view test-data/cmsearch_input2_mrum_genome.fa @ 7:477d829d3250 draft default tip

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 1527e05bcd748a2b3cef22e0e356697066a55635
author bgruening
date Sat, 11 Nov 2017 16:01:09 -0500
parents 6e18e0b098cd
children
line wrap: on
line source

>NC_013790.1 Methanobrevibacter ruminantium M1 chromosome, complete genome
ATGACTAATATTTTTGAGGATTTACAGGAAGAAAGCGTGGGAGTGAGTATTTTTAAAGATAAAAAACCTT
TAGATCATCGTTTTTTACCTGAAAATTTGCCTCATAGAAAGAAACAGATTACTGAAATTGCTAAACATTG
GATTGAAGCATTAAATGGAAACACCCCTTCAAACATTACAATTTATGGTAAGACAGGAACTGGAAAGACT
GCTGCTGCTAAATTCGCTAAAGAGCAGCTTATTGAAGCATCTAGAGATAAAAATGTCTTCATTAAAGTCG
AATATATCAGATGTACAGACTTCACTACAGAATACCAGGTCCTTACCTATCTTTGTCAAAGGCTAGGCCG
TGATGTTCCTAACCGTGGATGGACCAAGGGGGAGATTGTAAACACCTTTAGAGACATTTTAAGAAGAAAT
GCCTTTGGCAGAAATCTTATTTTAATTGTCATTTTAGATGAGATCGATATTCTTCTTGAAAAGGACGGCG
ACGGAATCTTATACACCCTTACAAGAACTGATAATATTGCCATTCTTTCAATAAGTAATTATCTTGACTT
TAAGCAATTCATTAAGCCAAGGGTTGCAAGCAGCTTAAGGGATAAAGAAATAGTGTTCCCGCCTTATGAT
GCAGAGCAATTAGCTGATATTTTACATGAACGTTCTGAATTGGCATTTGAAGAAAATACACTTGAAGAAA
GCGTTATTCCATTATGTTCAGCTATGGCTGCTAAGGAAGAAGGTGATGCAAGATATGCTCTTGACCTATT
GGAGAACGCTGGAGACATTGCTGTTGAAGAAGGATCTGAAATCGTTAAGGGAAAATATGTGCGTCAAGCT
AAGGATGTCATTGAGTATAATAAGGTTAAAGACGTTATTATTACACTTCCAACCCAACAGCAAAGGGTTC
TTGCAGCTATAATGAAATTAACTCAAGACAATGAGGAAATCACTTCAGGTAAGCTCTTTGAAGTCTATAA
AGATATTTCTAAAGGAGACAGTGTTACCTATAGAAGAATCTTTGATTTCATTAACGAATTGGAGATGTTA
GGAATTATCTCTACCAACACCATATCCAGGGGCAGAGGTAAAGGCAGGACCAATATTATTAAGTTGCAGA
CTGATTCTAAGTTGATTCAAGATAACTTATCTGCTGTTCTTTATTAGATAGATTCCTTATAATCTGGTAT
AATACTTATTTTGATTTTTTTTTATTATATCAGGTTTTTTCTTTTTTTTTAATTATTTTTTCTTATTATT
TTTGTTTTTCTTTTTTTTGGATGATTTTCATCTTTTTTTGTTTTTTATTGTTTTTGTGTGGTTTTCAATT
TGTATTCTTTTCTTTTTTTGTTTTTTTTTTTAATTTTTCCCATTTTTTAACATCTTAATATTTTTCTTTT
TCTTTTTTAGACACTCACCATCATAGATAATTATCCTAAAACTTAATGTTTGTAAATAAATCACAAATAA
TTTAATAAAAAATGAACATATATTATAATATTTGTATAAATAATCAATTATCGGTTTTTCATATTACTAA
TAACTTAAATATATTAAGATTAATCATTTTTTAAGATATCACTTTATTAATTAGCTATTTTTGTCTAGAA
TGAGAGGGTATTTTGAATTAATAGTAAAAAATTATTGAGGAAATTTAAATGACTAGACTTATTGAGTTTA
AGAATGTGAACAAGGAGTATAAATCTGGAGATTACATTTTAAAAGCTATGGATAATGTGAACTTTACAAT
AGATGAAGGAGAGTTTGTAGTAATTCTTGGACCTTCAGGTGCAGGTAAGTCCACCCTTCTAAACCTTTTA
GGAGGCCTTGATTCAGTTAGCTCAGGTGAAATAATCGTAAATGGCAGTCATATTGAATCATTCGATGACG
ATCAGCTTACAAACTATAGAGCCCGTAATGTAGGCTTTGTTTTCCAGTTCTATAACCTTATTCCTAACTT
GACAGCCTTGGAAAACATTGAATTGATGAAGGACGTTGTTGATTTTGACATCAATGGATTGGCTGTATTG
GATGCTGTTGGGCTAAAGGATCATGCCGATCATTTTCCAGCACAATTGTCCGGTGGAGAGCAACAAAGGG
TGTCAATTGCAAGGGCAATTGCTAAGAGACCTAGTATGCTTTTGTGTGATGAGCCAACAGGAGCTCTTGA
TTCAAAAACAGGGGCTTTGATATTGGCTTTGCTTCAGGACATGTGCGAAAAGCTCAATACAACTGTTGTC
ATAGTTACTCATAATGCAATTCTATCAGAAGCTGCCAATAAGGTTATTAGGATAAAGAATGGACAGATTG
AAAGTGTAATTGTAAATGAGATGCCTAAAAAGGTCTCTGAATTAGAATTGTGATTTTTATACTTTTAACT
AGAAAGAAATCATGATTAAAAGTGCTTATGAATAATTTATTTGATTTATTTGATGATTTATTATTATTTT
TATTGTAGTTAGTTTGGTATAAGCCGTAAATGTTTCTTGATTGGGATTTGTGATTATATGCTTAAAAGAA
AGATGCTAAGAGATATTTGGAATTATAAAGTTCAATTTATATCCATTTTCATAATTGCATTCATAGGCGT
ATTTGTATTTGCCGGACTGACTGCAGAGGCAGATGGTTTTGAAGCCTCCATAGACTCATTTTACCAGAGG
AGCAATTTAGCTGACGGATGGATATACTCAAACTATCTTGTTGATGACTTTCTAAAGCAGGTCTACTTGC
TTGGCGCAACCACTAGTATGGAGAGACAGTTGGTTGTAGATTCCCAAGCTGAATTAGATGGCAAGCCCGA
TATTACGCTGCATTTTGTTGAAAACAACACCATATCTAAATATTATCCTCTTGAAGGCAATGAATTAAAT
ATAAGCGATTCTGAAGGTGTATGGTTAGATAAAACTTTCGCTGATGCTCGAAATCTGAAGATAGGGGACA
CCATTGCATTTGAAAGCAATGGAATTAAAATAGAAAAGAAGATTAGGGGATTAGGCTATTCTCCAGAGAA
TGTTTATAGCTTAGTTCCCACTCAAACAGTTCCAAATTATACGGCAAGGGGCTTTGCTTATATGTCCTAT
AAGGCATTTCCATCAGACAATATAACTTATAATGTTCTTAATGTTAAGTTTGATGGACGCCCTGAAATCT
TCTCAGAGCTATTGTCCTATCGTTTAGATGGATATTATGAATTGTATCTGCCCCAATCAAATCAATATAG
CGTAAATGCGGTTTCAGATTCAATCGCTCATCAAAGTTCATTAAACGCTGTTTTCCCAATTCTTTTCACT
TTGATTTCAATGCTGATGCTTTCAGTGACTATGAAAAGAATCATCTCTAATCAAAGAACTCAAATCGGTG
TTCTTAAGGCTAATGGATTTAGCAATAGGTCAATAGCTATCCATTATATGTCCTTTGGCTTTTTATTAGT
CACATCAGGGTCAATATTAGGTGCAATTTTAGGGCCGATCGTATTCCATTTCGTTGTTCATGAATCCAGA
ATTTATTATTTTAAGTTCCCTGTTTGGGCTTATGTGGGACTTGAGAGATTCATATTTGTAATTGTTATAA
TATCATTGATTTCACTTATTGTTTCATATCTTTCAATTAAAAGCATTGTCAATGAGCCTCCATCTCAAAT
AATAAAGCCTAAGCCTCCAAAAATGGTCAGTTCTGGTTTCATTGAAAAGCTAGCAATCTGGAAAAGGCTT
TCATTTAACATAAGGTGGAATTATAGGGATATCAAAAGAAACAGGTTCAAATCACTAATGACAATCGTTG
GCGTGATGGGATGCACTATACTTTTGATTTCAGGCTTTGCAGTTTATGAGCAGATGGAAATTTCAAAGGA
TTGGTATTTCAATGACGTTAATCATTTTGAATCCAAGCTGGTGATTGATGATAATACAGACTTATCTCAA
ATAGATTCAATAGCCCATAAGGTTAATGGGGATGAGATAATGGAGTCCTCCATTGAAATATTAAAGGGTG
ATGCCAATTTTGCTTCCCTTTTGGTTTTAAATGACACCGATCTTATCACAATGACCAATGACAATCGTGA
GAAGATAGATATTCCAAAAAATGAGGTTTCAATTTCAAAGAAGATGGCTGATATTCTGGATTTAAAGGTT
GGAGATACTATAGATTGCCATCTATTAGATTCCAATAAGCTTGTTAAGATTAGGATTGATAGGATTCATT
CAACCCCATTTACTCAGGGCCTTGTCATGTCTGCCGATAAATATGAAGAGTTAGGCTTTAATTTTACTCC
AACAAGCATAATCACTTCAGAGCATGTCAATAAGTCTTATGATGGAGTCAAATCCACAATCTATTCAGAA
GATATGGTTCGAGGATGGGACCAGATGCAGAAAACCAGCATGATGATAATAACTTCAATATTGTTTTTAG
CTATTGTTTTAGCTGTTGTGATTCTTTATAATATGAATCTTCTTTCTTTCATAGAGATGGAGAATGATAT
TGCAACACTTAAGGTTTTAGGATTTAAGAGCAAGTATCTCACTAAATTGCTAGCTACTCAGGGCTTTTTC
TTTATTATTGTTGGTTTTATTTTAGGTCTTCCTGTAGCTTATTATATTTTAACATTGTTGATGCCTGCAT
TTGGAAATAAGATCTATTTGATTCCTAATATTTCTGTTTTGAATATGGCCTTTAGCTTTTTGATAATTGT
ATCTGTGTTTATTGTTATGAATTTATATTTCTCTAGGAAGATTAGAAAGCTAGACATGGTTGATGCTCTT
AAGACTTTTGAGTAGTCTTTTAGGCATATTAGGCATATATTTTCTTAATTTGATTAGAGGATTTTTTGTC
CTCTTACTTTTTTTATTCTTGATTTTTTAATTAATTCGGTGTTCTATAATTATATCATGGGTATCCATAT
ATTATATTTTCCAAATTAATATATTTTGACGAATTAAAACAACAAACTCTTCTTTTATTTTAATAGTTTA
ACTTTTTCTCTTAATTTAATTGCTCGTATTTTTAATAATTTTTTAGTTAATTAATCTTATCCTTGAGATT
ATTGTAAAAATGCATTTTAAGGGCTTAATTTGATGATGAATGGAAAGATTTATAAAAAGAGTTTTTGAAT
GATCATTCGATTTAAAAATTGTAAGATTAGAGTAAAAAGAGTTTTTGGAATTATAGATATTTGCTTAGAA
AAAAAAAGAAAAAGTGATTTTGAGCCATACAGCTCAAAATACTAATTTAAACTTATTTTATAGTAAGTTT
TTTACTTGCACTGGTAATAGTTGCATAAGTATCGTCGCCTGCGTATTTAGCAGTGAAAGCATAAGTGCCT
TTATTGGTAATGCTTACTTTAACTTTAGCAACACCTTTTGCATCGGTCTTAGCAGTGTAAGTTTTCTTAT
TGATGGTAAAGGTTATTTTCTTACCGGCTATTGGACTGCCTGCAGTTGTCTTAAAGGTAGCGCTGATGTA
TTTGTTTTTAGCGGATGCTTTGTAGCTAGCGGCAGTTCCGGTTAATTTAGCCTTTTGTTTTTTGACAGTA
ATTTTTGCAACTGCAAATGATCCGTTGGTTTTTTCATCACCGAGGAAACAAATAGCAAAGGTGTAATCAC
CTTTATATCCAAGGTTTATTTGCAATTTGACTGTACCGTTTTCATCACTGGTTCTGTTGTAGATTCTACC
ATTGAATCCGATTTGTACAAACTTGTCTGATAAGGCTTTGCCCTTGTCATCGGTTAATTTTACTACGAAG
TATTTACCGATTCTGCCATCAATTTTAGAGTCGAAAGCAGTTGTGGTCATATCTTCATAGTTGATGACAC
TCACAGTCTTTTCTTCTTTAAGGAACTTGTTAATTAAATCTTTGACTGCAGTGGTAAGGTTATCAACGAA
TGGACTGATATCATCAATTAATGAAGTGATGTTATCAATTAATGAAGTATCGTTTCCTAAGATTTTGGTC
CAGTTGATAGTTAGGGTTTCTCCTCCTAATAGGTCTGTCCAGTTGATGGTGAAGCTGTCTCCACCGAGGA
GGTCTGTCCAGTTGACTGTTAGGCTGTCTCTGCCGAGGAGGTCTGTCCAGTTGATGGTTGTGCTGTTTCC
TAAAAGATCTGTCCAGTTGATGGTGAAGCTGTCTCCGCCTAATAGTTCTGTCCAGTTAAGTGTTAGGCTT
TCGCCACCTAATAGTTCTGTCCAATTGAGGGTTGAACTTTCTCCAAAGAGGTCAGTCAAGTTAAGTGTTA
GGCTTTCTCCGAGGATTTTTGATATGTTAAGTGTAGAACCTTCTCCAAGGAGATCTGTCCAGTTGATGGT
TGTGCTTTCGCCTAATATATTTGAAAGATTGAATATGGAATCGTCTCCGAAGATGTCTGACATGTTAAGA
GCTAAGTCTTCTCCAAAGAGATCTGTCATGTTAATTGTGAAATCGTCTCCGAAGAGTTCTTCTAGTTTGT
TTGTTAAGTTTTCTCCAAAGATTGCTGTTAAGTTATCTCCAAAGATGTTTGTTAGGTTAAGTTTGAAATC
TTCTCCTAAAAGGCTTGTCATATTAAGGTTAAAGTCTTCTCCTAAAAGGCTTGACATATTGAATGTTAAA
TTGTCACCTAACAGTTCTGTCCAGTTGATGGTTGTGCTTTCGCCACCTAAAAGGCTTGACATATTGAGTG
TTAGGTTATCTCCTAATAGGTCTGTCCAGTTGAAGGTTAAGCTGTCTCCGTTAAGAAGGTCTGTCCAGTT
GACTGTTAGGCTGTCTCCTCCTAATAGGTCTGTCCAGTTGACTGTTAGGCTGTCTCTACCTAATAGGTCT
GTCAAATTAAGGGTAAAGTCTTCTCCGAGAAGGTCTGTCCAGTTGACTGTTAGGCTGTCTCTACCTAATA
GGTCTGTCCAGTTGAGGGTTGTGCTTTCTCCTCCAAGTAGGTCTGTCCAGTTGACTGTTAGGCTGTCTCC
TCCTAATAGGTCTGTCCAGTTAAGGGTGAAGCTATCTCCACTTAAGAGTTCGCTCCAGTTAAGGTTTAAG
TTGTCTCCACTTAAGAGTTTGCTCAAATTAAGGTTTAAGTTGTCTCCACTTAAGAGTTTGCTCAAATTAA
GGCTTGAGCTTTCTCCTCCAAGTAGGTCTGTTAAATTGATGCTAAAGCCAAGCAAACCGTCTTGGACGAT
TTTTTCATCATTAGCGATTTGAACCTTTTCTTCAGATATGATAGTTTCATCTGTAATTTCGGTTTCGTCT
TTTATTTCAGTTTCAGCTGTTTCATTTATGACTTCATCGTCAGCAGCTTCCACCTCTTCAATATTATTTG
TATCGGTTTCTATTTCTTCAAGGTTATTATCAACCGTTTCTATTTCTTGGATTTCACTATCAACTGTTAC
TACTTCATCAGCAGCAGGTGCTTCAATTGTATCAGTTATGTCTTCAGATGCGCTTGCCGCACCGATAGCG
AGTAATGAAATAAGGAATAGTGAAATAATTAAAATCATACGATTTTTCATAAAATGTTTCCTCCATTATT
TTAAAGGTATATATAATTATTATAAATATTTTTATAACTTTTTTTAAAACTCGATAGTATATTATTAAAA
AAATTCTAATTTTATATGGTATTAGTGTGATTTTGTTAAAATTTTTCTAATTTTCTATGATTTTTGATGT
ATTTTTTTTGATTTTGTTCAATAGTTTTGTTTATGAGTTTTGATGTATTTTTTTTGATTTTGTTCAATAG
TTTTGTTTATGAGTTTTGATGTATTTTTTTGTTCAAAATTTGAGCTATTCGTATCTGTGCCTAATGAGAT
TCTTTAATATGGCCATTCTTACAGGAATTGCATTTGCAGCCTGTTCAAAGTACTTATTGTATTTTGTATT
GTCAACATCATAGTCTATCTCATCTACTCTAGGCAATGGGTGCATTACAATCAGTTCCTTGCCTTCGAGC
AAGTCTTTGTTGATAAGATAAGCTCCTTTGATCTTTTCATACTCTTCAATATCCGGAAATCTTTCCTTTT
GAATCCTTGTGACATACAATACATCAATCTCATCTATGATGTCTTTCAGGTTTGATGTTTCCTTATATTT
TATATTGTTCTTTTCAAGGTCAAGGAGGTTTTCCTTAGGCATCTTTAGCTCTTCAGGGGATACGAATGTC
ATTTTAACATCATACATCCCTAAAGCATATGAAAGTGAGTGTACGGTACGGCCGTATTTTAAGTCTCCAA
GAAGTGCTATGTTAAGGCCATCGATCTTGCCGAAGTGCTTTCTGATGGTGTATAAGTCTAATAGGGTTTG
GGTAGGGTGTTGGCCTGCACCGTCTCCTGCATTTATGATTGGAACGTCTATTACATCAGATAAAAATCGT
GAAACACCTTCAAGGTCGTGTCTTATTACGATTGCATCGCAGTAGCTTTCAAACATCTTTGCAGTGTCTG
CAATGCTTTCTCCTTTGGCTACACTGCTGTTTGAAGTTTCTCCAAGTGAGATGCAGTCTCCGCCTAATCT
TTTCATGGCGGTTTCAAAGGACAATCTGGTTCTTGTTGAAGGTTCGTAGAATAATAGTCCGAGTATCTTT
CCAGAGAGCTCTTCTGATTTTTCTTTTGATTGAGCGATGTCTTCAAGCTTTTCAGCTTCATCTAGGATGA
ATTTTATATCTTCCTTTTCAAAGTCTTTTATTGAAATTACATTATTATGGCCAAAAATAATATTACACTC
CTTAAGTTTACACTTGAAATACAAGTCTTATATTTAGTTTGTATTATTTGATTTAAAATTCTTTTTATTT
CTTATTTGAAAAATATGAAAAGGGAATTATTTTTAGATAGTTGAGCATATATTTTTTAAATCATTGATTC
TTTCTTATTGATTTTTGCTAGTTGTTATTTCTTTTTTATTGTTCTTTTATTGATTTTATCTGCAAATTCA
TCTACAAGCTCCCAATCAATACTTGGTGGCTCCTTATTTTCCTTTTTAAACCTTTTTAAATTGGAATTTA
TTATGCGTTTAGTAATCATGTCTCCCTTATTGGGGTTTATTTCAGCTCCAAAGCATGCAGTTACAAATGC
TGATTTTACTATCTCCTCTGAAAATGATTTGTTCAGATATTCTTCAGCCTTGCCTTGGTTTGTGCAAGTG
ATATATAGGCCGTAATTTATTCCTTGCAATGTTTTATAGTTTTTATTTACAAAGGATTTTATTTCCCCTT
GAATGCGGCCGTAATGGATGGATCCTGCTATGATTACAAAGTCGTATTTTAAAAGACAGGCTGATTTGGC
TCTAGCTATTGGTATTGTTAGGACTTCTCCATCTATCTTGTCCACTAAGGCCTTTGCAATCTTTTTAGTA
GTTCCAGTTTTGCTTGCATAAATAATGGCTGTTTTCATTCTATCAGTTTATTTCTTTGTTTTTTTGATAA
TTATTCTATTATTTTAGATTGTTTAAATAATTCCAAGTAGGCATAATATGAGGAAAATAATAAGTAAGAG
AGCTATTATTTTTATTCCTTCTTTAGCTACTTTGAATAATACATAGATTAAAAGTATAATGAGTAATATT
TCAATTATTGTTGCAATTAGCATTTAATCACCTAAATTGAGTTTATTTTTACTATATTTTTATATTATTG
ATTTAAATTCATTCTAATGAGTTTTTTATTCTTCTTTTATTAAATAGTTCTTTAAGATTCCTATCTCTTC
AATAGAGACTTCTACAGTTGAACCAGCATCCATTGGACCTACACCTGGAGGTGTGCCGGTTGCAATTATA
TCTCCTGGATTGAGGGTAGTTGTCTGTGATATGAATTCAATTATCTCCTGTGGGGAGAAGATCATCATGG
AAGTGTTGGAATTCTGCTTTATCTCTCCGTTTACCTTTGTTACGATTCTTTGATTTAATGGGTCAAGGTC
TGTTTCAATAAAAGGCCCTATTGGGGCAAATCCATCACAGCTTTTTCCTCTTGTCCATTGGCCATCTCCA
AGGGTGAAATCCCTTGCGGTGACATCGTTTATGATTGTGTAGCCGAATATATAATCATCAGCCTCTTCTT
TAGATACCTTTTTTGTTGCCTTTCCAATGACAACTGCCAATTCCCCTTCATAATCCACTTGCTTTGAAAT
GTTAGGGAAGATTATATTCTTTTCTGTACTGTTTAATGCAGAATTTGGCTTTATGAAAATTACAGGCTTT
TTTGGAAGCTCTAAATTTAATTCTTTGGCATGGTCTTTGTAGTTTAGGCCAATGCATATGATTTTAGATG
GATTTACTGGAGCTTCTATTTCTATATCTTCTAGACTATATGATTCTATCATATTTTCCTTTATTTCATC
TAGATTAGAGTTAAAATAGTCTAATATGTCTCCTTTAAGTTCGATTATCTTTTCTCCATCGTAGAATCCT
ATTTTGATTGAATTGTCTTTGCCCAATTCATTGATTTTCTTTTTGAATCTTAAAAACTTCATTTAATCAC
GGCTATAAAACTAATTAATTTTTAAGCATTTCCATTTTTATTTTATTTTTAATATTATTTACATTTGTTT
ATATGATTGGGTGGTAGTTAAATTTATATTTCTTGTGTGATTCATTTTGTTGAACTAGTTCATTTGATTT
TATTTTTGTGGTGTGGTTCTTGGTTGAACTGGTTCATTTGATTTAATTGTTCCTTTTTAAGAAATTAATT
TATTAATTAACAAGGCAATGTTTTATTTTTTTCTCTTTTGTTCATTTTTTTTAATTTATTTTATATATTT
TAAAACAAAAGTTATTATTGTAAGTTGTTTATTTAGGAATGATAATTTTTACTATTTTTCAATGTTTTTA
ATTTTTAAAAAAGGATATTAGATTATCATACTTAAAGTACCTTAAAATAATCAAATATTTATATTAATTA
AATAACAATTTAAAAAGCATTTAAGTGATAGAATGAATCAAAATGCCCAGTGGAATTCAATTATAACATT
TATATTGGCAATGATTGGCCTTACCATAGGCATAGGGAATATTTGGCGTTTCAGCTATGTATTATACTCT
AATGGAGGAGGATCCTTCTTCATACCTTATTTTATTGCAATAATGGTTATGGGAATTCCTTTCTTGATTT
TAGAGTATGGATTAGGCTTTAGCCTAAAGAAGAGTTTTTCAAAGCTGATGCATGATATACGCCCGGAATT
TGAGGTAATTGCTTGGATGTTGGTCATATTCGTATTCATCGTTGTAATTTACTATATGGTTATCATAGGC
TGGGATTTTGTATATTTCCTAAACAGCTTTAGCTTCGGTTGGGGAAGCGATCCCAATTCATTCTTCATGA
CTTATGTTGGTGGAACTAGGGAGATATCCCAGATTGGAAGGCTTCTTCTTCCTACATTAATTTGCACAAC
AGTCTTATGGATTATTTTTTGGTTTGTATCCAATCGTGATGTGGATGAAGGAATCGGAAAGATTTCAACC
ATTCTAATGCCTTTGCTATTTATAATAATGATTTTTATCTTTTTATACTCATTCACATTGCCAGGATTTG
ACATTGGAATAAAGACATTGCTTAAGCCTAATTGGTCTCTTCTTTTAGACATTCACATCTGGCTTGCAGC
ATTCGGACAGACAATATTCACCTTAAGCATAGGCCAGGCAATGGTCTATACCTATGCAAGCTATTTGCCT
AGGAATTCCAAATTGGTCGATGAAGTATTGCTTGTGGTTATTACAAACACCTTATATGAGGTTTTCATTG
CCATTGGGGTCTTTTCAATACTTGGATATATGTCCCTAAAGTCATCAATACCTATAGAAAAACTAATCAG
TGAAGGAACTGGACTGATATTTGTTGTATTTCCAAAGATATTTAGTGAGATGGGTTTTGTAGGTCAGATT
ATAGGTCCATTGCTATTTTTATCAATACTATTTGCAGGATTTACTTCCGCATTGGCATTGTTTGAGCCTT
TCCTATCATCCTTATGTGATAAGTTTAATTTAAGTAGACGCAAAGGGGTTACAATACTTGTAATTGTTGC
AGTGATTTGCTCCATTCCTTTTTCAACAGGAATAAGCAGCTATTTGGTTGGGATTGTTGACAAGTTTGTA
AATGACTTTGGAATATTGATTTTGATTGGTGTGCAGGCCATTATATTTGGATGGTTCTATGGTGTTGAAA
AGGTCATGCCCGTTTTAAATGAGCTTTCTACTTTTAAGGTAGGCAAATCATGGGTTTTTACAATAAAATA
TCTATTGCCTGTTCTTATTATTATCATTTGGGTAAATGGTGTTGTGGGACTGTTCAGTAATACCAATAGC
TTTGAATTGATTGTAGATTTGATTATTACTTTTGTTGTGGTTGGATTCTCTGTTTTGTTTACTAAATTAG
GTGTTAAAGAGTAATTTAAGTGGTTTTAGGTCTTTAAAATAATTTTTTTATATTTTAAACCTTATGATGG
GTAATTTAGATATTATAATTTAACGTTAGGATTTAAATACTGGCCATGCTCTATAGACCTTTTTCCATAG
TGAATGGCAAATTGAGGACATCTATGTAGACAAGCAAAGCACATGTCACACTTTTTTCTCTTCCAGACAG
GCCGTTTATTCTCTATTTTTATTGTATTGGTTGGACAATTGTTTCTGCATATTCCGCAGCCTATACAATT
GTCATCTAGCTTAAAATTGCTTGTATTACGGATGAAGTCATATCCAACCTTGTATATGAATCCGCTGAAT
ATTTTATTTTCATTTTCAAGGTATTTTCCTGTTTTTCTTAAGAGTATTAGATTGTTCACTTCCTCTAATC
TTTTCTCTCCATATTCTTCAGCCTGTTTTATGTAGTTTTGGTCTGTTAGATCAAATTTAGGAACCCAATT
GTCTACCATCTTTACATTGAAGAATCCATCTATCTTTTTAAAGTATTTTGAAACTATGCTTTTAATGTTT
CCAACAGTGCTTCCATATGTGGCTACAAGGAAGATATATGGCTTTTTATTATAGTTAAGGCGGAGTTTCT
TAAGGAATATTCTAACAGAATCTGGTATTCCTAGCGAATAGATTGGGCATACAAATCCTATTATTTCATC
TTCTTTCACGTCAAATGTGAATTTGTTTTCCCTTATGCAGTCTGGGATTGAGATAATCTCTTCTTCATTG
CTTTTAGCTATTGTCTCTGCTACATATTTGCTGTTTCCAGTTCCTGTATAGTAGAATATCATTTATTTCC
TCTAGTTTAGTGGATTATTAAGATGTATGGCTTTTTTAAGTTTAACTATATGATTTTTTAATTCAATTCG
GTAATTATCTTTTTTTAATTTACGATTATTGAATAATCCTTTCTATAGGAACTACCAAGATATCACGTGC
GCCAGCATTTCTAAGCTTGTTAACTAGGTCAAAGACTTCATCCTCTCCAACCACTGCTTGTACGGCCATG
GTTTCCTCTTCGGAAAGCACTTGAGATATAGTAGGTCCGCTCATTGCCGGCATGACCTTTTGAACCTCAC
AAAGGTTTTCCTTTGCGACGTTCATCATAACCAGTTTCTTTCTTTCCGCTTCAAGCACACCTTGAATGCT
GGTGCTAACCGCTTCTACAAGGTTATTTTTTTCTGTGTATGAATTTTTGTTAGCTATCAATTTAATTGAG
CTTTCAAGGATGACATCAACTATCTTCAAATGATTCATATTTAGTGTTGTTCCTGTGCTTGTAAGGTCTG
TTATAGCATCTGCTATTCCAATGAATGGAGCTATTTCAGTAGATCCTGTAAGCTTTACTATCTTTATGTT
CAGATTGTTTTCTTCAAGGTATTTTCTTGTAAGGTTTGGAAATTCTGTAGCTATTGTCATTCCATCCTTC
AAATCATCTTTTGTGTTTATTTCGGAGTTTTCAGGAGAAGCTAAAACAAGCTTTGTTGCACCGAATTGGA
GGTCTGTTAATATTTTAACATCTGCTCCTGCCTCTTCTATCAGGTCATAGCCTGATATTCCCATATCACA
AATTCCTTCGTCTACAAATTCTGGAATGTCTGCTGCACGGGCAAACATCACGTCTATATTTTCATTGTAA
GTTGATGAGAATAATTTTCTGTTTGTTGAATCCTTTAAGCCTAGTCCTGCCTTTTCTAGTATTTTTATGG
AAGGTTCACTTATTCTTCCTTTGGAAGGGACTGCTATTTTGATTTTCATTTTATTCACCTATTGCTTTAG
TTAATGATTTTATAAATCTTTTAAAGTTTTAAAATTGTTTTATTTCTATTACTTTTATTTTAATTTTAGT
ATTATTTAATTATTTAGTTTATTTTTGATTATTTTCATTTTATTTGGTCATCTTTTCATTGATTTTGGGA
TTTTTTTTATTATTTTTGTTCATCTTTTCTTTGATTTTTTTTATTATTTTTGTTCATATTTCACTATTTT
TAATAATCGTTTTCATAGTATTTTTTCATCAAAAATTATTTTTAAAAAAGCATATGGAATGTATGATAAA
GTATATAAACTTTTTGTTTTTTGTTTTAAATAATCAATTTAACTTGAATTTAGATTTTATCATGTTTTTA
GTCAAATTTTTTGATTTTATGCCCTTTTTAGCCAGTTTTTTAGAAAGTTTTAAATATAATGATGTTAATA
AGAATAGTATGTGCTTATGAAATAAGGCGTCTAAGACAATATTTTTACAAAATATTTATTTAGATTCTTT
ATTTTTAAAATTTTTATATAAATATGATTTTTTAAAATTTTCTTTTGAAAAACCGAAATCTCATATTTTG
AAATGATGATAATATAAAAATTTTTATAAGTATATATTTTTATTTAAAAAAAATTAAGGAGATGTTAATT
ATGAGTATTCCTGTAGCTCCTATTGGAAGAATCATTAAAGACGCTGGTGCTGAAAGAGTAAGCGAAGATG
CTAAAAAAGAATTAAACGCATACGTAACCGCACAAGCTGAAGCTGTTGCTAAAAAAGCAATCGAATTCGC
AGCTATGGCAAAAAGAAAAACCGTCAAAGCTGAAGATATCGAATTAGCAATCAAAAACTTATAATTAATA
AAAAATAAGAAATAATTTTTTAATTATTTCATTTTTTATTTTTTTCTATTTTTATTATACTTTTACTTTA
ATCTTATTTTAACTTATTTTCTATTTTAAAAACTAATTTTTATCAAATTATTGATTTAACTTTAAAAAAT
TCCCTTTTGATTAAAACAAATATTTTTTTATATAATAATTTACAAATCTAAAATTATAGGATTATATAAT
CGATTATTTTTGGGCAATAAATTATTTTTAAAATCAATATATTAGAATTTGCCAGGTTTTAAATTCATTT
TTAAGGATTTTATCATGGCTTTTAAATAAGAGTAAAAAAATTAAAATAAGGGATTTAAGATGGGAAGAAG
AAAAAAACAAGATTCTACACTTGATTCTTATTTTCCAGATTCTGATTTGATAGAGGAAAAAAAGAAGAAG
GATGAAGCATGCAAGATCTGTGGCAATCCTATAGAGGACGCCACCTTTCAAAGATGTCGCAAGTGCTTAA
ACAAGCTTGCACTGATAGATGACTTAAGGGAACTATTGGAATACGTTTCTCCAGGTGAAAGCTTTAGGGA
AATTGACCTAATCAATAAAGGCTTTAAAAGCTTGAAACTCAACATTCTCATTTCTAAATTTTTAAAAGAA
CAGCTCATTTTAATTAATCTCGACGGTTTATTTACTCTTAACAATATTGATTTTTTAAATGCCTTTATTA
AAAAATATGGCGAAAAGGAAAAGCCACTTAAGGAAACAGATTACTTAATAGTAAGGGATGACAAGTCTGC
CTTTTATATTGATGTCAACAACTATTCAGATTATATAAAGATAAGGTTCAATCCTAGGATTAACAAGTGG
CAGGTTGATTTCTTTAATGAAAACGGCCTCGCAAATACCAAGTCCTTTATTGATTCCAATGATGCAAATA
AGGAAGCCATCTATTACATTAAGCAGTTAGGTGTTATCGGATCTTCAGCTGATGATAAGAAAGAGGAAAA
GTCTGATAAAAGATTATACTCTTCTCATGAGGGAATCTATTACAGCCCTAGCCGTGGAATGTGGGGAGCT
AAAGTCAAGGGATATAAGGGATTTAAGTTCATTGGACACTTCAGCAGCGAAGAGGAAGCTTATGAGGCAA
GATGCAAGTATTTGGAAAATAAGGAAAGAACCAGACAAAAGTATATTTCTGAAAAGAGAGGATTGAAATC
CGGCCTTAGGAATCAAAGCTCTGGAGAGCTGATTTACTTTAGCAAACAGAAGGGCAAATGGATTGTAAGG
CTTAAAAATAAGGAAGGCCAAATTGTTAATGTAGGCCAGTTTGACACCGAAGAGGAAGCTAATAAAGCTA
AAGAGGAGTTTATTAAGGATAATAGTTAATTATTAATTTCTTAATCTCTTATCATTTAATCTAATCAGAT
ATTTCTTCTTTTAAATTTTTTATCACTTCTTCATCTAATTTGGTCAGTTCAGATATTTTTTCTACTGACA
TTTTTTTTAATAGCTTTTCAACCATTTCTATTTTTTCTAATATTTTTGATTTTAAAGAACCTTGATTTAA
CTTATTTTAATTTATTTGCATATATAAGTCTTTTTGAATAAAATAGACGGTTTACTATTTATTAACAATG
GTTTACCAATTTTTAGAAAAGTTTATAAGATATGGTTTTAATAAAAAAAAGGTAATTACCTTTAAAAAAT
TTTTAAAAAATAGAAAAATTGATTTTTTTAAAGGCCATAATTATTAAAAATCGATAAAAGGATTTACTAG
AAAGTTAAATATAATATTGTGTGAGAAAATAGATATGAAATTCTGTTTTAAGGTTTTAATTTTTAAAAAA
TTAAAAAGATTTGCTTTTTTACCGTTTAAAGGCAGGTCTTTAACAGTATTAAAATATTACTTTCTATAAT
GTATTTTAAAGAAGTTTTGGGGACTTTTTTTAAAAAATTATTGTAGGATAGCATGAGTGAATTAAAGTTG
GATTTGGTATTCGATGACTATCAAATCAAAAGGGCAAAACCTGCAAGGGGTTCATCTGTTATTCATGTGA
ATAAGAGATGGATAGGAAAGGAAGTGTCCATAATTCCACTGCCATTTGACGTGGATGAAAAGTTTATTGA
TGAAACTAAAGGGGAAGACGGTTTATATCATTTAGAGTTGGCTGTTAAGGAGATCTTTTCCAAAACAGTA
TCAGATCGTAAAGATGTAGGATTCTTTTATCTTAAGGAGTCTTTGCTTGGATTGTTTTTCCTCATTATAG
AAGCGCCTGATATTGTTTATTAGGGGCTTGTCAGTAATTGATACTTTCTATAAAATCATTTTTTTCTTTT
TTTCTTTTTTTATTATATCTTGTTTCTATTTTTGTTATAGGCTTAGTTATTTATTATTATTTAGTTGTTT
ATGGGATGACTATTAGTTATCTATCGATTTATGAGATTTAGTTATTCTTTAATTATAGTTTATTCTCTTT
TTAACTATCACTTTAATATAATATATTCACTATTTAACTACAACTTTACTATATTCTATCTACAAATTAA
CTATCATTTTCATATATGTTATTTATAATTTACTTCATAATTATCAATAACTTAGTTATAAATTTACCAT
ATATTTAAATATCTTAATGAACATAATATATCATGTGAAATTTAATTTAAACTAAAAATTTAAATATTTA
AAATTTCATAAAGAATGTATAGATAATTTAAATTATCTAATCATGTTTATAAAGCTTAATTAAGTTTTAT
AATTTTCACTAAAAATTAGTTCTTCTTTTTTTGGTGAATTTCAAATGTTCGTAAGCAACTTACTTTTTGT
AAGTTGCTTTTTTTTATTGACTATTTTTCTTTTAGTACTCTTTTTAATTTGTTTTTATACAATTGGATAA
TAATTTTTCGATTTTTTCTATTTTTAGATATGCATTTATATCTTGGTGTCCAGTATATTGGATACCTCTT
TATAAATAGGTGTTCAGTTTACTTGATATCCTTTTATAAATAGGTGTCCAGTATATTGGATACATTTATA
TATTAACAATTTTATATAATTTATTAGGTGAGAAAAATGTATGAAAAAGAAGATATTTTAATCGATTATA
TTAATAATGAAATTAACACTGTTCCATTCAGCTTAAATGATAAACTTAAAATAAGAAATGAGAAGTTTCG
TTGTCGTGAGGAGTTTTATGAGATAAAAAATTATGTGGATGATTTTTTAGAAGGTAACTATACCAATAGA
TACATAGTGTTACCTGGACTAAGGGGTTTAGGTAAAACAACCATTATTTACCAGTTATATCAATATTTAT
TAAGAGAAAAGGAAATCAATCATAATCAAATTCTTTATATCTCCTGTGATGATTTAAATGACTATATGGA
TATTAATATTTTAGATGTCGTTAACTGCTTCTTGAAGCTTCATCATAATTCTAATTTAAGAACTTTAGAT
AAGAAGATCTTTATTTTTATTGACGAGTCACAGTATGATTCTAATTGGGCAGGGGCTGGTAAAAGAATTT
ATGATAAGACTAATAATGTTTTTTTAATATTTACTGGTTCATCTGCATTGAATTTAGAATATAATGCTGA
TTCTGCAAGAAGATTATTGAAAAAAAGCATCACTCCTTTAAATTACGGTCATTTTTTAAAATTAAAATAT
GGTTTTCACTATGATGAATTCTCTGATGCATTAAGTGACCTGATATTTTTAGGTGATGAGAAGAAAGCCA
TTCAATGTGAAAGGGAAGTTTATTCTAAATTGTATAATTTAGAAGGCTATAATGATAATGTATGGGATGA
TTTTTTAAGAAATGGAGGATTTCCCATATCCTTTTATGAGAAAAATGATGATAATGTTTCTCAAAGGTTA
AGGGAAGTAGTTAAAAAAGTCTTAATAAGCGATATTGCTAATATTTCCACTATTTCAAGTGAAAAGTATA
TTAACAGCATTAGGCTATTAAATTTTTTAGCGGTGCAAAAGCCAGGGGACATTTCACAAAATAAATTAGC
TAATTTTTTAAATGTATCTCCTACAACTGTTAAGGGTATAATAGACCTTTTGGAAAAGACACATTTGATA
TTTCATACAGAGCCTTATGGTTCTGCCGCCAAAAGATCTAAAAAATCATGGAAATATTTTTTTGCTAGTT
CTTCCCTAAAACATGCTTTAGTTAAGGATTTAGGTAGTTCTATGAGAGATGTAAAATCTTATGAAGGTAT
CTTATTAGAAAATCTTGTAGCATCCACTTTCTTTAATTGGACAAATAGGAAAAATATTTCCTTCAATCTA
TTTTATGATGCAAATGATGATGAAAAAAATAAGACTACTGTTGATTTTATTATTAAGGAAGGTTTTAATA
AGCCAATTCCTATAGAAGTAGGTATTGGAAAAAAAGGCGATAAGCAAATTTCCAAGTCTATTAGTGATTA
TAGGGCTGATTATGGTATTGTTATATCTAATAAGACCAAGTTTATAGAAAGACAGGGAAATGTTATTTAT
TTGCCTCCAAGAAGCTTTTCTTTTTTATGAGATTGCTTTTGGGAAGCTTTTCTTTTTTATAAGATTGCCT
TTGGGAAGCTTTTCTTTTTTCTATTTCTAAAACTTCTATCTTTTTTTCTTTCATTATTTTTCAAATCTTA
GCTTATATTGATTAAATTTGATGCAAAATTATTGATAAAAATTCATAAAAACTTCCTAATAAATTAACAT
TATTCCAAATTAAATATATTTATATTATATATAAGAACTTACAAAATATTTAATAATTATAAAACAATTT
ATTGACTAAATAAAAAATTATTAAAAAACCTTTCAATAAGTTAATTAAATATAATTTTGGGGATTTTTAT
GAAATTATATAAAAATAGCATAATCATTTTATTATTAATTTTAATTTTATCGATTGGAGCAGCTGCAGCT
GTAGAAAATGATTATTCTAATGCCGATTTAGATATTTCTAATGATTTTGTTTTAAGTGATAATTCTAATG
AAATTTTAATAGATTCTTCTGGCTCTTTAGATGATTCTTCTAGTGCCTTAGTTTCAGAAGGTTCTTCTAA
TGGATTGGATTCATATTATTCTAATGATTTGGTTTTAAATGATTCTTTATCTTCTAGATCATCTGTGATT
GAAGACTCTTGTTCTATTGACTCAACTACTATTGAAGATAAGGCCTTAGAAAAAAGCTTGTCTTCAAATG
AATTGGCTGAAGGCACAAAGACATATACAGACCTGCTAAAGGATATAAAGAGTGCTAAGAATGTGCTTAA
CTTAAAATACGACTATATATACGATAGCACTATTGACAAAAGTCTTAAAAAAGGAATCGTATTAACCTTT
GATGAAGACTATGAGCTTACAATCAATGGAAACGGCCATATTATAGATGGAAATGGAATTGCTGGTGGAT
TTAACTTTGAAAATGGTGAATTTGTCATAAATAACCTTAGCTTTCAAAACTGTAAGATATCCTCTCTAAT
CTTAACTAGCTGTGATTTCACTACAAATTATGTCACTTTTTCAAACAATTATGACAAGAGCTCTGGTGCA
TGCGTATATCTTGACAACTCTTATTTCTACAGCAGTCATGATAATTTTATAGATAACTATGCGCCTTCAG
GATCAGCCATCTATGGCGAATGCAGTGTAATAGATGTTTATGATGGCTTATTTGAGTCTCAAAAACCGAT
TGACTGGTCCTTTATCTATGGATGGGATGAGACTGAAATATATATAGAAGACTGTTTGTTTAGAAACACC
GTATCCAATTACTCAACTGCAGTATATGGCGATTATATAATAGAAATCTCCAACTCTCATTTTACTAATC
TATTCTCCAAATTCACAGGAGGAGCCATTGGAGTAAGGAATGCTAGCCTTACCGTTGAAAAATCTGAATT
TAACAATGTCTCCTCTTTAAGAAATGGCGGAGTCATTTATGCAGACATGAATGTGGATGAGGAAAAATCC
AGCGAAGAGACAATCATTAAGGATTCTAGCTTTGTAAATTCCAAGTCTGACTTTGGAGGAGCTGTATTGC
AGCTTGGAGGTAAATTAAAGATATACAGATCAAATTTTACAGAGAATACTGCCAACTACTATGGTGGTGC
CATTTATACTTCCAATGTCAGCTTTTACACCAGTAAAAGCAAATTTTCAAATAATGTAGCAAATGAAATG
AAAGGCTCTGCAATCTATTTTGACAATGGAGACTTGAAAATCGAAAATTCTAATGTCTTAAGCAATCCTT
CCTGCGAAGGAGCCATTTATATTTACGATAGCTTTTATAATATAAGTGGCAGTACGTTTTCAAACAATGA
TGTGGCAATACATTCATTCTTTGACCGCACAAGAACTGTAAAAAATTCTAAAACAGGTAAAAGCACCACT
GTAAAGTCCTCTCTAAATAATAATACTTGGGGCGGCGATAGAAATAAGTTAAACAATGTGGAATATCCTT
ATTTTGTATCCAATCTTGGTCAAGACATTATATTGAATCCAGTTAAAATTAATGCCACTATCAAGGACAA
ATACTTTAATCTGGTTGATTTGGGATTGGTGACACCTGTTAAGGACCAAGGAGACAGCGGAGCATGCTGG
GCATTTGGAGGAGCAGCGGCCCTTGAGTCAGCAATCTTAAAGGCAACTGGAGTAAGCTTAGACATATCTG
AAAACAATATACAGTCTGCAGGATTAAGATATAGCCTTTATGGAAAGCCTTCCCTTACCGAAGGAGGCTA
TGACTATACCGCCCTTGCATACTACTTAAGCTGGCTAGGTCCTAATAATAGCTCTATCGATGAGTATGAC
CAATTCGGTAAGATATCCCCTCAATTGTTCTCTGAAGATAATTATCATATCTTGGATGTGATTTTCCTAG
ACCCTGCAAATACAAGCTCAATAAAGGATGGATTAATCAAATATGGGGCATTGTCTGCCTCAGCAAATGG
TGCAGATTCAGATTCCAATGACTTTTTCAATGAAAAGACCTATGCCCAATACTGCAATGATGATGAGGCT
TCCGCCAATCACATCATAAGCATTGTGGGATGGGATGACAACTATTCCAAAAACAATTTCCTCATTACCC
CTAAGGGAAATGGGGCATGGATTGTAAAGAATAGCTGGGGATCTGACTGGGGAAAGAATGGATACTATTA
TATCTCCTACTATGACGAAAGCCTAAGGTCCTGCTATGCAGTAGCCTATCTATTAAATAATACTCTTCGC
TACAATAAGCTTTATCAATATGACTTGACTAATTACGATGACTTTGATGACGGCGATTATGATGGGGTTA
TCTATTCCAATAAGTTCACCTCAAATGGGGATGACCTGATTGCCGCTGTTGGAACCTACTTTGAATATGA
GGATGACGACTATGTCATTTCAGTTTATGTAAATGGCAAAAAGGCCTATCAGCAAAAGGGCACATCTGCA
TTTGTAGGATACAATACCATTAAATTGAATAAGTATATCGCTGTAAATAAGGGAGAAACATTTACAGTTG
CCATCAGCTCATCTGCCATGCCTTATGTTGATGATACTAGGATCCATCTTCCTAAGGGAAGCTCATTTTT
AACCGTTGACGGCGAACAGATTGACTTAAGCCAAAGAGGCCAAATAGCTTGCATTAAGGTATATACCTTT
AATGACACAAAGATAACTAGAGACCAAAGCACTTATTACGGTTCAGATAAGAAGCTAGCTATTGAATCTG
AGCTTGAAGGTACTACAATCAGCCTAACAGATTCAAATTGTAAGAGCTTAGGCTCTGCTAAGGTCGTAGA
TGGAGTGGCTCAATTCGATTTGGTATTAGGCCCTGGAACTTATTTCTACACAAGCTCATATGCTGGAGAG
AAAATAATAAATAGCTTTAAAGTCTTCAGCACAATCGGAGGAGTTTCTAATAAGAACATAGGATATAAGG
CTACAGCAAGCTTTAGCCTATCCTTTAAAGATGAAAATGGAGAGATTTTAAACAATAGTCAATTCACTTA
CACATTGGATGGAAAGTCAAAGACTTTAACCACATTGGATGATGGAACTTATAATATCTCCTTTAAGAAT
TTGGCCATTGGAACACATAAGTTGTCTGTCAAGAACCTTATAAGCGGCCAGGTTTCCAATGCCACAATCA
AGGTTGTCTCAAGATTCAGCGGCGCTAAAGACATTAGCATGTTCTATTTCGATGGCACATGCTATAAGGT
TAGAATAATGGGTAATGATGCTAAGGCAGTTGGAAAGGGACAGACAGTAACTGTAGTTCTCAATAAGAAG
ACCTACAAGCTAAAGACAGATGCAAACGGATATATCAGCCTTAAGATACCTAATACATTAACTCCAAATG
GCGCAAAGGCCAAGGTATACTCAATTAAGATGACTTATGCTGGTCAAAGCCTGTCCAAGAAGATAACTGT
AAAGCAGGTCTTAAAGACCAATAGTCTCACTGTCAAGAAGAAAGCAAAGAGCTTTTCAATTAAAGTCACA
CTTAAGGGAAAAACAGTTCTTAAGTATAAGGTGCTGACCATTAAGTTTAAGGGAAAGACCTATAAGGTCA
AGACCAATGCTAAAGGAATTGCAACTTTAACCCTTAAGAAAGCTGTTATTAATGGTCTTAAAAAGGGAGG
AAAGTACACTTTCACTGTGACCTATCTTAAGGACACTATTAAGGCTACTGTGAGTGTTAAATAGGAATAA
ATTTGATTAAACTTTTATATGGCTATATTTTAGGTGTAAATTAGCGTTTAAATTAGTATTATGCTTCATA
GGTGTAAAAAATGAATAAAAAATTGATTGAATATTTGATTATAGCAACAGTTATTATTTTAATCCTTTAT
GGTTGCTATTCTCTTATTGATTATCAATCCAACGGATATCAGTTTCGTATGGTGAATGCTACTGATTCAA
TGAATATATCTTGTCCTTCAAGTTCTGCCTATTCAGTCAGTGGAGACACAGTAGAATTTAGAAATGGATT
AAACAGTTTCTATAATATGGACGTTAGCAAGCTAAACTCTTCAGATGGTAAAGTTAAAAATATATTGAAT
CAATATTCTAAGTTCCATAAGTCCGGTACTTTAGATTTAAAAAATGAGACTTGCTATGTGCTGACAGTAG
AATTGGAAGACGATAAAGGATTTAATTATCATTCCATGATTATCTCTGTCGATTCATTTGATAAGGATAG
TTTATCCTTTAATAAGGAAGCAACCGTTTATCTATTTGATGGAAACAATAGGGAATTTGTTGTAGATACT
GTATATGGAAGTCAGGTGGTAATATGAGTCCATATGAACTGATAAAGGATGATGGTGAAGTGGTTAATCT
TGGTGGTTCTCCTGATGAGAGTCAAGATTTTGATGTTTCTTTAGAAAGGCTAAATGATAAATCTTTAGCA
GATTCAGATGGCGATGGAAAGCATGACGTATTCATCAGCTATTCAACTAAAAACTCAGATATAGCAAATG
AGATATGCTACCTTCTTGAAAAGAACGGTCTTGAATGCTGGATTGCTCCAAGAAACATTTCATCTGGCAA
AAATTATGTTGATGAGATAGCAGATGGAATCAAATCAACTAAAATAGTCGTTTTAGTATTTTCAAAATAT
TCACAGGAATCCAAATATGTAAACAATGAAGTTATGATGGCATTCAGCTATAATAAGCCTATTATTTCAT
TTAATATTGATCAAACAGAGCCTAATGACATTATGGGATATTATTTAAAGGTGGCTCAATGGCTGCCGGC
ATATCCAAATCCTAAAAGTCAGTATGAGACATTGGTTACTGACGCTTTAAAATTATGCAATGAAAGGCCA
AGAACTGTAATTACAAGCTTAGACGGCTTCATTCCAGAAGACATATCCAAGCAAAAGAAAAATTGGATAT
CACTTATATTGCTGTTTACTCCAATCTATTGGGCTTCATTTATTTATATGGGCCTTGTTTCAAAGAAAAA
ATCATGGACATTGTTAGGATTTTTATATGCGATTCCAACAGTAATCGGATTGCTTTTGTATTTCCAGGTA
TTTACCAGATTATTCCTTATTTATCCGATATTTAGGTTATTTAATTTAATATTTATATTATGCTGGATAT
TGGCCATAATTCATGGATTGGTTATTAGAAATGAGTTTTTAACCAGATATTCTGTTTTAGGACTGATGTC
TTTTGATAAGGATCTCTTTGAGTATCTTTATGGTATGTATTATAAAATGTAATCTGTTTAACAATTATGA
GGCTTAATTATGAGTCATGATGTTTTTATATGCTATGATGAGGAAGATAAAGATTGTGCAGAGGCCATTT
GCCGTATCTTTGAAGAGAATAATATTAAGACTTGGATTCGCTCAAGAGACGTATCTTCAAAGGATGCAGC
CCGCAATCTAACAGAGGCTATAAGAAATTCCAAATGTTTTGTATTGGTCTATTCAAAGAATGGAAAGAAC
ACCAATTATATTATAAATGAAACAGACATAGCATTTTCAAAAGAAATTCCAATTATACTCTTTAAGCTTG
ATGAGACAAGCATTCCAAAGGATTTGGAATTTATTTTAATAAGCAAAAAGAAGATAGTGGCATATCCTCA
TAGCAAAAGACAATTAAAGACTCTTGTAAAAGAGACTTCAGATATATTAGATAGACCAACAGATGATATT
AAGCTTGATTCTAATTCAGTCAAGACAATTGAAAGGTCTAATCCTAAAAGAAAGGAAAACAATATAAAGA
AAGCTATTGGAGCAGCGGCTTTAATAGCAGCAGTTTTAATTTTAATTTATTTATTTGTAATAGTGCCTAC
AGGCCAGAACATCACCGATAGCGGTGTATTCTCCATGGATGTAACCCATGTTGAAGTGGATGAATTGGCC
AAAGGCAATAAGTATACGATATATGGCGAATCATATAATTTGCCAAGTGATTCTGATAGATACTTTATGA
ACCTTCAATTCTTTGATGATAAGGATAATGTGGTTTATGAGGTAAATTCAACAGCCGATGAGTTTAAATC
AGGCATTATATGGAGTGGTGATATAAATAAAGGTGATATTAAGCATATTGGGTTTAAATTAACTGATATG
GATAATAAAATACTCTCCCAAGAGGATTATAATCTTGGATTGTAGTTTCTGCATTTCGATGGGTTATAAT
CTTGGATTGTAGTTTTCTGCTTTGCGGAAAGGATTTAGTCGGATTGTAATATTTTATTATTTAGTTTTTT
TAATTCCTATCAATTTTATATATTGGGTAATAATCTGTTGTTTGATCTTTTTAATTCCAATGAATTTTAA
AATCGAATATTTTATTCGGTTTTTTTAATTTCGAAGAGAATTATAAGAAAATGAAAATGGACTATTATCT
GATTTAATCAATAAAAAATAGATTATGGTGAAAATGAAATTTAAGCGTAGTTTAATATTGGCAGTGATTT
TGATAATCCTATTTTCACTTGGAACTGTTGCAGCAAGTGAAAATATAGTTATTGATGAGTCTTCTGATTC
CAATTTAGTTATAGACCATGCTAAGGATAATTATTTATTCAATGGACCTATAAAAGATAATTATTTATCT
AGCAGTTCTATTAGTGATAATTATTTATCTAAAGGTGTTCTTGATGATTCTTATTTATCAAGAAGCGATT
TGGATGATTCTTATTTATCTATGGATGATGGCAAAGGCTCTATCGATTTGACGAATCATAATCAACTATC
TAATTCAGATGATAAACAGCTTAAAACTTCTAATTTAGAGGATGAAAAACAGCTTGAAAGTGTAAATAAA
GGAGATAAGCTTCTTAAAGATTCAAATGACAATGTCGATTTGTTTATTAATATGGATGTAAAGACATCAT
TGACCAACAAGCAATATAACCGTGCAGGAAGCGAAGTTCCATGGATTATAACTGTTTCCTCTCTCAATGG
AACCAGCTATAATACCCAAGTTCGTGACGTTTTATCTGAAAATTTACAGTATTTATCACATAATGCTACA
ATGGGAACATTCGATCCGGAAAATGGAATTTGGACTGTTGGTGACTTGGAATCTTCTAAAAATGCAAGCT
TGACAATATTGACAAGATTGAAAAGAGATGGTACATATATAAACAAGGCTTATGCTACTACCGATTCAAA
TGATGTTAATCTATTGAATAACTTCCTAATCATTTCCATAAGGACCGGTTCATCAAAGATCACTTCTAAC
ATTACAGAGACAAGTGATGAAAGAGAGGGAATTCAGCATAATGTTCATTATGCTAGTATGGTTGATACGG
ACTTTATATATAGATATGAAGAGGACTCTTCAGAAGACGATGGCGGCAATGAAGAAGGCCAATCTGAAGG
AAATTCCCATACCAAGACTAGATCTTTAGGAAATAAATTGAAATTATTCAATGCTCAGAATATAGATTAT
CATTCTCTTTCCAAAAACATCGGTGGAGCATTAGGTTTTGGATATAATTCAAATGGAGGATTCCTTAATT
CAAAGGACATTTATGAGGCTTTATTTGTTTATGACTATACAAGAATCCCTATTATTGTATTTGCAGCCTT
TTTAGTTGTTTTAGCATCTATAGTTGGCTATGATAAGGTTAAATCTTCAAAATAAAATTTTCTTTTTTAA
TTTTTTATTATCAATTATTTAAATTAATATTATTAAAAATGAGAGTGTAAAATTAATTAAATATTGAATA
GTTAATGAAATGAAGGTATTTAATTAATTTTATATTTAATTAACGATTAACGGAATTAGGTACAAATTTA
ATGGAATGAGGATTATGATAAATAAAAAATTGTTTTTTGTTTTCTTATTAATGGTTCTAGTGATTGGAAC
CATTTCTGCAGTTAGTGCAAATGAATGCGCTAATGACTTAACGATGGAGATAAGTGATGATAATATAGCT
ATTGATAGTTCTTCTGCTTTAGAAGGGGATGATTTAGCTATTGATAGTTCTTCTTCAGATTTAAGTAATG
AAAATAATATAAATTCTATGAATGATAGTGTAATTAATTCTAATTCTATTAATTCTGATTCTATTAATTC
TGATTCTATTAATTCTGATTCTATTAACCCTAATCCTAATATTGATGATGAAATAAATAACCATAAAGAT
AGCTTTTTAAAGGCTGTACAGGCCTCTAAAACCGGAACATTTACAGAGCTTCAAACTAAGATAAACAAGG
CAAGCAAAGGCTCAACAATCTATCTGGATAAGAATTACCTCTATAATGATGACTTTAAAGGCAAATATGG
AATAGTGATAAACAAGTCTATCACAATCGATGGAAAAGGCCATGTCATTGACGGTTTAAAGAAATCAAAT
CTGATTTTCATCAATGATGCTTCAAACGTTGTCTTTAAGAACATAATATTTAGAAAGGGCGACGGGGACG
AGAATGGAGCTATAAATCTTATTGGCTCTGATCATATCGAGTTTAACAATTGCAGCTTCAATTATAACTA
TGGTGATAGGGGTGCTGTATTTTTATCCGGCAGCGATTACTCCTCCTTTGTAAATTGCAAGTTTAATGAG
AATATTGGGGAGAACGGCGGAGCTCTTATATTGGCTGATAGTGATTATTCTCGCCTTGTCAACTGTATCT
TTTTTGGAAATGAGGCATCTGACGGAGGAGCCGTATTTATAACTTATAGTGATTATTCTTACTTTTTCAA
CTGTACTTCAGAGGGCAATAGCGTAGATTATACAGGAGGGGCCTTTTATTTGGATTATTCCGATAATTCC
TCTTTCATTGATTGCGTATTTGACACTTCCAGCGCTAAGGATGGCGGTGCCTTTTATTTAGGCGATTGCC
ATAATTCCTCTTTCATTAACTGTAGCTATTGGAATAATCAAGTTGATTATTATGGTGCTGTTTGTTATTT
GGACAATTGCTATGACTCCTCTTTCATATCTTGTAATTTCACTGGAAATTCTGGTTCTAACCCTGAATTA
GATGAAACACCTTCCATTGGCGGTGGCGTATTTTATATAAGCGAGTCTCACGGCTTGTATTTTACCCATT
GTAATTTTTCCGAAAATGAGGCAAAAAATGATGGCGGTGCCATATATGCTTCAGATTCCGATGTTCATAT
TGATTCCTCTGTATTTGAGGAGAATTGCGCTTTATGCGGAGGTGCCCTTTATGCTATGAACTCTGATATT
TTCATTGACTCATCCCTTTTTGAGAGTAGCGTTGGAGATAGGGGAGGTTCAATATTTGCAAATAAGTCTA
ATGTTTATTCTAAAAACTCCTCTTTTATTCAATACTATGAAATTGAAGATGAATATGTCTATATTCCTGC
TTCTGGAGCATATCACCTTATGGAAGGAAATATTGGCGGAGCAATATACTCTCTTCAGTCTGTCTTGAAT
ATTTCTTCTAATAAATTCAATAACAATTTTGGCTTGACTTCAGGGGGAGATATCTATTCCCAATACAGCA
TGATCTATATAGATGACTGCTCATTTTCAAATTCATTCTCCAATGGATTTGGAGGCTCATTAAGCTTCAA
CAACGACTATGTCCAAATCACAGATTCCAGCTTTGAAAACTGCAGCTCAAGGGATAACGGCGGAGGTGGA
ATCTACTCTATAAATTCCATTTTGAATTGCTCTGATTCAGACTTCACCAATTGCTATTCATATTTCGGCG
GTTCAATCTGTTCCTTAAACACTGATCTATCCATTAATAACAATAATTTTTACAAAAGCTCTGCTGAATA
TTATGGCGGATCCATTTATTTCCTTTATGGAACTTTAGACATTAACGGCTCTCTCTTTTCAAATTCATAC
GGTCAGTATGGAGGCTCCATTTATATAAGAAGTCCTCAGACAATAAAGAACATTACAAATAATCAGTTTC
TATTTTCTCAAGGCATAAGAGGCCCAAGGATATATATCGACCAATATTATGGAGAAATCTCCAATAGCGG
CAATGTTTATACCGATGAATATGAAGAAAAGGGATTGTTTTCAGATTATGGAATGGGAATTTCTTTTGAA
AGCAATGAAGGTTTGGTCCCATTGATTCACTATTACCCTTCAAACGAGTCATTGCCTTCATTCTATGACC
CTAGAGGTGGTGGAGATTCAGAAGATGATTATGAAGATGAGGATGATGATTCAGATATAGCTGTTAAAGA
CCAAGGCATTGGAGGCAACTGTTGGGCATTTTCAGGAATTGCAACCCTTGAGGCATGCCTTGAAAAGGTA
ACCGGAGAGGAATTCGGCTTTTCAGAGGGCAATGCTAAAAACCTTATGGCCATATCATCCATTTATGGCT
TGAACATAGACACAAACAATGGAGGATATGACACAATGTTCCTTGCTTATCTTGCAAGCTGGCTAGGTCC
TATCTATGAGGAATATGATACATATAATCCATTATCCTCCCTATCCATAGATCTTCCTTCAGTATTCCAC
ATTCTTGACATTGATTTCTTGGCTCCTCGTAAAAACAGCTTGGATAATGATGAGTACAAAAGGGCGATAA
TGAATAACGGAGCCGTTTCAGTGACCTTCGATTGGGTGGAAAATAAGGTTTCCAACGGATTCCATTCAGT
TTCCATTATAGGATGGGATGATGATTATGATGACATTGACTCCTTAGGAAACTATGCAAAGGGCGCCTGG
ATATTTAAAAACAGCTGGGGCTATGAATGGGGAGATGGCGGTTTCGGATACCTTTCCTATAAGCAAAAGC
TTTCAGAGGAGATAGCTCCATATATGCATGCATATACATTTTCATTTAAGGAAAATGACATTGGATATAC
TGACATATATCAATATGACTTTTCAGGATTAAGCGATTTCCTGATTTTAAATTCCACAAATGCCTATTAT
AAGAACAAGTTCATAGCAGAGGACAATGAATTCCTATATGCATTTTCCACATATTTTGATAAGGAGACCG
ATTTCACCTATTCAGTTTCCATAAATGGCAATGTCATTACAAAAACAGAGGATGGCAAAGACATATTGAC
TTCTATCCATCATTCTCCGGCTGGATATCATACCATTCCATTAGGCTATAACCTGACCTTGAAGGAGGGG
GATGAGTTTGAGATAATCATAAAATTGCTGAATGACAATCAAAACAGGATTCCTGTTTGCCAAGCTGATG
AATTGTACAGAACTTCACTGCCTTCAAATGCATCTTTCATGAGTTTAAACGGCAAGGATTGGATTGACTT
GAGCAATTTAGCTTCATCCAATGAGTTCTCTTCACTTGGCATCAAGGCAAACACTTCACAAGTAGCTTGC
ATAAAGGCATTCACTTCCAATTGGAGAATGAATTCGGATTCCTCTATAGTGAACTCTAAGAATCATAGCA
TAATCACCTCAGAAGGAACAGAGTTAAGCCAATATGAAATATGCCAGCTTAAGGTAGGCTCATTTACAAG
GGCTTCAGCCAATGAAACTATCATTATAGCCATGAGCATTCCAGAATGGAGAAATTATCAGGATGAATAT
GAAAATTATATAGAGGTTCATATCAATGATGAATTCTATTATGTAAGGGTCAATGAGGGAGTTGCCTATT
TGGATATCAGCTTTGATAAGATTGGCCATTATGACTTTAAGGCCCAGTTCAAGTCCAATATATACTCATC
TGATATTGTAGAGTTTGATTTTGAAGTAGTAAAGGATTCAATCTTTGATGTTGATGATTTGGATGCCTCA
AACCCAGGAACTTTCAAGGAACTTCAGGATATAATTAGAAATGCTAAGAACGGTTCCATAATCAGTTTGG
ATAAGGATTATGCTTTCTCTAGTGGTGATGAGTCTGTTGTTGATGATTATATAGAGATAAATAAATCTCT
AATTATTGATGGAAAAGGCCATATAATTGATGGTTCTTCTGATTCAGGCATTTTTAGACTAAGTTCAGGT
GATAATCTTACTTTGAGAAACATTAAGTTTATGAATGCAGATAATGGTGCAATAGTTTCTAATGGAAATT
TGACAGTTTCTAATTGTTATTTCATTAGTAATTGTGCTTCTGGTTCTAGTTCTACTTCTACTTCCAGTTC
TGATTCTAGTTCTACTGCTTGTGGAGGTGCAATTTACTGTGAAGGCACTTGTTTTATAGTGAATTCTCTA
TTTGAATCTAATTCTGCAGATGCCGGTGGTGCTGTTTACTGTGAAGGCACTTGTTTTATAGTGAATTCTT
ATTTTGATTCCAATTATGCAGATCTTGGTGGTGCTGTTTGTTGTGATGGCAGCTGTTATATAGTGAATTC
TCTATTTGATTCCAATTTTGCAGTTTATGGAGGTGCAGCTTCCATAGTTGGAAATGAATCATGTGAAATT
ATAGATTCAAACTTTATTGAAAATGAGGCCATCTATGGCGGTGCAATATACTTAGAAAGCTATTGTTATC
TTTTAGATTCAAGTTTCAATTATAATTATGCAAACAATGGAGGCGCCATTTATTCTATAGCTGACCTTGA
CATTCATACCACTGGCTTTAATTACAATGAAGCCTATAAGGATGGAGGTGCAATCTATCTTGTAAACAGC
ACATCCTATATCAATGAAGGAAATTTCACTGAAAACAGTGCTAAAGAGAGGGGCGGTGCAATATGCGCAC
TTGAATTCTCAAATCTAACTATTAGATGGGCTTATTTCATGGATAACTCTGCTTCAAAGTATGGAAGTGC
AATCTTTTCAGTAAATGCCCTTAACATTACAGATTCTGAAGTGACTGTAAGTTCTGGTAAGGTGGAACTT
ATCTGCTTTGCTTATGATTATGCTTCAAATGGCCAGGCATATGGAGATTTATACTTTGATGAAAATAGCT
TTTATATCAGTGGTGCTCCTGAGATTTACTACTTCAGAGAAAAGATAGCTCATAAATTAGCCTTGGATCT
TGAGTTCAATAATATAGAGCTTATCAGAGGAGGAGGCGTTGAGATATCCAGGGACTTGAATGATGATGGC
TGGGAGGATAAAATCAATAACAATATGCTTGAGATATGCAGATTGGTTGATGACGATGATTATATGACTG
TCCTTAGAATGAAGGAGATAGAAGTGATTCTAATAAACAAGAACAATAGATCTGACATTCAAAAGTTTAA
GATTCCATTTAATGTCAAGCTTAATGGCTATTTCCTTAACACTTCTTCATTGAAGTATGGCTCTTATATC
CTTACTGGAAATCTTTCTAAGGATCTTGCAAGCAATTGTATTGTAAAGAATGGAACTTTGAAAGTTTTAA
GGAAAACTACCCTCTCTTCTCTGTCTACTTTCACTAAAGTTTATGGAAATAGTAAGAATCTTGTAGTTAC
TTTAAAGGACAGTAGTGGAAAAGCTATAGTTGGTGTTAATATTGCTGTTAAATTGAATGGAAAAACAATT
AAAGCAAAGACTAATTCAAAGGGTCAGATTTCCATAGCCATTAGTCTTAAGCCAAAGACATATACTGCAT
ATATCAGCTTTGCAGGCAATGACTATTATGCAAGCGCAAGCAAGAAGGTAAAGGTAGTTGTTAAAAAGGC
AAACCCTAAATTGACTGCCTCTAAAAAGACCTTTAAGTTAAGGAATGCTAAAAAGTATACAGTCACTCTT
AAGAACAACCTTGGAAAGGCATTGAAGAATGCTAAGGTCACTATTAAGGTGGCTGGAAAGACTTATACCG
CTAAGACTAATGCCAAAGGTCAGGTAACATTCAATTTGAAATTGGCTAAAATAGGCAAGTTCAAGGCAGT
TGTTAGCTTTGCAGGTAATAAGCTTTATAATGGCTTGAAGAAGGCGGTTGTTTTAACTGTTAAAAAGTAA
ATAGATTATTATTTTTATTTTATTTTTTTATTCTTTTTTTAAAATTTAATTATTAATTCTTTCTTAACCA
AAAACTTTATATATAACAATAGTTATATTATTATATACAGCATATAACAATTGTTATATCTCGTAATTTT
TATAATTTAATCATTTCTAAATTATAAAAATTTCTTTTTATGATAATATGCCTCCTCATATTATCGCTCA
ACCACAAATCAAACACACACAACCAAGGTTTTTTTTATCAACAATCCGTTATGATTTTAATAGCTGAGTC
CTCGATTAACTTATTTTAAGCAGTTATTAAGGTCATATAATTTCTTTTTTTTAGTTTTCTATTTTTTTAT
TTGGTTCAATATTTTTTTTTTTAAACTCTCTTTTCTTTAAAAAATTATATTAAAAATATCGGTTCAATAT
TATAATATGGAATATGAGAATATACTGGACTTGAAGAGCTCTGAAGAGTTTAGGGAGTGGATGATAAAAA
ACCATTCCAGCCAAAGGGAATGCTGGGTCAACTGCAAAAGGGGAAAGGCCGATAAGGATGAGTTGTCCTA
TGTCGATGCAGCCTATGTGGCATTGTCATTCGGATGGATCGATTCCACCTATGGGCTGATAGATGGAAAG
AGAATGCAAAGATTCTCTCCAAGGAGAAAAAACAGCAATTGGTCTCAGCTTAATAAGGAAAGATGTCGAT
GGCTTATAAGAAATGGCCTTATGACAGATAGCGGATATGAAAGCCTTCCCGATTTAGAGGAAGATTTTAT
TATAGATTCAGATATTTTAGATGAATTGAAGAAGGATAATGAGACTTGGAATAATTTTAAGAACTTTCCA
GACCTTTATAAAAGAATAAGGATAGCTAATATTCAAAAGGAAAAAGATAGGGAAGCATTTGATAAAAAGT
TGGCTAATTTTATTAAGGACACAAAGGACAATAAGATGAAAGGAAACTGGAATGATGATGGAAGGCTTAT
ATGATTTTATTTTTTTATAAATAGTTTTATATGGTAAACCAAGGATTATTAGTTATTGTTTTTTAATATA
AAGCATTAAATAGAAGGATAAATAATATTTATTCATGGCAAATGAGATAATTTTAAATATAGATGGCAAT
GAGCATCAAATTAAATATGATAATATGGAAGTAGATCATGTTTCTATAATAGATCTTGAAAAATTGGGAC
GTTCATTGATTTTAGAATTGGAAATAGATGGAAAGGTGGATAGGAACTCATTGGATGATGCTATCAACAG
CTTTTTAGATACAATCTATGATGATATTAAGTATTTTGCAGTAGAGTATGCAGATGATAATGAAATAGAA
TTAATATGAGAAACCCTAAAGATTATATTATGAAGACTGATTATTTGATTATTCTTATGGCCTTATTGCT
GATTTCTATAGTTTCACCTATAGCAGCTGCAGATAGCTTTGATTTTGATATTCCAGAGGGCTATCATATA
GAGAATGCAAGCGATGATTTCGTACTATTGGAGAATGAGGACTATTATAGCATTTCAATTTCCATTATGG
ACAATTCCACAGACAGGAAGACTCTGATGGATATGCTTGAAAGGCACAGGTGCTATGACTTTAGAAATGG
TGTCAATTATACCAAAGGGGATTTTTATATAGAGGAGAAGCCTTATTATCAGGAGTTCCAAATGGGAATT
TTGTACTTTTGTGAAAATGGTAGAGATCTTGTTGTGATTGATTATAAGGGACCTTTAGGTATGGATTTGA
ATAATAGTCCTATAGATGGCATTTTGGATAGTTTTAAGTGGGTAAGTTATTAAATTTAAAAATAAATAGT
AATACATTAATATTATTAGTAATAGACTTTAATTTATATTTTCTTTTTTTGAGGGGGTAGTGTTTAAAAA
AAATAATATTAGTGCTATAATTTTTAAGTTTATTTTTTTTAATTAGATATTTACTTTAAAGAATTACAGA
AGGGTGATATGTATGGGACAAGATGGTTTTAAAAACGAAGATTTAATGTTAGAAGCTTTAAATAATAAAA
AATTTATGGATTTGAACGATAATTTAAAACAAATGATTTTAGATATGTATGGTGAAGAAATTTCTCAAGA
TTTTATTATTAAGGCTTATAAAAAAGGTGGAGTAAATAAAACAGATTTGACTATTGATATTAATTCTCAA
AATTTTAATGTCAGTATAAAAAAAGGAACTGGAAATAGTGTCCATCAAGAAAAATTAGAAGAGTTTGTTT
CTTTTTTAAAAGAAGAATATGGTATTTCTAATGTATTATCTGATGATATAAGGTTTTTTATTTGGGGTGA
TGGAACTTTAGATGGTACTGGTGAAGTTTCAGATAGATTAAGCGCTTCTGAATTTAGAAAACAATTCCCT
GAAAAAATAAGAAATATTAGAGAATTTTTCTATACTGTTAAAAGAGATTTAATAGAACGTTTTGTCATTA
AAGGACCTAAATCTAAATCTAGGCCTGATTTTATTTATTATGGAACACCAGATAAAGGTATTATTGTTGA
ATCTCAATCCGTTATTGATTGGTTATCGGATGATAAAAATGAAAAAAGCAGCTCCCCTATTCCTATAGGC
AGATTAACATTCCAAGCATGGAATAGGAATATTAATGGTGGAGATAAATCTGAAAATAAAAGAGGGGTTA
TTCAATTAAAATGGAGTTCAGTTGGTAAGGATTTAGTTAAGATTTATAAGGAGAAAAAAGATGACAAATA
GAGGAACTGCAGAAGGTACAGAAGAAGAAATATCCTTTGTAAAATTATTAAACAAAAAAGAGGACTTATC
TTATTGGGATGTATTAAATTTAGATCATAATTGTCATTTTGCAATACATGTTTTATATCAAAAATTTAGT
AAAATAAGTAATAAAAAAGTTTATCCTAAAGCAGATGTTTATATTGCTAAAGGTAATGTTCCTTATAGCT
ATTTAGAAGATAATGATTTCTATCTAAGCGAAGATAATACAGAAGACTTTGATTTGGAACCTATAAAATA
CACTGGCATTTCAGTCAAACTTCAAAATTCTAGTAGATATCAAATAACAAAAATGGGACCTAATACATTT
AAAGATATTTTTGGTTGTTATGAATTGGGGGCTGGAGCTTCAATATATTGTAGAGATGTGGATGATTTAG
AAAAAAATCCTCAAGTCTTAACTGGCTGGAATACTAATTTTGAAGACTTTATAAAGTATTTTAAATCTTT
TGATGTAGTTTCCAGCTCAGATTTAGATATTTCTTCATATAAAAAATTAAAAGTTTTTCTAATCAAAAGA
TTGAGGAAATGATTAATAGTAATGAAGAAATTGCAGGATTTATATTTCAAGGAATAGGAAATTTTGAAGA
ACCCTTTACTGTCCATTATTTATATGAGAATGGTGAATTAAAAGATTCATGTTATATTCCATTTAAACCT
ACTACTGGATCTGGTAGGAGTAGAGGTGACTTTACTATTGTAATAAAACCTAAAGGGAGATAAAATATTA
ATTTAAATATTTTATCATTTCCTTAGCTATCAAAGTAACAACTGGAACAGTTACACTGTTTCCAATCTGC
TTATAGCTTTGAGAATAATTATCTTTAATTTTATAATTCTCTGGGAATCCTTGAAGTCTTAAACACTCAC
GAACAGTTAATTTCCTATTTTCATTTACTAATACCGGGACATTATTGCCACCAGTACCCATTTTAGCAGT
TAAACAAGGAGAATTGCCATCATTCCTAATAGAACATCTTGAAGGCCTAATTTCTGTAGCGAAAATGGGA
TAATTTTTATTAACTTTTTTATTTTTTAAGAATTCTTCATAATGCTTTTTTAGATGATCTGAAGCAATTC
CACTTAACTCATGATCTTTAACATTTTTTTCCAATAAATCATTAATATTGGCTTTATTTTCAAAAGGTAA
TGGGAACTTGAATGTATTTACATTGTCTTTAAACCCAACTATGAATATTCTTTCCCTGTTTTGAGGGACT
CCATAGTCTTTTGAATTTAAAACTTGGTAAAATATTGAATATCCTAAATTCCATAAGGATTCCTTGATAA
CTTTAAATGTTTTTCCCTTGTCATGGTTTGTTAAGCCTTTAACGTTTTCCAGTAGGAACATTTGGGGTTT
TTTAGCTTTAAGTATTCTTTCAATTTCAAAAAATAAAGTCCCTCTGGTATCACAAAACCCTTTTCTATAT
CCTCCTATGCTAAATGGCTGGCATGGAAATCCTGCACATAAAATGTCATGATCAGGTATTTGATTTGCAG
GAATCTCACTTATATCTCCATGAGGATATTCTCCAAAGTTCATATAATAAGTTTCATTGGCCCATTTGTC
AATATCTGAACTAAAGACACATTTTCCACCTACTGACTCAAAGGCTAATCTGAACCCACCAATACCTGAA
AATAAATCAATGAATGTGAAATCTTTATCGTTTTCTTCAGTTTCATCAAGATTTTTCTCTTTAAAATCTT
CTAATGTGTATTGCATTGCTCTTTTTTTTGAAACCATATTAATTCCTTTTTAATTTAACTTTTTTATAAT
TTGCTTTCCAATCTCATAACCTAATAATGGAGGAACAGCGTTAGCTAGTTGTTGATGTTGTGCAGTTTTA
TTTCCTTTAATTATAAAACTATCAGGTATTGATTGTAATCTAGCTGCTTCTCTTGCTGTAATTACTCTAT
TGAATGTTGGGTGAATTATCATAGATTTAATAGCATGTTTGATAGTTATAGACGGTTTATTTGGATCTAA
ACGTCTGTAATTATTACTATGTGTTCCACCAACATCATAGATTTCTGGAGGAATATCTTGCCAATTACCT
CCTTGAGGAACGTTTTCAATTCTTTTAAGCACTTTTTCATTATGTTTCATAGCGTCATGGTTATAGATTT
TCTTTTCTCCATCAGCCATAAGCTCTTGAAAGCTATTTGTTGGCTCATCATAATATTCAAAATTTGTGTC
TGGAATGTTGCCTAATGCTTCCATAACAGAAACTTTTTTATCTTTTGGTTTTGGGAATTCAACATCTCCA
ATTCTAGAACCAATGAAAATTACTCTTTTTCTTTTTTGAGGAACTCCATGTTCTGATGCATCTAGTATTT
TATAGTTTGTTTCATAGCCTAATTTTTCGAATTCAGAGACTATAAGTCCTTTAACATCTTCACCATCAAC
ATTTTCCATAGAAAGAAGGCCTACTACATTTTCAATAATAACAATTTTAGGATTAATAATTTTAACTGCT
CTCACTACCTCTTGGAACAGTTCATTTCTTTTATCTCCAACTTCTCTCTTTCCACACATTGAAAATCCTT
GGCAAGGTGGCCCTGCTATGATAACATCAACTTTATTTGTGTATTGTTTAAAAAAATCATCATCTAATTC
TGTTAAATCTGCTAATATTCCCTCTGTGTTTTTATGATTATGTTGGAATGTTTCTATTGCAATATCCCAA
ATATCTATTCCAAATAACACATCGAAACCTGCCATTTCAAATCCTTTACTAAATCCTCCGATTCCACAGA
ATAGATCAATAACTGTTGGTTTTTCCATTTTTTCAAATCCTTTTTATTTTAATAATTGTTAAATATTTTT
TCTTTTAGGGTTGTTGATATTAATGATTTTTCGCTTAGCCAAGCCATAGTTATATTTTTTATAACTTCTG
AATCACTGTTTCCTAATTCTCCTTTAAGTTTTTGTAATAGTTCATACTGTTCTTTTGTAAAATTTACTTG
TATTCTTTTCATTTCTTTACTCATATGTGCACCACAGTTGTGTATAATTAGAGTATATTATATTTGTTTT
AGTATATAAACTTTAAAAGAGCATGTGAAAAATATTATTGTAAAAAAATTTAGGCAATTAATAAAATATT
TTTAATCTCCTTTAATTATCATTGTAAATATTATTTTTTTTATTTCATAAAAACTTTATAATATTAAAAA
TAAAATTTTTATTATATTCTGCCAATTCTTACTTGAATGAAATCATAAAGACCACATTGATTCTACTTTT
AAAGCAAGAGATAAGAAAAGAACAAAGACGGGGCATAAAGAACATACTTTTATACTTCCGTGATGTGGAT
ACGCTGGATACAAATTCCATAAATTGGAAAATCCGCTATGATAGGAATAATCAGAATTATCAGATGATTG
TCGGCATTTGCTATCTTACACTTAAAGGACTCCTCCAGTCTGATAGTAAGGGTGAAAAGAAGCTTATGAG
CTTTTTGGATAATCAAAGGATGAATAGGCTATATGAGAAATTCATTTTAAATTATTATAAGAGAGAGCAT
CCTGACATCAAGGCTTCCTCTCCTAAGATAGAATGGCAATTGGACGATGATTTTGGTGAAATGCTTCCTC
GTATGCAGACAGATATCACTTTAGAGCATAAAAATAAGATATTGATTATTGATGCCAAGTATTATTCAAG
CACCACTCAGACCTATTATGATAAAAAGACCATTCATTCACACAATCTCTATCAGATTTTTACCTATGTG
AAAAATAAGGAAGTTGAAGTGGCTAATGAAGCAAATGGAGTGGAACTTGACAATAAGGTTTCTGGAATGT
TACTTTATGCAAGAACAAGAGAAAAAATATATCCAGACAATGATTATTTAATGAGTGGAAATAGGATAAG
CGTTAAAACCCTAGATTTAAACCAGGATTTTACTTTAATTAAGAAACAATTAGACAGCATTATAGAGGTT
TATTTGAAGGCTTGATTTTTTTCATATTGATAAATTATTGATAGAAAATTTCATATAATTTAATCAAAAT
AACACCTAATTAAAATACAAGTTACCACTTTTTCTTTTATTATATTAATCAACTCTTAAATTAAATCAAT
CACTATATGCAATATTATTTTTTTAAGATAGTATATCTACATCTAGCAAATAAAAATAATAAAAATATAT
AATCTATCCCCTATCACAAGTGATGAATAAACCCCGTCTGTCATTGAAAGCAAGAATTTTTTTTATTTTG
TCCGATTAGTTTTCACACGTCTCTAGGCACCTTATTTACTTTAAACTATGCTTTTGATAAACTATTATAC
ATGGAACATGTTATTTAAAAGTGCCAAACCCGTAAAACCTTTTTTTAAAGACATGTTCTTGAGATTATCC
TATGCTATTTTTAACTCTTGGGATAATCTCCACCCACTCTTTTTTATTTTTTTATTTTTTTTATCCTAAA
AGCCATTTTTTCCTTGATAGAAAGATATGGATAGATTTAAGAATTTATAAAACAAATATTAAACTAACTT
TTATTAGTTTTTAGACTTTTAGACTTTTTAAAATTTTTATTTTTAGACACATAGGAGGATAAGAATGAAT
AATAAAAAGATATTTGTGGCCGGATTAGCCATATTGGCTATTGTTCTAATGGGATCAGTTGCTGCAGTTG
ATATGGGCATTCTTAGCGGAAGCCCAACCAAATTCAGCATTGACGGCATCGACTTCAATATTCCACAGGG
ATATGCAGTTACTGACAACTATACAAGAGTGAATGATACAGACACTGCTGGAAGCTCAAGCTATAGGGTT
ACCCAAGCAACCTTTGAAAACAATGTACATGATGCCATTTCAGTTCTTGTAGCTGATTATGATCATGACA
TGAGTGAGGATATCATATCTCAAAGAGGCAATAAGACAACTATAAATGGTGTGGACGGATATATGCAAAC
CCAAGGGGATTATACTACATTCAATTATCTTGTTGATGGGAATCTTGTGACAATCACTCTTACAAATGCA
GATTTGCTTGAGGATATTATTGTTGGTAATCAGACAGATGACTGATTGTTTTTTTTTTAAGTGTGAATGA
TTTTTCCACTTAACTTTTTTTTATTTTTTAATTTTACTCATAATATTTTTTTTAACTTTTTTTATTTTTT
AAAAAGAGAAGTTTAGATCTTTTTGATTGCTATTTTTTATAAAAAAAGAGTTTATTTCATTAATTAGCTA
TTTTTTAAAAAGAGTGTGTTAATTTTTATTCATTAGCTGGTTTTAAAAAAAGAGTGTGTTAATTTTTATT
AATTATCGGTTTTTAAAAAGAGTTTTTTTATTAATTATCTTGTTTTAAAAAAAGAAAAAATTAGAAGTAG
ATTATTTTCTACTTCTTCTTACAAAAATTAAACTTGAAAGCACTATTAACAATGCCATTATAGGATTACC
TGGAGCTGTTTTATCCATTGGCATCGGCTTATTAGCTGAATGTTTTGCTGGAGCTACTGGATTATCTGGA
CTTACTGGACTTATTGGAGGCACTGGATTATCCGGAGTCTCTGGAGTTACAGTAATAAATCCAGTTCCAT
CAGCCTCTAGGAATGTATCATCTCCATCGAATCTTACGCTAACGGAATAAGTTCCATTATAATCCTCTGG
GACTGTCCATTCCACACTGCCTTCACCATTAGTGATTTGGGCAGTGACTTCAGTTCCGTCTGGCAATCTT
ACAGTTACATTTCCATTAAATAAGGATTCTTCTGCAGTGATTACTTCAATAGGAATTGTCACCTTATCTT
TTGGTTTTGCTGTAATGTTTCCAACAATTATTTCAACTGGGATCTTGGAATCAACCTTAATTATAGCAGT
ATTGTTTGATGGGAGGTAGGTTTCGTCTCCTTCAAATCTTACTGTATAATTATATTCTCCATTATAATCA
TCTGGAACAGTCCATGTTGTGTTTCCAATGCCCTCTGTGATTTCTGCTGTTTGAATTGTGCCATCAGGCA
GTTCAACACTTACTTTTCCATTGAATGGAACGTCATCATCAGTTTTTATTGTGATTGGAATTATGATTTC
TCTGTTTGGCTTTGTTCCAATGTTTTCAAGGTCGATTGAAGTTGGGATCTTTTCGATTGTAATGTATCCT
GTCTCGCTGGCAGATAGATATTTTCCATTGCCGTTGAAAGTGACTTTTATTGGATATTCACCTTCGTATC
CCTCTGGTACAGTCCAATTGAGAGCAGCTTTTCCATCCTTGACTTGAACTTCAACGGTGGAATTGTCTGG
TAAGGTTATATTGACATAGCCGTTGAAATTATCTCCATCATTAAGATGGTTGCTGGATAGAATGCCTTTA
GCTGAACTGATATAAGCCTTTAATAAAGCCTTATTATCATTATTGGATAAAACACCCTTATTTAGATTGT
TATCAGATAAAGCACCCTTATTTAGATTGTTATCAGATAAAGAACCTTTAGTTGAATTATCAGACTCACT
ACCATCATCTATAGCAACATTAACAGAAATAGTCACATCCTCTTTTGGATGAGCAGTAATGTTATCTATA
ATGATGAGTAATTTTATCTTTTCAACTGTTAGGGTGCTTGTTGCATTTGAAGGCAGGTAATTATTATCTC
CATCGAAAGTGAGGGTGAGATTATAATCTCCTACATCCAAATTGTCTGGAACAGTCCAAGCTATGTTTCC
TTTTCCGTCTTTAATCTCTACAGTTTCTTTAGAGCCATCAGGTAGATTCACTGTTATATTTCCATTGAAT
GGTACATCATTATCTGCTGTGACATTTACAGAAATATCTATCTCCTCTCCCGGATAGGCATTAGGAATGT
CTGCTGTGATTTGAGTACTGATCTTTGCTATGACTTCAATATTGGCTGTGGCATTTGAATCCAGATAGTT
TCCACCTCCAGGATAACTTGCGCTTATGGAATAATTGCCCTTATAATCATCTGGTACAGTCCAATTTACA
TTTCCTGTACCATTGATTATTTCTGCAGTTTTGTTTGTGCCGTCTGGGAAACTTACAGTTACAGTTCCAT
TTATAAGCTTAGCATCTCCTGCAGTTATGTTGATTTCTATTTCCACATCACTGTCTGGATAAGCAGTCAC
ATTAGATAGGCTTATTTCAGTGTAATATGGAATAACTTCAATATTTCCTTGGCCTTCAGATTCTAAATAA
GTTCCATTGCCTTCATAATATGCAAAGACACTGTAGTTTCCTGAAGCATAATTATCAGGAACATACCAGA
CTGTTTCTCCAATTCCGTTTGTGATTTCTACAGCTTCATTTGTCCCATCAGGGAAAGTAATGTTTACTGT
TCCATTAATTAAGCCTTTATCTGCAGTTATGTTGATTATTATTCTCACAAAACTGTCTGGATCGGCAGTC
ACGTTTTCTAGGCAGATATTGGTCGGAATAGTTTTAGCAACGGTTTCTTCAGACCTAGCTTCTTTATTAG
CAACTCCTGGACTTGAGACATTTACAATATTTGTGTATTTGCCTTCTTTGCTTATCTCAACAATAAATTC
TAAGATGGCGCTTTCTCCAACGCTTATGTTATTGTTGTAAGTGAATGAAGAATTGTCCTTGTTGTAAGTC
CAGCCTTCAGTGATAGAGGATTCATCCAGTATAAATGCAGGGTCCAGTTCGTCTTTGACAATAATGTTTG
TTAAAGTTCTATCTCCAGTGTTATCTATAGTGACAGTGTATTTTACAGTATCTCCGATATATATTTCAGT
GTCGTTTACTGTTTTTGTCACTGTCATATCCGGCTTGTAGACACAGACCTCTGGAGCTTCAGCTGTGATT
TCAGGATAATCTGAACTTAATATAAGCTTAGCAAGGTTAGTGTAATTGCCTTTTTCATTGATTGTAACAT
TGAAGCTAAGGTTTAAGGTGTCTGGATTGTCGCTAAGATCGAAAATGAAAGCATTTTCTGTTTCATCATA
ATGCCAATTCTCTGAGATAGTGTCCTTATCCAATGCAAATGTATCATTGAAAAGGTCTTCAACCTTTACA
GGGCCTTGATATCCGCTTAAATTAATGAAGATATTATACTCAACAGAGTCTCCTGCATCAATCTCTCTTG
AATTGACTGATTTGTTCATGAGAGCTAATACAATGACTATTGAATCATCCTCTTTATCATTAATGTTAAT
ATAGACATAATTGGAATAAGATCCTACCTTGCTTGTATTGAAGTAAAGCTTAAAGCTTGCAGATTCTCCT
ACCTCTAATGTTGAATTCAATGTAAATGAAAGGGAATCAGTTTCAATATTCTCTATCCATTTGCCTGTTA
TATCTTCATGACTGAGGTAAGTTAGAGCATCTTCATCATAGTCGTCGTTTACAACAAGTTCATAAGGATT
AAATGTCTTATCTCCAGTATTGGTGATATTAACAATGAAAACCGCTTGTTCTTGAAGATTTACTGTTGAA
TCTAGGGCAGTTTCAGCGATATTTGCATCACTTATTCTGACATGAGTGACATCAGACTCAGCACTGACTT
CAGGCAGGTCACCTATTTTAAGGGAAACTGTGTTGGTGTAATTTCCTCTTTCAGTGATATATACAGCAAA
ATTGAATTCAAATGACTCTGGAATGTCGCTTAGCATATATTCAAAGGCCTTTTCATCTCTATTATATTTC
CAATTTGAGGAGATGCTATCTTTATCCAAATCGAAGTATTCGTTTAAAATGTCGGTGACCTTGATTTTAA
AGTCATCAATGCCTAATTTATTGGCTCCTGTCATGTCGATGTAAACATTGTATTCAACAGACTCTCCCAT
ATCAATTTCAGTGGCATTGACAGTCTTTTCAATTCTTGGAACAACTGTGACAGTGGCATTTGCCTCTACT
TGAGGATTCGGATAGTTGCTATAGACATTATTGGTGAAATTTCCAATTTCTGTTGTTAAAAAAGATACTA
TTATAGCAGCAGATTCACCTATATCCAGCTGGTCCAAGCTAAAACCGTAATCTCCACCACGATTTGCAAA
AGAGTCCCAATTTCCACTTATGTTAGTGAACTCATTTAGGAATAATGATTCTTCAGGATCTTCATAGATA
CGCAAATTACTTAATGGCCTATTTCCGTTATTGGTAACGTTGATTGTAAAGTTTGCTATTTCTCCAATGG
TAACGATTGGATCATTGGCCACTTTTGTAATTGTTAAATTTGGAGCATAAACAGTCACTTCTTCGGATAA
GAACTCTTGAGAGCTTGTTAGGTTGGAGCTTACATTGATTGTGTTAATGTAAGTGCCTGTTTTATTTCCT
