view test-data/streptomyces_Tu6071_plasmid_genes.fasta @ 0:a4136c1534be draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
author bgruening
date Tue, 28 Nov 2017 10:11:42 -0500
parents
children
line wrap: on
line source

>lcl|NZ_CM001166.1_gene_1 [locus_tag=STTU_p0001] [location=183..2918]
TTGGCTCGTCTGCCTCGTGAGGAGATTCAAATGTCTGTTTCCCGGGTTCCGCTGCGGAAACATCAGGTAG
AGCTTATGTCGGACCTCAGGAAATGGGTCCGGGTAGCCGCCCGGGAAAGCGCCCGCACGGAGCGTGGGGC
GCGGGCCACGGTGGTGTCCGCTACGGGTACGGGAAAGACGATCAGCGCGGCTGCTGCGGCGTTGGAGTTG
TTCCCTTCGGGGCGGGTTCTCGTGATGGTGCCGACGCTGGATCTGCTGGTGCAGACGGCGCAGTCGTGGC
GGGCGGTGGGGCACACGGCGCCGATGGTCGGGGTGTGCTCGCTGCCCAGGGATCTGCTCCTGGAGGAGCT
GCGGGTGCGGACGACGACCCACCCGATCCGGCTCGCGCTTTGGGCCGGATCGGGGCCGGTGGTCGTGCTG
GCGACGTACTCCTCGCTCGTGGGCGAGGACGGGCAGGGCGGACCCTTGGAGGCCGCTCTCGCCGGGGCTG
GCTTGTACGGGCAGCGGATGGATGGCTTCGACCTTGCGGTCGTGGACGAGGCGCACCGCACGGCGGGCAG
CGCGGAGAAGGCGTGGGCGGCGATCCACGACAACGCCCGTTTTCCGGCGGCGCACCGGCTGTACCTCACC
GCGACCCCGCGCGTCCTGGCCCCGGCCCGTCCCGCCAGGCACGAGGGCGAGGAGGGACGCGGGGAGGCGC
CGGCACTCGTGACGATGGCGAATGATCCGGCGGGCGAGTACGGGGCGTGGATTCACGAACTCGGTTTGTC
CGAGGCAATCGCGCGAAAAATCGTCGCGCCTTTTGAGATTGACGTTTTGGAGATTACTGATCCTGAGCCG
GAATTGATGGAGGGATTGGATCGGGAGGCGCGGCGTGGGCGGCGGCTTGCGTTGCTTCAGACCGGGCTTT
TGGAGCACGCGGCCGAGCATAATATTTGCACCATGATGACGCTTCATCAGCAGGTTGAGGAGGCGGCGGC
TTTCGCGGAGAAAATGCCGGAGACGGCGGCGGAGCTTTACCGGAATGAGGTGTCGGCGGAGGATTTTGCC
CTGGCCGAGGAGCTCCCGGCCTCCGAGGTGGGTGGGGGGTTCTACGAGCTGGAGCCGGGGCGTCATGTGC
CGCCGTCGCGGGTGTGGTCGCGGTGGCTGTATGGGGAGCATCCTGTGGCCGAACGGCGTTCTGTGCTGCG
GGAGTTCGCGAACGGGATGGACGCGGAGGGGCGGCGGGTGCACCGGGCGTTCCTCGCTTCCGTACGGGTC
CTGGGTGAGGGCGTCGACATCGTCGGGGAGCGCGGGGTCGAGGCGATCTGCTTTGCCGACGCACGCGGGT
CTCAGGTGGAGATCGTGCAGAACATCGGGCGCGCGTTGCGCCAGAACCCGGATGGGCGGGCGAAGACGGC
GCGGATCATCGTGCCGGTCTTCCTGCGGCCGGACGAGGACGGGGAGGGCATGGTGGCGTCGGAGGCGTAC
CGGCCGCTCGTCGCCGTACTCCAGGGCCTGCGCTCGCACGACGAGCACCTGGTCGAGAAACTCATGCTGC
GGGCGCGCGTACGGGCCGAGAGCGCGAGCGCGCGCAGCGCGGAGGAGGGCGGTGCGGGGCCCTCGCGGCT
CCTGTCGGACTCCGGGACGGCGGCTGCGGCCTCCGAGGGCGTCGAGGGCCAGGAGCAGGGCGAGGACGGC
GCCGAGGCGGAGTCGGTGCTGCTGCGGTTCTCCTCGCCGCGCGCGGCGTCGACGGTCGCGGCGTTCCTGC
GGACGCGGGTGTACCAGCCCGAGTCGCTGGTGTGGCTGGAGGGGTACGAGGCCCTGCGCGCCTGGCGGGC
CGAGCAAGGGGTGAGCGGGGTGTGCGCGGTCCCGTACGACGCCGAGGTCGCCGCGGGGGCCTCGCGGCGG
TACCCGGTCGGGCGGTGGACCGCCGCGCAACGCCGCGCCCGCCGCGAGGGCACCCTCAGCGCACACCGCG
TCGAGCTCCTCGACGCGGAGGGCATGGTGTGGGAGCCGCGCGAGGAGGAATGGGAGCGCACGCTCGCGGG
GCTTCGCTCCTACCGGACGGCGTACGGGCACCTCGCCCCCCACAGGCGCGAAACCTGGGGCGAAGACGAG
GGTGAGGACGTCGTACGCGTCGGGGACCTGATGGCGAACCTCCGCCGCAAGGACGGACTCGGGAAGGACG
CGAAGCGGGCCGCCGCGCGCGCCGCGCAGCTGAGGGCCGTCGATGCGGACTGGGACTGCCCGTGGCCGCT
GGACTGGCAGCGCTGCTGCCGGAAACTCGTGCTCCTGGCCGCGGACGAGCCCGGCGGGCGCCTGCCGGAG
ATCGCGCCCGGGGTCTGCCTGGACGGGGATGACCTCGGGGTGTGGGTCGCGCGGCAGCAGGAGCCGCGGG
TGTGGGCGCGGCTCAGCACCGAGCAGCGGGCGCGGCTCGAAGCGCTCGGGCTGCGGCCCACCGAAGCGGC
CCCGGGGCGGGGTGTGGAGGGCACGGGGGCGGCGGGGAGCATGAAGCGGACGGCGACGGCGCGAACGGCT
TTTCAGCGGGGTGTGGCGGCGCTCGCGCAGTGGGTCGAGCGGGAAGGCGCGGGGAAACCCGTACCCCGCA
AACACGTCGAGACCGTCAGCGTCGACGGCGAGGACGTCGACGTACGCCTCGGCGTATGGATCTCGAACAC
CAAGAGCCGGTACGACGGGCTGAGCGAGGACGAACGCGCGCAGCTCACCGCACTCGGAATGCCCTGGGCA
GGATGA
>lcl|NZ_CM001166.1_gene_2 [locus_tag=STTU_p0002] [location=complement(2995..3171)]
GTGCTCGCCGCCGTACGGGACACGATCGCCGAGACCGGCCAGGGACCGTCCGTACGGCAGATCCAGCGCG
TCACCGGGCTCGCGCTCGGCACCATCGCCCACCACCTGAAGGCGCTGGAGGAGAGCGGCCCCCTCGTCCG
TACGGGCCTGCACTGGCGCACCTGCCGCCTGGGCTGA
>lcl|NZ_CM001166.1_gene_3 [locus_tag=STTU_p0003] [location=complement(3195..3407)]
GTGACCGATGAACTGCTCCGCCTCGCCCAGGAGAGGCGTGCGACCTACCGCGACCTCACCCTCGGCGGCC
CCGCCCGCCCCCCGACACCTCTGCGCCGGGCACTGATCCGGCAGTCCGCCCGCCTGCTCGACGGCCCGCC
CACCACGGCCCGCCGGGCTCTGCTGTGCCGCCCGCCCACGCCCGCGTCCCCGCCCTCGCGGGGGACCAGG
TGA
>lcl|NZ_CM001166.1_gene_4 [locus_tag=STTU_p0004] [location=3510..3866]
GTGACCGATTTCCCCGACGATCTCCTCGCGGCTCAGCGCGACCTCACCGCCGTACGCGCCACCCTTTCCG
CCCGCCTCGCGGCGCTGCCGCCCTCGGCCGAGCCGATGCCCGCGTGGGAGCGGCCCGACGGCTACTGGGC
GGGCGCCCGTACGCACCCGGCCTCCCCGGGGTGGAGCGAGGAGGAGCGCGAGGAGGTCGCCGCGCTCCGC
GAGCGGGAGCGGGATCTGGCCGGGGTGATCGTGACGCACGAGCTGTGGGCGAGCGTGCCGGCCGGGGAGC
GGATGCGGGCCCGCGACGCACTCAAGCACGCCCACGAGGCCCCGGCCGCAGCCGGGGCGGCGGGGGCGCG
GGGCTGA
>lcl|NZ_CM001166.1_gene_5 [locus_tag=STTU_p0005] [location=complement(4344..5609)]
ATGTCACAAGCCAATCACAGGACATCCGGCACTCCCACGGCCGAGCCCGTTGGAACAGCAGAGGAGATCG
TCATGGCAAGTAGCAACCGCGCCGTCACCTTCCAGAACCCGAAGGAGATGCGCGTCGAGTCTCTGGATTT
CCCGAAGCTTCAGATGCCGAACGGGAAGAAAGCCCCGCACGGCGTCATCCTCAGGATCGTCGCCACCAAC
ATCTGCGGGAGCGATCTGCACATCTACCGTGGGTCCTTCCCGGTGCCCCAGGGTATGGTGATGGGCCACG
AAATGACCGGGGAGGTCATCGAGGTCGGCCCCGACGTCGAGTTCCTCAGCGAGGGCGACCTCGTCTCCGT
CCCCTTCAACGTCGCCTGCGGCCGATGCCGCAACTGCCGGGCCCGCCGGACCGACGTCTGCGAGACCACG
AACCCTGAGGTGTCCTGCGGAGCGTACGGCTTCAACCTGGGCGACTGGACCGGTGGACAGGCCGAGTACT
TGTTCGTCCCTTATGCCGACTTCCAGCTCCTGCGCTTCCCGGACAGGGACCAGGCCATGGCGAAGATCCG
TGACCTGGCGCTGCTCTCGGACATCCTGCCCACCGCGTTCCACGGCCTCATGGAGGCCGGCGCCAAACCG
GGCTCCACCGTGTACATCGCCGGCGCCGGCCCGGTCGGCCGCTGCGGCGCAGCAGCGGCGCGGCTCCTCG
GGGCGTCCTGCATCATCGTCGGCGACTACCACAAGGACCGCCTGGAGCTGATGAAGAAGAACGGCTGCGA
GACGATCGACCTGAGCCAGGACGCAGCGCTCACCGACCAGATCGAGGCCATCCTGGGCGAACCCATGGTC
GACTGCGCAGTCGACTACGTCGGCACCGAGGCACACGGCATCGGCCGCGAGGCAGAGGACATGGACCCGG
CCCACGCCCTCAACCAGGTGCTCGACGCCACCCGCGCGGGCGGAGCCACCGGAGTCATCGGCGTCTACGG
TCCCGACCCGCTCGCGAAGTCGAAGGCCGAGCAGCAGGGAACGTACCCGATCGACTTCGGCAAGGCCTGG
ATCAAGTCGCCGCGGCTCGCCGCCGGGCAGGCACCGATCATGCACTACAACCGTGAGCTGATGATGGCGA
TTCTGTGGGACCGCATGCCCTACTTGAGCGCGATGCTCAACACGAAGGTGATCAGCCTCGACGACGCCCC
TGACGCCTACGCGACCTTCGACACCGGCGTGTCCGAGAAGTTCATCATCGATCCCCACGGCCTCATTGCC
GCCTGA
>lcl|NZ_CM001166.1_gene_6 [locus_tag=STTU_p0006] [location=complement(5617..6174)]
ATGACCAACGACTTGCACGGCAGGAAGATCGCAATCCTGGCCACGGACGGCGTTGAGCGCGTCGAGCTCG
AAGAACCTCTCGGCGCACTGCTGGGTGCTGGAGCGCAGGCTGAACTCCTGTCCCTCCACACCGGCGAAAT
CAACGCGCGCCAGATGGACATCGAGCCGGCCGGAACCTTCACCGTGGACAAGAAGGTCGCCGACGCCCGG
ATGGGTGACTACGACGCGCTCCTGCTGCCCGGCGGCACCATGAACCCCGACCAGCTGCGCGCCGACCCCG
ACGCCGTCGCCTTCGTGAGGGGGTTCGTGGAGACAGGGAAGCCCGTTGCCACCATCTGCCACGGACCCTG
GACCCTGGCCGAGGCTGACGTGCTGCACGGTCGCCGCCTCACCTCTTGGCCCAGCATTCGGACTGACCTG
CGCAACGCCGGCGCCGAGGTCGTCGACGAGGAGGTCGTAATTGACCGCCAGCTGATCTCCAGCCGCGGCC
CGCAGGACCTCTCTGCCTTCTGCAAGGCGATCGTCGAACGCTTCGCCAACGCACCGCAACCCACCTGA
>lcl|NZ_CM001166.1_gene_7 [locus_tag=STTU_p0007] [location=complement(6230..6499)]
ATGTCTTGCGGAGGTGGGGCAGCAGGAGAAGATCTCTTCGTGCGGTACTCCGTCCCCCGGGGACGCGCCC
GCACGACTGCGGGGACCGGCCCGGCCAACGTCAAGGCGTACAACCGGCAGCTGTGGGCCCTGATCGCGCA
GGGTAAAGCCAAGCTGGCCTGGATCGTTTTCCAGGAGCTGTCGCTGGACCGAGCACCGAGCCTCCCAGCA
CCTTCGGCCACCGAGAGGGCAGTCGGGCCAAGGTCCTCCTCCCTCATCGACGGCAGCTGA
>lcl|NZ_CM001166.1_gene_8 [locus_tag=STTU_p0008] [location=complement(6829..7137)]
ATGACAACGCAGGTCAGCAAAGCGGTTCTGGTGCGCCTCGAAGCGCTGCCCGGCAGGGAAGACGACGTCC
GCGACTTCTTGAACCAGGCGCTGTCGGTCGTCATGGGGGAGCCCAAGACCGTCAGGTGGATCGGAATCCA
GTTCGGACCATCGTCGTTCGGGATCTTCGATGCCTTTCCCGACGATGAGGGACGTCAGACGCATCTGTCG
GGTGCGGTCGCCAAAGCGCTCGGCGAGAAGACGGGTGAGCTCTTCGAGGAGCCCACAATCGAGCAACTCG
ATGTCGTCGTGGAGAAGCAGCCCGCGTAG
>lcl|NZ_CM001166.1_gene_9 [locus_tag=STTU_p0009] [location=complement(7191..7337)]
GTGAGGAATCTCCACGGCGTCCAGGTCACCAACAGGGGCTGGATGAGCATCTTCGTCAGCAGTATCTCCT
ACACCGCGACAGTCAAAGCGTCAAGCGGTAGGGGTGATCGGCGAGCAGTGGCAGATGGGTCGGCGCATCG
GGCGTAG
>lcl|NZ_CM001166.1_gene_10 [locus_tag=STTU_p0010] [location=complement(7773..7934)]
GTGCCGGCAGACACCATCGTACTGTTCCGGCAAAAAGCGCTCATTCTCCACAACGCCCGGGATATCGCCG
AGATCGTCCGCCAGCTGCTGGGGGAGCCCTGGCCGGTCGAGCCGGAGAACCTGTCGAGCCGGAGGACCTA
TCGAGCATCTCGCCCTATCTGA
>lcl|NZ_CM001166.1_gene_11 [locus_tag=STTU_p0011] [location=complement(7994..8878)]
GTGGACTTGGTGGTCCAAAGCCTTGGCCACCGTTACATCCAGGAGGAAGTTATGGCGGATCCGCGGGCGG
TCAGCCTTCCTTGTGGGGTTGCGGTCACGGCGCTCGGTCAAGGTACCTGGGGGATGGGGGAGAATCCCGG
GCGCCGCGCGGCCGAGGTGTCGGCCTTGCGTGCCGGGCTGGACCTGGGGATGACTCTTGTCGACACCGCC
GAGATGTACGGGGACGGCGCGGCGGAGGAGGTGGTCGCCGAGGCGGTGGCCGGACGGCGGGACGAGGTCT
TCTTGGTCAGCAAGGTGCTTCCCTCCCATGCGGACGCCCGCGGAGTGGCCGAGGCCTGCCGGGGGAGCCT
GCGCCGTCTGCGCACGGACCGGATCGATCTGTATCTGCTGCACTGGCGTGGAGCCGTGCAGCTGGAGGAG
ACGGTTGAGGCGTTCGAGGCCTTGGTGCGGGAGGGTGCCATCCGCTCCTGGGGTGTGAGCAACCTGGACG
TGGATGATCTCGCGGACCTGCCGCCTGGAGCCGGGCCGCAGACCGATCAGGTGCTGTACAACCTCAGCCG
TCGAGGGCCTGAGTACGGTCTGCTGCCCAGGTGTCGTGAACTATCGATCCCCGTGATGGCGTACTCGCCG
GTCGAGCAGGGCCGACTGCTCCGCCACACGGCGCTGCGGGACGTGGCAGCCGCCCACGGTGCGACGCCCG
CGCAGATCGCCCTGGCCTGGGTCCTGCGGCACGAGGACGTCATTGCCATCCCGAAGGCGTCCTCCCGCGC
GCACGTCGAGGAGAACAGAACAGCTCTGGAGGTGGACCTGACCGCCGAGGACCTCGCGATGCTGGACCGG
GCGTTCCCGCCCCCGAAGAGCAAACGCCCGCTGGAGATGCTGTGA
>lcl|NZ_CM001166.1_gene_12 [locus_tag=STTU_p0012] [location=9096..9602]
GTGGGTGGTGCTCGTGGACGGGCAGGAGGTCGGGGGCGGCTCCCCGCGCGGCGCCAGCTGGCGGACGGGT
GGCGGTACCACGTCGCGCTCCCGCTCTACCGCACCGTGGGCGGGGAGGGCCTGGAGGTCGAGGCGGCGCA
GTACGAGGTGTGGGTACGCGCGCCCGAGCACGTACGGCCCGTCGAGGATGTCGACTACACGGGCATGCCG
ACCACGGCGCTCCCGGCGCCCTCGCTCGTGGACGTGGCGCTCGGCCCGCGCAGGCCCGCCGGGTGGGTGC
TCGCGAAGAGCGGCGGCGGGCGCCGTGGGCCCTCCCGTGCGGTGCTGCACACCGTCGACTGCGCCGAGGC
GCCGCCCGGCCTCCCGGTCCTGCGGGTGGAACAGGCGCTCAACGCCGCCGAGCACCCCGCCACCCGGGCC
TGCGCCCTGTGCGGCGCCGCCGCCGAACTCGACCCGCTCCTCCGGGGCTTCGACCCTCACGACGAGGACA
CGGGCGCTTCTCCCTGA
>lcl|NZ_CM001166.1_gene_13 [locus_tag=STTU_p0013] [location=9685..9906]
ATGGCACCGGCCGACGTCTGCCTGGAGGCGGTCTGTGAGGAGCCGCGCGAGCGGGTCGACGGCGTGCTCT
ACGCCTGCCCCGCCCACGGGGCCGAGGCGGCCTCGCGGATCACCGAGGCGGGATGGACCGCGCTGGTCAA
AGTGATGGGGCCCGCGAGCCGGGCCAGGTGCGAGGTCTTCGACGGCGCCACCCGCGAGGCACGTCACCTC
CTGGGCGCGTAG
>lcl|NZ_CM001166.1_gene_14 [locus_tag=STTU_p0014] [location=complement(9913..10197)]
TTGCTCGGGGGCCACGTTGGTCACACATCCTGCCGCACTTGCCCCACGCTCTCGTGGAGCCAGCCCATAC
AGCCACGGCACCCTCAACCCCGACACGATCACCCTCGTACGTTTCACACTTCCCCCATTAGCTCGGCAGT
CGAGTACCGCATCCTGAACGTCCGCACGTGGGAGGCCGGGGACGACGCGGGCCTGGATGCCGCGTGGGTC
GATGAGGTCGTGGTGGACCTCGGTTCGCAGTGGGGCCAGTACGAGTACGTCACCAACATCGGCTTCGCCG
CCTGA
>lcl|NZ_CM001166.1_gene_15 [locus_tag=STTU_p0015] [location=complement(10356..11891)]
ATGAACAAGGGCTTCAAGAAAAAGCGGGTAGTCGCTATAGCGGCCGCGTCCGTCATGATGCCGCTCGTGG
CCGCCGTTCCGGCGAGTGCCACCACCGGCGCGGAGGTCCGGGACGGTGCACGGTCCTTCACCGTCCGCCT
CGACATCGGGAAGGGCACCCGGGGCTGTTCCGGGGTTCTGGTCGACGCCCAATGGGTCCTTACCGCGCGA
AGCTGCTTCGCCGACAACCCGGCCACGAGCATCGACATCCCCGCAGGAGCGCCCGCGCTCCGCACGACCG
CCACTGTCGGCCGTACCGACCTCACCACAGGGACCGGCGAGGTCCGCGAGGTCGTCCAGCTCGTTCCGCG
CACCGACCGCGACGTGACGCTCGCCCGGCTCGACAAGCCCGTCGCCGGGGTGGCTCCCGTCACCGTCGGT
ACTCAGCAGCCGAGCGCCGGCGAGGCCCTGACCGCCGCCGGATTCGGCCGTACGAAGACCGAGTGGGCCC
CGCTGCGCCTGCACACCGCCACCCTCGGCATCGACGCCGTCCAGAGCCAGGACATCAGCTTCCACGGGCA
GGACGGACAGGCCCTGTGTGCGGGGGACACCGGCGGCCCGCTGCTGCGCGAGAGTGGCGGCAACGCCGAA
CTCGTCGGCATCAACTCCCGTTCCTACCAGGGAGGGTGCTTCGGTATCGAGGCGACGGAGACCCGCTCCG
ACGGAATCTCCTCGCGCGTCGACGATCTCGGCGACTGGATCGCGAAGAACAGGCTCGCCGCTCGCGCCCC
GGAGCAGATCAAGCACCTCACCACCGGCGACTTCAACCGCGACGGGCACCCCGACATCGCGGCGATCCTC
GACGACAACAACTTGTACGCCTTCTACGGCACGAGTGACGGCAAGCTCACCTATGGCCGCGAGCTGTGGG
CGCACGACGGCACCTGGGGTTCCAAGGCCCGCATCCTGGGCGGCGACTTCAACGGCGACGGCAACGCCGA
CATCGCGGCTCTCAAGGACGACGGCGCCTTCCACAACTACGCCGGAACCAGCGGCGACCTGCTCAGCCCG
GCGGCAAGCATGTGGAAGGACAAGACCTTCGCGAGCTACCTGCCGACGACGTACCGTGCCAAGGGCTGGA
CGCGCGACGGCCTCGTTGCCATCGCGCCCACCGGCCGCCTCTACGCGTACGCGACCGGGGCCAACGGCAT
CCTCACCGACAGTCGCACCGAGGTGTGGCACGACGCCACCTGGGACAAGAAGTTCCTCACCAGCGCCGAC
TTCAACGGGGACGGCCTCAACGACATCGCCGCGATCTCCCAGAAGGGCGAACTGGCCCTCTACCCGGGGA
AGACGGACGGTACATTCGCCAACGCCAAACTGATGTGGGACGACGCGAGCTGGGGCGGCTTCCACGCCCT
GCTGAGCGGCGATTTCAACGGTGACGGCAACGCCGACATCGTTGTTCTCAACAGCGTCGACCACCTCTAC
CTCTACCCCGGAGACGGTAAGGGCGGGCTCGGCACCCGCCGCAGCATGTGGCCCGCCATAGGCTGA
>lcl|NZ_CM001166.1_gene_16 [locus_tag=STTU_p0016] [location=complement(12110..12643)]
GTGTCCGTGACGACTACGGATGCACAGATGACACTGAATTCGCGCTCACGCGCCCTTCTCGCGGTCGCCG
CCGCGACGCTCTCGCTGGCCGGCGTCTCCACACTGGCCTCCGCCGACGGGAAGGACTCCCCGTCCGTCCA
AGCGGCAGCGGCGGAGCAGCCCGGGTACGCGGTCGAGACCTTCGACTATCCCGGCGCCGACCGCATCGCC
GCCGAGCAGGGCATCACGCTGCGCCGGGGTGACGGCCACATCGTCCTCGCGGAGTGCGACGACTCCAGCC
CCATGATCAAGGTGTGGACCCGTAAGAGCGCGGCCGGGAGGTTCTGCTTCCGCAGCACCGCCTCCACCGG
GTCCCTCACCCTGGAGGTCCCCGACGTCTACGCCATCGAGACCGTCCAGCGGGCCGTGCACGCGGAGTTG
GAGGCCGAGGGCAAGTCAGTGGAAGTGGACGTGAAGAAGGACGAGTTCAAGGGAGTGGGCGAGGGAGTCG
GCGACGCCCCCACGGTTCTCCTCGAACTCCGCGTCACCGGCTGA
>lcl|NZ_CM001166.1_gene_17 [locus_tag=STTU_p0017] [location=12978..16529]
GTGGGTGTCGCCGTGCTGCTCGCCCTGACGGCCGGGATGCTCGGTCCGGCGCCGGCCTCCGCGCTCGACC
CCGACCCGGACGAGGACGACTACACGCCGGTCGCGTACCTGCCGGCGACCGACCGGGGAAAGGTGCTCAC
GGCGTGGGAGGAGGGCGGGCCGGGCGTCAAGGCAGCCGCCGAGGCAGCCCTGCTCGGCTCGGACGCCGAC
GTACGGAAGTTCCTGGACGGGGAGGAGGCGCTCGCGCGGACGGCGGACGACCGCGTCGCCACGGTCCAGA
TCCTCTCGCTCGGCGGGCGCGCCGTCCGCGAGGCGGCCGAGGAGGCCCTCGCGGGCCCCGAGGAAGGCCT
CGCCGACTTCCTGAAGGACGGCTGGAAGGAGCCTCTGGAACAGGACCAGCGCGTCCAGGTCACCCAGATC
ATCTCCTCCGCGGCCGGACCGCAGGTGGCGGCCGACGGGCGCAAAGCGCTCAACGGGGGTATGGAGGAGG
TACGGAAGTTCCTCTCCGAGGGGCAGTACACCGCCGCTGACAACGATGCCAGGGTGCAGGTCGTCCAGAT
CATGAGCACCGGCGGGCAGGCCACCAAGGAGGCCGCCCGCGTCGCGCTCAACGGCGACATCAACGACATC
CGCGAGTTCCTGGAGGTCGGGCAGCACACTGCCCGTGCCCGCGACCAGGAGCAGGCCACGGTGGCCGATC
TCGCCACGCAGGCCACCGAGGCCGGGCGGCAGGCGCGGGTGGAGACCGACCGCGCCAAGGAAGCGTCGGA
TCGCGCGATCAAGGCGACGAAGCTCGCCAAGGAGGCGGCGCAGAAGGCGGCCAAGGAGACCGAGGCCGCG
AAGGACGACGCCGTCAGGGCGTCGAACGCGGCAGGTCGTGCCGCCGACGCCGCGCGCGGTGCCGCACGGG
CCGCGCAGGTGGCCATCGACGCCGCCAGCGCCGCCAACCGGGCCGCCCGCGTCGCGGCCAACGCCGCCGC
CCAGGCAGCCTCCGCGGCAGCCGCCGCGGCCAACGCCGCCGCTCGGGCCCGGAACGCCGCCGCGGCAGCG
GCCACCGACGCGGGGAAGGCGTCCGCCGCCCGCTCCGCGGCCGAGGACGCCCTGGACGCCGCCAAGGGCG
CGAAGAAGGCCGCCCAGGCCGCCGACTTCGCCGCCACCGCCGTCGTCGAGGCGGCCGGCGCCGCCCAGGC
AGCCGCCAGTGCCGGGCAGAACGCCGACGCCGCGGCGTCGGCCGCGTCCGAGGCGAGCGGCCAGGCCGGC
GTCTCCGACGCGCAGGCCGCACGGGCCAGGGCCGCCGCCGCCGAGGCGCACCGGCACGCCGCCGAGGCGA
CGGCCGCCGCCAACCGGGCCGACTCGCTCGCGGCGAAGTCGGCCAAGGCGGCGCGTGAGGCGAGGGACGC
CGCCAACGCCTCTGCCGAGCACGCCGAGAAGGCGGCTGCCGCCGCCAAGGAGGCCGCGGAGCACGCGGGC
GAGGCAGCCACCGCCGCGGCCGAGTCCACCAAGCACGCCGCTGCCGCGAAGACCGCCGCGGACGCGGCGA
GCGCCGCGGTCCAGCAGGCCAAGGACACGTTCACGCTCGCCCGCGAGGTCGAGGCCGAGGAGCTGGCCTC
CCGCACGGCCGGAGCCGTCGAGCAAGCGCGTTCGCTGCGGGACCAGGACGACGAGCGCATCGCCGAGGGC
AAGAAGCAGGCCGACGCCGCCGCCGCGCTCGACTCCGAGGCAACGGAGCTGGCCGAGGAGATCTCCGCGT
CCGGCGAGAACACCGACGCCCTCGCGCCCAAGGCACGCAAGGTCGCGCTCAACACCGTCAAGACACGAGG
CCCGTGGAGCGTCAGCGCCGCCGAGGTCGCCCTCGCGGGCTCCGCCGACGACGTCGTGCGGTACGTGGCC
GAGGGCCGCGAGGAGGCCGCCGCTCTCGATCGGCGCGCGCGTGCCGAGACGCTCGCCACCGACTCGACGT
CGGCGGACGTGCGGACAGCCGCCGCCGCTGTCGTGGAGGAAGGCGACGCCCCGATCCAGGAGTTCCTGAG
GACGGGACAGTTCCAGGCGGTCTCCAATGACCTCCGCGTGCGCATCACCCAGTTGATGAACGGTGCGGGC
CCCGGCGTCAAGGAGGCGGGCCAGGCCGCGCTCAACGACGGTTCCCCCGCGAAACTGCGGGACTTCGTCG
ACAGCGGCTACTACGTGCAGCGGGCCAACGACGAACGCGTCCAGGCGACGCAGCTCGTCGGTTCCGGGAC
ACCGGAGGAGAAGGCCGCCGCGCGCATCGCCCTGGAGGGACCGCCGCAGGTCCTGCACGCCTTCACCGAG
ACCGGCCGTTTCAAGGCCAAGCGGCAGGACCTGCTCACCGCGACCCACACGGCGCGAGTCCAGGGCCTGA
TAGCCAGCGCCGCCAAGGTGGCGGCCGTCGCCCAGCAGAACGCGGCGCTCGCCGGTGAGACGGCGGCGAA
GGCGCGCAAGGCCGCCGCCGAGGCGAAGAAGTACGCGGACCAGGCGAAGGCGTCGGCCGAGCAGGCCGCG
TCCTACAGCAAGGACGCCGACGCCTCCGCCGACGCGGCGCAGAAGTCGGCCGACCAGGCGGCGAAGTCGG
CGAAGACGGCCCGCGCCGCCGAGGCCGACGCCCACGCCGCCGCCCGGGACGCGGACCACTCCGTCGCCCG
CGCCGAGGCGTCCGCCGCCTCCGCGCACGGCTCCGCCAACTCCGCCTGGGCCGCCGCCGGTGCGGCACGC
GCCTCCGCCGAGGCGGCGGGCAAGGACGCCGACGCCGCGGCCGAGGCGATGACCGAGGCGCTGAACGTCG
CCGCCGAGAAGCAGTGGGCGGAAATCCGCAAGGCGCTGGAGGACGAGCAGGACCGGGCCGACCAGGCGTC
CCTCCAGGAGCTGGAGGAGTACTTCGCCGACCTGGCCAAGCAGCAGGAGAGCGGCGACACCGACTGGTGG
GACCTCGCCACCCTGGGGCACACGGTCCTGGACACGGCCGGGCTGGTGCCCGGTTTCGGGGAGATCGCCG
ACGGTATCAACTGCGGCTGGTACGGAGCCGAGGGCGACAGCCTGAACGCGGGCCTCTCCTGCGCGGCGAT
GATCCCCTTCGTCGGCTGGGGCGCGACCGGCGGGAAGTGGGGCAAGCGCGGTGTTGACGCGATCGAGGCG
TTCAACAAGGCCATGCGTGCGGAGGGGAAGGTCCCGCACATATGGTCGGCCAATCCTCGCAAGGGCCGCA
ACAACGTTCAGAACGCCTACAGCCACTGGAAAGACCACGGCGCCCAGTTCCCCGAGCTGAACAACGCGCT
GGACTACGTCAAGAAAGCGCGGCAGTACGGGGACATGGCACTGGCGCAAAAGCCGGTGAAGGGCTATCGC
GTCTTCTCGCAGAACGGCGGTGCGGTGGCGATCTTCGACGAGAGCAACGGCGCTTGGGCCGCCTTCACGA
AGGACGGGATCCCGCAGACCATGTACAAGCCCGAGCCACGCAGCCAGAGCAATCCCAACGGGTACGCGAC
CACCATCGAGGACTGGCTCGCCGAGCCCGGCCGCGGCACAGAGATACGCTGA
>lcl|NZ_CM001166.1_gene_18 [locus_tag=STTU_p0018] [location=16534..16818]
GTGGCTGAAGAGGAAGAGTGGACGAAGGTCCCGGTCGAAGAGGTCTGCCGGGTGTGCGGCCTCTATGCCG
AGGGGGCCCTGTGGGACGAGTACGGGGCGCCGCAGTACCTCACCTGCCCTTGCTGCGGTGTGGAGTCCGG
GCTCGGTGACGCGTCCTACGAAATGGTCACGTGGAACCGGGCGCGATGGCTTGAGTCCGGCGCGGAATGG
CAAGAGCCCGAGTTCCGTCCCACGAACTGGAGCCTGGAAGAGCAACTGGCCTGTATTCCCGCCAAGTGGC
GCTGA
>lcl|NZ_CM001166.1_gene_19 [locus_tag=STTU_p0020] [location=complement(17296..17580)]
GTGCTGACGCGCTCGGCAGGCCTGACGGCCAACCAGCGCCTCGTCCTCATGCTCTACGCGACGCACAAAA
CCGACCGCTCCGGCGCCGTCCCGGTGACCGCCGCCGAGCTTGCCGCGCACCTCGGGCTCGCGCCCACCGT
GTTCTCCCGCACCCGTCGCCAGCTCGTCGCGGGTGGATGGCTGGAGGAATCGGAACGGTTCGGTCACATC
CGCTTCTACCGCCTCGCCCCGAAGAGCACCGGAGAGCAGGTCGTGGTCCCCCTGCGCCGGACCGGCACCC
GCTGA
>lcl|NZ_CM001166.1_gene_20 [locus_tag=STTU_p0019] [location=complement(17607..18065)]
GTGGGAGCCGTGCGCAGGCTGGTCGACGAGGCCACCGGCGAAGTCGTGCCCTATGCCCCGTACGCCTTCT
CCGGCGGCGGACACGTCCAGGTCGACAAGGCGCGCGTCGCGGCCATCACCGAGAGCCGCACGTTCACGCC
GAGCCAGAAGTACTTGATCCTGTGGTGGATCGGCACGTCACCGCCCGGCATGGAACCGCTGCGCCTCACC
GGCGCGGACATCGCGAAACGGGTCGGCATGACCCCCGACGCGGTCGGCAAGATCAACCGGGCCCTGCGCC
GGCGGCGCATCCTGATCGAACGCGGCCGGGTGGGCAGCTACCGCTTCTACCGGATCAGCCCCTACATCGC
