGTTTGGGATGGGGCTCGTGATCATCGTCACCATGATGAAGCGTGTCATGGGACGAGATGACCAATCTGAACTATAGATAAGTACCCCGTATGTTGGCGGGGCAAAGAACTCTACGACTGGTACACTCAGTTGGTGTAAAGCGCTGCTGTGCACCGCAAAATGGTGTGCAACTTGGCACCACATCCTGCTCACCGATGAAATGCATGACTGGCGGTCGGTGAGCTTGACAAAAGGACGGGAGGCGGAGGTTTTGTTTTGAAACATTACATTTGCCACGCTTGTTGCAAGGTAGAGAATGCGTGTTCTAATAATATGCAAAATGAAGAAGTGGACACAAAGTAACGAAAACGGTCGTTAACTTGGAAATTAAAATAAATCTGCGACAAATTTACAGTTTGTCAAGAGAAACTGTTTACACACCAAATGAAATAAGTTGAATTTTTTGACTTTAAAGGTCAGGTAACGGTTATTTGCTTGATTAAACGCAATTTTTTAAGGAAATATAATTAAGCAATATATATTTTATATAGAATTAAAAACAAATTCAAAATATCAAATATACAAAGAAAATAAATAACAAATTCCAAGTTTACACTTTTGAGAGTGTCCTCTGCCAAACCGTCATCTCTGGGATGAGCTGATAGGTCCACCTCCCCCCCGTCGCGACGTTTGCCATCTGCTCTGCCATTCACCTAATAGCCACTCGTGTTATATAACGCCTGGAAGCGCCACTCATAAGGCTGAGAGCCTTGATCTCAGATCAATCGGCAGGCCTGCCAGCGCTAGCCACGTCTTCGGATATGGTCCTGAATCTCTCTCTAATGAGCCTGAGGGCCATTGACCGTAGCACACCGAACGAGCTCCGCTTTCGGGTATGAGACCCTGCAAGTGGCATTGCTCCAGACTGGTTACGGCGTATGGCAGCGAAGCCTTTGCTACTGACACCAGCAGTTTCCTGGCCGGTGTCTTGACCTCCGACGTTGGGCATAAGCCTCGCCAACGAAGAGGATGTGACTGCTGTCTTCTGCTTGTTTAGTAGCTCGCGTGGTCTGAACGATGGTCTGCGATCTATCATTACCCCAGGTACTTTAGGGACTCTTGGTCCCCTGAGTACTTATGACGGAGATCAGCATGTTCTCCGCTCTTTTCCTGCTGCTTGGTAGGACTGCTTCGGTCTTGTGAGCCCGCTATTGCTAACCGGCTGTGATTGCCACATCGTCAGCGAAACAGCTGCCTCGACGACTTCAAGTTCTGTGACGGCAAATCTGGGGCAGGGGCTGCCTCTGTTATTTCATAATTATTGGTCTGCTTTGGAAATAAACTCCCCTGGTATGTTAGCCAGGACCCCCCGGGTCGGATGGGGTTGCCGCTCTCCTCTCCTTAGCTCGTTATTGTTAACAAGCAGGCGAGGCCCCAGATATCGCTGTCTACGCCATCCTGCAGCTCGAAACGACCGCGCTTTGGCAACCGCGATGCCGATGCTTGAACTCTAGGCGTTTGCTTCTGAAAGCCTCAAAGAGTTCCGCGTGGTGGGTACTGCCTCTGGCTCGTTGCGCCGTTCTCTTAGCCTGGTGTCAGACCGTAGTTGGCAGGGGAGGCACTCCACCAGTAAACGGGTGGTTTTGCGCTGTGCCTTATTTTTCCTTGGCATGATTGCGTCGCAGATTCTTCCCAGCATATTCATGAGGCCTGCCGCCATACTCTCTGCACATTTGGGATTTCCAGGGGAATTGATCTGGTGGTGGCATGGCCTCATCGATCTTCCTGGTGTCCAGCATGTTTTCCCGGCTTTGTTCTGCCTCTTGCCTTGCCCGTCTTTTTGGGCATGCCCTCCCGAGGAGAAGGGAGATCGGGGCATGATTAAACCGGCAATCATGACGTCATGGACCATCCAGTTGTTGTTGTCTACTAGCCCTCTGCTGACAAGGTAACGTCAATAAAGGGACATTGCCTATCGTTGTTAAACGTCGGCTTCCGTCATCGTTCAGCGGTATGAGGGTCCAGCATTCGCATGGCGTCAATCACAGCTCGTCCTCGGTGTTGGATGTCCTGCCCCATTCCACTGTCCAGGCATTAAAGTCGCCGGCAATGACCTTCGGGCTTCAAAGCCCACTCATGTCCACGAGCGCCTCAAGCTCCTCGGTGATCAGGGGGTGTCGCTCGGCGGAGCGTAGCAGCTGTACATGTGCGTGTTTTAACTTCGCATAAGCGATGCAATGGGTAAAGCAGCCAGTTCCTGGACGGAAGGCTGCAGCATTTGATAGCACAACACCTGCCTCGTCAAGGATCATGGACGGTGTCCACTACCAAGTAGGGTTCGCTTTAGGAGCATGATAATCTACGTGCGCTCAACCGCAGTCTGGAGCCAGGAGGAGCTCTGAGCTGCTGCGCAATGATTGACAATTGTACTACGCTAATATGAGCGTGCATTAAAAGGTGGCTCTTGGCATCTTTTAGTGTCGCTCTGTAAGTCGGGCACGCAAAGCTACCGTCGGGTTGGTTTCTGTCCACCTCGCTGCTGCAGATCAGGCATTTTGGTGCAGCAGCGCACTTGCTTGCCTTGATGCCCACGCTCACCATCTGAACAGCAGTCTGCCCTGTCAATGTCCTTGCAGGTTGCTGATCGATGCCCATAGCCAGACACCTGCTTGTAGCATCTCGTGGGTCGGACGTCCTGGGTGATACGACATCTTGACCATCCAACGATTATGGTGCCCTGTTTTGGGACTGGTATCGCAACGTTCGCGTTCAGCAGCACTGAAGGCTATTTGCTTTACAATTCCATACTGCGAAGGCCCCTGATATCTTCAGGATTTATCTGCAGGCCTGGGTGGGCGACCAAGCTGTGGGCTTCTCTGCTGTCGTAGCCTCGTCCAATCCGCTTTACAAGATAGAGCTATTCTTTGCGCTCCTGTGCGCACAGGAGGCCAAGTCGTGAGCGCCGCTTCCAGGTCGCTCTTAAACTGGGAACGCTTTCCAGCTTTCCCTCTACCTCAAGCAACAGATCACCTTTCTGCGTTCTCCGGATTTTTCGCACGTGACTGCCCAGTTCGCTAAGGCTCGGTCGATCTTAGCTTCCGAAGCATCTCTGCGTACAAGCCTCCTGTCTTTGATGAGTGCCTCTGCACCCGTGCTAGCATTCTTGGCGATAGATGCATGGCTGCCGCAGCTGGACTCGTTAGGTATGGATGTCGCCTTTTCTTCCACCGTTATGCCATCCAGCGTAGGGTTGCTCTGCTTCGGCGCCTGGACTTTGGCACCTGCACCGTGGGTACCTGCATTTTGTGGAAGACCTTTTGGTAGGCTTTTGTACCTCCGTCTGGGTAGCGCTGCTCTTCAAGCGGTGCTCGCTAGTAATTACCCAACTTCGTAGCTCTATCGCCATTAGGGCTGAGTTCGGAAGCTATGCCCTTTATTGTCTCATGTGTCGTTGGGTCTCGAATGCGGATAGGGGGGGCTGATCTTGCCATTCATCCTGGTAAGTATGCCCCTCGGATCCCTCGTTCTGGAGCAGTGGTCAGATCCGAAGACCGATGGGGGAACCAGCTGGGGACTTCCCTCCGTCTTTTGCGATGGCAGCGATGTGGTCCATCGTCTTCTGACTTGTCGCGGTCGTAGATGCTGTAGGAGCCAATTTCTCCACACTTACTACAGCATCGCTGCGATCGATAGTCCAGCAGCGGCTAAGGGGCCTGCGTGCTCCTGCCTACCGACGGGACCAATTCCGTCACCGCGGGTCGGGTTACCGACTCCTCTGGTGGGGGGATCTCGAAAGTCGAACTCCTCTGAACGGTCGTTGCGATCAGGGGACTGCCCCACTGCGCTGTCCATCAACTGAAGGATGGCTAAGGTTACCTAGGTCACGTAGGCCACGGATTTCCCCACTGGGGATGGAGGTTTGTACCGCCTCGACTCGGACACCAAGAGCCTCTGCTTAGGCACCAGCACGGTGAGAGGATGATATTTGGTCTGTCCGCGACATTGCCTTTCCCTTTCTTAAAGACTTGTGCGCTCCCAGTTACCAGAATCAAATTAAATTAAATTAAATTTCAACGGCTTAATTTTAAATTTAATTTTGAATTTCCTTCTGTCGCAACACAACTGATCACACGGTTGATCTGGCAACGCCTCCCACCAGATCGCGCTGCGCTATCAATGTTTATCCGCTGCAACAATCGCAAGATAATAAATTACCTATTTACATGAAACAGGCGCACAATTAACTTCCGCGTGATTGCAGCGCAGAACATATGGCGCGACTCCACCATTATTGATTTTGCCAGTTGCCGCACACCGGCCGACACAACTTCTATGGTTTCGAGCGCAATTCGGAACGTCCGTCTTCACGCTTTGATGTAGACTTGGTCTCCGCACCAGGATTGAGTGTCTAAGCCTGTGCGTTCAGGATTAAACTTTGGCAATACGACAGCATTAATTTTTGGGTCTCTTTGTGAGTTTGCACTTCTTTTAACGGATTCAGAGAAAAATGGCGATTGCGACTCTAGAATTGTCAGCAAATTGTTTTCACTATTGTAGTATGCACACATATCGGTTAAGCACTGTACCTATGTGTATTCATAGTGTAGCACTCTGTTGCAATATTGTTACATAAACAGTCCAGCACAAGTGTATACGTAATACGAACACCCGCGAGGGGCTAACATACATAGTACAGTCAGCAGTTCTCCGCTGGCCAGCTGACATATTGTTGCCTATACCACTCCTCCTCCAGCACCATCGCTCGGCGACGAGTACATATATATATACATATATATATAAGATACGCATATAAGCGTTGCTGCGCTGCGAGCTATGCCGGCAGCGCTGCTCCTGACAAACTAAAACTGTATGTAGATGGAGGGGGATTGACGGGTAATTTCGAATGGAGCGGGACCTTCCTGTTCTCAAATTGGATCAAATAAGAGAACAGCTAAAACACAAATGATCTATGACACAATGGAAACTACAGGAAGTTGGAGTAGGCGGTCCCCACTTCTGATGTCGGATCCTGAATCACTTTATACTCGGCATCACTCTCTACGGACACAAAGTAACAGAAACGGTCGTTAACTTGAAATTAAAATAAATCTGCGACAAGGTACAGTTTGTCAAGCTGTTTACACCGTGAAATAAGATGAATTTTGATTTTTAACTTGGTCAAACAGGGTTATTTGCTTAATTAAACGCAATTTTTTTAGGAAATATAATTAAACAATATTTATTTTACTTATAGAATTAAAACAAATTCAAAATATCAAATATACAAGAAAATAAATAACAAATTCAAGTTTACACACTTTTGAGGTGTCACTCTGCCCAAACCGTCATCTCTGGGATGAGCGATGGAATCCACCTCCCCGTCGCGACGTTTGCCATCTGCTCTGCCATTCACCTAATAGCCGCTCGTGTTGCCTCTTGCACGGAAGCGCCACTCCGCATAAGGCTGAGAGCCTTGATCTCAGATCAATCGGCAGGCCTGCCGGCGCTAGCCGCGTCTTCGGATATGGTCCTGAATCCTCTAATAATGAGCCTGAGGGCCATTGACCGTAACACCGAACGAGCTCGCTTTCGGGTATGAGACCCTGCAAATTGGCATTGCTCGAACTGGTGCGGCGTATAGCAGCGAAACGCTGCTACTGACACCAACGGTTTCCTGGCCGAATTGTCTTGGGCCTCCGACGTTGGGCATAAGCCTCGCCAACGAAGAGGATGTGACTGCTGGCTCTTCTTGCTGTAGTAGCTCGCGTGGTCTGAACGATAGTCTGCGATCTATCATTACCCCAGGTACTTTAGGGACTCTTGAGGAGTCCCCTGGTACCCTTGACGGAGATTTCCAGCATGTTCTCCATCTTTTCCTGCTGCTTAGTGGTTTCTTCGGTCTTGTGAGCCGCTATTGCTGGCAACGATTGCCCATCGTCAGCGAAACAGCTGCCTCGACGACTTCAAGTTCTGTGACGCACGGAAATCTGGGGGCGGGGGCTGCTCTGTTGTACTCCATGGTGTGGTCTGCTTTGGAAATAGCTCCTAGTATGTTATGGGACCCCGGGTCGGATGGGGTTACCGCTCTCCTCCTTGGCTCGTTATTGTAACAAGCGTAGGCGAGGCCCCAGATATCGCTGTCTACGCCATCCGCAGCTCCTTAAACGACCGCGCTTTGGCAGCCACGATGCCGTGCTTGAACTCTAGGCGTTTGCTTCTGAAAGCCTCAAGGTTCCGCGTGGTGGAGTACTGCTACTCTGGCTCGTTGCGCCGTTCTCTTAGCCTGGGGCAATCAGACCGTAGTTATTGGGGAGGCACTCCACCAGTAAACGGGTGGTTTGCTGTGCCTTATTTTCCTTGTGATTGCGTCACAGATTCTTCCCAGCATATTCATGAGGCCTGCCGCCATACTCTCTGCGTCCATTTGAGTTTCAGGGGTGATCTGATAGGCCAGCATGGCCTCATCGATCTTCCTGGTCCCATGTTTTTCCAGCTGTTCTACTCTGCCGTCTTTTGGGCATGCCCTCGAGATCAGGGGGGGGCATGAATTAAACCAGCGTCATGACGTCATGGACCATCCAGTTGTTGTTGTCTACTAGCCCTCTGCTGACAAAGGTAACGTCAATAAAGGACGTACCCCTATCGTTGGTAAACGTCGGCTTCGTCCATCGTTCAGCGGTATGAGGTCAACATTCGCATGGCGTCAATCACAGCTCGTCCTCTTGGTGTTGGATGTCCTTGCTTGCCCATTCCACTGTCAGGCATTAAAGTCGCCGGCAATGACCTTCGGGCTTCGCCCTCTCATGGTCCACGAGGCCTCCAGAAGCTCCTCGAACTGATCGGGGGTGTCGCTCGGCGGAGCATTAACGGCGGCGTACGTATTGCGTGTTTTAGCTTCATAAGCGATACGCATGGGTAAAGCAGCCAGTTCTGGACTTGGAAGAGCTGCGGCACGATGGCTGCTTTACCTGCCTCGTCAAGGATCATGGACGATTGTCACTACCTACCTACCAGAAGCCAGGGTTCGCTTAGGAGCATGATGTCTGTGCGCTCAACCGCAGTCAGGCCAGAGGCTCTGAGCTGCTGCGCAATGATTGACGTGAGCTTTACGCTATATGAGCGTGCATTAAAGATTAGCTCTTGGCATCTTTTGAGGTGTCGCTCTGTAAGTCGGGCACGCAAAGCTACCCGTCGGGTGGTTTCATCCCCACCTCGCTGCTGCAGATCAGGCATTTTGGTGCGGCAACGCTTTGCCTTGTGCCCACGCTCACCGCATCTAAGACAGCAGTCTGCCCTGTCCCGTGTGTCCTTGCGGGTTGCTGATCGTGCTTAGCCGAGACACCTGTAGCATCTCGTGGGTCGGACGTCCTAGATGACCTACGACATCTTGACCATCAACGATTATGGTGCCCTGTTTAAGGACTGGTATCACCCAACGTTCGCGTTCAGCAGCACTGAGGCTAGCGCAATTCATACTGCGAGAAGGCCTGATATCTTCAGGTTATCTGCAGGCCTGGAATTGGGCGACCAAGGCAACTATTAGACTTCTCTGCTGTCGGCCAGCCTCGTCCAATCCGCTGCAAGATAAGGGCTATTCTTTGCGCTCCCTGTGCGCACAGAGGCCAGAATCATTGAGCGCCGCTTCAGGTCGCTCTTAAACTTGGGAACGCTTTCAACTTTCCCTCTACCCCTCAAGCAACGAATCACCTTTCTGCGTTCTCCGGATTTTTCGCACGTGACTGCCAGTTCGCTAAGGCTCGATTCCGATCTTAGCTTCCGAAGCATCTCTGCATTGCAAGCCTCTCACACTGTCTTTACGATAGTGCCTCTGCACCCGTGCTAGCATTCTTGGCGACAGATGCATAGCTGCCTGGCAGACTCGTTAGGTATGGATGTCGCCTTTTCTTCGTTGCCATCAACGTAGGGTTGCTTTCTGCTTCGGCGCGGACTTTGGCACCTGCACCGTGGGTACCTGCGCATTTGTGGAACTTGCCTTTTGGTGAGCTTTTGTACCTCCGTCTGGTAGCGCTGCTCTTCAAGCGGTGCTCGCTAGTAGTACCTTCATTGCAGCTCTATCGCCCTGTTGTTAAGGGCTGAGTTCGGAAGCTATGCCCTTTGTCTCGTATTATTGTCGTTGGTCTCGAATGGATGGGGGGGGGCTGATCTTGCCATTCATCCTGGTAAGTATGCCCCTCAGGTCCTCGTTCTGGAGCAGTGGTCAAGTCGAACCGATGGGGAACAAGCTGGGGACTCTCCGTCTTTTGCGATGGCGGCGATGATGTGGTCCCATCGTCTTCGACTTGTCGCGATTGAACGGCCAGGAGCCAATTTCTCCGCCTCTACAGCATCGCTGCGGTCGATAGTCAACGGAGCAATACGTAAT
->e6a172b9-7593-4d0b-9f09-e85edaab94cf
-TAAGTACTTCGTTCGGTTACGTGGCTGCTGGCAGCTATGCATGTGTCGCCAAGAATGCTAGCACGGGTGCAGAGGCACTCATCGTAAAAGACGGGAGAGGCTTCGTACACCAGAGATGCTTCGGAAGCTAAGATCGGAATCGAGCCTTAGCGAACTGAGCAGTCACGTACGGCGAAAATCGAGAACGCAGAAAGGTGATCACCATTTGCTTGAGGTAGAGCTTCAGAAAGCGTTCCCAAGTTTAAGAGCGGTGACGGAAGCGGCGCTCAATGACTTGGCCTCTGTGCGCACAGGGCGCAAAGAATAGCTTTCTATCTTGCAGCGGATTGGACGAGGCTACGACAGCAGAGCTCCACAGCTGCTTGGTGCTTAATTCAGGGCCTGCAGATAAATCCTAGAATATCAGGGAACCTTCGCAGTATGCGGAATTGCAAACAAATAGCCTCAGTGCTGCTGAACTGCGAACGTTTACGATACCAGTCAGCAAACAGAGGGCACCATAATCGTTGGATGGTCAGAGATGTCGTATCACCCAGGACGTCCGACCCACGAGATGCTACAGGTGTCTCGGCTGGGCATCGATCAGCAACCTGCAGGACACTGACGGTGGAGCTGCTGTCTTAGATGCGGTGAGCGTGGAGCTGAAGGCAAAGGGGTGCGTTGTACTAAAATGCCTGATCTGCAGCAGCGAGGTGGTTAGAAATACACCCGACGGGTAGCTTTGCGTGCGAAGCTTACAAACGACACTAAAGATGCCAAGAGCCGCAATGCGCGCTCATATTAGCGTAGTACGGCTCAATGTCAATCATTGCGCAGCAGCTCAGAGCCTCCTGGCCCAGACTGCGGTTGAGCGCAATGTAGACATCATCTAAGCGAACCCTACGTCTCTGGTAGTGGACAATCGTCCATGATGTGACGAGGAGCAGGTAAAGCAGCTATCAAATGCTGCAGCTCTCTCAAGTCCAGGAACTGGCGCTGCTTTACCCATGCGGGGTATCGCTTAGCAGAGTTAAAAACACGTGCACATGTACAGCTGCTACGCTCCGCCGAGCGACACCCCGATCAGTTCGAGGGCTTCTGGAGGCGCTCGTGGACCATGCGAGAGGCAAGCCCGAAGGTCGTACCGGCGACTTTAATGCCTGGACAGTGGAATGGGGCAACGGACATCCAACACCAGAGGACGAGCTGTGATTGACGCCATGCGAGATGCTGGACCTCATACTGCTGAACGATGGACCGACGTTTAGCAACAACGATAGGGGTACGTCCTTTATTGACGTGCAACTGTCAGCAGGGCTAGTAGACAACAACAACTGGATGGTCCATGACGTCATGACGCTGAGCGACCAAAATGCCTGATCTCCTTCCCCGGAGGAGTCTTTATGCAAAAGACGGCGGTAAACAGCCAGGGAAAACATGGGACACAGGAAGATCGATGAGGCCATGCTGGCCTATCAGATCAATTCCCTGGAAATCCCAAATGGACGCAGAGAGTATGGCGGCAGGCCTCATGAATATGCTGGGAAGAATCTGCGACGCAATCATGCCAAGGAAAATAAGGCACAGCGCAAACCACCCGTTTACTGGTGGAGTGCCTCTAAGCCAACTACGGTCTGATTGCCTCAGGGCTAGAACGGCACCCAACAGGCAAATTACCCACCACGCGGAACTCTTGGAGGCTTTCAGAAGCAAACGCCTGAAGTTCAAGCACGGTATCGCGGCTGTAAAGCGCGGTCGTTTAAGGAGCTGCAGGATGGCGTAGACAGCGATATCTGGGGCCTCGCCTGGCTTGTTACCAACGAGCTAAGGAGGAGAACGTAATATCCGACCCGGGGTCCTGGCCTAACATGCTAAGGGGTATTTCCAAAGCAGACCACACTATGGAGACCAACAGAGCAGCCTGCCCCAGATTTCCATGCGTCACAGAACTTGAAGTCGTCGAGGCAGCTGTTTCGCTGACGATGGCTGGCAATGCAGCCGAATGCCAACAGCGGCTCACAAGACCGAAGCAGTCCTACTAAGCAGCAGGGAAAAGATGGAAACATGCTGGTCTCCGTCAAAGGGGTACTCGGGGACCTCTCAAGAGTCCCCTAAAGAGTACCTGGGGGTAATGATAGATCGCAGACTATCGTTCAAGGACCACGCGAGCTACGCCAGCAAGAGGAACAGCAGTCACATCCTCTTCGTTGGCGAGGAAGCATGCCCAACGTCAGGCCAGACACCCGGCCAGAGAGCTGCTGGTGTCGGTAACAAAGGCTTCGCTGCTATACGCTGCACCAGTCTGGAGCAATACCACTTGCGGTCTCTCATACCTGAAAGAACTCGTTCGGTGCTACGGTCAGTGGCCTCAAGGCTCATTAGAGGATTCAGGACCATATATCCGAAGAAGACGCGGCGCTAGCGCTGGCAGGCCTGCCGATTGATCTGGAAGTCAGGCTCTCAGCACTTATGCGGAGTAGCGCTTCCAGGCAAGAAGGCACACGAGTGGCTATTGGGTGAATGGCAGAGCAGATGGCAAACGTCGCGACGGGGAAATTGGACCTATCAGCTCATACCCAGAGATGACGGTTTGGGCGAGTGACACTCTCAAAAAAAGTGTGTAAACTTGAATTTGTTGTTGTTTTCTGCTTGTATATTTGATATTTTGAATTTGTTTTTTAATTTATAAGTAAAATAAATATTGTTTAATTATATTTCCTAAAAAAAATTGCGTTTAATTAAACAAATAACCCTTAATTTTGTTACGTTAAAATCAAAGGTATATTGCTGCGTTATTATGCGTGGTTTCTTGACAAACTGTACTTGTCATAGTTATTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTAGAGAGTGATACCAGTATAAAAGTGATTCGAATCCGACATCAGAAGTGGGACCGCCTACTCCGACTTCCTGTAGTTTCATTGTGTCATAGATCATTTGTGTTTAGCTGTTCTTTATTTGATCCAATTTGAGGAACAGGGAAGGTCCGCTCATTCGAAATTAATTCGTCAATCACTCTTATAGATCTACATACAAGGTTTTTTCTGTAGCCTAAGTCGAGAACGCGCTGTGCGGCATAGCCTGCAGCGCAGCAACGCTTATATGCGTATCTTATATATATGTATATATATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAGAGTGGTATAGGCACACATATAAGCGATGGCGCTTGGCCAGCAGAGAACTGCTGACCAGGCAATTATGTATATTGGCCTCAAGTGGGTGCTCGTATTACGTATGCGCTTGTGCTGGACTGTTTATGCCCCACATTGCAGCAGAGTGCTACAATTATGAATACACATAGGTACAGTGCTTAACCGATATGTGTGCATACTACAATGATAGTGAAAACAATTTGCTGACAATTCACAAGTCGCAGAATCGCCATTTTTCTGAACTGTTAAAGAAGTGCAAAACTCACAGGGCCCCGAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCTGAACGCACAGGCTTAGACACTCAATCCTGGTGCGGAGACCAAGTCTACATCGCGTGAAGACGGACGTCTTAAATACGCGGCGCGAAATGCTCGAAACCATAGAAGTTGTCGGCCGGTGTGTGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCGCCGGAACACGCTGCAATCACGCGAGTTAATTGTGCGCCTGTTTTCATGTAAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAACAGCTGATGGCGCAGCGAACGATCTGGAGAGAGAGGGAGGCGTTGCCAGATCAACCCGTGTGATCAGTGTTGTGTTGCGACAGTAGGGCGCGAAATTCAAATTAAATTCGTGGCATTGAAATTTAATTTAATTTAATTTGATTCTGGTAACTGGGAGCGCACAAGTCTTTAAGAGAAGGGGAAAAGGCACAAAGGTCATGGACAGACCAAATATCATCCTCACCGTGCTGGTGCCTAAGCAGAAGAACAATTGTTAGTCGAGGCAGTACAAACCTCCATCCGTAAAAGCCGGGAAATCCGTGGCCTACGTGACCCTAGGTAACCTTAGGCCATCCTTCGGTTGATGGACAGCGCAGTGGGGCAGTCCCCTGATCGCAACGACCCGTTCAGGAGGGCTCTCCCCAGCTTTCGAGATCCCCACCAGAGGAGTCGGTAGCCATTACATGGTGACGGAATCTCGGTCCCGTCGGTGGCAGGGTGAGCACGCAGGCCCCAGCATAGGTGACTATCGACTGCGCTTGATGCTGTAGAGGTGGAGAAATTAACCTACAGCATCTACGACCGCGACAAGTCAGAAGACGATGGACCCATCGCCGTGCCATCGCAAAGACGGGAGAAGTCCCAGCTGGTTCCCCTCATCGGTCTTCCGGACTTGACCACTGCTCTCCAGAACGAGGACCTGAGGGCATACTTACCAGGATGAATGGCAGATCAGCCCCTTCTATCCGCATTCGAGACCCAACGACATACACATGAGAGACAAAGGGCATAGCTTCGAACTCTCAGCCCTTAACAACAGGGCGATAGAGCTGTACAGAAGGTACTACTAGCGAAGCACCGCTTGAAGAGCAGCGCTACCCAGACGGAGTACAAAGCCTACCAAAGGAAAAACCACAAAATGCGCAGGTACTTACGGTGCGGGTGCCAAAGTCCAGGCGCCGAAGCAGAGCAACCCTACGTTGGGATGGCAGCGGTGAAGGCGACATCCATGCCTAACGAGTCCAAGCCAGGCGGCTATGCATCTGTCGCCAAGAATGCTAGCACGGGTGCAGAGGCACTCATCGTAAAAGACAGGAGGCTTCGTACGCAGAGATGCTTCGGAAGCTAAGATCGGAATTGACCTTGGCAGACTGGGCAGTCGTGCGAAAAAATCCGGAGAGAACACAGAAAGGTGATCTGTTGCTTGGTGGGGAAAGCTTCGGAAAGCGTTCCCCAAGTTTAAGAGCGACCTGGAAGCGGCGCTCAATGACTTGGCCTCTGTGCGCACAGGGTACGAATAAACCTATCTTTGCAGCGGATTGAGACGAGGCTGACAGCGGAAAGCTCCACAGCGCAGCGGTCGCCCAATTCAGGGCCTGCAGATAAATCCTGAAGATATCAGGGGCCTTCGCGGTATGCGGAATTGCAAGCAAATAGCCTCAGTGCTGCTGAACGCGAACGTTGCGATACCAGTCCTTAAACAGGGCACCATAATGTCGTTGGATGGTCAGATGTCGTATCACCCGGACGTCCGACCCACGAGAGATGCTACAGGTGTCTCGGCTATGGGCATCGATCAGCAACCTACAGGACACTGACAGGCAGACTGCTGTCTTAGATGCGACGTGGGCACAAGGCAAAGGGGTGCGTTGCTGCAAAATGCCTGATCTGCAGCAGCGGGTGGACAGCCACCCGACGGGAGCTTTGCGTGCCCGACTTACAGAGCGACACTAAAAGATGCCAAGAGTACAATGCACGCTCATATTGGCGTAGTACAGCTCAATGTCAGTATTGCCTTTAGCTCCAGAGCCTCCTGGCCCAGACTGCGGTTGAGCGCAATGTAGACATCATGCTCCTATAAGCGAACCCTACGTCTCTGGTAGTGGACAATCGTCCGCCGATCCTTGACGAAGGCAGGTAAAGCAGCTATCAAATGCTGCAGCTCTCCAAAGTCCAGGAACTGGCTGCTTTACCATGCGGGGTATCGCTTATGCGAAGTTAAAACACGTGCGCACATGTACAGCTGCTACGCTCCGCCGAGCGACACCCCGATCAGTTCGAGGGAGCTTCTGGAGGCGCTCGTGGACCATGCGGAGAACCCGAAAGGTCGTACCGGCGACTTTAATGCTGGACGGTGGAATGGGGCAGCAGGACATCAACACCAGGACGAGCTGTGATTGACGCCATGCGGATGCTGGGGCCTCATACTGCTGAACGATGGACGGAAGCCGACGTTTAACAACGATGAAATTTACGTCCTTTATTGACGTTACCTTTGTCAGCAGAGGGCTAGTAGACAACAACAACTGGATGGTCCATGACGTCATGACGCTGAGCGACCATGCCCTGATCTCCTTCTCCCGGAGGTATGCCCAAAAGACGGCAGAGTAGAACAGCCGGGAAAACATGGAACACCAGGAGGAAGATCGATGAGGCCATGCTGGCCTATCAGATCAATTCCTGGAAATCCCAAATGTGGACGCAGAGGTATGGCGGCAGGCCTCATGAATATGCTGGGAAGAATCTGCGACACCCAATCATGCCAAGGAAAAATAAGGCACAGCGCAAACCCGCGTTTACTGGTGGAGTGCCTCTAAGCCAACTACGGTCTGATTGCCTCGGGGCTAAGAGAACGGCGCAACGAGCCAGAGGCAGTACCACGCGGAACTCTTGGAGGCTTTCAGAAGCAAACGCCTAGAGTTCAAGCACGGCATCATGACTGCCAAAGCGCGGTCGTTTAAGGAGCTGCAGGATGGCGTAGACAGCGATATCTGGGGCCTCGCCACAAACTTGTTACCAACGAGCTAAGGAGGAGAGCAGCAACCCCATCGACCGGGGAGTTGGCTAACATACTGGGGAGCTATTTCCCGAAGCAGACCACGCTATGGAGAATGGCCAACAGGGCAGCCTGCCCCGGATTACATATGCGTCACAGAGCGAAGTCGTCGAGGCAGCTGTTTCGCTGACGATGTGGCAATCACAGCCGGGCTAGCAATAGCGGCTCACAAGACCGAAGCAGTCCTACTAAGCAGCAGGAAAAGATACGCTGGAGAACATGCTGGTCTCCGTCAAAGGGCCGCTGGGGACCTCAAGAGTCCCTAAAGGTACCTGGGGGTAATGATAGATCGCAGACTATCGTTCAAGGACCACGCGAGCTACGCCAGCAAGAAGACAGCAGTCATCCTCTTCGTTGGCGAGGCTTATGCCAACGATCAGGGCCCAAGACGCGGCCAGGAAACTGCTGGTGTCGGTATGAAAACTTCGCTGCTATACGCTGCACCAGTCTGGAGCAATGCCACTTGCAGGGTCATACCTGAAAGGAGCTCGTTCGGTGCTAGAGTCAATGGCCCTCCAGGCTCATTAGAGGATTCAGGACCATATCCGAAGACGCGGCGCTGGCAGGCCTGCCGATTGATCTGGAGATCAAGGCTCTCCAGCCTTATGCGGAGTGGCGCTTCCAGGCAAGAGAGCACACGAGTGGCTATTAGGTGAATGGCAGAGCAGATGGCAAACGTCGCGACGGGGAGGTGGACCTATCAGCTCATCCCAGAGATGACGGTTGGGCAGAGTGACACTCTCAAAAGTGTGTAAACTTGGGTATTTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTTTAATTTATAAATTAAAATATATATTGTTTAATTACCTTTCCTTAAAAAATTGCACGTTTAATCAAAGCAAATAACGTTAATTTTGACCTTTAAAGTCAAAAATTCAACTTATTCACGGTGTGTAAACAGTTTGCTTGACAAACTGTACTTGTCGCAGATTTATTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCCTTTCATTTTGCATATTATTAGAACACGCATTCTCTACCTTGCAACAGCGTGGCAAATAACTGTTTCAAAACAAAACCTCCGCTCTCTCTGTCCTTGTCAAGCTCACCGGGACTGCCAGTCAAGGTATTTCATCGGTGAGCGGGATGTAGTGCCAAGTTGCACCATCTTCTTTGCGGTGCACAGCAGCGCCTTTACGACCAGCTGGGCATTGCCAGTCGTAGGTTCTTGCCCCGCCAACATACGGGGTACTCCTTATCTATAGTTCAGATTGGTCATCTCGTCCTTACGGACACGCGCTTCATCATGGTGACGATGATCACGTGAGCCCCATCCCAAACGATTTTGTCCGCCATCATGGCAACAACCAAGCCTCTCGGGCTGAAGGTGACCAACGAGCGCCACGAGTTGCGCCCTCTCCTCGGCGAACCTGGAGCAGTGCAGTAGGATGTGCTCTGCGGTTTCCACTGCGTCTGTGCAATAAAGGCACTGGGCTGTATCCACGTGGCGGAACCTACATGGAGTACCCTCGAAAACAGCCATGGTCACGTGAGGAACTGGGTCATGTAGTGAGATCCACCGTTTTTGTGCTCATAATCAGCCCTCCACGTTGGTTGCGGAATGAGTTTGTAAAGTCCAGCGTCCCCGTTGTGACTCTTGCCACCTGGTCTGCCATACTCCTCCGAATCACTCTTTGATCTCTAATTGAGTGTATCCCTCACTCGCAAATTATTTGCCCTTTATGTCCAGGTCGTAGGTGTAATACCTGACAGAGCACGTGCGCTGCGTCGTCCGATATGGTTCTAAAGCCTCTGATTAGCCTGAAGGCCATTGTCCGTGATACTGCGCGGGCACTATCTGAATAGGTTTCTTTGTGGAAACGCAGCTCCAGATAGGCGCAACCAAAGCAGTGTTGCCTTTGAAACCGCCACTAACAGTCTCCTAGCCGGCAGTCTGGGTCCTCCCACGTTGGGCATGATTCTCGCCAAGGCTGCTGCTGTCATTGCCGCTTTTTTTGGCATACCTTGCGTGAGCCTTGAACGAGCCTTCGGTCTATTAGAACGCAAGGTATTTCAACGTTTCTGCTGAGGCGATTTCAACTCCTTTGACTGCACGCATGCACTCAACGGACTTTCTGCTGTTCAGCAGGACTAGCGGTCTTATGCGCAGCTATTTTAAGTCCGACTTTCTCGAGCCATTCTGGCCGCCGTGATTGCCACGTTACTTATGTCCTGGAGCTCCGGTATTGTCTTGGCGACCGCTGTTATCGCAACGTCGTCGGCGAAGCAGTGCGGCTCCACCTGGGCTTGCCTGTACTCCGGTATTCCATCATACATAATGTTCCACAGATCGGTCTAGTACCGACCCTTGAGGGAACCTGCAGAACTGGTGGCTTCTTGGACCATCTTCTGTTACATTACCATAACACACGGTCCCTGAAGTAGTTGCGCAATTACGCCTCGTATGTAGTCGGGAACGCCCAAGTTGCGCATAGCCCCGAGGATAATGGAGCCCATCTCGCTGTATTGAATGCGTTCTTGACGTCTGAAACGGTAACGGTACTTCTTACTGCCGCCTAACCATCGGTTACCGTCGAGTGCTTTCCTGGCAGCGTCTGTTACGGATTTGAGGCGTCGAGCGTGCTTTTACCACTTTCGGAAGCATACTGTTGGCCCTGAAGGCCTGTAGGACTTTCAGTGATTAGCTCAATGCGCGTACAGTATGCGCTCAAAGAACTACCAACAATGTCCAACAGACACAACGGTCGGTAACTGCGTGGAACATTGCAGGCCCGCGCGCTTTCGGCAGAAGGACCTTCATCTTTTCCAGCGCTTGGGAAGACTCCGTCCAGCAGACACTGTTGGAATGTATCCCTGAAGACCTCCGGTCTTGCGGTGGCAACTGCTTTCTGACGATCACGCCCGGGATACCATCAGTACCGGGAGCTTTTGTTCGGTCTGATCTCTTTGCTCTTCGACGACTTCGCATGACGTGATGCACGGGAAGTCAGAGGGCGGGGGGGGGGTCAACAGCGGGTTGCCATAACGTGTGTTGGCGGAAATAGTTCCGACACGATGTTGGCCAGGGCGGCTGGGTCTGAGATCCTGCACCAGCGGAATTGAGTTTTCCTTACGACTTTGTAGGCGGGCCAGGGTCGTCGTCTGCTTATCAATCAGATCGCCAAATGCATTCGCCTTTGCTGCTGATATGCCGTTCTTAAGCTCAGTTCGCTTCGCTTTATATACCTCAATGCACTGGGGTGCGGTTGCCCTCTAGATTGCTGCGCTTGCCTCCTCGCCTTGATGCATTCCGTCCGAAGCTGGTGCAATGGGTCACTCCACCAGTAGACAGGGGCTTTCGTTTCGTGTTCCTTTTCTCGGCATCACCGCATCACACATTGCTCTAAGCCTATCCATGAGCGCTGCCACCATGGTCTCCGTATCCAATTATGGACTCCATGCCCTCGATCTGGTATGCCAGCGTAATGTTCATCGGTTCCATACCGGACCCTAGCGCACATCTTCGCTGTTTGGGTGACGGCCTCATTGTTCGGGCACCGAACGTGATTAGGTTGTGAATTAAATGGCGTTATGTCATCATGGACCATCCAGTTCGAGCTAGCCGCAGAACTCTCTGCTAACAAAGGTGACATCAATGAAAGATGTACCTGCAATTATTGAACGTCAGTTTGAACCCGTCGTTTAGCAATACAGATCTAGCAGGTTCATGGCATCGATCACTGCTCGTCTCTTGTGTTAGAGATTCGACTGCCCCATTCTGTAGCCCAGGCATTGGGGTCACCTCCATTGACTGTTGGTCTGCCTTACTTGCATGGTTAACCAGCTTTCGAGCATGTCTCCGAATTGTTCGGGACTATGGCTGGTGGAGCATAGCAGCTGTAAGTGGATTCACTAATTTTGGCGTATGCTATGCCGCGCATTAGTGCGGTATCCCCTCCTCTACCAATAGCCTGGATGTACATTTAATGGCCGCGCTGCCTGTCTCGTCAGTAGCACTCCTGAGTTACCCACACCAGGTGATAGGTATGGTTCACTCCAGCACTACGTCCGCATGGCGCTCCTTCGCTGTTTGGTCAGGAGGTTCTGCATGCTGCGCAATGGTTAACGTTGAGCTGGATGTTAATTTTCTTCTGGCATCATTTTGACGGCTAATGGCTCCTTTGGTGTTGTTGGCTTTGTAGGTGGGGCATGCAAAACCACCCGTCGCGTGAAGTTCTTGTCCACGTCACTGCTGCAGATCAGGCATCTTGGTGGGGCTACGCAGCCCTTTGCCTTATACCCATGCTCGCCGCACCATGAGCGGCAGTCAGAGCGATCGACTGACTTGCGGTAGGGGCTCGGTGGCCAATTCGAGGGCATCTGAAGCATCTTATTGGGCGGACGTCTTGGGCTATGCGGCAACGCGACCATCCCACAGTTACAACGCCCCGGTTGATGACCGCAATGGCATCGTTCGCGCACATTAGCACAGAGGCTATCTGGGTCCCGTCACGCATCCTGCGAAGGTATCTTACATCCCTCTGGTTCAGGCGGATGCCCTGAAGTGGGGAGACCAGGGAATTATGAGTCCCTGAGCCGTCGTTGTCTCGTCTAGTCCGCTGCAGATTAGCGCAGTCCCTATGCGCCCGTGCGAACCAAGCAATCTCTTTGAGCGTCGCTTTGGCTCCACCATTTTAAAGCTGGGGATGACCTCGAGGCTTTGCCTTCTAATTCAAGTAGTTCTCCCTGTTGCGTCCTCCTTATTATTTGCACGTGCTTGCCGAATTCGGTCAGACTCGGTTCTGCTTTCATCTTCCGAAACATATCCAGGCGTAACCTCACCGTTTTCAGGATTAGCGCCTCAGGTTTTTTTTTTGCGCAGGCGCTTGGGCTTCACCTTAGCTGTTCCTCGTCCTTGTTAGCGTCCTTGGCATTGAACGCATAACTTTCCGGTTTGGAGTCAGCCACCGTCGGGTAACGCCTTACCGGTGTAGTTTCGCGGCAGATCGATGGTTGTCCGTTTTGCGGACCTGCACATTCGGTAATGCCTGTCTGGAATTAGCGCCACCTGGCTGCGCTTTGTTTTTTTTTTCTGCACTCAGTCTGTGTGGCGGTACTCTCGCTGGTGGGGCTACTGTTGATGCCACTCTGTAGCTCAATCGCTCTGTTATTGAGCGCCGATAGGTCACCTAGCACGCCCCTATCCTCGCTGGTTACGTGACGCCTAGTCTCGAACGAGGATAGAATGGCGGTGATCTTAGCTTTCATCATGTCCAGGATGCCTGCAGGTCCTCATTCTGGAGCGTCGTGGTCAGTTCTGGCGAGCGATGCGGCGATCTGATGGGACTTCGCTCCCGCCCTTTGAGCCAGCACGCTGATGAAATCTTGTCTTCAGGCTTGTGGCTGTCGTGGAACTGGTGGCCAGAGTCTCCACCTCCACAGCTGGCGCTACACTGCGTCGCCCCAGCTTTCGGCGGCGGGGGGGCCTGCTATGCCTCCCACTCCTGGATTGGGGTTCCGACTCCTCTTATGGGGATCTCGATGGCCTACCACTCCTCCTAAACGGGTCGTTGGGGTCGGGCACTACTTGTGCCTAATCCATCCAGATATAAAGAGGGACTTTGGCTTGTTGGTCCCAGCGCTCCGTGGGAAATAGAACAGCTTCAGTTCTTAGGTTATATTTAAAATTTTTGTTCAACTTAATTAGTTCAAATTTGAATTTGAATTCGAATTTCGCGCCCAACGAAGCGCGCGGCCGAATGACGATCGCACCGCTGATCTGGCAACGCCAGTCTTACCAGCTCGTCGACGCTGCGAAAGGGTTGGCAATGCTAGCTCCAGCTGTATTGTCTGATGCAGCTGATCTGATTTATTACCAGTTTACTGGATCGCCATTAATTCGGAACGACACCGTGACGCTCAGAAACGCGGCGCAAACTGAGAGTGGATTTGCAGGTTTATGTTGCAGTTTACGGCTGACCGGACTCGTATGACGAAATTCGCGCAGCGCAGCAGACGTGCGAAATACGCGAACTCGATTCACTATCAATGCCATAATGTGTGTTGGTATTGGGTATTATTATTATTGGAGTGAAGTAAAGTCTCAAAGTGTGTTTGATTGCGGGTAGACTTGAGTTCTAAATTATTGCAACGTTCGTTCTGCACGATGGAAAGTTTTGATCGCCAGAAGAGAATGGGCAATGCCTCGCTCCCAGATTAGAACGCGTCAGAAAACGTTACGACGACGGGGGGTGAGAGTGATGCTGAGTATAAAAGTGATTCAGATCCCACATGCCCAATGCAAATAAGTTTATTTTCAACTTTTTCTGTGTAAAATGATATTTTATGTCTATGTGCTTAATTCTCTTGTGGCAAGGGTTGGGTTATTTGCAATACTAATGCAACCTGGACCTTTAATTCTAGTTTAATTTCTACCAATAAACTTGAGCCATAAGGCTTCTCTAAAGGAAAAACCTTCAAATAAGGCCATGTAATCTGCTGCTTCGGTGGATGAAGCTGCAACGTTTGCTTCATTATTGTTCCATGAAATTAAACAACTTTCAAACAGTTTAAATAAATATCCAGTAGTACTTCGTCATCTGTCTCATTTCTGCCCAATCAGAATCAGCATGTCCAATAAGAATAATACTAAACTGTACACTTTTTCTCAGAAACGATCTCAAATCAACGGTTCCTTTTTAAATGCCTTAAAACTCTTTTTAAGGCATGGCCATAATTCCTTATTGTTATTCGAATATCGACTTAAAATGCTTATTGATCAAGTTTCTACATGGTGCCTCACATGATTCTACAGATTGTAGAGCCTCATAGTTTAGTTTGCTTGGAAGAGGTGTACTAACTGCATTACGGTCTTCCATATTAAACTTTTTCAACACATTCTTTATATATGCAGATTAACTGGAGACATATCTGACTTTTATTTCTATCAATTTTAATTCGATAAAATATCGAACTTCCTTCAAATAAGTCATTTTAAATTTATTTAGAGGTATGATTTAAATTTAGACCTAGTTTCGGATTTACTAGTGGCAATTATTACATCGTCCACATATAATAACAAAATATAGATATTATCTAAGAATTTTTCCTTTATCTAATATAATAGATTTTTCAAATACAACATCTTTTCCTTTTATTTTTCAAAACTTCCAAACCAGCATCTTGCAGCTTGTTTACCATATTTTGCTTTATTAAGCTTGCGTTGCATTCTCATCGCAATATGGCAACCCTTTTTGGAACCTTCATGTAGATTTCATCTTGCTCCAAGAATGCTGTTCTCACATCCATATGATGGACTTGTAAATTTTATTGATTTGGAAAGAGCCAAAAAAACCGAAAACTGGAAATTCGTTGCAACTGGTGCAAATGTCTCAATGTCGATTACATATTCTTGTGCTGAAACCTCGATGCTACTAATGATGCTTTATGCTACTAAGTTCCAAACTCATCTTGTTAGTGCTACTAAAAGCCATTTACAATCTACTATGCTTTATTATTGGGCTTCTGCACCAAACTCCACGTTTATTTTCTGAATGTGAACCAAGTTCATCTTGTATAGCTTTTCCCAAAAAGATCTGTCATCACGAAATTCAATTTCATCAAATCTATTAGAGATATCAATATCTATAGAATGGTTTAGGTTTATCTTTGTCAAGTTACGGGGTTGGACTGTCACCCGCTCTCCGCTCCTTTTACATCTCCGCTCTTCACCACCAGAGTCTCCCAAGGAGTCTCCTTGCCTTGGAAGAGCTAACTAGATGGGAATAAGCACCAGTGTCAAAACTAATTTCGCAGAATAAATATACGCCGGTCGCGCCATATCAATTACGAAGTCTAGTGTTCGCTTTTTCTTCGAGTTTCTTTTCAGCATATTTGGAAAATTCCAGGACAAGCACCCTACAGGCCTTCATTTTTTATTTCTTTCACTGCGTCTGATTTCTTACTCACTTTTGCTATCATTTATTATTTCATCACCAGTTTTCTTTAACTGGATCGGCATTCTTTAGACATGTGGAATTTTACTGTATTTATTTTTTAGAATCAACAGATTCATCATTTCACCATTGGAAAATCGAGGACTCTATTCTTTATTAAAAAAGAATCATAAATAGCACATGTTGAACCTTCGAGTCTTCTTCATGTTTTAATTCGTTTGTCATCTCGATCACCGAATCGTATCTCGCTTTCAAGGCCTCATCTCTTTTGAACGCTGCTCATTTCTTAAGAACTGAGCCAACGCGAAAAGACCTAGAATGCCAGCCCGGAACCGATATGTTCGGGGTCGCGAAAAGGCAAATAACGACATATTTGCCACACTCCGTTTCTCGTGAGTAGTTGAAGAGAATTCTTCTCGCATGGAATCGGATTCTTTTGCAACTTTGTTGGTATATTACCTCGCAAAATTTTGTGAGGAGTTTGTCAATTATCGTACGCGTGGGAGATGCCGAAAGGCTACTTGGGCTGAGGCTGACACTGGCCCAGTTAGTACCGTGAAAGTATGATCTCTTGCCCGCCCCAAAGAGGCGAATGTTGGTTTTGTAACCCTCCAGAAGCACCGGAGAGGAGGATTGCCAAATCCATGTGCGAAGAATTTCATTGGGCCCTGAAGCGAGTGCGGCAAATATGTCGTTACTCTGCGCTTTTCGCGACCCAGTGCCTATCGGTTCCGGGCTGGGGCATTCTAGGTGCTGTTTGGCTCAGTTCTTGAGCTGGCATTAAAAGATGGGCTGTGAAAGCGAGATACGATTCGGTGATCAGATGACGGCGAATTAAAACGCAGAAGAAGACTCGAAGGTTCAACATGAAATATTTTATGATTCTTTTAATAAAAGATAATGTAGAGTCGATTTTCCAATGGTGGAAAATGATGAATCTGTTGATTCTAGAAAAATGTACAACATGATGAAATTCCACATGTCTAAAGAATGCCGATCCAGTTAAAGAGCTGGTGATGAAATAAATGATAGCAGAAAGTGAAGTAGAAATCAGACGCAGTGAAAGAAATAAAAAAATGATGGGTTGTAGGGAATCCTGGAATTTTCAAATATGCTGAAAAGAAACTCTCGAAGAAGAACACTAGACTTTTCACCG
->48744a56-dcfe-48e0-97ab-3b903ebdb60a
-TTCAAACTGCGTTCAGTTACGTATTGCTAACCCTACGTCTCTGGTAGTGGACAATCGTCCATGATCCTTGAGGCAGGTAAAGCAGCTATCAAATGCGCTCTCTCCAAGTCCAGGAACTGGCAAAACTTACCCATGCAGGGGTATCCTTATGCGAAGTTAAAACACGTGCACATGTACAGCTGCTACGCTTCGCGAGCGACACCCCCGATCCCAGTTCGAGGAGCTTCTGGAGGCGCTCGTGGACCGTACGAGGAAGGGCGAAGCCGAAGGTCATTACCGACTTTAATGCTGGACAGTGGGAGATGGGGCAACAGGACATCAACACCAGAGGACGAGCTGGCAATTGACGCCATGCAGATGCGGACCTCATACTGCTGAACGATGGACCCGGAAACTCTGACGTTTGCGCTTGATAGGGTACGTCCTTTATTGACGTTACCTTTGTCAGCAGAGGGCTAGTAGACAACAACAACTGGATGGTCCGCTGACGTCATGACGCTGAGCGACCATGCCCTGATCTCCTTCTCCCCGGAGGTATGCCCAAAAGGTGGCAGAACAGGCAGCCGGAAACATGGGACGCCGAAGATCAGAGGCCATGCTGGCCTATCAGACCGAATTCCTAAAATCCCAAATGTGGACGCAGAAATTATGGCGGAGCCTCATGAATATGCTGGGAAGAATCTGCGACGCAATCATGCCAAGAAAATAAGGCACAGCGCAAACCACCCGTTTACTGGTGGAGTGCCTCCTAAACCAACTACGGTCTGATTGCCTCGGGGCTAAAGAGAACGGCGCAGGCAGAGGCAGTACCCTACGCGGAACTCTTGGAGCTTAGAAGCAAACGCCACAGAGTTCAAGCACGGCATCGCGGCTGCCAAAGCTTGAGTCGTTTAAGGGCTGCAGGATGGCGTAGACAGCGGCGATATCTGGGGCCTCGCCTGCAAGCTTGTTACCAGCAGAGCTGGGGAGGCGGCAGCCCCATCCGACCGGGGGTCCTGGCTAACATACTAGGGGAGCTATTTCCAAAGCAGACCACACTATGGGGAGGCCAACAGAGGCAGCCTGCCCAGATTTCCCGTGCGTCACCAGAACTTGAAGTCGTCAGAGGCAGCTGTTTCACGCTGACAGTGTAGCCCAATCACAGCCGGGCGGCTAGCAATAGCAGCTCACAAGACCAGAAACGGTCCTACTAAGCAGCGGGAAAAGATGGAGAACATGCTGGTCTCCGTCAAGAGAGGTACTCAGGGACCTCTCAGAGTCCTAAAGAGTACCTAGAATTATGTCGATCGCAGACTATCGTTCAAGGACCACGCGAGCTACGCCAGCAAGAAGACGGCGGTCACATCCTCTTCGTTGGCAGGGCTTATTAGCAACGTCAGGCCCAGAGACACCCGGCCAGAGCTGCTGGTGTCAGTAGCAAAACTTCGCTGCTATACGCTGCACCAGTCTGGAGCAATGCCACTTGCAGGGTCTCATACCTGAAAGGAGCTCGTTCGGTGCTACGGTCAATGGCCCTCAGGCTCATTAGAGGATTCAGGACCATATCCGAAGACGCCCCGGCTGGCGCTGGCAAGCCTGCCGGTGATCTGGAGATCGGCTCTCAGCCTTATGCGGAGTGGCGCTTCAGGCAAAGAGGCACACGAGTCAACTGTCGGTGAATGGCAGAGCAGATGGCAAACGTCACTGACGGGAGGTGGACCTATCAGCTCATCCCAGGATGACCCCGGTTTGGGCAGAGTGGTACTCTCAAAGTGTGTAAACTTGGAGTTGTTATTTATTTTTTCTTGTATATTTGATATTTTGAATTTGTTTTTTAATTTATAAGTAAAATAAATATTGTTTAATTATATTCCTAAAAAAAAAAAATTGGATTTAATTAAACAAATAACCCTTAATTTTGACCGTTAAAATCAAAATTCGCATCTTATTTCACGGTGTAAACCGGTTTCATGACAAACTGTACTTATCCATGATTCTTTGCCAATTTTCAGAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTGAGAGTGATGCCGGTATAAAGTGATTCAGATCCGACATCAGAGTGGGATACCACCACTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTGTGTTGTTTTAGCTGTTCTTTATTTGGTCAATTTGAGGAACAGAAGGTCCTTTCCATTCGAAATTAATTCGTCCAATCCTCTTATGATCTACATACAAGGTTTCTTAGCCTAAGTCGAGGAGCAGCGCTGCCGGCACAGCCTGCAACGCAGCAGCAACATGCGTATCTTATATATGTATATATATATATGCTTGCTGTCGCCGAGCGATGGTGCTGGAGGGAGGTGGTATAAGGCACACACATATAAGCGATCAGCGCTTGAAGCCAGCAGGAGAACTGCTGACCAGGCAATTATGTATGTTAGCCCTCAAGTGGGTGCTCGTATGCGTATACACTTGTGCTGGACTGTTTATGTACACATTGCAACAGAGTGCTACAATTATGAATACACATAGGTACAGTGCTTAACCGATATATGTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCACAAGTCGCAGAATCGCCATTTTTCTGAACTGTTAAAAGTTACCCAAAACTCACAAAGAGACCAAAAAACTCAATGCTGTCGTGACTTTAAAGTTTAATCCTGAACGCACAGGCTTAGACGCCAATCCTGGTGCGAGGACTGGTCTACGTCGCGTGAAGACGGACGTCTTAAATTACGGCGCGAAATACTCGAAACCATAGAAGTTGTGTCGGCCGGTGGCAATGCGGCAAACTGGCAAAATCACGGTGGAGTCGCCATGGTTCTGCACTGCAATCACGCAGATTAATTGTGCGCCTGTTTCATCATAAATAGGTATTATCTTGCGATTGTTGCAGCGGATAAACAGCTGATAGCGCAGCAGGGGCGATCTGGAGAGGGAGGCGTTTGCCAGATCAACCATTAATGATCAGTGTTGTGTTTGCGACAGTAGGGCGCGAAATTCAAAATTAAATTTAAAAAATTAAGCCGTTGAAATTTGTTTATTTTGTTCTGATTCTGGTAACTGGGAGCACAAGTCTTTAAGAAGGGAAAAGGCACAAAGGTCGCGGACAGACCAAATATCATCCTCTCACCGTGCTGGTGCCCTGGCATTCTGGTGTCCGAGTCGAGGCGGTACAAACCTCCATCCGTAAAAGCCAGGAAATCCGTGGCTACGTGACCTAGGTAACCTTAGGCCATCCTTCAGTTGATGGACAGCACCCGGTGGGGCAGTCCCTGATCGCAACGACACCCGTTCAGGAGGGAGCTCCCCGACTTTCGAGATCCCCACCAGAGGGAGTCGGTAACCCGACCCATGGTGACGGAATCTGGTCCCGTCGGTAAGCAAGGGGGGTGAGCACACCCGGGCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGAGGTGGAGAAATTGGCTCCTACAGCATCTACGACCGCGACAAGTCAGAAGACGATGGACCACATCGCCGTGCATCGCAAAAGACGGGAGAAGTCCCCAGCTGGTTCCCCTCATCGGTCTTCCGGACTTGACCACTGCTCCAGAACGAGGACCCAGGGGCATACTTACCAGGATGAATGGCAAGATCAGCCCCTTCCTCCGCATTTCGAGACCCAACGACACACATGAGGGGCCAGGGCATAGCTTCCGAACTCTCAGCCCTTAACAACAGGGCGATAGAGGCACAATACGAAGGTACTACTAGCGAGCACCGCTTGAAGAGCAGCGCTGCAGACGGAGGTACAAAGCCACCAAAGGCTCCACAAAAAGTGCGCAGGTGCCCACGGTCACTTCCAGAAGTCCAGAGCGCCAAAGCGAGCAACCCTACGTTGGATGGCAGCGGTGAAGGAAAAGGCGACATCCATACCTAACGAGTCCAAGCCGAACTGGCTATGCATCTGTCGCCAAGAATGCTAGCACGGGTGCAGAGGCACTCATCGGCAGACGGGAGGAGGCTTCGTACGCAGAGATGCTTCCGGAAGCTAAGATCGGAATCGAGCCTTAGCGAACTGGGCGATCGTGAAAAAATCCGGAGAACGCAGAAAGGTGATCATTTGCTTGAGGAGGTGGGGGAAGCTTCGGAAAGCGTTCCCAAGTTTAGAAACGACCTGGAAGCGGCGCTCAATGACTTGGCCTCTGTTGCTGGGAGCGCGAGAATAGCTCTATCTTGCAGCGGATTGGACGGGGCTACGACAGCGAGCTCCACAGCTGCTTGGTCGCCCAATTCCAGAGACCTGCAGATAAATCCTGAAGATATCAGGGGCCTTGCGTATGCGGAATTGCAACAAATAGCCTCAGTGCTGCTGAACGCAGAACGTTGCGATACAGTCCTTAAACGGGGCACCATAATCGTTTGGACCGGAAGGTCAAGATGTCATTATCGCAGGACGTCCGACCCACGAGATCACAGGTGTCTCGGCTATGGGCATCGATCAACCCGTACCACGAGAGACTGACAGGGCAGACTGCTGTGCTTAGATGCGGTGAGCGTGGGCACAAAGGCAAGGGTGCGTTGCTGCACCATCACCTGATCTGCAGCAGCGAGGTGGTTAGAAACCACCCGACGGGTAGCACGCGTGCCCGACTTACGAGCGACACTAAAGATGCAGGCCACCTTAATGCACGCTCATATTAGCGTAGTACAGCTCAATGTCAATCATTGCGCAGCAGCTCAGAGCCTCCTGGCCCAGAGACTGCGGTTGAGCGCAATGTAGACATCATGCTCTAAAGCGAACCCTACGTCACCGAAGAGTGGTGGACAATCGTCCATGATCCTTGACAGAGGCAGGTAAAGCCAGCTATCAAATGCCACGCTCTCTCCAAGTCAGGAACTGGCGCTTTACCCATGCAGGTATCGCTTATGCGAAGTTAAAACACGTGCACATGTACAGCTGCTACGCTCCGCCGGGCGACACCCCGATCAGTTCGAGGAGCTTCTGGAGGCGCTCGTGGACCATGCGAGGAGAACTGAAGCCGAAGGTCGTACCGGCTGACTTTAATGCCTGGACGGTGGAATGGGCAACAGGACATCCAACACCAGAGGACGAGAGCTGTGATTGACGCCAGCCGAATACTGGACCTCATACTGCTGAACGGTGGACGGAAGCGGAAACGTTGCTCGCTGATAAATTTACGTCCTTTATTGACGTTACCTTTGTCAGCAGAGGGCTGAAGTAGACAACAACAACTGGATGGTCCGCTGACGTCATGACTGAGCGACAGCGCCTGATCTCCTTCTCCCCGGAGAACCAGCATGCCCAAAAGACAGCAGTAGAACAGCCGGAAAACATGGGACACCAGGAAGTCGATGAGGCCATGCTGGCCTATCAGATCAATTCCTGGAAATCCAAATGTGGACGCACCCAGAGAGTATGGCGGCGAGGCCTCGCCAGATATGCTGGGAAGAATCTGCGACACCAATCATGCCAAGGAAAATAAGGCACAGCGCAAGCCCACCCGTTTACTGGTGGAGTGCCTCCCTAAGCCAACTACGGTCACAGTTGCCTCAGGGCTAAGAGAACGGCGCAACAGGCAGAGCAGTACCACCACGCGGAACTCTGGAGGCTTTCAAACAAACGCCTAGAGTTCAAGCGCGGCATCGCTGGCTGCCAAAGCGCGGTCGTTAGAGCTGCAGGATGGCGTAGACAGCGTATCTGGGGCCTCGCCTACAAGCTTGTTACCAGCGAGCTGGGAAACGGCAACTATCCGACCAGGGGATACAAGCTTCGCACATACTGGGGAGCTATTTCCAAAGCAGACCACACTATGGAGGCCAGCAGGCAGCCCTGCCCCAGATTTGCCGTGCGTCACAAGAACTTGAAATCGTCAGGGAACTGTTTCGCTGACGATGTGGCAATCAGCCAGACTGCTTAATAGCGGCTCTGAGACCGAAGCAGTCCTACTAAACTGGAAAAAGATGGAGAACATGCTGGTCTCCGTCAAAGGGTACTCAGGACCTCAAGAGTCCTAAAGTACCTGGGGGGTAATGATAGATCGCAGACTATCGTTCCAGGACCACGCGAGCTACGCCAGCAAGAGACAGCAGTCCGCATCCTCTTCGTTGGCGAGGCTTATGCCCCGGCGTCCGGAGGCCCAAGACACCCGGCGGAAGCTGCTGGTGTGCCTCCGTGCCGAAAACTTCGCTGCTATACGCTGCACCAGTCTGGAGTGCAATGCCACTTGCAGGGTCATACCTGAAAGAATACGTTCAGTGCTACGAGTCGAAGTAGCCCTCAAAGGCTCATTAGGGGATTCAGGACCATATCCGAAGACGCGGCGCTAGCGCTGGCAGGCCCTGCCGATTGATCTGGAGATCAGGGCTCTCAGCCTTATGCGGAGTGGCGCTTCCAGGCAAGAGACACACGAGTACCAGCTATTAAGGGTGAATGGCAGAGCAGATGGCGAAGCGTAGGCGGGGAGGTGGACCTATCAGCTCATCCCAGAGATGACGGTTTGGGCAGTGACACTCTCAAAAGTGTGTAAACTTGGGAATTTGTTGTTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTAATTTATAAGTAAAATATATATTGTTTAATTATATTTCCTTAAAAAAAATTGCGTTTAATCAAGCAAATAACCGTTAATTTTGACCTTTAAAGTCCAAGAAATTCAGCTTCACGGTGTGTAAACAGTTTCTTGACAAACTGTACTTGTCATAGGAATTGTACTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCACTTCTTTCATTTTGCATATTATTAGAACACGCATTCTCTACCTTGCAACAGCGTGGCAAATAACTGTTCAAACAAAACCTCCGCTCTCTCCTGTCCTTTGTCGGCTCGCGGGACTGCCAGTCAGGTGTTTCATCGGTGTGAAGCGGGATGTGGTGCCAAATTGCACACCATCTTCTTTTGGGTACTGTAGCGCCTTTCCTGACCAACTGAGCGTACCAGTCGTAGGTTCTTGCCCCGCCAACATGCAGGTTACTCCTTATCTATAGTTCAGATTGGTCATCTCTAAATGCGGACACGCTTCATCATGGTGACGATGATCACGTGACCCCATCCCAAACGATTTTGTCCGCCATCATGGCAGCAACCAAGCCTCTCGCCGAGGCTGAGAGGTATTGGCGAGCGCCACAGTTGCCCTCTCCTCGGCGAACCTGGAGCAGTGCGGTAGGATGTGCTGCGGAACTCCCTGCGTCGTACGTAAAGGCACTGGGCTGTATCCACGTGGCGGAACCTACATGGGTACCCTCGAAAACAGCCATGGTCCGTGAGGAACTGGGTCATGTGGTAGTCCACCGTTTTGTGCTCGCAATCAGCCCACTCCGTTAGTTGGAATGAGTTTGTAAGTCCAGCGTCCCCGTTGTGACTCTTGCCACCTGGAGTACCCGCGCTCCTCCAGGTCACTGCTCTTTGATCTGTGGTGTATCCCTCACTCGCAAGGGTATTTGCCCTTTATGTCGGAGTCAATGGGTGTAATGCCTGACAGAGCGTGCGCTGCGTCGTCCGATATGGTTCTAAAGCCTCTGATTAGCCTGAGAGAGCCATTGTCCGTGATACTGCGCGGGCACTATCTAGATAAAGTTTTCTGTGGAAGCGCAGCTCCAGATAGGCGCAGCATAAAGCAGTGTTGCGCTTTGAAACCGCCACCTAGCAGTCTCCTAGCCGGCAGTCTGGGTCCTCCCACGTTGGGCGCGATTCTCACAAGGCTGCTGCTGTCATTGCCGCTTTTTTGCTGGCGCGCGCCGTGAGCCTTGGACGAAGGCCTTCCGGTCTATTAGAACGCAAGGTATTTCAACGTTTCTGCTGGGCGATTTCAACTTAACGACTTCCACACGCATGCACTCAACGGACTCTGCTGTTCAGCGGGACTACTGGTCTTATGCACGGCTATTTTGAATCCGACTTTCTCGAGCCATTCTATGGCCGCCGTGATTACCACGTTACTTATGTCCTGGAGCTCCGGTATTGTCTTGGCGACCGCTGTTATCGCAACGTCGTCGGCGAAAACGGTGCAGCTCCCGCACCTCTGGGCTTGCTAATGCTCGGTATTCCATCATACATAATGTTCCACAGATCGGTCCTAGTACCGACCCTTGAGGAACGCCTGAGACTTGGTGGCTTCTTGGACCATCTTCTGTTACGTACCATAACACGCACGATTACGGTGGTTGCAATTACGCCTCGTATGTAGTCGGGAACGCCAAGTTGCACCTTAGCCCCGAGGATAATGGGCCATCTCGCTGTATTGAATGCGTTCGCGGCGTGGCGTGATGATGGCACAGTACTTCTTACTGCCTAACCATCGGTTACCGTCGAGGATGCTTTCACAGCGGCGTCTGTTGCAGTTGCGAAACGTCGAGCGTACTTTTACCGCTTTCGGAAGCCATACTGTTGGCCCTGAAGGCCTGTAGGACTTTCAGTGATTAGCTCAATGCGCGCGTACGGTATGCGCTCAGAACTTTACCCAGCGTATCCCAACAGACACAAGCGGTCGGTAACTGCGTGCAGGAACATTTGCCCCGGGCCTTGCCTTTCGACGGGACCAGCTTCATCTTTTCCAGCGCTTGGGAAGGCTCACCGTCCAGCGAACACTGTTGGAATGTTATCCTGAAGACCTCCGGTCACTTGCGGCGGTGGCGGCATAGCGACGATCACGCCGGGATACCATCAATGCCGAGACTTTGTTCGGTCTGATCCTCTTTGCTGCTTCGACGACTTCGCATGACGTGATGCACGGAAGTCAGAGGCGGGGAGTCAACAGCGGGTTGCCATAACGCGTGTGTTGGCTTGGAAATAGTTCCGACACGATGTTGGCCAGGGGCGGCTGGGTCCTGAGGAGATCCTGCACCAGCGTTAAGGTTTTTTTCCTTACGACTTTGTAGGCGAGACCCCGGGGTCGTCTACGCTATCAATCAGGTCCTTAAATGCATTCGCCTTTGCTGCTGATATGCCGTTCTTAGCTCAGTTCGCTTCGCTTTATATACCTCAATGCACTGGGAGTGGTGCGGTTGCGCCTCCTGAATTGCTGCGCTTGCCTCCTCGCCTTGATGCATTCCGTCGAAGCTGGTGCAATGAGTCACTCCACCAGTAGACAGGGGGCTTTCCGTTTCGTGTTCCTTTTTCTCGGCATCACCGCATCACATTGCTCTAAGCCTATCGCAGGCGCTGCCACCATGGTCTCCGCGTGTCAATTGGACTCCGCTGCCCTCGATCTGGTATGCCAGCATGTCTTCATCAGTTTCCTAATGTCCCATACCGGACCTAGCGCACATCTTCGCTGTTTGGGTGACGGCCTCATTGTTCCGGGCACCGAACGTGATTAGGTTATTGGTCGCTCAGCGTTATGTCCTCATGGACCATCCAGTTCGAGCTAGCCGCTAGAACTCTGCTAACGAGTGGCAGCATCAATGAAAGATGTACCTCTGTCATTATTGAACGTCGGTTTGAACCCGTCGTTTTAACAATACAATCTAGCGGGTTCATGGCATCGATCACTGCTCGTCCTCTTGTGTTAGGGTCGACTGCCCCGTTCTGTAGCCCAGGCATTGAGGTCACCTCCGATGGTCTGCCACTTGCATGGATTAACCAGCTTTTCGAGCATGTCCTCAGATTGTTCGGGACTGTCGCTAGGTGGAGCCCATAGCAGCTGTAGAAGTGGATTCCTCTAATTTTGGCGTATGCTATGCCGCGCATTGGTACGGTATCCCACTCCTCTACCAATAGCCTGGATGTACATTTAATGGCCGCCTTGCCTGTCTCATCGAGTAGCACTCTGAGTTACCCACACCGATTTAGGTACGGTTTCACTCAAAAGCACTACGTCCGCATGGCATCGCTTCGCTGTTTGAGTCAGGTTCTGTGCTGCTGCTGCAAATGGTTAACGTTGAGCTGGATGATGTTAATTTCTTCTGGCATCATTTTGACGGCTATTAGCTCCTTTGGTGTTGGCTTTGTAGGTGGGGCATGCAAAACCACCCGTCGCGTGGTTCTTGTCACGTCACTGCTGCAGATCAGGCATGCCGGGTGGGGAGTACGCAGCCCTTTTGCCTTATGCCCATGTGCTCGCGCACCGTAGGCAGCAGTCAGAGCGATCGACTGACTTACGGTAGGGGCTCATTGGCGGAAATTCGAGGCATCTGAAGCATCTTATTGGGCGGACGTCTTGGGCTATGCGGCAACGCGACCATCCCACAGTTACAACGCCCGGTTGATGACCGCAATGGCATCGTTCGCGCACATTAGCACAGAGGCTATCTGGGTCCCGTCACGCATCCTGCAGGCCCTCACCCATCCTCTGGTTCCAGGCGGATGCCCACAAGTGGGAGACCAGGGGTGGGAGTCCTGGTGATCGTTCAATCTCGTCTAGTCCGCTGCAGATTGGCGCAGTCCTATGCGCCCGTGCCGAACCGAAGCAATCTCTTTGACGTCGCTTCTGGCTCATTTTAAAGCTGGGGATGACCTCCGAGGCTTTGCCTTCTAATTCAGAAGTAGTTCTCCCTGTTGCGTCCTCCAGCATTTTACGCACGTAGCGCCGAGATTCGGTCAGACTCGGTTCTGCTTTCATCTTCCGAAGCATGTATCCGAGTACGTAACCTCACCCGTTTTTTCAGGATTAGCGCCTCAGGTTTTGCGCAGGCGCTTGAGCCTCACCTTAGCCCATTCCTCGTCCTTGTTAGCGTCGCTGGCGACAGACGCATAACTTTCCGGTTTGGAGTCAGCCGTCGTGGGTAACTTGCCTTACCGGTGGATTTCGCGGCAGATCGATGGTTGTCGTTTTGCGGACCTGCGCATTCGGTAATGCCTGTCTGGAGTAGCGCCACCTGGCTACGCTTTGTTTTTTTTGCCGCACTCAGTCTGTGTGGCGAGTACTCCAGCAGTGGGGAAAGCCGCGGTGATACCCTCCTGTAACTCAATCGCTCTGTTATTGAGCGCCGATAAGGATCCACTAGCGCGCCCTATCACTCGCTGGTTACGTGACGCCTAGTCTCGAACGAGGATAGAATGGCGGTGATCTTGGCTTTCATCATGTCAGGATGCCTGCAGGTCCTCGACCTGGGCGTCGTGGTCAGTTCGGCGAGCGATGCGGCGATCCTGATGGGACTTCGCTCACGCCCTTTGGGCCGGCACGCTGATGAAATCCATTGTCTTCCGGGCTTGTGGCTGTCTGTGGAGAATTTCATGGTGGCAGAATCTCCACCTCCACAGCACACTGCAGTCGCTAGCTTTCGGCGGCGGGGGGCCTGCTTGCTCACCTCCCTCCCTGGATTGGGTTCCGACTCCTCTTAGGGGATCTCGATACCTACCACTCCTCCTAAACGGGTCGTTGGGGTCGGGAGCTTTTTTCTTATATTGCTGTCCATCAGATATAAAGGGGGGGGGACTTTGGCTTGTTGGGTCCCCAGCGCTCCGTGGGAAATAGAACTAGCTTCAGTTCTTCCAGGTTATATTTAAAATTTTTGTTCAACAATTGGTTAAATTTGAATTTGAATTCGAATTTCGCGCCCAACGCAGGCGCGCGGCCGAATAACGATCGCACCGCTGATCTGGCAACGCCAGTCTTACCAGCTCGTCGACTGCGAAGGTTGGCAATGCTATCCAGCTGTATTGTCTGATGCAGCTGATCTGATTTATTACCAGTTTACTGGATCGCTCGTGAATTCGGAACGACACCGTGACGCTCAGAAGCGCGGCGCAAACCCCGGTGGTTGCGGGTTTATGTTGCAGTTTACGGCTGACCGGACTCGTATGTAATGAAATTCGCGCAGCGCCAGCAAAGACGTGCGAAAATGCGCGGGAACTCGATTCATATCCATGCCATAATGTGTTGGTATTGGTGTGTGTGGGTGAAGTAAGTCTCCAAAGTGTGTTTGATTGCAGATGGGCGGGACACGCTGGCGCAGCGTTCGTTCTGCACATTAAGTTTTGATCGCCGAAGAAGACAGACATGCCTCGCTCCGAATTAAACGCGTCAGAAAACGTTACGACGACGGGGTGAAGTGATGCTGAGGTATAAAAGTGATTCAGATCCACATACTTAATGCAAATGGTTTTATTTTCAGCTTTTCTGTTGGCAAATGATATTTTATGTCTGTATTGTAATTCTCTTGTGGCAGAGTTGGGTTATTTGCAAATACTAATGCAACCTGGACCTTTTAATTCTAGTTTAATTTCTACCAATAAAAACTTGAGCCATAAGGCTTCTCCTAAAACCTTCAAATGAGCCATGTAATCTGCTTCGGTGGATGAAGCTGCAACTGATTTTTGCTTCATTGTGTTCCTTGAAATTAAACAACTTTCAGAGCAGTTTAAATAAATATCGGTAGTACTTCGTCTGTCTGTCTCATTTCCTGCCCAATCGAATCAGCATGTCCAATAAGAATAATACTAAGCTGTACGCACTGTATTTCAATCTCAAATCAACGGTTCTTTTGAAATGCCTTACAAAAGAGCTCTTTAAGGCAGCCATAATTCCTTATTGTTGTTATTCGAGATATCGACTTAAAATACTTATTGATCAAGTTTCTACATAGTTGCCTCACATGATTCTACGGATTGTGGAGCACCTCATAGTTTAGTTTGCTTGGAGATTGTACTAACTTTGCATTACAGTCTTCCATATTAAACTTTTCAGCATTCTTTATATATGCAGATTAACTGAGACATATCTGACTTTTATTTCTATCAATTTTAATTCCGATAAAATAATGAACTTCCTTCAAATAAGTCATTTTAAATTTATTTAGAAGGGTATGATTAAATTTCAGACCCTAGTTTCGGATTTACTGAAGTGGCGCTGAACTATTACATCGTCCACATATAACAAAATATAGATGTTAATCACAAGAATTTTCCTTTATCTAATATAATGTAGATTTTCAAATACAACATCTTTTCGCACATTTCAAAACTTCAAACCGGCATCTTGCAGCTTGTTTTACTGCTATGCATTTTGCTTTATTAAACGCATTCTGCATTCTCATCACAATATGGCAACCCTTTTGGAGACAACTTCATGTAGATTTCATCTTGCTCCAAGAATGCTGTTCTCACATCCATATGATGGACTTGTAAATTTTATTGATTTGAAGAGCCAAAACCAGGCTTTGGAGATTCGTGCAGCTGGTGCAAATGTCTCATCATAATCAGTCACATATTCTTGTGTAAAACCTCGTGCTACTAGCCGTGCTTTATGCTTTACTAAAGTTTCCAAACTCATCTTATTGAATTGCTACTAAAAACCATTTACAATCTACTATGCTTTTATTATTAGGCTTCTGCACCAAACTCCACGTTTTATTTTCTGAATGTGACCAAGTTCATCTTGTATAACTTTTCCCAAAAGATCTGTCATCCACGAAATTCAATTTCATCAAATCTATTGGGAATATCAATATCACCTGCGACCAGTTTAGGTTTATCTTTGTCCAAGTTACGGGGTTGGACTGTCACCCTCTCCGCTCCTTTTTACGCTCTCCGCTCTTCACCACAGAGTCTCGAGGAGTCTCCGCTGCGCTTGGAAGAGCCTAACTAGAATAGAATAAGCACCAGTGTCAAAACTAATTTCCATGGGGTAAATATACGCCCGGTGCCCTCAATTACGAAAAGTCTAGTGTTCGCTTTTGCTTCGAGAGTTCTTTTCAGCATATTTGGAAAATTCAGGACAATACCCCCCTACAACCCATCATTTTTTATTTCTTTCACTGCGTCCTGATTTCTTACTCCTTTTGCTATCATTTATTTCATCACCAGTTTCTTTAACTGGATCCCGGCATTCTTTAGACATGTGGAATTTTTACTATGTTGTACATTTTTCTAGAATCAACAGGTCATCATTTTCCACGGTGGAAAATCGAGGACTCTACATTATCTTTATTAAAGAATCATAAATACTTTTATGTTGAACCTTCAGTCTTCTTCATGTTTTAATTCGTTTGTCATCTCGATCACTAGATCGTATCTCGCTTTCAAGGCCTCATCTCTTTTTTAGACGCTGCTCATTTCTTAAGAACTGAGCCAACTGCCAGACCTAGAATGCCTAGCCCGGAACCGATATGTTCGGGGTCCTTGAAAAGGCAGAGTAACGACATATTTGCTTGCACTCGTTTCTCGTGGTCGTTTGAGAAATTCTTCTCGCACGTAGATCGGATTCTTTTACCAGCTTTGTTGGTATATGTCCCTCTTAAGAACTGCTGAGGGAGTTTGTCCAGTGAATTATCGTACGCGTGGGAGATCTGTGTCGAAAAGAGAAATTCTAACGGGCTGGGGTGACACTGGCCCAGTTAGTACCCAGCCGAAAATGGTCTCTCTTGCCCCAAGAGAGAGCCACAGATGTTGGTTTTGCTCCTCCAGAGCACCGAAGGGAGGATGTCGGCTCCGATAAGTACATCTATTTGTGCGCTCTCATAGAATTTTGGATCCGCCAGTGGAAAATCGGGAAGATCCCGAAGGGAAGAGGAAGGTAGGAAGACGCTTCCGGCGCTGGTTGAGGGGAGGACGCAGGCCGTCGTCTCCAACTGCAACGCAGGCTAGTCGGAGATCCGGATGAACTTCACAGAGCTTCTTGGACTGAGCAGCTACTGTTTGCTTTAAAGCCCGGAAGCAATGTGGCACC
->94d29bbc-7b1e-4cc5-abaa-d26d744c82bb
-TTGGTGGCTTGCTTCGTTCAGTTACGTATTGCTGACTGTTTATGTACACATTTGCAGCAAGTGCTACAATTATGGAATGTTTCGGTGCTTAACCGATATGTGTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTAGAGTCGCAGAATCGCCATTTTTCTACGAACTGTTAAAAGAAGTTGCGCAAAACTCACAAAGAGACCAAAAAAACTCAATGCTGTCGTATTGCAAAGTTTTAATCCTGAGCGCACAGGCAGACACTCAATCCTGGTGCGGAGACCAAGTCTACATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCGAAATATAACTCGCATAGAAGTTGTGTCGGCCGGTGTGTGCGGCAAACTGGCAGAATACTACGGTGGAGTCGCATATAGTTCTGCTACAATCACGCGAAGTTAATTGTGCGCCTGTTTCATGTAAATAGGTAATTTATTATCGCGATTGTTTGCAGCGGATAAGCAGCTGATAGCGCAACGACGGTATATGGAGAGGAGGCGGTGCCAGATCAACCGATAGATAAGTGTTTGACCGACTTTCGCGACAGTAGGGCGCGAAAATTCAAGAAATTAAATTTAAAATTAAGCCGTTGAAATTTAGCCAATTTTAATTGGTACAGTTCTGTGGTAACTGGGAGCGCACAAGTCTTTAAGAAGGGGAAAAGGCACAAAGGTCGCGGACAGATAAATATTCCTCTCACCGTGCTGGTGCTGCCGGGGCTGGTGTCCGAGTCGAGGCGCAAACCCATCCGTAAAGCCAGGGAAATCCGTGGCCACCGTGACATCGGTAACCTTAGGCCATCCTTCAGTTGATGGACAGCGCAGTGGGGGGCAGTCCCTGATCGCAACGACCGTTCAGGAGGAGCTCCCGACTTTCGAGATCCCCACCAGAGAGGTCGGTAACCCGACCCATGGTGACGGAATCTCGGTCCCGTCAGTGGCAAGGGGTGAGCACGCAGGCTAACGCCGTTGGCGACTTTATCGACTGCAGCGATGCTGGCAGGGGTGGAAAGTAGCTCCTACAGCATCTACGACCACACTGACAAGTCCAGAAGACGATGGACCACATCGCCGTACATCGCAAAGAACGGGAGGGAAGTCCCCAGCTGCGGATTCCCCTCATCGGTCTTCAGGACTTGACCACTGCTCTCCAGAACGAAGACCTGAGGAACACTTACCAGGATGAATGGCAGATGAAATTTTCTATCACATTCGAGACCCAACGACACATGAGAGACAAAGGGCACTTCCGAACTCTCAGCCCTTAACAACAGGGCGATAGAGCTGTGCGAAGGTACTACTAGCGAGCACCGCGAAGAGCAGCGCGCAGACGGAGGTACAAAGCCTACCGGAAACCACAAATGCCGCACCCACGGTGCAGGTGCCAAGTCAGGCGCCGAAGCAGAGCAACCCTACGTTGGATGGCAACGGAGAAAATCCACATACCTAACGGGTTAAGCCAGGCAGCTTCATCTGTCGCCAAAGATGCTGCTTACGGGTGCAGAGGCACTCATCGTAAAGACTTGGGGAGGAGAGCTTCGTACTGCCAAATGCTTCGGAAGCTAAAGGTCGGAATCGAGCCTTAGCGAACTGGGCAGTCACGATGCGAAATCCGGAGAACGCGAAGGTGATCTGTTGCTTGAGGGTAGGGGAAAGCTTCGGAAAGCGTTCCCCAGAGTTTAGAAGCGACCTGGAAGCGGCGCTCGTGACTTAACCTCTGGCGCACAGGGCACAGAATAAGCTCATACGGCGGATTGGACGACAGCGAAACTCCACAGCTGCTTGTTCGCCCCAATTCCAGAACTACGAAGATAAATCGAAGATATCGGGGGCCTTCACGGTATGCGGAATTGCAAGCAATAGCCTCAGTGCTGCGCAGGCGCGACGTTGCGATACCAGTCCTTAAACGAGAACTTTACGCAATGTTGGATGGTCAAGATGTCGTATCACCCAGGACGTCGACCCACGAGATGCTACGGAATTATTACCGGCTATGGGCATCGATCAGCAACCTGCAAAGGTTTGACGGGGCAGACTGCTGTGTGACCGGTGAGCGGGCACAAGGCAAAGGGGTGCGTTGCTGCACCAAAATGCCTGATCTGCAGCAGCGAGATTGGACGAAACCACCCGACGGGTAGCTTTGCGTGCCCGACTGCAAACGACAGGAGTAAAGAGCCACCTTAATGCACGCTCATATTAGCGCAGCTCATGTCAATCATTGCGCAGCAACTCAAACCTCCTGGCCCAGACTGCGGTTGAGCGCAATGTAGACATCACTCTAAAACGACCCTACGTCTCTGGTAGTGGACCAATCGTCCATGATCGCTTGACGAGGAGCAGAAGGGTAAAACGCTATCAAATGCGGCTCTTCAAGTCCACGGGAACTGGCTGCTTTTGCCAGCGGGGTATCGCTTATGCGAAGTTAAAACACGATGCACATGTACGCTGCTACGCTCCGCCGAGCACTGACACCCCGATCGTTCTGAGGAGCTTCTGCGACGCTCGTGGACCATCGCGAGAGGGGCTGAAGCCCAGAGATATTACCGGCACTTTAATGCCTGGACAGTGGAATGGGGCAGCAGGACATCAACACCAGAGGACGGTGTGATTGACGCCGTACGATACTGGACCTCGCCTGCTGAACGATGGACCGACGTTTAACGATAGGGTACGTCCTTTATTGACGTTACCTTTGTCAGCAGAGGGCTGGTGACAACAACAACTGGATGGTCCATGACGTCATGACGCTGAGCGACCATGCCTGATCATAGCGCCTTCTCCCCGGAGGTACTTTAGACGGCAAGGTAGACAGCCGAGAACGCTGGGACACCGGGAAGATCGATGAGGCCATGCTGGCCTATCGAGATCAATTCCCTGAAATCCCAAATGTGGACGCAGAGTATGGCGGCAGGCCTCGCATGAATATGCTGGGAAGAATCTGCGACACGCAATGAAATCATACCAGAAAAATAAGGCACGGCGCAAACCGCACCGTTTACTGGTGGGTGCCTGCAAAATGCCAACACGGTCTACTCAGGGCTAAGAGAACGGCGCAACGAGCCAGAGGCAGTACCACCACGCAGGACTTCTTGGGGAGGCTTAAGAAGCAAACGCCTAGAGTTCAGCACACGGCATCGCGGCTGCAAAGCGCGGTCGTTTAAGGAGCTTTACGGGATGGCGTGAACAGCGATATCTGGAGGACTGCCTGAAAGCGGCACCAACGAGCTTCAGGAGAGCGGCGGCTTCCACATCCGACGGTCTGGCTAACATACTAGAACTATTTCCCAAAGCAGACCACTTCCGCGGAGGGGCAACAGAGGCAGCCTGCCCCAGATTTGCCGTCGCGTCACAGACACGAGAGTCGTCCGGGCAGCTGTTTCTGGCTGACGATGTGGCAATCACAGCCGGGCTAGCAATAGCGGCTCCACAAGACCGAAGCAGTCCTACTAAGCAGCGGGAAAAGATGGAGAACATGCTGGTCTCCGTCAAAGGGGTACTCAGGGGACCTCTCAAAGAGTCCCCTACAAAGATACCTGGGGGTAATGTCGTCCGCAGACCTTCTCGTTCAAAGGATATTACGGCTTCCCTTGCCAGAAGACAGCGATTATCTTCGTTGGCAGGAAGCATACCCGTCCGGAGGGCCAAGACACCCGGCCAGGAGGCACGCGGTGTCAGTAGCAAGGCTTCGCTTTGCTATACGCTGCACCAGTCAGACGAAAATATGCCGCTTTGCAGGGTCTCGCCTGAAGAGGAGGCTCGTTCGGTGCTACGTTCGGCGGCCTCAGGCTCGTGCCGGGATTCGGGACCATATCCGAAGACGCGGCGCTAGCGCTGGCGAATACCGGTGATCTGGAGATCAGGGCTCTCAGCCGGGTGGTGGCGCTTCCAGGCAGAGGCGCACGGTGGCTATTGGGTGAGATAATGGCAGGTGGCAAACGTCGCGACGGGGAGGTGGACCTATCAGCTCATCCCAGAGATGACGGTTTGGGCAGGTGACACTTTCTCAAAGTGTGTAAACTTGGAATTTGTTATTTATTTTCTTGTATGTTGATGTTTTGAATTTGTTTTTTAATTTATAAGTAAAATATATATTGTTTACAGTATATTTCCTTAAAAAAATTGCGTTTAATCAAACAAATAACCGTTAATTTTGACCTTTAAAGGTCAAAATTCAACATTTCACGGTGTGTAAACAGTTTCTTGACAAACTGTACTTGTCACCTTGAATTTATTTTAATTTCAACGACCGTTTTCATTGCATGTCACTTCTTTCATTTTGCATATTATTAGAACACGCATTCTCTACCTTGCAACAGCGTGGCAAATAACTGTTCAAAACAAAACCTCCGCTTCTCTCCTGTCCTTGTCAAACTCACTGGGACTACCAGTCAAAGGTGTTGTCGGTGAGCAGGATGTGAATGCCAAAGTTGCACACCATCTTCTTTTGCGGTGCACAGCAGCGCCTTTTTTACCAACTGAGCGTACCAGTCGTAGAGTTCTTGCCCACTCTCAACATACGGGGTACTCCTTATCACCGATTGGGGTGGTCATCTCGTCTTACGGACACGCTTCATCATGGTGACGATGATCACGTGAGCCCCATCCCAAACGATTTTTGTCGCCATCATAGCAGCAACCAAGCCTCTCGGGCTGGTGACCAACGAGCGCCACGAGTTGCGCCCTCTCCTCTGAACCTGGGGGGGGCAGATTTTTAGTAGGATGTGCTCTACGGTTTTCCACTGCGTCTGTGCAATAAAGGCACTGGGCGCAACGTCCACGTGGCGGAACCTACATGATACCCTCGAAAACAGCCATGGTCGGTACGGGGAACTGGGTCATGTGAGCGTCCACTGCGTTTTTGGCGCTCGCAATCAGCCCACTCCGTTGGTTGCGGAATGAGTTTGTAAGTCCAGCGTCCCCGTTGTGACTCTTGCCACTGGTCTGCCATACTCCTCGAATCCGCTCTTTGATCTCCCCATTTGAATTTCATCCCTCACTTTCACCAAAGGTATTTGCCCACTTTATGTCCGGGTCAATGGGTGTAATGCCTGACAGAGCGTGCGCGCGTCGTCCATTATGGTTCTAAAACCTCTGATTATGCAGAGGAAGCCATTGTCCGTGATACTGCGCGGGCACTATCTAGATAGGTTTTCTTTGTGGAAACGCAGCTCAAGATAGGCGCAGCATAAAGCAGTGTTGCCTTGAAACCGCCACTAACAGTCTCCTAGCCGGCAGTCTGGGTCCCTACGTTGGGCATGATTCTCGCCAAGGCTGCTGTCATTGCCGCTTTTGCTGGCATACCTTGCGTGAGCCTTGAACGAGAGCCTTCGGTCTGTTAGAACATAAAGGTATTTCAACGTTCTGCTGAGGCGATTTCAACTCCTTTGACTTCCACACGCATGCTCAACGGACTTTCTGCTGTTCAGCAGGACTACCACTTCGGTCTTATGAAAAGCTATTTACAGATCCGACTTTCTCGAGCCATTCTATGTGGCCGCCGTGATTACTGCGTTGCTTGTGTCCTGGGCTCCGGTATTGTCTTGGCGACCGCTTTGTTATCACTGCGTCGTCGGCGAAGCGGTGCAGCTCCACACCTCTGGGCTTGCTAATGCTCAGTATTCCATCATACATAATGACTTCCACAAGATCGGTTCTAATTTATGACCAGCGGGGAACACCATAACAATTGGCTTCTTGGACCATCTTCTGTTACGTACCATAACACGGTCCTGAAGTAGTTGCCAATTACGCCTCGTATGTAGTCGGGAACGCCCAGAGTTGCGCATAGCCCCCCGGATAATGGGCCATCTCGCTGTATTGAATGCGTTCTTGACGTCTAGCGTGATGATGGCACGAGTACTTCTTACACCGCCTAACATCGGTTACCGTCGAGTGCTTTCCTGGCAGCGTCTGTTACGGATTTGAGAGCGTCAGGCGTACTTTTTACCTTTCGGAAGCCATGCTGTTGGCCCTGAAGGCCTGTAGGACTTTCGGTGATTAATCAATGCGCGCGTACGGTATGCGCTCAAAGAGCTTGCCCAACAATGTCCAACAGACACAACGGTCGGTAACTGCATTGGAACATTTGCGGGCCCTTTCGGCGAAGGACCAGCTTCATCTTTTCAGCGCTGGGGAAGACTCCGTCCAGCGGTACTGTTGGAATGTATCCTGAAGACCTCCGGTCTTGCGGTGGCAACTGCTTCGATCACGCCGGGATACCATCCAATGCCGGAGCTTTGTTTGGTCTGATCCTCTTTGCTGCTTCGACGACTTCGCATGACGTGATGCACGGGAAGTCAGAGGCGGAAGTCATAACAGCGGGTTGCCGCATAACGTGTGTTGGCTTGGAAATATCCGACACGATATGTTGGCCAGGGCGGCTATGAGTCCTGAGAGATCCTGCACCAGCGGAATTGAGTTTTCACTTACGACTTTGTAGGCGGGAACTGAAGTGCGTCGTCTACGCTATCAATCAGGTCGCCCAAATGCATTCGCCTTTTGCTGCTGATATGCCGTTCTTAAGCTCAGTTCGCTTTAACTGCCATACCCTCAATGCACTGGGAGTGGTGCGTTTTGCCCTCTAGATTGCTGCGCGCACTCCTCGCCTTGATGCATTCCGTCCACGGCTGGTTGCAATAGGTCGCTTCCTGGAAGCTAGACGGGGGGCTTTCGTTTCGTGTTCCTTTCTCGGCATCACCGCATCACACATTGCTCTAAGCCTATCCATGAGCGCTGCCACCATGGTCTCCGCGTGTCCAATTATGGACTCCATGCCCTCGATCTGGTATGCCAGCATGTCTTCATCCAGTTTCCTAATGTCCCATACCGGACCTATAGCGCACATGCTTTGTTTTGGTGACGGCCTCATTGTTCGGGCACCGAACGTGATTAGGATTGTGGTCGCTCAGCGTTATGTCCTCATGGACCATCCAGTTCGAGCTAGCCACTAGAACTCTGCTAACAAAGGGTATCAATGAAGATGTACCTCTGTCATTATTGAACGTCGGTTTGAACCGTCGTTTAACAATACAGACTAAACGGAGTTCATGGCATCGATCACTGCTCGTCCTCTTGTGTTAGAATTCGACTGCCCCATTCTGTAGCCCAGGCATTGAGGTCACCTCCGATGACTGTTGGTCTGCGCCACTTGCATGGTTAACCAGCTTTTCGAGCATGTCCTCAGGTGTTCAGGACTGTTGACTTAGGTGAACATAGCAGCTGTAGGGATTCCGCCTAATTTTGTGGCGTATGCTATGCACGCGCATTGGTACGGTATCCGCTCCTCTACCAAACTAGCCTGGATGTACATTTAATAGCGCCTTGCCTGTCTCATCGAGTAGCACTCCTGGAGTTACCCACCAGGGTGGTGCGGTTCACTTTCCACTACGTCCGCATGGCGCTCCTTCATGTTTGAGTCAGGAGGTTCTATTAACGCTTTAGCATGATGGTTAACGTTGAGCTGGATGATGTTAATTTCTTCTGGCATCATTTTGACGGCTATTAGCTCCTTTGGTGTTGGCTTTGTGGGTGGGGCATGCAAACCACCCGTCGCGTGGTTTCTTGTCCACGTCACTGCTGCAGATCGAGGCATCTTGGTGGGCTGCACCCAGCCTTTGCCTTATGCTCGCCACTTTACCAGCCGAGCTGGCAGCAGTCAGAGCGATCGACTGACTTTACGGTAAAGAGCTCGGTGGCGAGTGAGGCATCTGAAGCAGCATCTTGGGCGGACGTCTTGGGCTATCCGGCAGCGACGTATCGATTTTAACGCCCGGTTTGATGACCGCAATTAGCATCGTTGCGCACATTAGCACGAGGCTATCTGGTCCCCGTCACGCATCCTGCGAAGGCCTCTTACATCCTCTGGTTCCAGGCGGATGCTGAAGTGGAGACCAGGGGAATTATGAGGTCCTGAGCCGTCGTTGTCTCGTCAGTCCGCTTTGCAGATTAGCGCAGTCTATGCGCACCCATTGCATTTCAAGCAATCTCTTTGAGCATCGCTTCTAGCTCATTTAAAGCTGGGGTTTCGATTTTGCGTTGCGTTTGGTGGAACTGGATTTACTACGCTTTCATCTTCCGAAGCATCAGTACGTAACTCACCGTTTTTTTTTTTCAGGATTAGCGCCTCAGGTTTTGCGCAGGCGCGGAAGCTTCCTGTAGCCCATTCCTCGTCCTTGTTAGCGTCCTTGGCGACAGACGCACTCCGGTTTGGAGTCGGCACCGTCGTGGGTAACGCCTTACCGGTGGATTTCGCGGCAGATCGATGGTTGTCCGTTTTGCGGACCTGCACATTCGGTAATGCCTGTCTGGGTGGCGCCACCTGGCTACGCGTTTTTTCTGCCTCGGTCTGTGTGGCAGTACACTCAGGTGGGGGCTTCTTGTTGATACCCTCCCGCAGCAACTCAATCGCTCTGTTGACGCTTTGAAGGCGCCGATAGATAGCACGCCCTATCCTCGCGCTGGTTACGTGACGCTGGTCTCGAACGAGGATAGAATGGCGGTGATCTTGGCTCATCATGTCCAGGATGCCCTGCAGGTCCTCATTCTGGAGCGTCGTGGTCAGTTCTGGCGAGCGATGCGGCGATCTGATGGAACTTCGCTCCCGCCCGCTTTGGGCCGGCACGCTGATGAAATCCATTGTCTTCAGGCTTGTGGCTGTCGTGGAACTGTAGTGGCCAGAGTCTCCCACCTCCACAACTACGCACAAGTCGCTAACTTTCGGCGGCGGGGGGGCCTGCTTATCACCTCCACTCCCCTGGACGGGACCCGACTCCTCTTATGGGGGGGATCTCGATAGCCACCACTCCTCCTAAACGGGTCGTTGGGGTCGGGGGGCACTACCCTGTGCTTTGTCCATCCAGATATAAAGGGGGGACTTTGGCTTGTTGGTCCCCAGCGCTCCGTGGGAAATAGAACTAGCTTCAGTTCTTGGGTTATATTTAAAATTTTGTTCAATAGTGGTTCAAATTTGAATTTGAATTCGAATTTCGCGCCAACGAGCGCGCGGCCGAATGACTGATCGCACGCGTCTGGCAACGCCAGATCTTACCAGCTCGTCGACTGCGAAGGTTGGCTTGATATATCAGCTGCGCATTGTCTGATGCGGCTGATCTGATTTAATCCTGTTGGTTGCTGGTCACTCGTGAATTCCGGAACGACACCGTGACGCTCAGAAACGCGGCGCAAACCCAGAGTGGATTTACGGGTTTATGTGTTGCGGTTACGGCTGACGGACTCGTATATGACGAAATTCGCGCAGCGCAACAAAAGACGTGCGAAATACGCGGGAACTCGATTCACTATCATGCCATAATATTGTTGGTATTGGTATTGTTGGTATTGAATTCAGTAAGTCTCAAAGTGTGTTTGATTGCGGGTAGACGCGGGTTCTACGCATTATTGCAACGTTCGTTCTGCACATTAAGTTTTGATCGCCGAAGAAGACAGACATGCCTCGCTCCCGAATTAAACGCGTCGAAAACGTTGTTACGACGACGGGTAGAGAGTGATGCTGGTGACAAAGTGATTCAGATCCCACATACTTAATGCAAATAAGTTTATTTTCAACTTTTTCTATTGTAAAATGATATTTTTTATGTCTATGTGCTTAATAATTCTCTTGTGGCAAGTTGGGTTATTTGCAATACTAATGCAACCTGGACCTTTTAATTCTGGTGAATTTCTACCAATAAAGAAGCTTGCGATGCGAGGCTTCTCCTAAAACAACTAAATAAGGCCATGTAATCTGCTTCGGTGGATGAAGCTGCAACTGATTTTGCTTCATTGTGTTCCATGAAATTAAGCAACTTTCAAACAGTTTAAATAAATATCCAGTAATTACACTTCGTCTGTCTGTCTCATTTCCTGCCCAATCAGAATCAGCATGTCAATAAGAATAATACTAAACTGTACACTTTCTCATATTTCAATCTCAAATCAACAGTTCCTTTTAAATACCTTAAAACTCTTTTTAAAGGCATAGCCATAATTCCTTATTGTTATTCGAATAATATCGACTTAAAATACTTATTGATCCAAGTTTCTACATGGTGCCTCACATGATTCTACAGTTAGCCAGAGCCTCATAGTTGATTTGCTTGGAAAGGGTGTACTAACTGCATTACAGTCTTCCATATTAAACTTTCAACACATTCTTTATATATGCAGATTAACTTTGAGAACATATCTGACTTTTATTTTCTATCAATTTTAATTCCGATAAAATATCGAACTTCCTTCAAATAGAGTCATTTTAAATTTATTTAGAAGGTATGATTTAGAATTTGAACCTAGTTTCAGTTTAATTGGCAATTCATACATCGTCACATATAACAAAATATAGATATTATCTAGAATTTTCCTTTATCTAATATAATATTAGATTTTCAAATACAACATCTTTTCGCACACATTTTTTCAAGCACTTCAAACCAACCAGCATCTTGCGAAAAGCTTTGTTTTACTGCGCATATTTTGCTTTATTAAGCTTTTGCATTCTGCATTCTCATCGCAATATATGGCAACCCTTTGGAGTTTCTTCATGTAGATTTCATCTTGCTCACC
->813565c4-b858-4289-979d-ed8db9603825
-TTGGTATTACTTCGTTCAGTTACGTGTGCTAAAGGGTGTACAGTTTAGTATTGTTCTTATTGGACATGCTGATTCTGATTGGGCAGGAAATGAGACAGACAGACTGAAATTACTACTGGATATTTATTTAAACTGTTTGAGAAGTTGTTTAATTTCATAGGAACACAATGAAGCAAAATCAGTTGCAGCTTCATCCACCGAAACAGATTACATGGCCTTATTTGAAGGTTTAAGAAGCCTTATGGCTCAAGTTTTTTTATTGGTAGAAATTAAACTGAATTAAAGGTCCAGGTTGCATTAGTATTGCAAATAACCCAACTTGCCACAAGAGAATTAAGCACATAGACGCGCGTCTCATTTTACAATAGAAAAGGTTGAAAATAAACATTTGCATTAAGTATGTGGGATCTGAATCGCGCATACTCCAGCATCACTCTCTACCCCGTCGTCGTAACGTTTTCTGACGCGTTTTAATTCGGGGCGAGGCATGTCTGTCTTCTTCGGCGATCAAAACTTAATGTGCAGAACAGACGTTGCAATAGTACGTAGGGCAAGTCTACCGCAATCAAACACACTTTGGAGACTTACTTCCTCCCACACACTAATACCAACACACATTATGGCATGAATCGAGTTCCCGCGTATTTCGCACGTCTTTTTTTGCTGCGCTGCGCGAATTTTAAAATTATATACGAGTCCGGTCAGCCGTAAACTGCAACATAAACCTGCAAATCCCTCTGGGGTTTTGCGCCGCGTGCAGGCGTCACGGTGTCGTTCCGGAATTCACGAAAAGTGATCCAGTAAACTGGTAATACGTCAGATCAGCTGCATCAGACAATACAGCTGATAGCATTGCCAACCTTTCGCAGTCGACGAGCTGGTAAGACTGGCGTTGCCAGATCAGCGGTGCGATCGTCATTCGGCCGCGCGCTCGTTGGGCGCGAAATTCGAATTCAAATTCAGAATTTGAACTAATTAAGTTGAACAAAATTTTAAATATAACCTAAGAACTGAAGCTAGTTCTATTTCCCACGGGCGCTGGGGACCAACAAGCCAAAGTCCCCTTTTTTTATATCTGATGGACAGCACAGGGGCAGTGCTTGCGACCCCAACGACGTTTAGGAGGTGGTAGGCTATCGAGATCTATAAGAGGAGTCGGAACCCACAATCCGGGGGGTGGGAGGTGAGCAAGCAGGCCCCCCCGCCGCCGGCCCCAGCGACTGCAGTGCAGCTGTGGAGGTGGAGACTCTGGCCACTACAGTCTCACGACAGCCACAAGCCTGAAGACAATGGATTTCATCAGCGTGCCCGGCCCAAAGGGGCGGGAGCGAAGTCCCCATCAGGATCGCCGCATCGCTCGCCAGAACTGACCACGACGCTCCAGATAGCAGGGACCTGCAGGGCATCCTGGACATGATGAAAGCCAAGATCACCGCCATTCTATCCTCGTTTCCGAGACTAGGCGTCACGTAACCAGCGAGGATAAGGGGCGTGCTAGTGGACCTATCGGCGCTCAATAACAGAGCGATTGAGTTACAGAGGAGGTATCAACAAAGAAGCCCCCCCACCAAGAATTACTGCCACACAGACTGAGGCAGAAAAAAAACAAAGAAAAGCAGCCAGGTGGCGCCACCCAGGTGGGCATTACCGAATGTGCAGGAGTCCGCAAAACGGACAACCATCGATCTGCCGCGAAATCCACCGGTAAGGCGTTACCCACGACGGCTGACTCAAACCGGAAAGTTATGCGTCTGTCGCCAGGACGCTAACAAGGACGAGGAATGGGCTAAGGTGAAGCCAAGCGCCTGCGCAAAAAAGAGCCTGAGGCGCTAATCCTGAAAGAAAACGGGTGAGGTTACGTACTCGGATATGCTTCGGAAGATGAAAGCAGAACCGAGTCTGACCGGGAATTCGGCAAGCACGTGCGTAAAGATAAGGAGGACGCAACCCAGGAGAACTACTTCTTGAATTAGAAGGCAAAGCCTCGGAGGTCATCCCAGCTTTAAAAATGAGCTAGAAGCGACGCTCAAAGAGATTGCTTCGGTTCACTTTTGAGCGCTGGGACTGCGCTAATCTGCAGCGGACTAAGACGAGACAACGACGGCTCAGGACCTTCATAATTCCTGGAGAGTCTCTCCCAATTTCCAGGGCATCCGCCTGGAACCAGAGGATGTAGAGGCCTTCGCAGGATGCGTGACAGGACCCAGATAGCCTCTGTGCTAATGTGCGCGAACGATGCATTGCGGTCATCAACCGGGGCGTTGTAGCGCGCTGTGGGATGGTCGCGTTGCCGCATAGCCCAAGACGTCCGCCCAATAAGATGCTTCAGATGCCTCGAGATTCGGCCGCGAACCACTGCGCAAAGTCAGTCGATCGCTCTGACTGCTGCCTACGGTGCAGCGAGCATGGGCATAAGGCAAAAGGCTGCGCATGGCCCACCAAGATGCCTGATCTGCAGCAGTGACGTGGACAAGAACCACGCGACGGGTGGTTTGCATGCCCCACCTACAAAGCCAACACCAAAGGCTAATAGCCGTCAAAATGATGCCAGAAGAAATTAACATCGGCCCAGCTCCAGCGTTAACCATTGCGCAGCAGCACAGAACCTCCTGACTCAAACGGCGGAAGGGCGCCATGCGGACGTAGTGCTTTTTAGTGAACCATACCTACCTGGTGTGGGTAACTCCAGGAGTGCTACTCGATGAGACAGGCAAGGGCAGCCATTAAATGTACATCAGGCTATTGGTAGAGGTGGGATGCCGTACCAATGCGCGGCATAGCATACGCCAAAATTAGAATCCCACTTCTACAGCTGCTATATGCTCCACTGGCGGCAGTCCCGAACAGTTCGAGGACATGCTCGAAAAGCTGGTTAACCATGCAAGTGGGCGCAGACCAGCAGTCATCGGAGGTGACCTCCAATGCCTGGGCTACAGAATGGGGCAGTCGAGATCTCTAACACAAGAGGACGAGCGGTGATCGATGCCGCTGAAACCTGCTGCTAGATCTCGTATTGCTAAACGACGAATTAGGCGACGTTCAATAATGAAGAGGTACATCTTTCATTGATGTCACCTTTGTTAGCAGAGTTCTAGTGGCTAGCTCGAACTGGATGGTCCATGAGGAACATAACGCTGAGCGACCACAACCTAATCACGTTCGGTGCCCGAACAATGAGGCCAAATCACCCAAACAGCGAAGATGTGCGCTAGATCCGGTATGGGACATTAGGAAACTGGATGAAGACATGCTGGCATACCAGATCGAGGCGAGTCTATAGTGGACACGCGGAGACCATGGTGGCAGCGCTCATGGATAGGCTTAGAGCAATGTGTGATGCGGTGATGCCGAGAAAAAGGAACACAGAGAACGAAAGCCCCCTCATCTGCTGGTGAGTGACTCATTGCACCAGCTTCGGACGAATGCATCAAGGCGAGGAGGCAAGCGCAGCGTCTAAGAGGGCAACCGCACCACTCCCAGTGCATTGAGGTATATAAAGCAGAAGCGAACTGAGCTTAAGAACGGCATATCAGCAGCAGGCAGATGCATTTAAGGACCTGATGATTGATATGGCCAAGGCGACGACCCCTGGGGTCTCGCCTACAAAGTCGTAAGGAAAAAACTCAATTCCGCTGGTGCAGGATCTCCCTCAGGACCCAGCCGCCCTGGCCCAACATCGTGTCCGGAACTATTTCCAAGCCAACACACGTTATGGCAACCCGCTGTTGACCCCCGCCTCCTGACTTCCCGTGCATCACGTCATGCGAAGTCGTCGAAGCAGCAAAGAGGGGATCAGACCGAACAAAGCTCCCGGCATTGATGGTATCCCGGGCGTGATCGTCAAAGCAGCCGCCACCGCAAGACCGGAGTCTTCAGGGGATACATTCCAACAGTGTCTGCTGGACGGAGTCTTCCCAAGCGCTGGAAAAGATTAAGGCTGGTCCTTCTGCCGAAGGCAAGGGGGGGCCCGCAAATGTTCCACGCAGTTACCGACCGTTGTCTGTTGGACGTGTTGTAAGCTCTTTGAGCGCATACTGTACGCGCGCATTGGGCTGGCACTGAAAGTCCTACAGGCCTTCAGGGCCAACGGTATGGCTTCGAAAGGGTAAAAAAGTACGCTCGACGCTCTCAAATCCGTAACAGACGCTGCCAGGAAAGCACTCGACGGTAACCGATGGTTAGGCGGCGGTAAGAGTACTGTGCCATCATCACGCTATGAACGTCAAGGAGCATTCAATGCAGCGAGATGGCCCATTATCACTCAGGGCTATATGCGCAACTTGGGCGTTCCCGACTACATACGAGGCGTAATTGGCAACTACTTCAGGGACCGTGTGTTATGGTACGTAACAGAAGATGGTCCAAGAAGCCGCAAGTCTGCAGGCGTTCCCCAAGGGTCGGTACTGGACCGATCTTGTGGAACATTATGTATGATGGAATACTGAGCATTATAAGCCCAGAGGTGTGGAGCTGCACTGCTTCGCCGACGACGTTGCGATAACGGCGGTCGCCAAGACAATACCGGAGCTCAGGACATAAGTAACGTGGCAATCGGCGGCCGTAAATGGCTCGAAGATCGGACTTAAAATAGCTGCATAAGACCGAAGTAGTCCTGCTGAACAGCAGAAAAGTCCGTTGAGTGCATGCGTGTGGAAGTCAAAGGAGTTGAAATCGCCTCCAGGCAGAAACGTTTGAAATGTCGCCCAGTGACCTAATAGACCGAAGGAGGGCTCTCGTTCAAGGCTCACGGGTATGCCCAGCGGCAATGACAGCAGCAGCCTTGGCGAGAATCATGCCCAACGTGGGAGGACCCGGACTGCCGGCTGGGGACTGGTAGTGGCGGTTTCAAAGGCAACACTGCTTTATGCGCCTATCTGGGCTGCGTTTCCACAAAAGAAACCTATCTAGATAGTGCCGCGCGATGTATCACGGACCAAAGTAGCTCTCAGGCTAATCCAGGGCTTTAGAACCATATCGGACGACGCAGCGCACGCTCTGTCAGGCATTACACCCGATGACCTGGACGCAAGGGCAAATACCTTGCAGTGGGGATACACTCAATTAGAGATCAAAGAGTGGATTCGAAATTATGGCAGACCAGGTGGCAAGAGTCACAACGGGGACGCTGGACACAAGCTCATTCCACCAACTAACGGAGTGGGCTGATTGCGAGCAAAACGGTGGACTACCACATGACCCGGTTCCTCACGGACCATGGCTGTTTTCCGGGGTACCTATGTAGGTTCCGCCACGTGGATACAACCCAGTGCCTTTATTGCACAGACGCGAGTGAAACCGCAGAGCACATCCTACTGCACTGCTCAGGTTCGCCGAGGAGAGGGCGCAACTCTGGCGCTCGCTGGAGTCACCTCTCAGCCCGAGAGGCTTGGTTGCTGCTATGATGGCGGACAAAATCGTTTGGGATGGGGCTCCGCGTGATCATCGTCACCATGATGAAGCGTGTCCATGGACGAGATGACCAATCTGAACTATAGATAAGAATTACCCCGTATGTTGGCAGGGCAGGGAACTCTACGACTGGTACGCTCAGTTGGTCGTAAAAAAACGCTACTGTGCACCGCAAAGAAGATGGTGTGCAACGGCACCACATCCTGCTCACCGATGCGAAATACCTTGACTGGCAGTCGGTAGGCTTGACAAGGGACAGGAGGAGAGAGCGGAGGTTTTTTGTTTTAGAAACAGTTATTTGCCACGCTGTTGCAAGGGTAGAGAATGCGTGTTCTAATGGCACAAATGAAAGAAATGGACACGGTAACAGAAAGAAACGGTCGTTAACGGGGAATTAAAATGATCTGCGACAGAAGTACAGTTTGTCAAGAAACTGTTTTACACACCGTGAAATAAGTTGAATTTTTTTGACTTTAAAGGTCAAAATTAACGGTTATTTGCTTGATTAAACGCAGTTTTTTTAAGGAAATATAATTAAACAATATGTTTTGCTATAAATTAAAAAACAAATTCAAAATATCAAATATACAAGAAATAAATAACAAATTCCAAGTTTACACACTTTTGAGTGTCACTCTGCCCAAACCGTCATCTCTGGGATGAGCTGATGGAGTCCACCTCCCCCCGTCGCGACGTTTGCCATCTGCTCTGCCATTCACCTAATAGCCACTCGTGTGCCTCTTGCCTGGAAGCGCCACTCCCGCGCCAGGCTGAGAGCCTTGATCTCCAGATCAATCAGCAGGCCTGCCAGCGCTGGCTTCGCGTCTTCGGATATGGTCCTGGATCCTCTAATGAGCCTGAGGGCCATTGACCGTAGCACCGAACGAGCTCCTTTCAGGTGCGGGGCCCTGCAAGTGGCATTGCTCCAGACTGGTTACGGCGTATAGCAGCGAAGCCTTTGCTACTGACACCAGCGGTTTCCTGGCCAGGTGTCTTGGGCCTCCGACGTTGGGCTCAGCCTCGCCAACGAGATGTGACTGCTGTCTTCTTGCTGGCGTAGCTCGCGTGAAAGTCCTTGAACGATAGTCTGCGATCTATCGTACCCCAGGTACTTTTGGGGACTCTTGGGGAGGAGTCCCCTGGGTACCCTTGACGGAGACCAGCAGCATGTTCTCCATCTTTTTTCCTGCTGCTTAGTAGGACTGTTTCAGTCTTGTGACCGCTATTGCTAGCCCGGCTGTGATTGCCACATCGTCAGCGAAACAGCTGCCTCGACGACTTCAAGTTCTGTGACGCACGGCAAATCTGGGGCGGGGCTGCCTCTGTTGGCCTCCATAGTGTGGTCTGCTTTGGAAATAGCTCCCCTAGTATGTTAGCCAGGACCCCGGGTCGGATAGGACACCGCTCTCCTCAGCTCGTTGGTAACAAGCAGGCGAGGCCCCAGATATCGCTGTCTACGCCATCCTGCAGCTCCTTAAACGGCCACTTTGGCGGCCGCGATGCCGTGCTTGAACTCTAGGCGTTTGCTTCTGAAAGCCTCAAGAGTTCCGCGTGGTGGAATTACTGCCTCTGGCTCGTTGCGCCGTTCTCTTAGCCCTGAGGCAATCAGACCGTAGTTGGCTTAGGGAGGCACTCCACCAGTAAACGGGTGGTTTGCGCTTTTAATGCCTTATTTTTTTCCTTGGCATGATTGCGTCGCAGGTGCCCCAGCATATTCATGAGGCCTGCCGCCATACTCTCTGCGTCCATTTGGGATTTTCCGGGAATTGATCTGATAGGCCAGCGCCGGCCTCATCGATCTTCCTGGTGTCCATAACAGCTGTTCTACTCTGCCGTCTTTTAGGCATGCCCTCCGGGAGAAGGAGATCAGGGCATGGTCAGCTCAGCGTCATGACGTCATGGACCATCCAGTTGTTGTTGTCTACTAGCCCTCTGCTGACAAAGGTAACGTCAATAGGGACATGCCCCTATCGTTGTTAAACGTCGGCTTCCGTCCATCGTTCAGCAGTATGAGGTCCAGCATTCGCATGGCGTCAATCACAGCTCGTCCTCTGGTGTTGGATGTCCTGCTGCCCCATTCCACTGTCAGGCATTAAAGTCGCCGGCAATGACCTTCGGGCTTCGCCCTCTCGCATGGTCCACAGGCGCCTCCAGAAGCTCCTCGAACTGATCGGGGGGGTGTCGCTCGTAAGGCCCGTAGCGGCTGTACATGTGCGTGTTTTAACTTCACGCATAAGCGATACCCGCATGGGTAAAGCAGCCAGTTCCTGGACTTGGAAGGCTGCAGCATTTGATAACTGCTTTACCTGCCTCGTCCAAGGATCATGTGGACGATTGTCCACTACCAGAACGTAGGGTTCAGCAGGAGCATGATATCTACATTGCGCTCAACCGCAGTCTGGGCCAGGAGGCTCTGAGCTGCTGCGCAATGGTGTTAGGCTGTACTACGCTAATATGAGCGTGCATTAAAGGTGGCTCTTGGCATCTTTTAGTGTCGCTCTGTAAGTCCGAAGACACGCAAAGCTACCCGTCGGGTGGTTTCTGTCACCGCTGCTGCAGATCAGGCATTTTGGTGCAGCAACTGCACCCCCCCTTTGCCTTGTGCCCACGCTCACCGCATCTAAGACAGCAGTCTGCCCCTGTCAGTGTCCTTGCGGGTTGCTGATCGGTGCCCATAGCCGGAACACCTGTAGCATCTCGTGGGTCCGGACGTCCTGGGTGATACGACATCTTGACCATCCAACGATTATGGTGCCCTGTTTAAGGACTGGTATCGCAACGTTCGCGTTCAGCAGCACTGAGGCTATTTGCTTGCAATTCCGCATACTGCGAAGGCCCTGATATCTTCAGGATTTATCTGCGGAGCCCTGGAATTGGGCGACCAAGCAGCTGTGGAGCTTCTCTGCTGTCGTAGCCTCGTCAATCCGCTGCAAGATGAGGCTATTCTTTGCGCTCCTGTGCGCACAGGAGGCAAGTCATTGACGCCGCTTCAGGTCGCTCTTAAACTTAAAGAGACGCTTTCCGAAGCTTTCCCCTCTACCTCAAGCAACAGATCACCTTTCTGCGTTCTCGGATTTTCGCACGTGACTGCCCAGTTCGCTAAGGCTCGATTCGATCTTGGCTTCGAAGCATCTCTGCGTACAGAGCCTCTCACCATCTTTTTTACGATGGTGCCTCTGCCCGTGCTAGCATTCTTGGCGACAGATGCATGGCTGCCTGGCGGACTCGTTAGGTATGGATGTCGCCTTTTTCTTCACCGTTGCCATCCAGCGTAGGGGTTGCTCTGCTTCGGCGCCTGGACTTTGGCACCTGCACCGTGGGTACCTGCGCATTTTGTGGGACCTTTTGGTAGGCTTTGTACCTCCGTCTGGGTGGCGCTGCTCTTCAAGCGGTGCTCGCTAGTAGTACCTTCGTACGAAGCTCTATCGCCCCACTGTTGTTAAGGGCTGAGAGTTCGGAAGCTATGCCCTTGTCTCTCATGTGTCGTTTGGGTCTCGAATGCGGATAGAAGAGGCTGATCTTGCCATTGCATCCTGGTAAAGTATGCCCCTCAGGTCCTCGTTCTGCGGAGAGCAGTGGTCAGTCCGAAGACCGTGGGGAACCAGCTGGGGACTTCCCTCCCGTCTTTTGCGATGGCGACGTGTGGTCCATCGTCTTCTGACTTTGTCGCGGTCGTAGATGCTGTAGGAGCCAATTTCTCCACCTCTACAGCATCGCTGCAGTCGATAGTCAACGGCGGCTCAGGGGCCTGCGTGCTCTGCCACTACCGACGGGACCGAGATTCCCGTCACCATGGGTCCGGGTTGCGAAGCTCCTCTAGTGGGGATCTCGAAGTCGGGAAGCTCCTCCTGAACGGTCGTTGCGATCAGGGGGACTGCCCCCCACTGCGCTGTCCATCCAGCTGAAGGATGGCTAAGGTTACCCTGGGTCGTAGTACGGATTTCCCCTGGCTTTTTTTTTACGGATGGAGTTTGTACCGCCTCGACTCGGACACCAGAGCCTCTTAGGCACCAGCACGGTGAGAGGATGATATTTGATGTCCGCGACCTTTGTGCCTTTCCTTTCTTAAGACTTGTGCGCTCCCAGTTACCAGAATCAGAATTAAATTAAATTAAATTTCAACGGCAATTTTAAATTTAATTTTGAATTTCACTCCCTACTGTCGCAACACAACACTGATCGCACGGTTGATCTGGCAGCATCCCTCTCCAGATCGCCCGCTGCTATCAGCTGTTTATCCGCTGCAACAATCGCAAGATAATAAATTACCTATTTACGCCAGAAACAGGCGCACAATTAACTCGCGTGATTGCAGCGCAGAGACTATGTAGCGCGACTCCCACCGTGTGATTTTGCCAGTTTGCCGCACGCACCGGCCGACACAACTTCTATGGTTTCGAGTATTTCGCGCCGCGCGTAATTTAAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCCGCACCAGGATTGAGTGTCTAAGCCTGTGCGTTGGGTTAAAACTTTGGCGAAATACGACGGCATTGAGTTTTGGGTCTCTTTGTGAGTTTTTGCGCTTCTTTAACAGTTCAGAAAATGGCGTTCTGCGACTCTAGAATTGTCAGCAAATTGTTTCACTATTTGGTATGCACATATCGGTTAAGCACTGTACCTATGTGTATTCATAATTTATGGCACTCTGTTGCAATGTGTACATAAACAGTCCAGCACAAGTGTATACGTAATGCGAGCGCAAAAGCTCAATGCTGTCATTATTTGCCGAAGTTTGTCCTGAACGCACGGGCTTAGACCTCCAGTCACCGAATGCCATCGCCGTGGCGTTCGGACGTCTTAAGCGGCATAATACTGAAAACCATAAATGTCACCTTCTCTTAAACAACGAAATCGCGATGATCACGCTACTGGTCTGCGCTGCAATCACGCAATTAATGTTCATCTTCAAATAAATTATTATCTTGCGATATTAAACGAATAAGCAACTGATAACGCGGCAATCTGGAAGGAAGGCAGCTCGTGTGATCGATGTTATTCGATTGCGACAGTAGTAAATTTAAAGGTAAGCCGTTAACAATTATTATTTTGATTCTGGCTGGGCTTATCTATCGAGCGTCGCAGTTTGTCATCACCGTGCTGATAAATCCGGCTCGAACGTGCAAACAAATCGGCAGAAAATCGTGACTACGTATTCGCTGCTCAAACCATCGCTGATGAACGGCGCGATTTATTCAGGAAAACTCCGACTTTCGAGATCCCCACCAGAGTCGACAACTGGCCGCCGTGAACGGAATCGTCCGTCGATGGCTGAAGATGATACCGTTGACTTATCGTGCGAAATGCTGTAGAGGTCGGAAGAAATTAACTCTACAGCATCACGACCGCGTGAAATCGAACGTGGACCCACATCGCCATATCACCGAAACTGGAGATCCCCGGCTGGTTCTAAATCGTTTGTTCCTGCTTTCTCAGGCTGAAAGGACGACATGCTACCGGGATGAATGAAGATCGGCCTTTCTATCGCGTCAACCGGCGTTATGGTTTCAAAGACGCCAACTCCGAACTCTCGGCCATGACGACATCAAACTGTGCGAAGTACTTACCAGCGGCGGCAATAAAAAGCCACCAAGGCTCCGCAAAGCGGTACCACGGTGCGCGAGTGCTTGAAGTCAGACGCCGAAGCAAACATTACGGATAATAACGACAGGCGACATCCGCCACTGGCGGATAACCGGCGGCTTGTCTCCGAAATGCTGCGGAGTGTAATCGTCGTAAGCGGGAGAAGCTTCGTACGCAATTCGGCTAAGATGGCGTCCGGGCATGAAAGGTGATCTGTTGGCGAAGATGAAGCTTCGGGCGACGACGCAGGAAAGCGACATATCGACTTGGCCTCTGGCGCGCGAGAGCACCGAAGTCGCTATCTTTGCGGCGGATGGACGGGCGACTCCACAATACGAACTGGAAATCGCGAATCGAGCGCTTCGTATGCCGGTGGCCAGTAACCTCCGGTGCTGGCAATTTTGCGATACGGTATCGTAAACGGGGCATAAATCGTTGGATGATCGAAAGGCGGGACATCGACCACAGTCTGAGGATATTGTGAACGTCGATCCTTAACAGAGATTTTTGACCAGAGGCAGATGCGACGTGTGAAACGAAGTGCGTTATCTTACGATCTGGCGGGCGACAGGTAGCTTTGCGTTAACCCGACACGAACGACAGCAAAACCGGAACTGGCTGCGGCTCATCGGCGGCTTTCAGTAATCGATATCGTTGCGCGGCGGCTCAACCTCTGACTGAGCTGCGGTTGACGATGAACATCGTAACTCCTGGCGAACCTGTCTGTGATGTCATGATCACCCGACCGAAGACGAATCGAAGCTTTATCAATGCTGCGGCTCTCAAATCGAGGGAACTTTAACGCTTTTGTGCGGTGGCTCATGCCGGATAAAACGTGCTGCATCTTCCGCCGGTACTGATCGGTGAAGAGCTTCTTCGTGAACCGTACTGAACGCCGGCGACTGTCACCTGGACAGTCAGATGGAGACGGCAGGGCATCAATGTGATTGGCATAAAATGCGAATAACTGGACATGCTGCTGAACAATGTTGAAGCCATTTAACGATGAAGTGCGTCGCTATTGACGTTACGCCTTTGTCGGCTTGAAGCTGGTGGGCTGGCAACAACTGGATGGTCCATTGACGTCGTGACTGACGATGTGCCGATCTCGCTCCGAACGTGCTTGAACGGCGGTGGCACCGGGACACCGATTGAACCGTAACGGCCTATCGTCAGTTCCTGGAAGTCCCCAAACAATCAGTTTGCCGAAGCGACATTCATGGTATATTAACGGGGAAAAATGCTGCGTCTAATCATTTTCGAAAAGAAATAGACGCGGCTCACCGTTTGATTAGTGCCTCCTGAAACTGCGGTGCGATTATCGGGAGACTGAACGGCATAACGTACCGCGTAATTTCTTCGGAAGAAACAAACGCCAAGTCGAAGCGGCATCTATAAAATCGATCGTTTGGAAGCTGCCGGAATGGCGATGAACAACGATATCTGAAGTTTTCATACAAACTGTTACCAACATTGGTGACGACTGAAGGCAACCACGACCGAGCGAAGGCGACTGGTGCCGTTAGGTATCACCAGGCTTGAACGGCTGTTTCGACGTCTGGCACCGAAGATAGCTGGCATCAGCGACTCCTGGACAGTAGTCTACTGGCTGACGAAGATGGTGTCAACGATCTCCGTCGAAACTCCGGACGGAAGTCCCTAAATACCGGAACGCAATGATGGATCGCCGGTTATCGTTCGGAACCGCCCGACTACGCCAATGAAACGGCAGTCTTTATCCTCTTCGTTGACGAATACCTTAACGTCGGGAACTGGGCTGCTGATACTGATGTCGGTAACAAGGCTTCGCTGCTTCTGCGATCTGGGTATGCCGCTGCGGGGAGTCTCATACCTGAAGATGGACCGACCACTCCGGGCTCGATAAATTCGAGAGATATCGAAGACACCGGCATGACGCTGGCGAACCTGCGATGAAACAATATTGCAATAGCGAGTGGCGCTTTCCCGGTACACGGTATTTATTAGTGGCAGAGCAGATGGCTGCGTCGCGACGATGAACTGTCGGGGATGTGAACGGTGACGCTTCTCGAAAGTGTGGCGATTTGTTATTTATTTTCTTGTACATATTTGATATTTTGAACTGTTTTAATTTATAGTATAAAATAGCTATATTGTTTAATTATATTTCTTAAAAAATTGCCATCGAAGCAAAATAACCGTTAATTGTTTGACCTTTAAAATCAAAATTCAACTTCACGGTGACAATACAATGACAAACGCTGGCGCTGGAATTGTTTTAATTTCAGGTGGCGTTACTCCTGTTACTTGTGTCCACTTCTTTGCATATTATTCAGAACGCGCGTGCCTTGCAACTGGCGTGACAATAACTGTTTTCCAAACAAAACCTCCTCTGCTATCAACCACCCGGGACTGCTGATCAGGTATTTCATCGGCGGGAGACAATGTTATGATTGCACGCCTCTTCTTTTGCGGTGCGCAGCGCAACGCCACGACCGGCTGAGCGTACCGATCGTGAAGTTCTTGCCCGGTACTCACTGGCCTGGTTCGGGTGATCATCGCTTGCGGACGCTTCATCGCCGACGATGATCGCAACCCCATCCCCGAGCTTGTTTTGATATCATCATAACGGCAACCAACACTCTCGGGCTGGTGACGGCGGCGCCGGTAACCCTGCTGCCTCGGCGAACCTGAACATTGACAGATGATGCTCTGCGACTTTCCATGCGTCTGTGCAATAAAGGCGCTGGAATGCGTGTGAACAGGTACCCTCGAAACAGCAACCGATCCGTGAAGAACACGATCGTGACTGATCACCGTTTTGTTAACAAATCGGCCGCTCAGGTGGTGCGGAGATGATTTTGTGGTGTGACTCTTGCCGCCTGGTCTGCCACTTCACTCGATCGCGTCTTTCTGGTCAGTGTATCCCTCGCTAAGGCGTGGTGTAATGCCTGACGAAGGCGTCGCGCTGCGTCGTCATCAGTTCTGAAAGCCTCTGATTAACACCGAATGACCGTCCGTGATGCCGAGGCTGCTCTGGAATCAGGTTTTCTTTGTCGGAAACGCGGCTTTCGAACAGGCACGGCGCATGGCTGTCGTTGGCGAAACTGCTGACTTTGATCTCACAGCCGGCGGTCTGCGCCGAAGGCTGCTGTCATTGCGCTTTTAACTGGCTTTACTGCGTGAGCGAACAGGCGCTCGATGATGGGCTGCCAGCCATTTCGGCGTTTCTGCTGAGCATTTCAACTCGCGCGACTCACGCGTACTCGCTCGGCTGCAATACTTCGTCTTATGCGCGTATTTAAGTCTCGATACGTCTGGCCGTGATTATGTTCCTGGAACTCGGCGGCGACGCTGTTATCGCCGTCGTCGGCGGCAGTGCGGCTATGAGCTTTGCCAATGCTCGGTATTCCATCATGCATAATGTTCAAGATCGATCTATTGCACCGACAGCGAGCGCCTGCGAACATGACGCTGAACCATCTTCTGTTGCGTACCATAACGGTCTATTGGTTAGCGGTACATAAATGTCGAGGAACGCACGGGGTGCGCGCCAGCCGAACTCAATGTTATCTCGCTGTGACCAGTGCGTTATTGACGTCTGGCATGATGATGACTTTTGTGCTTGCTGCCGCCTGGCCATCGGTTACCGTCAGTGCTTTCTGGCGGCGTCTGTTACGGATTTGAAGCGTCGGCGTACTTTACCCTTTCGAAATACGACGGCCTGGTACTGTGAACTTTCGTGTTAGCTCAGTAGCATCGTACGGTAATAGCTCAGAAACTGTCAACGGGCTGCAACGATCGACAACTTTGCGATGAGTTGCCCAGGCCTTGCGGTGAAAGAGCCAGCTTCATCTTTTCAGCGTAACTGAAGACTTCCGTCGGGCTGCTGTTGGAGTCTGAAGACATCCCGGTCTTTGCGGTGACGGCTGCTGGCGCGATCGCCAATGCATCGATACCGGCTTTGTTCGGAACGATCTCTTTAACAACTTCGACGACTTTCGCCTTTCGATGCGCGGAAGTCAGAGGCAGTGGCGGTTGCCGCCGGCATTGTTGTTGGCTGAGCGCGATTGGCCGAAGCGGCTGGTCTGAATTTCTCCCGGCTGTTTTCACGACTTTGTGAGCCGGGAGATATTACATCAATCGGTGTAAACAGCGCTTTGCTGCTGATATGCCGTTCTTAGCACCGGTTAAGCTTCAGCACCATATACTCAATGCGCTGGAATGATGCGGTTGCCGTGCTGCGCTTTGCACTCGCTGTTATCGGCTTGTTGCAATCTTCAATGGGCTGGGGCTTTCAATTTCGTGTTCGCCTATAAACATCTGCATCGCATTGCTCTGAAACTATCAGGCGCTGCTCTATTCATATCTGATTATGAACTCATGCCCTCGATCGTATGCCGGCGTAATCTTCATCCGGTTTCTAATGTCATGCCGGAACTTAGCGCACGCTCTACTTTGGTGGTGACGGCTGTTCGGGCTTTCGGAAACGTGTTAGACGTGATAAATTTCGGCCGTATGTCTCATGGATCCGGTTCGGCTGGCAGAACTTCTGCTGGCTGAGTGACGTCAATGAAGATGTACTCTGTCGTTATTGGCTCGGTTTTGGCGTGTTGTGGCCGTCACAACGAATTCATGGCGTCTCTCTCTTTGTGTTAATTCGACTGCTTCATTGCCCGATGACTGTTGATCTGCCTTGCTGCATGTTAACAGCTTTCGGCGTAATCTCGGTGTTCGCGGAGTGAGCGCTAACGGCAGAAGTCTTCTGACATCTCCATGCTTACGCGATGGTACGATCCTCTCCGCAATGGCTGGATAACACGTTTAATGACGCAGCAATCGGTAACGCTCGCGGTACCCGCACCGAGGATTTCGCTCAGCGCTGCGTCCGTAACTCCTTTCGCTGTTGGTGCGGGGATACGTACTGCTGCTCAATGGTGGCTGGATGATGTTCTGGCATCATTTTGACGACTATTGGCGGAATGAGGGCATCTGAAATTTCACCGTCGCGTGATTCTGTCCGCGTCATAACGATCGGTATCTTGATCAGACTGCGGCTTGCTGCAACCATTAACATCGCCTCACCATCGGTCGAGCGATCGGAGCTCGATGACCCGATTCGTCGAAAGCATCTTATTGGGCGGACGTCGACGCTCTTTGACGGCTTACCGACATCTGATTACTAACGCTTACGTTGATGATGCAATGGCGTCGTTCGCGCACTGATGTACCGGGGGGTATCTGGTCGTCACGCGAGCCTCTTACATCTCTGGTTCCGGGCGGATATTGAGGAGACCGAGGTGGTCACCGAGCAAATGGACGATAGATGATCCGCTGCCCGAACAACGCGGTCGCCCGTGCGAACGAGCAATCTTCTTGACGATAGCTACAATGGGCACAGGCTGGAATGACCTCGAACTTTGCCTTCTATTCGAAGTAGTTCGCTCCTGTTGCGTCCTCATACATTTTACGCATTATTTGCCGAATTCACCGGTCAGTTTCGACTTTCATCTTCCGGTCAGCTCGGTATACCGTTTTTTTTCGAGTTAACATATCAGGCTTTGCGCGAAGGCGCGGGCGCAATATTCTCATCGTATTGGCGTCATGACGAACATCGCCTTTCGGTTTGAGTCGGCGAATGTTGAACGCTGCGATGATTCGCGGCAATCGATGTTGATACTGCGGTCCTGCGATTCGTGCAATGCCTGATAACGAATATTACCTTTGACAGCTCGCGGAGGCCGATGCCCTCATAACTCAATCATCGTTATTCGAGCGCCGATGATCCGCGTTAATATTTGAAGTGCCCTGCCTGAACGTCGTGTTTGGCGAGCGATGCAGGGGACGCCTAACCGCGAACCGGCACGCTGATATCCGTTATCTCTTCGAGCTTTATTGACTTTGTCGTGGAAATTCACGGCTACGCTACGATCTTTAATGACGGCGAGGAAACGCTTTGCTCTGCTCACGGATGGGGTTCCGACTCTCTTATGAATAATACCGCTCACTCGGCAGATGCGTTGGTCATGCTACGTCATCGACAAAGGGGGACTTTTATTGTTGACTCCGTGAAATATAGACAACTTCAGTTAACGGGATTATTTGGGGTACTACGTTTCAACAATTAGTTCGAATACAATTTGGTGAATTTCGCCCGGCGCGCGATTCGTCGACGGAACCCGAGCGATATGGCTGGCTGTTGTCGCGATGCCAGCTTCGATCTGATTTTACTGGTCACTCGTGATCCGGAACGACTGCCGTATTTCGCTCGAAACGCGGCCAGGTGGATTTGCAGGTTATATTGCGGTCGTATATGACGAGGTCGGCACGGCTGAACGTGCGAAAATGCGCGGAACTATTCGCCTATCCCGTATACGCGCAATGTTGTTGGCCAGTATTCGATGATGAGTGGTGTGTTTGATTGCGGTGAACGGGTTCACGCATTATTACTGACGTTCGTTCTGCGCGATGGTTTGATAACCGAAGGCGGGCGTATATAAACTCCCAATTAAACGCGTCGAAAAACGTTTGTTTGACAGTGAAGTGATGGGTCGGTCGCGTATGACGGTTTGTTTTCGGCTTTTCTGTTAATGAAATATTTTTATCGTCTGTATGTAATTCTTGTGTCTGATTGAGTTGACTACCTGCTAATGCAACCTGAACCTTTAATTCTGGTTTAATTTCACCAATAAAACTTGGTATGGAAATAAAACCTTCAAAATAAGGCCATCATCTTTCGGTGGATGGCTGACTGATTTACGCTTCGTGTGTTCGTAATTAAACGACTTTCAAACGATTACCCGTTCGTCGGTAGTCGCCTCATCTTGATAGCGATATCGTGTCAGAATCGTACATGTTTCAATGAATATTCCAGGCTGTGCGCTTCCCAACTGTGCATCGGCACC
->392f8e7b-42bc-469c-81cd-199b5c068bd7
-TTGGTATACTTCGTTCAGTTACGTATTGCTTCAACAATGGTGTTTGCAGGCAGTGGGGCTGAAATTCAAGAAATTAAATTTAAAATTCAAGCCGTTGAAATTTAATTTAATTTAATTCTGATTCTGGTAACTGGGGGCGCACAAGTCTTTAAGAAAGGGGAAAAGGCACAAGGTCATGGACGAGGCCAAATATCATGCAGTGAACCTAAGCAGAGAGGCTCTGGTGTCGAGTCGAGGCGAGTACAAACCTCCATCCGTAAAGCCGGAAATCCGTAGCCTACGTGACCCTAGGTAACCTTAGGCCATCCTTCAGTTGATGGACAGCGCAGTGAGGGGCAGTCCCCATGATCGCAACGACCCGTTCAGGGAGGAGCTCCCGACTCGAGATCCCCCACCAGAGTCGGTAACCCGACCCATGGTGACGGAATCTCGGTCCCGTCAGTGGCAAGGGGTGAGCACGCAGGCCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGATGCTGTAGAGTGGAGAAATTGGCTCCCAGCATCACGGCCGCGACAAGTCAGGAAACAAGGCAAAGGAGGGAAGTCCCCAGCTTGTTCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCTCCCGAGCGAGGACCTGAGGGCACCTCAGGATGAGGTGGCGATCAGCCCCCTTCTATCATTCGAGAGACCCAACGACACACACTTGAGACAAAGGGGCGCAGCGAACTCTCAGCCCTTAACAGGGCGATAGAGCTGTACGAAGGTACTACTAGCGAGCACCGCTTGAAGAGCAGCATACCCAGACGGAGGTACAAAGCCTACCAAAAGGCTCCACAAAATGCGCGGGTACCCACGGTGCAGGTGCAAAGTCGGCGCCGAAGCAAGGCAGCCTACGTTGGATGGCAACGGTGAGAAGAGAAAAGGCGACATCCATACCTAACGAGTCCAAGCCAGGCAGCTATGCATCTGTCGCCAAGAATGCTAGCACGTTGCAGAGGCACTCATCGTAAAAAGACAGGAGGGAGAGGCTTCGTACGCAGAAGTGCTTCCGGAAGCTAAGATTTGGAGTCGAGGCGCCAGCGAACTGAGCAGTCACGTGCAGAAAAAAAATCCGGAGAACGCAGAAAGGTGATCTGTTGCTTGAGGTGAAGCTTCAGGCGTTCCCAAGTTTAGAGCGACCTGGAAGCGGCTCAACAAACTTGGCCTCTGTGCGCACAGGAGCGCAAAGAGGCCAAGCTCTATCTTGCAGCGAGTTGGACGAGGCTACGACAGCAGAGAAGCTCCACAGCTGGCAGGTGCTTAGTTTCGGGCCTGCAGATAAATCCTGAAGATATCAGGGGCCTTCGCAGTATGCGGAATTGCAAGCAAATAGCCTCCAGTGCTGCTGAACGCGAACGTTGCGATACCAGTCCTTAAACAGGGCACCATAATCGTTGGATGGTCAAGAGATGTCGTATCGCAGGACGTCCGACCCACGAGATGCTACAGGTGTCTCGGCTATAGGCATCGATCAGCGGCACTGCAAGGTTTACTGAAGCAGGGCAGACTGCTGTCTTAGATGCAGTGACGTGGGCACAAGGCAAGGGGTGCGTTGCTGCGATACCTGATCTGCGGCAGCGAGGTGGACAGAAACCGCACCCGACGGGTAGCTTTGCGTGCCGACTTACAGAGCGACTTCAAAGTGCAAGAGCCACCTTAATGCACGCTCGCTGGCGTAGTACGGCTCAATGTCAATCATTTGCGCAGCAGCTCAGAGCCTCCTGGCCCAGACTGCGGTTGGAAAGCAATCTTAGACATCATGCTCCTAAGCGAACCCTACGTCCTCTGGTAGTGGACAATCGTCCATGATCCCTTGACAGGAGCAGGTAAAGCAGCTATCAAATGCTGCAGCTCTCTCAAGTCCGGAACTGGCTGCTTTACCCATGCGGGGTATCGCTTATGCGAAGTTAAAACACGTGCACATGTACAGCTGCTACGCTCCGCCGAGCGACACCCCGATCAGTTCAGAGAACCACCAGAGGCGCTCGTGGACCATGCGAGGCGAAGCCCGAAGGTCGTGCAAGCGAGCTTTTGTGCCTGGACAGTGGAATGGGGCGGGACGCTAACACCAGAGGACGAGCTGTGATTGACGCCATGCGATACTGGACCTCTACTGCGCACGAACGATGGACGGAAGCCGACGTTTAACAGCGATAGGGGTACGTCCTTTATTGGCATTACCTTTGTCGGCAGGGCTGGTAAGGCAATAACAGCTGGATGGTCCATGACGTCATGACGCTGAGCGACCATGCCACGATCTCCTTTCCCGGAGGCCATGCCCAAAAAGACGGCGAAGTGGGAGAACAGCCGAGGAAAACATGGGACACCAGGAAGATCGATGAGGCCATGCTGGCCTATCGAGATCAATTCCCTGGAAATCCCAAATGTGGACGCAGAGAGTATGGCAGCAGGCCTCATGAATATGCTGGGAAGAATCTGCGGCCTGCAATCATGCCAGGAAAATAAGGCTGGCAAACCACCCGTTTACTGGTGGGTGCCTCCTAAACCAACTGCCGGGTACAGTTACTCGGGGCTAAGAGAACGGCGCAACGAGCCAGAGGCGGTACCCACCACGCCCGCGGAACTCTTTGGAGGCTTTCAGAGCAAACGCCTGAGTTCAAGCGCACGTATCGCGGCTGCCAAAGCGCGGTCGTTTAAGAACTGCAGGATGGCGTAGACAGCGATATCTGGGGCTGCGCCTACAAGCTTTGTTACCAGCAGGCTAAGGAGGAGGAGGAGGCGGCAGCCCCATCCGACCAGGGGTCCTGGCCTAACATACTAGGGGAGCTGGCTACCAAAAGCAGACCACACTATGGAGGCCAACAGAGGCAGCCCTGCCCAGATTTCCCGTGCGTCACAGGGCAGAGTCGTCGAGGCAGCTGTTTCGCTGACGATGTGGCAATCCTGGCCCGGGCAGCAATAGCGGCTCACAAGATGCGGCAGTCCCTACTAAGCAGCAGGAAAGATGGAGAGCAACGGTGCCAGTCCGGAGGGTACTCAGGGGACCTCTCAAGGGAATTCCCTAAAGTACCTGGGGGTAATGATAGATCGCAGACTATCGTTCCAAGGACCACTGAGCTACACGCCAGCAAGGAGACGGCGATGCGGTCCTCTTCGTTGAGGCTTGCCCAACGTCAGGAGGCCCAAGACACCCGGCCAGGAAACTGCTGGTGTCGGTAGCAAAGGAAGCCACTGCTATACGCTGCACCAGTCAAAGACGACATGCCACTTGCAGGGTCTCGCGCCACCTGAAAGGAACTCGTTCAGTGCTACGGTCAATAGCCCTCAGGCTCATTGAGGATTCAGGACCATATCCGAAGACGCGGCGCTAGCGCTGTAGCGAAGGCCTGCCGATTGATCTGGAGATCAAGGCTCTCCAGCCTTATGCGGAGTAGCGCTTCCAGGCAAGAGAGCACACGATGGCTATTAAGGTGAATGGCAGAGCAGATGGCAAACGTCGCGACGGGGGGGGAGTGGACCTATCAACTCATCAGAGATGACGGTTTGGGCAAGTGGCCTCTCAAAGTGTGTGACTTAGATTTGTTATTTATTTTCTTGTATATTTGATATTTTTGAATTTGTTTTTAATTTATAAAATTAGGAAATAAAATATTGTTAATTATATTTCCTAAAAAAAAAATTGCGTTTAATTAAGCAAATAGCCATAATTTTGACCGTTAAAATCAAAATTCATCTTATTTCACGGTGTGTAAACGGTTTCTTGACAAACTGTACTTGTCGCAGATTTATTTTAATTTCAAGAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTGAGAGTGATGCCGAGTATAGGAAGTGATTCAGATCCGACATCAGAAGTGGGACCGCCTACTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTGTGTTTTTTAGCTGTTCTTTGGCCCCAGTCAATTTGAGGAACAGGAAGGTCCGCTTCCATTCGAAATTAATTCGTCCAATCCTCTTATGATCTACATACAAAGGTTCTTAGCCTAAGTCAGGGAGCAGCGCTGCGGCATAGCCGCAGCGCAGCAATAGCTTATATGCGTATCTTATATATATGTATATATATATGTACTGTCGCCAGTGATGAGTGCTGGAGGAGGAGTGGTATAGGCACACATATAAGCGATCAGCGCTTGGCCAGCAGGAGAACTGCTGACCAGGCAATTATGTATGTTAGCCAGCCCTCAAGTGGGTGCTCGTATTACGTATACACTTGTGCTGGACTGTTTATGTACACATTGCAGCAAGAGTGCTACAATTATGTGAATACACATGGGTACAGTGCCCAGCGGTATATTGTGCATACTACAATGAGTGAAAACAATTTGCTGACAATTCCTAGAGTCGCAGAATCGCCATTTTTCTGAACTGTTAAAGAGAAGTGCAAAACTCACAAAGAGACCCAAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCTGAACGCACAGGCTTAGACCTCAATCCTGGTGCGGAGACCAGTCTACATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCCGTACTCGAAACCACAAGTTGTCGGCCGGTGTGTGCGGCAAACTGGCAAAATCACGCACGGTGGAGTCAGCGCCATAGTTCTGCGCTGCAATCCCGCGCGAGTTAATTGTGCGCCTGTTTCGTAAATAGGTAATTTATTATCTTGCGGTGTTGCAGCGGATAAACGGCTGATAGCGCAGCGGAGCGATCTGGAGGGAGAGGCGTTGCCAGATCAACCCGTGTGATCAGTGTTGTGTTGCGACAGTAGGGCGCGAAAATTCAAAATTAAATTTAAAAATTAAGCCGTTGAAATTTAATTTAATTTTAATTTGATTCTGGTAACTGGGAGCGCGCAGAGTCTTTTAAGAAGGAAAAGGCACAAGGTCGCGGACAGACCAAATATCATCCTCTCACCGTGCTGGTTTTCAAGCAGAGCTCTGGTGTCCGAGTCGGGGCGGTACAAACCCTCCATCCGTAAAAGCCGGAAATCCGTAGCTACGTGACCTAGGTAACCTTAGGCCATCCTTCCGGTTGATGGACAGCGCAGTGGGGGGCAGTCCCCTGATCGCAACGACCCGTTCAGGAGGAGCTCCCGACTTTCGAGATCCCCCACCAGAGGAGTCGGTAACCCGACCCATGGTGACGGAATCTCGGTCCCGTCGATGGCAAAGGGGTGAGCACGCAGGCCCCAGCCGCCGTTGACTATCGGCAAAGCGGTGATAGAGGTGGAGAAAATTGGCTCCTACAGCATCTACGACCGCGACAAGTCAGAAGACGATGGACCACATCGCCGTGCCATCACCAAAGACGGGAGGAAGTCCCCAGCTGGTTCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCCAGAACGAGGACCACAGGGGCATACTTACCAGGATGAATGGCAAGATCAGCCCCCTTCTATCCGCATTCGAGACCAACGACACACATGAGAGACAAAGGGCATAGCTTCCGAACTCACCAGCCCACTTAACAACAAGGGCGATAGAGCTGTACGAAGGTACTACTAGCGAGCACCGCTTGAAGAGCAACTACCAGACGGAGGTACAAAGCCTACCAAAAGGCTCCACAAAATGCGCAGGGTACCCGCGGTGCAGGTGCTCTTGAAGTCCAGGCGCCGAAGCAGAGCAACCCCTACGTTGGATGGCAACGGTGAAGAGAAAGAGGCGACACATCCATACCTACTTGTGAGTCAAAGGCCGGGCATTTATGCGTCTGTCGCGAATGCTAGCACGGGTGCAGAGGGGCACTCATCGTAAAAGACGGGAGGCTTCGTACGCAGAGATGCTTCGGAGGCTAAGATCGGAATCAAGGCCTTAGCGAACTGGGCGATCACGTGCGAAAATCCGGAGAACGCAGAAGGTGATCGCATTTGCTTGAGGTAGAGGAAAGCGGAGACGTTCCCCAAGTTTAAGAGCGACCTGGAAGCGGCGCTCAATGACTTAGCCTCTGTGCGCACAGGAGCGCAAAGAATAGCTCTATCTTGCAGCGGATTGGACGAGGCTACGACAGCAGAAGCTCCACAGCTGCTTGGTCGCCCAATTCCAGAGACGCAGATAAAATCCTGAAGATATCAGGGGGCCTTCGCAGTATGCGGAATTGCAAACAAATAGCCTCAGTGCTGCTGAACTGAACATTTTGATACCACCAGTCCTTAAACAGGGCACCATATGTCGTTGGATGGTCAAGAGATGTCGTATCACCCAGGACGTCCGACCCACGGATGCTACAGGTGTCTCGGCTGCAGGCATCGATCAACCCAGCCTGCAAGGACACTGACAGGGCAGACTGCTGTAGATGCGGTGGTGGGCACAAGGCAAAGGGTGCGTTGCTGCACCAAAATGCCTGATCACTGCAGCAGCGGGTGGACAGAAACCACTTAGGCGGGTAGCTTTGCGTGCCCGACTTACAGAGCGACACTAAAGATGCCAGGCCACCTTAATGCACGCTCATATTAGCGTAGTACGGCAATGTCAATCATTTGCACGCGGCAGCTCAGAACCTCCTGGCCCAGACTGCGGTTGAGCGCAATGTAGACATCATGCTCAGCGAACCCTACGTCTCTGGTAGTGGACAATCGTCCATGATCCTTGACGAGGCAGGAGTAAAGCAGCTATCCGATACGGCTCCGAGACTGGCTGCTTTACATGCGGGGTATCGCTTATGCGAAGTTAAAACACGTGCACATGTACGGCTGCTACGCTCCGCCGAGCAGCACCCCGATCAGTTCGAGGAGCTTCTGGAGGCGCTCGTGGACCGTACGAGAGGGCTGAAGGCGAGATACATTACCGGCGACTTTAATGCTGGACGGTGGAATGGGGCAGCAGGACATCCAACACACCAGAGGACGAGCTGTGATTGACGCCATGCGAATGCGGACCTCATACTGCTGAACGATGGACGGAAGCGACGTTTAACAACGATGGGGTACGTCCTTTATTGACGTTACCTTTGTCAGCAGAGGAGCTGGTAGACAAGCAACAGCTGGATGGTCCGACGTCATGACGCTGAGCGACCATGCCTGATCTCCTTCTCCCGGAGGTAATGCCCAAAAAGACGGCAGAGTAGAACAGCCGGGGAAAACATGGGACACCAGGAAGATCGGTAAGGGCCATGCTGGCCTATCAGGAGATCAATTCCTAAATCCCAAATGTGGACGCAGAGGTATGGCGGCAGCAGGCCTCATGAATATGCTGGGAAGAATCTGCGACGCAATCGTACCAAGGAAAAAATAAGGCGCAGCGCAAACCACCGTTTACTGGTGGAGTGCCTCCCTAAACCAACTACGGTCTGATTGCCTCAGGGCTAAGAGAACGGCGCGGCAGGCCAGAGGCGAGTACCCACCACGCGGAACTCTTGGAGCAAAACAAACGCCTAGAGTTCAAGCACGGCATCGCGGCTGCCAAAGCACCCGGTCGTTTAAGGAGCTGCAGGATGGCGTGAACCCAGCAGCGATATCCTGGGGCCTCGCCACAAACTGTTACCAACGAGCTGGGAGGAGAGCAGCAGCCCATCCGGCCAGGGTCTGGCTAACATACTAGGGGGAGCTATTTCCAAAGCAGACCTGCGCATGGGGCCAACAGGGGCAGCCTGCCCCAGATTTGCCGTGCGTCACAGAGGCGAGTCGTCGGGGAGCTGGCTGTTTCGCTGACGATGTGGCAATCACAGCCGGGCTAGCAATGGCAGCTCACAAAGTTCCAGGCGATTACCACTAAGCAGCAGGAAAAGATGGAGAACATGCTGGTCTCCGTCAAGGGTACTCAGGGGACCTCTCAAAGGTCCTAAAGTACCTGGGGGGTAATGATGATCGCAGACTATCGTTCAAGGACCACGCGAGCTGCCAGCAAAGAAGACAGCAGTCACATCACCTCTTCGTTGGCGGAAACGCCTGTAACGTCGGAGGCCCAAGACACCCAGCCAGGAAACTGCTGGTGTCAGTAGCAAAGAGCTTCGCGCTGCTATACGCTGCACCAGTCTCTGGAACAATGCCACTTGCAGGGTCTCATACCTGAAAGGGAGCTCGTTCGGTGCTACGGTCAATGGCCTCAGGCTCATTGGGGATTCAGGACCATATCCGAAGACGGCGCTAGCGCTGGCAGACCTGCCGATTGATCTGGAGATCAAGGGCTCTCGTAGCCTTATGCGGAGTGGCGCTTCCGGCGAAGGCGAGTGGCTATTAGGTGAATGGCAGGCGGATGGCAAACGTCGCGACGGGGAGGGTGGACCTATCAGCTCATCCAGAGATGACGGTTTGGGCGAGTGACACTCTCAAAGTGTGTAAACTTGGAATTTGTTATTTATTTTCTTGTATATTATTTGATATTTTTGAATTTGTTTTTTTTTTAATTTATAAGTAAAATATATATTGTTTTAATTATATTTCCTTAAAAAAATTGCGTTTTAATCAAGCAAATAGCGATTAATTTTGACCTTTAAAGTCAAAAAAATTCCAACTTATTTCACGGTGTGTAAACAGTTTCTTGACAAACTATTACTTGTCGCAGATTTATTTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCACTTCTTTCATTTTGCATATTATTAGAACACGCATTCTACCTTGCAACAGCGTGGCAAATAACTGTTTCAAACAAAGAAACCTCCCCTCTCTCTGTCCTTGTCAAGCTCACCGGGACTGCCAGTCAATTATTTCATCCAGTGAGCAGGATGTGGTGCCAAGTTACACCATCTTCTTTGCGGTGCACAGCAGCGCCTTTTACAGTCAACTGAGCGTACCAGTCGTAGAGTTCTTGCCCGCCAACATGCAGGGTACTCATATCTATAGTTCAGATTGGTCATCTCGTCCTTACGGACGCTTCATCATGGTGACGATGATCACGTGAGCCCCATCCCAAACGATTTTGTCCGCCATCATAGCAAGCCAAGCCTCTCGGGCTGAGAAATTTGACCAGCGAGCGCCACGAGAGTTGCGCCCTCTCCTCAGCGAACCTGGAGCAGTGCAGTAGGATATTGCTCTGCGGTTTCTCCACTGCGTCTGTGCAATAAAGGCACTGGGCTGTATCCACGTGGCGGAACCTACATAGGTACCCTCGAAACCAGCCATGGTCCGTGAAGGGAACTGGGTCATGTGATCCACCGTTTTGTGTGCTCGCAATCCAATACTCCGTTAGTTGCGGAATGAGTTTGTGATCAGCGTCCCCGTTGTGACTCTTACCCACCTGGTCTGCCATACTCCTCGAATCCACTCTTTGATCTCCCTGGTGGGTGTATCCCTCACTCGCAAGGTATTTGCCCTTTATGTCCAGGTCAATGGGTGTATTGCCTGACAGAGCGTGCGCTGCGTCGTCCGATATGGTTCTAAAGCCTCTGATTAGCCTGAGAGCCATTGTCCGTGATACTGCGCAGGCACTATCTAGATAGGTTTTCTTTGTGGAAACGCAGCTCCAGATAGGCGCAGCATAAAGCAATGTTGCCTTTGAAACCGCCACTAACAGTCTCCTAGCCGGCAGTCTGGGTCCTCCCACGTTGGGCATGATTCTCATAAGGCTGCTGCTGTCATTACCGCTTTTGCTGGCATACTTGCGTGAGCAGCAGACGAGAGCCTTCGGTCTATTAGAACGCAAGGTATTTCAACGTTTCTGCTGAGGCGATTTCAACTCCTTTGACTTCCACGCATGCACTCAACGGACTTTCTGCTTTATTCAGCAGGACTACTTCGGTCTTATGCGCAGCTATTTTAAAGTCCGACTTTCTCGAGCCGTTCTATGGCCGCCGTGATTACCACGTTACTTATGTCCTGGGCTCCGGTATTGTCTTGGCGACCGCTGTTATCGCAACGTCGTCGAGCGAAACGGTGCAGCTCCACCTCTGGAGCTTGCTAATGCTCAGTATTCCATCATACATAATGTTCCACAAGATCGGTCTAGTACCGACCCTTAGAGAACGCCTGAACTTGGTGGCTTCTTTGGACCATCTTCTGTTACGTACCATACACACGGTCCCCTGAAGTGGTTTGCCAATTACGCCTCGTATGTAGTCAGGAACGCCCAAGTTGCATAGCCCCGGGATGTCGGGCCCATCTCGCTGCTTATTGAATGCGTTCTTGACGTCTAGCGTGATGATGGCACGAGAATACTTCTTACTGCCGCTAACCATCCGGTTACCGTCAGGTGCTTTCCTGCTTGTCTGTTACCCGGTTGAAGGCGTCGAGCGTACTTTACCCTTTCGGAAGCCATACTGTTGGCCTGAAGGCCTGTATGGGACTTTCAGTGATTAGCTCAATGCGCGCGTACAGTATGCGCTCAAAGGCTTGCAGCAATGTCCAACGGAACCCGGCGGTCGGTAACCGTGGAACATTTGCGGGCCTGCCTTTCGGCAGAAGGACCAGCTTCATCTTTTTCCAGCGCTTAGGGAAGACTCCGTCCAGCAGACACTGTTGGAATGTATCCTGAAGACCTCCGGTCTTGCGGTGGCAACTGCTTTGACGATCACGCCCGGGATACCATCAATGCCGGGGCTTTGTTCAGTCCTGATCCTCTTTGCTGCTTCGACGACTTCGCATGACGTGATGCACGGGAAGTCAGAGCGAAGTCAACAGCGGGTTGCCATAACGATGGTGGTGGCTTGGAAATAGTTCCGACGATGTTGGCCAGGGCGGCTGGGTCCTGAGGAGATCCTGCACCAGCGGAATTGAGTTTTCCTTACGACTTTGTAGGCGAGACCCCAGGGTCGTCGTCTACGCTATCAATCGGAGTCCTTAAATGCATTCGCCTTTGCTGCTGATATGCCGTTCTTAAGCTCAGTTCGCTTCGCTTTATATACCTCAATGCACTGGGGTGGTGCGGTTGCCCTCGTTACTGCGCTTGCCTCCTCGCCTTGATGCATTCCGTCCGGCTGGTGCAATGGAGATCCGCTCCACCAGTAGACAGGGGGGCTTTCGTTTCGTGTTCCTTTTTTTCTCGGCATCACCGCATCACACATTGCTCTAAGCCTATCCATGAGCGCTGCCACCATGGTCTCCGCGGTATTCCAATTATGGACTCCATGCCCTCGATCTGGTATGCCAGCATGTCTTCATCAGTTTCCCTAATGAAATACATACGGACCTAGCGCACATCTTCGCTGTTTGGGTGACGGCCTCATTGTTCGGGCACCGGAGCGTGATTAGAGTTGTGGTCGCTCAGCGTTATGTCCTCATGGACCATCCAGTTCGAGCTAGCCACTAGAACTCTGCTAACAAAGGTGACATCAATGAAGACCTTGCCTCTGTCATTATTGAACGTCGGTTTGAACCCGTCGTTTAGCAATACGAGATCTAACGGGTTCATGGCATCGATGCTGCTCGTCCTCTTGTGTTAGAGATTCGAGCTGCCCATTCACCAGCAGCGGGCATTGAGGTCACCTCCGATGACATTTGGGTCTACGCCACTTGCATGGTTAACCAGCTTTTCGAGCATGTCCTCCGAATTGTTCGGGACTGTCGCTAGGTGGAACATAGCAGCTGTAGGAAGTGGATTCCTCCTAATTTTTGGCGTATGCTATGCCGCATTGGTACGGTATCCCACTCCTCTACCAATAGCCTGGATGTACATTTAATGGCCGCCTTGCCTGTCTCATCGAGTAGCACTCCTGAGTTACCCACCAGGTAGGTATGGTTCACTCAAAGCACTACGTCCACATGGCGCTCCTTGCGCTGTTTGAGTCAGGAGGTTCTGTGCTGCTGCGCAATGGTTAACGTTAGGCTGGATGATGTTAATTTCTTCTGGCATCATTTTGTGGCTAATGGCTTCCTTTGGTGTTGGCTGTAGGTGGGGCATGCAAAACCACCCGTCGCGTGGTTCTTGTCCACGTCACTGCTGCAGATCAGGCATCTTGGTGGGGCTACGCAGCCCGCTGCCTTAATGCCCATGCTCGCCGCACCGTAGGCAGCAGTCAGGCGATCGACTGACTTGCGGTAAGGAGCTCGGTGGCCGAAATTCGAGGCATCTGGAAGCATCTTATTGGGCGGACGTCTTGGGCTGTAAACCCAGCGCGACCATCCCCACAGTTACAACGCGGTTGATGACCGCAATGGCATCGTTCGCGCACATTAGCACAGAGGCTATCTGGGTCCCGTCACGCATCCTGCGAGGCCTCTTACATCCCCTCTGGTTCAGGCGGATGCCCTGAAGTGGGAGACCAGGAGATTATGAGGTCTGAGCCGTCGTTGTCTCGTCTAGTCCGCTGCAGATTAGCGCAGTCCCTATGCGCGCCAGTACGGGCTCAAAGCAATCTCTTTGAGCGTCGCTTCTAGCTCATTTTTTAAAGCTGGGATGACCTCCCGGGCTTTGCCTTCTAATTCAAGTAGTTCTCCCTGTTTGCGTCCTCCTTATTTTACGCACGTGCTTGCCGAATTCGGTCAGACTCGGTTCTGCTTTCATCTTCAGGGAAGCATATCCGAGTACGCTAACCTCACCCGTTTTTTTTTCAGGATTAGCGCCTCAGGTTTTTTTGCGCAATTTGCTTGGGCTTCACCTTAGCCCATTCCTCGTCCTTGTTATTAGCGTCCTTGGCGACAGACGCTAACTTTCCGGTTTGGAGTCAGCCGTCGTGGGTAACGCCGCACCGGTGGATTTCGCGGCAAGATCGATGGTTGTCCGTTTTGGACCTGCACATTCGGTAATGCCTGTCTGGGTAAGCGCCACCCACTGGCTGCCTTTGTTTTCTGCCTCAGTCTGTGTGGCGGGCCTCCTTAATTGGGGGGCTTCTTGTTGATACCCTCCTGTCAATCGCTCTGTTATTGAGCGCCGATGGAGTCCACTAGCGCGCCCTCGCTGGTTACGTGACGCCTAGTCTCGAACGAGGATAGAATGGCGGTGATCTTGGCTTTCATCATGTCAGGATGCCCTGCAGGTCCTCATTCTGGAGCGTCGTGGTCAGTTCTGGCGAGCGATGCGGCGTCCTGATAGGACTTCGCTCCCGCCCTTTGGGCCGGCACGCTGATGAAATCCATTGTCTTCAGGCTTGTGGCTGTCGTGGAACTGTAGTGGCCAAGAGTCTCCACCTCCACGGCTACACTGCAGTCCGCTAGCTTTCGGCGGCGGGGGGGGCCTGCTTGCTCACCTCCACTCCCTGGATTGGGGTTCCGACTCCTCTTATGGGGGATCTCGATAGCCTACCACTCCTCCTAAACGGGTCGTTGGGGTCAGGGGGCACTGCCCCACTATTATATCCATCAGATATAAAGGGGGGACTTGGCTTGTTGTTGGTCCCCAGCGCTCCGTGGAAATAGAACTAGCTTCAGTTCTTAGGTTATGGCCCAAAATTTTTTGTTCAACGAATTAGTTCAAATTTGAATTTGGTCGAATTTCGCGCCCAACTTGACGCGCGGCCGAATGACGATCGCACCGCTGATCTGGCAACGCCAGTCTTACCAATAAATACCGACTGCGAAGGTTGGCAATGCTATCAACTGTATTGTCTGATCGCTGATCTGATTTATTACCAGTTTACTGGATCACTCGTGAATTCGGAACGGCTTACCGTGACGCTCAGAAACCCTTGGCGCAAACCCAGAGTGGATTTGCGGGTTTATGTTGCAGTTTGCGGCTGACCGGACTCGTATATGACGAAATTCGCGCAGCCTGGCAAAAGACGTGCGAAATGCGGGAACTCGATTCACTATCCGTACCATAATGTGTGTTGGTATTAGTGTGTTGTGTGGAGTGAAGTAAGTCTCAAAGTGTGTTTGATTGCGGGTGAACTGGGTTCTACGCATTGACTGCAGCGTTCGTTCTGCACATTAAGTTTGATCGCCGAAGAGACAGACATCTCGCTCCCGAGATTAAACGCGTCCGAAAACGTTACGACGACGGGTGAGAGTGATGCGCAATTATAAAAGTGATTCAGATCCCACATACTTAATGCAAATAAAGTTTATTTTTCAACTTTTTCTATTGGCGAATGATATTTTGTCTATGTGCTTAATTCTCTTGTGGCAAGTTGGGTTATTTGCAATACTAATGCAACCTGGACCTTTTTAATTCCTAGGGGT
->805d527c-db18-465d-be1d-6ef52fa8f84f
-TTGTTGCTTCGTTCAGTTGCATTGCTGTGCAATATTAAGCCAGGAGCAAGTCTACCCGCAATCAAACACTTTGGGGGACTACTTCCCTCCACACACACGCACTAATACCAACACACACATTATGGCATGGATAGTGAATCAGTTCCCGCGTATTTCCGCACATCGCTGCGCTGCGCGGTACCGTCATATACGAGTCCAGTCAGCCGTAAACTGCAACATAAACCTGCAAATCCACTCTGGGGTTTGCGCCGCGTTCTGAGCGTCACGGTATCGTTCAGAATTCACGAGTGATCAATGCAACTGGTAATGAAATCAGATCAGCTGCATCAGACAATACAGCTGATAGCATTGCCAACCTTTCGCGATCGACGGCTGATGGGCTGGCGTTGCCAGATCAGCAGTGCGTCAAATCATTCAGCCGCTACGCTCGTTACAGGCGCGAGATTAATTAAATTCAAATTTGAACCTTCAATTAAGTTAGACAAAAAATTTTGAAATATAGCCTAAGAACTGAAGCTAGTTCTTCCCACAGGTATGGGGATAACAAGCCAAAGTCCCCTTTTATATCTGATGGACCTTTGGGGGGGCGGCGGTGCCCCTGACCCCAACGACCCGTTTTGCGTGGTAGGCTATCGAGATCCTATAAGAGAGTCGGAACCCCAATCAGGAGTGGGAGGTGAAAGAGCCGAAGGCAGGCCCCCCGCCGCCGAAAGCTAGCGACTGCGATTGCAGCTGGAGGTGGAGACTCAGCCTACAGTCCTCCACGACGGCCACAAGCCTGAAGACAGTGGATTTCATCGGCGTGCCCGTACAAAGGGCAGGAGCGAAGTCCCCATCGGGGATCGCCGCATCGCTCGCCAGAACTGACCGACGCTCCAGAATGAGGGACCGCCTGGGGCGGCATCTGGACGCATTAAGCCAAGATCCACCGCCATTTCTATCACTCGTTCAGGACTAGGCGTCACGTAATAGCGAGGATAGGGGCATTACTAGTCAGACCTATCAGCTCAATATACAGAGCGATTGAGTTACGGGAGGGTATCAGCAAAGCCCCACCCGTGGGAATTGCCACAGACTGAGGCAGAAAAACGAAAAGCATAGCCAGGTGGCGCCTGCAGACAGGCATTACCGAATGTGCAGGTCACCGACGGACAACCATCGATCTGCGCAGGAAATCCACCGAAGTAAGGCGTTACCCACGACGGCTGACTCCAAACCGGAAGTTATGCGTCTGTCGCCGGGAGACGCTAACAAGGACGAGAGATAGGCTAAAGGTGGAAAGTAACCCGAAGCTTATACTTGCAAAAAAAAAACCTGAGCGCTAATCCTGAAAAAAGCAGGTGAGGGTGCGTACTCGGATATGCTTCCGGAAGATGACAGAACTTCGGAAGTCTGACCAGATGGCAACACGATGCGTAAAATGGGAGGACGCAACGGAGAACCGCTGAATTAGAGGCAATAAAGCCTCGGAGAGTCATCCCAGCTTTAAAAATGGAGCTAGAAACGACGCTCAAAGAGGGTGCTTCGGTTCACTGGGCGCACATAGGACTGCGCGCTAATCTGCAGCGGACTACAGACACAGAGACAACGACAGCTCAGGACCTTTCATAATTCCTAGTCTCCCAATTTCAGGGCATCCGCCATAGACAGAGGATGTAGAGGCCTTCACCCGGGATGCGTGACAGGACCAGACTGGCTCTGCACAATGTGCGCGAACGATGCCATTGCGGTCATCAACCGGGAGCGTTTATGACGCTGTAGGATGGTCGCGGTACGCATAGCCAAGACGTCCGCGGCCAGAAGATGCGCTGAATGCCTCAGATTCAGCCGCAGGCTCCTGCTGCCGATCCAGTCGATCGCTCTGACTGCTGCCTACAGTGCAGCGAGCATGGAGCCATAAGGCAAAGGAGCTGCATGGCTACAAGATACCTGATCTGCAGCGGTGACGTGGACAAGAACCACGCGACGGCGATTTGGTTTTGCGTACCACCTGCACAAAGCCAACGCAGGGCTAATAATCAAAATGATGCCGGAAGAATTAACATCATCCAGCTCAGCGTTAGCCATTGCAGCACAGGAACCTCCTGACTCAAACGGCAGAAGGGTATGGCGGACGTAATGCTTTGAGTGAACCATACCTACCTGGTGGCAGGTAGCTCGCAGGAGTGCTACTCGGTAAGGACAGGCAAGGCAGCCATTAAATGTACATCCAGGCTATTGGTAGAGGGTGGGATACCGTACCAATGCGCGGCATAGCGTACGCCAAAATTGAGGAATCCGCTTCTACGGCTGCTGCTGCTCACTGGCGACAGTCGAACAATTCGGGGACATGCTCGAAGAAGCTGGTTAACGCCATGCAGTGGGCGCAGACCAACAGTCATCAGGTGACCTCAATTGCTGGGCTACAGAGATAGGGCAGTCGAATCCTCTAACTTACAAGAGGACGAGCAGTGATCGATTACCGCCAGACCTGCTAGATCTCGTATTGCTAAACGACGGGTTCAGAACCGACGTTCAGCCAATGACAGAGGTACATCTTTCATTGGTACAGCTGCCTTTATTTACAGCAGAGTTCTAGTGGCTAGCTCGAACGGATGGTCCATGAGGACATAACGCTGAGCGACCACAACCTAATCACGTTCGGTGCCGAACAGTAGGGCCAAATCACCCAAACAGCGAAGATGTGCGCTAGGTCAGTATGGGGTTGTTGAGAAACTGGATGAACATGCACAGCGCCTGGATCAGGCCTTAGAGTCCATGGTGGACACGCGGAGACCATGGTGGCGCTCATGGATAGGCTTAGAGCAGTATGTGGTACGGTGATGCCGAGAAAGAAAGACACAGGAAGCAAAGCCCCTGTCTACTGGTGGGTGACTCCATTGCACTAACTTCGGACAGGAATGCATCAGGCGAGAGCGTACGCGTGATACAGAGGAACAGCCGCACCGCTCCCAGTGCATTGGGAGTATATAAAGCAGAAGCCGAACTGGGCTTAAGAGCAGCATATCAGCAGCAAGGCGAAGATGCATTTAAGGACCTGATTGATAGCGTAGACGGCGACCCCTGGGGTCGCCTACAAAGTCGTAAAGGGGAAGAAACTCAACGAATTCCGCTGGTGCAGGATCTCCTCAGGACCCAGCCGCCCTGGCCCGGCTTATCATTATCGGAACTATTTTGCAAGCCAACGCACGTTATGGCAGCCCGCTGTTGACCCCCGCCTCTGGCTTCCGTGCATCACGTCATGCAGAAGTCGTCGAAGCAGCAAGAAGGATCAGGCCGAACAAAGCTCCCGGCATTGATGGTATCCGGGCGTGATGGCGTCCAAGCGGCCGCCACCGCAAGACCGGAGGTCTTCGGGGATCTGATCCAACGGTGTCTGCTGGATGGAGTCTTCCCAGCGCTGGAAAAAGATGAAGCCTGGTCGCTGCCCAGCGAAAGGCAAGGGGCCCTGGAAGTATTCCCGCATGATTACCGACTCGTTGTGTCTGTTGGACATTGTTGGCAAACTCTTTGGGCGCGCCTATGTACGCGCGTTGAGCTAATCGCAGAGATCCTGCACAGGCCTTCCAGGGTAACAATGCCTTAAGCCGAAGGGTAAAAGTACGCTCGACGCTCTCAAATCCGTAACAGACGCTGCCAGGAAAGCGCTCGACGGTAACCGTGGATTTAAGGCGGCAGTAAAGTGCACTGTGCCATCATCTGCGCCAGACGTCAAAGACGCATTCAATGATACTGCAGCGAGATGGCCCGATATCCTCAGGGCTATGCGCAACGGAAGCGTTCCCGACTTTACATACGAGGCGTAATTGGCAGCTACTTCCGGGGACCGATGATGTGTTATGGTACGTAACAGAAGATGGTCAAAGAAGCCGCAAGTCTCTGCAGGCGTTCCCCAAAGGTCAGTACCTAGGACCGATCTTGTGGAACATTATATGCTCGATGGAATACTGGAGCATTATGAAGCCCAGAGTGTGGAGCTGCATAGCTTCGCCGACGACGTTGCGATAGCAGTCGCTGCAGAGACAATGCAGACTCCAGGACATACCAAGTAACGTGGCAATCACGGCGGCATAGAATGGCTCGAGAAAGTCAGACTTAAAATGGCTGCGCATAAGACCGAGATAGTCACCTGCTGAACAGCAGAGAGAGTCCGTTGAAAGTGCATGCGTGTGGAAGTCAAGGAGTTGAAATCACCGCCTCAGCAGAAACGTTGAAATACTGTGAATTGTTCTAATGAGACCGAAGGCTCTCGTTTACGTTCAAGGCTCACTTTTAAGTATACCAGCAAAAGCAGCAATGACAGCAGCGGAAATCATGCCAAGTAGGAGGACCAGACTGCCGGCTGGGGGCGGCTGTTGAGTGGCGGTTTTCAAAGGCAACACTGCTTTGCTATGCTGCGCCTATCTGGGCTACGTTTCCTGAAGAAAGCCTATCACAGATAGTGCCGCGCAGTATCATGGACAATGGCTCTCGGGCTAATCAGAACTGGGAACCATATCGGACGGCCTGTGCGCGCTGTCTATCAGGCATTACCCATTGACCTGGACGCCAAGGGCAAATGCAGCAGTGAGGATACACTCAGTTACAGATAAAGAGTGGATTCGAAGAGGTATGGCAGACCAGGTGGCAAGAGTCACAGCAGGACGCTGGACTTACAAACTCATTCCACCAACTAACGGAGTAGGCTGATTGCGAGACACAAAGCAGTGGTTCCACCACATGACCCAGTTCCTCACGGACCATGGCTGTTTTCGAGGGTACCTATGGAGCCACGTCAATGCACAGCCCAGTGCCTTTGTTACAGACGCAGTGAAACCACCCAGAGCATCCTACTGCACTGCTCCGGATTCGCCGAGGAGAGGCGCAACTCGTGGCGCTCGCTGGGTATCTCAGCCCGAGAGGAAAACTGGTTGCTGCTACCAGTGGCGGACAAAATCGTTTTAGGATAGGGCTCGTGATCATCGTCACGCCCAGTGAAGCTGATGTCCATGGAACTGAATGACCAATCTGAACTGCCAGATCAGGAGTACCCCGTATGTTGGCAGGGCAAGAACTCTGACTGGTACGCTCAGTTGGTCGTAAAAGGCGCTGCTGTGCCGCGAAAGGAGATGGTGTGCAACTTAGCACCACATCCGCCTCACCGATGAAATGCTCGGCTGGCACAGTCCGGTGAGCTTGACAAAGGACACAGGAGGCGGAGGTTTTGTTTTTTTAGGCAGTTATTTGCCACGCTGTTGCAAGGTAGAGAGCCGCGTATTGTTCAATAGTATTACCGGGCTGAAGAAGTGGACACAAAGCTGGCAGAAGCGGTCGTTAGCACGGGAATTAAAAATAAATGCAGGCAGAGCACGGTTTGTCAAGGCTGTTTTTAATGAAATGGAAGTTGAATTTTACGGCTTTAAAGGTCAAAAGAATTAGCAGTTATTTCGCGGATTAAACGTTTTAAAGAAATGGCAATTAAAACATAGTATATCTTTGCTTATAAATTCAAAGAAACAAATTCGATATAGATATGCAGAAATAAATATGGAATTCCAGTTTACACTTTTGAGGAGTGTCCTCTGCCCAAACCGAAATGCATCTCTCTGGGATGAGCTGATGGAGTCCACCTCCCCGTCGCGACCGTTTGCATGCTCTGCCCGCATTCACCTAATAGCCCACTCATTGTGCCTCTTACCTGGAAGCGCTACCACTCGCATAAGGTAGAGTATGTGATCTCCAGATCAATCGGCGAATACCATGCTTAAGCGCATCTTCAGTTATAGTCCGCAGATCTCTAATAGGCCTGAGGGCCATTGGCCGTAGCACCGAACAGCTCCTTTCAATTATGAGACCTGCAAGTGGCATTGCTCGAACTGGTGCAGCGTATAGCATGAAGCCTTGCTACTGGCCACCAACAGTTTCCTGGCCAGGTATCTTGGGCCTCCGACGTTGATAAGCCTCGCCAACGAGGATGCGACTGCTATCTTCTTGCTGGCGTAGCTCGCGTAGTCCTTGAACGATAGTCTGCGATCTATCATTACCCCCAGGTACTTTAGGGACTCTTGAGGAGTCCCCTGGTACTATGACGGAGACCAGCATGTTCTCCATCTTTTCCTGCTGCTTAGTAGGACTGGCCAGTCTTGTGAGCCGCTATTTACTGGCCAGCTGTGATTGCCATCGTCAGCCAGGAACAGCTGCCTCGACGGCTGGATTCTGTGACGCACGGCGGAAATCTACAGGGCAGGGCTGCCTCTGTTAGCCTCAAAGTGTACGTGCAGCACGGAAATAGCTCCTAGTATGTGGCCCAGGACCCCACGGGTGGATGGGTTGCCGCTCTCCTTGGCTCGTTGGTGGCAACGAAGCATGGGCGAGGCCCCAACAGATATCGCTATCTGCGCCATCCATACGGCTCTACAGCCAAACAGCAGCCGCGCTTTGGCAGCCCGCGATGCCATTAGCAGACTCCTAGGCGTTTGCTTCAGAAGCCTCAAAGGTTCCGCGTGGTAGGTACTGCCTCTGGCTCGTTGCGCCGTTCTCTTAGCCCTGGGGCAATCATCAGACCGTAGTTGGCTTGGGAAGCCTCACCAGTAAACGGGTGGTTTGCGCTGTCACCTTATTTTCCTTGGCATGGTGCGTCGCGAATTCTTCCCAGCATATTCGTAGGGAAGGCCTGCCGCCATACTCTCTGCGTCCACGTTTGGGATTTTCCGGGGTGATCTGATAGGCCAGCATGGCCTCATCGATCTTCCGCCGGTATCCCCATGTTTCCCCGGCTGTTCTCTGCCGTCTTTTTTGGTAATACCCTCCGGGAAAGGAGATCAGGGCGTAATTCGCTCAGCGTCATGACGTCATGGACCAATCCAGTTGTTGTTATCCTACTGCCCTCTGCTGACAAAGTTAACGTCAATAAAGGGGACGTACCTATCGTTGTTAAACGTCGGCTTCCGTCCATCGTTCAGCGATGTAAGTCCCAGCATTCGCGCTGGCGTCAATCACAAACTCGTCTCCTGGTGTTGGATGTCTGCTGCCCCATTCCACTGTCCAGGCATTAAAGTCGCCGTACGGCCTTCCGGGCTTCGCCCTCTCGCATAGTCCACGAGCATCAGAAATCACTCGAACTGATCCGGGGTGTCGCTCTCGGCGGAGCGCCAGCAGCTACATGCACGTGTTTTAGCTTCCCGCATAGGCGATACCCGCATGGAGTAAAGCAGCCAGTTCCTGGACTGGAAGGCGCGGCATTTGATGCTTCTTTACCTCGTCAAAGGATCATGGACGATTATCCACTGCCACCAGAGACGTAGAGGTTCGCCAAGACATGATATCTACATTGCGCTCAACCGCGATCCTGGACAGAGGAGGCTCACGGGCTGCTGCTGTGGTCCGGCGATGAGCTGTACTACGCTAATATGAGCGTGCATTAAGGTGGCTCAGCATCTTTTGTCGCTCTGTAAGTCGAACGCATAGAAGCTACCCGTCGGGTGAGTTTCTGTCCACCTCGCTTAACGCAGATCAGGCATTTTGGTGCAGCAACGCACCCCTTTACCTTGTGCCCACGCTCACCATCTAAGACAGCAGTCTGCCTGTCAGTATCCTTGCAGGTTGCTGATCGATGCCCTTAATACGAGACACCTGTAGCATCTCTCATTGGTCGGACGTCCTGGAGTGTCTGACATCGCAATAAATCACAGCGATTATGGTGCCCTGTTTAAGGACTGGTATCATAACGTTCGCTCAGCAGCACTGGGGCTATTTGCTTGCAATTCCGCATGCCTGCGAAATTTCTATTCGGTTATCTGCAGGCCCTGGAATTGGAAGAAGCGTGAAGCAGCTGTGGGCTTCTCTGCTGTCGTAGCCTCGTCAATCCGCTGCAAGATAGAGCTATTCTTTGCGCTCCTGTATGCGCTGAAGTAAGTCATTTGAGCGCGCTTCAGGTCGCTCTTAAACTTCAGGAACAGCACCGAAGCTTTCCCCTCTACCTCAAGCAACAAGATCCACCTTTTCTGCGTTCTCCGGATTTTTCGCACGTGGCCTGCCCAGTTCGCTTCAGGCTCGATTCCGATCTGGCTTCCGAGCTCTCTGCGTGGAAACTCTCTGTCTTTTACGGTAGTGCCTCCTGCCACCCGTGCTAGCATTCTTGGCGACAGATGCATAGCTGCCTGGCGGACTCGTTAAAATTATGGATGTCGCGCTTTTCTTCACCGTTACCGAAAATCCAGCGTAGGGTTGCTCTGCTTCCTGGCGCCTGGACTTTGGCACCTGCACCGTGGGTACCTGCGCATTTGTAAGGGCCTTTTTTTTTGGTAGGCTTTTGTACACTCCCGTCTGGTGGCGCTGCTCTTCGGCGGTGCTCGCTGATAATACCTTCGTACGGCTCTATCGCCCTGTTGTTAAGGGCTGGGAAGTTCGGAAGCTATGCCCTTTGTCTCTCATGTGTGTATCGTTGGGTCTCGAATGCCTGCGGATGGGGCTGATCTTGCCGACCATCCTGGTAAATGCCCTCAGGTCCTCGTTCTGGAGAGCGGTGGTCGATCCGAAGACCGATGAGAGGAACCAGCTGGGGACTTCCTCCGTCTTTTTTTGCGATGGCACAGCGATGGCAATTCATCGTCTTCTGACTTGTCGCGGTCATGGATGCTGTAGGAGCCAACGTTTCTCTCCACCTCTACAGCATCGCTGCGTCGATAGTCAGCAGCAGCGGCTGGGGCCTGCGTACTCGCCACTTGCCACCGACGGGACCAGAGGATTCCATCACCATGGGTCGGGTTACCGACTCCTCTGGTGGGGATCTCAGTCGGAGCTCACCTCTGAACGGGCAGGTCGTTGCGATCAGGACTGCCCTGCGCTGTCCATCAACTGGAAGGATGGCCTAAAGGTTACCTAAGTCCGCGTAGGCACGGATTTCCCCTGGCTTTACGGATGGAGGTTTATACCGCCTGACTCGGACACCGGAACCTCTGCTTGACACCAGCACGGTAGAGAGGATGATATTTAGTCTATCCGCGACCTTTGTGCCTTTTCCCTTTCTTAAAGGAGCTTGTGCGCTCCCAGTTACGGAATCAAAGTGCATTAAATTAGAAGATTTCAAGCAGCAATTTTGGTTACTTTGGGTTTTGTATGCATGCGGCGGCGCGATGCGGCGACGCCGGAAGGTTGCGCAAAAGCACCGACGTTTGCTGTCCGGGAATCAGAAGCCGTTACTGTTTGCGTAGAACTGAAGGGCTTTGTCCGTGATTTGCGGCGGCTTCCGTGATGGTGCGCATTTTGCGCCAGGCGGGCATGACGCCGGTTTCAGGGGCCTTTGATTTCGAGACGTCCGTATTTTGCGGCGTCTGGGCCGGTCTCCACTTTGGGATTGATGTCAGGCGCGTTCCGGATTGAAACTTTTTTTGGCGGTGTTTACGATGACGTTGGTTTTGGCGGTTTTGCGCGGTTCAGGAAAGAATGACTTTCGGTGCATCAGGCAGGTGCGTTTCAGTTGCAATTCACGCTCTGTTGCGTGATTGTGGCGATCTGGTGGCTGGAATTTGCCCGTTATTGCGCCAATGCGAGCAAAAGCGAATGGCGGTGCGCAATTAGGCGGTTATTGCCGCCATGGCTGAAGCATTCAGCATTGCCTGCCACCACTCCTCCTCCAGCACCATCAGCTCAGCGACGGTACATATATATACATATATAAGATACGCATCTCAGCGTTGCTGCGCTGCGAGCTATACCAGCAGCGCTGCTCCTCAGCAAATAAGAAACCTTTGTATGTAGATCATAAGAAGTTGACGAATTAATTTCAGATGGGGCGGGACCTTCCCTGTTCCTCAATTGGATCAAATAAAGAACAGCTTCAAAACCTTACAAATGATCTATGACACAATGGAAACTACAGGAAGTTAGGTAAACGATTTATGATATCCGGATCTGAATCACCTCGCTATACTCAGCATCCTCTCTACAACGGACCTAAAGTAGCGAAAACAGTCGTTAACGAAATTAAAGGCAAATCTGCGACAAGTACAGTTTATCAAAACTGTTTACACCAAATGAAATAAAGTTGAATTTTGATTTTAACGCAGTCCGCTTCAAAGTCAGGGTTATTTAGCCAATTAAACGCAATTTTTTTTTAGAATATAATTAAAGCAATATTTATTTACTTATAAATTAAAAAAACAAATTCAAAATCTCAGAATATACAAGAAAAATAAATAATAACAAATTTCAAGTTTACACACTTTTGAGTATCCTCTGCCCAAACAAATCATCTGGGATGAGCTGATGGGATCCACCTCCCCGTCGCGACGTTTGCATCTCTACTCTTTTCCATTCACCTAATAGCCACTCATTATTGCCTCTGCCTGGAAAGCACCCTCCGCATGAAGGCTGAGAGCCTTGATCTCCAGATCAATCAGGCCTGGCACTTTGAAAGCGCCGCCGCATCTTCGGATATGGTCCTGAATCCTCCTAATAATGAGCCACAGGGGCCATTGACCGTAGCACCGGAGCAGGCTCTTTCAGGTATGAGACCATACCAAAGTGGCATTGCTCGAACTGGGTGCAGCGTATAGCATGACCTTTGCTACTGACCCGCCAGCAGTTTCCTGGCCCGGGCCTTGTCTTGGGCCTCCGACGTTAAGGCATAAGCCTCGCCAACCGGAAGAGGATGTGACTGCTGTCTTCTTGCTGGCGTAAGCTCGCGTAGTCCCTTGAACGATAGTCTGCGATCTATCATTACCCCAGGTACTTTAGGGACTCTTGAAGTCCCTAAGGTACCGGCGGAGACCAGCGTGACTACTCCATCTTTCCATCACCTTGATGGGACTGCTTCAGTCTTGTGAGCCATTACTCAAAGCCGGCTGCCAGTTACCCACATCGAAAACAGGCTACGCCTCGACGACAAGTTCTGTGACGCACGAAATCTGGGGCAGGGGCTGCCTCTATTATTGCCTCCATATGAGTAGCAGATCATAGCTTTGAAATAGCTCCTAATTATATTAGCCAGGACCCACAGGTCGGATAGAAGTACTCATCGTTGGTAACAAACGCTGGGCGGGAGCCCAGATATCGCTGTCTACGCCATCCTGCAGCTCCACATAAAACGCGACGCTGGCGTACTGATGCCGTGCTTGAACTCTAGGCGTTGCTTCCACAGAAAGCCTCAAGAGTTCGCGTAATTGCAGAGTACTGCTGCCTCTTGCCTCTCTGGCTCGTTGCGCCGTTCTCTTAGCCCTGGGCAATCCGGACGTAGTTAGCCAGGAGGCACTCCACCAGTAAACGGAGTGGTTTGCGCTCAGCACCTTATTTTCCCTTAGCGCCAGTTGCGTCGCAGATTCTTCCAGCATATTCGCGGGGCCTGCCGCCCGCCTCTCTGCGTCCACATTTTAGGTTCAGAGATTGATCTGATAGACCAGCGTATCATCGATCTTCCTGGTGTCCCATATTTTCCAGCGCAATTTCTCTCTGCCGTCTTTTGGGCGTACCCTCCGGGGAGAAGGAGATCAGGGCATGAAGGTCGGCTCAGCATCGCATGAAGCGTCATGGACCATCCAGTTGTTTGTTGTCTACTGGCCCTCTGCTGCGGCAAAGGTAAGCGTCAATAGGGACGTACCCTATCGTTTATTAAAACGTCGGCTTCAAATCCATCGTTCAGCGATGCTGAGGTCCAGCATTCGCATGGCGTCAATCACAGCTCAAATCCTCTGGTGTTGGATGTCACTGCTATTCCATATCCCAGGCATTAAAGTCGCCGGCAATGACCTTGGGAAAGCTTGCCCTCGCATAGTCCACGAGCGCCTCCAGGAAGCTCCTCTCCGGGCGAAATCAGGGTGTCAGCTCAGCGGGAGCGTAACAGCTAATACATGCATGCGTGTTTTAACTTCGCATAAGCGATACCCGCATGGTAAAGCAGCCAGTTCACGGACTTGGAGAGAGCTGCAGCATTTGATAAGCTGGCACACACCTGCATAAATCAGGGATCATGGACGATTTTCCACTACCAGAGCCGTAGGTTCAGCAGGAGCATGATGTCTACATTGCGCTCAGCGCAGTCCTGGGCAGAATGGGCTGCTGCGCAATGATTGACATTGAGCTGTACTACGCTAATATGACGATGCATTAAAATTGCTCTTGTATGGCATCTTTTAGTGTCGCTCTGTAAGTCGGAGCGCATAAAGCTACCGTCGGGTGGTTTCTGTCACCTCGCTTCTGCCACCAGATCAGACATTTTGGTGCAGCAACGCACCCCTTTGCCTTGTACTTGCGCTCCGCCGCATCTAAGACAGCAGCAGTCTACCCTCTCCTTTACGAATTATCATGCAGGTTGCTGATCGATACCCGCCGCCAGAACACCTATAGCATCTGCAGGTCGGACGTCACCGTTATTGACATCTCTTGACATCAGCGTTATGGTGCCCTGTTTAAGGACCGTTATCGCAACGTTCGCGTTCAGCGGCACTGAAGGGCTATTTGCTTTACCGATTTCCGCATACTGCAGGCCCTGATATCTTCGGTTTTATCTGCAGGCCCTGGGTGGGCGACCAAACGGCCTGTGGAGCTTCTCTGCTGTCGTAGCCTCGTCAATCCGCTGCAAGATAGAGCTATTCTTTGCGCTCCTGTACTTTTAAAGAGGCCAGAATCATTGAGCGGCGCCGCTGGAATGCGCTCTTAAACTTGGGAACGGCACCCGAAGCTTTCCCCTCTACCTCAAAGCAACAGATCTGCTTTCTGCGTTCTCGGATTTTTCGCACGTGACTGCCCAGTTCGCTAAGGCTCGATTCGATGCCAGCCGAGCATCTGCGTACCGAAGCCTCCTGTCTTTTTTTTACGATGGGTGCCTCTGCACCCGTGCTAGCATTCCTGGCGACAGATACGCCAGCTGCAAAGCGGACTCGTTAGGTATGGATATCGCCTTTTATTCACCGTTGCCATCAACGTGGGGTTGCTCAACCGGCGCCTGGACTTTGGCACCTGCTGCCGTGGAGTACGCCGCATTTTGTGGAGCCTTTTGGTAGGCTTTTGTACCTCCGTCTGGGTAGCGCTGCTCTTGGCCGGTGCTCGCTAGTAATACCTTCATTACCGACTCTATCGCCCTGTTGTTAAGGGCTGAGAGTTCGACTATGCCTTTGTCCTCTCATGTGTCGATTGCGGGTCTCAGATGCGGATGAAGGGGGCTGATCTTGCCATTCATCCACGCCAGTAGAAGTATACTTGCCCTCAGGTCCTCGTTCTGGAAGTGAGTGGTCCGTCGAAGACCGATGAAGTGAAGCTGGGGAACTTCCCTCCGTCTTTTTACGATGGCGCGGCGATGTGTCATCGTCTTCGGCTTATGCGATTATTAGATGCTGCTTAAGACCAGTTTCTCCACCTCTACAGCATCGCTGCAGTCGATAATCCAACGGCGGCTATAGGGGACCTGCGTGCTCACCGCCCGCACCGACGGGACCAGTTCAAATCACCATGGGTCGGGTTACCGACTCCTCGGTGGGGATCTCGAAAATCGGAGCTCCTCCTGAACCGGGTCGTTTGCGATCAAGGACTGCCCCTACTGCGCTTTATCCATCCAGCTGGAAGGATGGCTAAAGGTTACCCTGAGTCACGTAGGCCGCAGTTCCCCTGGCTTTTTTACGGATGGAGTTTGTACCGCCTCGACTCGGACGCCAGAGCCTCTGCTTGAAGCACCAGCACGGTGAGGATGATGATGTTGGTATCCGCGACCTTTGTGCCTTTTCCCTCTTAAGGAGCCGGCGCGCTTGATTGCAGAATCAAAATTAAATTAGATTAAATTTCAACGGCCAATTTTAGATTTAGTTTTGGTCCTCGCTACTGTCGCAACACAACACTGTGATCACGGGGGGTGATCCCAGCGCCTCCCTCTCAGATCGCCCGCTGCTATCGGCTGTTTATCCATACAACAATCGCAGATATCATTACCTATTTACATAGAACAGGCGCACAATTAACTCGCGGTGCGGCGCAGAACTATGGCGCGACTCCACCGTGCCATTTTGGGACAGCGCACACCGGCCAAACACAGCTTCTGTGGTTTCCGAAGGTATTTTAGCGCCGCGTAATTTAAGACGTCGCGTCTTCACGGCGGTAGACTTGGTCTCGCACCAGTTGAATATCTGACCGCAGCTGCGTTCAGGATCAAACTTTGGCAATGACAGCGTGAGTTTTGAGCAGGTCTCTTTGAGTTTTGCGCTTCTTTTAACAGTTCAGAGAAAAATGGCGATTCTGCGACTCTAGAATTATCCCAGCAGGTGTTACACCACTATTGTAGTATGCACGCATATCGGTTGGCACTGTACCTGTATTCATAATTATAGCCTCTGTTACATTAGCCAGTACATAAACAGTCAACTGCAAGTGTATACGTAATACGAGCACCCTTGAGGGCTAAGCAGCCACATAATTGCCTGGTCAGCAGTTCTCCCGCTGGCCAAGCTGATCGCTTATATGTGTTACCCTGCCACTCCTCCTCCAGCACCATCGCTCAGCGTTTTATACTCATCGCGCTGCCCAGGGTTGCCGGGGCGTTGCTGCGCTGCAGGCTAACTACTTGGCGGCGCTGCTCCTCGACAAGCTAAGAAACCTTTGTATGTAGATCTATGCAGAGGATTGACAGATTAATTTCAGATGGGCAGGACCTTCCTGTTCCTCAAATTGGATCAAATAAAGAACAGCTAAGAGCTTCAAAATCTGTACAATGGAAACTACAGGAGATTTAAAATTAGGCGGTCCCACTTCTGATGCTCAGATCTGAATCACTTTTGCTACTCGGCATCCTCTCTACAGCGGACACAAAGTAACAGAGAAAACAGTCGTTAACCAGAGTAAAAATAAATCTGCGGCAAGTACGGTTTATCAAGAGCTATTTACACACCGTGAAATAAGATGAATTTTGATTTTAACGAGTCAAAATTAAAGGGGTTATTTGCTTAATTAAACGCAATTTTTTTAGAAATATAATTAAACAATGGCTATTTTACTTATAAATTAAAAAAACAAATTCAAAATATCAAATGCCAAGAAAGAATAAACAACAGATTCCAAGTTTAAACACTTTTGAGGAGTTCAAGAGCTCTTTACACAAGAAAACCTTACTAAATTACTAAGTTTAATCCTAAAATTTTTAAATTATTTTACATTTAAAAGATTTGAGAAGGATTTATGATATTGGTATGACCCCATTGGCTTTGGCTACAAGTTAGAGCTTTTTTTTTCATGGAATGGATGAGTTTTTTAGATTATTCAATGGGTCAAAAAAAAGCTCTATCATAGCCATGGGCGGCTGTTGTCGTGTTTGGGTGCCCCTTTGCCACATTCTTCTGCTTTAGAAATTGCAGGCCCACAAATTTTCAATGGGGTTCAGATCAAGACTCTGGGGGCGTATCGATCTGCCACAGTTATAAAGGAGCCAGTTGCGTACATTGCACTCTTTATGTTTGCAGGATCCTTGTCTGATAAACTTAAAATTTGAAAGCATTGTTGCTAAAATAGACCAAATTTTCCTGCACTGGCCTTAGATTTGATTTAAAATATAGATATTGCAGCATTCATAGTGCTTTCAATAAAGGAGCTAATTTGCCCACTCCGGCGAGATACAGCCCCAAATCATCACTGATAATTTTCCGATTTGAGTTGGAATGATATTTTGTTTTCCTGGCGCACTCTTGGCTTGCGCCATACTCTGCTCCAGCCGCATCGTTATAATGAGAGCATCATTTTTTGTTTCGTCACAAAATGACGTCATCCAGTACCTCTTCCGCATGATCCATCATGCTCCACAGCGAATGAATGACCTTTTCCACTATATTGACCTCTGATAGCAAGGCTTTTTCTTGCAACTCTTAGAAGAGTACCTGTAAGCGTAGAATGACTTGGCGCACAGTTTTATTAATGGCACAACTTCGTCACATTCTTGCCTGATATCCTGAGCAAGTGATCTGGCCGAGATTCAGGGGGTTCACAATCACTTTTCCTTAATGGGCGGTCTACACGCTTGCTAATTTTAGTTTTGCGCCCACCCTCTTTTAGAGTTCAAGCCTATTCTCTTTTTTTTTTCAAGCGATTAAAAACATTTATAGACAGTCTTACGGGATACAGAAGACATTTATATATAATTCCTGGAATAGATTTTCCCAACTGGTGGTTTTAGTATATTATTTAGGTCTAAAAGCCTAAAAGCTAATCTATTTCAGGCATTTTATTAAATTTAATAACTCATTCCGATCAACAAAATTTAAAAACAATTAAAAAAATTTCCAATGAAGCGTTGTAAAGGTACCGAATGCAAAATAACCGGAAAATCCAGGTTCGTTCTAAGAAAGAACAAAACAAAGTAGGAAAACAAAATGTGTAAGGAGTTTCTTGCCACTCTCAAAAGTGTGTAAACTTAGATTTGTTATTTTAATTTCTTGTATATTTGATATTTTAGTTGTTTTTTAATTTATAGTAAAATAAATTGTTTTAATTATATTTCATTAAAAATTGCGTTTAATTAAAGAAATAACCCATAATTTTGACCTTTAAAGTGAAAGGAATTCAACTTATTTCACGGCGTGTAAATGGTTTCTTGACAAACTATATATCTACCGATTTACAGCTTGCGGTACCATCTGCAAGATTCATTATTGAAGTGGACTTTGACTCTCAGATGAATTAAGAGCATTATATTCTTAGATTGAACTGACGAGGAACCAGATGAACTAACTAAACTATCATTTAACTAAATTTTAATTTAGGATTTACTGATAATTTTGAGTTTCTTACAAAGATGACTAATATTAATTTTAGTTAAATGGTTTTTTTGAAAACTAGATTTATGTATAAATAATATTTCGAATTGATCTGGTTGGGTTTCTGGGTCTCCCCAACACCTCACTTAACAGATGCTGGATCAAAGGAATTATTCGTCAGAAGGACGTGCACAGTCTCGTGAGTAATAAAATTACAGCAATCTTAGCACAGGGTGGCGTGTTGGAAAGTATGTACACATTTAAGCCAAAAGTCACATGGCCGCATCAAAGACACTAGAATAATAAGATCGCACGTAACAGCCATACACTGGTTTGTACCTATACATTTGGCCACTTTTGGTGACGGCCAAAATTGCTCTCTCCGCTCGCTCACGCTGGGCCTTAAAGAGTCAAAATGGGAATTTGCTTGCTTGTGGGTAAAAACAAAGGGCAAGGAACGCGTATATATGTGATGTTGTGCTAGAAGAGCGATTTTCGGGCCGAAATCAATTCTGATCGCAGTAACAGATTTACATATGCTTTGCATACATATTTAGGAGTTTGGCCAATTCATGGAATATGATAAGGAATTGCGCGCTGTTTAAGATATCAAATTGGATATAAAAAAAACTGAAAAGAAGTCATTACACAGAAAAAAATATTTCATAAAAATAAATGCAGGAAGTAGAAATAAAAGATTATAGAATAAAAAAATGTTAACTGTTTATTTGCAGGCGTATCAAATTAAAATTATTCCTAGTGTCTTTTAGCTTTTGGTCATATCTTGCAGGGGCTGGGGGAATTACGGACACAAACACTCAACAATCCATTTGTCTTCTTAATACTCAAAAAATAAGGGCTGACACCAAGCAGGAACTATAACTGCTTTAGAATGCTTGAAGTAAAATAAAATCAAAAAGAGACCAAGCCCCTCCCGAGAGTTCAAAGAAAGGAAACAAGTTCCTGGATGATTCATCAAGCCACCAGCGCGAATAATTTCGCTCTCTTAAGCGACGGATTGCCCGACAAACAGAACAAAAGATATAGCAAAACGAGATCTCAGAATAGTGGAAGCGAGAGACAGTGCAGCTTCAGTTTTTGCTAAGCCCCACCTATCTTTCTCTCTGACGTCAAATGCAGGTATAAAATTATGAAAAGAAGCTAGCCTATCTTAAAGACTAAAATTAAGAGAACTTTTTTATTATAAGACTCAACGTTTTATGGACATATGCAAAATTAATGGATTCTAAAAGTATTGAAGAATTCACAGATAGTCAAAACCTTAATAATGATTGTGTGCAGTACCACATACCAACAAGGATAATAAGAGCATTTAGAGTTGTTATTAAAGGGGTGCATTTTTCTACGATTTAGATAAATTAAAGTGATGAAGAGTCAAAGGTCATGTTGACAGAAACTTATAAGTAATATTAAAAGCCATTACGACAAAGAGCACTGAACATGTTTTGTAGATATTAGGGCAACAAAAGAAAAACCTAGACATATATAATTAGCAAATAAAATGTGGAGCCTCCTACCGATGATAGAGCTCGTTCAATATATAGCTGCCAAATTCGGACATACTAAATCCTTGTATGCAAGGCATGCCGCTGTGTAAAGTCCTCTTCTCGACACCCAAGCAACATTTTACTTTGAAAATACAGAACAACCAATACAAAATGTAGCAACTGCTGCAGAAGAACGCCGCCAGCTACAAAGGGGTCATGGAGATTTATCAGGAACTCTTGTCAAAAAAAATGAAAATAGAAATATTGATCTGAGTAAAATGGTTAGGAATCAGCAAAGTTTACATTTCATACAACAAATGACATATACCCAACAGAAGCGATTATCAGTCTTGTGCCCAATTGCCGGAAAATAGCAGAAACGAGCACATCACTGGAGAGGGCCAGGCAGCTATTAGGAAAGTGATCTGAACTTACAGAATGATTTACTTAACATGATAATGTACTTATGAAAACAAATTATACAGTGATCTAGCCTTGGAATGTAGGTAGTAGGAGTGACTTCAATGCTAAAACTGAAGGGAAAACAGGCTGTATACAGATGCATAGTAAATATAACCAGCATAGCAACTCAGCCAGCAGGCCTACATACTGGCCTACTGATAGTAGAAGATACCAAACTTAACCTTTTCACCCCAGCGTTGCTTTGTAGCAAGGCAATTTCTATGTTTCAGGGCTAACTGTAAGTGTGCCTTTTTGTTTTATCTGCTGATGCTTAATCCGTAATACG
->f4f56757-4761-4f86-a434-3d8c09be3b37
-TTGTTGTACTTCGTTCAGTTACGTGTGCTACCATACCTACCTGGTGTGGGTAACTCAGGAGTGCTGCGATGAGACAGGCAAGGCGGCCATTAAATGTACATCAGGCTATTGGTGAAGTGGGATACCGTACCAATGCTGGCATAGCATACGCCAAATTAAGAGTCCGCTGGCTGCTGCCTTCCGCAGCGACGAACAATTCGAGGACATGCTCGAAAGCTGGTTAACCATGCAAGTGGGCGCAGACCAACAGTCATCGGAGGTGACCTCAATGCCTGGGCTACAGAATGGGGCAGTCAGATCTCTAACACAAGAGGACGAGCAGTGATCGATGCCATGAACCTGCTGAATCTCGTATTGCTAAACTTGACGGGTTCGACGTTCAATAATGACAGAGGTACATCTTTCATTGATGTCACCTTTGTTAGCAGAGTTCTGATGGCTAGCTCGAACTGGATGGTCCATGAGGACATAACGCTGAGCGACAACTAATCACGTTCGGTGCCCGAACAATGAGGCCGTCACCCAAACAGCGAAGATGTGCGCTAGGTCAGTAGCGGGACATTAGGAAACTGGATGAAGACATGCTGGCATACCAGATCGAGGGCATGGAGTCCATAATTGGACACGCGGAGACCATGGTGGCAGCGCTCATGGATAGGCTTAGAGCAATGTGTTGATGCGGTGATGCCGAGAAAAGGAACACGAAACGAAAGCCCCTGTCTACTGGTTGGGTGACTCATTGCACCAGCTTCGGACGGAGATGCATCAAGGCGAGGAGGCAGCAGCGATCTAGAGGAGCAACCGCGCACCTCCCAGTGCATTGGGGTATATAAAGCCAGAAGCGAACTGGAGCTTAAGAACGGCATATCAGCAGCAAAGGCGGGCGATTTCAGGACCTGATTGATAGCGTAGACGACGACCCTGGGGTCTCGCCACCACAAAGTCGTAAGGAAAAAAACTCAATTCCGCTGGTGCAGGATCCCCTCAGGACCAGCCGCCCTGGCCAACATCGTGTCGGAACTATTTCAAGCCAACACACGTTATGGCAGCCCGCTGTTGACCCCCGCCTCTGACTTCCCGTGCATCACGTCATGCGAGTCGTCGAAGCAGCAAAGAGGATCGGAACCGAACGAAGCTCCGGCATTATTGATAAAGGTATCCGGGCGACGTCAAAGCAGCCGCCACCGCACAAGACCGGAGGTCTTCAGGGGATACATTCAACGGTGTCTGCTGGACGGAGTCTTCACAAGCGCTGGAAAAAGATGAAGCTGGTCAGCTTCTGCCGAAGGCAAAGGCACAAATATTCCGCAGTTACCGGCCATTTATTGTCTGTTGGACATTGTTGGCAAAGCTCTTTGAGCGCATACTGTACGCGCATTGGGCTAATCACTTCCAGAAAGTCCTACAGGCCTTCAGGGGCCAACGGTATATTTCGAAAGGGTAAAAAGTACGCTCGACGCTCAAATCCGTAACAGACGCTGCCGGAAGCTCGACGGTAACCGGTGGTTAGGCGGCGGTAAAATACTGTGCCATCATCACGCTAGACGTCAAAGAACGCGGTACAATACAGCGAGATGGCCCGGCTTATCCTCGAGACTGCCCGCGGCTTGGGCGTTCGACTACATACGAAGGCGTAATTGGCAACTACTTCCCGGGGACCGTGTGTTATGGTGCGTAACAGAGGAGATGGTCAAGAAGCCACCAAATCTCTGCGGGCGTTCCCCAAGAGGTCGGTACCGGACCGATCTTGAACATTATGTATGATGGAATACTGAGCATTGGCAAGCCCAGAGGTGTGGAGCTGCACTGCTTCGCCGACGACGTTGCGATAACAGCGGTCGCCAGGCAATACCGGAGCTCAGGACATAAGTAACGTGGCAATCACGGCGGCCGCCAAATGGCTCGAGAAAGTCGGACTTAAAATAGCTGCGCATAAGACCGAAGTAGTCCTGCTGAACAGCAGAAAGTCCGTTGAGTCATGCGTGTGGAAGTCAAAGAGTTGAAATCGCCTCCTTAGAAACGTTGAAATACCTTGGTGTTCTAATAGACCGAAGGCTCGTTTCAAAGGCTCACACCAAAGGTATGCCAGCAAAAAAGCGGCAATGACAGCAGCTTAGCCTTGGCGAAATCATGCCCAACATGGGAGGACCAGACTGCCGGCTAGGAGACTGTTAGTGGCGGTTTCGAGCAACACTGCTTTATGCTGCGCCTATCTGGAGCTGCGTTTCCACAAAGAAAACCTATCTAGATAGTGCCCGCGCAGTAGCTATCGCGGACAACAATGGCTCTCGGTAATCAGGGCTTTGAACCATATCGGACGACGCAGCGCACGCTCTGTCAGGCATTACGCGATTGACCTGGACATAAAGGGCCAAATACCTTGCAGTGAGGGATACACTCAATTAGAGATCAAAGAGTGGATTCGAGGGAGTATGGCGAACCAGGTGGCAAGAGTCACAGCAGGGACGCTGGACACAAACTCTAATTTCCGCAGCGCTAACGGGTGGGCTGATTGCGAGCACAAAACGGTGGACTACCGCGACCCAGTTCCTCACGGACCATGGCTGTTTTCGAGGAGGTACCTATGTAGGTTCCGCCATTGGATACAGCCCAGTGCCTTTATTGCACAGACGCAGTGAAGCCGCAGAGCACATCCTACTGCACTGCTCCAGGTTCGCCGAGGAGAGGGCGCAACTCGTGGCGCTCAGCAGGTCACCCTCTCAGCCCGAAACTGGTTGCTGCTATGATGGCGCGGACAAAATCGTTTGGGATGGGGCTCGTGGTCATCGTCACCGCGTGAAGCGTGCATGGAGACGAGATGACCAATCTGAACTATAGATAAAGGAGTACCCCGTATGTTGGCGGGGCAAGAACTCTACGACTGGGTACGCTCAGTTGGTCGTAAAAAGGCGCTGCTGTGCACCGCAAAGAAGATGGTGTGCAACTTGGCACCACATCACCGCTCACCGATGAAATACCTTGACTGGCAGTCGGTGAGCTTGACAAGGGACAGGAGAGCGGAGGTTTTGTTTTTAAAGGAAACAGTTATTTGCCACGCTGTTGCAAGGTAAGAGAATGCGTGTTCTAATAATAGCCAAAATGAAAGAAGTGGACACAAAGCTTGAAAGCGATTGAATTGGCGGAATTAAAAATAAATCTGCGACAAGTACAGTTTGTCAGAAGCTGTTTACACACCGTGAAATAAGTTGAATTTTTTTTGACTTTAAAGGTCAAAATTAACGGTTATTTGCTTGATTAAACGCAATTTTTTAAGGAAATATAATTAAACAATATATATTTTACTTATAAATTAAAAAACAAATTCAAAATATCAAATATACAAGAAAATAAATAACAAATTCCAAGTTTACACACTTTTGAGAGTGTCACTCTGCCCAAATAAATCATCTGGGATGAGCTGATAGGTCCACCTCCCCCGTCGCGACGTTTGCATCTGCTCTGCCATTCACTAATAGCCACTCGTGCCTCTTGCCTGGAAGCGCCACTCCCGCATAAGGCTGAGAGCCTTGATCTCAGATCGTCGCTTGACCTGCCAGCGCTGGCGCCGCGTCTTCGGATATGGTCCTGAATCCTCTAATAATGAGCCTGAGGGCCATTGACCGTAGCACCAGGTGAAATCTCCTTTCAGGTATGAGACCCTGCAAGTGGCATTGCCAGACTGGTTACGGCGTATAGCAGCGAAGCCTTTGCTACTGACACCAGCGGTTTCCTGGCCAGGTGTCGCGGGCGCAGGCGTTGGGCGCTAAGCCTCGCTAACAGAAGAGAGGATGTGACTGCTGTCTTCTTGCTGGCTGACTCGCGTGGTCGCTTTTTTTACACGAGCGATAAGTGCGATCTATCATTACCCCCAGGTACTTTAGGGACTCTTGAGAGGTCCCTGAGTACCCTTGACGGAACCAGCATGTTCTCCATCTTTTTCCTGCTGCTTAGTAGGACTGCTTCGGTCTTGTGCGACCGCTGGCCTTTAGCCCGGCTGTGATTGCCATCGTCAGCGAGCAGCTGCCTCGACGACTTCAAGTTCTGTGACGCACGATCCTCTGGGGCGGGGCACTCACCGGCGGCCTCCCCATGGTGTGGTCGCTTTGGAATAAAGCTGCCTGGTAGCCGGCCGGGACCCAGGTCGGATGGGGTTGCCGCTCTCCTCGCCAGCTCGTTGGTAACAAGCTTGTAGGCGGGGCCCCAGATATCGCTGTCTACGCCATCCTGCGAAGAGAACCATGGCGCTTTTGGCAGCCGCGATGCCGTTAAGCGAACTCTAGGCGTTTGCTTCTGAAAGCCTCAAAGAGTTCCGCGTGGTGGAGTACTGCCTCTGTCGTTGCGCGTTCTCTCACCCAGCCCTGAGGCAAATCAGACCGTAGGTTGCGGCTTCCAGGGAGGCACTCCACCAGTAAACGGGTGGTTTGCGCTGTGCCTTGTACCTTGGCATGATTGCGTCGCAGATTCTTCCAGCATATTTCTGGGGGCCTGCCGCCATACTCTCTGCGTCGTTTTAGGTTCCAGGGAATTCTGATCTGGTAGTGGCATGGCCTCATCAGTCTTCCTGGTGTCCCATGTTTTCCAGCTGTTCTACTCTGCCGTCTTTGATATGCCGCCGGGAGAAGGAGATCAGGGCATGGTCGCTCAGCGTCATGACGTCATGGACCATCCAGTTGTTGTTGTCTACTAGCCCTCTGCTGAGCAGGTAACGTCAATAAAGGACATTACCCCTATCGTTGTTAAACGTCGGCTTCCGTCCATCGTTCAGCGAGTATGGTCCGTTCGCGCTGGCGTCAATCACAGCTCGTCCTCACTGGTGTTGGATGTCCCTGCTGCCCCATTCCACTGTCCAGGCATTAAAATTAGCCGGCAATGACCTTCAGGCTCGCCCTCTCGCGTAGTCCACAGGCGCCTCAAGCTCCTCGAACTGATCGGGGTGTCGCTCGGCGGGCGTAGCAGCCATGTGCGCGTGTTTTAACTTCGCATAAGCGGTGATACCCCGCATGGGTAAAGCAGCCAGTTCTGGACTTGGGAAGGCTGCAGCGTTGATAGCTGCTTTACCTGCCTCGTCAAGGATCATGGACGATTGTCCACTACCAGAGACGTAGGGTTCGCTTAGGAGCATGATGTCTACATTGCGCTCAACCGCAGTCTGGGCCAGGGGAGGCTCTGAGCTGCTGCGCAATGATTGACGCGTTGGGCTGTACTACGCTAATATGAGCGTGCATTAAGGTGGCTCTTGGCATCTTTTAGTGTCGCTCGCAAGTCCGGGCGCAAAGCTACCCGTCGGGTGGTTTCTGCTCCCACCTCGCTGCGCTTCTGGAACAGGCATTTTGGTGCAGCAACGCACCCTTTGCCTTGTGCCCACGCTCACCGCATCTAAGACAGCGGTCTGCCCTGTCAGGTGTCCTTACCGGGTTGCTGATCGATGCCCATAGCCGAGACACCTGGCATCTCGTGGATTGGACGTCCTGGAATTTGATACGACATCTTGACCATCAACGATTATAGTTGCCCTGTTTGGGACTGGCTGGTATCACTGGCGTTCGCGTTCAGCAGCACTGAGGGCTATTTGCTTTGCAATTCCGCATACTGCAGAGAAGGCCCTGATATCTTCAGGGATTTATCTGCGGAGGCCTGGAATTGGGCGACCAAGCAGCTGTGGGCTTCTCTGCTGTCGTAGCCTCGTCAATCCGCTGCAAGATAGAGCTATTCTTTGCGCTCCCTATTGCGCACAGAGGCCAAGTCATTGAGCGCCGCTTCCAGGTCGCTCTTAAACTGGGGCGCTTTGGCTTTTCCTCTACATAACAGCGGAATCCGCCTTTCTGCGTTCTCCGGATTTTCGCACGTGACTGCTTGATTCGCTAAGGCTCGATTCCGATCTTAGCTTCGAAGCATCTCTGCGTACGAAGCCTCTCCTATACTTTTACGATGAGTGCCTCTCTGCACCCGTGCTAGCATTCTTGGCGACAGATGCATAGCTGCCACAACCCGGACTCGTTAGGTATGGATGTCGCCTTTTTTCTTCGTTGCCGTAACGTAGGGTTGCTCTGCTTCGGCGCTGGACTTTGGCACCTGCACCGTGGGTACCTGCGCATTTTGTGGAGCCTTTTTGGTAGGCTTTGTACCCTCCGTCTGGGTAGCTGCTCTTCAAGCGGTGCTCCTTCGTAGTACCTTCGTACAGCTCTATCGCCCTGTTGTTAAAGGGCTGAGAGTTCGGAAGCTATGCCCTTGTCTCATGTGTGTCGTTGGGTCTCGAATGCGGATAGAAGGGGCTGATCTTGCCATTCATCCTGGTAATTATGCCCCTCAGGTCTATAGTTCTGGAGAGCAGTGGTCAAGTCCGAAGACCGATGGGGAACCAGCTGGGGACTTCCTCGTCTTTTTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCTGACTTTAATCGCGGTCGTAGATGCGGTGTTTCTCCCACCTCTACAGCATCGCTGCAGTCGATAGTCAGCGGCGGCTGGGGGCCTGCGTGCTCACCCATACCACCGACGGGACCGAATTCCGTCACCCATCGGGTCGTTACCGACTCCTCTGGTGGGGGGATCTCGAAAGTCGAAGGAAGCTCCTCTGAACGGTCGTTGCCGCGATCAGGACTGCCCCACTGCGCTGTCCATCAGCGGCTGAAGGATGGCCTAAGGTTACCTAGGTCACGTAGGCCACGGATTTCCCCTGGCTTTTACGGATGGAGGTTTGTACCGCCAATGGACTGAGAGCCTCTGCTTAGGCACCAGCACGGTGAGAGATGATGTTGGTCTGTCCGCGACCTTTCCTTCTTAAAGACTTGTGCGCTCCCAGTTACCAGAATCAAAATTAAATTAAATTAAATTTCAACGGCTTATTTTAAATTTAATTTGCGATTTCGCGCCCTACTGTCGCAACACAGCACTGATCACACGGTTGATCTGTAGCATACCTCCCTCTCCAGATCGCCCGCTGCGCTATCAGCTGTTTATCCGCTGCAACAATCGCAAGATAATAATTACCTATTTACATGAAACAGGCGCACAATTAACTCGCGTGATTGCAGCGCAGAACTATGGCGCGACTCCACCGTGTGATTTTGCCGGTTTTTACACCGGCGACACAGCTTCTATGGTTTCGGTATTTCGCGCCGCGTAATTTAAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCCGCACCAGGATTGAGTGTCTAAGCCTGTGCGTTCCGGAGTTAAACTTTGGCAATACGACAGCATTGAGTTTTGGGTCTCTTTGTGAGTTTTGCGCTTCTTTTAACAGTTCGAAAAATGGCGATTCTGCGACTCAAATTGTCAGCAAATTGTTTTCACTATTGTAGTATGCACATATCGGTTAAGCACTGTACCTGTGTATTCATAATTGTAGCACTCTGTTACGTGTACATAAACAGTCCAGCACAAGTGTATACGTAATACGAGCACCCGCGAGGGCTAACATACGCAGTACAGGTCGGCAGTTCTCCCGCTGGCCAAGCGTAATCGCTTATATGTTATATACCTCCTCCTCCAGCACCATCGCTCGGCGACGAGTACATATATATATACATATATATAAGATACGCATATAAGCGTTGCTGCGCTGCAGGCTATGCCAAGCAGCGCTGCTCCTCGACTTAGGCTAAGAAACCTTTGTATGTAGATCATAAGAGGGATTGACGAATTAATTTCGAATGGGCGGGACCTTCCCTGTTCATAAATTGGATCAAATAAGAGCAGCTAAAACACAAATGATCACTGTACAATAGAAACTACAGGAGTTGGAGTAGGCGATTCCACTTCTGATGCTCGGATCCTGAATCACTTTATACTCGGCATCACTCTCTACAGCGGACACAAAGTAACAGAAAACGGTCGTTAACTTGAAATTAAAAATAAATCTGCGACAGAACAGTTTGTCCAAGAAACTGTTTACACACCGTGAAATAAGATGAATTTTTTTGATTTTAACGGTCAAACAGGGTTGCCCAATTAAACGCAATTTTTTTTTTTTAGGAAATATAGCG
->c91c7a17-0d05-4248-b677-59617a91d4ce
-CTGATGTGCTTCGTTCAGTTACGTATTGCTAGCCCTCAGGTAGATTGCTCGTATTGCAACCACTTGTGCTGAACTTTGTTTATGTACACATTACTGTGAGTGCTACAATTATGAATACACCTTGAGTACAGTGCTTAACCGATATGTGTGCATACTACAATAGTGAAACAATTTGCTGACAATTCTAGAGTCACTTGAATCGCCATTTTCTGAACTGTTAAAAGTGCAAAACTCACAAAGGGGCCAAAAAAAAAAAAAAAAAAACTCAATGCTTTGTCATGTATTGCCAAAAGTTTAATCCTGAACACAGGCTTGAACGCACAATCCTGGTGCGGAGACCAAGTCTACATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCGAAATGCCTCGAAACCATAGAAGTTGTGTCGTACGGTGTGTGCGACAAACTGGCAAAATCACGGTGGAGTCGCGCCATAGTTCTGCGCTCCGCGAGTTAATTGTGCGCCTGTTTCATGTAAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAACAGCTGATAGCGCAGCAGGCGATCTGGAGAGGAGGCGTTGCCAGATCAACCATTAATGATCAGTGTTGTGTTGCGACAGTAGGGCGCGAAAATTCAAATTAAATTTAAAATAAGCCGTTGAAATTTAATTTAATTTAATTTGATTCGGTAACTGGGTACCTGAAGTCTTTAAGAAGGGAAAAGGCACAAAGGTCGCGGACGAGACCAAATATCATCCTCTCACCGTGCTGGTGCCTAGCAGGGCTCACTGGTGTCCCGAGTCGAGGCGGTACCTCCATCCGTAAAGCCGGGGAAATCCGTGGCCTACGTGATAGATACTGACCTTAGGCCATCCTTCGGTTGATGGACAGCGCAGTGGGGGCAGTCCCCTGATCGCAACGACCCGTTCAGGAGGAGCTCCCGGCTTTCGAGATCCCCACCAGAGTCGGTAACCCGACCCATGGTGACGGAGATCTCGGTCCCGTCGGTAACGGGTGAGAAACGCAGGCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGAGGTGGAGAAATTGGCTCCTGGCATCTACGACCTGACAAGTCAGAGAACTGATGGACCACATCGCCGTGCCATCGCAAAGACGGGAGGAAGTCCCAGCTTGTTCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCCAGAACGGAGACCTGAGGCATACTTACCAGGATAGATAGCAAGATCAGCCCCTTCTATCCCGCATTCGAGACTAACGACACATGAGAGACAAAGGGGCATAACTTCCGAACTCTCGGCCCACTTAACAACGGGGCGATAGAGCTGTCTGAAGGTACTACTAGCGAGCACCGCGCTTGAAGAGCAGCGCTACCAGACAATTTACAAAGCCTACCAAAAAAAAGGCTCCACAAAATGCTGGTACCCACGGTGCGGGTGCCAAAGTCCAGGCGCCGAGCAGGCAACCCTACGTTTGGATGGCAACGGTGAGAAGAAAGGCGACATCCATACCTAACGAGTCCAAACCGGGCAGCTATGCATCTGTCGCCAAAGAATGCTAGCACGGGTGCGAGGCACTCATCGTAAAGACAGGAGGCTTCGTACGCGAAGTGCTTCGGAGAAGCTAAGATCGGAATCGAGCCTTAGCGAACTGGGCGATCGTGCGAAAAAATCCGGAGAACGCAGAAAGGTGATCTGTTGCTTGAGGGTAGAGAAGCTTCCGGAAAGCGTTCAGGATTTAAAAGAGCGACCTGGAAGCGGCGCTCAATGACAACCTCTGTGCGCACAGGAGCGCAAAGAATAGCTCTATCTTGCAGCGAAGTTGGACGAATACGACAGCAGAGAAACTCCACAGCTGTGGTCGCCCAATTCCAGGGCCTGCAGATAAATCCTGAAGATATCAGGGGCCTTCGCGGTATGCGGAGTGCAAACAAATAGCCTCAGTGCTGCTACGAACGCGAACGTTGCGATACCAGTCCTTAAACGGGGGCACCATAATCGTTGGATGGTCAAAGATGTCGTATCACCCAGGACACGTCCGACCCACGGATGCTACAGGTGTCTCGGCTATGGGCATCGATCAGCAACCTGCAAGGTTACTGACAGGGCAGACTGCTGTCTTAGATGCGGTGAGAGCGTGGGCTGAAGGCAAAGGGTGCGTTGCTGCACCAAAATGCCTGATCTGCAACGGCGGGTGGACAGAAACCACCCGACGGGTAGCTTTTGCGTGCCCGACTTACAGACGACACTAAAGATGCCAGAGCCACCTTAATGCACGCTCATATTGGCGTAGTACGGCTCAATGTCAATCATTGCGCCTGGCAGCTCAAGAACCTCCTGGCCCAGACTGCGGTTGAGCGCAATGTAGACATCATGCTCCTATAAGCGAACTACGTCTCTGGTAGTGGACAATCGTCCATGATCCTTGACGAGGGCAGGTAAAGCAGCTATCAAATGCTGCAGCTCTCTCAAGTCCAGGAACTGGCTGCTTTATGCGAAGGGTATCGCTTATGCGAAGTTAAAACACGTGCACGTAGCGGCTGCTACGCTCCGCCGAGCGACACCCCGATCAGTTCGAGCTTCTGGAGGCGCTCGTGGACCATGCGAAGGGGCGAAGCGAAGGTCATTACCGGCGACTTTTAATGCCTGGACAGTGGAATGGGGCAGCAGCAGGACATCAACACCAGAGGACGAGCTGTGATTGACGCCATGCGAATGCTGGACCTCATACTGCTGAACGATGGACGGAAGCCGACACGTTTTAAGCGCAACGATAGAGGGGGGTACGTCGCTTTATTGACGATTACCTTTGTCAGCAGAGGGCTGGTAGACAACAACAACTGGATGGTCCCGCTGACGTCATGACGCTGAGCGACCATGCCCACGATCTCCCCTTCTCCCGGAGGGCAATGCCCAAAGACGGCAGAGTAGAACAGCCGGGAAAACATGGGACACCAGGAGAGATCGATGAGGCCATGCTGGCCTATCAGATCAATTCCCTGGAAATCCCAAATGTGGACGCAGAGAGAGTATGGCGGCGAGCCTCATGAATATGCTGGGGAAGAATCTGCGACGCAATCATGCCAGGAAAAAATAAGGCTAGCGCAAACCGCCGTTTACTGGTGGAGTGCCTCTAAGCAACCACGGTCTGATTGCCTCAGGGGCTAAGAGAACGGCGCAACGAGCAGAGGCAGTACCACCACGCGGAACTCTTGGAGGCTTTCAGAAGTAAACGCCTAGGAGGTTCCAAGCACGTATCGCAGCTGCCAAGCGCGGTCGTTTAAGGAGCTGCAGGATGGCGTAGACGGCTATCTGGGACCTCGCCTACAAAGAACATTACCAACGAGCTGGGAGGAGAGCGGCAACCCCATCCGACCCACGGGGGGTCCTGGCTAACATACTGGGGGGAGCTATTTCCAAAACAGACCGCCACACTGGAGCCAACAGAGGCGGCAACGGGAAAAAGATGGAACATGCTGGTCTCCGTCAAGGTACTCGGGGACCTCTCCAAAGAGTCCCCTAAAATTACCTGGGGGTAATGATAGATCACCCGAACTATCGTTCAGGACCACGCGAGCTACGCCAGCAAGGAAGACAGCAGTCCATCCCTGCTTCGTTGGCGAGGGCTTATGCCCAACGTCGGAGGCCAAGACACCCGGCCGGAAACTGCTGGTGTCGGTAACCCAAAGAACTTCGCTGCTATACGCTACCAGTCTGGAGCAATGCCACTTGCAGGGGTCTCATACCTGAAGGAGCTCGTTCGGTGCTACGGTCAATGGCCCTCAGCAGGCTCATTAGAGGATTCAGGACCATATCGAGCAGCGGCGCTAGCTGGCAGGCCTACCGTTGATCTGGAGATCAAGGCTCTCAGCCCCTTATGCGGAGTGGCGCTGGGCAAGAACACACGAGTGGCTATTAGGTGAATGGCAGAGCAGATGGCAAACGTCGCGACGGGGGAGATGGACCTATCAGCTCATCCCAGAGATGACGGTTTGAACGGAAGTGACACTTTCTCGAAAAGTGGTAAACTTGGAATTTGTTATTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTAATTTATAAGTAAAATAAATATTGTTTTAATTATATTTCTAAAAAAAAATTGCGTTTAATTAAGCAAATAACCCTTAATTTTGACCGTTAAAATCAAAATTCATCTTATTTCACGGTGTGTAAACAGTTTCTTGACAAACTGTACTTGTCTGAATTATTTTAATTTCAAGTTAACGACCGTTTTCTGTTGTTACTTTGTGTCCGCTGTAGAGTGATGCCGAGTATAAAGTGATTCAGATCCGACATCAGAAGTGGAGACCGCCTCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTGTGTTTTAGCTGTTCTTTATTTGATCAATTTGAGGGAACAGGGAAGGTCCGCTCCATTCGAAATTAATTCGTCAATCACTCTTATGATCTACATACAAAGGTTTCTTAGCCTAAGTCGAGGAGCAGCGCTGCCGGCATAGCCTGCAACGCAGCAACATACTATGCGTATCTTATATGCTCATATACATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAGAAGTGGTATAGGCACACATATAAGCGATCAGCGCTTGGCCAGCAGAAGAAACTGCTGACCAGGCAATTATGTATGTTAGCCCTCAAGTGGGTGCTCGTATTACGTATACACTGACTGGACTGTTTATGTACACATTGCAACAGGTGCCACAATTATGAATACACATAGGTTACCAGTGCTTAACCGATATGTGCATACTACAATAGTGAAAACAATTTATGACAATTCTAGAGTCGCAGAATCGCCATTTTCTGAACTGTTAAAGAGTGCAAAACTCACAAAGAGACCCAAAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCTGAACGCACAGGCTTAGACCTCAATCCTGGTGCGGAGACCAGGTCACACATCGCCGTGAACGGACGTCTTAAATTACGCGGCGCGAAATACTCCAGGCTCATAGAGTTGTGTCGGCCGGTGTGTTGCGGCAAACTGGCAAAATCACACGGTGAATCGCGCCATAGTTCTGCGCTGCAATCACGCGAAGTTAATTGTGCGCCTGTTTCGTATAAATGGTAATTTATTATCTTTGCGATTGTTGCAGCGGATAAACGGCTGATAGCGCAGCGAGCGATCCTGAAGGAGAGGAGCGTTGCCGAGATCAACCGTGTGATCAGTGTTGTGTTGCGACAGTAGGGCGCGAAATTCAAGTAAATTTAAAATTAAGCCGTTGAAATTTAATTTAATTTAATTACGATTCTGGTAACTGGGGCGCAAGTCTTTAAGAAGGGAGAAAAGGCACAAAGGTCGCGGACAGACCAAAATATCATCCTCTCACCGTGCTGGTGCCTAAGCAGAGGCTCTGGTGTCCGGTCGAGCCCGGTACAAACCTCCATCCGTAAAAGCCGGAAATCCGTGGCCCTGCGTGACCCTAGGTAACCTTGGGCCATCCTTCGGTTGATGGACAGCGCGGTGGGGCGGTCCCCTGATCCTTAACGACCCGTTCAGGAGAACTCCCGACTTTCGAGATCCCCCACCAGAGGAGTCGGTAACCCGACCCATGGTGACGGAATCTCGATCCCGTCGGTAGCGGGGGGTGAGCACGCAGGCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGAGGTGGAGAAATTGGCTCCTACAGCATCTACGACCGCGACAAGTCGAAGACGATGAACCACATCGCCGTGCCATCGCAAAAGACGGGAGGGAAGTCCCCAACTGGTTCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCCAGAACGAGGACCTGAGGGGCATACTTACCAGGATGAATGGCAAGATCCAGCCCCCCCCTTCTATCCGCATTCGAGACCCAACGACACATGAGAACAAAGGGCATAGCTTCCGAACTCTCGGCCCTTAACAACGGGGCGATGAGCTGTACGAAGAATTTACTACTAGCGGCACCGCTTGAAAACAGCACTGCAGACGGAGTACAAAGCCTACCAAAAGGCTCCACAAATGCGCAGTGCCCACGGTGCGGTGCCAAAGTCCAGGCGCCGAAGCAGAGCAACCCTACGTTGGATGGCAACGGTGAAGGAAAGGCGACATCATACCCTAACGAGTCAAGCCGAGCAGCTATTCATCTGTCGCCAAGAATGCTAGCACGGGTGCAGAGGCACTCATCGTAAAAAAAAACGGGAGAGCTTCGTACGCCTTGAGATGCTTCGGAAGCTAAAGATCGGAATCGACCTTAGCGAACACAGACGTCACGTGCGAAAAAAATCGGAGAACGCAGAAGGTGATCTGTTGCTTGGTGAAGCTTCGGAAAGCGTTCCCAAGTTTAAAAGAACCTGGGCGGCGCTCAATGACAACCTGCTGTGCGCACAGGAGCGCAAAGAATAGCTCTATCTTGCAGCGGATTGGACGAGGCTACGACGGCAGAGAAGCTCCACAGCTGCTTGGTCGCCCAATTCCAGGGCCTGCAGATAAATCCTGAAGATATCGGGGGGCCTTCGCGGTATGCGGAATTGAAACAAATAACTCAGTGCTTGCTGAACGCGAACGTTGCGATACCAGTCCTTAAACAGGGCACCATAATCGTTGGATGGTCGAAGATGTCGTATCGCAGGACGTCCGACCCACGAGATGCTACAGATTGTCTCGGCTATGGGCATCGATCAGCAACCTGCAAGGACGCGACAGGGCAGACTGCTGTCTTAGATGCGGTGAGCGTGGGCACAAAGACAAGGGGTGCGTTGCTGCACCAAATGCTGTCTGCAGCAGCGGGTGGACGAAAACACCGACGGGTAGCTGCGTGCTTGACTTACGAAACGACACTAAAAGATGCCAAGAGCCGCAGCAATGCACGCTCATATTGGCGTGGTACAGCTCAATGTCAATCATTGCGCAGCTCGAAACCTCCTGGCCCAGACTGCGGTTGAGCGCAATGAACATCATGCTCCTAAGCGAACCCTACGTCTCTGGTAGTGGACAATCGTCCATGATCCTTGACGAGGCAGGTAAGCAGCTATCAAATGCTGCAGCTCTCTCCAAGTCCAGGAACTGGCTGCTTTACCCATGCGGGGTATCGCATGCGAAGTTAAAACACGTACATGTACGGCTGCTACGCTCCGCCGAGCGACACCCCGATCAGTTCGAGGAGCTGGAGGCGCTCGTGGACCATGCGAGAGGGCGAAGCCCGAAGGTCATTACCGGCGACTTTAATGCCTGGACAGTGAATGGGGCAGCAGGACATCAACACCAGAGGACGAGCTGTGATTGACGCCATGCGAATGCTGGACCTCATACTGCTGAACGATGGACGGAAACCGACGTTTAACAACGATAGGTACGTCCTTTATTGACGTTACCTTTGTCAGCAGAGGGCTGGTGAACAACAACAACTGGATGGTCCATGACGTCATGACGCTGAGCGACCATGCCTGATCTCCTTCTCCCGGAGAACATGCCCAAAGACGGCAATTAGAACAGCCGAGGAAAACATGGGACACCAGGAAGATCGATGAGCCATGCTGGCCTATCAGATCAATTCACAAAATCCCAAATGTGGACGCCGAAGGTATGGCGGCAGGCCTCGCGAATATGCTGGGAAAGAATCTGCGACACCAATCATGCCAAGGAAAATAAGGCACAGCGCAAACCACCCGTTTACTGGTGGAGTGCCTCCCTAAGCCAACACGGTCTGATTGCCTCGGGGCTAAGAGAACGGCGCAACGAGCCAGGGGCAGTACCCACCACGCGGAACTCTTGGAGGCTTTCAGAAGCAAACGCCTAGAGTTCAAGCATCGCGGCTTGCAAAGCGCGGTCGTTTAAGAGCTGCAGGATGGCGTGAACGGCGATATCTGGGGCCTCGCCACAAGCTTGATACCAACGAGCTAAGGAGGAGAGCAGCAACCGAAACCCGGGGTCTGGCTAACATACTGGGGGGGCTATTTCCAAAGCAGACCACACTATGGGGAGGCCAACAGGGGCAGCCCTGCCCCAGGTACCGTGCGTCACAGAACGAAGTCGTCGAGGCAGCTGTTTCGCTGACGATGTGGCAATCGGCGGAGCTAGCAATAGCGGCTCACAAGACCGAAGCAGTCTACTAAGCAGCAGGAAAAGATGGAGAACATGCTGGTCTCCGTCCAGGAGTACTCAGGGGACCTCAAGAGTCCCTAAAGTACCTGGGGCCAATGATAGATCGCAGACTATCGTTCAAGGACCACGCAGGCTTCGCCAGCAAGAAGACAGCAGTCACATCCTCTTCGTTGGCGAGACATACTAACGTCGGAGGCCCAAGACACCCGGCCAGGCGCTGCTGGTGTCGGTAGCAAAGGCTTCGCTGTATGCACGCTGCACCAGTCTGAACAATGCCACTTGCAGGGGTCTCATACCTGAAGAATGGATTTCGGTGCTACGGTCAATGGCCCTCAGGCTCATTAGAGGATTCAGGACCATATCCGAAGACGCGGCGCTAGCGCTGGCAGGCCTGCCGATTGATCTGGAGATCAAGGCTCTCAGCCTTATGCGGAGTGGCGCTTCCGGAGCAGAGGCACAGTGGCTATTGGGTGAATGTAGGCAGATGGCGAAACGTCGCGACGGGGAAGTGGACCTATCGGCTCATCCAGGAGATGACGGTTTGGGCCGAGTGACACTCTCAAAAGTGTGTAAGCAGATTTGTTATTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTTTAATTTATAAGTAAAATATATATTGTTTAATTATATTTCCTTAAAAAATTGCGTTTAATCAAACAAATAACCGTTAATTTTGACCTTTAAAGTCAAAATTCAACTTATTTCACGGTGTGTAAAGCAGTTTCTTGACAAACTGTACTTGTCGCAATTTATTTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCACTTCTTTCATTTTGCATATTATTAGAACACGCATTCTCTACCTTGCAACAGCGTGGCGAAATAACTTTGTTTTCAAAACAAAACCTCATCTCTCTCCTGTCCTTGTCAAGCTCACCGGGACGCCAGTCAAGATATTATTTCATCAGTAGGAAGCAGGATGTGAATATGATTGCACACCATCTTCTTTTGCGGTGCACAACGGCGCCTTTTAACCAACTGAGCGTACCAGTCGTAGAGTTCTTGCCCGCCAACATACGAGGTACTCATATCTATAGTTCAGATTGGTCATCTCGTCCTTACACGGACACGCTTCATCATGGTGACGATGATCACGTGAGCCCCATCCCAAAACGATTTTGTCCGCCATCCTTGGCAGCAACCAGCCTCGGGCTGAAGGTGACCAGCGAGCGCCACGGTTGCCCTCTCCTCGGCGAACCTGGAGCAGTGCAGTAGGATGTGTGCTCTGCGGTTTCCACTGCTACGTCGCAATGCAATAAAGAGCACTGGGCTGCAGCATCACGTGGCGGAACCTACATAGTACCCTCGAAAACGGCCATGGTCCGTGAGACTGGGTCATGTATGTGGTAGTCCACCGTTTTGTGCTCGCAATCAGCCCTCCGTTAGTTGCGGAATGAGTTTGTAAGTCCAGCGTCCCCGTTGTGACTCTTGCCACCTGGTCTGCCATACTCCTCGAATCCACTCTTTGATCTCTAATTGGTGTATCCCTCACTTTCATAAGGGTATTTGCCCTTTATGTCCGGAGTCAATGGGTGTAATGCCTGACAGAGCGTGCGCTGCGTCGTCCGATATGGTTCTAAAGCCTCTGATTAGCCTGAGGCCATTGTCCGTGATACTGCGCGGGCACTATCTAGATAGGTTTTCTTTGTGGAAACGCAGCTCCAGATAGGCGCAGCATAAAGCAGTGTTGCCTTTGAAACCGCCACTAACAGTCTCCTAGCCGGCAGTCTGGGTCCTCCACGTTGGCATGATTCTCGCCAAAGGCTGCTGCTGTCATTGCCGCTTTTGCTGGCATACCTTGCGTGAGCGAACGAGAGCCTTCGGTCTATTAAGAACACCAAGGTATTTCCAACGTTTCTGCTGAGGCGATTTCAACTCCTTTGACTTCCACACGCATGCACTCAACGGACTTTCTGCTGTTCAGCAGGACTACTTCGATGTATGCGCAGCTATTTTAAGTCCGACTTTCTCAACCATTCTATGGCCGCCGTGATTACCACGTTACTATGTCCTGGAGCTCGGTATTGTCTTGGCGACCGCTGTTATCACCAACGTCGTCGGCGAAGCAGTGCAGCTCCACCTCTGGGCTTGCTAATGCTCGGTATTCCATCATACATAATGTTCCACAAGATCGGTCCTAGTACCGACCCTTGAGAACGCCTGCAAACTTGGTGGCTTCTTGGACCATCTTCTGTTACGTACCATACACGGTCCCTGGTAACCAATTACGCCTCGTCATCAGTCAGGAACGCCAAGTTGCGCATAGCCCCGGGATAATGGGCCATCTCGCTGTATTGAATGCGTTCTTGACGTCTAGCGTGATGATGGCACAGTACTTCTTACTGCCGCCTAACCATCGGTTACAGTCGAGTGCTTTCTGGCAGCGTCTGTTACGGATTTGAGAGCGTCGAGCGTACTTTTACCTTTCGGAAGCCATGCACTGTTGGCCCTGAAGGCCTGGGACTTTCAGTGATTAGCTCAATGCGCGTACGGTATGCGCTCAAAGAGCTTGCCAACAATGTCCAACAAGAACACAACGGTCGGTAACTGCGTGGAACATTTGCGGGCCTTGCCTTTCGGCAGGACCAGCTTCATCTTTTCCAGCGCTTGGGGAAGACTCCGTCCAGCAGACACTGTTGGAATGTATCCCTGAAGACCTCCGGTCTTGCGGTGGCAACTGCTTTGACGATCACGCCGGGATACCATCAATGCCGGGAACTTTGTTCGGTCTGATCCTCTTTGCTGCTTCGACGACTTCGCATGACGTGATGCACGGGAAGTCAGAGGCGAAGTCAGCAGCGGGTTGCCATAACGTGTGTTGGCGGAAATAGTTCCGACACGATGTTATGCCGAAGGGCGGCTGGGTCCTGAGGAGATCCTGCACCAGCGGAATTGAGTTTTTTCCTTACGACTTTGTAGGCGAGACCCCGGGGTCGTCGTCTACGCTAATCGGTCCTTATTCATTCGCCTTTGCTGCTGTTGTACCGTTGCTTAGCTCAGTTCGCTTCGCTTTTATATACCTCAATGCGCACAGGGTGGTGCGGTTGCCCTCTAGATTGCTGCGCTTTCCTCGCCTTGATGCATTCCGTCGAAGCTGTGCAATGGAGTCACTCCACCAGTAGACAGGGGCTTTCGTTTCGTGTTCCTTTTTCTCGGCATCACCGCATCACACATTGCTCTAAGCCTATCCATGAGCGCTGCCACCATGGTCTCCGGTGTCAATTATGGACTCCATGCCCTCGATCTGGTATGCCAGCATGTCTTCATCAGTTTCTAATAATCCCATACCGGACCTAGCGCACATCTTCGCTGTTTGGGTGACGGCCTCATTGTTCGGGCACCGAACGTGATTAGGTGTGGTCGCTCAGCGTTATGTCCTCATGGACCATTGATTCGAGCTAGCCACTAGAACTCTGCTAACAGGTGACATCAATGAAAGATGTACCTCTGTCATTATTGAACGTCGGTTTGAACCGTCGTTTAGCAATACGAGATCTAGCAGGTTCATGGCATCGATCACTGCTCGTCCTCTTGTGTTAAATTCGACTGCCCCATTCACAGCCAGGCATTGAGGTCACCTCGATGACTGTTGGTCTGCACTTACCCGTAGTTAACCAGCACCGAGCATGTCCTCGAATTGTTCGGGTTATCATGGTGGAGCATAGCAGCTGTAGAAGTGGATTCTCTAATTTTGGCGTATGCTATGCCGCATTGGTGATATCCCACTATACGTAACTTCCATA
