view test-data/glimmer_w_icm_trans-table-11_genomic.fasta @ 0:a4136c1534be draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
author bgruening
date Tue, 28 Nov 2017 10:11:42 -0500
parents
children
line wrap: on
line source

>orf00001 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGGCGAATGATCCGGCGGGCGAGTACGGGGCGTGGATTCACGAACTCGGTTTGTCCGAG
GCAATCGCGCGAAAAATCGTCGCGCCTTTTGAGATTGACGTTTTGGAGATTACTGATCCT
GAGCCGGAATTGATGGAGGGATTGGATCGGGAGGCGCGGCGTGGGCGGCGGCTTGCGTTG
CTTCAGACCGGGCTTTTGGAGCACGCGGCCGAGCATAATATTTGCACCATGATGACGCTT
CATCAGCAGGTTGAGGAGGCGGCGGCTTTCGCGGAGAAAATGCCGGAGACGGCGGCGGAG
CTTTACCGGAATGAGGTGTCGGCGGAGGATTTTGCCCTGGCCGAGGAGCTCCCGGCCTCC
GAGGTGGGTGGGGGGTTCTACGAGCTGGAGCCGGGGCGTCATGTGCCGCCGTCGCGGGTG
TGGTCGCGGTGGCTGTATGGGGAGCATCCTGTGGCCGAACGGCGTTCTGTGCTGCGGGAG
TTCGCGAACGGGATGGACGCGGAGGGGCGGCGGGTGCACCGGGCGTTCCTCGCTTCCGTA
CGGGTCCTGGGTGAGGGCGTCGACATCGTCGGGGAGCGCGGGGTCGAGGCGATCTGCTTT
GCCGACGCACGCGGGTCTCAGGTGGAGATCGTGCAGAACATCGGGCGCGCGTTGCGCCAG
AACCCGGATGGGCGGGCGAAGACGGCGCGGATCATCGTGCCGGTCTTCCTGCGGCCGGAC
GAGGACGGGGAGGGCATGGTGGCGTCGGAGGCGTACCGGCCGCTCGTCGCCGTACTCCAG
GGCCTGCGCTCGCACGACGAGCACCTGGTCGAGAAACTCATGCTGCGGGCGCGCGTACGG
GCCGAGAGCGCGAGCGCGCGCAGCGCGGAGGAGGGCGGTGCGGGGCCCTCGCGGCTCCTG
TCGGACTCCGGGACGGCGGCTGCGGCCTCCGAGGGCGTCGAGGGCCAGGAGCAGGGCGAG
GACGGCGCCGAGGCGGAGTCGGTGCTGCTGCGGTTCTCCTCGCCGCGCGCGGCGTCGACG
GTCGCGGCGTTCCTGCGGACGCGGGTGTACCAGCCCGAGTCGCTGGTGTGGCTGGAGGGG
TACGAGGCCCTGCGCGCCTGGCGGGCCGAGCAAGGGGTGAGCGGGGTGTGCGCGGTCCCG
TACGACGCCGAGGTCGCCGCGGGGGCCTCGCGGCGGTACCCGGTCGGGCGGTGGACCGCC
GCGCAACGCCGCGCCCGCCGCGAGGGCACCCTCAGCGCACACCGCGTCGAGCTCCTCGAC
GCGGAGGGCATGGTGTGGGAGCCGCGCGAGGAGGAATGGGAGCGCACGCTCGCGGGGCTT
CGCTCCTACCGGACGGCGTACGGGCACCTCGCCCCCCACAGGCGCGAAACCTGGGGCGAA
GACGAGGGTGAGGACGTCGTACGCGTCGGGGACCTGATGGCGAACCTCCGCCGCAAGGAC
GGACTCGGGAAGGACGCGAAGCGGGCCGCCGCGCGCGCCGCGCAGCTGAGGGCCGTCGAT
GCGGACTGGGACTGCCCGTGGCCGCTGGACTGGCAGCGCTGCTGCCGGAAACTCGTGCTC
CTGGCCGCGGACGAGCCCGGCGGGCGCCTGCCGGAGATCGCGCCCGGGGTCTGCCTGGAC
GGGGATGACCTCGGGGTGTGGGTCGCGCGGCAGCAGGAGCCGCGGGTGTGGGCGCGGCTC
AGCACCGAGCAGCGGGCGCGGCTCGAAGCGCTCGGGCTGCGGCCCACCGAAGCGGCCCCG
GGGCGGGGTGTGGAGGGCACGGGGGCGGCGGGGAGCATGAAGCGGACGGCGACGGCGCGA
ACGGCTTTTCAGCGGGGTGTGGCGGCGCTCGCGCAGTGGGTCGAGCGGGAAGGCGCGGGG
AAACCCGTACCCCGCAAACACGTCGAGACCGTCAGCGTCGACGGCGAGGACGTCGACGTA
CGCCTCGGCGTATGGATCTCGAACACCAAGAGCCGGTACGACGGGCTGAGCGAGGACGAA
CGCGCGCAGCTCACCGCACTCGGAATGCCCTGGGCAGGATGA
>orf00002 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGAATCCACGCCCCGTACTCGCCCGCCGGATCATTCGCCATCGTCACGAGTGCCGGCGC
CTCCCCGCGTCCCTCCTCGCCCTCGTGCCTGGCGGGACGGGCCGGGGCCAGGACGCGCGG
GGTCGCGGTGAGGTACAGCCGGTGCGCCGCCGGAAAACGGGCGTTGTCGTGGATCGCCGC
CCACGCCTTCTCCGCGCTGCCCGCCGTGCGGTGCGCCTCGTCCACGACCGCAAGGTCGAA
GCCATCCATCCGCTGCCCGTACAAGCCAGCCCCGGCGAGAGCGGCCTCCAAGGGTCCGCC
CTGCCCGTCCTCGCCCACGAGCGAGGAGTACGTCGCCAGCACGACCACCGGCCCCGATCC
GGCCCAAAGCGCGAGCCGGATCGGGTGGGTCGTCGTCCGCACCCGCAGCTCCTCCAGGAG
CAGATCCCTGGGCAGCGAGCACACCCCGACCATCGGCGCCGTGTGCCCCACCGCCCGCCA
CGACTGCGCCGTCTGCACCAGCAGATCCAGCGTCGGCACCATCACGAGAACCCGCCCCGA
AGGGAACAACTCCAACGCCGCAGCAGCCGCGCTGATCGTCTTTCCCGTACCCGTAGCGGA
CACCACCGTGGCCCGCGCCCCACGCTCCGTGCGGGCGCTTTCCCGGGCGGCTACCCGGAC
CCATTTCCTGAGGTCCGACATAAGCTCTACCTGATGTTTCCGCAGCGGAACCCGGGAAAC
AGACATTTGAATCTCCTCACGAGGCAGACGAGCCAAATCCCCAACTCAACATATGCATCA
ATTGGGCTGCGTTGA
>orf00003 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCCTTCACGGCGCATTCTTCGACAGTCCGGTGAGGAATCTCCACGGCGTCCAGGTCAC
CAACAGGGGCTGGATGAGCATCTTCGTCAGCAGTATCTCCTACACCGCGACAGTCAAAGC
GTCAAGCGGTAG
>orf00006 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGCGCCGTCAGCCTATGGCGGGCCACATGCTGCGGCGGGTGCCGAGCCCGCCCTTACC
GTCTCCGGGGTAGAGGTAGAGGTGGTCGACGCTGTTGAGAACAACGATGTCGGCGTTGCC
GTCACCGTTGAAATCGCCGCTCAGCAGGGCGTGGAAGCCGCCCCAGCTCGCGTCGTCCCA
CATCAGTTTGGCGTTGGCGAATGTACCGTCCGTCTTCCCCGGGTAGAGGGCCAGTTCGCC
CTTCTGGGAGATCGCGGCGATGTCGTTGAGGCCGTCCCCGTTGAAGTCGGCGCTGGTGAG
GAACTTCTTGTCCCAGGTGGCGTCGTGCCACACCTCGGTGCGACTGTCGGTGAGGATGCC
GTTGGCCCCGGTCGCGTACGCGTAGAGGCGGCCGGTGGGCGCGATGGCAACGAGGCCGTC
GCGCGTCCAGCCCTTGGCACGGTACGTCGTCGGCAGGTAGCTCGCGAAGGTCTTGTCCTT
CCACATGCTTGCCGCCGGGCTGAGCAGGTCGCCGCTGGTTCCGGCGTAGTTGTGGAAGGC
GCCGTCGTCCTTGAGAGCCGCGATGTCGGCGTTGCCGTCGCCGTTGAAGTCGCCGCCCAG
GATGCGGGCCTTGGAACCCCAGGTGCCGTCGTGCGCCCACAGCTCGCGGCCATAGGTGAG
CTTGCCGTCACTCGTGCCGTAGAAGGCGTACAAGTTGTTGTCGTCGAGGATCGCCGCGAT
GTCGGGGTGCCCGTCGCGGTTGAAGTCGCCGGTGGTGAGGTGCTTGATCTGCTCCGGGGC
GCGAGCGGCGAGCCTGTTCTTCGCGATCCAGTCGCCGAGATCGTCGACGCGCGAGGAGAT
TCCGTCGGAGCGGGTCTCCGTCGCCTCGATACCGAAGCACCCTCCCTGGTAGGAACGGGA
GTTGATGCCGACGAGTTCGGCGTTGCCGCCACTCTCGCGCAGCAGCGGGCCGCCGGTGTC
CCCCGCACACAGGGCCTGTCCGTCCTGCCCGTGGAAGCTGATGTCCTGGCTCTGGACGGC
GTCGATGCCGAGGGTGGCGGTGTGCAGGCGCAGCGGGGCCCACTCGGTCTTCGTACGGCC
GAATCCGGCGGCGGTCAGGGCCTCGCCGGCGCTCGGCTGCTGAGTACCGACGGTGACGGG
AGCCACCCCGGCGACGGGCTTGTCGAGCCGGGCGAGCGTCACGTCGCGGTCGGTGCGCGG
AACGAGCTGGACGACCTCGCGGACCTCGCCGGTCCCTGTGGTGAGGTCGGTACGGCCGAC
AGTGGCGGTCGTGCGGAGCGCGGGCGCTCCTGCGGGGATGTCGATGCTCGTGGCCGGGTT
GTCGGCGAAGCAGCTTCGCGCGGTAAGGACCCATTGGGCGTCGACCAGAACCCCGGAACA
GCCCCGGGTGCCCTTCCCGATGTCGAGGCGGACGGTGAAGGACCGTGCACCGTCCCGGAC
CTCCGCGCCGGTGGTGGCACTCGCCGGAACGGCGGCCACGAGCGGCATCATGACGGACGC
GGCCGCTATAGCGACTACCCGCTTTTTCTTGAAGCCCTTGTTCATGTACTACTTCCTCCT
CAACGTCACTTGGTGGTGGATATCTCGACAAGTGCGTAG
>orf00007 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCACGCGGAGTTGGAGGCCGAGGGCAAGTCAGTGGAAGTGGACGTGAAGAAGGACGAG
TTCAAGGGAGTGGGCGAGGGAGTCGGCGACGCCCCCACGGTTCTCCTCGAACTCCGCGTC
ACCGGCTGA
>orf00008 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGACGCCGGGGCCCGCACCGTTCATCAACTGGGTGATGCGCACGCGGAGGTCATTGGAG
ACCGCCTGGAACTGTCCCGTCCTCAGGAACTCCTGGATCGGGGCGTCGCCTTCCTCCACG
ACAGCGGCGGCGGCTGTCCGCACGTCCGCCGACGTCGAGTCGGTGGCGAGCGTCTCGGCA
CGCGCGCGCCGATCGAGAGCGGCGGCCTCCTCGCGGCCCTCGGCCACGTACCGCACGACG
TCGTCGGCGGAGCCCGCGAGGGCGACCTCGGCGGCGCTGACGCTCCACGGGCCTCGTGTC
TTGACGGTGTTGAGCGCGACCTTGCGTGCCTTGGGCGCGAGGGCGTCGGTGTTCTCGCCG
GACGCGGAGATCTCCTCGGCCAGCTCCGTTGCCTCGGAGTCGAGCGCGGCGGCGGCGTCG
GCCTGCTTCTTGCCCTCGGCGATGCGCTCGTCGTCCTGGTCCCGCAGCGAACGCGCTTGC
TCGACGGCTCCGGCCGTGCGGGAGGCCAGCTCCTCGGCCTCGACCTCGCGGGCGAGCGTG
AACGTGTCCTTGGCCTGCTGGACCGCGGCGCTCGCCGCGTCCGCGGCGGTCTTCGCGGCA
GCGGCGTGCTTGGTGGACTCGGCCGCGGCGGTGGCTGCCTCGCCCGCGTGCTCCGCGGCC
TCCTTGGCGGCGGCAGCCGCCTTCTCGGCGTGCTCGGCAGAGGCGTTGGCGGCGTCCCTC
GCCTCACGCGCCGCCTTGGCCGACTTCGCCGCGAGCGAGTCGGCCCGGTTGGCGGCGGCC
GTCGCCTCGGCGGCGTGCCGGTGCGCCTCGGCGGCGGCGGCCCTGGCCCGTGCGGCCTGC
GCGTCGGAGACGCCGGCCTGGCCGCTCGCCTCGGACGCGGCCGACGCCGCGGCGTCGGCG
TTCTGCCCGGCACTGGCGGCTGCCTGGGCGGCGCCGGCCGCCTCGACGACGGCGGTGGCG
GCGAAGTCGGCGGCCTGGGCGGCCTTCTTCGCGCCCTTGGCGGCGTCCAGGGCGTCCTCG
GCCGCGGAGCGGGCGGCGGACGCCTTCCCCGCGTCGGTGGCCGCTGCCGCGGCGGCGTTC
CGGGCCCGAGCGGCGGCGTTGGCCGCGGCGGCTGCCGCGGAGGCTGCCTGGGCGGCGGCG
TTGGCCGCGACGCGGGCGGCCCGGTTGGCGGCGCTGGCGGCGTCGATGGCCACCTGCGCG
GCCCGTGCGGCACCGCGCGCGGCGTCGGCGGCACGACCTGCCGCGTTCGACGCCCTGACG
GCGTCGTCCTTCGCGGCCTCGGTCTCCTTGGCCGCCTTCTGCGCCGCCTCCTTGGCGAGC
TTCGTCGCCTTGATCGCGCGATCCGACGCTTCCTTGGCGCGGTCGGTCTCCACCCGCGCC
TGCCGCCCGGCCTCGGTGGCCTGCGTGGCGAGATCGGCCACCGTGGCCTGCTCCTGGTCG
CGGGCACGGGCAGTGTGCTGCCCGACCTCCAGGAACTCGCGGATGTCGTTGATGTCGCCG
TTGAGCGCGACGCGGGCGGCCTCCTTGGTGGCCTGCCCGCCGGTGCTCATGATCTGGACG
ACCTGCACCCTGGCATCGTTGTCAGCGGCGGTGTACTGCCCCTCGGAGAGGAACTTCCGT
ACCTCCTCCATACCCCCGTTGAGCGCTTTGCGCCCGTCGGCCGCCACCTGCGGTCCGGCC
GCGGAGGAGATGATCTGGGTGACCTGGACGCGCTGGTCCTGTTCCAGAGGCTCCTTCCAG
CCGTCCTTCAGGAAGTCGGCGAGGCCTTCCTCGGGGCCCGCGAGGGCCTCCTCGGCCGCC
TCGCGGACGGCGCGCCCGCCGAGCGAGAGGATCTGGACCGTGGCGACGCGGTCGTCCGCC
GTCCGCGCGAGCGCCTCCTCCCCGTCCAGGAACTTCCGTACGTCGGCGTCCGAGCCGAGC
AGGGCTGCCTCGGCGGCTGCCTTGACGCCCGGCCCGCCCTCCTCCCACGCCGTGAGCACC
TTTCCCCGGTCGGTCGCCGGCAGGTACGCGACCGGCGTGTAG
>orf00009 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCGCATCACCCAGTTGATGAACGGTGCGGGCCCCGGCGTCAAGGAGGCGGGCCAGGCC
GCGCTCAACGACGGTTCCCCCGCGAAACTGCGGGACTTCGTCGACAGCGGCTACTACGTG
CAGCGGGCCAACGACGAACGCGTCCAGGCGACGCAGCTCGTCGGTTCCGGGACACCGGAG
GAGAAGGCCGCCGCGCGCATCGCCCTGGAGGGACCGCCGCAGGTCCTGCACGCCTTCACC
GAGACCGGCCGTTTCAAGGCCAAGCGGCAGGACCTGCTCACCGCGACCCACACGGCGCGA
GTCCAGGGCCTGATAGCCAGCGCCGCCAAGGTGGCGGCCGTCGCCCAGCAGAACGCGGCG
CTCGCCGGTGAGACGGCGGCGAAGGCGCGCAAGGCCGCCGCCGAGGCGAAGAAGTACGCG
GACCAGGCGAAGGCGTCGGCCGAGCAGGCCGCGTCCTACAGCAAGGACGCCGACGCCTCC
GCCGACGCGGCGCAGAAGTCGGCCGACCAGGCGGCGAAGTCGGCGAAGACGGCCCGCGCC
GCCGAGGCCGACGCCCACGCCGCCGCCCGGGACGCGGACCACTCCGTCGCCCGCGCCGAG
GCGTCCGCCGCCTCCGCGCACGGCTCCGCCAACTCCGCCTGGGCCGCCGCCGGTGCGGCA
CGCGCCTCCGCCGAGGCGGCGGGCAAGGACGCCGACGCCGCGGCCGAGGCGATGACCGAG
GCGCTGAACGTCGCCGCCGAGAAGCAGTGGGCGGAAATCCGCAAGGCGCTGGAGGACGAG
CAGGACCGGGCCGACCAGGCGTCCCTCCAGGAGCTGGAGGAGTACTTCGCCGACCTGGCC
AAGCAGCAGGAGAGCGGCGACACCGACTGGTGGGACCTCGCCACCCTGGGGCACACGGTC
CTGGACACGGCCGGGCTGGTGCCCGGTTTCGGGGAGATCGCCGACGGTATCAACTGCGGC
TGGTACGGAGCCGAGGGCGACAGCCTGAACGCGGGCCTCTCCTGCGCGGCGATGATCCCC