GTCATACGTATCTTGAGAAGGATGCTATGTTCAGGCTCTAATGCTTTTGTATAATTGAATACATTGCTCT
CATTTTTCCAATTTGGATTGTCATCAGCAAACCAAATATATTCCCATATCAATCCATCAGGGAAGTTTTC
AACAACACTGATATTGCCTATGCTTTCTTCTAGATTGTTGGTTATGTTGATGGTATAGTAGATAGTGTCT
CCAATGTCGTAAAATCCGTCTACAGGCATATGGTTAGAGCTGTTATCAATTGTTTTTGTAACAGTGAGGC
CAGTATTGGATTTTAGTGGGCTTTTAGTGATGGATTGGTTTAATCCATTATCTGTATCTACAAGATCTTG
AGTGGGATTAGCAGATTCATCTATTGAAGCGTCATTCTGACTAGCAGAGTTGGATTCAGCCTTTAAAGCA
TTATTATTGTCATCAGCAAAGTTAACGTCTGCTATCAAAGCACCATTATTGTCATTGATTCCAATATCTT
CGGACATATCATCGCTTGCACTTGCAATGTTAAGACTTAAGATAAAAATAATCGTTAGAACAATGATTAA
GTATTTCCTTTTCGTTTTTTCACCTCCTTTTACAGTTAATTAATAAAAACAGAGTAAAATAAATATAATA
AAATAATCTACTCATTAATATTTATTAAACTATTTAAATATAAATATTTTTAAAAATAAGGTGAAAGATG
GAACTTATCAAGAAAAATAAGGTTTTAAAATACTTAACATAGAAAACCTAATTAAAGAATGCCATTATCA
ATCCATGTCTACTTAAGAAATGCTATAATCAATCCATGTCTACTTAAGAAATGCTATTATCAATCCATGT
CTACTTAAGAAATGCTATTATCAATCCATGTCTAAAAATGAGTCTATTTCATGGATATTGTCAGATTCAT
TGTTTTCGATGGTGGAAGTCGTAATTTTGTATTTTTTATTGTTTGAGAATATTCCTCCACCTTTGTTTGA
TATGTTTTCGGTGATTATGGAGTCTTTGATGAATATTTCTCCATCGAAATTATGTATTGCGCCGCCATAC
TCATATGATTTGTTTTTATTGAGTGTGGAGGATATTATGCTTAATTTGTTCCAGCTGTGGATTGCTCCAC
CTATTTTTGCTATGTTTTTTGTGATTGTGGAGTTTTTTATGATTATTTCTCCAATATTATTGTATATTGC
CCCTCCTTGGCTTGATGTGTTTTCTTCTATTGTGCTTTCGGTGATTTTTAACTCATTGCCATCGTTGAAT
ATGGCTCCACCAAAGTCTTTTGCATCGTTTTTTCTTAATGTGGTGTTTTCTATGCTTAGAATGGCTCTAT
AGTTGTGGATTGCTCCTCCTTGCTTTGCGGTGTTTTCATTTATTATTGATTCCTCTATGCTCATCTTGCC
TTTATAGTTGTGGATTGCCCCTCCATTTGATTTGGCATTGTTTTTTGTGAATGTGGACTTTATTATTTCC
ATTTCTCCTTCGTCATTGTATATGGATCCGCCATATTTTGATTGGTTTTCTTTTATTGTGGCTTCTATGA
TTTTTATTTTGCCCTTTAGGTTGTATATGGCTCCTCCTATTGTATTTGTTTTTCCATTTTTTAATCTAAT
GTTTTTTATTGTGATGTTTTGGGCTGTGGAATAGAATATTCTTGTTTTTTCTTTGGCGTTAATGATATGG
CCATTTCCATTGATGACTAGATTGTCTATGTTCAGTTTAATTCCATCTGAATATTTTTGCTCTTCTTTGT
CCTCTAGGATTATGTCTGAGTCTAGATTTATTTCCTTTGCACCACTATGAATCAATTCATCAAGATATTT
GAAATTATTAAAGTCCATTATATCACCACTTAATACTATTTTTGTATTTTATATTACTTAATTTATAAAC
ATTGGACTTAGGATTATGAGCTTTAGATAAGATTTAAACTTAAATGATTTTTTAACATTGGTGTTAAGAT
TATAAACTTTGAATTAGATTTAAACTTTAAGGATTTTTAAAAGTAATTTTAATTAATAGAAAGTCAATAG
TTAATAATATGGTGTTTTTATGAGCAAAAGTTTTAGAGACCTTGAATTATTGATAGAAAATTGCGACGAT
GAGATAGTTTTGGATTCAGACATTGTTTTAGGAGATGGTGAAGGCCCTATTTACTTAGAAGGCATTAATT
TGGATAGTGATGTAATTATTGATGGGAATGGACATTCAATTGATGCATGTGGGAAAGTGAGAATATTTTA
TTCTTCAGGAGAACTTACAATTAAAAACATTAGCTTATTGAATGGATACTCTGATGAAAGCGGAGGTGCC
ATAGTGGTAGATGGGGGAAAGATGGACATAATTGATTCTATCATCTCTGGAAACTATTCTGCTGATGATG
GAGGGGCTATACACATAGAGGAAGGTGAATTGGCCCTTATAAACTCCACAGTTAAGGAGAATAAAGCAAA
GGAATTCGGTGGAGCAATCAATAATTGGGACAGCTTGAAGATTGTAAACTGTGAAATAAGCTCAAATGAG
GCACGTTTTGGTGGAGCAATCCTTAATAATGATGGCAATTTAGAGATAAGCGATTCTCTTTTTAAAGACA
ACAAGGCAGATAAGGGAGGAGTTATCTATAATCAAGATGGTGACTTTTCCGTTGAAAAAACACTCTTTGA
GAAAAACAAGGCATCTGCTGATGGCGGAGTATTCTATAATGAAAATTGTGATATAAGCGTTATTGAATCC
AAATTAAATGACAATCAGGCAGATAAAGGTGGAGTTATCTATAATAATGGTGTCTTTATCATAAAGGACT
GTGAACTTATAAATAATAGGGCAAATGATGGAGGATCTATTGTCAATTATGAGGCAGAGCTTAATGTAAT
GGGTTCCAGTCTTAGTGGAAATCTTTCTAATTATGGCGGGGCCATATACACTTATGATGGTGAGATGAGC
ATTGACGAGTCTAGATTTGATGATAATAGGGCAGAATGTGGTGGAGCTATCTATAGCGAAAAGTGCATCT
GGGATGTTTCTAATTCAGAGTTTAATTCAAATAAGGCTAAAAACTCTGGCGGTGCTATATTATTGAAGAA
ATCTAAATATGAAGTTGATAATGTTAGTTTTAGGGATAATGAGCCTGATGATGTTTCAAACTTTTAGAAA
AAATTTGATTATAATTTTTTCTTTCGGCCTACTACTTTTCCAAACTGATTATTCAAACTTTTAGAAAAAG
TTTGATCAAAATTTTCTTTTTCGGCCTACTACTTTTCCAAACTGATTATTTTCCCTAATCAAGTCACCAT
CAATATAGTATTTAGGCTTTCCATACATTCCTTCTTTTATATAGTTTCCTTCTATTCTATAGACGGGTTT
TCCAAACGGATTATTTTCTCTTACTATATCTCCGTCTATATAATAAATAGGCTTTCCAAAGAGACCTTCC
ACTATATAGTTTCCTTTTCTTGAGCTTACTGGCTCTCCATACATTCCTGCAGTGGTAATTAGGTCATCCA
TTATGTCTATAATTTCTCTCGCTTCTTTATTTAATTCATTATTATCCTCATTATCCTCATTATCCTCATT
ATTTTCGTATTCTGACTTAGGATAATTTATTTCAGACTCTTTTTTTTAGCGGATTGTATTCTTTATAGGC
AATGCTTTCTTTTATTATCTCATCTTCTGTTGCTATTTTGTCTTTTATTGGTGAGTCGATTCTATTTAGA
TAATCATTATAGGATTCGCCCTTTTTTGGATTGTATTTCTTATGGGACTCTTTTAAATCCTTATTGTGCT
CTTCTTTACGCTTTTCCAGATTGGAACCGCATTCTATGCAGAACTTTTGGTTCTCTTCTATCAATTTAGC
TCCGCATTTAAAACAGTATTTCATTTTATTCCTCTTTTATTGGGTTGGGTTCTGTATTTAAAACAGTAAT
TCATTTTATTCCTCTTTTATTGATTCACTTCCACAAGCAAAAAGATTTTATTCCTATTTAGTCATCTTCT
TAATATCATCGGGTTTATTGCCTTCCATATTGCAATTATTCAATTGGATATTTGAAACGTATGTAAATAT
AGCTCCTCTTTCCCCTTCTCCAATGTTTTCATTGATTGTGGAGTTGTCGATGGTCAGATTGCTTTCATAA
TTGTCTATCGCCCCTCCATTAATTGCGCTATTATTGCTTAGTGTGGATTCTTATCTAAAGTGATGTCTGA
ATCTAAAATGATTTCCTTTTCTCCTATGCGTATCAGCTCATCTAGATATTTGAAGCCTTTAGCTTCATCG
ATTTAATTTTCATCTGCTTCATTCTCATTAATCAGGGAGCATAGCTCATTAAGCAATGGACTTAAGTCCC
TATGTGTCCATCCCTTCCAAGATGAAAGGTTGTCCCTTATGTTTCTATATATTACAATTGCAAGGTCATA
CTTGTTCATTGTGTCAAATGCATGCTTTTCTCCTCCATGGAAATTAAAATAGCACTGTTCATTGTCTGCT
TCAACATCAAAGGTCCATCCCTCTCCATTGAAGTCAACATGGAAGTTTTCATCATTCTTTATTGCATTTA
CTATTGAGCTAAGGCAATCATAGGGCACATCTGTGATATATGATGCCCTGCTGTAGATGTCTCCCAGCTT
GACCAGGCACCATCCTGTTCCATAGATGTCTAGAAACTTGATATTTAGGTCAATATGGTGCAATGGCTTA
TTTTTGTCTTTTATTTCTTTTTTAAGGGGATTTTCCTTCACATTCGGACATTCATTGAAGATTCCTCCGG
CGATTACATCATTTGAGAGATTCCATGACTTTAAGGCAGAAACGTCACTTAAGGACTTGCATCTGTCAAA
CATCCTCTCTACAGTTGTGACATTTTCCAGATTCCAGTTTTCAAGCCCATTCAGGCTTTCTATAGAGGAG
CATCCGTCAAACATGCTTCTCATTATTATGACTTTGGAAGGCTTCCAGTTAGATAGCGGAGTGAGGTCCT
TTAGGGATTTGCAGTTTACAAACATATAGACCATGTCTTCAACATTTGAGACGTTCCAATCCTTTAATGG
GCTGATGTCAGTTAGGGATTCGCAGTTCCAAAACATGCGCCCCATTTTTCTAACATTGCTTGTGTTCCAA
TTGCTTAAGGCTGAAATGTCAGTTAAGGATTTGCATCCCCAAAGGAGACTTCCCATATCTTTTAGATTAG
AGCTGTCCCATGATCTGATGCCATTTATATCATTCAATGATTCGCATTCTGTAAAGAGACTGGTCATGTT
TGTAACATTGCTTGTGTTCCAATTGCTTATTGGTCTAAGGTCCTTTAATGATTTGCAGCCTGCAAACATG
CTCCACATCTTTGTAAGATTGGATGTGTTCCATTCCTTTAGTGAATCTATGTCATTTAGGCGGTAACAGT
CATTGAATAGGGCGGTCATGTCATTGACGTTAGAGACATCCAGATACCTTAGACCGTCGCAGCTTGTCAA
GCTGGAGCATCCTCCAAACATATTCTCCAAGCTTAATAGATTGGAAGTGTCCCATGTTTCAAGTCCGATT
ACGTCAATCAGGGACTTGCAGTCTGCAAACATTGATTCGATAAATTGGACTTTGCTTGTAATCCCTTGGG
CTATGATAAGGCGCATTCCTTCCAGGTCTCTATATTTGTTTGATATATAGCTCTCTCCAGACAGGTCTTC
ACTGATATAGAGAATGTCCTTTTTGTCTTCTATCTCTTTCCAATCGGTGATGTTTGTTCCATCTTTTAGG
ATGATTAGGACTTGGTATGGACTTATATTAAATATGCTGTCAGTTGTGGTGTTTAGTTCTTTAAATCTTT
TTAGATGGTCTATGGTTTCTTTAGGTCTGTTTTGCATTCGTTCTTCATCAGTTTTCTGTGGAGTTTTTTT
CTCTTTAGGTTCTTTATTTTCATTTGGGATTTTGTTATCGATTGGTTTTAAGTTGTTGTCTTCTTTTTTG
TCTTTTATTTTGTTATCGATTGGTTTTAAGTTGTTGTCTTCTTTTTTGTCTTTTATTTTGTTTTCAGTTG
ATTTTAAATTATTATTTTCTTCATCATCAGATTTTAATATTTTATTTAATTCCTCTCTAAAATCCATATT
AACACCTATTTAATCTAATATTTCTTTTCTTAATTTCAACTAATCTTCAATTAAAATTTCATAATTTAAA
TTATTATAATCCTTTTTAATCACTTTTATCAGTAATTTTATCACTGGCAGCTAAACGAACATCAATATTG
GAATCATTCATTGCAATATCTTTTAAAATATCTGTGTTTTCTATGTTTCTAATTGCAAGTCTTCTGATTT
TCCATTCTGGGTCATTTTTAGCTATTTTTCTTAGAACTGACTCATCATTTATCATTCTTACTGCAAGTTT
TCTAAGCTCAAATATTGGGTCGTTTTGAGCTATGTCTTCTAAAATACTTTTATCTTTTATTTTGCTTAAT
GCCTGCCTTCTGACATGCCAGTTTGAATCGTTTAAAGCAATATAAATCAATGCAGATTCATCTTCAATGT
TCTTTATTGATTCCAGTCTGACTCTCCAGGCAGGTTCATTAAAGGCAATTTCTTCTAAAAATGTTTCATT
AGTTATTTTGCCCACTGCATTCCTTCTTATTCTCCAACATGTGTCTTTTTTGACTATTTTTGTCATAACT
TCTTCATCATCTATTCTTCTGCAGGCGCATAACCTGACTTTCCAATCGAATGCATTGAGGGCGATATCTA
CTAAGATAGCTTTATCATTTATTTTTTTCACTGCTTCGTAACGTGTGCTTGGATTAGGGTCATTGCATGC
CATATATGCCAATACCTTTTCATCGGTGATTTTATTAAGGGCATTTGAACGAATCTGCCAATAAAAATCA
TTCTTTCCCATCTCTGCTAGGGTTTTTTCATCTGTGATCTTTTTGGATGCTTCCAGTCTGACATAGAAAT
CTGGGTCATTTAGGACGATTTGGGATAGGATCTTCTCATCATCAATATGTCTGGTGGCTTCCAATCGTTT
AAACTCGCTACGGTCTTTTAGGGCAATCTCTGCTAGGGCTTCACCATCATTTATTTTTTTTGCAGCTTCC
ATTTGAACAGAACTGTCCGGGTCGTTTAAGGCCAGTTCTTTTAAAACGAAAGGGTCATCAATTCCTTTAA
CAGCTGCACGGCGAACTTGATATTCCTTGTCATTTTGAGCAAGGTCGATTAGGACATTTTGGTCTTTGAT
TCTTTCTGCTGCCTTGCTTCTAGGGCTGGCCTTAAGCTTGCTATATGCTATATCGATTAAGACGTCTTGA
TTGTCGATTTTCTTTACAGCCTCACTGGAGCTTTCCCAATGGGGATCGTTGTAGGCAATGTCGATTAGGA
CGCTTTGGTCATTGATCTTTTTTACGGCATATTTTCGAACGATTCCCTCTTCTTCCTTTCGGGCAATCTC
CTCTAAAAGGGCTTGGTCATCTGTTTTTCTTATTATATCAATTCTTTTCATCCAATTGATATCTTTGTAT
TTTGGTATTAATCTATCGAGTAATTCCATAAAATCACCCTTTTAGTAAGTCTTTTAATAAGAATTTTTCT
TATAATTTTAAGTTCTTTTATATCTACTAATTTTTAAAGATTTATTTTTAAGTTCTTTTATATCTACTAA
TTTTTAAAGATTTATTTTTAAGTTCTTTTATATCTACTAATTTTTAAAGATTTATTTTTAAGTTCTTTTA
TATCTACTAATTTTTAAAGATTTATTTTATTATTAATTTTTATTATTTAAACAGATACCATATAAGTTCT
AACAATGATTTGCTTTAGCTAATTTAAATCATTAGGATAATTGTCCGAGAAAGTGCAATCAATCAGATTT
GGAGTTTTATAGGAAGATATTGCTCCTCCAAAATTGCTGTCCTTTAAATAATTGCCAATGAACTCTGTCT
GAATTATTGTAACCTCTTCATCGCCAATGGTTCGAATTGCACCGCCCCATGCGCCATCAGTATCATCCAA
TCCCATATTTTTCTTAAATGATGATTGCTTTATCACCATTCTTTTTTTATTAAAAATTGCCCCTCCAAAG
GATTCATCTTCTAATTGGAGGATTGGAATAAACCTGGCCTTAAATAATGATTCTTTGACAATGTTTTTTA
AAAATTTAGTTGAGACAATCTCTAAATCTTCTTTATTATATATTGCCCCTCCAATATGGCCTTCATTGCC
CTTAAAGCAAGTATCTATTATGGATAATTTCTGATGATTGTATATTGCTCCCCCTTCATTTGATTTGTTG
GATTCAAATAATCCATTGCTTATTGTAAGATGTCCTTTATTATTTATGGCTCCTCCCTTGCTTTCGGAAA
TATTATCGATAAATTTGCAGTTTTCTATTTTCAAATCAAGGCCTTTATAAACCTTTATTGCTCCCCCTTC
ATTGTTTGACATGAAATAATTGTCAAAAGCGTGTCCATTTTTAAATATTATGTTCTTAAGAGTGATATTG
TTTCCTGTAACTAAAAATATCCTTGACCTGCCTGATGCATCGATTGTCTTGCCCTTTCCATCAATCACCA
TATTGTCCCTGTCAAGTTCGATTCCCCCTTCATAAAAATCGAATTCATCGCTAAGCAAGCTAATGTCCTC
ATCAAAAGAAATTGTATCGGATATATTAGAATGAATCAGCTCATCCAAATAGCTAAAATTAAACTCATTT
TCCATTCCAAGATAAAAAACCTTGCCTACGGAAAAAATAAAGTTTTTATATTTTTTCTCGGCAGTTAGGA
TTCCCTCATTAAAAATGCTGACAGTCTTATCCTTTAGGATTATTTCTTTTAAGACCATATTGGACCTATT
GCATATATTATGGCAATTTTCTTTTTTAGAGTGATTGTTTTCAAAAATAGTTCCTGTAATGTTGCAATCC
TTTCCATGATTATAGACAGTGGTATAATCGCTGATATTATTGGCGATTTTTCCTTTTTCAATGCTTAAGA
TTCCAATTTCCCCATCATTTTCAATAACTGCGCTGTCTGATTGATTTGACTCGAAATTAGAGCTGTGGAT
TGTCATGAGATTGAAATTATGAACTATCTTTTTTAAGTCTTTAAAATCACAGGATGTGATTGTCAGATAA
CTGTCATTGTATATGACTGATCCTCTTTTTGCAGTTTCGTTTTTGAATTTGGAATCATCTATTGATATTT
CACCTATCTCATTATGAATCTCACCGCTTATATGGGAGCTATTGTTTTCAAATCTGCAGTCTTCTATTTT
TATTTTACATAAATATTTTAATTTTGGAATATCAATGCCTAAATTGTATATTGCACTTCCAAAAGGTGAT
GAGTTATTAATGAAGGAAGTGTTTTTCAGCAAAAGATTATCTGAATTACCGACTGCTCCGCCGACATCAT
GTTCGCCGTTCATTCCTCTTTTTTCACCTATGGCAATGTTTTTTATTATAAAGCTGTCTTCTATCTTCGC
ATCTCCTCCATTGATGAAGGCAGCCCCTGTAACTGCAATGTTATTTTCCATTGAAACATCCTTTAAGGAA
ACATATCCTCCATTGCTTATTGCTCCGGCAGTAAATGCAAGATTATTCTTAAAAGTCGTCTTTTCAATAA
AAAGATTTCCATCATTGAGGATCGCCCCTCCATTCCTTGCACTGTTATTTTCTATAATGGAGTTTCTTAT
GGTCATTTCTGCCATTGTTTCGTAATTACTATCAGGAGCTGTCATTTCTGCTATTTCCTGGTCACCATCA
GGATATTTTTTTATTGACTATTGCATTGCCCTCATATTTAGAGCCCCTATTGTTTTGCACTGATATATTT
TCCAGCGTAACTTTGCCCTTATTGCAAATGACTCCATCAGACTCGACAAATCCGTTTTTTAAAACAATAT
TTTTGATGGTGATGTTTTTCCCTGTGATGTTAAAGATTCCGCATTTTCCTTTTGCGTCTATGGCATGGCC
CCTGCCATCAATTAGAGTATCATCCACATCTAGAATGATTGGGCTGTCTCCTTCCATATGAATAATATCT
GAATCTAAAGTGATGTTCTTTTTATTGCTATGTATTAAATCATCTAAATATTTGAAAGAATTTATTTTGG
AGGATTTTTCATTTAGATATTCTTTATTGGATTGTGTATTCTTTTCTTCTTTATTGGCGGTTATGGTTGT
GTTCTTGTTTTCTTCTTTATTGGAGGTTATGGTTGTGTTCTTGTTTTCTTCTTTATTGGAGGTTATGGTT
GTGTTCTTGTTTTCTTCTTTATTGGATTGTATGTTCTTATTTTCTTCTATTTCGCAGTTAAAGGCCATAT
TGTCCTTTTCTAAACTATTTAGTCCAAAAATTTCATCAATTGCATCATTGATCTTGCTAAAGCAAGTTTC
AAAGGCATCCAAATCAGACCAAAACGGGTCTTGAATATCTAAATTAGAAAATCCTGCAAATTCATTAATG
GTTACAACTTTATAAACATGATAATAATATTTTAAGATATTTCTGATATAGGTTGTAGAACTTAAAATTA
ATGTAGAATCATCTAAATCATAATCTTCAATATTTGCTGTGCAGTGGCTAGATAGGTCAATATCATGATT
TTCGCATACTTTTATTGCATTTGGAACGGCTTTATTTCCACTGATTGCAGATAAACCTGCAGAGTAAGCT
TTAATGCCTTTGACTTTTTTATTAAAGATAGCTTCGGCTATGGGGCTAATGGAAATGTTTGCTCCGTCAA
CAAAAAGAATTTTATCCACTTTTATATTATTTTTTAGCTTATCAAGCATTTCATTTGGACTGTTTATCTT
TTTATCATTCTTGGATTTGGAAAATTCATTTTTCCTATCTTTAGGGTCTTCTTTGTTTGGTTTGGGCTTG
TTTTCTTTGTTTGATTTATTCTCATCTCTATCTATAGAATCCCCTATTATCATTATCAAATCGTTTTGAT
TTACAATATCTCCAGGATTTACAAGTATATTTTCAACTACACCACTTTTATCTGCAAAAATCTCACTTTC
CATTTTCATAGCCTCTAAAATACAGACTACATCACCTTTTTTAACGGAATCTCCGATTTTTACATTGATT
TTCAATACCATTCCCATTATATCCGATTTAACTTTCTCGACCCCATGATAAACACCTAAGTAATATTAAA
TATGGTTATGATATTAATTAAATTTATTTAGATTATTTAAGGTTTATAAATAGCATATTCATAGTTTATA
TCATGTGTTGGCTTATGAATTCATTATTTTTATAAATGAATATTGTTTCTAACTATATTGTATTTATAAG
TGTCTATATTTTTCAACTGCATAGTCTTTTTAAGTGTCTATATTTTTCAACTGCATAGTCTTTATAAGTG
TCTATATTTTTCAACTGCATATTATAAAAACGGCATTGATTTTCATTTGTAGTGCAAACTAATTTTTTTA
TTCATCTATTAATATATGCTTTTCTTTAGGAAATGAGATATCTTTTTAGCAGAATTGTATAGAAAAAATA
AATTATATTTATGCGCACATAGCTAATTATACATCATCACCACATAAAAAATCAACAATGTTTAGATGCC
TTACTCCGTCTTTTGAAAAATCATGATTTTCTGTTGTTATCAATATTGACTCGTATTTATCAGGTATTCT
TAATAATGGATTAATTTCACGATTTAGAGTTTGCTCGCTTGTCAATCTATAGGAGACTTGAATATATTTA
TATTTGCCAGATTTTTCACATACAAAATCTACTTCTGTTTTATCCTCATTTCTGCCAACATTTACTTTGT
ATCCTCTTCTTAATAGTTCTACATAAACAATGTTTTCTAATATTTTAGTTACTTTCAATATATTATCTTC
GATTAATGCATGATGAAAGCCATGATCGGTTAAATAATATTTTCCAAGGATTTTCATTTCTTTTTTTCCT
TTTAGATGGAAACATTTGCATTTTGAAATGAAGAAGGATTGTTTTAAGTATTCATTATATTTGAGCAATG
TGTCTTCTGAAGTATAGATATCATTGCTTTTTAAATAGTTTTTTATGCTTTTAGATGAGAATATTTCTCC
AGTGCTACTAATCATATAGCGAGAGAAACGTTGTAGTAGGTCAATATTGCTAATATTAAATCGTGAAACC
ACATCTTCAAATAATATTGAATTATAAATGTCTTTCAGAGCCAATCTTTTAAACTCATCACTGCCTAATG
AGAGAATACCAGGCATGCCTCCAAAGTTGAAGTATTCCTCATATAATTCATCAATTGAATACTTAGTTAT
TTCAACACCCTCAATTTCATTTTTATATTGTAAAAACTCTTTAAATGAGAATGGATAAACATGGATTGTG
AGATATCTTCCAGTCAATAGTGTTGCCAGTTCACCAGACAATAATTTTGAATTAGACCCTGTAATGTATA
TGTCACTGTCAATGGAAACCCTATAGCTATTAATGGATTTTTCCCATCCCTTTACTTGCTGGATTTCGTC
AAAAAATAGATATATTTTGCCTTCAAGATTTTCAACTTTCTTATAGACGAGTTCATCTAATTGCTCGCTG
TTGTTGATGTGGATATATTCTCTTGATTCAAAGGACATGAATATTATATTTTCATCATTTACGCCATCTC
TTTTAAGTTCGTCTATGATATTATGCATTAAACTAGTTTTGCCGGACCTTCTAATTCCTATATATACTTT
AACAAAATCAGTGTTAACATAATCTTTTAAATCACGAATGTAAGCTTCACGTTTGATTATTTTGCTTGGC
ATTATTCTCAACTCACTTTAAAATGTTCTTTCTAATTTTTCTTTTGTATCTTGGATTTTTGTTAATTAAA
TTCGTTTGTAGATAGGAAATTTTTTAATATTTTAGAAAAATTCTTTTACAGATAGAAAATTTTTTAATAT
TTTAGAAAAATTCTTTTACAGATAGAAAATTTTTTAATATTTTAGAAAAATTCGTTTGTAGATGGAAAAA
TTTCTTAATTATAATTTTTTCTTTATTATTATTTAATATTTCCTATCAATTATCACTAGTTCTAATGATT
AGAAAACTTTCTCTAATATATTAATTCTCCATTAGCCTATAAATTTGTTTAAAATGAAGCATTTTTAATG
GATTTTCTAGGATAAAGATACTAATCAGCTATTTCACTTATTGTGATTAAGAGGAACAATTTAATTTTTA
ATCTATTATTGATTATCAATTGAAACAGATTCTATATATTTTTACCAATTGAATTGATTTTACAATTTTT
TTTTCATATTTTTTATTTTGTAGAAACTACTTTGTAATGGATAGTATATATAGTTTCTCTATTAAAAATT
CGTTATTTGGCTAATGGTTTATATATAATTTAATATGGTAAAAAATAAGTCCAAATTGCAGAGAAATTTA
TAAATAGTTATATATGGTAAACCGTTCTATAGGTTTAAATTAATTTTATTTAAAAATATATTCAATTGTT
TTCACCTAAAAATTCTTCCTTAGAATGTCTTAAAAAAACACATTTTAATCATATGCTTTGATTTTTCAAA
GTGTTTATTAGGATGTTCGTTTTTTATTAAACAAAAAAAATAATAAAATATGGTTTTGTTCAATAAAATA
ACAATTTGTTAAGTCACTTAATACTTCAGTCACTTAACATTTAAACATTGTTTAGAAAAATTAAAAAAAT
TTGAAAAAAATTATTATATAGAAAATATAAATTATATATTATAACACTAAATGTGTCGGAACTTAACTTG
AAAGTTAAGTGAAATTTTATAAAATTTCTTAAAATAATCATTTTATGGGGATGTTCTTTTGGCTAAAAAG
AAAAAACTAAAAAAGAAGATGCCAAATCAGGCAGTAAGCCATTAACTGCTGAAGAGGTGTCTGAAAAATA
TACAGTTGCAGAACTAAAATACATTTTAAAGGAAAACGGCTTAAAGGTTTCAGGAAGAAAGCCAGATCTT
GTTGAAAGGGTTTTGCCTATCTTAAATGCTGAAGCAAGTGAAGAGGCCGTTGAAGAAGTTAAAGAAGAAG
TTAAAGAAGAAACTGTTGAAGCAGAAATTGTAGAAGCTGAAGAAAAAGCTCCAGTGGATTTGACTTTCCC
AGATACTGAGGAAGCATTAAGCTCCATACTTGCTCTGTATGGACTAAGCTATGACGATTTATCAATTAAA
GATATAGAATTTGCCGATGGTAAAATTTGCATAAACGGTGAAGCTTTCATTCAAAACGGTTTAAGCATGT
CAGATTCTACCATGTCAATAATAAATGCAGATCCAACTCTTAATCTGACAATGAATATTCCAGAAGTCGC
CTATAGTGACTTTGAAAGCACTATCTTTAGATTTAAAGACCTTGATTTAAATCTTATTCCTACTGATGAT
AGTCTTGAGTTTAAAGCGGCTTTGAAAGGCTTGGACATAATGACTGATTTGAATAATATAATCCTAAAGG
GCCTTGATTTCGCATTCAAGTCTTTCCCAGATAGGGGTGTAGAAATAGGTATTGATATAGACGATTTCAT
TTATCCTAATTTTTATAACACAAGCTTTAACTTTGAAAACCTTGATTTCAATATGGCAATAGGAGTGGAT
GGACAAAGCATTGCCATATCAGTTAATTTGCCTGCATTAGACCTACTAAACAAAGACTATAGGGTAAAAT
TATCTGATTTAAGTCTAAATCTAGTGCTCTCTGATTTGCAATTATCAGACCTTGACTTATCCATAGCAAT
ATCAGATTTCCATTACACAAACTTTGATGATGTTGTCATTTATATGGAGGACATAGGTGTATCACTTGAA
CATATTCCAGATACAAACAGCTTCAATGTCCTTATTGGCTTGAGCGCTATGGATGCAGTTGGTTTAAATT
CATTTGATGCCTTGTTCCCAATGATGGAAATCACTGGAGTAAACTTTAACTCTAAGGATTCAGACTCACT
AATTAACTTTACAGGTCTTATATCTCCTATAGATCTTACTCAAATTGATTTATTAGAGCTTGGCGCCCTT
TTAGGTTCAGGATTTGACCTTGACGCCTACACTAGAAATATGGCATATTATCCAGACATTGCAAGTGAAG
GAGCATCAGATTTAGGTATTCCAGGATTGGATTTAGGTGCCATAGTTGCAAACTGTGACTATTCATGTTT
AGGCGCAATCGAGCTTAATCTAACTGGACTCCTTGATTCAGCAGATATTGATTTATCTGATTTAGGCATT
GACTTGTCTGATTATGATATTTCTTCAATCAAATTGTCTGACCTTATCGGTGCTGTAGGAGATTCTGAGT
TTGTTATGTCTGCCATTCCAGCTGTCTTAAACATATTCTCACTTGACTTAACTGACGTTGACGTCTCTGG
ATTGATAGCTGACTTTGACGAAGAGAACTTTGATATCTCTTCTTTACTTGCTAGCCTTAATTTATCAAGC
ACAGATATTGCTGCTATTTTAGATATCTTAGATAAATCAGATATTGATTTAGGAGCCATATTTGCAGGCT
GTGATATTTCATGCTTAGATGCAATTACCCTTGACTTGACTGGATTCATTGATTCATTAGGCATTGATTT
GTCTGCATTTATTGATTTATCTGAATTTGACTTGTCTGCAGTTAGCTTAACTGATATTATTGCCATATTA
AACAGTTTTGAATTTGATATGTCTACCATTTCAGCTCTCTTAAAGATATTCGGCCTTGACATAGGAGATC
TTGACTTGGAAGGATTGATAGCAAGCTTTGACACTGAAAACTTTGATCTCTCTACTTTGCTTGCAAGCCT
TAACTTATCTGACTTGGATATTGATGCTATTTTAGCTATCTTCAATAATCCAGACTTCGATTGGGCTGGC
ATATTTGAAAACAGTGACTTGTCATGCTTAGATGCTATTACCCTTGACTTGACCGGTCTTCTAGATTCAG
CAGAGATTGACTTATCTGCCTTAGGCATTGACTTATCTGATTATGACCTATCTTCAATCAAATTATCTGA
GCTTATTGGCGTATTTGGAAATCTTGACTTTGACATGTCTGATATGATATCTGGCATTGACTTCGAAAGC
ATTGACTTTGAGAATATTGACTTGGAAGGATTGATAGCTGACTTTGACGCTGAGAACTTTGACATATCCA
CCTTATTGGAAAGCCTTAACCTATCCAGTACAGACTTATCTGCCATTTTCGACATGTTCATCAATTCAGA
TGTCGATTTAGGCAAGGTATTTGAAGGCTGTGACTATTCATGCTTAGATGCTATTGTGCTTAATTTAAGC
GGACTTCTTGATTCAATAGGCATTGACTTGGCTGATTTAGGCATTGACTTATCTGATTATGACCTTTCTG
CAATCAAACTCTCTGAGCTTATCGGAATCTTAAATGGATTCGATTTAGATATGAACACTTTATCTGCTCT
CTTGAAGATATTTGGAATTGACTTAGAAGAGCTTGACTTGTCTGGTCTTATAGCTATCTTTGACGGCGAC
AACTTTGATATGACTGCATTGTTATCCAGTCTTAATTTAGGAGGTGTGGATATTTCCGCTATTGTAGAGC
TATTTGATAATTTAGGCTTTGATTTCGATGGCATGTTTGAAAACTTGGATATTTCATGCTTCGATGCAAT
CACCCTTGACTTGACTGGACTCATTGATTCAACAGGCATTGACCTTGCTGCTTTCGGCATAGATTTGTCT
GCCTATGACTTATCTGCAATCAAGCTGTCTGATCTTATTGGTGTTGTATGCAGTTCTGAGTTTATCATGT
CTGCCTCTGGTGCTGTCATGAAGCTATTCAATATAAATGTGGATGACCTTGACTTTGATGGATTGATTGC
CAGCTTTGACGCTGAGAACTTTGACATATCTCCTTTATTAGAAAGCATTGAGCTATCTGGATTTGACATT
TCAGAGATGTTGGAAATGTTTGATATGAATGGATTTGACTTATCTCAGTTCTTGAATCAGTTCATAAGCT
CATTTATGGAGAATGCTCTTTTGGAATCTGGTGATGAATGAGTTTTTAATTAAATAATAGTGGATTATAT
TTCACTATTATTATTACTTTTTTTCAATTTTATTTATTTTTAAACATCTGATAATATTTTTTCTAATTTT
TATCTTATTTTACTTATTAATTGCTTTAAATGCTTATATTTCATCTCCATTTAATCGCTCTTATAAAAGA
TGTATGCATTTTTGCTAAATTCATCGATTCCATTATCTTCGCAAAATTTAATCATATGATCATAGATTTC
ATCACGTGTGGAATATAGAGTTTCATCGCTTGTTCCATTTAGATTATTGAAACAAAAGAAATAATCTGCA
GTATCAATGTCTCGCTCTTCCACTATGGTAAAATCCCCTAGAAAATCGTATTTTTTAGCGAATTTCTTTA
GTTCTTCTGTATAGATCCTTTTAGGCTCTTCCATTTCCATTCTAAATTCATCGATTTTTAGCATCTTTTT
TCTCACCTCCTTTTTCGGTTGGTACAAATTACTTTGTAATGGATAGTATTTATAGTTTTCTCTATGAAAA
ATTCGTTATTTGGCTAATGGTTTATATATAGTTTAATATGGTAAAAAATAAGTCCAAATTGTAGAGTAAT
TTATAAATAGTTATATATAGTAAACCGTTCTATAGGTTTAAAACTAATATTTTTTTTAATCATTGAAAAT
TGATTAATTATTCTTATTTTTATAAATGGTTATATATAGTAAACTAATTAGTTTATAAATAGTTATATAT
GGTTAATTTTTAATTTAAAGAGTATATATTCCTTATTTTTTAAAAATATTTATATATAAGTAATTATATA
ATTATGTCTTACAAAAAGAATTTTTATTGGAGGGTGTATATGTCTCAAGAAGAAAATAAAATGATAGATG
AAGTGGAAATGAGTTCTGTAGAAGAAATAGGGAGGGATTCTGTAGAAGAAATTAAAATTGGCTCTCAAGA
TGAAATAGGGATGAATTCTGTAGAAGAAATGGATTTAGACTCTGCAGATGAAATAGATATGGACGATGTA
GAAGAAATGGAAATGAAGATAGAAAACTATGAAAATAGAATCAAATTGCAAGATATATTAATAGAATCTT
TAGGAGAAAGATGTGAGGGAGAAAAGGAGAGAAATAAGCAACTTCATGATAGAATCATCCAATTAAATGA
AGAGTTAAAGAAAAAACAGGAACTGGAAATGGTAAGCGATATCAATTATTGGAGGGGAATTGAAAAAGCC
CATATAGAACTGCATGATAAGTACTATAAGAGGATAATCCAGCTTGAAAAACAGAATTTCCTGCTTGAAG
TTGAAAACGATGAGCTGAAGGATGAATTAGAGAGGATAAAAAATGTTTAATTTTCTCTCTATATATGATT
CATAAAATAAGTGGTTTTAGAGAGGATAAAAAATGTTTAATTTTCTCTCTATATATGATTCATAAAATAA
GTGGTTTAAAGGTCTTTCATTATCTTCTTTAATTATGCTTAGACATTTATCAAATCAACAAGCTTCTACT
TCATTATTAATTAAATCCCTTCGCGAACTAATTTAATTTATGTTTTTTTGGTTGTTTTTATCCTTTCTAT
ATTAGATGTTTTTTTTTATTTGTCCTTTAATTTCTGTTCCAATTGATTAAATTTTTTGTCGTATTCCTCT
AGTTTCTGTTCTAACTTTTTAACTTTATCTTTATATTCATTCAATTCTTGTGAGATTTCATTTATATTCT
GTGTGTCTGTATTCCTATTGTCAGAAACAGTTTGTTCATCGCTTTTTTCGGCTTCCTCTTTTTTCTCAGT
TAAAAATAGGGTGAAGAGTAAGATTCCAAGAACAGCGCCAAATGTCATTGGAGCATAAAGGGCATTAGCA
ATAAGAACTCCCTTTGGTTGAGGGGTTAATATGGTTATTAGAAACATGTCAAAGCCGCTATATAGAAGCA
TTAAAAGTGCAGCCTTATATGGCCTTAGGAATTCGCCATCGTTCCATCTATAAACGAGACTTCCTACAAT
TCCAGCCATTATTGTTGCAACGCCACATGCCAAGGCAGTAATGCCTCCCATGCCATATCTCCAGACTCCG
GCTATTATTCCTACAGGTATTCCAACATATGGTCCTCCAAGCAATGCGGATATCATTACAATCAATCCTC
TTGCATTTGCAGGGATTCCATTTACATCCATAGTGCAATATGATGCAAGAATTCCTAGAATGGAAAATAT
GATAATCTGCCAGATTATGGTTTTACGGGACTGTTGGCCTCTGATTATAACTTTAAAACTTTTGGATTTG
GTGGCTATGTATGTTAGAATCAAGACTACAGAAAGCATTCTAAACATTTCTAAAAATGGCGCCCATAATG
ATTCTCCATTTGCGGATTTGTTAAAATAGGAAATGGTGAGGCTTAACAAACCCATAATGATTAGATAGCC
TATCTCATAAACTGATCCGTCTGTCAGCTCTTTAAGTTTTGTTAGCCTGGTTGAAATAAATCCTAATATT
ATGATTGCAGATATTATTGTAGTAATCTCATGGACGACTGTTATGCTTTACATGCTGAACAATGGATCAT
ATAAGCAAAAAAGTTAATAAATAGGGCTATATTGAAGATTAACAATATTGAAAATAATATTATAATCTTT
TTATCACCAGAGAGTTTGTCTTTTAACATGTTATCTAGTTTTTAAGTATATAAAATATAATATGGATTTA
ATTTTATTCTTAAGTTGTTTAAGTTTGGTCTCTTTTTTGATTCTATTTATTTTTATTTTCTTTAGTTTTT
AAAGTTTTATTTTTAATCGCGTTTTATTTAGCTTTTTAATTTTATTTCTTAAGCCGTTTAAGTTTTTTTC
TTAAGTTTTTTAATTTTATTTTTAGGCTTTTAAATTATGGAAATTGAATATTAGGTTTAAATTGACTATT
AATATTTAAAGAAATCCCTACCCCAACTAAGGTTGCGTTTAACCTCTTGGATTTTCATTTCAGGGGTTTT
TTCATAATTTCGATATGCTTTTTCTATTATCTCTATTTTTTTTTCACCATTCATTGATTTAGTAATTTGG
CTGACAATTTCAATATTTTCGTCAACTTCGTCCATTTGATTAAATGCTTCATCTTTTATTTCAAAAAGAA
GGTCTATAGCTTCTCCAAGACTAATTCCGCTCTTTTCTAATTCTTTCACTTTTTCAATTTGTTCATCTGT
TAAATCAAATTCCATTTTAGTCATTTTTCCCACGCTCTTAACCTGTTTACTTAACTTAATTTATATTCAT
TATTTATAATATATTTTATCATATAATTTTGTTTTTCTTTTTCTTTGTTCCTTATTTCTGTGATTTAATC
CTTTTTTTTATTTATTTTAGATTTAACAGAATTATATTTATTCTCATAACTGTTTTTAATTGCTAAGTTA
AATGGAAATTTTTTAAAAGCTAATAAAAAGAGTTTTATTATTTTAAAGTAGTTATGGTAAGTTTTTTATT
TAGAATTAGTTAAAAAGAGTTATTATTATTTTTAAACTAGTTATGGTAAGTTTTTTATTTAGAATTAGCT
AAAAAGAGCTTTTATTATTTTTAAACTAGTTATTTAAGTTTTTTTTATTTAGAATTAGTTAAAAAGAGTT
TTTATTATTTTTAAACTAGTTATTTAAGTTTTTTTTATTTAGAATTAGTTAAAAAGAGTTTTTATTCAAA
AATAGTAAAAAAATTTTAATTTTAATTAAAAATAAAAAAAAAAGATAATGAGAGAATAAACTCTCATTGT
TTTTTAAGTTTATCTGGTTTTTTAATCTCCTTATCCGAGAGCCGCAATGTCAAGACAAAGATTATGGCCA
TCAGAGCCATCGTTACATACATTACAAACGCCATGGAATCTCTAACAATGACATTTACAATATTCTGAAT
AGTGCTGTTCTCTGCTTTAACATCGTTTATGCTGCTTATTGATTGGAATCCCTCATAGACATCGTGTTCG
AATGTCGCATTACCGGACTGATCCGGCACATAGGTATCAACTGCATTGCTGATTCCTCCAATGATGCCCA
GAATAAGGATTACACCAATGATTGCTGTACCCATAGACTGACCTAAAGTCTGACCGGTTGTAACAATACC
GGATGCATTGTTTTGACCTTCCTGCGGAATATTGCTTAATGCAATGTCCACACCTAAAGCCATTACAAAA
CCAAGTCCTGCTCCAAGTACGAAGAGTCCAGGCATTAGCTCAAGCATTGATGTCGCCATTGTAAACTGCT
GGCTTAAAATAAGACATCCTATGATTGATATTATACATCCTATTGACATGAGGATCTTGTGGTTCAGTTT
TGCAGATAGCTTTGGGGCTGTCAATGCAAAGAGAAGCAAACCTAAGGTCATTGGAAGCAAGGTCAAACCT
GTGTTGAATGCAGATAAGGCCAATACGCTTTGCAGATAGACTGAGACTGCAAACAATGCACCGCCCATTG
CAAGGTTAACCAACAGCCTAAGGAGAGTACCTACACGGAGATTTCTGTCTTTTAATAATTCAACATCAAG
CAACGGTACGTTGCCTTTTCTTTTTCTTTTGATTTCAAAGAGTGCAAAGAGTGCTAGAACAATTAATCCT
GCAGCCATTATAGCTATGCTGAAAGTGGTATCATCAGTTAGCATCAAAATACCCATAACAAAGAGGACAA
GACCTACAAATGAGATTATAGCACCTGTAATGTCCAATTCGCTTTTGGATCCTGTAGCTTCGAAATAAGG
TATTTTGCCCTGCAGTGCAAATACGATCAGGACGATTATAAATTCCACTGCAAATCCTAATCTCCAAGTG
AAGTATGTTGTAACGACCCCACCGAAGAGCGGGCCGATAGCTGCTGCAATTGCAACCAGTGCGCTTTCAA
TTGCAAGGGCGAATGTAAGCTTTTCACCCTGATAGGTTCCGCTTATGATGGAAACTGCAGTAGGTGTCAT
CAATGCACCGCCTATACCTTCCAGCAATGCCCATCCTATAAATAACATTAGAGTATTGGCACTTAATGCT
GCAGTCAAGGTACCGACGCCATAAATTCCAGCACCGATTAAAAAGAGCTTCTTTTTACCAACTATATCCT
GAAGCTTGGTACTTAAGAGCATGAATGAGGCAGTGATGAGAGTATAGAATGATGAGATTGTTTGAATGGT
ACTCACATCAGTGTTCAAGTCAGCAACAACTGAGGAAATGCTGACGTTCATGAATGTTGTATCCAAAGCT
ATGATAAAGGTAGCAAAACAAACAAGGATTAAGGGAATCCAAGAGTGCTCCTTAATGGTTTCATTCATAT
TTGCAATTCTCCATATTTTTTAAAATCTATTTAGATGCATATGATTATATAAAAATCTATTTAGATGCAT
ATGATAATTTTATTTATATATAAAATCCGTTTATATACATAAATAGGTTTAGTTATATTATTATTTATAC
TTAGTTTTATTAAAGCATATTTGTAGAAGAGGATAATTTTAATTTTACTTTGTTTTTATTGGGCATTTAG
CTTTTAAAGGATTTTCTTTTAGTTAGGGAAGAATTTGTGGATTTTAATACTTTTTCATTTTGCTTGATTA
GTTCTTATTGTACTTAATTTAATTAATAATGAATGCCAATATTATAATTAGGAAGAATATTCTAATGAAA
GTCTTTTTTTAGTGAAAGGCTATTATAATTAGGAAGAATATTCTAATGAAAGTCTTTTTTTAGTGAAAGG
CTATTATAATTAGGAAGAATATTTTTTTAGTGAAAGACTATTATAATTCTCATTTAAAAAGTCTTTTAAG
TAAAAGACGATTATAATTCTCATTTAAAAAGTCTTTTAAGTAAAAAGAACGGATTATAATTATTAATTTT
ATTCCAAAAAAGATAGGGGGAAAATGACAACATGACTACTACTAATGATCAAGATGAATCAATAAGCGAA
CATATAAAAAAAGCGTTCTCCTTGAAGGAAGATACGGCCTCTAATGAAGAGATTCGCTCCCGCCTTTTAG
ATGGAGGCAAAATCACAGGAACAAACATGCGCGTTCTGGTATGTGCTATGGTGATTGCATCTGTAGGGCT
TAACATGAGCTCAACTGCAGTAATCATCGGTGCCATGCTGATTTCACCTCTGATGGGAAGCATTCTTGCC
TCTGCCTATGCAAGCGTGACCAATGACCGTCCCCTTCTTGGAAAGCATTTAACCGGATTTGCAATGCAGA
TTATAATAAGCGTAACTGCAGCAGCCATCTTCTTTTTCCTCTCTCCAGTTAAGGAGCCAACAGTAGAGCT
ATTGGCTAGAACATCTCCTTCATTTTATGATGTGTTAATCGCATTCTTCGGAGGACTTGCAGGAATCATA
GGACAGACCAGGTCAGATAAGGTAAGCACAGTTATCCCAGGGGTAGCTATTGCAACAGCCCTTATGCCTC
CTCTATGTACCTGCGGTTATTCAATTGCAAACGGAAGATGGGACATGCTTCTAGGAGCAGGTTATTTGTT
TTTAATTAACTGCTATTTCATATTCCTCTCATCAAGCCTTATTTTAAGTGCATTGAAGATTCCAAAATTG
AAGGAGTATACAGAAAAAGAATGGAAAATCCATAAGTGGAGAATGAGTTACGGAATACTATTTTAATTTG
CTATTCCTAGTGTAATTGCGGTTTATTATATGCTTTAATCCTGTGCTATAGTAACGGATATAAAATTAAT
TTTAGGGTGTTTTTATAAAACACCTATTTTTACTTATTTTTAATGTTCGAATTTAAATCTTTTATTTTTT
GTTTTTAATTAATTTATTAACTCATCCTTTTTATGTCCATATTCATTTTCATCGGATACTTATTTACCCA
TCTCATTAATGTTGGCTGGCTGATTGTTTTTAAATTTACAATTGTCCTCTTTTAAGATGCCCTTATTTAC
TATGGCATATCCGCTGTTGCCATCAAACCTTGGAACTTGCCATCTCTAAAGGCTTCCCTCATTTGCGATT
GCTCCGCCGCTGCTAGGCACCTCCAATGAAAATCTCACTCCTCCCGCTTCAAAGTCCTTCCTTGAAGTGT
TATTGTTAAACTCACAGTCAAATATTTTCAAGGATGAATCTTCACTGTTAAATACGCATGATCCGGCATT
TGAAAAGTTATTTTTAAAGCTGCAGTTTCTTAAGGTCAATGAGGCATTATTGATTATGCATCCTCCTTTT
TGATAGATTACCTTATTGTCTCTAAAGTTGGAATCTATGATTTCCAAGGAATCTGAATTGTTTTTCACGA
CTCCTCCAGATTGTCTGGATTCGTTATTTGAAAATTCACAGTTTATGATTTTTGCTGAAGCACTATGGGT
TATGCATAATACTCCTCCCCCATCTTTTGAATTATCAAAATAATCCTGATAGTAATATCCGTTTTTAAAC
TTGATGTTTTTAATGACAATGCCATTTCCGGTTATATGGAATATTCTAGAGAGATTGTTTGCATCGATTG
TATGGTATTGCCCATCAATTGTCAGATTGTCTTCGTAGATTTCTATTCCCCCTTCATAGAATGCCTGCTC
CAGTTCATGCATTTGGATATTGCAGTCAAGGGTTATTTCACTTGAGCCGTCGTTAATCAAATCATCAAGA
TATTCAAAGCCCTTGAAGTTTTCTAAAATGCTTTCTGCATCTATATCTTCATTTTTAGAGCTTACTGTTG
TTTCTTCACCTTTATTTATAGAGCTTGTTTCTTTAAGACCTTTATTTGTAGATCTTCTTTCTTTAAGACC
TTCATTTGTAGAGCTGGTTTCTTTAAGATTTTTATTTATAGAACCTGTTTCTTCAGGACCCTCATTTGCT
AGGTTTATTTCTTCAACATCATCAAAGGAAACTTTAAACTTCGCATTATTAAAGTTCAATCCTCCCTCTA
TTGCATCAACAGAAGTCTTTTTATTAGTTGAAAATTGACAGTTTTCAATATTGAGATAGCTGTCTTTACC
GAATTGGGCAATGATTTCAGGAGCGTCATTTATCTTATCAGTGATGAACTGACAGTTGAAGAGATCCATA
AATGCCAGGTTTAAAATGGAGTTTCCATGCTTAATGAAATGATATCTTCCAGTTGCGCGGCTAAATGAGC
CATATCTCGGAAATTCAACCAGATTGTTTTTAAACTTGCACCTTGAAGCTGTTAGCCTGCCCTCATTGAA
GATGGCTCCGCCGGATAATCCGGCCTTATTGTCTTCAAAGATGCAGTCATATAGGTTTATTGAGCCTATA
TTCCTAATGACTCCTCCATTCTTGTCGGTAGAATTCTTTGCCAATATGCATTTTGTAAGTTCCATTGAAG
CGTTCTGCCCATTTGAAATGGCTCCTCCCCCATCATAAGGATTGCTATAATTTCTGCTTGCTGATTCCAC
TTTAGAATTTTCAATCTTGCATCTTCCATTGTTGTATAGGAATTCGTTTATTGTACAGTTATCTATATTG
CAGGAATCATCATTCTTAATGGAGCCTATTATACAGCCTTTAAGGCTTAGGGAAGATTCATTGAAGATTT
GATCAATATTGCAATCTGTCAGATTCAAGCTTCCATTAATGTTTTTGATTCTTCTGTCAAATGTGGAGTT
TTCTCCAGTCAAGTTCCCCTCATTAATTTCAATGGACTTGTCTATGATGGAATTGGAGATGTTTAAGGAG
CCTTCATTAAGGCGAATCAGCATATTGGTCTCTATATTCTTTATGCTGAAATTGTTTGCTTCAATCCTAA
GCTCGATTTTAGGGTTGATGCATTCAAGCTTATGGTTTTTCCCATCAATTGTCACATTGTCCCGATTTAT
GGTGATTGTTTCATATATGCCGTCCCCATCCAATATGAAATGATCGTCAAGGATGATTTCATCATTGTTG
AATAGATCCATAAATTTATCCAGGCTGTTTTTGCAGGTGGCTCTGATTGCTATTTTGCGCACGTTCTCAT
TAGGGTCATTGACGAACTCCTTTAACGCTTCTTCGCTTTTAATGTATTTTGCAGCAAGCCTGCGAAGAGT
CTCATCAGTCTCATTATGCATCAGGTCCACTAAAAGGCTATCGTCATTGATTCTATCAAGGGCCATTCCA
ATCTCAAAGTAGTATCTGTCATAATCCAGATTGTAATATTCCAAGGCAATATTCAATAGGGTCTCATCAT
CGCTCATGAACTCTATTGACTTGTTGAGCTGATTCTTTCCTTTATGGGCGAATTCGTATAATGCTTCATT
TGCAATTTTCTCATCCTTCATCTCATTTAAGGCATATTCAACGGTGTTGTTCCAATCATTTTGGGATAGG
ATGTATTTCTTTAGTTCCTTGTCATTGTTTATGTATTGGGCTACTTTAGACTTAAGCTCAGGGCTTCTGC
TGGATTCCAGGCATCTTCTCATCACTTCTGGATCGTTTTTAAATCTTTCCACAAACTTGTCTCGTATGCT
TTCATACCTTGTAAGGCATACGATATCAATGAGAAGCTCCTCATCATTTATCTTGTCATAGATGCAATTT
GCATTTTCCTCATTTGAATATCGTATTATCTCTCTCAATTTCCTTTCATCATTTATTTCCATTAGTTGCT
CTTTGGTGAACTTGCTTGCGATAGCGTTTCTTAATCCGATGCCCCATCTGTCCTCGTTAAGGTCAAAGAG
CTCAATCAAGTCTTCTCTTGAGGCATGTTTTATCTTTAGGATTGCGTCACGTCGAAGTTCAAGAAACGGA
TGGGATTTTCCAATTTCAATCAATAGGCGATCGTCACTTATTTTTCTTAAGATACTATGGACGACTGGCT
CGTCCCTATAGGACATTATGCTTTCAAATAATTTGTATTCCTCATCGCTACCATCAAAAGATGCCTTGTC
AATAGGTGGAGATTTCCTCTTCAATCCAGTGTCCTTTTGGGTATCTCTTTTAGAGCTTTTTTCTTTATTT
TTTCTGCCTATTCCTTTTTTTAATTTATCTATAAATCCCATTTAAACACCTTTTTTTCACTTATTCCTTT
TTTTATTTTATCTATAATGCCCTATTTAAACACCTTTTTTTCATTTAGCTATTTTTAAGACCCACTTATA
AGTCTTCATTGATTAATTGTTTTTTATCCCTTGTTTTAATATTTCTTTAAGATTTATTTCTTTTTATAGT
TATTAGTATATTTTTATGGCAGTTTTATTTATAACTTTTTAAAAAATCTTTAAAATTATTGAAATATCTT
CAATTGATATGGGGTTTCTTAAGGGGTGATGGTGAATTTATTTAAAATTTTCCTATGGGATAGGGATTGC
TAATATAAATAAAAACAATAATCCAATTTAGGAATTAGAAAATATATAATAAAAATAGTATGAGAAATGT
CAGAACCTACAGCCACCTAATTGACCATAATAATTATGGAAAGTCGTCGCAAGCGACAAGGACTTGTAGG
CTGAACTCTATGAGTTTTTACCTTCCAATCTTTCATTTAGACATTTGTTTTTCACTAAATATAAATTTAA
TTGAATATATGGGCTTTTTATAAATAGTTATACATATTAAACCATTATTTTGGTTAATAAATAGTTATAT
ATGGTAAACTTATCATTTAAAGAGTATTTAAGTTTGCATATTTAAAAATATTTAAATAAAATGCTTTATG
AGAATCATATTATAAAGGTCATAAGATTGCAAATAAAATGAAAATTTAGTATATTTATTTATACTAAACC
CTATTTAGTATACTTTTTTTATACTAAACGCTAGTTAGTATAAATTTTTATACTAGTATACTTAGTATAT
TTTTTATACTAAACCCTATTTAGTATATTTTTTTATACTAAACCCTATTTAGTATATTTTTTATACTAAA
CACTAGTTAGTATACTTTTTTATACTAAACACTAGTTAGTATAAATTTTATACTGGCCTATCACTATCTT
ACTATTTTTCTTTCATCTTAGCCAAATTATCCTTCAATATCCTATATATATTCTCAGCACCTACAATCTC
CTCATCTGGAATGTCCCAATCTGATGGATATAAAATAAATGGCTCTGACTGGCTTCCTCCAACGCCTCCA
TGGCTTCCAACCAGCTCTTCAAATGCACATACCTCATCATTTTCCACATCATAAAAGCTGTTTACAAGAA
TGTCCGGTGTGTACTGGAATGAGCTGTTTCTTTTAAGATGTTGGGTAACATTGTCTCCAAATCCAATGAG
AGGATTTTCCCCTTCTATCTCATCGCTATCCAGGTAATAAATTCCATTCTTGCCTATTGCCATATCACCA
TTTTCAGATGAGCGGACTAAAACAAATCCTACATATTCATTATTCACTATTTCACTTATCATATCTGGAA
ACATCTCATTGATCTCTTCATAAGTCAGCCTATGGCTCCATCGGGTAAGATAGATCATTGCAAGGTTTCC
AGAGGCAAGGACAATAACTTCAGACTCTGAAATCAGCTTATCCTCATCTGGCTTGTTCCTGTTTTTAAAT
TTATCTATTCTATCTTTAAATGGAATGTAGACCTCTGCAAAGTGGTCTTCGTTTGAGGACATCTTTGCAT
AGATATTGGTCTCGTGAGGAAGCAAGGACTTTACAAAGTCCTCAAATGACTGGCCATATCTTTGCTTGAA
TGTTGCACCATTGGTTTGGCCATGGTCTGACTGTATGACAAACTCATATTCCCTTGGAGAGTATTTGTTT
CCATAGATCAAGCGCCTTATCTGCTTGTCCATTCCCTTAAGGGCAAACCATACATCCTCATCTCTCACTC
CTGAATGGTGGGCAATCTCGTCATAGCCTAGATATGTTGAATATGCAACGTCAATGTCTCCAATCAGCAT
GTCCCCAATAAGGGTTTCGGTATTGATTTCCCTCATGAAGACATTTGTTCCGGCCCTTGTTGGAATATAT
GCGATGCCCCTTGAGATTCTTGGACGGATATTTAGTATGCTGTGCTTAAGTTGGGAATAGATCTCATGGA
CCATGTCTTCTATGACTAAAATTACTATACGTGCGAATTCGCTTGGATTTGAAAAGATTGAAAACCAAGC
GCCATTGTAAAGCTTTCTAAGGTCTGTTATTTTGCTGAAGGTAAATATGACATTGTCTGTATCCCCTGAA
AAGAGGTTTGATCTGCTTGCCCCATTTTCAACAAGCAAGCCGTTACCGTCTGATATTCTCTCTTCAAGAA
CCTTTACCTTTGTAACTCCAGAGCACTGCATCATCTGATTGTTGTTTTCCTTTTCAATCCATCTGAAGGC
GGTGATGTTTTCATTGTTTCCATGTAGGATACCTGCTTGGCTGGCTCCGGTTTGAGAGGAGAGGTCAGTC
TCCCATTTTTTAAGGATATGGGTTTTGTTGTCAATCATTGACTTGACAGTTGGCATGACTCCTTTCTCTA
CAGCTTCCAAGAGCACGTCATATGCAAGCCCATCGATTTCAACAATGATTAGCCCAGGATAATCCTTAAT
CTCTCCTTTTCTTTTAGTTTGGGCTTCTCTAAGAACAGCCTGATAATATGTGCCATCATCCTCAGCGTCC
ATAAGGGTTGATAGGACGATTGTAATAAGGGCAATTGTTAATGGGGCAAGGACTATTCCCCATCCTGATA
TGTCTAAGCCAAAGTATGGGCCGAAGAAGGCAAAGACCCCTCCGTTTAAAAGGAGTGCTCCGATTCCAAA
GGTCCAAACCATAAGGGGCATGTATATCCTTGTTACCAGAGGCCATATTGCTGCATTGAAGATGCTTATG
AAAAATATGAATATTATGACTCTGCCTAGATTGGTGACGGTGAAATCCAATCCAAAGCTGATTAGATACA
ATCCGATAAGATTTGCAATAAAAAGAATAAGATATCTTTTAAGTGACAGTCCTGGTGTCTTTTTAAGTTC
TTCAATGTCTCTCATGGCCCACTCCCATTATATTTAGATTTAATTGCATAATTTTTAATGTTTTATTCTA
AAATGCTATGAATTAATTTATATTTATTATTTAGGATTTATTTAAATATTTTGACTACAAATATTAAGTC
ATTTAATAATTAAGTGGCTTAAATTCTTTTTTTAGGGCCAATATGGATGGGTTGTTTTTATAAGGAGGGT
TTGTCTTTTACAGTTCTTAAAGGGTGTTGTTTTATTGTCAATTTTTTGATATGAAATAATTAATTTAAGC
TATCATAATTTTGATAGTAATCTTTTTTTAGTTGTTTTAATTAAAGCAATTTTTAATAATTTGATAGTTA
TATAATATTTCTAGTTTTTGTTTAATCGTAATCTATACATTCTTACACTTTAAACTTTAATTAATATTAA
ATTCATATCAATAAGGGATAAAAAAGCTGATTTAGATAAAAAAAGTATGTATTTCAATGCAATAGCCTAG
ATGGTCTTAGTGATTTGCATTAATTGGTCTGTGATGTAATTGGTTTGGTTTTTGAAAAATAGAATATTTT
TTATTTTTTTAATGAGTGATTTGTGCCTTATTAGCATAGTTACTAATAAGGCACTGAAGAAGTAATTTAG
AATACATCAATATTCTAAAAAATGACTGGATTAAATATATATTTTTGGAGTTTATATATTTTTCTATTAT
TTCCAATATTCAAATTTGTACATTATATTTTTGATAGTTCATCCACATCATTTTAATGATTCTTTTTCTC
CTCCCTTAAGACATTATCCATCATCTGCACATCAAATGATACAACATCGTCAAGATATATCCAGCTTATG
AAATCTCCTCTTCGAAGTTCCAGCAAAAGCTCGATGCCCTTGCCATACTTTGACATATCACATTGCACTA
TGCTGACTTGATCGCATCTTGTGCGGACATTGTTCACTGTTACTTTACAATCCATATGATAATCCAAGCC
TTCCTGCCAATAGTCATTTCCAGTTTCTATTTCCTTAATCATATCCATTACATCCATTTATTATTCCTCC
TTATATTTTTTGCATATTTCTTCCATCTTTTGGTAGTATTCTATCTTGTTCATGATGAGCTGAAAGTTCA
AGTCATCCTCATCCTCGCTGCCGGATTCAATGTTTTGAATGTCTATGAAATTATACATAAAGTTCACACA
TAGAGCGATGGCAGTGAGGAAGTCCCCATCAACTGAATTCATGCCCTCTTCATCTACAAAGCAGCAATGG
CTTGTAAATTGTTCTATCTTCATCATTTCATCGATCATTTCCTCTTCATAATCGTTTATGATATTATCGT
CCCCCTTTTCTTTAGAGCAGCTGATATTTATTCTTTAAAATCTTTTTTCTTAAAAATAGTCCTATAATCA
TTTCATTATTGTCTTGATTATAGCATTTATCTTATGGATATCGTCGTTTATAAACTCTTCCATTTTAAGA
ATAATTCAGAATATAAAAATTAAATGTCTCTATTTCGTATGATCAAGTCTTTGGCTGTAAAGTGAAGTAT
GGAAAAATTGTAAATTAAATGTGAGAAAAATTGAGATAAAGTTATTTTAAATGATTATTCATTTATTTTT
TTAAAAAATAGTTAGTTTAGAAAAAGAGATTTAGAAATTGATTGGAAATCTCTATTCTATTTTTAAATAG
ACTAGAGATTCAATCATTTGTTCAATATCTTATTGCAAGAAAAAATTCCTGCAATACACTCGATAGATAT
TGAAAAAAGCAAAAATTTTAGTTAGAATTAAAAATTCCAATTAAAGAATTTTTAAACTCTAAATAAAATT
ATGATTTAAATAATATATAAATTTATTTAATCATGATGTAAATTACAGGAAGTGTCTGTTACAATATAAA
CGGGAACCCAAACACATCGAGTGTAGTGAAAAAACTAAATTCTTGTAATATTTGTTTATTCCTGTAATTT
ATATCTGAGGATTAATTGTTCATACTAGCCTTAAAAAAACCAGCATGAGCATGCTGTATATTACCAACAA
ATAAAGTAGGTAAAATACTACTCCAATCCAAAATTTCTTTTGAATGGACACATCAATCCTCCTAAAATTT
TTGCTTTGATGGTTGCGATTTTTAACAAAATTGATTTTTGCTCGGCAAAAAATAAAATTCCTTACCATAA
AATCACCTCCAGATTTTTTAGGAGTTACCGTTTGATTTAAAATTCTGTAATTCCTCTTATTTATACTTTA
TTTTTAATTTAAAGAAGTTAAAATTGATTTTATTTCGTAAAATTGTTGTGATGTTGTTAAATTGATGTGA
AAGTGTGAAATTGATTTTATTTCGTAAAATTGTTGTGATGTTGTTAAATTGATGTGAAAGTGTGAAATTG
ATTTTATTTCGTAAAATTGTTCTTATTTCGTAAAATTTACTTTATGGTGTGAAATTGATTTTATTTCGTA
AAATTGTTCTTATTTCGTAAAATTTACTTTATGGTGTGAAATTGATTTTATTTCGTAAAATTGTTCTTAT
TTCGTAAAATTTACTTTATGGTGTGAAATTGTTTTCTTGTATAAAATCAATTTATTCGTATCAATTAAGA
CTTAAAGTCTTCGAATTTTTTAAAATTTATTTAAGTTAAGAAATTATTCTTTTATTCTTTCTAAAAAGTC
TTTTTTGTTTCTTATGGCCTTATCAGATATTGGCTTATGGATTTCAACATCATCAATGTAGTCAAATATT
TCTATATTTGTAAATCCCATCTCTTGAAGCACTTTAAGGTTTGATTCAGCTTCATCAGATTTATGCAATC
CCTTTATCCTTGGAACTCTTATCTTTATTTTGTTATTGTCCACATGTTCCTTTAGATAGATTAGATTGCC
GAAGAAGAGATCGTAGTCTCCTTTTGTGTATAGCTCATATCTGGTCTTGTCCATGTCCTTGCAGTCTATA
TAGAAGTAGTCGATAAGGTCGATTATATCTTTTAAGGAATCTGTCTTATATGATAGGGAGCTTTCCAAAT
AGAATTTCCATTTGGTGGAGCTGTACTTTTCTATGAACTTCCTTATGAATTTATGGTATAAGAGAGGCTC
TCCTCCGCCGAATGCTATCCCTCCACCTGTTGAGAGAAAGTAGATATTGTCTCTTTTTAGCTCTTCGTAT
AGCTCATCCACAGTCAAGGATTTTGGATAGGCCGTACCATCCCATGAGCTTGGATTAAGGCAGTATGCAC
ATCTTAATGGACATCCCATAGTTGCTACAAGGCTTGTTATTCCATCTCCATCTGTATATGTTCTAAGGCG
AGATACTGATAGGATGTTGATTTTATTCATATTCGTCCTCTTTGATTTCAAAAACAGTTATATCTCCATC
ATATTCCTTCTCATTATATGGAAGCACTATCTCTTCATCATTCCCTAAATAAAAGATTTTAAGGTATGTA
AAAGCATAATCTTTATACTCTATATCGCCGAAAGTTTCACAATATGGGCTCTTTTCTAGAATCTCCATTT
TAGGTCTTACAGGTTCAAAATTTCCAAAAGGCACAAAGACATCTTTGCATAATAGTTTAGTAGGCTCTTT
TTCCTTTAATGTGAATATTCCTTCAATGTCTATCTTTTCGCCATTGTCCTGTTTTTTTTCAAGCTCTCTT
TCAAGGTATGCAACTTCGCTTTCACATTTAGGGCATGTCCCGCTGCAGTTCCCTTCGAATGTGCATTCCT
CAAAGTCAAATTCAATATTGTTCGCTTTGGCTATCCTTTGCCGGACTTCGTTTAGAAGTTCGCATTTATC
CCTGCCATTCATGATTAACCCCCTTTAAATAAAAAAAGCAGTGAGATTGCAATTAGCTATTGCAATATCT
TTTTAAACAGTATTGGTATTTGCTGTTTATAAAGCTTTGCAAATTATGCTTTGGGGAAGTTAATTTTTTT
GAAGGAAAAAAATTATGAGCTTTGGAAAGATTGTAAAATTTATATGTAGGAAAAATTGTAGATAAAGTTA
TTTTAAACGATTATTCATTTATTTTTTATAAATTAGTTAGTTTAGAAAAATAGATTTAGAAATTGATTGG
AAATCTCTAATAATTTTTAAATAGACTAGAGATTCAATCATTTTTCAATATTATCCGAATAAATGAACTA
TCCAGTTTAAAATAATCATTTCTTATTTTAGGCTTATTCACCCTCAAACTCCTCTATAAGTTTTTCTTTA
TATTTAATAAAAGAGCTGTAATCCGGAATCAATCTAGAATATTGAGGATACTTATCAATGAAATTTTTCA
TCTCATCCATAACAAATATCACTGATTCTGTAACAGAATCAAAACTATAAATCTTATCCCTATAAGAGGT
TTCTAGCTCAAATATATCCGGTTTTTCATTATATGTCAACCAAAACCTTTTTTTATATGCATATTCAGAA
AGGAATTCAAAAGGCACAAAATCATCTAAATTAATTAAATCATCATTTATTTGGCATGAATAAACATCAT
CCACCATATCATGGACTGGCTTAAGAGCTTCTTCCATTTGATTAATACGCTCATCAAGAGAATTATCCAT
TTTTGAAGATGTGCCGATATCTTTAACTTTTTTAAGGTAAATAATATCAGAATGTTCTGGATATTTCCTA
ACAAGATCTAAGAGCATCCTGCAATTATCCTCTTTAATATCTTCATAATTTTGTCCACGATGGATTTTTC
CAAATAGATTACACCATTGATACAAACCTAATTTCCCATCAGACAGATTTAAATCTAACTCATATCTTGT
GCTTATGAACTTTTTAGCCTTCCCTACTGTTCCAGGCAAATCACATAAACATCAGGCAATTTTATTAACT
TTTCAATGTGATCTTCCAAATAAACCCTATTGATTTCATAGTTTTTGTAATGATATGTGTCATATTCAAT
CAGCAACACACCGTCGTAAGTGTATTCAAAATCATAACCTGGCACTAATTCACTTTTCATATTTAATCTC
CATTAATTATTGCCTTAAGTATAATCAATTTATTATCTTGATTATCAAGGGTTGTAACGTCATATAAGAG
ATCAATGAAGTCAATAATTCCTTATTTATCAATTCCTCAATATTATTTGAATAAATGGACTATCCAACCT
ATAATTATTGCTTATTTTTTTAGAATTTATGCCTATAAAATTCCCCAATAAGTTACAATTATTGATTCTT
TTTAATCTTCTTTTAATTCTTCTCTATGAATTTTTATATTCGGCCATTCATTACGGGTAGGAGAAAAAGG
GCACTTATTATTTATTTCCTCAAAACGTTTGCGTTTCTCTTCAGTCCACTCTATATCATCAGTAGGGCCA
AAAACCTCTTCTAAAAAAGAATCTAAATCAGAATAGTCTTCAGCGCTCTTTTCTTTTATTTTCTTATTAT
TTTCATTCATTTTATTCCCCCTCATCTAAATATCATAAACATATAAATCAATACTTGGATTCGCTTTAAA
GAAATAACTCATCACTTTTTCATATTTATCATAATTGTTAATTACTACATATTGATGTATAATTTCTTCG
GCATATTCTCTTTCAGCAACTGTTAAATCTATTTTATCCAATCCTCTTAAATAAGGTTTTTTTTCTTTTT
CTATAAATTCATTATATTTTTTTTCAATTTTTTCTAATTGATTAAGTAAATATTTTCTTTCTTTAGAAGA
TAAATCTTCTGCAACTACAATATATTTTTTAGTATATGATTTAACTATATTTAATTCTATTCCTGTTTCA
ATTTGAGTATAAATATCTGAAATAGAATGCATATTATCAAAATTAGTAGGATGATTATGTACTGAGATTT
TCCCTCCTTTCCTAACTGCTTCAATTATTTCTTCATTAGGCACATCAACCTCATGCATTTTACCAATATA
CAATTTTGAAGCTTCCCTACCATCAAAAGTATACATTTGAAAATATTCAATATCTTTATCTTCTAAAAAT
TTGTCAAAATTGTCTAATTCTCTTTTTAGTATAGGATGCTCTAATTCAACTAATGGAGTGTTATCGGATT
TTATAATGGGTTGTTTTAGAGATTTTTCACGAATTTTAAGTTCTAAAAGCTCTTCCAGTTCTTTTTTTCT
AAAATTATGTCCTTCTTTTTTTAATTTATTATTTGGAACTTTCAACACATTATTAAAACTATTTGATGAA
GAATTAATGATTTTTCCTCTATCTTTACTAGAATCATAATCTGGAATAGGTATCAGTTGATCTTCAGTAA
ACTCTTTTACTCCTGGAGGGGCCATCATACCCAACGGAATAATATAGGGCACACTAGTGCAACGACAATT
AATCCACTCATTTATGGGTCCTGATTTGTCTCCAGGATGCAACAAGCCATTGCTGAAAGTGTTACCAACT
GCTACTATATGGCTATGCAAAGGCTTATGTGAATCTCTTACACGGGCATCATTGCCTGTCCACCACATAT
GGTATTCTACACCAAGTTCATCGTAAACACTGAATGTTCCTACATTGCTTGCGGAATTAATCTCCGTCCT
TGCTATTCGCTTTGCTTGCCAACCTTTCAAACCAGTGAATTCCTCAGTAATCTTATGCCCAACATCCTCG
ATTCCTAATCCTTTATGGTAGCTATCTGCTAGGTTGTTGGTGATATTTTTACTAACACGAATCAATGTGG
AATTACTAGCTTGAAATGTGCTGTACCTTAGGCTGTCTTCTATTTCTGGGTTGGTACGGAACAATCCGAC
ATCAGTTTCTCGCATGATTTTTGGTTCGTAGAGGCCTGTCTTACTGGAAACCTTTTTCTGTTGAATAGTG
TACAATGTGGTGGCAGTTTCCCGGGCATTGTAGAATACTGTCAACCCATGCTTCAAGAGTATGGTATTGT
ATTCTGGCTTCATATCCTCTACGATAGTGGTAACCTTGTTGATATGGAGGAAGAACAGTTCATTTTCATA
GTAGATGTCTATGAGGTTCTGTATTCTTCTTTCCAGTTTGTGGAACCATTTGCTCAAGTCTTTTTTAAGA
TTATTTTCTTCTGCAGAACGCATCTGTGACTGTTTGTCTAAAAGTTTTAGAATCCTTTTTGACTGATGCA
CTTTCAATGACATTCTTACTAATGTGTTCCTCTTGTCCAATCGGTCTTCAATTGTAATTTCCTTGCCTAA
AAGTTCATTATGCAATCCTTGCAACAAAGTATCTACTTTATTGACAATCTCAGCATAGTCATCTTCAGGG
TCTCCGAATTTTTCAGAGGCTTTAATAAGATTATTGGCCTTATTGTTCATTTCAGTTACAAACTCGAGGG
TTTCGATTTTGAACTCATTAAATTCTGCTACAGTTATGAATTCCTGTGATTTTTTAGTGTTATCATCTTC
AGGATCTTCATTTTCTTTTTTAGTTGATTTTGTGTTTTTAAATATTTCTACTACACGTGTGCCGAATCCT
TTGATCTCTTCTTCGAGTTGAGTGTTTATTTTTTCATTTATTTCTTCGGTCATGTTAGACACCTTATTTT
TGCTTTTTAAACTACAAAATTTGCAAGAGGAACACAAGGAGAATGAACAATGCTTATAGTGATCACCACT
GGGTTTTTAATCTCGCTTATGGGTATGCGTTTGATTTTTGACTTTGTTGTTGATGTTATTGGAACATTTA
AGATTTTCCTTAGCTTGTCAGTATCTTCTCTTTCGATAGTGGTTGCACTTCCGCCGGTATAGTGTTCGTT
ATGTATTCCTTGAATCACATCTTGGTTTGTAATTTTCAATGTAACAAACCATGTGCCGGTAGGATATTCT
CGTGGTGTGCTGTCAATGAATTTCACGGTGACTGGTTCTGTGTTAACATGTGATTTTATTACTGTTCCTA
TTACCTGGCCAGTATAGAGGAATTCATGTTCAAGGTCAACTATCAGCCATTCTTCATAATCCCTTGCGAA
TTGGATTATTTGATCTGCGGTCAAGGGCTTTTCCCCATATTGGTATTCACAATCCGGTAAGTTTGGTATG
AATACGGGTAGCATGATTATGATATGGTCTGGTGTTTCTTCGATAATGTTGATCAAGGTGATTGCACTCC
CATCTTTCTTTTCCTACGATTTTGTTGTTATCGTTTTTTGGTGAAAATAGATATTTTTTTAAACTCGTGC
GAAAGATAGTGAAAAAAGTAGTAAGTGTAATCTATATGTCATACAACTAGGGTACCTGCTTTTCACTATC
TTCATTATACATAGTGGAAAGTTAGAGGCTTAATGGATAGTGCTTAAAAAAGGTAGTGGGGGGTGGTGTG
TGCTTGTTTAGGATAATTTATATAAAAATAGTGATTGGTAAAAAGTAGTAAAAATAGTTAAAAATTGCTT
TTTTTTTTAAAAATAAAATAGAGATTCATTACCAACTGGTACTCAGTAACGAAGTTATATAAGTTGAGAA
GAATTTTTAGAAAAATTAGTAAAAATTTTATAAAAAATTAGTTTTCGTTAAATTATTTAACGTGCTATAT
TCCATTATTAAAAAATAAGTTTAAAGTTTACTAAAAAAATCTGATAAACTGGATTGATTTTCATCAATAA
TTAGCAAATCATCTTTTAATTTTATATTATCGTTAAACATTTTTTTATTTTTAAGATATTTGCCTATATT
TTTATTTTCAATAACATGATTATTTACTCTAGTTAATTCTTGACTTAAAATACTTGAATTTATAATATCT
GATAATCCGTTAGTTTGTAGAATTGACTTTGAATTTAATTCTTAAATCAGATGGATATTCTAAAATACTA
AAATAATAATAGCTTGATGAATCAAAAATACGATTTTTATTAATTAAATTTTTTCTTTCAAATTCCCTTT
TTTCTTTAGCGGTTCTTTTAATATTTTTCCCAGGAAAACCTGACTCTCTATTTGAACCTAGAAAATCACA
ACCGAAAAAAGGCCCTAAAAAATCAGATGGTAAAGTGTAAACATCATCAAGATGTTTATTAATTTCTTTT
TTCATATTAGAAAAATATGTTACTGCATTTCCTTTAAATAAACGATTGATTAATCTTAAAGAATAACGAA
TGATAGAAATTTTAGTATTTATTTGATTGGAATAAAAATTAAACCAAATATTGCTATAGTTATTCTCTTT
ATAAAAATGTAATAATTTTTCAAGATTACTGTTGTCCAATTTCATAGATAATGGAACAAAAATAGGTTTA
TTATTAAATGAAGAAACAACATTTACTGCTTTTTCAATATACTCCATATAATTATCCATAGAATCAAATG
ACTTAAAATCAATATCTGGAATCAATACAAATAAAGTTGAATATTCATACATATAATCTAATAAATATTC
GAAATTAGAAAATGAAAGGGGTTTACTGTGCCCATGAGTAAATTTATTAGATTTAAATGGGTTTTTTGAG
AAAGTCAAAGATATAATTGATTTATATGATTTAAATGTATTATCTACCTTAAAAAATTGATTTAATTTTG
ATTTTTGATTATTAGGAGAATTTTCAAGTAAATTATATAATGCATCATATGATTTTTTATTATTGATAAA
TTTAGTAGTTTCAATAATATTTCCTTTAAGAGGCAATTCTAATTTATTTAATTTTACTTTAGACACATTA
AAAATCTTATATGGTGTGTTTAATATGGTTTTATCGTCAAAAGATAATTCTTTAGTAACATAATTACTAT
CTTTTGCTTCAATAACTTTTTCTACATTAATAAATGAATCAAATTCAACCATTTTACTCTACATCCAACA
TTTTAATCGCATCATCGATTATTTTTTTATAATTTTGTTTCCCAAGACTACAAATGAAATTCCCTTGAGT
TTCATCATGATTTTCGATTGCAAATTCAATATCTTTTAATATATTTGCAGCATCAATTTTTGAAATAAAA
TTATCTTTTGAACAAAATATAATAATGCCTATTGTTCCAGTAATATACTCTTGTAATTCTTCAAAATTTC
TTTTTGCAAATTTTCTTGCTCTTTTATCATCAATAATTATGTATTTCACTTGATTTAAAGACAAATAATG
TAAAGATAAACCTATTACTTCATATTCTCCTTTATTTTTATTTTTTTCTTCGTTAGATAAAAGAGGAGCA
ATTAAAGCAGAATAATTGTAATTATTGTTTGGACAAAAATGTAATTTATTAATTAAGTTATTATCAAGGT
GTTGATTTATTTCTTCAAAAACTTTTGAACCAATAGCAAAATTATAATAATCTAAAAAATTATAACAATT
GCTTTGTTTTAGTTCCTCTAAAAAACCATATGAAAGAAACCTTAGGAAATCTGCAAAAAACAAATTTATT
ATAAGATTCCTGATAACTCATTATATTTTTCCTCGCTAATAACTTTTTTTTCAAATAAATTTTTTGCAAT
ATTTGTTTTTTTAGATATTATATTTGAATACACTTCTGATTTTTCAGTGTACTCTGGGAACTCAGTATAA
ATCAGCAGTAATAATTCTTCACAATCTAAAGAACCATATAACCTATTTAACATACTTATAGCGGTATTTA
TATGAAGTAATTCTTCCTGATTTTCATCTTTAATTTTTTGAAGAAATTTTAAATATTCTTTATAACCTTT
ATCAGTGATTTTTAAAAATCCTCCACTAATTTTTTCTTTCGGTTCAAAATATTCCCAACAACCATCTAAA
TAAAATGGAGTTTCACAGCACGAATTAATTAAATCTAGATAGGGTCCTTTATAATGTTTTACAAAGGAAA
ATAATTTTTTTAACTCTACATCAAAGTTATATAACAAATATATTTCTTTTTGAATATGCAATACAGATAA
TTTATTTTTAAAGTCCCCTAATAATAATAAAATTAAATATTCAATATATTTTTGTTTATATTCTGCATTC
GATAAAGTCATAATGTTCACTCATTAAGATATTTAATATTTTCCTATTTTTTTATTAGGAATCTCCTATT
TTTCTAATTCAACTGAATTATTGACATAATGATGATTAGATTCAATAATTTCGGAGTTTAATTCTCAATT
TTTTTTCAAATAAAATTCTCTTTCTAAATTTTCAATTGTAAACTCTTAATTTGTTTTCTTTACTCTTATA
AGTTTTCCAGGTATTCCAAAAGAGCATAAACAGTTACTAGCAAGGTTTATAATAAGAATTATGTTAAAAG
TAGTATAAAAAGATTTAGAGATAGCATCTGAAAAGTAAAAAAAGAAAAAATCAGGATTTATAAATAACTT
AAACTTTAACACCCATTTTTTCATATAAAGACTTTTTATAACTTTCAAAAATAAGTTCCTTTTCAGCATC
GGATATCTTAGGGTCATCAAGAAGTTGCATTATTCTATTCCATTCAGAATCATCAAAGCCCATTGAATCT
ACTTTTTTCTGATTATCCATTTAGGCATTTTTTATCATCATCTCTACTGAAATATATCTGCTTATAATAG
AATCTCCGTTAAATTTCATCCAAGAATTTTCAGGACTTGAACTAGCTCTAATATGGTTATATCTATCAAT
AAACTCATCAAAATCTTCATAAGATTGAGGAACATCATTAAATTGAGTTATAAATATATACTTATTAGTA
TGTACTAGCACGTATTTAATATTTTCCGACGCATAAAATCCCTTAGAAAAATCTCCAGGGCTTAAAAAAG
TTCCATCTTGATGATTATGTAACACAATTAATATGTCTTCGCCAAAATCTTTTTGATTAATGGATTTACT
GAACTTCTTTTTCCATCAGTATATAAAATTCTTGGTTTATAATCATTTGTAAGTTTTTCAAATCTGCCTT
TACTTATATTATATACCATTGCCCATTCATTATCATCTTTAATTTTTAGAAAAATTTATTAAATTATTAA
TCAAGAAATTTAAATTTTCATCTTTGTCTAATAAAGGAAATCATTTTTTTTTAAAAAGTTTTTTATAATT
GTTAATATATAGTTAACTATATATAAAAAGTTTGAATATTTACAAATATTTTTAATAATTTTTTCTAACA
ATTTGTATCTTATCAAACATTTTAAAAGATAAGGGGGACTACTTATTTTAAAAGAAGGATTTTGAAAAGG
GTACTTTAAACGAGTATCCGTAAAGGGCCAAAGAGCGTTCTGGGTGGAACCAACAATCTCATCCCGATTG
CTAATTTTTATTAGAAATGATTTAAAAAATGATATAAATGAGCTACTTGGTGAGCCAAAATGTGGTAAAG
GTTCTGCAGGTATAGGTAATTTAGCTCATATGCCTTGGTTAGATTTTACATTGCATAATATTGATGAAAA
CTTAGGTGCTATTAATGTTGCTTATTTATTTAAACCAGATATGTCTGGATTTTATTTAACATTTAGAGCT
TTATTTTATCAAGAAATTGAGAAAAAACATGGCAAATATTTATTAATTTATTTAAAAAATAAATCAAGAC
ATATTAGAGAGTTTTTAGAGGAATCTAACAAACTTAGAGATGATTTTTTATTTAATATGGACTTCTCTGA
AGACACAGCTGTACTAAAAAAACATAGTGCAGGAACAATTGTAGCAAAATATTATGATGCAAGTAATGTG
CCTTCCGATGAGGAATTAATAAATGATTTAAATTATTTTTTAGATTTATATGCTTTTGTCATTGACAATT
ATGAAAATAAAACAGATCTTTCAGTAGATGAATGGGTCAAGGTTTTAGAAAATAAAGAATTAATTGATGA
TAAGATGTTTAGCATTTTAGAAATCATGAATGAAATGGATAATTATTCCGCTACTACAAGCCAGATTTCT
AAAAAAAGGGAAGAATTAGGATTTTTGGATGAAAAGTCTTATAATAGTATTATTATTTCTAATTCAAGAA
AAATTAAAGAATTCTTAAATAAAAAACCTATTTATAATGACGATGGTACCGAAAATTATTGGACAAGGTT
CTTTTATGGAAAAAATGTTGATGGTGCTTTTGAATTTAAAATGAAGGATGAATTAGTTGAAGCTTTTAAA
AAAACTAATGTGGAAAAACGAAAAAAAGGTGGGGAAGAAGTGACTAAAAACTATAACTCTTTTTATGATT
TCCTTTTAGATAATGGTTATTTGTTTGATAAAGGAACTATTGAGAATTATTTGCTTTCTTTAAAGGTTAA
GCCATTTGCTATTTTGACTGGTAACTCTGGAACTGGGAAAACTAAATTATCTCAATTGTTTTCTCAATAT
ATTTCTAATAATAATCCTATTTTAGTTTCTGAAATGAATAGATTATCAAAAGATACTGAAGATTTTGTAG
AGGTTCAGGTTACTACAAGAAGATCTTCGTGGAATATTTTTGAAAAAGGTAAAGAAATGAACCCTGGTTG
GACAATATCAAATGAATTTTTTAGTAATTATTTGCCTATTGATCAATTTAGTGGTGAATATCAAATTGAA
GTTGATGGAATTGAAGGTAATGGGATTATTAGTCCTGTAATTCAAGTATATTATGATAAAAATAGTTTAA
AACTTAAAAAAGAGTTTGAAAAATTGTATTTATCCGAATTAGAATCAATAGAAAAAGATAAAGAAAATAA
AGTTTCACACGAAATTCAATTAGTTGGTTTAGAATTAAATGTTAATTCTCTTGAAAATATGGTTAATACT
AATTTTACAAAATTTAAGGGAGATATAAGTTTTAAAAAAGAAATTACAACAACTTCTATTAAACCAGGAG
AATTCATTGTTCCTTATGAAATATTTGATTATATACCTTTTAATAAGAATCAAATGGATTGTAAAATAAT
TTCTTGTGGAAGATTTTCTAATGCTAATATCCATATTAAGTTTAAATTAAGAAAATTAAGTAAAAATATC
CGAGAGTATTTGGAAGAGAAGGGTGTAGGGGCTGAAATTGATGTTAAAATTAAAAATATTGACACTTCTT
TAGAAAGATTTAATCCAGATTGGAGTTCAGCTAAAAGATATTCTTCAGAGCAAATTGCACAATTAAACGA
AAAGAATATTGATTTAATCGACTTTAATTCTCAAAATTACAAAATAATCCCTGTAGGTGCTAATTGGACT
GAAAACAGAAACATAGTAGGCTATTACAATGTAATAACCAATAAATATCAATCCACTCCAGCATATGACT
TAATCACACAGGCACAAAAGTCTGATGAACCTCACTTCTTAATTCTTGATGAAATGAACCTTTCCCATGT
AGAGCGCTACTTTGCAGACTTTTTATCAGCTATTGAAAGTAAAGAAAAAATACCTCTCTATGGAGAAGAA
GCTTTAGAAATCCCTGATAATCTGTTTATCATAGGAACAGTCAATGTAGATGAAACAACATACATGTTCT
CTCCTAAGGTTCTAGATCGTGCTAATGTCCTTGAATTTAAAACATATTCTGCTGCATCCTATATGAATGG
CGATATTAAACTATCTGGTCCTGATGGAAACCTATCATATTTAGAAAATCCATTGGATGGTAATAATATT
CGTAGTAAGGGAATAGATGAATTAAGAGAGTTATTTGATGGAGTTAAAGTAGAAAATAAACCTTTCTGGA
ACATTTTATCTTCAGAGATTGAAAAGTTCCAATCTGTATTAAAAGTATCTGGATTTGATTTCGGTTTCCG
TGTAATTAATGAAATAGTTCGTTTCATGGCTGTAGCATGGGAATATGAGAACAAGCCTGATGAATTTAGC
AATTGGGAAAGATATTTTGATGCCCAAATAAAGCAAAAGATGCTTCCAAAATTACATGGCTCCGAAAAGA
TCATTGGAGATACAATTGATGAGCTTCACAAGATCTGCTTGGACAGTTCCATTGATGATGTGGAGATGGC
TAAATATCCAGAATCCTATAAGAAATTAACTGAGATGAGAAAAGTGCTTCGTAAGCAAAGATATGTTTCA
TTCATTAACTAAAATCTTATCAGTTTTAAAAGAGATAATCATTAAACTATTTTTCAGTATGTGCATAATT
TGCACATACTATTTAATCAAATCGTCATTCAATTAAAGGTGCAACATGGAGCAATACATTAAAATAAATG
CTATCGATAATGAATCTAATCAATTGGGAACATTCAAAATCTCAAAAGAATATGATGGATACATACCATC
TATAGAAAACTTTAATAAAGAGATTATTTTAGAAAACCTTATCCTATACAATGTTCCAATAGTTGAATAT
TTTGATAATAAGACTCCCATTCAATACTATAAGAATGATAGCTTTAATGCAAATATTCTTCTTCTTGAGG
AATATGAGTATACAATTGAATTTGAAGGCGATCTGAATCTTGATGTTTATGAAAGTTTAAAGAACAGCAA
AAACAGTCCATTGAAGTTGCTGTCAAACACTAATTCTGGCTTTTTAAACTTTGGAAGCTATGTAGGCAAG
ACATTTATAGACATTTATAAGGATGAAGGCCTTCTTTTCAAATGCCCTATAGAGGTTCGTTCTCGCAAGA
TAAATTATGCTAAAGACTATGCCACTATGATTGGGGATTTGTCTCGTTTTTCTTCTGGTCTAATCTATGA
GCTTAACTCCCCTGTCTATCAGTCATTGGAAGTAAGTGACATCAATAAGACTCCATATGAGGATTTTATG
CTTCTTGAGTATCTATTTGAGGATGAGAATCTTCCATCCACTGTTGAGTATTTGTCTCGCAATTTGTATA
CTTTGCTTGAGGAGTCCAGGGAAGAAGTTCCAAGCTCCCTTGCATCTAATATTGGGCCTAATGAGCTTGT
TGAGGTCTTTTCTAACAGTGATAATTTGGAAAGGTATGATGGCCTTGATAATGGTCATTTGGATTCTGTT
TTGTCTAGAACTAAAGGATATCTTCCATTAAAGATAAATGAAATAAAGTATGTGGACAATATAGACACTC
CTGAGAATCGATTCTATAAAAACTTTCTATTGTATATAGATGACTTGATTGATGATTTAATAAAAAGGAT
AGATGAAGGCTACTCTTTGGATAAGCTTCATGAATATAAGGAAACACTTAGCTATTATCTCTCTTCACGC
TATTTTTTAGACATTTCTCCTATGGATTATCCTCCTCTTAATTCACAGGTTTTGCAGAAGAAAGAGGGTT
ATCGTGACATTCTTGAATATTATCTTTTATTTGAGTTCGGTTTCAAGCTTAACTGGAATCAGGTTGTTGA
TGATTTTCGTGGCTATGAGAAGAAGGTGTATCGTCTTTATGAATACTGGTGCTATTTTGAACTCTTGGAT
ATAGTTGGTGAATTGACAGATACTGAAATACGTTTTGATGATCTTTTTATTGAAGAGAACTTGAACATCT
CCCTTAGGGAAGGGGCTATCAAAAGATTTGACTTGAACTTGTCTGACTTGTTGGACAATGATTTGCCTTC