->790136e4-0663-4d7a-b7e2-941f5d007754
-TTGGTGTACTTCGTTCGGTTACGTGTACTAATCACACGGTGGAGTCAGCGCCATAGTTCTGCGCTGCAATCACGCGAGTTAATTGTGCGCCTGAAACCATGTAAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAACAGCTGATGGCGCGAGGCGATCTGGAGAGGCGTTGCCAGATCAACCGTGTGATCAGTGTTGTGTTGCGACAGTAGGGCGCAGAAATTCAAATTAAATTTAAAAGAAATTAGAAAATTTAATTTAATTTAATTTGATTCTGGTAACTGGGACGCACAAGAGTCTTTGAAGGGAAAGGCACAAGGGTCGCGGACAGATAAATATCATCCTCTCACCGTGCTGGTGCCTAAGCAGAGGCTCTGGTGTCCGAGTCGAGGCGGTACAAACTCCATCCGTAAAAGCCGGGGGAAATCCGTGGCCTACGTGACCTAGGTAACCTTAGGCCATCCTTCCAGTTGATGGACAGCGCAGTGGGGGGCAGTCCCCTGATCGCAACGACCCGTTCGGGAAGACCCGACTTTCGAGATCCCCACCAGAGAGTCGGTAACCCGACCCTTGGTGACGGAGTCTCGGTCCCGTCGATGGCAAGGGAGGTGAGCGCAGGCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGAGGTGGAGAAATTGGCTCCTACAGCATCTACGACCGCGACAAGTCAGAAGACGATGGACCACATCGCCGTGCCATCGCAAAGACGGGAGGAAGTCCCCAGCTGGTTCCCCTCATCGGTCTTCGGACTTGACCACCCTCTCCAGAACGGGACCTGAAGAGGCATGCACCAGGATGAATGTAAGATCAATTGCTCTATCCGCATTCGAGACCCAACGACACACATGAGAGACAAGGGCATAGCTTCGAACTCTCAGCCCTTAACAACAGGGCGATAGAGCTGTACAGAAGGTACTACTAGCGAGCACCGCTTGAAGAGCAGCGCTACCAGACGGAGGTACAGAAGCCTACCAAAAGGCTCCACAAAATGCGCAGGTACCCACGGTGCAGGTGCCAAAGTCCAGGCGCCGAAGCAGAGCAGCCCTGCGTTGGATGGCAACCCGGTGAAGAAAGGCGACATCCATACCTAACGAGTCCAAGCCAGGCAGCTATGCATCTGTCGCCAAGAATGCTAGCACGGGTGCGAAGGCACTCATCGTAAAAAAGACAGGGAGGCTTCGTACGCAGAGATGCTTCGGAAGCTAAGATCGGAATCGAGCCTTAGCAGACTGGGCGATCACGTGCGAAAAATCCGGAGAACGCAGAAAGGTGATCTGTTGCCCTTGAGGTGAAGCTTCGAGCGTTCCCAAGTTTAAGAGCGACCTGGAAGCGGCGCTCAATGACGGCCTCTGTGCGCACAGGAGCGCAAAGAATAGCTCTATCTTGCAGCGGATTGGACGAGGCTACGACGGCAAGCTCCACAGCTGCTTGGTCGCCCAATTCAGGGCCTGCAGATAAATCCTGAAGATATCAGGGGCCTTGCAGTATGCGGAATTGCAAACAAATAGCCTCAGTGCTGCTGAACGCGAACGTTGCGATACCAGTCCTTAAACAGGGCACCATAATCGTTGGATGGTCAAGATGTCGTATCACCCAGGACGTCCGACCCACGAGATCTACAGGTGTCTCGGCTTCCATGGGCATCGATCAGCAACCTGCAAAGGACACTGACAAGGGCAGACTGCTGTCGCCGTCACAGTGAGCGTGGGCACAAAGGCAAAGGGGTGCGTTGCTGCACCAAAATGCCTGATCTGCAGCAGCGAGGGTGGACAGAAACCACCCGACGGGTAGCGGCTTTGCGTGCCGGCTTACAGAGCGACACTAAAGATGCCAGAGCCACCTTAATGCACGCTCATATTGGCGTAGTACGGCTCAATGTCAATCATTGCGCAGCAGCTCAGAGCCTCCTGGCCCAGACTGCGGTTAGGCGCAATGTAGACATCATGCTCTAGAACCCTACGTCTCTGGTAGTGGACAATCGTCCGTCCTTGACGAGGCAGGTAAAAGCAGCTATCAAATGCTGCAGCTCTCTCCAAGTCAGGAACTGGCTGCTTTACCCATGGGGTATCGCTTATGCGAAGTTAAAACACGTGCACATGTACGGCTGCTACGGCGCTCCGCCGAGCGACACCCCGATCAGTTCGAGGAGCTTCTAGGCGCTCGTGGACCGTGCGAGGGCGAAGCCCGAAGGTCATTACCGGCGACTTTAATGCCTGGACAGTGGAATGGGGCAGCAGGACATCCAACACCAGAGGGACGAGCTGTGATTGACGCCATGCGAATGCTGGACCTCATACTGCTGAACGATGGACGGAAGCCGACGTTTAACAACGATAGGGTACGTCCTTTATTGACGTTACCTTTGTCAGCAGAGGCTAGTAGACAGCAACAACTGGATGGTCCATGACGTCATGACGCTGAGCGACCATGCCCTGATCTCCTTCTCCCGGAGGTATTGCCCAAAAGACGGCAGAGTAGAACAGCCGGGAAGCATGGGACACAGGAAGATCGATGAGGCCATGCTGGCCTATCAGATCAATTCTAAATCCCAAATGTGGACGCAGAGAGTATGGCGGCAGGCCTCATGAATATGCTGGGAAGAATCTGCGACACCAATCATGCCAAGGAAAAATAAGGCACAGCGCAAACACCCGTTTACTGGTGGAGTGCCTCCCCTAAGCCAACTACGGTCTGATTGCCTCAGGGGCTAAGAGAACGGCGCAACGAGCCAGAGGCGGTACCCACCACGCGGAACTCTTGGAGGCTTTCAGAAGCAAACGCCTAGAGTTCAAGCACGGCATCGCGGCTGCCAAAGCGCGGTCGTTTAAGGGCTGCGGGATGGCGTAGACAGCGACTATCTGGGGCCTCGCCTACAAGCTTGTTACCAACGAGCTAAGGGAGGGAGAGCGGCAACCCCACATCCGACCCGGGGGGGTCCTGGCTAACATACTAGGGGAGCTATTTCCAAAGCAGACCACTATGGAGGCCAACAGAGGCAACCCCTGCCCCAGATTTGCCGTGCGTCACAGAACTTGAAGTCGTCGAGGCAGCTGTTTCGCTGACGATGTGGCAATCACAGCCGGGCTAGCAATAGCGGCTCTGCAAGACCGAAGCAGTCCTACTAAGCAGCAGGGAAAAGATGGAGAACATGCTGGTCTCCGTCAAAGGGTACTCAGGGGACCTCTCAAGTCCCTAAAGTACCTGGGGGGTAATGATAGATCGCAGACTATCGTTCAAGGACCACGCGAGCTACGCCAGCAGAAGACAGCAGTCACATCCCTCTTCGTTGGCGAGGCTTATGCCAACGTCGGAGGCCCAAGACACCCGGCCGGAAGCTGCTGGTGTCAGTAGCAAGGCTTCGCTGCTGCGCTGCACCAGTCTGGAGCAATGCCACTTGCAGGGTCTCATACCTGAAAGAATCGTTCGGTGCTTTACGGTCAATGGCCCTCAGGCTCATTAGAGATTCAGGACCATATCCGAAGACGCAGCGCCTTAGCGCTGGCAGGCCACCGGTGATTGATCTGGAGATCAAGGCTCTCAGCCTTATGCGGAGTGGCGCTTCCAGTGAAGGCACACGAGTGGCTATTAGGTGAATGGCAGAGCAGATGGCAAACGTCGCGACGGGGAATTGGACCTATCCGGCTCATCAGAGATGAAAGCGGTTTTAGGCAAATGACCTCTCAAAAAAGTGTAAACTTAGATTTGTTATTTATTTTTCTTGTATATTTGATATTTTGAATTTGTTTTAATTTATAAGTAAAATATATATTGTTTAATTATATTTCCTTAAAAATTGCGTTTAATCAAGCAAATAACCGTTAATTTTGACCTTTAAGTCAAAATTCAGCTTATTTCACGGTGTGTAAACGGTTTCTTGACAAACTGTACTTGTCGCAGATTTATTTTTTAATTTCAAGTTAACTGACCGTTTTCTGTTACTTTGTGTCCACTTCTTTTCATTTTGCATATTATTAGAGACACGCATTCTCTACCTTGCAACAGCGTGGCAAATAGCTGTTTCAAAACCGCCTCCGCTCTCTCTCCTGTCCTTGTCAAGCTCACCGGGACTGCCAGTCAAGGTATTTCATCAGTGAGCGGGATGTAGTTATGATTTTTTTATCTTCTTTGCGGTGCAGCAGCGCCTTTTGACCAACTGAGCGTACCAGTCGTAGAGTTCTTGCCCATAACCAACATACGGGGTACTCCTTATCTATAGTTCAGATTGGTCATCTCGTCCTTACGGACACGCTTCATCATGGTGACGATGATCGTGAGCCCCATCCCAAACGGTGCGACCATGGCAGCAGCCTCTCGGGCTGAAGACGATGACCAGCAGAGCGCCACGAGTTGCGCCCTCTCCTCGGCAGACCTGGAGCAGTGCGAGTAGGATGTGCTCTGCGGTTTCCACTGCGTCTGTGCAATAAAGGCGCTGGGCTGTATCCACGTGGCGGAACCTACATAGGTACCCTCGAAACAGCCATGGTCCGTGAGGAACTGGGTCATGTGGTAGTCCACCGTTTGTGCTCGCAATCCAGCCCCTCCGTTAGTTGCGGAATGAGTTTATGAGATCCAGCGTCCCCATTGTGACTCTTGCCACCTGGTCTGCCATACTCCTCGAATCCACTCTTTGATCTCTAGTGGGTATCCCTCACTCGCAAGGTATTTGCCCTTTATGTCCAGGTCAATGGGTGTAATGCCTGACCAGAGCGTGCGCTGCGTCGTCGATATGGTTCTAAAGCCTCTGATTAGCCTGAGGCCATTGTCCGTGATGCTGCGCGGGCACTGTATCTAGATAGGTTTTCTTTGTGGAAACGCAGCTCTCCAGATAGGCGCAGCATAAAGCAATGTTGCCTTTAGAACCGCCACTAACAGTCTCCTAGCCGGCAGTCTGGGTCCTCCCACGTTGGGCATGATTCTCGCCAAGGCTGCTGCTGTCATTGCCCGCTTTGCTGGCATACCTTGCGTGAGCCTTGAACGAGAGCCTTCCGGTCTATTAGAACGCAAGATTTCAACGTTTTCTGCTGGGCGATTTCAACTCGCTTTGACTTCCACGCATGCACTCAACGGACTTTCTGCTGTTCAGCGGGACTACTTCGGTCTTATGCGCAGCTATTTTAAGTCCGACAAACCATTCTATGGCCGCCGTGATTGCCACGTTACTTATGTCCTGGAGCTCGGTATTGTCTTGGCGACCCGCTGTTATCGCAACGTCGTCGGCGAAGCAGTGCAGCTCCACACCTCTGGGCTTGCCTAATGCTCCGGTATTCCATCATACATAATGTTCCACAAGATCCGGTCTAGTACCGACCCTTGAGGGAACATACCAAAGACTTGGTATTTCTTGGACCATCTTCTGTTACGTACCATAACACACGGTCCCTGAAGTGAAAAGTTGCCAATTACGCCTCGTATGTAGTCAGGAACGCCCAAGTTGCGCATAGCCCCGGGATAATGGGCCATCTCGCTGTATTGAATGCGTTCTTGACGTCTAGCGTGATGATGATGGCACAGTATATTACTGCCGCCCTAACCATCGGTTACCGTAAAAGTGCTTTCCTGGCAGCGTCTGTTACGGATTTGAGAGCGTCAGGCGTACTTTTACCCTTTCGGAAGCGCCGCTGTTGGCCTGAAGGCCTGTAGGACTTTTCAGTGATTAGCTCAATGCGCGTACAGTATGCGTCAAAAGAGCTTTACCAACAATATCCAACAGACGGCGGTCGGTAACTTCCGTGGAACATTTGCGGGCCTGCCTTTCGGCGAAGGACCAACTTCATCTTTTCAGCGCTTGGGGAGGCTCCGTCAGCGAACTACTGTTGGAATGTATCCCTGAAGACTCCGTTAACGGTGGCGGCTTCTTTGACGATCACGCCAGGATACCATCAATGCCGGGAGCTTTGTTCGGTCTGATCCTCTTTGCTGCTTCGACTGACTTCGCATGACGTGATGCACGGGAAGTCAGAGGCGGAAGTCAACAGCGGGTTGCCGCATAACGTGTGTTGGCAAATAGTTCGACACGATGTTGGCCAGGGCGGCTTCAGGTCCTGAGGAGATCCTGCACTTAGCGGAATTGAGTTTTCCTTACGACTTTGTAGGCGAGACCCAGGGGTCGTCGTACCGCTATCAATCAGGTCGCTTAAATGCATTCGCGCCTTTGCTGCTGATATGCCGTTCTTAAGCTCAGTTCGCTTCGCTTTATATACCTGTGCTGGGGTAGCGTTGCGTTGCCCTCAAGATTGCTGCGCTTGCCTCCTCGCCTTGATGCATTCCGTCCAGCGAAGCTGGTGCAATGGAGTCCTCCACCGAGTAGACAGGGGCTTTCGTTTTGTGTTCCTTTTTCTCGTACCGCATACACATTGCTCTAAGCCTATCCGCGAGCGCTGCCACCATGGTCTCCGCGTGTCCAATTATGGACTCCATGCCCTCGATCTGGTATGTAGCATGTCTTCATCCAGTTTCCTAATGTCCCATACCGGACCTGGCGCACATCTTCGCTGTTTGGGTGACGCTCGTGAACCGAACGTGATTGGGATTGTGGTCGCCGGCGTTATGTCCTCATGGACCATCCAGTTCGAGCTAGCCACTTCAGAACTCTGCTAACTTTCAGGTGACATCAATGAAAGATGTACCTCTGTCGTGTCCATA
->e72d1741-ef41-4bc7-a49e-279c9f9b7263
-TTGTTGTACTTCGTTCGTTGTATTGCTAGCTGATAGCGCAGCGGGGAACTGATCTGGAGGCGTGCCAGATCAACCGTGTGATCAGTGTTGTGTTGCGACAGTAGGGCGCGAAATTCAAAATTAAATTTAAAATTAAGCCGTTGAAATTTAATTTAATTTAATTTCTGATTCTGGTAACTGGGAGCGCACAGTCTTTAAGAAAGGGGAAAAAGGCACAAAGGTCGCGGACAGACAAATATCATCCTCTCACCGTGCTGGTGCCTAAGCAGAGGCTCTGGTGTCCGAGTCGAGCGGTACAAACCTCCATCCGTAAAAGCCGAAATCCGTGGCCTACGTGACCCTAGGTAACCTTAGGCCATCCTTCAGTTGATGGACAGCGCAGTGGGGCAGTCCCCTGATCGCAACGGCCGTTCAGGAGGAGCTCGACTTTCCCTCCCCACCAGAGGGTCGGTAACCCGACCCATGGTGACGGAATCTCGGTCCCGTCGGTAGCAGGGGTGAGCACGCAGGCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGAGGTGGAGAAATTGGCTCCTACAGCATCTACGACCGCGACAAGTCAGAGACGATGGACCACATCGCCGTGCCATCGCAAAAAGACGGGAGGGAAGTCCCAGCTTGTTCCCCTCATCCCGGTCTTCGGACTTGACCACTGCTCTCAGAACGGGGCCTGGGGGCATACCCACCAGGATGAATGGCAAGATCAGCCCCCTTCTATCCGCATTCGAGACCCAACGACGCACATGAGACAAGGGCATAGCTTCCGAACTCTCAGCCCTTAACAACAGGGCGATAGAGAGCTGTACGAAGAGTACTACTAGCGAGCACCGCTTGAAGAGCAGCTACCCAGACGAGTACAAAAGCCTACCAAAAGGCTCCACAAAATGCGCGAAACACGGTGCAGGTGCCAAGTCCAGGCGCCGAAGCAGAGCAACCCCTACGTTGGATGGCAGCGGTGAAGGCGACATCCATACCTAACGAGTCCAAGCCGAACTGGCTAGCCATCTGTCGCCAAGAATGCTAGCACGGGTGCAGAGGCACTCATCGTAAAAAAGACAGGAGAGGCTTCGTACGCAGAGATGCTTCAGGCTAAGATCGGAATCGAGGCCTTAGCGAACTGGGCAGTCACGTGCGAAAAATCGAGAGAACGCAGAAGGTGATCTGTTGCTTGAGGTGGGGGGGGAAAGCTTCGGAAAGCGTTCCCCGAGTTTAAAACGACCTGGAAGCGGCTCGGTAATGGCCTCTGTGCACTGGGGAGCTAAAGAATAGCTCTATCTTGCAGCGGATTGGACGGGGCTACGACGCCCGGCGCAGAAGCTCCACAGCTGCTTGGTCGCCCAATTCCAGGGCCTGCAGATAAATCCTGAAGATATCAGGGGCCTTCGCGGTATGCGGAATTGCAAACAAAATAGCCTCAGTGCTGCTGAACGAACGATTTGCGGTGAGATCCTTAAACAGGGCACCATAATCGTTGGATGGTCAAGATGTCGTATCACCCAGGACGTCCGACCCACGAGATGCTACAGGTGTCTCGGCTATGGGCATCGATCCAGCAACCTGCAAGGACACTGACAGGGCAGACTGCTGTCTTAGATGCGGTGAGCGTGGGCACAAGGCAAAGGGTGCGTTGCTGCACCAAAATGCCTGATCTGCAGCAGCGAGGTGGACGAAAACTTTCACCCGGTGGTAGCTTTGCGTGCCCGACTTACCAGAGCGACACTAAAGATGCCCAAAGAGCCACCTTAATGCACGCTCATATTAGCGTAGTACAGCTCAATGTCAATCATTGCGCAGCAGCAAACCTCCTGTGGCCCAGACTGCGGTTGGGCGCAATGGCAGGCATCGTAACCAGCAAACTCAATCTAGTAGTGGACAATCGTCCATGATCGCCAACGAAGCAGAGTAAAGCAGCTATCAAATGCTGCAGCTCTCTCAAGTCAGGAACGGCGCAAGCACCTTTTGAGAATTATCGCTTATGCGAAGTTCAAAACGTGCACATGTACAGCTGCTACGCTCCGCCGAGCGACACCCCGATCAGTTCGAGGCTTCTGGAGGCGCTCGTGGACCATGCAGAGAGGGCAAGAAGCCCGAAGGTCGTACCGGCGACTGAAATGCCTGGACAGTGGAATGGGGCAGCAGGACATCCAACACCAGAGGACGAGCTGTGATTGACGCCATGCGAATCTGGACCTCATACTGCTGAACGATGGACCCGGAAATGCGACGTTTAGCAACGATAGGGGTACGTCCGGCACCGGCCGAGCCGTTACCCAGCGCTTGTCCGAAGCCGGGGGGGGCTGAAAGTAGACAGCAACAACTGGATGGTCCATGACGTCATGACGCTGAGCGACCATGCCTGATCTCCTTCTCCCGGAGGTATACAATGCCCAAAGACGGCAGAGTAGAACGGCCGGAAGAGCATGGGACACCAGGAAGATCGATGAGGCCATGCTGGCCTATCAGATCAATTCCTGGAAATCCCAAATGTGGACGCAGAGAGTATGGCGGCAGGCCTCGCTGAATATGCTGGGAAGAATCTGCGACGCAATCATGCCAAGGAAAAAATAAGGCACAGCGCAAACCGCGTTTACTGGTGGTGGAGTGCCTCCCTAAGCCAACTACGGTCTGATTGCCTCAGGGCTAAAGAAGAACGGCGCAACGAGGCAGAGGCAGTACCCACCACGCGGAACTCTTGGAGGCTTTCAGAAGCAAACGCCTAGAGTTCAAGCACATCGCGGCTGCCAAAGCGCGGTCGTTTAGAGAGCTGCGGGATGGCGTAGACGAAAGCGATATCAGGGCCTCGCCTACAAGCTTGTTACCAACGAGCTAAGGAGGAGAGCGGCAACCCCATCCGACCCGGGGGTCCTGGCTAACATACTAGGGGAGCTATTTCCAAAGCAGACCACTATGGAGGCCAACAGAGGCAGCCCCTGCCCCAGATTTCCCGTGCGTCACAGGAGCTGAAGTCGTCGAGGCAGCTGTTTCGCTGACGATGTGGCAATCACAGCCGGGCTAGCATGGCTCACAAGACCAAGCAGTCCTACTAAGCAGCAGGAAAAAGATGGAGGAGAACATGCTGGTCTCCGTCAAAGGGTACTCAGGGGGGACCTCTCAAGAGTCCCTAAAGTACCTGGGGTAATGATGAATCGCAGACTATCGTTCAAGGACCACGCAGGCTACGCCAGCAGAAGACAGCAGTCACATCCTCTTCGTTGGCGAGGCTTATGCTTAACGTCGGAGGCCGAAGCACCCGGCCAGGGAAACTGCTGGTGTCAGTAGCAAAACTTCGCTGCTATACACGCGCAGTCTGGAGCAATGCCACTTGCAGGGTCTCATACCTGAAAGGAGGCTCGTTCGGTGCACGGTCAATGGCCCTCAGGCTCATTAGGATTCAGGACCATATCCAGGGCGCGGCGCTAGCGCTGGCAGGCCTGCCGATTGATCTGGAAGTCAAGGCTCTCAGCCTTATGCGGAGTGGCGCTTCCAGGCAAAAAGAGGCACACGAGTGGCTATTGGGTGAATGGCAGAGCAGATGGCAAACGTCGCGACGGGGAGGTGGACCTATCAGCTCATCAGAGATGACGGTTTGGGCAGAGTGACACTCTCAAAAGTTATTAATAAACTTGAGTTGTTATTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTAATTTATAAGTAAAATAAATATTGTTTAATTATATTTCCTAAAAAAAGTGCGTTTAATTAAGCAAATAACCATGGTACGACCGTTAAAATCAAAATTCATCTTATTTCACGGTGTTGTAACAGGTTTCTTGACAAACTGTACTTGTCGCAAGTTATTTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTAGAGAGTGATGCCGAGTATAAAGAGTATTGATTCAGATCCGACATCAAGTGGGACCGCCTACTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTGTGTTTTAGCTGTTCTTTATTTGATCCAATTTGGGAACAGGGAAGGTCCGCTCCATTCGAAATTAATTCGTCAATCCTCTTATGATCTACATACACAAGGTTTCTTAGCCTAAGTCGAGGAGCAGCGCTGCCGGCATAGCCTGCAACGCAGCAACGCTTATATCGTATCTTATATATATGTATATATATATGTACTGTCGCCGAGCAGTGGTGCTGGAGAGGTGGTATGACACATATAAAGCGATCAGCGCTTGGCCAGCAGGAGAACTGCTGACCAGGCAATTATGTATGTTAGCCCTCAAGTGGATTGCTCGTATTACGTATACACTTGTGCTGGACTGTTTATGTACACATTGCAGCAGGTGCTACAATTATGAATACACATAGGTACAGTGCTTAACCGATATGTGTGCATACTACAATAGTGAGAAACAATTTGCTGACAATTCACAGAGTCGCAGAATCGCCATTTTTTCTGAACTGTTAAAAGAAGTGCAAAACTCACAAAGAGACCCAAAAAAAACTCAATGCTGTCGTATTGCCAAGTTTAATCCTGAACGCACAGGCTTAGACACTCAATCCTGGTGCGGAGACCAAGTCTACATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCAGAAATACTCGAAACCATAGAAGTTGTGTCGGCCGGTGTGTGCGGCAAGCTGGCAAAATCACACGGTGAGTCGCGCCATGGTTCTGCGCTGCAATCACGCGAGTTAATTGTGCGCCTGTTTCATGTAAATAGGTAATTTATTATCTTTGCGATTGTTGCAGCGGATAAACAGCTGATAGCGCAGCGGGCAGTCTGGAGAGGGAGGCGTTGCCAGATCAACCGTGTGATCGGTGTTGTGTTGCGACAGTAGGGCGCGAAATTCAAAATTAAATTTAAAATTAAGCCGTTGAAATTTAATTTAATTTAATTTTGATTCTGGTAACTGGGGAGCGCACAAGTCTTTCAGAAAGGGGAAAGGCACAAAGGTCGCGGACCAGACCAAATATCATCCTCTGCCGTTAACAGTTGCCTAAGCAGAGGCTCTGATTGTCCGAGTCGAGGCGGTACAAACCTCCATCCCGTAAAGCCGGGAAATCCGTGGCCTACGTGACCCTGATGGCAACAGGCCATCCTTCAGTTGATGGACAGCGCAGTGGGGGCAGTCCCCTGATCCGCAACGACCCGTTCGGGGAGGCTCGGCTTTCGAGATCCCCCACCAGAGGAGTCGGTAGCGCCCGACCCATGGTGGGCGAGATCTCGGTCCCGTCGGTGGCAGGGGGTGAGCACGCAGGCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGGAGTGGAAAATTGGCTCCTACAGCATCTACGACCGCGACAAGTCAGAAGACGATGGACCACATCGCCGTGCCATCGCAAAAGACGGAGAGGGAAGTCCCCAGCTGGTTCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCAGAACGAGAGGACCTGAGGGGCATACTTACCAGGATGAATGGCAAGATCAGCCCCCTTCTATCCGCGTTATTCGAGACCCAACGGCACACATGAGAGACAAAGGGCATAGCTTCCGAACTCTCAGCCCTTAACAACAGGGCGATAGAAGAGCTGTGAAGGTACTACTAGCGAGCACCGCTTGAAAACGCTTACCCGGGCGGAGGTACAAAGCCGCAAAGAAACCGCAAAATGCACCGGGTACCCACGGTGCGGGTGCCAAAGTCCGGAGCGCCGAAGCAGAGCAACCCACGTTGGATGGCAGCGGTGAAGAAAAGGCGGCATCCATACCTAACGAGTCAAGCCAGGCGGCTGTGCCGTAGCCAAGAATGCTAGCACGGAGTGCAGAAGCGCTCATCGTAAAAAAAAAAGACAGGAGAGGCTTCGTACGCAGAGATGCTTCGGAAGCTAAGGTGGAATCGAGCCTTAGCAGACGCTGGGCGATCGTGCGAAAAAATCCGGAGAACGCAGAAGGTGATCTGTTGGCGAGGGTAGAGGAAGCTTCGAGCGTTCCCAAGTTTAAACGACCTGGAAGCGGCGCTCAATGACTTGGCCTCTGTGCGCACAGGGCGCAAAGAATAGCTCTATCTTGCAGCGGATTGGACCTTTGAGGCTACGACGGCAGAGAAGCTCCTGGCTGCTTGGTCGCCCAATTCCAGGGCCTGCAGATAAATCCTGTGAAGTATCAGGGGCCTTCGCAGTATGCGGAATTGCAAACAAATAGCCTCAGTGCTGCTGAACGCGAACGTTGCGATACCAGTCCTTAAACAGGGCACCATAATCGTTGGATGGTCAAGATGTGTACCACCCAGGACGTCCGACCCACGAGATGCTACAGGTGTCTCGGCTATGGGCATCGATCAGCAACCTGCAAGGACGCTGACAGAACCAGACTGCTGTCTTAGATGCGGTGAGCGTGGGCACAAGGCAAAGGGGTGTTGCACCAAAATGCCTGATCTGCAGCAGCAGGGTGGACGGCTCACCCGACGGGTAGCTTTGCGTGCCCGACTTGCAGAAGCGACACTAAAGATGCCAAGGCCACCTTAATGCATACTTATTGGCGTAGTACAGCTCAATGTCAATCATTGCGCAGCAGCTCAAGAGCCTCCTGGCCCAGACTGCGGTTGGTACCAATGTAGACATCGTATGCTCCCTAAGCGAACCCTACGTCTCTGGTGGTGGACAATCGTCCATGATCCTTGACGAGGCAGGTAAGCAGCTATCAAATGCTGCAGCTCTCTCAGTCCAGAGACGCTGCTTTACCCATGCGGGGTATCGCTTATGCGAAGTTAAAACACGTGCACATACAGCTGCTACGCTCCGCCGAGCGACACGCGATCAGTTCGAGGAGCTTCTGGAGGCGCTCGTGGACCATGCGAGAGGGCGAAGCCCGAAAGGTCATTGCCGGCGACTTTAATGCCTGGACGTGCGGAATGGGGCAGCAGGACATCCAACACCAGAGGACGAGCTGTGATTGACGCCATGCGAATGCTGGACCTCATACTGCTGAACGATGGACGAGAGCCGACGTTTAACAACGATAGGGGTACGTCCTTTATTGACGTTACCTTTGTCGGCAGAGGGCTGATGAACCCAACAACAACTGGATGGTGGCGTCCTTGACGCTGAGCGACCATGCTGATCTCCTTCTCCCCGGAGGCCTGCCCAGGGCAGCAGAGTAGAACAGCCGGGAAAGCATGGGACACCAGGAGAAGATCGTTGAGGGCCATGCTGGCTATAAGATCAATTCCTGGAAATCCCAAATGTGGACGCAGAAGGTATGGCGGCAGGCCTCATGAATATGCTGGGAAGAATCTGCGACGCAATCATGCCAAGGAAAAAAATAAGGCACAGCGCAAACCACCGTTTACTGGTGGAGTGCCTCTAAGCCAACTACGGTCTGATTGCCTCAGAGGGCTAAAGAGAACGGCGCAACGAGCCAGAGGCAGTACCCACCACGCGGAACTCTTGGGGGGGGGGGGCTTTCAGAAGCAAACGCCTGAGTTCAAGCGCATCGCTGGCACGGGTGTTTGAGAGCGGGGACGGCGATATCGGGCCTCGCTGCAGCACATTGCCGGCGGGGCTGGAAGCGGCAACCCATCCGACCCGAAGTTGTTTCGCACCGCAGGGCCGTTTCCCGAAGCGGGCCACTACCGGTAGCGAGGCAGCCCTGGCGTGCGGGCTTTGAAGTCGTCCCAAAGAGCGGCTTTGTTTGCTGCAGGCATTGCGTCGGCGGGCTTGGCGGCATTCACGGGCCGGCGATTACCGCCAGGGAAAGACAGGAGGCGAAATTGCTGGTCCGTGGGACCTGGGGGACTCTCAGAGTCCTAAAGAGTACCTGGGGTAATGATGATAGATCGCAGACTATCGTTCAAGGACCACGCGAGCTACGCCAGCAAGGGCAACAGTCACATCCTCTTCGTTAGCGAGGCTTATGCCAACGTCGGAGCCCAGACACCCGGCCAGGAAACTGCGGTAATCAGTAGCAAAGGCTTCGCTGCTATACGCTGCACACCAGTCTCTGGAGCAATGCCACTTGCAGGGTCTCATACCTGAAAGGCTCGTTCAGTGCGGTCAATGGCCCTCAGGCTCATTAGAGGATTCAGGACCATATCCGAAGACGCGGCGCTAGCGCTGGCAGGCCACCGATTGATCTGGAGATCAAGGCTCTCAGCCTTATGCGGAGTGGCGCTTCAGGCAAGAGCACACGAGTGGCAAATGGGTGAATGTAGAGCAGATGGCAAACTGCCCGATCGCGACGGGGGGGAGGTGGACCTATCAGCTCATCAGAGATGACGGTTTGGGCAAGTGACACTCTCAAAAGTATGTAAACTTGGAATTTGTTATTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTGTTTACAGTAAAATATATATTGTTTGGTATATTTCCTTAAAAAAAATTGCGTTTAATCAAGCAAATAACCGTTAATTTTGACCTTTAAAGTCAAAATTCCAACTTATTTCACGGTGTGTAAACGGTTTCTTGACAAACTGTACTTGTCGCAGATTTATTTTTAATTTCAGTTAACGACCGTTTTCTGTTACTTTGTGTCGCTGCTGTTTTACCATTATTAGAGCGCATTCTCTCTACCTTGCAACAGCGTGGCAAATGCTGTTTCAAACAAAACCTCCGCTCTCTCTCCTGTCCTTGTCAAGCTCACCGGGACTGCCAGTCCGAATTATTTCATCGGTGAGCGGGATGTGGTGCCATTGCACACCATCTTCTTTTGCGATTACTGGCAGCTTGCTTTTTTACGACAACTGAGCGTACCAGTCGTAGAGTTCTTTGCCCGCCAACATGCAGGGGGTACTCTTATCGCCGTTCAGATTAGGTGTCTAGTCGCTACGGACACGCTTCATCATGCGGTGACGATGATCACGTGAGCCCCATCCCAAACGATTTTGTCCCGCCATCATAGCGAAAGCAACCAAGCCTCGAACGAGAATGACCAGCGGAAGCGCCGAGTTGCGCCCTCTCTCCAGCGAACCTGCTGGAGCGGTGCAGTAGGATGTGCTCTGCGGTTTTCCACTGCGTCTGTGCAATAAAGGCGCTGGGCTGGCTTATCCACGTGGCGGAACCACCATGGCGGTACCTCGAAAACAGCCATGGTCCGTGAGGAACTGGGTCATGTGAAATTGATCCACCGTTTTATTGCTCGCAATCCAGCCCACTCCGTTAGTTGCGGAATGAGTTTGTAAGTCCAGCGTCCCCGTTGTGACTCTTGCCACCTGGTCTGCCTTACTCCTCGAATCCACTCTTTTGATCTCTAATTGGTGTATCCCTCGCGCAAGGTATTTGCCCTTTATGTCAGGTATTAAGATTGTAATGCCTGACAGAGCGTGCGCTGCGTCGTCCGATATGGTTCTAAAGCCTCTGATTAGCCTGAGGCCATTGTCCGTGATACTGCGCGGGCGCACTATCTAGATAGGTTTTCTTTATTGGAAACGCAGCTCCAGATAGGCGCAGCCTTAAAGCAGTGTTGCCTTTGAAACCGCCACTAACAGTCTCCTAGCCGGCAGTCCTCCACGTTGGGCATGATTCTCGCCAAGGCTGCTGCATCATTGCCCGCTTTTTTGCTGGCATACCTTGCGTGAGCCTTGAACAGGCCTTCGGTCACCATTAGAACACCAAAGGTATTTCAACGTTTCTGCTGAGGCGATTTCAGCTCCTTTGACTTCCACGCATGCACTCTTGGACTTTCTGCTGTTCAGCAGGACTACTTCGGTCTTATGCACCCGGCTATTTTAAGTCCGACTTTCTCCGAAACCATTCTATGGCCGCCGTGATTACCACGTTACTTATGTCCTGGAGCTCCGGTATTGTCTTGCTGACCGCTGTTATCGCAACGTCGTCGGCGAAGCAGTGCAGCTCCACACCTCTGGGCTTGCTAATGCTCAGTATTCCATCATACATAATGTTCCACAAGATCGGTCCTAGTACCGACCCTTGGGGAACGCCTGCAGAACGGTGGCTTCTTGAACATCTTCTGTTGCATTACCGCAACACGGTCCCTGAAGTAGTTGCCAATTACGCCTCGTATGTAGTCGGGAACGCCCAAAGTTGCGCATAGCCCGAGATAATGGGCCATCTCGCTGTATTGAATGCGTTCTTGACGTCTAGCGTGATGATGGCACAGTGCCGCTTCTTACTGCCGCCTAACCATCGGTTACCGTCGAGTGCTTTCTGGCAGCGTCTGTTACGGATTTGAGGCGTCGAGCGTACTTTTTACACCCTTTCGGAAGCCATACTGTTGTGGCCACAAGAAGGCCTGTATGGGACTTTCAGTGATTAGCTCAATGCGCGTACGGTATGCGCTCAAAGAGAGCTTGCCAACAATGTCCAACAGACACAACGGTCGGTAACTGCGTGGAACATTTGCGGGCCTTGCCTTTCGGCAGAAGGACCAGCTTCATCTTTTCAGCGCTTGGGGAGACTCCGTCCAGCAGACACTGTTGGAATGTATCCCTGAAGACCTCCGGTCTTGCGGTGGCGGCTGCTTATGGCAGTCACGCCCGGGATACCATCAATGCCGGGAGCTTTTGTTCGGTCTGATCCTCTTTAACAGCTTCGACGACTTCGCATGACGTGATGCACGGGAAGTCAGAGGCGGGGGGGTCAACAGCGGGTTGCCTGTTGGCTTGGAAATGGATTCCGACGATGTTGGCCAGGGCGGCTGGGTCCTGGGGAGATCCTGCACCAGCGGAATTGAGTTTTCCTTACGACTTTGTAGGCGAGACCCCCCAGGGTCGTCGTCTACACGCTATCAATCAAAAGGTCCTTAAATTAAATTCGCCTTTGCTGCTGATATGCCGTTCTTAAGCTCAGTTCGCTTCGCTTTATATACCTCAATGCACTGGGAGTGGTGCGGTTTTACTCTAGATTGCTGCGCTTGCCTCCTCGCCTTGATGCATTCCGTCCGAAGCTGGTGCAATGAGTCCACTCCACCAGTAGACAGGGGCTTTCGTTTCGTGTTCCTTTTTTCTCGGCATCCACCGCATCACATTGCTCTAAACCTATCCATGAGCTGCCACCATGGTCTCCGCGTGTCCAATTATGGACTCCATTACCCCTCCGATCTGTGGTATGCCAGCGTAATGTCATCAAGCAATGCGTAACTACACT
->78e01914-94ca-4040-bd8e-6c99d7583512
-CTGTTATTGCTGGTTCAGTTACACGTATTGCTGGCCAGCCGCCCTGGCCAACATCGTGTCGGAACTATTTCCAAAGCCAACTTACATTTAGCAGCCACTGTTGACCCCCCCCGCCTCTGACTTCCATTAAATGTCGTAAAGTCGTCGAAGCAACAAAGAGGATCAGACCGAACAAAGCTCCCGGCATTGATGGTATCGGGCGTGATCGTCAAAGCCGCCACCACCGCAAGACCGGGAGGTCTTCAAGGATACATTCAACGAGGTGTCTGCTGGACGGAGTCTTCCCCAAAGAAGCCCGCTGGAAAGATGAAGCTGGTCCTTCTGCCGAAGGCAAGGGGCCCGCAAATGTTACGCAGTTACCGACCGTTGTGTCTGTTGGACATTGTTGGCAAGCTCTTTGAGCGCATACTGTACGCGCGCATTGGGCTAATCCACTGCCATGAAAGTCTACAGGCCTTCAGGGCCAACAGTATGGCTTCCGAAGGGTAAAAGTACGCTCGACGCTCTCAAATCCGTAACAGACGCTGCCAGGAAAGCACTCGACGGTAACCGATGGATTGGGCGGCGAGTAAAAGTACTGTGCCATCATCACGCTAGACATCAAGAACGCATTCAATACAGCGAGATGGCCCATTATCCTCGAAACATGCGCAACTTGGGCGTTCGGCTACATACGAGGCCGTAATTGGCAACTTCGCCAGGAGTTGCGTGTGTTGCTGGTACGTAACAGAAGATGGTCAGAAGCCGCAAATCTCTGCAGGCGTTCCCCAAAGTCGGTACTAGGACCGATCTTGTGGAACATTATATGATGGAATACTGAGGCATTAAGCATTTAGAGGTGTGGAGCCGCCTTCGCCGACGACGTTGCGATAACAGCGGTCCTTAAGACAATACCGGAGCTCAGGACGCCGTGGCATTGGCAATCCCGGCGGCCGCCAGAATGAAGCTCCGAGAGTCCGGACTTAAGAATAGAAACGCGCGCCAAAGACCGAGAAGTAGTCACGCAACTTCCAAGACAGCAAGAAGGGGAAGTCCGTTGAGTGCATGCGATGTGGAAGTCAAAGGAGTTGAAATCCTCAGCAGAAACGTTGAAATACCTTGGTGTTCTAATAGACCGAAATATCGTTCAAGGCTCACGCAAGGTGCCAGCAAAGCAGCAATGGCAGCAGCAGCAGCTGAGAATCATGCCCAACATTGGGGAGGGACCAGACTGCCGGCTGGGAGACTGTTAGTGGCGGTTTCGAGGCAACACTGCTTTGCCCTTTCTATCTGGAGCTGCGTTTCCCTGAAAACCTATCTAGATGGTGCCGCGCAGTATCACGGACAATGGCTCTCAGGCTAATCAGGGCTTTGAGAACCACCATCGGACGGCCTGTACGCACGCTCTGTCGGGCATTACACCCATTGGCCACCTGGACGCAAGGGCAAATACCTTGCAGTGGGGATACACTCAATTAGAGATCAAAGAGTGGATTCGAGGAGTATGGCCAGACCAGGTGGCAAGAGTCACAACGGGGACGCTGGACTTACAAACTCATTTCCGCAATAACGGAGTGGGCTGATTGCGAGCACAAAACAGTGGACTACCACATGACCCAGTTCCTCACGGACCATGGCTGTTTTTTTTCGAGGGTACCTATGCCAAGGTTCCCGCCACGTGGATACAACCCAGTGCCTTTGTGCACAGACGCAGTGAAACCGCAGAGCACATCCCTACTGCTCCAGGTTCGCCGAGGAGGGCGCAGCTCGTAGCGCTCGCTGGGTCACCTCTCAGCCAGGAGAGGCGGGTTGCCGCTATGATGGCAGACAAAATCGTTTGGGATGGGGCTCGCGGCCGTCATCGTCACCATGATGAAGAAGCGTGTCCGTAAGGACGAGACTGACCAATCTGAACTATAGATAAGGAGTACCCCGTATGTTGGCGGGGCAAGAACTCTCTCTGACTGGTACGCTCAGTTGGTGCCAAAGGCGCTGCTGGCGCACCGCAAAAGAAGATGGTGTGCGGCAACATCCTGCTCACCGATGAAATACCTTGACTGGCGTCCATTGAAGCAGCAAAGGACGGGAGAGAGCGGAGGTTTTGTTTTGAAACAGTTATTGCCACGCTGTTGCAAGGTAGAGAATGCGTGATGTTCTAATAATATACAAGAAGAATGAAAGAAGTGGACACCAGAAGTAACACGAGAAAACGGTCGTTAACTTGAAATTAAAAATAAATCTGCGACAAATTACAGTTTGTCAAGAAACTGTTTACACACCGTGAAATAAGTTGAATTTTTTTGACTTTTAAAGGTCAAAATTAGCGGTTATTTGCTTGATTAAACGCAATTTTTTTAAGGAAATATAATTGAAAGCAATATATATTTTACTTATAAAATTAAAAAGAAAACAAATTCAAAATATCAAATATACAAGAGAAAATAAATATGGAATTCCAAGTTTACACACACTTTTGGGAGTGTCACTCTACCCAAACCGTCATCTCTGGGATAGGCTGATGGAGTCCACCTCCCCATCCCGCGACGTTTGCCATCTGCTCTGCCATTCACCTAATAGCCATCATTGTGCCTCTTGCCTGGAAGCGCCACTCCGCATGAACGAGCCTTGATCTCCAGGAATCAATCAGCAGACCTGCCAGCGCTAGCCTGCCCGCGTCTTCGGATATATGGTCCTGGAATCCTCTAATGAGCTGCAGGCCATTGGCCATCAGCACCGGAGCAGGCTCCTTTCAGGTGAGACCCGCCACCGTGGCATTGCTCCAGACTGGTCCGTGACTATGCTTGGCAAGCCTTGCTACTGACACCAGCCCAGTTTCCTGGCGGGTGTCTTGGGCCTCCGACGTTGGGCATAAGCCTCGCCAACGAAAGGATGTGACTGCTGTCTTCTTGCGGCGTAGCTCGCGGCGTAGTCCTTGAACGATAGTCTGCGATCTATCATTACCCCAGGTACTTTAGGGACTCTTGAAGTTACACAAGGTACTTATGACGGGGGAACCAGCATGTTCTCCATCTTTTCCCTGCTGCTTAGTAGGACTGCTTCGGTCTTGTGAGCCGCTGTGCTAGCTTGGCTGTGGTGCCACATCGTCAGCAGAAACAGCTGCCTCGACGACTTCAGGTTCTGCTTGTTGCGGCAAGATCTGGGGCAGGAGAACGCGCCTCTGTTAGCCCTCCATAGTGTAGTCTGCTTTGGAAATAAGCTCCTACGTACATGTGTAGGACCCCAGGTCGGATGGGGTTGCCGCTCTCCTCCTTAGCTCGTTGGTAGCAAGCTTGTAGGCTGGGGCCCCGAATCGCTATCTGCCATCAAGCTCCTTAAACGACCACCGCGCTTTGTGGCAGCCGCGATGCCGTGCTTGAACTCTAGGCGTTTGCTTCACAGAAAGCCTCAAGAGTTCCGCGCGTGGTGGAGTACTGCCTCTGGCTCGTTGCGCCGTTCTCTCTGGCCCTAGGCAATCCGGTGTGATTGGCGAGGGCACTCCACCAGTAAACGAATTGGTTTGCGTAATGCCTTATTTTTCCTTGGCGCCAGTTGCGTGCCAGATTCTTTAGCATATTCACTTAGGGGGGGGGGCCTGCCGCCATACTCTCTGCGTCCACATTTACAGGATTTCCAGAGTTAAGTCTGATAGGCCAGCATGGCCTCATCGATCTTCTGAATTATCCCATATTTTCCCAGCTGTTCTACTCTGCCCGTCTTTTTGGGCATGCCACTCCGGGGAGAAGGAGATCAGGGCATGGTCGGCTCAATCTGACGTCATGGACCATCAGTTATTTATTTGTCATACTAGCCCTCTGCTGACAAAGGTAACGTCAATAAAGGACGTACCCTATCGTTAAACGTCGGCTGCGTGCATCGTTCAGCGGTATGAGGTCAGCATTCGCATGGCGTCAATCACAGCTCGTCCTCTGGTGTTGGATGTCCTGCTGCCCCATTCCACTGTCAGGCGGTAAAGTCGCCGGCAATGACCTTCGGGCTTCGCCACTCTCGCATGAATCACAGGCGCCTCGAAGCTCCGAACTGATCGGGGGGGTGTCGCTCGGCGGAGTAGCAGCTGTATACATGTGCACGTGTTTTTTAACTTCGCGCAAACGATACCGCATGGAGTGAAGCAGCCAGTTCCTGGACTTGGAGAGCTGCAGCATTTGATGGCTGCTTTACCTGCCTCAATCAAGGATCATGGACGTTATCCCACTACCAGGACGTAGAGGTTCAGCAGGAGCAGTGTCTACATTGCGCTCAGCCGCAGTCTGGGCCAGGAGGCTCTGAGCTGCTGCCTGATGATTGACGATGAGCTGTACTACGCTATGTAAGGCGTGCATTAAGGTAGCTCGCATCTTTTTAGTGTCGCTCTGTAAGTCCGGAGCACGCAAAGCTACCCGTCGAATTGGTTTCTGTCCACCTCGCTGCTGCAAGATCAGGCATTTTGGTGCAGCAACGCGCCTTGCCTTATTAGCGCTCACCGCACATCTAAGACAGCAGTCTGCCCTGTCAGTGTCCTTACGGGTTGGCGTCGATTACTTCGCCAGCCGAGACACCTGCTTAATCTCGTGGGTCGGACGTCCTGGAGTGATACGACATCTTGACCATCCAACGATTATGATTGCCCTGTTTAGGACTGAGTATCCACCCAACGTTCGCGTTCAGCAGCACTGAGGCCCTATTTGCTTGCAATTCCGCACATACTGCGAGGCCCTGAAGTATCTTTAGGTTATCCTGCAGGCCCTGCGATTGGGCGACCAAGGAAACCCAGCTGTGGAGCTTCTCTGCTGTCGTAGCCTCGTCAATCCGCTGCAAGGATAGAGGCTATTCTTTTGCGCTCCTGTGCGCACAGAGGCCAAAGTCATTGAGCGCCGCTTCAGGTCGCTCTTAAACTTAAGGAACGCTTTCCGAAGCTTTCCCTCTACCTCAAGCAACAGATCCTTTCTGCGTTCGGTTTTCGCACGTGACTGCCCAGTTCGCTAAGGCTCGATTCCGATCTTAGCTTCCGAAACATCTCTGCGTACAGAAGCCTCTCCTGTCTTTTACGATGAGTGCCTCTGCACCCGTGCTAGCATTCTTGGCGACAGATGCATGGCACCTGGCGGACTCGTTAGGTATGGATGTCGCCTTTTTCTTCGCGGGTGCCATCCAACGTAGGGTTGCTCTGCTTCGGCGCCTGGACTTTGGCACCTGCACCGTGGGTACTGCGCATTTTGTGTGGAGCCTTTTGGTAGGCTTTTGTACCTCCGTCTGGGTAGCGCTGCTCTTCAAGCGGTGCTCGCTAAGTAATACCTTCGTACAGCTCTATCGCCTGTTGTTGGGGCTGAGAGTTCGGAAGCTAATACCCTTTTGTCTCTCGCGTAATGTGTCGTTGGGTCTCAGATGCGGATGAAGGGGGGCTGATCTTGCCATTCATCCTGGTAAGTATTATGCCCCTCAGGTCCTCGTTCTGGAGCAGTGGGTCAGGTCCGAAGACCGATGGGGAACCAGCTGGGGACTTCCCTCCCGTCTTTTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCTGACTTGTCGCGGTCGTAGATGCTGTAGGAGCCAGTTTCTCCCACCTCTACGAAGCATCGCTTGCAGTCGATAGTCAGCAGCGGCTGGGGGCCTGCGTGCTCACCCCTTGCCACCGACGGGTTCGAAGATTCAAATCACCATGGGTGGGTTACCGACTCCTCTGGTGAAGGGGATCTGAAAGTCAGGAAGCTCCTCCCTGAACAGGTCGATTTGCGATCAAGAGGACTGCCCCCCACTGCGCTGTCCATCCAACTGAAGGATGGCCTAAGGTTACCCTAGGTGATCACGTAGGCCACGGATTTCCCCTGGCTTTTACGGATGGAGGTTTGTACCGCCTCGGCTCGGACACCAGAGCCTCTGCTTAGGCACCAGCACGGTGAGAGGATGATATTTGGTCTGTGCGACCTTTGTGCCTTTTCCCTTTCTTAAAGAGACTTGTGCGCTCCCAGTTACCAGAATCAAGAGTCGTTGAATTAAATTTCAACGGCAATTTTAAAATTTAATTTTGAATTTCGCTTACTGTCGCAACACAACACTGATCCGCACGGTGATCTGGCAGCGCCTCCTCTCCAGATCGCCCGCTGCGCTATCGGCTGTTTATCCGCTGCAGCAATCACTTAAGATAATAAAATTACCTATTTACATGGAAACAGGCTTCAATTAACTCAGCGTGATTGCAGCGCAGAACTATAGCGCGACTCCGCCGTGTGATTTTGCCCAGTTTGCCGCACACACCGGCCGACACAACTTCTATGGTTTCAGGTATTTCAGCGCCGCGCGTAATTTAAGACGTCGTCTTCACGGCGATGTAGACTTGGTCTCCGCGCAGGTTAATTAATCTAAGCCTGTGCGTTCAGGATCAAACTTTGGCAATACGGCAGCGGTAAGGTTTTGGGTCTCTTTGTGAGTTTTGCACTTCTTTTAACAGTTCAAGAAGCTGATTCTGCGACTCTAGAATTGTCAGCAAAATTGTTTTCACTATTGTGATATGCACACATATCAGTTTAAGCACTGTACCTATGTGTATTCATAATTGTAGCGCCTGTTGCAATGTGTACATAAACAGTCCAGCACAAGTGTATACGTAATACGAGCACCCGCGGGGGGGCTAACAGCAGCCATGATTGCCTGGTCAAGCGGTGCCCGCTGGCCCGGCTGATCGGCTTATGGCGCTGCCACCGCTCCTCCTCCAGCACCGTAGCTCCGGCGACCCGGTATATATACATATATAAGATGCGCGCTATAAGCGTTGCTGCGCTGCGAGCTATGCCGAAACGGCGCGCTTCCCTCGACTTGGCTAAGAAACCTTTGGCCAGATCATAAAGAGGATTCCGGCGGAATTAATTTCCAGTGGAGCAGGGACCTTCCCTGTTCCTCAAATTGGATCAAATAAAGAACGGCTAAAACCTGGAAATGATCCTATGACACAATGAAACTACAGGAGTAGCAATACGTAATA
->e76596da-bcc2-4395-aa51-b96a89bf872f
-TTGTTGTACTTCGTTCAGTTACGTATTGCTGGAGGTCTTCAGGGATACATTCCAACAGTGTCTGCTGGACGGAGTCTTCCCCAAGCGCTGGAAAAGATGAAGCTGGTCCTTCTGCCGAAAGGCAAAGGGGCCCGCAAATGTCCCACGCAGTTACCGACCGTTGTGTCTGTTGGACATTGTTGGCAAGCTCGCTGAGCGCATGCTGTACGCGCGCATTGGGCTAATCACTGAAAGTCCTACAGGCCTTCAGAACAACAGTATGGCTTCGAAAGGGTAAAAGTACGCTCGACGCTCTCAAATCCGTAACAGACGCTGCCAGGAAAGCACTCGACGGTAACCGATGGTTAGGCGGCGGTAAAATACTGTGCCATCATCGCTGGGCGATCAGAACGCATTCAATACAGCGAGATGGCCCGTATCCTCGGGGCTATGCGCAACTTGGGCGTTCCCGACTACATACAGGCGTAATTGGCAACTTCTTCAAGGCCGTGTGTTATGGTACGTAACAGAAGATGGTCAAGAAGCCACCAAGTCTCTGCAGGCGTTACAGGGTCGGTACTAGAACGATCTTGGCGTTTATGTATGATGGAATACTGAGCATTAGCAAGCCCAGGGTGTGGAGCTGCACTGCTTCGCCGACGACGTTGCGATAACAGCGGTCATAAGACAATACCAGGCCAGGACATAGTAACGTGGCAATCACGGCGGCCATAGGAGAATGGCTCGAGAAAAGTCGGACTTAAAATAGCTGCGCATAAGACCGAAGTAGTCCTGCTGAACGAAGTCCGTTGAGTGCATGCGTGTGGAAGTCAAAGGAGTTGAAATCGCCTCAGCAGAAACGTTGAAATACCTTGGTGTTCTAATAGACCGAAGGCTCTCGTTCAAGGCTCACGCAAGGTATGCCAGCAAAAAAGCGGCAATGACAGCAGCAGCCTTGGCGAGAATCATGCCCAACGTGGGAGGACCCAGACTGCCGGCTAGGGAGACTGTTAGTGGCGGTTTCAAAGGCAACGCACAACATGCTGCGCCTATCTGGAGCTGCGTTTCCACAAAGAAAACCTATCTAGATAGTGCCCGCGCAGTATCACGGACAATGGCTCTCAAACAATGAGGCTTTAGAACCATATCGGACGACGCAGCGCACGCTCTATCGAGCATTACACCCATTGACCTGGGCATAAGGCAAATACCTTGCAGTGAGGATACACTCAATTAGAGATCAAAGAGTGGATTCGAGGTATGGCAGACCAGGTGCCAAGAGTCACAACGGGGACGCTGGACTTACAAACTCATTCCGCAACTAACGGGTGGGCTGATTGCGAGCACAAAACGGTGGACTACCACGCGGTAGTTCCTCACGGACCATGGCTGTTTTCGAAATTTTATGCCAGGTTCCGCCGTGGATGGCCCAGTGCCTTTATTGCACAGACGCAGTGAAACCGCAGAGCACATCTACTGCACTGCTCCAGGTTCGCCGAGGAGAGGGCGCAACTCGTAGCGCTCGCTGCCGTTCACCTCTCAGCCGAAGGCTTGGTTGCTGCTATGATGGCGGACAAAATCGTTTGGGATGGGGCTCACGTGATCATCGTCGCATGATGAAGCGTGTCCGTAAGGACGAGATGACCAATCTGAACTATAGATAAGAATTACCCCGTATGTTGGCGGGGCAGAACTCTACGACTGGTACGCTCAGTTGGTCGTAAAAGGCGCTGCTGTGCACCGCAAAAGAAGATGGTGTGCAACTTGAAAACACATCCTGCTCACCGATGAAATACCTTGACTGGCAGTCCCGGTGAGCTTGACACAAGAGGACAGGAGAGCAGGTTTTTTGTTTTGAAACAGTTATTTGCCACGCTGTTGCAAGGTAGAGAATGCGTGTTCTAATAATATGCAAAATGAAAGAAGTGGACACAAAGTAACAGAAAACGATTCGTTAACTTGGAAATTAAAAATAAATCTGCGACAAAGTACAGTTGTCAAGAAACTGTTTACACATAAATGAAATAAGTTGAATTTTTTTTGACTTTAAGGGTCAAAATTAACGGTTGTAGCAGATTAAACACCAATTTTTTGGAAATATAATTTAAACAATATATATTTTACTTATAAATTAAAAACAAATTCAAATATCAAATATATACAAGAAAATAAATAACAATTCAAGTTTACACACTTTTGAGAGTGTCACTCTGCCCAAACCGTCATCTGGGATGAGCTGATAGGTCCACCTCCCCGTCGCGGCGTTTGCCATCTGCTCTGCCATTCACCTAGCCACTCATTATTGCCTCTTTACCGACGCCGCGCCATAAGGCAAGAGCCTTGATCTCCAAGATCAATCGGCAGGCCTGCCAGCGCTAGCGCCGCGTCGCGGATATGGTCTGAATCTCTAATGAACCTGAGGCCATTGGTAACACCGAACGAGCTCCTTTCAGGTATGAGACCCTGCAAATTGGCATTGCTCGAACTGGTGCAGCGTATGGCAGCGAAGCCTTTGCTACTGACACCAGCGGTTTCACAGCCGGGTGTCTTGGGCCTCCGACGTTGGGCATAAGCCTCTCGCCAACTTGAAGAGGATATGACTGCTGTCTTCTTGCTGGCGTAGCTCGCGTGGTCCTTGAACGATAGTCTGCGATCTATCATTACCCCAGGTACTTTGAGGGACTCTTGAGAGGTCCCTATGAGTACTTATGACGGAATAGCATGTTCTCCATCTTTTCCTGCTGCTTAGTAGGACTGCTTCGGTCTTGTGAGCCGCTATTGCTAGCCCGGCTGTGTGATTGCCCACATCATCAGCAGAAACAGCTGCCTCGACGACTTCAAGTTCTGTGACCTTTGCAGCAAATCGGGGGCGGGCTGCCTCTGTTGGCCTCCATAGTGTGGTCTGCTTTGGAAATAGCTCCCCTAGTATGTTAGCCAGGACCCCCAGCGGGTCGGATGGGTGCGCTCTCCTCCTTAGCTCGTTGGTAACAAGCTTGTAGGCAGAGGCCCCAGATATCGCTGTCTACGCCATCCCTGCCCAGCTCCTTAAACGACCGCGCTTTGGCAGCCGCGATGCCGTGCCAGACTCTAGGCGTTTGCTTCTGCCAGCCTCCAAAGAGTTCCGCGTGGTGGTGCCTCTGGCTCGTTGCGCCGTTCTCTTAGCCCTGAGGCAATCAGACCGTAGTTGGCAGGAGGCACTCCACCAGTAAACGGGTGGTTTGCGCTGTGCCTTATTTTCCTTAGCATGGTGCGTCGCAGATTCTTCAACATATTCATGAGGCCTGCCGCCATACTCTGCGTCCATTTGGGATTTCCAGGAGATTGATGATAGGTAGCATGGCCTCATCGATCTTCCACCAATTGTCCCATGTTTTCCAGCATTCTCTGCCGTCTTTTGGGCATGCCCTCCGGGAAAGGAGATCAGGGCATGGTCGCTCCAGCGTCATGACGTCATGGACCATCCAGTTGTTGTTGTCTACTAGCCCTCTGCTGACAAAGGTAACGTCAATAAAGGACGTACCCCTATCGTTGTTAAACGTCGGCTTCCGAATCCATCGTTCAGCAGTATGAGGTCCAGCATTCGCATGGCGTCAATCTGGCTCGTCCTCTGGTGTTGGATGTCCTGCCCCATTCCACTGTCAGGCATTAAAAGTCGCCGGCAATGACCTTCGGGCTTCGCCCTCTCGCATGGTCCACGAGCGCCTCCATCCTCGGGCGATCAGGGGGGTGTCGCTCGGCGGAGCAGCATATGCAATAATGCACGTGTTTTAACTTCGCATAGCGATACCCGCATGGAGTAAGCAGCCAGTTCCTGGACTTGGAGAGAGCTGCAGCATTTGATGCTGCTACCTCGTAAGGGATCGCGGACGATTGACCACTACCAGGGCAATAGGGTTCGCTTAGGAGCATGATGTCTACATTGCGCTCAACCGCAGTAAGGCCAGGAGGCTCTGAGCTGCGCATGATTGACGATGAGCTGTACTACGCTATATGAGCGTGCATTAAGGTGTCTTGGCATCTTTTAGTGTCGCTCTGTAAAGTCCGGGCACGCAAAGCTACCCGTCCGGGTGGTTTCTGTCACCTCGCTGCTGCAGATCAATTTTGGTGCAGCAGCGCACCTTGCCTTGTGCCCGCGCTCACCACCGCATCTAAAGACGTAGTCTGCCCTGTCAGTGTCTTGCGGGTTGCTGATCGATGCCCATAGCCGAGGCCTGCAGCATCGTGGTCGGACGTCTGGAGTACGACATCTTGACCATCCAACGTTATGGTGCCCTGTTTAAGGACTGAGTAACGTTACGTTCAGCAGCACTGAGGCTATTTGCTTGCAATTCCGCATACTGCAGGCCCTGATATCTTCAGGATTTATCTGCAGGCCCTGGAGTGGGCGACCAAGCGGCTGTGGGCTTCTCTGCTGTCGTAGCCTCGTCAATCCGCTGCAAGATAGAGCTATTCTTTGCGCTCCTGTGCGCACAGAGGCCAAGTCATTGAGCGCCGCTTCCAGGTCGCTCTTAAACTTAGAACGCTTTCGAAGCTTTCCCTCTACATAAACAAGCAGAATCACCTTTCTGCGTTCTCCGGATTTTTTCGCGTGACTGCCCAGTTCGCTGAGAACAGTTCCGATCTTGGCTTCCGAAGCATCTCTGCGTACGAAGCCTCTCCTGTCTTTTTTACGATGAGTGCCTCTGCACCCGTGCTAGCATTCTTGGCGACAGATGCATAGCTGCCTGGCTTGGACTCGTTAGGTATGGATGTCGCCTTTTCTTCACCGTTGCCATCCAACGTAGGGTTGCTCTTTCTTCGGCGCCTGGACTTTTTAGCACCTGCACCGTGGGTACGCATTTTGTGGAGCCTTTTGGTAGGCTTTTGTACCTCCGTCTGGGTAGCGCTGCTCTTCAAGCGGTGCTCGCTAAAATGGTACCTTCGTACAGCTCTATCGCCCTGTTGTTAAGGGCTGAGAGTTCGGAAGCTATGCCCTTTGTCTCTCATGTGTCGTTGGGTCTCGAATGCGGATAGAGGGCGTTGCCATTCATCCTGGTAAGTATGCCCCTCAGGTCCTCGTTCTGGAGAGCAGTGGTCAAGTCCGAAGACCGATGAGGGAACCAGCTGGGACTTCCCTCCGTCTTTTGCGATGGCACGGCGATGTAGTCCCATCGTCTTCTGACTGTCGCGGTCGTAGATGCTGGCGAATTGTTCTCCCTCAGCATCTCGCTGCGATCGCCGAAAGGTGCTCACCTTGCCACCGACGGGACCGAGATTCCGTCACCATGGGTCGGGTTACCGACTCCTCGGGCAGGGATCTCGAAAGTCGAATCCTCTGAACGGGTCGTTGCGATCAGGGGACTGCCCCACTGCATGTCCATCAACTGAAGGATGGCCTAAGGTTACCCTAGGTCACGTAGGCCACGGATTTCCCCTGGCTACGGATGGAGGTTTTGTACCGCCTCGACTCCGGACACAGAGCCTCTGCTTAGGCACCAGCACGGTGAGAGGATGATATTTGGTCTGTCCGCGGCAATGCCTTTCCCCTTTCTTAAAGACTTGTGCGCTCCGGATTACCAGAATCAAAATTAAATTAAATTAAATTTCAACGGCAATTTTAAATTTAATTTTTGAATTTCACCGCCCTACTGTCGCAACCTGGCACTGATCACACGGTTGATCAGCAGCATACTCTCCAGATCGCCCGCTGCGCTATCAGCTGTTTATCCGCTGCAACAATCGCAAGATAATAAATTACTGTTACATGAAACAGGCGCACATTAACTCGCGTGATTGCAGCGCAAGAACTTTATGGCGCGACTCCACCGTGTGATTTTGCCCGGTTGCCGCACACACCGGCCGACGGCTTCTATGGTTTCGAGAGTATTTGCCCCGCGTAATTTAAGACGTCCGTCTTCACGTGATGGAGCTTGGTCTCCCGCACCAGGATTGAGTGTATAAGCCTGTGCGTTCGGGATTAAACTTTGGCAATACGGCAACATGAGTTTTGGGTCTCTTTGTGAGTTTGCGCTTCTTTTAACAGTTCAGAAAAAATGGCGGTTCTGCGACTCTAGAATTGTCAATAGAATTGTTTCCTTATTGAGTATGCACACATATCGGTTAAACTGTACCTATGTGTATTCATAATTAGCCAGCACTCTGTTGCAATGTGTACATAAATGATCCAGCACAAGTGTATGCGTAATACGAGCACCCACTTGAGGGCTAACATACACATAATTGCCTGGTCAGCAGTTCTCCCGCTGGCCAAGCTGATCGCTTATATGTGTGTGCCTATGCCTCCTCCTCCAGCACCATCGCTCGGCGACATTTATATATATATACATATATATAAGATACGCATATAGCGTTGCTGCGCTGCAGAGCTATGCCGGCAGCGCTGCTCGACAGGCTAAAAACCTTTATGTAGATCATAAGAGGATTTGACGAATTGTTTCCGAAGATGGAGCGGGGACCTTCCCTGTTCCTCAAATTGGATCAAATAAAAAGAACAGCTAAAACACAAAATGATCTATGACACAATGAAACTGGAAGTTGGAGTAGGCGGTCCACTTCTGATGTCGGATCCTGAATCACTTTATGCTCGGCATCCTCTACAGCGGACACAAAATGAAGCAGAAAACGGTCGTTAGCGGTGTAAATCTGCGACAAGTGACACAGTTTGTCAAGAAACTGTTTACACCGTCGAAATAAGATGAATTTTTGATTTTAACGGTCAGAGATAAGGGTTATTTGTAATTAGAAGCGCAATTTTTTTTGGGAAATATGAATTAAACAATATTTATTTTACTTATAAATTAAAAAAACAAATTCAAAATATCAAATATACAAGAGAAAATAAATAACAAATTCCAAGTTTACACTTTTGAGAGTGTCACTCTGCCCAAACCGTCATCTCTGGGATGAGCTGATGGGATTACCTCCCCGTCGCGACGTTTGCCATCTGCTCTGCCATTCACCTAATAGCCACTCATTGCCTCTTGCCTGGAAGCCTCACATAAGGCTGAGAGCCTTGATCTCCAGATCAATCGGCGGGCCTGCCAGCCTTCTTCGCGTCTTCGGATATGGTCCTGAATCCTCTAATGACCTGAGGGCCATTGACCGTAGCACCGAACGAGCTCCTTTCAGGTATGAGACCCTGCAAGTGGCATTGCTCCAGACTGGTGCAGCGTATGGCAGCGAAGCCTTTGCTACTGACACCAGCGGTTTCTGGCCGGGTGTCTTGGGCCTCCGACGTTGGGCATAAGCCTCGCCAACGAAGGATGTGACTGCTGTCTTCTTGCTGGCGCTCGCGTGGTCATGAACTGATAGTCTGCGATCTATCATTACCCCAGGTACTTTAGGGACTCTTGAGAGGTCCCTGGTACCACTGACGGAACCAGCATGTTCTCCATCTTTTTTCCTGTAGCAAGTAGGGGACTGCTTCGGTCTTAATGAGCCGCTATTGCTAGCCCGGCTGTGATTGCCACATCGTCAGCGAAACAGCTGCCTCGACGACTGGGATTCTGTGACGCACGGAAATCTGGGAGGCTGCCTCTGTTGGCCCTCCCATAGTGTGGTCTGCTTTGGAAATAAGCTCCCCTAATTATGTTAGCCAGGACCCCCCCGGGTCCGGATGGGGTTACCGCTCTCCTCCTTGAAGCTCGTTGGTAACAAGCTTGTAGGCGAGGCCCCAGATAGCAATACGTAACCGCA
->a6565705-c7a4-4365-9fd0-3b28c1919cdd
-TTCGCTTCGTTCAGTTACGTATTGCTAGGCAGCTGTTTCGCCCCAGCGATGTAAGCAATCACAGCCAGGCTAACAATAGCGGCTCACCAAGACCGAAAACAGTCTAAGCAGCAGGAAAAGATGGAGAACATGCTGGTCTCCGTCAAAGGGTACTCAGGGGACCTCTCAAGGTCCCTAAAGGAGTACCTGGGGAGTAATGATAGATCAAGACTATCGTTCCAAGGACCACGCGAGCTACATAACCAAGAAGACAGCAGTCACATCCTCTTCGTTGGCGAGGCTTATGCCCAACGTCCAGACTAAGACACCGGCCAAATTGCTGGTGTCAGTAGCAAAGGCTTCGCTGCTATACGCTGCACCAGTCTGGAGCAATGCCTTGCAGGGTCTCATACCTGAAAAGGAGCTCGTTCAGTGCTACGGTCCAATGGCCCTCAGGCTCATTAGAGGATTCGGACCATATCCGAAGACGCGGCGCTAGCGCTGGCAGACCTGCCGATTGATCCTGGAGATCAAAGGCTCTCAATATGCGGAGTGGCGCTTCCAGGCAAAGTACAGTGGCTATTAGGTGAATGGCAGAGCAGATGGCAAACGTCGCGACAGGAGGGTGGACCTATCAAACTCATCCCAGAGATGACGAGGACTTTGGGCAGAGTGACACTCTCAAAAGTGTGTAAACTTGGAATTTGTTATTTATTTTCTTGTATATTTTGATATTTTTGAATTTGTTTTTAATTTATAGAGTAAAATAAATGTTGTTTAATTATTTCCTAAAAAATTGCGTTTTAATTAAGCAAATAACCCTTAATTTTGACCGTTAAAATCAAAAAATTCATCTTATTTCACGGTGTGTAAACGGTTCTTGACAAACTGTACTTGTATGAATTTATTTTAATTTCAAGTTAACGGCCGTTTTCTGTTACTTTTATTGTCGCTGTAAGTGATGCCGAGTATAAAAGTGATTCAGATCCGACATCAGAAGTGGGACGCCTACTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTGTGTTTTAGCTGTTCTTTATTTGATCAATTTGAGGAACAGGGAAGGTCCACTCCATTCGAAATTAATTCGTCAATCCTCTTATGATCTACATACAAAGGTTTCTTAGCCTAAGTCGAGGAGCAGCGCTGCCGGCATAGCCTGCAACACCTTAACTATATACGTATCTTATATATATGTATATATATATGTACTGTCGCCGAGCGATGGTGCTGGGAGAGAGTGGTATAGGCACACATATAAGCGATCAGCGCCCAGCCAACGGAGAACTGCTGACCAGGCAATTGTATGTTAGCCTCAAGTGGGGTGCTCGTATTACGTATACACTTATTGCTGGACTGTTTATGTACACATTGCAACAGAGTGCTACAATTATGAATACACATGGGTACAGTGCTTAACCGATATGTGTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTGAGTCGCAGAATCGCCATTTTTCTGAACTGTTAAAAGTGCAAAACTCACAAAGACCAAAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCTGAACGCACAGGCGAGCCTCAATCCTGGATGCGGAGACCAAGTCTACATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCAGGAAATCTCGAAACCATAGAGTTGTGTGTCGGCCGGTGTGTGCGGCAAACTGGCAAAATCACGGTGGAGTCGCGCCATAGTTCTGCGCTGCAATCACGCGAGTTAATTGTGCGCCTGTTTCATGTAAATGGGTAATTTATTATCTTTGCGATTGTTGCAACTGGATAAACAACTGATAGCGCAGCGGGCGATCTGGAGAGGGAGGCGTTGCCAGATCAGCCATTGATCAGTGTTGTGTTGCGACAGTAGGGCACTTATTCAAAATTAAATTTAAAATTAAGCCGTTGAAATTTAATTTGGTGAACCACTGATTCTGGTAACTGGGAGCGCACAGAGTCTTTAAGAAAGGGGAAAAGGCACAAAGGTCGCGGACAGACCAAATATCATCCTCTCACCGTGCTGGTGCCTAAGCAGAAGGCTCTGGTGTTGTCCGAGTCAAGCGGTACAAACCTCCATCCGTAAAAGCCGAAATCCGTGGCCTACGTGACCTAAGGTAACCTTAGGCCATCCCTTCCGGATGATGGACAGCGCAGTGGGGGCGGTCCCCACAGTCATAACGACCCGTTCAGGAGGAGCTCCCGACTTTCGAGATCCCCACCAGAGGTCAACCCGACCATGGTGACGGAATCTCGGTCCCGTCGATCAGTGGCAAGGGGTGAGCACGCAGGCCCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGAGGTGGAGAATTGGCTCTACAGCATCTACGACCGCGACAAGTCAGAGAAGACGATGGACCACATCGCCGTGCCATCGCAAAAGTGGAGGAAGTCCCCAGCTGTGGTTCCCCTCATCCGGTCTTCCGGACTTGACCACTGCTCTCAAGAACGAGGACCTGGGGGGCATACTTACCAGGATGAATGGCAAGATCAGCCCCTTCTATCCGCATTCGAGACCCAACGGCACACGCGAGAGACAAAGGGCATAGCTTCCGAACTCTCAGCCCTTAACAACAGGGCGATAGAGCTGTACGAAGGTACTACTAGCGAGCACCGCTTGAAGAGCAGCGCTACCCAGACGGAGGTACAAAAGCCTACCAAAAAGGCTCACAAAATGCGCAGGTACCCACGGTGCAGGTGCAAAGTCAGGCGCCGAAGCAGAGCAACCCACCGTTGGATGGCAGCGGTGAAGAAAAGGCGACATCCATACCTAACGAGTCCAAGCCAGGCAGCTATGCATCTGTCGCCAAGAATGCTAGCACGGGTGCAGAGGCGCTCATCGTAAAGACAGGAGGAGGAAGCTACGTACGCAAGAGATGCTTCGGAAGCTAAAGATCGGAATCGAGCCTTAGCGAACTGGGCAGTCCGTGCGAAAAAATCGAGAACGCAGAAAGGTGATCTGTTGCTTGAGGTAGAGCTTCGGAAAGCGTTCCCAAGTTTAAAGAAGCGACCTGGAAGCGGCGCTCAATGACTTGGCCTCTGTGTGCGCACAGGGCCTGGGAATAGCTCTATCTTGCAGCCCGGATTGGACGAGGCTACGACAGCAGAGAAGCTCCACGGCTGCCCAGTCGCCCAATTCCAGGGCCTGCAGATAAATCCTGAAGATATCAGGGGCCTTCGCGGTATGCGGAATTGCAAACAAATAGCCTCAGTGCTGCTGAACGCGAACGTTGCGATACCAGTCCTTAAACAGGGCACCATAATCGTTGGATGGTCAAGATGTCGTATCACCCAGGACGTCCGACCCACGAGATGCTACAGGTGTCTCGGCTATGGGCATCGATCAGCAACCTGCAAAAGGACACTGACAGGGCAGACTGCTGTCTTAGATGCGGTGACGTGGGCACAAGGCAAAGGGGTGCGTTGCTGCGCAAAATGCCTGATCTGCAGCAGCGAGGGTGGACGAAACCACCGACGGGTAGCTGCGTGCCGACTTTACAAACGACACTAAAAGATGCAGAGCCACCTTGTAATGCACGCTCATATTATTAGCGTAGTACAGCTCAATGTCAATCATTGCGCAGCAGCTCAAACCTCCTGGCCCAGACTGCGGTTGAGCGCAATGTAGGCAGCATCATGCTCCTAAGCCGAACCCACCGTCTCTGGTAGTGGACAATCGTCCATGATCCTTGACGAGGCAGGTAAACGGCTATCCGTCTGCAGCTCTCTCAAGTCCAGGAACTGGCTGCTTTACCCATGCGGGGTATCGCTTATGCGAAGTTAAAACACGTGCACATGGCACAGCTGCTACGCTCCGCCGAGCGACACCCCGATCAGTTCGAGGAGCTTCTGGAGGCGCTCGTGGACCATGCGAGGCGAAGCCCGAAGGTCATTACCGGCGACTTTAATGCCTGGACAGTGGAATGGGGCAGCAGGACATCAACACCAGAGGACGAGCGCGATTGACGCCATGCGAATACTGGACCTCCTTACTGCTGAACGATGGACGGAAGCCGACGTTTAACAACGATGAGGGGTACGTCCTTTGTGTGATTACCTTTGTCAGCAGGGCTAGTAGACAACAACAACTGGATGGTCCGCTGACGTCATGACGCTGAAGCGACCATGCCCTGATCTCCTTCTCCCGGAGGTGTATGCCCAAAGACGGCAGAGTAGAACAGCCGGGGAAAACATGGGACACCAGGAATCGATGAGGCCATGCTGGCCTATCAGATCCATTCCCGCAAATCCCAAATGTGGACGCAGAGGTATGGCGGCAGGCCTCATGAATATGCTGGGAAGAATCTGCGACGCAATCATGCCAAGGAAAAAAATAAGGCCTGGCCTGGAAACCACCCGTTTACTGGTGGAGTGCCTCCCTAAACCAACTACGGTCACAGTTGCCTCAGGGCTAGAGAACGGCGCAACAGGCAGAGCGAGTACCACCACGCGGAACTCTTGGGGCTTTCAGAAGCAAACGCCTGGGGTTCAAGCACGGCGCGGCTGCCAAGCGCGGTCGTTTAAGGAGCTGCAGGATGGCGTAGACAGCGGCGATATCTGGGGCCTCGCCTGGCTTGTTACCAACGACTGGGAGGAGAAACGGCAACCCATCCGACCCGGGGTCTGGCTAACATACTGGGGGAGCTGTTTCCAAAGAAGCAGACCACTATGGAGGCCAACAGAGGCAGCCCCCTGCCCAGATTTGCCGTGCGTCACCAGAACTTGAAGTCGATCGAGGCAGCTGTTTCGCTGACGATGTGGCAATCACAGCCGGGCTATAATAGCAGCTCACAAGATATTAAACAGTCCTACTAAGCAGCAGGAAAAAAGATGGAGGCATGCTGGTCTCCGTTCCGGGGAGTACTCAGGGGACCTCTCAAAGTCCCTAAAGTACCTGGGGGTAATGATAGATCGCAGACTATCGTTCAAGGACCACGCAGGCTACGCCAGCAGAAGACAGCAGTCACATCCTCTTCGTTGGCGAGGTGGGCTTATGCCCAACGTCGGAGGCCCAAGACGCGGCCGGGAAACTGCTGGTGTCGGTAGCAAAGAGCTTCGCTGCTATACGCTGCACCAGTCTGGAGCAATGCCACTTGCAGGGTCTCATACCTGAAGGGCTCGTTCGGTGCTACGGTCAATGGCCCTCAGGCTCATTAGAGGATTCAGGACCATATCCGAAGACGCGGCGCTAGCGCTGGCAGGCCTGCCGGTGATCTGGAGATCAAGGCTCTCAGCACTTATGCAGATGGCGCTTCCGAGGCCAAAGGCACACGAGTGGCACAATGGAGTGAATGGCAGAGCAGATGGCAAACGTCGCGACGGGGGAGGTGGACCTATCAGCTCATCGAGATGACGGTTTGGAGCTAGTGACACTCTCAAAAGTGTAAACTTGGAATTTGTTATTTATTTTTCTTGTATGTTGATATTTTGAATTTGTTTTTAATTTATAAGTAAAATATATATTGTTTAATTATATTTCCTTAAAAAATTGCGTTTAATCAAACAAACCGTTAATTTTGACCTTTAAAGTCAAAAAATTCAACTTATTTCACGATTAATAAACAGTTTTCTTGACAAACTGTGCTTGTCGCGAATTTATTTTTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTGTGTCCCGCTTCTTTTCATTTTGCATATTATTAGAACACGCATTCTCTACCTTGCAACGGCGTGGCAAATAACTGTTTCAAAACAAAACCTCCGCTCTCTCTCACATGTAAGCTCACCGGGACTGCCAGTCAAGGTATTTCATCGGTGAGCAGGATGTGGTCTGGTGCACACCATCTTCTTTTGATTGCACAGCAGCGCCTGACCAACTGGGCGTACCAGTCGTAGAGTTCTTGCCCCGCCAACATGCGAGTTACTCCTTATCTATAGTTCAGATTGAGGGTCATCTCGTCCTTACGGACACGCTTCATCATGGTGACGATGATCACGTGAGCCCCGGCCCAACGATTTTGTCCGCCATCATAGCAGCAAAGCCTCTCGGGCTGAAGACTGACCAACGAGCGCCACGAAGTTGCGCCCTCTCCTCGGCGAACCTGGAGCAGTGCAGTAGGATGTGCTCTGCGGTTTCCACTGCGTCTGTGCAATGAGGCGCTGGGCTGTATCCACGTGGCGGAACCTATAGAGTACCCTCGAAAACAGCCATGGTCCGTGAGGGAACTGGGTCATGTGGTAGTCCACCGTTTTGTGCTCGCAATCCAGCCCACTCCGTTAGTTGCGGAATGTGGGTTTGTAAGTCCAGCGTCCCCGTTGTGACTCTTGCCACCTGGTCTGCCGCCTCCTCGAATCCACTCTTTGATCTCTAATTGAGTGTATCCCTCCCTCGCAAGGTATTTACCTTTACATGTCCAGGTCAATGGGTGCTAATGCCTGACAAGAGCGTGCGCTTTGCGTCGTCCGATATGGTTCTAAAGCCTCTGATTGGCCACACAGAGGCCATTGTCCGTGATACTGCGCGGGCACTATCTAGATCATTTTTCTTTGTGGAAAACGCAGCCAGATAGGCGCAGCATAAAGCAGTGTTGCCTTTGAAACCGCCACTAACAGTCTCCTAGCCGGCAGTCTGGGTCCTCCCACGTTGGGCATGATTCTCGCCAAGGCTGCTGCTGTCGTGCCGCTTTTTTTGCTGGCATACCTTGCGTGAGCCTTGAACGGAAACCTTCGGTCTATTAGAACACCAAGGTATTTCAACGTTTCTGCTGAGGCGATTTCCAGCTCCTTTGACTTCCACGCATGCACTCAACGGACTTTCTGCTGTTCCAGCAGGACTACTTCGGTCTTATGCGCAGCTATTTTAAGTCCGACTTTCTCGAAACCATTCTATGGCCGCCGTGATTACCACGTTGCCCATGTCCTGGAGCTCCGGTATTGTCTTGGCGAGCCGCTGTTATCGCAACGTCGTCGGCGAAGCGGTGCAGCTCCACCTCTGGGCTTGCTAATGCTCAGTATTCCATCATACATAATGTTCCACAAGATCGGTCTAAGTACCGACCCTTGAGGAACATATAGAACTTGGTGGCTTCTTGGACCATCTTCTGTTACGTACCGCAACACGGTCCTGAAGTAGTTGCCAATTACGCCTCGTATGTAGTCGGGAACGCCCAAGTTGCGCATAGCCCGAGGATAATGGAGCCATCGCTGTATTGAATGCGTTCTTGACGTCTGGTGATGGCACAGTACCTATTACCCTAACCATCGGTTACCGTCGAGTGCTGCTTTCCTGGCAGCGTCTGTTTGCGGATTTGAGCGTCGAGCGTACTTTTACCCTTTCGGAAGCCATACTGGTGGCCCTGAAGGCCTGTAGGACTTTCGGTGATTAGCTCAATGCGCGCGTACGGTATGCGCTCAAAGAGCTTGCCAACAATGTCCAACAGACACACAACGGTCGGTAACTGCGTGCGGAACATTTGCGGGCTGCCGCGCTTTACCGCA
->81954f91-3ccd-4af8-9bd4-69a43b777235
-GGTGTACTTCGTTCGGTTACGTATTGCTGTGGCTTCCGAAAGGGTAAAAGTACAGCTCGACCTCTCAAAATCCGTAACAGACGCTGCCAGGAAAGCGCTCGACGGTAACCGATGGTTAGGCGGCAGTAGAAGTACTAATGCCATCATCACGCTAGACGTCAAAATTGCATTCAATGGCAAGATGGCCCATTATCCTCGGGGCTATGCACCTTGGGCGTTCCCGACTACATACGAAGGCGTAATTGGCAACTACTTCAGGGACCGTGTTATGGTACGTAACGAAGATGGTCAAGCCACCAAGTCTCTGCAGGCGTTCCCAAAGGTCGGTACTAGGACCGATCTTGTGGAACATTATGTATGATGGAATACTGAGCATTAGCAAGCCCAGAGGTGTGGAGCTGCACTGCTTCGCCGACGACGTTGCGACTTTGGCGGTCATAAGACAATACCGGAGCTCCACAGGACGCAAGTAACGTGGCAATCACGGCGGCCATAGAATGAAACCGAGAAAGTCGGACTTAAAATAGCTGCGCATAGACCGAGAAATAGTCCTGCTGAACAGCAGAAAGTCCGTTGAGTGCATGCGTGGCAGAGTCAAAGGGTTGAAATCGCCTCAGCAGAAACGTTGAAATACCTTGGTGTTCTAATAGACCGAAGGCTCTCGTTCAGAGCTCACGCAAGGTATGCCAGCAAAAGCGGCAATGACAGCAGCAGCCTTGAGAATCATGCCAACGTGGGAGGACCCAGACTGCCGGCTAGGAGACTGTTAGTGGCGGTTTCAAAGGCAACACTGCTTTATGCTGCGCTATCTGGGCTGCGTTTCCACAAAGAAAACCTATCTAGATAGTGCCCGCGCGGTATCACGGACAATAGCTCTCAGGCTAATCAGAGCTTTGAACCATATCGGACGACGCAGCGCACGCTCTGTCAGGCATTACACCCATTGACCTGGACGCGGGGCAAATACCTTGCAGTGAGGATACACTCAATTAGAGATCAAGAATTGGATTCGAGTATGGCAGACCAGGTGGCAAAGTCACAACAGGGGACGCTGGACTTACAAACTCATTCCGCAGCTAACGGAGTGGGCTGATTGCGAGCACAAAACGGTGGACTACCACGCTGACCCAGTTCCTCACGGACCGCTGGCTGTTTTCGAGGGTACCTATGTAGGTTCCGCCACGTGGATACAGCCAGTGCGCTGTGCACAGACGCAGTGGAAACGCAGAGCACATCCACACTGCACTGCTCCAGGTTCGCCGAGGAGAGGCGCAACTCGTGGCGCTCTTTAAGGTCACCTCAGCCGAGGCTTGGTTGCTGCTATGATGGCGGACAAAATCGTTTGGGATGGGGCTCACGTGATCATCGTCACCATGATGGAAGCGTGTCCGTAAGGACGAGATGACCAATCTGAACTATAGATGAGGAGTACCCCGTATGTTGGCGGGGCAAAGAACTCTGACTGGTACGCTCAGTTGGTCGTAAAGAGCGCTGCTGTGCACCGCAAAAGAAGATGGTGTGCAACTTGGCACCACATCCTGCTCACCGATGAAATACCTTGACTGGCAGTCCCGGTGAGCTTGACAAGGACAGGAGAGAGCGGAGGTTTTGTTTTGAAACAGTTATTTGCCACGCTGTTGCAAGGTAGAGAATGCGTGTTCTAATAATATGCAAAATGAAAGAAGTGGACACAAAGCAGAAACGGTCGTTAACTTGAAATTAAAAATAAATCTGCGATAGGTACGGTTGTCAAGAAACTGTTTACACACCGTGAAATAAGTTGAATTTTTTTTGACTTTAAAGGTCAAAATTAACGGTTATTTGCTTGATTAAACGCAATTTTTTTAAGGAAATATAAATTAAACAATATATTTTACTTATATAAATTAAAAACAAATTCAAAATATCAAATATACAAGAAAATAAATAACAAATTCCAAGTTTACACACTTTTTTGAGAGTGTCCTCTGCCAAACCGTCATCTCTGGGATGAGCTGATGGATCCACCTCCCCGTCGCGACGTTTGCCATCTGCTCTGCCATTCACCTAATAGCCACTCGTGTGCCTCTTGCCTGGAAGCGCCACTCCGCATAAGGCTGAGGCATGATCTCCAGATCAATCGGCGAGCCTGCCAGCGTAGCGCCGCGTCTTCGGATGGTCCTGGATCCTCTAATGAGCCTGAGGGCCGTTGACCGTAGCACCAGACGAGCTCCTTTCGGGTATGAGACCTGCAAGTGGCATTGCTCGAACTGGTGCGGCGTATAGCAGCGAAGCCTTTGCTGCTGGCACCAGCGGTTTCTGTGTCTTGGGCCTCGACGTTGGGCATAAGCCTCGCCAACGAAGAGGGATGTGACTGCTGTCTTCTTTGCTGGCGTAGCTCGCGTGGTCCTTGAACGATAGTCTGCGATCCATCATTACCCCAGGTACTTTAGGGACTCTTGAGAGGTCCCCTGAGTACCCTTGACGGAACCAACATGTTCTCCATCTTTCTGCTGCTTAGTAGGACTGCTTCGGTCTTGTAGGCCGCTATTGCTAGCCCGGCTGTGATTGCCACATCGTGGCAGAAACAGCTGCCTCGACGACTTCAAGTTCTGTGACGCACGGCAAATCTGGGGCAGGGCTGCCTCTGTTGGCCTCCATAGTGTGGTCTGCTTTGGAAATAGCTCCCCTAGTATGTTAGCCAGGACCCCGGGTCGGATGGGTTGCCGCTCTCCTCCTTAGCTCGTTGGTATTGTAACAAGCTTGTAGGCGAGGCCCCAGATATCGCTGTCTACGCCATCCTGCAGCTCCTTAAACGGCCGCGCTTTGGCAGCCGCGATGCCGTGCTTGAACTCTGAGCGTTTGCTTCTGAAAGCCTCCAAGAGTTCCGCGTGGTGAGTGCCTCTGGCTCGTTGCGCCGTTCTCCAGCCCTGAGGCAATCCAGACCGTAGTTGGCTTGGGAGGCACTCCACCAGCGGGTGGTTTTGCTGTGCCTTATTTTTCCTTGGCATGATTGCGTCGCAGATTCTTTAGCATATTCATGGGGCCTGCCGCCATACTCTCTGCGTCCACATTTGGGATTTCAGGGGTGGAGTCTGATAGGCCAGCGGCCTCATCGATCTTCCTGGTGTCCCATGTTTTCCAGCTGTTCTGCTCGCACCGTCTTTGGGCATGCCCTCGGGGAGAAGGAGATCAGGGCATGGTCGCTCAGCGTCATGACGTCATGGACCATCAGTTGTTGTTGTCTACTAGCCTCTGCCCGACAAAGGTAACGTCAATAAAGGACGTACCTATCGTTGTTAAACGTCGGCTTCGTCCATCGTTCAGCAGTATGAGGTCCAGCATTCGCATGGCGTCAATCACAGCTCGTCCTCTGGTGTTGGATGTCTGCTGCCCCATTCCACTGTCCAGGCATTAAAGTCGCCGGCAATGACCTTCGGGCTTCGCCCTCTCGCATAGTCCACGAGCGCCTCCAGAAGCTCCTCGAACTGATCAGGTGTCGCTCGGCGGAGCGTAGCAACTGTACATGTGCGTGCGCTTCGCATAAAGCATTACCCCGCATGGGTAAAGCAGCCAGTTCCTGGACTTGAGAGAGCTGCAGCATTTGATAGCTGCTTTACCTGCCTCGTCAGGATCATGGACGATTGTCCACTACCAGAGACGTAGGGTTCGCTTGAGGAGCATGGTATCTACATTGCGCTCAACCGCAGTCTGGGCAGGAGGCTGAGCTGCTGCGCAATGATTGACGATGGCTGTACTACGCTAATATGAGCGTTACGTGGGTGGCTCTTGGCATCTTTTGAGTGTCGCTCTGTAAGTCGGGCACGCAAAGCTACCCGTCGAATTGGTTTCTGTCCACCTCGCTGCAGATCAGGCATTTTGGTGCAGCAACGCGCTTTACCTTGTGCCCACGCTCACCGCATCTAAGACAGCAGTCTGCCCTGTCAGTGCTTGCGGGTTGCTGATCGATGCCCATAGCCGAGACACCTGTAGCATCTCGTGGGTCGGACGTCCTGGAGTGATACGACATCTTGACCATCCAACGATTATGGTTGCCCTGTTTAAGGACTGGTATCGCAACGTTCGCGTTCAGCAGCACTGAAGCTGTTGCTGCAATTCCATGCAGAAGGCCCTGATATCTTCCAGGATTTATCGCAGGCCCTGGGTGGGCGACGGCAGCTGTGGGCTTCTCTGTCGTATCGTCAATCCGCTGCAAGATAGAGCTATTCTTTGCGCTCCTGTGCGCCACAGAGGCCAAGTCATTGACGCCGCTTCCAGGTCGCTCTTAAACTTGGAACGCTTTCGAAGCTTTCCCCTCTACCTCAAGCAACAGATCACCTTTCTGCGTTCTCCGGATTTTCGCACGTGACGCCCAGTTCGCTAGGCTGAATTCGATCTTGGCTTTGAAGCATCTCTGCGTGCGAAGCCTCTCTGTCTTTTTTTACGATGAGTGCCTCTGCACCCGTGCTAGCATTCTTGGCGACAGATGCGCCAGCTGCCTGGCGGACTCGTTAGGTATGGATGTCGCCTTTTCTTCACCGTTGCCATCAACGTAGGGTTGCTCTGCTTCGGCGCCTGGACTTTGGCACCTGCACCGTGGAGTACCTGCGCATTTTTTGTGGAGCCTTTTGGTAGGCTTTTGTGCCTCCGTCTGGGTAGCGCTGCTCTTCAAGCGGTGCTCGCTAGTAATTACCTTCGATACCCAGCTCTATCGCCCTGTTGTTGGGGCTGCGAGTTCGGAAACTATGCCTTTGTCTCTCATGTGTCGTTGGGTCTCGAATGCTGCGGATAGAAGGGGGCTGATCTTGCCATTTATTCATCCTGGTAAATGCCTCAGGTCCTATCGTTCTGGAGAGCAGTGGTCAGAATCCGAAGACCGATGGGGGGGGGAACCAGCTGGGGACTTCCCTCCCGTCTTTTGCGATGGCACGGCGATGTGGTCATCGTCTTCTGACATCGCGGTCGTAGATGCTGTAGGAGCCAATTTCTCCACCTCTACAGCATCGCTGCGATCGATAGTCAACGGCGGCTGGGGGGCCTGCGTGCTCACCTTGCCACCGACGGGACCGATTCCCGTCACCATGGTCGGGTTACCGACTCCTCTGGTGGGGATCTCGAGTCAGGAACTCCTCCTGAACAGGTCGTTGCGTCAGGGGACTGCTACTGCTTTGTCCATCAACTGAAGGATGGCTAAGGTTACCTAGGTCACGTAGGCCACGGATTTCCCCTGGCTTTTACGGATGGAGTTTGTACCGCCTCGACTCGGACACCAGAGCCTCTTGAAGCACCAGCACGGTGAAGGATGATATTTGGTCTGTCCGCGACCTTTGTGCCTTTCCCTTTCTTAAAGACTTGTGCTCCAGTTACCAGAATCAAAATTAAATTAAATTAAATTTCAACGGCTTAATTTTAAATTTAATTTTTTGAATTTCGCGCCCTGTCGCAACACAACACTGATCCACACGGTTGATCTGGCAACGCCTCCTCTCCAGATCGCCCGCTGCGCTATCAGCTGTTTATCACTGCAGCAATCGCAAGATAATAAATTACCTATTTACATGAAACAGGCGCACGATTAACTCGCGTGATTGCAGCGCAGAGACTATGGCGCGACTCCACCGTGTGATTTTGCCAGTTTGCCGCACACCGGCCGACACCTTCTATGGTTTCGAGTATTTCGCGCCGCGTAATTTAAAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCCGCACCGGGATTAGTGTCTAAGCCTGTGGGTTGAGTTAAACTTTGGCAATACGACGGCATTGAGTTTTGGGTCTCTTTGTGAGGTTTTGCACTTCTTTTAACGGTTCAGAGAAAAATGGCGATTCTGCGACTCTGGGAATTGTCAGCAAATTGATTTCACTATTGTAGTATGCACACATATCCGGTTAAGCACTGTACCTGTATTGTATTCATAGGTAGCCAGCACTCTGTTGCAATGTGTACATAAACAGTCAGCACAAGTGTATACGTAATACGAGCACCCACTTGGGGCTAACATACATAATTGCCTGGTCAGCGGTTCTCCCGCTGGCCAAGCGTAATCATATATGTGTGCCTATACCACTCCTCCTCCAGCACCATCGCTCGGCGACGAGTACATATATATATACATATATATAAGATACGCATATAAGCGTTAACTTGCGCTGCAGGCTATGCCGGCAGCGCTGCTCGACTTAGGCTAGAAACCTTTGTGTGTGAATCATAAGAGGATTGACGAATTAATTTCGAATGGGCAGGACCTTCCCTGTTCCTCAAATTGGATCAATGAGAGCAGCTAAAGAAACACGATGATGCGGCCTGAAAATGGAAACTACAGGAAGTTGGAGTAGGCGGTCCCACTTCTGATGTCGGATCTGAATCACTTTATACTCGGCATCACTCTCTACAGCGGACACAAAGTAACGAAAACGGTCGTTAACTTGAAATTAAAAATAAATCTGCAACCAGTACAGTTTGTCAAGAAACTGTTTACACACCGTGAAATAAGATGAATTTTGATTTTAACGGTCAAAATTAAGGGTTATTTGCTTAATTAAACGCAATTTTTTTTTAGGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAACAAATTCAAGATATCAAATATACAAGAAAATAAATAACAAATTCCAAGTTTACACACTTTTGAGAGTGTCACTCTGCTAAACCGTCATCTCTGGGATAGGCTGATAGGTCCACCTCCCCCCCGTCGCGACGTTTGCCATCTGCTCTGCCATTCACCTAATAGCCACTCGATGTGCCTCTTGCCTGGAAGCGCCACTCCGCATAAGGCTGAGAGCCTTGATCTCCAGATCAATCGGCAGGCCTGCCAGCGCTAGCGCCGCGTCTTCGGATATGGTCCTGAATCCTCTAATGAGCCTGAGGGCCATTGACCGTAGCACCAGACGAGCTCCCTTTCAGGTATGAGACCCTGCAAAGTGGCATTGCTCCAGACTGGTGCAGCGTATAGCAGCAAGCCTTTGCTACTGACACAGCAGTTTCCTGGCCGGGTGTCTTGGGCCTCCGACGTTGGGCATAATACTCGCCAACGAAGAGGATGTGACTGTCTTCTTGCTGGCGTAGCTCGCGTGGTCCTTGAACGATAGTCTGCGATCTATCATTACCCCAGGTACTTTAGGGACTCTTGAGAGGTCCCCTGAGTACCTTGACGGAAACCAGCATGTTCTCCATCTTTTTTCCTGCTGCTTAGTAGGACTGCTTCGGTCTTGTGAGCCGCTATTTGCTAGCCCGGCTGTGATTGCCACATCGTCAGCGAAACAGCTGCCTCGACGACTTCAAGTTCTGGCGACGCACGGAAATCTGGGGCAGGGCTGCCTCTGTTGGCCTCCATGGTGTGGTCTGCTTTGGAAATAGCTCCCCTGAGTATGTTAGCCAGGACCCCGGGTCGAGGATGGGGTTGCGCTCTCCTCCTTAGCTCGTTGGTGTTAACAAGCAGGCGAGGCCCCGAATATCGCTGTCTACGCCATCTGCAGCTCGTAAACGACCGCGCTTTTGGCAACCGCGATGCCGTGCTTGAACCTCTGAGCGTTTGCTTCTGAAAGCCTCCAGAGTTCCGCGTGGTGGAGTTACTGCCTCTGGCTCGTTGCCGTTCTCTTCCAGCCCCTGAGGCAATCCAGACCGTAGTTGGCTTGGGGAGGCACTCCACCAGTAAACGAATTGGTTTGCGCTGTGCATATTTTTCCTTGGCATGATTGCGTCATAGATTCTTCCCAGCATATTCATGAGGCCTGCCGCCATACTCTCTGCGTCCACATTTGGGATTTCAGAATTGATCTGATAGGCCAGCATGGCCTCATCGATCTTCCTGGTGTCCATGTTTTCCCGGCTGTTCTACTCTGCCGTCTTTTGGGCATGCCCTCCGGGGAGAAAGGAGATCAGGGCATGGTCAGCTCAGCGTCATGACGTCATGGACCATCCAGTTGTTGTTGTCTACTAGCCCTCCTGCTGACAAAGGTAACGTCAATAAAGGACGTACCCTATCGTTGTTAAACGTCGGCTTCCGTCCATCGTTCAGCAGTGAGGTCCGGCATTCGCATGGCGTCAATCACAGCTCGTCTGGTGTTGGATATCCTGCTGCCCCATTCCACTGTCAGGCATTAAAGTCGCCCAAACGTGACCGAAGACTTCGCCCTCTCGCATAGTCCACGAGCGCCTCCAGAAGCTCCTCGAACTGATCGGTGTCTCGGCGGAGCGTAGCAGCTGTACATGTGCACGTGTTTTAACTTCCATAAGCGATACCCGCATGGAGTAAAGCAGCCAGTTCACGCGGACTTTGGAGAGAGCTGCAGCATTTGATAGCTGCTTTACCTGCCTCGTCGGGATCATGGACGATTGTCCACTACCAGAGACGTAGGGTTCGCTTAGGAGCATGATGTCTACATTGCGCTCAACCGCAGTCTGGGCCAGGAGGCTCTGAGCTGCTGCGCAATGATTGACATTGAGCTGTACTACGCTAATATGAGCGTGCATTAAGGTGGCTCTTGGCATCTTTTAGTGTCGCTCTGTAAGTCGAGCACACTGCGGCTACCCGTCCGGGTGGTTTACCATCCCCACCTCGCTGCACCGCAGATCCAGGCATTTTGGTGCAACAGCACTTGCGCGTGCCCACGCTCACCGCATCTGAACAGCAGTCTGCCCTGTCAGTGTCCTTGCAGGTTGCTGATCGATGCCCATAGCCGAAGACACCTGTAGCATCGTGGGTCGGACGT
->3328f98c-6f8c-4bad-a998-22e81b0f64d0
-TTGACGCTGGATTCGTTACTGCGGCTTGCCAAAGCGCGGTCGTTTAAGAGCTGCAGGATGGCATGACAGCGGCCTCGGGGCCTCGCCACAAACGCGAGCTAAGGAGGAGCAGCAGCTAATCGACCAGCGGGGTCTGACTGGCATACTGGGGAGCTATTTCCAAAGCAGACCACACTATGGAGGCCAACAGGGCAGCCTGCCCAATTTCCCGTGCGTCACCCAGAACTTGATAGTGGGGGGGCAATTTTAACGACGATGGCAATCTCAGCCGGGCTAGCAATGGCGGCTCTCACAAGACCAGAAACAGTCCTACTAAGCAGCAGGAAAAGATGTCGGAGAAGTACATGCTGAATTCCGTCAGGGCGCTGCGGGGCCTCTCGAGGTCTGAAAGAGCACCTGGGGTCAATGACCAGATCGCACCGAAGACTATCGTTCAGGACCACGCGAGCTGCCGGCGAAGACACAGCGATAAAATACCTTGTTTGGCGAACGCTTAACGTCAATTTCAGAGACACCCGGCCAGGAAACTGCGCGCAGATGGCTCGGTAGCGAAACTTCGCTGCTATGCACCTGCACCAGTCTGAACCGTACTTCGCACCACGAGTCATAATACCTGAAAGAATGAATTTCGTGCACGGTCGGCAGCCCTCAGGCTCATTAGAGGATTCAGGATACCTGTATCCGAGACGCGGCCCCAGCGCTGGCGAATGATCTGAGGATCAAGGCTCTCAGCCTTATGCGGTGGCGCTTCCAGGCGAAAGAGCACAGTGGCTAATGAATTACGAATATGGCAGAGCGGATGCTGAATACGCGACGGGGAGGTGGACTATAAACCATCCCAAGAGATGACGGTTTGGGCAAGGTGACATACAAGAAGTGTGTAAACTTGGAATTTGTTATTTATTTTCTTGTATATTTGATATTTTGGTTGTTTTAATTTATAAGGCCAGAAATATGAAATATTTTGGTATTTCCTAAAAAAATTGCGGTTTAATTAAACCGTAACCCTTAATTTTGACCGTTAAAATCAAGAGGCTAATACTGCGGGTACAAGTTTCTGGAACTTGACGACAACGTTGGCGCGATTTCAGAGTTAACGCGACCGTTTCTGTTACTTTATTGTCCGCTGTAGAGAGTGATGCCGGTATAAAGTGATTCAGATCCGACATCAGAAGTGGGACCGCTACTCCGGCGCTACCATAGTTTCGTTACGTCATCCATAGATCGACATTGTTTAGCTTCTTTCTTTATTTAAGTCAATTTGAAGGGAACGAGGAAGGTCCCTTCGACGTAGAATCCATTCGTCGATACCCTCCTTGCCAGATCACGAACAGCTTCAAGTCGAGAACGGCGCTGCGGCATAATACTGGCAACAACATATGCGTATCTTATATATATGTATATATATATATGTACTGTCACCGAGCGATGATTGCGCTGGAGGAGGAGTGACGCAGGCACATATAAGCGATCAGCGCTTGGCCGTGAGTTGCTGACCAGGCAATTATGTATTACGCCCTCAAGTGGGTGCTCTCATATTGCATGCCACTTTGTGCTGAATGTTTAGCTGCCACGTGCAGCGGTACCATTGCTGCGGTATACACATAGGGTACAGTCACTTAACCGATATGGCTGCAAATGGTAATGGTAGAGCATTCTGAGTCGCAAAGATCGCCATTTTTCTGAACTGTTAAAAAATTGCAAAACTGCGAAGGGCTAAAAAAATAATGCTGTCGTATTGCAAGTTTAATCCTGAACGCACAGGCTTGAGCCTCAATCCTGGTGCGGAATAAAGTCTACATGCCCGTGAGGCGGAGACGTATAGAATGCGCGGCGCGAAATATCAGAAACCATAGAAGTTGTGTCCTGACCCGGTGTGCGGCAAACTGGCAAAATCCGCAGGTGGGTATACGCCGTTTATATGCTACCGTCGCGCGAGTTAATTGTGCGCCTGTTTACCGTACTAAAACGGGTAAATTTATTATCTTTGCGGTGTTTGCAGCGGATAAGCAATGATGGCCTGCGGCGGGCGTCGGGGAGGAAGGCGTTGCCAGATCAACCGTAACGATCGGTATTTGCGAGCTGAATGGGCCTGAAAGTCAAATTAAATTTAAAATTAAGCCGTTGAAATTTAATTTAATTTAATTTTGATTCTGACGGCTTTGGGCGCACGAAGGTGCCACCTGAGATATCGCGGACGGACAAATATCATCCTCTCACCGTGCTGGTGCCTAAACGCAGAGCTCTGGTGTCCAGAGTCGAAGAAGGCGGTACCAAACCTTCATCACCGTAAAGAAAGCCGGAAATCCGTGACTGCGTTCTGGGCAACATGGTGCATCTTCAGTTGATGGACAGCGCGGTGGGGAGCAGTCCCGATGCGACTGCCGTTCGGGAGCTCCCGGCTTTCGAGGATCTTTACCAGAGGAGTCGGTAACCCGACCCGCTGACAGGATAAGTTCCGTCGGTAACAGGGGTGAGCACACGCAGGCCCCCCAGCCGCCGTTGATATCGACTTGCAGCGATGCTGTAGAGGTGGAAAGTGAAACCTACAGCATCTACGACCGCGATCGATGGACCACATCGCCGTACATATTTTAAAGACGGGAGGAAGTCTGGCGGTTTCCCTCATCGGTCAGGACTTACGTGACGCCCTGCTCTCCAGAACGAAAGGACCTGAGGGCATACTTACCGGGATGAATGGCAAGATCAGCCCCTTCTATCGCATTCGAGACAACGACACACATGAAATGAGGGCGCGGCACGATTTCTGAAGCCCTTAACAACGGGGCGATAGAGCTGCGAAATTACTACTAGCGACACCGCGAAGAACAGCGCTACAGACGAATTACAAAGCCTGCAAAGAACCACTAGTACGCAGGTACCCACGGTGCAGATTGCCAAAGAATCGGAGCGCCGAAACCGGGCTGACCACGTTGGATGGCAGCGGTGAAGAAAAGGCGACATCAACGAAGAGTCCGGAAGCGGCAGCTGCGCTCATCGCCAGAATGCTAACACGGGTGAAACTAATGGCAAAGAACGGGAGAACTTTAGTACGCAGAGATGCTTCGGAAGCTAAGATCGAATCGAGCGCCGGCGAACTTTGGGCAGTCACGTGCGAAAAAATCCGGAGAGGAAACGCAGAAAGGTGATCTGTTCGCGGGGTGGGGAAAGCTTCGGAAAGCGTTCTAAGTTTAAGGAAACGACCTGGAAGCGGCGCTCAATGACAACCTCTGTGCGCACAGGCGCAAGAATAGCTCTATCTTGCAGCGAGGATTGGACGAAGGCTACGACGGCAGAGAAGCTCCACAGCTAGCGGTCGCCCAATTCAGGGCCTGCAGATAAATCCTGAAGATATCCAGGAACACTTGCAGTATGCCGGAATTACAAACAAACGCTCTGTTGCTGCTGAACGCGGTAGTTGCGATACCAGTCCATAAACAGGGCACATAATCGTTGGATGGTCAAGATGTCGTATCACCCGGGACGTCAGCCACGAGATGCTACGAATTGTCTCGGCTATGGGCATCGATCAGCAACCTGCAAAGGACTTGCTAACAGAACCGAAGACGCTGCTGTCTTTGAGCCGGTGGTAGAGCACAAGGCAAAGAGGTGCGTTACTGCACCAAAATGCCTGATCTGCAGCAGCCGAGGTGGACGAAACCACCCGACGGGTAGCTTTGCGTGCCGACTTGCAGAACGACACTAAGATGCCAAGAGCCCTTAATGTGCACGCGCTCATATTATTAGCGTAGTACAGCTCAATGTCAATCGTGCGCAGCAGCTCAGAGCCTCCTGGCCCAGACTGCGGTTGACTGTGCCGAACATCATGCTCTAAACCGAACCCTACGTCTCTGGTAATCGTCCATGATCCTTGACGAACTTAGGTAAAGCAGCTATCAAATGCTGCAGCTCTCTCAAGTCAAGACAGCAACACCCATGCGGGGTATGGCATGCGAGGAATTTAAAACACGTGCACATGTGCGGCTGCTACGCTCCGCCGAGCGACACCCCGATCAGTTCGAGAACTTCTGGAGGCGCTCGTGGACCATGCGAGAGGCGGGCTTAGTCGATACCGGCGACTTTAATGCCTGGACAGTGGAATGGGGCGGCAGGACATCCGCACCCAGAGACAGGCGAGCTGTGATTGACGCCGTGCGATATTTCCGGACCTCATACTGCTGAACGACGATGGACGGAAACAGGCGTTTAACAACGATAGAGAGGTACGTCCTTTATTGACGTTACCTTGTCAGCAGAGGGCTGTGGGCAACAACAACTGGATGGTCCGCGGCGTCGCCCGGCTGAAGCGACGTCAATCCTGCGCTGCTCCCGGAGGGCAATGCCCAAAAAAAGACGGCAGAGTAGAACAGCCGGGAAAGCGCTGGACACCAGGAAGATCGATGAGCCATGCTGGCCTATCAGATCAATCCCAAATGTCGGACGCAGAGAGTATGGCGGACGAGCCTCATGAATATGCTGGGAAGAATCTGCGACGCAATCATGCCAGGAAAAAAAATAAAGCGCAGCGCAAACCGCGGTACGTTTTGGTGAGTGCCTCCAACTACGATACATTTTCGGGGCTAAGAACGGCGCAACGAGCCAGAGGCAGTACCACCGCGGAACTCTTGGAGGCTTTCAGAAACCGAAGCACAGGGGTTGCGTTCGGCGCATGCGGCTGCAAAGCGCGGTCGTTTGGAGCTGCAGGATGGCGTAGCAGCGATATCTGGGCCTCGCCACTACAAGCTTGTTACCAACGAGCTAAGGAGGGAAGCGACGGCTTATCGACCCGGGGTCTGGCTAACATACTAGGGGCTATTTCCAAAACGAACCACTACTGGAGGCCAACGGAGGCAGCCCTGCCCCAGATTTACCCGTGCGTCACGGGCAGAATCGTCGAGGGCGGCTGTTCGCTGACGATGTGGCAATCACAGCCGGGCTAGCAATAGCGGCTCACAAGACCGAAGCAGTCTACTAAGCGGCAGGAAAAGATGGAGAACATGCTGGTCACTGCAAATCGAAGGGTACTCAGGAGGACCTCTCAAGAGTCCTAAAGTACCTGGGGGGTAATGATAGATCGCAGACTATCGTTCAAGGACAATACGCGAGCTACGCCAACAGAAGACAGCAGTCACATCCTCTTCGTTGGCGAGGGCTTAGCGTATCGGGAGGCCGGTACTTTACGGCAAACTGCTGGTGGTGGCGAAAACCTATAGCTGCTATACGCTGCCAGTCTGGAGCGCAGCAATGCTGCTTGCAGGGGTCATACCTGAAAGGAGCTCGTTCGTTAGCTGCGGTCAATGGCCCTCGGGCTCATTAGAGTTCAGGACCATATCGAGGCGCTAACTGGCAGGCCTACCGGTCAGATCACCGGAGATCTGCGACTCTCAGCCTTATGCGGAGTGGCACAGGCAAGAGGCACACGAGTGGCTCAATGGGTGAATGGCAGAGCAGATGGCAAACGCGTCGCGACGGGGAGGTGGACCTATCATTTCCATCCCAAGAGATGATGACGGTTTTGGGCAGAGTGGCCGCTCTCAAAGGGTGTGGCAAACTTGAATTTGTTATTTGTACTATGCGCCGCCGACGATATTTTGTTTGTTTTTAATTTGCCAGGCAAAGGCCTGCTGTTGTTTAATTATATTTCCTTAAAAAATTGCGTTTAATCAAACCAGTAGCAGTGTTTTTGACCTTTAAAATTAAATTGGCACCCATGCTTCACGGTGTGTAAACAGTTTCAGCGAACGAGCGCGCATCGCAGATTTTAATTTCAAGTTAACGACTTGTTTTGTGCTGGCAGCTACGCTTCCTTTCATTTTGCATATTATTATGAACACGCATTCTCTACCTTACGCAACAGCGTGGCAAATAACTGTTCAAACAAAAACCTTACTCGCTCTCTCTCCTGTCATTGTCAGAAGCTCACCGGGACTGCCAGTCAAGGTATTTCATCGATGGAAACACGGGTCGGGCTACTTTTATCTTCTGCTGCGGTGCTAGCCAGCGCCTTTTGTTTCAATAACTGAGCGTACCGTTAATGGAACCGCCAACATGCGGGGTACTCCTTATCTATAGTTCAGATTGGTCATCGTCCTTACGGACACGCTTCATCATGGTAGCGTGATGCGTGAGCTACATCAAACGATTTTGTCCGCCATCATAGCAGCAGCAAGCCTCTCGGGCTGGTGACCAGCGAGCGCCACGGTTGCGCCCTCCTCGGCGACTTCTGAACTGGCGAGTGCGGTAGGATATTGCTCTGCGGTTTCCACTGCATCTGTGCAATAAAGGCACTGGGCTGTATCCACGTAGCGGAACCTACATGAGTACCCTCGAAAACAGCCATGGTCCGTGAGGAGCACTGGGTCATGTGATGATCACCGTTTTGTGCTCGCAATCAGCCCACTCCGTTAGTTGCGGAATGAGTTTGTAAGTCCAGCGCGTCCCCGTTGTGACTCTTGCCACCTGGTCTGCCATACCTCCTCGAATCCACTCTTTGATCTCTAATTGAGTGTATCCCTCACTCGCAAGGTATTTGCCCTTCATCCAGGTCAAGCCGGTATGGCCTGGCACGGGCGAGCGTGCGTCCGATATGGTTCGGCTGTTGATTAGCCACAGAGCCATTGTCCGTGATACTGCGCGGAGCACTATCTAGATGGAGTTTTCTTTGTGGAAACGCAGCTCAGATAGGCGCAGCGCCAGCAGTGTTGCCTTTGAAGCCACTTACTTGCTGATCTCCACAGCCGGCGGTCTGGGTCCTCCGTTGGGCATGATTCTCTCGCCAGGCTGCTGCTGTCATTGCCGCTTTTTTTCGCGCTGCTTGCGTGGAAGGCGAACGGAAGGAGCCTTCGGTCTGTTAAGACTTTTGGTATTTCAACGCGTTCTGCTGAGCGATTTCCATCGCTGACTTCCACACGCATGCACTCAACGGACTTTCTGCTGTTCAACGGGACTACTTCAGTCTTATGCGCAGCTATTTTTAAGTCCGACTTTCTCGAAGCCATTCTATGGCCGCCGTGATTACCACGTTGCCCATATACGGAGCTCCGGTATTGTCTTGGCGACCGCGTATCGCAACGCGTCGTCGGCGAAGCAGTGCAGCTCCACACCTCTCGAACTTGCTAATGCTCAGTATTCCATCATACATAATGTTCCACAAGATCGATTACAGTACCGACCCTTGTGAGAACAAGAACAGCGGTGAAGCTGGACCATCTTCTGTTACGTACCATAACACACGGTCCACTGAAGTGGTTGCCAATTACGCGCCTCTGTGTAGTCTTGGGGAACGCCCAAGTTGCTGCGGGGCAATGGGCCATCTCGCTGTATTGGACTGCTTGACGTCTAGAGCAATGCAGCCAATAGCGGG
->1aff9669-f6d2-4ffd-8f77-4c99cef14421
-TCGTTCCAGTTACACGTATTGCTGCGAACATGGTGCCTAAGCAGAGCTCTGGTGTCCGGTCGAGGCGTTTGACCTCCATCCATGCAAGAAAGCCAGGAAATCCGTGGCCTGGCCTAGGTAACCTTAGGCCATCCTTCAGTTGATGGACAGCGCAGGTGGGGGCAGTCCCCTGATCGCAACGACCCGTTCAGGGAGGAGCTCTCCCGACTTTCGAGATCCCCACCTGGAGAGAGGTCGGTAACCCGGCCCATGGTGACGACGGAATCTCGGTTACGTCGTGAGGGGTGAGCACGCAGGCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGAGGTGGAGAAATTGGCTCCCTACAGCATCTGACCACCGACAAGTCAGAGACGATGGACCCATCGCTGCCATTACCATCGCAAAGACAGGAGGAAGTCCCAGCTTGTTCCCCTCATCGGTCTTCCCGGACTTGACCACTGCTCAGAACGAGGGACCTGGGGGGGCATACTTTACCAGGATGAATGGCAAAGATCAGCCTCTATCATTCCAGAGACCCAACGACACATGAGAGAGACAAAGGGCATGGCACCGAACTCTCAGCCCATAACAACAGGGCGATAGAGCTGTACAGAAGGGCTGCTGGCGACGCGCTTGAAGAGCAGCGCTACAGACGGAGTACAAAAGCCTACCAAAGGCTCCACAAAATGCGCAGGTACCCACGGTGCAGGTTACTTAAAGTCCAGGCGCCGAAGCAGAGCAACCCCTACGTTGGATGGCAGCGGTGAAAAAGGCGACATCCATATAACGAGTCCAAGCCAGGCAGCTGTGCATCTGTCGCCAAGGAATGCTAACGCACGGGTGCAGGGCACTCATCGTAAAAAAAAGACGAAGCAGGAGAGGCTTCGTACGCAGAGATGCTTCGGAAAGCTAAGATCGGAATCGAAGGCCTTAGCGAACTGGGCAGTCACGTGCGAAAAAAAAATCCGGAGAACGCAGAAGGTGATCTGTTTAGCGGTGGGGAGAGAAAGCTTCGGAAAGCGTTCCCCAGAAGTTTAAGAAACGACCTGGAAGCGGCGCTCCAATGACTTGCCAACCTCTATTGCGCACAGGGCAAAGAATAACTCTATCTTGCAGCGGATTGGACGAGGCTACGACAGCAAGAGCTCCACAGCTGCTTGGTCGCCCAATTCCAGGGCCGCAGATAAATCCACAGAAGATATCAGGGGCCTTCGCGGTATGCGGAATTGCAAATAGCAAAATAGCCTCAGTGCTGCAAACGCAGACGGTACGATACAGTCCTTAATGGGGCACCATAATCGTTGGATGGTCAAGATGTCGTATCCGCACCCAGGACGTCCGACCCGAGATGCTACAGGTGTCGGCTATGGGCATCGATCAAGCAACCTGCAAGGACACTGACAGAGGGCAGACTGCTGTCTTAGATGCAATGAGCGTGGGCACAAAGGCAAAGGGGTGCGTTGCTGCACCAAAATGCTCCTGATCTGCAGCAGCGAGGTGGACGAAACCACCGACGAACTTTGCGTGCCCGACTTACAGAGCGACACTAAAAGATGCAAGAGCCACCTTAATGCACGCTCGCATTAGCGTAGTACGAAGCTCAATGTCAATCATTGCACGGCAGCTCTGAAATCCTGGCCCAGACTGCGGTTGAGCGCAATGTAGACATCGTAAGCTTCTAACCCTACGTCTCTGGTAGTGGACAATCATTACTGATCCCTTGACAGCAGGTAAAGCAACTATCAAATGCAGCTCTCTCCAAGTCCAGGAACTGGCTGCTTTACCCATGCGGGGTATCGCTTATGCGAAGTTAAAACACGTGCACATGTACAGCTGCTACGCTCCGCCGAGCAACACCCCAGTTCGAGGGAGCTGGAAGCGCTCTACGGACCGTATGCGAGAGGGCGAAGCCCGAAGGTCGACTTTAATTATACCTGGACAGCAGTGGAATGGGGCAGCAGGACATCCAACACAGAAGGGACGAGAGAAGGCTGTGATTGACGCCATGCGAATGCTGGACCTCACTGCTACAGACGATGGACGGAAACCGACGTTTTAACAACGATAGGGGTACGTCAGCATTGACGTTACCCTGTCCCGGCAGAGGCTAGTGGGCAACAACAACTGGATCCATGACGTCATGACGCTGGAGCGACTGATCTCTCCTTCTCCCCGGAGGGGCATGCCCAAGACGGCAGAGTAGAACAGCCGGGGAAAACATGGGACACCAGGAAGATCGGTAGGCGCGCTGGCCTATCAGATCAATTCCCTGGAAATCCCAAATGTGGACCTGCAAGAGGTATAGCGCCCAGGCCTGGCCGAATATGCTGGGGAAGAAGTCTGCGACGCAATCATGCCAAAGGAAAATACAGGCACAGCGCAAACCCACCCGTTTACTGGTGGAGTGCCTCCCTAAGCCAACTACGGTCCCACAGTTGCCTCTCGGGGCTGAGCAGCGCAGCGAGCCAGAGGCAGTACCACACGCGGAACTCTTGGGCTTTCAGAAGCAAACGCCTAGAAGTTCAAGCACGCTCACGGCTGCAAAGCGCGCAGTCGTTTAGAGCTGCAGGATGGCGTAGACAGCTATCCTGGGGAGGCCTCGCCACAAGCTTGTTACCAACGAGCTACAAGGAGGGAGGAAACAGCAGCCCACATCCGACCCGAAGGGTTACAAGCTGTATACTAGGAGACTATTTCCAAAACGAAGACCACACTGGAGTAGCAGAGGCGGCCCCTGCCCCAGATTTCCCGTGCGTCACAGAACTTGGGGGTCGTCGAGGCAGCTACTGCAGCGGCGGTGGCAGCGATCACAGCCGGGCCCAATAGCGGCTCACAAGACCGAAGCAGTCCCTACTAAGCAGCAGGGGAAAGATGGAGAACATGCTGGTCTCCGTCAAAGGAGATTACTCGGGGACCTCTCAAGAGTCCCCTAAGGGTACCTGGGGATGATCGCAGACTATGGTTCCGGGACAACCACGCGAGCTTCCACGCCAGCAAGACGGCGTTGCGATATAGCTGCGTTTGGGCTTCCCGTAGCAACGATCGGAGGCCAGACACTTGGCCAGAAACTGCTGCTGGTGTCCGGTAGCAAAGAGCTTCGCTGCTGTAGCGCGCTTAGTCATGGGCGGTAGCACTGGGTTAACTCATACCTGAAGACTCGTTCGGTGCTACGGTCAGTGGTACCTCGAATCATTTGTTCTCAGGAGCGGCTTTAGCCGAGGCCTGCCGATTGATCACCGATCCGCTCAACCTTATGCGGAGTGGCAGCACCAGACGAAGGTGGCTATTAGGTGGGAACGGGAGACGACGTCAGAAACATTGGGGGGATGGTGGGCAAAGGTGTGCGTTGTTGCTGGCGGGCAAAACAGTATTGTTTGAATTATATTTCCCTAAAACCCATTTAATTAAGCAAATAACCCTTAATTTTGACCGTTAAAATCAAAAATTCATCTTATTTCACGGTGTGTAAACGGTTCTTGACAAACTGTACTTGTCGCAGATTTTATTTTTTAATTTCAAGTTAACGACCGTTTTCTGTTGCACTTTGTGTCCGCTGTAGAGAGTGATGCCAGTATAAAGTGATTCAGATCGACATCAAGTGGGACCGCCTACTCCAACTTCCTGTGGTTTCATTGTGTCATAAGATCATTTTGTGTTTGGCTGTTTCTTTATTTGATCCAATTTGAGAGACGGGAAGGTCCGCTCCATTCGAAATTAATTCGTCAATCCTCTTATGATCTACGCTTCTTAGCCTAAGTCCGAGAGGGCAGCGCGAAAGCCTACAGCGCAGCAATACTGCTATAACCATAAATATCTTATATATATGTATATATATATGTATCGCCGACGATGGTGCTGGAGGAGGTGGTATAGGCACACATATAAGCGATCAGCGCTTGTAGCCAGCAGAACACTGACCAGGCAATTATGTATGTTAGCCCTCAAGTGGGTGCTCGTATTACGTATACACTTGTGCTGGACTGTTTTATGTACACATTGCAACAGAGTGCTACAATTATGAATACATAGGTACAGTGTAACCGATATGTTATTGCATACTACAATAGTGAAGAAACAATTTGCTTTACAGTAATTCCTAGAGTCACTTAGAATCGCCATTTTCTGAACTGTTAAAAAGGGTGCAAAACTCGCAAAGAGACCCAAAAACTCAATGCGTCGTATTGCCAAAGTTTAATCCTGAACGCACAGGCTTAGACACTCAATCCTGGTGCGGAGACCAGGATCATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCAGAAATACCTCGAAACCATAGAAGTTGTGTCGGCCGGTATTGTTGCGGCAAACTGGCAAAATCACACACGGTGGAGTCATCGCGCCATAGTTCTGCGCTGCAATCCCGCGCCGAGTTAATTGCTGGTAGAACGATTTATTATCTTGCGATTGTTGCAGCGGATAAACAGCTGATAGCGCAGCGGAGCAGTCTGGAGGGGAGGCGTTGCCAAGATCAACCGATGTGATCAGTGTTGTGTTGCGACAGTAGGGCGCGAAATTCAAATTAAATTGATAAGCGTTGATTTTAATTTAATTTTGATTCCTGTATGGTAACTGGGAGCGCACAAGTCTTTTAAGAAAGGGGAAAAGGCACAAAGGTCGCGGACAGACCAAATATCATCCTCTCACCGTGCTGGTGCCTAAGCAGAGGCTCTGGTGTCCGAGTCGAGGCGGTACAAACCTCCATCCGTAAAAGCCGGAAATCCGTGGCCTACGTGACCCTAGGTAACCTTAGGCCATCCTTCCAGTTGATGGACAGCAGCGCAGTGGGGGCAGTCCCTGATCGCAACGGCCGTTCAGGAGGAGCTCCCGACTTTCGAGATCCCCACCAGAGTCGGTAACCGACCCACTTAGTGACTGAATCTCCGGTCCCGTCAGTGGCAGGGGTGAAGAGCACGCAGGCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGAGGTGAAAGTGGCTCCACCACAGCATCTACGACCGCGACAAGTCAGAAGACGATGGACCCATCGCCGTACCATCACGCAAAGACGGGAGAAGTCCCAGCTGGGTTCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCCAGAACGGGACCTGAGGGGCATACTTGCAGGATGAATGGCAAGATCAGCCTTCTATCACATTTCGAGGACCAACGACACGCAGGGGAATAAGGGCGCATAGCTTCCGAACTCTCCAGCCCTTAACAACAGGGCGATAGAGCTGTACGAAGGTACTACTAGCGAGCACCGCTTGAAGAACGCTACCCAGACGGGTACGCAGAAGCCTGCAAAGGCTCCACAAAATGCGCAGGTACCCACGGTGCAGATTGCCAAAGTCCAGGCGCCGAAGCAGAACAACCCCTACGTTGGATGGCAGCGGTGAAGAAAGGCGACATCCATACCTATGAGTCCAAGCCAGGCAGCTATGCATCTGTCGCCAAGAATACTGCTTACGGGTGCAGAGGCATCATCAATAAAGAACGGAGGCTGGCGCGCAGAGATGCTTCGGGGAAAGATCGAGCCTTGTAGCGAACTGGGCAGTCGTGCGAAAAAATCCGGAGGGTAGAAGGTGATCTGTTGCTTGGGGTAGAGGCTTCGGAAAGCGTTCCCAGTTTAAAACGACCTGGAAGCGGCGCTCAATGACAGCCTCTGTGCGCACAGGGCCTTAAAAAAGAATAGCTCTATCTTGCAGCCCGGATTGGACGAGGCTACATTTCAACAAGCTCCACAGCTGCTTGGTCGCCCAATTCCAGGGCCTGCAGATAAATCACACAGAAGATATCAGGGGGGCCTGCCAGTATACTGGAATTGCAAGCAAATAGCCTCAATGCTGCTGAACGCGAACGTTGCGATACCAGTCGCCAAAGCAGGGCACCGCCAGTCGTTGGATGGTCAAGATGTCGTATCACCCAGGACGTCCGACCCACGAGATGCTACAGGTGTCTCGGCTATGGGCATCCGATCAGCAGCAGCCTGCAAAGGACGCGACAGGGCAGACTGCTGTCTTAGATACGGTGAGCGTGGTACAAGGCAAAGGGTGCGTTGCTGCAAAATGCCTGATCTGCGGCAGCGGGGTGGACAGAAACCACCACCCGACGGGTAGCTTGCGTGCCCGACTTACAGAGCGACACTAAAAAGATGCAAGGGCACCTTAATGCACGCTCACTTATTAGCGTGAGTACAGCGGCTCAATGTCAATCATTGCGCAGCAGCTCAGAGCCTCCTGGCCCAGACTGCGGTTGAAGGCGCAATGTGAACGGCATCATGCTCCTCGCCGAACCCTACGTCTCTGGTAGTGGACAATCGTCCATGATCATGACAGCGAGGCAGGTAAAAGCAGCTATCAAATGCTGCAGCTCTCTCAAGTCCAGGAACTGGCTGCTTTACCAATACGGGGTATCGCTTATGCGAAGTTAAAGCGTGCACATGTACAGCTGCTACGCTCCGCCGACGACACCCCCGATCAGTTCGAGGGAGCTTCTGGAGGCGCTCGTGGACCTGCGAGGGCGAAGCCCGAAGGTCATTACCGGCGACTTTAATGCCTGGACGGTGGAATGGGGCAGCAGGACATCAACACCAGAGGGACGAGCTGTGATTGACGCCATGCAGATACTGGACCTCATACTGCTGAACGATGGACAGAGCCGACGTTTAACAACGATAGGGGTACGTCCTTTGTTAACCGTTACCTTTGTCGGCAGAGGCTGGTAGACAACAACAACAACTGGATGGTCCATGACGTCATGACGCTGGGCGACCGCCCTGATCTCCTTTCTCCCGAGAACATGCCCAAAAGACGGCAGAGTGAACAGCCGGGAAGAAACATGGGACGCAGGAAGAGATCGATGAGGCCATGCTGGCCTATCAGATCAATTCCTAAATCCCAAATGTGGACGGCGCAGAAGAGAGTGGCGGCAGGCCTCATGAATATGCTGCGGGAAGAATCTGCGACGCAATCATGCCAAAGGAAAAATAAGGCACAGCGCAAACCACCGTTTGCGGGTGGAGTTACCTCTAAACCAACTACGGTCTGGTGCCTCCAGGGCTAAGAAGAACGGCGCAACGAGCCAAGCGAGGTACCACCACGCGGAACTCTTGGGAGGCTTTCCGAAGCAAACGCCTAGAGTTCAAGCATCGCAGCTGCCAAAGCGCAGTCGTTTAAAGAGGAGCTGCGGGATGGCGTAGACAGCGATATCTGGGGCCTCGCCACAAGCTTGTTACCAACGAGCTAAGGAAGCAGCAGCTATCCGACCAGGGGTCTGGCTAACATACTGGGAGCTATTTCCAAAGCAAGACCACCTGTAAGGAGATAGCAAGAGGCAGCCCCTGCCCCAAGATTTGCCGTGCGTCCACAGAACTTGGGAAGTCGTCGAGGCAGCTGTTTCGCTGACGATGTGGCAATCACAGCCGGGCGTAGCAATAGCGATACTCCACAAGACCGAAGCAGTCCTACTAAGCAGCAGGAAAAGATGGAACATGCTGGTCTCCGTCAAGGGTGCTCAGGGGACCTCTCAAAGAGTCCCTAAAATTACCTGGGGTAATGATAGATCGCAGACTATCGTTCCAAGGACCACGCGAGCTACGCCAGCAAGAAGACAACCAGTCACATCCTCTTCGTTGGCGGGGCTTATGCCCAACGTCGGAGGCCCAAGACACCCGGCCAAGGAAACTGCGCGGTGTCGGTAGCAAGGCTTCGCTGCTATACGCTGCCACCAGTCTGGAGCAATGCCACTTGCGGTCTCATACCTGAAAGGAGCTCGTTCGGTGCTACGGTCAATGGCCCTCAGGCTCATTAGAGGATTCAGGACCATATCGAAGACGGCGCTAGCGCTGAGCCTGCCGATTGATCTGGAGATCAAGGCTCGCAGCCTTATGCGAATTAGCGCTTCCAGGCAAAGAGGCACACGAAATTCTTTATTAGGTGAATGGCGGAGCAGATGGGCAAACGTCGCGACGGGGGAGGGTGGACATCAGCTCATCAGAGATGACGGTTTGAGCCCCGAGTGACACTCAAAGTGTGAAACTTGGAATTTGTTATTTATTTTTCTTGTATATTTGATATTATTATTTTTTGAGATTTGTTTTTTTAATTTTATAGTAAAATATATATTGTTTAATTATATTTCCTAACTTAAAAAAAATTGCGTTTAATCAAGCAAATAACCGTTAATTTTGACCTTTAAAGTCAAAAAAAGAAATTCAGCTTATTTCACGGTGTGTAAAACGGTTTCTTGACAAACTGTACTTGTCCTTGGATTTATTTTTAATTTCAAGTTAACGACCACCATATTTGCTGTGTCCACTTCTTTCATTTTGCATATTATTAGAACACGCATTCTCTACCTTGCAACAGCGTGGCTTGATAACTGTTCAAAACAAAACCTCCGCTCTCTCTCTCCTGTCCTTGTCAAGCTCACCGGGACTGCCAGTCAAAGGTATTTCATCGGTGAAGCAGGATGTAGTGCCAAAGTTGCACACCATCTTCTTTTGCGGTGCACAGCAGCGCCTTTTTTTTGACCAACTAGGCGGTACCAGTCGTAGAGAGTTCTTGCCCCGCCAACATGGGTACTCCTTGTATCTATAGTTCAGATTGGTCATCTCGTCCTTACGGACACGCTTCATCATGGTGACGGTGATGATCACGTGAGCCCCATCCCAAACGTTTTGTCCGCCATCACTTAGCAGCAACCAAGCCTCTCCGGGCTGAGAGGTGACCAGCGAAGCGCCACGAGTTGCGCCCTCCTCGAACCTGGAGCGGATGCGGTAGGATGTGTGTGCTCTGCGGTTCCACTGCGTCTCTGGTATAATAAAGGCACTTTGGGCTGTGTATCCACGTGGCGGAACCTACATAGGTACCCTCGAAAACAACCATGGTCCGTGAGGAACTGGGTCATGTAGTGAACCGTTGTTGTGCTCGCAATCAATACTCCGTTAGTTGCGGAATGAGTTTGTAAGTCAGCGTCCCCGTTGCCGAGCTCTTGCCACCTGGTCTGCCGCTCCACTTTCTTTGATCTCTAATTGGGTATCTATACTCGCAAAGGTAATTTGCCCTTTATGAAAACCAGGTCAGTAAGGTTGTAGTATTACCCACACAGCAGAGCGTGCGCTGCGTCGTCCGATATGGTTCTAAAGCCTCTGTGTGGTTAGCCTAGAAGCCATTGTCCGTGATACTGCGCGGGCACTATCTAGATAGGTTTTCTTTGTGGAAACGCAGCTCCAATAGGCGCGAAAGCATAAACGAAGTGTTGCCTTTGCTCGCCACTAACGGTCTCTCTTCCTAGCCGGCGGTCTGGGTCCTCCCGTTGGGCGTAGTTCTCGCCAAGGCTGCTGCTGTCATTTGTTCACCGCTTTTTTGCTGGCATACCTTGCGTGAGCCTTGAACGAGAGCCTTCGGTCTATTAGAACAAGGTATTTCAACGTTTACTACTGAGGCGATTTCCAGCTCCTTTGACTTCCACGCATGCACTCCAGCGGACTTTCTGCTGTTCAGCAGGACTACTTCAGTCTTATGCGCAGCTTCAATTTTAAGTCCAGCAATACGTAACTTCCATA
->ef00aaf4-8ba0-45ff-8df2-bcc01dbf8d50
-TCATTGGCGCTACGTTCAGTTACGTATTGCTCATATCGTTGGATGGTCAAGATGTCGTATCACCCAGGACGTCCGACCCACGAGATGCTACAGGTGTCTCGGCTATGGGCATCGATCCAGCAACCTGCAAGGACACTGACGGGAGCAGACTGCTGTCTTAGATGCGGTGAGCGTGGGCACAAGGCAAGGGTGCGTTGCTGCGCAAAATGCCTGATCTGCAGCAGCGAGGTGGACAAGAAACCACCCGACGGTAGCTTTGCGTGCCGACTTGCAAACGACACTAAAGATGCCAAAAGAGCCACCTTAATGCACGCTCATATTAGCGTAGTACAGCTCAATGTCAATCATTGCGCAGCAGCTCAAAACCTCCTGGCCCAGACTGCGGTTGAGGCGCAATGTAGACATCGTAACCCGAACCCTACGTCTCTGGTAGTGGACAATCGTCCATGATCGCCCGGCGAGCAGGTAAAGCAGCTATCAAATGCTGCAGCTCTCTCAAGTCCAGGAACTGGCTGCTTTACCCATGCGGGGTATCGCTTATGCGAAGTTAAAACACGTGCACATGTACAGCTGCTACGCTCCGCCAGGCAACACCCCGATCCAGTTCGAGGGCTTCTGGAGGCGCTCGTGGACCATGCGAGAGGGGCGAAGCGAAAGGTCATTACCGGCGACTTTAGTACGGACAGTGGAATGGGGCAGCAGGACATCAACACCAGAGGACGAGCTGTGATTGACGCCATGCGAATGCTGGACCTCATACTGCTGAACGATGGACGGAAGCCGACGTTTAGCACAACGATAGGGTACGTCCTTTATTGACGTTACCTTTGTCCAGCAGAGGGGGCTAGTAGGCAACAACAACTGGATGGTCCATGACGTCATGACGCTGAGCGACCATGCCCTGATCTCCTTCTCCCGGTATGCCCAAAGACGGCGAGAGTAGAACAGCCGAGGAAAACATGGGACACCAGGAAGATCGATGAGGCCATGCTGGCCTATCAGATCAATTCCACAAATCCCAAATGTGGACGCAGAGTATGGCGGCGAGGCCTCATGAATATGCTGGGAAAGTCTGCGACGCAATCATGCCAAGGAAAAAATAAGGCACAGCGCAAACCACCCGTTTTACTGGTGGAGTGCCTCTAAATAACTACGGTCTGATTGCCTCCAGGGCTAAAGAGAACGGCGCAACGAGCCAGAGGCAGTACCCACCACGCGGAACTCTTGGGCTTTCAGAAACAAACGCCACAAGTTCAAGCACGGCATCGCAGCTGCCAAAGCGCGGTCGTTTAAGGAGCTGCAGGATGGCGTAGACAGCGATATCTGGGACCTCGCCACAAAACATTACCAACGAGCTAAGGAGGAGAGCGGCAACTATCCGACCAGGTCCTGGCTAACATACTGGGGAGCTATTTCCAAAGCAGACCACACTATGGGAGGCCAACAGAGGCAGCCTGCCCAGATTTCCACGTGCGTCACAGAACTTGAAGTCGTCAGGGCAGCTGTTTCGCTGACGATGTGGCAATCACAACCGGGCTAGCAATGGCGGCTCCTAGGAACCGAAGCAGTCCTACTGGCAACAGGAAAAGATGGAAGTATGCTGGTCTCCGTCAAAGGGGTACTCAGGGACCTCTCAAGAGTCCCTAAAGTACCTGGGGGTAATGATAGATCGCAGACTATCGTTCAAAGGACCACGCGAACTACGCCAGCAAAGACAGCAGCAGTCACATCCTCTTCGTTGGCAGGGCTTATGCCAACGTCGAGCCCAAGACACCCGGCCAGGAAACTGCTGGTGTCGGTAACTGGCAAAGGCTTCGCTGCGCGCTGCACCAGTCTGGAGCAATGCCGCACGCGGGGTCTCATACCTGAAGAGCTCGTTCGGTGCTACGGTCAATGGCCCTCAGGCTCATTAGAGGATTCAGGACCATATCCGAAGACGCGGCGCTAGCGCTGGCAGGCCTGCTGATTGATCTGGAGATCAAAGGCTCAGCCTTATGCGGAGTGGCGCTTCCAGGCAAGAGGCACACGAGGTGGCTATTAGGTGAATGGCAGAGCAGATGGCAAACGTCGCGACGACGGGGAGGTGGACCTATCCAGCTCATCAAGAGATGACGGTTTTGAACGGAAGTGACACTCTCAAAGTGTAAACTTGGAATTTGTTATTTATTTTCTTGTATATTTGATATTTTGTGAATTTGTTTTTGATTTATAAGTAAAATAAATATTGTTTTAATTATATTTCTAAAAAAAAATTGCGTTTAATTAAGCAAATAACCCTTGGTACGACCGTTAAAATCAAAAATTCATCTTATTTCGTGTAAACGGTTTCTTGACAAACTGTACTTGTCATGAATTTATTTTTAATTTCAAGGATAACGACCGTTTCTGTTACTTTGTGTCACTGTAGAGAGTGATGCAGGTATAAAGTGATTCAGATCCGACATCAGAAGTGGGACCGCCTACTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTGTGTTTTAGCTGTTCTTTATTTGATCAATTTGAGGAACGGGGAAGGTCCCTTTCCATTCGAAATTAATTCGTCAATCCTCTTATGATCTACATACAAGGGTTTCTTAGCCTAAGTCGAGAACAGCGCTACCGGCATAGCCTACTGTACAGCAACGCTTATATGCATTATCTTATATATATGTATATATATATGTACTGTCATACCGAGCGATGGTGCTGGAGGAGGGAGTGGTATAGGCACATATAAGCGATCAGCGCTTGGCCAGCAAGGAGAACTGCTGACCAGTGAGTGTGTATGTTAGCCCTCAAGTGGGTGCTCGTATTACGTATACACTTGTGCTGGACTGTTTATGTACACATTGCAACAGAGTGCTACAATTATGAATACACATAGGTACAGTTAGCAACCGATATGTGCATACTACAATAGTGAAAACAATTTTGCTACGACAATTCTAGAGTCGCAGAATCGCCATTTTTTCTGAACTGTTAAAGAGTGCAAAACTACAAAGAGACCCAAAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCTGAACGCACAGGCTTAGACACTCAATCCTGGTGCGAGGAACCAAGTCTACATCGCCATTGAACCGGACGTCTTAAATTACGCTGACGCAGAAATACTCAAACCATAGAGTTGTGTCGGCCGGTGTGTGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCATATAGTTCTGCGCTGCAATCCGCAGTTAATTGTGCGCCTGTTTCATGTAAATGAGTAATTTATTATCTTTTGATTGTTGCAGCGGATAAACAACTGATAGCGCAGCGGGCGATCTGGAGGGAGGCGTTGCCAGATCCAACCATTAATGATCAGTGTTGTGTTTGCGACAGTAGGGCGCGAAAATTCAAAATTAAATTTAAAATTAAGCCGTTGAGAATTTAATTTAATTTAGTACCCGATTCTGGTAACTGGGAGCGCACAAGTCTTTTAAGAAAGGGAAAAGGCACACAAAGGTCGCGGACAGACCAAATATCATCCTCTCTGGTACTGGTTATAAGCAGAGGCTCTGGTGTCCGAGTCGAGGAGCGGTACAAACCTCCATCCGTAAAAGCCGGAAATCCGTGGCCTACGTGACCCTAGGTAACCTTAGGCCATCCTTCAGTTGATGGACAGCGCAGTGGGGGCAGTCCCCTGATCGCAACGACCCGTTCAGGAGGAACTCCCGACTTTCGGATCCACCAGAGGTCAAGGTAACCCGACCCATGGTGACGGAATCTCGGTCCCGTCGGTAATGGCAGGGGTGAACACGCAGGCCCCAGCCGCCGTTGACTATCGGCTACAGCGATGCTGTAGAGGTGGAGAAATTGGCTCCTACAGCATCTACGACCGCGACAAGTCAGAAGACGATGGACCACATCGCCGTGCCATCGCAAAAGACGGGAGGAGATCCCAGCTGGTTCCCCTCATCGGTCTTCGGACTTGACCACTATCAGAACGAGGACCTGAGGGGCATACTTACCAGGATGGGCCGGCAAGATCAGCCCCCTTCTATCCGCATTTATTCGAGACCCAACGACACATGAGAGACAAAGACGCTTCCGAACTCTCGGCCCTTAACAACAGGGCGATAGAGCTGTACGAAGGTACTACTAGCGAGCACCGGCGAAGAGCAACTGCAGACGGAGGTACAAAAGCCACAAAAGGCTCCACAAAATGCGCAGGCTTACGGTGCAGGTGCCAAAGTCAGGCGCGAAGCAGGCAACCGTTGGATAGCAGCGGTGAAAGGCGACATCCATACCTAACGGAAGTCCAAAGCCAGGCAGCTATGCATCTGTCGCCAAGAATGCTAGCACGGGTGCAGAGCTCATCGTAAAAGACAGGAGGCTTCGTACGCAGAGATGCTTCGGAAGCTAAGATCGAATCGAGCCTTAGCGAACTGGGCAGTCACGTGCGAAAATCGGAGAACGCAGAAGGGTGATCTGTTGCTTGAGGTAGAGCTTCGGAAAGCGTTCCCCAAGTTTAGAACGACCTGGAAGCTCAATGACTTAACCTCTGTGCACAGGAGCGCAAAGAATAGCTCTATCTTGCAGCGGATTGGACGAGGCTACGACGGCAAGCTCCACAGCTGCTTGGTCGCCCAATTCCAGGGCCACAGATAAATCCTATGAAGATATCAGGGGCCTTCGCAGTATGCGGAATTGCAAGCAAATAACCTCGAGATTAACGCTGAACGCGAACGTTGCGATACCAGTCCTTAAACAGGGCACCCATAATAATCGTTGGATGGTCAGATGTCGTATCACCCAGGACGTCCGACCCGAGATGCTACGGGTATGTCTCGGCTGCTTGGGCATCGATCAGCAACAAAGGACACTGACAGGGCAGACTGCTGTCTTAGATGCGGTGACGTGGGCACAAGGCAAGGGTGCGTTGCTGCACCAAAATGCCTGATCTGCAGCAGCGAGGGTGGACAGAAACCACCGACGGTAGCTTTGCGTGCCGACTTACAGAGCGACACTAAAGATGCCAAGAGCCACCTTAATGCGCTCATATTGGCGTAGTACAGCTCAATGTCAATCATTGCGCAGCAGCTCAAACCTCCACAGCCCAGACTGCGGTTGAGCGCAATGTGAACGTAATGCTCCTAAAGCGAACCCTACGTCTCTGGTGGTGGACAATCGTCCATGATCGCCCGACGAGGCAGGTAAAGCAGCTATCAAATGCTGCAGCTCTCTCCAAGTCCAGGAACTGGCTGCTTTACCCATGCGGGGTATCGCTTATGCGAAGTTAAAAACACGTGCACATGTACAGCTGCTTTACGCTCCGCCGAGCGACACCCCGATCAGTTCGAGAGGAGCTTCTGGAGGCGCTCGTGGACCATGCGAAGGGGCGAAGCCCGAGGTCGTACCGGCGACTTTAATGCCTGGACAGTGGAATGGGGCGCTTAAGGACATCAACACCAGAGGACGAGCTGTGATTGACGCCATGCGAATGCTGGACCTCATACTGCTGAACGATGGACGGAAGCCGACGTTTAGCGATAGAGGGGTACGTGTTTATTGACGTTACCTTTGTCAGCAGAGGGCTAGTAGACAACAACAACTGGATGGTCCATGACGTCATGACGCTGAGCGACCATGCCCTGATCTCCTTCTCCCGGAGGGTATTGCCCAAAAGACGGCAGAGTAGAACAGCCGGGGAAAACATGGGACACCAGGAAGATCGATGAGGCCATGCTGGCCTATCAGATCAGCCCTGAAATCCCAAATGTGGACGCAGAGAGTATGGCGGCAGCCTCATGAATATGCTGGGGAAAGATCTGCGACACCAATCATGCCAAGGAAAAATAAGGCACAGCGCAAACCACCCGTTTACTGGTGGAGTGCCTCCCCAAGCCAACGCTACGGTCTACGGTGCCTCAGGGCTGAAGAACGGCGCAACGAGCCAGAGGCGGTACCCACCACGCGGAACTCTTGGAGCTTTCAGAAGCAAACGCCTAGAGTTCAAGCGGCATCGCGGCTGCCAAAGCGCGGTCGTTTAGGGCTGCAGGATGGCGTAGACAGCGATATCTGGGGCCTCGCCTACAGAAAACTGCATTGCCAACGAGCTAAGGAGGCAACCCCATCCGACCAGGGGTCTGGCTAACATACTGGGGGGAGCTATTTCCAAAGCAGACCACACTGAGGCCAACAGAGGCGGCCACCCCAGATTTGCCGTGCGTCACAGAACTTGAAGTCGTCGAGGCAGCTGTTTCGCTGACGATGTGGCAATCACAGCCGGGCTAGCAATAGCGGCTCACAAGACCAAAGCAGTCCTACTAAGCAGCAGAAAAGATGGAGAACATGCTGGTCTCCGTCAAAGGGTACTCAGGGGACCTCTCAAAGAGTCCCTAAAGGTACCTGGGGGTAATATTAGATCCTGAACTATCGTTCAAGGACCGAGCTACGCCAGCAAGAAGACAGCAGTCACATCCTCTTCGTTGGCGAGGCTTATGCCCCAACGTCGGAGGAGGCCCAAGACACCCGGCCAGGGAAACTGGCGGTGTGGTAGCAAAGGCTTCGCTGCTATACGCTGCGCAGTCTGGAGCAATACCCTTGCAGGTCTCATACCTGAAAAGGAGCTCGTTCGGTGCTTTACGGTCAATGGCCCTCAAGGCTCATTAAGGATTCAAGGACCATATCCGAAGACGCGGCGCTAGCGCTGGCAGGGCTGCCGATTGATCTGGAGATCAAGGCTCTCGGCCTTATGCGGAGTGGCGCTTCCGGGCAAAGAGGAGCACACAGTGGCTATTAGATTGAATGGCAGAGCAGATGGCAAACGTCGCGACGGGGGAGGTGGACCTATCAGCTCATCCAGGAGATGACGGTTTGGGCAGAGTGACACTCTCAAAAGTGTGTAAACTTGGAATTTTGTTATTTATTTTCTTGTATATTTGATATTTTGAGATTTGTTTTTTTAATTTATAGAGTAAAATATATATTGTTTAATTATATTTCCTTAAAAAAAATTGCGTTTAATCAAACAAATAACCGGTAATTTTGACCTTTAAAGTCAAAAAATTCAACTTATTTCACGGTGTGTAAACAGTTTCTTGACAAGCGTACTTGTCGCAGATTTATTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCACTTCTTTCATTTTGCATATTATTAGAACACGCATTCTCTACCTTGCAACAGCAGTGGCAAATAACTGTTCAAAACAAAACCTCCGCTCTCTCTCCTGTCCCTTGTCAAACTCACCGGGACACCAGTCCAAGGTATTTCATCGGTGAGCAGGATGTGGTGCCAAGTTGCACACCATCTTCTTTTGCGGTGCACAGCAGCGCCTTTTACGAACCAACTGAGCGTACCAGTCGTAGAGTTCTTGCCCACTCTCCAACATACGGGGGGTACTCCTTATCTATAGTTCAGATTGGTCATCGTCCTTACGGACTACGCTTCATCGTGATGAGGCGTGATCACGTGAGCCCCATCCCAAACGATTTTTGTCCGCCATCATAGCAGCAATAAACCTCTCGGGCTGAGAGGTGATGACCCAGCGAGCGCCACGGTTGCGCCCTCTCCTCGGCGAACCTGGAGCAGTGCAGTAGGATGTGCTCTGCGGTTTCCACTGCGTCTGTGCAATAAAGGCACTGGGCTGTATCCACGTGGCGGAACCTACATAAGGTACCCTCGAAAGCAACCATGGTCGTGAGAACTGGGTCGTAATGGTATTTAGTCCACCGTTTTGTGCTCGCAATCAGCCCACTCCGTTAGTTGCGGAATGAGTTTGTAAGTCCGGCGTCCCCGTTGGCGATACTTGCCACCTGGTCTGCCATACTCCTCGAATCCACTCTTTGATCTCTAATTGAGTGTATCCCTCACTCACCAAAGGTATTTGCCCTTTATGTCAGGTCAATGGGTGTAATGCCTGACAGAGCGTGCGCTGCGTCGTCCGATATGGTTCACAAAGCCTCTGATTAGCCACGAGAGCCATTGTCGTGATACTGCGCGGGCACTATCTAGATAGGTTTTCTTTATTGGAAACGCAGCTCCCAAGATAAGGCGCGAAGCATAAAGCAGTGTTGCCTTTGGAAACCGCCACTAACGGTCTCCCCACAACCGGCAGTCTGGGTCAGCAATACGTAGCA
->c22489fb-3bdb-484a-8c2a-e9706b7c40b3
-ATCATTGTACTTCACGTTCAAGTTACGTATTGTAATTATGTATGTTAGCCCTCAAGTGGGTGCTCGTATTACGTAGCAACCACACTTGTGCTGGATTTTGTTTATGTACACATTGCAACAGAGTGCTACAATTGTACGTTACACATAGGTACAGTGCTTAACCGATATGTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTAGAGTCGCAAAGTCCCGCCATTTCTGAACTGTTAAAGAGTGCAAAACTCACAAAGAGAGACCCAAAATACAGTACTGTCATGGCGCTGAAAGTTTAATCCTGAACGCACAGGCTTAGACACTCAATCCTGGTGCGGAGACCAGGTCATGTAGAAGACGGACGTCTTAAATTACGCGGCGCAGAAATGCCGAAACCATAGAAGTTGTGTCAGCCCGGTGTGTGCGGCAAACTGGCGAAATACACGGAGTAGGTCGCGCCATAGTTCCTGCGCTGCAATCACGCGAGTTAATTGTGCGCCTGTTTCATGTAAATGGTGATTTATTATCTTGCGATTTGTTGCAGCGGATAGGCAACTGATAGCGCAGCGGGCAGTCGATCTGGAAGGGAGGCGTTGCCAGATCCAACCGATAGCCCGATCAGTGTTGGCGTGTTGCGACAGTAGGAGCGCGAAATTCAAAATTAAATTTAAAATTAAGCCGTTGAAATTTAATTTAATTTAATTTTGATTCTACGTGACTGGGGTGCCTGCGAGTCTTTTAAGAGAGGAAAGACACAAAGGTCGCGGACAGACCAAATATCATCTCTCACCGTGCTGGTGCCTAAAGCAGAGGCTCCTGGTGTCGAGTCGAAGGGCGGTACAAACTCCATCCCGTAATATTAAAGCCAGGAGGAAATCCGTGGCCTACGTGACCTAAGGTAACCTTAGGCCATCCTTCAGTTGATGGACAGCGCGGTGGGGGCAGTCCCCTGATCCCATAACGACGCGTTCAGGAGGAGCTCGACTTTCGAGGATCCCCACCAGAGGAGTCGGTAGCGAGCCCTTGGTGACGGAATCTCGGTCCCGTCGGTGGCAAGGGGTGACACGCAGGCCCCAGCCGCCGTTGACTATCGACAGCGATGATGCTGTAGAGGTGGAGAATTGGCTCCCTACAGCATCTGACCCGCGTGATCAGAAGACGATGGACCACATCGCCGTGCATCGCAAAAGACGGGAGGGAAGTCCCCAGCTGGTTCCCTCATCCGGTCTTCCGGACTTGACCACTGCTCTCAGAACCTTGAAAGGACCTGAGAGGGGCATACTTACCAGGATGAATGGCAAGATCAGCCCCTTCTATCGCATTCGAGACCCAACGTGACACACTTGAGAGACAAAGGGCATAGCTTCCGAACTCTCAGCCCTTAGCAACAGGGGCGATAGAGCTGTACGAAGGTACTACTAGCGAGCACCGCTTGAAGAAGAGCAGCGCTACCCAGACGGAGGTACAGAAGCCACCACCAAAAGGCTCCACAAAGATGCGCGGTACCCACGGTGCAGGTGCCAAAGTCAGGCGCGGAAGCAAGGAGCAACCCCACGTTGAAGTTGGCAGCGGTGAAGGCATCCATACCTAGCGGTCCAAGCCAGGCGGCTATGCATCTGTCGCCAAGAATGCTAGCACGGGTGCGGAGCGCTCATCGTAAAAAGAGACAGGAGGCTTCGTACGCAGGATGCTTCCGGAAGCTAAGATCGGAATCGAGCCTTAGCGAACTGGGCAGTCACGTGCGAAAATCCGGAGAACGCAGAAAGGTGATCTGTTGCTTGAGGTAGAGGCTTCCCGGAAGCGTTCCCAAGTTTAAGAGCGACCTGGAAGCGGCGCTCAATGACAACTCTGTGCGCACAGGAGCGCGAAGAATAGCTCTATCTTGCAGCAGTTGGACGAGGCTACGACGGCAAACTCCACACAGCTGCTTGGTGTGAATTCCAGGGCCTGCAGATAAATCCACAAGAAGATATCAGGGGCCTTCGCAGTATGCGGAATTACAAACAAATAGCCTCAGTGCTGCTGAACGCGAACGTTGCGATACCAGTCCTTAAACAGGGCACCATAATCGTTCGTTGAGATGTCGTATCACCCAGGACGTCCGACCCACGGATGCTACAGGTATTACGGCTGGGCATCGATCAACCTGCAAAAGGACACTGACAGGGCAGACTGCTGCTGCCGGGCGTGACACGAGGGCGAGGAACGTTTTGCTTTTGAAGTAACAGCGGTGGACGAAACACCCGGCAGGGTAACGCGCTGACTTACAGAGCGACACTAAAAGATGCCAGAGCCGCAGCAATGCGCTCCTTATTGGCGTAGTACAGCTCAATGTCAATCATTGCGCAGCAGCTCAAGAGCCTCCTGGCCCAGACTGCGGTTGAGCGCAATGCTTGAACATCATGCTCTAAGCGAACCCTACGTCTCTGGTGGTGGACAATCGTCCATGATCCTTGACAGGAGCAGGTAAAGCAACTATCAAATGCTGCGGCTCTCTCAAGTCCAGGGAACTGGCTGCTACCCATGCGGGGTATCGCTTATGCGAAGTTAAAACACGTGCACATGTACAGCTGCTACGCTCCGCCGAGCGACACCCCCGATCAGTTCGAGGGCTTCTGGAGGCGCTCGTGGACCATGCGAGGGAGAGGGGCGAAGCCCAGAGACCAATTGCCGGCGACTTTGATACCTGGACAGTGGAATGGACGGCGGGGACATCCAACACCACAGAGGGACGAGCTGTGATTGACGCCATGCGGGAATGCGGACCTCATACTGCTGAACGATGGACGGAAGCGACGATTTAACAACGATAGGGGAGTACGTCCTTTATTGACGTACGCTTTGTCAGCGGGGGCTGGTAGACAACAACAACTGGATGGTCCACTTGACGTCGCGACGCTGAGCGACCATGCCCTGATCTCCTTCTCCCCGGAGGTATTACCCAAAGACGGCGAGAGTAGAACAGCCGGGAAAACATGGGACACCAGGAAGATCGATGAGGCCAAAGTAGCACGGCCTATCAGATCAATTCCTGGAAATCCCAAATGTGGACGCACCCGGTATGGCGGCAGGCCTCATGGAATATGCTGGGAAGAATCTGCGACACCAATCGTACCAGGAAAAATAAGGCACAGCGCAAACCACCCGTTTGGTGGGTGCCTCCCCTAAAGCCAACTACGGTCTGATTGCCTCGGGGCTAAAGAGAACGGCGCAACGAGCCAGAGGCAGTACCCACCACGCGGAACTCTTGGAGGCTTTCAGAAGCAAACGCCTAGAGTTCAAGCACGGCATCATGGCTGCCAAAGCGCGGTCGTTTAAGGAGCTGCAGGATGGCGTGGAGCAGTATCTGGGGCCTCGCCACCACAGAAGCGTACCAACTTGACTGGGGAGGAGGCAGCAACCCATCCGACCCACGGGGGGTCCTGAAAAGCTAACATACTAGGGGAGCTATTTCCAAAGAAGCAGACCACACTATGGAGGCCAACAGGGCGGCCTGCCCCGATTTTGCCGTGCGTCACAGAACTTGAAGTCGTCAGGCAGCTGTTTCGCTGACGATGTGGCAATCACAGCCGGAGCTAGCAATGGCGGCTCCACAAGACCGAAGCAGTCCTACTAAGCAGCGGGAAAAAGATGGAGAAGTATGCTGGTCTCCGTCAAAAGTCAGGGGACCTCTCAGAGTCCCTAAAGGGTACCTGGGGAGTAATGATAGATCCTGAATATCGTTCAAAGGACCACGCAGAGCTACGCCAGCAAAGAAGACAACAGTCACATCCTCTTCGTTTGGCGAGGCTTATGCCAACGATCGGAGGCCCAAGACACCCGGCCAGGAAACTGCGGGTGTCAGTAGCAAAGGCTTCGCTGCTATACGCTGCACCAGTCTGGAGCAATGCCACTTGCAGGGTCTCTCTCATACCTGAAAGGGAGCTCGTTCGGTGCGCTTTACGGTCAATGGCCCTCCAGATCATTAGAGTTCAAGGACCATATCGAAGACGCGGCGCTAGCGCTGGCAGGCCTGCCGATTGATCTGGAGATCGAGAACTACTCAATGCTTATGCGGGTAGCTTCCAGGCAAAGAGGCACACAGTCAACTATTATTAGGTGAATGGCAGAGCAGATGTAAACGTCTCGCGACGGGGAGGGTGGACCTATCAGCTCATCAGAGATGACGGTTTGGGTGAAGTGACGCTCTCAAAGAGATTAATTATTAAACGTTTGTTATTTATTTTCTTGTATATTTGATATTTTTGAATTTGTTTTAATTTTATAGAGTATATATTGTTTAGTGTATATATTTCCTTAAAAATTGCGTTTTAATCAAGCAAATAACCGTTAATTTTGACTGCTTCAAAGGTCAAAATTCAACTTATTTCACGGTGTGTAAACAGTTTCTTGACGAAGCTATGCTTGTCGCAAGATTTATTTTTTAATTTCAAAGTTAACGATGGTTTCTGTTACTTTGTGTGCTTCTTTCATTATTATTAGAACTACGCATTCTCTACCTTTTTGGCTTGGCGTGGCAAATAACTTTGTTTCAAAACAAAACCTCCGCTCTCTCTCCTGTCCTTGTCAAATGCGGGACTTTGCAGTCAAGACATTTCATCAGTGAGCAAGGATGTGGTGCCAAGTTGCACACACCATGCTAACGCGGTGCACAGCAGCCTTTGACAACTAGGCGTACCAGTCGTAGAGTTCTTGCCCATAACATGCGGGGGGTGCTCTTATCTACTATAGTTCAGATTGGTGGCATCGTCCTTACGGACACGCTTCATCATGAGGTGACGATGATCGCGTGAGCCCCATCTAAACGATTTTTGTCCTTCATCCTGCCCAGCAACCAAACCTCTCGGGCTGAGGTGACCCAGCGAGCGCCACGAGTTGCCCTCTCCTCGAAGAACCTGGAGCAGTGCAGTGGGATGTGCTCTGCGGTTCCACTGCGTCATTACGGTAAAGGCACTGGGCTGTATCCACGTGGCGGAACCTACATAGTACCCTCGAAAGAAACAGCCATGGTCCGTGAGGGAACTGGGTCATGTGAGTAGTCCACCGTTTTGTGCTCGCAATCCAGCCCACTCCGTTAGTTGCGGAATGAGTTTGTAAGTCCAGCGTCCCCGTTTGGCTCTGCCACCTGGTCTGCCATACTCCTCGAATCCCACTCTTTGATCTCTAGTGAGTGTATCCCTCACTCACTAAAGGTGTTTTACCCGCTATGTCCAAGGTCAGTAAGGTGTAATGCCTGACAGGGCGTGCGCTGCGTCGTCCGATATGGTTCTAAAGCCTCTGATTAGCCTGAGAGCCATTGTCCGTGATACTGCGCGGGCACTACATCTAGATAGGTTTTCTTTGTGGAAACGCAGCTCAGATAGGCGCAGCATAAAAGCAGTGTTGAGCAATACGTAACGT
->3c2169f8-24e7-455d-ae9f-44ca5224d990
-TCGGTATGCTTCGTTCGGGCACGTATTGCTCTGCCAGATTCGCCAGGAGGGCGCAGCTCTTGGCGCTCGCTGGATTACCTCTCAGCCGAGAACGGTTGCTGCTATGATGAGATGAAATCCGTTTGGGATGAGACTCCGTCATCGTCACCATGATGAAGCGTGTCCATGGGACGGACGGTAATCTGAACTATAGATAAGGAGAGTACCCCGTATGTTGGCGGGGCAGAACTTCTGACTGGGTACGCTCAGTTGGTCGTAAAAGGCGCTATATTGCACAAAGAAGATGGTGGTCTAACTTGGCACCATCCTACTCCTCGATGACACCTTGATGGCAGTCCCAGTGACTTGACAGGGACTGGGAGAGAGCGGAGGTTTTGTTTTGAAACAGTTAACACCCACGCTGTTGCAAGGTAGAGGAATGCGATGTTCTAATAATATGCAAAATGAAAGAAGTGGACACAAAGTAACAGAAGAGCGGTGTTAACTTGAGTAAAATAAATCTGCGACAAGTACAGTTTATGAAACTGTTTTACACTACGTAGAAATAGAGGGTTGAATTTTGACTTTCAAGGTCAAATTAACGGTTATTTAACTTGATTAAACGCAATTTTTTGGAAATATAATTAAAACAATATATATTTTACTATGGGGTAAAAACAAATTGAAATATCAAATACTGAAAGTATAAACACTAGATTCAGGATTTACACACTTTTGAAGTCACTCTGCCCCAAACCGTCATCTGGGATGAGCTGATGGATCCACCTCCCACGTCGCGACGTTTGCCATCTGCTCTGCCATTCACCTAATAGCCGCTCATTTTCTGCCTGGAAGCGCCACTCCGCACTGGGCTGAGGCAGCAGATCTCAGATCCGTCAAACGGAGCCTCAGCCGCACCCGCGTCCTTCGGATATGGTCCTGAATCACTCTAATGAGCCTGAGGGGCCATTGACCGTAGCATGAACGAGCTCCCTTTCGGTGAGACCCACCACAAGTGGCATTGCCAGACTGGTGCAGCGTATAGCAATGCTACTGACACCAGCAGTTTCCTGGCCAGTGTCTTGGAGGCGGCCTCCGACGTTATGGGCATAAGCCTCACTCCAACGAAAGAGGATGTGACTGCTGTCTTCTTGCTGGCGTAAGCTCAACGTGGTCATGAACGATAGTCTGCGATCATCGTACCCCAGGTACTTTAGGGACTTTCTTGAGAGGTCCCCTGGTACCCTTGACGGAGACCAGCATGTTCTCCATCTTTTCCTGCTACTAACTAGTAGGACTGCTTCGGTCTTATGAGCCATAACCTTTAGCCCGGCTGTGGTGCCACATCGTCAGCCAAACAGCTGCCTCGACGACTTCAAGTTCTGTGACGCGGCAAATCTGGGCAGGGCTGCCTCATTGGCCTCCATGGTGGTCTGCGCTTTGGTAGCTCCCCTAGGTATATTTAGCGGGACCCCCGGGTCGGGGATGGGGTTTACCGCTCTCCTCCACCAGCTCGTTGGTAACAAGAAAGCTTGTAGGCGAGGGCCCAGATATCGCTGTCTGCGCCATCCCACAGCTCACCAAACGACCGCGCTTTGGCAGCCGCGATGCCGTGCTGAACTCTGGAGCGTTTGCTTCTGAAACCTCAAGGTTCCGCAGTGGTGCGTTGCTGCCTCTAGCTCGAACGCGCCGTTCACCAGCCTGAACGTCAGACCGTAATTGGCTGCAGGGCACTCCACCGATAAACGGGTGGTTGCGCTAATTACCTTATTTTTCCTTGGCATGATTGCGTCGCGGATTCTTTAACATATTCCTTGAATACCGCCATACTCTCTACGTCCACATTTAGGATTTCAGGGAATTGATCTGATAGGCCAAAGCAGCTCATCGATCTTCCTGGTGTCCCATGGTACCCAGCTTCATTCTACTCTGCCGTCTTTTGGGCATGCCACTCCGGGAGGAGATCGGGGCGGTTAGCTCCAGCATCATGACGTCATGGACCATCAGTTGTTGATGTCTGCCTAGCCTCTGCTGACAAAGGTAAACGTCAATAAAGGACGTACCCTATCGTTGTTAAACGTCGGCTTCCGTCCATCGTTTCAGCGGTATGAGGGTCCAGCATTCACGCTGGCATTAATCACAAGCTCGTCCTCTGGTGTTTGGATGTCCTGCTGCCCCCATTCCACTGTCAGGCATTAGGTCGCCAGCAATGACCTTCAGACTGCCCTCGCGGATCCACGAGCGCCTCAGAGCTCCTCGAGCTGATCAGGGTTGATAATCACGGCGGGCAGCTGGCAACTATTACCATGTGCACGATGTTTAAACTTCGCATAAGCGGTACCGCATGAATTAAGCAACCAGTTCCTGGACTTGAAGGCTGCGGCATTTGATGGCTGCTTTACCACCATACTCATCGGGATCATGGACGATTGTCCACTACCAGAACGTAGAGGGTTCGCTGGGCATGATGTCTTATTTACGCTCAACCACCAGTCTGGGCCAGAATACTGAGCTGCTGCGCAATGATTGACGATGAGCTGTACTACGCTAATGAGCGTGCATTCGGTGGCTCTTAGCATCTTTTAGTGTCGCTCTATGAAGTCGGAATTTTCACGGCTTCCTCCGTCGGTGGTTTCTGTCCACCCTCGCTGCTGCAGATCAGGCATTTGGTGCAGCAACGCACCCCGCGCCTTGTGCCACTTTCACCGCATCTAAGACTTGGCAGTCTCTTGCCCTGTCGGTGTCCTTGCAGGTTGCTGATCCGATGCCTGACCAAACACCTGTAGCATCTCGTGGGTCGGACGTTACCGGGTGATACGACATCTGACCATCCAACGATTGCTGGTTGCCCTGTTGGGACTGGTATCGCAACGTTCGCGTTCAGCAGCACTGAGACTGTTTGCTTGCAATTCCGCACCTGCGAGGCCCTGAAACCATCTTCAGGATTTTATCTGCAGGCCCTGGAATTGGAGCGATAACGGCTGTGGAGCTTCTCTGCTGTCGTAGCCTCGTCCGATACGCTACAAGATAGGCTATTCTGCGCTCACTGTGCACACAGAGGCCAAGTCATTGAGCGCCGCTTTGGAACGCTCTTAAAACTTTGGGAACGCTTTCCGAAGCTTTCCCCTCTACCTCAAACAGCTAGATCACTTTAACTGCGTTCTCGGATTTTCACCTTGCGGCGACTGCCCCGTTCATGAAACCGATTTGATGCAAGCACGAGCATCTCGCGTGCAGGCCTCTCCTGTCTTTTTTACGATGGGTCCTCGCACCGTGCTAGCATTCTTGGCGGCAGATGCATAGCTGCAAACTGGACTCGTTGGGTATGGATGTAACCTTTTCTTCACCGTTGCCATCCAACGTGGGGTTGCTCTGCTTCGGCGCCTGGACTGGCACCTGCACCGTGCGTTATACTGCACATTTTGTGGAGACCTTTTTTGGTGGGCTTTTGTGCCTCCGATCTAGGTAGCGCTGCTCTTCAAGCGGTGCTTCGCTTCGTAGTATAACCTTTGGCTCTATCTAGCCCTGTTGTTAGGGCTTTAGAGTTCCGGAAGCTATGCCCTTTGATGTCTCGTAACATTCGTTGCGTTCTCGAATGCGGATAGAGGGGCGGTCTTGCCATTCATCCTGGTAGAGTGGCACCTCGGGTCCTCGTTCTGGAGCAGTGGTCAGGATCCGAAGACCGATGAAGTCAGCTGGGACTTCCCTCCCGTCTTTTGCGATGGCACGCTGATGCTGGACCGTCTTCCGACTTGTCGCGGTCGGCATGGAATACTGTAAGGAGCCAATTCCTCCCCACCTCTGTATCGCTGCGGACGATAGTCAACGGCGGCTGGAGATTTCCCGTGCTCACCTTGCCACCGACTGGGACCAGATTCGTCACCATGGGTCGGTGCCGAAGAAAGCTCCTCTGGTGGGGTCTCGAAAGTCGGGAAGCTCCTCTGAACGGGTCGTTGCGATCGGGACTGCCCCACCGCTGTCCATCAACTGAAGGATGGCCCAGGTTACTGGGTCACAACCCAGGCCACGGTTCCCCAGCTTTTACGGATGGAGTTTGTACCACGCCTCGACTCGGACACAGAGCTCTGCTTAGGCACCAGCACGAACTGAAGATGATATTTGGTCTGTCGCGAATAACGTGCCCTTTTCCCTTTCTTAGAACTTGTGCGCTCCCGGTTACCAGAATCAAATTTAAATTAAATTAAATTTCAGCGGCTTGTTTAAATTTAATTTTGAATTTCGCCTACTGTCGCAACCTGCTTACTGATCACGGTTGATCAGCAGCGCCTCCTCTCAGATCGCCCGCTGCTTATCGGCTGTTTATCCGCTGCAACAATCGCAAGATAATAAATTACCTATTTACAGCGAAACGGGCGCACAGTGCTTCAACGTGATTTACGGCGCAGAACTATGACGACTCCACCGTGTGATTTTGCCAGTTTGCCGCACACACCAGCCATTTAACTATGGTTTGCA
->df422228-a7ac-47c4-bfa9-17b9b694b1de
-TTGTTGTACTTCGTTCAGTTACGTATTGCTGTTTTTTGTTTTGAAACAGTTATTTGCCACGCTGTTGCAAAGGTAGGGAAGTCGTGTTCTAATAATGTATGCAAAATGAAAGAAGTGGACACAAAGTAACGAAACGGTCGTTAACTTGAAATTAAAAATAAATCTGCGGCAAGTACAGTTTGTCAAGAAACTGTTTACACCGTGAAATAAGTTGAATTTTTTTTGACTTTAAAGGTCAAAATTAACGGTTATTTGCTTGATTAAAGCATTTTTTAAGAAATATAATTAAACAATATATATTTTACTTATAAATTAAAAAACAAATTCAAAATATCAAATATACAAGAAAATAAATAACAAATTCAAGTTTACACACACTTTTGAGAGTGTCACTCTGCCCAAACCGTCATCTCTGGGATGAGCTGATGATCCACCTCCCCGTCATGACGTTTTGCCATCTGCTCTGCCATTCACCCTGTAGCCACTCATTGTTGCCTCTTGCCTGGAAGCGCCACTCCGCAGGCTACGAGCCTTGATCTCCAGATCAATCGGCAGGCCTGCCAGCGCTAGCGCCGTCTTCGAGGTCATGGTCTGAATCCTCTAATAATGAGCCTGAGGGCCATTGACCGTAGCACCGAACGAGCTCCTTTCAGGTATGAGACCCTGCAAGTGGCATTGCTCCAGACTGGTGCAGCATTATGGCAGCGAAGCCTTTGCTGCCTGACACCAACGGTTTCCTGACCGGGTGTCTTGGGCCTCCGACGTTGGGCATAAGCCTCGCCAACGAAAGAGGATAGCGAGCTGCTGTCTTCTTTTGCTGGCGTAGCTCGCGTGGTCCTTGAACGATAGTCTGCGATCTATCATTACCCCGGAGTACTTTAGGGACTCTTGAGAGGTCCCTGGTACCCTTGACGGAAGAGAACCAGCATGTTCTCCATCTTTTTCCTGCTGCTTAGTAGGACTGGCGGTCTTGTAGAGCGCTATTGCTAGCCCGGCGTTGCATCGTCAACGAAACAGCTGCTCGACGACTTCAAGTTCTGTGACGCACGGCAAATCTGGGGCAGGGGCTGCCTCTGTTTGGCCTCCCATAGTGTGGTCTGCTTTGGAAATGCTCCCCTGGTATGTTAGCCAGGACCCCGGGTCGGATGGGGTTGCGCTCTCCTCCTTAGCTCGTTGGTAACAAGCTTGTAGGCGAGGCCCCAGATATCTGTCTACCATCCTGCAGCTCCTTAAACTTGACGCCGCGCTTTGGCAGCCGCGATGCCGTGCTTGAACTCTAGGCGTTTGCTTCTGAAGCCTCCAGAGAGTTCCGCGTGGTGGGTACTGCCTCTGGCTCGTTGCGCCGTTCTCTTTAGCCCTGAGGCAATCAGACCGTAGTTGGCAGGGGCACTCCACCAAACGGGTGGTTTTGCGCTGTACCTTATTTTTCGGCTTGGCATGATTGCGTCGCAGATTCTTCCCAGCATATTCATGAGGCCTGCCGCCATACTCGTCCACATTTTGGGATTTCCGAAAATTGATCTGTGATAGGCCAGCATGGCCTCATCGATCTTCCTGAGGTGTCCCCATGTTTTCCAACTGTTCTACTCTGCCGTCTTTTGGGTACATGCCCTCCGGGGAGAAGGAGATCGGGGCATGGTCGGCTCAGCGTCATGACGTCATGGACCATCCAGTTGTTGTTGTCTACTAGCCCTCTGCTGACAAAGGTAACGTCAATAAAGGACGTACCCTATCGTTGTTAAACGTCGGCTTCCGTCCATCGTTCAGCAGTATGAGGTCCAGCATTCGCGTAGCGTCAATCACAGCTCGTCCTCTGGTGTTGGATGTCCTGCTGCCCCATTCCACTGTCCGAGGCATTAAAGTCGCCGGCAATGACCTTCGGGCTGCCTCTCGCATGGTCCACGAGCGCCTCCAGAAGCTCCTCGAACTGATCGGGGTGTCGCTCGGCGGAGCGTAACAGCTAATACATGTGCGTGTTTTAGCTTCATAAGCGATACCCGCATGGGTAAAGCAGCCAGTTCCTGGACTTGGAAGGCTGCGGCGACTGATAGCTGCTTTACCTGCCTCGTCAGGATCATGGACGATTGTCCACTACCAGAGACGTAGGGTTCGCTTAGGAACATGTTTCTACATTGCGCTCAACCGCAGTCTGGGCCAGGAGGCTCTGAGCTGCTGCGCAATGATTGACGATGAGCTGTACTACACGCTAATATGAGCGTGCATTAAGGTGGCTCTTGGCATCTTTTAGTGTCGCTCTGTAAGTCGGGCGCAAAGCTACCGGTATCGGGTGGTTTCTGTCCACCTCGCTGCTGCAGATCAGGCATTTTGGTGCAGCAACGCACTTATACCTTGCCCGTGCCCACGCTCTCACCGCATCTAAGACAGCAGTCTGCCCTGTCAGTGTCCTTGCAGGTTGCTGATCGATGCCCATAGCCGGACACCTGTAGCATCTCATGGGTCGGACGTCCTGGAATGATACGACATCTTGACCATCCAACGATTATGGTGCCCTGTTTAAGGACTGAGCGGTATCACCTTTTAGTGTCGCTCTGTAAGTCGGGCACGCAAGCTACCCGTCCGGGTGGTTTCTGTCCACCTCGCGCACTGCAGATCAGGCATTTTGGTGCAGCAACGCGCTTGCCTTGTGCCCACGCTCACCGCATCTGAACCAACCGGTCTGCCCTGTCAGTGTCCTTGCAGGTTGGCGGTCGATGCCCACGCCTTCGAAGACACCTGTGGCATCTCGTGGGGTCCGGACGATCTGGAGTGATACGACATCTTGACCATCCAACGATTATGGTGCCTGTTTGGGACTGGTATCGCAACGTTCGCGTTCGGCAGCACTGGGGCTATTGCTTGCGATTCCGCATGCTGCGGAAGGCCCTGATATCTTCAGGATTTATCACGAGCCCCTGGAATTGGACGACCAAGCTGTGGAGCTTCTCTGCTGTCGTAGCCTCGTCAATCCGCTGCAAAGATGGGGCTATTCTTTGCGCTCCTGTGCGCACAGAGGCCAAGTCATTGAGCGCCGCTTCAGGTCGCTCTTAAACTTAGACGCTTTCCGGCTTTCCCCTCTACCTCAAACAACAGATCACCTTTCTGCGTTCTCGGATTTTTCGCACGTGACTGCTTAGTTCGCTAAGGCTCGATTCCGATCTTAGCTTCCGAAGCTTATCTCTGCGTGCAAGCCTCTCCTGTCTTTTTTTTACGATGAGTGCCTCTGCACCCGTGCTAGCATTCTTGGCGACGATGCATAGCTGCCTGGCTTGGACTCGTTAGGTATGGATGTCGCCTTTTCTTCACCGTTGCCATCAACGTAGGGTTGCTCTGCTTCGGCGCCTGGACTTTGGCACCTGCACCGTGGGTACCTGCGCATTTTGTGGAGCCTTTTTTGGTAGGCTTTTGTACCTCCGTCTGGTAGCGCTGCTCTTCAAGCGGTGCTCGCTAGTGAAATACCTTCGGCACAGCTCTATCGCCCTGTTGTTGGGGCTGAGAGTTCGGAAGCTATGCCCTTTGTCTCTCATGTGTCGTTGGGTCTCGAATGCGGATAGAGGGGCTGATCTTGCCATTCATCCTGGTAAAGTATGCCCCTCAGGTCCTCGTTCTGGAGAGCAGTGGTCAGAATCCGAAGACCGATGGGGGGGGAACAAGCTGGGGACTTCCCTCCGTCTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCTGACTTGTCGCGCGGTCGTAGATGCTGTAGGAGCCAATTTCTCCACCTCTACAGCATCGCTGCAGTCGATCAACGGCGGCTGGGGCCTGCGTGCTCACCCTTGCCACCGACGGGACCGAGATTCCGTCACCATGGGTCAGGTTACCGACTCCTCTGGTGGGGATCTCGAAAGTCGGAGCTCCTCCTGAACAGGTCGTTGCGATCAGGGGGACTGCCCCACTGCGCTGTCCATCCAGCTGAAGGATGGCCTAAGGTTACCCTGGGTCACGTAGGCCACGGATTTCCCCTGGCTTTACGGATGTGGAGGTTTGTACCGCCTCGACTCGGACACCAGAGCCTCTGCTTGAAGCACCAGCACGGTGAGAGGATGATATTTGGTCGTCACGACCTTTGTGCCTTTTCCCTTTCTTAAAGAGATTGCTCCCAGTTACCAGAATCAAATTAGAATTAGAGGTGATTAAATTTCAACGGCTTAATTTTAAATTTAATTTTGAATTTCACTACTGTCGCAACACAACACTGATCACACGGTTGATCTGGCAACGCCTCCACCTCTCAGATCGCCCGCTGCGCTATCAGCTGTTTATCCACTGCAACAATCATAAGATAATAAATTACCTATTTACATGAAACAGGCGCACAATTAACTCGCGTGATTGCAGCGCAGGGCTTATAGCGCGACTCCACCGTGTGATTTTGCCGGTTGCCGCACACACCGGCCGACACAGCTTCTATGGTTTCAGTATTTCGCCGCTGCGTAATTTAAGACGTCCGTCTTCGGCGATGTAGACTTGGTCTCCGCACCAGGATTGAGTGTCTAAGCCTGTGCGTTCGGGATTAAACTTTGGCAATACGACAGCATTGAGTTTTTTGGGTCTCTTTGTGAGGTTTTGCGCTTCTTTTTTTTAACAGTTCAGAAAAAATGGCGATTCTGCGACTCTAGAATTGTCAGCAAATTGTTTCACTATTGTAGTATGCACACATATCCGGTTAAGCACTGTACCTATGTGTATTCATAATTGTAGCACTCTGTTGCAATGTGTACATAAACAGTCCAGCACAAGTGTATACGTAATACGAGCACCCACTTGAGGGGCTAACATACATAATTGCCTGGTCAGCAGTTCTCCCGCTATTGAAAGCGCTGATCGCTTATATGTGTGCCTATACCACTCCTCCTCCAGCACCATCGCTCGGCGACAGTACATATATATACATATAAGATACTTATATAAGCGTTGCTGCGCTGCGAGCTGTAGCAGCGCTATCCCCGACAGGCTAGAAACCTTTGTATGTGAATCATAAGAGGATTGACGAATTAATTTCGAATGGGCAGGACCTTCCCTGTTCACTCAAATTGGGATCAAATAAAGAACAGCTAAAACACAAATGATCTATGACACAATGAAACTACAGGAAGTTGGAGTAGGCGGTCCCACTTCTGATGTCGGATCTGAATCACTTTATACTCGGCATCACTTTCTCTACAGCGGACACAAAGTAACGAAAACGGTCGTTAACTTGAAATTAAAAATAAATCTGCGACAAGTACGGTTTGTCAAGAAGCGTTTACACACCGTGAAATAAGATGAATTTTTTGATTTTAGCGGTCAAAAAATTAAGGGTTATTTGGCAATTAAACGCAATTTTTTTTTAGGAAATATAATTAAACAATATTTATTTACTTATAAATTAAAAAACAAATTCAAAATATCAAATATACAAGAGAAAATAAACAACGAATTCCAAGTTTAAACACTTTTGAGAGTTTCAAGAAACTCTTTACACAAAACACTAAACCTAAGTTTAATCTAAATTTTTTTAAATTATTTTGTTAAAATTTGAAAAGTTGTAGTATTTAGTATGACCCCATTGGCTTTGGCTACAAGTTGGAAAACTTTTTTCATGGAATGGATGAGTTTTTTTAGGTCATATTCAAGCGGGATCTTTTCCCACTCTATCGCAGCCATGAGCTGTTGTCGTGTTTTGGTACTTGCGCACTTTTTGCGTTCTTCTTTAAGTAGGCCCACAAATTTTCAATGGGGTTCAGATCAAGACTCTGAGGGGGCGTATCGATCACCTTACCACAGTTATAAAGGAGCCAGTTGCGTACATTGCACTCTTTATGTTTGGGATGTTGTCCTGATAAAACTTAAAATTTGACTTGTTGTTTGCTAAATAGACCAAATTTTTTCTGCACTGGCCTTCAAAATTTGATTTTAAAATATCTAGATATTGCACGGCATTCATGGTGCTTTCAATAAAGGCTAATTTGCCCACTCCATGGCTTGATACAGCCCAATCATCACTGATAATTTTCCAAATTTGATTGTTGGAATGATATTTTTTGTTTTTTCACAGCACACTCAACAGCTTGCGCCATACTCTGCTTGGCCCATCGTTATAATAGAGCATCATTTTAGCAATACGTAACCGCA
->9efeb571-1ec4-4395-b645-526de152aac4
-TTCGGTATGCTTCGTTCAGTTACGTATTGCTCGATGGGCCAAGCAGAGGTATGGCGCAAGCTGTTGAGTGCGCTAGAAAAAAACAAATATCATTCCAACAATCAAATTTGGAAAATTATCAGTGATGATTTGGGGCTGTATCTCAAGCCATGGAGTGGGCAAATTAGCCTTTATTGAAGCACTATGAATGCCGTGCAATATCTAGATATTTTAAAATCAAATTTGAAGGCCAGTGCAGAAAAAAATTTGGTCTATTTAGCAACAACAAGCCAAATTTTTAAAGTTTTATCGGGACAATGATCCCAAACATAAAGGTGCAATGTGCGCAACTGGCTCCTTTATAACTGTAGCAGAATTGATCATTACATCCCTCAGAGTCTTGATCACAGACCCCCATTGAAAATTTGTGGGCCTACTTAAGAAGAATGTGGCAAAAGGGGCGCAAAACACGACAACAGCTCATGGCTGCGATAGAGTGGGAAAAGATCCGCTTGAATATGACCTAAAAAACTCATCCATTCCATGAAAAAAAGCTTCAACTTGTAGCCAAAGCCAATGAGGTCGCTACTAAATACTACAACTTTTCAAAATTTTAACAAAATAATTTAAAAAAATTTAGGATTAAACTTAGGTTTAGTGTTTTGTGTAAAGAGTTTCTTGAAACTCTCAAAGATGTTTAAACTTGGAATTCGTTGTTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTAATTTATAAATGAAATAAATATTGTTTAATTATATTTCCTAAAAAAAATTGCGTTTAATTAAACAAACAACCACTTAATTTGACTACGTTAAAATCAAAAAATTCATCTTATTTCACGGTGTGTAAAACAGTTTCTTGACAAACTGTACTTGTCGCAGATTATTTTTTAATTTCAAGTTAACGACCGTTTCTGTTACTTTGTGTCCGCTGTAGAGAGTGATGCAGTATAAAGTGATTCGAATCCGACATCAAGTGGGACCGCCTACTCCCAACTTCCTGTAAGTTTCGTGTGTCATAGATCATTTGTGTTTAGCTGTTCTTTATTTGATCCAATTTGAGGAACAGGAAGGTCCGCTCATTCGAAATTAATTCGTCAATCCTCTTATGATCTACATACAAAGGTTTCTTAGCCTAAGTCGAGGCATGCGCGGCATAGCCTACAACGCAGCAACAACTATATAAGTATCTTATATATATGTATATATATATATGTACTGTCGCCGAACGATGGTGCTGGAGGAAGTGGTATAGGCACACATATAAGCGATCAGCCTTGGCCAGCAGGAGAACTGCTGACCAGGCAATTATGTATGTTAGCCCTCAAGTGGGTGCTCGTATACGTATACACTTGTGCTGGACTGTTTATGTACACATTGCAACAGAGTGCTACAATTATATGAATACACATAGGTACAGTGTAACCGATATGTGTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTAGAGTCGCAAGTCGCCATTTTCTGAACTGTTAAGAAATTTTGATAACGAAATTTGCAAAAAAAACTCAATGCTGTCGTATTGCCAAGTTTAATCCTAGAACGCACAGGCCAGACACTCAATCCTGGTGCGGAGACCAGTCTACATCGCCGTGAAGACGGACGTCTTAAATTTACGCGGCGCAGAATACTCGAAACCATAGAAGTTGTGTCGGCCGGTGTATTGCGGCAAACTGGCAAATCACACGGTGGAGTCGCGCCATAGTTCTGCGCGCTGCAATCACGCGAGTTAATTGTGCGCCTGTTTCATGTAAATAGGTAATTTATTATCTTGCGATTATTTGCAGCGGATAGAAGCAGCTGATAGCGCAGCGAGGAGCGATCTGGAGAGGGAGGCGTTGCCAGATCAACCGTGTGATCAGTGTTGTGTTGCGAAGCAGTAGGGCGCGAAATTCAAAATTAAATTTAAAATTAAGCCGTTGAAATTTAATTTAATTTAATTTTGATTCTGGTAACTGGAGCGCACAAGTCTTTAAGAAGGGGAAAAGGCACAAAGGTCGCGAGGACAGACCAAAATATCATCCTCTCACCGTGCTGGTGTTGCCTGGCAAGGGCTCTGGTGTCGAGTCGAGCGGTACAAACCTCCATCCGTAAAGCCGGGGAAATCCGTGGCCTACGTGACCCTAGGTAACCTTAGGCCATCCCTTCGGTTGATGGACAGCGCAGTGGGGGCAGTCCCTGATCGCAACACGACCCGTTCAGGGAGGAGCTCCCGGCTTTCGAGATCCCCACCAGAGGAGTCGGTAACCCGACCCATGGTGACGGAATCTCGGTCCCGTCGATGGCAAGGGGTGAGCACGCAGCTAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGGGTGGAAAGTGGCTCCTACAGCATCTACGACCGCGACAAGTCGAGAGACGATGGACCACATCGCCGTGCCATCGCAAAGACGGGAGGGGAAGTCCCAGCATTCCCCTCATCGGTTCCGGACTTATTACTGCTCTCAGAACGAGACCTGAGGAGCATACTTACCGGATGAATGCTTAAAGATCAGCCTTCTATCCGCACTTCGAGACCCAACGACACACATGAGACAAAGGGCACCAGCTTCCGAACTCTCAGCCCTTAACAACAGGGCGATAGAGGCTGTACGAAGGTACTACTAGCGAGCACCGCTTGAAGAGCAGCGCTACCCAGACGGAGGTACAAAGCCTACCAAAGGCTCCCACAAAATGCGCGAGTACCCACGGTGCGAGGTTATGAAGTCCAGGCGCCGAAGCAGAGCAACCCTACGTTGGATGGCAACGGTGAAGAAAAGGCGACATCCATACCTAGCGAGTCCAAACCGAGCAGCTATGCATCTGTCGCCAAGAATGCTAGCACGGGTGCAGAGGCACTCATCGTAAAAAGACAGGAGAGGCTTCGTACGCAGAGATGCTTCGGAAGCTAAGATCGGAATCAGGCCTTAGCGAACTGGGCAGTCACGTGCGAAAAATCCGGAGAGAACGCAGAAAGGTGATCTGTTGCTTGAGGTAGGGGAAAGCTTCGAGCGTTCCCAAGTTTAAGAGCGACCTGGAAGCGGCGCTCAATGACTTAACCTCTGTGCACTGGGGCGCAAAGAAATAGCTCTATCTTGCAGCGGATTGGACGAGGCTGCGGCAGCAGAAGCTCCACAGCTGCTTGGTCGCCCATTTCAGAACCTGCAGATAAATCCTGAAGATATCAGGGCCTTCGCAGTATGCGGAATTGCAAACAAACCAATAGCCTCAGTGCTGCTGGGAACGCGAACGTTGCGACAGCCAAACTGGAAGCACCATAATCGTTGGATGGTCAAGATGTCGTATCACCCAGGACGTCCGACCCACGAGATGCTACAGGTGTGCGGCTATGGGCATCGATCAGCAACCTGCAAAAGGACACTGACAGGGGCGAACTGCTGTCTTAGATGCGGTGAGCGTGGGCACAAGGCAAAGGGGTGCGTTGCTGCGCAAAATGCCTGATCTGCAGCAGCGGTGGACGAAGCTCACACCCGACGAATTGCTTTGCGTGCCCGACTTACAGAGCGACACCTAAAGATGCCAAGAGCCACCGCAGCAATGCACGCTCATATTAGCGTAGTACAGCTCAATGTCAATCATTGCGCAGCAGCTCAGAGCCTCTGGCCCAGACTGCGGTTGAGCGCAATGTGAACATCATGCTCCTAAGCGAACCCTACGTCTCTGGTGGTGGACAATCGTCCATGATCATGACGAGGCAGGTAAAAGCAGCTATCAAATGCTGCAGCTCTCTCAAGTCCAGGAACTGGCTGCTTTACCCATGCGGGGTATCGCTTATGCGAAGTTAAAACACGTGCACATGTACAGCTGCTACGCTCCGCCGAGCGGCACCCCGATCAGTTCGAGGGAGCTTCTGGAGGCGCTCGTGGACCATGCGAGGGCGAAGCCCGAAGGTCAATGCCGGCGACTTTAATGCCTGGACAGTGGAATGGGGCAGCAGGACATCAACACCAGAGGACTTGAGCTGTGATTGACGCCATGCGAATGCTGGACCTCATGCTGCTGAACGATGGACGGAAGCCGACGTTTAACAACGATAGGGGGTACGTCCTTTGGCCGGAATTACCTTTGTCAGCAGGGCTAGTAGACAACAACAACTGGATGAGTCCATGACGTCGCTGACGCTGAGCGACCATGCCCTGATCTCCTTCTCCCCGGGGTATGCCCAAAGACGGCAAGTAGAACCGGGAAAACGCTGGGACACCAGGAAGATCGATGAGGCCATGCTGGCCTATCAGATCAATTCCTGGAAATCCCAAATGTGGACAGAGAGTATGGCGGCAGGCCTCACATGGAATATGCTGGGAAGAATCTGCGACGCAATCATGCCAGGAAAAAATAAGGCACAGCGCAAACCACCCGTTTACTGGTGGAGTGCCTCCCTAAGCCAACTACGGTCTGATTGCCTCAGGGCTAAGAGAACGGCGCAACGAGCCAGAGGCGGTACCACCACGCGGAACTCTTGGAGGCTTTCAGAAGCAAAACGCCTAGAGTTCAAGCACGGCATCGCGGCTGCCAAAGCGCGGTCGTTTAAGGAGCTGCAGGATGGCGTAGGCAGCGATATCTGGGGCCTCACAAGCTTGTTACCAATGAGCTAAGGAGGAGAGCAGCAACCCCATCGACCAGGGGTCCTGGCTAACATACTAGGGGAGCTATTTCCAAAGCGAACCACACTATGGAGACCAGAGGCAGCCTGCCCCAGATTTCCGTGCGTCACAGAACTTGAAGTCGTCGAGGCAGCTGTTTCGCTGACGATGTGTGGTAATCACAACCGGGCTAGCAATAGCGGCTCACAAGACCGAAGCAGTCCTACTAAGCAGCAGGAAAAGATGGAGAACATGCTGGTCTCCGTCAAAGGGTACTCAGGGACCTCTCAAAGAGTCCCACAAAGTACCTGGGGGTAATGATAGATCGCAGACTATCGTTCAGGACCACGCACCGAGCTACACGCCAGCAAAGAGACAGCAGTCACATCCTCTTCGTTGGCGAGGCTTATGCTACCAACGTCGGAGGCCCAAGACACCCGGCAGAAACTGCTGGTGTGTCCATTAGCAAAACTTCGCTGCTATACGCTGCACCAGTCTGGAACAGTACCACTTGCAGGGTCTCATACCTGAAAGGCGTTCGGTGCTACGGTCAATGGCCCTCAGGCTCATTCAGAGGATTCGGGACCATATCCGAAAGGGCACTGGCGCGCCAACGCTGGCAGGCCTGCCGATTGATCTGGAGATCAAGGCTCTCAACCTTATGCGGAGTGGCGCTTCCAGGCAAGAGGCACACGAGTGGCTATTAGGTGAATGGCAGAGAGCAGATGGCAAACGTCGCGACGGGGGGAGAGTGGACCTATCAGCTCATCCAGAGATGACGGTTGGGCAAGTGACACTCTCAAAAGTGTGTAAACTTGGAATTTGTTATTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTAATTTATAAGTAAAATAAATATTGTTTAATTATATTTCTAAAAAAAATTGCGTTTAATTAAAGCAAATAACCCTTAATTTTGACCGTTAAAATCAAAAATTCATCTTATTTCACGGTGTGTAAGCAGTTTCTTGACAAACTGTACTTGTCCTGAATTTATTTTTTTTACCCCAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCACTTCTGAAGAGTGATGCCGAGTATAAAGTGATTCAGATCCGACATCAGAATTAAGGACCGCCTACTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTGTGTTTTAGCTGTTCTTTATTTGATCCAATTTGAGGAACAGGGAAGGTCCCGCGCTCCATTCGAAATTAATTCAGTCAATCCTCTTATGATCTACATACAAAGGTTTCTTGGCAGTCGAGGAGCAGCGCTGCCAAGCATAGCCTGCAGCGCAGCAACGCTTATATGCGTATCTTATATATATGTATATATATATATGTACTGTCGCTCCGAGCGATGGTGCTGGAGGAGAGTGGTATGAGCACACATATAAGCGATCAGCGCTTGGCCAGCAGGAGGAACTGCTGACCAGGCAATTATGTATGTTAGCCCTCAGAGTGGGTGCTCGTACATTACGTATACACTTGTGCTGGACTGTTTATGTACACGTGCAACAGAGTGCTACAATTATGAATACACATAGGTACGGTGCTTAACCGATATGTGTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTAGAGTCGCAGAATCGCCATTTTCTGAACTGTTAAAGAGGGTGCAAAGCACAAAGACCCAAAAAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCCTGAACGCACAGGCTTAGACACTCAATCCTGGTGCGGAGACCAAGTCTACATCGCCGTGAACGGACGTCTTAAATTACGCGGCGCGAAGTACTCGAAACCATGAAGTTGTGTCGGCCGGTGTGTGCGGCAAACTGGCAAAATCACACGGTGGAATTAGCGCCATAGTTCTGCGCTGCGGTAAATCCGCGAAGTTAATTGTGCGCCTGTTTCATGTAAATGGGTAATTTATTATCTTTGCGATTGTTGCAACCGGATAAAGCAACTGATAAGCGCAGCGGAGCGATCTGGAGAGGAGGCGTTTACTTGAATCCAACCGTGTGATCAGTGTTGTGTTGCGACAGTAGGGCGCGAAATTCAAGAATTAAATTTAAAAATTAAGCCGTTGAAATTTAATTTAATTTAATTTCCCCACGATTCTGGTAACTGGGGCGCACAAGAGTCTTTAAGAAAGGGGAAAAGACACAAAGGTCATGGACAGACCAAAATATCATCCCTCTCACCGTGCTGGTGCCTAAGCAGAGGCTCTGGTGTCCGAGTCAGAGCATTTCCGAAACCTCCATCCGTAAAAGCCAGGAAATCAAGTGGCCTACGTGACCTAGGTAACCTTAGGCCATCCTTCGGTTGATGGACAGCGGTGGGGGCAGTCCCCTGATCGCAACGACCCGTTCGGGAGGAGCTCCCGACTTGAGATCCCCCCACCAGAGGAGTCGGCCGAGCCCATGGTGACGGAATCTCCGGTCCCGTCGGTGGCAAAGGGGTGAGCACGCAGGCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGAGGTGGAGAAAATTGACTCCTACAGCATCTACGACCGCGACAAGTCGAAGACGATGGACCACATCGCCGTGCCATCGCAAAAAGACGGGAGGAAGTCCCCAGCTGGTTCCCCTCATCCCGGTCTTCGGACGACCACTGCTCTCCAGAACGAGGACCTGAGGGCATACTTACCAGGATGAATGGCAAGATCAGCCCCCTTCTATCCGCATTCGAGACCCAACGACACATGAGAGACAAAGGCATGGCACCGAACTCTCAGCCCTTAACAACAGGGCGATAGAGCTGTACGAAGGTACTACTGCTTGGTACCGCTTGAAGAGCAGCGCTACCAGACGAAGGAGGTACAAAGCCTACCAAAAGGCTCCACAAAATGCGCAGGTACACCCACGGTGCGAGATTGCCAAAGTCCAGGCGCCGAAGCAGAGCAACCCTACGTTGGATGGCAGCGGTGAAGAAAAAGGCGACATCCATACCTAACGAAAGGTCAAGCCAGGCAGCTGGCATCTGTCGCCAAGAATGCTAGCACGGGTGCGGGGGCACTCATCGTAAAAAAAAAAGACGGGAGAGGCTTCGTACGCAGAGATGCTTCAGGCTAAGATCGGAATCGAGCCTTAGCGAACTGGGCTTGATCACGTGCGAAAAAATCCGGAGAACGCAGAAAGGTGATCTGTTGCTTGAGGTGAGGGAAAGCTTCGGAAAGCGTTCCCAAGTTTAAACGACCTGGAAGCGGCGCTCAATGACTTCAGCCTCTGTGCGCACAGGAGCGCAAAGAATAGCTCTATCTTGCAGCGGATTGGACGAGGCTACGGCTAACAGAAGCTCCACAACTGCTTGGTCGCCCAATTCAGAACCTGCAGATAAATCCTGAAGATATCAGGGGCCTTCGCAGTATGTCACCGGAGATTGCAAACAAATAGCCTCAATGCTGCTGAACGCGAACGTTGCGATACCAGTCCTTAAACGGGGCACCATAATCGTTGGATGGTCAAGATGTCGTATCACCCAGGACGTCCGACCCACGGATGCTACAGGTGTCTCGGCTATGGGCATCGATCCAGCAACCTGCAAAAGGACACTACGACAGGGCAGACTGCTGTCTTAGATGCGGTGAGCGTGGGCGCAAGGCAAAGGGGTGCGTTGCTGCACCAAAATGCCTGATCTGCAGCAGCGAGGTGGACGAAACCACCCGACGGGTAGCTTTGCGTGCCCGACTTACGAAACGACACTAAAAGATGCCAAGAGCCACCTTAATGCACGCTCATATTGGCGTAGTACAGCTCAATGTCAATCATTGCACCCGGCGCTCAAACCTCCTGGCCCAGACTGCGGTTGAGCGCAATGTAGACATCATCTCCCTAAAAGCGAACCTACGTCTCTGGTAGTGGACAATCGTCCATGATCCTTGACGAGGCAGGTAAAAGCAGCTATCAAATGCGCAGCTCTCAAGTCCAGGAACTGGCTGCTTTACCCATGCGAGTCAGCTTATGCGAAGTTAAAACACGTGCACATGTACAGCTGCCACGCTCCGCCGAGCGACACCCCGATCAGTTCGAGGGCTTCTGGAGCGCTCGTGGACCATGCGAGAGGGCGAAGCCCGAAGGTCCGTACCGGCGACTTTAAATGCCTGGACAGTGGAATGGGGCAGCAGGACATCAACACCAGAGGACGAGCTGTGATTGACGCCATGCGAATGCTGGACCTCATACTGCTGAACGATGGACGGAAGCCGACGTTTAACAACGATAGGGGTACGTCGCTTTATTGACGTTACCTTTGTCAGCAGAGGGGCTAGTAGACAACAACAACTGGATGGTCCGCTGACGTCATGACCTTTAGGCGACATGCCTGATCTACTTCTCCCGGAGGAGCATGCCCAAAAGACGGCAGAGTAGAACAGCGGAAAACATGGGACACCAGGAAGATCGATGAGGCCATGCTGGCCTATCAGATCAATTCCTGGAAATCCCAAATGTGGACGCAGAGAGTATGGCGGCAGGCCTCATGAATATGCTGGGAAGAATCTGCGACACCAATCATGCCAGGAAAAAATAAGGCACAGCGCAAACCCGCCCGTTTGGTGGAGTGCCTCCCTAAGCCAACGCTACGGTCTGGTGCCTCAGGGCTACAAGAGAACGGCGCAACAACGAGCCAGGGCAGTACCCACCGCACGCGGAACTCTTGGAAGCTTTCAGAAACAAACGCCTAGAGTTCAAGCACGGCCATCACTTGGCTGCAAAGCGCGGTCGTTTAAGGAGCTGCAGGATGGCGTGAGCCGGCGATATCTGGGGGCCTCGCCACAAGCTTGTTACCAACGAGCTGGGGAGGAGAGCGGCAACCCATCCGACCCGGGGGTCCTGGCCTTTAACATACTGGGGAGCTATTTCCAAAGCAGACCACACTATGGAGGCCAGCAGAGGCAGCCCTGCCCCAGATTTGCCGTGCGTCACAGAACTTGAAGTCGTCGAGGCAGCTGTTTCGCTGACGATGTGGCAATCACAGCCGGGCTAGCAATAGCGGCTCAAGACCGAAGCAGTCCTACTAAGCAGCAGGGAAAAGATGGAGAGCATGCTGGTCTCCGTCAAAGGTACTCGGGGACCTCTCAAGAGTCCCTAAGGTACCTAGGGGGCATCGATAGATCGCAGACTATCGTTCAAGGACCACGCGAGCTGCCAGCAAGAGAAGACAGCAGTCACATCCTCTTCGTTGGCGAGGCTTATGCCACCAACGTCCGGAGGCCCAAAGGGCACTGGCCAGGAAACTGCTGGTGTCAATGCCGAGGGCACAGCGCTGCTCGCTGCACCAGTCTGGAGCAATGATGCCACTTGCAGGGTCTGCCATACCTGAAAGGAGGAGCTCGTTCAGGTGCTACGGTCAATGGCCCTCAGGCTCATTGATAGAGGATTCAGGACCATATCCGAAGACGCGGCGCTAGCGCCAGCAGGCCTGCCGATTGATCTGGAGATCAAGGCTCTCCAGCCTTATGCGGAGTGGCGCTTCCGGGCAAGAAGGCACACGAGTGGCTATTAGGTGAATGGCAGAGCAGATGGCAAACGTCGCGACGGGGGGAGGGTGGACCTATCAGCTCATCCCAGAGAGATGACGGTTTTGGGCAGTGAGCGCCAAAAGTGTGTAAACTTGGAATTTGTTATTTATTTTCTTTGTATATTTGATATTTTTTGAATTTGTTTTTTAATTTATAATTAAAATATATATTGTTTGAGTATATTTCCTTAAAAAAAATTGCGTTTAATCCAAACAAATAACCGTTAATTTTGACCTTTAAAGTCAAAATTCAACTTATTCACGGTGTGTAAACAGTTTCTTGACAAACTGTACTTGTCGCAGATTTATTTTTTAATTTCAAGTTAGCAATGCGTAATA
->abf861f2-286c-4b4d-9214-6f7b989e1f32
-TTAAAACTGCTTCGTTCAGTTACATTATTGCTCCTTTCTTGGGAGCTTGTGCGCTCCCAGTTACCAGAATCAAAATTAAATTAAATTAAATTTCAACGGCTTAATTTTAAATTTAATTTTGAATTTCACCACCTACTGTCGCAACACAACACTGATCACACGAGGTTGATCTGGCAACGCCTCCCTCTCCAGGAATGCGCCCGCTGCGCTTTATCAGCTGTTTATCCGCTGCAACAATCATGAGATAATAAATTACCTATTTACATGAAACAGGCGCACAATTAACTCGCGTGATTGCAGCGCAGAACTGTGGCGCGAACTCCACCGTGTGATTTTGCCAGTTTGCCGCACACACCGGCCGACACAACTTCTATATGGTTTCGAGTATTTCGCCGCGTAGTGATCGATCTTCACGGCGATGTAGACTTGGTCTCCACGCACCAGGATTGAGTGTCTAAGCCTGTGCGTTCAGGATAAACTTTGGCAATACGCGACAGCATTGAGTTTTGGGTCTCTTTGTGGTTTTGCGCTTCTTTTAACGGTTCAGAAAATGGCGATTCTGCGACTCTGGAATTGTCAGCAAATTGTTTTCACTATTGTGGTATGCACATATCGGTTAAGCACTGTACCTATGTGTATTCATAAATTTGTAGCACTCTGTTTGCAATTATTGTACATAAACAGTCCAGCACAAGTGTATGCATGCGACGCCCAGCGGGCTAACATACATATTTGCCGCGGTCAGCAGTTCTCCCGCTGGCCAAGCATCGATCGCTTATAATGTGTGCCTATACCACTCCTCCTCCAGCACCATCGCTCGGCGACCACGATATATATATGCATGCATATAAGATACGCATGTAAGCGTTGCTGCGCTGCAGAAGACTATGCCGGCAGCGCTGCTCCTCGACAGGCTAAGAAACCTTTGTATGTAGATCATGGAGGATTGACGAATTAATTTCGAATGGGCGGGACCTTCCTGTTCCTCAAATTGGATCAAATAAAGAACGGCTAAAGGCACAAAATGATCTATGACACAATGAAACTACAGGAAGTTGGAGTAGGCGGTCCCACTTCACGATGTCGGATCTGAATCACTTTATACTCGGCATCACTCTCTGCAGCGGACACAGAAGTAACGGAAACGGTCGTTAGCTTGAAATTAAAAAATAAATCTGCGACAAGTACGGTTTGTCAAAGAAACTGTTTACACACCGTGAAATAAGATGAATTTTTTGATTTTAACGGTCAAAATTAGGGTTATTTGCTTAATTAAACGCAATTTTTTTTTAGGAAATATAATTAAAACGGCGCCTTTATTTTACTTATAAATTAAAAAAACAAATTCAAAATATCAAATATACAAAGAAAATAAATAACAAATTCAAGTTTACACTTTTGAGGAGTGTCACTTTCTGCCCAAACCGTCATCTCTGGGATGAGCTGATAGAGTCCACCTCCCCCCGTCGCGACGTTTTGCCATCTGCTCTGCCATTCACCTAATAGCCACTCGTGTGCTCTTGCCACGGAAGCGCCACTCCGCATAAGGCTGAGCCTTGATCTCCAGATCAATCGGCAGGCCTGCCAGCGCTAGCACCGCGTCTTCGGATATGATTCTGAATCCTCTAATGAGCCTGGGGCCATTTGGCCCGTAGCACCAGACAGGCTCCTTTCCGGGTATGAGACCCTGCAAGTGGCATTTGCTCCAGACTTCAGTTGCAGCGTATAGCAGCGAAGCCTTTGCTACTGACACCAACGGTTTCCTGGCCGGGTGTCTTGGGCCTCCGACGTTGGGCATAAGCCTCGCCAACGAAGGATGTGGGCTGCTGTCTTCTTGCTGGCGTAGCTCGCGGTCCTTGAACGATAGTCTGCGATCTATCATTACCCCAGGTACTTTAGGGACTCTTGAGAGGTCCCCACGAAAGTACCCAACAGGCGGAGACCAGCATGTTCTCCATCTTTTCCTGCTGCCGTGGGGACTGCTTCGGTCTTGTGAGCCGCTATTGCCTGACGGCTGTGATTGCCACATCGTCAGCCCGAAACAGCTGCCTCGACGACTTACCGAGTTCTGTGACGCACAGGGGAAATCTGGGGCGGGGGCTGCCTCTGTTGGCCTCCCATGGTGTGGTCTGCTTTGGAAATAGCTCCCTAGTATGTTAGCCAGGACCCCGGGGTCCGGATGGGGTTGCCGCTCTCCTCCTTAGCTCGTTGGTAACAAGCTTGTAGGCGGGGAGCCCCAGATATCGCTGTCTACGCCATCCTGCGGCTCCTTAAACGACCACCGCGCTTTTGGCAGCCGCGGTACCGTGCCGGAACTCTAGGCGTTTGCTACGAAACCGAGTTCGCGTGGTGGAATTACTGCTACTCTGGCTCGTTGCGCCGTTCTCTTAGCCCTGAGGCAATCAGACCGTAGTTGGCTTAGGGAGGGCACTCCGCAGTAAACGGGTGGTTTGCGCTGTGCCTTATTTTTTCCTTGGCATGATTGCGTCGCAAGATTCTTCCCAGCATATTCATGAGGCCTGCCGCCATACTCTCTGCGTCCACATTTGAGTTTGGGAATTGATCTGATGAGCCAGCATGGCCTCATCGATCTTCCTGAATTGTCCAGCATGTTTTCCAACTGTTCTACTCTGCCGTCTTTTTTGGGCATGCCCTCCGGGAGGAGATCAGGGCATGGTCGCTCAGCGTCATGACGTCATGGACCATCAGTTGTTGTTGTCTACTAGCCCTCTGCTGACAAAGGGTAACGTCAATAAAGGACGTACACCCCTATCGTTGTTAAACGTCGGCTTCCGTCCATCGTTCAGCAGTATGAGGTCCAGCATTCGCATGGCGTCAATCACAGCTCGTCCTCTCTGGTGTTGGATGTCCTGCTGCCCCATTCCACTGTCCGGGCATTAAAGTCGCCGTGACCTTCGGGCCCGCCCTCTCGCATGATCCCACGAGCGCCTCCAGAAGCTCCTCCGAACTGATCAGGGGGGTGTCGCTCGGCGGAGCAGTAGCAGCTAACCCACGTAATGCACGTGTTTTTAACTTCTGGCATAAAGCGATACCCGCATGGGTAAAGCAGCCAGTTCCTGGACTTGGAGAGCTGCAGCATTTGATAGCTGCTACCTGCCTCGTCAGGATCATGGACGATTGTCACTACCAGAGACGTGAGGTTCGCTTAAGACATGATGTCTACATTGCGCTCAACCGCGGTCTGGGCCAGGAGGCTCTGAGCTGCTGCAATGATTGACATTGAGCTGTACTACGCTAATATGAGCGTGCATTAAAGGTGGCTCTTGAAAATGGCGTTGGTGTCGCTTTCTGTAAGTCCGGGCACGCAAAGCTACCCGTCGGGTGGTTTCACAATCCCACCTCGCTGCTAAGATCAGGCATTTTGGTGCAGCAACGCACCTTTGCCTTGTGCCCACGCTCACCCTCTAAGACAGCAGGTGCCCTGTCAGTGTCCCTTGCGGTTTGCTGATCGATGCCCATAGCCGAAGACACCTGTAGCATCTCGTGGGTCCGGACGTCTGGGTGATACGACATCTTGACCATCCAACGATTATGGTGCCTGTTTAGGGACTGGGTATCGCAACGTTCGCGTTCAGCGGCACTGAGGGCTATTTGCTTGCAATTCCGCATACTGCGAAGGCCCCTGATATCTTCAGGATTTATCTGCAGGCCCTGGAATTGGGCGAGCCAAGCAGCTGTGGAGCTTCTCTGCTGTCGTAGCCTCGGTAATCCGCTGCAAGATGAATATTCTTTGCGCTCCTGTTACGCACAGAATAGAATCATTGAGCGCGCCGCTTCCAGGTCGCTCTTAAACTTGGGAACGCTTTCCGAAGCTTTCCCCTCTACCTCAAGCAACAGATCACCTTTCTGCGTTCTCGGATTTTCGCGCGGCAGGCTACCCAGTTCGCTAAGGCTCGATTCCGATCTTAGCTTCCGGAAACTCTCTGCGTACGAAGCCTCTCCTGTCTTTTACGATGAGTGCCTCTGCACCCGTGCTAGCATTCTTGGCGACAGATGCGCGCTGCCACAAGCGGACTCGTTAAGGTATGGATGTCGCCTTTTTCTTCACCGTTGCCATCCAACGTAGGGTTGCTCTGCTTCGGCGCCCGTGGACTTTGGCACCTGCACCGTGGGTACCTGCGCATTTTGTGGGCTTTTTGGTAGGCTTTTGTACCTCCGTCTGGTGCTGCTCTCTTCAAGCGGTGCTCGCTAGTAGTACCTTCATGCAGCTCTATGCCCTGTTGTTAAAGGGCTGAGAGTTCAGGGGAAGCTATGCCCTTTGTCTCTCATATTGTGTCGTTGGGTCTCGAATGCGGATAGAAGGGGCTGATCTTGCCATTCATCCTGGTAAATTATGCTCAGGTCCTCGTTCTGGAGAGCAGTGGTCAAGTCCAGAGACCGGTAAGGGGAACAAACTGGGGACTTCCCTCCCGTCTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCTGACTGTCGCGGTCGTAGATGCTGTAGGGAACCAATTTCTCCACCTCCACAGCATCGCTGCAGTCGATAGTCAACGGCGGCTACAGGGGGCCTGCGTGCTCACCTTGCCACCGACGGGACCGAGATTCCGTCACCATGGGTGGGGTTACCGACTCCTCACAGTGGGGGATCTCGAAGTCAGCTCCTGAACGGGTCGTTGCGATCGGGACTGCCCCTACTGCGCTGTCCATCAACTGAAGGATGGCCCTGGGTTACCCTAGGTCACGTAGGCCACAGTTCCCCTGGCTTTTTTACGGATGGAGGTTTGTACCGCCCCTCGACTCGGACACAGAGCCTCTGCTTAGGCACCAACGGTGAGAGGGATGATATTTGGTCTGTCCGCGACCTTTGTGCCTTTCCCCTTTCTTAAAGACGTACGCTCCAGTTACCAGAATCAAATTAAATTAAATTGCAAATTTCAGCTTGGTACAAATTTAATTTTGAATTTCAACGCCCTACTGTCGCAACACAACACTGATCACACGGTTGATCTGGCAGCGCCTCCCTCTCCAGATCGCCCGCTGCGCTATCAGCTGTTTATCCGCTGCAACAATCCCGCAAGATAATAAATTACCTATTTACATGAAACGGGCGCACAATTAACTCGCGTGATTGCAGCGCAGAACTATAGCGCGACTCCACCGTGTGATTTTGCCAGTTTGCCGCACACCAGCCGACGCCCACAACTTCTATGGTTTCGAGTATTTCCAGCGCCGCGTTAAGACGATCCGTCTTCGGCGATGTAGACTTGGTCTCCGCACCAGGATTGAGTGTCTAAGCCTGTGCGTTCAGGATTAAACTTTGGCAATACGACAGCATTGAGTTTTGGGTCTCTTTGTAGGTTTTGCACTTCTTTTAACAGTTCAGAAAAAAATGGCGTTCTGCGACTCTAGAATTGTCAGCAAATTGTTTCACTATTGTGAGTATGCACACATCGGTTAAGCACTGTACCTATGTGTTAATTCATAATTGTAGCACTCTGTTGCAATATTGTACATAAACAGTCCAGCACAAAGTGTATACGTAATACGAGCACCCACTTGAGGGGCTAACATACATAATTGCCTGGTCAGCAGTTCTCCCGCTGGCCAAGCTGTGATCGCTTATATATTGTTGCCTATACCACTCCTCCTCCAGCACCATCGCTCGGCGACGGTACATATATATATACATATATATAAGATACGCATATAAGCGTTGCTGCGCTACGAATATACCGAGCAATACGTAACTGGCA
->287e01ea-2dc0-44e6-8aeb-4c0016656c11