TTCGTCGGCTGGGGCGCGACCGGCGGGAAGTGGGGCAAGCGCGGTGTTGACGCGATCGAG
GCGTTCAACAAGGCCATGCGTGCGGAGGGGAAGGTCCCGCACATATGGTCGGCCAATCCT
CGCAAGGGCCGCAACAACGTTCAGAACGCCTACAGCCACTGGAAAGACCACGGCGCCCAG
TTCCCCGAGCTGAACAACGCGCTGGACTACGTCAAGAAAGCGCGGCAGTACGGGGACATG
GCACTGGCGCAAAAGCCGGTGAAGGGCTATCGCGTCTTCTCGCAGAACGGCGGTGCGGTG
GCGATCTTCGACGAGAGCAACGGCGCTTGGGCCGCCTTCACGAAGGACGGGATCCCGCAG
ACCATGTACAAGCCCGAGCCACGCAGCCAGAGCAATCCCAACGGGTACGCGACCACCATC
GAGGACTGGCTCGCCGAGCCCGGCCGCGGCACAGAGATACGCTGA
>orf00014 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGACCGCCACCAGCGGCACCGAAGCCGTCACCGGCCTCTCCCTCCCCGAGGCCCGCCGC
GTCGCCGTCGCCGCCGCCGGCCTCAACCCCCCACTGGCCGAGGCCACCCCCGCCGCCGTC
CTGGACCGGCTCCGCATCGTCCAGCTCGACTCCATCAACGTCCTCGCCCGCGCCCACCAG
CTCACCCTGGCCGCCCGCCTGCCCCACGCCACGTTCGCCGGCATCGACGCCGCCCTCGAC
CAGGCCTCGCCACCGCTCGCCTTCGAATACCCCGCCCACGCCCACGCCCTGGTCCCGCTC
GGCGACTGGCCCCTGTGGGCCTTCCGCCGCCGCGCCTCCCGCGCCCGCCCCGAATACCCC
CCGCCCGCCGAACGCGAACGCATCCTCCACCTCGTCCGCTCCCGCGGCCCGCTCACCCAC
CGCGACCTGCGCCCCGAGGGCGAACAACCCTCCACCGGCTGGAGCTGGGGGCCCGTCAAA
CGCGCGGTGGAGTTCATGCTCTGGGCCGGAGACCTGATCTGCGTACGCCGCACCCCCACC
TGGCAACGCCTCCTCGACCTCCCCGAGCGCCACCTGGCCACCGCACTGCACACCAACCGC
CTCACCGACGAGGAATGCCTCACCGCCCTCCTCACCCACGCCGCCCGCGCCCTCGGCATC
GCCACCACCGCCGACCTCGCCGACTACCTCCGCATCTCCACCCGCACCACCGCCGCTCTC
CTCCCGCACACCCCACTGCTGCCCGCCACCGTCGAAGGATGGACCGAACCGGCCTGGGCC
CACCCCGACGCCCTCACCCCACCCGCCCCGGCAGACGACCCACCCGTCTTCCTCGGCCCC
TTCGACAACCTCATCTTCAACCGCCCCCGCACCCAACGCCTCTTCGGCTTCACCCACACC
CTGGAGGCCTACAAACCCGCCGCGAAGCGCGAGCACGGCTACTACGTCTGCCCCCTCCTC
CACCACGACCAGCTCATCGCCCGCGCAGACCTCACCCGCACCACACACGCCGTCACGATC
ACCCAGACAAGCACCGAAACCAACGCGCCCGGGAACGCCAGCGCTCTTATCCACGAAGCT
CTGCAACACCTCACCCACGCCGCACAGTGA
>orf00016 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGCATCTCGGCGTCGCGGTCCGCCTCCCGCAGCCGTACTTCCTCATGGTCCTGCCCCT
GGACCCGCCCCTGCCCGGCCTCCACGTCCCCGTCGGGATCATCGGCGCGAAGACCGTGAA
CACCATGACGGACATCAGCATCGCCATCCACCCCACCCACCCCGTCGCCGTCCGCCGCGA
GCAGCCCGTCGCGCGCCTCGTGCTGCTGCACCCCGACACCCTCCGCGCCACCAGCACCAC
CACCCCCCTCACCGCCGCGCCCCCCGCACCCGCGTCGAGCCCACCCGACCCCGCCGGGCC
GGCCGCACCGGTCGCTGCGCCCAACACCACGATCCTGGACGCCTCATGACCCCCACTCCC
GCCGCCGCGACCCCCACCCCGCAGGCCCCGAGCGGCTGGCCGGTCCTCGCCCGCCGCCCC
GTCGCGCCGCTCCTCGCGCTCGCGTTCGCGGCCCGGACGACCGCGGCCGTACTTCCCATC
GCGCTGCTCCTGGCGCTCGCCGACCGCTACGGGTACGCGCGCGCCGGACTCGTCGGCGGC
ACCACCACCCTCGTCCTGGCCCTCCTGGTCCCCCTGCGTGGCCGCGCCCTCGACCGCTTC
GGCCACCGCCACGCCCTCCTGATCATGGGCACCGCCACGATGACCCTGACCGCGACCGCC
GCCGGGAGCGTCGCCGCCCGCTGGCCCTGGTGGACGACCCTCCTCCTCGTCCTCGCCGCC
AACCTCACCAACCCGCCCCTCAACGCCGCCCTGCGTTCCTCCTGGCGGCGCCTGGTCACC
ACACCCACCCAGCTCAAGACGGTCCACTCGGCCGACAGCATCCTCGAAGAAGCCGGCTTC
GTCGTCGCCCCCCTGACCGCCGGAGTCCTCATCACCTGGCTCGGCCCCGTGGCCGCCTAC
GAAAGCGCCACCGCCCTCTACCTCACCGTCATCGCCCTCTACCTCACCGCCGCCCGCCTC
TGGGGCCTCACCCCCACCAAACCCCCCGCCGCGCAGGCCGGGCGGAGCGAGCGCGCGCGG
CGCGCGCACCGCTGGCTCGGGCCACTCGCCCAGCCCCGCATCATCGGGATCATGATCCCC
ATGCTCGTCATGGGCACCCTGTTCGGCGGGACCAGCATCTACGTCCCCGCCTACAGCCAG
CACGAGCACGCCACCACCCTCATCGGCCCCCTCCTCGCCGCCACCAGCGCCGGCGGCGTC
CTCGGCGGCCTCCTCTACGCCCTCCTGCCCACCCAGCGCCTGGCCCCCTGGACCCTCTAC
CGGCTCCTGACCGCAGGGTTCGCGCTGCCCGCCTGCTTCCTCCTGGCCGCCCGCCCCCCC
TGGGCCCTCGCCCTCCTCCTCCTGCTCAGCGGCTTGTTCGTCACCCCGCTGTTCATCACC
GCGTTCCTCCTCATCGACACCCACGCCACCGACGACGTCCGCACCGAGGCCAACACGTGG
GTAGGCGCGAGCACGGACGTGGCCAACGGCGTCGTCGCCGCCGTCATCGGCGCCCTCACC
GCCCACAACAGCTTCACCACCGCCCTGACCGTCCTCACCGCCTGCGCCGCCCTCGGCCTC
CTGACCGCACTCCTCCTCCCCGCCCCCGAGAAGAGCACCGTGCCCGAAACCTCCCCACAC
GTGCCCGCCAACGACGCACCGGCCACGACCGCGTGA
>orf00017 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCCACTCCACGGTGCCCTGTCCGTTGGGCAGGAACATCGCCTCCCACTGCCCGCTGGA
GTTGCGGAAGTCGTAGCGGCGCAGCCAGCTTCCGCCCTGGTCGGGAACGGCGATCCAGTC
GGGGCCGCGGCGCCACATCTGCCCGCCGCCCGCGCGGCGGCTCACCGCTCTGACGTCCTC
GTCCTCGGGCACGGCGACGTCCGTGTCCGACAGCGGCGTCAGGGTCGCGGTGACCGGGGA
GCGCACCACCCAGCCGAGATCCTGGCCGAGCGCCCACGGCGGGCAGTCCGCGGGCAGCCG
GGCGATCCGCGCGTGCCGGAAATGCGCCGCGTACAGGTCGCGCTCCGACCGGGCGGCCGC
CCGGTCGGTACGCGGCTTGTCGGGCGGCAGGCTCCACGGGTAGAGCGCGGTGAACGCGAC
ATCAACCATGAGGGCTCCTCGAAGTGCGCGCGGCGAATGGACAACGAGTCAGGACCAGCG
GGGGACATGGGGGCGCCCGCCCCGGGCGCGGCGCGATCGGCGGCGCGTCGCGCCAGGAGC
GGGCGCGGGGACGGGGGCGGGTCAGGTGGTGAGGCGCTCGGTGCGGCGCTGGCGTTCCTG
CTCGGGCAGGGTGTCGAGGTCGAACATCGTCACCGAGCAGGGGCCGAAGCCGACGTAGAG
GGGCTCGGTGTCGAAGACGCCCTCCTCGCGGTCGAGAGGCGCGCTGCCGAGGTCGATGAC
GGTGAGGGTGTTGGGGTCGTAGTCGAGCTCCGGGGCCACCGCGCGCAGGTTCGTGCGGGA
GAAGTTCGTGACGTACGCGGTGGAGTCGGCGGGGTCGACGACGAGGCCGCGGGGGCCGCC
GCCGACGGGGATGTGCCGGGTAACGGCGAGGGTGTCGACGTCGATGACGTAGACCCGGCT
GATGGACTCGACCGTGATCAGCGCGTGGCGCCCGTCCGGGGAGAAGGCCACCCCACGGCC
GCCGATGAAGCCGACGTCGACACGGTGGGTCTCGTGGGTGGCGGTGTCGATCACCGTCAC
GTAGGTGGCCTGCGTGTTCGCGACGAACACCCTGCGACCGGAGGGGTCGATGCCGAGGCT
GTAGGGGTGGGCCTTCGCGTCGACGGGAATCCGCGCGACCTCGGTGACCCCGGCGGCGTC
CTGCCGTTCCACCAGCGCCGTGAGGTCGAGCTTGCTCACGTAGCCGGCGCCCCACACGCA
CACCCACGCACTCCGGCCGTCCGCGCTGATCCCCATGTGCCGCGGGTCGCGGCCCACCGG
CACCTGGTGGATCTCGACGTTCAGCTCGAGGTCGACGATGCTGACGGTGTCGGAGCCGGA
GTTGGAGACGAGCAGGTACGTGTCGCCGGGCAGCAGCCCCTGGCCGCGCGGGCCGTGCCC
GACCTCGATCCGCCGCACCTCGGTGTGGGCGACCGGGTCGATCTCGCTGATCGTGTTCTG
CGAGGTGTTGCACACGAACCCGCGCCCGGACCTCGTGAACTTCACGCCGCCGCGCGGCGC
GTTGCCGACCCGGATCTGGTCGATCCGCCGGTGCTCGCCAGGCCCGGCCTTCGCCACGAC
CGAGATCGTGCCGTCGTCGGTGTCGGTCGAGAAGAACTCGACGTTACGTGCCATGCCGTA
CTCCCTGTTTCCGATTTTCCCGTGGAAGGGACTGCGCCGCTGTATCTCAGCCGCGATGGA
GCGAGTAGTTCAGGTTCCAGGAAAGGGAAATACGCACCTCGTCGTCCTGGAATTCGGGCA
CCTCGTGACGCAGCCACCCCGGAATGA
>orf00020 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCAGCAAAAAGAACACCACATGGACGTGCGACTCCAACAAGATCAACGGGGTGAACTC
GACGTGGGGCAACATGAAGGTGTCGTACACCCACAGCACCTCGGGCACCCCCGACGGCCG
CGCCCGTGGGATCATCACGGCCTACTACCTCAACGACTGCGGTTGCTTCGCCGCTGA
>orf00021 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGTGGAGGGTGTCGTAGAGGAGTGCGGCGTCCTGTGCGGGGGTGCGTGGGGTGCCGGT
GCGCAGGGCGATGTGGTGGGTGAAGAGGGCCCAGGCGAAGGCGGCGGGGTTGGGGCGGCC
GATGACGCGGGGCCAGTCGGTGGCAAGGAGGGTGAAGACGTGGGTGACGAGGATGTGGGC
TTCATCGGTGGGGAGGAGGGCGCCGGCGTAGTCGCGGTAGGCGAAGTGGTTGAGGTCGTA
GAAGGCGTGGAAGGCGGCGGCGGTCGCGGCCAGGGTGCGGGAGGTCATCGCCGTCTCAGC
CGAAGTGCTCGGCGCGCAACGGCGAGGGCGTCGAGGTGCGTGCCTGGGCGACGGCGTGGT
GGTGGGCGGCCTGCCAGAGGGGGCGCATGTCGCTGGGCAGGCTGA
>orf00022 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCACGGTGGAGGCGAGGGCGTCGCCGAGGGTGTGGGGGGTGTGGCCGCAGGAGAGGAG
GAGGCCGGCGAGGTAGTCGCGCAGGTAGGCGACGGGATCGGTCTCCGGGGGCGGTTCGAT
GCCGGCGGCGACGTTGTAGAGGGGCAGGAGGAGGCGCTCGGCGATGCCGAGGACGCGGGC
GAAGTCCCGCACGTGGGGCCAGTGCAGGGGCTTTTCCCCCGACAGGAGCCGGGAGACGTA
GGAGGGGTGCCTTCTGATCGCCTCGGCGACGGCGCGCTGCGAGGCCGCGGAGCGGCGCAT
CGTGTGGGAGAGCGCGGCGCGCAGGCGGTCGGCGGCCCGGCGTTCGGAGCACTCCTGGGC
GCGGGGCAGGGAGGGCTCCTGGCCCGGCGGGCCTTCGGAGTCCGTCGCGGCGAAGACGGG
GGTCGGGTTCCACGGGTCCATGTAGGGGGCGAGGACGCGGTCGAGGTGCTTCTTGTCGTA
CTTCTTGCGGACGTGGTCCGCCGAGACGGAGAGGTGGGCGGCGACGGTGGCGTGGGTTTC
GTGCAGAGCGCGGGCCCGGGCGACGGTGGCGGCCTCCACGACGGTCAGCGCGCGCTGCAG
GCACGCGACGGTGGTGAGGAGGTCGCCGGTGGGGGCCGTGGTGCCGTAAGCCTGGTGCAG
CAGCGCCGCGGCGTGGCGGGCGACGGTGTCGGTGGCGGCGTGCAGCACGTCTTCGCAGAA
GGCGCGCGTCTGCCGGTCCTCTTCTTCTTTCTGCCGCTGGGCCGGGGTGCGGGTACGGCA
GTGCGCGCAGCGGGCGGCGGGCCGGCCGGAGCGGGCGGGCTCGGGTTCCAGCGGTGTGCC
GCAGTCCTGGCAGGAGCGGGGCGCGGGCGGGCGAACACTCATGTGTCGGGTCCTCAATCC
GGGGGTTCTTACTGCGTCGGGGTGGGGGTTTTTCCCCACCCTGACGACGCATCACGCGGC
CGGGCGGCCGTGGCAGGGGCCTCGTGA
>orf00025 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGCGCGAGTCCTACTCCCTCCGCTCCTCCGGAACGCCGTCGTCCAGGACGATGCGGAT
GGCGCCGGCTATTTCGTGGTCGCCGCCGGTGGCCTCGGAGAGCTCGTTCGCCATCCTGGT
GTAGGTCGTCACCGCCATCGCCCAGTCCCCGTCCGGGGACTCGGCGTCGGCTCGCGTGTC
CCACAACGTGATCAGCAGCGCGATGAGTGA
>orf00028 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGTCTTCATCCAGCGTCCGCAGACGCTCGGTTCAGGTGGGGATCGCGACGGCTGTTGTG
TCGGCCGTGGCGGTGTGGGGAATGCCGGCCGCGTACGCGGCGGCTCCTGACGCTCCGTCG
CAGCTGGTGGCGCTGACGGAGAGCACGGCGCCGTACGTGACGGCGAAGGTGGTGGCGCCG
TCGGGGAGCGGGAAGGTGACGGCGAAGTTCTACGCCGGCACATATGCGGCCAACGGTGAC
AACGACCTCGCGGACGGCAAGGAGGTGACGGTCGATTCGGGTGAGGTAGCACGGCTGAAG
CTGCCCGACATGCGGATCGGGACGCAGTTCACCTGGCAGGTCAAGGCCTGCGTCGACGAC
GACTGCTCCGACCTCTCCCCCCTCCAGACCACCCGGGTCAGCCCGATGACGGGCGCGGGC
GAGAGGCCCGGGGCCACGCGCCTGCAGTTCTCGACGGGCGACTCGACGGCCGCGCAGGTC
GATGTCGGCTCGGGCAATCTTCTGGTCAACGCCTCCGGGCTGACCTTGCCGGGGGTCAGT
GGTGACGTGGGCCTGGGGGCGGCGTACAACAGTGCGGCGATCGGCACGGATGCGACCTCG
GCGAAGTCGCCACTGGGGTACGGGTGGCGGCTGACCCCCTACGAGGTCGAACTGAAGGAA
CGCGGGGACGGCTCGGTCACCTACTACGGCCAGGGCGGGATCACCGGCCTGTTCGTGAAG
TCGGGCAGCGGGTTCACGACGCCGGGCGGGTTCAAGGCCGACCTGAAGAAGAACAACGAC
GGCACCTACACCCTCACCGACCACGGCTCCCAGTCGAAGCAGACCTTCACCAGCGCGGGC
AAGCTGACGAAGATCACCGACCGCAACGACAACGCCACCACGCTCTCGTGGAACGGCGAC
CTGCCCGACACCATCGTCACCACCCGCGGCACCAAGACGCAGCGCACGGCCGTGTACGCC
TCGGCGAACGGGCGGGTCACGACGCTGACGCAGACCGCCTCGGACGGCAAGAAGCGCTCC
GTCACCTACACCGTCGATGCTGCCGGAGACCTGGTGTCGATCAAGGACACCCTGGGCCGC
ACCACCAGCTTCACCTACACCGGGCACAAGATGACCTCGGTGACCAATCCCGGGGGTGGG