ATCTGATGATTTGGACATAAGGATAGACTTGATGTATAACAAGACCTTCAATAAGGATATGGCTTTTCAT
TCCTATTCAGTTGCCTTAAGGCCTGATTATACCTTGTCAATAGAGTTTGGGGGTAATGCTTATCGCATTC
ATTTCGATGCAAAGTATAAATTGAACATCAATGATGAATCCTTTAAGAATGATGATATTGTAAAGATGCA
TTCCTATAAGGATGCTATTGGGGATACAATTGCAGCATATGTGCTATATCCTGGAGATAGAAAAGAGATA
TTTTTATGAAGATGATGTTCATTTAAGGTCTGTAGGTGCCTTCCCCTTAAATCCAAGTGAGGATAGGGAG
AATAAAAAAGAGATATTGGACTTTTTAACTCGTCAGATTATTAAGTTGCTAAGTGTGGTTTAGTTATTAA
GATATCAAGAGTAATATTGGTGGAAAAAATTTAAATAAAGAATGGAAGTCCATTCTTTATTTTTTTTTAC
TTATTTTTAACATAGTTTTTAAGCTATTCCATTGGCATTGAATTCTATATTATTTTCACCTTGAAATTAG
TGCTAGTTGCCTTATACATTCCATCTCCTGCAAATTTGGCTGTACAGGTGTATGTTCCTTTTTTATTTAA
AGAAACCTTTACGCTAGCAACTCCCTTATCATTTGTTGTGCCTGTATAGGTCTTGCCGTTTATAACAAAG
TTGATCTTCTTGCCTTTTACTCCATGTCCTTTATCGGATAGGAATGTTGCAGTGATTGTCTTTGTCTTTG
CACTGGCTTTATATGTCTTTGCAGGTGCGGTTATCTTAGGAGCTTGCTTGCTGACTTTGATGATTGCAAC
TTCAAATGAGCCTGCATATTTATTGTCTCCCAAGAATGCTATTGCAAAGGTGTATGAGCCTTCATATCCA
AGGTTGATCTGTAGTTTTACACCGCCTGTAGCATTTGTTGTACGATTATAGACTGCTCCATTGAATCCTA
TTTGAACTGGCATGTTATTTAACGGCTGTCCTTCATCGTCGGTTAGGTTTACTTCAAAGTATTTGCCTAT
CCTGCCATCGACCTTGGAATTGACAGCCACTGTGCTCATGTTCTGATATAGGATTCTTGTGCTTGTTCTT
TCTCTGCTAATTATTGTTATATTGTTTTCATAGCTTTGATTATTGTAGCTGCTTGTTATCTTGTATGTTC
CTGGAGCTTCGCTTATCTTTATTTTGGCCACACCCTCATCATTAGTTTTAACTGTTGTTGTATTATTATT
GATGGTGAAAGTGACTTCCTCTCCTGGTCCTACAGATATATTATTCTCTGTTGCAGCCCTTACGCTGAAA
TAGGAATCTTCGCCATATTCAATAATCATGTCATTGGCGTCTGCTAATTTTGTAGTGTCATTGAGTGTGT
ATACTTTAAGACAGACAGTCTTATTTAAAGGAGCAAAGTCGGTCCAAGTGCTTCCATCAGCGCTTACAAG
GGATGTTCCATTTAGGTAATGGACCCTAGACCATGCCTGATAAGGAACTGAATTGCTCTTGAAGACTACC
TTGAACTGGTCTCCAGACTTAATAGGGATGTAATTATTTAAAACTATTGTCCTAAATCCTGCATATTCGC
TTGTTCCGTTTTGGGTTTGGACCTTTTTGTCGTTTACAAATATGTCAAAGGAGTATTTTATTCCTGATTC
ATTGAAATAGGTTCCTACTGCTCCTATCAGCTCGTCGTACTTTGAAGTGAACTCATTTGAATAGATTGTA
TAGTTTTGGTCAAATCCTGCAAGGCAGGTAAGGTCTGTCTGATAGTTTACATGATAGTCAATGTCGTTTT
CAAAGATATAGGCTACTGCAACCCTTAAAGGCACAATGGCAAAATAGTCTATGTCCGCGAAATTGATGTA
TTCTGTATTTGAGTATCCGAAAAGGGAATCCTTGGTTATCCAACACCCTGGGGCTCCGCCAAAATCATTT
GTAAAATTGTCGTCCCATCCTACAAGTGAAATGAAATGGGTGTTATGTTCCATAATGGAAATGTCCTCTC
CTTCGCTTAGTATTTCCTCACCTTCTCTATATGCCCAGTATTGCACAGTGACAGCGCCGTATTTAATTAT
CGCTTTTTTCAATTGATCTATTGTGTTGTTTTCTCCTGTATATATGAACATTGCATCCTGAACGTGGATT
CTAGGAACATTCATATCACTATCTGCAATCATTCCACGGTCATCATAAGCTGCATCTGTAGGCAAGACCC
CATACCAGCTTAATGCATAGCCTAAGCCGCTGGTTATGAATCCTGTCAGGCTGTTTCTCAAATCCCCCAC
TTCATAATATTTCAATTGAAGCTTCTGCACATAGTTCTGTGAGAGATTGTAGAGCACTCCTGTGGATTTG
CCAAGGCCTGTTTCAATGGAGGCTATTGTTGCAAATGCCCAGCAGTCGTCATTGTCTCCCTGGACTTTTC
CAGGTGTTGTCCATCCCCAATCCTGTGAATTGAATTTGGATGGGAGGGAGTCAACAATTATTTCATTATT
TGTTAGATTGAGTTTTATTCCAGGGGTTTCAACTGAAACGATGTAATTATGATTGTCCATGAGGAATATG
TCATCATTCTTATTGACGTTTGTGAAATTTGAATGGCTTGCAAAGTCTGCATAGACTGCAATTCCCCCAT
TGTCAAATGTGGAGTCACTGAAATCCGCTGCAACGTCATGGGCATAGATTGCATTTGCGGTAGTTGGGGA
TTCCTCAAGAGCGCTGTTATTGATGATATCGGAGGATTTGATTGATAGGTTTCCTTTGTCAAAGTATATC
GCTCCTGCATTCTTTTCTGCCTTATTGTTTTTTATGCTGGAATCTGTAATGTTAATGTTGGTCCATGAGG
AGTATATTGCACCTCCCTCGAAGCTTGCATAGTTATTTAGTAAATTGCTTTTTTCGAGATTCAATCCTCC
TCCTAGAATTGATATTGCCCCTCCATATTTGCTGCTGCAGTTTGTGAAATTGGAATCGATAATGTTTAGG
CTTTGGGCAATCCTTTGGGATCCTGAGTCAAAGTCAAAGTGAATTGCTCCCCCGTCGTTGAGGCAGGAAA
TGTTTTCAAATCTGCAGTTTTTGATTATCATAGGGTCTGATGGAAGGTATTGGGTTTTATTAGCTACTTT
TATATAGGCGGGGAAGTATTTTCCAAGTATTGCTCCGCCACTTAAATTGGAATGTATATTATTGAAACTT
GAGTTTTCTAGATCTAGGTAATATCCCTTGAAATCAATTATTGCACCGTTCTTGAAAGTGAAATTTTCAA
ATCTGGAATTGTGGATGACCAGCTGCCATCTGTTGGCTGAAATTGCTCTTTCATAATTGCCATTTCCAGA
AAAGATTGAATTGTTTACGGTTATATTTGACTGGGATCCGCTTATGATATTCTTTGCGCGGTTTGAATAA
AAACTGCAATTATTTACATTCAAGACGCCCTTGCTTACAAATATAATGCTTTCAAGTGATTCAAAGCTCT
CTGTAAAGTTGACATTGTTTAATGTAAGCTTTCCGTAAATTTGTAAAACTGTTTGGTTGAAATTCTTAAA
TGTCAAGTCATTAATTACAATTTCTCCCTTATTGTTTTCAAAATCAAATTCTGCCCCCATTTCATTTCCG
TCGATGATATGGCCATTTCCATTGATTGTAAAATTGGTCTTATTCACTGAAATTAATGGGCCGTAATACA
TTTGGTATAAGCTGGCATTGTCATAGCTTTTATTGAATATATAGTCATGTGTGAGGTTTAGCTCATCATC
TGATTGATTGATTTCCTGATATAAAGTTGTAAAGCATGTTTCATCTTCTATTTCTGGGGGGTTTGTGTTC
TCTTCTTTTAAAATATGTTCATTATTGTTTTTCAGATTTAAATCCTGGTTTTGATTTGATTCATCATTGC
AGATAGGATCAAATTCCATGTTTGTTTGATAATCATTATCTATATTTGATGCATCAGCTTGGAGTTCACT
TGCTGAAACTGATGAAATGCTTATTAGAATAGAGATAATGATTAGAAGTATAAAAAGTTTAGATTTCATA
GTTTTCTCCATTTATAAAATTAATTATTGTTTTTCCTTTATAGATATGAGGTAAGTGTTTTTCATAAAAA
TTTAATTTTATTGCATTGATTTATTTAAATTAATCTATAATATAAATCATTTAATTGCATTAATCTATTT
AATAAACTTATCTATAATATAAATAATTTAAATAAGTTTCTAAATTATTCCGGCACCTTAACTTTTGACT
TGCTATTGTTTAGTTAAATATGGCATTATTATTGGACAATTTACTATACTTTTTTAAATTTCTTATAATT
GTGTATAATTTTGTTATTATTAATTAACTGTTTTCCTAGGTTAAATAATCTTTCCTAAACGATATTCAAG
CCATATATAAAGATTTAAATAATTATTTGTTCATAATATTATTAGAGAAGACTTTCCATTTTGGATGTTT
TCTATATACTTTTAGGAGATAAATAAAATGAAAGGATTGGCAAGAATCGAACAAGATGTACTTGGCTGGG
TTGATGCTGAGCTAGACGAATGCGGACCTTATGATGCTATCTGTAAGCCATTGGCTATGGCACCATGTAC
CTCTGACGTCCATATTGTATGGGGTCATGCATACATGAGCGATGCACCTAACCGTGTAGTTGGACACGAA
GCAACTGGTGAGGTCATTAAAGTTGGGGATAAGGTTAAGGACTTCAAGCCTGGAGACCGTGTAATCGTTC
CTGCAATCACACCTGATTGGCTGACTGTGCCAGCTGAACAAGGATTCTCCCAACACTGTTATGGTATGGG
TACAGGAATGAGTTTTGTAACCTTTAAGCATGGGGTCTTTGCAGAGCAATTCCATGTAAACCAAGCTGAC
GCTAACTTGGCTCACTTGCCTGATAATGTAAGCCTTGAACAGGCTGTAATGATTTCAGACATGATGACCA
CCGGATTCTATGCTGCAGAGCTTGCAGACATTCAATTTGGTGATACTGTAGCTTGCTTTGGTATAGGTCC
TGTAGGACTTATGGCATTAGCTGGTGCTCAAGTTAAGGGTGCTTCTCACCTCATTGCTGTAGGAAGCCGT
CCAGCAGCTATCAAGGTTGCTAAAGAATATGGTGCACATGATATTGTAGACTATCACAACGGCAGTACAG
TAGAACAGATCATGGAATTGACCGATGGAAAAGGAGTAGATAAGGTTGTAATCGGTGGAGGAGGTAAGGA
TACCCTCTCTGAAGCTTTGTCTGTTCTTAAGGTCGGTGGTGTAATTGGAAACGTATTGCACTATGACGGT
ATTGAAACCATACCTGTAGACGGTCTTTCATGGGGTCAAGGACTTGCTGACAAGACCATTCGTGGAGGAG
TATGTCCTGGTGGACGTGCCAGAATGGAAAAATTAGCTAATCTTATTGAATATGGTCGTTTCGACTCTTC
TAAATTGATCACTCATAAGTTTGATAAGTTTGAAGACATTGAAGAAGCTATGATTCTTATGAGAGATAAG
CCAAGGGACATGATTAAGCCTGCGGTTATTTTAGATGAATAGTTGTAAGATTTAGGCTTATTTTTGATAG
AATTTAAGCTTTAGGCTTATTTTAGAGAGAATTTAAGCTTGCTTTTATTGTTTTTATGGTTAATATTTAA
CCATAACTTTTTCTTTTTTTAATCTGTTTTTTTTTGTTTATATTAAAAATTGGCAAAACTATATATTTAT
GAAGCCATATAAAACTTAAATAGAATTCTTAATTTAGACTCTTTTATGAATTCTAATTTTCACTGATTTT
TTTAGTCCTATGGTGTAATGGCAATCATACGAGTCTCTGGAACTTGTGACTCCGGTTCGACTCCGGATAG
GACTACTTTCTTTTTTTCTTTTACTATCAATGTGTTTTTTTGCTTAAACTTGAAGAAATAATGAATTGAC
ACTCTGACTGTTTTTATCTGTGGCTTATTTAAGCCCTGGAGAGTAGGTTTTTCCCCGACTTAGCTTAAGT
TTGTGGTTTAATGTTGGTTTTGTTATAACTTACCTATTACTTTATATTTGCTTAATGGTAGTTTTGTTAT
GACTTACCTATTACTTTATATTTGCTTAATGGTAGTTTTGTTATGACTTACCTATTACTTTATAGTTGTT
TAATGGTAGTTTTGTTATGACTTAACTATGGCTTTATAGTTGTTTAATGGTAGTTTTGTTATGACTTAAC
TATGGCTTTATAGTTGTTTAATGGTGGTTTAATCATTGCTTACTTCTTATTTTATTATAACTTGACTATA
ATTTATTTATGATTTATTTCTTGTTTAACTAGTGGATACTTATGTCTTTATTATAAGTTTATTATAATTT
ACTTATGGTTTATCTATTGCTTAATTATAGTTTACTTATAGTTTACCTATTACTTTATTATGATTTAGTT
ATAGTTTACTTATAATTTACTTATAGTTTACTTATTGTTTTATTGTAGTTTAGTTATAGTTTACTTATAG
TTTAGTTATAGTTTAGTTATAGTTTACCTATTGTTTTATTGTAGTTTAGTTATAGTTTAGTTATTGTTTA
CCTATTGTTTTATTGTAGTTTAGTTATAGTTTACTTATAGTTTAGTTATAGTTTAGTTATAGTTTACCTA
TTGTTTTATTGTGTCTTAGTTATAGTGTACTTATAGTTTACTTATTATTTGCCTATTGCTTTGCTATGGC
TTACTTATAACTTACTTATAGTTTAATTATAAGATTACTAGTGCTTAGTTATAGTTTACTTATGGTTTAA
CTATATGATTACTAGTGCTTAACTATGTCTTTGCTATATCTTAACCATAACTTATCTATTGCTTTATTAT
AGCTTAACTATGGCTTTATTATTATTTGCCTAGTTCTTTGCTATGACTTTATTATTGTCTGATCTCTTCA
CTCTTAAGGCTGAGTATATTTTTCTTTAATTAAAGAAAGATTAATATATTGGTTAAAACTATATATAATA
ATTAGAATGTTATTATTTATTAAATTACTTGATATTTAATGGTTATTTACTTATCTGATTGATATAAATT
AGTTATCAGATTACTATGGCTTTATTATGTCTTTGTTATCACTTAACTATTGATTAATTATAGCTTTATA
TGGACTTAACTATGGCTTAATGTATGGTTAGTTATGCTTTAGCTGTTGTTTAGCTATTGCTTATCTATTG
CTTAATTATGATTTAACTATGGTTTAGTTATTCCTTTGCTATAGTTTACTGGTGATTTAATCAATGCTTT
ACTATAACTTAATTATAACTTTATTATGATATTGTTATGGGTTAATTATGGCTTATCTATTGTTTAGATG
CTATTTAGTTGTTGTTTTGTTATAACTTTGCTATTGTTTAGTTATTATTTGGTTATAACTTGCTTATTGC
TTTGTATTTGTTTAGTTATAACTTTGCTATTGTTTAGTTATTATTTGGTTATAACTTGCTTATTGCTTTG
TATTTGTTTAGTTATAACTTAATTGTGGTTTAATTATTATTTGCTTCATATTTAGTTCTTATTTAACTAT
AAGTTTCTTATAAGTTTCTTATAATTTGCTTATTGCTTTATTATATCTTAGTTATTCTTTAGTTATAACT
TAACTAGGACTTGATTATAACTTTATTATAAATTTATATTTGCTTTATAACTGCTTTATTGTGGTTTTAT
TACAATTTACTACTTACTTATTGGTTATTTTATTATAATTTACTTATAGGATTGCTATAAGTTTCTTATG
CTTTACTTATGACTTAACTAGTGGTTTATTATGGCTTAATTATTATTTGCTTATGCTTTACTTACAGGAT
AGTTCTAGTTTAACTATTGCTTTGTTATGGCTTTGCTATGGTTTAGTTATAATTTAATTATTGCTTTATA
TCAGTATTATTGTCATTTACCTATAGTTTAGTTATAATTTAACCATTTCTTTAATATAAGATTGTATTTA
CTTTATGATTGCTTTATAGTGGTTTAATTATTATTTACTATTCATTTAGTGGTGGTTTTGTTATTATTTA
CTTATAGGATTGTTATAACTTTATTATAGTTTAGTTATAGTTTAACTTTAATTTACCTATAACTTTATTA
TTGTTTTATATTTGCTTAATAACAACTTAATTGTAGTTTATTTATAATTTACTATATATTTACTAGTTAT
TTTATTATAACTTACTTATAAGATTATAATAATATACCTACTACTTACTTATACTTTAACTATAACTTGC
ATATTACTTGCTTATCTTTTACCTACTAATTACTTATAGTTTAACATAATTTACTACATATTTACTAGTT
ATTTAATTATAACTTACTTATAAGATTATTATAATTTACTTATATTTTACCTACAACTTATTTATACTTT
AACTATAACTTGCATATTACTTACTTATAGTTTACTTATTTTTTAGCTATTACTTACCTATTATTTACTT
ATAGTTTACTTATAATTTAGTTATAACTTACTTATACTTTACTTATAGTTTACCTATAACTTAACTATCC
TTTAGTTATAACTTAACTATTATTTTACTATAAAGATTCAAAAAAAGATTAATTTATACAAATTTTAACT
TGATGAGAGGGGGGGATGAGAATAAGAAAAATTTCTAAAGTGGTGTATCAAAATCATTTTATTGTATTTA
GCCCTAATTAAATACACAGTTACAAAGATCCTATTGATTTGATTTCACAATCTTTTAAGGAAAAAATACT
CTCATCCAATATGATATGGTGCTTAGCGCATAAGTCTATTTGGAGCCTTATTATTTATTCAACTTCAGGC
ATAGCAATGTCATGTCATCGAACTGTTCAACACCTTTAGAGAAAGTGTTTACATCTGATATCAATGGTTT
TATAGGGACTTCATCGCCTTTAAACTCATTTAAGAATTTTAAAAGTCTATCTTCGCCATATATATTGGAA
TCCTCATCTGTGGCATCTGTTATTCCATCGGTATATACTATCAGCTCGTCCTTTAGTATTATCTCTTCGT
TTATATAGTCGAAGTCTCCAGTTATCCCTAAAACAAGCCCTGTATCAATGTCCAAATACTTGAATTTCTT
GTCTTCTTTTACTAATGGAGGGTTGTGGCCGCCATTAGCAAATCTTACTTTTTTAGTCCTTGTATTATAT
ATTCCAAGCCATAATGTTATGAACATACATTCAGGGTTATTTTCACTTAACTGATTATTTAAAGAATATA
AAACCTCTGAAGGGTTTAAAGTTTGTTTTAAAAAGTTTTTGATCATGAATTGAGTTATCATTGAAAGTAT
GGCTGCTGGGATTCCTTTTCCTGAAGCGTCACCAATGACTATAGCCAGATTTTCATCATCTACCATATAG
TAATCAAAGAAGTCTCCCCCTACCTCTTTTGCAGGAATGGAATAGCCTTCCACTGTAAAGTCATTTGTTT
TTATTGGATTTTCTGGAAGTGATGACTCTTGAATTTTAGTTGCAATGTCCAGTTCTGCATTGATTCTTTC
CTTTTCCCCTTCTATTTCTCGAATATTTTCGATATAGTTGTTATTGTGCTTTATCAGTTCGGTATATGAG
CGGGCAAGTGTTCCAATCTCTGTCTTCTCATCGGTATACTTGGAATAGGTCTTTACCAATCCGTCTTCAT
CAATCTTCTCATTTTCCTTAATGAATCCTTCGATTTTGGAAAATGATGAGATAGGCTGAACTACTTTGTC
TTCAATATATCTTAAGATAAAAATGCAAGGAATGAGGAACAGGAGCAATACCGTATCGGTTATTATAGGT
CCCCACATTAATACTAAGTAGACGTTATCGCTTTGACTATATGCACTGTAGCTGATCATGGAAATTGCTA
TTCCCAAAACTCCAAGGATAAATGTGATTATAATGAAATTCCGCATTATCCTTCCGCTGATTGTATCCTT
GTCATTCGGTGTTATATCATATTCGAATGGCTTTGTCAGATAGGCAAATAGGAAGATTCCCAAAACTATC
AACTCTATGATTCGCACCGTTGTATCATCAGTAGTTATAAATGATGTGGCTAGGATTATTGATGTGATGA
TTATCATGCAGAATATTGCCTGATATATTCTCTTGTCAACATGTCTTTTTGATTTTTTTGGTGTTTCGAA
ACAATCATATCTGTTGCAGATCCAAATGCCTATTATTCCATAGAGAAATGCCATTGTGGTAAAGCTCATG
AAATAAAAGAGGATCATTATATAAAATCTATCAACCCAGAATATAAGGTTAAAAGAGATTCCTTGGACTG
TTGAATAGATAAATCCACAGATGATGATGCTTACTAAAAATAGGGAGATGTGGTAGCTGTTATCTAGTTT
TGGCTTTGTAATTGTATCGGTTTTAAATCCAGAGTACCAAAGCCTGTATCCTAAATATGAGACTCCAAAG
GTGAATATTTCAAAGGGCAGTGTTTCCATAAGTGTGAATCCGTTTATTAAATTTAATGTCACGATTGCCA
ATGCGACACCTAAAGCACCATATGGGCCGAATAGTAATCCTAAAACATATATTAATCCTAAATCTGGGGC
TAACATTGACATTCCGCCAGATATGGGCAATAAAGTGACTGCGAAACTAACCACTCCCATAATTATAAAT
GATATTATTGTTTTCTTTAGTTTAGATATCATTTTTCCACTTTTTTAAGGATCTTTTATATATTTTAGGA
CTTTTTTGTTAACTTTAAGAGTCTTAATATTTTTAAATGGTTTTTCTATTTATTTGCTAGTTATTTTTGT
ACTTTGGATATTTTAAGTGTTATTTTGATTGAATTCATTCAATATTTAGGATTTTTATAAAACCGGACAT
TTTAAATATTTCTTTAACTGCATCATTGACGTTTCTGATGACAAATGGTATGTCCTCTGATTTTAATTTC
TTTTGAGTTGCAATCAAAATCCTTAAACCGGCACTGGAAGTATATTCTAAATCGCCTAAATCCATAATTA
ATGAGTCAAAATTACCCATTTCAGCATTAATTTCTTCCTCTAGCTCTTTAGCACTTATTGTATCAATACG
GCCATCTACTGCCATTGTTAATTCTTTTCCATTGTAATTTTTTATTACATTCATTCTATCATCCCTAAAT
TTGATAAGTATTATTTTTTTTTTATATTATATGTTTTTTATTATGTGTTTTTTTATTATGTGTTCATTGA
CTTTTTGTGCAAATAATTCATATTTCTCTTAATTAGATTTGTTTTAATTGCTTTTTTTATTTTTTTATTT
ATTTATTTAATTTTTTGCTTTTTTAAGAATTAGGCATCAGGAAGTGTGCATTAGCTCTTAACAATATTTG
AAAAATAGATTAAAGTTTAATTCACGTGAATATTTTCTTTTTTAAAGATTAAGTAATTAATTGCACTTAA
AAACATTATTACTATTAAGAATATGTTTAAACATTAATTAATATTTTTCGATACATAATGAGCTTAATTA
TTGAATTGCGTAACTATGATAGGATTTATATGTTGTTTTTTACAAAATTATTAATGAATAGTAATATTAT
TGTAAAAATATTATATTAATAATATATTCTTCATTTAGAATTTGATTTTGAATTTGACTTAAATGTTGAT
TTTGAATTTGACTTAAATGTTGATTTTGAATTTGACTTAAATGTTGATTTTAAATTGGATTAGAAATGGA
TTTAGTGTTTGATTTTGATTAAGATATGGAATAAGAAATATGGGTGAAAAATATGGATTTGTTTAATTTG
TCTTCGGCTCAGAAGATGCTATTGTTTTCTGAGATAAATAATCCTCAAAATGATTCTTTCTATCTTAAAT
TTAGAAAAGATTATGATTTAGGAGATTATGAATATGTTAAATCAGCTATAGAACTTATTTCTCGGAAATA
TTTGAATCTGCAGATTAAATATGATGAGAATGCTGATTTCAAACAATATTTTGTAGATGCTGATGAAGTA
AATGTCGATTCATTTGATTTTTCAGGCAGTGACCTTGATGGAATCGATGGTGATATTGGGGGCTCTGGTG
TCGGTTCATTTGATGGTGATATTGGTGGATCTGATGTCTCTTCATTCGATGGAGACCTTGATGAGTTTAT
AAAGAACTATTTGGATAAGCCTTTTGACGATATATTCGATTCTCCATTATATAAATGGGCTGTTTTAAAA
ACATCTGATTCTACAGTACTTATAGGGGTTGTTCAGCATATCTTGCTTGATGGAACATCATTATATTCAA
TCGTTCCTAGCGAAATTGAAAGATGCATTGACTCTCTTAAAAGCAATGAGGAATTCATTCCAATTGACTA
TTCATATGAGACATATGTCAATGACGAACTGGAATATCTCAATTCAAGCCAATCACAGGAGGATAAGCAA
TATTGGCTTGATAGTCTAAAGGGCTATAGTCAGGACTGGTATTCCTTTGATGACTCTGAACTTGGATTCT
ACGAAATTCTTTTAGAGAAGGTCCCGGATTTCGGATATTCTCCATTCGTCACTGCACTGGCACTTAGCTT
TTTATATTTCTCAAAGTCTAAGGAGGGCAACGAATCATTTAAGGATATGGTATTTAACACTTCAGTTCAT
GGAAGATACTTCTCCCAAGGGGATGCATTGGGAATGTTTGTAAACACAATTCCTTTAAGGCTAAGCTATG
ATGGGGATATGACCTTTGACGAATTGCTTGCCTATTCAAAATCCGTCTTAAAGGAGGGCTTAGGCCATGC
AAAGCTCCAGTTCAGCGAGTATACAACTGACTTAAGAAATGAGGGCATTGACCCTGATTGCATTTCAATG
TTTTCAATCGTATCCAACTCCACTGACATGAACTCTAAGTTTTTAACCCTTCAAAAGGACATTAAGTTCC
CATTGCACTTTAGGATAAACAAGAATTACTCTGATAAGAAGGGACTCCAGTCAATCTTCATAGAGTATGA
TAAGGCCTGCTTCCATAAGAGGGAAATAGCTTCCATTGCAGAGGGATTGAAATATTTAATAAGACAGCTT
ATTGACGATTCTGCTAAAAGATGTGCCGATTATATTGTCCATGAGGCTGAATTTTTCAAGGGAGAAAACT
ATTATAACAATCTGATCAATTCATTTGACAATCCGACAGCAATTTCACCTGATTTAAGTGGAGATAAGGT
AAGATTTGTCAATATATCCAAGCATATAGACATTGACAAGCTAAAGAACTTATCTAACAGATATCATCTC
TCAAAGGAAAAGCTGCTCCTTGCGATTTTCTTATATGACTTAAGCAAATTCTCATTTTCAAAGGATATAT
TGATAGCATATAACCGTGTTGCAGCAGGATATCACTTCAACACAGATTTGACTGTTGAAGAGTATTTGAA
TGACTTCAAGCAATCCTTTGAGGAATATAATAATTATCCTCTTTTAAATAATAGAAAATTAAACTTTGAA
AGCGAAATATTATTCTTCATTAATGATTATGACGCTAAAGACTATAAGCTTGTGTTTAATTTTGAAAGCG
GAAAGATCAATATAAGCTATGACGAATCATTCTATTCAAAGGAATTGATGGAAGCTTTCTTGGATTCAAT
GGATGTCCTATTGGGTAGATTTGATTCATCTGATGAGCCTCTTAAGGAGATTTCAATAAGACGTGAGCTT
GAATTGGATGAGGGATTCGAGATTGAGCTTGCAAATGAAGGTACAGTAAAGGAAATGTTTGAAAATATTG
CAAGTGAAAATCCGGATAAGACAATTCTTTACTGTGAAGATGGCCAGCTCACATATGATGAATTAAACAG
AAAAGCAAATAGGATTGCTAATGGATTACTCAAGCGTGGAGTAAAGATTGAAGATAAGATAATGTTTATG
ATGAGAAGGAACAGTGACTTGATTGCAGCTGTTCTAGGAATTGTTAAGGCAGGAGCTGCCTTCATTCCGA
TTGATCCAAATTATCCTAAAAACAGAATCCAACAGATTTTAGATGATAGTGATTCTAAGTTTGTGATTAC
CTCATCTGAAATAGATTATGATGGGGATAATAGGATTGATGTTGATGAATTGCTTTTAGATGGCGATTAT
TCAAACGAGGATAACGTTGATTCTAATCCTGATGTTGATTTGACTCCAGATGATTCTAATCCAAAACTTG
ATGCTGATTCTAATCCAAAACTTGATGCTGATTCTAATCCAAAACTTGATGCTGATTCTAATCCAAAACT
TGATGCTGATTCTAATCCAAAAGTTGACCTGACCCCAGATAATTTATGCTTCCTGATTTATACTTCAGGA
TCCACTGGAAAGCCAAAGGGAGTAATGATAACTCACCGTGGAATTACAAACTATATCGCAAATGTTAAGG
AAAATGTTCCTATTTATGAATTGAACCATAAATGCAGCGGCTTTGTATCAATCTCAACAGTTTCATTTAT
CGTTTTCCTAAGGGAGATATTGGGAACTGTCCTAAACGGATTGCCTGTGGTCTTTGCCAATGACGAACAG
GCAGTTGACCCATTGGAGTTTGCTGAACTTTTCAACAATAGCGATGCTGATGCTTTCGGTTCAACACCTA
CCAGATTGCTTGAATACTTGCAGCTTGAAGAGATTCAGGATCTTGTTGGAAAATGCAAGGTCATAATCGT
TGGAGGGGAAGGATTCCCTCCTGTATTATACGACAGGCTTAGAAAGCATACAGATGCTGACATCTATAAT
TCATATGGACCAACTGAAGTGACCATCGCTTCACATTATAAGCTTATCGATTCCAATGAGGTCACTGCAG
GTTGGGAGATGCTCAATGTGGTTGATAAGATTATGGATATTGATGGAAACCAGCTCCCTCCTTATGTCAC
TGGTGAAATCTATGTTGGAGGTGCTGGAATTGCAAGGGGATACCTGAACAATCCTGAACAGACTGAAAAG
GTCTTCTTGACATTAAACGATATTCCATATTACAACACTGGGGATTTAGGTAAAAAGGATGCAAATGGCG
AATTATATGTTGCAGGACGTAACGATACTCAAATCAAGCTTAGAGGATTAAGGATAGAGCTGTCTGAAAT
TGAAGGGGCAATTGCAAATTATGAGAATGTCTCCCTTTCAAAGGTCCTTGTCAAGAAGCTTAATAATGTG
GAGCATCTATGCGCCTATTTCACTGCATCCTCTGAGATTGGCTTGGGAGACTTAAAGCAGCACCTTATTG
ATTCATTGCCTGAATATATGGTGCCATCATATTTCACACAGCTTGAGTCATTCCCTAAGACACCTAACGG
AAAGACAGACTTTAAGAATCTGCCTGACCCTGAAATCGATGCTGATGAATTCATAAGCCCTAGAACCGAC
CTTGAAAAGGAGCTCTTTGACATTGTATCTGATATTCTTGGAATGGATGAGTTTGGGGTAAACACTGATC
TCTTTAGCATTGGGCTCACTTCACTTTCTGTAATTAAGCTGACCTCTGCAATCTATAATAAGTTAAATGC
ACAGATGAATGTTACTGAAATATTGAAATATAAGACAATTGAAAGGATCGCATCTGAAATCAAGATTGAA
GATGATGAGTCAAGGGACATTATGGAATTGTATCCATTGACTTCAAATCAGCTTGGAGTCTACTTTGACT
GCATTAAGGATTTGGAGAACACTGCCTACAACCTTCCTAAGAAAATTGAATTTACTGAAGGAATTGATGT
GGATAGGCTCAAGTCATCAATCATAAAGGCTATTGATAATCACCCATATTTGAAGACTCGAATTGTAATG
AATAACGGTGAAGTCTATCAGCAAAGAAGGGATGAGCTTAAAGTTGATGATTTAATCGAGATTTCAGATG
ATGAGAACCTCGATGACTTCGTAAAACCATTCAAGCTTGATGAGGGACCGTTATTCAGATTTAAGATAGT
TGGAGACTCAATACTCCTTGCCGACTTCCACCATATCATTCTTGATGGAACTTCCTTAAACATACTGTTT
GATGAAATTGCAAAGATATATGATGGAAAGGATTATGAGCTAGAGGAGCTGGACGGATTCGAATACTCAT
TGGATGAAGTCAAGGTAGAGCAATCCAGCCTGTACAAGGAAGCGGAGCTCTTCTTTGCAGATAAGATTAA
GGAATTTGATAATGCAAGCCTGATTCCACAGGACATCAACGGAGACGAGTCAAAAGGCAAGGCTGCAATC
TGTGACGTATTCCTTGAAAAGGATTCAATTGACGATTTCTGTTCTAAAAAGAACATCAGCCAGAACAACC
TATTCCTGGCAGCCACATCCTTTGTAATAAACAAGTTCGTATTCAATCGTGACACTCTGATTGCAACAAT
TACAAATGGAAGGTTCAATCCAAATCAGCAGAAGACATTGGCCATGATGGTCAAGACCCTTCCATTGGCT
TTAAAATTAAATTCCGATTCAACCCTTAAGGACTATATCGAATATGTCAATTTAGAATGGCTGAATGTAT
TGTCCTATTCCTCATATCCATTAACCGAAATCTCAAATGAGTTCGATATCACCCCTGAAATATTCTATGC
ATATCATGGTAAGATCATAGAGGAGATTGAGATTGGAGGAATGACTGTTGAAAGGCAATCCATTGATTAT
GAGGGCTTGAAATTCAAGGTCAACATCAATGTCGTTGAAGAGGACGGCCAATATAGAATTTTCTGCCAGT
ACAATGACCAGCTATACTCTGAAACCTTAATCGACACATTCCTTGACTGCATCAGGATTGTCTTAGACAA
GTTCCAAAGATTTGATGAGAATACATTGATGAAGGACATTTCAATCATTGAAAATGATGATTGGAGCGTT
GATGATTTGGAATATGATGAGATTCCAGAGGACAGGCTAAATAAGATATTCGAAAGTCAGGTTGAATTGC
ATCCTGACAGAGTTATCTTATATGCCACCGATGGGGAATTCACTTATCGCCAATTGAATGAAAAGGCCAA
TAGGATTGCACATAGCCTCATTAAAAAAGGCGTCGGCCCTGAAGATAGGGTAATGTTTATCTTAAATAGA
AACAGCAATGTTGTAGCTTCAATATTCGGTATCCTAAAAGCAGGAGGGGCATTCATTCCAGTGGATTCCG
AATATCCTTCAGAAAGGATTGAGCATGTCCTGACAGACAGCCAGTCAAAATTCATCATTGTGGATGATGT
GATTCGGAAGAAGGGCATTGACCTATCAGATTACAGCGAAAACCTATTGGATGTTAATGAGCTTCTATCT
GAAGAGGATACCTCTAATCCTGACCCTGATGTCCATGGAAATAATATGGCTTACCTTATCTACACCTCCG
GTTCAACAGGGCTTCCAAAAGGTGTAATCTTAGAGCATGGAAACATTGCAAACTTTGTCTATCCTGATCC
AAGAAATGTCTGTACATATGAACTGGTCCACAATCTTGAAAAAGAGGATTATAAGGTTCTTTCAACAACA
ACTGTCGCTTTTGACGTATTCCAGCAAGAGATTATGGGCTCCCTTTTAAATGGGGTTCCTATGGTATTTG
CCAATGACACAGAATACAAGGACCCTATTGAAATGATGGACCTAATCCATAGGACTGGAGCTAATGTTTA
TATTGCAACCCCTTCACGTCTGCTTCAATATTTGGAAATCGAAGCGATGCAGGAGACAATGTATGGATTT
AAGGTATATATCCATGCAGGAGAGCCATTCTCTGCAAGATTATATGATTTGCTTTCCCAAAACTCCAAGG
GTAAGTTCTTTAACATGTACGGACCGACAGAAACAACAGTTTACTGTAACGGACAGCTGCTTGAAAGCTC
AGACATTCACATTGGAAAGGAGCTCTTCAATGTCCATGAGATGGTTATGGACTTCGATTCCAATCCTTTA
CCTCCAAATGTCATCGGAGAATTATATATTGGAGGAAAGGGCGTTTCAAGGGAATATCTAAACCGTCCGG
AGAAAAATGCCGAGTCCTATGAAGTGATCAATGGAATCAGATTCTATCATTCCGGAGACTTTGTCAGGGT
CACTGAAGAGGGAAATTATTATGTCTTTGGAAGAATGGATAATCAGATCAAGCTTAGAGGATTGAGAATT
GAAATCGGAGAGATTGAAGTTGGCCTTTCAAAATTCCCTGGAATCAAGTCTGTTGCTGTTGTCGTCAGAA
AGATTAAGGGCAACGATCATTTATGCGCTTACTTTACAGTCCATGATGAGTATAAGGATGAAAAGCGTGG
AGAAAACGGATATTCCATTGACATCGATGATTTGAAAGCCTCCCTTGCTGAAAAATTAGTATATTATATG
GTTCCGACAGTCTATATGGAGCTTGAAGAGATGCCTCAAACTGCAAATGGCAAGACAGACTTGAGAAACT
TGCCTGAGCCTGTCCTAATCACAGAATACGTTGCACCTGAAAATGACATTGAAGCATTCTTTGCAAACTT
GTTCGGTGAAATCTTAGGATTGGATGAGGTCAGCGCCACTGATAACTTCTTTGAAATTGGTGGAACATCA
CTTTTAGTTACTAAAATCACTATGGAAGCATTGAATAGAAATTATAACCTAAGCTATGGGGATGTCTTCT
CAAATCCTACTCCAAGGGCATTGTCTGAATTGATTCTATCAGATGAGACCGCTGAGAAAAAATCAGAGTT
GTCTTATGATTACTCAGAAATCAATGCGCTTCTTAAGAAGAACAATCTTGAAAACATAATAAATGGCGAG
ATTCAAGAAAGCTTAGGCAATACATTGCTTACAGGAGCCACAGGATTTTTAGGAATACATGTCCTTAGGG
AACTGATTGAAAATGATATCGGAGACATTTACTGTTTCATAAGAGCCAATAAGGTCTTAAGCGGAGAGGA
AAGATTGAAGTCATTGCTATTCTATTACTTCTCTGATGAATATTCCGACATATTCTCTGAAAGGCTCCAT
GTCATTGAAGGGGACATTACCAGTTTCGATGACTTTGAAAAGCTTGTCCATGAAAGAATTGACACTGTAA
TCAACTGTGCAGCTAACGTAAAGCATTTCTCCTCTGGAACCGATATTGAGGATATCAACCTTGGAGGGGT
TATAAACGGACTTAAGTTCGCTAAAATGAAGAATGCAAAATATGTTCAGGTATCTACATACAGTATTGCC
GGTGAAAGCATAAACAATTATCCTCCAGTTGATGTTAAGTTTAGCGAAAATGACCTCTTCATCGGTCAGG
CTGTGGATAATCAATACCTTAATTCCAAATTCCTGGCAGAACGTGCAGTCTTAGAGGCTGCCGTCAATGA
TGACTTGGATGTTAAGATCATGAGGGTTGGAAACCTGATGGCAAGAAGTTCAGACAGCGAGTTCCAAATC
AACTTTGAGTCAAACGGATTCATTAATCGTCTGAAGGCATTTGTGACAATTGGAAAAATGCCATATTCAA
TGCTTATGAACAATGTGGAATTTTCACCGATTGACATGACTGCAAAATCCATTGTAGCTCTTTCAAAAAC
TCCTAAGGAATGTACTGTATTCCATCCATATGATCATCATAGCGTTTGCTTTGGTGATATAATTGAAATT
ATCAAACCTTTAGGATTGGATATCGAACCTGCTGAAGAGGAAGATTATGAAAAGGCTTTAGATGAGGCTC
TTGCTGATAAGGACAAGCAAGACGGTGTTTCTGGACTTATTACTTCAATAGGATCTGGAAAGGTTAAGAA
GATCTGGGTCCCTGTTGAAAATGTATACACTATTCAGGCATTGTATAGATTAGGCATTAAATGGCCTTTC
GTATCTGAGGAATACATATATAATTTTGTAAAATACTTGAATGATCTTGATTTCTTTAGTGTTTAGAGGT
TGAAGATGTATGGATTTGTTTCTTTAGTGTTTAGAGGTTAACAATTATGAAAGAATTATATTGAGGGCAA
ATTCTTTAGTGTTTAGAGGTTAAACAATGTATGAAAGGAATTATAAATTGTTGAGGGCAAAATTCTCTGA
ATTTTTCCTTCCCACATTATTTACATCAATGGCAGGTAACATATGCCTATTTGTTGATGGTTTGATTGTA
AGTTTTTTAATTGGAGCCAGTAATCTTGCTCCTATTCAGATTGTAGCTCCAGTAATCACATTTGTCAATC
TTATTTATTGGATGATCGGATTGGGAGGAAGCGTCCTATGTTCTGTTGCAAAGGCAGAATTTGATGATGA
AAAAAGCAATAGCTACTTTTCAGTATCAATCATATCCCTCATATCCATCGGGGTATTGATTACGGTTATA
GGACTCTTGTTTTCAGGAAGCATTGCCCAGTTCCTATGCTCTTCACAGCCTGAATTGGTTTCACAAGTGT
CCCAATATTTCATTGCATTGGTTATTGGAATGCCATTCTTATGTTATATGATGAGCTTATCTTATTTCAT
AAGGGCGGATGGTATCCCCCAACTGCCATTCAGGGCTATACTTATAGCAAATATTGTCAATATTTGCTTT
GACATTATTTACATTAAGTTTTTCAATTTGGGCCTAACAGGGGCGGCGCTTGCTACCTCAACCGGTTATC
TTGTAGGTTCCATTTTAATTTCATATTACTTCTTTAAAAAGGAACGTACTTTGGAATTTATAAAATTGAA
AGCTAACGCTTTCTTTAAATTCATTAAAAAGATAGTTACTTCAGGATTTTCTTCTGCGTCAACTCAACTC
TATCTGACTTTAAAATTGCTTGTCATAAACTTTTTAGTTGGCCTTTACGTTGGAAAGTCAGGGGTTGTCG
CATTCGGAATTTGTTATAACAGTCTGTTCATACTATACATATTCCTGATTGGAACTGCACAGACAATGTC
TCCAATCGTATCTGTTTACTTTAAGGAGGAAGACTATTCTGGAGTTGACTATATTATAAAGAGGTCCCTT
AAGATAGTGGTTGCTTCAAGTTTGGCTCTGTCTGTTTTATTCATATTCTATCCTCAGGCCTTGCTTTTCT
TGTATAGTGTTAAAGACCCGGCAGATGTTCCTGTAGTATTGAATGCATTGAGAATTTTTGCAATAAGTTA
TGTAGGAACTGCAATTACATTCTTATATACCTTCTATGCTCAAGCAATTCAAAAGAACAGATTATCCACA
ATCATTTCATTGCTTGAAGGATTTCTATTGCCAATTTCAGCAGCAGTCATATTGTCTTTTGCAATTGGTG
GAAATGGAATTTGGATTTCATTTGCAATAGCTGAGCTATTGACAATATTATTCATATTCGCTTATTCAAG
AAACATCAATAAAAAGACAAATGGGGAATACACTGGATTTTTCATAAACAAGCACAATGATGATGAAAGG
GTATTTGAATATACAATCAATGGAAATATTGAAGAGGCAGTAAATCTCCTTCAGAGGAAGTCCCAAAAAT
TACCTTATCTGGGGTGATAAAGTCCGCCACTTTAGTTGCTTTAGCTATTGAGGAGATGCTTGTAAATATC
ATTAACATTAATGATGTAGTCGATACGATTGATATCATCGTTAGAAAGAATGTTGATAATATTTTAATTT
CAGTTAAGGACACTGGGGTTGATTTCAATCCTGTGGTGGAAAATGAAGAGCTTAAATTCGATAATATATC
TGTGTTGAATAAAATTGCAGATAAGATTGATTATTCTAGAGTTTTAGGCTTGAACAGTACAGTGATAACT
ATAAAGAATTAATTGGGCTTTTTCCCAATTTTTATTTTTTTCTTGTTTTAATTGGAATTCGTTTTTTATG
TTTTTATTTTTTTTCTTGTTTTAATTGGGATTCCTTTTCCTAACTTTATTTTTTTCTTATTTTTCTAAAA
AAAGATGTTTTAAGGCCCTATTGATATAATTGCATAAAGATTATACAATTTTTGGGGCCTCCGATTGTTT
GATTTTTTTAAGGATTCCTTAATAAAATCAGAATCATCTTTAATAATTTTTTGGAGGATATGGAGACTTT
GTTTTCTTCTAACTCTTCATCTTCAGTTATTTTTGCGGAAATGCTTTGATATATTTTAAGAACTGGTTCT
AAAAGTCTCTGCATGATTTTTTGACTCAATAGGGGATTATTATTTTATTATTGCTTATTTATTTCTTGCT
CATGATTTAGTTTTATTTTGCAATTATAAAATTGCTTTAGAAGAATTATAGTTTAGGGAGTAAAGTTAGA
ATATGTTTTAGGGCAATAGTTATATTTTGCCTTTGATTTCATTTAATTCCTGTTCTAGCTTTTCAACCTT
ATCTTTATACTCTTTTAGTTCCCCTTCGGTTTGGTTGGCTTTTATTTTATATTCTTCCAATTCTTCCGAC
ATTAGTTCTATCTTTTTATCTTCATCTCCATCATCAGTATCGGTTTCAGCTTTCTCTTTTTTCTCATCTA
AAAATAGGCTGAATAGTAGGATTCCAAGGACTGCTGCAAATGTCATCGGGCCATAAAGATTGCTTGCAAC
GATGAGTCCAGTTGGTCTTGGGGTCAATATGGTAAGCAGAAACATCTCAAAGCCGCTGTAAAAAAACATT
AAAAGCCCTGCCTTGACTGGGGATATGAATTCATTCCCATTCCATCTGTGGATGATGCTTCCAGTGATTC
CGGCTAGAATTGTTGCAATGGCGCATGCCAATGCTGTAGGACCTCCCATTGAATATCTCCAGACTCCAGA
GATTATTCCTACAGGTATTCCAATATATGGCCCTCCAAGCAATCCGGATATCATTACAACCAATGCTCTT
GCATTGGCTGGAAGGCCGTTGATGTCCATTGTGAAATATGATGCAAGGATTCCAAGGACTGAACATAGGA
TTATCTGTGAGATGATTGTCTTTCGGGAGCGGTCTCCCCTTACTACGGCCTTAAAGCTTTTGGTTTTAGT
GGCTAGGAATGTTAAAATCAGGACGACAGATAGGATCCTGAACATTTCCAAATAGGGAGCCCATAATGAT
TCCCCATTGATGGACTTGTTAAAGAATGAAATGGTTATGCTTAATAGGCCTATGATGATAAGATAGCTTA
TTTCATAAATTGAACTGTCACGCTTTTTAAGATTGGGGAGCCTGGTTGAAGTAAATCCTAGGATTATGAT
TGCACAGTTGATTGTGACAAAGTCGTGTATGACCGCCATGTTTATGTCCTTGATGTCAACCATATACTTG
AATATGTTGATGTATAAGGCTATGTTAAAGATGGCTAATATTACAAACAATATTAGGATCTTTCTATCTC
CGGTCAGTTTGTCTTTATAGTTGTTAAACATAGTGTATATTTTTGTTGTTAGTATGTATTAAATGTTTAA
TATGATGGGGGTGGTTGGTGGTTTTGGGGTTTATTTATTGCTTTAATAATGATTTAGTTTATTTTTTTTA
ATATTTATTGTAAAATTGATTATTTTTCTACATAATCACTTAGCATAATTTAAAATAATAGTAATTTTTA
TTTAATACATAAAATATAGTCATTATTATAAAATTCAATTATTTTCTGATAATTTTATTGCCGATATTTA
AAAAATATTGCTAAATTTTAAAAATTATTGATAATATTTTAAAAAATCAATCAAAAAAGGTTTTTATTAT
GGATAAAAAGATTTTTATAGTTAGCTTTATTCTGCTAGCTATTTTCACAATAGGGGCTGTTGGCGCTTCT
GATGTATCAGAGCTGACAGCAAATGATTTAGATGATAATGCTTTATCTCTAAATGATGGTGAAGATTTGC
TTGCTGGAGATGAATCTGGTGAATCTGGCAAGGAATCTTATTTTAATAATGATAATAACTATAATGATGA
AAATAGGGTAAATGCGAATAATCTTGATTATGGTGCTGGTGATAATGATGCATCTAAAGACAAGGTCCTA
TCTGATAATGTTTCCGATTATATCTATGCCACTACCCTTAGCGTATCTGTCGATGACACTCCTCAAAGCC
AGTATCCTACCGCCACTGTCAGCTTAAATGATTTGAGTGGCAATCCTGTTGCTGAAGCCAGCGTTTCCGT
CAGTGTCGATGGTGATGATTATATGACTGTAATCACCACAACAGATGGTACATGCCCTCTTTCACTTGAT
AACTATCTGTCTGTAGGCAGTCATAAGGTTGGGGCAGAGTATTCCGGCGATGGGACTTATGGACCTTCAA
GCGCTTCCACCACATTCAATGTATTGGAAGAATATTCCTCTTATCTAAATACAGATTTGTTCATATATAC
AGGCACTGGCAGGGAAGGGGGCTATACTTCTGTTACAGGTAAGCTGACTCATATAAATCAGCCTATATCC
AATGCTACAATTTCCCTTTATGTCGACGATGACTTCTATTCTAATCTGACCACTGATAAGCAAGGCGAAA
TCGAGGGGATGTTATTCAATATAAGCGTAGGCCGTCATGAGCTTAGGGGAGAATATGTAGGTGATCGAGG
ATTTGAACCCTCAAATGCCACCAAATACTTCAATGTCTTGCCTAAGGATTCAGTTTCCAGCAATATTCAA
ATGACACTGAATGCCTCTGATGCTCAAGTGGGAACACAAGCTAATGCATATGTCTTATTGGAAAGACAAT
ATGGAGGCCCTATGGAGGATGCTACAATTTCCATCAGCGTTGATGACGTATTTTATATGAATGTGACCAC
TAACGCCCTAGGTTATGCTTTCTTTGATTTGTCTGATGACTTGTCTGTAGGCAGCCATAAGCTTTCTGGA
GAATATCCTGGCAATGAGTATACAGGCTCATCAAGCGCTTCAATCACTTTCAATATTTTACCAGTGGACG
ATTCCAGCTATAACTTCACTGTTACCGAATATGCAAATTACTTAGACACTAATACCACAGTTCTTGATAT
TTCATCAAAATACTATGTCAACGGAAGCTTTAATGTTTCAGTTGTCTCTCCAAACGGAACTCTGTCCACT
TTCACTCAAGACTGCAGTCCTGATGGCCATAATAATTGGTCAATGGCTGATTTTGGAATTGATGGCATTG
GAAGCTATATCATTTCCGGATCTTTAATCTTTAAGAATGAGACATTAACCCATTTTGACAATCAGACCTT
CCATGCAATCTGCATCAGGCCGATATATATGGAAAGCACTGAAGCCAACAATCCGTTGGATATCCTGGTG
GTATATAATTCAAGCGATGCAACCAAGGTCTCTGTGAATGGCTCCGGCCTATTTGAAGGACGAAAAATCA
CTGATGGTCCTATAGTCTGGAATCTTACAGACTTAAACATCACTGAGCTTGGAGACTATAACATCAGCGT
TATGTCATATGACAGCAAAGGCAATCTCATTGACAGATTTGACTATAATCTGACCATTGGCCCTAATGGG
GACGACTATAAACTCTATGCAAAGATAGATCCAAACTCTTACAGTACTGATGATGTGGCTGTAGCATTAT
ATTGTCCAAATGCATCATGGGGAAATGACATAGAGGTTCATATTTATATGGGCAACCCTCTTGAAGTTCT
CACCTTTTTCCCAGATAGCGTTAGTCCTACAGAAGCAGCGTCTTTTAAGAAATACACATTAGCTGATTTG
AGAATTGAAAATAGCAATGATTATAGGGTTGAGATTAAGGACTTTGCTCTCAACCAATTCCCAGGGATTT
CATTCAACATAAAAGTCTGCTATAGCAATATGATTCTCGTCAGCGGAAACGGAAGCTTTGAGATTGACTT
TGATGGTGCGTCAGTCAATGCAACCCTAACAGATTCAAATGGAAATCCTATTTCAAATGCTAGCGTTTCA
GCTTTAGTTAATGGAGTAGAGTCTAACTGCACTACAGATGATAATGGTAATCTAATAATTCCATTTGAAG
GCAATACAACTGTAAAATTGACTTATATTGATAATAATGGAGTTGAAATAAAAGGCACCGGGAAGTATGT
CAAGGAATCTGTCATTAAGAATAGAACTGAAACCAAGATTATCTATCAAAACATGACAACCACTACAGTC
AATTCCAATGTAGACGGAAGGATAGGCAAGTACTTTGAAGTAAGTCTGCAGGACGCCGATGGAAACCCAA
TTGCAAACAAGACTGTATTCATAGGATTCAATGGAAAGGTCTACAACCGTACCACTAACTCTACAGGTGG
CGTAAGCTTACAGATCAACCTTGGATATGCTGGAAAATATACATTTGCCATAGCATTCCTTGGAGATGAT
GATTATATGGGCTCATTTGAAGTTGCTTTAATCACTGTAAACAAGCAGACTCCTAAGATTACAGCAAGCT
CTAAGGCTTATAGGCCTAATTCCAAGGCTAAGTCTTTAGTTGCTACATTGAAGTCTGCAAAGGGCAATGC
AATAAGCGGCAAGAAGATAAGCTTTACCATTAATGGAAAGACCTATTCAACAACTACAAATGCAAAAGGA
CTTGCTACATTGAATGTTTCTTTAAGTAAGAAAGGAACTTACTCCTGTACTGCTAAATATGCAGGAGATG
GAATGTATAAGGCAACTAGTACTAAGTTTAGTGTAAAAATAGCTTAAGAGGATTATTCCTCTTATTTTTT
CTTTTTTTAGTTATTAAAATTTATTTTTTTAATCCCCTTTTTAGGGATAGGTATGATTTTTTCTTTTTTT
AGAAGTAAACTATTCTTTTTATCTTTTTTTAGGAATAGGTTATTATTTTTATCTTTTTTAGGAATAGGTT
ATTATTTTTATCTTTTTTTAGAAATAGATTTTTTTGATAGTGTTGGCACTTTTTGGCACCTTATTTTGTG
TATTTTTGGCACTTTCTGGCACTTTCTTTCAGTGTAATTAGAGACTGTTCCTTACTCCTTTTTCCTATTG
CTTACTTTAGATAAGTTTTTCCACTTTCACATCAATTTTTACTTCAAAATATTAAATTGATTTAAAAGTG
TTAAATTGATTTTATCCTGTTAGGTTTACTATATATTATAAATAGTAAACCGAGTATTATTTTTTTAAGA
TATGGGGTAATAATTAATCTTATTTTAACAAAAAAACTTATATAATAGTTTTTACACATCTATGTTTACA
GATGTTTTTTATGGATTTCATCTTTGTAATTTGGATATAAATATTAGTGTAAAAGACGTATTTTTGAAAA
GTATATTCTTAAGTGTGGAAATAAAGTTTAAAGATGTATTTTTTAAAAGTATATTCTTAGTTTTTTTTGA
GTGAATGCGTATTTTGGAGGGGCTTTTAATGAAGATTAAAGGTGATTATATGACTGTAAAAGTCTTTATA
AGCAGTAATCAAAATGAATTCTTTGAAGAAAGGAAGTTAATCAAAAAAGAGCTCGAATCTGATTCCATGT
TTAAAAACTATGTTGATGTTTTTGTTTTTGAAGAAAATGAAGCAAGATCCTTATCTCCACAGGAAAATTT
CATCGAAGGATTATATAATTCCGATGTATATATCGGTCTTATCGGATCATCTTATGGCGATATAAAGGAC
AATGGATTATCCTCTACAGAATATGAATATGAGATTTTCAGCAGACTTAAGAACAAACAGAATATCTATT
TTTTTATAAAGGATTCCAATGAAAGAGAAGATAAGGCTCTGGATTTCATTGAAAGAATTAAAAGCGATAC
AAGCTTTAAAATTTTTCACAATACTGTAGAGCTCATTGAAGAGATAAAAAGGAGCCTAAAGGCACATATA
AATCAGAGTCTAAGCAATCAGGAATTTGACTTTCAATTGTTAGCAGAATCCAGTTGTGACGATGTTAGCA
AGGAAGCTTTAGATTTGCTTTTTGATTCCATTGATTATCAGCCTATACTGGATTTATTAGGTAATCGTGA
TATGGAGAGCATATTAGAAATCTTAAGCTTGGGAAAGAAAGATTTGTCAGGAACTTTTCGTTTAAACAAT
GCCGGTGCCTTATTTTTAGCAGAAAACATTGAAAAGTTTAACATTGAGCATGAAGTGAAACTGGTTAGGT
TTAAAGGGAATACCAAATTGGAAATGATTGACAAATGCTATACCACCAGTCCTTTCTTTATTCTTTTAAA
GGAGTTTGAACATTTCTATTGGAAAAACATTAAAGTGGGCTCTGTCATTAACGGCTTGCGACGTGTAAAT
ATTCCAGAATATCCCTTTAATGCCATCAGGGAGGCTATGATAAATGCTTTGGCCCATAGGGATTATAGCT
TTAAGGGCAGTTTCATTCAATTTTATATCTATGACGATAGGATTGAGATAATTAGTCCGGGAAATCTTTT
GTATCCATTAAAGGTTTCTAATTTGAAGAATATTGAAGTCCCTGTGCACCGAAATAAGAATATTTGTAAT
TTGTTCTCCAAAACCATTTTTATGGAGCACGTTGGCTCTGGAATTCAGCGCATGTGTGATGAGATGAGAA
AGTCTGGCTTGAGGGAACCTGAATTTATAAACGGCGAGGGATTCTTTAAGGTAATATTTTGGGGACCTAA
TGGAAAATTGATCTATCCGGAAGAGGCTGTGGATAATAATGTTTTGGACCTAACTAAAGTAGGGTTGAAT
GATAGGCAGATAAGAGCATTGTCAAGAATAGTTAATGAAAAAGTAAAATATTCCTATGAAAGATATTCTA
ATGAGTTTGATGTGTCTAAATCAACTTCTAAACGAGATTTAAATGATTTGGCTAAGAAAGGGCTAGTTAT
TGAAAATAAATCCAATAGAAGAAATTATTATTTTGTTGAATAATTTTTTCTATTTTGGTTTGTTCTTGGC
ACTTTTTGGTATTTTTTGGCAGTTTGTGGTTTTTGTCTGTTGGTATTTTTTGACACTTTTTTAGGTCTCT
TATCAATGAATTTTTTAAGCAAAAATATTGATAATAAGTCATTTTATTTTAATGTATAGTTTACCATATA
TTACCAAACTCTTATTTTATATTTGTTTTTCTAAAATTTTAATGTATAGTTTACTATTTATAAAAATATT
AGTTTTCAGACGCTCTCACATCATTTATAAGCTATTAAAATCAAAATAATTTTGCGGAAAAATGAAGAAT
TTGTTTTGAAAATATTTTTTTAAAGGGTGATATGTATGATAGACGAATCAATACTCAATTTATTTAAAGA
CGAAAAAATAAGGTCCATTTGGGATGATAAGACAGGAGATTACTACTATTCAATTGTTGACCTTATTTCA
ATCATTACCGAAAGCAAAAATCCTGATAAATATTGGTCTGATTTGAAAAGAAAGATGAAAAAGGATGAAT
ACAACCTATTGAATAAATATATAGTTCAGATGGAAATGCCCTCCTCTAATGGCAAGATGCGTTTGACAGA
TGCAGGGGATATTGAAACGGTTTTGCGAATAATACAAGCAGTTCCATCACCAAATGCAGAGCCTTATAAG
GAATGGCTAGCCCAAGTGGCCAACGAATGCCTTGAAGAGTATATAAATCCTGAATTAGCTATTGAAATGG
CAATAGGCGCTTATCGCAAAAAGGGCTATAGCGAAGAGTGGATCAGTCGAAAGCTCTTTAGCATGGAGAT
AAGAAATGGCCTTAAGAAAGAGGGTTTTAAAGAAAAGACAAATAGGGAGCATGTTTTAGATAGTTTAGCT
TAAGTTTCGCAAATGAAATCATAAAGGCTAAAAACCCTGAAGAACTTGAAAAAAGTGAAGAACTAGCTAA
ATATGGGGAAAAGATAGCGAAAAACGCAAGATGTGAAATAGAAGCTGGAATTGCTTATAGTATTTTAACT
GAAGAAAATTCCAATCAGAGAGTATTTGGAAAATGATTTAATTAAAAATGTTTTTTATAGAAAACTTTTT
TATATAATTTGGAATATTTGTTTCTTATAGAAAACTTTTTAATATATTTTTTATAAATAGTTTCTTATAG
AATACTTTTTTATATAATTTAGAATATTTGTTTCTTATAGAAAACTTTTTTATACATTTCTTATAATTTA
ATTTTTTAGAAAACATTATTAATAATTTTTATTTTTTATAAAGAACTTTAATTAGGAGCTAAATCATGGT
GAAAAGAGAATTATATATGAATAAAATCAATAGCTTCATTGATAAGGATTTAATAAAAATAATAACCGGT
GTAAGACGTAGCGGCAAATCTTACTTTTTTAAATTAATCATTAATGAACTAAAGGAAAGAGGAGTGGCTG
AAGAAAATATTCTTTTAATAGATTTTGAACTTCCTCAATACAGACATATAAAAACAAGTGAAGAGTTAGA
TGAGATTGTATTGGATTTCATTGATTCACATCCTGAAAAAACATATCTCTTTTTTGATGAGATACAAAAT
GTTTCCGAGTGGGAGCTGTCTGTAAATTCATATTATAAATTATCAAAAAGCGATATTTACATTACCGGTT
CCAATTTTAAATTATTATCTAAAGAATTAGCTAGCTTTTTAACAGGGCGTTATGTTTCAATTAACATGTA
TCCTTTTTCATTTAATGAATTTATTGATTATAAAAAGGAGATTGGGTCTCTGCCTATAAATAGCAATGAA
TTAAATACCGAGCTTGAAAATTATTTCGATGAATATTTTCGCTATGGCGGTTTTCCTACAGCGATTTCTT
CTAATGACCATAAGGAGATAATATTGAATGATTTATATTCATCAATTATTTTAAATGACATCGTCACAAG
ATATGAGATAAGAAATGTAGGCCTATTCAGTAGGATAATCAAGTTTTTAATTGAAAATGTAGGAAATTTG
ATATCTGCCAATTCCTTGTATAATTATTTAAGAGGACAAGGTATGGAAATTACCAAACCAACAATATACA
ATTATCTAAATTATTTGGAAAGTGCTAATATACTATCTAAAATTACAAGGGAGGATTTAGTAGGCAAAAG
AGAAATTAACGGTTCTGAAAAGTATTATTTGATAGACCAAGGATTTTATAGGTCCCAGTTGGAGATTAAA
CAAGAAAATACTGGCAGAATCATAGAAAATATTGTTTACTTGGAATTACTTAGGAGAGGTTACACAATCA
CTATAGGATGCATTGGAAAATTGGAAGTTGATTTTGTATGCAAAAGGAACAATGAGAGGATATATATTCA
AGTTGCATATTATTTAAGCAGTGATGAAACCATTGAAAGGGAATTTGAACCTTTAAGGAGAATATCAGAT
AACTATCCGAAATATGTTTTATCCATGGATAAGACAGACCAATCTCGTGAAGGCATTAAACATTTAAACA
TAATTCAATTCTTAAGATCTTCTGAAGATATTTGATTGCTTTTAAATTTCCTCAAAAAATGCTATTTCAC
TATAATCTCCTAGTTTATTTTATTTTACTATAATCAAACTAATCGTTTCTTTATTAACTATTTTACACCA
TACAAACTAATAATTTCCTTTTTAAATTAATTTAATTAATTCTTATAAAATATAAATAGAAATTTTTATA
TGTTTATATTATATACTTTTAATTAATAGTATTACATTTAATTAATATTATTTGACTCAATTAATATCTT
TTGATGGAAGATGATGAAAATGACTAAAAAGAATCTTTTTTTAATTAGTTTAATACTACTAATTATTCTT
ACAATTGGTGCTGTCAGCGCAGCTGATGATTTATCTGCATCATCAGATCTGACAGTTGAAGATTCTGGAG
AAGCCATAGCTACGGCTCCTGAAGAATCTGTTCTGATTAATGAAAATAATGGAGATTCGATTGCTGATAA
GGGGCTTAGTGATCCTATCTCAAATGAAACTGCGAATATCGCAATAGATGAAAAGACTACAAATGATAAA
GCTATTTCTGAAGAGGATAATTCCATTTATTCTAAAGACAAGGCTAATGTTCTTCGTGAAAATGAAACAC
CTGTTATTTTGACTATAAATGCTCCAAATATCTATTATGGTGAAACCGCTAATGTAACTGTTTCTGCAAG
GTATGGGGCTGGGCCTTTAGCCAACAGTAGCATTAATCTTGCTCTTGATGGCGCAGCTGGTGAAAATATT
TTAATTTTTGATGACGGTATTGCTCAAAAGAATTATACTGGTTTAGCTGCAGGCAATCATGCTGTTGTAG
CATCCTTTAGCGGATATGGTCCTTATCCTTCTGCAAGTGCTTCAAAAAGCTTTGAAGTTTTAACCCCGAC
AGTCAATATAGAGATAGAAGCTAATGATATCTATTATGGGGAAAGAGCTTATGTCACTCTTCATGTAACC
TATGGAAACCAGCCTTTTGCCAATAATACTATCCAAGTATCTCTTGATGGCCAAAGCAGTACAAGTTTTA
TCGTAGAGGATGATGGCAATATTCAAGTGACTTATTCCAATTTGGCTCTAGGCAGTCACACTGTTTCAGC
ATACTTTAGCGGATATGGTCCTTATCCATCTGCAAGCGCTTCAAAAGACTTCAAGGTTTCAAAAAAGGAA
ACTGCTGTATCATTGAGCGTGTCCAATCCTCAGCTTGATAAGGGTGATGAGCTTCGTTTCACTCCTAGCG
TAATTTCAAACGGATTTTATGTTATGGCTAATTCCTATTCCATTATGGTTGATGGCATGAGTAATTATTC
TTATTGGACTGAAAACGGCACTTATTTCCTTTCAACTTCCTCTCTTAGTAGTGGAAATCATACTCTTACT
GTAAGTTATGCTGGAGATGCGAGTTTCTTGCCTTCATCTGCAAATGCCACTTTCACAGTCAATTCTTACA
AGGCCACTTTATCATTAATGATGATTGAAACAGAGCTTTATCCGGGGGATGATTGTTATATTTTCATTGA
TCTCTATGACAGCAATACTCATCAGTCAATTGCAGCTAATATTACAGTAAGCGTTGGCAATAATTCTTAT
CTGTATCCTATTCGAGTGAATTCAAGCTTTAATCTTCCTACTGATAATCTTGCTCCTGGAGTTTACAATG
TAACTGCATTCTTTGATGGAAATGGTCTATATGATCCTGAAACTGCAGTTGGAACCTTGACTGTTCTTTC
TAAGAAGGAAACTACTTTATCATTAAGCATATCCAATCCTGTTCTTAGTATTGGGGATGAGCTTCGTTTC
ATTCCTAGTTTAACTGGAGATGGGTCTTACATTTGGGGTGCTTCCTATACAATTAAGGTTGATGGCATGG
GCAATCAGACTTGTAGGCTTGTTAACGATACTTATTTCCTTTCAACTTCCGATTTTGCGATTGGTAATCA
TGCCCTTACTGTAAGTTATGCTGGAAATGGTGAATACATGCCTTCATCTGCAACCGGTTATTTCGAAGTT
ACTCCTAAAAAGGCCAATTTATCATTAAACATGTTATCAACAGAGCTTTATCCTGGTGATGACTGTTATC
TTTACATTTATTTGACTGACAGCAATACTCATCAGTCAATTGCAGCGAATATTACAATAAGCGTTGGCAA
TAATTCTTATCCGTATCCTATTCGAGAGAATTCAAGCTTTAATCTTCCTACTGATAATCTTGCTCCTGGA
GTTTACAATGTAACTGCATTCTATCCTGGAAATGATCTATACGGTCCTGAAACTGCAGTTGAAACCTTAA
CAGTTATGGAGGAAAACGCTACAATCAAAACAGAAACCTATCTAAGCATAATTATGGCTTCTGGAGATAA
ATATCTTGGAGACAATATACCATTCTCAGTTAGCCGAACTCCATCTGGAGTTTCACTCTTTGGAGATAAT
TACATCTTTAGCATTGACGGAGTTGAGTCTCAAGATATATTCTATGAGAATTTCTCCTATTTCATTGTAA
CTGAGAACCTTTCCCTTGGAAACCATAACCTTACAGCATATTATCCAGGAGATGAGATGTACTTGCCTTC
ATCTGCAAGTCAGAACTTCACACTTATCTCTAGGCCTAAATCAGATGTCTTATTAAGCATAGAGGCAAAT
GACACTTTCATTGGAGAGGATGCGACTATTATAATCAATATGATTGATGAATTAGGCAATCCTATTGATG
GAGCTAACGTTTACCTTTATATGGATAATAAGGAATTTGCTCTTCCGTTAGTAAATGGTGTCGCTCAATT
CTCCTACTCTAATTTATCATTAGGCACATATCTAGTTAGCGCATTATTTAACGGAACTGAATACTATAAT
CCTGCAAACGCTTCTGCAAGCTTTGAAGTTCTAAATGCAAACCTAACTGTAACCAAGGATAACTTCTTCC
AATTCTTCAATAATAACGGAGTATTGAATACAAATGCAACTGACTTAAAATTTGTAGGTGAATTTAATGA
TTTAGGCATTACAAGCATAAAAATCAACAAGCCAGTTTCCATTGTAGGTGAAAATGCAAATATAATCAAC
ATTCCAGTGATTGTCTCTTCAGATGACGTATCCCTTGCAAACATTGCATTTGCCTACAACGGTTCAGAGC
CTATAATATATGCAAACAATGTGGCTAATCTAGAAATCATAAACAATGCATTCTCCTATAAATCCCCTTC
AGATAAAAGCTATGCAGTAAACATTACAAAATCTGAAAATGTAACAATAATCGACAATTCCTTTAATGTA
GTGGGTGGAAACAATACCTATGGTATTAATATAGATGCAATTGGCTTTGAAATCGATTCCAACGATATCT
ATGTTGAATCCACAGAGTATTATGCCTCAGCAATCAACATCAACGGTCCAAGTTCAGGAAATGTTTTAAA
CAACACCATTAATGCATACGCTCCTATGATGGTCTATGCAATCAATACAGACCCATCTAGCGGAACCCTT
GAAACAAGCTACAGAGACAATGTAATTGAAGGAGAATCCTACTTTGCAATCGGTATTTACGACGATTCAG
AAACAATCACCGGTAACGAAATCAAATTGACTGCTAACTATGCAATAGGAATTGTAGCTCTCTCTGAATC
TAACATTGAAGACAATAAAATCAAGTTAGATGCTACAAATGTCGGTGACGAGGATGTTGAAGATGATGAA
GTTGACGTTCAGACTGCAGGAATTGTAATCAAGAACAATGTTCAAGTTACAGGAAACAATATCGATTCAA
GCGACGCATCCATTGCAGTTGTCTCAGGAAGCTCCACCATTAACAATAATGCATTGAATGGTCATGTAAC
CGTTGGAGGAGACAGCAGCGACAATAATATCGTAAACAATATCATCAACACAGAATCAGAATATGCAGTT
GAATTGACCACAACAACCGGAAACACTGTATACAACAATGAGATCCATGCAGCTGATACTGTAGGTAACG
ATGCTGTAAATGCTGAAAATATAGGTGCAAACACTGTAGAGGAAAATAACGATTGGGTAAACATCACTAA
CTTGATATTGACAGTGAATGATGATTCAACTGAAGTCACTGCAAACCTTACTGACATTTGGGGAAATCCT
ATAAGCGGCATCATAAATGTTTCACTAAACGGTGCAGATCCAGCCGAATGCACAGTAAATGAAACTGGAT
TATATGTGATTCCAATCACCCAAAACTCAACCGTTTACGCTTCTTATATAAATGTAGACGGCAGTCTTTC
CTTTGATAAGATAAAAGTAATTGTATTTAACTTCCCTGTAGAAGTTCTTCCTAATGCTACCATTGCATTG
ACTGACCTTGATGGCACTGTTGTTGCTAATGTGACTGACCTTGAGGGTAATGCTATAGCTAATAAATTGC
TTGCAGTTACCGTTAATGATATTCCGGTTCTTGGTGCTCAAACTGATGATGAAGGTATTTATTCTATTGA
TGTAGTAGGCAATGCCACTGTTGTTGTAAGTTACATTGATGCTAATGGAATTACTGTTAGCAGTTCAATT
CAAATAATTAACAATGTTGAAACTGAAACCGGAACCATAATTATTCGTCCTAATGCTACTATTGCATTGA
CTAATGTTGATGGCACTGTTGTTGCTAATGTGACTGATCTTGATGGCAATGCTTTAGCTAATAAGTTGTT
AACTGTCACTGTTAATGGTGCTTCTAAGCTTGGAGCTAAAACAGATGAAAATGGTATTTATTCTATCGAT
GTTGATGGCAATGCCACTGTTGTTGTAAGTTACACTGATGCTAATGGAATTACTGTTACCAGTTCCATTA
ATGTGGTTGTTAATACAGTAACAGAGACTGAAACTTTACGTCCTAATGCTACCATTGGTTTGGAAAGGGA
TGGAAATGTTGTCATTATTACTTTAGTTGATTCTGATGATAATCCTATTTCTGGTGCTGATGTGGTTGTT
TATGTTAATGATATTGAAACTTTAGTTGATCCTACTGATAGTGAAGGTAAAACCAACGTATCCTTTGAAG
GAAACGCTACTATTGAAGTTATTTATCTTGATGATAATCTTATAGCTGTTTCTAGCTCCATTGAAATTAT
TAACAATACTGAAGTTGAGATTGAGAGTGAAACTTTACGTCCTAATGTTACCATTGGTTTGGAAAGGGAT
GGAAATGTTGTCATTATTACTTTAGTTGATTCTGATGATAATCCTATTTCTGGTGCTGATGTGGTTGTTT
ATGTTAATGATATTGAGACTTTAGTTGATCCTACTGATAGTGAAGGTAAAACCAACGTATCCTTTGAAGG
AAACGCTACTATTGAAGTTATTTATCTTGATGATAATCTTATAGCTGTTTCTAGCTCCATTGAAATTATT
AACGATACTGTTGAAGGCGAAACCATTATTATCAATCCTGACGCTACCATTAAGTTACATCATGTTGATA
ATAAGGTCATTGTTAATTTGACTGACCTTGAAGGTCATCCTTTAGCTGATAAGGTGATTTACGTATATGT
TAATTATGAAGAGATAGAAGGTGCTAAGACTGATGAGAATGGTCTTTATTCTGTTGATATAGAAGGCAAT
ACATCTGTTATTGTCACTTATGTCGATCCTGTTGGAAGAAGGGTTACCAGTTCCATTGATGTGGTTGTAA
ATACTGAAACTGAGACCGAGACTGTTGTTATTCGTCCTAATGCTACTATTGCATTGACTAATGTTGATGG
CACTGTTGTTGCTAATGTGACTGATCTTGAGGGCAATGCTATAGCTAATAAATTGCTTACTGTTACTGTT
AATGGTGCTCCTAAGCTTGGTGCTCAAACAGATGAAAATGGTATTTATTCTGTTGATGTAGATGGCAATG
CTACTGTTGTTGTAAGTTGCACTGATGATAATGGCATAACTGTCACCAGTTCTATTATAGTTGTCAACAG
CACTGAGATAGTGGAAGTTGAAAAGATAGTAAACCAAACAGTTGAAGTTGAAAAGATTGTCTATGTAAAC
CAGACTGTAGAGGTTCCTGTTGAGGTTGAAAAGATCGTTTATGTAAACCAAACAAATAATAACACTATTG
AGGTTGAGAAGATTGTCTATGTAAACCAGACTGTAGAGGTTCCGGTTGAAGTAGAGAAGATTATTTACAT
CAACAATACTGTAGAGGTTCCTGTTGAAGTTGAGAAGATTGTCTATGTAAATGAAACCGACAACAGCACC
ATTGGAACTGAAAAGATTGTCTATATTAACCAAACTGTTGAAAAGATAGTTTATGTAAATCAAACAGTTC
CTATTATTCCAAATAGAACTGCCACTAATATTATATGTGATAATATGACTACTGAGGCAGTTGCTACAGT
TGACGGAAGAATAGGTAAATACTTTGAAGTGACTTTGGTGGATGCTGATGGAAACCCATTGGTCAATAAG
CCAGTCGCCATTGGATTTTCAGGCAAGATCTATAACCGTATAACAAATGAGACAGGGGGCGTAAAGCTAC
AGATCAACCTTGGATACAAAGGTTCATACACCTTTGCCATAGCATTCCTTGGAGATGATGACTATAACGG
TTCATTTGCAGTTGCAAACGTTAAGGTAACTGATCAGAATGCTAAACTTACAGCAAGTGGAAAAGCCTAT
AAGGCTAGCGCTAAGACTAAAGCAGTATCTGCTACCTTCAAGTCTGCAAATGGAAATGCAATAAGCGGCA
AGAAGATAAGCTTCACTGTCAATGGAAAAACCTATTCAGCGACTACAAACGATAAGGGAGTCGCTAAGGT
CAATGTTTCATTGAATAAAAAAGGAACTTACACTTGCACAGCCAAATTTACAGGAAATGGAATGTATAAG
ACAACAAGCACTAGTTTCAAAGTAAAAATATTTTAAGGATAGTTTTATAAACTATTCTTAATTTCCTTTT
TTTAAGTCATTTTCAGTTCTTCTTTTTTATTTTTTTTAAGTCATTTTCAGTTCTTCTTTTTTATTTTTTT
TAAGTCATTTTCATATTCTTCTTTTTTTTATTTTTTTATCAGTTTTTCTGATTGTTTTTTGTATGAATTT
TTATTTTTTGAGTTTGTTTTTTTCACTTTTTTTCTGATCATTTTTTTTCAGTTTTTCATATTATTTTTGT
CATAATTTTAATTAATTTTAGCTATTATAATTTGTTAAGTTCATTCTATTTTTGTAATTTTAAATAATCG
TAAATTTAATATAATTCATTCATATTAAAAATAATTTAAAATATATTTGCTCGATGAGGATATCAGTTTA
CTATTTATTATAAATAGTAAACAAAGTACTAAAACATTTAAAATAATTACTAAAAAAGAATGAAAATTTA
ACAATGTTTAAAATTTTTCAAAATATTAAACATTTTTTAATAAAACTTAGTTTTTATATAATTTCATTTA
TAGTTTATTCAAAACCTTATCTATCTATTCAAAAACATATAGAAATTTTTATTAGATATATAAAATATAA
ATTTTAAATGTAATTAATCAATTAATCTAATATTACTTACCAATATTATTTTAATGGAAGATGGTGATTA
TGAATAATAAAAAGCTTTTTATTGTTAGTTTGATTATACTAACTATTTTGACAATAGGCGCTGTCAGTGC
AGCTGATGATGGCCTGGCCACATCAGATGAGATAACAGTGGATGATTCGTCAGTAGCCGTTTCTACGGCT
TCTGCAGAGTCAGATATTTATGAAACTAATGGAGATATAGTTGCTGACTATCAAAGTGATTCTATCTCAA
ATGTAACTGTGGATGATGATAATACTAAAGATGAGATAATACGCTCTTCTCCTGCTAAGGACAATCTTCT
TCTTGATGATGATGACGATCCTGGTGCTGTAAATGATGATGATGAAGGGGATGACGATGAAGACTACCTT
GATGATATCTCAGTGTCTATCACAAATGAATATGACGTAACCGATCAGGATGCGGTTATAGTTTCCATAT
TCGTTCCAGATGTTGAAGAAGGAGAGGATGGCATTGAAGGATATTTTGTCGTTTGTCTTGATGACGATGA
TGAGATATTCTTAGGTCCTTTCAATCATACAATCACTCCTGATGACTATGGGACTGATGTTACTTTTACT
GCTTCTGATTTAGAGATTACAGAAGCTGCGAATTATTGGGTACGTGTTTTCTATGTTAGCGATCTGGCTG
AACCTCTTATCGATAATGATGAGGAAGATGGATACAATATGATTTTTGATGGGGATTGTATTGCAAGAGA
TTACACTCAATTTTATGTAATCGTCCCTCCAGATGGCAGAATAAGCATTTTTGACACTAGTGCTATCTAT
ACCGTTTACTGCCCTCCAGGAAGTGAAGGCACAGTCACCTTAACTCTAAGGGATGAGGAGGATGTAGAGA
CTTCATTTACCCAGGAAATTGAAGATGCTGATGATGAAAATCAATTATATTGGGATTTAGATTATATGGG
ATTGAACACTATAGATGCCGCCGGCAACTATGAGGTAACAATCACTCTTGAAAATGGCACTCTCATTTGT
GAGGATGATATAAGAATTATGGATCCTATAGAAATTCCTGAAGTCTCTTACATCAACTCTACAGACTATG
ACCATGCAACTTTAGTCGCTCTCATTAAGATTCCAAGTGAGCTTGATGATGATTTGGAAGAACTCATTGA
TGGAACAGTCATTATTCAAATAGACGATGAAACAGTCTTCGAAAAGACATTAAGCGAATTTGTCGAAGGA
GAAAGCCCTGATGACCCATTTTGGGTTTACCCAAAAATACATTGGAGTGATGAACTAGACACTTCAGTTA
AATTATACTATGTCCTCAACAATCAATTGGATATAGATTTAGAGCCTGGAACATATGATGTGACAGTCAA
GCTTGACCTTGACGGATGGGATGAAGTCTCAAGTACTGAAGAGGTTCGCTTGGTAGAAAGCAATGTAGTC
ATCGATGAGGACATTGGCGCAAGCATTGAAATCTTTGACCAAGAGGATATCCTCAATGATAATGAGGTAA
GAATCATCGCTATCACTGTAACCGGCGATAAGAGTGGAAGAGTTAATTTAGCAGTAGAAGGATGTCCTGA
ATGGGAATGTCCATTAGATGAATTGGAGAATGAAGGCGACATCTATTATATTAATTCCGGCTTTGATATT
GAAAGCGGTGAACATGAGGTTGTCGTCTCCTATGTCCTAAATGATGATAGATCTGTTTCAAACAGCGCTA
TCCTTAACTTTATCGTCTATCCAAGAATTTTCATTTGTGGAAATGGCGGTGAAGACATAGTAAACTATTT
CGCTGATGAGGATAGTGCAATTCACATATATCCTAAGGGAGATGACGTCTCCACCATAAGGATTGTGGTA
ACAATTGGAGATGAAGTTGTTCTAGATTCCACTATAGATGATTTAGGATTAAGCCCTAAGATAAACGATT
GGGGAGAAACCTATTATACAGTAGGTCCTGCTAATTTCAACAAAAAGCTTGAATTTGGCCATTATGAGCC
AGTGGTTGCTTATTATTATAGTGATGCATATGAGCTTAGCACTGAGGATGGGGAACTTTCATTCATTGAC
ATTATCGGAATGGTCCATGTAGCTGACATTGAAGATGATGAAACTCCAGTACTGGCTGTTTGCTCTGACC
GTGATGGTCAAATTGGAGTATATATTCGCCAATATACTGAAGATGGCGACCAAGAGTTAGAGCCAAAATA
CTTTGAAGTTGAAAAACATGGCTTCATAATGCCTACCATAGACCAATTAGGCCTTGATGAAGGACAATAT
CACATTGATGTTGCATATGCCGATGACGAATGGATCTTTGGCAACGATTTAATCGTTGTAAACAGTTCCG
AATACTTTGTGCTCTATGGCTGTGACTGGCTATACACTGAAGAGAGTGTAGTCTATGTATGGTGTCCGGA
TGATGCTGAAGGAATCATTAGCCTCACTAACAATGATGGAACAATAAATGTCGATCATGAAATTACAGAT
GAGGATAAGGGCAAATATGTCGAATTCACCTTAGAGGAATTAGGCATAAGCGGACCTGGCTGGTATGAAA
TCAGCGTAAGGGTAAATGGCAATGAAATCGATCATATTGGATTTGATGTTCCAAGCCCTATCTACATGCC
TAATTATAATGTATATCTTCCAGAGGAAGGATACGAACCTGATTATTCAATGATTATTGCCAAACTTGAA
CTCAATTCAGAATTAGAAGGCAACATTACCATAAACCTTGATGGAACCATTGTCTTCAATAAGGATATTG
AGGATATGGAAGCTATTAAAGATGGCTCCAAATGGATTTACACCATCTACACTTCTGATTTGGATGAAGC
AGAAGAAGGAATGCATGATGTTACTGTCACCTTCAACGATTTAAATGAAGAAAGATCCATAGAATTCCTT
AATAGAACAACTGAATCTGATGGTAACTTAAGCATCATAATGCTTGGAGGAACCTATTGCATTAACTGGA
ATGATGTAATTGCTGAGGTCATTGCTCCAACTAACTATAATGGCAGACTTGTCCTAAGGCTTCAAGGTGA
AATAATGCAATCTTGGGATGAATTGCATTGGGTCAATTGGGATAACTACAATGACACTCACAATATCTAT
TATATTTATGTAGATAATTTAGATAAAATGTGTATTGAAAATCCAGGAGAATACACTGTTTCTCTAGAGT
ACTATTCAGATAGGGAAGATGAGAATCCATCCCTTCAAAATAGCGAGGAATATAGATTTGTGAGAGATGA
AGAGCCTTCAGGTGACTTTGAATGGGAGGTCTATCATTGGGCAGACTATGAAGATGAAAACAGCCTGCTC
GTTACAGTCAGATATAATGATAATATAGTTGACGGCAGAATAGAAATCAACATTGAAGATCCAAATGGCA
TAACTTTAACAGATTCAAGGGATGTCGGCGAAGGATATGAGGACACTTGGCTTGTTTCAGACTTGGGAAT
TCAAGAATATGGAGTTTACACAATAAGCGCAAAACACATTTTAGGTGATGATGAGGAAATCATATTTGAA
AATGAACCTGTATATGTAACTAAAATACAGATTAGAGGTGAAGAGGAAGTTTATGTAGACGACCCATTAT
TCGTATTGGCCATATATCATGCCGGCGATAGGACTACAGTATATCTAAATGGCGCAGGAATTGAAGGCAG
AAGATTGCCTAATGGAGGTCCTCTTGTATGGTATCTCTCTGATTTGTATATCAATGAACCTGGGGAGTAT
GACTGCACCATTCAATTGTTTGATGAGGATGACAATTTATTTGCACAGACCGAATATTACTTAAATGTTA
TTGAAGGGGATGACGGCTATAGATTGATTAAAAACCTTGATTGGGACTATTTCACTTCAAGCACTCCTGT
TGCTGCATTATACTGTCCTGAAGGTTCTGTTGGAGACATATCAATTGACATTTACGCTCCAGATGACAAT
GATGATGATTACCGCAGCCGTGATATAGTAAATACAATACTAGATTCCATTGGCTCTGAAGACGTTGGTG
GCTTCAAGATATGGACTTTAGGCGATTTGGGAATTAACGAAGGTGGCTGGAACTATGGATTTGTCCTTAA
TGACGCTGATGGTGACACCATTACCGATGAAAATGGTGAAAACTGTGAATTTGGCTTCGGAGCAGTGCTC
TATCATGGAATCGGCATTGCCATATGGGATCAAAATCCTGTTGCCCTTGATAACGAATGGCTTGTGGATA
TCTACTCTCCTTTAGACAATGACGGTGATGTAATTCTTATGATTGGAGATGAGGTCTACTTCAGTGACAC
TTTGCAGAACTTAGCGATGTATCAATATGATGAAGATATAGAGCAAGGCTGTGCCCACTTCCACTTTGGA
GCAAACAGCTTCAACCGCACAATAGAAACAGGCCATTATGAAGAGGTCATAGTCTACTATGATGGATTTG
ATGGATATAGTACAGACAGTACTGCTTTCGATTGTCCAACTGTCTTAGACTTTGGCAAGCCTATGAACTT
TGACTGGTCTGTCAAAGGCGCTTATTATGAATATTATGATAATAATGTGATTAACGTTTGGTATAATGAG
GAGATAAATGGCGGTCAAATAAAAATCATTGCAAGAGCTGAAAATGGCACTGAATACGAATCTGTAAAAG
ATTATAATGACAATCGCAATAACGAGTGGACCATCACTGACTTTGGCATAAGCGAAATCGGAAAATACAA
CCTTACCTTGATATACATTAATGAAGGCGATGAAGAGATTGTCCGTGACGATAAGGTATTGCAGGTTCTA
ACCTTCGACCCTCGTTTTGCTAACTGGGTAACTGTGGACCATCCATATGACGTCCTTGCAATATACCAAG
CTACAGAAGAAATCAGGGTCTATGTAAACGGCGAAGGCCCATATGAAGGTATTAAAATGCCTAATGATGG
TCCTTTATCCTGGGATCTTGAGGCTTTAGGAATAAGCGCTGCAGGTGAATATGAGATTCTTGTAGAGTCC
TATGACGGAGAAGGCAATCTCCTCAGCAGCTTTGAAGATGTATTGTATGTAAGTGATGAGATGAATCCTA
ATGAATACAGGGTAGAGTATGCAAATGATTGGGACTTCTACTCTTTAGACAGTCCTGTATTTGGATTGTA
TTGTCCTGAAGGAAGCGAAGGCCCTATAACAATTGAAGTCTATGGTCCTGATGATAATGATGCTCTTTTA
AACACAATCAATGATAATATCGAATCTGGAGATATTGGCACAATCAAGAGCTGGACTGTCGGAGAATTGA
TCACTAACTTAAATGGCTGGGACTACAGATTTGTAATCTCCGATGCAAATGGCATCATTAAGAATGGAAA
TGATGAGGATATCGGAGAATTTAACAGAGGAATCAACTTCCATGACTCTATAGATTATATAAGTATTAAT
GAATGGTCTTACCTTGATGATGAATGGTTTATAGACATCTTTGCATACACTGGAAATGATGGAGATGTTG
CCGTTGAGTTTGATGGTGCAACTGTATATAATGGCAGATTGAGCGATCTTTTATTCTTCCAATCAGATGA
AGATATGCAAAGGGGCATTGCCCATTACCACATCCCTGTATCATATCTCTCTAATGAAGGAAATCCAATT
GAAGCAGGCCTGTATTTAAATATAATCGTTAAGTATTATGGTGATGACGGCTATAACACTACAGGCTATA
CATTACAATCATACATTGATGAAAATGGTTTCGATTGGGCTAATGTAAGGTTAAGCGTTGGTGACGATCC
TAATACAATCATTCTCACATTAACCAACTCCCATTGGGAACCTTTAGCAGATAAGGAGGTATATATTTCT
GTAAACGGAGGAGAAAGACAATGGGGATTAACTGATGAGTATGGTATAGCCATTTTCACAATAGATGGTG
GAAATTGCACAGTTCGTGGAGAGTATGAGAATGCAGAGAATCAATGGTCCGCCTATGAAATGACTCTATG
TGTATTTGGGGAGCCTATATATCCAAATGCTACAATTAGATTAGAATTTGTTGACGGTGAGGTTATTGTA
ACTCTAACTGATGGCGATGGTGCACCTCTGGCTAATAAAGGTCTTGGTCTAGCTATCGATGGTATCGTAG
TTATTGGCCCTAGCACTGATGATTATGGTATTTATAGAATGGGTATAGAAGGCAATGCAACTGTTGAAAT
TAGCTATCAAGATGAAAATGGAATTGTTGTTTCAAGTTCCATTACTATAGTCAATAATACTGAGACTGAA
ACTGTTTATGTTGGCCCTAATGCCACAATCCGTCTTGAAATTGTTGATGATAATGTTATTGCAAGCCTTA
GTGATGGAGATGGCGCCCCTATAGCTAATGAGTTTATTGATGTCTCTGTTAATGGAGTTCCTGTTAATGG
TGCAATGACCAATGCCAGCGGTCTTTATTCCATCTCTGTAGAGGGCAATGCAACTGTTGAGGTCAGCTAT
ACTGATGATAATGGAATTACAGTTTCAAGCTCAATTAGGATAATCAACAATATTGAGACTGTTCCTGAGC
CTGTTAATGTTCTTCCTAATGCTACTATCGGTCTTTCAAAAGATGGTGATAGTGTTGTTATTAGTTTGAA
AGATGGTTCTGGTGCTGCTATTGCTGGTGCTAGTGTGAATGTTTCTGTTAATGGTGGAGATGTCACTTTA
GTTGGTCCTACTGATGCTGATGGTAAGGCTAGTGTTGAAATCAGTGGTAATGCTACTGTTGTGGCCAGTT
ATGTTGATAATAATGGTATAACTGTTTCCAGTTCTATTGTGATTAATTCTGAGACTGTTCCTGAGCCTGT
TAATGTTCTTCCTAATGCTACTATCAGTCTTTCAAAAGAGGGTAATAGTGTTGTTATTAGTTTAAAGGAT
GGTTCTGGTGCTGCTATTGTTGGTGCTAGTGTGAATGTTTCTCTTAATGGTGGAGATGTCACTTTAGTTG
GTCCTACTGATGCTGATGGTAAGACTAGTGTTGAAATCAGTGGTAATGCTACTGTAGTGGCCAGTTATGT
TGATAATAATGGCATAACTGTTTCCAGTTCTATTATAATCACCAATAATACAGAAATTGTGGTAATTGAA
AAGTCTCATACTGCTGATGCTCTTTTCAATGTAATTATTCAAGAGGATAAACTTGGAGTATGGCTATACA
ATAACAATGAGGAAGAGCTTGCAAATAAAAACATTACAGTTGTATTTGATGATGATGAAGAAGGACAAAA
CTACCTTACTGATGGACAAGGATATACATCTATTCCTATCGGCGATCATTCTATTATAAAACTTTCATAC
ACTGATGAAGATGGCGCTAGCGTTTTCTACACAGTTCATCTTTTTGAAACCGGCGAGGTAGTCGATGCTG
ATTATGTAGTCATATACATAACCCCTCTTGACGATAGCTCACTTGAAGTAAGTGTCTCTGTCAATGGTGA
AGACCTTGAGGAAGGTGAAATTACATATTATCTTGGTGAAGATGCCGAAGGAATAACCGTTGACCTAGAG
