diff glimmer_long_orfs.xml @ 0:a4136c1534be draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/glimmer_long_orfs.xml	Tue Nov 28 10:11:42 2017 -0500
@@ -0,0 +1,119 @@
+<tool id="glimmer_long_orfs" name="Glimmer long ORFs" version="@WRAPPER_VERSION@">
+    <description>identify long, non-overlapping ORFs</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements"/>
+    <command><![CDATA[
+        long-orfs
+            -n -t
+            $cutoff
+            '$inputfile'
+            '$output'
+            2>&1
+    ]]></command>
+    <inputs>
+        <param name="inputfile" type="data" format="fasta" label="Genome Sequence" help="Dataset missing? See TIP below"/>
+        <param name='cutoff' type='float' label='cutoff' value='1.5'/>
+    </inputs>
+    <outputs>
+        <data format="tabular" name="output" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="inputfile" value='streptomyces_Tu6071_genomic.fasta'/>
+            <param name='cutoff' value='1.5'/>
+            <output name="output" file='longORFSTestOutput.dat'/>
+        </test>
+    </tests>
+    <help><![CDATA[
+
+**What it does**
+
+    This program identifies long, non-overlapping open reading frames (orfs) in a DNA sequence file.
+    These orfs are very likely to contain genes, and can be used as a set of training sequences
+    More specifically, among all orfs longer than a minimum length , those that do not overlap any others are output. The start codon used for
+    each orf is the first possible one. The program, by default, automatically determines the
+    value that maximizes the number of orfs that are output. With the -t option, the initial
+    set of candidate orfs also can be filtered using entropy distance, which generally produces
+    a larger, more accurate training set, particularly for high-GC-content genomes.
+
+
+
+-----
+
+**Glimmer Overview**
+
+::
+
+**************		**************		**************		**************
+*            *		*	     *		*            *		*            *
+* long-orfs  *  ===>	*   Extract  *	===>	* build-icm  *  ===>	*  glimmer3  *
+*            *		*	     *		*	     *  	*	     *
+**************		**************		**************		**************
+
+-----
+
+**Example**
+
+
+* input::
+
+	-Genome Sequence
+
+	CELF22B7  C.aenorhabditis elegans (Bristol N2) cosmid F22B7
+	GATCCTTGTAGATTTTGAATTTGAAGTTTTTTCTCATTCCAAAACTCTGT
+	GATCTGAAATAAAATGTCTCAAAAAAATAGAAGAAAACATTGCTTTATAT
+	TTATCAGTTATGGTTTTCAAAATTTTCTGACATACCGTTTTGCTTCTTTT
+	TTTCTCATCTTCTTCAAATATCAATTGTGATAATCTGACTCCTAACAATC
+	GAATTTCTTTTCCTTTTTCTTTTTCCAACAACTCCAGTGAGAACTTTTGA
+	ATATCTTCAAGTGACTTCACCACATCAGAAGGTGTCAACGATCTTGTGAG
+	AACATCGAATGAAGATAATTTTAATTTTAGAGTTACAGTTTTTCCTCCGA
+	CAATTCCTGATTTACGAACATCTTCTTCAAGCATTCTACAGATTTCTTGA
+	TGCTCTTCTAGGAGGATGTTGAAATCCGAAGTTGGAGAAAAAGTTCTCTC
+	AACTGAAATGCTTTTTCTTCGTGGATCCGATTCAGATGGACGACCTGGCA
+	GTCCGAGAGCCGTTCGAAGGAAAGATTCTTGTGAGAGAGGCGTGAAACAC
+	AAAGGGTATAGGTTCTTCTTCAGATTCATATCACCAACAGTTTGAATATC
+	CATTGCTTTCAGTTGAGCTTCGCATACACGACCAATTCCTCCAACCTAAA
+	AAATTATCTAGGTAAAACTAGAAGGTTATGCTTTAATAGTCTCACCTTAC
+	GAATCGGTAAATCCTTCAAAAACTCCATAATCGCGTTTTTATCATTTTCT
+	.....
+
+	- Cutoff 1.5
+
+* output::
+
+	Sequence file = /home/mohammed/galaxy-central/database/files/000/dataset_34.dat
+	Excluded regions file = none
+	Circular genome = true
+	Initial minimum gene length = 90 bp
+	Determine optimal min gene length to maximize number of genes
+	Maximum overlap bases = 30
+	Start codons = atg,gtg,ttg
+	Stop codons = taa,tag,tga
+	Sequence length = 40222
+	Final minimum gene length = 97
+
+	Putative Genes:
+	00001   40137      52  +2   0.892
+	00002    1319    1095  -3   0.654
+	00003    1555    1391  -2   0.793
+	00004    1953    2066  +3   1.078
+	00005    2045    2146  +2   0.919
+	00006    4463    4759  +2   0.985
+	00007    6785    6582  -3   1.033
+	00008    6862    7020  +1   0.915
+	00009    7300    7488  +1   0.900
+	00010    7463    7570  +2   0.912
+	00011    8399    8527  +2   1.044
+	00012   10652   10545  -3   0.895
+	00013   12170   12066  -3   1.108
+	00014   13891   13748  -2   0.998
+	00015   14157   14044  -1   1.026
+	00016   15285   15410  +3   0.928
+	00017   15829   15704  -2   0.949
+
+	....
+    ]]></help>
+    <expand macro="citation" />
+</tool>