GTGACGCGTTTCGAGATCGGCGCGATCGGCGCCACGAAGATCACCCAGGAGAACAAGGCC
GCCGGCTCGCCCGGAGACTCCGTCACCCGCCTGTCCTACGCGGACCCGGACAAGACGGTG
ATGGCGTCCCCCAACACCGACCAGACGAAGACCGTGACCGCCGTTCCGCACACCACCTAC
GAGCTGACCGACAACAACTCGGCGCGGGTGGCGAAGGCGACGGACGCGGAGGGCCGGGAG
CGCTCGAAGACGTACACGGCGAACTTCGACACCGCCTCCTCGACGGACGGCTCGGGCGCG
AGCGCGGGCACGACCACGAACACCTTCGGCGCCAACGACGGCGAATCGCTGACCAAGTCG
CAGGGTGCGGACGGCTCGACGTTCTCCGCCGCGTACGGCAACACGGCGGCGGGCTCGAAG
TTCTCGCCCTCGGAATCGACGGACGGGCAGTCGAACAAGTCCGCCTACTCCTACAACGGC
GCGGGGAACCTGGCCTCCTCGAGCAACGCGGAGGCGGCCGAGGCGAAGGTCGACTACAAC
GACGACGGCACCGTCAAGACCAGCACCGACCCCGGCAACAGCACGGACACGTCGTACACG
TACGACGGCGACAAGCAGCTCACCAAGGTCGACCCGGCCGGCGGCTCGCTCAAGTCCCAG
TCGTACACGTACGACGCCTGGGGCCGCCTGGCCGTTGCCACGGACGGCCGGGGCCTCACG
ACCACAACGACGTACGACGACGCCGACCGCGTGACGAAGGTCGACTACTCGGACAGCACC
CCTGATGTCTCCTACACCTACGACGCTTTCGGCCGTACGAAGACCCGCACCGACGGGACG
GGGACGGTCACCTATGGGTACGACGATCTCGGCGCGATGACGTCGCGGACCGCGACGTCG
GGCGGGGGCACGCTGGCGTACTCGTATGACAAGAACGGCAACCGCCTCAGCACCACTGAC
GCGCGCGGCACCACGCAGTACAAGTACGACCAGGCCGACAAGCTCACCCAGGCGATCACC
GATGCCCCGTCGACCAAGACGAAGATCGGGTTCAGCTACGACGATCGCGGCCGGCGCACG
GACACGTACTACGGCACCAACGACGCGAAGACGATCTTCAAGGCGCGCGTGCACCAGGAC
TACGACAAGTCCGGCCGCATCAGCCGCGTCTGGGCCGACCAGGGCCCGGCGACCGACACG
ACCCGCCAGTTCGACGCCACGTACTGCCGCAGCCTCGGCTCCACCTCGTCCTGCTCGACC
GAGAAGGCCGACAACACCGACCTGATCCAGTGGAGTAAGGACAACCTGAGCGGCAAGACC
ACCAAGTACACGTACGACAAGGCCAACCGGCTGACGAAGGTCGCAACCGACGGGGGTGGC
AAGACGTACACCTACACGTACGACGCCCGCGGCAACCGCAAGTCCTCGTCCGACGGCAGC
GCGGATCAGTCCCTGGCTTTCGACGCCGCCAACCAGATCACCAGCGACGGCTACACGTAC
GACGCCCAGGGCAACCAGACCAAGACCGCCAAGCTGTCCACGCTCACCTACGACGGCGCC
AACCGCATGACCGGCGCCAAGACGGCCAAGGGCACCAGCAACTACACCTACGCCGGCGAG
GACGCCACCGAGCTCGTCTCCCAGACCAGCGACGAGGGCGAGAAGACCGACTACGTCTAC
GGCGCCCCCGACCAGTACGGCATGCCCGTCATCGAACAGGTCACGCTGAAGGAGGGCACG
GCGTACATCGACCACGACCCCACCACCGGCCAGCCCCTCTCGCTCCGGACAACGAACGAG
TACGAGGCGTACTACATCGTCGACGGCATCGGAAACCCGGTCCAGTTCATCAACCAGTCC
ACGGTCCAGTCCACGATCTACGACTACGACCCCTACGGCACCGTCCAGACGACGAAGGAA
ACCGGCACCGCCGGCACCCAGAACCCCTACCGCTTCGTCGGCGGCACCTACGACAAAACC
ACCGGCTACGTAAAATTCGGCCAGCGCTGGTACGACCCCACCACCGGCCGCTTCACCACA
CAAGACAAACTCAGTTTCTTCGCGAATCCCGCACGCGGAAACCGCTACGCGTACGCAGGA
AGTGATCCTGCCAACGCGGCAGACCCAACCGGCCAGGATTACTACGACTGCGCCTTCGCG
GGACTCGTGTTTGTCGGGGCAGCGGGAACGGCAGTTCTCAGCAGCGGAGGCACAGCCCTT
TTCGGTGGCGCCGCTGCGGTAGGAGCCGGTGGTCAGTCGTACAGGGCTTGCCCCAAGGAA
GCCAAAGAGGGTCCCGGGCGGAAGAACTCGCTGAAGGCAGCAATAACCCCGATATGGAAA
ATTCTGTAA
>orf00031 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCCGGGTGGAGCCCGCGAGGACCTCCACCTCGAGTGCGGCGTCGGTGAGGTGGAGGGG
GCCGGTGTCGGGGTCGTGGGTGGTGCCGGTGTCGTGCCCGGGCAGGTGGTGGCCGAGTTC
GGCGGCGAGCGCGGCGGGGAGGTGCTGCGAGCGTACGGTCCGCCCGTCGGCCAGGAGGAC
GAAGAGGTGCGAGGGCCGTGA
>orf00032 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCCGGGTTGCTGCGTCGGCGTGCCCTCACCGGCGCCGGCCGCCGGGCCGGAGCGTCGC
GTCGTGAGGAGAGGTCGCGCTCGCCTCAAGGAGTAA
>orf00033 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCGCGGCCTCGTCCGGGTCGCCGAGCGGCCGGGACAGCCCCTCCGCCTCCTCCCGCCG
CTCTGCCGCGGTGGGGCGGCTGGTGCGCTCGCCCACCAGGTAGTCCGGATCCTCGGGCCC
GCCCGGCTCCATCCCGCCGCTGTCGTCGTCCTCGCCCATGAAAGTGACGATCCGCCCGGG
GGCCGGTGCGGGTGA
>orf00034 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGCGGACGGTGTCGAGGGGGACGGGCCGCCCGTAGGCCTCCTCGAAGTGGGACTGGGC
GGCCTCGGGGGAGCGGTCGGTGAGGAGGTGGAAGAGGTGTCCGGAGCCGTCCGGGTCCGG
GTTGCCCGAGGGGAACTCGATGCCCGAGCCGGTGCGCCAGGCGTTGGCGCCGGTCTCCCA
CCACAGGCAGGCGGTGACCCGCGGGGCGCCGAGGCCCTCGTCGACGAAGGTCGGGTCGTC
CAGGAGCGGGCGCAGCGCGGCGGGCACCTCGTCGATGACACCGGGCCAGACCTGTTCGTC
GTCCGTGGCGTACGGGCTCATCTCCGACTCGTGGTCGAAGCCGCGGACGAGCACACCGAC
CGGGGTGAAGAGGACGGAGAAGTCGTCACCCGAGCCGTTGTCCATCAAGGCCGCCTCCGT
CCCAGGCCCCCAGGTGGTGGAGAAGGAATAGCGGGGGAACCGCGGGTCGCGGCAGATCGC
CTGGTCCAGCACTGCCAGCGCGCGCAGGTGCGCGCGGAGTTCGGCGGGGTCCGGGAGGAG
GGCAGCGGTCGTGTGCACGGTGTCCATGGGATCATGTAA
>orf00036 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCGTCACCCCGGACCTGATCAAAGAAGCGATCACCGACGCCACAACCGCTGTGATGCC
GGTGCTCTTCGGCGGCCGGGCCATCGACCTCACCCCGATCCGCGAGGACCTCGCCCACCG
CGGCATCACGGTCATCGAGGACGCCGCGCACGCCTTCGGCTCCCGCAACCCCGACGGCAC
CGGATTCGTCGGCAGCGACAACTCAGTGCTGACCTGCTTCTCCTTCGGCGCCATCAAGAA
CCTGACCTGCGGCCAGGGCGGCGCCGTCATTCCCCGCACCCCCGACGAAGCGCACACCCT
CCGCCGCCTGAGACTGCTGGGAATCGAACAGTCCCAGAGCGAACGCGCCGAGACCACCAC
CTACCAGGTAGGCGGCTTCGGACTGCGCTACCCGCTCTCGGCGCTCAACGCCGCGATCGG
CCTCGCCCAGCTCGACCACTTCGACGAGACCGCCGTCACCCGGCGCCGCCTCTGGCGCGC
CTACCGCACCGCCCTCTCCGGCCTTCGCGACGTGCCCCTCATCGACGTCGGCGCCGACCG
CGCCGTCCCGCACCTGTGCCAGATCCGCGTACCGCGACGGGACGAAGTCTTCGCACACCT
GCGCAAGGCGCACATCGGCGTCGGCGTGCACTACCCGCCCAACCATCTCCAGCCCGCCTT
CGCACCCTGGAGCCGGTCGCTGCCCGCAACCGAACAGGCCGGCGAGGAGATCCTGAGCCT
GCCCTTCCACCAGCACCTCACCGAGGCCGACATCGCCCTCGTCGTGCACGCCCTACGCGC
CGCGCTCGAAGCGACAACCATCACTCCCCAGGCCTAGGCCGCGGCGGACACTCATTCCGA
TGCGGCGGTCAGCAGCACGTCCACCAGCCTGTCCGCCGCATCCGGGCGACCCTGAGCCCG
TGCCGCCACAGCCATGGCCTCCCTGCGCAAAGGATCTTCCAGCAGGGGGGCCACCGCCGC
GCGGAGCCGTTCCCCGCCGACCTCTCCCACGAGCGCGACGGCCGCGCCGGACTCCTCCAG
GTGCCGGGCATTGTGGGCCTGCTCATTCCCGGCCGCCGACGCGAGTGGAATGAAGACCGC
CGGCTTGCCCAGGGCAGTCAGCTCGGCGAGCGTCCCCGCGCCACTGCGCGAGATCACCAC
GGAGGCCAAGGCCAGCACATCGGGCAGCTCCGCGCCGACAAAGGGCGTCACGTGGTAGCG
GACCGCCAGGTGAGCAGGAAGCGTCGCCGCACGCGCGGCCAGCGACTCGTAATGCGCAGG
ACCACACTGGTGCACCACGTTGGCCCGCTCCAAGAGCCACGGCAGCTCCCCGCCGACGAC
CTCGTTGATCTGCTGCGAGCCCTGCGCCCCGCCCGTGACGTAGACCGTGGGCAGGGCCAG
ATCGAAGCCCAGCCCCAGGGCCGCCACGGCCTTGCCCGGATGCCCGGTCAGCACCTCTGG
ACGCACCGGATTTCCCGTGACCACCGCGAGAGAGCGCACACTCTCCGGCAGAAGCGGCAG
CGTCGACTCCGAGGAGACCGCGATCCGAGAGGCGCTCCCCGCGAGCCTCCGGTTGGCCAG
CCCCAGCCGCACCGTCTGCTCATGCAGCACAAGCGGAACCCTGCACATCCGGGCAGCGAG
CCCCGTCGGCACAGCCACGTACCCGCCCGTCGCGAGCACCACATGTGGCCGGAAACCCGC
GACCGCCTTGCGCGCCTGCGCCACACCGAGCGGAACGCGCGCCATGTCCCGCACATTCGC
AGGCGAGACCATCCTCAACGGATTCGACGAGCGCCTCACCTTCCCCGTGGCCACCGCCGT
GAACGCGATCCCCTCTGCCTCGGCAACACGCGCCTCCAAACTGTCGGCGCTGCCGATCCA
CAGCACATCGAGAGAACGCCCCCGCGCCCTCAACAGCTCCCGCAACGTACGCACAGCGGT
CAGGGCCGGGTAGGTATGCCCGCCCGTGCCTCCCCCCGTCACGACCAGACGGAGAACCAG
AGGGGGGTGAGAGGTGATAGCCACACAGGAACTTTAACGGCCGACCTCGAGAACGACCGC
CGCTTCCAGCTTGGTCGCCGGGTCAGCGGAGTCTGCCGCGCGCCCGGTCCAACTCCGCGT
ACGTCACCACGCCCGCTTCGGGCAGGCCCGCGTCCTGCCATGCCGCCTTCGCCGCCTCCT
CGCCACCGCTCGCCTCCTCCAGCAGGAGGTTTTTCGCCGCGTTCACCGGGAGGGCCCCCT
CGCCAAGATCCACGAGGTACACGACCATCCGGACGCTCCGGTTGCGATTCACCTGCTCGA
TGTACCGGTAGACGAGCACCAACACCTGTCCGTAGCGCGGGGGCCTACCCTCGCGCGCGC
GGAGGTCAAACGGCGCCGCGCGAGGCGGCCCTTGCCCTCGTGGGGTCCGCTCCGCTCGCG
CGGAGGTCACCCGCCGAGCTGACCGGGCCAGTCGGCTGCTGCGCCGTGGCCTACTCCGTT
GAGCGACAGACGAATGCGCCGCATCGGCGGGTCGGCCACGGCGATCCGCGCGGTCATCGC
ATCACCCACACGAATTTCCCTGGCAGGCTCTGCTGCGAGCAGTTCGGAGCTGTGAATCAG
CCCTGCAATCCCATTACCAAGATCCACGAAGGCGCCGAACGGCACGACCTTGGTGACCCG
ACCACTGACAATGCTGCCCACGCGCTCAGCCCAGACCAGCCATGGATTTTCCTGCAGGGC
GGCCAAGGACAGCACAGCCTGCCCATGCAACTCGGTGTCCAGGGCCAGAACCTCAGCACT
CACACGCTGCCCCAGCGATACCACTTCATGGGCAGAGGAGATCCATTGCCACGAAACCTC
GGGCGGAGGAATGAACCCGACCGAAGTCTCCGGCGCTCCGTCGAGATCGACGAACACGCC
AAAGGTCTCGACCCGGCTTACCATCCCAGCCACTACATCGCCTGGGCGGAGCAACTGGAG
GAAGTCTTTCAAGACCTTTGA
>orf00037 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGTCGGCCACGGCCAGGCCCTGTTCCAGGTCGTTGTTGTGCAGGTGCGCGGATGCTTC
CACCGCGAGCCGGATGCCGACCGCGCGGGTGTAGCGCTGGGCTGGCATGGTGTCGGCCTG
CTGGCTCCAGGTGAGCGCGTCGTGTGTGCGGCCCAGGTCGCGGTAGATCTCGGTGGCGTC
GGTGGCCAGGCGCTCGCGGGTGTAGTAGGCCATCCACGCCGGAGCCGTCTCCGTGCGAGT
CCGGTCGAGGAGGTTTTCTGA
>orf00040 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGCCACGGTGGGTTTCGCCCAGCTCGCCGACAATTTGGGCGGTGACACCGAAGCGGCCC
TCGATGCCCTGGACCGCTTCGTCGACAGCTTCGCCCGCTCCGTGCCCACCGGCTACCAGA
ACTCCTTCGCCCACCGCACCCGGCCCAGCCTCGTCGCCGTCGTGGTCCGCGAGGACCAGC
CCGTCAACCTCGTCACCGCCTTCGAGGAACCCGTCGTGTCGGAAGCCGGCATCCAAGCCG
CGTCGGTACGCAGCCTGGCCCACGAGTACGCGGCGGCCCGCAGCGCGTGGGGCGACGTCC
CAGTGCACGCGGCGGCGACCCACACCTTCGCCTCCGGCAAGCCGGGCGCGACGGAGACCG
TGGAGGCGCTCACCGAAGCCTTCGGCACCTCGGTCCCCTTCGACGAGCTGCGCTCGGGCC
TGCGCGCGTGCGTCAGCGCCGTCCTGGAGGCCCAGGGATGACCGCGACCGGTCCCACCAC
GGTTCTCCTGCTCCGGCTTGCCGGGCCCCTCCAGGCGTGGGGCGACCGCAGCGCCTTCAA
CCGGCGGGAGACCCGTCCCGAACCCACCAAGTCCGGGATCGTCGGGCTGCTGGCCGCGGC
CGCCGGGCGCCCGCGGCACGCCGCCATCGACGACCTGGCCGGACTCGGCCTGGGTATCCG
GGTCGACCAGGCCGGCAGCCTGTTGCGGGACTACCACACCGTCAGCGACTACCGCGGCCG
CCCGCTCCTGGCCGCCGCGGTGAACGCCAAGGGCACCCAGAGACTCACCGGCCCCGCCAA
GTACACCCACATCACCCAGCGCTTCTACCTCCAGGACGCTGTCTTCCTCGCCGCGATCGA
GGGCCCGGCGCACTTCATCACCACCCTCGAAAACGCGGTACGCCACCCGGCCTTCCCGCT
CGCTCTCGGCCGCCGCTCGTGCGTCCCCGCGCAGCCGCTCGTCCTGGGGCAGCGCACCGG
ACCGCTGGAGGAGGTACTGCGCGCGGAACCCTGGCACGTCACCGATGCCGTCCGGAAGCG
GTGGGGACGCCGCAACGGCAACGCCGCCCACGTCGACCTGCCCCTCACCCTCGACGACCC
GGCCGGCGACGACACGCGCGAGGACCTGCCCCTGTCCTTCGCGCCTACCAGCAGGGCCTA
CACCAGCCGCCGCGTCCGGCACACCTACGCCGCCGCCCCCACCGGCCTCACACCCCACCC
CGACCAGCCGCCATCCACCGGCGGCCACGACCCCTTCGCCCTCCTGGGCTGGTGATCCGA
CATGCCCTACCTCTCCCGCATCCGCATCAACCCTCTGCGCACCGCGAGCCGCACCCTCCT
CGCCAGCCCCCGCGCCCTGCACGCCCAGGTCCAAGGCGGCGTCCCGACCCTCCCGAACGA