GATGGTGTATATGTCATTAATTATGACAACACTGTAAATCAGACAATTGCTGTTGAATACATTGATGACG
ATGATGTAAGTTGGTATGCCTACTATGAAGTGGTCGTATACAACAATACTGTCACTGAAACAGTTTACCT
AAGCCCTAATGCTACTATCAGCTTATCTAAATCTGGTAATGATGTTCTTGTTAGCTTAACTGATAATGAT
GGTAAAGCTATTGCTAATGCTGACTTGGATGTATTAGTAAATGGTGCCAAATCCACTGCTAAGACCAATG
CAAAAGGTGAGGCTACCATTGCTATTAATGGAAATGCTACTGTTGTTGTAAGCTATAAGGACGCTAATAA
TATCACTGTTACAAGTTCTATCACTGTAGTGAATGAGACTGAAACAGTTGTGATTGAGAAGAACAATACC
ATAATTGAGTATGTAAATCAAACAGTTCCTCCTAATGCTACCGTTTCCCTATCCCTTGTTGATGGAAAGG
TTGTTGCTGAAGTAACTGATGGCGATGGTGTTCCTTTAGCTAATAAGCTTCTTGCTGTAACTGTTAACGG
CGCTCCTAAACTTGGTGCTGAGACCGATGCAAATGGTATCTATTCCATTCCTGTGGAAGGCAATGCAACT
GTTGTTGTATCATGCACTGACAATAATGGGGTAACTGTCTCAAGCTCAATCACTGTCCTTAACAATAGCG
AGACTGTTGTAGTTGAAAAGAACAATACAATAGTTGAATATGTAAATCAAACCGTATATGTTCCTGTTGT
TTCAAACTCAAGCTTTGATATAGTTGGAGATGAAAATGGAATAAGCGCAATCCTGCTTGATGAAGATGGC
AAGCCTATTAGCGGTGCTGTTGTTGAACTTGATGTAAATGGAGCAAAATCCAATATAACTAGTGATAAGA
ATGGTGAAATTGTGATTCCAACAGATAAGAATGGAACCATAACCATGACCTATACTGATGAGAACGGCGC
TAAGCTTATCTACACAACCAAGGTGATTACTCAAACAGAGATAATCTATCAAAACCAAACCATAGAGGTC
CCTGTTTATATCAATGTAACTCCTAATAGAGCTTCAACAAAGGTCATTTACAACAATATGTCTACAACTT
CAGTCAATTCCAATGTTGATGGAAGAATTGGAGAATACTTTAAAGTTCAATTGGTTGACTCCAATGGAAA
GGCATTGGCTAATAAGACTGTATACATTGGATTCAATGGAAGAGTTTATGTGCGTCAGACAAATGAGACC
GGCGGAGCACAGCTACAAATCAACCTCGGTTATCAAGGAGATTACACATTTGCTATAGCATTCCTTGGAG
ACGATGATTATAATGGATCCTTTGAAGTTGCTATAATTAAGGTAAGCAAGCAAAGCGCTAAGCTTACAAC
TGCTGCTAAAACATATAAGACAAGCGCTAAGACCAAAGCATTAAGCTCTACATTCAAATCTGCTAAAGGT
AATGCAATAAGCGGAAAGAAAATAAGTTTCACAGTAAATGGAAAAACCTATACTGGAACCACCGACTCAA
AAGGTGTTGCTACAGTCAAGGTATCTTTATCCAAGAAAGGAACTTATAGTTTCACTGCAAAATTCGCAGG
AGATGGAATGTATAAGGAAACTAGTGTTAGCTCTAAGCTCACTTTAAAATAAGAATATTTTAGAATAGTT
TTTTAAAACTATTCTTCTTTATTTTTTTATCAGATTTCTTTATATTTGATTATTTTTACTGACTGCTCAT
TTTCTAGGTTTTTTTTACTAATTTTTGCTGTTTTATAATTTCATAATTTTTAATTCCTCTGTTTATTCTC
AAAGATATTTTTCCATTATGAATTGAATTCGTTGTATTTCTTGGTTATTTTTTAATATAATTTAATTAAT
TTTAGCTTAAATAATAATCATAAATTAACTCTTATCTATTGTTTAATTAATCCTATATTGGATTAAATGA
TATTAATATTATTTTTTGACATTATGGGGTTATAATATCTCCTCAGTGACGTTTGTGATAATTTTGTATT
AAAACAGCTATTGAGGCGTAGATTTGCTAGATTTCCACTATAATTCATTGCATGATAACTTTTAATAGCT
AAAAAACTAGTTTTTTCAAGGTATTTTTTTTTTGTATTGGCAATGATTTTTTCACAATTGTGTTTTTTCA
CATTTGTGATTTTGTGTTTTTGTGTTTTTTCACAACTCTGTTTTTGTGTTTTTATTAATTTGTGTTTTTG
TGTTTTTTCACAACTCTGTTTTTGTGTTTTTATTAATTTGTGTTTTTGTGTTTTTTCACAAAATCGCATC
ATAATAATCTTTTAATACTATTTTAGAGATAGTAAATTCACCGATTTTTTTAATAAAAGAGATATTGGTA
AAATTAGCAAAAATTATTGATTTTTTCAATAGGAAATTATGGATGAATCTTTGCAAAAAGATTTATCTAT
GACTGGTTTTTAAGTAAAATCCTCTTTTATTTTAAAGAAAACAAAATAAGATTTTGGTTGTGATATTATG
TCTAATTTAGAAGTAGTGAAATCATTATTTTATCCTTCAGATGATGGAGAAGAAACAGTAGAAGTAATCA
TTCACTGAGAAACACTTTGGGCTACACAGAAGTCTATTTCAGAGTTATTTGGAGTAGATAGATCCGTAAT
TTCTAAGCACTTGAGGAACATTTTCAATGAGGGTGAATTGGATAAGGATTCAGTATGTGCAAAAATTGCA
CATACTGCCAGTGATGGTAAAATCTATAAAACCAATTTTTACAATCTCGACGCCATGATTTCTGTAGGAT
ATCGTGTAAATAGCATTAAGGCAACAAGGTTTAGGCAATGGTCCACATCTGTTTTAAAGGAATATATGGT
TAAAGGATATGTCTTGGATGATGTTTTATTGAAAAATGGCACTCGCTTTGGCAAGGACTATTTTGATGAG
CTCTTGGAAAAGATTCGTGAAATAAGGGCCAGCGAAAGAAGGGCATATCAAAAGGTGACTGACATATTCT
CCCAGTGCAGCTATGATTACAATCCCAAATCCGAAGTTGCAAGAGAATTTTATGCTAAGATTCAAAACAA
GCTTAATTTTGCAATCACCGGACATACTGCAGCAGAAATCATTAGTGAGCGAGCAGATAGTGAAAAAGAG
CATATGGGTCTAAAGACATGGAAAAACTCTCCTGATGGAAAGATTCTTAAGTCTGATATATCAATTGCCA
AGAATTATTTAAGCGAAGATGAGATAAAAAGCTTAAACAGATTGGTCAATATGTATTTGGACTATGCTGA
AAACCAGGCTTATATGCATAAGCTAATGGGGATGGATGACTGGGCTTTAAAGCTTGATAGCTTTTTGGAG
TTTAATGATTTTGAAGTTTTGGATAATAAGGGCCATATTAGCATGAATGAGGCTCAAAAGATTGCAGATG
CTGAATTTGATAAGTTTAGAGTAAAACAGGATAAGTTCTATCAGTCTGACTTTGACAAATTATTGGAAGA
TGTTAAAAGATTAAAATAAATCGGATTTTAATAAGTTCTTTTAATTGTTCGGATTTTGATAATTTGGATT
CTAAGAGCTCTTTAAATTCGTTTAGGTTTTTTATAGTTTTTTGGCTTTTGGAATTTCTCATATAACTTTT
AGCTCTTCTGTAACTTGAACTTTGTTTTATTGTTCTTCATAATTTTATTGTTCTTCATAAAATCAAATAT
AAATATATATTAATTAAGTTAAGCAAATTAATTATCATAATAGTAATAATTTTTTATTGTTATTTATTCA
AAATCTAAAAAAAGTCAAAGTAATTAAATTTGTGAAATTAATTAACTGATTAAATATTTAATCAGCGAAT
TTTCAAGATTAATTATTTTGAAAATTAAATTTAATTAATTATTTTTATATTTTCTATCTTCTAGAGATAT
TTTTATATTCTCTATCCTCTAGAAAGATTTTAATTTTTCTATCATTTTGAAAATTACTAGAAAATAATTA
TTACTTAATACTGAGTGATTCTATGAAGTTTAATAAAAATAGGGGCATATCTGCCATATCAATAATTTTA
ATTCTATTTTTAAGTATTTCTATGGCATCTGCTATAGAAATAAGTGCAGATGATGCTGATATGGATTCTG
GAGACTTATCCGTTTGTGAAGTCAGCACATCTGATTGCTACGGCGAGACTCTAATCAGCGCTGATGCATC
CGGTGCTGATTCAAGTGATGAAATTATAATCAACGAAACAATTGCAGATGAAAAGACAGACTATCGCAGC
TCAATCCTTGCTGATGGTGAGAAGAAAAACCTTCATGTTGAAGTCTCTAATGATGTTTTCACACCTGATA
ACGATTATGAGTTCATGCTCTATGATGAGGATTTTAATCAAATCGGAGGATATTTGGATATATATCTTAA
TGATGAACTAACATACTCTGATTTTACCGTTGATAGTAGTGAAAGTTCTTCTATTAGCTTAAGTGGTCTA
GAGTGCGGATTAAATAAGATAACTTTCATATATGATGAAGATGATGTTTATAATCGCCTCAATCAAACAA
AAGAATTTTACATTTATGGAGAAAATCCTGAATTTGTCATGATACCTCATTACGATACCATAACATTAAA
TGGCAATTATTCTTCTAGAGTATATCTGAAGGAATATGATGAATGGGGATACTATGATGAGGATAATGAG
GGCGATATTGAACCTATCGATGATAAATTCAATGTATACATATATAAAGAAAATCCTGGTGATGAATATG
AACTTGTTTGGGAAGATGAGTTCGAAGCTAATGGAACCATTAATTTCGATGATGCCATCAAAACCACTGG
AAACTATTTGATTAGATATGTCTTTAATGGAAGCTCCGATTATAGCTATGCTCCATACAACTCATCTAAC
ATTATAAGATGTGTCAATGTCATAACCGATTTTATCATTAATGATACCTACTTTATTCCGGATAAGGGTT
TCGGATTCTCAGTTTATCTGGTTGATAATGCCACTGGAGACATAATAGATAAAGAATTTAAGCTTATGGT
TTATTATATTCTTGATACTTCAAATCCTGTAAGAATCGTTGAAGAGGAAATGGTTAAAGGAAATAAAACC
TACACATTTGATTGCAGCGAAATTCCAGAGAATATTACTTATTTATTCATCGGATGTATTTTTGATGGGG
ATAGGGATGAATATTCCTCTGCAGATAAAGAGTATGCTCTTGAATTGACTGATAGTAGAATAGAAACTTC
TATTAACGCTAACATTGGTGATTCTGTCATAGGAAATTCAAGCAGTTTCCGCGTATATGTCCAAGATGAG
GAGAATTGGGGACAAATCGATGCAACTTTAGACATTTATCTTAATGAAGAATATTCCCAAACTGTTACTG
CATATGCCTATCTTGAAAACGAAGTTCTTATTGAGAATCTTAAAAAAGGTGAAAATACTCTTAGAATAGT
ATATAACGGAACTGATATTTATCAAAATTCTGAAAAGTCTTATAACTTTACAGTATCTGATAAGAGAGCT
AACATTGAAGTTGACGTTAGCAACATAATCGTTGGAGATGTGACAAAAATCACTGTTAATCTGACTGATG
AGGATGGCAATATTCTCAATAAGGAATTCAATGTCTCTATTTATAAGGGCGGCTCTTATTATGATGAAGA
CAGTGAATTAATATACTCCCAAGTTTATACTGGATCTGCCAACATATCACTTCCAGACCTTGAAATTGAT
GATTATTATGTTAGAGCAGAATTTGTAGATGAAAGCTTTGTCTATTCTCAAGCAGAAGATAGCGAGTACT
TCAATGTTTATTCTAAAGGCAGTTACATAGACCTTGGTAAAACTTATTGGCCTGATAATGATGATGTGGT
TTTAAACATAAGCCTTAGGAATTATATTGAAGAAAATATTAATGGAGAAGTCCTTTTCCAATTCAATGGC
ACTGATTATCCATTGACCTGCACTGAAGATGGGGCAATCTTAAACCTTGGCAAATTGCCTGTAGGCAAAT
ATCAAATCTTCGCTAAATTTGATGGTGATGGAGAATATGAAGCTTCCAATTTAACCGATCAATTAAGAAT
AGTTAAAGCAACAATCATTAATGTGGAAGCTTGTGATGTCTTAAAAGGCCAATCTGAAACTGTAAACATC
ACATTCACTGACGGCGACGGCAATCCATTGGATGTCAAAATGTTAGATATTAACATTTGGGATACTGATG
GAAACTGGCTGGATTATGGACAATTGAGAAATTCCATTGAAATTAAGAATATTCAAACCGATTATATTAT
CCGTGCTATGTTAAGTGATAGTTATGGAGAGATTGGTTATTCTGACTATTATCCTTCAAGCGCATATGGA
TTCATCAGAGTCTTAAACGGAACCGACCCTACTGTAATTACAGTTACAAACACTGCTAACATTGATTTGG
CTATCGATGGCCCTAAAGTGATTATCACCCTTACAGATGAGGATGGAAAAGCTATTTCTGGTGCTAAATT
AAATGCAGCTGTTGGAAATATGGAATCTATTCTAACAACTGACAGCAAAGGCCAAGCTGTTTTGGCTATA
GGTGCAAATGACACTGCTAAAGTGACTTATACTGATGAGAATGGTGCTGGTGTTAGTGCTTCCATTGTAA
ACAATGTGATTAACACTACAGTTACTGAAATCGTTGAAAAGAACATAACTGTTCCTGTAACTGCAAATGC
CACCATTGATTTGGCTATTGATGGATCTGATGTAGTCGTAAGCCTTAACGATCTTGATGGTAATGCAATT
GCTTCTGCTAGCTTGGATGCTACTGTCGGCACAACTAACTCTACCTTAACCACTGATGACAAAGGTCAAG
CTAAAGTTGCAATCGGCGTAAACGAAACCGCTAAAGTGACTTATACTGATGAGAACGGTGCTAGTGTTAG
CGCTTCCATTGTAAATAATGTGATTAACAGCACAGTTGTAATCAACAATACAGTTAAGAGAAATGCAACT
AAGATCATTTACAATAATATGTCTACTGTCTCTGTCAATTCTGAGGTTGATGGAAGAATAGGAGAATACT
TTAATGTGACTTTAGTTGACTCCGATGGAAATGCATTGGCAAATAAGACTGTATACATTGGATTCAATGG
AAGAGTCTATGTCCGTCAGACAAATGAGACAGGCGGAGCACAGCTACAAATCAACCTCGGTTATCAAGGA
GATTACACATTTGCTATAGCCTTCTTAGGTGATGATGACTACAACGGATCATTTGAAGTTGCTATCATTA
AGGTAAGCAAGCAAAGCGGTAAGCTTACAAGCTCTCCAAAAACCTATAAGGCTAAAGCTAAGACTAAAAC
AGTTTCAGCTACATTCACTTCCTCTTATGGAAATCCTATCCCGGGCAAGAAGATAAGTTTCATAGTCAAT
GGAAAAACCTACTCAGCTAACACCAATGATAAGGGAGTTGCTACAGTCAAGGTTTCCCTATCCAAGAAAG
GAACTTATACCTGCAATATCAAATTTGCAGGAAATGGAATGTACACTGAATCCATTGCAAAATCTAAGAT
AACTATTAAATAGGTTTTTTTAAGAATAGTTTTTTAACTATTCTTCTCTTTTTTTATTTGGTTTTTAATT
TTTTTATTACTTATTTTCTTCTTTATGCTTTTTTTTAACTATTTTCATCGTTTTTTACTTATTTTCTTCT
TTATGCTTTTTTTTAACTATTTTCATCGTTTTTAATCAGTTTTTATTTTGTGTTTTTTCACACTTGTGAT
TTTGTGTTTTTGTGTTTTTTCACACTTGTGTTTTAGTGATTTTGTGTTTCTGTGTTTTTTCAGATTTGTG
TTTTTTCACAAAATCGCATCATAACAATCTTTTAATAGTATTTAAGAGATAGTAAGTTTATCTATTTTTT
TAATAAATAGTTATAAGGAATTTTTTTAAAAAATAAATAATTTTATGAAGATTTGATATATAGTTTAAAT
TATTGCTTATGGTTTAAGTTTTATGAAGATTTGATATATGGTTTAAATTATTGCTTATGGTTTAAGTTTT
ATGAAGATTTGATATATGGTTTAAATTATTGCTTATGGTTTATGTTTTATGGGTTTTGATATATGATTTA
AAATGATTAATTTGAATGGAGTATAAAAAGATGCTTGCCGAAATTGATTTTTCAAAGGATTTGATTGGTT
TTTTTGAAGATAAAAACTTATGCATAATTAATGAATCTCTTCTTGATGGTACTTTCGGTCTTTCAAGGGA
TATTTTGTTTGATAAACGTATTCTCTTTAACAATGATTCTCTAATCGATAGTTTTCTCTTAAATGCTAAA
GCTTATAATTTGAATAATGAATTTTTTATTTTATTAAGCAATATCATTAGAAATGACTTTCAAGAAGCCA
TTTCCAATAAATCTAATAATGAAATTTTGGATTTTGAAGAAACTCTTGAGAAAGAGAGCCCATTTTATTC
TGGAATACCTGTATCCAAAGAAATGTTTGTAGGTCGTAAGGATAGCATACATAAGATATTAAGAAACTTC
CCACATATTTTTAAGGGACAGACTAGACATTTCTTTTTAACTGGGGATAGGAGAATGGGGAAAACATCCC
TTATTGATTTTATAGGAGAATATATGAAATCATATGGTGTTGTAAGTGTTTATATTTCCAATAAGGGTAA
TGATTCTGTTGAATTTTTAGCTTATGAGATTGTTGAAGGGCTTATTGATGAATTAACCCTTCCTGATGAA
TCCCTTAAAACAAAGATTGTTGACTTCTTTCAAGATCATGTGGAAAGTGTGGAGTTTAAAGGAACAAAAA
TAAAGCTAACGGTAGATAAAAATCTATCTGTATCTTTTAAAGAAGATTTCATTAATCATTTAAAATCAAT
CTATGATGAATTTGGAATGGATAAAAAAGGAATTCTGATAGTTGTTGATGACATTAATGGCCTTTCAAAT
TCAGAGGAGTTTGTTCATTGGTATAAAAGAATGGCTGATACAATACAAGTTTCTCATATAAATTTGCCTG
TTTATTTTTTACTTGCTGGGTATCCCGAGAAATTTTATAATCTTACAAGGCTTGATGAGTCTTTTGGAAG
CATTTTTGCTTACGATAACTTGGATAGATTATCCAATATGGAAGTTTTGGAATTTTTTGAAAGTTCTTTT
GGTGAAAAATCCATGCTTATTGATAAGGATGCCTTATTCTACATGATTTTGTTTTCTCAAGGTCAGCCAT
TAATGATGCAAGAGCTAGGAGAATCAGTATTTTGGGAATGTCCTAATGGCCATATTGATAAATATATAGC
AATCAGAGGAATCATAAATGCTGCAAATGTTTTAGCAAGCAGGCAGATAAAATATACTTTAAATATCCTA
AGTGAAGATGATAAGGCAATTTTCAAGTCTTTAATTTCAGATGGAAAGTTTTTTTTCAATTCATCAGATA
TCTGTGATGAGGGATTTTTAGAGTCTATGTTTGATTTAAGTCTGATTGAAGTTTCCAAAAAAGAGGATTA
TGACTTTTGTTTTAAAAATACTTTGGTCTTTATCTATTTTTGGGTAGAAGCAATACAAGGTCTTATTGAG
AAATAATTTTTAATTAATTATGTCTTAGCCATATCCTATTTATTTTTCTTTTTTGTTGTTTATTTTAGAT
TTTATGCGCCATTGGGTTAAAACATGTCTTTAAATTTTCATAATTTGAATTAATATTGATTAATTCATTA
AAGTATTTAACCGATATTCAAGCTTTAAAGGCTTATTAGGGCTTTAAGAATATTTTCTATTTCAGTGAAA
AAATAAAATTTATATACTAGGTAAATCTAAAATAAATGTGGACAAGGAAATTACTTGTTCTTTGTTTAAT
TAATTAAGCAAAATGTTATTAAATAAGAATATATAAAACGAATGAAATAGTTTACTATTTCACTTTGGGT
TGGTTACAATTATTCTTTATGAAGAAATGGAAGTTATAAATATTGCTGTCCTTTAAGATTAGTTTTTAGC
TACTATTAAGGGAGGGTAGTTAATGATTGATTTTAAAGATTGTTGACATTTATAAAGGGGATTTCTTAGT
AAGGATAATTTTCTTTTTTAGAAAATTTTAGTTCATCTATTATTGTAGGGGTTGGTTTATACTTCTTATG
GTTTTGCTTAGTTAAAATAATTCTTTTTTTCTATATTTCTCTTATTTTACTTTATTTTACTTATTTTATC
TTATTTTACATTATTCTAGTCTAATTTTATTTTATAATACTTATTTTTCCTAAATTAATTTTCAAGTTCA
ATTTTAACTCTAAATCTTTCTTTTTAAGATGAAAAAATGCATGGGGAAAAGTCTAAAATCTAATTAAATT
TAGTTAAAAATTAAAAAAAGAGTAATATATAATTAAAGAAATTTAGAGAAATTAAAATAATTTTTTGATT
AAAAATAGCAAATTAAAAGAGTTAGAACCATTCAGATTCCTTAAACTCTTTTAATATTTATTTAAAATTA
TTATTTTTCAACAGGAGATTAATCTAATATCCATAGCTTAAAACATTTCCATCACTGTCAATCACTCTAG
AATATCCATCATCATAATTGACTCTATACTCACCCTCTCCTAAATACTCTCTAGAAACCTCATGTTCTGA
AGGATCCCAACCATCTATAACATCATCTGCCTTATAGTCACTCGCATAATCTCCATTATTGGATGTGGCA
GTTGTAGTTGTGCTAGTGGTTTTAGAGCTTTGCTCAACTTCCTTAGGGCTTACAATGAATTCATAGGTTA
ATCCATAGCCTTCATATTGGCTTGTTCCATCGTATTTGGCTATGAGAGTATAATTTCCCCTTTGCAGGTT
TTGAATTTGGCTTTCACCATTCTCATCTGTTTTAATGACTATATCGTCATTAAAGTTTCCATCCTTTGAT
TGGATCTTTAAGCTAATCTTTTGATCGGCTATTCCCTTTCCATCCTTATCGCATAGCTTTAGTTTTAATG
TGTCTCCTTCTGTAAGGTATTGGCTTGTTAGAATGGTTATATGGGTTTCTTCCTGACCGTTCATATGGGA
TATGAGAAATAGGCCAAGGCATACAAGAATAATTAATGTAACACATATTATGATTAGGTTTTTAGTTTCC
ATATTCTTATCTCCCTTATTGGTCTAGAAAATTTATTTAAATCTTATTAAACTTTCTATAGTTTGATTTT
GTTTGTTTTATATTTTTTAATTCTTATTTAAACTTTTTATAATTTAATATATTAAGTATTTTTCTTATTG
CTTGCATGATTTTAAAATTTGAACTTCTAATAATTTTTATCCCATTCAATTCTTCATTTTCAATTTTAAT
CAACAATATTTCTATTCATTTTTTTATTATTTTATGCATATCTATTATCAAAAATGCTTATTTTTTTATT
ATATGAGTTCAATTTATCCATTTATTAAAAATATTAATTATTTGCTTTATTTTTAGTAATATTAATATAT
CAAAACACTAAATATATAATATACTAAAAAAGATTTTATACAATTTTATAAAGATTAGGTTTATATTTAA
CCCTAATGGGTGATTTAATTTATTTAAAAAACTCTAATCAAATTATTCAAAATTATTAATTTATTATAAA
CATTGAGGTGTTTTTATGAAATTAAACATAAAAAAGAAGCATTCTTCTATTGTCCATACTTTCTGTTCTA
TTTTTAAGCATGGCAATGGTATCTGCTTCTGATATTAGTGCAGATGATTCTGTATCTTTAGATGCAGCAG
ATTCAGACATCGTAAGCACTGATTCTATAAGTGTTGACTCTGTAAACACATATTCTGCAGATTCAGCTAT
ATCTTCTAATGAAGATAAAGACAATTATCACCCTTCCAATCTAAAGGATGATGATAATAAGATTTCAAAA
ATCAATTATGAACTTAATGACACCGTCTTTTATGGAGATGATGTCATAATAAACGCAAATCTTACAGATA
TGGACGGAAACATAATCGATGAGTTTTTCCAAGTTACAGTTTATGATGAAGGCAATCCATTGCAGTCAAA
CAGCTTGAAAGGCAAGGGGACCATGATTGTTCCTACAGTCTCATTGACCGAGAGCAGTTATTATGATGTT
GCCCTAAGTTTTGCAGGCAATGAGGAATATGCTTCCTGCAATGAATTTACAAGCTTTAACGTGACTTTTA
AGGAAAATTCATATCTTGCCATTTCTAATTATGATTCATATTCTAAAATAAATTCAACTAAAATAAACTT
CATCATATATGATGTGGATGACGAATATATCAACGACACAGCTGACATTTACCTTAATGGAGAATATTAT
ACAAGCGTCCTTACAAATGGAAATGAGAATGAAGTGACCATTGAAAACCTCCAAGTGGGAGAGAATACTG
TTTTAGTTAAATATAACGGCTCTAATATATATAAGGGCTCAGAAGACTCTGCTACCATAATGGGATATGA
AAAGGATACCTCCATTGGAATCGATGCTCCAGATGTCCTTATTGGAAACGATGCACGGATAAAGATTAAT
CTAACTGATGAGGACGGCAATATTGTAAATGGCAGAGTGGATGTGGAAATTTACGAATACTATACTGGTG
ACGACGAATCTTATGTTCCATTTAAAGACGATTATGTCGTGAATGGAGAGGCAATAATTGTTATTTATCA
ATCCAAATTGCGTGCAGGCGTTACATATTTCATAAGGGCTGATTATGAAGGAAATTTAACTTATTTCAGA
TCAGTTGGCTCTGACTACTTTGATTGTTTTAACAGAAGCACTGAAATAGTAATCGATGGAAGAATCGCAT
CTGATGATAAGGATATCACTCTTGAGATTGGTCTTTTTGACCAAAGACAAGTGATGATTGCAGGGCTTGT
CAATCTAACAGTTTTCGACAATGAATCCAATGTGGTCATTGACACAATTTCTGTTGAAACAAGCGCTGAT
GATTATGTCAATGTGACAATCGGCAAATTGCCTTATGGCCATTATATGATCAATGCAAGCTTTGAAGGTA
ATGAAGAGTATGAAGGATGCGAATTGGAAGCTAATTTGCATGTCTTTAAGGCAACCAACCTAACCATTGA
AGTTCGTGACCAAATCAAAGGAGAATCCCAAATAGTCAACTTCTCTTTAGTCTCATCTGATGGCGGATTA
AATGAAAGCGCAAGTCTTATCATAAGAAATATGGAAAATGACTTGATTTATGATGGTATAATCAACTTTA
CAGATGGTAAGGCTTCCTATAACTTAGACAACCTTGAAGAAGGTCTTATTATCTTAGCAGATTATAACAA
TGGAATGGACTTAGTAGGACCATTTGAAACAGTCTATGATTCAGCTTCCAAATTTGCAACTGTAAGGATT
ATAAAACAGCTCAATGGAACCATTGAGTTTGAGCCTGTCAATGATTCCATCATTGTAAACTTAAAGGACA
TTGATGGAAATCCAATTGCAGAGGCTCCTCTTAGTGTGGATGTCAACGGACAAGTATTTGAATTAATTAC
CGATGATAACGGTCAGGCAATGCTTGACAACATTCCAAACAATGTCACAATCGAGGTTAAATACACAGAT
AACCAAGGTCTTGTAGCAAGCAATAAGATTGTTGTCCTTGTTAAGGAACAAATCAAGCAAAGGGCTGCAA
GCAAGATTGTCTGCAAGAACATGAGCACTGTAGCTGTAGCTACACCTGACGGCAGAGTCGGTGAGTATTT
CAATGTCACCTTAACCGATGCAGATGGAAATCCTTTAGTCAATAAGACAGTTATGATTGGATTCAATGGA
AGGGTATATACCCGTACAACCAATGAGACTGGAGAGGTTAACTTACAGATCAACCTTGGTTATAAGGGAT
CCTATACCTTTGCTATGTGTTTCTTAGGTGATGAGGATTATAATGCATCCTATGAGGTATGTGTGATTAA
GGTTTCATCTCACCAGCCTAAATTGACCGGAAGCGCTAAGACCTATAAGGTATCTGCAAAGACTAAAGCG
ATATCTGCAACATTCAAGACATCTAATGGAAATGTAATAAGCGGCAAGTCTTTAGTTTTCATTATAGACG
GCAAGCTTTATAATGCTAAGACCAATTCCAAAGGAGTTGCTACTGTAAATGTTTCCATCTCTAAAAAAGG
AACTTATTCCTGTACCGTAAGGTCCAGTGATGATGGAATGTATGCAGCTACCAGCACTAAGTTTAATGTA
AAGATAGTTTAGATTGACTTTAAAGAATAGTTTTTTAACTATTCTTCTTATCTTTTTTTAAGCTTTTTTT
AGTTCTTTTTTATTATTTTAACTTGCTTATACAAGTTTTTTTAACTCTTTTTTTATTATTTTAACTTGTC
TCATAGTTATTTTTTCAAACTCTTATTCTAGTTTTTAAAAATTGTTTCCATTTCGTAACAATTTTGATTT
ACTTATAGAAAACTATTTTTATTAGTTTAAATAGAATATTAATGATAATGATTAATCTAATCTCGGAATT
ATTTTTAGTATTAATCATTATTATCTAAATCATTGTTGAGTAACTATATTTTTATAGTTACTCTTTTTTA
ATGGAAGATAATTTAGTTTATCATTATACGAACTTTTTTTAAAGAATTAAATTTTAATTGCTATTTTTTC
AAAATAACCATCATATACTTCTTATTTGTACTATTAAATAATTTTTAATCTTAAAATAACAAATAAGTTA
TTATAATCAATATTTGATTTTTTCATCTTCAAGTAAAAATTGATTTAAGAATGTTAAATTGTTCTAATAT
TAAATCAATATTGTTCCACCTTAATTAAATTTGTCTTATTTGAAATCAATTTTGGCTTTAAAAATTTTAC
AAATTACTTTTACAAAGGCTAATAAGAGGCCATTTTGACTATTGCAAATCAATTACAACTCTTTTTTTAT
TAACCAATTTAAGATATTTTTTCAAGAAAAAAAATATTAAAATATAAATATCATATTGGAATTAAATATA
TAATAATAATTAAAAAAGGTGTTTATTTTGAAATTTGAAATTAAAAGAAGTTTAATATTCATTTCAATAT
TAGCAATATTGATCTTATCTATTGGAATGGCATCTGCTTCTGAAGAAATTTCTGATTCTGTTTCAACTGA
TATAGCATCTGAAGATGTTACAAGCGAAATTCAAACAGATAATGTAGAAATTACTAATCTAGATGAAGAC
TCTTCTTTAGATGATGCTGATTTAGAAAAGGATACAGGCGATAAAGTCAAAAAGGCAAAGAAAAGAATTA
ATACTAAAATCATCTACCAAAATATGAGTACCACCGCTGTAGTTAATGAATATGATGGCAGAACTGGGGA
ATACTTTAATGTAACTTTAGTGGATGAAGACGACAAGCCTGTAGTTGGCGAATTGATTCAAATTGGATTC
AACGGTAGAATTTATAATCGTACCACTGATTCAAACGGTGGAGCCCAACTTCAAATCAACCTTGCTTATT
CAGGTCCTTATACCTTTGCTATCTGCTATTTAGGTGAAGATACCTATGAATCTTCCTTTGAAGTTGCAGT
AATTAATGTTGCTGCTAAAAAGATGACTTTAACTGTTCCTTCCAAAAGCTATAAGGCATCTGCTAAAACC
AAAACATTAACTGCTACCTTAAAGGATAATAAGGGCAATTTAATTAAAAGCAAACAGATCAGCTTCACTG
TAAACGGTAAGACATACAGTGCAAAGACCGATTCCAAAGGTGTAGCTACTGTTAAAGTAAGCCTTTCCAC
TAAAAAGACTTACAGCTTCACAGCAAAATTTGCTGGAGACAAGTCATTTGGTGCGGTTACTAAGACTGGT
AAGGTTACTATTAAATAATCAAGCTTTTTTTGGCCGAAGGCCAAAAAACCTTGACTAAAATTTTTTTTCT
TAAGGATTCAAACACGATTTTTAAATGGGTTTGTTTAAGTTCTTTTTTTTTAAATGGGCTACTTTAAACT
CTTTTTTTAAATTAAAATTCTTTTATTCATTTACTTTTTGTCTTTAACTCTTTTTTTTCACTTATTTCTT
ATTTTTTAACTAAACATTTGCCTTCAATTCATTCACAGAATTTTAAACTTTAATTATATTGGGCTAATTT
TAAAAATCGTTAATAAATTATATTAATTATTTATATTTGATTATAAGACTGCTCTTTTTTTCATTTAAAT
CTTATTCATAGATTTTATCTAAATTTTATTATTTGGGACTGCTCTTTTTTTAATATAAATTTAATCCATA
CATTTCATATTAATTTCACTGATTAAAACTCTCTTATTTTCATTCACAGATATTATTATCCATTTGATTC
GCTAAGAAAAATTCATTTTTGAATAGATTTTAAAATTTTTCATATAAATTTGACTGTTTTTAAAAATTTT
TAAAAATAAGTCTTCATTGTATAATTATAATTAAGATTCATAAATTTTAATTGTATTAAAAAATTATTAA
TATAAATTAAAAATGTAATACTTTAAAAAGATATATATAGGTGTGGGTACTATAAATAATATCAATAAAG
TATAATGGATATCTTTTCAATTATGCTTTATGGTAAGGTTTTATTTATTAAGGGAGGAAAATTAAGTAAT
TATTTACCCTAAAACTATTAAAATTATAAAATTATAAAACTATCAAAATAAATTAAATAATCAGAATTTA
TAAAGATTTAGAAGATAATTTAATGTTTAGAAGATAAATTGTTTATTTTATTAAATAAGTTTTTACTACT
TTTTCTATAAACTTTAAATTTTAATAAACTCTCCTCATAAGCAATGGATTTGAATTTTTATTTATTTTGG
GTACGAATCAATTTTGAACTTTTATTCCTAAAATTTCTTATCTTATAGTGTCTTGAAAAATAGTTTAATA
TCCATTTATAAAATTAGATTTTATAATCTAAGTAAATGAAAATAATCTTTCATTGCTTTAATTTATCTTC
TTGTATCAAAGTCAAATTTCATCAACTCTCTTTATAAATCTTTTCTCCCTTAATAGTAATTCCTTATTTT
TTGTAATTTGAAGTTGAATTAAAACCTTATAGCGAGGTGGTCTTTAACTTTTAATTAATTAGCTTTGTTT
ATTGATATTAAGCTTATTCATTATCTTTTTAAATTGATTAGTAGAATATTTTTTCTCTTAATAAAACCTT
ACTAAATTAATTAAAATTAGTTTATTATTTTTTTAAAGAAGTTTATAGCTTTAGACAGTTTAAGGGTTGT
TTTTTTTTCAGGTATTTGATTTTAATAGTTTTTAACTATTTTTTCAGCTATGATTTTAATAATTATTAGC
TATTTTTATTCAAGTCTTTTGATTTAAACAGTTAATTCTGTCTTATTCGACTTTTTTAATTAAATATAAA
CTTTTTTTTATTTTTTTAATTAATCTTTTACTAATCAATTTTTAAGATAATTATAGACTTATCATCAATG
CAAGCAATTATTCCAGTTAAAGACAATTTTCTAATTTTAGTGACAAATATGAAGAAAAGTGATTTTAAAC
GTATATTCATATGTTTAGTTCTTCTTACTTGCTTGATTGGTGCAGTAAGTGCTGCTGAAGACGTTTCAGT
CGATGATGTTAGCACAGATGCTGTAGCAGTTGACACAATCACTGAAGATGCAAGTGACCCTACAGATATA
AGTACGGTCAGCGAGCCAGTCTCCAATGATGTTCAAGCAAACACAAGCCAAGAACTAAACAAAGAACCCG
CTACCAAGTCTACAAATGTCTTGAAAGATGGCACATCCACTAACATTTATGTGGCGACTACTGGTAGCGA
TGAAAATGACGGTTTAACTCAATCTACTGCTGTAGCTAGTCTTGCTAAAGCAGTTGAGATTGTAAATGCT
ACCGCTGGTACAGATTTTACTATTAATGTTGCAAACGGTGACTATAATATTAGCAAAATCGAAAGTCCTG
CAGCTAAAAACGTAAATCTTATTGGTGAAAGCAAAGAAGGAGCGATTCTTCACGCTTCTGATACATATGG
TATCAACGTTTACGAAGATAACATTGCATGGACTATTGAAAACTTGACTATCTGTGATTTCAATAGTACT
ACCAGTACAAGTGCGGCTGTAAGATGCTTTGCTATAGACAGTGTTTTCAATATAAACAACTGTATATTCA
AAAATATCGGTTCTAAAAACGGTGCTATTTACATAACTTCCACTGGAACAAGGACAATCTCCAATGTTCT
TATAGAAGACTGTTTCGGTACTTATTCAAGTTCATCTTCCATAATTCACTTATATGGTGAAGGTCCAGTT
ACTTTGGATAATATTGAAATACGCGGTTCCTATATGGATCCTTCTGTAGGTACAGCAACATATTTAAGGT
CTGTTATCTATGCCGACCAAGCTCAAACCAATGTTACTTTAAAGAATTCCCGAATTGTTGACAATATCGG
TGCTATGGGTTCATTGATCGAAGCTAAAGGAGCATTTAAAGTCATTAACACCACTTTTGAAGGTAATTAT
CTCAATACTTCTTCTAATGGTGTAAATGGTGGTACTTTCATGTTCTATAGTGGAACCAGCTCCAATTCTG
CATCCAACATTGACATTAGCCAATCAGTAATTAAGGACAATGTCCTTGCTGGTGGAAGCATCGGTCTCTT
CAATTGCGTATATGGTACTCACAACATTGACCACAATGTAATCATGAACAACAAATATGCAAATGGAAAC
GACGTTCCATTAGGTAGCTTCAGCGGAGCTGCAATCAGCACTGACGACAACTACTGGGGAACCAATGAAA
GGCCTAACACCAAAACAACTGAATGGGTTATATTAACTGTAGATACTCCTGAAATGGCATTTGTTGGCGT
ATCAGAAGCCATACCTGTTAATTTAAACACCTATAAAACTACAAACAATGAAACAGGTGCTGTGGAAGGC
ATGCCTGATGTTGACTTTGGCGTAACATATGCTCTTAATCAAGCAAATCCATCTACTGTAACCGTTGCAA
ATGGTCAAGGAACCATTAACTATCTTGCAACTGTTGATGGAAATGAAACATTAACCTTTTCCACTGGAGA
TGCTTTCTCCTTTGATGTGAAGGCGGATATTGCAAGTTTAATCTATGTAGATGGCCTAAACGGCAATGCT
ACAGGTCCTGGTGACAGTGAACATCCTTATAAGACCATAGCACAAGCAATTAATGTAGCTGCCGATGGAA
AGATTATCGTTATCAAATCAGGCACTTACACAGAAAACAGTTTAATAATTGCAAATAACATTACTTTAAA
AGCTGATAAAAACGCAGAAGTAATCATTGATGCAAACAACGAAGGAAGAATATTTACTGTACAAAAAGAC
GCTATAATCAGAGACTTAACCTTAATTAATGGAAAGTCCACTGGCAATGGAGGCGCAATATCTCTTGATA
GCGGCTTATTAACTTTAAACAATGTTAAAATCTACAATTCAACTGCCCAATCTGGCGGTGCAATTGTTAG
TTTATCAGGTTCTCAATTATCAGTTTCCAATTCTGAGTTCATTGACAATAATGCAAGCAATGGCGGTGCT
ATATATGTAGCAGGCGTTGCTGATATTACAAACAATAAGTTTATCTCCAATGATCCTGAAGATGGAGGTG
CCATATATGTAGCAGGCGTTGCTGATATTGAATCCAACGAATTTACTTCCAACCATGCTACTAATGGTGG
AGCAATCTACATTGACAGTGAAAACAATCAAACTATCAAGGATAACACTTTCACTTCCAACACTGCAGAT
AAGGGAGAAGCCATTTATATTAAAAACGCTAATGTGAGCTTATCTGGAAACACAATGGGTGAAAATGATT
CAATATATCTTGATGGTGCAAGCTTAAAAACCACTCTTACTTTCTTAGGCGGAAAAACCATTGCTGCTGA
ATTTGGACAAACTCTCAATTTAACAGCTACCCTTACCGATGAAGATGGAAACAATATAAGGGGCGGAATT
GTAACATTCACCGCTAACGGTGAAACCATTGCAACTATTGACTTATCCACTGACGCTCAATTGAAAACCC
AATATACTGTTCCTAATGATGCCGCTGGTGATATAACAATTTCCGGTTCATACAGTTTAGACAATGGCGG
AGCTGTCATATCCGGTAAGATACACCCTGCAGTTCCTCATTGGTTCATTGAAGGGGGAAGCGGATACGAA
ACATTGGCTGATGCCATTGATGGTGCAAGCGCTGGAGACATTATCTACTACGACCTTCCAGAGGACTACA
CTGAAGTGATTAGCAGCAAGACCATCAACAAGGCATTGACCATTAAAAACAATGGTACCGGTGTCGTTAC
TTTAGATGGTAATCTTGATAGGATACTTAGCATAAGCTCTGCTTCAGTCAATTTGGAAAATCTGATTTTC
ATTAACGGGGCCACTGCCACTAACGGAGGCCTTATCTATTTATCCGGTTCAGCATCTAATGACCTTAATA
TAAGTGGATGTACATTTAAGGATTCTAAATTTACCACTACAAGTACTTACACATATGCTGTAGCCATTTA
TGCTAATGGCGGAAACATTAATATCAAGGACAGTGAATTCAGAAACTTAACTGCTCCTAAAACAGGAATG
ATCTATCAATCTTCAAGTTCAGGTGCTATAACTATAGAAAACTCTCTATTCGATAACATTACAGGCGCAT
ATGATGGAGGCTTAATTAACTCAAATGGTGATGTATCCCTAGTTAAAACCAATGTGACCAACATTTTCGG
TTCCACTTCTACAAGTGATTATGGTTTAATTTACATTAGGTCTTATGGAGGCTTTTTATTCATATCTGAG
TGTCAATTTATAAATATAAGTAATGCTGGTGCCCATCCTGTCTATTACAGAGGAAGCGGCGGTTATAACA
TTACCCAATCCTTATTTATGAATATTAACTCAAATAAGATAATAGATGCAAGTGCAAAAGGTTATGTAAA
TTATAATATATTTGCAAACAATTCCAATAATTATGTTTTATATGGAAGTTCCTCTTCAAAAATTTCTGCA
GATTATAATTTCTTTGGAAGCAATAGCAAGCCTACAAGTTATGTAAGCAATGTTAATTACACTTACTGGA
CTATTGTAGAATTGTCCTCTGCAAGCGATACAGCATATGTAGGAAATCCTACAGACATTGCTATACAGTT
TGTAGGAACCGATGGAAGCGAAAACCTTACTCTTGAAGGCATAATGCCTGAATACACATTCACTTTAAAT
GTTACAAACGGAACTATCGTTCCTAACACTGTAACTCTTGAAGATAACGAAGCTAATGCAGAATTCACTC
CAACAAGCGTGGGAAAGGTAAACATTACAGCCACTCCAGGTCCTGCCCAATTGACTCTTAATGTAATCGA
CCCATCCATATTGCTCGTTGTATCCACAGATGGTTCAGACACTAATCCAGGTACTTTAAACAGTCCATAT
AAGACCATTGCACATGCTTTAACTCAAGCGAATGCAACAAGAAACGTCATTTATCTCTTATCAAGTGATG
ATGCTTACGCAGAACATGGATTAACAGTTTCAGACAATATAACTATCCGAGCTGAAGACAATACTGTTAC
AATTGATGGCGGACAAGAGGGACCTATATTCACTGTCACAGGCACTTTAAGCATAGAAGACATTATCTTA
AGCAATGCTAAGGTTGATGAAGATAATGGCATTGGTGGAGCTATCTATCTAAATGGCGGTAATCTAACTG
TCAATGGCGTGGTTTTCTCTGATTGTATTGCAGCTTACGGTGGTGCAATTGCTACAACTGCAGGTTCAAA
TTTAACCGTTATTAACTCTGTATTCAGTGATAATAAGGCTAAATATGGTGGAGCTATCTATGTGGCTGGT
GAAGCTAATATCTCAAATAGCGAATTCAGCGACAATAATAATGAGATTACTTATGGCGGTGCCATCTATG
TAAACGGTACTGGCCCTGTAGTTATCTCTGCAAACGAATTTGATAACAATAAAGCAAACAAAGGAGAAGC
AATCTACATTGAAAACGGTGCTGTAAATGTATCTGAAAACACAATCCCTGCAAACGAAACAATTTATCTT
GCAGGAGGCAGCATAAACTCTGTTCTCATATTCCTTGCTAATGGCACTATAAGTGCAGAATTTGAAGAAG
AGGTTAACTTAACTGCTACCCTTACTGATGATCAAGGAAATGCCATTAAGGGAGGTATTGTAACATTCAC
TGCTAACGGCGAAACCATTGCAACCGTTGACTTATCTACTGACGCTCAATTGGAAACCCAGTACACTGTT
CCTAATGATGCAACTGGAGACATTCTCATTTCCGGTTCATACTCTTTAGATAATGGTGGAGTAGTTGCTA
CAGGTATTGTTCACCCTGCAGTTCCTCACTGGTTCATTGAAGGCGGAAGCGGATATGAGACCTTGGCTGA
AGCTGTTGATGCAGCAAGTGCTGGAGATGTAATCTACGGTGATGCTGGAACTTATGATGTAAGTGATCTT
ATAATTAATAAGGCTGTAACCATTAAAGCAAATGAATCAGGTTCTATCGTCTTAAATGGTAATGGTAACC
AAATATTCAATACCCGGGCTAATGTCATTTTAGATAATTTGACATTCATCAATGGTTCAGCAAGTTCCAA
CGGTGGATTTATTTATGTATACAGCGATTCCTTGGTAATAAACAATTCAGTATTCAAGGATTTAAAAGCT
ACTGGAGGATTAGGCTCTGCAATCTATGTTGCTACTGGAAGCTCAAACATCACAATTGAAAATTCAGCTT
TCGACAATATTAAGGCAGCTACTGGTTTAATAAACTGCAGATCCAAAACAACAACATTTACTCTAGTCAA
AACCAATTTCACTAATATTGATGTAAGCACTAATGGATTATTCTATTTATACGAAGGAGGACTTCGTGCA
TACGAATCTCAATTCATAAATGTTTCAGGTGGAGACGGTGCAGTAGTTTACTTCTATGGTCAAAGTGATA
ATATAGTTACAAAATGTCTATTCGACAATGTAACAACCACAAAAACCACTGGAATTATTTATTCCAACAG
TAAATCTGCTAATATAACTTATAATGCTTTCTTAAATGTCAATTATGGAGTTTACTCTTCATCATCCTAT
GGTGAAGTCATTACTGCAGATTACAACTATTGGGGAAGCAATGACAAGCCTGGCACAAGCCTTGTAAATT
CAAACAGCAAATTAAATAACTGGGTGGTCATGACTGTAAGTCCAGACACTCTTGACAGCTTGGATTCAGG
CGCTACTCAAGCATTCACTGTAGACTTCACTCACTACACTGATGGCACTGCAAACTACACAATGGCTGAC
ACCATTCCAGAGCTTACAGTCTCTGCAAGTGCAGTCAAAGGCAGCTTAGACCAAAGCGAAGTTGAAACTC
AAAACAATGTCGCAACATTCACTTACACTGGAAGCCAAAACGGTGAAGAAACCGTAACTTTCACTAATGC
AAATCTAAGCATTCCTGTAAAGTTCGTTGTTGGTGAAGGATACTTTGGAATTGTTTATGTAGCTAAGAAC
GGCAGCGATGAAAATAAGGGTAGCGAAGATGCTCCTGTAGCAACTATTGCAAGAGCAGTTGAAATTGCTC
AAAGAGGTTCTGGCCAAATCATTATCACTGAAGGCGTCTATAATGAAAACAACATCACTATAAATAGCGA
AATCCCTATTTCCATTAAAGGTCAAGGAGATGTGGTTATTGATGGTGAAGGATTGTCCTCATTAAGCATT
TTCACTATTAAATCCGGTGAAGTTTCAATTGAGAAAATCTCATTCAGAAACAATAAGGCTAAATTTGGTG
CAGGTGTAAATGTTCAAGGCACTTCCGGTTCATCATTATTGGATGCAAATGTCTTAATCAATGAATGTAA
CTTTGATAATCTTAGCTCAGATGCTTCAGGCAGTCAAGGTGGAGCAATATATGCAAAATACTTAAAAGGA
AACCTAGTAATCAACAATTCCAACTTTACAAACTCTATTGTAAAAAGTGGGGGTGGAGCTTTAACTGTTG
CATACTGTGCATATGAAGATGCTCTTGACTTGGTGATTTCCAATTGTAACTTTGAAAACAACACTGCTAA
TAATGGTGGTGCTGCATACTTAATGGCTAATACAATCAATATTGTAAACACTAGCTTTATTAACAACAAT
GCTACATACAGCCCTGGTGCACTTGAATTGTATAATTGTACTGGAACTATGGACAATTGTTCTTTCATAA
ATAACAGTGCTAAAAATACAGCTGCTGCATTTAAACTTGAATTTGTTAAAGATCAACCTATAACCAGTTT
AATAGTTACTAACTCCATATTTAAGGACAATGTTGGTAGAGATGAAGTCGCTCCTGCAATATTCGTTGAC
AGGGCAAGCTTAAACATCTCCAATTCCATTCTATTAAATCCTTTGAATATTAATACCAGCACAGTTACCG
GATACGGTGCTGTACCTGGCCAAGGGGTAACCGTTGCAAACAGTAACTGGTGGGGAACCAATGAAAATCC
ATCTAACTTAACTGCAGGCAGTGGTGACAATGTCAATACTACAATAGACAATTGGGTAATCATGAATGTC
AGCCCAACTGAAGCTATCGGATACACTGGTGAAGCTCTAGAAATAACTGTTGACTTTAAATACACTATGA
GTGCTGATGGCACTATTGAAACATTAGCAGGTACTTTACCAGAAGAGTTTACTGTAAATGCTAATGCGGC
TAATGGTACTTTAGATAAAACCACAGCAGATACCAGCAATTTACAAGCTAAATTCGCATTCACTCCTGAA
TTTGCTGGAGAAAACATCGTTAACATATACACAACAGAATCCAATACCGTACCTGTTACAATAATGGTAA
CTGAAAAATACGCAGGCCCTATCTATGTAACTAAAGACGGTGACGATGAAAATGAAGGTTCAGAAAACTT
ACCTGTAGCAACCATTGCAAAAGCAATTGAACTTGCCCAAGGCAAATCTGGCTTAATCTTCATTGGTGAA
GGTACTTATGTTGAATCCAACCTCACAATCAGCAAAGACTTAAACATCACTGCACTTGGAGAAGTGATTT
GGGATGCTAACGGTCAAAGGGCATTCTCCATGTCTACAGGTAGTGTATCCATTTCAAACATTACATTCAT
AAACGGTAACTACACCCGCAATGGTCACTTGATCTACTGTGCTGGTGACAGTCTCAAATTCGATGAATGT
AAGTTCTTAAGCAACGGTGGAAATGTAACTGGTACCAACGGAGTCATCTATGTAGAACTTGCAAGTGCAA
ACTTCAACAACTGTTACTTCGAAAACAACACTGCAGGTACTGGAACAAGCTATGGTTTGATTTCCGCTAA
AGATTCAGTTATTATAGTAGATGGCTGTACATTTGTAAACAACTTTAATAAAAACGGCTGTATTTATGTA
AGCGGATCTAATATTGGGTCCATGGCTGTCATAAATAATACCAAATTCATTGGAAACAATGCTACCTCTG
CAAGCGGAGGTTCTGGTGGAGCTATCTATGCAAGCGGTTCAATGGCTTACCAATACTCTAACGGTACTGT
AAGACCTGGTGCTCAATCTGCTGTCTATGTAATTGACTGTGACTTTATCAATAACACTGCTTTCGGCGGT
AAATACTACAACGCTGAAGGTGGAGCTATCTTTGTAAATGCAAATGCAACATTATATGCATCTAATTCAA
GATTCATCGATAATACTGCTCTTGATTATGAAGAAACTAATAAATCAGGTCGTGGAGGAGCTATTGCGGC
CACAACAGGTAATGTACAAATTTCAAATTGTATATTCCAAGGCAACACTGCTAACAATGGTTCTGTTATC
GCCATGAAATTTGCAAACAAAGACCTTACAACTGTAAATGTCTTAAGCATAAGCAACTCTGTAATCATGG
GCCCTGGCGAAAAATTAATTGTCTCTGACTTCACTAACGGTTCTTTAGTTGCCAACAACAACTGGTGGGC
AGCGAATGAAAACCCATCTGATAGGGTAAGCGAAGGAATCACTGTAGACAGTTGGGTAATCCTAACTGCA
GATCCAAGTGAAATCACTGGAACTCTTGATGAAATTATACCAATCGTTGCTAACTTCAGACACACCAACA
GCACTGATGGAACTATCGGTGATTTGGAAGGAGAATTCCCAGAACTAGAAGTATTCGGAATGACTTTAGA
TGAAGGTGAAATTACTGAATCCAACCTTACTGTAGACAATGTAGCTACCCTTTACTACACTCCAGAAGAA
ACTGGTGAAACCACTGTATATGCTATTTCAGGCAATGCAATGGTTCCAATCAAAGTAACTATAACCGACA
CTCCTCAACCTGTTGCAGATGTTATCTATGTATCACCATCCGGTGCTGATACCAATGCAGGTACATATGA
AGCTCCTGTTGCAACCATTGCACACGCAGTGGAACTTGCAGGTGCTGAAGGTGCTTCAGGTTTAGTCGTC
ATTGAAGAAGGTATCTATAACGAAAACGGCATTGTAATAAACTCTGCTATACCTATTACCATTACAGGTA
ACGGAACTGTTATAATCAGAGGAAACAACCATGTCGTTAACGGAAACGGAGCTGGAAGATTTGGCGATGT
AAGCGAATCCACAAGCATAATAATTGTAAACACAACTGAAGCTGTTGTTATTGCAAACATTGCATTTGAA
GACAACATTGCAGCAAACGGTGGTGCAATACTCATTGCAGGAACCAGCAGTTCCAACTTATTCGATGCTG
ATGTATTGGTTGAAAACTGTAGTTTCAATAACTTGCAAGGAAGAAATGGTGGTGCTATCTATGCATACTA
CGCTATTGGCAACCTAACTGTAGCCAATTGTGAATTCACAAACATCAACGCAACTTGGGCTGCTTTATGC
GCATATCAAGCTGCTTATGGCGAAGGGCTCACTGTAGAGATAAAAGATTCAAGCTTTACAAACAACTCTG
CAAACAATGCTCCTGCACTTTACTTGCAAGCAACTAATGTTGTAATAAAAGATTCCAACTTTACAGACAA
CAATGCAACCTACCACCCTGGTGCTATCTACTTGCAGAACACTACTGCAACAATCGACAATTGTATTGTT
GCAAACAACTCTGCTAAATACGATAAGGCAGCTATTGCAATCCATGGAGGCAATATCCAATACAACCCAG
TAATTGTAAAACCTTCTGAAGTAACAATTACAAACTCTATTATTGAAAACAACATCGGTAGGGATAAAGC
AGCTCCTGCTATCTACTTGGAAAACTCCATCTTAAACATGTCTTACTCTTCTGTAGTAAACGAAATCAAC
ATTAACAATACCGTTACTGCAACCTATGGAGATGAAAAACCTGGACTTGTTTTAATCAACAACAACTGGT
GGGGAACCAACGACCCAAGCACTACCATATTCGGTACAAACATCACTATGGACAATTGGGTCATCATGAA
TGTAGAAGCAAACGCTACTGAAATCCTTGCTGGAGAAGAAGTAAAATTAACTGTTGACTTTAACCATGTA
AACACTACCGCTGGTGAGATTGAAGAATTAACCGGTGGAGTTATTCCAAGAGAATCCTACAGTGTAGCAC
TTTCTGTAGATAATGGTACTGTTGCACCTGAAACATTAACCATTGCTAACGGAGCTACTGGCGAAGCAAT
TTTCACTGCAGCTAATGCTAATGCATTAATAACTGTAACAAGCGAAAATGCAGTTGAAACTATATTGATT
AATGTTGGAGAACAACCAGTTCCATTCACTGGAGTTGTATATGTCTCCAAAGATGGTGATGACGCTAATG
AAGGTTCTGAAGATGAGCCTGTAGCAAGCCTTGCAAGAGCTATTGAAATCGCTACAGCTGAAGAAGGATC
TGGTCAAATCATCATTAAGGAAGGCACATACATTGTTGACGGATACAACATTACCAAAGACTTAACCATT
ACTGGTGAAGGAGATGTAATACTCGATGCTCAAAACCAAGGCAACAGATTATTCAATATGGCCTATGGTA
CTACTGTATCCAATTTCGAATTGCATAACCTTGTTCTTGCTAATGTAACTGCTATGTATGGCGCAGTTGT
TTACAGCTATGCAGCTAATGCAGTCTTAGACAACATTACAGTTGCTGGAATCAACCATGAAATGGCTAGG
CTCATTTCAAACTATGGTAATTTAACAATTAAAGACTCTGTATTTGCAAACAACACTGTAAGCGGAATAA
TCACCCACTCTGGAAACAATAATTTAAATATTGTCAATACAATATTTGAAGGCAACAATGTAACATATGA
TTCATCTATCATGGGTGTGGTTTATGTTTCATCAGGCAGAGGAAACATAACAATCGAAGATTCCAAATTC
TATGACAACCTTGTACGTCAATCCACAGTACGCGGTTACACAGATACTAACATTACAGTCAAAGGTACTG
AATTCATTAACAACACTGCAGACAACTCTCCATATTACTGCTCTGGCGGAGCTATTTTTGCACAAGCTAA
TTTGGATGTAACAGAATCCATATTCATCAATAACAATGCTAGAAGAGAAGGAGGAGCAATTTATATTGGA
ATCAATGGTGTGGCAAACATCACCAAATCCGAGTTCATCAATAACACAATCTATGATAATGAGTACTATG
GAGATGCAATCTACACTAAAGGTACAACTGCCATCAATTACTGTATATTCTTGACAAATGGCACAAGATA
TGCAGTTTACAATGGCGGATCCAAAGAAGTAAATGCTCAATACAACTGGTGGGGCACTAACGACGATCCT
CAAGGATTTGCTTACTCTGCAGATGCATCTAACTGGATTATTATGACTGTAACCGCTCCAAGCACTCAAG
ATATTCAAGCAGGAGACGAATATGAATTGACTGTTGACTTCAACCATTACACTGATGGCAGTGACATTTT
AGAATTGCCAGATAGCTTAGCTCAAGAATTGACTGTAGAATTCACTTCTACCACAGGCACATTTGACAAT
CCTGTAGTAACTACTGAAAATCAAGTGGCTACTGCAAAATACACTGTAGTTGCAGGTGAAAACAGTATCA
CAGTAAAATCCACTGATGCTGTATGGAACACTAGTTTCACTGCTGGAGAAAAGGCTAAGGCTAAGATGAA
TGTTTCAATGGAAAACAATACAATTATTGTAACCCTTACCGATGAGGAAGGAGCTCCTATTGCAGGCAAA
ACCATTAGTGTGCTCATTAACGAAGACACATTATCCAACGAAACCAATTCAAGCGGTATTGCTGCAATTT
CACTTGGCACTTTAGATGCTGGCACTTATCCAGCTACAATCAGCTTAGCTGACAGCGAATATCAAGCTCC
AGAGCTAACTGTATTTGTACTTGTAGAAGAGACTCTTGTAGACAACCCTATAGGTGCAGTCATTGAATTG
GCTCTTGCTGAAAATGGCACTTCCATTGAAGTGACCTTGAAGGACATTAACGGTCAGCCTATTGGCGATA
CTATTGTTAGATATTACATTGGAAGCACTGATGGAGCTCTCCTTCCTATTGATGCAAACGGTAAAGGATC
ATTTGACATTGACAATACAGTCAATCAAACCATTAAGGTCAGCTACACTAAGGAAGGCACTGAATGGTCT
TCATATTATGACTTTATTGTAAACAATGAAGTAACTCCTGTTCCTGTTGCCAATAACGCTAAATTCGATG
TAATTGTTCGTGAAGATAGCATTGATGTATTCTTATACAACGATAACTTAGACGATTTCGAAGGCGCTAA
GATTATGGTTACTATCGGTGAAGAAGATCCAGTTGAATATATTGCTGGAGAGAACGGAAATATAACCATC
CCTATCAATGGCGATACCACTGTAGAGCTTTCATACACTGATGAAAACGGAGCTACTGTCTACCACACTG
TTAAAGTTTCCACTAGTGGTGTGGATCCTTCTGCTGAAATTGAAATTATCGTCGAATCTCATAACGACAC
TTCTATTGAAGTAAGCGTAACTGTTGATGGTGATGATGTCAGTGATGGTGAAATTACCTATTACATTGGT
GATGATGACGATGGAACAGTTGTTCCTATTGAAGATGGAATTGCTATCATACCATTCGACAATACTGTAA
ATCAAACCATCGAAATCACATACTCAGATGGTGACGCTACAGAGTCAGTATACTACACTATAGTTGCATT
CACTCACGAAGTTCCTGTTGAGCCTCCTGTAGCTAATGGCAGCTTTGATGTTGAAACAACTGATGATGCT
ATTGTTGCTACTTTAGTTGACTCTGATGGTAAACCTATTGCTGATGCAACTGTTTCTGCTATAGTCAATG
GCGAAGAGCAAAACTTCACAACTGATGCGGATGGTAAGCTAAGCGTTCCTATTGATGGCAATGCAACTGT
TGAGCTTAGCTACACAGATCCTGAAAACGGTGCTGTCTTAAAATATGTAACTGATGTGGTAACTAAAGAA
GTTCCTATTGAAGTTCCTGTTGTTGCTAACGGCACTATGAGTGTAGAAACAACTGATGATGCTGTTGAAG
CTACCTTAGTTGACAGTGACGGAAACCCTATTGAAAATGCTACTGTCACTGCTGTAATCGATGGTGAGGA
ACAAAACTTCACAACTGATGCAGATGGTAAGGTAAGCATTCCTGTAGGTGAAAACGCTACTGTAGAGCTT
TCATACACTGACCCTGAAAACGGTGCAGTTGTTAAATACAGCACTAAAGTCGTAACTAAAGAAGTGGAAG
TTCCTGTTGACGTTCCTGTTGTTGCTAACGGAACATTAACTGTTGAAACAACTGACGATGCTATTGTCGC
TACATTAGTTGACAGCGACGGCAAACCAATTGCTAACGCTACTATCATTGCAGTTGTAGATGGCGAGGAA
ATGGAAATACCTACCGACGAAGATGGTAAATGCAGCGTTCTTATCACAGGAAACAACACTGTAGAGTTCA
GCTACACAGATCCTGCAAACAACGCTACAGTTTCATACTCCACTAAAGTGGTCACTGAAGTCGAAGAAGT
AATCGTTCCTGTTCCAGTAGTTGCTAACGCTACAATCTCCTTAAGCACTGAAGACGGCAGCTCAATCGTT
GCAACCCTAAAGGACCTTGACGGCAACGCAATAGCAAACGCTACACTTGATGCTAATGTCAATGGCGAAG
AAACTAAGTTAACTACAGATGCAAACGGAATAGCAACTATTCCTGTATCTGCAAACACAACAGCAGTAGT
CTCCTACACAGATTCTAACAAAGCTACTGTAACAAGCTCAATGAGCCTAACAGTAATCGAAACCATCGTA
GAAATCAACAAGACAATTGAAGTTCCTCCAGTAAGAAACGCATCTCAAATCGTTTGTGAAGACATGAACA
CAATTGCAGTTGCAAAAGATGATGGAAGAATCGGAGAATACTTCTACGTAAAACTAGTTGACGCAAACGG
CAATGCATTAGTCAACAAGTCCGTACAAATCGGATTCAACGGCAGAGTATACAACCGTACAACTAATGAA
ACAGGTGATGTAAAACTACAAATCAACCTCGCATACAAAGGAACCTACACATTCGCTATCGCATACCTAG
GCGATGACAACTACAACGGTTCATTTGTCGTTTCAAAGATTACAGTAAAACAACAAAGTCCTAAGATTAC
TACAACTTCCAAGACTTATAAGGCTAGCGCAAAAACAAAAGCATTGACCGCTACCTTTAAGACAGCAAAT
GGAAACCTAATAGCTGATAAGACTATTAAGTTTACTGTAAACGGTAAGACATACTCTGGCAAGACCAATG
CAAAAGGTGTAGCAACTGTAAAAGTAAGCCTTAACACTAAAGGAACTTACAGCTTTACAGCAAAATACGC
AGGAGACGACACCTTTAAGGCAACTAGTGCAAGCGGTAAATTAACTATTAAATAAATATTAAATGGGTTT
GGTCAATTAAGGCCAAATCCCTCTCTTTTATTTTATTTAAGTTGATTAATTGCTTAGTATGGTATAAAAC
ACAATATTTAATTTCAGCTTTTATTTTTTATTTTAAAAGCTGATTCTTTTTATTTTTTTATTTAAACACT
TTGATTCTATTTATTTTATTCTTAACTTAATAATCGTTCTTATTTATCGTAAATGGTTTAATTTAAGTTA
TTTAATGGCTTATTGGAAGTTATTTATTTAACCTTTTTTTAAGCTTTAAGTAACTTTTATTCAAAGTTCG
ATTCTTTGATACGATCTTTTAAAAAATACAATTATCAATTTATAACTATATAGGAGAGCTTAAATGAACT
TTAAAAAACTTTTAATGATTTCATTAATCTTATTATTTGTCTTATCAGTAGGATTTAGCACAGCAAGCGC
TATAGACTCTGATAATCTATTAGATGAAAATAATAATATTAATGTTAATTATATTGATTCTGATAATTCA
GATTCTATTTTAATTTCTGACAATTCAAATGATGCTAAATCAAATAATTTAATATTAAATAATTCTATAA
ATAAAAAAGAATTAAATGATAATTCTAATTCTAATTCTAATTTAGAGTGTGATTCTTCAATCAATGAAAA
TTTAGATTTAGAAAATAATTACAAAATTAATGAAAAATCTGCAGGTCTTAAAGACAATACAAATACAATA
TACGTATCTGTAGACGGAAATGATGAAAATGATGGTTTGACTCTAGAAACAGCAGTTGCAAACATATCAA
AAGCTGTCTCACTTGCTGGAGAAGGATACACCATCCACATATCCAGCGGTACTTATGAACAAAACAAGTC
CACACAACTGTCTCATGCATTTAACTTTATTGGAGAGGATGGAACAATAATTAAAAGAATAGGCACAGCA
AATGCCTTTACATACACTTCAGACACTAAAAAGACAATAAGCTTTAAAAATATAATATTTTCTTCAACCA
CTCCAAATCCAAGCAATCCAATATTAAGCATGGCTGGAGGCGCCGATTTGCAAATAGACAACTGTACATT
TACAGATGCAATTGCAGGTAGAAACGGCCTTATCAGATATTTGGGATCAAGTACAGGAAAGATTACAAAC
ACCAATTTCATTGGATTGACCGGCTCTACAAGCGCTTCATCCAGCTATATCACTGCACTTGCCCAATCTA
AGGTAAAGGTTGAGAATTGTACCTTTGCAAATATCAATGAACCAGGCTTTTTAAATTCACTTGTTTATGT
CAATAACAATGAGACTAATTTAACATTGGTCAACTGTGTTTTTAATAATATAACCGGCAATTTGAATGCT
GTTGTTAATAATAGAGGGTATATGCAGATTAAAAATTGCAGTTTCACTGATATTTCATTAAGCGGAAACA
GCCCAAGAGGAATTGTATGGTCTTCAGAAACCATTTCAAAAAATTCAATCACTTATATAAACTCATCTGT
ATTCATTAATAATTCTGTAAATACAGAAGTGGTTGTAAACAGTTCAGTCATTCAAGCCAAATCTCCTACT
ATAGTTGAATACAGTGCATTTTTAGACAATGATGTTGTTTTTATAATCAACAATGACAATGACACTGATG
TAACTGCAAATTACAATTGGTGGGGAACTAATGAGGGCCCTAAAAACTGCAGTGTAAATAGAGAATCTTC
TGCTAGTTCTAATCCTTCCTCCTCTAGTGAAGAAAAGATATCTCTAGTCTCAGATGGAGTTACAGTTGAC
AATTGGGCCATTATGACAGTAGATCTAGAAACTTCAGGCCTGATTGCAGGTGAAGACTATCCAATCATAA
TCAATATCAATAAATACATGAATGAAAGGGGAGAGATAGACTCTTCAGTAGAATATGGAATAAGCGGTGC
CGAAATATTATTAAGCTCTCAAATAGGGACCTTCAATTCCGATTTCATAATTTACAATGAAGATAATGGA
AACATAATTCAAAATCAGGCGAAAGTCTATACAAATAATGGAGCTGTAACAGTTTTCTATAAAGCTACCG
AAGAAGGTTCAGATACACTTAATATCAGTTCCGGATATGAAGAAATAGTATACAACCTTGAATTCGGACA
ATCAATTGAATATAATGACATTTATGTTTCTAAAGATGGAAATGACAACAACGATGGTCTTAGTAATGAA
ACCTCTGTATTAACCATTGCAAGGGCATTGGAGATAGGAGAAAATCTAAATTCAAATATAAGAATTCACA
TAGGCAGTGGAAGCTATCATGAGAGTGGATTTGAATTAAATGGAACTTACACAGTTCAAGATGGTGTCTT
GCAAGTTAAAAGAACCACATACTCATTCATCGGATATGGAAATGTGGTAATTGACGGAGATGGCCAAAAC
AAAAGCCTATTCACAGTTCGAAACAATTCAGTTTCATATAAAAACATCAGATTTACAAATGTTGACGGTG
CCACATACGGTGGGGCAATAAATGGTGACAACTTATATCGAAGGACTGCGTATATTGATTTGACAATTAA
TAATTGTACCTTTGATGACCTGCATGTTAAATCTAGTGGAGGCGCTATTTATTTAAATTACGTCAGTGGA
AGGATCTCCATAAACAATACCAAATTTTATAATCTTACTACCAATTCAAGTTGGGGTGGGGCCATAAGCG
CTGAAGAGGCCTTTGATCTTGCAAGAGTTAAGGTGACTAACTCTGACTTTAGGGACAATTATGCAAACAA
TGCCCCTGCAATGTATTTGAGGGTGAGCAATGTAACAGTCTTAAATAGCAATTTTATAAATAACAGCGCT
AAATATTATCCTGGAGCCATTCACTTTTATAATGCCTCTGCAATTATAGAAAACTGTGTCATAGCAAATA
ACTCTGCTAAGAAGGATTCTGCTGCAATAAAGATAAGCGAAGGCACTAATGATGTTGGAAATAAGATAAT
CATCAAATCATGTATCATTGAAAATAATAGCGCTCGAGATGAGATTTCCCCTGCAATCTATGTTGAAAAG
GGTGCATTGGACATATCCTACTCATCTGTCGTTAATGACTTGTCCATTGCAACAAGAACCTATTACTCTA
ATCTATATGGTCTCCAACAAGGCGTTGCTATAGCAAATAATAACTGGTGGGGACTTAGCAATCCATTTGG
AGAAAATGAGATTGGAGGAAACTATTCATCATTATTAGGTGGCGTATTTAACGGATCTAACATTACTGTA
GACAGTTGGGTTATTTTAAATGCAGTCTTAAATGATACAGGTGTTTTAAAGGTTGGAAACATTGTAAATA
TTAGTATTGACTTTAATCATGTAAACACTACAAGAGGAGAGATAGAGCTCTTGTCTGGAGGCAAGATACC
TAAAGAGTACACTTTACGCTTAAACGCAACTGGAGGTATCGTTTATCCAAACTATATGAAGACAGTTAAG
GGAGAGGCTAATTCCAAGTTTACAGTTAGGGATTTGGATAATCTTGGAGATGACTTTGCATCCTGCGGAT
TTGATATTATATCCGACAATGAGATTACCCATATAGTCTTTGAAATAAACAATTATAAAGGGGTAATTTT
TGTATCCATGTCTGGAAATGATGATTGCAACGGCTCTATGGATGCTCCTGTAAGAACAATCAATAAGTCT
ATAGAGCTTGCTCTTGATGAGGAGTTTGGTTCTCATGAGATATTTGTTCTTCCAGGGACCTATGAGGCAT
ATGGCATAGAATTAGACAGCACATACCTTAGCATTACAGGTTCTGGCAGGGACAGCACAATTCTGGATGG
AGTAGGATATACAGGAGGAATCTTCAATATATTTGAATCAGAATTGACTGTTAAAAACCTTACCGTTATA
AATGGAGTCAATACAGTCTCCTCTGGTGGCGCATTTACAAATATGGGCAATTTGACTTTAGAGGGTGTCA
ATGTCTCAAACTGTCAAGTAAGGAATGCAAATGGTGCAGCAATCTATTCTGTCGGCAATCTTAATCTTAT
AAACTCAAGCTTTGTTAAGAACACAGCATTATCAGGCAATTATGCAAACGGAGGGGTTATTTATGCCGAT
GGATATTCCACTTCCCTTCCATATCCTCCAAGCTTGAACATAACTGACTGTGAATTCATTTCAAATGCAG
CACAAGGATCAACATTCGGCGGAGGAGTAATCTATGCACAGTACCTTGACGGATATAAGTCAATCAAAAA
CTCCAAATTCATCAATAACACTGCAGAATTCGGAGGAGCAATATTCCTGCAGGACTCCGAAGGGGATTTC
ATAATTGACAATACAAGCTTCATTGGAAATAAGGCAACAGGCCAAGCAGGTTCCACAAATCCATACTATG
GTGGAGGAGCCTTGAACCTGATTGGAAGAACTGACGGCCGAGAGGGCAATTTCATTATTACAAACAGCCT
TTTTATAAACAATTCTGCAAAGAACAGCCGTGGAGGAGGAGCTATCCTAGATCGGAATGTTGATTTGAAT
ATAACTAATTCTGTATTTTTAAACAATACAGATACAAATAAGAGCGTTCAAGTATTTAAGGACACTACCG
TTTATTTCCCTAGCGGAGGAAGAATAAGCTTGGAAGACAATTGGTGGGGAGCTAATGAGTTGAGCAGTTT
ATCTACAGTTGCTGCTAATGTGACTATTAACAGATGGGTGGTTATGAATTTATCTGTTGAGTTGATTGAT
GATCTTGATTCATGGGGTCTTAATTTAGGAAATAGTTTAGATGATGGCTTAAACACTGATTTAGGAAATA
CACTAACTGAAAATAATCTTAATAATTATCTAGTAAAAGTTCTTTTAAATGAGTACAACGATGGAACTCT
AATAGACAATCCTAATTACTATCCTCTTCTCAGATTATACACTTTAGAATCTTCTGATGGAGAAATAAAT
CCTTCCTTTGGCATTCTGCAAAACAATTGTGCAACTGCCTTATTAAGCTCTAGCAATAGGGAAAATGTGA
TTAGGGCAACTATTGATGGAGAAACTTTGGAATTCAATACAATTGACCTTTACACAAAAACAGTTCTTGA
TATTGAATTTGACTCTCCAATTAAGGCAGGGGAAAATCTTACTGTCTATCTTAACCTTACAGACATAGAT
GATAATCCGATTAATGGAACTGTAATTTTAAACATCTCTTCTGATTTGTATGAAACAGTAGAAACAGTGA
ATGTAAATGAGGGCAAAGGATTTAAAGAGTTCAGCGGATTGAAAGTAGGTGTTTACACAGTTTTAGCTAA
TTATTACGGCCAATCAATTTATTTAGACTCAAATGATAGCAAAGTCCTTGAAATAAGTCCTATATCCAGT
TATTTGGATTTAGAATCTAAGGAGATTAGTATATTCCTTGGATTTGGAAATCTAACTGGAACTTTAAGTG
ATGATAATGGCCCTATTTCAAATAGAAATGTTTCATTGATTATTGATGATGATACAATATTAAATGGATT
AACTGATGAATCAGGACAATTTCTAATTGATTTAAGCAGTTTGAAAGTTGGAAATTATTCTGATTTGGAA
TTGGTCTTTGAAGGTGATGGTGATCGCTTGTCATCATCCGACCTTGTTAATATAACTGTTAAGAAGATTG
TTCTTAATTTGAATTTGATTGTCGAAGATGATTCTATTGTTGTTAATTTGAGTATAGATGATTCTGTTCT
TGATTATTTAGGTGTGGATGATTCATTAGATGATATAAGTCTTGAAGGATTGACAGTATTGGCTTTCATT
AATGAGACTGATAGAGTCTCTGATTTAATCAATAAATCTGCAATTACAGATGATAATGGAATTGCAACTA
TTGACATTAGTGATCTTAATCCTGGCAATTTCACAGCTTTAGTTAGCCTAAAAGAAAATGATAATTTTGA
AATAGATTCAAATAAGGATATAAACTTCTCAATTGATAGATATAAAACCAATTTAACTGCTATTATTGAT
GAAAATAATAGTTATATTCTTATTAATTTAACTAGTGATATAGGTCTTGATAGTAAAACTGTAAGTGTTA
CTATTGGTAATGAGTCTTTTGATGTTATAACTAATAGTTCTGGCCTATATGGTCTTGATATTAGTGATTT
GGCCCCTGGATATTATGATTGTTTATTTGTATTTGATGGTGATGACTATTATGATTCTTCATCTGATTCT
TTAAATTTCACAATCGAAAATCGTATGAGTGAATTAACTGCAATTATTGACGATAATTATGAATCTATTC
TCATTAGCTTGACTTGTGATGGCATTGGCCTTGCTGGTAAAACTATAAGTGTTACTATTGGTAATGAGTC
TTTTGAGCTTATAACTAATGATTCTGGTCTTTATAGTCTTGATATTGGTGATTTGGTTCCTGGATATTAT
GATTGCTTGTTTGTCTTTGCTGGTGATGACTATTATGATTCTTCAAGTGATTCTTTGAATTTCACCATTG
ACAAGTATTCAAGTGATTTAACTGCTCTAATTAGTGAAGATTCTATCCTTATTAGTTTGTCTAGTAATAA
TCTAGGTCTTGATAATAAAACTATAAGTGTTACTATGGGAATTGAGTCTTTTGATGTAATAACTAATAGT
TCTGGTTTCTATAGTCTTGATATTAGTGGATTGGGTCCTGGAGATTATATTGATTGTCTGTTTGTCTTTG
CTGGTGATGATTATTATGATTCTTCAAGTGATTCTTTGAATTTCACAATTGACAAATACGACACTAAATT
GGATGCTAAAAATACCATTGGCAGTTTTGCTTTAGTAAATCTCGATGCTAAATTGACAAGTGGTGAAAAT
GCTCTTAAAGACAAATCCATTAGTCTTCATATTGCAAATAAGACCTTCACTAAAAAGACTGATGATCAAG
GTAAAGTTGTATTTGACTTATCTTCATTTGATCCAGGTAATTATATTGCTCTATTGAGCTTTGCTGGTGA
TGAATATTACAAAAATTCAACTGTTTCTGTTGAAGTCATTATAAACAAGTTGAATGCTGATTTAAGCAGT
GAATTTAAGGATAAAAAATTATATATTTCTTTAAGTCATAAAGGCGCTCCTGTTAAATATATGAATCTTG
CTATAGAGATAATCGATTCATCAAATAAGAGTACAGTATCAAATGCACTAACAGATAATGAAGGTCATTT
CATTATGGATTTAAGCGATTTAAGTCCTGATAGTTATGTTTCTATCATAAGGGCAATTGGAGATAAGATT
TATAATCCTGCAAGTGATGAAATAGAATTTGTCATTGGGGGAGATACTCCATCTAAATCCACTAGAACTG
CTGCAGACTTACAAAAACTTATAGATGATGCAAGTAGTGGAGATATTATAGATTTAGGTGAATATGACTA
TCTTAATGTTTCTAATATTAATATTACAAAGGATATTGTTCTTATTGGAAACAATACAAGCATTTCAAGT
TCAGGAGATGGAAATCCAATATTCAATATTGCTACAGGGTTAAGTAGTGTTAAAATCAGTGGAATTGACT
TTAATGCATCAAATGGGGATGTGATTGTTAAGGCAATTGCTCAAAACGGAACTGATTCATTGTCAATCAT
TGTTCCAGCTATTGAAATCACCAATAACACAGTGATGGGAGACAATATAGTTCCAGAATCCATCACTATA
TTAGAATTGGATTCAGATAGGGGAGTTCTTGCTCCGAATAATGAGATTTATATTGCCAATAACACTTTGG
AAATCGGAATGAAACCGTTTGAATTTAAGGTCAAGAGCTTTGAAAATGATTCAAGTGCTAATGTGCCTAT
CGGCGGTGGGTTGAATGGCAAAAAGACTTCCATCATCCATTATGAGAATATGGACACTGTAGCAGTCAAT
ATGGATATTGAAGGAAGAGTTGGAAAGTACTTTGAAGTCAATCTAACCGATTCAGATGGCAATCCTTTGG
CAGATAAGAAGGTTCAAATAGGATTCAATGGTGTAGTATACAATAGAACTACAAACGCCACAGGCGGGGT
AAAACTGCAGATAAACCTTGGATATAAGGGAACTTACACATTTGCCATCTCATATCTTGGGGATGATGAA
TACAATGGAAGCTTTGTAGTTGCTAAGATAAAGGTTAGCACTCAAAAGACAAGTCTTACAAGCACATCAA
AGACCTATAAGGCAAGTGCAAAGACAAAGACTCTCACTGCAACACTTAAAGACTCAAAAGGCAATTTAAT
AGCTGGAAAAACAGTTAAATTCACTTTAAATGGAAAAAGCTATTCAGCTAAGACAAATGCAAAGGGTCTT
GCTAGCGTTAATGTAAGCATCTCAAGCAAGAAGACCTATAGCTTTACAGCCAAGTATGCAGGAGATGATA
TGTATGCATCTTCCAGTGCAAGTGCTAAGCTTGTAATTAAATAAATTATTTGGAATAGCTTTTTAGCTAT
TCTTTTCTCTTTTTTTTAAACTTATTTTCCTTTTTTCACATATTAGCTTTTTTACTTATTTTAGTCTGCA
TCTTCCTTTTTTATTTTCTTTTTACTTATTTTAGTCTGCACCTTCCTTTTTTATTTTCTTTTTACTTATT
TTAGTCTGCACCTTCCTTTTTTATTTTCTTTTTACTTATTTTTGGCTGTTTTTATCCTATTTTTAATTAT
CTTATTTTTGTTCGTTTATTATATAACTAATATTATTCCCTTTATTTTTTCAAAAACTTAATATAATTAA
CTTATTTTTTGTTTTAATCAATTGAAACGTTTTATTATAGTAATAGAATCATTTAAAAATATTTATATAA
ATATACTTATAAAAATAAATTTAAGTATTTGAATAATTTTTCAATCATACTTCAAAGGTTTTATTTGCTA
AGACTTGTATAAAAACTGATTGAAAAGATTAGGTTTTTTCATTAAATGTTCAATGCTTAATCCAATTTAA
TTAGGCTATTTCTAAGATTAATCTATCTATCTCTTAGTCTAATTTCCTTATTGGTCTGTAAACTAATTAA
ATTTAATTATTTATCGAAAACTTTCTTTTATCTTTTATTTGGAGAGATATAATGAAGATTAAAAATATTA
AATATCTACTGATATCTTTAGTTCTTCTCATGTTTCTAATAGGTGCAGCAAGTGCAGCAGATGATGCTGT
TACTCTTGAAGGGGATGCTGCAGCTGTTGATTCAATTAGTGAAGATGCTAGCGCTCCTATAACTACTACG
GTTAGTGAAGATGCTAGCATAGGTACTACTTTTAGTGATAGCGCTATCGAAAGCGATTCTATTCAATCTA
ATGATGATCTGGAACTAAAGAATGTAACTGACGTTAAACAAAAGGATTCCTCTGATGCTTTAAAAGACGG
AGAATCCACTACTATTTTTGTATCCACTGGGGGTAATGACAATAATGACGGCTTAAGTTTGGAAACTGCT
GTTGCCACTGTTGAAAAAGCAATCAATATAACAAAAACTGGTGGAACTGATTTCACCCTCTTGATTTCAA
ACGGTGATTATAACATTGAACAAATCACCATCCCTGTCGGCAAATATATTTCTATTATTGGTGAAAGCAA
GGAGGGCACAATTCTTCATGCTTCCGGCGATTATGGATTTGACATTTCATACGGATGTAATTTTGAAAAC
CTGACCATATCTGACTTAAACAGCACTTCCTCTACAAGTGCTGCCATAAGGATTATTATGGATAATTATG
ATATTAATATAAATAACTGCATATTTAAAAACATTGGTTCTGCTTATGGGGCGGTTCATGTTTATTCCAA
TGGAAAAACCTCCATTTCCAATGTTCTTATAGAAGACTGCTTTGCTACCAAATCAGATGACTCTTCCATA
ATCCATGTTTCTGGAAAAGGTCCGGTTAGTTTGGATAATGTTGAAATAAGAGGCTCTTATATGCTGCCTC
CTGCTTTTCCATGGAGTACCCCTTATTTGGGAGCCATTATCTTTTTAAGCAGCGCTGATCCTGATGTGAC
TCTAATGAATTCAAGAATTCATGATAATAATGGTTCTATTTATTCCATAATCACATCTAAAGGGAAAATT
AAAATTATCAACACTACAATTTCCGATAACTGCCTTAACGCTTCATATGCAAGCATATTTTCCAGTGGAG
TAAATTCCAATACTGCAACTGACATAACTGTCACTCAGTCAGTCATTGCAGACAATATTCTTGCTAATAA
TGCTGTAGGTCTCTTAGACGCCCGATTTGGTGTCTTTAAGGTTGACCACAATATAATCATCAACAATAAG
AATGCAAATGGCAATGATCTGTCAGTAGGCGACCTTTCTGGAGCCTCTTCATTCTCCATTGACGATAACT
ATTGGGGTACTAATGTAAGGCCTAACGATAAAACAAGCGAATGGGTCATCTTAACTGGAGATGTAGCTGA
ATGCGCATTTGTAGGGGTTTGCGAAAACATTAAGATTTTCTTAAACAGCTATGTGACTGAAAGCGGCGAA
ATAGGTGTTATAGATGGCATGCCTACCGTTGAGTTAGCTGTGGGATATGCTCTCAATCAAGAGAATCCAT
CTGCTGTGACCATTAAAGATGGAGTGGGAACTATCAGTTACCTTGCTTCTATTGCTGGAGAGGAAACTTT
AATCTTATCCACTGGAGATGTCTTTGAATTTAATGTAAGCTCTGAGATTGGTTCTTTAATTTTTGTCGAT
GGCTCTGTTGAAACATCTGGTGACGGTACACAGGAAAATCCGGTAAAGACCATCGCTGAAGCTTTAAATA
TAGCTGCAGACGGTAAAATCATTCTCATTAAAAATGGCACTTATAAGGAAAGCAATTTGCTTGTGGATAA
GGACATTACCATAAAGCCATATGATGGCGCCGATGTAATCATAGATGGAGACAATCAAGACAGGATATTT
ACAGTCACTTCCACTGCTACCATAAGTGATTTAAGCTTAACCGGAGGAAATGCCACTGGTGATGGAGGTG
CAATCTATCTGAATGGAGGCAATTTAACTTTATCCTTCTTAAATATCTCTAACTGTATTGCAAGTGACAA
TGGTGGTGCTATCGCAACTGCTGCCGGATCTGATTTATATCTTTCCAATTCAATCTTCACTGACAATTTC
GCAAGCAAAGGCCAATCCATTTTCATTGGAGGGGAAGCTGAAATTTTGATGAATGATTTTGTAGCTCATA
TGGATGTATTAAGTCCTGATGCATCTTTCAATGCCATTAGTATAAACACAGACTCTCCTGTAAGCATCGT
TTCAAATAACTTTAATGACAATGGCGCAATTAAGGGACAAGCAGTTTACATTAAGGATGCTCCTGTAAGT
TTGTCTGGAAACATTATGGATGATGAAATCATTTATCTTGAAAGCGGAAGCGTAAATTCCAATCTCATTT
TTATGGATGGAAAAACCCTTACCGTTGAACCGGGAGCTGATGTTAACTTAACTGCCACTCTAACTGACGA
TAAGGGAAATCTCATCAGAGGAGGAGAGCTCACTTTCACTGCAAATGGTGTGGCTGTTGGAGACCCTATT
GATATAAGCGGCGACAATGAATTAAGAATTCCTTATACTCTTCCTTCTGACTCAGAGGGAGATATTATTA
TTTCCGGTTCATACAGCTTTGACAATGGCGGAACAATCGTAAACGGTACAATTGAGCCTGATATTCCATA
TTGGTTTATTGAAGGCGGAAGAGGATATAAAACCTTAAATGAGACCGTTGAGAATGCAGTTGCTGGAGAT
GTCATCTATGGCAGTCCAGGCACTTATATTGCAAATGGCATTTTCATTACAAAAGACCTTACCATTAAGG
CCAATGAAACTGGAGATATCATATTGGATGGTAACGGATCTAGAGTATTTACCATAAAAAATCAAGCCAC
TCTAAGCTTAGTTAACTTAGACTTAAGCAATGGAGGATCTGAAGGCGGAGGATTTGTTTATATATATGCG
GAAGGTGGAAATCTTAACGTCATCAATTCCACTTTAAGGGATTTGAATATTGTTGGCTATCCTGAGTCTT
TCGAAGGAGGAGCTATAAAAACTTATGCTTCATCCACAATAAATATTGAATCTTCCCATTTTGAAAATAT
TAACTCTTCAGCTTTTGCTCCAATTCTTTCTGGTTTAGGTGGTGTTAAGCTTAGCCTTACCATAAAGGAT
TCCAGCTTCACTGATATTAAGGGCACTGCCATGTATGGCTTAATGAATGCTCCAGGTAAAGTGAATATTG
AAAGGTCTAATTTTACAGGTATAATTGGAAATACCACTAAGCAAACTGGACTTATCTTTGCAGACTCCAC
TTCTAACTATTTAATTAATGAATGTCTCTTCTCTAATATTTCAACAGATTCTGTTATCCGATTTAAGAAT
AATGGAAATATAACTGTTACCAAATCAGTATTCCAGAACATTCAAGACACAGGGGGAGCTCTTTATATAT
ATAATCCAGGGTCTGCCAAGGTAAATTACAATTTATTCATAGATAATACAAATCTTAATGCCGATAGCAA
TAGGGACATCTATTCCTATGGCTCAAATGTCGATTTGTCCTATAACTTCTGGGGAAATAACAGCAAACCT
ACAGAAAGCCAGATCTATGATGTTTCAAAAGCTCCTTACTGGACTATAGAGGAATTGTCCATGAATTCCG
ACTATATATTTACAGACGAAACTGCAGATATTGCTGTACAGTTTGTTGGAACCGATGGGGAAGAAAATCT
CACTCTTGATGATGTAATGCCAGAATATAGCTTTAATCTGGAAGCCACTAATGGAACTCTTGATGCAAAT
ACTGTAACTCTTGTGGATAATGAGGCTATTGTCACATTCACCCCTCCTTCTCTTACAGGAACTGTAACAG
TTACAGCCACTCCAGGCCCTGCTGAATTGACATTTGATGTTATTGAGACTTCAAAATTGCTTGTAGTGTC
CACTGCTGGTAGCGATGAAAATGCAGGTAGCTTTGAAAGCCCTTATAGAACCATTGCATATGCCTTAACT
AAGGCAAACGAAACAAGAAACATTATCTATCTTATATATACTGGTGAGGACTACAAAGAACATGACTTGA
CTCTTGCTGGAAATCTGACTATTATGGGTGAAAATGATGAAGTGACCATTAATGCAACTATCGGCAGGAT
ATTCCTTGTAACTGGCAATGTAAGCATTAAATCTTTAACTTTGTCTAATGGTTTTGATCAGGACTATGGT
GGAGCAATCTATGTAGATGGAGGTAATTTAACTCTAGATTATGTTAATTTTAATTCTAACAGAGCTTACG
GCTTAGGTGGTGCTATTGCTACTAGTTCAGAATCTAATTTATATATTTCCAATTCTATCTTCACCGACAA
TTTCGCAAGCTTCTTCGGAGGTGCCATTGGAACTGCTTCTGGCTCTAACTTAAGCATTGATAATTGCATA
TTCAGTGATAATAAGGCTAGTTACGGCGGTGCCATCTATCTTGCTGGAGAATCCCTTATCTTAACTAGCA
CATTTGATGGCAATCATATCTTGCTGGATGATGGAAGAGGAGGAGCCATTTATGTAAACACCACAGACTC
TGTAGTGATCTCTTCGAACGAATTTGAAAACAATTTTGCATATACTGGAGAAGTGATTTACATTGAAAAC
GGTATTGTCACATTATCTGAAAATACAATAGACGGTGATACCATTTACCTTGCGGGAGGTAGCGTAAACT
CCAATCTTGTTTTCATGGATAACTCCACTTTAAAGGTAGAATTGGGAGAGACAGTTAATTTGACTGCAAG
CCTTAGTGACGATTGTGGAAATCCTATAAGAGGAGGAAGCATAATATTTACAGTAAATGGCGAAGCCATT
GGAGACCCTATTGACATAAGCGGAGACAATGAATTGAAGACCACTTACACAGTTCCAATTGATGCAAGTG
AAGATATGATCATTTCCGGTTCATACAGCTTGGACAATGGAGGAATAGTTAAGGCGGGTTCCCTTCACCC
TTCCGTTCCTCATTGGTTTATTGAAGGTGGAATCGGATATGAATATTTATCTGAAGCCATTGATGGAGCT
GAAGCTGGAGACGTAATCTACTACGACCTTCCAGAGGACTACACTGATGTGATTAGCAGCAAAACCATCA
ACAAGGCATTAACCATTAAAAACAATGGTACTAATATTGTTACCTTAGATGGGGATGGAAATAATGTCTT
TACAGTAAGCGCTGATTTGGATTTGATTAACTTAAACTTTGTCAATGGTGGAAATACCAAAGGCGGATTC