-TTGTTGTACTTCGTTCAGTTACGTATTGCTGTCCACATTTGGAGTTCCAGGGGAATTGATCTGATAAGCCAGCATGGCCTCATCGATCTTCCTGGTGTCCCATGTTTTCCCGGCTGTTCTACTCTGCCGTCTTTTGGGCATACCCTCCAGGGAGGAGATCAGGGGCATGGTCGCTCAGCGTCATGACGTCATGGACCATCCAGTTGTTGTTGTCTACCCCAGCCTCTGCTGACAAAGGTAACGTCAATAAAGGACGTACCCTATCGTTGTTAAACGTCGGCTTCCGTCCATCTGGAACGGCAGTATGAGTTCCGTATTCGCATGGCGTCAATCACAGCTCGTCCTCTCTGGTGTTGGATGTCCCTGCTGCCCCATTCCACTGTCCAGGCATTAAAGTCGCCGGCAATGACCTTCGGGCTTCGCCCTCTCGCAGGTCCACGAGCGCCTCCAAGAAGCTCCTCGAACTGATCCGGGGTGTCGCTCTGGCGGAGCGTAGCAATATGCATGGCGTGTTTAGCTTCATAAGCGATACCCACCCGCATGGGTAAAACGGCCAGTTCCTGGACGGAGAGGCTGCAGCATTTGATAGCTGCTTTACCTGCGCAAAGTAGGGTCATGGACGATTGTCCACTACCAGAGACGTAGGGTTCGCTTAGGAGCATGATGTCTGTGCGCTCAACGCAGTCTGGGCCAGGAGGCTCTGAGCTGCTGCGCAATGATTGACATGAGCACAATACTACGCTAATATGAGCGTGCATTAAGGTGGCTCTTGGCATCTTTTAGTGTCGCTCTGTAAGTCGGGCGCGCAAGCACCCGTCGAATTGGTTTCTGTGTCCACCTCGCCCTTACCAGATCCAGGCATTTTGGTGCAGCAACGCACCTTTGCCTTGTGCCCACGCTCACCGCATCTAACAAGACAGCAGTCCTGCCCTGTCAGTATGCTTGCAGGTTGCTTTAGATCGATGCCCATAACCGAGACACCTGCTGGCATCTCGTGGGTCGGACGTCCTGGGTGTTACGACATCTCCGACCGTCAGCGATTATGGTGCCCTGTTTGGGACTGGTATCGCAACGTTCGCGTTCAGCAGCACTGGGCTATTTGCTTGCAATTCCGCATACTGCAGAGGCCCCTGATATCTTCAGGATTTATCTGCGGAGGAGCCCACTGGAATTGGGCGATAACTGGCTGTGGGCTTCTCTCTGCTGTCGTAGCCTCGTCAATCCGCTGCAAGATAGAGGCTATTCTTTGCGCTCCTGTGCGCACAGAGCCAAGTCATTGAGCGCCGCTTCCAGTGCTCTTAAACTTGGAACAGCGAGCTTTCCCCTCTACCTCAAGCAACAGATCACCTTTCTGCGTTCTCCAGTTTTCGCACGTGACTGCCCAGTTCGCTAAAGGTTGATCTTAGCTTCCGAAAACGCATCTCACCATTGCAAGCCTCTCCTGTCTTTTACGATAGTGCCTCTGCACCCGTGCTAGCATTCTTGGCGACAGATGCATAGCTGCCTGGCCCAGACTCGTTAGACCTGGATGTCGCCTTTTCTTCACCGTTGCCATCCAACGTGGGGTTGCTCTGCTTCGGCGCCTGGACTTTGGCACCTGCACCGTGGTTGCACCTGCGCATTTGTGGAGCCCAACTTTTTTGGTGAGCTTTGTACCTCCGTCTGGGTAGCGCTGCTCTTCAAGCGGTGCTCACTGAAATGCGTGCGCACAAGTACAGCTCTATCGCCCTGTTGTTGGGGCTGAGAGTTCGGAAGCTATGCCCTTTGTCTCATGTGTCGTTGGGTCTCGAATGCGGATAGGGGCTGATCTTGCCATTCATCCTGGTAAGTATGCCCCTCAGGTCTCGTTCTGGAGAGCAGTGGTCAAGTCCGAAGACCGATGGGGGGGAACCAGCTGGGGACTTCCCCTCCGTCTTTTGCGATGGCACGGCGATGTGTCCGTCTTCTGACTGTCGCGGTCGTAGATGCTGTAGACCAGTTCCACCTCTACAGCGTAGCTGCAGTCGATAGTCAACGGCGGCTGGGGGCCTGCGTGCTCACCCTTGCCACCGACGGGACCGAGATTCCGTCACCATGGGTCGGGTTACCGTCTCACTCTGGTGAAGGGGATCTCGAAAGTCGGAAGCTCCCCTCCTGAACGGGTCGTTGCGATCAGGGGACTGCCTGCGCTGTCCATCAACTGAAGGATGGCTAAAGGTTACCCTAGGTCACGTAGGCCACGGATTTCCCCTGGCTTTTACGGATGGAGGTTTGTACCGCCTCGACTCGGACTACCAGAGCCTCTGCTTAGGCACCAGCACGGTGAGAGGATGATATTTGGTCTGTCCGCGACCTTTTGTGCCTTTCCCCTTTCTTAAAGACTTGTGCGCTCCCAGTTACCAGAATCAAAATTAGAATTAAATTAAGAGATTTCAACGGCAATTTTAAATTTAATTTTGAATTTCGCGCCCTACTGTCGCAACACAACACTGATCACACGGTTGATCTGGCAACGCCTCCCTCTCCAGATCGCCCGCTGCGCTATCAGCTGTTTATCCGCTGCAACAATCGCAAGATAATAAATTACCTATTTACACATGAAACAGGCGCACAATTAGCTTCGCGTGATTTGGCGCAGAACTATCGGCGCGACTCCACCGTGTGATTTTGCCAGTTTGCCGCACACACGCAGCCGACACAACTTCTATGGTTTCCAGTATTTCGCGCCGCGTAATTTAAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCCACGCAGGATTGGTGTCAAGCCTGTGCGTTCAGGGGATTAAACTTTGGCAATACGACAGCATTGGCGAGTTTTTTGGGTCTCTTTGTGAGTTTTGCACTTCTTTTAACAGTTCAGAGAAAATGGCGATTCTGCGACTCTCTAGAATTGTCAGCAAATTGTTTTCACTATTGTGGTATGCACACATATCGGTTAAGCACTGTACCTATGTGTATTCATAATTGTAGCACTCTGTTTGCAATGTGTACATAAACAGTCCAACACAAGTGTATACGTAATACGAGCACCCACTTGAGGGCTAACATACATAATTGCCTGGTCAGCAGTTCTCCCGCTGCGGCCGGCGCTGATCGCTTATATGTTATACCACTCCTCCTCCAGCACCATCGCTCGGCGACAGTACATATAACCTTATACATATATAAGATACGCATATAAGCGTTGCTGCGCTACAGACTATACCACCGGCAACGCTGCTCCTCGACTTAGGCTAAGAAACAACGTATGTGAATCATAAGAGGAGGGATTGACGGGTAATTTCGAATGGGCGGGACTTCCCTGTTTACTCAAATTGGATCAAATAAAGAACAGCTAAAACACAAATGATCTATGACACAATGAAACTACAGGAAGTTGGAGTAGGCGGTCCCACTTCTGATGTCCGGATCTGAATCACTTTATACAAGCATCCTCTCTACAGCGGACACAAAGTAACGAGAAAACGGTCGTTAACTTGAAATTAAAAATAAATCTGCGACAAAGTACAGTTTGTCAGAAACTGTTTACACACCCGTGAAATAAGATGAATTTTTGATTTTAACGGTCAAAATTAAGGGTTATTTGCTTGGTAAGCGCAATTTTTTTTTAGGAAATATATAATTAAACAGCTATTTACTTATAATTAAAAACAAATTCAAAATATCAAATATACAAGAAAATAAATAACAAATTCCAAGTTTACACACTTTTGAGTGTCCTCTGCCCAAACCGTCATCTCTGGGATGAGCTGATAGGTCCACCTCCCCCGTCGCGACGTTTGCCATCTGCTCTGCCATTCACCTAATAGCACTCGTGTGCCTCTTGCCTGGAAGCGCCACTCCGCATAAGGCTGAGAGCCTTGATCTCAGATCAATCCGGCAGGGCCCTGCCAGCGCCCAGCGCCGCGTCTTCGGATATGGTCCTGAATCCTCTAATTGACCTGAGGGGCCATTGACCGTAGCGAACGAGCTCCTTTCGAGTATGAGACCCTGCAAGGTGGCATTGCTCCAGACTGGTGCAGCGTAGCAGCGAAGCCTTTGCTACTGACACCAACGGTTTCCTGGCGGGTGTCGCGGGCCTCCGACGTTGAATAAGCGCATAGCAGAAAATTTTGGCGTAGCTCGCGTGGTCAGCAGACGATAGTCTGCGATCTATCGTACCCCAGGTACTTTAGGGACTCTTGAGGTCCCCTGAGTACCCTTGACGGAACCAGCATGTTCTCCATCTTTCCTGCTGCCCAGTAGGACTGCTTCGGTCTTGTGAGCCGCTATTGCTAGCCAGCGTGATTGCCACATCGTCAGCAGAAACCTTGGCTGCCTCGACGACTTCAAGTTCTGCCAGCTGACGCACGGGAAATCTGGGGCGGGGCTGCCTCTGTTGGCCTCCATAGTGTGGTCTGCTTTGACCAGCTCCCCTAGTATGTTAGCCAGGACCCCGGGTCGGATAGGTTACCGCTCTCCTCGCGGCTGGGTTGGTAACAAGCTTGTAGGCGAGGCCCCAGATATCGCTGTCTACGCCATCCTGCAGCTCAGCAAACGACCACGCGCTTTTGGCAGCCGCGATGCCGATGCTTGAACTCTGACGTTTGCTTCTGAAACCTCAAGAGTTCCGCGTGGTGGTACTGCTCTGGCTCGTTGCGCCGTTCTCTCTTAGCCTGAGGGCAATCAGACCGTAGTTGGCTTAGGAGGCGGCACTCCACCACCAGTAAACGGGTGGTTTGCGCTGTGCCTTATTTTTCCTTGACATGATTGCGTCGCAGATTCTTCCCAACATATTCATGAGGCCTGCCGCCACTACTCTCTGCGTCCCACATTTAGGTTCCAGGAATTGATCTGATATAGGCCAGCATGGCCTCATCAATCTTCCCTGGTGTCCCATGTTTTCAACTGTTCTACTCTGCCGTCTTTTGGGCACCTCCGGGGAGAAGGAGATCAGGGCATGGTCGCTCAGCGTCATGACGCGTCATGGACCATCGGAGTTGTTGTTGTCTACTAGCCCTCTGCTGACAAAGGTAACGTCAATACGCAAGGACGTACCCTATCGTTGTTAAACGTCGGCTTCCGTCCATCGTTCCGGCATTATGAGGTCCAGCATTCGCATGGCGTCAATCACAGCTCGTCCTCTGGTGTTGGATGTCCTGCTGCCCCATTCCACTGTCCAGGCATTACAAAGTGCGCCGGCAATGACCTTCGGGCTTCGCCCTCTCGCATGGTCCACGAGCGCCTCGAAGCTCCTCGAACTGATCGGGGTGGTAAACAAGCGAAGACATGCGCAGCTGTACATGTGCACGTGTTTTAACTTCGCATAAGCGATACCCGCATGGGTAAAGCAGCCGGTTCTGGACTTGGAGAGCTGCAGCATTTGATGGCTAGCACCTGCCTCGTCAAGGATCATGGACGATTGTCCACTACCAGAGACGTAGGGTTCGCTTAGGAGCATGATAATCTGTTGCGCTCAACGCAGTCGGCCAGGGAGGCTCTGAGCTGCTGCGCGATGATTGACGATGAGCTGTACTACGCTAATATGAGCGTGCATTAAAGGTGGCTCTTGGCATCTTTTGGTGTCGCTCTGTAAAGTCGGGCGCGCAAAGCTACCCGTCGGGTGGTTTCTGTCCCACCTCGCTGCTGCAAGATCAGGCATTTTAGTTGCAACAACGCACCCCTTTGCTGACATGCTGACCATCAACGATTATGGTGCCCTGTTTAGGACTGGTATCGCAACGTTCGCGTTCAGCGGCACTGAGGCTATTTGCTTGCAATTCCGCATGCTGCTTGAAGGCCCTGATATCTTCAGGTTTATCTGCAGGCCCACAGGTGGGCGACCAAACGGCTGTGGAGCCTGCTGTCATGGCCTCGTCCAATCCGCTGCAAGATAGAGCTATTCTTTGCGCTCCTGTGCGCACAGAGGCCAGATAATTTGAGCGCCGCTTCCAGGTCGCTCTTGAAAGCTTAGGAACGCTTTCCGAAGCTTTCCCTCTACCTCCAAGCAACAGATCACCTTTTCTGCGTTCTCCGGATTTTCGCACGTGACTGCCCAGTTCGCTGGAAGTCGATTCCGATCTTAACCCAGCTTCCGAAGCATCTCTGCGTACGAAGCCTCTCATCTTTTTTTTTTACGATGGTGCCTCTGCACCCGTGCTAACATTCTTGGCGACAGATGCGCGGCTGCCTGAAGGCGGTCGTTAATTTATGGATGTCGCCTTTTCTTCACCGTTGCCATCCAACGTAGGGTTTGCTCTCTGCTTCGACGCCTGGACTTTGGCACCTGCACCGTGGGTACCTGCGCATTTTGTGGGCCTTTTTTGGTAGGCTTTTGTACCTCCGTCTGGGTGCTTGCTCTTCGAAGCGGTGCTCGCTAGTAGTACCTTCGTACAGCTCTATCGCCCTGTTGTTGGGGCTGAGAGTTCGGAAGCTATGCCCTTTGTCTCACCATGTGTGTCGTTGGGTCTGTGAATGCCCCGGATGAAGGGGCTGATCTTGCCATTCATCCTGGTAGGAAGTATACTTTCAGTTATCGTTCTGGAGAGCAGTGGTCAAGTCCGAAGACCGATGGGGAACAAGCGAGGCTTCCCTCCCGTCTTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCTGACTTGTCGCGGTCGTAGATGCTGTAGGAGCCAATTTCTCCACCTCTAAAGCGCCAGCTGCAGTCAATCCAACGGCGGCTGGGGGGCCTGCGTGCTCACCCCTTGCCACCGACGGGACCGAGATTCCGTCACCATGGGTCGGGTTACCGGCTCACTCTGGTGGGGGGATCTCGAAAGTCTAGACGGTCACGTTGCGATGGGGACTGCTACTGCGCTTCATCCACTCTTTGAAGGATGGCCTAAGGTTGCCTAGGTCCGTAAGGCCACGGATTTCCCCAGCTTTTACGGATGGAGGTTTGTACCGCCTCGACTCGGACGCAAGAGCCTCTGCTTAGAGCACCAAACGCGGTGAGAGGATGATATTTTGATGCCATCCGCGACCTTTGTGCCTTTCCCCTTTCTTAAAGACTTATTGCGCTCCCAGTTACCAGAATCAAAATTAAATTAAATTAAATTTCAACGGCTAATTTAAATTTAATTTTGAATTTCACTACTGTCGCAACACAACACTGATCCGTTCTGGCAGCGCCTACTCTCAGATCGCCCGCTGCGCTATCAGCTGTTTATCCGCTGCAACAATCGCAAGATAATAAATTACCTATTTACATGAAACAGGCGCACAATTAACTCGCGTGATTGCAGCGCAGAACTATGGCGCGACTCCACCGATATTGATTTTGCCAGTTTGCCGCACACCGTGACACAACTTCTATGGTTTCGAGTATTTCGCGCCGCGTAATTTAAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCCGCACCAGGATTGGCGAGTTTGCACTTCTTTTAACAGTTCAGAAAAAAATGGCGATTCTGCGACTCTACAAATTGTCGGCAAATTGTTTTCACTATTGTAGTATGCACACACATATCGGTTAAGCACTGTACCTATGTGTATTCGCAATTGTAGCACTCTGTTGCAATATTGTACATAAACAGACACAAAGTGTATACGTAATACGAGCGCACCCACTTGAGGGGCTAACGCTTACATAATTGCCTGGTCAGCGGTTCTCCCGCTGGCCAAGCGCTGATCGCTTATATTATTGCCTATACCCTCCTCCTCCAGCACCATCGCTCGGCGACAGTACATATATATACATATATATAAGATACGCATATAAGCGTTGCTGCGCTGCGAGTATGCCGGCATGCTCCTCGACTTAAGAAACCTTTGTATGTGTAGATCATAAGAGGATTGACGAATTAATTTCGAATGGAGCGGGACCTTCCCTGTTCCTCAAATTGGATCAAATAAAGAACAGCTAAAACACAAATGATCTATGACACAATGGGGAAACTACAGGGAAGTTGGAGTAGGCGGTCCACTTCTGATGTCGGATCTGAATCGCTTTATACTCGGCATCACTCTCTACAGCGGACACAAAGTAACAAGAAAACGGTCGTTAAGCGAAATTAAAATAGTAGGTACAGTTTGTCAAGAAACTGTTTACACCAAATGAAATAAGATGAATTTTTTGATTTTAACGGTCAAAATTAAGGGTTATTTAGCAATTAAACGCAATTTTTTTTTTAGGAAATATAATTAAACAATATTTATTTTGCATAAATTAAAAACAAATTCAAAATATCAAATATACAAAGAAAATAAACAACGAATTCCAAAGTTTAAACACTTTTGAGAGTTTCAAAACTCTTTACACAAAAACACTAAACCTAAGTTTAATCCTAAATTTTAAATTATTTTGTTAAAATTTGAGAAAGAGTTTATCAGTATTTGGTATGACCCCCCATTGGCTTTGGCTACAAGTTGAAGCTTTTTTCATGGAATGGATGAGTTTTTTTTAAGGTCATATTCAAGCGGGATCTTTTCCCACTCTATCGCAACCATGAGCTGTTGTCGTGTTTTGGTGCCTTTTTTGCCACATTCTTCTTTAAGTAGGCCCACAAATTTTCAATGGGGTTCAGATCAAGACTCTGAGGGGCGTATCGATCGCGCGCGCCACAGTTATGAAATTCCAGTTGCGTACATTGCACTCTTTATGTTTGGGATCATTGTCCTGATAAAACTTAAAAATTTGGCTTGTTGTTGCTAAATAGACCAAATTTTTCTGCACCAGCCTAAATTTGATTTTTAAAATATCTAGATGCACGGCATTCATAGTGCTTTCAATAAAGAGGCTAATTGCCCACTCCATGGCTTGAGATACAGCCCCAAATCATCACTGATAATTTTTTCCAAATTTGATTGTTTGGAATGATATTTTGTTTTCTAGCGCACTCAACAGCTTGCGCCATACTCTGCTTGGCCCATCGTTATAATAGAGCATCATTTTGTTTCGTCACAAAATATTACGTCATCCCAGTACTCTTCCGCATGATCCATCATGCTCACAGCAACGCTTTCTATATTGACCTCTGATAGCAAGGCTTTTTCTTGCAACTCTTGAAGAGTACCTATGGCGTAGAATGACTTGGCGCACAGTTTTTATTATTGGCACAACTAGGTCACATTCTTGCCTGATATCCTGGTAAAGTGATCTGACCAGCCGAGATTCGGGGGGAGTTCACCAATCACTTTTCGCATAATAAGGCGGTCTACACGCTTGCTAATTTTAGTTTTGCGCCCACCACTCTTAGGTTCAAACCTGTTCTCTTTTCAAGCGATTAAAGAAACATTGTAGACGGTCTTACGGGATGCAGAGAAAACATTTATACTAATTCTGGAATAGATTTTTCCCAACTGGTGGTTTTAGTATATTATTTGGGTCACTTCAAAAGCTAATCTATTTCCAGGCATTTTATTAAATTTAATAACTCATTCGATCAGCAAATTTCACAAGCAAAGTAAAAAAAATTTCAATGAGCGTTGTGGGAATGCAAATGCCGAAATAGCAATGCGTAACCGTA
->bc8ffd1e-e0d0-4f15-8ea9-dc41acedb37d
-TAAAAGCTCGGTATGCTTCGTTCAGTTACGTATTGCTGACTGCTTCGGTCTTGTGAGCCGCTATTGCTAGCCCGGCTGTGATTGCCACATCGTCAGCAGAAACAGCTGCCTCGACGACTGCCCAGAGTTCTGTGACGCGGCAAATCTGGGGCAGGGGCTGCCTCTGTTGGCCTCCATAGTGTGGTCTGCTGAAATAGCTCCCCTAGTATGTTAGCCAGGACCCCGGGTCGGATGGGGTTGCCGCTCTCCTCGCGCCAAGCTCGTTTGGTAACAAGAAACGTAGGCGAGGCCCCAGATATCGCTGTCTACGCCATCCTGCAGCTCCTTAAACGACCGCGCTTTGGCAGCCGATGCCGTGCTTGAACTCTAGGCGTTTTGCTTCCTGAAAGCCTCAGAGTTCCGTGGTGGGTACTGCCTCTGGCTCGTTGCGCCGTTCTCTTAGCCCTGAGGCAATCAGACCGTAGTTGGCTTAGGGGAGGCACTCCACCAAGCGGGTGGTTTGCGCTGTGCCTTATTTTCCTTGGCATGATTGCGTCGCAGATTCTTCCAACATATTCATGAGGCCTGCCGCCATACTCTGCGTCCACATTTGCAGGATTTCCAGGGGAATTGATCTGATAGGCCAGCATGGCCTCATCGATCTTCCTGGTGTCCATGTTTTCCAGCTGTTCTACTCTGCCGTCTTTTTTTGGAGCATGCCCTCCGGGGAGAAGGAGATCCGGGAGGGCATGGTCGCTCAACGTCATGACGTCATGGACCATCCAGTTGTTGTTGTCTACTAGCCCTCTGCTGACAAGGTAACGTCAATAAGGACGTACCCTATCGTTGTTAAACGTCATTTCCGTCATCGTTCAGCAGTATGAGGTCCAGCATTCGCGTAGCGTCAATCACAGCTCGTCCTCTGGTGTTGGATGTCCGCTTTATTCCACTATCCAGGCATTAAGTCGCCGGCAATGACCTTCGGGCTTCGCCCTCTCGCATGGTCCACGAGCGCCTCCAGAAGCTCCTCGAACTGATCGGGGTGTCGCTCGGCGGAGCGTAAACAGCTGTACGTAATGCACGTGTTTTAACTTCGCATAAGCGATACCCGCATGGGTAAAGCAGCCAGTTCCTGTGGACTTGGAGAGAGCTGCAGCATTTGATAGCTTCTGCTTTACCTGCCTCGTCAAAGGATCATGGACGATTGTCCACCACCAGAGACGTAGGGTTCGCTTAGGAGCATGATGTCTACATTGCGCTCCAACCGCAGTCTGGGCCAGGAGGCTCTGAGCTGCTGCTGATGATTGACATTGAGCTGTACTACGCTATGAGCGTGCATTAAAGGTGGCTCTTGGCATCTTTTAGTATCAGCTCTGTAAGTCGGAGCGCAAAGCTACCCGTCGGGTGGTTTCACCAATTACACCTGCGCTGCTGCAGATCAGGCATTTTGGTGCAGCAACGCACCCCTTTGCCTTGTGCTTACGCTCACCGCATCTGAACCAGCAGTCTGCCCTGTCAGTGTCCTTGCAGATTTGGCGATCGTGCCCAGCCGAAGACACCTGCTTAGCATCTCGTGGGTCCGGACGTCCTGGGTGATACCACGACATCTTGACCATCCAGCAACGATTATGATTGCCCTGTTTAAGGACTGGTATCGCAACGTTCCGTTCAGCAGCGCAGGGCTATTTTGCTTGCAATTCCGCATACTGCGGGGCCCCTGATATCTTCAGGATTTATCTGCAGGCCTGGAATTGGGCGACCAAACGGCTGTGGAGCTTCTCTGCTGTCGTAGCCTCGTCCAATCCGCTGCAAGATAAGTATTCTTTGCGCTCCTGTGCGCACAGAGGCCAAGTCATTGAGCGCCGCTTCAGGTCGCTCTTAAACTTCAGGAACGCTTTCCGAAGCTTTCCCCTCTACGCCTCAACAACAGATCACCTTTCTGCGTTCTCCGGATTTTTCGCGCGTGACTGCCCAGTTCGCTAAGGCTCGATTCCGATCTTAGCTTCGAAGCATCTCTGCGTACGAAGCCTCTCTGTCTTTTTTTTACGATGAGTGCCTCTACCCGTGCTAGCATTCTTGGCGGAACAGATGCATAGCTGCCTGGCTGGACTCGTTAGGTATGGATGTCGCCTTTTCATCCACCGTTGCCATCCAACGTAGGGTTGCTCTGCTTCGGCGCGCCTGGACTTTGGCACCTGCACCGTGGGTACCGCGCATTTTATTGGAGCCTTTTTGGTAGGCTTTTGTACCTCCGTCTGGGTAGCGCTGCTCTTCAAGCGGTGCTCGCTGAAGTGAAGTACCTTCGTACAGCTCTATCGCCCTGTTGTTGGGGCTGAGGAGTTCGGAAGCTATGCCTTGTCTCTCATGTGTCGTTGGGTCTCGAATGCGGATAGAAGGGGGCTGATCTTGCCATTCATCCTGGTAAGTATGCCCTCAGGTCCTCGTTCTGGAGAGCAGTGGTCAAGTCCGAAGAAGACCGATGAGGGAACCAGCTGGGGACTTCCACTCCCGTCTTTTTTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCTGGCTGTCGCGGTCGTAGATGCTGTAGGAGCCAATTTCTCCACCTCTACAGCATCGCTGCAGTCGATAGTCAACGGCGGCTGGGGGCCTGCGTGCTCACCCGCTGCCACCGACGGGACCGAATTCCGTCACCATGGGTCGGGTTACCGACTCTCACAGTGGGGGGATCATCGAAAGTCGAACTCCTCCTGAACGGGTCGTTGCGATCAGGGGGACTGCTACTGCGCTGTCCATCAACTGGAAGGATGGCTAAGGTTACCTGGGTCACGTAGGCCACGGATTTCCCCTGGCTTTTACCCGGATGGAGGTTTGTACCGCCTCGGCTCCGGACACCAGGCCTGGCAGGCACCAGCACGGTGAGAAGGATGATATTTGGTCTGTCCGCGACCTTTGTGCCTACGCTTTCTTAAAGACTTGGTATTGCGCTCCAGTTACCAGAATCAAAATTAAATTAAATTAAATTTCAACGGCTTAATTTTAGAATTTAATTTTGGTCCCCTCGCATACTGTCGCAACACAACACTGATCACACGGTTGATCTGGCAACGCCTCCACTCTCCAGATCGCCCGCTGCGCTATCCGGCTGTTTATCCGCTGCAACAATCGCAAGATAATAAATTACCTGTTACATGAAACAGGCGCACAATTAACTCGCGTGATTGCAGCGCAGAACTATGGCGACTCCACCGTGTGATTTTGCCGGTTGCCGCACACACCGGCCGACCTGCTTCTATGGTTTCAGTATTTCGCGCCGCGTAATTTAAGACGTCCGTCTTCACGGCGGCGATGTAGACTTGGTCTCCCGCACCAGGATTGAGTGTCTAAGCCTGTGCGTTCAGGATTAAACTTTGGCAATACGACAGCGGTGAGTTTTGGGTCTCTTTTGTGAGTTTTGCACTTCTTTTAACAGTTCAGAAAAATGGCGATTCTGCGACTCTAGAATTGTCAACAAAATTGTTCACTATTGTAGTATGCACATATCGGTTAAGCACTGTACCTATGTGTATTCATAATTGTAGCACTCTGTTGCAATGTGTACATAAACGGTCAGCACAAGTGTATGCGTAATACGAGCACCCACTTGAGGGGCTAACGCACATAATTGCCTGGTCAACCCAGTTCTCCGCTGGCCAAGCGCTACGTCGCTATGGCGCCTATACCACTCCTCCTCCTCAGCACCATCAGCTCGGCGACGGTACATATATATATGCATATATGCAAGATACGCATATAAGCGTTGCTGCGCTGCAGGCTATGCCGGCAGCGCTGCTCCTCGACAGGCTAAAGGCAGCATTGTGTAGATCGCCAAGAGGATTGACGGAGTGAATTTCCGGGCAGGACCTTCCCTGTTCCTCAAATTGGATCAAGTAAGAACAGCTAAACACAAATGATCTATGACACGTGAAACTACAGGAAGTTGGAGTAGGGCATTCCCACTTCTGATGTCGGATCTGAATCACTTTATACTCAGCATCCCACTCTCTACAGCGGACACAAAGTAACAGAAAACGGTCGTTAACTTGAAATTAAAGCCGAAATCTGCGACAAGTACAGTTTGTGAAAACTGTTTACACACCGTGAGAAATAAGATGAATTTTTTGATTTAACGGTAAGAGTAAGGGTTATTTGCTTAATTAAACGCAATGAATTTTTTTTTTAGGAAATATAATTAAACAATATTTATTTTGCTTTATAAGAATTAAAAAACAAATTCAAAATATCAAATATACAAGAAAATAAATAACAAATTCAAGTTTACACACTTTTGAGAGTGTCCTCTGCCAATGTCATCTCTGGGATGAGCTGATAGGTCCACCTCCCCGTCGCGACGTTTGCCATCTGCTCTGCCATTCACCTAGCCACTCGTGTGCCTCTTGCCTGGAAGCGCCACTCCGCATAAGGCTGAGAGCCTTGATCTCCAGATCAATCGGCAGGCCTGCCAGCGCTAACGCCGCGTCTTCGGATATCAGTCCTGAATCCTCCTAATGAGCCTGAGGGCCATTGACCGTAGCACCGAACGAGCTCCTTTCAGGTATGAGGGCCTGCAAGTGGCATTGCTCCAGACTGGTGCAGCGTATGGCAACCCGAAGCCTTTGCTACTGACACCAGCAGTTTCCTGGCCAGTGTCTTGGGCCTCCGACGTTGGGCATAAGCCTCGCCAACGAAGAGGATGTGACTGCTGTCTTCTTGCTGGCGTAACTCGCGTGGTCCTTGAACGATAGTCTGCGATCTATCATTACCCCAGGTACTTTAGGGACTCTTGAGGTCCCCTGAGTACCCAACAGGCGGAAGACCAGCATGTTCTCCATCTTTTTTTTCCTGCTGCTTAGTAGGACTGCTTCGATCTTGTGAGCCGCTATTGCTAGCCCGGCTGTGATTGCCACATCGTCAGCGAAACAGCTGCCTCGACGACTTCAAGTTCTGTGACGCACGCGGGAAATCTGGGGCGGGGGCTGCCTCTGTTGGCCTTCCATAGTGTGGTCTGCTTTGGAAATAGCTCCCCTAGTATGTTAGCCAGGACCCCGGGTCGGATGGGGTTGCCGCTCCTCCCTTAGCTCGTTGGTAACAGAAGCGGGCGGGCCCCAGATATCGCTGTCTACGCCATCCTGCAGCTCCTTAAACGACCGCGCTTTGGCAGCCGCGATGCCGTGCTTGAACTCTAGGCGTTTGCTTCTGAAAGCCTCCAAGAGTTCGCGTGGTGGAGTACTGCCTCTGGCTCGTTGCGCCGTTCTCTTAGCCCACTGGGGAGCCAATCAGACCGTAGTTGGCTTAGGGAGGCCTCCACCAGTAAACGGGTGGTTTTGCGCTGTGCCTTATTTTTCCTTGACATGATTGCGTCGCAGATTCTTCCCAGCATAATTCATGAGGCCTGCGCGCCTCTCTGCGTCCACATTTGGGATTTCCAGGGGTGGTCTGATAGGCCAGCATGGCCTCATCGATCTTCTGGTGTCCCATGTTTTTCCCGGCTGTTCTGCCACTCTGCCGTCTTTTGGGCATGCCCTCGGGAAGAGATCAGGGGCATAGTCGCTCAGCGTCATGACATTAATGGACCATCAGTAGTTGTTGTTGTCTACCCACTAGCCCTCTGCTGACAAAGGTAACGTCAATAAAGGGGACGTACCCTATCGTTGTTAAACGTCGGCTTCCGTCCATCGTTCAGCAGTATGAGGTCCAGCATTCGCGTAGCGTCAATCACAGCTCGTCCTCTGGTGTTGGATGTCCTGCTGCCCCATTCCACTGTCCAGGCATTAAAGTCGCCAGCCCGTGACCTTCGGGCTTGCTTCCACTCTCGCATGGTCCACGAGCGCCTTGCTCCAGAAGCTCCTCAGCGATCGGGGGGTGTCGCTCGGCAGGCAGCAGCTATTACATGTGCACGTGTTTTTAACTTCGCATAAAGCGATACCCGCATGGGTAAAAGCAGCCAGTTCCTGGACTTGGAGAGCTTGGCATTTGATAGCTAGCACCTCGTCAAGGATCATGGACGATTGTCCACTGCAGAGACGTAGGGTTCGCTTGGAGCATGATGTCACCATTGCGCTCCAGCGCAGTCTGGGCCAGGAGGCTCTGAGCTGCTGCGCAATGATTGACGATGAGCTTTAATACTACGCTAATAGGCGATGCATTAAGGTGGCTCTTGGCATCTTTTAGTGTCGCTCTGTAAGTCAGACACCTAAAGCTACCCGTCGGGTGGTTTCTGTCCACCTCGCTGCTGCAGATCAGGCATTTTGGTGCAGCAACGCACCCCTTTGCCTTGTGCCCACGCTCACCGCATCTAAGACGGCAGTCTGCCCTGTGTTGTCATACGGGTTGCGGTCGTGCCTGTAGGGAGCCGCTGTAGCATCTCGTGGTGGGGACGTCCTGGGCGTACGACATCTTGAGCTATCCCAACGATTATGGTGCCCTGTTTAAGGACTGGTATCGCAACGTTCGCGTTAAACGGCACTGAAGGGCTATTTGCTTGCAATTCCGCATGCTGCGAGGCCCCTGATATCTTCAGGATTTATCTGCAGGCCTGGAATTGGGCGACCAAGCAGCTGTGGGCTTCTCTGCTGTCGTAGCCTCGTCAATCCGCTGCAAGATAGAGCTATTCTTTGCGCTCCTGTGCGCACAGAGGCCAGTCATTGAGCGCCGCTTCCAGGTCAAACAACTGGCAGAACGCTTTCGAAGCTTTCCCTCCAAGCAACAGATGCCTTTCTGCGTTCTCCAGTTTTCGCACGTGACTGCCCAGTTCGCTAAGGCTCGATTCGATCTTGGCTTCCAGAAGCATCTCTGCGTACGAAGCCTCTCACCATAACTTTACGATGAGTGCCTCTGCACCCGTGCTAGCATTCTTGGCGACAGATGCATAGCTGCTGGCTTAGACTCGTTAGGTATGGATGTCGCCTTTTTTTCTTCACCGTTGCCATCCAACGTAGGGTTGCTCTGCTTCGGCGCCTGGACTTTACCGTGGGTACCTGCGCATTTTTGTGGAGCCTTTTTTGGTAGGCTTTTGTACCTCCGTCTGGGTAGCGCTGCTCTTCAAGCGGTGCTCGCTAGTAATTACCTTCGTACGAAAGCTCTAATAGCCCTGTTGTTGTTAAGGGCTGAGAGTTCGGAAGCTATGCCTTTGTCTCTCATGTGTGTCGTTGGGTCTCGAATGCGGATAGAAGGGGCTGATCTTGCCATTCATCCTGTAAAGTATGCCCCTCGGGTCCTCGTTCTGGAGAGCAGTGGTCAAGTCGAACCGATGGGGAACAAGCTGGGGACTTCCCTCCCGTGCTTTTGCGATGGCACGGCGATGGTCCATCGTCTTCTGACTTGTCGCGGTCGTAGATGCTGTAGGAGCCAATTTCTCCACCTCTACAGCATCGCTGCAGTCGATAGTCAACTTGGCGGCTGGGGGGCCTGCGTGCTCACCTTGCCACCGACAGGACCGAGATTCCGTCACCATGGGTGGGTTACCGACTCCTCTGGTGAAGGATCTCGAGAGATCGAGAGCTCCTCTGAACGGGTCGTTGCGATCAGGGGGACTGCCCTACTGCGCGTCCATCAGCTGAAAGGATGGCTAAAGGTTACCTAGGTCATGCATTTTAGTTCCCCCCCCTGGCTTTTTTACAATAGGTTGGAGTTTGTACCGCCTCGACTCGGACACCAAGAGCCTCTGCTTAGGCACCAGCACGGTGAGAGGATGATATTTGGTCTGTCCGCGACCTTTGTGCCTTTTCCTTTCTTAAAGACTTGTGTGCGCTCCCAGTTACCAGAATCAAATTAAATTAAATTTAAATTTCCAACGGCTTAATTTTAAAATTTAATTTTGAATTCGCCTACTGTCACTGGCACAACACTACGATCACACGGTTGATCTGGCAGCATACCTCCACTCCAGATCGCCCGCTGCGCTATCAGCTGTTTATCCGCTGCAACAATCGCAAGATAATGATTACCTATTTACATGGAAACGGGCGCACAGATTAACTCGCGTGATTGCAGCGCAGAACGCTATAGCGCGGCTCCACCGTGTGATTTTTTGCCAGTTGCCGCACACACCGGCCGACACAACTATGGTTTCGAGTATTTCGCGCCGCGCAATTAAGACGTCCGTCTTCACGGCGATGTAAGACTTGGTCTCGCACCAGAGTTAGTGTCTAAGCCTGTGCGTTCAGGATAAACTTTGGCAATGCGACAGCATTGGAGTTTTGGGGTCTCTTTGTGAGTTTGCACTTCTTTTAACAGTTCAGAAAAATGGCGATTCTGCGACTCTAGAATTGTCAGCAAATTGTTTTTTCACTATTGTAGTATGCCAACATATCGGTTAAGCGCTGTACCCTGTATTGTATTCATAATTGTAGCACTCTGTTGCAATGTGTACATAAACAGTCCAGCACAAGTGTATACGTAATACGAGCACCGCCGAGGGCTAACATACATAATTGCGCGATTGGTGGTTCTCCCGCTGGCCAAGCGCTGATCGCTATATGTCTAATATTGTGCCTATACCACTCCTCCTCCAGCACCATCGCTCGGCGACGGTATATATATATACATATATATAAGATACGCATATAAGCGTTGCTGCGCTGCAGGCTATGCCGGCAGCATCTGCTCCTCGATGACAGGCCTAGAAACCTTTTACGTAGATCATAAGAGGATTGACGAATTAATTTCGAATATGGGCAGGACCTTCCCTGTTCCTCAAATTGGATCAAATAAAAAGAACAGCTAAAACACAAATGATCTATGACACAATGAAACTACAGGAAGTTGGAGTAGGCGGTCCCACTTCTGATGTCGAGATCCTGAATCACTTTTATACTCGGCATCACTCTCTACAGCGGACACAAAGTAACAGAAAACGGTCGTTAACTTGGAAATTAAAAGAAATAAATCTGCGACAAGTACAGTTTGTCAGAAGCTGTTTACACACCGTGAAATAAGATGAATTTTTTGATTTTAACGGTCAAAATTAAGAGGGTTATTTGCTTAATTAAACGCAATTTTTTTAGGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAAACAAAATTCAAAATATCAAATATACAAGAAAATAAACAACGAATTCCAAGTTTAAGCTTACTTTTTTGAGAGTTTCAAGAAACTCTTTACACAAGAGAAAAACACTAAACCTAAGTTTAATCCTAAATTTTTAAATTATTTTGTTAAAATTTGAAAAGTTGTAGTATTTAGTATGACCCCCCATTGGCTTTGGCTACAAAGTTGAAGCTTTTTTTTTCTGCATGGAATGGATGAGTTTTTTTAGGTCATATTCAAGCGGGATCTTTTCCACTCTATCGCAGCCATGAGCTGTTGTCGTGTTTTTGGTGCCCTTTTTTTGCCACATTCTTCTTTAAGTAGGCCCACAAATTTTCAATGGGGTTCAGATCAAGACTCTGAGGGGCGTATCGATCCTGCTTACTTACGTTATAAGGAGCCAGTTGCGTACATTGCACTCTTTATGTTTGGGATCATTGTCCTGATAAAACTTAAGAATTTGGCTTGTTGTTTGCTAAATGGGCCGGTACTTGCGCCTGGCCTTCAAATTTGATTTTAAAATATCTGAATATTTTGCGGCATTCATAGTGCTTTCAATAAAGGCTAATTTGCCCACTCCATGGCTTGAGATACAGCCCCAAATCATCACTGATAATTTTTCAAATTTGATTGTTGGAATGAGTATTTTGTTTTCTAAGCGCACTCAACAGCTTGCTTGCTTTCTGTGACCCATCGTTATAATAGAGCATCATTTTTTGTTTCGTCACCGGAAATATTACGTCATCCCACAGTACTTCCTTTGCATGATGCCATCATGCTCCTTTGTGAAATGGGGCGGCGCTTTCATATTGAGCCTCTGAAGTAGCAAAGGCTTTTCTTGCAACTCTTGAAGAGTACCTGCCAACGGTAGAATGACGCTTTTACGGTTTTGTGTATGGCTTTTGCTTCAGATCTACATTCGCGCAGTCTGGCGACGGTAGATCTGACCGAGATTCGGAGATTTCGCAATCACTTTTCGCATAATAAGGCGGTCCTACACGCTTGCTAATTTTAGTTTGCGCCCACCACTCTTAGGTTCAAGCCTGTTCTCTTTTCAAGCGTTAAAACATTGTAGACGGTCTTACGGGATACAGAAAACATTTATACTAATTCTGGAATAGATTTTCCCAACTGGTGGTTTTAATTGTATTATTTGGGTCACTTCAAAAGCTAATCTATTTCCGGGCATTTTTATTAAATTTAATAACTCATTCGATCAACAAAATTTCACAAGCAAAGTAAAAAAAATTTCAATAGAAGCGTTGTAAAAAGGAATGCAAATGCCAAAAATAACGGAAAAATCGAGTTCGTTCCTAGAAAGAGCAAAACAAAGTAGGAAACAAAATGTGTAAGGAGTTTGTGCCACTCTCAAAAGTGTGTAAACTTGGAATTTGTTGTTTAATTTCTTGTATATTTGATATTTGAATTTGTTTTAATTTATAAGTAAAATAAATATTGTTTAATTATATATTTCATTAAAAAAAATTGCGTTTAATTAAAGAAATAGCCATAATTTTGATGACCTTTAAAATTGAAAAATTCAACTTATTTCACGGCGTGTAAATAGTTTCTTGACAAACTGTATATATCTACAAATTTACAACTTGCCGGTACCGTAAAGTTTAATTTACATTGAAGTGGACTTTGACTCTCAGAATGAATTAAAACATTCTGTTCTTAGATTGAACTGACGAGGAGACAGACTGAACTAAGCTAAAACTAACTATCATTTAACTAAATTTAATTAAGTTTGATAATTTTGAGTTTCTTACAAAGATGACTAATATTAATTTTTTTAGTTAGAATGGTTGCAAAACTGAATTTATGTAAATAATATGTTCAATTGATCTGGTTGGGTTTCTGGGTCTCCCCAACACCTCATAACGAATGCTGGATCAAATTATTCGTCAGAAGGACGTGCACAGTCTCGTGGTAATAAAAGTACAGCAATCTTACTTTTGAGGAGGTGGCGTGTTGGAAATATGTACACATTTAAGCAAAGTCACATGGCCTGCATCAAAGACACTAGAATAATAAGATGCGTAACAACCATACGCGGTTTGGCACTATGCAGCCACTTTTTTTGGTGACGGCCAAAATTGCTCTCTTTCCGCTCGCTCACGCTGAGCGTAAGAAATCTAAAAGTAGAATTTGCTTGCTTGTGTGAGGTAAAAACAAAAGGCGAGAACAGCGTATATGTGCGTGTTGTGCTGAAGGCGATTTATAGGGCCGAAATCAATTCTGATCGCAGTAACGAATTTACATATGTACATACATATTTGGGGAGTTTTGGCCAATTTCGTAGAATATGATGAAATTGCGCTGTTTAAGATCAAATTGGAATATAAAAAAACTGAAAAAGTCATTACACTGAAAAATATTTCATAAAAATAATACGAAGTAGAAAATAAAAATTTATAAAATAAAAAAATGTTAACTGTTTATTTAAAACGTCATATCAAATTAGAATTATTCTAAAGATGTCTTTGCTTTGTGGTCATATCTTGAGGCACGAAGTGCGGACACAAGCTTGCACTCAAAGCAATCATTGTCTTCTTAATACTCAAGCAGAGGCGACACCGACGAACCTAACTGCTTTGAAATGGCAGAGAGTAAAATAAAATCCAAAAAGAGACCAAGCCCCTCCCGAAGTTCAAAGAAAACAGGATTCCCTGGACAATTCACG
->966ca1ba-4b50-4f09-9c16-5887f892bd76
-TCATTACTTCGTTCAGTTACGTATTGCTACCAGGATTGAGTGTCTAAGCCTGTGCGTTCAGGATTAAACTTTGGCAATACGACGGCGATGAAGTTTTGGGTCTCTTTGTGAGTTTTGCACTTCTTTTAACAGTTCAGAAAAATGGCGATTCTGCGACTCTAGAATTGTCAACAAATTGTTTTCACTATTGTAGTATGCACACATATCGGTTAAGCACTGTACCTATGTGTATTCATAGTGTAGCACTCTGTTGCAATGTGTGTACATAAACAGTCAACACAAGTGTATACGTAATACGAGCACCACTTGAGGGCTAACATACATAATTGCCTGGTCAGCAGTTCTCCCGCTGGCCAAGCTGATCGCTTATATGTGTGCCCTGCTGCTCCTCCTCCAGCACCATCGCTCGGCGACAGTACATATATATATACATATATATATAAGATACGCATATAAGCGTTGCTGCGCTGCAGGCTATGCCGGCAACGCTGCTCCTCGACTTAGGCTAAAGAAACTTAACTGTATGCTTAGATCATAAGAGGGATTGACGAATTAATTTCAGATGGGCAGGACCTTCCCTGTTCCTCAAATTGGGATCAAATAAAGAACAGCTAAAACACAAATGATCTATGACACAATGAAACTACAGGAAGTTGGAGTAGGCGGTCCCACTTCTGATGTCGGATCTGAATCACTTTATACTCGGCATCACTCTCTACAGCGGACACAAGTAACAGAAAACGGTCGTTAACTTGAAATTAAAATAAATCTGCGACAAGTACAGTTTGTCAGAAACTGTTTACCGTGAAATAAGATGGGTACGATTTTAACAGTCAAAATTAAGGGTTATTTGCTTAATTAAACGCAATTTTTTTTAGGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAAACAAATTCAAAATATCAAATACAAGAAAATAAATAACAAATTCCAAGTTTACACACACTTTTTTGAGAGTGTCCTCTGCCCAAACCGTCATCTCTGGGATGAGCTGATGGAGTCCACCTCCCCGTCGCGACGTTTGCCATCTGCTCTGCCATTCACCTAATAGCCACTCGACGCACTTGCCTGGAAGCGCCACTCCGCATGGGCTGAGAGCCTTGATCTCCAGATCAATCGGCAGGCCTGCCAGCGCTAGCGCGCCGCGTCTTCGGATATGGTCCTGAATCCTCTAATGAGCCTGAGGGCCATTGACCGTAGCACCGAACAGGCTCCTTTCAGGTGAGACCCGCACCAGAATTGGCATTGCTCCAGACTGGTGCAGCGTATAGCAGCGAAGCCTTTGCTTCACTGACACCAGCGGTTCCTGGCCAGGTGTCTTGGGCCTCCGACGTTGGGCATAAGCCTCGCCAACAGAAGAGGATGTGACTGCTGTCTTCTTGCTGGCGTAGCTCGCGTGGTCCTTGAACGATAGTCTGCGATCTATCATTACCCCAGGTACTTTAGGGACTCTTGAGGTCCCTGAGTACCCTTGACGGAGACAGCATGTTCTCCATCTTTTTTTCCTGCTGCTTAGTGGACTGCTTCGGTCTGTGAGCCGCTATTGCTAGCCCGGCTGTGATTGCCACATCGTCAATGAAACAGCTGCCTCGACGACTTCAAGTTCTGTGACGCACGGGAAATCTGGGGCGGGGGCTGCCTCCTGTTAGCCTCCATAGTGTGGTCTTGCTTTGGAAATAAACCTAATTTATGTTAGCCAGGACCCCGGGTCGGATGGGGTTAGCAACTCTCCTCCTTAGCTCGTTGGTAACAAGCTTGTAGGCGAGGCCCAGATATCGCTGTCTACGCCATCCTGCAGCTCCTTAAACGACCGCGCTTTGGCAGCCGCGATGCCGTGCTTGAACTCTAGGCGTTTGCTTCAGAAGCCTCCAAGAGTTCCGCGTGGTGGAATTACTGCCCGCCTCTGGCTCGTTGCGCCGTTCTCTTAGCCCTGAGGCAATCAGACCGTAGTTGGCTTAGGGAGGCGCACTCCACACCAGTAAACGGGTGGTTTGCGCTGTGCCTTATTTTTTCCTTGGCATGATTGCGTCGCAGATTCTTCCCAGCATATTCATGAGGCCTGCCGCCATACTCTCTGCGTCCACATTTGGGATTTCCGGGAATTGATCTGATAGGCCAGCATGGCCTCATCGATCTTCCTGGTGTCCCATGTTTTTTCCCAGCTGTTCTACTCTGCCGTCTTTTGGGCATGCCCTCCGGGGAGAAGGAGATCAGGGCATGGTCGGCTCAGCGTCATGACGATCATGGACCACATCAGTTGTTTGTTGTCTACTGGCCCTCTGCTGACAAGGTAACGTCAATAAAGGACGTACCCTATCGTTGTTAAACGTCGGCTTCCGTCCATCGTTCAGCAGTATGAGGTCAACATTCGCATGGCGTCAATCACAGCTCGTCCTCTGGTGTTGGATGTCCTGCTGCCCCATTCCACTGTCCAGGCGGTAAAGTCGCCGGCAATGACCTTCGGGCTTCGCCCTCTCGCATAGTCCACGAGCGCCTCCAGAAGCTCCTCGAACTGATCCGGGGGGTGTCGCTCGGCGGGCAATGCTTTTAGCTAATACATGTGCGTGTTTTAACTTCGCATAGCCTTGATACCCGCATGGAGTAAAGCAGCCAGTTCCTGGACTTGGAAGGCTGCAGCATTTGATAGCTGCTTTACCTGCCTCGTCAAGGATCATGGACGGTGTCCACTACCAGAGACGTAGGGTTCGCTTAGGAGCATGAGAATGTCTACATTGCGCTCAACCGCAGTCTGGGCCAGGAACCACAGGCTGCTGCACCGATGATTGACGATGAGCTGTACTACGCTAATATGAGCGTGCGTGCAAAAGGTGGCTCTTGGCATCTTTTAGTGTCGCTCTGTAAGTCCAGTCTAACGCAGATCGGAGCATTTTGGTGCAGCAACGCACCCTTGCCTTGTGCCCACGCTCACCGCATCTAAGACAGCAGTCTGCCCTGTCAGTGTCCTTGCAGGTTGCTGATCGATGCCCATAGCCGAGACACCTGTAGCATCTCGTGGGTCGGACGTCCTGGAGTGATACGACATCTTGACCATCCGGCGATTATGGTGCCCTGTTTAAGGACTGGTATCGCAACGTTCGCTTCAGCAGCACTGAGGCTATTTGCTTGCAATTCCGCATACTGCGAAGGCCCTGATATCTTTAGGATTTATCTGCAGGCCCTGGAATTGGGCGACCAAGCAGCTGTGGAGCTTCTCTGCTGTCGTAGCCTCGTCAATCCGCTGCAAGATAGAGGCTATTCTTTGCGCTGTGCGCACAGAGGCCAAGTCATTGAGCGCCGCTTCCAGGTCGCTCTTAAACTTGGGAACGCTTTCCGAAGCTTTCCCTCTACCTCAAGCAACAGATCACCTTTCTGCGTTCTCCGGATTTTTCGCACGTGACTGCCCAGTTCGCTAAGGCTCGATTCGATCTTAGCTTCGAAGCATCTCTGCGTACGAAGCCTCTCCTGTCTTTTACGATGAGGTGCCTCTGCACCCGTGCTAGCATTCTTGGCGACAGATGCATAGCTGCCTGGCTTGGACTCGTTAGGTATGGATGTCGCCTTTTCTTCACCGTTGCCATCCAACGTAGGGTTGCTCTGCTTCGGCGCCTGGACTTTGGCACCTGCACCGTGGGTACCTGCGCATTTTGTGTGGAGCCTTTTGGTAGGCTTTTGTACCTCCGTCTGGGTAGCGCTGCTCTTCAAGCGGTGCTCGCTAGTAGTACCTTCATTACAGCTCTATCGCCCTGTTTGTTAAGGGCTGAGAGTTCGGAAGCTATGCGCTGTCTCATGTCATTGTCGTTGGGTCTCGGGTACGGATAGAAGGGGCTGATCTTGCCATTCATCCTGGTAAATTATGCCCCTCAGGTCCTCGTTCTGGAGGCAGTGAAATTCAGGTCGAAGACCGATGGGGGAACAAGCTGGGGACTTCCCTCCATCTTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCTGACTTGTCGCGGTCGTAGATGCTGTAGGAGCCAATTTCTCCACCTCTACAGCATCGCTGCAGTCGATAGTCAACGGCGGCTGGGGCCTGCGTGCTCACCCCTTGCCACCGACGGGACCCGAGATTCCGTCACCATGGGTCGGGTTACCGACTCCTCTGGTGGGGATCTCGAAGATCAGGAAGAGCTCCTCTGAACGGGTCGTTGCGATCAGGGGACTGCCCCCCCACTGCGCTGTCCATCAACTGAAGGATGGCCTAAGGTTACAGGTCACGTAGGCCACCGGATTTCCCCACAAGCACGGATGGAGGTTTGGCTACCGCCTCGACTCGGACACCAGAGCCTCTGCTTAGGCACCAGCGCGGTGAGAGGATGATGTTTGGTCTGTCCGCGACCTTTATTGCCTTTCCCCTTTCTTAAAGACTTGTGCGCTCCCAGTTACCAGAATCAAAATTAGAATTAAATTAAATTTCCAACGGCAATTTTTTAAAATTTAATTTTTTGAATTTCCGCGCCCTACTGTCGCAACACAACACTGATCACACGGTTGATCTGGCAGCACCTCCCTCTCCAGATCGCCCGCTGCGCTATCAGCTGTTTATCCGCTGCAACAATCGCAAGATAATAAAATTACCTATTTACATGAAACAGGCGCACAACCGAGTACGCTCGCGTGATTGCAGCGCAGAACTATGGCGCGACTCCACCGTGTGTTTTGCCAGTTGCCGCACACACCAGCCGACACAACCTTCTATGGTTTCGAATTATTTCGCGCCGCGTAATTTAAGACGTCCGTCTTCACGGCGATGTAGACTTATTCTCCGCACCAGGATTGAGTGTCTAAGCCTGTGCGTTCAGAGTTAAACTTTGGCAATACGACAGCATTGAGTTTTTGGGTCTCTTTGTGAGTTTTGCACTTCTTTTAACAGTTCAGGAAAAAATGGCGATTCTGCGACTCTAGAATTGTCAGCAAATTGTTTTCACACTATTGTAGTATGCACACACATATCGGTTAAGCACTGTACCCCTGTATTGTACATTCATAATTGTAGCACTCTGTTGCAGTAATGTGCATAAACAGTCAACACAAGTGTATACGTAATACAGCACCCACTTGAGGGCTAACATACATAATTGCCTGGTCAGCAGTTCTCCGCTGGCCAAGCGCTGATCGCTTATATATTATTGCCTATACCACTCCTCCTCCAGCACCATCGCTCGGCGACAGTACATATATATATACATATATATAAGATACGCATATAAGCGTTGCTGCGCTGCAGGCTAATACCGGCAACGCTGCTCCTCGACAGAGCTAAGAAACAGCTGTATGTAGATCATAAGAGGATTGACGAATTAATTTCGAATGGGGCAGGACCTTCCTGTTCCTCAAATTGGATCAAATAAAGAACAGCTAAAACACAAATGATCTATGACACAATGAAACTACAGGAAGTTGGGTAGGCGGTCCCACACTTCTGATGTCGGATCTGAATCACTTTATACTCGGCATCACTCTCTACAGCGGACACAAAGTAACAGAAAACGGTCGTTAGCGAAATTAAAATAAATCTGCGACAAATTACAGTTTGTCCAAGAAACTGTTTACACCGTGAAATAAGATGAATTTTTTTGATTTTAACGGTCAAAATTAAAGGGTTATTTGCCCAATTAAACGCAATTTTTTTAGGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAAAACAAATTCAAAATATCAAATGCAAGAAAATAAACAACAGATTCAAGTTTAAACACTTTTGAGAGTTTCAAGAAACTCTTTACACAAAACACTAAACCTAAAAGTTTAATCCTAAATTTTTAAATTATTTTGTTAAAATTTGAAGAAGTTAGTAGTATTTGAGTATGACCCCCATTGGCTTTGGCTACAAGTTGGAAGCTTTTTTTCATGGAATGGATGAGTTTTTTTTTTTAGGTCATATTCAAGCGGGATCTTTTCCCACTCTATCGCAGCCATGAGCTGTTGTCGTGTTTTGGTGCCCTTTGCCACATTCTTCTTTAAGTAGGCCCACAAATTTTCAATGGGGTTCAGATCAAGACTCTGAGGGGCGTATCGATCACCTTACCCACAGTTATAAAGGCAAGTTGCGTACATTGCACTCTTTATGTTTGGGATCATTGTCCTGATAAAACTTAAAATTTAACTAATTGTTGCTAAAATAGACCAAATTTTCTGCACTGGCCTTCAAATTTGATTTTAAAATATCTAGATATTGCACGGCATTCATAGTGCTTTCAATAAAGGCTAATTTGCCCCTCCATGGCTTGAGATACAACCCCAAATCATCACTGATAATTTTCCAAATTTGATTGTTGGAATGATATTTTGTTTTTTTTCTAGCGCACTCAACGAAACGCCATACTCTGCTTGGCCCACATCGTTATAATAGAGAGCATCATTTTTTTGTTTCGTCACAAAATATTACGTCATCCCAGTACTCTTCCGCATGATCCATCATGCTCACAGCGAAAATGAATAATGACGCTTTCTATATTGACCTCCTGATAGCAAAGGCTTTTTTCTTGCAACTCTTGAAGAGTACCTATAGCGTAGAATGACTTAGCGCACAGTTTTGTGTAGCACAACTAGAGTCACGATGCTTGCCTGATATCCTGAGCAAGTGATCTGACCGAGATTCGGGGGGTTCGCAATCACTTTTCGCATAATAAGGCGGTCCTACGCTTGCTAATTTTGGATTTTGCGCCCACCACTCTTAGGTTCAAGCCTGTTCTCTTTTTCAAGCGATTAAAACATTGTAGACGGTCTTACGGGATACAGAAACATTTATACTAATTCTGGAATAGATTTTCCCAACTGGTGGTTTTAGTATATTATTTGGGTCACTTCAAAAGCTAATCTATTTCCAGGCATTTTATTAAATTTAATAACTCATTCGATCAGCAAAATTTCACAAGCAAAGTAAAAAATTTCCAATAGAAGCGTTGTAAAAAAGGAATGCAAATGCCAAAATAACGGAAAAAATCGAGTTCGTTCTAAGAAAAAGGCAAAACAAAGTAGGAAAACAAAATGTGTAAGGGTTTCTTGCCACTCTCAAAGTGTGTAAACTTGGAATTTGTTGTTTTAATTTCTTGTATATTTGATATTTTTAGTTGTTTTTTTTAATTTATAAGTAAAGAGTAAATATTGTTTTAATTATATTTCATTAAAATTGCGTTTAAAGTGAAATAACCCTTAATTTTGACCTTTAAAGTGAAAAATTCAGCTTATTTCACGGCGTGTAAATAGTTTCTTAATAAAACTGTATATATCTACAAATTTACAACTTGCCGGTACCATCTGCAAGATTCATTACATTGAGAAGTGGACTTTGACTCTCAGAATGAATTAAAACATTATATTCTTAGATTGAACTGACGAGGAACCAGACTGAACTAACTAAACTAACTATCATTTAATAAATTTAATTAAGTTTACTGATAATTTTGAGTTTCTTACAAAGATGACTAATATTAATTTTTAGTTAAAATAGTTGCAAAACTGAATTTATGTAAATAATATGTTCAATTGATCTGGTTGGGTTTTCTGGGTCTCCCCAACACCTCGCAACGAATGCTGGATCAAAATTATTCGTCAGAAGGACGTGCACAGTCTCGTGATAAAAGTACAGCAATCTTACTTTTTGAGGTGGCGTGTTGGAAATATGTGTACACATTTAAGCAAAAGTCACATGGCCTGCATCAAAGACACTAGAATAATAAGATGCGTAACAGCCATACACTGGTTTGGCACTATGCAGCCACTTTTTTTTGGTGACAGCCAAAATTGCTCTCTTTCGCTCGCTCACGCTGAGCGTAAGAAATCTAAAAAATAAATTTGCTTGCTTGTGTGAGAAATTAAAACAAAAGGCGAAAGAACGCGTATATGTGTGCGTGTTGTGCTAGAGAAGGCGATTTTCGGGCCGAAATCAATTCTGATCGCAGTAACGAATTTACATATGTACATACATATTTGGGAGTTTGGCCAATTTCGTAGAATATATGATGAAATTGCGCGCTGTTTAAGATATCAAATTGGAATATAAAAAAAAAAACTGAGAGATCATTACACTGAGAAAAAAAATATTTCATAAAAAAAATAATGCGAAGTAGAAATAAAATTTATAAAATAAAAAAAATGTTAACTGTTTATTTACTGGAAACGTCATATCAAATTAGAATTATTCTAGTGTCTTTGCTTTGGTCATATCTTGAGGCTGAAGTGCGGACACAAGCACTCAACAATCATTGTCTTCTTAATGCTCAAGCAGAGCGACACGACGAAGACCCTAACTGCTTTGAAATGGCAGAGAGTAAAATAAAATCCAAAAAAGAGACCAAGAAAGCCCCTCCCGAAGTTCAAAGAAAACAGGATTCCCTGGACAATTCATCAAGCACCAGCGCAAAATAATTTCGCTCTCTTAAGCGACGGATTGCTGCCCCGACAAAACAGGAAACAAATATAACAAAACGAAGATCTCAGGAAATGGTAAATGAAGACAGTGCAACTGATTTTGCTAAAGCCCCACCTATCTTTCTCTCGACGTCAATGGTATAAATTGAAAGCTAACCTATCTTAAAACTAAAATTAAGAGAACTTTTTTTATTATAAGACTCAACGTTATGGACATGTAAAGGTAATGGTTAAAAGTATTGAAGGAATTCCCTGAAAATTAGTCAAAACCTTAATAATGATTGTGTGCAGTACCACACATACCAGCTTAAGGATGACAGAGCATTTAGAGTTGTTATTAAGAGGTAG
->60b7b35b-60d3-4de7-b0f5-e19d5246578e
-CGGTATGCTTCCGTTCGGTTTGCGTATTTGCCCCCCTATCGTTGTTAAAGCATCGGCTTCCATCCATCGTTCAGCGGTATGAGGTCCAGCATTCGCGCTGGCGTCAATCCTGGCGTCGTCCTCTGGTGTTGGATGTCCTGCTGCCCCATTCCACTTTAATGGACTTGGGAGAGGCTGCAGCGTTTGATAGCTGCTTTACCTGCCTCGTCAAAGGATCATGGACGATTATTCACTACCAGAGGACGTGGGTTCAGCAGGGCATGATGTCACCGCATTGCGCTCAACCCACCCAGTCTGGGCCAGGAGGCTCTGGGCTGCTGCAATGATTGACGATGAGCTGTACTACGCTATAATGGGCGTGCATTAAGGTGTCTTGGCATCTTTTTTAGTGTCATCTGTAAGTCAGGCGCATAAAGCTACCCGTCAGGTGGTTTCTATCCCACCTCGCTGCTGCAGATCAGGCATTTTGAACAGCAACGCACCCTTTGCCTTGTGCCACGCTCACCACATCTAAGACAGCAGTCTGCCCTATCAGTGTCGCCCGCAGGTTGCTGATCGATGCCCATAGCCAGGACACCTGCGTAGCATCTCGTGGGTCCGGGCGTCACGGTGATACGACATCTTGACCGTCAACGATTATGGTGCTTGCCCTGTTTGGGACTGGTATCGCAGCGTTCGCGTTCCAGCTAGCACAAGGGGCTAATTTTAGCGCAGATTTCCGCATGCAAGAAGGCCCTGATATCTTCAGGATTTATCCTTGCCCAGGCCCTGGAATTGGGCGAGCCAAGAAGCCGGCTGCTGGGGCTTCTCTGCTGTCGTAGCCTCGTCAATCCGCTGCAAGATAGAGGCTATTCTTTTGCGCTCCTGTGCGCACAGAGATAAAGTCATTGAGCGCCGCTTCCGTTCGCTCTTAAACTTGGGAACCTTTCCGGGGAGCTTTCCCTCTACATCGAAACAGCAGATCCACTTGCTTTCTGCGTTCTCCAGTTTTCATACGTGACTGCCCAGTTCCTTTAAAGGCTCGATTCCGATCTTAGCTTCCGAAGCATCTCTGCGTACGAGCCCCTCTCCTGTCTTTTTTTACGATGAGTGCCTCTGCCGTGCTTTAGCACATTCGCGACGGTCATGGCTACTTACCGAAGCGGACTCGTTAGGTATGGATGTCGCCTTTTTCTTCACCGTTGCCATCCAACGTAGGGTTGCTCTGCTTCAGCGCCTGGACTTTTGGCACCTGCACCGTAAGTGCCTGCGCACGCATTTTGTGGAACCTTTTTTAGCGGTAGGCTTTTGTACCTCCGTCTGGGTGAAGCGCTGCTCTTAAGAAGCGGTGCTCGCTGAAAGTGAAACCACCTTCAGTACAGCTCCTATCGCCCTGTTATTTGGGCTGGGAGTTCGGAAGCTATGCCCTTTATCTCTCATGTGTATTGTCGTTGGAGTCTCGAATGCGGATAGAAGGGCTGATCTTGCCATTCATCCTGGTAAGTATGCCCCTCAGGTCACTATCGTTCTGGAGGCAGTGGTCAAGTCCGAAGACCGATGAGGGAACCAGCTGGGGACTTCCACTCCGTCTTTTTTGCGATGGCACGGCGATGTAGTCCATCGATCTTCTGACTTTATCGCCTTGGTCGTAGATGCTGCCAAGACCAATTTCTCCACCTCTACAGCATCGCTGCAGTCGATAGTCAACGGCGGCTGGGGCCTGCGTGCTCACCCCTTACCGACGGGACCGAGGATTCCGTCACCATGGGTCGGGTTACCGGCTCCTCTGGTGGGGGGGATCTCGAAAGTCAGGAAGCTCCTCCTGAACGGAGTCGTTGCGATCAGGGGACTGCCCCCCCTGCGCTGTCCATCAACTGGGAAGGATGGCCTAAAGGTTACCCTGAGTCCCGTAGGCCACGGATTTCCCCACAAGCTTTACGGATGGAGTTTGTACCGCCTCGGCTCGGACACCAGAGCCTCTGCTTAGGCACCAGCACGGTGGGAGGATGATATTTGGTCTGTCCGCGACCTTTGGCATTTCCCTTTCAAAGACTTGTGCGCTCCCAGTTACCAGAATCAAAATTAAAATTAAATTAAAATTTCCAGCGGCTTAATTTTGAACAATTTTGAATTTCCTTGCTCTATCGCAACACAACACTGATCCACGGTTGATCCTGGCAGCGCCTCCCTCTCAGATCGCCCGCTGCGCTATCGGCTGTTTATCCGCTGCAACAATCGCAAGGATAATAAAATTACCTATTTACGCCAGAACGGGCGCACAATTAACTCGCGTGATTGCAGCGCAGAACTATGACGCGACTCCACCCATTAGCCAGTTTTGCCAGTTTGCCACTTTACACCGGCCGACACAGCTTCTATATGGTTTCGAGTGTTCGGCGCCGCGTAATTTTGGACATCCGTCTTCACGGCGATGTAGACTTGGTCTCCGCACCAGAGTTGAGTGTCTAAGCCTGTGCGTTCAAGTTAAACTTTGGCAATGCGACGGCATTGAGTTTTAGGTCTCTTTGTAGAGTTTGCACTTCTTTTAACAGTTCAAGAGAATGGCGATTCTGCGACTCTGATTGTCAACGTTGTTTTCACTATTTATGAAGTATGCACATATCGGTTAAGCACTGTACCTGTGTAGTATTCATAATTCAGCACTCTGTTGCAATGTGTACATAAACAGTCCAGCACAAGTGTATACGTAATACGAAACTTACTTGAGGGGCTAACATGCATAATTGCCTGGTCAGCGGTTCTCCCGCTTTATTGGCTAATCAACTTATATGTGTGCCTATACCGCCCTCCTCCAAGCACCCATCGCTCGGCGGTACGCTATATGTACATATATATAAGATGCGCATATAAGCGTTGCTGCGCTGCAGGCTATGCCGGCAGCGCTGCTCTCGACTTAGACTAAGAAACCTTTGTATGTAGATCCTTAAGAGGATTGACGAATTAATTTCAGATGGGCCAGGACCTTCCTGTTCCTCAAATTGGATCAAATAAAGAACGAAGCTAAAACACAAATGATCCTGGCTGAAGTAGAGCTACAGGAAGTTAGGTGAGCCCGGTCCCACTTCGATATCGGATCTGAATCACTTTATACTCAAGCATCGCTCTCTACAGCGGACACAGAAGTAACAGAAACGGTCGTTGGCAGAATTAAAATAAATCCTGCGACAAGTACAGTTTGTCAAGAAACTGTTTTACCGTACGAAATAAGATGAATTTTTTGATTTTAACTTGGTCAAAATTAAAAAGGGTTATTTGTAATTAGAAACACCAATTTTTTTTTTTTAGGAAATATAAGGAATTAAACAATATTTATTTTTACTTATAAATTAAAAAAACAAATTCAAAATATCAATATACAAGAAATAAATATAAATTCCAAGAGTTTACACACTTTTAGAGGTATCACGCTCTGCTGAGCCATCATCTCTGGGATGAGCTGAAGTAGAGTCCACCTCCCCCGTCGCGACGTTTGCCATCTGCTCTGCCATTCACCTAATAGCCACTCGTGTGCCTCTTGCCTCGACGCCACTCCGCATAAGGCTAGAGGCCTTGATCTCAGATCAATCAGCAGGCCTGCCACAGCGCTGAAAGCGCCGCGTCTTCGGATATGGTCCTGAATCCTCTAATGGGCCACAGGGCCATTGACCATCAGCACCAGACAGGCTCTCCTTTCAGGTATGAGACCCTGCAAGTGGCATTGCTCCCGAATAGTGCAGCGTATAGCAGCAGAAGCCTTTGCTTACTGACACCAGCAGTTTCCTGGCCAGGTATCTTGGGCCTCCGACGTTGGGCTCAGCCTCGCCAACGAGAGGATGTGACTGCTGTCTTCTTGCTGGTTGTAGCTCGCGTGGTCCCTTGAACGATAGTCCTGCGATCTATCGTACCCCAGGTACTTTAGGGACTCTTGAGGAGGTCCACTGGAGTACCCTTATTGGAGACCAGCATGTTCCCATCTTTTTTCCTGCTGTAGTAGGACTGCTTCAGTCTTGTGAGCCCATATGTGCTAGCCCGGCTGTGATTGCCTTACATCGTCAGCCCAGAACAGCTGCCTCGACGACTGAGTTCTGTGACGCTTTTTTGGGGAAATCTGGGGCAGGAGGCTGCCTCTGTTGGCCTCCATAGTGTGGTCTGCTTTGGAAATAAGCTCCTAATTGTAGCCCAGGACCCCCCGGTCCGGATGGGGTTGCGCTCTCCTCCTTAAGCTCGTTGGTAACAAGCATGAGCGCGGGGCCCCAGATATCGCTGTCTACGCCATCCTGCGAGCTCAGCAAACGATAGCCGCGCTTTGGCAGCCGCGATGCCGTGCGCCCAGACTCTAGGCGTTTGCTTCTGAAAGCCTCCAAAGAGTTCCGCGTAAAGGTGGAAGAGTACTGCCTCTGGCTCGTTGCTTGCGCGCCGTTCTCTTAGCCCTGAAGCGAAATCAGACCGTAGTTGAAGCGGGGAGGCCTCCACCGATAAACGGGTGGTTTGCGCTGTCACCTTATTTTCCAGCCAGCATGGTGCATTCGCAGATTCACTTCCCAGCATATTCATGAGGGCCTGCCGCCATGCACTCTCTGCGTCCACATTTGGGGATTTCCAGGAATTGATCGGTGGCATGGCCTCATCGATCTTCCTGGTATCCCATGTTTTCCGGCTGTTCTACTCCTGCCGTCTTTTGGGCGTGCCACTCCGGGGAGAAGGAGATCAGGGCATGGTCGCTCAGCGTCAGCGGCGTCATGGACCATCCAGTTATTTGTTATCTACACTGGCCCTCTGCTGACAAAGGTAGCGTCAATAAAAGGACGTATTACCCCTATCGTTGATGCGGCTTGTCGGCTTCCGTCCATCGTTCAGCGAGTATAGGGTCCAGCATTCGCATGGCGTCAATCACAGCTCGTCCTCTGGTGACGGATGTCCTGCTGCCCCATTCCATATCAGGCATTAAAGTCGCCGGCAATGACCTTCAGGCTTCGCCACTCTCGCGCATAGTCCACGAGCGCCTCCAGAAGCTCCTCAGGGCTGATGATCAGGGTGCAATAAGCTCGGCGGAGCGTAGCAATATGCATGCGTGTTTTAGCTTCGCATACGGCATTACCCGCATGGGTAAAAGCAGCCAGTTCCTGGACTTGGGAGGCTACAGCGTTTGATAGCTGCGCTTTACACCTGCCTCGTCAAGGATCATGGACGTTATCCCACTACAAGAGACGTAGGGTTCGCTTAGGAGCATCAGATATCACCACATTGCGCTCAACCGCAGTCTGAATTACGAGGAGGCTCTGAGCTGCTGCGCAATGATTGACGATGAGTATACTACGCTAATATGAGGCGTGCATTAGGTGGCTCTTGGCATCTTTTAGGTATCAGCTCTGTAAGTCGGGCGCAAAGGCTACCCGTCAGGTGGTTTCTATCCCACCTCGCTGCTGCAAGATCAGGCATTTTGGTGCAGCAACGCACCCTTTGCCCCAATGCCCACGCTCACCCGCGTCGAGACAGCAGTCACCCTGTCAGTGTCCTTACGGGTTGCTGATCGGTGATGCGCAAAGCCGGGAACTGCCACTATAGCATCTCGTGGGTCCGGACGTCACCAGATGATGCGACATCTTGACCATCCAGCGGTGGGTGCCTGTTTGGGACTGGTATCGCAACGTTCGCGTTCAGCAGCACTGGGGCTATTTCAGCGCAATTCCGCGTAATACTGCAGAAGGCCCTGATATCTTCAGGATTTATCTGCGGAGAACAGGTGGGCGGCCAAGCAGCTATGGAGCTTCTCTGTATCGTAGCCTCGTCAATCCCGCTGCAGATAGAGGCTATTCTTTTGCGCTCCTGGCGCACAGAGGAGAATTAGAGTCGGTAAGGCGCCATGCCAGGTCGCTCTTAAACTTGGGAACGCTTTCCAGAAGCTTTCCCCTCTGCGCCTCAGACAACAGATCACCTTTCTGCGTTCTCGGATTTTCGCACGTGACTGCCCAGTTCGCTAAAGGCTCGATTCCGATCTCTTAGCTTCAGAAGCATCTCTGCGTACAGAAGCCCCTCGCCATCTTTTACGATGGAGTGCCTCTGCACCCGTGCTAGCATTCTTGGCGACAGATGCACCTTAGCACCTGGCAGACTCGTTAAGGTATGGATGTCGCCTTTTCTTCACCGTTGCCATCCAGCGTAGAGGTTGCTCTTAAGCCCGGCGCCTGGACTTTGGCACCTGCACCGTGGAGTACCTGCGCATTTTGTGGAGCCTTTTGTTAGGCTTTTTGTACGCCTCCGTCTGGGTAGCGCTGCTCTTCAAAGCGGTGCTGTAATGTCACGCTGTACGAAGCTCTATCCCTTGGCCTGTTGTTGGGGCTGAGAGTTCAGGCTATACCCCTTTATCTCATGTGTCGTTGGGTCTCAGATGCGGATAGAAGGGGCTGATCTGCCATTTCATCCTGAAGTAAGAGTATGCCCCTCAGGTCCTCGTTCTGGAGGCAGTGGTCAGAGTCCGAAGACCGATGGGGAACAAACTGGGACTTCCTCCCGTCTTTGCGATGCGGCACGGCGATGCTGGGTCATCGTCTTCTGACTTATCGCGGTCGTAGATGCAGGAATGAATTTCTCCCTCCTACAGCATCGCTGCAGTCGATGAAGATCAACGGCGGCAGGGGCCTGCGTACTCACTTGCCCGCCACCGGCAGGACCGAGATTCCGTCACCATAGGTCAGGTTAGAGCTCCCTCACGAGTGGGGATCTCGAAGAATCAGGAGCTCCCCTCCTGAACAGGTCGTTGCGATCCAGGGGACCGCCCTGCGCACCATCCATCAGCTGGGATGGCCCTGCGCAGGTTACCTAGGTCACATGGGCCACGGATTTCCCCACAAGCTTTTTTTTACGGATGGAGGTTTGTACCGCCTCGACTCGGACACCAGAGCCTCTGCTTAGGCACCAGCATTGAGAGGATGATATTTGGTCTATCCGACCTTTGTCGCCTTTTCCCTTTTAAAGACATGCGCTCCAGTTACCAGAATCAAAATTAAATTAAATTAAATTTCAACGGCTTAATTTTAAATTTAGTTTGGATTTCCGCGCCCTACTGTCGCAACACAGCACTGATCGGTTGATCTGGCAGCGCCCTCCCTCTCCCGAATCGCCCGCTGCTATCGGCTGTTTTATCCGCTTGCAACAGTAGGATAATAAAATTACCTATTTACATAGAGCTGGGCGCACAATTAGCTCGCGTGATTGCAGCGCAGAACTATAGCGCGACTCCACCGTGTTGTGATTTTGCCAGTTTGCCGCACCACCAGCCCGGCCCACCTTCTATGGTTTCGAGTATTTCGGCGTAATTTAAAGACGTCGATAGCTTCACGGCGACGATGTAGACTTAGTCTCCGCACCGGGATTAGTGTCTAAGCCTGTGCGTTCAGGATTAAACTTTGGCAATACGACAGCGTGGAGTTTTAGGTCTCTTTGTGATTTTGCACTTCTTTTAACAGTTCAGAAGAGTAGTTCTGCGACTCACAAGTTGTCAGCAAATTGTTTTTCCACTATTGTAGTATGCACGCTATCAGTTAAACTGCTGTACCTATGTGTATTCATAATTGTAGCACTCTGTTGCAGTATGTACATAAACAGTCCAGCACAAGTGTATACGTAATACGAGCACCCACTTGAGGGCTAACATACATAATTGCCTGGTCAACAGTTCTCCGCTGGCTGAAGCCTCTGATCGCTTATGGCGCCTATACCGCTCCTCCTCCAGCACCATCGCTCGGCGACAGTACATATATATATACATATATATAAGATACACGCATATAAGCGTTGCCGCGCTGCAGGCTATGCACCGGCGGCGCTGCTCGACTTAGGCTAAAGAGACGCTGTATAGCAAGATCATAAGAGGATTGACGAGATTAATTTCCAGATGGTGGGACAGCCCTGTTCCTCAAATTGGATCAAATAAAGAACAGCTAAGAAACACAAATGATCTATGAAGCACAGTAAAACTACAGGAAGTTGGAGTAGGCGGTCCCGCTGATGTCGGATCTGAATCACTTTATACTCAGCATCCTCTCTACAGCTGGACACAAAGTAACAGAAAACGGTCATTCTTTGAAATTAAAAATAAATCTGCGACAAAATTACAGGTTTGTCAAGAGCTGTTTACACACCGTGAAATAAGATGAATTTTTGATTTTAACGGTCAAAATTAAAGGGGTTATTTGCTTGAATTAAACGCAGTTTTTTTTTTAGGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAACAAATTCAAAGATATCAAATATACAAGAGAATAGCAACGAATTCCAAGTTTGGCTTACTTTTGGGGAGTTTCAAAGGAAACTCTTTGCACAAAACACCTAAACCTAAGTTTAATCCTAGAGATTTTTTACAAATTGTTTTGTTTAAAGGTTTGAAAGTTGTAGTGTTAGTACTTGACTTACATTGGCTTTGGCTACAGGATTTGGAAGCTTTTTTTTTCATGGAATGGATTAAGGTTTTTTTTAGGTCATATTCAAGCGGGATCTTTCCCTCTATCGCGGCCATGAGGCTGTTGTCGTGTTTTGGTGCCCTTTTTTGCCACATTCTTTGCTTTAGAAGTAGGCCCTGGAGATTTTCAATGGGGTTCAGATCAGAGACTCTGAGGGCGTATCGATGCTTTTATACCACAGTTATAAAGGCCAGTTGTTACGACTGCACTCTCTTTATGGTTTGGGATCATTGTCCTGAAATAAAACTTAAAATTTGGCTTATTTGTTGCTTCGACTAGACCAAATTTTTTCTGCACTGGCCTTACTAAGTTTGAATTTTAAAATATCCTAGATGTGCACGGCATTCTTGGTGCTTTCAATAGAAGCTAATTTGCCTCATGAAGCGAGATACAGCCCCAAATGTCGCTGATAATTTTTCCAAATTTGATTGTTGGGAATGTCTTTTGTTTTTTTCTAAGCGCACTCAACTTGGCTTGCCATGCTCTGCTTGGCCCATCGTTATAATAGAGCATCATTTTTGTTTCGTCACAAAATGTTACGTCATCCCAGTACTCTTCCGCGCCCAGTCCATCATGCTCACAGCGAATGAATGACGCTTTTCTATATTCCGGCCTCTGATAGAAAGCGTCATTCATTCCTTTAATATTTATAATGGATCATGCAATACTGAGACGCAAACGTAATATTTTAAAATGATAACTCTAACGATAGATTAACGGCTTTTAATGAAATACTGGCAAAATTCAACAATCAAATTGGAAATTATCAGTGATAAATTTAAAGGGCTATTATCTCAAGCCATGGAGGTAGTCCAACTTTAACGATGAAGCACTATGAGCTCGTTAATATCTGAATATTTAAAATCCAAGTTGAAACCGGTCTTGAAAGAGTTGGTCTGTTTAGCAACAATAGCCAAATTTTAAGTTTATCCGGGACGAAGCAGAGCATAAAGAGATGCGTATGGCTCGCTTTTGCTAACTTTATTGACGAATACGCTCTATCGGCGATCTGAACCCGTTAACTGGTCGCAAGAAGATGTGAAAAAGACGCAAGCTGCGACGGCAACTTCATGGCGCGATAGTGGGAAGATCCCTATGATAAAAACTCGATATGAAAAAGAAACTTCGGCAATGAAAACCAATGGTCGCTAAATAACAACTTTCAAATTTTAACAAAGATATTTAAAAATTTAGGATTAAACAGGTTTAGTGTTTTGAAAAGTTTCTTGAGCTTTCTCAAAGAAATTTAAACAGGTCGTTGTTCATTACTAACTGTATATTGATATTTTGAATTTGTTTAATTTATAGATAAAATTAATATTGTTTATTATATTTCCTAAAAAAATTGCGTTTAGTAAAGCAAATAACCCGCTGGTGACGGGTAAATCGAAATTCACGGTGTAAACGGTTGCCGTGGCTGCCGTTATTTTTATTTCGATTGGCGACAGATTTTCTGTGCTGTGTCATATGAAATGATGCCGGTATAAAGTGATTCGAGATCGACATCGAGATGAGACCGCCTTTCGCAACAGTTTCATTGTGTCATAGATCATTTGTGTTTTGGCTGTTCTTTGGAAGGTCCATCTCCATTCGAGGTAATTCGTCAATCTGTATGTTCCATGCAAAGGTTTCAACTGAAGTCGAAGAACGGCGCTTTGCCGTATGGCCTGCGGCGCGGCAACGCTTATGCGTATCTTATAGCAATATTGTATATGTAGGCATGATGCTGGAAGGAGGTATGAAACGCACGCTGCAAGCGTCGGCAACGGCCAGCGGGAAGAACTGCTGACGCCAGGCAATTATGTATGTTAGCCTGATGAATTAACTCGTATTACGTATACGCTTATTAGCTGGAACTGTTTATACGCATTGCAACGGAAGTGCTACAGTATGAATGCGCGGTAACTTAACCGGTATGCTGGCCAGTGAGCAATTTGCCCGACAATTCTGAAGTCACCAGGGCTCGCCATTTTCGAACTGTTAAAAGAGTACCAAGCACAAAGGGTAAAAAACTTTCAATGCTGTCATATTGCTGAAGTTAATCTGAACGCGCAGGCTAGACTGCTCGATCTGGTGCGAAGACAGTCTGTCGCCATGAACAGACGTCTTTAATTGCGGCTCATCTCCGGAGGCTGTAAACAGCCAAAATATCACGCAGTGGATCATACATAATTCTGCGCTGCCAATCGCGCCAATTAATATACCATTTCATGTAAAATCAAACCAATTTATTATCTTTGCGTTGTTACGGCGGACTCTTCCAGCTGATAGCAATCTGGAAGGAAAATTGCCCGAATCAACCGTAATGATCGATGTTGTCGTGTACGTGAAAGCGCGGGCAAATTTTGGGAGGCCGAAGCGTTAATTTAATTTAATTTGGTACGATTCTGGCAGGGCGCTTTCGAAGTCTTTGAAGAGGGAGAAACGAAAGGTCGCGGTGAACAAATATCGTCACTCTCACCGTGCTTGATGCTAAACGAAGACTCTGATCCCGAGAGCGATACAAACTTCCGTCGTAAAACCGGAAAATCCGTGACCTGCATTTCAGGTAACCTTAGGCCAAATCGCTCGATTGATGAACTGATGGTATTCTGATCGCAACGACTTCGGGAAGCTCCCGGCACAAGTTCACACCGAAGGCCAACCCGACCCGTATTGACACGGAGACTCGATAAAGTCGATGACGAAGGTACGTTCAGCCACTCAAATTATATCGACTGCAGCGATACTATGGAGATGAAGTAACTCTACATCTACGACATTTAATCGAAGACGATGGACAACCTGTGCCATCGCAAAAGGTGAAGATCCCAGCTGTTCCCTCATCGATCTTCGGACGACATATGCAGAACGGAGACCTGGTATACTTTACCAGGATGAATGAATCAACGCTCGCATTCGAATTAACGGTACATGAAGAACAAAGGCGCTTTCGACTCAGCCCTTAACAACGAGACGATGGCTTTAATACCGGTAGCGGCAGCAATGAACAGGCTTACCAAAGAATACCATCGCGGACTACGGTACGGAGAATCGACGCCGAAGCAAACAACCCTACGTTGGATGGCAACGATGAAAGGCGACATCCATACCTATTTCCGAGAATCCAAGCAATTTTGGCTTCATCTGGCTCTTCGATAACAACGCAGCGGTCTGAAGGCTATCTGGAACGGGAGAAGAACTTCGTACGCAGAGATGCTTTCAGGAAGATCGGAGATCAGCTGCGCAGGCTGGTACGGTCGCGACGCGAAAAATCGAACGCTGAAGAATGGAGAGAAGCTTCGGAAAGCGTTCCCCAGCGACATGAAGCGGCATCCTTGACCTCAATGCTGCAGGGAACTGCAAAGTAACAATATCTTTGCGGCGAGTTGAACGGCTCCACGCAGCTAACGTCGCAATTCAGTTACGGGCATCTGAAGATCGAGAACGCTAACGTGCGGGGCCTGACAAACAGCACCTCGGTGCTGCTGGTTACGCGAACATTATACCGATCGCCAAACGGGAGCGCCATAATCGTTGGATGATCGAATGTCATCTTGGGATCCGACCGGATGCTACGGAGTGTCTCGGCTGGGCATCGTCAGCAATACTGAACACTGACAGGGGACGAACTCTTGTCTTAGATACTGACGAGCGATGAGCTGGGCTGAAAGTGCGTTGCTAACAAATGCCTGATCTTCGGCAGCAGATGAACCACTTACGACGGTAACTGCGTGTGGCACCCTGAAGCGACATAAAAGATGCCAAAATTCACAGCAACTCTGCCGCTCATATTAGCGTAATTACGGCTTTCAATGTCAATCGTTGCGCGGCAGCTCAGGCTCTCTATTCCAGACGCATTGACTCGGCAAAACGTCATGCTCTAAACGATTTCGTCTCTGTTAGTGGAACAATCGTCAGCGATCGCCTTGACGAACGAGTGAAAACGGCTTCGATGCTGCGGCTCTCTTCAAGTCCGGGAACTGGCTGCTTTACTGTGCGAGGCTATCTTGGATGCGTACGTAGCATCTGCAGCTTCTAACACAAACACCCGATATCGATTCGAGGAAACTTCTGGGCATCTCTGAACCAATAACGGTGAAACGAATGCCGGCGACTGGCTGGACGATGAATGAACGGCAGACATCAACGCCAGGCGGACGAGCTGTGATTGACGCCGTGCGATGCTGGACTACGCTGCTGCTGAACGATGGACGGAAGCCAACGATAAGGAATTGCGTCGCTTTATTGACGTTTCCTTTGTCGGCAAAGGAAAATACTGGTAACAACGGTTCGGTGCATGACTGGTACGATCTCTTCCCCGGAGAACATGCTTAAAGACGATGATAAACGGCCGAAGCATGGGACACCAGGAGAAGATCGATGAATATGCTGACTCGGGATCAATTCCTGAAATCCCAAATGGACTGCTGTATGATAATATGGGAAGAATCGCGACATATTTCGATACCGAAAAATGGGCACGGCACTAACCACCGTTACTGATTGATTACCTCCCTGAAAGCAACTACGATCTGTTAACACTCGAGAACTGAAACGGCCTTTGCCAACCGGGCAACCACCCACCGCCGGAACTCTGGAGCTTTCGAAAGCAAACGCCAGTCAACGCGGCAGCAAAACTTGCGTCGTTAAGGGCTGCGGGATGGCGTAGACTTTAACGATGGGGACTCATACAACTTGTTACCAACGAGCTGGAAGGAGGCAACATCCGACTTAGTCGCTTTATGCTAAGGGGAGCTATTTCAAAGCGGACTTCCACACTATGGAGAGCCAACGGAGCGGCCCTTTCCAGGTGGCGTCGCAGAACTTCGAGGATCATCGAGAACGGCTGTTCATCAATGACATTTGGCCAGCTGAGCCAGCAGCCAGCATTTCTACCAGCGGAAAAGATGAGAACATGCTGATGCTCGATCGAAATTGCTCGGGGGGACTTCAGATACCGCGCAGATCGCGGACTATCGTTCAGCGAGCTTCGACGGCGGTCACATCTCTTCGTTATATGCGTCGGTGAACTTACCCGGCCGGGGAAGCTTGCTTTGGTGTCGTAACGAAACTTCGCTGCTGCTGCTGCGCCGGTACTGGGCTGCCGCTTGCGAAGTCTCATACCTGAGAAAATTCGGTCTTACGGTCAATGGCCTCGGAAGGATTCGAGACCATATCAGACGCGGCGCTAACGCTGGCAGTACTGCGATCTGGAGAATCTGACTCTCCAGCTGTGCGTGAATAACGAGCAGATGGCAAGCATTCGCGACTTGAAGATGAACCTATCGGCTCATCCCGAAGATGACGGTGGCAAATGTTGCTCTCAAAGTGTGTAGGCGGGATTTTGTATTTATTTTCTTTATACATATTTGATATTTTGGTATTTTTTAATTTATAAGTGGAAATAAATATTGGGCTGGTACTGTTCTAGCGTTTGAACAAGCCAAATATTGATTATCAAAGGAATTCATCTTCTTCGCGGTATTAATAACGGTTCTTGGAAACTGTACTTGTCGCGAATTTATTTTAATTTCGAGATTAACGACCGTTTTCTCTGCTTGTGTCCGCTATGAAAGAGTGATGCCGACAAGTGATTCCGAATCCATTTCAGTGAGACCGCTACTCCCAACTTCGCTAATAGTTTCATTGTGTCATAGTCATTTGTGGCTGTTCTTATTTGATCAATTTGAGAACGAGAGGTCAGCCATTCGAGAGCCAATTCGTCAATCTCTTATGATCATGCAAGGGGCCTGGCAACTTTAAGTCGAGAACGGCTTTAAACAACCTGCGGCGCGAGCAGCATATACAACAAACATCTTGTATGTATATGTGCTGTCGCCAATATTGGTGCGAGAAGGTAATGAACGCATAAACGTCGGCGCAGCCAGCGGGAGAACTGCTGACCAGGCTGACCATGTTAACCCGCCAGTGAACCTTCCATTACGTATGCGCCAGTAGCACAGACTGTTTATGTACATTACTGACGAAGTGCTACAGTGTGAATACGCAGGTAAATTAACTTAACCGATAATATTGCGTGCTGATAGTGAAAACAATTTGCTGACCTTCCAGAGTCTGGAAGTGCGGAAACTCACGAAAGACAAAAAACGTGCTGTCGTATTGCCAGAAGTTTGTCACCGAACGCGCAGGCTTAGACACTTTCGATCTGGTGCGGGGAACCAATCTGCATCGCCCGTGAGACGGACGTGCGTGCGGCGCGAAATACTCGAGCAAACGTCGGCCCGGTATTAACGGCAAACAATCACGCGGTAGGTCGGCATCGCTGGTCTGCGCTGCAATCGCGCAGTTAATTATTAATTTCATCAAAACTCGGTAATTTATTATCTTGCGATTATTGCGAATATCGCTGACTGATAACGCGGCGAGTACGTCTGGAAGAGGAGACGTTGCCCGAGATCGGCCGTGTGATCGGTATGTTGTGTTGCGATAGAGGCGCGGGTGGAATTTAGGTTAAGCCGTTGGTAATTTGGTGGTACGATTTCTGTCGACTTCGGGTATCTTCTGATCTTTGAAGAACGAAGATCGCCGGTTGAACAAATGGCATCTCTCTGCATTAGCACGGTCTAAGCAGGCTCTTGGTGTCGTCGGTATTCCCGTCGTAAACCGGGGAAATCCGTGACGTGAACCTGGAAACAGGCCATCCTTTCGGTCGATGCTTGGCGCGATGAAGACGTCTGGTTTTAACGACGGAAGGAGTAACTTTTCGAGATCTACACCCGGAAAACTGACTATGACGACGGAGATCTCGGTCCGTCGATGACGCGAAGTGGCGATATTATAGTATTATCGACTTCCGGCGACTGGCAGAAGGTAATTGGCTCCTGCAGCATCTACGACGCATTTGAAGTTATCGTGGACCGCATCGCCGTGCCATCGCAAAGACGGAGGAATACGGCTTCAGTTCCCCTCATCGATCTTCGAACGACCGCTTTATGCCAGAACGAGGACGTACGCACCGGGATAATCGAAGATCAGCCCTTCATCATTCGGGTAACGACACGCATGAACGAAAGGGCATGACTTCCGAACTCTCGGTAACGGGGCGACAAACTGTGCGAAACCGCGAGCGCAGCGGCTGGTGGCAAAAACCTGCCAAAGGCTCACAAAATGCGCGGTACCACGGTAAATTGCCAAATCGAGCTATGGCTAATGCTCCCGATGAACAGCAACGATGAAAGGCGACATCGTACCCTGGCGAGTCCGAAGCCGGGCGACTATGCATCGATGCGCCAAATCTTTAGCGCAGGTGCGCGAAGTCATAAATAAACAGACGAGGAGAATATCTTCGACTTAAGGTCGGGATCGAAACATTAACGAACTGAACGGTCGCGTGCCGAAATCCGGTGAACACGAAATCTGTTAGCGGTGGAAGCTTCGGAAAACGTTCCCCAGGGATTTAAGGCGTGCGAACGGCATCTCAATGACGGCTCTGTGCGCAGAACATCAAAGTGGCTCTATCTTTGGCGGATTGAACGGGCTGCGACTCACGGCGCTGATTAAACTTCAATTCGGTTATACGAATGTCCTGAAGATATCGAGACGCGGTATGCCGATTACGAAAAAATGGTGCCCAACACGTTATACCAAACGAGGCATACATGTCGTTAGTCAGATGTCGTATCACCAGGACGATCCGATACCGAATACAGTGTCTCTCGGCTATGGGCATCGATCAACGGCGCAAGTTACTGACGGGGCGAACTGCTGTCTTAGATGCGGTGACAGTGAACAAAGTTAGCGTTGCTGCACTAAAATGCCTGATCTGCGGCAGCGGTGAACGAAAACCACCCGACGAGTAACTTTAGATGCCCGACTTTGAACGTTTTAAAGATGCCGGAACGCTGCTCTGCGCTCGTATTAGCGTGGTGCAACTCAGTAATCGATCGTTGCGCGGCGGCTCGAACCTCTGGCAGACTTTGCGGTAACTTTAATGCGAACATCGTAAGCGAACCCTGCGTCTTCGTGGACAATCGTCCATGATCCTTGACAGCGAGTAAGCTCCAAGCTGCAGCCTATATCGAACTGCTGCTGTGCGGGTATCATATGCGAAATTAAAATTTACGTGCGCATCTTCAGCTTGCTACCTTCGCCGTACCCTTCGAGGAAGCTGGAAGTGAACCATGCGAGGCGAAACCGAATCATTGCCGACAAACGTGGATGAAACGGCCAGGGTAATCAACACCAGAGGACAGTGATGACGCCGTATATCTCCTGCTGGCGAACGATGAAGCTTTCCTTTAACGATAGTGGCTGTCGCGCGGG
->b0a82472-5383-452f-9d0f-967696824d91
-CTGATGTACTTCGTTCAGTTACGTATTGCTGTGCGTTCAGGATTAAACTTTGGCAATACGGCGGTGAAAGTTTTGGGTCTCTTTGTGAGTTTTGCACTTCTTTTTTTTAACAGTTCAGAAAAATGGCGATTCTGCGACTCTAGAATTGTCAACAAATTGTTTTTTTCACTATTGTAGTACATATCCGGTTTAAAGCACTGTACCTATGTGTATTCATAATTGTAGCACTCTGTTGCAATGTACATAAACAGTCCAGCACAAGTGTATACGTAATACGAGCACCCACTTGAGAGGGGCTAACATACATAATTGCCTGGTCCAGCAGTTCTCCCGCTGGCCAAGCGCTGATCGCTTGCTGTATTGCCTATACCACTCTCAGCACCATCAAGCTCGGCGACAGTACATATATATATACATATATATAAGATACGCATATAAGCGTTGCTGCGCTGCGGGCTTCATGCCGGCAGCGCTGCTCGACAGGCTAAGAAACCTTTGTATGTAGATCATAAGAGAGTTCTGACGAATTAATTTCGAATGGGCAGGACCTTCCCTGTTCCTCAAATTGGATCAAATAAGAACAGCTAAAACACAAATGATCTATGACACAGTGAAACTACAGGAAGTTGGGTAGGCGGTCCACACTTCTGATGTCGGATCTGAATCACTTTATACTCGGCATCACTCTACAGCGGACACGAAGTAACAGAAAACGGTCGTTAACTTGAAATTAAAAATAAATCTGCGACAAGTACAGTTTGTCAAGGAAACTGTTTACACACCGTGAAATAAGATGAATTTTTTTTGATTTTAACTTGATCAAAATTAAGGTTATTTGCTTAATTAAACGCAATTTTTTTTAGAATGTAATTAAGCAATATTTATTTTACTTATAGAGGAATTAAAAACAAATTCAAAATATCAAATATACAAAGAAATAGAAATAACAAATTCCAAGTTTACACACTTTTGAGAGTGTCACTCTGCCAAACCGTCATCTCTGGGATGAGCTGATGGAATCCACCTCCCCGTCGCGACGTTGCCATCTGCTCTGCCATTCACCTAATAGCCACTCATTATTGCCTCTTGCCTGGAAGCGCCACTCCGCGCCAGGCTGAGAGCCTTGATCCGCCAGATCAATCGGCAGGCCTGCCAGCGCTAGCGCCGCGTCTTCGGATATGGTCCTGAATCCTCTAATGAGCCTGAGGGGCCATTGACCGTAGCACCGAACGAGCTCCTTTCAGGTATGAGACCCGCAGTGGCATTGCTCCCGAACTGGTGCAGCGTATAGCAGAAGCCTTTGCTACTGACACCAGCGGTTTCCTGGCCGGGTGTCTTGGGCCTCCGACGTTGGGCATAAGCCTCGCCAACGAAAGGGGATGTGACTGCTGTCTTCTTTGCTGGCAGTAGCTCGCGGTAGTCATGAACGATAGTCTGCGATCTATCATTTTACCCCAGGTACTTTAGGGACTGCCAGGGGTCCCCTGAGTACCCTTGACGGGAGACCAGCATGTTCTCCAAAATATTTTTTCCTGCTGTAGTAGGACTGCTGAATGCTTGTGAGCCCTTCGCCCAGCTGGCGTTTGCCACATCGTCAGCGAAACAGCTGCCTCCGGCGACTTCAAGTTCTGTGACGCACGGAAATCTGGGGCGGGGCTGCCTCTATTTAGCCTCCATGAGTGTGGTCTGCTTTGGAAATAGCTCCCCTAGTATGTTATGGGACCCCGGGTCCGGATGGGGTTGCCGCTCTCCTCCTTAGCTCGTTTGGTAACAAACGTAGGCGAGGCCCAGATATCGCTGTCTACGCCATCCTGCAGCTCCTTAAACGACCGCGCTTTGGCAGCGCGTGCCGTGCTTGAACTCTAGGCGTTTGCTTCTGAAAGCCTCCAAGGTTCCGCGTGGTGGGCACTGCCTCTGGCTCGTTGCGCCGTTCTCTTAGCCCTGGGAGCGTCAAGGGCCGTAGTTGGCGGGGAGGCACTCCACCAATCGGCGGTGGTTTGCGCTGGTGCCTTATTTTTCCTTGGCATGATTCCAGATTCTTCCCAGCATATTCATGAGGCCTGCCGCCGCCTCTCTGCGTCCACATTTGGTTCAGAGATTGATCTGATAGGCCGACATGGCCTCATCGATCTTCCTGGTGTCATGTTTTTCCGGCTGTTCTACTCTGCCGTCTTTTTTGGGCATGCCCTCGGGAGAAGGAGATCAGGGCGAGATTAGCTCAGCGTCATGACGTGTGGACATCAGTTGTTGTTGTCTACTAGCCCTCTGCTGACAAGGTAACGTCAATAGGGGACGTACCCTATCGTTGTTAAACGTCGGCTTCCGTCCATCGTTCAGCAGTATGAGGTCCAGCATTCGCATGGCGTCAATCACAGCTCGTCCTCTGGTGTTGGATGTCCTGCTGCCCCGTTCCACTGTCAGGCATTAAAGAGTCGCCGGCAATGACCTTCAGACCGCCCTCTCGCATGGTCCACGAGCGCCTCCAGAAGCTCCTCAGACGCTGATCGGGGGGTGTCGCTCGGCGGAGCGTAGCAGCTGTACATGTGCGATGTTTTAACTTCGCACCGTGATACCCGCATGGGTAAAGCAGCCAGTTCCTGGACTTGGAGAGAGCTGCAGCATTTGATAGCTGCTTTACCTGCCTCGTCAAAGGATCATGGACGATTGTCCACTACCAGGGCAATGAGGGTTCGCCCAGGAGCATGATGTCTACATTGCGTTGCGCTCAACCGCAGTCTGGGCCAGGAGGCTCTGAGCTGCTGCGCAATGATTGACGATGAGCTAATGCTACGCTAATATGAGGCGTGCATTAAAGGTGGCTCTTGGCATCTTTTAGTGTCGCTCTGTAAGTCGAACAAAGCTACCCGTCGAATTGAAGGTTTCTGTCCACCTCGCTGCTGCTGCAGATCGGGCATTTTGGTGCAACAACGCACCCCTTTGCCTTGTGCCCACGCTCACCGCATCTAAGACAGCAGTCTGCCCTGTCAGTGTCCTTACGGGTTGCTGATCGATGCCCATAGCCGAGACACCTGTAGCATCTCGTGGGTCGGACGTCTGGAGATGACCACGACATCTTGACCATCCAACGTTATGGTGCCCACGTTTAAGGACTGGTATCTTAACGTTCGCGTTCAGCAGCACTGAGGCTATTTGCTTGCAATTCGCATGCCAAGAAGGCCCTGATATCTTCAGGTTATCTGCAGGCCCTGGAATTGGGCAAACCAAGCAGCTGTGGGCTTCTCTGCTGTCGTAGCCTCGTCAATCCGCTGCAGATAGAGGCTATTCTTTGCGCTCCTGTGCGCACAGAGGCCAAGTCATTGAGCGCCGCTTCAGATTTAGCTCTTAAACTTGGGAACGCTTTTCCGAAGCTTTCCCTCTACCTCAGCAACAAGATCACCTTTCTGCGTTCTCCGGATTTTCGCACGTGAGGCTGCCCAGTTCGCTAAGGGCTCGATTCCGATCTTAGCTTCCGAAGCATCTCTGCGTGCAAGCCTCTCCTGTCTTTTTTTTACGATGAGTGCCTCTGCACCCGTGCTAGCATTCTTGGCGACAGATGCATGGCACCTGGCTTGGACTCGTTAGGTATGGATGTCGCCTTTTCTTCACCGTTGCCATCCAACTTGTGGGGTTGCTCTGCTTCGGCGCCTGGACTTTGGCACCTGCACCGTGGGTACCTCTGCGCATTTTTTATTGGAGCCTTTTGGTAGGCTTTTGTACCTCCGTCTGGGTAGCGCTGCTCTTCAAGCGGTGCTCGCTAGTGAATACCTTCGTACAGCTCTATCGCCCTGTTGTTGGGCTGAGGAGTTCAGGCTATGCCCTTTGTCTCTCATGTGTGTGTCTACAGCATCGCTGCGGTCGATAGTCAACGGCGGCTGGGGCCTGCGTGCTCACCCCTTGCCACCGACGGGACCGAGATTCCCGTCACCATGGGTCGGGTTACCGACTCCTCTGGTGGGGATCTCGAAAGTCGGAGCTCCTCCTGAGCGATTCCGTTGCGATCGGGGACTGCCCCCACTGCGTCCATCAACTGAAGGATGGCCTAAGGTTACCTAGGTCACGGCCACGGATTTCCCCCTGGCTTTTACGGATGGAGGTTTGTACCGCCTCGACTCGGACACCAGAGCCTCTGCTTAGGCACCAGCACGGTGAGAGGATGATATTTGGTCTGTCCGCGACCTTTGTGCCTTTCCTTTCTTAAAGACTTGTGCGCTCCCAGTTACAGAATCAAAATTAAATTAAATTAAATTTCAACGGCAATTTTTTAAATTTAATTTTGAGATTTCCGCGCCCTACTGTCGCAACACAACACTGATCACACGGTTGATCTGGCAACGCCTCCCTCTCCAGATCGCCCGCTGCGCGCTATCAGCTGTTTATCCGCTGCAACAATCGCAGATAATAAATTACCTATTTACATGGAAACAGGCGCACAAATTAACTCGCGTGATTGCAGCGCAGAACTATGGCGCGACTCCACCGTGTGATTTTGCCAGTTTGCGCACCGGCCGACACAACTTCTATGGTTTCGAGTATTTCGCGCCGCGTAATTTAAGACGACCGTCTTCAGCGATGTAAGGCTTGGTCTCCGCACACACCAGGATTGAGTGTCTAAGCCTGTGCGTTCAGGATTAAACTTTGGCAATACGACAGCATTGAGTTTTTTTTGGGTCTCTTTGTGAGTTTTGCACTTCTTTAACAGTTCAGAAAAATGGCGATTCTGCGACTCTAGAATTGTCAGCAAATTATTTCACTATTGTAGTATGCACACATATCCGGTTAAGCGCACTGTACCTATGTGTATTCATAATTGTAGCCTCTGTTGCAATGTGTACATAAACAGTCCAGCACAAGTGTAGCCAATATTATTACGAGCATATCAGCGAGGGGCTAACATACATTGCCTGGTCAGCAGTTCTCCCGCTGGCCAAGCTGATCGCTTATATGTGTGCCTATATACCCTCCTCCTCCAGCACCATCGCTCGGCGACGAGTACATATATATATGCATATATATAAGATACGCATATAAGCGTTGCTGCGCTGCAGGCTATGCCGGCAGCGCTATCGACTTAGGCTAAAACAACTTTGTGTGAATCGCCAGAGGATTGACGAATTAATTTCGAATGGGCAGGACCTTCCCTGTTCCTCAAATTGGATCAAATAAAGAACAGCTAAAACACAAATGATGTAGAGCACAATGAAACTTCTGGGAAGTTAGGTAGGCGTTCCCCTTCTGATGTCGGATCTGAATCACTTTATACTCGGCATCACTCTCTACAGCGGACACAAAGTAACAGAAAACGGTCGTTAACTTGAAATTAAAATAAATCTGCGACAAGTACAGTTTGTCAAGAAACTGTTTACACACCGTGAAATAAGATGAATTTTTGATTTTAACGGTCAAAAAATTAGGGTTATTTGCCAATTAAACGCAATTTTTTTTTTAGAATATAATTAAACAATATTTATTTTACTTATAAATTTAAAAACAAATTCAAAATATCAAATATACAAGAAATAAACAACGAATTCCAAGTTTGGCTTACTTTTGAGAGTTTCAAAGAAACTCTTTACACAAAACTACTAAACTAAGTTTAATCCTAAATTTAAATTGTTTTAAAATTTAGAAAGTTGTAGTATTTAGTATTTATTGGCTTTGGCTACAAGTTGAGCTTTTTTTCATGGAATGGATGGGTTTTAGGTCATATTCAAGCGGGATCTTTCCTCTAGCATCGCAGCCATGAGCTGTTGTCGTGTTTTGGTGCCTTTTTTGCCACATTCTTCTTTAAGTAGGCCCCACAAATTTTCAATGGGGTTCAGATCAAGACTCTGAGGGGCGTATCGATACCTTGCCACAGTTATAAAGGAGCCAGTTGCGTACATTGCACTCTTTATGTTTGGGATCATTGTCTGATAAAACTTAAAGAATTTGGCTTGTTGTTTGCTAAATAGACCAAATTTTTTCTGCACTGGCCTTCAAATTTGATTTTAAAATATCTAGATATTGCGGCATTCATAGTGCTTTTCAATAAAGTAATTGCCCTCCATGGCTTGAGATACAGCCCCAAATCATCACTGATAATTTTTTCCAAATTTGATTGTTGGAATGATATTTTGTTTTTTTTCTAGCGCGCTCAACGGCTTGCGCCATACTCTGCTTGGCCCATCGTTATAATAGAGAGCATCATTTTTGTTTCGTCACAAAATATTACGTCATCCAGTACTCTTCCGCATGATCCATCATGCTCACAGCGAAATGAATGACGCTTTTCTATGGCCGACCTCTGATAGCAAAGGCTTTCTTGCAACTCTTGAAGGTACCTATGGCGTAGAATGACTTGGCGCACAGTTGTGTGTGGCACAACTAGGTCACATTCTTGCCTGATATCCTGAGCAAAGTGATCTGACCGAGATTCGAGGGTTCGCAATCACTTTTCGCATAATAAGGCGGTCTACACGCTTGCTAATTTTAGTTTTGCGCCCACCACTCTTAGGTTCAAGCCTGTTCTCTTTTTTTCAAGCGATTAAAACATTGTAGACGGTCTTACGGGATACAGAAAACATTTATACTAATTCTGGAATAGATTTTTCCCAACTGGTGGTTTTAGTATATTATTTGGGTGAAAAGCTAATCTATTTCCAGGCATTTTTATTTAAATTTAATAACTCATTCGATCAACAAAGAGTACAAGCAAAGTAAAAAAAATTTCAATAGAAGCGTTGTAAAAGGAATGCAAATGCCAAAATAGCAGGAAAAAATCGAGTTCGTTCTAAGAAAAGAGCAAAACAAAGCTGGGAAAACAAAGTATGTAGGTTTCTTGCGCCACTCTCAAAGAAGTGTTGTGTAAACTTTGGAATTTGTTGTTTAATTTCCTTGTATATTTGATATTTTGAATTTGTTTTTTTTTAATTTATAAGTAAAATAAATATTGTTTTAATTATATTTCATTAAAAAATTGCGTTTAATTAAAGAAATAACCCTTAATTTTGACCTTTAAGTGAAAAAATTCAACTTATTTCACGGCGTGTAAATAGTTTCTTGACAAACTGTATATATCTACAAATTTACAACTTGCCGGTACCATCACCAAGATTGTTTACATTTAGAGAGTGGACTTTACCAAGGTGAATTTAAGCGTACATTGGTTGATTTGGGCAGGAACCGGGCAGACGACCAACTGTTGCATGTTTGTGTTTGTGAAGTTTTGGTGTTTTGGGTTTTCTTGCGAGATGATAATGTGATTTTTTAGTTAAAATAGTTTGCAAAACTGAATTTATGTAAAATAATATGTTCAATTGATCTATTTGGGTTTTCTGGGTCTCCCCAACACCTCGCAACAGATGCTGGATCAAAATTATTCGTCAGAAGGACGATGCACAGTCTCGTGAGTAATAAAAGTACAACAATCTTACTTTTGAGGTGGCGTGTTGGAAAGTATGTACACATTTAAGCAAAAGTCCACATGGCCTGCATCAAAGACACTAAGATAATAAGATGCGTAACAGCGCCTGGTTTGGCACTATGCAGCCACTTTTTTTGGTGACGGCTAAAGTGCTCTCTTTCCGCTCGCTCACGCTGAGCGTAAAGAAATCTAAAAATAGAATTTGCTTGCTTGTGTGAGTAAAAACAAAGACGAGAACGCGTATATGTGTGCGTGTTGCAGAAGGCGATTTTCGGGCCGAAATCCAATTCTGATCGCAGTAACGGGTTTATATTTGGGGAGTTTTTGGCCAATTTCGTAGAATATGATGAAATTGCGCGCTGTTTAAGATATCAAATTGGAATATAAAAAAAACTGAAAAGTCATTACACTGAGAAAATGTTTCGCAAAAAATAATGCGAAGTAGAAAATAAAAATTTATAAAATAAAAAAATGCTTAGCAATGTACGTAACTGCAA
->672ce66c-b7b5-46b3-b38a-081f37e71c12
-CACTTATCGGTATTGCTTCGTTCCAGTTACGTATTGCTGCCGTGCTCACCTTACCACCGACGGGATCGAGATTCCCGTCACCATGGAGTCGGGTTACCGACTCCTCGGTGAGGATCTCCGAAAGTCGACTCCTCCTGAACGGGTCGTTGCGATCAGGGGACTGCCCCCACTGCGCTGTCCATCCAACTGAAGGATGGCTAAAGGTTACCCTGGGTCACGTAGGCCACGGATTTCCCCTGGCTTTTACGGATGGAGGTTTGTACCGCCTCGACTCGGACACCAGAGCCTCTGCTTAGGCACCAGCACGGTGAGAGGATGATATTTGGTCTGTCACGCGGCCGCTTGTGCCTTTCCCCTTTCTTAGAACTTGTGCGCTCCCAGTTACCAGAATCAAAATTAAATTAAATTAAATTTCAGCGGCAATTTTAAATTTAATTTGATTCGCGCCCTACTGTCGCAACAACACTGATCACACGGTTGATCAGCGCCTCTCAGATCGCCCGCTGCGCTATCAGCTGTTTATCCGCTGCAACAATCGCAAGATAATAAATTACCTATTTTACGTGAAACAGGCGCACAATTAACTCGCGTGGTAGCGCAGAATATGGCGCGACTCCACCGTGTGATTTTGCCAGTTTGCCGCACACCGGCCGACACAACTTCTATGGTTTCGAGTATTTCGCGCCGCGTAATTTCAAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCCGCACCAGGATTGAGTGTCTAAGCCTGTGCGTTCAGGATTAAACTTTGGCAATACGACAGCATTGGGTTTTGGGTCTCTTTGTGAGTTTTGCACTTCTTTTAACAGTTCAGAAAAATGGCGATTCTGCGACTCTAGATTGTCAGCAAATTGTTTTCACTATTGTGGTATGCACACATATCGGTTAGGCACTGTACCTATGTGTATTCATAGTGTAGCACTCTGTTGCAATGTGTACATAAACAGTCCAGCACAAATTATGCGTAATACGAGCACCCACTTGAGGGCTAACATACATAATTGCCTGGTCAGCGAAGTTCTCCCGCTGGCCAAGCTGATCGCTTATATGTGTGCCTATACCACTCCTCCTCAACATCGCTCGGCGACAGTACATATATATATACATATATATAAGATACGCATATAAGCGTTGCTGCGCTGCAGGCTATGCCGGCAGCGCTGCTCCTCGACTTAGGCTAAAGGCAACTTTGTATGTAGATCATAAGAGGATTGACGAATTAATTTCGAATGGAGCGGGACCTTCCTGTTCCTCAAATTGGATCAAATAAAGAACAGCTAAAACACAAATGATCTATGACACAACGAAAGTGACTACAGGAAGTTAGATTAGGCGGTCCCACTTCCACGATGTCGGATCTGAATCACTTTATACTCGGCATCACTCTCTGGCGGACACAAAGTAACAGAAAACGGTCGTTAACTTGAAATTAAAAATAAATCTGCGACAAAGTACAGTTTGTCAAGAAACTGTTTACACACCGTGAAATAAGATGAATTTTTGATTTTAACGGTCCAAAATTAGGGTTATTTGGCAATTAAACGCAATTTTTTTTTTTAGGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAGAAACAAATTCAAAATATCAAATATACAAGAAAATAATGAACAAATTCCAAGTTTACACACTTTTGAGGTGTCCTCTGCCCAAACCGTCATCTCTGGGATGAGCTGATGAATTCCACCTCCCCCGTCGCGACGTTTGCCATCTGCTCTGCCATTCACCTAATAGCCGTGTGCCTCTTGCCTGGAAGCGCCACTCCCGCATAAGGCTGAGGCCTTGATCTCAGATCAATCCCGGCGGAGCCTGCCAGCCTTGCTTCCGCGTCTTCGGATATGGTCCTGAATCCTCTAATGAGCCTGAGGGCCATTGACCGTGGCACCGAACGAGCTCCTTTCAGGTATGAGGACCCTGCAGGTGGCATTGCTCTGAACTGGTGCAGCTTGGCAGCGAAGCCTTTGCTACTGACACCCGGCGGTTTCCTGGCCGAGGTGTCTTGGGCCTCCGACGTTGGGCATAAGCCTCGCCAGCAGAAGGGGGGATGTGACTGCTGTCTTCTTGCTGGCGTAGCTCGCGTGGTCCTTGAACGATAGTCACCCGATCTATCATTACCCAGGTACTTTAGGGACTCTTGGGGTCCCCTGGTACCCTTGACGGAGACAAGCATGTTCTCCATCTTTCCTGCTGCTTGATAGGACTGCTTCGGTCTTGTGAGCCGCTGTGCTAACCCGGCTGTGATTGCCCACATCGTCAGCGAAACAGCTGCCTCGACGACCTTCAGAGTTCTGTGACGCACGGGGAAATCTGGGGCAAGGGAGCTGCCTCTGTTGGCCTCCATAGTGTGGTTTTGCTTTGGAAATAGCTCCCTAGTATGTTAGCCAGGACCCCCCGGGTCGGATGGGGTTGCCGCTCTCCTCCTTAGCTCGTTGGTAACAAGCTTGTAGGCGAGGCCCCAGATATCGCTGTCTACGCCATCCTGCAGCTCCTTAAACGACCGCGCTTTGGCAGCCGCGATGCCGTGCTTGAACTCTGAGCGTTTGCTTCTGAAAGCCTCAAAAGGTTCCGCGTGGTCAGGTACTGCCTCTGGCTCGTTGCGCCGTTCTCTTAGCCTGGGGCAATCAGACCGTAGTTGGCAGGAGGCACTCCACCAGTAAACGGGTGGTTTGCGCTGTGCTTATTTTTCCTTGGCATGATTGCGTCGCAGATTCTTCCCAACATATTCATGAGGCCTGCCGCCGCCACTCTCTGCGTCCACATTTTGGGATTTCCAGGGGAATTGATCTGATAGCCAGCATGGCCTCATCGGTGATCTTCCTGGTGTCCCATGTTTTCCAGCTGTTCTACTCTGCCGTCTTTTGGGCATGCCCTCGGGGAAGAAGGAGATCAGGGCATGGTCGCTCAGCGTCGCTGACGTCATGGACCATCCAGTTGTTGTTGTCACTGGCCCTCTGCTGACAAAGGTAACGTCAATAAAGGACGTACCCTATCGTTGTTAAACGTCGGCTTCCGTCCATCGTTGTTCAGCGGTATGAGGTCCAGCATTCGCATGGCGTCAATCACAGCTCGTCCTCTGGTGTTGGATGTCCTGCTGCCCCGGTCCACTGTCAGGCATTAAAGTCTCGCCGGCAATGACCTTCGGGCTTCGCCCTCTCGCATGGTCCACGAGCGCCTCCAGAAGCTCCTCGAACTGATCGGGGTGTCGCTCGGCGGAGCGTAGCAGCTGTACATGTGCACGTGTTTTTTTAGCTTCGCGTAAGCGATACCCGCATCGTTAAAGCCAGTTCTGGACTTGGAGAGAGCTGCAGCATTTGATAGCTTCTTTACCTGCCACCGTCAAGGATCATGGACGGTGTCCACTACCAGAACGTAGGGGTTCGCTTAGGAGCATGATGTCTACGGTGCGCTCCAACCGCAGTCTGGGCCAGGAGGCTCTAGGCTGCTGCGCAAATGATTGAGCGATGGCTGTACTACGCTAATATGAGCGTGCATTAAGGTGGCTCTTGGCATGGCACTTAGTGTCGCTCTGTAAGTCGGGCACATAAAGCTACCCGTCGGGTGGTTTCTGTCCCACCTCGCTGCTGCAGATCAGGCATTTTTGGTGCAGCAACGCACCCTTTGCCTTGTGCCCACGCTCACCGCATCTAAGACGGCGATGCCCTGTCAGTGTCCTTGCAGGTTGCTGATCGATGCCCATAGCCGAAGACACCTGTAGCATCTCGTGGGTCGGACGTCCTGGAGTGATACGACATCTTGACCATCCAACGATTATGGTGCCCTGTTTAAGGACTGGTATCACCAACGTTGCGTTCAGCAGCACTGAAGGCTGTTGCTTGCAATTCCGCATACTGCGAAGGCCCTGATATCTCAGGATTTATCTGCAGGCCCTGGAATTGGGCGACCAAGCGGCTGTGGAGCTTCTCTGCTGTCGTGGCCTCCGATCCAATCCGCTGCAAGATAGAGCTATTCTTTGCGCTCCTGTGCTGAAGGCCAAGTCATTGAGCGCCGCTGGAGTCGCTCTTAAACTGAACGCTTTCGAAGCTTTCCCCTCTACCTCAAGCAACAGATCACCTTTCTGCGTTCTCTCCTTTCGCACGTGACTGCCCAGTTCGCTAAGGCTCGATTCCGATCTTAGCTTCGAAGCATCTCTGCGTACAGAAGCCTCTCTGTCTTTTTTACGATGAGTGCCTCTGCACCCGTGCTGCTTCATTCTTGGCGACAGATGCATAGCTGCCTGGCGGACTCGTTAGGTATGGATGTCGCCTTTTCTTCACCGTTGCCATCCAACGTAGGATGCTCCTGCTTCGGCGCCTGGACTTTGGCACCTGCACCGTGGGTACCTGCGCATTTTTGTGGAGCCTTTTGGTAGGCTTTGTACCTCCGTCTGGGTAGCGCTGCTCTTCAAGCGGTGCTCGCTAATCAATACTGTCATTGCAGCTCTATCGCCTGTTGTTAAGGGCTGAGAGTTCGAGCTATGCCTTTGTCTCTCATGTGTCGTTGGGTCTCGAATGCGGATAGAGGGGGGGCTGATCGCTTGCCATTCATCCTGGTAAGTATGCCCCTCAGGTCCTCGTTCTGGAGAGCAGTGGTCAGGAATCCAGACCGATGAGGGGGGGGGGAACAAGCTGGGGACTTCCCGCAAACTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCTGACTTGTCGCGGTCGTAGATGCTGTAGGGCCAATTTCTCACCTCTACAGCATCGCTGCAGTCGATGATCAACGGCGGCTGGGGCCTGCGTGCTCACCTTGCCACCACAAACGGGACCGAGATTCCGTCACCATGGGTCGAGTTACCGACTCCTCTGGTGGGGGATCTCGAAAGTCGGAAGCTCCTCTGAACGGGTCGTTGCGATCGGGGACTGCCCCCCTGCGCTGTCCATCAACTGAAGGATGGCCTAAGGTTACCTAGGTCACGTAGGCCACGGATTTCCCCTGGCTTTTTTTTTTACGGATGGAGGTTTGTACCGCTCGGCTCGGACACCAGAGCCTCTGCTTAGGCACCGGCACGGTGAGAGGATGATATTTGGTCTGTCGCGACCTTTGTGCCTTTACGCTTTCTTAAAGGGCTTGTGCGCTCCCAGTTACCAGAATCAAAAAAATTAAATTAAATTAAATTTCAACGGCTTAATTTTAAAATTTAATTTTTGAATTTCACCTCCCTACTGTCGCAACACAACACTGATCACACGGTTGATCTGGCAACCTCCCCTCTCAGATCATGCTGCTTTATCGGCTGTTTATCCGCTGCAACAATCGCAAGATAATAAATTACCTATTTACATGAAACAGGCGCACAATTAACTCGCGTGATTGCAGCGCAGAACTGGCGCGACTCCACCGTGTGATTTTGCCAGTTTGCCGCACACACCGGCCGACACAACTTCTATGGTTTCAGTATTTCGCGCCGCGTAATTTAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCCGCACCAGGATTGATGTCTAAGCCTGTGCGTTCAGGGATAAACTTTTGGCAATACGACAGCATTGAGTTTTTTGGGTCTCTTTGTGAGTTTGCACTTCTTTTAACAGTTCAGAAAAATGGCGATTCTGCGACTCTAGAATTGTCAGCAAATTGTTTCACTATTGGTATGCACATATCGGTTAAGCACTGTACCTATGTGTGGTATTCATAATTGTAACTCTGTTGCAATGTGTACATAAACAGTCCAGCACAAGTGTATACGTATTACGAGCACCCACTTGAGGCTAACGAATACATAATTGCTGGTCAGCAGTTCTCCCGCTGGCCAAGCGCTGATCGTATATGTGTGCCTATACCACTCCTCCTCCAGCACCATCGCTCGGCGACAGTACATATATATATACACATATATATAAGATACGCGCATAGCGTTGCTGCGCTGCAGGCTATGCCGGCAACGCTGCTCCTCGACTTAGGCTAAGAGCCTTTGTATGTAGATCATAAGAGGATTGACGAATTAATTTCAGATGAATGGGACCTTCCCTGTTCCTCAAATTGGATCAAATAAAGAACAGCTAAAACACAAATGATCTATGACACAATGAAACGGGAAGTTGATAGGCGGTCCACTTCTGATGTCGGATCTGAATCACTTTATACTCGACATCACTCTCTACAGCGGACACAAAGTAACGAAAACGGTCGTTAACTTGAAATTAAAAATAAATCTGCGACAAGTACAGTTTGTCGAAACTGTTTACACACCGTGAAATAAGATGAATTTTTTTGATTTAACGGTCAAAATTAAAGTTATTTAACCCAATTAAACGCAATTTTTTTTAGGAAATATAATTAAGCAATATTTATTTTACTTATAAATTAAAAAACAAATTCAAAATATCAAATATACAAGAAAATAAACAACGAATTCAAGTTTAAACACTTTTGAGAGTTCAAAAAACTCTTTACACAAAACACTAAACCTAAGTTTAATCCTAAATTTTTTAAATTATTTTGTTAAAATTTGAAGAGTTGTAATGTTGGTAAAAGA
->e22ef20a-acd5-485b-8c1d-cca563383888
-TTCGGTATGCTTCGTTCAGTTACGTATTGCTGACATCTTGACCATCAACGGTGGGGTGCCCTGTTTAAGGACTGGTATCGCAACGTTCGCGTTCAGCAGCACTGGGCTATTTGCTTGCAATTCCGCATACTGCGAGGCCCTGATATCTTCAGGATTTATCTGCAGGCCCTGGAATTGGGCGACCAAGCAGCTGTGGAGCTTCTCTGCTGTCGTAGCCTCGTCAATCCGCTGCCAAGATAGAGCTATTCTTTGCGCTCCTGTGCGCACAGAGAATGATCATTGAGCGCCGCTTCCAGGTCGCTCTTAAACTTAGGAACGCTTTCCGGCTTTCCCTCTACCTCAAGCAACAGATCACCTTTCTGCGTTCTCGGATTTTTCGCACGTGACTGCCCAGTTCGCTAAGGCTCGATTCGATCTTAGCTTCAGAAGCATCTCTGCGTACGAAACCTCTCCTGTCTTTTTACGATGGAGTGCCTCTGCACCCGTGCTAGCATTCTTGGCGACAGATGCATAGCTGCCTGGCTTGGACTCGTTAAGGTATGGATGTCGCCTTTTTTTCTTCACGTTGCCATCAACGTAGGGTTTATGCTTCGGCGCCTGGACTTTGGCACCTGCCGTGGGTACCTGCGCATTTTGTGGAGCCTTTTTTTGGTAGGCTTTTGTACCTCCGTCTGGGTGGCGCTGCTCTTCAAGCGGTGCTCGCTAGTAATTACCTTCGTACGGCTCTATCGCCCTGTTGTTGGGGCTGGAGTTCCCGGAAGCTATGCCCTTTGTCTCATGTGTGTCGTTGGGTCTCGAATGCGGATAGAAGGGGCTGATCTTGCCATTCATCCTGGTAGAGTATGCCCCTCGGGTCGTTCTGGAGAGCAGTGGTCAAGTCCGAAGACCGATGAGGGGAACCAGCTGGGGACTTCCCTCCGTCTTTTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCTGACTTGTCGCGGTCGTAGATGCTGTAGAGACCAATTTCTCCACCTCTACAGCATCGCTGCAGTCGATAGTCAACGGCGGCTGGGGGCCTGCGTGCTCACCCTTGCCACCGGCGGGACCGAGATTCCGTCACCATGGGCCGGGTTACCGGCTCCTCTGGTGGGGATCTCGAAAGTCGGGAGCTCTCCTCCTGAACGGGTCGTTGCGATCAGAGCTGCCCCACTGCGCTGTCCATCAACTGAAGGATGGCCTAAGGTTACCTAGGTCACGTAGGCTAGTTTCCCTGGCTTTTACGGATGGGTTTGTACCCTCGACTCCGGACACCAGAGCCTCTGCTTAGGCACCAGCACGGTGAGAGGATGATATTTGGTCTGTCCGCGACAGCGTGCCTTTTTTCCCCTTTCTTAAAGACTTGTGCGCTCCCAGTTACCCAGAATCAAAATTAAATTGATTAAATTTCAGCGGCTTAATTTTAAAATTTAATTTTGCAGATTTCAGCGCCCCTACTGTCGCAACACAACACTGATCACGGTTGATCTGGCAGCGCCTCCCTCTCCAGATCGCCCGCTGCGCTATCAGCTGTTTATCCGCTGCAGCAATCGCAAGATAATAAATTACCTATTTACATGGAAACAGGCGCACAATTAACTCGCGTGATTGCAGCGCAGAACTATGGCGCGACTCCACCGTGTGATTTTTGCCGGTTGCCGCACACACCAGCCGACACAGCTTCTATGGTTTCGAGTATTTTTCGCCGCGTAATTTAAAGACGTCCAGATAACGACTGATGTAGACTTGGTCTCCCGCACCGGGATTGAGTGTCTAAGCCTGTGCGTTCAGGATTAAACTTTGGCAATACGACAGCATTGAGTTTTTGGGTCTCTTTGTGAGTTTTGCACTTCTTTTAACGAAGTTCAGAAAATGGCGATTCTGCGACTCCTAGAATTGTCAGCAAATTGTTTTTCACTATTGTAGTATGCACACATATCGGTTAAGCACTGTACCTATATGTGTATTCATAATTAGCCAGCACTCTGTTGCAATGTATTTTCAACAGTCCAGCACAAGTGTATACGTAATACGAGAGCACCCACTTGAGGGCTAACATACATAATTGCCTGGTCAACGGTTCTCCCGCTGGCCAAGCGCTGATCGCTTATATGTTAAACTGCCACCACTCCTCCTCCAGCACCATCGCTCGGCATTGGTACATATATATATACATATATATAAGATACGCATATAAGCGTTGCTGCGCTGCAGGCTATGCCGGCAGCGCTGCTCCTCGGCTTAGGCTAAGAGAAACCTTTGTATGTAGATCCTTAAGAGGATTGACGAATTAATTTCGAATGGAGCAGGACCTTCCCTGTTCCTCAAATTGGATCAAATAAAGGAACAGCTAAAACACAAATGATCTATGACACAATGAAACTACAGGAAGTTGGAGTAGGCGGTCCCACTTCTGATGTCGGATCTGAATCACTTTATACTCGGCATCACTCTCTACAGCGGACACAAAGTAACGAAAACGGTAGTCGTTAACTTGAAATTAAAAATAAATCTGCGACAAGTACAGTTTTGTCAGAAACTGTTTACACCGTGAAATAAGATGAATTTTTTTGATTTTAACGGTCAAAATTAAGGGGTTATTTGCTTAATTAAACTGCGAATTTTTTTTTTTTGGAAATATAATTAAACAATATTTATTTTGCTTATAAATTAAAAAAAAACAAATTCAAAATATCAAATATACAAGAAAATAAATAACAAATTCCAAGTTTACACACTTTTGGGAGTGTCACTGCCCAAACCGTCATCTCTGGGATGAGCTGATAGGTCCACCTCCCCGTCGCGACGTTTGCCATCTGCTCTGCCATTTACCTAATAGCCACTCATTGTGCCTCTTGCCTGGAAGCGCCACTCCGCATAAGGCTGAGAGCCTTGATCTCCAGATCAATCGGCAGGCCTGCCAGCGCTAGCGCCGCGTCGGATATGGTCTGAATCCTCTAATATGAGCCTGGGGGCCATTGACCGTAGCACCAGACAGAGCTCCTTTCAGGTATGAGACCCTGCAAGTGGCATTGCTCCGAACTGGTGCAGCGTGGCAGCAGAAGCCTTTGGACGCTGACACCAGCGGTTTCCTGGCCGGGTGTCTTGGGCCTCCGACGTTGGGCATAAGCCTCGCCAACGAAGAGGATGTGAGGCTGCTGTCTTCTTGCTGGCGGCCAGCTCGCGTGGTCCTTGAACGATAGTCTGCGATCTATCATTTACCCCCAGGTACTTTAGGGACTCTTGAGAGGTCCCTAAGGTACCCTTGACGGAGACCAGCATGTTCTCCATCTTTTCCTGCTGCTTAGTAGGACTGCTTCGGTCTTGTGAGCCGCTATTGCTAGCCCGGCTGTGATTGCCACATCGTCAGCGAAACAGCTGCCTCGACGACTTCAAGTTCTGTGACGCACGGGAAATCTGGGGCCGAGGGGCTGCCTCTGTTGGCCTCCATAGTGTGGTCTGCTGGAAATAGCTCCCCTGGTATGTTAGCCAGGACCCCGGGTCGGATGGGGTTCGCTCTCCTCTCCTTAGCTCGTTGGTAACAAGCTTGAGCGGGCCCAGATATCGCTGTCTACGCCATCCTGCAACAGCTCCTTAAACGACCGCGCTTTGTAGCCGCGATGCCGTGCTTGAACTCTAGGCGTTTTGCTTCTGAAAGCCTCCAAAGAGTTCCGCGTGGTGGTACACTGCCTCTGGCTCGTTGCGCCGTTCTCTTGCTTCAGGGCAATCAGACCGTAGTTGGCTTGGGAGGCCTCCACCAGTAAACGGGTGGTTTGCGCTGTGCCTTATTTTCCTTGGCATGATTGCGTCGCAGATTCTTCCAGCATATTCGCAATTCTGCCGCCATACTCTCTGCGTCCCACATTTGGGATTTCCAGAATTGATCTGATGAGCCAGCATGGCCTCATCGATCTTCCTGGTGTCCCATCACCAGCTGTTCTACTCTGCCGTCTTTTTTGGGCATGCCCTCCGGGGAGAAGGAGATCGGGCATGGTCATCAGCGTCATGACGTCATGGACCATCCAGTTGTTGTTGTCTACTGGCCTCTGCTGACAAGGTAACGTCAATAAGGACGTACCCCTATCGTTGTTAAACGTCGGCTTCCGTCCATCGTTCAGCGGTATGAGGTCCAGCATTCGCATGGCGTCAATCACAGCTCGTCCTCTGGTGTTGGATGTCCTGCTGCCCCATTCCACTGTCCAGGCATTAAAGAGTCGCCGGCAATGACCTTCCGGGCTTCGCCCTCTCCGCATGGTCTGAGCGCCTCCAGAAGCTCCCCTCGAACTGATCGGGGTGTCGCTCGGCAGGCAGTAGCAGCTGTACATGTGCGCGTGTTTTAACTTCGCATAAGCGATACCCGCATGGGTAAAGCAGCCAGTTCTGGACTTGGAAGAGCTGCAGCATTTGATAGCTGCTTTACCTGCCTCGTCAAGGATCATGGACGATTGTCCACTACCAGAGACGTAGAGGGTTCGCTTAGGAGCATGATGTCTACGTGCGCTCAACCGCAGTCTGGGCCAGGAGGCTCTGAGCTGCTGCGCAATGATTGACGATGAGCTGTACTACGCTAATATGACGTGCATTAAGAGTGGCTCTTAGCATCTTTAGTGTCGCTCTGTAAGTCGGAGCACGCAAAGCTACCCGTCGGGTGGTTTCTGTCCCACCTCGCTGCTGCAGATCAGGCATTTTTTTGGTGCAGCAACGCACCCTTTGCCTTGTGCCCACGCTCACCGCATCTAAGACGGCAGTCTGCCCTGTCAGTGTCCTTACGGGTTGCTGATCGATGCCCATAGCCGAGACACCTGTAGCATCTCTCGTGGGTCCGGACGTCCTGGAGTGATACATCTTGACCATCCAACGATTATGCGTTGCCCTGTTTAAGGACTGGTATCGCAACGTTCGCGTTCAGCAGCACTGAGGCTATTTGCTTGCAATTCCGCATACTGCGAGGCCCTGATATCTTCGGTTATCTGCAGGCCCTGGGGTGGGCGACCAAACGGCTGTGGAGCTTCTCTGCTGTCGTAGCCTCGTCCAATCCGCTGCAAGATAGAGCTATTCTTTGCGCTCCTGTGCGCACAGAGGAGCCAAGTCATTGAGCGCCGCTTCCAGGTCAGCTCTTAAACTTGGGAACGCTTTCCGAAGCTTTCCCCTCTACCTCAAGCAACAGATCACCTGCGTTCTCGGATTTTTCGCACGTGACTGCCCAGTTCGCTAAGGCTCGATTCGATCTTAGCTTCCAGAAGCATCTCTGCGTACGAAGCCTCTCCTGTCTTTTACGATGAGTGCCTCTGCACCGCGTGCTAGCATTCTTGGCGACAGATGCATAGCTGCCTGGCTTGGACTCGTTAGGTATGGATGTCGCCTTTTCTTCACCGTTGCCATCCAACGTAGGGTTGCTCTGCTTCGGCGCCTGGACTTTGGCACCTGCACCGTGGGTTACCGCATTTTGTGGAACCTTTTGGTAGGCTTTGTGCCTCCGTCTGGGTAGCGCTGCTCTTCAAGCGGTGCTCGCTAGTAGTACACCTTCGTACAGCTCTATCGCCCTGTTGTTAAGGGCTGAGAGTTCGGAAATATGCCCTTTGTCTCTCATGTGTGTCGTTGGGTCTCGAATGCGGATAGAAGGGGGGCTGATCTTGCCATTCATCCTGGTAAGTATGCCCCTCAGGTCCTCGTTCTGGAGAGCAGTGGTCAAGTCCGAAGACCGATGGGGAACAAGCTGGGGACTTCCTCCCGTCTTTTGCGATGGCACGGCGATGTGGTCATCGTCTTCTGTCGCGGTCGTAGATGCTGCTTGGAGCCAATTTCTCCACCTCTACAGCATCGCTGCAGTCGATAGTCAACGGCGGCTGGGGGCCTGCGTGCTCACCCTTGCCACCGACGGGACCGAGATTCCGTCACCATGGGTCGGGTTACCGACTCCTCTGGTGGGGATCTCGAGAGAGTCGGAACTCCTCCCTGAACAGGTCGTTGCGATCAGGGGACTGCCCCACTGCGCTGTCCATCAACTGAAGGATGGCCTAAGGTTTACCCTAAGGTCGCGTAGGCCACGGATTTCCCCTGGCTTTTACGGATGGAGGTTTGTACCGCCTCGGCTCGGACGCAGAGCCTCTCTGTAGCGGCACCAGCTTTTGGTGAGAGGATGATGTTTGTCTGTCCGCGACCTTTGCCTTTTCCTTTCTTAAGAACTGTGCGCTCCCCGGTTCAGAGATCCAAGGGTAAATTAGGTGGGAATTTCCAGCGGCAATTTTTTAGAATTTAATTTTGTTCGCGCCCTACTGTCGCAACCTGGCACTGATTTTACGGTTGATCTGGCAGCGCCTCTCCAGATCGCCCGCTGCGCTATCAGCTGTTTATCCGCCACCAACAATCGCAAGATAATAAATTACCCTATTTACATGAAACAGGCGCACAGTGCTCGCGTGATTGCAGCGCAGAACTATAACGACTCCACCGTGTGATTTTGCCAGTTTGCCGCACACCGAAGCCGACCCACAGCTTCTGGTTTCGAAATTATTTCGCGCCGCGTAATTTAAGACGTCCGTCTTCGGCGATGTAGACTTGGTCTCCCGCACACCAGGATTGAGTGTCTAAGCCTGTGCGTTCAGGATAAGCTTTGGCAATACGACAGCATTGAGTTTTGGGTCTCTTTGTGAGTTTTGCACTTCTTTTTTAACAGTTCAGAAAAATGGCGATTCTGCGACTCTAGAATTGTCAACCAAATTGTTTCACTATTGTAGTATGCACACATATCGGTTAATACTGTACCTATGTGTATTCATAATTAGTAGCACTCTGTTGCAATGTGTACATAAACAGTCCAGCACAAGTGTATACGTAATACCACGAGCACCACTTGAGGGGCTAACATACATAATTGCCTGGTCAGCAGTTCTCCCGCTGGCCAAGCGCTGATCGCTTATGTATTGTGCCTATACCCTCCTCCTCAGCACCATCGCTCGGCGACGAGTACATATATATATACATATATATAAGATACGCATATAGCGTTGCTGCGCTGCAGGCTATGCCGGCAGCGCTGCTCCTCGACAGGCTAAGAAACCTTTGTATGTAGATCATAAGAGGATTGACGAATTAATTTCGAGATGGGCAGGACCTTCCCTGTTCCTCAAATTGGATCAAATAAAGAACAGCTAAAACACAAATGATCTATGACACAATGAAACTACAGGAAGTTGGGTAGGCGGTCCCGCACTTCTGATGTCGGATCTGAATCACTTTATACTCGGCATCACTCTCTACAGCGGACACAAAGTAACAGAAAACGGTCGTTAACTTGAAATTAAAAATAAATCACCCGACAAGTACAGTTTGTCAAGAAACTGTTTACACCGTGAAATAAGATGAATTTTTGATTTTAACGGTCAAAATTAAGGGTTATTTGCTTAATTAAGCGCAATTTTTTTTTAGGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAAGAAACAAATTCAAAATATATCAAATATACAGAAAATAAACAACGAATTCCAAGTTTAAACACTTTTGAGGTTTCAAAGA
->48d5ce58-0d40-4fd6-8059-24027f9aaf7c
-TCGGTATTGCTTCGTTCAGTTACGTATTGCTTTATCCGCTGCAACAATCGCAAGAGATAATGAAATTGCCTATTTACATGAAACAGGCGCACAATTAACTCGCGTGATTACGCGCAGAACTTATGGCGCGACTCCCACCGTGTGATTTTGCCAGTTTGCCGCACACACCGGCCGACCCGCAGCTTCTATGGTTTCGAGTATTTCGCGCCGCGTAATTTAAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCCGCACCAGGATTGAGTGTCATAAGCCTGTGCGTTCAGAGTTAAACTTTAGCAATACGGCAACGTGGAAGTTTTGGGTCTCTTTGTGAGTTTGCACTTCTTTTTTAACAGTTCAGAAAAATGGCGATTCTGCGACTCTAGAATTGTAAGCAAATTGCTTCACTGTTGTAGCAGGTATGCACGCATATCGAAGGTTAAAGCACTGTACCTATGTGTATTCGCCAATTGTAGCACTCTGTTGCAATGTGTACATAAACAGTCCAGCACAAGTGTATACGTTAATACGAGCACCCACTTGAGGGGCTAACATACATAATTGCCTGGTCAACCCAGTTCTCCCGCTGGCCAAGCGCTGATCCTTATATGTGTGCCCTATACCACTCCTCCTCCAGCACCATCGCTCGGCGACAGTACATATATATATATACATATATATAAGATACGCATATAAGCGTTGCTGCGCTGCGAGCTATGCCGGCAGCGCTGCTCATCGACAGGCTAAGAAAACCTTTGTATGGCAGATCATAAGAGGATTGACGAATTAATTTCGAATGGAGCAGGACCTTCCTGTTCTCAAATTGAATCAAATAAAGAGCAGCTAAAACACAAATGATCTATGACACAATGAAACTACCGTGGGTAGGCGGTCCCACTTCATGATGTCGGATCTGAATCGCTTTATACTCGGCATCACTCTCTACAGCGGACACAAGTAACAGAAAACGGTCGTTAACTTGGGGAATTAAAAATAAATCTGCGACAAGTACAGTTTGTCGAAACTGTTTACACATAGAAATAAGATGAATTTTTATTTTAACGGTCAAGAATAAGGTTATTTGCTTAATTAAACGCAATTTTTTTAGAAATATAATTAAACAATTTATTTTGCCTAAATTAAAAAACAAATTCAAAATATCAAATATACAAGAAAATAAATAACAAATTCCAAATTTACCGCGCGAGAGTGTCACTCTGCCCATTACGTCATCTGGGATGAGCTGATAGGTCCACCTCCCCCGTCGCGACGTTTGCCATCTGCTCTGCCATTCACCTAATAACCACTCGTGTGCCTCTTGCCTGGAAGCGCCACTCGCATAAGGCTGAGCCTTGATCTCCAGATCAATCGGCGGAGCCTGCCAGCGCTAGCGCCGCGTCTTCGGATATGGTCCTGAATCCTCTAATGAGCCTGAGGGCCATTGGCCGTAGCACCAGACGAGCTCCTTTCAGGTATGAGACCGCAAGTGGCATTGCTCCAGACTGGTGCAGCGTATAGCAACCTTTGCTGACACCAGCGGTTTCCTGGCCGGGTGTCTTGGGTATCCGACGTTGGGCATAAGCCTCGCCAACGAAGAGGATGAAGCTGCCTCTTCTTTGCTGGCGTAGCTCGCGTGGTCCTTGAACGATAGTCTGCGTCTATCGTACCCCAGGTACTTTAGGGACTCTTGAGGGTCCCACAGGTACCCACTGACGGAACCAGCATGTTCTCCATCTTTTCCTGCTGCTTAGTAGGACTGCTTCGGTCTTGTGAGCCGCTATTGCTATTACGGCTGTGATTGCCACATCGTCGAAAGAACAGCTGCCTCGACGACTTCAAGTTCACCAGGCGCACGGGAAATCTACCGGGCGGGGGCGCACTCTGTTGGCTCCATGGTGTGGTCTGCTGCTTTGGAAATAACTCCCCCCCTAATTATGTTAGCCAGGACCCCCCAGGTCGGATGGGGTTGCCCGCTCTCCTCCTTAGCTCGTTGGTAACAAACTTTGTAGGCAGGCCCAGATATCGCTATCGCCATCCTGCAGCTCCTTAAACGACCGCGCTTTTGGCAGCCGCGATACCGTGCTTGAACTCTGAACGCTTCTGAAAACCTCCAAGAGTTCCATGGTGAATTACTGCCTCTGGCTCGTTGCCGTTCTCTTAGCCCTGAGGCAATCAGACCGTAGTTGGCAGGAGGCACTCACCGGTAAACGGGCCAGTTTTGCGCACAATACTATTTTTTCCTTGGCATGATTTGCGTCGCAGATTCTTTAACATGTCCTTGGGGCCTGCCGCCATACTCTCTGCGATCCACATTTGGGATTTCCAGAATTGATCTGATAGGCCAGCATGGCCTCATCGATCTTCCACAGTGTCCCATGTTTTCCCGGCTGTTCTACTCTGCCGTCTTTGGGCAATACCCTCCGGGGAAGAAGGAGATCAGGCATGGTCGCTCAGCGTCATGACGTCATGGACCATCAGTTGTTGTTGTCTACTAGCCCTCTGCTGACAAAGGTAACGTCAATAAGGACGTGCCCTATCGTTGTTAAACGTCGGCTTCAGATCCATCGTTCCCAGCGGTAATGCAGCATTCGCATGTGGCGTCAATCTAGCTCGTCCTCTGGTGTTGGATGTCCTGCGCTATTCCACTGTCAGGCATTAAGTCGCCGGCAATGACCTTCGGGCTTCGCCCTCTCGCATAGTCCACGAAGCGCCTCAGAAGCTCCTCGAACTGATCAGGGGTGTCGCTCGGCGGAAGCGTAACGGCTGTACATGTGCACGTGTTTTAACTTCATAAGCGATACCCGCATGGAAAAGCAGCCAGTTCCTGGACTTGGAAGCTGCAGCGTTGATAGCTGCTTTACCTGCCTCGTCAGGATCATGGACGATTGTCCACTACCAGAACGTAGGGTTCAGCTTAGGAGCATGATGTGCGCTCAACCGCAGTCTGGGCCAGGAGGCTCTGAGCTGCTGCGCAATGATTGACGATGAGCTGTACTACGCTAATATGAGCGTGCATTAAGGTGGCTCTTGGCATCTTTTGGTGTCGCTCTGTAAGTCGGGCACGCAAAGCTACCCGTCAGATTGGTTTCTATCCACCCTCGCTGCTAGATCAGCAGGCATTTTGGTGCAGCAACGCACCCTTTGCCCCGTGCCCGCGCTCACCGCATCTAAGACAGCAGTCTGCCCTGTCAGTGTCCTTACCCGGGTTGCTGATCGATGCCCATAGCCGAACACCTGCTGGCATCTCGTGGGTCGGACGTCCTGGGTGATACGACATCTTCAACCATCAACGATTATGGTTTGTTTGGGACTGGTATCGCAACGTTCGCGTTCAGCAGCACTGGGCTATTTGCTTGCAATTCCGCATACTGCGAAGGCCCCTGATATCTTCAGGATTTATCTGCAGGCCCTGCGGTGGGCGACCAAACGTATGGGCTTCTCTGCTGTCGTAGCCTCGTCCAATCCGCTGCAAGATAGAGCTATTCTTTGCGCTCCTGTGCGCGAGAGGCCAAGTCATTGACGCCGCTTCCAGGTCGCTCTTAAACTTGGGAACGCTTTCGAAGCTTTCCCCTCTACCTCAAACAACAGATCTGCTTTCTGCGTTCTCGGTTTTCGCACGTGACTGCCCAGTTCGCTAAGGCTCGATTCCGATCTAAGCACCGAGCATCTCTGCATTACAGAGCTCTGTCTTTTTTTTGATAAGGTCCTCTGCACCGTGCCGCATTCTTAACCGACAGATGCACCGCTGCACAGCTTGGACTCGTTAGGTATGGATGTCGCCTTTTCTTCACCGTTGCCATCCAACGTGGGGTTGCTCTGCTTCGGCGCCTGGACTTTGGCACCTGCACCGTGTGGGTACCTGCGCATTTGGTGAGCCTTTTGGTAGGCTTTGTACCTCCGTCTGGGTAGCGCTGCTCTTCAAGCGGTGCTCGCTAATCAGTACCTTCGTACAGCTCATCGCCCTGTTGTTAAGGGCTGAGAGTTCGGAAGCTATGCCTTTGTCTCTCATGTTATTGTCGTTGGGTCTCAGATAGGATGAAGGGGCTGATCTTGCCATTCATCCTGGTAAGTATGCTCAGGTCTCGTTCTGGAGAGCAGTGGTCAAGTCCGAAGACCGATGGGGGAACAAGCTGGGGACTTCCCTCCCGTCTTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCTGACTTGTCGCGGTCGTAGATGCTGTAGAAGACCAATTTCTCCCGCATACAGCATCGCTGCAGTCGATAGTCAACGGCGGCACAGGGGCCTACGTGCTCTGCCTTACCGACAGGCCGAGATTCGTCACTGTAGGTCGGGTTACCGACTCCTCTGGTGGGGATCTCGAAAGTCGAACTCTCCTGAACGGGTCGTTGCGATCAGGGGGTTCTTACTGCGCTGTCCATCAACTGAGGATGGCCTAAGGTTACCTAGGTCACGTAGTACAGTTTCCCCCCTGGCTTTACGGATGGAGGTTTGTACCGCCTCGACTCGGACACCAGAGGCCTCTGCTTGAGCACCAGCACGGTGAGGAGGATGATGACTGGTCTGTCCGCGACAGCACGTGCCTTTTTCCTTTTCTTAGAGACTGTGCGCTCCCAGTTACCAGAATCAAAATTAAATTAAGTTAAATTTCAACGGCAATTTTAAATTTAATTTTGAATTTCAAACCTTTCTACTGTCACCAACACAACACTGATCACCCACGGTTGATCTGGCAACGCCCTCCCTCAGATCGCCCTTTACGCTATCAGCTGTTTATCCACTGCAACAATCGCAAGATAATAAATTACTATTTACATGAAACAGGCGCACAATTAACTCGCGTGATTGCGGCCTGGAGACTATGGCGCGACTCCACCGTGTGATTTTGCCGGTTGCCGCACACCGGCCGACACAACTTCTATGGTTTCGAGTATTTCGCGCCGCGTAATTTAGACGTCCGTCTTCACGGCGATGGCAGAACTTGGTCTCCACCAGAGTTAGTGTCTAAGCCTGTGCGTTCAGGATTAAACTGGCAATACGGCAGCATTGGAGTTTTGGGTCTCTTTGTGAGTTTTACTTCTTTTATGGATTCAGAAAAATGGCGATTCTGCGACTCTAGAATTGTCAGCAATTATTTTCACTATTGTAGGTATGCACATATCGGTTAAGCACTGTACCTATGTGTATTCATAGTGTAGCACTCTGTTGCAATGTGTACATAAACAGTCCAGCACAAGTGTATACGTAATACGAGCATACATGAGGGCTAACATACATAATTGCCTGGTCAGCAGTTCTCCCCTTTGGCCAAGCGCTGATCGCTTATATGTGTGCCTATACCACTCCTCCTCCAACCATCAAAAGCTCAAAGCGGCAGTACATCTCCATATATACCATATATACATAAGATACGCATATAAGCGTTGCTGCGCTACTGACTATGCCGGCAGCGCTGCTCTATCGACAGGCTAAGAAACCTTTGTATGTAGATCATGGAAGAGTTGACGAATTAATTTCGAATGGGTGGGACCTTCCTGTTCCTCAAATTGGATCAAATAAAGAACGGCTAAGGCTTACAAATGATCTGTGACACAGTAGAGCTACGGGAAGTTGGAGTAGGCGGTCCCACTTCTGATGTCGGATCTGAATCACTTTATACTCGGCATCGCACAGCGGACGCAAAGTAACAGAAAACGGTCGTTAACTTGAAATTAAAGAATCATCTGCGACAAGTACAGTTTGTCAAAGAAACTGTTTACACACCGTGAAATAAGATGAATTTTTTTGATTTTAACGGTCAAAAAATTAGGGTTATTTGCTTAATTAAACGCAATTTTTTTTTTAGGAAATATGAATTAAACAATATTTATTTTACTTATAAATTAAAAACAAATTCAAAATCAAATATACAAGAAAATAAACAACAATTCAAGTTTATTACTTTAGAGTTTCAAAGCTCTTTACAAAACATAAACCCTAAGTTTAATCCTAAATTTTTTTTAAATTGTTTTGTTAAAATTTGAAAAGTTGTGGTATTTAGTATGACCCCATTGGCTTTGGCTACAAGTTGAGCTTTTTTTTCATGGAATGGTTGGTTTTGGGTCAAGCGGGATCTTTTCCCCACTCTATCGCAACCATGAGCACCGGTACATGTATTTTGGTGCCTTTTGCCACATTCTTCAACAAAGTAGGCCTGGAATTTTTTCAATGGGGTTCAGATCCAGAGACTCTGGGGCGTATCGATCACCTTGCCACAGTTATAAAGGTGGTTGCGTACATTGCACTCTTTATGTTTGGGATCATTGTCTGATAAAACTTAAAATTTGGCTTGTTGTTGCTAAATAGACCAAATTTTTTCTGCACTTTAACCTTCAAATTTGATTTTTAAAATATCTGGAGGAAATATTGCGGCATTCATAGTGCTTTCAATAAGGCTAATTTGCCCACTCCATGGCTTGAATGGCCCAAATCATCACTGATAATTTTCAAATTTGATTGTTGGAATGATATTTTGTTTTCTGGCATCAAGCAGCTTGCGCCATACTCTGCTTGGCCCATCGTTATAATAGAGCATCATTTTTGTTTCGTCTGAAAAATATTACGTCATCCAGTACTCTTCCGCGATCCATCATGCTCACAGCGAATGACGCTTTTCTATATTGACCTCTGATAGCAAAGGCTTTTTTTCTTGCAACTCTTGAAGAGTACCTATGGCTGTGGAATGACTGGCGCACAGTTTTGTGTGGCACAACTAGGTCACATTCTTGCCTGATATCTGAGCAAGTGATCACAGCCGAGATTCGAGGGGTTCGCAATCACTTTTTTCGCATAATAAGGCGGTCTACACGCTTGCTAATTTTAGTTTGCGCCCACCACTCTTAGGTTCAAGCCTGTTCTCTTTTTTCAAGCGATTAAAACATTGTAGACGGTCTTACGGGATACAGAAAACATTTATACTAATTCTGGAATAGATTTTCCCAACTGGTGGTTTAGTATATTATTTGGTCACTTCAAAGCTAATCTGTTCCAGGCATTTTATTAAATTTAATAACTCATTCGATCAGCAAAATTTCACAAACAAAGTAAAAAAAATTTCAATAGAAGCGTTTGTAAAGGAATGCAAATGCCAAAATAACGGAAAAAATCGAGTTCGTTCACAAGAAAGAGCAAAACAAAGTAGGAAAACAAATGTGTAAGGAGTTTCTTGCCACTCTCAAAAGGGTGTGTAAACTTGGAATTTGTTGTTTAATTTCTTGTATGTTGATATTTTGAATTTGTTTTTTAATTTATAAGTAAAATAAATATTGTTTAATTATATTTCATTAAAATTGCGTTTAATTAAAGAAATAACCAACAATTTTGACCTTTAAAGTGAAAAATTCAACTTATTTCACGGCGTGTAAATGGTTCTTGACAAACTGTATATATCTACAAATTTACAACTTGCCGGTACCATCTGCAAGATTCATTACGGCCCAATTGGACTTTGACTCTCAAGTGAATTAAAACATTATATTCTTAGATTGAACGACGGGGAACCAGACTGAACTAACTAAACTAACTATCCATTAACTAAAATTTGAGTGGGGTTGCTGATGATTTTTGAGTTTCTTACAAGATGACTAATATTAATTTTGGTTAAAATAGTTTGCAAAACTGAATTTATATAAATAATATGTTCAATTGATCTGGTTGGGTTTCTGAGTCCCAACACCTCATAACGAATACTGGATCAAAATTATTCGTCAGAAGGACGTGCACAGTCTCGTGGTAATAAAAGGAGTACAGCAATCTTACTTTTTGAGGGTGGCGTGTTTGGAATGTACACATTTAAGCAAAAAGATCACATGTACCATCAAAGACACTAGAATAATAAGATGCATGCTGTAGCACACTGGTTTGACACTATACATCGCACGAGTGACGGCCAAATTGCTCTCTTTCCGCTCGCTCACGCTGAGCGTAAAGAAATCTAAAAATAGAATTTGCTTAGCGTGAGTAAAACAAAGACGAGAACGCGTATATGTGTGCGTGTTGTGCTAGAGAAGGCGATTTTCGGGCCAGAAAATCAATTCTGATCGCATTAACAATTTACATATGTGTACATACATTTGGGGGTTGTAATTTCGTAGAATATGATGAAATTGCGCTGTTTAAGATATCAAATTGGAATATAAAAAAAACTGAAAAGAAGTCATTACACTGAGAAAAATATTTCCTTAAAATATTACGAGTAGAAAATAAAAATTTATAAAATAAAAAAAAATGTTAACTGTTTGTGCAAACGTCATATCAAATTAGAATTGTTATCTTTGCTTTGGTCATATCTTGAGGCACGGAAGTGCGGACTAAACCTCAACAATCAGTGTCTTCTGTCTCAAACAGAGCGACACCGACGAAGACCTAGCTGCTTTGAAATGGCGAAGGTAAAATGAAATCAAAAAAAAAGCCAAAGCCCACTCCCGAAGTTCCAAAGCAGGATTCCCTGGACAATTCATCAAGCACCAGCGCAAATATTCAACTCTCTTGAAGCGACGGATTGCCGACAAAACGGAAACAAATATAACAAAACAGAGATCTCAGGAAATGGTAAAGTAAAGACAGTGCAACTGATTTTGCTAAACTACTATCTTTCTCTCTGACGTCAATGGTATAAGTGAAAAGCTAACCTATCTTAAAACTAAAATTAAAGAAGAACTTTTTTATTATAAGACTCAACGTTATGGACAAGTAATGGTTATTGAAGAATTCTGAAAAGTAGTCAAAACACTTGTAATGATTGTGTACGTTACCACACATACCAACAAGGATGACAGAGCATTTAGAGTTGTTATTAAAATTTGCATTTTCCACAAATTTAGATGAAATTAAAGTGATGAAGAGTCAAAGGTCATGTTGTTAGAAACATAAGTAATATTAAAAAACCGTGCGACCAAAACGTCACTGAACATGTTTTATGTAGATATTGAGCCTAACAAAAAAAACCTAGACATATATAATGTAAATAAAATGGAGCCTCCCCACAATGAAATCGTTCAATGCTATAGCTGCCGGAATTCGGACATACTAAATCATATTGTACCAAAACGTACCGCTGTGTAAATCCTCTTCTCGACACCCAGCAACATTTGCCGAAAATACAGAACAACCAGCAAATGTGCCAACTGCTACGAAGAACACGCCGCCAGCTACAAGGTGTAGAATTTATCGAGGAACTCTTGTCCAAAAAAAATAGAAAATAAATAATAATGATCTGAGTAAAATGATTTAGGAATCCAGCAAAGTTTGTTCCGCCCTAACAAGTAACATATACCCAACAAAGTAACGATTATCAATCTTATGCCCAAATTGCTGCGGGAAATAGCAAAACAAACACATCACTGGAGAGAATAGAGCAACTGATGGGAAAACAGTCTACGAACAAATAATTTACTTAGCATGATGTGTTGCTTGTAAAACAAATTGTGCGAGTAAGTCTAACCTTGAATATGGAAGCGTAGTAGAGGTGACTTCAATACTAAGCTTCGAGAAGGAAACGGAGCATGCAAATGCATAGTAAACAACAGCATAACAACACTTTCAACCGGCAAGCCACATACTGGCCTACTGATGAGTAGAAAGATACCAAGCAACCTTTCGCGCAACGTTGCTTGTGAGCAATTTCTATGTTTCAGAGCTAACTGTAGGGTGTGCCTTTGTTTTATCTGCTGATTCTTTATGATAACGGTGCTTTTATGTGTCTACCTCTAATATAAAGCAAAAAAAACGCGTTTGGAGTTAATTGCAGGAATTATTTGCAATAAATGGCACGCATCACAATAATTATTGTTTTCGATGTTCGGTGCAACTTTTGGAATTATTAATTTTACTTTATAATACTTTAAAAAAAAGAACCTAAAGTATAAACAGCAAAGGAGTTAACAAGACAGTGATTTAGTCAAACTTAGTAAGTAGTGAACAATAAGTAAGTAAAATAATTTTTTTTCTAAGTTGCTAGTGAGCAACGGGCACATTCGTGATAATAATTTTCACCGAGAATTGAAGGTTTGTCTAACGAGAAAGAAATTGAACGGGATTTAGCGATTGGGATATTTCTACTGACGAGAAGAGAAGTGGTGAGGAGATGAAAGACATTTCTACGGTACTGGAGAAGAATTTAGAAGGAATTCTTGAAAGGGAGAAAGTATCGACATTGACCTTCTGGAAAAGCCACGTGATTGAAGGATGTGAACCTGACTCTTGCGTTATTTGTTGACAGTTGTAGAAAATTCAGTCAAAGAGGCTAAAGTGGAGAACAAGGCCGTTTGTAGCTCAGAAGAGTATTTGGGAGATATTAAAACTTTTTGATGTCAGGGACATAAAGACGACCGTGGAGTTCTTCTACACACTTTTGATACTCAGCTAATTCATTTAATAGCTAGGCAAACTGATATACAGTCATGGTCAAAATTATTTTCACAAAATTACATTTTGTGCATAGGGTCCTAAACAGTTGCTTGTGCAGCAAGTGGGGAGGTGAAATGCAAAAAAAACTTTGCTTTACAGAGTCAAACCTATGCAGAGTCAGATGAAAGAAGAATTGAAAAATAACTGTTCCTATGCACCGGGAAGAGAGGCAAATGAAGAGATCTTTATCCAGTTGTCCAGAAGTGTTGCACACGGTTTCGTCGCATCACAATTATTTTCTAACGCAATTTCTTCTTCAGTGATTGGTTTAGAGTGACAAGTGCCGGTTTGTTTGCTTAAATACATTTAAATTATTGAATAAAAGTGGAATTTCATCATTTCCTAATACAGTTATTAAATAAAATGCCCAAAACAAAAGAGTTAACAGTTGAGGCCGGAGCTGGTATTGTTGCTAGGTTTAAAACCATTGCACCTGCGGCCAAAATAATGGCTGAAATATATCAAATTTCGCGTAGAACTGTCTACTACTTAATAAAAGAAGTTTGATACAGTTGGCACATTAAAAATAAAAAAAAAGATCAGGCCGAAACCTGTATGCTGGACCAAAGGAAGGCAATACAGGCAAATACTTGAGTTGTGGCAGAAAGAATCACAGTGCCAGTCCGGTAAAAATTGCCTTAGAATCAAAAAAAAATAATTAGCAAACAAATTGAAGTTCTACAATTCGTCGCAGGCTAAAAGAAGCTGATTTTAAGACATACTTTGTTCGCAAAACGGTGAGATCACACCAACCAACAAAACAAAACGTCTTCGGTTGCGTTTGGAATAGCGACTTTTGGTTTAATATTTATGGACTGATGAGTCTGCATTTCAGTACCAGGGTCCTTACAGCAAGCATTTTATGCATTTGAAAAATAATCAAAAGCATTTGGCAGCCAATAATAATAGATTTGGTGGAGGCACAGTCATGTTTGGGATGTCTTTCCTAATGGATTCGGAGACTTGGTACCGATAGAAGGTACTTTAAATCCCGGAACGGATACCTTCTTATCTTAGAAACAGCCGTGCTTTTTACGTCTGGAAATGGAGCTTTTTTTCCAACTGCACAGATGGATTCTTCAGCTTGGGACAATGCTCCATGCCATAAAGGGTGGGATACCAGCAAAATTTTTTAAAACGACCTTAATCTGGCGGTTCTTCCGTGGCCCCAAAAGCCCAGACAATATCATTGAAAACGTTTGGGCTTTATTAAAAACAACGAACTATTGATAAAATAGAAAAAACGAGAGGAGCCATCAGTAGAAATGCTGGAAATTTGGTCAAATTGACATTAAATTACTGAAACTTTAGGTAAGAGTCAATACCAAAGACTTCAGCTAGTTATTGATGCAAGGTGAGATTGTTACAAAATATTAGTATTGTATTTATATAAAATAAAGAAATTCTTATGTTAACCCATTACGTGGCACC
->57511335-12a8-4ca5-b449-77f6922a16a3
-TTGATGTACTTCGTTCGGTTACGTATTGCTATTCATCCTGGTAAGTATGCCCCTCGGGTCCTCGTTCTGGAGGCAGTGGTCAAGTCGAGACCAGGTAGGAACCAGCTGGGGACTTCCCACTCCCGTCTTTTGCGATGGCGTGATGTGGTCCATCGTCTTCCTGACTGTCGCGGTCATTAGATGCTGTAGGTCAATTTCTCCACCTCTACAGCATCGCTGCAGTCGATAGTCAGCAGCGGCTGCAGGGCCTGCGTGCTCACCCCTTGCCGCCATTGGGACCGAGGATTCCGTCACCATGGGTCCCAGGTTGAAACTCCTGGTGAGGGATCTCGAAAGTCAGAGCTCCTCCTGAACGGAGTCGTTGCGATCAGGGGACTGCCCCCACTGCGCTGTCCAAATAGCTGAAGGATGGCTTCAGGTTACCTAGGTCACAGCCAGATACGGATTTCCCCTGGCACACGGATGGAGGTTTGTACCGCCTCGACTCGGACACCAGGCCTCTGCTTGAGCACCAGCACGGTGAGGATGATATTGTGAATCTGTCACGCGACCTTTGTGCCTTTCCCTTTCTTAAAGACTTGTACGCTCCACAGTTACCAGAATCAAAATTAGAATTAGAATTAAATTTCAGCGGCAATTTTAAATTTAATTTTGAATTTCAACCTACTGTCCTGCCAACGCAGCGTACTGATCCACGCAGTTGATCTGGCAACGCCTCCCTCAGATCGCCCGCTGCGCTATCGGCTGTTTATCCGCTGCAACAGTCGCAAGATAATAAATTACCTATTTACGCCGAAACAGGCGCACAATTAACTCGCGTGATTGTGGCGCAGGACATAGCGCGACTCCACCGTGTGATTTTGCCAGTTTGCCGCACACACACCAGCCGACGCACAACTTCTATGGTTTCCGGTATTTCGCGCCGCGCGTAATTTAAGACGATCCCGTCTTCACGGCGATGTGAACTTGGTCTCGCGCCAGGGATTGAGTGTCACAAGCCTGTACGTTCAGAGTTAAACTTTGGCAATACGACTGGCATTGCAGGTTTTGGGTCTCTTTGTGGGTTTGCACTTCTTTAACCAGTTCGAAAATGGCGATTCGACTCTGGTGTCAGCAAATTGTTTTTCATATTGCTGAGTATGCACACATATCGGTTAAGCACTGTACTATGTGTATTCGCCAATTGTAGCGCACTCTGTTGCAATGTAACGCATAAACAGTCCAGCACAAGTGTATGCGTAATACGGAGCACCACTTGAGACTAGCTAACATACATAATTGCCTGGTCAGCAGTTCTCCCGCTGGCCGAAGCTGATCATGTGTGCCTATACCGCTCCTCCTCAGCACCATCGCTCGCGACGGTATGTATGTACATATATAAGATACGCATATATTGCTGCGCTGCAGGCTAACCGGCAGCACTGCTCCTCGACAGACTGAAACCTTTGTATGTAGATCGCCGGAAGGATTGACGAATTTCAGATGGGCGGGACCTTCCCTGTTCCTCAAATTGGATCAAATAAAGAACAACTAAAACCTGCGATGATCTGTGACACAGTAAGAACTACCAGGAGGGTTGGGTAGGCGGTCCCCACTTCTGATGTCGGATCTGAATACTTTATACTCGGCATCACTCTCTACAGCGGACACAAGTAGCAGAGAGAAAACGGTCGTTAGCGAAATTAAAATAAATCTGCGACTGTTTACCGCAAATGAAATAGAATGAATTTTGATTTAACGGTCAAAATTAAGGGGTTATTTGCTTAATTAAACCTGTTTTTTGGAAATATGTTAAATATTATTTTACTTATAAATTAAAAACAAATTCAAATATCAAATATACAGAAAATGATAACAAATTCCAAGTTTACACACTTTGAGAGTGTCCTGCCCAAACCGTCATCTCTGGGATGAGCTGATGAGTCCACCTCCCCGTCGCGACGTTTATATCTGCTCACCATTCACCCTATCAACCCTCGTGTGCCTCTTGCCTGGAAGCGCCACTCCGCATAAGGCTGAGAGTATGATCTGAATCAATCAGCAGGCCTGCCAGCTAGCGCCATCTCGGATATGGTCTGAATCCTCTAATGAGCCTGAGGGCCATTGACCGGCTAACTTCCGAACAGACTCCTTTCAGGTATGAGACCACTGCAAATTGGCATTGCTCCAGACTGGTGCAGCGTATAGCGAAGCCTTTACTACTGACACCAACGGTTTCTGGCCCGTGTCTTGGGTGACGTTGGGCATAAGCCTCGCCAGCGAAGAGGATATGACTGCTGTCTTCTTGCTGGCGTAGCTCGCGTGGTCCTTGAACGATAGTCTGCGATCTATCATTTGGGCCTTTAGGGACTCTGGTCCCCTGGTACCCTCGAAACGGAGACAACATCATTTCTCCATCTTTTTTTTCCTGCTGCCAGTGGGACTACTTAGCGGTCTTGTGACCGCTATTGCTAGCCAGCTGGTGCCATCGTCAGCGAAACAGCTGCCTCGACGACTTCAGTTCTGTGACGCACGAAATGGGGCGGGGCTGCCTCTGTTGGCCTCCATGAGTAATGGTCTGCTGAAATAGCTCCCCTAATTATGTTATGGGACCCCCGGTCCGGATGGGTGCCGCTCTCCTCCTTAGCTCGTTGGTAACAGAAGCTTGTGGGCGAATTTGAATGTCGCTGTCACCCGCCAAATCCCTGCGGCTCCTTAAACGACCGCGCTTTGGCGGCCGCGATTGCCGTGCTTGAACTCTAGGCGGGTTTGCTTTACAGAAGCCTCAAGGTTCCGTGGTGGGTACTGCCTCTGGCTCGTTGCGCCATTCTCTTAGCCTGAGACGAAATCAGACCGTGGTTGGCAGGGGCCTCCACCGGTAAACGGGTGGTTTGCGCTGTGCCTTATTTTTCCCTTGGCGTGATTGCGTCGCAGATTCTTTAGCATATTCATGGGGCCTGCTGCGCCATGCTCTCGTCCACATTTGGGTTTCAGGGAATTGGTCTGATAGGCCAGCATGGCCTCAATCGATCCTGGTGTCCCATGTTTTCTGACTGTTCTGCTCTGCCGTCTTTTGGGCGCTGCCCTCGGGGAGAAGGAGATCAGGGCATGGTCATCAGCGTCGCTGACGTCATGGACCATCCAGTTGTTGTTGTCTACTAGCCCTCTGCTGACAAAGGTAACGTCAATAAAGGACCGTACCCTATCGTTGTCAAACGTCGGCTTCCGTCCATCGTTCGGCGGTAAGGGTCCAGCATTCCGCGGCAACGTCAATGCAACTCGTCCTCTGGTGTTGGATCCTGCCTTGTTCCACTGTCCAGGCATTAAAGTCGCCAACCAATGACCTTCGGGCTTCGCCCTCTCGCATAGTCCACGAGCGACCTCCAGAGCTCCTCGAACTGATCGGGGGTGTCGCTCGGCGGGCGGCCAACGGCTATACGTATTGCGTGTTTTAACTTCGCACCGTGATACCCGCGTGGGTAAAACAGCCAGTTCCTGGACTTGGAGAGAGCTGCGGCATTTGTGCTTCTTTACCTGCCTCGTCAGGATCATGGACGATTTGTCCACTACCAAGTTGGGGTTCGCTTAGGAGCATGATGTCTACATTGCGCTCAACCGCAGTCTGGGCCAGGAGGCTCCTGAGCTGCTGCAATGATTGACGATGAGCTGTACTACGCTAATATGAGCGTGCGTGGTGGCTCTTGGCATCTTTTGATCGCTCTGTAAGTCAGACGCAAAGCTACCCGTCCGGGTGGTTTCTATCCACCTCGCTGCTGCAGATCAGGCATTTTGGTGCAGCAACGCACCCCTTTGCCTTGTGCTCACCGCATCTAAGACCCAGCAGTCTGCCCTGTCAGTGTCCTTGCGGGTTGCTGATCGATGCCATAGCCAGGGTTACCTGTAACGCATCTCGTGGGTCGGACGTCCTGGAGTGATACGACATCTTGACCATCCAGCGATTATGGTGCCCTGTTTGGGACTGGTATCGCAACGTTCGCGTTCAGCAGCACTGATTGCGCAATTCCGCAGCCTGCAGGCCCTGATATCTTCAGGATTTATCTGCAGGCCCTGATTGGGCGACCAGGCAGCTGTGGAGCTTCTCTGCTGTCGTAAGCCTCGTCAATCCGCTGCAAGATGGAGCTGTTCTTTTGCGGCTCCTGTGCTGAAATGAAGTCATTGAGCGCCGCTTCGGGTCGCTCTTGAAGCTTGGAACCTTTCCGAAGCTTTCCTCTACCTCCAAGCAACCGAGTCCGCGCTCTGCGTTCTCCGGTTTTTTCGCGTGACTGCCCAGTTCATGGGCTCGATTCGATCTTAGCTTCAGAAGCGTCTCTGCGTACCGATATCTCTGTCTTTTACGATGAGTGCCTCTGCCCGTGCTGGCATTCTTGGCGACAGATGCATGGCTGCTGGCGGACTCGTTAGGTATGGATGTCGCCTTTTCTTCTACGTTAAATCCAGCGTAGGTGCTCTCGCCCGGCGCCTGGTTTGGCACCTGCACCGTGGGTTGCCTGCATTTTGGTAGACCTTTTGGTGGGCTTTGTACCTCCGTCTGGGTAGCGCTGCTCTTAAGCGGTGCTCGCTAGTGAAGTACCTTCGTACAGCTCTATCGCCCTGTTGTTAAGGGCTGAGAGTTCGGAAGCTATGCCCTTTGTCTCATGTGTGTGTCATTGGGTCTCGGAGAGATACCGGATAGAAGGGGCTGATCTTGCCATTCATCCTGGGTAATTATGCCCTCGGGTCCTCATTCTGGAGAGCAGTGGTCAAGTCGAGACCGATGGGGGGAACAAACTGGGACTTCCCTCCCGTCTTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCTGACTGTCGCAGTCGTAGATGTAGGAGCCAGTTTCTCCACCTCTGGCATCGCTGCAGTCGATCGTCAACTTGGCGGCTGGGGCCTGCGGTACTCCTTGCCACCGACGGACCAGATTCCGTCACCATGGGTCGGGTTACCGACTCCTCTGGTGGGGATCTCGAAAGTCGAGACTCTCTGAACGAGGTCACTGCGTTGCGATCGGGGGGACTGCCCCCACCGCTGTCCATCCAGCTGGAAGGGATGGCTAAAGGTTACCCTAGGTCGTAGGCCACGGATTTTCCCCTGGCTTTTATAGGATGGAGTTTGTACCGCCTCGACTCGAGACACCAGAGCCTCTGCTTAGGCACCAACACGGTGAAGGATGATATTTGGTCTGTCACGACCTTTGGCTGCCTTTCCCCTTTCTTAAAGACATGCGCTCCCAGTTACCAGAATCAAGGTAAATGAAATTAAATTTCAACGGCTTAATTTTAAATTTAATTTTGATTTCACCACCCTACAATAAACACAACACTGATCACACAGTTGATCTGGCAACGCCTCCTCTCCAGATCGCCCGCTGCGCTATCTGGCTGTTTATCACTGCAACAATCGCAAGATAATAAATTACCTATTTACAGCAAGAACAGGCACAATTAACTCACGCGTGATTGCAGCGCAGAACTATAGCGCGACTCCCACCGTGTGATTTTGCCGGTTGCCGCACACAATGATACAACTTCTATGGTTTCCCGATGTTTCGCGCCGCATGAATTTAGGGCAATCCGTCTTCACGGCGATGTAGACTTGGTCTCCGCGCAGGATTGAGTGTCTAAACCTGTGTACGTTTCAGAGTTAAACTTTGGCAATACGACGGCATTGAGTTTTTGGGTCTCTTTGTGAGTTTGCGCTTCTTTTAACGGATTCAGAAAAATGGCGATTCGACTCTCTGGGGTGTCGGCAAATTGTTTCACTATTGTAGTATGCGCATATCGGTTAAGCACTTGTACCTATGTGTATTCATAATTGTAGCACTCTGTTGCCAATGTGTACGCCGACAGTCCAGCGCAAGTGTATACGTATTGCACAGGCACCCGGGGGCTAACATGCATAATTGCCTGGTCAGCAGTTCTCCCTTTGGCCAAAGCGCTGATCCTTATATGTTATTGCCTATACCACTCCTCCTCCGGCACCATCGCTCGGCGACGGTACGTATATATGCATATATATAAGATACGCGTATAAGCGTTGCTGCGCTGCAGGCTATGCCGGCGGCGCAACTGTTGCTGCTCAAACATCTTATATATCGTATATCTTCTCTTTGTCTCGAGCTGACTGGAAATGGCTATGAACACATATAAACGATCGACGCTTTCAACCAACAGACTGATAATCTCATTAATACTCAATCTCAACGGAGAACTGCTGACCAGGCAATTGTCGCTGTATTGGCCTCAGGTGGTGCTCTCATTATTGCGTATACGCTTGTGCTGGACTGTTTATGTACGCATTTGCGGCAGGTGCTACAATTGAATACCTTGGGTACGGTGCTTATGATGTATTGCGTACGCAATGGTGAAACTGATTTATGACAATTGATTAGAGTCACTGAGATCATTTTCCTGAACACTGATAAAAATGCAAATTCCTGAACAACTCAATGCTATCGTATTATAAAGTTGTCCTGAACGCTGAGCGAAACACTCGATCCTAATTGCCGGAAGACAAATGAACGTCTTCAGGCATGATATCGACCATGAAGTTATTGATCGACCGACCGATGATGCGACTTCAAGCAACTGCGCTTCGTCACGCGGATAATGTGCGCCTGTTCGTATGAAATAGTGATTCAATCTTGCGATTATTTACGGCGGTCAAACGACGATGGCACGGCGAACGATCTGAAGGAACGCCGAATCAACCGACCGATCGTGTTACGTCGATGCGACGCAGTCAGGCTTGCCGAAATCAAAATTAAATTTAAAATTAAACGTTGGTAATTGTTGGTACGATCTGACAAAGAACTGCTGAAATAAAGAGGAAAAGCACGAACGGACAATGATATCGTCCTCTCACCGATAACGATACTAACGAAGACTCTGTTGACCGAAGTCGAGACGATGCAAAACCTCCGTAAACAAAAACCGGGGAAAATCCGTGACACCGTGACGACCATCCTTCGATTGATGGTTAACGCGGTCCCCTGATGCAACGACCGTTCAGGCTTTCGGATCCCCGCCGGAACAAACCGCTGCATGTTGACGGAATCTCGATCCCGTCGATGGCTAATGACGCCTGACAATACCGTCCAGTATCGTTTCTGACGATATCATCTACGTTCGTGGACCGCATCGCTAACCATCGGGCTGAAGGATCTGGCTTGTTCCCCTCGTCGATATTTCGGGCGATACTGCTCTCCAGAACAGTTCTGAAGTTTCACTACCGGATGACTCTTGAAGATCAACCCCGCTATCCTCGGTTTCAAAGGCAACTCCGGACTCGACCGCCAACGGTTTTGGGGCGATAATTTCAACAGAAAGGTACTGGCGAACGCGGG
->40926fad-c505-4453-a4bd-19739ea08e23
-CCCAAAATTGTGCTTCGTTCAGTTACGTATTGCTACTTTGCTGGATTCTAAATCGTTTTACTCAGATCATTATTTCTATTTTCTATTTTTTTTGGACAAAGGACTCACAATGATAAATTCCTACACCCTTGTAGCTGGCGGCGTGTTCTTCGTAGCAGTTGGCACATTTTGCTGGTTGTTCTGTATTTTTCGGGCAAATGTTGCTTGGGTGTCGAAGGATTTTACAACCCGGTACGTTTTGGTACAATATGATTTAGTATGTCAGAATTCCTGGCAGCTATAGCATTGAACGATTTCATTATTAAGGGGAGGCTCAATGTTTATTTACATTATATATGTCTAGGTTTGTTAGGCTCAATATCTACATAAAACATGTTCAGTGACGTTTGGTCGCACGGCTTTTAATATTACTTATGTTTCCTATGCTTATGACCTTTGACTCTTCATCACTTTTAATTTCATCTAAATTTGTGGAAAAAAATGCAAATTCTTAATAACAATCCTAAAATGCTCTGTCATCCTTAAGCTGGTATGTGTGGTACTGCACACAGTAGTAATAAGTGTTTTGACTAATTTGCTGGTCTTCAATGCTTTTAACCATTATACATGTCCATAACGTTGGAGTCTTATAATAAAAAAAAGTTCTCTTGTTTAGTTTTAAGATAGGTTAGCTTTCACTTATACCATTGACGATCGAAGATAGGTGGGAAAAACCTTAAAATCAGTTGCATCTTCTTCATTTACCATTTGAGATCTTCGTTTTTGTTAGCATATTTGTTTCCTGTTTGTCCGGGCAATCCGTCGCTTAAGAGAGCGAAATTATTTGCGCTGGTGCTTGATGAATTGTCAGGGAATCCTGTTTTCTTTGAACTTCAGGGAGGGAGCTTGGTCTCTTTTTTTTGGATTTTATTTTACTCTCTGCCATTTCAAAGCAGTTAAGGTCTTCGTCGAACATCGCTCTGCTTGAGTATTAAAGAAGACAATGATTGTTGAGTGCTTGTGTGTCCGCACTTCGTGCCTCAAGATATGACCAAAGCAAGACACTAGAATAATTCTAATTTGATATGACGTTTGCAATAAACAGTTAACATTTTTTTTATTTTATAAATTTTTTATTTTCTACTTCGTATTATTTTTTATGAAATATTTTTCTCAGTGTAATGACTTCTTTTTTTCAGTTTTTTTATATTCCAATTATCTTAAACAGCGCGCAATTTCATCATATTCTACGAAATTGGCCAAAACTCCCAAATATGTATGTACATATGTAAATTCGTTACTGCGATCAAAATTGATTTCGGCGAAAATCGCCTTCTAGCACAACACGCACACATATACGCGTTCTCGTCTTTTGTTTTACTCACAAACAAGCGAATTCTATTTTAGATTTCTTACGCTCAGCTGAGCGAGCAGAGAGAAGCGAATTTTGGCCGTCACCAAAAAAAGTGATGTGCATAGTGCCAAACCAGTGTATGGCTGCGCATCTTATTCTAGCTAGTGTGTCTTTGATGCAGGCCATGTGACTTTTGCTTAAATGTGTACATACTTTCCAACACGCCACCTCAAAGTAAGATTGCTGTACTTTTGGCTACTCAGGACTGGCGTCGCTTCTGACGGAATAAAGAATTTTGATCCAGCATTCCGTTGCGAGGGTGTTGGGGGGGAGACCCAGAAAACCCGACAGATCAATTGAACATATTATTTATAAATTCAGTTTGCAAACTATTTTAACTAAAATTAATATTAGTCATCTTTGTAAGAAACTCAAAATTATCCAGTAAACTTAATTAGAACTTTGGATTAAATGATAGTTGCGGTTTAGTTAGTTCAATTCTGGTTCCTCGTCAGTTCAATCTAAAGAATATAATGTTTTTAATTCATTCTGAGAGTCAAAGTCCACTTCTCAATGTAATGAATCTTGCAGATGGTGTACCGGCAAAGTTGTAAGTTGTAGATATATACAGTTTGTCAAGAAACTATTTACGCCGTGAAATACAAGTTGAATTTTTTTCACTTTAAAGGAGTCAAAATTAAAAGGTTTGCTGCTTTAATTAAATATAATTTTTTTTAATGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAAACAAATTCAAAATATCAAAATGCATACAAGAAATTAAACAACAAATTCCAAGTTTACACACTTTTGCCCCGAGGTGAAAACTCCTTACACATTTTTGTTTTTTTCCCTGCTTTGTTTTTTTTGCTCTTTTTTCTTAGAACGAACTCGATTTTTCCGTTATTTTTTGGCATTTTGCATTCCTTTACACAACTTCTATTGAAATTTTTTTACTTTGCTTGTGAAATTTGCTGATCAGTGGTTATTAAATTTAATAAAATGCCTGGAAATAGATTAGCTTTTGGAAGTGACCCAAATGTATATAAAACAAACCACCAGTTGGGAAAATCTATTCAGAATTAGTATAAATGTTTTCTGTATCCATGGGCCGTCACAATGTTTTAATCGCTTGAAAAAGAGAACGGGCTTGAACCTAAAGAGTGGTGGGCTGCAAAACTAAAATTAGCAAGCTGGTCGCCTTATTATGCGAAAGTGATTGCGAACCCCAGATATAAAGTCCAGATCCTTGCTCAGGATATCAGGCAAAGAATGTGACCTAGTTGTACACACAAAACTGTGCGCCAAGTCATTTCTACGCCATGGGTACTCTTCAAGGTTGCAGAGAAAAAAAGCCTTTGCTATCAAGAGGTCAATATGAAAGCGTCGACCTGTTCGCTGTGAGCATGATGGATCATGCGGGAAGAGTACTGGGATGACGTAATATTTTTCAATGACGAAACAAATGATGCTCTATTATAACGATGGAGCCAAGCAGGTATGGCCTGAAGCTGTTGAGTGCGCTAGAAAAACAAAATATCCCGTTCCAACAATCAATTTTGGAAAATTATCCGGTGATGATTTGGGAGACAGCATCATAGGAAGCCGAGTGAGCAAATTAGCCTTTATTGAAAGCACACTGAATGCCGTGCAATATGAAGTATTTTTAAAATTAAATTTGACCAGTGCAGAAAAGTTTGGTCTATTTAGCAACAACAAGCCATTTTAAGTTTTGTCGGGACAATGATTCCCAAACATAAAAGAGGTACGTACACGCAACTGGCTCCTTTATAACTGTGGCAAGGTGATCGATACGCCCCCTCGAGTCTTGATCCCCAGACCCCCCATTGAAAATTTATTGTGGGCCTGCTTAAAGAAGAGATATGGCCAAGGGGCGCAAAACACGACAGCAGCTCATGGCTGCGATAGAAGTGGAAAATTCCCTTGAATGAAAGCCTAAAAACTCATCCATTCCATGAAAAAGCTTTAACATGGCCGAAGCCAATGGAAGTTATACTAAATACTACAACTTTTTCAAATTTTAACAAAATAATTTAAAATTTAGAAGTTAAACTTAGGTTTAGTGTTTTGTAAAGAGTTCTTGAGGCGCTCTCTCAAAAAAAGTCATTTAAACTTGGAATTCGTTGTTTATTTTTCTTATATTATTTAATATTTCGGAAGTGACAATAAAGTAAAATAAACCTGTGTTAATTATATTTCTGCGTTTAAGTAAACAAATAACCCTTAATTTTAAACCGTTAAAATCAAAATTCATCTTATTTCTACACGGTGTCGCTGTTCTTGACAAACTGTTTCATTTCAAGTTAAACGACCGTTTCACCAGTACTTTGTAGTAACGCAGAGAGTGATGCCGAGTATAAAGTGATTCAGATCCGACATCAGAAGTGGGACCGCCTATACCTTCCTGTATTTCATTGTGTGTCATAGATCATTTTATTGAACTTTAGCTGTTCCTTTATTTGATCAGGCCCGAGGAACAGGGAAGGTCCCGCTCCATTCGAAATTAATTCGTCAATCCTCTTATGGTCACATGAGTTTCTTAGCCTAAGTCGAGGAGCAGCGCTGCCCGGCATAGCCTGCAACGCAGCAACTTGCTATATGCGTATCTTATATATATGTATATATATATATGTACTTGTCGCCGAGCGATGGTGCTGGAGGAAGTGGTATAGGCACACATATAAGCGATCAGCGCTTGGCAGCCAGCAGGGCTGACCAGGCAAGGTATTATGTATGTTAGCCCTCAGAGTAAGATTGCTCGTATTGCAATATACACTTGGTGCTGGGACTGTTTTATGTACACATTGCAACAGAGTGCTACAATTATGAATACACATAGGTACAGTGCTTAACCATTATGTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTAGAGTCCTTAGAATCGCCATTTTTCTGAACTGTTAAAGGGTGCAAAACTCACAAAGAGACCAAAACTCAATGCTGTCGTATTGCCAAAGTTTGATCACAGACGCACGGGCTTAGACACTCAATCCTGGTGCGGAGACCAAGTCTACACATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCGAAGTATCGAAACCATAGAAGTTGGCTGTCCGGCCGGTGTGTGCAGCCGACTGGCGAAATCACACCGGTGGAATCGCGCCATAGTTCTGCGCTGCAATCCGCACGGAAGTTAATTGTGCGCCTGTTTCATGTAAATGGGTAATTTTATTATCTTTGCGATTGTTGCAGCGGATAAAACTAACTGATAGCGCAGCAGCGATCTGGAGAGGAGGCGTTGCCAGATCAACCGTGTGATCAGTGTTGTGTTGCGACAGTAATGGGGCGCAGAAATTCCAAAATTAAATTTAAAATTAAGCGTTTGAAATTTAATTTAATTTAGTGCACGATTCTGGTAACGGGGCGCACAGAGTCTTTAAGAAGGGGAAAAGGCACAAAAGGTCATGGACAGGGCCCAAATATCATCCTCTCACCGTGCAGTTGCCTAAGCAGAGGCTCTGGTGTCGAGTCAGGGGCGGTACAAGCCTCCATCCGTAAAGCCGGGGAAATCCGTGGCCTGCGTGACCTATAGGTAACCTTAGGTATCCTTCAGTTGATGGACTTAGCGGCGCAGTGGGGGGCAGTCCCCTGATCGCAACGACCCGTTCAGGGGAGGAGCTCCCGACTTTCGAGATCCCCACCAGAGTCGGTAACCCGACCACATGGTGACGGAATCTCGGTACGTCAGTGGCAAGGAGTGAGCACGCAGGCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGAGGTGGAAAGTGGCTCCTACAGCATCTACGACCACTGACAAGTCAGAAGACGATGGACCACATCGCCGTGCCATCGCAAAGACGGGAGGGAAGTCCCCAGCTTGTTCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCCAGAACGAGGACCTGAGGGAGCATACTTACCAGGATGAATGGCAAGATCAGCCCCTTCTATCCGCATTCGAGACCCAACGACACGCATGAGAGACAAAGGGCATAGCTTCCAGACTCTCGGCACCTTGGGCGATAGAGCTGTACAGAAGGTACTATGACACCGCTTGAAGAGCAGCGCTTCTGCAGACGGAGGTACAAAGCCTACCAAGGCTCCACAAAATGCGCAAGGTACCCACGGTGCGGGTGCCAAAGTCCAGGCGCCGAAGCAGAGCAACCCTACGTTGGATGGCAACGGTGAAGAAAGGCGACATCCATACCTAACGAGGTCAAACCAGGCAGCTATGCATCTGTCGCCAAGAATGCTAGCACGGGTGCAGAGGCACTCATCGTAAAGACAGGAGGCTTCATTGCGCAGAATGCTTCCAGGTAGCTAAGATCGGAATCGAGGCAGCCTTAGCGGACTGGGCAGTCACGATGCGAAAAAATCCGGAGGAACGCAGAAGGTGATCTGTTGCTTGAGGGTAGAGCTTCGGAAGCGTTCCCCAAGTTTAAGAGCGACCTGGAAGCGGCGCTCAATGAGCTTGGCCTCTGTGTGCGCACAGGAGCGCAAAGAATAGCTCTATCTTGCAGCGAGTTTGGACGAGGCTACGACACGGCAAAGCTCCACAGCTGCTTGGTCGCCCAATTCCAGGGCCTGCAGATAAAATCACACAGAGATATCAGGGGCCTTCGCAGTATGCGGAATTGCAAACAAATGGCTACTCAGTGCGCCGGAACGCGAACGTTGCGATACCAGTCCTTAAACAGGGGCACCATAGTAATCGTTGGATGGTCAAGATGTCGTATCGCAGGACGTCCGACCCACGGATGCTACAGGTGTCTCGGCTATGGGCATCGATCAGCAACCTGCAAGGACACTGACAGGGCAGACTGCTGTCTTAGATGCGGTGAGCGTAGGCACAAGGCAAAGGGCGTTGCTGCACCAAAATGCCTGATCTGCAGCAGCGAGGTGGACGAAACCACTTACGACGGGTAGCTTTGCGTGCCCGACTTACAGAGCGACACTAAAAGATGCCAAGAGAGCCACGCCAATGCACGCTCCTTATTAGCGTAGGTAACCAATGTGTCATTGCGCAGCCCAGCTCAGAGCCTCCTGGCCCCGGACACCGGTTGAGCGCGCAATGTAGGCATCATGCTCCTAAGCGAACCCTACCGTCTCTGGTGGTGGACAATCAAGTCCATGATCCTTGACAGGAGCCCAGGTAAAGCAGCTATCCAAATGCCGCGGCTCTCTCAAGTCAGGAACTGGCTGCTATGCGAAGTTAAAACACGTGCACATGTACAGCTGCTACGCTCCGCCGGCAGCACCCCGATCAGTTCGAGGCTTCTGGAGGCGCTCGTGGACCATGCAGGCGAAGCCCGAAGGTCATTACCGGCGACTTTAATGCCTGGACAGTGGAATGGGGCAGCAGGACATCCAACACCAGAGGGCAGGCTGGCGTTGCGGCGCCGTATGCGAATGCTGGACCTCATACTGCTGAACGATGGACGGAAGCCGACGTTTAGCAACGATGAGGTACGTCCCGGCTACCGCTGTCAGCAGAGGCTAGTAGACAACAACAACTGGATGGTCATGACGTCATGACGCTGAGCGACCATGCCTGATCTCCCTTCTCCCGGAGGTACCCAGGAACTGGCAGAGTAGAACAGCCAGGAAAACATGGGACACCAGGAAGATCGATGAGGCCATGCTGGCCTATCAGATCAATTCCCTGGAAATCCCAAATGTGGACGCAGAGAGTATGGCGGCAGGCCTCATGAATATGCTGGGAAGAATCACGGGCACAATCATGCCAAGGAAAATAAGGCACAGCGCAAACCACCCGTTTGCAGTGGAGTGCCTCCCCTAAGCCAACTACGGTCTGATTGCCTCCAGGGCTAAGAGAACGGCGCAACAGGCAGAGGCAGTACCACGCGGAACTCTTGGAGGCTTTCCAGAGCGGCGCCTAGAGTTCAAGCACGTATCGCGGCTGCCAAAGCGCGGTCGTTTAAGGAGCTGCAGGATGGCGTGAGCCAGCGATATCTGGGCCTCGCCACCACAAACATTACCAACGGAAGGCTAAGGAGAGAGCAGCAACCCATCCGACCGGGGTCCTGGCTAACATACTGGGAGGAGCTATTTCCCGGCAGACCACACTATGGAGGCCAGCAGAGCGGCCTGCCCCAGATTTCCCGTGCGTCACAGAACTTGAAGTCGTCAGGGCAGCTGTTTCGCTGACGATGTGGCAATCACAGCCGGGCTAGCAATAGCGGCTCACAAGACCGAAGCAGTCCTACTAAGCAGCAGGAAAGATGGAGAACATGCTGGTCTCCGTCAAAGGGTACTCAGGGGACCTCTCAAGGTCCCTAAAGTACCTGGGGGGGGTAATGATAGATCGCAGACTATCGTTCAAGGACCACGCGAGCTACACGCCAGCAAGAAGACGCTGATCACGCATCCTCTTCGTTGGCGGGAAAAACATGTACCAGCGTCAGGCCCAAGACACCCGGCCGAAACTGCTGGTGTCAGTAGCAAAACTTCGCTGCTATACGCTGCCAGTCTGGAGCAATGCCACTTGCAGGGTCTCATACCTGAAGAGGAGCTCGTTCGGATTGCTACAGTCCAGTAGCCCTCAGGCTCATTAGAGGATTCAGGACCATATCCGAAGACGCGGCGCTAGCGCTGGCAGGCCTGCCGATTGATCTGGAGATCAAGGCTCTCAGCCTTGCGGAGTAGCGCTTCAGGCAAAGAGGCACACGAGAATAACTATTAGGTGAATGGCAGAGCAGATGGCAAACGTCGCGACGAAGGGGAGGTGGACCTATCAGCTCATCATCCAGAGATGACGGTTTGGGCAGAGTGACACTCTCAAAAGAAGTGTGTAAACTTGGAATTTGTTATTTATTTTCTTGTGTATTTGATATTTTGAATTTGTTTTTTTAATTTATAAATTAAAATAAATATTGTTTAATTATATTTCCTAAAAAAATTGCGTTTAATTAAACAAATAGCCCTTAATTTTGACCGTTAAAATCAAAATTCATCTTATTTCACGGTGTGTAAACGGTTTCTTGACAAACTGTACTTGTCGCAGATTTATTTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTATGAAGTGATGCCGAGTATAAAGTGAAGTTCAGATCGACATCAGAAGTGGGATACGCCTACTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTGTGTTTTAGCTGTTCTTTATTTGATCAATTTGAGGAACAGGGAAGGTCCGCTCCATTCAGAAATTAATTCGTCAATCCTCTTATGATCACATACAAGGTTTCTTAGCCTAAGTCGAGGGAGCAGCGCTTTGCAAGCATAGCCTGCAGCACAGCAACGCTATATGCGTATCTTATATATATGTATATATATATGTACTGTCGCCAGAGCGATGGTGCTCGGAGGGAGAATTGGTATAGGCACACATATAAGCGATCAGCGCTTGGCCAGCGGGAGGAACTGCTGACCAGGCAATTATGTATATTAGCCCTCAAGTGGGTGCTCGTATTACGTATATACACTTGTGCTGGACTGTTTATGTACACATTGCAGCAGAGTGCTACAATTATGAATACACATAGGTACAGTGCTTAACCGATATGTGTGCATACTACAATGAGTGAAACAATTTGCTGACAATTCTAGAGTCGCAGAATCGCCATTTCTGAACTGTTAAAGAAGTGCAAAGACTCACAAAGAGACCCAAAAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCTACAGACGCACAGGCTTAGACACTCAATCCTGGTGCGGAGACCAAGTCTACATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCGAAATGCCTCGAAACCATAGAAGTTGTGTCGGCCGGTGTGTGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCGCCATAGTTCTGCGCTGCAATCCGCGCGGGGATTAATTGTGCGCCTGTTTCGTAATAAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAACGGTAAGCGCAGCGGAGCGATCTGGAGAGAGGGAGGCGTTGCCAGATCCAACCGTGTGATCCAGTGATGTTGTGATGTTGCGACAGTAGAGGGCGCAGAATTCAAATTAAATTTAAAATTAAGCCGTTTGAAATTTAATTTAATTTAATTTTGATTCTGTGGTAACTGGGGCGCACAAGTCTTTAAGAAGGGGAAAGGCACAAAGGTCGCGGACAGACCAAATATCATCCCTCTCACCGTGCTGGTGCCTAAGCAGAGCTCTGGTGTCGAGTCGGCGGTACAAACCTCCATCCGTAAAAGCCGGAAATCCGTGGCCCTACGTGACCTAGAGTAAAGCAATGCATGGCAAA
->34286af3-056d-42c5-894a-ad874f1968f2
-TTGGTATTACTTCGTTCAGTTACGTATTGCTACGTTTGCAATAAACAGTTAACATTTTTTTTTTATTTTATAAATTTTTATTTTCTACTTCGTATTATTTTTTTATGAAATATTTTTTTTCTCAGTGTAATGACTTCTTTTCAGTTTTTTTTTATATTCCAATTTGATATCTTAAAGCAGCACCAATTTCATCATATTCTGCGAAATTGGTAAAAACTCTAAATAATAATGTACGTATGTAAATTCGTTACTGCGATCAGAATTGATTTCGGCCCGAAAATCGCCTTCTAGCACAACACGCACACATATACGCGTTCTCGTCTTTTTTGTTTTACTCACACAAGCAAGCAAATTCTATTTTTTAGATTTCTTACGCTCGAAAGTGAGCGAGCGGAAGAACAATTTTGTACGTCACCAAAGGTGTGGCTGCATAGTGCCAAACCAGTGTATGGCTGTTACGCATCTTATTATTCTAGATGATGCAGGCCATGTGACTTTTGCTTAAATGTGTACATACTTTTCCAACACGCCACCTCAAAAGTAAGATTGCTGTACTTTTATTACTCACGAAGACTGCTGTGCACGTCCTTCTGACGAATAATTTTTTGATCCAGCATTCGTTGCGAGGTGTTGGGAGACAGAAAAACCAACCAGATCAATTGAACATATTATTGCGAATTCGGTTTGCAAACTTATTTTAACTAAAGAATTAATATTAGTCATCTTTGAAACTCAAAATTATCGGTAAACTTAATTAAATTTAGTTAAATGATACAGTTAGTTTGAATTGGTTCAAGTCTGGTTCCTCGTCGGTTCAATCTAAAAAGAATGTAATGTTTAATTCATTCTGAGGAGTCAAAGTCCCACTTCTCAGTAATGAATCTTGCGGATGGTACCGACGGAGTTGTAAATTTTGTGGAGAATATATACGGTTGTCAAGAAACTATTTACACGCCGTGAAATATAAGTTGAATTTTCAAAACGAAAGGTCAAAATTAGGGTTATTTCTTTAATTAAATACTGATTTTTTAATGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAGAAAACAAAATTCAAAATATCAAATATACAAAATTAAAGCAACAAATTCAGAGTTTACACGCTTTTGAGAGTGGCAAACTCCTTACACATTTGTTTTCCTACTTTTGTTTTATGTTTTCTTAAGGAGACGAACTCGATTTTCCGTTGTTTTGACGTTTGTTCCTTTTTGACGCTATTGAAATTTTTTTTACTTTGCTTTGAAATTTTGCTGATCGAATGAGAGTTACATTAAATTTAATAAAATGCCTGGAGTAGATTGGCTTTTGAAATTGACCCAAATAATATGCTAAAACCACCGGTTGGGGAAAATCTATTCAGGAATTAGTATAAATGTTTTCTGTATCCCGTAAGACCGTCTACAATGTTTTTTAATCGCTTGAAAAAAAGAGAACAGGCTTGAATACAAGAGTGGTGGGCGCAAAACTAAAATTAGCAAACGTGTAGACCGCCTTATTATGCGAAAAGTGATTGCGAACCCCGAATCTCGGTCAGATCACTTGCTCGGGATATCAGGCAAGAATGTGACCTAGTTATTGCCACACAAAACTATTGCGCCAAGTCATTCTACGCCATAGGTACTCTTCAAGAGTTGCAAGAAAAAAAGCCTTGCTATCAGAGGTCAATAGAAAAGCGTCATTCATTCGCTGTGAGCATGATGGATCATGCGGAAGAGTATAAGGATGACGTATATTTTGTGACGAAAACAAAAATGATGCTCTATTATAACGATGGGCCAAGCAGGTATGGCGCAAACTGTTGGTATGAAAAACAAAATATCATTCCAACCATAATCAAATTTGGAAAATTATCAGTGATGATTTGGAGACTGTATCTCAAGCCATGGGTGGGCAAATTAGCCTTTATTGAAAGCACTATGAATGATGCCGTTGCAATATCTAGATATTTTTAAAATCAGAATTTGAAGGCCAGTTGCAGAAAATTTGGTCTGTTAGCAACAACAAGCCAAATTTTTAAGTTTTATCGGGACAATGATCCCAAACATAAAGGGATTGCAATGTACACCCAGCTGGCTCCTTTATAACTGTGGCAAGGTGATCGATACGCCCCCCTCAGAGTCTTGATCTGAACCCCATTGAATTTGTGGGCCTACTTAAAGAAGAATGTGGCAAAGGGCACCAAAACGACAACAGCTCATGGCTGCGATAGAGTGGGAAAAAAGATCCCGCTTGAATATGACCTAAAACTCATCCACATTCCGCCCAAGAAAAAAAAAAAGCTTCAACTTGTAGCCAAACCAATGGGGTCATACTAAAGGCACTACAACTTTTCAAATTTTTAACAAAATAATTTAAAAATTTAGGATTAAGAAAACTTAGGTTTAGTGTTTTGTGTAAAGAGTTTCTGAAACTCTCAAAGAGATGTTTAAACGGAATTCGTTGTTTATTTTTTTCTTGTATATTTGATATTTTGAATTTGTTTTTTAATTTATAAGTAAAATAAATATTGTTTGAATATATTTCCTAAAAAAAAAAATTGCGTTTAATTAAGCAAATAACGCAATTTTGACCGTTAAAATCAAGAAATTCATCTTATTTCACGGTGTGTAAGTAATGGTTTTGACAAACTGTACTTGTCCTGAATTTATTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTTGTGTGTCCGCTGTAGAGAGTGATGCCGGTATAAAGTGATTCAGATCCGACATCGAAGTGGGACCGCCTACTCCAACTTCCTGTGGTTTTCATTGTGTCATAGATCATTTTGTGTTTTAGCTGTTCTTTATTTGATCAATTTGAGGAATTGAGGAAGGTCCGCTCCATTCGAAATTAATTCGTCAATCCTCTTATGATCTACATACAAAGGTTTCTTAGCCTAAGTCGAGGAGCAGCGCTGCCAAGCATAGCCTGCAGCACAGCAGCACTGCTATATGCGTATCTTATATATGTATATATATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAGAGTGGTATAGGCACACATATAAACGTCAGCGCTTGGCCAGCAGGAGAACTGCTGACCAGGCAATTATGTATGTTAGCCCTCAAGTGGGTGCTCATTACGTATACACTTGTGCTGGACTGTTTATGTACACATTGCAACAGAGTGCTTTACAATTATGAATACACATAGGTACAGTGCTTAACCGTGTATTATTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTGTAAGTCGCAGAATCGCCATTTTTCTGAACTGTTAAAAGTGCAAAACTCACAAAGGGGCCAAAACTCAATGCTGTCGTATTGCCAAGGGTTTAATCCTGAACGCACGGGCTTAGACACTCAATCCTGCTGCAATCACGCGAGTTAATTGTGCGCCTGTTTCATGTAAATAGGTAATTTATTATCTTTGCGATTGTTGCAGCGGATAGAAGCAGCTGATAGCGCAGCGGGCGATCTGGAGAGGGAGGCGTTGCCAGATCAACCGATGTGATCAGTGTTGTGTTGCGACAGTAGGGCGCGAAATTCAAAATTAAATTTAAAGTAAGCCGTTGAAATTTAATTTAATTTAGTCTGATTCTGGTAACTGGGAGCGCACAAGTCTTTAAGAAGGGGAAAAAAAGGCACAAAAAAGGTCGCGGACAGACCAAATATCCTCTCACCGTGCTGGTGCCTAGCAGAAGGCTCTGGTGTCCGAGGTCGAGCGGTACAAACCTCCATCCGTAAAAGCCGGGGGGGAAATCCGTGGCCTACATTGACCTAGGTAACCTTAGGCCATCCCTTCAGTTGATGGACAGCGCAGTGGGGGGCCAGTCCCCTAGTCGCAACGACCCGTTCGGGAAGACTCCCGACTTTCGAGATCCCCACCAGAGGTCGGTAACCCGACCCATGAGTGACCCGATCTCGGTCCGTCGGTGGCAAGGGGTGAGCACGCAGGCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGGAGTGGAAGAAATTGGCTCCTACAGCATCTACGACCCTGACAAGTCAGAAGACGATGGACCACATCGCCGTGCCATCGCAAAGACGGGAGGGAAGTCCCAGCGATTTCCCCCTCATCGGTCTTCGGACTTGACACTGCTCTCCCAGAACAGGGACCGCGAGGAACGCCTTTCCAGGATGAATGGCAAGATCAGCCCCCCTTCTATCCGTTTCGAGACAACGACACATGAGGGGCAAGGGCATAGCTTCCGAACTCTCAGCCCTTAACAACAGGGCGATGGGGCTGTACGAAGGTACTTTACTAGCGAGCACCGCTTGAAGGCAGCGCTACAGACGGAGGTACAAAGAAACTGCAAAGGCTCCACAAAATGCGCAGGTACCCACGGTGCGGGTGCCAAGGATCAGGCGCCGAAGCAGGCAACCCCTACGTTCGGATGGCAACGGTGAAGAGAAAAGGCGACATCCATACCTAACAGCGGGTCCAAGCCAGGCGTATGCATCTGTCGCCAAGAATGCTAGCACGGGTGCAGGGCACTCATCGTAAAGAACGGGAGAGGCTTCGTACGCAGAGATGCTTCGGAAGCTAAGATCGGAATCGAGCCTTAGCGAACTGGGCAGTCACGTGCGAAATCCGGAGAACGCAGAAAGGGTGATCTGTTGTTGCTTGAGGTGGGGAAGCTTCGGAAAGCGTTCCCAAGTTTAGAAGCGACCTGGAAGCGGCGCTGTGTAACAACCTCTGTGTGCGCACAGGGCGCAAAGAATAGCGCTCTATCTTGCAGCGGATTGGACGAGGCTACGACGGCGAAGCTCCACAGCTGCTTGGTCGCCCAATTCAGGGCCTGCAGATAAATCCTGAAGATATCGGGGCCTTCGCGGTATGCCGGAATTGCAAGCAAATAGCCTCAGTGCTGCTGAACGCGAACGTTGCGATGCAGTCCTTAAACAGGGCACCATAATCGTTGGATGGTCAGAGATGTCATTATCACCAGGACGTCCGACCACGAGATGCTACAGGTGTCTCGGCTGGGCATCGATCAGCAACCTGCAAAGGACACTGACAGGGCAGACTGCTGTCTTAGATGCGGTGAGCGTGGGCACAAGGCAAGGGGTGCGTTGCTGCAAATGCCTGATCTGCAGCAGCGGGTGGACAGAAACCGACGGGTAACTTTGCGTGCCCGACTTACGAAACGACACTAAAAGATGCCAAAGAGCCACCTTAATGCACGCTCATATTAGCGTAGTACAGCTCAATGTCAATCATTGCGCAGCAGCTCAAAGAGCCTCCTGGCCCAGACTGCGGTTGAGCACAATGTGAACATCATGCTCCTAAAGCGAACCCTACGTCTCTGGTAGTGGACAATCGTCCATGATCCTTGACGAGGCGGGTAAAGCAGCTATCAAATGCTGCAGCTCTCTCAAGTCCAGGAACTGGCTGCTTTACCCATGCGGGGTATAAGCATGCGAGAAGTTAAAAACACGTGCACATGTACAGCTTACGCTCCGCCGAGCGAGCACCCCGATCCAGTTCGAGGAGCTTCTGGAGGAGGCGCTCGTGGACCATGCGAGAGGGCGAAGCCCGAGTCATTACCGGCGACTTTAATGCCTGGACAATGGAATGGGGCAGCAGGACATCAACACCAGAGGACGAGCTGTGATTGACGCCATGCGAATGCTGGACCTCATACTGCTGAACGATGGACGGAAGCCGACGTTTAACAACGATAGGGGTACGTCCTTTTGGCTGACGTTACCTTTGTCCGGCAGAGGGGCTGAAGTAGACAACAACAACTGGATGGTCCGTGACGTCATGACGCTGAGGCGACCATGCCCTGATCTCCTTCTCCCGGAGGGCATGCCCAAAAGACGGCGAGAGTGGAACAGCCGGGAAAACATGGGACACCAGGAAGATCGATGAGGCCATGCTGGCCCTATGGATATTCTGGAAATCCCAAATGTGGACGCAGAGAGTATGGCGGCAGGCCTCATGGTTATGCTGGGAAGAATCTGCGACGCAATCATGCCAAGGAAAAAATAAGGCACAGCGCAAACCACCCGTTTACTGGTGGAGTGCCTCTAAGCCAACTACGGTCTGATTTTACTCCAGGGCCGAGAGAACGGCACCAAACGAGCCAGAGGCGGTACCACCACGCGGAACTCTTGGAGGCTTTCAGGAAACAAGTTCAAGCACGGCATCACCGGCAAAGCGCGGTCGTTTAAGGCTTTGCGGGATGGCGTGAATTGTAGCGATATCTGGAGACCTCGCCTACAAGCTTGTTACCAACGAGCTAAGGAGGAGGAAGCGGCAATATCCGACCCGGGGGTCCTGGCTAACATACTAGAGCTATTTCCAAAGCAGACCACACTATGGAGGCCAACAGGGCGGCCCTGCCCAGATTTCCGTGCGTCTGGGGCTTGAAGTCGTCGAGGCAGCTGTTTCGCTGACGATGTGGCAATCACAGCCGGGCTAGCAATAGCGGCTCACAAGACCGAAGCAGTCCTACTAAGCAGCAGGAAAAGATGGAGGTATGCTGGTCTCCGTCCAGGGTACTCAGGGGACCTCTCAAGAGTCCCTAAAGTACCTGGGGGGGTAATGATAGATCACCAGACTATCGTTCAAGGACCACGCGAGCTACGCCAGCAAAGAAGACAACAGTCACGGCATCTGCTACCGTTGGCGAACATACCAACGTCGGAGGCCCAAGACACCGGCCGGGAAACTGCTGGTGTCGGTAGCAAAGGCTTCGCTGCTATACGCTGCACCAGTCTGGAGCAATGCACCACTTGCGGGTCTCATACCTGAAGGGAAGCTCGTTCGGTGCTACGGTCAATGGCCCTCAGGCTCATTAGAGGATTCAAGGACCATATCCGAAGACGCGGCGCTAGCGCTGGCAGGCCTGCCGATTGATCTGGAGATCAAGGCTCTCAGCCTTGTACGGAGTGGCGCTTCCAGGCAAGAGGCACACGAAGGTAACTTTAATGGGTGAATATGGCAAGAACAGATGGCAAACGTCGCGACGGGGGGAGGTGGACCTATCAGCTCATCCAGAGATGACGGTTTTGGGCAGAAGTGACACTCTCAAAAGTGTGTAAACTTTGGAATTTGGTATTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTAATTTATAGGAAGCAAAATAAATATTGTTTAATTATATTTCCTAAAAATTGCGTTTAATTAAGCAAATAACCCTTAATTTTGACCGTTAAAATCAAAATTCATCTTATTTCGGTGTGTAAACGGTTTCTTGACAAACTGTACTTGTCGCGAATTTGTTTTTAATTTCAAGTTAACGACCGTTTTTCTGTTACTTTGTGTCCTTTGTAGAGAGTGATGCCGGTATAAAAGTGATTCCAGATCCGACATCCTTTCTCTACAGCGGTTCTAATGCTGTCGTGCTGCTCATCTACGACTAGCTGATCAGCTATTTTACACCGACAACAAACCAATTTCAAAAACAGAGTTAATTAAACTTATTTTGAAATACTAGTAAACAATATTTATTTGCAGAACCAAGCTAAAATTCAAAATATCAAGCCTGCTGAAAGAAAGAGCATTCAAGTTTGCTGAAAGTCGCAAGCAAACATCTCACGGGATATTGTTCGTTAAATCAGGCGTGCTATGCTGCTAATACTATCGCGCTAGTATCTTTAACGCAGACCATCGCCAGGCGAACGCTGATGAATTATCGACAGTGCCGCCGTCTTCAGATACTGAATATTACGAAACCGATATTTCCGTAACCAATTTCGAACAGACCTGCAATTGACGAACTATTGCGGCATACTAACAACGGCCTCGGCAACAGCGAAATATTGTTCTTCTTCTTGCTTGTGTTCCTGTCTGCGATCTTACAGGGACTGGCGGAAAGACGGCCTTCTTGCTGCTAAATGACCGCTATTGATACCATCTTCTCGACGACTTCGAACCAACGACGCAATGGCGAGAATACTCGACTCCGCCAGTGTGATGCTGCTTTGGCTTCCCCAAAACTGAAAGATGGAATGGTTATGCAACTTTCGTTGTACAAGCACCTTCAGTGTAACCGTCACCATCTTCCTGCAACAGGCGTTTAGCGAAAACGCCAGTCCGATACGCAATTCTCTTCAACCTGGTTGACGCTCGCCGACAATGCACCGCTGACTTTCCCGGCGCGGGCCTGCTGCCACTGCTCTTAGCGATCGTTGGTGTCTGATGGCCGTGATGTTGATCCCGGCTTTCGTTCTGCCTCTTTGAACGCGAGGAAGATCGATGATAAGCTCGCTTATCATGTTGATCTCCAGTGACCTCTGCAACCCCTCTGCTGACAGGTGGCGACGGCCCCTGTCGTCGACTTCAAATCCTCGTTGTCCGGCGGCAATAGACCTCTGACCCCATTCACTGTCCCGAGCATAAAGTGTCGCCGACTTCGCCATGTTGGCGCACTAACTCCTCAGCTTTCGGCAGGCATGGCAATGCGCGTGTTTAACTAGCGATACTTACCCCACGTAGTGGCACAGCCGGTTCAGACTTGAGAACTGCGCGTGCTTTACTTTGCAGAAGTGAACGATGCGAAGGCATGGTCGCTGGTATGATATTTTACATTGCGCTTTCAACCTGGCTTCTTTGCGGCGATGGCTACCACTATGAAGCGTGCATTAAACTTCTTTTGAGTGTCGCTGCACTAGCATTTTCGCCGAATCAGCCATTTGCAACCTTACGCTTTCGGCGCAGTCTGCTAATCGTATTCACTTGCGAGTGCCGTCATCGCCATAACCGGTACGGGCGTCACATCAACATTATCGACCTGTTGAACTGTTATCTGGCTGGATTCGCACTGGCTGCTGCAATTCACGTATCTTCGGGATTATCTGCGGCAGGCGACGAAACTTCTCTGCTGTGCACAGCTTCGTCAATCGCTTTAGATAAGCTTATTCTTTGCGCTCTGTGCTGCAATCGTCGGCACTCGCTGCCTGAACTTTCGGCGGCTTTTCGCGCGTATTTGGTTAAGGCCTCGATTCGATAACGGCTTTATCTCTACCATGTAGCGATGAAGCATTGAATCTGCTGCTAACGGACTAATTACTTTGAGCCTTTATTGAGCACCTCCGTCGCGAACAACTCAACGATTGGCTCATACCTTCATTTTGTCTATCGCTACAGGCGGCTGCGGCTTCTCGTATTGTCGTTGAACTCGGCATGCTGGTGGGGCTGATCTTGCCATTCATCTGTCTCGTTGAAGCGGCGACGAAGAACTTCCGTCTTTGCGATGCGGCACGATCATTATCTTCTGGCTTTTGTGCCGATCTGTGAATTATTCTCCACTCGATCGTCGGCGGCGACACCGCACCGACCAGGGTTACGGCTCCTCATTGGTCTCGAAGATGCGTGCGATCTTTACTGCGCTTGTCCATCAACTGAAGAATGACTAAAATTACCTGATCACGTGGTACCTTTTCGCCTCGTCCAGAGCTTCTGTAGGCGCGACAACTAACCTTTTATAACCAAAAGGCATCTATTTTCAGAGAATCAAAATTAAAGTAAAATTGGAATTTCGGCACGACAAAATTTGGTGCAATTTCGCCTGCTGTTACAACGCTGATCACGGTGAATCTGTTTGTTACTCGCCGCTTGCATATGCAATGATATCGCGAATAACCGAAACGAGCACACAATTAACTCGCGTGTTCCAGCGATGCGCAGTTGTGTGCACCGGTTGCCGCACACCGACCTGAAAAGCATATGGTTTCATTCGCGCCGCCACGGCACCATTCTCCACACGCGTCAACTGTTAACCGGTGGTTTTGGTTCTTTGGCAGTTCGAAAATGTGGCGATCGGCAATGTATGCACACGCTGCCGATTAAGCCTGTTCTTCTGACAGTATGCAATATTATAAACGGTCCGGCTTTAATGTGAAACTAACTGCCTGGAACAATATTAGCGCATGATCAACCTGTCAGACGCTTCTCTACTCTCAACACCATCGCTCGACGACTGTCTATATATATACGCTTATAAAAGACTGCGCATATAAGCGTTGCTGCCTTACGAGCTATGCACCATCGACTTTGAGCTTCATGTGAATCGCAGAGGATGGGCAATTAATTTCGGAAGTTGTTCAAGTGGATCAAGCAAATTTCCAGCTAAAAAATGATCTATGACAATGAAACTACGGGAAGTTGGTGAGCATTTTCTGATGTCGGATCTGAATCGCATACTCGGCATCCTCCAGCGAACACAAAACAACAGCCAACACGAAATTAAAAAATAATCTGCGACGAGTACCCGGTTTGTCGAAAGAAGCTGTTTTACACCAGTGACAAGATAGATTTTGATTTTAACGGTCAAAATTAGGGGTTATTTGGCAATTAAAGCAATTTTTTTTGGGAGTATAATTAAACAATATTTATTTTGCTATGGGGTAAAAAAACAAATTCAAAATATCAAATGTGCAAAGAAAATAGTAGCGAATTCCAAGGTTTAAGCTTGCGAGGTTTCAAGAAACTCTTTACGCAAACACTAAACCTGAAGTTTAATCCTAAATTTTTAAAATTATTTTTGTTAGGTTGAAGAGTTGTGGTATTTAGTGTGACCCCATTGGCACGGCTGCAGAGTTGAGCTTTTAAATGGAATGGACGGGTTTTTTTTTGGGTCATATTCAAGGCGGGATCTTTCCTCTATCGCAGCCATGAGCTTTGTTGTCGTGTTTTGGTTGCCACGCGCATTCTTCTTTAGAGTAGGCCCACAAATTTTCAATGGGTTCAGATCAGAGACTCTGAGGGGCGTATCGATCACCTTGCCACGGTTATGGGGAGCCAGTTGCGCGTGCATTGCGCCTCTTTATGTTTTGGATCATTGTCCTGATAAAACTTAAAAATTTGACACGTTGTTTGCTAAATGAATAGAATTTTTTTTTCTGCACTGGCCTTCAAATTTGATTTTTAAAATATCTGAATATTGCGGCATTCATAGTGCTTTCAATAAAGGCTAATTGCCCACTCGGCGAGATACAGCCCCAAATCATCATCACTGATAATTTTTCCAAATTTGATTGGAATGATATTTTTGTTTCTAGCGCACTCAACGGCTTGCGCCATACTCTGCTTATTATCGTTGTAATAGAGCATCATTTTTGAACCGTCACAAATATTGCGTCATCCCAATTACTCTTCCGCATGATCCATCATGCTCACAGCGAATGACGCTTTTTTTCTATATTGACCTCTGATAGCAAGGCTTTTTTTTTCTTGCAACTCTTGAAGAGTACTATGGCGTGAAATGACTTGGCGCACGGTTGCAGTATTGGCACAACTAGGTCACATTCTTGCCTGATATCCTGAGCAAGTGATCTGACCGAGGAATTCGAGGGGTTCGCAATCACTTTTCGCATAATGGGCGGTCTACACGCTTGCTAATTTTAGTTTGCGCCCACCACTCTTAGGTTCAAACCTGTTCTCTTTTCGAAGCGATTAAAAACATTGTGAACGGTCTTACGGGATACAGAAAACATTTATACTGAATTCTGAATAGATTTTCCCAACTGGTGGTTTTAGTATATTATTTGGGTCACTTCAAAAAAGCTAATCTATTTCCAGGCATTTTTATTAAATTTAATAACTTCATTCGATCAATAAAAAAAATTTCATAAACAAAGTAAAAAAAAAATTTCAATAGAAGCGTTGTAAAGAATGCAAATGCCAAAAAATAACGGAAAAAATCGAGTTCGTTCTAAGAAAGAGCAAAACAAAGTAGGAAAACAAAATGTGTGGGGTTTCTTGCCACTCTCAAAGATGGTGTGGCTTTGGAATTTGTTGAATTTCTTGTATGTTTGATGTTGCAATTTATCAAAGTGAAATAAGTATTTCATTAAAAAAAATTGCGTTTAATTAAAGAAATAACCCTTAATTTTTTGACCTTTAAAGGTGAAATTCAACTTATTTCACGGCGTGTAAAATAGTTTCTTGACAAACTGTATGTATACAAATTTACAGCTTGCCGGGTACCATCTGCAAGATTCATTACATTGAGAAGTGGACTTTGACTCTCAGAATGAATTAAAGCATTATATTCAGACTGACGAGGGAACCAGACTGAACTAACTAAACTAACTATCATTTAGCTAAATTTAATTAGAAGTTTACTGATAATTTTGAGTTTCTTACAAAGATGACTAATATTATTAATTTTTTGGTTAAAATGGTTTGCCAACTGAATTTATGTAAAATGTATGTTCAGTGGTCTGGTTGGGTTTCTGGGTCTCCCCAATACCTCGCAACGAATGCTGGATCAAAGTGAAGGACGATTGCACGGTCTCATTAGTGGCAAAAGTACAGCAATCTTACTTTTTTGAGGGTGGCGTGTTGGAAGAGGTATGTACATTTAATAAAAGTCCTGGCCTGCATCAAAGACACTAGAATAATAAGATGCGTAACAGCCATACACTGGTTTGGCACTATGCAGCCACTTTTTTGGTGACGGCCAAAATTGCTCTCTTTCGCTCGCTCACGCTGAGCGTAAAAGTAGAATTTGCTGCTTGTGTGGTAAAAGCAAAAGACGAGAACGCGTATATATTGTGCGTGTTGTTAGCACAAGGCGATTTTCGGACCGAAATCAATTCTGATCGCAGTAACGAATTTACATGTGCATTTGGGAGTTTTGGCCAATTTCGTGAGAATATGATGAAATTGCGCGCTGTTTAAGATATCAGAATTGAATATAAAAAAAACTGAAAAAGTCATTACTGAGAAAAATATTTCATAAAAAAAAAAAAAAAAATAATGCGAAGTGAAAATAAAATTTATAAAATAAAAAAAAAATGTTAACTGTTTATTGCAAGAGCGTAGCAATACGTAACCA
->ad0a9787-1b38-4f0f-8fcf-02070c8eb567
-TTGCGTACTTCGTTCAGTTACGTATTGCTGTTAGAAGTGCAAAACTCACAAAGAGACCCAAACTCAATGCTGTCATTGTTGCCAAGAAGTTTAATCCTGAACGCACAGGCTTAGACACTCAATCCTGGTGCGGAAGACCAGATGCATCGCCGTGAAGACGGACGTCTTAAGTGCGCGGCGCGAAATATCGAAACCATAGAAGTTGTGTCGGCCGGTGTGTGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCATAGTTCTGCGCTGCAATCACGCAGGGATTAATTGTGCGCCTGTTTCATGTAAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAACAACTGATAGCGCAGCCCGGAGCGATCTGGAGAGGGAGGCGTTGCCAAGATCAACCGTGTGATCAGTGTTGTGTTACGACAGTAGGGCGCGAAATTCAAAGGTAAATTTAAAATTAAGCCGTTGAAATTTAATTTAATTTAGTTGATTCTGGTAACTGGGGAGCGCACAAGTCTTTAAGGGAAAAGGCACAAAGGTCGCGGACAGACCAAATATCATCCTCTCACCGTGCTGGTGCCTAAGCAGAAGGCTCTGGTGTCAGTCGAGGCGGTACAAGCCTCCATCAACCGAAATCCGTGGCCTGCGTGACCTAGAGCAACCTTAGGCCATCCTTCCAGTTGATGGACCAGCGCAGTGGGGGGGCAGTCCCCTGATCCCATAACGACCCGTTCAGGAGGAGCTCCCGACTTTCGAATCCCCACCAGAGGAGTCGGTAACCCGACCCATGGTGACGGAATCTCGGTCCCGTCGATGGCAAAGGGAGGTGAGCACGCAGGCCCCAGCCGCCGTTGACTATCGACGCGGCGTGCTGTAGAGGTGGAGAAATTAGCTCCCTACAGCATCTACGACCGCGACAAGTCAGAAGACGATGGACCACATCGCCGTGCCCTCATAAAGACGGGAGGAAGTCCCCAGCTTGTTCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCCAGAACGAGGACCTGAGGGGCATACTTACCAGGATGAATGGCAAGATCAGCCCCCTTCTATCCCGTGGAGGACCCAACGACACACATGAGAGACAAAGGGCATAGCTTCCGAACTCTCAGCCCTTAACAACAGGGCGATAAGAGCTGTACGAAGGTACTACTAGCGAGCACCGCTTGAAGAGCAGCGCTGCAGACGGAGGTACAAAAGCCTACCAAAAGGCTCCACAAAATGCGCAGGTACCCACGGTGCAGGTGCAAAGTCAGGCGCCGAAGCAGAGCAACCCCTACGTTGGATGGCAACGGTGAAGAAAAGGCATCCATACCTATGAAGTCCAAGCCAGGGCAGCTATGCATCTGTCGCCAAGAATGCTAGCACGGGTGCAGAGGCACTCATCGTAAAAAAAAAGACAGGGAGGCTTCGTACGCAGAGATGCTGGAAGCTAAGATCGGAATCGAGCCTTAGCGAACTGGGCGATCACGTGCGAAAAATCCCGGAGAGCAGAAAGGTGATCATTATTTGCTTGAGTGGGGAAAGCTTCGGAAAGCGTTCCCAAGTTTGAATGACCACAAGGCAGCGCTCAATGACTTGGCTCGCTGCACGGGAACAAAAGAATAGCTCTATCTTACCTTGGATTGGACGAGGCACGACAGCAGAGAAGCTCCACAGCTGCTTGGTCGCCCAATTCCAGGGCCTGCAGATAAAATCCTGAAATATCAGGGGCCTTCACCCAGTATGCGGAATTGCAAACAAATAGCCTCAGTGCTGCTTACGAACGCGAACGTTGCGATACCAGTCCTTAAACAGGGCACCATAATCGTTGGATGGTCAAGAGATGTCGTATCACCCAGGACGTCCGACCCACGAGATGCTACGGTGTCTCGGCTGCCGGAAATCGATCAGCAACCTGCAAAAGGACACTGACAGGGCGGGCACTGTCTTAGATGCGGTGAGCGTGGGCACAAGGCAAAGGGGTGCGTTGCTGCACCAAAATGCACGATCTGCAGCAGCGAGGTGGACGAAACCACCGACGGAGTAGCTTTGCGTGCCGACACAAACGACACTAAAAGATGCAAGAGCCACCTTAATGCACACGCTCATATTAGCGTAGTACAGCTCAATGTCAATCATTGCGCAGCAGGCCTGTGTAGACATCATGCTCCTAAGCGAACCCTACGTCTCTGGTGGTGGACAATCGTCCATGATCCTTGACGAGGCAGGTGAAAGCAGCTATCAAATGCTGCAGCTCTCAAGTCCAGGAACTGGCTGGCACCCATGCGAGGGCTGTCGCTTATGCAGTTAGAAACACGTGCACATGTACAGCTGCGCTACACGCTCCGCCGGCGACACCCCCGATCGGTTCGAGGGCTTCTGGAGGCGCTCGGCGGACCATGCAGAGGGCGAAGCCCGAAGGTCATTACCGGCGACTTTAATGCCTGGACAGTGGAATGGGGCAGCAGGACATCGCTTACCAGAGGACGAGCTGTGATTGACGCCATGCGATGGACCTCATACTGCTGAACGATGGACGGAAACCGACGTTGGCAGCGATAGGGGTACGTCCTTTATTGACACGCTGTCAGCGAGGGGCTAGTAGCGGAGCAACAACAACTGGATGGTCAGAGCGTCATGACGCTGGCGACCATGCCCTGATCTCCTTCTCCCGGAGAACATGCCCAAAAGACGGCAGAGTAGAACAGCCGGGAAAACATGGGACGCAGGAAGATCGGTAGAGGCCATGCTGGCCTATCAGATCAATTCTAAATCCCAAATGTGGACGCAGAGTATGGCGGCAGGCCTCATGAATATGCTGGGAAGAATGCGACGCAATCATGCCAAGGAAAAATAAGGTACAGCGCAAACCACCCGTTTACTGGTGAGTGCCTCCCCTAAGCCAACTACGGTCTGATTGCCTCGGGGCTAAAGAGAACAGCGCAGCGAGCCAGAGAGCGAGTACCCACCACGCCTTGGAACAACGGAGGCTTTCAGAAGCAAACGCCTAGAGTTCAAGCACGTATCGCGGCTGCCAAAGCCGCGGTCGTTTAAGAGCTGCAGGATGGCGTGAGCAGCGATATCTGGGGCCTCGCCTACAAACTTGTTACCAACGAGCTAGGAGGAAGCGGCAGCCCCATCCGACCCGGGGTCCTGGCTAGGGAGCTATTTCCAAAGCAGACCACACTATGGGGGGGGCCAACAGAGGCAGCCTACCCCAGATTTCCCGTATCCTGGGAACTTGAAGTCGTCCAGAGGCAGCTGTTTCGCTGACGATGTGGCAATCACAGCCGGGCTAGCAATAGCGGCTCACAAGACCGAAGCAGTCCTACTAAGCAGCAGGAAAAAAAGATGGAGAACATGCTGGTCTCCGTCAGGGTACTCAGGGGACCTCTCAAGAGTCCCTAAAAGTACCTGGGGGTAATGATAGATCACCCAGACTATCGTTCCAAGGATGACACGCCAGCAAGAAGACAGCCAGTCACATCCTCTTCGTTGGCGGGGAGAAGCATACCGGAGGCCCAAGACACCCGCGGCCAGAAACTGCTGGTGTCAGTAGCAAAGCTTCGCTGCTATACGCTGCACCAGTCTGGAGCAATGCCACTTGCAGGGGTCTCATACCTGAAGAATCGTTCGGTGCTACAGTCAATGGCCCGCATCAGGCTCATTAGGATTCAGGACCATATCCGAGGCAGCGCTAGCGCTGCTTGAGCCTGCCGATTGATCTGGAGATCAAGGCTCTCAGCCTTATGCGAATTGGCGCTTCCAGGCAGAGGCACACGAGTGGCTATTAGGTGAATGGCAGAGCAGATGGCAAACGTCGCGACGGGGGGAGGTGGACCTATCAGCTCATCCAGAGATGACGGTTTGGGCAGAGTGACACTCTCAAAAGTGTGAAACTTGGAATTTGTTATTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTAATTTATAAGTATTAAAATAAATATTGTTTAATTATATTTCCTAAAAAAAAAATTGCGTTTAATTAAACCAAATAACCCTTAATTTTGACCGTTAAAATCAAAAATTCATCTTATTTCACGGTGTGTAAACGGTTTCTTGACAAACTGTACTTGTCGCAGATTTATTTTTAATTTCAAGTTAACGACCGTTTCTGTTACTTTGTGTCCGCTGTAGAGTGATGCCGAGTATAAAGTGATTCAGATCCGACATCAGAAGTGGGACCGCCTACTCCAACTTCCTGTAGTTCATTGTGTCATAGATCATTTGTGTTTTAGCTGTTCTTTATTTGATCCAATTTGAGGAACGGGGAAAGGTCCCTTTCCGGTG
->5ffbdb24-d9ff-407b-bee4-3f1bd8e77b5a