GTCCCGCACCCTGTGGCGCCTGGACGCGGACAACCCCCACCGCCCCGAGCTGTTCGTTCT
CACCGCCGGAAAACCCGACTGGACCCACCTCGTCGAACAGGCCGGGTGGCCCGGCGCGGA
CGGCGAGCACTACGCGGTACGGGACTACGCGCCCCTGCTCGGACAGCTGGCGCAGGGCCG
GGAGTTCGCCTTCCGCCTGACCGCCAACCCCGTCCAGAACACCAACCGCCCCGACAAGCC
CACCGAGCGCCAGCAAGAACGCCTCGACGGCGGCACACGACGCAGCTTCCGCCTCGGCCA
CCGCACCGCCGCCTCGCAGCTCGGCTGGTTCCTGACCCGCACAGCCCGCTGGGGCTTCGA
CGTCCCCGCCGCCTCCCACCTGGACGGCACCCGCGACGACCAAGACGAACCACCACGCGA
CGTGCGTATCAGCACCCGCCGACGCCACTCCTTCGGCAAGCCGACCCGCGCCTCCAAGGA
AGACCGGGTAATCATGCACATGGTGACCTTCGAGGGAAAACTCCGCGTCACCGACCCCAG
CCTCCTCACCCAGCGGCTGCTGGCCGGGATCGGCCCTTCCAAGGCGTACGGCTGCGGGCT
CCTCACCCTCGCCCCTGTGCCCGCGAAGGCGTGACGCCCGTGGCCGACATCTGGTGGAAA
GCCGACCCCCACGACCTGCACCGTCTCACCGACCGCGTCTCCAGCGTCTACGTCGAACGC
AGTCATCTCGACCGCGACGAGAACGCCGTCGTCATCATCAATAAGCGACAAACCGTCCGT
GTCCCCGCCGCCATGGTGGCCGTCATGCTCCTCGGCCCCGGCACCCGCACCACCCACGCG
GCCATCCGGCTGCTCGCCGACTCCGGCACCACGGTCTGCTGGGTCGGTGAACAAGGTGTC
CGTATGTACGCTGCCGGCCTCGGCCCCAGCCGGGGCGCCGGCCTCCTGCACCGCCAGGCA
TGGCTCGTCACCCGGCCCAAAGAGCGCCTGGCCGTAGCGCGAGCCATGTACAGCATGCGC
TTCCCCGGCGAAGATGTATCGGCCCTGACCATGCAACAACTCCGCGGGCGCGAAGGCACA
CGCGTCCGCAAGCAGTACCACCACCACGCGGAACGCACCGGAGTGCCCTGGAACGGTCGC
GTCTACGTCGCCGGCGACGCCCACGCCGCCGGCGATGACCTCAACCGGCTCCTGTCCGCC
GCCAACGCAGCCCTCTACGGCATCTGTCACGCCGTCATCACCGGCCTCGGCGCCAGCCCA
GGACTCGGCTTCGTCCACACCGGCAAAGCCACCTCCTTCGTCCTGGACATCGCCGACCTC
TACAAAGCCGAATACACCATCCCCCTCGCCTTCGACCTCACCGCCCAAGGACTCACCGAA
GAACGCGACGCACGACTCGGCCTCCGCGACCTCATTACCCGTGACAAACTCCTCACGCGC
ATCGTCACCGACGTGAAAAACCTCCTCACGCCCGAAGGAGCCGAGTTCGAGGACTCCGAA
GCCAACCTCCTGTGGGACGAACAGGTCGGCGCAGTTTCCGGGGGAACCAACTACGCCGAC
TCAGCAGATTTGTCCGTCTACGGAATAGGAGACAACCACATCGCGGTCATCGGTCCCGAT
CTCGACGAAACCGGCCCCACCTCATGA
>orf00041 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGTCCGGTGCTGAAGGCGTCGGCGACGGGCAAGTCCTTGAGCTCTGCGGCGAGTTTCTC
GTCATCCAGCGCGGCCAGGTCGTGGGCCTGCCCGCTGACGAGAGCGGCGACCGTGTCGAG
CTGGGCGTTGCCGTAGAAAAGCAGGTAGGCGGTGTCGCTGGCCTTCTTCCCCTGGCTCAG
GTTGAGCCGGGTCAACAACGCGCCGGCGAGCCGGTCGGCCTTGTCACGCTCCAGCTTCGT
GTCACGCACGATCCGCTTGGCGAGTTCGCTGGTCAGGCGCCTGGTGCGGGTCGCGCGGTC
CGGCTCGGGCACCGTGGTGTCGAAGTGCTTGCGCGTCGCCCGCTTCCACGCCTGGGAGGA
GACGCGCGAGCGCCGTGCGCCACCGTAGACGGCCTCTTTCGGGTTCCCCTGGTCGTCACG
GTTCACGTTGGCGGGCGGGACCGTCTGGACGATGTGCACGTCGATGAAAAGGCGCTGTGG
CATGAGGTCGCTCCAGGGTGA
>orf00042 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGCCGCGCAACACGAGCATCGCCCGGCCCAGCCCGACGCCGGGCTGGTGCATGGGACG
GTCCTGGCTTTGCTGGTGCAGGCCGTACAGGGCGAGCGCGATGTGCTCGGCTTCCTGCTC
GGCGGACATCTGCCCCTTGCGGGCGGCGAAGTCGTCGATGGGGCAGGTGTAGAAGGGGAA
CATCTCCAGCACGGTGCCGGCGGGACGGGTCAGGCCCCGGCGCAGCACGGCGAGGTCCTC
GCCCGGCGGCCGCTTCGCGGCCGCGGTGCCTTTCGTGGTGCGCCAGGTGCCGTCCGCGGC
GATGTGGCGGTGCCAGATCCTCTGCGCGGCAGAGCGCTGTTCGGTCATAGCCGTGTCCAG
ACGTGA
>orf00043 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGGCGCCGCTCCCGTGTCGGCGGATCTGCCGCAATGGCGGCGACGGGATGCCGAGCAT
CCGCTGTCGGCCGGGACGCCGCGCTGGCAGGAGCGTCTCCCGCAGGGGCTGCTGGATTTG
TGGACCTGGCAGTCCCGCCGGGCCCTGCTCGTTCCCGAGGCCACCGAGGAGGGCGTGCGT
GTGACGCGAGTCCTGGTCGCGGCCGGGGACCGGATGCCGTACACGCCGGAGATCGAGCCG
CACACCATGTGGCGCACGGAACCCACGGGTGGCCGCAAGCCCGCCAAGAACAAGGGACGC
ATTGTGCCGCCGCGCCGGCCGTTGCGTCTTCAGCCGGGGAAGGCCGTGTGGCGGGGCCTG
GACGCGCTCCTCGCCACGGAACGTGCGACGCGGGAGGCGGGGGAGGGGACGAGCGGGTTC
GTGACGAGCAAGGTACTGGATCAGGCCGGAGGTCTCGTCGCCGAGCTTGGTGAGGGCTAC
CCGCTGCGGGTGGAGCTCACGGGTGTCGCCTACGGCAATCAGTCGGCGGTCGTCGACGAC
GTCATGCACGACGCGCTCCCCCTCCCGCTGGCCGCGCTCGAGGTGGACAGCTTCGTCCGC
TCCGCTCTGCTGGAAGTGTGCGAGCAGGCGGAGCAACTGGCCGCCGCCGTCAACCATCTC
TCCGCCGACCTGCGTCGCGCGCTTGGCACCGAGCCCATTCCGTGGGACCGGGGCCAGCGT
CCCGGCGAACTCGTCCTGCACGCCCTCGATCCGCTGGTGCGGCGGCTGCTGGCCGGGATA
CGGCATGTGGACGACCTCGAACGTATCGATGCCGGGCAGCTGGCGTGGGAGCAGCTCGCC
TGGAGCCGGGCCTGGGCGGTCGCGGACCGGCTGCTCCAGGCCGTACCGGTCAGCGCGTTC
GCGGGCCGGAGCACTTCTCAGGGGGAAGGGAAGCCTGAGCGGACCCACCGTGTCTCGCTC
GCCGAGTCGTTCTTCCTCAAACGCCGCGCGGAAATTTTGCACCGGGCCGCCGCTGCCCGG
CGCGAGAGCACCGCGGGCGTCGCAGAACCGGCCGGCCTGCCCACCGCATCCTGA
>orf00044 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGCGGCAGATCCGCCGACACGGGAGCGGCGCCCACGGGGAGGTTCAGCAGCAGCGTCTC
GAACAGGGTCCTGCCCGCCAGGAGCGTGACGCCCATCTGGCCAAGCGGGCCCGTCGGGTT
CCCTGTGGTCTTGCCCGCCTTCGCCTGCGGGTCGCCGACCGCCCCGGTCTTGATCGCCGC
CGTATCCCAGCAGTGGGTGTGCAGCAGCCAGAGCACGGCCTGCGCCGGCGTCAGAGCGAA
CACGTCCCCTTCCGTACGCGAGGCGAACAGCGGGACGTTGTTCCCGGTCGCCGCGTGCGG
CACGATCAGGGCGGCATTCTTCGTCTCCCCCCTCGGGGTGTGCAGCCCGGCCACCTGCGC
AAATGGCCGCACCGGATCGAAGAGACCGAACGCCTCACGGTACGCGTCCAGATACGCGGT
GAGCCGCGCGCGCTGCTCGGGCGTCCAGCGCCCGGCGGCGAACCATTGCGTCCATTCCCG
CTCGTCAGCGGGACGGCCCAGCGCATCGACGACCACCGGAAGAAGCAGCTGCCGCAGTAC
CGCCGGCCGCTGGGTGGCACTCTCCACCGCCAGGTCCCCGAACTCGTGCGCGTCCAGCAG
CACCGTACTCAGCGAACGCTCCCGCGCCAGACCGCCGACCGCCGGCGGCACACGCAGCCA
CCGCTCCTCGAGCAGGGAAAACCCAAACCCCATCAATCCCCCTTGAAACCTTCTCTGTTT
AACCTACGCACACCCACCACGCGCGCGGGCAGGTTTCCCGCAATCCGATGCGAGAATCCG
TTGACCGACAACCGACCCCACCCCTGGCGCTGTCCGCGGGGATGA
>orf00046 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGAGTCGACAGCGGACCGTCCGCTTCCAGGCGCGCGAGGATCGGAGGATCCCCCGCGA
GCGCGAGGTCGACGCCGTCACGCTGATGTCGCCACCAGGACGGTCCGGGCGCCCCATCCC
TACGAGCACGGGGCCGACCGAGGGCTTTCACGACCGGTGGATCGACGGGTAGGAGGGTAC
CCGCGACCTGAGCGAGTGGATGCCCGGCTGCGGCCTCAACGGAGGATCTCCGCGTGCGCG
GGGTCGACGCCAGACGGGTCCTGCCATATGAGGTCCAGCTTGGAGGATCCCGCAGGCGCG
GGGGCAACCGGGCGATGCTGCCTGTCTCCTCGAAGCGGCCCGGAACATCCCTGGCGGCGG
GTGGCACGCGTGTCGCCGCGGCGGTGGGGGGGTGGGGGCCTGCGGGTGCGGGTCAGCCCA
TCTGGGTTCGGGCGGTGCCCTTGTATCACGGGGTCGGGGGTGGCGGGTGTCGTTTTGGTG
ATTCTCCTTATCGTTTGTGCAGTTCAGAGGGTGTTGTCGGTGGTGCCGTTTACGATCCGG
TTCTCGAATTCGTGTGTGAGGTGGGGGTTTTCGGTGGATGTGAATGAGCTGGCGTTGAGG
TACGGCGCGGCGGTGGTGCGGGGGCTGGAGACGTTGTGGGGGAAGTCGCGGGAGAGGGCT
GCGGGGAGGACGAGTCTTCTGCTGGGGCATCTGCTGGATACGGCGGCGGTTGCGGAGCTG
ATGTGGGAGGAGTTCTTGGCGCCGGCGACGCGTTCGGCGCTGGATGAGGTGGCGGGTGGG
GTGGGGTGTGGGCGTGGGTTGTTTGTGTGGTTGTGCGCGGTGCATGACTGCGGGAAGGCG
ACGCCTGCGCATCAGCGGTTGTGGGATGAGGGGGCTGAGGCGGTTCGTGCTGCTGGGTTG
ACGTGGCACGAGCCTTCGGCTGTAGCGGGGGCGAAGCAGCGTTGGCGGCACGACTGGGCC
GGTGGGCTGATCGTTCGGGAGTTGCTGGGGGAGGTGGGGTGGAGTGGCGAGCAGGTGGAC
TGGGTGTGGCCGCTGGTCGCCGGTCACCACGGGGCTTTCCCGACGCTGAAGGACGTGCGT
GAACCGGGGTCCGCGAAGCGGCAGTTGCGCGGGATCGGGGTGTGGCGGGAGGTTCAGCGC
GCACTGCTCGATGTGGTCTCGCGCGAGGTGGGCTTTGCGGGGCCGGCGGAGGTGGAGCCT
GTGGTTGTTCCGTCGAGGGCATTGCAGTTGCAGGTGAGTGGTCTGGTGGTGATGGCGGAC
TGGATCGCGAGCGACGAGCGGTACTTCGGTGGGGTCGATGACCTGCGAGAGGTGAGTGCG
GAGGGTTCTCGTCGGCGGGCCGCGGGGGCGTGGAAGGCGCTGGGGCTGCGTGGTGGCTGG
GGTGAGCGGGGTGTGCCGGGGCGGGAGGTTTTTGCGGGGCGGTTCGGGTGTGTGCCGCGG
CCGGCGCAGCGGATGGTCGTCGACGCGATGGGGGATATGGGGGGTGCGGGGCTGGTGGTG
GTGGAGGCTCCGACGGGGGAGGGGAAGACGGAGGCGGCGCTGTTCGCCGCGGAGGTTCTG
GCGGCGCGGTTTGGTGCGGACGGTGTGTTCGTGGGGATGCCGACGCAGGCGACGAGTGAC
CCGATGTTCTCCCGGGTGCGTGGGTGGCTGGGGGCGGTTTCGGAGGAGTTCGCGTCGCGG
GTGGTGCTGTTGCACGGCAAGCGGGCGTTCAACCGGGAGTGGAAGGGGCTGGTGGAGGAG
GGGGCGGGGGCGAGGGAGGCCTTTGGTGGGGTGGATGAGTTCGGTTTGGCTGGTGATCCG
TTCGGTGTGAGCGGGGAGGGGGGTGGGGAGCTGGAGTGTCAGGCTCTGGTGGAGTGGTTT
TTGGGGTCGAAGCGGGGTCTGCTGGCTCCGTTCGTGGTGGGGACGGTTGATCAGCTGCTG
TATGCGGCGACGCGGACGCGGCATGTGATGTTGCGGATGGCGGGGCTGGGCGGGAAGGTC
GTGGTGCTGGACGAGGTGCACGCGTGCGACGTGTACATGAGTCAGTTCTTGCACGAGGCG
TTGCGGTGGCTGGGGCAGGCGGGGGTCCCGGTGGTGGTGCTGTCGGCGACGCTGGCCCCG
GCGCAGCGGCGGGGCTTGCTGGAGGCGTATCTGGCGGGTGCGGCGTCCGTGGAGGAGTTG
CGGGTCGAGGTGCCGGCCGCTGAGGGGTATCCGAGTGTGACGACCGCGTGGTCGCCGGCT
GGGGGCGAGCCGCAGATCCGGGTTCGGGCGACGGGTAGCTGGCGGGCGGATCTCGGGGTT
GAGGTGCGGGTGGTTCCTGAGGCGGTTCCGGGGCGGGGGAGTTCGCGTGAGGAGCGGGAG
CGGGCGCAGGCTTCTGCGGATGCGCGGGTGGGGGAGTTGCTGGCCGGTGAGCTTGCCGGG
GGTGGTACGGCGCTGGTGATCCGTAATTCGGTGGCGCGGGCGCAGAGCCTTTTCGAGGAG
TTGCGGGGGCGTTTTGGCGGGGATGAGGTGCGGTTGCTGCACGCGCGGTTCACGGTGGCG
CGGCGTGCGGAGCTGACGGAGGAGTGTTTGCGGCTGCTGGGGCCGGGGGCGGGGCGTTCG
CGTTCGGGGCGGTTGGTCGTGGTGGCGACGCAGCTTGCGGAGCAGTCTTTCGATGTGGAT
GCGGATGTGCTGGTCACGGATGTGGCGCCGGTGGATCTTTTGTTGCAGCGCGTGGGGCGC
TTGCACCGGCACGAGGGCACGTGGAGGCCGGAGGGGCTGCGGGTTCCGCGTGTCTTCGTG
ACGGGTTTCAGTCCTCGTGAGGGGCGGGAGCCGGAGTTCGTGTCCGCGAGTGAGGGGATC
TACGGGCGTCATCTGCTGTTGCGGACGGCGGCCGTACTGCCCGGTGCGGGTGTGGGGGCG
AAGGCGGGTGCGGGCGGGGTGTGGCCGGTTCCGGGGCGGGTGCCCGCTCTGGTCGAGGAG
GTGTACGGGGATGAGGAGTCGCTCTTGCCCGAGGGGTGGCGTACGGCGGGTGAGGCGGCC
CGGAGCGAGCAGGAGACGCAGGACCGGGAGCGGGCGCAGAACGCGCGGCAGTTTTTGCTG
ACGGGGCCGGGTGAGCACGAGCGGCGGACGCTGGCCGGGTTGCATTACGGCGGGGGGACG
GCGGGCGGCGGTGAGGACGCGTTGCGGGCGGCGGTACGGGACGGGGACGAGTCCGTGGAG
GTCGTGCTCGTGCGCCGCGACGGGGACGACGGAGCGTTCCGGACGCTTGCGGGGCGGGCG
CTGAGTGTCAACGGGGACGTGGCTCCAGAGGTGCTGGAGGAGGTACTCGGTTCCGTGGTG
CGGCTGCCCGCGAAGTTCACCAAGGCGGCCGCAGGGCTGGCGCCGCTGCCGGGCTGGCAC
GGGCATCCGTGGCTCGGCCGCAGCCGTGCTCTGGTGCTGGACGCCTCGGGTAGGGCCCGG
CTGGGCGATTTCGCGGTGGCGTACGACGGCGTGCTGGGGTTGCGGCAGGTATGA
>orf00047 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGTACGACGACGCCTTCGTGTCGGTCGAACTGCTCTCCGCGCAGGTGAAGCTGACCCAG
CCCTCCGAGATCGCCCTGTATTTGCGGGCGTTCGAAGAGCTGCGGAGCATGGCCGTCTAC