ATATCACAAAGTTCAAATAACCTTAATATTATCAATTCCAGCTTTAAAAATAGTGCTTCCAGTAGCTCCG
CAGCTGCAATCCTAAGCTCAAATGGTAATCTAAACATTGAATCCTGTCTATTTGAAAATATAAGTTCCAG
CGCTTCAAGCAATGGTGGAATTATCTGTTATTCTGGAAGCAGCGGAAATTTAAACATTAATAATTCAGCA
TTCAATAACTTATCAGGTAAATATGACGGTTTCATCATATATTCCAGCACTTTTACAAATATTGCAAACT
CCAATTTCACAAACCTTTTAGGTCCAACTAGCTCTGGCTATTGGGGAGGCATTTATAACAGCAAATCCTT
GAATCTTACAAATTGCCAATTCATAAATGTTACAGGCCCTAAAGGTGCAGCCATCTATTCAACAGGATCA
CTTAATGTGACAAGGTCTGTCTTTGAAAATATTATTACAACTAATTCAGTAATTTATTCATACAGTTCCG
ATTCCTTTATAAATTATAACATCTTTGCAGATAACAATAAGGCCATTGATTCAACTAGAGCAAATGCAGA
TTACAACTTCTGGGGATCTAATGATAGACCAAGTTCAGATATTGTGAGCTCAAGCATATACCATGACTGG
GTCATTGTAGAGCTTTCTTCATCCAATGATACCATATTCTTAGGATCAACTGAGGATATTTCTATAGGAT
TTTTGGCAACTGACGGAGAGGAAAACTCCACTCTAGAGGATGCAATGCCAAGCTATGGCTTTGAATTGAC
TGTCACAGATGGAACCATTGAACCTTCCCTTGTAATTCTTGAGGATAATGAGGCAAAGGCAGTTTATACT
CCTTCTGCTGTAGGAACTGTAACAATTACAGCTAGCCCTGGTTCTGCTGAATTGGAACTTAATGTAATGG
ACAAATCCACTATGCTTATAGTGTCTGCTGAAGGTTCTGATGAAGGAGACGGCAGTTTTGAAAGTCCATA
TGCAACTATTGCACATGCTTTAAGTCAAGTAACCGAAACTAGAAACATTATCTATATCCTATCCTCTGAT
AAGGCTTATAAGGAAAGCGGATTGGTCCTTTCTGGAAACGTAATTATTATGGGTGAAGACAATTCAGTAA
CCATTAACGGTGGAAATGAAAGCAGGATATTCCTTGTAACTGGAAATGCAAGCATCAGTGACTTGATCCT
ATCTGAAGGAATGGCTGATGATTACGGTGGAGCAATCTATGTTGATGGAGGCAGCTTGGCCTTAAATAAT
GTGATTATTTCACAGTCCAAAGCATCTCTTGGAGGAGCCATCTATATCAACACAAGCTCTGATGTCAGCA
TAAGCTCAAATGTCTTTGAAGATAACGAGGCTGAAAAGGGAGAGGCGATATACATTGAAAACGGCGCTCT
TACCCTAACTGAAAATGCTATGGGTAATGAAACAGTTTACCTTGCTGGAGGTAGCGTAAACTCCAATCTT
GTTTTCTTGGCAAACAGCACTCTAAATGCAGAGTTTGGAAAGAACATGACTATAACTGCCACTCTAACTG
ATGATTGTGGAAATGTTATCCGCGGAGGTGCTGTGGTCTTAACAGTTGATGGCGAAACTATTGGAACTGT
TGATTTAAGTGGAAGCGATCCTCTTGAAATTGATTTCTATGTTCCTCAAGATGCAAGTGAAGACATGCTT
GTTTCAGGTTCATACAGCTTTGACAATGGAGGAACTGTCTCCACAGGAGCTATCCATCCTTGCATATTTT
ACTGGATAATAGAAGAAGGTAGATACGGATTTGAAACCTTGGATGAAGCAATAGACGCTTCCCGTGACAA
TGATGTAATCTATTATGACCTTCCAGATGATTACGAAGAAATACTTAATGACAAAGTCATTAGCCATAAC
TTGGTGATTAAAAACAATGGTACTGGAATTGTGACTTTAGACGCTGACAGAAGAAGAATGTTTGATTTAA
GTGGAGATTTGGAGCTGAATAATTTAGTCTTTATAAATGGGGCTACTAATAAGGATGGCGGATTTATCTA
TCAAAATTCAGGAAGCCTTAATATTATAAGTTCCATATTTAAAGACTCTCTTTCATCATACAGCGGTGTG
GTAGTCTTTTCAAATGGGGGTGACATAAGCATCGATGGCTCCAGATTTGAAAATCTGACTTCAAGGAAGG
GACCTATTGACTTTGAGTCAAATAGCGGAAGAGTAGACATTAGAAATTCAGTATTTGACCATATAACCGG
CAACTATGATGGATTTGTTATCTATTGCAAATCTGATTTGAATATTGAAGATTGCAATTTCACTAATCTC
AACAGTACAAGGGCTACAAGTACAAATTATTATGGAGCTATCTGTCATGAAAGCGGCAGCGGTGATTTAA
ATATAAGTGGCTCTTACTTCAGTAATATTTATGGCCCTACTGGAACTGCTGTCTACTACAAAGGTTCCGG
TACATATAACATAAGTAAAAATATCTTTGAAAACATCAGCTCCGGAGCAAATACTTGCATAATCTATGGC
GGAAGCTCTGGAAACATTAACTATAATGTATTCCTGGACATTAACTGTGGCATTACCACAAGCGGAGGAA
ATATTGATTATAATTACTGGGGAACTAACGATTATGCCGGCCTTGGCATAAATGGAACCGTCCCTAATAA
TTGGATAATTATGAATGTGGTAGCAAATGATTCCGATGTGATTGCTGAAAATGAAGTTCCAATAACTGTT
GACTTCAATCATTACATTGAAAATGGCGAGATTAAGGAATTGGAAGACAGTTTGGCTAAGGAATTCACTG
TTCAATTCACTTCCTCTACAAGTGAATTAGACGTTGATGAAGTGAATACAACCGATCAAGTGGCTATTGC
ATTCTGCACTGCTGTTGTCGGAGAGAACAATATCACAGTCAAGTCAGATAATGCAGTAGTCGAAATCACC
TTCAATGCAAGCGAACCTCTTGAATCTCATATGTCTGTAGATATGGATGATGACAACAATCTCATTGTCA
CAATCACAGATGGAGAAGGCAATGGAATTGAAGGCAAGACAGTATGTCTATTCATTGGTGATGAAGTCTT
AAATGCCACTACCGATTCAGAAGGTAATGCAGTAATCGCTCTTGATGAAGTAGATGATGGTGCTTACACT
GCAAAAATAAGCTTTAAGGATCCAGAGTATAAGGATATCAATGAAAACACTTTTGTTGTTATAAGAACTA
ATGAGCTTATTGAACCTGTAGCAGCAAATATTAGCATTGAATTATCTATTGAAGATGGCAAGGTCATTGC
TAATGTCACTGATCTTGATGGAGTTCCTTTAGCAGAAAAGCTTCTTACAGTAAGCATTGACGGCGTTCCT
GTTCTTGGTGCTAAGACTGATGAGAATGGTATCTATTCAATTGATGTCAGTCCTAATGCAACTGTGACTG
TTTCCTGCAGTGATGTTAACGGTGCTGTTGCTAGTGCTTCTATCACTTATGTTGAAAACAACAACACTGA
AGAAGTGGTTGTTATTGAGCCTGTAAGCGCTAACATTACTATTGTATTGTTAGTTGCTGAGGGTAATGTC
GTTGCCTATGTGACTGATCTTGATGACGTTCCTTTAGTTGAAAAACTTCTTAGCGTAAGTATCAACGACA
TCCCTATTCTTGGCGCTAAGACTGATGAGAAGGGTATTTGGTCTCTTCCTATAGAGGCTAATTCAACTAT
TGTAGTCTCTTGCAGTGATGTTAACGGTGCTGTAGCTAGTGCTTCTATCACTTATGTTGAAAACAACAAC
ACTGAAGTTGTTGTTGAGCCTGTAAGCGCTAATATAGTTATTGGATTATCCATAGTTGATGGCAAGGTCA
TTGCTAATGTCACTGATCTTGATGGCAATACTTTAGCAGATAAGCTTCTTAGCGTAAGCATTGATGGCGT
TCCTGTTCTTGGTGCTAAGACTGATGAGAATGGTATTTGGTCCATTGATGCAGAAGCTAATTCCACTGTT
GCAGTCTCTTGCAGTGATGCTAACGGTGCTGTAGCTAGTGCTTCTATCGCATACATTGAAAACAACAAGA
CTGAAGAGATAATTGTACCTGTTCCTGTTCCTGTTCCTGTAGTTGCAAATGCTACAATATCCTTAAGCAC
TGAAGATGGCAAATCAATCATTGCAAACTTAAAGGACCTTGACGGTAAGGCAATAGCAAACGCTACCCTT
AACGCTAAAGTCAACGGTATTGAACAAAACTTAACTACAGATGCAAATGGAATAGCAACTATCCCAGTAT
CTGCAAACACTACTGTAGAAGTTTCATACACAGATTCCAATATGGCTACTGTAACAAGCTCAATGAGCTT
GACTGTAATCGAAACCATCGTAGAGATAAACAAGACAATTGTAGTTCCTCCTATTAGAAATGCAAGCCAA
ATAGTCTGCAGTGACATGAACACAATTTCTGTTGCTCAAGAAGATGGAAGGGTCGGCGAATACTTCAATG
TAAAACTTGTAGATGCAAACGGCAAGCCATTAGCTAATAAGTTTATCCAAATCGGATTTAACGGAAGAGT
CTACGACCGTACAACCGATGAAAACGGAAGCACTAAATTGCAGATTAACCTTGCATACAAAGGAACCTAC
ACATTCGCTATAGCATATCTTGGCGATGATAATTATAATGGTTCATTTGTTGTTTCAAAAATCAAGGTAA
CTCAACAGACTCCAAGCTTAAAGACAAGCTCCAAAACCTATAAGACTAGCGCAAAAACAAAAGCACTGAC
CGCTACCTTTAAGACAGTTGGAGGCAAGCCAATAAGCGGTAAGACAGTTAAGTTCACAGTTAACGGCAAG
ACATACAGCGGCAAAACCAATGCTAAAGGTGTTGCAACTGTAAATGTAAGCCTAAACAAGAAAGGAACTT
ATAGCTTTACAGTTAAATACGCTGGAGACGATATCTTTAAGGCAGTTAGTGCTAGCGGTAAGTTGACTTT
AAAGTAAAATCAAGCTTTTCCGGGCCTTCGGCCCGCAAAACCTTGACCAAAATTTTTATTTATTTAGGTG
TTAATTAGGCTTTTTATGCTTAATTAGCCTTTTAATTTATTTTTTAACTTTTCTTTACTTTTTTTACTTT
TTTAAGTTTTCTTTATCTTTTTTTTCTAGTTTTTAATTTTATTTTTCCAAATTCTATTTTTACAATGAAT
TAGTTTTTCTCTGAATCCTATTTTGTAAATTTTATCATTCTAATTTTCAAAATGATCCAAATTATTAAAA
ATCTTTAAATTACTTTAAATTAATATAATTATTAGAGGTTGAATTTCTTTTTAAATTCAATTTAACTTTT
AATCAAATTTTAATTTTTATAATCATTATTAAGAATAAATAATAAAAATTCTAATTTTTATAATTTATTT
AATAATTATAATCAATGGATATATAGATTTCATTAATTTAAAAATTAAAATTATAATAATTCTTTAAGTA
TATTAAAACTAGACTCATTTAAATAAGGTGTTTTAATGGAAAGTCAAAGTATATTAATCAAAAATGCAAG
CATATTAAATCCAATTGGTGATGGAAAAACAGAAGAGTTTAGGAAGGATCTTTTGATTGTTGATGATAAG
ATATCTCAAATTGATGAGGATATAGATGAATCCAATGCAGATAAGATTATAGACGCTAGTGATAAGATAT
TGATGCCTGGATTTGTCAACACACATACTCATATTTCCATGTCTTTGCTTAGAGGCATAGCAGATGATTT
GGAACTTGATACATGGTTGAATGACCATATATGGCCTATGGAAGCACATTTAAGTGAAGAGTACTGCTAT
ATCGGAGCTCTTCTTGGTGCATGTGAGATGATTAAGTCTGGAACCACCACATTTTCAGACATGTACTTCT
ATATGGATGGAGTTGCAAGAGCTGTTGATGAGATTGGAATGAGAGGGGTCCTTTCCTATGGAATGATTGA
TTTTGGAATTGAGGAAAAACGTGAAAACGAATTTAAGGAAAACATATCCTTGATTAAGAAGCATAACAAC
ACTGCAGATGGTAGGATAACTGCTCGATTCGGTCCTCATTCTATCTATACAGCTTCAGTTGACCTTTTGG
AACGTGTCAGAAAGGAAGCTGACAAGTACAATGTAGGCATTCACATTCATATGAACGAGACATTGAAGGA
AATCAATGACTCTAAGGAAAACCATGATGGAAAAAGGCCTTTTGAGCTATTGGACAGCATTGGATTTTTG
GCTGATGATGTGGTAGCTGCACACTGCGTATGGCTTGATGATGCTGAGATAAAATTGATTAAGGACAATG
GAGTTTATGCTTCCCATAATCCATGTAGTAATATGAAGCTTGCATCTGGAGCAGCTCCTGTTGCTGAGCT
ATTGTCTCAAGGCATTTGCGTTGGCCTTGGAACTGACGGTGCAAGCAGCAACAATAATCTTGACATGTTT
GATGAGATGAAGTTTGCAGCACTTCTTGGAAAGGCCTCTACACTTAATCCTAAGGTATTGACTGCTGAAG
AGGTGGTTAATATGGCAACTATCAATGGTGCAAAGGCACTCAATATTGATGCAGGGACCATTGAAGTGGG
CAAAAAGGCAGATATTATTCTTGTTGATGCAAATAGTCCTAACATGACTCCTATGAGCAATACACTTTCA
TCTAATCTTGTATATTCTGCTAATGGATCTAATGTTGATACAACTATCTGTAATGGTAGGATCCTTATGG
AGAATAGAAAGATGGTGACTGTGGATGAGGAGTTAATATTATCCGAAGCAAAAAGAGCTATTAAAGAGAT
GAAAGAGTTAAGAGAGGCTGATGAATAGAGTTTTCTATTCATATTTATTTTTTTAATTTTTAAGTTTGTT
TCTTAACTTACGAACTATTATTTCTTGGATAAAAAAAGGCGGAATGAATCCGCCAGCAGGAAATCAATCT
TAAAAATTAAGATTGACACTTCAACACATAATCAGTATTATATTCTTTTTATTATTTAAACCTTTTTTTT
AATTGATTTAATCAATAAAATAAAGGTTTAAAATTTAAATTATTATTCTAGTTATCTTTTAGCAAACCTT
ATCTTGCTTTTGCTCATGACTATGCTCTTTTTCCAAGTGTCATTAGTCTCTGGGAAGTCTTCTCTGAAGT
GAGCTCCTCGGCTTTCCCTTCTAAGTATTGCTGATTTAACTATAAGGATGCATATCTCAACCATGTTTGT
GACTTCAAGAGCTGTTATGAGAGACTCATTGAATTGGGTTCTATCATCTACATTAAGGTCATTAAGTTCA
TTTTTCATCTCAAGAAGTCTTTCAAGGGCGGACTTAAGGTTTTGCTCATTTCTGACAATGGATACTTTCT
CCCACATCAGGTTTTGGATTTCCTTTTTCATATCCAATGGGTTTATTGAGCCTTCCTTGATTAATGATTT
TATTCTGTTCTCTTCATCTTCTACTGCTTCATTATTGTATCTGAACTCAGCAATGTCTGTTGCAGATGCT
GCAGATGATCCTGCAATCTTACCAAATACTTGAGTGTCTGCAAGTGCATTTCCTCCGAGTCTGTTTGCTC
CATGGACTCCTCCACAGACTTCTCCAGCTCCAAATAGGTTTTCCACATTTGTGCTTGCGTCTGGGTTTAT
TCTAAGTCCTCCCATATGGTGGTGGGCAGTTGGGGCAACTTCCATTGGCTCTTTCCTTATATCCACTCCA
ACATCAAGGAATTGCTCTAGCATTGTTTCAAGTTTTTCCTCTATTAGTTCTCCGTCAAGGTGGGTCACAT
CAAGGTATACTCCTCCATGCTCGGTTCCTCTTCCTTCCATGATTTCATTATAAATTGATCTTGCTACAAC
ATCTCTTGTTGCAAGTTCCATTCTATCGTCATAGCGGCCCATGAACCTTTCACCTTCGCTGTTTATGAGC
TTTCCTCCTTCTGCTCTTACAGCTTCGGTTACAAGGACTCCCTTTCTTGAATCTGGATAGACCATTCCTG
TAGGGTGGAACTGAACCTCTTCCATGTCGATTAGGTCTGCTCCGGCATTCCATGCTATTGCAAGTCCGTC
TCCGTTCTTTTGGGTTGTGTTTGAGCTGACAGGGTATAGCTGACCAGCACCTCCGCTTGCAAGAATGACA
GCCTTAGCCTGGAAGAAGATTGTTTCACTTGTCTTAAGGTCAAGTCCTACTGCTCCGATGACCTTTGGCA
TAAAGGATTCAGCAGGGTCAAGTATAAGCTGTGTAATCATCACTTCATCCATAGTTTTTATGTTTCTCTT
TAGGATTTCCTCCTTAAGGGCAGTCATAATCTCATGGCCTGTTCTGTCTCCCTGGAAGCATGTTCTTCTA
TAGGTTTGGCCTCCAAATGGTCTTTGGTTTAATTCTCCAGACTCTTGTCTGTCGAACAATGCACCATACT
CTTCAAGGTCGCTCAAGCGTTTTGGTGACTCGTTAACCAATATGTCTACTAATTTAGGGTCATTAAGGTA
TGCTCCACCTTTTAAGGTGTCTTTTATATGTGCTTCGATAGTGTCTTCAGGGTCAACAAGTCCAAGTGCA
GCGTTGTATCCACCTTCAGCCATGCCTGTACAACCAGAGCGGAATGAAAGTCCTTTAGAAACTATTAAAG
CTTCTTTGCCCTCATTGGATACTTCTATAGCTGCTCTGCAACCAGCTCCTCCTGAACCTATAATCAAAAC
ATCTGATTTGATAATTTTACTTTCCATAATTTCCCTCATTAGTTTTTTAATTGGATAATTCTTAGTTTTT
TAATTAATTAATTCTTAATTTTTAATTAAAATAATGCATAGTCTTTTAATTAAATGATAGTTTTTTAGAT
GTCATTTTCCTTACGATAAGCAATTATGTCTTCAATTGTAACTACAGGCATGTCATGCTCTGCTGAAAAT
TCAATTACATCAGGCATTCTTGCCATTGTTCCATTTGGAAGGGTGATTTCACACAATACGCCACATGGAT
TAAGTCCTGCAAGTCTCATAAGGTCAATTGTTGCCTCTGTATGACCGTCCCTTTCAAGGACCCCTCCAGG
TCTTGCCCTAAGTGGGAATACGTGACCTGGGTGGTGTAAATCGCTTGGTTTTGCATCCAATGCAGATGCT
GCTTTTACTGTAGTTACTCTGTCTGCTGCAGATACTCCGGTTGTAACACCTTCTGCAGCTTCAATTGTTA
TTGTAAATCCTGTACCATAGGTACTTGTATTGTTTTCAACCATTAATGGAAGTTCAAGAGCATCAGCCTT
ATCTTGGGTTAGGCATAAGCATACGATTCCGCTTCCTTCTCTTATGAGAAGTGCCATCTGTTCTTCAGTT
AAATGTTCGCTGGAGAAGATCATGTCTCCTTCGTTTTCTCTGTCTTCGTTATCTGTTACGATAACTCCAT
TTCCTGCTTTTATTGCTTCTAATGCTGTTTCTACTCTTTCTATTGGACTTCCTTTTAATCTTTCTTCTTG
ATTCATAGTAAAGCTCCTTTGTTGTTTATTTTAAAAGTTTTCTAGATTCCAGTTACTAGAATCAGGGCAA
AAAAAGGATATTTTTTAAGTAAATTAGTGATTTATTATAAATATAAATATAAAATAAATTGATTAAAGGT
AATGCTCTTTATTTTGGATAAAAAGACCTAATATTAAATAAAATATTAAATAATCTATATTTATTTACTT
AAATTTTCATATTCTCTTCCATCCGGACTTTCACCGTCGGTTTTGGACTTTCACCAAATCAACACATCTG
TGCTCGTGGACTTATCACTTTTTTGTTTTATGAATTACCACCGGTGGAGAATTTCACTCCGCCCTGAGAA
CATATTTAAATATATTTTTATTGATTTAAATAGTTTTATGTATTCTTTTATTAAATCGCTTATTTGGACA
TATAATATTTTGATTAAAAAAAGTCTTTAAAAATTGTTAATTGTTTATTATAAATGGTAAAATTAATAAA
TTTGTATATAAATGCCGTAATGGTTTTTATTTATGAAAATAGTTTAATAAATGGGGGATTTGTCTATTGT
AGGCTTTTTAAGTTATAAAAAAGATTTTAATAAATTATATAATTAAATATTCATTGGATTTTTAAGTCAT
AAAAAGAGGATTTTAATAAATAAAATTATGATTGGATTGGAATTTTAACTAATTTAAAAGAAAATTTTAA
AAAAAAAATAAAAAGTTAGAGAATCAAATTCTCTATCTTTTAAACTTCGACTTTAATCTATTTAACCTTC
ACAGTTGTCTTTGCACTTTTCTTAAGATAAGTGATTTGAACTGAATAGGTTTTTCCCTTTTTAAGCTTTT
TAATAACTGCTTTACCGATTTTTACTTTAGCCACTCCATTGCTATTGGTTTTAGTGGTATAGGTTTTTCC
ATTGAATTTAAATGTGACCTTTTTATTTTTAAGCTTTTTAGTACCATTTGTAATTGTGGCAGTTAAAGTA
AAGCTCTTAGCAGTCTTTTTAACTGTAACGCTTTTAGTGCTTATTTTCACATAGAAGTATATGCAGTTTG
AACAGCTTCCGGAAAATACATCTCTGCCAAGTGATGCCTTATTGTCTGTAAAATTACATTTGCTTACTTT
AAGACGTTTTTTATCAGAGACTGTATGATTAAATTCATATATTGCCCCTCCTTTGCTGGCAGTGTTTTTT
GTAAAGATTGAATCCTTGATTGTTGCTGTATAATATTTCATTTTGGAAACCCAAGTCTTATTTACATAGC
TTCCGCTTAATTCATGGCATCTGAAATAAACTGCGCCTCCATATTTAGGGGCCTTATTGTTTGTAAACTT
GGACTTTGAAATATTTAGGTTTTTATTTGCAAATACTGCGCCTCCATGTTCGCCAGCCTTATTGGAATTG
AATGTACAGCCATTAATCTTTATGTGGGTAAATGCATAGATTGCTCCTCCTCCACGGCCTTTGGCCACAT
TTGAGCTAAAGCTGCAATTATTTATGCTGTCCCATCCATAGTTTATGTTTATGTTCAATATATAATCTAT
AATAAAGTCCATATTTCCATCAATGACCTTATCTTTATAGATGTCTTTAAAGATATTTGTGCTATTTCCT
ATTTTAAATGAAAATACTGCTCCGGCATCTCCTCCTGCAGTGTTGTTTTTAAAATTGGAATTTTTTAAAA
TCATTTCGCCTACAGAATTGATGGCTCCTCCGCAGGTTTTTGCATAGTTGTTTTTGAATGTGCACTTGTT
TACTGTCAGATTTCCATAGTTAAATATGGCTCCTCCATAAAGGTCTGTCTTTCCATTGGCGAATACTATA
TTGTTTAATGTGACCTTATTGTTTCCAGTCAATCCAAAATGAATGAGAAAGATCCTTGATGCGGACAGTC
CGTTTATGGTGTGTCCGTTTCCATTGATTGTAATGCTTTTCTTGATTTCAATGCCTCTTGTGCTGAATCC
TTCATCATAGCTATAATCCTTATCTAGGCTTATTGTAGCGCCATTTGGGGCAGAATTGATTTTATACTGC
AAAGCGGTAAAAGTTCCATCGTCAATTGGCTCTGATTCTTTTTTAGATGAATTTATTATCTTGCTTATTA
CATCGCTAAGGACATCTTGAAGAGAGCTGTAATTGTTTGATTGAAGATAGCTTTTAATTCCATCCTCGAT
GGAAGGGTAGTTGTTTTCCTCTAGATAGTTGTTAATTTCTTTTATTAGGGTGCTGAAATTGTTTTCCTCT
AGATAGTTGTTTATTTCTTTTTGTAAGGCCTTATAGCTATTTTTCAAGATATACTTGCTTATTTCCTCTT
TTATGGCATTGTTATTGCTTTTCTTCAGGTAGTTGTTTATTTCTTCCTTTAGGGCAGTGTAGTTGTCTTT
CTCGAGGTAGCTGTTTATTTCTTTTATTAGGTAGCTAGTGTTAATTTTTATAGGAGCAGCGTTATCTCCG
TATTTTGAGCTAAACAAACTACCGTCTGCTTTTTTATTTAAATCATCATCAGATTCTTGTACTAATAAGC
CCTCATCAGATTCTAGATTATTATTATCATTATCAGATTCTTGAACTAGTAAATCTTTATCTGACTCTGG
ATTATTATTATCATTATCAGATTCTTGGACTAGTAAATTTTTATCTGACTCTTCATTTAATTCTTTTAGA
TTATTATCATCTTCAAGGCTTAATAAGTCCCCATCTGCCTCTTTGATTAGATTGTCACCATCACTTATGG
TTGTATCATTTATATCACTAGCTGCAACACTTGCAATAGTAAATAAACAGATAATTAAGCATAAAATGAC
AAAACTCTTTTTAATTTTCATGTTTTCTCCTTTTAAGCCATGAATTTTTTTATTTAAATCATGACTCCAT
TTCCAAATTTAAATTTTATTAATATTATATATTTTTATCTACGACTTATAAATTATTAGTATTCTTATAT
ATTAAACAAGTAGTTAATTAAATTTTCTTTATTTTTCCACTTTTTTAAAAATTCATCATATTTTTGTATT
AATGAACATTTTTTCATAAGTTAAAAATCAAAATCCATATTAATAAGATTTATTAAATTATTATTATGGA
GGTTTTACATGAGTTTAAAAAGTAAAGCAAAAAAGATCGGTAAAGCAGTAATTTTCGTAAAATTGTTTGA
AGATTTAATGGCAAATAAGGACAAAAGGGAAGAAGACATTGCTAAATTAAGAATACACATTGAAGAATGG
AAAGCTGAAGCTCCAGATGATTTAAATGCTATTTTAGCAGCTATATTAATGAAAGCTCCAGATTCTTCAC
CAGATGAAATCAAAGCAGAATTCGAACAAGCTAAAGCCGAATATCATGCTGAAGATGAAGATATTCTCCC
ATGGTTTGAAAGCCAAATAGAAAACATTACAAAAGAGGGAGAAGAAGCTGAAGAAGAGGCTGAAGAAGAA
GCAGTCGAAGTGGAAGTTACTGAAGAAGAGCCTGAAGAATAATTTTAAATTATCTTTTTAAACTCTTTCT
TTTTCTTATTTTTCTATTATTTTATTTTTCTATAATTTTATTTTCCTATTTTCCTATCTTTCTATTTTTC
TTTTTTTAATTAATTAATTTATATCTTTACTCTATTTTTTCAATTCTCTTTTTATTATTCTTATTTTTCC
ATTTAATGATGCAAGTAAGCGTTTACATTCGAAAAGCTTTATATAAATTCTTATTCAAATATTATTTGTA
GAAAAGAAAAAAATTAAAAAGGACGATACTATGGATAATAAATTTATAATATTGCTTTGCTTAGTGACTG
TTTCAGTTTTTATAAGTGCTTCATTTGCTTTTGGCAATGTTCTAAGCAATGCAGATAACGGATCTGTGCA
AACTTACAATAGTCATAAGGATATTTCCTCTCCAAATATGGATTATAAGCATCCTGGTGAACTTATTTAT
GGGGGCTGTGGTGGAAATCAAAATATTCAAACCGATGGGCATATTTGCGAGAAATAAAGTTATCCGAGAC
GGCCTTATTTAAAAAAATCTCACATTAATGTTTTAAGATATAATATCTCTCCAAATGGCAGCGCTTATCC
GGTGCTGCTAATTCTTAAAAAAAATAACTTAATTTATTCAAATGGTGGAAAATTGATTTTCCTCCATTTC
ATTCTTTTTTTCTTAAATTCTTATTTGTATTTTCCTAACTAGTAATCGGCTTCACTAATTTTCATTAAAT
GTTCTTTTTAGATGTTTAAATCATTTTTAACAATTTTATTTAAAAAATGAGCCAATAAGGATTTTATGTT
TTAAGTTGTTTGCAAGGAAAATTATTAAAAAAAGCTGTAGGGGTGGTTGGCATGGAAGACATGATAAGTG
TTATCAATTTGCTCTTGCAAATGATTAACGTAACTTTTGTTATGTTGATGTATTTCAAGAGCTAAGTAGG
GAGGGATAGTTTATCCCTTCCTAAATTGGTAATATTATTTTGTCTTTCATATATATAAATAGTTTTTTGG
AGGTAAATCATGAATTTGATATCAGTCATTATATATCTCATAATTCTTATTTTTGGAGTATGGGTGCTTT
ATAGGGGCTATAAAAAAGGAATGGAGTTTGGAAAGTTCCAGTATGCATTTATTGTTTGCTTAAGTGCCCT
GTTTATTTGCTTGCTTTATAGCCTATTTAATTAAATTTTAATTTCCTTTTTTTCTTTTTTTTAAGACCAA
ACTCTTTTAGCTTTTATTTTCAATAATTGATTAACTCTTTTAACATTAAATATAAATTCTAATTTTATTA
AACTATTATATGTGAAACCACTCATAATTTTATAAAAAAATAGATATTGTGATGTTTTATGGGCCCTGAA
GATACAATATATGAAAGCCAATCCCTTGAAGATACAATATACAAAAGAAAATCAGTACGCTCTTATGAGG
ATGCTCCATTGGATAACGAGACAATAAATGAAATAAGAGATTTTATAGAAAATGCAAATCCTCTCAATCC
TAATATAGAATGGAGCTATGAGATTCTTCCTAAAGAAAAAATAAGCACAATGATGAGATGGAAGGCTCCA
CATTATATTGCCATCTTTTCAGAGGATAAGGAAAACTATTATCAAAATATAGGATTCATATTCCAACAGG
TGGACTTGTTTCTACAAAGCAAGGGGATAGGCAGCTGCTGGATAGGAATGGGAAGTCCAAAGGATTATAA
GAATCCACATGGTCATAAGTTTATCATTTTGATTTCATTTGGAATGAGCGAAAGAATCTACAGAGAAATG
AATCAGTTTAAAAGAAAGGATATTGATGCAATATCCGATAATAAGGATGAAAGACTGATTCCGGCACAGT
TTGCCCCATCTTCCATGAATACCCAGCCATGGTACTTCACTCATAATGATGACGGTAGCTTCGACTTATA
CAGGGTAAAAAGGGGAGTCCTTAGAAACAGGTTTATGGGAAGATGGAATAAGATTGACACTGGAATAGCC
CTTGCACATCTTTATGTGGCAAATAGGGACAACTTTAGCTTCTATATGAAGGACAATCCTAAAGAATTGA
AAGGCCATATATATGATGGAAGTTTTGAAATTTAGGTTCTTTAGCTTATTTTTTGTTTATTTTAGTTGAA
CTTATAAGTTCACTTTTTTTAAATTTTTGCACTTTTGTAACTTGTAAGTTCATTTTTTATTAAATTCAGT
ATTTTTGTAACTTATAAGTTCACTTTTTTTAAATTTTTGCACTTTTGTAACTTGTAAGTTCATTTTTTAT
TAAAATTAGTATTTTTGTAACTTATAAGTTCACATCAAAAAGGCTTTTTTTTTAAAAAACTACCACAAAT
ATGGTATTAATCTATATTTTACCCTTTTTTCATACTCCACATATCCATCAAGCTCTTCTTCTAAAAGCTT
TTCTTCGTTTTTTATTCTAAAGATTATGATTATTGGATAAATCAGCATGACTATAAATGAAAATATGCTA
TCCAATACCAATGGCATTGATAGAAACAGGAATATTGTGGAAGTGTACATAGGATGACGCACAATGCCAT
AGAGTCCTGTGTCAACCACATTTTGACCCTCATTCACTTCTACTGTTCGAGAGAGGTATTCATTCTCCCT
AAGAACCTCTGCATACATGATATATGCAAGGAGAAATATGACTGAAGCAATGATTATAATCAAGCTATTG
AGCTTAAACCATCCGAATCTAAAGTTTAGCCCTGCAAGAATAAAAGCAAGAAGAAAGATGATTGCGCTAA
TTAAGATCACTATTTTTTGCTCTTCTTCCTCTTCATCAGCATTCAATCGTCTTCTTAGAAGCTCTGGACT
TTTGATAAACATGATGATTCCAGCAAAAAACATTGGGATGAAGAGTAATGCTATAAATAGCCATCCGTTC
GGGTAGTTGAGAGTTCCAGCGGGAATAAAAAGAAGTGCGCATATTATAATTAGGCCAATGAAAAATTTGC
TAAATGCCTGTAAAAATAGTTTATTGTCCATCCTATCACCAACTATAATAATCTTTAATTTTTTTAACAT
AAATCTTTTGACTTTTTGACTAAATTTAATTTCTTAGATAGTCTTTCGGTAAAATAAGTTAAATTTTTTA
AAACTATCTTTTGTTTTTGGAATAAATTAAATATTTTCAAAATAAATATATTAATCATTGATTAAATGAT
TGATTTAATGATTGATTAACTGATTGATAGATAATTGATTTAAGATAAAATGATTATAACTGATTCATAT
GAAGTGGAAGATTGGAGATGTAGAAATAGACAATCAAGTGGTTCTAGCCCCTATGGCCGGAGTATGTGAC
TCTGCATTTAGAACCATAGTCAAATCTATGGGTTGCGGGCTTATAGAAACCGAAATGGTTTCAGATAAGG
CAGTCATGTATGGCAATTGGAAAACTAAGGAAATGTTATATATGACAGACTATGAGCGCCCTATCTCTCA
GCAGATTGTCGGATCTGATATTGAATCTCTCACTTTTGCTTCCAAATACATCCAAGACAATACAAATGTT
GATATCATAGATATCAATATGGGATGTCCTGTAACTAAGGTGACAAATAGGGGCAAGGCTGGAAGCGCAT
TGCTAAAATCTCCGGATAAAATAAAATCTATTGTAGAATCTATTGTAGACTCTGTAGACATTCCTGTTAC
TGCAAAGATTAGAAGTGGATGGGATAAAAGCTGCATAAATGCAGTTGAAATAGCAAAGATTATTGAAGAT
GCAGGTGCATCAGCCATTACTGTTCATCCTAGAACAAAGGACCAGGCTTATTCTGGAAAGGCAGATTGGT
CTATAATTAAAAAGGTTAAGCAAAGCGTTAATATTCCGGTTATTGGAAATGGAGATGTAAGAACTTGTTT
TGATGCAAAAAGAATGTTGGATGAAACTGATTGCGATGCAGTGATGATTGGAAGGGCTGCACTAGGCAAT
CCTTGGCTTATTAGAGATTGTGTAAATTATCTGGATAATGGGGACTTGCCTATGGAAGTTACAATAGAAG
AGAGAATGGATATGTTAAAAAGACATGTGAATCTATTGCTTGAAAATAAGGGAGAAGAGTTTGCCATTCC
TAAGATGAGAACACATGCTGCCTATTATGTTAAAAAATTACCTCGCACTATTGAGCTAAAGCAGATGATA
TTTAAGATGAATACAAAAGAGGATCTTTTTAATCTATTGGATGATTATGTGGATTCATTAGATGAATTAA
AAAGGTAATTGTCTATTGTATAGTTTATGTTTATTCTTTAGAGGGGTAAAAAATTAGGTTTTATTCTATT
GTATATTTATTTTATTCAATAGACAAATTAGAGTTTGGAAAACTTATTTATTTTATACAATAGGAAAAAT
TTTAAGTTTTTATACTTTTAATTTTTTTTATGCAAGAAAAATTTGGAAAATTATAAAAAAAAGTTCTAGT
TTTTAACAAAAAAGTAAAAGTTTAGTCTTTAAAAGACAATAAAAAAAGTTTAATGTTTTTGAAATTAATC
AAAACATTATTTTATCTAGTAATATAGTTTATAGCTTATTTTTATTTAATAATAAACCTTAACAGCCTCA
TCAACATCATCATAAAGGCCAAGTGCTGCAAGTGCCCCTACTTTGCCTTGTTCTCCTGTAACTGCAAGAA
GTGGAATGTTAAGTTCTTCTGCTAGCTTTTCAGCTGTTTCAACATCCATCATGCCGGTTTTTGTAGCCAT
AGCATATTCCCTAAGCTTAGGTGGGATTCCAATTCCTTCAAGGATGGCTATTGCAGTCTTATCAGACAAT
GTGTCGTGCTTGAGTATTTCAATAAGCCTGTTTATTAGATTTTCTTTTTCTTCTTTGAGTACAGCAAATG
TAAGCGCTATAGAAACACAGTTTTGAGTCTTATGAGGATTATGAGGGAATAATTGAACGATAATATGGTC
AAGGTATTCATAGCCTTCTTCCTTTAATTGAAGACCAATATTATGTGCCATAGTCCAGGTTGCACCTGCA
TCCTTAACGTCTGTATCGTCTATTCCGATTACAAGCTTTTCGTATTTAGGAGTTACTACTGTGGCTTTTC
CTTCCTTGCTTCCTCCTCCGACTTCAAGAAGCTCTATGTATTTGACACCTTCTCCCATGCCTCTGCACAT
TCCAGCACCTACTCCAGCGCCAGCTAGACCTCCGTGGGTGACTTTGACTTCATTCTTTTCTTCGTCAATT
GCAACCTCTTCAATTCCAGCAGCATTTATGCTTGCCTTAAGGTCTAATGGCTTTTTGCCTACCTTACAAA
GATAGGTGTGCTTGTTTCCATCCCTTTTAGCATCTATGATAAGTTCGCTGCTGTGTTGGTATTGGTATAA
CAGCCAGTTTGAACCGCTAGGGCATGGATGGTATTCTATAAGTTCTACTTTATCTCCATCAGCCATGGTT
ATGACTTTTTCATATGGAGCAATCCATGGGTCATTAAATTTCTCTTTTAACTCTTCAGGTTTTAAAATTT
CCATATTATCACTTAAACCTTTAAAAAAAGTTTTTAAAAAGGATAATTCTTGTAAAAATTAATATAATGT
CTTTTAAGATAATAATTAGTTCTTAATGTAATGTCTTAAGATATATTTTGATTAAATTAATTCTTATTAT
AATTTTTATGAAAAAAAGTATTAAAAGAATTCAAATGAATTCTTTTTTTTAATTTATTATCTTTTAGACT
ATTTTTTAATTTATCTATCTGATTTAGATTAGATTAAATTATATGTCTTGTAATCTGTCACACATTTTAA
CAGCTGCTTCAACAGCGTTTTTACCATAGCTAACTCTTCTGTGTGCATCTAATCTGGTCATTCCAGGACC
GCTGATTCCAAGGGAAATTGGTTTGCCCCATTCTAAGGATAAGTCAGCTATCTTACGGGATGCATGTTGA
GCTACAATTTGGTCATGATCTGTTGCACCTTCAATTACAGTACCAAGAGTGATTATACAGTCAAGGTCGA
TTCTTCCTTCTTGGTCTGCTTCTGTAAGTTTTTTGATAGCAAGTGGCATGTCAAATACGCCAGGGACCAT
TACAATCTTTGTTATTTCACAGTCACGAACTTGAGCTTCAGCTTTAGCAAGCTCTAACATCATGTGAGTG
ATATCATAATTAAATTCAGCAACAACTGCTCCTATATTATATTTTACCATAATTCTTCCTCCAATAAATA
TTCTATTAGTAATTAGTTTAAATTAATTTATTTAGTTTATTTAGTTTATTTTGTTTTATTTTTCAGTTAC
AATAATAATTATCCTTTAGATTTACATTACCATAACGATAAAACTTGCTACAGCACTGAAAACCATAATT
AAGATAATAAATATTGCTGCGATTTGTGCTCTACTCATTTCAAATCTCCTTTAGTTTTGCTTAATAATAC
ATTACTTTAATATATTTATATAATTATTTATAAATGTTTATTTTTTATGATTCTTTAAGGGAATTTTTAT
AAAAATACTGGACCTTAAAATCTATCTCCAAATAGTTTTTCTTTTGAACTAATCATACCTTATTCTCTTG
AAAGTATTCAAATCATTAATTTATTCAAAATCATAAGGAGAAAAAGTATTCAAATCATTAATTTATTCAA
AATCATAAGGAGAAAAAGTATTCAAATCATTAATTAATTATATAAATCATAAAGAATAAAGTTTTAATAA
ATAGGATAAGGGTGTTTTAATGTCTATTAATAAGTCAAAATCTAATTTAAGCCTAAAAAATAAACTTAAA
TCTTTATTTAGTGGCAATTCCAATAAAAGCAGATATCAATCCAAACTAATAAGGGGGGACTTCGATTCAC
TCCATGACTTGAATATAGCATATGTCTTGAAGGGCTTTCCTACACTTTCACAGACTTTTGTTTCAAATGA
GCTTAGATATTTGGTTGAAGATGGCTTCAATGTAGTTGTATTCTGCTATATGGATCCTGCAGACTTGGTT
GAATTGGATTTTGATTTGGAAGTAATTCGCTTTGATGAGTCAGATGACCCTACTGGGAAATTGGAGCAAT
TACTATTGGACTATGAGATAGACATAGTGCATACCCATTTTGTCTATCCTCCCTGTACAGAATATACATT
TCCCGTTTGCGATAGGCTGGGAATTCCTTTTACAGTATTTGCACATGCTGTTGACATCTTCAAATATGAT
GTCGATAAAATTAATAGGGTTGATGAGATATCCAAAAGCCCATTCTGCAAGGGAATTCTTACATTGAGCA
ACTATCACAAGAATCATTTGATTGAAAGGGGAGTGGATAAGGATAAGATTCATATTACAAGGCAGGCTAC
TGACTATGAGATAGAGGAGCTTGAATTGAAAGAGAGGAATGTGAGAAATATTGTAAGCATTTCCCGTTTT
GTTGAAAAGAAAGGAATTGATGTCTTGATTGATGTGGCAGACATTCTAAGGGATGAGGATTATGAGTTTT
CCATCTATGGATTTGGAGGACTTGAAAAGGCATATCAAAGGCAGATTGATGAGTTGAATCTAGATAATAT
TTCCATTAAGGGGCGTTTGGACGGTCCTCAAGAGGTAAAAGAGGTCTTTGATAAGGCAGATATATTGGCG
TCTCCATGCAGAATAGCTGAAAATGGCGATAGGGATGGAATTCCTACGGTCATATTTGAGGCAATGGCCT
ATGGAGTGTGTGTATTGACTACAGAGGTTTCAGCAATCCCTGAAGTTATTGATGATGGAAGGAATGGTTT
TATTGTTCCTCCAGACAGTCCTGAAATATTTGCAGATAAGATTAGGGAAATTGCTAATTTGTCCCCAGAG
GAACGCTTTGAAATAGCTAAACAGGCACAAGTGGATGTTCAGGACACTTCCAGTGTTGATGAAACTATGA
AAACACTTTTTTTAACTTGGAGTTTGTAATGATTAAAAACTTTAGAATTGGGTTTTATTTATTTATTTAG
AATTATTGGTAATTATTCGGTTTAATTTATTTATTTATTTTTATTAGGATTAATTGAATTTATTTTACTG
TTTGGTGGATTGAAAATGAATTATGCTTTAATGGTTTACAACTATACAACAAACTTAGGCAATGAGATAC
AGACAATTGCTGCTAGAAGATTCCTGCCTAAGATAGATTACTATATCGATCATGAGAAGATAAATCTCTT
CAATGAGGAGGATAATGTAAAGATGATTATGAATGGATGGTATCTTGACTGTGAAAAGGCATGGCCTCCA
TCTGAATCAATCGATCCTCTCCTTATCTCCATGCATTTCAACACCACTTCAAGCAATAAGGAAAGGTTAA
AAGCTCTTTTAAGCGATGAAAGCATAGAATACTTTATGAACCATGCCCCTATAGGTTGCAGGGATTATTC
AACAGTTGAGTTTTTAAATGAGCAGGGAATAGATGCATACTTTTCCGGATGCCTTACATTGACATTGGAT
AATGGCAAAACTAAAGAGGAAAGGGAATTGGATAAAGGACAGGATTATATTGTTGTAAACTCTGAAATTG
CAGATGAGATCATTTCTTTTTTAAAGGATAAGACAGATAAAAAGATCTATAGGATTCAGCAAGACATGAT
ACCATCATTTGACACATCATTTCCAGAATCCATGCCATTATGGCTTTATAACCTTAGCTCCTTTTATGAT
TATGAGGAAAAGCTGTTTATGGCTGAAAATCTTTTAAGGATATATGAGAATGCCTCTTGTGTAATCACCG
ACAGATTGCATTGCGCCTTGCCATCTCTTGCCCTAGAGACTCCAGTGATGCTATTGAACAATAGGGGATT
TAGGGAAAGGTTTGATGGATTGAGCAATTTATTGCTGGAGAGTGACATTGATAGCTATGAATCCAATTAT
AATATCTTTGATGTGGACAATCCTCCTGAAAATCCCAAGGACTATTTGAAAATACGTAAGGATTTGATTG
AAAAATCTAAGAAATTCACCGGACATATCAACAATTCTTATTACTCTGATATTTCACAGAGGGAAATATT
TGAAAGAAATAACTTATTATTGTCTAGAAATGCCATTGGAACTAGGGATTATATTAGGAATGTCTTAAAA
AGAATGAGGCAGCATGAGAAGGACATTTCCAAAAAGGAAGAGATCATTAAAAATCAGGAAGCTATTATTG
ATAAGCAGAAAAAGATGATTGATGAGATGAAGGGGTCCAATAGCTGGAAGATAACTTCTCCTCTTAGAAA
GATTAGAAAATAAGTTATTTTTTAATTGGAGAAATTAAATAAGTTTTTTATTTTTAGATTGATATTTTTG
GAGAATATCATAAAATTATAGGCATTTAATTGCTATTTGACCTAATATTCTGGATTGTTCTTTTTAAATT
CCTCATAATTGTCATACTTAATTACATCTAAAAAGAACTTTTTCTTCTTTGGACCTAGATTATCAAGATA
ATCCTGATAATATTCTGTATTTTTTATCTTCTCATAGTCTTCTTTTATTAGATTGAACAACGGTTCCTTA
GCATCTTCAGTTATGTCCATAAGAGCCATTCTTGGACCATTTATCTTGTATGCGATAAGGTCGAACTTAT
AGTCATCATAGAACCCATTGTCTATGAATCTTCTCATTAGTTCGCATCCCGCTTCCACAGTATCCAGATA
ATTTGCATCTACCACATGGGTGATTGAAGCATTGTGCTTTCGTCTGTAATAAAAATGATGTCTGATTATT
GAAATTCTCTCTGCCTTAAGATAGACATAAAAGAAGAAAGGCATGTCTTCAAAATAGATTCCTTCTGGAA
AGCTTGCATTTATTGACTTTAAAAAATCATTTCTATAGATCTTTTGGCATGAACTTACTGATAAGTCAAA
TAGAAAGTCTTTTGTTTTCTCAGGTGTAAATACTATACCATCAAAGCTTTCATCAAGGTTGTTTAGATTA
AACCAGTCGTTTTCGTATATTCGTCCTGTTGCATCATCATAATTTATCATCTGATACATGGTTATGTCTG
TATCCTTTGATTTCGCCTCATTGTATGCTATCTCAAGAGCATCTAATCTGTACCAGTCATCTCCATCAAG
AAATCCCACATATTCTCCTTGGGCAATTGCCATTCCTTTATTTCTGCTTGCTCCAAGCCCAATATTTGAT
TGGTTTATTACAGTGATTCTTGGGTCTTCTTCAGCATATTTCTCTATGATTTCTGGTGTTTTATCGGTGG
ATCCATCGTTTATTATGATTATTTCTATGTCTTTAAGGCTTTGGTTTGTTAGACTGCATATGGCCTTATC
GATGAATCTCTCTTCATTATATGCTGATAAAATCATGGAAACTTTTGGTTTGGTCATTTTTACACCAATA
TTGTTTTATTAGTTTAATTAGAATTATTTTAATTGATTATTTCACTATCTTTTTAATTTGGTACTTTAAA
GAGCCTTTTGAAGACTTAAGATACTTCAAATCCTTTTTATACTTCTTGTTTTCTTTCTTTAGTTTCTTAT
TTTCCATCTCTAATTTTTCATTTTTCAAGTTCAGTTTCTTTGCCTCATCTGCAAACAAGCCTCTTCCTCT
TGTTCCATTAAAAAGATGATTTAAATGATTGGTTCTACCCTTTAGGTAATTATTTTCATTTATCAGTTCA
ACTATCTCATCTTCACTCATTGCACTGGCTCTTTTAGCTAAATAATCATTATCCTCGAATGGATTTTCTT
TCAATCCATCATCTATCTTACTAGAATCTTTAACTATCTGATTGAAGGTCAATTTAGCTGAATAGAAGTC
ATTAATATAAGATTTATATTTTATTTCATCTAATCCATCCATTATGCTGTCCTTTTCACAGATTCCCCAT
ATGTCTCTTCCGCTTCCAATATAATCAGCTATTTTAGATGGGCGGTATGGATTTATCTCAAAGTTTCCCT
TTGTCTCTGTATCATTTACAAGGAGAATGTCCAATTTGGTAGATAGATTTAAAAATTCAAGCAATGAAAC
CTTGTCATTCACTATGATGTTCTTGCTTATCTTTAAGTTGCCTGTAAGTCTTTTTAGGTTATCTCCATGG
TTTAGGAAGAGATGGAATTTTACTTTTGACCTTATGTCCTCATTTAGGCTTTCGCAGGCATAGAAGATTG
TTTCAAAGTTTCTCTTTCCAAAATAAGTTCCAAAGTATCCTATATTTATGCAGTCATCATCAATCTTATA
GTCAACTTCCTTGATGTGGTAGTATTTCTCATCAAGGGTAGGGTGAGGATTGATTTCAGACTTTGCCATG
ACCATGTCCTTTACATCATAAGGGCATTGATTAAGCATTATCTCCCTTTGGTTTGGGTTTGTAAAGCGTA
TCTTGTCGGCAAAGACATATGCTATATATTCGCATATCAAGTATATGAAGTCGCTTTCCTTAATATGCTC
CAGATTTTGTCCGGTTCTTTCATTGACCTTGTCGATTTCATTATTGATTCTATCGATGTATTCCTTATTG
TCTAACTTGAATCTTCTATCCCTTGGCTTGTTTTCAATGTTCACAGTTAAGGGATCTGAGAATTCAGCAG
TCCAGAATGTGTCTGGGTGCTTTAATTTATATTCCAAAGCTAAAAAATTAGGCTGGAATCCCCAGGAACG
TGTAGTTATTGTTTTATAGTTGGGATTTGTCTCTTCCAGTTTTTTCAATCCCTCTGTTATATAATTTCTA
AAGGTCTCATTAAGCTCCTTTTTACTCATTTCATATTCGAAATTCTTTATAATGATTCTGTTATCTATAA
TCTCTTCTGCAATTTCGTTAAAGTCATTATCAAGGGGCTCTTTAATCACTGTATGGCAAACATCATATCT
CTTGCCGCTAAGCAGGGCTCTTTTTGCAAGTATGATTCCACTTACATCATTCATAGGAGGGAATTTGTTT
GCTATTAATAGGTCTTCTGCTTGTTCTTTTTTGTTATTGTCTTTCATTTTATCCCTTGATAGTTGATTAG
AGTTTAATTATTTGAAATTGTAAGATTAGTGTGTATTTTAATATTTTAATTTTTAATATATTTTAGGGGT
TTTATTATTATAATTTGCTTTTTATGGCCTCACTAACTTCCATAGTTGTTGAACTGCCACCTAAATCTGG
AGTTAGGCATTTTCCTTCATTTAATAGTTCAAGGATTGCATTATTTAACTTCTCTTCAGCTTCACTCTCA
CCAAGATAGTTCAGCATCATGACTGCTGAAAGCATCATAGCCAATGGATTTGCAATTCCCTGACCTGCAA
TGTCTGGGGCTGAACCGTGGACTGGCTCAAACAATGCTCCGTTTTCTCCAATATTGCCTGATGGAATCAT
TCCAAGGCCTCCTACAAGTCCTGCACCTTCATCTGATAGTATGTCTCCAAAGAGATTGGTTGTTACAATC
ACTTCAAAGCTTTCAGGTCTTGTTATGAGATACATTGCAGTTGCATCGACATAAAAATCCTCTGAATCTA
TTTCATCCTTATACTTGTCTGCTATTTCATTAAATATATCTCTAAAGAGACCATCTGATATTTTTAGCAC
ATTTGCCTTATGAACTCCTGTAACCTTTGACTTATTGTTGTCCTTTGCATATTGGAAAGCATATTCTATT
ATTCTTTCGCTTGCCTTTCTTGTTATTATCCTTCTTGCAATTGCTCCTTCGGCTGTATATTCCTCTTCCT
TTGCAATATACATTCCTTCTGTATTTTCCCTCACTATCATAAAGTCAAGATTTTCAAAGAGGGCATTTGT
ATTTGGATAGCTTTTAACTGGCCTTAGGTTAGCAAAGAGGTTCAGTTCCTGTCTTAGTCTTACGATGACA
TCTGCTGCAGTCTCTCCTGCAGCTCCGAATAGGCAGGCATCTGCATTTTTTGCAAGTTGGATGGTTTCAT
TTGGAAGGGCCACTCCGTTCTTTTCCAGACATTCGTCTCCAGCCTCACCATAAGTAAAGTTAAAGTCCAC
ATCCAATGATTCTAAAACATTTATGGTTGCTTCCATTACCTCTTTACCTATTCCATCTCCAGGAATTACT
GCAATTTCGTACATTTTTCAATCTCCTTTACTATAATAGATAATAAGTTTAAACTCTCGCTAATTTTGTA
TTTATTGTTATTTAAAAAAATAATATTTATTTGTTTTTTAATATGATAAATATAATATTTTTTTTCTTTA
AAATGATAAATAATTGTTATTCATTCTGTTTTTTAAGATAATTAATCAATCCGCCTTCTTCAAGGATTTC
CAACATGAATGGAGGCAGCTTCTTAAATTCATACTCCTTTCCGCTTTCAGATATGATAATCCCCTTTTCC
ATATCCACTTCTATTTCCTCTCCATTTTCAATGGCAGAACTTATTCCAGGAGCTTCTAGGAGGGGAACTC
CCACATTTGTTGCATTTCTATAAAAGATCCTTGCAAAGGATTCGGCGATTACTGCAGATATTCCACAGCC
TTTGATTGCTATTGGAGCATGCTCCCTGCTTGATCCGCAGCCGAAGTTAGTTCCTCCAAGGATGAAATCT
CCAGCGCTTACTTTATTTTTAAAGTCAGGGTCCAATCCTTCCATGCAATGCTCGGATAGCTTTTCCTCAT
CAGTATAGATTAAATATCTTCCAGGAAGTATGATGTCAGTATCAATATCATTTCCAAATTTCCAAACTTT
TCCTTTCATTTTATCCCCTAAGATGGTTTGTTTTTCTTTTTCTTATTTAGGAACACTAATTCTTCCCTCA
ATTGCTGATTGTGCAGCTACTTTAGCGCTTGATAGGTAAACTTCACCTTCAGGACTTCCTTGTCTTCCCT
TAAAGTTTCTGTTTGATGTAGAAAGACTGACCTCTCCAGGACCTATTAGTCCTGTATGGCCTCCAAGGCA
TGGTCCACAGCATGGTGCTGAAACAAGGGCTCCAGCTTCCACAAATATCTTGATTAATCCTTCATCCAAT
GCCTTCATATATGTTTCCCTTGATGCAGGAATCACGAGCATTCTAAGGCCGGATGCTATATGCTTGCCTT
TTAATATCTTTGCGGCATCCCTTAGGTCTTCAATTCTTCCGTTTGTGCAAGAACCTACAAACACTTGGTC
TATTTCAATGTCGCTTAGCTCGCTTGCTGGCTTAACGTTATCTACATTATGTGGGCATGCGATTTGTGGC
TCAAGGTCGCTAACATCAATGTCCATTGTTTCAAGACTGGATGAATCCTCATCTGTTTTAAGATTGGACT
TTTCAATGAATGCCTTTAATCTGTTTTTGTTTTCGTCCTTTACCCTGTCCTTAAGGTATTGATAGGTTAC
ATTATCAGGCTCAATTATTCCGGTTTTTCCTCCCATCTCTATAGCCATATTGGATAATACCATTCTATCT
GAAATGTTCATAGTGGATATGGTCTCTCCCTTGAATTCACAGGACTTGTAGGTTGCTCCATCTGCCCCTA
CCTGTCCAATTATATTAAGAATCACATCCTTTGCAGATGTATTTTCCTTAAGGATTCCCTCTATATTGAA
TTGAATGGTTTCTGGAACCTTAAACCATAATTGCCCGGTGGACAATACCATAGCCATGTCTGTAGAGCCT
ATTCCAGTGGAAAATGCTCCAAGGGCACCATATGTTGTGGTATGTGAGTCTGCACCAACAATAACAGTTC
CTGGAATCACATGGCCTTTTTCAGGTAGAACCTGATGACAAACTCCTTCATAAACATCATAAAAGTTTTT
TATATCCTGCTCTTTTACGAACTTTCTCATTAGGATATGATTGTTTGCAGAGTCAAGAGAATCTGCTGGA
ACTTGGTGGTCAAATGGGATGACGATCTTTTCATTGTCCCAGACCCTTTCAGTTCCTATCTTGTTAAATG
ATTCAACTGCAAGAGGTCCAGTCAAATCATGCATCATGGCTATGTCAATGTCAGCCATGACTATATCTCC
AGCTTCAACTTGTCCTTGTCCTGAAGCTCTTGATAATATCTTTTCAGCAATTGTTGACATGTTTTCACCT
ATGTTTTTAAAAATAAGTTAAAATAGTTAGTTAGAATGAAAAATGAATGATTTTATTATTTTTTAATCTT
TTTTATATTTAAATAAACCCTTTTGAAATCTTATATATTTAAAGAATTTTAAATTAAGCGTTTAAAAGAT
TTGAAAATTATTTATTCCAAATCTTTTAGCTTTATGATTATTTTTATTTTTGTTGCTTTTCACTTGGATT
TTAACAATTTTCGTTTTATTCTATCATTAATGTATAAACTTATACAAATTGCCATAATTGACTAAAGTAA
CATCCTCTGGTACACTTTTAATTATATTTTTAGTGTCAAATATGAGCTTGGTCTTCATATTCCTCTTTAT
GCTATCATAATCCATATCCTTGAACTGATTATGGTCAGATAAGATAAGTATCATTGAAGAATCCTTGATT
GCATCATCAAAGTCTAAGTAATCTGGATTGTCAAAGTGAGGGTCATGTATGACCACTTCATATCCTGCAG
CCTTCAGTCCTGCAATTATCTCAAATGCAGGGCTTTCCCTTGCATCGTCTGTATTTCCTTTATAGGCCAC
TCCAAATACGCTTATCTTCTCTGCATCTTTGTCTAATTTGCTTAGAATCTTTCCGGTATTCTCTATTACA
AAACCTGGCATGCTGTTATTTGTATCCCTTGCAAGCTTGATTATTTTTGCTGTCTCTGGAGCCTTTGCAT
AGATGAAATATGGATCGATTGCAAGGCAGTGGCCTCCAACACCAGGGCCTGGGCTATGGATATTAACTCT
TGGATGCTTGTTTGCCATTTCAATAACGTCAAGGGCGTTTACGCCAATCTCTGCACATATTTTAGCAAGC
TCATTCGCAAGTGCGATGTTGACGTCTCTGAAGGTGTTTTCCATGCATTTTGATAATTCTGCAGTCTTTG
CTTCAGTCTCTATTATTTCTCCTTTTACAAAGGTTCTATAGACATCTGCAGCTTTTTTAGTACATTCTTC
AGTGATTCCACCTACTATTCTGTTGTTGTTTACAAGCTCTTCCATTATTTGTCCAGGCAATACTCTTTCA
GGGCAGTGAGCAAGATATAGGTCCTCTCCAATGACATAGCCTTCATTTTCAAAGATAGGCTTGATTACCT
CATCTGTAGACATTGGAGCTATTGTTGATTCGATGATAACGACATTTCCCTTTTTAAGGACAGGGAGAAT
GGAATTGCAAGCGGATATTACATAGCTTAAGTCACAGCTAAGATCCTCAGGCAAATATGGGGTTGGAACG
GTTATTATGAATGTGTCTGCCTCCTCAGGAGTTAATGAAGCATGATAATGGCCTTGGTCTACCGCATTTT
TGATTGAGTCGCTTATTCCAGGCTCTTCTATATGGGCTATTCCTTGGTTTAGCTTTTCAATGATTTCCTT
ATTTATGTCTACGCCAACAACCTCACAGCCACTTTTAGCAAATAATGCTGCAGTTGGCAATCCGATATAT
CCTTGTCCTACAATACAAATTTTCATAATATCTCCCTGAGTTTATTTTTATTGCATTTTAGTAATTTTTA
AGTTTTATTTCTTTAATAATTAAATGTTTATTTCTTTTCGTTTAATAGCTAAATTGTTATTTTCAAAATC
TTTTTTAAGAGTTTATTTTTTTTTTTAAAAAATTAATCAATTCAAACACTATTAAATATTAATTAAAATA
GTTTATACGATTTTATATATAATCTTTATTTAATATAAATATTATCAGAATAATTTTGGCTATTTTTCAC
TATTAAGGCAATCTAATTTATTTTACAGTTTTCTTTTGCTATTTTTCCAATTAGAGAAAAAATTTAATAT
TTTTTGATTAATTATATATTTTATGAAATTAAAAATTATATTATAATATATTACAACAGTTATTACAATA
TTTATTCAAATTAATTTAGAGGAATATTTATGAGGATTTTAATTACAGGCGCTTATGGAATGTTAGGATC
TGACTTAAGAGAGGTTCTAAAAAATCATGATTTAATTGCAACAGGCTCTAAAGACCTAGACATCACAGAT
GAAGAAAGATGTATTGATTTTATTGCTAAAGAACGTCCGGAAATAGTCATAAATGCTGCAGCTTACACTG
CTGTAGATGACTGTGAGACTCATTATGATGATGCATATGCAGTAAATGCCCTAGGGCCTCGTAATTTGGC
AATAGCCTGTAATAAGATTGATATTCCTTTGGTCCATATAAGCACAGACTATGTCTTTGATGGAACTAAG
CGAACTCCTCTTATAGAAAATGACAAATTAGGTCCTCAAAGCGCATATGGAAAGACCAAGCTTGCTGGAG
AGGAGTTCATTCAGGAAAACACTCAAAAATACTTCATTCTTCGTACCGCTTGGCTATATGGAATCCATGG
AGGAAACTTTGTAAAGACCATGTTGGATTTGGCTAAGGAACATGATGAGATAACTGTTGTAAATGATCAG
ATAGGGTCTCCTACATTCTCTCTTGATTTGGCAATGGCAATATGTGAGGTTCTAGACAGCGATAAGTATG
GCATCTATCACCTTACAAATGATGGGGAATGTTCCTGGTATGATTTTGCAAAAGAAATCTTTAGAATATC
TGATATTGATGTGAAGGTCATACCTGTAAGCACTGAAGAGTTTCCAAGACCTGCTCCAAGGCCACATTAT
TCTGTATTAAGCAATGTAAAATGGAAAAGCGCAGGTTTTGTTCCAATGAGAGATTATAAGGAAGCTTTGA
ATCAATATATTTCTTTATATAATTTTTTTGTAAAAATAGGTAAAATTTAATATTTATTTAATAATTTAAC
ACATATTTGTAGTTATATTTAAGTTGTGATAATATGAAAGGAATCGTTTTAGCTGGTGGTTCTGGAACCA
GATTATATCCAATTACAAAGGCTGTTTCTAAGCAGTTATTGCCTTTATATGATAAGCCAATGATTTATTA
TCCTATATCTGTCTTGATGCTAGCGAATATTAAAGATATATTAATAATATCAACTCCTCGTGATTTGCCA
ATGTATAAGGACTTGCTAGGGGATGGAAGCAATTTAGGAATGTCCTTTTCCTATGCTGAGCAAGAGAATC
CTAACGGGCTTGCTGAAGCATTCATCATAGGGGAAGACTTTATTGGCGATGACAATGTTGCTCTTATATT
GGGAGACAATATTTTCCATGGACACAGATTTACTGAAATCCTAGAAAGAGCTCGTGATCTTGATGATGGA
GCGGTCATATTCGGCTACTTTACAAACAAGCCAGAGGCTTTTGGGGTTGTTGAGTTTGATAATGAATGGA
ATGTTCTCTCCATAGAAGAAAAGCCAGAACATCCTAAATCCAATTATGTTGTTCCGGGACTTTATTTCTA
TGATAATGATGTTATTGAGATAGCAAAGAGTGTAAAGCCTTCAGATAGGGGAGAGCTTGAAATAACCTCT
GTAAATGAGGAGTATCTTAATAGGGGCAAGCTTAAGGTAGAGCTCCTAGGTAGAGGTATGGCTTGGCTTG
ATACAGGTACTCATGATGGGCTTCTTGAGGCAGCTAATTTCATTGAGACAGTTCAAAAGAGACAAAGTTT
GTATATTGCTTGTTTGGAGGAAATTGCTTATTCCAAGGGATATATTAGCAAAGAAGAGCTTTTAAAATTA
GCAGAGCCTCTTAAGAAAACTGCTTATGGTGATTATTTAACTAAATTAGCAGAAAGAAAGATTTAATCTG
TTATTGGAGAAGTATAATTTTACTTAACAGAAAGAAGTATAATCTGTTAATTGGAGAAGTATAATTTTAT
TTAACAGAAAGAAGATTAGTTATTTAATGAAAAGAATAATAATGGCTATTATAATTTAAGTGATAATATG
GGCAAGTTTAATATAATTAAAAGTGAAATTGAAGGTGTATTTACAGTTGAACCTACCGTTTTTGAAGATG
AACGGGGCTACTTTATGGAAACTTATAATGAGAATGACTTTAAGGCAGAGGGGATTGATTTAACCTTTGT
TCAAGACAATCAATCAAAGTCATCAAAAGGAGTACTTAGAGGCCTCCATTTCCAATACACACAGCCACAA
GGAAAGCTGGTTCGTGTAATAAAGGGAGAAGTCTTCGATGTGGGAGTGGATCTTAGAAAAGACTCACCTA
CATATGGAAAATGGATGGGGGAAATACTCTCTGAAGAAAACAAAAAACAGTTATTTATACCAAAAGGATT
TGCCCATGGCTTTTTAGTATTATCAGATGAAGCAGAATTCGTTTACAAGTGTACAGACTTCTATAAAGGA
GATGATGAGGGAGGAATCCAATGGAACGACCCTGATATAGGAATCGAATGGCCATTGGGAGACCTTAAGG
AAGAGGATCTGATTCTATCTGAAAAGGACAAGCTATTGAAGCCAATGAAAGACACTCCAACTGATTTCTA
TATGGAAGATGAATGATGATTTAGTTTTTGATTAATTTAGTTTAATTTAGTTTAATTCAGTTTAATCTAG
TTTATTTGATTTATTTATTTAATTTTATTTATTTTTAATTAATTATATTTTATTTAAGGTGTTTTTATGA
CAAAAATTTTAGTTACTGGCGGTGCAGGTTTTATAGGTAGTAACTTTATAAAATATATGCTTGATAAGTA
TCCTGATTATGAAATAGTTAATTTAGATGCTTTGACTTACTGCGGAAACCTTGAAAATCTTGAAGATATT
GAAGATAATCCGAATTATTCCTTTGTTAAGGGAAATATCATGGATGAAGGTCTTGTTGATGTTGTTGTAA
GCAGCGTAGACTACATAGTCAATTTTGCAGCTGAAAGCCATGTGGACCGCAGCATAGAAGACCCGCAGAT
ATTCATCAAATCCAACATAATCGGAACACAGGTATTGCTTGATGCAGCCTATAAATACCAAATCAAAAAA
TTCCTACAAGTATCCACCGACGAAGTATATGGAAGCCTAGGCCCAGAGGGATACTTCACCGAAACAACTC
CTCTCCAGGCAAACAGCCCATATTCAGCCTCAAAGGCAGGTGCTGACCTTATGGTAAGAGCATATGGAGA
GACATTCGACCTCCCAATCAACATAACAAGATGCTCAAACAACTATGGGCCTTATCAGTTCCCAGAAAAA
CTGATACCACTAATGATCTCCAATGCCTTAGAAGACAAGGAGCTCCCAATATACGGCGACGGAAAAAACA
TAAGAGACTGGCTACACGTCTACGACCACTGCTCAGCTATTGACCTTGTTCTCCACAAAGGAAAGATAGG
AGAAGTATACAACATTGGCGGCCACAACGAAAAGCAAAATATAGAAATAGTAAAACTTATTCTTAAGGAA
CTTGATAAACCAGAAAGCCTAATAAAATTTGTAAAAGACAGATTAGGTCATGACAGACGCTATGCAATAG
ATTCAACCAAAATAACAGAAGAATTAGGCTGGAAACCAAAATACACATTTGAAACAGGAATAGTGGAAAC
AATCCATTGGTATTTGGACAATCAAGACTGGATGGAAAAGGTAAAATCCGGCGAATATCAAGAATATTAT
GAAAAGATGTACTCTAAAAAGTAGATTTTCTAAATAAGGTTCCTTTTAATCCTTCTTTGAATAAAATATT
ATTCCAATTTATTTTAAATTCTTCATAATTCAATTAAAAAAAATAGTGATTATATGAAAGTATCAGTAGT
AACACCTAACTATAATGGTCTTAAATTCTTAAACGCCTATTTTGAAACCTTAGCTTTTCAAAGTAGGTTC
ATAGAAGAGATCATCATAATCGATAATGCATCTACTGATGCCAGCTGTGATCTTATAGAAGAATACATAA
ACAGTCCTAGCTATAAGATTGACATAAAACTTATAAAAAATGATAAAAATCTTGGATTTGCTCCTGCAGT
CAATCAGGGCATTCGCTTGGCTAAATCCGAACTAATCTATTCTGTAAACAATGATGTAGAACTTGAATTT
AATACTATAGAAACATTAATTCAATCTATGGAAAGATCCATTGAAGAGGGGAAAAATCCATTCTCCATTC
AGTCAAAGATGATACAGTACCATAATAGAAGCCTAATTGATGATGCAGGTGATGAATATAATCTACTTGC
ATACACTAAGAAACTAGGCGATGGGAGTCCGATTGACAACTACAATGAAAAAAGGGAGATATTCTCATCC
TGTGCAGGTGCTGCATTGTATAGAAAATCCATTTTGGAGAAAATAGGTCTTTTTGACGATAATTTCTTTG
CTTATGTAGAGGATATAGATCTTTCATTCAGGGCTCAAATAAATGGTTATAGAAACTACCTAGAGCCTAA
ATCAATCATCTATCATTATGGAAGTGCTACAAGCGGAAGCAGGTATAATGAGTTTAAGATAAGGCTTGCT
GCACGAAATAATGTTTGGATGATTTATAAGAATTTCCCAATTCCTCTAAAGATTGTTAATTTCATCTTCA
TATTTCTTGGATTTTTCATAAAATACCTCTTCTTTTTAAGGAAAGGATTCGGTTCAATCTATTTGGGCGG
AGTAAAAGAGGGCTTAAGAGAAAGAAAAGGAATAGAAAAGACCCACTTTGAATGGAAAAACTGGAAAAAT
TACTTTAAGATAGAATGGAAGATGATTAAGAACACATTTGGCTACTTTAAAAAATAGGATTGAAATAATC
GAATAACAGAATTTACTCGTAGGTGAAAAAGAATGAGAAATATAGACTTATCAATTATTGTTGTTAATTA
TAACACCTTTAAATTAACAAGGGACACTATAGATTCTTGTTTAGCTGAACCTACTCATTATACATATGAA
ATATTCCTTGTAGACAACAAATCAACAGATGACAGCCTTGAAAAACTTCAAGAATACTTTAAAAGTGAAA
CAGAACGAGGAATATTAAAAATCATTCCAAACCAATCCAACGATGGTTTTGCAAAGGCAAATAATATTGC
AATAGAGCAAGCAAAAGGGGATTTCATACTTCTTTTAAACTCAGACACCCTTATGAAGCAATCCACTATC
GACAAGTGCATGGATTACATAACAGACAAAGGCCACGATGATATAGATGCATTAGGCTGTAAGGTTTCCC
TTGCCGATGGAAGTCTTGACAAGGCCTGCAAGCGCAGCTTTCCAAATCCTGCAAACTCCTTTTATAAATT
GTTTCATATAAATGTAGATAGTGACAAGAACGATTATAATCTGGATGATCTTGATGATGATGGTATTTAT
GAGATTGATTGCCTTGTAGGGGCATTTATGCTTGTTAGAAGGACTACAATCGATGAAGTAGGCCTTTTGG
ATGATGCTTTCTTCATGTATGGAGAGGATATTGATTGGTGCTATAGAATCAAACAGGCAGGATGGAAGAT
AGTTTACTTCGGCCAGGCAGAGATAATTCACTATAAGGGAGCAAGCAGCGAGGATAAAAATACTAAAAAA
AGAAATCCAAAGATTATTTATGAGTTTTATAGGGCAATGTATGTCTTTTATAAAAAGCACTATACTAAAA
AATATAATTTCCTTGTAAACATTGCAGTCTATATTGGAATTGGAGTTTTGCTAGTTTTTAACTTAGTTAG
AAATGCCTTCAGGTCTTGATACTTGTTTTCACTTGTTTTAATTTAGTTTAGAATGCTTTCAGGCTATAAT
TTTCTTATTCCAAATGATATTTTAATCAATACAGACTTTTTTAAAAATTATCTTATTGTCTTAATTTATT
CTTATCTAATTTTTATTACTTTTTTTATCAAATATTTAAATAATTATTATTTTTTTAAATTTATAATTAT
TCTAAAAACTTTTATTATTTTTTTAGGCAATTAAAATAGGTAATTATATAAATCATATTTTTTAAAATTA
TATATAATATAAAATATTATGTTTACTTGGATAATTATTATGTGAATATAATTTTTATAAAATAATTTTT
ACTTAGAATATAAGATTTAAATTTTCACGTGGAATATAAGATTAAATGAATTTATAAGTTTAATTATTAA
AATTAGTTTTTAAAGTTCTTTAAAAACAACCTAAAAGAGTGGTACCATGATTAAAGAAAATCAGAGAATA
TTAAATGCAATACTAGTCATCATAGACATTATTGTAATTCTTATCTCACTAGGCCTTGCATACTTTGTAA
GATTCAAGACCACCATATTCTCAGTAGGAGGCTCCCTTCCATTCAGTGACTATTTCATATTCACAATCGT
TTGCATAATTCCTACTTATATTCTATTATACTACTTCTTTGGTCTTTATAAGCCATTCCGTAACCAATCA
TCAATATTCTCTGGTGCTGAGGACATTGTAAAGTCTGACATAATGGCATTCATCATCCTGGTTGCTATTT
TGTTCATCATCAATCAGCCTAACTTTTCAAGGATCATGCTCCTTCTTTTAAGCCTATTTGGAATGATTCT
CACAATCGCTGAAAGGGTATTGGTCGTTCTTGTATTGAGAATGATGAGAACAAACAACCTTAACCTGAAG
CATATGCTTATCATCGGAGACAATGACTTGGCATTCGAGTTTGCACATAAGATCAACTCTAAAACCTATT
TGGGATACAATATTGCCGGATTTTTAGGAAGAAAGGAAAATATAGGCAAACGATTTGAAGGAACCAAGTT
TATAGGCAGCTTTGATGACTTGCCTCGTGTTCTAAAGACCCATAAGTTTGACAGGGTGGTCATAGCCATT
CCCCTTAAGTATTATTACCATCTAAACGAAATCGTGGATGCATGTGAGGAAGAGGGAATCAAGGCAGAAA
TCATTCCAGACTATTATAAGTATCTTCCGGCTAAGCCTTCAGTTGACATGCTTGATGACATGCCTATCAT
CAATATCCGCTATGTTCCATTGGATGATGCCTTCAATAAGTTCAAGAAGATAGTCTCAGATTACTTTGTA
TCCATTGTAGCTATTATAATCACATCTCCAATCATGATTTTAACTGCAATTGCAATTAAGATTGAGTCTC
CAGGACCTATCATCTTCAAGCAGGAAAGGATAGGCTATAACGGTAAGCCCTTCATGATGTATAAGTTCAG
AAGCATGAAGGTTCAGGATGATGAGGAGGAGAAATCCCAATGGACAACTAAGGACGATCCAAGAAAGACA
AGAATAGGCACTTTCATTAGAAAATGGAGCATAGATGAGCTTCCTCAGTTTTTCAATGTCCTAAAGAGGG
ATATGAGCGTAGTCGGTCCCCGCCCTGAGAGGCCTTATTTTGTGGAGGAGTTTAAGAAAACCATTCCTAA
ATACATGGTTAAGCATCAGGTAAGGCCTGGACTAACTGGACTTGCTCAGGTAAATGGTTATAGGGGAAAC
ACTTCAATTAAAAAGCGTATTGAATATGACATTCGCTATGTAGAAAATTGGAGTTTGGCGCTGGATGTAA
AAATCATGTTTTGGACAGTATTTAGGCGTAATAAGAATGCTTATTAATTAATTTTATTTAAATATTTCAT
TTTTTATCTACTTTTTTTATTCAACTTATTTTTATCATTATTTTAAATTATTGTTATTATTAAACACTTA
TTTTTATTGTATGACTGTTCTCCACTCGCTAATAGTTTTTTAATTTCACATCAATTTCACATTCTCACAT
CAAAATTGCTTTTGTTCGTAAGAAATGATACAAATTTTTCAAATTTTATCCCAATGTCAACTATTTTTCA
AGGCCAAAAAGATACTCATCCTAAGCTCTTTATTTTTAAAAAATACCCTCCCTCTTATAAACTCTATAAA
ATTTTACACTTTGACATCAATTTCACATTCTCATATCAATTTTACTCCTTGACATCAATTTTACACTTTG
ACATCAATATTGATTTAAAATGGCTAAATTGACTTGAAATTGTTAAAGTTGTATGGAACTGTCTTTTTTT
TAACTAAAAAAGCATAAGTTTATATATTTGGTCGTATAATGAATTAGTACAGATTGTTTTTGCGAAAGGG
TAAATTATTCCAAAAAGATTTTTTTTAAAATCATTCGTTGCATATACTGTAGTTTCATTGAATCTTGATT
TTTTAAAAAATAGCCTTAAGAAAATCGAATTTCCTATTAGATTTGGTTTAGCTAAAATTCACCCTATTCT
GCTCGATAATTAAAATTTTCTATTAAATTTGATTTCTTAAAGGCTATCCATAAGAATTTTCCTCAAAAAA
TTTGGAATGATTTTATTGATCTAGAAAGATTTTACCTTTTTAAAGCTATAATCTTAGATAAATAAGTATA
ATTGAATTCTAATGGACATTTTTACATCATCTGAATAATCTATCTAAATAATCTATAGTCTAAATATTTT
TTACATCTCATCGGTCTCTATAAAAATATTATCAATTTAATTATGATTTTGAAAATACATTTGTATTAAT
TTCTCTGGTCATTTTTTCGCTTTTGAAATCATAAATTAAATTACATATAATAACAATATTATATAATAGA
TAATTTTTAATTAATCCGATAAGTTTATAAAAAACAAAAATATAATTCTATTAGAATTTATCAAAGAATT
TAATTGATTAAAAATAGCAATTAATTTGATTAAAAATTATATGATTTATGAATATCTATGGTTATATGTT
TAAAAAAACAGTCTGTGAGGGCAAAAACTAGTATCTATCCATTTTAAGTGATTTTTTTTATCTTCGTGGT
TTTAGATGTCTTTTGGGAAAATTGCATATTTTTTTACACTTGAAATATAGGTATTAGTTTTCAAATGCTC
TCTCTTAAACATTATATATAGATAAAATTAAATTATAATTTACAAGAGAAAAATTGTATCAAAATAATTA
TTTGAGAATGACTTTGATTATTTTCAAAATATTTTAAAAATTGCATGAAAGTGTAAATCCCTTGAATGTG
ATTTTTTAATAATAATTATTAAAAATCTTTGACTAAATTTATAATTTAATAAAACGAGGGTTTGGTATGG
AAAAAGAATTTTTCGAAGGAATGAATTTGGAAGAAGACATTAGCGATGAGGACTTCCAGACTATTGTAGA
AGGCTGGGAAAAAGTCCAAGATCAAATGTCCAAAGAAGAATTTATAACTAAATTTAATGAACACAAGGCA
GAATTTAAAGACGCTTCTTTCTTCAGCGACATAGACTTTTTAAACATGATTGTTAATCCATTAGTGGGTG
GTGGCGATGATGAGCCAGGACCTGCTATTGTAGAAGGCGAATTCCAGAAGATATCTGATGTTGAACCAGG
CAATGAAGGATTCAATGTTGTTGCACGTATAATGAGCATTGGAAACAGCAGAATATTCACTTCCAGAAAA
GGAAAGCAAGGAAAGCTTTGCAACTTGCAGATTGCCGATGACACCGGAGAGCTAAGACTTGTTCTTTGGA
CTGAAAACATCAAGCATCTCAAGCATGTCACTGAAGGAGATATTGTAGAGATTACAAATATCGAATGTAA
AGAAGGCTTCAGAGGAGGTAAGGAATTCTCCCTACGTCCAAGATCATCTTTAAGACCTATTGAAGAGGGC
AGTGAAAACTATCCGGAAAACATTGCTGCTTTCCCTGTCTATGAGGAAAAGATTACTCAGATTGCAGACA
TTAAGCCTGATGAAACCGTAAGCATCATAGGAAGGCTAATCAGAGTTCCTAAGCCACATGCCTATGAAAG
CAACGGCAAGAAAGGTAAGGTAACCTCCCTTGAAATTCAGGATGCAAGCGGAAAGACCTCATACACATTA
TGGAACAATGACGTTAAGCTAATCGACATCTTGGAATTGAAGGAAGGGGACATTGTCAAAATCCTTAATG
AACAATCCAGAGAAAGAAACGGAGAAATTTCCTTAAGCCATTGGGATGGAAGAATCGTCAAGGCTGAAGG
CGACTATGACATTCCAGAATATGAGGAAAACATCATTAAGATTGCAGATGCCCAAGAGATGCAGGATGTA
AGCATTATCGGTCTTGTTACAAAGGTTCAGGACGTAATTCAATTCACAAGAAACGACGGCTCTGAAGGCT
TTGTAAAATCAATCGAGCTTTCAGACGACGAAGGAAGCATCAGAGTAACCCTATGGGGAGACGACACTAA
GATACCTATCTCCAAGGGAGACATTGTCAAGGTCATTGGAGGAAATATAGAATATGATGATTTCTCAAAC
GGCTACAGGGTAAACACCAATTGGAACACTGAGTTAAAAATCAACCCTGAAGAGCATAGCGATTTGATAG
AAACCTTAAAAGGTCAAGCAGAAAACTTAGGACCTATTCCAATCAGCGAGGTTCAATCTATTGAGGAAGA
CGGTGAGGAAGTTGACATTATCGGTAGAATCATCACCTTAAATGACACCCACACCTTCCCAAGGGATGAC
GGCACTGAAGGTGTTGTCCGCTCTGGTGAAATGGCTGATGGATCATCTCCTGACGGACTTGTAAGGGTAT
CCTTCTGGGATGACAAGGCTAAGGTTCCTGAAATAGGAAAGGCCTACAAGGTTGAAAACGCCAGAACCCG
TATGGGAATGTATGCAGTGGAAGTCAATGTAGGAAAGACCACAAGATTCATTGAAATCCCAGAAAGCGAA
GCAGGTGACCTTCCTTCATTTGAAGAGTTAGAAGAGTCCATCTACATCAGCAAAAAAATTGAAGAATTGG
ATGAGGATGACATGAACATTAAAGTCTTGGCTAGAATCCTGGAAGTTCATGAACCTCGGGAATTCCCAAG
GGATGACGGCACTAAAGGATTGGTTGGAAATATGGAGGTTGCAGACATAACCGGCTCCATTAGAGTAACC
TTATGGGATGATAAGAATAACCTTCCATACGGCGTTGGGGACGCTATCAAAATCCAAAATCCACGTGTAA
GATATAATTCAAATATGGACTATTTAGAATTAAGCGTTGGAAACGGAACAAATATCTTAACTCCATCTGA
CAGTGAGATAAATGATATTCCAGACATTTTAGAGTTACAAAATACATTGTATCAAACCAAGGAGATTGCT
AACCTTTCAGATGACGACACTAAAATCAGAGTTACAGGCAGATTTGTAGACATCTATGGTCAAAAGATGA
TCATTCCTAAATGTCCTCAATGTAACAATACATTAGAGCCTGAAGATATCGATGCTGAGGAATGCAGCTT
CTGCGGCAATTATATTGACGAGCCTAAGTACCTTTTAATGCTTCCAGGTAAATTAGAGGATGACACAGGC
GACATTCAAGTTACATTCTTCAATGAATTGGTTGGAGAATTGCTTGGCATGAAACAGGATGAAATCTTTG
AACTCTATGAGGGAGAAGGTGGAGACCTTGGTCCATTGGAAGGAAAGATTGATGATTTGGAAGGCATTAC
CTTAGAAATCCTTGCAGATGTTACATTCAATGAATATGATGAGGAAAATAGGTTAAGACCAAGAAAGATC
TTTAATATGGAATGGTAATTTGGTTGAATCATTTTAAAAATATTTAATTGGAATGGTAATTTGACTGAAT
CGTCATAAAAAATATTTAATAAGAAATTAGCAGTTTTTACTGCTAAATTATTATTTTTTTCTATAGATTT
TATTTATTAATATTTTCACGATTAAAACATAATAACAAACTGACAGATGAATAAATTAAATAAAAAGGAT
TGATTATAATGGTAGAACTTGAAGACTTACCTAATGTTGGAGAAAAAACTGCAGAAAAGTTAAGAGAGGC
TGGATTTGCTGATATGATGAGATTAGCTACTGCTACTGCTAAAGAATTATCTGTAAAAGCGGAAATCGGT
GAAGGTGTAGCTGAAAAAGTTATTGAAGCAGCTCGTAAGGCAGAAAAGATCGATTTTGAAACTGCATTTG
ATGTAATGGAAAGAAGGAGAGATGTTGGCCGTATCACTACAGGGAGCAAAAACGTAGACGAATTGATCGG
CGGTGGAATCGAAACCCAATCTATCACTGAAGTATTCGGTGAGTTCGGTTCAGGTAAAAGTCAAATCTCC
CACGAATTAGCTGTTACAGTTCAATTGCCTAAGGAAAGAGGCGGACTTGAAGGGGAATGTGTATTCATCG
ATACAGAAAACACATTCAGACCAGAAAGGATTGAACAAATCGCAGATGCTTGTGGAATCGACCGTGAAGA
GGCTTTACAAAGAATCCACATCGCAAGAGCTTTCAACTCCTCTCACCAAATATTGATGGCTGAAAAGATT
AATGAGCTTATCCAAAGTGGAGTAAATGTAAGGCTTGTAATCGTTGACTCACTTATGGCTCACTTCAGAG
CAGAATATGTAGGAAGGGAATCATTAGCAACCAGACAGCAAAAGCTTAACCAACATTTACATGCATTGCA
ACAAATCGCTAACACCTATAATGTTGCTGTATTCCTTACTAACCAAGTACAAGCAAGACCAGATGCTTTC
TTCGGCAGCCCTACAAAAGCTATTGGTGGACACGTTTTAGGACACGCTTCAACTTACAGAATCTGGCTTA
AAAAAGGTTTAGCTGGTAAAAGAATTGCTAGGCTCGTAGACAGCCCTCACTTACCTGAAGGAGAAGCAGT
ATTTAAGGTTACTACAGACGGAATTGTTGACTAAATTCAAGCTTTTTGAGCCTTCGGCTCAAAAACCTTG
ACCAAAAATTTTATCACTTGTTGGGAGTACCTTGCTCTTTAACTTGTGTTTTTTCTTTTTTTACTTAATT
TTTATTCTTTAACTTAATTATAACTCTATTTTTTTCTTAATTTTTATTCTTTAACTTAATTTAAACCCTT
TTTTCTTATTTTTCATTTTAAACTTTTTCTTTAACTTTTATTTTCCTTAATTTTCATTTCTACTATTTTT
ATTCCATAGAATTCTTAAATTTTCTAATTCTCAAAATCATTACAAAAGTATTTTAATTATTTAAAATAAA
TTAAATAATACTTATTTTTATATGTTGATTGCTATGGACTTTAGAATAATTATACTCTCAATAATCATAA
TGATTCTGCTTGGAGTGCTTCTTAAAAAAATAGACCTTCTAAAAGAAGAAGATGTCGAAACACTCAATAA
TTTAGTAATCAATATATGTCTACCTTGTCTAATTTTCAATGCTTTATACACTGCTGATGTTTCCTTGCTT
CCATCTTTGAGTATTTTAACACTTTCCACTACTATCACTAGTTTAATCGTAGGAGTATTCACTTATATTC
TACTTAAATTATTTGCTTGGGATAATGTTAAAATATGGAGCATACTTGTAACAGTGGTCTTGGGAAATAC
AGGGTTTTTAGGCTATCCGATTACACAGGGGATCTATGGCAGCGAAGGCCTTATACGTGCAGTCTTCTGT
GACTGCTCCACCTCAATCACATTTGTAATATTGAGCGTTATCCTGATATTGATTTTTGATGGTGAATTGA
AGGTGGCTTTAAGAAAGATAGCTACTTTTGTTCCATTATGGTCTATCGTTTTAGGAATTCTCTTTAATAT
ATTCGCCATTCCGATAACAGATGTCGGAACTACTGTAGTTGGTTATTTGGGTGATGCCACTATCCCTCTT
ATTATGATCTCTTTAGGCTTGTCCTTGAATATAAGCGGGCTTAAGAACAATCTTAAGGAAGTGAGTCTTG
CCTCATTCATTAAGCTTATATTATATCCCTTTGTGGCTTTAGGGGTTATGGCCTTGCTTGGAATCACTGG
ATTCAATCATACAATCGGACTTATTGAAGCGGCTATGTCATCAGCTATGATTGGGCTTGTTTTAGCCATA
ACTTATAAGTTGGATCCTCATTTGACTTCAGATTGTATTTTTACTTCGACTTTGTTTGGCTTAGTGACTA
TTCCTTTGTTTTTAATGTTTATAGTTTAAATTAATAAAACAATATATAATATTTTTTTAATTTAGTTGTT
TTATCTTCATATTTTGCTTTTCATTTTTTTTTAGAAGATATTCATTTTTTATCTTCATATTTTCTTTATC
ATTTTTTTAGAAGATATTCATTTTTTATCTTCATATTTTCTTTATCATTTTTTTTTAGAAGGTATTCATT
TTAATCTTATTATTTTTTCAAAAATTATTATTAATTAGCTGTCACCTTTTAGGTTACACTAAATCATAGA
ATTTGTTCGTTTTTATAGATATATTAATAATTAAGAAATTCGTTCAGAATTTTTTATTCAATTAAAGGGC
TCTCGAGGCTTATTTAAAATTCATTTTTTCAAAATTAAAAAATTTAGGTATATAAAAATCTATTTCTAAT
TTCTATTTAAAGAAGATTTATTAATTGTTTTTTATATTAAACCTACAATTATGTTTATTTTTACAAAAGT
TTGTTTTATTTCTATTATTTCAATAATAACTCTTCTTAAAATGGTCTAAAATCTTCTAGTATATATACTT
TACTCCTACTTTTTTATAGAAAGGTTTATATACTCTCATTTCTAACATAAAATTATCTAATATTTTATAT
ATATAAAAATATTTTATAAAAATTAGATCAAATGATTAATCATTTTAACTTGTACAAGGTGATTTAATGG
CAGAAGAAATAAACAACGAAGAAATTAGAGTGGGAGTATATGTTTGCCACTGTGGTGTAAACGTTGGTGG
AGTCGTAAACTGTCCTGAAGTAGCAGCTTACGCAGAAACTTTACCTAACGTAGTTATTGCAAAAGATTAC
AAATACATGTGTTCAGACCCTGGTCAAAGTCTTATCCAAGAAGACATCAAAGAACACAACTTAAACAGAA
TTGTAGTAGCAGCATGTTCTCCTAGACTTCACGAACCTACCTTCAGAAGATGTGTAGAAGAAGCAGGATT
AAACAAATTCTTATTTGAATTCGCTAACTTAAGAGAACAAGACTCTTGGGTACACATGACCCAACCTGAA
GAAGCAACTGCAAAAGCTAAAGACTTAACTCGTATGGCTGTTGCAAAAGCAAGATTATTAGAACCTCTTG
AAGCTTCTAAAGTAGCAGTAGACAAAAAATGTCTCGTTATTGGTGGTGGAGTAGCAGGTATTCAATCTGC
ATTAGACTTAGCTGATATGGGATTCAAAACCTACATGGTAGAAAGAAACCCAACTATCGGTGGAAGAATG
GGTCAATTAGACAAAACCTTCCCTACCTTAGACTGTTCCATGTGTATTCTCGCACCTAAGATGGTAGACA
CATCCAAACACGAAAACATTGAATTAATTACTTATGCTGAAGTTAAAGAAGTAGACGGATACATCGGAAA
CTTCACTGTAACCGTAGAAAAGAAACCTAGATACGTCAAAGAGGATGACTGTACCGGATGTGGACAATGT
CAAGAAGTATGTCCTATCGAAATACCAAACTACTACGACGAAGGTGTAGGTATGGTAAAAGCTGCATACA
TCCCATTCCCACAAGCAGTACCTCTCTGTGCAACCATTGACAAAAACTACTGTATTGACTGTGGTCTTTG
TGAAACCGTATGTGGTCCAGATGCAATTGACCGTGACATGGAACCAGAAGAAATCGAACTCCACGTCGGT
ACCATCATTGCAGCAACCGGTTACGACCCATATGACCCAACCGAAAAATACGAATACGGTTACGGCAGAT
ACACTAACGTAATTACCGCTATGGAAATCGAAAGGATGATCAACGCATCCGGTCCTACCGGTGGTCACGT
ACAAAAACCATCTGACGGTAAAGAACCTAAACGTGTAGCATTCATCCACTGTGTCGGTTCAAGAGACGAA
CAAATCGGTAAATCCTACTGTTCCAGAGTATGTTGTATGTACTCCATGAAAAACGCTCAATTATGTATTG
ACCACGAACCTGACACTGAAGTAACCTGTTACTACATGGATATCCGTTCATTCGGTAAAGGATTCGAAGA
GTTCTACAAAACTTCCCAAGAAAAATACGGTATTGAATTCATCAGAGGACGTCCTGCAGAAATCCTCGAA
AACGATGACTTAACCTTAACCGTAAGAGCAGAAGACACATTACTCGGAAAAGTAACTGAATACACCTACG
ACTTAGTTGTATTATCTGTTGGATTAGAACCTCCAAAAGGATCCAACGAACTCAGACAAACCTTAGGTTT
ATCCAGAACTACCGACGGATTCTACATGGAAGCTCACCCAAAACTCAGACCTGTTGACACCTTAACTGAC
GGTGTTTACATTGCTGGTGTAGCACAAGGTCCTAAGGATATTCCTGACGCAGTAGCACAAGGTTCAGCTG
CAGCATCAAGAGCATCTATCCCAATGGCTAAAGGTGAAGTAGAAATCGAACCTATTACTGCTGACACTGA
TACCACCGTTTGTGGTGCATGTGAAGTATGTGTAGAATTATGTCCATTCGGTGCTGTAAGTATTGAAGGT
GAAGGCGCTGACAAACACGCAGCTATTAACGTTGCTTTATGTAAAGGATGCGGTACCTGTGTAGGTGCAT