TTTCCACGGCAGCGGAGTCGAGCAGCGCGAAGCGATCACGCTGTGCAACCCGCCCGACATCCCAGGCTTC
GACAAGGACGCCCGCACGGCAGCGCAGGAGGCGCAGTGA
>lcl|NZ_CM001166.1_gene_21 [locus_tag=STTU_p0021] [location=18119..18415]
GTGCATGTGGGACGCCTGAGGGACGGGCTCATCAACATGGACGCACCCCACCCCTTCAACGCGGGGCCGG
ACGGGTCCCGGACGCCGGTCGAGGAATGCAAGAGCGTCAGAAGCCCACGAGGACCTCATGCCCGATTCCG
GGAAGCCACCCCCCCCTCCCTCATGTACTCCACGTGCATTTACCCGGTTCCTGGGAACTGGCAGGCAGAT
CCTGGGAACTGGCAGGCAGATCCCAGGATCGTGGTGTCCGACAACGTTTCAGCAGGTCGGAGGGGATTTC
CTGGCGCCGCCCTCTAA
>lcl|NZ_CM001166.1_gene_22 [locus_tag=STTU_p0022] [location=19059..19361]
ATGAAGCCGATGTTGGTGACGTACTCGTACTGGCCCCACTGCGAACCCAGGTCGACCACGACCTCGTCGA
CCCACCCGGCACCGGCGCAGGTTGAGGGTGCGGTCCGAAATCGTGAGCCCGGCCTCCCGGGCGGCGGCGA
GCTGGCGGGGGCTGCCGGTGAGGGGGCGCAGAGGGGCCGTGAGGTGACGGCGGGTGGTGACCGGGGAGGC
GACGAAGCCCGCGAGGCTGTCGAGGCCGCGGGGCGCGACGACGCTCTCGTGCACGGCGAGGCCCGCGCGC
CACCGGAATATGCGCACGCCTGA
>lcl|NZ_CM001166.1_gene_23 [locus_tag=STTU_p0023] [location=19390..20079]
GTGCACGTGTCCACGTTTTCCGGAGGACTCATGAAGATCGGCATTGTCGGCGCGGGACACATCGGCGGGA
ACCTCACCCGCCGTCTGACGGCGCTCGGGCATGACGTGAGCGTGGCCAATTCGCGTGGCCCACAGACGCT
GTCCGAGCTCGCCGAGGAGACCGGGGCCACCGCGGTTCCCGTCGCCGAGGCGGGGCAGGGCGCGGACATC
TTCGTGGTCACGATCCCGGTGAAGAACATCCCCGACCTGCCCGCCGGGCTCCTCGACGGCGCGACGGAGG
GGTTCGTCCTCATCGACACCGGCAACTACTACCCGCAGCGCGACGGCCGGATCGCCGGGATCGAGGACGA
GGGCCTCACCGAGAGCCGATGGACCGAGCGTCAGCTCGGGCACCCGGTGGTGAAGGTCTTCAACGCCACC
TACGCCCAGGACCTCCTGGACAAGCCGCGCCCCGCAGGCGCCGCCGACCGCATCGCCCTGCCCCTCACCG
GTGACGACGAGGAGGCGAAGAAGACCGTGACGTCCCTGCTCGACGAACTCGGCTTCGACGCCGTCGACGC
GGGCGGCCTCGACGAATCCTGGCGCCAGCAGCCCGGCACCCCGGTCTACGGGCTGGCCGCGGGCGCCGAC
GAGGTCGTCGCCGCGCTGGCCGCCGCCACCCCGGAGCGTCCAGCGCAATTCCGCGCCTGA
>lcl|NZ_CM001166.1_gene_24 [locus_tag=STTU_p0024] [location=complement(20276..20899)]
GTGGAGTTCATGCTCTGGGCCGGAGACCTGATCTGCGTACGCCGCACCCCCACCTGGCAACGCCTCCTCG
ACCTCCCCGAGCGCCACCTGGCCACCGCACTGCACACCAACCGCCTCACCGACGAGGAATGCCTCACCGC
CCTCCTCACCCACGCCGCCCGCGCCCTCGGCATCGCCACCACCGCCGACCTCGCCGACTACCTCCGCATC
TCCACCCGCACCACCGCCGCTCTCCTCCCGCACACCCCACTGCTGCCCGCCACCGTCGAAGGATGGACCG
AACCGGCCTGGGCCCACCCCGACGCCCTCACCCCACCCGCCCCGGCAGACGACCCACCCGTCTTCCTCGG
CCCCTTCGACAACCTCATCTTCAACCGCCCCCGCACCCAACGCCTCTTCGGCTTCACCCACACCCTGGAG
GCCTACAAACCCGCCGCGAAGCGCGAGCACGGCTACTACGTCTGCCCCCTCCTCCACCACGACCAGCTCA
TCGCCCGCGCAGACCTCACCCGCACCACACACGCCGTCACGATCACCCAGACAAGCACCGAAACCAACGC
GCCCGGGAACGCCAGCGCTCTTATCCACGAAGCTCTGCAACACCTCACCCACGCCGCACAGTGA
>lcl|NZ_CM001166.1_gene_25 [locus_tag=STTU_p0025] [location=complement(21382..22413)]
ATGGGCACCGCCACGATGACCCTGACCGCGACCGCCGCCGGGAGCGTCGCCGCCCGCTGGCCCTGGTGGA
CGACCCTCCTCCTCGTCCTCGCCGCCAACCTCACCAACCCGCCCCTCAACGCCGCCCTGCGTTCCTCCTG
GCGGCGCCTGGTCACCACACCCACCCAGCTCAAGACGGTCCACTCGGCCGACAGCATCCTCGAAGAAGCC
GGCTTCGTCGTCGCCCCCCTGACCGCCGGAGTCCTCATCACCTGGCTCGGCCCCGTGGCCGCCTACGAAA
GCGCCACCGCCCTCTACCTCACCGTCATCGCCCTCTACCTCACCGCCGCCCGCCTCTGGGGCCTCACCCC
CACCAAACCCCCCGCCGCGCAGGCCGGGCGGAGCGAGCGCGCGCGGCGCGCGCACCGCTGGCTCGGGCCA
CTCGCCCAGCCCCGCATCATCGGGATCATGATCCCCATGCTCGTCATGGGCACCCTGTTCGGCGGGACCA
GCATCTACGTCCCCGCCTACAGCCAGCACGAGCACGCCACCACCCTCATCGGCCCCCTCCTCGCCGCCAC
CAGCGCCGGCGGCGTCCTCGGCGGCCTCCTCTACGCCCTCCTGCCCACCCAGCGCCTGGCCCCCTGGACC
CTCTACCGGCTCCTGACCGCAGGGTTCGCGCTGCCCGCCTGCTTCCTCCTGGCCGCCCGCCCCCCCTGGG
CCCTCGCCCTCCTCCTCCTGCTCAGCGGCTTGTTCGTCACCCCGCTGTTCATCACCGCGTTCCTCCTCAT
CGACACCCACGCCACCGACGACGTCCGCACCGAGGCCAACACGTGGGTAGGCGCGAGCACGGACGTGGCC
AACGGCGTCGTCGCCGCCGTCATCGGCGCCCTCACCGCCCACAACAGCTTCACCACCGCCCTGACCGTCC
TCACCGCCTGCGCCGCCCTCGGCCTCCTGACCGCACTCCTCCTCCCCGCCCCCGAGAAGAGCACCGTGCC
CGAAACCTCCCCACACGTGCCCGCCAACGACGCACCGGCCACGACCGCGTGA
>lcl|NZ_CM001166.1_gene_26 [locus_tag=STTU_p0026] [location=complement(22689..23459)]
ATGGTTGATGTCGCGTTCACCGCGCTCTACCCGTGGAGCCTGCCGCCCGACAAGCCGCGTACCGACCGGG
CGGCCGCCCGGTCGGAGCGCGACCTGTACGCGGCGCATTTCCGGCACGCGCGGATCGCCCGGCTGCCCGC
GGACTGCCCGCCGTGGGCGCTCGGCCAGGATCTCGGCTGGGTGGTGCGCTCCCCGGTCACCGCGACCCTG
ACGCCGCTGTCGGACACGGACGTCGCCGTGCCCGAGGACGAGGACGTCAGAGCGGTGAGCCGCCGCGCGG
GCGGCGGGCAGATGTGGCGCCGCGGCCCCGACTGGATCGCCGTTCCCGACCAGGGCGGAAGCTGGCTGCG
CCGCTACGACTTCCGCAACTCCAGCGGGCAGTGGGAGGCGATGTTCCTGCCCAACGGACAGGGCACCGTG
GAGTGGCATCTCGGCGTCGCGGTCCGCCTCCCGCAGCCGTACTTCCTCATGGTCCTGCCCCTGGACCCGC
CCCTGCCCGGCCTCCACGTCCCCGTCGGGATCATCGGCGCGAAGACCGTGAACACCATGACGGACATCAG
CATCGCCATCCACCCCACCCACCCCGTCGCCGTCCGCCGCGAGCAGCCCGTCGCGCGCCTCGTGCTGCTG
CACCCCGACACCCTCCGCGCCACCAGCACCACCACCCCCCTCACCGCCGCGCCCCCCGCACCCGCGTCGA
GCCCACCCGACCCCGCCGGGCCGGCCGCACCGGTCGCTGCGCCCAACACCACGATCCTGGACGCCTCATG
A
>lcl|NZ_CM001166.1_gene_27 [locus_tag=STTU_p0027] [location=complement(23592..24644)]
ATGGCACGTAACGTCGAGTTCTTCTCGACCGACACCGACGACGGCACGATCTCGGTCGTGGCGAAGGCCG
GGCCTGGCGAGCACCGGCGGATCGACCAGATCCGGGTCGGCAACGCGCCGCGCGGCGGCGTGAAGTTCAC
GAGGTCCGGGCGCGGGTTCGTGTGCAACACCTCGCAGAACACGATCAGCGAGATCGACCCGGTCGCCCAC
ACCGAGGTGCGGCGGATCGAGGTCGGGCACGGCCCGCGCGGCCAGGGGCTGCTGCCCGGCGACACGTACC
TGCTCGTCTCCAACTCCGGCTCCGACACCGTCAGCATCGTCGACCTCGAGCTGAACGTCGAGATCCACCA
GGTGCCGGTGGGCCGCGACCCGCGGCACATGGGGATCAGCGCGGACGGCCGGAGTGCGTGGGTGTGCGTG
TGGGGCGCCGGCTACGTGAGCAAGCTCGACCTCACGGCGCTGGTGGAACGGCAGGACGCCGCCGGGGTCA
CCGAGGTCGCGCGGATTCCCGTCGACGCGAAGGCCCACCCCTACAGCCTCGGCATCGACCCCTCCGGTCG
CAGGGTGTTCGTCGCGAACACGCAGGCCACCTACGTGACGGTGATCGACACCGCCACCCACGAGACCCAC
CGTGTCGACGTCGGCTTCATCGGCGGCCGTGGGGTGGCCTTCTCCCCGGACGGGCGCCACGCGCTGATCA
CGGTCGAGTCCATCAGCCGGGTCTACGTCATCGACGTCGACACCCTCGCCGTTACCCGGCACATCCCCGT
CGGCGGCGGCCCCCGCGGCCTCGTCGTCGACCCCGCCGACTCCACCGCGTACGTCACGAACTTCTCCCGC
ACGAACCTGCGCGCGGTGGCCCCGGAGCTCGACTACGACCCCAACACCCTCACCGTCATCGACCTCGGCA
GCGCGCCTCTCGACCGCGAGGAGGGCGTCTTCGACACCGAGCCCCTCTACGTCGGCTTCGGCCCCTGCTC
GGTGACGATGTTCGACCTCGACACCCTGCCCGAGCAGGAACGCCAGCGCCGCACCGAGCGCCTCACCACC
TGA
>lcl|NZ_CM001166.1_gene_28 [locus_tag=STTU_p0028] [location=complement(24697..25320)]
ATGCAGGCGTTCGCCACGCCCGTGGCGCGGTGCCCGTACCCGGAGGCCGCAGCCGTGCGGGATGTCCTCA
CCGAGGCGGTCCTCTCCCGCCTGGGGGAGGGGAAGGTGTTCGGCTACAAGCAGGAGACCTCCCGGGACCT
GACCACATGGGGTGTGGCGGAGCTGGACGCGCTGACGGGCTGGGTCGGCCGGATGACGCGTCAGCTGGTG
GAGAAGCTGGCCGGCGTCCCGCTGGGGGAGGCGTTCGCGCGCTCGGCGGGCCGGGAGGGCGAGGGTGCGG
GGGTGCGGGCGGCGGGGATCGTGGCGTCGCGGAGCTGGGCGAGCGTGTACCGGGCGGGTGACCGGCATGC
GGCGCACTTCCACCCGAACACGGCCTGGTCGGCGATCTACTACCTGACCGCTCCCGGTGTGTGTGAGCTG
GACCTGCTCGATCCCCGCCCCGTGGGCTACTTCGATGCGGGGATCGTCTTCGCGGGGGAGGACCAGCGGA
TGCGGCTCTCCTGCTCACCCGGCGACCTCGTGATCATTCCGGGGTGGCTGCGTCACGAGGTGCCCGAATT
CCAGGACGACGAGGTGCGTATTTCCCTTTCCTGGAACCTGAACTACTCGCTCCATCGCGGCTGA
>lcl|NZ_CM001166.1_gene_29 [locus_tag=STTU_p0029] [location=complement(25613..25759)]
GTGCGGGCTCGCGCGGGGCGGCGGCGGTGCGGGGCCGGGGACCTTGCGGGTGCCGGTGCTGTGCGCCTGT
GGCTGCGCCGCTTCTGCTCCCGTGCGGGGCAGGTTTTCTCTGTGGTGCTGCAGGTGGGGGTTGCGTTTTG
GTGGTAG
>lcl|NZ_CM001166.1_gene_30 [locus_tag=STTU_p0030] [location=complement(25840..26139)]
GTGGATTGGGACGCTCACACCGAAGAGGTGCGCCTCGCGACCATCGCGCTGCCCACGGTGGTCTCCGATC
TCCTCGGGCGCCTCACGGACGAGATCGAGAAGCTGACCAGGTCGTCACCACTCGCTGCGGCACGCGCCGC
GCACCTCATGCAGGTCGCTGCGAAGCAGGCCGGCCGGTGGCCCGCGCAGAAGGCCCTGAACGACACCGAC
CGACACGATGCGGCCGTTGCGCTGGTCGTCAGCGAGAACGGCGCGCGCTCGTTGCTGGCGCATCTCGGTG
ATGTCAGCCTGTACGGCTGA
>lcl|NZ_CM001166.1_gene_31 [locus_tag=STTU_p0031] [location=complement(26139..26732)]
GTGTCTCACAGACGAGGCAGCGGCCCGGGCACTGAGGCCGCGCTTGCCCACGAGTTCTCCCAGCGGATCC
TGATCGCCATCTCCAACGGCACCAACGCCGTCGCGGCGAAACAGTCATCCGCCGACGCGGTCGTCGCCTC
TGGTGCGCTCGCCTGTTCCCTCGAGAGCGGCGTGCGGGCTCGGAGCGGGCGGCGACTTTCTGGTTTTTGG
GGCGGCGGCGGCTGGGAGGGGGCATTGTCGGAGCACCGTATCTGTAGCGCGGGTGGCGAGCGGCGGGTGG
AGGAAGTTGTGGTGGAGCGGGAGACGTGGACGGACCCGGAGTTCGGCTCCGAGCACGAGGGATGGGTCGG
TGTTCTGCTTGAGGACGGCACGGTCCCACCACCTGTTTTCTTCGGCTCGGAGAGCAGCGCTCATCACAGC
GAGGTGGCTCAGTGGAGCGTGTACATCGGCAGGTACCCCTACGGGCCGCGCGCCGCTGCGCTGCGGGGAG
CCTGTGCGTGCGGCTGGACCGGGCCCGCGCACGTGCTGGACTGGGGAAGATCGGCGACCGGGAACTGCAA
CTCGCCGGAGCCAACGCAGCGGACAACTGTGTAG
>lcl|NZ_CM001166.1_gene_32 [locus_tag=STTU_p0032] [location=complement(26773..27093)]
TTGCGAGACCAGTACGCCGACCACCTCAGCGCCTTCGGCGCCGCGGCAACTGAAGGAATCCAAGGTGTCC
TGGACGAGAGCAACTACGGGCAGCTGAGCTCCCTCGACTTCGACGAGACCGAGCAGGGCATCTTCGTCTC
TTTCACGATCGACCTGAGCGGCGAGGTCGCGGAGCGCTGGGGATCCGACGTCTACACCCGCCGCTACCTG
ATCATCAGGACGCAGGACGGACCTGTTGACCCGGTGGAATTCGGTGCCTCTCTCCTGCACACGAGTGTGA
TGGAAGACCTGGACACCGCTGGCAGACGCTCCGCGCGGTAG
>lcl|NZ_CM001166.1_gene_33 [locus_tag=STTU_p0033] [location=complement(27096..27581)]
ATGCGACGCGCGGCCATCGCTACCGGAGCCAGCATCGCCAGCACCATCGGGCTCCTCATCGCCGGCACAG
TCCCTGCACATGCGGCGGGTGAGAACTGGGCCGTCTACTCCACCCACTTCTCGCCCAAGGGACACGACAT
CCCGCTGCGGTACGGGCGGCACGACAACACGGCCGGGCACACGACGGGCTTCGGGAAATACCACATCGAG
GACCGCGGACACCTGCTCGGTGTCTCCTGGAGCACGTTCAAGAAGGACATCGACGAGACTCTCGACAGTC
CGACCATCAAGTGCAGCAAAAAGAACACCACATGGACGTGCGACTCCAACAAGATCAACGGGGTGAACTC
GACGTGGGGCAACATGAAGGTGTCGTACACCCACAGCACCTCGGGCACCCCCGACGGCCGCGCCCGTGGG
ATCATCACGGCCTACTACCTCAACGACTGCGGTTGCTTCGCCGCTGAGGAGAAGACCTCAAAGTGA
>lcl|NZ_CM001166.1_gene_34 [locus_tag=STTU_p0034] [location=complement(27778..28059)]
GTGGTCAAGGTGAGGGAGTACTGGCGCGGCGGCACGAAGGTACGGGCGCATACCCGCCTGCCTCCCGGCG
CGCGCAAGCAGCTGACCATCGCTCTCGTCGCCGTGGCGGCCGTCTTCGTCTTCAGCCACACCGGCCCCGC
CACCGAGGCGTCAGAGCCGCGCCGGCCATCGACGAACCGCTCCACACCGCCACCTGCGCCCGCAAGGGAG
AAGGAGGAGCCGAGGCCGGGGCCGAGCTGGACCGTCACCTACCCCATCCCCTGGGACCGCGACGGCTCCT
GA
>lcl|NZ_CM001166.1_gene_35 [locus_tag=STTU_p0035] [location=complement(28478..28843)]
ATGACCTCCCGCACCCTGGCCGCGACCGCCGCCGCCTTCCACGCCTTCTACGACCTCAACCACTTCGCCT
ACCGCGACTACGCCGGCGCCCTCCTCCCCACCGATGAAGCCCACATCCTCGTCACCCACGTCTTCACCCT
CCTTGCCACCGACTGGCCCCGCGTCATCGGCCGCCCCAACCCCGCCGCCTTCGCCTGGGCCCTCTTCACC
CACCACATCGCCCTGCGCACCGGCACCCCACGCACCCCCGCACAGGACGCCGCACTCCTCTACGACACCC
TCCACCACAGCATCAACACCATTGCCACCCTCACCGGAACCGAACCCACCCTCGTCGGCACCCTCATCAC
CGCCACCCGCCGCTAA
>lcl|NZ_CM001166.1_gene_36 [locus_tag=STTU_p0036] [location=complement(28851..29921)]
ATGAGTGTTCGCCCGCCCGCGCCCCGCTCCTGCCAGGACTGCGGCACACCGCTGGAACCCGAGCCCGCCC
GCTCCGGCCGGCCCGCCGCCCGCTGCGCGCACTGCCGTACCCGCACCCCGGCCCAGCGGCAGAAAGAAGA
AGAGGACCGGCAGACGCGCGCCTTCTGCGAAGACGTGCTGCACGCCGCCACCGACACCGTCGCCCGCCAC
GCCGCGGCGCTGCTGCACCAGGCTTACGGCACCACGGCCCCCACCGGCGACCTCCTCACCACCGTCGCGT
GCCTGCAGCGCGCGCTGACCGTCGTGGAGGCCGCCACCGTCGCCCGGGCCCGCGCTCTGCACGAAACCCA
CGCCACCGTCGCCGCCCACCTCTCCGTCTCGGCGGACCACGTCCGCAAGAAGTACGACAAGAAGCACCTC
GACCGCGTCCTCGCCCCCTACATGGACCCGTGGAACCCGACCCCCGTCTTCGCCGCGACGGACTCCGAAG
GCCCGCCGGGCCAGGAGCCCTCCCTGCCCCGCGCCCAGGAGTGCTCCGAACGCCGGGCCGCCGACCGCCT
GCGCGCCGCGCTCTCCCACACGATGCGCCGCTCCGCGGCCTCGCAGCGCGCCGTCGCCGAGGCGATCAGA
AGGCACCCCTCCTACGTCTCCCGGCTCCTGTCGGGGGAAAAGCCCCTGCACTGGCCCCACGTGCGGGACT
TCGCCCGCGTCCTCGGCATCGCCGAGCGCCTCCTCCTGCCCCTCTACAACGTCGCCGCCGGCATCGAACC
GCCCCCGGAGACCGATCCCGTCGCCTACCTGCGCGACTACCTCGCCGGCCTCCTCCTCTCCTGCGGCCAC
ACCCCCCACACCCTCGGCGACGCCCTCGCCTCCACCGTGCACCCCACCGCTGTCCGCGAAGCCCTGCACG
GCCCGGGCGTCCCCGACTGGGCCGTGCACAAGCAACTCGCCGCCGCCCTGTTCAGCCTGCCCAGCGACAT
GCGCCCCCTCTGGCAGGCCGCCCACCACCACGCCGTCGCCCAGGCACGCACCTCGACGCCCTCGCCGTTG
CGCGCCGAGCACTTCGGCTGA
>lcl|NZ_CM001166.1_gene_37 [locus_tag=STTU_p0037] [location=complement(30069..30230)]
TTGGCGGTCACCGTGCGCGGAAACCTCCTCACCGGGGCGCTCACCATGCCCTGGCTCCTCATCACGGGCA
CCTCGTCGCCCTGGACCGCTCCCGTCCTGGCCGCGCTGAGCACGGCCGCGGTCGGCTCCAGCGTCGTCTA
CCGGCGCGTTTGGCAGCGCTGA
>lcl|NZ_CM001166.1_gene_38 [locus_tag=STTU_p0038] [location=complement(30862..30981)]
GTGCGCCACGGCTCCGGGATGGACTGCGCAGAGCGGGCCGGCATGTTCGTGACCGAGCGCGCTCAGGGCC
AAGCTGAATCACGGGAGAGGCCGGGTGTGCGGGTCTGGGGTATCCCGTAG
>lcl|NZ_CM001166.1_gene_39 [locus_tag=STTU_p0039] [location=complement(31284..31400)]
ATGCCTGGTGCGCGACATCACTCGCCGCGCCGATGCCGCGCGAACCGGCAGCGTCCGGTCGGGCGGCGTG
CGGGTGCCTCGATGCCGGCGACGAGGATCTGGGCGCGCGCGGCGTGA
>lcl|NZ_CM001166.1_gene_40 [locus_tag=STTU_p0040] [location=31454..31849]
ATGATGATCAACGAGATCGGCCCTCGCATGGCCGGGGAGCGTCTGATGTACAACCGGGCCGTCAGGGTCG
ACCAGCCACGTAGTTGGCTGTTCGTCTCGGGGCACGAGGCTCGCGACGACGACGGCGGCATCGCTCACCG
GGGCGACATGGCCGGACAGATGGAACTGACGCTGCGGCGGCTGGGCGAGACCGTGGCCGAGGGCGGAATG
AAGATGGCGGACGTGGTACAGATCCGCGTCTTCACCACCGATCTCACCTCGTGCAAGGCCCACTACGGCG
TCCTCTTGGATGCACTCGCGGCGGTGGACTGCCGACCTGCCAGTCTGCTGGCAGAGGTCAGCGCTTTGTC
CGACGAAGACATGCTGATCGAGATCGAGGCCGTAGCGGTGTGCTGA
>lcl|NZ_CM001166.1_gene_41 [locus_tag=STTU_p0041] [location=32021..32137]
ATGCATCGCATCCGGACGGTCTGGCCCGGCTTCCGGCCCTTCTCGGTACGCCGGCTGGTGCTCGTGGGCG
GGTTCGCGCGGGGGCGCTTGAGGCGAGCTGTTGATGGGGAGATATGA
>lcl|NZ_CM001166.1_gene_42 [locus_tag=STTU_p0042] [location=32171..33139]
GTGGGGTGGAAAGATGAGTTTCAGATCGCGATGGGACAACTGGGCGAAATACGGGAACAGTTGGGGCGTC
TCGAGGGGCGCCTCGACGATCCGACGGCGGGGCTTGTCGCCCTGCATGGACAGGTCGAGCAGGCCCGGAC
GAAGATCCTGGAGAACGTGCAGGGAGGCACGACCGGGCTGCGCGAGGAGAATCGCGAGCTGCGACGTCGG
CAAGAACGCATGATCAGCGATCTGAGCGAGGCGAGGGCGGAGCTGAGCCGTCCGGCCCCGACCCGTGCGG
ATCTGTTGGAGAGCCCGGTCTCACACGTACCGGAGCTGGCCGAGGAGAAACCGAGTCAGGAGACCGACGC
GCCCGGCCCGGCCCTCACCGTTGTGGGATCCCAGGACGGCAAACGCCCCACCACGGATGAGCCGGAGCAC
GCCCTGCCCACGAATGACCTCTCGGGAGACAGCATGCGCAACTATGACCGGGCCGTCCGTGCGGAGCGGG
ACCAAGACCGTGATCTGCGGCCGTCGGTCGAAGCCGCCTACCGGGGCACCAGCGCCCCCGCCGGCCCGGC
ATCGACCTCTGGCTCTCCGGAGAAGGGCCTCCGGGTTGCCCACGGCGTCCTGCTCCTACGCGCCGCGGGG
GTGGCCTCGGCCGAGGTGGTCGCGCACCGGGACACCTGGGAGTGGCTGGCTTCTCTCGCCTCCGAGCACG
CCCACTTCCGCGCCCCGTTCGCGGTCGAGGACTCCGGAGAGGGGCGGGTACGGGTCGTGGTGTCCGGGCG
TTCACTCATCGCGCTGCTGATCACGTTGTGGGACACGCGAGCCGACGCCGAGTCCCCGGACGGGGACTGG
GCGATGGCGGTGACGACCTACACCAGGATGGCGAACGAGCTCTCCGAGGCCACCGGCGGCGACCACGAAA
TAGCCGGCGCCATCCGCATCGTCCTGGACGACGGCGTTCCGGAGGAGCGGAGGGAGTAG
>lcl|NZ_CM001166.1_gene_43 [locus_tag=STTU_p0043] [location=complement(33671..34279)]
GTGAAGGAGAGGGTGCCCTTCCCTTTCGGGATGATCCCTGAGCGCTGCTATTCCGGCGGTGGCGTACGGG
CCGCGCAGGGCGACGGTTATGACTGCGACTCCTACGGCACTGTCCAGACGACGAAGGAAACCGGCACCGC
CGGCACCCAGAACCCCTACCGCTTCGTCGGCGGCACCTACGACCGCACCACCGGCTACGTTAAGTTCGGC
CAGCGCTGGTACGACCCCACCACCGGCCGCTTCACCACCCAGGACAAGTACAGCTTCCTTGCCAACCCCG
GACGGGGCAACCGCTACGCCTATGCCGGCGGCGATCCAATCAACAACACCGACCCGCTCGGGCTCTTTTC
GTTCGCTGATACGGTCGGGATCGTCGCTGGTGGCCTGGCAGGAGCTGCCGGGGTGGCTGTGGTGGCGGGT
ACGTGCGCGCTGACAGCTGGAGCAGGATGCGTGGCGGGGGCTCTCATCACCGGTGCCATGTGGGGTGCAG
GTGGAGGGGCGCTCGGATCTACTCTCGCTGGCGGAGACTCTGCCGAAAAAAGCAATGGGACACTTGGCGG
TCTCGTCGGGGGAGCCACGGGCGGACTCGCGTCTCTGCTTTTCGGATAG
>lcl|NZ_CM001166.1_gene_44 [locus_tag=STTU_p0044] [location=complement(34590..34754)]
ATGCGAGACAAAGAGATCGCTCTGTACGTGGCGGGGGTTTGCCTTACTCTGGGGCTCGCCTTCTCTCTAT
ATAGAGAAAATTACACCCTCGCAATCCTGGCGGCATTTGCGCTGATCGTCAACGGATTCGCAATCTCTCA
GGAGAGGAGAAAGAAAGGCGACTAA
>lcl|NZ_CM001166.1_gene_45 [locus_tag=STTU_p0045] [location=complement(34754..38242)]
ATGTCTTCATCCAGCGTCCGCAGACGCTCGGTTCAGGTGGGGATCGCGACGGCTGTTGTGTCGGCCGTGG
CGGTGTGGGGAATGCCGGCCGCGTACGCGGCGGCTCCTGACGCTCCGTCGCAGCTGGTGGCGCTGACGGA
GAGCACGGCGCCGTACGTGACGGCGAAGGTGGTGGCGCCGTCGGGGAGCGGGAAGGTGACGGCGAAGTTC
TACGCCGGCACATATGCGGCCAACGGTGACAACGACCTCGCGGACGGCAAGGAGGTGACGGTCGATTCGG
GTGAGGTAGCACGGCTGAAGCTGCCCGACATGCGGATCGGGACGCAGTTCACCTGGCAGGTCAAGGCCTG
CGTCGACGACGACTGCTCCGACCTCTCCCCCCTCCAGACCACCCGGGTCAGCCCGATGACGGGCGCGGGC
GAGAGGCCCGGGGCCACGCGCCTGCAGTTCTCGACGGGCGACTCGACGGCCGCGCAGGTCGATGTCGGCT
CGGGCAATCTTCTGGTCAACGCCTCCGGGCTGACCTTGCCGGGGGTCAGTGGTGACGTGGGCCTGGGGGC
GGCGTACAACAGTGCGGCGATCGGCACGGATGCGACCTCGGCGAAGTCGCCACTGGGGTACGGGTGGCGG
CTGACCCCCTACGAGGTCGAACTGAAGGAACGCGGGGACGGCTCGGTCACCTACTACGGCCAGGGCGGGA
TCACCGGCCTGTTCGTGAAGTCGGGCAGCGGGTTCACGACGCCGGGCGGGTTCAAGGCCGACCTGAAGAA
GAACAACGACGGCACCTACACCCTCACCGACCACGGCTCCCAGTCGAAGCAGACCTTCACCAGCGCGGGC
AAGCTGACGAAGATCACCGACCGCAACGACAACGCCACCACGCTCTCGTGGAACGGCGACCTGCCCGACA
CCATCGTCACCACCCGCGGCACCAAGACGCAGCGCACGGCCGTGTACGCCTCGGCGAACGGGCGGGTCAC
GACGCTGACGCAGACCGCCTCGGACGGCAAGAAGCGCTCCGTCACCTACACCGTCGATGCTGCCGGAGAC
CTGGTGTCGATCAAGGACACCCTGGGCCGCACCACCAGCTTCACCTACACCGGGCACAAGATGACCTCGG
TGACCAATCCCGGGGGTGGGGTGACGCGTTTCGAGATCGGCGCGATCGGCGCCACGAAGATCACCCAGGA
GAACAAGGCCGCCGGCTCGCCCGGAGACTCCGTCACCCGCCTGTCCTACGCGGACCCGGACAAGACGGTG
ATGGCGTCCCCCAACACCGACCAGACGAAGACCGTGACCGCCGTTCCGCACACCACCTACGAGCTGACCG
ACAACAACTCGGCGCGGGTGGCGAAGGCGACGGACGCGGAGGGCCGGGAGCGCTCGAAGACGTACACGGC
GAACTTCGACACCGCCTCCTCGACGGACGGCTCGGGCGCGAGCGCGGGCACGACCACGAACACCTTCGGC
GCCAACGACGGCGAATCGCTGACCAAGTCGCAGGGTGCGGACGGCTCGACGTTCTCCGCCGCGTACGGCA
ACACGGCGGCGGGCTCGAAGTTCTCGCCCTCGGAATCGACGGACGGGCAGTCGAACAAGTCCGCCTACTC
CTACAACGGCGCGGGGAACCTGGCCTCCTCGAGCAACGCGGAGGCGGCCGAGGCGAAGGTCGACTACAAC
GACGACGGCACCGTCAAGACCAGCACCGACCCCGGCAACAGCACGGACACGTCGTACACGTACGACGGCG
ACAAGCAGCTCACCAAGGTCGACCCGGCCGGCGGCTCGCTCAAGTCCCAGTCGTACACGTACGACGCCTG
GGGCCGCCTGGCCGTTGCCACGGACGGCCGGGGCCTCACGACCACAACGACGTACGACGACGCCGACCGC
GTGACGAAGGTCGACTACTCGGACAGCACCCCTGATGTCTCCTACACCTACGACGCTTTCGGCCGTACGA
AGACCCGCACCGACGGGACGGGGACGGTCACCTATGGGTACGACGATCTCGGCGCGATGACGTCGCGGAC
CGCGACGTCGGGCGGGGGCACGCTGGCGTACTCGTATGACAAGAACGGCAACCGCCTCAGCACCACTGAC
GCGCGCGGCACCACGCAGTACAAGTACGACCAGGCCGACAAGCTCACCCAGGCGATCACCGATGCCCCGT
CGACCAAGACGAAGATCGGGTTCAGCTACGACGATCGCGGCCGGCGCACGGACACGTACTACGGCACCAA
CGACGCGAAGACGATCTTCAAGGCGCGCGTGCACCAGGACTACGACAAGTCCGGCCGCATCAGCCGCGTC
TGGGCCGACCAGGGCCCGGCGACCGACACGACCCGCCAGTTCGACGCCACGTACTGCCGCAGCCTCGGCT
CCACCTCGTCCTGCTCGACCGAGAAGGCCGACAACACCGACCTGATCCAGTGGAGTAAGGACAACCTGAG
CGGCAAGACCACCAAGTACACGTACGACAAGGCCAACCGGCTGACGAAGGTCGCAACCGACGGGGGTGGC
AAGACGTACACCTACACGTACGACGCCCGCGGCAACCGCAAGTCCTCGTCCGACGGCAGCGCGGATCAGT
CCCTGGCTTTCGACGCCGCCAACCAGATCACCAGCGACGGCTACACGTACGACGCCCAGGGCAACCAGAC