-TTATCGGTACTTCGTTGGTTACGTGCTGCTTTTTATAAAATTTTTATTTTTCTACTTCGTATTATTTTTTTATGAAATATTTTTTCTCAGTGTAATGACTTCTTTTTTTCAGTTTTTTTTTTTATATATTCCAATTTGATATCTTAAACAGCGCGCAATTTCATCATATTCTACGAAATTGGCCAAAACTCCCCAAATATGTATGTACATATGTAAATTCGTTTAGGTCGAGTGATTTCATTTGAAATCTCATACAGCACCAACTACGCACACATATACGCGTTCTCGTCTTTTTTGTTTTTACTCTACACAAACAAGCAAATTCTATTTTTAGTTTGCCAGCGTGAGCGAGCGGAAGAAGGCTGTTGTGTCACCCAAAAGTGGCTGCATAATTGCTGAAACCAGTGTGGCTGTTACGCATGTTGTTATTACGGTATTGTCTTTGAAGTGCGAAGGCCGTAGCGACTTTGTATCGTATTTTATGCTTTCCAACACGCCACCTCAAAGTAAGATTGCTGGCACTTTTATTACTCACGAGACGTCCTTCTGACGAATAATTTTTGATCCAGCTTCGTTGCGAGGTGTTGGGGAGACCAGAAAACCAACCAGATCAATTGAACATATTATTTACATGATTCGTTTTGCGAATGTTTTAATAGGTAAAAATATTAGTCATCTTTGTAAGAAACTCAAAATTATCAGTAAACTTAATTAGAATTTAGTTAAATGATAGTTAGTTTAGTTAGTTCAGTCTGGTTCCTCGTCAGTTCAATCTAAGAATATAATGTTTTAATTCATTCATAATTCAGAGTCCACTTCTCTATGTAATGAATCTTGCAGATGGTACCGGCAAGTTGTAAGAATTTGTAGATATGTACAGTTTGTCAAGAAACTATTTACACGCCGTGAAATAAGTTGAATTTTTTCACTTGGTTAAAATTAAGGGGTTATTTCTTCGTTCGGCGCAATTTTGTCGAGAATATAATTCAAGCAATATTTATTTGCTGCTATAAATTAAAAAACAAATTCAAAATAATGAAAATATACAAAGAAATTAAAGCAGCAGGTTAAGTTTACACATAAAGTGGCAGAAACTCCTTACACGTTTTCCTACTTTGTTTGCTCTTTTTTCTTGGGCGAACTCGATTTTCCGTTATTTTTTGGCATTTGCATTCAACAACGCTATTGAAATTTTTTTACTTTGCTTGTGAAATTTTGCTGATCGAATGAGTTATTAAATTTAATAAAATGCCGCAAATGGGTAGCTTTTGAAGTGACCCAAATAATATACTAAAACCACCAGTTGGGAAAATCTATTCAAGAATTGGTATAAATGTCTGCAATGTTTTGGTCGGCGAAGAGACGGGCTTGAACCTAGGTGGTGGGCGCAAGGCTAAAAGATTAGCAAGCGTGTGAGACCGCCTTATTATGCGAAAGTGATTGCGAACCCAGATCTCGGTCGAATCACTTTGCTCGGGATATCAGGCAAGAATGTGACCCTGGTTGTGCCACACAAGGCGCTGTGCCAAGTCATTCTACGCCATAGGTACTCTTCAAGGTTGAAAAAAAAGCCTTTGCTATCAGAGGTCAATATAGAAAGCGTCATTCATTCGCTGTGAGCATGATGGATCATGCGGAAGGTACTGGGATGACGTAATATTTTTCAATGACGAGCAAAATGATGTATCTATTATAACGATGTCATTTAAAGCAGGTATGGCGCAAGCTGTTGAGTGCGCTAGAAAAACAAAATATCATTCCAACAATCAAATTTGGAAAATTAATGGTGATGAAGTTTGGGGCTGTATCTCAAGCCATGGAGTGGAGCAAATTAGCCTTTATTGAAAGCACTATGAAGATGCCGTGCAATATCTAGATATTTTAAAATCAAATTTGAGGCCAGTGCAGAAAGATTTGGTCTATTTAACAACAACAAAATAGATTTTTAAGAGTTTATCAGGTTAATGATCCCCAAACATAAGGGGTGCAAATGTAACGCAACTGGCTCCTTTATAACTGTGGCAAGGTGATCGATACGCCCCCCTCAGAGTCTTGATCACGAACCCCATTGAAATTGTGGGCCTACTTAAAGAGAATGTGTGGCAAGGGGCACCAAAACACGACAACAGCTCATGGCTGCGATAGAGTGGGAAAAGATCCCTTGAATATGACCCTAAAAACTCATCCATTCCATGAAAAAAAGCTTCAACTTGTAGCCAAAGCCAATGGGGGTCATGCCTAAATACTACAACTTTTCAAATTTTAACAAAATAATTTGCAAAATTTAGGATTAAACTTAGGTTTAATTGAACATTGTAAAGAGTTTCTTGAAACTCTCAAAGTATTTAAACTTAAAGATTCGTTGTTTATTTTCTTGTACTTTGATATTTTGAATTTGTTTTAATTTATAAGTAAAATAAATATTGTTTAATTATATTTCTAAAAATTGCGTTTAATTAAGCAAATAGCATAATTTTGACCGTTAAAATCAAAATTCATCTTATTTCACGAGTGTATAAAGAAGCAGTTTCTACAACCAAAGCTAAATACTTGTCGCAGATTTATTTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTGAGGGAGTGATTGCCGAGTATAAAGTGATTCAGATCCGACATCAGAAGTGGGACCGCCTACTCCAACTTCCTGTGGTTTCTGTGTCATAGATCATTTGTGTTTTAGCTGTTCTTTTATTTGATCAATTTGAGGAACAGGAAGGTCCGCTCCATTCGAAATTAATTCGTCAATCTCTTATGATCTACATACAAAGGTTTCTTAGCCTAAGTCGAGGCCTTTGCCGGCAGCCTGCAGCACAGCAACCTTATATGCATCTATATGTATATATATATGTACTGTCGCGAAACGATGGTGCTGGAGAATTAGTGCTCAGGCATATAAGCGATCCAGCGCGCCCAGCAGAGGAGCGAGCCAGACATTGTATGTTAACTGCAGTGGGTGCTCGTATTTTTGGCCTACACTTGTGCTGGACTGTTTATGTACATTGCAACAGAGTGCTACAATTATGAATACATGGGTACAGTGCTTAACCGATATGTGTTACTGCATACTACAATGAGTGAAACAATTTGGCAATTCCTAGAGTCACTTAGAGAATCGCCATTTTCTGAACTGGTAAAGAAGTGCAAAACTCACAAAGAAGGGCCCAAAAAACTCAATGCTGTCGTATTGCCAAAAGTTTAATCCTGAACGCACGGGCTTAGACACTCAATCCTGGTGCGGAGACCAAGTCTACATCGCCGTGAAGACCGGTGTGATACGCGGCGCAGAAATGCCAACCATAGAAGTTGTGTCGGCCGGTGTGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCATAGTTCTGCGCTACAATCGCGAGTTAATTGTGCGCCTGTTTCATGTAAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAACAGCTGATAGCGCAGCGGGCGATCTCTGGAGAGGGAGGCGTTTGCCAGATCCAACCGTGTGATCAGTGTTGTGTTGCATTGACAGTAGGGCGCGAAATTCAAAATTAAATTTAAAATTAAGCCGTTGAAATTTAATTTAATTTAATTTTGATTCTATTGGCTTTAGGGCGCACAAGTCTTTAAGAAGGCACAAGGTCGCGGACAGACCAAATATCATCCCTCTCCACCGTGCTGGTGCCTAAACGGCAGAGGCTCTGGTGTGTCCAGGTTCGAGGCGGTACAAACCTCCATCCGTAAAAGCCGGAAATCCGGCCTAGGTAACCTTAGGCCATCCTTCAGTTGATGGACGCATTCGGGGGCAGTCCCCTGATCGCAACGACCGTTAGGAGAACTCCCGACTTTCAGAGATCCCCACCAGAGTCGGTAACCCGACCCATGGTGACGGAATCTCGGGCCGGATCGGTGGCCAGGTGACATTTAAAGCAGCGGGCCGACATCGTTGCGGAAACGATACTATGAGAGGTGGAAGGCAGTACAGTCAAGAAGACGATGGACCACATCGCCGTGCCGTAACAAAGGAACGGGAAGTCCCCAGCTTGTTCCCCTCGGTCTTCGGACTTGACCACTGCTCTCTCAGAACGAGGACCTGAGGGGGGCATACTTACCAGGACGAATGGCAAGATCCAGCCCCTTCTATCCGCATTCGAGACCAACGACACATGAGAGACAAAGGTATAGCTTCCGAACTCCAGCCTTAACAACGGGGCGATAAAACAATACGAAGGTACTAGCGGCACAGCGAAGAGCAGCGCTACCCACGAGACGAGGAATTTTTAAAGAAAGCCCACCACCAAAAGGCTCCCACCGAAAGTGCCGCAGAGTACCCACGGGTGCAGGTGCCGAAAGTCAAGGCATAGCAAGGAAACCAGAAGCTGGATTGGATGGCAACGGTGAAGAGAAAGGCGACATCCATACCTAACGAGGTCCAAGCCAGACGTATGCGTCTGTCGCCAAGTGCGCGCTTACGGGTGCAGAGGCGCTCGTATTAAAAGACGGGAGGGCTTCGTACGCAGAGATGCTTCGGAAGCTAAGATTTGGAATCGAGCCTTAGCGAACTGGGCAGTCACGTGCGAAAAATCCCGGAGAGGGAGCATGAAGTCGTTAAAGTTGAACAGCGAGTCGCCCAATTCCAGGGCCTGCAGATAAATCGAGGTCATCAGGGGCCTTCATAGAGTATGCGGAATTGCAAATAGCCTCGAGATTAACGCTGAACGCGAACGTTGCGATACCAGTCCTTAAACAGGGCACCATAATCGTTGGATGGTCAAGATGTCCGTATACTTAGGACGTCCGACCCACGGTGCTGCAGGGGTATTATAAGCGGCTATGGGCATCCGTCAACTTCAACCGCGGCAGGAAGGACACTGACAGGGCAGACTGCTGTCTTAACGTTGAAGGCAAGGGGTTGCTGCGAGCCTGATCTGCAGCAGCGAGGTGGACGAAAACACCCGACGGGTAGCTTTGCGTGCCAGCACACAGAGCGACACTACAAAGATTTGAGAGCGCACCTTAATGCACGCTCATATTAGCGTGGTACGCTCAGTGTCGTGTTTGCGCGGCAACTCCGGAACGCACTCCTGGCCCAGACTGCGGTTGAGCGCAATCTGAACATCATGCTCCCTATAAGCGAACCCTACGTCTCTGGTGAGTGGACAATCGTCCATGATCCTTGACAGGCAGGTAAAAGCAGCTATCAAATGCTGCAGCTCTCAAGTCCAGAGACGGCTGCTTTACCCATGCAGGGGTATCGCTTATGCGAAGTTAAAACGTGCACATGTACAGCTGCTACGCTCCGCCGAGGCGGCTTTTGATCAGTTCGAGGAGCTTCTGGAGGCGCTCGTGGACCATGCGAGGGCGAAGCCCGAAGGTCATTACCGGCAGCACAATGCCTGGACCGGTGGAATGGGGCAGGCAGGACATCCAACACCAGAGGGACGAGCTGTGATTGACGCCATGCCATGCTGGACCTCATACTGCTGAACGATGGACGGAAGCGGCGTTTGTAACGATGGGGGGTACGTCAGCGCATTGACGTTACCTTTGTCAGCAGAGGGCTAGTAGACAAAAGCAACAACTGGATGGTCCATGACGTCGCTGACGCTGGCGACCATGCCCTGATCTCCAGCGCTCTCCCGGAGGTAATGCCCAAAGACGGCAGAGTAGAACAGCCGGGAAAACATGGGACACCAGGAAGATCGATGAGGCCATGCTGGCCTATCAGATAATTCCGCAAAATCAAATTGAGAGGTATGGCGGCGAGGCCTCATGAATATGCTGGGAAGAATCTGCGACGCAATCATGCCAAGAAAAATAAGGCACAGCGCAAACCACCCGTTTACTGGTGGGTGCTCCTAAAGCCAACTACGGTCTGAGTGCCTCAAATTTTAAGAAGGGAACGGCGCAACGAGCCAGAGGCAGTACCCACCACGCGGAACTCTTGGAGGCTCAGAGCAAACGCCACAGAGTTCAAGCACATCGCGGCTGCCAAAGCGCGGTCGTTTAAGGGCTACGGGATGGCGTAGACGAAGCATATCTGGGGCCCGCCTACAAGCTTGTTACCAACGAGCTAAGGAGGAGAGCAACAACCCATCCGACCCGGGGTCTGGCTAACATACCAGGGAGCTATTTCCAAAGCAGACATTATGCACTATGGAGGCCAACAGGGCTATTACTGCCCCAGATTTCCCGTGCGTCTGGAACTTGAAGTCGTCGAGGGCAGCTGTTTCGCTGACGATGTGTGAAATCACAGCCGGGCTAGCAATGGCGGCTCACAAGACCGAAGCAGTCCTACTAAGCTTGTAACGGGAAAGATGGAGAACGCTGAGGGTCTCCCGTCAAAGGGTCCTCAGGGGACCTCTCAAAGAGTCCCTAAAGTACTGGGGGGTAATGATAGATCATGAATATCGTTCAAGGACCGCGAGCTACGCCAGCAAGAGACAGCAGTCACATCCTCTTCGTTGGCGGGCTTATGCGCCCCAACGTCGGAGGCCAAGACACCCGGCCAGGAAACTGCTGGTGTCAGTAGCAAAGGCTTCGCTGCTATACGCGCACCAGTCTGGAGCAATGCCGCTTGCAGGGGTCTCATACCTGAAAGGAGCTCGTTCGGTGCTACAGTCAATGGCCCTCGGCTCATTAGAGGATTCAGGACCATATCCGAAGGCGGCGCTAGCTTGTGAATACACCGATTGATCTGGAGATCAAAGGCTCTCCAGCCTTATGCGGAGTGGCGCTTCCAGGCAGAAGGCACACAGTGGCTATTAGGTGAATGGCAGAGCAGATGCTTGAAACGTCGCGACGGGGAAGTGGACCTATCAGCTCATCCAGAGATGACGGTTTGAAGACGCATTGACACTCTCAAAAAGGTATTAAACTTAGATTTGTTATTTATTTTCTTGTATCGGTGATATTTTGAATTTGTTTTAATTTATGGTAGAAATAAATATTGTTTTAATTATATTTCCTAAAAAAAAATTGCGTTTAATTAAACAAATAACCCTTAATTTTGACCGTTAAAAAAATCAAAATTCATCTTATTTCACGGTGTGTAACAGTTTCTTGACAAACTGTACTTGTCATAGATTTATTTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTTGTGTCCGCTGTGAAATTGATGCCAGTATAAAGTGATTCAGATCCGACATCGAAGTGGGACCACCTACTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTGTGTTTTAGCTGTTCTTTATTTGTTGATCCAATTTGAGAACAGGGGAGGTCCGCTCCATTTCAGAATTGAATTCGTCAATCCTCTTATGATCTACATACAAGGTTTCTTAGCCTAAGTCGAGGAGCAGCGCTGCCAAGCATAGCCTGCAACAGCAACGCTTATATGCGTATCTTATATATGTATATATATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAGGAGTGGTATAGGCACACATATAAGCGATCAGCAACCAGCGGGAGAACTGCTGACCAGGCAGTATGTATGTTAGCCCTCAAGTGGGTGCTCGTGGCCCATGTACACTTGTGCTGTAGATGTTGCCTTTTGGCTAACAAGAGTGCTACAATTATGAATACACATAGGTACAGTGCTTAACCGATATTGCATACTACAATGATGAAAACAATTTGAAATTCCTAAATTCCACTTAAGAATCCATTTCTAGAAGAACCTGGTAAAAAGA
->18bc683b-3844-41e6-a198-1abad9703f44
-TTGCGCTGCGGTTCGGTTGCGTATTGCTCACTTCGTTGCCTCGAGATATGACCAAGCAAAGACACTAGAATAATTCTAATTTGATGACGTTTGCAATAAACAGTTAACATTTTTTTTATTTTATAAATTTTTATTTTCTACTTCATTATTATTTTTATGAAATATTTTTTCTCAGTGTAATGAGCTTCTTTTTCAGTTTTTTTTATATTCCAATTTGATATCTTAAACAGCGCGCAATTTCATCATATTCTACGAAATTGGCCAAAACTCCCCCAAATATGTATGTACATATGTAAAATTCGTTACTGCGATCAAATTGATTTCGGCGAAAATCGCCTTCTAGCACAACACGCACACATATACGCGTTCTCGTCTTTTGTTTTTACTCACACAAGCAAGCAAATTCTATTTTTAGATTTCTTACGCTCAGCGTGAGCGAGCAGGAAAGAACAATTTTGGCCAAATCACCAAAAAAGTGAAAACGCATAGTGCCAAACCAGTGTATGGCTGTTACGCATCTTATTATTCTAGTGTGTCTTTGATGCAGGCCATGTGACTTTTTAGCAGAAATGTGTACATACTTTCCAACACGCCACCTCAAAGTAAGATTGCTGTACTTTTATTACTCACGAGACTGTGCGTCCTTCCTGACGAATAATTTTGATCCAGCATTCGTTGCGAGGTGTTGGGGAGACCAGAAAACTTAACCAGATCAATTGAACATATTATTTACATAAATTCAGTTTGCAAACTATTTTAACTAAAAGTAATATTAGTCATCTTTGTAAAAAACTCAAAATTATCAGTAAACTTAATTAAATTTGGTTAAATGATAGTTAGTTTAGTTAGTTCAGTCTGGTTCCTCGTCAGTTCAATCTAAAGAATATAATGTTTTAATTCATTCTGAGAGTCAAAGTCCACTTCTCAATGTAATGAATCTCACTTGCAGATGGAATACCGGCAAGTTATAGAATTGTAGATATATACAGTTTGTCAAGAAACTATTTACACGCCGTGAAATAAGTTGAATTTTTCACTTTAAAGGAGGTCAAATTAGGGTTATTTCTTTAATTAAACTACAATTTTTAATGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAACAAATTCAAAATATCAAATATACAAGAAATTAAACAACAAATTCCAAGTTTACACACTTTTTGAGAGTGGCAAAGAAATACATACATTTGTTTCCTACTTTTGTTTTTGCTCTTTTCTTAGAACGAACTCGATTTTTCCGTTATTTTTTGGCATTTGCATTCCTTTTTACAACGCTTCTGTGAAATTTTTTTACTTTGCTTGTGAAATTTTGCTGATCGAATGAGTTATTAAATTTAATAAAATGCCTGGAAATAGATTAGCTTTTGAAGTGACCCAAATAATATACTAAAACCACCAGTTGGGAAAATCTATTCCAGAATTAGTATAAATGTTTTCTGTATCCCGTAAGACCGTCTACAATGTTTTTAATCACGCTTGAAAAGAGAACAGGCGAACCTAAGAGTGGTGGGCGCAAAACTAAAATTAGCAAGCGTGTGGTTTATGCGAAAAGTGATTGCGAACCCCGAATCTCGGTCAGATCCTTGCTCAGGATATCAGGCAAAGTGTGACCTGGTTATTGCCAAAACTGTGCGCCAAGTCATTCTACGCCATAGGTACTCTTCAAGAGTTGCAAGAAAAAAAAGCCTTTGCTAATCAGAGGTCAATATAGAAAGCGTCATTCATTCGCTGTGAGCATGATGGATCATGCGGAAGAGTACTGGGATGACGTATGTACTAATGACGAAACAAAAATGATGCTCTATTATAACGATGGGCCAAGCAGAGTATGGCGCAAGCTGTTGAGTGCGCTAGAAAAACAAAAATATCATTCCAACAATCAAATTTGGAAAATTATCAGTGATGATTTGGGGGGCTGTATCTCAAGCCATAGGAGTGAGCCAAATTAGCCTTTATTAAGAAAGCACTATGAATGCCGTGCAATATCTAGATATTTTTAAAATCAGGATTTGAAGGCCAGTGCGAAAAAATTTGGTCTATTTAGCAACAACAAGCCAAATTTTAAGTTTTATCAGGACAATGATCCCAAACATAAAGAGTGCAATGTACGCAACTGGCTCCTTTATAACTGTGGCAAGGTGATCGTCGCCCCCTCAGAGTCTTGATCTGAACCCCATTGAAAAGATTTATTGGGCCTACTTAAAGAAGAATGTGGCAAAGGGCGCAAAACACGACAACAGCTCCTTGGCTGCGATAGAAGTGGGAAGATCCCGCTTGAATGTGACCTAAAAAACTCATCCATTCCATGAAAAAAAAGCTTCAACTTGCTTAGCCAAAGCCAATGGGGTCATACTAAATACTACAACTTTTTCAAATTTAACAAATAATTTAAAATTTAGGATTAAACTTAGGTTTAGTGTTTTATTGTAAAGAGTTTGTACGGAAACTCTCAAAAGTGTTTAAACTTGGAATTCGTTGTTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTTTTTTTAATTTATAAGTAAAATAAATATTGTTTAATTATATTTCCTAAAAAAAAAAATTACGTTTAATTAAACAAATAACCCTTAATTTTGACCGTTAAAATCAAAAATTCATCTTATTTCACGGTGTGTAAACACAGTTTCTTGACAAACTGTAGCATCGCAGATTTATTTATTTTTAATTTCAAGTTAACGACCATTTTCTGTTACTTTGTGTCCGCTGTAAGAGAGTGATGCCGAGTATAAAGTGATTCAGATCCGACATCAGAAGTGGGACCCTTCCTGCTCAACTTCTGTAGTTTCATTTGTGTCATAAGATCATTTTGTGTTTTAGCTGTTCTTTATTTGATCAATTTGAGGAACAGGAAGGTCCCTTTCCATTCGAAATTAATTCGTCAATCCTCTTATGATCTACATGCAAAGGTTTCTTAGCCTAAGTCGAGGAGCAGCGCTGCCGGCGCAATACAGCGCAGCAACGCTTTATATGCGTATCTTATATATATGTATATATATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAGAGTGGTATAGGCACACATATAAGCGATCCAGCGCTTGTATGGGAGGAACTGCTGACCAGGCAATTATGTATGTTAGCCCTCAAGTGGGTGCTCATTATTACGTATACACTTGTGCTGGACTGTTTATGTACACATTGCAACAGAGTGCTACAATTATGAATACACATAGGTACAGTGCTTAACCATTATGTGTGCATACTACAATAGTGAAAACAGTTTGCTGACAATTCTAGAGTCGCAGAATCGCCATTTTTCTGAACTGTTAAAGAAGTACCGGCTCACGAGACCAAAAAAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCACAGACGCACAGGCTTAGACACTCAATCCTGGTGCGGAGACCAGAGTCTACATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCAGAAGTACTCGAAACCATAGAAGTTGTGTCGGCCCGGTGTGTGCGACGGAAACTGGCAAATCACACGGTACCCAGGTCGCGCCATAGTTCTGCGCTGCAATCACGCGAGTTAATTGTGCGCCTGTTTCATGTAAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAACAACTGATAGCGCAGCGAGGCGATCTGGAGAGGGAGGGCGTTGCCAGATCAACCGTGTGATCAGTGTTGTGTTGCGACAGTAGGGCGCGAAATTCAAATTAAATTTAAAAATTAAGCCGTACGGGAATTTGAATTTAATTTAATTTGATTCTACAGTAGCACAGGGCGCACAAGTCTTTAAGAAGAGCACAAAGGTCGCGGACAGACCAAATATCATCCTCTCACCGTGCTGGTGCCCTAAGCAGAGGCTCTGGTGTCCGAGTCGAGGCGGTACAAACCTCCATCCGTAAAGCCGGAAATCCGTGGCTACGTGACCTAAGGTAACCTTAGGCCATCCTTCCAGTTGATGGACAGCGCAGTGGGGGGCAGTCCCCTGATCGCAACGACCCGTTCAGGAGGAGCTCCCGACTTTCAGATCCCCCACCAGAGTCGGTAACCCGACCCATGGTGACGGATCTCGGTCCGTCAGTGGCAAGGGTGAGCACGCAGGCCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGAGGTGGAGAAATTGGCTCCCTACAGCATCTACGACCGCGACAAGTCAGAAGACGATGGACCACATCGCCCGTGCCATCGCAAAAGACGGGAGGAAGTCCCCAGCTTGTTCCCCTCATCGGTCTTCGGACTTGACCTGCTCTCGGCAGCGAGGGACCTACAGGGGCTATACCACCAGGATGAATGGCAAGATCAGCCCCTTCTATCCGCATTCGAGACCCAACGACACACATGAGAGACAAGGGCGCGAAAGCTTCCGAACTCTCAGCCCTTAACAACAGGGCGATAGAGGCTGTACGAAGGTACTACTAGCGAGCACCGCTTGAAACGAAGCTACTTGAACGGAGTACAAGCCTGCCAAAGGCTCCACAAAGATGCGCAGGTACCCACGGGTGCAGGTGCCAAAGTCCAGGCGCCGAAGCCCAGAGCAACCCTACGTTGGATGGCAACCCGGTGGAAGAAAGGCGACATCCATACCTAGCGGAGGTCCAGAAGCCGAAGGCGGCTATGCATCTGTCGCCAGAATGCTGCTTGCGGGTGCAGAGAGGCACTCATCGTAAAAAGACAGGAGAGGCTTCGTACGCAGAGATGCTTCAGGCTAAGATCGGGATCGAGCCTTAGCAGACACAGGCAGTCACGTGCGAAAAATCCGGAGAACGCAGAAAGGTGATCTGTTGCTTGAGGTAGGGAAAGCTTCGGAAAGCGTTCCCAAGTTTAAAGAGCGACCTGGAAGCGGCGCTCAATGACTTGGCCTCTGTGCCACAGGAGCGCAAAGAATAAGCTCTATCTTGCAGCGGATTGGACGAGGCTACGACGGCAGAGAAGCTCCACAGCTGCTTGGTCGCCCAATTCCAGGGCCTGCAGATAAATCCTGAGATATCAGGGGCCTTCGCGGTATGCGGAATTGCAAACAAATAGCCTCAGCGAGTGCTGCTGAACGCGAACGTTGCGATACCAGTCCTTAAACGGGGCACCATAATCGTTGGATGGTCAAGATGTCGTATCACCCAGGACGTCCGACCCACAGCGGATGCTACAGGTGTCTCGTATGGGCATCGATCAACAGCCTGCAAAGGACACTGACAGGGCGGGCTGCTGTCTTAGATGCGGTGAGCGTGGGCACAAAGGCAAAGGGTGCGTTGCTGCACCAAATGCCACGTCGACAGCGGGGTGGACAGGAAACCACCCGACGGGTAACTGCGTGCCCGACTTACAGAGCGACACTAAAGATGCCAGAGCACCTTAATGCACGCTGCGTGGCGTAGTACAGCTCAATGTCAATCATTGCGCAGCAGCTCAAACCTCCTGGCCCAGACTGCGGTTGAGCGCAATGTAGACATCATGCTCCTAAAGCGAACCCTACGTCTCTGGTAGTGGACAATCGTCCATGATCCTTGACGAGGCAGGTAAAAGCAGCTATCAAATGCAGCTCTCTCTCAAGTCAGGAACTGGCTGCTTTACCCATGCGGGGTATCGCTTATGCGAAGTTAAAACACGTGCACATGTACGGCTGCTACGCTCCGCCGAGCAGCACCCCGATCAGTTCGAGGAGCTTCTGGAGGCGCTCGTGGACCATGCGAGAGGGGCAGAAGCCCGGAAGGTCGTACCGGCGACTTTAATGCCTGGACGGTGGAATGGGGCAGCAGGACATCCAGCACCAGAGGACGAGCTGTGATTGACGCCATGCGAGATGCTGGACCTCATACTGCTGAACGATGGACGAAGCCGACGTTTTAACAACGATAGGGTACGTCCTTTATTGACGATTACCTTTGTCAGCAGAGGGCTGAAGTGACAACAACAACTGGATGGTCCGACGTCATGACGCTGAAGGCATGCCTGATCTCCTTCTCCCCGGGTACATGCCCAAAAGACGGCAGAGTAGAACAGCCGGGAAAACATGGGACACCAGGAAGATCGATGAGGCCATGCTGGCCTATCCAGATCAATTCCTGGAAATCCCAAATGTGGACGCAGAGAGTATGGCGGCAGGCCTCATGAATATGCTGGGAAGAATCTGCGACGCAATCATGCCAAGGAAAATAAGGCACAGCGCAAACCACCCGTTTACTGGTGGAGTGCCTCCCTAAACCAACTACGGTCTGATTGCCTCAGGGCTAAAGAGAACGGCGCAATGGCTTGAGCCAGAGCCCAGTACACCCACCACGCGGAACTCTTGGAGGCTTTCCAGGAAGCAAACGCCTGGGGTTCAAGCACGTACATCGCGGCTGCCAAAGGCGCGGTCGTTTAAGGCTGCAGGATGGCGTAGACAGCGATATCTGGGGCCTCGCCTACAAGCTTGTTACCAACGAGGCTAAGGAGGGAGGCAACCCCATCCGACCCGGGGGGTCCTGGCTAACATACTAGGGGAGCTATTTCCAAAGCAGACCACACTATGGAGGCCAACAGGGGCAGCCCCTGCCCAGATTTCCCGTGCGTCACAGAACTTGAAGTCGTCGAGGCGGCTGTTTCGCTGACGATGTGGCAATCACAGCTCCAGGCTAGCAATAGCGGCTCACAAGACCGAAGCAGTCCTGCTAAGCAGCCTTGGGAAAAGATGGAGAACATGCTGGTCTCCGTCAAGGGGTACTCAGGGGACCTCTCAAGAGTCCCTAAAAAGTACCTGGGGGGTAATGATAGATCACAGACTATCGTTCAAGCCACGCGAGCTACGCCAGCAAGAAGACAGCGATCACATCCTCTTCGTTGGCGAGGCTTATGCCCAACGTCGGAGGCCCAAGACACCCGGCAGAGCTGCCAGTGTCAGTGGCAAAGGCTTCGCTGCTATACGCTGCACCAGTCTGGAGCAATGCCATGCAGGGTCTCATACCTGAAAGGAGCTCGTTCGGTGCTACGGTCAATGGCCCTCAGGCTCATTAAGTTCGGGACATATCCGAAGACACTTGGCCGCGCTAGCGCTGGCAGGCCTGCCGATTGATCTGAGATCAAGGCTCTCAGCCCTTATGCGGAGTGGCGCTTCCAGGCAAGAGAGGCACACGAGTGGCTATTAGGTGAATGGCAAGAGCAGATGGCAAACGTCGCGACGGGGGAGGAGTGGACCTATCCAGCTCATCCAGAGATGACAGTTTTGGGCAGGTGACACTCTCAAAGTGTGTAAACTTTGTTTGGTATTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTTTAATTTATAAGTAAAATAAATATTGTTTTAATTATATTCCTAAAAAAATTGCGTTTAATTAAACAAATAACCCTTAATTTTTGGCCGTTAAAATCAAAATTCATCTTATTTCACGGTGTGTAAACAGTTTTCTTGACAAACTGTACTTGTCGCAGATTTATTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTAGAGTGATGCCGAGTATAAAGTGATTCAGATCCGACATCAAGTGGGACCGCCTACTCCAACCATGTAGTTTCATTGTGTCATAGATCATTTGTGTTTTGGCTGTTCTTTATTTGATCCAATTTGAGGAACAGGGAAGGTCCCACGCTCCATTCAGAAATTAATTCGTCAATCCTCTTATGATCTACATACAAAGGTTTCTTAGCCTAAGTCGAGGGAGCAGCGCTGCCGGCATAGCCTGCAACGCAGCAGCAACGCTTATATGCGTATCTTATATATATGTATATATATATGTACTGTCGCCGAGCGATGATTGCTGGAGATGGTATAGGCACATATAAGCGATCAGCTTGGCCAGCAGGAGAACTGCTGACCAGGCAATTATATATTTAGCCCTCAAGTGGGTGCTCGTAATTACGTATACACTTGTGCTGGACTGTTTATGTACACACATTGCAACAGAGTGCTACAATTATGAATACACATAGGTACAGTGCTTAACGTATGTGTGCATACTACAATAGTGAAACAATTTGCTGACAATTCTAGAGTCGCAGAATCGCCATTTTTCTGAACTGTTAAAAGTGCAAAACTCACAAAGAGACCCAAAAAAACTGAAATGCTGTCGTATTGCCAAGAGTTTAATCCTGAACGCACAGGCTTAGACACTCAATCCTGGTGCGGAGACCAGTCTACATCGCCGTGAGAGACGGACGTCTTAAATTACGCGGCGCAGAAATGCTCCGAAACCATAGAGTTGTGTCGGCCGGTGTGTGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCATAGTTCTGCGCTGCAAATCGCGAGTTAATTGTGCGCCTGTTTCGTAAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAACAGCTGATAGCGCAGCGAGGCGATCTGGAGAGGGAGGCGTTGCCAAGATCAACCGTGTGATCAGTGTTGTTGCGACAGTAGGGCCGCGAAATTCAGAATTAAATTTAAAATTAAGCCGTTGAAATTTGAATTTGAATTTAATTTTACGATTCTGGTAACTGGGGCGCACAGAGTCTTTTAAGAAGGAGAAAGGCACAAAGGTCGCGGACAGACCAAATATCATCCTCTCACCGTGCTGGTTACTAAGCAGAGCTCTGGTGTCCGGTCGAGGCAGGTAAACCTCCATCCGTAAAGCCGGGGGAAATCCGTGGCCCTGCGTGACCCTAAGGTAACCTTGGGCCATCCTTCCAGTTGATGGACAGCGCGGTGGGGCAGTCCCTGATCGCAACGACCCGTTCAGGAGGAGCTCCGGCTTTCGAGATCCCCACCAGAGGAGTCGGTAACCCGACCCATGGTGACGGAATCTCGGTCCGTCAGTGGCAAAGGGGTGAGCACGCAGGCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGAGGTGGAAAATTGGCTCCTGCAGCATCTACGACCGCGACAAGTCAGAAGACGATGGACCACATCGCCGTGCCATCGCAAAGACGGGAGAAGTCCCCAGCTGGTTTCCCCCTCATCGGTCTTCTGGACGACAGCCACTGCTCACCAGAACGAGGACCTGGGGGCCATACTTACCAGGATGAATGGCAGATCAGCCTTCTATCCGCATTCGAGACCCAACGACACACGCGCTGAGACAAAGGGCGCTAGCTTCCGAACTCTCTCGGCCCTTAACAACAGGGCGATGGGGCTGTACGAAGGTACTACTAGCGAGCACCGCTTGAAGAGCAGCGCTACCCAGACGGAGGTACAAAAGCCTACCAAAAGGCTCCACAAAATGCGCAGGTACCCACGGTGCGGGTGCCAAAGGATCCGAGCGCCGAAGCAGAGCAACCCTACGTTGGATGGCAAGCAATGCGTAACTACCA
->b4b8965a-5654-469d-a541-542d65f4998d
-TTGTTGTACTTCGTTCAGTTACGTATTTTATGATCTACATACAAAGGTTTCTTAGCCTAAGTCGAGAACTTACAGCGCTGCCGAGCATAGCCTGCAGCGCAGCAACGCTACTGTACGTATCTTATATATATGTATATATATGTACTGTCGCCGAGCGATGATTGCTGGAGGAGTGGTATAGGCACATATAACCCGATCAGCGCTGGCCAGCAGGAGAACTTTACTGACGAGCAGTATATATGTTAGCCCTCAAGTGGGTGCATATTACGTATACATTGCTGGACTGTTTATACACATTGCAGCAAGTGCTACAATTATGAATACATAGTACAGTGCTTAACCGATGTATTATTGCATACTACAATAGTGAAAACAATTTGCTGACAAATTCTAAGTCGCAGAAGTCGCCATTTTTCTGAACTGTTAAAAGAAGTGCAAAACTCACAAAGAGCCAAAACAATGCTGTCATTGCCAAAGTTTAATCCTGAACGCACAGGCTTAGACGCACCAATCCTGGTGCGGAACCAAGTCTATCTGTAGAAGACGGACGTCTTAAATACGCGTACCGATACTCGAAACCATAGAAGTTGTGTCCGGCCGGTATTGAGCGCATGACAAACTGGCAAAATCACACGGTGGAGTCGCGCCATAGTTCTGCGCTACAATCACGCGAGTTAATTGTGCGCCTGTTTCGTATAAATAGGTAATTTATCTTGCGATTGTTGCAGCGGATAAACAGCTGATAGCGCAGCGGGCGATCTGGAGAGAGGAGGCGTTGCCAGATCAACGCCGATGTGATCCAGTGTTGATGTTGCGACAGTAGGGCGCGAAAATTCAAAATTAAATTTAAAATTAAGCCGTTGAAATTTAATTTAATTTGTAATTTTGATTCTGGCTAACTGGGAGCGCACAAGTCTTTTAAGAAAGGAAAAGGCACAAAGGTCGCGGACAGACCAAATATCATCCTCTCACCGTGCTGAAGGGTGCCTAAGCAGAAACTCTGGTATTCCGAGTCGAAGGCGGTACAAACCTCCATCCGTAAAAGCCAGGGGAAATCGTGGCAGCTACGTGACCTAGGTAACCTTAGGCCATCCTTCCGGTTGATGGACGGCACCGGTGGGGGCAGTCCCGGAGGAGCTCCCGACTTTCGAATCCCCACCAGAGGGGTGGTAACCCGACCCATGATGACGGAATCTCGGTCCCGTCGGTGGCAGGGGTGAGCACGCAGGCCCCCAGCCGCCGTTGACTATCGACTGCAGCGATTCTCTTTATGAGGTGGAGAAATTGTCCTACAGCATCTACGACCGCGACAAGGTCAGAAGACGATGGACCACATCGCCGTACCATCGCAAAGACGGGAGGGAAGTCCCCAGCTTGTGTTCATCGGTCTTCGGACTGACCCACTCTCCAGAACCTTGAGGACTGAGGGCATACTTACACTGGGATGAATGGCAAGATCAGCCCCCTTCTATCCGCATTCGAGACCCAACGACACGCTGAGAATAAAGGCATAGCTTCCGAACTCTCAACCCTTAACAACAGGGCGATAGAGCTGTACGAAGGTGGCACTAGCGAGCACCGCTTGAAGAGCAGCGCTACAGACGGAGGCACAAAGCCTACCAAAAGGCTCCACAAAATGCGCAGGTACCCACGGTGCAGGTGCCAAAGTCAGGCATGAAGCAAGAACAACCCTACGTTGGATGGCAACGGTGGAAAAGGCGACATCCATACCTAACGAGGAACCAAGCCAGGCAGCTATGCATCTGTCGCCAAAAGATGCTAGCACGGTGCAGAGGCGCTCATCGTAAAAAAAAAGACAGGAGGCTTCGTACGGAAATGCTTCGGAAGCTAAGATCGGAATCGAGCCTTAGCGAACTGGGCGATCACGTGCGAAAATCGGAGAACGCAGAAGGTGATCTGTTGCTTGAGGTAGGGGAAAGCTTCGGAAAGCGTTCCCAAGTTTAAGAGCGACCTGGGCGGCGCTCAATGAGCAACTCTGTGCGCACAGGAGCGCAAAGAATAGCTCTATCTTGCAGCGGATTGGACGGTACGACAGCAGAAGAAAATCAACTGCTTGGTGTGAATTCCGGGGCCTGCAGATAAATCCTGAAAGATATCGGGGGGGGCCTTCGCGGTATGGAATTGCAAACAAATAGCCTCGAACGCGAACGTTACGTGTCACCGGTCCTTAACAGGGCACCATAATCGTTGGATGGTCAAGATGTCAGTATCACCCAGGACGTCCAAACCCACGAGATGCTACGGGTGTCTCGGCTATGGGCATCGATCAGCAACCTGCAAGGACACTGACCAGGGCAGACTGCTGTCTTAGATGCGGTGAGCGTGGGCACAAGGTAAAGGGTGCGTTGCTGCACCAAATGCCTGATCTGCAGCAGCGGGTGGACAGAAACCACCCGACGGGTAGCTTTGCGTGCCCGACTTACGAACGACACTAAAAAGTGCCAAAGAGCCACCTTAATGCACGCTCATATTATTGGCGTAGTACAGCTCAATGTCAATCATTGCGCAGCAGCTCGGAAACCTCCTGGCCCAGACTGCGGTTGAGCGCAATGTCGCTTGAACCCTACGTCTCTGGTAGTGGACAATCGTCCATGATCCTTGACGAAGACGGGTAAGCAACTGTAAATGCTGCAGCTCTCTCTCAAGTCCAGGAACTGGCTGCTACCCGTAGGTATCGCTTATGCGAAGTTAAAACACATTACACATGTAGCTACCGCTCGCCGAGCGACACTGATCAGTTCGAGGCTTCTGGAAGCGCTCGTGGACCATGCGAGAGGGCGAAGCCCGAAGGTCGTACCGGCGACTTTAATGCCTGGACGGTGGAATGGCAGCAGGACATCCAACACCAGAGGACGAGCTGTGATTGACGCCATGCGAATGCTGGACCCTCGCCTGCTGAACGATGGACGGAAATACGACGTTAACAACGATAGGGGTACGTCGCTTTATTGACGTTACCTTTGTCCAGCAGAGGGCTAGTAGACAGCAACAACAACTGGATGGTCCATGATCATGACTGAGCGACCATGCCTGATCTCCTTCTCCCGGAGGTGCAATGCCCAAAGACGGCGAAATGGGGTAGCCGGAAAGCAGGACACCAAGGAAGATCGATGAGGCCATGCTGGCCTATCGGATGACCACAAATCCCAAATGTGGACTGACGCAGAGAGTATGGCGGCAGGCCTCATGAATATGCTGGGAAGAATCTGCGACACCAATCATGCCAAAAGGAAAATAAGGCACAGCGCAAACCCACCCGTTTACTGGTGGAGTGCCTCCCTAAACCAACTACGGTCTGATTGCAGGGCTAAGAGAACGGCGCAACAGCCAGAGGCGAGTACCCACACGCGGAACTCTTGGGCTTTTCAAGAGCAAACGCCTGGGGAGTTCAAGCACGGCGCATATCGCGGCTGCCAAAGCGCGGTCGTTTAGGAGCTGCAGGATGGCGTGAACGGCGATATCTGGGGCCTCGCCTACAGCTTGTTACCAACGAGTAAGGAGGAGAGCGGCAGCCATCCGACCCGGGGTCTGGCTAACATACTGGGGGAGCTATTTCCAAGCAGACTAACCACACTGGAGGCCAACAGAGCCAGCCTGCCCCAGATTTCCCGTGCGTCACAGAACTTGAAGTCGTCGAGGCAGCTGTTTCGCTGACGATGGCAATCACAACCGGGCTGGCAATAGCGGCTCACAAGACCGAAACGTCCTACTAAGCAGCAGGAAAAGATGGAGAACATGCTGGTCTCCGTCAAGGGTACTCAGGGGACCTCTCAAGAGTCCCTAAAAGTACCTGGGGGTAATGATGATCGCAGACTATCGTTCAAGGACCACGCGAGCTACGCCAGCAAAGAAGCAGCAGTCACATCCTCTCTTCGTTGGCGAGGCTTATGCCCAACGTCAGGCCCAAGACACCCGGCCAGGAAGCTGCTGGTGTCAGTAGCAAAACTTCGCTGCTATACGCTGCACCAGTCTGGAGCAATACCACTTGCAAGGGTCTCATACCTGAAAGGGCTCGTTCGGTGCTACGGTCAGTAGCCCTCGAGCTCATTAGAGGATTCAGGATCGCATATCCGAACGGCACGCTGGCAGAGACCTACCGATTGATCTGAGATCAAAGCTCTCAGCGCCATGCGAATTGGCGCTTCCAGGCAAGAGGCACACGGTGGCTGTGGGTGAATGGCAGAGCAGATGGCAAACGTCGCGACGGGGGAGGTGGACCTATCAGCTCATCCAGAGATGACGGTTTTGGAGCCAAATTGTTTCTCTCAAAAGTGTATAGAAGCTTGGAATTTGTTATTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTTAATTTATAAGTAAAATAAATATTGTTTTAATTATATTTCCTAAAAAAAATTGCGTTTAATTAAGCAAATAACCCTTAATTTTGACCGTTAAAATCAAAATTCATCTTATTTCCGGTGTAAACAGTTTCTTGATAAAGCTGTACTTGTCGCAGATTTATTTTAATTTCCAAGTTAACGACCACCGTTTTCTGTTACTTTGTGTCCCGCTGTAGCCAGAGTGATGCCGAGGTATAAAATTGATTAAGATCAAACGCTTGAAGTGGGACCGCCTACTCCAACTTCCTGTGGTTTCATTGTGTCATAGATCATTTGTGTTTTAGCTGGTTTCTTTATTTGATCCAATTTGAGAACAAGGGAGGTCCCTTCCATTCGAAATTAATTCCGTCAATCCTCTTATGATCTACATACAAAGGTTTCTTAGCCTAAGTCGAGGAGCAGCGCTGCCAAGCCTGCAGCGCAGCAACGCTATGCGTATCTTATATATATATGTATATATATATGTACTGTCGCCGAGCGATGGTGCTTTCGGAGGAGTGGTATAGGCACACATATAAGCGATCAGCGCTTGGCCAGCGGAGAACACTGACCAGGCGGTATGTATGTTAGCCTCAAGTGGGTGCTCGTATTACGCCTTACTTGTGCTGGACTGTTTATGTACACGACTGCAACAGGATACTTACAATTATGAATACACATAGGTACGAAGTGCTTATGATATGTGTGCATACTACAATAGTGAAAACAATTTAACGACAATTCTAGGGTCGCAGAATCTTCATTTTTTCTGAACTGGTAAAGAGATTGCAAACTCACAAAGGGCAAAAAACTCAATGTATCGTATTGCCAAAGTTTAATCCTGAGCGCACAGGCTTAGACGCAATCCTGGTGCGGAGACCAAGAGTCACCATCGCCGTGAAGACCGGACGTCTTAAATTACGCGGCACCGAAATACTCAAACCATAGAAGTTGTGTCGGCCGGTGTGTGCGACAAACTGGCAAAATCACACGTCGCGCCATAGTTCTGCGCCCAATCCCGCGAGTTAATTGTGCCTGTTTCATAAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAACAGCTGATAGCGCAATAGCGGGCGATCTGGAGAGGAGGCGTTGCCAGATCAACCGTGATCAGTGTTGATATTTGCGACAGTGGGGCGCGAAATTCAAAATAAATTTAAAAATTAATGGTGAAATTTAATTTAATTTTGGTACTGATTCCTGGTAACTGGGGCACTGAGTCTTTAGAAAGGGAAAAGGCACAAAGGTCGCGGACAGATAGTATCATCCTCTCACCGTGCTGGTGCCTAAGCGAGGCTCTGGTGTCGAGTCGAGGCGGTACAAACCTCCATCCGGCTTCAAAAGCCAGGGGAAATCCGTGGCCTACGTGACCTAGAGTAACCTTAGGCCGCCATCAGCCTTCAGTTGGTGGACGGAAGCGCAGTGGGGGCAGTCCCCTGATCGCAACGACCGTTGGGAGGAGCTCCCGACTAGCAATACGTAGCACCGCA
->6b00228f-f824-4054-b070-2d3b3c400503
-TTGGTAGCGTTCGGTTGCATTATTGCTGCCATCAGATTGTGATCGATAAAGATTTTTTTTTGGAATTTTTTTTTGCGCTAACAACCTCCTGCCGTTTTGCCCGTGCATATCGGTCACGAACAAATCTGATTACTAAACTGGTAGCCTGGTTGTTCTATCAGTAATCGACCTTATTCCCTGGTAAATAGAGCCAAATCCTTATTGGGGTGGAACATGAAGATGCCAGAAAAACATGACCTGTTGGCCGCCATTCTCGCGGCAGAAAGGAACAAGGCATCCGGAAATCCTTGCGTTTGCAATGGCGTACCTTCGCGGCAGATATAATGGCGGTGCGTTTACAAAGAAAACAGTAATCGACGCAGCTTGATGTGCGCCATTATCGCCTGGATTCATTCGTGACCTTCTCGACTTCGCCGGACTAAGTAGCAATCTCGCTTATATAACGAGCGTGTTTATCAGCTACATCGGTACTGAAGCTCGATTGGTTCGCTTATCAAACGCTTCGCTGCTAAAAGCCGGAGTAGAGATGGTAGAAATCAATAATCAACGTAAGGCGTTCCCTCGATATCACTGGCGTGGGAGGGAACTGGACGGACGTCAGAAAACCAGAAATCATGGTTATGACGTCATTGTAGGCGGAGAGCTATTTACTGATTACTCCGATCACCCTCGCAAACTTGTCACGCTAAAACCCAAAACTCAAATCAACAGGCGCCGGACGCTACCAGCTTCTTTCCCGTTGGTGGGATGCCTACCGCAAGCAGCTTGGCCTGAAAGACTTCTCTCGAAAAGTCAGGACGCTGTGGCATTGCAGCAGATTAAGGGCAGTGGCGCTTTACCTATGATTGATCGTGGTGTTGATATCCGTCAGGCAATCGACCGTTGCAGCAATATCTGGGCTTCACTGCCGGGCGCTGGTTATGGTCAGTTCGAGCATAAGGCTGACAGCCTGATTGCAAAATTCAAAGAAGCGGGCGGAACGGTCAGAGATTGATGTATGAGCAGAGTCACCGCGATTATCTCCCGCTCTGGTTATCTGCGCCATCGTCTGCCTGTCATGGGCTGTTAATCATTACAGTGATAACGCCATTACCTACAAAGCCAGCGCGACAAAATGCCAGAGGGAACTGAAGCTGGCGAACGCGGCAATTACTGACATGCAGATGCGTCAGCGTGATGTTGCTGTGCTCGATGCAAAATACACGAAGGGAGTTAGCTGATGCTAAAGCTGAAAATGATGCTCTGCGTGATGATGTTGCCGCTGGTCGTCGTCGGTTGCGCACATCAAAGCAGTCTGTCAGTCAGTGCGTGAAGCCACCACGCCTCCGGCGTGGATAATGCAGCCTCCCCCGACTGGCAGACACACCGCTGAACAGGATTATTTCACCCCTCAGAGGCTGATCACTATGCAAAAAAAAAACAACTGGAAGGAACCAGAAGTATATTAATGAGCGAGTGCAGATAGGAGTTGCCCATATCGATGGGCAACTCGTATGTGTGAGCAATACACACGCTTCCAGCGGAGTATAAATGCTGAAATAAAACCGAGGCAATCCGATTTACACGAATGTTTGCTGGGTTTCTGTTTTAACAACATTTTCTGCGCCGCCACAAATTTTGGCTGCATCGACAGTTTCTTCTGCCAATTCCAGAAACGAAGAAATGATGGGTGATGGTTTCCTTTGGTGCTACTGCTGCCGGTTTGTTTTGAACAGTAGAAGCGTCTGTTGAGCATCCTGTAATAAGCAGGGCCAGCGCAGTAGCCGGTAGCATTTTTTTCATGGTGTTATTCCCGATGCTTTTGAAGTTCGCAGAAGAATCGTATGTGTAGAAAATTAAACAAACCCTAAACAATGAGTTGAAATTTCATATTGTTAATATTTATTAATGTATGTCAGGTGCGATGAATCGTCATTTGTATTCCCGGATTAACTATGTCCACAGCCCTGACGGGGAACTTCTCTGCGGGAGTGTCCGGAATAAATTAAAACGATGCACACAGGGTTTGAAAGCGCGTACACGTATTGCATTATGCACCAACGCCAGTGCTGACACAAGGAAGAAACCGGACGTTATGATTTAGCGTGGAAAGATTTGTGTAGTGTTCTGAATGCTCTCAGTAATAGTAATGAATTATCAAAGGTATAGTAATATCTTTTATGTTCATGTGGATATTTGTAACCATCGGAAAACTCCTGCTTTAGCAAGATTTTTCCCTGTATTGCTAATGTAGATTTCTCTTGATTTCAACTATCATGGGACGTTTCTATAAAGTGCGTGTTTCTATGATAACTACAAAGTCTTTAATATCGTCTAACAGATAATATAAATTCAATCATCACAGTCCTAAAATCTTTTCCGCACTTGATCGAATATTTCTTTAAAAATGGCAACCTGAGCCATTGGTAAAACCTTCCATGTGATACGAGACGCGTAGTTTGCATTATCCCGTTTTATCGTTTTCAATCTGGTCTGACCTCCTTGTGTTTTTTGTTGATGATTTATGTCAAATATTAGGAATGTTTTTCACTTAATAGTATTGGTTGCGTAACAAAGTGCGGTCCTGCTGGCATTCTGGAGGAAATACAACCGACAGATGTATGTAAGGCCAACGTGCTCAAAATCTTCATACGAAAGATTTGAAGTAATATTTTAACCGCTAGATGAAGAGCAAGCGCGTAATGGAGCGACAAAATGAATAAGGAACAATCTGCTGATGATCCCTCCGTGGATCTGATTCGTGTAAAAATATATGCTTAATAGCACCATTTCTATAGGTTACCCTGATGTTGTAATTGCATGTATAGAACATAAGGTGTCTCTGGAAGCATTGGAAGCAATTGAGGCAGCGTTGGTGAAACACGATAATAATAATATGAAGGATTATTCCCTGGTGGTTGACTGATCACCATAACTTTGCTAATCATTCAAACTATTTGGTCTGTGACAGAGCCAACACGCAGTCTGTCACTGTCAGGAAAGTGGGTAAAACTGCAACTCAATTACTGCAATGCCCTCGTAATTAAGTGAATTTACACAATATCGTCCTGTTCGGAGGGGAAGAACGCGGGATGTTCATTCTTCATCACTTTTAATTGATGTATATGCTCTCTTTTCTGACGTTAGTCTCCGACGGCAGGCTTCAATGACCCAGGCTGAAATTCCCGGACCCTTTTGCTCAAGAGCGATGTTAATTTGTTCAATCATTTGGTTAGGAAAGCGGATGTTGCGGGTTGTTGTTCACCTGCGGGTTCTGTTCTTCGTTGACATGGGGTTGCCCCGTATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTTTTTACGTTAAGTTGATGCAGATCGAAATTAGCTGATACCTGCGTCATAATTGATTATTTGACGTGGTTTGATATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCGCTACGGGTCCTTTCCGGTGAAAAAAAAAGGTACCAAAAAAAAGCTTGTATCGTCGTGAGTAGTGAACCGTAAAAATACTAATTATTGGCCCGATGCGCGTGCTATTTATTGCAAATAATTCCTGCAATTAATCTCCAAATGCGTTTTTGCTTTTTTTATATTTAGAGTAGACACATAAACACCGTTATCATAAAAGAATCAGCAGATAAAAACAAAAAAGGCACACTTACAGTTAGCTCTGAAAACATAGAAATTGCTCACAAGCAACGTTGGGTGCAGAAAGGTTAAGTTTGGGTATCTTTCTACTATCCAGTAGGCCAGTACAATGTAGGCTTGCCGGTTGAAAGTGTTATTGTTATGCTGTTGTTTACTATGCATTTGTACGAGTTCGCTTCCCTTCGGAAGCTTAGCATTGAAGTCACCTCCTACTACGCTTCCATATTCCAAAGGTTAGGATTTACTTGCATGAATTTGTTTACAGTAACATTATCATGTTAAGTAAATTATTTGTAAGTTCAGACTGTTTTCTAATGGTTGCTCTATTCTCTCCAGTGATGTGTTTGTTTTGCTGTTCCTGCAGCAATTTGGGCATAAGATTGATAATCGTTACTTTGTTGGGTATATGTTGTGGCTTGTTAGGCGGAACAAACTTTGCTGGATTCTAAATCATTTTACTCAGATCATTATTTCTATTTTCTATTTTTTTTTGGACAAAGAGTTCCTGATAAATTCTACACCCTTTGTAGCTGGCGGCGTGTTCTTCGTAGACAGTTGGCACATTTTGCTGGTTGTTCTGTATTTTTCAGGGCCAAATGTTGCTTGGGTGTCCGAGAGGATTTTACACAGCGGTACGTTTTGGTACAATATGATTTAGTATGTCGAATTCTGGCAGCTATAGCATTGAACGATTTCATTGTGGGGGAGGCTCAATATTTTATTTACATTATATATGTCTAGGTTTTTTTTTGTTAGGCTCAATATCTACATAAAACATGTTCAGTGACGTTTTTTGGTCGCACGGCTTTTTTAATATTACTTATGTTTCCTAACAACATGACCTTTTGACTCTTCATCACTTTTAATTTCATCTAAATTTGTGGAAAATGCAAATTCTTAATAACAACTCTAAATGCTCTGTCATCCTTAAGCTGGTATGTGTGGTACTGCACACAATCATTATTAAGTGTTTTGACTAATTTTCAGGAATTCTTCAATACTTTTAACCATTACTCTTACATGTCCATAACGTTGAGTCTTATAATAAAAAAGTTCTCTCTTAATTTTAGTTTTAAGATAGGTTAGCTTTTCACTTATACCATTGACGTCAGAGAAAGATAGGTGGGGGCTTAGCAAAATCAGTTTGCACTGTCTTCATTTACCATTTCGAGATCTTCGTTTTGTTATATTTGTTTCCTGTTTTGTCGGGCAATCCGTCGCTTAAAGAGAGCGAAATTATTTGCGCTGGTGCTTGATGATTGTCAGGAATCCTGTTTTCTTTGAACTTCGGGAGGGGCTTGGTCTTTTTTTTTAGTTTTATTTTACTCTGCCATTTCAAAGCAGTTAGGTCTTCGTCGGTGTCGCTCTTGAGTATTAAAGAAGACAATGATTGTTGAGTGCTTGTGTGTCCGCACTTCGTACTCAGATATGACCAAAGCAAAGACACTAGAATAATTCTAATTTGATGAGCGTTTGCAATAAAACAGTTAACATTTTTTTTTTTTTTATTTTTTTTATAAATTTTTTATTTTCTACTTCGTATTGTTTTATGGAAATATTTTTTTCTCAGTGTAATGACTTCTTTTCCGAAGTTTTTTTTTATATTTCCAATTTGATATCTTAAACAGCGCGCAATTTCATCATATTCTACGAAATTGGCCAAACTCCCCAAATATGTATGTGTACATATGTAAATTTGTTACTGCGATCAGAATTGATTTCGGCCGAAAATCGCCTTCTAGCACAACACGCACACATACGCGTTCTCGTCTTTTTGTTTTACTCCCGCACAAGCAAGCAAATTCTATTTTAGATTTCTTACGCTCAGCGTGAGCGAGCGGAAAAGAGCAATTTGGCCGTCACCAAAAGGTGGCTTACGCATAGTGCCAAACCAGTGTGGCTGTTACGCATCTTATTATTCTAGTGTGTCTTTGATGCGGGCCATGTGACTTTTTCTTAAATGTGTACATACTCCAACACGCCACCTCAAAGTAAGATTGCTGTACTTTTTTTATTACTCACGAGACTGTGCACGTCCTTCTGACGAATAATTTTGATCCAGCATTCGTTGCGAGGTGTTGGGGAGACCCAGAAAGCGCCAACCAGATCAATTGAACATATTATTTACATAAATTCAGTTTTGCAAATATTTTTTAACTAAAAATTAATATTAGTCATCTTTGTAAAGAAACTCAAAATTATCAGTAAGCAATTAAATTTAGTTAAATGATAGTTGGTTGTTGTTCCAGTCTGGTTCCTCGTCAGTTCAATCTAAGAATATAATGTTTTAATTCATTCTGAGTCAAAGTCCACTTCTCAATGTAATGAATCTTGCAGATGGGTACCGGCAAGTTGTAAATTTGTAGATATATACAGTTTGTCAAGAAACTATTTACACGCCACCGTGAGAAATAAGTTGAATTTTTCCTTTAAAGGTCCAAAATTAAGGGTTATTTCTTTAATTAAACACTTTTCATTTTTTAATGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAAACAAATTCAAAATATCAAATATACAAAGAAATTAAACAACAAATTCCAAGTTTACACACTTTTGAGGTGGCAAGGAAACTCCCTTACATTTTTGTTTTTTCCTACTTTGTTTTGCTCTTTTTTCTTAGAACGAACTCGATTTTTCCGTTATTTTTTGGCATTTGCATTCCTTTTTACAACGCTTCTATTGAAATTTTTTTTTACTTTGCTTGTGAAATTTTGCTGATCAAGATGGTTATTAAATTTAATAAAATGCCTGGAAATAGATTAGCTTTTAGTGGCCCAAATAATATACTAAAACCACCAGTTGGGAAAATCTATTCCAGAATTAGTATAAATGTTTTCTGTATCCCGTAAGACCGTCTACAATGTTTTAATCAGCGAAAAAGAGAACGAGGCTTGAACCTACAAGAGTGGTGGGCGCAAAACTAAAATTAGCAAGCGTGTAGACCGCTTATTAATGCGAAAAGTGATTGCGAACCCCCCAGATCTCGGTCAGATCACTTGCTCAGGATATCAAGGCAAGAATGTGACCTGGATTGTGCCACACACAAGGCATGCGCCAAGTCATTCCTACGCCATAGGTACTCTTCAAGAGTTGCAAAGAAAAAAGCCTTTGCTATCAGAGGTCAATATAGAAAAGCGTCATTCATTCGCTGTGAGCATGATGGATCATGCGGAAGAGTACTGGGATGACAATAATATTTTTAATGACAGAAACAAAATGATGCTCTAATATAACGATGGGCCAAGCAGAGTATGGCGCAAGCTGTTGAGTGCGCTAGAAAACAAAATATCATTCCAACAATCAAATTTGGAAAATTATCAGTGATGATTTGGGGCTGTATCTCAAGCCATGGAGTGGGCAAGTGTAGCCTTTATTGAAGCACTATGAATGCCGTGCAATATCTAGATATTTTAAAATCAAATTTGAAGGCCAGTGCAGAAAGAAAATTTGGTCTATTTAGCAACAACAAGCCAGATTTTAGAGTTTATCAGGACAATGATCTAGCATAAAGAGTGCAATGTACGCAACTGGCTCCTTATAACTGTGGCAAGGTGATCGATACGCCCCTCAAGTCTTGATCTGAACCCCATTGAAAATTTGTGGGCCTACTTAAAGAAGAATGTGGCAAAGGGGCGCAAAACACGACAACCAGCTCATGGCTGCGATAGAGTGGGAAAAGATCCCTTGAATATGACCTAAAAACTCATCCATTCCATGAAAAAAGCTTCCAACTTGTAGCCAAAGCCAATGGGGGTCATACTAAATGCTACAACTTTCCAAATTTTAACAAAATAATTTAAAGAGGTGGGATTAAACTTAGGTTTAGTGTTTTTTTGTAAAGGTTCTTGGAAACTCTCAAGAGTGTTTAAACTTGGAATTCGTTGTTTATTTTCTTGTATATTTGATATTTTTGAATTTGTTTTAATTTATAAATTAAAATAAATATTGTTTAATTATATTTCCTAAAAAAAAATTGCGTTTAATTAAGCAAATGTACATAATTTTTGACCGTTAAAATCAAAATTCATCTTATTTCACGGTGTGTGTAAAACGGTTTCTTGACAAACTGTACTTGTCACTTGAATTTATTTTTTAATTTCAAGTTAACGACCGTTTTTTTCTGTTACTTTGTGTCCGCTGTAGAGAGTGATGCCGAGTATAAAGTAGTTCGAGATCCGACATCGAAGTGGGACCGCCTACTCCAACTTCCTGTAGTTTCATTATTATTATAGATCATTTGTGTTTTTAGCTGTTCTTTATTTGATCCAATTTGAGGAACAGGGAAGGTCCGCTCCATTCGAAATTAATTCGTCAATCTCTTATGATCTACATACAAAGGTTTCTTAGCCCTAAGTCGAGGAGCAGCGCTGCCAGCATAATACAGCGCAGCAACGCTATATGCGTATCTTATATATATATGTATATATATATGTACTGTCACTCGAGCGATGGTGCTGGAGTGGGTATAGGCACACATATACCATAAGCGATCAGCGCTTGGCCCAGCAGGAGGAAAAACTGCTGACCAGGCAATTATGTATGTTAGCCCTCAAGTGGGTGCTCGTATTACGTATACACTTGTGCTGGACTGTTTATGTACACATTGCAACAGAGTGCTACAATTATGAATACACATGGTACAGTGCCCAACCGATATGTGTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTAGAGTCGCAGAATCGCCATTTTCTGAACTGTTAAAAAGAAGTGCAAAACTCACAAAGAGACCAAAAAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCTGAACGCACAGGCTTAGACACTCAATCCTGGTGCGGAGACCAAGTCTACATCGCCACCGTGAAGACGGACGTCTTAAATTACGCGGCGCAATACTCGAAACCATAGAAGTTGTGTCGGCCGGTGTGTGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCATGGTTCTGCGCTGCAATCACGCGAGTTAATTGTGCGCCTGTTTCATGTAAATAGGTAATTTATTATCTTGCGGTTATTTGCAGCGGATAAGCAAGCTGGTGATAGCGCAGCGAGGCGATCTGGAGAGGAGGCGTTGCCAGATCAACCGTGTGATCAGTGTTGTGTTGCGACAGTAGGGCGCGAAATTCAAAATTAAATTTAAAATTAAGCCGTTGAAATTTAATTTAATTTAATTTTGATTCTGGTAACTACAGGGCGCACAAGTCTTTAAGAAGGGAAAAGGCACAAAAGGTCGCGGACAGGCCAAATATCATCCTCTCACCGTGCTGGTGCCTAAGCAGAGGCTCTGGTGTCCGAGTCGAGGCGGTACAAACCTCCATCCGTAAAAGCCGAAATCCGTGGCCCTGCGTGACCCTAGGTAACCTTAGGCCATCCTTCAGTTGATGGACAGCGCAGTGGGGGGCAGTCCTGATCGCAACAACCCGTTCAGGAGGAGCTCCCGACTTTCGAGATCCCCACCAGAGGTCGGTAACCCGACCCATGGTGACGGAATCTCGGTCCCGTCAGTGGCAAAGGGGGTGAGCACGCAGGCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGAGGTGGAGAAAATTGGCTCCTACAGCATCACGACGCGCGACAAGTCAGAAGACGATGGACCACATCGCCGTGCCATCGCAAAGACGGGAGGGAAGTCCCCAGCTTGTTCCCCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCAGAACGAGGACCTGAGGGGCATACTTACCAGGATGAATGGCAAGATCAGCCCCTTCTATCACATTCGAGACTAACGACACACATGAGAGACAAAGGGCCTGCTTCGAACTCTCAGCCCCCACTAACAACAGGGCGATAGAGGCTGTACGAAGGTACTACTAGCGAGCACCGCTTGAAGAGCAGCTACAGACGGAGTACAAAGCCTACCAAAAAAGGCTCCACAAAATGCGCAGGTACCCACGGTGCGGGTGCCCAAAGTCCAGACGCCAGTAGAGCAACCCTACGTTGGATGGCAGCAGTGGAAGGAAAGGCGACATCCATACCCTAACGAGTCAAGCCAGGCAGCTATGCATCTGTCGCCAAGAATGCTAGCACGGTGCAGAGGCACTCATCGTAAAAAGACAGGAGGCTTCGTACGCAGAGATGCTTCGGAAGCTAAGATCGGAATCGAGCCTTAGCGAGGCAGGCGTCACGTGCGAAAAAAATCCGGAGAGGAGAACGCAGAAAGGTGATCTGTTGCTTGAGGTAGAGGGGAAAGCTTCGGAAAGCGTTCCCAAGTTTAGGAAGCGACCTGGAAGCGGCGCTCAGCTTAACCTCTGTGCGCACAGGAGCGCAAAGAATATAGCTCTATCTTGCAGCGGATTGGACGAGGCTACGACAGCAGAAGCTCACAGCTGCTTGGTCGCCCAATTCAAGGCCTGCAGATAAATCCTACAGAAGATATCAGGGGCCTTCGCAGTATGCGGAATTGCAAGCAAGCCAGCTCAGTGCTGCTGAACGCGAACGTTGCGATACCAGTCCTTAAACAGGGCACCATAATCGTTGGATGGTCAAGATGTCGTATCACCCAGGACGTCCGACCCACGAGATGCTACAGGTGTCTCGGCTATGGGCATCGATCAGCAACCTGCAAGGACGCACTGACAGGGCAGACTGCTGTCTTAGATGCGGTGAGCGGTGAGCACAAGGTAAAGGGTGCGTTGCTGCACCAAAATGCCTGATCTGCAGCAGCGAGGTGGACAGAAACCACCCGACGGGTAGCTTTGCGTGCCCGACTTACAGAAACGACACTAAAAGATGCCAAGAGCCACCTTAATGCACGCTCATATTAGCGTAGTACAGCTCAATGTCAATCATTGCGCAGCAGCTCAGAGCCTCCTGGCCCAGACTGCGGTTGAGCGCAATGTAGACATCATGCTCACTTGAACCCTACGTCTCTGGTAGTGGACAATCGTCCATGATCCTTGACGAGGCAGAATTAAAAGCAGCTATCAAATGCTGCAGCTCTCTCAAGTCCAGGAACTGGCTGCTTTACCCCATGCGGGGGTATCGCTTATGCGAAGTTAAAACGTGCACATGTACGGCTGCTACGCTCCGCCGAGCAGCACCCCGATCAGTTCGAGGAGCTTCTGGAGGCGCTCGTGGACCATGCGAGAGGGGCGAAGCCCGAAGGTCATTACCGGCGACTTTAATGCCTGGACAGTGGGAATGGGGCAGCAGGACATCCAACACCAGGACGAGCTGTGATTGACGCCATGCAGATGCTGGACCTCATACTGCGCTGAACGATGGACGGGAAGCCGACGTTTAACAACGATAGGGGTACGTCCTTTATTGACTACGTTACCTTTGTCAACAGAGGAGCTGGTGGAGCAACAACAACTGGATGGTCCATGACGTCATGACGCTGAGCGACCATGCCTGATCTCCTTCTCCCCGGAGGTATGCCCAAAGACGGCGAGTAAGAACAGCCGGGAAAACATGGGACACCAGGAGGAAGATCGATGAGGCCAATGCTGGCCTATCAGATCAATTCCTGGAAATCCCAAATAATGGACGCAGAGAGTATGGCGGCAGGCCTCATGAATATGCTGGGAAGAATCTGCGACGCAATCATGCCAGGAAAAAATAAGGCACAGCGCAAACCACCCGTTTACTGGTGGAGTGCCTCCTAAACCAACTACGGTCTGATTGCCTCAGGGCTAAAGAGAACGGCCTGAGCCAAGCGGTACCTAGAGTTCAAGCGGCATCGCGGCTGCCAAAGCGCGGTCGTTTAAGGAGGAGCTGCGGGATGGCGTAGACAGCGATATCTGGGGCCTCGCCTACAAGCTTGTTACCAGCAGGCTAAGGAGGAGAGCAGCAGCCCACATCCGACCCGGGGGTCTGGCTAACATACTAGGGGAGCTATTTCCAAAGCAGACCACACTGTGGAGGCCAACAGAGGCAGCCCCTGCCCCAGATTTCCGATGCGTCTGGGGCAGAGTCGTCGAGGCAGCTGTTTCGCTGACGATGTGGCAATCACAGCCGGGCTAGCAATAGCGGCTCACAAGACCGAAGCAGTCCTACTAAGCAGCAGGAAAAGATGGAGAACATGCTGGTCTCCGTCAAGAGAGGTACTCAGGGGACCTCTCAAGAGTCCCTAAAGTACCTGGGGTAATGATAGATCACCAGACTATCGTTCAAGGACCACGCGAGCTACGCCAGCAAGAAGACAGCAGTCATCTCTTCGTTGGCGAGGCTTATCAACCCCTTCCCAACGTCGGAGGCCCAAGACACCCGGCCAGGAAACTGCTGGTGTCAGTAGCAAAGGCTTCGCTGCTATACGCTGCACCAGTCTGGAGCAATGCCACTTGCAGGGTCTCATACCTGAAGGAGCTCGTTCGGTGCTACGGTCAATGGCCCTCAGGCTCATTAGAGGATTCAGGACCATATCCGAAGACGCGGCGCTAGCGCTGGCAGGCCTGCGGTGATCTGGAGATCAAGGCTCTCAGCCTTATGCGGAGTGGCGCTTCCAGGCAAGAGGCACACGAGTGGCTATTAGGTGAATGGCAGAGCAGATGGCAAACGTCGCGACGGGGAGGTGGACCTATCAGCTCATCCAGAGATGACGGTTTGGGCAGAGTGACACTCTCAAAGTGTAGCCAAACTTGGAATTTGTTATTTATTTTCTTGTATATTTGATATTTTTGAATTTGTTTTAATTTATAAGTAAAAATAAATATTGTTTAATTATATTTCCTAAAAAAATTGCGTTTAATTAAACCAAATAGCCCTTAATTTTGACCGTTAAAATCAAAATTCATCTTATTTCACGGTGTGTAAACAGTTTTGACAAACTGTACTTGTCGCAGATTTATTTTTTAATTTCAAGTTAACGACCGTTTCTGTTACTTTGTGTCCGCTGTAGAGAGTGATGCCAAGAGCAATACGTAAAAAGGGA
->09ae6e10-df9f-439b-9819-e0932c88091b
-TTCGGTACTTCGTTCAGTTACATTGCTTCTTCCCAAATACTCTCTGGAGCTACAAACGACCTTGTTCCCTTTAGCCTCTTTGGATCCAATTTTCTCTAAGCAACTGTCAACAACAACGCAAGAGTCAGGTTCACATCCTTCAATCACTGTATTTTCCGGAAGGTCAATGTCGATACTTTCTCCCCTTTCAAGAATTCCTTCTAAATTCTTCTCCCAGTACCAAATAGAAATGTCTTTTTTCATCCTCCTCACCACTTTCTTCGTCAGTAGAAATATCCCAATCGAAGTTTAAAATCCCGTTCAAATTTCTTGTTCAAACCAAAGCCTTCACTTTCGAGTGAAAAGTGTATCTGAATGCCCAAGGTTGCTCACAAACAACGAAAGTATTACTTACTTATTGTTCACTACTTACTAAGTTTATTTCGTCACTGTCGTATTCTCTGCTGTTTATACTTTGGGTTCTTTTAAAGTATTATAAAATGATATGTCATTCCCAAGAGATTTACACAAGAATATAATAATAAATTATTAAATTAAATTACTATTTATTGCAAATAATTCATACAATTAATCTCAAATGCGTTTTGCTTTTTTATGATTTGGGGCTAGACACATAAAAGCACACCGTTATCATAAAGAATCTGGCAGATAAAACAAAGGCACCTTACAGTTAGCTCTGAAAACATAGAAATTGCTCACAAGCAACGTTGGGTTAGAAAGGGTTAGAAGTTTGGTATCTTTCTACTATCCAGTAGGCCAGTATGTAGGCTTGCCGGTTGAAAGTGTTATTATGCTGTTGTTTACTATGCATTTGTACAGTTCGCTTCCTTCGGAAGCTTAGCGATGAAAGTCACCTCCTACGCTTCCATATTCCAAGGTTAGGATTTACTTGCATAATTTGTTTACAAGTAACATTATCTGTGTTAAAGTAAATTATTTGTAAGTTCAGACTGTTTCCTAATAGTTGCTCCTATTCTCTCCAGTGATGTGTTTGTTTTGCTATTTCCTTATGGCAATTTGGGCATAAGATTGATAATCGTTACTTTGTTTGGTATATGTTGGCTTGTTAGGCGGAACAAACTTTGCTGGATTCTCTAAATCATTTTACTCAGATCATTATTTCTATTTTTTTCTATTTTTTTTTGGACAAGAGTTCTGATAAATTCTACGCCCTTTGTAGCTGGCGTGTTCTTCGTAACTTAGTTGGCACATTTGCTGGTTGTTCTGTATTTTTCGGGCAAATGTTGCTTGGGTGTCGAGAAAGTTTTACACAGCGAGGTACGTTTTGGTACAATATGATTTGTGTATTAAATTCACCAGCAGCTATAGCATTGAACGATTTCATTGTGGGGAGGCTCAATATTTTATTTACATTATATATGTCTGGTTTTAATTTAGGCTCAATATCTACATAAAACATGTTCAGTGACGTTTTTGGTCGCACGGCTTTTAATATTCCTTATAACAACAAACATGACCTTTTTTGACTCTTCATCACTTTTCATTCATCTAAATTTGTGGAAAAATGCAAATTCTTAATAACAACTCTAAATGCTCTGTCATCCATAAAAGCTACGACATGTGTGGTACTGCACACAATCATTATTAAAGTGTTTTGACTAATTTTCAGAGTCTTCAATGCTAACCATTACTCTTACATGTCCATAACGTTGGAGTCTTATAATAAAAAAAGTTCTCGCCATTTTGGTTTAAGATAGGTTAGCTTTCACTTATACCATTGACGTCAGAGAGAGAAAGATAGAGTGGGGCTTAGCAAAATCAGTTGCACTGTCTTCATTTACCATTCGAGATCTTCGTTTTGCTATATTTATTTCCTGTTTTTGCTCGGGCAATCCGTCGCTTAAAAGCGAAATTATTTGCTTCTGGTGCTTGATGGTGTCAGGGAATCCTGTTTCTTTGAACTTCGGGAGGGCGGTCTCTTTTTTGGATTTTATTTTTACTCTCTGCCATTTCAAAGCAGTTAGGTCTTCGTCAGTGTCGCTCTGCTTGAGTATTAAGAAGACAATGATTGTTGAGTGCTTGTGTCCGCACTTCGTGCCTCAAAATATGACAAAGGCAAATACTAGAATAATTCTAATTTGATATGACGTTTTGCAATAAACAGTTAACATTTTTTTTTTTATTTTACCAATTTTATTTTCTACTTCGTATTATTTTTTTTATGAAATATTTTTTCTCAGTGTAATGACTTCTTTTCCAGTTTTTTTTATATTCCAATTTGATATCTTAAACAGCGCAATTTCATCATATTCTACGAGAATTGGCCAAAACTCCCACAAATATGTATGTACATATGTAAAATTCGTTACTGCGATCAGAATTGATTTCGGCCCGAAAATCGCCTTCTAGCACAACACGCACACATATACGCGTTCTCGTCTTTTGTTTTTACTCACACAAACAAGCAAATTCTATTGCAGATTTCTTACGCTCAGCGTGACGAGCGGAAAAAGAGAGGCAATTTGGCAAATCACCAAAAGTGGCTGCATAGTGCCAAACCAGTGTATGGCTGTTGCATCTTATTATTCTGGGTATCTTTGATGCAGGCCATGTGACTTTGCTTAAATGTTGTACATACTTTCCAACACGCCACCTCAAAGTAAGATTGCTGCTTTTATTACTCCTGCGAGACTGTGCGTCCTTCTGACGGAATAATTTTGATCCAGCATTCGTTTGCGAGGTGTTGGGGAGACGAAAAAAAACCTTGAATCAATTGAACATATTATTTTACATAAATTCAGTTTGCAAACTATTTTAACCTAAAAATTAATATTAGTCATCTTTGTAAGAAACTCAAAATTTATCAGTAAACTTAATTAAATTTGGTTAAATGATAGTTAGTTTAATTAGTTCAGTCCTGGTTCCTCGTCAGTTCAATCTAAGAATATAATGTTTAATTCATTCTGAGAGTCAAAGTCCACTTCTCAATGTAATGAATCTTTTAGATGAGTACAAGCAAGTTGTAAATTTCATGAGTATATACAGTTTGTCAAAGAAACTATTTACACGCCGTGAAATAAGTTGAATTTTTCACTTTAAAGGTCAAAGGAATTAAAGGGTTATTTCTTTAATTAAACACAATTTTTAATGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAAACGATTCAAAATATCAAATATACAAGAAATTAAACAACAAATTCCAAGTTTACACACTTTTGAGAGTGGCAAGAAACTCCTTACATTTTGTTTCCCTGCTTTGTTTTGCTCTTTTTTCTTAGAAGACAAGACTCGATTTTTCCGTTATTTTTTGGCATTTGCATTCCTTTTACAACGCTTCTATTGAAATTTTTTTACTTTGCTTGTGAAATTTTTGATCGAATGAGTTATTAAATTTAATAAAATGCCTGAAACCGAATTAACTTTGAAGTGACCCAAATAATATACTAAAACCACCAGTTGGAAAATCTATTCAAATTAGTATAAAATGTTTTCTGTATCCCGTAAAGACCGTCTACAATGTTTTTAATCGCTTGAAAGAGACACAGACCTAAGAGTGGTGGGCACCAAAACTAAAATTAGCAAGCGTGTAGACCGCCTTATTATGCGAAAAGTGATTGCGAACCCCCGAATCTCGGTCAGATCCTTGCTCAGGATATCAGGCAAGAATGTGACCTAGTTGTGCCACAAAACTGTGCGCCAAGTCATTCTACGCCATAGGTACTCTTCAAGGTTACAGAAAAAAAGCCTTTTGCTATCAGAGGTCAATATAGAAAGCGTCATTCATTCGCTGTGAAGCATGATGGATCATGCGGAAGAGTACTGGAGATGACGTAATATTTTGTGAACTAGAAAACAAAAATGATGCTCTAATATAACGATGGGCCAAGCAGAGTATGGCGCAAGCTGTTGAGTGCGCTAGAAAAAAGCAAAATATCATTCCAACAATCAAATTTGGAAAATTATCAGTGATGATTTGGGGCTGTATCTCAAGCCATGGAGTGGAGCAAATTAGCCTTTATTGAAAGCACTATGAATGCCGTGCAATATCTAGATATTTAAAATCAAATTTGAGAGGCCAGTGCAGAAAAATTTGGTCTATTTAACAACAACAAGCCAAATTTTAAGTTTTATCAGGACAATGATCCCCAAACATGAGGTGCAATGTACGCAACTGGCTCCTTTATAGCACTGTGGCAAAGGTGGTCGATACGCCCCCTCAGAGTCTTGATCCTGAACCCCCATTGAAAATTTGTGGGCCCTACTTAAAGAAGAATGTGGCAAAGGGGCACCAAAACACGACAACAGCTCATGGCTGCGATAGAGAGTGGGAAAAGATCAACTTGAATATGACCCTAAAAAAACTCATCCATTCCATGAAAAAGCTTCAACTTGTAGCCAAAGCCAATGGAGTCATACTAAATACTACAACTTTTTTCAAATTTTAACAAAATAATTTAAAAATTTAAGTTAAACTTAGGTTTAGTGTTTTTGTGTAAAGAGTTCTTAGAAACTCTCAAAGTCATTTAAACTTGGAATTCGTTGTTTATTTTCTTGTATATTTTGATATTTTTGAATTTGTTTTTTTTTAATTTATAAGTAAAATAAATATTGTTTAATTATATTTCTAAAAAAATTGCACGTTTAATTAAGCAAATAGCCATGAAAATTTTGACCGTTAAAAATCAAAAGAAATTCATCTTATTTCACGGTATTAATAAACAGTTTCTTGACAAACTGTACTTGTCGCAGATTTTATTTTAATTTCAGTTAACGACCGTTTTTTTCTGTTACTTTGTGTCCACTGTAAGAGTGATCACCCGAGTATAAAGTGATTCAGATCCAAACATCAGAAGTGGGACCGCCTACTCAACTTCCTGTGGTTTCATTGTGTCATAAGATCATTTGTGTTTTAGCTGTTCTTTATTTGATCCAATTTGAGGAACAGGGAAGGTCCGCTCCATTCGAGAATTAATTCGTCAATCCTCTTATGATCTACATACAAAGGTTTTCTTAGCCCTAAGTCGAGAACTAGCCTTTGCCAAGGCATAGCCTGCAGCGCAACGGCTTGCTTATATGCGTATCTTATATATATGTATATATATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAGAGTGAAATAGGCACACATATAAGCGATCAGCAGCAGCCAGCGGAGAACTGCTGACCAGGCAATTATGTTAGCCCTCAGAGTGGGTGCTCGTATTACGTATACGCGAATGGCTGGACTGTTTATGTACACACATTTGCAACAGAGTGCTACAATTATGAATACACATGGGTACGGTGCTTGAAACCGATATGTTGTGCATACTGCAATGAGTGAAAACAATTTGCTGACAATTCTGGGAGTCGCAGAATCGCCATTTTCTGAACTGTTAAAGAAGTGCAAAACTCACAAAGGGCGAAACAGGCTGTAAATGCCCAAAGTTTAATCAGACGCACGGGCTTGAACGCTCAATCCTGCACCAGTGCGGAGACAAAGTCTACATCGCGTGAAGACGGACGTCTTAAATTGCACATGACGCGAAATACTCGAAACCATAGAAGTTGTGTCGGCCCGGTGTGTGCGGCAAACTGGCAAATCACACGGTGGAGTCGCGCCATAGTTCTGCGCTGCAATCGCGCGAGTTAATTGTGCGCCTGTTTCCTTGTAAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGACGCAAGCAACTGATAGCGCATGAGCGATCTGGAGAGGAGGCGTTGCCAGTCAACCGTGTAATGATCAGTGTTGCATTGATAGAGGGCGCGAAATTCAAAATTAAATTTAAAATTAAGCCGTTGAAATTTAATTTAATTTAAATTTTGATTCTGGTAGCTTCTAGGGCGCACAGTCTTTAAGAAAGGGGAAAAAGGCGCAAAGGTCGCGGACGAGACCAAATATCATCTCACCCGTGCTGGTGCCCTGAAAGCAGAGGCTCTGGTGTCCGAGTCGAGGCGGGGTACAAACCTCCATCCGTAAGAAGCCGATCCGTGGCCTGCGTGACCTAAGGTAACCTTAGGCCATCCTTCCAGTTGATGGACAGCACGGTGAGGGGCAGTCCCTGATCACGGCAGGCGACAGGAAGAATACGACTTAGGAATCCCCACCACCAGAGGAGTCGGTAACCCGACCGCGGTGACGAATCCTCGGTCCGCCGTCGGTGGCAAAGGGGTGAGCACGCACTGAGCCCCCAGCCGCCGTTGACTATCGACTGCAGCGTGCCTGTAGAGGTGGAGAAATTGGCTCCTACAGCATCTACGACCGCGACAAAGTCAGAAGACGATGGACCACATCGCCGTGCCATCGCAAAGACGGGAGGAAGTCCCCAGCTTGTTCCCCTCATCGGTCTTCGGACTTGACCGCTGCTCTCAGAACGAGGACCTGAGGGGCATACTTACCAGGATGAATGGCAAGATCAGCCCCTTCTATCCCGCATTTCGAGACCCAACGACACACGCAGAGACAAAGGCGCAAGCACAGAACTCTCAGCCCTTAACAACAGAGACTGATAGAAGAGCTGTACGAAGGTACTACTGTGACACCGCTTGAAGAGCAGCGCTACCCAGACGGAGGAGGTACAAAAGCCTACCAAAAGGCTCACAAAATGCGCAGGTACCCACGGTGCAGGTGCCAAAGTCAGGCTTGCCGAAGCAGAGCAACCCTACGTTGGATGGCAGCGGTGAAGAAAGGCGACATCCATACCTAACGAGGTCCAAGCCAGGCGCTATGCATCTGTCGCCAAGAATGCTAGCACGGGTGCAGAGGCATATCGTAAAGACAGGAGAGGGCTTCGTACGCAGAGATGCTTCGGAAGCTAAGATCGGAATCGACGCCTTGAACTGGGCAGTCCGTGCGAAAAATCCGGAGGAAAAAGAACGCAGAGAAAGGTGATCTGTGCTTGGTAGAGGGAAAGCTGGAAAGCGTTCCCAAGTTTAAGAGCGACCTGGAAGCGGCGCGCTCAATGGCTTGGCCTCTGTGCGCACAGGAGCCCCGCAAAGGGCATCTATCTTGCAGCGGATTGGACGAGGCTACGACAGCGGAAGGCTCCACGGCTGGCGGTCGCCCAATTCAGGGCCTGCAGATAAATCCTGAAGATATCAGGGGCCTTCGCAGTATGCGGAATTGCAAAATAAATAGCCTCAGTGCTTACTGAATTGCGAACGTTGCGATACCAGTCCTTAAACAGGGCACACCGCAATCGTTGGATGGTCAAGATGTCGTATCACCAGGACGTCAGAGCCCGGATGCTACAGGTGTCTCGGCTATGGGCATCGATCAATAACCTGCAAGAGTTACTGACAGAACGGTTGCTGTCTTAGATGCGGTGAGCGTGGGCACAAAGGCAAAGGGGTGCGTTGCTGCACCGTGCCTGATCTGCAGCAGCGATTGGACCAAAAGCTCACCGACGAATTTAGCTTTGCGTGCCCGACACAGAGCGACACTAAAAAAGTGCCAGAGCCACGCCAATGCACGCTCGCCAGTAGCGTAGTACGGCTCAATGTCAATCATTTGCGCAGCAGCTCAGAACCTCCTGGCCCAGACTGCGGTTGAGCGCAATGTAGACATCATGCTCCCCTCGCGAACCTACGTCTCTGGTAGTGGACAATCGTCCATGATCCTTGACGAGGCAGGTAAAGCGGCTATCAAATGCTGCAGCGAAAGCTCTCTCCCAAGTCCGGAACGAAACCTTTACCCATGCAAGGTATCGCTTGTCTGAAGTTAAAACACGTGCGCATGTGCAGCTGCTACCTCCGCCGAGCGGCACCCCGATCAGTTCGAGGAGCTGGAGGCGCTCGTGGACCAATGCGAGAGGGCAGAAGCGAAAGGTCGTACCGGCGACTTTAATGCCTGGACGGTGGAATGGGGCAACCAGGACATCCAACACCAGAGGACGAGCTGTGATTGACGCCATGCGAATGCTGGACCTCATACTGCTGAACGATGGACGGAAGCCGACGTTTAACAACGATAGAGGGTACGTCCTTTATTGACGTTACCTTTGTCAGCGGGGCTAGTAGACAACAACAACTGGATGGTCCTTGACGTCATGACGCTGAGAGCGACCATGCCTGATCTCCTTCTCCCCGGAGAACATGCCCAAAAAGACGGCAGAGTAGAACAGCCGGAAAACATGGGACACCAGGAAGATCGATGGGCCATGCTGGCAATATCCAGATCAATTCCCGCAAATCCCAAATGTGGACGCAGAGGTATGGCGGCAGGCCTCATAGATATGCTGGGAAGAATCTGCGACGCAATCATGCCAAGGAAAAATAAGGCGCAGCGCAAACCACCCGTTTACTGGTGGAGTGCCTCCCTAAATAACTACGGTCTGGTGCCTCCGGTTCCACAAGAGAACGGCGCAACAGGCAGAGGAGGCAATTACCCACACCACGCGGAACTCTTGGAAACTTTCAGAAACAAACGCCTAGAGTTCAAGCACGGCATCGCTTGCTTCCAAAGCGCGGTCGTTTAAGAGGCTACTGGGGATGGCGTGAGCAGCGATATCTGGGGCCTCGCCGCTTGTTACCAACGTGAGCTGGGGAGGAGGACGGCAACCCCATCCGACCAGAGGGGTCCTGGCCCCTACAACATACTAGGAGCTATTTCCAAAGCAGACCACTATGGAGGCCAACAGAGGCAGCCCCTGCCCCCAGCAGATTTCCCGTGCGTCACAGAACTTGGAAGTCGTCGAGGCAGCTGTTTCGCTGACGATGTGGCAATCACAGCCGGGCTAGCAATAGCGGCTCACAAGACCGAAGAAGCAGTCCTACTAAGCAGCAGGAGAAAAGATGGAGAGCATGCTGAGTCTCCGTCAAAGGGTACTCAGGGACCTCTCAAGAGTCCTAAAGTACCTACTGGGGGTAATGATAGATCGCAATTTATCGTTCCAAAGGACCACTGCGAGCTACGCCAGCAGAAGACAGCAGTCATCCTCTTCGTTGGCGGGAGGCTTATACTTAACGTCGGAGGCCCCAAGACACCCGGCCAGAGAGCTGCTGGTGTGTCAGTAGCAAAAGCCTTCGCTGCTATACGCGCTGCACCAGTCTGGAGCAGCTACCACTTACTAGAGTCTCACCTGAAAGGAGCTCGTTCAGTGCTACGGTCAATGGCCTCAGGCTCATTAGAGGATTCAGGACCACATATCCGAAGACGGCGCGCTGGCGCTACAGCTTGGGCCTGCCAGTTGATCTGGAGATCAAGGCTCTCAGCCTTATGCGGAGTGGCGCTTCCAGGCAAAGAGAGGCACACAGTGGCTATTGGGTGAATGGCAGGCAGATGGCAAACCCCGCGTCGCGACGGGGGGGAGGTACGGACCTATCGGCTCATCCCAGAGATGACGGTTTGGGCAGTGACACTCTCAAGTGTGTAGAAGCTTGGAATTTGTTATTTATTTTCTTGTATGTTGATATTTTGAATTTGTTTTTTAATTTATAGTGAAATAATGTTGTTTGAAATATATTTCTAAAATTGCATTTTTTTAGTGGCAAATAGCCATGGTATTTTGACCGTTAAAATCAAAATTCATCTTATTTCACGGTGTGTAAACGGACGACTGACAGAAGCCATACTTGTCGCAGATTTATTTTTTAATTTCAAGGTTAACGACCGTTTTCTGTTGCTGTGTCCGCTGTAGAAGTGATGCCGAGTATAAAGTGATTCCAGATCCGACATCAGAAGTGGGACCGCCTGCTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTGTGTTTTGGCTGTTCTTTATTTGATCCAATTTGAGGAACAGGGAAGGTCCCTCCATTCGAAATTAATTCGTCAATCCTCTTATGATCTACATACAAAAGGTTTCTTAGCCTAAGTCGAGGAGCAGCGCTGCCGGCATAGCCTGCAACGCAGCAACACTATGCGTATCTTATATATGTATATATATGTACTGTCGCCGAACGATGGTGCTGGAGGAGGTGGTATATAGGCACACATATAAGCGATCAGCCTTGACAGCGGAACTGCTGACCAGGCAATTATGTATGTTAGCCCTCAAGTGGGTGCTCGTACAAATGCGTATACACTTGTGCTGGACTGTTTATGTACACATTTGCAACAGAGTGCTACAATTATGAATACACATAGGTACAGTGCTTAACCGATATGTGTGCATGCTACAATAGTGAAAACAATTTTGCTGACAATTCTAGAGTCACCAGAATCATGCATTTTCCTGAACTGTGCAAAGGGGTGCAAAACTCACGAAGACCAAAAGAAATGCTGTCGTATTGCCAAAGTTTAATCTGAACGCACGGGCTTAGACACTCAATCCTGGTGCGGAGACCAAGTCTACATCGCGCCGTGAAGACGGACTCTTCAAATTACGCGGCATGGAAATGCCTCGAAACCATAGAGTTGTCGGCCGGTGGTGTGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCATAGTTCTGCGCTGCAATCACGCGAGTTAATTGTGCGCCTGTTTTCATGCTCAAATAGGTAATTTATTATCTTTACGATTGTTGCAACGGATAAACAGCAATGTACGCAGCGGGCGATCTGGAGAGAGGGAGGCGTTGCCAGATCAACCGTGATCAGTGTTGTGTTGCGACAGTAGGGCGCCGAAATTCAAAATTAAAATTTAAAATTAAAATAGGTAATTTGTTCGAATTTAATTTGATTCTGGTAACTGGGGCGCACAAGTCTTTAAGAAGGGAGAAAAGGCACAAGATTCGCGGACAGACCAAATATCATCCTCTCACCGTGCTGGTGCCTAAGCAGCAGAGAGCTCTGGTGTCGAGTCGAGCCGAGTACAAACCTCCATCCGTAAAAGCCAGGGGAAATCCGTGGCCTGCGTGACCTAGGTAACGCCAGGCCATCCCTTCAGTTGATGGACAGCGCAATTGGGGAGCCAGTCCCCACAGTCGCAACGACCCGTTCGGGAGGAGCTCCCGACTTTCAGATCCCCACCAGAGGAGTCGGTAACCCGACCCGTAGTGACGGAATCTCGGTCCCGTCGGTAGCAAAGGGGTGAGCACGCAGGCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGAGGTGGAGAAATTGGCTCCTACAGCATCTACGACCGCGACAAGTCAAGAGACGATGGACCACACATCGCCGTGCCATCATAAAGACGGGAGAAGTCCCCAGCTGGTTCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCAGAACGGACCTGAGGAGCATACTTACCGGGATGAATGGCAAAGATCAGCCCCTTCTATCCGCATTCGAGACCCAACGACACACATGAGAGACAAAGGGCATAGCTACCGAACTCTCAGCCCTTAACGACTGGGGCGATAGGCTGTACGAAGGTACTACTAGCGACACCGCTTGAAGAGCAGCATACCCAGACGGAGTACAAAGCCTACCAAAAGGCTCCACAAAATGTAATTTACCCACGGTGCAGGTGCCAGTCCAGGCGCCGAAGCGAGCAACCCTACGTTGGATGGCAGCAGTGAAGAAAAGGCGACATCAATACTAACGAGTCCAAGCCAGGCAGCTATGCATCTGTCGCCAGAATGCTAGCACGGGTGCAGAGCACTCATCGTAAAAGACAGGAGAGGCTTCGTACGCAGAGATGCTTCCGGAAGCTAAAGATCCGGAATCGAGCCTTAGCGAACACAAAGACGTCACGTGCGAAAAATCCGAAGAACGCAGAAGGTGATCTGTTGCTTGAGGGTAGAGAGCTGGAAAGCGTTCCCAAGTTTAGAAACGACCTGGAAGCGGCGCTCAATGACAACCTCTGTGCGCACAGGAGCACAAGAATAGCTCATCTTGCAGCGGATTGGACGAGGCTACGACAGCAGAAAGCTCCACAGCTGCTTGGTCGCCCAATTCCAGGGCCTGGAATAAATCCTATGAAGATATCAGGGGCCTTCGCAGTATGCGGGAATTGCAAACAAATAGCCTCAGTGCTGCTGAACGCGAACGTTGCGATACCAGTCTTAAAACAGGGCACCATAATCGTTGGATGGTCAGAGATGTCGTATCGCAGGACGTCCATTCACGAGGATGCTACGGAGTGTCTCGGCTATGAGCTCGATCAGCAACCTGCAAAAGGACACTGACGGGGCAGACTGCTGTCTTAGATGCGGTGAGCGTGGGCACAAGGCAAAGGGGTGCGTTGCCTGCTTGCACCAAAATGCCTGATCTGCAGCAGCGGGGTGGACAGAAACCACCCGACGGGCGCTTTGCGTGCCCGACTTACAGAGCGACACTAAAGATGCCAAGAGCCACCTTAATGCACGCTCATATTAGCGTGAGTACAGCTCAGTGTCAATCATTGCGCAGCAGCTCAAACCTCTGGCCCAGACTGCGGTTGAGCGCAATGTAGACATCATGCTCCTAGCGAACCTACGTCTCTGATACAGTGGACAATCGTCCATGATCCTTGACGAGCAGGTAAAAGCAGCTATCAAATGCTGCAGCTCTCTCCCAAAGTCCAGGAACTGGCTGCTTTACCCATGCGAGGGTATGTCGCTTATGCGAAGTTAAAACACGATACATGTACAGCTGCTACGCTCCGCCGGCGACTGATCAGTTCAGGCTTCTGGAGGCGCTCGTGGACCATCACGGAGGGCGAAGCCCGAAGGTCATTACCGGCGACTTTAATGCCTGGACGGTGGAATGGGGCAGCGGGACATCAACACCGGAAGGACGAGCTGTGATTGACGCCATGCAGTGCCTGGACCACTCATACTGCTGAACGATGGACGGAAGCCGACGTTTAACAACGATAGGTACGTCGCTTTATTGACGTTACAGCACAGCAGAGGGCTGGTAGACAACAACAACTGGATGGTCCATGACGTCATGACGCTGAGCGACCATGCCCACGATCTCCTTCTCCCGGAGGCAATGCCCAAAGACGGCAGAGTAGAACGGCCAGGAAAACTTCTGGGACACCAGGAAGATCGATGAGGCCATGCTGGCTATCGGTCGAATTCACCGGAAATCCCAAATGTGGACGCAGAAAGTATGGCGGCGGGCCTCATGAATATGCTGGGAAGGAGATGCGACGCAATCGTAAGGAAAAAATAAAGGGGCACCAGCGCAAACCACCCGTTTTACTGGTGGAGTGCACTCTAAACCAACTACGGTCTGTTGCCTCGGGGCTAAGAGAACGGCGCAACGGAAACCAGAAGCGAGTACCCACCACGCGGAACTCTTGGAGGGCTTTCAGAAACAAACGCCGGTTCAAGCGCGCAGCATGCTGGCTGCGAAACTTGATCGTTTAGGAGCTGGGATGGCGTAGACAGCGATATCTGGGGCCTCGCCTACAAAGCATTTACCAGCAATGGGAGGAGAGCGGCAACCCCATCCGGCCAGGGTCTAGCTAGCACCTACTAGAGGGAGCTATTTCCAAAACAGACCACACTATGGAGGCCAACAGGGAAGGCAGCCTACCCCAGATTTGCCGTGCGTCACAGAACTTGGAAGTCGTCGAGGCAGCTGTTTCGCTGACGATGTGGCAATCACAGCCGGGCTAGTAGCGGCTCACAAGACCGAAGCAGTCCTGCTAAGCGGCGGGGAAAAGATGGAGGGGTATGCTGGTCTCCGTCCAAGGGGTACTCAGGGGACCTCTCAGAGTCCTAAAGTACCTGGGGGTAATGATAGATCGCAGACTATCGTTCAAAAGGACCACGCGAGCTACGCCAGCAAGAAGACAGCAGTCATCCTCTTCGTTGGCGAGGCTTATGCCCAACGTCGGAGGCCCAGACACCAGCCAGGAAACTGCGCTGGTGTCAGTAGCAAAACGCTGCTATACGCTGCACCAGTCTGGAGCAATGCACCACTTGCAGGGTCTCGCATACCTGAAGCCAAAAGCTCCACGTTCAGCAATACATGGCGGG
->4988adec-ffe1-49b3-ae56-520e3b961fa2
-TTGTTGTACTTCGTTCAGTTACGTATTGCTACAAAACTGTGCGCCAAGTCATTCTACGCCATAGGTACTCTTCAAAGAGTTGCAAGAAAAAAGCCTTTGCTATCAGGGGTCAATATAGAAAAGCGTCATTCATTCGCTGTAGGCATGATGGATCATGCGGAAGAGTACTGGGATGACGTAATATTTTTGTGACAGAAACAAAATGATGCTCTATTATAACGATGGGCCAAGCGAGTATGGCGCAAGCTGTTGATGCGCTAGAAAAACAAAATATCATTCCAACAATCAAATTTGGAAAATTATCAGTGATGATTTGGGGCTGTATCTCAAACCATGGAGTGGGCAAATTAGCCTTTATTGAAAGCACTATGAATGCCGTGCAATATCTAGATATTTTAAAATCAAATTTGAAGGCCAGTGCAGAAAAAATTTGGTCTATTTAGCAACAACAAGCCAAATTTTAAGTTTTATCAGGACAATGATCCCAAACATAAAGAGTGCAATGTACGGCTCCTTTATAACTGTGGCAAGGTGATCGATACGCCCCCTCAGAGTCTTGATCTGAACCCCATTGAAAATTTGTGGAGCCCCTACTTAAAGAAGAATGTGGCAAAAGGGGCACCAAAACACGACAACAGCTCATGGCTGCGATAGAGTGGGAAAAGATCCTTGAATATGACCCTAAAAAAACTCATCCATTCCATGAAAAAAAAAGCTTCAACTTGTATGCAAAGCCAATGGGGGTCATACTAAATGCTACAACTTTTCAAATTTTAACAAAATAATTTAAAAATTTAGAAGTTAAACTTAGGTTAGTGTTTTTTGTGTAAAGAGTTTCTTGAAACTCTCAAAAGTCATTTAAACTTGGAATTCGTTGTTTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTAATTTATAAGTGGAAATAAATATTGTTTAATTATATTTCCTAAAAAAAAAAATTGCGTTTAATTAAGCAAATAACCCATGAATTTTGACCGTTAAAATCAAAAAATTCATCTTATTTCACGGTGTGTAAACAGTTTCTTGACAAACTGTACTTGTCCTTAGATTGTTGCAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTAGAGAGTGATGCGAGTATAAAGTGATTCAGATCCGACATCAAGTGGGATGACCGCCTACTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTGTGTTTAGCTGTGCTATTTGATCCAATTTGAGGAACAGGAAGGTCCCTTTCCATTCGAAATTGATTCGTCCAATCCTCTTATGATCTACATACAAGGTTTCTTAGCCTAAGTCGAGGAGCAGCGCTGCGGCATATAGCCTGCAGCGCAGCAACGCTTATATGCGTATCTTATATATATGTATATATATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAGAAGTGGTATAGGCACACATATAAGCGATCAGCGCTTGGCCGGAGAACTACTGACCAGGCAATTGTAATATATTAGCCCTCAAGTGGGTGCTCGTATTACGTATACACACTTGTGCTGGACTGTTTATGTACACATTGCAACAGAGTGCGCACAATTATGAATACACATAGGTACAGTGCTTAACCGATATGTGTGCATACTACAATAGTGAAACAATTTGCTGACAATTCACAGAGTCGCCAGAATCGCCATTTTCTGAACTGTTAAAGAAATTGCAAAACTCACAAAGAGACCAAAAACTCAATGCTGTCGTATTGCCGAAGTTTGTCCTGAACGCACAGGCTTAGACCTCAATCCTGGTGCGGAGACCAAGTCATCGCCATGAAAGAGACGGACGTCTTAAATTACGCGGCGCGAAATACTCGAAACCATAGAAGTTGTGTCGGCCGGTGGTATTGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCATAGTTCTGCGCTGCAATCACGCGAGTTAATTGTGCGCCTGTTTCGCTCTAAATAGGTAATTTATTATCTTGCGATTGTTGCAGCAGGATAAACGGCTGATAGCGCAGCGAACTGATCAGAGAGGAGGCGTTGCCAGATCAACCGTGTGATCAGTGTTGTGTTGCGACAGTGGGGCGCAATTCAAATTAAATTTAAATTAAGCCGTTGAAATTTAGTTTAATTTAATTTTGATTCTGTGGTAACTGGGAGCGCACAAGTCTTTAAGAAAGGGGAAAAGGCACAAAAGGTCATGGCGGACAGACCAAATATCATCCTCTCACCGTGCTGGTGCCTAAGCAGAGCTCTGAACTGTCCAGTCGAGCGGGTACAAACCTCCATCCGTAAAAGCCAGGGGAAATCCGTAGCCTACGTGACCTGGTAACCTTAGGCCATCCTTCAGTTGATGGACAGCGCAGTGGGGGGCAGTCCCACAGTCGCAACGGCCGTTCGGGAGGAGCTCCCGACTTTCGAGATTTACCAGAGGAGTCGGTAACCCGACCCATGGTGACGGAATCTCGGTCCCGTCAGTGGCAGGGGTGAGCACGCAGGCCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGAGGTGGAGAAATTGGCTCCTACAGCATCTACGGCCGCGACAAGTCGAAGACGATAGACCACATCGCCGTGCCATCGCAAAAGACGGGAGGAAGTCCCCAGCTTGTTCCCCTCATCCGGTCTTCGGACTTGACCACTGCTCTCCAGAACGAAAGGACCTGAGGGCATACTTACCAGGATGAATGGCAAGATCCAGCCCCCCTTCTATCGCATTCGAGACCCAACGTGACACACTTGAGACAAAGGGCATAGCTTCCGAACTCTCAGCCCTTAACAACAGGGCGATAGAGCTGTACGAAGGTACTACTAGCGAGCACCAGCGAAGAGCAGCGCTGCAGACGGAGGTACAAAAGCCTACCAAAAGGCTCCACAAAATGCGCAGGTACCCACGGTGCAGGTGCCAAAGTCAGGCGCCGAAGCAGAGCAACCCTACGTTGGATGGCAGCGGTGAAGGAAAAGGCGACATCCATACCTAGCAGGTCCAAGCCAGACGGCTATGCATCTGTCGCCAGAATGCTAGCACGGGTGCAGAGGCACTCATCGTAAAAGGAACCGGGAGGCTTCGTACGCAGAGATGCTTCGGAAGCTAAGATCGGAATCGAGCCTTAGCGAACTGGGCGATCACGTGCGAAAAAATCCGGAGAACGCAGAAAGGGTGATCTGTTGCTTGAGGTGGGAAGCTTCCGGAAAGCGTTCCCAAGTTTAAGAGCGACCTGGAAGCGGCGCTCAATGACTTACAACCTCTGTGCGCACAGGAGCGCAAGAGGTAGCTCTATCTTGCAGCGGATTGGACGAGGCTACGACAGCAGAAGCTCCACAGCTGCTTGGTCGCCCAATTCAGGGCCTGCAGATAAATCCTGAAGATATCCGGGGTATGCGTATGCGGGTGCAAACAAATAACCTCAGTGCTGCTGGCGAACGCGAACGTTGCGATACCAGTCCTTAAACGGGGCACCATAATCGTTGGATGGTCAAGATGTCGTATTATCACCCAGGACGTCCGACCCGAGATGCTACGGAGTGTCTCGGCTATGGGCATCGATCAGCGGCACTGCGGAACACTGACAGAAGACTGCTGTCTTAGATGCGGTGGTGGGCACAAGGCAAAGGGTGCGTTGCTGCACCAAATGCCTGATCTGCAGCAGCGAGGTGGACAGAAACCACCGACGGGTGACTTACAGAGCGACACTAAAAGATGCCAAAGAAGAGCCACCTTAATGCACGCTCGCCAATGGCGTAGTACAGCTCAATGTCAATCTGTTGCGCAGCAGCTCAGAGCCTCCTGGCCCAGACTGCGGTTGAGAGCGCAATGTGGGCATCATGCTCCTAAGCGAACCCTACGTCTCTGGTAGTGGACAATCGTCCATGATCCTTGACGAGGCAGGTAAAGCAGCTATCAAATGCTGCAGCTCTCTCCAAGTCAGGAACTGGCTGCTTTTACCCATGCGGGGTATCGCTTATGCGAAGTTAAAACACCTGCGATGCACATGTACAGCTGCTACGCTCCGCCGAGCGACACCCCCGATCAGTTCGAGGGAGCTTCTGGAACGCTCGTGGACCATGCGAGAGGCGAAGCCCAGAGTCGTACGGCGACTTTAATGCCTGGACAGTGGAATGGGGCAGCGGGACATCAACACCAGAGGACGAGCTGTGATTGACGCCATGCGAATGCTGGACCTCATACTGCTGAACGATGGACGGAAGCGGCGTTTAACAACGATAGGGGTACGTCCTTTATTGACGATTACCTTGTCTTGAGAGGGCTAGTAGACAACAACAACTGGATGGTCCATATGACGTCATGACGCTGACGACCATGCCCTGATCTCCTTCTCTCCCGGAGGCATGCCCAAAAGACGGCAGAGTAGAACAGCCGGGAAAACATGGGACACCAGGAAGATCGATGAGGCCATGCTGGCCTATCAGATCAATTCCTGGAAATCCCAAATGTGGACCTGAGAGTGGCAGGCCTCATGAATATGCTGGAAGAATCTGCGACGCAATCATGCCAAGGAAAAATAAGGCACAGCGCAAACCACCCGTTTACTGGTGGAGTGCCTCTAAACCAACTACGGTCTGATTGCCTCCAGGGCTAAAGAGAACGGCACCAGCTGAGCCAGAGGCGGTACCACCACGCGGAACTCTTGGGAGGCTTTCGAAGCAAACGCCTAGAGTTCAAGCACGGCATCGCGGCTGCCAGCGCGGTCGTTTAAGGAGCTGCAGGATGGCGTAGACAGCGATATCTGGGGCCTCGCCACAAGCTTGTTACCAACGAGCTAGGAGGAGAGCGGCAACCCCATCCGACCCGGGGTCCTGGCTAACATACTAGGGGAGCTATTTCCAAGCAGACCACACTATGGAGGCCAACAGAGGCAGCCGCTGAATTTCCCGTGCGTCACAGAACTTGAAGTCGTCGAGGCAGCTGTTTCGCTGACGATGTGGCAATCACAGCCGGGCTGGCGGCAGTCCTACTAAGCAGCAGGAAAAGATGGAGAACATGCTGGTCTCCGTCAAGGGTACTCAGGGGACCTCTCTCAAGAGTTCAGTACCTGGGGGGGTAATGATAGATCGCAGACTATCGTTCAAGGACCACGCGAGCTACGCCAGCAAGACAGTCACATCCTCTTCGTTGGCGGGAGAAACATGCCCAACGTCGGAGGCCAGACACCCGGCCAGGAAGCTGCTGGTGTCAGTAGCAAGGCTTCGCTGCTATACGCTGCACCAGTCTGGAGCAATGCCACTTGCAGGGTCTCATACCTGAAAGAGCTCGTTCGGTGCTACGGTCAATGGCCCTCAGGCTCATTAGAGGATTCAGGACCATATCCGGGCGAACGCTAGCGCTGGCAGGCCTGCCGATTGATCTGGAGATCAAGGCTCTCAGCCTTATGCAGGTGGCGCTTCCAGGCAAGAACACGAGTGGCTATTAGGTGAATGGCAGAGCAGATGGCAAACGTCGCGACGGGGGGAGAGTGGACCCTATCAGCTCATCCCAGAGATGACGGTTTGGGCAGAGTGACACTCTCAAAGTGTGTAAACTTGGAATTTGTTATTTTCTTGTATATTTGATATTTTAGTTGTTTTAATTTGCAAGTAAAATAAATATTGTTTGAATTATATTTCCTAAAATTGCGTTTAATTAAGCAAATAACCCTTAATTTTGACCGTTAAAATCAAAAATTCATCTTATTTCACGGTGTGTAAACGGTTTCTTGACAAACTGTGTACTTGTCGCAGATTTATTTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTAGAGTGATGCGAGTATAAAATTGATTCAGATCCGACATCAGAAGTGGGACCGCCTACTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTGTGTTTTAGCTGTTCTTTGTTGATCCAATTTGAGGAACAGGGAGAGGTCCATTTCGAAATTAATTCGTCAATCCTCTTATGATCTACATACAAGGTTTCTTAGCCCTAAGTCGAGAACGCGCTGCCAGCGCAGCCTGCAGCGCAGCAACGCTTATATATTATCTTATATATATGTATATATATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAGAAGTGGTATAGAGCACACATATAAGCGATCAGCGCTTGGCCAGCAGGAGAACTGCTGACCAGGCAATTATGTATGTTAGCCCTCAAGTGGGTGCTCGTATTACGTATACACTTGTGCTGGACTGTTTATGTACACATTGTGAGTGCTACAATTATGAATACACATAGGTACAGTGCTTAACCGATATGTGTGCATACCACAATAGTGAAAACAATTGCTGACAATTCTAGAGTCGCAGAATCGCCATTTTCTGAACTGTTAAAGTGCAAAACTCACAAAGAGACCCAAAAAAACTCAATGCTGTCATTATTGCCAAAGGTTTAATCCTGAACGCACAGGCTTAGACACTCAATCCTGGTGCGGAGACCAGTCTACATCGCCGTGAAGACGGACGCGTCTTAAATTACGCGGCGCGAAATGCTCAAGGAAACCATAGAAGTTGTGTGTCGGCCGGTGTGTGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCATAGTTCTGCGCTGCAATCACGCGAGTTAATTGTGCGCCTGTTTCATGTAAATGGGTAATTTATTATCTTGCGGTTGTTGCAGCGGATAAACAGCTGATAGCGCAGCGGGCGATCTGGAGAGGAGGCGTTGCCAAGATCAACCGTGTGATCAGTGTTGTGTTGCGACAGTAGGGCGCGAAATTCAAAATTAAATTTAAAATTAAGCCGTTGAAATTTAATTTAATTTAATTCTGATTCTGGTAACTGGGGCGCACAAGTCTTTTAAGAAGGGAAAAGGCACAAAAGGTCGCGGACAGACCAAAATATCATCTCACCGTGCTGGTGCCTAAGCAGAGCTCTGGTGTCGAGTCGAGCGGTACAAACCTCCATCCGTAAAGCCGGGGAAATCCGTGGCCTGCGTGACCCTAGGTAACCTTAGGCCATCCTTCAGTTGATGGACAGCGCAGTGGGGGGCGGCAGTCCCCTGATCGCAACGACCCGTTCAGGAGGCTCCCGACTTTCGAGATCCCCACCAGAGGTGGTAACCCGACCCATGGTGACGGAATCTCGGTCCCGTCGGTGGCAGGGGTGAGCACGCAGGCCCCAGCCGCCGTGGGCTATCGACTGCAGCGATGCTGTAGAGGTGGAGAAAATTGGCTCTACGGCATCTACGACCGCGACAAGTCAGAAGACGATGGACCACATCGCCGTGCCATCGCAAAGACGGGAGAAGTCCCCAGCTGGTTCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCAGAACGAGGACCTGAGGGGCATACTTACCAGGATGAATGGCAAGATCAGCCCCTTCTATCGCATTCGAGACCCAACGACACACATGAGACAAAAGGGCATAGCTTCCGAACTCTCAGCCCTTAACAACAGGGCGATAGAGCTGTGAAGGTACTACTAGCGAGCACCGCTTGAAGGTAGCGCTACCCGGACGGGTACAAGCCTACCAAAAGGCTCACAAAGTGCGCAGGTACCCACGTTGCAGGTGCCAAAGTCAGGCGCCGAAGCAGAGCAACCCTACGTTGGATGGCAACGGTGGAAGAAAAGGCGACATCGCCTAACGAGTCCAAGCCAGGCAGCTATGCATCTGTCGCCAAGATGCTTGCTTGCACGGGTGCAGAGGCGCTCATCGTAAAAAAAAGAAGACAGGAGGCTTCGTACGCAGAGATGCTTCGGAAGCTAAGATCGGAATCGAGCCTTAGCGAACTGGGCAGTCACGTGCGAAAAAATCCGGAGAACGCAGAAGGTGATCTGTTGCTTGAGGTGGGGAAAGCCGGAAAGCGTTCCCCAAGTTTAAGAGCGACCTGGAAGCGGCGCTCAATAACTTGGCCTCTGTGCGCACAGAAGGAGCGCAAAGAATAGCTCTATCTTGCAGCGGATTGGACGAGGCTACGACGGCAGAGCTCCACAGCTGCTTGGTCGCCCAATTCCAGGGCCTGCAGATAAATCCCTGAAGATATCAGGGGCCTTCGCGGTATGCGGAATTGCAAGCAAATAGCCTCAGTGCTGCTGAACGCGAACGTTGCGATACCAGTCCTTAAACAGGGCACCATAATCGTTGGATGGTCAAGATGTCGTATCACCCAGGACGTCCGACCCACGAGATGCTACAGGTGTCTCGGCTATAGGCATCGATCCTGCAAAAAGGACACTGACAGAACCCAGACTGCTGTCTTAGATGCGGTGAGCGTGGGCACAAGGCAAAGGTGCGTTGCTGCACCAAAATGCACCTGATCTGCAGCAGCGAGGTGGACAGAAACCACCCGACGGGTAGCTTTGCGTGCCGACTTACAAAACGACAAGCAATACGTAACT
->f1376a0a-4590-45ff-9d04-f0516d9b2137
-ATCACGGTATGCTTCGTTCAGTTACGTATTGCTAACATAAAATTTCTTTATTTTATATAAATGCAATACTAATATTTTTGTAACACCACCCCTTCATCAATAACTGCTTGAAGTCTTTTGGTATTGACCTTACACCAAGTTTGTTACAAAATTCTAATGTCAATTTGGATAAATCTCCGCTATTTCAATGATGGCTCCCTCGTTTTCTATTTTTATCAATAGTTCGTTGGTTTTAATAAAAGCCCAAACGTTTTCAATGATAATGGAGTCTGGGCTTTGGGGGGCCACGGAAAAGTCCCTGAATTAAAGATCGTTTAAAAATTTTGTTTGGTATCCTACCCTTATGGCATGGGCATTGTCCTGCTGAAGAAGTCCATTCAGTGGTTGGAAAAAGTCTATTTCCAGACGTAGTAAAAGCATGGTTGTTTAAGATGAAGGTATCCGTTCTGATTTAAAAGTACCTTCTATCAGTACAAGTCTCCGAATCCATAATAGGAAAGACATCTATTAAAACATGACTGTACTACACAAATCTATTGGTTGGCTGGGCTGCAAATGCTTTGATTATTTTCAAATGCATAAAATGCTTGCTGTATGACCTGGTACTGAAATGCAGACTCATCAGTCCATAAAATATCAGTAAACCAAAAGTCAAGGAAGCTTCTTAACATATTCAACGCAAATCGAAGACGTTTGTTTGTTGGTTGGTGTGATCTCAATCGTTTGCGAACAAAGTATGTCTTAAAATCAACTTCTTTTAGCCTGCGACGAATTGTAGAACTACTAACTTGTTTTATAATTATATTTTGATTCACAAGGCAATTTTTTTACCGGACTGGCACTAAGTTCTTCGCCACAGCTCCAAGTATTTGCCTGCATTGCCTTTTGGTCCAGCGCACGGAGTTTTCCGGCTTCGATCTTTTTTTTATTTTTTTAATGTGCCAGCTGTATCAAACTTTTTTTTATTAAGTATTATTAGACAGTTCTACGCAGAAATTTGATATATTTCCAGCTATTTTGGCCACCAGGTGTACCGGCACTAAACTAACAACAATACCAGCCCGAGGCCTCAACTGTTAACTCTTTTGTTTTTGGGCATTTTATTTAATAACTGTAATAGGAAAATGATTAAATCTAATTTTTATTCAATATAATTTAAATGTATTTAAAGCAAACAAACCGGCACTTGTCACTCTAAACCAATCACTGAAGAAGAGAATTGCGTTGTGAAAATAATTGTGATGCGACGAAACCGTGTGCAAATACTTCTGACAACTGATAAAGATCTCTTCATTGCCTCTTCCTTTGCGCGTAGAGACGGTTATTTTCAATTCTTCTTTCATCTGACTCTGCATAGGTTTAATTTGCAAAAGAAACAAAGTTTTTGCATTCACCTCCCCACTTGCTGCACAAGCAACTGTTTTGCTTTGACCCATGCACAAAATGCGCTTTGTGAAAATAATTTTGACCATGACTTTTGTATATCAGTTTGCTAATGATAAATGAATTAGCTGAGTATCAAAGTGTGTAGAAGAACTCCACGGTCGTCTTTATGTCCCCGACATCAAAGTTTTGTCATCTTCCCAAATACTCTGGAGCTACAAACGGCCTTGTTCTCCCTTTAGCCTCTTTGGATCAATTTTCTCTAAGCAGCTGTCAACAACAACGCAAAGGTCAGGTTCATCCTTCAATCCTGTATTTTCAGAAGGTCAATGTCGATACTCTCCCCTTTCAGAATTCCTTCTAAATTCTTCTCCAATTTACCGTAGAAATGTCTTTCATCTCCTCACCACTTTCTTCGTCGGTGAAATATCCCAATCGAAAGTTTACTAAATCCCGTTCAATTTCTTCGTTAGACAAACCTTTCACTTTCGGTGAAAATTATTATCACGAATGCCCAAGGTTGCTCACAAGCAACTTAGAAAGGTATTTACTTACTTATTGTTCACTGCTTACTAAGTTTGACTAAATCACTGTCTTGTTAACTCTTTGCTGTTTATACTTTAGGTTCTTTTTAAAGTATTATAAAAGTAAATTAATAATTCCAAAGTTGCCGAATATCGAAACAATAATTATTGATGCATGATGCTATTTATTGCAAATAATTCCATACAATTAATCTCCAAATGCGTTTTTTTGCTTTTTTTATATTTAGAGTAGACACATAAAAGCACCGTTATCATAAGAGAATCAGCAGATAAAAACAAAAGGCACACTTACAGTTAGCTCTGAAAACATAGAAATTGCTCACAAAGCAACGTTGGGTGCAGAAAGGGTTAAGTTGGTATCTTTCTACTATCAGTAGGCCAGTATGTAGGCTTGCCGGTTGAAAGTGTTGTTATGCTGTTGTTTACTATGCATTTGTACAGTTCGCTTCCCTTCGGAAGCTTTAGCATTGAAGTCACCTCCTACTACCTTCCATATTCCAAGGTTAGGATTTGCATGGTGTTTACAGTAACATTATCATGTTAAAGTAAATTATTTGTAAAGTTCAGACTGTTTTCTAATAGTTGCTCTATTCTCTCCAGTGATATTAATGTTTGTTTTACTTTATTTCCTGCAGCAATTTGGGCATAAGATTGATAATCGTTACTTTGTTGGGTATATGTTGGCTTGTTAGAGCGGAACAAACTTTGCTGGATTCCTAAATCATTTTTGCTCAGATCATTATTTCTATTTTTCTATTTTTTTGGACAGAGTTCTGATAAATTCTACACCTTTGTAGCTGGCAGTGTTCTTCGTAATAGTTAAGCACATTTTGCTGGTTGTTCTGTATTTTCGGGCAAATGTTGTTGCTTGGGTGTCGAGAAGGATTTTACTACAACGGTACGTTTTGAGGGTACAATATGATTTAGTATGTCCGAATTCCTGGCAGCTATAGCATTGAACGATTTCATTGTGGGGGGGCTCAATATTTTTTTATTTACATTATATATGTCTAGGTTTTTTGTTAGGCTCAATATCTACATAAAACATGTTCAGTGACGTTTTGGTCGCACGGCTTTTAATATTACTTATGTTTTCTAACAACATGACCTTTGACTCTTCATCGCGCAATTTCATCTAAATTTGTGGAAAAAATGCAAATTCTTAATAACAACTCTAAATGCTCTGTCTGTGTAAGCTAGTATGTGTGTTACCACACACAATCATTATTAAATGTTTTTGACTGAATTTCCAAATTAATACGCTTTTAGCCATTACTATACATGTCCATAACGTTGAGTCTTATAATAAAAAGTTCTCTCTTAATTTTAGTTTTAAGATAGGTTAGCTTTTCACTTATACCATTGACGTCAGAGAGAAAGATAGGTGGGGAGCTTAGCAAAATCAGTTGCACACTGTCTTCATTTACCATTTCGAGATCTTCGTTTTTTTGTTATGTTGTTTCCTGTTTTGTCGGGCAATCCGTCGCTTAAAGAGAGCGAAATTATTTGCGCTGGTGCTTGATGGTGTCAGGGAATCCTGTTTTCTTTGAACTTCGGGAGGGCTTGGTCTCTTTTTTGGATTTTATTTTACTCTCTGCCACTCAAAGCAGTTAAGGTCTTCGTCGGTGTCGCTCTGCTTGAGTATTAAAGAAGACAATGATTGTTGAGTGCTTGTGTCCGCACTTCGTGCCTCAGATATGATGACCAAAGCAAAGAGACACTAGAATAATTCTAATTTGATATGACGTTTGCAATAAACAGTTAACATTTTTTTATTTTATAAATTTTATTTTCTCGCCATTATTATTTTTATGAAATATTTTTCTCAGTGTAATGACTTCTTTTTCAGTTTTATATTCCAATTTGATATCTTAAACAGCGCTGTAATTTCATCATATTCTACGAAATTGGCCAAAACTCCCCAAATATGTATGTACATATGTAAATTCGTTACTGCGATCAGAATTGGTTCGGCCCGAAAATCGCCTTCTAGCACAACACACACACATATACGCGTTCTCGTCTTTTGTTTTTACTCACACAAGCAAGCAAATTCTATTTTTAGATTTCTTACGCTCAGCGTGGGCGAGCGGAAGGAAACAATTTGGCCGTCACCAAAGGTGGCTGCATGATGCAAACCAGTGTAAGCTGTTACGCATCTTATTATTCTAGTGTGTCTTTGATGCAGGCCATGTGACTTTTGCTTAAATATTAGTATACTTTCCAACACGCCACCTCAAAAGTAAAAGATTGCTGTGCTTTTATTACTCACGAGACTGTGCGTCCTTCTGACCCGAATAATTTTGATCCAGCATTCGTTTGCGAGGTGTTGGGAGACCCAGAAAACCCAACCAGATCAATTAAGACATATTATTTACATAAATTCAGTTTGCAAACTATTTTAACTAAAAATTAATAGTAGTCATCTTTGTAAGAAACTCAAAATTATCAGTAAACTTAATTAAATTTAGTTAAATGATAGTTAGTTTAGTTAGTTCAGTCGTTCCTCGTCAGTTCAATCTAAGAATATAATGTTTTAATTCATTCTAGAGTCAAAGTCCACTTCTCAATGTAATGAATCTTGCAGATGGTACCAGCAAGTTGTAAATTTGTAGATATACAGTTTGTCAAAGAAACTATTTACACGCCGTGAAATAAGTTGAATTTTTCACTTTAAAGGTCAAAATTAAGGGGTTATTTCTTTAATTAAACGCAATTTTAATAAATATAATTAAACAATATTTATTTTATAAATTAAAAAACAAATTCAAAATATCAAATATACAAGAAATTAAACAACAAATTCAAGTTTACACTTTTGAAATTGGCAAAACTCCTTACACATTTTGTTTTCCTACTTTGTTTTGCTCTTTTTCTTAGAACGAACTCGATTTTCCGTTATTTTGGCATTTGCATTCCTTTTTACAACGCCTATTGAAATTTTTTTTTACTTTGCTTGTGAAATTTTGCTGATCGAATGAGTTATTAAATTTAATAAAATGCCTGGAAATAGATTAGCTTTAGTGACCCAAATAATATACTAAAACCACCAGTTGGGAAAAATCTATTCAGAATTAGTATAAATGTTTTCTGTATCCCGTAAGATAGCGTCTACAATGTTTTAATCGCTTGAAAAAGAGAGAACAGGCTTGAACCTAAAGGTGTAATTGGGCATAAACCAAAATTGGCAACGAAGCATTAATGAACCGCCTTGTTATGCGAAAAGTGATTACGAACCCCCGAATCTCGGTCAGATCCTTGCTCGGGATATCAGGCTTGAGAATGTGACCCTAGTTGTGCCACACAAAACTGTGCGCAAGTCATTCTACGCCATAGGTACTTTCTTCAAGAGTTGCAGAAAAGCCTTTGCTTTATCGGAGGGTCCAGTATAGAAGAAGCGTCATTCATTTCGCTGTGAGCATGATGGATCATGCGGAAAGGTACTGGGATGACGTAATGTTACTATTAATGACAGAAAACAAAAATGATGCTCTAATATAACGATGGGCCAAGCAGAGTATGGCGCAAGCTGTTGAGTGCGCTAGAAAAACAAAATATCCATTCCAACAATCAAATTTGGAAAATTATCAGTGATGATTTGGGGCTGTATCTCAGAAGCCGTAGGTGGGCAAATTAGCCTTTATTGAAAGCACTATGAATGCCGTGCAATATCTAGATATTTTAAAATCAAATTTGAAGGCCAGTGCAGAAAAAAATTTGAGCCTATTTAGCAACAAAGCCAAATTTTTAGGTTTTATCAGGACAATGATCCCAAACATAAAGTTGCAATGTACGCATGACTGGCTCCTTTATAACTGGCAAGGTGATCGATACGCCCCCTCAGAGTCTTGATCTGAACCCCATTGGTGTGGGCCTACTTAAAGAAGAATGTGGCAAAAGGGGCACCAAAAACGACAACAGCTCATGGCTGCGATAGAGTGGGAAAGATCCCGCTTGAATATGACCTAAAAACTCATCCATTCCATGAAAAAAAAAGCTTTCAACTTGTAGCCAAAGCCAATGGGGTCATACTAAATACTGCAACTTTTCCAGAATTTTAGCAAAATGAATTTAGAAATTTGAAGTTAAACTTAGGTTTAGTGTTTGTGTAAAGAGTTTCTTGAAACTCTCAAAAGTGTTTAAACTTGGAATTCGTTGTTTATTTTCTTGTATTTGATATTTTGAATTTGTTTTAATTTATAAGTAAAATAAATATTGTTTCAATTATATTTCCTAAAAAAAAATTGCGTTTAATTAAACAAATAACCCTTAATTTTGACCGTTAAAATCAAAAATTCATCTTATTTCACGGTGTGTAAACGGTTTCTTGACAAACTGTACTTGTCATAGATTATTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGGCAGAGTGATGCCGGTATAAAATTGATTCAGATCCGACATCGAAGTGGGACCGCCTACTCCAACTTCCTGTGGTTTCATTGTGTCATAGATCATTTTGTGTTTTTTAGCTGTTCTTTATTTGATCCAATTTGAGAACAGGGAAGGTCCCGCTCCATTCAATTAATTCGTCCAGTCACTCTTATGATCTACATACAAGGTTTCTTAGCCTAAGTCGAGAACAGCGCGCAAAAGCGCCTGCAGCAGCAACGCTCTATGCGTATCTTATATATATGTATATATATATGTGTACTGTCGCCGAGCGATGGTGCTGGAGGAGGAGTGGTATAGGCACACATATAAGCGATCAGCGCTTGGCCAGCGGAACTGCTGACCAGGCAATTATGTATTAGCCCTCGGTGGGTGCTCGTATTACGTATACACTTGTGCTGGACTGTTTATGTACACATTGCAACGGGAGTGCTACAATTATGAATACACATAGGTACAGTGCTTAACCGATGTATTGTGCATGCTACAATAGTGAAAACAATTTGCTGACAATTCTAGAGTCGCAGAATCGCCATTTTCTGAACTGTTAAAGAAGTGCAAAACTCACAAAGAGACCCAAAACTCAATGCGTCGTATTGCCAAAGTTTAATCCTGAACGCACGGGCTTAGACACTCAATCCTGGTGCGGAACCAAGTCTACATCGCCGTGAAGACGGACGTCTTAAATTTACGCGGCGCGAAAGTACTCGAAACCATAGAGTTGTGTCGTGGCCGGTGTGTGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCGTAGTTCTGCGCTGCAATCACGCGAGTTAATTGTGCGCCTGTTTCATGTAAATAGGTAATTTATTATCTTGCGATTGTTTGCAGCGGATAAACAGCTGATGGCGCAGCGGGCGATCTGGAGAGGGAGGCGTTGCCAGATCAACCGTGTGATCAGTGTTGTGTTGCGACGGTAGGGCGCGAAATTCCAAATTAAATTTAAAATTAGCGTTGAAATTTAATTTTAATTTAATTTTGATTCTGGTAACTGGGGAGCGCACAGAGTCTTTAAGAAGGGGAAAAGGCACAAAGGTCGCGGACAGACCAAATATCATCCTCTCACCGTGCTGGTGCCTAAGCAGAGGCACAATTGTCCGGAAGTCGAGCGGTACAAACCTTACTCCATCCCGTAAAGAAGCCGGAAATCCGTGGCCTACGTGACCCTAGGTGACGCTTAGGCCATCCTTCAGTTGATGGACAGCGCAGTGGGGGGCAGTCCCCTGATCGCAACGACCCGTTCAGGAGAATCCCGACTTTCGAGATCCCCACCAGAGGAGTCGGTAACCCGACCCATGGTGATGGAATCCGGTCCCGTCGGTGGCAGGGGTGAGCACGCAGGCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAAGTGGAGAAAATTGGCTCCTACGGCATCTACGACCGCGACAAGTCAGAAGACGATGGACCACATCGCCGTGCCATCACCGCAAAGACGGGAGGAAGTCCCCGGCTTGTTCCCCTCATCGGTCTTCGGACTTGACCGCATACTCAGAACGGGACCACAGGGGCATACTTACCAGGATGAATGGCAAGATCAGCCCCTTCTATCCGCATTCGAGACCCAGCGGTACACACTTAGAGACAAAGGGCATAGCTTCCGAACTCTCTCAGCCCTTAACAACAGGGCGATAAGAGCTGTACAGAAGGTACTACTAGCGAGCACCGCTTGAAACAGCGCTACCCAGACGAGTGCAAAAGCCTACCAAAGGCTCCACAAAATGCGCAGGTACCCACGGTTGCGGGTGCCAAAGGGATCGAGCGCGCCGAAGCAGAGCAACCCCTACGTTGGATGGCAGCGGTGAAGAAAAGGCGACATCCATACCTAACGAGTCCAAGCCGGGCAGCTGTCATCTGTCGCCAAGAATGCTAGCACGGTGCAGGGCACTCATCGTAAAAAAGACAGGAGGCTTCGTACGCAGAGATGCTTCGGAAGCTAGGAATCGAGCCGCCAGCGAACTGGAGCGATCACGTGCGAAAAAATCCGGAGAACGCAGAAGGTGATCTGTTGCTTGAGGTGGGGGGAAAGCTTCGGAAGCGTTCCCAAGTTTAGAAGCGACCTGGAAGCGGCGCTCGGCTCTGGCCTCTGTGCGCACAGGGCGCAAGAATAGCTCTATCTTGCAGCCCGGATTGGACGAGGCTACGACAGCAGGAGAAGCTCCACAGCTGCTTGGTCGCCCAATTCCAGGGCCTGCAGATAAATCCTGAAGATATCGGGGCGCTTCGCAGTATGCGGAATTGCAAGCAAATAGCCTCAGTGCTGCTGAACGCGAACGTTGCGATACCAGTCCTTAAACAGGGCACCATAATCGTTGGATGGTCAGATGTCGTATCACCCAGGACGTCCGACCCACGAGATGCTACAGGGTGTCTCGGCTATGGGCATCGATCAGCAACCTGCAAAGGACACTGACAGGGCAGACTGCTGTCTTAGATGCGGTGAGCGTGGGCGCAAGGCAAAGGGGTGCGTTGTTGCTGCGCAAATGCCTGATCTGCAGCAGCGAGGTGGACAGAAACCACCCGACGGGTGGCTTTGCGTGCCCGACTTACTGGAAACGACACTAAAAGATGCCAGAGCCACCTTAATGCGCTCATATTAGCGTAGGTACAGCTCAATCGTCATTGCGCAGCAGCTCAAGAGCCTCCTGGCCCCAGACTGCGGTTTGAGCGCAATGGCATCATGCTCCCCTAAGCGAACCCTACGTCTCTGGTAGTGGACAATCGTCCATGATCCTTGACGAGGCAGGTAAAGCAGCTATCAAATGCTGCAGCTCTCTCAAGTCAGGAACTGGCTGCTTACCCATGCGGTATCGCTTATGCGAAGTTAAAACACGTGCACATGTACAGCTGCTACGCTCGCCGAGCACGACACCCCCGATCAGTTCGAGGGCTTCTGGAGGCGCTCGTGGACCATGCGAAGGGCGAAGCCCGAAGGTCGTACCGGCGACTTTAATGCCTGGACGGTGGAATGGGGCAGCAGGACATCAACACCAGAGGGACGAGCTGTGATTGACGCCATGCGAATGCTGGACCTCATACTGCTGAACGTGGACGGGGAAGCCGACGTTTAACAACAGTAGGTACGTCCTTTATTGACCCGTTACCTTTGTCAGCGGGGGGCTGGTGAACTTAACAGCAGCTGGATGGTCCATGACGTCCTTGACGCTGAGCGACCATGCCTGATCTCCCTTCTCCCGGGTATGCCCAAAGACGTAGAGTAGAACGGCCGGGAAAACATGGGACACCAGGAAGATCGATGAGGCCATGCGGCCTGTCAGATCAATTCCTGGAAATCCCAAATGTGGACGCAGAGGTATGGCGGCGGAGCCTCGCCAGATATGCTGGGGAAGAATCTGCAGCGCAAAATCATACCAAAAGGAAAAATAAGGCACAACGCAAATACCGTTTACTGGTGGAGTGCCTCCTAAACCAACTGCAGTCCTGATTGCCTCAGGGCTAAGAGAACAGCGCAACGAGCCAGGGCAGTACCACCACGCGGAACTCTTGGAGCTTTCGAAGCAAACGCCCTGCAGAGTTCAAGCATCCGCGGCTGCAAAGCGCGGTCGTTTAAGGGACTTCTGGGATGGCGTGAGCGATATCTGGGGCCTCGCCTACAAACTTGTTACCAACGAGCTAAGGAGAGCAGCAACCCATCCGACCGGGGTCCTGGCTAACATACTAGGGGAGCTATTTCCAAAACCAGACCACTATGGAGGCCAGCAGAGGCAGCCTGCCCCAGATTTCCCGTGCGTCCACAGAACTTCGGTCGTCAGGCAGCTGTTTCGCTGACGATGTAGCAATCACAGCCAGGAGCTGTAATGGCAGCTCACAAGACCAGAAGCAGTCCTACTAAGCAGCAGGAAAAAGATGGGTATGCTGGTCTCAAATCCAGGGTGCACTCGGGGACCTCTCAAGAGGTCCCCTAAAGGGGTGCCTGGGGTGTCGATAGATCACCAGACTATCGTTCAAGGGACCACGCGAGCTACGCCAGCAAGAAGACAGCAGTCACATCTCTTCGTTGGCAGGGCTTATGCTGGCGTCGAATTTAAGACACCCGGCCGGAAACTGCTGGTGTCATTAGCAAAGAGCTTCGCTGCTATACGCTGCACCAGTCTGGAACGATACCACTTGCGGGGTCTCATACCTGAAAGGCGGATTGATTGCTTTACGGTCGTAACCCTCGGGCTCATTAGAGGATTCAGACCATATCGAACGCGGCGCTAGCGCTGGCAGGCCACTGCCGATTGATCTGGAGATCAAGGCTCTCGGCAGCAATATGCGGGTGGCGCTTTTGAGCAAAGGCACGCGAGGTGGCTATTAGGTGAATGGCAGAGCAGATGGCAAACGTCGCGACGGGGGAGGTGGACCTATCGAGCTCATCAAGAGATGACAGTTTGGGCAGAGTGACACTCTCAAAGGGTATTAACCAAACTTGGAATTTGTTATTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTTTTTTTAATTTATAGAGTAAAATAAATATTGTTTAATTATATTTCCTAAAAAAAAATTGCGTTTAATTAAGCAAATAACCCTTAATTTTGACCGTTAAAATCAAAATTCATCTTATTTCACGGTGTGTAAACAGTTTCTTGACAAAACTATACTTGTCGCAGATTTATTTTAATTTCAAGTTAACGACCGTTTTTCTGTTACTTTGTGTCCCGCTGTAGAAATTGATGCCGGTATAAAGTGATTTCCAGTCCGACATCCAGAAGTGGGACCGCCTACTCCAACTTCCTGTAGTTTCGTGTGTCATAGATCATTTGTGTTTTAGCTGTTCTTTATTTGATCCAATTTGAGGAACAGGGAAGGTCCCGCTCCATTCGAAATTAATTCGTCAATCCTCTTATGATCTACATACAAAAGGTTTCTTAGCTAAGTCGAGGAGCAGCATGCCGGCATAGCCTGCAACGTAACGCTTATATGCACC
->a0766d31-4a6b-442c-838a-5f43a3f6354a
-TGGTAGCTAGCTTCGTTCAGTTACGGTATTGCTCTTTAATATTATAAAATATGGTTTTATATATGATAAATACATCATTACCAGACTCAGTCAAACAGCATTAAACGTCAAAGGAAATTTAGCAGGTGCCAGTATTTTGCTCTCAAATGCAATTTCATTTTAATCATGACATTGTCAGGGTTCAGTAGCCTCTTCGAATCCAAACTGGTGTTTGGGTATGATAACGAATTCTTCCAAGTTGACAGCATTCTCTTTAAAATTATTTTTTAAATGCTTTAGAAAATGCTTGACAACAAGCTAATGGGACGGTACAATGTCACTTCATTTCTCTTGTTTGGTTTAAGGTTCCTATAATTTCTGCACATTTCCATTGTGGGAAGTGGTCGCTCTATACGCCCATTTTTTTCAAGGCTATTACCATCTGTTTTGTCCCAATCTAGACCTTTTTACTTTTAGCCATTTCTGAGTAGAGCTTCATTAATGCCGCAGTTTTACGAATGGGTAAGCTCATTTGGCGGTATCGAAAGTTATCTACTTCCCTTTCTGTTTGCGGGTTATCAATATCGTTTGGCTGAAATACAGAGTGCAGGTGTTAAAGCAAATGCTTGGCAATTTCATCATCAGATCTACGCCATTCGCCATTAGAGTTTCGGACTACTGTGTTTCTTTTGCAGGTCCTTGAGATATTTGGATTTACTCTCCATAAATTATGTTCAACGGATTTCAAGAATGTGGATCTAGATTTCCTAAGATATTCAGCGAGAGATTAATTTTCTTAAAGTTGACAGTAGTTTTCTGCGATCGGATGCAGCCTTGTTATACGATCTTTGTCGGCAGGGTAGAGTTTCTTGCCATCTCTTCGATTCTCTTGTGTTGTATTTGTTGTCGGATTTCAGCTAGAGATAGAGGCCAGTTTGATTGTGAGTTTTCTGGCTGGTGGCTTCATTGCATATATAGCTTGCTTTATGGATATTGTTGTGAGTAGCTCCACGGTAGCTCTCCTCTCCTGATTTTAGCGAGATATCCAGGCTGATAGCTGTTTCAGACTAACTTTTAAATGCATTGATATCTGCTTGTTTGCAATATGAGCTACTATGTCCACTAGCAATAGAATGATCTGAGCTTAGATCCAAAACTTTCCATTATTCATTAATGAGGATTCTGATTCAAAGTATGCTGAGAATCTTTAACCCTTTCGCACCAACTTTACCCGGTAATTTGTTTTTATCATTAATGTTTTTACATTGTTTAGAAAAGAATTGCTTAAAATTTGCAGTAATACCCACGCCCATTAGTTTGGGCGGTAGCAAAGAAAGTTTTCTTGTAGGCAACGTCAGGCGGTAATTGATGTGAAAGCATTGTTTTTTATAATCTGGAATATGAAATATTTTTCTTTATAATGACAATTTAAATGTATTGGTATGACAAAAGACCAGTTTTTATTGTTATTTGCAGCACAGATGGACTTTGCACGCCATGGGCATTTAATAGGTCTGTCAGTGTTTACAATTTTGCCTGATCTGCAACGTCCTCTTTCTCCAAAACTGCAATGTTCAAGCATCATACGTACAATTACCCTATTTGCAAAGATTCCTATTTCCTTCAACGTCGGGAAGGATTACAGACGTAAACCAATTACAAAATACAGTTTAAAGAGTGCACGTGTTTTGGGAAATTTCTGCCAAATATAAGACAACATGAATGATACAAGCCATAAGGAAGGAGATGCCTTCTCAACATATAGCAAAATCTATAGCTAATCAGATATTCCAGCCAGCGTAAACATTTTAAGACCCCATTTATGAGGAGTTTGGATTATATTACCCTAAAGCGTGGATCGACCACCAACAAAGCAATTATTAAATAAAACTAATTTAAAGAAAATTAAAACAACCTTTAAGATACAATTGTTGCTCATCGACACTTGATGCTCTTCTGCGATGGATTTTCCAAAATTTTCTTTGAGAATTCTGGAAACAAAGGGCGGATCTTGTAGAGTTTATCATAGTTTCAATCCTTTTAATTGTTGTTTGGCGTTGTCGTTGAAATGTAAAGCATTGTTTTATTTTTTAAATCTCCCACGCAGCATTGAATCAGTTATTGCGGTAATCTTTACAAATGCTGTCCGCCATTTCTGAATTGCCGTAGTTTAAACCCAAAATTACAATAAAATGCCAATGTAGCGTTTGATTCCCTCATCAGTACATTTAAGTTCAATACCGTGCTCCTACAGGCAACTATATACAGAATTGGTCAAAAGTATTTTCACAACACTGTATTTGCAAACTTCAACTTCTTTTGTTATATTTCTTCTTGTTGTTGTCCGATTTGCCGGAAATAGTTCTTATCGGCAGCTTGATCCAATACGCAGAAGGTAGTCAGAAAAGAAATGAAGATAGCAGTTCATAGTATAAAGCTTAACCAAAAGAAAATATGCATACCAAGGATTGTCCAATGAATATTTTCACATGTTTATTGCACTTCAAAAGTAATTTTCACTCAACAATTTAGTAAATTTCAATAACATCTAATTTCAACATAAGAATTTCTTCTTGCTCTCAGTAATACTAATATTTTAGCAACACCACCTTGTGGCATCAATAACTGCTTGAAGTCTTTTAGTATGACCTTACCAAAGTTTGTACAAATTCTAATGTCAAATTTGGACCAAATCTCCGCTATTTTCAATGATGGCTCCTCTCGTTTCTATTTTATCAATAGTTCGTTGGTTTTAATAAAAGCCCAAATTGTTTTCAATGATATTAAGGTCTGCTGGGCTTTTGGGGGCCACGGAAGAACCGCCAGATTAAGGTCGTTTAAAATTTTGTTGGTATCTATACCCTTATGGCATGGAGCATTGTCATATGAAGAATCCTAATTCAGTGGTTGGAAAGAAGTCTATTTCCAGACAATAAAGCATGGTTGTTTAAGATAAAGGTATCGATTCTGATTTAAATTACCTTCTATCTCAGTACCAAGTCTCCGAATCCATAATGTGAAGACATCCCAAAACGCCTTGATATGCCCCACCAATCTATTGGATTTGGCTTTGGAATGCCAAATGCTTTGATGATTATTTTTCAAATGCATAAAATGCTTGCTGTATGACCCCTGTGGTACTGAAATGCAGACTCATCAGTCCATAAAATAATGAAATATGTAAAAAGTCAAGAGGAGAAAACAACAACATATTCCAGCACGCAAAGTCAGAGACGTTTTGTTTTGTTGGTTGAATTGATCCTCAATCGTTTTGCAATTAAGTGATATGTCTTAAAATCGGCTTCTTTTTAGCCTGCGACCGGTGTAAGGAACTACTAACTTGTTTGCCAATTGTATTTTTGATTCTACAAGGCCAATTTTTTACTTAGTTGCTTTTCGGATTCTTCGCCACAACTCCAAGTGTTGCCTGCATTGCCTTTGGTCCAGCACGGGTTTTCGGCTGATCTTTTTATTTTAATGTACAGCTATGAACTTTTTATTAAGTGGTAGACAGTTCTGCGCGAAATTGATATATTTCCTTCTTTTGGCCGCAGGTGTACTTAGGCTTTAAACCTAGCAGCAATGCAGCGAGGCCTCTCAGCTGTTAACTCTTTTGTTTTGGGCATTTTGTTTGTAACTGTAATGGGAAAATGATTAAATCTAATTTTATTCAATAATTTAAATGTATTTTAAACAGCAAACCACCGGCCTTGTCACTCTAAACCAATCACTGAAATTGCGTTGTGAAAATGGTGTACGGCAAACCGTGTGCAAATGCTTCTGACAACTGATAAAAGATCTCTTCATTTGCCTCTTCCCTTGCGCATAGGAACAGTTATTTTCAATTCTTCACTGTCGACTCTGCATAGGTTTGGTGCAAAAGCAAAGTTTTTGCATTTCACCTCCCCACTTGCTGCAAGCAACTGTTTTATGACCCATGCACAAAAGAAATGCACTTTGTGAAAATAATTTTGACCATGACTGTATATCAGTTTGCCTAGCCATTAAATGAATTAGCTGAGTATCAAAAGGTGTGTAGAAGAACTCCTGCGGTCGTCTTTATGTCCCCGACGTCAAAAGTTTGTCATCTTCCCAAATACTCTCTGGAGCTACAAACGGCTTGTTCTCCACTTTAGCCTCTTTGGATCAATTTTCTCTAAACAACTGTCAACAACAACGCAAAGAGTCAGTTCCATCCTTCAATCACTGCCTATTTTCCAGAAGGTCAAATGTCGATGCCTGCCCTTTCAAGAATTCCTTCGAATTCTTCTCAGTACCAATAGGAAATGTCTTTCATCTCCTCTCACCCACTTTACTGCATCAGGTGAAATATATCCCAATCGAGTTTTAAATCCCGGTTGAACTACGTTAGACAAACCTTTTCCTTTCAGTGAAGATTATCACAGATGCCCAAGGTTGCTCACACAAGCAACTTAGAAAAATTATTACTTACTTATTATTCTACTCTTACTAAGTTTGATAAATCACTGTCTTACATTATCTTTGCTGTTTATACTTTAGGTTCTTTTTAAAGTATTATAAAAGTAAAATTAATAATTCAAGAAGTTGCACCGAACTCTCAGAACAATAATTGTGAAAATTACGCGTGCCTATTTGTACAAATAATTCACCTGATTAATCTCAAATGCGTTTTACTTTTATATTTGATGAACACATAAAGCACCGTTATCGCAAAGAATCAGCAGATAAAAACAAAGGCACACTTACAGTTAGCTCTGAAAACATAGAGAGTATGCAAGCAACGTTGGGTGCGAAAGGGTTAAGTTTGAGTATCTTTCTACTACTATCAGTAGGCCAGTATGTAGGCTTGCCCGGTTGAAAGTGTTGTTGTGCTGTTGTTTTACTATGCATTTGTACAGTTCCTTCCCTTCAGGAAACAGCAGTGATCACCCTCCTACTACGCTTCCATATATTCCCAGGTTAGGATTTACTTGCCATAATTTGTTTTACAGTAACATTATCATATTAAATGTAAATTATTTGTAAAAGTTCGAACTGTTTTCCTAATAGTTGCTCCTATTCCTCTCCAGTGATGTGTTTGTTTTGCTGTTCACTTAAAACGAATTTTGGGGCATAAGATTGATAATCATTTACTTTTGTTGGAATTGTCATTGCGACGGCCAGGCGGAACAAACTTTTCAGTTCTCGTCATTTTTTTACTCAGATCATTATTTCTATTTTTCTATTTTTTGGACAGAGTTCTAGTAAATTCCACCTTTGTAGCTGGCGTGTTCTTCGTAACCAGTTGGCACTTTGCTGGTTGTTGTTCTGTATTTTCGGGCAAATGTTGCTTGGGTGGTGTCGAGAAGGATTTTAACTGGTACGTTTTGGTACAATATGATTTAGTATGTCCAGAATTCTAGCGGCTATAGCATTGAACGATTTCATTGTCTAAGGAGGCTCAATATTTTATTTACATTATATATGTCTAGGTTTTTGTTGAGCTCAATATCCCATAAAACATGTTCAGTGACGTTTTGGTCCTTTTGGCTTTTAATATTACTTATGTTTCTAACAACGAAGCCATGCAGGCTCATCACTTTAATTTCATCTAAATTTGTGGAAAAATGCAAATTCATAATAAACTCTAAATGCTCTATCGTCAACCAAACTGGTATAATGTGGTACTGCACACAATCTGTTAATGATGTTTTGACTAATTTTCAGAATTCTTCAATACTTTTAACCATTCTCTTACATGTGTATAACGTTGAGTCTTATATACAAAAGTTCTCTCTTAATTTTAGTTTTTTAAGATAGGTTAGCTTTCCTTATACCATTGACGTCAGAGAAAGATAGGTGGGGGAGCTTATACGAAATCAGTTACTGTCTTCATTTACCATTTCAGAATCTTCTGTTTTTCTTTATATTTGTTTCCCCACCATATTTGTCCAAGACGATCCGTCATAGAAATGAAATTATTTGCGCTGGTGCTTGATGAATTGTCCAGAGGGGAATCCTGTTTTCTTTGAACTTCGGGAGGCTTGGTCTCTTTTTGGATTTTATTTTCTCTCTGCCATTTCCAAGCAGTTGGGTCTTCGTCAGTTGTCGGCTCTGAGTATTAGAGACAATGATTGTTGAGTGCTTGTGTCACTTCGTGCCTCAAGATATGATAGCAAAGGAGCACTGGGAATAATTCTAATTTGATATGACGTTTGCAATGAAGCAGTTAACATTTTTTATTTTATAAATTTTTATTTTTTTCTGCTTCCGTATTATTTTTATGTAAAATATTTTTTCTCAATTCTAAATGACTTCTTTTTCAGTTTTTATATTCCAATTTTGATATCTCCAAATGGCTTGCGCAATTTCATCATATTCTACAATTGCGTAAAGAGCTCCCCAAATATGTAACTGCATGTAAATTCGTTACTGCGATCAAATTGATTTCGGCCGAAAATCGCCTTCTAGCACAACACACACATATATATACGCGTTTCTCGTCTTTTGTTTTACTCCTTTGTAATGAAATTCTATTTTTAGATTTCTGCGCTCAGCGTGAGCGAAACGGAAAGAAATTTTGGCCGTCACCAAAAATTGGCTATAGTACCAAACCAGTGTATGGCTATTACGCATCTTTCTTATTCTAGTGTCTTTGATGCAGGCCAATAGCGAGCTTTTGCTTAAATGTGTACATGTACCAGCACGCCACCTCAAAAATTAAGATTACTGTACTTTTATACTCACAGAGACTGTGCGTCCTTCTGACGAATAATTTTGATCAAACATTCGTTTACACTTGTGGTGTTGGGGAGACCAAACCAGCAGATCAATTGAACATATTATTTACATAAATTCAGTTTTGCAAACTATTTTAACTAAAAATTAATATTAGTCATCTTTGCCAGAAATAAGAGTGTATCAGTAAACAATTAAATTTGGATTATAAATAGTAGTTAGTTCTGAATTTAGTTCAGTCTGGTTCCTCGTCAGTTCAAATAAGAATATAATGTTTTAATTCATTATTCCTGAGAATGAGTCCACTTCTCAATGTAATGAATCTTACCAGATGGTACCAGCAAGTTGTAAATTTGTAGATATATATACAGTTTGTCAAGAAACTATTTACACACCGTGAAATAAGTTGAATTTCACTTCTAAAGGTCAAATTAAGAGGTTTCTTCAATTCGCGCAATTTTTAATGGAGTATAATTAAACAATATTCTTTACTTATATAAATTAAAAACAAATTCAAAATATCCAAATATACAGAAATTAAACAACAAATTCAAGTTTTACACACTTTTGAGTGGCAGAAACTCCATACATTTTGTTTTCTCCTACTTTGTTTTGCTCTTTTTTCTTAAATTGAACTCAGTTTTCCGTTATTTTTGGCATTGCATTCCTTTTACAACGCTTCTCTTGAAATTTTTTTACACTTTGCTTGTGGAAATTTTGCTGATCGAATGAGTTAGTAAATTTAATAAATGCCTGGAAATAGATTAGCTTTTAAGTGAGCCCAAATAATATACTAAAACCACCAGTTGGGAAAATCTATTCCAGAATTGGTATAAATGTTTTCTGTATCCCCGTAAGACCGTCTACAAGTGTTTTAATCATCTGTGAAAAAGAGACAGGCTTGAACCTACAGGTGGTGGGCATAAAACTAAATTAGCAAGCGTGTAGACCGCCTTATTATGCGAAAAGTGATTGCGAACCCCAGATCTCGGTCGAGATCACTTGCTCAGGATATCGGGCAAGAGATGATGTGACTAGTTATTGCCACAAACTGTGCGCCAAGTGTTCTACGCCATGGAGCTCTTCAAAGAGTTTGCAAGAAAAAACCTTTTATCAGAAGAGGTCAGCTCTCTGAAAGCGTCATTTCATTCCTTTGTGGTATGATGGATCATGCGGAGAGTACTAGGATGACGTAATGTTTCCTGTGACGAAACAAAATGATGCTCTATTAATATAACGATGGGCCAAACAGGAGGTATGGCGCAAACTGTTGAATTACGCTAAGAAAAACAAAATATCATTCAACAATCAAATTTGGAAATTATCAGTGATGATTTGGGGCTATCAAACCATGGGTGGGCAAATTAGCCTTTATTGAAAGCACTATGAATGTAGTGCAATATCTAGTGTTTAAAATCAAATTTGAAGGTAGTGCAGAAAATTTGGTCTATTTAGCAACAACTCAAACCAAATTTTAAGTTTTATCGGGACAATGATCCCCAGAGCATAAAGAGTTGTGTGTACGCAATGACTCCTTTATAGCTGTGGCAAGGGTGATCGTGCGCCCCTCAGGTCTTGATCCCAGACCCCATTGAAATTTGTGACCCTGCTTAAAGAATGTGGCAAAGGGACTTAAAACGACAACAGCTCATGGCTGCGCGATAGAGTGGGAAAGATCCGCTTGAATATGACCTAAAACTGTCATTCCAGAAAAGCTTCAGCAGCCAGCCACAGAGCCAATGGGGTCATACTAAAATACTACAACTTTCAGAATTTTAACAAAATAATTTTAAAAGTTGGGATTAAAACTTTAGGTTTAAGTGTTTTTTACAGTGGCAAGAGTTTCTGAGAGCTCTCAAAGGAGTGTTTAAACTTGGAATTCGTTGTTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTTAATTTATAAGTAAAATAAATATTGTTTAATTATATTTCCTATAAAAAATTGCGTTAATTAAACAAATAACCCTTAATTTGACCGTTAAAATCAAAAATTCATCTTATTTCACGGTGTGTAAAACAGTTTCTTAATAAACTGTGCTTGTCGCAGATTTATTTTTAATTTCAAGAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTGAGTGATGCAGTATAAAGTGGTTCAGATCCGACATCAGAGGTGGGACCGCCTACTCCAACTTCCTGCTTAGTTTTCATTGTGTCGCCAGATCATTTGTGTTTTAACTGTTCTTTATTTTGATCAATTTGAGGAACAGGAGGTCCCGCTCGGCTCAATTAATTCGTCAATCTCTGCCGAATCTACATACAAAAGTTTCTTAGCCTAGTCGAGAACGCTGCCGGCATAGCCTGCAACGCAGCAACCTTATGCAATGTCTATATATATGCCTGCTCGCCATACTGTCTATGAAACGATGGTGCGGAGGAGGAACATAGGCACACATATATAAGCGATCAGCGCTTAGCCATGGGAGAACTGCTGACAGGCAATTATGGCGTTAACCCTCAAGTGGGTGCATCGTATTACGTATACCTTGTGCGGACTGTTATATTTTGACATTGCAGCAGAGTACACAATTATGAATACACATGGGTACAGGTCTTAACCGATATGTGCATACTACAATGGTAAAACAATTTGCTGACAATTCTAAGGTCCTTAGATCGCCATTTTTTCTGAACGCTGTTAAAGAGTGCAAAACTCACAAAGAGACCAAAAACTCAATGCTGTCATGTTGCCAAGTTTAATCCCTGAACGCACAGGCTTAGACACTCAATCCTGAATTGCGGAGACCAAGTCTACATCGCCGTGAAACGGACGTCTTAAATTACGCGGCGCAGTACTGAAACCATATAGAAGTTATTGTCGGCCGGTGTGTGCGACGAACTGGCAAATCACACGGTGAGTCGCGCCATAGTTCTGCGCTTTCTCCACGCGAAGTTAATTGTGCGCGCCTGTTTCATATGAAATAGGTAGTTGTTATCTTACGATTGTTGCCTTGGATAAACAGCTGATAGCGCGGCAGGCGATCCTGGAGAGGAGGCATTTGTAGATCAACCGTGTGATCAGTGTTGTGTTGCGACGGTAGGACGCGAAAATTCAAAAAATTAATTCATTAAGCCGTTGAAATTTAATTTAATTTGGTACGATTCTGGCAACTGGGAGCACTGATCTTCGAAAGGGAAAAACTGCCAAGGTCCTTGGACGGACAAATATCATCCTCTCACCGTGCAATTTGCCTAACAGAGCTCTGGTGTCCAAGTCGAGCCCAGTGACGCCTCCATCCGGCATCAAAGCCAGTCCGTGGCCCTGCGTGACCCTGGAGTAACCTTAGGCCATCCTTCGGTTGATGGACAGCGCAGTGGGGCGGTCCCTGGTCGCAACGACCCGTTCCAGGAGGCTCCCGACTTTCCGAGATCCCCACCAGAGGAGTCGGTAACCCGACCCGGTGACGGAATCTCAGTCCATCGGTGGCAAGGAATTTAGCCACGCGGGCCCCAGCCGCGTGACTATCGACTGCAGCGATGCTGTAGGGTGGAGAAAATTGGCTCCTACAGCATCTGACCCGCGACAAGTCAGAGACGATGGACCACATCGCCGTGCCATCCTGCCAAGACGGAGGAGATCCCCGGCTTGTTCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCTCCAGACGAGGGACCCTGGGGCGCCACTTTTCAGGATAGATGGCAAGATCAGCCCCTTCTATCGCATTCAGACCCAACGACACGCGAGACAAAGGGCACTTGGCCTACGACTCTCAGCCATAACAACAGGGCGATAGAGGCGCTGTACGAAGGTACTGCTTGAGCACCGGCTTGAGAACGGCGCTACCCAGACGGAGGTACAAGCCCACCACCAGGCTCCACAAAGATGCGCAGGTACCCACGGTGCAGGTGCCGTCCAGGCACCAGCAGAGCAACCCTACGATTCGGACCATGGCAGGTGAAGAAAAGGCGACATCACTTACTAACTGAGTCCAAATAGGCAACTACCATCTGTCGCCAAGAATGCTAGCACGGAGTGCAGAGGCACTCATCGGCGTAAAGAACAGGAGAGGCTTCGTACAGAGATGCTTCAGCGGAAGCTAAGATCGGGAATCGAGCCTTAGCAGACTGGAAGCGAATCACGTGCGAAAAATCAGAAGGTGATCTGTTGCTTGAGGTGGGGAAAGCGGGAAGCGTTCCCAAGTTTAAAACGACCTGGAAGCGGCTCGTGACTTAGCCTCTGTGCTGCTGGGAGCGCAAAGATAGCTCTATCTTGCAGCGGATTCTGGACGGGAAGACTGCGACGGCAGAGAAGCTCTACGGCTGGCAGTCACGCCCCAATTCCAGGGGCCTGCCAGATAAATCCTGAGATATCGGAGGCCTTCGCGGTATGCGGAATTGAAGCCAAATAGCCTCCAGTGCTGGGGCACGCGAACGTTGCGATACCGGTCTTAAACAGAGCTGTAATCGTTGGATGGTCAAAGTGTCGTATCTGCCCAGGACGTCCGACCCACGAGGATGCTACAGGTGTATAAAGCTATGGGCATCGATCAGCAACCTGCAAGGGACACTGACAGGGCAGATTTGCTGTCTTGGATACCGGTGGCAGGCGTGGGCACAAGGCAAAGGGGTGCGTTGCTGCACCCAAATGCCTGATCTGCAGCAGCGGGGTGGACAGAAACCACCCAGGTGGTGGCACGTGCTTGACTTACAGAGCGACACTAAAGATGCCAGAGCCGCCTTGGTACGCTCATATTGGCGTAGGCCTGGCTCAATGTCAATCATTGCCCAGCAGCTCAAACCTCCTGGCCCCAGACGGTTGAGCGCAATGTAGACATCATCTCCCTAAAGCGAACCCCCGTCTCTGGTGTGGACAATCGTCCATGATCCTTGACGAAGGCAGGTAGGCAGCCTATCAAATGCAGCTCTGCGATCCAGGGAACTGGCTGCTTACCCATACAGGGTATCACTTATGCGAAGTTAAAACGTGCATGTACAGCTGCTACGCTCCGCCGAGCGACCACCCCGATCAGTTCGAGGAGCTTCTGCGGAGGCACTCGTGGACCATGCAGGGAGGCAAGCCCGAAGGTCACATTATAGAAGCGACTTTAATGCCTGGACAGTGGAATGGGGCAGCAGGACATCCAACGCAGAGGACGGACTGTGATTGACGCCATGCCGGGCTGGACCTCAATACTGCTGAACGATGGACGGGAAACCGACGGTGTTAACAACGATAGAGAGTACGTCCCTTTATTGACGGTACCTTTATCCAGCGGAGAGGGAGCTGAAGGCAAAGACCCAACAACAACTGGATGGTCCATGACATCAGGCGCTGAGCGACCGGCCGCCCTGATCTCTTCTCCCCCGGAGGGCAGCCAAAAGACGGCAGAGTAGAACAGCCGGGAGAAACGGACCACCAGGAAGATCTGATGGGGCCATGCAATACTATCAGATCAATTCCTGGAAATCAAATATGGACGCAGAGGAAGCGGCAAGGCCCTCATGAATATGGGAGAATCTGCGACGCAATCATGCCAAGGAAAAATAGAGCTAGCGCAAACCACCCGTTTACTGGGTGATGCCTCAAGCCAACTACGGTCTGATTGCCTCAGAGCTGAAGGAACGGCGCAACAGACCGACGGTACCCACCACGCGGAACTCTTGGGCTTTCAGAAGCAAACTGGGGTTCAAGCACGGCATCGCGGCTGCCAAAGCGCGGTCGTTTGGGAGCTGCTGGGATGGCATGGACAGCGATATCTGGGGCCTCGCCACAAACTTACCAACGGGCTAAGGAGGGATCAGCCTACCCCAGATTTCCAGTACATCCACCAAAACTTGAAGTCGTCAAAGGCAGCTGTTTCGCTGACGATAACAGCAATCCTGGCCAGGCTATTAGCAGCTCAGACCGAAACAGTCCTACTAAACATGGAAAAAGATGGAGAACATGCAGGTCTCAATCAAGAATACTCGAGGACCTCAGTCCCTAAAGTACCTGGGAAGTAATGATAGTCGCAGACTATCGTTCAGGACCACGCGAGCTACGCCAACAAGAAGACATGATCATCCTCTTCACGTTGGCGAGGCTTATGCTAACGACATCGAAGCCCAAGACACCCGGCAAGAGCTGCACAGGTGTCAGTAGCAAAGAGCTTCGCTGCTATACGCTGCACCAGTCTGGAGCAATGCCATACAGGGTCTCGCTACCCTGAAAGGACTCGTTCAGTACTACGGTCAATGGCCTCAGGCTCATTAGAGATTCAGGACCCTTTACCTCAAGACGCAGCGCTAGCGCTTTAAAGGCCTGATTGATCCGGAGATCAAAGGGCTCTCAATGGCCTGTACGGGTAGCGCTTCCGGGCAAAAGAGGCACACAGTCTTCAATGGGTGAATGGCAGAGCAGATGGCAAACGTCGCGACGAAGGAGTGGACCTATCAGCTCATCCCAGAGATGGTTTGGGCAGGTGGCCTCTCAAAGTGTGTAAACTTGAATTTGTTATTTATTTTCTTGTATGTTGATATTTTGGCGTTGTTTTTTAATTTATAAGTAAAATAAATATTGTTTAATTATATTTCCTAAAAAATTGCCGTTTAATTAAATGACAATATAATTTTGACCGTTAAAATCAAATTCATCTTATTTCACGGTGTGTAAACAGTTTTCTTGACAAATTTCTTGTCACAGATTTATTTTTAATTTCAAGTTAACGACCGTTTTCTGTTGCTTTGTGTCCGCTGTAGAGTGATGCCGAGTATAAAGTGATTCAGATCCGACATCAGAAGTGGGACCGCCTGCTCCAACTTCCTGTGGTTTCATTGTATCATAGATCGTTGTGTTTATTGTTCTTCATTTGATCCAATTTGAGGGAACAGGGAAGGGTCCCGCTCCATTCGAAATTAATTCAATCCAGTCTCTATGATCTACCCTGGTTTCTTGGCCTAGGTCAGGAGCAGCTGCCAGCATAGCCTGCAGCGCAGCAACCTCTAATAAATATCTATATATATGTATATATATATCAATACTGTCGCCAGGCTTGATGGTGCTGGAGGAGAGTGGTATAGGCACACATATAAACGATCAGCGCTTGGCCAATAAGAACTGCCTGACCAGACGATTATATATTAGCCCTCCATTAGATTGCTCAACTATTACACGCTTATGCACCACTTGTACTGGACTGTTTATATACACATTTACAGCAAAGGGTCTGCAATTATGAATACACACATGGTACAATTGTAACGCGATATGTACCTACAATAATTGAGAAACAATTTGCTGACAATTCTAGGTCGCGAAATCGCCATTTTTGAATTATTAAAAGAAGTGCAAAACTCACCGAAAATGCAAAAACTCAATGCTCATTATTGCCAAGTTTCAAATACGAACACGAGCTTAGACACTCAATCCTGGTGCGGAGACAAGTCCATCCAAATAGAAGACGGACGTCTTAAATTACGCGGCGCAGAAATACTCGAAACCATAGAAGTTGTGTCAGCCGGTGTGTGTGACAAACTGGCAAAATCACACACACAGTGAGTCGCGCCATAGTTCTGCACTGCAATCACGCGAGTTAATTGTACGCCTGTTTCATCTAAAATAGGTAATTTATTATCTGCGATTGGCTTTGCAGCGGATAAACAGCTGATAGCACAACGAGCGATCTGGAGGAGAGGGAAATGACTGCCAAGATCAACCCGTGTGATCGAATGTTATTTGCGACAAAACCAAGGGCACCGAAATTCAAAATTAAATTTAAAATTAAGCCGTTGAAATTTAATTTAATTTAGTACAGTTCTGGTAACACAGAACGCACAGTCTTTAAGAAGGAAAAGGCACAAAGGTGTGGATGAATAAATATCATCCGCAAATGCTGGTACCTAAGCAAGGCTCTGGTATTCGAGTCGGGCGGTACAAATCTGTCCGTGAAGCCGGAAGTCAAGCGTACCGTGACCCTAGGTAACCGCGGGTATCGTACCGGTTGGGCCGATGGCGGCAATGGTGTTGATTGTTCTGCCACGCTATGCCGTGTGATGCCGTTGGTGGTTGGCAATTGATGCCCCGTTGTTATGCGTTACCTTGATGCGCTACGAACTGATGATACGTTGGTGATTACCCGCTGATGTTGTTGCTGTTGTTCTTGTTGTTGTAGCGTTGCTGATTGCCGTTTATTGCCGATTCGCCCGTTGTGGGCCGATTGATGTTGTTGTTATTTGGCGTGGTTTACTGCCATTGTAGCCCAGCGCCGTGCCGGCGTTGATTGACGTTGTTATGCCCGTTGATTTAATTCCCCGTGCCTTGTTCGTTACATTGATTATGAATTGCCGTTACCGCTTGTTCTTACGTTATGCCGTTGTGGCAGGCAGCGCTAACCAGCCGTTGTTCTGATTGTTAGCGATGTATTGTTCCAGCGCCTTTGTTCGCCGTTATTAGCCGTTGCCTGATGAGCGACGCCCAGCAACCCGTTAACCCAGCGTTAACCGCGTTAGCCAGCGTTAACCGCTGATGCGTTATTATGCTGGCGACATGGTGGACAGCGCCGGCACGACGCGTTTGGTTGGCGCTGGTGGACGGTCCCCTGGCGTTGAACGGGAGGGCTCTGGGCTTTCGGAGGTCCACGGAGGTCTGGTGGCTGCCGGGCCAGGTCTCAGTTCGAATGGTGTTGTGGCGAACGCGCTTGCTTGGTGGGCGACGACATTGCGGCTGACGCCTGCTCTGCATATATCGACATTCATTCTCGGTGATTGCCGGCGGAAAATTGATATTTTGG
->5d8de168-4d72-42bd-a85d-e104650eebbc
-TTGTTGTACTTCGTTTCGGTTACGTATTGCTCAGGGCTCCTCCTGAACGGGTCGTTGCGATCAGGGGACTGCCCCCCACTGCGCTGTCCATCAGCTGAAGGATGGCCTAAAGGTTACCTGGTCACGTAGGCCACGGATTTCCCCTGGCTTTTTTTTACGGATGGAGGTTTGTACCGCCTCGACTCGGACGCAGAGCCTCTGCTTAGGCACCAGCACGGTGAGAGGATGATATTTGGTCTGTCCGCGACAGCACATTGCCTTTTCCCTTTCTTAAAGACATGCGCTCCCAGTTACAGAATCAAAATTAAATTAAATTAAATTTCCAGCGGCAATTTTAGGAATTTAATTTTGAATTTCACCGCCCTACACAATGTAACACAACACTGATCACACGGTTGATCACAGCAGCACCTCCCTCTCAGATCGCGCCCGCTGCGCTATCAGCTGTTTATCCGCTGCAACAATCGCAAGATAATAAAATTACTATTTACATGAAACAGGCGCACAATTAACTCGCGTGATTGCAGCGCAGGAACTATGTACGACTCCACCGTGTGATTTTGCCAGTTTGCCGCACACACCGGCCGACACAGCTTCTATGGTTTCGAGTATTTCGCGCCGCGTAATTTAAAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCCGCACCAGGATTGAGTGTCTAAGCCTGTGCGTTCAGGATAAACTTTGGCTTGGCCCGGCAGCATTGAGTTTTGGGTCTCTTTGTGAGTTTGCACTTCTTTAACAGTTCAGAAAAATGGCGATTCTGCGACTCTAGAATTGTCAGCAAATTATTTTCACTATTGTAGTATGCACACATATCGGTTAAGCACTGTACCCATGTGTATTCATAGTAGCACTCTGTTGCAATGTGTACATAAACAGTCAGCACAAGTGTATACGTAATACGAGCACCACTTGAGGGGCTAACATACATAATTGCCTGGTCAGCAGTTCTCCCGCTGGCCAAAGCGCTGATCGCTTATTGATGCCTATACCCTCCTCCAGCACCGTAAACGGCGACGAGTACACATATATATATACATATATACCAAGATACGCATATAAGCGTTGCTGCGCTGCGAGCTATGCCGGCAACTGCTCCTCGGCTTTAGGCCTAGAAACCTTTGTATGTAGATCATAAGAGGATTGACGAATTAATTTCGAATGGGCGGGACCTTCCCTGTTCCTCAAATTGGATCAAATAAAGGTAGCTAAAACACAAATGATCACATGACACAATGAAACACAGGAAGTTGGAGTAGGCGGTCCCACTTCTGATGTCGGATCTGAATCACTTTATACTCAAGCATCTCTCTACAGCGAGACACAAAGTAACAGAAAACGGTCGTTAACGAAATTAGAAATAAATCTGCGACAGGTACCAGTTGTCCAAGAAACTGTTTACACACCGTGAAATAAGATGAATTTTTTGATTTTAACGCAGTCAAAGTAAGGGTTATTTAGCAATTAAACGCAATAATTTTTTTTTGAAATATAATTAAACAATATTTATTTTACTTATAGGGTGAAACAAATTCAAAATATCAAATATACAAGAAAATAAATAACAAATTCAAGTTTACACACTTTTAGAGTGTCACTCTGCCCAAACCGTCATCTCTGGGATGAGCTGATAGGTCCACCTCCCCGTCGCGACGTTTGCCATCTGCTCTGCCATTCACCTAATAGCCACTCATTATTGCCTCTTGCCTGGAAGCGCCACTCCGCATAAGGCTGAGCCTTCGATCTCCAGCAGATCAATCCCGGCAGGCCTGCCAGCGCTAGCGCGCCGCGTCTTCGGATATGGTCCTGAATCCTCTAATAATAATGACCTGAGGGCCATTGACCGTAGCACCGAACAGGCTCCTTTCAGGTATGAGACCCTGCAAGTGGCATTGCTCCAGACTGGTGCAGCGTATAGCGGCAAACCTTTGCTACTGACACCACCAACGGTTCCTGGCCAGGTGTCTTGGGCCTCCGACGTTGGGCATAAGCCTCGCCAACGAAGAGGATGTGACGCTGCTGTCTTCTTGCTGGCGTAGCTCGCGTGGTCCTTGAACGATAGTCTGCGATCTATCATTACCCCAGGTACTTTAGGGACTCTTGAGAGGTCCCCACAAGGTACACTTACTCCGAGCGGAGACCAGCATGTTCTCCATCTTTTTTTCCTGCTGCTTAGTAGGTTCAGCTTCGGTCTTGTGAGCCGCTATTTGCTTTAACCCGGCTGTGATTGCCACATCGTCAGCGAAACAGCTGCCTCGGCGACTTCAAGTTCTGTGACGCACACACGGGGAAATCTGGGGCGCAGGGGCTGCCTCTGTTGGCCTCCATAGTGTGGTCTGCTTTGGAAATAGCTAGTATGTTAGCCAGGACCCCGGGTCGGATGGGGTTACCGCTCTCCTCCTTGGCTCGTTGGTAACAAGCGTAGGCGAGGCCCCGATATCGCTGTCTACGCCATCCTGCGGCTCAGCAAACGACCGCGCTTTGGCAGCCGCGATGCCGTGCTTGAACTCTAGGCGTTTTGCTTCTGAAAGCCTCAAGAGTTCCGCGTGGTGGAGTACTGCCTCTGGCTCGTTGCGCCGTTCTCTTAGCCCTGAAGGGCAATCAGACCGTAGTTGGCTTAGGGGAGGCCTCCACCAGTAAACCGTTGGTTTTGCGCTTCCAATGCCTTATTTTTTTCCTTGGCATGATTGCGTCGCAGATTTGCTTCCCAGCATATTCGCGGGGCCTGCCGCCATTACTCTCTGCGTCCACATTTGGGATTTCCAGGGAATTGATCGATAGGCCAGCATGGCCTCATCGATCTTCCTGGTGTCCATGTTTTCCAGCTGTTCTACTCTGCCGTCTTTTGGGCAATGCCCTCCGGGGAGGAGATCGGGGCAGCATGGTCGCTCAGCAATCATGACGTCATGGACCATCCAGTTGTTGTTGTCTACTAGCCCTCTGCTGACAAAGGTAACGTCAATAAAGGGACGTACCCTATCGTTGTTAAACGTCGGCTTCCGTCCATCAGATTCCAGCTTGGTATGAGGGTCCAGCATTCGCATGGCGTCAATCACAGCTCGTCCTCTGGTGTTGGATGTCCTGCTGCCCCATTCCACTGTCAGGCATTAAAGTCGCCGGCAATGACCTTCGGGCTTCGCCCTCTCGCATGGTCCACAGCGGAAGGCGCCTCCAGAAGCTCTCGAACTGATCAGGGGTGTCGCTCGGCGGAGCGTAGCAGCTGTACATGTGCACGTGTTTTAGCTTCGCATAAGCGATACCCCGCATGGGTAAAGCAGCCAGTTCCTGGACTTGGGAGAGAGCTGCGGCATTTTGATAGCTGCTTTACCTGCCTCGTCAGGGATCATGGACGACGTTGTCCACTACAGAGACGTAGGGTTCGCTTAGAGGGCATGATGTCTACATTGCGCTCAACCGCAGTCTGGGCCAGGGCTCTGAGCTGCTGCGCAATGATTGACATTGAGCTGCTCACCTACGCTAATATGAGCGATGCATTAAGGTGGCTCTTGGCATCTTTAGTGTCGCTCTGTAAAGTCCGGGCACGCAAAGCTACCCGTCAGGTGGTTTCTGTCCCTCGCTGCTGCAGATCAGGCATTTTGGTGCAGCAACGCACCCCTTTTGCCTTGTGCCCACGCTCACCGCATCTAAGACAGCTTGGCCCAGTCTGCCCTGTCAGTGTCCTTGCGGGTTGCTGATCGATGCCCATAGCCGAGACACCTGTAGCATCTCGTGGGTCGGACGTCCTGGGTGATACGACATCTTGACCATCCAACGATTATGGTGCCCTGTTTAAGGACTGGTATCGCAACGTTCGCGTTCAGCAGCACTGAGGCTATTTAGCGCAATTCCGCATACTGCGAAGGCCCCTATTATCTTCAGGATTTATCTGCAGGCCCTGGAATTGGGCGACCAAGCTGTGGGCTTCTCTGCTGTCGTAGCCTCGTCAATCCGCTGCAAGATAGAGCTATTCTTTTGCGCTCCTGTGCGCACAGAGGCCAAGTCGTTGACGCCGCTTCCAGGTCGCTCTTAACTGGGAACGCTTTCCGAAGCTTTCCCCTCTACCTCAAACAACAGATCCGCCTTTCTGCGTTCTCCGGATTTTTCGCACGTGACTGCCCAGTTCGCTAAGGCTCGATTCCGATCTTAGCTTCCGAAGCATCCTGCGTGCAGAAGCCTCTCCTGTCTTTTTTTACGATGAGTGCCTCTGCACCCGATGCTAGCATTCTTGGCGACAGATGCATAGCTGCCTGGCTTGGACTCGTTAGGTATGGATGTCGCCTTTTCTTCACCGTTGCCATCAACGTAGGGTTGCTCTGCTTCGGCGCCTGGACTTTTGGCACCTGCACCGTGGGTACCTGCGCATTTTGTGGAAGGCCTTTTTTGGTAGGCTTTTGTACCTCCGTCTGGGTAGCGCTGCTCTTCAAGCGGTGCTCGCTAGTATACCTTCGTACAGCTCTATCGCCCTGTTGTTGGGGCTGAGAGTTCGGAAGCTATGCCTTGTCTCATGTGTGTCGTTGGGTCTCGAATGCGGATAGAAGGGGCTGATCGCCATTCATCCTGGTAGGAGTATGCCCCTCGGGTCCTCGTTTACGGAGAGCAGTGGTCAAGTCCGAAGACCGACAGGGGAACAAACTGGGGACTTCCCTCCCGTCTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCTGACTTGTCGCGGTCGTAGATGCTGTAGGGCCAATTTCTCCCACCTCTACAGCATCGCTGCAGTCGATAGTCAACGGCGGCTGGGGGGCCTGCGTGCTCACCCCTTGCCACCGACGGGACCGAGATTCCGTCACCATGGGTCGGGTTGCAGGCTCCTCTGGTGGGGGGATCTCCAGTCGAACTCCAGACGGGTCGTTGCGATCAGGACTGCTACTGCGCTGTCCATCAACTGAAGGATGGCCTAAGGTTACCTAGGTCACGTAGGCCACGGATTTCCCTGGCTTTACGGATGGAGGTTTGTACCGCCTCGACTCGGACACCAGAGCCTCTGCTTAGAGCACCAGCACGGTGAGAGGATGATATTTGGTCTGTCCGCGACCTTTGTGCCTTTCCCTTTCTTAAAGACTTGTGCGCTCCCAGTTACCAGAATCAATTAAATTAAATTAAATTTCAACGGCTTAATTTTAAATTTGTTTTGAATTTCAACGCCCTACTGTCGCAACACAACACTGATCACACGGTTGATCTGGCGAAAGCGCGCCTCCCTCTCCAGATCGCCCGCTTTGCGCTATCAGCTGTTTATCCGCTGCAACAATCGCAAGATAAATTACCTATTTACATGAAACAGGCGCACAATTAACTCGCGTGATTGCAGCGCGGAGACTATGGCGACTCCGCGGCGGGTTTTGCCCACGCCGCTTTACACCGACGACACAACTTCTATGGTTTCGAGTATTTCGCGCCGCGTAATTTAAAGCGTCCCGTCTTCACGGCGATGTAGACTTGGTCTCCGCACACCAGGATTGAGTGTCTAAGCCTGTGCGTTCAGGTTAAACTTTGGCAATACGACTGGCATTGAGGTTTTGGGTCTCTTTGTGAGTTTTGCACTTCTTTTAACAGTTCAGAAAAAAGTGGTGCGACTCTAAATTGTCAATAAAATTGTTTTTTACACACCATATTGTGGTATGCACACATATCGGTTAAGCACTGTACCCTATGTGTATTCATAATTGTAGCACTCATTTGCAATGTGTACATAAACAGTCCAGCACAAGTGGCCGCCGTAATACGAGCACCCACTTGAGGGCTAACATACATAATTGCCTGCTGGTCAGCAGTTCTCCCCGCTGTAAGCGCCTGATCAACTTATATGTGTTATTGCTACGGCTCTCCTCCAGCACCATCGCTCGGCGACGGTACATATATATATACATATATATAAGATTTTATATAAGCGTTGCTGCGCTGCAAAGACTATGCTGGCAACGCTGCTCGACAGGCTATAAGAAACAACTTTGTATGTAGATCGCAAGAGGATTGACGGGTAATTTCCGAATGGGCAGGACCTTCCTGTTCCTCGGTGGATCAAATAAAGAACAGCTAAAACACAAATGATTATGACTACCAGTGAGTTGAATTAGGCGGTCCACTTCTGATGTCGGATCTGAATCACTTTATACTCGGCATCACTCTCTGCAGCGGACACAAAGTAACAGAAAACGGTCGTTAACTTGAAATTAAAAATAAATCTGCGACAAGTACAGTTTGTCAAGAAACTGTTTACACACCGTGAAATAAGATGAATTTTTTGATTTTAACGGTAGTCAAAAATTAAAGGGTTATTTTAGCGAATTAAACGCAATTTTTTTTTAGGAAATATGAATTAAACAATATTATTTATTTTACTTATAAGAACAAAAACAAATTCAAAATATATCAAATATACAAGAAAATAAACAACGAATTCCAAGTTTAAACACTTTTAGGAGTTTCAAGAAACTCTTTACACAAAACACTAAACCTAAGTTTAATCCTAAATTTTAAAATTATTTTGTTTAAAATTTGAAAGGATTTAGCCAGTATTTAGTATGACCCCATTGGCTTTGGCTACAAGTTGAGCTTTTTTTCATGGAATGGATGAGTTTTAGGTGTAGGCTAGTGGGATCTTTTCCACTCTATCGCAGCCATGAGCTGTTGTCGTGTTTTTTGGTGCCCCTTTTGCCACATTCTTCTTTAAAGTAGGCCACAGGTTTTCAAATGGGGTTCAAAGATCCGAAGACTCACCGAGGGGGCGTATCGATCCTGCCGCAGTTATAAAGGGAGCCAGTTGCATTACATTGCGCTCTTTATGTTTGGGATCATTGTCCTGATAAAACTTAAAATTTGGCTTGTTGTTGCTAAATAGACCAAATTTTTCTGCACTGGCCTTCAAATTTGATTTTAAAATATCTAGATATTGCATTCGCGGTGCTTTCAATAAAGGCTAATTTGCCCACTCCATGGCTTGAGATACAGCCCAAATCATCACTGATAATTTTTTTGAATTTGATTGTTGGGTGATATTTTTTTGTTTTCCGGCGCACTCAACAGCTTGCGCCATACTCTGCTTGGCCATCGTTATAATAGAGCATGTTTTGTTCGTCACAAAATATTACGTCATCCCAGTGGCTCTTCCGCATGATCCATCATGCTCACAGCGAATGAATGACGCTTTTCTATATTGACCTCTGATAGCAAGGCTTTTTTTCTTGCAACTCTTGAAGAGTACCTATAGTAGAATGACTTGGCACAGTTTTTATTATTGGCACAACTAGAGTCCACATTCTTGCCTGATATCGAGCAAGTGGTCAGGCGAGATTCGAGGTTCGCAATCCTTTTCGCATAATAAGGCGGTCTACGCTTGCTAATTTAGTTTGCCCCCGCCTCTTAGGTTCAAGCCTGTTCTCTTTTTTCAAGCGATTAAAAACATTGTGAACCTTGGTCTTACGGGATACCACCAAAGAAAACATTTATACTAATTCTGGAATAGATTTTCCCAACTGGTGGTTTAGTATATTATTTGGGTCACTTCAAAAAGCTAATCTAACGGTTTTATTAAATTTAATAACTCATTCGATCAGCAAAATTTCACAAGCAAAGTAAAAAAAATTTCAATAGAAGCGTTGTAAAGGAATGCAAATGCAAAATAACGGAAAAATCGAGTTCGTTCTAAAGAAAAGAGCAAAACAAGTAGGAAAACAAAATATTGGCAGGAACAACGCTCTCAAAGGTGTAAACTTGGAATTTGTTGGCAATTTCTTGTATATTTGATATTTTGAGATTTGTTTTAATTTATAAGTAAAATAAATATTGTTTTGAATTATATTTCATTAAAAAAATTGCGTTTAATTAAAGAAATAACCCTTAGTGGCCTTTAAAATTGAAAAATTCAACATTTCACGGCGTGTAAAATGGTTTGTGACGAGCTAATATATATCTAAATTTACAACTTACCGGTACCATCTTGCAAGATTCATTGTTGGAAGTGGACTTTGACTCTCAGAATGAATTAAACATTATATTCTTAGATTGAACTGACGAGGAACCAGACCAGAACTAACTGACAATATGTTTAAGCTAATTTAATTAAGTTTACTGATAATTTTTGGAGTTTCTTACAAAGTGAAGCTAATATTAATTTTTTAGTTAAAATAGTTTGCGAGCTGAATTTATGTAAATAATATGTTCAATTTGATCTGGTTGGGTTTTCTGGGTCCCCAGCACCTCGCAACAGATACTTTGGGATCAAAATTATTCGTCAAAGGAAGGACATTTTACAGTCTCGTGATGAGTAATAAAAGTACAGCCGTCTACTTTTGAGGAGGTGGCGTGTTTGGAAAGTATGTGCATTTAAGCAAAAGTCACGCCCAATGCCATCAAAAGACGCTGGGAATAATAAGATGCGTAACAGCCATACACTGGTTTGGCACTATGCAGCCACTTTTGGTGACAGCCGTGCTCTCTTTCCGCTCCGCTCACGCACAGGCGTAAAGAAATCTAAATAGGGTACAGCGCTTGCTTGTGTGAGTAAAACAAAAGACGAGAACGCGTATGTGTGCGTGTTGTGCTAGAAAGGCGATTTTCGGGCCAGAATCAATTCTGATCGCAGTAACGAATTTACATATGTACACGCATACATATTTGGGGAGTTTGGCCAATTTCATTTAGAATATGATGAAATTGCGCGCTGTTTAAGATAAACAATACGTAACGT
->3fd6c549-95cc-451f-8dba-5ddf243b2f33
-TCGGTATTACTTCGTTCAGTTACGTATTGCTTCCTACTTTGTTTGCTCTTTTTTCTTAGAACAGACTCGGTGCCATTCATTTTTGGCATTTGCATTCCTTTTTACAACGCTTCTATTGAAATTTTTTTACTTTGGGACTTTGCTGATCGAATGAGTTATTAAATTTAATAAAATGCTACAAATAGATTAGCTTTGAGTGACCCAAATAATATACTAAAACCACCAGTTGGGAAAATCTATTCAAGTCAGGTATAAATGTTTTCTGTATCCCGTAAGACCGTCTACAATGTTTGTCAACGAAAAAAAGAGAACAAGGAGGCTTGAACCTAAGAGTGGTGGGCGCAAAACTAAAATTAACTTGAAGCGTGTGAACCGCCTTATTATGCGAAAAGTGATTGCGAACCCCAGATCTCAGTCAGATCCTTGCTCAGGATATCAGACGAATGTGACCCTAGTTGATGCCACAAAACTGTGCGCCAAGTCATTCACATATATGGAGTACTCTTCAAGAGTTGCAGAAAAAAAGCCTTTGCTATCAGAGGTCAATATAGAAAAGCGTAGACCATTCGCTGTGAGCGATGGATCATGCGGAAGAGTACTGGGATGACGTAATATTTCAATGACAAAACAAAAAAAATGATGCTCTATTATAACGATGGGCCAAACAGAGTATGGTAACAAGAAGCTGTTGAGTGCGCTAGAAAAAACAAAATCATTCAACAATCAAATTTGGAAAATTATCAGTGATGATTTGGGGCTGTATCTCAAACCATGGAGTGGGCAAATTAGCTTTATTAGAAAGCACTATGAATGCCGTGCAATATCCTAGATATTTTAAAATCAAATTTGAAGGAGCCAGTGCAGAAAAAATTTGGTCTATTTAGCAGCAACAAGCCAAATTTTAAAGTTTTATCAGGTTAATGATCAAACAAAGAGTGCAATGTACGCAACTGGGCTCCTTTATAACTGTAGCAAGAATTGATCTGATACGCCCCCTCAGAGTCTTGATCTGAACCCCATTGAAAATTTGTGGGCCTACTTAAAGAAGAATGTGGCAAAAGGGGGCACCAAAACCTTACGACAACAGCTGCTTGGCTGCGATAGAGTGGAAAGTCCGCTTGAATATGACCCTAAAAAAACTCATCCATTCCATGAAAAAAAGCTTCAACTTGGCAGCCGAAACCAATGGGGGGTCCATACTAAATACTACGGCTTTTCAAATTTTAACAAAATAATTTAAAATTTAGGATTAAGCTTAGGTTTAGTGTTTTTGTGTAAAAGAGTTCTTGAAACTCTCAAAGTGTTTAAACTTGAATTCGTTGTTTTATTTTTTCTTGTATGATATTTTGAATTTGTTTTAATTTATAGAGTAAAATAAATATTGTTTAATTATATTTTAAAATTTAGGTACCAATTAAACAAATAACCCTTAATTTTGACCCGTTAAAATCCAAAAAATTTCATCTTATTTCACGGTGTGTAAACAGTTTCTTGACAAACATGCTTGTCGCAGATTTATTTTAATTTCAAGACAACGACCGTTTTCTGTTGCTTTATTGTCCGCTGTAGAGTGATGCCGGTATAAAGTGATTTCCAGATCCGACATCAAGTGGGACCGCCTACTCCAACTTCTGTAGTTCATTGTGTCATAGGTCATTTTGTGTTTTAGCTGTTCTTTATTTGATCCAATTTGAGGAACAGGGAAGGTCCCTTCCATTCGAAATTAATTCGTCAATCCTCTTATGATCTATTACAAGGTTTCTTAGCCTAAGTCGAGGGAGCAGCGCTGCGGCATAGCCTGCAGCGCGCAGCAACGCTTATATGCGTATCTTATATATATGTATATATATATGTACACTGTCACCGAAACGATGGTGCTGGAGAGGAGTGGTATAGGCACACATATAAGCGATCAGCAGCCAGCGGAGAACTTCTGCTGACCAGGCAATTATATGTATGTTAACCCTCAAAGTGGGTGCTCGTATTACGTATACACTTGTGCTGGACTTTGTACACATTGCAGCAGAGTGCTACAATTATGAATACACGTTGCAATTATGCTTAGCGATATATGCATACTACAATAGGTGAAAACAATTTGCTACGGCAATTCTGAGTGCCAGAATCGCCATTTTTTTCTGAACTGTTAAAAGAGTGCAAAACTCACAAAGAGACCCAAAAGAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCTGAACGCACGAGGCTTAGACGCACTCGAAATCCCACCAGTGCGGAGACCAAGTCTACATCGCGTGAAGACGGACTGCAAATTACGCGGCGCGAGTACTCGCGAAACCATAGAAGTTGTGTCTTCGGCCCGGTGTGTGCGGCAGAGCTGGCAAAATCACACGGTGGAGTCAGCGCCATGGTTACGCTGCAATCGCGCGAGTTAATTGTGCGCCTGTTTCATGTAAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAACAGCTGATAGCGCAGCGGGCGATCTGGAGAGGGAGGCGTTGCCAGATCAACCCGTGTGATCAGTGTTATTGATGTTGCGACAGTAGGGCGCGAAATTCAAAATTAAATTTAAAATTAAGCGTGAAATTTATTTAATTTTAATTTTGATTCTGTGGTAACTGGAGCGCACCGAGTCTTTAAAGAAGGGGAGAAAAGGCACAAAGGTCGGACAGACCAAATATCATCCTCTCACCGTGCTGTTTTCGCTTAGAGGCTCACAATTGTCCGAGTCGAGGCGGTACAAACCTCCATCCGTAAAAGCCGGAAATCCGTGGCCCTACGTATTCTAGGTAACCTTAGGCCATCCTTCGGTTGATGGACCTTGGCGCAGTGGGGGAGCGAGTCCCTGATCGCAACGACCCGTTCAGGAGGAGCTCCCGACTTTCGAGATCCCCACCTGCCAGAGGAGTCAGTAACCCGACCCATGGTGACGGAATCTCGGTCCCGTCAGTGGCAGAATTTGGTACGCAGGCCCCAGCCGCCGTCCGTATCGACTGCAGCGATGCTGTAGAGGTGGAGAATTGGCTCCTGGCATCTACGACCTGACAAGTCAGAGGCTTGATGGACCACATCGCCGTGCGCCACATAAAGACGGGAGGAAGTCCCCAACGTTTTCCCCCCCTCATCGGTCTTCCGGACTTGACACACTCTCAGAACGAGGACCTGAGGGGCATACTTACCAGGATGAATGGCAAGATCAGCCTTCTATCCCATTCGAGACCCAACGACACACATATGAGGGGAGACAAAGGGCACTTAACTGAACTCTCAGCCCTTAACAACAAAGGGCGATAGAGGCTGTACGAAGGTACTACTAGCGAGCACCGCTTGAAGAGCAGCATACCCAGACTGAGTACAAAAGCCTACCAAAGGCTCACAAAATGCCTCAAGATTTACCCACGGTGCGGTGCCAAAGTCAGGCATGGCAGAGCAACCCTACGTTGGATGGCAACGGTGAAGAGAAAAGGCGACATACATACCTAACAGCGAGTCAAAGCCAGACAGCTATGCATCTGTATGCGGGGAATGCTAGCACGGGTGCAGAGGCACTCATCGTAAAAAAGACAGGAGAGGCTTCGTACGCAGAGATGCTTCCCAAGGCTAAGATCGGAACCTTAGCGAACTGGGCAGTCACGTGCAGAAAATCCGGAGAACGCGAAGGTGATCTGTTGCTTGAGGTGGGGAAAGCTTCGGAAGCGTTCCAAGTTTGAACGACCTGGAAGCGCTCAATGGCTTGGCTTCTGTGCAGGAGGAGCGCGAATAGCTCTATCTTGCAGCGGATTGGACGAGGCTACGACATGAAAGCTCCACAGCTGGCGGTCGCCCAATTCCAGGGCCTGCAGATAATCCACAGAGATATCAGGGGCCTTCGCGGTATGCGGAATTGCCAAACAAATAGCCTCGATGCTGCTGAACGCGAACGTTGCGATACCAGTCCTTAAACAGGGGCACCATAATCGTTGGATATGGTCAAGAGATGTCGTATCACCGGGGACGTCCGACCCACGAGATGCGCACAGGTGTCGGCTATGGGCATCGATCAGCAACTGCGGGACACTGTGGGGCAGACTGCTGTCTTAGATGCGGTGACGTGGAAAGCACAAAGGCAAGGGGTGCGTTGCTGCACCGATGCCTGATCTGCAGCAGCGAGGTGGACAGAAACCACCCGACGGGTAGCTTTGCGTGCCGACTTACAGAGCAACACTACTGCCAGAGCCACCTTAATGCACGCTCATATTAGCGTAGTACAGCTCAATGTCAATCATTGCGCAGCAGCTCGAGTACTCCTGGCTTTGGACTGCAGTTGAGCGCAATGGCAGACATCATCACTCCCTAAGCGAACCCTACGTCTCTGGTAGTGGACAATCGTCCATGATCCTTGACGAGGCAGGTAACAGCTATCAAATGCTGCAGCTCTCTCCAAGTCAGGAACTGGCTGCTTTACCCATGCGGGGTATCATCGCTGCGGTATGCGAAGTTAAAACGTGCACATGTACGGCTGCTGCGCTCCCGCCGAGCGTACCTGATCAGTTCGAGGAGCTTCTGGGCGCTCGTGGACCATGCGAGAGGGCGAAGCCAGAAGGTCATTACCGGCGACTTTTAATGCCTGGACAGTGGAATGGGGCAGCAGGACATCCAGCACCAGAGGGACGAGCTGTGATTGACGCCATACGAATGCTGGACCTCATGCACCTGCTGAACGATGGACGGAAGCCGACGTTTAACAACGATAGGGTACGTCCTTTATTGACGTTTTACCTTTGTCCCAGCAGAGGGCTAGTAGACAACAACAACTGGATGGTGCGACGTCGCTGACGCTGAGCGACGCCATGCCTGATCTCCCTTCTCCCGGAGGTATGCCCAAAGACGGCAGAGTAGAGACAGCCAGGGAAAACATGGGACACCAGGAGATCGATGAAGCCATGCTGGCCTATCAGATCATTCCTGAAATCCCAAATGTGGACTGAAATTATGGCGGAGCCTCATGAATATGCTGGGAGAGAATCTGCAGCCTGTAATCATGCCAAGGAAAAATAAGGCTGGCTGCGATACCCGTTTGCGGTGGGTGCCTCCCCTAAACCAACGCTACGGTCCTGGTGCCTCAGGGCTAAAGAGAACGGCGCAACAGGCCAGGCAGTACCCACCACACGCGGAACTCTTGGAGGCTTTCAGAAGCAAACGCCTAGAGTTCAAGCACGGCGCCCATCGCGGCTGCCAAAGGCGCGGTCGTTTAAGGAGCTGCAGGATGGCGTAGACAGCGATATCTGGGGCCTCGCCTACAAGCTTATTACCAACAGGCTAAGGAGGAGAGCAGCAACCCATCCGACCAGTCCTGGCGGCACTGGGGAGCTATTTCCAAAGGCAGACCACACTATGGAGGCCAACAGAGCAGCCTGCCCCAGCAGATTTCCCGTGCGTCCTGGGGCAGGATGAAGTAGAACTGGCTGTTTCGCGACGATGTAGCAATCTGACCGGGCCCCAGCAATGGCGGCTCACAAAGCCGAAGCAGTCCTACTAAGCAGCAGGGAAAAAGATGGAGAACATGCTGGTCTCCGTCAAAGGGGTACTCAGGGACCTCCGGAAGTCCCTAAAATTACCTGGGGTAATGACCGTCGCAGACTATCGTTCAAAGGACCACACCCGAGCTACGCCAGCAAGAAGACGACGGTCACATCCTCTTCGTTGGCGGGAGGCTTATGCCCAACGTCGGAGCCCAGACACCCGGCCAGGAAACTGCTGGTCGGTAGCAAGAGGAAAACTTCGCTGCTATACGCTGCCAGTCTGGAACAATGCCACTTGCAGGGTCTCATACCTGAAAGGGAGCTCGTTCGGTGCTACAGTCCAATGGCCTCAAGGGCTCATTAGAGGATTCAGGACCATATCAGAAGACGCGGCGCGCTAGCAGCAGGGCTACCGATTGATCACGGAGATCGGGCTCTCAGCCTTATGCGAGGTGGCGCTTCCAGGCCAAGAGGCACACGAGTGGCTATTGGGTGAATATGGCAGAGCAGATGGCAAACGTCGCGACGGGGAGGTGGACCCTATCTGTCATCCCAGAGATGACGGTTTGGGCAGAGTGACATCTCAAAAGTGTGAAACTGGAATTTGTTATTTATTTTTCTTGTATATTTGATATTTTTGAATTTGTTTTTTAATTTATAAGTAAAATAAATATTGTTTAATTATATTTCCTAAAAAAATTGCGTTTAATTAAGCGAAATAACCCATATGGTACGACCGTTAAAATCAAAATTCATAACACGATTATTGTAAACAGTTTCTTGACAAACTGTACTTGTCATAGTTATTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTGTCCGCTGTAGAGTGATGCCGAGTATAAAATTGATTCAGATCCGACATCAGAAATTGAGCAATGCATGGCAG
->08a29493-dc23-48a4-b7b3-b3bdcb00340e
-GGTATTGCTTCGTTCAGTTTTTATTGCTGACACCTGCCTTGGCATCGTGGGTCGGACGTCCTGGGTGATACGACATCTTGACCATCCAACGATTATAGTTGCCCTGTTTAAGGACTGGTATCGCAACGTTCGCGTTCAGCAGCACTGGGCGGCTATTTGCTGAATTCCGCATACTGCGAAGGCCCCTGATATCTTCAGGATTTATCTGCAGGCCCTGGAATTGGGCGATAGCAGCTGTGGGCTTCTCTGCTGTCGTAGCCTCGTCAATCCGCTGCAGATAAGAGCTATTCTTTGCGCTCCTGTGCGCACAGAATGAAGTCATTGAGCGCGCCGCTTCAGGTCGCTCTTAAACGGGAACGCTTTCAGCTTCCTCTACCTCAAGCAACAGATCACCTTTCTGCGTTCTCCGGATTTTCGCACGTGACTGCCCAGTTCAGCAGGCTCGATTCCGATCTTGGCTTCCGACATCTCTGCGTACGAAGCCTCTCCTGTCTTTTACGATGAGTGCCTCTGCACCCGTGCTAGCATTCTTGGCGACAGATGCATAGCTGCCTGGCTTGGACTCGTTAGGTATGGATGTCGCCTTTTTCTTCGTTGCCATCAACGTAGGGTTGCTCTGCTTCAGCGCCTGGACTTTGGCACCTGCACCGTGGGTACCTGCGCATTTTGTGGAACCTTTTTTGGTAGGCTTTTGTACCTCCGTCTGGGTAGCGCTGCTCTTCAAGCGGTGCTCGCTAGTAGGTAACCTTCGTACAGCTCTATCGCCCTGTTGTTGGGGCTGAGGAGTTCGGAAGCTATGCCCTTTGTCTCTCATGTGTGTCGTTGGGTCTCGGAGATGCGGATAGAGAGTGATCTTGCCACCATTCATCCTGGTAAGTATGCCCCTCGGTCCTCGTTCTGAGCAGTGTGGTCAGATCCGAGAGACCGATGGGGAACCAGCTGGGACTTCCCTCCCGTCTTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCTGACTGTCGCGGTCGGCGTAGATGTAGACCAATTTCTCCACCTCTACAGCATCGCTGCAGTCGATAGTCAACGGCGGCTGCGGGGCCTGCGTGCTCACCCACTTGCCACCGACGGGACCGAGATTCCGTCACCATGGGTCGGGTTGCCCGACTCCTCTGGTGAGGATCGAGAGATCCGGGAGCTCTCCTGAACGGGTCGTTGCGATCGGGGGGACTGCCCCACTGCGCGTCCATCAACTGAAGGATGGCCTAAAGGTTACCCTGGGTCGTAGGCCACGGATTTCCCCACCGGCTTTACGGATGGAGGGTTTGTACCGCTTCGACTCGGACACCAGAGCCTCTGCTTAGGCACCAGCACGGTGAGAGGATGATATTTGGTCTGTCCGCGACCTTTGTGCCTTTTCCCTGGCAAGACTTGTGCGCTCCCAGTTACCAGAATCAAAATTAAATTAAATTAAATTTCCAACGGCTTAATTTTTTAAAGAGTTTGGTGCGGGAATTTCACTTACTCTGTCGCAATGACACAACACCTGATCACACGGTTGATCTGGCAACGCCTCCCTCTCCAGATCGCCCGCTGCGCTATCAGCTGTTTATCCTACCGCAATCGCCAAAGATAATAAATTACCTATTTACATGAAACAGGCGCACAATTAACTCGCGTGATTACGCAGCGCAGAACTATGGCGCGACTCCGCAGTGGCGAATTTTTGCCAGTTTGCCGCACACACCGGCCGACACAACTTCTATGGTTTCCAGGTATTTCGCGCCGCGTAATTTAAGACGATCCGTCTTCACGGCGATGTAGACTTGGTCTCCCGCACCAGGATTGAGTGTCTAAACCTGTGCGTTCAGGATTAAACTTTGGCAATACGACGGCATTGAGTTTTTGGGTCTCTTTGTGAGTTTGCACTTCTTTTTTTAACAGTTCGAAAAAATGGCGATTCTGCGACTCTAGAATTGTCAGCAAATTGTTTTCACTATTGTAGTATGCACACATATCGGTTAAAGTACTGTACCTATGTGTATTCATAGTGTAGCACTCTGTTGCAATGTGTACATAAACAGTCCAGCACAAGAAGTGTTATACGTAATAAAGGCACCACTTGAGGGCTAACATACATATTGCCTGGTCAGCGGTTCTCCGCTGGCCAAGCGCTGATCGCTTATATGTGTGCCTATACCACTCCTCCTCCAGCACCATCGCTCGGCGGCGAGTACATATATATACGCCCATATATAAGATTACGCATATAAGCGTTGCTGCGCTGCAGGCTATACCGGCAGCGCTGCTCGACTTAGGCTAAGAAACCTTTGTATGTAGATCCTTAAGAGGATTGACGGGTAGGCATTTCGAATGGAGCGGGACCTTCCTGTTCCTCAAATTGGATCAAATAAAAAATTGGCTAAAACACAAATGATCTATGACACAATGAAACTACAGGAAGTTGGAGTAGGCGGTTACGCTTCTGATGTCGGATCTGAATCTTTATACTCGGCATCACTCTCTACAGCGGACCACAAAGTAACAGAAAACGGTCGTTAACTTGAAATTAAAAATAAATCTGCGACAAGTACGAGTTTGTCAAGAAACTGTTTACACACCGTGAAGCCAGATGAATTTTGAGTTTTAACGGTCAAAATTAAGGGTTATTTGCTTAATTAAACGCAATTTTTTTTAGGAATATATAATTAAACAATATTTATTTTACTTATAGAATTAAAAACAAATTCAAATATCAAATATACAAGAAAATAAATAACAAATTCAAGTTTACACTTTTGAGTGTCCACTCTGCTAAACCGTCATCTCTGGGATGAGCTGATGGAGTCCACCTCCCCGTCGCGACGTTTGCCATCTGCTCTGCCATTCACCTAATAGCCACTCGTGCCTCTTGCCTGGAAGCGCCGCTCCGCATAAGGCTGGAGCCTTGATCTCCAGATCAATCGGCGAACCCTGCCAGCGCTAGCGCCGCGTCTTCGGATATGGTCCTGAATCCTCTAATGAGCCTGAGGGCCATTGACCACCAGCACCGAACGAGCTCCTTTCAGGTATGAGACCCTGCAAGTGGCATTGCTCCAGACTGGTGCGTATAGCAGCCTTGAAGCCTTTGCTACTGACACCAGCAGTTTCCTGGCCGGGTGTCTTGGGCCCTCCGACGTTGGGCATGAAGCCTCGCCAACGAAGAGAGGATGTGACTGCCTGTCTTCTTGCTGGCGTAGCTCGCGTGGTCCTTGAACGATAGTCTGCGATCTATCGTACCCCAGGTACTGGGGACTCTTGAGGGAGGTCCCTGGTACCCTTGACGGAGACCAGCATGTTCTCCATCTTTTCCTGCTGCTTAGTAGGACTGCTTCGGTCTTGTGAGCCGCTGTGCTAGCCAGCTGTGATTGCCACATCGTCAGCGAAACAGCTGCCTCGACGACTTCAGAGTTCTGTGACGCACGGGAAATCTGGGGCAGGGGCTGCCTCTGTTGAAAAGCCTCCATGGTGGTCTGGCACGGAAATGGCTCCCCTAATTATGTTAGCCAGGACCCCCCCGGGTCGGATGGGGTTACCGCTCTCCTCCTTAGCTCGTTGGTAACAAGCTTGTAGGCGAGGCCCCAGATATCGCTGTCTACGCCATCCTGCAGCTCCTTGTGACCGCGCTTTGGCGGCGCGATGCACCGATAGCGAACTCTGACGTTTGCTTCTGAAGCCTCAAGAGTTCCGCGTGGTGAGTACTGCCTCTGGCTCGTTGCGCCGTTCTCTTAGCCCACAGGCAATCAGACCGTAGTTGGCAGGGAGGCACTCCACCAGTAGAAGCAGATTGGTTTTGCGCTGTGCTGCTTATTTTTCCTTGGCATGATTGCGTCGCAGGTGCTTCAACATATTCATGGGGCCTGCCGCCATACTCTGCGTCACATTTGGGATTTCCGAGAATTGATCTGATAGGCCAGCATGGCCTCATCGACCTTCCTGGTGTCCACATGTTTTTTCCAGCTGTTCTCACCGTCTTTTGGGCATACCCTCCAGGGAGAAGGAGATCAGGGCATGGTCGCTCCAGCGTCTGACGTCATGGACCATCCAGTTGTTGTTGTCTACTAGCCCTCTGCTGACAAGGTAACGTCCAATAAAGGACGTACCCTATCGTTGTTAAACGTCGGCTTCCGTCCATCGTTCAGCAGTATGAGGTCCAGCATTCGCATGGCGTCAATCACAGCTCGTCCTCTGGTGTTGGATGTCCCTGCTGCCCCATTCCACTGTCAGGCATTAAAGTCGCCGGCAATGACCTTCGGGCTTCGCCCTCTCGCATAGTCCACGAGAGCGCCTCCAGAAGCTCCTCGAACTGATCGAGGGTGTCGCTCGGCGGAGCGTAGCAGCTGTACGTAATGCACGTGTTTTAACTTCGCATAAAGCGATACCCGCATGGGTAAAGCAGCCAGTTCCTGGACTTGGAGAGCTGCAGCATTTGATAGCTGCTTACCTGCCTCGTCAAGGATCATGGACGATTGTCCACTACCAGAGACGTAGGGTTCGCTTAGGAGCATGATGTCTACATTGCGCTCAACCGCAGTCTGGGCCAGAGGAGGCTCCTGAGCTGCTGCGCAATGATTTGACATTGAGCTGTACTACGCTAATATGAGCGTGCATTAAAGGTGGCTCTTGGCATCTTTTGAGTGTCGCTCTGTAAGGATCGGGCACGCAAAGCTACCCGTCGAATTGGTTTCTGTCCACCTCGCTGCTGCAGATCCAGGCATTTTTAGTTTTGACAACGCACCCTTATTGCCCGCGCTCACCGCATCTAAGACCTTGGCGAGTCTGCCCTGTCCAGTGTCCTTGCAGGTTGCTGATCGATGCCCACATAGCCGAGACACCTGTAGCATCTCGTGGGTCGGACGTCCTGGAGGTGATACGACATCTTGACCATCAACGATTATAGTTGCCCTGTTTAGGACCTGGTATCATAACGTTCGCGTTCAGCAGCACTGAGGCTATTTGCTTGCAATTCCGCATACTGCGAGGCTATCTTCAGGTTATCTGCGAGCCCTGGAATTGGGCGATAAGCAGCTGTGGAGCTTCTCTGCTGTCGTAGCCTCGTCCAATCCGCTGCAAGATAGAGCTATTCTTTGCGCTCCTGTGCGCACAGGAGCCAAGTCATTGAAGGCGCCGCTTCCAGGTCGCTCTTAAACTTCAGGAACGCTTTCCGGCTTTCCCCTCTACCTCAAGCAACAGATCACCTTTCTGCGTTCTCAGTTTTTCGCACGTGACTGCCAGTTCGCTAAGGCTCGATTCCGATCTTAGCTTCGAAGCATCTCTGCGTACGAAGCCTCTCCTGTCTTTTTTTTTACGATGAGTGCCTCTGCACCCGTGCTAGCATTCTTGGCGACAGATGCATAGCTGCCTGGCTTGGACTCGTTAGGTATGGATGTCGCCTTTTTTCTTCACCGTTGCCATCCAGCGTAGGGTTGCTCTGCTTCGGCGCCTGGACTTTGGCACCTGCACCGTGAATTTACCTGCGCATTTTGTGGAGCCTTTTTTTGGTAGGCTTTTGTACCTCCGTCTGGGTAGCGCTGCTCTTCAAGCGGTGCTCGCTAATCGGAAGAATACCTTCATTACAGCTCTATCGCCCTGTTGTTAAGGGCTGAGAGTTCGGAAGCTATACCCTTTGTCTCATGTGTCGTTGGGTCTCGAATGCGGATAGAAGGGGGCTGATCTTCACCATTCATCCCTGGTAAGGCCATGCCCCTCAGGTCCTCGTTCTGGAGAGCAGTGGTCAAGTCCGAGGAACCGATGGGGGGGGAACAAGCTGGGGACTTCCCTCCCGTCTTTGCGATGGCACGGCGATGGCCAGTCCATCGTCTTCTGACTGTCGCGGTCACAGATGCTGTAGGAGCCAATTTCTCCACCTCTACAGCATCGCTGCAGTCGATAGTCAGCGGCGGCTGGGGCCTGCGTTAACCCCTTGCCACCGACGGGACCGAATTCCCGTCACCATGGGTCGGGTTACCGACTCCTCTGGTGGGGATCTCCGAAAGTCAAGGGAAAACTCCTCCCTGAACGGGTCGTTGCGATCAGGGGGACTGCCCCTGCGCTGTCCATCAACTGAAGGATGGCCTAAGGTTACGCCCTAGGTCACGTAGGCCACGGATTTCCCCAGCTTTTTACGGATGGAGGTTTGTACCGCCTCGACTCGGACACCAGAGCCTCTGCTTAGGCGCCCAGCTTTGGTGAAGGATGATGATATTTGGTCTGTCCGATACTTGTGCTTTCCCCTTTCTTAAAGACTTGTGCGCTCCCAGTTACCAGAATCAAAATTAAATTAAATTAAATTTCAACGGCTTAATTTTAATTTAATTTTGAATTTCGCCTTACTGTCGCAACCTACAGCACTGATCACACGGTTGATCTGGCAGCGCCTCCCTCTCCAGATCGCCCGCTGCGCTATCAGCTGTTTATCCCGCTGCAACAATCGCAAGATAATGAAATTACCTATTTACATGAAACGGGCGCACAATTAACTCAGCGTGATTGCAGCGCAGAACTTGTAAGCGCGACTCCACCGTGTGATTTTGCCAGTTTGCCGCACACACCAGCCGACACAGCTTCTATGGTTTCGAGTATTTCGCGCCGCGTAATTTAAAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCCGCACCAGGATTGAGTGTCTAAGCCTGTGCGTTCAGTTAACTTTGGCAATACGGCAGCATTGAGTTTTGGGTCTCTTTGTGAGTTTTGCACTTCTTTTAACAGTTCAAATGGCGATTCTGCGACTCTAAATTGTCAACAAATTGTTTTTTCACTATTGTGGTATGCACACACATATCGGTTAAGCACTGTACCTATGTATTCATAGTGTAGCACTCTGTTGCAATGTGTACATAAACAGTCCAGCACAAGTGTATACGTAATACGAGCACCCACTTGAGGGCCTAACATGCCAAATTACCCTGGTCAGCAGTTCTCCCGCTTGAAGCCCAGCGCTGATCGCTTATATGTGTGCCTATACCACTCCTCCTCCGGCACCGGCGCTCGGCGACGAGTACATATATATATACATATATGAATGCGCATATAAGCGTTGCTGCGCTGCAGGCTATGCCGGCAGCGCTGCTCCTCGACTTAGGCTAAGAAACCTTTATGTAGATCATGAAGGATTGACGAATTAATTTCGAATGGGCAGGACCTTCCCTGTTTCCTCAAATTGGATCAAATAAAGAACAGCTAAAACACAAATGATCTATGACACAATGAAACTACAGGAAGTTGGAGTAGGCGGTCCACTTCTGATGTCGGATCTGAATCACTTTATACTCGGCATCACTCTCTACAGCGGACACAAGTAACAGAAAACGGTCGTTAACGGAAATTAAAAATAAATCTGCGACAAGTACAGTTTGTCAAGAAACTGTTTACACACACCGTGAAATAAGATGAATTTTTGATTTTTAACGGTCAAGAATAAGGGTTATTTGCTTAATTAAACGCAATTTTTTTTAGGAAATATAATTAAACAATGGCGCTTTGTTTTAACATTTTTACTTATAGAATTAAAGAAACAAATTCAAAATATCAAATATACAAGAAAATAAACAACGAATTCAAGTTTAAACACTTTTGAGAGTTCAAAGAAACTCTTTACACAAAACTACTAAACTAAGTTTAATCCTAAATTTTAAATTATTTTGTTAAAATTTGAAAAGTTGTAGTATTTAGTATGACCCCCATTGGCTTTGGCTACAAAGTTGAGCTTTTTTTCATGGAATGGATGAGTTTTTTAGGTCATATTCAAGCGGGATCTTTTCCCACTCTATCGCAGCCATGAGCTGTTGTCGTGTTTTGGTGCCCTTTTTGCCACATTCTTCTTTAGTAGGCCCACAAATTTTCAATGGGGAGGTTCAGATCAAGACTCTGAGGGGCGTATCGATCACCTTGCCACAGTTATAAAGGAGCCAGTTGCGTACATTGCACTCTTTATGTTTGGGATCATTGTCTGATGGAAACTTAAAATTTGGCTTGTTGTTTGCTAAATAGACCAAATTTTTCTGCTGGCCTTCAAATTTGATTTTAAAATGTAGATATTGCACGGCATTCATGATGCTTTCAATAAAAGAAGGCTAATTTGCCCACTCCATGGCTTGAGATACAGCCCCAAATCATCATGATAATTTTCCAAATTTGATTGTTGGAATGATATTTTTGTTTTCTAGCGCACTCAACAGCTTGCGCCATACTTTCTGCTTGGCCCATCGTTATAATAGAGCATCATTTTTGTTTCGTCACAGAATATTACGTCATCAGTACTCTTCCGCATGATCCATCATGCTCACAGCGAATGAATGACGCTTTTCTACTTATTGACCTCTGATAGCAAAGGCTTTCTTGCAACTCTTGAGAGAGTACCTATGGCGTAGAATGACTTAGCGCACAGTTTTGTGTGGCACAACTAGATCACATTCTTGCCTGATATCCTGAGCAAATTGATCTGACCGAGATTCGGGGTTCGCAATCACTTTTCGCATAATAAGGCCCGGTCTACACGCTTGCTAATTTTAGTTTTTGCGCCCACCACTCTTAGAGTTCAAGAAACCTGTTCTCTTTTTTCAAGCGATTAAAAAACATTGTGAACGGTCTTACGGGATACAGAAAACATTTTATACTAATTCTGGAATAGATTTTCCCAACTGGTGGTTTTAGTATATTTGGGTCACTTCAAAGCTGAAAATCGGCTTCCAGGCATTTTTATTAAATTTAATAACTCATTCGATCAAGCAAAATTTCACAAGCAAAGTAAAAAAAATTTCAATAGAAGCGTTTGCCGGGAATGCAAATGCCAAAACTAACGGAAAATCGAGTTCGTTCACAAGAGAAAAGAGCAAAACAAAGTAGGAAAACAAAATGTGTAAAGAATTTCTTTGCCACTCTCAAAAGTGTGTAAACTTGGAATTTTGGGAA
->3cff810f-585b-4233-9596-fb063582cb6f
-TGCCATCGGTATTACTTCGTTCAGTTGCGTATTGCTTCCTGTGCGCACAGAGGCCAAGTCATTGAGCGCCGCTTCCAGAGTCGCTCTTAAACTTATGGGAACGCTTTCCGAAGCTTTCCCCTCTACCTCAAGCAACAGATCACCTTTCTGCGTTCTCCGGATTTTTCGCACGTGACTGCCCAGTTCGCTGGAGCTCGATTCCGATCTTAGCTTCCGAAGCATCTGCGTACGAAGCCTCTCCTGTCTTTTTTTTTGATGGTGCCTGCACCCGTGCTAGCATTCTTGGCGACAGATGCATAGCTGCCTGGCGGACTCGTTAAATTATGGATGTCGCCTTTTCTTCACCGTTGCCATCCAACGTAGGGTTGCTCTGCTTCGGCGCCTGGACTTTGGCACCTGCACCGTGGGTACCTGCCGCATTTTGTAGACCTTTTGGTAGGCTTTGTACCTCCGTCTGGGTAGCGCTCTTCAAGCGGTGCTCATGATAGTACCTTCATTGCAGCTCTATCGCCCCTGTTGTTAGGGGCTGGGAGTTCGGAAGCTATGCCCTTTGTCTCTCATGTGTATTGTCGTTGGGTCTCGAATGCGAGGATAGAAGGGGCAGTCGCGCCCATTCATCCTGGTAAAGTATGCCCCTCAGGTCCTCGTTCTGGAAACTGATGGTCAAGTCCGAGACCGATGGGGAACCAGCTGAGGACTTCCCTCCCGGCTCCTTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCTGACATCGCGGTCGTAGATGCTGCTTAGGGAATTGAATTTCTCCACCTCTACAGCATCGCTGCAGTCGATAGTCAACGGCGGCGGGGCCTGCGTGCTCACCCTTGCCACCGACGGGTTCGAGATTCCCGTCACCATGGAATCGGGTTACCGACTCCTCACAGTGGGGATCTCGAAGTCAGGAGCTCCTCTGAACGGGTCGTTGCGATCAGGGGGGACTGCCCCCCACTGCGCTGTCCATCAGCTGGAAGGATGGCCTCTCAGGTTACCTAGGTCACGTAGGCCACGGATTTCCCCTGGCTTTTACGGATGGAGGTTGTACCGCCTCGACTCGGACACCAGAGCCTCTGCTTGAGCACACCAGCACGGTGAGAGGATGATATTTAGTCTGTCCACGACCTTTATTCTGCTTTTCCCCTTTCTTAAAGAGGCTTACGTGCGCTCCCAGTTACCAGAATCAAGAATTAAATTAAATTAATTTCAACGGCTTAATTTTTAAAATTTAATTTTGAATTTCGCGCCCTACTGTCGCAACCTGGCACTGATCACACACGGTTGATCTGGCAGCGCGCCTCCTCTCAGATCGCCGCTGCGCTATCAGCTGTTTATCCCGCTGCAACAATCGCAAGATAATAAAATTACCTATTTACATGGAAACAGGCGCACAATGAATTAACTCGCGTGATTGCAGCGCAGAACTATGGCGCGACTCCACCGTGTGATTTTGCCAGTTGCCGCACACACCGGCCGACACAACTATGGTTTCGAGTATTTCGCGCCGCGTAATTTAAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCCGCACCAGGATTGAGTGTCTAAGCCTGTGCGTTCAGGGATTAAACTTTGGCAATACGGCAGCATTGAGTTTTGGGTCTCTTTGTGAGTTTTGCGCTAACAACAGTTCAGAGAAAAAAATGGCGATTCTGCGACTCCAGAATTGTCAGCAAATTGTTTTCCACTATTGTAGTATGCACACATATCGGTTAAACTGTACCTATGTGTATTCATAGTGTAGCACTCTGTTGCAATGTGTACATAAAACAGTCAACACAAGTGTATATACGTAATACGAGCACCCATGAGGGGCTAACATTACATAATTGCCTGGTCAACCCAGTTCTCCCGCTGGCCAAGCGTAATCGCTTATATGTGTGCCTATACCCTCCTCCTCCAGCACCATCGCTCGGCGACAGTATATATATATACATATATATAAGATACGCATATAAGCGTTGCTGCGCTGCAGGCTATGCCGGCAGCGCTGCTCCCTCGACAGGCTAAGAAACAGCACAATAGCAGATCATAAGAGGATTGACGAATTAATTTCCAGATGGAGCAGGACCTTCCCTGTTCCTCAAAAGGTGGATCAAATAAAGAACAGCTAAAACACACAAATGATCTATGACACAATGAAACTACAGGAAGTTGGAGTAGAGCGGTCCCGCTTCTGATGTCGGATCCTGAATCACTTTATACTCAGCATCACTCTCATAGCCGGACCACAAAGTAACAGAAAACGGTCGTTAACTTGAAATTAAAATAAATCTGCGACAAATTTACAGTTTGTCAAGAAACTGTTTACACCGTGAAATAAGATGAATTTTTTGATTTTAACGGTCAAATTAAAGGGTTATTTGCTTAATGCAAGCGCAATTTTTTTTTAGGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAAAACAAATTCAAAATATCAAATATACAAAATAAATAACAAATTCCAAGTTTACACACTTTTGGGAGTCACTCTGCCCAAACCGTCATCTGGGATGGGCTGATGGGTCCACCTCCCCGTCGCGACGTTTGCCATCTGCTCTGCCATTCACCTAATAGCCACTCGTGTGCCTCTTGCCTGGAAGCGCCACTCCGCATAAGGCTGAGCCTTGATCTCCAGATCAGTCGGCGGAGCCTGCCAGCCTTAGCTGCCGCGTCTTCGGATATGGTCCTGAATCCTCTAATGAGCCTGAGGGCCATTGACCGTAACACCAGACGAGCTCCTTTCAGGTATGAGACCCTGCAAGTGGCATTGCTCGAACTTCGGTGCAGCGTATAGCAGCAGAAGCCTTTGCTGCGAGCACCAGCGGTTTCCTGGCCGGGTGTCTTGGGCCTCCGACGTTGGGCATAAGCCTCGCCAACAGAGAGGATGTGACTGCTGTCTTCTTGCTGGCCGCCGCTCGCGTGGTCCTTGAACGATAGTCTGCGATCTATCATTACCCCAGGTACTTTGGGACTCTTGAGAGGTCCCCTGAGTACCCTCCAGGCGAAACCAGCATGTTCTCCATCTTTTTCCTGCTGCTTAGTAGGACTGCTTCAGTCTTGTGAGCCGCTATTGCTAGCCGGCTGTGATTGCCACATCGTCAATAGAAACAGCTGCCTCGACGACTTCAGTTCTGTGACACTTTGCGGGAAATCTGGGGCAGGGGCTGCCTCTGTTAGCCTCCATAGTGTGGTCTGCTTTGGAAATAGCTCCCCTAGTATGTTAGCCAGGACCCCCCGGGTCCGGATGGGGTTACCCGCTCTCCTCCTTAGCTCGTTGGTAACAAGCAGAGGCGAGGCCCAGATATCGCCAATACGCCATCCTGCAGCTCCTTAAACGACCGCGCTTTGTAGCCGCGATGCCGTGCTTGAACTCTAGGCGTTTGCTTCACAGAAAGCCTCAAAGGTTCCGCGTGGTGGAGTACTGCCGCAAACCACCGTTGCGCCGTTCTCTTAGCCCTGGGGCAATCAGACCGTAGTTGGCAGGGGCGCTCACCAGTAAACGGGTGGTTTGCGCTGTGCCTTATTTTCCTTGGCATGATTGCGTCGCAGATTCTTCCCAGCATATTCATGAGGCCTGCCGCCATACTACTCTCTGCATCCACATTTGGGATTTCCAGGGGAGTCGATCTGATAGGCCAGCATGGCCTCATCCCGATCTTCCTGGTGTCCCATGTTTTCCCAACTGTTCTACTCTGCCGTCTTTTGGAACATGCCCTCCGGGGAGAAAGGAGATCAGGGCATGGTCGCTCAGCTACGTCATGACGTCATGGACCATCCAGTTGTTGTTGTCTACTCAGCCCTCTGCTTGCTGACCAAAGGTAACGTCAATAAAGGGACGTACCCCTATCGGTTTCATTAAACGTCGGCTGAAATCATCGTTCAGCAGTGGGGTCCAGCATTCGCATGGCGTCAATCCACAGCGGCTCGATCACTCTGGTGTTGGATGTCCCTGCTGCCCCGACCATATCCAGGCGTTAAAGTGCCGGCAATGACCTTCGGGCTTCGCCCTCTCTCGCATGATTTTGAAGCGCCTCCAGAAGCTCCTCGAACTGATCGGGGGTGTCGCTCGGCGGAGCAGTAGCAATATTACGTATTTCGCGATGTTTTAACTTCGCATGGCTTGATACCCGCGTGGTACAGCCAGTTCCTGTGGAACTTGGGAAGGCTGCAGCATTGATATAGCTGCTTTACCTGCCTCAAATCGGGATCATGGACGATTGTCCACTACCAGAGACCGTAGGGTTCGCTTAGGAGCATGATGTCTACATTGCGCTCAACCGCAGGTGGGCAGGAGCTCAAGGCTGCGCAATGATGGCGGTGGGCTATGCCCTGCTAATATGGGCGTGATGCATTAAAGGTGGCTCTTGGCATCTTTTAGTGTCATCTGCAGTCAGACACGCAAAGCTACCCGATCGGGTGGTTTCTGTCCACCTCGCTGCTGCAGATCAGCGGGCGTTTTGGTGCAGCAACGCACTTGCCTTGTGCTTACACCGCTCACCGCATCTGGACAGCAGTCTGCCCTGTCAGTGTCCTTGCGGTTGCTGATCGATGCCCATAGCCGAGACACCTGTAGCATCTCATTAAGGTCCGGACGTCCTGGGTGATACGACCATCTTGACCATCCAACGATTATAGTTGCCCTGTTTGGGACTGGTATCACCAACGTTCGCGTTCAGCAGCACTGAGGCTATTTAGCGCAATTCCGCATGCTGCGAAGGCCCCTGATATCTTCAGGTTATCTGCAGGCCCTGGAATTGGGCGACCAGCAGCTGTGGAGCTTCTCTGCTGTCGTAGCCTCGTCAATCCGCTGCAAGATAGAGCTATTCTTTGCGCTCCACTGTGCGCACAGAGGCCAGAATCATTGAGCGCCGCTTCGGAGTCGCTCTTAAACTGGGAACGCTTTCCGAAGCTTTCCCCTCTACCTCAAACAACAGATCCGCCTTTCTGCGTTCTCGGATTTTCGCACGTGACTGCCCAGTTCGCTAAGGCTCGATTCGATCTTAGCTTCCGAAGCATCTCTGCGTACGAAGCCTCTCCTGTCTTTTACGATGAGTGCCTCTGCACCGTGCCTAGCATTCTTGGCGACAGATGCATGGCTGCGCACAGCGGATCGTTAGGTATGGATGTCGCCCAGCACTGTACCGTTGCCATCCAACGTAGGGTTGCTCTGCTTCGGCGCCTGGACTTTGGCACCTGCCGTGGGTACCTGCATTTTGTGGAGCCTTTTGGTAGGCTTTTACGCCATTCTGGGTAAGCGCTGCTCTTCGAAGCGGTGCTCGCTGGTAGTACCTTCGGCGTACAGCTCTATCGCGCCCTGTTGGGGCTGAGGAGTTCGGAAGCTATGCCGCCTGTCTCTCTCATGTGTGTCGTTGGGTCTCGAATGCGGATAGAAGGGGCTGATCGTTGCCATTCATCCTGGTAAAATTATGCCCCTCGGGTCCCTCGTTGCAGAGAGCAGTGGTCAAGTCAAAGAGACCGATGAGGGGAACAAGCTGGGGACTTCCCCTCCGTCTTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCTGACTGTCGCGGTCGTAGATGCTGTAGGAATGAATTTCTCCACCTCTACAGCATCGCTGCAGTCGATAGTCAACGGCGGCTGGGGGCCTGCGTACTCGCACCCCTTGCCACCGACGGGACCGAGATTCCGTCACCATGGGTCAGATTTACCGACTCCTCTGGTGGGGGGGATCTCGAAGTCGGGAAGCTCCTCCTGAACGGGTCGGTGCGATCAGGGGACTGCCCCCACTACGCTGTCCATCCAGCTGAAGGATGGCCCTAAGGTTACCCTAGGTCACGTAGGCCACGGATTTCCCCTGGCTTTTACGGATGGAGGTTTGTACCGCCTCGGCTCGGACCTGGAGCCTCTGCTTAGGCACCAGCACGGTGAGGAGGATGATATTTGGTCTGTCCGCGACCTTTGTGCCTTTTCCCTTTCTTAAGACTTGTACGCTCCCAGTTGCAGAATCAAAATTAAATTAAATTAAATTTCCAGCGGCAATTTTAAATTTAATTTTGAATTTCAAACGCCCTACTGTCGCAACCTGGCACTGATCCGCACGGTTGATCTGGCAACGCCTCCTCTCAGATCGCCCGCTGCGCTATCAGCTGTTTATCCGCTGCAACAATCGCAAGATAATAGAATTACCTATTTACATGAAACAGGCGCACAATTAACTCAGCGTGATTTGCGGCGCAGAACTATAACGACTCCACCGTGTGATTTTGCCAGTTTGCCGCACACACCATGCGACACAACTTCTATGGTTTCGAGTATTTCGCGCCGCGTAATTTAAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCCGCACCAGGATTGAGTGTCTAAGCCTGTGCGTTCAGGATTAAACTTTGGCAATACGACAGCGTGAGTTTTTTGGGTCTCTTTGTGAGTTTGCGCTTCTTTTAACAGTTCAGAAAAAAATGGCGGTTCACGACTCTAGAATTGTCAACAAATTATTTTCGCACCTATTGTAGTATGCACGCATCGGTTAAGCACTGTACCTATGGCTGTATTCATAATTGTAGCACTCTGTTGCAATGTGTACGCAAACAGTCCAGCACAAGTGTATACGTAATACGAGCACCCAGCGAGGGCTAACATACATAATTGCTGGTCAGCAGTTCTCCCTTTATTAGTATCCTGATCGCTTATGTATTGTGCCTATACCACTCCTCCTCCCAGCACCATCGCTCGGCGACGGTACATATATATATACATATATATAAGATACGCATATAAGCGTTGCTGCGCTTGGCCAGCGGGAGAACTGCTGATTGACAATTGTAATATGTTAGCCCTCAAGTGGGTGCTCGTATTACGTATACGCGGCCAACGGAACATTTATGTACACATTTGCAGCAGAGTGCTACAATTATGAATACGCATAGGTACGATTGCCCAGCCGATATTGCGTACTACAATGAGTGAAAACAATTTTAGCGACGAATTCTGGGGTCGCCAGGTCGCCATTTTCTGAACTGTTAAAGGGGTGCAAAAAACTCACAAGCGTTCTCAATGCAACTCATATTATAAGTTAATCCTGAACGCACAGGCGCGAACACTCAATCTGGTGAAGATTAATTATCACCGTGGCATTGAACGTCTTAAAGTACGATATCATCTCAGGCTCCCTTAATCGGCTTTCCAGTATGGCTTTAAACTAACAAAATGCGATGGAAATCGCCGCCATGGTTCTGCGCTGCAATCGCACGGTGTCGTATATTTCATAATAAATAAATCTTTGATGCAACGGATAAACTTTAACTGTACGGCGAACGTCTGAAGAGGAAGGCACGACAATGATCAGTCGACGTGTTGCATGGAAGCGCGAAATTCAGGTAAATTTACCAAGGTCAAGCCGTTAATTTAATTTAATTGAGCGATTCTGAAGCAACTGGTACCTGAAGTCTTTAAAGAAAACACAAAGATCGCGGACAGGCTAAATAAATCCTCTTCACCGACCAACGTACTAACCGAAGATACGTGATCGAACATTTCAAACCTCATCACGTAAAAAACCGGAAAATCCGGCGTGACCTGACAACTATGATTGATGAACAGCACCGGTGGTATCCCCGATCGCAACATTTCGTTCGAGGAAGGCTTCCCGACTTTCGAGATCCCCACCGGAATCATGGCATCGATCCCCGTCGATGACGGGAAACAGTACCGGCCGACTTATCGACAACGATGCTAATGAAGATGGAGAAACTCTGTACGACCGCAGACGATGGTTTATCGCCATGTTCAGCGTCCCCAACTACCATCGATCTTCGGACGATACTGCTCTCGAACGAGACCGCAATTTCACCGGGATAATGGCGAATCGCTTATCCGCGTTCGAGCAACATTTACATGAACAGGGGACATCCGACTCTCGACCACTTAACAGCTGGGGCGATAAACTGCGGTATAACGACGCACCGCCCAATACTGAACGGAGGTAGCCACCAAAACCACAAAACACTGGCGGTCACCGAATATGATCGAGCGCCGGAAAGCTCTTCGTTGGATAATGCTGGCACAGTGAAGGCATCCATGCCCAACGGTCCAAACCGACAGCCATCTGTCGCCGAAATGGCAGTGCACTCATCGTAAAAGACACGGAAGGCCCGCGCGAAGATGCTTTCGGCGGGATCGACGCAACGAGCTGGTGCAGTCATCGGTACAGTGATCTGCTTGGTGAGGAGAAGCTTCGGCGTTCCCCAGACTGGAAGCGACGCAGAAACTTGACTCTGTGCTGCGCGAAACGCAATAACCATCTTGCGGCGGATTGGTTTCGGGCTGTTTGGCTGAAGCTCGCAGCTTGCTGATGCTTGATTCAGGGCCTTGAATAATCTGAAGAAGATATCGGGGCCTTCGCGGTATGCGGAGATTACAGCAAACTAACCTCGGTCTGCTGAACGCAGTGCGATACCGATCGCGGAAACGGGGCATACCAATCAGACGGATGTCGAATGTCAAACGTCGCCGGGACTCCGACTTACCGAATGCTGAATGTTCGCCGGCTTTATGGCATCGATCGGAAGTTTGTTTAGATGCGTTGACGACGGGCACGAAGACGAAGTGCGTTGCTGCCAAACTCTTGTTTGGCGAATGAACCACCCGACGAACTGCTTTAACGTGCCCGACTGAGCGACGCTAAGACGCCGAGCACGCCAGCTCAAACCATATTGCGTAGTGCAGCTCAATCGGCATTGCGCGGCCTCACAACCCGAACTGGCGCAATAAGCGAACCCACCGCGATCTCTGGTAGTGAACAATCGTCCGTGATATGACGAACAGAACGAAACGGCTATCAATATCGATCGAAGATTCAACTTTACTGTGCGAAGGCCGCTCGCAGCTCTGGCGTGCGCATGTACGGCTGCTTTACGCTCACCGACGTACTGATTCGGCTCTGGAAGGCGCTCGTGAACCTGCAGGCCAGCATTTAGCTCTTACCGGACGAGGCAGCCGGAGACGACAATGATGACGCCGTGCGAAGATGCTGGTCATACTTTGCTGAACGGCCGGAAAACCGACGTTTAACAACGACAGAAGTGCGTCGCTTTATTGACGTTACTGATAAACGGAAGGCGTGAACTGCAACGGCTGGATGATCCTTGACGTCGCTGAGCGACCATGCCCTGATCTCTCCCGAGAACGGCAAACGGCGAGTAAGGCGGCCGGCGCGCAGAGGCCGGCTATCCAGATCGATTCACCAATCCCAAATGGCGGCGGCGAATTTCGTAATAACGATCCGCGACATAATGCGAAATGAGCGCAGCACCAAGCTTCCGTTTGTTGAATAACACTCTAAACCAACTACGCCTCGAGAACTGAAGAGGCTGGCGCAATGACAAAGCAGTACTTACCGTTCGAAATGACGCAGAGTTCAGCGGCATCGCGGCAAAGCGCCGATCGTTTAGCTGCAGATGGCGTGGACAACGATGGGTATAATATCCTACAGCGTTACCAACGACTGGGAAGAGCGACGGCTTAAATCCGACCGGTCCCAACTGACATGCTGGGGAATGGCGAACCACATATCGGAAGACGGCCTGCCCGTGCGTCTGAGCTTTGAAGTCGTCGGGCGGCTATTTCGCTGACGTCCTGACCGGGCTGGCACAATGGCGACTTCTGAACCGAAACGTCTACCAACGGCGAAAAGATGAACGTATAACGATGCTCCGTCGAAATGCTCGGGAGACTTCTCAGAGTCCCTAATTACCGAGGTAATGTTCAGATCGCGAACTATCGTTCGGAACTGCGCGACTACGCCGGCGATTTGCATCACTGCTGGATTGGCGAACATATGACCCAGACTGCTGCGACGAGAAAACTTAACGGTGTCGGTAACAGGCTTCGCTGCTATACGCCAGTCTGGGCTGTGCCGCTTTGCGGGTCTCGCTTACCTGAAAATGGGTCGGTATTTACCCGGTCAATGACCTCGGTAAGTTGAACCGCTATCGAAAGAAGACTTGCGATAACGCTGGTGATCGGAGATCCGAAGACTCTCGACTGCTTATGCCCAGTGGCGGTGAAGACGAATGACGCTATTATCTTGTTTGAACCAGACCTATCAGCATCCGAAGATGACCCGTTTCGACGCAGGTATTTCGCTCAGAGATAACAAACTTGGAATTCGTTATTTATTTTCTTCGTATCTGACCCCGATGACTGTTTTTTAATTTATAGAAGTAAAATAAATGTTGTTTTAATTATGATTTCCTAAATTGCGTTTAATGATAGATAACGCAGTGCGTTAAATCGGGGTGAAATATTTCACGCGGTGTTATCAAACGGACTGTGCTGTCGCCAATTTATTTTGATTTCGGTTAACGACGTTTTCTGTTGCCCCGACCGATCATCAATGAAAATGATGCCAGTATAAAGTGATTCGGCGTCGAAATTGAACCATACTCAACTTTCTGTAGTTTCGTTTGATGATAGATCATTGTGTTTTGCTTGTTCAACTTTGTTGATCGGTGGGAGGTTCATTCGAAGATATTCGTCAATCTCTTTATGTCTACGTACAGGTTGCCAACTTAGATCGAACTGGCATGCCGACATGGCGCGGCAACGGCTTTATATTAACTTGTCTTATAACTGTAACAGCCAGCCTGCAATGACGCCGATAGCCGGTGATAGCACGGAGGAAGAATGATATAGTACGCTATCGGCGATCGGCTGCTGACCGGCGAGGACTTTGATGAGCTGGTATGTATGTTGGCGCCACTTCGAGTGAATTATCGCATTACGTATACGCGATAACAATTATTTATGTACGCATTGCGTCTTACTGATGAATGCGCATGGGTGCGGTCTTAACCGACAATATTGTTAAATACTACAATGAGTGGCTGAACGCTGAACGGATCGTCACTGCGAACTGTTAAAAGTGCTAAAAGACAAAAAAACCGATACTGTCGTATTATGAAGTTGTCCTGAACGCGCGAGGCTTGAACACTTCAATCTGATGCCGGCGTTGGTCTACATCGCCGTGAACGGACGTCTTCAAATTGCGGCGCTTCGAGAACCATGAAATCGACGGTGATGCGGCAATGACGAAATCACTGCGGTGAGTCACGCTGCGCTACTGTCGCATTAATTATTAGCGCTGTTTAATGAAATAGTGATTTATTTCCATCTTTGCGTTGTTACGGCAGATAAACTGACTGATAACGGTACGATCGGTGGATAACCAGATCAACCGTTATTGATCGGTATGTTGGTGATGAGGCGCGAAATCAAAGGTGGAATTTGGAATTAAGCCGTTAATTAATTTGGTGGTACGATTCTGTACTGAATCACGGGGAAAACAGATAGCGGTTGAACAAATATCGTCACTACTTCACCGTGCTGATGCCTAACTGAAGACTCTGTTGTCGGTCGGAGCATTTTCGACCTCTAAAAAGCAAAATCGTGACCTCCGTGAACCTGGTAACCTTAGGCCATCGGTTGATGGTTGGCACGATCGAAGACGTCGTCGCAACATTTAGATTCGGGAAACTCCCGACTTTCGAGGATCCCCGCCGGAATCGACGGCCCGACTTGAATCTCGATCCGTCGATTGACGAAGGTACCAACTACTGGAACCGACTCGTTCGCGGCGATATGTGGGGTGGAAGTGCAACCATCCGACGCGATCAGTGGGTGATGGTTTCCATCATCGCCGTCGCGAACGGAGAAGTCCCCGGCTATTCCCCTCGTCGATAATGGACGACCGCTGCTCTCCGGAACGAAAGGACACCGAGGGGCACTTTTCGGGATGAATAACGGATGCTATCACGTTCAGCGGTACATGAACGAAAGGACGATGTACTACCCAACGGCGCAGCGGCATCACAGACGAACAAAGACTTTCACAAATATGCGCGGTACCGGTGCGAATATAGTCGAACGAAACAACCGTTGATGGCAACGATGACGACATTTAACGAGGTCAAGCCAACGGCCTTCATCTGTCGCCAAATTCTTTAGCGCGAGGGCACTTTCGTATGGGGCGCAGAAGATGCTTCGGAAAGCGGATCGGAATCGGCTTATGGCACTGAACAGTCATGCCGACACCGAAGGACTTCGGAAAGCGTTCCCCAGGGCCCCAGGCGACGCAAACGGCGGCACCAATGAAACTGACTATGCGCAGAAATTTTAATACGCTAACGCGGG