GGCGCGGACGCGCGCGCTCTGGTCGTGCGGGCGATCGACGCGTTGCGGTAG
>orf00049 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGAGGAGGACACGGTGCCGGTATGCCTGGGTGATCTCGCGGACGTGAGTGAGGTCGTC
GAGGTCGGTGGCAGCGAGTTCCCTGTCGAACTGGTCGAGGTCGCTGGGGTAGCCGTGCCG
GCGTAG
>orf00050 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGACTGCAGGTCAGCAAGTGTCGGCCCCGCGAGCGCGGGGATCCTCCAGCTCGTCGGCG
AGCTTCGCGTGCGCGGCCTCGGTCGGCCCCGCGAGCGCGGGGATCCTCCGATGTGCGCTG
GATGCAGCGTGCGATCGGCCTTGTCGGCCCCGCGAGCGCGGGGATCCTCCGGCGGGCTGG
TACTTCCGGCCCGTAGACCGGATGTCGGCCCCGCGAGCGCGGGGATCCTCCGGGAACCTG
CTACGCCGACCGCGAGTTCGACGGGTCGGCCCCGCGAGCGCGGGGATGCTCCCTCCGGGG
CGACGGGCCGGGCGTGACGAACGAGGTCGGCCCCGCGCACGCGGGGATTCTCCGGTTGTC
GAACATCGAGCCGTACGGGCTCGTCTGTCGTCCCCGCGTGCGCGGGGATCCTCCGGGCTA
CGCGCTCCTCTTCGACCAGGACTTGGGGTCGGCCTCGCGTGCGCGGGGATCCTCTGCTGC
TGGTGGGTGACGGCACGTGTATACACGTGGACCCCGCGCTCGGGGAGCGGTCACTCGGCC
TGTTCCACGCATCACCGTGTCGCCTTACGGGATCGCACGACGCGGGGCCCGGTCCGCGCG
GGCCCGGCGACGTGCGGCCGCCTCGATCTCGGCACCGGTGCGCCGCTCCGCGTCGACGTC
CTCGCGCGCCGAGAGACGGGGCACTTCGTCGGGGAAGGCGTGGTGGGACAGGGCGCGCAT
CGCGGCCGCCTGGCGCTCGCCGGCGCGGCGGTCGGCCTTGAGGACGTCGTGGTCGACGCG
CTGGGCGGGGGCTGCCTGCTGGTGGGCGCGGAGCGCAGGGCGGTATCCGGGCGAGGCGTT
CTCCCGGGTCCGTACGGGCGTGGGTGCGGCGGTGCCTTCGCCGTCGGCAGTGGCCGGGGC
CGGGGTGGGCGCGGGGCCGGTGCTGGGGGCGAGGACCCGTACGGCCCGGACCACGGTGCG
CCCCGCCGCCGTGTTTGCGGCCTCAATGATCTGGGCCTTTCGCAACCGGGTCTCGGTGGC
CCAGACAGCCGAGCTTGGCCGCAGGATCAGGCACCCGCTGGCAGCGTTGTAGCCGACGGC
GGCGACGGATCCGGCGAGGTCGGGTGCGATCGCCGTCCAGCGGTCGCGGAGCGTGGCTCC
GGCGGCGGGGAGTTCCCAGGCGCGCTCGGCGAGCAGCGCTTGGAGGGCGGCGCCGAGCCC
GAGCGGCTCGCGCCCGCCGGGCTCCGGTGCGGGTGGAGCGCGGCGTCGTGCTCGCGGGGC
GGCCGCCGCCGTTCTTCCGCGCGGCCTTCATCGCCGCCCGCAGTGCGACCCGGGCGAGGT
CCGCGCCGGAAGTCTTGTTCTCGGTGCTGCTCATGCGATCCCCCAGGGGCTCGTGGTGAG
GGTGAGGTGGTCGCGGCCGGTCACGCGGTGGACGGTGGCGACGAGCGCGCGGGTGAACAG
CCGCTGCGCGGAGTGCTCGCCGTAGCGGGCGATGTGGTCGAGAACGACCTGGTGGTCGTA
GGTGGCGCGGGCGCGCCAGTCGAGGATCTGCTCGCGAGTCAGCTCCTCCAGCACGAGCTC
GTCGACGACCTCGCGGACCTGTCGCCCGGCAGGCGCCACAGCGGGGGCGGCCGTACGGGA
CGCCAGCACCCGAGCCCGCGGCGCCGGGAGCGCGCCCAGGGCGGGAGCGGTGGGCTCCGG
CTGGTCCTGGCGGGCGGCATCGGCGCGTGCGCGGGCCGCGGCCTGCCGCGCCCGGACCCG
CTCCCACTCCCACTCGCGCGCCCACCCGGCGGCCCTTACGTCCTCGTGCAGCTGCCGCAC
AGTCGCCGCGCGCCGCTCCTCCTCCCCCGCGTACGGGAGCCGCTCCTCGACCTCGGCGGC
GATCCGGCGACGCTGCGCACGGCGATCGACCTGCCGGTCCTCGCACCGCGGGCACGCCTG
CCCGGAGTCGAGCAGGATGCGGTCGTCGCAGCGCACGTCCCCGCACTGCTGGCGCTGCGG
CAACCCCCGCGCGAGCAGCCAGCCCGCCGGATCCCGGATCACGCCGCCCGTACGGATCTG
CTCCCCCAGGCGCCGGAACAGCCGGGCACCGAGGACCTGCGGCGCATCCGTACGGCCCAC
GAGGCCCTGCAGGACGGCGAGCTCGGCGTGCGCGGCCGCCTCGACGACGCGGCGCAGCCC
CGGCCTGGGCAGCTGCGCCCACATCCAGTCCACCGGCTCCAGGACCGCCCGCAGATCCTC
CGGCGGCAGCGGCGCTGGAGCCTGCTTCGGTTGCTGACGGCCTTGAGCGCAGCCCTGAGG
CTCCGGCACCAGGGTCACCGCCGGGCCCGGCCCGCGCTTTTCACTGCTGCTCGACGAGGG
GGACTCCTCACGCTTTTCCCCGCGCAGCGGGCCCTCCTCACGCGCGCTCGCGCGGTCCGG
CGACGGCGGGGTCCCCCCACGGCCTTCGCCGGAAAAACCCGAGGAGTCCTCAACTTGATC
AGCAGGAGTAGCCCCAGAAGCGTGAGAGGCGTGAAGGTGTGCAGCATCGGCGCGGTCTGC
CGAATCAGGCTCCTGGCCCATCCCGGTACCCTGAACCCCAGTAACCACAGGGGACACAGT
CTCAACCGTCGTCTCAAGATCGCCGGATGCAGTAACGGCGAGGTCTGA
>orf00051 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCGCCCTGGCCACCGGCAGCAGCCGGACCCGACTGCGCGCATGCAGACCCGACGCCGT
CTCCCGCCGGTCCACCGACAGCACGCCCTGCTCCTGGAGCCGCTTGAGGCTCTTCGCCCC
GGCCGCCGCCGTGCAGCCCATCAGCCGCGCCACCGTCGCCGCCGGACGGCCCCGCCCGGT
GTCCACGCTGCCCGAGCACAGCTGCAGCCACCCTCTGGAGTTCGACGACAGCACCATCAG
CAGCAGCCCGAGCCGGTCCGTCGCCGCCCCGCGCCCCGTACGCCCCGCGAGCATCCCGGC
CGGGGTTACCCGGCCGTCCCGGTGTTCCCAGCCCGGCGCGAACAGCACCTCGATCAGCGC
TAG
>orf00053 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCCCCATCCGCCACTGCGCGTACAGGAACAGACGGCACCGCACCACAAATCGCATAGG
GGCACCGTTCACTCCGGCGCACATCCGCGATGA
>orf00054 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGGAGGGCATCCGCTACGAACCCGGCACTCTCGCCTACGTCGTCCATGTCCCGGAGGGC
GAACCACTGGTCCGCGTGTTCTATGAGCTCTACGCGAGCTACGACGCGTTTCAGATCCAC
GAGGCGCAGCCCCATACGCAGCGGATGCTCAGCGAGCGAGAGCAGTACCTCGACGGCAGC
GAGGTCACGTTTCTCAACGAGCTGATGGGCAAGCGCCCGACGGAGACGACATGA
>orf00055 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGATTCGCCGGGCTCCGGCCCACGTACGCCCCGGTGTCCAACCACCGGGGCGTTCGTCG
TTGTGGGGGCCGGGCGTTGGCGTAGAGCGTGATCCGTCGCGCTCTCCGCTCGCTCACCGA
CCAGCCCCGTCTGGGCCGTGCGGTGAGCGACGGGGCGCGCGAGGATCAGGCCGCCAGCAC
CTCGGACTCCGCGAACGACACGACGACGGTGCGGTCGATCCGCAGCTGCCGCGCGGCGGG
GATGAGGATGTCGACGAGGCGCTCGCGGACCCGCTCGGTGACGGTCGGATCGGCGGCGAG
GATGTCCCGCGCCGCATCCCGCCGCGCCCCGGAGGCCGCAACAACCTCCTCGCGCGCCCG
GGCCCGGCCTTTCTTCACCACGGAGACGGCGTCCCATCGGGCCAGCTCGTCTGCGGTCAC
CAGGTCGTACATCTCCAGCGGCGTGCCGAAGGCGACGTCCAGGTCCAGGTCGCCGAACGC
GGGGAGCGGCACCTCGACCGCCTCCAGGAGCGCGAGCGTCTCCGTGTCGAACTCAGTCAG
CGGGTCGGTAGCGGACATCGGTATCTCCATGGGGGTCTGGGGGGCTCCCGTGTGGGGGAG
CGCGAGGGCCCCGGGCTGCGAGGTGCAGCTCCGGGGCCCGGAGGGTGTGGATGGTGGTGC
GGGTCATGCGGCGGCGAGCGGGGACCTGCGGCAGCGGGTGATGTACGCGGCGACGGTCTC
GCCCGGGACTGGCGCGGGCAGCGCGGCCCTGACCGCAGCGATGAGCGCGGTGTGTGCGGG
CTGGTCGGCCGGGGTCAGGGGGCGGCGCCAGAGGGTGGCCAGGTGCAGGTACGCGGCGCG
GGTGAGGTGCTCGGCGAGCCCGTCGCCCGCGAGCCGGTCCTGGCGGGCGTCGGCCAGAGC
GCGCAGGGTGCCGGTGGCCAGGGCGCGGACGGAACGGCGGTCCCCGGCACTCTGGCGGCG
CAGGGCCGGCGGGGCGCCGGCGGGGCCGTCGACGGCCCGGCCGCGAGTGGTGGGGAGCGC
GTCGGCGGGGACCGCGCGGGCGGCGTCGGCCTGGCGGGCGGCGGGCACCGCGCGCTCCCA
CTGCGCGCGCCGGTCGGCAGGCCGCTGCTGGGGCCGGGCGACTTTGAGGGTCTGGACGGT
GGCTCGGCGGTGGCGGGTGAGGTCGACGGCGAGACGCTCCTCGCGCGCCCACTCGTCGTA
CTGGCGGCGCCACATGGAGTCGGTGAGGTCCACGTCGACGAGGCGGTTGCTGGAGCGGCA
GCGGATCGCGGCGTCGACGCCAGCACGACCGGTGTGGTGCGGGACGAGCTTGAGGAGGTA
GGTACCCCGGTGCGGGGTCACGGCCACCCAGGTGCGGCAGTCCGGGCACACCAGCGAGAT
ACGGCGGGCCTGCGTGGCCTCCACCCTGCGCATGTCGATGTGACCGGGCGACAGGGTCGA
GACGACGATCGCGTCCAGGGGGCTGACGCGGGAGGTACGGGTGCGGCCCCGGCGCGTACG
GGCCGTGGGCATGGCGAGCTCGGGCATGGCGACTCCTCGGCAGGAGAAGGGAGGGGGATT
CGCGGGGCGGGTGCTCTCTCCGCCCACCAGGTCCACGAGCCAGCGGCCCACGTCCTGGCG
GACAGACAGCGCATCAGCGCTGAGGTCATACAGCAGTCCTGCCAGCCAGGGGGTTTGGTG
GTGCTACCGCCTCCGGCCACCTGCCCGACTCCGAAGAGACGAGCCGCAGAAACTGCGGTG
GCGACACGACCGACGCTACGCACACTTTTCGTGCTAGTCAATACTTCAGTGCTAGGCAGT
GTCTTCAAATGA
>orf00056 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGGGGCGGGCGGGCTCGGTCGGCGGCTGCGGCTGACGGCCCCCGGTCTCGTGCGGCTG
CGGGCGGGTCGGGAGCGGGTCGCGCTGGACGCGCGGCGAGCGGGGCAGGGTAGCGTTCGG
CATGCGAACTCCATCTCGTGA
>orf00057 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCGCACCGATGTTCAACTGGGCGAGGCCCGCATTCAGGCGGAGGTCGACAAGATCCGT
GGCGAGGGTCGCCTGAAGATCGCCCGGGCTGAAGCGGAACGCGAGGCTCAGGCGGAGATT
CAGGCCGCCGAGGCCGATGCTCAACTGCGTGAGGCGCAGCGTCAGCACGCGCTCAAGCTC
GCGGAGGACCAGGCTGCGGCCGAAGCGCAGGAGCTCGCCGACGAGACCGAGAAGCGGCGC
ACGCTCTCCCGGATCGACCGGGAGAAGGTGCAGGCCAGTTGGGGTCTGGAGCAGAAGCAG
ATGGCCACCGAGGCCACCGAGCGCGAGCGCCGTATCCAGGCCGATGCCGCCGCCCGCGCC
CAGCGCGAGGAGATCACACGGCAGGCCGGCATCGCGGAGCAGGCGGAGCGGCGCGCGCGG
GCGCTCGCCGGGGAGAGGGCGGCCCTGGAAGAGGCCGCTGAACGCGAGAGGAAGGAGGCT
GAACATCGCGCCGCGACGGTGAACACGATCTTGGAGGCGCAGCGCGGAGCCGAGTCGATC
GCCGTGTCGAAGGCCCGCGAGCAGGCCGCGATCGAGGACGCCGCCGCCCGCAAGGCGCGT
GCGGCTGAACACGAGGCGGCGGCGGTTGAAGCCGCGGCGCGCGCCCGCATGACCCAGGTC
GACTGGGATGTGCAGCGGGTCTCCGCGATGATCCAGGCCCGGGGCGATAGCGCGGTCACC
GTCCGCGTCATCGCTGACGAGCTGGGCATCTCCACCGGCTCCGCGCAGGACCGCAAGACC
AAGGCGCTCGCCCTGCTCAGGGGCGAGTCCACCGGCGATCTCGAGCGGGCTGCGGCCTGA
>orf00058 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGAACATCGGTGCGCACGCGCTGAATCTCAGCCTCAGCACGCTGAACAGCGGCCCGCGC
CGCCCGCTGGAGGCGCTTGGTCTCTTCCTCCAGCGGGACCCCGAGAGCGCGCTCCACGCT
GAACCCGAACGGGGCCAGCTTGAACGGCAGCAGCTCGTCCGGCGTCGCCGCCCGGCGCCA
GCTCTGCTCGTGGTTCTCGTACTTCTGGCGCAGGCCCTCGCGGTAGATCCGCAACGCCTG
GTGCTGGGCGGCGACCTCCTTGTAGGGGAGGTTGTACAACCGCATCCGACGGGCCAGGCG
CGGCGTGGACAGCGGGGCGAGGATCCAGCGGGTCAGCGGGACCGACCCGAGCGGGGTCTC
ACCGGCGAGCAGGTCGGCCATCCGGCCGATGTAGTGGCGAGCGGCCTCCACGGCGATGAT
GAACAGCACCGGGATGACGCCGTGCATGGACGCAGCGAGCGGGTCCTCGGTCACCGGGCC
GGCGGCGGCCGCGTTGAAAGCGACGGTCGCGACGGTCAGGCCGTGCGCGGTCCAGCGAAG
GATCGGCCACGGCATCCGCTTGCGCATCATGTACAGATCGAGCGCGAGCAGCACGAGGAT
GCCGGCGTCGATACCGACGGGGAAGGCGTAGGAGAAAGTCCCGAAGCCCTTGCTCTCCGC
GAGGTGGCGCAGCGTGTTGTAGGAGCCGGTGAAACCGATCCCGGCGAGGACCAGGCCGCC
GACGCCAGCGACGACGGCGAGCAGCCGCATGGTGCGCGGGTCGTCGTCCCGGTCGTCCTG
GTCGTGCTGCTGGGAGCCGGGCTGCTCCTGGTCGTGATCGGTGTGGTCGGCCGGGGCCGG
GACGGGCCAGGAGTGCTGGTCGTCGTCGTCCGGGCGGACCGTTTCGGGCTTGCGGATATC
GACGGCGGTCATGTACTGCTCTCCGGGTCATCAGCGGGGAAGAACGGGTCCAGGGCCAGG
CCGACGCACAGCCGGACCGCGCCGAACACGGCGAGGCCGACGGCGAGATGCAGCAGGGTG
GGCCACAGGCCGTTCACGAAGAGGTCGAACAGGGCGAGGACGGTGGAGATCACCGCGATG
ACCGTGGCCAGCAGAGCGGGCAGCGGGTTGCGCGGGACGAAGACGTCGTCCGTCATCTTG
CTCGGGGTCGGGGTGGCCGTCGTGGTACTCATCGGGCACCCCCACTGGTAG
>orf00062 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGAGGAGATTCGTCGTGGCAGACACCGCGACCGCGACCCCTGAAACCACCGCCGACACC
ACCGGCGACGGGGCCACGGACACCGCCGAATACACCGTCGTCACCGAGCCCGAGACCACC
ACCGACACGGCCTCGGACAAGCCGAAAGCCAACCGGTCGCGGCCGAGGGCGATGCCGCTG
CTGATCCACGGCGGCAACGCAACCGGAATCGCCGCAGGCGTCGCCTACGGACTCGCCGGA
GTGCCCGGTCTCATCGCCGCCGGCGCGGCCGGAGCCGCGGTCGGCGCCGCCGCGCTGGCG