CAAGACCGCCAAGCTGTCCACGCTCACCTACGACGGCGCCAACCGCATGACCGGCGCCAAGACGGCCAAG
GGCACCAGCAACTACACCTACGCCGGCGAGGACGCCACCGAGCTCGTCTCCCAGACCAGCGACGAGGGCG
AGAAGACCGACTACGTCTACGGCGCCCCCGACCAGTACGGCATGCCCGTCATCGAACAGGTCACGCTGAA
GGAGGGCACGGCGTACATCGACCACGACCCCACCACCGGCCAGCCCCTCTCGCTCCGGACAACGAACGAG
TACGAGGCGTACTACATCGTCGACGGCATCGGAAACCCGGTCCAGTTCATCAACCAGTCCACGGTCCAGT
CCACGATCTACGACTACGACCCCTACGGCACCGTCCAGACGACGAAGGAAACCGGCACCGCCGGCACCCA
GAACCCCTACCGCTTCGTCGGCGGCACCTACGACAAAACCACCGGCTACGTAAAATTCGGCCAGCGCTGG
TACGACCCCACCACCGGCCGCTTCACCACACAAGACAAACTCAGTTTCTTCGCGAATCCCGCACGCGGAA
ACCGCTACGCGTACGCAGGAAGTGATCCTGCCAACGCGGCAGACCCAACCGGCCAGGATTACTACGACTG
CGCCTTCGCGGGACTCGTGTTTGTCGGGGCAGCGGGAACGGCAGTTCTCAGCAGCGGAGGCACAGCCCTT
TTCGGTGGCGCCGCTGCGGTAGGAGCCGGTGGTCAGTCGTACAGGGCTTGCCCCAAGGAAGCCAAAGAGG
GTCCCGGGCGGAAGAACTCGCTGAAGGCAGCAATAACCCCGATATGGAAAATTCTGTAA
>lcl|NZ_CM001166.1_gene_46 [locus_tag=STTU_p0046] [location=complement(38557..38748)]
ATGGGTGGCGGGGCTGGTTCGGGGGTGTTGGTGGTGGCGGATGGCGGTGGCGAGCAGCAGTCCCACGACG
CAGGCGGTGAGGCCCCAGAGGCCGAAAGCGAGGGCGAGGGTGTGAAGGCTGGGCATGGAGCGGGCTCCGT
GATCTGTGCGCTCGACGACACCGAGTGCGGCGAAATTGTGTTTTCTGAGTGA
>lcl|NZ_CM001166.1_gene_47 [locus_tag=STTU_p0047] [location=38936..40114]
GTGTCGAAGCTCGCGGAGCCGTGCTCGGGGTTGTTCGCAGGGCGCCGGGGTACCACGGCGGCGGGCAGTA
CGGTGATCGGACCAGAGAACGAGACGACGGGAGCGCCGGTCGGGTCCATGGTCGCTTTGGCGACGGTTCT
CGAGCCGAGCTTGCCCGCAGTATGTCTCGTGACTCGGCGTCCCGCTGAGGGCACACGCCCGCCCGGGGGG
CAGAGGTCGTGTGCGTCGGTGGTGACGGGTCGCAAGCGCATGCTGAGCATCTGGCGGATGCCATGCCGTC
CCGTCATCACGCTCCGCGCAAGCCATGCGGCATGTGAGCCCGCATGCCTACATCTCCCCGGCGAGCGCCT
CCCGTGCCTCTTCGGGGCCGGACCGGCTGCGCAGGGCGTCGCTGAGGCCGGTGACCTCGAGCAGGCGCAG
TACTGCGCCACCAGCGCCGGCCAGGGCGACGGGGCGGCGTGCACGGGTTTGGAGGAGGAGATTGAGGGTC
TGGGAGTCGGCGAAGGTGACCTCGCTCAGGTCGAAGACGACAGGTCCTCCGAAGCGGCTCAGGGCATCGT
CCACTGCTTCCTCCACGTCCTCGGCGCTGTCCATGTCGATGTCCCCGCCCAGAGCGATGAGCCACACGCC
CTGCCACAGCGTGCTGCGCAGGACCGGGTGACCCGCTCTCCTTCCAACATTTGTCATGCGGCAACTATCC
AGGGCCCCTCTGACAATGCCGCCCCCGGGTGTCCCTCCGGGCAACGCACACGCTCAGGGGTATCCGTTCG
CGGACAGAGGGTAGGCGCGAGCTATCCGAAAAGAGGAGCAAGGGTGCTTTCCCTGGAGTCCGCTGAACTC
ACCGCCGTTGACGCGCGACTCCTGGCACAGACGTACGCGGCCGCCCACTGCCCGCGCGTGGACCGTGCCG
CGGTGGCCCTGGTCGTGGCCGAGCTGCTCGCGAACGCCGAACGTCACACCGCTGGGAGCTGGCGGCTCGT
GGTCAGCCACAGCACTCGCCTGCTGAGCATCGCCGTCCACGACCTGGGCCGTCTTCTCCCTCTACCTGGC
AAAGTGGCGTTCGACGGCACCGGGCAATTCGGTCTGCGCATCATCCGCGGTCTCAGCGATCACTTCTCCG
TCCACTCCGGCCCGACGGGAAAGACCGTCACCGCACAGTGGCACCTCGCCACCCTCTGA
>lcl|NZ_CM001166.1_gene_48 [locus_tag=STTU_p0048] [location=complement(40801..41478)]
TTGCGCCTGTCCCGCACCATCCCCGCCGCCCTCACCGCGCTCGCTCTCAGCACCGCGCTCGCCCCCACCG
CGGCCGCCGCCGACCTTCCAGCCGCTCCCGGCGACACCGTGACCCTCCCGCTCCGCAAGGCCATCGCCGC
CCTCGACACCCGGGCCGAGAAGCGCACCGGCTACGAGCGGACAAAGTTCAAGCACTGGATCGACGAAGAC
CGCGACGGGTGCACCACGCGCAACGAGGTCCTGCTCGCAGAGGCCGTCACCGCGCCCGAGGAAGGCGCCC
GGTGCAAGCTGAGCGGCGGCACATGGCACTCCGCCTACGACGACACCACCATCACCGGGCCCGGCGGTCT
CGACATCGACCACTTCGTCCCCCTCGCCGAAGCCTGGGACAGCGGCGCCTCCGAGTGGAGCGCGAAGGAC
CGCGAGCGGTACGCGAACGACCTTGGCGACGACCGCAGCTTGATCGCGGTCTCAGCGAAGACGAACCGCA
GCAAGGCCGACCAGGACCCGGCCACCTGGATGCCACCGGCCGCCTCCTACCGCTGCACCTACGTCACGAC
CTGGACCACTGTGAAGACCAGGTGGGGCCTGTCGGCCGATACCTCCGAGAAGGCGACCCTGGAGCGCGTG
GCGGGGGACTGCCCGAACGTGCCGATCAAGGTCGAACTGGCCCGCTGA
>lcl|NZ_CM001166.1_gene_49 [locus_tag=STTU_p0049] [location=42413..43333]
GTGATCTCGGCTGGGGGTGGGTGTCGTGCGTGGCGGCGTGGGTGGGGTGAGGGTGGGGGGATGGAGTATC
CGGTGCGGGTCGGGCTTGCCCGCGCGGCCGCCGCGCTCCCGGCCGGCGACGGGTGGTGGTACGAGCCGAA
GTACGACGGCGACCGGTGCGTCCTGTGGCGGCTCGACACTGTCCGCCTCCAGTCCCGTACGAGCAGGGAC
ATCACCGCCGCCTGGCCCGACCTCACCACCCCCGCCACGGACCTGCCGCGCGGAACCGTCCTCGACGGCG
AAATCGTCATCTACCGCGACGGCATGCTCGACTTCGGCGCCGTACGGGCCCGGTCCTCCAGCCGCGGGCG
GCGCCTGCAGGACCTCGTCACCCGCCACCCCGCCCACTACGCCGCCTTCGACGTCCTCATGCACCAGGGC
CAGGACGTGCGGGCCCTGCCGTACGAGGCGCGACGCGCCCTGCTCCTGACCGTCCTCGAGCCGCTCGGGC
CCCCGCTCCAGGCCACCCCCGCCACCGACGACCACGACGTCGCGACCGTGTGGATGACGAGCCTGCGCCC
CCAGGGCATCGAGGGGATCGTCGCCAAACGCGGCACAAGCCCGTACCCGGTGGGCCGCCGCGAGTGGGTG
AAGGTGCGTCACGCCGACACCGTCGACGGCGTCGTCACCGGCTACCAGGGCCTGCCCTCACGGCCCTCGC
ACCTCTTCGTCCTCCTGGCCGACGGGCGGACCGTACGCTCGCAGCACCTCCCCGCCGCGCTCGCCGCCGA
ACTCGGCCACCACCTGCCCGGGCACGACACCGGCACCACCCACGACCCCGACACCGGCCCCCTCCACCTC
ACCGACGCCGCACTCGAGGTGGAGGTCCTCGCGGGCTCCACCCGGCACGCCACCGCCACCGTCACCCGCC
TGCGCACCTGA
>lcl|NZ_CM001166.1_gene_50 [locus_tag=STTU_p0050] [location=43687..43938]
ATGGCGGCCTGCTCCTCGTCGGAAGCGGCCAGCACTGGGGGACCCGCCAATCCAGCCGCTTCGGCGAAGC
CTGCCTCCGACAAGGGCTCCGGGAACGCGGACCCCGCGGGCGGAGGTCAGACTTCCACCACACCGGCCAG
TGCGGACCCGTCGGACTGCGCTGCCGCCGACAAGCCGGAGTGCGTGGTCGACATCGGGTCCATCGAGATG
GAAGAAGGCAAGCTCGCTGACGGGCCGCCCCAGACGCGCTGA
>lcl|NZ_CM001166.1_gene_51 [locus_tag=STTU_p0051] [location=complement(44116..44634)]
ATGCGTGCAAGCAAGCGAGCTCGGTGGAGCGTTCTGTCGGGTGCGGCGGCACTCGCTTTTTCTGTCCTGA
CCGTGTCGCCGGCGGTGGCTGACGAGGCGCCGCCGGGGATGGTGGAAGTGACCCTCCCGGCCGACATCGA
GATGGTCGAGGGCACGCCCGTAGCGCCGGGCGAGGAGCCTTCCACAGGGCTCTCGAAGGCGGCCGCGGTG
GACCGTGTCTGTCTCGGATTGACGGTGACCATTGGTTCTCAGGGCTGCTTCCAGCCCTACGGTGACGTCG
TCTTCTCCGGTGACACGCAGGCGGACGGCCGGTCCTCTGTCACCATCGTCTACACCGACTACGGTCGCGA
GCCCTTCGGCTGTTACAACAGCACAGGGGCGAACACCTGGGTCAAGTGCAACAAGAATTACCGGGAGGAC
GGCAACGTCTACCTCAAGGTCCTCCGCTACGACAAGCCCACGGGCAAGTACTACCAGCCTGAGGCGAAGT
CCAGCTGGATCCCGGTCGACGGCCAGTGA
>lcl|NZ_CM001166.1_gene_52 [locus_tag=STTU_p0052] [location=complement(44807..44941)]
GTGCAGCGGCCCGGCACCCTGCTCCCCGCGACCCGCGGGTACTCGCCCGCCCCTCCCGAAGCGGCCCACT
TGGTGTTGTCGGGTCAGGCGCGCAGGCGGCTGACGGTGAGGGTGGCGTGTGTGTGGGGGGCATGA
>lcl|NZ_CM001166.1_gene_53 [locus_tag=STTU_p0053] [location=44999..45376]
ATGGGCGAGGACGACGACAGCGGCGGGATGGAGCCGGGCGGGCCCGAGGATCCGGACTACCTGGTGGGCG
AGCGCACCAGCCGCCCCACCGCGGCAGAGCGGCGGGAGGAGGCGGAGGGGCTGTCCCGGCCGCTCGGCGA
CCCGGACGAGGCCGCGCACCGCTCCGCGCGCGGGCCCGCCCCCGGGCCGGTAGCGGGGAGAGAGGTGCGC
GTTCCCGTCCAGCCCGGCCCGCAGGACCGCGAGCAGTTGCCCCGCCCCACCGAGCCCGCGCCCCAGGCCT
CGCCCACGCCCGCATCGGGCTCGGCCGAGGAGGGCGGCGCCGGGACGTCACCGCGCCCGCACGGCCCGCA
GGAGCCGTCGGCGCAGGCCGGAGGGTGA
>lcl|NZ_CM001166.1_gene_54 [locus_tag=STTU_p0054] [location=45472..45900]
ATGAGGACCACCCGGCAACAGCGGCGCCGCTCGCGCGCGCTCTTCCGCAGCGCCCGCTCGGCGGTGAAAG
GACTGCGCCTGCCCGAGGGGGCCGGCCTCGAGGAGGCGGCCGTGCGCGTCGCCCTGCACATCGGCAGGCC
CCTGGCTCTCCTGCCCGCTGAGGAGCTGCCCCTCAACGGCGCCCTGACTCGCGCCATGGACGGCACCCTC
GCCGTCCGCGTCCCCGTCCGCGGCGCGTTTCGGGAGCAGCCGGATACCTATCTCGTGCACCTGGCCTGCC
GGGGCCTGGCCCGCGCCCTCCTCGGCGTTCCCGGGGATCCCCGTGCGGGCATCGACTACCGCACCGAGCC
GGAGCGGCTCGTCGAGCTGACCGCCACCGAACTCGGCGTGCGCCTGCGGCCCGCCACCGCCGACGCACAC
GGCCTCTGA
>lcl|NZ_CM001166.1_gene_55 [locus_tag=STTU_p0055] [location=46355..46636]
ATGCGGTCGCTGCGCGCGCTGGGCGGCATGGCGCCGCTGCCGGCCCGCGGCCTCGTGCTCGGTGCGCGCG
CAGCCGCTCCTCGAGGACGCGCTGGCGCTCGGCGGTGGGGAGGTCGGCTGCTCCTGGTCGAGCTCGGCAC
CGAGGCGGGAGCGGTGCGCGCGGCGGACGTGGATCACGTTGCCGCAGCTCTCGCAGGGCTGGTTGGTGTC
CAGGCTGATCCCGTCGTCGCACCGCAGGTCCGAGCAGGCCGGGCGAGGCTGCGGTGCAGCAACCACGGGT
AG
>lcl|NZ_CM001166.1_gene_56 [locus_tag=STTU_p0056] [location=46864..48033]
ATGGACACCGTGCACACGACCGCTGCCCTCCTCCCGGACCCCGCCGAACTCCGCGCGCACCTGCGCGCGC
TGGCAGTGCTGGACCAGGCGATCTGCCGCGACCCGCGGTTCCCCCGCTATTCCTTCTCCACCACCTGGGG
GCCTGGGACGGAGGCGGCCTTGATGGACAACGGCTCGGGTGACGACTTCTCCGTCCTCTTCACCCCGGTC
GGTGTGCTCGTCCGCGGCTTCGACCACGAGTCGGAGATGAGCCCGTACGCCACGGACGACGAACAGGTCT
GGCCCGGTGTCATCGACGAGGTGCCCGCCGCGCTGCGCCCGCTCCTGGACGACCCGACCTTCGTCGACGA
GGGCCTCGGCGCCCCGCGGGTCACCGCCTGCCTGTGGTGGGAGACCGGCGCCAACGCCTGGCGCACCGGC
TCGGGCATCGAGTTCCCCTCGGGCAACCCGGACCCGGACGGCTCCGGACACCTCTTCCACCTCCTCACCG
ACCGCTCCCCCGAGGCCGCCCAGTCCCACTTCGAGGAGGCCTACGGGCGGCCCGTCCCCCTCGACACCGT
CCGCCACGTCCTCGCGGGCCATCCCCTGGCCCCCGAAGCCGCCCGCGGCCTCAACCCGGCCGCCCTCTCC
GACGAGGCACTGCTCGGCCGGATCGCCGCCAACCCCGAGGTCGGGGCCTACCTCGCCCGCGACGGCGAGT
TCGACCTCACGCGGACCGACCCCATCGAGCCGATCACCCTGCCCGGCGGTCTCCCGGTGGAGCCCGTGGC
CGGCTGCAGCGCGGGAGGCACCCACTACCTCTGCGGCCCGGCTGGCTCCGACCGCGTCCGCCCCGTCCTC
TACACCGACTCCGAGGGCCAGGCTTCCCTCATCGCGGAATCCCTCGCCGAGGCCCTGACCCTGGCCATCG
CCCTTCCCTCCTGGCACGACGCCCTGGCCGGCGTTCGTCCCCCCGCGCTCAACACCGACTACCTTGAGGA
CAACCCGGACCACCCCGAGGTCCGCGACCGCCTCCTCGCCGCCCTCCGCCTACCCCCGGCCACCGAGCCC
GAGGTCCTGACCCGCCTCCTCACCACGGCCGCCCGCACCGTCCCGGACGGCTACCTCCCTTCGGTCGAAG
GCGACGAAGACACCACCTTCGAACCGATGCTCCGTCTACCGACCGAGTAG
>lcl|NZ_CM001166.1_gene_57 [locus_tag=STTU_p0059] [location=complement(48354..48935)]
GTGGGGTCCGCTCCGCTCGCGCGGAGGTCACCCGCCGAGCTGACCGGGCCAGTCGGCTGCTGCGCCGTGG
CCTACTCCGTTGAGCGACAGACGAATGCGCCGCATCGGCGGGTCGGCCACGGCGATCCGCGCGGTCATCG
CATCACCCACACGAATTTCCCTGGCAGGCTCTGCTGCGAGCAGTTCGGAGCTGTGAATCAGCCCTGCAAT
CCCATTACCAAGATCCACGAAGGCGCCGAACGGCACGACCTTGGTGACCCGACCACTGACAATGCTGCCC
ACGCGCTCAGCCCAGACCAGCCATGGATTTTCCTGCAGGGCGGCCAAGGACAGCACAGCCTGCCCATGCA
ACTCGGTGTCCAGGGCCAGAACCTCAGCACTCACACGCTGCCCCAGCGATACCACTTCATGGGCAGAGGA
GATCCATTGCCACGAAACCTCGGGCGGAGGAATGAACCCGACCGAAGTCTCCGGCGCTCCGTCGAGATCG
ACGAACACGCCAAAGGTCTCGACCCGGCTTACCATCCCAGCCACTACATCGCCTGGGCGGAGCAACTGGA
GGAAGTCTTTCAAGACCTTTGA
>lcl|NZ_CM001166.1_gene_58 [locus_tag=STTU_p0057] [location=49010..49252]
GTGTTGGTGCTCGTCTACCGGTACATCGAGCAGGTGAATCGCAACCGGAGCGTCCGGATGGTCGTGTACC
TCGTGGATCTTGGCGAGGGGGCCCTCCCGGTGAACGCGGCGAAAAACCTCCTGCTGGAGGAGGCGAGCGG
TGGCGAGGAGGCGGCGAAGGCGGCATGGCAGGACGCGGGCCTGCCCGAAGCGGGCGTGGTGACGTACGCG
GAGTTGGACCGGGCGCGCGGCAGACTCCGCTGA
>lcl|NZ_CM001166.1_gene_59 [locus_tag=STTU_p0058] [location=49311..50483]
GTGGCTATCACCTCTCACCCCCCTCTGGTTCTCCGTCTGGTCGTGACGGGGGGAGGCACGGGCGGGCATA
CCTACCCGGCCCTGACCGCTGTGCGTACGTTGCGGGAGCTGTTGAGGGCGCGGGGGCGTTCTCTCGATGT
GCTGTGGATCGGCAGCGCCGACAGTTTGGAGGCGCGTGTTGCCGAGGCAGAGGGGATCGCGTTCACGGCG
GTGGCCACGGGGAAGGTGAGGCGCTCGTCGAATCCGTTGAGGATGGTCTCGCCTGCGAATGTGCGGGACA
TGGCGCGCGTTCCGCTCGGTGTGGCGCAGGCGCGCAAGGCGGTCGCGGGTTTCCGGCCACATGTGGTGCT
CGCGACGGGCGGGTACGTGGCTGTGCCGACGGGGCTCGCTGCCCGGATGTGCAGGGTTCCGCTTGTGCTG
CATGAGCAGACGGTGCGGCTGGGGCTGGCCAACCGGAGGCTCGCGGGGAGCGCCTCTCGGATCGCGGTCT
CCTCGGAGTCGACGCTGCCGCTTCTGCCGGAGAGTGTGCGCTCTCTCGCGGTGGTCACGGGAAATCCGGT
GCGTCCAGAGGTGCTGACCGGGCATCCGGGCAAGGCCGTGGCGGCCCTGGGGCTGGGCTTCGATCTGGCC
CTGCCCACGGTCTACGTCACGGGCGGGGCGCAGGGCTCGCAGCAGATCAACGAGGTCGTCGGCGGGGAGC
TGCCGTGGCTCTTGGAGCGGGCCAACGTGGTGCACCAGTGTGGTCCTGCGCATTACGAGTCGCTGGCCGC
GCGTGCGGCGACGCTTCCTGCTCACCTGGCGGTCCGCTACCACGTGACGCCCTTTGTCGGCGCGGAGCTG
CCCGATGTGCTGGCCTTGGCCTCCGTGGTGATCTCGCGCAGTGGCGCGGGGACGCTCGCCGAGCTGACTG
CCCTGGGCAAGCCGGCGGTCTTCATTCCACTCGCGTCGGCGGCCGGGAATGAGCAGGCCCACAATGCCCG
GCACCTGGAGGAGTCCGGCGCGGCCGTCGCGCTCGTGGGAGAGGTCGGCGGGGAACGGCTCCGCGCGGCG
GTGGCCCCCCTGCTGGAAGATCCTTTGCGCAGGGAGGCCATGGCTGTGGCGGCACGGGCTCAGGGTCGCC
CGGATGCGGCGGACAGGCTGGTGGACGTGCTGCTGACCGCCGCATCGGAATGA
>lcl|NZ_CM001166.1_gene_60 [locus_tag=STTU_p0060] [location=complement(50498..51475)]
GTGACCTCCGGGACCGCCGCGCTCCACACGGCGCTCGTCGCGGCCGGCGTCCAGCCCGGCGCCGAGGTGA
TCGTGCCGTCCATGACGTTCTGCGCCACCGTGCAGACCATCCTCGCCGTCGGCGCGACCCCACGGTTCAT
CGACATCGACGCCACCACCCTGTGCGTCACCCCGGACCTGATCAAAGAAGCGATCACCGACGCCACAACC
GCTGTGATGCCGGTGCTCTTCGGCGGCCGGGCCATCGACCTCACCCCGATCCGCGAGGACCTCGCCCACC
GCGGCATCACGGTCATCGAGGACGCCGCGCACGCCTTCGGCTCCCGCAACCCCGACGGCACCGGATTCGT
CGGCAGCGACAACTCAGTGCTGACCTGCTTCTCCTTCGGCGCCATCAAGAACCTGACCTGCGGCCAGGGC
GGCGCCGTCATTCCCCGCACCCCCGACGAAGCGCACACCCTCCGCCGCCTGAGACTGCTGGGAATCGAAC
AGTCCCAGAGCGAACGCGCCGAGACCACCACCTACCAGGTAGGCGGCTTCGGACTGCGCTACCCGCTCTC
GGCGCTCAACGCCGCGATCGGCCTCGCCCAGCTCGACCACTTCGACGAGACCGCCGTCACCCGGCGCCGC
CTCTGGCGCGCCTACCGCACCGCCCTCTCCGGCCTTCGCGACGTGCCCCTCATCGACGTCGGCGCCGACC
GCGCCGTCCCGCACCTGTGCCAGATCCGCGTACCGCGACGGGACGAAGTCTTCGCACACCTGCGCAAGGC
GCACATCGGCGTCGGCGTGCACTACCCGCCCAACCATCTCCAGCCCGCCTTCGCACCCTGGAGCCGGTCG
CTGCCCGCAACCGAACAGGCCGGCGAGGAGATCCTGAGCCTGCCCTTCCACCAGCACCTCACCGAGGCCG
ACATCGCCCTCGTCGTGCACGCCCTACGCGCCGCGCTCGAAGCGACAACCATCACTCCCCAGGCCTAG
>lcl|NZ_CM001166.1_gene_61 [locus_tag=STTU_p0061] [location=complement(51646..52758)]
ATGCTGAGCGAGGCTCCCGCTCTCCCCTTCGCCGACGCCACGATGATCATCTCGACGCGGGACGCCGACG
CCATCGCCGACGCGCTAGGCGACGTCCGTCCCGCCGGGATCGTGGGAGGCGCGAGCGACGCCGCCCTGGC
CACCTGGCACACCCTGAGCCAGCGCTACTGCGCCCCCTACGTGTACCCGGAGGGCGCGCTCGCCGCCGGT
GACAAGGGAGCCTTCCACGCGATCACCGCGTCCTGCGGGGTGAGCGGATACGGGTGGATCGCGTCGGAGG
ACGAGGAAGAAGTCGTCGCGAAGGCAGCAGGGTTGCGCTTCCCGCTCATGATCAAGCCCACGGACGGGTC
GGGCAGCAAGGGCGTGACCCAGATCGACGCGCCAGAGGAGCTTTCCGGTGCTGTCGCGTACGCCCGCTCG
TACTCCGCCTCCCGCACCGTGATCGCCGAGGAGTTCGTCCCGGGACGCCCCGTGACCGTCGATGTGTTCA
TGCGCGACGGCAGGGCCGTGATGACCTCCATCAAGGATGAGGACTTCATCGACGGGGGCTTCGTCCTCCG
GCGAATGCGCACCGCGCAGCTCGCGCCACCCGCCCAACGCCACCTCGAAGCCACCGCCGAGCGACTGTGC
CGTGCGCTCGGCATCGACAACGGGCCGGCGAACTTCGACATGGTCCTCGGCCCGGACGGCCAAGAGCACG
TCATCGAGGCCAACGCACGCCTCGGAGGAGACGGCATCCCGCGACTGCTCGCTGCCGCGTACGGCATCGA
CGTCGTACGGGCGCTCATCTCCCTCGCCCTCGGACAAGCCTTCCACGACCACCTGACACCCACGCGCGCC
GCGCACGCGGCCCTGGAGCTGATCGGCTCGCCGCACGCCACGGAAGGCGAACTGATCACGTGGGAAGGCA
TCGCCGAAGCCCGCGGTGTCCCCGGCATCACCGATATCGAGATATACGCCAAGCCGGGCGATCTCGTACG
CCCCCACGACCAGTCCGGCCACAAGATCGGCATGATCGTCGCCGCAGGCGCCACGGAAGCCCAAGCGCTC
GCGGCCCTGGAAAGCGCGAGCACCCTGCTCAGGCCGATCATCCGCCCCAAGGAGGGATCGTGA
>lcl|NZ_CM001166.1_gene_62 [locus_tag=STTU_p0062] [location=complement(52862..53890)]
ATGGAACATGTGCTCGTCACAGGCGGCGCCGGCTTCATCGGCTCGCACTTCGTGAAGAGGCTCATCACGG
CTGAAGACGTGGCCCGCGTCACCGTGCTCGACGCCCTCACCTATGCCGGTCATGTCGAGAACCTCGGCAC
GGCCTTCTTCTCCGACAAGCTGCGCTTCGTCCACGGCAATGTGCAGGACGCCGACCTCGTGAACGACGTC
ATGGCGTCCGGCCCCACCGCCGTCGTGCACTTCGCCGCGGAATCCCACGTCGGCCGCTCCTACGGAGCGG
CGAGAGAGTTCCTGTCCACGAACGCCCTCGGGACGCAAGTGCTCGTAGACGCCGCTCACCGCCACACCAT
CGGCAAGTTCGTCCACGTCTCGACCGACGAGGTCTACGGCCCGCTCGTCCAGGGGAGCGCCACCGAGCAG
GCGGCGCTCCGCCCCTCCGTCCCCTACGCCGTCTCCAAGGCTGCCGGTGACCTGGTAGCGCTCGGCGCCT
ACCAGACCCTCGGACTCCCTGTGTGTGTGACGCGCAGCAGCAACAACTACGGGCCGTACCAGTACCCCGA
GAAGATCATTCCCCTGTTCCTCACCCGGCTCCTGCGGGGGATGCCGGTGACCTTGCACGACCGGGGCCAG
CATGTGCGCAACTGGCTGCACGTCGAGGACAACTGCGCCGGGATCGAGGCCGTCCTGCGCGACGGTAAGC
CCGGCGAGGTCTACAACCTCGGTGGCGGAGCCGACCTGTCGAGCAAGGACCTGACCGGATACCTGCTCGC
CGTGTGCGGCGCGACGTGGGACGCCGTCACCTACATCCCCGACCGCCCGGCCAACGACATCCGCTACTCG
ATCGACTGGGCCAAGGCCCGCGACCAGCTCGGCTACCGGCCCAAGCGCCGCCTAGAGGACGGGCTCGCCG
AGACTGCGGAGTGGTACCGCCGAAACCCCGACCGGTGGGCGCCCATCGCACGCGGCAAGATCCCCGCCGT
CCCCCTCGCCCGCACCATCCCTTCCGGAAAGGGAAGCCCGCATGCCTGA
>lcl|NZ_CM001166.1_gene_63 [locus_tag=STTU_p0063] [location=54154..55476]
ATGAGTCACGACGCGCTCGCGCTGCGCGTCAACGAACTCACCTGGCATGCCGGAATTCGCACGCAGTACA
CCAATACGAGTGTTTCCAACTGGGTGAAACGCGGCATGCTCCCCCGCCCTCCGACACCCGACTGCATCGC
CGCTGCGCTGGGCGAACACCTGGGCCGACCGGTCCACGTCACCGACATCGGCATGAGCGAACCGCGCGGC
ACGATTCCCGACATAGGGTTGGATTTCCCGCGTGAGACCGCCGACGCCGTACACGGCGTCCTCGCCTTCT
GGAGACACGTGGACCGCAGAGCATTCCTGAACCGCAGTTTCGCCATCGGCGCCTTCGCCGTCCCGGTCAC
CCGGTGGCTCGCCGTCCCCGCCGACGCCGCGAGCAGTCACCACGATGCTGGAGGCCAGCGCGTGGGGCGC
GAGGATATCGCCCACTTGTGGACCGCCGTCGAGGAGGCCCGCGTGGCGGACTCCCAGTTCGGCGGAGGGA
ACTGGAAGGCGTCCTCCACAGCCGCATGCCTGCGCGAGTACGCCACCCCCCTGCTGAAGGGCACCTACAC
CGAGGAGACCGGCAAAGCCCTCTTCGGGGTCACCGCCGAACTGACCCGGCAGATCGGCTGGTCCGCCTTC
GACGCCGGGCACCAGGGCGCCGCCCAGCGGCACTTCATCCAGGCCCTGCGCCTGGCGCGCGCCGCCGCGG
ACGTCCAGGCCGGCGCCTACATCCTCACGACCATGTCCCTGGCCGCCTTCCTGCGCGGCCACCCGACCGA
AGCCGTCGACATGGCCGAGGGAGCCTACGAGCGCGCGAAAAACCTCCCGAACGCCGAGAAGGTCCTCTCG
TTCGCGAAACTCGCACAGGCTCGAGCGCACGCCCGCGCCGGGCAAACACGCGAGGCGACCACCGCACTCG
CCCTGTCAGAAAACCTCCTCGACCGGACTCGCACGGAGACGGCTCCGGCGTGGATGGCCTACTACACCCG
CGAGCGCCTGGCCACCGACGCCACCGAGATCTACCGCGACCTGGGCCGCACACACGACGCGCTCACCTGG
AGCCAGCAGGCCGACACCATGCCAGCCCAGCGCTACACCCGCGCGGTCGGCATCCGGCTCGCGGTGGAAG
CATCCGCGCACCTGCACAACAACGACCTGGAACAGGGCCTGGCCGTGGCCGACCACTCAGTGCAGCTCCT
GTCAAAAGTCCGTTCCGCTCGCGCCCACGGGTACGTCCACAGCCTCACGACCATGCTGGCGACCCGACAG
CGCGACAAGCGCGTCACCGCCTTCATCGAACACGCTCGCCGGAACCTGCCTGCCCCAAGCTAG
>lcl|NZ_CM001166.1_gene_64 [locus_tag=STTU_p0064] [location=55634..55990]
GTGAAGCTGGACGACCGGCCCGGAGCATCCCCGCGCGTGGGCTCGACTTCTTGGGTGACTCTACGCGTCA
GCCCATCTGCGGAGCATCCCCGCGCGCGCGGGCTCGACGGTGCGTGGAGTTTCGATCTCACCCCGAACGC
CGGAGCATCCCCGCGCGCGCGGGCTCGACCCGCCGCTTCACCGGGCGGACGAGTCCCTCTCGGGAGCATC
CCCGCGCGCGCGGGCTCGACCCGGAGCGTCCACGCCGTGTTCGTCGTGGTGGTGGAGCATCCCCGCGCGC
GCGGGCTCGACACGGGCCAGATCGCCGCCCGCGTCGTCGCTCACGGAGCATCCCCGCGCGCGCGGGCTCG
ACCATAA
>lcl|NZ_CM001166.1_gene_65 [locus_tag=STTU_p0065] [location=55994..56386]
GTGTTAAGCACTACGGCGGCTAGACGGAGCATCCCCGCGCGCGCGGGCTCGACCATCACCGTGACCAACG
TCGCCACCGGCGAATCCGGAGCATCCCCGCGCGCGCGGGCTCGACACTTGTTGACCTGCAGTTCTACTGG
CAGAAGTGGCCTTTTTTATTCAGTTGTTTTTGGGACGGGCGGAGAGAACAAGGCCGTCGAAGTCGACCGG
TTGCCAGCGGTTGCGGCCTGCGGTGCGGACTGCCCAACCCTGTTCGTTGCGGGCTGGTTCGACCAGGATT
GCTTGGCCGTCGCCGATGCGGGCGGCGAGGAGTTCCCAGAGGCGGTCTCGGATGCGGCGGCTGGGATTGC
CGACGAAGACGCCTGCGCTGGCTTCGATCATCCAGCGGGTTAG
>lcl|NZ_CM001166.1_gene_66 [locus_tag=STTU_p0068] [location=complement(56431..57438)]
GTGGCCGACATCTGGTGGAAAGCCGACCCCCACGACCTGCACCGTCTCACCGACCGCGTCTCCAGCGTCT
ACGTCGAACGCAGTCATCTCGACCGCGACGAGAACGCCGTCGTCATCATCAATAAGCGACAAACCGTCCG
TGTCCCCGCCGCCATGGTGGCCGTCATGCTCCTCGGCCCCGGCACCCGCACCACCCACGCGGCCATCCGG
CTGCTCGCCGACTCCGGCACCACGGTCTGCTGGGTCGGTGAACAAGGTGTCCGTATGTACGCTGCCGGCC
TCGGCCCCAGCCGGGGCGCCGGCCTCCTGCACCGCCAGGCATGGCTCGTCACCCGGCCCAAAGAGCGCCT
GGCCGTAGCGCGAGCCATGTACAGCATGCGCTTCCCCGGCGAAGATGTATCGGCCCTGACCATGCAACAA
CTCCGCGGGCGCGAAGGCACACGCGTCCGCAAGCAGTACCACCACCACGCGGAACGCACCGGAGTGCCCT
GGAACGGTCGCGTCTACGTCGCCGGCGACGCCCACGCCGCCGGCGATGACCTCAACCGGCTCCTGTCCGC
CGCCAACGCAGCCCTCTACGGCATCTGTCACGCCGTCATCACCGGCCTCGGCGCCAGCCCAGGACTCGGC