->0937aeb7-9a6c-4ac0-adb6-c3f7e888fb03
-CTCCTGTTAGCCGCCGTTCCAGTTATTATTGCTCTGTATTTTTCAGACAGAAATGTTGCTTGAGTGTCGAAGGAGTTTTGTGACGTTTTAATTTCTTCTGATTTATTGGTATGTCCAATTCCTGGCAGCTATAGCATTGAACGATTTCATTGTGGGGGCTCAATATTTTATTTACATTATATATGTCTGGGTTTTTATTGGAGCTCAATATCTACATGAAACAATAATTTCAGTGACGTTTGGTCCTTTGGCTTTTAATATTACTTATGTTTCTAACAACATGACCTTTTGACTCTTCATCACTTTTAATTTCATCTAAATTTATTGGAAGAAATGCAAATTCTAATATTAAAGCTGAAGTATTATTGGTACTGCACACAATCATTATTAGTGTTTTGATAATTTTGGGGAATTCTTCAATACTTTTAACCATTACTCTTACGTAATCCATAACGTTGAGTCTTATAATAAAGTTCTCCTCTTAATTTTAGTTTAAGATAATGGGTTAGCTTTTCACTTATACCGATGACGTCAGAGAAGATAGATTGGGGGCTTAGCAAGGTTGCACTGTCTTCATTTACCATTTCGGGATCTTCGTTTTTGTTGTATTTGTTTCCTGTTTGTCAATCCAAGTCCTTAAAGAGCAATTATTTGCGCTGGTGCTTGATGAATTGTCAGGGAATCCCCTGTTTTCTTTGAACTTCGGGAGGGGCTTGGTCTCTTTTTAGTTTACCTCTCTGCCATTTCAAAGCAGTTAGATTAACTTCGTCGGTAATAAGCTCTGCTTGAGTATTAAAGAAGACGATGATTGTTGAGGTGCTTATTGTCACACTTCGTGCCTCAAGATATGAAGCCAAAGCAGAACATAGAATAATTCCTATGATATGACGTTTGCAATGACAGTTAACATTTTTTATTTTATAAATTTTTATTTTTCTACTTCATTATTTTTATGAAATATTTTTTCTCGAATTGTAATGACTTCTTTCAGTTTTTTTATATTCCAATTTGATATCTTAAACAGCGCGCAATTTCATCATGTTCAAAATTGGCCAAAACTCTAAATATGTATGTACATATGTAAATTCGATTACTACGATCCAGAATTGATTTCGGCCCGAAACCTTCTAGCACAACACACACATATACGTTTTACTCACACAAACAAAACGGAAATTCTATTTTTTTAGATTTCTTACGCTCAGCATGAGCGAGCGAAGAGAGCAATGATCACCAAAAATTGGCTGCAGATTATATGCAAACCAGTGTAATGGCTGTTACGCATCTTATTATTCCTGAGTGTCTTTGATGCAGGAGCCATTAGCTGACTTTTGCTTAAATGTGTACATACTTTCCAACACGCCACCTCATAAAGTAAGATTGCTTGTACTTTATTACTCGAGACAATGCATTCTGACGAATAATTTTTGATCCAGCATTCGTTGCGAGGGTGTTGGGGAGACAGAAAATTATGAATCAATTGAACATATTATTTATGTAAATTCAGTTTTGCAAACTATTTTAACTAAAATTAATATTAGTCATCTTTGTAGAAATAAAATTATCAGTAACAATTAAAATTTAGTTCAAATGATGAATAGTTAGTTTAGTTGGATTCAGTCTGGTTCCTCGTCAAGTTCAATCTAAGAATATAATGTTTTAATTCATTCTGAGGAGTCCAAGTCCACTTCTCAATGTAATGAATCTTGCAGATGGTACCAGCAAGTTGTAAATTTGTAGAATATATACAGTTTGTCAACTATTTACGCCATGAAATAAGTTGATTTTCACTTTAAAAAAGGTCAAAATTAAAATTTCTAACAATTAAACATATTTTAATGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAACAATTCAAAGTATCAAAATATACAAGAAATTAAACAATTCCAAGTTACACACTTTTGAGTGGCAAGAAACTCCTTACATTTTGTTTTCTACTTTTGTTTTGCTCTTTTTCTTAGAACGAACTCGATTTTTTCGATTATTTTGGCATTTTGCATTTCTTTTTACAACGCTTCTATTGAAATTTTTTACTGCTTGTGAAATTTTTGCTGATCGAATGAGTTGATAAATTTAATAAAATGCCCATGGAAATAGATTAGCTTTTGAAGTGACCAAATAATAATATACTAAAACCAGTTGGGAAAATCTATTCCAGGTAGGTATAAATGTTTTCTGTATCCCGTAAGACCATCTACAATGTTTTTAATCGCTTGAAAAGAGAACGAAAGGCTTGAACCTAGAGTGGTGGGCGCAAACTAAGGTAACAACAGAAGCGTGTAGATTTTGCCATATTAATACGAAAAGTACTTGAACTAGATCTCAGTCAGATCACTCCCAGGATATCAGGCAAGAATGGAAACCTGAATTGTGCCACACAAAACTGTGCGCAAGTCATTCTACGCCATAGGTACTCTTCAAGAGTTTAAGAAAAAGCCTTGCTATCAGGTCAATATAGAAGAAGCGTCATTCATTCCGCTAATGACATGATGGATCATGCGAGTCTGGGATGACGTAATATTTTTATTGACGAACAAAAATGATGCTCTATTATAACGATGGGCCAAAACAGGTATGGCTGAAAACTGTTGAGTTATAGAAAAACAAAATATCATTCCAACAATCAAATTTGGAAAATTACTCAGTGATGATTTGGGGCTGAAAACAGAAGCCATGGGTGAACCAGGTATTTATTGAAGCACTATGAATGGCAATTGCAATATCTAGATATTTTAAAATCAAATTTGAAGGCCAGTGCAAGAAGAATTTGGTCTATTTAGCAGTAACAAATAGATTTTAAGTTTATCAATGATCCCCAAACATAAAGAGTTGCAATTGTACGCAATGGCTCCTTTATAACTGTATTACGGGTGATACCTCAGGTCTTGATCTACGAACCCAAATTTGTGGAGCTACTTAGCAAGAAGAATGTGTGGCAAAGGGGGCGCCAAAACACGACAACAGCTCATGGCTGCGATGGAGTGGGAAAAGAGATCCCACTTGAATATGACCTAAAAAACTCATCCATTCCATGAAAAAGCTTCAACTTACAGCCAAGCCAATGGGGTCGTACTAAATACTACAACTTTTTCAAATTTTAACAAAATAATTTAAAAATTTAGGATTAAACGGAGTTTAGTGTTTTTATTGTGAGAGTTTCTTGAAACTCTCAAAGTGTTAACTTAAGATTCGTTGTTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTTAATTTATAAAATAAATAATGTATTTAAAATATTTCTAAAAAATTGCATTTAGTCAACTAAATAATATGGTATATAGATGCATCAAATTCATCTATTCACAGTGTAATAAGCAATTCTTGACAAATATATACTATTGAATTTATTTTAATTTCAATTGGCACCGACCGTTTTCTGTTACTTTGTGTCGCTGTAAGAGTGATGCCAGTATAAAGTGATTCAGATCCGACATCGAAGTGGGACCGCCTACTCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTGTGTTTTTAGCTGTTCTTTATTTGATCCAATTTGAGGAACGGAGGTCCGCTCCATTCAGAAATTAATTCGTCAATCCTCTTATGATCTACATCCTGGTTTCTTAGCCTAAGTCGAGAACAGCGCTGCCGGCATAATATACAGCACAACAACATATATGTATATATATGTATGTACTGGCTCGAGCGATGGTGCTGGAGGAGGAGTGGTATAGGCTTTTATATATAAACGTCAGCGCTTGTACAACAGAACTACGATGAACGGTGTATGTTAGCCCTCAGTGGGTCGTGATACGTATACACTTGTGCTGGATTGTTGTATGTAATACATTGCAACAGGTGCTACAATTATGAATACATGGGTACAATTAACTAACCGATATGTGTTGCGTATTTATTAGTTAGAAACAGTTTGCTGACATGATTCTAAGTCGCCAGGATCGCCGTTTTCTGAACTGTTAAAGTGCAAAGACTCACAAAGGACCAAAAACTCAATGCTGTCGTATTGCCAGAGAGTTTAATCCCTGAACGCACAGGCTTAGACATCGATCCTGGTGCGAGGAATGAGTCTACATCGCCATTGAGACGGACGTCTTAAATTACGCGGCGCAGTACTCGAAACCATGAAGTTGTATTCCATTGCGGTGTGTGCGGCAAATAGCAAAATCACGTTAGATCGCGCCATGGTTCTGCGCGCTGCACGCGAGTTAATTGTTGCGCCTGTTTCATGTAAATAGGTAATTTATTATCTTGCGATTGTTGCGGCGGATAAGCAGCTGATAATGACGATCTGGAGAGGCGTTGCCAGATCAACCATTGTGATCAGTGTTGTGATGTTGCGACAGTGGGGGCGCGAAATTCAAAATTAAATTTAAAATTAAACCGTTGAAATTTAATTTGAATTGTTACGATTCTGGTAACTAGGGCCTGGTATCTTTAGAAGGAAAAGGCACAAGGTCGCGGACAGACCAAATATCATCTCACCGTGCTGGTGCTAAGCAGAGCTCTGGTGTCAGTCGAGGCAGTACAAAACCTCATCCGTAAAGCCGGAAATCCGTGGCTACGTGACCCTAGGTAACCTTGAGCCCATCCTTCAGTTATTCGGACGGCGGCGCAGTGGGGGCAGTCCCCTGATCCGCAACGACCGTTCCGCTTTCATCTATAGCAGGAAGGTCGGTAACCCGACCCATGGTGACGGAATCTCGGTCCCGTCAGTAACGGGGGTGACAATTTAACCATAGATTGACTATCGACTGCCACCGCAGCGATGCTGTAGAGGTGGAAAATTGGCTCCTGGCATCTACGACCGCAACAAGTCAGAGACGTGGACCATCGCCGATATATCACGCAAAGACGGAGAGTCCCCAGCTTGTTCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCAGAACGAGGACGGGGGCATACCCCAGGATAGATAATGAGATCAGCCCCTTCTATCCACGGTGGACAACGACATGAGACAAAGGCATGGCTTCCGAACTCTCAGCCAGCCCATAACAACAGGGCGATAGAGCTGTACAATTTTCTGCTGACACCAGCGAAGAACAGCGCTATGGACGAAGATACAGAAATACCAAAGAACCACAAAATGCGCAAAGGCGGTACCCACGGTGCGGGTGCCAAAGTCCAGACGCCGAAGCAGGCAACCTACGTTGGATGGCAACGGTGAAGAAAGGCGACATCCATACCTAACGAGGTCAAACCAGGCAGCTATTGCATCTGTCGCCAAGTGCTAGCGCACGGGTGCAGAGAACTCATCGTAAAAGAACGGGAGGCTTCATTACGCAGAGATGCTTCCAGGAAGCTAAGATCGGAATCGAACGCCAGCGAACTGGCAGTCACGTTACGAAAAATCGGAGAACGCAGAAGGTGATCTGTTGCTTGAAGGTGGGGAAAGCTTCGGAAAGCGTTGAAGTTTAAGAGCAACCTGGAAGGCAATGAAGCAACCTCTGTACAGGAGCGCAAAAGAATATCTATCTTACGCTTGGATTGGACGAGGCTACGACAGCAAAATGCAACAGCGGTCGCCCAATTCAGAACCTGCAGATAAATCTGAGATATCGGGGGCCTTCACGGTATGCGGAATTGCAAGCAAATAGCCTCAGTGCTGCTGAAGATTTTGAACGTTGCGATACCGAAGTCCCTATTAAACAGGTATAATCGTTGGATGGTCAAGTATTAAATGGACGCGATCCGACCCACGAGATGCCACAGGTGTCTCGGCTATGGGCATCGATCAGCGGCTGGGACACTGAAACCCAGGGCAGACTGCTGTCTTAGATACGGTGAGCGTGGGCTAAGGCAAAGAGTTGCGTTACTTGCGCAAAATGCCTGATCTGCAGCATTTTAGCGAATTGGACGAAACCGACGGGTAACGCCCACTTTTGGAACGACACTAAAAGATTGCCAAGAACCGCACCTTAATTACGCTCATTGGCGTGGTACAGCTCAGTAATCAATCTCGGCGTTGCGCAACTGGCTCAGAGCCTCACAATGGACGGTTGGCGCAATGTAGCATCATGCTCTAAGCGAACCCCATTCTCTGGTGGTGGACAATCGTCCATGATCGCCAACGAACGGGTAAAGCTATCAAATGCTGCAGCTCTCAAGTCCAGGAACGCTGGCTGCTTTACCAATGCAGGTATCGCTTATGCGAAGTTAAAACACGTGCACATGTACAGCTACGCTCCGCCAGAGGCGACACCCCGATCAGTTCGAACTTCTGGAGGCGCTCGTGGACCGAGAGGCGAAGCCCGAAGGTCGATACCGACTTTAATGCCTGGACGGTGGAATTGGGGCAGCAGGACATCAACGCAAAAAGGACGAGCTGTGATCCGACGCCATGCGAGTACTGGACCCTCATACTGCGCACTGAACGATGGACGGAAGCCGGTTTTAACTTAACGATGAGGTACGTCCTTTATTGTTACCTTTGTCAGCCGAGGAGCTAGTGGGCAATAACAACTGGATGAATCCGCGTCGCTGAGCGACCATTGCCCTGATCTTGGAGGGCATGCCCAAAGACGGCAGAGTGAACGGCCGGAAAACATGGTACCAGGAAGATCGATGGGCCATGCTGGCTATCAGATCAATTCCCTGGAAATCCCAAAATGGACGCAGAGTATGGCGAGGCCTCATGAATATGCTGGGGTAGATCACGACATCAGCCTGCAAAGGAAAAATAAGGCACAGCGCAAACCACCGCCGTTTACCAATGGTGGGTGCACTCCCCTAATAACTACGGTCTGATTGCCTCAGGGGCTAAAGAGAACGGCGCAACGAGCCAGAGGCAGTACCCACCATGGGCTCTTGGAGCATACAGAGTTCAAGCACGGCATCACTGGCTGCCAGCGCAGTCGTTTGGAGCCTGGGATGGCGTGAACGGCGATATCTGGGGCCTCGCCACCTGAAACTGTACCAACGAGCTAAGGAGAGCGGCCATCCGACAGGGGTCTGGCTAACATACCCAGAACTATTTCCAGAAACGAGACCACTATAGGCAGGTGGCAGGGCAGCTACCCCAATACCCGATGCGTCTGGGGCAGTCGTCCCGGGCAGCGTTTCGCTGACGATGGCAGCAATCACAGCCGGGCGGCTAGCAATAGCAGCTCTAAGACCGAAACGGTCCTACTAAGCAGCAGGAAAAGATTATGGAGAACAATACTGGTCTCGTCAAAGGGGTACTCGGGGACCTCTCAGGTCCCTAAAGAGTACCTGGGGTAATGATAGATCCTGAACTATCGTTCAAGGACCACGCGAAACTGCCAACAGACAGCAGTCACATCCCTCTTCGTTGGCAGGCTTATGCCCAACGTCGGAGGCCCAAGACACCCGGCCGGAAACTGCGGTGTCAGTGGCAAAGAGCTTGCTTCGCTGCTATACGCTGCACCAGTCTGAACAGTACCACTTCCTGGGGTCTCATACCTGAAGGAGCTCGTTCGGTGCTACGGTCAATGGCCTCAGGCTCTGATGGGGGATTCAAGGACCATATCGAAGACGCGGCGCTAGCGCTGGCAGGCCACCGATTGATCTGGAGATCGGGCTCTCCAGCCTTATGCGAAAGTGCTTCCGGAGCAAGAGCACACAGGTGGCTATTGGGTGAATGGCGAGCAGATGGCAAACGTCGCGACGGGGAGGTGGACCTATCAATCGTAGAGATGACAGTTTGGGCAGTGAGCACTCTCAAAGTGTGTAAACGGAATTTGTTATTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTAATTTATAAGTAAAATAATGTTGTTTAATTATATTTCCTAAAGAATTGCGTTTAATTAAGCAAATAACCCTTAATTTTGACGTTAAAATCTAAAAGAAATTCATCTTATTTCACGGTGTGTAAACAGTTTCTTGACAAATTGTACTTGTCCGCAGATTTATTTTAATTTCAAAGTTAGCTGACCGTTTTCTGTTACTTTGTCCGCTGTGAAGGTGATGATACCGGTATAAAGTAGTTCAGATCGACATCGGTGGAACCCATACACTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTATTGTTTTAGCTGTTCTTTTATTTGATCCAATTTGTGAGGAACGGGAAGGTCCCGCTCAATTCGAGAAATTAATTCGTCAATCTCTTATGATCTACATTTCTAAGGTTTCTTAGCTAAGTCAGGGCAGCGCACTAAGCGTAGCCTGCAACGCAACAGCAACTTATGCGTATCTTATATATATGTATATATATATGTACTGTCGCCGACGATGGTGCTGGAGGAGAGTGGTATAGGCACACATAAGCGATCAGCGCAGCCAGCGGAGAACGCGACCAGGCAATTATGTATGTTAACCCTCAAGTGGGTGCTCGTATTACGTATACACTTGTGCTGGTTGTTTATGTACACATTGCAACAGGAGTGCTACAATTATGAATAATACACATAGGTACAGTGCCCAACCGATAATATGTGGTACATACTACAATGAGTGAAAACAATTTGCTGACAATTCTAGAGTCCACCCAGAGATCGCCATTTTCTGAACTGTTAAGAGTGCAAACTCACAAGACCCAAAACTCAATGCTGTCATTGTTGCCAGAAAGTTTAATCCTGAACGCACAGGCTTAAGACACTCAATCCACAGTGCGGAGACCAAGTCTGTCCTTATTGAGACGGACGGCGTCTTCTGCGCGAAGTACTCGAAACCATGAAGTTGTGTCCTGACGGTGTGTGCGACAACTGGCAAAATCCGCACGGTGGAGTCGCGCCATGGTTCTGCATGCAATCACGCGAGTTAATTGTGCGCCTGTTTCATGTAAATAGGTAATTTATTATCTTGCGATTATTTGCAGCGGATAGGCAGCTTATTGATAGCGCAGCGGGCGATCAGAGAGGAGGCGCGTTGCCAGATCAACCGTGTGATCGGTGTTGTCTGTTGCGACGGTAGGGCTGAAATTCAAATTAAAATTTAAAATTAAGCCCGTTGAAATTTGAATTTAATTTAATTTTGATTCTGGCGGTAACTGGGGCGCACAAGTCTTTGAAAGGAAAAGGAGGCACAAAGGTCGCCGGACAGACCAAATATCATCCCTCTCACCGTGCTGGTGCCTAAGCAGAGGCTCACAATTGTCAGTCGAACGTACAAACCTCCATCCGTAAAGCCAATCCGTGGCCTACGTGACCCTAGGTAACTATGACCGCGTCCTTCAGTTGATGGACAGCACAGGTGGGGCAGTCCCCTGATCGCAACGACGGTCGGGAGGGAGCTCCCGACTTTCGAGATCCCCACAGAGTTGTGGGTTGGTGGGTTGAAATCGTTGACGCTATCGACTACGCGGCGTGCTGTAGAGGTGGAAAGTAGCTCCACAGCATCTGACCCGCGACAAGTCAAATGGACCCATCGCCGTGCCATCACGCAAAAGACGGAGGAAGTCCCCAGCTGGTTCCCCTCATCGGTCTTCGGACAGCCACTGCTTTCTCAGAACACGAGGGGCATACCAGGATGTGAATCAGCCCCTTCTATCCGCATTCAGACCAACGACACATGAGAGACAAAGGCGCTTAGCTTCCGAACTCTCAGCCCTTAACAACAGGCGATAGAGCTGTACGAATTTACTACTAGCGAGCACCGCGAAGAGCAGCGCTACCAGACGAGTGAAAGCCTACCAAAGGCTCCACAAAGTAGGTACCCACGGTGCACGAAAGGTACTCAAGTCCAGGCGCCGAAGCAGGCCTACGTTGGATGGCAACGGTGAGAAAAGGCGACATCCATACTAACGAGGTCGAAGCCAGACGTATGCGTCTGATAGCCAGATGCTAGCACGGGTTGCAGAGGGGCACTCATCAAAAGACGGGAGGCTTCGTGCAGAGATGCTTCCTTTGGAAGCAAGATCGGAAGTCGAGCCTTAGCGAACTGTAGTGATCACGTGCGAAAAATCCAGGCTGCAAGAAAGGTGATCTGTTGCTTGAGGTGGGGAAAGCTTCGGAAAGCGTTCCCCAAATTTAAAACGACTGGCGCTCAATGACAACCTCTGTGCGCCTGGAGCACCAAAGAGCCAGCTCTATCTGCAGCAGTTGGACGGGCTGGACAGCGAGCTCCGCAACTGCTTGGTCATGAATTCCAGGGCCTGCAGATAAATCCTGAGATATCGGGGGCCTTCGCGGTATGCGGAATTGCAAAACAAATGGCCTCAGTGCTGCTGAACGCGAACGCGTTTGCGATACCAGTCCTTAAACGGGGCACCATAATCGTTGGATGGTCAGAAGATGTCGGTATCTGGGACGTCCGACCCACGAGGATGCTTACGGTGTCTCGGCTTATGGTATCGATCAGCAACCTGCAGGACACTGACAGGGCAGACTGCTGTCTTAGATGCGGTGAGCGTGGAGCTAAAGACGGGGGTGCGTTTACCGCAAATGCCTGATCTGCAACGGTGTGGACGAAAATTTCCACCGACGAATTTGCACGTGCCACCCGACTTACAGAGCATTACTAAAGATGCCAAGGAGCCACCTTAATGCGCACTCCTTGATAGCGGCAGGTACAGCTCAATGTCAATCATTGCGCAGCAGCTCGAAACCTCTGGCCCAGACTGCGGTTGAGCGCAATGAACATCATGCTCCTAAGCGAACGATCTCTGGTGAGTGGACAATCATGATCGCCGACGAAGACGGGTAAGCAGCTATCAAATGCTGCAGCTCTCTCAAGTCAGGAACGGCTGCTTTACCCAATGCGAAGGGTATCGCTTATGCAGTTAAAACACACATGTACAGCTATACGCTCCGCCGATGCGGCACCCGATCAGTTCGAGGAGCTTCTGGGCGCTCGTGGACCATGCGAGGGGCGAAGCCCGAGGTCATTACCGGCGACTTTAATGCCTGGACGGTGATGGGGCAACGGGACATCAACGCAAAGAGGGACGAGCTGTGATTGACGCCATGCGAATGCTGGACCTCATGCACGCTGAATGATGGACAGGAAGCCGACGTTTAACAACGATAGAGGTACGTCAACATTGACGTTACCTTTGTCGACGAGGGGCTAGTAGACAACAACAACTGGATGGTCCATGACGTCATGACACGCTGAGCGACCCATGCCCTGATCTCCTTCTCCCCGGAGGGCATGCCCAAAGACGGCAATAGAACAGCCGGGAAAATGGGACACCAGGAGATCGATGAGCCATGCTGGCCTATCGGATCAATTCCGTCAAATGTGGACGCAGAGGTATGGCGGCAGGCCTCATGAATATGCTGGAAGATCTGCGACACAATCATGCCAAGGAAAAATAAGGCTTTTAGCGACTTCACCGTTTACTGGTGGAGTGCCTCCCCTAAAGCCAACACGGTCTGATTGCCTCAGGGGCTAAAGAGGAGACGGCGCAACGAATGAGGCAGTACTGCTCTTGGGAGGCTTTCGGAAACGCCTAGAGTTCAAAGCACGGCATCTGCGCGGTCGATTTAAAGGAGCTGCAGGATGGCGTGAACAGCGTTATCTGGGGCCTCGCCACCACAAAGCTTGTTACCAACGCAGACTAAGGAGGGAGGCAGCAACCCATCGACCCAGGGTCCCTGGCTATACTAGGGGAGCTATTTCGAGCAGACCACACTATGGGTAACAGGCAGCCTACTTGAATTTGCCGATGCGTCACAGAACTTGAAGTCGTCAGGGCAGCTGTTTCGTATTGTCACAGCCGAATTTCGCAATAGCGGCTCACAAGACCGAAACGGTCAAGCAGCAGGAAAAAGATGGAACATGCTATTGGTCTCCGTCAAGGGTACTCAGGGGACCTCCTCAAAGAGTCCCTAAAGTGCCTGGGGGTAATGATAGATCGCAGACTATCGTTCAAAGGACCACGCGAGCTACGCCAAAGCGAAGACAGCTTGAGTCACATTCGTTGGCGGGCTTATGCCCAACGTCGGAGACCTGACCGGAAACTGCTGAAGGTGTCAGTGAAAGCAGAGCTTCGCTGCTATACGCTGCACCAAGTCTGGAACAATGCCACTTACGGGGTCTCATGTACCTGAGAAGGGAAGACTCGTTCGGTGCTACAGTCAATGGCCCTCGAAGACTCATTAAGGATTCGGATAACTATCCGAAACGCGGCGCCTTAGCGGAGCCTACCGATTGATCTGGAGATCAAGGCTCTCAATATATGCGGAGTGGCGCTTCGGAGCAGAGGGCACACAGTGCTTCTATTGAATTGAATGCTTGAGCGAAGATGGCAAACTTGACGTCGCGACGAGTGGACCCTATCAGCTCATCCAAAAGGATGACGGTTTGGAGCGAGTGACACTCTCAAAGTGTGTAAACTGGAATTTGTTATTTATTTTTCTTGTATGTTGATATTTTGAATTTGTTTTTAATTTATAAAGTAAAATATATGTGTTTGAAATTATATTTCCTTAAAAAATTGCGTTTTAATCAAACAAATACCGTTAATTTTGACCTTTAAAGTCAAAAATTCAACTTATTTCACGGTGTGTAGTAGTTTCTTGACAAACTGTAGCTGTACTTGTCGCAGATTTGTTAATTTCTAAGTTAGCGACCGTTTTCTGTTACTTTATTGTCCACTTCTTTCATTTTGCATATTATTAGAACATTCTCTACCTTGCAACAGCGTGGCAAATAACTGTTTCAAAACAAAACCTCCGCTCTCTCTCTACAATCGCTTGTCAAAGCTCACCGGGTTTGCCAAGGTATTTCATCCGTGAAAACGGGATGTGTTATAAGTTGCACACCATCTTCTTTTACGCGGTGCAACTTGTACTTTGTCCAACTATGAGCGTACCAGTCCGTAGAGTTCTTGCCCGCGCTTATACGGGGTACTCCTTATCTATAGTTCAGATTGTTCATCTCGTCCCTTACGGACACACTTCATCCTTAGTGACGATGATGCATGAGCTACATCAAACGATTTTAATCATCGCCGCTTGTACCAATAAACCTCTCGAATGAGGTGACCAGCAAACGCCACGGGGAAGTTGCGCCCTCTCTCGGCGAACCTGGAGCAGTGCAGTAGGATGTGCTCTGCGGTTTCCACTGCGTCTGTGCAATAGGGCACTGGGCTGTATCCGTGAAGCGGAACCTACGGTACCCTCGAAGCAATATGGTCCGTGGAACTGGGTCGTAATGGTGATCCACCATTTTGTGCTCGCAATCAGCCCTCCGTTAGTTGCGGAATGGTTTGTAGAGTCCAGCGTCCCCGTTGTGACTCTTGCCACCCTGGTCACCGCCATACTCAGATCCACTCTTTTATTGATCTCTAATGGCGATTGTATCCCTCACTCGCAAGTATTTATCCAGGTCAATGGGTGTAATGCCGAACCTGGAGCGTGCTGCGTCATCCGATATGGTTCACAAAACCTCTGATTAGCCACAACGAAAGAGCCATTGTCCCGTATTACTGCGCGGGCACTATTATCTGGAATAGGTTTTCTTTGTGGAAACGCTGCAGCTCCAGATAGGCGCAGCATGAAGCAGTGTTGCCGCTGACCGCCACTAACAGTCTCTAGCCGGCAGTCTGGGTCCTCCCGTTGGGCATGATTCTCGCAAGGCTGCTGCCAATGCATTTGCCGCTTTTGCTGGCATACCTTGCGTGAGCGAAGACGAGGCAACTGGTAGAACCCCTTAAGGTGGTATTTCAACGTTTCTGCTGAGGGCGATTTCAACTCCTTTGACTTCCACGCATTGCACTCAATGGACTTTA
->834cd6b9-2700-41bb-a877-4721917e016b
-TCGGTACTTCGTTCAGTTACGTATTGCTGGAAGCTATGCCCTTTGTCTCATGTGTCGTTTGGGTCTCGAATGCGGATAGAAGGGGCTGATCTTGCCATTCATCCTGGTAAAGTATGCCCCTCAGGTCCTCGTTCTACGGAGAGCAGTGGTCAGATCGAAGACCATTGAGGGAACCGGCTGAGGGACTTCCTCCGTCTTTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCCTGACTTTGTCGCGGTCGTAGATGCTGTAGGAGCCAATTTCTCCACCTCTACAGCATCGCTGCAGTCGATAGTCAACGGCGGCTGGGGGGGCCTGCGTGCTCTGCCACCGACGGGACGAGATTTCCGTCACCATGGGTCGGGTTACCGACTCCTCACGGTGGGGATCTCGAAATCCGGGAAACTCCTCCTGAACGAGGTCGTTGCGATCAGGGGGGGACTGCCCCACTGCGCTGTCCATCAACTGAAGGGATGGCCTAAGGTTACCCTAGGTCACGTAGGCCGCAGTTTCCCCTGGCTTACGGATGGAGGTTTGTACCGCCTCGACTCGAGACTTACCAGAGCCTCATAGCAGGCACCAGCACGGTGAGGATGATATTTGGTCTGTCCGCGACGCGCATTGCCTTTTCCCTGTAAAGACTTGTGCGCTCCCCAGTTACCAGAATCAAAATTAAATTAAATTAAATTTCAGCGGCAATTTTAAATTTAATTTTGATTTAAACACTGTCGCAACACAACACTGATCACACGGTTGATCACGGCAGCGCCTCCCTCTCCGAATCGCCCGCTGCGCTATCGGCTGTTGCATCGCTGCAACAATCGCAAAGATAATAAATTACTATTTACATGAAACGGGCGCACAATTAACTCGCGTGATTGCGGCGCAGAACTATGTGCGACTCCACCGTGTGATTTTGCCGGTTGCCGCACACACCGGCCGACACAACTTCTATGGTTCGGTATTTCGCGCCGCGGCAATTTAAGACGTCCGTCTTCGGCGATGTGAACTTGTTCTCCGGCTTCAGGATTGAGTGTCTAAGCCTGTGCGTTCAGGATTAAACTTTGGCAATACGACAGCATTGAGTTTTTTTTGGATGCTCTTTGTGAGTTTTGCACTTCTTTTAACAGTTCAGAAAAATGGCGATTCTGCGACTCACAGAATTGTCAGCAAATTGTTTTTCACTATTGTGGTATGCACACACATCGGTTAAACGCGTACCTATGTGTATTCATAGTCAGCAGCACTCTGTTGCAATGTGTACACATAAACAGTCCAGCACAAGTGTATGCGTAATACGAGCACCCGCGAGGGGCTAACGTACATAATTGCCTGGTCCGGCGAGTTCTCCCGCTGTGGCGCGATCGCTTATATGTGTGCCCTATACCACTCCTCCTCCAGCACCATCGCTCGGCGACAGTACATATATATATACGCCTTATATAAAGATACGCATATAAGCGTTGCTGCGCTGCAGGCTATGCCGGCAGCGCTGCTCCCCTCGACAGGCTAAGAAACCTTTTGTATGTGAATCATAAAGAGGATTGACGAATTAATTTCGAATGGGCGGGACCTTCCTGTTCCTCAAATTGGATCAAATAAAGAACAGCTAAAACACAAATGATCTATGACACAATGAAACTACGGGAAGTTGAATTGGGCGGTCCCCACTTTCTGATGTCGGATCTGAATCACTTTTATACTCGGCATCACTCTCTACAGCGAACAAAGTAACAGAAAACGGTCGTTAACTTGAAATTAAAAATAAATCTGCGACAAGTACAGTTTGTCAAGAAACTGTTTACACCGTGAAATAAGATGAATTTTGATTTTAACTTTGGATCAAGTAAAGGGTTATTTAGCAATTAAACGCAATTTTTTTTTAGAGAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAAACAAATTCAAAATATCAAATATACAAGAAAATAAATAACAAATTCAAGTTTACACACTTTTGAGAGTGTCACTCTGCTTAAACCGTCATCTCTGGGATGACTGATAAGGTCCCGCACTCCCCTGCCAGCGCCCAGCGCCCGCGTCTTCGGATATGGTCTGAATCCTCTAATGAGCCTGAGGGGCTTATTGACCGTAGCACCGAACGAGCTCCTTTCAAGGTATGAGACCCTGCAAATTGGCATTGCTCCAGACTTGGTGGCGGCGCCAGCAGCGAAGCCTTTGCTACTGACACCAGCAGTTTCCTGGCCGGGTGTCTTGGGCCTCGACGTTGGGCATAAAGCCTCGCTCAACGAAGAGGATGTGACTGCTTTATCTTCTTGCTGGCGTAGCAGCTCGCGTGGTCCTTGAACGATGGTCTGCGGTCTATGTTTACGTTGGTTGAGACTCTTGAGGGTCCCCTGAGGTACCCTTGACGGAAGTTTCAGCATGTTCTCCATCTTTTCCTGCTGCTGGTAGGACTGCTTCGGTCTTGTGAACCGCTATTGCTAACCCGGCTGTGATTGCCCTCGTCCGGCGAAACGGCTGCCTCGACGACTTCAAGTTCTGTGACGCACGGGAAATCTGGGGCGGGGCTGCCTCTGTTGGCCTCATGGTGTGGTCTGCTTTGGAAATAAACTCCCCTAGTATGTTAGCCAGGACCCCGAAGGTCGGATGGGGTTGCCGCTCTCTCCTCCCCAACTCGTTGGTAAACAAGCTTGTAGGCGGGCCAGATATCGCTGTCTACGCCATCCTGCAGCTCCTTAAACGACCGCTTTGGCAACCACGATGCCGTGCTTGAACTGGGCGTTTGCTTCTGAAAGCCTCCAAAGAGTTCGCGTGGTGGGTACTGCCTCTGGCTCGTTGCGCCGTTCTCTTAGCCCTGAGGCAATCAGGCCAACAGGCCGGCAGGAGGCACTCACCAGTAAACGGGTGGTTTGCGCTGTGCCTTATTTTTTCCTGGCATGATTGCGTCGCAGATTCTTCCAACATATTCATGAGGCCTGCCGCCATACTCTCTGCGTCCACATTTGAGTTTCCAGGGAGTGATCTGATAGGCCAACATGGCCTCATCGATCTCCTGGTGTCCCATGTTTTCCCAGCTGTTCTACTCTGCCGTCTTTTGGGCATGCCCTCGGGGAAGAAGGAGATCAGGGCATGGTCGCTCAGCGTCATGACGTCATGGACCATCCGGTTGTTGTTGTCTACTAGCCCTCTGCTGACAAAGGTAACGTCAATAAAGGACGTACCCTATCGTTGTTAAACGTCGGCTTCCGTCCATCGTTCAGCATTATGAGGTCATTCGCATGGCGTCAATCACAGCTCGTCCTCTGGTGTTGGATGTCCTGCACCTTTATTCCGCTATCTTCCAGGCATTAAAGTCGCCGGCAATGACCTTCGGGCTTCGCCCACTCTCGCATGGTCCACGAGCGCCTCCAGAAGCTCCTCGAACTGATCGAGGTTGTCGCTCGGCGGGCGTAACAGCTTCAACATGTGCGTGTTTTAACTTCGCATAAGCGATACCCGCATGGTAAAACAGCCAGTTCCTGGACTTGGAGAGAGCTGCAGCATTTGATAACTGCTTTTACCTGCCTCGTCAAGGATCATGGACGATTGTCCACTACCAGAACGTAGGGTTCGCTTAGAACATGATGTCTACGTGCGCTCAACCACCCAGTCTGGGCCAGGGCTCTGAGCTGCTGCGCAATGATTGACATTGAGCTGTACTACGCTAATATGAGCGTGCATTAAGGTGGCTCTTGGCATCTTTTAGTGTCGCTCTGTAAGTCGGGCGCAAGCTACCGTCGGTGATTTCTGTCCACCTCGCTGCTGCAGATCCAGGCATTTTGGTGCAGCAACGCACTTGCCTTGTGCTTACGCTCACCGCATCTAAGACAGCAGTCTGCCCTGTCAGTGTCCTTACGGGTTGCTGATCGATATAGCCGAGACACCTGTAGCATCTCTCGTGGGTCGAACGTCTGGGTGATACGACATCTTGACCATCAACGATTATGGTACCTGTTTAAGGACTGGTATCGCAACGTTCCGTTTAGGCAAGCACTGAGGCTATTTGCTTGCAATTTCATGCTGCGGAAGAATTCCGATATCTTCAGGATTTATCATGCAGGCCCTAGGTGGGCGACCAAGCAACTATTGAGCTTCTCTGCTGTCGTAGCCTCGTCCAATCCGCTGCAAGATAGGCTATTCTTTGCGCTCCTGATAGCACAGAATGAAGTCGTGACGCCGCTTCCGGGTCAGCTCTTAAACTTAGAGGAACGCTTTCCGAAGCTTTCCCCTCTACCTCAAGCAACAGATCACCTTTCTGCGTTCTCCGGATTTTTCGCACGTGACTGCCAGTTCGCTAAAGGCTCGATTCCGATCTTAGCTTCCGAAGCATCTCTGCGTACGAGCCTCTCCTGTCTTTTGATGAGGTGCCTCTGCACCCGTGCTAGCATTCTTGGCGACAGATGCACTTAACTGCCCACAACTGAACTCGTTAGGTATGGATCAATGCGCCTTTTTTCTTCACCGTTGCCATCCAACGTAGGGGTTGCTCTGCTTCGGCGCCTGGGCTTTTACGGCACCTGCACCGTGGTACCTGCGCATTTTGTGGAGCCTTTTGGTAGGCTTTTTTGTACCTCCGTCTGGGTGGCGCTGCTCTTCAAGCGGTGCTCGCTGATAGTACAACTTCGTACAGCTCTATCGCCCTGTTGTTAAGGGCTGAGAGTTCGAAGCTATGCCCTTTGTCTCTCATGTGTGTCGTTGGGTCTCGAATGCGGATAGAAGGGGGCTGATCTTGCCATTCATCATGGTAAAGTATGCCCCTCGGGTCTCGTTCTGGAGAGCAGTGGTCAAGTCGAAGACCGATGAGGGGAACAAGCTGGGGACTTCCCTCCGTCTTTTTTACGATGGCACGGCGATGTGGTCCATCGTCTTCTGACTGTCGCGGTCGTAGATGCTGTAGGAGCCAATTTCTCCACCTCTACAGCATCGCTGCAGTCGATAGTCAACGGCGGCTTCTGAGAGCCTGCGTGCTCACCCTTGCCACCGACGGGACCGAATTCCGTCACCATGGGTCGAGGTTACCGACTCTGGTGGGGATCTCCGAAGTCGAGGAAGCTCCTCTGAACGGGTCGTTGCGATCGGGGGGGACTGCCCCACTGCGCTGTCCATCAACTGAAGGATGGCCCTGGGTTACCCTGATGCGTAGGCCACGGATTTCCCCACAACACGGATGGAGGTTTGTACCGCCTCGACTCGGACACCAGAGCCTCTGCTTAGGCACCAGCACGGTGAGAGGATGATATTTGGTCTGTCCGCGACAGCATTGCCTTTCCCCTTTCTTAAAGACTTGTGCGCTCCAGTTACCAGTCAAAATTAAATTAAATTAAATTTCGACGGCTTAATTGCAAATTTAATTTTGGTTCGCCCTACTGTCGCAACACAACACTGATCCGCACGGTTGATCTGGCAAGCGCCTCCCTCAGATCGCCCGCTGCGCTATCGGCTGTTTATCCGCTGCAACAATCGCAAGATAATAAATTACCTATTTACATGAAACAGGCGCACAATTAACTCGCGTGATTGCAGCGCAGAACTATGGCGCGACTCCACCGTGTGATTTTTGCCAGTTTGCCGCACACACCGGCCGACACAACTTCTATGGTTTCAGTATTTCGCGCCGCGTAATTTAAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCCGCACCAGGATTGAGTGTCTAAGCCTGTGCGTTCAAGGATAAACGGCAATACGACAGCATTGAGGTTTTGAATCTCTTTATTGAGGTTTTGCACTTCTTTTAACAGTTCAGAAAAAATGGCGATTCTGCGACTCTAAATTGTCAACAAATTGTTTCACTATTGTAGTATGCACACATATCGGTTAAGCACTTTGTGTACCTATAGCTGCCAGTGTAGCACTCTGTTGCAATATTGTACATAAACAGTCCAGCACAAGTGTATGCGTAATACGGCATATGAGGGGCTAACATGCATGGTACCGGTCGGCATTCTCCCGCTATTGGCGCTGATCGCTGCTATTATTGATAGCCTATGCCACTCCTCCTCCAGCACCATCGCTCGGCGACGGTACATATATATATACATATATATAAAGATACGCATATAAGCGTTGCTGCGCTGCGAGTATGCCGACATGCGCTGCTCCTCGACTTAGGCTGAAAACTTTGTATGTAGATCGCCAAAGAGGGATTGACGAATTAATTTCGAATGGGCGGGACCTTCCCTGTTCCTCAATTGGATCAAATAAAGAACAGCTAAAACACAAATGATCTATGACACAATGAAACTACAGGAAGTTGGAGTAGGCGGTCCCACTTCTGATATGGGATGAATCACTTTATACTCGGCATCCTCTCTACAGCCGGACACAAGTAACAGAAAACGGTCGTTAACTTGATTAAAAATAAATCTGCGACAAAATTACAGTTTGTCAGAAACTGTTTACACACCGTGAAATAAGATGAATTTTTTTGATTTTAACGGTCAAAATTAGGGTTATTTGCTTAATTAAACGCAATTTTTTTAGGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAAAAACAAATTCAGAAATATCAAATATACAAGAAAATAAACAACGAATTCAAGTTTAAACACTTTTGAGGTTTCAAGAAACTCTTTACACAAAATACTAAACCTAAGAAGTTTAATCCTAAATTTTAATTATTTTGTTAAAATTTGAAAAGTTGTGGTATTTAGTATGACCCCATTGGCTTTTGGCTACAAGTTGGAAGCTTTTTTTTCATGGAATGGATGAGTTTTTTTTAAGGTCATATTCAAGCGGGATCTTTTCCCACTCTATCATGACCATGAGCTGTTGTCGTGTTTTGGTGCTTGCCCACATTCTTCTTTAAGTGGGCCCACAAGATTTTCAATGGGGTTCAGATCAAGACTCTGAGGGGCGTATCGATCACCTTGCCACAGTTATGAACGGTTGCATACGTGCACTCTTATGTTTGGGATCGTGTCCTGATAAAACTTAAAATTTGGCTTGTTGTTGCTAAATGAACCAAATTACTGCACTGGCCTTCAAATTTGATTTTAAAATATCTAGATATTGCACGGCATTCCTTAGTGCTTTCAATAAAGGCTAATTGCTTACTCCGTAACGAGATACAGCCCCAAATCATCACTGATAATTTTCCAAATTTGATTGTTGGAATGATATTTTGTTTTCTAGCGCACTCAACAGCTTGCGCCATACTCTGCTTGGCCCATCGTTATAATAGAGCATCATTTTTGTTTCGTCACAAAATATTGCGTAACCAGTACTCTTCCGCATGATCCATCAATGCTCACAGCAAAATGAATGACGCTTTTCTATATTGACCTCTGATAGCAAAAGGCTTTTTTTCTTTTAACTCTTGAAGAGTACCTATGGCGTAGAATGACTTGGCGCACAGTTTCAGTATTAACACAACTAGGTCATTCTTGCCTGATATCTGAGCAAGTGATCTGACCGAGATTCGGGGTTCACCAATCACTTTTTTTCGCATAATAAGGCCGATCTACGCTTGCTAATTTTAGTTTGCGCCCACCACTCTTGGAGTTCAAGCCTGTTCTCTTTTTTCCAAGCGATTAAAAACATTGTAGACGGTCTTACGGGATACCAGAAAACATTTATACTAATTCTGGAATAGATTTTCCCAACTGGGGTGGTTTTGGTATATTATTTGGGTCCTTCAAAGCTAATCTATTTCCAGGCATTTTATTAAGTTAATAACTCATTCGATCAGCAAAATTTCACAAGCAAAGTAAAAAAATTTCAATAGAAGCGTTGGCAAGGAATGCAAATGCCAAAATAACGGAAAAAATCGAGTTCGTTTAAGAAAGAGCAATAAGTAGGAGAAAACAAAATGTGTAAGGGAGTTCTTGCCACTCTCAAAGGTGTGTAAACTTGGAATTTGTTGTTTAATTTCTTGTATATTTGATATTTTGAATTTGTTTTTTTTTAATTTATAATTAAAATAAATATTGTTTAATTATATTTCATTAAAAATTGCGTTTAATTAAAATAACCCTTAATTTTCGACCTTTAAAGATGAAAAAATTCAACTTATTTTGCGGCGTGTAAACTAGTTTCTTGACAAGCTTTATATATCAAATTACAACTTGCCGGTACCATCTGCAAGATTCATTACATTGAAATTGGACTTTGACTCTCAGAATGAATTAAAACATTATATTCTTAGATTGAACGACGAGGAACCAGACTGAACTAACTAAACTAACTATCATTTAACTAAATTTAATTAAGTTTACTGATAATTTTGAGGTTTCTTACAAAGATGACTAATATTAATTTTTTAGTTAAAATAGTTTGCAAAACTGAATTTATGTAAATAATATGTTCAATTGATCTGGTTGGGTTTTCTGGGTCTTCCCCAACACCTCGCAACGAATGCTGGATCAAATTATTCGTCGAAGGACGTTGCTGATACTCGATGAGTAATAAAAGAAGTACAGCAATCTTACTTTTGAGGGTGGCGTGTTGGAAAGTAGCCGCACATTTAAAGCAAAAGTCACATGATGCATCAAAGACACTAGAATAATGGATGGTAACAGCCATACACACTGGTTTGGCACTAATGAAGCCACTTTTTTTTGGTGACGACCAAAGTAGCTCTCTTCCTTTCGCTCACGCTGAGCGTAGAAATCTAAAATAAATTTGCTTGCTTTATTGTGAGGTAAAACAAAGACGAGAACAGCGTATATGTGTGCGTGTTGTGCTAGAAAGGCGATTTTCGAGGCCGAAATCAATTCTGATCACCAGTAACAATTTATATGTACATACATATTTGGGGAGTTTTTAGTAATTTCGTAGAATATGATGAAATTGCGCGCTGTTTAATATCTAAGTGGAATATAAAAAAACTGAAAGAGTCATTACACTTTGAGAAAAAAAAAAAATGTTCATAAAAAATAATACGAGTAGAAAATAAAATTTATAAAATAAAAAAAAAAAAATGTTAACTGTTTATTGCAAACGTCGTATCCAAGGTGGGAATTATTCTGGTGTCTTTGCTTTTGGTCATATCTTGAGGCACGAAGTGCGGACCTAACTCAACAATCATTGTCTTCTTAATACTCAAGAAGCAGGCGACATAGACGAACCCTAACTGCTTTGAAATGGCAGAGAGTAAAATAAAATCAAAAAAAGAGACCAAGCCCCTCCAGTTCAAAACAAGGATTCCCTGGACAATTCATCAAGAAACACCAGCGCAAATAATTTCGCTCTCTTAAAGCGACGGTTGCCGATGAAACGAGGAACAAATATAACAAAACGAGATCTCGAAGTGGTAAATGAGACGGTGCAACTGATTTTTGCTAAAGCCCCACCTATGCTCTCTCTGACGTCAATGGTATAAGAATTGAAAAGCTAACCTATCTTAAAACTAAAATTAAAGAGAACTTTTTTATTATAAGACTCAACGTTATGGACATGTAAGAGTAATGGTTAAAAGTATTGAAGAATTCACGAAAATTAGTCAAAACGCAATAATGATTGTGCAGTACCACACATACCAGCTTAAGGATGACAGAGCATTTAAGAGTTGTTATTAGAATTTGCATTTTCCACAAATTTAGATGAAATTAAAGTGATGAAGAGTCAAAGGTCATGTTGTTAGAAACATAAAGTAATATTAAAAAACCGTGCGACAAAACGTCATGAACATGTTTTATGTAGATGATGAACTAACAAAAAAACCTAGACATATATAATGTAAATAAAATATTGAGCCTCCCACAATGAAATCGTTCAATGCTATAGCTGCCAGAATTCGGACATACTAAATCATATTGTACCAAAACGTACCGCTGTGTAAAATCCTCTTCTCGACACCAAGCAACATTTGCCTGAAAAATACAAGAACAACCAGCAAAATGTGCCAACTGCTACGAAGAACTGCGCCGCCAGCTACAAGGGTGTAGAATTTATCAGGAACTCTTGTCCAAAAAAAAATAGAAAATAGAAATAATGATCTAGGGATAGAAAATGATTTAGGAATCCAGCAAAGTTTGTTTCACCCTAACAAACCAACATATGCCAACAAGTAACATCGATCTTATGCCCAAATTGCTGCAGGAAATAGCAAAACAAACACATCACTGGAGAATAGAGCAACACAATGGGAAAACAGTCTGAACACAAAATGAATTTACTTAACATGATAATGTTACTTGTAAAACAAATTATGCAAGTAAATCCTAACGTGGAATATGGAAGCGTAGTGGAGGTGACTTCAATGCTAAGCTTCGAAGGGCACGAACTGTACAAATGCGCCAGTAAACAACAGCATAGCTGCTTTCAACCGACGAAGCCTACATGCTGGCCTGCGGTAGAAAGATACCAAACTTAACCCTTTCGCACTTAACGTTGCTTGTGAGCAATTTCTATGTTTTCAAGGCTAACTGCTTGTTTTTATCTGCTGATTCTTTTATGATAACGGTGCTTTTTATGTGTCTACTTTCTAAATATAAAAAGCAAAACGCATTTGGAGATTAATTGCAGGAATTATTTGCAATAAATAACACGCGCATCACAATAATTATTGTTTCGATATTCAGTTACAGCTTTTGAATTATTAATTTACTTTTTATAATACTTTTAAAAAGACCTACAAAATTATAAACGGCAAAGAGTTAACAAGACTATTGATTTAGTCAAACTTGGTAAGTAGTGAACAATAAGTAAAGTAAATAATTTTTCTAAATTTGCTTGTGAGCAACCTTGGGCATTCATTGATAATAATTTTCACCGAAAAGTGAAAGGTTGTCTAACGGAAAATTGAACGGGATTTAAACTTCGATTGGGATATTTCTACTGACGAGAAAGAAAGTGTTGTGAGAGATGAAAGGCATTTCTACGTACTGGAGAAGAATTTAGAAGGAATTCTTGAAAGGGGAGAAAATATCGACATTGACCTTCCACCTGGAAAAACTCGGAAGGTGATTGAAGGATGTGAACCTGACTCTTGCGTTGTTGTTGACAGTTGCTTAGAAAATTGATCAAAAGGGCTAAAGTGGAGAACAAGGCCGTTTGTAGCTCAGAGAGTATTTGGGAAGATGGCTGCTGTGTCTGGGACATAAAGACGACCGTGGAGTTCTTCTACACACTTTGATACTCCAGCTAATTCATTTAATGGCTAGGCAAACTGATATACAGTCATGGTCAAGAAATTATTTTCACAAAAGTGCATTTTTTGTGCATGGGTCACAAACAGTTGCTATTACGCAGCAAGTGGGGAGGTGAAATGCAAAAACTTTTGCTTTGCAAATTCAAACCTATGCGAGTCAGATGAAGAAGAATTGAAAATAACTGTTCTATGCGCAAGGAAGGGACAAATGAAGAGATCTTTATCAGTTGTCAGAAGTATTTGCACACGGTTTTCGATCGCATCACAATTATTTTCACAACGCAATTTCTTCTTCAGTGATTGGTTTAAGTGACAAGTGCCGAGTTTTGTTTGCTTAAATACATTTAAATTATTGAATAAAAATTAAGATTTAATCATTTTTTATACAGTTATTAAATAAAATGCCCAAAACAAAAGAAGTTAACAGTTGAGGCCGGGCTGGTATTGTTGCTAAGGTTTAAACCGGTACACCTGCGGCCAAAATAGCTGAAATATATCAAATTTCGCGTAGAACTTGTCTACTTAATAAAAAAAGTTTGATACAGTTGGCACATTAAAAATAAAAAAAAAGATCGAATACGCTGGACCAAAGGCAATGCAGGCAAATACCCCAGATTTAAGCGAAGAATCAGGTGCCAGTCCGGTAAAAGTACTTGTAGAATCAAAAATACAATTGGCAAACAAGTTAGTAGTTCTACAATTCGTACAGGCTAAAAAGAAGCTGATTTTAAGACATACTTTGTTCATAAAACGATTGAGATCACACCAACCAACAAAACAAAACGTCTTCGATTTGCGTTGGAATATGTTGTTAAGCCTCTTGACTTTTGGTTTAATATTTTATGGACCCGATGAGTCTGCATTTCGAGCACCAGGGGTCATACGGCAAGCATTTTATGCATTTGAAAAAATAATCAAAAGCATTTGGCGTAACCAACCAATAGATTTGGTGGGGGCACAGTCATGTTTGGGGATGTCTTTTCCTATTATGGATTCGGAGCTTGGTACCGATAGAAGGTACTTTAAATCAGAACGGATACCTTCTTATCTTAAACAACCATGCTTTTTTACGTCGCGGAAATGAACTTTCCAACTTACTGAGATGGATTCTTCAACGGGACAATGCTCCATGCCATAAGAATTGGGATATAACAAATTTTAAACGACCTTAATCTGGCGGTTCTTCCGTGGCCCCAAAGCCAGACCTTAATATCATTGAAAACGTTTGGGCTTTTATTAAAACAACGAACTATTGATGAAAATGAAAACGAGAGGGAGCCATCATTGAAATAGCGGAGATTTGGGTCCAAATTGACATTAGAATTTGCACAAACTTTGATGAGTCAATGCCAAAGACTTCAAGCAGTTATTGATGCCAAAGGTGGTGTTACAAATATTAGTATTATATTTATATAAAACTAAAGAAATTATTCTTATGTTGAAATTAGATGTTAAACTGGGGTACTAAATTAAAGTTGAGTGAAAATACTTTTGAAGCGCAATAAACAATGGTAATACTAGTGACAACTTGCATGCATATTTTCTTTTGCTTTAAGCTTTTGTACTATGAACCGTTATCTTTCGTATTTCTTTTCGACTACCTTCGCCAAGATCAAGCTGGCAGTAAGAACTATTTCGAACAAATCGGACAACAACAAGAAGAATATATGAAAAAAAAAAAGTTGTGAAGTTTGCAAATATTGTGCGTTGTGAAAATACTTGACCACCTCTGTATATAGTTTGCGGGAGCGGTATTGAACTTAAATGTACTGATGAGGAAATCAAACGCTACATTGGCATTTTATTGTACTTTGGTGTTTTAAAACTACCGCAATTCAGAATGGCGTGGTCAAAGTATTTAAAGATTACCGCAATAGCTTGATTCAATGCCAGCATTAGGGAGATTTAAAAAATAAAAACAATAGCATTTCAACGACAACGCCAAACAATTAAAAAAGGGGATTGCAACTATGATAAACTCTACAAGATCCGCCCTTTGTAGATTCTCAAAGAAAATTTTGGAAAAAACTAACGCAGAGGAAGAGCATCAAAGTGTCGATGGTAAATAATTACGCATTCAAAGGTTACGTTTTAATTTTCTTTTAAATTAGCTTTATTTTAATAATTGCTTTTGTTGCAGGTCGATCCACGCTTGAACAATATATAATCAAACCTCATAAATGTAAAATGTTTACGCGGGCTGGAATATCTGGATTGGTTTATGATTTTACGCTATATGTTGGAGAGAGGCACTTCTCCTTCTTATGGCAGAGATATCATCTTATGTTGTCTTATATATTTGGCGAAAGTCTTCCCAAAAGACAAAATTTTAAACTGTATTTTGATAATTGGTTTACGTCTGTAATCCTTCTGATTTCGTTGAAGGAGAAATAGAATCTTTGCAACAGGTACTGTACGTATGATAAAGTTGAACATTGGGTAGTTTTTTTGGAGAGGACGTTACTGGAACTATTGCAATTACAACACCGATGACCAAAAAAATGCCTTACGTACAAAGTCCATCTGTTGCTGCAATAACAATAAAACTTTGTTTTGTCATACCACACTTAAATTGTCATTATAAAGAAAAATATTTCATATTCTGTGATTTATAAAAAAAACAATGCTTACATCTGCATTGACGTTGCTCACAAGAAAACTTTGCTACCGCCCAAACTAATGGGCGTGGCATATAAGAGCCACACCTTTAAATTTTTCTAAAAATAAATGTAAAACATTAATGATAAAAACAAAATTTCACGGGTAAAAGGATTGGGCGCGAAAGGGTTAAAGAAGACTTCGTAGCATACTTTGGAATCCCAGAATCTCACATGCGAATAATGGAAAGTTTTGATCTAGCTCAGATCGTTCTCTAATAATAGTGACATACGGTACAGTAGCTCATATATTTGCAAAGCCTGAATGTCAATGCATTTAAAGAGTTATCTGGAAACGGCTATCCGGCCTGGATATCTCGCTAAAATCGGGAGAGGAGAGCTACTGTGGAGCTACTCACAAAACAAGATCCCATAAAGCGAAGCTATATATGTACGAAGCTACCGGCGAAACTCACAATCAAATCAGCTCTATCTCTCGAAGCTGAAATCCAGGCAACAAATACAACACAAGAGAAATTTGTAAGAGATGGCAAAGAAACTCTCTACCCTGCCGACAAAAGATCGTATAACAAGGCTGCATCTGATCGCGAAGAAACTACTGTCAACTTTAAAATTAATCTCTCGCTGAATATCTTAGAAATCTAGATCCACATTCTTGTAACCACGAACATAATTTATGGAGAGTAATAATCTCAAACGACCTGCAAAACACAGTAGTCCGAAACTCTAATGGCGAATGGCGTAGATCTGATGATGGTGCAAACCAAAGCATTTGCTTAACACCTGCCTCTGTGTTTCTTTTGCAGGTCGCTTGAGATATTTGGTTACTCTCCATAAATTATGTTCGGTAATTTCGAAATGTGGATCTAGATTTCTAAGATATTCAGCGAGAGATTAATTTCTTAAAGTTGACCGGTAGTTTTCTGCGATCAGATGCAGCCAACGTTATACGATCTTTTTTGTCCGGCGGGTCGAGAGTTTCTTGCCATCTCTTGCGCAAATTTCTCTTTGTGTTGTATTTGTTGTCAGTTCGGCTGAGATTAAACTTCGGTTGATTGTGAGTTTCTGACTGGTAGCCTTCGTACATATATAGCTTGCTTTATGGATCTTGTTTGTGAGTAGCTCCACGGTAGCTCTCCTCTCCCTGATTTTAGCGAGATATCCAGGCTGATAGCTTGTTTCAAATAACTTTAAATAAATTATTGATATCTGTATTTACAATATATGAACTACTGTACTGTATGTCACTATTGATGAGAGAATGATCTGAGCTTAGATCAAAACTTTTCCATTATTCGCGTGAGATTCTGGGATTTCCAGTATGCTACAGTCTTCAACGCTAGCACACCGTGAAATTTTGTTTATCATTAATGTTTTTACATTTATTTTAGAAAAATTTAGCAAAATTTTGGTATACCCTTACATTAGTTTGGGCGGTAGCAAAGGACACTGCTTAATGAGGAACAACGTCGAACACAGTAGTGATATTAACATTGTTTTTTTTATAAATCACAGAATATGAAATATTTTCTTTATAATGACAATTTAAGTGTGGTATGACAAAAAACAGTTTTTATTGTTATTGCAGCACAGTGGACTTTGCATGTAAGGCGACTGGTCATCGGTGTTGGTACACAGTCTGCAACGTCCTCTTTCTCCAAAACACCCAATGTTCAACTTTATCATACGTACAGTACCTGTTACAAAGATTCTATTTCTCCTTCAACGAAATCAGAAGGTTACAGACGTAAACCAATTATCAAAACCACAGTTTAAAAATTTTTGTCTTTGGGAAGACTTTCTTATAAATATAAGACAACATAAGATGACATATTCAACTCCATAAGAAGGAGAAGTGCCTTCTCAACATATAGCGTAAAATCATAAACTAATCCAGATATTCCAGCCCGCGTAAACATTTTTAGACCCCATTTATGAGGGTTTGGATATATTGCTAGCGTGGATCGACCTGCAACAAAAGCAATTATTAAAATAAAAGCTAATTTAAAGAAAATTAAAACGTACCTTTGAATGCAATTTGCTCATCGACACTTTGATATCTCTACGTTAGTTTTTAAAGGCCTCTTTGAGAATTCTGAGCAAGGGCGGATCTTCGTAGAGTTATCATGGTTACAATCCCTTTTTTTAATTGTTTGGCGTTGTCGTTGAAAATCAATGGCATTGTTTATTTTTTTTAAATCTCCACGCGGCGCGTTGAATCGGTTATTGCGGTAATCTTTAAATACTTTGACCACCATTAGTGCGGTAGTTTAAAAACACCAAGTACAATAAAATGCCAATGTAGCGTTGTTCCTCATCCGGTACATTTAAAGTTCAATACCGTGCTCCTGCAAACTATGAGGTGGTCAAAAGTATTTTCACAACGCACAATATTTGCAAACTTCAACTTCTTTTTTTGTTATATTTCTTCTTGTTGTTGTCCGATTTGCTACCAATAGTTCTTATCGCTTAGCTTGATCTATGCAGAAAGGTAGTCGAAATACGAAAAGATAACGGTTCATAATTACAAAGCTTAAAGCAAAGAAAATATGCATGCAAGTTGTCAATAGTATTTTCACATGTTTGTGCGCTTCAAAGAAATATTTTCCGCTCAATAATTTAGTAAATTTCAACAGCATCTAATTTCAACATAGAATTTCTTTATTTTATATAAATACAATACTAATATTTTGTAACACCACCTTTGGCATCAACTAACTTTCTTGAAATCTTTTTGGTATTGACCTTGCAAAGTTTGTGCAAATTCTGATTTGGACTAAATCTCCGCTATTTCAATGATGGCTCCACTCGTTTTCTATTTTTTATCAATAGTTCGTTGGTTTTAATAAAGCCCAAACGTTTTCAATGATATTAAGGTCTGAGCTTTGAGGCCACGGAAGAACCAATTAAGGTCGTTTAAAAATTTTTGTTGGTATCCTACCCTTATGGCATGGAGCATTGATCCTGCTGAAGAATCCATTCAGTAGTTGGAAAAGTCTATTTCCAGACGTAAAACATGGTTGATCAGAAAGGTATCCGTTCTGATTTAAAGTACAACTATCGGTACCAATCTCCGAATCCATAATAGGAAAGACATCCGTTGTGCCACCAAATCTATTGGGGCCGGCTGAACTGCCAAATAACGTTATTTTCAAATACATAAAATGCTTGCTGTATGACCTGTTGCTGAAATGCGAACTCATCAGTCCATAAAATATTAAACCAAAAGTCAGAGGAAAGCTGCTTAACATATTCCAACGCAAATCGGGCGTTTTGTTTTGTTGGTTGGTGTGATCTCAATCGTTTTGCGGGCAAAATATGTCTTAAAATCAGCTTCTTTAGCCTACGACAATTGTAGAACTACCAACTTGTTTGCCAATTGTATTTTTTTTGATTCTAAGGCAATTTTTTTACCGGACTGGCCTTTGGATTCTTCGCCACAACTCGAAATGACTACATACCATTGCCTTTGATTGCCTGGAGTTTTCGGCCTGATCTTTTTTTATTTTTTTTAATGTGCCAACTGTATCAAACTTTTTTGTTTCGTACGTGAACAGTTCTACGCGAAATTTGATATTTCAACTTATTTTGGCCGCAGGTGTACCGGCTTTTAAACCTGGCAACAATACCAGCCGGGCCTCAACTGTTAACTCTTTTGTTTTGAACATTTTATTTAATAACTGTAATAGGAAAATGATTAAAATCTAATTTTTATTAATAATTTAAATGTATTTAAACAAACAAACCGGCACTTGTCGCTCTAAACCAATCACTGAAGAAAATTGCGTTGTGAAAATGGTATGCGACAACCGTATTCTGATAACTACGACAACTGATAAAGATCTCTTCATTGCCTCTTCCTTGCGCATAGGAACAGTTATTTTCGAATTCTTCTTTCATCTGACTCTGCATAGGTTTGAAATTGCAAAAAGCAAAAGTTTTTTGCATTTCACCTCCCCACTTGCTGCACAACAACTGTTTTGTGACCCAGCAAAAATACTTTAATGAAAACAATTTTGACCATGACTGTATATCGGTTGCCTAGCCATTAAATGAATTAGCTGGTAATAAAGTGTGTGAAGAACTCCCGCGGTCGTCTTTATGTCCCCGACATCAAAGTTTTGTCATCTTCCCAAATACTCTCTGGGCTACAAACGACGCTTGTTCTCCACTGGCCTCTTTTGGATCAATTTTCTCTAAGCAACTGTCCAGCAACAACGCAAGGTCGGGAATTCACATCGCTTCAATCACTGTATTTTCAGAGGTCAATGTCGACTACTTTCTCCCCACTTTCAAAGAATTCCTTCTAAATTCTTCTCCAGTACCGTAGAAATGATAACTCGTCTCCTCACCACTTTCTTCAGATCGGTAGAAATATCCCAATCGAAGTTTAAATCCGTTCAATTCTTCGTTGAACAAACCTTTCACTTTCGGTGAAAATTATTATCACGAATGCCCAAAGGTTGCTCACAAAAGCAACTTAGAAAATTGTTACACTTATTGTTCACTACTTACTAAGTTTGACTAAATCACTGTCTTGTTAACTTTCTTTGCTGTTTATACTTGGAGTTCTTTTTTGAAGTATTATAAAAGTAAATTAATAATTCCAAAGTTGCACCGAATATCGAAACAATAATTATTGTGTGATGCGCGTGCTTTATTTATTGCAAATAATTCCTGCAATTAATCTCCAAATGCGTTTTTTGTACCTGTTAGAGTGAACTTACATAAGCACCGTTATCAAAGAATCGGCAGATAAAAACAAAAGGCACTTACAGTTAGCTCTGAAACATAGAAATTGCTCTAACGCAACGTTGGAGTGCAAAGTTAAAGTTTGGTATCTTTCTATCAGTAGGCCAGTGAGCTTTACCGGTTGAAAGTGTTGTTATGCTGTTGTTTACTATGCATTTGTACGATTCGCTTCCTTCAGGCTTAACATTGAAGTCACCTCCTACTACGCTTCCATATTCAAGGGATGGGATTTACTGCATAATTTGTTTACAATAACATTATCATGTTAAGTAAATTATTTGTAAGTTCAAATTGTTTTCCTAATGGTTGCTCTATTCTCTCCAGTGATGTGTTTGTTTTTGCTATTTCCTGCAGTATTTGGGCATAAGATTGATAATCGTTACTGTTGGTATATGTTGGCTTGTTAGGCGGAACAAGCTTTGCTGGATTCTAAATCATTTTACTCAGATCATTATTTCTATTTTCTATTTTTTTTTGGACAAGAGTTCCTGATAAAATTCTACACCCTTTGTAGCTGGCGACGTGTTCTTCGTAACGGTGGCGCATTTTGCTGGTTGTTCTGTATTTTTCGGGTAAAATGTTGCTTGGTGTCGAAGGATTTTACAACGGTACGTTTTGAACAATATGATTTGTATGTCAATTCCTGGCAGCTATAGCATTGAACGATTTCATTGATGGAGGCTCAATATTTTGACCCACATTACTCCCATATGTCTAGGTTTTTTTTTGTTGAGCTCAATATCTACATAAAACATGTTCAGTGACGTTTTTTGGTCGCACGGCGATATGTTTCTAACAACATGACAGCGCATTTCTTCATCTTTTTAATTTCATCTAAATTTGGAAAAAAAATCACAAATTCTTAATAGCTGACTCTGTCTTTCCTGGCATCCTTAAACTGTTGTATTGATGATTGCTACACATCATTATTAAGTGTTTTGACTATTCAGGAACTAACTGTACTTTTAACCATTACTCTTACGTGTCCCATAACGTTGGTCTTATAATAAAAGTTCTCTCTTAATTTTAGTTTAAGATAGGTTAACTTTCACTTATACCATTGACGTCGAGAAAAGATGGGTGAGGCTTAGCAAAATCGGATACACTGTCTTCGTTACCATTTCGAGATCTTCGTTTTTGTTATATTTGTTTCCTGTTTTGTCCGGGCAATCGATAACAGAAACGAGATACATTGCGCTGGTGCTTGTCGAAATTGATCCAAGGAATCTGTTTTCTTTGAACTTTTCGGGGAGGGAGCTTGAATATAACGTTACCCGACACTCTCTGCCATTTCAAACAGTTAGGTCTTCGTCGGTGTCTGGCGGTATTAAGAAGACAATGATTGTTGAGTGCTTGTGTCCGCACTTCGTTGCCTCAGATATGACAAAGCAAAGAACACTAAGAATAATTCTGGTGATATGACGTTTGCAATAAACGGTTAACATTTTTTATTTTATAAATTTTTTATTTTCTACTTCGTATTATTTTTTATGAAATATTTTTTTTCTCAGTGTAATGACTTCTTTTTCAGTTTTTTTTATATTCCAATTTGATATCTTAAACAGCGCACCAATTTCATCATATTCTACGAAATTGACCCAAAACTCTAAATATGTATGTACATATGTAAAATTCGTTACTGCGATCAGGGGTGATTTCGGCCCGAAAATCGCCTTCTAGCACAACACGCACACATACGCGTTCTCGTCTTTTGTTTTACTCACACAAACAAACAAATTCTATTTTTTTGAATTTCTTACGCTCGGCGTGAGCGGCGGAAGAGAACACAATTTTTGGCCGTCACCAAAAGTGGCGCATAGTGCCAAACCGGTGTAATGGCTGTTACGCATCTTATTATTCTATTGTCTTTGATGCGAACCCGTAGTGACTTTTGCTTAAATATTGTACATACTTAACACGCCACCTCAAAAGTAAGATTGCTGTACTTTTATTACTCACGAGGCTGTGCACGTCCTTCTGACGAATAATTTTGATCCAGCATTCGTTGCGAGGTGTTGGGAGACAGAAAACCAACCAGATCAATTGGTTTGTATTATTTACATAGAAATTCAGTTTGCCGAGCTATTTTTAACTAAAAATTAATATTGGTCATCTTTGTGAAACTCAAAATTATCAGTAAACTTAATTAGATTTAAATGATGGATTAGTTTAGTTAAGTTCAGTCCTGGTTCCTCGTCAGTTCAATCTAAGAATATAATGTTTTTAATTCATTCTGAGAGTCAAAGTCCACTTCTCAATGTAATGAATCTTGCAGATGGTGTACCGGCAAGGATTGTAAATTTGTAGATATATACAGTTTGTCAAACTATTTACACGCCGTGAAATGGTGGGGCCTTAAGGATCAAAATTAAAGGTTATTTCTTTAATTAAACACAATTTTTTTAATGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAACAAATTCAAAATATCAAATATACAAGAATTAAACAACAAATTCAAGTTTACACACTTTTGAGGTGGCAAGAAAGCGCCCACATTTTGTTTCTACTTTGTTTTGCTTTTCTTAGAACGAACTCGATTTTTTCCGTTATTTTTGGCATTTTGCATTCCTTTTTTCGCTTGCTTCTATTGAAATTTTTTTTTACTTTGCTTGTGAAATTTTGCTGATCGAATCGAGTTATTAAATTTAATAAAATGCCTGGAAATAGATTAACTTTGAGTGACCCAAATAATATACTAAAACCACCAGTTGGGAAAATCTATTCAAATTAGTATAAATGTTTTCTGTATCCCGGCAGACCGTCTACAATGTTTTAATCGCTTGAAAAAAAAAACAGGCTTGAACCTAAGGTGGTGGGCGCAAAACTAAAATTAACGAAGCGTGTAGACCGCCTTATTATGCGAAAAGTGATTGCGAACCCCGAATCTCGGTCAGATCGCTTGCTCCGGGATATCGAGCAGAATGTGAACCTGGTTGTGCCACACAAAACTGTGCGCCAGGTCGTTCTACGCCATAGGTGCTCAGGTTACCAGAAAAAAGCCTTTGCTATCAGGGTCAATATAGAAAAGCGTCATTCATTCATTTTGAGCATGATGGATCATGCCGGAAGAGTACTGGGATGACGTAATATTTTTTAATGACGAAACAAAGATGCTCTATTATAACGATGGGCCGAAGCAGGTATGGCGCAAGCTGTTGAATTCGCGCTGAAAACAAAATATCATTCAACAATCAAATTTGAAGAATTATCCGGTGATGATTTGGGGCTGTATCTCAAACCGTAGGTGGGCAAATTGGCCTTTATTGAAAGCACTATGAATGCCGTGCAATATCTGCGATCTTCGAATCGGTTGAAGGCCAGTGCGGTCTGTTAGCAACAACAAGCCAAATTTTAAGTTTATCGGGACAATGATCCCAAACATAAAAGTGCAATGTACGCAACTTCAAACCATTTTATAACTGTGGCAAGAATTGATCGATACGCCCCCCTCAGAGTCTTGATCTGAACCCCATTGAAATTGTGGGCCTACTTAAAGAAGAATGTGGCAAAAAGGGCACCAAAACACGACAACAGCTCATGAAACGCGATAGAGTGGGAAAAGATCCGCTTGAATATGACCTAAAAACTCATCCATTCCATGAAAAAAAAGCTTCAGCATGGCCAAAACCAATGGGGTCATACTAAATACTACAACTTTTCAAATTTTAACAAAATAATTTAAATTTAAGGATTAAACTTAGGTTTAGTGTTTTGTGTAAGGATTTCTTGAAACTCTCAAAGAGATGTTTAAACTTGGAATTCGTTGTTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTAATTTATAAGTAAAATAAATATTGTTTAATTATATTTCCTAAAAAAAAATTGCGTTTAATTAAGCAAATAACCCTTGTTTTGACCGTTAAAATCAAAGATTCATCTTATTTCACGGTGTGTAAACGGTTTCTTGATGAAGCTGTACTTGTCACCAGATTCTTTTAATTTCAAGTTAACGACCGTTTTCTGATACTTTGTGTCCTTGTGAAAGTGATGCCGGTATAAAAGTGATTCGAATCCGACATCAGAAGTGGGACCGCCTACTCAACTTTCTGTAGTTTCATTGTGTCATAGATCATTTGTGTTTTAGCTGTTCTTTGACGGTCAATTTGAGGAACAGGGGAAAGGATCCCTTCCATTCGAAATTAATTCGTCAATCTCTTATGATCTACATACAAGGTTTTGCCAGCCCTAGAGATCGAGAGCAACGCTGCCAAGCAGCCTGCAACACTATATGTATCTCTTATATATATGTATATATATATGTGCGACGATGATTGCTGGAGAATTGATAGAGCACACATATAAGCGATCAGCGCTTGACCAGCAAGTGCTGACCGAGCAATTATGTACATGTTAGCCCTCAAGTGGGTGCTCGTATTACGTATACGCGTGCTGGACTGTTGTAGCGCACATTGCAACAGAGTGCTACAATTATGAATACACATAGGTACAGTGCTTAACCGATATGTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTAGAGTCGCAGAATCGCCATTTTTCTGAACTGTTAAAAGAGTGCAAAACTCTGAGACCCAAAAAACTCAATGCTGTCGTGTTGCCAAAGAGTTTAATCTGAACTGCCACAGGCTTAACACTCAATCCCACAGTTGCGGAACCAGGTCTACATCATGATGAACCGGACGTCTTAAATTACGCGGCGCAATACTCGAAACCATAGAAGTTGTGTCGGCCGGTGATGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCATAGTTCTGCGCTGCAATCACGCGAGTTAATTGTGCACTGTTTCATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAACAGCTGATAGCGCAGCGAGCGATCTGGAGAGGAGGCGTTGCCAGATCAACCGTGTGATCAGTGTTGATGACCCGACAGTAGGGCGCGAAATTCAAGATAGAATTTAAAATTAAGCCGTTGAAATTTGAATTTAATTTAATTTTGATTCTGGTAACTGGGAGCGCACAAGTCTTTAAGAAGGGGAAAAGGCACAAAGGTGGACAGACCGTATCATCCTCTCGTGCTGGTGCCTAAGCAGAGCTCTGGTGTCCGGTGGTGGTACAAGCCTCCGTAAAAGCCGGGGGAAATCCGTGGCCTGCGTGACCCTAACAGGCCATCCTTCAGTTGATGGACAGCGCAGTGGAGGCAGTCCCCTGATCGCAACACGACCGTTCAGGAGGAGCTCCCGACTTTCGAGATCCCAACCCGACCCATGGTGACGGAATCTCGGTCGGTGTAGGGGTGAGCACGCAGGCCCCAGCCGCCGTTGACTATCGACTGCAACGATGCTGAAGATTGGAGAAATTGACTCCTACAGCATCTACGACCGCGACAAGTCAGAAGACGATGGACCACATCGCCATCGCAAAGACGGAGGAAGTCCCCGGCGTTCCCCATCGGTCTTCGGACTTGACCACTGCTCTCCAGAACGGTACAGGAACTACTTACCAGGATGAATGAATCAGCCCCCTTCTATCGAGACCCAACGACACACATGAGAGACAAGGGCATAGCTTCCGAACTCTCAGCCCTTAACAACAAGTACTACTGAGCACCGCTTGAAGAGCAGCACTTCTGGACGGAGGTACAAAGCCTACCAAAAAGGCTCCACAAAATGCGCGGGTACGCCCACGGTGCGAGGTGCCAAAGTCCAGGCAGCAGAGGCAACCCTACGTTGGATGGCAGCGGTGAAGAAAAAAGGCGACATCCATACCTAACGGTCAAACGGGCGGCTATGCATCACAATAACCAAGAATGCTAGCACAGTTGCAGAACTCATCGTAAAGACGGGAGGCTTCGTACGCAGTCTTCGGAAGCTAAGATCGGAATCGAGCCTTAGCGAACTGGGCAGTCACGTGCAAATCCGGAGAACGCAGAAGGTGATCTGTTGCTTGGTGGGGGGAAAGCTTCGGAAAGCGTTCCCAAGTTTAAGAGCGACCTGGAAGCGGCGCTCAATGACTGGCCTCTGTGCGCAGGGGCGCAAAGAGCAAGCTCTATCTTGCAGCAGAGGCTACGACAGCGAAGCTCCACAGCTGCTTGGTCGCCCAATTCCAGGGCCTGCAGATAAATCTGAAGATATCAGGGGCCTTCGCGGTATGCGGAATTGCAACAAATAGCCTCAGTGCTGCTGAACGCGAACGTTGCGATACCAGTCCTTAAACGGGGCACCATAATCGTTGGATGGTCAAGATGTCGTATCGCAGGACGTCCGACCCGAGATGCTACGAATTGTCTCGGCATGGGCATCGATCAGCAACCTGCAGGTTACTGACAGGGCAGACTGCTTGCTGTCTTAAGATGCGGTGAGCATTGGGCACAAGGCAAAGCGTTGCTGCCAAAATGCCTGATCTGCAGCAGCGAAGGTGGACAGCTCACCGACGGGTACAGCTTTGCGTGCCGACTTGCAAACACTAAAGATGCCAAGAGCCACCTTAATGCGCATCATATTAGCGTAGTACAGCTCAATGTCAATCATTTGCGCAGCAGCTCAAGAACTCCACAATTTGGGACGCGTTGCAGGCGCAATGTAGACATCATGCTCCTAAGCGAACCCTACGTCTCTGGTGGTGGACAATCGTCCATGATCGCTTGACGAGGCAGGTAAAGCAGCTATCAAATGCTGCAGCTCTCTCAAGTCCAGGAACTGGCTGCTTTACCCATGCGGGGTGTTATCGCTTATGCGAAGTTAAAACACGTGCACATGTACAGCTGCTACGCTCCGCCGAGCGACACCCCGGGCTTCTGGAGGCGCTCGTGGACCATGCGAAGGGCAAGCCCGGGTCATTACCGGCGACTGGATTAGGGCGTGGAATGGGGCAGCAGGACATCCAACAGAGGACGAGCTGTGATTGACGCCATGCGAATGCTGGACCCTCATACTGCTGAACTGGACGGAAGCCGACGTTTAGACAACGATAGGGGTACGTCCTTTATTGACGTTACCTTTGTCAGCAGGGGCTAGTGAACAACAACAACTGGATGGTCATGACGTCGCGACGCTGAGCGACCATGCCCCGATCTCCTTCTCCCGGAGAACATGCCCAAAGACGGCAGAGTAGAACAGCCGGGGAAAACATGGGACACCAGGAAGATCGATGAATTTGGCCTATCAGATCAATTCCTGGAAATCCCAAATGTGGACGCAGAGTATGGCGGCAGGCCTCATGAATATGCTGGAAGATCTGCGGCGCAATCATGCCAAGGAAAAATAAGGCACAGCGCAAACCACCCAGGTTTGCGGTGGAGTGCCTCTAAGCCAACACTACGGTCTGATCAGGGCTAAAGAGAACGGCGCAACGAGCCAGAGGCAGTACCCACCACGCGGAACTCTTGGAGGCTTTCAGAAGCAAACGCCTAGAGTTCAAGCACGTATCGCAGCAAAGCGCGGTCGTTTAAGGAACTGCGGGATGGCGTGAGCAGCGATATCTGGGGCCTCGCCTGCGGTACCAACGAGCTAAGGAGGAAACCCCATCCGACCGGGGGTCCTGGCTAACATACTAGAGCTATTTCCAAAGCAGACCACACTATGGAGGCCAACAGATTTCCCGTGCGTCACAGAACTTGAAGTCGTCAGGGCAGCTGTTTCGCGCGGTCAATCCACAGCCGGGCTAGCAATAGCGGCTCACAAGACCGAAGCAGTCCTAAGCAACGGGAAAAGATGGAGAACATGCTGGTCTCCGTCAAGGGGACCTCTGGATGCTAAAGTACCTGGGGTAATGATAGATGCGCAGACTATCGTTCAAGGACCACGCGAGCTACGCCAGCAAGAAGACAGCAGTCACATCCTCTTCGTTGGCAGGAAAGCATGCTTAACGTCGGAGGCCCAAAGACGCCGGCCGGGAAACTGCGGTGTCGGTAGCGAGCTTCGCTGCTATACGCTGCACCAGTCTGGAGCAATGCCACTTGCAGGGTCTCATACCGTTCGGTGCTACGGTCAATGGCCCTCAGGCTCATTAGAGGATTCAGGACCATATCCAGCGCGGCGCTAGCGCTGTGAGCCACCGATTGATCTGGAGATCAAGGCTCTCAGCCTTATGCGGAGTAGCTTCCAGGCAGAGGCACACGAGTGGCTATTAGGTGAATGGCAGAGCAGATGGCAAACGTCGCGACGAATTGAACCCTATCAGCTCATCCAAGTTGACTGGTTTGAACGAAGTGACACTCTCAAAAGTGTGCAATTTGTTATTTGTGCACCTTTGTATATTTGATATTTTGAATTTGTTTTTTTTAATTTATAAGTAAAATGAATATTTAGTTTATATTCCTAAAAAAAATTGCGTTTAATTAAGCAAATAACCCTTAATTTTGACCGTTAAAATCAAAATTCATCTTATTTCACGGTGTGTAAACAGTTTCTTGACAAACTGTACTTGTCGCAGGTTATTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTATTGTCCGCTGTAGAGAGTGATGCCGGTATAAAGTGATTCCGAATCCGACATCAGAAGTGGGACCACCTACTCCAACTTCCTGTAGTTTCATTTGTGTCATAGATCGTTTGTGTTTAGCTGTTCTTTATTTGATCCAATTTGAGGAAGGGTCCGCTTTCCATTTCGAAATTAATTCGTCAATCTCTTATGACGATCG
->fd5fe859-6839-4960-8133-2e2eb602d3f1
-TGCACCCCATCCAACGTAGGGTTGCTCTGCTTGGCGCTTTGGCACCTGCACCGTGCCTGCTTTTGTGGAGCCTTTTTTTGGTGAGCTTTTGTACCTCCATCTGGGTAGCGCTGCTCTGCTCGCTTCGTCATTACCTTCGTACAGCTCTATCGCCCTGTTGTTAAGGGGCTGGGGAGTTCAGGCTATGCACTTTGTCTCTCATGTGTGTCGTTGGGTCTCGAATGCGGATAGAAGGGGCTATTGGCCCCTCAGGTCCTCGTTCTGGAGCAGTGGTCAAGTCGAAGACGGAGGGAACCAGCTGGGGACTTCCACTCCATTTGCGATGGCGGCGGTGGCGGTAATAATGTTTGACTTGTCGCGGTCGTAAGATGCTGTAGAGACCAATTTCTCCACCTCTACAGCATCGCTGCGGTCGATAGTCCAGCGGCGGCTGGGGGCCTGCGTGCTCACCCTTGCCACCGGCGGACCGAAGATTCCGTCACCATGGGTCAGGTTACCGACTCACTCTGGTGGGGATCTCGAAAGTCAGGGAGCTCCTCCTGAACGGGTCGTTGCGATCAGAGCTGCCCCCCACTGCGCTGTCCATCAGCTGAAGGATGACTAAGGTTACCTGGGTCGCGTAGGCGGATTTCCCCGGATGGAGGTTTGTACCGCCTCGGCTCGGACACCAGAGCCTCTGCTTGAGCACCAGCACATTGTTGAAGATGATGTTGATCTGTCCGCGACCTTTCTTCCCTTAGACTTGTGCGCTCCCAGTTGCAGAATCAAAATTAAATTAGAATTAAATTTCAACGGCTTGAATTTTAGATTTGGTGCTGAATTTCACGCTCCCTACTGTCGCAACCCCAACTGATCACGGTTGATCTGGCAGCCTTACTCCCACTCTTAGATCGCCCGCTGCGCTGTCAGCTGTTTATCCGCTGCAACAATCGCAAGATAAATTACCTATTTACCAAGAACAGGCGCACGAATTAGCTTTCCGTGATTGCAGCGCAGAACTATCTTTTGACTCACCGTGTGATTTTTTGCCAGTTTGCCGCACACGCAGCCGACACAATATAGTTTCGAGTATTTTGGCGCCGCGTAATTTGGGCAATCCCGTCTTCACGGCGATATGAACTTGGTCTCCACGCAGGTTAAGGTGTAAGCCTGTGCGTTCAGGATTAAACTTTGGCAATACGACAGCGTGAGTTTTTTTTGGGTGGTTTTGCACTTCTTTTAACAGTTCAGAAAAATGGCGTTGCGACTCGGTGTCAGCAAATTGTTTTCACTATTGTAGTATGCGCACATATCGGTTAAAAAATGCCTTATATTGTATTCATAATTTAGCAGCACTCTGTGCAATGTGTACATAAACAGTCAGCACAAGTGTATACGTAATACGAGCTTCCGCCGAGGGCTAACATACATAATTGCCTGGTCAACAGTTCTCCCTTTGGCCAAGCGCTGATCGCTTATATGTTACTATACCACTCCTCCTCCAGCACCATCGCTCGGCGACAGTACATATATATACATATATATAAGATACGCATATAAGCGTTGCTGCGCTGCAGGCTGCCGGCAGCGCTGCTCATTGAGCTAAAGAAACCTTTGTATGTAGATCATAAGAGGATTGACGAATTAATTTCGAATGGGCAGGTTCCCTGTTCCTCAAAATTGGATCAGAGTAAAGAACAATACAAAACACAAATCTATGACACAATGAAACTGGGAAGTTGGGTAGGCGGTCCCACTTCTGATGTCGGATCTGAATCACTTTATACTCGGCATCACTCTCTGGATTTACAAAGTAACAGAAAAGTCGTTAACTTGGAAATTAAAAAATAAATCTGCGACAAGTACAGTTTAAATCAAGAAACTGTTTTACACACCGTGAAATAAGATGAATTTTGATTTTAGCAGTCAAAATTAAGGGTTATTTGCTTAATTAAGCGCAATTTTTTTTTAGGAAGTATAATTAAACAATATTTATTTTTTACTTATAAAATTAAAACAAATTCAAAATATCAAATATACAAGAAAATAAATAACAAATTCCCAAAGTTTACACACACTTTTTTGAGGTATCTCTGCCCAAACAAATCGCATCTCTAGGATGAGCTGGTAGATCCACCTCCCCGTCGCGACGTTGCCATCTGCTCTGCCATTCACTAATAACCCACTCATTAATGCCTCTTGCCTGGAAGCTTTTGCCACTCCGCATAAGGTAGTAATCCTTTCGAATTATGAGACCCGCAAGTGGCATTGCTCCAGACTACAGATTGCAGCGTATAGCAAAACCTTGCTACTGACACCAGTTTCCTATGGCCGGGTGTCTTGGGCCTCCGACGTTGGGCATAAGCCTCGCCATGAGGATGTACTTGCTGGCGTAAGCGTGGTCATGTGAACGATGATCTGCGATCTATCATTACCCCCCAGGTACTTTAGGGATCTTATGCGTTATGACGGCGGAGACCAGCATGTTCTCCATCTTTTTTCTGCTTCTTAGTAGGACTGCTTCCGTCTTGTGAGCCGCTATTGCTAGCCCGGCTGTGATTGCCACATCGTCAGCGAAACAGCTACCTCGACGACTTCAAGTTCTGTGACGCCACGGAAATCTGGGGGGCAGGGGCTGCCTCTGTTAATCAGGTGTGGTCTGGAAATAAGCTCTAGTATGTTAGCCAGGACCCAGGTCGGATAGAGTTCGCTCTCCTCCTTGTCGTTGGTAACAAGCTTGTAGGCGAGGCCCCAGATATCGCTATCTACATAATCCTGCAGCTCATAAACGGCCGCGCTGGCGCGATGCCGTGCTTGAACTCTAGGCGTTTGCTTCTAGAAAGCCTCCAAGAGTTCCGCGCGTGGTGGGTACTGCCCTCTGGCTCATGCGCCGTTCTCGCCCTGAGCCAATCAGACCGTAGTTGGCAGGGAACTCCGCACCAGTAAACGAATTGGTTTGCATATGCCTTGGCCACTGCATGGCATGATTGCGTGGTTCTTCCCAGCATAAGGGCCTGCCGCCTTACTCTCTGCGTCCACATTTGGGATTTCCAGGGAATTGATCTGATGGGCCAGCATGGCCTCATCGACCTTCCTGGTGTCCCATGTTTTCCCGGCTGTTCTACTCTGCCGTCTTTGGAGGCATGCCCTCCGAGGAAAGGAGATCAGGGCATGGTCGCTCAGCGTCATGGCGTCATGGACCCATCAGTTATTTGTTGTCTACTGGCCCTCTGCTGACAAGGTAATCAATAAAGGACGTACCCTATCGTTGTTAATCGGCTTCCGTCCATCGTTCCAGCGGTATGGGTCAACATTCGCATGGCGTCAATCACAGCTCGTCCTCTGGTGTTGGATGTCCTGCTGCCCCATTCCACTGTCAGGCATTAAGGTCGCCAGCAATGACCTTCGGGCTTCGCCCTCTCGCGAAGTCCACGGCCTCAAATCCTCGAACTGATCGGGGGGTGTCATCGGCGGAGACGTAGCTGTACATGTGCGTGTTTTAACTTCGCATAAGCGATACCCGCATGGGTAAAGCAATAAGTTCCTGGACTTGGAGAGCTGCAGCGATTTGATGGCTTTCTGCTTTACCTCGTCAAGGATCATGGACGGTGTCCACTACCAGAGAGACGTAGGGTTCGCTTAGGAGCATGATGTCTATTTACGCTCAACCACAGTCCTGGGAGGCTCTGAGCTGCTGCGCAATGATTGACATTGAGGCCGTACTACTACATAATATGGGCGTGCATTAAGGTGGCTCTTGGCATCTTTTAGTGTCGACGCAAAGCTACCGTTGGATTTCTGTCCACCTCGCTGCTGCCAGATCAGGCACGGGTGCAGCAACGCCCTGCCTTGTGCCCACGCTCACCGCATCTAAGACAGCAGTCTGCCTGTCGAGGCTTATCCTTACGGGTTGATCGATGCCCATATGCGAGACACCTGCTTAACTCGTGGGTCCGGACGTCCTGGGTGATACGACATCTTGACCATCCGGCGGTGCCCTGTTTGGGACTGGTATCGCAACGTTCGCGTTCAGCACTGGGGCTATTTAGCGCAGTTCATACTGCGAAGGCCCTGATATCTTCAGGATTTATCTGCAGGCCCTGGAATTGGGCGACCAAACAGCTGTGGGCTTCTCTGCTGTCGTAGCCCTCGTCAATCTTTTGAGATAGAGCTATTCTTTTGCGCTCCTGGCTGCGCACAGAAGTGCGTCAAATTGAGCGCTTAAACTGCGGGTCAGCTCTTAAACTTGGAACGCTTTCGAAGCTTTCCCTACCTCCAGCAACCAAGATCACCTACCGCCTGCGTTCTCCGGATTTTTTCTTACGTGACTGCCCAGTTCGCTGGGCTCGATTTCCGATCTCCAGCTTCCAGAAGCATCTCTGCGGCGACCCTCTCTGTCTTTTTGATGGTGCCTCTGCGCGTGCTAGCATTCTTGGCATTAGATCGCAGCTGCCTGGCGGACTCGTTAGGTATGGATGTCGCCTTTTTTTTCTTCACCGTTGCCATCCAACGTAGGGTTGCTCTGCTTCGGCGCCCTGGACTGGCACCACCGTGGGTACCTGCGCATTTGTGGGACCTTTTGAGGTGGCGACTTTTTGTACCTCCGTTGGTGGCGCTGCATAACCAAGCGGTGCTCGCTAGTAATACCTTCGTACAGCTCTATCGCCCTGTTGTTAAGGGCTACTGAGAGTTCAGGCTATGCCTTTGTCTCATGTGTCGTTGGGTCTCGAATGCAGATAGAAGGGGGGCTGATCTTGCCACTGCATCCTGGTAAATTATGCCCCTCAGGTCGTTCTGGAGAGCAGTGGTCAGAATCAAAGAGACCGATGAGGGAACAAAGCTGAGTTCCACTCCGTCTTTGCACGGCGATGTGGTCCATCGTCTTCCTGACTGTCGCGGTCGTAGATAGCAGGGGCCAATTTCTCCACCTCTACAGCATCGCTGCAGTCCGATAGTCCAGCGGCGGCTGGGGCCTGCGTGCTCACCTTGCCACCGGCGGGACCGAGATTCTCACCATGGGTCAGGTTACCGACTCTGGTGGGGATCTCGAAGTCAGGAAGCCTCCTGAACAGGTCGTTGCGATCAGGACTACTGCGCCTCAGCTGGAAGGATGGCCTAAGGTTACCTAGGTCACGCCAGGCCACAGTTTCCCCTGGCTTACGGATGGGTTTGTGCCGCCTCGGCTCGGACACACAGAGGCCTCTTGGGCACCAGCACGGTGAGGGATATTTGAGGTCTGTCCGCGACCTTTGTCACCTTTTCCCCTTTTCTTAAAGACATTGCGCTCCCAGTTACCAGAATCAAATTAAATTAAGGTGTTCAACGCGGCAATTTTAAATTTAATTTTGAATTCGCATCGCAACACAACACTAGTCGATCTGGCAGCGCCTCCTCCAGATCGCCCGCTGCGCTTTATCAGCTGTTTATCCATGCAACAATCGCAAGTGTAAATTACCTATTTACATGAAACAGGCACTGAATTAACTCGCGTGATTGCGGCGCAGAACTATCAGCGCAATCCACCGTGTGATTTTGCCGTTTACTTACCCACACCACGGCCGACACAGCTTCTATGGTTTCGAGTATTTCGCGCCGCGTTTAAGACGTCCGTCTTCACGGCGATGTAGGCCAGTCTCCGCACCACCAGGATTGAATGTCTAAGCCTGTGCGTTCAGGATTAATTTGGCAATACGACAGCATTGAGTTTTGGGTCTCTTTGTGAGTTTGCACTTCTTTGGCACCCAGTTCGAAAAATGGCGATTCTGCATTTCGGGTGTCAGCAAATTGTTTTCACTATTGTAGTATGCACGCATATCGGTTAAGCACTGTACCTATGTATTCGCCAATTATGGCACCCTGTTGCAATGTGTACATAGTCAACACAGAGCATACGTAATACGAGCACCGCCGGGGGCTATTACATAATTGCCTGGTCAGCAGTTCTCCCGCTGGCCAAGCGCTGATCAGCATATGTGTGCCTATACCACTCCTCCTTAGCACCATCAGCTCGGCGGCAGTACATATATATACATATATATAAGATGCGCATATAAGCGTTGCTGCGCTGCAGGCTATGCCGGCAGCGCTGCTCCTCTTGACTAAGAAACCTTTGTATGTAGATCATAGAGGATTGACGAATTAATTTCCGAATGGGTGGGACCTTCCCTGTTCCTCAAATTGGATCAAATAAAGAACAGCTAAAACACAAATGATCTATGACACAATGAAACTACAGGAGGTAGGTCCCATACGATGTGGATCTGAATCACTTTATGCTCGGCATCACTCTCTGGCGGACACAAAGTAACAAGAAAACAGAGTCGTTAACTTGAGTAAAATAAATCTGCGACAAGAAATTACGTTTGTAAAGAAACTGTTTACCTGCGTGAAATAAGATGGAGTACAGTTTTAACGGTCAAAATTAAGGGTTATTTGCTTAATTAAACACCATTTTTTAGGAAATATAATTAAACCAGTATTTATTTTACTTATAAATTAAAACAAATTCAAAATATCAAACTAGCAATTCCAAGTTTTAAACACTTTAGAGTTTCAAAACTCTTTTACACAAAACACTAAACCTAGTTTAATCCTAAATTTTAAAATTATTTTGTTAAAATTTGAAAAGTTGTAGCAGTATTTAATTATGACCCCCATTGGCTTTGGCACCTAAGGTTGAAGCTTTTTTCATGGAATGGATGAGTTTTTTAGGTCATGTTGAAGCGGGATCTTTCCCACTTCTATCGCAGCCATGAGCTGTTGTCATTTTGGTGCCTTTTGCCACATTCTTCTTCGAAGTAGGCCCCTAATTTTCAATGGGGTTCAGATGTAGAATACAGGGGAATATCGATCACCTTACAGTTATAAAGACCAGTTGCGTACATTTGCACTCTTTAATGTTTGGGATCATTGTCCTGATAAAACTTAAAAGTTGGCTTGTTGTTGCTAAATAGATAAATTTTCTACGCAGCCTTCAAATTTGATTTTAAAATATCTAGATATTACGGCATTCATAGTGCTCCAATAAAGAAACTGTTGCCCACTCCGGCAAGTACTGGCCCAAATCATGCTGATAATTTTCCAAATTTGATTGTTGGAATGATATTTTGTTTTCTAGCGCCTCAACAGCTTGCGCCATACTTTCTGCTTGGCCCATCGTTATAATAGAGCATCATTTTGTTTCGTCACAAAATATTACATCATCCAGTACTCTTCACGCGATCCATCATGCTCACAGCTGACCTCTGATAGCAAAGGCTTTTTTCTTGCAACTCTTGAAAATTACCTATGATAGAATGACTTGGCGCACAGTTTTGTGTGGCGCTAAGGAACCTGATATCCTGAGCAAGTAGTCTGACCGAGATTCGGGAGTTCGCAATCACTTTTCATAATAAGGCAGTCTACGCTTGCTAATTTTAGTTTGCGCCACCACTCTTGGTTCAAGCTGTTCTCTTTTCAAGCGATTAAAGCCCAGACGGTCTTACGGGATACAGAAAACATTTATACGAATTCTGGAATAGATTTTCCCAACTGGTGGTTTTAGTATATTGTTGGGTCACTTCAAAAGCTAATCTATTTCCAGGCATTTTATTAAATTTAATAACTCATTCGATCAGCAAAAATTTCACAAACAAGTAAAAAGAACAATAGAAGCGTTGTAAAGGAATGCAAATGCCAAAATAACGGAAAAGTCGAGTTCGTTCTAAGAAAAGAGCAAAACAAGTAGGAAAACAAAATGTGTAAGGAGTTTCTTGCCACTCAAAAGTGTGTAAACTTAGATTTGTTGTTTTAATTTCTTGTATATTATTACAATTTGTTTTAACCATAGTAAGTAATCAAGCAGACTAGTCATTAAATTGCGTTTGAATAAAAATAACCACTTAATTGACAACTAAAATGAAAAATTCAGCTTATTTCACGGCGTGTATAGTTTCTTGACAAACTATCTAAATTTAACACTTGGAAGTACCATCTGCAAGATTCATTACATTGAAGTGGACTTTTGACTCTCAGAGATGAATTAAAACATTATATTCTTAAGATTGGCGACGAGGAACCAGACTGAACTAACTAAACTAACTATCGATTTAACTAAATTTAGTGGGTTTTACTGATAATTTTGAGTTTCTTACAAAGATGACTAATATTAATTTTTTTAGTTAAAATAGTTTGCAAAACTGGATTTATGTAAATGTATGTTCAGATCTGGTTGGGTTTTCTGGGTCTCCCCAACACCTCGCAACGAATGCTGAATTGGAATTATTCGTCAGAAGGACGATTGATCTCGTGAGTAATAAAAAAGTACAGCAATCTCTTACTTTTGAGGGTGGCGTGTTGGAAAGTATGTACACATTTAAGCAAAAGTCATGGCCTGCATCAAAGACACTAGAATAATAAGATGCGTAACAATGACCATACACTGGTTTGGCACTATGCAGCCACTTTTTTGAGCCAAAATTGCTCTCTTTCCGCTCACGCTGAGCGTAAGAAATCTAAAAATAGAATTTGCTTGCTTGTGTGAGAGTAAAAACAAAGACGAGAACACGCGTATATGTGTGCGTGTTGCCTAGAGGCGATTTTCGAGGCCAGAAATCAATTCTGATCGCAGTATTTACATATGTACATACATATTTGGGGAGTTTGGCCAATTTCGATAGAATATGAGTAAAGAATTGCGCTGTTTAAGATATCAAATTGGAATATAAAAAAAAAACTGAAAAAGAAGTCATTACACTGAGAGAAAAATATTTCATAAAAATAATACGAAGTAGAAAATAAAAGAATAAAAAAATGTTAACTGTTTATTTACCCAAACGTCATATCAAATTAGAGATTATTCCTGAGTGTCTTTGCTTTTGGTCATATCTTGAGGCGCAGAAATTGAGCAATACGTAACCCC
->d97ddf33-5653-4d95-b894-e58a48e917ab
-TTGCTCGGTGTGCTTCGTTCAGTTACGTATTGCTACATAAACAGTCCAGCACAAGTGCTTATACGTAATACGAGGCAGCACCCACTTGAGGGGCTAACATACATAGTGCCTGGTCAACCCAGTTCTCCCGCTGGCCAAGCTGATCGCTTATATGTGCCTGCCACCACTCCTCACCTCAGCACCATCGCTCGGCGACAGTACATATATATACATATATAAGATACATATAAGCGTTGCTGCGCTGCAGGCTATGCCAGCAGCGCTGCTCCTCGACAGGCTAAGAAACCTTTGTTATGCTTAGATCCTTAAGAGGATTGACAGATTAATTTCAGATATGGGCCAGGACCTTCCCTGTTCCTCAAATTGGATCAAATAAGAACGAGCTAAAACACAAATGATCTATGACCCACAATGAAATGAAACTACAGGAAGTTGGAGTAGAGCGAGGTCCACTGATGTCGGATCTGAATCGCACTTTATACTCAGCATCACTCTCTACAGCGGACCTTGTACAAAGTAACAGAAACGGTCGTTAACTTGAAATTAAAAATAAATCTGCGGCAAATTTACAGTTTGTCAAAACTGTTTACACACCGTGAAATAAGATGAATTTTTTGATTTTAACAGTCAAAATTAAGGGTTATTTGCTTAATTAAACGCAATTTTTTTAGGAAATATAATTAAACAATATTTATTTATTTTACTTATAAATTAAAAAACAAATTCAAAATATCAAATATACAAGAAATAAATATAGATTCCAAGTTTACACACTTTTGAGGTGCATCACTCTGCCCAAACCGTCATCTAGGTTAGGCTGATGGGTTACCTCCCCGTCGCGACGTTGCCATCTGCTCTGCCATTCACCTAATAGCCACTCATTATTGCCTCTTGCGCAGGCGCCACCGCTCCGCATAATTTAGAGGCAGCGATCTCAGATCAATCAGCGAGGCCTGCCAGCGCTAGCGCCGCGTCTTCGGATATGGTCACGAATCCTCTAATAATAATAATAGGCCACAGGGGCCATTGACCGTAGCACCAGACGAGCTCCTTTCAGGTATGAGACCCTGCAAGAGTGGCATTGCTCCAGACTGGTGCAGCGTATAGCAGCGAAGCCTTTGCTACTGACACCAGCGGTTTCCTGGCCGAATTGTCTTGGGCCTCCGACGTTGGGCGCCAAGCCTCGCCAACGAGAGAGGGATGTGACTGCTGTCTTCTTGCTGGCGTAGCTCGCGTAGTCCTTGAACGATAGTCTGCGATCTATCATTACCCCAGGTACTTTAGGGACTCTTGAGGAGGTCCCCTGGAGTACCCTTGACGGAGACCAGCATGTTCTCCATCTTTTTCCTTTCTGCTGCTTAGTAGGACTGCTTCGGTCTTGTGAGCCCATATTGCTAGCCCGGCTGTGATTGCCACATCGTCAGCAGAGCAGCTGCCTCGACGACTTCAAGTTCTGTGACGCACTTGCGGAAATCTGGGGCGGGGCTGCCTCTGGTAGCCTCCACATGAGTGGTGCTGCTTTGGAAGCCAGCTCCCCTAGTATGTTAGCCAGGACCCGGGTCGGATGGGGTTGCGCTCCTCCTTGGCTCGTTGGTAACAAACGCGTAGGCGGGGCCCCAGATATCGCTGTCTACGCCATCCCTGCGGCTCAGCAAACGGCCGCGCTGGCGGCCGCGATTGCCGATGCCAGACTCCTAGGCGTTTGCTTCACAGAAAGCCTCCAAGAGTTCCGCGTGGTGGAGTACTGCCTCTCTGGCTCGTTGCGCCGTTCTCTTGGCCCTGGGGCAATCAGACCGTAGTTGGCTTAGGAGGGCACTCCGCAGTAAACGGGTGGTTTGCGCTGTACCTTATTTTCCTTGGCATGATGATTGCGTCGCAGATTCTTTAGCATATTCAGGGGCCTGCCGCCATACTCTCTGCGTCCACATTTTGGGATTTCCAGGGGAATTGATCTGATGGGCCAGCGCTGGCCTCATCCCGATCTTCCTGGTGTCCCATGTTTCCCGGCTGTTCTACTCTGCCGTCTTTTTGGGCATGCCCTCCGGGGAGATCAGGGCATGAATTCGCTCAGCGTCATGACGTCATGGACCATCCAGTTATTTGTTGTCTACTGGCCCTCTGCTGACCAAAGGTAACGTCAATGGGACATTACCCTATCGTTGTTAAACGTCGGCTTCCGTCCATCGTTCAGCGGTATGAGGTCCAGCATTCTCGCGTAATCAATCACGAAGCTCGTCCTCTGGTGTTGGATGTCCCTGCTGCTACATTCCACTGTCAGGCATTAAAGTCGCCGGCAATGACCGGGCTTCGCCCTCTCGCATGGTCCACGAGGCGCCTCAGAAGCTCCTCAGACGATCGGGGGGGGTGTCGCTCGGCGGAGCGTAACGGCTATACGTAATGCACGTGTTTTAGCTTCGCGTAAAGCGATACGCATGGAGTAAAGCAGCCAGTTCCTGGACTTGGAGGCTGCGGCATTTTGATGGCTGCTTTTACCTGCCTCGTCAAGGATCATGGACGATTGTCCACTACCAGAGACGTAGGGTTCGCTTAGGGCATGATGTCTACATTGCGCTCCAGCCGCAGTCTGGGCCCAGGAGGCTCTGAGCTGCTGCGCAATGATTGACGATTAGGCTGTACTACGCTAATATGAGGCGTGCATTAAGGTGGCTCTTGGCATCTTTTGAGTGTCGCTCTGTAAGTCCGGGCACGCAAAGCTACCCGTCAGGTGGTTTCTGTCCACCTCGCTGCTGCCACCCAGATCAGGCATTTTTGGTGCAGCAACGCACTTTTGCCTTATTGTGCCCACGCTCACCGCATCTAAGACAGCAGTCTGCCCTGTCAGTGTCCTTGCGGAGGTTGCTGATCGATGCCCATAGCCGAGGACACCTGCTTGGCATCGTGGGTCGGACGTCCTGGGTGATGCAACTCTTGACCATCAACGATTATGAATTTGCCCTGTTTAAGGACTGGTATGCCAGCGTTCGCGTTCAGCAGCACTGGGGCTGGCGCAATTCCGCGCCTGCGAAGGCCCTGATATCTTCAGGATTTGTATCTGCAGGCCCTGGAATTGGGCAGCCAAACTGGCTGTGGAGCTTCTCTGCTGCATCGTAGCCTCATTAGTCGCTGCAGAGATGGGGCTATTCTTTTGCGCTCCTGTGCGCACAGAGGTAAGTCATTGAGCGCCGCTTCCAGGTCAGCTCTTAAACTTAGGAACAGCACCGAAGCTTTCCCCTCTACCTCAAGCAACAGATCCGCACCTTTCTGCGTTCTCTCGGATTTTTTTTCGCACGTGACTGCCCAGTTCGCTAAGGCTCGATTCCGATCTTAGCTTCCGAAGCATCTCTGCGTGCAAGCCTCTCCTGTCTTTTACGATGGAGTGCCTCTGCACCCGTGCTAGCATTCTTAGCGACAGATGCATAGCTGCCTGGCTTGGACTCGTTAGGTATGGATGTCGCCTTTTCTTCACCGTTATGCCATCCAACGTAGGTTGCTTCTAGCTTCGGCGCCTGGACTTTGGCACCTGCCATTAGGTACCTGCGCATTTTGTGGAGCCTTTTGGTAGGCTTTTGGCCTCCGTCTGGGTAGCGCTGCTCTTCAAGCGGTGCTCGCTGAATATTACCTTCGTACAGCTCTATCGCCCTGTTGTTAAGGGCTACGGGAGTTCAGGCTATGCCCTTTGTCTCTCATGTGTGTCGTTGGGTCTCAGATACTTGGCGGATAGAAGGGGGCTGATCTTGCCATTCATCCTGTTAAATTATGCCCCTCAGGTCCTCGTTCACAGGTTAGGGTCCTAGGTTGGGTGAGGACATCGGCTGGGGACTTCCCTCCCGTCTTTGCGATGGCGGCGATGTAATTCCATCGTCTTCTGACTTATCGCGGTCGTAGATGCTGTAGGAGCCAATTTCCTCACCTCTACAGCATCGCTGCAGTCGATAGTCAACGGCGGCTGGGGGCCTGCGTGCTCACCTTACCCGACAGGACCGAGAGATTCCGTCACCATGGGTCCGGGTTACCGACTCCCTCTGGTGGGGGGATCTCGAAAGTCAGGAGCTCCTCCTGAACGGGTCGTTGCGATCAGGGGACTGCCCCACTGCGCTGTCATCAGCTGGAAGGATGGCCTAAGGTTACCCTAGGTCACATGGGCCACGGATTTCCCCTGGCTTTACGGATGGAGGTTTGTACCGCCTCGACTCGGACACCAGGCCTCTGCTTAGGCACCAGCACGGTAGAGGATGATATTTGGTCTGTCCGCGACCTTTGTGCCTTTCCTTTCTTAAAGGGCTTATTGCGCTCCCAGTTACCAGAATCAAAATTAAATTCATTAAATTTCAGCGGCTTAATTTTAAGATTTAGTTTTGAATTTCCTTTCCCTACTGTCGCAACACAACACTGAAGTCACGCACAGTTGGTTGATTGGCGCTTCCTCAGATCGCCATGGCCCCTGTTTATCCGCTGCAACAATCCCTTAGAGATAATAAATTACCTATTTACATGAAACAGGCGCACAATTAACTCGCGTGATTGCAGCGCAGAGACTATGGCGCGACTCCACCGTGTGATTTTGCCAGTTTGCCGCACACACCGGCCGACACAGCTTCTATGGTTTCGAGTATTTCGCGCCGCGTAATTTAAAGACGTCCGTCTTCACGGCGATGTAGACTTGAGTCTCCCGCACCAGGATTGAGTGTCTAAGCCTGTGCGTTCAGGATAAACTTTGGCAATACGACAGCATTGGAGTTTTGGAATTCTCTTTGTGAGTTTGCACTTCTTTAACAGTTCAGAAAATGGCGATTCTGCGACTCTAAATTGTCAACAAATTGTTTTCACTATTGTAGTATGCACACATATCGGTTAAACTGCTGTACCTGGCATGTATTCATGGTGTAGCACTCTGTTGCAGTGTGTACATGAAACAGTCCAGCACAAGTGTATGCAATATTTTGAAGGCAGCACCCAGCGAGGGGCTAACATACATAATTGCCTGGTCAACCCAGTTCTCCGCGCTGGCCAAGCTACGATCGCTTATATGTGTGTGCCTATACCCTCCTCATCAGCACCATCAGCTCGGCGACAGTACATATATATATACATATATATAAGATACGCATATAAGCGTTGCTGCGCTGCAGGCTAGCTATAGCAGCGCTGCTCCTCGACTTAGGCTAAGAGCCTTTGTGTATGTAGATCCTTAAGAGGATTGACAGATTAATTTCAGATGGGCAGGACCTTCCCTGTTGTTCCTCAAATTACTTGGATCAAATAAAGAGACAGCTAAAACCTGGAAATGATCTATGACACAGTAAGAGCTACAGAGTTGGAGTAGGCGGTCCCACTTCTGATGTGGATCCTGAATCACTTTATACTCGGCATCCTCTCTACAGCGGACCCCACAAAGTAACAGAAAACGGTCGTTAACTTGAAATTAAAAATAAATCTGCGACAAGTACAGTTTCAAAGAAACTGTTTTACACACCTGCAAATGAAATAAGATGAATTTTTTTAGTTTTAACGGTCAAATTAAAGAGATTTATTTGCTTAATTAAACGCAATTTTTTGAGGAAATATAATTAAACAATATTTATTTTACTTATAAAATTAAAAAACAAATTCAAAATATCAAATTATATACAAGAGAATAAACAACAGATTCCAAGAGTTTAAACACTTTTTTTGAGAGTTTCAAGAGAGCTCTTTACACAAAACCACTAAACCTAAGTTTAATCCTAAATTTTTAAATTATTTTATTAAAATTTGAAGAGTTGTAGTGTTATTTAATTATGACCCCCATTGGCTTTGGCTACAAGTTGGAAGCTTTTTTCATGGAGATGGATGAGTTTTTTTAGGTCATATTCAAGCAGGATCTTTTTCCCACTCTATCGCAGCCATGAGCTGTTGTCGTGTTTTGGTGCCTTTTGCCACATTCTTCTTTAAAAGTAGGCCCACAAATTTTCAATGGGGTTCAGATCAAGACTCTGAGGGCGTATCGATCACTTACTTGCCACAGTTATAAAGGAGGCCAGTTGCATTACATTGCACTCTCTTTATGTTTGGGATCATTGTCCTGATAAAACTTAAAATTTGGCTTGTTGTTTTTTGCTAAATAGACCAAATTTTTTCTGCACTGGCCTTCAAATTTGATTTTAAAATCTAGATATTGCACGGCATTCATAGTGCTTTCAATAAAAGGCTAATTTGCCCTCCATGGCTTGAGAGATACAGCTAAAATCATCACTGATAATTTTCCAAATTTGATTGTTGGAATGATATTTTTGTTTTTTCTAAAGCGCACTCAACAGCTTGCGCCATACTCTGCTTGGCCCATCGTTATAATAGAGCATCATTTTGTTTCGTCACAAAATATTACGTCATCCAATTACTCTTCCGCGTCCATCATGCTCACAGCGAATGAATGGCCTTTTTCGAAATCAAACCTCTGATAGCAAAGGCTTTTTTTCTTGCAACTCTTGAAGAGTACCTATATGGCGTAGAATGACTTAGCGCACAGTTTCCAATATTGCTGCTTCGGTCCCACATTCTTGCCACAATCCTGGAGCAGAGTGATCTGACCGAGATTCAGGGAGTTCATAATCCGCTTTTCGCATAATAAGGCGGTCTACACGCTTGCTGTTTAGTTTTACGCCCACACTCTCTTAGAGTTCAAGCCTGTTCTCTTTTTTCAAGCGATTAAAACATTGTAGACGGTCTTACGGGATACAGAAAACATTTATACTAATTCTGGAATAGATTTTTTTTTCCCAACTGGTGGTTTTAGTATATTATTTGGGTCACTTCAAAGCTAATCTATTTCCAGGCATTTTTATTAAATTTAATAACTCATTCGATCCACAGCAAAATTTCACAAGCAAAGTAAAAAATTTCAATGAAGCGTTGTAAAGAGATGCAAATGCCAAAGAAATAACGGAAAAAATCGAGTTCGTTCTAAGAAAAGAATAGAAACAAAGTAGGAAAACAAAATGTGTAAGGAGTTTTCTTGCACTCAAAGTGTAAACTTGGAATTTGTTGTTTTAATTTCTTGTATATTTGATATTTTGAATTTGAACTGAATTTATAAGTAAAATAAATGTGTTTAATTTATATTTCATTAAAAGTGCGTTTAATTAAAGAAATAACCCTTAATTTTGACCTTTAAAGAGTGAAAATTCAGCTTATTTCACGGCGTGTAAATGGATTTCTTGACAAACTGTATATATCTACAAATTTACAGCTTGCCCAGTGCCATCTGCAAGATTCATTTACATTGAGAAGTGGACTTTGACTCTCAAATTAAAACATTATTATATTCTTAGATTAGACTGACGAGGGAACCAACAGACTAGACTAACTAAACTAACTATCATTTTAACTAAATTTAATTAAGTTTACTGATAATTTTGAGTTTCTTACAAGATGACTAATATTAATTTTTTTAGTTAAAATAGTTTGCAAAACTAGTTATGTAAAATAATGTATTCAATTGATCTGGTTGGGTTTTCTATAGGTCTCCCCAACTTTACCTCACTGTGAATGCTGGATCAAAATTATTCGTCAGAAGGACGTGCACAGTCGTGAGTAATAAAATTACAGCAATCACCTTTTGAGGTGGCGTGTTGGAAGAGTATATGTACACATTTAAGCCAAAAGTCCATGGCCTGCATCAAAGGAACACTAGAATAATAAGATGCGTAACAGCCATACACTGGTTTGGCACTATGCAGCCACTTTTTTTTTTTGGTGACGGCCAAAGGTGCTCTCTTTCCGCTCGCTCACGCTGGGCGTAAGAAATCTAAAATAGAATTTGCTTGCTTGTGTGAGTAAAACAAAGACGGAGACGCGTATATGTGTGCGTGTTATTGCTAGAAGGCGATTTTCAGGCCAGGAAATCAATTCTGATCGCAGTAACGAATTTACATATATGTACATACATATTTAGGGGAGTTTAGCCAATTTCGTAGAATATGATGAAATTGCACTTTATTTAAGATATCAAATTGGAATATAAAAAAAACTGAAAAGAAGTCATTACACTGAGAAAATGTTCATAAAATAATACAGAAATTAGAGAAAATACAAAATTTATAAAATAAAAAATGTTAACTGTTGTACAGAGCGACGTCATATCAAATTAAATTATTCTAGTGTGTATCTTTTGCTTTGTAGGGTCCTTATCTTGAGGCTGAAGTTGGTTTAAACACTCAACAATCATTGTCTTCTTAATACTCAGCCCAGGCGGCACCGGCGAAGACCTAACTGCTTTGGGAATGGCAGAGAGAGTAAAATAAAAGATCAAAAAAAAGAGACCAGAAGCCCCTCGAGTTCAAAGAAACAGGATTCCCTGGACAATTCATCAAGCACCAGCGCAAATTAATTTCCTTTCTCACTTAAGCGACGGATTGCCCAAACAAAGGCAAGGAAACAAATATAACAAAGGCAAGAGATCTCAGAATGGTAAGTAGAGACAGTGCAACTGATTTTTGCTAAGCCCCCACCTATCTTTCTCTCTCTGACGTCAATATTGGTATAGAGTGAAAGCTAACCTATCTTAAAACTAAAATTAAAGAGGAGACTTTTATTATAAGACTCAACGTTATATGGACGTATAAGGTAATGGTTAAAAGTATTGAAGAGTTCACAAGAAGGTGGTCAAGGCAAAAATAGTTGGCTATTGCAGTACCACACATACCAGCTTAAGGATGACAGAGCATTTAGAGTTATTATTAAAATTTGCATTTTCCACAAATTTAGATGAAATTAAAAGTGATGAAGAGTCAAGGTCATGTTATTTAGAAACATAGAAGTAATATTAAAAAAGCCGTGCGACCAAAACGTCACTGAACATGTTTTATGCAGATATTGGAGCCTAACAAAAGACCTAGACATATAGTATAAATGCGTGTTGGGCCTCCCCACAGTAAGTCGTTCAATGATGCTATGGCTGCCAGGAATTCGGACATGCTAAATCATATTATTGTACTGCAAAGAGCCTTGTGCCGCTGTAAAATCCTCTTCTCGACACCCAAGCAACATTTGCCCAGAAAATACAGAACAACCAATAAAGATGTGCTTAGCTGCTACGAAGAACCGCCATGGCTACAAGGGTGTAGAGATTTATCAGGAACTCTTGTCAAAATAGAAATAGAAATAATGAAAGTCTAGATGCAAAATGGTTGCAAGGAATCAATAGAGTTTGTTTCCGCCTAACAAGCCAACATATATACCCAACAAAGTAACGATTATCAATCTTATGCCCAAGTGCTGCAGAATATAGAAACAAACATCACTGGAGATAGGATAGAGGCAGCTGTGGGAGGAGAGGCAGTCTGAACTTACAGATGGGTTGCTTAACGATGAAGTATTTACTTGTAAACAAATTATGCAGAGTAAATCCTAACCTTGGAATATGGAGGCGTAGTAGGAGGTGGCTTCAATTACTTCAGCTTCAGAGGGGAAAACAGACTGTACAAATGCATAGTAAACAGCAGCGCAAGCACTTTCAATGTGAAGCCTACATACTGGCCTACTGATGAGTAGAAGATGCAAACAACCCTTTCACTTAACGTTGCTTGTGAGCCAGTTTCTATGTTTTTTCAGGAGCTAACTGTAAAGTGTGCCTTTTGTTTTATCTGCTGATTCTTTATGATAGCGGTGCTTTTTTATGTATGTCTACTCTAAGTAAAAGCAAAAAACGCATTTGGAGATTAATTGCAGGAATTATTTGCAATAAATGGCACGCATCACAATAGTTATTGTTTCGATATTCAGTTACAGCACGTTATTAATTTACTTTTATAATACTTTAAGGCCTAAAGTACTTATAAACCCAGCAAAGGAGAGTTAACAAGACCAGTGATTTAGTCAAACTTAGTAGAGTAGTGAACAATAAGTAAGTAAAATGAATTTTTCTAGAGACGTAGGCAACCTTGGGCATTCAGTGATAATAATTTTCTGCCAGGGTAGAAGGTTTACATCTAACAAGAAGAGATTAGACAGGATTTAAACTTCGAGTTACTGGGATATTTCTACTGACGAAAGTGGTGAAGGGGAGATGAAAGACATTTCTACGGTACTGGAGAATTTAGAGAGGAGTTATGAAGGGAGGAAAGTATCGACATTGACGCTTCTGGAAGAGAAATACAGTGATTGAAGGATGTAAGACCTGACTCTTGCGTTGTTGTTGACCCAGTTGCTTAGAAAATTGATTAAAGAGGCTAAAAGTGGAACAAAGGCCGTTTGCTTGAAACCAGAGTATTTGGGAAGATGACAAAACTTTTGATGTAGCAATACGTAATACG
->b8495fa0-cf3a-4be1-a974-de366ef86f72
-TTGGTATTGCTTCGTTCAGTTACGTATTGCTTCTACACCCTTTGTAGCTGGCGGCGTGTTCTTCGTAACAGTTGGCACATTTTGGTTGTTCTGCATTTTTTTTCGGGCAAATGTTGCTTGGGTGTCGAAGGGATTTTTACACAACGGTACGTTTTGGTACAATATGATTTAGTATGTCGAATTCCTGGCAGCTATAGCATTGAACGATTTCATTGTGGGGAGCTCAATATTTTTTATTTACATTATATATGTCTAGGTTTTGTTAGGCTCAATATCTACATAAAAAAAACATGTTCAGTGACGTTTTGGTCGCACGGCTTTTAATATTACTTATGTTTCTAACAACATGACCTTTGACTCTTCATCACTTTTAATTTCATCTAAATTTGTGGAAAATGCAAATTCTTAATAACAACTCTAAATGCTCTGTCATCCTTAAACTGGTATGTGTGGTACTGCACACAATCATTATTAAGTGTTTTTGACTAATTTTCAGAATTCTTCAATACTTTTAACCATTACTGCTACATGTCCATAACGTTGAGTCTTATAATAAAAAAAGTTCTCTCTTAATTTTGGTTTTAAGATGGGTTAGCTTTTCACCCATACCATTGACGTCAGAGAAAGATAGGTGGGGGCTTAGCAAAATCAGTTGCACTGTCTTCATTTACCATTTCAGATCTTCGTTTTGTTATATTTTGTTCCTGTTTTGTCCAGACGATCCAAATGGCTAAGAGCGGTATTTGCGCTGGTGCTTGATAAATTGTCCAGGAATCCTGTTTTCTTTGGAACCGGGAGGCTTGAATTCTCTTTTGGATTTTATTTTTTTTACTCTCTGCCATTTCAAAGCAGTTGGGTCTTCGTCGGTGTCGCTCTGCTTGAGTATTAAAGAAGACAATGATTGAGTGCTTGTGTCCGCACTTCGTGCCTCAAGACGACGAAGCGAAGACACTGAGAACGATTCTAATAATTTGATATGACGTTTTGCAATAAACAGTTAACATTTTTTTTTATTTTATAAATTTTTTATTTTTTCTACTTCGTATTATTTTTTTTTATGAAATATTTTTCTCAGATGTAATGACTTCTTTTCAGTTTTTTTTATATTTTAATTTGATATCTTAAACAGCGCGCAATTTCATCATATGCAAAGTGGCCCAAAACTGCAAATATGTGTATGCATATGTAAATTCGTTACTGCGATCAGGAATTGATTTCGGCGAAAATCGCCTTCTAGCACAACACGCACACATATACGCGTTCTCGTCTTTGTTTACTCACACAAGCAAGCAAATTCTAGCGTTCTTACGCTCAGTGAGCGACGGAAGAGTAATTTTGGCCGTCACCAGTGGCTGCATGGTGCCAAACAGTCATTATGGCTGTTACGCATCTTATTATTCTAGTGTCTTTGATGCGGGCCATGTGACTTTTGCTTAAGTATTGTACATAGCACCAACACGCCACCTCAAAGTAAGATTGCTGTTTTTTATTACTCACGAGACTGTTGCGCATTCCTTCTGACGGAATAATTTTTGGTCAGCATTCGTTGCGAGGTGTTGGGAGACCAGAAAACAACCAGATCAATTGAACATATTATTTACATAAATTCAGTTTTGCAAACTGTTTTAACTAAAAATTAATATTAGTCATCTTTGTGAAACTCAAAGGTATCAGTAAACTTAATTAAATTTGGTTAAATGATAGTTAGTTTAGTTAGTTCAGTCTGGTTTCCTCGTCAGTTCAATCTAAAGATAATGTTTTAATTCATTCACAGAGTCAAAGTCCCACTTCTCAATGTAATGAATCTTGCAGATGGAGTACCAAGCAGGATGAAATTTGTAGATATATACAGTTTGTCAAAGAAACTATTTACCGTGAAATAGTTGAATTTTCTTTAAAGGTCAAAATTAGGGTTATTTCTTTAATTAAGCACAATTTTAATGAAATATAATTAAACAATATTTATTTACTTATAAATTAAAAAACAAATTCAAAATATCAAATATACAAGAAATTAAACAACGATTTGAGTTTTACACACTTTTGAGAGTGGCAAGAAACTCTTACACGGTTTTGTTTTCCTACTTTGTTTTGCTCTTTTTCTTAGAACAGAACTCTGATTTTCCATTATTTTGGCATTTGCATTCCTTTTACAACACTTCTATTTAGAATTTTTTTTTACTTTGCTTGTGAAATTTTGCTGATCGAATGAGTTATTAAATTTAATAAAATGCCTGGAAATAGATTAGCTTTTGAAATTATTAAATAATATACTAAAACCACCAGTTGGGAAAATCTATTCAGAATTAGTATAAATGTTTCTACCCAATATCCCGTAAGACCGTCTACAATGTTTTAATCGCTTGAAAAAGAGAGCAGGCACGAACTAAAATTGGAGTGGGCACAAAACTAAAATTAAGCAAGCGTGTAGACCACTTAGCAATATGCGAAGGTGCATTTGGTCATAATTGGATAGCATGGGACATGGGCGGGCTGATTTGTGCCACTGGCTTTATGCACTTAAGTCGGTTCCGCCATAGGTACTCTCTTCAAAGGTTGCAAGAAAAAAAAGCCTTTGTATCAGAGGTCAATATAGAAAAGCGTCATTCATTCGCTGTGAGCATGATGGATCATGCGGAAGAGTACTGGGATGACGTAATATTTTGTGACAAGAAACAAAAATGATGCTCTATTATAACGATGGGCCAAGCGGAGGTATGGCGCAAGCCTGTTGAGTGCGCTAGAAAAAACAAATATCATTCCAACAATCAAATTTGGAAAATTATCGAGTGATGATTTGGGGGGCTCATCTCAGAAGCCATGGAGTGGGCAAATTAGCCTTTATTGAAAGCACTATGAATGCCGTGCAATATCTAGATATTTTAAAATCAAATTTGAAGGCCAGTGCAGAAAAATTTGGTCTATTTAGCAACAACAAGCCAAATTTTAAGTTTTATCAGGACAATGATCCCCAGAAACGTAAAGAGTGCAATGTACGCAACTGGCTCCTTTATAACTTTGTGGCAAGGTGATACGCCCCTCAGAGTCTTGATCTGAACCCATTGAAAATTTGTGGGCCTACTTAAAGAAGAATGTGGCAAAAGGGGCGCAAAACACGACAACAGCTCATGGCTGCGATAGAGTGGGAAAAGATCCCTTGAATATGACCTAAAAACAAGTAGTCCATGAAAAAAAAGCTTCAACTTGTAGCCAAAGCCAGTAAGGGGTCATACTAAATACTACAACTTTTCAAATTTTAACAAAATAATTTAAAATTTGGGATTAAACTTAAGGTTTAGTGTTTGTGTAAGAGTTCTTGAAACTCTCAAAGTGTTTAAACTTGGAATTCGTTGTTTATTTTCTTGTATATTTGATATTTTTGAATTTGTTTTTAATTTATAGAGTAAAATAAATATTGTTTTAGTATATTTCCTAAAAAAATTGCGTTTAATTAAACAAATAACCCTTAATTTGATACGTTAAAATCAAAAATTCATCTTATTTCACGGTGTGTAAGCAGTTTCTTGACAAACTGTACTTGTCACTGGTTATTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTAGAGAGTGATGCCAGTATAAGTGATTCAGATCCGACATCAGAGGTGGGACCGCCTACTCTAACTTCCTGTAGAACTGCGTTGTGTAGATCATTTGTGTTTTAGCTGTTCTTTATTTGATCCAATTTGAGGAACAAGGAAGGTCCACTCCATTCAGAAATTGTTTGTTAATCCTCTTATGATCTACATACAAAGGTTTCTTAGCCCTAAGTCGAGGAGCAGCGCTGCGGCATATACAGCAGCAACACTATATCACGTATCTTATATATATGTATATATATATGTACTGTCGCCGAAACGATGGTGCTGGAGGAGGAGTGGTATAGGCACACATATAAGCGATCAGCAGCAGCCAGGAGAACTTGCTGACCAGGCAATGGTGTATGTATGTTAGCCCTCAAGTGGGTGCTCGTATTACGTATACACTTGTGCTGGACTGTTTATGTACACATTGCAACAGAGTGCTACAATTATGAATACACATAGGTACAGTGCTTAACCGATATGTGTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTAGAGTCGCAGAATCGCCATTTTCTGAACTGTTAGGGTGCAAAACTCACAAAATTTAAAACTCAATGCTGTCGTATTGCAAAGTTTAATCCTGAACACCGGGCTTAGACCTCCAATCCTGGTGCGGAGACCAAGAGTCTACCGCATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCGAAGTACTCGAAACCATGGTTATTGATAAGCCGATTATTGTGCGTAAACTGGCAAAATCACACGGTGGAGTCGCGCCATAGTTCTGCGCTGCAATCACGCGGGATTAATTGTGCGCCTGTTTCGTAATAAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAACCCAACGATAGCGCAGCGGGCGATCCTGGAGAGGAGGCGTTACCAGATCAACCCGTGTGATCCGTGTTGTGTTGCGACAGTAGGAGCGCAGAAAATTCAAATTAAATTTAAAATTAAGCCGTTGAAATTTAATTTAATTTAATTCCACGATTCTGGTAACTGGGAGCGCACAAGTCTTTAAGAAGGGGAAAAGGCACAAAGGTCGCGGACGAATGATATCATCCTCTCACCGTGCTGGTGCCTAAGCAGAGGCTCTGGTGTCCGAGTCGAGGCGGTACAAACCTCCATCCCAGCAAATACAGGAAATCCGTGGCCTACGACCTAGGTAACCTTAGGCCATCCTTCAGTTGATGGACAGCTGCAGTGGGGGCAGTCCCCTGATCGCAACGACCCGTTGGGAGGAGCTCCCGACTTTCGAGATCCCCACCAGAGTCAGGCCCCGACCCATGGTGACGGAATCTCGGTCCCCGTCGGTGGCAAGGGGTGAGCACGCAGGCCCCCAGCCGCCGTTGACTATCGACTGCAGCGTGCTGTAGAAGGTGGAGAAATTGGCTCCTACAGCATCACGACCGCGACAAAGTCAGAAGACGATGGACCACATCGCCGTGCCATCGCAAAAGACGGGAGGGTACAGCTTGTTCCCCTGCGGTCTTCCGGACGACCACTGCTCTCAGAACGAGGACCTGAGGGGCATACTTGCAGGATGGTGGCAGATCAGCCCCTTCTATCCGCATTCAGACCAACGACACACATGAGACAAAGGGCATAGCTTCCGAACTCTCAGCCCTTAACAACAGGGCGATAGAGCTGTACGAAGGTACTACTAGCAAAACCGCTTGAAGAGCAGCAAAAGCTGCAAAATGCTGGGTACCCACGGTGTACGGGTGCCGGAATCAGAGCGCCGAAGCAGAGCAACCTACGTTGGATGGCAACGGTGAAGAAAAGGCGACATCCATACCTAACGAGTCCAAGCCAGGCAGCTATGCATCTGTCGCCAAGAATGCTAGCACGAGTTGCAGAAGGCACTCATCGGCGTAAAGACAGGAGGCTTCGTACGCAGAGATGCTTCGGAAGCTAAGATCGAGCCTTAGCGAACTGGGCAGTCACGGTGAAAATCGAGAGAGAACGCAGAAGGGTGATCTGTTGCTTGGTGAAGCTTCGGAAGAAGCGTTCCCGGTTTAAAACGACCTGGAAGCGGCGCTCAATGACACCAGCCTCTGTGCGCACAGGGCGCAAAATAGCTCTATCTTGCAGCGGATTGGACGAGGGCTACGACGGCAGAAGCTCCACAGCTAGCGGTCGCTGGGTGGAGACCTGCAGATAAATCCCTGAAGATATCAGGGCCTTCGCGGTATGCGGAATTGCAAGCAAATAGCCTCAGTGCTGGGGCGCGAACGTTGCGATACCAGTCCTTAAACAGGGGGTATATAATCGTTGGATGGTCAAGATGTCGTATCACCAGGACGTCCGACCCACGAGATGCCTGGTGTCTCGGCTATGGGCAATAGATAAAGCGACAGGGACACTGACAGGGCAGACTGCTGTCTTAGATGCGGTGAGCGTGGGCTGGAGCAAAGGGGTGGGTGCCGCAAAGCGCGCGGTGCAGCAGCGAGGTGGACAAAATACACCGACGGGCGGCTTTGCGTTAGCGACTTTACAGAGCGACAACTGAAAGATGCCAGGCCGCAGCAATGCGCTCATGATAGCGTGGTACGGCTCAATGTCGATCATTGCGCAGCAGCTCAGAGCCTCTGGCCCAGACTGCGGTTAGGCCTGTCGCCGGAGCATCATGCTCGCCCGAACCCTACGTCTCTGGTAGTGGACAATCGTCATGATCCTTGACGAGGAGCAGGTAAAGCAACTATCAAATGCTGCAGCAGCTCTCTCGAGTCCAGGAACTGGCTGCTTTACCATGCGAGGGTATCGCTTATGCGAAGGATTAAAACACGTGCACATGTACAGCTGCTACGCTCCGCCGAGCGACACCCCGATCAGTTCGAGGGAACTTCTGGAGCGCTCGTGGACCAATGCGAGAGGGCGAAGCCCGAAGGTCGATACCGGCGACTTTAATGCCTGGACAGTGGAATGGGGCAGCAGGACATCCAACACCAGAGGACGAGCTGTGATTGACGCCATGCGAATGCGGACCTCATACTGCTGAACGATGGACGGAAACCGACGTTTAACAACGATAGGGTACGTGCTTTATTGACGTTACCTTTGTCAGCAGAGGGCTGGTAGACAACAACAACTGGATGGTCCGCTGACGTCTGACGCTGAGCGACCATGCCCTGATCTCCTTCTCCCGGAGGGCCATGCCCAAAAGACGGCAGAGTAGAACAGCCGGGGAAACATGGGACACCAGGAAGATCACGATGAGGCCATGCTGGCCTATCAGATCAATTCCTGAAATCCCAAATGTGGACGCAGAAGTATGGCGGAAGGCCTCATGAATATGCTGGGAAGAATCTGCGACGCAATCATGCCAAGGAAAAATAAGGCAGCGCAAACCACCCGTTTACTGGTGGAGTGCCTCCCTAAACCAACACGGTCCTGATTACTCAGGGGCTAAGAGAACGGCGCAACGAGCCAGAGGCAGTACCCACCACGCGGAACTCTTGGAGGCTTTCAGAAGCAAACGCCTAGAGTTCAAGCACGGCATCGCAGCTGCCAAAGCGGTCGTTTAAGGAGCGCTGCAGGATGAAGTAGACAGCGATATCTGGGGCCTCGCCTACAAACTGTTACCAACGAGCTGGGAGAGAGCAGCAGCCCCATCCGACCCGGGGGGTCCTGGCTAACATACCCAGGGAGCTATTTCCAAAGCAGACCACTATGGAGGCCAACAGAGGCAGCCTGCCCCAGATTTCCCGTGCGTCACAGAACTTGAAGTCGTCGGGCAGCTGTTTTGCTGACGATGTGGCAATCACAGCCGGGCTAGCAATAGCGGCTCACAAGACCGAAACAGTCCTACTAAGCAGCAGGGGAAAAGATGGAGAACATGCTGGTCTCCGTCAAAGAGGCCACTCAGGGGACCTCAAAGAGTCCCTAAAGTACCTGGGGAGGTAATGATAGATCTCGCAGACTATCGTTCAAAAGGACCACGCGAGCTACGCCAGCAAGAAGACAGCAGTCCGCATCCTCTTCGTTGGCGAGGCTTATGCTGCCAACGTCGGAGGCCCAAGACACCCCGGCAGGGAAACTGCTGGTGTCAGTAGCAAAGGCTTCGCTGCTATACGCTGCACCAGTCTGGAGCAATGCCACTTACGGGGTCTCTTACCTGAAAGAGGGCTCGTTCGATTACTTTACGGTCAATGGCCCTCAGGCTCATTAGGATTCAGGACCATATCCGAAGACGCGGCGCCTTAGCGCTGGCAGGCCTGCCGATTGATCTGGAGATCAGAACTCGGCCTTATGCGGAGTGGCGCTTCCGGGCAAGAGAGGCACACGAGTGGCAATGGGTGAATGGCAGAGCAGATGGCAAACGCGTCGCGACGGGGGAGGTGGACCCTATCCAGCTCATCCAGGAGATGACGGTTTGGGCAGAGTGACACTCTCAAGGAATTATTAATAAACTTGGAATTTGTTATTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTTAATTTATAAGTAAAATAAATATTGTTGTATATTTCCTAAAAAAAATTGCGTTTTAATTAAACAAATAACCCTTAATTTTTTGACCGTTAAAATCAAAATTCATCTTATTTCACGATTATTGTAAACAGTTTCTTGACAAACTGTACTTGTCGCAGATTTATTTTTTTTTAATTTCAAGTTAACTGACCGTTTTTCTGTTGCTATTGTCCGCTGTAGAGAGTGATGCCGAGTATAAAGTGATTCAGATCCGACATCAAATTGGGACCGCCTACTCCAACTTCCCTGTAGTTTCATTGTGTCATAGATCATTTGTGTTTTAGCTGTTCTTTGGTGATCCAATTTGAGGGAACAGGGGAAGGTCCCGCTCCATTCGAGTAATTCGTCAATCCCTCTTATGATCTACATACAAAGGTTTCTTAGCCTAAGTCGAGGGAGCAGCGCTGCCGGCATAGCCTGCAACGCAGCAACACTATATCGTATCTTGCCAGCA
->d4657c21-9a0b-4729-9da9-8e2c1123554a
-TCGGTACTTCGTTCAGTTACGTATTGCTGTCGAGATGATGAGAACTGGGGACTTCCCTCCGTCTTTTTTGCGATGTTTACGGCGGTGGCGGTCCCGCATCGTCTTCTGACTGTCGCGGTCGTAAGATGCTGGCAGAGACCAATTTCTCCACCTCTACGGCATCGCTGCGGTCGATAGTCAACGGCGGCTGGGGAGCCTGCGTGCTCACCGCCCCTTACCGACGGGACCGAGATTGCGTCACCATGGGTCGGGTTACCCGACTCACTCTGTGGGGGGATCACTCGAAGAAAGTCAAAGACTCCTCACAAACGAAGGTCGTTACGATCAGGGGGACTGCTTACTGCGCTGTCCATCAACTGAAGGGATGGCCTAAGGTTACCTGGAGTCACGTAGGCCACCGGCGTTTCCCCTGGCTTTACGGATGGGTTTGGCGTACCGCCTCGACTCGAGGACACCAGAGCTAGCCGGCGCCAGCACGGTGAGAGGGATGATGACGGATACTGATAAAAGCTGGCACGATGTACCACTTTCTTAGAGACGGTAACGGTTGCAGAATCCGTTAAAATTCGTTAAGTTTCCGGCGGCTTGGCGTTTTAAGGATTTTGGTTTTGATTTCGCCATACTGTCACCCAACACAACACTGATCACGGTTGATCTGGCAGCACCTCCCCTCTCCAGGTGTCCGCCGCTGCGCTTTATCGCTGTTTATCCGCTGTAAATAAAGATAATGGAAGTTACCTATTTGCCGAAACAAAGGGCGCTGGTGCTCGCGTGATTGCGGCGCAGAACTACTCAACGACTCCACCGTGTGATTTTGCCAGTTTACTTTTTACCTGACCGACACAACTTCTATGGTTTCGGTATTTCGCGCCGCAGCAATTTGAACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCCGCAGGTTAGTGTCTAAACCTGTGCGTTCAGGGGATTAAACTTTAGCAATACGACAACGTGAGTTTTAAGGTCTCTTCCTTGAGTTTGCATACCAACAGTTCAGAAAATGGCGATTCTGCGACTCTAAATTTGTCCAGCAAATTATTTTCACTATTGTAGTAGTATGCACATATGGTTAAGCACTGCACCTATGTGTATTCATAATTGCTTTCTGTTTTTATTCGTAACACGCCAAACAGTCCAGCACGCAAGTGTACCGTAATACGAGCACCGCCGAGGAGAAGCTGCTGCGCCGCATAATTACCTGGTCAGCAGTTCTCCCACTTGTGAAAGCGCTGATCAACATAATATGACGCTATACCACTCCTCCTCCAGCACCATCGCTTTCGGCGACGGTACGTATATATATACATATATAAGGAATACGCATAAGCGTTGCTGCGCACTGCGGAACATACCGAGCAGCACTGCTCGACTTGAACTAAGAAACCTTGGCCATGTGATCATGAAGGATTGACGAATTGAATTTCAGATGGGCAGGGACCTTCCCTGTTCTCAAGTGGATCAAATAAAGAACAGCTAAAACACAAATGATCTATATGACACAATGAAACCACAGGGAAGTTGGAGTGAAAAGCGGTCCCACTTCGATGTCGGATCTGAATCACTTTACTCTGAGCATCACTGCTCTGAAAGCGGACTAAAGTAACAGAAAACGATTAGTTAACCAAGGTAAAATAAATCTGCGACAATACAGTTTGTCAGAAATGTTTACACCGTGAAATAAGATGAATTTTGAATTTACAACGATTCAAGTAAGGTTATTTGCTTAATTAAGCAATTTTTTAGGAAATATAATTAAACAATATTTATTTACTTATAAATTAAAAACAAATTCAAATATCAAATAACCTGAAAATAAATAACAAATTCAGGGTTACTGCACGAGTCGCCCAAACCGTCATCCTCTGGGATGAGCTGATAGGTCCACCTCCCCGTCGCGACGTTGCCATCTGCTCTGCACCTGGAAAATTTCACCTAATAACCGCTCACGATACTTTCGCACCAGGCACTCACTCCGCATAAGGCTGAGAGCCTTGATCTCCAGATCAATCGGCAGGCCTGCCAGCGCTAGCGCCACGTCTTCGGATGGTCTAGATCCTCAATGAACCTGAGGGCCATTGACCGTAACGAACGAAACCTTTCGGTATGAGACCTGCAAAGGTGGCATTTGCTCCAGATTTCTGGTGCGGCGTATAGCAGCGAAGCCTTTGCTGAAACAACGGTTTCTGGCGGGTGTGTAGCGGGCCTCCGACGTTGGGCGCCAAAGCCTAGCCGAAAGCGAGGATGTGACTGCCTGTCTTCTTTACTTTAGCGCGTAGCTCGCGTGGTCCTTGAACGATAGTCTGCGATCTATCACTGTGTTACCCCAGGTACTTTTGGGGACTCTTGAAGGTCCCCTGGTACCGACGGAGACAAACATGATGTTCTCCATCTTTTTCCTGCGCCCAGTAAGGACTGCTTCGGTCTTAATGAGCCGCTATTGCTAGCCGGCTGGCGGTGCCACATCGTCAGCGAACAGCTACCTCGACATTCAAGTTCTGTGACGCAGAAATCCTGGGGAGCGGGGCTTTCTGGTGGCCTCATAGTGTGGGGTCATGCTTTGGAAATAGCTCCCCTGGTAAAATAATTGTAGGACCCCAGGTCGGATGGGTACCGCTCTCCTCCTTAGCTCGTTGGTACAAACTTGTAGGCAGGGCTGAATATCGCTGTCCATAATCCACGGCTCGCCGACAGCCGCGCTTTGGCAGCCCCGCGATGCCGTGCTTGAACATCAGGCGTTTAGCTACGAAGCCTCAAGAGTTCCCGCGTGGTGGGTACTGCCTCTGACTCACGTTACGCCGTTCTCATGCTTACTGAACCTTTACGATCAGACCGTAGTTGGCTTAGGGCACTCCACCAACCGGGTGGTTTGCGCTGTGCCCTTATTTTCCTTGCTTGATTGCGTCTGAATTCTTTAACATATTCATAGAACCTGCCGCCATACTCTCTGCGTCCATTTAGGATTTCAGGAATTGATCGATAGGCCAACGCCAGCGCATCGATCTTCACAATGGTGAAATCCCATATTTTTCCAATTCTCTGCCGTCTTTTGGAACTTCCTCCGGGGAGGAGATCGGAGGCATGGTCGGCTCAGCGTCGAAACGTCATGGACCATCCGGTTGTTGTTGTCTACTAGCCCTCTGCTGACAAGGTAACGTCAATGGACGTACTATCGTTAACGTCGGCTTCGATCCATCGTTCAACTTTGGTATAAAGGGTCCAGCATTCGCATGGCGTCAATCACAGCTCGTCCTCTGGTGTTGGATGTCCTGCTGCCCCATTCCACTGTCCAGGCGGCAAGTCGCCGGCAATGACCTTCGGGCTTCGCCTCTCGCATGGTCCACGAGCGCCTCAGAAACTCCTCGAACGATCGGGGTGTCGCTCGGCGGGCGTAACTGTACATGTGCACGTGTTTTAACCATAAGCGATACCGCATGGGTAAAACAGCCAGTTCCTGGACGGAGAGCTGCAGCATTTGATGGCTGCTTTACCTGCCTCGTCAGGATCATGGACGATTGTCCACTACCAGAGACGTAGGGTTCGCTTAGAGACATGATGTCTACATTACGCTCAACCGCAGTCTGGGCCAGGAGAAACCACGAGCTGCTGCGCAATGATTGACATTGAGAGCTGTACTACATATGAGCGTGCATTAAGGTGAAATCTTGGCATCTTTGGTGGTGTCGCTCTGTAGTCCGGAGCGCATAGAGCTACCCGTCAGTTGGTTTCTGTCCACCTCGCTGCGGATCGGCGTTTGAAGTTGCGGCAACGCCCTTTGCCTTTATTGCCCCACGCTCACCGCGGCGTCTAAGGACGGCGGTCTGCCCTCGGTGTCCTTGCAGGTTGCTGATCGATGCCGCCTTCACGGAACACCTGGCAGCATCTCGGTGGTCGGATCCTGGGTGATACGACATCTTGACCATCCAACGATTATAGTTGCCCTGTTTAAGGACTGAGTATCGCAACGTCGCGTTCAGCAGCACTGAGGAGCTATTTGCTTGCAATTCCGCATGCTGCGAGGCCTAATTATCTTCTAAGGATTTATCCGGGCCTGGTCCAGGCGACCAAGCAGCTGTGAACTTCTCTGCCAATGACCTCGTCAATCCGCTGCGAAGATGAGCTATTCTTTGCGCTCCTGTGCGCACAGGCCAGAATCATTGAGCGCCGCTTCCAGGTCGCTCTTAAACTTTAGAACGCTTTCGGCTTTCCTCTGCTCCAGCAACAGATCACCTTTCTGCGTTCTCCAGTTTTTTCTGCGCGTGACTGGTTCATGGCAAGGCTCGATTCCGATCTTAACAGCTTCGAAGCATCTCTGCGCACGTACGAAACCTCTCTATCCTTTTTTTACGATGGAGATTGCCTCTGCACCCGTGCTACAGCATTCTTGGCGACAGTGCGCAGCGCCGCAGCTTGGACTCGTTAGGTAATGGATCACGCCTTTTCTTCTGCCGTTGCCATCAACGTAGGGTTGCTTCTGCTTCAGCGCCTGGTTTTTGGCACCTACCACCCATTGGGTACCTGCGCATTTGTGGAGCCTTTTTTTGATGAGCTTTTGTACCTCGATGGGTAGCACTGCTCTTCAGAAGCGGGTGCTTTCGCTATTAGTACCTTCATGCAGCTCTATCCGCCCTATTTATTGGGCACAGAGTTTCGGAAACTATGCCTTTGTCTCATGTGTCGTTGGGTCTCGAATGCGGATAGGGGCTGATCTTGCCATTCATCCTGGTAAGTATACCTCGGGTCCTCGTTCACCGAGCAGTGGTCAAGTCGAAGACCGATGAGGGAACAAACTGGGACTTTCCCTCCGTCTTTGATGGCACGACGATGTGGTCCATCGATCGCTGACTTGTCGCGGTCATGGAGTGCTGTAGGGTAATTTCTCCTCTACGAAGCGTCGCGCAGTCGATAGTCAGCGGCGGCTGGGAGACCTGCGTGCCTCTTACCACCGACGGGACCAATTCCGTCACCATGGGTCGGGTTACCGACTCCTCTGGTGGGGATCTCGAGGGAGATCGAGACTCCTCTGAACAGTCGTTGCGATCAGAGTTTACCCCACTGCGTATCCATCAACTGAGGATGGCCTAAAGGTTACCAGGTCACGCGTAGGCCACGGATTTCCTGGCTTTACGGATGGAGGTTTGGCAATACCGCCTCGACTCGGACTTCAGAGCCTGCTTGGAACTTTCCAACGCGGTGAGGATGATATTTGGTCTTAATCCGCGACCTTTGTGCCGCACTTTCCTTTCTCTTAGGAACTTATTGCTCCCAGTGCCAGAATCAAAGTGAAATTAAATTAAATTTCAACGGCTTAATTTTAAGAATTTCGGTACGAATTTCCGCATACTGTCACCAACACAACACTGATCACACGGTTGATCACAGCGGCACGCCTCCTCTCAACAGATCGCCCTTCGCTATCGGCTGTTTATCGCCAGCAATCGCAAGATAAATTACCTGTTACATGCGACGCAAAGCACTGAATTAACTCCGCGTGATTGCAGCGCAGAACATAACGCGACTCCACCGTATTGATTTTGCCAGTTTGCCACACCGGCCGACTACAACTATGGTTTCAGTATTTCGCGCCGCGTGGTTAAGACGATCGATCTTCCGCGGCGATGTGAATGGTCTCCCGCACCAGGATTGAGTGTACAAACCTGTGCGTTGGGATTAAGCTTTTGGCATTGACGGCGACGGGTTTTGGATCTCTTGTGAGGTTTTGCGCCTGCAACAGTTCGGAAAATGGCGATTCTGCGGGCCTCGGTGTCCAGCAATTGTTTCACTATTGTGGTATGCGCACGCTATCGGTTAAGCACTGGCACCTATGTTATTCATGGTTAGCAGCACTCTGTTGCAATGTGTACATAAACGGTCAACGCAAAGTGTAATACGACGCCCGCGAGGGCTGGCACATATACGTAATTGCCTGGTCAACGGATCTCCCCGCTGGCCAACGCTGATCGCTGCTATATTGTGCTATACCACTCCTCCTCCAGCACCATCGCTTTCGGCGACAGGTACATATATATATACATATATATAAGATGCATATAAAGCGTTCTGCCGAGCTATTCCGGCAGCTCTCGACTTAAACTAGAACATGTAGATCACATGGAGGTCCTGACGGTCACGATTTCGAGATGGAGCGGGACGCTACACCTGTTCCTCAGGAAATTGGATCAAATAAAAGACAACTAAAACACAAATGATCTGACACAATAGAACTGGGAAGTTGAATTATAAGGCGGTCCCACTTCTGATGGTCGGATCTGAATCGCTATACTCGGCATCCACTCTCTACAGCGGACACAAAGTAACGAGAAAACGGTCGTTAACTTGAAATTAAAAATAGAATCTACGACAAATTACAGTTTGCAGTAAACTGTTTACACCGTGATAAGATGAATTTTTTGATTTTAACGGTCAAAATTAAGGGTTATTTAGCAATTAAACGCAATTTTTAGAGATATATTAAAAAGCAATATTTATTTTACTTATAAATTAAAACAAATTCAAAAATATCAAATATACAGAAAATAGCAACAGATTCGAAGTTTTAAAACACTTTTGAGAGTTCAGAAACTCTTTACAAAACATACTAAACCTAAGTTTAATCCTAAATTTTTAAAATTATTTTGTTAAAATTTGAAAAGTTGCTTAATTATTAATTATGACCCCATTAGCTTTATTACAAGTTGAAGCTTTTTTTCATGGAATGGATGAGTTTTTAGGTCATGTTATGAAACTTGGATCTTTTCCCAACTCTATCTTGACCATGAGCTGTCGTCAATTTTTTAGAAGGTGCCCGCACCGCATTCTGTCTTCTTTAAGTAGGCCTAAATTTCAATGGGTTCAGATCAAGACTCTGAGAATATCGATCCACCCTTTACCACAGTTATAAAGGAACCAGTTGCGTATTGCACTCTTTATGTTTGGGATCCATTGTCCTGATAAAACTTAAAATTTGGCTTGTTGTTGCTAAATAGTCAAAATTTTTCTGCACTGGCGAAAACTCAAATTTGATTTTAAATATCAGATATTACACGGCATTCATAGTACTTTCAATAAGGCTAATTTACCCTCATGGCTTGAGATACAGCCCAAATCATCACTGATAATTTTTCAAATTTGATTCA
->885c7e52-2334-4e7a-9aaa-ee6a2aba0d5c
-CATTGTACTTCGTTCAGTTACGTATTGCTCTTGATGGATTGTCAGGAATCCTGTTTCTTTGAACTTCGGGAGGGGCTTTGAAGTCTCTTTTGGATTTTATTTTACTCTCTGCCATTTCAAAGCAGTTAGGTCTTCGTCGGTGTCAGCTCTGCTTGAGTATTAGAGGCCAATGATTGTTGAGTGCTTGTGTCCGCACTTCGTGCCTCAAGATATGACAAAGCAAAGACACTAGAATAATTCTAATTTGATATGACGTTTGCAATAAACAGTTAACATTTTTTTTTATTTTTATAAATTTTTATTTTTTCTACTTCGTATTATTTTTATGAAATATTTTTTCTCCAGTGTAATGACTTCTTTTTTTCAGTTTTTTTTATATTTTCCAATTTGATATCTTAAACAGCGCGCAATTTCATCATATTCTACGAAATTGGCCAAAACTCCCCAAATATGTATGTACATACATGCCGAATTCGTTACTGCGATCAGAATTGATTTCGGCCCGAAAATCGCCTTCTAGCACAACACGCACACATATACGCGTTCTCGTCTTTGTTTTACTCACACAAGCAAGCAAATTCTATTTTTTAGATTTCTTACGCTCAGCGTGAGCGAGCGGAAGAAATTTTGGCCGTCACAAAAAGTGAAACTTGCATAGTGCCAAACCAGTGTATGGCTGTTACGCATCTTATTCTAGTGTGTCTTTGATGCAGGCCATGTGACTTTTGGCAAATGTGTACATACTTTCCAACACGCCACCTCAAAGTAAGATTGCTGTACTTTTATTACTCTTTGAGACTGTGCGTGCTTCTGACGAATAATTTGATCCAGCATTCGTTTGCGGCGAGGGTGTTGGGGAGAACAGAAAACCCAACCAGATCAATTGAACATATTATTTACATAAATTCAGTTTGCAAACTATTTTAACTAAAATTAATAGTAGTCATCTTTGTAAAAACTCAAAATTATCAGTAAACAATTAAAATTTAGTTAAATGATAGTTAGTTTAGTTAGTTCAGTCTGGTTCCTCGTCAGTTCAATCTAAGAATATAATGTTTTAATTCATTCTGAGAGTCAAAGTCCACTTCTCAATGTAATGAATCTTGCAGATGGTACCGGCAAAGTTGTAAATTTGTGAATATGTATACAGTTTGTCAAGAAACTATTTACACGCCGTGAAATAAGTTGAATTTTTTTTCACTTTAAAGGTCAAATTAGGGGTTATTTCTTTAATTAAACGCAATTTTTTGGTATAACATTTAAACAATATTTACTACTTATAAATTAAAAAAACAAATTCAAAATATCAAATATACAAGAAATTAAACAATTCAAGTTTACACACTTTTGAGGTGGCAAGAAACTCCTTACACATTTTTGTTTTCCTACTTTGTTTTTGCTCTTTTCTTAAACGAACTCGATTTTCCGTTATTTTGGCATTTGCATTCAACACACAACCTTCTATTGAAATTTTTTTTACTTTGCTTGTGAAATTTTGCTGATCGAATGAGTTATTAAATTTAATAAAATGCCCACCGGAAATAGATTAGCTTTGAAGTGACCCAAATAATATAAAACCACCAGTTGGGAAAATCTATTCCAAATTGGTATAAAATGTTTTCTGTATCCCGTAAAGAATGCGTCTACAATGTTTTAATCGCTTGAAAAAAAGAGAACAGGCTTGAACCTAGAGTGGTGGGCGCAAAACTAAAATTAGCAAGCGTGTAGACCCTTGTGTACGTGGTTGCGACCCCAGATCTAATTCAGATCACTTGCTCAGGATATACAGGCAAGAGTGGCGGCCTAGTTGTTATACTAAAACTGTACTTCAGGAGTCATTCTACGCCATAGGTACTCTTCAAGAGTTGCAAGAAAAAAAAGCCTTTGCTATCAGAGAGGTCAATATAGAAAAGCGTCGATTCATTCGCTGTGAGCATGATGGATCATGCGGAAGAGTACTAAGGATGACAATAATATTTATTTTGTGACGAAACAAAAATGATGCTCTATTATAACGATGGGCCAAGCAGAGTATGGTACGCAAGCTGTTGAGTGCGCTAGAAAAAACAAAATATCATTCCAACAATCAAATTTGGAAAATTATCCGGTGATGATTTGGGGCTGTATCTCAAGCCATGGGTGGGCAAATTAGCCTTTATTGAAAGCACTATGAATGCCGTGCAATATCTAGATATTTTTAAATCAAATTTGAAGGCCAGTGCAGAAAAAATTTGGTCTATTTAACAACAACAAGCCAAATTTTAAGTTTTATCAGGACAATGATCCCAAACATAAAAGTGCAATGTACGCAACTGGCTCCTTTATAACTGTGGCAGGGTAGTCGGTACGCCCCCCTCAGAGTCTTGATCTGAACCCCATTGAAAATTTGTGGAGCCCTGCTTAAAGAAGAATGTGGCTTAAAGGGGCGCAAAACGACAACAGCTCGTAGCTTGCGATAGAGTGGAAAAGATCCCGCTTGGTCTTGACCTAAAAAACTCATCCATTCCATGAAAAAAAAGCTTCAACTTGGCAATACGGCCAATGGGGTCATACTAAATGCTACAACTTTTCCAAATTTTAACGAAATAATTTAAGGTAGGATTAAACTTAGGTTTAGTGTTTTTGTGTAAAGAGTTTCTTGAAACTCTCAAAAGTGTTAAACTTTAGATTCGTTGTTTATTTTCTTGTATATTTGATATTTTTTGAATTTGTTTTTTAATTTATAGAAGTAAAATAAATATTGTTTAATTATATTTCTAAAAAAAATTGCGTTTAATTAAACAAATAACCCTTAATTTTGACCGTTAAAGTCAAAAAATTCATCTTATTTCACGGTGTGTAAAACAGTTTTTTCTTGACAAACTGGCCACTTGTCGCGAATTTATTTTTAATTTCAAGTTAACGACTTCGTTTTCTGTTACTTTTATTGTCCGCTGTAGAGAGTGATGCCGAGTATAAAGTGATTCAGATCCGACATCAGAAATTAGGACCGCCTACTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTGTGTTTTAGCTGTTCTTTATTTGATCAATTTGAGGAACAGGAAGGTCCCGCTCCATTCGAAATTAATTCGTCAATCCTCTTATGATCTACATACAAAGGTTTCTTAGCCTAAATTCGAGGGCAGCGCTGGCGCCTTCTGCAGCGCAACAACGCTTTATATGCGTATCTTACTTATATATATGTATATATATGTACTGTCTCGGCGACGGTGCTGGAGGAGAAGTGAGTATAGGCACACATATAAGCGATCAGCGCTTGCTGGCCAGCGGGAGAACTGCTGACCGAAAGACAATTATGTATGTTAGCCCTCAGGTGGTGCTCCGGCATTGCGTATACGCGTGCTGGACTGTTTATGTACACATTGCAACAGAGTGCTACAATTATGAATACACATAGGTACAGTGCCCAACCGATATATTGTGCATACTACAATAGGTAACAATTTGCTGACAATTCTAGAGTCGCAGAATCGCCATTTCTGTGAACTGTTAAAAGAGTGCAAAACTCACAAAGGGCGAAACTCAATGCTGTCATTATTGCCAAAGAGTTTAATCTGAACGCAGGCAGACACTCAATCCTGGTGCGGAGACCAAGTCTACATCGCCGTAGCAGACGGACGTCTTAGAACACGCGGCGCGAAATACTCAGAAACCAGCAAAGTTGTGTCCCGGCCGGTGTGTGCGGCAAACTGGCAAAATCGCACGGTGGAACGCCATAGTTCTGCGCTGCAATCACGCAATGAGTTAATTGTGCGCCTGTTTCATGTAAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAGCAACTGATGATAGCGCAGCGGAGCGATCTGGAGAGGAGGCGTTGCCAGATCAACCGATGTGATCAGTGTTGTGTTACGCGACAGTAGGGCGCGAAATTCAAAATTAAATTTAAAATTAAGCCGTTGAAATTTAATTTAATTTAATTTACGATTCTGGTAACTGGAGCGCACAAGTCTTTAAGAAAAGGGGAAAAGGCACAAAGGTCGCGGACAGACCAAATATCATCCCCTCTCACCGTGCTGGTGCCTAAGCAGAGGCTCTGGTGTCAGAGTCGAGGCGGTACAAACCTCCATCCCGTAAAAGCCGATCAAGTGGCCTACGTGACCTAGGTAACCTTAGGCCATCCTTCAGTTGATGGACAGCACCGGTGGGGCAGTCCCCTGATCATAACGACGCCAGTTCCGGAGGAGCTCCCGACTTTCTCGAGATCCCCACCAGAGGAGTCGGTAACCCGACCCATGGTGACGGAATCTCGGTCCCGTCGATGGCAAGGGTGAGAGCACGCAGGCCCCAGCCGCCGTTGACTATCGGCAGCGATGCTGTAGAGGTGGAGAAATTTGGCTCCTACAGCATCTACGACCGCGACAAGTCAGAAGACGATGGACCACATCGCCGTGCCATCGCAAAAGACGGAGGAAGTCCCAGCTTGTTCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCAGAACGGGGACCGCAGGGGCATACTTCCCTGGGATGAATGGCAAGATCAGCCCTTCTATCCCGCATTCGAGACCCAACGACACATGAGACCGAGGGCGCTGCAGAACTCTCAGCCCTTAACAACAGGGCGATAGAGGCTGTACGAAGGTACTGCCTAGCGAGCACCGCTTGAAGAGCAGCGCTGCAGACGGAGGTACGAAGCACAAAAGGCTCCACAAATGCGCAGGTACCCACGGTGCGGGTGCCAAGTCCAGGCGCCGAAGCAAGAGCAACCCTACGTTGGATGGCAGCGGTGAAGAGGAAAAGGCGACATCCATGCCTAACGAGGTCCAAGCCGGGCAGCTGGCCATCTGTCGCCAGAATGCTAGCACGGGTGCAGAGAGGAGCACTCATCGTAAAAGGCAGGAGGCTTCGTACGCAGAGATGCTTCCGGAAGCTAAGATCCGGAATCGAGCCTTAGCGAACTGGGCAGTCACGTGCGAAAAATCCGGAAGGTGATCTGTTGCTTGAGGTAGGGGAAAGCTTCGGAAAGCGTTCCCCAGGTTAAAACGACCTGGAAGCGGCGCTCAATGACTTGGCCTCTGTGCGCACAGGAGCCGCAGAATAGCTCTATCTTGCAGCGGATTGGACGGGGCTACGACAGCAGAGAAGCTCCCACAGCTGCGTGCTGATTCAGGGCCTGCAGATAAATCTACAGAAGATATCAGGGGCCTTCGCGGTATGCGGAATTACGAAGCAAAATAGCCTCGGTGCTGCTGAACGCGAACGTTGCGATACCAGTCCTTAAACGGGGCACCATAATCGTTGGATGGTCGAGATGTCGTATCACCCAGGACGTCCGACCACGAGACGGTGTCTCGGCTGGCAGGCATCGATCAGCAACCTGCAAAGGACACTGACTGGGGCAGACTGCATGCTTAGATGCAGAGTGAGCGTGGGCACAAGGCAAAGGGGTGCGTTGCTGCACCAAAATGCCTGATCTGCAGCAGCGAGGTGGACAAAAAACACCACCCGACGGGTAGCTTTGCGTGCCGACTTACAGAGCGACACTAAAGATGCCGGAGCCACCTTGTGCGCGGCTCATATTAGCGTAAGTACAGCAAATGTCAATCCCCATTGCGCAGCAGCTCAGAGCCTCCTGGCCCGAACTGCGGTTTGAGCGCAATGTAGACATCATGCTCCCTAAAAGCGAACCCTACGTCTCTGGTAGTGGACAATCGTCCATGATCCTTGACGAGGCGGGTAAAGCAGCTATCAAATGCAGCTCTCTCAAGTCCAGGAACTGGCGCTGCTTTACCCATGCGGGGTATCGCTTATGCGAAGTTAAAAACACGTGCACATGTACGGCTGCTGCAGCTCCGCCAGCGACGACTTTTTTGATCAGTTCGAGGAGCTTCTGGAGGCGCTCGTGGACCACGAGAGGGCGAAGCCCGAAGGTCGATACCGGCGACTTTAATGCCTGGACGGTGGAATGGGGCAGCAGGACATCAACACCAGAGGACGAGCTGTGATTGACGCCATGCGAATGCTGGACCTCATGCTGCTGAACGATGGACGGAAGCCGACGTTTAACAACGATAGGGTACGTCCTTTATTGACGTTACAGCATCAGCAGAGGGCTAGTGGGCAACAACAACTGGATGGTCCCGCTGGCGATCATGACGCTGAGCGACCATGCCCTGATCTCCTTCTCCCCGGAGGGCATGCCCAAAGACGGCAGAGTAGAACAGCCGGGAAAACATGGGACACCAGGAAGATCGATGAGGCCATGCTGGCCTATCGAATAAATTCCTGGAAATCCCAAATATTGGACGTACCAGAGTGGCGGCAGGCCTCATGAATATGCTGGGAAGAATCTGCGACACCAATCATGCCAAGGAAAAAATAAGGCACAGCGCAAACCACCCGTTTACTGGTGGAGTGCCTCCCCTAAACCAACTACGGTCTGATTGCCTCGGGGGGCTAAGAGAACGGCGCAACGAGGCCAGAGGGCGAGTACCCACCACGCGGAACTCTTGGGCAACCAAACGCCTAGAGTTCAAGCACGGCATCGCGGCTGCCAAAGCGCGGTCGTTTAAGAGAGCTGCAGGATGGCGTAGGCGGCGTATCACAGGGGCCTCGCCTACAAGCTTTGTTACCAACGAGCTAAGGAGGAAGCAACAACCCATCCGACCCGGGGGTCTGGCCTTTAACATACTAGGGGAGCTATTTCCAAAGCAGACCACACTATGGAGGCCAACAGAGGCAGCCCTGCCCCAGATTTCCCGTGCGTCCACAGAACTTGCGGAAGTCAGTCGGGCAGCTGTTTCGCTGACGATGTGGCAATCACAGCCGGGCTAGCAATAACGCGGCTCACAAGACCGAAACAGTCCTACTATAAGCAGCAGGAAAAGATGGAGAACATGCTGGTCTCCGTCAAGGGGGTACTCAGGGGACCTCTCAAGAGTCCCAGAGTACCTGGGGGTAATGATAGATCGCGAACTATCGTTCAAGGACCACACCCGGCTACGCCAGCAAGAAGACAGCAGTCACATCCTCTTCGTTGGCAGGGCCCATGCTAACGTCAAGGCCCAGACTGGCCAGGGAAACTGCTGGTGTCAGTAGCAAAGCTTCGCTGCTATACGCTGCACCAGTCTGGAGCAATGCCACTTGCAGGGTCTCATACCTGAAGGCTCGTTCCGGTGCTACGGTCAATGGCCCTCAGGCTCATTAAGAGGATTCAGGACCATATCCGAAGACGGCGCTAGCGCTGGCAGGCCTGCCGATTGATCTGGAGATCAAGGCTCTCAGCCTTATGCGGAGTGGCGCTTCCAGGCAAAGAGGCACACGAGTGGCTATTAGGTGAATGGCAGAGCAGATGGCAAACGTCGCGACGGGGGGAGGTGGACCTATCAGCTCATCCAGAGATGACGGTTTGGGCAGGTGACACTCTCAAAAGTGTGTAAACTTGGAATTTGTTGTTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTAATTTATAAGTAAAATAAATATTGTTCGACCGCACTATTTCCTAAAAAAAAATTGCGTTTAATTAAACAAATAACCCTTAATTTTGACCGTTAAAATCAAAAATTCATCTTATTTCACGGTGTGTAAACAGTTTTCTTGACAAACTGTACTTGTCGCAGATTTGTTTTAAATTTCAGTTAACGACCGTTTTCTGTTACTTTATTGTCCGCTGTGAGAGTGATGCCGAGTATAAAGAGTGGATTCAGATCCGACATCTGAAGTGGGACCGCCTACTCCAACTGTGGTTTCATTGTGTCATAGATCATTTGTGTTTTTAGCTGTTCTTTTATTTGATCAATTTGAAAGGGCAGGAAGGTCCTCCATTCGAAATTAATTCGTCAATGTAATACGTAACTTAC
->65baae2c-5dfc-45a0-8cb6-1a4215d4788c
-TCGGTATGCCTGCTTCGTTCAGTTACGTATTGCTCATGATTGCGTCGCAAATTCTTCCAACATATTCAGCAGGGACGTACCGCTATACTCTCTGCGTCCACATTTGGGATTTCCAGGGGAATTGATCTGATAGGCCAGCATGGCCTCATCGATCTCCTGGTGTCCCATGTTTTCCCGGCTGTTCTACTCTCTGCCGTCTTTTGGGCAGCCCTCCGGGGAAAGGAGAGATCAGGGCATGGTCGCTCAGCGTCATGACGTCATGGACCATCCAGTTGTTGTTGTCTACTAGCCCTCTGCTGACAAAGGTAACGTCAATAAAGGACGTACCCTATCGTTGTTAAACGTCGGCTTCCGTCCATCGTTCAGCGAGTATGAGGTCCAGCATTCGCATGGCGTCAATCACAGCTCGTCCTCTGGTGTTGGATGTCCTGCTGCCCCATTCCACTGTCCGGGCATTAAAGTCGCCGGCAATGACCTTCGGGCTTCGCCCTCTCGCATGGTCTGACGCCTCCAGAAGCTCATCGAACTGATCGGGGGTGTCGCTCGGCGGAGCGTAGCAGCTTTAATACATGTGCACGTGTTTTAACTTCGCATAAGCGATACCCGCATGGGTAAAGCAGCCAGTTCCTGGACTTGGAGAGCTGCAGCATTTGATAGCTGCTTTACCTGCCTCGTCAAGGATCATGGACGATTGTCCACTACTGGGGAGCGTAGGGTTCGCTTAGGAGCATGATGATGTCTATTCGCTCAACCGCAGTCTGGGCCAGGAGGCTCCTGAGCTGCTGCACCGTGATTGACGATGAGCGCCGCACGCTAATATGAGCGTGCATTAAAGTGGCTACTGGCATCTTTTAGTGTCGCTCTGTAAGTCCGGGCACGCAAAGCTACCCGTCGGGTGGTTTCTGTCCACCTCGCTGCTGCAGATCAGGCATTTTGGTGCAACAACGCACCCTTTGCCTTGTGCCCACGCTCACCGCATCTAAGACAGCAGTCTGCCCTGTCAGTGTCCTTACGGGTTGCTGATCGATGCCCGAGACACCTGTAGCATCTCGTGGGTCGGACGTCCTGGGTGATGACATCTTGACCATCCAACGATTATGGTGCCCTGTTTTAGGACTGGTATCATAACGTTCGCGTTCAGCAGCACTGAGGCTATTTGCTTGCAATTCCGCCATACTGCGGCTGATATCTTCAGGATTTATCTGCAGGCCCTGGGTGGGCGACCAAGCAGCTGTGGGCTTCTCTGCTGTCGTAGCCTCGTCAATCCGCTGCAAGATAGAGCTATTCTTTGCGCTCCCTGTGCGCACAGAGGCCAAGTCATTGAGCGCCGCTTCCAGGTCATCTCTTAAACTTGGGAACGCTTTCGAAGCTTTCCCCTCTACCTCAAACAACAGATCCACCTTTCTGCGTTTCTCCGGATTTTTCGCACGTGACTGCCCAGTTCGCTAAGGTCGATTCCACTGCGTCGCTAGCTTCCGAAGCATCTCTGCGTACGAAGCCTCTCCTGTCTTTTTTTTTTACGATGAGTGCCTCTGCACCCGTGCCTAGCATTCTTGGCGACAGATGCATATGGCGCTGCCTGGCTTGGACTCGTTAGGTATGGATGTCGCCTTTTTTCTTCACCGTTGCCATCCAACGTAGGGTTGCTCTGCTTCGGCGCCTGGACTTTGGCACCTGCACCGTGGGTACCTGCGCATTTTGTGGAGCCTTTTTGGTGAGCTTTTGTACCTCCGTCTGGGTAGCGCTTTGCTCTTCAAGCGGTGCTCGCTGAATGAAATACCTTCGGCGTACAGCTCGCCCTGTTGTTAAGGGCTGAGAGTTCGGAAGCTATGCCGCTTTGTCTCTCATGTGTGTCGTTTGGGTCTCGATGCGGATAGAAGGGGCTGATAACACCATTCATCCTGGTAAGTATGCCCCTCAGGTCCTCGTTCTACGGAAACGGTGAGGTCAAGTCCGAACCGATGAGGGGAACCAGCTGGGGACACTCCGTCTTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCTGACTTGTCGCGGTCGTAGATGCTGTAGGGCCAATTTCTCCACCTCTACAGCATCGCTGCAGTCGATAGTCAACGGCGGCTGGGGGCCTGCGTGCTCACCTTGCCACCGACGGGACCGAGATTCCGTCACCATGGGTCGGGTTACCGACTCCTCTGGTGGGGATCTCGAAAGTCGGAAGCTCCTCCTGAACAGGTCGTTGCGATCAGGACTGCCCCCACTACGCTGTCATCAGCGGAAGGATGGCCCTAAGGTTACCTGGTCGTAGGTTGGCTTTTTTACGGATGGAGGTTTGTACCGCCTCGACTCCGGACACCAGAGCCTCTGCTTAGGCACCAGCACGGTGAAGGGATGATATTATTTGGTCTGTCCGCGACCTTTATTCTGCCTTTTCCCCTTTCTTAAAGACTTGTGCGCTCCCAGTTACCAGAATCAAAATTAAATTAAATTAATTTCAACGTATTTTGGTTTGATTTTTGAATTTCTCGCATACTGTCGCAACACAACACTGATCACACGGTTGATCTGGCAACGCCTCCCTCTCCAGATCGCCCGCTTTGCGCTATCAGCTGTTTATCCGCTGCAACAATCGCAGGATAACCGTTACCTATTTACATGAAACCGAACGGGTATTCGATTTGCGCGCAGAACGCGGCGACTCCACCCCGTGTGATTTTTGCCAGTTTGCCGCACACACCGGCCGACACAACTTCTATGGTTTCGAGTATTTCGCGCCGCGTAATTTAAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCCGCACCAGGATTGAGTGTCCTAAGCCTGTGCGTTCAGGATTAAACTTTGGCAATACGACAGCATTGAGTTTTGGGTCTCTTTGTGAGTTTTGCACTTCTTTTAACAGTTCAGAAAAATGGCGATTCTGCGACTCTAGAATTGTCAGCAAATTGTTTTCACTATTGTAGTATGCACACATATCGGTTAAAGCGCAGCGCCTATGTGTATTCATAATTGTAGCACTCTGTTGCAATGTGTATAAACAGTCAACACAAAGGTGTATACGTAATACGAGCACCCACTTGAGGGGCTAACATACATAATTGCCTGGTCAGCAGTTCTCCGCTGGCCAAGCGCTGATCGCTTATATATTGTGCCTATACCACTCCTCCTCCAGCACCATCGCTCGGCGACAGTATATATATATACATATATATGAATACGCATATAAGCGTTGCTGCGCTGCAGGCTATGCCGGCAGCGCTGCTCCTCGACAACTTTGTATGTAGATCATAAGAGGATTGACGAATTAATTTCCTGGGCGGGACCTTCCCTGTTCCTCAAATTGGATCAAATAAGAACAGCTAAAACACAAATGATCTATGACACAATGAAACTACAGGAAGTTGGAGTAGGCGGTCCCACTTCTGATGTCGGATCTGAATCACTTTATGCGCCATTCACTCTTCACGGCGGTGCAGAAGTAACAGAAACGGTCGTTAACGAAATTAAAATAAATCTGCGACAAATTGCAGTTTGTCAGAAACTGTTTACACCGTGAAAATAAGATGAATTTTTTGATTTTAACGGTCAAAAATTAAGGGTTATTTGCTTAATTAAACGCAATTTTTTTTTTAGGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAACAAATTCAGAAGTATCAAAATATACAAGAAAATAAATAACAAATTCAAGTTTACACACTTTTGAGAGTGTCACTCTGCCCAAACCGTCATCTCTGGGATGAGCTGATAGGTCCACCTCCCCGTCGCGACGTTTGCCATCTGCTCCTTGCCATTCACTAATAACTCGTGTTGCGCATAATAACGCGCAGGCGCCGCTCATAAGGCTGAGCCTTGATCTCCAGAAGATCAATCTGGCAAGCCTGCCAGCGCTAGCTCCGCGTCTTCGGATATGGTCCTGAATCCTCTAATGTGAGCCTGAGGAGACCCATTGACCGTAGCCGAACGAGCTCCTTTCGGGTATGAGACCCTGCAGGTGGCATTGCTTCCAGACTTTGGTGCGGCGTATAGCAGCGGCCTTTGCTACTGACACCAGCAGTTTCCTGGCTTAGTTGTCTTGGGCCTCCGACGTTGTGAACATATATGAAGCGCTCGCCAACAGCCGAAGAGGATGTGACGCTGTCTTCTTGCTGGCGTAGCAGCTCGCGTGGTCCTTGAACGATAGTCTGCGATCTATCATTACCCCAGGTACTTTAGGGACTCTTGAGAGGTCCCCTGTGAGTACCCATGACGGAGACCAACATGTTCTCCATCTTTTTCCTGCTGCTTAGTAGGACTGCTTCGGTCTTGTGAGCCGCTATTGCTAGCCCGGCTGTGGTGCCATCGTCAGCCCAGAGAAACAGCTGCCTCGACGACTTCCAAGTTCTGTGACGCACGGGAAATCTGGGGCAGGGCTGCTGTTATTACCTCCATAGTGTGGTCTGCTTTGGAAATAGCTCCCCTAGTATGTTAGCCAGGACCCCCCCCCCGGGTCCGGATGGGGTTACCGCTCTCTCATAGCTGTTTGGTAAACGGGCGAGGGCTGAATGTCACCACGCCATCCTGCAGCTCCTTAAACGACCGCGCTTTGGCGGCAGCCGCGATGCCGTGCTTGAACTCTGGGCGTTTGCTTCTGAAAGCCTCAAGAGTTCCGCGTGGTGGGTACTGCCTCTGGCTCGTTGCGCCGTTCTCTTAGCCCTGAGGCAATCAGACCCGTAGTTGGCAGGGAGGCACTCCACCAGTAAACGGGTGGTTTTGCGCTGTGCCTTATTTTTTTCCTTGGCATGATTGCGTCGCAGATTCTTCCCAGCATATTCATGAGGCCTGCCGCCATACTCTCTGCGTCCATTTTGGGATTTCCAGGGGAATTGATCTGATGAGCCAGCATGGCCTCATCGATCTTCCTGGTGTCCCATGTTTTCCCGGCTGTTCTACTCTGCCGTCTTTTGGGCATGCCCTCCGGGGAGAAGGAGATCAGGGCATGGTCGCTCAGCGTCATGACGTCATGGACCATCAGTTGTTGTTGTCTACTAGCCCTCTGCTGACAAAGGTAGCATTCAATAAAGGACGTACCCCTATCGTTGTTAAACGTCGGCTTCCGTCCATCGTTCAGCAGTATGAGGTCCAGCATTCGCATGGCGTCAATCTGGCGTCCTCTGGTGTTGGATGTCCTGCTGCCCCATTCCACTGTCCAGGCATTAAAGTCGCCGGCAATGACCTTCGGGCTTCGCCCTCTGAAGTCCACGAGCGCCTCCAGAAGCTCCTCGAACTGATCGAGGTGTCAGCTCGGCTTGGAGCACAATAGCAGCTAATACATGTGCACGTGTTTTTTAACTTCGCGTAAGCGATACCCGCATGGGTAAAAGCAGCCAGTTCCTGGACTTGGAGAGAGCTGCAGCATTTGATAGCTGCTTTACCTGCCTCGTCAAAGGGATCATGGACGATTGTCCCACTACCAGAGACGTAGGGTTCGCTTAGGAGCATGATGTCTACATTGCGCTCAACCGCAGTCTGGGCCAGGAGGCTCTGAGCTGCTGCGCAATGATTGACATTGAGCTGTACTACGCTAATATGAGCGTGCATTAAGGTGTGCACGAATTGTCGCTCTGTAAAGTCGGCGCAAAGCTACCCGTCCGGGTGGTTTCTGTCCACCTGCTGCAGATCAGGCATTTTGGTGCAGCAACGCACGCTTGCTTGCTTGTGCCCACGCTCACCGCATCTAAGACAACGGTCTGCCTGTCAGTGTCGCTTGCAGGTTGCTGATCGATGCCCACATAGCCGAACACCTGTAGCATCTCGTGGGTCCGGACGTCCTGGGTGATACGACATCTTGACCATCCAACGATTATGGTTGCCCTGTTTAGGACTGGTATCGCAACGTTCGCGTTCAGCAGCACTGGGGCTATTTGCTTTTTTTAATTCCGCATACTGCGAAGGCCCTGATATCTTCAGGATTTATCTGCAGGCCCTGGAATTGGGCGACCAAGCAGCTGTGGAGCTTCTCTGCTGTCGTAGCCTCGTCAATCCGCTTTGCAAGATAGAGCGCGCTCCTGTGCGCACAGGAGCCAAGTCATTGAGCGCCGCTTCCAGGTCGCTCTTAAACTTGGGAACGCTTTCGAAGCTTTCCCCTCTACCTCAAGCAACAGATCACCTTTCTGCGTTCTCGGATTTTCGCACGTGACTGCCCAGTTCGCTAAGGCTCGATTCCGATCTTAGCTTCGAAGCATCTCTGCGTACGAAGCCTCTCCTGTCTTTTACGATGAGTGCCTCTGCCCGTGCTAACTTTATTCTTGGGCGGTGCGGCTGCCTGGCTTGGACTCGTTAGATATGGATGTCGCCTTTTTCTTCACCGTTGCCATCCAACGTAGGGTTGCTCTACTTCGGCGCTGGACTTTGGCACCTGCACCGTGGGTACCTGCGCATTTTGTGTGGAGCCTTTTTTGGTAGGCTTTGGCACTCCGTCTGGGTAGCGCTGCTCTTCAAGCGGTGCTCGCTAATCAGTACGCAACTTCGTACAGCTCTATCGCCCTGTTGTTTAGGGCTGAGAGTTCGGAAGCTATGCCCTTTGTCTCATGGCGTGTTTGGGTCTCGGAGAATGCGGATAGAAGGGGGGCTGATCTTGCCATTCATCCTGGTAAGTATGCCCCTCAGGTCCTCGTTCTGGAGAGCAGTGATTAAGTCCGAAGACCGATGGGGAACAAGCTGGGGACTTCCTCCGTCTTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCTGACTTGTCGCGGTCGTGGAGTAGGAGCCAATTTCTCCACCTCTACAGCATCGCTGCAGTCGATGATCAACGGCGGCTGGGGGCCTGCGTGCTCACCCCTTGCCACCGACGGGACCGAATTCCGTCACCATGGGTCGGGTTACCGACTCCTCTGGTGGGGATCTCGAAGAGATCGGAAGCTCCTCCTGAACGGGTCGTTGCGATCAGGACTGCCCCACTGCGCTGTCCATCAACTGAAGGATGGCCCTAAAGTTACCCCTAGGTCACGTAGGCCACGGATTTCCCCTGGCACGGATGGAGGTTTGTACCGCCTCGACTCGGACACCAGAGCCTCTGCTTGAAGCACCAACTTTGGTGAGAGGATGATATTTGGTCTGTCCGCGACCTTTGTGCCTTTTCCCTTTTCTTAAAGACTTGTGCGCTCCCAGTTACCAGAATCAAATTAAATTAAATTAAATTTCAACGGCTTAATTTTAAATTTGAATTTTGAATTTCACGCACTTCTGTCGCAACACAACACTGATCACACGGTTGATCTGGCAACGCCTCCCTCTCCAGATCGCCCGCTGCGCTATCAGCTGTTTATCCGCTGCAACAATCGCAAGATAATAAATTACCTATTTACATGAAACGGGCGCACAATTAACTCGCGTGATTGCAGCGCAGAACTATGGCGCGACTCCACCGTGTGATTTTGCCAGTTTGCCGCACACACCGGCCGACACAACTTCTATGGTTTCAGTATTTCGCGCCGCTGTAATTTAAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCCGCACCAGGATTGAGTGTCTAAGCCTGTGCGTTCAGGATAAACTTTGGCAATACGACAGCATTGAGTTTTTTGGGTCTCTTTGTGAGGTTTTGCACTTCTTTTAACAGTTCAGAAAAAATGGCGATTCTGCGACTCTAGAATTGTCAACAGAATTGAACTGCACTATTGTAGTATGCACACATATCGGTTAAGCACTGTACCTATATGTATTCATAATTAGTAGCACTCTGTTGCAATGTGTACATAAACAGTCCAGCACAAGTGTATACGTAATACGAGCACCCACTTGAGGGCTAACATACATAGTGCCTGGTCAGCAGTTCTCCCTTGTGGCTTGTGATCGCTTATATGTGTGCCTATACCACTCCTCCTCCAGCACCATCGCTCGGCGACCCAGTACATATATATATACATATATATAAGATACGCATATAAGCGTTGCTGCGCTGCAGGCTATGCCGGCAGCGCTGCTCCTCGACAGGCTAGAAACCTTTGTATGTAGATCATAAGAGGGATTGACGAATTAATTTCAGATGGAGCGGAACCTTCCTGTTCCTCAAATTGGATCAAATAAAGAACAGCTAAAACACAAATGATCTATGACACAATGAAACTACAGGAAGTTGGAGTAGGCGGTCCCACTTCTGATGTCGGATCTGAATCACTTTATACTCAGCATCATACTCTACAGCGGACACAAAGTAACAGAAAACGGTCGTTAACGGAAATTAAAATAAATCTGCGACAAGTACGGTTTGTCAGAAACTGTTTACGTGAAATAAGATTTTGATTTTAACGGTCAAGTAAGGGTTATTTGCTTAATTAAACACCAATGAATTTTTTTTTAGGAAATATAATTAAACAATATTTATTTTGCTTATAAATTAAACAAATTCAAAATATCAAATATGAAAATAAACAACGATTCCAAGTTTAAGAAACACTTTTGAGAGTTTCAAGAAACTCTTTACACAAAACACTAAACCTAAGTTTAATCTAATTTTTTTAAATTATTTTTGTTAAAATTTGAAAAAGTTGTAGTATTTAGTATGACCCCCATTGGCTTTTGGCTACAAGTTGAGCTTTCATGGAATGGATGAGTTTTTTTTAGGTCATATTCAAAGCGGGATCTTTTCCCACTCTATCGCAGCCATGAGCTGTTGTCGTGTTTTGGTGCCTTGCTTTTGCCACATTCTTTAACAAGTAGGCCCACAAATTTTCAATGGGGGTTCAGATCAAGACTCTGAGGGGCGTATCGATCACCTTGCCACAGTTATAAAGGAGCCAGTTGCGTACATTGCACTCTTTATGTTTTGGGATCGTGTCCTGATAAAACTTAAAAAGACGGCTTGTTGTTGCTAAATAGACCAAATTTTTCTGCACTGGCCTTCAAATTTGATTTTAAAATATCTAGATGTGCACGGCATTCATAGTGCTTTCAATAAAAGGCTAATTTGCCCCTCCATGGCAGAGATACAGCCCAAATCATCACTGATAATTTTTCCAAATTTGATTGTTGGAATGATATTTTGTTTTCTAGCGCACTCCAGCAGCTTGCGCCATACTCTGCTTATTACATCGTTATAATAGAGCATCATTTTTGTTTCGTCACAAAATATTACGTCATCCCGATGACACTTCGCATAGTCCATCATGCTCACAGCGAATGACGCTTTTTCTATATTGACCTCTGATAGCAAAGGCTTTTCTTTTAACTCTTGAAGAGTACCTATGGCGTAGAATGACTTGGCGCACAGTTTTGTGTGGCACAACTAGGAATCACATTCTTGCCCGATATCCTGAGCAAGTGATCTGACCGAGATTCGGGGAGTTCGCAATCACTTTTCGCATAATAAGGCGGTCTACACGCTTGCTAATTTTAGTTTGCCCACCACTCTTAAGTTCAAGCTGTTCTCATAAAGCGTTAAAACATTGTAGACGGTCTTACGGGATACAGAAAACATTTATACTAATTCTGGAATAGATTTTCCCAACTGGTGGTTTAGTATATTATTTGGGTCCTTCAAAAGCTAATCTATTTCCAGGCATTTTATTAAATTTAATAACTCATTCGATCAGCAAAATTTCACAAGCAAAGTAAAAAAAATTTCAATAGAAGCGTTGTAAAAGGAATGCAAATGCCAAAATAACGGAAAAATCGAGTTCGTTCTAAGAAAAAAAGAGAGCAAAACAAAGTAGGAAAACAAAATGTGTAAGGAGTTTCTTGCCACTCTCAAAAGTGTGTAAACTTGGAATTTGTTGTTTAATTTCTTGTATATTTGATATTTTTTTGAATTTGTTTTTTTAATTTATAAGTAAAATAAATATTGTTTAATTATATTTCATTAAAAAAATTGCGTTTAATTAAAGAAATAGCCCTTAATTTTTTGACCTTTAAAGTGAAAAAATTCAACTTATTTCACGGCGTGTAAAATGGTTCTTGATAAAACTCTGTATATATCTACAAATTTACAACTTGCCGGTACCATCTGCAAGATTCATTACATTGAGAAGTGGACTTTGACTCTCAGTGATTAAAAACATTATATTCCTTAGATTGAACTGACGAGGAACCAGACTGAACTAAACTAGCTTCTTCTCAATTTCTTGGGCTGATTAAGTTTGCGATAATAATTTTGAGTTTCTTACAAGATGACTAATATTAATTTTTTTAGTTGAAATAGTTTACCAAAAAAAACTGAATTTATGTAAATAATATGTTCAATTAGTCGGTTGGGTTTCTGGGTCTCCCCAACACCTCAAAGCAGTACTGGATCAAAATTATTCGTCAGAAGGACGTGCACAGTCTCGTGAGTAATAAAGAATTACAGCAATCTTACTTTTGAGGTGGCGATGTTGGAAAGTATGTACACATTTAAGCAAAGTCACACCGACTGCATCGAAACTGCTAGAATAATAAGATGCGTAACAGCCATACACTGGTTTGGCACTATGCAGCCGCGCGACGACGGCCAAAATTGCTCTCTTTCCGCTCGCTCACGCTGAGCGTGAAATCAAAGAAGCAGGTACACTTGTGTGAGTAAAACAAAGACGAGAACGTATATGTGTGCGTGTTGTGCTAGAGAGCGATTTCGGGCCGAAATCAATTCTGTTGATCGCAGTAACGAATTTACATATGTACATACATAGCTGGGAGTTTTGGCCAATTTCGTAGAATATGATGAAATTGCGCGCTGTTTAAGATATCAAGTGGAATATAAAAAAGCACAGTGGGTACACTGAGAAAAAATATTTCGCAAAAATAATACGAAGTAGAAAATAAAATTTATAAAATCAAAGAAATGTTAACTGTTTATTGCAAACGTCATATCAAATTAGAATTATTCTAGTGTGTTTGCTTTGGTCATATCTTGAGGCTGAGAGTGCAGTTCGCTTACTCAACAATCATTGTCTTCTTAATACTCAAGCAGAGCGACACCGACGAACCCTAACTGCTTTGAAATGGCCAGAGGTAAAATAAATCAAAAAAAAGAGACCAAGCCCCTCCCGAAGTTCAAAGAAAACGGATTCCCTGGACAATTCATCAAGCACTGTGCAAATAATTTCATCTCACTTGGCGACTGGTTGCCCGACAAAACAGGGAAACAAATATAACAAAACGAAGATCTCGAAATGGTAAATGAAGACGAAGTGCAACTGATTTTGCTAAGCCCCACCTATCTTTCTCTCCTGACGTCAATGGTATAAGTGAAAAGCTAACCTATCTTAAAACTAAAATTAAGAGAACTTTTTTTTATTATAAGACTCAACGTTATGGACATGTAGAGTAATGGTTAAAAGTATTGAAGAATTCTGAAAATTAGTCAAAACACTTAATAATGATTGTGTGCAGTACCACACATACCAGCTTAAGGATGACAGAGCATTTAGAGTTGTTATTAAAAATTTGCATTTTTCCACAAATTTAGATGAAATTAAAAGTGATGAAGAGTCAAAAGGTCATGTTGTTAGAAACATAAGTAATATTAAAAACCGTGCGACCAAAACGTCACTGAACATGTTTATAGATATTTAGGCTTTAACAAAAAAACCTGAACATATATAATGTAAATAAAATATTGAGCCACCCCACAATGAAATCGTTCAATGCTATAGCTGCCAGAATTCGGACATACTAAAATCATATTGTACCAAAACGTACCGCTGTGTAAAATCCTCTTCTCGACACCCAAGCAACATTTGCCCAGCTTTAAGAACAACCAGCAAAATGTGCCAACTGCTACGAAGAACACGCCGCCAGCTACAAAGGGTGTAGAATTTATCAGAACTCTTGTCCAAAAAAAATAGAAAATAGAAATAATGATCTGAGTAAAATGATTTAGGAATCCAGCAAAGTTTGTTCCGCCTAACAAGCCAACATATACCCAACAAAGTAACGATTATCAATCTTATGCCCAAATTGCTGCAGGAAATAGCAAAACAAACACATCACTGGAGAGAATAGAGCAACTATTGGGAAAACAGTCTGAACTTACAAATGAATTTACTTAACATGATAATGTTGCTTGTAAACAAATTATGCAAGTAAATCTAACCTTGGAATATGGAGGCGTAGTAGGAGGTGACTTCAATGCTAAGCTTCCGAAGAGGAGAAACGAACTGTACAAATGCATAGTAAGCAACAGCATAACAACACTTTCAACCGGCAAGCCTACATACTGGCCTACTGATAGTGAGAAAGATACCAAACTTAACCCTTTCGCACCCAACGTTTGCTTGTGAGCAATTTCTATGTTTTTCAGAGCTAACTGTAAGTGTGCGCTTGTTTTTTATCTGCTGATTCTTTATGATAACGGTGCTTATGTGTCTACTCTAAATATAAAAGCAAAAAACGCATTTGGAAGTTAATTGCAGGAATTATTTGCAATAAATAGCACGCGCATCACAATAATTATTGTTTCGATATTCGGTGCAACTTTTGGAATTATTAATTTAGCACTTATAATACTTTAAAAAAGAACCTAAAGTATAAACAGCAAAGAGTTAACAAGACAGTGATTTAGTCAAACTTAGTAAGTAGTGTGAACAATAAGTAAGTAAATTTTCTAAGTTGCTTGTGAGCAACTTATGGGCATTCGTGATAATTTTTCACCGAAAGTGAAAGGTTTGTCTAACGAAAGAAATTGAACGAGTTTAAACTTCGGTGGGATATTTCTACTGACGAAGAAGAAAGTGGTGAGGAGATGAAAGACATTTCTACGGTACTGGAGAAGAATTTAGAAAGAATTCTTGAAGGGGAGAAAGTATCGACATTGACCTTCTGGAAAATACAGTGATTGAAGGATGTGAACCTGACTCTTGCGTTGTTGTTGACGGTTGCTTAGAAAATTGATCCAAAGAGGCTAAAGTGGAGAACAAGGCCGTTTGTAGCTCCAAATTATTTGGGAAGATAATAAGAGCACTGATGTCGGGGACATAAAGACGACCGTGGAGTTCTTCTACACACTTTTGATACTCAGCTAATTCATTTTAATGGCTAAGGCAAACTGATATACAGTCATGGTCAAAATTATTTTCACAAGTGCATTTTTGTGCATGGGTCACAAACAGTTGCTTGATACCTGCAGCAAGTGGGGGAGGTGAAATGCAAAAAACTTTTGCTTTTGCAAATTCAAACCTAATAAGAGTCAGATGAAAAGAAAGAATTGAAAAATAACTTTGTTCTATGCGCAAGGAAAAGAGGCAAATGAAGATCTTTATCCAGTTGTCAAGTATTTGCACACGGTTTCGTCATCACAATTATTTTCACAACGCAATTTCTTCTTCAGTGATTGGTTTAGAGTGACAAGTGCCGGTTTGTTTGCTTAAATACATTTAAATTATTGAATAAAAATTAGATTTAATCATTTTCCTATTACAGTTATTAAATAAAATGCCCAAAACAAAAGAGTTAACGGTTGAGGCCCGGGTGGTATTGTTGCTAGGTTTAAAGCCGGTACACCTGCGGCCAAAATAGCTGAAATATATCAAATTTCGCGTGTCTACTACTTAATAAAAAGTTTGATACAGTTGGCACATTAAAAATAAAAAAAAAGATCAGGCCGAAACCTGTGCTGTGGACCAAAAGGCAATGCAGGCAAATACTTGGAGTTGGCGAAGAATCTAGTGCCAGTCCGGTAAAATTGTAGAATCAAAAAAATACAGATTGGCAAACAAGTTAGTAGTTCTACAATTCGTCGCAGGCTAAAAGAAGCTGATTTTAAGACATACTTTGTTCGCAAAACGATTGAGATCACACCAACCAACAAAACAAAACGTACTTTGTTTGCGTTGGAATATGTTAAGAAGCCTCTCTTGACTTTTGGTTTAATATTTTATGGACTGATGAGTCTGCATTTCAGTACCAGGGTCATACAGCAAGCATTTTATGCGTGAAAAATAATCAAAAGCATTTGGCAGCCCAGCTTAAACTAATAGATTTGGTGGGGGGGCACAGTCATGTTTTGGGGATGTCTTTCCTATTATGGATTCGGAGACTTGAGCCGATAGAAGGTACTTTAAATCAGAACGGACACCTTCTTATCTTAAACAACCATGCTTTACGTCTGAAATAGACTTTTTCCAACTACTGAATGGATTCTTCAGCAGGACAATGCTCCATGCCATAAGGGTGTTAGGATACCAACAAAATTTTTAAACGACCTTAATCTGGCAGTTCTTCCGTGGCCCCAAAAGCCCAGACCTTAATATCATTTGAAAACGTTTGGGCTTTTATTAAAACCAACGAACTATTGATAAAAATAGAAAACGAGAGGAGCCATCGTGAAATAGCGGAGATTTGGTCCAAAATTGACATTAGAATTTGCACAAACTTTAGTAGGTCAATACCAAAAGACTTCAAGCAGTTATTGATGCCAAAGGTGGTGTTACAAATATTAGTATTGTATTTATATAAAATAAAGAAATTCTTATGTTGAAATTAGATGTTAAGCTGTTACTAAATTAAGTTGGTGAAAATACTTTTGAGCGCAATAAACGTAATGAAAATACTATTGACAACTTGCATGCATATTTTCTTTTGCTTTAAGCTTTGTACTATGAACCGTTATCTTTCGTATTTCTTTTCGACTACCTTCTGCATAGATCAGCTAGGCGATAAGAACTATTTCAGGCAAATCGGACAACAAGAAGAAATAGTTCTTGTAGCAACTTGATCTATGCAGAAGGTAGTCGAAGAAATACGAAAGATAACATTTCATAGTACAAAGCTTAAAGCAAAGAAAATATGCATGTCAATAGTATTTTCACATGTTTTATTGCGCTTCAAAAGTATTTTCACTCAACTTAATTTAGTAAATTTCAACAACATCTAATTTCAACATAAAATTTCTTTATTTTATATAAATACAATACTAATATTTTGTAACACCACCTTTGGCATCAATAACTGCTTGAAGTCTTTTTTGGTATTGACCTTACAAAGTTTGTGCAAATTCTAATGTCAATTTGGACCAAATCTCCGCTATTTCAATGATGGCTCCCTCTCGTTTTAACATCAATAGTTCGTTTGGTTTTAATAAAAGCCCAAACGTTTTCAATGATAAGGTCTGGGCTTTGGGGGGGCCACGGAAGAACCGCCAGATTAAGGTCGTTTAAAGAGCTTTGTTGGTATCCTACCCTTATGGCGCCAGGTATTGTCCTGCTGAAGAATCCATTCAGTAGTTGGAAAAAGTCTATTTCCAGACATTAAGCATGGTTGTTTAAGATAAGAGGTATCCGTTCTGATTTAAGTACCTTCTATCGGTACCAAAGTCTCGAATCCATAATAGGAAAAGACATCCCAAAACATGACTATTGCCCCACCAAAATCTATTGGTTGGCTGGGCTGCCAAATGCTTTTGATTATTTTTCAAATGCACTGGTACTGAAATGCAGACTCATCAGTCCATAAAATATTAAACCAAAAGTCAGAGGCTTCTTAACATATTCCAACCTCGAAGACGTTTTGTTTTGTTGGTTTGGTGTGATCTCAATCGTTTTGCGAACAAAGTATGTCTTAAAATCAGCTTCTTTTAGCCTGCGACGAATTGTAGAACTACTAACTTGTTTGCCAATTGTATTTTGATTCTAAGGCAATTTTTTTTACCGGACTGGCACTAAGTTCTTCGCCACAACTCAAGTATTTGCCTGCATTGCCTTTTGGTCCGGCACAGGTTTTCGGCCTGATCTTTTTTATTTTTAATGTACCAACTGTATCAAACTTTTTTGATAAGTAGTAGACAGTTCTACGCGAAATTTGATATATTTCAGCTATTTTGGCCTGGGTGTACCGGCTTTAAACCCTAGCAACAATACCAGCCCGGGCCTCAACTGTTAACTCTTTGTTTGGGCATTTTATTTAATAACTGTAATAGGAAAATGATTAAATCTAATTTTTTATTCAATAATTTAAATGTATTTAAGCAAACAAACCGGCACTTGTCACTCTAAACCAATCACTGAAGAAGAAATTGCGTTGTGAAAATAATTGTGATGCGACAGAAACCGTGTACTTCTGACAACTGATAAAGATCTCTTCATTTGCCTCTTCCTTGCGCATAGGAACAGTTATTTTTCAATTCTTCTTTCATCTGACTCTGCATAGGTTTGAATTTGCAAAAGCAAAAAAGTTTTTTTGCATTTCACCTCCCCACTTGCTGCACAAGCAACTGTTTGTGATATGCACAAAAATGCACTTGTGAAAATAATTTTGACCATGACTGTATATCGGTTTGCAGCCATTAATGGATTAGCTGGTATCAAAAGTGTGTAGAAGAACTCCACGGTCGTCTTTATGTCCCCGACATCAAAGTTTTGTCATCTTCCCAAATACTCTCTGGAGCTACAAACGGCCTTGTTCTCCACTTTAACCTCTTTGGATCAATTTTCTCTAAGCAACTGTCAACAACAACGCAGAGTCGGAGTTCCACATCCTTCAATCACTGTATTTTTTTCAAGTAAAATATGATACTTTCTCTCAAAATTCCTTCTGGTGTCTTTCATCTCTCACTTTCTTCGTCCGGTAAGAAATATCCCAATCATCCCGTTCAATTTCTTCGTTAGACAAACCTTTCACTTTCGGTGAAAATTATTATCACAGGCAAGGTTGCTCACAAACAGCAGAAAATTATTTACCCTTATTGTTCACTACTTACTAAGTTTGATAATCGCTGTCTTGTTAACTCTTTGCTGTTTATACTTTAGGTTCTTTTAAAGTATTATAAAGTAATTCAATGGTAAAAGTTGCACCGAATATCGAAACAATAATTGTGATGCGCGTGCTATTAATACAAATAATTCCTGCAATTGAAATCTCAAATAGTTTTTTGCTTTTATATTTAGAGTAGACACATAAAAGCACCGTTATCATAAAGTCAGCAGATAAAAACAAAAGGCACATACAGTTAGCTCTGAAAACATAGAAATTGCTCACAAGCAACGTTAGTGCGAAAGAGGTTAAGTTTGGTATCTTTCTACTATCAGTAGGCCAGTATGGAAGCTTGCCGGTTGAAGGTGTTGTTATGCTGTTGTTTACTATGCATTTGTACAGTTCTTCCTTCGGGCTTAGCATTGAAGTCCTCCTACTACGCTTCCATATTCAAGGTTAAGTTTACTTGCATAATTTGTTTACAAGTAACATTATCATGTTAAGTAAATTATTTGTAAGTTCAGACTGTTTTCTAATAGTTCTATTCTCTCCAGTGATGTGTTTGTTTACTTCACGGCAATTTGGGCATAAGATTGATAATCGTTACTTTGTTGGGTATATGTTGACGTTAGGCGGAACAAGCTTTTGCTGGATTCGTTCTTCGTAGCAGTTGGCACATTTTGCTGGTTGTTCTGTTTTTCGGGCAAATGTTGCTTGGGTGTCGAGAGGATTTTTACACAGCGGTACGTTTTGGTACAATATGATTTAGTATGTCCGATTCTGGCAGCTATAGCATTGAACGATTTCATTGTGGGAGGCTCAACTTATTTACATTATATATGTCACAGGTTTTTTTTTTGTTAGGCTCAATATCTACATAAAACATGTTCAGTGACGTTTTGGTCGCGGCTTTTAATATTACTTATGTTTCTAACAACATGACGAGCCTCTTCATCACTTTGGCTATCCTAAATTTGTGGAAAATGCAAATTCTTAATAACAACTCTAAATGCTCTGTCATCCTTAAGCTGGTATGTGTGGTACTGCACACAATCATTATTAAGTGTTTTGACTAATTTTCAGAATTCTTCAATACTTTAACCATTACTCTTACATGTCCATAACGTTGAGTCTTATAATAAAAGTTCTCTCTTAATTTTAGTTTTAAGATGAGTTAGCTTTTCACTTATACCATTGACGTCGAAGGTGGGGGCTAGCAAAATCAGTTGCACTGTTACCATTTCGAGATCTTCGTTTTTTGTTATATTTGTTTCCTGTTTTGTCGGGCAATCCGTCGCTTAAAGAGCGAAATTATTTGCGCTGGTGCTTGATGAATTGTCAGGAATCCTGTTTTCTTTGAACTTCGGGAAGGCTTATTCTCTTTTGGATTTTATTTTCTCTGCCATTTCAAAGCAGTTAGGTCTTCGTCGGTGTCGCTCTGCTTGAGTATTAAGAAGACAATGATTGTTGAGTGCTTGTGTCCGCACTTCGTGCCTCGGAATTGACCAAAGCAAAAGACACTAGAATAATTCTAATTTGATATGACGTTTGCAATAAACGGTTAACATTTTTTTTATTTATAAATTTTTATTTTCTACTTCGTATTATTTTATAAGAATATTTTTCTCAGTGTAATGACTTCTTTTCAGTTTTTTTTATATTCAATTTGATATCTTAAACCTTTAATTTCATCATATTCTGAAATTGGCCAAAACTCCCAAATATGTATGTACATATGTAGATACTGCGATCAGAATTGATTTCGGCCGAAAATCGCCTTCTAGCACAACACGCACATATACGCGTTCTCGTCTTTTGTTTTACTCACACAAACAACTTTTAGATTTCTTACGCTTTCCAGCGCCTTGACGGAAGAACAATTTTGGCCGTCACCAAAAAGTGGCTGCATAGTGCCAAACCAGTGTATGGCTGTTACGCATCTTATTATTCGAATTGTCTTTGATGCAGGCCATGTGACTTTTGCTTAAATATTGTACACATACTTTCCAACACGCCACCTCAAAGTAAGATTGCTGTACTTTTATTACTCACGAGACTGTGCGTCCTTCTGACGAATAATTTTGATCAGCATTCGTTGCGAGGTGTTGGGGAGACCCAGAAAACCCAACCAGATCAATTGAACATATTATTTACATAAATTCAGTTTTGCAAACTATTTTAACAAAAATTAATATTAGTCATCTTTGTAAGAAGCTCAAGAATTATCAGTAAGCTTAATTAAATTTAGTTAAATGATAGTTAGTTTAGTTAGTTCAGTCTGGTTCCTCGTCAGTTCAATCTAAGAATATAATGTTTAATTCATTCTGAGAGTCAAAGTCCATACTCAATGTAATGAATCTTGCAGATGGTACCGGCAAGTTGTAGGGTGTAGATATATACAGTTTGTCAAGAAACTATTTACACGCCGTGAAATAAGTTGAATTTTTCACTTTAAAGGTCAAAATTAAGGGTTATTTCTTTAATTAAACTAATTTTTTTAATGAAATATAATTAAACAATATTTATTTTACTAAATTAAAACAAATTCAAAATATCAAATATACAAGAAATTAAACAACAAATTCCACACACTTTTGAGAGTGGCAAAACTCCTTACACATTTGTTTCCTACTTTGTTTTGCTCTTTTCTTAGAACGAACTCGATTTTCCGTTATTTTTGGCATTTGCATTCCTTTTTTTACAACGCTTCTATTGAAATTTTTTTACTTTGCTTATTGAAATTTTTTGCTGATCGAATGAGTTATTAAATTTAATAAAATGCCTGGAAATAGTAGCTTTTGAAGTGACCCAAATAATACTAAAACCACCAGTTGGAAAATCTATTCCAAATTAGTATAAATGTTTTTTCTGTATCCCGTAAGACCGTCTACAATGTTTTAATCGCTTGAAAAAAGAGAAATTGAAGCTGAACCTAAAAGTGGTGGGCGCAAAACTAAGATTAGCAAGCGTGTAGACCGCCTTATTATACGAAAAAGTGATTGCGAAAGACCCCCGATCTCGGTCAGATCACTTGCTCAGGATATCAGGTAAGAATGTGACCTAGTTATTGCCCTGTGCGCCAAGTGTTCTACGCCATAGGTACTCTTCAAGGTTGCAAGAAAAAAAAAGCCTTTGCTATCAGAGGTCAATATAGAAAGCGTCATTCATTCGCTGTGAGCATGATGGATCATTGCGGAAGAACAAGGATGACACGTAATATTTTAATGACGAAACAAAATGATGCTCTATTGCGCAACGGCCAAGCAGAGTATGGCGCAAGCTGTTGAGTGCGCTAGAAAACAAGTATCATTCCAACAATCAAATTTGGAAAATTATCAGTGATGATTTGGGGCTGTATCTCAAACCGTAGATTGGGCAAAATTAATTTATTGAAAGCTATGAATGCCGTGCAATATCTAGATATTTTAAAAAATCAAATTTGGCCAGTGCAGAAAAATTTGGTCTGTTAACAACAACAAGCCAAATTTTTTAAGTTTATCCAGGACAATGATCCCAAACATAAAGAGTGCAATGTACGCAACTGTCCTTTATAACTGTGGCAAGGTGATCGATACGCCCCCTCCAGGTCTTGATCTGAACCCCATTGAAAATTTGTGGGCCTACTTAAAGAAGAATGTGGCAAAAGGGGCACCAAACACGACAACAGCTCATGGCTGCGATAGAGTGAGGAAAAGATCCCGCTTGAATATGACCTAAAACTCATCCATTCCATGAAAAAAGCTTTCCAACTTGTAGCCAAAGCCAATGGGGGTCTTATAAATACTACAACTTTTCAATTTTAACAATAATTTAAAATTTAGGATTAAACTTAGGTTTAGTGTTTTATTGTAAGAGTTTCTTGAAACTCTCAAAAGTGTTTAAACTTGGAATTCGTTGTTTATTTTCTTGTATATTTGATATTTTTGAATTTGTTTTTTTAATTTATAGAAACGTTTAATTAAGCAAATAACCACAATTTTGACCGTTAAAATCAAAGTCATCTTATTTCACGGTGTGTAAGTTTCTTGACAAACTGTACTTGTCATAATTTATTTTTTAATTTCAAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTAGAGGCGTGCCGAGTATAAAGTGATTCAGATCCGACATCAAGTGGGGACACTGCCAACTTCCTGTAGTTTCATTGTGTCATAGATCGTTTTTTAGCTGTTCTTTATTTGATCCAATTTGAGGAACAGGGAAGGTCCCTTTCAATTCGAGTAATTCGTCAATCCTCTTATGATCTACATACAAGGTTTCTTAGCCTAAGTCGAGAACGCTGCCGGCATAGCCTGCAGCAGCAACATATATGCGTATCTTATATATATGTATATATATGTACTGTCTCGCCGACGATGGTGCTGGAGGAAGTGGTATAGGCACATATAAGCGGTAGCGCTTGTTTGCTGACCAGGCAATTATGTATGTTAGCCCCTCAAGTGGGTGCTCGTACGTATACACTTGTGCTGGACTGTTTATGTACACATTGCAACAGAGGTACTACAATTAGTCTACATAGGTACAGTGCTTAACCGATATGTGTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTAGAGTCGCAGAATCGCCATTTTTTTCTGAACTGTTAAAAAGTGCAAAACTCACAAAGAGATTAAAACTCAACGTCGTATTGCCAAGTTTAATCCTGAACGCACAGGCTTAGACACTCAATCCTGGTGCGGAGACCAAGTCTACATCATAGGACGTCTTAAATACGCGGCGCGAAAATGCCTCGAAACCATAGAAGTTGTGTCGGCCGGTATTGTGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCGCCATAGTTCTGCGCTGCAATCACGCGAGTTAATTGTGCGCCTGTTTCATGTAAATAGGTAATTTATTATCTTTGCGATTGTTGCAGCGGATAAACAGCTGATAGCGCAGCGGGCGATCTGGAGAGGGCGTTGCCAGATCAACCGTGTGATCAGTGTTGTGTTGCGACAGTAGGGCGCGAAATTCAAATTAAATTTAAAATTAAGCCGTTGAAATTTAATTTAATTTAATTTTGATTCTGGTAACTGGGGCGCACAAGTCTTTTAAGAAAGGGGAAAGGCACAAAGGTGCCGGACCAGACCAAATATCATCCTCTCACCGTGCTGGTGCCTAAGCGAGGCTCTGGTGTCGAGTCGAGGCGGTACAAACCTCCATCCGTAAAGCCAGGGGAATCCGTAGCCTACGTGACCCTAGGTAACCTTAGGCCATCCTTCGGTTGATGGACGGCGCAGTGGGGGCAGTCCCCTGATCGCAACGACCCGTTCGGAGCTCCCGACTTCGAGATCCCCACCAGAGGAGTCGGTAACCCGACCCATGGTGACGGAATCTCGGTCCCGTCGGCAAGGGTGAACACGCAGGCCCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGAGGTGGAGAATTGGCTCCTACAGCATCTACGACGCGACAAATTCGAAGACGATGGACCACATCGCCGTGCCATCGCAAAAGGCAGGAGGAAGTCCCCAGCTTGTTCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCAGAACGAGGACCGGGGCATCACCCACCAGGATGAATGGCAAGATCCAGCCCCCTTCGCATTCGAGACCCAACGACACACATGAGAGACAAAGGGCACTTCCGAACTCTCAGCCCTTAACAACAGGGCGGTAGAGCTGTACGAAGGTACTACTAGCGAGCACCGCTTGAAGAGCAGCGCTACCCAGACGGGTAAAAGCCTACCAAAGAAACCACAAAATGCGCAGGTACCCGTTGCGGGTGCAAAGTCCAGGCGCCGAAGCAGAGCAACCCTACGTTGGATGGCAACGGTGAAGAAAGGCGACATCCATACCTAACGAGGTCCAAGCCGGGCAGCTATGCATCTGTCGCCAAGAATGCTAGCACGGGTGCAGAGGCACTCATCGTAAAGACGGGAGAGGCTTCGTACGCAGAGATGCTTCGGAAGCAGATCCGGAATCGAGCCTTAGCGAACTGGAGCGGTACGTGCGAAAAAATCCGGAGAACGCAGAAAGGTGATCTGTTGCTTGGGGTAGAGGCTTCGAGCGTTCCCAAGTTTAAACGACCTGGAAGCGGCGCTCAATGACGGCACTCTGTGCGCACAGGAGCGCAAAAGAATAGCTCTATCTTGCCTTGGATTGGACGAGGCTACGACAGCAGAAAGCTCCACAGCTGCTTGGTCGCCCAATTCCAGGGCCTGCAGATAAATCCTGAAGATATCAGGGGCCTTCGCGGTATGCGGAATTGCAAGCAAATAGCTTCAGTGCTGCTGAACGCGAACGTTGCGATACCAAACAGGGCACCATAATCGTTGGATGGTCAAGATGTCGTATCACCCAGGACGTCCGACCCACGAGATGCTACAGGTGTCTCGGCTATGGGCATCGATCAGCAACCTGCAAAAGGACACTGACAGACAGACTGCTGTCAGATGCGGTGAGCGTGGGCACAAGGCAAAGGGTGCGTTGCTGCACCAAAATGCCTGATCTGCAGCAGCGGTGGACGAAACCACCCGACCCGGGTAGCTTTGCGTGCCCGACTTACAGAGCGACAAGATGCCAAAGAGCCACCTTAATGCACGCTCATATTAGCGTAGTACAGCTCAATGTCAATCATTGCGCAGCAGCTCAGAGCCTCTATTGCGGTTGAGCGCATGTAGACATCATGCTCTAAGCGAACCCTACGTCTCTGGTAGTGGACAATCGTCCATGATCCTTGACGAGGCAGGTAAAGCAGCTATCAAATGCTGCAGCTCTCTCCAAGTCAGGAACTGGCTGCTTTACCCATGCGGGGTATCGCTTATGCGAAGTTAAAACACGTGCACATGTACAGCTGCTACGCTCCGCCGAGCGCGACACCCCCGGTTCGGGCTGGAGGCGCTCGTGGACCATGCAGCAGAGGGCGAAGCCCGAAAGGTCATTACCGGCGACTTTAATGCCTGGACAGTGGAATGGGGCAGCAGGACATCCAACACCAGAGGACGAGCTGTGATTGACGCCATGCGAATGCTGGACCTCATACTGCTGGACGGAAACCGACGTTTAACAACGATGAGGGTACGTCCTTTATTATTTGTCAGCAGAGGCTAGTAGACAACAACAACTGGATGGTCCGCTGACGTCATGACGCTGGCGACCATGCCCTGATCTCCTTCTCCCCGGAGGGTGTACCCAAAGACGGCAAGGTAGAACAGCCGGAAAACACATGGGACACCAGGAAGATCGATGAAGTGCATGCTGGCTATCAGATCAATTCCTGGGAAATCCCAAATGTGGACGCAAGTATGGCGGCAGGCCTCATGAATATGCTGGGAAAAGATCTGCGACACCAATCATGCCAAGGAAAAAAATAAGGCACAGCGCCGTTTACTGGTGGGTGCCTCCTAAGCCAACTACCTGATTGCGGGGCTAAAGAAGAACGGCGCAACGAGCCAGAGGCAGTACCCACCACGCGGAACTCTTGGAGGCTTTCAGAAGCAAACGCCTGGGGTTCAAGCACGACATCGCGGCTGCCAAAGCGCGGTAGGTCGTTTAAGGAGCTGCAGGATGGCGTAGACAGCGTATCACGGAACTCGCGCGAGCTTGTTACCAACGAGCTGGGGAAGCAGCAACCCATCCGACCCGGGGTCCTGGCTAATACTAGGCTTCAAAGCAGACCACACTATGGAGGCCCAACAGGGTAGCCTATTGCAGATGGAATGCTGGTCTCCGTCCAGGGGTACTCAGGGGACCTCTCAAAAGGAGTCTAAAAGTACCTGGCAATGATAGATCACCAGACTATCGTTCAGGACCACGCATGACTACGCCAGCAAGAAGACCAACAGTCATCCTCTTCGTTGGCGAGGCTTATGCCCAACGTCGAATTAAGACACCCGGCCAGGAAACTGCTGGTGTCAGTAGCAAAGGCTTCGCTGCTATACGCTGCACCAGTCTGGAGCAATGCCACTTGCAGGGTCTCATACCTGAAAGGAACTCGTTCGGTGCTACCTCAGGCTCATTAGAGGATTCAGGACCATATCCGAAGACGCGGCGCTAGCGCTGGCGGGCTGCCGATTGATCTGAAGTCGAAACCTCAGCCTTATGCGAATTGGCGCTTCCAGGCAAAGGCACACGAGTGGCTATTAGGTGAATGGCAGAGCAGATGGCTTAAACGTCGCGACGGGGGAGGTGGACCTATCAGCATCCCAGAGATGACGGTTTGGGCGGTGACACTCTCAAAAAGTGTGTAAACTTGGAATTTGTTATTTATTTTCTTGTATATTTGATATTTTTGAATTTGTTTTAATTTATAAGTAAAATAAATATTGTTTAGGGAG
->8c57c17b-432c-48a2-8956-c58c284ca646