GGCCGCAAGAAGCGCTCGAAGGTCTCCGCCGCCCGCACGAACGCCGCGAGCAACCGCTCC
GGCGGCGGGACGCACCGCTCCGGAGGTGGCGCGGGCAAGGGCGGCCTGCTCGGACGCGGC
GGCGGTCGCGGCCGGGGCGGCGGCGGTGCTGCTGGTGGCGGCGGCCGCGGGCCCGGGCGC
GGTGGCAAGGGCGGCGGCTGGCTGAACGGCTCCGGGTCAGGGGGCGGTGGGACCGGCACG
AAGAACCGGCCCGGCGGCGGCAAGCACGGCGCCGGTGGCGGCGGGCGCGGCCCGGGAGGA
ACGGGCGGCGGCAAGCACGGCCGCGGCGGCGGCCTGGGCGGACTGCTCGGAGGTGGCAGG
AACCGGCGCGGTCCCGGCGGTCCCAACTCGCCCGGCGCGAACACCCCGAAGGGCACCGGG
AACGGCAAGAACAACGGGGGAGGCAAGAACGGTCCCGGCGGGAAGGCCGGCGCCCACCAG
CAGTCTCGCACCGGCAAGGCCTGGCAGACCCTCAAGGGCTGGGGCAACAAGATGCGCCGC
AACAACGGCGGCACCTCGAGCTCCGGCGGCTCCGGATCCTCCGGTTCGGGCGGCGGCTCC
AGCTCGGGCACCTCCGGCTCCGGCACGAAGACCATCACGCCCGCCAAGACCCGCCTCGGT
CGCGCCCTGCAGAAGATGCGCGGCCTCGCGAGCAAGCTCCGCCGCTCCAAGAAGAAGAGC
GGCTCCACCAGCTCCGGTGGAAGCGGCCCGACCTCGGGCCGCTTCCACCGGATGCGCCGC
CTAGCCGCCCGCAAGCTCGGGCACTGGCTGCGCTGCGCAGGCGCCGGACTCCTCGCCGGA
CTCGGAGGGCTGGCAACGCTGCCCCTCGGACTCCTGTGGGGACTGGCCCTGCTGCCGTTC
AAGCGCCGCGACCCGCTCCACGGGTTCGCGCTGCCCGTCCGTGTCGCCGGACGGATCTGG
CGGTTCTTCTTCCGCCGCTCCAAGGCCCGCCACGACAAGAGCGCCAAGGCGGACACGCTC
AACCTCAAGGTCAACAACCCCAGGAAGGACACCGATCCCGTGACCGGACCCTCGCTCGCT
GCTGGCACCACGGTGCTGGACGGCAACAGCTCCAAGTTCGCGATGGCCATGCGCGCCGCG
CACGCCTCCTACACCGGCTACAGCCCGCGCAGCATGATGGAGGTCGCTGCCGAGTACGCC
GGCCTGCCCAACGGCATCCGCGCCGCGGCCCTGGCGGTCCAGCAGATGGCCGTCAACGCC
GACCAGAAGTACCCGTGCAGCAAGAAGGCGCTCGCCAAGCTGAGCGAGGCCTGCGCCAAG
CTGGTCGCCGCCGCCGCTCGCGCGGACGGCATGGTCGCCTTCTTCCGCATGGTCCACGCC
TTCGACATCGAGCGGATCGTCGCCCCGAGGACGAACGAGTGGATGTGGAACGTCACCCCG
ACCGGCTCCGACGCCGCTGAGGGCGCGATGTTCATGCCCGGCCGCATCGAGTCCGGGTGC
GTCCTGATGGCCGTGCTCTACCGCACCTTCGAGCCGGTCCACATGATGCAGGTCGGCTCC
GAGTTCCAGGGCATCGCCTACGGGCTCACCGCCCTGGCCGACTGCGTCCAGGCCCTCTAC
GAGCGCACCATTGCCCTCTACCCGGTCGACGACCGCGTCACCGACGAGATCGGCAAGCTC
GTCTCGATGATCCGGGCCGCGTCCGACGACGCGGACATGGCCGCGAAGCTGTTCGTGGAG
GACCACAGCCGCGAGATCAGCCACAACACCAGCCCCCGCAAGGGCCCGGCTGCCGAGTCC
ATGTGGAACACCCCCCGCTGA
>orf00065 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
ATGTCGATGCGTCACTGGGACTGGTCGCTGCCCAGCGGCCACACCACCTTCCTCGGATAC
GCCACCGAGACCGCCATGACCACCGTCGCGCTCGCCCCGCTCACCGGCCTGCCCTGGCAG
GCTGCCGCCCTCACCCTGGGCAGCGCGGCCGCCGCCGGCACCGTCCACGACCTGCGCGTG
AGCACCACCCTGGGCACGCTCACCACCCGTGCCGTCTCCTGGCTGACCGCGTCCGCATGG
GCGTCCTGGGCGCTGGCGACCGCGCCGCTGACCACCACCGGCTGGGCGAGCGGCCTGGGC
CTGGCCACCGTCGGCCTCGCCGCCAACGCCTCCGCCAACCGCACCGAGAACACCCGCTCC
GAGCGCAAGAAGCTCCTCAAGCTCCGCCGCAAGTCGGTCGGCATCCTCCTGGACTGGGAA
GACCGCATGAAGCGCGTCGCCCGCATCGAGGACTGCCACGGCAAGGACGTGCAGCACTGG
CCCGGCGAAGTCGGCTACACCGTGGAGATGGACCTGCCCGCCGGCGGCACCAACGTCGAC
GACCTCAACGGCTACGGCCCGAAGTTCGCCAGCGACCTGCGCCTGCCCGACGGCTGCGGA
GTCGAGCTGTTCCCCGGTGCCAACCGCGGCACCATCCTGATCGAGGTCACCCTCAAGGAC
GTCATCACCGCCGACATCCCTTACCCCGAGGACTACTCCGAGATCAGCCTCACCGAGCGG
TTCCCGTTCGGCGTGTACCGCAACGGCGAGCCCGCGCTCGGCAGCCTCTGCAACGACTGC
GGGATCCTCGTGGGCGAGACCGACGCGGGCAAGACCAACACCCTGCGCGTCGTCACCGCC
CAGCTCGCCCGCATGCCCGACGCGCTGATCTGGGCGATCGACACCACCGGCGGCGGCGTC
GCCCTCCCCTGGATCACTCCGTGGGCCACCGAGGGCATCGCGTCCGCGCCGATCGTCGAC
TGGATCGCGCACACCGAGGACGAAGCCCGCCTCATGCTCAAGATGGCCGCCGAGATCATC
GCCGCGCGCAAGGCCGGCTACCAGCAGCTGATGCGCGAGAGGAAGACCGACAACAAGCTG
CCGATCAGCGCGGAGATCCCCGGCATCGTCATCATCACCGACGAGACCGCCTCCCTGCCG
TACGACATCAAGGAGATGATCGACAAGGTCGAGCAGGAGGGCCGCGCGATGCGCGTGCGC
GCACTCGTGGCCGCCCTGCGCGCCACGCAGGACGCCATCACCGCGATGATGAAGCTGATG
TCGAAGTGGCGGGTCGGCATGACCGTCTCCGACGCCGAAGAGCTCGCCTACCTCTTCCCC
GGCTACATCAAGATCGACCCGAAGGACGCGCCCGTCGCAGGGTCCGGGTGGAACATGCAC
ACCCGCCTCGGACCGAAGAAGCCGACCGCGATGAAGGTATGGCGCCTGGTCGACGAGCTG
ATGGACACCATCTGCCAGGCCACGGCCGGGCGACGGCCCAAGCTCGATGAGCTGTCTGCC
GCGGTGGACAGCGGCGAGCACTACCCGCAGCGGTGGGCGCGCACCCTGCCCGACCTGTAC
AAGGGGCAGAAGCTCACCGAGTCCGCGCAGTACGCCGTCGACAACGCCGGTGAGATCATC
GCCGCCGCGACGCTGCTCGCCTCCGACCCGGTGCCGCAGGGCAGCAGCATGGCGTCGCCC
GCTCCGGTGGTGCCGGCCGGGTTCGAGGGGTTCGGCGGTGCAGAGGAGCTGTTCGCAGCC
GTCACCGCACAGCTGGACCCGAACGCCGCGCACCTCGCCGTCCCCACGGCTCCGGCCCCC
ACGCCGGCCGCCGCGCCGACGGCACCGGCCCCGCTCCCCCGCCCTGCCCGCCCGGTCGAT
CCGCGCGAGCTGGGCTGGGAGCTCCTGGCCGCCGCCGGGGCGACCGGCTACACGCCCAAG
CTCCTGCACGAAGCCCTCGCGGCGGAGATGGACCGGCGGAAGGTGGGCGACGCCCCGGCA
CAGCGCACGGTCGGCGGCTGGCTCCAGGCGTGGGCGAAGGACGGCAAGGCCATCAAGGAC
GACTCCGGGCAGTACACCCGCTACGTCGCCCGCGAAGCCGCGGTCGGCCCGGCCGTCTCC
GGCCCGGCCACCCCGGCCGGGTCGGAGACGGCACCCCTGCCCGAGGGTCTGGACGCGGCC
CTGGTCCTCCAGGCCGTGGACTTGGTCGTCTCCACGCAGTTCGGGTCGGCGTCGATGCTC
CAACGCAAGCTGCGCATCGGCTTCGCCCCCGTCCAGAACCTGATGGACTTCCTCCACCAG
CTGGGCATCGTCGGCCCGTCCGACGGCTCAAAGGCACGCGAAATCCTGGTCTCGACGGCA
GACTTGGACGCGACCATGATGAGGATCGCCGACGAACTCGGCTACACCACGCGCGACTTG
GGCGCGATGGGCCTCGCGGCGGCTGCCGCTTCGCATGCCAAGGAGTGA
>orf00066 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCGCGGCGGCCTGCTGGTACTGCGCGCGGATGTGGTTCAGTGCCTCTTCCCGGCGGAC
CAGGTCGTAGACCCGGGCCATGTACGCCTCGTCGGTGGGCAGGCCGACGGCGGTGTGCGG
GGTGGGGGCGGGCAGGCCGCCGGCGCCGGGTCGGGCGTCGGGGAACAGCTCCCAGATCTT
TTCCAGGCCCTCGTAGGGGAGTGCGACGGCGGGCGGGGCGGGGGTCTGGTCGGTGAGGGT
GAGGTCGCGGGGTTCCACGGCGGGCTCCTTGCGGGGGACAGGTGGTGCGGGAACGCGAAG
GACCCGCCCTGCCGGGTGGCGGGGCGGGTCCGTGGTGGCCCGGGCGGGCCGTGA
>orf00067 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGGCTTTGACGGCGTTGGACAGCGCGTCCCACCACCGGCGGGCGTAGCGGTCGGCGGC
CTCGCGCTCGCGCTGCTTGTTCTCGAGGCGCAGGAGCCGGGCCTGGAGGGTGGGGCAGGT
GCAGTCGGCGTCCGGGTCCTGGAGGCGGGCCATGCAGCCGGGCATCAGGCACAGGTCGCC
GTCCGGGTCGGTCCACCAGTAGCAGCCGGACGGGACGGTGCCGGGCGTGGTCGCGGCGGG
ATGGTCGCGGTCACCGGGCGGCACCGTCAGGCCTCCGGGAGCTGGCGGGCGGAGTAG
>orf00068 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCAGCTGCTCGCGCTCAGCGCGGCGGCGCGCGCTGTCGTCGAGGAGGGTGGCGAGGTC
GGTGAGCTCGGTGTCGGTCAGGCGGATCTCGTCGACTGTGCTGGTGCCGTCGTGGACGCG
GAGCAGCGCTGTCCAGTCCCCGGTGAGGAGGGTGGGCGGGGCGGCGTCGTCGAGGGCGTC
CCAGAGCAGGTCGGCGTCCGCGCTCTCCCCGGTGGTGTCGAGGCCGCAGTCCTCGGCGAG
CTGGAGGATGTCGGGGGCGGCCAGGGGCAGGTAGGCGAGGTGGCTCCCGTCGGGCGCGAG
GAGGACGACCCAGCCGCGTGGCGGGTTGGTGTCCGTGACAGTGCTGCGCTCGCGCAGCAC
TGTGATCAGGCGGTCGAGGGCGTTCATCAGAAGGTCGGGTCCTTCCTTGCGGTCTGCTCG
GCGTGCAGGGTGACGACGTGGAGCCACTCGGCGCTCAGGCGCAGATCGCCGAGGACGAGT
CGGGTGGCCTCGGTGAGCGCGAGCCGCTCGGCGGGGGTGAGCCGGTCCCACAGCGCGTGC
GCGTGCTGGTGA
>orf00069 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGTGGGTCGCGGAACGGGCGCAGGTCCAGGGTGATGTCCGCGTCCTGGGGGCGGGGGCC
GTGGAGGTGCCCGAAGGAGGTGATGTGTACGCGCACGAGACGCTCCTTGCTTGTTGA
>orf00074 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGGGCGAGGGCGTGGGCGGTGAGCTCGCAGCTGGGGCGCCACAGGCCGAGGCGGCCGAG
CGCGGGGATCGGCTCCAGGAGCGGGGTGACGTCGGTGAGGGTGAGGTGCCACGCCTCCGG
GTCGGCCCACGCCGAACAGGCGCGGCCGGGCTCGTCCTGGTGGCAGTCGGTCAGGCGCGC
GACGGCCAGGACGGCGCCGAACTCCAGCGGCTGTCGGGGGAAGGTGCAGGTGACGCGGGG
GTCGGTGAGCGCCTGGTGGTCGGTGCCGCGGCCGGCGTGGATGAGGAACCATCCGCGCCA
CCACCAGGGCCGGGTGCGGTTCTCTACCCTCTTCGAGCCGTGGGCGATACAGGAGGCCCA
GGGCTGGCGGACGGTGAGCGCGCGCAGCCCGTCGCCGCGCGGCGGTGTGCTGGTCATGCG
GCCTGCCCCCACACGCTGGTGCCGGGACGGCCCATCCTGCGCCCGTTGATGGAGGGGACG
CGGGTGTGCGCGGTGGTCGCGAGGACGGCGCGGCCGGTGTGCTTGCCGTCGTAG
>orf00075 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGGGGAGGCCGAGGGCGTCGAGGAGGAGGACGAGGTCCTCCTTGCCGTGGGCGTGGCG
GGCGACGGTGCGGGCGGCGGCTGCTTCGGTGTCGGGGCTGGGTGGGGTGAGTTCGAGGGC
TTCGGCGGTCTGGGCGGGGTTCAGGTCGGCGTACACGGCGCTCACTTCGCGCTGAGCTCG
TGCTGGAGGCGTTCGCGGTTGTGGCGCTGCTGCTCGGGGGTGAGCTTGCGGGTGCGCGGG
CGGGGCGTGGTGGTGTGGTGCCAGGTGGAGGTGGCGGGGGGTTCGGGGTAG
>orf00076 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCCGCTCGAGGACGGCTGTGGTGACGGCGGCCGGGTCGGACAGTTCCGGCGCGGTCTC
CAGCACGGCGAGCTCGGTGACGTCCAGCCGCATCGGCTCGTCCGGCGTGCGGGGCAGCCG
GAGGTGGCCGGTGACGCGGAGCTTGTCGCCGGGGACCAGGTCGTGGATGACGGTGTGCGC
GAGCGCCGGGTCGGTGACGCTGCAGGGAAGGATCATCTCGTCCGTGCGCTCGTCCGTGGG
GGAGACGGTGAGGCGGAACCGCGCCGTCGATCCGTGCAGGTCGCCGGGCACGGTCTCCTC
GTCCAGGGCTATCGCGTCGTCGGTCATGGTCAGCCGGCCTTCCGGACCGGCGCCCGGTGC
GCGGTGTCGTACGCCTGA
>orf00077 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGCCACCCGGCAGCGCCCAGGCGCCCTCGAAGGGCGGCCAGTCGCGCTCGATCAGCAG
GACGTTGCCGTCGGGAGTCAGGGCGACCACGTCGGCGGTGTAGCGGGTGGTCTCGGTCTC
GGTCATGAGTACCTCTCGGTGAAGTGGATCAGTGGGTAG
>orf00078 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGTCATGCGAGCTCCCGGGCGAGGGCGCGCATGGCGACGGACTGTGTGCAGGTGGGGGA
GTAGGACAGGAGCGGTTGTTGCATGCGTACGGCTTCCTTCTGCTCCTTGAGGTCGCCGAC
GAGGCCGACGACGCGGGGGTCCTTTATGTCGACCCAGCCCTGGAGGGAGCTGGTGGCGAT
GTAGCCGCGGCGGGCGTCGTAGAGGTTGACGACGATGCCGAGGTAATCGATGACGACGTC
GAGGTCGCTGCGGAGGTCGTCGATCTGGGTGGTGAGCATGTCGTAGGCGTCGGCGGAGCT
GTCTTCGGCCTGGACGACGATGAGGGTGCCTGA
>orf00079 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCTTGGTGAGGCTGTCGCCGTCGAGGGGGAGGGGCTCGGCGCCGAGCTGGCGGGTGAG
GTGGCATTGGGGGTCGAAGTCGATCAGGAGGACGCGCAAGCCGAGGCCGGGGAGGTTTTC
TACCTCGAGCGCGTCGCTGCTGCCGTCAGTTTCCGGTGA
>orf00080 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCGCGGCGTACTGCTGGGCGAGGGCGTAGACCTCGGAGAGGACCACGGCGGCGCGGCG
CTTCTCGGGGCCCTCGGCGGCGCGCATCGTGGCGTGCCCGGTGCGGATGAGATCGGGAAG
TACGGCTGCGACAGCGGTGCGCTGCTCGCGCACTCCGTGCCAGATCGCCCACGTCCGGGC
GACCCGCCCGGCGAGGACACCGACGTCCTCGGGCTCCTCCTGAACGAAGAGCGGCGCGTG