TTCGTCCACACCGGCAAAGCCACCTCCTTCGTCCTGGACATCGCCGACCTCTACAAAGCCGAATACACCA
TCCCCCTCGCCTTCGACCTCACCGCCCAAGGACTCACCGAAGAACGCGACGCACGACTCGGCCTCCGCGA
CCTCATTACCCGTGACAAACTCCTCACGCGCATCGTCACCGACGTGAAAAACCTCCTCACGCCCGAAGGA
GCCGAGTTCGAGGACTCCGAAGCCAACCTCCTGTGGGACGAACAGGTCGGCGCAGTTTCCGGGGGAACCA
ACTACGCCGACTCAGCAGATTTGTCCGTCTACGGAATAGGAGACAACCACATCGCGGTCATCGGTCCCGA
TCTCGACGAAACCGGCCCCACCTCATGA
>lcl|NZ_CM001166.1_gene_67 [locus_tag=STTU_p0066] [location=complement(57444..58196)]
ATGCCCTACCTCTCCCGCATCCGCATCAACCCTCTGCGCACCGCGAGCCGCACCCTCCTCGCCAGCCCCC
GCGCCCTGCACGCCCAGGTCCAAGGCGGCGTCCCGACCCTCCCGAACGAGTCCCGCACCCTGTGGCGCCT
GGACGCGGACAACCCCCACCGCCCCGAGCTGTTCGTTCTCACCGCCGGAAAACCCGACTGGACCCACCTC
GTCGAACAGGCCGGGTGGCCCGGCGCGGACGGCGAGCACTACGCGGTACGGGACTACGCGCCCCTGCTCG
GACAGCTGGCGCAGGGCCGGGAGTTCGCCTTCCGCCTGACCGCCAACCCCGTCCAGAACACCAACCGCCC
CGACAAGCCCACCGAGCGCCAGCAAGAACGCCTCGACGGCGGCACACGACGCAGCTTCCGCCTCGGCCAC
CGCACCGCCGCCTCGCAGCTCGGCTGGTTCCTGACCCGCACAGCCCGCTGGGGCTTCGACGTCCCCGCCG
CCTCCCACCTGGACGGCACCCGCGACGACCAAGACGAACCACCACGCGACGTGCGTATCAGCACCCGCCG
ACGCCACTCCTTCGGCAAGCCGACCCGCGCCTCCAAGGAAGACCGGGTAATCATGCACATGGTGACCTTC
GAGGGAAAACTCCGCGTCACCGACCCCAGCCTCCTCACCCAGCGGCTGCTGGCCGGGATCGGCCCTTCCA
AGGCGTACGGCTGCGGGCTCCTCACCCTCGCCCCTGTGCCCGCGAAGGCGTGA
>lcl|NZ_CM001166.1_gene_68 [locus_tag=STTU_p0067] [location=complement(58203..58775)]
TTGCGGGACTACCACACCGTCAGCGACTACCGCGGCCGCCCGCTCCTGGCCGCCGCGGTGAACGCCAAGG
GCACCCAGAGACTCACCGGCCCCGCCAAGTACACCCACATCACCCAGCGCTTCTACCTCCAGGACGCTGT
CTTCCTCGCCGCGATCGAGGGCCCGGCGCACTTCATCACCACCCTCGAAAACGCGGTACGCCACCCGGCC
TTCCCGCTCGCTCTCGGCCGCCGCTCGTGCGTCCCCGCGCAGCCGCTCGTCCTGGGGCAGCGCACCGGAC
CGCTGGAGGAGGTACTGCGCGCGGAACCCTGGCACGTCACCGATGCCGTCCGGAAGCGGTGGGGACGCCG
CAACGGCAACGCCGCCCACGTCGACCTGCCCCTCACCCTCGACGACCCGGCCGGCGACGACACGCGCGAG
GACCTGCCCCTGTCCTTCGCGCCTACCAGCAGGGCCTACACCAGCCGCCGCGTCCGGCACACCTACGCCG
CCGCCCCCACCGGCCTCACACCCCACCCCGACCAGCCGCCATCCACCGGCGGCCACGACCCCTTCGCCCT
CCTGGGCTGGTGA
>lcl|NZ_CM001166.1_gene_69 [locus_tag=STTU_p0069] [location=complement(58997..60151)]
ATGCCACAGCGCCTTTTCATCGACGTGCACATCGTCCAGACGGTCCCGCCCGCCAACGTGAACCGTGACG
ACCAGGGGAACCCGAAAGAGGCCGTCTACGGTGGCGCACGGCGCTCGCGCGTCTCCTCCCAGGCGTGGAA
GCGGGCGACGCGCAAGCACTTCGACACCACGGTGCCCGAGCCGGACCGCGCGACCCGCACCAGGCGCCTG
ACCAGCGAACTCGCCAAGCGGATCGTGCGTGACACGAAGCTGGAGCGTGACAAGGCCGACCGGCTCGCCG
GCGCGTTGTTGACCCGGCTCAACCTGAGCCAGGGGAAGAAGGCCAGCGACACCGCCTACCTGCTTTTCTA
CGGCAACGCCCAGCTCGACACGGTCGCCGCTCTCGTCAGCGGGCAGGCCCACGACCTGGCCGCGCTGGAT
GACGAGAAACTCGCCGCAGAGCTCAAGGACTTGCCCGTCGCCGACGCCTTCAGCACCGGACACCCGGTCG
GTGTGGCGCTGTTCGGCCGCATGGTCGCCGACATCCCCAAGCTCAATGTCGACGCCGCCGTGCAGGTGGC
GCACGCGCTGTCGACGCACGAGACACAGCTGGAGTTCGACTACTTCACCGCCGTCGACGACAAGACCGAG
AAGGAGGAGACCGGCGCCGGGATGATCGGCACCATCGCCTTCAACTCCGCGACGCTGTACCGGTATGCCA
CGGTGGGTTTCGCCCAGCTCGCCGACAATTTGGGCGGTGACACCGAAGCGGCCCTCGATGCCCTGGACCG
CTTCGTCGACAGCTTCGCCCGCTCCGTGCCCACCGGCTACCAGAACTCCTTCGCCCACCGCACCCGGCCC
AGCCTCGTCGCCGTCGTGGTCCGCGAGGACCAGCCCGTCAACCTCGTCACCGCCTTCGAGGAACCCGTCG
TGTCGGAAGCCGGCATCCAAGCCGCGTCGGTACGCAGCCTGGCCCACGAGTACGCGGCGGCCCGCAGCGC
GTGGGGCGACGTCCCAGTGCACGCGGCGGCGACCCACACCTTCGCCTCCGGCAAGCCGGGCGCGACGGAG
ACCGTGGAGGCGCTCACCGAAGCCTTCGGCACCTCGGTCCCCTTCGACGAGCTGCGCTCGGGCCTGCGCG
CGTGCGTCAGCGCCGTCCTGGAGGCCCAGGGATGA
>lcl|NZ_CM001166.1_gene_70 [locus_tag=STTU_p0070] [location=complement(60270..60863)]
ATGACCGAACAGCGCTCTGCCGCGCAGAGGATCTGGCACCGCCACATCGCCGCGGACGGCACCTGGCGCA
CCACGAAAGGCACCGCGGCCGCGAAGCGGCCGCCGGGCGAGGACCTCGCCGTGCTGCGCCGGGGCCTGAC
CCGTCCCGCCGGCACCGTGCTGGAGATGTTCCCCTTCTACACCTGCCCCATCGACGACTTCGCCGCCCGC
AAGGGGCAGATGTCCGCCGAGCAGGAAGCCGAGCACATCGCGCTCGCCCTGTACGGCCTGCACCAGCAAA
GCCAGGACCGTCCCATGCACCAGCCCGGCGTCGGGCTGGGCCGGGCGATGCTCGTGTTGCGCGGCCACGA
CAAGACCAGTGCGGACGCGGTCGACCGGCGTTTCCAGCAGACCTTCTCCACCACGTCCCTGACGGCGCTG
CAGAGCCGGCTGCGCGGGCTGGTCACCCAGCTCAAAGACATCAAGTGCCCGCTCGACTACGACCGCCTGA
TCCTCGACGTCCAGGACTGGAGTCGCCCCGCAACGCGCTCACGAGTGCGGCGGCGCTGGGGCCTGGACTA
CTACGGCTGGACCCAGCGCTCCAAGGAATCGTGA
>lcl|NZ_CM001166.1_gene_71 [locus_tag=STTU_p0071] [location=complement(60959..62689)]
ATGGGGTTTGGGTTTTCCCTGCTCGAGGAGCGGTGGCTGCGTGTGCCGCCGGCGGTCGGCGGTCTGGCGC
GGGAGCGTTCGCTGAGTACGGTGCTGCTGGACGCGCACGAGTTCGGGGACCTGGCGGTGGAGAGTGCCAC
CCAGCGGCCGGCGGTACTGCGGCAGCTGCTTCTTCCGGTGGTCGTCGATGCGCTGGGCCGTCCCGCTGAC
GAGCGGGAATGGACGCAATGGTTCGCCGCCGGGCGCTGGACGCCCGAGCAGCGCGCGCGGCTCACCGCGT
ATCTGGACGCGTACCGTGAGGCGTTCGGTCTCTTCGATCCGGTGCGGCCATTTGCGCAGGTGGCCGGGCT
GCACACCCCGAGGGGGGAGACGAAGAATGCCGCCCTGATCGTGCCGCACGCGGCGACCGGGAACAACGTC
CCGCTGTTCGCCTCGCGTACGGAAGGGGACGTGTTCGCTCTGACGCCGGCGCAGGCCGTGCTCTGGCTGC
TGCACACCCACTGCTGGGATACGGCGGCGATCAAGACCGGGGCGGTCGGCGACCCGCAGGCGAAGGCGGG
CAAGACCACAGGGAACCCGACGGGCCCGCTTGGCCAGATGGGCGTCACGCTCCTGGCGGGCAGGACCCTG
TTCGAGACGCTGCTGCTGAACCTCCCCGTGGGCGCCGCTCCCGTGTCGGCGGATCTGCCGCAATGGCGGC
GACGGGATGCCGAGCATCCGCTGTCGGCCGGGACGCCGCGCTGGCAGGAGCGTCTCCCGCAGGGGCTGCT
GGATTTGTGGACCTGGCAGTCCCGCCGGGCCCTGCTCGTTCCCGAGGCCACCGAGGAGGGCGTGCGTGTG
ACGCGAGTCCTGGTCGCGGCCGGGGACCGGATGCCGTACACGCCGGAGATCGAGCCGCACACCATGTGGC
GCACGGAACCCACGGGTGGCCGCAAGCCCGCCAAGAACAAGGGACGCATTGTGCCGCCGCGCCGGCCGTT
GCGTCTTCAGCCGGGGAAGGCCGTGTGGCGGGGCCTGGACGCGCTCCTCGCCACGGAACGTGCGACGCGG
GAGGCGGGGGAGGGGACGAGCGGGTTCGTGACGAGCAAGGTACTGGATCAGGCCGGAGGTCTCGTCGCCG
AGCTTGGTGAGGGCTACCCGCTGCGGGTGGAGCTCACGGGTGTCGCCTACGGCAATCAGTCGGCGGTCGT
CGACGACGTCATGCACGACGCGCTCCCCCTCCCGCTGGCCGCGCTCGAGGTGGACAGCTTCGTCCGCTCC
GCTCTGCTGGAAGTGTGCGAGCAGGCGGAGCAACTGGCCGCCGCCGTCAACCATCTCTCCGCCGACCTGC
GTCGCGCGCTTGGCACCGAGCCCATTCCGTGGGACCGGGGCCAGCGTCCCGGCGAACTCGTCCTGCACGC
CCTCGATCCGCTGGTGCGGCGGCTGCTGGCCGGGATACGGCATGTGGACGACCTCGAACGTATCGATGCC
GGGCAGCTGGCGTGGGAGCAGCTCGCCTGGAGCCGGGCCTGGGCGGTCGCGGACCGGCTGCTCCAGGCCG
TACCGGTCAGCGCGTTCGCGGGCCGGAGCACTTCTCAGGGGGAAGGGAAGCCTGAGCGGACCCACCGTGT
CTCGCTCGCCGAGTCGTTCTTCCTCAAACGCCGCGCGGAAATTTTGCACCGGGCCGCCGCTGCCCGGCGC
GAGAGCACCGCGGGCGTCGCAGAACCGGCCGGCCTGCCCACCGCATCCTGA
>lcl|NZ_CM001166.1_gene_72 [locus_tag=STTU_p0072] [location=62699..62821]
TTGAAACCTTCTCTGTTTAACCTACGCACACCCACCACGCGCGCGGGCAGGTTTCCCGCAATCCGATGCG
AGAATCCGTTGACCGACAACCGACCCCACCCCTGGCGCTGTCCGCGGGGATGA
>lcl|NZ_CM001166.1_gene_73 [locus_tag=STTU_p0074] [location=complement(62922..66026)]
GTGTCGCCGCGGCGGTGGGGGGGTGGGGGCCTGCGGGTGCGGGTCAGCCCATCTGGGTTCGGGCGGTGCC
CTTGTATCACGGGGTCGGGGGTGGCGGGTGTCGTTTTGGTGATTCTCCTTATCGTTTGTGCAGTTCAGAG
GGTGTTGTCGGTGGTGCCGTTTACGATCCGGTTCTCGAATTCGTGTGTGAGGTGGGGGTTTTCGGTGGAT
GTGAATGAGCTGGCGTTGAGGTACGGCGCGGCGGTGGTGCGGGGGCTGGAGACGTTGTGGGGGAAGTCGC
GGGAGAGGGCTGCGGGGAGGACGAGTCTTCTGCTGGGGCATCTGCTGGATACGGCGGCGGTTGCGGAGCT
GATGTGGGAGGAGTTCTTGGCGCCGGCGACGCGTTCGGCGCTGGATGAGGTGGCGGGTGGGGTGGGGTGT
GGGCGTGGGTTGTTTGTGTGGTTGTGCGCGGTGCATGACTGCGGGAAGGCGACGCCTGCGCATCAGCGGT
TGTGGGATGAGGGGGCTGAGGCGGTTCGTGCTGCTGGGTTGACGTGGCACGAGCCTTCGGCTGTAGCGGG
GGCGAAGCAGCGTTGGCGGCACGACTGGGCCGGTGGGCTGATCGTTCGGGAGTTGCTGGGGGAGGTGGGG
TGGAGTGGCGAGCAGGTGGACTGGGTGTGGCCGCTGGTCGCCGGTCACCACGGGGCTTTCCCGACGCTGA
AGGACGTGCGTGAACCGGGGTCCGCGAAGCGGCAGTTGCGCGGGATCGGGGTGTGGCGGGAGGTTCAGCG
CGCACTGCTCGATGTGGTCTCGCGCGAGGTGGGCTTTGCGGGGCCGGCGGAGGTGGAGCCTGTGGTTGTT
CCGTCGAGGGCATTGCAGTTGCAGGTGAGTGGTCTGGTGGTGATGGCGGACTGGATCGCGAGCGACGAGC
GGTACTTCGGTGGGGTCGATGACCTGCGAGAGGTGAGTGCGGAGGGTTCTCGTCGGCGGGCCGCGGGGGC
GTGGAAGGCGCTGGGGCTGCGTGGTGGCTGGGGTGAGCGGGGTGTGCCGGGGCGGGAGGTTTTTGCGGGG
CGGTTCGGGTGTGTGCCGCGGCCGGCGCAGCGGATGGTCGTCGACGCGATGGGGGATATGGGGGGTGCGG
GGCTGGTGGTGGTGGAGGCTCCGACGGGGGAGGGGAAGACGGAGGCGGCGCTGTTCGCCGCGGAGGTTCT
GGCGGCGCGGTTTGGTGCGGACGGTGTGTTCGTGGGGATGCCGACGCAGGCGACGAGTGACCCGATGTTC
TCCCGGGTGCGTGGGTGGCTGGGGGCGGTTTCGGAGGAGTTCGCGTCGCGGGTGGTGCTGTTGCACGGCA
AGCGGGCGTTCAACCGGGAGTGGAAGGGGCTGGTGGAGGAGGGGGCGGGGGCGAGGGAGGCCTTTGGTGG
GGTGGATGAGTTCGGTTTGGCTGGTGATCCGTTCGGTGTGAGCGGGGAGGGGGGTGGGGAGCTGGAGTGT
CAGGCTCTGGTGGAGTGGTTTTTGGGGTCGAAGCGGGGTCTGCTGGCTCCGTTCGTGGTGGGGACGGTTG
ATCAGCTGCTGTATGCGGCGACGCGGACGCGGCATGTGATGTTGCGGATGGCGGGGCTGGGCGGGAAGGT
CGTGGTGCTGGACGAGGTGCACGCGTGCGACGTGTACATGAGTCAGTTCTTGCACGAGGCGTTGCGGTGG
CTGGGGCAGGCGGGGGTCCCGGTGGTGGTGCTGTCGGCGACGCTGGCCCCGGCGCAGCGGCGGGGCTTGC
TGGAGGCGTATCTGGCGGGTGCGGCGTCCGTGGAGGAGTTGCGGGTCGAGGTGCCGGCCGCTGAGGGGTA
TCCGAGTGTGACGACCGCGTGGTCGCCGGCTGGGGGCGAGCCGCAGATCCGGGTTCGGGCGACGGGTAGC
TGGCGGGCGGATCTCGGGGTTGAGGTGCGGGTGGTTCCTGAGGCGGTTCCGGGGCGGGGGAGTTCGCGTG
AGGAGCGGGAGCGGGCGCAGGCTTCTGCGGATGCGCGGGTGGGGGAGTTGCTGGCCGGTGAGCTTGCCGG
GGGTGGTACGGCGCTGGTGATCCGTAATTCGGTGGCGCGGGCGCAGAGCCTTTTCGAGGAGTTGCGGGGG
CGTTTTGGCGGGGATGAGGTGCGGTTGCTGCACGCGCGGTTCACGGTGGCGCGGCGTGCGGAGCTGACGG
AGGAGTGTTTGCGGCTGCTGGGGCCGGGGGCGGGGCGTTCGCGTTCGGGGCGGTTGGTCGTGGTGGCGAC
GCAGCTTGCGGAGCAGTCTTTCGATGTGGATGCGGATGTGCTGGTCACGGATGTGGCGCCGGTGGATCTT
TTGTTGCAGCGCGTGGGGCGCTTGCACCGGCACGAGGGCACGTGGAGGCCGGAGGGGCTGCGGGTTCCGC
GTGTCTTCGTGACGGGTTTCAGTCCTCGTGAGGGGCGGGAGCCGGAGTTCGTGTCCGCGAGTGAGGGGAT
CTACGGGCGTCATCTGCTGTTGCGGACGGCGGCCGTACTGCCCGGTGCGGGTGTGGGGGCGAAGGCGGGT
GCGGGCGGGGTGTGGCCGGTTCCGGGGCGGGTGCCCGCTCTGGTCGAGGAGGTGTACGGGGATGAGGAGT
CGCTCTTGCCCGAGGGGTGGCGTACGGCGGGTGAGGCGGCCCGGAGCGAGCAGGAGACGCAGGACCGGGA
GCGGGCGCAGAACGCGCGGCAGTTTTTGCTGACGGGGCCGGGTGAGCACGAGCGGCGGACGCTGGCCGGG
TTGCATTACGGCGGGGGGACGGCGGGCGGCGGTGAGGACGCGTTGCGGGCGGCGGTACGGGACGGGGACG
AGTCCGTGGAGGTCGTGCTCGTGCGCCGCGACGGGGACGACGGAGCGTTCCGGACGCTTGCGGGGCGGGC
GCTGAGTGTCAACGGGGACGTGGCTCCAGAGGTGCTGGAGGAGGTACTCGGTTCCGTGGTGCGGCTGCCC
GCGAAGTTCACCAAGGCGGCCGCAGGGCTGGCGCCGCTGCCGGGCTGGCACGGGCATCCGTGGCTCGGCC
GCAGCCGTGCTCTGGTGCTGGACGCCTCGGGTAGGGCCCGGCTGGGCGATTTCGCGGTGGCGTACGACGG
CGTGCTGGGGTTGCGGCAGGTATGA
>lcl|NZ_CM001166.1_gene_74 [locus_tag=STTU_p0073] [location=66048..66248]
ATGTTCCGGGCCGCTTCGAGGAGACAGGCAGCATCGCCCGGTTGCCCCCGCGCCTGCGGGATCCTCCAAG
CTGGACCTCATATGGCAGGACCCGTCTGGCGTCGACCCCGCGCACGCGGAGATCCTCCGTTGAGGCCGCA
GCCGGGCATCCACTCGCTCAGGTCGCGGGTACCCTCCTACCCGTCGATCCACCGGTCGTGA
>lcl|NZ_CM001166.1_gene_75 [locus_tag=STTU_p0075] [location=66460..66621]
GTGGGGATCAGTCGCGCCGCCGAGCGGCTTTCGGGGGTTTTCGGGGGTTACGGTGTTGACGTGGAGGGTG
AGAGCTGGTGGGGGCGAGCTGTTGTTTCTGTTCTGGGCTCAGTAGCCGGCCGGAAAGCAACTGAAGGAAA
ACCGGCAGACCGGCTGGTATGA
>lcl|NZ_CM001166.1_gene_76 [locus_tag=STTU_p0076] [location=complement(66753..67187)]
ATGCCACTGGTCCTCATCCCGACCGACACCGTGGGAAGATCCCCGCGTGCGCGGGGCCGACAGTTCGAGC
GCGGGCGAGCGGCCGTCCTGCGTCGGAAGATCCCCGCGTGCGCGGGGCCGACCCGTGCACCTGATCGGCG
AACAGCTCACGACCAGGAAGATCCCCGCGTGCGCGGGGCCGACACCTTGCCCCTTGTTGTCACGCCGACG
CTGGTTCGGAAGATCCCCGCGTGCGCGGGGCCGACGTGCCGTTCCAGATGCTCTACCGGCTGTGGGACGG
AAGATCCCCGCGTGCGCGGGGCCGACGCCCGCTCGAGCGCGGCCTCGCTGAACGAGACCGGAAGATCCCC
GCGTGCGCGGGGCCGACGCGCCGACGCGCCGCCAGGCGGCCCGCAGACGCGGAAGATCCCCGCGTGCGCG
GGGCCGACCCGTTGA
>lcl|NZ_CM001166.1_gene_77 [locus_tag=STTU_p0077] [location=complement(67221..67508)]
GTGCGCGGGGTCGACGCCCGCCGTGCCGAGCCGGAGGCACCCGGCCTGGGAAGATCCCCGCGGGCGCGGG
GCCGACCACCTCCCTCGCTTCGGCCTCGCGGAGGCGATCGGAGGATCCCCGCGGGCGCGGGGCCGACCGG
AGCCGACTCGGCGGACAGGTACGGCTTGTCCGGAGGATCCCCGCGCTCGCGGGGCCGACGCGCCGACGCG
CCGCCGCGAGGCGTGCAGCCGCGGAGGATCCCCGCGTGCGCGGGGCCGACCGGTGGAGCCTGCGACGACT
GCCCCTGA
>lcl|NZ_CM001166.1_gene_78 [locus_tag=STTU_p0078] [location=68014..68478]
GTGTGCGTCGGTGTTCCCACCGATCGTTGCCCCCGCGCCTGCGGGGATTTTCCGGACCTCTTCGAGTCGT
TCGCCGCCCTCGCCCGGTTGCCCCCGCGCCTGCGGGGATTTTCCCTCACCAGCTACGACCGTCCCACCGC
CCGGAACGTTGCCCCCGCGCCTGCGGGGATTTTCCGAGCAGCCGCAGACCACCGACGTGTGGAACGTGGT
CGCCCCCGCGTCGGCGGGGATTTTCCGTCCACCCCCGCCGCCTCGGCCCCGGACATGTGGTTGCCCCCGC
ACCTGCGGAGATGCTCCGGTTCGGTGGGCGGAGTGCCACGGCTCGATCGGGGCCGGGTTGTCGCCGTGTT
CGTTGGTGTCATCGCCTATGGGCTTCTCCTCTTCTTGGTGGATGAGGTGTTCTGCGTCCCGAGTGGGGCG
GAAGTCGTAGGTCACTCTGGGCTGCACGGCCCCTTCTCAGCGTAG
>lcl|NZ_CM001166.1_gene_79 [locus_tag=STTU_p0079] [location=complement(68637..68768)]
GTGTGGTGCGAGACCACGCTCCAGCCCGGCATCGACGACATCGACCTCGGCGCCCGCCCCGCCACCCGCA
CCGGGCCAGCCTGGTTCCCCCGCGGCTGCCGCCGCTGCTGCTACGGCAGGGACGAACGATAA
>lcl|NZ_CM001166.1_gene_80 [locus_tag=STTU_p0080] [location=complement(68843..69370)]
GTGATCTGCGGCAGCCCCTATCGCAAGCCCGTGCACGCCGCGACCTACGGGGCCGGGCGCAGGAGGCGCA
GCATGACCTCGACTCTCCTCCCGAGGGCCCACCCCGGGTGCGCATGGCTGACCGAAACCCTGCTCGACCC
GTCCCCCGCCTACGCCGACTGGCAGCGGGAACGGCTCGCGCCGGTGCCCTCGACGGGAATCTGGCGGGTC
GTCGAGGCCCCGCTCTACCCGTCGATCGACGCCTTGTGCGTGCTCCGGATGAGCGGCAACGCCGGTCCCG
TCCAGGGGTCCTCCGACGCTCGCCGCGCCTGGTGGCTCGTGGCCGCCGGGACCGCGACCCTCCTCACCGA
CGTCCCGGGCACCCTCGCCCACCCCGCCGGGTGGGTGCTCGACTGCCCCGCACCCGGCATCGGCGCCGCC
GGGCGCACTTGGCTGCACCCGCCCTACGGCACCGGTCTCCTCACTCCCGCACGCCTCCTCCGTGAAGCGC
TCCTCGACGCGCGGGAGATGGAGGTGATGGAGCGGTGA
>lcl|NZ_CM001166.1_gene_81 [locus_tag=STTU_p0081] [location=69530..69790]
ATGTCGTTACGGTTCATCGGGATCGACCCGAACACAGGAGACAAGGAGAGCCCGACCGTCTGGGTGGACG
AGGAGCACAGCGAGCTGGTCTTCCAGGGCTGGGTGCCGTCACCGGCCCTGGAGGCGGAGTGCACGGCCAC
GGAGGTACCGGGCCACGCGAAGGGGATTCCCGAGGGGGAAGCGGTCGTCCGCATCCCGGCCCGGATGGTG
GAGATGGTGAGGGAGGCGTGCGATGCCATCGAGCAAGCCCACGTTCGATGA
>lcl|NZ_CM001166.1_gene_82 [locus_tag=STTU_p0082] [location=69828..70286]
ATGCGCGACGCCTACGCCGTGGACTACGAGAAGGGTCCCTTCGCGGACTGGCGCGCCGGACACCGGCTCA
ACCCGGCGGAACGCGAGACCTGGTGGCGTCCGTGGCTCGACCTCATCAGCGAAACGGTCGACCGCGGCGC
GGAAGTGCGGCGCGCGCGGATCGTGTCCGAGCCGGTCAGCGAGTACACCCGCTTCCTCTACGACGGCACC
TTCACCAATGTGGCCGCCGGGGAGCAGGTCCGCTGGCTGCCCCGACGCCAGGCATCCGACATTCCCCTGC
CGGGCAATGACTTCTGGCTCTTCGACGGCGTGTGGGTGCACTGGAACCACTTCGCCGGGGACGGGTCATC
GCTCGGCGCGGAGATCACCGACGATCCCCGCGCGGCGGCTGTGTGCCGTGACGCCTTCGAGCAGGTGTGG
GAACGAGCTACACCGCACGACGAGTACAAGATCCGCTGA
>lcl|NZ_CM001166.1_gene_83 [locus_tag=STTU_p0083] [location=70357..71166]
GTGGCCGAGCGGCTGCGCGACCTCCGCCGAGCCGCAGGGCTCACGGTGACAGAGCTGGGGGCGGCGTGCG
GCTGGCACCACGCAAAGACGTCCCGGATCGAGAACGCCCGTACCGCGCCCTCGGCCAAGGACATCACCGC
CTGGTGCCGTGCATGCGGAGTTGAGGCGCTGACCGGGGACCTGGTGGCGCAGTCCCTCAACGCCGAGTCG
ATGTACAGCGAGTGGCGCGACCAGATGCGGGGCGGAATAAAGCGCCTCCAGGAGTCCTTGACGGACTTCT
ACCGGGAGACGCGCCTGTTCCGGGTCTACTCCTCCACGCTCATCCCCGGGCTGTTGCAGACGGAGGGATA
CGCCGCGGGCCTCCTCACGGCCATCGCCGACTTCCGCCAGATCCCGGTGAACGACGGGGCGGAGGCGGGC
GCCGCCCGGGTGGCCCGGTCTCGGGTCATCTACGAGCCCGGCCACCGCTTCGTCCTCCTGATCGAGGAGG
CCGCCCTCTACTACCGGATCGGCGACGACGAGGCAATGGCCGCCCAACTCGGCTTTCTCCTCACGGCTGG
TGCCCTGCCCGCCGTGTCGCTGGGCATCGTCCCCTCGTCGCACCCACAGCGTCGGCAGTGGCCGCACGAG
ACGTTCCACATGTACGACGACGCCTTCGTGTCGGTCGAACTGCTCTCCGCGCAGGTGAAGCTGACCCAGC
CCTCCGAGATCGCCCTGTATTTGCGGGCGTTCGAAGAGCTGCGGAGCATGGCCGTCTACGGCGCGGACGC
GCGCGCTCTGGTCGTGCGGGCGATCGACGCGTTGCGGTAG
>lcl|NZ_CM001166.1_gene_84 [locus_tag=STTU_p0084] [location=complement(71258..71626)]
GTGACGCACGGCTACGAGGACGAGTGGGGGCCATCCCCGCGCGTGCGGGGACCATTCGATGTGGCAGTGC
TCGCTCTGCGGCACCTGGGGGCCATCCCCGCGCGTGCGGGGACCATCCGCATCCGTGAAACCCGAGAAGG
CGACCTTCGGGGCCATCCCCGCGCGTGCGGGGACCATTTCGACTTCCGGCATGTCGCTGACCTGCTGTTT
GGGCCATCCCCGCGCGTGCGGGGACCATACCGTCTGGAAGTCCTCGTCGGGGGTGTCCATGGGGCCATCC
CCGCGCGTGCGGGGACCATCAGCACGGGCATCCCAGGCCACGACCGAGCGTGGGGCCATCCCCGCGCGTG
CGGGGACCATACTTCGTGA
>lcl|NZ_CM001166.1_gene_85 [locus_tag=STTU_p0085] [location=complement(71631..71861)]
GTGAACGTCTACAACGGCGGAGGATCCCCGCGGGCGCGGGGCCGACTTCTGCGAGAAGGTCGCGCAGCGC
TTCGCCCGCGGAGGATCCCCGCGCTCGCGGGGCCGACGCCGATGAGCGCGGTGGCGGTGGAGGCCGCCGT
GGAGGATCCCCGCGTGTGCGGGGACCATCCCACGGTCGTCTTACCGACGGACCCAGCCCGGGGGCCATCC
CCGCGCGTGCGGGGACCATAG
>lcl|NZ_CM001166.1_gene_86 [locus_tag=STTU_p0086] [location=72035..72163]
GTGGGTTTCGGGGGTTACGGTGTTGATGTGGAGGGTGAGAGCTGGTGGAGACGGGCTGTTGTTTCTGTTC
TGGGCTCAGCGGCCGGTCGGAAAGCAACTGAAGGAAAACCGGCAGACCCGCTGGTATGA
>lcl|NZ_CM001166.1_gene_87 [locus_tag=STTU_p0087] [location=complement(72171..72287)]
ATGCCGGGCATGGCTGCCCGGAGGATCCCCGCGCTCGCGGGGCCGACTACAGCTCCGTCCCCGAGATGTG
GAGCTTGTACGGAGGATCCCCGCGCTCGCGGGGCCGACACTTGCTGA
>lcl|NZ_CM001166.1_gene_88 [locus_tag=STTU_p0088] [location=complement(72469..73953)]
GTGTGCGGGGTCGACTCCACCAGCGAGATGACCGCGAGGGGAGAGTCCCCGCGGGGACGGGGCCAACGAG
GCGGTGCTCCTCGCCGTACGACGTACTCACGGAGGATCCCCGCACACGCGGGGCCAACTTCAACCGCGCC
GACGAGCCCGGCCGGGGCGGCAGAGGATCCCCGCGCTCGCGGGGCCGACTTCGCACCACCATCCTGTCTC
GTCTCGACGCCCGGAGGATCCCCGCGCTCGCGGGGCCGACTCGAGCACGGTCACGGTGTCGTGCTCGCTG
AACGGAGGATCCCCGCGTGCGCGGGGCCGACCTGGCCGAGACCCTCGCGACCCTGTCCCTCAAGGGAGGA
TCCCCGCGAGCGCAGGGTCGACCCGCCCCTCGCCACCCGGCCTCGGGAAGACCGGGGAGGATCCCCGCGC
ACGCGGGGCCGACGCTCATCCGCGCGCCGGGCCAGACTCACGCGCGGGGAGGATCCCCGCGCTCGCGGGG
CCGACCTAGGCGGCGGTGAGCGTGCGCTCGGTCAGGGCGGAGGATCCCCGCGCTCGCGGGGCCGACGCGA
GCCGGAACTCGCCCGCCTCCGCACCGAGCGGAGGATCCCCGCGCTCGCGGGGCCGACAGGGCCCCCGCCA
GAGTTCCTCGGAGAGCACCCGGAGGATCCCCGCGCTCGCGGGGCCGACCGCCTCGAAGTCCACGCCTCCC
CGGACAGCGGCGGAGGATCCCCGCGCTCGCGGGGCCGACGTGGTCGAACACGATGTGCGCGGACAGGTCG
AGGGAGGATCCCCGCGCTCGCGGGGCCGACGCGGGGCGGACCTGCATCCGGGTGCCGTCCGGAGGATCCC
CGCGCTCGCGGGGCCGACCTCGTCGGTGACCGGGATGTGATCCCATCCCCAGGAGGATCCCCGCGCTCGC
GGGGCCGACTGCATGGCCCGGTCGGCCGCGCGAAGGGAGAGCGGAGGATCCCCGCGCTCGCGGGGCCGAC
CGGCCGCCGTGGCGCCGCCATAGCCTCCTCCACGGAGGATCCCCGCGCTCGCGGGGCCGACGATACCCAG
TCAGGAGACGTCATGGCTCTACACGGAGGATCCCCGCGCTCGCGGGGCCGACCGGGGTCCCGGTGGTGCT
GTAGCCGCCAAGCTCGGAGGATCCCCGCGCTCGCGGGGCCGACGAGCTCTGGGAGGACAAGGACGCACTG
GGCAAGGGAGGATCCCCGCGCTCGCGGGGCCGACGCCGTCGCGGCGTTCCTCACGGTGCAGGCGACCCGG
AGGATCCCCGCGCTCGCGGGGCCGACGCATCGGGTCCCCTGTTCGGGGGCGACCACGGCGGAGGATCCCC
GCGCTCGCGGGGCCGACTCCTGGGGAGATGAGGTGGTGCACGTCAAGGACGGAGGATCCCCGCGCTCGCG
GGGCCGACGGGCGCTACCGCCTCGGGGAGACCTTGCAGAGCGGAGGATCCCCGCGCTCGCGGGGCCGACC
ACTCGCCCCTGGTGA
>lcl|NZ_CM001166.1_gene_89 [locus_tag=STTU_p0089] [location=complement(74275..74394)]
GTGCGCATCAAACGTCCCGCAGAGGTTGTTCCCTACCAGCACTTTCAAAGACTCCCCTTGAAATTATTTT