-TTGGTAATACTTCGTTCAGTTACGTACTGTAATATTATATTTCCTAAAAAAGTGCGTTTAATTAAACAAATAACCATAATTTTGACCGTTAAAATCAAAATTCATCTTATTTCACGGTGTGTAAACAGTTTCTTGACAAACTGTACTTGTCGCAGATTTATTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTAAGTGATGCCAGTATAAAGTGATTTCAGATCCGACATCAGAAGTGGACCGCCTACTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTGTGTTTTAGCTGATGCTGTTGATCCAATTTGAGGAACAGGAAGGTCCCGCTCCATTCGAAATTAATTCGTCAATCCCCTCTTATGATCTACATACAAAGGTTTCTTAGCCTAAGTCGAGGAGCAGCGCTGCCGGCATAGCCTGCAACGCTTTATATATGCGTATCTTATATATATGTATATATATGTACTGTCATAGAAACGATGGTGCTGGAGGAGAATTGGTATAGGCACACATATAAGCGATCAGCGCTTAGCCAGCCAGGAGAACTGCTGACCAGGCAATTATGTATGTTAGCAGCCCTCAAGTGGGTGCTCGTATTGCAGTATACACTTGTGCTGGACTGTTTATGTACACATTGCAACAGAGTGCTACAATTATGAATACACATAGGTACAGTGCTTAACCGATATGTGGTGCATACTACAATAGGAAGTGAAAACAATTTGCTGACAATTCTAGAGTCGCAGAATCGCCATTTCTGAACTGTTAAAAAGTGCAAAACTCACAAAGAGAGACCCAAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCTGAACGCACAGGCTTAGACACTCAATCTGGTGCGGAACCAGAGTCTACATCATACCGTGAAGACGGACGTCTTAAATTACGCGGCGCAGAAGTACTCCGAAACCATATAGAAGTTGTGTCGTGATTGGTGTGCGGCAAGTAGCCCCAGCAAAATCACGGTGAGTCGCGCCATAGTTCTGCGCTTTCTGCAATCACGCGAGTTAATTGTGCGCCTGTTTTCATCTTAAATAGGTAATTTATTATCTTGCGATTGTTGCCAGCGGATAAACAGCTGATAGCGCAGCGAAGGCGATCTGGAGAGGAGGCGTTGCCAGATCAACTACGTGTGATCAGTGTTGTGTTGCGACAATTAGGACTTTTGAAATTCAAAATTAAATTTAAAATTAAGCCGTTGAAATTTAATTTAATTTAATTTTGATTCTGGTAACTGGGAGCGCACAAGTCTTTACCAGAAGGAAAAGGCACAAAGGTCGCGGACAGACCAAATATCATCCCTCTCACCGTGCTGGTGCCTAAGCAGAGGCTCTGGTGTCGAGTCGAGCGGTACAAACCTCCATCAATAAAGCCAGAAATCCGTGGCCTGCGTAACCCTAGGTAACCTTAGGCCATCCTTCAGTTGATGGACAGCGCGGTGGGGGGCAGTCCCCCTGATCGCAACGACCCGTTCAGGGGAGGAGCTCCGACACCGAGAGATCCCCACACCAGAGGAGTCGGTAACCCGACGCCCATATGGTGACGGAATCTCGGTCCCGTCGGTAACCCAGGGGTGAGCGCAGACCCCAACCGCCGTTGACTATCGACTTTGCAGCGATGCTTTAACAGGGTGGAGAAATTGGCTCCTACAGCATCTACGACCGCGACAAGTCAGAAGACGATGGACCACATCGCCGTGCCATCGCAAAGACGGGAGGAAGTCCCAGCATTTCCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCCAGAACGGGCCTGAGGGCATACTTACCCAGGATGAATGGCAAAGATCAGCCCCTTCTATCCGCATTCGAGACCCAACGACGCACATGAGAGACAAAGGGCATAGCTTCGAGAACTCTCAGCCCTTAACAACAGGGCGATAGAGCTGTACGAAGGTACTGCTGCTTGACACCACGCTTGAAGAACAGCACTTCTACAGACGGAGAGTACAAAGAAAGCCTACCAAAAGGCTCCACAAAATGCGCAGGTACCGGTGCAGGTGCAAAGTCAGACGCCGAAGCAGAGCAACCTACGTTGGATGGCAACGGTGAAGAAAAGGCGACATCCATACCTAACGGGGTCAAGCCAGGCAGCTATGCATCTGTCGCCAGAATGCTAGCACGGGTGCAGAGGGCACTCATCGTAAAGACGGGAGGGCTTCGTACGCAGGATGCTTCGGAAGCTAAGATCAGGAATCGAGCCTTAGCGAACTGGGCGATCACGTGCGAAAAATCCGGAACGCAGAAAGGTGATCTGTTGCTTGAGGTGAGGGAAGCTTCGAGCGTTCCCAAAGTTTAAGAGCGACCTGGAAGCGGCGCTCGGCGAGCTTATTGGCCTCTCTGTGCGCACAGGGAGCGCAAAGAGAATAGCTCTATCTTGCAGCGGATTGGACAGGGCTACGACAACGAAGCTCCACAGCTGCTTGGTCGCCCAATTCAGAACCTGCAGATAAATCCTGAAGATATCAGGGGCCTTCGCAGTATGCGGAATTGCAAACAAATAGCCTCAGTGCTGCTGAACGCGAACGTTGCGGTACCAGTCCTTAAACAGGGCACCATAATCGTTGGATGGTCCAGAATGTCGTATCACCCAGGACGTCCGACCCACGAGATGCTACGGTGTCTCGGCTATGGGCATCGATCAGCAACCTGCAAAGGGACATGACAGGGCAAGACTGCTGTCTTAGATGCGGTGGCGATGGGCACAGGAAGCAAGGGGTGCGTTGCTGCGCAAAATGCTGATCTGCAGCAGCGAGGTGGACAGAAATACCCGACGAGGTAGCTTTGCGTGCCGACTTACGAAACGTACTAAAGATGCCAGAGCCACCTTAATGCACGCTCATAGCGTAGTACAGCTCAATGTCAATCATTGCGCAGCAGCTCAAGAGCCTCCTGGCCCGAACTGCGGTTGAGCGCAATGTAGACATCATCTCCCTAAGCGAACCCTACGTCTCTGGTAGTGGACAATCGTCCATGATCCTTGACGAAGGTGGTAAACAGCTATCGATGCTGCAGCTCTCCAAGTCAGGAACTGGCTGCTTTACCCATGCGGTATCGCTTATGCGAAGTTAAAACACGTGCACATGTACGGCTGCTGCACTCGCCGAGCGAGCACCCCGATCAGTTCGAGGCTTCTGGAGGCGCTCGTGGACCATGCGAGAGGAACTGGCCCGAAGGTCGTACCGGCGACTTTAATGCCTGGACGGTGGAATGGGGCAGCAGGACATCCAACACCAGAGGACGAGCTGTGATTGACGCCATGCGAATGCTGGACCTCATACGCAGCACGAACGATGGACGGAAGCCGACGTTTAACAACGATAGAGTACGTCGCTTTATTGACGTTACCTTTGTCAGCAGGGCTGAAGTAGACAGCAACAACTGGATGGTCCGCTGACGTCATGACGCTGGCGACGACCATGCCCCACAATCTCCTTCTCCCCAGTGCCATGCCCAAAAGACGGCGAAGTAGAACAGCCGGGAAAACATGGGACACCAGGAAGATCGATGAGGCCATGCTGGCCTATCAGATCAATTCAATCCCAAATGTGGACGCAGAAGGTATGGCGGCGAGCCTCATGAATATGCTGGGAAAAGTCTGCGACGCAATCATACCAGGAAAAATATAAGGCACAGCGCAAACCACCCGTTTACTGGTGGAGTGCCTCTAAACCAACTACGGTCCACGATTGCCTCAGGGCCACAAAGGGGGTGGCGCAACGAGCCAGAGGCGAGTACCCACCACATGGAACTCTTGGAGGCTTTCAGAAGCAAACGCCTAGAGTTCAAGCACGGCATCGCGGCTGCCAAAGCGCAGTCGTTTAATTACGGGATGGCGTAGACAGCAGCGATATCCTGAGACCTCGCCACCACAACTGTTACCAACGAGCTAAGGAGGAGAGCAGCAACCCATCCGACCGGGGGTCTGGCTAACATACTGAGAACTATTTCCAAACAGACCACACTATGGAGGCCAACAGAGAGCGGCCCTGCCCAGATTTCCCGTGCGTCACAGAACTTGAAGTCGTCGAGGCAGCTGTTTCGCTGACGATGTGGCAATCACAACCGGGCTAGCAATAGCGGCTCTCTAGACCGAAGCAGTCCTGCAAGCGGCAGGAAAAAGATGGAGAACATGCTGGTCTCCCGTCAAGGGGTACTCAGGGACCTCAAAGAGTCCTAAAGTACCTGGGGGGGTAATGATAGATCGCAGACTATCGTTCAAGGGACCACGCGAGCTACGCCAGCAAGAAGACCTTGATCACATCCTCTTCGTTGGCGAGGCTTGGCATCAACGTCGGAAGCCCAAGACACCCGGCCAGGAAACTGCTGGTGTCGGTAGCAAAGAAACTTCGCTGCTATACGCTGCACCAGTCTGGAGCAATGCCACTTGCAGGGTCTCATACACCTGAAAGAACTCGTTCGGTGCTACGGTCAGCCCTCAGGCTCATTAGAGGAGATTCAGGACCATATCCGAAGACGCGGCGCTAGCGCTGTGGCGAACCTGCCGATTGAATCTGGAATCAAGGCTCTCAGCCTTATGCGGAGTGATGGCGCTTCCAGGCAAGAGGCACGCAGTGGCTTCAATGGGTGAATGGCAGAGCAGATGGCCAAACGTGTCGCGTGGGGGAGGTGGACCTATCAGCTCATCCAGAGATGACGGTTTGGGCAGAGTGACACTCTCAAAGTGTGTAAACTTGGAATTTGTTGTTATTTATTTTTCTTGTATATTTGATATTTTGGTTGTTTTAATTTATAAGTAAAATAAATATTGTTTAATTATTTCCCTAAAAAAAATTGCGTTTAATTAAACAAATAACCCTTAATTTTGACAATTAAAATCAAAAAATTCATCTTATTTCACGGTGTGTAAACAGTTTCTTGACAAACTGTACTTGTCGCAGATTTATTTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTGTGTCCGCTGTAAGTGATGCCAGTATAAAGTGATTCAGATCAAACATCAGAAGTGGGACCGCCTACTCAACTTCCTGTAGTTTCATTGTCATAGATCATTTATTGTTTTAGCTGTTCTTTATTTGATCCAATTTGAGAACAGGGAGGTCCCGCTCCATTCGAAATTAATTCGTCAATCCTCTTGTATGATCTACATACAAAGGTTTCTTAGCTAAGTCGAGGAGCAGCGCTGCGAAAGCATGGCCTGCAGCGCAGCAACGCTATATGCGTATCTTATATATATGTATATATATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAGGAGTGGTATAGGCACACATATAAACGTCAGCGCTTGGCCAGCCAGGAGAACTGCTGACCAGGCAATTGTGTATGTTAGCCTCAAATTGGGTGCTCGTATTACGTATACACTTGTGCTGGACTGTTTATGTACACATTGCAACAGAGTGCTACAATTATGAATACACATGGGGTACAGTGCTTAACCGATATGTGTGCATACTACGTAGTGAAAACAATTTGCTGACAATTCTAGAGTCGCAGAATCGCCATTTCTGAACTGTTAAAGAAGTGCAAAACTCACAAAGAGACAAAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCTGAACGCACAGGCTTAGACACTCAATCCTGGTGCGGAGACAAGTCTACATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCGAAATGCTCGAAACCATGAAGTTGTGTCGGCCGGTGTGTGCGGCAAACTGGCAGAAATCACACGGTGGAGTCGCGCCGCGCCAGTTCTGCTGCAATCACGCGAGTTAATTGTGCGCCTGTTTCATGTAAATGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAACAACTGATAGCGCAGCGGGCGATCTGGAGAGGCGTTGCCAGATCAACCGTGTGATCAGTGTTGTGCGACAGTGGGGGCGCGAAAATTCAAAATTAAATTTAAAATTAAATGGGCAGAGTTAATTTTAATTTGGTACGATTCTGGTAACTGGGAGCGCACAAGTCTTTAAGAAGGGGAAAAGGCACAAGGTCGCGGACAGACCAAATATCATCCTCTCACCGTGCTGGTGCGCACAAGCAGAGGCTCTGGTGTCGAGTCGAAGGCAGTACAAAACCTCCATCCGTAAAAGCCAGGGGAAATCCGTGGCCTGCGTGACCCTAAGGTAACCTTAGGCCATCCTTCCAGTTGATGGACAGCGCGGTGAGGGCAGTCCCCTGATCGCAACGACCCGTTCAGGGGAGGAGCTCCCGACTTTCGAGATCCCCACCAGAGTCGGTAACCCGACCACGGTGACGGAATCTCGGTCCCGTCGGTGGCAAAGGGTGAGCACGCAGGCCCCAGCCGCCGTTGACTATCGACTACGCTTGATGCTGTAGAGTGGAGAAATTGGCTCCTACAGCATCTACGACCGCGACAAGTCGAAGACGATGGACCACATCGCCGTGCCATCGCAAAGACGGGAGGAAGTCCCCAGCTGGTTCCCCTCATCGGTCTTTCGGACTTGACCACTGCTTTCTCAGAACGAGGACCTGAGGGGCATACTTACCAGGATGAGATGAAGATCAGCCCCCCTTCTATCCGCATTCGAGACCCAACGACGCATGAGAGACAAGGGCATAGCTTCCGAACTCATCAGCCCTTAACAACAGGCGATAGAGCTGTACGAAGGTACTACTAGCGAGCACCGCTTGAAGAGCAGCGCGCTACCCAGACGGAGGGTACAAAGCCTACCAAAGGCTCCACAAAATGCGCGATTACCGGTGCGGAGTGCCAAAGTCAGACGCCGAAGCAGAGCAACCCACCGTTGGATGGCGAAAGCGGTGAAGGAAAGGGCGACATCCATGCCTAACGAGTCCAAGCCGGGCAGCTGTGCATCTGTCGCCAGAATGCTAGCACGGGTGCAGAGGCGCTCATCGTAAAAGACGGGAGGCTTCGTGCGCAGAGATGCTTCCGGGCTAAGATCGGGATCGAGCCTTGGCGAACTGGGCGTCACGTGCGAAAATCCGGAGGAACGCAGAAAGGTGATCTGTTTGGCAGGGGTGGGGAAAGCTTCGGGCGTTCCCAAGAGTTTAAAACGACCTGGAAGCGGCGCTCGATGACTTAGCCTCTGTGCGCACAGAGCACAAGAATAGCTCTATCTTGCAGCGGATTGGACGAGGCTACGACAGCGAAGCTCCACGGCTGCTTGGTCGCCAATTCAGGGCCACAGATAAATCCCTGAAGATATCCAGGGGCCTTCGCGGTATGCGTTGCAAACAAATAGCCTCGGTGCTGCTGAACGCGAACGTTGCGATACCGGTCTGTAAACAGGGCACCATAATCGTTGGATGGTCCAAAGAGATGTCGTATCACCAGGACGTCCGACCCACGAGATGCCAGGTGTCTCGGCTATGGGCATCGATCAGCAACCTGCAAGGACACTGACAGGGCAGACTGCTGTCTTAGATGCGGTGAGCGTGGGCTAGGAGGCAAAGGGGTACGTTGCTGCGCAAAATGCCTGATCTGCAGCAGCGAATGGACGAAACCTACCCGACGGGTGGCTTTGCGTGCCCGACACAGGTGACACTAAAAGATGCCAGAGCCACCTTAATGCACGCTCATGATAGCGTAGTACAGCTCAGTGTCAATCATTGCGCAGCAGCTCAAACCTCCTGGCCCAGACACGGTTGAGCGGCGCAATGTGAACATCATGCTCCCTAAAGCGAACCCTACGTCTCTGTTGGTGGACAATCGTCCATGATCCTTGACAGGAGCAGGTAACGGCTATCAAATGCTGCAGCTCTCTCAAGTCCAGGAACTGGCTGCTTTACCCATGCAGGGGTGGTATCGCTTGTCGAAGTTAAAACACGTGCATGTGCAGCTGCTACGCTCCGCCGAGCGTACCCCGATCAGTTCGAGGGCTTCTGGGCGCTCTGTGGACCATGCGGAGAGGGCGAAGCCGAAGGTCATGCCGGCGACTTTAATGCCTGGACGGTGGAATGGGGCAGCAGGACATCCAACACCAGAGGACGAGCTGTGATTGACGCCATGCGAATGCTGGACCTCATACTGCTGAACGATGGACGGAAGCCGGCGGTTAACAACGATAGGGGTACGTCCTTTATTGACGTTACCTTTGTCAGCAGAGGGGCTAGTAGACAACAACAACTGGATGGTGTGACGTCGCGACGCTGAGCGACCATGCCTGATCTCCTTCTCCCCGGAGAATGCCCAAAAGACGGCGAGTAGAACAGCCGGGGCTTATGGGACACCAGGAAGATCGATGAGGCCATGCTGGCCTATCAGATCAATTACAAATCCCAAATGTGGACGCAGAGTATGGCGGCGAGCTCATGAATATGCTGAAGAGGAAGAATCTGCGACGCAATCGTACCAAGGAAAAATAAAGGCACAGCGCAAACCACCCGTTTACTGGTGGAGTGCCTCCCTAAATAACTACGGTCTGATTGCCTCAGGGCTAAGAAGACGGCGCAACGAGCCAGAGGCAGTACCCACCACGCGGAACTCTTGGAGGCTTTCGAAGCAAACGCCTGGAGTTCAAGCACGGCCATCGCGGCTGCCAAAGCGCGGTCGTTTAAGGAGCTTTGCAGGATGGCGTGAGCAGCGATATCTGGGGCCTCGCCTACAGAAAGCTTGTTACCAACGAGCTGGGAGGGAGAGCGGCAACCCCATCCGACCCGGGGTCCTGGCTAACATACTGGGGAGCTATTTCCAAAGCAGACCACTATGGAGGCCAGCAGAGAGCTGGCCTGCCCCAGATTTGCCGTGCGTCTGGAACTTGAAGTCGTCGAGGCAGCTGTTTCGCTGACGATGTGGCAATCTGGCCGGGCTAGCAATAGCGGCTCACAAGACCAGCGTCCTACTAAGCAGCGGGAAAAGATGGAGGCAATGCTGGTCTCCGTCAGGATCTCAGGGACCTCTCCAGAGTCCTAAAGGGTACCTGGGGTAATGATAGATCGCAGACTATCGTTCAAGGACCACACCCGAGCTACGCCAGCAGAAGACAGCAGTCACATCCTCTTCGTTGGCGAGGCTTATGCCCAGCGTCGGAGGCAAAGACACCCACAGCCAGGAAACTGCTGGTGTCGGCGGTAGCAAAGGCTTCGCTGCTATACGCTGCCAGTCTGGAGCAATGCCACTTGCGGGTCTCATACCTGAAAGGAGCTCGTTCGGTGCTGCGGTCAATGGCCCTCAGGCTCATTAGAGGATTCAGGACCACCATATCCGAACGCGGCGCTAGCGCTGGCAGGCCTGCCGATTGATCTGGAGATCAAGGCTCTCAGCCTTATGCGGAGTGGCGCTTCCAGGCAGAAGGCACACGAGTGGCTACTATTAGGTGAATGGCAGAGCAGATGGCAAACGTCGCGACGGGGAGGGTGGACCTATCGTAGCTCATCCAGAGATGACGGTTTGGGCAAGAGTGACACTCTCAAAAGTGTGTAAACTTGGAATTTGTTATTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTTTTAATTTATAAGTAAAATATATATTGTTTAATTATATTTCCTTAAAAAATTGCGTTTAATCAAGCAAATAACCGTTAATTTTTGACACAAGTCAAAAATTCAACTTATTTCACGGTGTGTAAACAGTTTCTTGACAAACTGTACTTGTCGCAGATTTATTTTTAATTTCAAAACCTTATTGTGGCTTATCGCA
->98ca49b0-7072-44b3-938a-91c4b773b3f2
-CACTTAACTCGGTATTACTTCGTTCAGTTACGTGTGTGCTATCGGTACCAAAGTCTCCAAGATCCATAATAGGAAAGACATCCCAAAACATGACTGTGCCCCACCAAATCTATTGGTTAACTGGGCTGCCAAATGCCGCAGTTATTTTCAAATGCATAAAATGCTACTGTATGGCCCTGGTACTGAAGTACAAGACTCATCAGTCCATAAAATATTAAACCAAAGTCAGAGGCTTCTTAACATATTCAACGCAAATCGAAGACGTTTTGTTTTGTTGGTTGGTGTGATCTCAATCGTTTTGCGAACAAAGTATGTCTTAAAATCAGCTTCTTTTAGCCTGCGACGAATTGTAGAACTACTAACTTGTTTGCCAATTGTATTTTGATTCTAAGGCAATTTTTTACCGGACTGGCACTGGGATTCTTCGCCACAACTCAAGTGTTGCCTGCATTGCCTTTGGTCCAGCACAGGTTTTCGGCCTGATCTTTTTTATTTTTTAATGTACCAACTGTATCAAACTTTTTATTAAGTAGTAGACAGTTCTACGCGAAAATTTGATATATTTTCAGCTATTTTGGCCGCAGGTGTACCGGCTTTAAACCTAGCAACAATACCAGCCAGGAACTTTCAACTGGTAACTCTTTGTTTTGGGGCATTTTATTTATGCTGTAATGGGAAAATGATTAAATCTAATTTTATTCAATAATTTAAATGTATTTAAGCAAACAAACCGGCACTTGTCCTCTAAACCAATCACTGAAGAAAGTGTGCGTTGTGAAAATAATTGTGTGATGCGACGAAACCGTGTGCAAATACTTCTGACAACTGATAAAGATCTCTTCATTTGCCTCTTCCTTGCGCATAGGAACAGTTATTTTTTCAATTCTTCTTTCATCTGACTCTGCATAGGTTTGAATTTGCAAGAAGCAAAGTTTTGCATTCCTCCCCACTTGCTTACTGCAAGCAACTGTTTGTAGCTGACCAATACACAGTACTTTGTGAAAATAATTTTGACCATGACTGTATATCAGTTTGCCTAGCCATTAAATGAATTAGCTGAGTATCAAAAGGTGTAGAACTCCACGGTCGTCTTTATGTCCCCGACATCAAAAGTTTTGTCATCTTCCCAAATACTCTCTGGAGCTACAAAACTTGACCTTGTTCTCCACTTTAGCCTCTTTGGATCAATTTTCTCTAGCAACTGTCAACAACAACGCAAGAGTCGGGTTCACATCCTTCAATCACTGTATTTTCCAGAGGTCAATGTCGATACTTTCTCCCTTTCAAAGAATTCCTTCTAAATTCGCTACCGCCAGTACCAAACGGAAATATCTTTCATCCTCCCTCACCACTTTCTTCGTCAGTAGAAATATCCCGTCAGTTTAGTCATTCGAATTTCTTCGTTAGACAAACCTTTCACTTTCGGTGAAATTATTATCTGGGCTGAGTTTGCTGCAGCAACTTAGAAAGTATTTACTTGCTGTTGTTCACTACTTACTAAGTTTGACTAAATCACTGTCTTGTTAACTCTTTGCTGTTTGCTATTTTAGGTTCTTTTTAAAGTATTATAAAGTAAATTAATTCCAAAAAGTTGCACCGAATATCGAAACAATAATTATTGTGATGCGCGTGCTATTTATTGCAAATAATTCCTGCAATTAATCTCCAAATGCGTTTTTTGCTTTTATTTAGAGTAGACACCTTAAAAGCTTCGTTATCGCAAAGAATCAGCAGATAGTAAAGGCACCTTACAGTTAGCTCTGAAAACATAGAAATTGCTCACAAGCAACGTTGGGTGCGAAAGGGTTAAGTTGGTATCTTTCTACTATCAGTAGGCCAGTATGTAGGCTTGCCGGTTAAGTGTTGTTATGCTGTTGTTTTACTATGCATTTGTACAGTTCCTTTCCCTTCGGAGAAGCTTAGCATTGAGAATACCTCCTACTACGCTTCCATATTCCAGGTTAGGATTTACTTATGAATTTGTTTACAAATAACATTATCATGTTAAGTAAATTATTTGTAAGTTCAGACTGTTTTCCTAATAGTTGCTCTATTCTCTCCAGTGATGTGTTGTTTTGCTATTTCCTGCAGCAATTTGGGCATAAGATTGATAATCATCTTTACTTTTATTTGGGTATATATTTGGCGTGAGCGGAACTAAACTTTGCTGGATTCCTAAATCATTTTTTACTCAGATCATTATTTCTATTTTCTATTTTTTTTTGGACAGAGTTCTGATAAATTCTACACCCTTTGTAGCTGGCGGCGTGTTCTTCATTAGCAGTTGGCACATTTTGCTTAGTTGTTCTGTATTTTCGGGCAAATGTTGGAATTGTCGAGAGAGATTTTACACAGCGGTACGTTTTGGTACAATATGATTTAGTATGTCCGAATTCCTGGCAGCTATAATTGAACGATTTCATTGTGGGAGAGCTCAACTATTTTATTTACATTATATATGTCTAGGTTTTTTTGTTAGGCTCAATATCTACATAAAACATGTTCAGTGACTTTGGTCATACAGCTTTTAATATTACTTATGTTTCTAACAACATGACCTTTTGACTCTTCATCACTTTTAATTTCATCTAAATTTTGTGGAAAATGCAAATTCTTAATAACAACTCTAAATGTGTCATCCTTAAAAAAAATAATTATAATCAATTATTCAGAATAGAATCTATTAAATTCTGACTAGTGCAGATGATGATCAGTCAGTCAGTTATGTTCGTCTTCGTTTTGTTATATTTGTTTCCTGTTTTTTGTCGGGCAATCCAGGCAAGAGCGAAATTGATTTTGCGCTGGTGCTTGATGAATTGTCAGGGGAATCCTGTTTTCTTTGAACTTCGGGGAGGGCTTGGTCTCTTTTTTTGGACATATTTTACTCCTGCCATTCAAAGCAGTTAGGTCTTCGTCGGTGTCGCTCTGCTTGAGTATTAAGAGACAATGATTGTTGAGTGCTTGTGTGTCCGCACTTCGTGCCTCAAAGATATAAACCAAAGCAAGAACACTAGAATAATTCTAATTTGATATGACGTTTGCAATAGAAGCAGTTAACATTTTTTTTTATTTTATAAATTTTTATTTTCTACTTCATTATTATTTTTTTATGAAATATTTTTTCTCAGTGTAATGACTTCTTTTTCAGTTTTTTTTTATATTCAATTTGATATCTTAAACCAGCGCGCAATTTCATCATATTCTACGAAATTGGCCAAACTCCCCCAAATAATATGTACATATGTAAATTCGTTACTGCGATCCAGAATTGATTTCGGCCCGAAAATCGCCTTCTAGCTTCTTACGCACACATATACGCGTTCTCGTCTTTTGTTTTTTACTCACACAAGCAAGCAAATTCTATTTTAGATTTCTTACGCTCAGCGTGAGCGGCTTGAAGAGCAATTTTGGCCGTCACCAAAAGTGGCTGCATAGTGCCAAACCAGTGTATGGCTGTTTACGCATCTTATTGATAGTGTCTTTGATGCAGGCCATGTGACTTTTGCTTAAATGTGTACATACTTTCAACACTGCCTCAAAGTAAGGTGCTGTGCTTATTACTCACGAGACTATTACGTCAAGCTGACGAATAATTTTTTGATCCAGCATTCGTTGCGAGGTGTTGGGGAGACCAGAAAAGCCAACCAGATCAATTGAACATATTATTTACATAAATTCAGTTTTGCAAACTATTTTAACTTCAGAGTGTGTGTCATCTTTGTAGAAACTCAAAATTATCAGTAAAAACTTAATTAAATTTAGTTAAATATTAGTTAGTTTAATTAGTTCAGTCTGGTTCCTCGTCAGTTCAATCTAAGAATATAATGTTTTTAATTCATTCTGAGAGTCCAAAGTCCACTTCTCAATGTATTGATCTTTTGCGAGATGGTACCGGCAAGTTGTAAATTTGTAGATATATACAGTTTTGTCAAAAAACTATTTACACGCCGTGAAATAAGTTGAATTTTTCACTTTAAAGGTCAAAATTAGGGTTATTTCTTTATTAAACACAATTTTTTTTAATGAAAATATAATTAAGCAATATTTATTTTACTTATAATTAAAAACAAATTCAAAATATCAAATATACAGAAATTAAACAACAAATTCCAAGTTTACACACTTTTGAGTGGCAAAGAAACTCCTTACACATTTTGTTTCTTTTGTTTTGCTCTTTTCTTAGAACGAACTCGATTTTTTCCGTTATTTTTTGGCATTTGCATTCCTTTTTACAACTTCTATTGAAATTTTTTTGCTTTGCTTGTGAAATTTTGCTGATCCAGATGAGTTATTAAATTTAATAAAATGCTGGAAATAAATTAGCTTTTGAAGTGACCCAAATAATATACTAAAACCACCAGTTGGGAGAAAATCTATTCCAGAATTAATTATAAATGTTTTCTGTATCCCGTAAGATAGATCTACAATGTTTTTAATCCTTGAAAAAAGAGAACAGGCTTGAACCTAAGGTGGTGGGCGCAAAACTAAAATTAGCAAACGTGTAGACCGCCTTATTATGCGAAAGTGATTGCGAACCCAGATCTCGGTCAGATCCTTGCTCAGGATATCGAGCAAGAATGTGACCTGGTTGATTTTACAAAACTGTGCGCCAAGTCGATTTCACGCCATAGGTACTCTTCAAAGAGTTGCAGAAAAAGCCCCTTTGCTATCAGGGTCAATATAGAAAAGCGTCATTCATTCGCTGTGAGCATGATGGATCATGGAAGAGGTACTGGATGACGTAATATTTTGTGTTGAAACAAAAATGATGCTCTGTTGCAACGATGGGCCAAGCAGAGTATGGCGCAAGCTGTTGAGTGCGCTAGAAAAACGAAATATCATTCCAACAATCAAATTTGGAAAATTATCAGTGATGATTTGGGGCTGTATCTCAAGCCATGGGTGGGCAAATTAGCCTTTATTGAAAGCACTATATGAATGCCGTGCAATATCTAGATATTTTAAAATCAAATTTGAAGGCCAGTGCAGAAAATTTGGTCTGTTTAGCAACATGACAAATTTTAAGTTTTATCAGGACAATGATCCCAAACATAAAGAGTTACCCAATGTACGCAACTGGCTCCTTTATAGCTGTGGCGAGGTGATCGATACGCCCCCTCAAGTCTTGATCTGAACCCCATTGAAAATTTATTGGGCCCTACTTAAGAAGAATGTGTAAAGGCACCAAAACACGACAACAGCTCATGGCTGCGATAGAAGTGGGAAAAGATCCCGCTTGAATATGACCCACAAAAAACTCATCCATTCCATGAAAAAAGCTTCCAACTTGTAGCCAAAGCCAATGGGGTCATACTAAATACTACAACTTTCAAATTTTAACAAAATAATTTAAAATTTAGGATACGGCAGGTTGGTGTTTTTGTGTAAAGAGTTTGTGAAACTCTCAAAAAGTGTTTAAACTTGGAATTCGTTTGTTTGGCCCTGCTTGTATATTTGATATTTTGAATTTGTTTTAATTTATAAGTAAAATAAATATTGTTCCAATTATATTTCCTAAAAAAAAGTGCGTTTAATTAAGCAAATAACCATAATTTTGACCGTTAAATCAAAATTCATCTTATTTCACGAGATTGTGTAAACGGTTTCTTGACTGTACTTGTCGCAGATTTATTTTAATTTCAAGTTAACGACCGTTTCTGTACTTTGTGTCCGCTGTAGAGAGTGATGCCGAGTATAAAGTGATTCAGATCCGACATCAGAAATTAGGACCGCCTACTCCAACTTCCTGTAGTTTCATTTGTGTCATAGATCATTTGTGTTTTTAGCTGTTCTTTGTTGATCAATTTGAGGAACAGGAAGGTCCCGCTCCATTCAGAAATTAATTCGTCGAATATACCCTTGGTCTACATACAAAGGTTTCTTAGCCTAAGTCGAGGAGCAGCGCTGCCGGCACAGCCTGCAGCCGCTTAACGCTATATGCATATCTTATATATATGTATATATATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAGGAGTGGGTATATAGGCACACATATAAGCGATCAGCGCTGACCAGCGGGAGAACTGCTGACCAGGCAATTATGTATGTTAGCCCTCAAGTGGGTGCTCATTATTACGTATACACTTGTGCTGGACTGTTTATGTACACATTGCAACAGAGTGCTACAATTACTTGAATACACATAGGTACAGTGCTTAACCGATGGCAGTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTGGAGTCGCAGAATCGCCATTTTTCTGAACTGTTAAAAGTGCAAAACTCACAAAAGAGACCCAAAAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCTGAACGCACAGGCTTGAACACTCAATCCTGGTGCGGAGACCAAATCTACATCGCCGTGAAGACGGACGTCTTAATTACGCGGCGCGAAATACTCGAAACCATAGAAGTTGTGTCGGCCGGTGTGTGCGGCAAACTGGCAAAATCACGATTGATCAAGCGCGGTTCTGCGCTGCAATCACGCAGTTAATTGTGCGCCTGTTTCATGTAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAACAGCTGATAGCGCAGCAGACGATCTGGAGAGGAAGGCGTTGCCAGATCAACCGTGTGATCAGTGTTGTGTTGCGACAGTAGGGGCGCGAAATTTAAAATTAAATTTAGAATAAACCGTTTGAAATTTAATTTAATTTAATTTGATTGCAATGACTTCAGGAGCGCACAAGTCTTTAAGAAAGGAAAAGGCACAAAGGGTCGCGGACGACCAAATATCATCCTCTCACCGTGCTGAATTTGCCTAAGCAGAGACTCTGGTGTCCAGTCGAGCGTTCAAACCTCCATCCGTAAAAGCCAGGGGGAAATCCGTGGCCTACGTGACCTAGGTAACCTTGGGCCATCCCTTCAGTTGATGGACAGCGCAGTGGGGCAGTCCCCTGATCGCAACGACCAGTTCAGGAGGGCTCCCGACTTTCGAGATCCCCGCAGAGGGTCGAGCCGACCCATGGTGACGGAATCTCGGTCCCGTCGGTGGCAAGGGTATTTTTTGCAGGCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGAGGTGGAGAATTGGCTCCTACAGCATCTACGACCGCGACAAGTCCAGAAGACGATGGACCACATCGCCGTGCCATCGCAAAAGACGGAGGAAGTCCCAGCTTGTTCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCCCAGAACGAGGACCTGGGGGGCATACTTACCAGGATGAATGGCAAGATCGGCCCCCCTTCATCGCATTAAGAGACGCTTGACACACATAGAGACAAAGGGCATAGCTTCCGAACTCTCAGCCATAACAACAGGGCGATAGAGCTGTACGAAGGTACTACTGAGCGAGCACCGCTTGAAAGGCAGCGCTACCAGACGGAGGTAAAAGCCTACCAGGCTCCACGCAAATGCGCAGGTACCCACGGTGCAGGTGCCAGAGTCCAGGCGCCGAAGAAACGGAGCAACCCTACGTGGATGGCAGCGGTGAAGAAAAGGCGACATCCATACCTAACGGAGATCCAAGCCAGACGTATGCATCTGTCGCCAAGAATGCCCAGGGGTGCAGAGCACTCATCGTAAAGACGGGAGGCACCGTGCGCAGAGATGCTTCCGGGCTAAGGATCCGGAATCGAGCCTTAGCGACTGGGCAGTCACGTGCGAAAATCCGAACGCAGAAAGGTGATCTGTTGGCGGGGTAGAGGGGAAGCTTCGGGCGTTCCCAAGTTTAGAGCGACCTGGAAGCGGCGCTCAATGACTTAACCTCTGTGCGCACAGGGCGCGAAAAGAATAGCTCTATCTTGCAGCGGATTGGACGAGGCTACGACAGAGAAGCTCCACAGCTGCTTGGTCGCCCAATTCAGGGCCGCAAGATAAATCCACGAGGTATCAGGGCCTTCGCAGTATGCGGAATTGCAAACAAATAACCTCAGTGCTGCTGAACGCGTTGCGATACCAGTCATAAACAGGGCACCATAATCGTTGGATGGTCAAAGATGTCGGTATCACCCAGGACGTCCGACCCACGAGATGCTACAGGTAATGCGGCTATGGGCATCGATCAGCAACCTGCAAGGACACTGACAGGGCAGACTGCTGTCTTAGATGCAGTGAGCGTGGGCACAAGGCAAAGGGGTGTTGCTGCGCAAAATGCCTGATCTGCAGCGGCGAGTTGGACAGAAACCACCCGACGGGTAGCTTTGCGTGCCCGACTTACAAACGACACTAAAAGATGCCAAGAGCCACCTTAATGCACGCTCATATTAGCGTAGTACAGCTCAATGTCAATCATTGCGCAGCAGCTCAAACCTCCTGGCCCAGACTGCGGTTGAGCGCAATGTAGACATCATGCTCTAAGCGAACCCCTCGTCTCTGGTAGTGGACAATCGTCCATGATCCTTGACGAAGGCAGGTAAAGCAGCTATCAAATGCTGCAGCTCTCTCCAAGTCCAGGAACTGGCTGCTTTACCCATGCAGGGGTATCGCTTATGCGAAGTTAAAACACGTGCACATGTACAGCTGCTACGCTCCGCCGAGCGACACCCCGATCAGTTCGAGAACTGGAGGCGCTCGTGGACCATGCGAGAGGGCGAAGCCCGAAGGTGATACCGGCGGCACTGGCTACCTGGACAGTGGAATGGGGCATGGGACATCCAGCACCAGAGGACGAGCTGTGATTGACGCATGCGAATGCCGGACCTCATACTGCTTTGAACCTTGATGGACGGAAGCCGACGTTTAACAACGATAGGGTACGTCCTTTATTGACGTTACCTTTGTCAGCAGAGGGCTGGTAGACAACAAACTGGATGGTCCGCGTCATGACGCTGATGACTAAATACCCTGATCCTCGCTTACTCCCGGAGGTACCCAAAGGGCTGGCCAGAAGTAGAACAACCGAAATGGGACACCGGAAGATCTGATAGAGGCCATGCTGGCCTATCAAGATCCATTCCTGGAAATCCCAAATGTGGACGCAGAGTATGGCGGCAGGCCTCATGAATATGCTGGGAAGAATCTGCGACGCACCAATCATGCCAAGGAAAATAAGGCACAGCGCAAAACCACCCGTTTACTGGTGGGTGCCTCCTAAACCAACTACGGTGGTCTGATTGCCTCAGGGCTAGAAGAACGCAACAGGCCAGAGGCGAGTACCCACCACGCGGAACTCTTGGAGGCTTTCAGAAACAAACGCCTAGAGTTCAAGCACATCGCGGCTGCCAAAGCGCGGGTCGTTTGGGAGCACGGGATGGCGTAGACAGCGATATCTGGGGCCTCGCCTACAAGCTTGTTACCAACAGGCTAAGGAGGAGGCGACGGAAAACCCCATCCGACCCGGGGTCCTGGCCTAACATACTGGAACTGTTCCAAAGCAGACCGCACTATGGAGGCCAACAGGGCAGCCTGCCCCGGATTTCCCGTGCGTCACAGAACTTGAAGTCGTCGAGGCAGCTGTTTCGCTGACGATGTGGCAATCACAGCCGGGCTAGCAATAGCGGCTCACAGAACCGGCAGTCCTACTAAGCAGCAGGAAAAGATGGAGAACATGCTGGTCTCCGTCAAGGGGTACTCGGGGACCTCTCAAAGAGTCCCTAAAGTACCTGCGGGGTATGAAGATCACCAGACTATCGTTCCAAAGGACCGCGGGCTACGCCAGCAAAGAAGGCAGCAGTCACATCTCTTCGTTGGCGGGCATACTTTAACGTGGGGCTGGGCTTTGGCCCAGAGCTGCTGGTGTCAGTATGCGAGAGCTTCGCTGCTATACGCTGCACCAGTCTGGAGCAATGCCACTTGCAGGGTCTCATACCTGAAAGGGCTCAGTTGGTGCTGCGGTCGGCCTCAAGGCTCATTTCGGGGTTGGGGACACCATCCGGGCGGCGCTGGCGCTGGCAGGCCTGCGGTTGATCTGAATCAGGGCTCTCAAAACACTTATGGAGTGGCGCTTCCAGGCAAAGAGGCACGAGTGGCTAATGGGTGAATGGCAGAGCCGGGTGGCGACGTCGCGACGGGAGGTGGACCTATCGGCTCATCCGGGGCGACGGTTTGGGCAGAGTGGCTTACTCTCAAAAGTGTAAACGGGTTGTTATTTATTTTTCTTGTATGTTGATATTTTGAATTTGTTTTTAATTTTATAGTACAAAATGACTCATTTGTTTTGGTATATTTCCTAAAAAAAATTGCGTTTTAATTAAACAAATAGCCATGGTTTTGACCGTTAAGTCAAAATTCATCTTTATTTCACTGATTGTGTAAATGAACACTAACCCGACCGAGCTGTGCTTTGTCATGGGGTGCTTGTTTTGATTGACGATGAACGGTAGCATTAAGCTGTAGAGTGATGCCGGTATAAAGTGATTCAGATCCGACATCAAATTGGGACCGCCTACTCCTTCCTGTAGTTTCATTGTGTCATAGATCATTTTGTGTTTTAGCTGTTCTTTATTTGATCAATTTGAGAGACAGGGAAGGTTCACTCGTTTCAAGGTAATTCGTCAATCACTATGATCTGCCTAAGGTTTCTTAGCCCTAAGTCGAGGAACAGCGCTGCCAGCGCAGCCTGCAGCACCTTAACTTGCTATATGCGTATCTTATATATGTATATATATATATATATGTACTGTCATAAAACGTGGTGCTGGAGGAGGAGTGGTATAGGCACACATATAAGCGATCAGCTTGGCCAGCAGGAGAACTGCTGACCAGGCAATTATATTATGTTAGCTACAGGAAGTGGGTGCTCGTATTACGTATACACTTGTGCTGGACTGTTATGTACACATTGCAACAGAATTACAATTATGAATACATGGGGTACAGTGCTTAACCGATATGTGTGCATGCTGCAATAGTGAAAACCGTTTACTGGTGGTGAGTCTTGAATCATGGCTTTTCTGACTGTGAAAGTTGCCAAAACTCACAAAGGGCCAAAAACTCAAATGCTGTCGTATTGCCAAAGTTTAATCCTGGGGCGCGCAGGGCAGGTACTCGTCCGCACCG
->b16608f5-73d0-4f8d-b3c8-bb1dc735636a
-TTGTTGTACTTCTGGAACAGGTTACGTATTGCTGTGTTTTAGCTGTTCTTTATTTGATCAATTTGAGGAACAGGGGGGGAAGGTCCTCCATTCAGAAATTCGTCAATCCTCTTATGATCTACGGGTTTCTTAGCCTAAGTCGAGGAGCAGCGCTGCCGGCATAATACGGCGCAGCAACACTTTATATGCGTATCTTATATATATGTATATATATGTACTGTCGCCGAGAACGATGGTGCTGGAGGAGAGTGGTATAGGCACATATAAGCGATCAGCGCTGGCCAGCGGGAGAACTGCTGACCAGGCAATTATGTATGTTAGCCCTCAAGTGGGTGCTCGTATTACGTATACACTTGTGCTGGACTGTTTATGTACACATTGCAACAGAGTGCTACAATTATGAATACACATAGGTACAGTGCTTAACCACGATATGTATGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTAGAGTCGCAAGTCGCCACGAACGCTGTTAAAGTACAAAACTCACAAAGAGACCCAAAAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCTGAACGCACGAGCAGACACTCAATCCTGGTGCGGAGACCAAAGTCTACATCACCGTGAAGACGGACGTCTTAGCAAATTACGCGGCGCGAAATACTCGAAACCATAGAGTTGTGTCGGCCCGGGTGTGGCGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCATAGTTCTGCGCTGCAATCACGCAGAGTTAATTGTGCACCTGTTTCATGTAAATAGGTAATTTATTATCTTTACGGTGTTACGCTGGATAAACAGCTGATAGCGCAGCGAGCGATCTGGAGAGAGGCGTTGCCAGATCAACCGCCGTGTGATCAGTGTTGTGTTGCGACAGTAGGGCGCGAAATTCAAAATTAAATTTAAAATTTAAAGCCGTTGAAATTTAATTTAATTTAATTTTGATTCTGGTAACTGGGAGCGCACAAGTCTTTTAAGAAGGGAAAAGGCACAAAGGTCGCGGACCGAACCAAATATCATCCTCTCACGGTGCCCTAAAGCAGAGGCTCTGGTGTCGAGTCGAGCGGTACAAACCTCCATCCGTAAAAAAAGCCAGGAAATCCGTAGCTACCGTGACCTAGGTAACCTTAGGCCATCCTTCCAGTTGATGGACAGCGCAGTGCCGTTGGGGGGCAGTCCCCTGATCGCAACGACCCGTTCAGGAGGAGCTCCCGACTTTCGAATCCCCACCAGAGTCGGTAACCCGACCCATGTGACGGAATCGGTCCCGTCGTGGCAAGGGAGGTGAGCACGCAGGCCCCAGCCGCCGTTGACTATGACTACGCGATGCCTGGCAGTGGAAAGTGGCTCTACAGCATCTACGACCGCGACAAGTCAGAGACGATGGACCACATCGCCGTGCCATCGCAAAAGACGGGAGGGAAGTCCCCAGCATTTCCCCCTCATCGGTCTTCCGGACTTGACCACCGCCTCTCCAGAACGCGGGACCTGAGGGCATACTTTACCAGGATGAATGGCAAGATCGGCCCCTTCTATCCGCATTCGAGACCCAACGACACACATAGAGACAAGGGCATAGCTTCCGAACTCTCAGCCCTTATAGGGCGATAGAGCTGTACGAAGGTATTACTACTAGCGAAGCACCGCTTGAAGAGCAGCGCTACCCAGACGGGTACAAAAGCCACCAAAACCACAAATGCGCAGGTACCCACGGTGCAGGTACCCAAAGTCAGGCGCCGAAGCAGAGCAACCCTACGTTGGATGGCAACGGTGAAGAAAGGCATGTACCTAACGAGGTCCAAGCCAGACGGCTATGCATCTGTCGCCAGAATGCTAGCACGGGTGCAGAGCACTCATCGTAAAAAAGACGGGAGGCTTCGTACGCAGAGATGCTTCGGAGGCTAAGATCGGAATCGAGCCTTGGCGAACTGGGCGATCGTGCGAAAAAAAAATCCGAGGAAACGCAAGAAAGGTGATCTGTTATACGGTGGGGAAAGCTTCGGAAAGCGTTCCCAAGTTTGGAAACGACCTGGAAGCGCTCGTAACAACCTCATGTGCGCACAGGAGCGCAAAGAATAGCTCTATCTTGTGGTTGGAACGATACGACAGCGGAAGCTCCACGGCGCTGTTCCTTAATTCCAGGGCCTGCAGATAAATCTATGAAGAAGACAGCCTGCCCCAGGGTTACTGACAGGGCAGACTGCTGTCTTAGATGCCGTGAGCGTGGGCACAAGGCAAAGGGGGGGTGCGTTGCTGCACCAAAATGCCTGATCTGCAGCGGACAGAAACTCCCCACCCGACAGGTGCTTTGCGTGCCCGACTTACAGAGCGACTAAAGATGCAGAGAGCCACCTTAATGCACGCTCATATTATTAGCGTAGGTACGAAGCTCAATGTCGAAGTCATTTGCGCAGCTCAGAGCCTCTGGCCCCAGACTGCGGTTGAGCGCAATAGACATCATGCTCCCTATAGCGAACCCTACGTCTCTGTTGGTGGACAATCGTCCATGATCCTTGACGAGGCAGGTAAAGCAGCTATCAAATGCTGCAGCTCTCTCAAGTCCAGGAACTGGCTGCTTTACCCATGCGGGGTATCGCTTATGCGAAGTTAAAACACGTGCACATGTACAACGCGCTCCGCCGAGCAACACCCCGATCGGGACTGAAGGCTGGAGCGCTCGGCTGGACCATCTGAAGGCAAAGAAGCCCGAAGGTCATTACCGGCGACTTTAATGCGGACAGTGGAATGGGGCATGGGACATCCAACACCAGAGACGAGCTGTGATTGACGCCATGCGAATGCTGGACCTCATACCTGCTGAACGATGTGGACGGAAAGCCGACGTTTAACAACGATAGGGTGCATTGCTTTATTGACGTTACCTTTGTCAGCAGGGCTGGTAGACAGCAACAACTGGATGGTCCATGACGCGTCGCTGACGCTGAGCGACCATGCCTGATCTCCTTCTCCCCGGAAGTGTACTTAAAAAAAGACGGCAGAGTAGAACAGCCGGAAAACATGGGACACCAGGAAGATCGATGAGGCCATGCTGGCCTATCAGATCAATTCCTGGAAATCCCAAATGTGTGGACCTGCTTAGAGAGTATGACGGCAGGCCTCGCTGAATATAGGAAGAATCTGCGACGCAATCATGCCAAGGAAAATAAGGCACAGCGCAAACCACCCGTTTACTGGTGGAGTGCCTCTAAGCCAACTACGGTCTGATTGCCTCAGGGCTAAAGACAGCACAACGAAATGACGGTACCCACCACGCGGAACTCTTGGAGGCTTTCAGAGAAGCAAACGCCTAGAGTTCAAGCACACGGCGCTATCGCAGCTGCCAAGCGCGGTCGTTTAAGGAGCTGCAGGATGGCGTGAGCAGCGTCTGGGGCCTCGCCTACAAGCTTGTTACCAGCTTGAGCTGGGAGGAGAGCAGCAACCCCATCGACCAGGGGGTCACAGCTGGCATACTAGGAGCTATTTCCAAAGCAGACCACACTATGGAGGCCAACAGAGGCGGCCCTGCCCAGATTTCCCGTGCGTCACAGAGAAGACTTGGAAGTCGTCGAGGCAGCTGTTTCGCTGACGATGTGGCAATCACAGCCGGGCTGGCAATAGCGGCTCTGAGACCGAAACCCAGTCCTACTAAGCAGCAGGGAAAAGATGGAGAACATGCTGGTCTCCGTCAAAGGGAACAGGGGACGGGGAGTCCTAAAGGGTACCTGGGGGTAATGATGATCGCAGAACTATCGTTCAAAGGACCCGCACTTACGCCAGCAAAGTAGCAGTCACATCCTCTTCGTTGGCGAGGCTTAGCCCAACGTCAGAGCCCCGGGCAGCCGGAAACTGCTGGTGTCAGTAGCAAAGGCTTCGCTGCTATACGCTGCACCAGTCACCGACAATGCACAGGGTCTCACATACGAAAGGAGCTCGTTCGGTGCTACGGTCAATGGCCCTCTCAGGCTCATTAGGGGATTCAGGACCATATCCGAAGACGCGGCAGCGCCTTCGCTGGCGGAGCCACCGATTGATCTGGAGATCAGGCTCTCAGCCTTATGCGAATTAGCGCTTCAGGCAAGAGAGCACACGAGTGGCTATTAGATTGAATGGCAGAGCAGATGGCAAACGTCGCGACGGGGGAGGTGGACCTATCAGCTCATCCCAGAGATGACGGTTTTAGGTAGGTATTGGCACTCTCAAAGTGTGTAAACTTGGAATTTGTTATTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTAATTTATAAGTAAAATAAATATTGTTTTAGTATATTCCTAAAAAAAAAATTGCGTTTAATTAAGCAAATAGCCCTTAATTTTGACGAACTAAAATTAGCCAAGAGTTAACGACCGTTTTCTGTTACTTTGTGTCACTGCTGAGTGATGCCGAGTATAAAGTGATTCAGATCCGACATCAAGTGGGACCGCCTACTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTTGTGTTTAGCTGTTCTTTATTTGATCCAATTTGAGAACAGGGAAGGTCCGCTCCATTCGAAATTAATTAAAGTAAATCCTCTTAGATCTACATACAAAGGTTCTTAGCCTAAGTCGAGGGAGCAGCGCGCTGCCGGCGCAGCCTGCAACGCAGCAGCTTGTATATGCGTATCTTATATATATGTATATATATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAGGAGTGGTATGACACACATATAAGCGATCAGCCTTGTAAGGAAACTTGCTGACCAGGCAATTATGTAGCCCTCAAATTGCGTTTTTCGTATTACGTATACACTTGTGCTGGACTGTTTATCGCACACGACAGAGTGCTACAATTATATGAATACACACATGGAATTTACAGTGCTTAACCGATATGTGTGCATACTACAATGAAGAAACAATTTGCTGACAATTCTAGAGTCGCAGAATCGCCATTTTTCTGAACTGTTAAAGAAGTGCAAAACTCACAAAGAGACCCAAAAACTCAATGCTGTCGTATTGCCAGAACAATCCACAGACGCACAGGCGGAAAGACCTCAATCCTGGTGCGGAGACCAAAGTCTACATCGCCGTGAAGACGGACGTCTTAAATTACGCCCGGCGCGAAGTACTCCGAAACCATAGAAGTTGTGTCGGCCGGTGTGTGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCGCAGGACTGCGCTGCAATACGCCGGAACTAAATTATGCGCCTATTTCATATGAAATAGGTAATTTATTATCTTTGCGATTGTTGCAGCGGATAAACAACTGATAGCGCAGCGGGCGATCTGGAGGGAGGCGTTGCCAGATCAACCGTGTGATCAGTGTTGTGTTGCGACAGTAGGGCGCGAAATTCAAAGGTAAATTTAAAATTGGCCGTTGAAATTTTAATTTGGTGGTACGATTCTGGTAGCAGAACGCACAAGTCTTTAAGAAGGGAAAAGGCACAAGGTCGCCGGATGAATACGAAATATCATCCTCTCACCGTGTGCTGGGTGCCTAAGCGGGAGCTCTGGTGTCTCCGAGTCAGCGTTCACAAACCTCCATGCGTAGAAAGCCGGAAATCGGCGGCTACGTGACCTAGGTAACCTTAGGCCATCCCTTCAGTTGATGGACAGCGCAGTGGGGGGCAGTCCCCTGATCCGCAACGACCCACGTTCAGGAGGAGCTCCCGACTTTCGAGATCCCCACAGAGGTCGTGGCAGCCACTTGTTGGAATCAGTCCGTCGAACGGCAGGGGGTGACACGCAGGCCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGCAGAGGTGGAGAAATTGGCTCCTACAGCATCTACGACCGCGACAAGTCAGAGGAAGACGATGGACCACATCGCCGTGCCATCGCAAAGACGGAGAGTACAGCTGGTTCCCCTCATCGATGTTCGGACTTGACCACTGCTCTCAGAACGAAAGGACCTGAGGGGCATACTTACCAGGATGAATGGCAAAGATCGGCCCCTTCTATCCGCATTCGAGGACCCAACGCGACACGCGAGACAAAGGGCTGGCTTCGAACTCTCAGCCCTTAACAACAGGGGGCGATAGGTATGCAGAAAGGTACTGGCGAGCACCACCCAGCGAAGAGCAGCTGCAGACGGAGGTACAAAAGCCTACCAAAAGGCTCCACAAAGATGCGCGGTACCCAGTACGGTTGCGCAAAGGAATCCAGGCGCCGAAGCGAACAGCCCTACGTTGGATGGCAGCTTGGTGAAGCATCCATACCTAACGAGTCCAAGCCAGGCAGCTATGCATCTGTCGCCAAGAATGCTAGCGGGTGCAGAAGGCACTCATCATAAAAAGACAGGGGAGAGGCTTCGTACGCAGAGATGCTTCGGAAGCTAAGATCGGAATCGAGCCTTGTAAACTGGGCAGTCACGTGCGAGAAAATCCGGAGAACGCAGAAGGTGATCTGTTGCTTGAGGAGGTGGGGGGAAAGCTTCGGAAGCGTTCCCAAGTTTAAGAGCGACCTGGAAGCGGCGCTCAATGACAGCCTCTGTGCGCACAGGGCGCGCAAGAATTAGCTCTATCTTGCAGCGGATTGGACGAGGCTACGACGGCAGAAGCTCCACAGCTGGCGGTCGCCCAATTCAGGGCCTGCAGATAAATCTGAAGATATCGGGGCCTTCGCGGTATGCGGAATTGCAAACAAAATAGCCTCAGTGCTGCTGAACGCGAACGTTGCGATACCAGTCAGCAGGGCACCATAATCGTTGGATGTGGTCAAGATGTCGTATCACCCAGGGCGTCCGACCCACGAGATGCTACAGATTGTCCTC
->608a3d1b-2395-41a7-b8aa-e3ae3ae002fa
-TCATTGTGCTTCCGGTTCAGTTACGTATTGCTTTTTTTTTTTAGGAAATGCTCTCGAATTAAAATATTTATTTTGCTTATAAATTAAAAACAAATTAAAATATAGATATACAAGAAAATAAATAACAAATTCGAGTTTACACGCTTTTGGAGTTAAATAATACCAAACCGTGCATCTGGGATGAGCTGATGGATCCACCTCCCCGTCGCGACGTTTTGCCATCTGCTCTGCCATTCACTAATAGCCACTCGTGTGCCTCTGCGCACCGAACCACTCCGCAGGCTGAGGAGCCTTGATCTCAGATCAATCGGCGGAGCCTTGCCGGCTTCTTCGCGTCTTCGGATATGATGCGGATATCCTAATAGACACAGGGGCCATTGACCGTAGCACCGAACGAGCTCCCTTTCAGGTAGGATGGCATTGCTCCAGACGAAGATTTGGCAGTATAGCGGCAGAAGCCTTTGCTGCAAGCACCAGCAGTTTCACAATGGCAGGTGTCTTGGGCTCGAGCGTTGGGCATAAGCCTCGCTCGGCAGGATGGCTGCTGTCATTTCTTGCTGCAAGCGTGGCTCACGTGGTCGCGGGCGATGATCGCGATCCTATCCCGGGCGCTTTAGGGACTCGCAGGAGGGTCCCCTGAGTACCCGCCGGCCGGAGACCAGCACAATGTTCTCCATCTTTTTTTCCTGCTGCTTAGTGGGACTGCTACCAGTCTTGTAAGGCCGCTATTTAACTGTAGCCAGCTGCTTGATTTGCTTATCGTCAGCAGAGCAAAGCTGCCCTCGACAGCTTCTAAGTTCCTGAAAGCGCGCGGAAATCTAGAGCGGGCTGCCTCTGTTGGCCTCCAGTGGCGATGGCTCCCCTGAGTATGTAGCCAGGACCCCAGGTGTTCCGGATGGGACATATACTCGCCAGCTCGTTGGTAACAAGCATAGGCGGGAGCCCCAGATATCGCTGTCTACCATCCATGGCTCCTTAAAACGCGCTTGGCAGCCACGGTGCCGTGCGCGAACTCTAACGTTTGTACAAAGAAGCCTCCAGGTTCCGCGTGGCAGGTGCTACCCGCCTCTGGCTCGTTCGTTGCCACGTTCTCACCAGCTGGGCAATCAGACCGTAGTTGAAAACGGAGGCTCACCCGTGGCAGTTGGTTTGCGCTGTTGCCGCCATTTCCTTGGCATGGCGTCGCAGATTCTTCCCAGCATGTGTTTCGCGGGCCTGCCGCCATACTCTCTGCGTCCACATTTTGAGTTCCAGGGAATTGATCTGATAGGCCAGCGCATGGCCTCATCGATCTTCCACAATTGTCCATATTTTCCAATTTCTACTCCTGCCGTCTTTTTGGGCGTAATGCCCTCCAGGGGAGGAGGTCGGGGCGTTAAGCTCAGCGACGTCAGCGGCAATCATGGACCATCCAGTTGTTGTTGTCTACTGGCCACCTCTATACTTTGGCAGGGTGACATTAATGTCCGGGACGTACCCCTATCGTTTAATTAAACGTCCGGCTTCCGTCCATCGTTCCAGCGAATTATGAGGAGGTCCAACTTCGCATGGCGTCAATCACAGCAGCTCGTCCTCTGGTGTTGGATGTCCTGCCCCATTCCACTGTCCAGGCATTGAGTCGCCAGCAGCGATGGCCTTCCGGGCTTCGCCCTCGCGTCCACAGGCGCCTCCAGAAGCTCCTCAACGAACTGATCCAGGGTGTCGCTCGGCGGGCAATAGCAACTGTACATGTGCACGTGTTTTTTTAGCTACGCGCCAAGCGAAATTACGCTGGGTAAAGCGAAGCTGGGATTTCCTGGACCGCGGAAGAGCTGCAGCATTTGTGCTGCTTTACCTGCACTAAATCCAGGATCATGGACGATTGTCCACTACAGGGGACGGCTAGGGTTGCTTAGGAGCATAGTGTCTACGTACGCTCAACCGCAGTCTGGGCCCAGGAGGCTCTGAGCTGCTGCGCAGTATTGGTCGAATGGTTCTACGCTAATAGCAGGCGTGCATTAAGGTGGCTCTTAGCATCACCCCAGGTGTCGCTCTGTCCGGTCAGCGCAAGCTACCCGTCAGATTGGTTTCTTTATCCACCTCGCTTTCGCAGATAAAGGCACGGGTGCAGCAACGCGCCCCGCCCTTGCCTTATTGCCCACGCTCACCCGCACATCTAAAGACAACCCAGTCCTGCCCTGTCCAGTGTCCTTGCAGGTTGCTGATCGATCAGTACCCCATAGCCGGGAACGCACCTGCTTGGCATCTCATTGGGTCGGACGTCACCAGGTGATACGGCTTATCTTGACCATCCAGCGATTATGGTGCCCTGTTTGGGGACTGATGCGGCATTGCGTTAAACTGGCGCTCGCTACAGCGCAGTTCACGCATACGCGAGGCTATTCTTCAGGTTTTATGCGCGTTACCGGGTGGGCCGGCGGCGCAGACTTCTGTATAACATTAACCTCATCCAATCCCGCGCTACAAGATAAAACTATTCTTTACGCTCCTGGCGGGGCCAGTCGGTGAGGCGCTTCTTCCAAATTCGACTTCCGGGAACGCTTCCTCCTCGGCAAACGGTCTGCTTTCTACCGTTCTCCGGATTTTTCGCACGGTTCAGCTGAAACCAGTTTCGTCTTAGCTTCCGAAGCGTAACAGGTATGGATGTCGCCCTTTTCTTCACCGTTGCCATCCAACGTAGAGGTTACACTCGCTTCAGCGCCCTGGACAGCACCTGCACCGTAAGGTACCACCACTGGCCAAGACCTTTTGGTAGGCTTTGTACACCTCCGTCTGGGTAGCGCTGCTCTTCAAACGGTGCTCACTGGTATTACCGGCTGTCGCCTGGCAGGCGAGTTCGGGCTAAGCACGCCATTGTTGTGGGGTTAGATTGAATTCGTTGAGAGGGCTGCGATCGCGCGCCGTTTCATCCACAAATTGGTATGCCCCTCAGGTCCTCGTTCTGGAAACGAGGTCCAAGTCCGAAGACCGATGGGGGGGAATAAACCCCAGGGACTTCCCTCTGCATCTTTGCGTGCGCGTGTGATCATCGTCATTCAGGCTTTACCGTAAATTCGTTGGATAACGGCAGACGATTTCTCACGGCATCGCATTCGATGGCCGTCAGCGACGGGCTTCTGCGTTTAACCGCTTGCCCTTTTCGACTGGGACCAGAGATTCCGTCACCACATGGGTCAGGTTACCGGCTCCTCTGGTGGGGATCTCGAAAGTCAGGAGCTCTCCTCTCTGAACGCAGGTCGTTGCGATCAGGACTGCCCTGCGCTTCTAATCATCAACTGAAGGATAGCTAAGATTTTCGTTCATGCAGGCCTGGTTTCCCCACAAGCTTTTACCCGGATGGAGGTTTGTACCGCTACCTCGAGCTCGGACACAGAGCCTCTGCTTAGAGCACCAACCAGCACGGTGAGAGGATGATGTTTAGCCAGGTGTATCCCGCGACCTTTGTCGCCTTTTCCCCTTTCTGCCCGCTTGTGCGCCCGTTCATGATCTAAAATTAAATTAAATTCGATTTCAGCGGCCCAAATTTTAAATTTGAATTTTGAATTTCACCTACTGTCGCAACACAACTACTATTGATCACACACGGTTGATCTGGCAACGCCTCCCTCCAGATCGCGCCCGCTGCGCTATCTGGCTGTTTATCCGGCTGCGGCAGTCGCCGAGACGGCAAATTTTGTTTACAGGCTTGAGCACTGCCCGATTGGCTGCGTGATTTGCGGCGCAGGACGCTATAAGCGCGACTCCACCCGTGTGATTTTGCCAGTTTTTACGCACACCAGCCGGCCTTACAACTATGGTTTCGAGTATTTCGCGCCGCGCGTAATTACAAGACGATCCGTCTTCACGGCGATGTAGACGAAATTATGCGCACACCAGAGTTGAGTCATCCTAAGCCTGTGCGTTCAGGTTAAACTTTGGCAATACGGCAGCATTGGGTTTTGGGTCTCTTTGTAGCAGGTTTGCGCTTCTTTCGGTTCAGAAAATGGCGTTCTGCGTCTGGAATTTGTCAGCCGATTGTTTTCCACTATTGTAGAGTATGCACATATCGGTTTAAAACTTGCTGTACCTATATTGTATTCATAGTGTACTCTGTTGCGAAATTATGTACATAAACAGTCCAGCACAAGTGTATACGTAATGCAGGCACCCAGCGAGGGGCTATAGCCATGTAATTGCCTGGTCCAGCGGTTCTCCCCGCTGGCCAAACATCTGATCATAATAATGTGCGCCTATACCCTCCCTCCTCCAGCACCATCCCGTCGGCGACGTATATATAATACGTATATAAGATGCGCATATAAGCGTTGCTGCGCTGCAGGCTATATGCCGGCAGCGCTGCTCCCTCGACAGGCTAAAGAGAGCGCTTTGCAATAGATTCTTGGAGGGTTGGCGTTAATAATTTCAGATGGGCGGGACCTTCCCTGTTTCTCCGTTGGATCTGCAAATAAAGAGCAAGCTAAAACACAAATGATCTATGGCCTGAAGTAAGAGCTACAGGAGTTTAAGGTGGCGTTACTTCTGATGTCGGATCTGAATCCGCGCTTTATACTCAGCATCACTCTACAGCCGGACTGCAAAGTGAAAAAGCAGAAACGGTCGTTGGCAGAATTAAAATATCGTCACGACAGAATTACAGTTTGTCGAGAGCTGTTTACCGTAGAGGCAAGTGGTGCTGGATTTAACGAGTCAAAATTAAAAAGAGGGTTATTTACATGATTAAACGCAATTTTTTTTTAGGAAATATAATTAAACAGCTGGCTTTGCTTATAAATTAAAAACAAATTCAAAATGCCATCAAATATACAAATAAACAACGAATTCCAAGGGTTTAAACACTTTTTGGTACGAAACTCTTTACACAAATTTTCCACTAAAGCCAGTTTAATCCCACAAATTTTTAAAATTATTTTGTTAAAATTTGAAGAGTTGATGTTAATTATGACCCCCATTACCTTGGCTTTGGCTACAAGAGTTTATTTTTTTTTAGCATACCGATTGGTTGGTTTTGCTTTGGAATTAATATTCAAATAGGATCGCACCATCATGTGATTTTGTTGTCGTGTTTTAGTGCCCCTTTTTGCCACATTCTTCTTTAAGTAGGCCTGGTACCAATGGGGTTCCAGATCAGAGACTCTATAGGGGGGGGGCGTATATATCGATCACTTGCTTACCACAGTTATAAAAGACCGATTGCGTACACACATTTGCAACCTGCTATGTGTTTTGGGATGGTATTCGATAAAACTTCCAAAATTTGGCTTGGTGACGGACTGAATTTTCTGCTGGCAGCTAAGAGTTCCAGTTTTAAAATGTCAGATATTGCACGGCATTCCATAGATTCTGCTTTCGTGGAAAGCTGATTTGCCTCCATGAAGCGAGATACAGCCCAAATCATCACTGATAATTTTCCAAATTTGGTTATTTGGAATGATGTTTGTTTTTTTCTGCAAGCGCACTCAACGAAAGCTTGCGCCATACTCCTGCTGGCCCAGCATCGTTATAATAGAGCATCGTTTTGACGTGTTCGTTATTACGTCATCCAGTACTCTTCCGCGCCTTGATCCATCTCCACAGCGAATGACGCGCTTTTCTATAGTAAAGCCTCTGGATGGCAAAGGCTTGGCTTTCTGAGAGAATTACCTAGCGTATTAGAATGACTCCCGGCGCACAGTTTTGTAGTAGCTGCTTCAGATTACATTCTTTGCTGATATACGGTAGTGATCTGACCGAGAGATTCAGGGTTCCTGTGAAATCACTTTTCGCACATAATAAAGGGCGTTCTGCTAATTTTGGTTTTGCTTCCTCTTAGGTTCAAGCCTGTTCTCTTTTCAAGCGATTAAAGAAACGGCCCAGCAGACGGATCTTGCGGGTTGAAAGAGCATTTATCGCCGTTCGGAATGGGTGCCAACTACCGGTGGTTTTGGCCATATTATTTGGAGGTCCACTTCAAAAGCTAATCTATTTCCAGGCATTTATCAAATTTAATAGCTCATTCGATCAACAAAAGATTTCACAAACCGTAAAAGAAAGGAATTTCAAATGAAGCTGATTTGGCAGCAAAGGATGCAAATTACCAAAAGCCGCTGGAAAAAATCAGAGTTCTACGTTCTAAGAAAAGAATAGCAGAAGACTTAGATGGAAAGTAAAGTAACAGGAGGTTTCTTGCCCTCCTCAAAGTTAGTAGCAAACTTAGGAATTTGTTGTTTAATTTCTTGTATATTTGATATTTTAGATTTTAACTTTGAATTTATAAGTAAAATGTGTTTAATTCTCTTTCATTAAAAAAATTGCGTTTAATTAAAAGAAATAACCCTTTTGACCTTTCAAAGAGTATGAAAAATTCAACTTATTTCACGGCGTGTAAATGGTTTTCTTGACAAACTGTATATATCCCTGGAATTTACAAACTTGCCTTTGGGTTTCATCTGCAGATTCATTTACATTGAAATTGGACTTTGACTCTCAGAATGGAATTGACCATTTATATTCTTAGATTCGGACTGACGAGGAACCAGACTAAGACTAACTAAACTAATATCATTTAACTAGAATTTAATTAAGTTTACTGATGAATTTTGAGTTTCTTACAAAGATGACTAATATTAATTTTGGATTCAAAATAGTTTACCGACTTCGTTTATATAAATAATATATTTCAAATTGGTCTGGTTGGTTTTTTAACAGATTCCCAACACCTCACAGCAGATGCTGGATCAAATTATTCGTGGAAGGACGAAGTACGCACAGTCGTGAGTAATAAAAATTACCTTAATCTGCCTTTTATGAGTGGCGTGGACCATACATTTTAAGCAAAAGAAGTCCACATGGCCGCCATCAAAGACACTGGGAATAATAAGATGCGTAACAGCCATACACTGGTTTTGGCACTAATACAGCCACTTTTTTTTGAGTGACGGCCAAAATTGCTCTCGCTCACGCTGAGCGTAAGAAATCTAAAATAGAATTTGCTTGCTTGTGCTTGAGAATTAAGAAACAAAAGACGAACGCGTATATATTATTGCGTGTTGTGTGCTAGAAGGCGATTTTCGGGGTGAAGAATGTTCAGTCTGAAAGTGATAACAGATTACATATGTAATACATACATGTTGGGGGAGTTTGGCCAATTTCGTAGGAATATGATGGGAATTGCGCGCTGTTTAAGATATCAAGGGTGGAATATAAAAAAAGGAAGAAGAAAGAGTCCATTACACACTGAGAGAAAAATGTTCAAAATAGTAATACAGAAGTAGAAATAAAATTTATAAAATAAAAAAATGTTAACAGCGCTGGCTATGACGTCATATCAGTTCAGTTAAGCTACCAGTCATCTTTTGCTTTGCGGTCATATCTTGCCCAGGGCGGAAGTTGGACCCCAAACACTCAACAATCATTGTCTTCTTAATGCTCAAACAGAGCGGCCACCGACCCGGACCCTAACTTCTGGCATGGAAATGGCAGAGAGTAGAATAAATCCAAAAAGGGCCAAGCCCTCCAGTTCGAAAACTACCAGGATTCCCTGGACAATTCATCAGAGCTTGGCACCAAAATAAATTTCAACTCTCTTAAAAGCGGATTTTGACAAGGCAAGAACTTAGTATAACTGAAAAAGCAGGAATCTCAAGTGATGAAACAGGAGACGTTGCAAACTGATTTTCAGCCCACCTATCTTTCTCTCAGCGTGTTGGTATAAGTGAAAAGCTAACCTATCTTAAAACTAAATTAAGAGAGGGAACTTTATTACTTAGACTCAACGTTATGGACGTATAGAGTAATAGTTAAAAAGTGAAGTTAATTGATTCAGAAACTTACTTAATAATGATTTATGTACCCTTATACCAAGCAAGGACTGACGGGCGTTTTAAGGTTTTATTGTTAGAATTTGCATTTTCACCTTGGAATTTAAGATGAAATTAAAGTGATATATTATAGAAGAGTCAAAGGTCATGTTTATTTGAAACATAGTGATAACAAAGCCATTACGACCAAAACGTCACACTGAACATGGCATGGGATGACTGGGGACCTAACAAAAAAAAACCTAGACATATATAGTATGACTAAAATGTTAGGCCTCCCCACAGTAAAATCGTTCAGTATATGGCTACTAGGGTTTCGGACATACTAAATCCATATTGTACAAGAGCAGTATTACCCGCTTTGTAGCAAAGAATCTTTATGAACTTTTAGTAATTTGCCAAAAAAATACAGAACAACCGGCCGTATTGCTGGCTTCTTTTCTTCAAAGAAGAACACATATGCTTCTAAAGGGTGTAATTTATCTAAGAACTCTTGTCCAAAAAAATAGAAATAGAATGACCAGTCCTGAGTAAAATGATTTGGGAGATCAGCAAAGAGTTTGTTCCGCCCTATTTTGAGCTGGCATGCGGCATCAGGATGGAATGGGTGTGGTGGGATGAAGCAGGAAGCCAAGAAGGCAGACACATCACTGGAGAGAATGAGCGCCTAATAGGAAAAGCAGTCTGGAACTTACAAATAATTTACTTAACATGATAATGTTACTTATAAAATTATGCAAGTAAAATCCTAGCATGGGAATGTGGAGGCCTTGTAGTAGTTAGAGGTGACTGTGCTAAAACACTTCCGAGGCAGGCTTCCTGCAAATGCATAGTAAACAACAGCATACTTACTTCAACCCAGCCACAGGCCCTTTACTGGCCTGCCCAGTAGTAGAATGAGCTTAACCCTTTCACCCCAACATTTAGCAGAGCAGATTTCTATGTTTTCCAAGAGCTAACAATAGAATTGTGCCTTTGTTTTATCTAGTTCTTTTGTCTGTGGAGTGCTTTTATGTGTCTCTACTCTAAATATAAAACAAAAAAACATTTGGAGGTGGTGTTACTGCAGAAGATTATTGCAATAAATAGCGCGCATCACAATTATTTTGTTTAATTCGTTGCAACTTTTGGAATTATTAATTTACTGTGCTTTAAAAGAACCTAAATTATACAACAACCAAGGTTAAACAGACAGTGATTTAGATCAAACTTAGTAAGTAGTGAACAATAAGTAGTAAATAATTTTCCTACAGAAGTTGCTTATGAGCAACAACAGGCATTCATTGATAATAATTTTCCACCGAAGAGTGAAAGGTTTGTCTAACAGAAAGAAATTAAGACAGGATTTAAACTTCAGTTGGGATCTCTCACAGAATGAAAGTGGTGAGGAGATGAAGAGACATTTCTACACGGTACTGGAGAAGGAATTTAGAAGGAATTCTTAGCAGAAAGGGAGAAAGTATCGACAGTGATGACCTTCTGGAAAAGAAATACAAATTGGTGCAGAGGATGTAGACCACAGCTCTTGCATTGTTATTTGTGATTTGCTTAGAAAATTAGTCAGAGGCTAAAGTGGAGAACAAGTAGATTTGTAGCTCCAGAGGTATTTGGGAAGATGATAGTAAAAGAGCTTTTTGATGTCAGGGGACATGGGGCTTGAGCCAAAGTGGGAGTTCTTCTACTTTTTTTGATACTCAAGCTAATTCATTTTAATGGCTAGGCAAAACTGATATACAGTCATGAGGTCAAAATTAATTTCCACAAAGAGTGCATTTTTTTTTGTGCATGGGTCACAAAGCAATGATTTAGCATTACATGGGGAGTGGGGGAGGTGAAATACAAAAAACTTACTTTGCAAATTCAAAACCTATACAGAGTCAGATGAAAGAGAATTGGAAAAATAACTGGTATTCCTATATACGCAAAGGAAGGCGAATGAAGAGAGATCTTGTCGTTTGTGGAAGGTGTTTTGCACACAGTTTCAAATCGCATCAGTGTTTTCACAGCACCATTTCTTCTTCAGTAGTTGGTTTGGGAGTAACCAAGTGCCAGGACATTTTGCTTAAATACATTTTAAATTCATTGAATAAAAATTAGATTTAATCATTTCCCTATACAGTTGTAAATAAAATTGAAACAAAAGAGTTAACAGTTATGAGGGCCCAGCGGGCTGGTATTGTTGCTAGGTTTAAAAGCCAATTTTACTGCAGCTGAAAATAGCTGAAATATATCAAATTTCCAAGTATAGAACTATCTACTACTTAATAAAAAAAGTTTGATACAGTTGGCACATTAAAAAAATAAAAAAAAGATCAGGCCGAAAACCTGTATTGTGTGCCGGACCCAGGCAATGCAGGCAAAATACTTGGAGTTGGCAGAAGAATCCTAAGGTGATTGATCCAAATTAAAAATTGCCTTAGAATCAAAAAATACAATTAGCAAACAAGTTAGAGTAGTTCTAAATCATAGGCTAAAAGGCTGGGTTTAAGACATACTTTGTTCATAGGAAACGATTGAGATCCACACTAATAATAACAAAGGCAAACATCTTTCAATTTGCGTTGGAATATATTCTACAAGAAGCCTCTTGACTTTTGGTTTTAATATTTTGCTGGGCTGGTGATTGTAGACAATTACCAGGGTCCTTTACAGCAAGCATTTTATGCATTTGAAAAAATAATCAAAAGCATTTGGCAGCCAATTATTAATAGATTTGGTGGGGGGCACAGTCATGTTTTGGGGATGTCTTTCCCTGTGTAGTTCGGAGACTTGGTACGCAGAATGAGAGGTGCCTTTAAATCAGAACGGATACCTTCTTATCTTAAAACAAAAGCCAGCATGCTTTTACGTCTGGAAATAGACTTTTTTCCAACTACTGGATGGTTCTTCTAAATAGGACAGTATATTGCCATAGGTGGAATACCAACAGAATTTTGAAAACGACCTTAATCTGGCGGTTCATGGCCCCCCAAAGCCCAGCAATATCACATTGAAAACGTTTGGGCTTTTTTATTAAGGCTCAACGAACTAGCTTCCAAGTACTAAAAAATAGAAAGCAGGAGGGCATCAGGCTAGAGCTAAGCGGAGATTTGGTCCAAATTATTGATAGAATTTACTGAAGCTTTGGTGAGTCAATACCAAAGACTTCAAAGCAATTCAATTAAATTTTCAAAGGTGGTGTACAAAATATTAGTGGCCATGTTTATAAAATAAAAGAAATTCTTATATGTTGAAATTTAAGATGTTAAGCTGAATTTACTAAATTAAGTTGAGTAGAAAATACTTTTTTGAAGCACCAAATAAACATGTGAAAATACTATTGACAACTTGCATATTTTTTTCTTTTTTGGCTTTAAGCTGCCACTAGACTATTCATCTTTCGAGGTATTTCTTTTCGGCTGCAGCTGCATAGATCAAGCTAAGCTGATAGGAGCTAACAGAATCGAGGACAACAAAGGAAGAAATATAACAAAGGTTGAAGTTTACCAAATATTGTGCGTTGTGTGAAATACTTTTGACCACCTCACCTTGTATAGCATATATATAGTTTGCAGGGCAGCACGGTGTGAACCCAAATGTACTGATGGGGAAATCAAACATTTGGCGTTTTGTTGTACTTTGGTGTTTAAGAGCTACTTGATTCAAGAATTGATAGTAAGATTACCGCAATACTTGAGTTGTTGCGTTGGAGGTTTGTAAAAAATAAAAACAATGCTTACATTTCAACGACAACGCCAAACAATTAAAAGGGGAGTTACAGCTATGATAAACTCTACAAGATCCGCCCTTTGCTCCAGAATTCCTCAAAGAAATTTTGGGAGAAGAGCTATGGGAAAGGCATCAAAGTGTCGATGTTCGAGGTACGTTTTAATTTTCTTTTTAAATTAAACTTTGGCCCCAATAATTTACCTTGCTTTTGTTGCAGGTCAGATCCCTTAGGCAATATAATCCAAACCTCATGACTGGGATGTGAATGTTACACTTGGGCTGGAATATCTGGATTAGTTTATGATTTTTACGCGCTATATGGAGAGGCCTTCTCCTTCTCTTATAACCCAGGAATATCATCTGCTTATGTTATCTTATATTTGGCAGAAGAGAAGTCTCTTGAGAGACGAAATTTCTAATATTTTGATGAATTGGTTTACGTCTATAATCCTTCTGTGATTTCGTTGGAAATAGGAATCTTTTGCAACAGGTACACTGTACGTATGATAAAGTTAGACATTGGGTAGTTTTGGAGAGGACGTTTGCAGACTGTGCAAAATTGCCAGCACCGATGACCAAATGCCACATGCAAAGGGTCATCATAACACCAACAACAATAAAACTGTTTTTTGTCACACCAAATTGTGTTATAAAGAAAAATGTTCCGCCTTCTACTTGGATTTATAAAAAAAAACAATGCTTACACATCACTGCCCGACGCGTTGCCTTACCGAGAAAACTTTTTTGCTACCGCCCAAAACTAATGGGCGTGGCATACCTAAAATTATAAATTTTCTAAAATAAATCATAAAACATTAATGACAAATTTCCGGGATGAAGTTGGGCGCAGAAGGGTTAAAAGACTTCGTAGCATACTTTGGAATCCCAAGTCACATACGAATAATGGAAGTTTGAGTCCAAAGCTCAAGATCATTTCTCTAATAATAGTGACATGACACAATTTACAGTATGGCGATATCTCGCGCTAAAATCAGGAGGCTACTGTGGGGCTACTCACAAATATCGAGATCCGTAAAACGAGTATATGCACGGCTGCCAGCCAAGAACTCACGATCAAATCAATATCCTCTCAGCTGTGAAGAATCATTGTTGCTGAGATTGCATTAAGAGATGGCAAGAAACTCTCTACCCTACCGACAAAGATCATTATAACAAGGGCTGCATCAGTCACGCGAAGAGCTGTAACTTTTTAAAGAATTAATCCTCTCGCTAGATATCTTTAGAAATCTAGATTCATTCTTGTAACCACGAACTGGTTTGTGGGAGTAATATATAAAATATCCTCAAAGGCGACCTGCAAAAGAAACACAGTAGTCCGAAACTCTAATATTGGCAGACTGGCTGGTCATTAGGCCGGTTTCAAGCCAAAGCTTGTTGCTAACACCTGCACTCTATTGTGGTAAGGCTGATGACCTTTACAAACCCAGAGAGTAGATAGCACCGAGGAGTCCACCGCCAGTGAGCTTACCCATTCGTAAAATCCAATTATTAAGTGATTCACAATGAAGGCTAATGCAAAAAATTAAAAAAGGCTCCAGATTGGGTTAGTGGATGGCCTTTAGAAAAAAAAAAATGGGCGGTTAGAGTTCCGAGCCACTTCCCAAACTAGTGATAGGAAATGTGCAGAAATTATAGGAATCAGCAAACCAAAACAAGGCGAAGGCTGTTGACGTTGTACCGTCCGGTTTGTTGTCAATATTTTCTAAAAGTAGCTAAAAAAATAATTTTCACAAAAGAGAATGGTATTTGGCAATGTCCAATCTTGGAAAGATTCGCTATCATACCCAAAGGCTGGTTGGATTCGGAAGAGACCACACGGAACCCTGAACGTTAGGGTTAAAAAAGTAATTTCATCAGCATTTTGAGGAGCAAAAATACGCTACTAGAATTTCTTGACGTTTTAACTCTCGTTGATCCGGAGTCTGTGAGCATGTATAAAACCATATTTTATATATTAAACAGAGTCATACTTAACTGACGAACAATTTTATTTACAACAAAAAAATGAATACCATACTTTATAAAAACTGGAATTCCCACAAAGGGAAGGAAAGTGTAGTAACTATCCTTATACACCTGGCAGCAGATGTCGCGCAGTAGCTCAAATCTGCCTGTAACAAATTAATTACAGCTATAGTAGCTACAAAAATCACATCTAAAGGGAAGCCTCCAAACCATACCAAGCAGGGCTGCACATATTGACTGGTTTCTTATTTGGAAAATTAAGAGTCAACGCCTTCGATCTGCGCAATAGCTTTTGCATTAAGAAGGGTAGCTGAAGTGTCATTTAATGGATCGTCCACAGATATCGATCATAGGTTAACGTGGAAACCACATGGCATGAAACAAGCTTGTAGCTAAATCAAAAAAAGTTTGAGAGAGATGGCCTGGTTTAGCTGGCCAGAAATCTCACCAACCACTCTCTGGAAGAAATAAAATCCCGTTTATACTTCTAAAGCCAGTGGACTTACTGGCGTAGCTTTGGGGGGTGCACTATAAAAAGCAACTCAAATGTGTGACATTGAGGATTCTACATTCCTTAATCAAAAATGTGTGAATAAATTGTGTCTCCATTTTATATTTAATTGCAGATATCTGAACTGAGGAATGCATAATATTTAAAAGAAGGAAAATAGCAAAACCGCTATTAAAAGAAATGTATGAACTAGATAAAGGAACCACATATAACTTAGTATAGAGTTTGTTGTCGTATGCTGTGGAGACTTAAAGATTTCACATTTCAGATCCTCCCCGACCAGTTTTAAGTATATTCGGCTTATGTTATGAGTAGGGACTGTATATATAGTAAAAAAAGTTAATGGATAACTACTGCCTCTAATAATTAAGATTGAATTATAAAATTTACTTGTCGCCACTTTTTTTTTAAGACAGATTGTAAATAAAAGAGAAAAAATAGTCTAAAAAATATTTGGGAATTTATTTTGTGATATTATGATTCAGCTATTACTATTTATAAGCTATATTTAAAATGATGGCAACATTCAAGGCAAGTACAAAATAAAGATTTCTCACTTTATAGTTGCCAATTGATTAGAATAAAATATAGATTTCAGAGTCTAAGGAACTTCTAAAGATTGAAGGGCATATTTTACATGGAATTTACATTTAAAATAATAATTCTGGCTGTACCAGCGTGCTCATTGTATTTGGTTTCAGGCATTTCTAAAAAGGAAATGAAAAGGACATGGCCCGGTTATTAGCAGCTGGTAACAGCAATAATATCAATAATATAAAAGAAAAATGTTCTGCTTCTGAGCCCACACAAAATGTCAAATCGACAATGCATTAGCCTTTTTATATTTGAAAACGGATTTACAAAGTAGTATCTATTTAAAAGGCAGACTATGAAGTTTGATACCCCATCATCCTATGATGTTTCTTAGTATAAACTAAAACGGTTAGGCTACAACAACTCTTAAACCACACACAACTTCGCGGATTCTTGAAGTAATTGTAAGAACTTTCCAGGAAATACCAATTCGATGGAGATGCCAGTTAATATTTAGCTGTGGATCTGATGGATCAGCCTTGGTCGAGGTATTTGTCAGCTTAACGTTATGAGGGGGAAATCAGTGCTGTATGCTTGGTAGGCCTGCTCCTTCTACCTTTCCTTTACTCTTTTGCACATTCCTAGTCTTTTATTTTTCTAATTTGCCATAATGACCAATCCTAGTCCTTAGAAACTTATACACATTCCATACACCCATCCTTACTATACTTCACATACATACAAATGTATCAGAAACTTATCAGACTGATTCTGACTCCTTCCTCTACAGGGAGGCAAGCACATGTGGCACC
->97e3bf38-ee83-43d1-90ef-8e6fb5d08b25
-TTTTACTCGGTACTTCGTTCAGTTACGTATTGCTATAAAGTGATTCAGATCCGACATCAGAAGTGGACCGCCTACCAACTTCTGTAGTTTCATTTGTGTCATAGATCATTTTGTGTTTTTAGCTGTTCTTTATTTGATCCAATTTGAGGAACAGGAAGGTCCCTTTCCATTCGAAATTAATTCGTCAATCCTCTTATGATCTACATACAAGGTTTCTTAGCCTAAGTCGAGCGCTGCCGGCATAGCCTGCAGCGCAGCAACCTTATATGCGTATGTATATATATGTATATATATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAGGAGTGGTATAGGCACATATAAGCGATCAGCGCTTGTAGCAGGAGAACTGCTGACCAGGCAATTATGTATGTTAGCCCTCAAGTGGGTGCTCGTATTACGTATACACACTTGTGCTGGACTGTTTATGTGTACACATTGCAGCAAGTGCTACAATTATGAATACACACAGGTACGGTGCTTAAGCAAGTATGTATGCATACTACAATGAGTGAAAACAAGATTTGTGACAGTTTACAAGTCACCAGAATCGCCATTTTTCTGAACTGTTAAAAGTGCAAAACTCACAAAGTAAAAACTCAATTGCTGTCGTATTGCCCAAAGGTTTAATCCTGGGCACTGGGCTTAGACACTCAATCCTGGTGCGGAGACCAGAGTCTACATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCAGAAATACTCGAAACCATAGAAGTTGTGTCGGCCGGTGTGTGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCATAGTTCTGCTACCCAATCACGCGAGTTAATTGTGCGCCTGTTTCATGTAAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAACAGCTGATAGCGCAGCGGAGGCGATCTGGAGAGGGCGTTGCCAGATCAACCGATGGCCGATCAGTGTTGTGTTGCGACAGTAGGGTACCGAAGTTAAATTCAGAATTTCAGAATTAAGCCGTTGAAATTTAATTTAATTTAATTTTGATTCTGGTAACTGGGGGGGCGCACAAGTCTTTTAGAAGAGGAAAAGGCACAAGGTCGCGGACAGACCAAATATAAATTACTCACCGTGCTGGTGCCTAAGCAGAGAACTCTGGTGTCGAGTCGAGGCGGTACAAACCTCCATCCGTAAAGCCGAAATCCGTGGCCTGCATTGACCTAGGTAACCTTAGGCCATCCTTCGGTTGATGGACAGCGCGGTGGGGGGCAGTCCCCTGATCGCAACGACCGTTCAGGAGAATCCCCGACTTTCTCGAGATCCCCACCAGAGGAGTCGGTAGCCAGCCCATGATGACGGAGATCTCCGGTCCCGTCGGTGGCAAGGGGTGAGCACGCAGGCCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGAGGTGGAAAATTGAAACCTACAGCATCTACGACCGCGACAAGTCGAAGACGATGGACCACATCGCCGGCACCGCATCGCAAAGACGGGAGGGAAGTCCCCAGCTTGTTCCCTGTGGTCTTCCGGACTTGACCACTGCTCTCCAGAACGAGGACCTGGGGGCGCCACTTACCAGGATGAATGGCAAGATCAGCCCCTTCTATCCCGCATTCGAAGTTAACGACACACATGAGAGACAAAGGGCGCAACTGCGAACTCTCAGCCCTTAACAACAGGGCGATAGAGGCTGTACGAAGGTACTACTAGCGAGCACCGCTTGAAGAGCAGCTACAGACGGGTACAAAGCCTGCAAAAGGCTCCACAAAATGCGCAGGTACCCACGGTGCAGGTGCCAAAGTCAGGCGCCGAAACAAGGCAACCCTACGTTGGATGGCAACGGTGAAGAAAAGGCGACATCCATACCTAACGAGTCCAAACCAGGCAGCTGTATCTGTCGCCAAGAATGCTAGCACGGGTGCAGAGGCACTCATCGTAAAAAGACGGGAGGGCTTCGTACGCAGAGATGCTTCCGGAAGCTAAAGATCGGAATCGAGCCTTAGCGAACTGGGCAGTCACGTGCGAAAAAATCCGGAGAACGCAGAAGGGTGATCTGTTGCTTGAGTGGGGGGAAAGCTTCGGAAAGCGTTCCCAAGTTTAAGAGCGACCTGGAAGCGGCGCTCAATGGCAGCCTCTGTGCGCACAGGGCCTGAAAAGAATAGCTCTATCTTGCAGCCAGCGGATTGGACGAGGCTACGACAGCAGAAAGCTCCACAGCTGCTTGGTCGCCCAATTCAGGGCCTGCAGATAAATCCTGAAGATATCGGGGCCTTCGCAGTATGCGGAATTTACAACAAATAGCCTCAGTGCTGCTGAACGCGAACGTTGCGATACCAGTCCTTAAACAGGGGCACCATAATCGTTGGATGGTCAAGATGTCGTATCACCCAGGACGTCCGACCCACGAGATGCTACAGGTGTCTCGGCTATGGGCATCGATCAGCAACCTGCAAGGACACTGACAGGGCAGACTGCTGTCTTAGATGCGGTGAGCGTGGGGCACAAGGCAAAGGGGTGCGTTGCTGCACCAAATGCCTGATCTGCAGCAGCGAATTGGACAGAAACCACCGACGGGTAGCTTTGCGTGCCCGACTTACTGAAACGACACTAAAGATGCCAAGAGCCACCTTAATGCACGCTCATATTGGCGTAGTACAGCTCAATGTCAATCATTGCGCAGCAGCTCAGAGCCTCTGGCCCAGACTGCGGTTGAGCGCAATGTAGACATCATGCTCCTAAGCGAACCCTACGTCTCTGGTAGTGGACAATCGTCCATGATCGCCCGACGAGGCAGGTAAAACAGCTATCAAATGCTGCAGCTCTCTCAAGTCAGGAACTGGCTGCTTTACCCATGCAGGGTATGGCATGCGAAGTTAAAACACGTGCACATGTACAGCTGCTACGCTCCGCCGAGCGACACCCCGATCAGTTCGAGGAGCTTCTGGAGGCGCTCGTGGACCATGCGAGAGGGCAAGCCCGAAAGGTCATTACCGGCGACTTTAATGCCTGGACGGTGGAGATGGGGCAGCAGGACATCCAGCACGAAGGACGAGCTGTGATTGACGCCATGCGAATGCTGGACCTCATACTGCTGAACGATGGACGGAAGCCGACGTTTAACAACGATAGGGGTACGTCCTTTATTAGGCGTTACCTTTGTCAGCAGGGCTAGTAGACAACAACAACTGGATGGTCCATGACGTCATGACGCTGAGCGACGCGCTGTCTAAACTACTCCCGGAGTGTATTGCAAGACGGCGAGTAGAACAGCCGGAAAACATGGGACCTGGAGATCCGATAGGGGCCGTACTTTGGCCCCTACATCAGATCAATTCACCAAAATCCCAAATGTGGACGCAGAGAGTATGAGCGAGGCCTCATGAATATGCTGGGAAGAATCTGCGACGCAATCATGCCAGGAAAATAAGGCACAGCGCAAACCACCCGTTTACTGGTGGAGTGCCTCCCCTAAACCAACTACGGTCTACCCAGTTGCCTCAGGGCTAGAGAACGGCGCAACGAGCCAGAGGCGGTACCACCACGCGGAACTCTTGGGGCTTTCAGAAGCAAACGCCTAGAGTTCAAGCACGTATCGCGGCTGCCAAAGCGCGGTCGTTTAAGGAGCTGCAGGATGGCGTAGACAGCATCTGGGGCCTCGCCTGCAAGCTTGTTACCAACGAGGCTAAGGAGGAGCGGCAACCCCATCCGACCCGGGGGTCCTGGCTAACATACTGGGGAGCTATTTTAAAGCAGACCACACTGGAGGCCAACAGAGCCCTGCCCCAGATTTCCCGATGCGTCCCACAGAACTTGAAGTCGTCGAGGCAGCTGTTTCACCGTGACGATGGCAATCACAGCCGGAGCTATGTAGCGGCTCACAAGACCGAAGCAGTCCTACTAAGCAGCAGGAAAGATGGAGAACATGCTGGTCTCCCGTCAAAGGGGTACTCAGGGGACCTCTCAAGAGTCCCTAAAGTACCTGGGGGTAATAGATCGCAGACTATCGTTCGGGACCGCGAGCTACGCCAGCAAGAGACAGCAGTCACATCCTCTTCGTTGGCGGGGCTTGTGCCCAACGTCGGAGGCCCAAGACACCCGGCCAGGAAACTGCTGGTGTCAGTAGCGAGCTGCTGCTATACGCTGCACCAGTCTGGAGCAATGCCACTTGCAGGGTCTCATACCTGAAAGGAGCTCGTTCGGTGCTACGGTCCCTATTCAATGGCCCTCAGGCTCATTAGAGGGATTCAGGACCATATCCGAAGACGGCGCTGGCGCTGGCAGGCCTGCCGATTGATCTGGAGATCAAGGCTCTCAGCCTTATGCGGAGTGGCGCTTCCAGGCAAGAAGGCACACAGTGGCTATTAGGTGAATGGCAGAGCAGATGGCAAAAGCGTCGCGGAAGGCAGGGGAGGTGGACCTATCAAGCTCATCAGAGATGACGGTTTGGGCAGAGTGACACTCTCAAAGTGTGTAAACTTAGATTTGTTGTTATTTTTCTTGTATATTTGATATTTTGAATTTTGTTTTAATTTATATAAGTAAAATAAATATTGTTTAATTATATTTCCTAAAAAAATTGCGTTTAATTAAGTAAATAACCCTTAATTTTGACCGTTAAAATCAAAATTCATCTTATTTCACGGTGTGTAAACAGTTTCCTTGACAAACTGTACTTGTCGCAGATTTATTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTGAAAGTGATGCCGAGTATAAAGTGATTCAGATCCGACATCCAAGTGGGACCGCCTACTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTGTGTTTTAGCTGTTCTTTATTTGATCCAATTTGAACAGGAAGGTCCGCTCCATTCGAAATTAATTCGTCAATCCTCTTGAATCTACATACAAAGGTTTCTTAGCCTAAGTCGAGGAGCAGCGCTGCCGGCATAGCCTGCAACGCAGCAGCCTTTATAAATACTATCTTATATATATGTATATATATATGTACTGTCGCCAAGGCGATGGTGCTGGAGGAGGAGTGGTATAGGCACACATATAAGCGATCAGCGCTTGGCCAACGGGAGAACTGCTGACCAGGCAATTATGTATGTTAGCCCTCAAGTGGGTGCTCATACGTATACACTTGTGCTGGATGATTTGTATGTACACATTTGCAACGAAGTGCTACAATTATGAATACACATAGGTACAGTGCTTAACCGATATGTGTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTAGAATGCGAATAGCCATTTTCTGAACTGTTGTTAAAAGAAGTGCAAAACTCACAAAGGGCCAAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCTGAACGCACAGGCTTGGAGCCTCTCAATCCTGGTTGCGGAGACCAAGTCTACATCGCCGTGAGACGGACGTCTTAGAATTACGCTGACGCAGAAATACTCGAAACCATAGAAGTTGTGTCGGCCGGTGTGTGCGGCAAACTGGCAAAATCACACGGTCGCGCCATAGTTCTGCGCTGCAATCACGCGAGGAGTTAATTGTGCGCCTGTTTCATGTAAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAACAACTGATAGCGCAGCGAGCGATCTGGAGGGAGGCGTTGCCAGATCAACCGTGTGATCAGTGTTGTGTTGCGACAGTGGGGCGCGAAATTCAAAATTAAATTTAAAATTAAGCCGTTGAAATTTGAATTTAATTTGAACCACGATTCTGGTAACTGGGGAGCGCACAAGTCTTTAGAAAGGGGAGAAAGGCACAAGGTCGCGGACAGACCAAATATCATCTCTCACCGTGCTGGTGCCTAAGCAGAGCTCTGGTGTCGAGTCGAGGCGGTACAAACCTCCATCCGTAAAGCCGAAATCCGTGGCCTACGTGACCCTAGGTAACCTTAGGCCATCCTTCGGTTGATGGACAGCGCAGTGGGGGAGCCATTCTGATCGCAACGACCCGTTCAGAGGAGCTCCCGACTTTCGAGATCCCCACCAGAGGAGTCGGTAACCCGACCCATGGTGACGGAATCTCGGTCCCGTCGGTGGCAGGGGTGAGCACGCAGGCTAGCCGCCGTTGAGCTATCGACTGCAGCGATGCTGTAGAGGTGGAGAAATTGGCTCCTACAGCATCTACGACCGCGACAAGTCAGAGACGTGAATGCACATCGCCGTGCCATCACCAAAGACGGGAGGGAAGTCCCAGCTGGTTCCCCTCATCGGTCTTCCGGACTTGACCACTGCTCTCCAGAACGAGGACCTGAGGGCATACTTACCAGGATGAATGGCAAGATCAGCCCCCTTCTATCCGCATTCGAGACCCAACGACACACACATGAGAGACAAGGGCATGGCTTCCGAACTCTCGGCCCTTAACAACAGGGCGATAGAGCTGTACGAAGGTACTACTAGCGAGCACCGCTTGAAGAGCAGCGCTACCCAGACGGAGGTACAAAGCCTACCAAAAAGGCTCCACAAAATGCGCAGGTACCCACGGTGCGGGTGCCAAGATCAGGCGCCGAAGCAGAGCAACCCTACGTTGGATGGCAACGGTGAAAAGGCGACATCCATACCTAACGAGTCCAAGCCAGGCAGCTATGCATCTGTCGCCAAGAATGCTAGCACGGGTGCAGAGCACTCATCGTAAAAAAAAGACAGGAGAGGCTTCGTACGCAGAGATGCTTCGGAAGCTAAGATCGGAATCGAGCCTTAGCGAACTGGGCAGTCACGATGCTGCCGAAAAAATCCGGAGAACGCAGAAGGTGATCTGTTGCTTGAGGTAGGGGAAAGCTTCGGAAAGCGTTCCCAAGTTTGGGGAAGCGACCTGGAAGCGGCGCTCAATGACTTGGCCTCTGTGCGCACAGGAGCGCAAAGAATAGCTCTATCTTGCAGCGGATTGGACGAGGCTACGACAGCGAAGCTCTAGCTGCTTGGTCGCCCAATTCCAGGGCCTGCAGACCAATCCTGAAGATATCAGGGGCCTTCGCAGTATGCGGAATTGCAAACAAATAGCCTCGAGGTGCTGCTGAAGACGCGAACGTTTGCGATACCAGTCCTTAAACGGGGCACCATAATCGTTGGATGGTCAAGATGTCGTATCACGCAGGACGTCCGACCCACGAGATACTACAGGTGTCTCGGCTATGGGCATCGATCAGCAACCTGCAAGGACACTGACAGGGCAGACTGCTGTCTTGGTGCGGTGAGCGTGGGCACAAGGCAAAGGGGTGCGTTGCTGCGCAAAATGCTGATCTGCAGCAGCGGGGTGGACAGAAACCACCCGACGGTAGCTTTGCGTGCCCGACTTACAGAGCGACACTAAAGATGCCAAGAGCCACCTTAATGCACGCTCATATTGGCGTAGTACAGCTCAATGTCATCATTGCGCTGGCAGCTCAGAGCCTCTGGCCCAGACTGCGGTTGAGCGCAATGTAGACATCATGCTCCCTAAGCAACCCTACGTCTCTGGTAGTGGACAATCGTCCATGATCCTTGACGAGGCAGGTAAAAGCAACTATCAAATGCGCAGCAGCTCTCTCCAAGTCCAGGAACTGGCTGCTTTACCCATGCGGGGGGTATCGCTTATGCGAAGTTAAAACACGTGCACATGTACAGCTGCTACGCTCCGCCGAGCGACACCCCGATCAGTTCGAGGGCTTCTGGAGGCGCTCGTGGACCATGCGAGGAGGGCGAAGCCCGAGGTCATTACCGGCGACTTTAATGCCTGGACGGTGGAATGGGGCAACAGGACATCAACGCAGAGGACGAGAGCTGTGATTGACGCCATGCGGATACTGGACCTCATACTGCTGAACGATGGACGGAAGCCGACGTTTAACAACGATAGGGGGTACGTCCTTTATTGATTACCCTTTGTCAGCAGGGCTAGTAGACAACAACAACTGGATGGTCCATGACGTCGCTGACTGAGCGACCATGCCTGATCTCCTTCTCCCCGGAGGTATGCCCAAAGACGGCAGAGTAGAACAGCCAGGAAAACATGGGACACCAGGAAGATCGATGAGGCCATGCTGGCCTATCAGATCAATTCCACAAATCCCAAATGTGGACGCAGAGTATGGCGGCAGGCCTCATGAATATGCTGGGAAGAATCTGCGACACCAATCATGCCAGGAAAATAAGGCACAGCGCAAACCCACCCGTTTACTGGTGGAGTGCCTCCCCTAAGCCAACTACGGTCTGATTGCCTCAGGGCTAAGAGAACGGCGCAACGAGCCAGAGGCGAGTACCCACCACGCGGAACTCTTGGGGCTTTCAGAAGCAAACGCCCTAGAGTTCAAGCACGGCATCGCGGCACCAGCAAAGCGCGGTCGTTGGGAGCTGGGATGGCGTAGACAGCGATATCTGGGGCCTCGCCACCTGGCTTGTTACCAACGAGCTAAGGAGAGAGCGGCAACCCCATCCGACCCGGGGTCTGGCTAACATACTGGGGGGCTATTTCCAAAGCAGACCACACTATGGGAGGCCAACAGAGGCAGCCCTGCCCCAGATTTGCCGTGCGTCACAGAACTTGAAGTCGTCGAGGCAGCTGTTTCGCTGACGATGTGGCAATCACAGCCGGGCTGCTGTAGCGGCTCACAAGACCGAAGCAGTCCTACTAAGCAGCAGGAAAGATGGAGAACATGCTGGTCTCCGTCAAGGGGTACTCAGGGGACCTCTCAAGAGTCCCTAAAGGTACCTGGGGGTAATGATAGATCGCAGACTATCGTTCAAGGACCGCGAGCTACGCCAGCAAGGGCAGCAGTCACATCCTCTTCGTTGGCGGGGCTTATGCCAACGTCGGAGGCCCAAGACACCCGGCCAGGAAACTGCTGGTGTCAGTAGCAAAGAAGGCTTCGCTGCTATACGCGCACCAGTCTGGAGCAATGCCGCGGGGATACCATACCTGAAAGGGCTCGTTCGGTGCTACGGTCAATGGCCCTCCAGGCTCATTAGAGGATTCAGGACCATATCCGAAGACGCGGCGCTAGCGCTGGCAGGCCTGCCGATTGATCTGGAGATCAGGCTCTCAGCCTTATGCGGAGTGGCGCTTCCAGGCAAAGGCACACGAGTGGCGCTATTAGGTGAATGGCAGAGCAGATGGCAAACGTCGCGACGGGGGGAGGTGGACTATCAGCTCATCCAGAATGACGGTTTTGGGCAGAGTGACACTCTCAAAGTGTGTAAACTTGAGCAATACGTAACCGTA
->c0a1219a-9fac-40ce-9239-fae125c9c858
-TCGGTATACTTCCGTTCCAGGTTACCCATGTTACTTTCCATCCGCTCCTGCGCCCCAAAACCCAAGTCATCCTCACCAAGGATAGAGAGCTAGTAAGAGTCCCACCCTCCCCGAAATCACCGGCCGATTTTGCCATCTCCATCGCCCGCCCGTTCACCTAAGCCAAGCCTCGTGTGCCTCTTGCCTGCGACGCCACTCCGCATGGGCTGAGCTGTGATCTCCAGATCAATCGGCAGGCCTGCCAGCGCTAGCGCCGCGTCTTCGGATATGGTCCTGAATCCTCCTAATGAGCCTGAGGGCCATTGACCGTAGCACAGACAGGCTCCTTTCAGGTATGAGACCCTGCAAGTGGCATTGCTCCAGACTGGTGCAGCGTATAGCAGCGAAGCCTTTGCTACTGACACCAGCGGTTTCTGGCCGGAGTGTCTTGGGCCTCCGGCGTTGGGCATAAGCCTCGCCAGCGAAGAGGATGTGACTGCTGTCTTCTTGCTGGCGTAGCTCAGCGTGGTCCTTGAACGATAGTCTGCGATCTATCATTACCCCAGGTACTTTAAGGGACTCTTGGGGGGGGTCCCTGAGTACCCTTGACGGAGACCAGCATGTTCTCCATCTTTTTCCTGCTGCTTAGTAGGACTGCTTCGGTCTTGTGAGCCGCTATTGCTAGCCCGGCTGTGATTGCCACATCGTCAGCGAAACAGCTGCCTCGACGACTTCAAGTTCTGTGACGCACGGGAAATCTGGGGCCAGGGCTGCCTCTGTTGGCCTCCATAAGATGTGGTCTGCTTTGGAAATAGCTCCCCTAGTATGTTAGCCAGGACCCCCGGGTCGGATGGGGTTGCCGCTCTCCTCCTTGGCTCGTTGTTTGAAGTAACAAACACCGGCGGGGCCCCAGATCTCAGCTGTCTACGCCATCCGCAGCTCCTTAAACGACCGCGCTTTGGCAGCCGCGATGCCGTGCTTGAACTCTAGGCGTTTGCTTCTGAAAGCCTCCAAAGTTCCGCGTGGTGAGTGCTGCCTCTGGCTCGTTGCGCCGTTCTCCTTAGCCTGAGGCAATCAGACCGTAGTTGGCAGGGAGGCCTCCGCAGTAAACGGGTGGTTTTGCGCTGTGCCTTATTTTTCCTTGGCATGATTGCGTCGCGGTTCACCCCAGCATATTCCTTGAGGCCTGCCGCCATACTCTCTGCGTCCACATTTGGGATTTCAGGGGAATTGATCTGATAGGCCAGCATGGCCTCATCGATCTTCCTGGTGTCCCATGTTTTTCCCGGCTGTTCTACTCTGCCGTCTTTTTGGGCTATGCCCTCCGGGGAAGAAGGAGATCAGGGCATGGTCGCTCAACGATCATGACGTCATGGACCATCCAGTTGTTATTTGTTGTCCTACTAGCCCTCTGCTGACAAAGGGTAACGTCAATAAAGGACGTACTATCGTTGTTAAACGTCGGCTTCCGTCATCGTTCAGCAGTACCAGGGGTCCAGCATTCGCATGGCGTCAATCACAGCTCGTCCTGGTGTTGGATGTCCTGCTGCCCCATTCCACTGTCCAGGCATTGAAGTCGCCGGCAATGACCTTCGGGCTTCGCCCTCTCGCATGGTCACGAGCGCCTCCAGAAGCTCCTCCCGAACTGATCAGGGGGTGTCGCTCGGCGGAGCGTAGCAGCTGTACATGTGCACGTGTTTTAACTTCGCATAAGCGATACACCCGCGCCGTTAAAGCAGCCAGTTCCTGGACTTGGGAGAGCTGCAGCATTTTGATGGCTGCTTTACCTGCCTCGTCAAGGATCATGGACGTTGTCCACTACCAGAGACGTAGGGTTCGCTTAGGAGCATGATGTCTACATTGCGCTCAACCGCAGTCTGGGCCAGGAGGCTCCTGAGCTGCTGCGCAATGATTGACATTGAGCTGTACTACGCTAATATGAGCGTGCATTAAGGTGGCTCTTGGCATCTTTTGAGTGTCGCTCTGTAAAGTCGGGCATAAGCTACCCGATCCGGGTGGTTCTGTCCACCTCGCTGCTGCAGATCAGGCATTTTGGTGCAGCAACGCACCCACGCTGCCCACGCTCACCGCATCTAAGACAGCAGTCTGCCCTGTCCAGTGTCCTTGCAGGTTGCTGATCCGATGCCCATAGCCGAGAGGATTACCTGTGGCATCTCGTGGGTCCGGACGTCACTGGGTGATACGACATCTTGACCATCCAACGATTATGATTGCCCTGTTTAAGGACTGGTATCGCAACGTTCGCGTTCAGCAGCACTGAGGCTATTTGCTTGCAATTCCGCATGCAGAAGGCCCTGATATCTTCAGGATTTATCTGCAGGCCTGGAATTGGGCGACCAAGCGGCTGTGGAGCTTCTCTGCTGTCGTAGCTCGTCCAATCCCGCTGCAGAGATAGAGCTGTTCTTTTGCGCTCCTGTGCGCACAGAGGCCAAGTCATTGAGCGCCGCTTCCAGGTCGCTCTTAAACTGGGAACTTTCGAAGCTTTCCCCTCACCACCTCAAGCAACAGATCCCGCCTTTCTGCGTTCTCCGGATTTTCGCACGTGACTGCCCAGTTCGCTAAGGCTCGATTCGATCTTAGCTTCGAAGCATCTCTGCGTACGAAGCCTCTCTCCTGTCTTTTACGATGAGTGCCTCTGCACCCGTGCTAGCATTCTTGGCGACAGATGCATAGCTGCCTGGCTTGAGACTCGTTAGGTATGGATGTCGCCTTTTTCTTCACCGTTGCCATCCAACGTAGGGTTGCTCTGCTTCGGCGCCTGGACTTTGGCACCTGCCGTGGGTACCTGCGCATTTTGTGGAGCCTTTTGGTGAGCTTTGTACCTCCCGTCTGGGTAGCGCTGCTCTTCAAAGGCGGTGCTCGCTAATGATACCTTCGTACAGCTCTATCGCCCTGTTGTTAAAATTTGAGAGTTCGGAAGCTATGCCCTTTGTCTCTCATGTGTGTCGTTGGGTCTCAGATACTTGCGGATGGGGGGGGCTGATCTTGCCATTCATCCTGGTAAGTATGCCCCTCGGGTCTCGTTCTGGAGAGCAGTGGTCAAGTCCGAAGACCGATGGGGAACAAGCTGGGGACTTCCCTCCGTCTTTTGCGATGGCGGCGATGTGGTCCATCGTCTTCCTGACTTGTCGCGGTCGTAGATGCTGGCAAGGCCAATTTCTCACCTCTACAGCATCGCTGCAGTCGATAGTCAACGGCGGCTGGGGGCCTGCGTGCTCACCTTGCCACCGACGGGACCGAGATTCCGTCACCATGGGTCGGGTTACCGACTCCTCTGGTGGGGGGATCTCGAAAGTCAGGAAGAGCTCCTCCTGAACGGGTCGTTGCGATCAGGGGGACTGCCCCACTGCACTGTCCATCAACTGGAAGGATGGCCTAAGGTTGCCTAGGTCACGTAGGCCACGGATTTCCCCTGGCTTTTACGGATGGAGGTTTGTACCGCCTCGACTCGGACACCAGAGCCTCTGCTTAGGCACCAGCACGGTGAGAGGATGATATTTGGTCTGTATCCGCGACCTTTGTGCCTTTCCCCTTTCTTAAAGACTTGTGCGGCCAGTTACCAGAATCAAAATTAAATTAAATTAAATTTCAGCGGCTTAAATTTTAAAGAATTTAATTTTGATTTCCTCCCTACTGTCGCAACACAACACTGATCACACGGTTGATCTGTAGCAGCGCCTCCCTCTCCAGATCGCCCGCTGCGCTATCAGCTGTTTATCCGCTGCAACAATCGCAAGAGATAATAAATTACCTATTTACATGAAACGGGCGCACAATTAACTCGCGTGATTGCGGCGCAAGAACTATGGCGCGACCACCGTGTGATTTTGCCAGTTTGCCGCACACGCAATGCGACACAGCTTCTATGGTTTCGAGTATTTCGCGCCGCGTAATTTAAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCGCACCGGGATTGAGTGTCTAAGCCTGTGCGTTCAGGATTAAACTTTGGCAATACGACAGCATTGAGTTTTGGGTCTCTTTGTGAGTTTTGCACTTCTTTTAACAGTTCAGAAAAAATGGCGATTCTGCGACTCTAGAATTGTCAGCAAATTGTTTTTTCACTATTGTAGTATGCACACATATCGGTTAAGCGCTGTACCTATGGCCGGTATTCATAGTGTAGCACTCTGTTGCAATGTGTACATAAACAGTCCAGCACAAGTGTATGCATCAATACAGGCACCCACTTGAGGGGCTAACATACATAATTACTGGTCAGCAGTTCTCCCGCTGGCCAAGCGCTGATCGCTTATATGTGTGCCTATACCACTCCTCCTCCAGCACCATCGCTCGGCGACGAAGTACATATATATATACATATATATAAGATACGCATATAAGCGTTGCTGCGCTGCAGGCTATGCCGGCAGCGCTGCTCGACAGGCTAAAGAGCCTTTGTATGTAGATCATGAAGTTGACGAATTAATTTCGAGATGGGCGGGACCTTCCCTGTTCCTCAAATTGGATCAAATAAAGAACAGCTAAAACACAAATGATCTATGACACAATGAAACTACAGGAAGTTGGAGTAGGCGGTCCCGCTTCTGATGTCGGATCCTGAATCACTTTATACTCGGCATCCTCTCTGCAGCGGACCTAGAAGTAACAGAAACGGTCATTAGCGAAATTAAAATAAAATCTGCGACAAGTACAGTTTGTCAGAAACTGTTTACACCGTGAAATAAGATGAATTTTGATTTTAACAGTCAAAATTAAGGGTTATTTGGCAATTAAAGCGCAATTTTTTTTTTAGGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAACAAATTCAAATATCAAATATACAAGAAAATAAACAACGAATTCCAAGTTTAAACACTTTTGAGAGTTTCAAGAAACTCTTTACACAAAAACACTAAACCTAAGTTCCAATCCCTAAATTTTTAAATTATTTTGTTAAAATTTGAAAAGTTGTAGTATTTAGTATGACCCCCATTGGCTTTGGCTACAAGTTGGAAGCTTTTTTTTTCATGGAATGGATGAGTTTTTTTAAGGTCATATTCAAGCGGGATCTTTTCCCACTCTATCGCGGCCATGAGCTGTTGTCGTGTTTTGGTGCCCCTTTTGCCACATTCTTCTTTAAGTAGGCCCACAAATTTTCAATGGGGTTCAGATCAAGACTCTGAGGGGCGTATCCGATCACCTTACCACAGTTATAAAAGGAGCCAGTTGCGTACATTGCACTCTTTATGTTTTGGGATCATTGTCCTGATAAAACTTAAAATTTGGCTTGTTGTTGCTAAATAGACCAAATTTTTCTGCACTGGCCTTCAAATTTGATTTTAAAATATCTAGATATTGCACGGCATTCATAATGCTTTCAATAAAGGCTAATTTGCCCACTCCATGGCTTGAGATACAGCCCCAAATCATCACTGATAATTTTCCAAATTTGATTGTTGGAATGATATTTTTGTTTTTCTAGCGCACTCAACAGCTTGCGCCATACTCTGCTTGGCCCATCGTTATAATAGAGGCATCATTTTTGTTTTCGTCACAAAATATTACGTCATCCCAATTACTCTTCCGCATGATCCATCATGCTCACAGCAGATGAATGGCAGCACTTTTCTATATTGACCTCTGATAGCAAGGCTTTTTTCTTGCAACTCTTGAAGAGTACCTGTAATGAAGAATGACTTGGCGCACAGTTTGTGTGGCACAACCAGGTCACGGTCTTGCGGTATCTGAAGCAAGTGATCTGACCGAGATTCGGTTCGCAATCACTTTTCGCATAATAAGGCGGTCTACGCTTGCCTAATTTTAGTTTTGCGCCCACCACTCTTAGGTTCAAAGCCTGTTCTCTTTTCAAGCGATTAAAAACATTGTAGACGGTCTTACGGGATACGAAAACATTTATACTAATTCTGGAATAGATTTTTCCCAACTGGTGGTTTTGGTATATTATTTGGGTCACTTCAAAGCTAATCTATTTCCGGGCATTTTATTCGTTAATAACTCATTCGATCAGCAAAAATTTCACAAAGCAAAGTAAAAAAATTTCAATAGAAGCGTTGTAAAAGAGATGCAAATGCCAAAATAACGGAAAAATGAGTTCGTTCTAAGAAAAGAGCAAAACAAAGTAGAGGAAAACAAAATGTGTAAGGGTTTCTTGCCACTCTCAAAGTGTGTAAACTTGGAATTTGTTGTTTAATTTCTTGTATATTTGATATTTTGAATTTGTTTTAATTTTATAAGTAAAATAAATATTGTTTAATTATATTTCATTAAAAATTGCGTTTAATTAAAAGAAATAATATAATTTTGACCTTTAAAGTGAAAATTCAGCTTATTTCACGGCGTGTAAGTTTCTTGACAAACTGTATATATCTACAAATTTACAACTTGCCGGTACCATCTGCAAGATTCATTACATTGAAGTGGACTTTGACTCTCAGAATGAATTAAAACATTATATTCTTGATTGGGCTGGCGAGAGGAACCAGACTGAACTAACTAAACTAACTATCATTTAACTAAAATTTAATTAAGTTTGCGATAATTTTTTGAGTTTCTTACAAAGATGACTAATATTAATTTTAGTTAAAATGGTTGCAAAACTGGTTATGTAAATAATATGTTCAATTGATCTGGTTGGGTTTTCTGGAGTCTCCCCAACACCTCGCAACGAATGCTGGATCAAAATTATTCGTCAGAGGACGTGCACAGTCTCGTGAGTAATAAAAGTACAGCAATCTTACTTTTGAGGTGGCGTGTTGGAAAGTATGTACACATTTAAGCAAAGTCACATGGCCTGCATCAAAGAGACACTAGAATAATAAGATGCGCGTATACACTGGTTTGGCACTATGCAGCCACTTTTTTGATGACGGCCAAAATTGCTCTCTTTCCGCTCGCTCACGCTGAGCGCCTGAAATCCTAAAAAAATAGAATTTGCTTGCTTGTGTGAGTAAAACAAAGACGAGAACGCGTATATGTGTGCGTGTTGTGCTAGAGGAGGCGATTTTTCGGGCCGAAATCAATTCTGATCGCAGTAACGAGATTTACATATGTACATACATATTTAGTTTTGGCCAATTTCGTGGGAATATGATGAAATTGCGCGCTGTTTAAGATATCAGAAATTGGAATATAAAAAAAAAAACTGAAAAGAAGTCATTACACTGAGAAAAAAATGTTTCATAAAAAAAAAATAATACGAAATTAGAAAATAAAATTTATAAAATAAAAAAAATGTTAACTGTTTGTTACAGGCGTCATATCAAATTAAATTATTCTAGTGTCTTTTAGCTGGTCATATCTTGAGGCACGAAGTGCGGACCTAAACACTCAACAATCATTATCTTCTTAATGCTCAAGCAGAGCGACACCGACGAACCTAACTGCTTTTGAAATGGCGAAGTAAAATAAAATCAAAAAAAGAGAGACCAAAGCCCCTCCCGAGAGTTCAAAGAAAACAGGATTCCCTGGACAATTCATAAACACCAGCGCAAATAATTTCGCTCTCTTAAGCGACGGATTGCCCGACAAAACGAAGAACAATATAACAAAAACGAAGATCTCGAAATGGTAAGTAGAGACAGTTACAGCTGATTTTGCTAAGCCCCACCTATCTTTCTCTCTGACGTCAATGGTATAGGTGAAAAGCTAACCTATCTTAAAACTAAAATTAAGAGAACTTTTTATTATAAGACTCAACGTTATGGACATGTAAGGTAATGGTTAAAAGTATTGAAATTCACGAAAATTAGTCAAAACACTTGTAATGATTGTGTGCAGTACCACTGTACCAACTAAGGATGACAGAGCATTTAGAGTTGTTATTAAGAATTTGCATTTTCCACAAATTTAGATGAAATTAAAAGTGATGAAGAGTCAAAGGTCATGTTGTTAGAAACATAAGTAATAATATTAAAAGCCGTGCGACCAAAGCGTCACTGAACATGTTTTATGTAGATGTGGAGCCTAACAAAAAAAAACCTATAGACATATATAGTGTAAATAAAATATTGAGCCTCCCCACAATGAAATCGTTCAATGCTATAGCTGCCAGAATTCGGACATACTAAATCATATTATTGCCAAAACGTACCGCTGTGTAAAATCCTCTTACTCGACACCCAAGCAACATTTGCCCGAAAATACAGAACAACCAGCAAAATGTGCCAACTGCACTACGAAGAACACGCCGCCAGCTACAAAGGGTGTAGAGATTTATCAGGAACTCTTGTCAAAAAAAATAGAAAATAGAAATAATGATCTGAGTAAAAATGATTTAGGAATCCAGCAAAGTTTGTTCCGCCCTAACAGAAGCCAACATATACCCAACAAAGTGTAGCGATTATCAATCTTATGCCCAAATTGCTGCGGGAAATAGCCAAGGCAAACACATCACTGGAGGAATAGAGCAACTATTAGGAAAACAGTCTGAACTTACAAATAATTTACTTAACATGATAATGTTGCTTGTAAACAAATTATGCAAGTAAATCCTAACCTTGGAATATGGAGAAGCGTAGTAGGAGGTGAGCTTCAATCACAAGCTTCCGAAGGGAAGCTTGAACTGTACAAATGCATAGTAAAGCAACAGCATAACACTTTCAACCGGCAAAGCCTACATACCCTGGCCTACTGATAGTAGAAAGATGCAAACTTAACCCTTTCGCGCAACGTTGCTTGTAGGCAATTTCTATGTTTTCAGAGCTAACTGTAAGTGTGCCTTTGTTTTTATCTGCTGATTCTTTTTTTATGATAGCAGTGCTTTTATGTGTCTACTCTAAATATAAAAGCAAAACGCATTTGGAGATTAATTGCAGAATTAATTTGCAGTAAATGGCACGCGCATCACAATAATTATTGTTTCGATATTCAGTGCAACTTTTGGAATTATTAATTTACTTTTATAATACTTTAAAAGAACCTAAAGTATAAACAGCAAAGAGTTAACAAGACAGTGATTTAGTCAAACTTAGTAAGTAGTGAACAATAAGTAAGTAAATAATTTTTTCTAAGAAGTTGCTTGTAGGCAACCTTGGGCATTCGTGATAATAATTTCACCGAGAGTGAAAGGTTTGTCTAACGAAGAGAATTGAACAGGATTTAAACTTCGATTGGGATATTTCTACTGACGAAGAAGAGAAGTGGTGAGGAGATGAAAGACATTTCTACGGTACTGGAGAAGAATTTAGAAGGAATTCTTGAAAGGGGAGAAAGTATCGACATTGACCTTCTGGAAAATACAGTGATTGAAGGATGTGAACCCTGACTCTTGCGTTGTTGTTGACAGTTGTAGAAAATTGATCCAAAGAAGAGGGGCTAAAGTGGAGAACAAGGCCGTTTGTAGCTCCAGAGAGTATTTGGAGAAGATGACAAAACTTTTGATGTCAGGGACATAAAGACGACCGTGGAGTTCTTCTACACACTTTTGATACTCAGCTAATTCATTTTAATGGCTAAGGCAAACTGATATACAGTCATGAGGTCAAATTATTTTCTAAAGTGCATTTTTTGTGCATGGGTCCTAAACAGTTGCTTGTGCAGCAAGTGGGGGGGGTGAAATGCAAAACTTTTGCTTTTGCAAATTCAAACCTATACAGAGTCAGATGAAAGAAAGATTGAAAAATACTTTGTTCTATGCGCCGAGGGAGAGGCAAATGAAGAGATCTTTATCAGTTGTCAGAAGTATTTGCACACGGTTTCGTCGCATCACGATTATTTCACAACGCAATTTCTTCTTCAGTGATTGGTTTAAATTGACAAGTGCCGGTTTGTTTGCTTAAATACATTTAAATTATTGAATAAAAAATTAGATTTAATCATTTTCCTATTACAGTTATTAAATAAAATGCCCAAACAAAGAGTTAACAGTTGAGGCCCGGGCTGGTATTGTTACTGAGTTTAAAAGCCGGTACACCTGCGGCCAAAATAGCTGGAAATATATCAAATTTCGCGTGAACTGTCTACTACTTAATAAAAAGTTTGATACAGTTGGCACATTAAAAAAATAAAAAAAAGATCGGGCCGAAAACCTGTGGACCAAAGGCAATGCAGGCAAATACTTGGAGTTGTGGCGAAAGAATCTAGTGCCAGTCCGGTAAAAAAATTACCTTAAGTCAAAAATACAATTGGCAAACAAGTTAGTGATTCTACAATTCGTCGCAGCAGGCTAAAAAGAAGCTGATTTTAAGACATGCTTTGTTTTCCGCAAAACGGTGAGATCACCAACCAACAAAACAAAAACGTCTTCGATTTGCGTTGGAATATGTTAAGAAGCCTCTTGACTTTGGTTTAATATTTTATGGACTGATGAGTCTGCATTTCAGTACCAGGGGTCGCTGTAAGCATTTTATGCATTTTGAAAATAATCAAAAGCATTTGGCAGCCCAGCCAACCAATAGATTTAATTGGGGGCACAGTCATGTTTAGGGATGTCTTTCCTAATGTAAGTTCGGAGACTTGGTACCGATAGAAGGTACTTTAAATCAGAACGGATACCTTCTTATCTTAAACAACCATGCTTTTACGTCTGAAATAGACTTTTCCAACTACTGAATGGATTCTTCAACGGGACAATGCTCCATACCATAAAAATTAGGATACTGCTCAGAATTTTAAACGACCTTAATCTGGCGGTTCTTCCGTGGCCCCAAAGCCCAGACCTTAATATCATTGAAAACGTTTGGGCTTTTATTAAAACCAACGAACTATTGATAAAATAGAAAACGAGAGGAGCCATCCATTGAAATAGCGGAGATTTGGTCCAAATTGACATTAGAATTTGCACAAACTTTGGTAAAGGTCAATACCAAAAGACTTCAAGCAGTTATTGATGCCAAAGGGGTGGTGTTACAAAATATTAGTATTGTATTTATATAAAATAAAGAAATTCTTATGTTGAAATTAGATGTTAAAACAATTTACTAAATTAAGTTGGTGAAAATACTTTTGAAGCGCAATAAACATGTGAAAATACTATTGACAACATGCATATTTCTTTTGCTTTAAGCTTTGTACTATGAACCGTTATCTTTCGTATTTCTTTTCGACTACCTTCTGCATAGATCAAGCTAAGCGATAAGAACTATTTCAGGCAAATCGGACAACAACAGAAGAAATATATAACAAAAAGAAGTTGAAGTTTGCAAATATTGTGCGTTGTGAAAATACTTTTGACCACCTCTGTATATAGTTTGCGGAGCGGTATTGAACTTAAATGTGTACTGATGAAATCAAACGCTACATTGGCATTTTATTGTACTTTGGTGTTTTAAAACTACCGCAATTCAGAATGGCGTGGTCAAAGTATTTAAGATTACCGCAATAACTGATTCAATGCCGCATTAGGAGATTTAAAAAATAAAACAATGCTTACATTTCCAACGACAACGCCAAACAATTAAAAAAGGGATTACCAGCTATGATAAACTCTACAAGATCCGCCCTTTGCTCAGAATTCTGAAAATTTTTGGAAAAACTAACACTTGGGAAGAGCATCAAAGTGTCGATGAGCAAATAATTGCATTCAAAGGTACGTTTTTAATTTTCTTTAAAATTAGCTTTATTTTTTAATAATTGCTTTTGTTGCAGGTCGATCCACGCTTAAGGCAATATATTCAAACCTCATAAATGGGGTCTTAAAATGTTTACGCGAACAGGAATATCTGGATTAGTTTATGATTTTACGCTATATGTTGGAGGAAGGCACTTCTCCCTTCTTATGTAGAATATCATCTTATGTTTAACATCTTATTGGCAGAAAGATGTTCCCAAAGACAAAATTTTTAAACTGTATTTTGATAATTGGTTTACGTCTATATCCTTCTGATTTCGTTGAAGGAAATGAATCTTTGCAACAGGTACTGTACGTATGATAAAGTTGAACATTGGGTGGTTTGGAGAAAGAGGACGTTGCAGACTGTGCAAAGTGCAGCACCGATGACCGTACGCATTACGAAGTCCATCTGTGCTGCAATAACAATAAAAACTGACTTTTTGTCCTTTTCACCTTAAATTGTCATTATAAAGAAAAATATTTCATATTCTGTGATTTATAAAAAAAAAAAAAACAATGCTTACACATCACTACTGCCCGACGTTGCTCACCGAAACTTTTGCTACACTTAAACTAATGGGCGTGGCATACCTAAGAGCCACGCTAAATTTTTCCCTATAAAATAAATGTAAAGCAGTAATGATAAAACAAAAATTTCACGGGTAAAAAAAAGTTGGGCGCGAAAGGGTTAAAAGACTGTGGCATAGCATACTTTTGGAATCAGAATCTCACATGCGAATAATGGAAAGTTTTTGATCTGGCTCAGATCATTCTCTAATATGGTGACATACAGTACAGTAGCTCATATAATATTTTGCAAATACAGATATCAATGCATTTAAAAGTTATCTGGAAACAGCTATCCAACCTGGATATCTCCTTCATCCAGGAGAGGAGCTACTGTGGAGCTACAAACAAGATCCATAAAGCAAGCTATATATGCAAGCTACCAGCCAGAGCTCACAATCCAAATCAGGCTCTATCTCTCGGCAAATCGACAACAAATACAACACAAAGAGAAATTTGCGTAAGAGATGGCAAGAAAACTCTCTACCCTGCCGACAAAGATCGTGTAACAAGGCTGCATCGATCGCAGAAAACTACTGTCAACTTTAAGAAATTAATCTCGCTGAATATCGGCAGAAATCTAGATCCACATTCTTGTAACCACAGACATAATTTATGGAAGTAACCAAATATCTCAAGCGACCTGCAAAAGAAACACAGTAGTCGAAACTCTAATGGCGAATGGCGTAAAGATCTGATGATGAACAAGCCGAAAAACATTTATATGCTACCTGCACTCTGTATTTCAGCAGCAATGCGTATTAGCGGG
->6e4702d9-b827-498f-811f-db788f92d620
-TGCATGCTTCCCGTTCAGTTTACGTATTGCCATGAGACCCTGCAAGTGGCATTGCTCCAGACTGGTGCAGCGTATAGCAGCAGAAGCCTTTGCTGGCTTCTGTAGTTTCCTGGCCGGGTGTCTTGGGCCGCCGACGTTGGGCATAAGCCCTCGCCAACGAAGGAAGGATGTGACTGCTGTCTTCTTTGCTGGCGTAGCTCGCGTGGTCCTTGAACGATAGTCTGCGATCTATCAATTTTAAGGGTACTTTAGGGACTCTTGAGAGGTCCCACAAGTACGCAGGCCGGAACCAGCATGTTCTGCCATCTTTTTTCCTGCTGCTTAGTAGGTTCTTCCGGTCTTGTGAGCCGCTATTGCTAGCCAGCTGTAGTTTGCCCACATCGTCAGCCAGAGCAATGCCTCGGCGACTTCAAGTTCTGGCGACGCACGGGAAATCTGGGGCAGGGCTACCCTCTATTTGGCCCTCATAGTGTGGTCTGCTTTGGAAATAGCTCCTAGTATGTTAGCCAGGACCCCAGGTCGGATGGGGTTGCCGCTCTCCTCCTTAAGCTCATTGGTAACAAGCTTGTAGGCGGGGGGCCCCAGATATCGCTGTCACCGCCATCCTGCGGCTCAGCAAACGGCCAGCACTTTGGCAGCCACTGATGCGCCGTGCCATGAACTCTGGGCGTTTGCTTCACCAAGAGCGCTGGGTTCCGCGTGGTGGAGTACTGCCTCTGGCTCGATTTGCGCCGTTCTCTCTGGCCTGGGGCAATCAGATACGTAGTTGGCTTAGGGAGGCCTCCACCCAGTAAACGGGTGGTTTTGCGCTGCATGCCTTATTTTTTCCTTGGCATGATTGCGTCGCGGATTCTTTGGCATATTCATGAGGCCTGCCGCCATTACTCTCTGCGTCCACATTTGGGATTTCAGGAATTGGGTATTGATAGGCCAGCATGGCCTCATCGATCTTCCTGGTGTCCCATGTTTTCCCGGCGCTGTTCTATCATGCCGTCTTTTGGGCATGCCCTCGGGGAGGAGATCAGGGCATGGTCGCTCAGCGTCATGACGTCATGGACCATCCAGTTGTTGTTGTCTACTGGCCCTCTGCTGACCAAGGTAGCGTCAATGCGGGACGTACCCCTATCGTTGATAAACGTCGGCTTCCGTCCATCGTTCAGCGAATTATGGGGTCCAGCATTCGCGTAGCGTCAATCACAGCTCGTCCTCTGGTGTTGGATGTCCTGCTGCCCCATTCCACTGTCAGGCATTAGAAGTCGCTGGCAATGACCTTCAGGGCCCCGCCACTCTCCGCATGGTCCGGCCTCAGAAGCTCCTCCAGCGAACTGATCGGGGTGTCGCTCGGCGGAGCGTAGCAGCTGTACATGTACGCGTGTTTAACTTCGCGCCAAGCGATACGCATGCATTAAAACAGCCAGTTCCTGGACTTGGGAGAGGCTGCAGCATTTGTTAAGCTGCTTTACCTCGTCAAGGATCATGGACGATTGTCCACTACCAGAGACGTAGGGTTCGCTTAGGAGCGTGTCACATTGCGCTCGGCCGCAGTCTGGGCCAGGAGGCTCTGAGCTGCTGCTGAATGGTGTTGATGAGCTGTACTACGCTAATATGAGCGTGCATTAAAGGTGGCTCTTAGCATCTTTTGAGTGTCGCTCTGTAAGTCGGGCACACCGGCGCTGCAATCCGGGTGGTTTTACCATCCCCACCCTCGCTGCTGCAGATCAGGCATTTTGGTGCAGCAACGCACTTGCTTGCCTTGTGCCCACGCTCACGCATCTAAGACGGCAGTCTGCCCTGTCCAGTGTCATACGGGTTGCTGATCGATGCCGCCGCCGAGACACCTGCTTAACTGGCATCTCGTGGGTCCGGACGTCCTGGAGTGATACGACATCGCCCGGTACATCCAACGATTATGGTGCCTGTTGCGGGACTGAGGTATCGCAACGTTCAAGACCAGCAGCACTGGGGCTGTTGCTTGCAATTCCGCATGCACTGCGAGGCCCCTGGTATCTTCAGGATTTATCTGCGGAGCCCTGGAATTGGGCGATAGCAGCTGTGGAGCTTCTCTGCTGTCGTAGCCTCGTCCAATCCGCTGCCAAAGAGATAGAGCTATTCTTTGCGCTCCACGCAATATTGCGCACAGGGCTGGAATCATTGAAGGCGCCGCTTCCAGGTCCGCTCTTGAAAGCTTGGGAACGCTTTTCCGAAGCTTTCCCTCTACCTCAAACAACAAGATCCACCTTTCTGCGTTCTCCGGATTTTTTCGCGCGTGACTGCCCAGTTCGCTAAGGCTCGATTCCGATCTTAGCTTCCGAAGCATCTCTGCGTGCAGGGGGCCTCTCCTGTCTTTTTTTACGATGGAGTGCCTCTGCACCGTGCTAGCATTCTTGGCGACAGATGCATAGCTGCCTGGCTTGGACTCGTTAGGTATGGATGTCGCCTTTTCTTCACGTTACGCCATCCAACGTAGAGTTTGCTCTGCTTCGGCGCCTGGACTTTGGCACTGCACCGTAGATTTTGCCTGCGCATTTTGTGGAGCCTTTTGGTAGGCTTTTGTACCTCCGTCTGGGTAGCGCTGCTCTTCAAGCCCGGTGCTCTGATGAAATACCTTCGTACAGCTCGCCCTGTTGTTGGGGCTGAGTTCGGAAGCTATGCCCTTTGTCTCTCATGTGTGTCGTTGGGTCTCAGATGCGGATAGAGAGGGGCTGATCTTGCCATTCATCCTGGAAGTAGGTATGCCCCTCAGGTCCTCGTTCTGAGCAGTGGTCAAGTCCGAAGACCGATGGGGAACAAGCTGGGGACTTCCTCCACGTCTTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCTGACTATCGCGGTCGTAAGATGCTGCTTAAAGACCAGATTTCTCCACCTCTACAGCATCGCTGCAGTCGATAGTCAACGGCGGCTGGGGGCCTGCGTGCTGCCTTGCCACCGACGGGACCGAGATTCCGTCACCATGGGTCGGGTTACCGACTCCTCTGGTGGGGGGGATCTCGAAAGTCAGAACTCCTCCTGAACAGGTCGTTGCGATCAAGGACTGCCCCCACTGCGCTGTCCATCCAACTGAAGGATGGCCTGGGTTACCCTAGGTCACGTAGGCCACGGATTTCCCCCTGGCTTTTTTTACGGATGGAGGTTTGTACCGCCTCGACTCGGACCACCAGAGCCTGCTTAGGCACCAGCACGGTGAGAGGGATGATATTTGGTCTGTCCGCGACCTTTGTACCTTTTCCCTTTCTTAAAGACTTGTACGCTCCGGTTACCAGAATCAAAATTAAATTAAATTAAATTTCCAGCGGCTTAATTTTAGAATTTGAATTTTGAATTTCGCGCCCTACTGTCGCAACCTGGCACTGATCACACGGTTGATCTGGCAGCGCCTCCCACTCCAGATCGCCCGCTGCGCTTTATCGGCTGTTTATCCGCTGCAACAATCGCAGAGATAATAAATTACCTATTTACATGGAAACAGGCGCACAATTAACTCGCGTGATTTGGCCGCAAGAACTATGGCGCGACTCCACCGTGAGTTTTGCCGGTTACCCGCACACACCGGCCGACCCTGCTTCTATGGTTTCGGTTCGCGCCGCGTAATTTAAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCGCACCAGGATTAGTGTCTAAGCCTGTGCGTTCAGAGTTGAAACTTTGGCAATACGACAGCATTGAGTTTTGGGTCTCTTTGGCAGGTTTGCACTTCTTTTAACAGTTCAGAAATGGCGATTCTGCGACTCTAGGTGTCAGCAAATTGTTTTCACTATTGTAGTGGCACACATATCGGTTAGAAGCACTGTACCTATGTGTATTCGCAATTAGCAGCACTCTGTTGCAATGTGTACATAAACAGTCCAGCACAAGTGTATACGTAATGCGAGCACCCACTTGAGGGGCTAGCATACATAATTGCCTGGTCAGCGGATTCTCCCGCTGGCCAGGCGATCAACTTATATGTGTGCCTATACCACTCCTCCTCCAGCACCATCGCTCGGCGACAGTACATATATATATATATAAGATACGCATATAAGCGTTGCTTTGCGCTGCCAGGCTATGCCGGCAGCGCTGCTCCTCGGCAAACTAAGAAACCTTTGTATGTAGATCCTTAAGAGGGATTGACGAATTAATTTCAGATGGGCGGGACCTTCCTGTTCCTCAAATTGGATCAAATAAAGAACAGCTAAAACACAAATGATCTATGACACAATGAAACTACAGGAAGTTGGGTAAGGCCGGTCCCGCTTCACGATGTCGAATCTGAATCACTTTATACTCAGCATCACTCTCTACAGCGGACACAAAGTAACAGAAACGGTCGTTAACTTGAGAATTAAAATAAATCTGCGACAAATTACAGTTTGTCAAGAAACTGTTTACACACCGTGAAATAAGATGAATTTTTTTAGTTTTGGCAGTCCAGAATTAAGGGTTATTTGCTTAATTAAACGCAATTTTTTTTAGGAAATATAATTAAAACGAAATATTTATTTTTACTTATAAATTAAAGAGCAAATTCAAAATATCAAGTACTGAAAATAAACAACGAATTCCAAGTTTAAACTGCTTTTGAGTTCAAGAAACTCTTTACACAAAACCACTAAACCTAAGTTTAATCCTAAATTTTTAAAATTATTTTGTTAAAATTTGAAAGTTGTAGTGGTAATTATGACCCCCATTGGCTTTGGCACCACAGAGTTGAAGCTTTTTTTCATGGAATGGATAGGTTTTTTTTTTTTTTTAGGTCATATTCAAGCGGGATCTTTTCCCACTCCTCACTGACCATGAGCTGTTGCGCCGTGTTTTGGTGCCTTTTTGCCATTTCTTCTTTAAGAGTAGGCCCTGGAATTTTCAATGGGGTTCAGATCCAAGACTCTGGGGGGCGTATCGATCACCTTACCCACAGTTATAAAGGGAGCCAGTTGCATTACATTTTCACTTTATGTTTGGGATCATTGTCCTGATAAAAGCTTAAAATTTGGCTTGTTGTTGCCTAAATAGTTAAATTTTTTTGCACTGGCCTTCAAATTTGATTTTAAAATATCCTAGATGTGCACGGCATTCATAGTGCTCAATAAAGGCTAATTTGCCCACTCGACTGAGATACAGCCCAAATCATCACTGATAATTTTCCAAATTTGATTGTTTGGAATGATGATATTTTGTTTTTTTTCTAGCGCACTCAACAGCTTGCACTTCATACTCTGCTGGCCCATCGTTATAATAGAGGCATCATTTTTGTTTCGTCACAAAATATTACGTCATCCAATTACTCCCGCACTTGATCATCATGCCACGTGAATGAATGGCCTTTTCTATATTGACCTCTCTGATACTTAAAGGGCTTTTTTTCTTGCAACTCTTTGAAAATTACCTATGGCGTAGAATGACTTGGCGCACAGTTTTGTCTTAGCACAACTAGGTCACATTCTTGCCTGATATCACGAACCGTGATCTGACCGAGATTCGGGGTTCGCAATCCGCTTTCGCATAATAGAAAGGCCGGTCTACGCTTGCTAATTTTAGTTTTGCGCCCACCGCTCTTAGGTTCAAGCCTGTTCTCTTTTTCAAGCGATTAAAAACGGTATAGACGGTCTTACGGGATACAGAAAACATTTTATGCAATTCTGGGATAGATTTTCCCAACTGGTGGTTTTTAGTATATTATTTGGGTCACTTCAAAGCTAATCTATTTCCAGGCATTTTATTAAATTTAATAACTCCATTCGATCAGCAAAATTTCACAAGCAAAGTAAAAAAAAAATTTCAATAGAAGCGTTGTAAAAGGAATGCAAATGCCAAAATAACGGAAAAATCGAGTTCGTTCTAAGAAAAAAACAAAACAAAGTAGGAAAACAAAATGTGTAAGGAGTTTCTTGCCACTCCTCAAAGTGTGTAAACTTGGAATTTGTTGTTTAATTTCTTGTATGACTTTGATATTTTGAATTTGTTTTTAATTTATAAATTACAAAATAAATATTGTTTAATTATATTTCATTAAAGGTGCGAGCAATGCAATAATA
->12445b7d-8836-4393-8a17-353b75f7aa41
-CTCCATAGACCACTTCGTTCAGTTACGTATTGCTATATGCGTATCTTATATATATGTATATATATATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAGAATTAGGTATAGGCGCACATATAAAGCGATCAGCAGCCAGCCAAGGAGGAGCACTTTGACCAGGCAATTATGTATGTTAGCCCTCAAGTGGGTGCTCATTACGTATACACTTGTGCTGGACTGTTTATGTACATTGCAACAGAGTGCTACAATTATGAATACACATAGGTACAGTGCTTAACCGATATGTGTGCATACTACAATAGTAGAAACAATTTGCTGACAATTCTAGAGTCGCAGAATCGCCATTTTTTCTGAACTGTTAAAGAAGTGCAAAACTCACAAAGAGACCCAAAAAACTCAAGCCTTGTCGTATTGCCAAAGTTTAATCCTGAACGCACAGGCTTAGACACTCAATCCTGGTGCGGAGACCAAGTCTACATCATACCGTGAAGACGGACGTCTTAAATTACGCGGCGCAAGTACTCAAAGAAACCATAAATTGTGTCGGCCGGGTACGCGGCAAACTGGCAAAATCACACGGTGGAATAGCATAGTTCTGCGCTGCAATCACGCGAGTTAATTGTGCGCCTGTTTCATGTAAATAGGTAATTTTATTATCTTGCGATTGTTGCAGCGGATAAACGCTTGATGATAGCGCAGCGGAGCGATCTGGAGAGGGAGGCGTTGCCAGATCAACCGTGTGATCAGTGTTCATTGCGACAGTAGGGCGCGAGGGTCAAAATTAAATTTAAAATTAAGCCGTTGAAATTTAATTTAATTTAATTACGATTCTGGTAACTGGGAGCGCACAAGTCTTTAAGAAAGGGAAAGGCACAAGGTCGCGGACAGACCAAAATGCTATTCCTCACCGTGCTGTAGTTGCCTAAGCAGAGGCTCTGGTGTCGAGTCGAGGCAGTACAAACCTCCATCCATAAAAGCCGGAATCCGTGGCCCACGTGACCTAGGTAACCTTAGGCCATCCCTTCAGTTGATGGACAGCGCAGTGGGGAGCAGTCCACGATCGCAACGGCCGTTCAGGAGGCCCGACTTTCGAGATCACCAGAGGAGTCGGTAACCCGACCCCAGCGGTGACGGAATCTCGGTCCGTCGATGGCAAGGGGTGAGCACGCAGGCCCCAGCCATAGATTGACTATCGATGCAGCGATGCTGTAGAAGTGGAGAAATTGGCTCCTACAGCATCTACGACCGCGACAAGTCGAAGACGATGGACCACATCGCCGTGCATCGCAAAGACGGGAGGAAGTCCCCGGCATTTCCTCATCGGTCTTCGGACTTGACCACTTGCTCTCAGAACGAGGACCTGTAAGGGGCATACTTACAGGATGAAGATGGCAAGATCCAGCCCCTTCTATCCGCATTCGAGACCCAACGTACACGCAGAGACAAAGGGCATGGCTTCCGAACTCTCAGCCCTTAACAACAGGGCGATAGAGCTGTACGAAGGTACTACTAGCGAAGCACCGCTTGAAGAGCAGCGCTGCAGACGGAGGTACAAAAGCCTACCAAAAAGGCTCCACAAAATGCGCAGGTACCCGGTGCCCCAAAGTCAGGCGCCGAAGCAGAGCAACCCTACGTTGGATGGCGGTGAGAGAAAAGGCGACATCCATACCTAACGAGTCCAAGCCAGGCAGCTATGGAGGCTTCGTGCGCAGAGATGCTTCGGAAGCTAAGATCGGAATCGAGCCTTAGCGAACTGGGCAGTCACGTGCGAAAATCCGGAGAACGCAGAAAAGGATCTGTTGCTTGAGGGTAGAGGGAAAGCTTCCGGAAAGCGTTCCCAAGTTTAAGAGCGACCTGGAAGCGGCGCTCAATGACTTAGCCTCTGTGCGCACAGGGCGCAAAGAATAGCTCTATCTTGCAGCCCGGATTGGGCGAGGCTACGACAGCAGAAGCTCCGGCGCTTGGTCGCTTTGAATTCCAGACCTGCAGATAAATCCTGAAGATATCAGGGGCCTTCGCGGTATGCGGAATTGCAAACAAATAGCCTCAGTGCTGCTGAACGCGAACGTTGCGATACCAGTCCTTAAACAGAAGGGCACCATAATCGTTGGATGGTCAGATGTCGTATCACCCAGGACGTCCGACCCACGAGATACTACAGGTGTCTCGGCTATGGGCATCGATCAGCAACCTGCAAGGACACTGACAAGACAGACTGCTGTCTTAGATGCAGTGAGAGCGTGGGCACAAGGCAAGGGTGCGTTGCTGCACCAAAATGCCTGATCTGCAGCAGCGAGAATTTGGGCGAGAAACCACCCGACGGGTAGCTTTGCGTGCCCGGCACAGAGCGACACTAAAGAGATGCCAGGCCACCTTAATGCGCGCTCATATTAGCGTAGTACAGCTCAATGCTCAATCATTGCGCAGCAGCTCAACAGAGCCTCCTGGCCCCAGACTGCGGTTGAGCGCAATGTAGACATCATGCTCTAAGCGAACCCTACGTCTCTGGTAGTGGACAATCGTCCATGATCGCGCTTGACGAGGCAGGTAAAGCAGCTATCAAATGCAGCTCTACCAAAGTCCAGGGAACTGGCTGCTTTACCCATGCGGGGTATCGCTTATGCGAGTTAAAACACGTGCATGTACAGCTGCTACGCTCCGCCAGGCGACACCCCGATCGGTTTCGAGGAGCTACTGGGCGCTCGTGGACCAGCCTGCGAGAGGGCGAAGCCCGAAGGTCATTACCGGCGACTTTAATGCCTGGACAGTGGAGATGGGGCAGCAGGACATCCAACACCAGAGGACGAGCTGTGATTGACGCCATGCAGATACTGGACCTCGCCTGCTGAACGATGGACGGAAGCCGACGTTTTAGCAACGATAGGGGGTACGTCCTTTATTGACGTTACCTTTGTCAGCAGAGGGCTAGTAGACAACAACAACTTCTGGATGGTCCATGACGTCGCTGACGCTGAGCGACATACCTGATCTCCTTCTCCCGGAGAATACCCATGAGGCAGCGAGAGTAGAACAGCCGGGAAAACATGGGACACCAGGAGATCGATGAGGCCATGCTGGCCTATCAAGATCAATTCCCTGGAAATCCCAAATGTGGACGCAGAGAGTATGGCGGCAGGCCTCATGAATATGCTGGGAAGAATCTGCGACGCAATCATGCCAAGGAAAAAATAAGGCACAGCGCAGCCACCCGTTTACTGGTGGGTACCTCCAGCCAACTACGGTCTGATTGCCTCAGGGCTAAGAAAGGAACGCGAAGCGCAACGAGCCAGAGGCGAGTACCCGCCCGCGGAACTCTTGGGCTTTCCAGGAAACAAACGCCTAGAGTTCAAGCACGGCATCACTTGGCTGCCAAAGCGCGGTCGTTTAGGAGCTGGGATGGCGTGGGCGCAGCGATATCTGGGGCTCGCCTGCAAACTGACACCAGCAGGCTGAGAGGAAACAGCAACCCATCCGACCCAGGGGGTCTGGCTAACATACAGGGAGCTGTTCCAAAGCAGACCACACTGGAAGGCCAACAGGGCGGCCCTGCCCCAGATTTCCCGTGCGTCACGGGCTTGAGTGTTCGAGGGCGGCTGGGCACCGTGACGATGGCCCAGCGTCACGGCCCAGGGCCCCAGCAATGGCTCCTGAGACCGAAGCAGTCCTACTAAAGCAGCGGAAAAAGATGGAGGCATTGCGGTCCTCCGTCAAAGGGTACTCAGGGGACCTCTCAAGAGTCCTAAAATTACCTGGGGAAATTGTGACCAGTCTTGGAACTATCGTTCCAGACCACGCGAGCTACGCCAGCGAGAAGACAGCAGTCACATCCTCTTCGTTGGCGAGGAGGGCTTATGCTAACGTCGGAGGCCCAGACGCCAGCCAGGGAGAGCTGCTGGTGTCAGTAGCAAGATTGGACCTATCGAAACCAATTCCCAGGATGACGGTGGGCAGAGTGACACTCTCAAAGGGTAGTGTAAACTTGGAATTTGTTCATTTCATTTGGCATATATTTGATGCTTTTGATTTTGAACTTTGGTTTGCAGGTAGAAATATGATGTGACGATATATTTCCACAAAATTTGCGTTTGGTAAAGCTGAGCCAGCATAATTTTGACCGTTAAGAATTAAAATTAAATCTTATTTGCGGTGCATTCGGCGGTTTCTTGACAAGGCTGTAGCGTATGGAATTTATTTTTTTTAATTTCAAGTTAACGGCGGTTTTGTTGCTGTGTCCGCTGTAGAGAGTGATGCCGGTATAAAGTGATTCCAGATCAGGCATTCCGGGAAGTTGGACGCCGCCAACTTCCTGTATAGTTTCATTGTGTCATAGATCATTTGTGTTTTAGCTGTTTCTTTATTTGAGTCAAATTTAGGGGCAGGAAGGTCCCGCTCCATTCGAAATTAATTTGCGTCAATCCTCTTATGATCTACATACAAGGTTTCTTAGCCTAAGTCGAGGAGCAGCGCTGCCGGCATAGCCTGCAGCCTGTGAAACGCTTATATGCGTATCTTATATGTATATATATATGTACTGTCATGACGTGCTGGAGGAGAATTGGTATAGGCACACACATATAAGCGATCAGCCTTGTAGCAGGAGAACTGCTGACCAGGCAATTATGTATGTTAGCCCTCAGGTGGTTGCATATATTACGTATACACTTGTGCTGGACTGCTATGCACATTTACGGCGAGTGCTGCAATTATGAATACACATAGGTACAGTGCTTAACCGTTATATTATTGCATACTACAATGAGTGAAAACAATTTGCTGACAGATTCTAGAGTCACCCAGAATCGCCATTTTCTGAACTGTTAAAGTGCAAAACTCAAAGAGACCCCGAAAACAAGTGCGTCGTATTGCAAAGTTTAATCCTGAACGCACAGGCTTAGACACTCAATCCTGAATGCGGAGACCAAGTCTACATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCAAGTATCGAGCCGCGGTTGCATAGGCCGGTGTGTGCGGCAGGCTGGCGAAATCACACGGTGGAGTCGCGCCGCCGGTTTACGCTACTGCAATCACGCGAGTTAATTGTGCGCCTGAACATCATGAAGCCAGGTGTTTATTATCTTGCAGTTGTTGCAGCGGATAAACAGCTGATAGCGCAGCAGACGATCTGGAGAGGGAGGCGTTGCCAGATCGGCCGTGGCGTGGGAGTGTTGTGTGTTGCGACAGTAGGGGCGCAGGAAATTCAAATTAAATTTAAAATTAAAGCCGTTGAAATTTAATTTAATTTAATTTTGATTCTGGTGGCTGGAGCGCACCAGAGTCTTTAAGAAAGGGGAAAAGGCACAAAGGTGGGACAGGGCCAGATATCAAATCTCTGCCGTGCTGGTGCCTGGCAGAGGCTCTGGTGTGGGGTCCGAGCGGTACAAACCTCCATCCGTAAAAGCCGAAATCCATGGCGGCTGTGACCCTAGGTAACCTTAGGCCATCCTTCAGTTGATGGACAGCGCAGTGGGGGGGCAGTCCCCAGTCGCGGCGACGTTCGGGAGGCTCCCGGCGCAGGTCCCCACCGAGGTCGTGGCCGACGCGGGCGTGCAGTCTGGTCGATGGTGGCCAGCAATACATGAAAACCGCG
->a5dc244e-5f1b-4df2-9c60-cb3128e683d8
-TTGTTGTACTTCGTTCAGTTACATTACTCATTTGCTGGTTGTTTCTGTATTTTCGGGCAAATGTTGCTTGGGTGTCGAGAAGAGGATTTTACACAGCGGTACGTTTGGTACAATGATAATATGATTTAGTATGTCGAATTCCTGGCCTTCTATAGCATTGAACGATTTCATTGTGGGGAGCTCAATATTTTATTTACATTATATATGTCTAGGTTTTTTTTTTGTTAGGCTCAATATCTACATAAAACATGTTCAGTGACGTTTGGTCCTTTGGCTTTTAATATTACTTATGTTTCTAACAACATGACCTTTTGACTCTTCATCACTTTTAATTTCATCTAAATTTGTGGAAAAATGCAAATTCTTAATAACAACTCTAAATGCTCTATCATCCTTAAGCTGGTATGTGTGGTGCTGCACACAATCATTATTAAGTGGTGTTTGACTAATTTTTCAGAATTCTTCAATACTTTAACCATTACTCTTACATGTCCAACGTTGGAGTCTTATAATAAAAAGTTCTCTCTTAATTTTAGTTTTAAGATAGGTTAACTTTTCACTTATACCATTGACGTCAGAGAAAGATGGAATTGGGGGCTTAGCAAAATCAGTTGCACTGTCTTCATTTACCATTTCGAGATCTTCGTTTTGTTATATTTGTTTCCTGTTTTGTCCAGACAATCCGTCGCTTAAGAGAGAGCAGAAATTATTTGCGCTGGTGCTTGATGGTGTCAGGGAATCCTGTTTTCTTTGAACTTCAGGGAGGGCTTGGTCTCTTTTTTGGTTTATTTTACTCTCTGCCGACAAAGCAGTTAGGTCTTCGTCGGTGTCGCTCTGCTTGAGTATTAAAGAAGACAATGATTGTTGAGTGCTTGTGTCGCACTTCGTGCCTCAAGATATGACCAAAGCAAAGACACTAGAATAATTCTAATTTGATATGACGTTTGCAATAAGCAGTTAACATTTTTTATTTTATAAATTTTTATTTTCTACTTCGTATTATTTTTATGAAATATTTTTCTCCAGTGTAATGACTTCTTTTTTTCAGTTTTTTTTATATTCCAGTTTGATATCTTAAACAGCGCACCAATTTCATCATATTCTACAGAAATTGGCCAAACTCCCAAATATGTATGTACATATGTAAATTCGTTACTGCGATCAGAATTGATTTCGGCCGAAAATCGCCTTCTAGCACAACACGCACATATACGCGTTCTCGTCTTTTGTTTTACTCACACAAGCAAGCAAATTCTATTTTAGATTTCTTACACGCTCAGCGTGAGCGAGCGGAAAAGAAACAATTTTGGCCGTCACCAAAAAAAAGTGGCTGCATAGTGCCAAACAGTGTATGGCTGTTACGCATCTTATTATTCTAGTGTCTTTGATGCAGGCCATGTGACTTTTGCTTAAATGTGTACATACTTTCCAACACGCCACCTCAAAAGTAAGATTGCTGTACTTTTATTACTCACGAGACTGTGCGTCCTTCTGACGAATAATTTTGATCCAGCATTCGTTTGCGAGGTGTTGGGGGGCAAGAAAACAACCAGATCAATTGAACATATTATTTTACACAAATTCAGTTTTGCAAACTATTTTTAACTAAAATTAATATTAGTCATCTTTGTAAGAAACTCAAAATTATCCAGTAAGCAATTAAATTTGGATTAAATGATAGTTAGTTTAGTTAGTTCAGTCTGGTTCACCGTCAGTTCAATCCCTGAGAATATAATGTTTTAATTCATTCCTGAGAGTCAAAGTCCACTTCTCAATGTAATAGATCTTGCAGATAGTACCGGCAAGTTGTAAATTTGTAGATATATACAGTTTGTCAAGAAACTATTTACACGCCGTGAAATAAGTTGAATTTTTTGCTGAGTCAAAATTAAGGAGGTTATTTCTTTAATTAAACGCAATTTTTTTAATGAAATATAATTAAACAATATTTATTTTGCCGTTAAAAACAAATTCAAAATATCAAATATACAAGAAATTAAACAACAAATTCCAAGTTTACACTTTTGAGAGTGGCAAAACTCCTTACACATTTTGTTTTCCCTGCTTTGTTTTGCTCTTTTCTTAGAACAGACTCGATTTTTCCGTTATTTTTTGGCATTTGCATTCCTTTTACAACGCTTCTATTGAAATTTTTTTACTTTGCTTGTGAAATTTTGCTGATCCAAGATAGGTTATTAAATTTAATAAAATGCCTGGAAATAAGATTAGCTTTGGAAGTGACCCAAATATTATACTAAAACCACCAGTTGGAAAATCTATTCCAGAATTAGTATAAATGTTTTTCTGTCCGTAAGACCGTCTACAATGTTTTAATCGCTTGAAAAAAAAAAGAGAACAGGCTTGAACCTAAGTGGTGGGCCGCAAAACTAAAATTAAGCGTGTAGACCGCCTTATTATGCGAAAGTGATTGCGAACCCCCCGAATCTCGGTCAGATCCTTGCTCAGGATATCCAGGCAAAGAATGTGACCTAGTTGTGCCACACACAAACTGTGCGCCAAGTCATTCTACGCCATAGGTACTCTTCAAGAGTTGCAAGAAAAAAAGCCTTTGCTATCAGAGGTCAATATGAAAAGCGTCATTCATTCGCTGTGACATGATGGATCATGCGGAAGAGTACTGGGATGACGTAATGTTACACTACCAATGACAGAAACAAAATGATGCTCTATTATAACGATGGGCCAAGCAGGTATGGCGCAAGCTGTTGAGTGCGCTAGAAAAACCAGAAATATCATTCCAACAATCAAATTTGGAAAATTATCAGTGATGATTTGGGGCTGTATCTCAAGCCATGGAGTGGGCAAATTAGCCTTTATTGAAAGCACTATGAATGCCGTGCAATATCTAGATATTTTAAAATCAAATTTGAAGGCCAGTGCAGAAAAATTTGGTCTATTTAACAACAACAAGCCAAATTTTAAGTTTTATCAGGACAATGATCCCAAACATAAAGAGAGTGCAATGTACGCAACTGGCTCCTTTATAACTGTGGCAAGGTGATCGATACGCCCCCTCAGTCTTGATCTGAACCCCATTGAAATTTGGGCCTGCTAAGAAGAATGTGGCAAAGGGCGCAAAACACGACAACAGCTCATGGCTGCATTAGAGTGGGAAAAGATCGCTTGAATACTTGACCACAAAAACTCATCCATTCCATGAAAAAAAGCTTCAACTTGTAGCCAAAGCCAATGGGGGTCATACTAAATGCACAACTTTTCAAATTTTAAAATAATTTAAAATTTAGGATTAAACTTAGGTTTAGTGTTTTATTGTAAAGAGTTTCTTTAAAACTCTCAAAAGTCATTTAAACTTGATTCGTTGTTTATTTTCTTGTATATTTGATATTTTTGAATTTGTTTTAATTTTATAAGTAAAATAAATATTGTTTAATTATAACCTAAAAAAAAATTGCGTTTAATTAAACAAATAACCCTTAATTTTGACCGTTAAAATCAAAATTCATCTTATTTCACGGTGTCGCTGATTTCTTGACAAACATATACTGTCTGAATTTATTTTTAATTTCAAGTTAACGACCGTTTTCTGTTGCTGTGTCCGCTGTAGAGAGTGATGCCGAGTATAAAAGTGATTCAGATCCGACATCAGAAATTGGGACCGCCTACTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTTGTGTTTTTTAGCTGTTCTTTATTTGATCCAATTTGAGAACAGGAAGGTCACTCCATTCGAAATTAATTCGTCCCAATCCTCTTATGATCTACATACAAAGGTTTCTTAGCCTAAGTCGAGGAGCAGCGCTGCCAAGCGTAGCCTGCAGCGCAACGCAACGCTTATATGCGTATCTTATATATATGTATATATATGTACTTGTCCTCCGAGAGCGATGGTGCTGGAGGAGGAGTGGTATAGCAAGGCACACATATAAGCGATCAGCCTTGGCCTTGGGAGAACTGCTGACCAGGCAATTATGTATGTTAGCCCTCAAAGTGGGTGCTCGTATTACGTATACACTTGTGCTGGACTGTTTATGTACACATTGCAACAGAGTGCTACAATTATGAAATGCATAGGTACAGTGCTTAACCATTATGTGTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTAGAGTCGCAGAATCGCCATTTTCTGAACTGTTAAAAGTGCAAAACTCACAAAGAGACCAAAAAGCTCGAAATGCTGTCGTATTGCCAAAGTTTAATCCTGAACGCACAGGCTTAGACCTCAATCCTGAATTGCGGAGACCAAGTCTACATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCGAAATATCGAAACCATAAGTTGTGTCGGCCGGTGTATTGCGGCAAAACTGGCAAATCACACAGTGGAGTCGCGCCATAGTTCTGCGCTGCAATCCGCGAGTTAATTGTGCGCCTGTTTCATGTAAATGGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAACTAACTGATAGCGCAGCGGGCGATCTGGAGAGGGAGGCGTTGCCGGAATCAACCGTGTGATCAGTGTTGTTGCGACAGTAGGGCGCGAAATTCAAAGGTAAATTTAAGAATTAAGCCGTTGAAATTTGAATTTAATTTAATTTTGATTCTGGTAACTACAGAACACAAGTCTTTAGAAAGGGAAAAAAGGCACAAGGTCGCGGACAGACCAAATATCATCCTCTCACCGTGCTGGTGCCTAAGCAGAGCTCTGGTGTCGAGTCGAGGCAGGTACAAGCCTCCATCCGTAAAAGCCGGGAAATCCGTGGCCTGCATTGACCTAGGTAACCTTAGGCCATCCTTCAGTTGATGGACAGCGCAGTGGGGGGCAGTCCCCTGATCGCAACGACCCGTTCAGGAGGAGCTCCCGACTTCGAGATCCCCCCACCAGAGGTCGGTAGCCCGACCCATGGTGACGGAATCTCGGTCCCGTCGGTGGCAAGGGTGAGCACGCAGGCCCCAGCCGCCGTTGACTATCGATGCAGCGATGCTGTAGGGTGGAAAATTGGCTCCTACAGCATCTACGACCGCGATAGATCGAAGACGATGGACCACATCGCCATTGCCATCGCAAAGACGGAGGAAGTCCCAGCTTGTTCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCCAGAACGGGACCACAGGGGCATACTTACCAGGATGAATGGCAAGATCAGCCTTCTATCCGCATTCGAGACCCAACGACACACATAGAGACAAAGGGCATAGCTTCCGAACTCTCAGCCCATAACAACAGGGCGATAGAGCTGTACGAAGGTACTACTAGCGAGCACCGCTTGAAGAGCAGCGCTGCAGACGGTACAAAAAAGCCTACCAAAAGGCTCCACAAAGATGCGCAGGTACTACGGTGCAGGTGCAAAGTCAGGCGCCGAAGCAGAGCAACCCCTACGTTGGATGGCAACGGTGAAGAAAAGGCGACATCCATACCTAGCGAGGTCAAGCCAGGCAGCTATGCATCTCATGAAGTCACTAGCACGGGTGCAGAGAGGCACTCATCGTAAAAAAGACAGGAGAGGGCTTCGTACCCGCAGAGATGCTTCGGAAGCTAAGATCGGAATCAGGCCTTAGCGAACTGGTGATCACGTGCGAAAATCCGGAGAACGCAGAAGGTGATCTGTTGCTTGGTGGGGAAAGCCGGAAAGCGTTCCCAGAAGTTTAAAACGACCTGGAAGCGGCGCTCAATGACTTGGCCTCTGTGCGCACAGGGCGCAAAGAATAGCTCTATCTTGCAGCGAAAGTTGGACGAGGCTACGACAGCAGAAAGCTCCACAGCTGCTTGGTCGCCCAATTCCAGGGCCTGCAGATAAATCCTGAGATATCAGGGGCCTTCGCGGTATGCGGAATTGCAAACAAATGAAAGCCTCAGTGCTGCTGGCGAACGCGAACGTTGCGATACCAGTCCTTAAACAGGGCACCATAATCGTTGGATGGTCAGATGTCGCGTATCGCAGGACGTCCGACCCACGAGATGCTACAGGTGTCGGCTATGGGCATCGATCAGCAACCTGCAAAAGGACACTGGCAAGGGGCAGACTGCTGTCTTAGATGCGGTGAGCGTCGGGCACAAGGCAAAGGGGTGCGTTGCTGCACCGTCACCTGATCTGCAGCAGCGGTGGACAGAAACCACCGACGGGTAGCTTTGCGTGCCCGACTTACAGAAGCGACACTAAAGATGCCAAGAGCCACCTTAATGCGCGCTCATATTAGCGTAGTACAGCTCAATGTCAATCATTGCGCAGCAGCTCTCAGAGCCTCCTGGCCCAGACTGCGGTTAGGCGCAATGTAGACATCATGCTCCTAAGCGAACCCTACGTCTCTGGTAGTGGACAATCGTCCACGATCATGACGGGCAGGTAAAGCAGCTATCAAATGCTGCAGCTCTCTCCAAGTCAGGAACTGGCTGCTTTACCCATGCGGGGTATCGCTTAGCATGCGAAGTTAAAACGTGCACATGTACAGCTGCTACGCTCCGCCGAGCGACACCCCGATCAGTTCGAGGAGCTTCTGGAGGCGCTCGTGGACCATGCGAGAGGGCGAAGCCCGAAGGTCATTGCCAGCGACTTTAATGCCTGGACGGTGGAATGGGGCAGCAGGACATCCAACACCAGAGGACGAAGGCTGTGATTGACGCCATGCGAATGCTGGACCTCATGCTGCGAACGATGGACGGAAAGCCGACGTTTAACAACGATAGGGTACGTCCTTTGGCGTTACACCTTTGTCAGCGAGGCTAGTAGACAACAACAACTGGATGGTCCATGACGTCGCTGACGCTGAGCGACCATGCCTGATCTCCTTCTCCCGGAGGCATGCCCAAAAGACGGCAGAGTAGAACAGCCGGGAAAACATGGGACACCAGGAAGATCGGTAGAGGCCATGCTGGCCTGTATCAGATCAATTCCTGGAAATCCCAAATGTGGACGCAGAGAGTATGGCGGCAGGCCTCATGAATATGCTGGGAAGAATCTGCGACACCAATCATGCCAAGGAAAAAATAAGGCACAGCCTGGAAACCACCCGTTTACTGGTGGAGTGCCTCCTAAACCAACTACGGTCTACGGTGCCTCCAGGGCTAAGAGAACGGCGCAACAGGCCAGAGGCGAGTACCTTACCACGCGGAACTCTTGGAGGCTTTCCGGCAAACGCCTGAGTTCAAGCACGGCATCACGGCTGCCAAAGCGCGGTCGTTTAAGGAGGCGCTGCAGGATGGCGTAGACAGCGATATCTGGGGCCTCGCCACCACAAGCTTGTTACCAACGAGCTAAAGGAGGAGAGCGGCAACCCCATCCGACCCGGGGGTCCTGGCTAACATACTAGGGGAGCTATTTCCAAAGCAGACCACACTATGGAGGCCAGCAGAGGCAGCCCTGCCCAGATTTCCCGTGCGTCACAGAACTTGAAGTCGTCGAGGCAGCTGTTTCGCTGACGATGTGGCAATCACAGCCAGGCTAATAGCGGCTCACAAGACCGAAGCAGTCCTACTAAGCAGCAGGAAAAGATGGAGAACATGCTGGTCTCCGTCAAAGGGTACTCAGGGGACCTCTCAAGAGTCCCTAAAGTACCTGGGGGGTAATGATAGATCGCAGACTATCGTTCAAGAGACCACATGACTACGCCAGCAAGAAGACAGCAGTCACATCCTCTTCGTTGGCGAGGCTTATGCCCAGCGTCGGAGGCCCAAGACACCCGGCCAGAAGCTGCTGGTAGCAATACGCCATA
->4e46d316-c191-40b1-bec4-fab4be850da6
-CCGCCTTACTTCGGTATTGCTTCCGTTTCCAGTTACGTATTGTTGCTAAGAGGATGTGACTGCTGTCTTCTTGCTGGCGTAGCTCGCGTGGTCCTTGAACGATAGTCACGCGATCTATCATTACCCCAGGTACTTTAGGGACTCTTGAGAGGTCCCCTGGTACCCTTGACGGAGACCAGCATGTTCTCCATCTTTTTTTTCCTGCTGCTTAGTAGGACTGCTTCAGTCTTGTGAGCCGCTATTGCTAGCCCGGCTGTGATTGCCACATCGTCAGCAGAAACAGCTGCCTCGACGACTTCAAGTTCTGTGACGCACAGCAAATCTGGGGCGGGGAGGGCTGCCTCTGTTGGCCTCCATAGTGTGTGGTCTGCTTTGGAAATAGCTCCTAGTATGTTAGCCAGGACCCCCCGGGTCGGATGGGGTTGCCGCTCTCCTCCTTAGCTCGTTGGTAACAAGCAGCAGGCGAGGCCCCAGATATCGCTGTCTACCACGCCATCCTGCAGCTCTCCTTAGAAAGCGACCGCCTTTGGCAGCCGCGATGCCGTCTTGAACTCTAGGCGTTTGCTTCTGAAAGCCTCAAGAGTTCCGCGTGGTGGAGTGCTGCCTCTGGCTCGTTGCGCCATTCTCTTAGCCCTGAACCTTGAAATCAGACCGTAGTTGGCTTGGGAGGCACTCCACCAGTAAACCCGGGTGGTTTGCGCTGTGCCTTATTTTTTCCTTGGCATGATTGCGTCGCAGATTCTTCCAGCATATTCATGAGGCCTGCCGCCATACTCTCTGCGTCCCATTTGGGATTTCAGGAATTGATCTGATAGGCCAGCATGGCCTCATCATCTTCTGGTGTCCCATGTTTTCCAGCTGTTCTGCTCTGCCGTCTTTTGGGCATGCCCTCGGGGAGGAGATCAGGGCATGGTCGCTCAGCGTCATGACGTCATGGACATCCAGTTGTTGTTGTCTACCTAGCCCTCTGCTGACAAGGTAACGTCAATAAAGGACGTACCCCTATCGTTGATTAAACGTCGGCTTCCGTCCATCGTTCCAGCAGTATGAGTCCGGCATTTCGCATGGCGTCAATCACAGCTCGTCCTCTGGTGTTGGATGTCCTGCTGCCCCATTCCACTGTCAGGCATTAAAGTCGCCGGCAATGACCTTCGGAGCCGCCCTCTCGCATAGTCCACGAGCGCCTCCAGAAGCTCCTCGAACTGATCAGGGGTGTCGCTCGGCGGGCGTAGCAGCTGTACGTATTGCACGTGTTTTAACTTCGCATAAGCGATACCCGCATGGGTAAAGCGGCAGTTCCTGGACTTGGAGAGCTGCAGCATTTGATAGCTGGCACACCTGCCGTCAGGATCATGGACGATTGTCCCACTACCAGAGACGTAGGGTTCGCTTAGGAGCATGATGTCTACATTGCGCTCCAGCCGCAGTCTGGGCAGAGGCTCTGAGCTGCTGCGCAATGATTGACGGTAGGCTGTACTACGCTAATATGAGCGTGCATTAAGGTGGCTCTTGGCATCTTTAGTGTCGCTCTGTAAGTCGGGCTGCGCAAAGCTACCCGTCGGGTGGTTCCTGTCCACCTCGCTGCTGCAGATCGAGCATTTTTGGTGCAGCAACGCACCCTTGCCTTGGCTTACGCTCACGCGTAAGACAACAGTCTGCCTGTCAGTGTCCTTGCAGGTTGCTGATCGATGCCCATAAGCCGAACACCTGTAGCATCTCGTGGGTCCGGACGTCCTGGATGATACGACATCTTGACCCATCCAACGATTAGCGGTGCCCTGTTTAAGGACTGGTATCGCAACGTTCGCTGCGTTCAGCAGCACTGAGGCTATTTGCTTGCAATTCCGCATACTGCGAAGGCCCCTGATATCTTCGGTTTATCTGCAGAGGCCTGGAATTGGGCGACCAAGCAGCTGTGGGCTTCTCTGCTGTCGTAGCCTCGTCAATCCGCTGCAAGATAGAGCTATTCTTTGCGCTCTACTGTGCGCACAGAGGCCAAGTCATTGAGCGCCGCTTCCGGGTCGCTCTTAAACTTAGGAACGCTTTCCGAAGCTTTCCCCTCTACCTCAAGCAACAGATCACCTTTCTGCGTTCTCCGGATTTTTTCGCACGTGACTGCCCAGTTCGCTAGGCTCGGTCCGATCTTAGCGCCGAAGCATCTCTGCGTACAGAAGCCTCTCCTGTCTTTTACGATGGAGTGCCTCTGCACCCGTGCTAGCATTCTTGGCGACAGATGCATAGCTGCCTGGCTTGGACTCGTTAGGTATGGATGTCGCCTTTTCTTCACCGTTGCCATCCAACGTAGGGTTGCTCTGCTTCGGCGCCTGGACTTTGGCACCTGCACCGTGGGTACCTGCGCATTTTGTGGAGCCTTTTTTTGGTAGGCTTTATTGCCTCCGTCTGGGTAGCGCTGCTCTTCAAGCGGTGCTCGCTGAAGTAGTACCTTCGTACAGCTCTATCGCCCCCCCTGTTGTTAGGGGCTACGAGGTTCAGGCTTCTGCCCTTTGTCTCTCATGTGTGTCGTTGGGTCTCGAATGCGGATAGAAGGGGCTGATCTTGCCATTCATCCTGGTAAGTATGCCCCTCAAGGTCCTCGTTCTGGAGAGCAGTGGTCAGATCCGAAGACCGATGAGGGTCAGCTGGGGACTTCCCTCCCGTCTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCTGACTTTGTCGCGGTCATTAGATGCTGTAGGAGCCAATTTCTCCCACCTCTACAGCATCGCTGCGATCGATAGTCAGCGGCGGCTGGGGGCCTGCGTGCTCACCCTTACCGACGGGACCGAGATTCCGTCACCATGGGTCAGGTTACCGACTCCTCTGGGTGAGGGGATCTCCGAAGGGAGATCCGGGAAGCTCCTCCTGAACGGGTCGTTGCGATCAGGACTGCCCCCACTGCGCTGTCCGTAACTGAAGGATGGCCTAAGGTTACCCTAGGTCACGTAGGCCACGGATTTCCCCTGGCTTTTACGGGATGGAGGTTTGTACTCGGCTCGGATTTTGAGCCTCTGTAGGCACCAGCACGGTGAGAGGATGATATTTGGTCTGTCCGCGACCTTTGTGCCTTTCCCTTTCTTAAAGACTTGTGCGCTCCCAGTTACCAGAATCAAAATTAAATTAAATTAAATTTCCAACGGCAATTTTTTAAATTTAGTTTTGAATTTCGCGCCCTACCAGCCGCAACACAACACTGATCACACGGTTGATCTGGCAGCGCCTCCCTCTCCAGATCGCCCGCTGCGCTATCAGCTGTTTATCCGCTGCAACAATCGCAAGATAATAAATTACCCTATTTACATGAAACGGGCGCACAAAGATTAACTCGCGTGATTGCAGCTCCGGGCTATCGTACCCGACTCCACACCGTGTGATTTTTTTGCCAGTTTGCCACACCGGCCGACACAAACTTCTATGGTTCCGGAGGTATTTCGCGCCGCGTAATTTAAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCCGCACCAGGATTGAGTGTCTAAGCCTGTGCGTTCAGGATTAAACTTTGGCAATACGACGGCATTGAGTTTTGGGTCTCTTTGTGAGGTTTGCACTTCTTTTAACAGTTCAAGAAAAATGGCGATTCACCG
->cb251471-4026-4bb5-99cf-349062f4a487
-TTGTTATTGCTTCGTTCCAGTTACGTATTGCTAATCGAAGACGTTTGTTTTGTTGGTTGGTATGATCTCAATCGTTTTGCGAACAAAGTATGTCTTAAAATCAGCTTCTTTTAGCCGCGACTGAATTGTAGAACTACTAACTTGTTTGCCAATTGTATTTTTTGATTCTAAGGCAATTTTACCGGACTGGCACTAGGATTCTTCGCCACAACTCCAAGTATTTGCCTGCATTGCCTTTGGTCCAGCACAGGTTTTTTTTCAGCCTGATCTTTTTTTTATTTTTAATGTACCAACTGCTTATCAAACTTTTATTAAGTAGTAGACAGTTCGCGAAATTTGGTCTCCATTTTGGCTATTTTGTACCAGGTGTATTACCGGCTTTAAACCTAGCAACAATACCAGCCCGGGCCTCAATGTTAACTCTTTTGGTACGGGCGTTTTATTTTAATAACTTTGTAGGAAAATGATTAAATCTAATTTTATTCAATGAATTTAAATGTATTTAAGCAATATAAACCGGCACTTGTCACTCTAAACCAATCACTGAAGAAGAAATTGCGTTGTGAAAATAAATTGTGATGCGACAGAACCGTGTGCAAATACTTCTGACAACTGATAAAGATCTCTTCGACCTCTTCCTTGCGCATAGGAACAGTTATTTTTTTCAATTCTTCTTTCATCTGACTCTGCATAGGTTTAGTTGCAAAAGAAACAAAAGAAGTTTTGCATTTCCACCTCCCTTGCTGCACAAGCAACTGTTTGTGACCATGCACAAAAAATGCACTTTGTGAAAATAATTTTGACCATGACTGTATATCGAGTTTGCTAGCCATTATTGAATTAGCTGAGTATCAAAAGTGTGTAGAAGAACTCCACGGTCGTCTTTATGTCCCCGACATCAAGAGTTTTGTCGTCTTCCCGGAAATACTCTCTGGGCTACAAAACCGGCCTTGTTCTCCACTTTAGCCTCTTTGGATCAATTTTTTCTCCTAAGCAACTGTCAACAACAACAACGCAAGAGTCAGGTTCACATCCTTCAATCACTGTATTTTTCCAGAAGGTCAATGTCGATACTTTCTCTCCCCTTTCAAGGAATTCCTTCTAAATTCTTCTCCAGTACTTGTGAAATAAACATGTCACCACTTTCTTCGTCGGTAGAAATATCCCAATCGAAGTTTAAATCCCGTTAATTTCTTCGTTAGACAAACCTTTCTTTCAGTGAAAATTATTATCTGAATGCCCAAGGTTGCTCACAGCAACTTAGAAAATTATTTACTTACTTATTATTGTTCACTACTTACTAAGTTTGACTAAATCACTGTCTTGTTAACTCTTTGCTGTTTATACTTTAGAGTTCTTTTAAAAATTATTATAAAGTAAATTAATAATTCCAAAAGTTGCACCGAATATCAGAGCAATAATTATTGTGATGCGCGTGTATTTATTACCAAATAATTCCCGTTAATATATTCGTTTTTTGCTTTTATATTTAGAGTAGACACATAAAAGCACCGTTATCATAAAAGAATCAGCAGATAAAACAAAAGGCTTACAGTTAGCTCTGAAAACATAAAGGGGAATTGCTCACAAAGCAACGTTGGGTGCGAAAGGGTTAAGTTGGTATCTTTCTACTATCAGTAGGCCGAATATGTAGGCTTGCCAGGTTAGAAAGTGTTGTTATGCTGTTGTTTTACTATGCATTTTGTACAGTTCGCTTCCTTCAGGCTTAGCATTGAAGTCACCTCCTACTACGCTTCCATATTCCAAGGTTAGGATTTACTTGCATAATTTGTTTTACAAGTAACATTATCATGTTAAGAAATGCAAATTATTTGTAAGTTCAGACTGTTTTCCTAATAGTTGCTCTATTCTCTCCAGTGATGTGTTTGTTTTGCTATTTCCTGCAGCAATTTTGGGCATAAGATTGATAATCGTTACTTTGTTGGGTATATATTTGGCTTGTTAGGCCGGAACAAACTGCTGGATTCCTAAATCATTTTTTACTCAGATCATTATTTCTATTTTCTATTTTTTGGACAAAGAGTTCCTGATAAATTCTACACCCTTGTAGCTGGCGGCGTGTTCTTCGTAGCAGTTGGCACATTTGCTGGTTGCCTGTATTTTTTTTCGGGCAAATGTTTGTAGGTGTCGGGAAGAGGATTTTACACACAACAGTACGTTTTGGTACAATATGATTTTGGCTGTCGAATTCCTGGCAGCTATAGCATTAGACGTTTCATTGTGGGAGGCTCAATATTTTATTTACATTATATATGTCCTAGGTTTTTTTTTGTTAGGCTCAATATCTACATAAAACATGTTCAGTGACGTTTTGGTCGCACGGCACTAATATTACTTATGTTTCCTAACAACGCGACCTTTTGACTCTTCATCACTTTTAATTTCATCTAAATTTGTGGAAAAAAAAATGCAAATTCTTAATAACAACTCTAAATGCTCTGTCATCCTTAAGCTGGTATGTGTGGTACTGCACACAATCATTATTAAGTGTTTTGACTAATTTTCCAAGAATTCTTCAATGCAACCATTACTCTTACATGTCCATAACGTTGAGTCTTATAATAAAAAAGTTCTCTCTTAATTTTAGTTTAAGATAGGTTAGCTTTTCACTTATACCATTGACGCGTCAGAGAGAAAGATAGGTGGGGGGCTTAGCAAAATCAGTTGCACTGTCTTCATTTACCATTTCGAGATCTTCGTTTTTTGTTATATTTGTTCCTGTTTTGTCCGAAGACGAAATCCGTCGGCAAGAGCAGAAATTATTTGCGCTGGTGCTTAGTGAATTGTCAGAAGTCTATTTTCTTCCCAGACTTCGGGAGGGGCTTGGTCTCTTTTTTGGATTGCATTTGCTCTCTGCCATTTCAAAGCAGTTAGGTCTTCGTCGGTGTCGCTCTGCTTGAGTATTAAAGAAGACAATGATTGTTGAAGGTGCTTATTAATCCGCACTTCGTGCCTCAGGATATGACCAAAGCAAAGACACTTCGAATAATTCCTAATTTGATATGACGTTTTGCAATAAACAGTTAACATTTTATTTTATAAATTTTTATTTTCTACTTCGTATTATTTTTACTGAAATATTTTTTTTTCTCAGTGTAATGACTTCTTTTTTCAGTTTTTTTTATCGGCAATTTGATATCTTAAACAGCGCGCAATTTCATCATATTCTACGAAATTGGCCAAAACTCCCAAATATGTATGTACATATGTAAATTCGTTACTGCGATCAAATTGATTTCGGCCCGAAATCGCCTTCCTAGCTGCTTACGCACACATATACGCGTTCTCGTCTTTTGTTTTACTCCACACAAGCAAGCAAGATTCTATTTTTAGATTTCTTACGCTCAGCGTGAGCGAGCGGAAAGAGAACAATTTTGGCCGTCACCAAAAAAAAATTGTGCATAGTGCCAAACCAGTGTATGGCTGTTACGCATCTTATTATTCTAGTGTCTTTGATGCAGGCCATGTGACTTTGCTTAAATGTGTACATACTTTCCAACACGCCACCTCAAAGTAAGATTGCTGTACTTTTATTACTCACGAGACTGTGCGTCCTTCCTGACGAATAATTTTGATCCAGCATTCGTTTGCGGCGAGGTGTTAGGGGAGACCCGAGAAAACCAACCAGATCAATTGAACATATTATTTACATAAATTCAGTTTTGCAAACTATTTTAACTAAAATTAATATTAGTCATCTTTGTAAGAAACTCAAAATTATCAGTAAAGCTTAATTAGAATTTAGTTAAATGATAGTTAGTTTAGTTAGTTCAGTCTGGTTCCTCGTCAGTTCAATCTAAGAATATAATGTTTTGAATTCATTCCTGAGAGTCAAAGTCCACTTCTCAATGAATCTTGCAGATGGTACCAGCAAGTTGTAAATTTGTAGATATATACAGTTTGTCAAGAAACTATTTACGCCGTAGAAGCAAGTTGAATTTTCACTTTAAAGGTCAAAATTAAAGTTTATTTCTTTTAATTAAAACCGCAATTTTTAATGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAACAAATTCCAAAATATCAAATATACAAGAAATTAAACAACAAATTCAAGTTTACACACTTTTGAGTGGCAAGAAACTCCTTACACATTTTGTTTTTCCTACTTTGTTTTGCTCTTTTTTCTTAGAACGAACTCGATTTTTTCCGTTATTTTGGCATTTTGCTTTTTTTACAACGCTTCTATTGAAATTTTTTTACTTTGCTTGTGAAATTTTGCTGATCGAATGAGTTATTAAATTTAATAAAATGCCTGGAAATAGATTAGCTTTTGGTGACCCAAATAATATACTAAAACCACCAGTTGGGAAAATCCTATTCCAGAATTAGTATAAATGTTTTCTGTATCCGCTAAGACCGTCTACAATGTTTTTAATCGCTTGAAAAAGAGGAACAGGCTTGAACCTAAAGAGTGAGTGGGCGCAAAACTAAAGGTGTAAAGCGTGTAGACCTTATTATGCGAAAGTGATTGCGAATTTGCGAATCTCAGTCAGATCCTTGCTCAGGATATCAGGCAAGAATGTGACCCTAGTTGTGCCACACAAAACTGTGCATAAGAGTCATTCTACGCCATAGGGTACTCTTCAAAGAGTTACAAGAAAAAAAGCCTTTGCTATCAGAGGTCAATATAGAAAAGCGTCATTCATTCATGAGCATGATGGATCATGCGGAAGAGTACTGGGATGACGTAATTATTTTATTGACAGAAACAAAAGAAATGATGCTCTATTATAACGATGGGCCAAGCAGAGTATAGCAAGCTGTTGGTACGCTAGAAAAACAAAATATCATTCCAACAATCAAATTTGGAAAATTATCAGTGATGATTTGGGGCTGTATCTCAAGCCATGGAGTGGGCAAATTAGCCTTTATTGAAAGCACTATGAATGCCGTGCAATATCTAGATATTTTTAAAATCAATTTGAAGGCCAGTGCAGAAAAATTTGGTCCTATTTAGCAACAACAAACCAAATTTTAAGTTTATCAGGACAATGATCCCAAACATAAAGAGAGTGCAATGTACGCAACTGGCTCCTTTATAGCTTTGTAGCCAGAATTGATCGATACGCCCCCTCAGAGTCTTGATCTGAACCCCATTGAGATTTGTGGGCCTACTTAAAGAAGAATGTGGCAAAAGGGGCGCAAAACACGACAACAGCTCATGGCTGCGATAGAGTGGGAAAAGATCCCTTGAATATGACCTAAAAAAACTCATCCATTTCCACTTGAAAAAAAAAAAAGCTTCCAACTTGTAGCCGAAGCCAATGGGGGGTCATACTACTAAATGCTACAACTTTTCAAATTTTAACAAAATAATTTAAAATTTAGGATTAAACTTAGGTTTAGTGTTTTGTGTAAAGAGTTTCTTTGGAAACTCTCAAAGTGTTTAAACTTGGAATTCGTTGTTTATTTTTCTTGTATATTTGATATTTTGAATTTGTTTTTTTTTTTAATTTATAAGTAAAATAAATGATTGTTTAATTATATTTCCTAAAAAAAAAAAAAAAAAATTGCGTTTAATTAAGCAAAATAGCCCTTAATTTTGACCGTTAAAATCAAAATTCATCTTATTCACGGTGTGTAAACAGTTTCTTGACAAACTGTACTTGTCGCAGATTATTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTGAAGTGATGCCGAGTATAAAGTGATTCAGATCCGACATCCAAGTGGGACCGCCTGCTCCAACTTCCTGTAGTTTTCATTGTGTCATAGATCATTTGTGTTTTAGCTGTTCTTTATTTGATCAATTTGAGGAACAGGAAGGTCCACTCCATTCGAGGGAGTGAATTCGTCAATCCTCTTATGATCTACATACAAAGGGTTTCTTAGCCTAAGTCGAGGAGCAGCGCTGGCATAGCCTGCAGCGCAGCAACGCTTATATGCGTATCTTATATATGTATATATATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAGAGTGGTATAGGCACACATATAAGCGATCAGCCTTGGCCAGCAGAAGAACTTTACTGACCAGGCAATTATATGTTAGCCCTCAAGTAGGTGCTCGTATTGCGTATACACTTGTATGCTGGACTGTTTATGTACACATTGCAGCAGAGTGCTACAATTATGAATACATAGGTACGGTGCTTAACCGATATGTGTGCATACTGCAATAGTAGAAACAATTTGCTGACAATTCACAAGTCGCGGTCGCCATTTTCTGAACTGTTAAAGAGTGCAAAACTCACAAAGAGACCCAAAAAAACTCGAAATGCTGTCGTATTGCCAAAGTTTAATCCTGAGCGCACAGGCTTAGACACTCCAATCCTGGTGCGGAGACCAGGTCTACATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCGAAATGCTCGAAACCATAGAAGTTGTGCGTCGGCCCGGTATTGTGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCATAGTTCGCGCTGCAATCACGCGGAAGTTAATTGTGCGCCTGTTTCGTAACAAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAACAACTGATAGCGCAGCAGGCGATCTGGAGAGGGAGGCGTTGCCAGATCAACCGTGTGATCCAGTGTTGTTGTGTTGCGACAGTAGGGCGCGAAATTCAAAATTAAATTTAAAATTAAGCCGTTGAAATTTAATTTTAATTTAATTTTGATTCTGGTAACTGGGGCGCACAAGTCTTTAAGAAGGGGAAAGGCACGAGGTCGCGGACAGACCGATATGTCCTCTCACGTGCTGGTGCCTAAGCAGAGGCTCTGGTGTCGAGTCGAGGCAGTACAAACCTCCATCCGTAAAAGCCAGGAAATCCGTGGCCTGCGTGACCCTAGGTAACCTTAGGCCATCCTTCAGTTGATGGACAGCGCGGTGGGGGCAGTCCCCTGATCGCAACGACCCGTTCAGGAGGAGCTCCCGACTTTCCGAGATCCCCACCAGCAGAGGAGTCAGTAGCCCGACCCATGGTGACGGAATGCCAGTCCCGTCAGTGGCAAGGGTGAGCACGCAGGCCCCAGCCGCCGTTGACTATGACTGCAGCGATGCTGTAGGGTGGAGAAATTGGCTCCTACAGCATCTACGACCGCGACAAGTCAAGAGACGATGGACCACATCGCGTGCCATCACGCAAAAGACGGGAGGGGAAGTCCCAGCTTGTTCCCCTGTGGTCTTCGGACTTGACCACCTGCTCTCCAGAACGAGGACCTGGGGGCATACTTACCAGGATGAATGGCAGATCAGCCCCTTCTATCCGCATTCGAGACCCAACGACACACACTTGAGACAAAGGGCATAGCTTCCGAACTCTCAGCCCATAACAACAGGGCGATGGGGCTGTACAGAGAAGGTACTACTGCGCGAGCACCGCTTGAAGAGCAGCGCTGCAGACGGAGTACAAAGCCACAAAGGCTCCACAAAATGCGCAGGTACCCACGGTGCAGGTGCCAAAGTCAGGCGCCGAAGCAGAGCAACCCTACGTTGGATGGCAACGGTGAAGAAAAGGCGACATCCATACCCACAACGAGTCAAGCCAGGCAGCTATGCATCTGTCGCCAGAATGCTAGCACGGGTGCAGAGCACTCATCGTAAAAAGACGGGAGGCTTCGTACGCGAGATGCTTCAGGCTAAGATCGGAATCGAGCCTTGAACTGGAGCGATCACGTGCGAAAAATCCGGAGAACGCAGAAGGTGATCTGTTGCTTGGTGGGGAAAGCTTCCGGAAAGCGTTCCCCAGTTTAAAACGACCTGGAAGCGGCGCTCAATGACTTGGCCTCTGTGCGCACAGGGCGCAAGAATAGCTCTATCTTGCAGCGAAAGTTGGACGAGGCTACGACAGCAGAGAAGCTCCACAGCTGCTTGGTCGCCCAATTCCAGGGCCTGCAGATAAATCCTGAAGATATCAGGGGCCTTCGCGGTATGCGGGTGCAAACAAATAGCCTCAGTGCTGCTGAACGCGAACGTTGCGATACCAGTCCTTAAACAGGGCACCATAATCGTTGGATGGTCAGATGTCGTATCACCCAGGACGTCCGACCCGAGATTCTACAGGTGTCTCGGCTATGGGCATCGATCAACCCAGCCTGCAGGACACTGACAGGGCAGACTGCTGTCTTAGATGCGGTGAGCGTGGGCACAGGCAAAGGGTGCGTTGCTGCACCAAAATGCCTGATCTGCAGCAGCAGGGTGGACGAAGCTCACCCGACCTTGAGTAGCTTTGCGTGCCGACACGGAAACGACACTAAAGATGCCAAGAGCCACCTTAATGCGCTCATATTAGCGTAGAGTACAGCTCAATGTCAATCCATTTGCGCAGCAGCTCCAGAGCCTCACAGGCTGGCAGACTGCGGTTGGGCGCAATGTAGACATCATGCTCTAAGCGAACCCTACGTCTCTGGTAGTGGACAATCGTCCATGATCGCCCGACGAGGCGAGGTAAAGCGGCTATCAAATGCTGCGAAACAAGTCAGGGCTGGCTGCTTTACCCATGCGGGAATCGCTTGTAGAAGTTAAAACACGTGCACATGTACAGCTGCTACGCTCCGCCGAGCACGACACCCCCCGATCAGTTCGGGCTTCTGGAGGCGCTCGTGGACCATGCGAGAGGAAGGGCGAAGCCCGAAGGTCGTACCGGCGACTTTAATGCCTGGACAACAGTGGGAGATGGGGCAGCAGGACATCAACACCAGAAGGACAGGCTGGAGATTGACGCCATGCAGATGCCTGGACCTCATACTGCTGAACGATGGACGGAAGCCGACGTTTAACAACGATAGGGGGTACGTCGCTGACGTTACCTTTGTCAGCAGAGGGCTAGTAGACAACAACAACTGGATGGTCCATGACGTCATGACTGAGCGGCCATGCCCTGATCTCCTTCTCCCGGAGAGGTATGCCCAAAGACGGCAGAGTAGAACGGCCGGGGAAAACATGGGACACCAGGAAGATCGGTGAGGCCATGCTGGCCTATCAGATCAATTCCCTGGAAATCCCAAATGGACGCAGAGAGTGGCGGCGAGGCCTCATGAATATGCTGGGAAGAATCTGCGACGCAATCATGCCGGAAAAATCAGGCACAGCACCGAGCCACCCGTTTACTGGTGGAGTGCCTCCCCTAAGCCAACTACGGTCTGATTGCCTCAGGGCCACAAAGGAGCAGCGCAGCAGAGCCAGAGGCGGTACCCACCGCGCGGAACTCTTGGAGGCTTTCAGAAGCAAACGCTAGAGTTCAAGCACGGCATCGCGGCTGCCAAAGCGCGGTCGTTTAAGGAGCTGCAGGATGGCGTAGACAGCGATATCTGGGGGCCTCGCCTACAAACTTGTTACCAACGAGCTAAAGGAGGAGAGCAGCAGCCATCCGACCCGGGGGTCTGGCTAACATACTAGGGCTATTTCCAAAGCAGACCACACTGGAGGCCAAGCAGAGGCGGCCCCTGCCCCAGATTTCCCGTGCGTCTGGAGACTTGAAGTCGTCGAGGCAGCTGTTTGCGCTGACGATGTGGCAATCACAGCCGGGCTAGCAATGGCGGCTCACAAGGGGCCAGAAGCAGTCTACTAAGCAGCAGAGGAAAAGATGGAGAACATGCTGGTCTCCGTCAAAGAAGGGTACTCAGGGGACCTCTCAAGAGTCCTAAAGTACCTGGGGGTAATGATAGATCGCAGACTATCGTTCAAGGACCACGCAGGCACACGCCAGCAAGAAGACAGCAGTCACATCCTCAAAAGA
->d0a64580-a494-4fbb-8613-426952da6b9e
-TTGTTGTACTTCGTTCAGTTACGTACTGCTGTCTTCTGCTGGCGTAGCTCGCGTGAATCCTTGAACGATAGTCTGCGATCTATCATTACCCCAGGTACTTTGGGACTCTTGAGAGGTTCGAGTACCCATGACGAAATTCAACATGTTCTCCATGCTTTCCTATGCTGTAGTAGGACTGCTTCCGTGCGTGAGCCGCTATTGCTAGCCGGCTGTGATTGCCACATCGATGGCGAGCTTGCTGCCTCGACGACTTCAAGAGTTCTGTATTGCGGAAATCTGGGGCGGGGCTGCCTCTGTTGGCCTCCATGAGTGTGGTCTGCTTTTGGAAATAGCTCCCCTAGTATGTTATGGGACCCCCAGGTCGGATGGGGTTGCCGCTCTCCTCCTTAGCTCGTTGGTAACAAGCTTGTAGGCGAGGCCCCAGATATCGCTGTCTACACCGCCATCCCATACAGCTCCTTAAACGACCCGCGCGCTTTGGCAGCCGCGATGCCGTGCTTGAACTCTAGGCGTTTGCTTCTGAAGCCCAAGGTTCCGCGTGGTGGTACACTGCACCTCTGGCTCGTTGCGCCGCCGTTCTCTCTTAGCCCTGGGGCAATCCAGACCGTAGTTGGCTTGGGAGGCCTCCGCCAGTAAACCCAATGGGTGGTTGCGCTGTGCCTTATTTTCCTTGGCATGATTGCGTCGCAGATTCTTTGGCATATTCATGAGGCCTGCCGCCATACTCTCATCCACATTTGAGTTTCCAGAATTGATCTGATAGGCCAACGCCTCATCGATCTTTCCTAATGGTGTCCATCACCGGCTTCATTTCTACTCTGCCGTCTTTGAGCATGCTACTCCGGGGAGAATCGGGGCATGGTCAGCTCCAGCGTCATGACGTCATGAGACCATCCAAGTTGTTTGTTGTCTACCACTAGCCCTCTGCTGACAAAGGTAACGTTAATAAAGGACGTACCCTATCGTTGACAAACGTCGGCTTCCGTCCATCGTTCGGCATTATGAGGTCCAGCATTCGCTGGCGTCAATCACGGCTTCGTCCTCTGGTGTTGGATGTCCCGCGCTGCCCCATTCCACTGTCAGGCATTGAAGTCGCCGTAATGACCTTCAGAGCTTAGCCTCTCGCATGGTCCGAGCGCCTCCAGAAACTCCTCAACCCGAACTGATCAGGGGTGTCGCTCGTGAGCGTAGCAGCAATACATGTGCACGTGTTTTAACTTCGCATAAACGATACCCGCATGGAACAGCCAGTTCCTGGACTTGGAAGCTGCAGCATTTGATAGCTGCTTTACCTGCCTCGTCAGGATCTGGACGATTGTCCACTACCAGAGACGTGGGGTTCGCTTAGGAGCATGATGTCTACATTTATAGCTCAACCACCAGTCTGGTGCGGGAGCTCTGAGCTGCTGCGCAGTGATTGACATTGAGCTGTACTACGCTAATATAGGCGATGCATTAAAGGTGGCTCTTGCGGCATCTTTTAGTGTCGCTTTCTGTGAAGTCGGGCCTGCTTCCCCACCCGTCGGGTGGTTTTCTGTCACCCTCGCTGCTGCAGATCGGAGCATTTTGGTGCAGCAACGCACCCTTTGCCACCGCCTTGTGCCCACATCACCGCATCTAAGACAGCAGTCTACTGTCAGTGTCCTTACGGGTTAGCACGATCGATGCCCATAGCCAGACACCTGCCTTAGCATCTCGTGGGTCCGGACGTCCTGGAAGCCATTGACATCTTGACCATCAACGATTATAGTTGCCCTGTTTGGGACTGGTATCGCAACGTTCGCGTTCAGCAGCACTGGGGACTATTGCTTGCAATTCACGCATGTACTGCGAAGGCCCCTGATATGCTGGGATTTATCTGCGGGCCCTGGAATTGATCCAAATATTGGAGCTTCTCTGCTGTCGTAGCCTCGTCAATCCCACTTCGCGGAATAGAGCTATTCTTTGCCTCACCTGTGCGCACAGAGACCGAGTCATTGAGCGCCGCGCAGGTCGCTCCGCCAAACTTTAGAACGCTTTTCGAAGCTTTCCCCTCTACCTCAAGCAACAGATCCACCTTTCTGCGTTCTCGATTTTTCGCACGTGACTGCCAGTTCGCGCTAAGGCTCGGTCCGTCTGCCAGCTTCCGAGCATCTCTCTGCGTACGAAGCCTCTCCTGTCTTTTTTTACGATGAGTGCCTCTGCACCCGTGCCAGCATTCTTGGCGACAGATGCATAGCTGCACAAGCGGACTCGTTGGGTATGGATGTCGCCTTTTCTTCACCGTTGCCATCCAGCGTAGGTTTTGCTCCTGCTTCGGCGCCTGGACTTTGTTTTTGCACCGTGGGTACCGCATTTTGTGGAACTGCTTTTTTGACAGGCTTTTGTACCTCCGTCTGGGTAGCGCTGCTCTTCAAGCGGTGCTCGCCAGTACAACACCTTCATTTAGCTCTATCGCCCGCAGTGGGGCTACGGGGATTCCGGAAGCTATACCCGCTGTCTCTCAATAGCTGTCGTTGGGTCTCGAATGCGGATAGAGGGGGGCTGATCTTGCATTCATCCTGATGATATGCCCCTCAGGTCCTCATTCTGGAGCAGTGGTCAAGTCCGAAGATTCGATGGGGGGGGGGGCGCTGGGAACTTCCCTCCGTCTTTTGCGATGGCACGGCGATGGTCCATCGTCTTCTGACTTGTCGCGGTCGTAGATGCTGTAGAATTGAATTTTCTCCACCTCTACAGCATCGCTGCGGTCGATGATCAACGGCTGGGGCCTGCGTGCTCGCACGCACACCGACGGGACCAGATTCCGTCACCATGGGTCGGGGTTGCGAGCTCCTCACAGTGGGGGGGATCTCGAGAAGAATCGGAACTCACCTGAACGGGTCGTTGCGATCGGGGACTGCCCCACTACGCTGTCCATCAACTGAAGGATGGCCTAAAGAGATTTACCTAGGTCACGTAGAGCCACGGATTTCCCCTGGCTTTGGATGGAGGTTTTGCAGCGCCGCCTCGACTCGGACACCAGAGCCTCTGCTTGAGCACCAACTTTACGGTGAGAGGATGATATTTGGTCTGTCCGTGCTGATGCCTTTTCCCCTTTCTTAAAGACTTGGCACTCCCAGTTACCAGAATTAAATTAAATTAAATTAAGAATTTCAACGGCGGCAATTTTTAAATTTAATTTTGAATTTCACCTACTGTCGCAACACAACACTGATCACGCAGTTCGCTAATACTCCCTTCCAGATCGCCCGCTTTGCGCTTATCGGCGGCTTCTGTTTATCCGCACATAATCGCAAGATAATAAATTACCTATTTACATGAAACAGGCGCACAATTAACTCGCGTGATTGCAGCGCAGAACTATGTACGTGACTTCCACCGTGTGATTTTGCCAGTTGCCGCACACACACCGGCCAGAGCTACAGCTTCTATATGGTTTCAGTATTTCGCGCCGCGTAATTTTAAGACGTCCGTCTTCACGGCGATGTATGAACTTGGTCTCGCACCAGGATTAGTGTCTAAACCTGGCTGCGTTTCAGGGATTAAACTTTGGCAATACGACGGCATTGAGTTTTTTTTGGGTCTCTTTGTGAGTTTTGCACTTCTTTAACAGTTCAGAAAAATGGCGATTCTGCGACTCTAGAATTTGTCAAGCGAATTGTTTTCACTATTGTAGTATGCACACATATCGGTTAAAGCACTGTACCTATGTGTGTGATATTCATAATTAGCAGCACTCTGTTTGCAATGTGTACATAAACAGTCCAGCACAAGTGTATACGTAATACGAGCGCACCCACTTGAGGGCGCTTGTACATAATTGCCTGGTCCGGCGTTGCCGCTGGCCAAGCGCTGATCGCTTATATGTGTGCCTATACCACTCCTCCTCCAGCACCATCGCTCGGCGACAGTACATATATATTACATATATAAGATACGCATATAAGCGTTGCCTTGCTGCGCGCCACCACGAGGCTATGCCGGCACTTTGCTCCTCGACTTAGGCTAAAGAAACCTTTGTGTAGTAGATCATAAGAGGATTGACGAATTGAACCGAATGGAGCGGGACCCTGTTCCTCAAATTGGATCAAATGAAGAACAGCTACAAAAACACAAATGATCTATGACACAATGGAAACTACAGGAGTTGGGTAGGCGGTCCCACTTCTGATGTCAGGATCTGAATCTGCCTTTATACTCGGCATCACTCTACAGCCGGACACAAAGTAACAGAAAACGGTCGTTAACTTGAAATTAAAATAAATCTGCGATAAATTGCAGTTTGTCAAGAAACTATTTTACACGTGAAATAAGATGAATTTTTTGATTTTAACGGTCAAAGAATTAGAGTTATTGCTTAATTAAACGCAATTTTTTTTAGGAAATATAATTAACAATATTTATTTTACTTATATTAAAAACCAAATTCAAAATATCAAATGTACAGAAAGAAATAAACAACGAATTCAAGTTTAAACACTTTTGAGAGTTTCAAGAAACTCTTTACACAAAACTTACTAAACCTAAAGTTTAAATCCTAAATTTTTATTTTTGTTAAAATTTGAAAAGTTGTAGTGGTATTTAGTAGCGGCCCCATTGTGGCTTTTGGCTACAGTTGACTTTTTTTTCATGGAATGGATGAGTTTTTTTTTAGGTCATATTCAAAGCGGGATCTTTTCCCGCTCTATCGCGGCCCATGAGAGCTTTGTTGTCTCTTTTAGTTGCCCACTTTTGCATTCTTTAAGTAGGCCCTATAAAATTTTCAATGGGTTCAAGATCAAGACTCTGGGGGGGCGTATCGATCCACCCTTGCCACAGTTTATAAAGGAGCCAGTTGCGTACATTGCACTCTTTATGTTTGGGATCATTGTCCTGATAAAACTTAAAATTTGGCTTGTTGTTGCTAAATATAGACCAAATTTTTCTGCACTGGCCTTCAAATTTTGATTTTTAAAATATCTAGATGTGCACGGCATTCATAGTGCTTTCAATAAAGGCTAATTGCCCCTCCATGGCTTGAGATACAAGCCCCAAATCATCGCAATAATTTTCCAAATTTGATTGTTGGAATGATCTTTGTTTTCTAGCGCACTCAACAGCCATACTTTCCTGCTGGCCCATGGAACATAATAGAGGCATCATTTTTGTTCGTCACAAAATATTACGTCATCCAATTTTCCATGGTCATCATGCCACGTGAATGAATGACGCTTTTCTATATTGACCTCAGTAGCAAAGGCTTTTTTCTTTCATGAAGTACCTATAGCGTAGAATGACTTGGCACTGGTTTGTGTGGCACAACTGGGTCACATTCTTGCCGATATCCTGAACAAGTCAGATAAAGGCTTCGAGATTCGGGGAATTCACCAATCACTTTTCGCATAATAAGGCGGTCTACACGCTTACTGAACATTTTTAGTTTTGCGCCCACCACTCTTAGGTTCAAGCCTGTTTCCTGCTTTTTTTCAAACGATTAAAAACATTGTGAACGTGCCACGGGATACGAAAACATTACTAATTCTGGAATAGATTTTTTTCCCAACTGGTGGTTTTAGTATATTATTTGGGTCACTTCAAAGCTAATCTATTTCCAGGCATTTTATTAAATTTAATAACTCATTCGATCCAACCAAAATTCCTGGCAGAGTAAAAAATTTCAATAGAAGCGTTGTAAAGGAATGCGAAGTACCAAAGTAACGGAAAAATCGAGTTCGTTCTAGAAAAGGAAACCAAAACAAAGTAGGAAAACAAAATATTGTAAGGAGTTTCTTGCCACTCTCAAAAAGTGTAAACTTTAGGAATTTGTTGTTTAATTTCTTGTATATTTGATATTTTATTTGTTTTTTTAATTTATAAGTAAAATAAATATTGTTTTAATTATATTTCATTAAAATTGCGTTTTAATTAAAGAAATAACCCTTAATTTTTGACCTTTAAAATTGAAAAGATTCAACTTATTCACGGCGTGTAGGCTTTCTTACGACAAAACTGTATATATCTACAAATTTGCTTACCCGGTACACCATCTGCAGATTCATTACATTGAGAAGTGGACTTTGACTCTCAGAATGGGTAAAACATTTATTATATTTAGATTGAACTGACAGGGAACAGACTGAACTAACTAAACTAACTATCATTTAACTAAATTTAATTAAGTTTACTGATAATTTTGAGTTTCTTACAAAGATGACCCAATATTAATTTTTTTAGTTAAAATAGTTTGCAAAACTGAATTTATATGTAAATAATATGTTCAATTGATCTGGTTGGGTTTTCTGGGTCTCCCCAACACCTCACCGGCGAAGATATGGATCAAAATTGTTCGTCAGAAGGACGTGCGATATAAATGAGTAGTAATAAAAAGTACAGCAAATCTTACGCAGAGGTGGCGTGTTGGAAAGTATGTACATTTAAGCAAAGTCACATGGCCTGCATCAAAGACACTAGAATAGCCAAGATGCGTAACAACCAGCCCTGGTTTGGCACTATGCAGCCACTTTTTTGGTGACGGCCAATTGCTCTCTTTCACCGCTCATGCGCTGAGCGGCGTAAAAAATCTAAGAAATAGAATTTGCTTGGCGTGGCCAGAGTAAAACAAAAGACGAGAGAACGCGTATATATTGTGCGTGTGTTGTGCTAGAGGCGATTTCGGGCGAAATAATTCTGATCGCAGTAATTTGTATGTACATACATGTTACGGGGAGTTTTAGCCCAATTTCGTAGAATATGATGAAATTGCGCGCTGTTTAAGATATCAAATTGAATATAAAAAAAACTGAAAAAGTCATTACACTGAGAAAAAATATTTCATAAAAAAAAATAATACAGAAGTAGAAAATAAAATTTATAAAATATAAAAAAAAATGTTAACTGTTTACCGAAACGTCATGAAGAATTATTCAGTATCTTTGCTTTGGTCATATCTTGAGGCACGAAGTGCAGACACAAGCACTCCAGCAATCATTGTCTTAATACCAAGCAGAACTGACACCGACGAGACCTAACTGCTTTTGAAATGGCAGAGAGGTAAAATAAAATCAAAAAGGGCCAAGCCCCTCCCGAGTTCAAAGAAAACAGGATTCCCTGGACAATTCTCAAGCACCAAGCGCAAATAATTTCGCTCTCTTAAGCGACGGATTGCCCGACAAAACAGGAAACAAATATAACAAAAAAACGAAGATCTCTCAGGAAATGGTAAATGAGGCAGTTTCTTCGGAGTGCTAAGCCCCACCCTATCTCTGACGTCAATGGTATGAAAGTGAAAAGCTAACCTATCTTAAAACTAAAATTAAGAGAACTTTTTTTATTATAAGACTCAACGTTATGGACATGCTTAAAGGTAATGGGTTAAAAGTATTGAGAATTTACGAAAATTAGTCAAAACCTTAATAATGATTATTGTGCAGTACCACACATACCAGCAAGGATGACAAAGAGCATTTAGAGTTGTTATTAAGAATTTGCATTTTCCACAAATTTAGATGAAATTAAAAGGTAATTGAAAGTCAAAGGTCATGTTGTTAGAAACATAGAAAGTAATATTAAAAGCCGTGCGACCAAAGCATCACTGAACGTAACATGTAGATATTGAACCTAACAAAAAAAACCTAGACATATGTAAATAAAATGGCTGAGCCTCCCACAATGTAAATCGTTTATTCTGCTATAGCTGCCAGAATTCGGACGTACTAAATCATGTGTACGCAAAGGCAGTACCGCTGTGTAAAATCTCTTCTCGACACCCAAGCAACATTTGCCCGAAAAAATACAGAACAACCAGCAAAAGATGTGCCAGCTGCCTGAAAAGAACACGCCGCCAGCTACAAGGGGTGGCCAAATTTATCAGAACTCTTGTCCAAAAAAAAAAGCCAGAAAATAGAAATAATGATCTGGTAAAAAATGGTTAGGAATCCAGCCGGTTGTTCCGCCTAACAAGCCAACGCGCACCCAACAAAGTAACGATTATCAATCTTGTACCCCAAATTGCTGCAGGAAATAGCGAGAACGAGCACATCACTGGAGAGAATGAGCAACTATTAGGAAAACAGTCTGAACTTACAAATAATTTACTTAACATGACCAATGTTGCCTTAAACAAATTATGCAAGTAGAATCTAACGGAATATGGAGTAGTAGGAGTGCGAGCTGTGCTAAGCTTCCGGAAAGGAAACCGAGCTATTATGCAAATGCATGATAAACAACAGCATAACAACACTTTCAGCCGGCAGAGCCTACATGCGTACCTGCTGATGGTAGAAGATACCAAAACTTAACCCTTTCGCACTGGCATTGCAGCATTGAGGCAATTTCTATGTTTTTCAGAGCTAACTGTAAGTGTGCCTTTTGAACCTGCTTTGATTTCTTTATGATAACGGATGAAGCATGTGTCTACTCTAAATATAAAAACAAAAAAAGCATTTGATTAATTGCAGGAATTGTTGCAATAAATAGCACGCGCATCACAATAATTGTGTTTCGACATTCGAGGTGCAACTTTTGGAATTATTAATTTACTTTTATAATACTTTAAAAGAACCTAAAATTATAAACAGCAAAGAGTTAACAGAGACGATTTAGTCAAACTTAGTACCAAAGTAGTGAACAATAAGTAGAGTAATAATTTTCTAAGTTGCTTGTGTGAGCAACCTTGGGCGATCGTGATAATAATTTTCACCGAAATTGAAGGTTTGTCTAACGAAGAGATTGAACGGGATTTAAACTTCGATTGGGATATTTCTACTGACGAAGAGAATTGAATTTGAGGAGATGAAGAAGACATTTCTACAGTGCTGAAGGGCTAGAGAATTCTTGGAAGGGAGAAAGTATCGACATTGACCTTCTGGAAAATACAATTGATTGAAGGATGTAGACCACAACTCTTACGTTGTTGTTGACTGACAGTTAGCAGAGAATTGATCAAAGGGCTAAAGAAAGAGTGGAGAACAAGGCCGTTTTGTAGCTCAGAGTATTTGGGAAGATAATACAAAACTTTTGATGTCGGGGACATAAAGACGACCGTGGAGTTCTTCCTACCTTGCACGATGCTCAACTAATTCATTTTAATGGCTAGGCAAGAGCTGATACTCTGATCATGGTCAAAAATTATTTTCCTGAAAGTGCATTTTTGTGCATGGGTCACAAACGAACAAGTGGGGGAAATTGAAATGCAAAAAAAAACTTTTGCTTTTTTGCAAATTCAAACCTATACAGAGAGAGTCAGATGAAGAAGAATTTGGAAAATAACTGTTCCCTATGCAAGGAAGAGGCAAATGAAGAGAGATCTTTATCAGTTGTCAGAAAGTATTTGCACACGGTTTCGTCGCATCACAATTATTTTCACAACATAATTTCTTCTTCAGTGATTAGTTTAGAGTGACAAGTGCCGGTTTGTTTGCTTAAATACATTAAATTTATTGAATAAAAAAATTAGATTTAATCATTTTCTATTACAGTTATTAAATAAAATGCCCAAAACAAAGAGTTAACAGTTGGAGGCCGGGCTGGTATTGTTGCTAGGTTTGCGGTACACGGCCAAAATAGCTAGTATATCAAATTTCGCGTAGAACTGTCTACTACTAATAAAAGTTTGATACAGTTTGGCATTAAAAAATAAAAAGATGGGCCGAAAACCTGTGCTGGACCAAAGGCAATACAGGCAAATACTTTGGAGTTTGTGGCAGAATCTAGTGCCAGTCAGTAAAAATTACCTTAGAATCAAAATACAGAATTACGGCAAACAAGTTAGTAGTTCTACAATTCGTCGCAGGCTAAAGAAGCTGATTTTGAACAGCCAAAACACGTGCGCATAAAACGATTGAGGATCACACCAACCCAACAAAACAAAACGTCTTCCACGCGTTGGAATATGTTAAAAACCTCTTGACTTTTGGTTTTAATATTTTATGGACTGATGGTCTGCATTTAGAGGTACCAGGGTCATACAGCAAGCATTTTATGCATTTGAAAATAATCAAAAGCATTTGGCCAAGCCAACCAATAGATTTGGTGGGGCACAGTCATGTTTTGGGGATGTCTTTCCTATTATGGATTCGGAGACTTGGTACCGAGTAGAGGTGCTAAATCAGAACTGGATACCTTCTTATCTTAAACAACCATAGCACTTACGTCTGGAAATAGACTTTTTTCCAACTACTGAATGGGTCTTCCAGCGGGACAATGCTCCATGCATAAGAATTGGAAGGACCAACAAAATTTTTTAAACGACATAATCATGGCAGTTCTTCCATTGGCCCCCCCAAGCCCAGACCTTAATATCATTGAAAACGTTTGGGCTTTTTGGCTAAAACCAACGAACTATTGATAGAAATAGAAAACGAGGAGCCATCATTTAATGGCGGAGATTTGGTCAAATTGACATTAGAATTCACACAAACTTTTGGTAAAGGTCAATGCCAAAAGACTTCAAGCAGTTATTGATGCAAAGGTGAGGGTGTTACAAAATATTAATTATTGTATTTATATAAAATAAAGAAATTCTTATGTTGGAAATTAAGATGTTAAATGAAATTTACTAGAATTAAGTTGAGTGAAAATACTTTTGGAAAGCGCAATAAACATGTGAAAATACTATTGACAGCTTGCATGCATATTTTTCTTTTGCTTTAAGCTTTGTACTATGAACCGTTATCTTTCAGTATTTTCTTTTCGACTACCTTCTGCATAGATCAAGCTAAGAAGCGATAAAAAAAAAAGAACTATTTCAGGCAAATCGGTTAACAACAAGAAGAAATATGCAACAAAAAGAAGTTGAAGTTTTTTACCAAATATTTGTGCGTTGTGAAAATACTTTTGACACCTCTGTATATAGTTTGCAGAGCACGGTATTGGGCGAACTTAAATGTACTGATGAAATCAAACGCTACATTGCATTTTATTGTACTTTGGTGTTTCAAAACTACCGCAATTCAGAATGGCGTGGTCAAAGTATTTAAAGATTACTGCAATAACAGTTCAATGCCGCGTGGGAAATTCCCAAAAAAATAAAGTAATGCTTACATTTCAAGCGACAACTTAGAAGCAATTAAAAAAAGGGGGGATTGCAACTATGATAAACTCTAAGATAACCCTTTGCTCAAGATTCAGAAAATTTGGAAAAATATACTTTGGGAAGAGCATCAAAGTGTCGATAGGCAAATAATTGCATTCAAAGGTACGTTTTTAATTTTCTTTTAAATTAGCTTTATTTTTTAATAATTGCTTTTGTTGCAGGTCGATCCATGACAATATAATCCAAACCTCCGCAAATAGGTCTTGAAAATGTTTACGCGGGCTGGAATATCTGGATTGGATTTATGATTTTACGCTTATATGTTGGAAGGCACTTCTCCTTCTTATGGCTTGGGAATATCATCTTATGTTGTCTTATATTTGGCAGAAAGTCTTCCCAAAGAACAAAAGAATTTTAAACTGTATTTTGATAGTGGTTTACGTCTGTAATCCTTCTGATTTCAGGTGGAAGGAAATAGGAATCTTTGCAATAGGTACTGCCGTATGATAAAGTTTAGGAACATTGGGTAGTTTGGAAAGAGGACGTTGCAGACTGTGCAAGGTACAACACCAGGCCAATGCCTTACATTGTTGAAGTCATCTGTGCCGGTAACAATAAAAACTGTTTTTTGTCATACCACACTTAAATTGTCATTTGCCAAGAAAAATATTTCATATTCTGTGATTTGCTCACAAAAAAAACAATGCTTACACATCACTACTGCCCGACGTTTGCTCACAAGAAAACTTGCTACCACTTAACCAAACTAATGGGCGTGGCGTACTAAAATTTTGCTAAATTTTTTTTTACAAAATAAATGTAAAGCATTAATGATAAAACAAAATTTCACGAATTTAAAAAAAGTTGGGCGCAGAAAGGTTAAAAGACTTCGTACATGCGCATACTTTGGAATCAGAATCTCACATACGAATAATGGAAAGTTTTTGATCAGCTCAGATCATTTCTCTAATATGGTGACATACAGTACAGTAGCTCATATGTTTAAATACAGATATCAATGCATTTAAAAGTTATCTGGAAACAGCTATATCAGCCTGGATATCTCGCTAAAATCAGGAGAGGAGAGAGCTACTGTGGAGCTACTCCACAGAGCAAGATCCATAAAGCAAGCCCATATATGTACGAAGCTACCAGCCAGAAACTCACAATCAAATCAGCTCTATCTCTCAGCTGAAATCCGACAACAAATACAACGCAAGAGAAATTTGCGTAAGAGATGGCAAACTCTCTACCCTGCCGACAAGATCGTGTAAGGGCTGCATCTGATCGCAGAGAAACGCCAACTTTAGAAATTAATCTCTCGCTGAATATCTTAGAAATCTAGATCCACATTCTTGTAACCACGACATAATTTGTAAGGAGGTAACCCACTCTCCTACTTTAACTTTCTACCAATGGTGCA
->b25fe5e3-6232-4fa5-9751-b719ba7b83f2
-CCGGTATGCTTCCGTTCAGTTACGTATTGCTTCAAACAAACGCCTGGGATTCAAGCACGGCATCGCGGCTGCCAAAGCGCGGTCGTTTAAGGAGCTGCAGGATGGCGTGAACCTTGGCGATATCTGGGGCCTCGCCTACAAGCTTGTTACCAACGAGCTAAGGAGGAGGCAGCAACCCCATCCGACCGGGGGTCCTGGCTAACATACTAAGACTATTTCCCAAGCAGACCACACTATGGAAGGAGCCCACAGCAGGGCAACCCTGCCCAGATTTCCGTGCGTCACAGAACTTGAAGTCGTCAGGGCAGCTGTTTCGCTGACGTGTGGCAATCACAGCCGGAGCTGGCAATAGCGGCTCACAAGACCGAAGCAGTCCTACAAGCAGCAGGAAAAGATGGAGAACATGCTGGTCTCCGTCCAAGGTACTCAGGGGACCTCTCAAGAGTCCCTAAAGTACCGCAGGGGTAATGATAGATCGCAGACTATCGTTCAAGGACCACGCGAGCTACGCCAGCAAGAAGACAGCAGTCACATCCTCTTCGTTGGCGAGGGCTTATGCCAACGTCAGGCCCAAGACACCCGGCCAGGAAACTGCTGGTGTCAGTAGCAAAGGCTTCGCTGCTATACGCTGCACCAGTCTGGAGCAATGCCACTTGCAGGGGTCTCATACCTGAAAGGAGCTCGTTCGGTGCTACGGTCAATGGCCCTCAGGCTCATTAGAGGATTCAGGACCATATCCGAAGACGCGGCGCTGGCGCTGGCAGGAGCTGCCGATTGATCTGGAGATCAAGGCTCTCAGCACTATGCGGAGTGGCGCTTCCAGGCAAAGAGCACGAGTGGCTATTAGGTGAATGGCAGAGCAGATGCTTAAACGTCGCGACGGGGGAGGTGGACCTATCAGCTCATCCCGAGATGACGGTTTGGGCGAAGTGACACTCAAAGTGTGTAAACTTGGAATTTGTTATTTTATTTTTTTCTTGTATGACTGATATTTTGAATTTGTTTTTTTAATTTATAAGTAAAATAAATATTGTTTAATATATTTCCTAAAAAAATTGGAATTTAATTAAGCAAATAACCCTTAATTTTGACCGTTAAAATCAAAAATTAAATGCTATTTCCGGTGTGTAAACGGTTTCTTATTGACAAACTGTACTTGTCATGAATTTATTTTTTAATTTCAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTGAAGTGATGCCGGTATAAAGTGATTCCGAGATCCGACATCAGAAGTGGGACCGCCTACTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTGTGTTTTAGCTGTTCTTTTATTTGATCCAATTTGAGGAACAGGGAAGGTCAACTCCATTCGAAATTAATTCGTCAATCCTCTTGCCGATCTACGTACAAGGTTTCTTAGCCACAAGTCCTCGAGGGAGCAGCGCTGCCGTATGCAGCAACAGCGCTTCTATGCATGTCTTATATATATGTATATATATATATGTACTGTCACTCGAGCGATGGTGCTGGGGAGAATTAGTACTTACAGGCACACATATAAGCGATCAGCCTTGGCCAGCGGGAGAACTTTGCTGACCAGGCAATTTATGTATGTTAGCCCTCAGTGGGTGCTCGTATTACACGTATACACTTGTGCTGGACTGTTATGTACACATTGCAACAGAGTGCTACAATTATGAATACGCATAGGTACAGTGCTTAACCGATATGTGTGCATACTACAATGAGGTAGAAAACAATTTGCTTTGACAATTCTAGAAGTCGCAGAATCGCCATTTTTCTGAACTGTTAAAAGAAGTGCAAAACTCACAAAGAGACCCAAAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCCACAGACGCACAGGCTTAGACACTCAATCCTGGTGCGGAGACCAGTCTACATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCAAAGTACTCCGGAAACCATAGGGTTTGTGTCGGCCGGGGTGTGTGCGGCAAACTGGCAAAATCACACGGTGAGTCGCCATAGTTCTGCGCTGCAATCACGCGAAATTGGTATTGCGCCTGTTTCATGTAAATAGGTAATTTATTATCTCTTGCGATTGTTGCAGCGGATAAACAGCTGATAGCGCAGCGGGCGATCTGGAGAGAGGAGGCGTTGCCAGATCAACCGTGTGATCAGTGTTGTGTTGCGACAGTGGGCGCGAAATTCAAAGTAAATTTAAAATTAAGCCGTTGAAATTTAAATTTAATTTAATTTGATTCTGTGGTAACTGGGGCGCACAAGTCTTTAAGAAGGGAAAAGCACAAGGTCGCGGACCGGACCAAAATATGCATCCTCTCACCGTGCACAGTTGCCTAAGCAGAGGCTCTGGTGTCGAGGTCGAGGCGGTACAAACCTCCATCCAGAAAAGCCGGGGAAATCCGTGGCCTGCGTGACCCTAGGTAACCTTGGGCCATCCTTCCAGTTGATGGACAGCGCAGTGGGGGCAGTCCCACACAGTCGCAACGACCCGTTCAGGAGGAGCTCCCGACTCCGAGATCCCCACCAGAGGAGTCGGTAACCCGACCCATGGTGACGGAATCTCGGTCCCGTCGGTGGCAAAGGAGGTGAGCACGCAGGCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGAGGTGGAGAAATTGGCTCCCTACAGCTCTACGACCGCGACAAGTCGAAGACGGAAGTGGACCACATCGCCGTGCCATCTTAAAAGACGGGAGGAAGTCCCAGCTGGTTCCCCTCATCGGTCTTCCGGACTTGACCCTGCTCTCCAGAACGGGACCTGAGGGGCATACCTGGGATGAATGGCAAGATGGCCCCTTCTATCCGCATTCGAGACCCAACGACACACGCGCATGAGACAAGGGCATAGCTTCCGAACTCTCAGCCCGCCCGGCACAACAGGGCGATGGGAGCTGTACGGGAGTACTACTAGCGAGCACACCGCTTGAGCAGCGCTACCCAGACGGAGTACAAAGCCTGCAAAACCACAAAATGCGCGAGTACCCACGGTGCGGGTGCCAAAGTCAGGCGCGAAGCAGAGCAACCCCTACGTTGGATGGCAACGGTGAAGAAAGGCGACATCCATACCTAACGAGTCCAAGCCAGGCAGCTATGCATCTGTCACTTCAAGAATGCTAGCACGGGTGCAGAAGGCACTCATCGTAAAAAAGACAGGAGAGGCTTCGTACGCGAGATGCTTCGGAAGCTAAGATCGGAATCGAGCCTTAGCGAACTGGAGCAGTCACGTGCGAAAAATCCGGAGAACGCAGAAAGGTGATCTGTTGCTTGAGGTAGAGAGCTTCGGAAGAAGCGTTCCCCAAGTTTAAAACGACCTGGAAGCGGCTCAATGACAACCTCTGTGCGCACAGGGCGCAAAGAATAGCTCTATCTTGCAGCGGATTGGACGAGGCTACGACAGCAAGCTCCACAGCTGTGGTCGCCCAATTCCAGGGCCTGCAGATAAATCCTGAAGATATCGGGGCCTTCGCGGTATCGCGGAATTGCAAACAAATAGCCTCAGTGCTGCTGAACGCCGAGAACGTTGCGATACCAGTCCTTAAACAGGGGCACCATAATCGTTGGATGGTCAAGATGTCGTACTCACACCCAGGACGTCCGACCCACGAGATGCTGGGTGTCTCGGCTATGGGCATCGATCAGCAACCTGCAAAGGACACTGACAGGGCAGACTGCTGTCTTAGATGCGGTGAGCGTGGGCACAAGGCAAAGGGGTGCATTGCTGCACTTATTGCCTGATCTGCAGCAGCGGGTGGACAGAAACCACCCGACGGGTAGCTTTGCGTGCCGACTTACGAGCGACACTAAAGATGCCAGAGCCACCTTAATGCACGCTCATATTAGCGTAGTACAGCTCAATGTCAATCATTTTGCGCGCAACGCTCAAACCTCCTGGCCCAGACTGCGGTTGAGCGCAATGTAGACATCATGCTCTAAGCGAACCCTACGTCTCTGGTGGTGAACGAAATCGTCATGATCCTTGACGGGCAAGGTAAAGCAGCTATCAAATGCTGCAGCTCTCTCAAGTCCAGGAACTGGCTGTAGCGCTACCCATGCGGGGTATCGCTTATGCGAAGTTAAAACGCGTGCACATGTACGGCTGCTACGCTCCGCCGAGCGTACCCCGATCAGTTCGAGGAGCTTCTGGAGGCGCTCTCGCGTACGGACCATGCGAGAGGGCGAAGCCCGAAGGTCATTACCGGCGACTGTGCCTGGACAGTGGAATGGGGCAGCAAGGACATCAACACCAGAGGACGAGCTGTGATTGACGCCATGCGAGATGCTGGACCTCATACTGCTGAACGTGGACGGAAGCCGACGTTTAACAACGATAGGGGTAAGTCCTTTATTGACGTTACCTTTGTCCAGCGGGGCTAGTAGACAACAACAACTGGTGGTTATGACGTCATGACGCGCTGAGCGACCATGCCTGATCTCCCTTCTCCCGGAGGGTATGCCCCAAAAGACACGGCAATTAGAACAGCCGGGGAAAACGCCGTGGGACACCAGGAAGACATCGTTGAGGCCATGCTGGCCTATCAAGATCAATTCACAAATCCCAAATGTGGACGCAGAGAGAGTATGGCGGCAGGCCTCGCCAGATATGCTGGGAAGAATCTGCGACGCAATCATGCCAGGGGAAAAAATAAGGCACAGCGCAAACCACCCGTTTACTGGTGGAGTGCCTCCCTAAACCAACTACGGTCGTTGCCTCGGGGCTAAAGAGAACGGCGCAACGAGCCAGAGGCAGTACCACCACGCGGAACTCTTGGAGGCTTTCAGAAACAGAAGCCGCCTAGGTTCAAGCACGTGCACATCGCGGCTGCCAAAGCGCGGTCGTTTAAGGAGCTGCAGGATGGCGTGAGCACAGCGATATCTGGGGCCTCGCCTACAAGCTTGTTACCAACGAGCTGCGGGAGGAAGCGGCAACCCATCCGTGCCGGGGGGTCTGGCTAACATACTGGGGAGCTATTTCCAAAGCAGACCACACTATGGAGGCCAGCAGAGGCAGCTACCCCACAGATTTGCCGTGCGTCACAGAACTTGAAGTCGTCGAGGCAGCTGTTTCGCTGACGATGGCAATCACGAATTTGCTTGTAGCGGCTGCAAAGGGAAGACCGAAACGTCCTGCCAGCAGCAGGGAAAAGATGGGCGGAGAACATGCTGGTCTCCGTCAAAGGGGTACTCAGGGGACTCAAAGAGTCCCCTCACCTGGGGTAATGGCAATACGTAAAAAAGA
->fecf82d6-7a66-456e-8123-ef37e5b7c325