GTCCATCCGGTGCTATGAACCAAAACCACTTCAAGACCGAACAAATTATGGCACAAATTGCAGCTGCTCT
TGAAGACGTTGCAAAATAGATTAAGAGATTATTTCTCTTATTCTTTAAACTTAAAAGGGAATTTTTATTC
CCACTCTTTTTTCTTTTTTTTTAGAAATTTTATTTTGATTCGTACATTTACTAACTATTTCTGAATCTTT
TATATTTTCTCTCTAAGATCTTTTCTTCTATTTTTTTTATTTTTTATCTTTCCTTTTTTAGGATTCTTTT
TTTCTTTTTTTTAATCTTTTATCTTTCCTTTTTTAGGATTCTTTTTTTCTTTTTTTTAATCTTTTTATTC
TTTAACTTTTTTTTTAAGGATTTTTTTATTCTATTTTTTAATCATTTATCTTTTCCCTCCAGGATCTATT
TTTCAATTTTTTATTGTTCAAAAATCATCATCAATTTTTATTTCAATTGTACTTAATTTTAAGGACAAAA
TTCATATTTGAAAAAAGCAAACCTTTATAAATAAGCAAATCCATATACTGTATGGAGTTGTTAAACGAAC
TACATTTGTAAAAGAATTAATCATATATATTTAAATATTAAAAAGAATAATATAAATTCTTAAAATAAGT
TTTAGATTAATAATAATTATTTTTTTAATAATGATTATTATCTTTTTATAAAAAATTTATATTTTATTTT
TAATATTTTTATTTAAATTTTTAATACTTTTATTAAAAAATATTGCGTCATAATTTATTATGGCAACGTC
CTAATTTTTATGGATAAATTTATATATGATGAAGTTCAATATAATTATGTGGTAAGTTACACTGCTATGG
ATTATGGTGGCAAGTACTAGTTAAGTACAAATTTATCTACCAAATTTTAGGCAGTAGTTAAACTACCAAA
AAAAGTAAAGAAGGGTGATATGTTATGAAAAAATTTGAAAGTGTCGATTTTGACAAAACCGAAAAAATAG
TTGATGGAATTGCTATCGAAGATAATGAAGCTATGGATATAGTGGTTATACTTGAACCCGGCTCAGGGCA
GTATGCATTCTTGGCTTCAAGAAAGGCACCATCAAAGGGTTTCAACGCTTTTATTGAAACCGAAGCTGCA
AAAGACCATAAAACATTTGTCACTGCAGTGCTTTTTGACAATGAATATGAAATTCTCCACTCTAGAAGGG
ACATTAATGAGGTTCCTATTCTCACCACTAATGAATACTCATGCAGAGGATGCACAGCATTGTACGATGC
AATCGGAATAACTATTGAAAGTATTAAAGATGAAATCGACAATAAAGTCTTGTTTTTAATCATTACCGAT
GGAATGGAAAACGCTTCAAGAAGATTCAATGAAGATCAAATAAGATCTTATATTGATGAGCTTGATTACG
AGTTTATCTTTGTTGGTGCAGACATAGACAGTTACCGTGAAGCATCTAAAATAGGAATCAGGCAATCCCA
CACCGCAAGCTTCAAGAAAACTGGTGAAGGAATAGATGACTTATTTAAAACAATTTCTGATGTGTCTGAC
ATTCATCGCGACAATATGAAATTAGAGGATGTCGATTGGAAGCACAGACTTGAAGATTAGTTATAATCTT
CCCACCACACCACTTTAATTTATTATTGATCTCACTAATTACTGATTTTAGATCGATATCATTAAAGCCA
TTTTATTTAATTTTTTTTTTATTATTAAAGAGGGTCCGCCAAAAAGCTATTTTTTTAAAAAAGTTTAAAA
TTTTCAATTTTTTAAGTTATTTATTTTAGTTATTTTTTTAAAATTCGATGTTTTTTCTATTGTTTTCTTT
TAATTTTGGTGCTTGCACCTTGAAAAAATTTTTTACTTGTTAATTATTCTTTAAATATGAAATAAAGCAA
TAATATTATAGTAAACTTTATATACTACTTTAAACATAAATAATATCAACAAAGGGTTAATATTTTGGTG
TTATTTATGGTTAAAAGAATTCCTGATGAAGAACAAATAAAATTAGGCATTAGAACTTTAGATTTTAACA
TTCCAGAGGATCATATTTCTCGTTTTGTTGTGGATTTCATTGACGAATATTATCCTCTTTTAGGAATCAA
AGAAAATAAAAAGAAGAAAGGGCGTGACAGTTTTCCTGTGAAAGAGATGTTAAAATTGCTTATTTATGCT
AAAATCGAGCATATTGATAGTATGAGATTCTTAGCAGACATGGTAAAATATCATGACGTATATAAATTCG
TTGGAAATGGAATTTGTCCTTCAGAACGATCATTACAACGATACAGAGAAAAATACGGCAAATATTACAA
TGAATTGTTAAAAGCAACCTTAAAAAAAGCTTCAGATGTGGATTACACTGATTTCAACGAAGTTTCCATT
GACGGAACCATCAAAAAAGCATACAATTCAAAAAATAAAGTGATCACAGAAAAAGAAACTGAAATATTAA
CCCGTTACTTCGAAGGAGGCCGTGTAAGTCAGGAAGAGCTAGATAAACTCCATAAACCGGCCCGAGAGAT
TCTTGAAAATAAAAAAATCAGCAACCAAGAAAAATTATACCTCTTGGATGACATTAAAACACAATTCACA
CTGTCTGGTCAAAAATCAGTGCCAGTAACCGACATAGAAGCACGTTGGATGAAAAGCAAGAAAGGAAACT
CACAAATAAGCTATAATATCCAATCTGCAGTCGATTACGATACAAAAATGATTTGTGCAATAAACGTCGT
ACAAGCCCCTACAGACCATTACCAATTGCCAAAAATCGTAGATAAGGCAATAAACAACACAAACGTAATA
CCAAGATTCGTATTGGCAGATACAATCTATCTGAATGAAGAAAGCTTATCATATCTTGCAGATAATCAAA
TAAATGGAGTTATACCAGATAGAAAGCAATCCAAGGAAAAAATCGGAAGATTGAACAAGAACCCATATCA
CAAGGATCACTTCAAATACTTCCCTGAAATTGATGCATTTGAATGTCCAGAAGGCCAAATAATGTATTTT
TTCAACAAATACACTGAAAAAAATGATGATTTGGACAAGCCAGACAAAATTAAGCGTTTATATTCCAATT
ATGGTGCTTGTAAGGCTTGCAATTGCCGTGAAAACTGCCTTTCATCCACCCAAACCCACAGAACAATCAC
CGAATATGGCGGAAGTTTAAAGAAAGCAATGTGGGAAAAAATGGAAACAGAGGAATATAAGGAAGAATAT
GCAAAAAGGTCATCTGTCGAAGGACCTTTTGGCATTTTAAAGGAACAATTCCATATAGAAAGCGAAGTAG
TGATAGGAAAAACAAAGACAGAAGAAAGAATACTATTAGATGCCGTGGCTTATAATTTAATACGATTATT
TAACTTAGAACAAGAAATAAAAAATGATAAAGAAGATATAGTTGATTTCTGTGAGAAAATTTCTGTCCAA
GAGAAATTAGAGGTCAGAGCAACCATATTTTAACTGGTGTTGTCAAAATTTTATTTTGGCGGACACCCTA
AATGAATATATTATTAAAATTTATGTAAAGGAGGCTGAATAATGAGTTTTGAAGACTTGATTGAAGACTA
TGTCAAAGCTAAGATAGATTTGAATGTCAAGTTCGGATCTGTATTGGATGAATTGAATATTGAATACGAA
AGCTTTTGCTTCTATGATGAATTCAAATCCGTCTGTCTTGATTTGGAAATGCATAATAAGGAATTGTCTG
ATGAAGAGATTGAAAATATCATTGAAAAGACAGGATTTGACTTCCTAAAGGTGGAAATCAAAGGCAAAAA
GTTTCCTTTTGGAAATGGTGAAGAAATCGATTACACCTATGTATTCGAGTGTTAATTATTGAAATTAATA
AACTTTAAACTAAAAAAACTATAAAAAAATGGGGTGATATATAATGAAAATTAGTTTAAATAATGTATCT
TTAGATATTGACTTAAAGAACAGTCAAAAATTTAAAAATATGGAGGTAATTCCTATTGAGGCTTTAAGCG
CTGGTAAAAAGGAATTTATCACACTTAAGGCGGGCATTCAAGAAGGGTATGTGAAGATTTCCGAATGTGA
AAGCAGCACAGTAAATACTGTCATGGCTCAAAACAAGTCTTCCACTCCACTTGTTTTAATAGATGGCGAG
GAAGTAATTGGCGCTATGCAAAATAGAATAATGAACAGGTCTTTAATTGTTCCTGGAAATACCACTATGC
CTATTTCAGTAAGCTGTACAGAACATGGAAGATGGCATACTCGTGGAAACAGTCCTAAAGCAAGGGAATT
TTCTCATTCTGACTTCTTTGCAGACTATGAAACACGTCATCGTAAGTCTGAAACCTTATATAATAATTCT
GACTGCCAGTCTGAAGTATGGGCTTCAATCAGCGACCTTGAAATTAAGAATTCCTACAGATCTCCAACAA
GTGCATTGAATGATAGCTATGTCCATCACAGGCCAAGACTTAATGAATATTTAAAACATTTCAGCATGCT
TTACAATCAAATTGGAGCTATATTCATAATCAATGGCCAAATCAAAGGATTGGAATTGTTCTATAATCCT
TTCCTCTGTTCCCAGTACTATGACAAGATTCTTAAAAGCTATATCATGAATGCTATTACTAATTACTACA
GTAATTGTAGTTCAAATAGTTCAAATATTGATGTAGGGGCATTTTTGGCAGATTTAAGCGACTCCAAATT
AAACCACTCTCCTAATCAAGGTCTTGGTCAACACATTAAGTTTTCAAACAATCATGGGACCGGCTCTGCA
TTGATTAATGATGGGGAATTCGTTCACTTGAATTACTTTAAAACCAAATATGATGTTTCTTACAAGAAGC
AGAGAAAAAATGTCAGAACTTTTGGTTCCTTCGATGACTTATTGAGTAAAATGGATGAATAAATGAGTAT
TAATAGGATAAGAAATTTATTTATCCATTAAAAGGGGATTATCTAAATAATTCTCTTTTATTTTCATATT
TATCTCTCAATATATTAGAAAAGCTTTTCTTAATTTGTTTAGCTTCCACATTTCTAACTCTATATCATCT
CCTTAGAAAAGCTTTTCTTTTATTTTTATCATTTTTGCACCTCTGAATTAGAAAAGCTTTTCTAAATCTT
TCTCTCAAATGCCATAATAAAATCACTTCAAATTTTAGTTTTCGTTCCTTTAGAAAAGCTTTTCTTTTAT
TTTATTTTCTTATATGCTTATTTTATTTTATTTTCATTGTTTAGAAATATAACTCTTAAATCTTAACTCT
TTTTTATTTAACTTTTTAAATGTTTCATAGGGCTCATTTTCATAAATTTAATTTTCTTAAAAGATTTTGT
TTTTTATCCGATTTCTATTTATCAATTTTATTACTAAATACAAAAAAATTAATAAAAAACTGCCTTATTT
TGACATTTAATAAAAACTTTTATTTAACTTAAAAATTATATTCTATATTAATAAGAATTTTATAAAGAAT
TAAACATATCTTTATAATTTTTTTTAATAATTTTTTAATTTGATTTAATCAAAATTACATTAATTAATCA
TTATTTAAGAATAGATAGGTGTTATTTTTATGTATCAATACGAAAATGAAGTTACTAAACTCAATGAATT
AATGGAAACTCATAATAACTGGATGAGAGATAGCGTAAACCTTATTGCAAGTGAAAACACTACAAGTAAT
GCAGTTACAGGAGCTGTTGCTTCAGACTTAGCTCACAGATATGCTGAAGGACAAGCATTCGAACGTTTAT
ATCAAGGATGCACATATATCGATGAAATTGAAGACATTGTAAAAAGGCTCTCAAGAGAAGTCTATGACTG
TAGTTATGCTAATGTACAGCCTGTATCTGGTGTAACTGCTAACCTTGCTGCTTTCTTTGGATTTGCAAAG
GCTGGAGACAAGATGATGGCTATGAACATTCCATTTGGAGGTCACATCTCCCATGCAAACGTAAGTGCAG
CAGGTATCAGAGGATTAAAAACCCTTGAACATCCTTTCAACCCAGAGGTTATGAACATTGATATTGATGC
AATGAACAAGATGATATTGGAAGAAAAGCCAAAGATCATTCTCTTCGGTGGAAGCTTATTCCTTTTCCCA
CACCCTGTAAAAGAGGCTGTAGATGCAGCAAACGAAGTTGGGGCAACTATCATGTATGACGGTGCTCACG
TTCTCGGTTTGATTGCAGGTAAACAGTTCCAAGATCCTTTAAAGGAAGGAGCTGAAGTTATGATGGGTAG
TACCCACAAGACCTTCCCAGGTCCTCAAGGGGGAATCATCCTATCAGACGAATCAAACAAGGAACTAATC
GACAATGCTGTTTTCCCAGGTGTAGTGAGCAATCACCACTTGCACCACTTAGCAGGTTTAGGAATCGCTA
CAGCTGAAATGCTCGAGTTCGGTGAAGATTATGCTAAACAAACAATCAAAAACGCTAAAGCATTGGCTGG
AGCTCTTGCAGAACAAGGTTTCAATGTATTCTGTGAAGATCTTGGCTACACAGAATCTCACCAAGTCGCT
ATGAATGTAAGCGATGTCAAAAGAGCAACAATATTGGCTAAAGAGCTAGAGCAAAACAACATTATATTAA
ACAAAAACCTCATTCCAGGTGACAATGTAAATGACAGTGATGACCCTTCAGGTATAAGAATAGGTACCCA
AGAAATCACAAGACGTGGAATGAAGGAAAAAGAAATGGAAGAAGTTGCTGAGTTTATCTGGAAAGTTGCA
GAAGGCGACAAAGTAGATATCAAGGATGAAGTAACTGAATTCATGAGTCAATACAGAACTATTCATTATG
CTTTTAAAGAAGAAGAAGGTTATAAGTATATTCAATACTAATCTCAAGCTTTTTTGGCCTTCGGCCAAAA
AACTTTGACCAAAATTTTTTATTTTGGCGCATGCTTAAACTAGGAATTGTTTTTTGAGCATTATGAATAT
TTTTTTATTTTTTAAATTATTATTCTTTTTTTATCAATAATTTTTTTATTTTTTTATTATTTTATTATTT
TATTTATTTAATTTCTTATTGTAATTTTTACTAATATTATTTAATTGGAGTTATTTTATGAGAATAGGAT
GGGCTTTTACTGGTGCAGGACATTTGCTTAGGGAAAGTGTAGAAGCTATGGAAGAAGTGGCAAAATACCA
TGATATAACCGTATTTTTATCACAGGCTTCAGAGGAGGTCTTAAGGATGTATGGTTTATATGACCGTGTG
GTTGCTGTAACTGGCGGAAGGTACAGAGAGCTTGCCTGCGATTCCAATCAGAAATTTAGCTTTCCAATAA
CTGGCAGGCTTTCTCTTGGAAAATATGATGCTCTTATAGTTTCTCCTGTCACTGCAAATACAGTTGCAAA
GATAGTTTATGGAATTTCAGACACTCTTGTGACAAATGCAGTGGCTCAGGCTGGAAAAGGGAGAGTCAAA
ACCCTTATGGTTCCGGTCGATATTGAACCCGGGGATGTTGATACAGTTCTTCCTTCTAAGCTAGAGCTTT
CAAAATGTCAAAAATGTGATGTGTGTGATGCAGCTGAAGTCTGTCCAAATGGGGCAATTGTGGCTCATCA
GGAGATTGATCTCTTGAAATGCATTGGCTGTGGTGCATGTAAGGACATTTGTCAATATGGTGCAGTTTCT
GCCGGTAAGATTATAACAATGCATATGAGAGACATTGATATAGAGAATACTCAAAAGCTATCAAAAATGG
AAGGAATTGAAATATTTGCAAGTCCTCAAGAGCTTTTACTCCATTTTGATTATAAATAACATTTTATTTA
TTTCAATTTTTTTCTTTTTTTTAAAAAAAGCTCAGTTCAATTTTTTCTTATTTTTTTTTAAAAAACTCAT
TCTTTTTATTTTCTTTTTTTTTTTAAAAAATTATTTCAATTTTTATTTTATTAAATAACTTATTTTTTTA
TTTTAACTCTACTTCATCACCTATTTTTAAATCATAATCACTAAATCCATTTTTATCAAATTCTATTATA
TATTTGGCTGGTTTTTTAGGTGCATAATATCTCCATGGCTTCAAATCACTTATTTCATATATGATATTGT
TCTTATCAATAAAAACTAATTTTAATTCAAATCTCATAAAGCAGCTATGAATGGATGATCTATGCCTATT
ATTAATATTCTGTGGAATCTTAAACAATAAAGGATAATCTATATCTTTTTTAAACATCAATCCAAGAAAA
CGACTTAAAAAGCTATCTGCTATTCTTAGGTCTGTTATTTTTTCATTGGATTTTTTTAAATGCAATGATT
TTAAATGATTATTCTCTTTATTTTGATTATTTTTTCTATTATTTTTCATAATTATCTTATTTTCTATTAA
ACTTTCATCTAAATAAATATTTTGTTTTTTAAAACCTTTTTTAACACTTTCATATCAATTTAACAATCTT
AAATCAATATTGATGTGAGAGTGTAAATCTCTATTATATTACTATAATCATTTTAATTAATACTAATAAT
AATAACAATTATATATACTTAAATTAAGAAATATAAATCATAATAAGTTATGTTTTATATTTTGTTCCAA
TGCTATGAAAATAAACTTTAGATTAGAAATTAATCTTTTATCAATTGAATTTATTTTTTAATATTGGAAC
TGAATATTGATATTTTAATTATTATCTAAATAAATGACTTTTATAAAAATCAGAATTTAAAGACTAATTT
AAATTTTATACATAATTAGAATTTAAAAAACAATTTAAATTTTAAAAAATCATTTTTATAAAAATTATGA
ATATATGAAAACTAAATGCTTAACTATTAGAATCTGAGGGATTTTATGAGTAGAAATATTTTTGTTGAAA
AATTAAATCAAACTTTTATCGAAGATCTTGATATTGAAATTGTAGAAAGAAAAGGTATTGGTCACCCAGA
CAGTATCAGTGATGGTATTGCTGAATCTGTAAGTGAAGCTCTCTGTAAGATGTACATGGATGAGCTTGGT
GGAGTATTGCACCACAATACTGACGAAGTCCAAATCACCGCAGGTGAATCCAACCCTGTATTCGGTGGAG
GACAAATCATCAAACCAATCGATATTCTCTTAACCGGTAGAGGAGTATCTGAATACGAAGGTCATAAATT
GCCTCTTGATTATGTAGCAATCGACGCAGCAAAAGAATTCTTAGACAAGACTGTAATCAACTTAGACGTA
AACCGTGACACAATCGTTGAATGTAAAATCGGACACGGTTCCGGAGACCTTGTAGACGTATTCAAAAGGG
AAGGAGCACCTTCCTCCAACGACACATCCTTCGGTGTAGGATACGCACCATTCTCCGAAGTTGAAACCAT
CGTCTTTGAAACCGAAACCTTACTTAACTCCAAAGCATTCAAAAAAGACCACCCTGGAGTAGGTGAAGAC
ATAAAAGTAATGGGACTTAGAGAAGGAGACAAGATCACATTAACAATCGGTTGTGCAACGGTATCCAAAT
ACCTTGCAAACAGAGAAGAATACATCGCATGCAGAGACGTATTAAAAGACATTGTAGCTGACCTTGCAGT
AAAATACACAGACAGGGAAATTGAAGTATTCGTCAACACAGCAGACAACGACAATGCAACAGACGAATCA
GGCTACTACCTAACCGTAACCGGAACTTCCGCTGAAATGGGAGACGACGGATCTGTAGGAAGAGGAAACA
GGGCAAACGGTCTTATCACCCCATGCAGACCAATGTCCATGGAAGCAACCTCTGGTAAAAACCCAATCAA
CCACGTAGGTAAAATCTACAACATCCTCTCTAACGAAATCGCAAACGATGTAGCAAAAGATGTCGAAGGA
GTAAAACAAATCAATTTAATGATTCTTTCCCAAATAGGTAAACCTATCGACCAGCCTAAAGCAGCTTCAG
CTGGAATTATCCTTGAAGACGGCTATGAAATGGGTAAGGTAAGCCCACAAGTTGAAAAAATCATTGACAA
TTGGTTAGAAAACATTACCGACATTACTGAAAAGGTAGTTCAAGGTAAAGCAAGAACTTTCTAAATATTT
TTTGTTTACGAGCAGTAGTTTATACTACTGCCATTTATTTAATTTAGTGGTTTTTTAATTTAAAGAATTT
TTTTATTTTACTTATTCACAATTTAGGAAGTTTTTAGCTATTTATTAATTTAAAGAACTTTTTATTTTAC
TTATTCATAATTTAGGAAGTTTTTAGCTATTTATTAATTTAAAGAACTTTTATTTTAGCTATTTTTCCTT
TTAGTTTTTTAAATTTATTTATTTGCTTATTTATCTATCAATTGAATGATATCATTTAAAAAGAAAAATA
CGTTTATTTTCATGCTTTTTAATTACAAAACTCATTATAATTCGCTTATTTAACAAAATAAATAAATAAT
AATTATAATGATTTAATTATATTTCACAAAAATTTACATTTATTAGGAGAATCGATATGCCAATAGAAGA
GGCAGAAAAATCATATGACTTTAAAAAAATAGAATCAAAGGTCCAAAGCTTTTGGGAAGATGAGGACATC
TATCAAAAGACCAATGAATTGAACAAAAACGGTCCTCAATATTCCTTCTTGGACGGACCTCCATACTGTA
GTGGTAAAATCCATTTAGGTACTACTTGGAATAAGGTTATTAAAGACACATTGTTACGTTACAAATCAAT
GAATGGATTTGCACTTAGAAGACAAGCTGGTTGGGACACTCACGGATTGCCAATCGAACATAAGGTAGAG
CAATTGCTTGGAATTGAATCCAAACAGGAAATCGAAGAGAAATATGGCATAGACAAGTTCGTAGGCAAAT
GTAAGGAATTTGCAATGGAAAACAAGGTTGCAATGACTGAACAGTTTAAAAGCCTTGGAGTTTGGATGGA
TTGGGACAATCCTTATATGACCTTGGATCCTAAATATATGGAATCAGCTTGGTGGACATTAAAGAAGACT
CATGAAAAGAACTTGCTTACAAAGGACAAAAGGGTAATCAGCTGGTGTCCTCACTGTCAGACTGCACTTG
CTGCAGCTGAGATTGACTATACTGAAGACACAGACCCTTCCATTTATGTCCGTTTCCCACTTAAGGAAAA
GTTCCTAAATGAAGAAAACTGCAGTGAATTTGCAAATGATTCTGATTTGGCCAACTTAAAACAGTCATTC
CTTGTATGGACAACCACCCCTTGGACACTCCCTGGAAACTTGGCTATCTGTTTGAATGAGGATTTCGAAT
ATTCATTTGTTAAGGTAGATGAAAGATTAAACGAGTCAGATGACGAAATATTAATCATTGCAAATGAACT
TCTTGAAACTGTTTTAGGTCCTATCGAAATCATACATAAGAATAAGATTCCAAATCCTAAATATGATCCA
GAAAATAAGGAGTCCAAAGAGAAAAAATACCTCATTGAAGAGGAAACTGAAGTGATGTATGAAATAATAA
AGACAGTAAAAGGCTCTGAGCTTTTAGGTCTTGGCTACGTCTATCCTTTAGCTGAAGAAGTTCCAAAGCA
AATGGAAATAGAAGCTGAAAACAGTCTTGTTCACACAACCTTCCACGGAGACCATGTTGAATTGGGAGAA
GGTACCGGATTTGTACACACAGCTCCTGGACACGGTCCTGAGGACTTTGAAATCGGTCAAGAAGTAGGAC
TTCCTATCCATTGTCCTGTAGATGAGGCAGGATGCTTTACCGAAGACGGAGGAGCATATGCCAATGGATA
CACCAAAGACCTAAATGACACAATCATTGCAGACTTGATAGCAAAAGGATTGATGTTTAAGAATGATACA
ATAACCCACAGATTTGGGGTCTGTTGGAGATGTAAGACTCCTATCATTTACTTAGCTACTGAACAATGGT
TTATTAAAGTGCCTGAAATCAAGGAAAAGATGCTTTCTGAAATCGACAGAGTCGAATGGGTTCCTAAATG
GGCTGGTGAAGGAAGGTTCCATGATTGGGTAGCTAACGCTAAGGACTGGACCATTTCAAGACAAAGATAC
TGGGGTATTCCAATCCCTATATGGGTATGTCCTGACTGTGGAGAAATAAAGGTTATAGGCTCTGTAGAAG
AGTTGAAAGAGCTTTCAATCAATGAAATCACTGCAAGCGATGAGGAATTGGTTCACAGACCTTATGTTGA
TGACATTTTAATCAACTGCGATTGCGGATGTGATAGCCCAATGAAACGTATTCCAGATGTATTGGATGTA
TGGATTGACTCTGGAGTTGCAGGATGGGCTGCATTATACTATCCTCGTGAAGAGGAAATGTTTGATAAAT
GGTATCCATATGACTTTATCTGCGAAGGACATGATCAAACCCGTGGATGGTTCTATTCACAGTTAGGTAC
AGGTGTAATCGCATTGGATCAAGCCCCTTACAATAAGGTATTGATGCATGGATTCGTATTGGACGAGGAA
GGAAAGAAAATGAGCAAATCCTTAGGAAATGTAGTTCAGCCTGAGGAAGTTATTGAAAAATACGGTGCAG
ATGTACTTAGATTCTACCTTTTATGGGCTTGCAAGCCATGGGATGACCTTAAATTCGTTTGGGATGAATT
GAACAATGTTAAAAAGATGTTCAACATCTTATGGAACGTTTATGTATTCTCAACAACCTATATGGCACTT
GACGAATTCGACCCAGCAAAATGCGTACTTGATGGCCCTGATGCAAATGTCACACTTAGAAATGAGGACA
GATGGATCTTATCCAGAGTAAACTCACTTGCTAAGGAGGCAGGAGATGCCATAAATGACGTACACTTCCA
CTTGGCTACAAGAGCAATCAATAATTTCATACTTGAAGACTTAAGCAGATGGTATGTAAGATTAATCAGA
GGAAGGACTTGGGTTGAAAGCGATGATCCTGACAAGTTAGGTGCATATTATACACTTTACAATACTCTTA
ATACTTTAATTCATTTGATGGCTCCAATAACTCCTCACTTGTCTGAGGAAGTTTATGAAAACTTGGTTAA
AAACCTTGATGATAATGCAGTTGAAAGCATTCATATGGATAATTGGATGTTTGATGAATGCTTAATCGAT
AAGGAGCTTGAAGCTGAAATGGACCATATTAGAGAAATCATTGAGGCAGCTGCAAGGGCAAGAGATGTTG
CAAGATACAAGTTAAGATGGCCTGTAAGTGACATTACCGTTGTTTCTCAGGATGAATCTATCTTAAACAG
TGTTGCACTCCTTGAAGATGTAATCAAAGACCAATCCAACACTAAAGAGGTTCTTACAGCAAATGAGTTT
GAAAACCTTACATTCATTGCAAAGCCTAATCTCAAGACCTTAGGCCCAAGGCTTAAGGGAGATATGGGAA
TTGTCCAAAAGTTCTTTGCCCAAGCCAAGGCTGAAGGAATAGGCAATTCAATTAAAGAAGAGCTTGACTC
AAGCGGAAAATACATTGTCACAGGTGAAGACAGAGAGGGCAATCAGAAAGAAATCGAACTCAGTGCAGAT
GATGTCCTTTATGAAACTGAGCTTCCAGATGATGTAGTTAGCGCAGAATTCAATGGAGGAAACGTATTTG
TAAATACTAAAATTACTCCAGAAATCTTATCTGAAGCTATGGCTCGTGAGACCATCAGAAGAATCCAAGA
CATGAGAAAAGACATGGACTTAGATGTTGAAGCTAATGTTGGCGTAATGATCAATACTGATGGAGAGTTT
AAGGAGCTCATTGAAAAGCAATCTAATTTGATAAGCGATGAAGTAAGAGCTAAATCCCTTGTAATATTCG
ATGGAAAAGCCTGTGAAGTCTGTACTGATAAGGGTATGGGCAGAGAGTATGAGGACATTTCTGTAGAATA
TTCTAAAGAATGGGAGATCGAAGGTCATAAGGTTATTATTTCAGTTGTAAAACTTTAAAAAGTTTTTTTA
AGTTATTATTTCAGGTAAAACTTTAAATCATGAAATTCGCTTATAAAACTTTAATATTTATTAAAAAAGA
CTAAACAATCATTATTTTATGTTAATTCTATGCTAAGGTGTTTAAATGACTTTAACAGATTCTGAAGTAA
AATATATTGAAGGAATTCTCGGTAGAGAAATGAACGAATTGGAAGAGGGAATGTTAGATGTAATGTTTTC
CGAGCATTGTTCATATAAAAGTAGTAGACCATTTTTAAGAATGTTTCCTACTGAAGGAGAAAACATTGTC
CTAGGGCCTGGAGACGATGCAGGTCTTGTATCTATTACAGATGAATATGCTCTTGCTGTAGGTATGGAAA
GTCATAATCACCCTTCAGCTATTGAACCTTACGGAGGAGCAGGTACAGGTATTGGAGGAATCCTTAGAGA
CATTATCTCTATGGGTGCAATGCCAATTGCCCTTTTAGACAGCCTTCGTTTTGGTCCTCTTGAAGACCAA
AAGTCAAGATACTTGTTTGAGCATGTCGTTGAAGGAATCTCCGACTATGGTAACAGGGTAGGAGTTCCTA
CCGTTGCAGGTGAGATTGAATTTGACGAATCATTCAGAACAAACCCTCTTGTAAACGTATTATGTGCAGG
ACTTGTCAAAAAGGATGAGATAGTTCTTGCTGTAGCTCCAAATATAGGAGATGTCTTCCTTCTTATGGGA
GGAACCACAGGCCGTGATGGAATTCACGGAGTGACCTTTGCATCTGAAGAGCTCACATCAGACAGTGAAA
CCGAAGACAGACCTGCAGTACAGGTAGCTGATCCATTCACCAAAAAGAGAGTTCTTGAAGCTTCCCTTGA
AATCCTAGAAAAGATAGACTGTTCCGGAGTAAAGGACCTAGGGGGAGGAGGCCTTACCTGCTGTGTCTCT
GAGCTTGTAGATAAGTCTAAAAACGGTGCAGTTGTAGACCTTAGAGCTATTCCTTTAAGGGAAGAGGGAA
TGACCCCTTATGAAATAATGCTTTCAGAATCTCAAGAGCGTATGATTTTTGTCATAAACCCTAAAGATGT
GGAATTGGCACAAAAGATATGTGATAAGCATGAAATTCCTTCTGCAGTGATTGGAGAAGTCACTGAAGGA
AGCAATATGGTTGTAAAGGACTTCGATGCAGAAGAAGAGTTACAAACCTTGTGTAATGTTCCAACAATCC
TTTTAGCAGATCCTCCTTCAATTGACAGGCCAACAGTAGAGCCTGCTAAATCAGAAGATCTTGTTGAAGT
GATTGACGGACCTATTGATGAATCATTAATTAAGATATTGTCCTCTCCAAACATTGCAAGCAAGGCATGG
GTATATAAACAATACGACCATGAGGTTCAAACCAGAACCGTTGTAAAGCCTGGAGATGACGCAGCAGTAT
TGCAGATAGATGACGAGACAGCTGTTGCACTTACAGCAGACTCCAACACTGTTCACACAAAGCTTTCCCC
ATATGATGGAGGGGCAGGCAGTGTAGCTGAAGCAATAAGAAATGTTGTTTCAATGGGTGCTAAACCTTAT
GCAATTGTTGATTGTCTTAACTTCGGAAATCCGGAAACACCAGAAATCCTCTGGCAATTCAAGGAGTGCA
TTAGAGGAATGTCTGATATAGCAGAGAAATTCGAAGCTCCAGTCATAAGTGGAAATGTTAGTTTCTACAA
TGAAACAGAAGGTATTAAAATCAACCCAACTCCGGCAGTTGGAGTCATTGGAGTTGAAAAGCTATCAAGC
ATCAGAACACTTCCATTCAAGAATGAAGGAGATAAGATAATAATCATTGGAAAAACCTATGATGAGCTTG
GTGGGTCCGAATACCACAGAGCAGTCCATAACCTTGAACAAGGAGAAGCTCCTAAAATCAGAATAGATGA
TGAATTGGCTGCAGCTAATGCAGTTCTTGACCTCATAGAAAATGATGGAGATTATGTAAAATTCCTTGAA
GGTGAAGACAAGCTCAATATAAAAGCCACACATGACGTATCTGCAGGTGGAATAGCAATTGCATTGTCTG
AAATGGTTATGAAAGGCAAGTTAGGCTGTGAAATAGATATCAGCAATGTCCCAGCGGAAGAAAATATTAG
CGATAATGACTTGTTATTCTCTGAATCCCATGGAAGATACATCATTGCAGTAGATGCCGATAAGGCAGAG
GAAATAGTAAATTCCATAGATATTGATGCTGCAATTATTGGTGAAGTCAAAGGAGATTCTTTAATAATCA
AGAATAATGATGAAACCATTGTTGATTTTGCTATAGATGAGTTAGATAATGCTTATAATGGTGTTATTGA
AAAGTATATGGCTTAATTCTATATTTTTCCAATTATATGGATTCAATCATTTAGAGATTCATCATTTGTG
ATTCACTTATTTAGGGATTCAATCATTTACAAATTCAATTATTTAAGAGATTTGATGTTCAAATCTTCTT
AAATTCTATTTTTTTATTTAATGTATTTATATTCGTAGATTGTATGTTGTTTGTTTAATTGATTATTTAA
TAAATTGCCTTAAATTTAATCATATGATTTAAATGCTTTAGAATTTATTAAATAATTAATTGAATCAGTA
TTTAGTTAATTATAGGTAATAGAAGTTTATGAAAGTTGTAGGACGATTAATATGAAGTTTATATCAAATT
TAATTCCATTAGAAGAAGCATTATCAAAAATAAATGATAATATAAAACTTATGGATACAGAAACCATTGA
CTTAAAGGACTCTCAAGGCAGAGTTTTAGCACATGCTGTATCTTCTTATCACAATTCACCTCCATTTGAC
AAATCAGCTATGGATGGATATGCAGTTATTGCTGAAGACACTTTTGGAGCTTCCAATAATGTTATAAAAG
AGTTAAAAATCATCGATAGGATTGGTGCAGGTGATTTTTCCAATAAGTCCCTTCAAAATGGTGATGCTAT
AGTTATAGCAACAGGGGCACCTATTCCAGATGGTGCAAATGCTGTTTTAATGAAGGAATACACTTATGAG
GATGGTGACAATCTTGAAATCCACTCTCAAGTGACTCCCGGTGAAAACATATCTCCAAAGGCTGAAGACA
TTGCCAAAGGAGATGAGATTTTAGGAGAAAATGTTTTAATCAGGCCTCAAGAGATGGGCTTGATAGCTTC
CGCAGGATACAGTGAAGTGGAAGTCTATAAAAGGCCAAGAGTAAAACTGCTGATTACAAGCAATGAATTG
GTGGATCCTTCCCCTAATATAGATGATGCTAAAATAATCAATTCAAACCAATACACAATTGCAGCTCTCA
TCAGAAGTGCAGGAGCAACAGTAGATATTGACCATGGAATCGATGACTTTGATGAAATTCGCGATGCAAT
CGATAAGGCAAGCAGGGAATATGACTGTGTAATTACAACCGGAGGAACTGCAATAAGCAAAGGGGATGTT
GTCATTGATGCAGTTGAGGACTTGGGAGAAGTATTGTTCCATGGTGTTGCAATGAGGCCAGGTAAGCCGG
TAGGTGCTGGAATAGTCAACGGAACCCAGATATTCATGCTTTCAGGACAGCCTGTAGCTGCAATGGGTCA
GTTTGATATAATTGCAAGACATTTCCTATTTAAGGTTCAAGGCCTTGATTATTCCCATAAGATTGTAAAG
AGGACATCTTCAACTAAGATACACTCTTCCCTAGGCAGAACCGATTATATAAGGGCTGTAGCAGATGATG
AGACTGTTCATCATGTTTTAAACAGAGGTTCTGGAATCATAAGGTCTATGGTTGAGGCAAACTGCTACAT
AATCATTGATGAAAACCATGAAGGCATTGAGATAGGCGATATGGTAGACTTGATTTTCTTTAATGATATG
GCTTGGCCTAGTCTTTAAAAAAAGAGTTTAGATAAGAATTATTAATTCTTATCCTTTAATTTTACTTATT
TTTACTTATTACTTATTTTTTAAATTATCTTTATTTTACTTATTACTTTTTTTTAAATTATCTTTATTTT
TCTTTTATTTCTATTATTATTTTTTCTTAATTATCATTTTTCTATAATTCAAACATTTTTAATTTTATTG
GCTTGTTAGTTTACTTATTTACTTAATAACGACTCCTTTGACCTAATTTATAGAAGAAATAATAACCCAA
GAGTTCGCCTCCTCTGCTATCGCTTCTTCCTTGATTATATCCCTCACGATATGCCTGTTCATATTGATAA
GCCTCTTCTTGTTCTATTTGATCTTCAATATACTCCTCTTGAGCCTTATTTAGCTTTTCATTAAACTCTT
CCTTACTCAATTTGGATTTAGGACTATAAGATACGATTTTTTTCATAGAGGAATTAACGTCATCTCCATC
ATAGGACAATGCATAGAATGTTCCATTTGATTCAAAATATAAATAAGTTACAGTATGATTGACTATGCTT
CTATTGCTGTAGTAGGCTACGGCATGATGTCCGTCGATTTCCATCTCTTCAACATCATAATTCTCTTCAT
TTGTCGCTTCATAGCCGTAATTATTTCTAAAACTTTTATTGTTTTCCAAAGCTACGAGTCCGAAGGTAAA
TACATTGTTAAAAAGATAATCTCCGCTTGCATTCCTTCCACCTCCATACTCTGGAGGAATTTGGAAGTTT
ATATCGTTTACAGTTATATTCACCCAATCAGAGGTGTCCACATCACTTTCAGCACTAATGTAACTTACCG
ACAAAAGTGCTATCCCTATTACACATGCTAAAAAAATTATTTTTTTATTCATGTTTTATTCTATAGGTCT
TTTTCTTTTTAAAAATTTCTTTTTAATTCTTTAAAGAACATTTTTCTTAAGAGTTTAAAAGCATCTTTTC
TTAGCATTATCTTTTTATTTGCAAATTACAATTTTATTGCTAAAATGATTATCTTTTTATATTATGAAAA
CTTAATAATATTATTCAAATATTCTAAATGATTTTTATAATCTTATTAAATTTGACCTTAAATTTGTTTA
GAAAATTAAATGGAAAATAATTAAAACTAATGATTATCAATAAGTGTTACTATGAACGGAATATATTATT
ATGTAATAGCCTTTCTACTTATTTGGACTATTGCAATTGTATTTAAGGGCAGACTTGAAAATTATGGCCT
TGAAGTCAATTTTCCCCTTTTGATGTGGAAGACACAGAGATTGAGAGGATTTATAGACAGAATCGCCAAT
AGGGCTCCACGGTTTTGGAAATGGTACATGAATATAGGAATCGTCATCTCTACTGGATTTATGATTCTGA
TGGCTGTGGCCTTGGTATATTCTCTTAAGACCCTGATGGACGCTCCTACAGTCAGCCTGGTTATTCCAGG
GGTGGAAGTGCCAGGATCTCCAATATTCATTCCTTTCCTATCTGGTCTTATAGCCCTTGCAACAGTTCTT
ATAGTTCATGAGTTCAGTCATGGAATATTGGCAAGGGTGGAGAAAATCAAGATTAATTCAATAGGTCTTC
TATTATTTGCAATTCTTCCAGGAGCTTTTGTAGAGCCTGATGAAGAGGAATTGAAGGGATTGAACCGTCC
TTCTAGAATGAGAATATATGTTGCAGGTTCCATGGCTAATCTGACCTTGGCAGCTATTGCTCTTGTTATC
ATGATGCTCATATCCTCCTTTGTAGTCCCTGCAGTCTTTGAGGATGACGGCATTGTAATAAGCAGGCTCA
CTGAAGACGGCAATGCAATCAATTATCTCTCTGAGGGAATGGTGATAAAGGGAATAAACAATTATTCCGT
AAGCGATGGGGCATCCTATCAAAAGGCTGTAAGCACATTAAGGCCTAATCAAACGGTGACTGTTCTAACG
GATCAGGGAGAGTATAGCTTCCAATTGAAGTCAAATCCTCAAAACAAGTCTTTAGGATATATGGGAGTTC
AGGCACAGGTTAATCAAATAATTTCTCCGGATTTTGATAATAAGTTCTACACTCCTTTATTATGGGGAAT
AATGTCTTTGACAGACTTATTGTTCTGGATATACTTCTTGAACTTTGCTGTCGGCACATTCAACCTGCTT
CCAATGAAGCCATTGGATGGAGGTCATTTGTTTGAGGACCTTTTATCCTATATTACATCAGAGAATATCT
ATAAGCCTGTTGTGACTTTCATGTCCTTCTTTATGGGAATAATTATTGTTGTTAGTTTGGTTGTTGGATT
TGTTGGTGTTCCATTCTAAACTAACTTTAAAAGCTTTATTTTAACTTTTTTTCTTTATTTTTCTACTATT
TTTTTTGAATTTTCATTGTTTTGTCTTCCTATAGTCTTTTTTATAATATTTTTATTTGTTCGTACATCAT
AAAACCAAAACTTTATATACATTAAAAACCATATAAATAAATGTTTAAGCATTTACGAACTAATAATACT
TTTATTTTGTAGATGTTAAGATAGTAATACTTTAAGATTTGTTTTTAAAGAACTTATAAAGTAAATTAAG
ATAAATAATTCATATAATTTATTTTTAGCAATTTAAAGATAAATTCAATCTAGCTTAAAGTATTAACAAA
CTTTATGAGGAATTAAAATGAAAGCAAAAGCTGAAAAAATCGGTGATGGAGTATACTGGATCGGTGTACT
TGATTGGGACTTAAGAACTTACCACGGATATACCTTAGACGGAACCACTTACAATGCTTACATTGTATTC
GGCGAAAAGGTAGCAATCATTGACAATGCATATCCTGGAAAAACTGAAGAGATGATGGCACGTATCGATG
ACGCTTTCGAACAAGAAGGAAGGGAAATCAAAGTGGACTACATCGTTCAAAACCACGTAGAAAAGGACCA
CAGTGGTGTCTTATACGACTTATGGAAAAGATTCGATGCACCTATCTACTGCAGTAAGATCGCTCAAGGA
GGATTGCTCAGACACTATCCTAAATTGGAAGGTGCAGAATTCAACATTGTCGGAACCGGCGACGCTCTTG
ACCTTGGAGGCAAAACTTTAGCATTCTTAGATGCATTCTTGCTCCACTGGCCTGACAGCATGTTCACCTT
ACTTGCAGAAGACGGAATCCTATTCCCTAACGATGCATTCGGTCAACACTTATGCTACTCCAAAAGATAT
GATAAGGACATTCCAGAATATGTTCTTATGGATGCAGCACAAAAGTTCTATGGTAACTTAATCACTCCAC
TATCTAAAAAGGTTCTTAACAAGTTTGATGAAATCATTGAATTAGGCCTTTTAGAACAAGTTAAGATGAT
TGCTCCTTCCCACGGTCAAATCTGGACAGACCCAATGAAAATCATTGGCGCTTACAGTGACTGGGCAACC
GGTAAAAGAGCAGAAGACAAAGTTACCATTGTCTATGACACAATGCACTATTCCACCCAAAAGATGGCTC
ACGAAGTTGCTGAAGGAATCATGGCAGAAGGATACGATGTGGAAATGTTCTTCTTGCACGAAGACGAAAG
AAGTGAAATCGTAAAAAGCATATTAACCAGTAAGGCTGTTGCTTTCGGTATTCCAACAATCAACGACTTC
CCATTCCCAAGCATTGGAGACATTATCTACTACTTGAAAGGTCTTCACTTCAACAGAACAGGATTCAAGA
GACCCGCTGTAACCTTTGGTTCCATGGGAGGAAGAGGTGGAGCTGTTGAATTCATTGCAAACGAGCTCAC
CGAATGTGGATTTGAAGTTCTCGACCAACAAGAAATCTACTATGTACCTGCAGATGAAGACGATGAAGCT
AGCTTCAAATTAGGTCAAAAATTAGTAGAAGAAGCTAAAAAGTTAGAACTTTAAGTTTAAAAGCTAAAAT
AAAATAGAACTTTAGTTTTAAAGTTCTTTTATTTTTTTCTTTTTTTATTTAAATTTTTTAATAATCCTTT
TTTTCATAATCATACTCACTATTTTTTTAGTTATTTTTATCATAATCATGCTCACTATTTTTAGTTATTT
TTTTTATTTAGAATATCATTATTTTTGTATTTTTTTCACTTTTCTCTCATTCAACATTAAACATCTTCAC
TGAATTTTCACAATTTTTTAGTGAAATCATAAAAGTTTTTAAAAGTCGATAAAAATTTGTATTTTTACTA
ACTGTTCGTATTTTTTTCTTTATTTTTAACATTTTATACGAATTATTCCTATTTTTAACTTAAACTAGTT
TAGACTTTATTAAACTGTTCGTACTAAATTTTAAAAAAATAAAACATTTTGTATACATAAGAACAAGTAT
ATATGCTATAAAGTTTATACTATAATTATAAAACAATTTTGTTTAATGTTTATACAACAAAATTTAACAA
TTCTTGTTAAATTTTAGATTTTTCTTGAAATTTTTTTGAGGGGTTATAATGGAAAATGAAGAGAATATTA
GTCAACCAAAAGCAATTCAAATTTTTGCTAAGGCTCCAGGGGAGCTTGGCGTAAATGTTGTAAAGAGCCC
AGTGAAATTAACTATCCTTTCCATGCTAAAGGACACTGATATGGAATTTGATGAAATCGTTAAAAACACT
GGTAAGTCAAAATCAACTATTTCTGTACATTTAAAGTCTTTAAGGGAAGATGGAATCGTAAGCTACAGAT
TTGATGCAAACGACCACAGAAAGAAAATATTCTACATCAGCTCCAAATTCTTAGGAGAAGTAGAATCTGG
TGATGAGAAGGAATTGGAAGAAAGACAAGCCGAATTCTTGGTAAAGAATATTTTAGATGTAGACAACTTC
AAGTTCTCTTTTCTATTGTTCCACACCTTAAGATCCAACTTGATTCAAGAGGGAATTAACATCAACCCAG
TATTAAACCAAACAGGAAAGAATATTGGTGCAGCAATGTATGAAAAGCTTTATGACGATGACATTAAAGT
CTTCTGTGACAATATTACTGAATTCTGGGCAGATAATGGATTAGGAAAACTTGATATAGTTTTAGGAGAT
ATCATTAATGTTACTGCATATGAGTGTTTTGAATGCAGTTTGCTTCCTAAGAAGGGTAAACCTGCTTGCT
ACTTAGATGCAGGTATATTTGAAGCTCTTTTCGCTAATTATCTTAAAAAAGACATAGCAGTAACTGAAGT
TAAATGTTTCACAATGGGTGACGACTGCTGTCATTTCTTAGTTGAAGGCATTAATGGTGAATCTTTAACT
TAATTCGACCAATTTGAAGTTTTTATTTTAAACAACTTCATTTTTTTCTTTTTTACTCTTTTTATTATTT
TTATTCTACTTTTTTTACTATTTTTTAATTATTATTCATTTATTATTGTTTCAATTCATTTTCATTTATT
TTTATGGAATTTTATACATTCCTATTCATTAGTTCACGATTCCATCAATTTCACATTTTTATGTCAATTT
TGTTTTGATTTCGTAACAAGTTTATACTTTCACATCAATTTCACATTTTTAGTTTAATTTTGTTTTGATT
TCGTAACAATTTTATATTATCATATCAATTTTACGAAATAAAATCAATTTCACATTTTCAAATCAATTTA
ACACTTTTAAATCAATTTTTTTAACAAATATTATTTTTCAACTGCTCTTTCTAAAAGATATTTATATCAT
TAAATCCAATATAACTGTAATGTCAAATTCAATATTTTGTCCCGACTGCGGGATGCTTAAGGAAAACTGT
GTATGTGGAAGGTACAAAGCAAATCGTGATAAGGTAAAGTACACCAAAGGTACTAGATCCAATCCACAGT
ATAAGAAACGAAAAACATTTAATTATTCTAATAAAAAAAGAGCGGAAAATATGAAAAATACATCATCAAA
CAAATCAAAAGGTTTATTCCAATATGAAGAGCCCAAAGGGCTCTATCAATATGAGGATCTTGAACCTGTT
AAAGTAGAGGAAGAGGACGACTTTGGAAGTTCAAAGGTCTATGACATAGCTGAACATGACTTGCCTAAGG
AGATAATAGATGGCTTAAAAGAGGACTATCCTGAAATTCCAGATAGCATTATAGAAAACTTCCCATTTGA
AAGGCCAAGGGAAGGACAATTGGATATAATTGCAGATATTGAGGAGGCCATATCAAAAGGATTCAAATAC
ATCATCCTTGAGGCAGGAACAGGTACAGGAAAGTCAGCTGTAGCCACAACCCTTGCTAGAATGTATGAGT
CAGCATATATTCTTACAATGACCAAGCAGCTTCAAAGGCAGTATGCAGACGAGTTTGACTTTCCCCTTGT
AAAGGGAAGAGGCAATTTTGACTGTATAAAAGACGGATTTGAAGTCACCTGTGACATGGGGGCATGTAAG
ACAGCTCCAAAGAATTCCAAATTCTTCTGTCCATATGGAATTAGCAAAAACCCAACACTTACAGGAGACT
TGGCATTTCAGGACTCCTATGGTGGAGACATTTTCTTCCAGACAAATGACCACTGCCATTACTGGCAGCA
GAAGGCAAATGCAATAAACTCTCCAATCACCCTTATGAATTATGACTACGCTATTTTGGAGTTGAATTAT
GTAAAGCATTTCGGTAAAAGAACCCTTCTCATTCTTGACGAGGCTCATAACATTGAAGACAAGCTGATGA
AAACCATGGAAATCAATCTTTATAATCGTCAGCTTGAAAAGGACATAAAGAAGGTCATAAGCCCTCAGAC
TCTTAAAACAAGAGAGATGGGCGAATGGATAATGGAGATTGATGCAATTCAAGGCCATTATGCAGATATT
GACATAAAGGACCTCCCTACAAACAAGGCAGACAGGATCCGTTCAACTTCAGCAAGGCTGAAGGACCTAA
AGAACAAGCTTGAAACAGAGCCTGGAAACTGGGTAATCGACTCAAATGAAAATGGAGTTTCTTTCAAGCC
ACTTAAAGTCAATCATTATGCCAACGATTATTTATTCAAGCATGGTGATGTTGTAATATTCTTAAGTGCA
ACCATCCTTTCAGCTAAGATGTTTTCAAAATGGCTAGGCTTAAATCCTCATGAAGTCTATCATATAAAGG
TGGACAGCCCATTTTCAGTTGAAAAAAGACCAATTGAACTAAACCTTGCAGGCAAGATGTCAAAAAACAG
GGTAAAGCAGTCTGCCCCTAAGTCTATCGAAATATTAAACAAGATTCTAAAAAGGCATGAAGGAGACAAA
GGACTGATTCACACCCATTCATACAAATGCCAGCAATATATAATAAACAACCTTTATAACTCCAGATTGA
TTGCACATGGCTCTAACAATAGGGAAAGGGTCTTAAAATACTTTGAGGAAGATGATAACCCTCTTGTGCT
GGTCAGTCCGTCAATGAGCGAAGGTGTTGACCTTCCATATGACAAGTGTAGGTTCCAAGTCATTTACAAA
ATCCCGTTCCCTTATCTTGGAGACCCTCAGATAAATATGAGAAGGAAGAAGGACCAAAGATGGTATGCAT
ATAAGACAGTAATGACATTGATGCAGGCCTATGGAAGGGGAATGAGAGCAGAAGACGACTCCTGTGTAAC
TTATATATTGGATTCAGATATTCAAATGCTTTTAAAGAGCCCATTGTATAGGTCATTGATTCCAGAGTTC
TTTAAGGAAGCGATTATTGTTAATGATGATCGTATTATTTAAACCAAGCTTTTTTGGCCTTCGGCCAAAA
AACCTTGACCAAAATTTTTTTTACTACTATACTTAATCCCCTAATATTTTAAGTGAATTTTTTAATAATT
TTTTCATACATTATTACTTGTGTTGTTATTATGGTTATAAAAGAAAAGATAGAAATTGAAGGAATTCCAG
TGGAAGTCCATAGAAAAAGAATGAAAAATGTCTATCTGCGTGTATTGCCAGATGCCACCCTTCGTGTTTC
CGCCCCAGAGAGGGTATCAAATGATTATATAATAGAATATGTCACTTCTAATTTGGATTGGGTTAAGCAG
ACTCAAGAGAGAATTCTTAAAAACCCTCCAAAGCCTAAAATAATGTATAAGAATGGAGAGGTCCATAAGA
TTTGGGGAGAGGAATACAAGATACAACTAATTACCAATGACACAATAAAACATGCCTTTTATGATGCTGA
CGAATCTATAGTTTATCTTCCCGTAAGAAGAAGATCCACAGTTAATGAAAGGGAGAAAGCACTATTTGAA
CTTTACCGCTCTGAAATGAAAAGAAACATTGATTGCTTTTTAAATAAGTGCGTTCCAATTGTTGGAGAGC
AACCTAAGGAAATAAAATTCAGAAACATGAAAAACTGGGGAAACTGCAGAAGAAATAAGACAATCACATT
AAACATAAAGTTGGCTTCAAAGCCTCCAATCTGCACAGAATATGTTCTTATTCATGAGCTCTGCCATATA
CTTGAATTCAATCATAGCCCACGGTTTAAGGCATTGATGGATGGCTTCTGTCCTAACTGGAGAGAGATTA
AAAAACTTTTAAACGAATCTGATGATTAAAAAGAGTTTTATAAAATGAGATTTATTAAAAAGCCATCTTA
AAAAAAAATTTTTAAATTTAAGGATTTATTAAAGGAAATATCTTAAAAATAGTTTTATTTTTATGGAAAT
TTACGGGACCCTAGGGGGGATTTGAACCCCCGACCTTGGGATCCGAAGTCCCACGTCATAATCCTGACTA
GACTATAGGCCCAAAATAAAATATAAAAAATATTAATTAATTACTTATTATACTTTATCTCTTATCTTTT
TTAAAATTTTACTTTTTTTAGATAAAAATATTAATAAAAATTAATATAAATAGATTTAGTTAAAATTTCA
ATCAAATTTATTTTCATATTTGGAATAAAAAACAATTTAATAATTTATCTTCATTAGAATTTAAAATATA
TAAATATTTATCTTCCATTAAAGAACAAATTAATACTTTATCTTAATTCAAATTTAAATAATTATGTGAT
TATCATGCTTACAAAAAGAATTATTCCTTGCTTGGATTGTGACCTGCAAGTGCCTGAAGGCCGTGTGGTA
AAGGGAGTTGAATTTAAACAGATCAGATATGCTGGAAACCCAGTTGAGCTTGCTACCAAATATTACGAAG
ATGGAGCAGATGAGATAGTCATCCTAGACATTACAGCTTCCCACGAACGTAGAGGAACCATGGTGGATGT
TATAGAAAGGCTTACTGAAAACGTTTTCATCCCAATATGTGTAGGTGGAGGAATAAGAAAGGTAGAAGAT
TATACCAGAATGCTAAAGGCAGGTGCAGACAAATGCTCCACAAATACTGCTGCAATCCATAACCCACAGC
TTCTAACAGACGCTTCTAAAGTGGTTGGATCCCAAGCTGTTGTAATCGGAATAGATGCAAAGAGAAGATA
TGTGGAAGAGGACCCAGAGCAAGCTAAAGGAAAAACCATAGTGGACACAGACGATGGAGAGGTATGGTTT
GACTGCAGCATCTACGGAGGAAGAGAGTTCACTGGCATGGACGCCATTGCTTGGGCTCAGGAATGTCAGG
ACAGAGGAGCAGGAGAAGTCCTTTTAACCTCTATGGATGGAGATGGAACAAAGGACGGCTATGACCTTAT
TCTAACAAAGGCAATAAATGACAATGTGGACATTCCAGTAATAGCCTCTGGAGGAGTTGGAAACCCACAC
CACATACTCGAGGCATTTGAGATAGCAGATGCAAGTGCGGCCCTTGCTGCAAGCATATTCCACTTTGATG
AGTATCCGGTTCCTGTGGTTAAAAAATACCTGAAGGAAAATGGTGTTCCAATTAGGGAGACTTTTTAAAA
TGCTAAAAGCTCTTAACTTTTTTTTATATAAGTTATGATATTTTTTTATAAAAACTCTGATACTTTTTTA
TTTTTTCTAATTCAGATTCGTGATAAAAATGTCTAGTCAAAAAATCAATTCCTTAATCGATCTTAATCTT
ACCCAATATTCAGGCCAAACTTCACAGTCTCCATGGAGACATAATTCTATGGAAAATATTGATAAGTTTG
ATGAGCTAATTTACTTAAAAGTTCCTTCAATTATTGATGGACTTGATGATAAAACTATCAATTTAAATGG
ACTTCCAGTTCTTTTAAACCTATCACAAGATAAAGATAATATAAATGGTTTTGAATATACATATAGTTTA
CCTCAAAAAGTAGAAAAACAAGCATTTTCTATAGGGCAAGACAATCTTTCAAAGAAGGAACTTCAATCCA
TTGAAAGAGAAATAGACTCAAATCTAAATAACATCTATGACTTGGAATTTGACCTTGAAAAGTTCTATGA
GTTTCTTTTAGAGGATGAGAAGCTGGCTCCTTCAGTTGATTTTTGTAAGGGATTGAGACTATTTATTGCA
AAGGATCCTTTTGAATGCATAATATCCTCAATTTGTTCAGCTAACAATTCAATTGCTCGTTGGACTGCTT
CAATAGATAAGATAAAGTTAAACTGGGGAGAAAAGGTGGAATTTGATGAAGGTATGTTTTATGGTTTTCC
ATCTCCTAAAGACTTTTTAGACTTTTATGAAACTCCTATTGAACAGTCAGAGGCTGATGGACGTAGGTAT
GAGGTGGATTGCTACACAAAAAATCTTAAATCATGTGGAGTTGGATATAGGGCTCCATATATGAAAAAGG
CAAGTCAGATGCTTATTGATGAGATAGATATGAATGATGTTTCAAAAATGGCTTATGATGAGGCATTTGA
TCTTATTTTAAGATTGCCGGGAGTTGGTCCTAAGGTGGCTGATTGCATATTGCTGTATGGATTTGGATTC
CAGGAGGCTTTCCCATCTGATGTCTGGATAAAGAGGATAGTTTCTCATCTTTACTTTGATGGGGAAGATA
TCTCTGCAGATAAGACTAGGGAGTTTGGAATAGAGCGCTTTGGTGATTATGCAGGATATGCACAGCTTTA
TCTATTCCATTATGCACGTAAATCTGGTTTAATGGATGAGATTAAGAATAAATAGTCCTTATTATTTATT
TTTTTCTTATCTTTTTTTAATCTCTTTTTTTTAAATCTCTTTTTTGCAATACTTCTTTATTTTTTTAGTC
TTCAAACTCTTTTTCAAGCAGTATAGTTACAGGACCATTGTTTAACAAGCTCACTTTCATGAATGCACCA
AATACTCCTGTTTCACAGGGAACCTCTTCGCTGCACTTTTCTACAAAGTAGTCAAAGAGTTTGGTAGCCT
CATTTGGGGCTAAGGCCTTATGGAAGGAAGGTCTGTTCTTTTTGGTTCTGCCGTATAAGGTAAACTGGGG
AACAAGCAAGAGTTTTCCTCCTATATCTTTTACTGAACGGTTCATTCTGCCCTCTTCATCTGGGAATATT
CTAAGTTTTGTAAGCTTTCTAGCTAGGTAATCAACTTCTTTTTCTGTATCTGTCTGGCCAAAACCTACTA
AAACCATTAATCCTTCTTCTATTTGGCCTGTAATTTCTCCTTCAACTTCTACGCTGGCGTTTGTAACTCT
TTGAATGACTAATTTCATATTTTTGCCTTTTATTTTTTTAATCTTATATTATATTTATTTTTAGTTCTTA
AAATATCTTTTTGGACTTTTTTAATCATAATTTTTTTAGATAATAGTTTCATTTTTAACTGTTTCAAATG
AAACATTTATATCATATGAATGCCAATATAATTTTGAAGAATACTTTTTTAATTTTAGGGGTGCATTTAT
GAATGGTGAAAGCTTCCAGGGAATATGGGATAATTCTCCCTTAATTGCATGGATTCATAATCTCTCTAAG
AATCATTTCAAGTACCTAAAGGCAAAAATCAACGAGTTTGATTTAGGCCATGAGATAAGGTATATCATGA
TGATTTACGACAATCCAAATATTTCTCAAGATGATTTGGTGATAATGTCTGGTCAAAGCAAGGGAAACAT
TGCCAAGTCATTGAAGAAACTGGAGGATGATGGATACATTAAAAGAGAGGTAAATCCGGAGAATAGGAGA
AAGTACATGTTAAGAACCACTTCCAAAGGTGATGAGTTGGTTCCTAAGGTTAGGCAGATTTCTAAGGATT
GGGAAAAGGAAGTTGGAATAACCGAAGATGATAAGGAAGTTATTGAAAGAATAAAAGAGATAGCTATTAA
TGGAATGAAATTAACGGAGGATTTATGATTTTAGTTCCTTAGAATTATTAGATTTGATTTTTCTATTGAC
AGTTTAAGTCATGAATGGCTATTTCGGAGATTTTATTTTTATGGGTTATTTTTATATATTGTCAAGAGTG
ATAAAATGAAATTCGATTCAGAGACATCTGTATTGCTTGTATCATTCCTTACAGCATTCTTTGCAGTGTT
TTTAGCTGCAGGTATAGTCATAGGAGTTCCAGCAATTGCAAATGAGTTTGGAATGAACAATGTAGTTCAA
AATTGGATTATTACAATCGCATTGCTTGTTGTAGCTATGTTTACGCTTCCTGCTGGACAGTTGTCCGGTA
AGTTCGGTGTCAAAAGGTCTTTGCTTGTTGGAGTATTAATCTTTATCGTCGGTTCAATAGGAGCATGCCT
TGCTTTTTCTGCCGAATCATTCCTCTTCTTTAGGGTGATTCAAGGAATCGGAGGGGCATTTTCAAATGTG
GCTTCTATGGCTATGGTCGTTCAGGCAATCAAGCCACAAAGCAGAGGAAAGGCCCTTGGGCTTACTGTAA
CTGGGGTTTACCTTGCAGGATCCCTTTCTCCTGTAATATGCGGATTCCTTGTTTATAACTTTGGATGGAG
ATCCATGTTTTACTTTACAATTCCATTCTTCCTTATTTGTATTGCGCTAATGCTTTGGAAGATTCCAGGG
GATTGGAAAACCTATGAAAATGATAAGATTGACTCTATAGGATACATGATTTATGCAGTGGGAATATTGC
TCTTCATCTATGGATTTACAAACTTGATAAACGCTTGGGGTTTGATTTGTGTTGTTGTAGGCTTTATATT
GCTTCTTGCCTTTGCATATTATGAAACAAGAGTGGACACTCCTGCATTTAACATGAGATTGTTTAAGAAT
ACTAAGTTTGCATCCTCCAATGTTGCGGCATTATGCAGCTATCTTGCAGTTGCAGCACTCACTACCATAT
TGAATTATCATTTCCAGTATGTAAGGGGATGGAACGCTCAAATGTCTGGGCTTATATTGATTGTTACCCC
TATAATCATGGCATTTATGGCTCCAAACTCCGGTAAATTGTCTGATAGGATACATCCTCAAAAATTGGCA
GCTATTGGAATGACCATTGCAACTGCAGCCCTAGTGATTTTGATATTCTTAGATGCAAACACTCCAATTT
GGCTGATTATTGTTGCTATGGTACTTCAGGGGGTTGGTATGGGACTATTTACAACTCCAAATACAAATGC
GATCATGAGCTCTGTTCCTCCTAAGGAGACTCCTAATGCTTCAGCAGCACAGTCTGCAATGAGAACAATC
GGTCAGACAATGAGTTTAGGGCTTCTTACCCTTGTATTTGCTTGGATTATGGGCAGTCTTAAGCTATCTT
CACAGTATGCAGGAATGGTTGTTCAAGCATCTCAGATAGTTTGTATTATCTGTACAATAATTTGTGTAGT
GGCTATATTTGCTTCATTGGTTGGTATAAAGTCTAAGGATGAGTTTAATATTGAAAAGCCAAGTTAATTT
ATTTATTGCTTGAAAAAAATTATTTATGGGTTTTAAATAGGGGGAATTAAGTTTTCATTATTTTAATTTT
ATGATTTTGTGTATTGATTAAAAACTAATTATAATTATTTTAATTGTCGTTTTGTGTATTGATTAAAAAA
CAAATATAAGAGGGATTTTATGAAATTAGATTTAGAAACAGTTGTAGTGGCGGTATCGTTTATTACTTCA
TTTTTTGCAGTATTTTTATCAAATGGAATTGTCATAGGGGTTCCAGCTATTGCACAAGAGTTTGCAATGA
ATAATGTTATTCAAAACTGGGTTCCTACAATATTCTTCCTTGTGGTAGCTATATTTACAGTTCCTGCAGG
GCAGATATCAGGTAAGTTTGGTGTTAAGAAGTCTTTGCTTGGAGGAGTGCTTGTCTACCTCTTTGCTTCA
ATAGGGGCTGTGCTTTCATTCTCTACTGAGTCATTCCTCCTTTTCCGTATCCTTCAGGGTGCAGGGGTTG
CATTCTTGAATGTGTCTGCTATGGCTATGGTTGTACATGCAGTTAAGCCTCAAAATAGGGGAAAGGCACT
TGGATTTACAGTGACTGGGGTTTATTTGGCTACATCATTGTCTCCTGTAATTTGCGGATTCCTTGTTCAT
AATCTCGGCTGGAGATCAATGTTCTACTTTGTAATTCCTTTCCTTGTTATTTGCGTTCTTCTTATGGCAT
TTAAAATACCTGGAGAATGGAAGACATATGAAAAGGACAAGATCGATATGATCGGATCCATTCTATATGG
AATCGGAATATTGGCATTCATCTATGGATTTACAACCTTAACAACAAGCACAGGTCTTATCCTAACCATT
GCAGGACTTGCCATGCTTGTTGTATTTGGAGCTTATGAGCTAAGACAGAAGTCTCCTGTATTCAATATGA
ACCTATTTAAAAATAAGAAGTTCACATCTTCAAATATAGCAGCATTGTGCAGCTATATTGCCGTTATGGT
GGTTACAACAATCTTGAATTATCATTTCCAGTATGTAAGGGGATGGAATGCTCAGACTGCAGGTATGATA
TTGATTATCACTCCAATTATCATGGCAATAATGGCTCCAAACTCTGGAAAGCTTTCAGATAAGATACATC
CTCAGAAACTGGCTGCAATAGGCATGTCAATTGCTACTGTGGCTCTTCTTATTCTCACATTCCTGGATGG
AAACACTCCTATTTACTTTGTAATACTTGCTATGATCTTACAAGGTATTGGAATGGGACTATTCTCCTCT
CCAAATATGAATGCGATAATGAGTTCTGTTCCTCCAAAGGATGCTCCTACAGCATCAGCTTCACAGGCAA
CCATGAGAACAATAGGCCAGACTATGAGTCTTGGGCTTTTAACCCTTGTATTTGCATGGGTGATGGGCAG
CTTGCCTCTTGCAACTAAATATGCAGGAATGGTGGTTCAAGCATCTCAAATAATCTGTGGAATCTGTACA
GTGGCTTGTATCCTTGCAATATTCGCTTCATTGGTAGGTGTAAAGTCCAAGGATAAGTTTAATACAGATA
GGCCAACATAGATTGGAGGAAATGATTATTAATCATTTCTTTTTCTTTTTTTTAAACCAATTTTCTTCTT
TTTTTATTTTTTTATTTTTTTCTATTTTTAAAACTTTATTAAATATAGTTTCTAAAATAATATTATGAAT
GACTTGACAGACAGACTTTTTCACTTTTTTAAGGAAGAAATAATATTCTCTATTTCTCTGATTTTAGCTA
TTATTTCTTGTTTTTTTGTTCCTCCCAGTGTAGATTATTTAAATTATATCAATTGGGAAACAATTATTCT
TCTTTTTATAATTATGCTCTTTGTAGAGATTTTAAAGAATCTGTCTGTTTTTGAAATATTGGTTCGTAAG
CTATTGAAAAAAGTAAAAAATACCAGAGGACTGGTTCTATTTTTAGTCTTCACCTGCTTTTTTAGCTCCA
TATTCATTACAAATGATGTTTCATTGATTATATTTGTACCATTTACAATATTGGCCTTAAGAAAGGTTGA
TAGACTTGATTTGATAATATTTGCAGTGTCTATGGAGACAATTGCAGCTAATGTTGGCTGTATGGTTCTT
CCTATTGGGGCTCCACATAATATTGTAATGTATATGGTTTCTCATATTCCATTCCAGTCATTTTTCTTGA
TTCTTTTGCCTTATATCGTTGTATCTGCAGTGTTTTTGATTATTCTATCCTTCTTTGTTCCAAGCGATGC
AGTAAACTTGCCTAAATTTGGCAAAGTTGAGATTAATAAGGAAGGCTTCTTTAAAAGAGTCTTATTTGGT
GTTGATTATTTCCTTCTTTTGACTTTCATAGCACTATTTGTATTGATAGGAAACTTGGAAAACATTACAT
TCTTTAATCTGTTGTTTAAAAAGTGGATAATAGGCAATGAGGTTATTTGGGGCGTAGTGGCATCTCAGTT
TATTTCAAATGTTCCTGCTGCAATCTTGCTCAGTGGATTCAGCACTAATTATGAGGCGATAATTGTTGGA
ATCAATATTGGAGGGCTTGGAACTCTTATTGCGTCTATGGCAAATCTTATTTCATATAAGATTCTTGTGA
GGGAGCATGGGGAGTTTAAAATCAGATATTTGATTATATTTACATTTTTAAATGTGGTTCTGCTCTTTAT
CCTATTGGGAGTTTATGTTTTTATTCATTAAGTTCATTCATAGAAACGAGTAAGAATAATTCTTTATAAA
AATAGATTTTTGCTTTAAAAATAGTTTTAAGTTTAATCTAAACCTTATTTAATAAAAAATAGAATTTAAT
CCATTTATATCTTGTGCGCTAATGTATCCACATCAAAGATGCAGAAACACTAGTTGCAACAAAGATATAA
AAATTAAAACTAGAATTGTTTTAATATTTATCTTAAAATTTTTTAGGTATAATTACGAGGTTTAGTTTTT
GTGAGTTTCTTCCACACTATAATATATAAATACCTTATTATATAAAGTTTTTCGAATGCAAGTGTTTACT
TACATATTTATTTGGGAGAAACAAAAAGAATATTTATTATTTTTAAAAAAGAAAAATAATTAAAGATTAT
TTTTAATTTTAAATAGATTTTAGACTAATTTTTATTAGGGAAATTGAATAAAATAATTAGGATTATTGTC
TTTATTTCCTTAAAATAGGTTTTAAAGAATCTATTCAAGGTTTATTCTCTTAAATAGTTTTAAAGAACCT
ATTGAACCTTAATTCCATTAAAAATTATATCTAAAAATTCATCTGCATAATAGTCTGCAGCTAAATCTCC
ATCATTATATATCTGCCATAAGATAAGAGACTGGAATATTATGCTAAAGCACATTAGGGATACTGCTTTG
GAATTAAGATCCTTAATTGTTCCCTTTTCCAATTGCAATTTAAAGAACTCATCCAATTTGTTTATTATTG
TGTCTGTAATTGTAGTGATAAGGAGCTTTTTGTCATCATCATTCTTAACTTCCTGCATTGCAACTCTGAT
TATGTTGAAATCCTCTTCTGAAAATTCTAAAATCTTATTGAAGCTTCTTTTAAGATATTCTTCAATGCTG
TCGGTTTCGTTAAATTCAAAGCTTTCCTCTAGTTTGGCGATGAGCTGATTGGTATAATATTCTTTAGTCT
TTTTTATGAGGTTCTTTTTGTTTTCAAACTTTCTAAAAATAGTTACTTCATTTACACCTGCTTCAGCAGC
TATCTTTTTAGTTGTTGCCTTTTGTAATCCTTCCCTTTGAACAATATCGAATGTGGCTCTTATAATCTTT
TCCTCGGTATTTTCCTTTTCGAATAACATAATATTTGCTATATTCTTATTATTATATAATTTTTTTTAAA
TAATTCTTTGAATTTGCCAGTTTTTTAATCTAAAATTGGTGTTTTCTTGATAAAATAATATGAATTATGA
AAAAAGAGTAATGAATATTTAAATTTTTTTAAGAATAAATAGTAGTTCTAGTTAAAAAAAGATATTGGTA
GTATTTTTTATTTAAAAAAAGATAATTGGGTGTAGTTTCTATTTAGAAAAAGATATTTGGCAGTATTTTT
TATTTAAAAAAAGATAATTGGGTGTAGTTTCTATTTAGAAAAAGATATTTGGCAGTATTTTTTATTTAAA
AAAAAGATAATTGAGATTATTTTTTATTTAAAAAAATAAAAGTAAAGACTAAATTATCAAAAATAATTTA
GCCTTTTTTTAACTTAAAAGGTTTATTGAATCTATTTTAATGTCAATTTAGCCTTTGCACTAGAAGTAGC
AAATGTATCGTCACCTGCAAACTTGACAGTAAAGCTATAAGTTCCCTTCTTGTTTAGGCTTACATTTACA
GTAGCAGTTCCTTTGGAATTGGTTTTAGCTGAGTATGTTTTGCCATTAACTGTGAAACTTATCTTTTTAC
CGCTTACGGCCTTTCCGTTTGCTGTCTTGAAGCTTGCAGTAAGGCTTTTTGTCTTTGCACTTACCTTATA
TGACTTATTTGGGGCAGTCAATTTAGGGGTCTGTACTTTTACAGTAATCTTAGCAACTTCAAATGCTCCA
AGGTATTCCTCATCTCCTAAGAATCCTATTGCAAAGGTGTATGTGCCTTTGTAAGCAAGGTTTATCTGTA
GCTTTGCACTGCCGTTTTCATCTGTTGTTCTATCATAGACCCTTCCATTGAAACCTATCTTTATTGGTTT
ATTGGCTAAAGCAGTTCCGTTTTCGTCTTTTAAAGTAACTTGGAAGTATTCTCCTATTCTGCCGTCTTCA
GATGCCACTGCAGTGGTTGTCATGTTTTTACAGTCTATTCTTGTATTGATTCTAGAAGATTCCTTTTTCT
TGTCTTCATCTGTAGTATATACCTTTATAGCACAGACTTTCCCGTCACTGGTAAGGTCTACCCATTCTCC
ATTTAGATTTGCAGCTGACTTGTTTTCTATATAATGCTGTCTTCCACTTTCTAAAATTGGAATGCAGTCT
GATGTGATCTTAACGTCAAATTCATCCCCTTCCTTGATAGGGACATATGAATCCAATTGGATTGTATGGA
ATCCAAAAAATGGTGAAGTTCCATCTTGGCTGTATTTCAATTCATCATTGACATAGATCTCTATGTTGTA
ATCGACGCCAGCATCAATGAAGTATGTTCCGACTGCTGCAATGAAATCATCTTCCAAAGCCTCAAATTCA
TTGACGTATTCATTTCCCATATCAGTGAATTCCAATGTGCCTCCGATGTCATATTGATAGTTTTTATTGT
AAATGACTGTATTCATTATTGGGAATCCGACAGAAGGCACTAGGGTTGCAAAACTTGCGTCATAATAGGA
TATGTAATAGTATCCCTTATCTCCTAATTCTTCTCCCCAGCTGTTTTTGATTATCCAAGCTCCGTCTCCT
GGAGGGGTCATATAGAAATTGTCCTTGGAATAGTCATCATCCCATCCCACTAAAAGAACGCGATGGTTAC
TATCATTTTTTAGGCTGTATTGTGATGAGGTATTCTCATTTAATCCAGGTTCATCGGTTTCGGCATAGTA
GCTTACTGCTAAAGCGCCATATTTTAAAAGGGATTGCTTTAATTTATCCTTGTCAGTGGAATTCATAAGA
GGAGGCACAAAGACTGCGTCCTGCAAATGGATGCTGTCATCTGTTGCGATTATTGCTGAAATCTTTCCAA
GCTCATCGTAAACGTCATATTCTGAAGGGAATACTCCAAACCAACTTAATGCATAGGAAGGGCCTAGGTT
ATACTCTCCCCCTTCTTCTGCTCCTAGGGTTCCATAGCGATAATATTGCAATAAGCTGTCTTGCATGTTG
TTTTCAGAGATGTCCATTTCAAGGCCTAAAAATCTTAATATTGAAGATTCTATAGCTCCTACAGTTCCAA
ATGCCCAACATGAACCCATGTAGCCTTGGTTTTTAACTGGAGTCACCCATCCCCATTCACGTAGGTCAAA
TTTCCGAGGAGGGTTTGTCACATTGATTTCATTTTCTATGAGGGTAAAGTTCATTCCAGAAACGGCGATT
ACTGATTCATACCTTTCGTTGTTCAGGCATATTGAATCCTCTCCGCTATAGCTATTGTTTTCAAGTGTGG
CGATTTCCCCATCGAAGTCTGTGAAGATATCATCAAACTCACTCTCTTTGTTGGTATTGTCTTTGAAAGT
GGAGTTTGCAATGTAGTAGCCTGAATCATATGTATATAGGGCTCCTCCAGTTTGGGCGTTATTGTTGCTG
AAGCTGCAATTCAATATAATCAATGCGCTAATGTCAGAGAATATTGCCCCTCCAAAGGAACCTCTATCAT
CATCTAATTCTACAGAGTTATTGTCAAAGATTGTCTGTGAAATTGTAAGCTGTGAGAAGGAAGAATAGAT
TGCTCCTCCGTCAAAGAATGCCCCATTGTTTGTGAAATTGTCTTCCTCCAATGTGATTTTTCCCCCTAAA
GAGAGGATTGCTCCTCCGAATTCGCTGTAGCAATTAACAAAGGAGGATCTTGAAATCATTATTGGTACGT
CTTCGCTATCTGAATATATGTCAAGGAATATTGCCCCTCCATTTTTTTGTGAACTCACATTAATGAATGT
GCAATTGTCAATTTCAGCCTCTTCAATTCTTTTTAATCCTATTGCTCCTGCAGTAAGGTTTGCATAGAGA
TTAATGAATTTAGAATCATGAATTACTGTTTCTCGATCTCCCTTGATTGCTGTAGCGTATTTGGAGGTGG
TATTTGCAAATGTTGTGTTTAAAACGTAGATTGAGGAATTTCCCAAACTGTTGACGAAAGCCCAGTCCAA
TGGCTTGGAGCTTTCAAAATATCCGTTGTTGATAGTTATTTCACCAAGGTATGAGTTTATTACTCCATCA
TTGAGGGATGTGCAGTCTATAAACTTATCATTATTGCTTGTATATTTTGCTCCAAATGCAAATATTACTC
TTTTGTCTGAGCTGTCGTTGATGAAGGTTACATTGTTTGTCTCAAGCTCAGAGCCTGGGTTGAGTAATAG
GGCGCTGTCCTTTGTAGAGTTTGCATTTATTATATTGAGATTTTTTAGGGTTATGTTAGTTCCGTTGATT
TGGAAAATGCCACATTGATTGTCTCCGTCTATTGTATGGCCATTTCCGTTAATTACGAAATTGCTTTTAG
AGATTGTTAATGTGATATTGTCAGTTTCATTGTTGTATTTATAGTCGTCTGTCAATTCTAAAAGGTCACT
TGCATTTATTATTTCCATTTGTAAGTCTGTAAATGTCTTCGCAGGATCTTTTAGAGCTTTATTATTATCA
TTATTATTTGTATCTTTTAAATTATCATGATCATTTTGGATGATTGTGCTTTCGCTTAAGCTTTTATCAC
TTAAAGTGTTGTCGCTTAAGGTATTTTCATTTAAGCTGTTGTCGCTTAATGTGTTATCGTTTAGTCCATT
ATCACTTAAATCATTATTAAAATTCTCTGTTGCTGAAACCGCTCCCAGAGATATGATTAAAATAAGCATG
ATAATTGCTATCTTTAAGACCTTCATGATTAGAATTTATGTTGAAATTATTATATATTTTTAATTTTATT
AACTTAATTAATGAATTATTTAAAGAATTCTTTATGTTATTATCTTTTTTAAGATTAAAGAATCATTTAG
AAAACTATTTAAATAACGCAAAATATAGGATAATTATTCATTTAAAGGAGGGTGTACTATGGCAAGATGT
CCAAGATGTGGTTCCGAAGCACTTGAAGAGATCAATTTCAATACATATAAATGCCATGAATGCGGCTATA
TGATTAGAAATCCGGATGACCTTGAATTGGTTGAAAGAGAAAATGGTGATTTATGACTCAAGCTTTTTTG
GCCTTCGGCCAAAAAACCTTGACCAAAAATTTTATTGGGGGTTGTGAGAAAGTCCCTTTTCTATTTTTTT
ACTTTTTATTATTGAATTTTTATTTTTTTGTTATTTTAATCTTATTTATCTTTTAATTTCTGTTTTTATT
TTTATGAAGGACTTTTTTTATGAATTTTTATTTTTACAAATTTATATCTTTCTTATCTAGTTTACTGGAT
AGTCTTTTATATATTATTATCTAGTTTACTGGATAGTCTTTTATATATTATTATCTAGTTTACTGGATAA
ATATTATATTATATGATTTTTAATAAAAAAAGAGTAATTTAAATTTGTTAATAAAAAGGATGAGTTAAAA
ACTCTTATATATAAAAAGAGTTAAAAACTTCCCAGATCTATTTAAAAATAAGTTAGAGTTAAACTGCTTG
GATTTATCCTTGAACAGTAACTTTTAGCATCTTATCTCCAGGACGGATAGCATTTACAACATCCATTCCT
TCGATAACTTGTCCAAATACGGTGTGAACACCATCTAAATGAGGTTGCGGACTGTGGGTAATAAAGAACT
GGCTTCCTCCAGTGTCCTTACCTGCATGTGCCATGGATAATGCTCCGGTTCCATGTTTGTGTGGGTTTCC
TTCGGTTTCACATTTGATGGTCCAGCCAGGTCCTCCGGTACCGTCTCCTCTTGGACATCCTCCTTGGATT
ACAAAGTCAGGAATTACACGGTGGAAGGTTAATCCGTCATAGAATCCGCTGTTTGCTAATTTTTCAAAGT
TTGCTACAGTTCCAGGAGCTTCGTTAGGGAATAATTCCAATACGATATCTCCTTTTTCAGTTTCAATAAT
TGCCTTTTTCATTATAATCACTTTTCATTGTCTTTTAATGAATTAGTTATTTTTTTAGTTGTTTGAAACA
TAATATCTTGTTTAAAACATATTAAAAATACTATTTATATTTTATTTAACTTAATATTTAAAATTATTTT
TTCCAGTCTTTTCATATTCAATTTAATTTTAGTTTTTTCTGTTTTATTCAGTGATTTATCGCTTTCTAAA
AAATTTTAAATATAACTATTTATATATAAGAAAATATGTTAGAACAATATATGCAATTTATGTGGTTAAT
CATTTTTGGGAATATAGAGAACTTGATTTTATCTTCCCAAGGAGTTGTACAGGGAGTGGATCCTAAGATT
TTAGGTGGATTAAGTATTCTTGTAGTTATTATGTGGTTTGTAATCGGTACAGTCATTACTGATGTTGCAA
TACAATATTCCAATCTTATTAATTTTATTGGCGGTCTTGCAATATTTCTTTTAGGTTTTCAAGCTGTTTA
TGAGGCTGTTAGGAACATAAGGGGTGGATAAGATGGATTGGAAACCTTATGCTCCATTCACTGCATTGCT
TATTTTTGGAAACATTGAAAACCTTATTCTATCATCTGAAGGTGTAATAGCAGGTGTTAATTCATTTGTT
TTGCTTATATTGAGTTTGATAGCCGTTGTTGCTTGGCTTCTCTTAGGAACATATGGTACAAACTATGCAA
TCAAGTATGCTGATTATATTGAAATTATCGGCGGAATCGCTATTATTCTATTGGGTTTAGAATCAATGCT
TGAAGCCTTTGGAATTCTTTAATTCCTTACTTTACTTAAAATTCGCAGAATTCTTTAATTCCATTTTTTA
TTCTTTTTTTTAGACCTTTCACTCTTTTTTAATATTTTTTTAATTCTAGTTTTTATTTATTTTTCACTAT
TTATTCCTAAAAGTTAAGTTTTTTCTTTATCTATTTAATTTTCACTATTTATTCCTAAAAGTTAAGGTTT
TTTCTTTTTCACTATTTTAAACCTAATTTAATAAATTTAAACCTTAATTTCTCCAGATAGGATCTTTTTA
TAATCCTCATAGTTCTTCTTTAAAAGCTCTGGAATGTCAAGTTCATATGGACATTTCATGACACATTGCC
TGCATTCTGTGCAGTCCTCTATCTTTCTCATCTTCTCTTGAGTCTCTTCATTTAGGTTTGGTTCAGCTGG
GAACCTTCTAATCCATAATGACATTCTTGCGCAGATGAATATTTGAATGTCTTCAGGGCATGGCATGCAG
TATCCGCAGCCTCTGCAGAAGTCTCCCTGCAATTCTTCTCTTTCCTTTGCAATTATCTCTTCAAGTTGCT
TATCTAATTTGGTGTCGTCTGCCATATATGATAGGAATTCGTCAAGTTCGCTTAGTTTTTGAACTCCCCA
TATTGGAACAACATTATCAAAATGATTGATGTATGCAAATGCTGCCTTAGAGCTTCTGATAAGCCCTCCG
CTCATTGCCTTCATTGCAATGAATCCTATATTGTTTGCCCTTGCCATCTCCACAATTGCAAGCTCCTTTG
GCCCTGTAAGGTAAGAGAAAGGAAACTGTATGGTTTCGTATAATCCGCTGTGGATTGCTTCTTCTGCAAG
TTCATATTTGTGGGAGGTGAATCCTATATGTCTTATTGTTCCCTCATCGTAGAGGTCGAACAATGCATCG
TATGCTCCGCTTCCGTCCCCTTCTGTAGGGCAGAATGATGGGTTGTGTATCTGATAAAGGTCTATATAGT
CGGTTCCTAGATTGTCAAGACTAGTCTTGATATCCTTTTCAATGTCTCTTCTGTTTTCCCCTTGGGTCTT
GCTTGCAATAATGATGCTTTCTCGTGGAAACTCTTTATCGAATCCTTTAAATGCATAGTTAAGTTTTTCT
TCACTATCTGTATATGCTCTTGCAGTGTCGAAGAAGTTTATTCCGTTATTGTAAGCCTTTCGAACAATCT
CTGCACTTTCATTAAAGTCAACACGTTGAATAGGGAGTGCTCCAAATCCGTTTTTCTCTATTTCAAGTCC
AGTCTTGCCAAGTATTATTCTAGCCATCCTATCACCAAATCAATCAACACAATTAGTTGTTTAAATTTTT
TTATCCTCAAATTATTGCTTATATTTATCATCTTATGAAAAGTATTACAAAACATTATCTTTAATTATTT
TTTTATATTATAAACTATAAATATAATTGTGTTAAACTCTTATTTTAATCAATAAATTAACTTAATTCAA
TTAATTTAATCAATTAAAAAAAAAAATTTAAGGAGTTATTATTTATGAATACACAGGAAATCATTGATAT
TGAAGATAAATATTTCATTAATACATTTAACAGGGTCCCAATAGTCCTTGACCATGGAGAAGGAGTAAAA
GTATGGGACATAGATGGAAACGAGTATTTGGACTTTTTAGCAGGTATTGCTGTAAACTGCTTAGGTCACA
ACCATCCTAAGCTTGTAAGCGCAATTCAAGAGCAAGCAGGAAAGCTTATTCACGTATCAAGCATCTATTA
TAACGAACCTGCAACAGTTTATGCCAAAAGATTGGTGGATGCAACTGGCTTTGATAGAATATTCTTTGCA
AACTCTGGAGCTGAAGCCAATGAGGGAGCAATCAAGCTTGCAATCAAATACAGCGGCAAGCATGAGGTCC
TATACTGTGGAGACTCTTTCCACGGAAGAACAATCCTTACCCTTTCTGTAACTGATCACCCTGAATACAG
CGCACCTTATGTTGAAAACCTGCCAAAAGGATTTAAGAAAGTTGAATTCGGCAATTTGGACAGCGTTAAG
GAAGCAATCACAGATCAAACTGCAGCAATCATCATTGAACCTGTTCAAGGTGAAGGTGGAGTTCATGTTG
CTTCAGAAGAGTTCTACAAAGGATTGAATGACTTATGCAAGGAAAAAGGAATCCTAATCATTGCAGATGA
GGTCCAATCAGGATTTGGAAGATGCGGAGCATTGTTTGCACATGAATTATTTGGCCTTGAGCCAGATATA
ATGACTGTTGCAAAAGGAATCGGCGGAGGATTCCCAATGGCTGCATTTCTGGCCAAAGAGGATGTAGCTG
GCGGATTTGTACCGGGAGACCACGGTACAACCTTTGCAGGTAGCCCTCTTGCAGGTGCAGCTGCAAATGC
AGTATTTGATGCATTCGAAGAAGAGAATATTGTAGAAAACAGTAAAAAGATGGGAGAATACTTTAAGGAA
AAATTAGCTCCTCTTAAAGACAAATACGACTTCATAACTGATGTAAGAGGTTCCGGTCTTTTAGTAGGGC
TTGAATTAAACTTTGAAGGAGCAGATATAGTTGGAAAGATGCTTGAAGAAGGATTCTTAATCAACTGTAC
AGCAGGTAATGTATTAAGGTTTGCACCTCCTCTTGTAGTTAAAGAGGAAGAGATTGATGCACTTGTTGAA
GCTCTTGATAAGGTTTTTTCTTCCTTATAATTTAATTTTAAGTTCTAGTTTCTTTTGAAACTAGATTTTC
TTCTTTTTTATTTATTTTTTTTGTTCCAGTTTCTTTTGAAACTAGATTTTTTTCTTTTTATTCTTTTTAT
TCTTTTTAAAAAATTCTTTACCAATTTTACTTTTTGCTTCTTTTATTTAAATTTTTTAAAAAATTATTTA
AAGACTTCCAAATAAATTAATTAACATGGAAATAAAAAGAATCAACAGGTATGTCATTTACCTATTTTCA
CTGTTTTTAATATCATTAGGGGCCTCAATATCAATCAAGGCAAATCTGGGAACATCTCCAATCATCTGCC
TTCCATATGTTTCAAGCCTTATCTTGAATATGAGCGTTGGAACAGTCTGTTTGATATTTAATGTTATATT
CATACTTGTTCAGATAATCCTCCTTAGGGGAGACTTTGAAAGGAGACAGTATCTTCAGATAATTGTAGGA
ACAATCTTCTCCCTTTCAATTGACTTTTCAATGACGCTTGTAACTTTTTTAAATCCTACAAACTACATTA
GCCAGTTTGCCGTCCTTATGCTAAGTTGTGTGGTTGTTGCATTTGGCGTATTGCTTGAGGTTCAAACAGA
GGTGGTCTTTCTTCCTCCCGATGGAATCATTGTGGCTATTTCAAAGGTTCTAAATAAGGAGTTTCCTAAG
GTAAAACCTTTCTTTGATACATCATTAGTGCTTACAGCAGCTATTCTTTCAATAGTTTTCCTAGGCTACC
TTGCAGGAGTCCGTGAAGGAACCATAATTTCAGCTGTAATAATTGGGCCTATCGTTAAAGTGCTTCAGAA
GTTCTTTAATCCTTATATCGAGGCTGTAATTGAAAAATAATGCTTTTTTTATATATTTGCTCCATTCAGA
TGAAGTTCTTTAGTTGGGTGAAGTTATTTACTTAGATAAAGTTCTTTCATTCTCTAAATCTTTTGTTAAA
AGTTCATTAAAAATAAAATTAATAAATTTAAGATATTTAAATCTTAAAATCTCTTTTTTCTAAAGTCAAT
CTTAATGTAGGTGTAACCATATCATTTTTATAAAGCTCCTTCAACTCTTCTATGCTCACCCACTTAAAAT
CATCATGCTCTGAACTTATTTCCACTTCTCCGCCCATTATCTCAAGATTCATCATTAACTGAACAGTGCT
TATCGGCTGATTGGTTCTTCTACTTATGAATTCATCTTGTACTGTCTCAAATAAGCTCACTATATTTACA
TCAAGATTGGTTTCTTCCTTGAATTCCCTAATCAATGCTTCATCAAAGAATTCTCCGGGATCCACTTTTC
CTCCTGGAAGCTCGTATTTATTAGGATTGTTTCTTGACTTGGGATGTCTTCTAAGGATTAATATCTTATC
TTCCTGTTGAACTATCCCTCTTACTGTCAATCCCCAGTCTTTTCTATTTGTCATATTATCACATTTCTAT
TGTTTTAATTAAGTTTTTTCTAAAAAAGCTGAAACCTTTATTAAGTTTATTATAAAAAATTTAAACCTTT
AATTAATTTATTCTAGAAAACTTTAAACCTAATAGTTATTTTATTTGGATTTCATTAATAAAATATTTAG
TTTTTTCTAGTCGGATATTCAAGTTCCTTAAATAATTTTATATATTAGTTTAAATAGACATTTATTGAAA
ACTTATTTTTAAGATTATTGCAGTATAATTTTAATATTTTCATGGAGGCTAATTATGGATTTAAACATAA
AGACAAACGACAAAGGCCATTTAGATATTGGCGGTGCTGATGCTTGTGAACTTGTAGAAGAGTATGGCAC
TCCTATCTATGTAATAGACGAAGAAAGAGTTAGAGACAACTACAACAGATTTTATAATGCTTTTACTAAA
TTTTATCCTAAATTTAAAGTATTCTATGCATGCAAAGCAAATACAAACATTGCAGTGCTCAAAATCCTCG
AAGAGGAAGGATGCTGTATCGATGCAGTTTCCCCTGGAGAAGTCTATATCTGTAAAAAGATGGGATTTTC
CGGAGACAGGATACTCTTTACAGGAAACAACATTAGAAACGATGAGATGGACTATGTAAACAGCGAAGAC
GTTATCCTAAACATCGATTCCGTCTCTGCCCTTAAAAGGTTAGCTGAAAGCATCGATCCACAAGGTAAAA
AGATCTCTTTCAGAGTAAACCCTATGGTAGGTGCAGGCCACCACGGTCATTGTATCACTGGTGGGGAAAT
GAGTAAATTCGGTATTATGGAAACCGAAGCTGTAGAGATTTACAAATTAGCTAAGGAATTAGGATTCGAG
CCTGTAGGTATGCACTCTCACATCGGTTCAGGCATTCTTGACCCGGAACCATTCAAATTAGCTATAGAAT
CTACAATGAACATTGCAGGTAAGGTCCACCAAGAAGCTGGAATTGACTTTGAGTTTATTGACTTCGGTGG
AGGAGTCGGTATTCCTTACACTCCAGAAGAAGAGCTTTTAGACTTAGAGCACTTTGCAGAGGAAAATATA
AAATTATTCAAAGAAAAATTAGAAGAGTTTGACATGGGAGAACCTATTTTATACCTTGAACCTGGAAGAT
ACATTGTAGGTGACGCTTCTGTAATACTTGTTGAAGTAAACAGCGTAAAGGAAAGTTATAGAAAATTCAT