TCATCGAGACTCTGAATTTCTTTTTTCCCGGCAAGCGCAAGGGGTTGTGA
>lcl|NZ_CM001166.1_gene_90 [locus_tag=STTU_p0090] [location=75091..75234]
GTGGTGCATGCAAAAGAGGGAGGGGCCGCTACCTGGTTGGCAACGACCCCTCGTGTGTGGCGTTTGGCCG
ACTACGAGCAGACCCAGATCATCAGCTGGAGCTGCAACTCCATCAGGCTGACGATGAAGGTCCATAGCTC
GTAG
>lcl|NZ_CM001166.1_gene_91 [locus_tag=STTU_p0091] [location=75768..76622]
GTGTCACTCCTCAACGCCGTCGTCGCCGACCCCCGCGCACGCGGGGATCTTCCGGAGTTGGCGTTCTGGT
CTGCGGACCGGAGGGGGCCGGCCCCGCGTCCGCGGGGATCCTCCGCGGCAGACCGCCGACGCCGAGGCCG
TAGCGCAGTCGGCCCCGCGTCCGCGGGGATCCTCCGCGGTACGTCAGGTCGTTGGTCGTCGCGTTCGGGT
CGGCCCCGCGCTCGCGGGGATCCTCCGGCCACGACCTCGGCGGCGGCCAGGATGAGGACGTCGGCCCCGC
GCTCGCGGGGATCCTCCGTTCACCTGTCCGCTCTTCTGCCCGGCAACCTGGTCGACCCCGCGCTCGCGGG
GATCCTCCTTGCGAGACGCCTCCTGCACGTCCCCGAGCGCCGTCGACCCCGCGCTCGCGGGGATCCTCCG
CGGCTGATGGTGGAGGGCGGTGGGACGATCCAGTCGGCCCCGCGCTCGCGGGGATCCTCCTCGTCGGCGG
GAAGTCGTGAGGACGTGACGGGAGTCGGCCCCGCGCTCGCGGGGATCCTCCGGCGGCGACGGCGCGCTCC
AGGCGCTCTCGCTCGTCGGCCCCGCGCTCGCGGGGATCCTCCGTCCATCTACGAGGACACCGCCGCGCAC
GTCCTGTCGGCCCCGCGCCCGCGGGGATCCTCCCGAGATGAACCGGTCCGCCGCGCCGAGCCCGGCCGTC
GGCCCCGCGCTGCGGGGATTCTCCCTCCATGCCCGGTCAACGCCCGACCCCCGACCGGACTGGCTGGAGC
ACCGGCGAAGTCGGTGGCCGAACACCGCGAATCTCCACCTGCTGATCAACAACGAGACCGCCACCAAGAC
CAGCCGAGCCAGTAA
>lcl|NZ_CM001166.1_gene_92 [locus_tag=STTU_p0092] [location=76872..77381]
GTGACGTCGACCGAAGCAGCAGCAATCGCTCTACAGGACCATGCCGCCCTCTGGAGCATGGGGGAAATCC
GTGCGAGCGATGTCGTCAATGCCGCCTGTGAGGCGCTCGTCGCCGGACTCGACACCCCCGGCCTTCGAGT
CCTCGCCGCCTGCACACGCGCCGAGTCGGACTACGACGTCCACGAGTTGCTTCCTGAGGCACTCAACGAA
CTCGGCCTCACCTTTTATCCCATCGCCAGCGATGCCGGCCAAGAAGCCGCTGCCCGAGCGCTCGCACGCC
GCATGCTCGCGGGTGAGCTGACACCTCGGGAGTTCACAGTCCGCATTCACCAGCGCTACGGACATGAGCT
GCCACTGACTGAGCGGCTCGCCGAACTCGATGACGAGTACGACGTCCTCGAATACGGCGACGGAACCGTG
GACCACGTTGATGTCGAGGTCACCGCCGAAGCGCGCCGCCTCGCAGCCCACCCCCACGTTCCAGCCGAAT
CCACGGACACGCCCAGCTGA
>lcl|NZ_CM001166.1_gene_93 [locus_tag=STTU_p0093] [location=complement(78111..79388)]
GTGCGCGGGGCCGACATCACGGAGGGTGCCCCAGTGCGCGTGGTCGGCCTGACGCTCCGCGTGCGAGAAA
TTGAGGGCCTGGCTGGCGAGGGCTTGGCTCCACCACCCGGAGCATCCCCGCGTGCGCGGGGCCGACGGGA
CGTAAGGGCTGCTCACGGAGCATCCCCGCGTGCGCGGGGCCGACGTGCGGGATGTGGATACTCATGCCGC
CACCGCCGGAGCATCCCCGGGTGCGCGGGGCCGACGTATGCGGGAGCTGCGGGCGGACGGATGGCCCAGG
AGCATCCCCGCGTGCGCGGGGCCGACCTCGCTCTCGTCCTCGACGACGGCGGGGAGACCGGAGCATCCCC
GCGTGCGCGGGGCCGACCCCACGCCGGTCGAGAGCGGCGCTCCACCACCCGGAGCATCCCCGCGTGCGCG
GGGCCGACGGGACGTAAGGGCTGCTCACGGAGCATCCCCGCGTGCGCGGGGCCGACGTGCGGGATGTGGA
TACTCATGCCGCCACCGCCGGAGCATCCCCGCGTGCGCGGGGCCGACCTCGCTCTCGTCCTCGACGACGG
CGGGGAGACCGGAGCATCCCCGCGTGCGCGGGGCCGACCTCGGATCAGACTGGTCATCCGCTCCGGCATC
AGGAGCATCCCCGCGCTCGCGGGGCCGACCGCGACGGCTGGGGACCCCTCGATGCCTGGTACGGAGCATC
CCCGCGCTCGCGGGGCCGACGGCTCTCTCGGGGCCACGGCTCCAGCTCCTCTCGGAGCATCCCCGCGCTC
GCGGGGCCGACGACCGCCACACCTATGCATCACGACCCGAAGGCGGAGCATCCCCGCGCTCGCGGGGCCG
ACGGCGCCGGGACCTCGCCGAACGACCCGGACGACGGAGCATCCCCGCGCTCGCGGGGCCGACCTCCTCT
CCCTGGCCGAAGTCCTCTTCGCGGTCGGAGCATCCCCGCGCTCGCGGGGCCGACTGGTCGTTGCGCAGGA
TGGAGATGACCAGGCGCGGAGCATCCCCGCGCTCGCGGGGCCGACCGGGAAGGGCCGGAGGGCGCAATCC
CCCGGCCCGGAGCATCCCCGCGCTCGCGGGGCCGACTGCGGACGCCTTGTAGTTGACGTGCGCGACGCCG
GAGCATCCCCGCGCTCGCGGGGCCGACGCGCTTGGGCTCACGAGCAGCTTCGTCGTGGGCGGAGCATCCC
CGCGCTCGCGGGGCCGACACTTGCTGACCTGCAGTCATACCAGCGAGTCTGCCGGTTTTCCTTCAGTTGC
TTTCCGGCCGGTCGCTGA
>lcl|NZ_CM001166.1_gene_94 [locus_tag=STTU_p0094] [location=complement(79407..79754)]
GTGCGCGGGGCCGACCGTGGTCCGGCTGCCCGAGGAGCAGCGCGGGGAGGAGCATCCCCGCGTGCGCGGG
GCCGACGGCCAGAGCAGCGCGTCGACAAGACCCCGCAGCGGAGCATCCCCGCGTGCGCGGGGCCGACCGT
CGGGGCGGGACGATGTGGCCGCAGTCCGGCGGAGCATCCCCGCGTGCGCGGGGCCGACTGCGAGAGGCGG
CTGGTGATGCGCTGGCCGAGCGGAGCATCCCCGCGTGCGCGGGGCCGACGGCCCATCGCGGGCCAACCCC
AGTGGAACGGCCGGAGCATCCCCGCGTGCGCGGGGCCGACCTGCAGCGTCCGGTCATCGTGCGCGTAG
>lcl|NZ_CM001166.1_gene_95 [locus_tag=STTU_p0095] [location=complement(79839..81017)]
GTGACGACCAGCGCCCTCGTGCCGGTCGGAGGATCCCCGCGCATGCGGGGACGACCCGGGGTGAGGGTGT
CCGTCATGACGTGCTCTCGGAGGATCCCCGCGCATGCGGGGACGACGTCGCGCGGGCGCGCAGCCATTCC
AGCGCCCGCGGAGGATCCCCGCGCATGCGGGGACGACGGCCAGCTGCGAGGCGCAGCTTCGCGCGCACAG
GGAGGATCCCCGCGCATGCGGGGACGACAGCTCGACACGGGCGGTGATGGCGTTGACCAGCGGAGGATCC
CCGCGCATGCGGGGACGACGTTCGTGCACGCCGAAGGCCCCGTACGCAGAACGGAGGATCCCCGCGCATG
CGGGGACGACCGGATCAGGTTGACGTTCTTGATGCCGTTGGCCGGAGGATCCCCGCGCATGCGGGGACGA
CGTGACCTCCTCCAGGGCGGCCCGGGTCACGGCCGGAGGATCCCCGCGCATGCGGGGACGACCCACTCCG
GCTCGCGCGGGTACCACCCCTCCTCGGAGGATCCCCGCGCATGCGGGGACGACCGCGTGTTGGTGCTCGC
CTGCCGCATGTGCTCCGGAGGATCCCCGCGCATGCGGGGACGACCCGGACGTCGACAGCCCGTTGGCCGT
CAGCGCCGGAGGATCCCCGCGCATGCGGGGACGACCACGCGTCCAGATACCGCTGGTACAACCGGTGCGG
AGGATCCCCGCGCATGCGGGGACGACCCACGGCCCGGCTTCCACCCCGCACAAGACCGCGGAGGATCCCC
GCGCATGCGGGGACGACCCCACCGTCCCGAGCGGCGGCAGGCTCATGGGCGGAGGATCCCCGCGCATGCG
GGGACGACACTTTCTGACCTGCGGTCATACCGGCTGGTCCGCCAGTTTTCCTTCGGTCGCTTTTCAAACG
GCCGCGGAGCCCAGGATAGAAACGACCGCCCGACCCCAGCCCCAGTAGCTCTCACCACCGCTCATACGAA
CACCGTAGCCCCGCCCAGCCACCCCCGTAACGCCACCGATCCCGGGAGCGCGGGGTCGTCCCTCCTCCCC
GTCGCCCGCACCCCTCAGGAGATCCCCACACCCGTAGGGCCGACCCGAGGTCGTCGTCGTGGTCGCCGAG
GACGACCGGAGGGTCCCCGCGCCCCCAGGGCCAACGCCAGGAACATCTCACGAGCCTGA
>lcl|NZ_CM001166.1_gene_96 [locus_tag=STTU_p0096] [location=81757..82050]
GTGACCGCCCCACACGAGCACTACCAGCCCACCGACGACGCCCCGCCCATGCGGACCTTCGCCGACCTCC
GCGCCGCACTACGCCGGCACGGCTACCCCAGCGACCTCGACCAGTTCGACAGGGAACTCGCTGCCACCGA
CCTCGACGACCTCACTCACGTCCGCGAGATCACCCAGGCATACCGGCACCGTGTCCTCCTCCACCGCGAC
GCGGACGCGGCCACCGCCATCTCCCGCTCCAGCCAGGACATCGAGGCGGAACTGCGGCGCAAGATGAGCG
AGGCCGACCGGTGA
>lcl|NZ_CM001166.1_gene_97 [locus_tag=STTU_p0097] [location=82125..82319]
ATGGTACGCCGCCGTCTCGAGGAGCAGCCCGACCAGCCCAGCGCCCGTCCGCTGCCCGATCGAGGAACGC
GCAGCGCGACCTACGCCTACGAGCTCCTCCCCGAGCAGACCGGCGGCCGCGGTATCAGCGTCGTCTACCG
CTACGCCGAGAACCTCGACGCGGTCTTAATCCTGTGGCTCATCGCCGGGCCCTGA
>lcl|NZ_CM001166.1_gene_98 [locus_tag=STTU_p0098] [location=82675..83832]
TTGGCCCCGCGCCTGCGGGGATCCTCCGAAAATCACCGCGCACTCCGCGCGGGCAGGCGCGTTGGCCCCG
CGCCTGCGGGGATCCTCCGTGGAGCGGCTGTTGCGCGAGCGCGCCCTGCGCGTTGGCCCCGCGCCTGCGG
GGATCCTCCGACCGGCCGGGGCTCACGGCAGCAGGTCACGCAGTTGGCCCCGCGCCTGCGGGGATCCTCC
CCAGCCCAGCATCGAGGACGCGTTGCCCTGCGGGTTGGCCCCGCGCCTGCGGGGATCCTCCGAGGATCGG
CACGACGCCGTGAGCGCCGGCCACGTTGGCCCCGCGCCTGCGGGGATCCTCCTCCCTCGCCGGTGATGGG
GTTAGGCACGGGCGGGTTGGCCCCGCGCCTGCGGGGATACTCCGCCAGTGAGCACTGGCGCCTCGCGCGA
GCTGGCGTTGGCCCCGCGCCTGCGGGGATCCTCCGTTTCGTACGGCGGGGTCCAGGCCGGTCAGGCGGTT
GGCCCCGCGCCTGCGGGGATCCTCCGGTCTCGCCGGTCAGGGTGACGCGGGCGACCCAGTTGGCCCCGCG
CCTGCGGGGATCCTCCGGAGCACCAGGCGGACGGCGTCCGCACCGAGTGGTTGGCCCCGCGCCTGCGGGG
ATCCTCCTCGCGGGCTCCCCTCTCGGTCAGGGCTCTTGGGGTTGGCCCCGCGCCCGCGGGGATCCTCCGT
GGGCCCGCTCGAGCGCGGGGAACCTTTGCAAGTCGGCCCCGCGAGCGCAGGGATCCTCCAGATCGCGGCC
CTCTTCGTCGGTGGGGTCATGCGTCGGCCCTGCGGGCGCGGGGATCCTCCGGTCACCAGCTCGACCACCA
CGGCGGTCAACTTGTTGGCCCTGCGGGCGCGGGGATCTTCCGCACGGTCAGCGGAGCTACTGGCGGACCA
ACAGGTCGACCACGCGCACGCGGGGATCTTCCGACGATCAGGCCGACGATCACGTTTCGTACCCCGTCGA
CCCCGCGCGCGCGGGGATCCTCCGGCTGCTGCAGGCGAACTGGCGGGCGCCGGGTTGCCCTCGCGCTGGC
GGGGATCTTCCGACCGCTCGGGGCGGCGCGCGCTGGCTGAGCCTGTCGGCACCGCGCTCGTGGGGATCAG
TCGCGCCGCCGAGCGGATTACGGGAGTTACGGTGTTGA
>lcl|NZ_CM001166.1_gene_99 [locus_tag=STTU_p0099] [location=83841..83984]
GTGAGAGCTGCTGGGGTCGGGCGGTCATTTCTGTCCTGGGCTCAGCGACCGGCCGGAAAGCAACTGAAGG
AAAACTGGCAGACCAGCCGGTATGACCGCAGGTCGGCAAGCGTCGTCCCCGCGGGCGCGGGGATCCTTCT
CTGA
>lcl|NZ_CM001166.1_gene_100 [locus_tag=STTU_p0100] [location=complement(83992..84606)]
TTGGACGCCAGCACCGAAGGATCCCCGCGCCCGCGGGGACGACGATCCCTCCACCTCGGCGGCCAGACCG
TAGCCCGAAGGATCCCCGCGCCCGCGGGGACGACGGGCGGTCAGCGTCTCGTACCCCCGCCCGGCCAGAA
GGATCCCCGCGCCCGCGGGGACGACGACGTCCAGATCATCACGTTCAAGCGCATCTCCGAAGGATCCCCG
CGCCCGCGGGGACGACTCGTCGCAGAAGCGGATGAGGAAGTCGAGGACCGAAGGATCCCCGCGCCCGCGG
GGACGACCGCGCACGTGCCAGCGTCCCCGGCCGCGCAGGAGGAAGGATCCCCGCGCCCGCGGGGACGACC
ACCGTTCGGCGGAACGGCGAGGCGAGCGTGTCGAAGGATCCCCGCGCCCGCGGGGACGACTTCTGGGCGT
CAGATGCCGAGGTCGAGGCCGAGGAAGGATCCCCGCGCCCGCGGGGACGACGACCCCGGACTGCCAGAAC
ACGACGCCCCTCCCGAAGGATCCCCGCGCCCGCGGGGACGACCCGGGCGAGACGAGGGCTTCACCTTGAT
CAAGGTGAAGGATCCCCGCGCCCGCGGGGACGACTCGCGGGACTCGGCGGCATGA
>lcl|NZ_CM001166.1_gene_101 [locus_tag=STTU_p0101] [location=84849..85730]
GTGAGGGCGACCCCGGGAGGCCGGTCGGCCCCGCGAGCGCGGGGATCCTCCGCGGTCCTGTCCGCGCGGT
GGTCCTGGCCAGAGGTGTCGGCCCCGCAGGCGCGGGGATCCTCCGACGGAGAACTGGGTGGTCGAGGCGA
TCCAGGCGTCGGCCCCGCGCTCGCGGGGGTCCTCCGGTGTGCGGCGCACTTCGGGAATCCGCTTCGCCCC
GTCGGCCCCGCGTGCGCGGGGATCCTCCGCTGGAGAGCGGCAGCACGCGCATCCTGGCGAGGTCGACTCG
CGCTCGCGGGGGATCCTCCGGCCCCGTGTGCTCCGCCCTCGGCCCGCTGGGTCCCGGCCCCGCGCTCGCA
GGGGCCCTCCTCCCTCGGCTGCCTCGCCGACGTGTTCAGGGCCATCGGCCCAGCGCTTGCGGGATCCTCC
GGGACTCTTGCGCGAGGCCGCAGGCACACCGAGCGTCGACCCCGCGCTCGCAGGGATCGTCCGCGCTCTC
GGTGTGGCTGGCCGGCGATACGGTGTACGTGTGGGGGTGAGAGCTGGTGGGTTCGGGCGGTTGTTTCTGT
TCTGGGCTCAGCGGCCGGACCGGAAAGCCACCGAAGGGATACTGGCAGACCCGCTGGTATGACTGCAGGT
CAGCAAGTGTTGGCCCCGCGCCTGCGGGGATCCTCCGGCCGGGGGGCTGCTCGCGTGGTCGGTGGAGCAG
TTGGCCCCGCGCCTGCGGGGATCCTCCGGCCGGGGGGCTGCTCGCGTGGTCGGTGGAGCAGTTGGCCCCG
CGCCTGCGGGGATCCTCCGGGGCAGCGCCTGAACTCGTCCAGCTTCGTGGAGTTGGCCCCGCGCCTGCGG
GGATCCTCCGGTCCTCGGCAGCGGCTGGCGGGCAGAGGCTGA
>lcl|NZ_CM001166.1_gene_102 [locus_tag=STTU_p0102] [location=85793..86029]
TTGGCCCCGCGCCTGCGGGGATCCTCCGCTTTCGTGGACGCGTCCGAGATCGACCCGATCGTTGGCCCCG
CGCCTGCGGGGATCCTCCCTCCTCATGGTCCGCACGGGGCGCCGTCAGGTGGTTGGCCCCGCGCCTGCGG
GGATCCTCCGTCCACCCCCACCCCCGAGCGCGAGCCCGCGTTGTTGGCCCCGCGCCTGCGGGGATCCTCC
GGTATTGATCGGCACACCGAAACCTGA
>lcl|NZ_CM001166.1_gene_103 [locus_tag=STTU_p0103] [location=86034..86153]
GTGCTGGCCCCGCGCCTGCGGGGATCCTCCCAGACGGCACATCACCGCAAATCTCTACGAACGGTTGGCC
CCGCGCCCGCGGGGATCCTCCGACGAGAGCGGCGCCGCCGGGCCGGGTGA
>lcl|NZ_CM001166.1_gene_104 [locus_tag=STTU_p0104] [location=86169..86306]
GTGCGCGGGGATCCTCCGCGGCTCGCCGACCAGATCCTCAAGACCCCCGAATCGGCCCCGCGCTCGCGGG
GATCCTCCGAGGCCCGTGTCCGCCGCGCGCCCCGCCTCCGCGTCGGCCCCGCGCGCGGGGATCTTTAG
>lcl|NZ_CM001166.1_gene_105 [locus_tag=STTU_p0105] [location=complement(86413..87126)]
GTGCTCCAGACCGGCCTGCACGCCCGTCGGAAGATCCCCGCGCACGCGGGGCAACGGGCCGCGCGAGGCC
AGCGGGAAGTTAATCCGCGGAAAATCCCCGCAGGCGCGGGGGCAACGACCCGCTCCTGGTCCGCGTCGGC
CTCTGGGCAGGAAGATCCCCGCACACGCGGGGACGAGGTGCTTTTCATGACGGATGCTGAGGCCAGGGAA
GGAAGATACCCGCACACGCGGGGACGACACGCCGCGAGCTCGAAGAGCCTCAAGTTCGGCTGGAAGATCC
CCGCGCATGCGGGGACGACCATCACGCACAGTCGGTCAGCTCCTAGTGCTGGGGAGGATCCCCGCGCATG
CGGGGACGACGGCACGGGACTCCCGGCCCGCTCCCTGAAACCGGGAGGATCCCCGCGCATGCGGGGACGA
CGCCGTAGATCAGCCCGTCGGACTGGTCGGGCTCGGAGGATCCCCGCGCATGCGGGGACGACTTCCTCAG
CGCATCCATGCGGTAGAAGTCGTACGGAGGATCCCCGCGCATGCGGGGACGACCTCAGGCTCGGGCGCGA
GGGCCAGGGTCTCCCCGGAGGATCCCCGCGCATGCGGGGACGACACTTTCTGACCTGTGGTCATACCGGC
TGGTCTGCCAGTTTTCCTTCGGTCGCTTTTCAAACGGCCGCGGAGCCCAGGACAGAAACGACCGCCCAAC
ACCAGCCCCAGTAG
>lcl|NZ_CM001166.1_gene_106 [locus_tag=STTU_p0107] [location=complement(87305..87694)]
GTGCGCGGGGCCGACCTCGTTCGTCACGCCCGGCCCGTCGCCCCGGAGGGAGCATCCCCGCGCTCGCGGG
GCCGACCCGTCGAACTCGCGGTCGGCGTAGCAGGTTCCCGGAGGATCCCCGCGCTCGCGGGGCCGACATC
CGGTCTACGGGCCGGAAGTACCAGCCCGCCGGAGGATCCCCGCGCTCGCGGGGCCGACAAGGCCGATCGC
ACGCTGCATCCAGCGCACATCGGAGGATCCCCGCGCTCGCGGGGCCGACCGAGGCCGCGCACGCGAAGCT
CGCCGACGAGCTGGAGGATCCCCGCGCTCGCGGGGCCGACACTTGCTGACCTGCAGTCATACCAGCGGGT
CTGCCAGTTTTCCAGCAGTTGCTTTCCGGCCGGTCGCTAA
>lcl|NZ_CM001166.1_gene_107 [locus_tag=STTU_p0106] [location=87710..87844]
TTGTCGAACATCGAGCCGTACGGGCTCGTCTGTCGTCCCCGCGTGCGCGGGGATCCTCCGGGCTACGCGC
TCCTCTTCGACCAGGACTTGGGGTCGGCCTCGCGTGCGCGGGGATCCTCTGCTGCTGGTGGGTGA
>lcl|NZ_CM001166.1_gene_108 [locus_tag=STTU_p0108] [location=complement(87919..88359)]
TTGCGAAAGGCCCAGATCATTGAGGCCGCAAACACGGCGGCGGGGCGCACCGTGGTCCGGGCCGTACGGG
TCCTCGCCCCCAGCACCGGCCCCGCGCCCACCCCGGCCCCGGCCACTGCCGACGGCGAAGGCACCGCCGC
ACCCACGCCCGTACGGACCCGGGAGAACGCCTCGCCCGGATACCGCCCTGCGCTCCGCGCCCACCAGCAG
GCAGCCCCCGCCCAGCGCGTCGACCACGACGTCCTCAAGGCCGACCGCCGCGCCGGCGAGCGCCAGGCGG
CCGCGATGCGCGCCCTGTCCCACCACGCCTTCCCCGACGAAGTGCCCCGTCTCTCGGCGCGCGAGGACGT
CGACGCGGAGCGGCGCACCGGTGCCGAGATCGAGGCGGCCGCACGTCGCCGGGCCCGCGCGGACCGGGCC
CCGCGTCGTGCGATCCCGTAA
>lcl|NZ_CM001166.1_gene_109 [locus_tag=STTU_p0109] [location=complement(88705..90783)]
GTGGGCAACCCGCTCCAGCTGACCGCGACGATGCGTACCCGGCTGCTCGCCGCGGTGCGCGCTCTGGTGT
CCGATCCCGCCCTGGACGGGGCGGGCGACCCCGCGCGCCTGGCGGCGGTAGTGCTGATGGCGAAGGCCAC
GGTGGCAACCGACTACAGCACGCGGATCACCGCGACGGAGCTGGGTCGGTGGATCGGGCTGAAGAAGTCC
CGGGTCGCGCACCACGTAGTACCGGAGCTGCGCGAGCGTGGCGTGCTGGGCTCGAACGGGACGACGAACG
CTGCCGGGTGGATGACGGGCCTGGAGTGCTGGGTGATCCCGATGTACCGGGCGCAGCACGGCGGGGACCG
TAGGCACGTCCTGGCGCTGTCGCGGGTGGAGCTGGTCGTGCTCCTAGCGCTGATCGAGGTGCTGTTCGCG
CCGGGCTGGGAACACCGGGACGGCCGGGTAACCCCGGCCGGGATGCTCGCGGGGCGTACGGGGCGCGGGG
CGGCGACGGACCGGCTCGGGCTGCTGCTGATGGTGCTGTCGTCGAACTCCAGAGGGTGGCTGCAGCTGTG
CTCGGGCAGCGTGGACACCGGGCGGGGCCGTCCGGCGGCGACGGTGGCGCGGCTGATGGGCTGCACGGCG
GCGGCCGGGGCGAAGAGCCTCAAGCGGCTCCAGGAGCAGGGCGTGCTGTCGGTGGACCGGCGGGAGACGG
CGTCGGGTCTGCATGCGCGCAGTCGGGTCCGGCTGCTGCCGGTGGCCAGGGCGCACGGGATCGCTGTCCG
GGAGGCCCGCGGGGCCGCCGGCGCGGTGTTTTCAGACCTCGCCGTTACTGCATCCGGCGATCTTGAGACG
ACGGTTGAGACTGTGTCCCCTGTGGTTACTGGGGTTCAGGGTACCGGGATGGGCCAGGAGCCTGATTCGG
CAGACCGCGCCGATGCTGCACACCTTCACGCCTCTCACGCTTCTGGGGCTACTCCTGCTGATCAAGTTGA
GGACTCCTCGGGTTTTTCCGGCGAAGGCCGTGGGGGGACCCCGCCGTCGCCGGACCGCGCGAGCGCGCGT
GAGGAGGGCCCGCTGCGCGGGGAAAAGCGTGAGGAGTCCCCCTCGTCGAGCAGCAGTGAAAAGCGCGGGC
CGGGCCCGGCGGTGACCCTGGTGCCGGAGCCTCAGGGCTGCGCTCAAGGCCGTCAGCAACCGAAGCAGGC
TCCAGCGCCGCTGCCGCCGGAGGATCTGCGGGCGGTCCTGGAGCCGGTGGACTGGATGTGGGCGCAGCTG
CCCAGGCCGGGGCTGCGCCGCGTCGTCGAGGCGGCCGCGCACGCCGAGCTCGCCGTCCTGCAGGGCCTCG
TGGGCCGTACGGATGCGCCGCAGGTCCTCGGTGCCCGGCTGTTCCGGCGCCTGGGGGAGCAGATCCGTAC
GGGCGGCGTGATCCGGGATCCGGCGGGCTGGCTGCTCGCGCGGGGGTTGCCGCAGCGCCAGCAGTGCGGG
GACGTGCGCTGCGACGACCGCATCCTGCTCGACTCCGGGCAGGCGTGCCCGCGGTGCGAGGACCGGCAGG
TCGATCGCCGTGCGCAGCGTCGCCGGATCGCCGCCGAGGTCGAGGAGCGGCTCCCGTACGCGGGGGAGGA
GGAGCGGCGCGCGGCGACTGTGCGGCAGCTGCACGAGGACGTAAGGGCCGCCGGGTGGGCGCGCGAGTGG
GAGTGGGAGCGGGTCCGGGCGCGGCAGGCCGCGGCCCGCGCACGCGCCGATGCCGCCCGCCAGGACCAGC
CGGAGCCCACCGCTCCCGCCCTGGGCGCGCTCCCGGCGCCGCGGGCTCGGGTGCTGGCGTCCCGTACGGC
CGCCCCCGCTGTGGCGCCTGCCGGGCGACAGGTCCGCGAGGTCGTCGACGAGCTCGTGCTGGAGGAGCTG
ACTCGCGAGCAGATCCTCGACTGGCGCGCCCGCGCCACCTACGACCACCAGGTCGTTCTCGACCACATCG
CCCGCTACGGCGAGCACTCCGCGCAGCGGCTGTTCACCCGCGCGCTCGTCGCCACCGTCCACCGCGTGAC
CGGCCGCGACCACCTCACCCTCACCACGAGCCCCTGGGGGATCGCATGA
>lcl|NZ_CM001166.1_gene_110 [locus_tag=STTU_p0110] [location=complement(91495..91779)]
ATGCAACTACCCCTCGGGCTGGCCGCAACCTCCAAAGCCAGGACGCGACATGAAGCAGAGTACCCGGAGT
TCACCCCGGTCAGACAGGTGGAGCCACGGTTCCGGCGTGAGGATCACACCGCCGACGGACGTTACCCCTG
TCCCTCCTACCGCCGCACACGCGTGACCGCCCGGAGCGGGGCTGCCCCCGCTCTCGCCGTCATGCCCACA
CGCCTCATCCCCGAGCGCCGCGTTGTCGGCGTCTCGGGGCAGACCCCACCCGCTGCGGGGGGTCGGATGA
CGTAG
>lcl|NZ_CM001166.1_gene_111 [locus_tag=STTU_p0111] [location=complement(92060..93226)]
ATGACGCAACAGGAGCTGGCAGCCCGGTTGAATGGACGGTCCGCTGGCTGGATGAGCCAGGTAGAACGCG
GAATCCAGCCGGTACGTCGCGTCGATGTTCTCCAGGAGATTGCTGACGCGCTGGGTGTCTCCATCCAGAT
GCTCGACCCCAGCTCCCCGATTTTCACCCCTTCGGTTCCACCTGTCACCGAGGCCACCAACGACCTCGAC
GGTGCTCGAACCGTCATCTCAGGGCACCCCGCGATCGGCCTCATCACCGGGGTCGAGGAATCGGGAGCCA
TTGACCTTGGTGCGCTCGAAGAGTCCGTCGAGCAGATTTGGGAGTACACCCACCGCAATGCGTATCCGGA
GATCAGCGAGACAATCGCCGCGCTGCTCCCTCAGCTGGAACGTGCCGTACGCACCGTCCCCGCCCCGGAC
CGGCCTGTCGCCTACCGGAACCTGGCGCGGGCGTACCAAGCACTCGCCGCCGCCTTCGCTCGGCAGGGCG
ATTCTCGCTCATCATGGGTGTCCGCTGACCGGGCAGTAGCCGCCGGCGAGAGATCCGGTGACATTTTCCT
CGTGCACGCGGGGATCTTCCGCATGGTGCACGCCTTCGTCCGCCTGGGGCACAACCAGGAAGCCGAACAC
GCGGTCACCGAAGCGGTCGCAGCTCTCCAACGGCGCGCGGACCTCCCCCCGGAGGGCCTGTCCGTGCTCG
GCTCGCTCCACCTCGCAAAAGCGCTGGTTCACGCCAGGTCTGGGCAACGCTCGGAGGCCCGCGCGGAACT
GGAGAGCGCGAGACGGGTAGCGGAGCAGATCGGCGAGGACCGCAATGACTACAACCTCGAATTCGGCCCG
ACCAATGTCATGATCCAGACAGTCTCAACCGCCCTGGATCTCGGTGATGCCGGGGAGGCTCTCGACATAG
GGCAATCCATCGATGCCGCCTCGTTGTCGCCCGAGCGCCAAGCTAGGTTGTTGATGGACTTGGGGCGAGC
CCACGCGCAGCGGCGACACACGCCCGACGCAGTCGAATGCCTGCTGCGCGCGGAGGAAATGTCACCGGAC
CTAGTACGTCAGCACAGCGCGGCCCGGGCCGCGATCAGAGAGCTGTTGCTCGTGAGCGGGCCGAAGGCGT
CCGCCGATCTGGTGGCTCTGGCCGCGCGGGCGTCCGCGGCGGAATGA
>lcl|NZ_CM001166.1_gene_112 [locus_tag=STTU_p0112] [location=complement(93307..93645)]
ATGACCATCCCAGGAGGAGAAGTGAGCGGATACGCACTCGTCGTGCGGTTCACCACCCGTGACGCCGACT
CAGCCAAGAAGTTCGACGCCCTCGTGAGTCGCACTTTGGAGGGCATCCGCTACGAACCCGGCACTCTCGC
CTACGTCGTCCATGTCCCGGAGGGCGAACCACTGGTCCGCGTGTTCTATGAGCTCTACGCGAGCTACGAC
GCGTTTCAGATCCACGAGGCGCAGCCCCATACGCAGCGGATGCTCAGCGAGCGAGAGCAGTACCTCGACG
GCAGCGAGGTCACGTTTCTCAACGAGCTGATGGGCAAGCGCCCGACGGAGACGACATGA
>lcl|NZ_CM001166.1_gene_113 [locus_tag=STTU_p0113] [location=complement(93711..94109)]
GTGGTCACGGGTGGAAACACCAACGACTGCACCCGGTTCCCCGCCGTGATGGAAGCGATCCGCGTGCCCC
GGATCGGACCCGGCCGTCCCCGGGTCCGGCCCGATCACGTCCTAGGCGACAAGGGCTACAGCTCGAAGGC
GATCCGCGCCTGGCTCCGTCGCAAGGGCATCGCCCACACGATTCCCGAGCGGGCCGACCAGGCCCGCAAC
CGGGCCCGGCGGGGCAGCCGCGGAGGCCGCCCGCCGGCCTTCGACCGCGAGGTCTACAAGCACCGCAACG
TCGTGGAGCGGTGCTTCAACCGTCTGAAGCAGTGGCGCGGGATCGCCACCCGGTACGACAAGACTGCCGA
GTCCTACGAAGCAGCTGTCACGCTCGCGTCACTCCTGATGTGGGCGTGA
>lcl|NZ_CM001166.1_gene_114 [locus_tag=STTU_p0114] [location=complement(94160..94558)]
GTGGATCATGGTGTCGTGATACGTCGCCATGAACTGTCGGATGCCGAGTGGGAGTTCGTCCGGCCGCTGC
TGCCCGAGTCGTTGCGGGGACGCAAGCGGTTGGACGATCGCAGGGTCCTGAACGGGATCGTGTGGAAGTT
CCGGACCGGGACGGCCTGGCGGGACGTGCCCGAGCGCTATGGCCCGTGGGCCACGCTGCATACGCGTTTC
CGCAGGTGGGCGGCGGACGGGACGTTCGACCGGATGCTCCGCGCCGCCCAGGCGAAAGCGGATGCGGCGG
GCGACGTCGACTGGCTGGTGTCCGTCGACTCGACGATCGTCCGCGCTCACCAGCACGCGGCCGGGGCCCG