-CCCAGCTCGGTGTGCTTCGTTCCAGTTGCCGTATTGCTTCTGCTGCTTTGGAAATGGCTCCCTAGTATGTGTAGGACCCCCCGGGTCGGATGGGATTACCGCTCTCCTCCTTAGCTCGTTGGTAGCAAGCTTGTGGGCGGGAGGCCCCAGATATCGCTGTCTACGCCATCCTGCGGCTCCTTAAACTGACCGCGCGCTTTGGCAGCCGCGATGCGTGCTTGAACTCTAGGCGTTTGCTTCTGAAAGCCTCCAAAGGTTCCGCGTGTGGTGGAGTACTGCCTCTGGCTCGTTGCGCCGTTCTCTTAGCCACAGAGGCAATCGGGCCGTAGTTGGCTTAGGAGGCCTCCACCCAGTAAACGGGTGGTTTGCGCTTGTGCCTTATTTTTCCTTGGCATGATTGCGTCGCAGATTCTTCCCAGCATATTCGCGGGGCCTGCCGCCATACTCTCTGCGTCCACATTTTGGGATTTCCAGGAATTGATCTGATAGGCCAGCATGGCCTCATCGATCTTCCTGGTGTCCATTTTCCAGCTGTTCTACTCTGCCGTCTTTTGGGTAGCCTCAGGGGAGAAGGAGATCAGGGCATGGTCGCTCAGCGTCATGACGTCATGGACCATCCAGTTGTTGTTGTCTACTAGCCTCTGCTGACAAGGTAACGTCAATGGGGACGTGTGCCCTATCGTTGTTAAACGTCGGCTTCCGTCCATCGTTCAGCAGTATGAGGTCCAGCATTCGCATGGCGTCAATCACAGCTCGTCCTCTGGTGTTTGGGATGTCCTGCTGCCCCATTCCACTGTCCAGGCATTAGAGTCGCCGGCAATGACCTTCGGGCTTCGCCCTCTCGCATGGTCCACGAGCGCCTCAGAAGCTCCCTCAGACTGATCCGGGGGGTGTCGCTCGGCGGAGCGTAGCAGCTGTACATGTGCACGTGTTTTAACTTCGCATGGCGATACCCGCATGGGTAAAACAGCCAGTTCCTGGACTTGGAGAGAGCTGCAGCATTTGATAAGCTGCTTTACCTGCCTCGTCAAGGATCATGGACGATTGTCCACCACCAGAGACGGCGGGTTCGCTTGGGAGCATGATGTCTACATTGCGCTCAACCGCAGTCTGGGCAGGAGGCTCTGAGCTGCTGCGCAATGATTGACGATGAGCTGGCACTACGCTAATATGAGCGTGCATTAAAGGGCAGCTCTTGGCATCTTTTAGTGTCGCTCTGTAAGTCGGGCACGCAAACTACCCGTCGGGTGGTTTCTGTCCACCTCGCTGCTGCAGATCAGGCATTTTGGTGCAGCCAACGCACCCCTTTGCCTTGTGCCCACGCTCGCCGCATCTGGACAGCAGTCTGCCCTGTCAGTGTCCTTGCAGGTTGCTGATCGGTGCCCATAGCCGAGAGACACCTGTAGCATCTCGTGGGTCGGACGTCCTGGAGTGATACGACATCTTGACCATCCAACTTGATTATGGGTGCCCTGTTTGGGACTGGTATCGCAACGTTCGCGTTCAGCAGCACTGAGGCTGTTGCTTGCAATTCCGCGCTGCAGAAGGCCCCTGATATCTTCAGTTTATCTGCAGGCCCTGGAATTGGGCGACCAAGCAGCTGTGGGCTTCTCTGCTGTCGTAGCCTCGTCAATCCGCTGCAAGATGGGGGCTATTCTTTTGCGCTCCTGTGCGCACAGAGACCAAGTCATTGAGCGCCGCCGCTTCCAGGTCGCTCTCTTAAACTTGGGAACGCTTTCCGAAGCTTTCCCCTCTACCTCAACAACAGATCACCTTTCTGCGTTCTCCGGATTTTTTCGCGTATTTGCCCAGTTCATGAGCTCGATTCCGATCTTAGCTTCCGAAGCATCGCATTACAGAGCCTCTCCCTGTCTTTTACGATGGAGTGCCTCTGCACCGATGCTAGCATTCTTGGCGACAGATGCATAGCTGCCTGGCTTGGACTCGTTAGGTATGGATGTCGCCTTTTCTTCACCGTTGCCATCCAACGTAGGGGTTGCTCTGCTTCGGCGCCTGGACTTTGGCACCTGCACCGTGGGTACCTGCGCATTTTGTGGAGCCTTTTTGAGGTAGGCTTTTGTACCTCCGTCTGGGTAGCGCGCTGCTCTTCAAGCGGTGCTCGCTGAAGTAGTACCTTCATTACAGCTCTATCGCCCTGTTGTTAAAGGGCTGAGAGTTCGGAAGCTATGCCCTTTGTCTCTCATATGCGTGTCGTTGGGTCTCGAATGCGGATAGAGGGGCTGGTACGCCATTCATCCTGGTAAGTATGCCCCTCAGGTCCCTCGTTCTGGAGAGCAGTGGTCAAGTCCGAAGACCGATGGGGGAACCAGCTGGGGTTTCCCCTCCCGTCTTTTGCGGTAGCACGGCGATGTGGTCCATCGTCTTCTGACTGTCGCGGTCGTAGATGCTGTAGGAGCCAATTTCTCCACCTCTACAGCATCGCTGCGGTCGATGATCAACGGCGGCTGGGGGCCTGCGTGCTCACCCCTTGCCACCGACGGGACCGAGATTCCCGTCACCATGGGTCGGGTTACCGACTCCTCTGGTGGGGATCTCGAAAGTCGAACTCCTCCTGAACAAGTCGATGTCAGCAAATCAATTTCCTCGGTACGCCAGTTGAATAAAGGAAATTGAAATTCGACCATTCAAAATTAATTTAATGCCAGAACCGCTGGTATTGTTGATTTTTTGCCGGTTGCCGCGCACCGGCCGACACCTTCTATGGTTTCAGGTATTTCGCCGCGTAGTTTAAAGACGTCCGTCTTCCACGGCGATGTGAACTTGGTGCTCCGCACCGGGATTGAGTGTCTAGGCCTGTGCGTTCGAGTTAAACTTTGGCAATACGACAGCATTGAGTTTTTTGGGTCTCTTTGTGAGTTTTGCACTTCTTTTAACAGTTCAGAAAAAATGGCGATTCTGCGACTCTAGAATTGTCAGCAAATTGTTTCACTATTGTAGTATGCACACATATCGGTTAAACACTGTACCTATGTGTATTCATAATTGTAGCACTCTGTTTACCCAATGTGTGTACATAAACAGTCCAGCACAAGTGTATACGTAATACGAGCACCAGCGAGGGCTAACATACATAATTGCCTGGTCAGCGAGTTCTCCCGCTGGCCAAGCGCTGATCGCTTATATGTGCCCATACCACTCCTCCTCAGCACCATCGCTCGGCGACGAGTACATATATATATACATATATATAAGATACGCATATAAGCGTTGCTGCGCTGCAGGCTATGCCGGCAGCGCTGCTCGACTTAGGCTAAGAAACCTTTGTATGTAGATCCTTAAGAGGATTGACGAATTAATTTCCGGGCGGGACCTTTACCCTGTTCCTCAAATTGGATCAAATAAAGAACGAAAGCTAAAACCTAGGTGATCTATGACGTGAAACTACAGGGTTAGATTAGGCGGTCCCGCTTCTGATGTCGGATCTGAATCACTTTATACCGGCATCACTCTCTACAGCGGACACAAAGTAACAGAAAACGGTCGTTAACTTGGGGAATTAAAAATAAATCTGCGACAATTACAGTTTGTCAAGAAACTGTTTACACACCGTGAAATAAGATGAATTTTTTGATTTTAACGAGTCCAAAATTAAGGGTTATTTGTAATTAAACGCAATTTTTTTTTTTTAGAATATAATTAAACAATATTTATTTTTACTTATGATTTAAAAAACAAATTCAAAATATCAAATGTAAGAAATAAATAACAAATTCCAAGTTTACACTTTTGAGGGAGTGTCACTCTGCCCAAACCGTCATCTCTGGGATGAGCTGATGAGTCCACCTCCCCGTCGCGACGTTTGCCATCTGCTCTGCCATTCACCTATAGCCACTCGTGTGCCTCTCTTGCCTGGAAGCGCCACTCCGCATAAGGCTGAGAGCCTTGATCTCAGATCAATCAGCAGGCCTGCCAGCGCTAGCTACCGCGTCTTCGGATATATGGTCCTGAATCCTCTAATGAGCCTGGGGGCCATTGACCGTAGCGCAAGGCAGGCTCCTTTCAGGTATGAGACCCTGCAAATTGGCATTTGCTCCAGACTGGTGCAATATTATAGCAGAGCGCTGCTACTGACACCAGCGGTTCCTGGCCGGGTGTCTTGGGCCTCCGACGTTGGGCATAAGCCTCGCCAACGAGAGGAGGATGTGACTGCTGTCTTCTTGCTGGCGTAGCTCGCGTGGTCCCTTGAACGATGGTCTGCGATCTATCAGTACCCCCCAGGTACTTTTGGGGATAGCCAGGGGGGTCCCCTGAGTACCCTTGACGGAGACCAGCATGTTCTCCATCTTTTTTCCTGCTGTAGTAGGACTGCTTCGGTCTTGTGAGCCGCTATTGCTAGCCCGGCTGCTTGATTGCCACATCGTCAGCGAAACAGCTGCCTCGACGACTTCAGAGTTCTGCTGACGCACTTTTGGGAAATCTGGGGCAGGGGCTGCCTCTGTTGGCCTCCATGAGTGTGGTCTGCTGCTGGAAATAAGCTCCCCTGGTATGTTAGCCAGGACCCCCCCCCGGGTCGGATGGGGTTGCCGCTCTCCTCAGCAGCTCGTTGGTAACAAGCTTGTAGGCGAGGCCCCAGATATCGCTGTCTACGCCATCCTGCAGCTCAGCAAACGGCCGCGCTTTGGCAGCCGCGATGCCGTGCGGGAACTCTAGGCGTTTACTTCTGAAAGCCTCCAAGAGTTCCGCGCGTGGTGGGTACTGCCTCTGGCTCGTTGCGCCGTTCTCTTAGCCCTAGAGACGGAAATCAGACCGTAGTAGTTGGCTTAGGGAGGCCTCCACCAGTAAACGGGTGGTTTGCGCTCATTTTATTTTTCCTTGGCATGATTGCGTCGCAGATTCTTCCAGCATATTCATGAGGCCTGCCGCCATACTCTCTGCGTCCACGTTTAGGTTCCGGGGGGTGATCTGATAGGCCAGCATGGCCTCATCGATCTTCACAGTGTCCCATGTTTTCCCAGCTGTTCTACTCTGCCCGTCTTTTGGGCATACCCTCCAGCGGGGAGAAGGAGATCAGGGCATGGTCGCTCGAAATTCGCGTGTGGACCATCCAGTTGTTGTTGTCACCACTAGCCCTCTGCTGACAAGGTAACGTCAATAGGGACGATACCCCTTCCGTTGTTAAACGTCGGCTTCCGTCCATCGTTCAGCAGTATGAGGTCCAGCATTCGCATGGCGTCAATCACAGCTCGTCTAAATTGTTGGATGTCCTGCTTGCCCCATTCCACTGTCCAGGCATTAAAGTCCGCCGGCAATGACCTTCCGGGCTTCGCCCTCTCGCATGGTCCACGAGCGCCTCCAGAAGCTCCTCGAACTGATCAGGGGGGTGTCGCTCGGCGGAGCGTAGCAGCTAATACATGCACGTGTTTTAACTTCGCATAAGCGATACCCCGCATGGGTAAACAGCCAGTTCCTGGACTTGGAAGGCTGCAGCGTTTGATGGCTGCTTTACCTGCCTCGTCAAGGATCATGGACGATTGTCCACTACCAGAGACGTAGGGTTCGCTTAGAGGGCATGATGTCTACATTGCGCTCAACCGCAGTCTGGGCCAGGAGGCTCTGAGCTGCTGCGCAATGATTGACGATGAGCTGTACTACGCTAATATGAGCGTGCATTAAGGTGGCTCTTGGCATCTTTTAGTGTCGCTCTGTAAGTCCGGGCACGCAAAGCTACCCGTCGGGTGGTTTCGCCACCTACGCTGCTGCAGATCAGGCGTTTTTGAGATTTGCGGCAGCGCACCCTTTGCCTTATTGCCCACGCTCACCGCATCTAAGACAGCAGTCTGCCCTGTCAGTGTCCTTGCGGGTTGCTGATCGATGCCCATAGCCGAGACACCTATGGCATCTCGTGGGTCCGGACGTCCTGGGTGTTACGACATCTTGACCATCCAACGATTATGGTTGCCCTGTTTAGGACTGGTATCGCAACGTTCGCGTTCCAGCAGCACTGAGGCTATTTGCTTGCAATTCCGCATACTGCGAGGCCTATTATCTTCAGGATTTATCTGCAGGCCCTGGAATTGGGCGACCAAGCAGCTGTGGAGCTTCTGCACTTTGTCGTAGCCAGCAATGCAATAACCCCGCA
->b3eb38b1-1e66-43ca-b575-8f892115e662
-TAAAATCTTCAACATTGCTTCGTTCAGTTACGTATTGCTCAAGCAGCTGTTTGTGACCCATGCACAAAAATGCACTTTATTGAAAATAATTTTGACCATGACTGTATATCCAGTTTGCCTAGCCATTAAATGAATTAGCTGGTATCAAAAGAGATATTATTAGAAAACTCCACGGTCGTCTTTATGTCCCCCGACATCAAAAGTTTTGTCATCTTCCCAAATGCTCTCTGGAGCTACAAACGGCCTTGTTCTCCACTTTAGCCTCTTTGGATCAATTTTCTCTAAGCAACTGTCCAACAACAACGCAGGAGTCAGGTTCACATCCTTCAATCACTGTATTTTCCAGGATCAATGTCGATGCTTTCTCCCTTTCAAGAATTCCTTCTAAATTCTTCTCCAGTACCGTAGAAGTAACCATCTCCTCACCACTTTCTTCGTCAGTAGAAATATCAATCGAAGTTTAAATCCGTTCGAATTTCTTCGTTAAGACAAACCTTTCACTTTCGGTGAAAATTATTATCACAGATGCCCAAGGTTGCTCACAAACAACTTAAGAAAGAGTGTTACTTACTTATTGTTTCCACTACTTACTAAGTTTGACTAAATCACTGTCTTGTTAACTCTTTGCTGTTTATACTTTAGGTTCTTTTTTAAAAGTATTATAAAGTAAATTAATAATTCAAAAGTTGCACCGAATATCGAAGCAATAATTGTGATGGAGTGCTATTTATTATAGAAAATAATTCCTGCAATTAATCTCCAAATGCGTTTTTGCTTTTTTATATTTAGAGTAGACATAAAAAAGCACCGTTATCATAAAGAATCAGCAGATAAAAACAAAGGCACACACTTACAGTTAGCTCTGAAAACATAGAAATTGCTCACAAGCAACGTTGGGTGCGAAAGGGTTAAGTTTGGTATCTTTTTTCTCTACTATGCAGTAAACCAGTATGTAGGCTTGCCGGTTGAAAGTGTTGTTATGCGCATATTGTTTACTATGCATTTTGTACAGTTCGCTTCCTTCAGGCTTAGCATTAGTCACCTCCTACTACGCTTCCATATTCAAGGTTAAGTTTACTTGCATGAATTTGTTTACAAAGTAACATTATCATCATGTTAAGTAGAATTATTTGTAAGTTCAGACTGTTTTCCTAATAGTTGCTCTATTCTCCAGTGATGTGTTTGTTTGCTATTTCCTGCAGCAATTTGGGCACCAAGATTGATAATCGTTACTTTGTTGGGTATATGTTGGCTTGGCACGATGAGGCGGAACAAGCTTTGCTGGATTCCTAAATCATTTTTACTCAGATCATTATTTCTATTTTCTATTTTTTTTTGGACAAGAGTTCCTGATAAATTCTACACCCTTTGTAGCTGGCGGCGTGTTCTTCGTAGCAGTTGGTTTATTTTGCTGTGGTTGTTCCTGTATTTTTTCGGGCAAATGTTGCTTGGGTGTCGAGAAGAGGATTTTACACAACGGTACGTTTTGGTACAATATGATTTAGTATGTCAGGTTCCCTGGCAGCTATAGCATTGAACGATTTCATTGGGGAGGCTCAATATTTTATTTACATTATATATGTCTAGGTTTTTTTGTTGAGCTCAATATCTACATAAAACGTGTTCAGTGACGTTTTGGTCGCACGGCTTTTTTAATATTATATGTTTCCTATAACGCTGACCTTTTGACTCTTCATCACTTTTAATTTCATCTAAATTTGTGGAAAAATGCAAATTCTTAATAACAACTCTAAATGCTCTGTCATCCTTTAGCTGGTATGTGTGTGGTGCTGCACACAATCATTATTAAGTGTTTTGTTAATTTTTCGAATTCTTCAATACTTTTTAACCATTACTCTTACATGTGTCGCAACGTTGGAGTCTTATAATAAAAAAGTTCTCTCTTAATTTTAGTTTTAAGATAAGTTAAAGAAAACGCCGCTTATACCATTGACGTCAGAGAGAGAAGATAGGTGGGGGCTTAGCAAAATCAGTTGCACAATATTTGTTTACCATTTCAGAATATTCGTTTTTTGTTATATTTGTTTCTGTTTGTCCGGGCAATCCGTCGCCCAAGAGAGCGAAATTATTTGCGCTGGTGCTTGATGGTGTCAAGAGTCCTGTTTTCTTTGAACTTCGGAGGCTTGGTCTCTTTTTTGGATTTTATTTTACTCTCCACGAAAACGGTTAGGTCTTCGTCGGTGTTAGCTCTGCTTGAGTATTAAGAAGACAATGATTGTTGAGTGCTTGTGTCCGCACTTCGTGCCTCAAGATATGACCAAAGCAAAAGACACTAGAATAATTCTAATTTGATATGACGTTTGCAATAAACAGTTAACATTTTTTTTATTTTTATAAATTTTTATTTTCTACTTCGTATTATTTTTATGAAATATTTTTTCTCAGTGTAATGACTTCTTTTTTCAGTTTTTTTTTATATTCCAATTTGATATCTTAAACAGCGCGCAATTTCATCATATTCTACGAAATTGGCCAAAACTCCCCAAATATGTATGTACATATGTAAATTCGTTACTGCGATCAGAATTGATTTCGGCCCGAAAATCGCCTTCTAACTGCTTACGCACACATATACGCGTTCTCGTCTTTTGTTTTTACTCACACAAGCAAACAAATTCTATTTTTAGATTTCTTACGCTCAGCGTGAGCGAGCGGAAGAGGCACTGAATTTTGGCCGTCACCAAAAGTGGCTGCATAGTGCCAAACCAGTGTATGGCTGTTACGCATCTTATTATTCTAGTGTCTTTGATGCAGGCCATGTGACTTTTTTGCTTAAATGTGTACATGCTTTCAACACGCCACCTCAAAGTAAGATTGCTGTACTTTTATTACTCACGGACTGTGCGTCATTTCCTGACGAATAATTTTGATCAGCATTCGTTGCGAGGTGTTGGGGAGACAGAAAACTTAACCAGATCAATTGAACATATTTACATAAATTCAGTTTTGCAAACTATTTTTTTAACTAAAATTAATATTAGTCATCTTTGTAGAAACTCAAAATTATCCGGTAACTAATTAAATTTGTGGTTAAATGATGATTTTTTGGATCGGTCTGGTTCCTCGTCAGTTCAATCCTAAGAATATAATGTTTTAATTCATTCTGAGAGTCAAAGTCCACTTCTCAATGTAATGAATCTTTGCAGATGGTACCGGCAAGTTGTAAATTTGTAGATATATACAGTTTGTCAAGAAACTATTTACACGCCGTGAAATAGTTGAATTTTTCACTTTTAAAGGTCAAAATTAAAGGGTTATTTCTTTAATTAAACGCAATTTTTTTTAATGAAATATAATTAACAATATTTATTTTACTTATAAATTAAAAACAAATTCAAAATATCAAATATACAAGAATTAAACAACAAATTCCAAGTTTACACTTTTTGAGAGTGGCAAAACTCCTTACATTTTGTTTCCTACTTTGTTTTGCTCTTTTTTTCTTAGAACGAACTCGATTTTTTCCGTTATTTTGGCATTTGCATTCCTTTACAACGCTTCTATTGAAATTTTTTACTTTGCTTGTGTGAAATTTTGCTGATCGAATGAGTTATTAAATTTAATAAAAATGCTGGAAATAGATTAGCTTTTGAAGTGACCCAAATAATACTAAAACCACCAGTTGGGAAAATCTATTCAGAATTAGTATAAATGTTTTCTGTATCCCGTAAGACCGTCTACAATGTTTTTAATCGCTTGAAAAAAAAGAACGGGCTTGAACCTAAGAGTGGTGGGCGCAAAACTAAAATTAGCAAGCGTGGTAGACCGCCTTATTATGCGAAAAGTGATTGCGAACCCCGAATCTCGGTCAGATCCTTGCTCGGGATATCAGGCAAGAATGTGACCTGGTTGTTGCCACACAAAACTGTGCGCCAAGTCATTCTACGCCATAGGTACTCTTCAAGAGTTGCAAGAGAAAAAAGCCTTTGCTATCAGGGTCAATATAGAAAAGCGTCATTTATTCATTCGCTGTGAGCATGATGGATCATGCGGAAGAATGCCCTGGGATGACGTAATATTTTGTGACGAAACAAAGCGTTGCTCTATTATAACGATGGGCCAAGCAGAGGTATGGCGCAAGCTGTTGAGTGCGCTAGAAAAAAACAAAATATCATTTCCAACAATCAAATTTGGAAAATTTATCGGTGATGATTTGGGGCTGTATCTCAAGTATGAATTGGGCAAATTAGCCTTTATTGAAAGCACTATGAATGCCGTGCAATATCTAGATATTTTAAAATCAAATTTGAAGGCCAGTGCAGAAAAATTTGGTCTGTTAGCAACAACAAGCCAAATTTTAAGTTTTATCAGGACAATGATCCCAAACATAAAGAAGTGCAATGTACGCAACTTGGCTCCTTTATAGCTTTGTGGCAAGGTGATCGATACGCCCCCTCAGAGTCTTGATCTGAACCCCATTGAAAAGTTGTGGGCCTGCTTAAAGAAGGAGAAATGTAGCAAAGGGGCGCAAAACGACTAACAGCTCATGGCTGCGATAGAGTGGGGAAAGATCCCGCTTGAATATGACCTAAAAAACTCATCCATTCCATGAAAAAGCTTCGGCTTGTGCAAAGCCAGTAAGGGGTCGTACTAAATGCTACAACTTTTTCAAATTTTAACAAAATAATTTAAAATTTAGGATTAAACTTAGGTTTAGTGTTTTTGTGTAAAGAGTTTCTTGAAACTCTCAAAAGTGTTTAAACTTGGAATTCGTTGTTTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTTTAATTTATAAATTAAAATAAATATTGTTTAATTATATTTCCTAAAAAAAATTGCGTTTAATTAAACAAATAACCCTTAATTTTGACCGTTAAAATCAAAATTCATCTTATTTCACGGTGTGTAAACAGTTTCTTGACAAGCTGTACTTGTCGCCAGATTTATTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTAGAGAGTGATGCCGGTATAAAGTGATTCCAGATCCGACATCAAGTAGGACCGCCTACTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTGTGTTTTAGCTGTTCTTTATTTGATCCAATTTGAGGAACAGGAAGGTCCCTTTCCATTCGAAATTAATTCGTCAATCCTCTCTTATGATCTACATACAAAGGTTCTTAGCCTAAGTCGAGGAGCAGCGCTGCCAAGCATAGCCTGCAGCCTCAGCTTATTGCTATATGCGTATCTTATATATATGTATATATATATGTACTGTCGCCGAGCGATGGTGCTGCCGGAGGGTATAGGCACACATATAAGCGATCAGCGCTTGGCCAGCGGGAACTGCTGACCAGGCAATTATGTATGTTAGCCCTCGAAGTGGAGTTGCTCGTATTGCATTATACACTTGTGCTGGACTGTTTATGTACGCATTGCAACAGAGTGCTACAATTATGAATACACATGGAACGGTGCTTAGCAGTGTGTGCATGCTACAATAATTGAAAACAATTTGCTGACGTTCTAGAGTCGCCAGAATCGCCATTTTTTCTGAACTGTTAAAGAAGTGCAAAACTCACAAAGAGACCCAAAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCTGAACGCACGGGCTTAGACACTCAATCCTGGTGCGGAATGAGAGGTCTACATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCAGGAAATACTCGAAACCATAGAAGTTGTGTCGGCCGGTTATTGTTGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCATAGTTCTGCCGCTGCAATCACGCGAGTTAATTGTGCGCCTGTTTCATGTAAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAACAGCTGATAGCGCAGCGGGCGATCTGGAGAGGGAGGCGTTGCCAGATCAACCGATGTGATCAGTGTTGTGTTGCGACAGTAGGGCGCGAAATTCAAAATTAAATTTAAAAATTAAGCCGTTGAAATTTAATTTAATTTAATTTACTGATTCTGGTAGCTGGGGTACACAAGTCTTTAGAAAGGGGAAAAGGCAGCACAAGGTCGCGGACAGACCAAATCATCCTCTCACCGTGCTGGTGCTAAGCAGAGGCTCTGGTGTCCGAGTCGAGAAGGCGGTACAAACTCCATCCGTAAAAGCCGAAATCCGTGGCCCCTGCGTGACCCTAGAGTAACCTTAGGCCATCCCCTTCCGGTTGATGGACAGCGCAGTGGGGGGCAGTCCCCTGATCGCAACGACCCGTTCAGGAGGAGCTCCCCGACTTTCGAGATCCCCACCAGAGGAGTCGGTAACCCGACCCATGGTGACGGAATCTCGGTCCCATCAGTGGCAAGGAGGTGACACGCAGGCCCCAGCCGCCGTTGACTTATCGACTGCAGCGATCTGTAGAGGTGGAGAAATTGACTCCCTACAGCATCTACGACCGCGACAAGTCGAAGACGATGGGCCACATCGCCGTGCCATCGCAAAGACGGGAGAAGTCCCCAGCTTGTTCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCCAGAACGGGCTGAGGGCATACTTCAGGATGAATGGCAAGATCAGCCCCTTCTATCCGCATTCGAGACCCAACGACACATGAGACAAAGGGCATAGCTTCCGAACTCTCAGCCCTTAACAACAGGGCGATAGAGCTGTACGAAGGTACTACTAGCGAGCACCGCTTGAGAGCAACTACCCAGACGGAGGTACAAAGCCACCAAAAGGCTCACAAAATGCGCGGGTACCCACGGTGCGAGGTGCCAAAGTCCAGGCGCCGAAGCAGAGCAACCCTACGTTTGGATGGCAGCGGTGAAGAGAAAAGGCGACATCCATACCTAACGAGTCCAAGCCAGGCAGCTATCATCTGTCGCCAAGAATGCTCTTTAGCACGGGTGCAGAGCGCTCATCGTAAAAGACAGGAGAGGCTTCGTGCGCAGAGATGCTTCGGAAGCTAAGATCCGGAATCGAGCCTTAGCGAACTGGGCGATCACGTGCGAAAAAAATCCGGAGAGGAAACAGAAAAGGTGATCTGTTGCTTGGTAGAGCTTCGGAAGCGTTCCCAAGTTTAGAAGCGACCTGGAAGCGGCGCTCAACCGGCAACCTCTGTGCGCACAGGAGCGCAAAGAATAACTCTATCTTGCAGCGGATTGGACGAGGCTACGGCTAACAGAAGAAGCTCCACAGCACAGCGGTCGCCCAATTCCAGGGCCTGCAGATAAATCCTGAAGATATCAGGGGGGGGCCTTCGCAGTATGCGAATTACCAAACAAATAGCCTCAGTGCTGGCGAACGAACGTTGCGATACCAGTCCTTAAACAGGGCACCATAATCGTTGGATGGTCAAGAGATGTCGTATCACCCAGGACGTCCGACCCACGAGATGCTACAGGTGTGTCTCGGCTATGGGCATCGATCAGCAACCTGCAAGGACTGACAGAGACAGACTGCTGTCTTAGATGCGGTGAGCGTGGGCACAAGGCAAAGGGGTGCGTTGCTGCACCAAAATGCCTGATCCTGCTACAGCAGCGAGGTGGACAGAAACCACCCGACGGGTAGCTTTGCGTTGCCCGACTTACAGAGCGACACTAAAAGATGCCAGAGCCACCTTAATGCACGCTCATATTAGCATGTAGTACAGCTCAATGTCAATCATTGCGCAGCAGCTCAGAGCCTCCTGGCCCAGACTGCGGTTGAGCGCAATGTAGACATCATGCTCTAAGCGAACCCTACGTCTGGTAGTGGACAATCGTCCATGATCCTTGACCTTGAGGCAGGTAAAAGCAGCTATCAAATGCCAGCTCTCCAGTCCAGGAGCAGCTGCTTTACCCATGCGGGGCATCGCTTAGAAGTTAAAACACGTGCACATGTACAGCTGCTACGCCGAGCGACACCCCGATCAGTTCGAGGAGCTTCTGGAGGCGCTCGTGGACATGCAGGAGGCGAAGCCCGAGGTCGTACCGGCGACTTTAATGCCTGGACGGTGGAATGGGGCAGCAGGACATCAACACCAGGAGAGGACGAGGAGAGCTGTGATTGACGCCATGCAGATACTGGACCTCATACTGCTGAACGATGGACGGAAGCGGAAGCGTTTAGCTGTAACGATAGGGGTACGTCCTTTATTGACGTTACCTTTGTCAGCAGAGGGCTAGTAGGCAAGCAACAACTGGATGGTCCATGACGTCATGACGCTGACTGACCATGCCTGATCTCCTTCTCCCGGGAGGGTATGCCCAAGGCGGCAGAGTAGAACAGCGGAAAACATGGGACACCAGGAAGATCGATGGCCATGCTGGCCTATCAGATCAATTCCTGGAAATCCCAAATAATGGACGCAGAGAGTATGGCGGCAGGCCTCATGAATATGCTGGGAAAATCTGCGACGCAATCATGCCAAGGAAAATAAGGCACAGCGCAAACCACCCGTTTACTGGTGGAGTGCCTCCCTAAGCCAACTACGGTGCGCAGGGGCTAAAGAGAACGGCGCAACGAGCCAGAGGCGAGTACCCACCACGCCCAGGAACTCTTGGAGGCTTTCCAGAAGCAAACGCCTAGAGTTCAAGCACACGTATCGCGGCTGCCAAAGCGCGGTCGTTTAAGGAACTGCAGGATGGCGTAGACAGCGATATCTGGGGCCTCGCCTACAAGCTTGTTACCAACGAGCTAAGGAGGAGGAGAGCGGCAACCTACCATCCGACCCGGGGGTCCGCCATCGCTGAAATCGGGCCGTCACGCGGCGGCA
->1ef80ce2-66a6-480c-b4d9-b7102136810b
-TCGTGTACTTCGTTCCGGTTACGTATTTGCTGAACTGAGTTCTACGCGAAATTTGAGTATATTTCAGCTAATTTTGGCCTGGGTGTACCGGCTAAACCCCTATGTAATGCCAACCGGGGCCTCAACTGGTAACTCTTTTGTTTTTGGGCATTTTGTTTAATAACTTTAATATGAAGATGATTCAAATCTAATTTTTTATTCAATAATTTAAGTAATATTTTAAGCAAAATAAGCCGACACTTGTCCGCTCCGGCTCCAATCCCACTTCGAAGAAAATTGCGTTGTGAAAATAATTCGTGATGCGAGGCAAAGGCCATTGATGCAAATAGCTTCTGACAACTGATAAAGATTTCTTCATTTAACTCTTCCTTGCGCATAGAACAGTTATTTTTTCAATTCTTCTTTCATCTGTTTCTACTTTTATGATTTGAATTTGCAAAAACAAAGTTACTACATTCACCTCCCCACTTGCTGCACAAACAACTGTTTGTGAGCTCCATGCCACCAAAATGCGCTGTGAAAATAATTTGACCATGACTGTATATCAGTTTGCCTAATACATTAAATGGATTAGCTGAATATCAAAAGGATGTGTACAGAACTCCACGGTCGTCTTTATGTCCCCGACATCAAAGTTTGTCATCTTCCCAAATACTCTCTGGAGCCTACAAACGGCGCTTGTTCTCCACTTTAACCTCTTTGGATCAATCAATTTTCTCTAAACAACTGTCAACAACAACGCAAGAGTCAGGTTTCACATCCTTCAATCACTGTTTTCCAGAGGTCAATATCGATCTTTCAAAGGAATTCCTTCTAAATTCTTCTCCAGTGCCAAGTAGAGTAATCTTTCATCCTCACCACTTTCTTCGTCGGTAGAAATATCAATCGAGAGTTTAGAAATCCCGTTCAATTTCTTCGTTAGACAAATAACAAACCTAAGTGAAAAGTATTATCCACCGAATGCTTGGGTTTATACAAAGCAGCTTAAGTATTACGCACTTTATTGTTCACTGCGCACCCTGCGGATTTGACTAAATCCTGTCTTGTTAACTCTTTGCTGTTTATACTTTGGGTTCTTTTAAAGAGTATTATAAAATGAAGATAGCCATTCAAAGTTCACCGAATATCGAAATAATAATTATTGTGATGCGCGTGCTATTTATTGCAAATAATTCTACAATTAATCTCCAAATGCGTTTTAGCACTATATTTCAGGTAGACACATAAAAGCACCGTTATCATGAGATCATCAGATAAAACAAAGGCACTTACAGTCCAACTCTGAAAAAACATAGAAAATTCGCTCCGCGATAACGTTGGTGCGAAAGGGTTAGTTTAATTATCTTTCTACTATCGGTTGGAAGGCCAGTATATTCAGGCTTGCCGGTTGAAAGAATGTTGACCATGCTGTTGTTTACTGTACGCATTTTTTGTTTCTATAGTTCGCTTCCTTCGGAAGCAGCATTGAAATCACCCTCCTACTACACGCTCCACATATTCCAAGGTTAGGATTTATACATGAATTGTTTACAAACCAACATTATGTGATAAATTATGAAGTTCAGCGAACAACACCGTAAGTTTGTCTATTATTCTCTCGGTGATGTGTTTGTTTGCGCTCCCACGCTTGAATTTGGGCATAAGATTGATAATCGTTGCCCTGTTATGGGTATATGTTGAAGCACATTGAAGCTAGAACAAGCTTTGCTGGATTCCTAAATCATTTTATAGATCATTATTTCTATTTTCTATTTTTTTTTGGACCACGAGTTCTGATAAATTCTACACCCTTTCTTAATAACCAGCTGGCGGCTGATTTAATATTTCAAAGTAACTGAATTGGCACCATTTGCTGGTTGTTCTGTGACCACTTTCGGCAAATGTTGCTTGGGTGTCGAAGAGAGTTTTAACCCGGTACGTTTTTTGAATTTTAATATGATTTGGTATCCGAATTCCTGGCAGCTATAGCCATTGAACGATTTCTACGGTATTAGAATCAATATTTTATTTACATTATATGTCTAAGGTTTTGTTCAGGCTCAATATCTACCATAAACATGTTCGAAAAGTGACGTTTTGGTCTTTTTTAACTTAATATACTTATGTTTTCTAACAACATGACCTTACCCCGATACTTCATCACTTTAATTTCATCTAAATTTATTTGGAAAAATGCAAATTCAACAGCTAACAACTCTAAATGCTCTGTCATCCTTAAGCTGGTATGTGTGTGGTACTACACCTGAGAAAATCGGTAATGAAGTGTTTTTACGGCTTCATTTCAGAATTCTTCAATACTTTGCTCATTACTCTTACATGTCCATAACGTTGAGTCTTATAACCAAAAAAGTTCTCTCTCTTAATTTTGGATTTTAAGATAGGTTAGCTTTTCACTTATACCATTGACGTCCCAGAGAAGATAGGTGGGGAGCGCTCAAATCAGTTGCACTGTCTTCATTTACCATTTCGAGATCTTCGTTTTTTTGGTATATTTGTTCTGTTTTGTCCGAAGACGTCCGTCGCTTCCAAGAACGAAGTGTTGCCTTTGGTCTTGATAGATGTCCCAGGAATCCTGTTTTCTTTGAACTTCAGGGGCGGGTCTCTTTTGGATTTTATTTTTTGCTCTCTGCCATTTCAAAGCGGATTCGGTCTTCGTCGGTGTCGCTCTGCTTGAATTATTCAGAGAAGATAATGATTGATTTGAGTGCTTATTCATCCCGCCACTTCGATACTCAAGATATGAAAATACGAAAAACAAAGACACTAAAGACAATTCTAATTTGATCATGACCCGGTTTGCAATCAAACCCAGTTAACGACACTTTAATTTTCTAAAATTTTTATTACTACTACTTCGTATTTACACATGGAAATATTTTCTCGGTCTTAATGACTTCTTTTTCTGATTTTTTTTTTTATATTCAATTTGATATCTTAAACAGCGCGCAATTTCATCATATTCTGAGAGAATTAGCAAAACTTTCAAATATGTATGTATATGGCAAATTCGTTAACTGCGATCCAAATTGGTCAGTAGAAATCGCCTTCAGCACAACACGCACACATATACTGGATTCCCTATAGATACTGTTTTTACTCACACAAGCAAAGCAAATTCTATTTTTTAGATTTCTTACGCTCGCGTGGCGAAGCGGAAAAGAAACAATTTCCCGGAAATCCCACTTAAAAGTGAAACATAGTGCCAAAACTCAGTGTAGCCTGTTACCGCATCTTATTATTCTAGTGTCTTTTGGTAAAGGCCATGTGACTTTACAGCAAATGTGTACATGCACCAACCACTGCCACCTCAAAATGGATTACTGCTTTATTACTCACGAGAGACTGTGACACGTCCTTCGACCCCGGAAAAATAATTTTGATCCAGCGACCTAGTTGCGGCAGGAGTTAAGGAGACAGAAAGAAACTAACCAGATCAATTGAACTGTATTATTTACACATAGAATTCCAGTTTGCAAACTTGTTTAACTAAATTAATATTAGTCATCTTTGTAAGAAACTCAAAATTATCCAGTAAGCAAGGTAAATTTCGGATTAAATGATAGTTGGTTGAATTAGTTCAGTCTGGTTCTCGTCAGTTCAATCCTAAGAGAATATAAATATTTTAATTCATTCACGAAGAGAGTCAAAGAAAGTCCACTTCTCAATAATAATGAATCTTTGCGAATAGTACCGGCAAGATTGTAGAATTTGTGAGAATCATATATACGGTTTGTCAAAAGCTTATTTACTACTCAAATGAAATAGAAGTTGAATTTTTTCGCTTTAAAGGTCAAAGAATGGAATTTATTTATTTTAATTAAACGCAATTTTTAATGAGAATATGAATTAAACAATATTTGTACATATAAGAATTGAAAGCAAATTCAAAAATATCAAATATGCAAGAAATTCAAACAACAAAATTCCAAGTTTACTGCTTTTGAGTGGCAAAACTCCTTACATTTTGTTTCCTACTGTTTTGCTCTTTTCTTAGGGCGAACTCGATTTTTCCCGTTCAATTTTTTGGCATTTGCATTCCTTTTTGCGCCTTCTATTGAAATTTTTTTTTACTTTGCTTGTGAAATTTTGCTGATCGAATAGGTTATTAAATTTAATAAAATGCAAAATGGAATTAGCTTTTGAGAAGTGACCAAATAATATACTAAAACCACCAGTTGGAAAATCTGATATTCAGAATTAGTATAAATGTTTTCTGTATCACATGGAATAGTCTACAATGTTTTGAAATCGCTTGAAAAGAAGAAGAACAAGGCTTCGAAAGACCTAAGGTAATTGGGCGCAAAACTAAGAAAGTCTTGACGGTAGACCGCCTTTATGCTTCGAAATTGATTGCGAACCCCCAAAGATCTCGGTCAGATCACTTGCTCCGGGATATCAGACAAGAATGTGACCCTAGTTCGGTATACAAAACTGTGCGCCAAGTCATTCTACGCCATAGAATTTGCTCTTCTAAGGTTGCAAGAAAAAAGCCTTTTATATCAAGAGATCAATATAGAAAAGCGTCATTCATTCACTGTGAGCATGATGGATCATGCGGAAGAATGCCTGGGATGACGTATTTAGTGACAGAAACAAAAATGATGCTCTAATGCTTTCAACGATGGGCCAAACGGGTATGGCGGCTGTTGAGTGCGCTAGAAAAAACAAAATATCATTCCCAACAATCCAAATTTGGAAGGAATTATCGGTAGATGATTTACAAGACTTATCTCAAACCGTAGGGTGAACCAGAGAATTAGCTGGCACATTGAGAAAGCACTTCATGAATGCCGATTACTACAATATCAGATATTTTTTAAAATCCAAGAATTTAGAGAGGAATGAGATTACCGAAAAAAATTCCCCGGTCACCAATTTAAGCAGCAAGCAAAGCCCAGAGAGGAATTACTAGAAGTTTACTATCGGGACGTGATCCCAAACATAAAGAGTTACGAGAAATATTGCGCCTAACTGAAGGCTCCTTTATAACTGTCAGCAGGGTGATCGATACGCCCCCTCAAGGTCTTGATCTAGACATTTAATTGTGGGCCTACTTAGAATCTCTTAACTAAAGGAGCTGCCAAAAGACACGACAACAGCTCATGTGGCTCGCGATAAGAGGTGAAGGAAAAGATCCCCGCTTGAATATGACCCTAAAAAAAACTCATCCATTCCATGAAGCTTCAGCACCTATGCTCCAAAAGCTCCAATTAGAGGGGTCCATGCTAAAATACTATGGCTTTTCAAATTTCAACAAAATAATTTAAAATTTAGGTTGGCGCTTAGGTTTAGTGTTTGTGTAAGAAGGTTTCTTCAAAACTCAAAAAAAGTGTTTAAACGGAATTCGTTGTTTATTTTCTGCAGCTATAGCCGATATTTTGAGATTTGTTTTTTAATTTGTAAATTAAAATAAATGTTGTTTTGGTATAACCTAAAAAAATTGCACCGTTTAATTAAACCAAATAACCCTTAATTTTGACCGTTAAAATCAAAAAAATTCGTCTTCCATTTCACCGGTGTGTAAACAGTTTTCTTGACAAACTGTACTTACATCATGAATTATTTTTTAATTTCGAGTTAACGATACGTTTTCTGTTACTTTGTGTCGCTGTGAGAGGTGATTACCGAGTATAAAGTGATTCAGATCCGACTTTATCAGAAAATTAAGGACCGCCTACTCCAACTTCCTGTATTAGTTTCGATATCATAGATCATTTTGTGTTTTGTGTTCTTTTATTTCAGTCAATTTTGAGGAACAGGGGAAGGTCCGCCCATTCGAAAGTGGTGATCAATCCTCTTACTGAATCTATACAAAGGTTTCTTAGCGAAGTCGAAGGGGCAGCTTTAGCTGCGCGGCACATATACTGCTTGCAACGGCTTTCTTTATATCATTATCTTATGTATATGTATATGGCCTTGTCATCGACGATGGTGCTTTGGAAGAGAATTGGTATAGGCACATATAAGCGATCAGCAGCAGTAGCGGAGAACTGCTGACCAGGCAATTATGTTAGCCCTCAATTGGGTCTTTCGTACGTATACGCCGGTAACAGACTGTTTATGTACCCCACTACATTACAGCATGAGATGCTGCAATTATGAATACACATAGATACAATGCCAACCATTAATATTGTGCATACTACCAATGGTGAAAACAATTTACTGACAGACACAGGGTCACCAAGGATCGCCATTTTTCTGAACTGTTGAAGTGCAGAGCCTAAAGACCAAAAGAGCTCCAGTAACGATGCGAGTTTGAAATCTGAACGCGCGAGCCAGACATGATCCTGGTTACTGGAGACCAGAATCTACATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCGAAAGTACTTGAAATACGCTAGAGTTTGTGTCGGCCCACGGTGTGTGCGGCAGGCTGGCTAAATCTACGCAATTGAGTCGCGCCATGGTCCTGCGCTGCAATCACGCAGCAATTGTGCGCCTGTTTCATGTAAATAGGTAATTTATTATCTTTGCGATTGTTGCAGCGGATAAACGCTGATAGCGCAGCGAGGAGCGATCTCAGAGGCGTTGCCAGATCAACCGTCAGTCGGTGTTGTGTTGCGACAGTAGGGCGCGATTCAAAATTAAGATTTAAGAATTAAGCCGTTGAAATTTATTTAATTTAATTTTGATTCTGGTAACTGGAGCGCGCAAAGAGTCTTTAGAAGGGAAAAGGCACAAAGGTCGCGGACAGACCAAAATATCATCTCACCAAGTGCCTGGTGCCTAAGCAGAGCTCTGGTGTCCGAGTCGAGGCGATTTCAAACCTCATCACGTAAAGCCAGAGGAAATCGGCCTGCGGCTGACCCTGATAACATAGGCCATCCCCACTTCGGATTGATGGATATTGCCAGTGGGGGGCAGTCCCCTGATCGCAACTTGACCCGTTCGGGAGAGGGCTTTCCCGACACAGTCCCCACCAGAAGAGTCGGTAACCGACCCTTAATTTGTGGAATCGGTCCCGTCGGTAGCAGGAATTTGAGCTTACCTGGGCTAATATAGGTGACTATCGACCTGCCAACGTGCCTGTAGAAGGTGGAAGAAATTGGCTCTACAGCATCTACGACCGCGACAAGTCGAAGACGATGGACCCGCATCGCCGTGCCATCACCGCAAAGGCGGAAGGGGAAGTCCCCAGCTTGTTCCCTCATCGGTCTTCGGACTTGACCACTGCTTTCTCCGAAACCGGACCACAGAGACGCACCAGGATGAATGGCAGATCAGCCCCCAACTATCCATTGAGACTAAGCGACACACCAGAGGAACCAAAGGCACATAACCGAACTCTCAGCCCGCCAACAACAGGGGCGATAGAGGCTGTACAGAAGGTACTTACTATGACACCGCTTGAGAGCAGCGCTTACCCAGACTGGGAAGGTACAAAGCCCTACCAAAGGAAATACAAAATGCTGCAGGTACCACGGTGCAGGTGCCAAAGTCAAGACGCTCCGAAAGTATAGAGCAACCCTACGTTGGATGGCAACTGGTGAAGAACGACATCCATACCCTAACGGGTCAAAACCAGGCAGCTATCATCTGTCACGCCAAGAATGCTTTAACACGGTGCAGGAAAACGCTCCGCATCGTATTAAAGACAGGAAGGCTTACCGTGCACTGGATGCTTCCGGAAGGCAAAAGATCGGAATCGAGCCTTGGCGCGAACTGGAGAAGATCACGATGCGAAAATCGGAAAGAAGGACGCAGAAGGTGATCATTTGCTTCGGTGGGAAAGCTGGAAGCGTTCCACAAGTTTAAGAGCTGACCTGGAAGCGGCGCTCAATGACTTGGCCTCTGTGCGCACAGGAGCCGCAAAGAATAGCTCTATCTTGCAGCGGATGGACAGGCTACGACGGCAGAGAAGCTCCCTGGCCTGGCGGTCGCTAATTCGAGGGCCTGCAGATAAATCCTGCTGAAGAAGGATATCGGGGGCCTTCGCGGTATATGGTGCAAGCAAATAGCCTCAGTGCTGCTGAACTGCCGAACGTTGCTGATACTTCAGTCCTTAAACCAGGGCACCATAATCGTTCGGATGGTCAAGATGTCGTATCACTAGGACGTCCGGCCACGAAGGATGCTACAGGTGTCTCGGCTATGGGCATCGATCGGCAACCTGCAAAGGACTGCTGACGGAGACTGAGCTGCTGTCTTAGATGCGGTGACGTGAACAAGGCAAGGGTGCGTTGCTGCTTTCAAAATGCCTGATCTACGGCGGCGAGGTGGACAGAAACCACCCGACGGGTAGCTTTTGCGTGCCCGACTTCGACGACACTAAAGATGCCAAGAGCCACCTTAATGCCGCGCTCATATTAGCGTGGTACAAGCTCAATGTCAATGTTGCGCACAACCAGCTCGGAAACCTCTGGGCCCCAGACTGCGGATTCCCCGGCGCAATGTAGACATCATGCTCCTAAGCGAAAACCCTACGATCTCTGTTGAGTGGACAATCGTCCGCTATGATCCTTGACGAGGAGCAGGTAAGCAGCTATCAATGCTGCAGCTCTCCTCAAGTCCGAACTGGCTGCACTTTACCCATGCGGGGTATCGCTTTATGCGAAGTTAAAGCTTACGTGCTACGTATTTACAGCTGCGCTTCTCCGCCGAGCAGCACTACGATCAGTTCGAAGAAGAACTTCTGGAGGCGCTCGTGGATAAATACCGAAGAGGAGCGAAAGCCCGAAGGTCGTACCGGCTTGACTTTAATGCTGGACGGACGGTGGAATAAGGGCTGGCAGGACATCAACACCAGAAAGGACGAGCTGTGATTGACGCCATGCGAATGCTGGACCCTCTGCACCGAACAGTGAACCCGAAACCGACGTTTTGCTAACGATAGGGGGGCCGTCCGCTTTATTGACGATACCTTTGTCGGCAGAGGGCTAGTGAATAACTGCAACAACTATGGATGATCCATGACGATCATGACGCTGAGCACAAACCATCCTGATCTCCTCTCCCGGAGGTATTACAAAGACGGCGAAGTAGAACAGCCGAGGAAAACATGCGGACCTCAGAGAGATCGATGAGACTTCATGCTGGCCTATCAGATCAATTCCCGCAAATCCCAAATAATCAGACTGCCAGAAGAGTATGGCGGCAAGGCCTCATGAATATGCTGGAAAGAATCTGCGACTACAATCATGCCAAGAGCAATGCACGCGGG
->3776c0fc-7145-4027-bff3-2be292df0127
-CTAGTACCGAGTATAAAGTGATTCGAATCCGACATCAGAATTAGGCCGCCTACTCCAACTTCCTGTAGTTTCATTATTGTGTTCTTTATTTGATCAATTTGAACGAAGGTCCCGCTCCATTCGAAATTAATTCGTCAATCCTCTTATGATCACATACAAAAGGTTTCTTAGCCTAAGTCGAGGAGCAGCGCTGCCGGCATAGCCTGCAGCACAGCAACGCTATGTATCTTATATATATGTATATATATATGTACTGTCGCCGAGAACGATGGTGCTGGAGGAGGTGGTATAGGCACACATATAAGCGATCAGCTGGCAGCCAGCAGGAGAACTGCTGACCAGGCAATTATGTATGTTAGCCCTCAAGTGGGTGCTCGTATTACATGCCCACTTGTGCTGGACTGTTTATGGTACATTGCAACAGAGTGCTACAATTATGAATACACATAGGTACAGTGCTTAACCGATATGTGTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTAGAGTCGCAAGAATCGCCATTTTTCTGAACTGTTAAAGAAGTGCAAAACTCACAAAGAGACCCAAAAAACTCAATGCTGTCGTATTGCCAAGTTTAATCCTGAACGCACAGGCTTAGACACTCAATCCTGGTGCGGAGACCAAGTCTACATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCGAGAAATACTCGAAACCATAGAAGTTGTGTCGGCCGGTGTGTGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCATAGTTCTGCGCTGCAATCACGCGAGTTAATTGTGCGCCTGTTTCATGTTAATTTATTTATTATCTTGCGATTTGCAGCGGATAAGAAGCAGCTGATGGCGCAGCGAGCGATCTGGAGAGGGGCGTTGCCAGATCAACCGTGATCAGTGTTGTGTTGCGACAGTAGGGCGCGAAATTCAAAATTAAATTTAAAATTAAGCCGTTGAAATTTGAATTTAATTTAATTACACTGATTCTATTACAGCACAGGGTACACAAGTCTTTAGAAAGGGGAAAAAAGGCACAAAAGGTCATGGACAGACCAAATATCATCCTCGCAGTGCTGGTGCCTAAGCAGGGCTCTGGTGTCCCGGTCGAGGCGGTACAACCTTCCATCCGTAAAGCCGGAAATCCGTGGCCTACGTGACCCTAGGTAACAGCAGGCCATCCTTCCAGTTGATGGACAGCGCAGTGGGGGGGCAGTCCCCTGATCGCAACGACCCGTTCAGGAGGAGCTCCCGACTCGGTCTGACCCATGGTGACGGAATCTCGGTCCCGTCGGTGGCAAAGGGGTGAGCACGCAGGCCCCAGCCGCCGATTGACTATCGGCACAGCGATGCTGTAGAGGTGGAGAAATTGGCTCTACAGCATCTACGACCGCGACAAGTCAGAAGACGATGGACCACCTCGCCGTGCCATCGCAAAAGACGGGAGGAAGTCCCCAGCTGGTTCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCGAACGAGGACCTGAGGGCATGCCACCAGGATGAATGGCAAGATCAGCCTTCTATCCGCATTCGAGACCCAACGACACACATGAGAGACAAGGGCATAGCTTCCGAACTCTCAGCTGTATAGGGCGATAGGGCGCAGGATACCCTACTAGCGAGCACCGCTTGAAGAGCAGCGCTACCCAGACGGAAGTACAAAAGCCTGCAAAAAACCACAAAATGCGCAGGTACCCGGTGCAGGTGCCAAAGTCCAGGCGCCGAAGCGAAACCCTACGTTGGATGGCAGCTTGGTGAAGAAAGACGACATCCATACTAACGAGTCCAAGCCAGGCAGCTAGCCATCTGTCGCCAAAGAATGCTAGCACGGGTGCAGAGGCACTCATCGTAAAAGACGGGGAGGCTTCGTACGCAGAGATGCTTCCGGGTAGATCGGAACCTTAGCGAACTGGTGAAGTCACGTGCGAAAAAATCCGGAGAACGCAGAAGGTGATCTGTTGCTTGAGAGTAGAGGGCTTCGGAAGCGCGTTCCCCAAGTTTAAGAGCGACCTGGAAGCGGCGCTCAGTGATATCTGTGCGCACAGGAGCGCAAGAATAGCTCTATCTTGCAGCGGATTGGACGAGGCTACGACAGCAGAGAAGCTCCACAGCTGCTTGGTCGCCCAATTCCAGGGCCTGCAGATAAATCCTGAAGATATCAGGGGCCTTCGCAGTATGCGGAAGGAATTGCAAACAAATAGCCTCAGTGCTGCTGAACGCGAACGTTGCGATAGAAGTCCTTAAACAGGGCACCATAATCGTTGGATGGTCAGAAGATGTCGTATCACCCAGGACGTCCGACCCACGAATGCTACAGGTGTCTCGGCTATGGGCATCGATCAGCAACCTGCAAGGACACTGACAGGGCAATGTAGATGCGGTGAGCGTGGGCACAAGGCAAAGGGGTGCGTTGCTGCAAATGCCTGATCTGCAGCGGCGAGGTGGACGAAACCACCCGACGGGTAGCTTTGCGTGCCCGACTTGAAACGACAAAGATGCCAGAGCCACCTTAATGCACGCTCATATTAGCGTAGTACAGCTCAAGTATCAATCATTGCTGCTTGTCAAACCTCTGGCCCAGACTGCGGTTGAGCGCAATGTGAACATCATGCTCCTAAGCGAACCCTACGTCTCGGTGGTGGACGATAAGTCCATGATCCTTAGTGACGAGGCAGGTAAAGCAGCTATCAAATGCTGCAGCTCTCTCCAAGTCCAGGAACTGGCTGCTTTACCCATGCGGGGTATCGCTTATGCGAAGTTAAAACACGTGCACATGTACAGCTGCTACGCTCCACCGAGCGACACCCCGATCCAGTTCGAGGAGCTTCTGGAGGCGCTCGTGGACCATCACGAAGGGCAAGCCCGAAGGTCTAATGCCTGGACAGTGGAATGGGGCAGCAGGACATCCAACACCAGAGGACGAGCTGTGATTGACGCCATGCAGATACTGGACCTCATACTGCTGAACGATGGTTGGAAGCCGACGTTTAACAACGATAGGGGTACGTCCTTTATTGACGTTACCTTTGTCAGCAGAGGGCTAGTAGACAACAACAACTGGATGGTCCTTGACGTCATGACGCTGAGCGACCATGCCCTGATCTCCTTCTCCCCGGAGGGTATGCCCAAAGACGGCAGAGTAGAACAGCCGGGAAAACATGGGACACCAGGAAGATCGTGAGCCATGCTGGCCTATGTCCATTCCTGAAGTAAATGTGGACGCAGAAGGTATGGCGGCAGGCCTCATGAATACTGGGAAGAATCTGCGACGCAATCATGAGCAATACGTAACTACCGCA
->6b630d92-01f0-41ae-a90a-1724cd5437be
-TTCGGTGTACTTCGTTCGGTTACATTATTGCTATGATTGCGTCGCAATTTCTTCCCAGCATATTCATGAGGCCTGCCGCCATACTCTCTGCGTCCACATTTGGGAGTTCAGAGATTGATCTGATGGTAGCGCTGGCCTCATCGATCTTCCTGGTGTTATCTTTTTCCCAGCTGTTCTACTCTGCCGTCTTTTTGGGCATGCCCTCCGGGGAAGAAGGAGATCAGGGCATGGTCGCTCAGCGTCATGACGTCATGGACCATCCAGTTGTTGTTGTCGCCCTCTGCTGACAAAGGTAACGTCAATGAGGACGTACCCCTATCGTTGTTAAACGTCGGCTTCCGTCCATCGTTCAGCAGTATGAGGTCAACATTCGCATGGCGTCAATCACAGCTTCGTCCTCTGGTGTTGGATGTCCTGCTGCCCCATTCCACTGTCCAGGCATTAGAAGTCGCCGGCAATGACAGGCTTCGCCCTCTCGCATAGTCCACAGGCGCCTCAAGCTCCTCCGAACTGATCAGGGGGTGTCGCTCGGCGGAGCGTAACGGCTATTACATGTGCACGTGTTTTCGCTTCGCATAAGCGATACCCGCATGGGTAAAAGCAGCCAGTTCCTGGACTTGGAGAGAGCTGCAGCGTTGATAGCTTCTTTACCTGCCTCGTCAAGGATCATGGACGTTGTCCACTACCAGGGCAATGGGGTTCAGCAGGAGCATGATCGCTACCACGTGCGCTCAACCCGCAGTCTGGGCCAGGAGGCTCTGAGCTGCTGCGCAATGATTGACGATGAGCTATTACTACGCTAATATGAGCGTGCATTAAGGTGGCTCTTGGCATCTTTACGGAGTGTCGCTCGCAAGTCGGGCACGCAAAGCTACCCGTCGGGTGGTTTCTGTCACCTCGCTGCTGCAGATCAGGCATTTTGGTGCAGCAACGCACCCTTTATTGCCCACGCTCACCGCATCTAAGACAGCAGTCTGCCCTGTCGGATGTCCTTGCAGGTTGCTGATCGATGCCCATATGAGACACCTGCATATTGGGTCGGACGTCCTGGGTGATACGACATCTTGTCATCCAACGATTATGGTGCCCTGTTTAAGGACTGGTATCGCAACGTTCGCGTTCCAGCAGCACTGGCCTCTTGCAATTCCGCATGCGAGGCCCTGATATCTTCAGGATTTATCTGCAGGCCTGGGTGGGCGACCAAGCAGCTGTGGAGCCTCTGCTGTCGTAGCCTCGTCAATCGAGATAGAGCTATTCTTTGCGCTCCTGTGCGCACAGAGGCCAAGTCATTGAGCGCCGCTTCCAGGTCGCTCTTAAACTTGGGAACGCTTCAGAAGCTTCTCTACCTCAACAACAGATCACCTTTCTGCGTTCTCAGTTTTTTCGCACGTGACTGCCCAGTTCGCTAAGGCTCGATTCCGATCTTGGCTTCAGAAGCATCTCTGCGTACGAAGCCTCTCCTGTCTTTTACGATGAGTGCCTCTGCACCCGTGCTAGCATTCTTGGCGACCAGATGCATAGCTGCCTGGCTTGGACTCGTTAGGTATGGATGTCGCCTTTTTCTTCACCGTTGCCATCCAACGTAGGGTTGCTCTGCTTCGGCGCCTGGACTTTGCTTTCACCGTGGTACCTGCGCATTTGTGGAGCCTTTTGGTGACTTTTTGTACCTCCGTCTGGGTAGCTTCTCTTCAAAGCGGTGCTCTTCAGTAATTACCAGCCTCATTACAGCTCTATCGCCCTGTTAGTGGGGCTGAGAGTTCGGAAGCTATGCCCTTGTCTCTCATGTGTCGTTGGGTCTCGAGATGCGGATAGAGGGGGGCTGATCTTGCCATTCATCCTGGTAGTATGCCCCTCAGGTCTCGTTCTGGAGAGCGGTGGTCAAGTCAGACCGATGAGAGGGAACAAAACCCTCCCGTCTTTGCGATGGCACGGCGATGTGGTCCATCAGTAACGACTGTCGCGGTCGTAGATGCTGTGCGGAGCCAATTTCTCCACCTCTACAGCATCGCTGCAGTCGATAGTCAACGGCGGCTGGGGGCCTGCGTGCTCACCTGCCACCGACGGGACCGAAGATTGCGTCACCATGGGTCGGGTTACCGACTCCTCTGGTGGGGATCTCGAAAGTCGAGGCTCCTCCTGAGAACGGTCGTTGCGATCAGGACTGCCCCATCATCAACTGAAGGATGGCCCTAAGGTTACCTAGGTCACGTAGGCACGGATTTCCCCTGGCTTTTTACGGATGGAGGTTTGTACCGCCTCGACTCGGACACCAGAGCCTCTGCTTAGGCACCAGCACGGTGAGAGGATGATATTTGGTCACAATCCGCGACCTTTATTCTGCCTTTCTTAAAGACTTGTGCGCTCAGTTACCAGAATCAAAATTAAATTAAATTAAATTTCAGCGGCTTAATTTTAAATTTAATTTTGATTTCACGCCCTACTGTCGCAACACAACATGATCACACGGTTGATCTGGCAGCATACTCCCTCTCGATCCTTGCTGCGCTATCGGCTGTTTATCCGCTGCAACAATCCCTTAGAGATAATAAAATTACCTATTTACATGAAACAGGCGCACAATTAGCTTCAGCGTGATTGCAGCGCAAACTATCAGCGCGACTCCACCGTGTGATTTTGCCAGTTTGCGCACACCGGCCGACACAACCTATGGTTTCGAGTATTTCGCGCCGCTGAACCACGTCCGTCTTCACGGCGATGTAGACTTGGATATTCCCGCACAGGATTGAGTGTCTAAGCCTGTGCGTTCAGGATTAAACTTTGGCAATACGACAGCATTGGAGTTTTGGGTCTTTGTGAGTTTGCACTTCTTTTAACAGTTCAGAAGAAGCGATTCTGCGACTCTGGTGTCAACCATTGTTTTCACTATTGTAGTATGCACACATATCGGTTAAGCACTGTACCTATGTGTGATATAATTGCTTAACTCTGTTGCAATGTGTATAAACAGTCCGGCTGATGTAGCGTAATACGAGCACCCACTTGAGGGCTAACATACATAATTGCCTGGTCAGCAGTTCTCCCGCTGGCCAAGCGCTGATCGCTTATATGTGTGCCTATACCACTCCTCCTCCAGCGCCATCGCTCGGCGACGAGTACATATATATATACATATATATAGATACGCATATAAGCGTTGCTGCGCGCAGGCTATACCGGCAACGCTGCTCCTCGACAGGCTAAGAAACCTTTGTATGTAGATCGCCAGAGGATTGACGGGTGTTCGAATGGAGCGGGACCTTCCCTGTTCCTCAAATTGGATCAAATAAAGAACAGCTAAAACACAAATGATCTATGACACAATGAAACTACAGGAGTTGGAGTAGGCGGTCCCACTTCTGATGTCGGATCTGAATCACTTTATACTCTGGCATCCTCTCTACAGCGGACACAAAGTAACAGAAAACGGTCGTTAACTTGAAATTAAAAATAAATCTGCGACAAGTACAGTTTGTCAAGAAACTGTTTACACACCGTGAAATAAGATGAATTTTTGGTTTAGCGGTCAAATTAAGGGTTATTTTGGCAATTAAACGCAATTTTTTTTTAGAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAAACAAATTCAAAATATCAAATATACAAGAAAATAAACTTTCGGCATTTAGGATTTAAACACTTTTGAGTTTCAAAGAACTCTTTACACAAAACACTAAACCCTAGTTTAATCCTAAATTTTTTAAATTATTTTGTTAAAATTTGAAAGTTGTGAGTATTTAGGTATGACCCCATTGGCTTTGGCTACAAGTTAGGCTTTTTTTTTCGATGGATGAGTTTTAGGTCATATTCAAGCGGGATCTTTCCCACTCTATCGCAGCCATGAGCTGTTGTCGTGTTTGAATTGCTTTTGCCACATTCTTCTTAAGTAGGCCCACAAATTTTCAATGGGGTTCGAATCAAGACTCTGAGGAGACGTATCGATCACCTTGCCACGGTTATAAAGGGAGCCAGTTGCGTACATTGCACTCTTTATGTTTGGGATCGGTGTCCTGAATAAAACTTAAGATTTAACTGTTCATTTTACTAAATAGACCAAATTTTTCTTACTGGCCTTCAAATTTGGTTTTTGCAAATATCTAGATATTGCACGGCATTCATAGTGCTTTCAATAAAAGGCTAATTTGCCCACTCCATGGCTTGAGATACAGCCCCAAATCATCACTGATAATTTTCCAAATTTGATTGTTGGAATGATATTTTGTTTTCTAGCGCACTCAACGGCTTGCGCCATACTCTGCTTGGCCCATCGTTGTAATGAGCATCATTTTGTTTCGTCACAAAATACGTCATCCCAGTGCTCTTCCGCATGATCAATGCTCACAGCGAATGAATGACGCTTTTCTATTGACCTCTGATAGCAAGGCTTTTTTTCTTGCAACTCTTGAAAGAGTACCTATGGCGTGAATGACCAGCGCACAGTTTTGTGTGTGGCACAACTAGGTCGATGCTTGCCTGATATCCTGAGCAAATTGATCTGACCGAGATTCGGGGGGTTCGCAATCACTTTTCGCATAATAAAGGCGGTCTACACGCTTGCTAATTTTAGTTTATACTCTAGGTTCAAGCCTGTTCTCTTTTTTCAAGCGATTAAAAACATTGTAGACGGTCTTACGGGATACAGAAAACATTTATCTAATTCTGGAATAGATTTTCCCAACTGGTGGTTTTTAGTATATTATTTGGGTCACTTCAAAGCTAATCTATTTCCATTTTATTAAATTTAATGCTTTCATTCGATCAGCAAAATTTCACAAGCAAAGTAAAAAATTTCAATAGAAGCACGTTGTAAAAGATACAAATGCAAAATAACTAGGAAAAATCGGTTGGTTCCTAAAGAGAAAAAGAGAGCAAAACAAAGTAGGAAAACAAAATGTGTAGGAGTTTCTTGCCACTCTCAAAGTGTGTAAACTTAGATTTGTTGTTTTATTCTTGTATATTTGATATTTTGAATTTGTTTTTAATTTATAAATTAAAATAAATATTGTTTAATTATATTTCATTAAAAATTGCGTTTAATTAAAAATAACCCTTAATTTTGACCTTTAAAGTGAAAAAAATTCCAACTCACGGCGTGTAAATAGTTTCTTGACAAACTGTATATATCTACAAATTTACAACTTGCCGGTACCATCTGCAAGATTCATTACATTGAGAAGTGGTTTGACTCTCAGAATGAATTAAAATATTCTTAGATTAGACGAGGAACCAGACTGAATTAACTAAACTAACTATCATTTAACTAGAAATTTAATTAAGTTTACTGATGAATTTTGAGTTTCTTACAAAAGATGACTAATATTAATTTTTTAGTTAAAATAGTTTGCAAACTGAATTGCTCTTAAATAATATGTTCGAATCTGGTTGGGTTTCTGGGTCTCTAACACCTCACCGCAACGAATGCTGGATCAAAATTATTCGTCAGAAGGACGTGCACAGTCTCGTGGTAATAAAAAGTACAGCAATCTTACTTTTGAGGTGGCGTGTTGGAAGAATATGTACACATTTAAGCAAAAGTCACATGGCCTGCATCAAAGACTAGAATAATAAGATGCGCTTAGCCATACTGGTTGGCACTATGCAGCCACTTTTTTTTGGTGACGGCCAAAATTGCTCTCTTTCCGCTCGCTCACGCTGAGCGTAAGAAATCTAAAAATAGAATTTGCTTGCTTGTGTGAGTAAAAACAAGGAGCGAAACGCGTATATGTGTGCGTGTTGTGCTGAAGGCGATTTTCGGGCGAAATCAATTCTGATCGCATTAACGAATTTACATATGTACATACATGTTGGGGAGTTTTGGCCAATTTCGTAGAAGATATGATGAAATTGCGCGCTGTTTAAGATATCAATTGGAATATAAAAAAAAACTGAAAAAGAAGTCATTACACTGAGAAAAAATATTTCATAAAATAATGCAAGTGAAAATAAAAATTTATAAAATAAAAAAATGTTAACTGTTTATTGCAAACGTCATATCAAATTAGAATTATTCTAGTGTCTTTGCTTTGTATCTTGAGGCGGTGCGGACACAAACACTCAACAATCATTGTCTTCTTAATACTTAAGCAGAGCTGACACCGACGAAGACCTAACTGCTTTGAAATGGCAGAGGTAAAATAAGGAAATCAAAAGAGACCAAGCCCCTCCCGAAGTTCAAAGCAAGTTCCCTGGACAATTCATCGGCACCAGCGCAAATGTTCAGCTCTCTTAAGCGACGGATTGCCCGACAAAACGGGAAACAAATATAACAGAAAACGAGAGATCTCGAAATGGTAGAAGACAGTGCAACTGATTTTGCTAAGCCCCACCTATCTTTCTCTCTGACGTCAATGGGTATAGAATTGAAGCTAACCTATCTTAAAACTAAAATTAAGAGAACTTTTATTATAAGACTCAACGTTATGGACATGTAAGAGTAATGGTTAAAAGTATTGAAGATTCTGAAAATTAGTCAAAACACTTAATAATGATTGTGTGGTACCACACATACCAGCAAGGATGACAGAGCATTTAGAGTTGTTATTAAGAATTTGCATTTTTCCACAAATTTAGATGAAATTAAAAGTGATAAGAGAGTCAAAGGTCATATTGTTAGAAACATAAGTAATATTAAAAGCCGTGCGACCAAGAAACGTCACTGAACATGTTTTATGTAGATATTGAGCCTAACAAAAAAAAACATGTAAATGTAAATAAAATATTGAGCCTCCCCACAATGCGAAATCGTTTCCAAATTACTATAGCTGCCGGGAGTCGGACATACTAAATCATATTGTGCAAAACGTACCACTGTGTAAAATCCTCTTCTCGACACCCAAGCAACATTTTGCCCGAAAAGAGCTGGAACAACCAGCAAAATGTGCCAACTGCTGCGAAGAACACGCCGCCAGCTACAAAGGGTGTAGAATTTATCAGGAACTCTTGTCCAAAAAAATAGAAAATAGAAATAATGATCTGAGGTAAAAATGATTTAGGAATCCTTAATTTTGTTTCCGCCTAACAAGCCAACATATACCCAACAAAGTAACGATTATCAATCTTATGCCCAAATTGCTGCAGGAAGCAAAACAAACACATCACTGGAGATAGAGCAACTATTAGGAAAACAGTCTGAACTTACAAATAATTTACTTAACATGATAATGTTACTTGTAAACAAATTATGCAAGTAAAATCTAACCTTGGAATATGGGAAGCGTGAGTAGGGAGGTGACTTCAATGCTAAGCTTCCGAAGGAAGCGAACTGTACAAATGCATAGTAAACAACAGCATAACAACACTTTCAACCGGCAAGCCTACATACTGGCCTACTGATGGTAGAAAGATACCAAACTTAACCCTTTCGCAACGTTGCTTTAGCAGGCAATTTCTATGTTTTCAGAGCTAACTGTAAGTGTGCCTTTTGGTTTTATCTGCACGATTTCTTTATGATAACGGTTTTATGTGTCTACTCTAAATATAAAAAAGCAAAAAAAACGCATTTGAGTTAATTGCAGGAATTATTTGCAATAAATAGCACGCGCATCACAATAATTATTGTTTCGATATTCAGTTACGAACTTTTTTGGAATTATTAATTTACTTTTATAATGCTTTAAAAAGACAAAATTATAAACAGCAAAAGAGTTAACAAGACAGTGATTTAGTCAAACTGGTAAGAAGTGAGTGAACAATAAGTAGAGTAAATAATTTTTTTTTTCTAAGTTCTTGTGAACAGCCTTGAATTCAATAATTTTCTGAAAGGTTTGTCTAACGAAGAGAATTGAACAGGATTTAAACTTCAGTTGGGATATTTCTACTGACGAAGAAAGTGGTGAGGAGATGAAGACATTCTACGGTACTGGAGAAAATTTAGAAGGAATTCTTGAAGGGAGAAAGTATCGACAGTGACCTTCTGGAAAATACAGTGATTGAAGGATGTGAACCTGACTCTTGCGTTGTTGACAGTTTAGCTAGAAAATTGATCCAAAGAATGGAAACAAGGCCGTTTGTAGCTCAAGTATTTGGGAAGATGACAAAACTTTTGATGTCGGGGACATAGACGACCGTGGAGTTCTTCTACACACTTTGATACTCAGCTAATTCATTTAATAGCTAGAGCAGAAACTGATATACAGTCATGGTCAAAATTATTTTCACAAAGTGCATTTTTGTGCATGGGTCTAAACAGTTGCTTGTGCAGCAAAAGTGGGGGAGGTGAAATGCAAAAAAAAACTTTTGCTTTTGCAAATTCAAACCTATGCAGAGTCAGATGAAAGAAGAATTGAAAAATAACTTTGTTCCTATGCGCAAGGAAGGGCAAATGAAGAGATGCTTTATCAGTTGTCAAGTATTTGCACACGGTTTCGTCGCATCACAATTATTTTTTCACAACGCAATTTCTTCTTCATTGGTTTTAGAGTGACAAGTGCCGGTTTGTTTTGCTTAAATACATTTAAATTATTGAATAAAAAGTGGAACAATCATTTTCCTATTACAGTTATTAAATAAAATGCACCCAAAACAAAAAAGTTAACGGTTGAGGCCCGGGCTGGTATTGTTGCTAGGTTTTAAGCCGAGGTACACCTGCGACCAAAATAGCTGAAATATATCAAATTTCGCGTAGAACTGTCTACTACTTAATAAAAAGTTTGATACAGTTGGCACATTAAAAATAAAAAAGATCAGGCCGAAAACCTGTGCTGGACCAAAGGCAATGCAGGCAAATGCTTGGGTTGTGGCGAAAGAATCCTAGTGCCAGTCCGGTAAAAGTGCCTTAGAATCAAAAATACAGATTGTAAACAAGTTAGTAGTTCTACAATTCGTCGCAGGCTAAAAAAGCTGATTTTAAGACATACTGTTCCTGCAAAACGGTGAAGTCCACGCAGCCAACAAAACCGTCTTCGATTTGCGTTGGGTGCCAATACGTAACA
->330e4a7a-08b8-4346-ae87-7a114a128c7a
-TACCGGTATTACTTCGTTCAGTTGCGTTGCTATATTCCAACGCAAATCGAGGGAGCGTTTTGTTGTTTTGTTGGTTGGTGTGATCTCAATCGTTTTGCGAACAAAGTATGTCTTAAAATCCAGCTTCTTTTAGCCGCCGATGGTGTAGGGCTTCACTAACTTGTTTGCCAATTGTATTTTTTTTGATTCTAAGGCAATTTTTTTTTTACCGGACTGGCACTAGGATTCTTCGCCACAACTCTGGAAATTTGCCTGCATTGCCTTTGGTCAGCGCTGGAGTTTTCGGCCTGATCTTTTTTTTATTTTTTAATGTGCCAATATCAAACTTTTTTTTTATTAAGTAGTAGACAGTTCTACGCCTTGAAATTTGATATATTTCAGCTATTTTGGCCGCAGGTGTACCGGCTTAAACCTAGCAACAATACCAGCCCGGGCCTCAACTGTTAACTCTTTTTGTTTTGGGCATTTTATTTAATAACTGTAATAGGAAAATGGTCAAATATTCACATTTAAATAATTTAAATGTATTTAAGCAAACAAACCGGCACTTGTCACTCTAAACCAATCACTGGAAGAAGAAATTGCGTTGTGAAAATAATTGTGATGCGACGAAACCGTGTGCAAATACTTCTGACAACTGATAAAGATCTCTTCATTTGCCTCTTCCTTGCGCATAGGAACGGTTATTTTTTCAATTCTTCTTTTCATCTGACTCTGCATAGGTTTTGAATTTGCAAAGCAAAAGTTTTTTGCATTTCACCTCCACTTGCTGCACAAGCAACTGTTTGTGACCCATGCACAAATGCACTTTGTGAAAATAATTTTGACCATGACTGTATATCAGTTTGCCTAGCCATTAAATGAATTAGCTGAGTATCAAAAAAAGTGTGTAGAAGAACTCCACGGTCGTCTTTATGTCCCCCGACATCAAAAGTTTTGTCATCTTCCCAAATACTCTCTGGAGCTACAAACGGCCTTGTTCTCCACCTTTAGCCTCTTTGGATCAAATTTTCTCTAAGCAACTGTCAACAACAACACAAAGAGTCAGGTTCATATTCAAATGTATTTCCAGAAGGTCCAATGTCGATACTTTCTCCCCTTTCAAGATTCGCCTAAATTCTTCTCCAGTACCATGAAGTATACTTTCATCTCCTCACCACTTTCTTCGTCGGTAGAAATATCCCAGAAATCGAAGTTTAAATCCCGTTCAGGCTTTCTTCGTTAGACAAGCCTTCACTTTCGGTGGCATTATTTATCACGAATACCCAAGGTTGCTCACAAGCAACCCAGAAAATTATTACTTACTTATTGTTCACTACTTACTAAGTTTGACTAAATCACTGTCTTGTTAACTCTTTGCTGTTTATACTTTGGGTTCTTTTTTAGGCCTATAAAGTAAATGTAATTCCAAAAGTTGCACCGAATATCGAAGCAATAATTATTGTGATGCGCGTGCTATTTATTGCAAATAATTCCTGCAATTAATCTCCAAATGCGTTTTTGCTTTTTTATATTTAAATTAGACACATAAAAGCACCACCGTTATCATAAAGAATCAGCAGATAAAACAAAGGCACACTTACAGTTAGCTCGAAAACATAGAAATTGCTCACAAACAACGTTGGGTGCGAAAGAAAGGGTTAAGTTGGTACATCTTCTACTATCAGTAGGCCAGTATGTAGAGCTTGCCGGTTGAAAGTGTTGTTATGCTGTTGTTTACTATGCATTTTGTACAGTTCGCTTCCAACCTTGGAAGCTTAGCATTAGTCACCTCTACTACGCTTCCATATTCCAAGGTTAGGATTTACTTGCATAATTTGTTTACAATTAACATTATCATGTTAAGTAAATTATTTGTAAGTTCAGACTGTTTTTTCTAATAGTTGCTCCTATTCTCTCCAGTGATGTGTTTGTTTTTCCTTCCTTCCTGCAGCAATTTGGGCATAAAGATTGATAATCGTTACTTTGTTGGGTATATGTTGGCTTGTTAAGGCGGAACAAAAGAAGAGCTTTGCTGGATTCTAAATCCCTCATTTTTTTTTTTTTACTCAGATGTTATTTCTATTTTCTATTTTTTTTTGGACAAAGAGTTCCTGATAAATTCTACACCCTTTGTAGCTGGCGGCGTGTTCTTCGTAGCAGTTGGCACATTTTGCTGGTTGTTTACCTGTATTTTTCGGGCAAATGTTGCTTAAGGTGTCGAAGAAGTTTTACAGCGGTACGTTTTGGTACAATATGATTTAGTATGTCCGAATTCCTGGCAGCTACGCATTGAACGATTTCATTGGGGGCTCAATATTTTTTTATTTACATTATATATATGTCTAGGTTTTTTTTTTTGTTAGGCTCAATATCTACATAAACATGTTCAGTGACGTTTTGGTCGCACGGCTTTTATGTTTCTAACAACATGACCTTTTGACTCTTCATCACTTTTAATTTCATCTAAATTTGTGGAAAAATGCAAATTCTTAATATAACAACTCTAAATGCTCTGTCATCCTTAAGCTGAGTATGTGTGGTACTGCACACAATCATTATTAAGTGTTTTGACTAATTTTCAGAATTCTTCAATACTTTTAACCATTACTCTTACATGTCCATAACGTTGGAGTCTTATAATAAAAAAGTTCTCTTAATTTTAGTTTTAAGATGGTTAGCTTTTCACTTATACCATTGACGTCAGAGAAAGATAGGTGGGGGGGCTCCAGCAGCAAAATCAGTTGCACTGTCTTCATTTACCATTTGAGATCTTCGTTTTTTTGTTATATTTGTTTCCTGTTTTGTCGGGCAATCCGTCGCTTAAGAGAGCGAAATTATTTGCGCTGGTGCTTGATGAATTGTCAGAATCTGTTTTCTTTGTGAACTTCAGGAGGGGCTTGGTCTCTTTTTGGATTTTATTTTACTCTCTGCCATTTCAAAGCAGTTAGGTCTTACCGTCGGTGTCGCTCTGCTTGAGTATTAAAGAAGACAATGATTGTTGAGTGCTTGTGTCCGCACTTCGTGCCTCAAGATATGACCAAGCAAAGAGACACTAGAATAATTCCCACAATTTGATATGACGTTTGCAATAAACAGTTAACATTTTTTTATTTTATAAATTTTTACTTTTTTCTACTTCGTATTATTTTTTATGAAATATTTTTTCTCAGTGTAATGACTTCTTTTTCAGTTTTTTTTTTATATTCCAATTTGATATCTTAAACAGCGCGCACCAATTTCATCATATTCTACAGGGAATTGGCCGGAAACTCTAAATATGTATGTACATATGTAAATTCGTTACTGCGATCAGGTGGTTTAGGCCCGAAAATCGCCTTCTGGCACAACACGCACACATATACGCGTTCTCGTCTTTTTGTTTTACTCACACAAGCAAGCAAGTTATTTTTGATTTCTTACGCTCAGCGTGAGCGAGCGGAAGAGAGCAATTTTGGCCGTCACCAAAGAAGTGGCTGCATAGTGCCAAACCGGTGTATGGCTGTTACGCATCTTATTATTCTAGTGTCTTTGATGCAGGCCATGTGACTTTGCTTAAATGTGTACATACTCAACACGCCACCTCAAAGTAAGATTGCTGTACTTTTATTACTCCACGAGAGACTGTGCACGTCCTTCTGACGAATAATTTTGATCAGCATTCGTTTGCGAGGTGTTGGGGAGACCCAGAAAACCAACCAGATCAATTGAACATATTATTTACATAAATTCAGTTTTGCAAACTATTTTAACTAAAAAATTAATATTAGTCATCTTTGTAAGAAACTCAAAATTATCAGTAAACTTAATTAAATTTAGTTAAATGATAGTTAGTTTAGTTAGTTCAGTCTGGTTCCTCGATAGTTCAAATCTAGAATATAATGTTTTAATTCATTCTGAGAGTCAAAGTCCACTTCTCAATGTAATGAATCTTTGCAGATGGTACCGGCAAGTTGTAAATTTGTAGATATATACAGTTTGTCAAGAAACTATTTACACGCCGTGAAATAAGTTGAATTTTTTCACTTTAAAGGTCAAAATTAAGGGTTATTTCTTTAATTAAACGCAATTTTTTTAAATGAAATATAATTAAGCAATATTTATTTTACTTATAAATTAAAAACAAATTCAAAATATCAAATATACAAAGAGAATTAAACAACAAATTCCAAGTTTACACTTTTTGAAGGTGGCAGAAACTCCTTACACACATTTGTTTCCTACTTTGTTTTGCTCTTTTTTCTTAGAACGAACTCGATTTTTCCGTTATTTTGGCATTTGCATTCAGCACACAACGCTTCTATTGAAATTTTTTTGCACTTTGCTTGTGAAATTTTGCTGATCGAATGAGTTATTAAATTTAATAAAATGCCTGGGAAATAGATTAGCTTTTGAAGTGACCCAAATAATATACTAAAACCACCAGTTGGGAAAATCTATTCAAATTAGTATAAATGTTTTCTGTATCCGTAAGACCGTCTACAATGTTTTTAATCGCTTGAAAAAGAGAACAGGCTTGAACCTACAAGAGTGGTGGGCGCAAAACTAAAATTAGCAAGCGTGTAGACCGCCTTATTATGCGAAAGTGATTGCGAACCCCGAATCTCGGTCAGATCACTTGCTCAGGATGTATCAGGCAAAGAATGTGACCTAGTTGTGCCTTTTACAAAACTGTGCGCCAAGTCATTTCTACGCCATAGGGGTACTCTTCAAGAGTTGCAAGAAAAAAAGCCTTTGCTATCAGAGGTCAATATAGAAAAGCGTCATTCATTCGCTGTGAGCATGATGGATCATGCGGAAGAGTACTGGGATGACGTAATATTTTTCAATGACGAAACAAAAATGATGCTCTATTATAACGATGGGCCAAGCAGAGTATGGCGCAAGCTGTTGAGTGCGCTAGAAAAACAAAGAATATCATTCAACAATCAAATTTGGAAAATTATCAGTGATGATTTGGGGCTGTATCTCAAGCCATGGGTAGGCAAATTAGCCTTTATTGAAGCACTATGAATGCCGTGCAATATCTAGATATTTTAGAAATCAAATTTGAGAGGCCAGTGCAGAAAAATTTTAGATACATTGCGCAACAACAAGCCAAATTTTAAGTTTTATCGGGACAGTAGTCCCAAACATAAAGAGTGCAATGTACGCAACTGGCTCCTTTATAACTGTGGCAAGGTAGTCGATACGCCCCTCAGAGTCAGACCCCATTGAAAATTTGTGGGCCTGCCAAAGAATGTGGCAAAGGGGCGCAAAACGACAACAGCTCATGGCTGCGATAGAGTGGGAAAGATCCCGCTTGAGACCATGACCTAAAAAAACTCATCCATTCCATGAAAAAAAACTTCCAACTTGTAGCGGCAATGCGGTCATACTAGAAGCTTGCCTGAAAGCGGGTTTTGGCAAAATAATTTAAAAAATTTAGAGTTAAACTTAGGTTTAGTGTTTTGTGTAAGAGTTTCTTGGAAACTCTCAAAGTGTTTAAACTTGAATTCGTTGTTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTAATTTATAAGTAAAATAAATATTGTTTAGTATATTTCCTAAAAAAATTGCGTTTAATTAACTAAAAGCCAACTTGCCTTAATTTTTGACCGTTAAAATCAAAATTCATCTTATTTCACGGTGTGTAAAACAGTTTCTTGACAAACTGTACTTGTCGCAGATTTATTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTAGAGAGTGATACCGAGTATAAAGTGATTCAGATCCGACATCAAGTGGACACTTCTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTTATTGTTTTAGCTGTTCTTTATTTGATCCAATTTGAGGAACAGGGAAGGTCCCCGCTCCATTCGAAATTAATTCGTCAATCTTATGATCTACATACAAAGGTTTTCTTAGCCTAAGTCGAGAACGCGCTGCCGGCGCAACCTGCAGCGCAGCAACGCTATATGCGTATCTTATATATGTATATATATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAGTGGTATAGGCACACATATAAGCGATCAACTGGCCAGCGGGAGGAACTGCTGACCAGGCAATTATGTGGCAATGTTACGGCCTCAAGTGGGTGCTCGTATTGCGTATACACTTTGTGCTGGATTTTGTTATGTACACATTGCAACAGGTGCTACAATTATGAATACCCACATAGGTACAGTGCTTAACCGATATGTGTGCATACTACAATGGTGAAAACAATTTGCTGACAATATTCTAAGATACTTAGAATCGCCATTTTTCTGAACTGTTAAAAGGGTGCAAAACTCTAGGGGCCAAAAAACTCAATGCTGTCATTATTGCCAAAGTTTAATCCTGAACGCACGGGCAGACACTCAATCTAGTGCGGAGACCAAGTCTACATCGCCGTGAGACGGACGTCTTAAATTACATGGCGCGAAATACTCTCGAAACCATACCGGGATTTATGTGTCGGCCCGGTGTGACACGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCATAGTTCTGCGCTGCAATCACGCGAGTTAATTGTGCGCTGTTTCATGTAAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAACGGCTGATAACGCAGCGAGGCGATCTGGAGAGGGAGGCGTTGCCAGATCAACCGTGTGATCAGTGTTGTGTTGCGACAGTAGAGACGCGAAATTCAAAATTAAATTTAAAAATTAAGCCGTTGAAATTTAATTTAATTTAATTCCTGGTAACTGGGAGCGCACAAGTCTTTAAGAAGAGAAAAGGCACAAGGTCGCGGACAGACCAAATATCATCCTCTCACCGTGCTGGTGCCTAAGCAGAGGCTCTGGTGTCGAGTCGAGCGGTACAAACCTCCATCCGTAAAGCGGGGGAAATCCGTGACACCGTGACCCTAGGTAACCTTAGGCCATCCTTCAGTTGATGGACAGCGCGGTGGGGGCAGTCCCTGATCGCAACGACCCGTTCAGGAGGAGCTCCCGACTTTCGAGATCCCCACCAGAGGTCGGTAACCCGACCCATGGTGACGGAATCTCAGTCCCGTCAGTGGCAAGGGGTGAGCACGCAGGCCCCAGCCGCCGTTGATTTATCGACTGCAGCGATGCTGTAGAATTGAAAGTGGCTCCACAGCATCTACGACCGCGACAAGTCAGACGATGGACCCATCGCCGTGCCATCGCAAAGACGGGAGGGGAAGTCCCCAGCATTTCCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCAGAACGGACGGGGGCATGCTACCAGGATGAATGGCAAGATCCGAAGCCCCTTCTATCCCATTCGAGACCCAACGACACACATGAGAGACAAAGGGCATAGCTTCCGGAACTCTCAGCCCATAACAGCAGGGCGATAGAGCTGTACGAAGATTACATACTGCTTGAGCTGCTTGAAACAGCGCTACCAGACGGAGGTACAAAAGCCTACCAAAAGGCTCCACAAAGATGCGCGGGTACCCACGGTGCGGGTTACTTCGAGTCCAGGCGCCGAAGCAGAGCAACCCTACGTTGGATGGCAACGGTGAAGGCGACATCCATACCTAGCGAGTCAAGCCAGGCAGCTGTCATCTGTCGCCAAGAATGCTGCTTACGGGTGCAGAGGCACTCATCGTAAAAAAAGACGGGAGGCTTCGTACGCAGAGATGCTTCGGGCTAAGATCGGAATCGAGCCTTAGCGAACTGGGCAGTCGATGCGAAAAAATCCGGAGAACGCAGAAAGGTGATCTGTTGCTTGGTGGGGAAAGCTTCGAGCGTTCCCAAGTTTAAACGACCTGGAGCGGCGCTCGTGACTTCAACCTCTGTGCGCACGGGCGCAAAGAATAGCTCTATCTTGCAGCGGATTGGACGAGGCTACGACGGCAAGAAGCTCCACAGCCATTCGCCCAATTCCAGAGCCTGCAGATAAATCCGCAAGAAGATATCAGGGGCCCTTCGCAGTATGCGGAGTGCAAACAAATAACCTCAGTGCTGCTGAACGCGAACGTTACGATACCAGTCCTTAAACGGGGCACCATAATCGTTGGATGGTCAAGATGTCGTATCACCCAGGACGTCCGACCCACGAGATGCTACAGGTGTCTCGGCTATGACATCGATCAGCAACCTGCAGGAGGACACTGACAGGGCAGACTGCTGTCTTAGATGCGGTGAAGCGTGAGCACAAGGCAAAGGGGTGCGTTGCTGCACCAAAATGCCTGATCTGCAGCAGCGAGGTGGACGAAACCACCCGACGGGTAGCTTTGCGTGCCCGACTTACAGAAACGACACTAAAAGATGCCAGAGCCACCTTAATGCGCTTCATATTAGCGTGGTACAGCTCAATGTCAATCATTGCGCAGCAGCTCCAGAGCCTCCTGGCCCAGACTGCGGTTGAGCCTGTCTTAGACATCATGCTCCTAAGCAGACCCTACGTCTCTGGTAGTGGACAATCGTCCATGATCGCTGACGAGGCAGGTAAAGCAGCTATCAAATGCTGCAGCTCTCTCAAATTAGAACTGGCTGCTTTACCCATGCGGGGTATCGCTTATGCGAGAAGTTAAAACACGTGCACATGTACAGCTGCTACGCTCCGCCGAGCGGCACCCGATCAGTTCGAGGAGCTTCTGGAAGGCGCTCGTGGACCATGCGAGGGCGAAGCCCGAAAGGTCATTACCGGCGACTTTTAATGCCTGAACAGTGGAATGGGGCAGCAGGACATCCAACACCAGAGGACGAGCTGTGATTGACGCCATGCGAGATACTGGACCTCATACTGCTGAACGATGGACGGGAAGCCGACGTTTAGCAACGATAGGGGTACGTCCTTTATTGACTGGTCGCTTTGTCGGCAGGGCTAGTAGACAACAACAGCTGGATGGTCGCCGCGGCGTCACGCGGCGCTGGTGACCATGCCCTGATCTCCTTCTCCCCGGAGGGCATGCCCAGACGCTGAAGTAGAACAGCCGGGAAAACATGGGACACCAGGAAGATCGATGAGGCCATGCTGGCCTATCAGATCAATTCCTGGAAATCCCAAATGTGGACGCAGAGAGTGGCAGCGAGGCCTCATGAATATGCTGGGGAAGAATCTGCGACGCAATCACTTAGCAATACGTAATA
->816d5f49-1ea2-4788-9dd3-a8cf1e9ae020
-TTGTTGCTTCAGGATTTCCAGTTACGTATTGCTCTTGGTACAGTCAGTGAGTTAGTAATTTAATAAAATGCCTGGAAATAGATTGGCTTTTGGTGACCCAAATATACTAAAACCACCAGTTGGGAAAATCTATTTCCAAGAATTAGTATAAATGTTTCTGTATCCCGTAAGACCGTCTACAATGTTTTTAATCGCTTGAAAAAAAGAGAACAGGCTTGAACCTAAGAGTGGTGAACAAAACTAAAATTAGCAAGCGTGTAGGTACTTATTTAACCGAAAAGTGATTGCAGCGAACCCCCAGATCTCAGTCAGATCCACTTATCAGGATATCGAGCAGAATGTGACCCTAGTTATTGCCACGCACCAAACTGTGCGTAAGTCGTTACGCCATAGGTACTCTTCAAGAGTTGCGAAAAAGCCTTTGCTATCAGAGATTCAATATGAAAATCATTCATTCCTGTGAGCATGATGGATCATGCGGAAGAGTACTGGGATGACGTAATATTTTAATGACAAAGAAATGATGCTCTATTAACGATGGGCCAAGCAGTATGGCGCAAGCTGTTGAGTGCGCTAGAAAAACAAAAATATCGATTCAACAATCAAAATTTGGAAAATTATCGAGTGATGATTTGGGGCTGTAATGTCGTATGGAATTGGGCAAATTAGCCTTTATTGAAAGCACTATGAATGCCGTGCAATATCCTAGATATTTTAAAATCAAATTTGAAGAATGGTGTAAAGAAAAAATTTGGTCTGTTGCAGCAACAGCCAAATTTTAAGTTTTATCAGGACAATGATCCCAAACATAAAAGAGTGCAATGTACGCAACTGAAACCTTTATAACTGTGGCAAGGTGATCGATACGCGCCCTCAGAGTCTTGATCACGAGACCCATTTGAAAATTTATTGGGCCTACTTAAAGAAGAATGTGGCAAAAGGGCGCAAAACACGACAACAGCTCATGGCTGCGATAGAGTGGGAAAAGATCGCTTGAATATGACCTAAAAAACTCATCCATTCCATGAAAAAAAGCTTCAACTTGTAGCCAAAGCCAATGGGGGTCATACTAAATGCTGGCACCAAATTTTAACAAAATAATTTAAAAATTTAAGTTAAACTTAGGTTTAGTGTTTTGTGTAAAGAGTTTCTTGCAAAACTCTCAAAAAGTGTTTAAACTTGGAATTCAGTTGTTTATTTTCTTGTATATTTATTGTTTGAATTTGTTTTTTTAATTTATAGAAGTAAAATAAATATTGTTTAATTATATTTCCACAAAAAAAAAAATTGCGTTTAATTAAGCAAATAACCCTTAATTTTGACCGTTAAAATCAAAATTCATCTTATTTCACGGTGTGTAAACAGTTTTTCTTGACAAACTGGCCTTGTCGCAGATTTATTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTGTCCGCTGTGAGAGAGTGATGCCGAGTATAAAAGTGATTCAGATCCGACATCAAGAAGTGGGACCGCCTACTCCAACTTCCTGTAGAACACCATTGTGTATAGATCATTTGTGTTTTAGCTGTTCTTTATTTGATCAATTTGAGAACAGGGGAAGGTCCGCTCCATTCGAAATTAATTCATTAAATCCTCTTATGATCTACATACAAAGGTTTCTTAGCCTAAGTCGAGGAGCAGCGCTTTGCAAGCGCCTGCAACGCAGCAACGCTGCTATGCGTATCTTATATATATGTATATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAAGTGGTATAAGGCACACATAAAGCGATCAGCCTTGGCCAGCAGGAGAACTGCTGACCAGGCAATTATGTATGTTAGCCCTCAAGTGGGTGCTCTCGTACGTATATACACTTGTGCTGGACTGTTTATGTACACATTGCAACAGAGTGCTACAATTATGAATACACATAGGTACAGTGCTTTAACCGATGTATTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTAAGTCGCAGAATCGCCATTTTTCTGAACTGTTAAAAGAAGTTGCAAAACTCACAAAGAGACCCAAAAAACTCAATGCTGTCATTGCCAAAGTTTAATCCTGAACTGCCTGAGCTTAGACCTCAATCCTGGTGCGGAGACCAAGTCTACATCGCCGTGAAGACGGACGTCTTGATTACATGACGCGAAATGCCTCGAAACCATAGAAGTTGTGTCGGCCGGTGTGTGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCATAGTTCTGCGCTGCAATCACGCGAGTTAATTGTGCGCCTGTTTCATGTAAATAGGTAATTTATTATCTTTGCGATTGTTGCAGCGGATAAACAGCTGATGATAGCGCAGCGAGGCGATCTGGAGAGGGAGGCGTTGCCAGATCAACCGTGTGATCAGTGTTGTGTTGCGACAGTAGGGCGCGAAATTCAAAATTAAATTTAAAATTAAGCCGTTGAAATTTAATTTAATTTAATTTTGATTCTGGTAACTGGGGCGCACAAGTCTTTAAGAAAGGGGAAAAGGCACAAGGTCGCGGACAGACCAAATATCATCCCTCTCACCGTGCTGGTGCCTAAGCAGAGGCTCTGGTGTCGAGTCGAGGAGCGGTACAAACCTCCATCCGTAAAGCCGGGAAATCCGTGGCCTAGAGCCCTAGGTAACCTTAGGCCATCCTTCGAAGTTCGATGGACAGCGGTGGGGGGGCAATTCCCCTGATCGCAACGACCCGTTCGGGAGGAGCTCCCGACTTTTCCGAGATCCCCCCACCAGAGAGTCGGTAACCCGACCCATGGTGACGGAATCTCGGTCCCGTCAGTGGCAAAGGGGTGAGCACGCAGGCCCCAACCGCCGTTGACTATCGACTGCAGCGATGCTGTAGAGGTGGAGAATTGGCTCCTACAGCATCTACGACCGCGACAAGTCAGAAGACGATGGACCACATCGCCGTGCCATCGCAAAAGACGGGAGAAGTCCCAGCTTGTTCCCCTCATCGGTCTTCGGACTTGACCACTGCTTATACTCCAGAACGAGGACCTGAGGGCATACCAGGATGAATGGCGAGATCAGCCCCTTCTATCCGCATTCGAGACCCAACGACACGCATGAGACAAGGGCATAGCTTCCGAACTCTCAGCCCTTAACAACAGGGCGTACAGAGCTGTACGAAGGTTACTACTAGCGAGCACCGCTTGAAGAGCAGCGCTACCAGACGGAGGTACAAAAGCCTGCAAAAGGCTCCACAAAATGCGCAGGTACCCACGGTGCAGGTGCCAAAGTCAGAGCGCCGAAGCAGAGCAACCCCTACGTTGGATAGCGGTGAGAGAAAGGCGACGCATCCATACCCCACCAGCGAGTCCAAGCCAGGCGGCTATGCATCTGTCGCCAAGAATGCTAGCACGGGTGCAGGGGCACTCATCGTAAAAGACGGGAGGCTGCATTGCGCAGAGATGCTTCGGAAGCTAAGATCGGAATCGAGCCTTAGCGAACTGGGCAGTCACGTGCGAAAAAAAAATCCGGAGAGGCAGAAGGTGATCTGTTGCTTGAGGTGGGGAAAGCTTCCGGAAGCGTTCCCAAGAGTTTAAGAGCGACCTGGAAGCGGCTCAATGAGGAAAAACTGACCTCTGTGCGCACAGGGCGCAAAGAATGGCTCATCTTTGCAGCGGATTGGACGAGGCTACGACGGCAGAGAAGCTCCTGGCTGGCGATTCGCCCAATTCCAGGGCCTGCAGATGAAATCCTGAAGATATCAGGGGCCTTCGCGGTATGCGGAATTGCAGAAGCAAGCCGCTCCAGTGCTGCTGAACGCGAACGTTGCGATGCAGTCAGCCAAACAAGGGGCACCATAATCGTTGGATGGTCAAGATCGTATCACCCACAGGACGTCCGACCCACGAGATGCTACAGGTGTCTCGGCTGCCAGGCATCGATCAGCAACCTGCAAAGGACACTGACAGGGCGGGCTGCTGTGTAGATGCGGTGAGCGTGGGCACAAGGCAAGGGGTGCGTTGCTGCACCAAAGATGCCTGATCTGCGGCAGCGGGTGGACCAGAAACCGCCGACGAATTGGCTTTTGCGTGCCCGACTTACAGAGCGACATAAAAGTGCCAGAGCCGCAGCAATGCGCATATTGGCGTGGTACGGCTCAATGTCGAAATCATTTGCGCGGCAGCTCAGGGCTCCTGGCAGACTTTGCGGTTGAGCCGCAATGATTGACGTGTTGTACTACACCAATATGAAGCGTGCGTGGAGCAACATCTTGAATCAGGCTCTTCCACCGTCGGGCAATTTCTGACCACCTCGCTGCTACGAATCGGCGACTTTGACAGCAACCTTGCTGCTATTACGCTCACCGCCTGTCGGAGTTGATCGATATGCTTCAGACACCTGGCAGCGTGGATAATCTGAGTATTATCTTGACCATCAACGTTATATTTTGTTGTTGTTCGCGTTCAGCCCGTATTTGCAGTCACGCCGCTACGAAGACTGATATCTTCCGGATTTATCTGCGAGCCTGGTACCAGGCGACAACTTCCAGCTATTAATACTCTGCGCTTTCGTCAATACTGCAGATAAGCTAACGAAGCGACTTCAAGTGTCGGCACGCTTCAGATAATCAAAGCTTTGGAGACGCTTTCCCTGCAACAATTGCGTTATCGCGTGATGCCAGTAAAGGCTTCGATTCCGATAACCCTTTCCGGTACTGCGTCACAGCCTCTCTATGTTTTGCGATGATGCTCTGCGCCGTCTTGGCGTTAACGGCGACGAATCGCTCTTCGCGCAACTTTGTTCACCGTTGCCGTCAACGTGAAGGCCAGCGCTGCTTTCATCTTCTGCCTGCGCGACCTGAACTTGCTTTTATTGAGTAGCGCTTTGCTCTTCAGCGGTGGCTTTCGTGTCGTACGTATCGCCCTGTTATTGAAGTTATGCCGTATTGATGATGGTGGTCTCGAAATGCTGTTTGATCTGCCATTCATCAGCGCCTCGAGGTCTCGTTCTCGGAAGAACGTGGTCCGAGTCCAGCCGTTAATTTTAACTCCATTGCGATGGCATAAATAATACGTAACGATAAACAGGCTGGCGGGAATCCACCTCTGGCATCGCTGCGATCGGTCGGCGTCTGCCACCGGCAGTTGTTCGATATGGTCGAGTTACCTCGCACCTCTGATGAGGATCGGGGCTGAACAGTCGTTGGGAGAAACGACGCTGTCCATCAACTTTGAGATATTTGGAGTAAACTGCAGTTGGCAGTTTCGACTCCGGTTGCCAGGCCTACTGCTGGAAACACCGGCGCGATGATGATATTTGTTCTGTCGACATGCTGCTTTACTGTATTGCTCAATACCGAATCAGGGGTAGGTGGGGTGGAATTTCGGCGGCTTAATTTGGTACGGTTCGCGCCCACAATGCTGACACAACTGCTGATCACGCGGTTGATCTGGCGCCTCCTGCATATCAGCGCTGCGGCAATCTGAATAATAAATTACCCTGACCCGTGAACGAAGCGCACAATTAACCGTGTTACGGCTATATTTTAACCGATTTAAACGAACTGCGCTTCTGGTTTCATTCGCTGCCGCGTCATCTTCACGGCGATAATTTTGATGCTCACGGGAGTATTAAACTATTAGCGTTCAGATTAAACGACGACTCGTCGGTCTCTTTGTGATTTTGCCTTTCTTTCAACAGTTCGAAAAATGGCGTTCTGCGACTTTCAAATTGTCGGCAGTGACGCCGCCATTGGCTGTCTTTTGTGGGGTCAAGCACTGTACTAATATTGTCGTTAACAATTGTAACTTCTGTTTTGTCAACTGGCTGGCGTACGTCTGGCTGCTGAAGAACGTACATATTTTCGGGTGGTGCTTCGGCAGCGCGATCATTGCTGTGATGATAGCGCATGAACGTTTATTCACCATGGCATGCGTAGCGTATGGATGCGCATATGCCGTTGCTGCGGGCTTTATGCCAAACTACGTAATGGTCATGGAAGATTTGTTCCTCAGAACCGGATCAGGCGGCTAAAACACAAATGATGCTATGACATCAGGCTTTACGGGACGGAGTGGCGATCTGCCTACGATGTCGGATCTGAATCGCTTTATCGACATCGCCGGCAAATGACGTTAACGGAATTAAAGATGGAGTGCGTTATTACGGTTGTCGAAACTGTTTACGTTAACGGTCGAAACAGGGTTGACACAACTGGTCAAACGCGGTGCAGGGAAATATGAACCAGAAGCAATGTTTATTTTATAGTGAAGCAAATTCAAAATCGAATGTACGAAATGAACAGCCAGTTTAAACGCGCTTTTGAGTTTCGAAGCTCTTTGCAAAACGCTAGGCTAAGTTTAATCTGGACACGAATTATTTTGTTAAAATTTGGTCCAACGGTGACCAGTATGACCCCGACCGGCACGAAACGGTTTTCGTGGAATGGTGGTTTTGGGTCGGGATCTTCCCCGCTTTCTGCGACAACCGACGATCTTTTTTGAACCGCGCTGCCACGTTCTTCGCAGTAGGCCTGAAGGCGTGGGGTTCGAACTCTGAGGGGCATTGTCGTTTTTAACCACGGACCATAAGGAGCCGGTTACGACTATGTTTGGGGATCGTGTCTGATAAAGCAAAGGTTGACTGTTGTTGCTAATAGACGGTACACCTTGCGCGGCAATTTGGACACCCGTAACAGATATTGCGCGACAATTGCTCGATAAAGGCAATTTCGACTGACTTCCCCCGTA
->9bba8c0c-d216-4886-a2a9-89d17928afbc
-TTGGTATTGCTTCGTTCCAGTTACGTATTGGCGGGCAGGAACCATAAAGAGATTAAGGTCGTTTAAAAGAATTTTGTTGGTATCCTACCCTTATGGCATGGAGCATTGTCCTGCTGGAAAATCCATTCAGTAGTTGGAAAAGTCTATTTCAGACGTAAAAGCATGGTTGTTTAAGATAGAAGGTATCCGTTCTGATTTAAAGTACCTTCTATCGGTATAAAGTCTCAGATCCATAATAGGGAAGACATCCCAAAACATGACTGTGCCCCACCAAATCTATTGGTTGGCTGGGCTGCCAAGTAACGATTATTTTTTCAAATGCATAAAATGCTTGCTATTATGACCCTGGTACTGAAATGCAGACTCATCAGTCCATAAAATATTAAACCAAAAGTCAGAGGCTTCTTAACATATTCCAACGCAAATCGAAGACGTTTTGTTTTGTTGGTTGATTAATGATCTCAATCGTTTTGCAGACAAGTATGTCTTAAAATCAGCTTCTTTTAGCCTGCGACGAATTGTAGAACTACTAACTTGTTTTGCCAATTGTATTTTTTGATTCTAGGCAATTTTTACCGGACTGGCACTAGGATTCTTCATACAACTCAAGTATTTGCCTGCATTGCCTTTGGTCCAGCACAGGTTTCGGCCTGATCTTTTTTTATTTTTTAATGTGCCCAGCTATTATCAAACTTTTTTTTATTAAGTAGTGAACAGTTCTACGCGAAATTTGATATATTTCAGCTATTTTGGCCGCAGGTGTACCGGCTTTTAAACCTAACAACAATACCAGCCCGGGCCTCAACTGTTAACTCTTTTGTTTTGGGCATTTTATTTAATAACTGTAATAGGAAAATGATTAAATCTGAACATTCAATGAATTTAAATGTATTTAAGCAAACAAACCGGCACTTGTCCTCTAAATAGCCAATCACTGAAGAAATTGCGTTGTGAAAATATGGTGTGATGCGACGAAACCGTGTGCAAATACTTCTGACAACTGATAAAGATCTCTTCATTTGCCTCTTCCTTGCGCATAGAACAGTTATTTTTCAATTCTTCTTTCATCTGACTCTGCATAGGTTTGAATTTTGCAAAGCAAAGTTTTTGCATTTCACCTCCCCACTTGCTGCATGAAAGCAACTGTTTGTGATTATGCACAAAAATGCACTTTGTGAAAATAATTTTGACCATGACTGTATATCAGTTTGCCTAGCCATTAAATGAATTAGCTGAGTATCAAAAGTGTAGAAGAGCTCACGGTCGTCTTTATGTCCCCGACATCAAAGTTTTGTCATCTTCCCAAACTCTCTGGAGCTACAAACGGCCTTGTTCTCCACTTTAACCTCTTTGGATCAATTTTCTCTAAGCAACTGTCAACAACAACGCAAAGGTCAGGTTCATCCTTCAATCACTGTATTTTCAGAGGTCAATGTCGATACTTTCTCCCCTTTCAAAGAATTCCTTCTAAATTCTTCTCCAGTACCATGGAAATGTCTTTCATCTCCTCACCACTTTCTTCGTCAGTAGAAATATCCCAATCGAAGTTTAAATCCCGTTCAATTTCTTCGTTAGGGCAAACCTTTCACTTTCGGTGAAAATTATTATCACGAATGCCCAAGGTTGCTCACAAGCAACTTAGAAAATTATTACTTACTTGTTGTTCACTACTTACTAAGTTTGACTAAATCACTGTCTTGTTGTTAACTCTTTGCTGTTTTATACTTTGGGTTCTTTTAAAAGTATTATAAAAGTAAATTAATAATTCCAAAAGTTGCACCGAATATCAAGAAACAATAATTATTGTGATGCGCGTGCTATTTATTGCAAATAATTCCTGCAATTAATAATCTCCAAATGCGTTTTGCTTTTATATTTAAAGTGAACACGCATAAAAGCACCGTTATCATAAAGAATCAACAGATAAAACAAGACACGCTACGGTTAGCTCTGAAAACATGAAATTGCTCACAAACGTTGGGTGCGAAAGGGTTAAGTTTGGTATCTTTCTGCTATCAGTAGGCCAGTATGTGGAAGCTTGCCGGTTGAAGGGTGTTGTTATGCTTGTTGTTTTACTATGCATTTGTACAGTTCGCTTCCTTCGGAAGCAAGCATTAAGGGAATGCCTCACCTACTACGCTTCCGCCTTCCAAGGTTAGGATTTACTTGCATAATTTGAAGTGGCATTATCATGTTAAGTAGAATTATTTGTAGGTTCAGACTGTTTTCCTAATAGTTGCTCTATTCTCAGTGATGTGTTTGTTTTGCTATTTCCTGCGGCAATTTGGGCATAAGATTGATAATCGTTGCTTTGTTGGGTGTATGTTGTTGTTAGGCCGGAACAAACTTTGCTGGATTCTAAATCATTTTACTCAGATCATTATTTCTATTTTCTGTTTTTTTTTTTTGGACAAAGAGTTCCTGATAAATTCTACACCCTTTAGCAGCTGGCGGCGTGTTCTTCGTAGCAGTTGGCACATTTTGCTGGTTGTTCTTTCTGTATTTTTCGGGCAAATGTTGCTTAAGGTGTCGAGAAGGATTTTACACAACGGTACGTTTGGTACAATATGATTTAGTATGTCCGAATTCCTGGCAACTATAGCATTGAACGATTTCATTGTGGGGAGGCTCAATATTTTATTTACATTATATATGTCTAGGTTTTTTTTTTGTTAGGCTCAATATCTACATAAAACATGTTCAGTGACGTTTTGGTCGCACGGCTTTAATATTACTTATGTTTCTAACAACATGACCTTTTGACTCTTCATCCCTTTGCAAATTTCATCCCCTAAGAATTTATTGGGAAAAAAAAAAATGCAAATTCTTAATAACAACTCTAAATGTCTGTCATCCCCTTAAGCTGGTATGTGTGGTACTGCACACAATCATTATTAAGTGTTTGACTAATTTTCAAATTCTTCAATACTTTTAACCATTACCACATGTCCATAACGTTTGAGTCTTATAATAAAAAAAGTTCTCTCTTAATTTTGGTTTTAAGATAGGTTAACTTTTCACTTATACCATTGACGTCAGAAGAATGGGTTATGGGGGGCTTAGCAAAATCAGTTGCACTGTCTTCATTTACCATTTCGAGATCTTCGTTTTGTTATATTTGTTTCCTGTTTTGTCGGGCAATCCGTCGCTTAAAGAGAGCGAAATTATTTGCGCTGGTGTGATGAATTGTCAGGGAATCCTGTTTTTCTTTGAACTTCGGGAGGGGCTTGGTCTTTTGGATTTATTTTACTCTCTGCCATTTCAAAGCAGTTGGGTCTTCGTCAGTGTCGCTCTGCTTGAGTATTAAGAAGACAATGATTGTTGAGTGCTTGTGTCCGCACTTCGTGCCTCAAGATATGATGAAAGCAAAGACACTAGAATAATAATTCTAATTTGATATGACGTTTGCAATAAACAGTTAACATTTTTTTTATTTTATAAATTTTATTTTTCTACTTCGTATTATTTTTTATGAAATATTTTTTTCTCCAGTGTAATGACTTCTTTTCCAGTTTTTTTACTTAATTTGATATCTTAAACAGCGCGCAATTTCATCATATTCTACGAAATTGGCCAAAACTCCCCACAAATATGTATGTACATATGTAAATTCGTTACTGCGATCAAATTGATTTCGGCCCGAAAATCGCCTTCTAGCAACACACATATACGCGTTCTCGTCTTTTGTTTTACTCACACAAACAAGCAAATTCTATTTTAGATTTCTTACGCTCAGCGTGAGCGAGCGGAAGAAACAATTTTGATCACCAAAAAAATTGGCTGCATAGTGCCAAACTCCAGTGTATGGCTGTTACGCATCTTATTATTCTAGTGTCTTTGATGCAGGCCATGTGACTTTGTAAATGTGTACATACTTTCCCAACACGCCACCTCAAAAGTAAGATTGCTGTACTTTTATTACTCACGAGACTGTGCACGTCCTTCTGACGAATAATTTTTGATCAAAGCATTCGTTGCGAGGTGTTGGGGAGACCCAGAAAACTTAATAGATCAATTGAACATATTATTTATAGAATTCAGTTTGCAAACTATTTTAACTAAAATTAATATTAGTCATCTTTGTATGAAACTCAAAATTATCGAGTAAACTTAATTAAATTTGGTTAAATGATAAGTTAGTTTGGATTAGTTCAGTCTGGTTCCTCGTCAGTTCAATCTAAGAATATAATGTTTTAATTCATTCTAGAGTCAAAGTCCACTTCTCAATGTAATGAATCTTGCAGATGGTACCGGCAAGTTGTAAATTTGTAGATATATACAGTTTGTCAGAAACTATTTACACGCCGTGAAATAGGTTAATTTTTTTCACTTTAAAGGTCAAAATTAAAGGGTTATTTCTTTAATTAAGCTATTTTTAATGAAATATAGTTAAACAATTTATTTTTACTTATAAAATTGAAGCAATTCAAAATATCAAATATACAAGAGAATTAAACAACAAATTCCAAGTTTACACACTTTTGAGAGTGGCAAAGAAACTCCTTACATTTGTTTTCCTACTTTGTTTTATCTTTTTCTTAGAACGAACTCGATTTTCCGTTATTTTTTTGGCATTTGCATTCCTTTTTTTTACAACGCTTCTATTGAAATTTTTTTACTTTGCTTGTGAAATTTGCTTTGATCGAATGAGTTATTAAATTTAATAAAATGCCTGGAAATAGATTAGCTTTTAGTAGGCCCAAATAATATACTAAAACCACCAGTTGGGAAAATCTATTCCAGAATTGGTATAAATGTTTTCTGTATCCCGTAGACCGTCTACAATGTTTTTTTTTAATCAGCAGAAAAAAAAAGAGAACAAGGCTTGAACCTAAGAGTGGTGGGCACAAAACTAAAATTAGCAAGCGTGTAGACCATATTATGCGAAAGTGATTGCGAGAACCCCGAATCTCCGGTCAGATCACTTGCTCGGGATATCAGGCAAGTGTGACTGGTTGTGCCACACAAAACTGTGCGCCAAGTCATTCTACGCCATAGGTACTCTTCAAGAGTTGCAAGAAAAAAAGCCTTTGCTATCAGGGGTCCAGTATGAAAAGCGTCATTCATTCGCTGTGAGCATGATGGATCATGCGGAAGAGTACTGGGATGACGTAATATTTTAATGACGAAACAAAAATGATGCTCTATTATAACGATGGGCCAAAGAAGCAGGTATGGCGCAAGAAGAAGCTGTTGAGTGCGCTAGAAAAAGGAAACAAAATATCATTCCAACAATCAAATTTGGAAAGTGCTCCAGTGATGATTTGGGGCTGTATCTCAAGCCATGGGTGGGCAAATTAGCCTTTATTGAAAGCACTATGAATGCCGTGCAATATCTAGATATTTTAAAATCAAATTTGAAGGCCAGTGCAGAAAAATTTGGTCTATTTAGCAACAACAAGCCAAATTTTAAGTTTTATCAGGACAATGATCCCAAACATAAAGAGTGCAGTAACGCAACTGGCTCCTTTATAACTGTGGCAAGAATTGATCGATACGCCCCCTCAGAGTCTTGATAGAACCCCATTGAAAATTTGTGGGCCTACTTAAAGAGAATGGCAAAAGGGGCACCAAAACACGACAACAGCTCATGGCTGCGATAGAGTGGGAAAAAGATCCCGCTTGAATATATGACTAAAAAAAACTCATCCATTCATGAAAAAAGCTTCAACTTGTAGCCAAGCCAATGGGGTCATACTAAATGCTACAACTTTTCAAATTTTAACAAAATAATTTAAAATTTAGGATTAAACTTAGGTTTAGTGTTTTGTGTAAGAGTTTCTTAGAACTCTCAAAAGTCATTTAAACTTAGATTCGTTGTTTTATTTTTTCTTGTATATTTGATATTTTTGAATTTGTTTTTAATTTATAAGTAAAATAAATATTGTTTAATTATATTTCCTAAAAAAAAATTGCGTTTAATTAAGCAAATAACCCTTAATTTTGACCGTTAAAATCAAAAATTCATCTTATTTCACGGTGTGTAAACGGTTTCTTGACAAACTGTACTTGTCCTGCAGATTTATTTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTCCGCTGTAGAGGTGATGCACCGAGTATAAAGTGATTCAGATCCGACATCCAAGAAGTGGGACCGCCTACTCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTGTGTTTTTAGCTGTTTGCTGTTGATCAATTTGAGGAACAGGGGAAGGTCCCTTTCCATTCGAAATTAATTCGTCAATCCCTCTTATGATCTACATACAAGGTTTCTTAGCCTAAGTCGAGGAGGAGCAGCGCTGCCGGCGCAATACAGCGCAGCAACTTTATATGCGTATCTTATATATATGTATATATATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAGGAGTGGTATAGGCACACATATAAGCGATCAGCGCTTGGCCAGCAGGAGAACTGCTGACCAGGCAATTATGTATGTCCCTCAAGTGGGTGCTCGTATGCAGCTATACACTTGTGCTGGACCCTGTTTATGTACACATTACAGCAGAGTGCTACAATTATGAATACACGCCGGTACAGTGCTTAACCGATATGTGTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTGAGTCGCAGAATCGCCATTTTTTCTGAACTGTTAAAAGTGCAAAACTCACAAAGAGACCCAAACTCAATGCTGTCGTATTGCCAAGTTTAATCCACAGACGCACGAGGCAGACACTCAATCCTGGTGCGGAGACCAAGTCTACATCGCCGTGAAGACGGACGTCTTAAATGCGCGGCGCGAAATGCGCCGAAACCATAGAAGTTGTGTCGGCCGGTTGTGTGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCACCATGGATCTGCGCTGCAATCACGCGAGTTAATTGTGCGCCTGTTTCATGTAAATGGGTAATTTATTATCTTTGCGATTGTTGCAGCGGATAAGCAACTGATATGCAGCGGGCGATCTGGAGGAGGCGTTGCCAGATCAACCGTGTGATCAGTGTTGTGTTGCGACAGTAGGGCGCGAAAATTCAAAATTAAATTTAAAATTAAGCCGTTGAAATTTGTTTAATTTAATTTGATTCTGGTAACTGGGGCACAAGTCTTTAGAGAAAGGCACAAGGTCGCGGACAGACCAAATATATCATCCTCTCACCGTGCTGTGGTGCCTAAGCAGAGGCTCTGGTGTCCGAGTCGAGCGGTACAAACCTCCATCCGTAAAGCCGAAATCCGTGGCCTACGTGACCCTAAGGTAACCTTAGGCCCATCCTTCGGTTGATGGACAGCTGGTGGGGGGCAGTCCCTGATCGCAACGACCCGTTCGGGAGGAGCTCCCGACTTTCGAGATCCCCACCAGAGTCGGTAGCCCGACCCATGGTGACGGAATCTCCGGTCCCGTCGGTAGGGTGTTGGTACGCAGGCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGGGGTGGAAAATTGGCTCCTACAGCATCTACGACGCGACAAGTCAAGGAAGACGATGGACCACATCGCCATTGCCATCGCAAAAGACGGGAAGTCCCCAGCTTGTTCCCCTCATCGGTCTTCGGACTTGACCTGCTCTCAGGAACGAGGGCCACAGGGGCATACTACCAGGATGAATGGCAAAGATCAGCCCGCTCTATCCCGCATTCGAGACCCAACGACACACATGAGAGACAAAGGGCATAACTTCCGAACTCTCAGCCCTTAACAACAGGGCGATAGAGCTGTACGAAGGTACTACTGGCAACACCGCTTGAAGAGCAGCGCTGCAGACGAGTACAAAGCCTGCAAAAGGCTCCACAAAATGCACAGGTACCACGGTACGGGTGCCAAAGTCGACGCCGAAGCAGAGCAACCCTACGTTGGATGGCAACGGTGAGAGAAAGGGCGACATCCATACCTAACGAGTCCAAGCCGAACTATGCATCTGTCGCCAAGAATGCTAGCACGGGTTGCAGGGGGCACTCATCGTAAAAAAAAAAGACAGGAGGCTTCGTACGCAGAGATGCTTCGGAAGCTAAGATCGGAATCGAGCCTTAGCGAACTGGGCAGTCACGTGCGAAAATCCGGAGGGTACTTGAAAGGTGATCTGTTGCTTGGGGTGGGGGAAAGCTGGAAGCGTTCCCAAGTTTAAGAAGCGACCTGGAAGCGGCGCTCGGTAACTGGCCTCTGTGCGCACAGGAGCGCAAGAATAGCTCTATCTTGCAGCGGATTGGACGAGGGCTACTGACAGCAGAGAAGCTCCACAACTGCTTGGTCGCCCAATTCAGAGCCTGCAGATAAATCCTGAAGATATCCAAGGGGCCTTCGCAGTATGCGGAATTACGAAGCAAATAGCCTCAGTGCTGCTGAACGCACCGAACGTTGCGATACCAGTCCTTAAACGGGCACCATAATCGTTGGATGGTCAAGATGTCGTATCACCCAGGACGTCCGACCCACGAGATGCTACAGGTGTCTCGGCTATGGGCATCGATCAGCAACCTGCAAAAGGACACTGACAGGAGCAGACTGCTGTCTTAGATGCGGTGAGCGTGGGCACAAGAGGCAAGGGTGCGATTGCTGCACCAAAATGTCCTGATCTGCAGCAGCGAGGTGGACAGAAAACCACCGACGGGTAGCTTGCGTGCCGACTTACCTGAAACGACGGCA
->40e2cefe-10f8-43e7-b2fe-17a1fc548f0d
-TTGTTGTACTTCGTTCAGTTACGTATTGCTCGGGCACGCAAAGCTACCCGTCGGGTGGTTTTCTGTCCACCTCGCTGCTGCAGATCAGGCATTTTGGTGCAGCAACGCACCCCTTGCCTTATTGCCCACGCTCACCGCATCTAGACAGCAGTCTGCCCTGTCAGTGTCCTTGCAGGTTGCTGATCGATGCCCTTAACCCTGAGACACCTGTAGCTTGCATCCTCGTGGGTCGGACGTCCTGGAGTGATACGACATCTTGACCATCCAACGATTATGGTGCCCTGTTTAAGGACTGGTATCGCAACGTTCGCGTTCAGCAGCACTGAGGCTATTTGCTTGCAATTCCGCATACTGCGAAGGCCCTGATATCTTCAGGTTATCTGCAGGCCCTGGAATTGGGCGACCAGCAGCTGTGGAGCTACTCTGCTGTCGTAGCCTCGTCAATCCCGCTGCAAGATAGAGCTATTCTTTGCTCCTGTGCACACAGAGGCCAAGTCATTGAGCGCCGCTTCCAGGTCGCTCTTAAACTTAGGAACGCTTTCCAGCTTTCCCCTCTACCTCAACAACAGATCACCCTTTCTGCGTTCTCCGGATTTTTCGCACGTGACTGCCCAGTTCGCTAAGGCTCGATTCCGATCTTAGCTTCAGAAGCATCTCTGCGTACAAGCCTCTCTCCTGTCTTTTTTTTACGACAGGTGCCTCTGCACCCGTGCTAACATTCTTGGCGGCAGGCCGCTGCCTGGCGGACTCGTTAGGTATGGATGTCGCCTTTTCTTCACCGTTGCCATCCAACGTGGGTTGCTCTGCTTCGGCGCCTGGACTTTGGCACCTGCACCGTGGGTACCTGCGCATTTGTGGGCCTTTTTTTTTGGTAGGCTTTTGTGCCTCCGTCTGGGTAGCGCTGCTCTTCAAGCGGTGCTCGCTAGTAATTACCTTCGTACAGCTCTATCGCCCTGTTGTTAAGGGCTGGTTGGAAGCTATGCCCTTTGTCTCTCATGTGTGTCGTTGGGTCTCGAATGCGGATAGAAGGGGCTGATCTTGCCATTCATCCTGGTAAGTATGCCTCAGGTCCTCGTTCGCAGAGCAGTGGTCAGAATCCGAACCGATGAGGGGAACAAGCTGGGACTTCCCTCCCGTCTTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCTGACTTGTCGCGGTCGTAGATGCTGTAGGAGCCAATTTCTCCACCTCTACAGCATCGCTGCAGTCGATGATCAACGGCGGCTGGGGGCCTGCGTGCTGCTGCCACCGACGGGACCGAGATTCCCGTCACCATGGGTGGGTTACCGGCTCACTCTGGTGGGGATCTCGAAGAATCAGGAGCTCCTCCTGAACGGGTCGTTGCGATCAGGGGACTGCCCCCCCTGCGCTGTCCATCAACTGAAGGATCGGCCTAAAGGTTACCTAGGTCGTAGGCCACAGTTTAACTTTTACGGATGGAGGTTTATTACCGCCTCGACTCGGACACCAGAGCCTCTGCTTAGGCACCAGCACGGTGAGAGGATGATGTTGGTCTGTCCGCGACCTTTGTGCCTTTTCCCCTTTCTTAAAGACTTGTGCGCTCCGGTTACCAGAATCAAAATTAAAATTAAATTAAATTTCAGCAGCTTAATTTAATTTTGAATTTCTGCTACTGTCTGGCTACAACACTGATCACGGTTTGATACGGCGGCGCATACCTCTCGAGATCGCCCGCTGCGCTATCGGCTGTTTATCCGCTGCAACAATCATAAAGGCCAGTACCTATTTTGCAGAGCAGGCGCACAATTAACTCGCGTGATTGCGGCGCAGAACTATGACGCGACTCCACCGTGTGATTTTGCCGGTTGCCGCACACACCGGCCGACACAACTTCATGGTTTCGAGTATTTCGCGCCGCGTAATTTAAAGACGTCGTCTTCACGGCGATGTAGACTTGGTCTCCGCACACCAGGATTGAGTGTCTAAGCCTGTGCGTTCAGGATTAAACTTTGGCAATACGACAGCATTGGTTTTGGGTCTCTTTGTGAGTTTTGCACTTCTTTAACAGTTCAGAAAAAAAATGGCGATTCTGCGGCTCTAAATTGTCAGCAAATTGTTTTCACTATTGTGATATGCACACATATGGGTTAAGCACTGTACCTATGTGTATTCATAATTGTAGCACTCTGTTTACCCGTGTGTACATAAACAGTCCAGCACAAGTGTATACGTAATACGAGCTTTGTACCCGCCGAGGGCTAACATACATAATTGCCTGGTCAGCAGAGTTCTCCCGCTGGCCCGTATCGTCGCTTATATGTGTGCCTATACCACTCCTCCTCAGCACCATCTCGGCGACGGCCATATATATATACATATATATAAGATACGCATATAAGCGTTGCTGCGCTGCAGGCTATGCCAGCAGCCTTTGCTCCTCGGCTTAAGCTAAGAAACCTTTATGTAGATCATAAGGAGGATTGACGAATTAATTTCGAATGGGCGGGACCTTCCTGTTCCTCAAATTGGATCAAATAAAGAACAGCTAAAACACAAATGATCTAGCGAGCTGGTAAAACTACAGGAAGTTGGAGTAGGCGGTCCACTTCTGATGTCGGATCTGAATCACTTTATACTCGGCATCACTCTCACAGCGGACACAAAGTAACAGAAAACGGTCGTTAACTTGAAATTAAAATAAATCTGCGACAAGTACAGTTTGTCAAGAAACTGTTTACACACCGTGAAATAAGATGAATTTTTGATTTTAACGGTCAAAATTAAAGGGTTATTTGCTTAATTAAACGCAATTTTTTTTTTAGGAAATATAATTAAACAATATTTATTTTACTTATAGAATTAAAAAACAAATTCAAAATATCAATATACCGAGAAAATAAACAACGAATTCAAGTTTAAACACTTTTGAGGTTTACGAAACTCTTTACACAAAATACTAAACCTAGTTTAATCCTAAATTTTTAAATTATTTTGTTAAAATTTGAAAAGTTGTGTATTTAATTATGACCCCATTGGCTTTGGCTACAAGTTGAAGCTTTTTTTCATGGAATGGATGAGTTTTTTTAGGTCATATTCAAGCGGGATCTTTCCACTCTATCGCAGCCATGAGCTGTTGTCGTGTTTAGTGCCTTTTGCCACATTCTTCTTTAAGTAGGCCCACAAATTTTCAATGGGGTTCAGATCAAGACTCTGAGGGGGGGGCGTATCGATCACCTTGCCACAGTTATAAAGGCCAGTTGCGTACGGTGCGCTCTCTTTATGTTTGGGATCATTGTCCTGATAAAACTTAAAAAATTTGGCTTGTTGTTGCCTAAATAGGCCGAATTTTAACCTTCAAAATTTGATTTTAAAATATCTAGATATTGCACGGCATTCTAGTGCTTTCAATAAAGGCTAATTTGCCCACTCCATGGCGAGATACAGCCCCAAATCATCACTGATAATTTTCCAAATTTGATTGTTGGAATGATATTTTTGTTTTTCTAAGCGCACTCAACGGCTTGCGCCATACTCTGCTTGGCCCATCGTTACCAGCCGACATCATTTTTGTTTCTCACAAAATATTACGTCATCAGTACTCTTCCGCGTCCGTCATGCTCACAGCGAATGAATGACGCTTTTCTATATTGACCTCTGATAGCAAAGGCTTTTTTTTCTTGCAACTCTTGAAGGGGAGTACCTATGGCGTAGAATGACTTGGCGCACAGTTTTTGTCAGTAGCACAACTAAAGTCACATTCTTGCCTGATATCCTGAGCAAGTGATCTGACCGAGATTCGGGGGGTTCACCAGTACTTTTCGCACTAATAAGGCCAGTCTACACGCTTGCTAATTTAGTTTGCGCCCACCACTCTTAGGTTCAGCCTGTTCTGCTTTTTTCAAGCGATTAAAAACATTGTAGACGGTCTTACGGGATACAGAAAACATTTATACTAATTCTGGAATAGATTTTCCCAACTGGTGGTTTTAGTATATTATTTGGGTCACTTCAAAAGCTAATCTATTTCCAGGCATTTTATTAAATTTAATAACTTTCATTCGATCAACAAAATTTCACAAACAAAGTAAAAAAATTCCAATAGAAGCGTTGTAAAAGATGCAAATGCACCAAAAATAACGGAAAAAAATCGAGGTTCGTTCTAAGAAAGAAACAAAACAAGTAGAAACAAAATGTGTAGGGAGTTTCTTGCCACTCTCAAAAGTGTGTAAACTTGGAATTTGTTGTTTAATTTCTTGTATATTTGATATTTTAAGTTTGTTTTTTAATTTTAGTGAAATAATATTGTTTGATTATATTTCATTAAAAAAATTGCGTTTAATTAAAGAAATAACCCTTAATTTTGACCTTTAAAATTGAAAAAATTCAACTTATTTCACGGCGTGTAAATAGTTTCTTGACAAACTGTATATATCTACAAATTTACAACTTGCCGGTACCATCTGCAAGATTCATTACATTGAGAAGTGGACTTTGACTCTCAGAATGAATTAAAACATTATATTCTTAGATTGAACTGACGAGACAGACTGAACTAACTAAACTAACTATCATTTAGCTAAAATTTAATTAAGTTTACTGATAATTTTGAGTTTCTTACAAAGATGACTAGTATTTTGCAATTTAAAATAGTTTGCAAAACTGAATTTATGTAAATAATATGTTCAATTGATCTGGTTGGGTTTCTGGGTCTCCCCAACACCTCGCAACGAATGCTGGATCAAATTATTCGTCAGAGGACGTGCACAGTCTCGTGAGTAATAAAAGTACAGCAATCTTACTTTTGAGGTGGCGTGTTGGAAAGTATGTGTACACATTTAAGCAAAGTCACATGGCTGCCATCAAAGACACTAGAATAATAAGATGGCTGGTTTGACTTCGCGCGACAGCCAAAATTGCTCTCTTTCCGCTCGCGCTCGCTGTTCAAAATCTAAAGCCCGAAGGTGACGTGGTAAAAACAAAGACGAGAACGCGTATATGTGTGCGTATTTTGTGCTAGAAAGGCGATTTTCGGGCCGAAATCGAATTCTGATCGCAGTAACAATTTACATATGTACATACATATTTGGGGAGTTTGGCCAATTTCGTAGAATATATGATGAAATTGCGCTGTTTTAAAGATATCAAATTGGAATATAAAAAAAGCTGAAAAGAAGTCATTACGCACAAGGAAAAAATATTTCGCAAAAAAATAATGCGAAGTAGAAAATAAAAATTTATAAAATAAAAAAATGTTAACTGTTTTGTGCAAACGTCATATCAAATTAGAATTATTCTAGTGTCTTTGCTTTGGTCATATCTTGAGGCACGAAGTGCGGACCCCACAAGCATATTAATCATTGTCTTCTTAATACTCAAGCAGAGCGACACCGACGAACCTAACTGCTTTGAAATGGCAGAAGTAAAATAAAATCCAAAAAGAGAGACCAAGCCCCACTCCCGAAGTTCAAAACAGGATTCCTGGACATTCATCAAGCACAGCGCAAATGTTTCCAGCTCTCTTAAGCGACGGATTGCCCGACAAACAGGAAACAAATATAACAAAAGCAGAGATCTCGAAGGTAAAATGAAGACAGTGCAGCAATTTTGCTAAGCCCCCACCTATCTTTCTCTGACGTCAATGGTATAAGTGAAAAGCTAACTGTCTTTAAAACTAAAAATTAAGAGAACTTTTTTTTATTATAAGACTCAACGTTATGGACATGTAAGAGTAATGGTTAAAAGTATTGAAGAATTCTGAAAATTAGTCAAAACCTTAATATGATTGTGTGCAGTACCACATACCAGCTAAGGATGACAGAGCATTTAGGTTGTTATTAAATTTGCATTTTCTAAATTTTAGATGAAATTAAAAGTGATGAAAGTCAAAAGGTCTGTGTTGTTAGAAACATAAGTAATATTAAAAGCCGTGGGGCCCAAAGGCGTCACTGAACATGTTTTATGTAGATATTGGGCCTAACAAAAAAACCTAGACATATATAATGTAAAATAAAATATTGAGCCTCCCCACAATGAAATCGTTCAATGCTATGGCTGCGGGAATTCCGGACATACTTGCGTCTGCATTGTACCAAAACGTACCGCTGTGTGGAAATCCTCTTCTCGACACCCAAAAGCAACATTTGCCCGAAAAATACAGAACAACCAACCGTAGCTGCTACGAAAGAACACGCCGCCAGCTACAAAGGGTGTAGAATTTATCAGGAACTCTTGTCCAAAAAATAGAAAATAGAAATAATGATCTGGTAAAAATGATTTGGGAATCCAGCAAAGTTTGTTCCGCCTAACAAGCCAACATATACCCAACAAAGTAACGATTATCAATCTTATGCCCAAATTGCTGCGAAATAGCAACAAACACACATCACTGGAGAGAATAGAGCAACTATTAGGAAAACAGTCTGAACTTACAAATAAATTTACTTAACACTGATAATGTTACTTGTAAACAAATTATGCAAGTAAATCCTAACCTTGGAATATGGAAGCGTAGTAGAATTTGACTTCAGTATATGGCTTCCGAGAGGAAACGAACTGTGCAAATGCATAGTAAACAACAGCATAACAACACTTTCAACCGGCAGAGCACATACTGGCTGCTGATGGTGAAAGATGCCAAACTTAACTGCTCGCGCAACGTTGCTTGTGAGCAATTTCTATGTTTTCCAGAGCTAACTGTAAGTGTGCCTTTTGTTTTATCTGCTGATTCTTTATGATAACGGTGCTTTATGTCTGCTCTAAATATAAAAAGCAAAAAAACGCATTTGGAGATTAATTGCAGGAATTATTTGCAATAAATAGCACGCGCATCACAACCATTGTTGTTTCGATATTCGGTGCAACTTTTGGAATTATTAATTTACTTTTATAATACTTTAAAAGAACACAAGTATAAACAGCAAAGAGTTAACAAGACAGTGATTTAGTCAAACTTAGTAAGTAGTGAACAATAAGTAGAAGTAAATAATTTTCTAAGTTGCTTGTGACAACCTTGGGCATTCATTGATAATAATTTTCCACCACCGAAGAAGTGAAGGTTTGTCTAACGAAAGGAAATTGAACGAGTTTAAACTTCGATTGGGATATTTCTACTGAAAGAGAAGTGGTGAGATGAAGACATTTCTACGGTACTGGAGAGAAGAATTTAGAAGGAATTCTTGAAGGGAGAAAGTATCGACATTGACCTTCTGGAAAATACAGTGATTGAGGATGTGAACCTGACTCTTGCGTTGTTGTTGACAGTTGCTTAGAAATTGATCCAAAAGAGGCTAAAGTGGAGAACAAGGCCGTTTGTAGCTCCAGAAGTATTTGGGAAGATGACAAAACTTTGATGTCGGGGACATAAAGACGACCGTGGAGTTCTTCTACACACTTTTGATACTCAGCTAATTCATTTTAATGGCTGAGCAAACTGATATACAGTCATGGTCAAAATTATTTTTCACAAAGTGCATTTTTTGTGCATGGGTCTAAACAGTTGCTTGTGCAGCAAAGTGGGGGAGGTGAAATGCAAAACTTTTGCGCAAATTCAAAACCTATCACAGAGTCAGATGAAAGAAAGGAATTGAAAAAAACTAACTGTTCCTATGCGCAAGGAAGAAGTGGAAATGAAGAGATCTTTATCAGTTGTCAGAAATATTTGCACGGTTTCGTCGCATCACAATTATTTTCACAACGCAATTTCTGCTATTTCAGTGATTGGTTTAAGAGTGACAGAAGTGCCGGTTTGTTTGCTTAAATACATTTAAATTATTGAATAAAAAGTGGAATTTAATCATTTTCCCTATTACAGTTATTATTAATGAAATGCGCCCAAAACAAAAGGATTAACAGTTGAGGCCCGGGCTGGTATTGTTTGCTAGGTTTAAAGCCGGTACACCAAGCCAAAATAGCTGAAATATATCAAATTTCGCGTGAGGCTATACTACTTAAATAAAAAAAGTTTGTGGTTAACATTAAAAATAAAAAAAGATCGGGCCGAAAACCTGTATTGCTGGACCAAAGGCAATGCAGGCAAATGCTTGGAGTTGGCAGAAAGAATCCTGAGTGCCAGTCCGGTAAAATTGCCTTAGAATCAAAAAATACAATTGGCGGCAAGTTAGTTCTACAATTCGTCGCAGGCTAAAAGCTGATTTTAAGACATACTTTGTTCATAAAACGGTGAGATCACACCAACCAACAAGCAAAGCGTCTTCGATTTGCGTTGGAATATGTTAAGAAGCCTCTTGACTTTTGGTTTAATATTTTTATGGACTGATGAGTCTACATTTCAGTACCAGGGTCATACAGCAAGCATTTTATGCATTTGAAAAATAATCAAAAGCATTTGGCAGCCCAACCAACCAATAGATTTGGTGGGGGGCACAGTCATGTTTTA
->70261984-718b-4344-b03b-b3f57fc078f0
-TTGTTACTTCGGTTCAGTTACGTATTTATGGCCCAGCATCACCCAGTATAATCGCTCCTGCTAAGTCAGGCGCCAGCTTCACCAAATCAGGTGGTTTCTATCACCTCGCTGCTGCAGATCAGGCATTTTGGGTTGCTTAACGCACCTTGCCTTATGCCCGCACTCCACCACATCTAAGACCAGCAGTCATGCCCTGTCAATTATCCTTACCCAGGTTTGCTGGTCAATTACCCTGCTTCGAAAGACCTGTACATCGTGGGTCGGACGTCCTGCCGTTGATACGACATCTTGACCAACCATCCATGATTATGGTGCCCTGTTTGGGACTGGTATCGCAGCGTTCGCGTTCCCAGCAGCACTGAGGCTATTTGCTTGCAATTCCGCATACTGCGAGGCCCTGATATCTTCGGGATTTATCTGCGAGCCTGGAATTGGGCGACCAGAAGCGGCTATTAGACTTCTCTGCTGTCGTAGCCTCGTCCAATCCGCTGCAAGATGGGAGCTATTCTTTGCGCTCCCTGTGCGCACAGTGAAATCATTGAGCGCCGCTTCCAGGTCGCTCTTAAACTTGCGGGAACGCTTTCCAGCTTTCCCCTCTACCTCAAGCAATGATCACCTTTCTGCGTTCTCCGGATTTTTCGCACGTGACTGCCCAGTTCGCTAAGGCTCGATTCGATCTTAGCGAAGCATCTGCGTGAAGCCTCTCCTGTCTTTTTTACGATGGTGCCTCTGCACCCGTGCTAGCATTCTTGGCGACAGATGCGCCAGCTGCCTGGCAGACTCGTTAGGTATGGATGTCGCCTTTTTTTCTTCCTGGTGCCATCCAACGTAGGGTTGCTCTGCTTCGGCGCCTGGACTTTGGCACCTGCACCGTGGGTACCTGCGCATTTTGTGGAGCCTTTTTGGTAGGCTTTTGTACCTCCGTCTGGGTGGCGCTTTGCTCTTCAAGCGGTGCTCGCTAGTAGTACCTTCGTGCAGCTCTATCGCCCTGTTGTTCAAGGGCTGAGAGTTCGGAAGCTATGCCCTTTGTCTGTGTGTCGTTGGGTCTCGAATGCGGATAGAAGGGGGCTGATCTTGCCATTCATCCTGGTAAGTATGCCCCTCGGGTCACTCGTTCTGGAGGCAGTGGTCAAGTCGAAGACCGATGGGGGGGGAACAAGCTGGGAACTTCCCTCCGTCTTTTTTGCGATGGCACGGCGTGTGGTCCATCGTCTTCTGACTTGTCGCGGTCGTAGATGCTGTAGAGACAATTCTCACCTCTACAGCATCGCTGCAGTCGATAGTCAACGGCGGCTGGGGGGCCTGCGTGCTCACCTTGCCACCGACGGAACCGGATTCCGTCATGGGTCAGTTACCGACTCCTCTGGTGGGGATCTCGAAAGTCGAACTCCTCCTGAACAGGGTCGATTTACGCGATCAGGAGGACACCCCACCTACGTAATCCATCAACTGGAAGGTCAGCTCAGGGTTACCCTAAGTCCATGAAGCCCCAGATTTCCCCCTAAGCTTTACGGATGGAGTTTGTGCCGCCTCGACTCCCGGACACCGGAGCTACTGGCGGCTGCTTGGTAGAGGATGAAATCTTTAGGTCCTGTCCGCGACCTTTATGCCTTTCCCCTTTCACCCAAAGACGCTTGCATCCAGATTTACAGGAATCAAATTAAATTCGAGAATTAAATTTCGCAGCTTAATTTTAAATTTAATTTTGAATTCCCGCCCTACTATGCCAACCTACTTACACAGTCCACACGGGTTGATCCCAGCGCGCCTCCCTCTCAGATCATACACTGCGCTATCAAAGCTCTTTATCCGCTGCAAACAAATCCTTAAGATGTCAGTACCTATTTACATAGAAACAGGGCGCACAGTGCTCGCGTATTGATTACGGCACGCAGAACTATGGCGCGGCTTCCACCGTGTGAAGTTTTTTTTTAATTTGCCGCACACAGCCAGCCCTTCTGGTTTCCAGGTGTTTCGCGCCGCGTAATTTTAAGACGATCCGTCTTTCACGGCGATGTAGACTTGGTCTCCGCACCGGGATTGAGTGTCTAAGCCTGTGCGTTCGGTTCAAACTTTGGCAATACGACGGCATTGGTTTTTTGGGTCTCTTTGTGAGTTTTGCACTTCTTTTTTTAACGGTTCGGAAAAAATGGCGATTCTGCGACTCTGGAATTGTCAGCAAATTGTTTTTCACTGTTAGCGGTATGCGCACATATCGGTTAAGCTTGCACAGCCTTTATGTGTATTCATAATTGTAACACTCTGTTGCAATGTGTACGCCAAACAGTCCAGCACAAGTGTATGCGTACGAGCACAGCGCGCACCCGCGAGGGGCTAACATGCATAATTGCCTGGTCAGCAGTTCTCCCGCTGGCCAAGCGCTGATCGCTTATGTGCCTATACCACTCCTCCTCCAGCACCATCGCTCGGCGACAGTACATATATATATACGTATATATAAGATACGCATATAAGCGTTGCTGCGCTGCAGGCTATGCCGGCAGCGCTGGCTCCTCGACTTAGGCTAAAGAAACCTTTGTATGAATCATAAGAGTTGACGAATTCAATTTCCGAATGGAGCGGGACCTTCCCTGTTCCTCAAATTGGATCAAATAAAGAACGGCTAAAACACAAATGATCTATGACACAATGAAACTACAGGAAGTTGGAGTAGGCGGTCCACTTCTGATGTCGGATCCTGAATCCTTTTATACTCATCCTCTCTACAGCAGACACAAAGTAACAGAAAACGGTCGTTAACCGAAATTAAAGAAATAAATCTGCGACAAGTACGGTTTGTCAAGAAACTGTTTACACACCGTGAAATAAGATGAATTTTGATTTAACTTGAGGTCAAAGTAAAGTTATTTGCTTAATTAAACGCAATTTTTTTAGAGTATAATTAAACAATATTTATTTTACTTATAAATTAAAAACAAATTCAAAATATCAAATATACAAGAAATAAACAACAGATTCAAGTTTAAACACTTTGAGAGTTTCAAAGAAACTCTTTACACAAAACCACTAAACCTAAAGTTTAATCCTAAATTTTTAAAATTATTTTGTTAAAATTTGAAAAGTTGTAGTATTTAGTATGACCCCATTGGCTTTGGCTACAAGTTGGAAGCTTTTTTTCATGGAATGGATGAGTTTTTTTTTTAGGTCATGTATTCAAGCGGGATCTTTTTTCCCGCTCTATCGCAGCCATGAGCTGTTGTCGTGTTTTGGTGCCTTTACATACATTCTTCTTTAAGTAGGCCCACAAATTTTCAATGAGTTCAGATCAAGACTCTGAGGCGTATCGATCACCTTGCCACAGTTATAAAGGGAGCAGTTGCGTACATTGCACTCTTTATGTTTGGGATCATTGTCCTGATAAAACTTAAGAAATTTGGCTTGTTGTTGCTAAATAGACCAAATTTTCTTACTGGCCTTCAAATTTGATTTTAAAATATCTAGATATTGCACGGCATTCATAGTGCTTTCAATAAAGAGCTAATTTGCCTCCATGGCTTGAGATACGGCCCAAATCATCACTGATAATTTTCCAAATTTGATTGTTGGAATGATATTTTGTTCTAGCGCACTCAACAGCTTGCGCCATACTCTGCTGGCCCATCGTTATAATAGAGCATCATTTTGTTTCGTCACCAAAATGTTACGTCATCCCAGTACTCTTCACTGATTACATCAACCTCACAGCAAGTGAATGACGCTTTTCTATATTGACCTCTGATAGCAAGGCTTTTCTTTGCAACTCTTGAGAGAGTACCTATGGCGTAGAATGACTTGGCGCACAGTTTTGTGTTGGCACAACTAGGTCACATTCTTGCCTGATATCCTGAGCAAGTGAAGTCTGACCGAGATTCGGGGTTCGCAATCGCACTTTTCGCATAATAAGGCCGGTCTACACGCTTGCTAATTTGGTTTTGCGCCCGCCACTCTTAAGGTTCAAACCTGTTCTCTTTCCAAGCGATTAAAAACATTGTGAACCGGTCTTACGGGATACAGAAAACATTCTCACTAATTCTGGAATGAATTTTCCCAGCTGGTGGTTTAGTATATTATTTGGGTCATTCAAAGCTAATCTTATTTCAGGCATTTTGTCAAATTAATAATACGAACCGATCAGCAAAATTTCACAAAGCAAAATGCAATAGAAGCGTTGTAAAAGGAATGCAAATGCCAAAAATAACGGAAAAATCGAAAGGTTCGTTCTAAGAAAAAGAAACAAAAACAAAGTAGGAAAACAAAATGTGTAGGAGTTTCTTGCCACTCTCAAAAGTGTAAACTTGGAATTTGTTGTTTAATTTCTTGTATATTTAATCTTTGAATTTATTTTTTTAAATTTATAAGTAAAATAAATATTGTTTAATTATCTTCATTAAAAATTGCGTTTAATTAAAGAAATAACCCTTAATTTGACCTTTAAAGTGAAAAATTCAACTTATTTCACGGCGTGTAAATAGTTTTCTTGACAAACTGTATATATCTACAAAATTTACAACTTGCCGGTACCATCTGCAAGATTCATTACATTGAGAAGTGGACTTTGACTCTCAGAATGTGAATTAAAACATTATATTCTTAAGATTGAACTGACGGGAACCAGACTGAACTAACTAAACTAACTATCATTTAACTAAATTTAATTAAGTTTACTTACTGATAATTTTGAGTTTCTTACAGATGACTAATATTAATTTTTTAGTTAAAATAGTTTGCAAAACTGAATTTATGTAAATAATATGTTCAATTGATCTGGTTGGGTTTTCTGGGTCTCCCCAACACCTCATAACGAATGCTGGATCAAAATTATTCGTCAGAAGGACGTGCTGGTCGTGAGTAATAAAAGTACAACAATCTTACTTTTGAGGTGGCGTGTTGGAAAGTATGTGCATTTAAGCAAAAGTCACATGGCCTGCATCAAGACACTAGAATAATAAGATGCGTAACAGCCATACACTGGTTTGGCACTATGCAGCCACTTTTTTTGGTGACGGCCAAAATTGCTCTCTTTCCGCTCGCTCACGCTGAGCGTAAGAAATCTAAAAATAGAATTTGCTTGCTTGTGTGAGAGTAAAACAAAGACGAGAACAGCGTATATGTGTGCGTGTTGTGCTAGAAAGGCGATTTCGAGGCCGAAATCAATTCTGATCGCAGTAACGAATTTACATAATATTTTATACATATTTGGGAGTTTTGGTAATTTCGTAGAATATGATGAGGTAGCTGTTTAAGATATCAAATTGGAATATAAAAAAAACTGAAAAGTCATTACTTGCTGAGAAAAAAAATATTTCATAAAATATTACGAGTAGAAATAAAAATTTATAAAATAAAAAAAATGCTATTTATTACAAACATCCATATCAAAATTAAAGGAATTATTCTAGTGTCTTTGCTTTGGTCATATCTCCCAGAGCTGAGGTGCAGACTTTGCTCCTCAACAATCGACATCTTCTTAATACTCCGAAGCAGGCGACACCGACGAAGACCTAACTGCTTTGAAATGGCAGAGTAAAATAAAATCAAAAAAAAGAGACCAAGCCCCTCCCGAAGTTCAAAGAAAACAGGATTCCCTGGACAATTCATCGAAGCACCAGCGCAAAATAATTTCGCTCTCTTAGAAAGCGACGGATTGCCCGACAAAGGCAAGGAAACAAATATAACAAAAGCAGAAGATCTCGAAATGGTAAAATGAAGACAGTGCAACTGATTTTGCTAAGCCCCACTATCTTTCTCTCTGACGTCAATGGTATAAGTGAAAAGCTAACCTATCTTAAAACTAAAATTAAGAGAACATTAGACTCAACGTTATGGACATGTAGAGTAATGGTTAAAGTATTGAAGAATTCTGAAAATTAGTCAAAACACTTAATAATGATTGTGTGTTACCACACATACCAGCTTAAAGATGACAGAGCATTTAGAGTTGTTATTAGAATTGCATTTTTCCACAAATTTAGATGAAATTAAAAAGTGATGAGAGTCAAAAGGTCATGTTAGAAACATAGTAATATTAAAAAAGCCGTGCGACCAAAACGTCATGAACATGTTTATGTAGATATTGAGCCTAACAAAAAACCACAGACATATATAATGTAAAATAAAATATTGAGGAGCCTCCCCACAATGAAATCGTTCAATGCTATGGCTGCCAGAATTCGGACATACTAAAATCATATTGTACCAAAACGTACCGTGTGTAAAATCCTCTTCTCGACACCCAAGCAACATTTGCCCGAAAATGCAAGAACAACCAGCAAAATGTGCCAACTGCTACGAAGAACACGCCGCCAGCTACAAGGGTGTAAATTTATCAAGGAACTCTTGTCCAAAAAAATAGAAAATAGAAATAATGATCTGAGTAAAAATGGTTAGAATCAGCAAAAGTTTGTTCCGCCTAACAAGCCAACATATACCAACAAAGTAACGATTAATGATCTTATGCCCAAATTGCTGCAGGAAATAACAAAACAAACACATCACTGGAGAGAATAGAGCAACTATTAAGGAAAACAGTCTGAACTTACAAATAATTTACTTAACATGATAGTATTTACTTACGTAAACAAATTATGCAAATGAAATCTAACTGGAATAGGCTTGTAGTAGGAAGTAGCTTACAAATACTAAAAGCTTCCAAGGAAACGGAGCTAATACAAATCATAATGCTCTTATAACTAGCTACTTTTTCTTCCAGCAAAGCCTACACTTACTGGCCTACTGATGGTAGAAAGATGCCAAACTTAACCCTTTCGCACCCAACGTTGTATGTGAGCAATTTCTATGTTTTCAGGAGCTAACTGTAGGGTGTGCCCTTTTGTTTTATCTGCTGATTCTTTATGATAACGGTGTACATGTGTCTACTCTAAATATAAAAGCAACATTTAAATTAATTGCAGGGAATTATTTGCAATAAAATAGCACACTTTTATCCACAATAATTATTGTTTCAATCTTCAGACACAACTTTAGAATTAATGAAATTTACTTTTATAATACTTTAAAAAAAGAACCTAAAATTCTCAACAACAAAAGTTAAACAAGACAGTGATTTAGTCAAAACTTAGTAAGTAGTGAACAATAAGTAAGTAAATAATTTTCTAAGTTGCTTGTGAGCAACCTTGGGCATTCGTGATAATTTTCACCGAAGGTTTGTCTAACAGAAAGAAATTGAACGAGTTTAAACTTCGATTGGGATATTTCTACTGACAGAAGAAAGTGGTGGGAGATGAAAGACACATTTCTACGTGGTACTAGGAGAAATTTAGAAGGAGAATTCTGAGAAAGGGAGAAAAGAAAGTATCGACAGCTGACCTTCTGGAAAGAAATACAGTGATTGAAGGATGTAAAGGGCCTGACTCTGCGTTGTTGACAGTTGCTTAGAAAATTGATCCAAAAGAGGCTAAAGTGGAGAACAAGGCCGTTTGTAGCTCAGAAGTATTTGGGAAGATGACAAAACTTTGATATCCGGGGACATAAAGACGACCGTGGAGTTCTTCTACACCTTTTTGATACTCAGCTAATTCATTTAATGGCTAGGCAAACTGATATACAGTCATGGTCAAAATTATTTTCACAAAGTGCATTTTTGTGCATGGATCACAAACAGTTGCTTGTGCAGCAAAAAGTGGGGAGGTGAAATGCAAAAAACTTTGCTTTGCAAATTCAAACCTATGCGAGTCAGATGAAAGAAGAATTGAAAAATAACTGTTCCTATGCGCAGGAAGAGGCAAATGAAGAGATCTTTATCAGTTGTCAGGAAATGTTGCACGGTTTCGTCGCATCACAATTATTTTTCACAACGCAATTTCTTCTTCAGTGATTGGTTTAGAGTGACAAGTGCGGTTTGTTTGCTTAAATACATTTTAAATTATTGAATAAAAGGTGTTAATCATTTTTCCTATTACAGTTATTAAATAAAATACCCAAAACAAAAGAGTTAACAGTTGAGGCCCGGGCTGAGTACATTGTTGCTAGGTTTAAAGCCGGTACACCTGCGGCCAAAATAGCTGAAGCAATACGTAACTACCA
->07e1acde-1da3-4e11-aa85-2eae621f1856
-TTCTCGGTATTACTTCGTTCAGTTACGTATTGCTCAGTGATGATTTGGGGCTATCTCAAGCCATGGGTGGGCAAATTAGCCTTTATTAGTACTATGAATGCCGTGCAATATCTAGATATTTTAAAATCAGAGATTTGAAGACCAGTGCAGAAAAATTTGGTCTATTTAACAACAACAAGCCAAATTTTAAGGTTTATCAGGGACAATGATCCCAAACATAAAAGGTGCAATGTGCGCAACTGGCTCCTTTACCTAACTGTGGCAAGGTGATCGATACGCCCCCTCAGAGTCTTGATCTGAACCCCATTGAAAATTTGTGAATTTCACCAAAGAAGAATGTGGCAAAGGGCGCAAAACACGACAACAGCTCATGGCTGCGATAGAGTGGGAAAAGATCCCGCTTGAATATGACCTAAAAAACTCATCCATTCCATGAAAAAAAAAGCTTCAACTTTGTAGCCAAAGCCAATGGGGTCATACTAAATACTACAACTTTTCAAATTTTAACAAAATAATTTAAAATTTAGGATTAAACTTAGGTTTAGTGTTTTGTGTAAAGAGTTTCTTGAAACTCTCAAAAAAGTGTTTAAACTTGGAATTCGTTGTTTATTTTCTTGTATATTTGATATTTTTGAATTTGTTTTTTAATTTATAGAGTAAAATAAATATTGTTTATTATATTTCCTAAAAAAAAAAATTGCGTTTAATTAGCCAAATAACCCTTAATTTTGACCGTTAAAATCAAAAATTCATCTTATTTCACGGTGTGTAAACGGTTTCTTGACAAACTGTACTTGTCGCAGATTTATTTTTTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTAGAGAGTGATGCCGAGTATAAAATTCAGATCCGACATCGAAGTGGGACCGCCTACTCCAACTTCCTGTAGTTTCATTGTGTCATGAATCATTTGTGTTTTAGCTGTTCTTTATTTGATCAATTTGAGGAACAGGGAAGGTCCCGCTCCATTCGAAATTAATTCGTCAATCCTCTTATGATCTACAGCCTATAAAGGTTTCTTAGCCTAGAAGTCGAGAACGGCGCTGCCAGCATAGCCTGCAACGCAGCAACTTGCTATATGCGTATCTTATATATATGTATATATATATGTGTACTGTCCTCGAGCGATGGTGCTGGAGGAGAAGTGGTATAGGCACACATATAAGCGATCAGCGCTTGGCCAGCAGGAGAACTGCTGACCAGGCAATTGTATGTTAGCCCTCAAGTGGGTGCTCGTATTACGTATACACTTGTGCTGGACTGTTTATGTACATTGCAGCAGAGTGCTACAATTATGAATACACATAGGTACAGTGCTTAACCGATATGTGTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTAGAGTCACTTAAGAATCGCCATTTTCTGAACTGTTAAAGGGTGCCAAAACTCACAAAGAGACCCAAAACTGAAATGCTGTCATTATTGCCAAAGTTTAATCCTGAACGCACCAGGCTTAGACACTCAATCCTGGTGCGGAGACCAAGTCTACATCGCCGTGAGAGATTGGACGTCTTAAATTACGCGGCGCGAAATACTCAGAGGCCATGAAGTTGTGTCGGCCGGTTATTGTTACGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCATAGTTCTGCGCTGCAATCACGCACCTTGAGTTAATTGTGCGCCTGTTTTCGTAATAAATAGGTAATTTATTATCTGCGATTGTTTACGCGGATAAACAACTGATAGCGCAGCGAGGCGATCTGGAGAGGAGGCGTTGCCAGATCAACCGTGTGATCAGTGTTGATGATGTTTGAAACAGTAGGGCGCAAAATTTATTAAATTTAAAATTAAAGCCGTTGAAATTTAATTTAATTTAATTTTGATTCTGGTAACTGGGGCGCACAAGAGTCTTTAAGAAAGGAGAAAGGCACAAAGGTCGCGGACAGACCAAATATCATCCCTCTCACCGTTAGTTGCCTAAGCAGAGCTCCCAATTGTCCAGTCGAGGCAGTACAAACCTCCATCCGTAAAGCCGAAATCCGTGGCCTACGTGACCCCTAGGTAACCTTAGGCCATCCTTCAGTTGATGGACAGCGCGGTGGGGGGGCAGTCCCCTGATCGCAACGACCCGTTCAGGGGAGGAGCTCCCGACTCGGGATCCCCACCAGAGGTCGGTAACCCGACCCATGGTGACGGAATCTCAGTCCGTCCAGTGGCAAGGGGTGAGCACGCAGGCCAACCGCCGTTGACTATCGACTGCAGCGATGCTGTAGGGTGGAAGAAATTGGCTCCTACAGCATCTACGGCCGCGACAAGTCAGAAGACGATGGACCCATCGCCGTGCCATCGCAAAAGCGGGAGGGAAGTCAACGTTTCCCCTCATCGGTCTTCCGGACTTGACCACTGCTCTCCAAATTTAGGGACCTGAGGGGCATACTTACCAGGATGAATGGCAAGATCAGCCCCTTCTATCCGCATTCGAGACCCAACTGACACATGAGAGACAAAGGGCATGGCTTCGAACTCTCAGCCCTTAACAACAGGGCGATAGAGCTGTACGAAGGTACTACTAGCGAGCACCGCGAAGAGCAGCGCTGCAGACGGAGGTACAAAGCCTACCAAAGGCTCCACAAAATGCGCAGGTACCCACGGTGCAGGTGCAAAGTCCAGGCGCCGAAGCAGAGCAACCCACGTTGGATGGCAACGGTGAAGAAAAGGCATCCATACCTAACAGGTCAATGAGGCAGCTATGCATCTGTCGCCAGAATGCTAGCACGGGTGCAGAGGCACTCATCGTAAAAAGACAGGAGAGGCTTCGTGCAGAGATGCTTCGGAGGCTAAGATCGGAATCGAGCCTTAGCGAACTGGGCAGTCACGTGCGAAAAATCAGAGAACACCAGAAAGGTGATCTGTTGCTTGGTGGGGCTTCGGAAAGCGTTCCCAAGTTTAGAAGCGACCTGGAAGCGGCGCTCAATGGCAACCTCTGTGCGCACAGGAGCAAAGAATAGCTCTATCTTGCAGCCCAGTTGGACAGGAGCTACGACGGCTGAAGAAGCTCCACGGCTGCTTGTCCTTATTCAGAATAATCCTGAATATCGAGAACCCTTCATCCTGATCCATATCGATTCAGATGATCAGATCATCCATCAATCAACAAGTCATCGATCGAATCATCTATCATCGATCGAATATCGACAATGAATCATCTTCGATCCATCCATCGAATCAATGAATATCTTCAAATCAAATCAAATCTCCTTCATCGAATCGATATCGATCGATTCGATTCGAGTCATC
->9cd35645-0183-4935-aa28-460559d8b034
-CTGTTGTACTTCGTTCAGTTACGTATTTGCTGTCAACATGTCCCCGACATCAAAAGTTTTAATCATCTTCCCAAATACTCTCTGGACGCTACAAACGGCCTTGAATTTCTCCACTTTAGCCTCTTTGGATCAATTTTCTCTAAGCAACTGTCAACAACAACGCAAAGTCAGGTTCACATCCTTCAATCTGCGCCATTTTCCAGAAGGTCAATGTCGATACTTTCTCCCCTTTCAAAATTCCTTCTAAATTCTTCTCCAGTACCGTGAAAGTATCTTTCATCTCTCACCCTTTCTTCGTCAGTAGAAATATCCCAATCGAAGTTTAAATCCGTTCAATTTCTTCGTTAGACAAACCTTTCACTTTCGGTGAAAATTATTATCACGAATGCCAAGGTTGCTCTGGCTTAACTTAGAAAATTGTTACTTACTTATTGTTCACTGCTTACTAAGTTTGACTAAATCACTGTCTTGTTAACTCTTTGCTGTTGTTTTATATACCTTTAGGTTCTTTTAAAAGTATTATAAAGTAAATTAATAATTCAAAAGTTGCACCGAATATCGAAACAACCAATTATTGTGATGCGCGTGCTATTTATTGCAAATAATTCTGCAATTAATCTCCAAATGCGTTTTTTGCTTTTTATATTTAGAGTAGACACATAAAAGCACCGTTATCATAAAGAATCAGCAGATAAAACAAAAGGGGCACACTTACGAGATTGCTCTGAAACATAAATTGTGCTCACAAGCAACGTTAGATTGCGAAAGGGTTAAGAAGTTTGGTATCTTTCTACTATCAGTAGGCCAGTATGTAGGCTTGCCGGTTGAAGATGTTGTTATGCTGTTGTTTACTATGCATTTGTACAGTTCGCTTCCTTCGGAAGCTTAACGTGGTACACCTCCTACTACGCTTCCATATTCCAAGGTTAGGATTTACTTACATGAATTTGTTTTACAAGTAACATTATCATGTTAAGTAAATTATTTGTAAGTTCGAACTGTTTTCCTAATAGTTGCTCTATTATATCAGTGATGTGTTTGTTTTTGCTATTTCCTGCGGCAATTTGGGCATAAGATTGATAATCGTTACTTTGTTGGTATATGTTGGCTTGTTAGGCGGAACAAGCTTTGCTGGATTCCTAAATCATTTTACTCAGATCATTATTTCTATTTCTATTTTTTTTGGACAAGAGTTCTGTCGTTCTACACCCTTTGTAGCTGGCGGCGTGTTCTTCGTAGCAGTTGGCGCATTTTGCTGGTTGTTCTGTATTTTTCGAACAGAAATGTTGCTGAATTGTCGAAGGGATTTTACACAGCGGTACGTTTGGTACAATATGATTTAGTATGTCGAATTCCTGGCAGCTATAGCATTGAACGATTTCATTGTGGGGAGGCTCAATATTTATTTACATTATATATGTCTAGGTTTTTTGTTAGGCTCAATATCTACATAAAACATGTTCAGTGACGTTTTGGTCGCACGGCTTTTAATATTACTTATGTTTCATAACAACATGACCTTTTGACTCTTCATCACTTTTAATTTCATCTAAATTTGTGGAAAATGCAAATTCTTAATAACAACTCTAAATGCTCTGTCATCCCTTAAGCTGGTATGTGGTACTGCACACAATCGATATTAAAGATGTTTTGACTAATTTTCAAATTCTTCAATACTTTTAACCATTACTCTTACATGTCCATAACGTTGGAGTCTTATAATAAAAAAAGTTCTCTCTTAATTTTGGTTTTAAGATAGGTTAACTTTCCTTACCATTGACGTCAGAGAGAAAGATAGGTGGGGGCTTAGCAAAATCGGTTGCACTGTCTTCATTTACCATTTCGAGATCTTCGTTTTGTTATATTTGTTTCCCTGTTTGTCGGGCAATCCGTCGCTTAAAGAGAGCAGAAATTATTTGCGCTGGTGCTTGATGAATTGTCCAGGGAATCCTGTTTTCTTTGAACTTCGGGAGGGCTTGGTCTCTTTTTTTTGGATTTTATTTTACTCTCTGCCATTTTCAAAGCAGTTAGGTCTTCGTCGGTGTCGCTCTTAGCGGTATTAAAGAAGACAATGATTGTTCGGTCTTGTGTCCGCACTTCGTGCCTCAAGATATGACCAAAGCAAAAGACATAGAATAATTCTAATAATTTGATATGACGTTTGCAATAAACAGTTAACATTTTTTTTTTATTTTATAAATTTTTTATTTTCTGCTTCGTATTATTTTTTATGAAATTTTTTCTCAATTAATAATGACTTCTTTTTCAGTTTTTTTTATATTCCAATTTGATATCTTAAGCAGCGCGCAATTTCATCATATTCTGCAGAATTGGCCAAAACTCACAAATAATAATAATGTACATATGTAAATTCGTTACTGCGATCCAGAATTGATTTCGGCCCGAAAATCGCCTTCTAGCACAACACGCACACATATACGCGTTCTCGTCTTTTGTTTTACTCACACAAAGCAAGCAAATTCTATTTTAGATTTCTTACGCTCCAGCGTGAGCGAAGCGGAAAGAGAGCAATTTGGCCCGTCACCAAAAAAGTGGCTGCATAGTGCCAAACCAGTGTATGGCTGTTACGCATCTTATTATTCTGAGTGTCTTTGATGCAGGCCATGTGACTTTTACCTTAAATGTGTACATACTCCAACGCCTCAAAGTAGATTGCTGTACTTTATTACTCACGAGACTGTGCATCCTTCTGACGAATAATTTTGATCCAGCATTCGTTGCGAGGTGTTTGGGGAGACCCAGAAAATTAACCAGATCAATTGAACATATTATTTACATAAATTCAGTTTTGCAAACTATTTTAACTAAAATTAATATTAGTCATCTTTGTAAGAAACTCAAATTATCCGGTAAACAATTAAATTTGGTTAAATGATAGTTAGTTTAATTAGTTCAGTCTGGTTCCTCGTCAGTTCAATCCTAAGAATATAATGTTTTTAATTCATTCTGAGAGTCAAAGTCACTTCTCAATGTAATGAATCTTGCAGATGGTACCGGCAAAGTTGTAAATTTGTAGATATATACAGTTTGTCAAAAACTATTTACACGCCGTGAAATAAGTTGAATTTTTTCACTTTAAAGGTCAAAATTAGGGTTATTTCTTTAATTAAACGCAATTTTTTAATGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAAAACAAATTCAAAATATCAAATATACAAGAAATTAAACAACAAATTCAAGTTTACACACTTTTGAGGTGGCAAGAAACTCCTTACACATTTGTTTTCCTACTTTGTTTTGCTCTTTTTCTTAGAGAACGAACTCGATTTTTCCGTTATTTTTTGGCATTTTGCATTCCTTTTACAACGCTTCTATTGAAATTTTTTTACTTTGCTTGTGAAATTTTGCTGATCGAATGAGTTATTAAATTTAATAAAATGCCTGGAAATAGATTAGCTTTTGAAGTGACCAAATAATATGCTAAAACCACCAGTTGGGAAAATCCTATTCCAGAATTAGTATAAATGTTTTCTGTATCCGTAAGACCGTCTACAATGTTTTTTAATCGCTTGAAAAAAGAGCAGGCTTGAACCTAGAGTGGTGGGCGCAAAACTAAAATTAGCAAGCGTGTAGACCGCCTTATTATGCAGTGATTGCGAACCCCCGAATCTCAGTCCGAATCGCGCTCAGGATATCGGAAGAATGTGACCTAGTTGTTGCCACACAAGAGCATTGCGCCAAGTCATTCTACGCCATAGGTACTCTTCAAGAGTTGCAAGAAAAAAAAGCCTTTGCTATCAGAGGTCAATATAGAAAAGCGTCATTCATTCGCTGTGAAGCATGATGGATCATGCGGAAGAGTACTGGGATGACGTAATATTTTGTATTGAAACAAAATGATGCTCTATTATAACGATGGGCCAAGCAAATTATGGCACCAGCTGTTGAGTGCGCTAGAAAAACAAAATATCATTCCAACAATCAAATTTGGAAAATTATCAGTGATGATTTGGGGCTGTATCAAGCCATGGAGTGGAGCAAATTAGCCTTTATTGAAAGCACTATGAATGCCGTGCAATATCTAGATATTTTAAAATTTGAAGGCCAGTGCAGAAAAAATTTGGTCTATTTAGCAACAACAAGCCAAATTTTTAAGTTTTATCCAGGACAATGATCCCAAACATAAAGAGTGCAATGTACGCAACTGGCTCCTTTATAACTGTGGCAAGGTGGTACGCCCCTCAGAGTCTTGATCTGAACCCCATTGAAAATTTGTGGGCCTACTTAAAAAAGGAAGAATGTGGCAAAGGGGCATAGAAACACGACAACAGCTCATGGCTGCGATAGAGTGGGAAAAGATCCGCTTGAATATGACCTAAAAAACTCATCATTCCATGAAAAAAAGCTTCAACGTAGCCAAAGCCAATGGGGGGTCATACTAAATACTACAACTTTTCAAATTTTAACAAAATAATTTAAAATTTAGGATTAAACTTAGGTTTAGTGTTTTGTGTAAAGAGTTTCTTGAAACTCTCAAAAAAGTGTTTAAACTTTAGGAATTCGTTGTTTATTTTCTTGTATATTATTTGATATTTTGAATTTGTTTTTAATTTATAAGTAAAATAAATATTGTTTTAATTATATTTCTAAAAAAAAAATTGCGTTTAATTAAATAAATAACCCATAATTTTTGACCGTTAAAATCAAAATTCATCTTATTTCACGGTGTGTAAACAGTTTCTTGACAAACTGTACTTGTCGCAGGTTATTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTAGAAGTGATGCCGAGTATAAAGTGATTCAGATCCGACATCAGAAGTGGGACCGCCTACTCCAACTTCCTGTAGTTTCATTGTCATAGATCATTTGTGTTTTAGCTGTTCTTTATTTGATCAATTTGAGGAACAGGAAAGGTCCCACTTGGGTTATTCATCCAATCCTCTTACCAATCTACATACAAGGTTTCTTAGCCTAAGTCGAGAGCACTGCCAAACTTAGCCTGCAGCACCTTAACTTGTATGCGTATCTTATATATATGTATATATATATGTACGTCGCCGAGCGATAGTGCTGGAGAGGAAGTGGTATAGGCACACATATAAGCGATCAGCGGCCAGCAGGAGAGGCTGCTGACCAGGCAATTATGTATGTTAGCCCTCAAGTGGGTACTCGTATTACGTACACTTGTGCTGGACTGTTTATGTACACATTACGGCAAGAGTGCTGGTATATGAATACACATAGGTACAGTGCTTAACCGATATGTGTGCATACTACAATAGTGAAAACGAGAATTTGCTGACAATTTCACAGAGTCGCAGAATCGCCATTTTCTGAACTGTTAAAGAAGTGCAAAACTCACAAAGAGACCCAAAAAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCTGAACGCACCAGGCTTAGACACTCAATCCTGGTGCGGAGACCAAGTCTACATCATACCGTGAAGACGGACGTCTTAAATTACGCGGCGCGAAATACTCGAAACCATGAAGTTGTGTCGGCCGGTGTGCGGCAAACTGGCGGCAAAATCACACGGTGAGTCGCGCCATAGTTCTGCGCTGCAATCACGCGAGTTAATTGTGCCTGTTTCATCAACAAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAACGGCTGATAGCGCAGCGAAGCGGAGCGATCTGGAGAGGGAGGCGTTGCCAGATCAGCCGTGTGATCAGTGTTGTGTTGCGACAGTAGGGCGCGAAATTCAAATTAAATTTAAAATTAAGCCGTTGAAATTTAATTTAATTTAATTTTGATTCTGGTAACTGGAGCGCACAGAAGGGGAAAAGGCACAAGGTCGCGGACAGACCAAATATCATCCTCTCACCGTGCTGGTGCCTAAGCAGAGGCTCTGGTGTCGAGTCGAAGGCGGTACAAACCTCCATCCGTAAAAGCCGAAATCCGTGGCCTACGTGACCTAGGTAACCTTAGGCCATCCTTCCAGTTGATGGACAGCGCGGTGGGGGGCAGTCCCCTGATCGCAACGGCCCGTTCAGGAGAACCCGACGAGATCCCCACCAGAGGAGTCGGTAACCCGACCCATGGTGACGGAATCTCCGGTCCCGTCGGTGGCAAGGGAGGTGAGCACGCAGGCCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGAGGTGGAGAAATTGGCTCCTACAGCATCTACGACCGCGACAAGTCAGAACGATGGACCACATCGCCGTGCCATCACCAAAAGACGGGAGGAAGTCCCCAGCTTGTTCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCCAGAACGAGGACCGGGGCATACTTACCAGGATGAATGGCAAGATCAGCCCCTTCTATCCGCATTCGAGACCCAACGACACACATGAGAGACAAAGGGCATAGCTTCCGAACTCTCAGCCCTTAACAACAAGGGCGATAGAGCTGTACGAAGGTACTACTAGCGAGCACCGCTTGAAGAGCAGCTGCAGACGGAGGTACAAAGCCTACCAAAAGGCTCCACAAAATGCGCAGGTACCCACGGTGCAGGTGCCAAAGTCAGGCGCCAGCAGAGCAACCCTACGTTGGATGGCAACGGTGAAGAAAAGGCGACATCCATACCTAACGAGTCCAAGCCAGGCAGCTATGCATCTGTCGCCAAGAATGCTAGCACGGGTGCAGAGGCACTCATCGTAAAAGACAGGGGCTTCGTACGCGAAGTGCTTCGGAAGCTAAGATCGGAATCGAGCCTTAGCGAACTGGGCGATCGATGCGAAAAATCCGGAAGACGCAGAAGGTGATCTGTTGCTTGAGGAGGTAGAGGGAAAGCTTCGGAAAGCGTTCCCAAGTTTAAAACGACCTGGAAGCGGCTCAATGACGCAGCCTCTGGCGCACAGGAGCGCAAAGAATAGCTCTATCTTGCCCGGCCAGTTGGACGAGAATTACGACAGCAGAAAGCTCCACAGCTGAGCAATACGTAATGGCA
->824488d5-65f8-431c-9b1c-1de406a854ab
-TTGTTGTACTTACGTTCAGTTACGTATTTAGCAGGCTTCTCTGCATCGTGGCCTCGTCCAATCGCTGCCAAATTAGAATTCCTTCACGCGCTCACAGAGGCCAAAGTCGTAGGGCGCCGCTTCCAGGTCAGCTCTTAAACTTTGGGAACTTTTCAGGCTTTCCCTCTCAACAATAGTCACCTTTTCTTGCGTTCTCGGATTTTCGCACGTGACTGCTTGATTCGCTAGGCTCGATTCGATCTTAACTGAAACTGTCTCTGCGTACCGAGCCTCATAATCTTTGCGATGATGCCTCTGCACCGTGCTGTATTCTTGGCGACAGATGTAGCTACCTGGCGGACTCGTTGGGTATGGATGTGCTTACTGTTCTGTTGCCGTCAACATGGGGTTGCTCTTCGCGCCTGGACTTTGGCACCTGCTGTGGGTACCTGCACATTTGTGAACCTTTTGTGACTTTGTACCTCGATCTGGTGGCACTTTGCTCTTCAAACGGTGCTCACTAATCAAACCACCAACCTAAATTACCGGCTCTATCGCCCTGTTGTTGGGGCTGCAGAGAGTTTGAGAGCTATCTTACTGTCTCAACCGTGTCAATTTAAAGTTAGTCGGATAGAGGGCTGATCTTGCCATTCATCCTGTTCGTGCCTCAATTCCTCGTTCTGGGCTGGTCAAATGAGAGACAACTGGGGACTTCCTCAATCTTTGCAGAGTATTTGACATTGTGGTCCATCGTCTTCTGACTTGTCGGTCGTAGATCTGGAACCAATTTCTACACCTCTACAGCATCCTTTGCAGTCGATAGTCCAATGGCAATGGAGGATACCGTGCTTTCACCTTGCCACCAACAGGACGGATTCCGTCACCATGGGTCAGGTTACCGACTCCTCTGTGGGGATCAAGATCCATCCTGAACGGAGTCGTTGCGATCAGGGACTACCCACTAAACTATCCATCCAACTTTGAAGGATGGCCTAAGGAGTTACCCTAGGTCACGTAGGCCACAGATTCCCAGCTTTTTACGGATGCAGGAGTTTGTACCCGCCTCGCTCGGACACCCAGAGCCCTCTGCTTAGGCACCAGCTTTGGTGAGGATGATATTTGAATCTGTCACGACCTTTTCCTTTCTTAAAGACTTTGGCATCCAGTTACCAGAATCAGGTGAAGTGTTCATTTCAACAGCAATTTTAATTTAATTTGATTTCACGCCTATATCGCAACACAGCACTGATCACACGATTTGATGCCTTCCTCCTCCAGATCTGCTGCATATCAGCTGTTTTATCACTTCTGCAACAATCGCAAAGATAATGGAATTACCTATTTACGAAACTTGTTTTGAATTAACTCGCGTGGTGCATGGAGACTATGGCGCGACTCACCCATTGTTGTTTGCCAGTTGCCGCCACGACCGACCTGGCTGGTTTCAGGTATTTCCGCCGCGTAATTTTAGACGTCCATCTTCACGGCGATGCCAGACGGTCTCCGCACTAAGGTTAAGGTGTAAGCCTGTGCGTTCCGGGATTAAACTTTAGCATGCGACAGGTAGTTTTAGGTCTGTGGTTTGCACTATGGCTGGATTCAAAATGGCGATTCTGCGACTCTGGAATTGTCAGCAGAATTGTTTCACTATTATGGTATGCACACATATCCGGTTGGCTGGCGCACCATGTATTTCATGGTGCAGCATCTGTTTGCAGTATTGTGCGTAACCAGTCAGCTACCGTGTACCAATACGACACTTAGCGGGGCTGGCATGCATAATTGCCTGGTCAGCGCGGTTCTCGCTTTGGCTGGCGCTGATCGCTTATGTGTGCCTACCATCACTCATCGGCGCAAGCTCGCTCACGGCGACGGTACATATATGGCAGATACGCCATATAAGCGTTTGCTTGGCTGCATTGCCAGCGGCGCTGCTCTCGACTTAGGCTAAAGAGCCTTTGTATGTGGTCTGTGGGATTGACGAATTGGCTGATAGGCGGGACGCTTCCTATTCCTCAAATTTGGATCAAATAAAGAACAATAAAACACAAATGATCTGTGACTTTTGGTAGGGCGGGAGTTTGGAGTGGGCGATTAAAAGCTACGATTGTCGGTCTGATCTTCGTATGACGTCGCTCTGCAGCCGGACTGGTAACGAGAGAAAACGGTCGTTAACGGTGAAAATCAATCTGCGATAAGGTACGGTTTGTGAAACTGTTTGCATGATGAAATGGATGGGTGCGGTTTTTAACGGTCAAAGTGGGGTTGTGGCGGTGAACGCGGTTTTGCGAACGGTTAACGACCGTTTCACCGGCGGCGGTAACGGCGATGATGGCAATAAAGTGATTCGAATCCGACGATACTCTCAATTTCGTGCTCAATCAGAATCTTTAATGTTTAATATTCTTTATTGATCAATTGAAAGGTGGAAAGTCGCGTCGAAATCTGCAGCCACAAGGTTTCTTAACCTAAGTCGAACGCTTGCTACCGGCATAACCTACGGCACGGCTGCTTATATCTTATAATATAATAATATTGCTCATGAGCGGTAATAGCACATATAAAGCGTCGGCCTGACTGGCGGGAGAACTGCTGACAACGACCAGCGTGACCTGAAATGAGCAGCATAAAATGCAATACGCCCGTATGGTGTTGTACATTCTGACAGTCTTCTGGTCAATTACATAGATGGGTACTTAACCGACTAATGCAATGATGAAACAATTTTGCTGATGATCTGGAATGCAGAAATCATTCTAAACTGACCAAAAGTGCAAAACTACGAAAGAACAAAAAAAACCAATGCTATCGTATTGTAAGTTCAGATGCTGAAGAACAAAGCCGCCGTGAACGAACGTCGAAACTCACTCAATTGTGTCGACGGTGCGACTTAAACAACACAATCTGCGATGAAAGTCGCCATGAATCACGCCGGGGATGTTCAATAACGCCTGTTGCTCATCAGTATTATTATCTTTACGATTGTTAACGAATAAACTGATAACTGGCGTACGTCGAAGGCGTTGCCGAATCAGCAATGATGTTAAATGTTTGCGTCAAAACAAATTTAACCGTTAATTAATTGGGCAATTTTTGATTCTGGCTGAACACTAAATGAAAGGCAAGGTGGGCTCTATCCTCGTGTGGTTCTGCTTTCAGGCTTATTTCGCTCAATCCGTAAAAAGCAGAAATCTGAAACCTACGAACTTCACCATAG
->60b436eb-632a-4127-8531-27c73c3824f0
-TCATTACTTCGTTCAGTTACGTATTGCTAGTTCGCTTCCCTTCGGAGCTTAGCATTAGAAGTCACCTCCTACTACGCTTCCATATTCAAAGGTAGGGATTGCATAATTTGTTTTACAAGTAACATTATCATGTTAAAGTAAATTATTTGTAAGTTCAGACTGTTTTCCTAATAGTTGCTCTCTATTCTCTCCAGTGATGTGTTTGTTTTGCTTCTTTCCTGCAGCAATTTGGGCATAAGATTGATAATCGTTACTTTGTTGGGTATATGTTGGCTTGTTAAGGCCGGAACAAACTTTGCTGGATTCCTAAATCATTTTACTCAGATCATTATTTCTATTTTCTATTTTTTTTTTTGGACAAAGAGTTCCTGATAAATTCTACACCTTTAGCTGGCAGCGTGTTCTTCGTAACCCAGTTGGCACATTTTGCTGAAATTGTTCTGTATTTTTCGGGCAAATGTTGGCAGATTAATCGAGAAGAGGATTTTACACAACGGTACGTTTTGGTACAATATGATTTAGTATGTCGAATTCCTGGCAGCTATAGCATTGAACGATTTCATTGTGGGAGGCTCAATATTTTATTTACATTATATATGTCTAGGTTTTTTTTTTTGTTAGGCTCAATATCTACACCATATGTTCAGTGACGTTTGGTCCTTACGGCTTTTAATATTACTTATGTTTCTAACAACATGACCTTTTGACTCTTCATCACTTTTAGTTTCATCTAAATTTGTGGAAAAAATGCAAATTCTTAATAGCAACTCTAAATGCTCTGTCATCCTTAAGCTGGTATGTGTGGTACTGCACACAATCATTATTAAGTGTTTTGACTAATTTTCAGAATTCTTCAATACTTTTAACCATTACTCTTACATGTCCATAACGTTGAGTCTTATAATAAAAGTTCTCTCTTAATTTTAGTTTTAAGATAGGTTAGCTTTTCACTTATACCATTGACATCCAGCAGAGAAAGATGGAGTGGGGGGGGCTTAGCAAATCAGTTGCACTGTCTTCATTTACCATTTCAGGATCTTCGTTTTTGTTATATTTGTTTCCTGTTTTGTCGGGCAATCCGTCGCTTAAAGAGAGCGAAATTATTTGCGCTGGTGCTTGATGAATTGTCCAGGAATCCTGTTTTCTTTGAACTTCGGGAGGGCTTGGTCTCTTTTTTGGATTTTATTTTACTCTCTGCCATTTCAAAGCAGTTAGGTCTTCGTCGGTGTCGCTCTCTGCTTGAGTATTAAAGACAATGATTGTTGAGTGCTTGTGTCGCACTTCCGTGCCTCAAGATATATGACCAAACAAAGACACTAGAATAATTCTAATTTGATATGACGTTTTGCAATAAACGAGTTAACATTTTTTTTATTTTTATAAATTTTTTGTTTTCTACTTCGTATTATTTTATGAAATATTTTTTCTCAGTGTAATGACTTCTTTTTCAGTTTTTTTTATATTCAATTTGATATCTTAAACAGCGCGCAATTTCATCATATTCTACGAAATTGGCCAAAACTCCCCAAATATGTATGTACATATGTAAATTCGTTACTGCGATCAGAATTGATTTCGGCCCGAAAATCGCCTTCTAGCACAACACGCACACATATACGCGTTCTGTCTTTTGTTTTTTACTCACACAAAGCAAGCAAATTCTATTTTTAGATTTCTTACGCTCAGCGTGAGCGAGCGGAAAGAGGAGGCACAATTTTGGCCGTCACCAAAAGTGGCTGCATAGTGCCAAACCAGTGTATGGCTGTTACGCATCTTATTATTCTAGTGTCTTTGATGCAGGCCATGTGACTTTTGCTTAAATGTGTACATACTTTCCAACACGCCACCTCAAAAGTAAGATTGCTTTTAATACTTTATTACTCACGAGACTGTGCACGTCCTTCTGACGAATAATTTGATCCAGCATTCGTTGCGAGGTGTTGGGGAGACCCAGAAAACCCAACCAGATCAATTGAACATATTATTTACATAAATTCAGTTTGCAAACTATTTTAACTAAAATTAATATTAGTCATCTTTGTAGAAACTCAAAATTATCCAGTAAACTTAATTAAATTTGGTTAAATGATGGATTAGTTTGAATTAGTTCAGTCTGGTTCCTCGTCAGTTCAATCTAAGAATATAATGTTTTAATTCATTCTGAGAGTCAAAGTCCACTTCTCAATGTAATGAATCACAGATAGTACCGGCAAGTTGTAAATTTGTAGATATATACAGTTTGTCAAAACTATTTACACGCCGTGAAATAAGTTGAATTTTTTTCACTTTAAAAAGGTCAAAATTAAGGGTTATTTCTTTAATTAAACGCAATTTTTTAATGAAATATAATTAAACAATATTTATTTTGCATATAAATTAAAAAACAAATTTCAAAATATCAAATATACAAAAATTAAACAACAAATTCCAAGTTTACACACTTTTTGAGAGTGGCAAAACTCCTTACACATTTTGTTTTTTCCTACTTTGTTTTATGCTTTTTCTTAGAACGAACTCGATTTTCCGTTATTTTTTTGGCATTTGCATTCCTTTTGCTGCTTCTATTTGAAATTTTTTACTTTGCTTGTGAAATTTTGCTGATCGAATGAGTTATTAAATTTAATAAAATGCAAATGATTAGCTTTTGAAGTGACCCAAATAATATACTAAAACCACCAGTTAGGAAAATCTATTCCAGAATTAGTATAAATGTTTTCTGTATCCCGTAAGACCGTCACAATGTTTTTAATCGCTTGAAAAAAGAGAACAGGCTTGAACCCACAAGAGTGGTGGGCGCAAAAGGCTAAAATTAGCAAGCGTGTAGACCGCCTTATTATGCGAAAAGTGATTGCGAACCCCAGATCTCAGTCAGATCACTTGCTCAGGATATCAGGCAAGGAATGTGACCCTAGTTGTGCCACACACAAAACTGTGCATAGAATCATTCTACGCCATAGGGTACTCTTCAAGAGTTGCAAAGAAAAAAGCCTTTGCTATCAGAGGTCAATATAGAAAAGCGTCATTCATTCGCTGTAGGCATGATGGATCATGCGGAAGAGTACTGGGATGACGTAATATTTTCTTGACGAAACAAAAATGATGCTCTATTATAACGATGGGCCAAGCAGAGTATGGCGCAAGCTGTTGAGTGCGCTAGAAAACAAAATATCATTCCAACAATCAAATTTGGAAAATTATCAGTGATGATTTGGGGCTGTATCTCAAGCCATGGAGTGGGCAAATTAGCCTTTAGTAGAAAGCACTATGATACCGTGCAATATCTAGATATTTTAAAATCAAATTTGAAGGCCAGTGCAGAAAAATTTGGTCTATTTAACAACAACAAGCCAAATTTTAAGTTTTATCAAGGACAATGATCCCAAACATAAAGGGGTGCAATGTACCAACTGGCTCCTTTATAACTGTGGCAAGGTGATCGATACGCCCCTCAGAGTCTTGATCTGAACCCCATTGAAAATTTGTGGGCCTACTTAAAGAAGAATGTGGCAAAAAGGGGCACCAAGAGCGACAACAGCTCATGGCTGCATTAAGTGGGAGAAAGATCCGCTTGAATATGACCTAAAAACTCATCCATTCCATGAAAAAAAAGCTTCAACTTGTAGCCAAAGCCAATGGGGTCATACTAAATACTACAACTTTTCAAATTTTAACAAAATGAATTTAAAAATTTAGGATTAAACTTAGGTTTAGTGTTTGTAAAGAGTTCTTGGGAAACTCTCAAAAGTCATTTAAACTTGGAATTCGTTGTTTATTTTCTTGTATATTTGATATTTTTGAATTTGTTTTAATTTATAAGTAAAATAAATATTGTTTAATTATATTTCCTAAAAAAATTGCGTTTAATTAAGCAAATAACCCTTAATTTGACCGTTAAGTCAAAATTCATCTTATTTCACGGTGTGTAAACGGATTTCTTGACAAATATACTATCCTGAATTTATTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTAGAGTGATGCCGAGTATAAAGTGATTCAGATCCGACATCAAGTGGGACCGCCTACTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTTGTGTTTTAGCTGTTCTTTTATTTGATCAATTTGAGGAACAGAGAAGGTCCCGCTCCATTCAGGGAGTAATTCGTCAATCCTCTTATGATCTACATACAAAGGTTTCTTAGCCTAAGTCGAGGAGCAGCGCTGCCGGCGCAACCTGCAGCACCAGCAACAGCTGCTGCGTATCTTATATATATGTATATATATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAGGAGGAATTAGTATAAGAGCACACATATAAGCGATCAGCGGCCAGCAGGAGGCTTGCTGACCAGGCAATTATGTATGTTAGCCCTCAAGTGGGTATGTTATTACGTATACACTTGTGCTGGACTGTTTATGTACACATTGCAACAGAGTGCTACAATTATGAATACACATAGGTACGGTGCTTAACCGATATGTGTGCATACTACAATGGTAGAAACAATTTGCTGACAATTCTAGAGTCGCAGAATCGCCATTTTTTCCTGAACTGTTAAAGAAGTGCAAAACTCACGGGCCAAAAAAACTCAATGCAATCGTATTGCCAAAGTTTAATCCTGAACGCAGGCAGACACTCAATCCTGGTGCGGAGACCAAGTCTACATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCGAGTACTCGAAACCATAGAAGTTGTATGATGTCGGCCGGTGTGTGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCATGGTTCTGCGCTGCAATCACGCGAGTTAATTGTGCGCCTGTTTCATGTAAATGGTGTTTATTATCTTGCGATTGTTGCAGCGGATAAACGCTGATAGCGCAGCGAGCGATCTGGAGAGGGAGGCGTTGCCAGATCAACCGTGTGATCAGTGTTTGTGTTGCGACAGTAGGGCGCGAAATTCAAAATTAAATTTAAAATTAAAGCCGTTGAAATTTAATTTAATTTAATTTTGATTCTGGTAACTGGGAGCGCACAAGTCTTTAAGAAAGGGAAAAGGCACAAAGGTCACGGACAGACCAAATATCGGCCCTCTCACCGTGCTGGTGCCTAAGCAGGGCTCTGGTGTCGAGTCGAGGCGGTACAAACCTCCATCCGTAAAAGCCAGGGGAAATCCGTGGCCTACGTGACCCTAGGTAACCTTAGAATGGCCATCCTTCAGTTGATGGACAGCGCAGTGGGGCAGTCCCCTGATCGCAACGACCCGTTCAGGAGGAGCTCCCGACTTTCGAGATCCCCACCAGAGGAGTCAGTAGCGACCCATGGTGACGGAATCTCAGTCCCGTCAGTGGCAAGGGGGGTGACACGCAGGCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGAGGTGGAGAAATTGGCTCCTACATCTACGGCGACAAGTCAGAGACGATGGACCATCGCCGTGCCATCGCAAAGACGGGAGGGAAGTCCCCAGCATTTCCCCTCATCGGTCTTCGGACTTGACCCTGCTCTCCAGAACGAGGACCTGAGAGGCATACTTACCAGGATGAATGGCAAGATCAACCCCTTCTATCCCGCATTCGAGACCCAACGACACACATGAAAGGGAGACAAAGGGGCATAGCTTCCGAACTCTCAGCCCTTAACAACAGGGCGATAGAGCTGTACGAAGGTACTACTAGCAGCACCGCTTGAAGAGCAGCGCTACCAGACGGAGGTACAAAGCCACCAAAAGGCTCTAAAATGCCAGGTACCACTTACAGTGCAGGTGCCAAAGTCCAGGCGCGCCGAAGCAGAGCAACCCACGTTGGATGGCAACGGTGAAGAAAGGCGACATCCATACCTAACGAGTCCAAGCCAGGCAGCTATGCATCTGTCGCCAGAATGCTAGCGCACGGGTGCAGAGGCACTCATCGTAAAAAGACGGGAGGCTTCGTACGCAGAGATGCTTCAGGCTAAGATCGGAATCGAGCCTTAGCGAACTGGGCAGTCACGTGCGAAAAAAAAAATCCGGAGAACGCAGAAAGGTGATCTGTTGCTTGAGGGTAGAGAGGGGAGAAAGCTTCCGGAAAGCGTTCCCCAAAGCAATACGCTAACTACACC
->43a7512d-b3a0-4b14-919c-a766c125bd9c
-TGGGCGAGGCAAAGTTTCTTGTGTGAACAGCGATCCGGGCAGTAGTGATGTGTAAGCATTGTTTTTTCAAATCCACAGAATATGAGAATATTTTTCTTTATAATGATGTTCTGAGTGTGGTATGACGAAACGTTTTATTGATTATTGCAGCACGGATGGACTTTGCATGTTAATAAGACATTTGAATAATAAAGGTGTTGCAATTTTGCACAGTCTGCAACGTCCTCTTTCTCAAAAACTACCCGTGTTCGCTTTATCCATACGTACGGTACCTGTTGCAAAGATTCCTATTTCCTTCGCTTAGAAATCAGGAAGGTTGGGGCATGAAAACCATTAAATAAAATACAGTTTAAAATTTTTGTCTTTGGGAAGACTTTCTGCCAAATATAGACAATAACTTATAAGATGATATTCCCAAACCATAAGAAGGAGAAATTACTTCAACATATAGCGTAAAATCATAAACCAATCCAGATATTCCAGCCGTAAAACGTTTTAGTTGTTTCGCGGGGTTTGGATTATATTGCTAAGCCTGGATCGACCATAACAACAAAAGCAATTATTAAAAATAAAAGCTAATTTAAAGAAAATTAAAACGTACTGGCACGGTACAATTATTTGCTCATCGACACTTAAGTGCTCGCTTCCGTTGGTTTCAAAATTTTCTTTGAATTCTGAAGCAAAGGGCGGATCTTGGTTATCGCCGTTACGTCGCTTTTAATTGTTTGGCGTTGTCGTTGAAATGTAAACATTGTTTTGTTTGATACCCGCGGCGATTGAATCAGTTAATGCGGTAATCTTTAAATAACGCGAATTTCTGATTGCGGTGGTTTTAAAACGCAAAGTACAATAAAATGCACCGATACGTTTCCTCATCCAGTACATTTAAAGTTCAATACCGTGCTCCTGCAAACTATATATATGCAGAGGTGGTCAAAAGTATTTTCACAACGCACAAAGCAAAAAACGAAAATATGCATACAGTTGTCAATAATTTTTTTTTTTTTTTTTTTATTTTCGTTTTTTTTTTTTTTTTTGCATGTTTTATTTTTTGCTTCGAAAGTATTGCGCACCGCTCCGGCAAATTTATTAAATTTCACGGCTTAACATCTAATTTCAACCGCGCCGAAATTTCTTTTATTTATATAAATACAATACTAATATTTTCTTAACACCACCTTTGGCATCAATAACTGCTTGAAGTCTTTTGGTATTGACCCTTACCAGATTTTGACGCAAATTCTAATGTCAATTTGGACCAAATCTCCGCTTATTTCAATGATGGCTCCCTCTCGTTTTCTATTTTTATCAATAGTTCGTTGGTTTTAATAAAGCCCAAACGTTTTCAATGATATTGGATAAGGCTTTGGGGGGTGGAAGAACTTCACTCAGATTAAAGATCGCGTTTAAAATTTTGAGTATCCCTACGCCGCCGGCGTAGACATTACATTACTGAAAAGTCATTCATTGTTGGAAAAAGTCGAAATTTTGAACGTAAAACATGGTTGTTTAAAGATAAGAGGAATATCCGTTCTGATTTAAAATTACCTTCTATCGGTACAAATCTCGAATCCATAACCGGGAAGAACTGCATGACGTACTTTACCAATCTATTGCGGTTGGCTGGGCTGCCAAAATCGCACGATTATTTTCAAATGCGCCAGAAATTGCTTTTCAGCGCGAAGCCCTGGTACTGAAATGCGAACTCATCAGTCATAAAATATTAACCAAAGTCGAAAGAGGCTGCCAATAACATATTCAAGCGCAAATCAGGAGCGAACTTTTGTTTTGTTGGTTACGTCGCCGATCTAATCGTTTTGCGAACAAAGTATGTCTTAAAATCAGCTTCTTTAGCCTGCGACGAATTGTAGAACTTCACCGCTTGTTTGCCAGTGTATTTTTTTGATTCTAAGAGCAATTTTACCGGACTGGCACTAGGATTCTTCGCCCACAACTCAAATATTGCCGCCATTGCTTGCTTTGGTTAGCACGGTTTTCGGCCTGATCTTTTTTTATTTTTTAATCATAGCCGAAACTTTATTAAGTAGTAGACAGTTGCCGAATTTGATATATTTCAGCTATTTTGGTACGGTAGCGCGACTTTAAACCGGCGGCTGTGCGGCTTGGGGCCTCAACTTTGTTAACTCTTTTTGTTTTGGGCGTTTTGTTTATGCTGTAATAGGGAAAATGATTAAAATCCGAATTTTTTTATTCAATAATTTAAAATGTATTTAAACAAACAAACTGACTTGTCTCTAAACCAATCACTGAAGAAAGAAAGTGTGCGTTTGGCGAAAATAATTTGGCGATGCACGACGAAACCATTATTGCAAATACTTCTGACAACTGATAAGACATCTCTTCATTTGCCTCTTCCTTGCGCATAAAGACAGTTATTTTTTCAATTCTTCTTTCATCGACTCTGCATAGGTTTGAATTTGCAAAACAAAGTTTTTTGCATTTCACCTCCACTTGCTGCACAAGCAACTGTTTGTGAGCAGCACGAAATACGCTTTGTGAAACAATTTTGACAACCGACAGCATGCAGTTTACATGCATTAAATGAATTAGCTGAGTATCAAAAGTGTGAAGAACTGCGGTGCAGTAACTGCATGTCCCCGACATCAAAGTTTTATCCTTCCCAAATACTCTGGAACTACAAACGTGCATTTCTCCGCCCCCAGCACTCTTTGGATCAATTTTCTCTAAGCAACTGTCAACAACAACGCAAAGTCAGGTTCACATCCTTCCAATCACTGTATTATTTTCCAGAAGGTCAATCGATACTCTCCCCTTTCAAGAATTCCTTCTAAATTCTTCTCCAGTACCGTAGAAATGTCTTTTCATCTCCTGCACTTTCTTCGTCAGTAGAAATATCCCAATCGAAGTTTAAATCCGTTCAATTTTCTTCGTTAGACAAACCTTTCACTTTCGGTGAAAATTATTATCACGAATACTTAAAGGAAGGTTGCTCACAAGCAAGCTTAAGAAAATTATTACTTACTTATTGTTCACTACTTACTAAGTTTGACTAAATCACTGTCTTGTTAACTCTTTGCTGTTTATACTTTAGGTTGCTTTTTTAAAGAGTATTATAAAAATGAAATTAATAATTCAAAAGTTGCACCGAATATCGAAACAATAATTATTGTGATGCGCGTGCTATTTATTGCAAATAATTCCTGCAATTAATAATCTCCAAACGTTTTTTTGCTTTTTTTATATTTAGAGTAGACACATAAAAGCACCGTTATCATAGAATCGAATAAAAACAAAGGCTGCCCACAGTTAGCTCTGAAAACATAGAAATTGCACAAAGCAACGTTGAGTGCGAAAGGTTGAGATTTGGTATCTTTCTACTATCAGTAGGCCAGTATGGAAGCTTGCCGGTTGAAAGTGTTGTTATGCTGTTGTTTACTATGCATTTTATTGCAGTTCAGCTTCCTTCGGAAGCTTAGCATTAAGTCACCTCCTACTACGCTTCCATATTCAAGGTTAGGATTTACTTGCATAATTTGTTTTACAAGTAACATTATCATGTTAAAGAATGGGGTATTTGTAAAGTTCAGACTGTTTTCCTAGTTGCTCTATTCTCTCCAGTGATGTGTTTGTTTTATTTCCTGCAGCAATTTGGGCATAGATTGATAATCGTTACTTTTGTTGGGTATATGTTGGCTTGATAGGCGGAACAAACTTTGCTGGATTCCTAAATCATTTTTACTCAGATCGGTATTTCTATTTTCTGTTTTTTTGGACAAAGAGTTCTGATTCTACACCCTTGTAGCTGGCGGCGTGTTCTTCGTAGCAGTTGGCACATTTGCTGGTTGTTCTCACCAGCCATTTTTCGGGCAAATGTTGCTTGGGTGTCGAGAAGAAGGATTTTACACAGCGGTACGTTTTGGTACAATATGATTTAGTATGTCCGAATTCCTGGCAGCTATAGCATTGAGAACGATTTCATTGTGGGGAGGCTCAATATTTTATTTACATTATATATGTCTAGGTTTTGTTAGGCAATATCTACATAAAAAAACATGTTCAGTGACGTTTTGGTCGCGGCTTTTAATATTACTTATGTTTCTAACAACGCTGACCTTTTGACTCTTCATCGCGAATTTCATCTAAATTTGTGGAAAAATCACCAAATTCTTAATAACAACTCTAAATGCTTTCTGCATCCTTAGCTGGTATGTGTGGTACTGCACACAATCGGCAATAAGTGTTTTGATAATTTTCAGAATTCTTCAATACTTTAACCATTACTCTTACATGTCCATAACGTTGGAGTCTTATAATAAAAGTTCTCTCTTAGGCATTTTAGTTTTAAGATAGGTTAGCTTTTTCACTTATACCATTGACGTCAGAGAAGATAGGTGGGGGGGGCTTAAGCAAAATCAGTTGCACGCATCTTCATTTACCATTCGAGATCTTCGTTTTTTTATATTTGTTTCCTGTTTTGTCAGGCAATCAGTCGCTTAAAGAAACGAAGTATTTGCGCTGGTGCTTGATGAATTGTCAGGGAATCCTGTTTTCTTTGAACTTCGGGAGGAGGGCTTGGTCTCTTTTGGATTTGTATTTTACTCTCTGCCATTTTCAAAGCAGTTAGGTCTTCGTCGGTGTCAGCTCTGCTTGAGTATTAAGAAGACAATGATTGTTGAGAATTCTTGTGTCCGCACTTCGTGCCTCAAGATATTAGAAAACAAGGAACACTAGAATAATTCTAATTTGATATGACGTTTGCAATAAACCAGTTAACATTTTTTTTATTTTATAAATTTTTATTTTTCCGCCATTATTATTTTTATGAAATGTTTTCTCAGTGTAATGACTTCTTTTTTCAGTTTTTTTTATATTCCAATTTGATATCTTAAACGGCCTTGCACTGTGGTTTCATCATATTCTGAAATTGGCCAAAACTCTAAATATGTATGTACATATGTAAATTCGTTACTGCGATCAGAATTGATTTCGGCGAAAATCGCCTTCTAGCACAACACGCACACATATACGCGTTCTATAGATGTTGTTTTGCTCACACAAGCAAGCAAATTCTATTTTTTAGATTTCTTACGCTCAGCGAGCGAGCGGAAAAGAAACTTCGAGTACAGCCGTCACAAAAAAGTGGCTGCATAGTGCCAAACCAGTGTATGGCTGTTACGCATCTTATTATTCTAGTGTCTTTGATGCAGGCCATGTGACTTTTGCTTAAATATTATTACATGCACTCCCAACACGCCACCTCAAAAGTAAGATTGCTGTACTTTTTTATTACTCACGAGACTGTGCATCGCTTCTGACGAATAATTTTTGATCCAGCATTCGTTGCGAGGTGTTACAGGGGAGACAGAAAAACCAACCAGATAATTGAACATATTATTTACATAAATTCAGTTTGCAAACTATTTTAACTAAAATTAATATTAGTCATCTTTGTGAAACTCAAAATTATCAAAGTAAACTGCAATTAAATTTGGTTAAATGATAGTTAGTTTGAATTAGTTCAGTCTGGTTCCTCGTCAGTTCAATCTAAGAATATAATGTTTTAATTCATTCTGAGAGTCAAATCCACTTCTCAATGTAATGAATCTTGCAGATGGTATTTTACCGGCAAGTTGCTTAAATTTGTAGATATATACAGTTTGTCAGAAACTATTTACACGCCGTGAAATAAGTTGAATTTTTCACTTCCAAAGGTCCAAAATTAAAAGGGGTTATTTCTTTTAATTAAACTTATGATTTTTAATGAAATATAATTAAACAATATTTATTTTACTTATAAGTGCAAAAACAAATTCAAAATATCAAATATACAAAGAAATTATTAACAAATTCAAGTTTACACACTTTTGAGTGGCAAAGAAACTCCTTACACACATTTGTTTTCCTACTTTGTTTTGCTCTTTTTCTTAGAACGAACTCGATTTTTTTCCGTTATTTTTTGGCATTTGCATTCCTTTTACAACGCTTCTATTGAAATTTTTTTTACTTTGCTTGAAATTTTGCTGATCGAATGAGTTGGCCATTTAATAAAATGCCTGGAAATAGATTGGCTTTTGAAGTGACCCAAATAATATACTAAAACCACCAGTTGGAAAATCTATTCCAGAATTAGTATAAATGTTTCTGTATCCGTAAGACCGTCTACAATGTTTTTAATCGCTTGAAAAAGAGAACGAGCGAACCTAAGAGTGGTGGGCTTAAAACTAAAATTAGCAAGCGTGTAGACCACTTATTATGCGAAAAGTGATTGCGAACCCCCCAGTCCTCGGTCAGATCACTTTACTCGGGATATCAGGCAAAATTGTGACCTAGTTGTGCCACACAAAACTGTGCGCCAAGTCATTCTACGCCATGGGGCGCTCTTCAAGAGTTGCAAGAAAAAAAGCCTTTGCTGAGGTCAATATGAAAGCGTCATTCGTTACCGCTGTAGGCATGATGGATCATGCGGAAGAGTACTGGGGTGTAATATTTTAATGACGAAACAAAAATGATGCTCTATTATAACGATGGGCCAAGCAGAGTATGGCGCAAGCTGTTGAGTGCGCTAGAAAAAAACAAAATATCATTCCAACAATCAAATTTGGAAGGTATCGGTGATGATTTGGGGGCTGTATCTCCAAGCCATGGGTAAGGCAAATTAGCCTTTATTGAAAGCACTATGAATGCCGTGCAATATCTAGATATTTTAAAATCAAATTTGAAGGCCAGTGCAGAAAAATTTGGTCTATTTAGCAACAACAAGCCAAATTTTAAGTTTTATCAGGACAATGATCCCAAGAGACTTATAAAGAGTGCAATGTACGCAACTGGCTCCTTTATAGCACTGTGGCAAAAGGTGTCGATACGCCCCTCAGGGGAGTCTTGATCTGAACCCCATTGAAAATTTGTGGGCCTAGCAAAATGTGGCAAGGGGCACCAAAGCACGACAACAGCTCATGGCTGCGATAGAGTGGAGAAAAGATCCGCTTGAATATGACCTAAAAAACTCATCCATTCCATGAAAAAAAAGCTTCGAAAAGCTTGTAGCCGAAGCCAATGGGGTCATACTAAATACTACAACTTTTCAAATTTTAACAAAATAATTTAAAAATTTAGGATTAAACTTAGGTTTAGTGTTTTGTGTAAAGAGTTTCTTGAAACTCTCAAAAGTGTTTAAACTTGGGTTGTTTATTTTCTTGTATGTTGATATTTTTGAGATTTGTTTTTTAATTTATAAGTAAATAAATATTGTTTAATTATATTTCCTAAAAAAATTGCGTTTAATTAAGCAAATAACCCTTAATTTTGACCGTTAAAATCAGGCTATGTATTTCACATGTAAACGGTTTCTTGACAAACTGTACTTGTCGCGAATTTTATTTTTAATTTCCATAACGACGTTTTCTGTTACTTTGTGTCGCTGTAAGTGATGCCGGTATAAAATTGATTCAGATCCGACATCAAGTGGACCGCCTCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTTGTGTTTTAGCTGTTTCTTTATTTGATCAATTTGAGGTGGGGGGGAAGGTCCGCTCCATTCGAGTAATTCGTCAATCCTCTTATGATCTACATACAAAGAGTTTCTTAGCCTAAGTCGAGAGCAGCGCTGCCGGCATAGCCGCAGCGCAGCAACACTATATGCGTATCTTATATATATATGTATATATATGTACTGTCGCCGACGATGGTGCTGGAGAAGTGGTATAGGCACACATATAAGCGATCAGCGCTTGGCCAGCAGGAGAACTTTGACCAGGCAATTATGTATGTTAGCCCTCAGAGTGGGTGCTCGTATTACGCCATACACTTGTGCTGGACTGTTATGTACACATTACGGCGGTGCTACAATTATGAATACACATAGGTACAGTGCTTAACCGTGTGTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTAGAATTGCTTTAGAATCGCCATTTTTCTGAACTGTTAAAGAAGTGCAAAACTCACAAAGAGACCCAAAAAAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCTGAACGCACAGGCTTAGACACTCAATCGATGCGGAGACCAGAAGAGTCACCATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCGAAATACTCGAAACCATAGAAGTTGTGTCGGCCCGGTGTGTGCGGCAAACTGGCAAAATCACGGTGGAGTCGCGCCATAGTTCTGCGCTGCAATCACGCGAGTTAATTTATTGCGCCTGTTTCATGTAAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAACAGCTGATAGCGCGGGCGATCTGGAGAGGCGTTGCCAGATCAACCGTGTGATCAGTGTTGTGTTGCGACAGTAGGGCGCGAAAATTCAAAATTAAATTTAAAAAATTAAGCCGTTGAAATTTAATTTAATTTGGTTTGATTCTACCAGTAACTGAGGGCGCACAAGTCTTTAAGAAAGGGGGAAAAGGCACAAAGGTCGCGGACAGACCAAATATCATCCTCTCACCGTGCTGGTGCCTAAGCAGAGAGGCTCTGTTGTCCGGTCGAGCGGTACAAACCTCCATCCGTACCAAAGCCGGAAATCCGTGGCCTACGTGACCTAGGTAACCTTAGGCCATCCCTTCAGTTGATGGACAGCGCAGTGGGGGCAGTCCCCTGATCGCAACGACCCGTTCGGGAGGAGCTCCCGACTTTCAAGTCCCCCACCAGAGGTCGGTAACCCGACCCATGGTGACGGAATCTCGGTCCCGTCGAGTGGCAGGGGTAACACGCAGGCCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGGAGGTGGAGAAATTGGCTCCTACAGCATCTACGACCGCGACAAGTCAGAAGACGATGGACCCATCGCCGTGCCATCGCAAAAGACGGGAGAGGGAAGTCCCCAGCTTGTTCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCCAGAACGAGGACCACAGAGGCATACTTACCAGGATGAATGGCAAGATTGGCCCCTTCTATCCGCATTCGAGACCCAACGACACACGCATGAGACAAAGGGGCACTTGGCTTCCGAACTCTCCGGCCCTTAACAGCAGGGGCGATAGAGCTGTACGAGAAGGTACTACTGGCGAGCACCGCTTGAAGAGCAGCGCCTTGCAGACGGAGGTACAAAGCCTACCAAAAGGCTCCACAAAATGCGCAGGTACCCACGGTGCGGGTGCCAAGAGATCCAGGCGCCGAAGCAGAGCAACCCTACGTTGGATGGCAACGGTGAAGAAAAAGGCGACATCCATACCTAACGAGGTCCAAGCCAGGCAGCTATGCCATCTGCTGTCGCCAAGAATGCTAGCGCGATTGCAGAAGGCACTCATCGTAAAAAAAACATCCTTCCATCCTTCCATTCCTTCCTCCATTCCTCCTCCCTCCTTCCATTCCACTCCTCCATTCCTCCTTCCATCCATCCATTCCCTCCACTCCATTCCTTCCTTCCTCCTCCATTCCTTTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTCTCT
->b4be134a-fbda-489a-974b-7c093f2c5a30
-TTGTTGTACTTCGTTCAGTTACGTATTGCTTCAAACGCTACATTGGCATTTTATTGTACTTTGTGGTGTTTTTAAAACTACCGCAATTCAGAATGGCGTGGTCAAAGTATTTAAAGATTACCGCAATAACTGATTCAATGCCGCGTTTGATTTCCTCATCGAGTACGATTTTAAGTTCAATACCGTGCTCCTGCAAACTATATACAGAGGTGGTCAAAAGTATTTTCACAACGCACAATATTTGCAAACTTCAACTTCTTTTTTGTTATATTTCTTCTTGTTGTTGTCCGATTTGCCTGGGAAATAGTTCTTATCAGCAAGCTTGATCTATGCAGAAGGTAGTCGAAATACCGCGAAGATAACGGTTCATGAGTACAAAGCTTAAAGCAAAAGAAATATGCATGCAAGTTGTCAATGAGTATTTTCACATGTTTATTGCGCTTCAAGTATTTCACTCAACTTAATTTAGTAAATTTCGAGCAACATCTAATTTCAACATAAGAATTTCTTTATTTTATATAAATACAATGCTAATATTTTGTAACACCACCTTTGGCATCAATAACTGCTTGAAGTCTTTTTGGTATTATTGCTTACCAAAGTTTGTGCAAATTCTAATGTCAATTTGGACCAAATCCTCCGCTATTTCAATGATGAAAACCACTCGTTTTCTATTTTTATCAATAGTTCGTTGGTTTTAATAAAAGCCCAAACGTTTTTCAATGATATTAAGGTCTGGGCTTTGGGGGGCCACGGAAGAACCGCCAGATTAAAGGTCGTTTAAAAAATTTTTTGTTGGTATCTGCTACCCTTATGGCATGGAGCATTGTCCTGCTGAAGGAGAATCCATTCAGTAGTTGGAAAAGTCTATTTCAGGCCCGTAAAAGCATGGTTGTTTAAGATAAAGAGGTATCCGTTCTGATTTAAGTACCTTCTATCGGTACCAAGTCTCGAATCCATAATAGGAAAGACATCCCCAAAACATGACTGTGCCCCACCAAATCTATTGGTTGGCTGGGCTGCCAAATGCTTTTGATTATTTTTTCAAATGCATACAAAATGCTTGCTAATATGACCCTGGTACTGAAATGCAGACTCATCAGTCCATAAAATATTAAACCAAAGTCAAGGAGGCTTCTTAACGTATTCCAACGCAAATCGAAGACGTTTGTTTTTTGTTGTTGGTTGGTGTGATCTCAATCGTTTTGCGAACAAAGTATGTGTCTTAAAATCAGCTTCTTTTTTAGCCTTACGACGAATTGGCAGCCCAGAACTACTAGCTTGTTTGCCAATTGTATTTTTTGATTCTAAGGCAATTTTTTACCGGACTGGCACTGATTCTTCGCCACAACTCAAGTATTTTACCTGCCATTGCCTTTTGAAGTCCAGCACAGGTTTTCGGTACGATCTTTTTTTATTTTTTTTAATGTGCCAGCTGTATCAAACTTTTTTATTAGAAGTGGTAGACAGTTCTACGCGAAATTTGATATATTTCAGCTATTTTGGCCGCAAGGTGTACCGGCTTTAAACCTAGCAACAATACCAGCCCGGGCCTCAACTGTTAACTCTTTTTGTTTTTTTGGGCATTTTTTATTTAATAGCTGGCGGTAGTTAAATCCTAATTTTTTATTCAATAATTTAAATGTATTTAAGCAACAGAGCGGCACTTGTCACTCTAAAACCAATCACTGAAGAAGAAATTGCGTTGTAGAAATAATTATTGTGATGCGACGAGGAAGCCGTGTGCAAATGCTTCCTGACAACTGATAAAGATCTCTTCATTTGCCTCTTCTACGCGCATAGGAACAGTTATTTTTTTCAATTCTTCTTTTCATCTGACTCTGCATAGGTTTGAGATTTGCAAAGCAAAGGGATTTTTTGCATTTCACCTCCCCGCGCTGCACAAACGGCTTTGTTTGTGACCCATGCACAAAATGCACTTTGTGAAAATAATTTTGACCATGACTGTATATCAGTTTGCCTAGCCATTAAATGAATTAGCTGAGTATTATCAAAAAGTGTAGAAGAACTCCACGTCCTCAGCGCATGATACGACATCAAAAGTTTTGTCATCTTCCCAAATACTCTCTGGGGCTACAAACGGCCTTGTTCTCCCACTTTAGCCTCTTTGGATCAATTTTCTCTAAGCAACTGTCAACGAAAGCAACGCACAAAGAGTCAGGTTCACATCCTTCAATCACTGTATTTTTCCAGAGGTCAATGTCGATACTTTCTCCCCGCGCCAAAATTCCTTCTAAAATTCTTCTCAGTACCAAATGAAATGTCTTTTCATCTCCTCACCGCATTCAGTGAAATATCCCAATCGAAGTTTAAATCCCGTTCAATTTCTTCGTTAGACAAACCTTTCACTTTCAGTGAAAATTATTATCGATACTTAAGGTTGCTCACAAGCAACTTAGAAAATTGTTACTTACTTATTGTTCACTACTTACTACTAAGTTTATTTAAATCATATCTTGTTAACTCTTTGCTGTTGATTTTATACTTTGGAGTTCTTTTTTAAAGAAGTATTATTATAAAAGTAAATTAATAATTCCAAAAAGTTGCGAATATCCAAGAAACAATAATAATTATTGTGATGCGCGATGCTATTTATTTACAAGTAATTCCTGCAATTAATCTCCAAATGCGTTTTGCTTTTTTTTATATTTAGAGTAGACACATAAAAGCACCGTTATCATAAAGAATCAGCAGATAAAAACAAAAGAGCACACACTAGTTAAGCTCTGAAAACATAGAAATTGCTCACAAAGCAACGTTGGGTACAGAAGGGTTAAGTTTGGTATCTTTCTATCAGTAGGCTTCAGTATGCTTAGGCTTTGCCGGTTGAAGTGTTGTTATGCTGTTGTTTACTATGCATTTGTACAGTTCGCTTCCCTTCGGAAGCTTAGCGTGAAGTCACCTCCTACTACGCTTCCATATTCAAGGTTAGGATTTACTTACCAATTTGTTTACAAGTAACATTATCATGTTAGTAAATTATTTGTAAGTTCAGACTGTTTTCCTAATAGTTGCTCTATTCTCTCCAGTGATGTGTTTGTTTTGCTATTTCCTGCAGCTTAATTTGGCATAAGATTGATAATCGTTACTTTGTTGGGTATATGTGGCTTGTTAGGCGGAACAAACTTTGCTGGATTCTAAATCATTTACTCAGATCATTATTTCTGGCCCTTTTCTATTTTTTTTTTTTTTGGACAAAGAGTTCCTGATAAATTCTACACCCTTTGTAGCTGGCGGCGTGTTCTTCGTAGCGAGTTGGCACATTTTGCTTTGGTTGTTCGCCATTTTTTTTTCGAACGAAATGTTGCTTGGGTGTCGAGAGGATTTTACGTTTTGAGGGTACAATATGATTTAGTATGTCGAATTCCTGGCAGCTATAGCATTGAACATTTCATTATTGGGGGGGAGGCTCAATATTTTATTTACATTATATATGTCTAAGGTTTTTTTTTGTTAGGCTCCAATATCGTTACATAAAACATGTTCAGTGATGACGTTTTTGGTCCGCTTTTGGCTTTTAATATTACTTATGGTTTCTAACAACATGACCTTTTGACTCTTCATCACTTTTAATTTCATCTAAATTTGTGGAAAAATGCAAATTCTTAATAACAACTCTAAATGCTCTGCATCATCCCTTAAGCTGTGGTATGTTGGTACTGCGCACAATCGGTATTAAAAGTGTTTTGACTAATTTTCAAATTCTTCAATACTTTTTTTAACCATTACTCTTACATGTCCATAACGTTGGAGTCTTATAATAAAAGTTCTCTCTTAATTTTAGTTTAAGATAGGTTGAAAACTTTTTCATATACCATTGACGTCGGAAAGATAGGTGGGGAAAACTAGCAAAATCAGTTGCACTGTCTTCATTTACCATTTCGAGATCTTCGTTTTGTTATATTTGTTTCCTGTTTTGTCCAGGCAAATCCGTCGCTTAAAGAGAGCGAAATTATTTGCTGGTGCTTGATGAATTGTCCAGGGAATCCTGTTTTCTTTTGAACTTCGGGAGGGCTTGGTCTCTTTTTTTTGGATTTTTATTTTACTCTCTGCCATTTCAAAGCAGTTAGGTCTTCGTCGGTGTCAGCTCTGCTTGAGTATTAAGAAGACAATGATTGTTGGTACTTATTAATCCGCACTTCGTGCCCCTCAGATATGACAAAGCAAAGAGACACTAGAATAATAGTCCCCTAATTTGATACTTATGACGTTTGCAATAGAAGCAGTTAACATTTTTTTTATTTTATAAATTTTTATTTTCTACTTCGTATTTTTTTATGAAATATTTTTTCTCCAGTCTTAATGGCCCGAGCTTCTTTTTCAGTTTTTATATTCAATTTGATATCTTAAACGCCTGTTTCATCATTCTACGAAATTGAAACAGAAACTCCCAAATATGTATGTACATATAGCAAATTCGTTACTGCGATCAGAATTGATTTCGGCCCGAAATCGCCTTCTAGCACAACACGCACATATACGCGTTCTCGTCTTTGTTTTACTCACACAAGCCAAGCAAATTCTATTTTTTTACTGAATTTCTTACGCTCAGCGTGAGGCAGCGGAAGAGGCAATTTGGCCGTCTCACCAAAAGTGAAAGCATGAGTGCCAAACCAGTGTAAGCTGTTACGCATCTTATTATTCTAGTGTCTTTTGATGCAGGCCATGTGACTTTTGCTTAAATGTGTACATACTTTCCAACACGCCACCTCAAAGTAAGATTGCTGTACTTTTTGTACTCACGAGACTGTGCACGTCAGCTTCTGACGAATAATTTTTTGATCCAGCATTCGTTGCGAGGTGTTGGGGAGACCCGAAAACTCTAACTTGAATCAATTGAACATATTATTATTTACATAAATTCAGTTTTGCAAGAGCTATTTTTTAACTAAAATTAATATTATTAGTCATCTTTGTAAGAAACTCAAAATTATCAGTAAGCTTAATTAGAGATTTGGTTAAATGATAGTTAGTTTAGTTAGTTCAGTCTGGTTCCTCATCAGTTCAATCTAAGAATATAATGTTTTAATTCATTCTGAGGAGTCAAAGTCCACTTCTCAATGTAATGAATCTTGCAGATGGTACCGGCAAGTTGTAGAATTTGTAGATATATACAGTTTGTCAAGAAACTATTTACACGCCGTGAAATAGAAGTTGAATTTTTCACTTTAAAGGTCAAAATTAAGGGTTATTTCTTTTAATTAAACGCAATTTTTTAATGAAATATAATTAAGCAATATTTATTTTACTTATAGAGATTAAAACAAATTCAAAATATCAAATATACAAGAAGTAAACAAATTCAAGAGTTTACACACTTTTTGAGGTGGCAAGAGGAAACTCCTTACATTTTGTTTTCCTACTTTGTTTTGCTCTTTTTTGTAGGCGAACTCGAGATTTTTCCAGGTATTTTTTGGCATTTGCATTCCTTTTTTTACAACGCTTCTATTGAAATTTTTTTACTTTGCTTTGTGAAATTTTGCTGATCGAATGAGTTATTAAATTTAATAAAATTAACACCAAATAGATTAGCTTTTGAAGTGACCCAAATAATATACTAAAACCACCAGTTAGGAAAATCTATTCCAAATTGGTATAAATGTTTCTGCAGCTCCGTAAGACCGTCTACCACAATGTTTTTTAATCAGCGAGAAAGAGGCTTGAACCTATAAGAGTGGTGGGCGCAAAACTAAAATTAGCAAGCGTGTAGACCGCCTTATTATTATGCGAAAGTGATTGCGAACCCCCGAATCTCCGGTCAGATCACTTGCTTGCTCAGGATATCAGGCAAAGAATGTGACCCCTAGTTGTGCCACACAAAACTGTGCGCCAAAGTCATTCTACGCCATAGGTACTCTTCAAGAGTTGCAAGAAAAAAGCCTTTGCTATCAGAGGTCAATATTATAGAAAGCGTCATTCATTCGCTGTGAGCATGATGGATCATGCGGAAGAAGGGAAGTACTGGGATGACGTAATATTTTGTGACGAAACAAAAATGATGTGCTCTATTATAACGATGGGCCAAAGCAGAGTATGGCGCAAGCTGTTGAGTGCGCTAAGAAAAAACAAAATATCATTCCAACAATCAAATTTGGAAAATTATCCACAATTGATGATTTAAGGGCTGTAATATAAACCGTAGGTGGGCAAATTAGCCTTTTATTGAAAGCACTATGAATGCCGTGCAATATCTAGATATTATTTTTTAAAATCAAATTTGAAGGCCAGTGCAGAAAAATTTGGTCTGTTGCTTAACAACAAGCCAAATTTTTAAAGTTTTATCAGGACAATGATCCCAAACATAAAGGTGCAATGTACCCAACTGGCTCCTTTTATAACTGTGGCAAGGTGATCGATACGCCCCCTCAGAGTCTTGATCTGAACCCCATTGAAAATTTATTGGGCCTACTTAAAGAAGAATGTGGCAAAAGGGGCACCAAAACACGACAACAGCTCATGGTAACCTGCGATAGAGTGGGAAGGTCCCGCTTGAATATGACCTAAAAACTCATCCATTCCATGAAAAAAAAGCTTCCAACTTGTAGCCAAAGCCAATGGGGGTCATACTAAATACTACAACTTTTTCAAATTTTAACAAAATAATTTAAAATTTAGGATTAAACTTAGGTTTAGTGTTTTGTGTAAGGTTTCTTGGAAACTCTCTCAAAAGTCATTTAAACTTAGATTCGTTGTTTACATTTTCTTGTATATTTGATATTTTTGAATTTGTTTTTAATTTATGATAAAATAAATGTTGTTTAATTATATTTCCTAAAAAAAAATTGCGTTTATTAAATGAAAATAACCATGGTACGATACGTTAAAAATCAAAAATTCATCTTATTTCACGGTGTTAATGTAAAACAGTTTCTTGACAAACTGTACTTGTCGCAGATTTATTTTTTTAATTTCAGAGTTAACGACCGTTTTCCTTACTTTGTGTCCGCTGTGAAAGTGATGCCAGTATATAAAGTGATTCAGATCGACATCAGAAGTGGGACCGCCTACTCCAACTTCCTGTAGTTTTCATTGTGTCATAGATCATTTGTGTTTTAGCTGTTCTTTATTTGATCAATTTGAGGAACAGGAAGGTCCGCTCCATTCGAAATTAATTCGTCAATCCTCTTATGATCTACATACAAAGGTTTCTTAGCCTAAAGTCGAGGGAACAGCGAGGCATAGCCTGCAGCGCAGCAACGCTATATCGTATCTTATATATGTATATATATATATGTACTGTCGCCGAGCGATGGTGCTGGAGAAGTGGTATAGGCACACATATAAGCGATCAGCGCTTGGCCAGCAGGAGAACTGCTGACCAGGCAATTATGTATGTTAGCCCTCAAGTGGGTGCTCGTATTACGTATACGCGGCTATTGCTGGACTGTTTATGTACACATTGCAACAGAGTGCTACAATTATGAATACATAGGTACAATGCTTAACCGATATATTATTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTAGAGTCGCAGAATCGCCATTTTCTGAACTGTTAAAGTGCAAAACTCACAAAGAGACCAAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCTGAACGCACGGTAGCAGACACTCAATCCTGGTGCGGAGACCGAAGTCTACATCGTGAAGACGGACGTCTTAAATTACGCGGCGCAGAAATGCTCGAAACCATGAAGTTGTCGAGCCGGTGTGGTGCGTATTTTGGCAAAATCGCACGGTGGGTCGCCATAGTTCTGCGCTGCAATCGCGCGAAGTTAATTGTGCGCCTGTTTCATTAGCAAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAGCAGCTGATAGCGCAGCGGAGCGATCTGGAAGGCGTTGCCAGATCAACCGTGTGATCCAGTGTTGTGTTGCGACAGTAGGGCGCAGAAATTCAAAATTAAATTTAAAATTAAATACCGTTGAAATTTAATTTAATTTAATTTTTGATTCACCATAGTAACTGGGGTACCTGGGAAGTCTTTAAGAAGGGAAAAGGCACAAAGGTCGCGGACAGACCAAATATCATCCCTCTCACCGTGCTGGTGCCTATAAGCAGAGCTCTGGTGTCGAGTCGAGGCAATTTACAAACCTCCATCCGTAGTAAGAAGCCAGAAATCCGTGGCCTATACGTGACTGGGTAACCTTAAGGTATCAACTGGTTGATGGCGCGGTGGAGGCAGTCCCCTGATCGCAACGACCCGTTCGGGAGGGCTCGACTTTCAGATCCCCACCAGAGTCAGTGGCAAACCCATGGTGGCGATCTGTTGTCCGTCGATGGCAAGGGTGACGCAGGCCCCAGCCGCGTGACTATCGACTGCAGCGATACTATTAAGAGGTGGAGAATTGGCTCCTACAGCATCTACGACGCGACAAAGTCCAGAACTGATGGTTACATCGCCGTGCCATCGCAAAGACGGAGGGTCCCCAACGATTTCCCCTCATCGGTCTTCGGACTTGACCCTTACTCTCAGAACGGAACCTGAGGGCATACTTACCAGGATGAATGGCGGTCAATGCTATCCACATTCGAGACCAACGACACACTTAGAGACAAAGGGCAACTTCGAACTCTCAGCCCTTAACAACAGGGCGATAGAGGCTGTACGAAGGAATTACTACTAGCGAGAGCACCGCTTGAAGAGCAGCGCTACCAGACGGAGGTACAAGCCTACCAAAAGGCTCCACAAAATGCGCAGGTACCCACGGTGCAGGTGCCAAAGTCCAGGCGCCGAAGCAGAGCAGCCAGACCGGATGGCGGCGGTGAGAGAAAGGCGACATCCATACCCTAACCACGAGTCCAAGCCGAGCGGCTATGCATCTGTCGCCAAGAATGCTAGCACGAAAGGGTGCAGAGGAGCAATACGGCAAA
->a58e3c7c-b22e-48f5-a91d-8f3e3ff2937a