CACCGCGGCTCGCAGCTCTTCGACGCCGGGGTGGGCGAGGCGCCCGCCGGTCGCCACGGG
CATGGACGTCTGCCCGCCCGTCAGCTCCGCGACGTCGGTCAGGCCCAGGACGCGGCACAG
GCGGTAGAGCGTCGGCAGCCTGTCCTCGGTGCGCTGCCCCGTCTCCACCCTCTTCACCCA
GTCGGGGCCCACGCCGAGGAGGGAGGCGAGCTGCGGGCGCGTCAGGTGCCGGGCTTCGCG
CGCGCGCCGCAGCCGCGCGCCGTCCACGCACAGGGTCTCTTCGGTCGGGCCGTCCATGAG
GGGCCCCCTTCCGCTCTTCTTCTCTGTACCCGCAGCGTAGCCACGCGCACCCCGGCCCCG
GACCGAATTGCCCAGCAGGGGCGGGGGTTGGGCCGTGCCGAGGTGGTGGGCGCGCCCGTT
GAGGAGGTGGTGAGAGGAGCGGGGATGAGCGAGCTGCCGAGCGTGTGGGACCTTCTGGGG
CGTCTGGGCCTGGCGGGCGGGGTGGTGGTGGGGGTGGTCGGCGCCGTCGTCCTGTCGCTC
GTGATCGTGCCCGCCGAGGACTTCAACCGCGGTTTCGAGACGGGCGTGCGGGCAGTGGTG
CGGTACCTGTCCGGCCGCGAGCTGGGCAGCGGGACCGCACCAGGTGACGCGACGTGGTGG
CGTCCGGCGACGAACGAGGCCCCGGCGCCGCCCCCGAGGGCCCGGCCCCTGCGGGCGGCT
GCGACGGCGGTGAAGCGGTGCGCGGTACGCGCGAGGACGTCGGGAGTTCGGTACGGGCGG
CGGGTGCGGGGACGGGTGCGCGAGCGGTTCCCGGACGTGCTGCGGGCGGCGGGGCGCGGG
GTGAGGTCGGCGGCGGGAGCGGGCCGGGCCGCGCGGTCCCTCGCGCAGTGGCCGGCACTC
GGACGGGCCGTCGCCCGGACGCTCGCGCGGAGCGGACCGGCGGCATGGGCCGCAACGGCG
GCGGCCGGGGCGGCGTGCGGGCGCGGGGCGGGCCGGGCCGGGCGGTGGACGGTGCGGGCC
GGGCGGGCGGCGTACGCGGCGGCGGTGCGGTCGGGACGTGCCGCAGGGCGGGTGGTGAGC
GGCGCGGCCGTGGGAGTGGTGCGGGTGCTGCGGGCGTGGGGGCGGTGGCCGTACGCGGCG
CGCGCGGCCGTACGGATCGCGCCGGGGGTGCTGGCGTGGGGGGTGCTCGCGGCGCCGGGG
ACGACCCGCGCCGTGGTCCTGGTGCTCCTCGGCGCCGTCGTGCTCGCAGCGCTGAGCGGG
CCGTCAGGGGCCCGGTGGTGGTGTGTGCCCCCGGCACGGGAACGGCGCGCCTAA
>orf00084 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGCGGTGGGCGTTGCCGAGCGAGGGAAACGGGCACTCAGGCGGCGAAGCCGATGTTGGT
GACGTACTCGTACTGACCCCACTGCGAACCGAGGTCGACCACCACCTCGTCGACCCACGC
GGCATCCAGGCCCGCGTCGTCCCCGGCCTCCCACGCGCCGACGATCCGCTCCCACTTGCG
CACGTTGAGGGTGCGGTACTCCACGACCCGCTGGCGAGGGCGTTCCACCCCGGATTGATT
GACGGGGTGGAACTCGACGCGGGTCCCCCGGCCCTGCCGGTTGAGGCGGGCCAGGAGGTG
CCGGGAGACGTTCTGACGACGCACCGCGCGGTAAGTGGCGTCGATCTCGCGGAGCGTACG
GGCGGAGGGGCGGCGTGTGCCCTGCATCTGCGCCTTGATCGTGCGGTCCGAGATCGTGAG
CCCGGCCTCCCGGGCGGCGGCGAGCTGGCGGGCACTGCTCGTGAGGTAGCGCAGCCGCGC
GGTCAGGCCACGGCGGGTGGTGACCGGGGACGCGATGAACCCGGCGAGGCTGTCGAGGCG
GCGGGCGACGAACTCGTGGCCCTTGACGCCCTGGGCGCCGTACGCGCCGAACTCGATGTT
CCGCTCAGGCATCCCGTCCCCTCCCGTACGTTGCCGAATTACGGCACCTTGCCAGTATAT
CCCCTGTTTTGTATGGGAGTTGACGCGGTAGCGGCCTCCCCGTACCGGCGGCTGCGGTAC
GGGGAGGCCGGGTGCCCGCGCGCTTCCTGCGGGGGTCAGGGGCGCGGGCCGTCCTGGAGG
GAGAGCCGCCACGCGAGGGGGAGGTACACGTCGAGCGCGGCCCGGGGGGACATGCGGAGG
GTGGTGCCGTCCACGCAGCGCACTTCGAGCCGGGGAGCGGTGGAGGCGCGGGGGGCGGGC
AGCCGGGGCGCCTGCGCGGCGACGCGGGTGACGCCCCCGTACCGCAGGCAGTGCCCGTCG
CGGAGCAGGACGGCGGGCAGGGGCCAGAACTCCCGGGCCGCGCCGGGGGGCTCGGCGGCG
TCGGCGCGCAGGACCGGGGCGGCGTCGGCGGTGCGGGTGAGGACGTCCGCGAGGCTCACC
GCGACGCCGGAGGCGGCACCGCCGAGCGCGACCATGGCGGTGCCCATGGCAGCGGGGCGC
TCGGCGCCCAGAGAGGGCAGCCGCAGGCCCACCCGGTCCAGAGCGGTACGCAGCGCGGTC
ACGGCGTCGGCCGCGTCCTCCTCTTCGCCCGGCTCCGCGCGGTCGGCGCGCAGGTCGGGG
AGGACGGCGGCGGCGTGGGTGAGGACGGCGGCGAGGCGCAGGGCCGTGATGGCGGGGGCG
CGGCCGAGGGTGACCATCGCGGTGCGGCCGGTGGGGAGGTCGCCGCGCAGCTCGGGGAGG
GTGATGCCGAGGCGGGCGGCGGCCTCGCGCAGCCCTGCTGCCGCGCCGTCGCCCGCCCGG
CGGCCGGTGAGAGCGTCGAGGACGCTGTCCGCCTCTGTGGTCGTGCGGGTCATGGGGTCG
CCTCCCGGGTCAGGGTGTCCAGGTCGGGGAGGGGCACGATCCACTCGCGCCCTCCCCCGC
GTGCGGGCCGCAGGAACACCACGACGACCTCCCCCTCCTTGTGCCACTCCTTCGTCACGG
CGACGGGCAGCCAGCGCTCCCCGTCGGCGTCGAGGCGGGGGCGGCGCAGCGCGCGCGGGA
GATCGGTGTAGTACTCCAGGTTCGGCACCTTCTCAGCGTGAGAGCCCGTCACCCGCCACA
GGGGGCCATTTCGGCCCCCCTACCCGAGGGGGCCGAAATGGCCCCCTGTGGCGGTCCTCG
CCCGGTACGCCGAGGACCGGGCGATGCCGCGCGGCGCCGTCTACTCGACGGGCACGCCGA
CGAGTGAGGCGACCTCGTGCGCGGCCCGGCGTAGGGGCGCGGGGGCGGTACGAGCGAGGT
CCTCGGCGAGCGCGCGCCCGGCGGGGACGTAGCGCACCGCCTCCGGCGAGGTCGCCACCG
CGAGACGCAGGTACGTCAGGGCGGCGGCGACCTGGCGCCGCGCGCGCTCGCCGCGCGCGG
CGTCGAGGTACAAGCGGGAGCGGCGCTCGACGCTCGGGATCGTCTCCGGGTCCACCTCGG
TCATGCGCTGGAGCGCGGTGCCGTGGGCGCCGAGGTCGGCGGCGATGCTCACCCCGTGCA
CGGCGACATTGCCCTCGCCGAACGCCGTCCACGGGTGCATGTACGCGGTGCCGAGGCGGG
CAGCGGCGCGGTCGGCCTTGTCCCACCAGTGCCACGCGTCGCCCTCGCGGCGCTCCTGGG
CGGCGCTGA
>orf00085 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGCGGCCAGTGGTCGCGGTCCGCGACGCCGGTGTGCCACTGGAAGACGGCGTCGAGACG
GTCGGTGCCAGCGCCGGAGTCGTCTTCGCTGGTCCACCACTGTGCGGGCGCAATGTCGCG
GGCGGCGAGCGCGTCGGCGACAGCGGCCATGTACTCGTTGTGCGGTAG
>orf00086 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGTCGCCCATCTGGATGGGGTCGATCTCAGAGGCGTCGACGAACGCCTCGATCTCCAGG
GCGCGCGCGGTGGGGAGGGGGAGGTCGTCGAAGTCGGAGTCCGAGAGCGGGACCACGGTG
TCCTTCGAGACCTCGTACCCGCGCGCGATCTCGTCGGCCGACAGCTCCTTGCCGTCGAGT
TCGCACACCTTCCGGTTGCGGACGAGGCCGTCGTCGGCGGTGTGGATCTGCCGGAAGTGG
ATGCTGTGGTCGCCGACGGCGGGGAGCATTTTCACGGGGATCGTGACCAGGCCGAAGCTC
ACGGCGCCGGACCAGGCGGGACGGACCACGACTACCTCCAGGCCCCCCGGGAGCGGATGC
GATCAGCGTAGGAGGGGTGGGGGGCGGCGGCATCCGGGGCCGGACCCGGCTGCCGCCGGT
CAGCCCAGGCGGCAGGTGCGCCAGTGCAGGCCCGTACGGACGAGGGCGCCGCTCTCCTCC
AGGGCCTTCAGGTGGTGGGCGATGGTGGCGAGCGCGAGCCCGGTGACGCGCTGGATCTCC
CGTACGGAGGGGCCTTGGCCGGTCTCGGCGATCGCGTCCCGTACGGCGGCGAGCACGCGG
TGGCGCCCGTCCCCCGCCGTCACCTGGTCCCCCGCGAGGGCGGGGACGCGGGCGCGGGCG
GGCGGCACAGCAGAGCCCGGCGGGCCGTGGTGGGCGGGCCGTCGAGCAAGCGGGCGGACT
GCCGGATCAGTGCCCGGCGCAGAGGCGTGGCGGCGGCGGGGTGTGCGAGGGCGAGGGCGT
GGTAGGTGGCTCGCCGTTCGAGGGCGAGCCGGAGCAGGGCATCGTTCACACCCCTACCCG
ATCACATGTTCGATTTTTTGGGCAACCGAACCCGCGCAAAACGCCACATCACCGCCGTGC
GCGCGCTCTGGCCGGTCGTACCCTCGCTGGTGTGACCGATTTCCCCGACGATCTCCTCGC
GGCTCAGCGCGACCTCACCGCCGTACGCGCGACCCTTTCCGCCCGCCTCGCGGCGCTGCC
GCCCTCGGCGGAGCCGATGCCCGCGTGGGAGCGGCCGGACGGCTACTGGGCGGGCGCCCG
TACGCACCCGGCCTCCCCGGGGTGGAGCGAGGAGGAGCGCCAGGAGGTCGCCGCGCTCCG
CGAGCGCGAACGGGATCTCGCGGCGGCGATCGTGACGCACGAGCTGTGGGCGAGCGTGCC
GGCCGAGGAACGGATGCGGGCCCGCGACGCACTCAAGCACGCCCACGAGACACAGGCCGC
CGAGGCGGCGGGGGCCCGGGGCTGAGTGTGTCGGGCCACGAAGGCGCGAGCAGCAGCGGG
GCGCCGGGGGTGTGGGTGGTGCTCGCGGACGGGCAGGAGGTGCGGGGGCGGCTCCTCGCG
CGGCGCCAGCTCCCGGACGGGTGGCGCTACCGCGTCGCGCTCCCGCTCTACCGCAACGTG
GGCGGGGAGGGCCTGGAGGTCGAGGCGGCGCAGTACGAGGTGTGGGTGCGGGCCCCCGAG
CATGTGCGGCCCGTCGAGGACGTCGACTACACGGGCGTGCCGACCACGGCGCTCCCGGCG
CCCTCGCTCGTGGAGGTGGCGCTCGGGCCGCGCAGGCCCGCCGGGTGGGTGCTGGCGAAG
AGCGGCGGCGGGCGCCGGGGGCCCTCCCGTGCGGTGCTGCACGCCGTGGACTGCGCCGAG
GCGCCGCCCGGCCTTCCGGTCCTGCGGGTGGAACAGGCGCTCAACGCTGCCGAGCACCCC
GCCACCCGGGCTTGCGCCCTGTGCGGGGCCGGTGCGGAGCTTGATCCGCTTCTGCGGGGC
TTCGACCCGCAGGAGGACGCGGTGGGAGACCCCTGA
>orf00088 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGTGGGTGGGTGGCCTCGTAGAGGATGCGCGAGAGGTCGGCGCGCAGGATCTCCAGGTC
GGCGATCGGTCCCTGGCCGCCGAAGGCGCCGCTGGTGAAGGCGGCTCTGGTGCGGTTCGC
CGCGTCGACGAAGCGGATGCCTTCTTCGCGGGTGGCGTGGTCCCGGAGGGTGTGTTCCAG
GCCCATCCTGCGGGCGACGTCCCGTCCGGCACCGCGCAGGTCCACGGTCTGTCCGCCCTC
CCGCGGGGCGGGGGCCCGCTCGACGAGGGTGGCCTGCATTCCGTGCCGTTTGAGCCAGTG
GGCCAGGGCCGGACCGGCGATACCGGCTCCCGCGATCAGCACATTCCGGTGCGTCATGGC
GCTCCCTTTCGTTTTCCTGGGCTTCTCCCGCCTCGGGCGGCGGCTCCGGTGCGGTCCCGG
CCGGGTCCGCTTGTCGTGCACGGCCCCGGCCGGGGCTCAGATGGCGAGGTGCTGCTTGGT
GCCGGAGTCGTCGGCAGTGGTCTCGGGGGTGATGCCGTGCTGCTCGTCTTCGGGGCGGCC
CTTCTTGGGCAGCAGGAAGGTGATCGCGAAGAAGACCACCAGCAGGCATGCCTGGACGAT
CAGGGCCCGGTGGAAGCCGCCGGTGAAGTCGCCGGTCTTGGCCTGGGCGAAGAACACCGA
GCCGAAGACCGCGACGCCGATGGAGCCGCCGACCGCCTGGACCGCCGACAGGACCCCGGA
GGCGGATCCGATCTCGTCGTCGTCGACCGCGGCCAGGATGAAGCTGAACAGTGCGGCGAT
CACCATGCCGGCGCCGATGCCCGCCACTGTCGTGCCCGGGACGATGTCCCAGATCGAGAA
CGAGGCGGAGTCGAGGCCGTCGAGCTCGAACCACAGCACGGCGGCGCCGGCCAGCTGGAC
CAGCGGTCCGATCTGGAGCACCTTGCGGCCGATCCTGTCAGCGAGGAACGCGCCGCTGAT
GGCGCCGCCGATCGCGGTTCCCACCGCGAGGGGCAGGTTGCCAAGGCCCGCGTCACCAGC
GGTGAAGTGCTGGCCGATCTGGAGGAACAGGGTCAGGACGAGCTGGGTGCCGATGAGTCC
GCCGAAGAACAGGGCGATGCCGCCGAGCCCGACGGTGAAGGCGGGCTTGCGCAGCAGGCC
GGGGGTCACCAGCGGCTCGCGGCCCACGGCGGCCGTGCGACGCTGCTGGAGGGCGAAGAG
GGCGAACCCGATCGCGGAGGCGGCCATGGACAGCCACGTCCACAGCGGCCAGCCGCTCTC
CTGGCCCTGGTTGAGCGGCAGCACCAGCAGGGCGCAGGACGCCACGATCAGGGCGGCGCC
GGTCATGTCGACCCGGACCGTGCGGTCGCCCGCCTTCTTGGGCACGAATTTCGCGGCGAC
GATCAGTGCCGCGATGCCGATGGGCAGGTTGATCAGGAAGACCGAGCGCCAGCCCAGGCC
GAAGAAGTCGCCCTCGATGAGGAAGCCGCCCAGGACTGGGCCGATGATGCCGCCCAGTCC
GAGGACGGGGCCGAAGATCGCGAAGACCTTGGTGAGCTCGGGGCCGGAGAAGTTCTCGCG
CAGCAGACCCAGGCCCTGGGGCAGCAGCATCGCTCCGGCGGTGCCCTGCAGCAGGCGGAA
GGCGATCAGCGACTCGATGTTCGGCGCGATCGCGCACAGCAGCGATGCAGTGGTGAAGGC
CGCGAGTCCGATCAGGAACATCCGGCGCCGGCCGTAACGGTCACCGAGCCGCCCGCCGAG
CACCAGACCGGCGCCCAGGGTGAGGGCGTAGCCGCCGATCACCCACTGCAGTCCGACCGA
GCCGGCGCCGAGGGACTTCTCCAGGTCCGGTCCGGCGACGTTGACGATCGAGGCGTCCAG
GAGGTCCATGATCTCCGCGACGATCATCACCGCCAGGATCAGCCACCGCCACCGGTAGGG
CTCGGTCGTCTCCTCGCGGGTGGGGGACGGGTCACGCATTCCAGTTACCTCCATGGTGAA
GTAATTCCATCATGA
>orf00089 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGCCGTCCATGGTGGCGTTCAGGTCGGCCATGAACGCTTCGACCTGTTCCAGGAACTG
GGGCGGGTAGGGCGACATCGCGGCGTCGAGGCGGTGGGCGAGCGGGCCGAAGAACTCGTC
CGCCCGCTCCTGGATGTGCTCGCCGCTGTGCAATGTGACGATGCGCCGGTCGGAGTGCTC
GCGGGCGCGGGTGATGTGCCCGGCCGCTTCGAGGCGGTTCAGCAGCGCGGTGGTGGCGCC
GGTGGACAGGGAGATCCGTTCGCTCAGCCGCGCCGGTGA
>orf00092 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGATCAGCCCGCGGTGAAGTCGCCGTCCGCGGCGAGTACGGCGCCCGTAACGAAGGCG
GATCGCGGGAGACCAGGAAGCACAGGACTTCCGCGACCTCGTGCGGCTGCGCCACCCTGC
CCAGGGGGTGGACGTTCCCGAAGGACGCGAGATAGGCGCGGCTGTACGGCCACGGTGGGC