AAAAGGGGGCTCCGCGACCCGGCCCTCGGCCGGTCAAGAGGCGGTCTGA
>lcl|NZ_CM001166.1_gene_115 [locus_tag=STTU_p0117] [location=complement(94568..94960)]
GTGACCGGGCGACAGGGTCGAGACGACGATCGCGTCCAGGGGGCTGACGCGGGAGGTACGGGTGCGGCCC
CGGCGCGTACGGGCCGTGGGCATGGCGAGCTCGGGCATGGCGACTCCTCGGCAGGAGAAGGGAGGGGGAT
TCGCGGGGCGGGTGCTCTCTCCGCCCACCAGGTCCACGAGCCAGCGGCCCACGTCCTGGCGGACAGACAG
CGCATCAGCGCTGAGGTCATACAGCAGTCCTGCCAGCCAGGGGGTTTGGTGGTGCTACCGCCTCCGGCCA
CCTGCCCGACTCCGAAGAGACGAGCCGCAGAAACTGCGGTGGCGACACGACCGACGCTACGCACACTTTT
CGTGCTAGTCAATACTTCAGTGCTAGGCAGTGTCTTCAAATGA
>lcl|NZ_CM001166.1_gene_116 [locus_tag=STTU_p0115] [location=94976..95716]
GTGGAGGCCACGCAGGCCCGCCGTATCTCGCTGGTGTGCCCGGACTGCCGCACCTGGGTGGCCGTGACCC
CGCACCGGGGTACCTACCTCCTCAAGCTCGTCCCGCACCACACCGGTCGTGCTGGCGTCGACGCCGCGAT
CCGCTGCCGCTCCAGCAACCGCCTCGTCGACGTGGACCTCACCGACTCCATGTGGCGCCGCCAGTACGAC
GAGTGGGCGCGCGAGGAGCGTCTCGCCGTCGACCTCACCCGCCACCGCCGAGCCACCGTCCAGACCCTCA
AAGTCGCCCGGCCCCAGCAGCGGCCTGCCGACCGGCGCGCGCAGTGGGAGCGCGCGGTGCCCGCCGCCCG
CCAGGCCGACGCCGCCCGCGCGGTCCCCGCCGACGCGCTCCCCACCACTCGCGGCCGGGCCGTCGACGGC
CCCGCCGGCGCCCCGCCGGCCCTGCGCCGCCAGAGTGCCGGGGACCGCCGTTCCGTCCGCGCCCTGGCCA
CCGGCACCCTGCGCGCTCTGGCCGACGCCCGCCAGGACCGGCTCGCGGGCGACGGGCTCGCCGAGCACCT
CACCCGCGCCGCGTACCTGCACCTGGCCACCCTCTGGCGCCGCCCCCTGACCCCGGCCGACCAGCCCGCA
CACACCGCGCTCATCGCTGCGGTCAGGGCCGCGCTGCCCGCGCCAGTCCCGGGCGAGACCGTCGCCGCGT
ACATCACCCGCTGCCGCAGGTCCCCGCTCGCCGCCGCATGA
>lcl|NZ_CM001166.1_gene_117 [locus_tag=STTU_p0116] [location=95822..96214]
ATGTCCGCTACCGACCCGCTGACTGAGTTCGACACGGAGACGCTCGCGCTCCTGGAGGCGGTCGAGGTGC
CGCTCCCCGCGTTCGGCGACCTGGACCTGGACGTCGCCTTCGGCACGCCGCTGGAGATGTACGACCTGGT
GACCGCAGACGAGCTGGCCCGATGGGACGCCGTCTCCGTGGTGAAGAAAGGCCGGGCCCGGGCGCGCGAG
GAGGTTGTTGCGGCCTCCGGGGCGCGGCGGGATGCGGCGCGGGACATCCTCGCCGCCGATCCGACCGTCA
CCGAGCGGGTCCGCGAGCGCCTCGTCGACATCCTCATCCCCGCCGCGCGGCAGCTGCGGATCGACCGCAC
CGTCGTCGTGTCGTTCGCGGAGTCCGAGGTGCTGGCGGCCTGA
>lcl|NZ_CM001166.1_gene_118 [locus_tag=STTU_p0118] [location=complement(96383..96709)]
GTGGGTGGTCGAGGTACGGCCGCCGTGGCCGTCGCAGTCCGAGCAGGCGATGCCCGCGGCGTGGTTCAGG
CGGGCGCGCTGCTCGGCGGCGGTACGCGGCGCGCGACGACCGGCGGGGATACGGGTGTCGGCCTGGCGGG
CCTCGGCGAGCATCCGGTCCTCGAACGTCGCGGCGGTGCGCTGAGGGTGGGGGCGGGCGGGCTCGGTCGG
CGGCTGCGGCTGACGGCCCCCGGTCTCGTGCGGCTGCGGGCGGGTCGGGAGCGGGTCGCGCTGGACGCGC
GGCGAGCGGGGCAGGGTAGCGTTCGGCATGCGAACTCCATCTCGTGA
>lcl|NZ_CM001166.1_gene_119 [locus_tag=STTU_p0120] [location=complement(96810..97079)]
GTGAACGTCCGTGACGTGGTGGCCCGCGTTGAAAGCGCGCGCCGCCGTCCGCCCGGCGAGGGCGAGCAAA
CGGCGCGCGCGGGGATGCGCGGGTCCGTGGGAGAGCGCCCGCGCCGCGAGGAGTTGCGCGGCGCGGGCGC
GTCTTATGTGGGGCACGCCCACCGCTACTTCGCGGGAGCGGGCGGCGGCGGGGGCGGGGTCTGCCCGCAC
TCGCAGGGCGACATGGCGACGCTCTGGAACGGTTTGCCGTCCGCGCCGGTGTGGTTGTAG
>lcl|NZ_CM001166.1_gene_120 [locus_tag=STTU_p0119] [location=97104..97280]
ATGCCGACCACCTCCCCCACCTCCCAGCCGATCCCCGCGCCCGCGCCGACGCTGTGCCGCTACCGGCGCG
AGCACGGCGACCCGACGACCTGGACCACCTCGGAGATTGAGGGCTGGCTGCACCGCCAGGACGCCGCCCA
CGCCGACCTCACGACGCACGCGAAGGGAACCCGATGA
>lcl|NZ_CM001166.1_gene_121 [locus_tag=STTU_p0121] [location=97412..97615]
GTGGGCGAGACCGGCCCGGGGGCCGTGCAGCTCGAGGAGGCCAAGAAGATCTGCACGGGCTGCCCCGTCC
GCGCCCTGTGCCTGGAGTTCGCGCTCGACTCCCGCCAGCAGGACGGCGTGTGGGGCGGCATCTCCGCCGA
GGAACGCCGCCGCATGCGCCGGCGCCGCGCATGGCCCGCGACCACGGACACCCCCGCCGCGTGA
>lcl|NZ_CM001166.1_gene_122 [locus_tag=STTU_p0122] [location=97732..97887]
ATGCCCGATCAGCCGCAGCCCACCACCGAGCAGGTTGCCCAGGCCATCGTCGACGCCGCCACCAGCGGGG
ACCAGGCGTTCACCGAGACGGTCGCCAACTCCTACACGACCGAGCAGCTCGAAGCGGCCCAGGCCTACCT
CACGCAGGGACGCTGA
>lcl|NZ_CM001166.1_gene_123 [locus_tag=STTU_p0123] [location=97992..98243]
GTGAGGGGAGTCGGACAGCCCGAACCACGACCACTCAGTAAGGGAGTTAATCCCATGGCCTTTCTCCAGC
GCCTCGTCAGCCCGCTGCGCCGCATAAACGCCGACCCCGACAAGCTCGTGGAAGAGGCGTGGACGCACAT
CGCGGAGGCGGAGCGGAACCACGGCCTGTGGCCCGCGATGAGCGCCCTCACCGACCTCGCCACAGCCAAG
GTCCAGGTCGCCCAGTACCTCAAGGAGCACCGCGACACGTGA
>lcl|NZ_CM001166.1_gene_124 [locus_tag=STTU_p0125] [location=complement(98455..98628)]
GTGGGCCACAGGCCGTTCACGAAGAGGTCGAACAGGGCGAGGACGGTGGAGATCACCGCGATGACCGTGG
CCAGCAGAGCGGGCAGCGGGTTGCGCGGGACGAAGACGTCGTCCGTCATCTTGCTCGGGGTCGGGGTGGC
CGTCGTGGTACTCATCGGGCACCCCCACTGGTAG
>lcl|NZ_CM001166.1_gene_125 [locus_tag=STTU_p0124] [location=98734..100467]
ATGACCGCCGTCGATATCCGCAAGCCCGAAACGGTCCGCCCGGACGACGACGACCAGCACTCCTGGCCCG
TCCCGGCCCCGGCCGACCACACCGATCACGACCAGGAGCAGCCCGGCTCCCAGCAGCACGACCAGGACGA
CCGGGACGACGACCCGCGCACCATGCGGCTGCTCGCCGTCGTCGCTGGCGTCGGCGGCCTGGTCCTCGCC
GGGATCGGTTTCACCGGCTCCTACAACACGCTGCGCCACCTCGCGGAGAGCAAGGGCTTCGGGACTTTCT
CCTACGCCTTCCCCGTCGGTATCGACGCCGGCATCCTCGTGCTGCTCGCGCTCGATCTGTACATGATGCG
CAAGCGGATGCCGTGGCCGATCCTTCGCTGGACCGCGCACGGCCTGACCGTCGCGACCGTCGCTTTCAAC
GCGGCCGCCGCCGGCCCGGTGACCGAGGACCCGCTCGCTGCGTCCATGCACGGCGTCATCCCGGTGCTGT
TCATCATCGCCGTGGAGGCCGCTCGCCACTACATCGGCCGGATGGCCGACCTGCTCGCCGGTGAGACCCC
GCTCGGGTCGGTCCCGCTGACCCGCTGGATCCTCGCCCCGCTGTCCACGCCGCGCCTGGCCCGTCGGATG
CGGTTGTACAACCTCCCCTACAAGGAGGTCGCCGCCCAGCACCAGGCGTTGCGGATCTACCGCGAGGGCC
TGCGCCAGAAGTACGAGAACCACGAGCAGAGCTGGCGCCGGGCGGCGACGCCGGACGAGCTGCTGCCGTT
CAAGCTGGCCCCGTTCGGGTTCAGCGTGGAGCGCGCTCTCGGGGTCCCGCTGGAGGAAGAGACCAAGCGC
CTCCAGCGGGCGGCGCGGGCCGCTGTTCAGCGTGCTGAGGCTGAGATTCAGCGCGTGCGCACCGATGTTC
AACTGGGCGAGGCCCGCATTCAGGCGGAGGTCGACAAGATCCGTGGCGAGGGTCGCCTGAAGATCGCCCG
GGCTGAAGCGGAACGCGAGGCTCAGGCGGAGATTCAGGCCGCCGAGGCCGATGCTCAACTGCGTGAGGCG
CAGCGTCAGCACGCGCTCAAGCTCGCGGAGGACCAGGCTGCGGCCGAAGCGCAGGAGCTCGCCGACGAGA
CCGAGAAGCGGCGCACGCTCTCCCGGATCGACCGGGAGAAGGTGCAGGCCAGTTGGGGTCTGGAGCAGAA
GCAGATGGCCACCGAGGCCACCGAGCGCGAGCGCCGTATCCAGGCCGATGCCGCCGCCCGCGCCCAGCGC
GAGGAGATCACACGGCAGGCCGGCATCGCGGAGCAGGCGGAGCGGCGCGCGCGGGCGCTCGCCGGGGAGA
GGGCGGCCCTGGAAGAGGCCGCTGAACGCGAGAGGAAGGAGGCTGAACATCGCGCCGCGACGGTGAACAC
GATCTTGGAGGCGCAGCGCGGAGCCGAGTCGATCGCCGTGTCGAAGGCCCGCGAGCAGGCCGCGATCGAG
GACGCCGCCGCCCGCAAGGCGCGTGCGGCTGAACACGAGGCGGCGGCGGTTGAAGCCGCGGCGCGCGCCC
GCATGACCCAGGTCGACTGGGATGTGCAGCGGGTCTCCGCGATGATCCAGGCCCGGGGCGATAGCGCGGT
CACCGTCCGCGTCATCGCTGACGAGCTGGGCATCTCCACCGGCTCCGCGCAGGACCGCAAGACCAAGGCG
CTCGCCCTGCTCAGGGGCGAGTCCACCGGCGATCTCGAGCGGGCTGCGGCCTGA
>lcl|NZ_CM001166.1_gene_126 [locus_tag=STTU_p0126] [location=100826..102931]
GTGGCAGACACCGCGACCGCGACCCCTGAAACCACCGCCGACACCACCGGCGACGGGGCCACGGACACCG
CCGAATACACCGTCGTCACCGAGCCCGAGACCACCACCGACACGGCCTCGGACAAGCCGAAAGCCAACCG
GTCGCGGCCGAGGGCGATGCCGCTGCTGATCCACGGCGGCAACGCAACCGGAATCGCCGCAGGCGTCGCC
TACGGACTCGCCGGAGTGCCCGGTCTCATCGCCGCCGGCGCGGCCGGAGCCGCGGTCGGCGCCGCCGCGC
TGGCGGGCCGCAAGAAGCGCTCGAAGGTCTCCGCCGCCCGCACGAACGCCGCGAGCAACCGCTCCGGCGG
CGGGACGCACCGCTCCGGAGGTGGCGCGGGCAAGGGCGGCCTGCTCGGACGCGGCGGCGGTCGCGGCCGG
GGCGGCGGCGGTGCTGCTGGTGGCGGCGGCCGCGGGCCCGGGCGCGGTGGCAAGGGCGGCGGCTGGCTGA
ACGGCTCCGGGTCAGGGGGCGGTGGGACCGGCACGAAGAACCGGCCCGGCGGCGGCAAGCACGGCGCCGG
TGGCGGCGGGCGCGGCCCGGGAGGAACGGGCGGCGGCAAGCACGGCCGCGGCGGCGGCCTGGGCGGACTG
CTCGGAGGTGGCAGGAACCGGCGCGGTCCCGGCGGTCCCAACTCGCCCGGCGCGAACACCCCGAAGGGCA
CCGGGAACGGCAAGAACAACGGGGGAGGCAAGAACGGTCCCGGCGGGAAGGCCGGCGCCCACCAGCAGTC
TCGCACCGGCAAGGCCTGGCAGACCCTCAAGGGCTGGGGCAACAAGATGCGCCGCAACAACGGCGGCACC
TCGAGCTCCGGCGGCTCCGGATCCTCCGGTTCGGGCGGCGGCTCCAGCTCGGGCACCTCCGGCTCCGGCA
CGAAGACCATCACGCCCGCCAAGACCCGCCTCGGTCGCGCCCTGCAGAAGATGCGCGGCCTCGCGAGCAA
GCTCCGCCGCTCCAAGAAGAAGAGCGGCTCCACCAGCTCCGGTGGAAGCGGCCCGACCTCGGGCCGCTTC
CACCGGATGCGCCGCCTAGCCGCCCGCAAGCTCGGGCACTGGCTGCGCTGCGCAGGCGCCGGACTCCTCG
CCGGACTCGGAGGGCTGGCAACGCTGCCCCTCGGACTCCTGTGGGGACTGGCCCTGCTGCCGTTCAAGCG
CCGCGACCCGCTCCACGGGTTCGCGCTGCCCGTCCGTGTCGCCGGACGGATCTGGCGGTTCTTCTTCCGC
CGCTCCAAGGCCCGCCACGACAAGAGCGCCAAGGCGGACACGCTCAACCTCAAGGTCAACAACCCCAGGA
AGGACACCGATCCCGTGACCGGACCCTCGCTCGCTGCTGGCACCACGGTGCTGGACGGCAACAGCTCCAA
GTTCGCGATGGCCATGCGCGCCGCGCACGCCTCCTACACCGGCTACAGCCCGCGCAGCATGATGGAGGTC
GCTGCCGAGTACGCCGGCCTGCCCAACGGCATCCGCGCCGCGGCCCTGGCGGTCCAGCAGATGGCCGTCA
ACGCCGACCAGAAGTACCCGTGCAGCAAGAAGGCGCTCGCCAAGCTGAGCGAGGCCTGCGCCAAGCTGGT
CGCCGCCGCCGCTCGCGCGGACGGCATGGTCGCCTTCTTCCGCATGGTCCACGCCTTCGACATCGAGCGG
ATCGTCGCCCCGAGGACGAACGAGTGGATGTGGAACGTCACCCCGACCGGCTCCGACGCCGCTGAGGGCG
CGATGTTCATGCCCGGCCGCATCGAGTCCGGGTGCGTCCTGATGGCCGTGCTCTACCGCACCTTCGAGCC
GGTCCACATGATGCAGGTCGGCTCCGAGTTCCAGGGCATCGCCTACGGGCTCACCGCCCTGGCCGACTGC
GTCCAGGCCCTCTACGAGCGCACCATTGCCCTCTACCCGGTCGACGACCGCGTCACCGACGAGATCGGCA
AGCTCGTCTCGATGATCCGGGCCGCGTCCGACGACGCGGACATGGCCGCGAAGCTGTTCGTGGAGGACCA
CAGCCGCGAGATCAGCCACAACACCAGCCCCCGCAAGGGCCCGGCTGCCGAGTCCATGTGGAACACCCCC
CGCTGA
>lcl|NZ_CM001166.1_gene_127 [locus_tag=STTU_p0127] [location=103080..105521]
ATGCGTCACTGGGACTGGTCGCTGCCCAGCGGCCACACCACCTTCCTCGGATACGCCACCGAGACCGCCA
TGACCACCGTCGCGCTCGCCCCGCTCACCGGCCTGCCCTGGCAGGCTGCCGCCCTCACCCTGGGCAGCGC
GGCCGCCGCCGGCACCGTCCACGACCTGCGCGTGAGCACCACCCTGGGCACGCTCACCACCCGTGCCGTC
TCCTGGCTGACCGCGTCCGCATGGGCGTCCTGGGCGCTGGCGACCGCGCCGCTGACCACCACCGGCTGGG
CGAGCGGCCTGGGCCTGGCCACCGTCGGCCTCGCCGCCAACGCCTCCGCCAACCGCACCGAGAACACCCG
CTCCGAGCGCAAGAAGCTCCTCAAGCTCCGCCGCAAGTCGGTCGGCATCCTCCTGGACTGGGAAGACCGC
ATGAAGCGCGTCGCCCGCATCGAGGACTGCCACGGCAAGGACGTGCAGCACTGGCCCGGCGAAGTCGGCT
ACACCGTGGAGATGGACCTGCCCGCCGGCGGCACCAACGTCGACGACCTCAACGGCTACGGCCCGAAGTT
CGCCAGCGACCTGCGCCTGCCCGACGGCTGCGGAGTCGAGCTGTTCCCCGGTGCCAACCGCGGCACCATC
CTGATCGAGGTCACCCTCAAGGACGTCATCACCGCCGACATCCCTTACCCCGAGGACTACTCCGAGATCA
GCCTCACCGAGCGGTTCCCGTTCGGCGTGTACCGCAACGGCGAGCCCGCGCTCGGCAGCCTCTGCAACGA
CTGCGGGATCCTCGTGGGCGAGACCGACGCGGGCAAGACCAACACCCTGCGCGTCGTCACCGCCCAGCTC
GCCCGCATGCCCGACGCGCTGATCTGGGCGATCGACACCACCGGCGGCGGCGTCGCCCTCCCCTGGATCA
CTCCGTGGGCCACCGAGGGCATCGCGTCCGCGCCGATCGTCGACTGGATCGCGCACACCGAGGACGAAGC
CCGCCTCATGCTCAAGATGGCCGCCGAGATCATCGCCGCGCGCAAGGCCGGCTACCAGCAGCTGATGCGC
GAGAGGAAGACCGACAACAAGCTGCCGATCAGCGCGGAGATCCCCGGCATCGTCATCATCACCGACGAGA
CCGCCTCCCTGCCGTACGACATCAAGGAGATGATCGACAAGGTCGAGCAGGAGGGCCGCGCGATGCGCGT
GCGCGCACTCGTGGCCGCCCTGCGCGCCACGCAGGACGCCATCACCGCGATGATGAAGCTGATGTCGAAG
TGGCGGGTCGGCATGACCGTCTCCGACGCCGAAGAGCTCGCCTACCTCTTCCCCGGCTACATCAAGATCG
ACCCGAAGGACGCGCCCGTCGCAGGGTCCGGGTGGAACATGCACACCCGCCTCGGACCGAAGAAGCCGAC
CGCGATGAAGGTATGGCGCCTGGTCGACGAGCTGATGGACACCATCTGCCAGGCCACGGCCGGGCGACGG
CCCAAGCTCGATGAGCTGTCTGCCGCGGTGGACAGCGGCGAGCACTACCCGCAGCGGTGGGCGCGCACCC
TGCCCGACCTGTACAAGGGGCAGAAGCTCACCGAGTCCGCGCAGTACGCCGTCGACAACGCCGGTGAGAT
CATCGCCGCCGCGACGCTGCTCGCCTCCGACCCGGTGCCGCAGGGCAGCAGCATGGCGTCGCCCGCTCCG
GTGGTGCCGGCCGGGTTCGAGGGGTTCGGCGGTGCAGAGGAGCTGTTCGCAGCCGTCACCGCACAGCTGG
ACCCGAACGCCGCGCACCTCGCCGTCCCCACGGCTCCGGCCCCCACGCCGGCCGCCGCGCCGACGGCACC
GGCCCCGCTCCCCCGCCCTGCCCGCCCGGTCGATCCGCGCGAGCTGGGCTGGGAGCTCCTGGCCGCCGCC
GGGGCGACCGGCTACACGCCCAAGCTCCTGCACGAAGCCCTCGCGGCGGAGATGGACCGGCGGAAGGTGG
GCGACGCCCCGGCACAGCGCACGGTCGGCGGCTGGCTCCAGGCGTGGGCGAAGGACGGCAAGGCCATCAA
GGACGACTCCGGGCAGTACACCCGCTACGTCGCCCGCGAAGCCGCGGTCGGCCCGGCCGTCTCCGGCCCG
GCCACCCCGGCCGGGTCGGAGACGGCACCCCTGCCCGAGGGTCTGGACGCGGCCCTGGTCCTCCAGGCCG
TGGACTTGGTCGTCTCCACGCAGTTCGGGTCGGCGTCGATGCTCCAACGCAAGCTGCGCATCGGCTTCGC
CCCCGTCCAGAACCTGATGGACTTCCTCCACCAGCTGGGCATCGTCGGCCCGTCCGACGGCTCAAAGGCA
CGCGAAATCCTGGTCTCGACGGCAGACTTGGACGCGACCATGATGAGGATCGCCGACGAACTCGGCTACA
CCACGCGCGACTTGGGCGCGATGGGCCTCGCGGCGGCTGCCGCTTCGCATGCCAAGGAGTGA
>lcl|NZ_CM001166.1_gene_128 [locus_tag=STTU_p0128] [location=105526..105831]
ATGGCTGAGACCGCAGACGAGGAGATCGAGCGCCTGGAGGCCGAACGGCACTCCTACAGCGAGACCTTCA
AGAACACGTCCGACACGGACGCGGTCACGCGCGCGCACCTCCAGTCCGAGATGGACCGGCGCACCGACCG
GATCCAGGAACTCCAGCAGCACCAGCCGCTCGGGTTCCTCGCCCGCTGGGGGCTGCGCGCCGCCTCCCTC
GCCCTGCTCTGGGGCGCCTGGGAGGTCGGCCCCTGGTGGGCCAAGACCGGCTGCGTCCTGCTCGCTGCCT
TCCTCGCCTTCTACAGCCTCGGCTGA
>lcl|NZ_CM001166.1_gene_129 [locus_tag=STTU_p0129] [location=105943..106572]
GTGGAACCCCGCGACCTCACCCTCACCGACCAGACCCCCGCCCCGCCCGCCGTCGCACTCCCCTACGAGG
GCCTGGAAAAGATCTGGGAGCTGTTCCCCGACGCCCGACCCGGCGCCGGCGGCCTGCCCGCCCCCACCCC
GCACACCGCCGTCGGCCTGCCCACCGACGAGGCGTACATGGCCCGGGTCTACGACCTGGTCCGCCGGGAA
GAGGCACTGAACCACATCCGCGCGCAGTACCAGCAGGCCGCCGCGCACGTCGCCCTCGCCCCGGCCCCGG
TCTACCCCCAGATCGTCGCCCAGACCCCGGCTCCCGCCCTGCCGCCCGCCCCGGCCCCCGAGCCCCAGCG
CGCGGTGCCGGCGTACGTGTGGAAGTACAGCGCGCTCACCCTGTCCACCGGCGGCTGCATCGCGCTCACC
GGCGTCGGCATCGGAGCCGCCGCCCCGACCCTCGCCCAGATCCCCGCCATCCTCACCGCGACCGGCCAGG
TCCTGATGAGCGGGACCGTCCTGGTCGTCGTCGTCCTCCTGCTGCTCGCCCTGCGCGGCACCGGGGGCGG
CGGCGGGCGCGGCGGCAACACCTTCAACATCCGCAAAGCGGTCTTCCGGCGCAACACCTTCCGGGGATGA
>lcl|NZ_CM001166.1_gene_130 [locus_tag=STTU_p0130] [location=106667..107410]
TTGGCTACCAACGACCCCAACACGCGCGCCGAGAACGACCTCACCACGAAGGTCGCGACGACCAAGACGC
CCCCGCGCCTCAAGACCGCCCGCGCCTGGTGGACCCAGGCGTGGAACGAAGGCGGCATCCTGTACTCGCT
GTGGGACGACGTCCGCCAGGCACCCGACGCCGGATGGCACGGCATGGCCAACTGGATCAAGACCGCCCTC
GGCATGATCGCGTTCTCGTTCGTCGTGTTCCTCTTCACCGGCGCCGTCGACGTCCTGATGGACGCCGTGG
ACCACCTCCTGACCGCCGTGCCCACGGTCCAGATCAGCGACAACACCTCCAGCGGCGTGTGGGCCACGAT
CGACAACCCGATCCGCTCCTACATCGCCGCCCACAGCGCGGACCTGCCGATCAGCGGGGCCACCGTCTAC
ACCCTGTGGCGGTTCACCGGCCTGTTCTGCCTGGTCGCCGGGTTCTTCACCCGCAACAACGGCGTCCGTC
TGACCTGGACGGCCTGGGGCGCGGCAGGCATCGCGATGGTGTGGACGACCACCCCGGACACCAGCCGCAC
CGTCGCCACCGCCGTCGCCCTGCTGGCCTGGACGCTCGCCTCCGCCTTCGCACTGCGCGGCCTCAACCTG
CGCCCCCGCGTGCTCACCAACATCGGCGCACCGCAGATCACCGTCCAGCCCGAGATCCACGTCCCCGTCC
AGCCCGGCCCCGCTGACAACGACAACATCCGCCACCTGCGCTGA
>lcl|NZ_CM001166.1_gene_131 [locus_tag=STTU_p0131] [location=107521..108099]
ATGGCCCTCACCCTCTTCACCCGCCGCCCCGAGCCCGCCCCCACCGAGGAGGTCCTCCACCCCGCGCGCT
GCCCCGAGACCGGTGAGTCCTGGACGCCCGAAGGCGTCACCGTCGCCGAGCGCTACTACAACCTCGCGGG
CGCGGTTGTCCTCGTCTACACCGCCGACACCTCGACGAGCCCCGGCACCTACTACGCGGTCGCCTGCCTC
GGCTGCCACTACGCCACCCGCCAGGACTCCACGTACGCGCGCTACACCCTGACCGCCGCCGCGAAGGTCG
CCAACACGCACGCGAGCAGCTGCCGGGCACTGCCCCGCACCATCCCCGCCCGCCCCGACGACGACACCGT
CCGCGAACGCCTGCACTCCTGGGTGCGCCGCGCCCGCCGCCAGGACGAGGGCGTCCAGATTTGGATCCGT
GACCTGGACCTGATGCGCCTCACCCTCCAGCGCACCACCAAGTGGATCGAGGCCGTGCTTCATCAGCTGG
CCGAGGACCAGCCGGACGTCCTCTGGATCGCGCACAGCCAGTACAGCGACGCCGTCGCCTACTCCGCCCG
CCAGCTCCCGGAGGCCTGA
>lcl|NZ_CM001166.1_gene_132 [locus_tag=STTU_p0132] [location=complement(108317..109756)]
GTGCTTCGCGCGGATCACGTGCTCCGGCACGCGGCGCTCGCGGGCCGCGTTGCGGGCGAGGCATTCCTCG
AGCGGGGTGTCGAAGAGCACGGCGTGCACCAGACGCCCGTGGTGGCGGGCACGCTGCACGAGGAACGTGC
GCGCGGTAGGGGCGGTGTTCGTGCTGTCGGCGACGGTGGTCAGCCCGCGTTCCAGGCGCGCGTCGAGGAC
GATCTCCTGCATCGCGACGACCTGCGCGTTGGCGCTCTGGTCGCCCTCGTCGCCGGTGAGCAGGCCGCGG
TAGGTGTCGAGGCAGATCCTGGAGGCCTGCGGGAAATGGGCCGCGGCAGTCGATTTGCCTGCGGCGGGCG
CCCCGACGAAGACGATGAGGCTGCCGGGCGGGAAGCCCGCGAGCAGGCCCGCGCGGACCTTCGATGCCTC
GCGTGTGGCGCGCTCCTCGTCCTTGCGGGCGAACTCCTCGTCGATCCAGCCCTGTACGGGAAGGCCGAGG
CCTTCGGCGGCCGCGTACGGGTCGGTCATCTCCGGCCACTCGCCCTCCTCTTCCAGGGCGGCGGCGAGGG
CTGTGGCGCCGTCCGGGTCGGTCTGGGCCAGGGCGGCGAGGGTGCGGTGCAGGTTCCACGCGGCAGCGCT
CCCGGAGGCGTACGCCCACATCGTCTGCGGGTCGGGGGCGGCCGGGATGCGCATGGACAGGCGGATGTGC
GCGTGGAGCGCGAACTCGTGCAGCGCGCGGACGTGATCGGTGGGCAGCTGTGTGTCGGACACGTTTTCTC
CTCGCGTGAGGCGGCTGAGGGACCACCGCACTGCCCCGGCCCTGGAGGAGGGCCGAGGCAACACGGAGGC
CCCTCAGCTGTGCGGGCCGGGAAGGTCGGCGGCGGCGTGCTGGACACGCGGCGGCGTGGGGGTGGGGTCG
GTGGTGCCGTGGGCGACGGCTGCGAGGGTCCGGCTGAGCCGGTGTCCCTGCGCGACGGCGGCCTCCATGA
GCTCGGTGAGGCGCGGGTCCAGGTTGTGGTGGCGGGCGCCGACGAGAACGCCTTCGAGGCGGGCGAGGTC
GAGGAGGAGTCGGTCTCGGACGTCGAGGACGGAGGGCTGGAGGGACAGCGCGGTCGGGTGCTTCGCGATG
GCGAGCGCCGCGTGGTCGGCGAATTGTGCGTTCGCGGTCTCGGTCTGTTCGGCGAGCGCGCTGTCGATCG
CGCGGGTGGTGGTGTGGGCGCGGTGCCGGCCGAACCGGGCGGCGAGCGTGTCGAGGCGATGACGAGTGAG
GGGCATGAGGGCTCCGGTGTTCGGGGCGGGGTGGGGCTCCGGGACGGCCGGGCGCTGGGCCTGCGGCCGT
CCCGCACCGGTCAGCGGCCCGCGCGGCGGCGGGCGTCGGCGAGGATGCTCTGCGCGTCGGGGTGGGCTTT
GACGGCGTTGGACAGCGCGTCCCACCACCGGCGGGCGTAG
>lcl|NZ_CM001166.1_gene_133 [locus_tag=STTU_p0133] [location=109825..110112]
ATGAGCGGCACCCCGAACGCCAGGACCGGGCAGGGCTGGGACCGGGCGGACTTCCGGTGCGGGCGGTGCG
GCGCCCGCCGCACCGCGACCACGGAACCCGAGTACACCGCCGTTGTCGCGGCTCACCAGCACGCGCACGC
GCTGTGGGACCGGCTCACCCCCGCCGAGCGGCTCGCGCTCACCGAGGCCACCCGACTCGTCCTCGGCGAT
CTGCGCCTGAGCGCCGAGTGGCTCCACGTCGTCACCCTGCACGCCGAGCAGACCGCAAGGAAGGACCCGA
CCTTCTGA
>lcl|NZ_CM001166.1_gene_134 [locus_tag=STTU_p0134] [location=110112..110762]
ATGAACGCCCTCGACCGCCTGATCACAGTGCTGCGCGAGCGCAGCACTGTCACGGACACCAACCCGCCAC
GCGGCTGGGTCGTCCTCCTCGCGCCCGACGGGAGCCACCTCGCCTACCTGCCCCTGGCCGCCCCCGACAT
CCTCCAGCTCGCCGAGGACTGCGGCCTCGACACCACCGGGGAGAGCGCGGACGCCGACCTGCTCTGGGAC
GCCCTCGACGACGCCGCCCCGCCCACCCTCCTCACCGGGGACTGGACAGCGCTGCTCCGCGTCCACGACG
GCACCAGCACAGTCGACGAGATCCGCCTGACCGACACCGAGCTCACCGACCTCGCCACCCTCCTCGACGA
CAGCGCGCGCCGCCGCGCTGAGCGCGAGCAGCTGCACGCCGATCATCCCGAGCTCGTCGCCGAGGTCACC
GCGATCGCGGCCTGGCCCGAGGACGAACTCTCCGCCGACATCACTGCGATCGCCGCCTGGCCGGAAGACG
AGCTCGCCGCTGAAATCGAGGATCTCGCCCCGCGCAGTCAGAGCGACATCTGCGTGCTCTACGCCGAAGT
CCTCGCCCACGGCCGCCGAGTGGCTGCGACCCGCGCCCTCGACGACTGGTTCGGCGCGGTCACCGACCCC
AGCGACGAAGACCCCCGATAA
>lcl|NZ_CM001166.1_gene_135 [locus_tag=STTU_p0135] [location=110812..111207]
GTGCGCGTACACATCACCTCCTTCGGGCACCTCCACGGCCCCCGCCCCCAGGACGCGGACATCACCCTGG
ACCTGCGCCCGTTCCGCGACCCACACTTCGACCCGGCCCTGCGCGAACTGACCGCCCGCGACCGACGCGT
CATCAAGACGGTCCTCACGACCCCCGGAATCCGCGAGCTGATCGCGGCGACCGTGGCGCAGGCCCGCGCC
TATGCCGCCGCGCCCGCCGCCCGCGAGCGGACCCTGCACATCGCGGTCGGCTGCTCGGGGGGCCGACACC
GCGCCGGTGTCACCGCCCACGTCCTCGGCCGACGCCTGCGCCGCCGCGGCCACACCGTCACCGTCGTCGA
CCGCGACTTACACCGCCCCGTCGTCGACCGCCCCGCCCCACGGTGA
>lcl|NZ_CM001166.1_gene_136 [locus_tag=STTU_p0136] [location=111403..111768]
ATGGAGCAGGTGATGCCCCGGGCCCGCCGGAAGCGCCGTCGCGAGGCCCGCCGCGTCCCGCGCAGCGACG
CGCACCTGCCCGAGTACGACCGCGGGGACTGCCCCGAGGGCCTCCTCACCCGACGGCAGTTACGCGACCT
GGGACTGAGCCCCGGCGGACACGGCCCGGTCGCGGTGCTGCGCTGCAAAGGCTGCGCCTACCGGCCCGAC
CAGGCGTGCAACCACCCCACCCGGGCCTGGCTCTACAGCGTGGCGCTCGCCCGACCGAAGCGCACGCCGA