CGGAGTCGATGCAGGATTCAACACTCTTCTTAGACCTGCCATGTATGATTCCTACCATCACATTGTAGTT
GCAAACAAGATGAATGAAGAGCCTACCCAAACTGTAGACGTTGCTGGTAATGTCTGTGAATCAGGAGACC
TCTTTGCAAGGGACAGACCACTTCCAGATATTGAGGAAGGTGACATATTAGGAATATTGAATGCTGGCGC
ATACGGTTATACCATGGCTTCCAACTACAATTCAAGACCGCTTCCAGCAGAGATCCTTGTTAAAAACGGA
GAATCCTTTGTTATTCGTGAAGCACAGACCTTTGATGACATATTTGAAAAGCAATCCATTCCAGAACACT
TGAAATAGATGGATTATTTAAAATAGGTGCTTGTAAATAGAAAAGTACATTATCAAATTAGGTGTTATTA
TGGTAGATTTAAAAGGTTTAAAATTCTCTAAAATGCATGGAATCGGTAATGATTTCCCTATAATTGATGA
AAGTAAAGGAGAACAAATCAAAGAAGCAGATAAGCCAGAAGCATGCAGACAGTTATGTCATAGGAACTTT
GGTGTAGGGGGAGACGGAGTATTGTTCGTTGTCCCATCAGACGTCGCTGACATTGGATACAGAATGTTCA
ATCCTGACGGATCTGAAGCTGAAATGTGCGGAAACGGCATTCGCTGCTTTGGAGACTTTGTCTACAGAAA
CAAGATTGTGGAAAAGGAAACAATGACTGTTGAAACCAAATCAGGTATCAAAACCATTGAGATAACTGTA
GAGGACGGAGAGCCTGTTCTCTTTAAGGTAAATATGGGCAAATCCACATTCAAGGTCCCTGAAATTCCTA
TGATTGCTGATACAGATGAATTCGTTGATGGGGATTTGGATGTGATAGATACCACTTTCAAGGCAACTTG
CGTAAATGTGGGAAACCCTCATGCCATTTTGTTTGTAGACAATGTAGATGATATTGATATTGACAAATAC
GGACCGGCCATTGAATGCCATGAAGTTTTCCCTGAAAAGATCAATGTTCATTTTGTTGAGGTTTTAAGCA
AAAATGAAGGAAAAATGAGAACTTGGGAAAGAGGAGCTGGCGTTACCCTTGCATGTGGTACCGGTGCAAC
TTCAACAGCCCTTGCCGGTGTAAAATTAGGTCTTTTTGATAAGAATGTACTTCTCCACTTACCTGGAGGA
GACCTTGAATTTGAGGTCTATGAGGAAGATGGTGAGCTTGGTGCATTTATGAAAGGCCCTGCAGCATTAG
TATTCAATGCTGAAATCCAATAGAATTTATTATTCTTTAATAATAAATTTTCTTTTCTTCTTTTTTTTAA
ATTCTTTTTTTTCTTTAAATTTTATTTCTTCTTTTTTTTAAATTCTTTTTTTCTTTAAATTTTATTTCTT
CTTTTTTTTAAATTCTTTTTATTTTCTTAAAATTTTATTTTTAATTATTTTTTCAAATTGCATTTTTTCA
GACATTTATAAAATAGGATTCTGGAAAAATCATCTATAATTTTCAATTTCTCTAAAGAAATCTTTATAGG
GCTGCAAACCTTTATCCGCCCAAAGCTTCCAAATATTCAGCTCATTTTGAACAACACCTGCCTTGGCACA
AGCTTCTTCAAGTGTTTTTCCTTCTTTCAAATAATTCAAAATGTTTCTTGATAAAATCATGAATCTTGGC
AGTTCTTCTTTGTAAAAATCTAATGGACTTCCATTAAAAATAGTAAAACCCCCTAAAAACTCCTATTTAA
AGAATTAAATAAATTTTAATTAAATTTTAAATCATATTTCCTTAATTAGATTCCTGTCGGTTTCTATTCC
TAAGTATTCTTTAGTGTAAGGGCAAGCCAGACCACATTTGGCGCATAAGCTCTTGCCGTTTGTTCTTTTC
ATTTCCTTCTTTATGAACTCAAAGCACTTTTCCGCATCGAAGTACTCTTCCCTTTCTCGCCTTGAGTTCC
ATTTCACTTCATTTATCGCATCTACAGGACATGCATCCTGGCAGTCTGTGCAATCTTCACATAAGGAGTC
ATCTATAGGTGTTCCCACTTTAATGGGCATGTCTGTAAGCAATGTAGAGAGTCTAAGTGCGGCACCATAT
TCCGGACTGATGAGCAATGCACATCTTCCTATCCATCCAAGTCCAGATCTTGTTCCGGTTGTCTTATGGG
GAATCTTGCTGGCAAGGTCTTTCAATTCCCCCGCCACCCTTTCTCTTGAAATGGCCAAGGCATTGTAATT
CATGGTGTTTTTGATGTAATCCTCACCTTCAAGGATAATGTCATTCAGTTTTTGAGCCACTTCCTTCATG
GATTCAACATACAATGATTGGTCATTGGTATAGATGGTTTTCAATGCTTCCTTTTCAATTGGAATCCCTA
TTAAAATGCTGTTTGGATACTCCTTAGGAACATTTCTAATGTTTTCAAGACTAGCAAAACCTACCACTTT
CACTCCTTTTGATTTGAAGAACTCCTCTATTTCCCTTGAATTTCTCTCTTCCAAATTCATCCTATCCTCT
CAATTTGCTGATTTTGTTAGATTATATGATTAAATATGATTTTCAAATTTTTAAATATTTTCTTATGATT
TCAATATTTTCAAATCAGAGTCTTCATACCGGTTATGGCCTTTAAGACTTTTCTTGTATTTCCAACATTT
AATTGCATCATCCAGGGATCTGCCCTCATTGTCTTCAAAGAAATCCCGTATGTATTGGTTGTATTGGAAT
TGCCTGTCTATTTTGGTTTTCTCGTTGGAGTTCTGCAATTCATAGTAGGCATTGATTGCATCCTGATATG
TTTTATCAGGATTTGCCTTCAGCCATCTTTGGAATTTTACCTTGAATTTAAATCCTTTTCCTATTTCCCT
TTCAAAGAATTCCCGTTTATCTTCACTGCATCTGAAGTTCTCACCTAAAATGGAATCCAATGTGATTTCT
TGAGAATCAGAATTACTGATTTTATGATTGCAATTTTTAGTTTTATTATCATCTTTGACAGATTTGTGAT
TTTTGGTTTTATTTCCATCTTTGACAGATTCATCTAATGATTTGCCAGTATCCAGATAGTAAATGATTCT
TTCCTCTAACTGATTTTTACTACCGCCAATCTTCAATCCTTCTCTTCTACAGAATTCCTTTAACTCTTCC
TTTAAAAAATAGTATTCCATGAAGTCTTCACTTTTCAGGTCTTTTGTTAATTGTGGTCTTGTTTTGGTGT
TTTTAGTTTTCATATTATCATAAAAATAATAATCAGTCTGAAAATTGAAATGGTTTAAATCTTATAGGCA
TTAATCAGAACAATCTCTTCAAAGAAAAAGCTTTCGCTTTTAGCTATTTCTGCAATAAATCCATTCCTAT
CAAACATATCCAATGTCTTATCATTATTGGATAATGAGGACTGAATTATCTGGACAATTCCTCCATCATT
TAAATAATGTGACACTTCATTAATGAATCTATCTATGACTTTTCTTCCATCTATTCCACCGTCAAATGCA
TAATTCAAATCATCATCAATAATGTCATCAGTATCGGTAGGCAGATATGGGGTATTAAATAGAATTACAT
CAAACTTCTCATTTTTTACAGGCTCAAATAGGTCTCCGAACTCAAGCCTTATTGTGTTGATATCGTTTAG
CTTGAAGTTCTTCTCAGCAAGCTCAAGGGCATTGTAGTTGATGTCTGTTGCTGTTACATCATCTGTTAGT
AGACTTGCATACATAGAGACAAGCCCTGATCCTGTTCCTATTTCAAGGACACTTTGGCCTTCCTTTATCT
CAAGGTTTTCAGCTAATAGAAAAGTGTCATCTGAAGGGATGTATACTAAATCATCTGTTTCTATTTCAAA
TTTCCCCATTCTCATAATTTTGCCTGTAAATTTGTTTGATAAGATATTTAGAGTAGTTAGATTAATTAGA
ATTTTTAATCAATATTCAATTAATTATTTATAATTGGTCTTTTAAGAGTATAGTTAGTTCCATAATCTCT
TCTGGAGCTAAATTAATGGTTCGCTCTAATAGTATTTCTTTTATTCTTGGATTTTCATCTTCCAAATCGT
TTAAAATGCTTTTTAATTCCTTTTTATCTTTAAAGCCAATTATATGTCTGGAATCAATCAATGCATTTCT
TGCCTTCTTGTTTCTGTGTTGGAACAATGCCTTAACCACTTTCGAATATGTCTTATATGTTTCTTTATCT
ATTTCATATTCCTTATCATTGATTCTTATTGAATCAATATTCTTTGGCTTAAGTTGGATAACCGCCGAAT
CTACCTTTGGAGATGGAATGAATGACTCTGGAGATACCTTTGTTAAGAACTTGACATCTGCCTTAAAGTA
TAGCATTGCGCTAAGTCTTGAATATTGCTTTGTTCCCACCTTTCCATTCATTCTGTCTGCAAATTCCTTC
TGATACATGAGTATAGCAAGGTCAAAGTCGTGATTAAGGAACTTGAAGCTGATAGGTGAGGATATCTGAT
AAGGGAGGTTTGAGACTATCTTATTAAACTCTGGAAAGTCTACTTTAACTGCATCGCCGTTTATAAGCTC
AACATTATTGATTTTTTCCTTTTCTAGACGTTTTTTAAGGATATTAAAAATAGTCTCGTCTTGCTCTATG
GCAATTACTTTTTTTGCTCTTTTAGCAAGCTCTATTGTAAGAGTTCCTATTCCGGGGCCAATCTCTAGGA
CTGTATCCTCCTTTGTTAGATTTGCATAATTGATTATTTTCTTTCTTTTAAAGTCGTCGATAAGGTAATT
CTGTCCAAGGTTCTTGTTTAACTTAATATCATTTTCCTGAAGTATCCTTTTGGTTTGCTTTGCTAATGAT
ATTTCTTCCTTCAATTAATCACCTTAAAATTAGAATTTTAATTAATCCCCTTATTTAAAAAGAGTCAGAC
GGTTTTTAAGACTTTAAGATATTTCAATAATTATAAGATATTTCAAAATTTTTTTAAAATAATGATTGTA
AAAAAAGAAAAGTTAGAATGAGCAAGCTCATTCTGTTTTTGGTTTATTAGTTGCTTTATTATTAGCCTTA
TTATTAGGTTTTTTATTCCTATTTTTATTTGGCTTTCTGTTTCTGTTGTTCCTGTTTCTGTTGTTTCTTC
CTCTTCTATATCTCTTTTTATTGGAAGGATGTTTGCTTGGAACTTGAGTAAACATATAGTATTTTTTCTT
GCCTCTTTTCACTTGTGTGGTGTCGAGTTCAAGGCTTACTCTTTTTGCAAGCATGTCAACAGGATCTCCA
AGAAGAGGGACTCTCTTCTTTAGGTCTTCAAAGTCTTTGAAAGGCTCTTTCTTACGCTCTTCAAGAATCA
TTTGAGTATGTTTCTTGCCGATTCCTGGAATAAGCTCTAGCTTGTGCATCTTGATGTTTAAGGAATCTAT
TTCATTAAAGAACTTAATGTAAATCTCCTCTTTTGATTGGATGATTTCCTTAATTGCATATTCCAATTCG
ATTCTGCTTGTAGCAGTAAGCTTTTCATAATCAAGCAATCCCTTTACTCGGTTGATCTTGTCTCTTTTTC
CAGAACCTATGTAAACTTTTTCATGAATTTCCAAATCAATTCCTTGTTTTGGTGTGACTTCGATTAATGT
GAATTTATCAACGCCAAGAGCTTGTGCAATTGGCTTTCCACGAGCAGTTGGTCTTTCGGGATTTATATAT
CCAAATTTAAGATAATCTAATATAATCACATTTTCTTCTTTCTTTGGAGCAGGATTATCAATGTTTGGAT
TATCCATATTTTCACCTCTAATAATTGTCCTCAATTTTTTTTAATCTAATAATATTTTTCTCTTTTTATA
TTAATTTGTTAAACATTTGTTATTAATCTTTTTGTATTCTTATTAATTTTTTTAAATTATATTTATTTCG
AGTATTTAACAAATCATTTTTTTATTAATATAATAAGTATTAGTTTAATAGTATAAGTATTTTAAGTGTA
AATTTACTTATTTTTAATCAAATTTGATTATAATTTTCTAATTTTATTAATTTTTTAATTAATTTTTCAG
CGAATATTTGTTCTAATTTTATGAAATTAATTTAAATTAATCTAATAATTTGGTCTTAGAAAAATTGCTT
CATTAAATTAATTTAAATTAACTTATAATGAGTTGTTTTCACTTGTTTTTAAATTAAAAAAATTAAAAAT
GAATCTTAGAAATAATTCTAAGACTCAATTAAATCTATTTCTTGTTTCTATTCGGATTAACAAAACTATT
TTTATTTAATGGTCAATTTTCCACTCTTTGTTACAGATGCAAATTGATCATTACCTGCCCATTTTACAGT
AAAGCTATAAGTTCCTTTCTTGGATAGGCTTACATTTACGCTGGCTATACCTTTTGAATTGGTAGTTCCG
CTGTATGTCTTTCCGTTTACTGTAAAGCTTATCTTTTTGCCACTTACTGTATTTCCATGTTCGCTCTTGA
AGGTGGCAGTCAATGTCTTTGTCTTTGCACTTGCCTTATATGTTTTGCTTGCAGTGCTTAACTGTGGCTT
TTGAAGTTTTACAGTTATCTTAGCTACTTCAAATGCTCCAGTGTAATTGTCATCTCCAAGGAATCCTATT
GCAAAGGTGTAATCTCCCTTATAACCGAGGTTTATTTGAAGTTTTGCTCTTCCGTCTGCATCGGTTGTAC
GGTCGTATACGACTCCATTGAATCCTATTTTAATAGGCTTGTAGGCTAATGGCTTACCGGTTGCGTCTAT
TAGTCTGACATTGAAGTATTCTCCTGTTCTGCCATCTGCAGATGCCACTGCAGTTGTAACCATGTTTTCG
TATTCGAATGCAGTGTCTGTTCTGTTTGGAATGACATATACAATTTTTTCAACCTCAACAGGGACTTCCA
CGGTTTGGTTTACATAGACAATCTTCTCTATTTCAACCGGAACCTCTACTGTTTGGTTTACAATCTTTTC
AGTAACATTGTTTATGATAATTATTTCCATAGATGCCTTTGCAGTTGTGTTATTTGCATCAGTATAGCTT
ACCTTGATTGATGAATTTCCGCTGAAGCTAATGTTGGCCATTCCATTATTGTCTGTTTTTGCTTTGGATT
CTACTCCATTCACTTTTACTGTTAGCTCTGCATTTGCAACAGGCTTTGAATCGGAGTCCTTAAGGCTTGC
AATTACTGTGTTGTCATTTACCTTGGTCAATTCAAGGTCATATTCGGTTTTTTCGCTTTTCCCTTCAGCT
ATTCTAATGAATCCATAAGCTTCGCTGCTTAAATAATGATTGCTAGGTCCTATTTCTATTTTGCTTGTAT
CCAATCCATAGTAGCGTCCATAGATGATATAATCCTTAGTGATGTTTTTGAGTTCAATGCTTTTTACTCC
ATTTGTTGTGTTGAAGTCTCCATTTATTAGATATTTTCCGGTATTGTCGTAAATGCGAACTGTAATGATT
CCGTTTATTCCTTCATCATCAGGGCCTGTCAAGCTTATGTTGACAGTCAGGTCGCTTCCGGAGGTGACGT
CTCCATCTTCAATGCTCATGAAGCTTGGATAGATTACTAGGAATTCTGCATTGTTGTAGCTTGGAAGCCA
TCCTTCGCTATCGTCTCCTGTGTAGTTTAGTTCAATATTGTGGAGGCCATAGCCTAACTTTCCAAGGTCC
AATTCCACAGGATGTTGGATGTCATCGGTAGTGTTTACTTGGTAACTTGTCTTGTTGTCAAGGACAACAT
TTACAGTGCCTTTTATGGCTTTTCCAGATAGGTCAGCTAATTCTATGCCTACAATAACATTCTCTTCAGT
TGAATAGGTTCTTGCGACAGCGTCAACTCTTGTTTCCTTAGGGAATACTTCAAGGGTGCTTTCTTCTTCA
GTTGCTAGGTATTTGTAGTTTTTACCATTGTATACAGCTGAAATGTAGTATGTTCCTTCCTCTAGGTCGC
TAAGAGTTATTGTTTCGCTTCCTTTTATGGTAAACTCTTCATCATAGACAAATTCGACCTCATCTTCATC
CTCAACGTAGTTTTTGATATAAAGCTTGAAGTTTTCGTTGATTGGCTTTTTGACGATTCCGTCAAGGTAA
CTTAGGCTGGCCTTGATCTTTGCATCGTCACCGATAATGATATCTGAGCTTTCAAGGTCTATGATGGACT
CGGTTTCGTATCTGATTAGGTTTACTGATTCGCTTACGTTTACTCCATCTCTGATTTGGTATAGGAATGT
GGCATTGTTAGGGCCAAGCTGAAGGCCTTCTACAATGTGGTGGGAGTAACCATCTTCATCATAGTTAAGT
TCTAATGTTTTTACAAAGTTTCCATTTAGGTATAAGTCAATGCTTCCTTCTTCTGCTTCTTCAGATGGAT
TTAGTAGTTTTACACCCATTTCATATGAGTCTCCTACAAGTTTTTTCTCATCTTCTGGATTGAGGATGAT
TTGGTAGTTGTCTGGGTCATAGTTGCTTTTGACTGTGAAGTTGACTGCTTTTGTTATGATGTTAGTGTAT
TTTGGAACGCTGTCAATGCTTGCAACTTCCAATGAATAGTTTCCTTCCTGAAGGTTTTCAAAGATGATGT
TGTTATTTTGGCCCTCTACAACGTTTACCTTTTTAGAATCATAGTTTTCTCCATTCCTGTAAATCTCTAG
GTTAACCTTTTCAGTCATTTTGTTATTGAATTCATCCATTAAGCTTATTTTTGCAGTTATATCGTCTCCT
TCCACTAGATTTTCAAGTTCTGCTACACTGTAGTCTATGGTAAGATTTGCATATACCTTTTTGTTGTAGT
TGGTTCTGATAGAGAATTCCGGATTATCTAATTGGTTTCCTTCTGCATCTTCAAAAGTTACATCTAATTG
AGTTCCTTCATCTTCTATTCCACCAAAATCATCAAAAACCACGCCTTCATAAAAGAATATGACATAGTCT
CCTGGAGGCAAATAAATTGGAACGACATAGTCGGTGAGCCCGGTTGCTTCAAATGGATGATATATGTCGA
CATCTGTACTTTCACCATAAAAATTAATAAACCAGTCTCCGGAAACAGGCTCATAGTCTTGATCTGTAAA
ATTAAATATTATTTGTATTCTTTCTCCTTCAACAAAGATAGTTCCATTTTCAGACGGTGTAATTGTATAA
TCTGCATAGATTCCATCAATTCTATAATTTTCATCATCATCGTCATTTGTTATGCCGCCTTCCTCTTCTT
CTCCTTCATCATATAGTTTGTCCTTGGATTTATTTGCAATTTCATAGTTAGGCAAACTATCCTCAGATGC
TATCTGTTCATCATTTAAACTTACATCAGACACATCAATGCTATCAGATTGATAATCCGTGTCTATATCT
GTATTTATATCTTCGGATGCTGATGCCATTCCAATACCTATTATTAAAATGAAAAGTAATGAAATAAGAA
TCAAGCTTCCTTTTGTTTTAAAATTCATGTTTTTCCTCTATTTGTTTAATATTTGAATAATAATTCTTTA
AACTTTGTTTTAAAAGTTGTAATTATTATTTAAATGTTTTTTTCAATACTTAAAATTCATATGAATTTGA
TTAAAAGTATTAAAATTCTTATTTAAGAATTTTTTTTTAATATTATATTAATCTTATTATATTTTTTTAA
AAATGAATTTTAAGTTAAACAGGAAAATGATTGTTAAAAATAGTTTGTTGGGCATAATAAGTTTAAATTA
ATAAAATTCGTAGAAAAGGAGTTAAAGTTAGAAAATCAGTTTAAAAGTGTTAGAATTTAATAAAATAAGT
TTAAATAAGTAAAAATAAGAAAATTAGTTAAAAAAAGTAAAAAAAGTAGAAAAATATAATATGAAAAAGG
TGTTGATTAATAAAAATTATTCCTCAACATAAATTTCATATTTTTCAATAATTTCAAGAATTTGCTCCAT
ATCTTCTTTAGAAGGAGCGTTTCTTTCTTTTGCAAAAATTAATCTTAAGTCTGCCATGTCTCTTGGAAGC
AAGTCCGCTACACGGATTGCTTGTTTATGGGTCATGAATGCTTCAAGCTCTTCGATTAATTTTTCAGCAT
CTTCTAGGGAAAGTTTATTTAGATTAGTCACATGAGCTAAGGTCAAGTTCTGTTCATAGTTGAGCTCATA
TTTTTCTGAAAACTCTTCTAATATTTCTTTAACTTTAGCTGCTGGTATCGGTTCACTTTCTAATGTTTTT
TTCCCAATCATTGTACTCACTCTTTATTTTAAATTTTTTGGAGTATTGTAATTACTCTTGTAATTTTAAA
TGTTCTGGAGTAACTATTAATTCTTTTGCTTTATTACCATCTTTTAATGCAAGTATGTAAGCTTTACCTT
TTTTATCTACTACTTTAGCAGTTTTTCCATGGAATCTGGAATGAGGTTGGCCTTTTTGAATACTTGGGTC
GATGATAATGTGTACCATATCACCGTTTTCAAATTGCTGAATTCTTCTGGTGATCGGATTAGCACGACCA
GGTCTAACTTTCTTGGTCAATTTTTTTCTACTTCTACTTTTAAATCCTCTGGATCTTTGCATTTTTATAC
CTCTTTAAAATTAATTAATTGTGTATTAAAATATAAAACCCATCATTTTATATCTTTTTAAATAGCTAGT
AGCCAATAATAGTTATTTTTTTATTATTTTAGCCCTTCGGTTTAGCTATTCATGTAAAAGCCAATATATA
GTTGTTAATTTAGACTTAGCCCTAATCGTAGGTTTAATTGACTAGAACATATCCAAATTTTATATATTGA
AAGAAAAAAATATCAAAAATATAATAAAATTCTCATATATTTTAGTGACTAGATTTCAGCATTAATCTAA
TCTTCTATTTTTGATAGTAATAAAGTATATATTTTAAGATGTTAATAAACTTATTGTTTTTTAAAAATAG
TTTGTCCTTAGGCGAACACTTATGAAGAATTATTATTTAATATAAAAGAACATTTTAGGGATTATTATTT
AATCCCCACTTCAATCACATCAAGCTCTGCACATATGGCTTGAGTGCCTAAAACTTCACTTACGCTTGGA
TTGGACCTTCCCTCATCTGAAGAGATAAGCTCTTTTATGTACAATCCACCTTCGGTTTTAATGATCATTT
CAAAGGTCTTAGAGTCAATGAATTCTGCCTTTATTTCCTTGACTTCCTTTTGTCTTATCTTATCTGCCCT
TCTGTGGGAGACTCTTATAGGAGTTCTTTGCTGGATTATGTGAAGTGTTTGAAGCTTTTCAAGGTCTTCT
TCCTTGATGTAATCTTCGCATTTTACAAGAGCTCTGTAGACCTTATAGGTATCTGGAGATGACTCCTTTA
TTTCTGCCTTTCTTCTTCTTTCTGTAAACTTGAGATTAAGGTATTCTGTCTTTCCTTTTGCAGAGATTGC
AACTTCTTCTTCTATCTTTTTAAGGTCTATCTTTCTTATCTTTGGCTCTTTTATCTCAAGAACAAATGGC
CTGCCTGTTCCAAGCATTCTAACATCTATATCTTCCCTTCCGGCACCATGGAACTTGGCTTCGTATCCGT
TGGTGTGCTTTAGAACCACTTCAGAGAGCAGCTCTTCAACAGATTCTGGGTACTGCTTGCCTGTGAAATT
GCATTCCTCGCATCCTTTTCCTTTGCATTTTCTGCAAGGCCATTTGGTTTGAGGAATTGTTCTGATAAGC
TTTCTATATCTTCCTTCTATGAAGATTGGGTTTATCTGAAGGCGGACCTTGATTGGATTTTCAATGTCTT
CCTTTAATATTCTTCTAAAGTCAACCATTACAAGGACATCCTCTCCATCAAAGTCTACATTCTGCTCTAG
ATTTGATTCAAGGAGCTTGCCGATTTCTCTGTTGACTTCCTTTTTGATTATCTCAACATTGAAATCAAAT
TCGTCACTTATCTCTTGGTCCTTTTCCACTATTTCCTTTGGAAGCTTGCATCCCACTACAAAGGTGTCAA
ATTCCACCTTAAGGAGATCTATTTTTTCATTCACCAAATCAAGGACAGTGTTGAGGTCTTCAAATAAATC
ATTGCAGATTAGGCATTTTTCATCATTTGCAGGATTATCTTCATTTGCTTTGTAAGGCTCTAGATTAAGT
GCTTGTCTTATTTTAGCACCTCTATCTTCATTTCCATCTCCTTCAACACAGTCTGAGAATTTACGTCCTA
AACAGTGATTACAGATATTTCCATTTGTATGATTTATTAATTCTTCTGCTTTATTTAGTATTTCTTGATT
CAATTGAATTCCTCTCTAATAAATATGATTAAATAATTAAAATAAGATTATATCTAAAATGGCTATGTTT
TTAAATATATAAAAACAAGAATGATTTTATTTTTATAAAAAAAGAAAATTTAGGACCTATTGGTCCTTAA
TTCTATTATTATTGGTCTTTTTAAGGGTATTTGGATTTTCTTATTATGGTCTTTTAAAGGATATCTATGA
TTTCTATTATTATGGAGCCTATTTCATAAATTGACCCATAATCCTATTCATAGCTCCTCCACCCATTCCT
CTTCGTCCAATACCTTTCATAGCCTTTTTGGTATTGTTATAATATCTCAATAGCTCTTTTACATCGCTTT
CCTCTACGCCAGCGCCTCTAGCTATCCTTTGAATCCTGGATTGCTTGATTATCTTAGGATTGAGCATTTC
CTCTTCAGTCATAGAGGACATGATTATCTTAAATCCATTGATCTTATCCTCGGTCATCTGGCTTGCCTCT
TTTGGGATCTTTCCTCCAAGCCCTGGAATCATGTTCATGACCTGTTGCATAGGTCCCATGCTGTTCATCA
TCTCAAACTGGCTTCTCATATCCACTAGAGTGAACTTTCCGCTGAGCATATTGTTCATGGTCTTGGTGGC
TTCATCCTCATCAATCACTTCTTCAGCCTTTTCGATAAGGCTTCTGATGTCTCCCATTCCAAGGAGTCTT
GAAATGAATCTTTCAGGGTCAAATGCTTCAAAATCATCTATTCCTTCTCCGGTACCAATGAATTTGATTG
GCGCACCAGTTTCAGCTACTGCTGAGAGAGCGCCCCCACCCTTAGCTGTACCGTCTAATTTTGAAATGAT
GATTGAACCGATGTCAGTTGCTTGGGAGAATGCTTTAGCCTGTTCCCCTGCTTGCTGACCGATAGTTGCG
TCAATTACAAGCATGGATTCGCTTGGATTAATGATCTTGTCTAACTTGTTCATCTCTTCGATGAGGTCTT
CCTCATTCTTATGCCTACCTGCAGTATCGAAGATGATGATTTTTTGATTTTTAAAGTGTTTAAGACCTTT
TTCAGCTAAATCAAGTGCATCTTTATTGTCTGGGTCTCCGTAAAGTTGAATTTGCATTTCTTCAGTAAGC
TGCTTTAACTGCTCATATGCTGCAGGTCTCCAAGTGTCTGTACATACGACAGCTGGTGAGAAACCTTTTC
TTTGCAAGTATCTGCATAATTTGCCTATGGTGGTGGTTTTACCACTACCTTGCAATCCTAAGAAAAGGAT
TTTAAATGGCTTTTCTGTAATCTTAAGCTCTTGAGCTTCGCTTCCGAGGAGATTGACCATCTCTTCATAG
ATGATTGTGATTACATGTTCCCTTGGGGTTATTCCCTTTGGAGGCTCCTCTTCAAGTGCTCGCTTTTCGA
TTGTCTTTGATAATTTTAATACAAGCTGAATGTTTACGTCTGATTGAATTAAAGCCCTTTGAATGTCTTT
AACAACTTCTTTAATAACCTTCTTATCTATAACACTCATTCCAGCTAGCTTTTTCATGGTGTTTGTAAGG
TTTTCTCCTAAACTTCCTAACATGGACATAATATCTGCTCCGATATTGTTTTAAATGATAATTTTAATTA
ATTTAATTTTTTTCTAAATTTATTGTTCCAAGTGGAACATTTAATAGTTTATCTTATTAACTATTTTGTA
TAAATTAATATTATATAAAAGTTTATTTATCTTTTGTTATAAAATTATTGAATATAGGATATTTAAATTT
ATTCATTGGATTTTTGAAATTATAAAAATTTTTGAATTATTTATTTTATTCATGGGTTTTTGAATTTAAA
AAAATTTATTGAATTATTTAATTTATCATTGGATTTTAAAATAAGAAATTATTAAAATTTTTATTTAAAA
TCTTTAATTTTTATTTAGGGGTTTAAAAATGCTTGAAAATTTAGTTGAATCATTAAGAAATGCACCTGTT
GTTAAAAAAGGAGATTACGATTACTTCGTTCATGGAATAAGTGATGGAATACCTGCCCTTAATCCATGTG
TTCTAAAAGAGATTTCTGAAGTTCTCGCTGAAAGGATTGATTTGGATAAAGTCGATAAGATTGTTGGGGT
TGAAGCTATGGGAATTCACATTGCCACTGCTTTATCCTTAGAAACAGGCCTTCCATTGCTTGTTATCCGT
AAAAGGGAATATGGATTGGAAGGAGAGCATGAAATCTTAAAGCACACAGGATATGCAACTTCCAAATTAT
ACATCAATGACTTAAATGAAGGAGACAATATTGTCTTGGTGGATGATGTTGTAAGTACTGGAGGAACTCT
TTCTGTTGTAATAAATGAATTAAAGGCTATTGGTGTGAATATCCTTGATACATTTGTTGTAGTTGAAAAG
GGAGAAGGAAAAAAGATAGTTGAAGATAAAACTGGAGAAAATATTGTAACTCTTGTAAAATTGGATGTAG
TGGATGGAAAGGTTGTAGCTGATTCTTTAATCTAATAGTGGATGGATAGGTTGTAGTTAATTCTTTAATC
TAATCATTGCTTGTTTAAAAGTTATAACTATTTATTTATCCATTTATCTTTTATCCAGTTATCTTTTATC
AATTTATTCATTTATTTATTATTTATTTTTCATTGAATAGATTTAACTTCTATTCAAAAATATTTATTAC
TTTTTTTAATAATTAGCTTGTCTGATAAAATGTCAATATACGATATGGAATTAAAGAAGGTTATTCGAAA
GATTAACTCCTTAAATGTAAAGAATGTAGGTTTGCAGTTTCCGGAAGGTCTCAAGATGCAGGCGGTAGCT
ATTGCTCGAGAGATTGAAAAGAACACAGAGGCAAATGTAATTATATCTGCGGATCCCTGCTTTGGGGCAT
GTGATGTGTCAGATAGGAAAATGAATGGAATAGTTGACTTTATTGTTCATTATGGCCATACCCCCCTCCC
ACTTAGATATAGCATTCCTACAATGTTTATTGAGGCAAAGGCCAATGTGAATATAAAGCAATATTTAGAA
GATGCCTTGGAAATGCTTGAGGACTATTCTAAAGTGGCCATTGCAACAACAGCACAGCACCTACACTTGC
TTGATGAGATCGTTGACTTTTTAGAAGACCATGGAAAGGAAGTTGTAATAGGCTCTTCAAGAAGCACAAG
GAAAGGACAAGTATTGGGATGCAATTTCTCTTCAATCAAGAATCTGGGGGCAGATGTTTATCTGTTTATT
GGAAGCGGAAATTTCCATCCTTTAGGGATTTATATGTTTACAAATTCTCCTGTTTTGGCAATTGATCCTT
ATAGTGGCGACATTCGTGAAATGAGCGGATATGCAGATAGGATTCTTAGGATAAGGTTTGCTAGAATCGT
CAAGGCAAGGGAAGTTAAGAAATGGGGAATAATCGTTTCCTCAAAGGAAGGCCAATATCGGATGGCCTTG
GCTAAAGAGCTGAAAAAACTTCTTGAAGATGAGGGAATGGAAGCATTCATCCTTCTTATGGATCATATCA
ATCCAGATGTTCTTCTTCCGTATATGGAACTTGAAGGATTTGTTGTTACAGCATGCCCAAGGATAGCAAT
CGATGACTCTCAGATGTATAAGAAGCCTGTAATAACTCCAAAGGAGTTGGAGATAGTTCTAAATAAAAGG
GAATGGGAAAAGTATCAATTAGATGAGATATTATTTGAGGATCGTTATTATCAGTAATTCTCAATAATTT
TTGATTTTTTTTCGATAATAATTAATCATTATTAGTTATTTATTTATTCTCAGTTATTTTCAATTATTCT
CAATTTTCTTATTTTTTTTTAAATATCTTTTTTAATCAGTGATATTATGAATTTCGAATTCTCCATTCTT
GGATTGTTTTTATTATTGCTCCTATTTGTTCCAAACATAATCTGGACTAAATTTATCCCTAAAGATTATG
AAAATTATTCAAAGAGAGAAAATAAGATATTGTTAATCCTTGAACGTATTGGTGAAGTGGCAACTGTTGT
ATTTGCCTTGTTTTGCGGTGCTAAATTTAGCTGGTCATTATTATTAATTATTATTTTTATTCTAATGGCT
TTGTATGAGGTTTATTGGATTAGATACTTTATGTCAAGCCATACAATGAAGGATATGTGTGATAGTCTTT
TAATGATTCCCCTTCCAGGTGCCACATTGCCTGTAATTGCATTCTTTTTGTTTGGAATCTATTCAAATAG
CATATTTTTAGTTATATCTTCAATTATTTTGGCAATTGGACATATTGGTATTCATTATAATCATAAAAAG
CAGTGTAATCTTAATTAAGGCTTTTAATCTTCCAATATAAAAAACATTATTTTATTTAAAATTTTCTAAA
AACCGAATTTTTTATATATTACTAAAAAACATAAATAATTTACATATAAATAATTTAATTTTATGGATGA
TAAGTTATTTCAAATCAATTTCATAAATTTAATGCTTTTATGAATGTGAATTTACTTAATTTAATTTCAT
ATAATTTATAAAAATTTTATAAATGGAATTATAAAATTTGCTTGGATGGATTGTCCCTATTTTATAAACG
GAGTTATGAAATTTATTTTTGGAGAATCTATCTATTAACAAACTAAAATTTAGGGCAATGCCCTATCATG
AGGTGTTTAGATGAAAGTAGAATCTGGAGATTTTGTAATGCCTGGCGACTTTTTAAGTGTAAGTGAAGAA
TTCCTGCCAGGTCCTGGAGCATATGAAGATGATGGAAGTGTTAAATCAGGTGTTCCTGGAAATGTATTTG
TTGATAATGGTGAAAAGGAAATCTCTGTAATTTCAAAATCCGGCGGTCCAAACTTATTGAAGGTTGGAGA
TATTGTATATGGTGAAGTGAAGGACGTTCGTGGCCAAAGAGCCTTGATTAGTGTATACGCTAAAAAGGGA
ACCGATCGTCAATTGGCTCTTCCTTATATGGCAGCTATTCACATTTCTCAAGTGACTCCTGGATATATTG
ACAAGCTTACTGACGCTTTTAGAATCGGAGATTTGATTGAAGCAAAAGTAGTTAAGATTATGGGAGATAA
TTTGGACTTGAATACTGAAGACATTACTTCTGGTGTTGTTAAGGCTATGTGTACAAGATGCAGAGCATTT
ATGGAGCCTCGTACAGAGTCTGAAGTATACTGTCCGGTATGCAATAGAAAGGAAAAAAGAAAGGTTTCAA
AGAATTATGATTATTAATTTCAATAATGGTTGTTTGAATTATTGAATTAACTTTCATATTTTTATATTTA
TTTGTAATTTATTTGCAATTTAACTGTTAATCTATTTATTTTAAAGGAAAAGGTATTATGGAAATTGAAG
TTATTAAAGAATCAAAATTAGAACTTGAAATGATTATTCATGGTGAAAACCACTCTCTTTGTAATGTCTT
AAGAAAATATCTTATGGAAGATGATGATGTGGAATATGCGGTTTACGGAATCGATCACCCTCTTACAGGT
GCAGGTAAGCCGGTTATGACCATCAAGACCAAAAGATCAAAAAGACCTAGAAACTCTCTTTTAAAAGCAG
CTACAAGATTAAAAGAAGAAACTGCTGAATTTAAAGAGTTAATTGAAGAATTATAATTCTTCATTTTTTT
CTATCTTTTTTTATATATTTTTTTATAAATTTTATTATTATCAAGTTACTTATTTTATTTAAGATTTAAT
TTATCAATATTTATTTATTTAAGGTTTAATTTATTAATTTATATTAATTTGGGGTGTGATTATGGCTTAT
AAGATTCCATCTTTAACTGTAGACATATTTATTTTTAACGATGAGAAAGAGTTTATACTAATTAAACGTA
AAAATGACCCTTATAAGGATTTCTGGGCATTGCCTGGTGGTTTTGTCGATTATGGTGAGACAACAGAGCA
TGCAGCTGTCCGTGAAGCTAAAGAAGAGACAAGCATTGATGTTGAATTGATTAAACTCTTCAATGTCTAT
TCAGACCCTGATAGAGATCCAAGAAGACACACAGTAAGCGTATTCTATTTAGCTCATGGAGATATGAATG
ATGCCAAGGCAGATGATGATGCAAAGGACATTGGCATTTTCTCATTTGATGACTTGGATAATTTAGATCT
TGCCTTTGATCATAGGATGATTTTAAATCAGGTCAAAGAGTATTTTGATAAGGAATAATCGATTCATAAA
AGTTTGATAAATATTATCAATTCACAAAGTATTATTTTAACTATTTTTTTCCAAATTTATTTTTTATATT
TTTTTAATTTTTATAAATTTTTATAAATCTCATCAAGTTTTTCATTGAAAAATTTATTTATTTTTTATAA
ATTTTTATAAATCTCATCAAGTTTTTCATTGAAAAATTTATTTATTTTTTATTCTAGTTTCAAGAAGAAT
TTCATTAATTTTTCAATCAAATATTTTAAATTTTTTACCATTTATCCATTGACTTAATCAAATGATTTAT
TATAATTTTTTACTAAATTTTTACTATTTTTTATAATTTTTACCCATTTTTTACCCTATTTTTAAATTAA
GTTTATATACTATGAAATAAAAAACCTTAATTATTATATAATTAGTTAGATTAAGTCATCTGCAATTAAT
TTAGATTTTTTTAGCAAAAACAATTTGAAATCTTTGCTAATTTTTTAAAATTCAAAATCTTTCAGGATTA
ATTTTTTATTATTCTGATTTGGTAGATGGCAATAAGAAAAATACTTATAATTAATTCTATTCTATTTGGT
AGAGGAGGTTAATTGATGGAGTTCTGTCCAAAGTGTAATGGTATGATGATGAACACAACTGTCAAGGTTA
AAAAAGAAGACCTTGAAGAAAAAGTTGATGAAGAAAATCAATCAAACCAAGAAACAGAAGAAGAAAAAGT
TGTTTTTAAATGCATGACTTGTGGCTATGAAAAAGACCCTTCTGAAGTTGATCAGGACCAATATAAAGTT
AAGGAAACAGTAGAATCCAGTGATAGTGTTATTATGAGAGGAGATGAAAGCGGAATGCGCTCTACTGTAA
GAGAGATTTGTCCTAAATGCGGTCACGATCGTGCTTCCTATGAATTGTTACAAACCCGTAGTGCTGATGA
GGCACCAACCAGGTTCTTTACTTGTGAAAAATGTCATCACAAGTGGAGAGGATATGATTAAGTAATTAAA
CGGCTTTAATTATTAGGTCTTATCCATTAAAATTTATTTTTAAACTAAAATTACTATTAGTTTATATTCA
AATAATTTATAATTAATTTATCAATTAAGATTAATTAAATCAATTAAAATCAATTAAATCAATTTAATCC
TTTTAAGGATTTAATTCATATTTATTATTCATTTTAAGTAAATTGTGATTTTCTAGAAAGTATTAATTCT
AGATTTTTTAAGTAAGGAGATAAAATGTCTAATTCGCAAAATGATGGTTTAGAAGATGTTTCCAAGGGAA
ACAATGAATCTGCTGGTGAAAATACAGATTCAACTTCTAATAAAAAAACTAGATTTACTAAATCTAAATC
TATTTCAGAGGTTTTTAAGGAATTAGATTCTCAGGAAACCAATGATTCCATCTTAGATTCTGAAGATGCT
GCTTCTGAATTAGAATCTGAAGATAAATATTCTAATATAGAAAATTATCTTTCCGAGGCAGAATCTGAAG
AAGAAATTTTAGATGCTTCTTCTGAGGCAGAATCTTTAGATGCTAGTTCTGATGTAGAATTTGAAGAGGA
TATTATTATCGATTCTACTGCAGAAGAAGAAATAGATGAAATTATTCCTATTCATAATGAATATAAGGAT
TTAGATGAATCTGAAGCTTTCAATACAGAATCTATTGATGAAGAAGAAATTTCAGAATCTTCTGAATTGG
ATAATTATGTTGAAAGCATTGTTAATGAAAAAGATGACTTAAGCTCTGATGAACTTGTCGATTCTAAAGA
AAACTTAGATGCTGTCGGTGGAGATGAAGGCTCTATGAGCGTTAAAGATATCGAAAACGCTTCATTTGAA
GCTGAAGATACCTCATTAGATGCTGAAGATTACGAAGATGACTCTATTGACAGTGAGGATATCGATCAAT
CTTATGAAGAAGAGCTTCTTGATGAGAATATGAAAGTTATAAAGGTAAATAATGCTTCTTCAGAGGATGT
TTTATCAAAGAAAAATAAAGGATTCCTTAGCTCTTTCGGGTCTATAAAAATGGATTCTTCCTTTATTATC
ACAGTTCTTAGTTTCATTGTTGGACTGGGAATTTTAATCATGGGTATATTCTATCTCAACTCCAGTTCTG
ATAGAGTTGTAGATAATGTTTTATCTGGTGAAACTGCAGGTCTTGCAGTCTTTTTAATTATCATTGGTCT
TTTAATTATCGGTTTCAGTATTTTAAGATTCCTTTCTTCTACAAAGGCCGATCAGTCTTCTTCTATGCTG
GATATGTTTAAAAGCATAAGGGACATCGACTATGATGATGTTAAAGATGATAATATAAGTCGCGATGACT
TTGATTCTGTATTTTCTAGCGTTTTTGGCAAAGAAAAACGCTCTGATTTTTCCAACGACGATGGCGATAA
AAGCTCTGTTGATAAAAACCTTTTTGATGAGGATGACGAAATATCCGATGAAGATATTGATGCCTTATAT
TCCGACTCAAATTTAAATAAAACTGCTTCTTCTACTAAAAATTCAACAGGCATTCAAGACACTGACAATA
TAATTGAAGAGGATCTTGATGACGATTTTGATATGATTGATTCCGATAATTCCGAGGATTTTGATAACGA
TACTGATTTAGAGGATGATAATGTGTCTGATTTAAAAGATAAATATTCTAAATACAATTTCGATGATGAT
GATGCTCCATCCAAACCTCAGTTTAAAAAATCAGTGGACATTTCAAAATTCGATGATGATGGTTTATCTG
AAGAGGAATTGGAAGCTGAAAGAAGAAGAAAAGCGGAAGAATTGGAAGAAAAGAAAAGAAGAATCATCCA
AGGAACTAATTTTGATAATAGCTTAAGAAAATAAGAGTTTTCTCTTATTTTCATTTATTTTGGATTTCTT
AGTTATTTTAGATACCTTCGGATTCTATTGGCTTTTTGTAGTCTGTTTTAGGTATCTCTAGTCTATTTTA
TCTAAATTTTATAAGTTTTTTTTACTATTTTTAACAATATTTTCCAAAAAGGAAAATCTTTTTATACTAT
CAAATTCCATAAATTATTTGTTTTTCATAAAATTTTTTCATAGCTAAAGTTAAATATTTTGCCATATTAT
AAAATTTTATAAATGATGAATTACTAAATTTTAATTATAATAAAAATATGAAAAACATATTTTTAAAAAA
TTATTATTAAGGCATTAATTAATTATATTTATAATTTATAAGATATAGCAATGCTTAAATTAAATCAAGA
GATGATTTATAATGTTTAAAGCTGAGTTAAGTGATTCTAGTATTTTAAAAAGCAGTTTTGATGCTATTTC
ATCTATTGTAGATGAAGTGCAGATTCAAACTGACAGTGAAGGTTTTCGTTTAGATGCCTTAGACCGTAGT
CATATTACATTTGTTCATTTAGAACTTAAAGCAAGTTTATTTGATGAATTTGTTTGTGATGAACCTGAAA
AAATTAATATTGACACTGATGAATTGATGAAAGTATTAAAACGTTCCAAATCCGATGATCGCGTATTGAT
GTCATTGGATGAAGGTAACTTTATCCTTACCTTTGAAGGAGAAGCTACCAGGACTTTTAAAATCAGATTG
ATTGATATTGAATATGACTCTCCAGCACCTCCATCCTTGAACTATCCTACTGAATTTGAGATTCCATTCT
CTCTTTTAAAGGATTCCATTCAAGATATGGATATTTTCTCTGATAAAATCACTTTAATGGTAGATCCAGA
GTACTTTAAAGCATTTGCTCAAGGTGAATTCGGAGATGCAAATATTGAATATCTTCACGGTGAAAAGATA
GATGCAAGCGCTAAATCCATTTTCTCTTTAGAAAAGATAAGAGAAATGCTTAAGGCAGATAAATTTTCTG
ATATCGTTAACATCAGCCTTGGAGATGACATGCCTGTAACCTTAACCTTAAGAAGAGTTGCAAATGATGG
TGAGCTTAGTTTTTTGCTTGCTCCAAGGATAGAATCAGAAGAATAGATTGTTTAATTCATTTAGTTTATT
TAAATCGATTATGATTAGATTTTAAAAGATGTTTTAAACAAAGGATTTAGTTGAATAAATTAATTTTAAA
TTAATTTATTCTTTTTTTTTATTTTATTAATTACTTTAATTTACATTTATGCACATACACATAAAACTTT
ATTATTATTAAGATTTATTAATACTTTATTTTTAAGATGATTTCTATGGATGGAGACTTTTTTCAATTAT
TGCGAAGGGTTCAAAAGGAGGAACGGACTAAATCCACTTTAGCAAGAGTGGATAAAGATTTCTATAAACA
ACTCTATTCCTATATTAGAGATTTAGAACGTTCTGTTGCTCAAAATCCTTTCGATACTGCTCAATCAAAT
CTATTGAACAATGCTCAAAGGATTGCTACTGAGATTTGTCAATGGAGAGAATCAAAGATCAGTACGGCTG
CAAACAATAATATTTATAGGTCTTTCCATCTTTTCAAAAAAGGAAACCCTCAGTTTGATTTGATTGATAC
AACTCCATTGCATCTTACACCTGAAGAGGAAACTTTATATTTCGCCTTGATGGACGCTCTTAAGACTCAT
AGATATAATATTTCATTGGACAAATTCGGGGATGAAAAAGCCGATTGGGGTGCTGATGATTATGAGGACG
AAGAAGAGGATGATTTTGAAGAAGTCGCTTCCGTTGTAAAAAGCCGTGTTAATAAAGGGGTTGTTTCTGA
TGAAGAGTTCTTCAATGAGGGGGGTTCTTCTAATGAGTCCGTTACTGATGGATTCAGTGGAGAGTCTATT
TCCATTGAAGAGTCCGGTGCTGATCCTGTAGTTCAAGAGCCTGCTGTAGAAACTCCTGTTGAAGAAAGTT
CTGGCAGTGGTTTTAAGCAAGAAGTTCAAGAGTCTGCTGTAGAAACTACTAATACCAATGTAGGTGGATC
TGATGAGGTTTTAGATAGGTTAAATCAAATTAAAAATTCAACTGTTGTTACAGATGAAAAATACGAACCT
ATTGAAAAGCAAATCAATAATCAGGCTAAAGTAGTTCCAAATGTCTCCATGTCTAATAATCTTAATTATG
AAAGTAAAAATTATAATGGTCAAGATAATGAGTTTGATTCTAAACTTAAACCAGATTATGAATCTGATGT
AGAATCAGAACCTAAAATAGAGTCTAAACCTAAGGTAGAATCTGCACCTAGAATTGAGTCTAAACCTAAG
GTAGAATCTGCACCTAAAATAGAGTCTGAACCTAGATTAGAGTCTAAACCTAAAGTAGGATCCGAACCTA
GAGTGGAGTCTAAACCTAAAGTAGAGCCTAAAACTATCGAAGATAGGCCTAAAAGGAAAAGTTCATCAAC
ATTAGACTTTGACAGCATCTTTGCAAATCCAGACAGTCAATTTGATAGCATACACAATTTTGAACCTGAT
TATGAAGCGGATTTAGCAAACATTCAAGCAAGTTCCAGTTTTGCAGAGCCTAGCGAAGCAGATTTAATGT
TTTCAACAAAACCTAGGCCTAAAAAAGAGCCTAAACCTAAATCTCAAGTTGGATCTAAAGAAGAGTTCGA
ATCTAGACCTAAAGTAGAAGAACCAAGTCATGCTCCAACTGCTAAAGCAGAAAGACCAAGATCTCAATCT
ATAAAAGCTTTTGCTAAAAAGGAAGAATTGGAAAACACTACAGTTGTAATATACAAAAATATTGATTCAT
TTATGGGAATTGATGAAAAGATTTATGGTCCTTTTATAGCAAATGATGTGGTTATTTTACCAAATATAAC
TGCACAAATACTTATAGACAATAATAAGGCAGGTCTAATTGATATTTAAATAAATATTAATTCTTTATAT
TTTTTATCAAAAAGACTCTTTTAAACTATTTTTTCTATTTTAATACCAAAGGTTTAAATATAGTTATTAA
ACATATATAATTAATGTATCTATAATAAAGATATTTTCTTATTTTAAAATATTTATTAATAGATTAGATT
TTTATTAATCTTATAAGATTTTTAATCTTAGTTCAATTAGATAAGATTTACAATCTTTTTTTTATTAGTT
TAACAAAAAACTAATAACTCTATGTATGAATAAGGAAATAATAGATGCTCTCTTGCTTTTGAGATACTTA
AAAGGTTCTTAAAGGTTTGCAGGATTATCCTCATGCAATTTAGAAACCTAAACAGTTCTAAGTGGTATGT
TGTAATTATATATTATAAAAATCCGTTTGGATTATCAGATAAGGTGATATTTATGAAGATGCCTAAAGAA
AAAAGAACATACTGTCCACATTGTAAAAGACACACTATTCACGAAGTACACACTTCCAAAAAGAGAAAAG
CTAGTGAATTAAAATGGGGACAAAGACAATTCAGAAGAGTTACCGCAGGGTACAGAGGTTATCCAAGACC
ATTGCCAGGTGGTAACAAGCCGGTTAAGAAATTAGATTTAAGATACAAATGTAAAGAATGTGGAAAATCC
CACATCAGAAAATCTTTCAGAGTAGGAAAACCTGAATGGGTATCTAACTAAGGTGATTTGTATGGCTAGT
AATGGTAGAGGAAACTTTTTAAGAGTTAAATGTTTAGATTGTGACAACGAACAAATCATTTTCGATCGTG
CAGCTTCTGATGTAAAATGTATCATCTGCGGTAAAACCATTGTTAAATCCCGTGGAGGAAAAGCTAAAAT
CATGGCTCACATCGATGAAGTTTTAGATTAAGTTCAAGGTTATTTCTAATTAATCAATTAAAAGCAAGAA
TTTATTCATTTAATTTAAATCTAATGATTAAATTACTGCTTGTTTTTTAATTTCGATTAATTATTATGTG
ATTTATAAATTAAGACTCTAGAAGTCTTAACTATTTTTATATTTCGGTGTTTTAATTGGTAAGAAAAAGT
CAAGAATGGCCAAATGAAGGAGAACTTATTGTAGGAACTGTATATAAAGTTCTTAACTATGGTGCATTCG
CTAATTTAGAAGAATACGCAGGTAAAGAAGCTTTTATTCATATTTCTGAAGTTTCTTCTGGTTGGGTTAA
AAATATCCGAGATCATGTAAGAGAAAATCAAAAGATTGTAGCTCGTGTTTTAAGGGTTAATCCTAAAAAG
GGTCATGTAGACGCTTCCTTAAAAAGAATCAGGGAAGACCAAAGGACCAAAAAGATTCAGCAATGGAAAA
TTGAACAGAAAGCTGAAAAATTCTTGGAACTTGCTGCTAAATCTTTAGATAAGGACTTAGATACTGCTTA
TGATGAAGTAGGCTATGAGCTTATGGATATCTTTGGAGATATCTATGGCGCTTTTGAAAGTGCAGCTGAA
GAAGGAGCTGAAACTCTTACTGAAGAGGGCATTAGCCAAGAGTGGGCTGATGCAATCACTGAAGTGGCTG
TCAAGAACATTCAACCTCCTGAAGTTCACATTACAGGATATGTTGACATTGAAAGCTATGCTCCACATGG
AGTGGAAATCATTAGGGAAGCCCTTTTAGCAGCTGAAGACGAAAATATTGAAGTTCAATGTGTTGGAGCT
CCTCGTTACAGAATCACTGTAACTTCCACTGACTATAAGCTTGCAGAAGGTCAATTGAAAGAGGCCGCCA
ATAAGGCTATTGACATTGTCATTGAAAACGGTGGAAAAGGAGAATTCTTACGTGAAATTGATAATTAATT
GTGAATCAGATGAAAATGAAAATGAAAAAGTGTCCTGTTTGCAATATTTACACACTAAAGCCTCAATGCC
CTAATTGCGGCGGAGAGTTAAGGGTGATTTATCCTCCTAAATTCTCAGTTGAGGACAAGTACGGTAAATA
TAGAAGACAATTAAAAAAAGAGATGCTTAATAAGGAATAATAATAGGCTTGATGAAATGATCTTTTCAAT
AGATTCATTGAATTGATATCTCTCAAGATTATTGGTCTTTTCAATAGTTTCATTGAATTGATATCTCTCA
AGATTATTGGTCTTTTCAATAGTTTCATTGAATTGATTCTCTCAAGATTATTATCCTATTTTTATTTTTT
TCTATTTTTATCTATTTTTATCTATTATGCTTAATTTTATCCTAATGGGGTGATTTTATGAGAACAACCC
AATTTAAAGTATTAGAAGAAGTTAAATTAAACAATCCAATATTTATTGAAGCACTTCCTGGTGTCGGTCA
TGTAGGAAAATTAGCTATTGACCATGTAATTGATGAATTGGAAGCCACTAAATTTGTAGAGATTTATTCT
CCATACTTCCCTCCTCAAGTTCTTGTTGGAGAAGGCGGAATTGTTGAAGATATGAAGAATGAATTATACT
ACTTGAAATCTGCTGGCGGAGACGAAAGGGATTTCATTTTCCTTGTTGGAAACTGTCAAGGATTAAATCC
TGAAGGTCAATACGAACTCTGTGGTTCCATACTTGATTTTGTAGAGTCTCTTGGAGCAAAAGAGTTTTAC
ACATTAGGAGGCCTTGCTACCGGTCAGCCTTTAGAAGGTGTAGAAGACCGTGTTTTAGGTGCTGCTACTG
ATGAGGAACGTATTGAAATGCTCAAAGAAGCAGATATTGAAATCAGATCTGCTGATGGCGGTATTGTAGG
TGCTTCTGGTTTATTCTTAGGATTAGGAAGACTTAGAGGTATGAAAGGCGCTTGCTTAATGGGCAAAACC
CCTGGCTATTTCATTGATGCTGAAGCTGCTGAAGCCATTTTGGCAAAATTAGCTATCCTTGTAAAGCTTG
AGGTCAGCACTGACGAGTTAGAGGAAAGAGCTAATGAGATTCGTGAAATGATCAATAAGGCTCAAGAGAT
GGAGCAGGAAATGATCAATAGGGCTATGGGCCAACAGCAAGCACAAACTCAAGACGACCTTAGATATATC
GGTTAAACTTTTAGAAAAAGTTTAATCAAAATATTTTTTTTATAAACTGCTTAAAACTTTTATTTTAAAC
AAATAGCTATTCAGCTATTTTCTTTTTTTATTTTTCTACTTTTTTTAATCTTTTTAAGATTCTTTATATT
CAATAAGATTTTCATAATTTTCACAATTGTTCTATAACAATAAAACTACTTTTTAAATAATTTTTTATAC
TTTTAAAATCAAATATTATACAGTATTATAATAATAAACAAAACAATTCAATTTAATAATAATTAATTTA
AACAATTAGGAATGATATTATGCTTCAAATTGCAGTAACAGGTAAACCAAATGTAGGAAAGTCTTCTTTT
TTTAATTCAGCCACTGCATCTCAAGTAGAAATGGCTAACTATCCATTCACAACCATAGATGCAAATAAGG
CTGTAGGTCATGTCATCAGTGAATGCCCATGTAAGGAATTAGGGGTCACATGCAATCCAAACAACTCCCA
ATGTATAGATGGAACAAGATTGATTCCAATAGAGCTTATAGATGTAGCAGGACTTGTTCCAGGGGCTCAT
GAAGGTAAAGGTTTAGGAAACAAGTTCTTGGATGACTTGATGCAAGCTAAGGTATTCATCCATGTAATAG
ATGCCTCAGGAGGTACCGATGCAGAGGGAAACCCAGTGGAACTAGGCTCCCACGACCCATTGGAAGACAT
TGAATTCCTTGAGCATGAGATAGTCATGTGGATGTATGGAATCGTCAGCAAAAACTGGGTAAGGCTTATC
CGTAAGGTTGAAGCAGAGCACTTAGACTTTTCTAAGGTCATATTTGAGCAACTGTCAGGTACAGGTATCC
TAATTGAAGATGTAATAGAAGCTTTAAGAACTGTAAGTCCTGATTATGGAAAATGGGAAGATGAAGACCT
TATAGAATTTGTAAGAAACCTTTTAAACATTGCAAAGCCATCAATCGTCATTGCAAATAAGGCAGATCTT
CCTGGAGCAAAGGAAAACATTGAAAGGATGAAGGAAAAGTATCCTCGTGTCATTGCAACATCTGCTGAAT
CTGAGCTTGCATTGGTAAATGCAACAAGGGCCGGGCTCATCTCATACATCTCAGGAGACAACAGCTTTGA
AATCCTAGAGAAGGACAAGCTAAACCCTAATCAAATCAAGGCATTGGAATACATTCAAACAAACATTCTT
GACGTTTATGGAAGCACTGGAATTCAAGAGGCATTAAACACTGCTGTATTTGAGCTTTTAAATATGATAG
TGGTTTATCCGGTTGGGGATGAGCATAAGTTCACTGACCAAAAGGGAAATGTGTTGCCTGATGCTTTCCT
AGTTCCTAAAGGTTCCACACCACGTGAATTTGCATATATCATTCACACAGACATTGGTGATAAGTTTATG
CATGCAGTGGACGCTAGGAAGAATATGAGAATTGCAAGCGATTATGAAATCCAAGATAGAGACATTATTA
AGATTGTAACTAGATAATTTGATAATTAAAATACTTTAGAATTTATTTAGAGGATATTAGGATACAATTT
ATTTAAGGAAGGTTATTATTATGATGCATCCACGTCCAAGTCCAATTGCCGCTTCTTTATACACTTTAAG
AGATTTAAATGCAGATGTAATTATTATGCACGGTCCTCATGGCTGCTGCTTTAGAACAGGAAGGCTCCTT
GAAAGCGATGGGGTAAGAGTTGTCACAACTGCTATGGCTGAGAATGATTTCATATTAGGAGCTGCAGACA
AGCTAGAGGAAACATTGCAGGAGGCTTATGACACATTCAATCCTAAATTGATAGGAATTGTAGGAACATG
TGCAAGCATGATCATCGGCGAAGACCTGAAGGAGCCGATTGAAAACTTAAATCTTGATGCTGTTGTCATA
CCTGTAGAGTCTCACGGAGGCTTTGGAGAGGGAGACAATACAGAAGGTGCTATTGCAGTGCTTAACGCTG
CTGTAGAATGTGGTGTCATTCCTCAAGAGGAAGCAGACAGGCAAAATGAGATGCTTCGTTTAGCAACTGT
GGTTGAAAAAACAAGAGGCATGGCTCAGGGAAAGTATATAAAGCCTAATTTTGGAGACAATAAGGAAAAA
GTTGCAAAGATTGTTGTAAAAGCAGTAAAAGAAGGAAAAAATGTTGCATTTGTATTAAATGCGAAAAAAG
AAACTTCATATCTTTTTGCAGACATTTTAAATTGCGATTTCTCTAAACTTTTCCAAGATACTGATTCAAA
TATAAAGTCCAATAAAGATATAGAAAACCTTCATTTCATTGCAAATCTGGATGAGAACATCGGCCTTCCA
AGAATAAGGCAGCATGCAGTAAATATTACAAAAGAACTGAATGAAACAGGAATAGATATTGAATGCATCA
CAGGTGGCCTTGATGAGTATCCAATCACTCCAAGAAAGGCAGAAGAGTATCTTAACGAGCTAAATCCTGA
TCTTGTTATCGTTGCAGGAGTTCCACATGCATTGTATGTAGAGGAGCTTGACTGTGAAACCATTGCAGTT
ACAGATGGTCCTAGACTTGTTCAGCCACTTAATGAATTAGGCTATTCTCATGTAATAGCAGAACTTGATG
CCCATTCTAAGACATTAGGTGTAGATGAGATAGTTGATTCAGACTTTGGTATGATGATACGTTCAGCTAT
TGAATGGGAGCTTGAATAAAATGGATAGTTATATGTAAATCTATCATTTTAATCAATCGTTATTTTAATT
AAAATATAATTAATTTTTTTTATAAAAGTTATATATGGTAAACCAAATAAAAAAGTTTTAGGTAATTTTC
ATGATTACAATTATTGATTATAAAAGCGGAAATCTTAGAAGCATTTCCAATAGTTTTAAAAAGATAGGTT
CAAAAGCAGTCATAACAAGCAATCCCGAGGACATTGCAAATGCTAATCATTTAGTTCTTCCAGGGGTAGG
TGCCTTTGGAACAGCTATGGAAAACATTGAGCCATACAAGGATTTGATTTATGAGCATATCGATGATGGA
AAGCCATTTTTAGGAATCTGTTTAGGGCTTCAAGTGCTCTTGTCCTCAAGCGATGAGACTCCTGGAGTCA
AAGGCCTTGATATATTTAAGGGGCATGTTGAAAAGATTCCCGAAGGCAGGAAGATTCCTCATATGGGTTG
GAATCAGTTAAAACAAGTCAAGCCATGTCCTATACTTGATGGTGTGGATGGCAAGGACTTTTACTTTGTA
CATTCCTATTATGCAGTTCTTGATGATGAAAGCAATTTGTCTGGAATCTGTGATTATGGTGTTGACTTGA
CTGCATCAGTTTCAAGGGATAATGTATTTGCTACCCAGTTCCACCCTGAAAAAAGTGGAGTTCCAGGCTT
AAAAATCCTTAAAAACTTTGTAAATTTAGAATAATTTTATTCTACTTTTTTTAAATCCTTTTTTTCTTTA
TTTTTTCAATCTCGAATCAATTTTCTAATGTTCAATCTTTTTGATTGAACTTAGATTATTTTTTAATTTT
TATTATTTTATCTGATTTTAATTTCTCATAATTATTTAGTAAATTTTATAAATAACTGTGCACATACTAG
TTTTGGGGGAGATAATATGGGAAAATTTAAATTTATATTTATTCTAGTTTTAGCTCTATTTTTAATATGT
GGAATTGCTGCAGTTGTAGATGCGCCTGATTCCTTTGATGGCTCTTTAAATCTTATACCTGTTTCTGATT
CTAGTGTAAGTCAGTCTGATTCATCAGTAAATCAGTCTGATTGTGAAAATGGGACTTGTTCAGTTGACTT
AAACAAATCTGAGGATAATTCTTCTAAAGAAACTTCAGATGATGAAATTGATTATGATTCAAAGTATTAT
GACGATTCTTTGATTGATGGATTGTATTTCTGCAATGACCTAGAGCATGCATTTAAGGATGCTAAACAAC
ATCATAAGAATGTGATGATCATTTTTGACGGAGCAGCCTGCATTTACTGCGAATATCTTAAGGATGAAGG
ATTGACAGATTCAGATATTCAAAAGGAAATAAATGAGAATGATATCCTACTTATGACTTATACCAGCGAT
AGCCCAGAGCTTTCTCAAAAATTGGAGATTTATGGAACTCCAACAACTGTAATATTTGATGAAAATGGAA
CTGAGTTAGGAAGAATCGAGGGCTATGAGTCTCCAGAGCAATTCTTAAGTGAACTGAAAGAGTATAATGG
CAAATAATCAGATTTAGTGGACTTTAAAAAATAAATTTATTTATAGTAGGGAGAGTTAAAATGGAGATAA
TGCCTATTATTTCATTTTTTATAGGGGTAATTTCAATATTATCTCCTTGCATTCTGCCTACCTTGCCAAT
AATTGCAGGATTTAGCCTAAAAGCCGAATCAAAAGCAGAAATAGTGGCCTTCATATTAGGGCTATTTAGC
ATATTCACAATCATTATATTCCTGACAGGATTCTTTACAACTATTCTTTTTAGGTATATTGTTTATGTAA
GGGTCATTGCCGCATTTCTTTTGCTCATTATGGGAATATTGATGTTTTTTGACTATAATCTATCTTTTGG
ATCGGTTAAGTCTCGTAGTGGTGAGGGAATAGTCAATTCATTTATTTTAGGATTTCTTACATCAGTGGCT
TGGGCAGATTGCTATAGCGGATATCTCATTTCTCTTATAACTATGCTTGTATCAAGCAGTCCTTTATATG
CAGTTTTTAATATTTTCATTTATGTTTTTGGCTTTGCATTGACCTTGCTTGTATTGTGCTTGGCCATTTC
AAAAATAGATCTAGAGAAGCTGATTTATAAGTCAGGCTATATTCCTAAGATATTTGCTGTTTTAATTATT
ATTGGGGCTTTTTATATGTTTTACACTTCAATTCAAGTGTTTTTATAATTAATTAACTATTTTTTATTTT
TTTAATTCTTTTTCTCTTTCTTTTTTAATCTTTTTATATTTCATTTCAATATCTATTTTTAAATGTTTTG
TTCCACAATCTAAAGTCAAATAATATATACTGAATAAAACAAATATATTTACATAAAGATTATAAAATTA
TTAAATTCTCATTCTTTAATAATTTAAAATAATTCTAATTTTTAAGTGGAGATTCAAATGATTTACTCAA
AAGAAATTGAAAATATGTGTCCTGTTCATAAGGGAGCAGACCACGGTCCTGCACCAATTCCTGAAGAGGG
AAGATGGGTAAAATCCAAGGAGATCTCAGACATTTCCGGACTAACCCATGGTATAGGATGGTGTGCGCCT
CAACAAGGATGCTGCAAATTGACTTTAAACGTTAAGGATGGAATAATCGAAGAGGCATTGGTAGAAACTC
TTGGATGCTCTGGAATGACCCATTCTGCAGCTATGGCTGGAGAGATCCTTGTTGGAAAGACAATCCTTGA
GGCTTTGAATACAGATCTTGTATGCGATGCAATAAACACTGCAATGAGGGAGCTCTTCCTCCAGATTGTA
TACGGAAGAACCCAATCTGCATTTTCCGAAGGAGGCCTTCCGATTGGAGCTGGACTTGAAGACTTAGGAA
AAGGTCACAGGTCCCAGGTTGGAACAATCTATTCAACCAAAGTGAAAGGCCCAAGATATTTAGAGCTTAC
AGAAGGTTATATCACTGAAATAGGTCTTGATGAAGATGATGAAATCATTGGATACAAATACATTAATATG
GGGGTCATGCTTGACCTTATAAAGGATGGAACAGATCCAATGGAAGCGATTGAAAAGGCAAGCGGGCAAT
ACGGCAGATTTGAAGATGCCGTTAAGAAAATTGACCCAAGGAAGGAATAAAAAATCTATTAGGAAAGGGA
TAAAATGAGTTTATTTGAAAGTTATGAAAGAAGAATAGATCAAATTGTTCCAGTGCTTGAAAAATACGGC
ATTAAAGACCTTGAGGAAGCAAAAGCAATCTGCAATGAAAAAGGATTCAATCCATATGACATTGTAAAAA
GCGTACAGCCAATTTGTTTTGAAAACGCTTGTTGGGCATACACTCTTGGAGCAGCTATCGCAATCAAGAA
AGACTGTAAAAAGGCTAGTGATGCTGCAACTGCAATAGGAGAAGCTTTACAGGCATTCTGCATTCCAGGA
AGCGTTGCAGATGACAGAAAAGTAGGTCTCGGCCATGGAAACCTTGCTTCAATGTTACTTAGTGATGAAA
CCGAGTGTTTTGCATTCCTTGCAGGTCACGAAAGCTTTGCAGCAGCAGAAGGTGCAATTGGAATTGCAAA
TTCAGCTAATAAGGTTAGAAAGGAGCCACTTAGAGTCATCTTAAATGGTTTAGGAAAAGATGCTGCACTT
ATCATCTCAAGAATCAATGGATTCACCTATGTTCAAACAGAGTTTGACTACTTTACAGGAGAGGTTAAGG
TAGTTAGGGAAAAGGCCTACAGCGATGGCGAAAGAGCAAAGGTAAGATGCTACGGCGCTGATGATGTAAG
GGAAGGTGTAGCTATCATGCACCTTGAAGGTGTAGATGTGTCAATTACCGGTAACTCAACAAACCCTACA
AGATTCCAGCATCCGGTAGCGGGAACCTATAAGAAGGAATGTGTCCTTCAAGGCAAGAAATACTTCTCTG
TTGCTTCAGGCGGAGGAACTGGAAGAACCTTGCACCCTGACAATATGGCAGCAGGCCCTGCTTCCTATGG
TATGACTGACACTTTAGGAAGAATGCATTCTGATGCTCAATTTGCTGGGTCCAGCTCTGTACCTGCCCAC
GTGGAAATGATGGGGCTTATTGGTATGGGGAATAATCCTATGGTAGGTGCTACAGTGGCTGTAGCAGTTG
CCGTTGAAGAAGCTTTAAAATAGTTTAAATCATATTTAAACTATTATTTTTTCTTTTTTATATTTTAATT
AGTTATTTCTCTTTTTTCTATTAATTCTTTTTAATTTCCTATAAAGTCTATATATTATTTTTTTATATTA
AACAGCTTAAATATAGGCTTATATAACTTATTTTTCATATTAAACCACTCAAATATAAACTATATTAAAT
ATTAAATCCAATATAAGATTATGTATACATTTTTAATTTGTTTATTTGCATTAATATTATCTTATTTTGT
ATATGGTAAGTTCTTGGAACGTATCATCGGAGTTGATGAAACTGCCAAAACGCCAGCATATGAATTAGAG
GATGGGGTCGATTATGTCCCTATGAATAAATACAGGGCATTATTGGTTCATTTTCTTAATATTGCAGGTT
TAGGTCCTATTTTCGGAGCTATTCAAGGCGCATTATTCGGACCTTCTGCATTCTTATGGATCGTTTTAGG
TACTATCTTTGCTGGTGGAGTCCACGATTTCTTCGAAGGGGCAATGTCTGTTCGAAATGACGGTCTATCC
ATGCCTGGAATAATAAGCAAATATTTGGGAGATAGGGTTCGCAAGTTCTTTGCCGTTTTAATAATTATAA
CATGCATTCTTGTGGCATCTGTTTTTGCATCTGGCTCAGCAGATTTGCTTTCAAGTTTAACAAATATAGA
TATTCATATTTGGCTCGTTGCAATATTCATATATTTCCTCATAGCCACATTATTCCCAGTTGATAAGATT
ATAGGTAAGATTTATCCAATTTTCGGAGCTTTGTTTTTTATAATGGCTGTTTTGCTTATTTCTGCATTGA
TATTAAATCCAAATTATTCATTGCCAGAATTTACAACTGCAGGGCTTTATTTAACTGACAAAGCCATTTT
CCCATTCCTATTTGTAACCATTGCTTGCGGTGCAATCTCCGGATTCCATGCATCCCAAGCGCCAATTGTT
GCAAGATGCGTTAAAAATGAAAAGGATATGCATATGGTATTCTATGGTGCAATGGTTATTGAAGGAATAC
TTGCATTAATTTGGGCAACTATTGCCATGTCATTTTTCCATGGACAGCCTCAATTAGCCAGTATTTATGG
ATCCAGCCCTTCCATTGCAGTTAAAGAAATGTCAATAGCATTGATTGGTACTGTAGGATTGGTTTTGGCA
ATCATTGGTGTTGTAATATGTCCAATCACATCAGGGGACACTTCCCTTCGTAGTGCAAGAATAACAATTG
CAGATGAATTAGGTTTAAATCAGGATAAACTAAAGACTAGACTTAAGATATCCATTCCTTTATTCCTTGT
GTCTTTTGGATTGACTTTCATTGATTTTTCCTTGGTCTGGAGATATTTCGCTTGGTCTCAATTGATTGTA
GCTATTGCAGTTCTGCTTGCTGCAACTGTTTATCTGATTGATAATAAGAAGCATTTCATTGTTACATTTG
CTCCAGCCATTTTCTGTACGGTGGTTGCTATAGCTTATATATTGCAGGCTTCTGAAGGTCTTAGATTGGA
TCCTTTCATATCTAATGTTATTTCTGTTATAGTTGCACTTGCTTTAAGCGTGTATTTTATTTTAAAGTAT
AGAAAACAGCCAAATACTACAACATAGAAATAGTTTTTTCATTTAAAACTATTTTCATATTTTTTTCAAT
CCTTTTGATTAAAATGATAAAAATTTATTTATTTGTTTTTATAAAATAAGATTATGGGAATATTTTCATT
TTTTAAAAAGGATAAAGATAAAGAAAAAGTAGAGAGTCATGAAGAGGTTCATTCCATTCAAATAAATGCA
GAAAACTGTCAAGGATGTGGAAGATGTGTTTCTGTATGTCCTAATAATGCATATGAACTTATAGAAGGCA
AGTCTAGCTTAAAAGAGAATTTTACTTGCAGAGATTGTAAAGTATGTTTGGCAGCTTGCTCAAATGATGC
TATCACATTTGTTAATTAATTTTCTTTTTTAATTTTATTCTTTTTAATTTTATTTATTTTACTTATTTTA
TTGTTTAAACTATTTTTTTAGAGATATTTATATTTTATTCTGCTTAGTTTATCGTTTAAACTATTTTAAA
AGATACTTACAAGCTTTAATCTAGTTTATCTTGTCACGAACGGTATCAATAAAGCTTTGCCAATTCAGTT
TTATAATCTTGGTTTTTGCATCTGATTTCTTGATTTTTAAGATATCTCCAGTCTCTATTTCACTTGACTT
TCCATCGGATAGGGCATATGATGAAGTGTGCTCTCTAAGCTCTGTAATCTTTATTTCAACAATTGACTTA
TCTGATAAGACTATGCTCCTATTTATTATTGTATGTGGGGCTATTGGAGTAATTGTAATAATCTCTGCAG
TCGGATCTACAATAGGGCCTCCGCAGGAAAGATTATATGCAGTTGAACCTGTAGGTGTGCAGATTAAAAT
TCCATCTGCTGTGTATGAATTTATAAGTTTTCCATCTACTATGGCATCAAATCTAACCACTCCAAAGATA
TTTTTAGAAATGGACATTTCATTTAATGCCGGAGGCATTTTTATTATCTCTCCGCTTTCCTTGATAATCT
CTGCTTCAAGCATCATTCTCTCTTCGATATAATAATTCCCATCAATTATATCTTTCATGGCTTTTTTAAT
CCCTTCGGGATTCACATCAGTCAAATAACCTAATGTTCCACAGTTTATTCCAATGATTGGCTTTTGCAGA
GCTAATTTTGAAGATTCTAGAAAAGTACCGTCTCCTCCAATGGAACATATGATATCTGCTTCATTAATGT
CCTCGGATATTTCTATTCCTAATTCATTTGCTGTTTCAATCAGTTTTTCTTTTGTTATTTGGGCAATTTC
CTTGTAAGTGTCTGCATTAATAAAAATTTTCATATTAATAAATTGTTTTTTCAATTAAATAAATCCATAT
TCTTTTTTTACTAAATTTAAGAAATTTTTTAATCAGATAGTTTTTAAGTTATTTGTAACTGATTTTCAAT
TAAATAAACTTATATAATATCTTAATTAAAGTATAATTAACTAATATTTTTATTAGAATATTCTAAACTA
TTAAAACTAATTCAAATTAGAAAATTAGCAAACTAAAAATAATTTTTTAAGGTTATTTATTAGTTAAAGC
AATTAATAATCATTTTTTTATTTAAGGTGTAAAAATGGATATAGAAGGTTTTGTAAGAGGAAGACTTACC
AAAGGCGAAGATGAAGAAGAGCTTAAGTCTATCCTTGCAGAGAGAATAAGAGAATTTAAAGACATTTCAG
AAGAACATTCCCTCTTAATGGCTGAAAGCGTTATAGATGAAGTAAAGACAACTCTTGAGCTAAACAATAC
TGAAGATGAGTTCTTAAAGGACATCATCACAGTTCCAAAGGCAAATGTTGGCATGGGTAAGATGGGTGTA
GGTTCCCGTGGTGCAGGTGACTTCTTTGTACATAGAAAGATAGCACAAATCGTAAAAAGTACAAATACAC
AATCTGTTGTCGACCCTAATGCTCAAGATGATGGCGGTGTTGTCAAGGTACCAGCTCCAGGTGACGATGT
CTATATAACCACTGCAGTGGATGGAATACACTCAAGATTAAGCGAATATCCATTTTTAGGAGGTTTCCAT
GTAACAAGAGCTACCTTAAGGGATGTTTGTGTTATGGGAGCAGATCCTGTCGCTATCCTAAGCGACCTTC
ACCTTGCAGATGATGGTGACATTGGAAAGCTATTTGACTATACTGCAGGTATCTGTGCAGTTTCAGAGCT
TATTGATGTTCCTCTTGTAGCTGGAAGCACATTGCGTGTAGGTGGAGACATGGTTCTTGGAGATAGGCTT
GTAAGTTGTGTTGGAAGTGTGGGAGTCTCACAGCATCCTCCAACCGCAAGAAAAGGAGCAACCGTCGGAG
ACATTATTCTAATGACTGAAGGTGCCGGAGGAGGCACAATCACTACAACTGCCCTTTACAATGGCTACTT
TGATGTTGTATGGGATACAATGAATATCAGCTTTGTAAAGGCTTCTAAGGCATTGTTTGATGCAGACCTG
GTTAAGGATGTCCATGCAATGACTGACGTAACCAATGGAGGCCTTAGGGGAGACGCTCATGAAATCTGTG
AAACCACTGGTGTGGGGCTTGAGTTCTATCATGATAAGATAAAGACCACTGTAGCACCTAATGTATTGAA
TATGCTGGAAGACTTGGATATTGATCCTTTAGGAGTTTCTACAGATTCTCTTATGCTTGTAGTTCCTCCA
GAGATTGCTGATGACGTTGTTAAAACTGTGAGCGATGTTGGAGTTTACATTACAGAGATTGGTAAGGTGG
ATGATGAAGGCAGTCCTCGCCTTATTAAGGAAGATGGAAGTGTAGATACTTTGGTTCCTCTATTTAGGGA
AGCTGCTTACACAAAGATTAAAAAGTTAGTTGGAGATACAACTCCTGAAGACTTTGAAATCATGAAGGAA
AAAGTTCAAAAGGCTGCAGATGATTCTATAAGGAAAAAAGAAAGAGTCATTGATTATATTTTGAATAATA
ATTAGTTTTAATTAATAAAATGGAGAATAAATTAGTTAGCGGTTTTGTTAAGTTTTTATTCAATCGTTAA
TTATTATTTATTTTCATTCATTTTTTTATTTATCATTTTCATTTTTTTATTTATTTTCATTTAAAAGGTG
ATAACATGGCATTAGAAGGTGCAGAAAGAATAGATGAATTTATAAGCGAAGCAAAAGTGTTTTTCTTAGC
AACTGTTGACGGAGACAAACCAAAAAACCGACCATTAGGTTTCCATCTTCTTAAGGATGGTAAAATCTAC
TTTGGTGTTGGAAACTTTAAGGACGTATACAAACAAATGGAAGCAAATCCTTATGTTGAAATTGTAGCCC
TTGTAGAAACTGATTTCCTAAGATACTATGGAAAAGCTGTCTTTGAAGAAACATACGACATGGCTGATGC
TATAGTTGCTGGAAACGAATTCCTGCAAGGAATTTATAATGATGAAACCGGTTTTAAATTAGCTATTTTC
CACTTGGAAGAGGCCACTGCGGAAATCCGTGACATAACCGGTAAAATCAATGAATCATATAATTTCTAAT
TCTTTTTTTCTTTTATTTTTTTTATTTCTTTACTAAACTACTTTTCAAGCTAATTAAGGCAGATTTTTTA
ATTTTAGGAGCTATTAAATAAATTACTTATAAAAAACATTTTGATTATAATTTTTGTGATTAGATTTAAT
GATTTAAAGTCAATTTTGAGATATTTTTTATTAAAGGTGAGTCTATGAGCTTATTTAAAAATTTTATTGG
AAATTTTAAAAAATCTGATGTATTGGATTTAGCTAAGGGCTTTAAATTAGAATATGAAGCCAATAATTTG
GAAAATATGAAATCGATTGTAGATAAATTTGTTGATTTTCATCCTGATTCCTATTTTGCTTCTTGCTCTA
TGGTGATTTATATAATTCAATTGTATAAGAAAGATCCTTTAAAGGTGTCTCCAAATATGCTTAATAATTT
AAGCATTATGGAACGCAATATAAAATTTTATGATAATTCAAGCACTGACTCTTTAGATAATGAAGAGTTG
GAACTAAGGCAATGGTTTAAAAAGGAAGTTTATGAAAACGTTAAATATATGGAATCTGCAGGATTAAGAT
TTTCTGCTGATGATAAATAGTTTGCTAAACTTGAGTTTGGAAAATAAATCAACGTGATAAAGGGGAATAT
AAAACTTTCGAAATAAATTTATAAAAGAAATCAACGTGATAAAGGGGAATATGAAACATTCAAAATAAAT
TTAAAAAAATTAAACAAAAATAGATAATTTATTATAATTTAAAGAATATATTATTATTAGATATCCTTAA
AAAAGGGTATTCTTTAAAAAAGAGGTGAAAAAATGCAACTTAATAAAATTTGTTTAGCTGCTATCGTATT
ATTTGTTTTATTCACTATTTTGAAATTTGTGATGAAATGGAGTTTTAAATTATTTGCTATAGGAATTGTA
ATTTGTATTATCCTTGCAATATTTGGATTCTTCAAAGGAGATGACTTATAGTTAATCTATTTGTCATAGT
TTCGTAAGATTTTGGTTTAAAGGACTAATTTTAATAAATTAAGTTCTTTAAACAATAGTTTTACTAAAAC
AAGTTTTCAAAAGGCTTTTTAATCAAAATCCTAAAGAGAGTAGAATGTCAAGCAATTCAGATAAAGATAT
ATTAAAAGAATTAAGAGATATAACAAAAGACAAGGAAAGCTGGAAATCAAATATAAATCATGTCGCAGTT
AAATTGAATGATGATTTTTCCCTTTCAGTAAAGGCAAAGGTCTTATGGCTTCTTGGAGAAATGGGTTTAA
AACACCCATTGGAGATAGAAGAATATGTCGATGACATTGCAGTTTATTTGGAGGATGATCATCCTAAATT
GAGGGAAAGGTCAGCTAATGCAATTGGAAGAATAGGCAGGGCTGATAAGAACTTAGTAATCAATTATATG
GATAAATTGATGAAACTGAGTGACGATGAATCAGAAAGTGTAAGGCATGCATTCATCTGGGCTTGTGAAA
ACATAGCTGTAAATGCTCCAGAATTGTTTTGTGAAAAATTGGATATATTTTATGAAATGATTTCAGATCC
TGGTGAAAAGGTTCGCATAGAAGCTCCTGAAATCTTTAGGGTAGTTGGAAAAAGAAATCCAAGTTGTGTA
AAGCCTTATTTGGATAAATTAGAGCATATAGCAGAAAATGATGAGAACCCTGTTGTTCGCATTCATAGTG
CTGGTGCAGTTCGAATTACAAGAAAAGCCTTAAAAGAAAGTGATAATGCTTAAATAGTTTTAATTGATTT
TTTTTTAACTTATTTTCTAACTAAATTGTTCTTATTTTATTTATAAACTTATTTACTCCTTTTTTATTTT
TTAGTTTTTTTTTTAATTTAAATTTTTTACTCATTTTTTGTGTTTTTTATTTTTTTTAATTTAATATTTT
TACTCATTTTTTATTTTTTTAGTTTTTTAATATTTTTATATATTTTTTAATATTTAGGTATACCAAAACT
TTTATATTTAACTTGATTCAAATATTTATTCACAAGATTATTTAATGGATTTTAATTTATTCAAATAGAA
TTTATTAATTTTTTTAATTTATTATAAAGGTGTTAAAATGGGCTTTTTTTCAAATATGAGAAAACCAGAA
GGAAAATTAGGCAATATTCAATTAAAATCAATGAATAAGGAACATACTCCAGTTTCATTATGGGGTTTAA
AACATCTAGACATTTCTCCGGAGGATACAATTTTAGATATTGGGTGTGGCGGGGGAATGAACATTAATCG
TATGGCTCAGACTGCAAAGAAGGTTTATGGGGTTGATTATAGCATAGAAAGTGTAAATCTTTCAAAAGAA
GTGAATGCTGACTTTATTAGGAGCGGAAAGGTTGAAGTTTATGAAGGAAATGTTTCAAATCTTCCTTTTG
AAGACAATAGCTTTGATATTGTAACTGCTTTTGAAACAGTTTATTTTTGGCCAGATATTGAAAAATCATT
TGGAGAGGTTAAAAGAGTTCTTAAGCCAGATGGAATGTTTTTGATTGGCTGTGAATCAAATGGGGCAAAC
AATTTAGCAATGAAGTTCTTTGATCGTGTAATAGACATGGAACTCTATGAAGATAATGAATTATATGGAT
TTTTGAAAAATAATGATTATGGTGATATAACCATTTATTTAAGGGATGGAAAAAACAAACAAGAGATTAT
TAAAAAGGATGATAAAACCTTTGTAATTGATGATGATTATGATAATTTTTCTATTTCAGATAGATGGGTT
CAATGGATGACTATAACTGCTATAAAATGATTTTAATAGGGTTATAGTTAATTTTATAATCTTTTATTAA
TTATTTTTATTTAAGTCAATTTCATGCTTTCATATCAATTTTACATTTTTTAATCAATTTTACGAGATGG
GGTCAATTTTATAGTTTCATATCAATTTTACATTTTTTAATCAATTTTACGAGTTGAGGTCAATTTTACA
TTTTCATATCAATTTCACACTTTCACATCAATTTAACAATTTTAAATCAATATTTAATTAAATCAAGTCT
TTAATAAGCTTTAAATAGCATAAAATCAAATATCTACTTAACAATGATTTAGGTAATATTATGTTAAGTT
TAATTAAAGACAATAAAGGCTTTTTATCTCTTATAGATGCTATTTTATCTATTTTTCTAATTTTTATAGT
TCTAATCTCATTTAATATGATTGTAGATATGGAGATGCCTAGCTTATCCGAAGACAACAATCAATTCAAG
ACAAGTCAAGATCTTATGGAGCTGATGTCTTCAAAGATAGATGGCAGGGATTATTCCACATTGGAGCGAA
TCTCATATGTTTTATCCTCCAATGATAATTCGATAGCCTCAAGAAGGGAAGTTAAGAATATTCTAGATGA
TTTCTTTAGCGCTCATCTGGGTTCTGACTATAAATATGTTTTTATAGAGACTAATCAATTAAATGGCTAT
GTCTTGTCATCTGATGGTGATTATTCAACTGCTGATGAGGTTTCTCTAGCTATAAGAAACTATGGAAATT
ATTCTTATAAGCTTTATATTTTCAAGGCTTAAATGGTGTCCTGTTCTAGGGATTGTAATTATTTAGGGGT
TGTCATGCTCTAGGGATTGTAATGCCTAAGAATTTTGAATTAAATCTGTGGCCATAGCAAATTTTGCTTT
AAAAATGCTCATCTTTATATAGTGGAAAAAACATATATTTATTTGTTGAAATATTAGCAATTTCACTATT
TTTATTTTTATATTTCAATTGTCTTTGCCCTGGTGGTGTAGCTTGGATAACACGTGGGACTGCGGATCCC
ATTCCCCGGGTTCAAATCCCGGCCAGGGCATTTTTTTATTTAATTACTTCTTTTATAAGTAGATTTACTG
GATTTTAATTTTAAAATTTAATTTTCTAAATTGGCTTTAATATTTAAAAATTCTTAAACTTAATTCAATG
CTTATTAATAATTTATTGAGGAATGGCTATGCTTAATGCAAACACTTATGTAACAGAGGAAGAAGGTATC
GGCGGAACTATAAGAAACAGATGGGAAGACTTCTATGTTGAAGAGATTCCGGAAGTAATTCCAGATGGAG
AAGGTCCAAACATTTATATTTGGATTGAAAAATTAGGAAGAACCACCCTTGACGTTTTGCTTGATATTGC
AAGAGACCTCCATATAGACAGGAAAAGAATGGGCTTTGCTGGAATGAAAGATAAAAAGGCCATCACTCGC
CAATGGATCTGCATAGCGAATATGGATTCAGAGGAACAGTTTGCACAAGTTGAGGCATTAGCAGGCACAA
TTCATAATACTGAATTTTTAAAAGTAATTAGAGGTCGAAAAAAGTTAAGAATGGGTCAGCTTAAAGGAAA
TAAGTTTAGAATTCTTGTTAAGGATATTGATGGCATGGAATCAGATAACGAAGAAACTCGTAAATTAGCC
ATTGAAGATGCTGCAAAAAGAGCAGATGCCATCTTAAAAACCTTGGAGAAGACTGGAGTTCCTAACTACT
TTGGCTGGCAAAGATTTGGAAAGCCAAGAACAAATACTCATTTGGTTGGAGAGGCTCTTATTCATAATGA
TTTAAAAGAGGCTGTCAGACGTTATATTGGAAATCCTAGCGAAGAAGAAAGTGAAGATTCAAGAAAAGCC
CGACAAGCCTTTGATGATGGAAATTGGGAAGAATCCCTTGAATTGATGCATCCTGGAATGCGCTATGAGA
AGATGATGTTGAAAGTGCTTTTAAAAGAAAAAAGAAGAGCAATCAGGAAGATTGCAGAGGAAGAAGGAAT
TGAAATTGAAGAAGTAGATGAATCCAAAGTGGAATTATCAGATAAGGCTTATAAAAATGCTATTCATGCA
CTTCCAAAGCCACTTCAAAGAATGTTTGTCCATGCTTATCAGTCATTCCTATTCAATGCTGCAGTAAGTG
AGCGTGTAGCAATGGGTATGGATAAATATATCGAAGGAGATATTGTCATTGATAAGGAAGAGAGAATTGT
AAGAGATAAGACTCCTGAGGAGTTTCAGGAAATGGTATCTTCCTTTGAAATAAATCAGACTTGCCCTTTG
TATGGTACAAAGGTTCCATTTGCAGGTGGAGAAGTTGGCAAGATGGAAGAGGAAATCTTAAACAGCTATG
GATTGACTAGAGATGACTTTGAAGTACCTAAAATGCCTCGTTTAGGAAGCCATGGTCTTAGAAGGTCTAT
GAGATTCCAGGTATGGGATGCAAGTGCAACAGCAACTGAAGATGGTGTTATGTGTGAGTTTTCCATTGAT
AAGGGATCATATGCTACTGCTGTTCTTAGGGAAGTTATGAAGAAGGATGTTTACTAGCCACCTTTTACGA
GCCTACGGCTCGCAAAAGCTGGACCAAAAATTTTATTTTAACTTGGGAGTACATTGCTCTTAAGTCTTTT
TTTATTAATTAAAATATTTTCATGCTTCTATTTATTAATTAAAATCTAGATTTACTATTTGTCCATATTA
ACTAAACTAAACTTTTTTTTAAGAATATTTTATTTTATCCTATTTGCTAATATTAGGCAATTTAGACTTA
TTTTTAAGCAATATCGGAATGTACGCAAGTATTGCTGATACAATCACTGCAAGCAAAGTAGGTCCTAGGA
ATATTGAATCCAGGTTTACAGTTGCTTGATATACAATAAATCCTGCAAGCCATGCAAATATGTTCCAATA
CCATATTCTAGCATTTCCAGTCTCTTCCTTTGAAAGATAGAAAGATACAAGGAGCACTGCAGCCATAGGA
GCAAATACAGATGCAATAAGATATAAGAATCCAATATAATGATCCATAATTCCAGATATTGCAAGTATTG
CACTTATTGCACTCACTACAACTCCTGCAATCTTTGGATTGATTCTATTAAAGATGGCCTTTGCTGATTC
CCCTGCTGAATTTGCAGCTACAAAATTGGAGGTTACAGTTGAAAGCACTAAAATTATCACTCCTTGAGCT
CCAAGACCTGCAAGGAGGATTGATTGTGCAATGCTTGTTGTTCCAATGCCAACTATTTCTATGCCTAAAA
AATACATCCAAAGGCTTGCTATGGTATATGCTATTGCAGAGACCAATGTGCCGTTTACTGGGTTTTCCAC
ATCTTTGGTATAATCTGAAATCACAGGAAGCCATGAGATTGGCATAGCTATTGAAATTTCAAAGATGCTC
CAAAAGCTTAATGCTGTTGAATTAATGTTTTGAATAGGCAAAGCATTGGATATATGGACCCCTAAGAGTT
TTACAGATAGAATAACCAGCAATGCTGTAAGCACTATCATCATAATGGTAGTAATCTTAGATGACCTTCT
AAGTCCTACATAAACCCATACTGCAATGATTGCAGACAGGATAATGCAGGTTAAAGGGAAGGATATGGGT
AAATTCAAGCCCATCAATGCTGAAGCCCCTTGTGCATTCAGCACAGCTACCCAAGCTATAAGCTGCAATA
CATTTAATGTGGAAAAGAATTTGGAGCCATAATTGCCAAAGGTTGATTTGATGGTCTCCATTGCATTCAA
TCTAAGACGTGCACCTATAAGTCCTGTAGAAAATAGCAGTATGCCTCCTATGATGTGGCCAAGGACTAAA
GGTAGCCAAATGGAATCAAGGGTGTTCATGGAAGCAAGCTGTATTCCTGCCTCTATTTCTGAGACAGAGA
TTGCAACTCCGAACCAGATAACTCCATTTGAAAAAAGTCCAGTACGTTCTTCCATATTTTGCCCACTTAA
AAATTAGATATTTAAATTGATTTTTACTTATTTTTTTAGATTTGAAGTACTTATATTATTTTTACTTATT
TTTTTTAGATCTGAAGTACTTATATTGATTTTTACATATTTTTGTTTTTTCATATTGAAGAGTTATATTG
ATTTTAACAGATCATACAACTCTGGAATTGCCTGTTCGAATTTAACTCCATAAGTATGAGTCTCATCGCC
AATGGTCTTTTCAATTGCCTTTTTAGTAAATTCTCCGGCTATCTTTGCTGCTGCTGAAGGGGACTTACCT
AACATGGTTGATCCTACAAATGATGAAGCAAATACATCTCCAGTTCCATGGGATACATAATTTATCTTTT