-TTGTTGCTTCGTTCGGTTACGTATTGCTACTCGTTGGGGTATGGATGCCTTTTCTTCGTTGCCATCCCAGCATTGGGGTTGCTCTGCTTCGGCGCCTGGACTTTGCTTTTCGCACCGTGGTACCTGCGTTTTGTGAACCTTTTTGGTAGGCTTTGTACCTCGTCTGGGTAGCCGCTGCTCATCTTCAAGCGGTGCTCATGATAGTACCTTCGGCTGGCTTCATCGCCCTGTTGTTGGAGCTGAAGAGTTCAAGCTATGCTTGTCTCTCATGTGTGTCGTTGGGTCTCGAATGCGGATAGAAGGGGCTGATCTTGCCATTCATCCTAGTAAGTATGCCTCAGGTCCTCTGGAAACGTGGTGGGGTCGAAGACCGATGGGGAACAATGGGGACTTCCCTCCCGTCTTTTGCGATGGCACTGACGATGTGGTCCATCGTCTTCTGACTTCCATCGCGGTGTGAATGCTGTGGAACCAATTTCTCACCTCACAGCATCGCTGCAGTCGATAGTCAGCGGCTGGGGGGCAGCCTGCGTGCTCACCTGCCACCGACGGGACCGAAGTTCCGTCACCATGGGTCAGGTTACCGACTCACTCTGGTGGGGGATCTCGAAAGTCGGAAACTCCTCCTGAACAGGTCGTTGCGATCTGGGGTTACCCCCACTGCGCTGTCCATCCTGAGGATGGCCTAAGGGTTACCCAGGTCACGTAGGCCACGGATTTCCCCTGGCTTTTTACGGATGGAGGGTTTGTACCGCCTCGACTCAGACACAGAGCCCTGCTTGAGCGCCAGCACGGTGAGGAAGGGATGATGTTTGGTCTGTCCGCGACCTTTGTGCCTTTCCCTTTCTTGAGACTTGTGCGCTCCCAGTTGCCAGAATCAATTAAATTAATTAAATTTCGGCTTAATTTTAAAATTTAATTTTGAATTTCGCCTCCCTACTGTCGCAACACAACACTGATCTACACGGTTGATCTGGCAGCGCCTCCCTCTCCCAGATCGCCCGCTGCGCTATCAATACATCCCTGCAACAATCGCAGATATTAAATTGCCTATTTACGCCAGAACAGGCGCACGAATTAACTCGCGTGATTGCCGGCGCGGAACTGGCGCGACTCCACCCGTGTGTTTGCCGGTTGCCGCACACTACGGCCGGCACAGCTTCTATGGTTTCGGTGTTTCGCGCCGCGTGATTTAAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCCGCGCAGGATTGGTGTCTAAGCCTGTCGTTCAGAGGATTAAACTTGTGGAAATCACACGGTGGAGTCGCGCCATAGTTCACGCTGCAATCACGCAGTTAATTGTCGCCTGTTTCATAAATGAACGGTTTAGTATCTTGCGATTGGTGCAGCGGATAACAGCTGATAGCGCGGCGGGCGATCTGGAGAGGGAGGGCGTTGCCAGATCAACCGTGTGATCAGTGTTGTCGACAGTAGGGCGCGGAATTCAAGAATTAAATTTGGAATTAAGCCGTTGAAATTTGTTTAATTTGGTACCGAAGTTGACTTTAGGGCGCTGGGTGCTTTAAGAAAGGAAAAGGCACAAGGTCGCGGACAGACCAAATATCATCCTCTCACCGATGCTGGTGCCTAAGCAGAGCTCTGATTCACG
->3d54824f-85e6-445b-a7ef-2829abb55882
-TTGTTATTGCTTCCGTTCAGTTACGTATTGCTACGTAGGGTTGCTCTGCTTCGGCGCTGGACTTTTTAACCTGCACCGTGGGTACCTGCGCATTTTGTGGAGCCTTTTTGGTAGGCTTTGGCCTCCGTCTGGGTAGCGCTGCTCTTCAAGCGGTGCTCGCTAGTGAGCGCCACCTTCGTACGAGCTCCTATCGCCCTGTTGTTGGGGCTGAGAGTTCGGAAGCTATGCCCTTTGTCTCTCATGTGTCGTTGGGTCTCGAATGCGGATAGAGGGGGCTGATCTTGCCATTCATCCTGGTAAGTATGCCCCTCAGGTCCTCGTTCTGGAGAGAGCAGTGGTCAAGTCCGAAGACCGATGAAGGCTCAGCTGGGAACTTCCCTCCGTCTTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCTGACTGTCGCGGTCGTAGATGCTGGCAGGAATGAATTTCTCCCACCTCTACAGCATCGCTGCAGTCGATAGTCAACGGCGGCTGGGGGCCTGCGTGCTCACCCTTGCCACCGACGGGACCGAGATTCCGTCACCATGGGTCGGGTTACCGACTCTGGTGGGGATCTCGAAAGTCAGGAGCTCCTCACGAACGAGGTCGTTGCGATCGGGGGGGACTGCCCCCACTGCCTTTGTCCATCGCTGAAGGATGGCCTAAGGTTACCCCTAGGTCACGTAGGCCACGGATTTCCCCTGGCTTTTACGGATGGAGGTTTGGTACCGCCTCGACTCGGACACCAGAGCCTCTGCTTGGGGCACCAGCGGTGAGGGATGATATTTGGTCTGTCCGCGACCTTTGTACCTTTTCCCCTTTCTTAAAGACTTGTGCGCTCCCAGTTACCAGAATCAAAATTAAATTAAATTAAATTTCCAACTGGCTTAATTTTAAATTTATTTTGAATTTACCTACTGTCGCAACACAACGCACTGATCACACGGTTGATCTGGCAACGCCTCCCTCTCAGATCGCCCGCTGCGCTATCAATGTTTATCCGCTGCAACAATCGCAAGAGATAATAAATTACTATTTACATGAAACGGAGCGCACAATTAACTTTCGCGTGATTGCAGCGCAGAGACTATGGCGCGACTCCACCGTGTGATTTTGCCAGTTTACCGCACACACCGGCCGACACAACTTCTATGGTTTCGAGGTATTTCGCGCCGCGTAATTTAAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCCGCACCAGGATTGAGTGTCTAAGCCTGTGCGTTCAGAGTTAAACTTTGGCAATACGACAGCATTGAGTTTTGGGTCTCTTTGTGAGTTTGCGCTAACGCAACAGTTCAGAAAAATGGCGATTCTGCGACTCACAGAATTGTCAACAAATTGATTTTTTCACTATTGTATGCACACATATCGGTTAAGCACTGTACCTATGTGTATTCATAGTGTAACACTCTGTTGCAATGTGTACATAAACAGTCCAGCACAAAATTGTATACGTAATACGAGACACCAGCGAGGGGCTAACATACGCCAATTGCCTGGTCAGCAGTTCTCCCGCTGGCCAAGCGCTGATCAACTTATATGTGTGCCTATACCCGCGCCTCCTCCAGCACCATCGCTCGGCGACAGTACATATATATATACATATATATGAGATACGCATATAAGCGTTGCTGCGCTGCAGGCTATGCCGGCAACGCTGCTCCTCGACTTAGGCTAAAGAAACCTTTGTATGTAGATCATAAGGAGGGATTGACGAATTAATTTCGAATGGAGCGGGACCCTGTTCCTCAAATTGGATCAAATAAAGAACAGCTAAAACACAAATGATCTATGACACAGTAAGAACTACAGGAAGTTGGAGTAGGCGGTCCCACTTCGATGTCGGATCTGAATCACTTTATACTCGGCATCACTTTCTGTGGACCTGAGTAACAGAAAACGGTCGTTAACTTGGAAATTAAAAATAAATCTGCGACAATTACAGTTTGTCAAGAAACTGTTTTACACACCGTAAAGAAATAAGATGAATTTTTTGATTTTAACGGTCAAAATTAAAAAAAGTTATTTGCTTAATTAAACGCAATTTTTTTTTTTAGGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAAACAAATTCAAAATATCAAATATACAAGAAAATAAATAACAAATTCCAAGTTTACACACACACTTTTGAGGAGTGTCACTCTGCCCAAACCGTCATCTCTGGGATGAGCTGATGGGATCCACCTCCCCCGTCGCGAGCAATGTCCGTAACTGG
->8c332fe5-d0cf-412e-bd09-b3c543fb6659
-TTGGTACTTCGTTCAGTTACGTATTGCTCCCAAGCCATAAGGAAGGAAATTGGCTTCTCCAACATGTATCAAATCATAAACTAATCCAGATATTCCAGCCCGCGTAAACATTTTAAGACCCATTTATGAGGTTTGGATTATATTGCCTAAGCGTGGATCGACCTGCAACAAAAGCAATTATTAAAAGAAATAAAGCTAATTTAAAGAAATTAAAGCAATACCTTTGAATGCAATTATTTAGCTCATCCTGACACTTTGATGCTCTTATAGATTGTTTTCCAAATTTTTCTTTGAATTCTGGGCAAAGGGGCGGATCTTTATACGAAGTTTATCATAGTTGCAATCCTTTTTTGTTGTTTGGCGTTGTCGTTGAAATGTAAGCATTGTTTTATTTTTTAAATCTCCCACGCGGCATTGGATCAGTTATTGCGGTAATCTTTAAATACTTTGACCACGCCATTCTGAATTGCGGTAGTTTAAAACACCAAAGTACAATAAAATGCCAATGTAGCGTTTGATTTCCTCATCGGTGATTACATTTAAGTTCAATGCCATGCTCCGCCACCAAACTATATACAGAGGTGGTCAAAGTATTTTCACAACCTTACAATATTTTACCAAACTTCAGCTTCTTTTTGTTATATTTCTTCTTGTTGTTGTGCGGTTGCACAAGGAAATAGTTCTTATCTTGGCTTGATCTATGCAAGAAGGTAGTCGAAAAGAAATGCAGAAAGATAACTTGGTTCATGGTACAAGCAAAGCAAAGAAATATGCATGCAAGTTGTCAATAGTATTTTCACATGTTTTATTTAAACTTCAAAGTATTTTCCTCTAACTTGAATTTAAATGGGAATTTCGAAAACAACATCTAATTTCAGCATAAAATTTCTTTGTTTTATATAAATACAATACTAATATTTTGCTTAACACACCACAGCTGGCATCAATAACTGCTTGAAGTCTTTTGGTATTATTGTACCAAAGTTTGTGGAAATTCAATGTCAATTTGGACCAAATCTCCCGCTATTTCAATGATGGCTCCCTCTCGTTTCTATTTTATCAATAGTTCGTTGGTTTTAATAAAGCCCAAACGTTTTCAATGATAGTAAAGGTCTGGAGCTTTGGGGGCCACGGAAGAACCGCCAGATTAAGGTCGTTTAAAATTTTGTTGAGTATCCTACCCTTGTATGGGCATTGTCATGCTGAAGAATCCATTCAGTAGTTGGAAAAAGTCTATTTCCAGACGTAAAGCATGGTTGTTTAAGATAGAAGGTATCCGTTCACAGTTTAAAGTACCTTCTATCGGTACCAGTCTCGAATCCCATAATAGGAAAGACATCCCAAAACATGACTGTGCCCCCACCAAATCCTATTGGTTGGCTGGGCCAATCTTTTGATTATTTTCAAATGCATAAAATGTACCAACCTGACCCCTGGTATGATACAGACTCATCAGTCCATAAAATATTAAACCAAAGTCAAGAGGCTTCATAACATATTCCAACACCAAATCAGAAGACGTTTTGTTGTTTGCTGAGTTGAGTGATCCTCAATCGTTTACCCGAACAAAATTAATGTCTTAAAATCCTTGGCTTCTTTTAATACCGACGGTGTAAGAACTACTAACTTGTTTTGCCAGTGTATTTTGATTCCTAAGGCAGATTTTACCGGACTGGCTTTCGGATTCTTCGCCACAACTCCAAGTATTTGCCCTGCATTGCCTTCTGGTCCAGCACAGGTTTTCGGCCTGATCTTTTATTTTTAATTGCCATGTATCAAACTTTTTTATTAAGTAGTATTAGACAGTTCTACATAAATTGATATATTTCAGCTATTTTGGCCGCAGGTGCCGGCTTTAAACCTAGCTTAACAATGCAGCCCGGGCCTCAACTGTTAGCTCTTTTTTGTTTTGGGCATTTTATTTAGCCAACTGTAATAGGAAAATGATTAAATCTAATTTTTTATTCAATAATTTAAATGTATTTAAGCAAACAGAGCCAGCACTTGTCACTCTAAACAATCACTGAAGAAGAAATTGCGTTGTAGAAATGGTGTGATGCGACAAAGGCAAGTGTGCAAATGCTTCTGACAACTGATAAGATCTCTCTTCATTTACCTCTTCCTTGCGCATAGAACAGTTATTTTTCAATTCTTCTTTCATCCTGACTCTGCATAGGTTTGAATTTGCAAAGCAAAAGTTTTGCATTTCCTCCACTTGCTGCACAAGCAACTGTTTTGTGACCATGCACAAAATGCGCTTTGTGAAAATAATTTTGACCATGACTGTATATCAAGTTTGCCTAGCCATTAAATGAATTAAGCAGGTATCAAAGGGTGTGTAGAAGAACTCCACAGTCGTCTTTATGTCCCCGACATCAAAGTTTTGTCATCTTTAGAAATACTCTCTGGAGCTACAAAACGGCCTTGTTCTCACTTTAGCCTCTTTGGATCAATTTTCTCTAAGCAACAATAACAACACTTGAAGTCGGAGTTCACATCAGCTAATCCTGTATTTTCCAGAAGGTCAATGTCGATACTTTCTCCTTTCAAAATTCTATTCTAAATTCTTCTCCAGTACCGTAGAAATAATGTTTTCTATCCTCCTCTACACTTTCTTCGTCAGTAAAGAAATATCCCAATCGAAGTTTAAATCCGTTCAATGATTTCTTCGTTAGACAAACCTTTCACTTTCGGTGAAAATTATTATCACGAATGCCCAAGGTTGCTCACAACAGCTTAGAAAATTATTTGCCGCCCATTGTTCACTACTTTACTAAGTTTGACTAAATCACTGTCTTGTTAACTCTTTTGCTGTTTATGCTGGGTTCTTTTAAAGTATTATAAAAGTAAATTAATAATTCCAAAGTTGCACTGAATATCGAGAGCAATAATTATTGTGATGCGCGTGCTATTTATTGCAAATAATTCCTGCAATTAATCTCAAATGCGTTTTTTGCTTTTTTATGATATTTAGAGTAGACACACCAAAAGCACCGTTATCATAAAAGAATCAGCAGATAAACAAAGGCACACTTACAGTTAGCTCTGAAAGACATAGAAATTGCTCACAAGCAACGTTGGGTGAAAGAGGTTAAGTTGGTATCTTTCTACTATCAGTAGTGACCCGGTATGCATAGGCTTGCCGGTTGAAAGTGTTATGCTGTTGTTTACTATGCATTTTGTACCAGTTCGCTTCCCTTCGGAGCTTAGCAGTGATCACCTCCTACTACGCTTCCATATTCCAAGGTTAGGTTTGTGCATAATTTGTTTACAAATGCCCATTATCATGTTAAGTAAGAGGTGTTGCCAAAGTTCAGACTGTTTTTCCTAATAGTTGCTCCTATTCTCTCAGTGATGTGTTTTGTTTGCTATTTCCTGCAACTAATTTTGGGCATAAGATTGATAAAATGTTCACTTTGTTGGTATATGTTGGCTTGTTAAATGAACAAACTTTGCTGGATTCCTATAAATCATTTTTACTCAGATCATTATTTCTGTGGCCCCTCTATTTTTTTTGGACAAAGAGTTCCTGATAAATTCTACACCCTTTGTAGCTGGCGGCGTGTTCTTCGTATTAGCAGTTGGCACATTTTGCTGTGGTTGTTCTTTTTTCCGGGCAAATGTTGCTTGGGTGTCGAGAAGAGGATTTTTACACAGCGGTACGTTTTGGTACAGTATGAGTTTAGTATAATCCGAATTCCTGTAGCTATAGCATTGAACGATTTCATTGTGGGGAGGCTCAATATTTGTTTACATTATATATGTCTAGGTTTTTTTTATTTAGGCTCAATATCTACATAAAACATGTTCATTGACGTTTGGTCGCACGGCTTTTAATATTACCCATGTTTCTAACAACATGACCTTTTGACTCTTCATCACTTTTTTAATTTCATCTAAATTTGTGGAAAAATGCAAATTCTTAATAACAACTCTAAATGTCTATCTCATCCTTAAGCTGGTATATTATTGGTACTGCACACAATCATTATTAAGTGTTTTGACTAATTTTCAGAATTCTTCAATGCTTTTAACCATTACTCTTACATGTCCATAACATTGAGGAGTCTTATAATAAAAGTTCTCTCTTAATTTTAGTTTAAGATAGGTTAGCTTTCCGCCGTGATGACGATCAGAGAAAGATGGAAATTAGGGGCTTAACGAAATCAATTTACTTGCTAATCTTCATTTACCATTTCGAGATCTTCGTTTTGGTATATTTGTTTCCTGTTTTGTCCGGGCAATCCGTCGCTTAAGAGAGCGAAATTATTTACTTTGGTGCTTGATGAATTGTCCAGGGAATCCTCTTTCTTTGAACTTCGGGAGGGGGCTTGGTCTCTTTTTTGGATTTTATTTTACTCTGCCATTTCAAAGCAGTTGGGTCTTCGTCAGTGTCGCTCTGCTTGAGTATTAAGAGACAATGATTGTTCTGAGTGCTTGTGTCCGCACTTCGTGCCTCAAGATATGACCAAAGCAAAAGAGACACTAGAATAATTCTAATGGTGTTGATATATGACGTTTGCAATAAACAGTTAACATTTTTTATTTTATAAATTTTTTTATTTTTCTAAGCTACATATTATTTTTATGAAATATTTTCTCAGTGTAATGACTTCTTTTTCCAGTTTTTTTATATTCCAATTTTGATATCTTAAACAGCGCGCAATTTCATCATATTCTACGAAATTGGCCAAAACTCCCCGATATGTATGTATATGTAAATTCGTTACTGCGATCAGAGTTAATTTCAGCCCGAAAATCTTCTAGCACAGCAACACGCACACACATATACGCGTTCTCGTCTTTTGTTTTTACTCACACAAGCAAAGCAAATTCTATTTTTTTACTGATTTCTTACGGCTCAGCGTGGGCAGAGCGGAAAAGAAAGGCATAATTACAGCCCAAATCACCAAAAGAGTGAAACATGGTGCCAAACCAGTGTATGGCTGTTGCATCTTATTATTCTAATTGTCTTTGATGCGGAGCCATGTGACTTTGTAAATGTGTAGTATACTTTCCAACACGCCACCTCAAAGTAAGATTGCTGTACTTTTATTACTCCACGAGACTGTGCGTCCTTCTGACGAATAATTTTTGATCAGCACATTCATTTGCGAGGGTGTTATGAGAGGACCAGAAACCCAGCCAGATCAATTGAACATATTATTTACATAAATTCAGTTTTACCAGAGCTATTTTAACTAAAAATTAATATTAGTCATCTTTGTAAGAAACTCAAAATTATCAGTAAACTTAATTAAATTTAGTTAAAATGATAGTTAGTTTAGTTAGTTCAGTCTGGTTCCTCGTCAGTTCAATCTAAGAATATAATGTTTAATTCATTCTGATCCAAAGTCCACTTCTCAATGTAATGAATCTTTTTTAGATGGTACCACAGCAAGTTGTAGCAAATTTAATAGATATATGCAGTTTGTCAAGAAACTATTTGCAAAATAAGTTGAATTTTTTCACTTCTGGAAGTCAAAATTAAAGGGTTATTTCTTTGAATAAACCTGAATTTTTAATGAAATATAATTAAACAATATTTATTTTACTTATAAAATTAAAAAACAAATTCAAAATATCAAATATACAAAATTAAACTTAATAAATTCAGTTTACACACTTTTGAGTGGCAAAACTCCTTACATTTTGTTTTCCCTGCTTTGTTGTTTTGCTCTTTTTCTTAGAACCAGACTCGATTTTTTCCGTTATTTTTTGGCATTTGCATTCCTTTTTTTACAACGCTTCTATTGGAAATTTTTTTTTACTTTGCTTGTGAAATTTTGCTGATCAGATAGAGTTATTAAATTTAATAAAATGCCAGAGTAATAGATTAGCTTTTGAGTGACCCCAAATAATATACTAAAACCACCAGTTAGGAAAATCTATTCCAGAATTAGTATAAATGTTTTCTGTATCCCGTAAGACCGTCTACAATGTTTTTAATCAGCAGAAAAAAAAGAAGAGAACAGGCTTGAACCTAAGAGTGAGTGGGCGCAAAACTAAAATTAGCAAACGTGTAGACCATACATATGCGAAAAGTGGTGCGAACCCCCCCGAATCTCGGTCAGATCCTTGCTCGGGATATCAGGCAAGAATGTGACCTAGTTGTGCCACACAAAACTGTGCGCCAAGTCATTTCTACGCCATAGGTACTCTTCAAGGTTGCAAGGAAAAAAGCCTTTGCTATCAGAGGTCAATATAGAAAAGCGTGTTCATTCGCTGTGGTATGATGGATCATGCGGAAGAGTACTAGGATGACGTAATGTTACAATGACAAGAAACAAAATGATGCTCTATTATAACGATGGGCCAAGCAGGTATGAAAGCAAGCTGTTGGAGGTGCGCTGAAAAACAAATATCATTCCAACAATCATTTGGAAAATTATCAGTGATGATTTGGGGCTGTATCTCAAGCCATGGAGTGGGCAAGATTAGCCTTTGTGAGAGAAAGCACCTGAATGCCGTGCAATATCTAAGATATTTTAAAATCAAATTTGAAGGCCAGTGCAGAAAGAGTTTGGTCTATTTATATAAGCCAAATTTTAAGTTTATCAGGACAGTCCAGAGCATAAAGAAGAGAGTGCAATGTACCAACTGGCTCCTTTATAACTGTGGCAGGAGTGATCGATGCACGCGCCCCCCCTCAGAGTCTTGATCTGAACCCCATTGAAGAAAATTTGTGGGCCCTGCCAAAGAAGAATGTGGCAAAGGGGCGCAGAGCGACAGCTCATGGCGTGAGAGTGAGGAAAAAAGATCCCACTTGAATCTGACCTAAACTCATATCCCATTCCAAAGCAGAAGCAAAGCACCAGCAGCCAAAGCCAATGGGGGTCATGTACTAAATGCTACAACTTTTTCAAATTTTAGCAAAATGAATTTAATTTAGAGGATTAAACAGGTTTAGTGTTTTGTGTAAAGGTTTCTTGAAACTCTCAAAGTGTTTAAACGCGGAATTCGTTGTTTATTTTCTTGTATATTTGATGTACAGTTGTTTTTAATTTATAAATTAAAATAATGTGTTTAATTATATTTCCTAAAAAAAATTGCGTTTAATTAAGCAAATAACCCTTAATTTTGACCCATTCAAAATCCAAATTCATCTTATTTCACGGTGTGTAAAAATCTGAGACCCTAATGACAAACTATACTATCATGAATTTATTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTAGAGAGTGATGCAGGTATAAAGTGATTCAGATCCGACATCAGAAGTGGGACCGCCTACTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCCGCGTGTGTTTTAGCTGTTCTTTATTTGATCAATTTGAGGAACAGGAAGGTCCCGCTCCATTCAATTAATTCGTCAATCCTCTTATGATCTACATACAAAGGTTTCTTAGCCCTAAGTCGAGAGAACAGCGCTGCAGCGCAACCTACTGCCTGTAACTTGCTATAAATATCATATATATATGTGTATATATATATATGTACTGTCGCCGAGCGATGGTGGAGGAGAATTAGTATAGGCACACATATAAGCGATCAGCCTTGGCCAGCAGGAGAACTGCTGACCAGAGCCAATTATGTATGTTAGCCCTCAAGAGTGGGTGCTCGTATTACGTATACACTTGTGCTGGACTGTTTAATACATTGCAGCAAATTGCTGAATTATGAATACACATAGGTACAGTGCTTAACCGATATGTGTGCATACTACAATAGTGAAAACAATTTTGCTGACAGAGATTCTAGAGTCGCAGAATCACCGCCATTTTCCTGAACTGTTAAAAGAAGTGCAAAACTCACAAGGGCCAAAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCTGAACGCACAGGCTTAGACACTCAATCCCTGGTGCGGAGACCAAGTCTACATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCGAAATCCTCGAGGCTCCGCCGAGTTGTGTCGGCCGGTGTGTGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCATAGTTCTGCGCTGCAATCGCGAGTTAATTGTGCCGCGCCTGTTTCATGTAAAAATAGGTAATTTATTGTATCTTGCGATTGTTGCAGCGGATAAACAGCTGATGGCGCAGCGGGCGATCTGGAGAGGGGAGGCGTTGCCAGATCAACCGTGTGATCCGATGTTGTGTTGCGACAGTAGGGTGCCGAAATTCAAAATTAAATTTAAAAATTAAGCCGTTGGAGTTTAATTTTAATTTAATTTTGATTCTGGTGGCTTTAAGGGCGCACAAAGTCTTTAAGGAAAAGGCACAAAGGTCGCGGACAGACCAAATATCATCCTCTCACCGTGCTGGTGCTAAGCAGAGGCTCTGGTGTCGAGTCGAGGCGGTACAAACCTCCATCCGTAAAGCCAGGAAATCCGTGGCCCTGCACGTGACCCTGCATTGACATAGGCCATCTTCGGTTGATGGACGAAGCGCGGTGGGGGGGCAGTCCCCTGATCACAACGACCCGTTCGGGAGGCTCCCGACTTTCCGAGATCCCCCCCCACCAGAGGTCAGTAGCCGACCCATGGTGACGGAATCTCGGTCCGTCGGTGGCAAAGGGTGAGCACGCAGGCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGGGTGGAGAAATTGGCTCCCTACAGCATCTACGACCGACAAGTCAAGAAGACGATGGACCACATCGCCGTGCCATCGCAAAGACGGGAGGAAGTCTGGCTTGTTTCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCCAGAACGAGGACCTGAGAGCATACCCACCAGGATGAATGGCAAGATCAGCCCCCTTCTATCCGCATTCAGGACCCAGCGACGCATGATCAAAGGGCATAAAGCTTCGAACTCAGCCCCGCTTAACAACAAGGGCGATAGAGGCTACACAATACGAAGGTACTACTGAGCACCGCTTGAAGGACAGCGCTACAGACGGAGGTACAAAGCCACCAAAAGGCTCCACAAAATGCACCCAGGTACCCGTA
->407e46b6-5800-41ee-a691-443260135e24
-TTGGTATGCCCCCGTTCAGTTGCATTGCTGGTAGCCTTTGCTCTTCAAGCGGTGCTCGCTGGTAGCAACTTACTTCATGCACGCTCTATCGCCCTGGCTGTTGGGGCTGAGAGTTCAGGCTATGCCCTTTACATGTCTCTCATGTGTCGTTGGGTCTCGAATGCGGATGGGGGGCTGATCTTGCCATTCGGCATCCTGGTAAGTATGCCCCTCAGGTCCTCGTTCCTGGAGAGCAGTGGTCAGAATCCGAAGACCGATGCGGGGGGGGCGGCTGCGGGAACTTCCACTCCGTCTTTTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCTGACTGTCGCGGTCGTGGAGTGCTGCTTGGAACCCAATTTCTCCACCACCTCTACAGCATCGCTGCGGTCGATAGTCAACGGCGGCTGGGGGGCCTGCGTGCTCACCCTTGCCACCGGCGGGACCGGAATTCCGTCACCACCATGGGTCAGGTTGCGATACTGGTGAGTTCTCGAGAATCGGAAACTCCTCCTGAACGGGTCGTTGCGATCAGAGGACTGCCCCCCACTGCGCTCACATCCATCAGCTGAAGGATGGCTAAGGTTACCCTGGGTAGGTCACGTAGGCCGCGTTTCCCTGGCTTTACGGATGGAGGTTTGTACCGCCTCGACTCGGACACCAGAGCCTCTGCTTGGAAAGCAAGCACGGTGAGGATGATATTTGGTCATAAACGCTTTGTGCCTTTTCCCCTTTCTTAAAGACTGTGCGCTCCAGTTACCAGAATCAAAATTAAAATTCAGGTAAATTTCAACGGCAATTTTAAATTTGAACACGATTTCAACGCCCTACTGCTTCGCAACACATGCTAATCCCGCACGGGTGCGTCACAGGCGGCTTTCCTCTCCAGCCGGTCGCGCTGCGCTTTATCGGCTGTTTATCATACAACAATCACCGAATAATAAATTACCTATTTACATGAAACAGGCGCACAGTGTAACTCGCGTGATTGCAGCGCACCAGAGCTATGGCGCGACTCCACCGTGTGATTTTGCCGGATTTGCCGCACCGGCCGACACAACTTCTATGGTTTCGGTATTTCGCGCGCCGCGCGTAATTTTAGAACGTCGCTTCTTCACGGCGATGTAGACGGTCTCCGCAGGATTGAGTGTCTAAGCCTGTGCGTTCAGGTTAAACTTTGGCAATACGACAGCGTGGGTTTTTGGTCTCTTTGTGAGTTTTGCACTTCTTTTTAACAGTTCAGAAAAATGGCGATTCTGCGACTCTAGAATTGTCAGCAAATTGTTTTCACTATTGTAGTATGCACACATATCGGTTAAGCACTGTACCTATGTGTATTCACCGTTAGCAACGCTCTGTTGCAGTAGTAACGCATAAACAGTCCAGCACAAATTGTATACGTGGCGACGCACCACTTGAGGGCTAACATACATAATTGCCTGGTCAGCAGTTCTCCCACAGCCCAAGCGCTGATCGCTTACAGCGGCACTTTCTGCACTCTCCTCCAGCACCATCGCTCGGCGACAGTACATATATATACATATATAAGATGCATATAAGCGTTGCCGCTGCAGGCTATGCCGGCAGCTGCTCCTCGACTTAGGCTAAGAAACCTTTGTATCCAACCAGATCATAGGGATTGACGAATTAATTTCGAATGGGCGGACCTTCCCTGTTCCTCAAATTGGATCAAATAAAGAACAGCTAAAACACAAATGATCTATGACACAATGAAACTACAGGAGGTTGGAGTAGGCGGTCCCACTTCTGATGTCGGATCTGAATCACTTTTTACATATGGCATCACTCTCTACAGCGGACACAAAGTAGCAAGAAAACGGTCGTTAACGAAATTAAAAATAAATCTGCTGCGACAAGTACAGTTTGTCGAGAGCTGTTTTACACACCGTGAAATAAGATGAATTGCGATTTTAACGGAATCAAAATTAAGGTTATTTGCTTAATTAAACGCAATTTTTTTTTAGGAAATATAATTCAAACAATATTTATTTTACTTATAAATTAAAAACAAATTCAAATCCATCAATATACAAGAAAATAAACAACGAATTCCAGTTTAAAACACTTTTGAGGAAGAAACTCTTTACACAAGAAACATAAACCTAAAGTTTAATCTAAATTTTAAATTATTTTGTTAAAATTTGAAAAGTTGTAGTATTTAGTACTTATTATTGGCTTTGGCTACAAGTTGAAGCTTTTTTTCATGGAATGGATGAGTTTTTTGATTCATATTCAAGCGGGATCTTTTCCCCTCTATCGCAGCCATGAGCTGTTATCTATGTTGGTGCCTTTTGCCACATTCTTCTTTAAGTAAGGCCCACAAATTTTCAATGGGGTTCAGATCAGACTCGAGGCGTATCGATCACCGCCTGCCACAGTTAGCAAAGGAACCAGTTACTTGCGTACATTGCACTCTTTATGTTTTGGGATCATTGTCTGATAAACTTAAAAATTTGGCTTATTATTTGCTAAATGAATAGAATTTTTCTGCACTGGCATACTTCAAATTTGATTTTTTTAAAATATCTAGATGTGCACGGCATTCATAGTGTAATTTTAAATAAGGCTAATTTGCCCACTCCATGGCTTGAGATACAGCCCAAATCATCACTGATAATTTTCAAATTTGATTGTTGGAATGATATTTTTGTTTTTTCTAGCGCACTCAACGGCTTGCGCCATACACTCTGCGCGGCTATCGTTATAATAGAGCATCATTTTTGTTGCGTCACAAAATGGCCGTCGCATCCAGTGATACTCTTCCGCATGATCCATCATGCTCCACAGCGAATGAATGACGCTTTTCTATATTGACCTCTGATAGCAAAGGCTTTTTTCTTGCAACCTCTTGAAGAGTACCTATGGCGTAAGAATGACTTCAGCGCACAGTTTTGCTGGCAGCACAACTAGGTCACATTCTTGCCACATTATCTGGAGCAAGTGATCTGACCGAGATTCGGGGATTCGCAATCGCACTGCATAATAAGGCCACGTTACGCTTGCTAATTTTAGTTTGCGCCCACCACTCTTAGGTTCAAGCCTGTTCTCTTTTTTTCAAGCGATTAAAAACATTTGTAGACGGTCTTACGGGATACAGAAAACATTTATACTAATTCTGGAATAGATTTTTCCAACTGGTGGTGGTTTAGTATATTATTTGGGTCCTTCAAAGCTAATCTGTTTTCGAGCAGTAAATTTAATAACTCATTCGATCAACTGCGAAATTTCACAAACAAAGTAAAAAAAAAATTTCAATAGAAGCGTTGTAAAGGAGATGCAAATGCCAAAAATAACGGAAAAATCGAGTTCGTTCTAGAAAAAAAAATAACCAACAAAGTAGGAAAACAAAATGTTATAGCGTAAGGAGTTTCTGCCACTCCTAAAGTGTGCGAACTTAGAATTTGTTGTTGGAAATTTCTTGTATATTTGATATTTTTTTAGTTTGTTTTTAATTCATAAAAGTAAAATAAAATATTGACAAATTATATTTCATTAAAAAATTGCGTTTAATTAAGAAACCTTAATTTTTTTGGCCTTCAGAGTGAAAAATTCAGCAACTACACGGCGTGCCGTGGTTTTGCTGACAAACTGTATATATCTACAGATTTACAACTTGCCGGTACCATCTACGAATTCGACTACGGTGAGGACTTTTGACTCTTACTCGAAATTGAATTACGTATATTCTTAGATTGAACCGGCGAGGAACCAGACTGCGAACTGACTAAACCAACAACTTATCGATTTTAACTTCGGAGAATTTGGAGTAAGTTTACTGATGCATTTTGGAAGTTTTACACCACAAAGATGACTAATATTAATTTGATTCTAGAAAATAGTTTGCAAAACTGAATTTATGTAAATATGTTCAATTGATCTGGTTGGGTTTTCACGGGTCTCTAACACCTCGCAACAGATGCTGGATCAAAATTATTCGTCGAAGGACGGTACTTTGATCTCGTGAGTAATAAAGTACAGCAATCTTACTTTTTGGCGGGTGGCGTGTTGGAGAGAATATGTACACACATTTAAACAAGAATGCAGCCTGCATCATAAAGAATTACTAGAATAATAATAAGATGCGTAACAGCCGCCGCTGGTTTGGCACTATTAGCCAGCATTGAAATTGCTCTCTTTCCGCTCGCTCACGCTGAGCGTAAAGTAAAATAGAATTGCTTGCTTGTGTGGTAAAAACAAAAGGCGAAGACGCGTATGGCAATTGTGCGTGTTGTGCTGAAGAGCGATTTTCGGGCCGAAATCAATTCGATCGCAGTAACAGATTTACATATGTACAGCCACATATTTTGGGAGTTTGGCCAATTTCGTAGAGACTTCATAGATGAAATTGCTGTTTAAGATATCAAATTGAATATAAAAAAAACTGAAAAGAAGTCGACTACACTGAGAAAAATATTTCACATAAAAATAATACGAAGTAGAAAATAAAAATTTACCAAAATAAAAAAATGTTAACTTTGTTTATTACAAACGTCATATCAAAATTAGAATTATTCTGATATCTTTGCTTTGGTCATATCTTGAGGCGAGATTACGGACTAAACACTCAACAATCATTTGTCTTCTTAATACTCAAACCATATTATTTGAGCGACACCGACGAACCAACTGCTTTGAAATGGCAGAGTAAAATAAAATCCAAAAAAAGAGACCAAAGCCCCTCGAGTTCAAAGAAAACAGGATTCCCTGGACAATTCATCAAGCACCAGCGCAAATAATTTTTCGCTCTCTTAAGCGACGGATTGCTTAAACAAAACAGGAAACGAAATATAGCAAAACAGAGATCTCAGGAAATGGTAAATGGGAGCAGTTACGACTGATTTTGCTAAGCCCCACCTATCTTTCTGACGTCAATGGTATAAATTGAAAAGAGCGCAACATCTTAAAACTAAAATTAAAGAACTTTTTTATTATAAGACTCAACGTTATGGACACGTATGAGTAATGGTTAAAAGTATTGAAGAATTCCTGAAAATTGAAGACAAAACATAATAATGATTGTGTGCAGTACCACATACCAGCTTAAGGATGACAGAGCATTTTGAGAGTTGTTATTAAAATTTGCATTTTTCAATTTAGATGAAATTAAAAGTGATGAAGGAAGAGTCAAAGGTCATGTTAAGAAACATAAGTAATATTAAAAACCGTGCGATAGAAACGTCTGAACATGTTTTGTGTGAATGTTAGACCTAACAAAAAAACCCTGAACATATATATAATGTAGAAAATAAAATATTAGACCTCCCACAATGAAATCGTTCAATGCTATAGCTGCCAGGAATTCGGACATACTAAAATCATATTGGCCTGAAACGTACCGCTGTGTAGGTCCTCTTCTCGACACTTTAAAGCATTTTGCCCGAAAATGCAGAACAAGCAATACATAGCACGCA
->2936e591-9dae-4d89-bdc9-e6d99652f4d3
-TTGTTGCTGGATTTCGGTTACGTATTGCTTAAGTCGAGGGCAGCGCTGCCGGGCATAGCCTGCAGCAGCAACCATAATATGCATTATCTTATATATGTATATATATATGTACTGTCACTCGAGCGATGGTGCTGGAGGAGAGTGGTATAGGCACATATAAGCGATCAGCCTTGTGGCAAGGAGGAACTGCTGACCAGGCAATTATGTATCATTAGCCCTCAAGTGGGTGCTCTCGTATTACGTATATACACTTGGTAGCACCGGACTGTTTATGTACACACATTGCAACAGGTACTGCAATTATGAATACACATAGGTACGGTGTAACCGATATGTGTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTAGAGTCGCAGAATCGCCATTTTTCTGAACTGTTAAAGAAGTGCAAAACTCACAAAGAGACCCAAAACTCAATGCTGTCAGCCAAAGGTTTAATCCTGAACGCACAGGCCAGGTCAATCTAGTGCGGAATAGAGTCTACATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCGAGAATACTCCAGAGGAACCATAGAAGTTGTGTGTCGGCCGGTGTGTGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCATAGTTCTGCGCTGCAATCACGCACTGATTAATTGTGCGCCTGTTTCATGTAAATGGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAGAAGCAGCTGATAATGGCGCAGCGGAGCGATCTGGAGAGGAGGCGTTGCCGGATGTGTGATCAGTCATTGTGTTGCGACAGTAAGGGCGCGAAATTCAGGTAAATTTAAAAAATTAAAGCCGTTGAAATTTAATTTAATTTAATTTACGATTCTGGTAACTGGGAGCGCACAAGTCTTTAAGAAGGGGAAAGGCACAAGGTCGCGGACGGACCAAATATCATCCCTCTCACCGTGCTGGTGCCTAAGCAGAGCTCTGGTGTCCGAGTCGAGGCGGTACAAACCTCCATCCGTAAAGCCGGGGAAATCCGTGGCCTACGTGACCTAAGGTAACCTTAGGCCATCCTTCCGGTTGATGGACAGCGCACCAGTGGGGGGCAGTCCCCACAGTCGCAACGACCCGTTCGGGAGGAGCTCCCGACTTTCGAGATCCCCACCAGGGAGTCGGTAACCCGACCCATGGTGACGGAATCTCGGTCCCGTCGGTGGCAAAGGGGTGAGCACGCAGGCCCCAGCCGCGGTGACTATCGACTGCAGCGATGCTGTAGAGGTGGAGAAATTGGCTCCTACAGCATCTACGACCGCGACAAGTCGAAGACGATGGACCACATCGCCGTGCCATCGCAAAGACGGGAGGGGGGAAGTCCCCAGCTTGTTTCCCCTCATCGGTCTTCGGACTTGACCACTGCTCTCAGAACGAGGACCTGAGAACATACTTACCAGGATGAATGGCAAGATCAGCCCCTGGTCCGCATTTCAGAGACCCAGCAATACGTAAAAAAGA
->8af478e5-f3e0-4aab-80b0-92ac09383735
-TTGGTAGCTTCGTTTCAGTTACGTATTGCTCCTTGTGGCATGGCGTAAGCGAATACCAGATTGATCTGGAGGTCAAGGCTCTCAAGCCTTATGCGGAATTAGCTTCCAGGCAAGAGGCACGAGATGACATTAGGTGAATGGCAGGCAGATTAGGCAAACGTCACCGACAGGGGGGTGGACCTATCAATCATCAGAGATGATGACAGTTTGGGCAGAAGTGACACTCAAGGTGTGAAACTTGGAATTTGTTGTTTATTTTCTTGTATATTTGATGTTTTAGATTTGTTTTAATTTATAAGTAAAATAAATGTTGTTTAGTATATTTCCTAAAAAATTCCGTTTAATTAAACCAAATAATATAATTTCGACCGTTAAAATCAAAAATTCTGTCTTATTTCACGTTATTGTAAAACGGTTTCTTGACAGAGCTGCGCGTACTAGTTATTTTAATTTCCAGTTAACGACAAACTCTGTTGCTGTATGATGTCCCACTTTAACAGAGAGTGATGCCAGGTATAAAGTGATTCAGATCCGACATCGAAGTGGGACAACTACTCCAACTTCCTGTAGTTTCATTGGTAATCATAGATCATTTGTGTTTTAGCTGTTCTTTATTTGATCCAATTTGAAGGAACAGGAAGGTCCCACTCCATTCGAAATTAATTCATCAATCCTACCTGATCTATACAAGGTTTCTTAGCTTCGTCGAGAACGGCACTGCTTATGGCACACTGTACAGCGCAATAACGCTATAATACGTATATATATATGTATATATATATATATATGTGCTGTCACTCCGAAACGATGAATGCTGGAGGAGAATAAAACATAGAGCACATATAAGCAGTCAGCATGGCCAACAATTTACTTGACCAGAGCAATTATGTATATTAATATCAGAGTGAATTGCTCATATTACATACTACATGTGCTGGACTGTTATGTATTACCTGTGCAACAAATTACTTTAATTATGAGCCACATAGGTACAGTGCTTAACCGATATGTGTGCATACTACAACAGTGAAAACAATTTGCCCAACCAATTCTAGAGTCTATATTTTCTGAACTATTAAAAAGTGCAAAACTCACAAGAGACCCAAAAACTCAATGCTGTCATTGCAAAGTTAATCCTGAACTACTGAGCTTAGACACTCAATCCTGATTGGGATAAGTCTATCATGTGAACGGATATTAAATTACAGCAGTACTCGAAACAAAGTTGTGTCAGCCGGTTGTGTGCAGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCATAGTTCTGCAGGTTAATTGTGCGCCTGTTTCGCGTCATAAATAGGTACGTTATTATCTGCGATTGTGCAGCGGATAAATGGCAGTATTAGCGCAGCGGAAGCGATCGTCTGGAGGAGGAGGCCTTAGAATCCAACCGTAATGATCGATGTTGATATTTTACGACAGTAGAGGCATGAAATTCAAATTAAATTTAAAATTAAACCGTTGAAATTTAATTTAATTTAATTTTGATTCTGGTAACTGGAGCGCACAAGTCTTTAAGAAGGGAAAGGCACAAAGGTCGCGGACAGACCAAATATCATCTCCTCACCGTGCAGATTTTCGCGGGCTCTGGTGTCGAGTCGAGGCGGTACAAACCTCCATCAATACCAAAGCGGAAATCCGTGGCCTACGTGACCTAGGTAACACCGGTGTCGCCGGTTGATGGACAGCACGGTGGGGGCGGTCCCCTGATCGCAACGACCCGTTCGGAGAATACCCGACTTTCGGATCCCCTGTAGAGGAGTCCGGTAGCCGACCCATGGTGACGAATCCTCGGTCGTCGTTGTGGGGTGACGCGGGCCCCCATGCCGATTGACTATCGACTACGGCGATGCAGCGGGAACCCGGAGAAGTGGCTCCTACAGCATCCACGGCACGACAAGTCAGAGAGACGATGGACCACATCATGCCGTGCCATCACCGCAAAGACGGGAGAAGTCCCCAGCTGGTTCCCCTCATCGGTCTTCGGACTTGACCGCTGCTCTCCAGGGCGGGACCTGGGGGCATACTTGCCGGGGATGAATGGCAGATCCCGGCCCTTCTCCGCGGTG
->c74014a7-65f1-4606-a53a-199892fc3966
-AGGTATTGCTTCGTTCAGTTGCGTATTGCTATCTTGCCATTCATCCTGGTAAAGTATGCCCCTCAGATCCTCGTTCTGGAGAGCAGTGGTCAAGTCCGAAGACCGATGAGGGAACAAGCTGGAACTTCCCTCCCGTCTTTTTTGCGATGGCACGGCGATGTGGTCCATCGTCTTCCTGACTGTCGCGGTCGTAGATGCTGTAGGAGCCAATTTCTCCCTCTACAGCATCGCTGCGGTCGATAGTCAACGGCGGCTGGGGGCCTGCATATCACCCTTACCCACCGACGGGACGAGATTCCGTCACCATGGGTCGGGTTACCGACTCCTCTGGTGGGGATCTCGAAGTCGGGAGCTCCTCCTGAACTGGTCGTTGCGATCAGAGGACTGCCCCCCTGCGCTGTCCATCCAACTGAAGGATGGCCTGAAATTTACCTAGGTCGCGTGGGCCACGGATTTCCCCTGGCTTTACGGATGGAGGTTTGTACCGCCTCGACTCGGACACCAGAGCCTCTGCTTAGGCACCAGCACGGTGAGAGGATGATATTGGTCTGTGTCCGCGACCTTTGTGCCTTTCCCTTTCTTAAAGACTTGTGCGCTCCCAGTTACCAGAATCAAAATTAAATTAAATTAAATTTCAACGGCTTAATTTTAAATTTGGTGCAATTTCGCTTCTGTCCGCAACACAACACTGATCACACGGGTGTGATCTGGCAACGCCTCCCTCTCCAGATCGCCGCTGCGCTATCAGCTGTTTATCACAACAATAATCGCAAGATAATAAATTACCTATTTACATGGAAACAAGGCGCACAATTAACTCGCGTGATTAAGCGCAGAACTATGGCGCGACTCCACCGTGTGATTTTTGCCAGTTTGCCGCACACACCGGCCGACACAACTTCTGTGGTTTCGAGTATTTCGCGCCGCGTATTTGAACGTCCGTCTTCGGCGATGTAGACTTGGTCTCGCACCAGGATTGAGTGTCTAAGCCTGTGCGTTCAGAGTTAAACTTTGGCAATACGACAGCATTGAGTTTTGGGTCTCTTTGTGAGTTTTGCACTTCTTTTTTAACTTTCAGTTCAAGAAAAATGGCGATTCTGCGACTCTAAATTGTCAACCAATTGTTTTACTATTGTGAGTATGCACACGTATCGGTTAAGCACTGTACCTATGTGTATTCATAGTGTAACTCTGTTGCAATGTGTGCATAAACAGTCCAGCACAAATTACATACGTAATACGAGCACCCACTTGAGGGGCTAACATACATAATTGCCTGGTCAGCAGTTCTCCCGCTGGCCAAGCGCTGATCGCTTATATGTGTGCCTATACCACTCCTCCTCCAGCACCATCGGCTCGGCGACGGTACATATATATGCGCTATCGTTGCTGCGCTCTGAGCTAATGCCGGCAGCACTGCTCCTCGACTTAGGCTAAGAAACCTTTGACCAATAGCAGATCATAAGAGGATTGACGAATTAATTTCGAATGGGCGGGACCTTCCCTGTTCCTCAAATTGGATCAAATAAAGAACAGCTAAAACACAAATGATCTATGACACAATGAAACTACAGGAAGTTGGAGTGAGTTACACTTTCTGATGTCGGATCTGAATCACTTTATGCTCGGCATCACTTTCTCTGGCGGACACAAAGTAACGAAAACGTTAGCAGGGGTAAAATAAATCTGCGACAAGTACAGTTTGTCAAAACTGTTTACACCGTGAAATAAGATGGTACGATTTTTAACGGTCAAGAATTAAGGGGTTATTTGCTTAGTAAACGCAATTTTTTTTTTTAGGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAAACAAATTCCAAAATATCAAATATACAAGAAAACAACGAATTTAAGTTTAAACACTTTTGAGAGTTTCAGAAACTCTTTACACAAAGATACTAAGCCTAAGTTTAATCCTAAATTTTTTTAAATTATTTTGTTAAAATTTGAAAAGTTAGCGTATTTAGTATGACCCCCCCCATTGGCTTTGGCTACAGAGTTGAAGCTTTTTTTTTTTTCATGGAATGGATGAGGTTTTTTTTAGGTCATATTCAGGCGGGATCTTTCCCACTCTATCGCAGCCATGAGCTGTTGTCGTGTTTTGGTGCCCTTTTTTTGCCACATTCTTCTTTTAAGTAGGCCCACAGAATTTTCAATGGGGTTCCAGATCAAGACTCTGAGGGGCGTATCGATCACCTTACCACAGTTATAAAGGAGCCAGTTGCGTACATTGCACTCTTTATGTTTTGGAAGTCGTGTCCTGATAAAACTTAAAAATTTGGCTTGTTGTTGCTAAATAGACCAAATTTACTGCTACTGGCCTTCAAATTTGATTTAAAATATCACAGATATTGCACGGCATTCATAGTGCTTTCAATGAGAGCCCCTGGTGCCCTCCATGGCTTGAGATACAGCTAAATCATCACTGATAATTTTTCCAAATTTGATTGTTGGAATGATGATATTTTTGTTTTCTAGCGCACTCAACGGCTTTGCCATACTCTGCTTGGCCCATCGTTATAATAGAGCATCATTTTTTTGTTTCGTCACAAAATATTACGTCATCAATTACTCTTCCGCATGATCCATGTATGCTCACAGCGAATGAATGACGCTTTTTCTATATTGACCTCTGATAGCAAAGGCTTTTTTCTTGCAACTCTTGAAGAGTACTACGTAGAATGACTGGCGCACAGTTTTGTGTGGCACAACTAGGTCATTCTTGCCTGATATCCACGAGCAGAGTGATCTGACCGAGATTCGAGTTCGCAATCACTTTTTCGCATAATAAAGGCGGTCTACGCTTTGCTGAATTTTAGTTTGCGCCCACCACTCTTAGGTTCAAGCCTGTTCTCTTTTCAAGCGATTAAAACATTGAACGGTCTTACGGGATACAGAAAACATTTATACTAATTCTGGAATAGATTTTTCCCAACTGGTGGTTTTAGTATATTATTTGGGTCACTTCAAAAGCTAATCTATTTCCGGGCATTTTTATTAAATTTAATAACTCATTCGATCGGCAAAATTTCACAAGCAAAGTAAAAAAAAATTTCAATAGAAGCACGTTGTAAAAGGAATGCAAATGCCAAAAATAACGGAGAAAAATCGAGTTCGTTCTGAAGAAAAAACAAAACAAAGTAGGAAACAAAGTAATGTAGGAGTTTCTTGCCACTCTCAAAGTGTGTAAACTTGGAATTTGTTGTTTAATTTCTTGTATATTGTTGATATTTTTAGTTGTTTTTTAAATTTATAAGTAAAATAAATATTGTTTAATTATATTTCATTAAAAATTGCGTTTAATTAAAGAAATAACCCTTAATTTTGACCTTTAAAGTGAAAATTCAACTTATTTCACGGCGTGTAAAATAGTTTCTTGACAAACTGTATATATCTACAAATTTTGTTTTACCGGTACCATCTACCCAAGATTCATTACATTGAAGTGGACTTTGACTCTCAGAATGAATTAAAACATTTACTATTCTTAAGTTGAACTGACGAACCAGACTGAACTAACTTAAACTAACTATCATTTAGCTTCAAATTTAATTAAGTTTACTGATAATTTTGAGTTTCTTACAAAGATGACTAATATTAATTTTTTAGTTAAAATGGTTGCAAACTGAATTTATGTAAATAATATGTTCAATTGATCTGGTTGGGTTTTCTGGGTCTCCCCAACACCTCGCAACGAATGCTGGATCAAAATTATTCGTCAGAAGGACGTGCACAGTCTCATTAATTAATAAAAGTACAAGCAATCTTTACTTTTGAGGTGGCGTGTTGGAAAGTATGTACACATTTAAGCAAAAGTCCGCATGGCCTGCATCAAAGACACTAGAATAATAAGATGCGTAACAGCCATACACTGGTTTGTACTATGCGGCCACTTTTTTGGTGACGGCCAAAATTGCTCTACTTTCCGCTCATCACGCTGAGCGTAAAGAAATCTAAAATAGAATTTGCTTGCTTGTGTGAGTAAAAACAAAAGACGAAACGTATATATGTGTGCGTGTTATTGGCACAGAAAGGCGATTTCGGGCGAAATCAATTCTGATCGCAGTAACAATTTACATATGTACATACATATTTGGGGAGTTTGGCCAATTTCGTAGAATATGATGAAATTGCGCTGTTTAGATATCAAATTGGAATATAAAAACTGAAAAAGAAGTCATTACACTGAGAAAAAAAAATATTTCATAAAAATAATACGAGTAAATAAAAATTTATAAAATAAAAAAATGTTAACTGTTTGTACAAACGTCATATCAAATTAGAATTATTCTGGTGTCTTTGCTTTGGTCATATCTTGAGAGGCACGAAGTGCGGACTACAAGCACTCAACAATCATTTGTGGCTAATACTCAAGCGAGCGATGACACCGGCGAAGACCTAACTGCTTTGAAATGGCGAGAGTAAAAATAAAATCCAAAAAAGAGACCAAGCCCTCTCCGAAGTTCAAAACAGGATTCCCTGGACAATTCATCAAGCACCAGCGCAAATAATTTCGCTCTCTTGGCGACGGATTTGCCCGACAAGGCAGGAAACAAATATAACAAAACGAAGATCTCAGGGAAATGGTAAATGAAGACAGTGCAACTGATTTTGCTAAATACCTATCTTTCTCTCGGCGTCCAATGGTATAGTGAAAAGCTAACCTATCTTAAAACTAAAATTAAAGAGAGAACTTTTTTTATTATAGACTCAACGTTATGGACATGTAAGAGTAATGGTTAAAAGTATTGAAAAGAATTCTGAAAAATTAGTCAAAAACAATAATGATTGTGTGCAGTACCACACATACCAGCTGGGATGACAGAGCATTTAGAGTTGTTATTAAGATTTGCATTTTCCACAGAATTTAGATGAAATTAAAAGTGATGAAGAGTCAAAAGGTCATGTTGTTGTTAGAAACATAAGTAATATTAAAGCCGTGCGACCAAAACGTCAGCAATGCGTAACCCA
->47179d29-e688-40ca-be48-803aad949dbb
-TTGTTGGCCCAGCTGAATCAGTTGTGTTGCTTGACCACGCCATTCTGAATTGCGGTAGTTTAAAACACCAAAGTACAATAAAATGCCAATGTAGCGTTTGATTTCCTCATCAGTACATTTAAGTTCAATACCGTGCTCCTGCAAACTATATACAGAGGTGGTCAAAGAAATGTTGCCACAACGCACAATGTTGCAAACTTCAACTTCTTTTGTTATAATATTTCTTCTTGTTGTTGTCCGATTTGCCTGAAATAGTTCTTATCGGCAACTTGATCTATGCAGGAAGGTAGTCGAAAAGAAATACGAAGATAACGGTTCATAATTACAAAGCTTAAAAGCAAAGAAAATATGCATGCAAGTTGTCAATGAGTATTTTCACATGTTTATTGCGCTTTCAAAGTATTTTCCTCCAGCAGATTTAGTAGAGATTTCAACAACATCTAAGAATTTCAGCATAGAGGAATTTCTTTATTTTATATAAATACAATACTAATATTTTGTAACACACCTTTGGCATCAATAACTGCTTGAAGTCTTTTTTGGTATTGACCTTTACCAAAGTTTATTGCAAATTCTAATGTCAATTTGGACCAAATCTCCGCTATTTCAGTAGAGCCACTCTCGTTTTCTATTTTTTTATCAATAGTTCGTTGGTTTTAATAAAAGCCCAGGCGTTTTCAATGATATTAAGGTCTATGGGCTTTGGGAGACCACGGAAGAACATGAATTAAGATTAAAAATTTTGTTGGTAACATCCCTACCTTATGGCATGGAGCATTGTCCTGCTGGAAGAATCCATTCAGTAGTTGGAAAAGTCTATTTCCAGACGTAAAAGCATGGTTGTTTAAGATAAGAAGGTATCCCGTTCTGATTTAAAATTACCTTCTATCATCAGTACCAAGTCTCAGATGTCCATAATAGGAAGAACATCCCCAAAACATGACTGTGCCCCCACCAAATCTATTGGTTGGCTGGGCTGCCAATGCGCATTATTTTTCAAATGCATAAAATGCTTGCTGTATGACCCTGGTACTGAAATGCAGACTCATCCAGTCCATAAAATGTTAAACCAAAAGTCAAGAGCTGTAACATATTCCAACGCAAATCGAAGACGTTTTTTGTTTTGTTGGTTGGTGTGATCTCAATCGTTTTGCGAACAAAGTATGTCTTAAAAATCAGCTTCTTTTAGCCTGCGACGAATTTGGTAGAGACTACTAACTTGTTTGCCAATTGTATTTTTTTTGATTCTAAAGCAATTTTACGGACTGGCACTAGGATTCTTCGCCTACAACTCAAATTTGCCTGCTGCATTGCCTTTGGTAGCACAGGTTTTCGGCCTGATCTTTTTTTATTTTTAATGTGCCAACTGTATCAAACTTTTTTTATTAAGTGGTAGACAGTTCTACGCGAAATTTGATATATTTCAGCTATTTTGGCCGCAGGTGTACCGGCTTTAAACCTAGCAACAATACCAGCCAGGCCTCAACCATTAACTCTTTTTTGTTTGGGCATTTTATTTGGCGAACTGTAATAGGAAAATGATTAAATCTAATTTTATTCAATGAATTTAAATGTATTTAAGCAAAACAAACCGGCGCGGTAAACCACAGGCCCAATCACTGAAGAAGAAATTGCGTTGTGAAAATAATTGTGATGAAACTGAAACCATTATTACCCAAATACTTCTGACAACTGATAAAGATCTCTTCATTTGCCTCTTGCTATTTGCGCATAGGAACAGTTATTTTTCAATTCTTCTTTCATCTGACTCTGCATAGGTTTTGAATTTGCAAAAGCAAAAGTTTTTTTTTGCATTTCACCTCCCACTTGCTGCACAAACCCAACTGTTTGTGACCCATGCACTAAAAATGCACTTTGTGAAAATAATTTTGACCATGACTGTATATCCAGTTTGCCTAGCCATTAAATGAATTAGCTGAGTATCAAAAGTGTGTAGAAAGAACTCTGGTCGTCTTTATGTCCCCGACATCTCAAAGTTTATCATCTTCCCAAATACTCTCTGGAGCCTAAAACGGCCTTGTTCTCCACTTTAGCCTCTTTGGATCAGGTTTCTCTAAGCAGCTATCAGCTTAACGCTTGCAAGAGTCGGGTTCACATCCTTCAATCACTGTGCTGTGCCAGAAGGTCAATGTCGATGCATATACCTTTCAAAATTCCTTCTAAATTCTTCTTTTTCAATTACCGTAGAAGTAATCTTTCATCTCCTCACCACTTTCTTCGTCAGTAGAAATATCCCAATCGAAGTTTAAATCCGTTCAATTTCTTTGGTGCAGACAAACCTTTCACTCGGTGAAAATTATTATCACGAATGCCCAAGGTTGCTCACAAACAGCTTAGAAGTGTTACTTACTTATTGTTTTCACTACTTACTAAAGTTTGACTAAAATCACTTTATCTTGTTAACTCTTTGCTGTGTTTATACTTTAGGTTCTTTTAAGAAGTATTATAAAAGTAAATTAATAATTCAAGCACCGAATATCGAAACAATAATTATTGTGATGCGCGTGCTATTTATTGCAAATTCCTGCAATTAATCTCCAAATGCGTTTTGCTTTTATATTTAGAGTAGACACATAAAGCACCGTTATCATAAAGAATCAGCAGATAAAACAAAGGCACTTACAGTTAGCTCTGAAAACATAGGAAATTGCTCACAAAGCAGCGTTGGGTGCAGAAAGGGTTAAGTTGGTATCTTTCTACTATCAGTAGGCGAGTATGTAGGCTTTGCCGGTTGAAAGTGTTGTTATGCTGTTGTTTACTATGCATTTGTACAGTTCGCTTCCCGCTGGAGCTTAGCATTGAAGTCACCTCCTACTACGCTTCCATATTCCAAGGTTAGGATTTACTTGCATGAATTTGTTTTACAAGTAACATTATCATGTTAAGTAAATTAGCGTAGGATCAGACTGTTTTCCTAATAGTTGCTCTATTCTCTCCAGTGATGTGTTTGTTTTACTTTGTTTCCTGCAGCAATTTGGGCATAAGATTGATAATCGTTACTTTGTTGGGTATATGTTAGGCATTAGGCGGAACAGCTTTGCTGGATTCCTAAATCATTTTTACTCTCAGATCATTATTTCTATTTTCTATTTTTTTGGACAAGAGTTCTGATAGAGATTCTACACCCTTTGTAGCTGGCGGCGTGTTCTTCGTAGCAGTTGGCACGGTACATGGTTGTTCTGTATTTTTTCGGGCAAATGTTGTAGGTGTCGAGAAGGATTTTACACAGCCGGTACGTTTTGGTACAATATGATTTAGTATGTCGAATTCCTGGCGGCTATAGCATTGAACGATTTCATTGTGGGGAGCTCAATATTTTATTTACATTATATATGTCTAGGTTTTTTGTTAGGCTCAATATCTACATAAAAAACGTGTTCAGTGACGTTTGGTCCTTTTGGCTTTTAATATTACTTATGTTTCTAACAACATGACCTTTTGACTCTTCATCACTTTTTTAATTTCATCTAAATTTGTGGAAAAATGCAAATTCTTAATAACAACTCTAAATGCTCTGTCATCCTTAAGCTGGTATGTGTGGTACCGCACAATCATTGATAAGTGTTTTGACTAATTTTCAAGAATTCTTTGTACTTTTAACCATTACTCTTACATGTCCGCAACGTTGAGTCTTATAATAAAAAGTTCTGTTTTAGTTTTAAGATAGGTTAGCTTTTCACTTATACCATTGACGTCAGAGAAAGATAGGTGGGGGGGCTTAGCAAAATCAGTTGCACTGTCTTCGTTTTACCATTTCGGATCTTCGTTTTGTTATGTTGTTTCCTGTTTTGTCCGGGCAATCCGTCGCTTAAGAGAGCAAGAATTATTTGCGCTGGTGCTTGATGAATTGTCCAGGGAATCCTGTTTTCTTTGAACTTCGGGAGGGGCTTGAAGTCTCTTTTTTTTTGGATTTTATTTCTCTGCCATTTCAAAGCAGTTAGGTCTTCGTCGGTGTCGCTCTGCTTGAGTATTAAAGAAGACAATGATTGTTGAGTGCTTGTGTCCGCGCTTCGTGCCTCAAGATATATGACCAAAGCAAAGACACTAGAATAATTCTAATTTGATATGACGTTTTGCAATAAACAGTTAACATTTTTTTTTATTTTATAAATTTTTTATTTTTTTCTACTTCGTATTATTTTTATGAAATATTTTTTTTCTCAGTGTAATGACTTCTTTTTCCAGTTTTTTTTTTATATTCCAATTTGATATCTTAAATGGCGCACCAATTTCATCATATTCTACGAAATTGGCCAAAACTCCCCAAATATGTATGTACATATGTAAATTCGTTACTGCGATCAGAGATTGATTTCGGCCCGAAAATCGCCTTCTAGCACAACACGCACACATATACACGCGTTCTCGTCTTTTTTGTTTTACTCCGCACAAGCAAAACCAAGTCTATTTTTTAGATTTCTTACGCTCAGCGTGAGAGCAGCGGAAAAGAGAGCAATTTTGGCCGTCACCAAAAAAAAGTGAAACATAGTGCCAAACCAGTGTATGGCTGTTACGCATCTTATTATTCTAGTGTCTTTGATGCAGGCCATGTGACTTTTTGCTTTAAATGTGTACATACTTTCCAACACGCCACCTCAAAGTAAAGATTGCTGTACTTTTATTACTCACGAGACTGTGCGTCCTTCTGACGAATAATTTTTGATCCAGCATTCGTTGCGAGGTGTTGGGGAGACAGAAAACCAACCAGATCAATTGAACATATTATTTACATAAATTCAGTTTTTTGCAAACTATTTTAGCTAAAAGTGTGTAGTCATCTTTGTAAGAAACTCAAAATTATCCAGTAAACTTAATTAAATTTAGTTAAATGATAGTTAGTTTAGTTAGTTCAGTCTGGTTCCTCGTCAGTTCAATCCTAAGAATATAATGTTTTTAATTCATTCTGAGAGTCAAGTCCACTTCTCCAATATAATGAATCTCTTGCAGATGGTACCGGCAAGTTGTAAATTTGTAGATATATATACAGTTTGTCAAAGAAACTATTTTACGCCGTGAAATAGGATTGAATTTTCACTTTAAAGGTCAAAATTAAGGGTTATTTCTTTAATTAAACATAATTTTTAATGAAATATAATTAAACAGTATTTATTTTACTTATAAATTAAAACAAATTCAAAAGAAATATCAAATATACAAAGTAAACAACAAATTCCAGTTTACACTTTTGAGAGTGTAAGAAACTCCTTACATTTTGTTTCCTACTTTGTTTTGCTCTTTTTTTCTAGTAGAACGAACTCGATTTTCCGTTATTTTGGCATTTGCATTCCTTTTTTGCTTGCTTCTATTGAAATTTTTTTTTTTACTTTGCTTGTGAAATTTTGATCGAATGAGTTAGTAAATTTAATAAAATGCCTGGAAATAAGATTAGCTTTTGAAGTGACTAAAATAATATACTAAAACCACCAGTTGGAAAGTCTATTCCAGAATTAGTATAAATGTTTCTTGTATCCCGTAAGACCGTCTACAATGTTTTGAGAAATAGCGAAAAAAAGAGAACGAGGCTTGAACCTACAAGAGTGAGTGGGCGCAAAACTAAAATTAGCAAGCGTGTAGACCACTTATTAATGTACGAAAAGTGATTGCGAACCCCAGATCTCAGTCAGATCCTTGCTCAGGATATCAGGCAGAATGTAGCCTAGTTGTGCCACACAAACTGTGCATAAGTCATTCCTACGCCATAGGTACTCTTTAAAGGTTGCAGAAAAAAAGCCTTTGCTATCAGAGGTCAATATAGAAAAGCATCATTCATTCGCTGTGAGCATGATGGATCATGCGGAAGAGTACTGGGATGACGTAATATTTTAATGACGAAACAAAAAATGATGCTCTATTATAACGATGGGCCAAGCAGAGTATGGCGCAAGCTGTTGAGTGCTAAGAAAAAAACAAAAATATCATTCCAACAATCAAATTTGGAAAATTATCAGTGATGATGAAGTTGGGGCTGTATCTCAAGCCATGGAGTGGGCAAATTAGCCTTTATTGAAAGCACTATGAATGCCGTGCAATATCTAGATATTTAAAATCAAATTTGAAGGCCAGTGCAGAAAAATTTGGTCTATTTAACAACAACAAGCCAAATTTAAGAAGTTTTATCAGGACAATGATCCCAAACATAAAAGGAAAGTTACGTGCGCAGCTGGCTCCTTTATAACTGTGGCAGGGTGATCGATACCGCACGCCCCTCAGAGTCTTGATCTGAACCCCATTGAAAATTTGTGGGCCTACTTAAAGAAGAATGTGGCAAAGGGGCGCAAACACGACAACGGCTCATGGCTGCGATAGAGTGGGAAAAGATCCCGCTTGAATATGACCTAAAAAACTCATCCATTCCATGAAAAAAAAGCTTCAACTTGTAGCCGACCAATGGGGGTCATACTAAATACTACAACTTTTCAAATTTAACAAAATAATTTAAAAATTTAGAAGTTAAACTTAGGTTTAGTGTTTTGTGTAAAGAGTTTCTTGAAACTCCTCAAAGGGTGTTTAAGCAATTCGTTGTTTATTTTCTTGTATGTTGATATTTTAGTTTGTTTTTTTAATTTATAAGTAAAATAAATATTGTTTTAATTATATATTTCCTAAAAAAATTGCGTTTAATTAAGCAAATAACCCTTAATTTTGACCGTTAAAATCAAAAAAATTCATCCATTTCACGGTGTGTAAACAGTTTCTTGACAAACTGTACTTGTCGCAGATTTATTTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTAGAGAGTGATGCCGAGTATAAAGTGATTCAGATCCGACATCAGAATTGGGACCGCCTACTCCAACTTCCTGTAGTTTCATTGTGTCATAAGATCATTTTGATAACTTTAGCTATTTCTTTATTTGATCAATTTGAGGAACAGGAAGGTCCCGCTCCATTCGAAATTAATTCGTCAATCCTCTTATGATCTACATACAAGGTTTCTTAGCCTAGAGTCGAGGAGCAGCGCTGCCGGCATAGCCTGCAACACAGCAACGCTGTCGTATCTTATATATATGTATATATATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAGGAGTGGTATAGGCACACATATAAGCGATGTACTTGGCCAGCAGAGGAGCTACTGACCAGGCAATTATGTATGTTAGCCCTCAAGTGGGTGGCGTATTACGTATACACTTGTGCTGGACTGTTATAGCACACATTGCAACAGAGTACTGCAGTATGAATACACATAGGTACAGTGCTTAACCGATATGTGTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTAGAGTCGCAGAATGCCATTTTTCTGAACTGTTAAAGAGTGCAAAACTGCAAAGAGACCCAAAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCTGAACGCACGAGCAGACACTCAATCCTGGTGCGGAGACCAAGTCACCACATCGCCGTGAGACGGACGTCTTAAATTACGCGGCGCGAAGTACTCGAAACCATAGAAGTTGTGTCGGCCGGTGTGTGCGGCAAACTGGCAAAATCACACGGTGGAGTCGCGCCGCCAGTTCTGCGCTGCAATCACTGGAAGTTAATTGTGCGCCTGTTTCATGTAAATAGGTAATTTATTATCTTGCGATTGTTGCAGCGGATAAACTGCTGATAGCGCAGCGGAGCGATCTGGAGAGGAGGCGTTGCCAGATCAACCGTGTGATCCAGTGTTGTGTTGCGACAGTAGGGCGCGAAATTCAAAATTGCGATTTAAAATTAAGCCGTTGAAATTTAATTTAATTTAATTTTGATTCTGGTAGCACAGGAGCGCACAAGTCTTTAAGAAAGGGAAAAGGCACAAGGTCGCGGACAGACCAAATATCATCCTCTCACCGTGCTGAATTGCCCTGGCTTAAGAGGCTCTGGTGTCCGAGTCGAGGCAGTACAAACCTCCATCCGTAAAGCCAGGGAAATCCGTGGCCTACGTGACCTAAGAGTAACCTTAGGCCATCCTTCAGTTGATGGACAGCGCAGTGGGGGGCAGTCCCCTGATCGCAACGGCCCGTTCAGGAGGAGCTCCCGACTTTCCCACACCAGAGTCGGTAACCCGACCCATGGTGACGGAATCTCGGTCCCGTCAGTGGCAAGGGTGAGCACGCAGGCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGAGGTGGAGAAATTGGCTCCTACAGCATCTACGGCCGCGACAAGTCAGAAGACGATGGACCACATCGCCGTGCCATCGCAAAGACGGGAGAGGAAGTCCCCGGCTTGTTCCCCTCACGGCA
->8a3376ac-f356-4dd7-8c63-c7e3faa479bf
-CTCTTCGTTCAGTTACGTATTGCTAACAAGCTGGGGACTTCCTCCCGTCTTTTGCGATGGCACGGCGTGTGGTCCATCGTCTTCTGACTGTCGCGGTCGTAGATGCCAGCGAGGCCAGAACACCCACCTCTACAGCATCGCTGCGGTCGATAGTCAACGGCGGCTGGGGGCCTGCGTGCTCACCCACTTGCACCGACGGGACCGAGATTCCGTCACCATGGGTCGGGTTACCGACTCCTCTGGTGGGGGATCTCGAGATCCGGAAGCTCCTCCTGAACGGGTCGTTGCGATCAGGACTGCCCCACTGCACTGTCCATCAACTGAAGGATGGCTAAAGGTACACCTAGGTCACGTAAGACACAGTTTTGGCTTTTACGGATGGAGGTTTGTACCGCCTCGACTCGGACACCAGGAGGCCTCTGCTTAGGCGCAGCACGGTGAGAGGATGATATTTGGTCTGTCCGCGACCAGCTGATGCTGCTACGCTTTCTTAAAGAGACTTGTGCGCTCCCAGTTACCAGAATCAAAATTAAATTAAATTAAATTTCAGCGGCAATTTTAAATTTAATTTTTGAATTTCCGCGCCTACTGTCGCAACACAACACTGATCCGCACGGTTGATCTGGCAGCATACCCTCTCCAGATCGCCCGCTGCGCTATCGGCTGTTTATCCGCTGCAACAATCGCAAGATAATAAATTACCTATTACATGGAAACAGGCGCACAATTAACTCGCGTGATTGCAGCGCAGAACTATGGCGCGACTCCACCGTGTGATTTTTGCCAGTTTGCCGCTTTTACACCGGCCGACACAACTTCTATGGTTTCAGTATTTCGCGCCGCGTAATTTAAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCCCGCACCAGGATTGAGTGTCTAAACCTGTGCGTTCAGAAGAGTTAAACTTTGGCAATACGACGGCATTTGGTTTTGGGTCTCTTTGTGAGGTTTGCACTTCTTTTAACAGTTCAGAAAATGGCGATTCTGCGACTCACAAATTGTCAGCAAATTGATTTTCACTATTACAATGAGTATGCACACATATCCGGTTAAGCACTGTACTATGTGTATTCATAATTGTAGCACTCTGATGGTGCAATGTGTACATAAACAGTCCAGCACAAATTAATACGTAATACGAGCACCCACTTGAGGGCTAACATACATAATTGCTGGTCAGCAGTTCTCCCGCTGGCCAAGCGCTGATCAACTGTATTGTGCCTATACCCTCCTCCTCCAGCACCATCGCTCGGCGACAGTACATATATATATACATATATAAGATACGCATATAAGCGTTGCTGCGCTGCTGAGCTATGCCGGCAGCTGCTCCTCGGCTTAGGCTAAAGAAACCTTTGTATGTAGATCAGCAAGAGGATTGACGAATTAATTTCGAATGGAGCAGGACCTTCCTGTTCCTCAAATTGGATCAAATAAAGAACAGCTAAAACACAAATGATCTATGACACAATGAAACTACAGGAAGTTGGAGTAGGCGGTCCCACTTCTGATGTCGGATCTGAATCACTTTATACTCGGCATCACTCTCTACAGCGGACAAAGTAACAGAAAACGGTCGTTAACTTGAAATTAAAAATAAATCTGCGACAAGTACAGTTTGTCAAGAAACTGTTTACACACCGTGAAATAAGATGAATTTTTGATTTTTTAACGGTCAAATTAAGGGTTATTTGCTTAATTAAACGCAATTTTTTTTAGGAAATATAATTAAACAATATTTTATTTACTTATAAAATTAAAAACAAATTCGTATCAAATATACCGAAAATAAACAACGAATTCCAAGTTTAAACACTTTTTGAGAGTTTCAAGAAACTCTTTACACAAACTAAACCTAGTTTAATCTAAATTTTTAAATTATTTTGTTAAAATTTGAAAAGTTGTAGTATTTAGTATGACCCCCATTGGCTGGCTACAAGAAGTTGAAGCTTTTTTCATGGAATGGATGATGAGTTTTTTTAGGTCATATTCAAGGCGGGATCTTTTCCCACTCTATCGCAACCATGAGCTGTTGTCGTGTTTGGTGCCCTTTTTTGCCACATTCTTCTTTAAGTAGGCCCTGATTTTCAATGGGGTTCAGATCAAGAGACTCTGAGGGGGCGTATCCGATCCACCTTGCCACCAGTTATAAAGGAGCCAGTTGCGTACATTGCACTCTTTATGTTTGGGATCATTGTCCTGATAAAACTTAAAATTTGGCTTGTTGTTGCTAAATAGACCAAATTTTTTCTGCACTGGCCTTCAAATTTGATTTTAAAATATCTAGATATTGCACGGCATTCATAGTGCTTTCAATAAAGGCTAATTTGCCCACTCCATGGCTTGAGATGGCCCAAATCATCGCGATAATTTTCAAATTTGATTGTTGGAATGATATTTTGTTTTCTAGCGCACTCAACAGCTTGCGCCATACTCTGCTTGGCCCATCGTTTATAATAGAGCATCATTTTTGTTTCGTCACAAAATATTACCGGGATCTTCCGCATGATCCATCATGCTCACAGCGGAAATGAATGGCAACTTTTCTATATTGACCTCTGATAGCAGAGCTTTTTTTTTTTCTTGCAACTCTTGAAGAGTACCTATGGCGTAGAATGACTTAGCGCACAGTTTTATTATTAGCACAACTAGAGTCACATTCTTGCCTGATGTATCCTGAGCAAGTGATCTGACCGAGATTCGGGGTTCACCAATCACTTTTCGCATAATAAGGCGGTCTACACGCTTGCTAATTTTAGTTTTGCGCCCACCACTCTTAGGTTCAAGCCTGTTCTCTTTCAAGCGATTAAAAACATTGTAGACGGTCTTGCGGGATACAGAAAACGATATACTAATTCTGGAATAGATTTTCCCAACTGGTGGTTTTAGTATATTATTTGGGTCCTTCAAAAGCTAATCACTTTCCAGGCATTTTATTAAATTTAATAACTCATTCGATCAGCAAAATTTCACAAGCAAAGGTAAAAAAATTTCAATAGAAGCGTTGTAAAGATGCAAATGCCAAAATAACGGAAAAAATCGAGTTCGTTCTAAGAAAAGAGCAAAACAAAGTAGGAAAACAAAATGTGTAGGAGTTTCTTGCCACTCTCAAAGTGTGTAAACTTGGAATTTGTTGTTTTAATTTCTTGTATATTTGATATTTTGAATTTGTTTTTTTAATTTATAGAGTAAAATAAATATTGTTTAGTATATTTCGTTAGAGTACGTTTAATTAAAGAAATAGCCCTTAATTTTTTGACCTTTAAATTAAGAAAAAATTCAACTTATTTCACGGCGTGCAAATAGTTTTCTTGACAAACTGTATATATCCTACAAATTTACAACTTGCCGGTACCATCTGCAAGATTCATTACATTGAGAAGTGGACTTTGACTCTCAGAATGAATTAAAACATTATATTCTTAGATTGAACTGACGAGGAACCAGACTGAACTAACTAAACTAACTATCATTTAACTAAATTTAATTAAGTTTGCGATAATTTTGAGTTTCTTACAAAGATGACTAATATTAATTTTTTTTAGTTAAAATGGTTTGCAAAGAGCTAATTTATGTAAATAATATGTTCAATTGATCTGGTTGGGTTTTCTGGGTTATACTAACACCTCGCAACGAATGCTGGATCAAAATTATTCGTCAGAAGGACGTGCACAGTCTCGTGAGAGTAATAAAATACAGCAATCTTACTTTTGGTGTGTGGAAAGTATGTACACATTTAAGCAAAAGTCCACGCTGTGCATCAAAGACACTAGGAGCCAGCCAAGATGCGTAACAATGCTGGTTTGGCACTATGCAGCCACTTTTGGTGACGGCCAAAGTGCTCTCTTTCCGCTCCTTTCACGCTGAGCGTAAGAAATCTAAGAAATAGGAGGAATTTGCTTGCTTGTGTGAGTAAAACAAAAAGACGAGAACGCGTATATGTGTATTGCGTGTTGTGCTAGAAAGGCGATTTTCGGGCCGAAATCAATTCTGATCGCAGTAACGAATTTACATATGTACACTTTGGGGAGTTTTGGCCAATTTCGTAAGAATATATGATGAAATTGCGCTGTTTAAGATATCAAATTGGAATATAAAAAAACTGAAAAAGAAGTCATTACACTGAGAAAAAATATTTCATAAAAAATAATACGAAGTAGAAAATAAAAATTTATAAAATAAAAAAAAAATGTTAACTGTTTATTGCAAACGTCATATCAAATTAAATTATTCTAGTGTCTTTGCTTTGGTCATATCTTGAGGCACGAAGTGCGGACACAAGCACTCAACAATCATTGTCTTCTTAATACTCCAAGCAGAGCGACACCGACGAAGACCTAACTGCTTTGAAATGGCAGAGAGTAAAATAAAATCCAAAAGAGACCAAGCCTCGAAGTTCAAGAAAACAGGATTCCCTGGACAATTCATCGAAGCACCAGCGCAAATAATTTCGCTCTCTTAAGCGACGGATTGCCCGACAAAACAGGAAACAAATATAACAAAACGAAGATCTCGAAATGGTAAATAGAGACAGTGCAACTGATTTTTGCTAAAGCCCCACCTATCTTTCTCTCCTGACGTCAATGGTATAAGGTGAAAAGCTAACCTATCTTAAAACTAAAATTAAAGAGAACTTTTTTTATTATAAGACTCAACGTTATGGACATGTAAGGTAATGGTTAAGTATTATTGAAAAGAATTCTGAAAGGTGATTAAAACGCTTATATGATTGTGTGCAATTTCCACACATACCAACTTAAGGATGACAAGGCATTTAGAGTTGTTATTAAGAATTTGCATTTTCCACAGAATTTAGATGAAATTAAAAGTGATGAAGAGTCAAAAGGTCATGTTATTAGAAACTATAGGTAATATTAAAACCGTGCATTAAAACGTCACTGAACATGTTTTATGTAGATGTTAAGGCCTAACAAAAAAAAACCTAGACATATATAATGTAAAGATAAAATATTGAGCCTCCCCACAATGAAATCGTTCCATTCACTATAGCTGCCAGAATTTGGACCTTACTAAATCATATTGTGCAAAGCATTACCGCTTTAATTAGCAAATCCTCTTCTCTCGACACCCAAGCAACATTTGCCCGAAAAATACAGAACAACCAGCAAAATGTGCCGAAAACTGCACACCGAAGAACACGCCGCCAGCTACAAAGGGTGTAGAATTTGTCGAGACTCTTGTCCAAAAAAATATAGAAAATGGAAATAATGATCTGAGGTAAAAAAATGGTTAGGAATCAGCAAAGAGTTTGTTCCGCCTAACAGTAACATATACCCAACAAAGTAACGATTATCAATCTTATGCCCAAATTGCTGCAGAATAATAAAACAAGCATCACTGGAGAGAATAGAGGCAATAATGGGAAAACAGTCTGAACTTGCAAATAATTTACTTAACATGATAATAATGTTACTTGTAACAAAATTATGCAAGTAAAATCTAACCTTGGAATATGGAAGCGTAGTAGGAATTTGAGAAAACTTCCAATGCACAGCTTCCAGGGACGAACTGTGATACGTAGCTAACAACATAACAACACTTTCAACCAGCAAGCCATGCAGCTACTGATAGTAGAAGAAGATACCAAACTTAACCCTTTCACGCAATAGCGTTTAGCGACGAATTTCACATGTTTTCAAACTAACTGTAAGTGCCTTTTGTTTTTATCTGCTGGATTCCTTTATGATAACAGTTGCTTATGTGTACTCATGCCAAGGCAAAAACGCATTCATTGCAGGAATTATTTGCAATCATGCGCGCATCACAATAATTATTGTTTCGATATTCAGTTGCAACTTTGGAATTATTAATTTACTTTTATAAATACTTTAAAAGAACCTAAAATTATAAACAGCAAAAGAGTTAACAAGACAGTGGATTTAGTCAAACTTAGTAAGTAGTGAACAATAAGTAAGTAAATAATTTTTCTAGTTTGCTTGTGAGCAACCAGACGTGATAATAATTTTCTTTGAAATTGAAAGGTTTGTCTAACAGAAAGAAATTAGACGGGATTTAAACTTCGATTGGGATATTTCTACTGACGAAGAAAGTGGTGAGGATGAAGAGACATTTCTACGGTACTGGAGAAGAATTTAGAAGAATTCTTGAAGGGGAGAAAGTATCGACGCAGTGACCTTCTGGAAAATACAGTGATTGGAAGATGTGAACCTGACTCTTGCGTTTATTTGTTGACAGTTGCTTAGAAAATTGATCCAAAGAAGGGCTAAAGTGGAGAACAAAGAGCCGTTTGTAGCTCAGAGAGTATTTGGGAGAGATGACAAAGCTTTGATGACCGGGGACATAAGAACTGACCGTGAGTTTCTTCTACACACTTTTTGTTGATACTCAGCTAATTCATTTTAATGGCTAGAGCAGAAGCTGATATACAGTCATGGTCAAAATTATTTTCACAAAGTGCATTTTTTTGTGCCATGGGTCTAAAACAGTTGCTTATTGCGAAAAAGCAGAAGTGGAGGTGAAATGCAAAAAAAAAAGAAACTTTTAGCTTTGCAAATTCAAACCTATGCAGAGTCAGATGAAAGAAGAATTGAAAAATAGGCATTCCCCTATACGCAAAGGAAGAGGCAAATGAAAGAGATCTTTATCAGTTGTCAGAAGTATTTGCACGGTTTCGTCGCATCACAATTATTTTCACAACGCAATTTCTTCTTCCAGTGATTGAGTTTAGAGTGACAAGTGCCAGTTTTGTTTTGCTTAAATACATTTAAATTATTGAATAAAAAATTAGATTTAATCATTTTTCTAATACAGTTATTAAATAAAATGCACCCAAAACAAAAGAGTTAACAGTTGGGGCCCGGGCTGTTATTGTTGCTTTAGGTTTAAAGCCAGTACCTACGGCCAAAATGACTGAAAGAAATATATCAAATTTCGCGTAGAACTGTATCTGCTACTTAATAAAAGTTTGATACAGTTGGCACATTAAAAAAATAAAAAAAAAAGATCAGGCCGAAAACCTGTGCTGGACCGAGCGAAATGCAGGCAAATACTTGGAGTTGTGGCGAAGAATCCCTGTAGATGCCAGTCCGGTAAAAATTGCCTTAGAATCAAAATACAATTGGCAAACAAGTTGAGAGTAGTTCTACAATTCGTCGCAGGCTAAAAGAAGCTGATTTTTAAGACATACTTTGTTCGCAAAACGATTAGAATCCACCAACCAACAAACGTCTTCGATTTGCGTTTGGAATATATTGCAAGCCTCTTGACTTTTGGTTTAATATTTTTATGGACTGATGAGTCTGCATTTCAGTACCAGGGTCATACAGCAAGCATTTTATGCGTTTTGAAAAAATAATCAAAAGCATTTGGCAGCCCAGCCAATAATAGATTTGGTGAGGGCACAGTCATGTTTTTGGGGATGTCTTTCCTATTATGGATTCCGGAGACTTGGTACCGATAGAAGGTACTTTAAGTCAGAACGGATACCTTTCTTATCTTAAACCATGCTTTTACGTCTGGAAATAGACTTTTTCCAACTACTGAATGGATTCTTCCAGCAGGACAATGCTCCATGCCATAAGGGTAGGATACCAACAAAATTTTTTTAAACGACCTTATCTGGCGGTTCTTCCGTGGCCCCCAAAGCCCAGACTATATCATTGAAAACGTTTGGGCTTTATTAAAACCAACGAACTATTGATAAAATAGAAACGAGAGGGAGCCATCATTGGGGAAATAGCGGAGATTTGGTCCAAATTGACATTAGAATTTGCACAAAACTTTAGCAGCTACGTAGCCCGCA
->7ccf42c2-9824-4328-bb9f-4e88142b2a42
-TTGGTATGCTGGTTCGGTTACGTATTGCTCCCGTCTTTTTTTGCGATGGCACGGCAGTGTGGTCCATCGTCTTCTGACTTTGTCGCGGTCGTAGATGCTGTAGGAGCCAATTTCTCCACCTCTACAGCATCGCTGCAGTCGATAGTCAACGGCGGCTGGGGCCTGCATTAACTCACCCTTGCCACCGACGGGACCGAGATTCCGTCACCATGGGTCGGGTTACCGACTCCTCTGGTGGGGGGGATCTCGAAAGTCGGGAAACTCCTCGAACAGGTCGTTGCGATCGGGGGGACTGCCCCACTGCGCTAATCCATCAGCTGAAGGATGGCCCTAAGGTTACCTAGGTCACGTGAGCCACGGATTTCCCTGGCACACGGATGGAGTTTGTACCGCCTCGACTCGGACACCAGAGCCTCTGCTTGAGCACCAGCACGGTGAGAGGATGATATTTGGTCTGTCCGCGACCTTTGTGCCTTTTCCCTTTCTTAAAGACTGTGCGCTCCAGTTACCAGAATCAAAGAATTAGAATTAAATTAGAGATTTCAACGGCAATTTTTTAAATTTAATTTTTTGAATTTCCGCATACTGTCGCAACACAACACTGATCACACGGTTGATCTGTGGCATACTCCACTCTCCAGATCGCCCTGCGCTATCAGCTGTTTATCCGCTGCAACAATCGCAGATAATAAATTACCCTGTTTACATGAAACGGGCGCACAATTAACTCGCGTGATTGCAGCGCAGAACTATAGCGCGACTCCACCGTGTGATTTTGCCAGGTTTGCCGCACACACACCGGCCGGCCTAACTTCTATGGTTCGAGTATTTCGCGCCGCGTAATTTAAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCCCGCACCGGGATTGAGGTGTCTAAGCCTGTGCGTTCAGAGTTAAACTTTGGCAATACGACAGCGGTGAGTTTTGGGTCTCTTTGTGAGTTTTGCACTTCTTTTAACAGTTCAGAAAAATGGCGATTCTGCGACTCTAGAATTGTCAGCAAATTGTTTTCACTATTGGCCAGAGTATGCACACATATCGGTTGGCACTGTACTATATTGTATTCATAATTGTTAACTCTGTTGCAATGTACATAAACAGTCCAACTAAGTGTATACGTAATACGAGCACCGCGAGGGGGGCTAACATACATAATTACCTGGTCGCCAGTTCTCCCGCTGGCCAAGCGCTGATCAACTTATATGTGCCTATGCCACTCCTCCTCCAGCACCACCATCGGCTCGGCGACGTGCATAACAACCATATATATGAATGCGCATATAAGCGTTGCTGCGCTGCAGGCTATGCCGACGCGCTGCTCCTCGACTTAGGCTAAGAAACCTTTGTATGGCAGATCATAAGAGGATTGACGAATTAATTTCGAATGGAGCCGGGACCTTCCTGTTTCTCAAATTGGATCAAATAAAGAACAGCTAAAGAAACACAAATGATCTATGACACAATGAAACTACAGGAAGTTGGGTAGGCGGTCCCACTTCTGATGTCGGATCTGAATCGCATACTCGGCATCACTCTCTACAGCCGGACACAAAGTAACGAAAACGGTCGTTGGCGGAATTAAAATAAATCTGCGACAAAAATTACAGTTTGTCAAAGAAACTGTTTACACACCGTGAAATAAGATGAATTTTTTTTGATTTTAACGGTCCAAAATTAAAGGGTTATTTGCTTAATTAAACGCAATTTTTTTTTAGGAAATATAATTAAACAATATTTGTTTGCATGAAATTAAAAACAAATTCAAAATATCAAATATACAAGAAAATAAACAACGAATTCCAGAAGTTTAAACACTTTTGAGGTTCGAAACTCTTTTACACAAAAACACCAC
->c8a09f75-6f50-42c6-b702-2046286f02c1
-TTGGTACTTCGTTCAGTTACGTATTGCTAAACTATTTACACGCCGTGAAATAAGTTGAATTTTTCACTAAAGGTCAAAATTAAGGTTATTTCTTTAATTAAACCGCAATTTTTTTAATGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAACAAATTCAAAATATCAAATATACAAGAAATTAAACAACAAATTCCAAGTTTACTTTTTGAGGTGTAAAGAAACTCCTTACACATTTGTTTTCCTACTTTGTTTTGCTCTTTTTTTCTTAGAACGAACTCGGTTTCCGTTATTTTTTTGGCATTTGCATTCCTTTTACAACTGTGAAATTTTTTTTTACTTTGCTTGTGAAATTTGCTGATCGAATGAGTTATTAAATTTAATAAAATGCCTGGAAATAGATTAAAGCTTTTGTTATTAAATAATATACTAAAACCACCAGTTGGAAAATCTATTCAGAATTAGGTATAAATGTTTTCTGTATCAATAGACCGTCTAATGTTTTTTAATCGCTTGAAAAAAAAGGCTTGAACCTAAGAGTGGTGGGCGCAAAACTAAATTAGCAAGCGTGTAGACCGCCTTATTATGCGAAAATTGATTGCGAACCCCCCGAATCTCGGTCAGATCACTTGCTCAGGGATATCGAACAGAATGTGACCTAGTTGTGCCACACAAAACTGTGCGCCAAGTCATTCTACGCCATAGGTACTCTTCAAGAGTTGCAAGAAAAAAAGCCTTTGCTATCAAGAGGTCAATATAGAAAAGCGTCATTCATTCGCTGTGAGCATGATGGATCATGCGGAAGAGTACTGGAATGACGTAATATTTTAATGACGAAACAAAAATGATGCTCTATTATAACGATGGGCCAAAACATGAGGTATGGCGCAAGCTGTTGAGTGCGCTAGAAAACAAAATGTTCCAACAATCAAATTTGGAAAATTATCAGTGATGATTTGGGGGCTGTATCTCAAGCCATGGAGTGGGCAAATTAGCCTTTATTGAAAGCACTATGAATGCCGTGCAATATCTAGTATTTTTAAAATCAAATTTGAAGGCCAGTGCAGAAAAAATTTGGTCTATTTAGCAACAACAAGCCAAATTTTAAGTTTTATCAGGACAATGATCCCAAACATAAAGAGTGCAATGTACGCAACTGGCTCCTTTATAACTGTGGCAAGGTGATCGATACCACGCCCCTCAGAGTCTTGATCTGGAACCCCAGTGAAATTGTGGAATACTTAAAGAAGAATGTGGCAAAAGGGGCACCAAAACACGACAACAGCTCATGGCTGCGATAGGTGGGAAAGATCCCGCTTGAATATGACCTAAAAAAACTCATCCATTCCATGAAAAAAAGCTTCCAACTTGTAGCCAAAGCCAATGGGGGTCATACTAAATACTGCAACAAATTTTAACAAAATAATTTAAAAATTTAGGATTAAGCTTGGGTTTAGTGACATTGGGGTTTCTTGAAACTCTCAAAGTGTTTAAACTTGGAATTCGTTGTTTATTTTTTCTTGTATATTTGATATTTTGAATTTGTTTTTTAATTTATAAGTAAAATAAATATTGTTTAATTATATTTCTAAAAAAAAAAAAATTGCGTTTAATTAAGCAAATAACCCTTAATTTTGACCGTTAAAATCAAAAATTCATCTTATTTCACGGTGTGTAAAACGGTTTCTTGACAAACTGTACTTGTCGCAGATTTATTTTTTAATTTCAGTTAACGACCGTTTTCTGTTACTTTATTGTCCGCTGTAGAGAGTGATGCCGAGGTATAAAAGTGATTCAGATCCGACATCAAAATTAAGGACCGCCTACTCCAACTTCCTGTATGGTTTTCATTGTGTCATAGATCATTTATTGTTTTAGCTGTTCTTTTATTTGATCCAATTTGAGGAACAGGGAAGGTCCACTCCATTCAATTAATTCGTCAATCCTCTTACAGTCTACATACAAAGGTTTCTTAGCCTAAGTCGAGGAGCAGCGCTGCCGGCATAGCCTGCAACGCAGCGCTTATATGCATATGTATATATATGTATATATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAAGTGGTATAGGCACTGCAAGCGTCAGCGCTTGGCAACGGAGGAACTGCTATTGAGCAATTATGTATGTTAGCCCTCAAATTGGGTGCTCGTATTACGTATACACTTGTGCTGGACTGTTTATGTACACATTTACAACAGAGTACCACAATTATGAATACACATAGGTACAGTGCTTAACCGATATGTGTGCATACTACAATAGTGAAAACAATTTGCTGACAATTCTAGAGTCGCAGAATGTCTTCCATTTTCTGAACTGTTAAAAGAAGTGCAAGAAGAGCTACAAAGAGACCAAAAACTCAATGCTGTCGTATTGCAAGTTTAATCCTGAACGCACGGGCTTGGGCATAATCACAGTGCGGAGACCAAGTCTACATCGCCGTGAGACGGACGTCTTAAATTACGCGGCGCGAAATACTCTCGAAACCATAGAGAGTTGTATTGTCGGCCGGTGTGTGCGGCAAACTGGCAAAATCACACGGTAAGGAGTCGCGCCACTTAGTTCTGCATACCCAATCCGCGCGAAGTTAATTGTGCGCCTGAACATATAAATGGTATTTGGCTATCTTGCGATTGTTTGCAGCGGATAAACAGCTGATGATAGCGCAGCGGGCGATCTGGAGAGGCGTTGCCAGATCAACCGATGGCGATCAGTGTTGTGTTGCGACAGTAGGGCGCGAAACCAAAATTAAATTTAAAATTAACCGTTGTGAAATTTAATTTGTTTAATTTTTTGATTCTACGGTAACTGGGAGCGCACAAGTCTTTAGAGAAAGGAGAAAAGGCACAAAGGTCGCGGACAGACCAAATATCATCCTCTCACCGTGCTGGTGCCTAAGCAGAGGCTCTGGTGTCCAGGTCGAGGGCGGTACAAACCTCCATCCGTAAAAGCCGGAAATCCGTGGCCTACGTGACTGGGTAACCTTGGGCCTCCTTCGGTTGATGGATTGTAGCGCGGTGGGGGCAGTCCCCACAGTCGCAGCGACCCGTTCGGGAGGAGCTCCCGACTTTCGAGATCCCACCCAGAGAGGTCAGTAGCCCGACCCATGGTGACGGAATCTCAGAGAGTCCCGTCAGTGGCAAAGGGTGGCTTGCAGGCCCCAGCCGCCGTTGACTATCGACTGCAGCGATGCTGTAGGGTGGAGAAAATTGGCTCCTACAGCATCTACGACCGCGACAAGGTCGAAGACGATGCGGACCACATCGCCGTGCCATCGCAAAAGCAATACGTGAAAAAAAAAAGAAAAAAAGA
->a1a3d3fd-039b-4c44-a531-c5792f32eb92
-ATGGCCACTTCGTTCGTTACGTGTTGCTCGCTGGTCAGCGGCGGCTGGGGCCGCGTGCTCACCTTGCCATGACGGGACCGAGTTCCGTCACCGGCAGGTCGAGGTTACCGACTCATCTGGTGGGGGTCTCGAAAGTCCATCCTGAACGAAGATACCGTTCCAGTCGGGGGCTACACTTACTGCGCGCCATGTCCATCAGCTGGAAAGGACCTTCTAAGGTTACCTGGGCGAGCACCAGCCTTAGAGAGTTTCCCACGTAGGCGCCCGCATGTTCCCCTGGCTTTTTACGGATGGAAGTTTGTACCGCCTCGGCACTCAGACACAGGAAGAAATTCTTTACGGCACCCCAGCACGGTGAAGGATGATATTTGGTCATCCACCTTTGTGCCTTTCCCCGCCCAAAGACTTGTGCACTCCAGTAACAGAATCAAAATTAAATTAAATTAGAATTTTAACCGAACCGTTTAAGTTTAATTTTGAATTTCGCGCTCTGTCGCAACAACACTGATCACGCGGTTGATCTGTACGCGCCTCCCTCTCGATCGCCCGCGCCTGCAAAGTTGGCAGCGCTATCAGCCCTGTCGCTGCAACAATCGCAGAATAATAAAGTACCTGTTACCGAACAGGCGCGAATTAGCACTCGCGTGGCTGCAGCGCAAAACTATGGCGCGACTCCACCGTTGGTTTTGCCAGTTTTGCCGCACACCAGCCGGCTTAAACTATAGTTTCGAGTATTTCGCGCCGCGTTAATTTTAGACTGATCTCGTCTTACGGCGATCGTAAAGACTTGTGTCTCTCACTGGGATGAAATTGCGGATAAAACAGCTGTCGCTGCTGCCAACTTGGTGCAACGGGCGATCTCGAAGGCGTTGCCAGATCAACCACGCGATCGTTGTGTTGACAGTGAAGCCGCGAGAATTCAAAATTAAACTTAAACTTAAACCGTTAAAAATTTAATTTAATTTTAATTTTGATTCTGGTTACTGGAGCGCACCAGTCTTTAAGAAAGGGGAAAAGGCACAAGGTCATGGTTGGACCAAATATCATCCTCACCGTGCGCTGGTGCGCCTAAACTGACTCTGGTGTCCCGAGTCAGGCAACAAACTCCATCCAGCAAAGCCAGGGGAAATACGTGGCCACGTAAGACCCTTCACTCTTTACCACC
->d3c5ef59-9fa2-4590-8488-e60bca41cd05
-TGGTATAAGACCAGTTACGTGTTGCTCAAGATTGATCCGATACGCCTCAAGTCTTGATCCCAGGGCCAGCTGGTGATTTCAAGATGCTGGCAAGGGCACTGAGCTTGACAACATCATAGCAGCTAGATAGGTGGGAAAAGATCCCTTGAATACAGGCCCTACAAACTCATCACATCCATGAAAAACTTCAACTTGTAGCCAAAGCCAGTAGGTCATCACTAAATGCTAGCTTTCAAATTTAACAAATAATTTAAAAGTTGGATTAAACTTAGGTTGGTGTTTTTGTAAAGAGTTTTTCTTGAGAACTCACTCAAAGAAGTGTTAAACTTAGATTCGTTAATTTATTTTTCTTGTATATTTATTCTTTGTTGTTTTTAATTTATAAATGAAATAAATATTGTTGAAATTATATTTCCTAAAAAAATTGCACTGCATTCAATTAAAAGCAAATAGCATAGTACCTGACAATTAAATCAAAAATTCTAATCTTATTTACAATTGTGCCAAACAGTTTTTCTTGACAAACTATGCTTGTCATATGAATTTATTTTAATTTTCAAATTCATGTTTCCTTACTTTATGTCACTAGCAGAAAGTGGTACAGGTATAAGTGATTCAGATCCTATTACATCAGAAGTGGATACGCCCTACTCAACTTCTATGGTTTCATTATCATCATAGATCATTTGTGTTTTAGCTGTTCTTTATTTGATCCAATTTATGAGGGAACAGGAAGGTCACTCAATTCAAGAGTGTTAAATGTATCTTATGATCTACAGCCTGAGAGTTTCTGTAGCCTAGAATTGAGAGCAACCATGGCATAACCTGTAGCCTGTAACCTTTCTCTTATATATGTATATATATATATGTGCCTCTATCAGTGGTGCACTGGAGGAGAATTAAGTATAGGCACATATATAAGCTTGATCAGCCTTGGCCAGCAGGAGACAGCACGTGAGCAGGCTAATGTAGCCTCCAGAGTGGGTGCTCATTATTGCATGCCTTGTGCTGGGCTATCTATGTACACATTGCAACCAGAAGTGCTACAATTATGAATACATAGGTACAGTGCCATGATATGTGTGCATGCTACAATGAGTAGAAAACAATTTGCTGACAATTCTAGAGTCACTTGAGAATCGCCATTTCTGAACTGAAATGAAGTGCAAAACTCCTACAGATACCAAACTCAATGCTGTCAATGTGCCAAGGTTGTCCTGAACTGCTGGGCTTAGACACTCAATCCTGGTGCAGACCAGTCTGCATCATAGAAGCAAGAGACAGACGTCTTAAATTACGCAGCTGCAAGTATACTCAGGCTCCTTAGAAGTTGTGTCCAATGGTGTGTGCAGCAGGCAGCCAAAATCTGCAGTGGGAGTCCTTGCATGATTCTGCGCTGCAATCGCATGAGTTAATTGTGCCTGTTTCTAACACAATAGGTAATTTATTATCTTACAGTTATTTTGTGGATAAACAGCTGATAAGCGCAATGAGCAATCTGGAGAGGCATTGCTGAATCAACCATCTTGATCAGTGTTAATGCGACAATGGAGCACTGAGAATTCAAAATTAGGTGGAGGCTAAAATTAAAAGCTAATTTGAGAAATTTAATTTAATTTAATTTGATTCTGGTAACTGGGCGCACAGAGTCTTTAAGAAGGGAAAGGCACAAGGTCATGGACGAGACCAAAAAATATCTATCTCTCGTGCTGGTGCCTAGCAGGAGGCTCTGGTGTCAGGTCAGGCAGTACCGAGCCTCCCATCCATGAAGCCAGAAGTCGTGGCCTGCGTGACCTAAGTAACTTGACCATCCTTCAGTTGATAAGACAGCGCAGTGAGGGCAGTCCCCTGATCACTAACATTTAGCCATTCAGGAAGACTCTGACACAAGGTCTACAGGAGAGTCCAAGCTGCCCAAACCCAGTGACTGGAGAATCTCTCAGTCCCATCCAGTGGCTGAGAAATTGAGCCACATGAGCCCCAACATTGACTATCATTGCAGCTTGATGCTGAGGTGGAAATGTCCCTACAACATCTACGAAACCACAAGTCGAGACAGTAGTTATTACATCATATTACCATCCCTCAAAAGACAGGAGGAAGTCCCCAACATTCCCTGTCAGTCATCAACAAACCCTTTCTCCCTCCCAGAACGAGGACCTAGAGGCATACAGATGGGCTGCTAAGATCAGCCCCTTCTATCACATTCCAAGGACCCAACAGCACACATGAGAGACAGGCACTTCTGCTGCTGGGAACTGATAGAGGCTGTACAAAGTGCTACAAAACTGCTTGAAAGAGCAGCACTTCTGAACCAGGTACAGAAGCCTGCCAAAGGCTCCTGGAGAGTACTGGTGCAGTGCAGGTGCCAAGTCCAGGCATGAGAGGTGACCCCTACGTTGGATCTGAGATCACTTTGTCTCGGCATCTCTCAGCGGACTGCAAAGTAACCAGAAACGGTCACGTTGGCAAAGTGAGAAATAAATCTGCGTATTTGGTTTGTCAAAGAACTGTTTGCAGTGAAATGGATGGGTGCAGTTTTAAGTCAAGTGGAGTTATTTGTAGATGTGACAATTTTTTAGGAAATATAATTAAACAATATTTTATTTTACTTATAAATTCAACAAATTTGATTCAAATATCAAATATACAAGAAGAATAAACAACACAGATTAGTTTAAACCTTTTGGGAGTTTCAAAACTCACAAACCACTAAACTAAGTTCAATCCCTAAATTTTAGAATTATTTCTTCTAAAATTTGAAAGTTGTAGTGTTAGTATGACCCCATTGGCTTTATTGATTTAGGCTTTTCATGAATGGATGGAGTTTTTGGGTCTTCAAGCTGGGATCTTTTCCCATCTGCCAGCCAGGCTTTGTTAATATTCGTGTTTTGAGTGCCTTTTTGCCATTCTTCTTTAGAGCCATTACAGATTTTTCAATGGGAGTTTCAGATCAGGAATCTGAGAGGGGCCTCAGATGCCTTGACAGCTGTAACCTTA
->9b4aadf5-e242-4b39-bf9a-5a2efc315649
-TTGGTAGCCGCTTCGTTCAGTTACGTATTGCTGCCCCACTGCGCTGTCCATCAGCTGGAAGGATGGCCTAAGGTTACCTAGGTCACGTAGGCTGGATTTCCCCACAAGCTTTTACGGATGGAGTTTGTACCGCCTCGGCTCGGACACCAGAGCCTCTGCTTAGGCACCAGCGCGGTGAGAGGATGATATTTGGTCATCCGCGACCTTTCATTGCGCCTTTCCTTTCTTAAAGACTTGTGGCTCCAGTTACCCAGAATCAAAATTAAATTAAATTAAATTTCCAGCGGCTTAATTTTTTAAATTTAATTTTGCAGATTTCCTTCTGTCGCAACACAGCACTGATCACACGGTTGATCTGGCAGCGCCTCCCTCTCCAGATCGCCCGCTGCGCTATCAGCTGTTTATCCGCTGCAACAATCACTTAGAGATAATGCAATTACCTGGCCCATAGAACAGGCGCACAGATTAACCAGCGTGATTGCAGCGCAGGACTATAGCGCGACTCCACCGTGTGATTTTGCCAGTTTGCACCGGCCGGCCACAGCTTCTATGGTTTCAGGTATTTCGCGCCGCGTAATTTAAGACGATCCGTCTTCACGGCGATGGGGCTTAGTCCTCCGCACCAGGATTGAGTGTCTAAGCCTGTGCGTTCAGGATTAAACTTTGGCAATGCGACTGGCATTGGAGTTTTGGGTCTCTTTGTAGGTTTTGCACTTCTTTTTAACAGTTCAGAAAATGGCGATTCTGCGACTCTAGAGATTGTCAATAGGTGTTTCACTATTGAGTATGCACATAGCAGTTAAGCCTGTACCTATGTGTAAATTCATAGATATAGCACTCTATTTGCAATGTGTACATAAAACAGTCCAGCACAAGTGTATACATGTGACACCCGCCCGGGGCTAACATAGTGCCTGGTCAGCGGATTCTCCGCTGGCCAAAGGCGCCGATCAGCTTATATGTGTACCTATACCCTCCTCCTCCAGCACCATCGCTCGGCGTGAGTACATATATATACATATATATAAGATACGCATATAAGCGTTGCTGCGCTGCAGGCTATGCCAGCAGCGCTGCTCCTCGACAGGCTAAGAACCTTTGTATGTAGATCCTTAAAGAGGATTGACGAATTAATTTCAGATGGGCCAGGACCTTCCCTGTTCCTCAAATTGGATCAAATAAAGAACGAAACAAAACTACCGAATGATCTGCTGACACAGTAAGAACTTCACAGGAAGTTAGATAGGCGGTCCACTTCTGATGTCGGATCCTGGATCGCTTTATACTCGGCATCACTCTCTACAGCGGACACAAAGTAACAGAGAGGCAGTCGTTAACCCGAAATTAAAATAAATCTGCGACAAAGTACAGTTTGTCAAGAAACTGTTTACACCGTGAAATAAAGATTAGATTTTTTGATTTTAACGAGTCAAAATTAAAAAAAAGGGTTATTTGCTTAATTAAACGCAATTTTTTTTTGGAAATATAATTAAACAATATTTATTTTGCTTATAAATTAAAAACAAATTCAAAGATATCAAATATACAAGAAAATAAACTAACAAATTCCAAGTTTACACACTTTTGAGTATCACTCTGCCCAAATACCGTCATCTCTGGGATGAGCTGATAGGTCCACCTCCCAAATCGCGACGTTTACCCATCTGCTCTACCATTCACCCTAAAAAGA
->61e93c14-cbc2-4935-a6dd-cf8fcdb485e6
-TTGTGTACTTCGTTCCAGTTACGTATTGCTTAAGAATTACGCGGCGCGAAGTACTCGAAACCATAGAAGTTGTGTCGGCCGGTGTGTGTGCGGCAAACTGTAAAAATCACACACGGTGGAGTCGCGCCATAGTTCTGCGCTGCAATCACGCGAGTTGAAATTTGTACGCCCTGAACATGTAAATAGGTAATTTATTATCTTGCGATTGTTGCGGCGGATAAACCAGCTGATAGCGCAGCAGGCAGCGATCTGGAGAGGAGGCGTTGCCAGATCAACCGATGTGATCAGTGTTGTGTTGCGACAGTAGGGCGCGAAATTCAAAATTAAATTTAAAAGGTAGAAGCCGTTGAAATTTAATTTAATTTGAGAATTCTGATTCACCAGGCGGCTAGGGCGCGAAGTCTTTAAGAAGAAGGGGAAAAGGCACAAAGGTCGCCCGGACGAATAAACATCATCCTCTCACACCGTGCTGGTGCCCTAAGCAGGGGCTCTGGTGTCCGAGTCGAGGCGGTACAAAACCATCCGTAAAAGCACGGCACCGCGGG
->b01dfb96-ba44-4aa0-ba2b-02dfbeb747bb
-TTGTTGTACTTCGTTCAGTTGCAGTATTGCTAACTAAAATTAGCAAGCGTGTAGACCATATATTATGCGAAAGTGATTGCGAACCCCGAATCTCGGTCAGATCACTTATGGATATCAGGCAAGAATGTGACCTAGTTGTGCCACACAAAACTGTGCGCCAAGTCATTCTACGCCATAGGTACTCTTCAGAGTTGCAAGAAAAAAAGCCTTTGCTATCAGAGGTCAATATAGAAAAGCGTCATTCATTCGCTGTGAGCATGATGGATGTGCGGAAGAGTACTGGGATGACGTAATATTTTAATGACGAAACAAAAATGATGCTCTATTATAACGATGGGCCAAGCAGAGTATGGCGCAAGCTGTTGAGTGCGCTGAAACAAAATATCATTCCAACAATCAAATTTGGAAAATTATCAGTGATGATTTGGGGCTGTATCTCAAGCCATGGAGTGGGCAAATTAGCCTTTATTGAAAGCACTATGAGTAGAGTGCAATATCTAGATATTTTAAAATCAAATTTGAAGGCCAGTGCAGAAAAATTTGGTCTATTGCCCAGCAACAAGCCAAATTTTAAGTTTTATCAGGACAATGATCCCAAACATAAAAGTGCAATGTACGCAACTGGCTCCTTTATAACTGTGGCAAGGTGATCGATACGCCCCTCAGAGTCTTGATCTGAACCCCATTGAAAATTTGTGGGCCTACTTAAAGAAGAATGTGGCAAAGGGCGCAAAACACGACAACAGCTCATGGCTGCGATAGAGTGGGAAAGATCCCGCTTGAATATGACTAAAAAACTCATCCATTCCATATGAAAAAAAAGCTTCAACTTGTAGCCAAAGCCAATGGGGGGTCATACTAAATACTACAACTTTTCAGAATTTTAACAAAATAATTTAAAAAATTTAGGATTAAACTAGGTTTAGTGTTTGTGTAAAAAGTTTCTTGAAACTCTCAAAAGTGTTTAAACTTGGAATTCGTTGTTTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTTAATTTATAAGTAAAATAAATATTGTTAATTATATTTCCTAAAAAAAAAAAATTGCGTTAATTAAACAAATAACCCTTAATTTTGACCGTTAAAATCAAAAAATTCATCTTATTTCACGGTGTGTAAACAGTTTCTTGACAAACTGTACTTGTCCTGAATTTATTTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTAGAGAGTGATGCCGAGTATAAGTGATTCAGATCCGACATCAGAAGTGGGACCGCCTACTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTTGTGTTTTAGCTGTTCTTTATTTGATCAATTTGAGAACAGGGGAAAGGTCCGCTCCCATTCGAAATTAATTCGTCAATCCTCTTATGATCTACATACAAGGTTTCTTAGCCTAGAATCGAGGAGCAGCGCTGCCGGCATAGCATACGGCGCAACTTAACGCTTCTATGCGTATCTTATATATATGTATATATATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAGAGTGGTATAGGCACACATATAAGCGATCAGCAGCAGCCAGCAGGAGAACTGCTGACCAGGCAATTATGTATGTTAGCCCTCAGTGGGTGCTCGTATTACGTATACACTTGTGCTGGACTGTTTATGCATTTTAACAGAGTGCTACAATTATGAATACACATAGGTACAGTGCCCAGCCGTATGTGCATGCTACAATAGTGAAAACAATTTGCTTTGACAATTCTAGAGTCGCAGAATCGCCATTTTTCTGAACTGTTAAAGAAGTGCAAAACTCACAAAAGAGACCCAAAAAAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCTGAACGCACAGGCTTAGACACTCAATCCTGGTGCGGAGACCAAGTCTACATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCGAAAATCTCGAAACCATAGGGTTGTCGGCCGGTGTGTGCGGCAAACTGGCAAAGTACGGTGGAGTCGCTGCCATAGTTCTGCGCTGCAATCACTTGCTGAGTTAATTGTGCGCCTGTTTTCATGTAAATAGGTAAATTTATTATCTTGCGATTGTTGCAGCGGATAAACAGCTGATAGCGCAGCGAGCGATCTGGAGAGGGAGGCGTTGCCAGATCCAACCGTGTGATCAGTGTTGTGTTGCGACAGTAGGGCGCGAAATTCAAAATTAAATTTAAATTAAAGCCGTTGAAATTTGAATTTAATTTAATTACGATTCTGGTAACTGGGAGCACACAAGTCTTTAAGAAAGGGGAGAAAAGGCACAAGGTCGCCCGGACAGACCAAATATCATCCTCTCACCGTGCTGGTGCCTAAGCAGGAACTCTGGTGTCCGAGTCGAGGCGGTACAAACCTCCATCCGTAAAGGGGGGGGG
->e1e1f244-e877-4666-b280-f24750e5bc84
-TTCAAAACTCGATGTTATGCCGTTCAGTTGTGTTACTGATGATATTTGGTCTGTCGCGACCTTTGTTGCCTTTTCCCTTTCTTGAAGACTTGTGCGCTCTGGGTTACCAGAATCAAAAATTAAATTAAATGATTAAATTCAGCGGCAATTTTAAATTTAATTTGAATTTCATACTCTGTCACCAACACAACTACTGATCACGGTTGATCTGGCAACGCCACTCCCTCTCCAGATCGCCGCTGCGCTATCAGCTGTTTATCCAGCAATCATGGATAATGATTACCTGACATGCCAAAACAGGCACTGTGCTGCGTGGTGCAGCGCAGAACTGCTGGCGCGACTCCACCGTGGTTGCCAGTTGCCCTTGCAAGCCGACACAACTATGGTTTCCAGTATTTCGCGCCGCGCCGTTAAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCCACGCAGGATTGGTCAGCTAAACCTGTGCGTTTCAGGATTAAACTTTGGCAATACGGCATTGAGTTTTGGGTCTCTTTGTGAGTTTTGCACTTCTTTTAACAGTTCAGAAAATGGCGATTCTGCACGACTCACAGAATTGGCCAACAAATTGTTTTCATATTGGCAGTATGCACGCATATCGGTTAAACTGCTGTACCTATGTGTTGCATGCCACAAATAATTGAAAACAATTGCTGATAATTCAGAGTCACTGAAATCACCGCCCTGAACTGTAAAAAAGTGCAAAAACAAAAACAAACTCAAATATCGCTGTAAAGTTCAATCGCGACAAATTACTCAATGTGAACAAAGTCTATCATAAGTGAACGTCAAGCGCCAGCTCGCTCCGCAACTATTTAAATCACACAGGTAAATCCTCACTGGTCTACGCCATCACCTGGTACGCCTGTTCGTAAATAAATAATTTATCTTGCGATGATGCAACAATCAGCTTTAACTTGATAACGGCAAATCTGAAGGAAGAAGTGAATCATCGACAATGATCTTGTCATTTGTGAAACAATCAAGTAAATTTAAAAGATGGCAATTGAAATTAATTATTGGCTGATTAAAGAACCTGGCTAAGAAAAGAGGCGCAAAAAGGCGCAGACAAACTAAAATATCATCAACAATAACGGCA
->e8af5a0c-d198-4fa8-84d3-b61085e037fd
-TTGGTATTACTTCGTTCGGTCACATTGCTGTGCGCTCCCAGTTACCAGAATCAAAATTAAATTAAATTAAATTTCAACGGCAATTTTAAATTTAATTTTTTGAGATTTCACCCTTACTGTCGCAACACAACACTGATCACACGGTTGATCTGGCAACGCCTCCCTCTCAGATCGCCCGCTGCGCTATCAGCTGTTTATCCACTGCAACAATCGCAAGATAATAAATTACCTATTTACATGAAACAGGCGCACAATTAACTCGCGTGATTGCAGCGCAGAACTATGGCGCGACTCCACCGTGTGATTTTGCCAGTTTGCCGCACACCAGCCGACACAACTTCTATGGTTTCGAGTATTTCCGCGCCGCGTAATTTTAAGACGTCCGTCTTCACGGCGATGTAGACTTGGTCTCCCGCACCAGGTTGAGTGTCTAATGTGCGTTCAGGATTAAACTTTGGCAATACGACAGCATTGAGTTTTGGGTCTCTTGTGAGGTTTTGCACTTCTTTTTTAACAGTTCAGAAAAATGGCGATTCTGCGACTCTAAATTGTCAGCAAATTGTTTTACTATTGTAGTATGCACACATATCAGTTAAACACTGTACCTATGGCGTATTCATAGTGTAGCACTCTGTTGCAATATTATTTACATAAACAGTCCAGCACAAGTGTATGCGTAATACGAGCGCACCCACTTGAGGGCTAACATACATATGCCTGGTCAGCGGTTCTCCCGCTGGCCAAGCGCTGATCGCTTATATGTGTGCCTATACCACTCCTCTCCAGCACCATCGCTCGGCGACGAGTACATATATATATACCTTATATATAAGATACGCATATAAGCGTTGCTGCGCGCTGCAGGCTAGCTGCCGACGGCGCTGCTCCTCGACAGGCTAAAGAAACCTTTGTGCATGTAGATCGTAAAGGATTGACGAATTAATTTCGAATGGGCAGGACCTTCCTGTTCATCAAATTGGATCAAATAAGAACAGCTAAAACACAAATGATCTATGACACAATGAGAGCACTACGGGAAGTTGGAGTAGGCGGTCCCACTTCTGATGTCGGATCTGAATCGCCTTCGGCATCACTCTCTACAGCGGACACAAAGTAACGAAAACGGTCGTTAACTTGGGGGTAAAATAAATCCTGCGACAAGTACAGTTTGTCAAGCTGTTTACACCGTGAAATAAGATGAATTTTTTTTGATTTTAACGGTCAATTAAACGCAATTTTTTTTTAGGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAACAAATTCAAATATCAAACCTTACAAGAAAATAAACAACGAATTCCAAAGAAGTTTAAACACTTTTGAAATTTCCAAGAAACTCTTTACACAAAACACTAAACTGGTTTAATCCTAAATTTTTAAATTATTTTGTTAAAATTTGAAAAGTTGTGGTATTTAGTATGACCCCCCCCCATTGGCTTTGGCTACAAGTTGAAACTTTTTTTTTTCATGGAATGGATGAGTTTTTTTTTTAAGGTCGCATATTCAAGCGGGATCTTTTCCCACTCTATCGCAGCCATGAGCTGTTGTCGTCGTTTTGGTGCCTTTTTTGCCACATTCTTCTTTAAGTAGGCCACAAATTTTCAATGGGGTTCAGATCAAGACTCTGAGGGGCGTATCGATCACCTTACCACCAGTTACCGAGCCAGTTGCGTACATTGCACTCTTTATGTTTGGGATCATTGTCCTGATAAAACTTAAAATTTGGCTTGTTGTTTGCTAAATAGACCAAATTTTCTGCACTGGCCTTCAAATTTGATTTTTAAAATATCTAGATATTGCACGGCATTCATAGTGCTTTCAATAAAGGCTAATTTGCCCACTCCATGGCGAGATACAGCCCCAAATCATCGCTGATATTTTAAATTTGATTGTTGGAATGATATTTTGTTTTCTAGCGCACTCAACAGCTTGCGCCACCATACTCTGCTTGGCCCATCGTTATAATAGAGAGCATCATTTTTGTTTCGTCACAAAATATTACGATCATCCAATTGCTGCTTCCGCATGATCCATCATGCTCACAGCGAATGAATGACGCTTTTCTATATTGACCTCTGATAGCAAAGGCTTTTTTTCTTGCAACTCTTGAAGAGTACCTATGGCGATAGAATGACTTGGCGCACAGTTTGTTATTAACAACTAAGGTCACATTCTTGCCTGATATCCTGAGCAAGTGATCTGACCGAGATTCGGGGGGTTCGCAATCACTTTTCGCATAATAAAGGCGGTCTACACGCTTGCTAATTTTAGTTTTGCCCACCACTCTCTTAGGTTCAAGCCTGTTCTCTTTTTTCAAGCGATTAAAAACATTGTGGAGCGGTCTTACGGGATACAGAAAACATTTATACTAATTCTGGAATAGATTTTCCCAACTGGTGGTTTTAGTATATTATTTGGGTCACTTCAAAAGCTAATCTGTTCCAGGCATTTTTATTAAATTTAATAACTCATTCGATCAGCAAATTTCACAAGCAAAGTAAAAAATTTCAGCTAGAAGCGTTGTAAAGGAATGCAAAGTACCGAAATAACGGAAAAATCGAGTTCGTTCTAGAAAAGAGAGCAAAACAAAGTAGGAAAACAAAATGTGTAAGGGTTTCTTGCCACTCTCAAAGTGTAATAAACTTGGAATTTGTTGTTTAATTTCTTGTATATTTGATATTTTGAATTTGTTTTTTTTGTTATAGAGTAAAATAAATATTGTTTAATTATATTTCATTAAAAAATTGCGTTTAATTAAAGAAATAACCCTTAATTTTGACCTTTAAAAGTGAAAAAAATTCAACTTATTTCACGGCGTGTAAATGGTTCTTGACAAACTGTATATATCTACAAATTTACAACTTGCCGGTACCATCTGCGATTTAATTTTGCATTGAGAAGTGGACTTTGACTCTCAGAATGAATTAAAACATTATATTCTTAGATTGAACGACGGGGAACCAGACTGAACTAACTAAACTAACTATCATTTAACTAAATTTAATTAAGTTTACTGTGTTTTGAGTTTCTTACAAAGATGACTAATATTAATTTTAGTTAAAATAGTTTGCAAAACTGAATTTATGTAGCATAAATATGTTCAATTGATCTGGTTGGGTTTTCTGGAGTCTCCCCAACACCTCGCAACGAATGCTGGATCAAAATTATTCGTCAGAAGGACGTGCGTCTCGTGAGTAATAAAAGTACAGCAATCTTACTGAAGGGTGGCGTGTTGAAAGTATGTACACATTTAAGCAAAAAAGTCACATGGCCTGCATCAGACACTAGAATAATAGGAATGCGTAACAGCCATACACTGTGGTTTGGCACTATGCAGCCACTTTTGGTGACGGCCAAAATTGCTCTCTTTCCGCTCGCTCACGCTGAGCGTAAGAAATCTAAAACTTTGCTTGCTTGTGTGAGTAAAAACAAAGACGAGAACGCGTATGTGTGCGTGTTGATGTTGTACTTTAGAAGGCGATTTTCGGGCCGAAATCAATTCTGATCGCAGTAACGAATTTACATATGTACATACATATTTGGGGAGTTTGGCCAATTTCGTAGAATATGATGATGAAATTGCGCGCTGTTTAAGATCAAATTGGAATATAAAAAAAACTGAAAAGTCATTACACTGAGAAAAAATATTTCATAAGAAAATAATACGAAGTAGAAATAAAAATTTATAAAATAAAAAAAATGTTAACTGTTTATTGCAAACGTCATATCAAATTAAATTATTCTAGTGTCTTTGCTTTGGTCATATCTTGAGGCACGAAGTGCGGACTAAGCACTCCGCAATCATTGTCTTCTTAATACTCCGAAGCAGAGCAGCACCGACGAGAACCTAACTGCTTTGAAATGGCGAAGTAAAATAAAATCAAAAAAGAGACCAAGCCCCTCCCGAAGTTCAAAAGCCAGGATTCCCTGGACGAATTCATCAGCACCAGCGCAAATAATTTCGCTCTCTTAAGCATTGGTTGCCCGGCAAAACAGGAAACAAATATAACAAAACGAAGATCTCGAAATGGTAAATGAAGACAGGTACGGCAATTTTGCTAAGCCCCCACCTATCTTTCTCTCTGACGTCAATGGTATAAATTATTAACCTATCTTAAAACTAAAATTAGAGAACTTTTTTTTATTATAGACTCAACGTTATGGACATGTAGAGTAATGTTAAGTATTGAAGAATTCTGAAAATTAGTGAAAGCACTTAATAATGATTGCAGTACCACACATACCAGCTTAAGAGATGACAGAGCATTTAGAGTTATTAAAATTTGCATTTTCCACAAATTTAGATGAAATTAAAAGTGATGAAGAGTCAAAAGGTCATGTTGTTAGAAACATAAGTAATATTAAAAAGCCGTGCGACCAAAACGTCACTGAACATGTTTTATGTAGCAGATATTGAGCCTAACAAAACCTAGACATATGTAATGTAAATAAAATATTGAGCCTCCCCACAATGAAATCGTTCAATGCTATAGCTGCAAGAATTCGGACATGCTAATCATATTATTTACCAAAACGCCGCTGTGTAAAATCTCTTCTCGACACCCAAGCAACTTGTTGCCCGAAAAAATACAGAACAACCAGCAAAATGTGCCAACTGCTACTGAAAATGCGCCAGCTACGAGGGTGTAGAATTTATCAGGAACTCTTGTCCAAAAAAAATAGAAAATAGAAATGTGATCTGAGTAAAATGATTTAGGAATCAGCAAAGAAGTTTGTTCCGCCTAACAAGCCAACATATACCCAACAAAGTAACGATTATCAATCTTGTATGCCCAATTGCTGCGAAATTAGCAAAACAAAACACATCACTGGAGAGAATAGAGCAACTATTAGGAAAACGATTCTGAACTTACAAATAATTTACTTAACATGATAATGTTGCTTGTAAATAAATTATGCAAAATGGAAATCCTAACCTTGGAATGGAAGCGTATTGAGGTGACTCCAATGTAAGCTTCCGAGAGGAAACTCGAACTGTACAAATGCATAGTAAACAACAGCATAACAACACTTTCCAACCGGCAGAGCCACACTGGCCTACTGATGGTAGAAGATACCAAACAACCCTTTCGCACCCAACGTTGCTTGTGAGCAATTTCTATGTTTTCAGGCTAGCGCAAGTGTGCCTTTTGTTTTTTATCTGCTGATTCTTTATGATAGCGGTGCTTATGTGTCTACTCTAAATATAAAAGCAAAAAAACGCATTTGGAGATTAATTGCAGGAATTGTTGCAATAAATAGCACGCGCATCACAATAATTATTGTTTCGATATTCAGTTACAGCTTTGGAATTATTAATTTGCACATAATACTTTTAAAAGAACCTAAAGTATAAGCAACAAAGAGTTAACAAGACGGTGATTTAGTCGACTTAGTAAGTATTGAACAATGAAATGAAATAATTTTCTAAGTTGCTTGTGAGCAGCAACGGGCATTCGTGATAATAATTTTTTACCGAAAGTGAAAGGTTTGTCTAACGAAGAAATTGAACGGGATTTAAACTTCGGTGGGATCTCTACTGACGAAGAAAGTGGTGAGGGAGATGAAAAGACATTTCTACGGTACTGGAGAAGAATTTAGAAGGAATTCTTGAAGGGGAGAAAGTATCGACATTGACCTTCTGGAAAATACAGTGATTGAAGGATGTGAACCTGACTCTTGCGTTGTTGACAGTTGCTTAGAAAGAATTGATCCAAGAGGCTAAAGTGGAGAACAAGGCCGTTTTGTAGCTCCAAGAGAGTATTTGGAAGATGACAAAACTTTTGATGTCGGGGGGGACATAAAGACGGTAGTAGGAGTTGCTACACACTTTTTGATACTCAGCTAATTCATTTAATGGCTAAGAGCAAACTGTTGATATACAGTCATGGTCAAAATTATTTTCACAAAGTGCATTTTTTGTGCATGGGTCACAAACAGTTGCTGATGCAGCAAGTGGGGGAGGTGAAATGCAAAAAAAAAACTTTTTTTGCTTTTGCAAATTCAAACCTATGCAGAGTCAGATGAAAGAAGAATTGAAAAATAACTGTTCCTATGCGCAAGGGAAAGAGGCAAATGAAGAGATCTTTATCGGTTGTCAGAAGTATTTGCACACGGTTTCGTCGCATCACAATTATTTTCACAACGCAATTTCTTCGGTGATTGGTTTAGAGTGACAAGTGCCGGTTTGTTTGCTTAATACATTTAAATTATTGAATAAAAAATTAGATTTAATCATTTTCTATTACCGGTTATTAAATAAAATGCCCAAAACAAAAGAGTTAACAGTTGAGGCCGGGCTGGTATTGTTGCTAGGTTTCGCCGGTACACCTGCGGCCAAAGAAATAGCTGAAATATATCAAATTTCGCGTAGAACTGTCTACTACTTACTTAATAAAAAAGTTTGATACGGTTGGCACATTAAAAATAAAAGATCCAGGCCGAAAACCTGTGCTGGACCAAAGGCAATGCAGGCAAATACTTGAGTTGTGGCGAAGAATCTAGTGCCAGTCCGGTAAAAATTGCGAATCAAAAAAAATACAATTGTGGCAAACAAGTTATTGTAGTTCTACAATTCGTCGCGGGCTAAAGAAGCTGATTTTAAGACATACTTTGTTCATAAAACGGTGAGATCACACCAACCAACAAAACAAAACGTCTTCGATTTGCGTTGGAATATCATTGCAAGCCTCTTGACTTTTGGTTTAATATTTTATGGACTGATGAGTCTGCATTTCAGTACCAGGGGTCATACAGCAAGCATTTTATGCATTTGAAAAATAATCAAAAGCATTTGGCAGCCCAACCAACCAATAGGTGCGGTGGGGGCACAGTCATGTTTGGGGATGTCTTTCTATTATGGATTCGGAGACTTGAGGTACCGATGAAGGTACTTTAAATCAGAACGGATACCTTCTTATCTTAAACAACCAATGCTTTTACGTCTGGAAATAGACTTTCCAACTACTGAATGGATTCTTCAGCAGGACAATGCTCCATGCCATAAAGGGTAGGATACCAACAAAATTTTTAAACGACCTTAATCTGGCGGTTCTTCCAGTAGCCCCAACCCAGACCTTAATATCATTGAAAACGTTTGGGCTTTTGGTAAAACCAACGAACTATTGATAAAAATAGAAAACGAGAGGAGCCATCATTGAAATAGCGGAGATTTGGTCCAAATTGACATTAGAATTTTGCACAAACTTTGGTAAGGTCAATACCAAAAGACTCAAGCAGTTATTGATGCCAAGGTGAAGTGTTACAAAATATTAGTATTGTATTTATATAAAATAAAAGAAATTCTTATGTTGGGGAGGTAAGATGTTAAGCTGAAATTTACTAAGTGGTTAGTGAAAATACTTTTGAAGCGCAATAAACATGTGAAAATACTATTGACAACTTGCATGCATATTTTCTTTTGCTTTTAAGCTTTTGTACTATGAACCGTTATCTTTCGTATTTCTTTTCGACTACCTTCTGCATAGATCAAAGGCTAAGCGATAAGAATTTATTTCAGGCAAGGACAACAACAAGAAGAAATATAACAAAAAGTTGAAGTTGCAAATATTGTGCGTTGTGAAAATACTTTTGACCACCTCTGTATATATAGTTTGGAGCACGGTATTGAACTTAAATGTACTGATGAGGAAATCAAACGCATTGGCATTTTATTGTACTTTGGTGTTTTAAAACTACCGCAATTCAGAATGGCGTGGTCAAAGTATTTAAAGATTACCGCAATAACTGATTCAATGCGGAGATTTAAAAAAATAAAACAATGCTTACATTTCAACGACAACGCCAAACAATTAAAAAAAGGGATTGCAACTATGATAAACTCTACAAGATCGCCCTTTGCTCAGAGTCAAAGAAAATTTTGGAAAAACTAACGCAGGAAGAGCATCAAAGTGTCGATGAGCAAATAGTGCATTCAAAGGTACGTTTTTAATTTTCTTTTAAATTAGCTTTATTTTAATAATTGCTTTTGTTGCAGATCGATCCACGCTTAGGTAATGCAATCCCAAACCTCATAAATGGGATGTACAAAATGTTTACGCGGCTGGAATATCTGGATTAGTTTATGATTTTACGCTATATGTTGGAGAGGCACTTCTACTCCTTCTTATAACTTGGGAATATCATCTTATGTTGTCTTATATTTGGCAGAAAGTCTTCCCAAAGACAAAATTTAAACTGTATTTTGATAGTGGTTTACGTCTGTAATCCTTCCTGATTTCGTTGAAGAAATAGGAATCTTTGCAACAGGTACTGTACGTATGATAAAAGTTGAACATTGGGTAGTTTTGGAGAAAGAGGACGTTGCAGACTGTGCAAAATTGCAACACCGATGACCAAATGCCTTACATGCAAAGTCCATCTGTGCTGCAATAACAATAAAACTGTTTTTTGTCGCGCCACACTTAAATTGTCATTATAAAAAGAAAAAATATTTTATATTCTGTACGATTTATAAAAAAAAAACAATGCTTACATCACTACTGCCCGACGTTGCTCACAAAGAAAACTTTTTTGCTACCGCCTTGAAACTAATGGTGGCATATAAAATTTTGCTAAATTTTTCTAAAAATAAATATGTATTAATGATAAACAAAATTCACGAATTGTTAAAAAGTTGGGCGCGAAGGGTTAAAGACTTCGTAGTAGCATACTTTGGAATCCCAGAATCTCACATGCGAATAATGGAAAGTTTGATCTAAGCTCAGATCATTCTCTAATAATAATAGTGACATACAGTACAGTAGCTCATATATTGCAAATACAGATATCAATGCATTTAAAGTTATCTGGAAACAGCTATCAACCTGGATATCTCGCTAAAATCAGGAGGAGAGCTACTGTGGAGCTACTCACAAACAAGATCCATAAAGCAGCTATATATATGTACGAAGCTACCAGCCAGAAACTCACAATCAAATCGCTCTATCTCTCAGCTGAAATCCGACAACAAATACAACACAAGAGAAATTTGCGTAAGAGATGGCCAAGAAACTCTCTACCCTGCCGACAAAAGATCATTATAACAAGGCTGCATCTGATCATGAAAACTACTGTCAACTTTAAGAAATTAATCTCTCGCTGAATATCTTGAGAAATCTAGATCCACATTCTTGTAACCACGAACATAATTTATGGAGGTAACCAAATATCTCAAGCGACCTGCAAAAGAAACAGTAGTCGAAACTCTAATGGCGAATGGCGTAGATCTGATGATGAACAAAGCCAAAGCATTTGCTTAACACCTGCACTGTATTTCAGCCAAGTGATATTGATAACCCTGAAACAGAAAGGAAGTAAAGATAGCTTTCGAGTCACCGCCAAATAGGCTTACCCATTCGTAAATCGGTATTAATGAAGTTTCATCAGAAATGGCTAAAAGTAAAAAGGCTCCAGATTGGGACAAAATAGATGTAGCCTTGAAAAAAAAAATGGGCGGTTAGGTTGACCACTTCCCAAGCCAATGGAAATGTGCGAAGTGCAGGTCACTTAAACCAAACAAGGCAGAAAATGAAGTGACATTGTACCGTCCCGTACGGTTTGTTTGTCAATATTTTCTAAGTATTTAAAAAAATAATTTTTAAAGAATATTTATTTGTCAATCTTGGAAAATTCGCTATCATACCCAAACACCAGTTTGGATTGAGGAAGGAGCCACGGAACCCCTGAGCAATGTCACGGGATTAAAAAATGAAATTTCGTCAGCATTTGAGAGCAAAAATACTGCACTGCTAAATTTCTTGACGTTTAACAAGCGTTTGATCGAGTCTGGCATGATGACATACTCAAACCATATTTTATATATTATTAAAGTCATACTTAACCAATAGACAATTTTATTTGCAACAAAAATGAATACTCGCCCTTGCACTTTATAAGCTGGAGTCCCACAAAGGAGAGTCTTAGTAACTGTCTTATACACCCTGTAACGGCAGATATGCCGGTAACAAATACCTGCCTGTAACAAATGATACAGCTATATTGGCTACAAAGCTCATCTAAAGAAATCTCACAAACTCCTGCAAACAGAGCTACGCCTTGATGAAAGCTGGTTTCTTATTTGGAAGAATTAAAGTCCAACGCCCTGAAATCTGCGCAAATAACTTTGCATTTAAGAAGAGGTAACTGCCAAGAAGTGTCATTTAATGGATCAGCAATCCCACAAAGTATCGATCGCAGACTAACGTGGAAACACATAAACATAAAAGCAAAGCGCCAGCAACTAAATCAAAAAGTTTGAAGATGACCTGGTTGCTTGGCCGAAAATCTGCAACCACTCACAGATAAAGTCCGTTTATACAAAGCTATACTAAAGCCCATGTGGACTTATGACATACAGCTTTGGGGTACTGCCAGCAACTCAAATATTGAGATTCTACAATGCTACCAATCAAAAAATATTAAGACAAAATTGTTAATGCTCCATTTTATATTTCAAATGCAAGTATCTATAAAGATAGGAATCCCTTATGTTAAAGAAGAAATGTAAACATATTAAAAATATATAGACGAATACAAGAACACATGAAAATAGCCTTAAATTTGGTAAATAATAATGACGTCAGAAGACTTAAAAGATTTCACGTGCTAGATCTCCCCGACAAGTTTAAGTATTAAAACATGTTATGAAATGGGGTATGTAGTAGGGATTAATGGATAACTACCTCTGGTAATTTAAGATTAATTATAAAATTTACTTATTGTCATACTTTTTTTAAGACAGATTATGTAAATAAAAGAAAAAAAAAATAGTCTAATATTTGAAATTTATTTTGTGGTAGTATGATTCGGCTGTTATAAGCTATATTTAAATAATAATAACATTTGAGCATTACAAAACAAAATTTCTGTACGGTGCCGGTGATTAAAAATAATATAGATTTAAGAGATCTAGAACACTTCTAAGGTGAAGGGCATATTTTTGTAAAATGGCA
->155e6dc8-d8ba-4819-bcc9-de1dffd431c3
-TTGGTATTGCGCTACGTTCGGTGCATTGCCAGCATACTCCTCCAGATCGCCGCTGCGCTATCGGCTGTTTATCGCTACAACGAATCGCGAATAATAAATTCTCTTTACACGTAGAGCAGGCGCACAATTTAACTCTGCGTGATTGCGGCGCAGAACTATGGCGCGACTCGCCGTGTGATTTTGCCAGTTTGCCCGCACGCAGCCGACGCTTCTATGGTTTTCGGTATTTCGCGCCGCGTAATTGAACGTCCGATATGCGTGGCGATGAATGGTCTCCGCACCAGTTGAGTCGTAAACCTGTGCGTTCAGGATTCGGCTTTTGGCAATGCGTGCTGATTTTGGGTCTCTTGTAGGTTTTGCCTTCTTTTAACAGTTCAGAAAAATGGCGATTCACGTCTAGGTCTGTCAGCAAATTATTTTTCATGTTAGCGGTATGCATATCGGTTGTACTTTGTATATGTGTATTCGCATATTAACACTCTGTTGCAATGTACATAAACAGTCCAGCACAAGTGTATGCATCAATACGGCACCACTTGGGGCTGCTGTATAATTGCTGGTCAACGGATCTCACTTCGGCCGAAGCGCTGATCGCTTATATGCCTGCCTACCTCCTCCTCCAGCACACCATGTCGCTCGAAGCGACAGTACATATATATACATATATAAAGATACGCATATAAACGTTGCTGCAGTATATAACCTGCTCCCTCGACTTCTTCAAAACTGTATAGATCATAAGAGGATTGACGAATTGTTCCGAATGGGCAGGACCGCTTCCTGTTCGCGGTGGATCAAATAAAGAACATTAAAACACAAATGATCTATGACACAATGGCTTTGCAAGTTGGGTAAGCGGTCCCACTTCTGATGTCGGATCTGAATCACTTTATACTCGGCATCACTTTCTCTGTGGACTAAGTAACAGAAACAGTCGTGCTTGAAATTAAAAATAAATCTCTGCGACAAGTACGGTTTGTCGAGAAACTGTTTACACACAAATGAAATAAGTGAATTTTTGATTTTAACGGTCAAAATTAGGGTTATTTGCTTAATTAAACGCAATTTTTTAGGAAATATAATTAAACAATATTTATTTACTTATAATTAAAACAAATTCAAATATCAAATATACAAGAAAATAAACAACAATTTCCAAGTTCATTACTTTTGAAGGTTTCAAAACTCTTCCCCTGAAAAAAACACTAAACCTAGGTTAATCTAAATTTTAAATTATTTTGTTAAATTTGAAAAGTTGTAGTATTTAATTAGACCCCATTGAGCTTTGGCTAAGTTGACTTTTGTAGAATGGATGATTTTTTTTTAGGTCTATTCAAAGCGGATCTTTTCCCACTCTATCACTTGACATGAGCTGTTATCGTGTTTTAGTTGCCCTTACGCCGCATTCTTCTTTAGTAGGCCCACAAATTTTCAATAGGTTCAGATCAAGACTCTGAGGGAGGCGTATCGATCACCTTATACAGAACATATAAGGAACAGTTGCGTACGTGCACTCTTTATGTTTGGGATCATTGTCCTGATAAAACTTAAAATTTGGCTTGTTGTTGCTAAATAGACAAATTTTCTACTGGCCTTCAAATTTAGTTTTAAATATCTAAGATATTGCACGGCATTCATAGTGCGCTTTTCAATAAGGCTAATTGCCCACTCAGCGGCTTGAGATACAGCCTGAAATATGACAATTTTCAAATTTGATTGTTGGAATGATGTTTTGTTTTTCTAAGCACTCATGGCTTGCATATACTCTGTAACCCCATCCATTGTAATAGGCATCATTTGTTTCATCACAAGCCGTCATCCCAGCCTCTTCCACATGATCCATCATGCTCACAGCAAAATGAATGGCACTTTCTATGTGACCTCTGATAGCAAAGGCTTTTCTTGCAACTCTTGAAACCTGTAGATGACAGCGCACAGTTTTGTGTGGCATAGGTCACCATTCTTGCCTGATAACATCCTGAAACAGTGATCAACAGATTCGGGGGTTCACAATCACAACACATATGCAGGCCGGTCTACACTTGCTTAATTTTAGTTTTGCGCCACCACTCTTAGATTCAAAGCCTGTTCTCTTTTTTCAAACGATTTCAAACAATTGTAGACAGGGTCTGCGGGATGAAAGCATTCTCTACTAATTCTGGAATAGATTTTTCCCAACTGGTGGTTTTAATTATATTATTTGGGTCACTTCAAAAGCAAATCTATTTCAGGCATTTTATTAGAATTTAATAACTCATTCGATCAGCAAAATTTCACAACAAGTAAAAAAATTTCAATAGAAGCGTTGTAAAAGGAATGCAAATGCCAAAATAACGGAAAAATCGAAGTTCATTCTAAGAAAAGAATGAAACAAATGAAATAAAATGTGTAGAGGTTTCTTGCCACTTTCTCAAAGTGTAATAAACTTGGAATTTGTTGTTTAATTTCTTGTGGCTGATATTTTGAATTTGTTTTAATTTATAAAGTATTAAAAATAAATGTTGTTAATTATATTTCGTGCAAAATTGATTTAATTAAAGAAATAACATAATTTTGACCTTTACTAAAGTGAAAAGTTCAAAGCTTATTTCTGGCGTGTAAATGGTTACCTTGACAAACTGTATATATCTACAAATTTACAACTTGTAATTTACCATCTGCAGATTCTTGTTATTACAGTGGTTTGACTCTAGAATGAATTAAAACATTATATTCTTAAATTGAACGACGAGGAACCAGACTGAACTAATAAATATTTATCATTTAACTGATTTATTAGTTTTACTAGTAATTTTTGTGAGTTTCCTTACAAAGATATTAATATTAATTTTTGCAGTTAAAATAGTTCAAAACAATTATGTAAATAATGTTCAATTGATCTGGTTGGGTTTTCTGGGTGCTCCCAAACTCAACGAATATGGATCAAATATTCTATGATCAGAAGGACGTACTGATCCTCGTGATAAAGTACAACAATCTTACTTTGGTGGCGTGTTGAGTATCTTTTATTTAAACAAAGTCCTGGCCTGCATCAAGAACTTACTTTTAGAATAATAAGATGCGTAACAACCATACACTGGTTTGGCACTCGCCGACCTTTTGGTGACAGCCAAAAGGTATACTCTTTCAACTCATCACGCTTGAAGGCAAAGAAATCTAAAAGCCAATTTGCTTGCTTGTGTGGTAAACAAAAGAATTGAAACGCGGCTATGTTGCGTGTTGTGCTTCAGAAGGCGATTTTCAGACTGAAATCAATTCTGATCGCAATGTAGATTTACATAACATACATATTTGGGGAGTTTTGGTAATTTCATGAATATGATGAAATTGCGCTTTGTTTAGATGTACAAATTGGAATATAAAAAAACTGAAAAAGAAGTCATTACACAGAAAAATATTTCATAAAAAATAATACAGAGTAGAAATGAAGTTATAAATAAAAAAAAATGTTAACTGTTGTGCAAACGTCGTATCAAATTAATTATTCTAGTGTCTTTGCTTGTTGTATCTTGAGGCAGGGTACGGACACAAGCACTCAACAGTGTTGTCTTCTTATACTCCAAGCAGGCATTTTGACGAAGACCTAACTGCTTTGTCTTGAGGTAATAAAATCAAAAAGAGACCAAACCCTCCCAGAGTTCAAAACAGGATTCCTGGACAATTCAAATGAAGCACCAGCATTTCGCTCTTAAAGCGACGGATTGCCGACAAAACAGAACAAATATAACAAAACAGATCTCAGAAATGGTGAAATGAGACGGTACGACTTCTGATTTTGCTAAGCCCCATATATCTTTCTCTCCGACGTCAATGGTATAAGTGAAAGTAACTATCTTAAAACTAAATTAAGAGAACTTTTATTATGAGACTCAGCGTTATGGACATGAGTAATGGTTAAAATGTGAAGAATTCTGAAAATTCGTCAAAACACTTAATAATGATTGTGTGCAGTACCACACATACACCAACAGGATGACAGAGCATTTAGGTTGTTATTAGAATTGCATTTTCCTGGAAATTTTAGATGATGAAATTAAAAGTGATGAAGGAGTCAAAGGTCATGTTCCATTTAAACATAAGTAATAATGAAAGCCGTGCGACCAAAAATCACTGAACATGTTTATGTGATATTGAGCCTAACAAAACCTAGACATATAATGTAAAGCAAATATTGAACCTCCCACAATGAAATCGTTCTGTCACTATAGCTGCCAGAATTCGGACATAAATCTGTATTGTGTACAAAACATTTACCACTGTTAAATTACTATCGACTTTTAAACAACTTATTTGCTTTGAAAAATACAGAATAACCAACAAAATGTGCCAACTTCTTTACGAAGAACTTATACATAGCTACAAGGATGTGGAATTTAATGGAACTCTTGTCAAAAAATAGAAATAGAAATAATGATCTGAGTAAAAATGATTTGGAGATCCAGCAGTTTATTCCTTAACAAAGCTAGCTTATATACCCAACAAAGTAACGATTATCAATCTATGCCCAAATTGCTGGGAAATAACAAAACAAAGCATCACTGGAGAGAATAGAGCAACTATTAGGAGAAACAGTCTAGAACTAAATAATTTTATAGCCTGATAAATATTTTGCCTTGTAAATGAAATTATGCAAGTAAAATCTATGGAATATGGGAAGCGTAGTGGGGAGGTGGCTTCATTCAACTTCCAGAGGAGCGAACTAGCCTCTAATCATGGTAACAACAACATAACAACTTACTTTCAACCGGCAAGCCTACATGCCAATACTTGTTAGAAGATACTAGAAACGCCCTTTCACTTTTTTTAATAACGTTGCTTGTGAGCAATTTTCTATGTTTCAGGCTAACTGTGATGTGCCTTTTGTTTTTTATCTGCTGATTCTTTATGATAACAGTGCTTTATGTGTCTATAAATATAAAAACAAAAAACACATTTGATTAATTGCAGAATTATTTGCAATAATGCTTGCATCCTGACAATTATTGTTTCGATATTCAGTTACCAACTTTGAATTTATACTATAATACTTTAAAAGAACCTAAGTATGGCAACAAGAAATTAACAAGACAGTGATTTAGTCAAACTTAGTAGTGAGTGAACAATAAGTAAGTAAATAATTTTCTAAGTTGCTATGAGCAACACTTATGGGCATTCGTGATAAATAGTTTCACAGAAATTGAGTTTGTCTAACCGAAGAGAGAGACAGACAGGATTTAAACTTCGGTGGGACCTACTGACGAAGAAAGTGGTGAGGAGATGAACTTATTCTACAGTGGAAAATTTAGAGGAATTCTTGAAAGGAGAAAGAGGTATCGACATTGACCTTCTGGAAAATACAGTGATTGGAGGATGTGAACCTGACTCTTGCGTTGTTGGTGACAGTTGCTTAGAAAATTCTGATCCAAAGATAGAAATTGGAGAAACAAGGCGTTTGTAGCTCAGAGGAGGTATTTGGGAAGATGACAAAACTTTGATGTCAGGAGGACATAAAGACGACCATGAGTTCTTCTACACTTGCTTTTTGATACTTCAGCTAATTCATTTAATGGCTAAACGAAACTGATATACAGTCATGGTCAAATTATTTCACAAAGTGCATTTTTGTGGGTCTAAACAGTTGCTTGATACTAAAACAACAAAAGTGGGGGGAGGTGAGTAAAAACTTTGCTTTGCAGAAGTCTCAAACCTATGCAGGAGTCAGATGAAGAAGAATTGAAAAAATAACTGTTCTATGCTGGAAGGGCAAATGAAGAGATCTTTATCCCATTCCATCCATTCCATCCATTCCATCCATTCCATCCATCCATTCCATCCATGTCCATTCCATTCCATTCCATCCATCCATCCATTCCATCCTTCCATTCCTGTCCATCCATCCTCCGTCCATTCCTCCATCCATTCCATTCCATTCCTCCATCCACCTCCATCCATTCCATCCATTCCATCCTTTCCTTCCATTCCTCCATCCATCCATCCATCCATTCCATCCATCCGTCCATTTCCATTCCATTCCTTC
->4d2b1428-abe0-4818-b622-bba2d950ccd5
-TTATCAAAACTCCTGAAAGAGACCCAAAAAAAAACTCAATGCGTGTCGTATTGCCAAAGTTTAATCCTGAACGCACGGGCTTAGACACTCAATCCTGGTGCGGAGACCAAGTCTACATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCGCGAAGCCCTCGAAACCATAGAGTTGTGTCGGCCGGTGTGTGCGGCAAACTGGCAAATCACACGGTGGAGTCGCGCCATAGTTCTGCGCTGCAATCGTACGCGAGGATTAATTGTGCGCCTGTTTCGTAAATAGGTGTTATTATCTTGCACCGCA
->ceebc08c-7aa9-494d-aebb-17eda5aff43f
-TTAAAGGCACCGTTCGGTTACGTATTGCTAAGCGATCAGCGCTTGGCCAAACGGAAGCGACCAGGCAATTATGTATGTTATGCCAGCCCTCAAATTGGGTGCTCGTATTACGTATACGCGTGCTGGATGTTTGTACACATTGCAACAGGTGCTTCGTATGATACACATGGGTACACAGTGCTTAACCGATATGTGTGCATACTACGACGGTAGCTCATTTGCCTACCTTAAATTCTGGTCGCAGAATCGCCATTTTCGAACTGTTAGAAAAGTTTTGAAAGCTCACAAAGGGCCAAAAAACTCAATGCTGTCTGTTGCTACCCGAAGTTTAATCCTGAACGCACGACTGGGCACCTCAATCCTGGTGCTGGCAAATTCGAGTCTACATCGTGAAGACGGACGTCTTAGAATACGCGGCGCGAAATATACTCGAAACCATAAGTGATGTCTCGGCCGGTGTGACGGCAAACTGGCAGTTGAGTCGCGCCGCCAGGCTACTGCAATCACGCGGCGGGGATTAATTGTGCGCCTGTTTCAAAAGCAATAATGGCA
->ab6053ad-b8e4-4751-a199-149dfb18fd03
-TTGTTGTACTTCGTTCCAGTTACGTATTGCTAGACCAAAAAACTCCAATGCTGTCGTATTGCCAAAGTTTAATCCTGAACGCACAGGCTTAGACACTCAATCCTGAATTGCGAGACCAAGTCTACATCGCCGTGAAGACGGACGTCTTAAATTACACTTGCGCAGAAATACTCGAAACCATAGAAGTTGTGTCGGCCGGTGTGTGCGGCAAGAGCTGGCAAATCACACGGTGGGTCGCTGCGCCATAGTTCTGCGCTGCAATCCGCGCCCAGGGTTAATTGTGCGCCGTA
->ead3cd4f-2c70-4833-91d5-8cbb462c3771
-TTGTTGTACTTCGTTCAGTTACGTATTGCTTAACTCGCGTGATTGCAGCGCAGAACTATGGCGCGACTCCACCGTGTGATTTTTGCCAGTTGCACACACCGGCCGACACAACTTCTATGGTTTCGAGTATTTCGCGCCGCGTAATTTAAGACGTCCGTCTTCACGGCGATGTGAACTTGGTCTCCGCACCGGGATTAGTGTCTAAGCCTGTGCGTTCAGGATTAAACTTTGGCAATACGACAGCGTGAGTTTTAAAGGTCTCTTTGTGAGTTTGCACTTCTTTTAACAGTTCAGAAAATGGCGATTCTGCGACTCTAGAATTGTCAACAAAATTGTTTTCACTATTGTAGTATGCACACATATCGGTTAAGCACTGTACCTATATTAATGATTCGCAATTGTAACTTTCTGTTGCCAGTATTGCATAAACAGTCCAGCACAAGTGTATACGTAATACGAGCACACCACTTGAGGGGCTAACATACATAATTGCCTGGTCCATCATTCTCCCGCTGGCAGCAATACGTAACCCCGCA
->0710cc90-79b8-4110-8b96-220adece61b7
-TTAACTCAGTGTACTTCGTTCAGTTACGTATTGCTTCTTCCTTGTGGGACTCAGCTTTTATAAGTGCAAGGGCAGTATTCATTTTTTTTTGTTGCAAATAAAATTGTCTATTGGTTAAGTATGGCTTTAATGTATAAAATATGGTTTTTTTTTTTTATATGATAAGCCATCATGCCAAAGATCGATCAAACGCTTGTTAAGCAATCAAGAAATTTAGCAGTGCAGTATTTTTCAACTCTCAAATGCTGACATTTTCATTTTTTAATCCTGTGACATTGCTCAGGGGTTCCGTGGCTCTTCGAATCAAACTGGTGTTTGGAATTCATGATAACAATTCTTCAAGATTGACAACATTCTCTTTAAAAATTATTTTTTTAAATACTTTAGAAAATGTGACAACAAACTAATGGGACGGTACAATGTCACTTCATTTCTGCCTTGTTTGGTTTAAGTTCCTATAATTTCTGCACATTTCCATTGTGGCTTGGGAGTGGTCAACTCCTAACCGCCATTTTTTTTTCAAGGCTATGCCATCTATTTTATCCCAATCTGGAGCCTTTTTTTACTTTTTTAGCCATTTCTGATGAAACTTCATTAATACTGATTTACGAATGGGTAAGCTCATTTTAGCAGTGACTCGAAAAAGTTATCTACTTCCTTTCTGTTTGCGGGTTATCAATATCATTTTGGCTGAAATACAGAGTGCAGGTGTTAAGCAAATGCTTTGGCAATTCATCATCAGATCTACGCCATTCGCCATTAGAGTTCGGACTACTGTGTTTCTTTTGCAGGTCGCTTGAGATATTTGGTTACTCTCCATAAATTATGTTCGTGGTTACAAGAGAATGTGGATCTAGATTTCTAAGATATTCAGCGAGAGATTAATTTCTTAAAGTTGACCAGTAGTTTTCTGCGATCAGATGCAACCTTGTTATACGATCTTTTTGTCCGGCAGGGTGAGAGTTTCTTGCCATCTCTTACGCAAATTTCTCTTGTGTTGTATTTGTTGTCAGTTTCAGCTGAGAGATAGAGCTGATTTGATTGTGAGTTTCTGGCTGGTAGCTTCGTACATATATAGCTTTATGGATCTTGTTTGTGAGTAGCTCCACGGTAGCTCTCCTCTCCTGATTTTAGCAGAAATATCAGGCTGATAGCTGTTTCAGATAACTTTTAAATGCATTGATATCTGTATTTGCAATATGAGAGCTACTGTACTGTATGTCATATTATTAGAGAATGATCTGAGCTTAGATCAAAACTTTCCATTATTATTCGCATGTGAGATTCTGGGATTCCAATTATGCTACGAAATCTTTTAACCCTTTCGCGCCAACCTTTTTTACCCGTGAAATTTTGTTTTATCATTAATGTTTTTTACATTTATTTTTTTAGAAAAATTTAGCAAAATTTTTTAGTATGCACCACGCCAGTAGTTTGGGCGGTATAGAAGATTTTCTTATGAGAGCAACGTCGGGCAGTAGTGATGTGTAAGCATTGTTTTTTTTTATAAATCACAGAATATGAAATATTTTCTTTATAATGACAATTTAAGTGTGGTATGACAAAAACAGTTTTTTTTTATTGTTATTGCGGCACAGATGGACTTTTGCATGTAGGCGTTGGTCATCGGTGTTGCAATTTTACAGTCTGCAACGTCCTCTTTCTCAAAAACTGCAATGTTCAACTTTATCATACATTACGGTACCTGTTGCAAAGATTCCTATTTCCTTCAATGAAATCAGAAGGATTACAGACGTAAAACCAATTATCAAAATACAGTTTAAAATTTTGTCTTTGGGAAGACTTTCTGCCAAATATAAAGACAACATAAGATGATATTCCCAAATACAAGAAGGAGAAGTGCCTTCTCAACTTATATAGCGTAAAATCATAAACTAATCCAAGATATTCCAGCCCGCGTAGTATTTAAGACCCCATTTATGAGTTTGGATTATATTGCTAGCGTGGATCGACCTTATACAACAAAGCAATTATTAAAAATAAAGCTAATTTAAAGAAAATTAAAACATTACCTTTGAATGCAATTATTTGCTCATCGACACTTTGATGCTCTTCCCTGCGTTGGATTTTCGAATTTTCTTTTGAGTCTGAGCAAAGGAGCGGATCTTGTAGAGTTTATCATAGTTGCAATCCCCTTTTTTTTTAATTGTTTGGCGTTGTCGTTGGAAATGTAAGCATTGTTTTATTTTTTTAAATCTCCCACGCGGCATTGAATCCAGTTATTGCGGTAATCTTTAAATACTTGACCACGCCATTCTGAATTGCGGTAGTTTTAAAACTTGCAAAGTACAATAAAAAATGCCAATGCTTAGCGTTTGATTTCCTCATCAATTACATTTAAGTTCAATACCGTGCTCCTGCAAGCTATATACAGAGGTGGTCAAAGTATTTTCACAACGCACAATATTTGCAAGCTTCAACTTCTTTTTTTGTTATATTTCTTCTTGTTGTTGTCCGATTTTGCCTGAAATAGTTCTTATCGCTTAGCTTGATCTATGCGAAGGTAGTCGAAAAGAAATACGAAAGATAACGGTTCATAATTACAAGCTTAAAGCAAAGAAATATGCATGCAAGGTTGTCAATAGTATTTTCACATGTTTATTGCGCTAAAGTATTTTCACTCCAACCCAATTTGGTAAATTTCGGCAACATCTGAATTTCAACATAAGAATTTCTTTATTTTATATAAATACAATACTAATATTTTGTAACACCACCTTTGGCATCAATAACTGCTTGAAGTCTTTTTTTGGTATTGACCTTACCAAGTTTGTTACCAAATTCTAGTATCAATTTGGACCAAATCTCCGCTATTTCAATGATGGCTCCCTCGTTTTCTATTTTTATCAATAGTTCGTTGGTTTTAATAAAACTAAAACGTTTTCAATGATATTAAGGTCTTTGGGCTTTGGGGGGGGCCACGGAAGAACCGCCAGATTAAGGTCGTTTAAAAAATTTTGTTGGTATCCTACCCTTATGGCATGGAGCATTCTCCTGCTGAAGAATCCATTCAGTAGTTGGAAAAAGTCTATTTCAGACGTAAAAGCATGGTTGTTTTGAATAAGAAGGTATCCGTTCTGATTTAAAGTACCTTCTATCGGTACCAAGTCTCCGAATCCATAATAGAGGAAGACATCCCAAAACATGACTGTGCCCCACCAAATCCTATTGGTTGGCTGGGCTGCCAAATGCTTTTGATTATTTTTTTCAAATGCATAAAATGCTGCTGTATGACCCTGGTACTGAAATGCAGACTCATCAGTCCACAAAATATTAAACCAAAAGTCAGAGGCTTCTTAACATGTATTCCAACGCAAATCGAAGACGTTTTGTTGTTTTGTTGGTTGGTGTGATCTCAATCGTTTTGCGAACAAAGGTATGTCTTAAAATCAGCTTTTCTTTTAGCCTGCGACGAATTGTAGAACTACTAACTTGTTTGCCAATTATTTTTTGATTCTAAGGCAATTTTGCGGACTGGCACTAAGTTCTTCACGCCACAACTCCAGAGTATTTGCCTGCATTGCCTTTGGTCCAGCACAGGTTTTTTCGGCCTGATCTTTTTTTTATTTTTAATGTGCCAGCATCAAACTTTTTTTTTTATTAAGTAGTAGGTAGTTCTACGCGAAATTTGATATATTTCAGCTATTTTGGCCGCAGGTGTACCGGCTTTAAACCCTAGCAATACCAGCCCGGGCCTCAACTGTTAACTCTTTTGTTTTGGGCATTTTATTTAATAACTGTAATACAGGAAAATGGTTGAAATCTAATTTTTTATTCAATAATTTAAATGTATTTAAGCAAAACAAACCGGCACTTGTCACTCTAAACCAATCACTGAAGAGAAATTGCGTTGTGAAAATAATTGTGATGCGACGAAACCGTGTGCAAATAACCCTGACAACTGATAAAGATCTCTTCATTTGCCTCTTCCTTGCGCATAGGAACAGTTATTTTTCAATTCTTCTTTCATCTGACTCTGCATAGGTTGAATTTGCAAAAGCAAAAGTTTTTTGCATTCACCTCCACTTGCTGCACAAGCAACTGTTTGTGTTATGCACAAAAATGCACTTTGTGAAAATAATTTTTGACCATGACTGTATATCAGTTTGCTAATACCATTAAATGAATTAGCTGAGTATCAAAAGTGTGTAGAACTCCACGGTCGTCTTTTGTCCCCGACATCAAAGGTTTTGTCCTTCCCAAATGCTCTCTGGGCTACAAACGGCCTTGTTCTCCACTTTAGCCTCTTTGGATCAATTTCTCTGGCAACTGTCAACAACAACGCAGAGTCAGGTTCACATCCTTCAATCCTGTATTTTCCAGAAGGTCAATGTCGATACTTTCTCCCTTTCAAGAATTCCTTCTAAATTCATCAGTACCGTAGAAATGTCTTTCATCTCCTCACCACTTTCTTCGTCGGTAAATATCCCAATCGAAGTTTAAATCCCGTTCAATTTCTTCGTTAGACAAACCTTTTCACTTTCGGTGAAAATTATTATCACGAATGCCAAGGTTGCTCACAAGCAGCAGAAAAGTGTTACTTACTTATTGTTCACTACTTACTAAGTTTGACTAAATCACTGTCTTGTTAACTCTTTGCTGTTTATACTTTAGAGTTCTTTTTTTAAAGTATAAAAGTAAATTAATAATTCAAAAAGTTACACCGAACCATCGAAACAATAATTATTGTGATGCGCGTGCTGTTGTACGGAAATAATTCCTGCAATTAATCTCCAAATGCGTTTTGCTTTTTTATATTTAGGTAGACACATAAAAGCACCGTTATCATAAAGAATCAGCAGATAAAAACAAAAGGCACACTTACAGTTAGCTCTGAAAACATAGAAATTGCTCACAAGCAACGTTGGGTGCGAAAGGGTTAAGTTTGGTATCTTTCTACTATCAATGGAAGGCCAGTATGTAGGCTTGCCGGTTGAAAGTGTTGTTATGCTGTTGTTACTATACATTTGTACAGTTCGCTTCCTTCAGGCTTAGCATTGAGGAGTCACCTCCACTACGCTTCCATATTCAAGGTTGGGATTTACTTGCATAATTTGTTTTACAAATAACATTATCATGTTAAGTAAATTATTTGTAAGTTCAGACTGTTTTTCCTAATAGTTGCTCTATTCTCTCCGGTGATGTGTTTGTTTGCTATTTCCTGCAGCAATTTGGGCATAAGATTGATAATCGTTACTTTGTTGGGTATATGTTGGCTTGTTAGGCGGAACAAACTTTGCTGGATTCCTAAATCATTTTTTACTCAGATCATTATTTCTATTTTTCTATTTTTTTTTGGACAAGAGTTCCTGATAAATTCTACACACCCTTTGTAGCTGGCGGCGTGTTCTTCGTAGCAGTTGGCACACATTTTTGCTGGATTTGTTCTGTATTTTCGGGCAAATCCTTGGGTGTCGAGAAGAGGATTTTTTACACAGCGGTACACGTTTTGGTACAATATGATTTAGTATGTCGAATTCCTGGCAGCTATAGCATTGAACGGTGATTTCATTGTGGGAGGCTCAATATTTTTTATTTACATTATATATGTCTAGGTTTTGTTAGGCTCAATATCTACATAAAACATGTTCAGTGACGTTTTGGTCCTTTTGACTTTTAATATTACTTATGTTTCTAACAACATGACCTTTTGACTCTTCATCACTTTTAATTTCATCTAAATTTGTGGAAAAATGCAAATTCTTAATAACAACTCTAAATGCTCTGTCATCCTTAAGCTGGTATGTGTGGTACTGCACACAATCATTATTAAGTGTTTTGACTAATTTTCAGAATTCTTCAATACTTTTTTATGCCATTACTCTTACATGTCCATAACGTTGAATCTTATAATAAAAAGTTCTCTCTCTTAATTTTAGTTTTTAAAGATAGGTTAGCTTTTCACTTATACCACCATTGACGTCAGAGAGAAAGATAGGTGGGGCTTAGCAAAATCAGTTGCACTGTCTTCATTTACATTTCGAGATCTTCGTTTTGTTATATTTGTTTCCTGTTTTGTCGGGCAATCCGTCGCTTAAGAGCAGAAATTATTTGCGCTGGTGCTTGATGAATTGTCCAGAATCCTGTTTTCTTTGAACTTCGGGAGAGGCTTGGTCTCTTTTTGGATTTTATTTTACTCTCTGCCATTTCAAAGCAGTTAGGTCTTCGTCGGTGTCGCTCTGCCCGAATTATTAGAAGACAATGATTGTTAGTGCTTGTGTGTCGCACTTCGTGCCTCAAGATATGACCAAAGCAAAGACACTAGAATAATTCTAATTTGATATGACGTTTTGCAATAAACAGTTAGCATTTTTTTTATTTTATAAATTTTTATTTTCTACTTCATTAGTTATTTTTATGAAATATTTTTTTCTCAGTGTAATGACTTCTTTTCAGTTTTTTTTATATTCCAATTTGATATCTTAAACAGCGCGCAATTTCATCATATTCTACGAAATTGGCCAAAACTCTAAATATGTATTGCATATGTAAATTCGTTACTGCGATCAAATTGATTTCGGCCCGGAAATTCGCCTTCTAGCACAACGCACACATATACGCGTTCTCGTCTTTTTGTTTTACTCACTGAAGCAAGCAAATTCTATTTTGATTTCTTGCAGCTCAGCGTGAGAGCGAGCGGAAGGAAGTAATTTTGATCACCAAAAGTGGCTTGCATAGTGCCAAACCAGTGTATGAAGCTGTTACGCATCTTATTATTCCTAGTGTGTCTTTGATGCGGGGCCATGTGACTTTTGCTTAAATGTGTACATACTCCAACCCATACCACCTCAAAAGTAAGATTGCTGTGCACATTACTCACGAGATGCACGTCCTTCTGACGAATAATTTTGATCCAGCATTCGTTGCGAGGTGTTGGGAGACCAAGCCCAACAGATCAATTGAACATATTATTTACATAAATTCAGTTTTGCAAACTATTTTAACTAAAATTAATATTAGTCATCTTTGTAAACTCAAAATTATCAGTAAACTTAATTAAATTTGGTTAAATGATAGTTAGTTTGGATAGTTCAGTCTGGTTCTCGTCAGTTCAATCTAAAGAATATAATGTTTTAATTCATTCTGAGAGTCAAAGTCCACTTCTCAATGTAATGAATCTTGCAAGATGGTACCGGCAAGATTTGTAAATTTGTAGATATATACAGTTTGTCCAAAGCTATTTACACGCCGTGAAATAAGTTGAATTTTTTTTCACTTTAAAGGTCAAAATTAAAGGGTTATTTCTTTAATTAAACGCAATTTTTTTTAGTAGAAATATAATTAAACAATATTTATTTTACTTATAAATTAAAAAAACAAATTCAAAATATCAAATATACAAGAAATTAAACAACAAATTCAAGTTTACACACTTTTTTTGAGGTGTGAAACTCCTTACATTTTGTTTTCCCTGCTTTGTTTTGCTCTTTTTTTCTTAGAACGAACTCGATTTTTCCGTTATTTTTTTGGCATTTGCATTCCTTTTTTCTTGCTTCTATTGAAATTTTTTTTTTTTTACTTTGCTTGGCGGTACCTTTGATCGAATGAGTTATTAAATTTAATAAAATGCCTGAAATAGATTAGCTTTTGAGTGACCCAAATATTATACTAAAACCACCAGTTGGAAAATCTATTCAGAATTAGTATAAATGTTTCTGTATCAATAAGACCGTCTACAATGTTTTTTAATCGCTTGAACAGGAGAACAGGCTTGAACCTAAGAGTGGTGGGCGCAAAACTAAAATTAGCAAGCGTGTAGACCGCCTTATTATGCGAAAAGTGATTGCGAACCCCGAATCTCGGTGAATCACTTGCTCAGGATAGTCAGGCAAGAATGTCTTGACCTGGTTATTGCCACCTGAAAACTGTGCGCCAAGTCATTCTACGCCATAGGTACTCTTCAAGAGTTGCAGAAAAAAAAGCCTTTGCTATCAGAGGTCAATATAGAAAAGCGTCATTCATTCGCTGTGAGCGATGGATCATGCGAAGGAAGAGTACTGGGATGACGTAATATTTTTGTGACGAAACAAAATGATGCTCTATTATATGACGATGGGCCAAGCAGAGTATGGCGCAAGCTGTTGAGTGCGCTAAGAAAAAACAAAATATCCATTCCAACAATCAGAATTTGAAGGAATTATCGGTGATGATTTGGGGCTGTATCTCTCAAAAACCGTAGGTGGAGCAAAATTAAGCCTTTATTGAAGCACTATGAATGCCGTGCAATATCTAGATATTTAAAATCAATTTGAAGGCCAGTGCAGAAAATTTGGTCTATTTAACAACAACAATAGAATTTAAGTTTTATCGGACAATGATCCCAACATAAAGAGTGCAATGTACCAACTGGCTCCTTTATAACTGTGGCAAAGGTGATCGATACGCCCCCCTCAGAGTCTTGATCTGAACCCCATTGAAAATTTGTGGAGCCTACTTAAAGAAGAATGTGTAAAAGGGGCACCAAAACTTACGACAACAGCTCTTGGCTGCGATGAAGTGGAAAGATCCCGCTTGAATATGACCACAAAAAACTCATCCATTCCATGAAAAAAAGCTTCCAACTTGTGGCCAAAGCCAATGGGGTCATACTAAATACTACAACTTTTCAAATTTACAACAAAATAATTTAAAATTTAGGATTAAACTTAAGGTTTAGTGTTTTGTGTAAAGAGTTCTTGAAACTCTCAAAGTGTTAAACTTGGAATTCGTTGTTTATTTTCTTGTATGTTTGATATTTTGGATTTGTTTTAATTTATAAGTAAAATAAATATTGTTTAATTATATTTCCTAAAAAAAAATTGCGTTTAATTAAGCAAATAACCCTTAATTTTGACCGTTAAAATCAAGAAATTCATCTTATTTCGTTGGGTAAGCAATTTCTTGACAAACTGTACTTGTCATAGATTATTTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTAGAGAGTGATGCCGAGTATATAAAGTAATTCCAGATCGACATCAAGTGGGACCGCCTACTCAACTTCCTGTAGTTTCACATTGTGTCATAGATCATTTGTGTTTAGCTGTTCTTTATTTGATCCAATTTGAGACAGGGAAGGTCCGCTCCATTCAGTAGTCAATCCTCTTATGATCTACATACAAAGGGTTTCTTAGCCTAAGTCGAGAACGCTGCCAAGCATAGCCTGCAACGCAGCAACGCTGCCTATGCGTATCTTATATATATGTATATATATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAGAATTGGTATGAGCACACATATAAGCGATCAGCGCTTGTAGCAGGAGAACTGCTGACCAGGCAATTATGTATGTTAGCCTCAAGTGGGTGCTCGTATTACATGCATACGCATTGCTGGACTGTTTATGTACATTGCAAGCAGGTGCTACAATTATGAATACACATAGGTACAGTGCTTAACCGATATGTGTGCATACTACAATAGTGAAACAATTTGCTGACAATTCTAGAGTCGCAGAATCGCCATTTTCTGAACTGTTAAAAGAAGTGCAAAACTCACAAAGAGACCCAAAAAACTCAATGCTGTCGTATTGCCAAAGTTTAATCCTGAACGCACAGGCAGACACTCAATCCTGGTGCGGAGACCAAGTCTACATCGCCGTGAAGACGGACGTCTTAAATTACGCGGCCGTC
->bd6456a8-f3f9-41d1-b407-82b3ba62d032
-CTGATACTTCGTTTCAGTTACGTATTGCTTGATCTACATACAAAGGTTTCTTAGCCTAAGTCGAGGAGCAGCGCTGCCAGCGCCAGCCTGCAGCGCAGCAACATATGCGTATCTTATATATATGTATATATATATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAGGAGAGTAGTATAGAGCACACATATAAGCGATCAACTTGGCCAGCAGGGAGAACTGCTGACCAGGCAATTATGTATGTTAGCCCTGAAGTGGGTGCTCGTATTACGTATACACTTGTGCTGGACTGTTTATGTACACATTGCAACAGAGTGCTACAATTATGAATACATAGGTACAGTGCTTAACCGATATGTGTGCATGCAATAGTGAAAACAATTTGCTGACAATTCTAGAGTCGCCAGAATCGCCATTTTTTTCTGAACTGTTAAAGAAGTGCAAAACTCACAAAAGGAGACCAAAACTCGAAATGCTGTCGTATTGCCAAGTTTAATCCTGAACGCACAGGCCAGACACTCAATCCTGGTGCGGAGACCAAGTCTACATCGCCGTGAGACGTCTTAAGCAATAGCCAACTACC
->9b8f82a7-638a-4d64-abd5-2f0e11554a9e
-TTCATGGCCGTTTCGGTTACGTATTGCTGTCTGAAGCCTGTACGTTCCAGGATTAAACTTTGCTTGAAAATTACGACTAGCGTGGGATTTTTAGGTCTCTTGCCAGGTTTTGCGCTAGCACTAGCGGATTTCAGAAGAAGTAGCGATTCTGCGACTCAGTTATCAATAGGTGTACATACGCACTATTGTAGTATGCACACACATATCGGTTGCCGGCCACTGTACCTATATGTATTTATTCATAATTCCGCCTCCTGTTGCAATGTAATACGCCGACAGTCCAGCACAAGTGTATACGTAATGCAGGCACCCAGCGAGGGCTAACATACATAGTGCCTGGTCAGCAGTTCTCCCGCTATTGAAGCTGATCCTTATATATTGTACCTATACCACTCCCTCCTCCAGCACCATCAGCTCTGGCGACGAATTACATATATATATACATATATACAAGATGCGCGCATATAAGCGTTGCTGCGCTGCAGGAGAAGTATACAGCGCTGCTCGACAGAGCTAAAGAGCCTTTGTATATAGATCATGGAGGATTGGCCAGATTAATTTCCAGATGGAATGGGACCCAGCCCTGTTCCTCAAATTGGATCAGATAAAGAACGAAACTCTAAAACGCAGATGATCCGCAGCTGTGAAGTAGAACTACTGGGAAGTTAGATGGAAGCGGTCCACTTCTGATCGGATCTGAATCACCTTTATACTCAGCATCCTCTCTACAGCTGGACCTGAAGTAGCAGAGGCAGTCGTTAACTTGGAATTAAAGAATAAATCTGCGACAAATTACAGTTTGTCAAAGAGCTGTTTACACCGTAGAATAAGATAGATTTTGATTTAACGGTCAAAATTAAAGGGTTATTTGCTTGAATTCGACGCAATAATTTTTTTTTTTTTAGAGTATAATTAGAGCAATATTTTATTTTACTTATAAATTCAAAAAACAAATTCAAGATATCAAATGCTACAAGGAAGAATAAACCAGCAGATTCCAAGTTTAAACACTTTGGGAGTTTCAAGAGCTCTTTACAAGAACTACTAAACTCAGTTTAATCCCTGGAGATTTTTAAATTATTTTGTATTAAAGATTTGAAGGTTGTAGTATTTAGTATGACCCCCATTGGCTTTGGCTCTAGGGTTTAGGCTTTTTTTTCATAATGGGATGGATGGAGTTTTTTTAGGTCATATTCAAACGGATCTTTTCCCACTCTATCCCTTGACCATAGGGGCTGTCATATTTTGGAGTACCTTTTGCCCACATTCTTGCTAAAATTAGGCCCACAAGATTTTTCAATGGGGTTCGGATCAAATGGACTCTAAGGGGAATATCAGTCCACCTTACCACGGATATAAGACCAGTTGCATTACATTGCACTCTTTATATTTGGGATCATTATCCTGGTCGAGCTTAAAAAAATTTGAAGCTGTTGCTTCGATAGACACCAGATTTTTCTGCACTGGCCTTCGATTTGATTTTGGAAATATCTAGATGTGCAGCATTCCTTAGATGCTTTCAATGCGAAATTAGATTTACTTATCCATGGCTTAGGATACGGCTAAGATCATCCTTTGATAAGATTTTTTTAGATTTGGTTATTTAGGATAAGTATTTTGTTTTTCCTAGGCGCACTCAACGAAGCTTACGCCATACTCTGCTTAGCCCATCGATTATAATGGGGCATCATTTTTGTTTCGTCACAAAGTCTTACATCATCAATTACTCTTCGCAGTCATCAGCCTCCACAGCCAGATAGATAGCCTTTTCTCTTCGACCTCTGATAGCCGGGGCTTTTTTCTTTTAGCTCTTAGAGAATTACCTATAGAATGGCTTAGCTTTGGTTTTATGTGCTTCTTCGGTCCATTCTTGCCTGATATCCTGAGCCAATTATTAGTCAGTATTGGGGATTCAGGGGTTCACAATCCACTTTTCGCGCTAATAAGGCCCAGTCTACACGCTTGCTAATTTTAGTTTGCGCCCACCCTCTTAGGTTTCAGAGCCTGTGTTCCTCTTTTCAAACCGATTCACAAACGGTACTTAGACGAGGTCTTACAGGATACGAGAGAGAACATTTATACTAAATTCCAGGTGATTTTTTTCCCAGCTGGTGGTTTTAGTATTATTTTGGAAGTCCTAGCTAAAGCTAAAATCCTATTTTTGGGCGATTTTATTCGATTTAATAACTCATTCCGATCAATAGTTTCCCAAACCAGAAGTAAAAAAAAATTCCAATGCGGAAAGCGTTGTAAAAGGAATGCACAGATGCAAAATGTGGAAAATCGAGTTCGATTCACAAGAAAGGGGCGGAAATAAAGTAGGAGAGAACCGAATGTATAAAGGGTTTCACCCTCTCAAAGTGTATGAAGCTTAGGATTTATTTATTTTAATTTCTTGTATATTTGATATTTTGGATTTGTTTTTTAATTCTCGTCGATAAATGTTATTTGATTATATTTCATTAAAATTGCGTTTAATTAGAAATAGCCCTTAATTTGTGCTTCAAAGTAGAAAATTCAACTTATTTCACAGCGTGCTCGTGGATTTCTTGACAAGGCTGTATATATCTACTAGGAATTTACCAGCACTTGAATTTACCATCTGCAAGTTCGACATTTACATTGAAGTGGACTTTGACTCTCAGGATAGATTAAAGGCAGTATATTCTTGATTAGACGAGCGAGGAACCAGGGCTGAATATGCGACTAGCTTCTGTTTAACTAGAGTTTAGATTAGGTTTACTGCCGTGAATTTTGAGTTTCTGCCCACAAAGAGATAGCTAATGTCTTAATTTTTTAGTTAAAATGGTTGCAAAACTAGATTTATATAAAATAATATATTCAATTGATCTAGTTTGGAGTTTTTCTAGAGTCTCCCCAACACCCTCCGCAACAGATACTGGATCAAAATTATTCATCAGAAGGACGTACAGTCATGGAGTAATAAAAGTACTGTAATCTGCACTTTTGAGGTGGCGTAGAAGATGCTGTACATTTCGTAAAGTCACACTTGAAATGCCATCAAAGAGACACTGGAATAATGGATTCCTTAACAGCCATACACTTTCGTTTGGCACTATGCAGCCCTTTTTTTTGGTGGCAGCCGAGAATTTGCTCTCTCCGCTCCTCCGCTTCTAGGCGTAAAGAATCTAAAATGGCGGGAATTGCCTTGCTTATGTAGAGTAGGAAACAAAGGGCAAAGGAACGCGTATATGGCCACGTGTGTTATGCTAGAAGGCGATTTCAGGCCAGAATCAATTCTGATCAATGCTTAGTTTACATATGCATACGTATGTTGGGAGTTTGAAAGCCAATTTCGTAGAATGGTAAATTGCGCGCTGTTGAATCTAGATTGGAGATATAAAAAAAAAAACTGAAAGAAGTCAATTTACATAGGAAAATGTTTCATAAAATAATGTTGGAGTAGAAATAGAGTTATAGGAATAAAAAAATGTGCTATTTATTTACCAGACATCATATCTCGATTAAATTATTCTAATTATCTTTGCTTTGAGTCATATCTTGAGGCTGGAATTACGGACTGACACTCAACAGTCATTTGTCTTCTTAAATACTCAAACAGAGCTGACGGCACACCGGCAGAGACCTAACTGCTTTAAGAATGGCAGAGGTAAAATCCGTCAAAAGGATAGAAGCCTCCAGAGTTCGAGAGCAGGATTCCCTGGACAGTTCCACATCAAGCACCAGCGCAAATAAATTTCAGCTCTCTTAGAAGCGTGGATTGCCCGACAAAGACAGAACCAGATATAGCAAAGCAGAGATCTCAGAATGAGTAAATGAGAGACAGTGCAGCTGGTTTTGCACAAGCCCCACCTATCTTTCTCTCGGCGTCAGTAGGTATAAATTGAAGCTAGCCTATCTTAAGGCTAAAATTAAAGGAAGACTTTTTTTATTATAAGACTCAACATTTATATATGGACCTTATAAGAGGAGTAATGGATTTAAAGTATTGGAAGAGATTCTAGGTCGTCCGGAAACCTTAATAATGATTGTATACCAGTACCACACATACCAACCTAGGATAATAGGCATTTAGAGTTATTATTAAGAATTTGCATTTTCCACAAATTTAGATGGGAATTAAAGAAAGTGATGGAAGTCAAAGGTCATGTTATTTAGAAACATAAGTAGTATTAAAATACGTACATTAAAGGCATTATGAACATATTTTTTATGTAAGATGTGGAGCCCTAGCAAAACCTAGACATATATAATGTAAATGGAATGTAGGCCTCCCCACAGTAGAAGATCGATTTCCAAATTATGCTATGGCTGCAGGAATTCGGACATACTAAAGTCATGTGTACCAAGGCAGTACGCTGTATAGAATCCTCTTCCTCGACACCCCAAGCAACATTTGCCCGAAAATGGAGACAATAGCCGATGCTGCAACTGCTGCAAGAACACGCCATAGCTTCACAAGGTGCCAGTTATCAGGGCTCTGTCAAAATAGAAAGGAAATAGAAATAATGAATCCCAGATACAAAATGGTTTACAGGAATCCAGCAAGTTTGTTCCGCCTAACAGACCAACATATACCCAACAAGTAACGATTCCATCAGTCACCCTTGCCCCAAGGTGCAGAAATATGCATAGAATAAGACACATCACTGGAGAGATGAGGCAATATTGGGAAACAGTCTAGACTTACAAATGAATTTACTTATGATGAAATGTACTTACATAAAATAAGAGTGCAAATAAAGTCTAATAACCTTGGAATGCATGAAGTAGGAGTGAGAAAACTGATACTAGAAAAACTTCCAGAGGGAAACCCAGACTGTACAAATGCATAGTAAACAGCAGCGCAGCAACGCTCCAATGGCAAGGCCCTACATACTGGCCTACTGATAGTAGAAGATGCAAATAGCCCTTTTACCACTTTTAGCATTTGCTTGTAGGTAGTTTCTATATTTTTCAAGACTAATAAGTGTACCTTTTTGTTTTTATCTGCTGAGTTCTTGCAATGCTTGGTGCTTTTATATATATCTACTCTAAATGTAAAAGAAGCCAAAGAACGCATTTGGAGATTAATTGCAGAGATTAACGATAAATAGCACGCGCATCCTGATAGTTATTGTTTTCGATATTCAGTTGCGGCTTTGGGATTAATGAATTTGCTTTTTATAATGCTTTGAAAGACCTAAAGTATAAACATGAAAGGAGTTAACTAGGACAGTGATTTTAAACA
->f55b0ceb-8665-4045-95f3-f89652a49876
-TTGGTGTACTTCGTTCAGTTACGCGACTATTGCTATTATTTACTATGAATGCCGTGCAATATCAGATATTTTAAAATCAAATTTGAAGACCAGTGCAGAAAAAGAATTTGGTCATTGTAACAAGCCAAATTTTAAGTTTTATCCAGGACAATGATCCCAAACATAAAGGGATGCAATAATACGCAACTGGCTCCTTTATAACTGTGAAGCAGAATTGATCGATACCCCTCAGAGTCTTGATCTGAACCCCATTGAAAATTTGTAGACCTACTTAGAGAATGTGGCAAAGGGGCACCAAAACGACTGTGGCTGCGATAAGTGGGAAAAAGATCCCTTGAATGACCTAAAAACTCATCCATTCCATGAAAAAAGCTTCAACTTTAGCCAAAGCCAATGGGGTCATACTAAATACACAACTTTTCAAATTTTAACAAAATAATTTAAAAGATTTAGGATTAAACTTAGGTTTAGTGTTTTGTGTAAAGAGTTTCTTGAAACTCTCAAAAGTGTTCAAGCTTTAGATTCGTTGGTATTTTCTTGTATATTTGATATTTTGAATTTGTTTTAATTTATAAATTAGTAAATATTGTTTAATTATATTTCCCTAAAAATTACGTTTAATTAACCAAATAACCTTAATTTTGACCGTTAAAATCAAAATTCATCTTATTTCACGGTGTGTAAGCAGTTTCTTGACAAACTGTACTTGTCATAGATTTATTTTAATTTCAAGTTAACGACCGTTTTCTGTTACTTTGTGTCCGCTGTGAAATTTGATGCCAGTATAAAGTGATTTGAATCCGACATCAAGTGGGACCACCCTACTCCAACTTCCCTGTGATTTCATTGTGTCATAGATCGTTTGTTTTAACTGTTCTTTATTTGATCAATTTGAGATTGAGGGTCCCGCTCCATTCGAGGAATTAATTCGTCAATCCTCTTATGATCTACATACAAAGGTTTCTTAGCCTAAGTCGAGAACCTTTGCCGGCATAGCCTGCAACGCAGCAACATATGTATCTTATATATGTATATATATATGTACTGTCCTTCAGCTTGATGGTGCTGGAGGAGAGTGGTATAGGCACATGCGTGATCAGCGCTTGTGACGGGAGAACTGCTGACCAGGCAATTGTAATGTTAGCCCGCAAGTGGGTGCTCGTGTACATTATATGTGCTGGACATTTATGTACACATTACCTTTGCACAATTATGAATACGCTAGGTACAGTGCTTAACCGATATGGTATGCATGCACTACAATGATGAAACAATTTGCATGTTCTAGAGAGAGTCGCAGAATCGCCATTTTCTGAACTGTTAAAAGAGACCTCACAAAGGGCAAAATAATTGTCGTATTGCCAAAGTTATAAAGGAACCAGTTGCATACATTACACTCTTTATGTTTGGGATCATTGTCTGATAAAACTTAAGAATTTGGCTTGTTGTTTGCTAAATAGACCAGAATTTTCTACACCTAGCCTTCAAATTTGATTTTAAATATCTAGATATTGCACAGCATTCATAGTGCTCAACCTTATTACGTAACTTGCTTGCA
->6915bb75-9550-42b8-8873-c4e07b18f079
-TTGATGTACTTCGTTCAGTTACGTATTGCTTCTCTTTGTGAGTTTGCACTTCTTTTAACAGTTCAGAAAATGGCGATTCTGCGACAAATTGTCAACCATTATTTTACTATTGTAGTAATACACATATCGGTTAAGCACTGTACCTATGTGTATTCATAGAGGTGGCGCCTCTCTGTTGCAATGTGTACATAAACAATCCAGCACAAGTGTATAAACGTACGGCACCCGCTGAGGGCTAACATACACTGTTGCCTGGTCAGCAGTTACTCCCTTTGTGAAAGCGTGATCGCTTATATGTGCCTATACCACTCCTCCTCCAGCACCATCGCTCGGCGACAGTACATATATATATACATATATATAAGATACGCATCTCAACGTTGCTGCGCTACACAGCTATGCCGGCAACACTGCTCCTCGACTTAGGCCTTCAAAACCTTTGTATGTAGATCATAAGAGGATTGACGAATTAATTTCAGATGGGCAGGACCTTCCCTGTTCCTCAAATTGGATCAAATAAAGAACAGCTAAAACACAAATGATCTATGACTACAATGAAACTACGAGAGTTGGAGTAGGCGGTCCCACTTCTGATGTCGGATCTGAATCACTTTATACTCCGGCATCACTCTCTACAGCGGACACAAAGAAGTAACGAAAACGGTCGTGCTTGAAATTAAAAAAAATAAATCTGCGACAAGAAGAGTACAGTTTGTGAAACTGTTTACACACCGTGAAATAAGATGAATTTTTGATTTTAACGGTCAAAATCAAGGGTTATTTGCTTAATTAAGCCGCAATTTTTTTTTAGGAAATATAATTAAACATATTTATTTACTTATAAATTAAAAAACAAATTCAAATATCAAAATATATACAAGAAAATAAACAACGAATTCCAGTTTAAACGCTTTTGAGAGTTTCAAGAAACTCGCAAAACACTAAACCTAGTTTAGTCTCATTTTAAATTATTTTGTTAAAATTTGAAAAGTTGTAGTATTTAGTATGACCCCCATTGGCTACAAGTTGAAGCTTTTTTTTCATGGAATGGATGAGTTTTTTTAGGTCATATTCAAGCGGGATCTTTTCCCACTCTATCGCAGCCATGAGCTGTTGTCGTGTTTTGGTGCCCCTTTTTTTGCCCATTCTTCTTTTAAGTAGGCCCACAAATTTTCAATGGGAGGTTCAGATCAAGACTCTGCAGGGGGCGTATCGATCACCTTGCCACAGTTATAAAGGTGATTGCGTACATTGCACTCTTTATGTTTGGGATCATTGTCCTGATAAAACTTAAAATTTGGCTTGTTGTTGCTAAATGAACCAAATTTTTCTGCACTGGCTAAATTTGGTTTTAAAATATCTAGATATTGCACGGCATTCATAATTCTGCTTTCAATAAAGCTAATTTGCCTCATGGCTTGAGGCCGGCCCCAATCGTATCACTGATAATTTTCCAAATTTGATTGTTGGAATGATATTTTGTTTTCCAGCGCGCTTCAACGGCTTTGCGCCATACTCTGTAGCCCATCGTTATAATAGAGCATCATTTTGTTTCGTCACAAAATATTACGTCATCAGTACTCTTCCGCATGATCCATCGCTGCTCACAGCCGATGAATGACGCTTTTCTATATTGACCTCTGATAGCAAGGCTTTTTTCTTGCAACTCTTGAAGAGTACCTATGGCGTAGAATGACTTGGCGCACAGTTTGTTATTGGCACAACTGGAGTCACATTCTTGCCTGATATCCTGAGCAAGTGATCGATAGCCGAATTCGGGGTTCGCAATCACTTTTCGCATAATAAGGCGACCACGCGCTTGCTAATTTTAGTTTTGCGCCCACCACTCTTGAGTTCAAGCCTGTTCTCTTTCAAGCGATTAAAAACATTGTAGACGGTCTTACGGGATACAGAAAACATTTATATAATTCTGGAATAGATTTTCAGCTGGTGGTTTAGTATATTATTTGGGTCATATAAAAGCTGAAATCTATTTCCAGGCATTTTATTAAATTTAATAACTCATTCGATCAGCAAGAATTTCACAAAGCAAAGTAAAAAAAATTTCAATAGAAGCGTTGTAAAGGAATGCAAATGCCAAAAATAACGGAAAAATCGGTTCGTTCTAAGAAAAAAAACAAAACAAAGTAGGAGAAACAAAATGTGTAGGGAGTTTCTTGCCGCTTTCCTCAAAGTGTGTAAACTTGGAATTTGTTGTTTAATTTCTTGTATATTTGATATTTTTGAATTTGTTTTTTAATTTATAAGTAAAATAAATATTGTTTAATTATGTTTAGGTAAAAATTACGTTTGAAATTAAAGAAATAACCCTTAATTTTTGACCTTTAAAATTGAAAAATTCAGCTTATTTCACGGCGTGTAATAGTTTCTTGACAAACTGTATATATCTACAAATTTACAACTTGCCGGTACCATCTGCAAGAATTCATTACATTGAAGTGGTTTGACTCTCAGAATGAATTAAAACATTATATTCTTAGATTGAACTGACGAGGAACAGACTGAACTAACTAAACTAACTATCATTTAACTAAATTTAATTAAGTTACTGATAATTTTGAGTTTTCTTACAAAGATGACTAATATTAATTTTTAGTTAAAATAGTTTGCAAAACTGAATTTATGTAAATAATATGTTCAATTGATCTGGTTGGGTTTTCTGGGTCTCCCCAACACCTCACCAACGAATGCTGGATCAAGGTATTTCGTCAGAAGGACGTGCACAGTCTCGTGGTAATAAAAGTACAACAATCTTACTTTTGGGGTGGCGTGTTGGAAAGTATGTACACATTTAAGCAAAGTCACATGGCCTGCATCAAAGACACTAGAATAATAAGATGCGTAACAGCCCTTTTACTGGTTTGGCACTATGCAGCATCCACGCTTTTTTGGTGACGGCCAAAATTGCTCTCTTTCCGCTCGCTCACGCACAGGCGTAGAAATCTAAAAATAGATTTGCTTGCTTGTGTGGTAAAACAAAAGACGAGAACAGCGTATATGTGTGCGTGTTGTGCTGAAGGCGATTTCGGGCCGAAATCAATTCTGATCATGGCGAATTTACATATGTACATACATATTTGGGAGTTTTGGCCAATTTCGTAGAATATGATGAAATTGCGCTGTTTAAGATATCAAATTGGAATATAAAAAAAAACTGAAAAGTCATTACACTGAGAAAAATATTTCATAAAAATAATGCGAAGTAGAAAATAAAAAATTTATAAAGCCAAAAAAAAATGTTAACTGTTTATTGCAAACGTCATATCAAATTAGGAATTATTCTAGTGTCTTTGCTTTGGTCATATCTTGAGGAGCTGAAGTTATACGGACACAAAACACTCAACAATCATTGTGTAATACTCAAACGGAGGCGACACCGACGAAGACCTAACTGCTTTGAAATGTGAAGTACAAATAAAATCAAAAAAGAGAGACCAAGCCCCTCCCGAAGTTCAAAGAAAACAGGATTCCTGGACAATTCATCAAGCACCAGCGCAAATAATTTCGCTCTCTTAAGCATGACGGATTGCCCGACAAAACAGGAAACAAATATAACAAAACGAAGATCTCAAATGGTAAATGAAGACAGTGCAACTGATTTTGCTAAGCCCCCACCTATCTTTCTCTGACGTCAATGGTATAAGTGAAAAGCTAACCTATCTTAAAACTAAAATTAAGAGAACTTTTTTTATTATAAGACTCAACGTTATGGACATGTAAAATGTGGTTAAAAAATATTGAAATTCTGAAAATTAGTCAAAACACTTAATAATGATTGTGTGCAGTACCACATACCAGCTTAAGGATGACAGAGCATTTAGAGTTGTTATTAAATTTGCATTTTTCCACAAATTTAGATGAAATTAAAAGTGATATGAAGAGTCAAAGGTCATGTTGTTAGAAACATAGTAATATTAAAAGCCGTGCGACCAAAACGTCACTGAACATGTTTTATGTAGATATTGAGCCTAACAAAAAACCTGAACATATATAATGTAAATAAAATATTGAAGACCTCCCCACAATGAAATCGTTCAATGCTATAGCTGCCAGAATTCGGACATACTAAATCATATTGTACCAAAACGTACCGCTGTGTAAAATCCTCTTCTCGACACACCCAAGCAACATTTGCCCGAAAATACAGAGACAACCAGCAAAATGTGCCAACTGCTACGAAAGAACACGCCAGCTACAAAGGGTGTAGAATTTATCAGAACTCTTGTCAAAAAATAGAAAATAAGCCATGATCTGAGTAAAAATGATTTAGGAATCCAGCAAAGTTTGTTCCGCCTAACAAGCCAACATATACCCAACAAGTAACGATTATCAATCTTATGCCCAAATTGCTGCAGGAAATAGCAAAACAAACATCACTGGAAGATAGAGCAACTATTATAGGAAAACAGTCTGAACACAAATAATTTACTTAACATGATAATGTTACTTATGGCTGGTATACATTAAATCCTAACCTTGAATATGGAAGCGTAGTAGGAGGTGACTTCAATGCTAAACTTCCGAAGAAACTTAACTGTACAAATGCATATTAAACAACAGCATAACAACACTTTCAACCGTGACCTACACATACTGGCCTACTGATGGTAGAAAGATGCCAAACAACCTTTCGCACCCAACGTTGCTTGTGAGCAATTCTATGTTTTCAGAGCTAACTGTAAGTGTGCCTTTTGTTTTTTATCTGCTGATTCTTTTATGATATGATTAACATGTGTCTACTCTAAATATAAAAGCAAAAAACGCATTTGGAGATTAATTGCAGAGATTATTTACCTGCAATAAATAGCACGCGCATCACAATAATTATTGTTTCGATATTCAGTTACCTTTGGAATTGATAATTTGCTTTTATAATACTTCAAAAGAACCTAAGTATAAACAGCAAAAGAGTTAACAAGACAGTGATTTAGTCAAACTTAGTAAGTAGTGAACAATAAGTAAGTAAATAATTTTTCTAAGTTGTGAGCAACCTTGGGCATTCGTGATGTAATTTTCACCGAAAATTAGAGGTTGTCTAACGAAGAAATTGAACGAGTTTAAGCTTCGATTGGGATATTTCTACTGACGAAGAAAGTGGTGAGAGATGAAAAGACATTTCTGGTACTGGAGAAAAGAATTTAGAAGGAATTCTTGAAAGGGGAGAAAGTATCGACATTGACCTTCTGGAGAAAATACAGTGATTGAAGGATGTGAACCTGACTCTTGCGTTGTTGTTGACAGTTGCTTAGAAAATTGATCCAAGAGGCTAAAGTGGAGAACAAGGCCGTTTCTTGGCTCAGAGAGTATTTGGGAAGATGATAAAACTTTTGATGTCGAGGACATAAAACGACAAGTGGAGTTCTTCTACCTTTTGATACTCAGCTAATTCATTTAATGGCTAGGCAAACTGATATACGGTATGGTCAAAATTATTTTCTAAAAGTGCATTTTTTGTGCATGGGTCACAACAGTTGCTTGTGCAGCAAGTGAAGTGAAATGCAAAAAAAAACTTTTGCTTTTGCAAATTCAAACCTATGCAGAGTCAGATGAAAAGAAAGAATTGAAAAAACCTTTGTTCCTATGCGCGGAAAGAGGCAAATGAAGAGATCTTTATCAGTTGTCAAGTATTTGCACACGGTTTCGTCGCATCACAATTTCACAACGCAATTCTTCTTCAGTGATTGGTTTAAGAGTGACAAGTGCCGGTTTGTTTGCTTAAATACATTTAAATTATTGAATAAAAAATTAAGATTCATTTTCTATTACGGTTATTAAATAAAAAATGCCCAAAACAAAAGAGTTAACAGTTGAGGCCCGGGCTGTGGTATTGTTGCTGAGTTTAAAGCCGGTACACCTGCGACCAAAATGGCTAAAAATATATCAAATTTCGCGTAAGACTGTCTACTACTTAATAAAAAAAAGTTTGATACAGTTGGCACATTAAAAATAAAAAAAAGATCAGGCCGAAAACCTGTGCTGGACCCAAAGGCAATGCAGGCAAATACTTGGAGTTGTGGCGAAGAATCCTAGTGCCAGTCGGTAAAAGTACCTTGAATCAAAAATACAATTGGCAAACAAATTTGGTAGTTCTACAATTCGTCGCAGGCTAAAAGAAGCTGATTTTTTTTAAGACATACTTTGTTCGCAAAAACGATTGAGATCACACCAACCAACAAAACAAAACGTCTTCGATTTGCGTTGGAATATGTTAAGAAGCCTCTTGACTTTTGGTTTAATATTTTATGGACTGATGAGTCTGCATTTCAGTATTACCAGGGGTCATACAGCAAAGCATTTGTGCATTTGAAAAATAATCAAAGCATTTGGCAACCCAGCAACCAATAGATTTGGTGGAGCACAGTCATGTTTGGGGATATCTTTTCTAATATGGATTCGGAGACTTGGTACCGATAGAAGGTACTTTAAATCCAGAACGGATACCTTCTTATCTTAAACAACCATGCTTTTACGTCTGGAAATAGACTCCAACTACTGAATGGATTCTTCAGCAGGACAATGCTCCATGCCGCAGGGTAGGATACCAACAAAATTTTTAAACGACCTTAATCTGGCGGTTCTTCGTGGCCCCCCAAAGCCCAGACCTTAATATCATTGAAAACGTTTGGGCTTTATTAAAACCAACGAACTATTGATAAAATAGAAAACGAGGAGGAGCCATCATTGAAATAGCGGAGATTTGGTCCAAATTGACATTAGAATTGCACAAACTTTGGTAAGGTCAATGCAAAAAAGACTTCAAGCAGTTATTGATGCCAAGGTGGTGTTACAAAATATTAGTATTGTATTTATATAAAATAAAGAAATTCTTATGTTGAAATTAGGTGTTAAGAGCAATACGTAACTT
->5e0e2a47-ef68-42c0-be32-6de65b478269
-TTGTTGTACTTCGTTCAGTTACGTACTATTTCCATTGGCTTGAGAGTGGTCCAGCTCTAACCGCCCATTTTTTCAAGGCTATGCCATCTATTTTGTCCCAATCTGGAGCCTTTTTTACTTTTTTTAGCCATTTCTGATGGAAACTTCATTAATACTGATTTTACGGGCGTTAAGCTCATTTGGCGGTGACTCGAAAAAAGTTATCTACTTCCCTTTCTGTTTTGCGGGTTATCAATATCATTTTAGCTGAAATACAGAGTGCAGGTGTTAAGCAAATGCTTTTGGCTTGTTCATCATCAGATCTGCGCCATTCGCCATTGGAGTTTCGGACTACTGTGTTTCTTTTGCAGGTCGCTTGAGATATTTGGTTACTCTCCATAAATTATGTTAGTTACAAGGAATGTGGATCTAGATTTCTAAGATATTCAGCGAGAGATTAATTTCTTAAAGTTGACAGTAGTTTTCTGCGATCAGATGCAGCGGTATACGATCTTTTGTCGGCAGGAGTAGAGGTTTCTTGCACCATCTCTTACGCAAATTTCTCTTGTGTTGTATTTGTTGTCGGATTTCAGCTGAGAGATAGAGGCTGATTTGATTGGTTTCTGGCTGGTAGCTTCGTACATATATAGCTTGCTTTATGGATCTTGTTTATTGGTATCACAGTAGCTCTCTCTCCTGATTTTAGCGAGATATCAGGCTGATAGCTGTTTCCAGATAACTTTTAAATGCATTGATATCTGTATTTGCAATATATGAGCTACTGTATTGCTGTATGTCACTATTATTAGAGAATGATCTGAGCCCAGATCAAAACTTTCCATTATTAGCATGTGAGATTCACCAGGATTCCAAGTATGCTACGAAGTCTTTTAACCCTTTCGCCCAACTTTTTGCAGAATTTTGTTTTATCACCAATGTTTACATTTATTTTTTTAGAAAAAAATTTAGCAAAATTTTGAAACCCATTAGTTTGGGCGGTAGCAAAAGGATTTTTTTTTCTTGTGAGCAACGTCGGGCAGTAGTGATGTGTAAGCATTGTTTTTTATAAATCACAGAATATGAAATATTTTTCTTTATAATGACAATTTAAGTGTGGTATGACAAAAAACAGTTTTTTATTGTTATTGCAGCACAGATGGACTTTGCATGTAAGGCATTTGGTCATCGGTGTTGCAATTTTACACAGTCTGCAACGTCCTCTTTCTCAAAACTACCCAATGTTCAACTTTATCATACATTACGGTACCTGTTGCAAAGATTCCTATTTCCTTCAACGAAATCAGAAGGATTACAGACGTAAACCGAACAACTCAAAATACAGTTTAAAATTTTTTGTCTTTGGGAGAAGACTTTCTGCCAAATATAAGACAACTAAGATGATATTCCCAAGCCATAAGAAGGAGAAGTGCCTTCTCCAACATATAGCGTAAAATCATAAACTAATCCAGATATTCCAGCCCGCGTAAAACATTTTAAGACCCCATTTATGAGGTTTGGATTATATTGCCTAAGCGTGGATCGACCTGCAACAAAAGCAATTATTAAAAATAAAAGCTAATTTAAAAGAAAATTAAAACGTACCTTTGAATGCAATTATTTGCTCATCGACACTTTGATGCTCTTCCTGCGTTAGTTTTTTCAAAATTTTCTTTGAGAGTCTGAGCAAAGGAGCGGATCTTGTAGGATTTATCATAGTTGCAATCCCTTTTTTTAATTGTTTGGCGTTGTCGTTGAAATCTTGCTTATTGTTTATTTTTTAAATCTCCACGCGGCATTGGATCAGTTATTGCGGCCAATCTTTAAATGCTTTGACCACGCCATTCTGGATTGCGGTAGTTTTAAAACGCAAAAGTACAATAAAATGCCAATGTAGCGTTTGATTTCCTCATCAGTACATTTAAGTTCAATACCCGTGCTCCTGCAAACTATATACAGAGGTGGTCAAAAGTATTTTTCACAACGCACAATGTTGCAGCTTCCAACTTCTTTTTTGTTATATTTCTTCTTGTTGTTTATCCGTTTGCCTGAAATAGTTCTTATCGCTTGGCTTGAGTCTATGCAGAGGTAGTCGAAAAGAAATAGAAGATAATAACGGTTCATAGATACCAAAGCTTAAAGCAAAAGAAAATATGCATGCAAGTTGTCAATGAGTATTTTCACATGTTTATTGCGCTTCAAAAAGTATTTTCCTCAGCAATTTAGTAAATTTCAATAACATCTAATTTCAACATAAGAATTTCTTTTATTTTATATAAAATACAATACTAATATTTTGTAACACCACCTTTGGCATCAATAACTTCTTGAAGTCTTTTTTGGTATTGACCTTACCAAAGTTTGTGCAAATTCTAATGTCAATTTGGACCAAATCCGCTATTTCAATGATGGCTCCCTCTCGTTTTCTATTTTTTATCAATGGTTCGTTGGTTTTAATAAAAAACTGACGTTTTCAATGATATTAAAGGTCTGGGCTTTGGGGGGCCACGGAAGAACCGCCAGATTAAGGTCGTTTTAAAAATTTTGTTGGTATCCTACCCTTATGGCATGGACATTGTCCTGCTGAATCCATTCAGTAGTTGGAAAAAGTCTATTTCAGACGTAAAAAGCATGGTTATTTAAGATAGAAGGTATCAGATTTCTGATTTAAAGTACCTTCTATGGGTACCAAGTCTCCGAATCAATAGGAAAAGACATCCCAAAACATGACTGTGCCCCCCCGCCAATCTATTGGTTGGCTGGGCTGCCAAATGCTTTTGATTGTACCAAATGCATAAAGTAGCGCTGTATGACCCCTGGTACTGAAATGCAGACACCATCAGTCCATAAAATATTAAACCAAAGTCAAGAGGCTTCTTAACATATTCAACGCAAATCGAAGACGTTTTGTTTTTGTTGGTTGGTGTGATCTCAATCGTTTTGCGAACAGTATGTCTTAAAATCAGCTTCTTTTGGCACCGCGACGAATTGTAGAACTACTAACTTGTTTTGCCAATTGTATTTTTGATTCTGGCAATTTTACCGGACTGGCACTAGGATTCTTCGCCACAACTCAAGTATTTGCCGTGCTGGTCCAGCACAGGTTTTTTCTGGCCTGATCTTTTTTTATTTTTTTAATGTGCCAACTGTATCAAACTTTTTTATTAAGTGGTGAACAGTTCTACGCGAAATTTGATATATTTCAGCTATTTTGTACAGGTGTACCGGCTTTAAACCTATAACAATACCAGCCCGGGCCTCAACTGTTAACTCTTTTGTTTTGGGCATTTTATTTAATAACTGTAATAGGAAAATGATTAAATCTAGTGCATTTAATAATTTAAATGTATTTAAGCAAAGCGAGCAGCATCACTCTAAACCAATCACTGAAGAAGAAATTGCGTTGTGAAAATAATTGTGATGGAATGAAACCGTGTGCAAATACTTCGACAACTGATAAAGATCTCTTCATTTGCCTCTTCCTTTGCGCATAGGGCAGTTATTTTCAATTCTTCTGTCTGACTCTGCATAGGTTTGAATTTACCAAAAGCAAAAGTTTTTGCGTTTCACTCCCCACTGCTGCACAAAGCATGTTTGAGCCAATGCACAAAAATGCACTTTGTGAAAATAATTTTGACCATGACTGTATATCAGTTTGCCTAGCCATTAAATGGATGGCCTGGTATCAAAAGTGTGTAGAAGAACTCCACGGTCGTCTTTATGTCCCCGACATCAAAGTTTGTCATCTTCCCAAATACTCTCTGGGCTACAAACGGCCTTGTTCTCCGCTTTAGCCTCTTTGGATCAATTTTCTCTAAGCAACTTCTATCAACAACAACGCAAGGTCAGGTTCACATCCTTCAATCACTGTATGTATTTTCCAGAGGTCAATGTCGATACTTTCTCCCCTTTCAAAGAATTCCTTCTAAATTCTTCTCCGGTACCGTAGAAATGTCTTTCATCTCACCACTTTCTTCGTCAGTAGAAATATCCCAATCAGTTTAAATCCCGTTCAATTTCTTCGTTAGACAAACCTTTCACTTTTCGGTGAAAATTATTATCTGAATGCCCAAGGTTGCTCTAAACAGCTTAGAAAATTGTTACTTACTTATTGTTCACTGCTTACTAAGTTTGACTAAATCACTGTCTTGTTAACTCTTTGCTGTTTATACTTTGGGTTCTTTTTTAAAAGTATTATAAAAGTAAATTAATAATTCCAAAGTTGCCGAATATCGAAACAATAATAATAATTATTGTGATGCGCGTGCTATTTATTGCAAATAATTCCCTGCAATTAATCTCCAAATGCGTTTTGCTTTTTTATATTTAGAGTAGACACATAAAGCACCGTTATCATAAAGAATCAGCAGATAAAAACAAAAGGCACACTTACAGTTAGCTCTGAAAACATAGAAATTGCTCTAACAACGTTGGGTGCAGAAAGAGGGTTAAGTTTGGTATCTTTCTACTATCAGTAGGCCAGTATGTAGGCTTGCCGGTTGAAAGTGTTGTTATGCTGTTGTTTACTATGCATTTGTACAGTTCTTCCTTCGGAGCTTAACGTGAAGTCACCTCTACTACGCTTCCATATTCCAAGGTTAGGATTTACTTGCATAATTTGTTTACAAGTAACATTATCATGTTAAGTAAATTATTTGTAAGTTCAGACTGTTTTTCTAATAGTTTGCTCTCTATTCTCTCAGTGATAATGATGTTTGTTTGCTATTTCCTGCAGCAATTTGGGCATAAGATTGATAATCGTTACTTTGTTGGGTATATGTTGGCTTGTTAGGCGGAACAAACTTTGTACGGATTCCTAAATCATTTTTTACTCAGATCATTATTTCTATTTTCTATTTTTTTTTGGACAAGGTTCTGATAAATTCTACACCCTTTGTAGCTGGCGGCGTGTTCTTCGTAGCAGTTGGCACATTTTGCTGGTTGTTCTGTATTTTTCGGGCAAATGTTGTAAGGTCGAGAAGAGGATTTTACACAGCGGTACGTTTTGAATTACAATATGATTTAGTATGTCGAATTCCTGGCAGCTATAGCGTTGAACGATTTCATTGTGGGGAGGCTCAATATTTTTATTTACATTATATATGTCTAGGTTTTGTTGAGCAATGTCCTTAAAATGACGTTTTGGTCGCACGGCTTTAATATTACTTATGTTTCTAACAACATGACCTTTTGACTCTTCATCACTTTTAATTTCATCTAAATTTATTGGAAAAATGCAAATTCTTAATAACAACTCTAAATGCTCTGTCATCCTTAAGCTGGTATGTGTGGTACTGCACACAATCATTATTAAGTGTTTTTGACTAATTTTCAGAATTCTTCAATACTTTTAACCATTACTCTTACATGTCCCTTAACGTTGAGTCTTATAATAAAAAGTTCTCTCTTAATTTTTAGTTTTAAGATAGGTTAGCTTTTCCTTATACCATTGACGTCAGAGAAAGATAGATTATGGGGCTTAGCAAAATCAGTTGCACTGTCTTCATTTACCATTTCGAGATCTTCGTTTTGTTATATTTGTTTCCTGTTTTGTCGGGCAATCCGTCGCTTAAGAGAGCGAAATTATTTGCGCTGGTGCTTGATGAATTGTCAGGGAATCTGTTTTCTTTGAACTTCGGGAGGGGCTTGGTCTCTTTTTTTTGGATTTTATTTTACTCTCTGCCATTTCAAAACCCAGTTAGGTCTTCGTCGGTGTCGCTCTGCTTGAGTATTAAGAAGACAATGATTGTTGAGTGCTTGTGTCCGCACTTCGTGCCTCAAGATATGACCAAAGCAAAGACACTAGAATAATTCTAATTTATTATGACGTTGCAATAAACAGTTAACATTTTTTTATTTTATAAATTTTTATTTCTACTTCGTATTATTTTTATGAAATATTTTTTCTCAGTGTAATGACTTCTTTTTTCAGTTTTTTTATATTCCAATTTGATATCTTAAACAGCGCGCAATTTCATCATATTCTACGAAATTGGCCAAAACTCCCCAAATATGTATGTACATATGTAAATTCGTTACTGCGATCAGAATTGATTTCGGCCCGAAAATCGCCAACTTCTAGCTGCTACGCACACATATACGCGTTCTCTCGTCTTTTGTTTTTACTCACACAAACAAGCAAATTCTATTTTGGATTTCTTACGCTCAGCGTGAGCGAGCGAAGAGAGCAATTTTGGCCGTCACCAAAAAAAGTGGCATGGTGCCAAACCAGTGTATGAAACATTTACGCATCTTATTATTCTAGTGTGTCTTTGATGCAGGCCATGTGACTTTTGTAAATATTGTACATACTTTCCAACACGCCACCTCAAAAGTAAGATTGCTGTACTTTTATTACTCACGAACTGTGCACGTCCTTCTGACAGATAATTTTGATCAGCATTCGTTTGCGAGGTGTTGGGGAAATTAGAAAACCAACCAGATCAATTGAACATATTATTTACATAAATTCAGTTTTGCAAACTATTTTAACTAAAATTAATATTAGTCATCTTTGCTTAAGAAACTCAAAATTATCAGTAAACTTAATTAAATTTGGTTAAATGATAGTTAGTTTTAGTTAGTTCAGTCTGGTTCCTCGTCAGTTCAATCTAAGAATATAATGTTTTAATTCATTCTGAGAGTCAAAGTCCACTTCTCAATGTAATGAATCTTGCAGATGGTACCAGCAAGTTGTAAATTTGTAGATATATACAGTTTGTCAAGAAACTATTTACGCCGTGAAATAAGTTGAATTTTTCACTTTAAAGGTCAAAATTAAGGGTTATTTCTTTAATTAAACCTGTTACAATGAAATATAATTAAACAATATTTATTTTACTTATAAAATTAAAAACAAATTCAAAATATCAAATATACAAGAGATTAAACAACAAATTCAAGTTTACACACTTTTTTTTTGAGTGGCAAGAAACTCCTTACATTTTGTTTTTCCTACTTTGTTTTGCTCTTTTCTTAGAACGAACTCGATTTTCCGTTATTTTTTGGCATTTGCATTCAACACAACGCTTCTATTGAAATTTTTTTTTTTACTTTGCTTGTGAGAATTTTGCTGATCGAATGAGTTATTAAATTTAATAAAATGCCTGGAAATAGATTAGCTTTTGAAGTGACCCAAATAATATACTAAAACCACCGGTTAGGGAAAATCTATTCCAGAATTAGTATAAATGTTTTCTGTATCCCGTAAGACCGTCTACAATGTTTTTTAATCGCTTGAAAAAAAGAGAACAGGCTTGAACCTAAAGAGTGGTGAACAAAACTAAAATTAGCAAGCGTGTAGACCGCCTTATTATGAAAGTGATTGCGAACCCCCAGATCTCCGGTCAGATCACTTGCTCAGGATATCAGGCAGAATGTTGACCTAGTTGTGCCACACAAAACTGTGCGCCAGATCATTCTACGCCATGGAATTTTACTCTTCAAGAGTTACCCAGAAAAGCCTTTGCTATCAGAGGTCAATATAGAAAAGCGTCATTCATTCGCTTTTAATGAGCATGATGGATCATGCGGAAGAGTACTGGGATGACGTAATATTTTGTGACGAAACAAAATGATGCTCTATTGCAACGATGGGCCAAGCCAGAGTATGGCGCAAGCTGTTGAGTGCGCTAGAAAACAAAATATCATTCCAACAATCAAATTTGGAAAATTATCAGTGATGATTTGGGGGCTGTATCTCAAGCCGTAGGTGGGCAAATTAGCCTTTATTGGAAAGCACTATGAATGCCGTGCAATATCTAGATATTTTAAAATCAAATTTGAAGGCCAGTGCAGAAAAAATTTGGTCTATTTGGGACAACAAAGCCAAATTTTAGTTTTATCAGGACAATGATCCCAAACATAAAAGAGTGCAATGTACGCAACTGGCTCCTTTATAACTGTGGCAAGTGATCGATACGCCCCCTCAGAGTCTTGATCTGAACCCCATTGAAAATTTGGCAAGGCCCCTACTTAAAGAAAGATGTGGCAAAAGGGCACCCAAAGAAGCACGACAACAGCTCATGGCTGCGATAGAGTGGGAAAAGATCCCGCTTGAATATGACCTAAAAAAGCTCATCCATTCCATGAAAAAAAAAGCTTCAACTTGTAGCCAAAGCCAATGGGGGTCATACTAAATGCTATAGCTTTTTCAAATTTTTAACAAAATAATTTAAAATTTAGGATTAAACTTAGGTTTAGTGTTTTGTGTAAAGAGTTTCTTGAAACTCTCAAAGTGTTTAAACTTGGAATTCGTTGTTGTTTATTTTCTTGTATATTTGATATTTTTTGAATTTGTTTTTTTAATTTATAAGTAAAATAAATATTGTTTGATATATTTCCTAAAAAAAAAGTGCGTTTAATTAAGCAAATAACCCTTAATTTTGACCGTTAAAATCAAAATTCGTATTTCACGGTGTGTAAGCAGTTTCTTGACAAACTGTACTTGTCGCAGATTTATTTTTAATTTCAAGTTAACGTTTCTGTTACTTTGTGTCCGCTGTAGAGAGTGATGCCGAGTATAAAGTGATTCAGATCCGACATCAGAAGTGGGACCGCCTACTCCAACTTCCTGTAGTTTCATTGTGTCATAGATCATTTGTGTTTAGCTGTTCTTTATTTGATCAATTTGAGGAACAGGAAGGTCCCTCCATTCGAAATTAATTCGTCAATCCTCTTATGATCTACATACAAAGGTTTCTTAGCCTAAGTCGAAGACAGCGCTGCCAAGCAGCCTTACAGCGCAGCAACGCTGCTATGCGTATCTTATATATATGTATATATATGTACTGTCGCCGAGCGATGGTGCTGGAGGAGGAGTGGTATAGGCACACATATAAGCGATCAGCGCTTGGCCAGCAGGAGAACTGCTGACCAGGCAATTATGTATGTTAGCCCTCAAGTGGGTGCTCGTATTACGTATACACTTGTGCTGGACTGTTATGTACATTGCAACAGAGTGCTACAATTATGAATACACATAGGTACAGTGCTTAACCGATATGTGTGCATACTACAATAGGTAGAAAACAGATA
->b053d6c1-d220-4a4b-aa6b-d2481eede066
-TTATTGTGTACTTCGTTCAGTTACGTATTGCTACACATATCGGTTAACTGTACCTATGTTATTCATAATTAGCAGCACTCTGTTGCAATGTGTATAAACAGTCCAGCACAAGTGTATGCGTAATACGAGCACCACTTGAGGGGCTAACATACACATAATTGCCTGGTCAGCAGTTCTCCGCTGGCCAAGCGCTGATCGCTGCTGTATTGTTACTATACCACTCCTCCTCCAGCACCATCGCTCGGCATTGATACATATATATATACATATATAAGATACGCATATAAGCGTTGCTGCGCTGCGATATGCCGGCAGCGCTGCTCTATAGGCTAAGAAACCTTTGTATGTGAATCATAAGAGGATTGACGAATTAATTTCGGAAGGAGCGGGACCTTCCCTGTTCCTCAAATTGGATCAAGCGAAACAGCTAAAACACAAATGATCTATGACACAATGAAACTACAGGAAGTTGGAGTAGGCGGTCCCACTTCTGATGTCAATCTGAATCACTTTATACTCGGCATCACTCTCTACAGCGGACACAAAGTAACGAAAACGGTCGTTAGCGAAATTAAAATAAATCTGCGACAGTACAGTTTGTCGAAACTGTTTGCAAATGAGAAATAAGATGAATTTTGATTTTAACGGTCAAAAGAATTAAGTTATTTGTAATTAAACGCAATTTTTTTTTAGGAAGTATAATTAAACAATATTTATTTTACTTATAAATTAAAAAACAAATTCAAAATATCAAATATACAAAATAAACAACGAATTCAAGTTTAAACACTTTTGAGAGTTTCAAGAAACTCTTTACACAAGAAACATAAACCTAAGTTTAATCTAAATTTTTAAATTATTTTGTTAAAATTGAAAAGTTGTAGTATTTAATTATGACCCCCATTGGCTTTTGGCTACAAGTTGAAGCTTTTTTTCATGGAATGGATGAGTTTTTTTTTAGACATATTCAAGCGGAGTTTCCACTCTATCGCAGCCATGAGCTGTTGTCGTGTTTTGGTGCCTTTTGCCGCATTCTTCTTTAAGTAGGCCCTAAATTTTCAATGGGGTTCAGATCAAGACGGGGCGTATCGATCACCTTGCCACAGTTATAAGGCCAGTTGCGTACATTACTCTTTATGTTTGGGATCATTGTCCTGATAAAACTTAAGAATTTGGCTTGTTGTTGCTAAATAGACCAAATTTTCTGCACTGGCCTTCAAATTTGATTTTTTAAAATATCTAGATATTGCACGGCATTCATAGTGCTTTCAATAAAGGCTAATTTGCCCTCCATGAAGCGAGATACAGCCCCAAATCATCACTGATAATTTTTCCAAATTTGATTGTTGGAATGATATTTTTGTTTTTTCTAGCGCACTCAACAGCTTGCGCCATACTCTGCTGGCCATCGTTATAATAGAGCATCATTTTGTTTCGTCACAATATTACGTCATCCCAGTACTCTTCCGCATGATCCATCATGCTCACAGCGAATGACGCTTTTCTATATTCTCTGATATGAAGGCTTTTTTTCTTTTAACTCTTGAAAGAGTACCTATGGCGTAGAATGACTTGGCGCACAGTTTGTACCTTTAACTAGGTCACATTCTTGCCTGATATCCTGAGCAAGTGATCTGACCGAGATTCGGGGTTCGCAATCACTTTTCGCATAATAAGGCGGTCTACGCTTGCTAATTTAGTTTTGCGCCCACCACTCTTGGTTCAAACCTGTTCTCTTTTCAAGCGATTAAAAACATTGTGAACTTGATCTTACGGGATACAGAAAACATTTATCTAATTCTGGAATAGATTTTTCCCCAACTGGTGGTTTTGAGTATATTATTTGGGTCGCTAAAACAATAATCTATTTCCAGGCATTTTATTAAATTTAATAACTCATTCGATCAGCAAAATTTCACAAACGAGTAAAAAACCAATAGAAGCGTTGTAAAAGGAATGCAAATGCCAAAATAACGGAAAAATCGAGTTCGTTCTAAGAAAAAACAAAGTAAAGTAGGAAAATATTGTGGGGAGTTCTTGCCTCTCAAAGTGTGTAAACTTGGAATTTGTTGTTTAATTTCTTGTATATTTGATATTTTAGTTGTTTTAATTTATAAGTAAAATAAATATTGTTTAATTATATTTCATTAAAATTGCGTTTAATTAAAGAAATAACCCTTAATTTTTTGACCTTTAAAGTGAAAAATTCAACTTATTCTGACGTGTAAATAGTTTCTTGACAAACTGTATATATCTACAAATTTTACAACTTGCCGGTACCATCTGCAAGATTCATTACATTGATGGACTTTGATCTCAGAATGAATTAAAACATTATATTCTTAGATTGAACTGACGAGGAACCAGACTGAACTAACTAAACTAACTATCATTTAACTAAATTTAATTAAGTTTACGCACTGACGGTAATTTTGAGTTTTCTTACAAAGATGACTAATATTAATTTTTTAGTTAAAATAGTTTGCAAACTGAATTATGTAAATAATATGTTCAATTGATCTGGTTGGGTTTCTGGGTCTCCCCAACACCTCGCAACGAATGCTGGATCAAAGGTATTCGTCAGAAGGACGTGCACAGTCTCGTGAGTAATAAAAGTACATATCTTACTTTTGAGGGTGGCGTGTTGAAGAAGTGTATGTACGACAGCAAAGATCACATGGCCTGCATCAAAGACACTAAGAATAATAAGATGCGTAACAGCCATACTGCTGGTTTGGCACTATGCAGCCACTTTTTTGGTGACGGCCAAAATTGCTCTTTCCGCTCGCTCACGCTGAGCGTAAGAAATCTAAAATAGAATTTGCTTGCTTGTGTGAGAGTAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGACGAGAACGGATATATTGTGCGTGTTGTGCTAGAAAGGCGATTTTCGGGCCGAAATCAATTCTGATCGCAGTAACGGGTACATATGTACATACACATATTTGGGAGTTTTGGCCAATTTCGTAGAATATGATGAAATTGCGCTGTTTAGATATCAAGTGGAATATAAAAAAAACTGAAAAGAAGTCATTACACTGAAAAAATATTTCATAAAAATAATACGAAGTAGAAAATAAAAATTTATAAAATAAAAAAATGTTAACTGTTTATTGCAAACGTCATATCAAATTAGATTATTCTAGTGTCTTTGCTTTGGGTCATATCTTGGTACGAAGTGCGGACCTGAACTCTAACAATCATTGTCTTCTTAATACTCGAAGCAGAGCGACACCGACTGAACCTAACTGCTTTGAAATGGCAGAGAGTAAAATAAAATCAAAAGAGACCAGCCCCTCCAGTTCAAGAAAACAGGATTCCCTGGACAATTCATCAACACCAGCGCAAATAATTTCGCTCTCTGTAAGCGACGGATTGCCCGACAAAACAGGAAACAAATATAGCAAAAACGAAGATCTCAGGAAATGGTAAATGAGCAGTGCAACTGATTTTGCTAAATTACCTATCTTTCTCTGACGTCCAATGGTATAAGTGAAAAGCTAACCTATCTTAAAACTAAAATTAAGAGAACTTTTATTACAAGACTCAACGTTATGGACATGTAAAGTATTAATGGTTAAAAGTATTGAAGAATTCTGAAAATTAGTCAAAACACTTAATAATGATTGTGTGCAGTACCACACATACCAGCTAAGGACAGAGCATTTAGAGTTGTTATTAAGAATTTGCATTTTCACAAATTTAGATGAAATTAAAAGTGATGAAGGATCCAAGGTCATGTTGTTGTTAGAAACATAAGTAATATTAAAAAAGCCGTGCGACAAAACGTCACTGAACATGTTTTATGAATGTTGAGCCTAACAAAAAACCTAGACATATATAATGTAAATAAAATGTTGAGCCTCCCACAATGAAATCGTTCAATGCTATGGCACAGAGATTCGGACATACTAAATCATATTGTACCAAAACATTACCGCTGTGTAAAATCCTCTTCTCGACACCCAAGCAACATTTGCCCGAAAAATACCAGAACAACCAGCAAAATGGTAACGCTGCTACGAAGAACACGCCGCCAGCACAAGGGTGTAGAATCCCAGGAACTCTTGTCCAAAAAAAATGAAAATAGAAATAATGATCGCCAATTATGATTTAGGAATCCAGCAAAGTTTGTTCCGCCTAACAAACAATATACCCATAAGTAACGTTAGCTAATCAATCTTATGCCCAAATTGCTGCAGGAAATAGCAAAACAAACACATCACTGGAAGGGAATAGAGCAACTATTAGGAAAACAGTCTGAACTTACAAATAATTTACTTAACATGATAATGTTACCTTGAAATTAATGCAAGTAAATCTAACTAGCAGATATGGAGGCGTGGTAGGGTGACTATTCTTCCGAAGGGAAGCGAACTGTATACAAATGCATAGTAAACAACAGCATAACAACACTTTCAACCGGCAAACCCATACTGTACACGATGAGTAGAAAGATGCAAACTTAACCCTTTCGCACCAACACGTTGCTTGTGAGCAATTTCTATGTTTTCAGAGCTAACTGTAAGTGTGCCTTTTGTTTTATCTGCTAGCGTTCTTTATGATGATTGCTTATGTGTCTACTCTAAATATAAAAGCAAAAAACGCATTTGGAGATTAATTGCAAATTGTTGCAATAAATAGCACGCGCATCACAATAA