CGCTCGCCCAGGAATGGGCCCTGGACAGAGCGATGGCCGCGAGGTCCACGTGCCCGGAATGCAAGCGCCG
GTACTACTTCAGGTAG
>lcl|NZ_CM001166.1_gene_137 [locus_tag=STTU_p0137] [location=111921..112982]
GTGCTGAAGTATGCGCTCAGACCCAAGGCCCGTAGGTCAGCCGCCGTAGAGGCCCCACTCGTCGAGGCCC
CCGTAGATGTGCGCTTCGAGGCATTGCGGGGCGTCAAGGCCCACGGCCTCACCCCGGTACACGGCGATGA
GGGAGTCCTTGCCCCGCCACCACGAGTCGGTCACACCCTGTACTTCGGGTACCGGCTCGAATGCGCCGAG
ATCCAGTGCGTCGACGGCCTTGCGCTTGACCCTCGTGACGGTCGTGGCCCAGCGGCGGGCATGAGCGGCG
AGCGCCAGGGATTCCACCCATCCGTCAGTGTTGGCATGCAGGGGCGTCCACTGGTAGGCGTCGATGCCGA
ACGCACCGTCGGGGCCGATCGCGAAGCTGTAGGCCATGGAAACCCGGCAGCCCCCTGCCGGGAACGACCA
GCCTTCTGCGGGCATCTCCTCGGGGCAGTCGGCATCCAGGATGCGCGGACCGCCCTCGTAGAACGGGGCC
GGCGGCAAGGCGAGGCCGCCCCAGCGGTCCTGGAAGGCAGCAGCCCGCTCGATCTCCGCAGCGGGGACCC
CGTACTCGATCCACGCGTCGCGGTGTCGCCGGATGTCCGGCCGGCGAACACGTATGCCCTCCGTCTCGAC
AAACCGCTGGGCCCTACGGCTCAGGCCGGCAGGCGCGACCGGGACGGACGATACGGGCTGGTCAGCCATT
ACCGCTGCTCGCCGTCACCGGCGTGGAGCACGGCCGACGCAATCTCCCGCACGCGCTCCGGGCTGATCCC
TGTGCGCTGCTCGACGGCGAGGGGGTGGTCGGTGGGCTCCAGCTCGACGAAGGGGCGCTCACCGACCGGA
CGGGTATGGACGCGCGTCTTCAGGTTGAGCGTCGTCGCCGGGTATACCGGAAGATCGGTGGTGAGCCAGC
CGAAGTACGGCTTCTCAGCCTCGCGGCCGGGCCTGTCCCACAGATCCGAGGCTTGGGAGAAGCTCTCTCG
GCTGAGCGAGACCCAGACGCCCCAGGAGAACACCTCGGCACTGCCGATGACCGGTATCTCGATCAGGCCC
TTCACGAAGTAG
>lcl|NZ_CM001166.1_gene_138 [locus_tag=STTU_p0139] [location=complement(113383..113535)]
GTGGTGGCCTTGGTGGTGGCGACCACGGCCGCGACCAGCACGGCGGTTCGGGCGCGGATGGTCAGGGCCG
GGCGAAGGGGTGGACGAGCCACGGTGATTCTCCTTGATCAGGCGGCCAGCCGGTGGATGACCGGGGCCGT
GGGGACGAAGTAG
>lcl|NZ_CM001166.1_gene_139 [locus_tag=STTU_p0138] [location=113539..113889]
GTGACCGGCCGCACCCGCACCCGCCTGAACCGGGTGCGCGCCTCCGTCGGCATCGCCCAGCTCGCCCTCC
AGCAGATCGAGGACGACATGAGCGCCGACGACGTCGACGGCCAGGAGCTCGCCGCGATCCTGCGCGAGCT
CCAGGAGGACGCCGACGTCCCCTGCGGCCTCTTCCCCGCCCTCGCGCAGCTGGTCACCGCCGCCGCACGC
CGGGCGGAGCAGATCGAGCCCGACCGCGACGGCGACGCCTCCTGCCCCCTGCACGAGGCCGCCGCCCTGC
TCACCGACAACGCCGGGCCCCGCCTGAACTGGGCGGCCCGCTCCCTCGACCCGCAAGGAGATCTCGCATG
A
>lcl|NZ_CM001166.1_gene_140 [locus_tag=STTU_p0140] [location=113913..114848]
ATGCCCGAGCACAGCCTCGTGGTCCTCATCGGTGCGTCCGGCGCCGGGAAGTCGACGCTCGCGCGCACCT
GGCCCGCCTCGCAGGTCCTGTCCCTGGACGCACTGCGGGAGGCCGTGGCCGACGACGCGGGCGACCAGGA
CGCGACCGGCGACGCCGTCGCCGCCCTGCACCTGCTCCTGGAGGCGAGGATGCGCCGCCGGTTGTTCACG
GTCGTCGACGCCACCAACGTCACGGCCGCCGCCAGGAAGCCGCTCATCGCCGCCGCCAAGCGCCACGACA
TGCTCCCGATCGCGGTCGTGTTCACCACGCCCGGCAGCATCTGCATCGAGCGGCAGGGCCCGCGGCCGGC
CAACCGCACGGTGCCGGAAGAGGTGGTTGCCCAGCAGCACGACGACATGTTCGCCTCCCGCCGCACCCTG
CGGGCCGAGGGCTTCCCCGAGATCGTCTACTCCGACAGCATCTGCCGACTCGCGCCGTACCTGGAGCGCC
TGAGCGAGAGGCGGCAGGCCGACCTCGGGCTGGACGGTGGCGCCGGCCTCGGTGACCTGAACCTCGTGGC
CCGGGTGTTCGGCGAGAACATCCTGCCGCTGTGGCAGTGGAAGCCCGGCTCGAACATCGCCGGCGGCGAC
CGCGTCGCGGAGATCCGCCTCGGTCAGCAGTACCTCACCCTCGCCCTGCGCACCGACGTCGACGGCGAGG
GCGACGTCGGGTTCGACGTGATGGTGCCGTGCCCGCACGACGACGAATGCACCGGCCACGCCTGGGTGCC
CGCCTACAGCGTCACCTGCCTGTTCCGCGCGCTCAACGGCGACCTGGACGACGACGAGGACATCGTCTGC
ACCGTCCACGGCCCGAACACCGACGAGGACCAGGAGGACGATCCCGAGGGCCGCGCCGACCTAGAAGAGC
AGTTCGCGACTGCGGTCCGCGAGTGA
>lcl|NZ_CM001166.1_gene_141 [locus_tag=STTU_p0141] [location=115076..115849]
ATGGCCCGCAAGCCCATCACCTGGTACATCGCCACCCCCACCGACGGCACCATCGAGATGTCCCGCGAGG
CCGGAACCCCGGTGGACCTTTCCGTCAACGTCGGCAAGGCCATCGACCACCCCAACCCCTGCCGCAACAA
GTGGTACGACGAGAGCGGCTTCTCCTACTTCCGCATGGTCAAGCGCGTCGGCGAGGCGCTGGAGGACACC
GGTATCTGGCCCATCACCTGGCCCGTCCGGTTGTGGATCGTGGAGCCGCTCGGGGAGACCGGCAACTGGA
GCCAGCGCCACTACCCCTACCGGCTGCTCTCCCACCGGATCCGCGTCCTCGAGGAGACCGACGCCCACCG
CGCGCTCGGACCCGCCGGCCTCGACGTCCTGAACGTCGTCCAGCAGGAGATCCCCGAGCGGGCCGCACGC
TGGGCCGCGGACTGGGACGCCGACCCCGAGGGCATGCGCGTCCGGACGTGGAACTGGGAGCAGTGCGGCG
GTCCCACCTGCGGCAGCGGCCGATGGGCGGACGAACTCGCCATGGCGGTCTCGCACAACCGCCGCGAGTC
GGGCGCCCAGACCTGGATCGAGCACCTAGCGCGCAACGCCGTCGACCAGGCCCTCGCCGACACCGACGCC
AGCATGACGGCCCGCTGCTACGCCTACGGCCGCGCCACCGGCCACGCGGTAGCCGCCCAGCACCAGAGCC
GCTTCGAGCCGTACGTCCTGGACGCGCTGCGCGGCGTCGGCCTCGACTCCCCTGCCCCGGCCGTGGCCGC
CTGA
>lcl|NZ_CM001166.1_gene_142 [locus_tag=STTU_p0142] [location=115981..116658]
ATGGACTCCGTCCTGCACACCACGGGCCGCTTTGGCCCACGCACCCTCCTGATCACCGCCGCTGCCGTCC
CGCTGACCGGCTGGGCCGTCCACGCGACCGTGCTGCTCAAGCAGATCGCTGCCAAGGAGAAGGACCCGCT
GACCGGGCTGCTGCGCCGCGACACCTACACCGCCCGCGCCCGCCGGATCCTCGCCCGGCACGGTGACAAC
ACGACCGTGGTCATGGTCGACGCCGACCACTTCAAGCAGATCAACGACCGCGACGGCCACGAGGCGGGGG
ACGCGGTCCTCGCCGCGCTCGGGCAGCGGCTCACGGCCTGGGCCGGTCCGCGCGCGGTGTGCGGGCGCCT
GGGCGGCGACGAGTTCGCCGTCGCCCTCCCCCTGCCCGCCGAGCACCGCGCCGAGCGCCTGGAGCAGCTC
GTGCGGGCACTGCACGCGCCGGTCCGCCTCGACGACGGGCGCCTCATCCAGGTCGCGGTCTCCGTTGGCG
CCGCCACCACCGACACCCTCCACACCCGCGACCTCGCCGCGCTCCAGCGCGCCTCGGACGCGGCCCTCTA
CGACGGCAAGCACACCGGCCGCGCCGTCCTCGCGACCACCGCGCACACCCGCGTCCCCTCCATCAACGGG
CGCAGGATGGGCCGTCCCGGCACCAGCGTGTGGGGGCAGGCCGCATGA
>lcl|NZ_CM001166.1_gene_143 [locus_tag=STTU_p0143] [location=116768..117376]
GTGGTGGCGCGGATGGTTCCTCATCCACGCCGGCCGCGGCACCGACCACCAGGCGCTCACCGACCCCCGC
GTCACCTGCACCTTCCCCCGACAGCCGCTGGAGTTCGGCGCCGTCCTGGCCGTCGCGCGCCTGACCGACT
GCCACCAGGACGAGCCCGGCCGCGCCTGTTCGGCGTGGGCCGACCCGGAGGCGTGGCACCTCACCCTCAC
CGACGTCACCCCGCTCCTGGAGCCGATCCCCGCGCTCGGCCGCCTCGGCCTGTGGCGCCCCAGCTGCGAG
CTCACCGCCCACGCCCTCGCCCAACTCCCCCACCTGAAGCCGTGACGCGCGCGAACCGGCCGAAACAGCT
GTGGGAGCCGGGTCTCATCCCGGCTCCCGGCGCCCTCCTGGACTGGCGCGACGCCCGCCACCACGACGCC
CGCAACGCCTACCCCTGCACGCTGTGCGGCCACCCCACCCACCTGCGCTCCCACACCGGCGAACCCGCCC
ATAAAACGTGCGCCGAAACGTGGATCGCCACCCACTACCCCGAGGCCCGCCGCACCGCGCGCTTCGCCTC
CGACCCGGCCCCCGCGCGCCGCTCCGATGCCGCCGACGACCACGCCTGA
>lcl|NZ_CM001166.1_gene_144 [locus_tag=STTU_p0144] [location=117396..117572]
ATGCCCGTGAACCACACCCCGCGCGCCGACTCCGACCGCGCCCTCGCCTACCCCGAACCCCCCGCCACCT
CCACCTGGCACCACACCACCACGCCCCGCCCGCGCACCCGCAAGCTCACCCCCGAGCAGCAGCGCCACAA
CCGCGAACGCCTCCAGCACGAGCTCAGCGCGAAGTGA
>lcl|NZ_CM001166.1_gene_145 [locus_tag=STTU_p0145] [location=117578..118447]
GTGTACGCCGACCTGAACCCCGCCCAGACCGCCGAAGCCCTCGAACTCACCCCACCCAGCCCCGACACCG
AAGCAGCCGCCGCCCGCACCGTCGCCCGCCACGCCCACGGCAAGGAGGACCTCGTCCTCCTCCTCGACGC
CCTCGGCCTCCCCCACAACGACGACACCCTCACCGCGCTGTTCCCCCTCCTCACGGAAACCGGAGCCACC
CTTCCCATGACCGCCAAGAACCCCGCCACCGTCCTCGCCCCCGCAGTCGATATCGCGGCCTTCGACGCCG
CTCCCGCTCCCGCTCCCGCTGGCCGGAGCGTGTCTGCGTTCGAGGCCATGGCCCTCTCGATGCACACCAA
CGGCGACAGCATCCAGGGGATCTGCGCGGCCACCGGCCTGAGCGAGACCGAACTCAGCGACCTCCTCGCC
GCCCCGGCCACCGGTACCCCGGACGTCGCGCTCGCCGTCACCCCCGAGATCCAGGAACTGCTCGACTGGG
CGGCCGCGCACCCGGCCGCCTCGGTCCGCAGCCGCGCCGCCCGCATCACCGCCGACCTGGCCGAGCTGTC
CGAGCGCCGCGACAGCGAGGCCGCGCAGCGCGAGGCCGAAGCGAAGGTCGCCAGGGCCAAGGCCGAACTG
GAGAAGGCGCAGGAGGAGCTGCGCACCGTCAAGGCCGGCACCCGCACCACCACGGCGGCCGCCGTGGCCG
CCCCGATTCGCGCGGCCCTCGGCAGCGGCCGTACCCGGGAGGAGCTCGCCGCCGTACGGGCGTGGGCGCG
CGAGAACGGCCATCAGGTCGCCGACACCGGGATCGTGCCCAAGCGGGTCCTTCAGGCGTACGACACCGCG
CACCGGGCGCCGGTCCGGAAGGCCGGCTGA
>lcl|NZ_CM001166.1_gene_146 [locus_tag=STTU_p0146] [location=118450..118932]
ATGACCGACGACGCGATAGCCCTGGACGAGGAGACCGTGCCCGGCGACCTGCACGGATCGACGGCGCGGT
TCCGCCTCACCGTCTCCCCCACGGACGAGCGCACGGACGAGATGATCCTTCCCTGCAGCGTCACCGACCC
GGCGCTCGCGCACACCGTCATCCACGACCTGGTCCCCGGCGACAAGCTCCGCGTCACCGGCCACCTCCGG
CTGCCCCGCACGCCGGACGAGCCGATGCGGCTGGACGTCACCGAGCTCGCCGTGCTGGAGACCGCGCCGG
AACTGTCCGACCCGGCCGCCGTCACCACAGCCGTCCTCGAGCGGCACGGGCCGTACGTCTGCTGGTTCGA
CGCCGAGAACTCCGGTGAGATCCCGGTGTGGACCGAGGCCGGGGTCTGGGTCGGGCACGCCGGTGACCCG
GACGCTCTGGGCGAGCTGATCGAAGCCTTCGAGCAGCGCCAGGCCGCCAGCGGCGAGCAATAG
>lcl|NZ_CM001166.1_gene_147 [locus_tag=STTU_p0147] [location=118943..119410]
GTGCCCATCCGTCCCGAGAACCTGCACCGCTACCCGCGCAACTGGCCCCAGATCAGTGCGCGCATCCGCT
TCGAGCGGGCGGGCGGCCGCTGCGAGTGCGAAGGCCAGTGCGGCCTGACGCACCCGGGCGGCCGCTGCCC
CGCCGTCCACGCGGAGACCCACCCCACTACCGGGTCCGTTGTCTGCCTCACCACCGCCCACCTCAACCAC
ACACCCGAAGACGTGCGGGACGAAAACCTCCTCGCCGCCTGCCAGCTCTGCCACCTGCGCATCGACCACG
GCCACCACCAGGTCACCCGCGCACGCACCCTCGACGCCCGTACGGCGGCCACCGGACAGCTCGGCATCCT
CGACAACGCCGACCTGGTCCGAACCGAACCACCCACCCCGCCGCCCCGGCCGCCCGCACCCCGCACAACA
CCCGCCGACCGCCAGCAACTCACCCTCACCGACCAGGAGGCCCCCTGA
>lcl|NZ_CM001166.1_gene_148 [locus_tag=STTU_p0148] [location=119410..119592]
ATGCCCAAGCAGCCCCAACCCCCGCGCACCGTCCTGGAGCGCTTCCCCGCCGGAGGCCCCCGCGGCTCCT
GGCCCGCCGAAGCGTTCGCCGCCGCCCAGCGCGCTCAAGGTGCGCGGGTGCAGGTCGTCATGGACCTGCA
CACCGACCAGTTCCTCGTGGTCACCGACACCACTACCCACTGA
>lcl|NZ_CM001166.1_gene_149 [locus_tag=STTU_p0149] [location=119615..120034]
ATGACCGAGACCGAGACCACCCGCTACACCGCCGACGTGGTCGCCCTGACTCCCGACGGCAACGTCCTGC
TGATCGAGCGCGACTGGCCGCCCTTCGAGGGCGCCTGGGCGCTGCCGGGTGGCCACCAGGATGAGGGGGA
GACCAGCCGCATGGCGGCTGCTTGGGAACTCCTGGAGGAGACCGGGGTCCGCGTCGACCCCGACCAGCTG
CGCACGATCGGCACATGGGACCAGCCCGGCCGCGACCCGCGCGGCAGGTACAGCACCGACGCCTACCTCG
ACGTCGTCCCCACCGGCACTCCGATCACCGCCGGGGACGACACCCGCACCGCCCGCTGGTGGCCTCTGGA
CGCACTTCTGGAACGGCTCGCGTTCGACCACGCCGACATCCTCCACGCGGCCACAGCGTCCAGCGCCTGA
>lcl|NZ_CM001166.1_gene_150 [locus_tag=STTU_p0150] [location=complement(120628..120876)]
GTGGTCGTTTTGACGGCGCTCCACACGGGGCAGGAGCGGTGGATGAGTACCGCCCGCCGCCGCCTGGGCA
CAGGCCCCCAGCCCGGTGTCCCGTTCTTGCTGGCCAAGAGGGTCGCGTCGGATGTTGAGCCCCGCATCCC
TGCGGAACGGCTCCTCGACGTGCCCGAGGCGGTCCGGGCCGCCGCCACCCGCGCGGTGGCGGACGGGCGC
CGTGTGCTCGGCACGAGACCGGCCCTCCTGAAAACGTGA
>lcl|NZ_CM001166.1_gene_151 [locus_tag=STTU_p0151] [location=complement(121090..121260)]
GTGACCGACCTGGTCGGCGGGCTGCGGGATCACGGCACGGATGCCTCGCCGCCGGAGATGCTCACGGATC
GCGCGGGATGCATACGCGCGGTCCGCCAAGACGGCGTCCGGCCGGGCAAGACCCGGGCCGAGCCGGCCGC
ACCCGTTGGCAGGCCTCCCGTCACGCTGTAG
>lcl|NZ_CM001166.1_gene_152 [locus_tag=STTU_p0152] [location=121517..121978]
ATGGTCTTTCGACACCCCGACGGCGACTATGCGATCACCGCAATCTACTCCGTGCCCGATGACGCCTGGC
ATCTGGAACTGGATCTCGTGGCCGGGCAACGGAGTCTCGTGACCGCAACCACCCCCGACGAGGATCCGGC
ACGGGAGCCGACAGTGCGCTTCAACCCGAGCGCAGAACACACCGACGTCCCGTACGAGGTCATGCGCTGG
TTCATGCACCAGGTTGATGAAGAGATCCGTAGCTCCCGTGCCTGGATGCGGCTGAGACCGGAGCTCGTCG
AGATCGTCTATCAACTACGTCAGGAGCACATGGGTGTCATCGACGATGACGCCTTTCCCCAGGTTCTGGC
GGACATGCGTACCACGGTGCCTGAGGAGGACCTCCCCGCCGTTCTAGAGGCCGCCTTCGGGCGGAACCCT
GACGGCACCACCAAGACCACCCGCAAACGCCCCAGCCTGTAG
>lcl|NZ_CM001166.1_gene_153 [locus_tag=STTU_p0153] [location=complement(122106..123047)]
GTGCCCTCCCCCACCGAGCTGCCCCCTCACCGGATCAGCCTGAACCCGGACAACCCGCGCTCCTCCCTCG
GCGACCTCACCGACCTCGCCGGAAGCCTCAAGGACCACGGGCAGAAGCAGGCCATCACGGTCATGAACCG
CGACGCATACATCGCCGCGAACCCCGCCGCCGAGGAGAAACTCGAACCCGACACGGCATACGTCGTCGTC
GACGGCTCCAGCCGTCTCGCAGCAGCCCGCGAAGCCGGCCTCACCACCGTGAAGGTCATGGTCGACGACG
GCCAGGGCGGCACCAGCGAAGAGATCCTCGAATCCGCCCTCGTCGCCAACATCCACCGCCGCGAACTCTC
CGAACTGGACGAAGCCCGCGCCCTGCAACGACTCCTCGCCCTCCACGGCTCACAACGTGCCCTCGCCGCA
CGCCTGCACCGCTCCCAGCCATGGATCTCGACGCGCCTCGCACTCCTCGGACTCTCCGAAGAGATGCAGA
ACCTGGTCGGCACCGAGAAGATCGAACACCTCCGAGCCATCGGCAACAAACCGGCCGAGGAGCAACCCGC
AGCGCTCCAGGCGCTCAAGGACAAGGAATCCACGCAGCGCACCGTGCGGAGCCGGAAAGGTGCGGCCACC
CAGGCGGCCGACACGGGGGAGCGGGCCGAGAATGATTACGGCGTAATCGCCTCACCGAACGTGCCCGAGA
GCAGAAAACAGCCGGCGCATGATTACGCCGTAATCACCTCCGCCCCCGCCTCATCATCCGAACCGCCTGA
GTCGTCGCAGCCGCCGCGCCCTCCACAGCCCGCAACTCCCCGCACAGCGCCAGCAGCTCTCATCCCGGTC
ACAGCGATCCCATGGCGGCACGTCAACGTTGTCCACCGGATCCTGCGGGAGCACATGACGCCGGAGGACT
ACAAGGCGCTCCAAGAGCTCATGGCCACATGA
>lcl|NZ_CM001166.1_gene_154 [locus_tag=STTU_p0154] [location=complement(123155..124420)]
ATGGTTAGTAACATCTCACCCATGAGTCAGCCCAGCGACCGCGAAAAGGTCGTCTCCAAACTCCCCGCCA
GCCTCCGCCAACAACTCAAGATCCGTGCGGCACAACATCGCCTCGACATCCAGATCGCCGTGGAACAAGC
CATCCACGCCTGGACCGCCCTCGCCGCCTCCCCCGCAGCCGTTGACGTCAGCGGCGCCAGCTCCTTCGCG
ACCTTCCTCCCCCCGGGCCAGTGGGACACCTTCAAGAAGGCTGCCGCCGCCCGTGACGTGACTCTTACTC
AGGGCCTGGCACAAGCCGTGCAGCTGTGGCTCGACATGAACCCCTCCCCCGAGGTCATCCGTCCAGAGAC
AACCCGCCGCATCATCGTCTGCAACCAGAAAGGCGGTGTCGGCAAGACCGCCATCACGGCAGGGACAGGA
GAAGCCCTGGCCGAGAACCCTGACACCCTGCGCCCGGTACGAGTCGCCAAGCAGCTCGCCGCCGCACAAC
TCGCATCACCGGAAACTGACGGCAGCAGCGACGCGCTCGAGGTAGAAAACCTCCCCGGCCTCGGCTTGCG
CGTCCTCCTGATCGACTTCGACCCCCAATGCCACCTCACCCGCCAGCTCGGCGCCGAGCCCCTCCCCCTC
GACGGCGACAGCCTCACCAAGCACATGGGCGGAGAGGCAAAGGGCGAACTCCGCGACCTGATCGTCGCCG
TCGACCAGGAACACTTCGGCGACCGGCTCCACATGCTGCCCGGCTGCAACGACGCCTTCCTCCTCGACGT
CAAACTCGCGTCCGTTCGCGCCAGCGAGAAAGCCCTGGAACGAGCCCTCGCCCCCCTCGAAGGTGATTAC
GACGTAATCATCGTCGACTGCCCACCCAGCCTCGGCCTCTCCATGGACGCCGCGATCTACTACGGCCACC
GCCGCGACGGCGAAGCCCCCGGACAGTCAGGCACCCTCATCGTCGTCCAGGCCGAAGACAGCTCCGCCGA
CGCCTACGACATGCTCACCACCCAGATCGACGACCTCCGCAGCGACCTCGACGTCGTCATCGATTACCTC
GGCATCGTCGTCAACCTCTACGACGCCCGCCGCGGCTACATCGCCACCAGCTCCCTCCAGGGCTGGGTCG
ACATAAAGGACCCCCGCGTCGTCGGCCTCGTCGGCGACCTCAAGGAGCAGAAGGAAGCCGTACGCATGCA
ACAACCGCTCCTGTCCTACTCCCCCACCTGCACACAGTCCGTCGCCATGCGCGCCCTCGCCCGGGAGCTC
GCATGA
>lcl|NZ_CM001166.1_gene_155 [locus_tag=STTU_p0155] [location=complement(124906..125775)]
ATGAGCGAGCTGCCGAGCGTGTGGGACCTTCTGGGGCGTCTGGGCCTGGCGGGCGGGGTGGTGGTGGGGG
TGGTCGGCGCCGTCGTCCTGTCGCTCGTGATCGTGCCCGCCGAGGACTTCAACCGCGGTTTCGAGACGGG
CGTGCGGGCAGTGGTGCGGTACCTGTCCGGCCGCGAGCTGGGCAGCGGGACCGCACCAGGTGACGCGACG
TGGTGGCGTCCGGCGACGAACGAGGCCCCGGCGCCGCCCCCGAGGGCCCGGCCCCTGCGGGCGGCTGCGA
CGGCGGTGAAGCGGTGCGCGGTACGCGCGAGGACGTCGGGAGTTCGGTACGGGCGGCGGGTGCGGGGACG
GGTGCGCGAGCGGTTCCCGGACGTGCTGCGGGCGGCGGGGCGCGGGGTGAGGTCGGCGGCGGGAGCGGGC
CGGGCCGCGCGGTCCCTCGCGCAGTGGCCGGCACTCGGACGGGCCGTCGCCCGGACGCTCGCGCGGAGCG
GACCGGCGGCATGGGCCGCAACGGCGGCGGCCGGGGCGGCGTGCGGGCGCGGGGCGGGCCGGGCCGGGCG
GTGGACGGTGCGGGCCGGGCGGGCGGCGTACGCGGCGGCGGTGCGGTCGGGACGTGCCGCAGGGCGGGTG
GTGAGCGGCGCGGCCGTGGGAGTGGTGCGGGTGCTGCGGGCGTGGGGGCGGTGGCCGTACGCGGCGCGCG
CGGCCGTACGGATCGCGCCGGGGGTGCTGGCGTGGGGGGTGCTCGCGGCGCCGGGGACGACCCGCGCCGT
GGTCCTGGTGCTCCTCGGCGCCGTCGTGCTCGCAGCGCTGAGCGGGCCGTCAGGGGCCCGGTGGTGGTGT
GTGCCCCCGGCACGGGAACGGCGCGCCTAA
>lcl|NZ_CM001166.1_gene_156 [locus_tag=STTU_p0156] [location=125923..127152]
ATGGACGGCCCGACCGAAGAGACCCTGTGCGTGGACGGCGCGCGGCTGCGGCGCGCGCGCGAAGCCCGGC
ACCTGACGCGCCCGCAGCTCGCCTCCCTCCTCGGCGTGGGCCCCGACTGGGTGAAGAGGGTGGAGACGGG
GCAGCGCACCGAGGACAGGCTGCCGACGCTCTACCGCCTGTGCCGCGTCCTGGGCCTGACCGACGTCGCG
GAGCTGACGGGCGGGCAGACGTCCATGCCCGTGGCGACCGGCGGGCGCCTCGCCCACCCCGGCGTCGAAG
AGCTGCGAGCCGCGGTGCACGCGCCGCTCTTCGTTCAGGAGGAGCCCGAGGACGTCGGTGTCCTCGCCGG
GCGGGTCGCCCGGACGTGGGCGATCTGGCACGGAGTGCGCGAGCAGCGCACCGCTGTCGCAGCCGTACTT
CCCGATCTCATCCGCACCGGGCACGCCACGATGCGCGCCGCCGAGGGCCCCGAGAAGCGCCGCGCCGCCG
TGGTCCTCTCCGAGGTCTACGCCCTCGCCCAGCAGTACGCCGCGCACATCGTCGACCCGCCCCTGTACTG
GACGTTGGTGGACCGGGCCCGGATGCTCGCCGAGACGGCCGACGACGTGCTCGCGCTCGCGGGCGCCGCC
TGGGTCACCGGCAACGGCTTGCGGGCGGCGGGGGACACGGAGGGCGCGCGGCGCGTCGCGGCCGACGCCG
CCGAGACCCTGGAGCGCAGCACCGAAGACGGCTCCGACCGGCTACGGGGGCTGTACGGGAGCCTGTGCCT
GCACGTGGCCCTCAGCGCCGCCCAGGAGCGCCGCGAGGGCGACGCGTGGCACTGGTGGGACAAGGCCGAC
CGCGCCGCTGCCCGCCTCGGCACCGCGTACATGCACCCGTGGACGGCGTTCGGCGAGGGCAATGTCGCCG
TGCACGGGGTGAGCATCGCCGCCGACCTCGGCGCCCACGGCACCGCGCTCCAGCGCATGACCGAGGTGGA
CCCGGAGACGATCCCGAGCGTCGAGCGCCGCTCCCGCTTGTACCTCGACGCCGCGCGCGGCGAGCGCGCG
CGGCGCCAGGTCGCCGCCGCCCTGACGTACCTGCGTCTCGCGGTGGCGACCTCGCCGGAGGCGGTGCGCT
ACGTCCCCGCCGGGCGCGCGCTCGCCGAGGACCTCGCTCGTACCGCCCCCGCGCCCCTACGCCGGGCCGC
GCACGAGGTCGCCTCACTCGTCGGCGTGCCCGTCGAGTAG
>lcl|NZ_CM001166.1_gene_157 [locus_tag=STTU_p0157] [location=127261..127503]
GTGACGGGCTCTCACGCTGAGAAGGTGCCGAACCTGGAGTACTACACCGATCTCCCGCGCGCGCTGCGCC
GCCCCCGCCTCGACGCCGACGGGGAGCGCTGGCTGCCCGTCGCCGTGACGAAGGAGTGGCACAAGGAGGG
GGAGGTCGTCGTGGTGTTCCTGCGGCCCGCACGCGGGGGAGGGCGCGAGTGGATCGTGCCCCTCCCCGAC
CTGGACACCCTGACCCGGGAGGCGACCCCATGA
>lcl|NZ_CM001166.1_gene_158 [locus_tag=STTU_p0158] [location=127656..128237]
ATGGTCACCCTCGGCCGCGCCCCCGCCATCACGGCCCTGCGCCTCGCCGCCGTCCTCACCCACGCCGCCG
CCGTCCTCCCCGACCTGCGCGCCGACCGCGCGGAGCCGGGCGAAGAGGAGGACGCGGCCGACGCCGTGAC
CGCGCTGCGTACCGCTCTGGACCGGGTGGGCCTGCGGCTGCCCTCTCTGGGCGCCGAGCGCCCCGCTGCC
ATGGGCACCGCCATGGTCGCGCTCGGCGGTGCCGCCTCCGGCGTCGCGGTGAGCCTCGCGGACGTCCTCA
CCCGCACCGCCGACGCCGCCCCGGTCCTGCGCGCCGACGCCGCCGAGCCCCCCGGCGCGGCCCGGGAGTT
CTGGCCCCTGCCCGCCGTCCTGCTCCGCGACGGGCACTGCCTGCGGTACGGGGGCGTCACCCGCGTCGCC
GCGCAGGCGCCCCGGCTGCCCGCCCCCCGCGCCTCCACCGCTCCCCGGCTCGAAGTGCGCTGCGTGGACG
GCACCACCCTCCGCATGTCCCCCCGGGCCGCGCTCGACGTGTACCTCCCCCTCGCGTGGCGGCTCTCCCT
CCAGGACGGCCCGCGCCCCTGA
>lcl|NZ_CM001166.1_gene_159 [locus_tag=STTU_p0159] [location=128381..128956]
ATGCCTGAGCGGAACATCGAGTTCGGCGCGTACGGCGCCCAGGGCGTCAAGGGCCACGAGTTCGTCGCCC
GCCGCCTCGACAGCCTCGCCGGGTTCATCGCGTCCCCGGTCACCACCCGCCGTGGCCTGACCGCGCGGCT
GCGCTACCTCACGAGCAGTGCCCGCCAGCTCGCCGCCGCCCGGGAGGCCGGGCTCACGATCTCGGACCGC
ACGATCAAGGCGCAGATGCAGGGCACACGCCGCCCCTCCGCCCGTACGCTCCGCGAGATCGACGCCACTT
ACCGCGCGGTGCGTCGTCAGAACGTCTCCCGGCACCTCCTGGCCCGCCTCAACCGGCAGGGCCGGGGGAC
CCGCGTCGAGTTCCACCCCGTCAATCAATCCGGGGTGGAACGCCCTCGCCAGCGGGTCGTGGAGTACCGC
ACCCTCAACGTGCGCAAGTGGGAGCGGATCGTCGGCGCGTGGGAGGCCGGGGACGACGCGGGCCTGGATG
CCGCGTGGGTCGACGAGGTGGTGGTCGACCTCGGTTCGCAGTGGGGTCAGTACGAGTACGTCACCAACAT
CGGCTTCGCCGCCTGA
>lcl|NZ_CM001166.1_gene_160 [locus_tag=STTU_p0160] [location=129002..129427]
ATGACTGACCTACCGCACAACGAGTACATGGCCGCTGTCGCCGACGCGCTCGCCGCCCGCGACATTGCGC
CCGCACAGTGGTGGACCAGCGAAGACGACTCCGGCGCTGGCACCGACCGTCTCGACGCCGTCTTCCAGTG
GCACACCGGCGTCGCGGACCGCGACCACTGGCCGCACGGCGTGTACCTGAGCTGGGACCAGTACGACGGA
TGGCGCCTCATCGAGGCCGGCGGAGGCCGGAACATCTACGACCTTTCGCCGGATTCCCTGATCTACTGCG
ACCCGCGGCAGGTCGCCGCCGACGTTCAGGCCCGGCTCACACACGGGCTCGACGGATGGTCCCCGGGCCC
TATCTGCGTCGTCGGCGCCCGGTGGGACGTGCGCCCCACGATGGCCGCTGTAGAACGCTGGGAGGCGGCG
GCCTGA
>lcl|NZ_CM001166.1_gene_161 [locus_tag=STTU_p0161] [location=129914..130153]
GTGCTTTTGTGGCTCCAAATTGAGACTCGACACGGGTGGTTGTGGGCGTACGACCTGGAGCACCTCGACT
TGCTACGGCGCTTCGTCCAAGCACCGCTGCGCGAACGAGCGCCCTGGTACGACACCGGGCAGAAGATGAC