CGGCTGTCGGCGGCGACCCGGTCCCGGCTGGACGACCTGGTGGCCGAGGACGCCGGCGGG
GAGGAGTCGGCGGGCGGCGGGGTGTCATTCTTCTCCGAGCTGAAGGCGGACCCGGGCGCG
CTGGGGCTGGACAGTCTGCTGGCGGAGGTGAACAAGCTCCAGCGGGTGCGTGCGCTGGAG
CTGGCGCCGGAGCTATTCGGGGACGTGTCGGAGAAGCTGGTGGCGGCGTGGCGGGCGCGG
GCGTCGAAGGAGTACCCCTCGGACCTGCGGGCGGCAGCCGGGCCGGTGCGCTACACGCTG
CTGGCCGCGCTGTGCCATGTGCGGCAGACGGAGATCACCGACTCGCTGGTGGAGCTGTTC
ATCCAGCTGGTGCAGCGGATCAACACGCGGGCGGAGAAGAAGGTTGAGGGCGAGTTCACC
AAGGATCTCAAGCGGGTCCGTGGCAAGGAGGGGATTCTGCTGCGGCTGGCGGAGGCCGCG
GTCGCGGAGCCGGGCGGCACGGTCCGCAAGGTGATCTTCCCGGTGGCCGGGGAGTCCACG
CTGAAGGCCCTGGCGGCGGAGGCCGCGGCGAACGAGGCCCGCTACCGGGCCCGGGTGCGC
ACGGTGCTGCGGTCGTCGTACTCGGGGCACTGGCGGCGGATGCTCTCCCCGCTGCTGGGG
GCGGTGGAGCTGAAGTGCAACAACACCGCTTACCGGCCGGTGATGGACGCCATCGACCTG
CTGAAGCGGTACCTGGACCAGCCCATCGCCAAGGAGGGCGCGTTCTTCGACGAGTCGGAG
AACATCCCGCTGGCCGGGGTGGTGCGCGAGGAGTGGCGCAAGGCAGTGGTGGACGAGCGC
GGCCGCGTCGAGCGCATCCCGTACGAGCTGTGCGTGCTGGTCAGCCTGCGGGACGCGCTG
CGGCGCCGGGAGATCTGGGTCCCGGGCGCGGGCCGGTGGCAGAACCCCGAGGGCGACCTG
CCCCCCGACTTCGAGGACAACCGCGATGTCCACTACGACGCGATCCGCCAGCCGCAGGAC
CCTGGGTCCTTCATCGGGGCCCTTCAGAAGCGGCTGCGGGAGGCCCTGACCCGGCTCGAC
ACCGCGCTGGAGCTGGGCACCACGGGCGGCGTGGACATCGTCCGCAAGCACGGCGAGCCG
TGGATCAAGGTCTCGCCGCTGGGCAAGCAGGCAGAGCCGGAGAACCTCGTCGCGCTGAAG
GCGGAGATCGAACGCAGGTGGGGCACCATCGACCTGATCGACATCCTCAAGGAGGCCGAG
TTCGCCACCGGGTTCACGTCCGAGTTCGCCTCAGTCGCCACGAGGGAGGCGGTCCCGAAG
GCGGTGCTGCGGCGCCGGCTGCTGCTCGTGCTGTTCGCGCTGGGCACGAACATGGGCATC
AAGCGGGTCGCGGTCACCGGCAAGCACGGCGAGAGCGAGGCCGTCCTGCGCCGGGTGCGG
CACCTGTTCGTCAACCGCACCAACCTGCGCGCCGCCCTGGTCCGCCTGGTCAACGCCACC
TTCGCCGCCCGCGATCAGGCGTGGTGGGGCGAGGGCACCGCCTGCGCGAGCGATTCGAAG
AAGTTCGGGTCCTGGTCCAGCAACTTCATGACCGAGTGGCACCAGCGCTACCGCGGGCCC
GGGGTGATGATCTACTGGCATGTCGAGCGGAAGTCGCTGTGCGTCTACTCCCAGCTCAAG
TCCTGCTCGGCCTCCGAGGTCGCGGCGATGATCGAGGGCGTGCTGCGGCACTGCACGGAC
GTGGAGATCGACCGCCAGTACACCGACACCCACGGGGCCTCGATCGTCGGGTTCGCCTTC
GCCCACATGCTCGGCTTCAACCTGCTCCCCAGGTTGAAGAACGTCGGCTCGGCGCGGTTG
TACCGGCCGGCGGCTGGGGAGGACGACACCTGGCCGCATCTGGCGCCGGTGCTGTCGACC
AAGACGATCGACTGGGACCTGATCGCCCAGCAGTACGACCAGATCGTGAAGTACACCACC
GCCCTGCGGCTGGGCACCGCCGAGGCCGAGCAGGTCCTGCGGCGCTTCACCCGCGGAGGC
CCCAAGCACCCCACCTACCGGGCGATCGAGGAACTCGGCCGGGCGGCACGTACGGCGTTC
ATCTGTGACTACCTCGCCGACGCCGACCTGCGCCGCGAGATCAACGACGGACTCCAGGTC
GTGGAGAACTGGAACTCCGCCAACCACGACCTGCTCTACGGCAAGGACGGTGATCTGACC
GGCTCCGACAAGGAGTCCCAGGAGGTCTCGATGCTCGCGCTGCACCTGCTCCAGTCCGCG
CTGGTGCACGTCAACGCCCTGCTCCTCCAGGACATCCTCGCCGAGGAGAAATGGCAGAAG
AAGCTCACCGACGCCGACCGGCGGGCCCTGTCCCCGCTGTTTTGGACGCACGTGAACCCG
TACGGCCGGTTCGAGCTGGACATGAATTCCCACCTGGACCTCGTCGCCGCCGTGGCGGCT
TCGGTGCCCGGCCCGCGCAGCGGCGAGCCGGCCACGTCCCCGGCCTGA
>orf00093 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGACTCGCGGGAGTGGCCCTCCCGGCGTCAAGGGACGGCGACCACGTTCAGGGCTCCGG
GGGGCATCAGTGCAAGGGCCCCGGCGCGACGCCGTCGGTCGCCTCTTCATACACAACCCG
CGAGGTGTCCCTCAGGGCGCCCGCGAGGGGGAGGCACGCGGCCATGACGGCGGCTACGAC
CAGCAACGCCGGTGCGAGGCCGGTCCGGTCGGCGAGGGCGCCGAACAGGGGCGGGCTGCA
GACAAAGCCGCAGTACCCGATCGAGGTGATCACGCCGACCCGCGCGGCCGCCTGGGCGGG
GTCGTCCGAACCGGCGCTCAGACCGAGGGGAAAGCCGAGTGCCGCGCCCGCTCCCCACAG
CAGCGTCCCCGCGAACCCCGCCCAGAGGCTGGGCCCGGCCGCGAACAAGACCACCCCGAG
GCAGGCGGCCAACGCAGACGCGCGCAGTGCTCCTGGCCGGCCCAGGCGGCCGACGATCAG
CGGACCGAGCCAGCGGCCGAGGGTGACGGCCGCGAGGAAGGCGGCGTAGGCGAGCGTAGC
GACTGCGGCCGTGGTGCGGTGGCGGTCGATGACAGTGAGGCTGACCCAGTTGCTTCCCGC
TCCTTCCGCCAACGCGAAGGCCAGGGCGACGAGGCCGAGGACGACCGTGCGTGGGTCGCG
CCATGCGCGCTGTCCGGGCTCCTGCGTCGTCCTGCGTGGTGGCCATGCCGGGGGTGCACT
CCGGGGGAGGAAGCGGCGAACCGCCACGGGTGTCAGCACGGTGATGAGCAGGGCCACCGC
GCCGATGTGCAGGCTCACCGTTACGCCCAGCGCCGTCAGGAGCGCGCCGAGGCAGGCGCC
GACGACGGTGCCGAGGCTGAACCCGGCGAAGAAGCGGGGCATCAGAGCGCGACCGAGTCG
TCGTTCGAGGGCTGCGGCGTGCACGGCCACCGCGACATCCCAGAAGCCCGTGGCAGTGCC
CAGGACGAAGAGGCCGATGAGGAGCAACGGTGGCCAGAGAGCGAAGCCGGTCGACACCGC
AGCGAGGCCGGCACCTACGAACGCGCCCACCGTGGTGACGGCCCGGCGCGGCCCGACCCG
TGTGACGAGGAGACCGGCCAGCGGCAACGCCACCAGACCGCCGACCCCGAGGAGGAGCAA
CAGGAGACCCACTGCCGCGGCGTCCAGATCCATGCGGTCCCGGATCTGCGGCAGGCGGGA
CGCCCACGTGGCCCCGGCCAGGCCCAAGAGGGCGAAGACGAGGTAGGTCGCCCGTACGGC
GCTCGCGGTCTCGCGTGCGTACGAGCCTGGCGCGGCACGGGGTTTCACTTACTCGGCCCG
GCGGCCGGGCCGAGCGTCTGCGCCAGGGACTCCCGGGTCGCCTCGGGCGGTTCCTGGTCC
GTGGAGAGCAGTGCGTGCATGATCATTCCTTCCAGGAGGGCATCGAGGCGGGCGGCGGCC
CGCGGCCCGGTGAAGCGGGCCAGCACCGCCCGGCTGGAGCTGGTCCACTGCTGGGTTAGG
ACGCGCAGCGCGGGATCGCGCAGCGCCGCCAAATGCAGTTCGAAGCCGAGAACCGCGCTG
CGATGCCGGGCCGGTCCTCCTTGGACCACCGTCACCAGGACGTCGATCAGGTCTTCGCGC
GATGCCACCTGGGTGAACAGGGCCTCATATTCGGCGGTGCGCTGTTCGACGTACCAGGCG
AACGCCTGCGTGCACAGTTCGGTCAGGCTTGCGAAGTGGTAG
>orf00094 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGGAAGCCCAAGTGGTCGTGCATCAGCCGGTGCCAGAGGTCATGGGTCTGCTCGGCGTC
GGTGAGGGCGGGGCGCTGTGGCGAGAAGGTGAAGCCGGGCAGGGAGGGGATGATGACGGT
GAAGGCGTCGCGGGCGTCTCCTCCGTGGCGGGAGGGGGCGGCGAGTCGTTCGGCGAGCAT
GGTGAGTTCCATGACGGTACTCGGCCAGCCGTGGGTGAGCACGATCGGCAGGGCGTCAGG
GTGTTCGGCCTCGTAACGCAGGTAGTGCACTCGTGTGCCGGCGATGTCGGCAAAATGGGA
GGGCAGTGCGTTGACGGCGGCTTCGTGGGTGCGCCACGTGTAGTCGGTGGCCCAGTACAT
GACGAGGCGGCGGAGTTCGGCTGCGTCGGTACCCGCCTGCCAGCCGTCGACCGGCCAGGG
CTCGGGCCAGCGAGTGGCGCGCAGCCGGGTGCGGAGGTCTTCCAGGTCGGCGTCGGCGAC
CTGGATGACGGGTGTGCTGGTCGGCACGGTGTGCTCCTTCATGTGCGTGATGTGCAGGGG
GACGGCGGCGGTGCGGTTCGTTCTCGTGCGTGA
>orf00095 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
GTGGTAGGTGCGCTCGGCCCAGCTCCGGGGCGGTTGGGCGAGGTCTGCGGGGAACAGGGC
GAGGGCGGTGGGGACGTCGACCCGCCGCACGCGCCGGGTGAGCTGGTGCGCGTACTCGTA
GTACGGGCGGAAGGACGTGGAGATCGTGCCGGTGAACCAGTAGAGCGATGCCTGGGTGAG
GAGGAAGTCGTCGCCGAAGCGGGTGGACAGGTCGCCGCCGCAGTCGGTCCACGCGCGGTA
CTTCTCGAGGATCCAGGAGAGCAGTCCGGCGGGCGAGTCGTTCAGTGCGGGCGCGAGGGT
GAGGGGACGGGTGTTCTGCTGGTGCATGTAGGCGCCCTCCTCTGCCTGCCAGGCCGCGGC
GGACAACAGGTGGGTCTTCTCCTCAGGGGTGAGCGAGGCCGGATCGTACTCTGCCGGGGC
CGCGGCAGCGAGCAGATGAATGCCGACGACGGCCTCGGGGTGGGCCTCGGCGAGCCGTGA
>orf00097 gi|333028963|ref|NZ_CM001166.1| Streptomyces sp. Tu6071 plasmid pTu6071, whole genome shotgun sequence
TTGGCTTGTCTGCCTCGTGAGGAGTTTCAAATTTCTGTTTCTCGGGTTCCGTTGCGGAAA
CATCAGGTGGAGCTTATGTCGGACCTCAGGAAATGGGTTCGGGTGGCTGCCCGGGAAAGC
GCCCGTTCGGGGCGGGGGGCGCGGGCGACGGTGGTGTCCGCTACGGGTACGGGGAAGACG
ATCAGCGCGGCTGTTGCGGCGTTGGAGTTGTTCCCTTCGGGGCGGGTTCTCGTGATGGTG
CCGACGCTGGATCTGCTGGTGCAGACGGCGCAGTCGTGGCGGGCGGTGGGGCACACGGCG
CCGATGGTCGGGGTGTGCTCGCTGCCCGGGGATCTGCTCCTGGAGGAGTTGCGGGTGCGG
ACGACGACGCACCCGATCCGGCTCGCGCTGTGGGCCGGGCAGGGGCCTGTGGTCGTGCTG
GCGACGTACTCCTCGCTCGTGGGCGGGGACGGGCAGGGCGGGCCCCTGGAGGCCGCCCTG
GCGGGCTCGGGGTTGTACGGGCAGCGGATGGACGGCTTCGACCTCGCGGTCGTGGACGAG
GCGCACCGTACGGCGGGCAGCGCGGCGAAGCCCTGGGCCGCGATCCACGACAACGCCCGT
ATCCCGGCGGCGCACCGGCTCTACCTCACCGCCACCCCGCGCGTCCTCGCGCCCGCCCGC
CCCGACAGGGACGAGGACCAGGAGGAGGGCGGCGGGGAGGCGCCGGCACTCGTGACGATG
GCGAACGACCCGGAAGGCGAGTACGGGGCGTGGATTCACGAACTCGGGTTGTCCGAGGCG
ATCGAGCGGAAAATTCTTGCGCCTTTCGAGATTGATGTTTTGGAGATTACCGATCCTGAG
CCGGAATTGATGGAAGGAATGGACCGGGAGGCGCGGCGTGGGCGGCGGCTCGCCCTGCTC
CAGACTGCGTTGCTGGAGCACGCGGCCGAGCACAATCTGCGCACCGTGATGACGTTCCAT
CAGCGGGTGGAGGAGGCGGCGGCTTTCGCGGAGAAAATGCCGGAGACAGCGGCGGAGCTT
TACCGGAATGAGGTGTCGGCGGAGGATCTTGCCCTAGCCGAGGAGCTCCCGGCCTCCGAG
GTGGGCGGGGGCTTCTACGAGCTGGAGCCGGGGCGGCATGTGCGGCCGGAGCGGGTGTGG
TCGCGGTGGCTGTACGGAGAGCACCCGGTGGCCGAACGCCGTGCGGTGCTGCGGGAGTTC
GCGAACGGGATGGACTCGGCAGGGGTGCGGGTGCACCGCGCGTTCCTCGCCTCCGTCCGC
GTGCTCGGCGAGGGCGTCGACATCGTCGGGGAGCGCGGGGTCGAGGCGATCTGCTTCGCC
GACGCGCGCGGGTCCCAGGTCGAGATCGTGCAGAACATCGGCAGGGCGCTGCGCCCGAAC
CCGGACGGGCAGACGAAGACGGCGCGGATCATCGTGCCCGTCTTCTTGGAGGCCGACGAG
GACGGGGAGGGGATGGTCGCGAGCGAGGCGTACCGGCCGCTCGTGGCCGTGCTCCAGGGG
CTGCGCTCGCACTCCGAGCACCTGGTCGAGAAGCTGATGCTCCGGGCCCGGGTGCGGGCC
GAGAGCGCGAGCGCGCGCAGCGCGGAGGAGGCCGGTGCGGGGCCCGCGCGGGTCCTGTCC
GACTCCGGGACCTCTTCCCCCGCCTCCCAGGCCTCCGGGGACGTCGAAGGCGAGAACGAG
GACGACGTCGAGGCGGGCGCGGACGGCGCTGAGGCGGGCGCGGACGGCGCTGAGGAGTCG
GAGTCGGTGTTGTTGCGGTTCTCGACGCCGCGCTCGGCGTCGACCATCGCGGCCTTCCTG
CGGACGCGGGTGTACCAGCCGGAGTCGACGGTGTGGCTGGAGGGCTACGAGGCGCTGCGC
GCCTGGCGGGCCGAGCAAGGGGTGCGCGGCTTGTGCGCGGTCCCGTACGACGCCGAGGTC
GCCGCGGGGGCCTCGCGGCGGTACCCGGTCGGGCGGTGGACCACCGCGCAACGCCGCGCC
CGCCGCGAGGGCACCCTCAGCGCACACCGCATCGACCTGCTCGACGCGGAGGGCATGGTG
TGGGAGCCGCGCGAAGAGGAGTGGGAGCGCACGCTCGCCGGGCTTCGCTCCTACCGGGCC
GCGTACGGGCACCTCGCCCCCCGCCGGCGCGAAACCTGGGGCGAAGACGAGGGTGAGGAC
GTCGTACGCGTCGGGGACCTGATGGCGAACCTCCGCCGCAAGGACGGACTCGGGCGGGAC
GCGGAGCGGGCCGCCGCGCGCGCGGCCCAGCTGAGGGCCGTCGATGCGGACTGGGACTGC
CCCTGGCCGCTGGACTGGCAGCGCTGCTGTCGGCAGCTCGCGCTCCTGGCCGCCGACGAA
CCCGACGGACGCGCGCCCCGGATCGCGCGCGGGGTGCGCATCGACGGGGACGACCTCGGC
GCGTGGGTCGCGCGGCAGCAGGAACCGCGGGTGTGGGCGAAGCTCAGCACCGAGCAGCGG
GCGCGACTCGAAGCGCTCGGGCTCCGGCCTACCGAGACGGCCCCACGGCGGGGTGTGGAG
GGCACGGGGGCGGCGGGGAGCGGGAAGCGGACGGCGGCGGCGCGAACGGCCTTCCAGCGC
GGCCTCGCGGCGCTCGCGCAGTGGGTCGAGCGGGAAGGCGCGGAGAAACCCGTACCCCGC
AAACACACCGAGACCGTGAGCGTGGACGGTGAGGACGTCGACGTACGCCTCGGCGTGTGG
GTCTCGAACGTGAAGAGCCGCTTCGACGGGATGGGCGAGGACGAGCGCGGCCAGCTCACC
GCGCTCGGAGTGCCCTGGGCGGTGTAG