GTTGGTCGCCCGTCTGCCACTATGGATCAAGCGCGCGAAGAATCGGGACGAGATCCTGCGCGGCATTGCT
CGAATCCGCGCATCACTGGTCTGTGCCTGA
>lcl|NZ_CM001166.1_gene_162 [locus_tag=STTU_p0164] [location=complement(130337..130885)]
GTGTCGGGCCACGAAGGCGCGAGCAGCAGCGGGGCGCCGGGGGTGTGGGTGGTGCTCGCGGACGGGCAGG
AGGTGCGGGGGCGGCTCCTCGCGCGGCGCCAGCTCCCGGACGGGTGGCGCTACCGCGTCGCGCTCCCGCT
CTACCGCAACGTGGGCGGGGAGGGCCTGGAGGTCGAGGCGGCGCAGTACGAGGTGTGGGTGCGGGCCCCC
GAGCATGTGCGGCCCGTCGAGGACGTCGACTACACGGGCGTGCCGACCACGGCGCTCCCGGCGCCCTCGC
TCGTGGAGGTGGCGCTCGGGCCGCGCAGGCCCGCCGGGTGGGTGCTGGCGAAGAGCGGCGGCGGGCGCCG
GGGGCCCTCCCGTGCGGTGCTGCACGCCGTGGACTGCGCCGAGGCGCCGCCCGGCCTTCCGGTCCTGCGG
GTGGAACAGGCGCTCAACGCTGCCGAGCACCCCGCCACCCGGGCTTGCGCCCTGTGCGGGGCCGGTGCGG
AGCTTGATCCGCTTCTGCGGGGCTTCGACCCGCAGGAGGACGCGGTGGGAGACCCCTGA
>lcl|NZ_CM001166.1_gene_163 [locus_tag=STTU_p0162] [location=complement(130888..131412)]
GTGTGCGAGGGCGAGGGCGTGGTAGGTGGCTCGCCGTTCGAGGGCGAGCCGGAGCAGGGCATCGTTCACA
CCCCTACCCGATCACATGTTCGATTTTTTGGGCAACCGAACCCGCGCAAAACGCCACATCACCGCCGTGC
GCGCGCTCTGGCCGGTCGTACCCTCGCTGGTGTGACCGATTTCCCCGACGATCTCCTCGCGGCTCAGCGC
GACCTCACCGCCGTACGCGCGACCCTTTCCGCCCGCCTCGCGGCGCTGCCGCCCTCGGCGGAGCCGATGC
CCGCGTGGGAGCGGCCGGACGGCTACTGGGCGGGCGCCCGTACGCACCCGGCCTCCCCGGGGTGGAGCGA
GGAGGAGCGCCAGGAGGTCGCCGCGCTCCGCGAGCGCGAACGGGATCTCGCGGCGGCGATCGTGACGCAC
GAGCTGTGGGCGAGCGTGCCGGCCGAGGAACGGATGCGGGCCCGCGACGCACTCAAGCACGCCCACGAGA
CACAGGCCGCCGAGGCGGCGGGGGCCCGGGGCTGA
>lcl|NZ_CM001166.1_gene_164 [locus_tag=STTU_p0163] [location=131505..131753]
GTGCCGCCCGCCCGCGCCCGCGTCCCCGCCCTCGCGGGGGACCAGGTGACGGCGGGGGACGGGCGCCACC
GCGTGCTCGCCGCCGTACGGGACGCGATCGCCGAGACCGGCCAAGGCCCCTCCGTACGGGAGATCCAGCG
CGTCACCGGGCTCGCGCTCGCCACCATCGCCCACCACCTGAAGGCCCTGGAGGAGAGCGGCGCCCTCGTC
CGTACGGGCCTGCACTGGCGCACCTGCCGCCTGGGCTGA
>lcl|NZ_CM001166.1_gene_165 [locus_tag=STTU_p0165] [location=131871..132767]
GTGAGCTTCGGCCTGGTCACGATCCCCGTGAAAATGCTCCCCGCCGTCGGCGACCACAGCATCCACTTCC
GGCAGATCCACACCGCCGACGACGGCCTCGTCCGCAACCGGAAGGTGTGCGAACTCGACGGCAAGGAGCT
GTCGGCCGACGAGATCGCGCGCGGGTACGAGGTCTCGAAGGACACCGTGGTCCCGCTCTCGGACTCCGAC
TTCGACGACCTCCCCCTCCCCACCGCGCGCGCCCTGGAGATCGAGGCGTTCGTCGACGCCTCTGAGATCG
ACCCCATCCAGATGGGCGACACCTACTACCTCGCCGCCGACGGGCAGGTCGCCGCGAAGCCGTACGCGCT
CCTGCGCGCGGCCCTGGAGCGCACCGACAAAGTCGCCCTCGCGAAATACGCGTTCTCCGGGAAGGAGCGC
CTGGGGATGCTCCGTGTGCTCGACCAGGACGTCATCGCGCTCCAGGTCCTGCACTGGCCCGACGAGATCC
GCTCCCCCGAGGGACTCGCCCCGCCCAGCGTAGACCTCACCGAGGACGAGATGACCGGGGCGCTCGCCCT
CATGGACACCATGGCCCGCGACGGCATCGGCGACGAAGAGGACGAGTACCGCAACGCGGTCGAGAAGCTC
GTCGAGGCGAAGGCCGAGCACCGTGCGCCGCCGCGCGCCGAGCGCGAGGAGCAGCCGCGCGGGGAGGTCG
TGGACATCATGGCCGCCCTCCAGGACAGCGTGGACCGCGCGCAAAAAGCCCGCGGCGAGACCGGCAAGGA
CGCGACCGTCCACGAGATGCCGAAGAAGCGGGCCGCGAAGAAAGCGCCGACGAAGAAGACCGCAGCCAAG
AAGGCAACGTCGAAGAAGACGACCGCGAAGAAGACGAGCCGGAAGAAGCCCGCCTGA
>lcl|NZ_CM001166.1_gene_166 [locus_tag=STTU_p0166] [location=complement(132845..133870)]
GTGCGAGAATCCGGGCCCATGACGGACCCTCAGCAGCCCTCGCAGACCGACCGATCGGATGCCGACGACG
TCGAACAGCACGCCTGTCCGAAGTGTGACACGCAGCCCGGCTCGCCGTGCCGCTCGCGCGGCGGCGCGGT
TGCCTCCGCCTACCACACCCGCCGCTTCACGATGGTGCCCCGGCTGAAGAAGGCGCTGCGCGTGCCGACC
CCGGCCGACCGCGGCCCGGGCCGGCCGTGGCGGCCGGGCACCCCGCCGCCGACGCCGATCGATCCGGACC
TGCCGAGCGCGGACATCCGCATCGGCTACGCACGGTGCTCGACGCTCGGGCAGGAACTCGACTCCCAGCT
CGACGCGCTCGCGGGACACGGCGTCCCAAGGGACAAGATCTTCAGCGAGAAGATCAGTACCCGGGTGCGG
GTCCGCCCGAAGTTCGAGGAGGCGCTGAGGACCGCGCGGGAGGTCAAGGCGCACGCCCCGCACTGCCGGG
TCATCTTCACCGTGTACGAGATGAAGCGCCTCGGCCGCGACGCCGCCGAGCTCACCGCGCTCGCCGACCA
CCTCACCGCCCACGGCCTGGTCCTGGAGATGCTCGCCGGGCCCTTGCCCGGCATCTACGACCCGACCGGG
CCGGGGAAGCTGCTGTTCGCGTTCTTCGCCGCGATGGCGGAGACCGAGCGGGAGAACATCCGGGAGTCCA
CGCTGGAGGGGCTCGACACGGCGGCCCGCAAGGGCAAACACGGCGGCCGACCCCCGGTCATCACCGACGA
CATGCTCCACACTGTCCTGCGGCGCCGCGCGGGCGGCGAGTCCGTCGAGCAGATCCAGCCTGACCTGATC
ATCCCCACCGGCAAGCGCAAGGGCCACAACCCCTCAGTGGCCAGCGTCTACCGGGCCCTCGCCGAGCACG
CCAAACGCGAGGCATACCCCGAAGCCGTCGCCCAGGCGCACGCCGACTTCGCTGCCCTTCGGGCCGACGA
CGTCCCCGGGCCCCGCCTCGCACCCTCTGACCGAGCGTCACTCTGA
>lcl|NZ_CM001166.1_gene_167 [locus_tag=STTU_p0167] [location=complement(134159..135334)]
GTGCTGATCGCGGGAGCCGGTATCGCCGGTCCGGCCCTGGCCCACTGGCTCAAACGGCACGGAATGCAGG
CCACCCTCGTCGAGCGGGCCCCCGCCCCGCGGGAGGGCGGACAGACCGTGGACCTGCGCGGTGCCGGACG
GGACGTCGCCCGCAGGATGGGCCTGGAACACACCCTCCGGGACCACGCCACCCGCGAAGAAGGCATCCGC
TTCGTCGACGCGGCGAACCGCACCAGAGCCGCCTTCACCAGCGGCGCCTTCGGCGGCCAGGGACCGATCG
CCGACCTGGAGATCCTGCGCGCCGACCTCTCGCGCATCCTCTACGAGGCCACCCACCCACACACCGAGTA
CCTATTCGGGGATGAGATCACACAGCTGTCCGACACAGGAAAGAAGGTCGACGTCACCTTCCGCAACGGG
CCGGACCGTGCATTCGACCTCGTCATCGCCGCCGACGGAGCCCGCTCCCGCACCCGCGACCTGATCTTCG
GCGACACCACCGACATCCGCCCCGTGGGCCTGACGACCGCGTACTTCACCATCCCCCGCGAGCCCTCGGA
CGGCACCTGGGCCCGCTGGCACAACGCCACCCATGGACGCACGGCGACCCTGCGCCCCGACAACCGGGGC
ACCACCCGCGCCTCCCTGTCCTACCTCTCCCCGCCCCGCGGAGACGAACGCCTGGCACCCGACGCACAGA
AGCAACTCCTGCGCCGCCTGTTCACCGGCGCGAGCTGGGAGATTCCACGCATCCTCACCGCCATGGACAC
CGCCGACGACTTCTTCCTCGACTCCGTCATCCAGGTCCGCATGCCTTCCTGGTCCCGGGGGCGGATCGCT
GTCGTCGGCGACGCCGCGTACTGCGCCTCGCCCCTCAGCGGCATGGGCACCAGCCTCGCTCTCACCGGCG
CCTACGTCCTGGCCGGTGAACTCGCCCACCACGCGCATCACGGCAACGCGTTCGCCCGCTACGAGCACAT
CCTCCGCCCCTACATCACCCGCGCCCAGCATCTACCGCCCGGCGTTCCTCGCATCGCCTCACCCCGCACC
CGGGCCGGCATCCGGGCCCTCAACACCGTCCTGTACGCCGCCTCCCGGCCCCGCATCGCCAAAGCGCTCA
ACCGCTTCCTCGTACCGCCAGCCGACACCTTCACACTGCCCCCGTACGGCCTCTGA
>lcl|NZ_CM001166.1_gene_168 [locus_tag=STTU_p0168] [location=complement(135449..136951)]
ATGCGTGACCCGTCCCCCACCCGCGAGGAGACGACCGAGCCCTACCGGTGGCGGTGGCTGATCCTGGCGG
TGATGATCGTCGCGGAGATCATGGACCTCCTGGACGCCTCGATCGTCAACGTCGCCGGACCGGACCTGGA
GAAGTCCCTCGGCGCCGGCTCGGTCGGACTGCAGTGGGTGATCGGCGGCTACGCCCTCACCCTGGGCGCC
GGTCTGGTGCTCGGCGGGCGGCTCGGTGACCGTTACGGCCGGCGCCGGATGTTCCTGATCGGACTCGCGG
CCTTCACCACTGCATCGCTGCTGTGCGCGATCGCGCCGAACATCGAGTCGCTGATCGCCTTCCGCCTGCT
GCAGGGCACCGCCGGAGCGATGCTGCTGCCCCAGGGCCTGGGTCTGCTGCGCGAGAACTTCTCCGGCCCC
GAGCTCACCAAGGTCTTCGCGATCTTCGGCCCCGTCCTCGGACTGGGCGGCATCATCGGCCCAGTCCTGG
GCGGCTTCCTCATCGAGGGCGACTTCTTCGGCCTGGGCTGGCGCTCGGTCTTCCTGATCAACCTGCCCAT
CGGCATCGCGGCACTGATCGTCGCCGCGAAATTCGTGCCCAAGAAGGCGGGCGACCGCACGGTCCGGGTC
GACATGACCGGCGCCGCCCTGATCGTGGCGTCCTGCGCCCTGCTGGTGCTGCCGCTCAACCAGGGCCAGG
AGAGCGGCTGGCCGCTGTGGACGTGGCTGTCCATGGCCGCCTCCGCGATCGGGTTCGCCCTCTTCGCCCT
CCAGCAGCGTCGCACGGCCGCCGTGGGCCGCGAGCCGCTGGTGACCCCCGGCCTGCTGCGCAAGCCCGCC
TTCACCGTCGGGCTCGGCGGCATCGCCCTGTTCTTCGGCGGACTCATCGGCACCCAGCTCGTCCTGACCC
TGTTCCTCCAGATCGGCCAGCACTTCACCGCTGGTGACGCGGGCCTTGGCAACCTGCCCCTCGCGGTGGG
AACCGCGATCGGCGGCGCCATCAGCGGCGCGTTCCTCGCTGACAGGATCGGCCGCAAGGTGCTCCAGATC
GGACCGCTGGTCCAGCTGGCCGGCGCCGCCGTGCTGTGGTTCGAGCTCGACGGCCTCGACTCCGCCTCGT
TCTCGATCTGGGACATCGTCCCGGGCACGACAGTGGCGGGCATCGGCGCCGGCATGGTGATCGCCGCACT
GTTCAGCTTCATCCTGGCCGCGGTCGACGACGACGAGATCGGATCCGCCTCCGGGGTCCTGTCGGCGGTC
CAGGCGGTCGGCGGCTCCATCGGCGTCGCGGTCTTCGGCTCGGTGTTCTTCGCCCAGGCCAAGACCGGCG
ACTTCACCGGCGGCTTCCACCGGGCCCTGATCGTCCAGGCATGCCTGCTGGTGGTCTTCTTCGCGATCAC
CTTCCTGCTGCCCAAGAAGGGCCGCCCCGAAGACGAGCAGCACGGCATCACCCCCGAGACCACTGCCGAC
GACTCCGGCACCAAGCAGCACCTCGCCATCTGA
>lcl|NZ_CM001166.1_gene_169 [locus_tag=STTU_p0169] [location=137074..137571]
GTGCGTGACGGGGTCGCTCAGCAGCGTGAGCGGCTGATGGAGTCGCTGAGGATCTACGGTGGCCACTACT
CCGAGCTCAGCCGGCGCTTCGCCGCCTGGCTGGGCCTGCACTCCACGGACGCGACGGCGGTCCTGGAGAT
CGCCGCCGCCGAGGAACGCGGCACCCCCCTGTCACCGGCGCGGCTGAGCGAACGGATCTCCCTGTCCACC
GGCGCCACCACCGCGCTGCTGAACCGCCTCGAAGCGGCCGGGCACATCACCCGCGCCCGCGAGCACTCCG
ACCGGCGCATCGTCACATTGCACAGCGGCGAGCACATCCAGGAGCGGGCGGACGAGTTCTTCGGCCCGCT
CGCCCACCGCCTCGACGCCGCGATGTCGCCCTACCCGCCCCAGTTCCTGGAACAGGTCGAAGCGTTCATG
GCCGACCTGAACGCCACCATGGACGGCCACCTCACGGAACAGAACGCAGTGGCACCGCGCTCCCTCCGCA
CTCCCTGA
>lcl|NZ_CM001166.1_gene_170 [locus_tag=STTU_p0170] [location=complement(137825..140512)]
GTGGATCAGCCCGCGGTGAAGTCGCCGTCCGCGGCGAGTACGGCGCCCGTAACGAAGGCGGATCGCGGGA
GACCAGGAAGCACAGGACTTCCGCGACCTCGTGCGGCTGCGCCACCCTGCCCAGGGGGTGGACGTTCCCG
AAGGACGCGAGATAGGCGCGGCTGTACGGCCACGGTGGGCCGGCTGTCGGCGGCGACCCGGTCCCGGCTG
GACGACCTGGTGGCCGAGGACGCCGGCGGGGAGGAGTCGGCGGGCGGCGGGGTGTCATTCTTCTCCGAGC
TGAAGGCGGACCCGGGCGCGCTGGGGCTGGACAGTCTGCTGGCGGAGGTGAACAAGCTCCAGCGGGTGCG
TGCGCTGGAGCTGGCGCCGGAGCTATTCGGGGACGTGTCGGAGAAGCTGGTGGCGGCGTGGCGGGCGCGG
GCGTCGAAGGAGTACCCCTCGGACCTGCGGGCGGCAGCCGGGCCGGTGCGCTACACGCTGCTGGCCGCGC
TGTGCCATGTGCGGCAGACGGAGATCACCGACTCGCTGGTGGAGCTGTTCATCCAGCTGGTGCAGCGGAT
CAACACGCGGGCGGAGAAGAAGGTTGAGGGCGAGTTCACCAAGGATCTCAAGCGGGTCCGTGGCAAGGAG
GGGATTCTGCTGCGGCTGGCGGAGGCCGCGGTCGCGGAGCCGGGCGGCACGGTCCGCAAGGTGATCTTCC
CGGTGGCCGGGGAGTCCACGCTGAAGGCCCTGGCGGCGGAGGCCGCGGCGAACGAGGCCCGCTACCGGGC
CCGGGTGCGCACGGTGCTGCGGTCGTCGTACTCGGGGCACTGGCGGCGGATGCTCTCCCCGCTGCTGGGG
GCGGTGGAGCTGAAGTGCAACAACACCGCTTACCGGCCGGTGATGGACGCCATCGACCTGCTGAAGCGGT
ACCTGGACCAGCCCATCGCCAAGGAGGGCGCGTTCTTCGACGAGTCGGAGAACATCCCGCTGGCCGGGGT
GGTGCGCGAGGAGTGGCGCAAGGCAGTGGTGGACGAGCGCGGCCGCGTCGAGCGCATCCCGTACGAGCTG
TGCGTGCTGGTCAGCCTGCGGGACGCGCTGCGGCGCCGGGAGATCTGGGTCCCGGGCGCGGGCCGGTGGC
AGAACCCCGAGGGCGACCTGCCCCCCGACTTCGAGGACAACCGCGATGTCCACTACGACGCGATCCGCCA
GCCGCAGGACCCTGGGTCCTTCATCGGGGCCCTTCAGAAGCGGCTGCGGGAGGCCCTGACCCGGCTCGAC
ACCGCGCTGGAGCTGGGCACCACGGGCGGCGTGGACATCGTCCGCAAGCACGGCGAGCCGTGGATCAAGG
TCTCGCCGCTGGGCAAGCAGGCAGAGCCGGAGAACCTCGTCGCGCTGAAGGCGGAGATCGAACGCAGGTG
GGGCACCATCGACCTGATCGACATCCTCAAGGAGGCCGAGTTCGCCACCGGGTTCACGTCCGAGTTCGCC
TCAGTCGCCACGAGGGAGGCGGTCCCGAAGGCGGTGCTGCGGCGCCGGCTGCTGCTCGTGCTGTTCGCGC
TGGGCACGAACATGGGCATCAAGCGGGTCGCGGTCACCGGCAAGCACGGCGAGAGCGAGGCCGTCCTGCG
CCGGGTGCGGCACCTGTTCGTCAACCGCACCAACCTGCGCGCCGCCCTGGTCCGCCTGGTCAACGCCACC
TTCGCCGCCCGCGATCAGGCGTGGTGGGGCGAGGGCACCGCCTGCGCGAGCGATTCGAAGAAGTTCGGGT
CCTGGTCCAGCAACTTCATGACCGAGTGGCACCAGCGCTACCGCGGGCCCGGGGTGATGATCTACTGGCA
TGTCGAGCGGAAGTCGCTGTGCGTCTACTCCCAGCTCAAGTCCTGCTCGGCCTCCGAGGTCGCGGCGATG
ATCGAGGGCGTGCTGCGGCACTGCACGGACGTGGAGATCGACCGCCAGTACACCGACACCCACGGGGCCT
CGATCGTCGGGTTCGCCTTCGCCCACATGCTCGGCTTCAACCTGCTCCCCAGGTTGAAGAACGTCGGCTC
GGCGCGGTTGTACCGGCCGGCGGCTGGGGAGGACGACACCTGGCCGCATCTGGCGCCGGTGCTGTCGACC
AAGACGATCGACTGGGACCTGATCGCCCAGCAGTACGACCAGATCGTGAAGTACACCACCGCCCTGCGGC
TGGGCACCGCCGAGGCCGAGCAGGTCCTGCGGCGCTTCACCCGCGGAGGCCCCAAGCACCCCACCTACCG
GGCGATCGAGGAACTCGGCCGGGCGGCACGTACGGCGTTCATCTGTGACTACCTCGCCGACGCCGACCTG
CGCCGCGAGATCAACGACGGACTCCAGGTCGTGGAGAACTGGAACTCCGCCAACCACGACCTGCTCTACG
GCAAGGACGGTGATCTGACCGGCTCCGACAAGGAGTCCCAGGAGGTCTCGATGCTCGCGCTGCACCTGCT
CCAGTCCGCGCTGGTGCACGTCAACGCCCTGCTCCTCCAGGACATCCTCGCCGAGGAGAAATGGCAGAAG
AAGCTCACCGACGCCGACCGGCGGGCCCTGTCCCCGCTGTTTTGGACGCACGTGAACCCGTACGGCCGGT
TCGAGCTGGACATGAATTCCCACCTGGACCTCGTCGCCGCCGTGGCGGCTTCGGTGCCCGGCCCGCGCAG
CGGCGAGCCGGCCACGTCCCCGGCCTGA
>lcl|NZ_CM001166.1_gene_171 [locus_tag=STTU_p0171] [location=140575..141183]
ATGCGGGAGAGAGAAACATTCGAAGAACAAGGCGCGGCGGGCGGTGAGGGGCGACGCACGCGTCGGCACG
ATCCGCGCCGTCGGGAGCGGGTGCTCGACGCCGCGCTGGAGGTGCTCGTCGAAGACGGGGTCGCCGGGAT
CACGCACCGCAAGGTGGCGGCCCGCGCCGACGTGCCACTGGGCTCCGTCACCTACCACTTCGCAAGCCTG
ACCGAACTGTGCACGCAGGCGTTCGCCTGGTACGTCGAACAGCGCACCGCCGAATATGAGGCCCTGTTCA
CCCAGGTGGCATCGCGCGAAGACCTGATCGACGTCCTGGTGACGGTGGTCCAAGGAGGACCGGCCCGGCA
TCGCAGCGCGGTTCTCGGCTTCGAACTGCATTTGGCGGCGCTGCGCGATCCCGCGCTGCGCGTCCTAACC
CAGCAGTGGACCAGCTCCAGCCGGGCGGTGCTGGCCCGCTTCACCGGGCCGCGGGCCGCCGCCCGCCTCG
ATGCCCTCCTGGAAGGAATGATCATGCACGCACTGCTCTCCACGGACCAGGAACCGCCCGAGGCGACCCG
GGAGTCCCTGGCGCAGACGCTCGGCCCGGCCGCCGGGCCGAGTAAGTGA
>lcl|NZ_CM001166.1_gene_172 [locus_tag=STTU_p0172] [location=141261..142421]
TTGGGCCTGGCCGGGGCCACGTGGGCGTCCCGCCTGCCGCAGATCCGGGACCGCATGGATCTGGACGCCG
CGGCAGTGGGTCTCCTGTTGCTCCTCCTCGGGGTCGGCGGTCTGGTGGCGTTGCCGCTGGCCGGTCTCCT
CGTCACACGGGTCGGGCCGCGCCGGGCCGTCACCACGGTGGGCGCGTTCGTAGGTGCCGGCCTCGCTGCG
GTGTCGACCGGCTTCGCTCTCTGGCCACCGTTGCTCCTCATCGGCCTCTTCGTCCTGGGCACTGCCACGG
GCTTCTGGGATGTCGCGGTGGCCGTGCACGCCGCAGCCCTCGAACGACGACTCGGTCGCGCTCTGATGCC
CCGCTTCTTCGCCGGGTTCAGCCTCGGCACCGTCGTCGGCGCCTGCCTCGGCGCGCTCCTGACGGCGCTG
GGCGTAACGGTGAGCCTGCACATCGGCGCGGTGGCCCTGCTCATCACCGTGCTGACACCCGTGGCGGTTC
GCCGCTTCCTCCCCCGGAGTGCACCCCCGGCATGGCCACCACGCAGGACGACGCAGGAGCCCGGACAGCG
CGCATGGCGCGACCCACGCACGGTCGTCCTCGGCCTCGTCGCCCTGGCCTTCGCGTTGGCGGAAGGAGCG
GGAAGCAACTGGGTCAGCCTCACTGTCATCGACCGCCACCGCACCACGGCCGCAGTCGCTACGCTCGCCT
ACGCCGCCTTCCTCGCGGCCGTCACCCTCGGCCGCTGGCTCGGTCCGCTGATCGTCGGCCGCCTGGGCCG
GCCAGGAGCACTGCGCGCGTCTGCGTTGGCCGCCTGCCTCGGGGTGGTCTTGTTCGCGGCCGGGCCCAGC
CTCTGGGCGGGGTTCGCGGGGACGCTGCTGTGGGGAGCGGGCGCGGCACTCGGCTTTCCCCTCGGTCTGA
GCGCCGGTTCGGACGACCCCGCCCAGGCGGCCGCGCGGGTCGGCGTGATCACCTCGATCGGGTACTGCGG
CTTTGTCTGCAGCCCGCCCCTGTTCGGCGCCCTCGCCGACCGGACCGGCCTCGCACCGGCGTTGCTGGTC
GTAGCCGCCGTCATGGCCGCGTGCCTCCCCCTCGCGGGCGCCCTGAGGGACACCTCGCGGGTTGTGTATG
AAGAGGCGACCGACGGCGTCGCGCCGGGGCCCTTGCACTGA
>lcl|NZ_CM001166.1_gene_173 [locus_tag=STTU_p0173] [location=142535..143683]
ATGAAGGAGCACACCGTGCCGACCAGCACACCCGTCATCCAGGTCGCCGACGCCGACCTGGAAGACCTCC
GCACCCGGCTGCGCGCCACTCGCTGGCCCGAGCCCTGGCCGGTCGACGGCTGGCAGGCGGGTACCGACGC
AGCCGAACTCCGCCGCCTCGTCATGTACTGGGCCACCGACTACACGTGGCGCACCCACGAAGCCGCCGTC
AACGCACTGCCCTCCCATTTTGCCGACATCGCCGGCACACGAGTGCACTACCTGCGTTACGAGGCCGAAC
ACCCTGACGCCCTGCCGATCGTGCTCACCCACGGCTGGCCGAGTACCGTCATGGAACTCACCATGCTCGC
CGAACGACTCGCCGCCCCCTCCCGCCACGGAGGAGACGCCCGCGACGCCTTCACCGTCATCATCCCCTCC
CTGCCCGGCTTCACCTTCTCGCCACAGCGCCCCGCCCTCACCGACGCCGAGCAGACCCATGACCTCTGGC
ACCGGCTGATGCACGACCACTTGGGCTTCCAACGCTACGCGGCCCACGGCGGAGACCTGGGCGCCGGCGT
CACCTCACGGCTCGCCGAGGCCCACCCCGAGGCCGTCGTCGGCATTCATCTGCTCGCTGCCGCGGCCCCG
GCAGAGTACGATCCGGCCTCGCTCACCCCTGAGGAGAAGACCCACCTGTTGTCCGCCGCGGCCTGGCAGG
CAGAGGAGGGCGCCTACATGCACCAGCAGAACACCCGTCCCCTCACCCTCGCGCCCGCACTGAACGACTC
GCCCGCCGGACTGCTCTCCTGGATCCTCGAGAAGTACCGCGCGTGGACCGACTGCGGCGGCGACCTGTCC
ACCCGCTTCGGCGACGACTTCCTCCTCACCCAGGCATCGCTCTACTGGTTCACCGGCACGATCTCCACGT
CCTTCCGCCCGTACTACGAGTACGCGCACCAGCTCACCCGGCGCGTGCGGCGGGTCGACGTCCCCACCGC
CCTCGCCCTGTTCCCCGCAGACCTCGCCCAACCGCCCCGGAGCTGGGCCGAGCGCACCTACCACCTCACG
CGTTACACCCGTATGCCTCGCGGCGGCCACTTCGCCGCGCACGAGGAACCGGCCTTGCTTGCCGACGACA
TCACCGCGTTCTTCGGCGACCTCCGTTAG
>lcl|NZ_CM001166.1_gene_174 [locus_tag=STTU_p0174] [location=complement(143857..143970)]
GTGGATGGACTGCATGGGAGCCCACTTCATAAGAGGCTCGACGAACACTGCGCTGGCCGATTCGGGATCG
CACCACCGCTAACCGGGGAAATCACCACGAAGATCAACCACTGA
>lcl|NZ_CM001166.1_gene_175 [locus_tag=STTU_p0175] [location=complement(143981..144157)]
ATGCCCACCGAGACCCTGCCGCCCGAGGTGCGGAATTTCATCGACGATGCGCGGCGTCACCTGGCTTTCT
GCGCCGGGCTGCGCGCGGGCGAGGACCCGGCGTACGCGACCGTGCTCCTGGCCGCCGCCGAGCAGGGAGA
AGAAGTCCTCGCCCGGTACGAAGGCCGCGTAGCTTAG
>lcl|NZ_CM001166.1_gene_176 [locus_tag=STTU_p0176] [location=complement(144230..147016)]
TTGGCTTGTCTGCCTCGTGAGGAGTTTCAAATTTCTGTTTCTCGGGTTCCGTTGCGGAAACATCAGGTGG
AGCTTATGTCGGACCTCAGGAAATGGGTTCGGGTGGCTGCCCGGGAAAGCGCCCGTTCGGGGCGGGGGGC
GCGGGCGACGGTGGTGTCCGCTACGGGTACGGGGAAGACGATCAGCGCGGCTGTTGCGGCGTTGGAGTTG
TTCCCTTCGGGGCGGGTTCTCGTGATGGTGCCGACGCTGGATCTGCTGGTGCAGACGGCGCAGTCGTGGC
GGGCGGTGGGGCACACGGCGCCGATGGTCGGGGTGTGCTCGCTGCCCGGGGATCTGCTCCTGGAGGAGTT
GCGGGTGCGGACGACGACGCACCCGATCCGGCTCGCGCTGTGGGCCGGGCAGGGGCCTGTGGTCGTGCTG
GCGACGTACTCCTCGCTCGTGGGCGGGGACGGGCAGGGCGGGCCCCTGGAGGCCGCCCTGGCGGGCTCGG
GGTTGTACGGGCAGCGGATGGACGGCTTCGACCTCGCGGTCGTGGACGAGGCGCACCGTACGGCGGGCAG
CGCGGCGAAGCCCTGGGCCGCGATCCACGACAACGCCCGTATCCCGGCGGCGCACCGGCTCTACCTCACC
GCCACCCCGCGCGTCCTCGCGCCCGCCCGCCCCGACAGGGACGAGGACCAGGAGGAGGGCGGCGGGGAGG
CGCCGGCACTCGTGACGATGGCGAACGACCCGGAAGGCGAGTACGGGGCGTGGATTCACGAACTCGGGTT
GTCCGAGGCGATCGAGCGGAAAATTCTTGCGCCTTTCGAGATTGATGTTTTGGAGATTACCGATCCTGAG
CCGGAATTGATGGAAGGAATGGACCGGGAGGCGCGGCGTGGGCGGCGGCTCGCCCTGCTCCAGACTGCGT
TGCTGGAGCACGCGGCCGAGCACAATCTGCGCACCGTGATGACGTTCCATCAGCGGGTGGAGGAGGCGGC
GGCTTTCGCGGAGAAAATGCCGGAGACAGCGGCGGAGCTTTACCGGAATGAGGTGTCGGCGGAGGATCTT
GCCCTAGCCGAGGAGCTCCCGGCCTCCGAGGTGGGCGGGGGCTTCTACGAGCTGGAGCCGGGGCGGCATG
TGCGGCCGGAGCGGGTGTGGTCGCGGTGGCTGTACGGAGAGCACCCGGTGGCCGAACGCCGTGCGGTGCT
GCGGGAGTTCGCGAACGGGATGGACTCGGCAGGGGTGCGGGTGCACCGCGCGTTCCTCGCCTCCGTCCGC
GTGCTCGGCGAGGGCGTCGACATCGTCGGGGAGCGCGGGGTCGAGGCGATCTGCTTCGCCGACGCGCGCG
GGTCCCAGGTCGAGATCGTGCAGAACATCGGCAGGGCGCTGCGCCCGAACCCGGACGGGCAGACGAAGAC
GGCGCGGATCATCGTGCCCGTCTTCTTGGAGGCCGACGAGGACGGGGAGGGGATGGTCGCGAGCGAGGCG
TACCGGCCGCTCGTGGCCGTGCTCCAGGGGCTGCGCTCGCACTCCGAGCACCTGGTCGAGAAGCTGATGC
TCCGGGCCCGGGTGCGGGCCGAGAGCGCGAGCGCGCGCAGCGCGGAGGAGGCCGGTGCGGGGCCCGCGCG
GGTCCTGTCCGACTCCGGGACCTCTTCCCCCGCCTCCCAGGCCTCCGGGGACGTCGAAGGCGAGAACGAG
GACGACGTCGAGGCGGGCGCGGACGGCGCTGAGGCGGGCGCGGACGGCGCTGAGGAGTCGGAGTCGGTGT
TGTTGCGGTTCTCGACGCCGCGCTCGGCGTCGACCATCGCGGCCTTCCTGCGGACGCGGGTGTACCAGCC
GGAGTCGACGGTGTGGCTGGAGGGCTACGAGGCGCTGCGCGCCTGGCGGGCCGAGCAAGGGGTGCGCGGC
TTGTGCGCGGTCCCGTACGACGCCGAGGTCGCCGCGGGGGCCTCGCGGCGGTACCCGGTCGGGCGGTGGA
CCACCGCGCAACGCCGCGCCCGCCGCGAGGGCACCCTCAGCGCACACCGCATCGACCTGCTCGACGCGGA
GGGCATGGTGTGGGAGCCGCGCGAAGAGGAGTGGGAGCGCACGCTCGCCGGGCTTCGCTCCTACCGGGCC
GCGTACGGGCACCTCGCCCCCCGCCGGCGCGAAACCTGGGGCGAAGACGAGGGTGAGGACGTCGTACGCG
TCGGGGACCTGATGGCGAACCTCCGCCGCAAGGACGGACTCGGGCGGGACGCGGAGCGGGCCGCCGCGCG
CGCGGCCCAGCTGAGGGCCGTCGATGCGGACTGGGACTGCCCCTGGCCGCTGGACTGGCAGCGCTGCTGT
CGGCAGCTCGCGCTCCTGGCCGCCGACGAACCCGACGGACGCGCGCCCCGGATCGCGCGCGGGGTGCGCA
TCGACGGGGACGACCTCGGCGCGTGGGTCGCGCGGCAGCAGGAACCGCGGGTGTGGGCGAAGCTCAGCAC
CGAGCAGCGGGCGCGACTCGAAGCGCTCGGGCTCCGGCCTACCGAGACGGCCCCACGGCGGGGTGTGGAG
GGCACGGGGGCGGCGGGGAGCGGGAAGCGGACGGCGGCGGCGCGAACGGCCTTCCAGCGCGGCCTCGCGG
CGCTCGCGCAGTGGGTCGAGCGGGAAGGCGCGGAGAAACCCGTACCCCGCAAACACACCGAGACCGTGAG
CGTGGACGGTGAGGACGTCGACGTACGCCTCGGCGTGTGGGTCTCGAACGTGAAGAGCCGCTTCGACGGG
ATGGGCGAGGACGAGCGCGGCCAGCTCACCGCGCTCGGAGTGCCCTGGGCGGTGTAG