CATTGTAAACTATATCAATAGTGTCTTCTATTTTATCTAAAACGATCATTCCCATCTTGTCTTCTTCTTC
ATATCCCTTTAATATGACATATCTTTTAGTGAATGCTTTAAGCTCTTTAGCCATCTCTAGCATTTCTTCT
TTTGTAAAGCTTTCTTTCCAAGGCTTATGTAGGATAAAGCATGCTTCAGTTGTGTTAGGGAGAATGAAAT
CACCTAATTTACAAAGCTCTCCCATTTTATCTGCAAATTCTTGGTCAAATCCATTATAGAATTCTCCATG
GTCTGCCATGGCAGGGTCAACAAATACAAGGCCATTTTCTTTTAATCTTGAGTCTATGATGTCTTTTATG
TAATCTAACTGTTCTGCTGATGCAATGAATCCAGTGTAAATTGAATCGAAAAATATTCCTTCTTTTTCCC
AATGTTTACGGATTTCTGGAAGATCTTCTGTTAAATCTCTAACAGTAAAATCAGTAAAACCTGAAGTGTG
TGTTGAGAGTACAGCAGAAGGGAGGATTGCTGTTTCTATTCCAAAAGCAGAAATTACGGGTAATGCAACT
GTGATGGAGCATTGTCCATAACAGGATATGTCTTGAATTGTTAAGGTTTTTATTGTTTCATTCATTTTAT
TCGACCTGATTGTCATTTTTTGAAATGATTTTTTACTATTATTAATATTGAATTTTTAATATATAATTTT
TATCTTACTTGAGTTAACTTAGTTTTCATATTTGAATTATAATCTTTCATATTTGAATTATTACTTTCAG
ATTTAAATTATAACAATTGTTATGTATATTCTATTATATAAATATTTCTAAAATTAGATATTTGATAATA
AATAAATGTTTTTAAGATTTATTTAAGATAATGACTGTTCTTAATTGTTTTTTCCGCCTAAAAACAGTTA
ATGAATAAAAAATAGTATAAGAATTAGAATTTAAATTCTAATTATTGAATTGATTTTATATTTAAATGTC
TAGTTTTTCCATTGGTTTTCCTTGCGTATGGAAAAATAGTCCATAATAAAAATCGCTATAAATGATATGG
CCACTATGAATATAACATAATCAAAGGCAGTTCCCATATTTCCAGCAGCCACTTCAGAGTAAACCGCCAT
AGGGAGTGTTCTAGTTTGTCCGGCAATGTTTCCGGCAAGCATTGCGGTAGCACCGAATTCTCCTAAGCCA
CGGGCATAAGCAAGAATTCCGCCACTTATGATTCCAGGCAAAGCATTTGCAAATAAGATTTTCCAAAAGA
TCTTCCACTCAGACATACCTAATGTACGGCCGGCATCCAATAAATTGGAATCAACTTGTTTAAATGCACC
TCTAGCAGAACGATACATTAAAGGAAAAGACATAACCACTGCAGCTATAACAGTTGCAGGCCATGAAAAT
GCTATCTTTACAGCAAAGAAGTCTAAAAAGAAGCTTCCTATAGGTCCTCTGATACCAAAAATATAAAGCA
GGAAAAACCCTACTACTGTAGGTGGCAATACAATTGGAAGTGTGAAAATGCCATCCAGTACAATTTTTGT
AGTGTCATTTTTTATCTTAACGAGAAGCCAAGCTACAATCAAACCTAAGAAAAAGGTTATAAAGATTGAT
AGGCTTGCGGTTTTCATTGAGATAAAAATAGGGGACCAGTCCATCATGTCTTACTCCTTTAATAATCTTT
CTGTTCATTTAAATATTTTAGATAATTTTTTTTTTTAAATTGAATATCCATTAATTTATTATAAACTTTA
TATTATATTAAATTTTCATTTAATACAGATTTATTTTTTTTATTTCTAAATTAATGGTTTATTAATTTAC
GCTTATTTAAATTAAATATTTAATCATTTAAATGATTAATTGCTAAATTTATTCGTGAATGGTAAATCCG
TATTCAACAAATTTGTCTTTAGCTTCTTGGGTTTGTAAGAATTCAAGGAATGCTTTTGCTGCATCTGCAT
CTTTAGCGTCTTTAATCATAGCTACAGGATAAATAACTGAAGTGTTTAAAGAGTTTTCAGGAGCTTCACA
AACCACTTTTACATCATCATTGGATTTAGCGTCAGTAGCATATACAATACCACATTCAGCAGATCCTTGA
GCTACTTGGTTCAATACAGCAGTTACATCAGTTCCTAAAGAGAATTTAGATTCAACAGCGTCCCAAATAC
CGAGGTTGGTTAATGCTTCTTTAGCATATTGTCCTGCAGGTACAGATTCTGGGTCACCAATAGCAATGGT
ACCTTTCACATCTTTTAAGTCATCGAATGATGTGATGTTTAAGTCTGAATCTTTAGGTACGATTAAAACA
ACTTTATTTTCTAAGAATTGAAGGTTGGTGTCATTGTCGATTAAACCTTCATCAGCTAAAGCGTTCATTT
GTTTGTTGGAAGCAGACATGAATACGTCTGTTTCTAAACCGTTTTCAATTTGAGTTTGTAAGTCACCACT
TGAAGCGTAAGTTGGAGTTACTTTTACTCCAGGATATTTTGCTTCAAACATTGGAATCAATTCATCATCA
TATACATTTTTTAGACTTGCTGCTGCAGCTAAATTAACTTCTTTTCCATTTAAACTGTCGTCAGTAGCGT
TGTCTCCTCCTAAAAAGTCAAGGAAACCTGCAGAGCATGAACTTACAGCAACAATTGCTATTAAAGCAAC
TACAGCAATCATTAATATTTTCTTAGAATCCATAGTTTTTCCTCCTATTTTTAAGCATAATCAGATATAA
ATATAAATCAAAGATTGGCAAAAGGCAAGGTCTAAACTCTAAATTAAAATCTGTTTTCTCTTATTCGTTT
AAGATAATTAGAGTAAAATGAACAATTTTAATATATTTTTTCATATTTCTTTTCCAATCTAAAATCATAA
TTATTATCATGATTACTATTAATTTTATTCAAGTTAATATATAAATATTTTCATATCGGTTTATTACTAT
TTTTTAAAAATTACCTAATTTTTATTATTTTTTTTATTTTAATAGTTAATTGGATTGATTTTTAACTAAT
TCATTTTTAAAACTCTATTTTTATTAATATTCTGTTTTATTTTCTCTTAAGATTATTTATTTCTGGATTT
TTTTCAAATTTTTTTCTCATTTTTCGAAATATTATTCTTTTCATTTACACTATTTTTTTAATAAAAAAAG
AGAAATTTTTAAACAATTATCTTAAAGGAATTTACCTTATGGCTAATTTTTACTCATCACTTCATATTGA
AATCTAGGTTATTTGAGTGTATTTTTATTAAATTCTAGTTTTAAATGGGTTAATTTTCATCGTTTTATCG
ATTGTTTCATATTAACTGTATGATAGGTTTAAGATAAAAATTGCTTGGGTGCTTTTAGTTGATTTAATGC
TGATTTTTAGTTTTTTATCCTAAAGTTATTTTTAAATTATTATTTTTTTTGAAAAAAATTTTAATTTTTA
AAAATTTTTATAATAGAATTAATAAATTAATTATATTCAAAGATAATTTTATGATTGATTCAGTTAATTG
TTATTTATGCTGATTTTTGATTAAATCATAATTCAAAACGAGTGATTTTATGATTGAATGCAGAAATATT
TCTAAAGGAAAAGCAGAAGGGGAATTAATAGTATCAGATGAAGCAATCAGCTTTTTAGGAGGCGTAGATC
CTGAAACTGGTGTGGTAATTGATCCTAATCATGAATTGAAAGGCCAATCCATTAAAGATAAAATACTTTT
TATTCCAGGTGGAAAAGGCTCCACAGTAGGATCTTATGTAATATTTCAGATGATGAAGAATAATACAGCT
CCAAAAGCAATTATTTGCCTTAAGGCAGAGCCTATTATAGCAACAGGAGCTATAATGTCTGATATTCCTA
TGGTTGATTCTCCATCAAGTGTTGAAGAATTGGTTAATGGCCAAATGGTAGAAGTAGATAGTGATAATGG
TAAAATAGAGATTTTATAGTTAGCAAAAAAATTCTATTTTTTTTTAGTTTCCTAATAAGTTATTCAGATT
ATTTTATTTGTAAAATTTATTAATGAGGTGATTAAATGCCTTCTTTATACATTAAAAACGTAAATATTAT
AAATCCATTCAGTGAAGAGCCTCTAGATGAAAGGCATGTCCTAATCAAGGACGGCAGAATCGAATCCCTT
CATGCAGAGGAGTCTGCATTATATGCCAATCATATAGTCTTGGATGGTGAGGATAATTACCTCCTTCCAG
GCTTTATAGACTCCCACGCTCATGTCATGGCAAACGGGTTTCATAAAGAGGATACAATGAAAAATCCACT
TGCATTGCACTTTTACAATGCTATAGAGAATATGAAAGCTACAATTGATGCTGGGGTAACAACTGTACGT
GACACTGGACTTGCAGATATTGGAGTAAAGATGGCACAGGAAAGGAAGATATTCCCTGCTCCAAGATTAA
ACATTTCCATTAAGCCATTGGCTATCACTGGAGGTCATTTTGACTTTTATCTCAATTCAGGCTTTGATAT
GGAACTTGCATATCCTGGCTTTCCAATCGGTACCTGCGATGGGGTGGAGGATGTCTTGAAGAAAACCCGT
GAGGTTATTAGGGCTCGTGCTGACTTTATTAAAATCATGGCAAGCGGAGGAATTCTATCTCCTAATACAA
GCCCTGAATTTGCACAGTTCAATAAAAAGGAATTGAAGACAATCGTCTCTGAGGCTGAAAACTATAACCT
TAAGGTAGCTGCCCATTGCCATAGCTTAGAAGGAATACAAAGATGTGTAAAGGCTGGAATCAAGTCCATT
GAACATGGTACTTTCATTGATAGAAAGACATCAGAGCTATTGGCTAAAAAGAGAATCTACCTTACTCCAA
CCTTAATCGTTCATCAAACCCTTATTAAGGAAGGTTTCCCTGTTTGGGATAATTTTGCAGATGATAAGGT
TAAAAAGCTTAAGGAAGTCGTTAAGATTCAAAAGGAAAATATCGAAACAGCTTACCAGTGTGGGGTTAAG
TTCCTGATGGGCTCTGACTGTGGTGTGATTGACCATGGAAGAAACCTTGGAGAGTTAAAGCAATTGGTTG
ATATTGGACTAAGCCCTCTTGAGGCTATTCAAGCCGGAACAATAGAAGGTGCTAAATTCTTCAATCAAGA
GAATGACTTGGGATCCATTGAAACAGGTAAGATTGGTGATGTTATTTTAGTTAAAGAGAATCCTATTGAA
AATATTGGGTCTTTAGTTGATAATGATAATATTTTAGCTGTAATTCAGGATGGAAAAATACTTAAGGATA
AACCTATCTATTAAAATACTCTTAAAAATAGTTTATTTATTAAAAAAGTTTTTATAAGTGTTTATAAACT
AAAAATTAGTAATTTTATTTTTTAAAAAAAGAGTAAAGAGATAATAAAAAATATTATCTCTTAAAAATTC
ATTTATTTTTTAAAAAGGCCTTTTATTTTGCTTAAAACACCACTAGCAAGAAGACCTATGGCGATATCAT
AGATTTGTTCAGCTTGTGCTGCATCAACACCTAATTTTTCTGCAATTAAGTTAACAATAGTATCTTTGTT
CTTATTTCCAGCTAAAAAGGTGCTTTGGAAAATATCGTTGACTTGGCCACCTTGGTCTTCACTTAAGTTA
GCTTGTTTCATAATTTCTTGAATAAAATCTGCTTCATTCATAATAATAGTTTTGTCTTTTATAGTATTAA
TATTAAACTGTTTTATATTCAATTATATTTTACTTCTTTACTTATTTTCCCTTGTTTTAATTAGATGGCG
ATTTTAAAGAGTTTTTTAGGTTTACCAAAACTATATATTATATGTCGATATAAATAAATTTATACAAAGA
AAATTTATTTATGAAGTTGATAAATTTTTAAAGGTGATAAATATGGCAGAAAAAGAATTAAATGTTGTCG
GTATGCACTGTCCTTCATGTGTAATGGCTGTTGAACTTTCCATGAAAGATTTAAATGGTGTAGACGACGC
TAAAGCAAGTTTAGACACTAACTCTGTAACAGTAGAATATGATCCAGACAAAATTACTGATGCAGACTTA
GTTGGCGCTGTAAAAGAAGCAGGATTTGATGTAGAATAAGTAAGATAATAGTTAAAAACTTTTTTTCTTA
TTTTTTTATTTATTTTACTTTAATCTTTTTCTTTTTTTATTGGAATTTTATTTTTCAAAGGTTGATTTTA
GAATTTTCTAATTTTTTTAACTATTGTTATAAGATATCTAATTAAATATTTTAAATTATTAAATGATTAT
TAAGAATTAAAGGAAGACTTATATGGCTCAAAAAGAATTGGATATTCCTGTAGATGGCATGCATTGTTCC
TCTTGTTCCCTTCTAGTTGAAAAGTCGCTAGGTAAGCTTGATGAAGTGGAATCCATCAATGTGGACCTAA
ACACCAATAAGGCCCATATGGTGTTAAAGGATAATCTCTCTCCAGAAACAATCGATAAGACAGTTGAATC
TGTGGGATTTACCGTTCCAAAGGAGGAAGTGGTCATTCAGATTGCTGGAATGCATTGTGCCTCTTGCGTG
AACAATGTTGAAAAGTTCCTTCCTCGTGTAGATGGTGTGGTTGAGGCAAATGCCAATCTTTCCAATCAGA
AGGTTACCATCACATACTATAGGGACATGCTCAATCTAAAGGAGATTCAAAAGACAATCGAAATGCTTGG
ATTCGAATATATCGGCCTTGACGGCGAACTGGACATAATGGATGAAGAGGAAAGGTATCAAAAGGACCTT
AGAGGCAAACTATATAGAATCATAGTAGGTCTGGTCTTTGCCGGTATACTTATGGCAATTATGCATTTCC
ATATTACAATTCCTCCATTGACTATGGGACAACTCTCTTTAATCATAGCTATTTTCCCATTCTGTTATGT
AAGCATGCCTATCTTAAAGGCTGGATGGAACTCCTTCAAGCATAAGAACCTAGATATGGATGTAATGTAT
TCAATGGGTATTCTTGTGGCATTTGTATCAAGCGTATTAGGTACATTCAATATAATTCTCGACTCAAGTT
TTATGTTCTATGAATCTGCAGTGATGTTGCCTTCATTCCTCACTATAGGACGTTATCTTGAGGCAAGAGC
AAAAAGGAAAACCTCATCATCAATCAAGGAGCTTATTGGCCTTCAGCCAAAAACAGCAACATTAATTACA
AGTGATGAAGAGGGCAATAGCATAGAAAAGGAAATAGATATTGAGGATATCAATATTGGAGACATATTGC
TTGTAAAGCCTGGTGAAAAGATACCTGCAGACTCTATTGTAGTTGACGGTGAAAGCTATGTTGATGAGGC
TATGATTACAGGAGAACCGGTTCCTAAGCTTAAAAAGGAGGGAATCGATGTTTTCTCAGGTACAATAAAC
CAAGATGGTGCATTAAAGATAGAGGCTCAGAAGATTGGGTCTGAAACTGTCTTATCACAGATCATTCAAC
TTGTTGAAAAGGCACAAGGGTCAAAGCCTCCTGTTCAAAGGCTTGCAAATAAGATTGTCAGCTGGTTTAT
ACCTGTTATCCTTACAATTGCTATAGTCGTATTCTGTCTATGGTACTTTGTAGCAGGTGCAGGCTTGTTG
TTCTCACTAACATGCCTTATCTCTGTTCTTGTAGTTGCATGTCCATGTTCCCTTGGCCTTGCTACCCCTA
CAGCAGTTACCGTTGGGGTCGGTAGGGCAGCAGAATATGGTATACTAATCAAGAATGGAGAAACCTTGGA
AAGCTCTAAGGATGTTGATGTATGTGTATTCGATAAGACTGGAACCATTACAGAAGGCAAGCCTGAGGTA
GCAGACATTGAAACATTTGATATGGCTGGTGACAAGTTCCTTCAAGTCCTATCAAGCGTTGAGAATAATT
CAAATCACCCTATTGCAAAATCCATTTTAAACAGATTTAAGAGTGATAATCTTAAATTAACAGAGGAAGG
CAAGGATGATTTGGCTTTACTTGAAGTAAGTGACTTTGAAAACATAACTGGTAAAGGTTTAAAGGCTAAT
GTGGTAGTGGATGAAAATAATTCTTCAGTTCTCGCCGGAAACCTTAAACTTATGGAATCAGAAGGTGTGG
AAGTCACAGATGAAGTATTAGATAAGTTCAATACCTTTGTGTCCGAAGCAAAAACAACCATTGTAATGGC
AATAGATGGCGAGATAAAGGGAATAATCACCTTAATGGATAAGATAAAGGATAACTCCAAGTCAGCTATT
GATGAGCTCCATAAGATGGGCATAGAAACCTATATGCTTACAGGAGACAATGAAAAGACAGCTTCCACTG
TAGCAAATGAAGTAGGCATAGATAATGTTATAGCAAATGTTCTTCCAAACGACAAGTTGGATAAGGTTCA
AGAGCTTCAAAAGGAAGGAAAAAGAGTCTTGTTTGTTGGTGATGGAATCAATGATGCTCCAGCTTTATCC
CAAGCAGACGTAGGTGTGGCTATGGGAAACGGTACCGACATTGCTATGGAAAGCGGTGATATTGTTATTA
TGGAAGGAGACTTAGAAAACGTTGTAGCTTCCATACAGTTCTCCAAAAAGGTAATGACAAGAATCAAGGA
AAACCTTTTCTGGGCTTTTGCATATAATATGCTCTTGGTTCCAGCAGCTGCAGGTTTGCTATTCCTATTA
TTTGGAATAGTATTTAAGCCAGAATGGGCTGGACTTGCAATGGCATTAAGTTCAGTGACTGTAATCAGCT
TATCATTGTTATTAAAACGTTATGTGCCTCCAATAAAAAGGAATAAGGTTTAATAATTTAAAAAATTATT
TTTTTTTGATTTGATTAGGCTTATTTTTTTAAATTCTTTAATTCATTTTTATTTTTTCTTTTTTTAGTTT
TTTTTTTAATTCTTAATTTTCATTTTTTATTTTTCTTTTTTTAGTTTTTTTTTTAATTCTTAATTTTCAT
TTTTTATTTTTCTTTTTTTAGTTTTTTTAATTTAATTTAACTTTAGTGCTCTCTACGGATTCTAATTAAT
TAGGCTTAATTTTCCTCATCATTCTCCTTTTAACAAATCTTAAACTTTGGTTAAATGTCTCAAATCCTAT
TTGGATAGTTAAAAGTATAGGAATTATCTCCAGTCTTCCTAGCCACATTAAAAATATCAACACTACCTTT
GGAATAGTGCCAAGCTCTCCGCTGATTATTCCTGTGCTTAATCCCACATTACCTAAAGTGGACACCACAT
CAAATAAAGTATTGAATGGATCATTTGTATAATAAGTCATTATTATCCAAGATATGGCTAAAAAGAATAT
ATAAACTGCCATATATGAAGATGCCTCTTTCATTTCTCCTTCATTTATTGATTTTCCAGATATCTTGATC
TTTACAAACCTTCCAGGAGAAACTATATTTGTCACAGCAAGATGTGTGCTTTTTAAGAGTGTAATTACTC
TAACAAGCTTTATAGCACCTACAGTGGAACCTGAAGAACCACCCATCAGCATCAAGACTATTATGATTAT
CAGTGCAGGGGGAGCCCATGCTGCCATCTCACTTGGAGGGGCAATGTTTGCTCCTGTTGTTGTAATTGCA
GAAACGACATGGAAAACCACATCCATAGGAGCAAGTTTTGTAATGATTGCAATTGCTATTGCACTAAGTA
TGATGCTTACAATCAATAGTTGGAATTGTATATCCTTTAATATGGCTTTTCCTTTTGTTTTAGCCATTTT
ATAATGGACTGTAAAGCTTGTAGCCCCTAATATCATTAGAAAGATAGTGATTATATAAACAATATCATTT
TGGTAGAATCCGATATTTGCATTCTTTATTGACATTCCTCCGGCGGATATTGTAGTGAATGTCAGATTTA
TGGAATCAAAGAGGGGAAGTCCTGCTATAAGATATAAGATGACCCCTATAACGGTATAAATGGCATATAT
CTGCATTGTTTTTTTAAGGGTATTTTTTATATTTGGCTTTATTCTATCTTCCCTTGCTTCAGACTTGTAT
AGCTTGAATGCAGAAGTTCCAGGCTTAATGAGTAGGCTTATGAAGATGATTACCACTCCAAGTCCACCGA
TCCATTGTTCCACACTTCTTAAAAATAGTATTGACATAGGCAAGGATTCAACATCGCTGAACATGGTCAA
TCCGCTTCCGGTCCATGCAGAGATATTTTCAAAAAAAGCGTCTACGAATGAGACATCTAAAATCAGCATC
ATGATTATTGCTCCAACAAGACCTGCCCATAGCCATGATATGCTTGATATGATCATCCCATGCTTGAATT
TAAGTTTGTCATATTCTCTGAATCCTTGAGAAAAAATAACTCCTAATATGATTGAAATTAAAGGCGGAAT
TACTCCATAAACATAATTGAATTCTCTATAGAATAAGTCGATTGGCAGAGGAAATAGCAGTATTGCCCCT
ATGCCGATCATGATGTATCCAAGATAATGTAAGATAATTTTAATATCTTGCTTTGATAGGTATTTTATTC
TCATTAAACCCACCTTCTTTAAATTCAATCTTAAATTACCAATAATATAAATAAAGTTAGGCATTATTGT
ATTTATATTAGGTATGAAGTATTTTGAAAATTTTAATAATTACCATTTATAAGATTTATTCAAGTAATAT
TTAAATTTTTTTATTTATGCATATTCCGATAATTTTTTTTGAAAATATGTCATTATAATGTATATTTTTG
TACAACAAAGATTTAAATAGTACATTATACATAATAAAATATACATTATAAAAAGATATAAATTAATGTT
TAAGTAAGATTTTAACATTTATTTATTTATCAAAATTTTTAAAATTTATTTATCTACTAAAATTTCTAAA
ATTTATTTATTTATCAAACAAAAGGAGATTAAGAAGTGTTTTACCCCAAAATAGAAGAAGTAAAGGAAAT
AGCAAAGGATGATTCGTATAAAAGAATCCCAATAAGCTATGAAATATTTTCAGACACTAAGACTTCAATA
GAAGTCTTAAGAAGACTTAGAATCTTAAGCAACCATTGCTACATGCTTGAAAGTGTAGAAGATTCTAAAA
ATTGGGGTAGATACAGTTTTCTTGGATTCAATCCTATCCTTGAGTTGACTTGTCAGGATGGAGAACTGGT
CATTAAAGGAAAATCAAGCTTCAGTGATTGTGGAATTGAAGATGAAAAAGATAAATGCTTTAGCATAAAA
ACTGATAATCCTGGAGAATATATTAGAGAAATAATAGAAGAAAACAAATCTCCAAAGCTTGAAAACATCC
CTCCATTTTCAGGTGGGCTTGTAGGCTATTTCTCATATGATTATATCAAGTACAGCGAACCCTCACTGAT
ATTGGATGCACAGAATCAGGACGCCTTTAAGGATGTTGACTTGATGCTCTTTGATAAGGTAATTGCATTT
GACAACTACAAGCAGAAGATAGTTGTAATCGTTAATATGAAAGTAAACGATGAAGATATGCTAAAAAATG
AATCAATCGAGGAAAACTATCAAAAAGCCTGCAATGACATTAAGGACATAGTGAATATTATAAAGGCAGA
TAATATAGTGGATCTCTTGAATGACGACTTTAAAGACCAGCTAACAAACAAGAAGACAATCAAGTCATTA
GAGGAAATGAAAGGACTAAAAACCTTAGAGGAATTGGACAGATGCAGAAAGGAAATTACCAAACACCTTC
CGATTGAACTCAAGTCTGATTTCAGATATCTCTTTTCAAAAGAAGAATACTGTGACATGGTGGAGCGGGC
AAAGCATTACATAAGAGAGGGAGACATTTTCCAAGTGGTTCTTTCAAACAGAATAGAAGCAGACATTGAA
GGAAGCTTGTTTGATGTATATAGGGTTCTTAGAACAACAAATCCTTCCCCTTATATGTTCTATTTCTCCA
GTGATGATATAGAAATAGCAGGTGCTAGTCCTGAAACTCTTGTAAAGCTTGTAAACAATCAGGTTTACAC
CTTCCCTCTTGCTGGAACCCGTCCAAGGGGAAAAACAGATGAAGAAGACAGACAACTGGAAGAGGAACTG
TTGGCAGATGAAAAGGAAAGAGCAGAGCATAATATGCTTGTCGACCTTGGAAGAAATGACATAGGCAAAA
TAAGCCAAATAGGCTCTGTCAAGGTAAACAGATATATGGATATAGTAAGGTTCTCCCATGTGATGCACAT
AGGATCAACTGTAGAGGGAATTTTAAGGGAAAATTATGACTATCTATCCACAATAGATTCAATCCTACCT
GCTGGAACCTTATCTGGAGCCCCTAAGATAAGGGCATGTGAGATAATCAATGAGCTTGAAGACAATAAAA
GAGGAATCTATGGTGGAGCAATTGGCTATATTGACTTAACAGGCAATCTGGACACTTGCATTGCAATAAG
GATAGCTTTTGCAAGAGACAATAAGGTATTTATCAGATCAGGTGCAGGAATAGTTGCAGATAGCGTCCCC
GAAAGCGAGTTTGTAGAATCTATCAATAAGGCACAGGCAGTTATGGATGCTTTAAGATTAGCAGATGGAG
GGATAGAATGATTCTATTAGTAGACAATTATGACAGTTTCGTTTATAATTTATATCAATTCATTGGAGAG
GCTTTAGCAAATATAAAGGGATACGATTTAGCCAGCAAAGGAGATTTGTATAAAATCTATGAAGAGATTA
AGGTAATTCGAAATGATGAAATGACTGTAGAGGAACTAAGAGAGTTAAATCCAGATTATATTATCCTATC
TCCAGGTCCAGGCAAACCTAAGGATGCAGGAATCTGTAAGGATATTGTAAAAGAGTATATTAATTCAGAT
GTTCCAATTTTAGGTGTATGCCTTGGCCATCAAGCCATTTGTGAAGCCCTTGGCACCAATATCATACATG
CCAAGGAATTGATGCATGGAAAAACCTCTATTATTGAATTGGATGAGGATAAGATATTCAAGGACATTTC
AGACCCAATTCAAATAGCACGATATCATTCCTTGGCTGTAGAGAATGATAGTTTGTCTAATGATTTGATT
GTATTGGCAAGAACAGATGATAATGAGATAATGGCGGTAAGGCATAAAAATGCTAATATTTATGGTCTGC
AATTCCATCCAGAGTCTGTATTGACTCCTGAGGGATTAAAGATAATAGAGAATTTTTTAAATATTAAAAA
TTAGATTTAGATGTTTTTTCTTTTAAATAAAGTTAAAAATAAAGAATTTTAAATATTTTTATTGGATAGA
GTTTAATTTTATGAATTTTAAATATTATTAGAAAAAGTTAAAAAAGGGATTTTATGATTAAAGAAGCTAT
TTTAAAAGTATACAAAGATGAAGATTTGACTTATGATGAAGCTTATGCAACTATGGATGAAATCATGAGT
GGTGAGGCAAGCGAGGTTCAAATGAGCGCTTATCTGACTGCCATGTCTATGAAAGGAGAAACAATTGAAG
AAATCACAGCATCTGCTGAAGCCATGAGGGCTCATTGTGTAAGATTATTAAATGATGAAGAGGTTTTAGA
GATTGTAGGAACCGGTGGAGACGGTTCAAATACATTCAACATATCAACAACCTCCTCTATTGTCATTTCC
GCAGCAGGAGTTCCTGTAGCCAAGCATGGAAACAGATCGGCTTCAAGCAAATGCGGTGCAGCGGATGTAT
TGGAAGAGTTAGGAGTCAATATTCATATAAGTCCTGAAAAAAGCTTAGCATGCCTAAAAGAAATCAATCT
ATGTTTCCTGTTTGCTCAAAACTATCATCTTTCAATGAAATATGTTGCAGGGGTAAGAAAAGAGCTTTCA
ATCAGAACAATATTCAATATTTTAGGGCCATTGACAAGCCCTGCAGGGGCTTCAATGGAAGTCTTGGGAG
TTTATGAAAGGGAGCTTATAGAGCCTCTTACCGATGTGTTGAAAAATCTTGGAGTAAAGTCTGCAATGGT
TGTCTATGGATTGGATGGAATGGATGAAATCTCTGCAAGCGATAAGACTGCAGTATGCGAACTTAAGGAT
GGAAAGACAAGAACATATGAAATTTCCCCAGAGGATTTCTCTATGGATATTGCATCTAAAGAAGACCTTG
TTGGTGGAGATGCAAATGAAAATGCAGAAATCACATTGGCTGTTCTAAATGGTGAAAAGGGACCAAGAAG
AAATGCAGTTTTATTAAATTCAGCTGCAGGTCTTTATGTTGCAGGTAAGGTAGATTCCATAGAAGATGGA
GTTAAGCTAGCAGAAGAGATAATAGATTCTGGAAAAGCCTTAAATCAGCTTGAAAAGTTCATTGAAGTTA
CAAACAGATAATTGTTATTAGAGATTGTTTCTAAGTATTAGGGATTGTTTTTAAATCATAAACTGAACAG
ATGATTTTTATGTTAAAGAAGATAGTTGCTAAAACTGAAGAGAGATTAATTGAAGCTAAAAAGATTAAAT
CCTTAGATAAGCTAAAAGAGGAAGTATCAAAGTTAGAAATAAATAATGAATTCCCTTTTAAAGAAGCCTT
AAAAGACCCTGAAATTGCTATCATTGCTGAAGTTAAGAAAGCATCTCCTTCAAAAGGATTAATTGCCGAA
GACTTTGATTATATCAAGATAGCAAAGGAATATGAGCAAGCTGGAGCTTCTGCAATATCAGTCCTAACAG
AGCCATATTTCTTCCAAGGATCCAACGATTTCCTAAAGGAAATTTCTCAAAATGTATCAATTCCTCTTTT
AAGAAAGGATTTTACCATTGATGAGTATATGATATATGAAGCAAAGATATTAGGTGCTTCTGCCATCCTT
TTGATTGTTTCAATACTTGATAATGTTCAATTAAAGAATTACTTGGATTTGGCACATGATTTAGGTCTCT
CCGCAATTGTTGAAACCCACGATGCAGATGAAATAAGAACTGCAGTAGATGCCGGTGCAGGGATAATTGG
AGTAAACAATAGAAATTTAGCTGATTTTACAGTAGATATTGAAAATAGCATCAGATTAAGAAGTCTTGTA
AGCGATAAGATCCTATTCATTTCCGAAAGCGGTATCAAAACAGCTGAAGATGTAGGCAGACTAAAGAAAA
ACAATGTGGATGCAGTTTTAATCGGTGAAACTTTAATGAGAAGTGATGATAAGAAATCTATGATTTTGGA
GTTGAAGAATGGTTAGGATTTAAAAAAAATGCATAATTTGATATTTTGGATTGATTTTGGAGTTGAAGAA
TGCTTAAACTTAAGATTTGTGGACTAAGAAGAAAAGAGGATATAGATATTGTAAATAAATACAATATTGA
TTATATAGGTTTCGTATTTGCAGGCAGTCCTCGTAAGGTATCATATGAGCAAGCTAAAGAATTATCTGCT
CTTTTAAGAGAAGATATTATTCCTGTAGGTGTATTTGTAAATGAACATATGAAACTTATTGTAGACTTAT
ACAAGGAAGGAATAATCAAGATTGCTCAGCTTCATGGAGATGAGGATGAGGATTATATAAAGAACCTAAA
AGCTAAATCATTAGAGCAAACTGGCCATGAAATACCAGTTATTAATGCAATTGAAATCAATAATGCTAAT
AATTATGATAATTTCAATGATAAGTTATTGGAGTGGCGAGATTCAGTATCTGACTATTTTATCTTAGACA
GTGGCAAAGGCTCTGGAAAGACATTTGACTGGAGTCTTCTTGATAAAAATAGCGAATTTTTTAAAAATTC
CATCTTTTTAGCTGGTGGTTTAAACAGTGAAAACTTAGACTCTGCTATAAAAGAGTTCAACCCATATGCA
GTTGACTTAAGCAGTTCAGTAGAAACAGATGGCTTTAAGGATGAAGAGAAAATCAAAGAGATAGTTGAAA
TTGTAGAAAGATATAGAAATTAATTTTATATTTTGATATTGTAAATGATTAGGGAGATTAATCTTAATTT
TGATATTGTAAATAATTATGGGGATTAATTTTATAATTGTTTAAAATCTAGATAAATATAGAGATAAATT
TTAATGATTAATAATTCTTATCAAATAATCAAAAGTATTCAATGGAGAAAGAAATATGAGTAGAGGTCGA
TTTGGAGTTCATGGTGGACAATACATGTCTGAAACCTTAATGAATGAACTTCTTAACTTAGAAAAACAAT
ATAATCATTTTAAAGAAGACCCTGAATTTATAGAAGAGTTAAACACTCTTTTAAAGGAATATGCAGGAAG
GCCTTCTTTATTATACTATGCAAAAAGAATGACAGAGGATCTTGGAGGAGCAAAGATCTATCTAAAGCGT
GAAGACTTAAACCATACTGGTGCACATAAGATAAACAATGTTCTTGGACAGTGTCTGCTTGCTAAAAAGA
TGGGCAAAACCAGAGTGATTGCAGAAACCGGTGCAGGTCAGCATGGTGTTGCAACAGCTACTGCTGCAGC
CTTATTGGACATGGAATGTGAAGTCTTTATGGGTGAAGAGGACACAAAGCGTCAAGCATTGAATGTATTC
CGTATGGAACTTCTAGGAGCTAAGGTTCATACAGTAACAACAGGCTCTAAAGTCCTTAAGGATGCAGTAA
ACGATGCTTTTAGAGAATGGATTTCAAGAGTGGATGACACCCATTATGTAATAGGTTCCACTATGGGTCC
ACATCCATTTCCAACTATAGTTCGGGACTTTCAGGCAGTGATAAGTCAGGAAATGAAAGAACAGATTCTA
GAGCTAGAAGGCAAGCTTCCAAATATGGTTATTGCCTGTGTCGGTGGAGGAAGCAATGCGATGGGTTCAT
TTTACAATTTCCTGGATGATGAGGAAGTGGAGCTGGTTGGAGTTGAAGCTGCAGGAAAGGGAATAGACAC
TGAATACCATGCGGCTACAATTGCAAAAGGAGAGCTTGGAATATTCCATGGAATGAAATCCTATTTCTGC
CAAGGCAATTATGGTCAGATTGCTCCTGTATATTCAATATCAGCAGGTCTTGACTATCCTGGAATTGGTC
CTGAACATGCCTATTTGCATGATATAGGAAGAGCAAAATATGTCTCAGCTACCGACGATGAGGCAGTGGA
AGCCTTTGAATACCTATCAAGAACGGAAGGAATCATTCCAGCAATAGAATCCTCCCATGCAATAGCCCAT
GCAATGAGGGTTGCAGGAGATATGGATAAGGATGATATAATCATCATTAATGTTTCAGGTCGTGGAGATA
AGGATGTGGCAGCTATTGCCCGATATAAGGGAGTTGAATTATACGAATAATTGTAGGATATCGAACTACA
TTAATAAATGAATGTTTAAGGGTGATAAGATGGAGAAAGATATAAAGATTAGCGATGCATTTAAAGATGG
AAAAGCTTTCATCGGATTTTTAACCGCTGGAGATCCTACAATTGAAAAGACAGTTGAATATGTGCTGGCA
ATGGAAGAGGCAGGTTGCGACCTTGTAGAGATTGGAATTCCTTTCTCAGACCCTGTAGCTGAAGGGCCAG
TCATTCAGGAAGCAAATATAAGGGCACTATCAAACAATACAAACACTGATGATGTCTTTGAGGCAATAAG
ACAAATAAGAGAAAAGTCAGATGTTCCTTTAGTATTTCTAACTTACATCAATCCAGTGTTCTATTATGGA
TATGACAAGTTCTTCAAAAGATGCCAGGAACTTAATGTCTGTGGAATAATATCTCCAGACCTTCCATATG
ATGAAAAGGATGAGATATTGGAGGTAACAAAGAAATATGGTGTTGATATAATTAGCCTGATTGCACCTAC
TTCAAAGGAACGCATACAAATGATTGCAAGTGAAGCAAGTGGATTTATCTATGTTGTTTCATCATTAGGA
GTCACTGGTATGAGAAGTGAGATTAGGACGGATTTAAAATCAATAATTAGTGATATAAAGGAAGTTACTG
ATGTTCCAACAGCTGTTGGTTTTGGTATCAACACTCCAGAACAAGCTAAAAATATCTCAAAAGTTGCAGA
TGGTGTTATTGTAGGGAGTGCAATTGTTAATATTATTGCAGAGCATGGGGAAAATGCAAGAGAGCCTCTT
GCAAATTATGTTAAATCAATGAAAGATGCTATTTCCAAGTAGCTTCTTTCAATATTTTTTATACTATTTT
TTCTTTTGTTAGGGTTTAATATATTAAACCTTTATAAACATTTTTTTATACTATTTTTTTTGTTAGGGTT
TAATATTTTAAACTTTTATAAACTATTTTTTTATACTATTTTTTTTGTTAGGGTTTAATATTTTAAACTT
TTATAAACTATTTTTTTATACTATTTTTTTTTGTTAGGGTTTAATATTTTAAACTTTTATAAACTATTTT
TTTATATTCTTTTTTGTGGTGGATAGGGGAATAAAACAGTTACGAATTATCCTCCTTTTAATTATTATGG
TTTGCTGGCGTTTTTTTAAGGGTTAATTTGATGTTTATCATAGCAAATTAACCATTCTTTATTATTGATT
GGCCTTCATAGTAGCTATCTGCTCATCACGGCCTTTTAATCTTAAGGTGAATGCAAATGCAATCAGTGCA
ACTATTGCAGCTATGATAAGACTGACCTGATAGCCTAAAATTCCTGTAAATGATGCGATTATTCCTCCAA
TCAGGGCTCCTCCTATCAGCTGTCCTGCACTTGATAGCATATTTACTATGGCTTGGCCTGCTCCTCTTTC
ATATGGCTTTGCTTCGGTGAGGACTATATATCTTAACGGCGCTCCTATTATTGTTACAAGTCCCACTCCA
ATAAGGCATCCGGCTATTATGAAGAATATTAGATTGCTTGGATAGATTGCAATTGCAATAAGCCCTATTG
CAAGAATCATTGTTCCCATTGCCATAAGCTTCTTTGAGCCTGTTTTATCCAGGATTTTTCCAAGAATCGG
TGCTGCAACTGCATTTGCTCCAAGTATTGGAATCAGCATAAGGCTTGCAAGCTGGTCGTCCAATCCCATT
GAAAGGATTACCAGTGATGGTATGAAAATTGCTGAAGAGTAGATTATTCCATAGCATAAGGTTTCTATGC
ATGCAATTGATATTTCCTTATTCTTTAGCATATGGATTGGCACGATTGACTCTTCGGCTTTTTTCTCTAC
CTTTAGGAATATTGGGATTAGAATTATGAATATTACTAAGAATGGAAGTACATTTAGAGAGAGTAGGCTC
GCTATAAAATTGCTTGAGTCTATTTGATTAAGCCCGTAGGATAAGAATATGGCTAGCAAGCTTAATATTA
GTATTCCTAAATAGTCTATCTTTAGTTTTCTATCGTTATCTGAGTCTGGCAGTATGTACCATGCAAAGAT
AATTAGAAATATTGCAATTGGAATGTTTATTGTAAAACACCAGTTCCAGCCATAGGGGATTAATGCTGCT
CCTACAAGAGGCCCTCCTATTGCTGATATTCCAAATACGCTTCCAAGAATTCCCAATGCCTTTCCTCTCT
CTTCCAATGGGAATCCGTCTCCTACAAATGCCCCCGCTACTGGGAATATTCCTCCACAGCCGAATCCTTG
TATGAGTCTGCCTAAAAATATTAATTCTATGCTTATGGATGCTGCTATTAGGCAAGATCCTATTCCAAAA
AGAAGAACGTCAAGGATGAATATCTTTTTTCTTCCATAGAAGTCTGAAAATTTGGCCATTACTGGAGAAC
CAATCATGAATGTGATTACAAATAATGTAAATATCCAGCTTGATTCTCGGCTTGTCAGATGGAAGCTCTG
TTCGATTGAGGGAAGGACAGGTCCAATTATTCCTGTGTCCAATGAGCCCATGAATACGCCTATTAAAAAT
AGAATGAGTATTAAGTTGCGTGTTCTTGTGTCTAGTGTTTTACCTTGCATATTATTAATTTTTATATTTG
CTTTTAAATAGTTTTTCTTGAATTGATTTAGTTTGGTGGTGGTTTTTATTGGTTGGTTTGGTGGTGGTTT
TTACATGTTTCTTTTTTTAAGAGTGGGTTCTAACTGTATGGAATAAAATTTTGGTCAAGGTTTTTTGAGA
CCGAAAGTCTCAAAAAAGCTTGAGTTATGTGCCAAAGTTCTCTCTAATCTTCTTGATTGTAAATCTGGCA
AATGTGAAGTTTAATATACTTGCAGTTATTCTTCCTATAGCAAGTCCAGTCCAGATTCCAACCAATCCCC
ATCCTAGAACTATTCCAAGGATGTATGTTGCGCTTACTGTAAATATTACCTCTCTTATTATTGTCCACAT
GAGGCTGATTGTTCCCTTTCCTATTCCTTGGTATAGGAAGCTTGAACACATTCCAGCTCCTGTCAGTGGG
AGGCATAAGCTTGCTATTCTTAAGAATTGGGTTATTTCAGGGACTAATGGTGCAGTTTCTGGAGTGTATG
CAAATATTGTTGCAAGCTGTGGAGCAAAGGCTATAAGGATTATTGTAACTGCTGTTCCAAAGGCTATTCC
AAACTTAGCGCCGTAAATATGTGTTCTTGATAGGTAATCTCCGTTTCTTGCTCCATAGGCGCTTCCTGCT
ACTGCTGCCACTGCGCTTCCTATTGATGTTAGAGGCATTATTGCAAATAGGTATAGCCTTTGACCTGATG
TGAATGCAGCTATGCCGAATTCTCCTCCTATTGTTGAGATGAATATTAGATAAAGACTGACAGCTAGTGA
CATCATGAACATGTCCATTGAAGCAGGAATTCCTACTTTTAGAATGTCCTTTGCTATATTTGAATCGAAC
TTGAAGTTCTTTAGCTCCACATGGACCCAAGTGTCTTTCTTTATAAGTATCCAATACATTATGACTATGG
CTGAACCTGCAGAGCTGACTATAGTTGCAAGGGAAGCTCCTGCTGAGCCCATACCTAATGTGTAGATGAA
GATAGGGTCAAGGCATGTGTTTAATATTACAGATACAATTACTGCATACATTGCCCTTTTCATGTCCCCT
TCTCCACGGAGAATTCCGCTTCCTCCATTTGCAAACATGAATGTGAAGAGTCCTAGAAATAGGGGGCTTC
CGTATTTTAGTCCTTCAGCTAGAGATTGTCCGCTTGCTCCATATGTTCTAAGGAGAGGTTCTTGGATGAA
GAGGAATATGATTGTTAGGATTATTGAGGCTATAAGGAATATCAATAGGGCATGGGTGGCTGACTTGTTT
GCTCCTTCGTGGTTTTTAGCCCCTACAAAACGACTTATGCTGCTTGTTGCACCGCTTCCAAGACCTACGC
TTACACCGTTTAGTATCATGAATATTGGGGTTACAAAGCCTATTCCGGCAATTGCTGCCTGGCCTAAGCC
TGCTACGAATATTCCATCGATTATGTTATATGATGCGGTTAGGAGCATGGAAATCATGATTGGAATTGCC
AGTTTCTTAACTGCTATCTCCGGTGCTCCTCTCATTAGCTCTACATTTTCATTTGCCATTTTAATCCCTA
TCTGTAATAATGTAATTATGATTTTTCTTATTTTTAAAGAGTAATTACTCTTTTTTATCTTTTTAAATGA
AGATTTATTCTTCTTTTAGTATTTCTTCTGTTTTTCTAGCTATCTTTCTTAATTGATTTTTTGTTTCATC
ATCTAGTTTGTCTATTCCAACAGCTTCTTCCCAGCTTGATAAATCTTCTTCTAATAAAATAGCTAGTTTT
TCTCCTTCTTGTGTTGTTTTAAGAATGTATTTTCTTCTATTGTTTTGGTTAATGATTCTCTCTACATATC
CCTTATCTTCCAACTTTCTAAGTGCTTTTGCTATTGTTCCTTTGCTTTGACCGAATATGTTTGCAAGATC
ATCTTGGGATAAATTCTTTCTTTTGTGTATCTCCATTAGATAGCGACCCTCATGAACCATGTCTATATGG
TTAGGGTTTTTTCTTGCATATCTTAGTTTATTTTGGGATATGTGGTGTATTAATGCAATAAAAGGCATTG
AATCAAATTTATCTGGGTGTTTGCTTTCTTTCATGGTTTAATCACATTTTGCTTGGTTTTTTAATATGTT
TCTTGGGAAACTGTTTACTGATGAACGATTTTTCTTATATTATTCTCTTTTGTTTTCATTTTATATAAAT
GTTTCCTGGGAAACTGTTTATCGATGAACAATATTTTTTTTTTAAAACCAATCGTTATTATGTATTGTTA
TTTAATATTTTCATTATATCAAAGTGGTCTGCACATTTTTTATTTGCCAATCAATCTCTTCTAAGCCCTT
GTCCTTTAGAAATTCATTAGCTAACTTGAAATGATTGCATCCAAAAAATCCTCTTCTTGCTGAGAATGGT
GATGGGTGGGAAGAAATTAGTACTAAATGATTAGGATTTGTAATGAGTTCTTTTTTTAATTCTGCCTGTT
TTCCCCATAATAGAAAAACGATAGGGGAATCTTGTTGGTTTAATATTTTTATTACATTGTCTGTAAATGT
CTGCCATCCGCATTTGCTATGGGAGTTGGCATTTCCTTCCTCCACTGTAAGGACTGTGTTTAGAAGGAAA
ACTCCTTGCTTTGCCCATGATTCAAGGCATCCTGAATCTGGAATTGGATAGTTGTACTCTTCTTTAATTT
CCTTAAAGATGTTTTTAAGAGATCTTGGGATTGGATGGCCTTCAGGGGTGGAGAATGCAAGGCCATGGGC
CTGTCCCTTTTCATGGTATGGGTCTTGGCCTAAAATTACCACTTTTACATTGTCTAATGGGCATAACTTA
AATGCATTGAAGACTTCTTCTTTAGGTGGATAGATAGTTTTTGTTTTGTATTCGGCTTCTACAAATTCCT
TTATCTTTATGAAGTAGTCTTTATTGAATTCATCTTCCAATGCATTGTCCCAATCGTTTCCAATCATAAA
ATCACTTGAATCAATCTTTTTATTATAATTTATAGGGTTATTGGTTAAATTATAATTAATTAATTTTTTT
TTAATTAATTTTTATTTTTATAATTTAATTTATTTATTTAATTACTTTTTTCATCATGGCAAAGACTATT
TTAGCAAATATTCCTTTAAAGAATCCTAATTTTACATTTGGTGCAAAATCATAATTTACAAGTCCGGTTG
CTTCCCAATATTCCTTATCTGCTTTTATTGGATCTTTACTTACTGCCATTGCTCTCCAAACATTGTAAAA
TACAATATCCATAAATTTAGGGGAGTGGAGTTTTTTGGAGCTAACGTCCTTTTGGAACTTCTGCGCTGTC
TTATTTATCTCTTCTGTGTTTATTGTGTCTTTTCCGCCGCAGGCATAAGTTATCTTATGGTTCTTATTAA
ATCCCCAATGTCTAAGGGTTTCATCCATATATTTGGCTACATTCTTATGACCTGCCCCTGCAGTTGATAC
TATGATTAGAGCTTTCTTATCAAAGAATTCTGGTCTGTGGTAGATATATGCAGTATGGTCAAAGAAGTTC
TTTATAAGTCCTGTGACATTCATAGCATAAACTGGGCTTGTTATTATGAGTCCGTCAGCTTCTTTTATCT
TTTCTACGATTGGATGTACTGTTTCAAAGTGAGGGCATTTATCTTCCCCTTCCATTATGCATTTAAAGCA
GCCATTGCACATTGGTATTTTTGTTTTCATTAATTGAATCTCTTCAAATTCACCTTCTAGGTTTGTTTTA
GCTTGCTTTACCATGGCCCATGTGTTTTTCTTCCTTGGGGAACCGTTAATAATTAGATATTTCATATTTT
CACATCCTTTATAAGTAATTCATAAATCTTAGTTTGCTAATTGTTTTATCATTATCTTTTTATTCATTCC
AACTGTCCTTCTTGAACCCTCTTTTGCTTATACTCAAAGTTTTCATCAAATTTATCTACGTCATCTTGGC
TGACGTTAAAGACTTTTGGATTGTAGAAGATTCCTCTGTCGTAGTCCTTGTCTTTAAAAAGGTCTTTAAA
TATTCTTATCATGAAGAATGGATTTTCCTCGCTTGTATCTGTTCCCTCCAGAAATAGATTGTATTTAGAT
GCGCTTTCAAATCCAAATCTGTTATAATAGTTCTCATCCCCTATTACAAAGACATATGGAATGTTCTTGT
TTTTTGCAAGTCTTAAGGTATGCTTTATCAATCTGAATCCATATCCCTGGTTTTGGTATTTTGGATTGAT
TGCTATTGGGCCAAGAACAACTGCTTCCTCATTCCAATCGTTTATCTTCTCCATTCCTTGATTGTTTTTC
TTATAAAGGTTCAGATTTCCCTTAGAATAGTTTATATGTCCTATTATTTCATCATCTTCCTCTATAATGT
ATGCCAGGTCCTTTATGAAGCTTGGGTCTTCTCTTAGATTGTAGACGATAAAGTGTTCATAAGCTCCTGG
ACGATATATGTTCCAAAATGCATCTCTTACAAGATTTTCAACTTTTTTGTAGTCCTTTTCCTCTTCCAAT
CTCATGATTTCTGTTTCTAATTCTTTGTTTTCTTTATCGTGATTGGAGGATGGATTGTTTTTATTATTGT
CTATTTTAGATTCTTCATTGTTTATTTTAACTGAGTTAAATATTATCTTCATATGATCGGTTGTTCTTCT
TTCGAAGTCCTTTAGGAACTTTTCATCATCTTCAGGATAGTTGAATATGAAATGTTCATATAATAGGAAT
ATTCCATATGAATAGAAAGATTCTGCAAGCTGTTTGCTGTTTGCATCTTTTCTTATGATTTCTTTTTCTT
TCATTAGATTGAACAGCTCTTCCCAACCTTTTATTGCATAGTCAATGATTCCTTCCTTTACAAAAGCCTT
CATCTTTTCATTGTGATACGATCCTACCAGAAATATTCTTGTGATTTTCATCATTCTCTCTTCAGAGAGT
TTTGATAGGAATCTGTCGCTGCCCTGCTTATAGAAATATTCAAATCCTAAATCCAGATTGTCGTTGGATT
GCATAATAGGAGCTTCTTCCTTTAGCATTTCGCTGATATAATAGTTTAATATTGATTCCAATATTGCTTC
CTTGCTTTGGTAGTGGTTATAGATTGAGCTTTCCTTTATTCCTACTTCTTTGGCGATTTGTCGTATGGAT
GTGTTTGTATATCCATATTGGGAGAATAAATCAATTGAAGAGTCAAATATCTTTTCTTTTGTATTCTTTT
TAGCCATGTTATTCCCTTATTATTCTTAAAATCTTTTTTGCTTGTTTTTTGGTCATTTTGAAACTTTTAT
CATTCTAAATTTTAACTAACACTTGTTAGTTAACTCTATATGGTATTTTTGACTTTTTAATTTATAAAAC
TAACGATTGTTAGTTAAATATTTGATGCTTTTGACTCTTTCATAAAAAACTATGGATTAGTATAATTTTT
AAAAAGGTTCAAGATTAATTGATTTTAAAATAAGTTTTAAAATGGCTAAAGAGAGTATTTAAAAAGAAAA
GTTGAAATATTGTTTAAGGGGTCCATTAATCTTTCTAATTATTTTTAATTATTCTTAATTCAATTTACTA
AAAGGAGAAATATGGATGCGAAGTTTCTTCATTTTTTTAACTTATGAAAAATAAAAAATTAGTTTTAACT
ATTTAAATATATAAACAGTGCTTCTGCCTTTGCCTTTTGACTTAATCAATCCTTTTTTAACTAATTCATT
AATATAAAAATGGGACCTTTGGGCAGATAAGTTAAGCAGATCCTGAACTTCCTTATTTTTTATGGAATTG
TTTTTTTCAATAAACTCCAATATTTTAATCTCTTTTTCGTTTAATTTAATTTTGCCATTCATTTTTATAT
CAAAACGGGATATGCTTTCAATATCCTTTTTAACATTGGATAATGAAACTAAAAATCCTGTGGAAAAATA
TTCTAGCCATTCAGTTAAATCTTGAGACTTATCTGCAGATTGCAATGCATTGTAGTAGGATTGCCTATCC
TGATTATAATATTCATCAAGGGAAAAATATCTTTTTATGTCAAAATCTTTTAAAAGAAGTATTAAAGTAG
CTAATGCTCTTGCATTTCTTCCATTGCCATCTACAAAAGGATGAATTCTAACGAATTCATAGTGGAAGAT
TCCTGCAAGAATGATTGGATTTAAATCCTCTTGAACGTCTGCCCAATCCAATAATTCCCTGATTAAATAA
GGAACTTTAATAGGGCTTGGAGGCACATAATTAAGTTGGCCTGTTTTTATATTCCCAATTACTACTGGAG
AATCTCTGAATTTTCCTGCCATATTAGGATCTTTAAGGGTTCCTTCAGTGATATTTTTATGAATATCTAA
AATAGTTTCTTCATCAATTTTTTCATAGTTATCTAAATTTTCAAGTGTTTTAAAGTAATTTAAAACTTCT
ATTTCAGATTTATTTAATTTAAGCTCATCTAATTTATTTTCCTGTTTTAAATTAAATAATTTTGTTACTT
GTTTAAAATCCAATGGATTTCCTTCAATGGATGTTGAATTATAAGAAGATGTGATTATTGCTTTATTTCT
TAGTAAAATGTCATAGGAAGGCAAAATTTGGGAATTCAAAATAAATTCCTTGATGGTGGAAATTTCCATC
AAATTATTGATGATTTTATTGGTATATTGAAACTTTGCATCAAACATTAAAGGCCTCCTAATAATTCATA
TCTGTGTTTATTATAATAAATTATCTAAATTATTATATATAAATTATGCATCAGAATTTAAAAAATATAT
TTGTTCGTGGCTTGATGAATAATATGATTTTGACTTGATGATTATTTTTAAACACTAATAAATAATCTTA
AATTATCATATAAAGCATTAATATTAGTGGAAATAAAACTGAATTTACTTGATGATTATCCTTGATGATA
AATAAAATTTCATCATTTAAAAAAAGAAAAATAGAAGAGCAATAAGCAAATTGCTCTTTTAAAAAAGTTT
TTATTTAAGTGTAAGTTTGGATTTTACGCTTGTTGCCTTATATGTTTCATCTCCGGCATACTTTGCAGTA
AAGCTATAAGTTCCTTTTTTGGATAATGAAACATTGACTTTAGCAAGCCCTTTTGAATTTGTGCTTGCTG
TATAAGTCTTACCGTTAACTGTGAAGCTTATCTTCTTGCCGCTTATTGGGTTTCCATTAGATGTCTTAAA
GGTGGCAGTCAATTCTTTTGTCTTTGCGCTTGCCTTATAAGACTTATTAGGGGCACTTAGCTTAGGGCTA
TGAAGATTTACAGTGATTTTTGCCACTTCAAATGCTCCGAGATAGTCCTCATCTCCAAGGAATCCTATGG
CGAATGTGTAGGTTCCCTTATATGCGAGGTTTATCTGCAGCTTTGCGCTTCCGTTTTCATCTGTGACTCT
GTCATAGACTCTTCCATTGAAACCTATTTTTATTGGCTTGTTTGTTAGGGCTGTTCCATTTTGGTCTTTT
AAGGTGACAACAAAGTATTCTCCAACTCTTCCGTCTGCACTTGCTACGGCAGTTGTTGTCATGTTCTTGC
AGTCTATTATTGTAGATGCTCTGCTGGATATGTTTTCCTTATCGCTTTCTATTGTATATACCTTAAGACA
GACTGTTCTATTCTTATCGGCATAATCGATCCAATTGCTGCCATCTGCACTTATCATAGACATATTAGGG
ATATAGTGTTGCCTTGAATATGCTTGGAAAGGAAGTGCATTGCTTTTGAATATTACTTTAAATGTGTCAT
TTGCCTTGATTGGAACATATTTGTCCAAAACGATTGTTCTGAATCCTGCAAACTCACTTGTTCCGTTTTG
GGAGTGTGCCTTTTCTCCATTTACATATATGTCAAAGGAATAGTCGATTCCTGATTCGTTGAAATAGGTT
CCAACAGCTCCAATCCACTCGTCGTACTTTGATACGAACTCATTGGAGTAATAGCTGTAGTTTTCATCAA
ATCCTGCAAGGCCTGTGATGTCTGTTTGATAGTTGACATGATAGTCGTTAGTGTTTTCAAAGATATAGGC
TACACCTGCAGCTTGAGGAATGACTGGGTAGAAATCCTTGGATAATATTGAAAGGTCATAATAGGATAGG
TAAACATAGCCATCTTCTCCTAATTTAGAATCTTCTGAATCTTTCATTAGCCAAGCTCCAGGTCCTGGAG
GAATATTGGTCTCGTCTATGGCCATTTTGGTATTTACTTTTTCAGGAGGGCAATTGTCATCCCATCCGAT
TAAGGTAACGAAATGTCCTGGCTGCAGGTCCACTTCAGTGTAATTGGCAGTGTAATCATAAGGAGCATAC
ATATATTGGATGGATACTGCACCATATTTCATTATTGCTTCCTTCATCAGATTCCTTGTATCGTTTCTTC
CGCCGAAGATTATCATTGCATCCTGAACATGGATTCTCTTATCGGTTTCTGCAACGTCAGAGTACATTCC
TCTTTCATCATATGGGTCATCTTCTGATGTGATGGCTCCATACCAGCTTAATGAATGGCCTAAACCACTG
TAAGCATAACCTATGGCACTGTTTCTTCTATCCCCTTCGGAGAAATATTTTAATTGGAGATTTTGAATAT
TGTTTTCAGAAATATTATATAAGACTCCAGTCTGCTTTAAAAGAGCGCATTCCAATGCTCCGGCAGTTGC
AAATGCCCAGCAGGCCACATTGTCTCCTTGGAATTTAAGAGGGCTAGCCCAACCCCAATCACGGCCGTCA
AATTTTGAAGGCAATTTATCTACATTGATTGTATTGTTTGTCAGATTAAGTTTTATTCCCTTATTTTCAA
CAGAAACAATATAATTGGTATTATTCCATAGGAATAAATCTGTAGAAGTGTTATTTTCAAATTTGGAATT
GCTTGCGAAGTTTGCATAGACTGCAACTCCTCCGTTATCAAATATGGAATTTCTTATCTCTGCATCTACG
TCATTGGCGTATATGATGCTTTCTTTGCCTGAAGAGATATTATTCACCTTATTATCTGTAAAATTGGAAT
TATCAATTATTAATTTGCTATAATCAAAGTAGATTGCTCCTGCGTCCTTATCGGCGCTATTGTTTATGAT
ATTGCAATCTTTAAGACTTAAATCTGCCCAGGAACTGTAGATTGCACCTCCTATCTTGGCATGGCAATTT
ATGATATTTAGATTGGAGAAGTCTAGGATTTCTCCTTGGCTTGCAATTGCTCCTCCAAAGTCGGATGAGG
CATCTGTTATGTTGCAATTGTTAATATGGATAGTTTTTGCAAAGCCCTCAGAACTTGAATCCAGATTCAA
GTAGATTGCACCTCCGTTATGAGTTGATGAGACATTGGAAAATTCACAATTCTCAAAAAGCATGTCTTCA
CCCGGAATATAGGGGCCATCTTTATTTGTTTTTGGGAAATACTTTGCAAAAATTGCTCCTGCAGTTATTT
CGGCATTCAAGTTCTTGAATTTTGAATTTTTAATGACAAAGGTGTTTCCTTTGAAATTTATTGCTCCTCC
ATAGGGGGCAGTGAAATTTTCAAAGCTGCAGTTATCTATATACAATTCGAACCTATTGGCATAAATAGGG
CTTCCAATCCCTTTTCCGTTGGAGAAATTTGAATTTGTAATTCTTAGCTCTGCAAAATTTGTGTATATGA
GGTTAGTATTATTGTTTGAATCGAAATTACAGTTATTTATAGTTAATGCTCCATTGAAAACTGATATCAT
TCCCTCTGAATACAAAATGCCCAATTTATTGTGATTGTTAGTGAAATTGACATTATTTAAACTGATATTT
CCTCCGTCTTCATTAACTATGGTGTAATCGTTGCAGTTAATGAAAGTTAAGTCATTGATGATTATATTTA
GTGATTCCTTTAAAAATTCAAATCCTCCAGCTTTATTGGATCCATCAATGACATGGTTATTTCCGTTTAT
CACTAGATTGGTTTTATTTATGCTTATAAAGGTGTGGTTATCGCTTTCAGTGTATTTATAGTCGTTTTCT
ATATTGAACGTATCTTCGCAGTTTTTTATGTCATTATAGAGATCATTATAGGTCTTATCTTCAGATGCTT
TTAGCAAATCATTTTCTTGATTATTTGCCTGCAAATTTTGGTTTAGATTTGTATCTGATTGATATGCTTC
ATTTAATTGCAAATCTTGATTTATATCTTGATTTGCATCATTTTGCAGATTTTGATTTATACTCATATCA
TTATCATTCGCTGAAACTGTTGAAATACTGAATAGGATACATATTATGAGTAAAAATACAAAATACTTTG
ATTTTAACTTCATTTTATACCTTCTTATTTAAATTTTGATAGTTGTTTTTTTATATCTAATTCTTATTCT
TTTTAGATATTTTTAGGCATTGACTTTTTTTTCTTATCTGGATATTTTTGATTATTTGGCTATTTTTTAA
TTATTATTTATCCTTTAGTCCTTAACTTCCTATAAGCTAGTGCAGTGACTGTAGATATAATCAGCATACA
TATTGAAACTATTGTAGTTACCAAATCATCAAATACTAATCCTTTGGAGAAATAAGTGATTAAGATTATT
GTTACAGGTATATAGAACCATTGTGCAATATAAATTTCATTAATATTGCGGCTTAGTGTTGAAAAGAACT
TGGTAATTGAATCTGGCAGATAATCTGAAATCCAATAGCATAATCCGATGAATGCGTGGGCATTTATTAT
GCAGAATACTGCATCCAATGTGTTTAAAAAGTAATATAAGTGAACATCCTCTGAAAAGACTCCTCCCCAA
TAGCGTGAGGATATGAAGAAGTAAGCAAAAGCCACAATCAATAGGATCGGCCAGTATTTAAAGAATTCCC
TTTTGTCCTTGGCTCTGATGAAATACTGTCCCCAGACGTATCCCGCAACTGGGAAGATAAACCAATTGAA
TAAAGGAAATGCGGTATGTCCGTTTTTAGCTCCAATGAAGTGACCGAAGAATGAGCATACTGCAGGGATT
CCAAAGTCAATTCCTATTGTGAAACTGCCGATTAGAGACATTATAACTGCAATTATAATCATAGCTTTAT
TTGAAACTTCGAATTTCCTTAGGATTCCCATAAGGATAAATGCCAAACCTGCAAATGCCAAGATGTCAAC
ACAAAAGATTATTAGTCCTCCAAATAGAGGGAAAGCCTCAGCATTAACGCCAAGGTATCCGGCAAGATAA
TGAGGTAAGAAGAACTCAAAGACATTTACCAAAAGGCCTAAGAGATATAGGATAATTCCTCTTTTAATCA
TCAAGTTCCATTGGCTGTGCCTTGAATATACCACACCGACTCCCATGCAGAACATGAAGACGACTGCAGC
ATAAGGCCTTCCTAAGACATTGCCGATTATATAAGTATAAGTTGGGCTTAAGCCGACATTATATGCTTCA
ACTATCATGACAGTATGTAAAAAAATCATAAATATGATTGCAAATGCCTTAGCGATATCCAGTTCGACTT
GTCTTCCTGTATTAACTTTTTCATCTGAAAATAAACTTGAAATATTCATATTATTATTTTATTTTGGGAT
AGTATATATATTAATGGCTTTTAGAATTATTTTTTTATGCTTTTGCTATTAGAACAAATGATATATGTTT
TTAAAATAGAATAAGTCAGTTAAGGAATTAATAGCGGAAATAAGTAAAATTAAGAATAGTTGACTAAGAT
AAGATTAAAATAAAAGTAAAGTTAAAAATAATTTATTAAGATAAGATTAAAATAAAAGTAAAGTTAAGAA
AAAAAGAAAAATTAATTATGTTATCTAACATTCTAAGAATTATTGACATTCTAAGAATTATGTAAGAATA
GTAAAAGAAGAATTATTCTTCTAGAGCAGTACTGTACTCTTTTTCTAGAGCAGTTTCATCATTACTGCAC
TCTTTTTCTAGGGCAGTTTCATCATTACTGTACTCTTTTTCTAGGGCAGTATTATCATTACTGTACTCTT
TTAGTTTCTTTAAATTCTCTTTTAAGATTTTATAAATACTTTCAGCACCAACAATCTCTTCATCACTGAC
ATTCCATCCTGACGGATATAAGATGAATGGTTTTGATTGGCTTCCTCCAACTCCTCCATGGCTTCCAACC
AACTCTTCAAATGCACAGACCTCATCATTTTCACAGTCATAGAAGCTGTTTACCAATATATCCGGTGTGT
ATTTGAATGAGCTGTTTCTTTTAAGGTGTCTTGCAATGTTTTTGCCAAATCCTTCAAGAGGATTTCCTCC
TATAATATCTCCAGTGTCTAAATTGTAAATGCCCTTTTTACCCATTGCAAGGTCTCCTTCATCTGATCTG
ATGACAATAAATCCTACATATTCATTTTCAACGATTCCAGGAATCAGTTCTGGGAAGAATTTATTTATCT
CTTCTATGCTTAATCTATAGTCCCATTGGGTTAGATAGATCATTGCAAGATTTCCTGAGGCAAGGACAAT
AACTTCAGAGTCTCCTAACTCTTCTAGATCCTTTTCATCTATCAGATCATCGTTCTTTCTTGAAAAAGGA
AGGAATGATTCGGCATAATGGTCTTCATTTGATGACATTTTTGCAAACATCTTCATCTCTTTTGGAAGCA
GGGACTTTACATAATCCTCAAAGGATTGGCCGTATCTCTGCTTGAATGTTGCACCGTTTGTTTGGCCGTG
GTCTGACTGAATGACAAACTCATATTTTCTAGGAGTGTACTTATTTGTATTTATTAAACGCTCTATCTGC
TTGTTCATTCCTTTAAGGGCATACCAAGAGTCCTCATCGCGAACGCCAGAATGGTGAGCTATCTCATCAT
ATCCTAAATAGGTTGAATATGCAACGTCAATGTCGCCGACCATCATGTCTCCAATCAATGTTGAGGTGTT
GATTTCCCTCATGAAAACATTGGTTGCAGCTCTTGTTGGAATATAGGCTATGCCACGTTTGATTCTAGGC
CTGATGTTCTTTACGCTGTGCTTTATTTGGGATATGATTTCCAAGGTCATGTCGTAAATAAACAGGCATA
CTATACGGGCAAAGTTGCTAGGATTTGAGAATACTGAAAACCATGCCTTGTTGTATAGTTTTCGGATGTT
TAGGATTTTGCTGAATGTAAATATTACATTGTCTGTATCACCGGAGAAGAGATTGGATCTGCTGGCTCCA
TTATCTACAAGAAGCCCATTTCCATCTGAAATTCTCTCTTCCAATGTTGTTACTTGAGTCACTCCAGAGC
ATTGCATCATCTGATTGTTGTTTTTCTTTTCAATCCATCTGAATGCGGTGATGTCTTCATTATTTCCATG
CAGTATCCCTGCCTGGCTTGCCCCTGTTTGTGAGGATAGGTCTGTCTCCCACATTCTTAGGGTATGTGTA
TTATCAATCATTGATTTGAGGGTAGGCATATATCCCTTATCAACCGCTTCCTTTAAGACGTCATATGCAA
GACCGTCAATCTCAACGATTATGAGTCCCGGATAATCTTTCACTTCCCCTTTTCTTTTCTTTTCAGCATC
CCTATAGACTGACCTGTAATAGGATCCTTCATCTTCAATGGTTAATATTGTAGATAGGGCTGTTGTAACA
AAGGACATTGCTAGTGGAGCTAAAATTATTGCAGGGCCTTCCACATTTATGCCGAAAAGGGGTCCGCAGA
AGTTTAATAATAGGCCATTTAGAATAAGTGTCCCTATTCCAAATGATAAAACGAGAAATGGCATTAGGAT
TCTGGTGAGTATAGGCCATAAGATTGCATTGATTAGACTTACAAATATGATGAATAGTGCAACATCATTG
AAATTGGTTAATTTAACTCCTAATCCAAAAAAGCTAATTAAATACATTCCTATTATGTTTCCAAATAAAT
ATTATTAGGCTTCTTTTAATTGTAATTTGAGGAGGCCTTTCATAATCTTGGATGCGTTTCATTTTATCCC
CTATTAATCTTATTTTGCTTTTTAAAGAGTTTGCTATTAAGGCAATATCTTTTTTTTTTAAGAGTTAACT
ATTAAGGCATTTTTTTTAAGAGTTTACTATTAGACAATTTATTTTGCTTTTTAACTCTTATTGTCTTGAG
GAAATTTCTTAAGTTTTTAACATTCCTTATACAATATTATATTTATTTTTAGATTAAAAAAATTTTTTGT
AAATTTTTTTAGAATTCTTTAGGGATTTCTTTTAAACGAAAGTAAATTAATTTTTTTGGGATTATGGGGT
AATGTGTTTTTTTGGGATTATGGGATTGTTCATTTTAGTATGGATGAGTATGGATGATTTGGAGCATCTG
TACATAAAAATATTAAAAAATGAAGCAGATGTCTTATCAATTAGGATTATAATTTTGAAATAATACTTAT
CTTTATATATTATTAATAAAATATATATAAATGTTTTATTTAACTTAATTTAATTAAAGGTGAAACAAAA
TGGATATAAGTGAAATAATTGGAGATGCAATTGCATATCCTATACATAATATTAAAGCTTTAGTAATTTA
TATGATTATTGGAATCATTACTGGAATCTTAGGTGGCGCAAGTTTCATGGGCTTACTTATGAGCCTAACA
GGCAAAAACGCTCTTGCTGCTGGAGGATTTGGTATCCTTGGAGTATTAGTTCTCCTCATTGGAGCATTAT
TAATTACAGGATATGGTTTGGATATTGTAAAATTTGGTATTGAAAGAAGAGATGACGGTCCTGGAATTGA
CTTAGTAAGACAAGTTTTAAATGCAGTTAAATTACTTATTGTCAGCATTGTTTACTACATTGTCCCTGCA
ATTATTGCTTGGGTATTGTTTACTCTCTTAGGTAGGGGTATATTAACTGTACTTATTGTTATGATAATTT
CTATTATCTTCGCATTTGCTGAATTTATGGCAATATGCAGATTAGCTAAATATGATAGTTTAGGAGAAGC
TTTAGCAATCGGTGAAGCTATTGGTGACATATCAAAAGTAGGTGTAATAAAACTTCTCGCAACTATTATT
ATAGTAGTTGTCATTGCAATGATCGTATGCTTTATCTTATTATACGTTTATAAATTAAATAGCCTCATTG
GAGGAATTTTATTGGGTATATTTGCTGTATACCTAACATTCTTCGCCAATAGGGCAGCTGGTTTATTATA
CTCTGATGCATAAATAAACTAACTCTTTTTTCTTTTTTTTTATTTTATTTTTCTATTTTTTTTTATCATG
ATTTTATCTTTTAGGGATACTTTTTCTATTTTTTTATTTTTTTTTATCATGATTTTATCTTTTAGGGATA
CTTTTTCTATTTTTTTATTTTTTTTTATCATGATTTTATCTTTTAGGGATACTTTTTCTATTTTTTTATT
TTTTTCTCATTATTTTATCTTTTAGGGATACTTTTTCTATTTTTTTTCTATTTGTTGATTATTTTAGGGT
TATTTTATCTTTTAGGTGATGTTTTTTCTATTTTTTTCATAGGGTGCTTTTTTATAGTTATTTGTCTTTT
TAGTAATACTTAATGCTTGATTTATTATTTTTGCTATGGGCTTTTTTAAACTAATTTTAAGACTATACTT
TAAACAGTTTCTTTGCATTCTCTGTTGTTATTTCAATGATTTTCTCTTCTTTAATATCTAATTCTTCTGC
TAATTCTTCTATAATGTATTTTAAGTTCAGTGGTGTATTATTCTCTCCCCTTTTATCTTCTGGTGGAAGA
TATGGTGAATCTGTTTCTATAAGTATATGGCTAATTCCTACTTGATTTACTGCTTTTCTTATTTTCTTGC
TGTTTTTGTAGGTGATTGTCCCTCCTATTCCTATATAAAAGCCTAATTTAACAAATTCCCTTGCCATTTC
TGCTGAACCTTGGTAAGAATGAAGGGATCCAACTGCATTGTGATTCTTTAGTATGTCATAGGTGTCTTGT
GATGCCTTTCTAGAATGGACTATGACTGGTAGTTTATGCTTTTCAGCAAGATCTAACATCTTTTCAAAGA
GTTCCTTCTGACTGTCCTTATTTTCTTTTGTATGGTAATAGTCAAGTCCTATTTCTCCAACAGCTATTAT
TTTGTCATTATTGAGTTGACTGTCCAATAGATCAATCTCTTCATCACTTATTTCATCTGCAAGAGTATAG
AAATATCCTAAAGCTCCATAGACATTATCATATTTGCTTGAAAGTTCTAAAATCTCCTTATTGCTTTTGG
GATCAGTGCCGTTTAATATGAGGCAGATGTCGTTTTTTTGAGCTTCTTTGATTATTTCCTTTGCATTTTC
CATTTCGCTATTGTAGATATGGCAGTGTGTATCTATAATCATATGAATCCTCACTTAAATGATTATTCTT
TTTTCAGATAGTCATTATTTATATTCATATATAGTTCTTTCAGATAGTCATTATTTATATTGATATATGG
TTCTTTTTGCATTAAGTTTTTATTGTTTTAAGCCCAATAATTATATGATTGATTAAATTTAACTCTTTTT
TAGTTATATTTATTTTTTATAATTTAATTTATTTTTTGGTGAGTGGAAATGGATGAAAAGTTTTCAAGAA
CAGAAATGTTAGTTGGAAATGAAGGAATGGAAAAATTAAGAAATGCAAAGGTTGTTATTTTTGGTCTTGG
TGGTGTAGGTTCCTTTGTTTGCGAAGGACTTGCAAGAAGCGGTGTAGGTAACTTTGTCTTGGTGGATTAT
GACAAGGTGGATGAAACAAATATAAACAGACAAGTAATTGCCACAACAAAGACAATCGGCCAATGTAAGG
TTGATATCATGAAGGAGAGGATTCTAGATATCAATCCAGATGCAAATGTTGAGATTTATAAGGAATTCTA
TTTGGAAGATTGTGAAATAGACATTATTACTAGTGATTTATCCTATGCCGTTGACTGCGTTGACACAATC
ATGGCAAAGATTGCAATTATCTGCAAGTCTAAAGAGCTTGGCGTTCCAGTTATATCATCAATGGGAACTG
GAAACAAGTTGGATCCTACTATGTTTGAGGTTGCTGACATTTATGAGACTTCAGTATGTCCTCTTGCCAG
AATTATGAAAAAAGACCTTAGAAAAAGAAATATAAAAGATTGTAAGGTGGTTTATTCTCAGGAGCTTCCA
AAAAACACTAATGATTGTGATATAAATAAAAATAAGGGTAAGGTAAAGGTAAAAGGAAGCATCTCTTTTG
TCCCATCTGTTGCAGGTTTAATAATTGCTGGTGAAGTAATAAAAGATATTGTCAATGCTAAATAAAATAA
AATTTTTGGTCAAGGTTTTTTGGCCTTCGGCCAAAAAAGCTTGCTTATTTTTCCTTAACTACTTTCCCAC
TCATATGCTCTATGCTGATTTCATACAGTTCTGTTACATCCAAAAGCCTATCAATTTCATCTTTTGTTTC
CTCTTCGCTTGGGAAGAACTTATTTCCTAAATAGGTGAGCTTTTCTATTTTTGTTTGCTTGTCATTGATT
GTTTTCATTCTTCCAAAGACAATAACACTTTTGAATGTGTACCACCAACTATCTGACTTTGTTCCTTTAT
CCATTACACAAAAGGATACTTTATCGTGTTTTTTGATTGCATCTCTTTTGTGGCTGTCTTTTATTGTTCC
ATGGAAGTATATCTTTCCATCTACATAGACATGACTTAATGGAACTGCATAAGGATATTCATCATCTCCT
AAAACTGCTAAGACTCCACGAGGTTCGTTAATTAGGATATCGATACATTCCTCTTTGGATAATTCTTGTT
TTGCTCTTCTCATTTTTCTAAACATGTTTAAATATTGGTGGAAACTTATAAAAATACTTATTGTTGCTTT
TTAAGTTTTTATTGTTGTTTTTTAAGTTTTTATTATTGTTTTTTAAGACTAGTTTAGATTTCTTTAAAAA
TAGTTGTTTTTTGAGCTTTTTAGATAAGTTTTAAAAAATAGTAAGCGCTATGAAGAGGATTTGAACCTCT
GGTGCTCTCGCACATCCGCTCTCCAGGCGGACACCTTAAGCCTGACTCAGTCACCATAGCATTTAATTTA
AAGTTTTAATTTTAATTTCAGTGTCAATTCAAATTTATAGTTTAGTTTTAATTTAAATTTTAATTTATAT
TTCAATTAATTCCTTTTAATGTTATTTAACGCCATGAAGAGGATTTGAACCTCTGGTACTTTCATACGTC
CGCTCTCAAGGCGGATACCTTAAGCCTGACTCAGTCATCATGGCAATTTAATTTAAGGGGAAAAGATTAA
TCTTTTTATAAGATCAATCTTTTAAATTTATGGGAAAAGACTAATCTTATTTATCTAGTAAAAATAGTTT
TAATCTTATATTTATGAAATAAGATCAATCTTTTTAATTTAAGAGGGAAATATTAAACCTTTAAGCTTTT
TTAACTTAAAGATTTAAATGAAGATAGAAAGATTCGAACTCTCATCTCTTGGTCTGGAGCCAAGCATTCT
TGCCGTTAAACTATATCTTCTTTTTTTAAAGCTCTAGCTGGGACTTGAACCCAGAATTCACCTTTAGAAG
AGGTGTTTGTTTCCAATTACAACACTAAAGCAGATGGACCAGTTGGGAGTCGAACCCAAAGTCTTCTCCT
CGCAAGGGAGACGTCATACCAATTAGACCACAGGCCCAGTATTTTTTTTTATATATGAAAGTGCTTTAGC
TGGGATTCGAACCCAGATTTCACCCTTGGAAGGGGCGGGTGTTGCCAATTACAGTACTAAAGCAGAAATA
GACCTAATGGGATTTGAACCCACAATCTTCTAGTCCGTAGCTAGATGCTTTTTCCGTTAAGCTATAGATC
CATAATTTTTTAAGAGATAATGTCCGGAATTGCACCGAAATAAACTGCTTTGCAAACAGCCACCTTTCTA
GTCGGTCACATTACCATAGGGACACATAAGGGATTTGAACCCTTTCCACAAGCTCCACAGACTTGTATGC
TAGCCATTAACACCAATGCATCCATAAGAAAGATAATGAAGATAATAATGGAATAATTCATTGATTATCT
GATTCAACGTTTTTATTTTATTTTAACGCCTCCGCCGGGATTCGAACCCGGGTACCACGGCTGACCACCA
TGGATACTAGGCCACTATACTACAGAGACATGATTTTTGAAATTGGTCTGAAGGGATTTGAACCCTCGAT
CACTTGCATATCAGACAAGCGCCTTACCATGCTTGGCCACAGACCAAATTGATAAATTTTATAGGGCAGA
ATTATTTATCACTCAAATTGTTGTTTTTCTAACGGCGTGGATGGGATTTGAACCCATGAGCGTTTTATCG
CAGAGGATTAGCAGCCCTCCGCCCTACCGAGCTAGGCCACCACGCCAGTTTAGTGCTTCTACCGGGATTT
GAACCCGGATTATCGGATCGAAAGTCCGATGGGTTTGCCGATTACCCCATAGAAGCAGTGAGCCTGAAGG
GATTTGAACCCCTGATCTTCCGGTTAAAAGCCGGACGCCTTGATCAGACTTAGCCACAGGCCCCTATCAA
TTTACTAAAGGGTTGGAGCTATTACCTCCAACCCTGCACAAGGTGACAAATATTGCATATTTTATTAAGA
TTAATATCTTAAGCGGTTCTAAGAAGATTCGAACTCCTATCTGCCGGTTAACAGCCAGTTGTTTTACCTG
TTAAACTATAGAACCGATTTAAGCTTAAATCACTGCATTAATAATTTAAAAGAGTGGGGCTAAAGGGAAT
CGAACCCATAACCTTTTGGATGTCAGCCAAACGCTCTGCCATTGAGCTATAGCTCCATAAGATTAATTTA
ATTAATCTTCATATAGTTGAGAAGCTTTTTAAATTATTTCGACCTGCTTGTAATTTAAGCTGTAACTTAT
GAAATTTTCCTTAAAATTTATTTACTTTCTATTTCTTTTATTACCGAAATTGGCTAAAATTTATTTCATT
AGTTTAAATTCATTTTAAGGAGTTAAACTTATATTTTTTTTTTTAAATTTATGAAGAAATCCATCTTCAT
ATAGTTCTATCCCGTCTCGAACGGGAATCTCCGGGTCCAAAGCCCGGAATGATTGCCAGTTACACCATAG
AACTAATTGATGGGATAGCCAAGATTTGAACTTGAGTTTGTCGCTCCCAAAGCGACGGTGCTAGACCACT
ACACTACAATCCCATAATTTTAATATATTTTTGATTCTTTCTGGATTTTTTTTAAAAAACACATTCCTGA
ATTTGTCAAGAAGATGTTAAGTCTCCGCGGAGGGATTCGAACCCCCATAAACGGTTCTACAGACCGCCGC
ATAACCACTTTGCTACACAGAGAGTTAAAGGAATATATTCTCATGGAGTTGTAATTATGGTTGAGATCTT
TATTAGTACATAGGAGGAAAAACATTAAATTTGAGATATTAAAGAGAATATATTCCTAATTGATTAAATA
TAGTTTAAAACTAATTAATGGGTTCAGTAAATTTTTTTAGTTTAAACTTATTTAAATGGGACATGCTGGA
TTTGAACCAGCGATGAACAGATCTTCAGACTGTCGCTTTCCCGCTTAGCTAATGCCCCAAAAATCTAATT
AGTAGTGATAAATTAAGTTAAAGGCTAATTAAGTTATAGGTGTGTGTTATGAATATTTGTGAATTAATTG
CATTAACTGAATTTTAAATGATTTTTTAGATGATTGCGTCTCTAAAATCAATCGATTTATCAAAATATAA
ATTAATGGAGTTGACTTTGCTAATTTTAATGATTAAAATCATTGATTTTAGATTTCAAAATCCTGAAACT
TAAAAATCCTTTAACTTAATTGTAAAAATACGTTTTATTAGAACTGTTTTAGGAATTATTTTTCCCAAAT
AAACTATAACTGTGTGGTGAATGGTTGGTATATATGGTTTGGTGTTGGTGTTTGTTTTTTGGGTATAGAA
TTTTCTTTTATGATCCCAACACAAACCTGTCTACCACATCTTCACCAATAGGGCAATTATAGCTGCAGGC
ACTATCTTGTGACTGTCTGCTGCTATAATCTCCTTCAATAGAAGATTTGGGATTAATAAAATTATTATTA
CTATGAATTTTCATTTTATCACGTTTTCTTTGTTTTTTCGTTGTTTTGTTTTTTCCATGAAGATAATTTT
TATCTTCCAGTAGCCGAGACGGGATTTGAACCCATGAGGAGACTAACTCCCTGGATCTTAAGTCCAGTGC
CTTACCAAGCTTAGCTACTCGGCTATTTACTTTTGATAATTTTTCTCATCATCAATTAAACTTTTGTTTT
GTGTATATATAAGTTGAATAAAGTTTTTGCTTTACTTGGGCCTTTCCTTTTGATAAGATCTTTTTACAAT
CTTTTAGAAATTCCTTTTCGGATATTTCCTATTCTATTGTCTGTTTTGGTTTATATATAAATTGAATAAA
GTTTTTGCTTTATTGAAAGTTATTATTTGAAAATAATTTCTTTCAAGAAGATTTTTAAATCTTCATAGCT
GCGATGGGATTTGAACCCATGATGAGACTAACTCCACGAATCCTAAGTCCGCTGCCTTAGACCTGACTTG
GCACTACACAGCTATTTCATCTTGATGAATTTTCATCATCAAATAAACTTTTATTTTGTGGATATATAAA
TCGAATAAAGGAAATTCTTTAGTGAAGAAAATTAGTTTTTAAATCAATCATTGATTGAATAATAAAATAG
TTTGATAGGATAAATAAGTTAAAATAAGTTAAAAAGGGTTATAAATAAGTTAAAAAAGGTTATAAATAAG
TTAAAAAAGGTTATAAATAAGTTAAAATAAGTAAAATTAATAAGTTAAAATTAGAACTAATAAAATATAA
ATAAAGTTAAGAGTAATTGCTCTTAACCCTAAATAAAAATTTTGATCAAACTTTTTTTAAAAGTTTGAAG
CTAGAACCAGTCTTTAGAAGCTTCTAGAATCTCATCTACTATGATTGGTGCAGAACCAATATAAGTGTGA
GGGTCCATGATTCTTTCAACGTCCTCTTTGCTTAGGAATTGACTTGCATCAGGGTCTTCAAGGATAAGGT
CTGCAAGGAGAAGCTTTTCCTTATTTGCTTTTATCGCATTCTTTCTAGCGACCCCATAAGCTGTTTGCTT
ACCCATTCCAGCTCTTGTAAGCTCTGCCATTAATCTTTCAGCCATGATGAGCCCATTTGTGAAATTAAGG
TTTCTTTCAATGTTTTCATCATAGAAGATAAGATTGTTCATAAGCTTGATTGTAAGGTTTAAGATGTAAT
CTGTAAGAATGCAAGCTTCAGGGAACATGATTCTTTCACAGGAAGAGTTTGTAAGGTCTCTTTCGTGCCA
GAGAGGGTTGTTTTCCATAGCTGCATTTACATATGATTTTACTATTCTAGCAACACCACAGATTCTTTCT
GCTGTAATTGGGTTCATCTTATGTGGCATTGTACTACTTCCAACTTGCTTTTCAGGGTCGAAATATTCTC
CTAACTCTTGAATTTCAGTTCTTTGTAGGTTTCTAACTTCAAGAGCTATTTTGCTAAGGGTTGTTGCAAT
GTTTGCAAGGGTAGCTATGAACTCTACATGATTATCCCTTTGAAGGACTTGGTTTGTAATTGGGGCTGGC
TTAAGGCCAAGAATTTCAGATACCTTCTTATGAACTTCCCATCCTTGGGTTCCAAGAGCTGCAGTGGTTC
CCACAGCACCATCCATCATTCCAAGACATACATTGTCCTTTGCATGCTGCAACCTGTCATATTGCCTGTG
CAATTCATCGGCCCAGATTGCAAATTTCATGCCGTAGGTGGTTGGAAGTGCATGCTGTCCGTGTGTACGG
CCTATGCATACCTTTGTTTTGTTTTCATCTGCTAATTTAAGAATTATCTTGGTTAATCTTTCGATTTTTT
CTTCTAAAACTTCAATGGAGTCTTTTAAAAGCAATGAGTTAGAGCTGTCTACAATATCGTTAGAGGTTGC
TCCAAAGTGAACGTATTCTCCAGCCTCACCTTCACATACTTCGCTTAATCCTTTTGATAGGGAAGCGATA
TCGTGTTTGGTTTCAGCTTCAATTTCACTTACGCGCTCTAAGGTTACATATTCAATGCTTGCTTTTGCTT
TGATTTCATCTGCATATTCCTTTGGAATTATTCCAAGCTCACCTTCAGCTTGAGCCAATGCAGATTCAAT
ATCTAACATTCTTTGCTGTTTGTTTTCCTGCTCCCAGATTCTTTTCATTTCTGGAGTTCCGTATCTAAAT
TCAATTGGATGTATTGCCATTTAAACTCTCCTATCCTTTCGTTAATAGAATAAATATTAATTTTTGCTTT
ATAGTTTATAGTTAAGCATATTATATTTCTAAATTATTTTAAGGCCTTTTTAAATCACGATTATAACGTT
TAGGCCTTGATTTGGATTTAAATTATTATAAAAAATAAATAAAATTATAATAAAAAAATATATTTAGAAT
ATACATTCTTATTTTTGAATTTTAGATTAAATATATTTTATCAATTTTATAATCTTTGATGATAAAAATT
TCAACATTTGATTTTGTTTTATAAAAATTTATAAATAATTAAATTAAATTATTATTATTAATTTAACTAA
AGAAAATTATTTTATATAGAAAATATTATTAAACTAAAATTTATTTTCTAATTGAATAATCATTATTAAA
CTAAAAACTTATAATATTTTTAAAGGGGATGAATATGGATTTCAGCGTAAAGGATTTTAATGTACGGCTC
CGGACAATACGTATTTGGGAAGTAGTCATAGCTCTTGTTGTAGCATTCTTTTTAACCGGATTTACATGCG
ATTATTTTGGAATCTACTCTGGAGAGGCAGAGTATATCATATTCTTCTTGTATATGATGGTCTTCTTTGC
AATAGCCTCCATCGGGACACATGGGTTTAAAGATGACATATACGGTGTATTCAAGGCCTCCAATCTGTTT
AAGGTCATTATGATAGTCATACCAAATATGCTCTTGGCTTTCTTTATACAGCAGCATCTTGCTGGTTTTG
ATGCTATGTTTAATAATATCAATTTATTAGCTCTTCCAGTTTCAGATTTGGCTTATGAGGCTTCAAATCC
TCTCTTGTTCCTTTTTGAATTCTTTTCAGCAATCTTCATTGCGCCTATTTCAGAGGAGCTCTTCTTTAGA
GGAATCTTATTCAATAGGCTTAAGATAAGAAAAGGAGTTATATTTGGAGTGGTGGTATCTTCAATCATCT
TTGGATTATGCCATTTCAATTATCCAGACCATTTGGCTCATATAATTTACACTTGCCTATTTGGAATGTG
CTTATGCATTCTCTATTTGAGAACAGACAATCTATTGATAAACATGTTTGCACACTTCCTCTATAATCTA
TTGTCTTATGTGATAGTATACACTCCAATAGGGGATCTCTTCTTAGGAGGTCCGTTTATGGATTTCACTG
TCATAGTCTTGTTGTTTTCAATAGTATTTGTTCCGGCGTATATATTTTATTTCTCTATAAAGCTGAAATG
AAGGTTTATTTTTGGATAAGCGAAAATTAAATAAATTTAAATAATTTAATAAATTAATTAATTATATTCT
AAAAAATTGTTTATAGTAAAAACTTAATTTATAATTATATTCTATAAAAATTGTTCATTTAGTAAAAATT
TCATTTATATTATTTCTATAAATTATTTTTATAAAATTAATTAGCAAATAGGAGGAAAAGTATGGATTTT
AATGTAACAGACTTCAATGTTAGATTAAGAACAATTAAGCTTAGGGAATTATTAGTAGGTATTGTCATTG
CTTTTATTTTATCCATAGCCCTCTTAATCATATTTCCAGTTATGGATAGTTATGATGATTTGGCTTTGAT
GGTTTTTGTATTCTTCTTATTCATTTTCTTCCTTTATGCTTTAAAAGGTACCTCTGGTCTAAAACAGGAT
TTCAATAAACTATTTGAAAGGGACAACAGTCGTGAAATTCTTTATGTGCTCATTATCAATATGTTGTTTG
CTTTTTTAGTCTTGGCTATATTTTCCACTTTCGATGCATACCTTACTTTAGCTGATTCGGAGTGGGTTTC
TATCCTTGATTTTACTCCTACTGCTATTGATCCTGCAGTTTTTCTATTTGAATCTTTCACTTCCATTATA
ATCGCTCCAATTCTTGAAGAATTGGTCTTTAGGGGAGTTTTATTCAATAGGTTAAAGATTAGAACAGGCA
TTCTTCCGGCTATGTTAATCTCTTCATTCCTATTTGCAATAGGTCATGAATTCGGCGGAATGACAAGTGC
ATTTGTATTTGGAATGTGTATGTGTGTTCTTTATCTTAAAACAGATAATATATTAATGGGCATGTCTGTT
CATTTCCTGAACAATCTTATATTTACAGTATGGGACTTATTTGCATTGGATGCAATTGTTTTCCAAATGC
CTGTATTGCCATTGACTTTACTCATTTCCATTATTTCTGGATTATTAATAATTCTTTATTTATATAAGGA
GATTGGTAAATTACTGGCTGAATAGTGCTTTAATTAATTTAAACACTATTTTTACTTTTTTACTTTTTTT
ACTCTTTTTTTCTTTAGTTTTACTATTTTTTTTCTTAGTTTTACTATTTTTATATTTTTCATTAAAATTT
TATTTTGATTAAACATTTTTGATATTTCACCAAAAATTTCTAATTTTAATTCCAAATTTTTCCATATTTT
ACAAAATTGTCGAAAGATTTATATATGATGTAATATAATTTTAACATGTGGAATATATTTTTAACAAATG
TAATATATTTTTACATTTTCCATATTTTTTATCCAAATTGTTTAAAGTGATCATATGAAAACAATAATAC
GATATCTAAGGCAGGAGGTTAAGATGAGTCAGCAGGATTTAGCAAAATCTGCTGGAGTAACTCGTCAAAC
GATTAATGCTTTAGAAAATGGACGATATAATCCCTCTTTACTTTTAGCATATAATATAACAAGGATTCTA
AATAAAGCCACTTATGGTGACGATGTAGATTCCTATCTAAGTATTGAGGACGTATTTAAATTTGATGATG
ATGAAATTTCAGTTTAAATTTGACTTTTAAATTTGAATAATGATTTTGAATTTCTGTTTAGCTTTGATTA
AAATTTTAAATTTGAATAATGATTATTGATTTAATTTAAACTTGACTAGTCATTGTCAAATTTGATTATA
ATTTTTTAAAAAATCTTAATTTTTATATAATTTATTTAGGGGATGATTTTGTTGATATTAGACATATATA
AAGATTCTTTAGAATATTCGGCTAAGGATTTAAAAACTTTATTGATTATTGGAGTATGTTATTTCTTAAG
TTTCCTTTTCCTTCCAATGTTCTTGATTTACGGCTATTCCTACAGGGTTACAAAGGTCTCTGTAGAAGGG
ATGATTAACGGTAACGATCCATTGCCAGAATTTGATGATGTGATTGGCATGTTTGTTGACGGCATAAAGG
TTTGCCTGGTCTATCTGGGATATGCGCTGGTTCCAATAATAATATTCATGGTCTTTGCTTTAGTCTCCAG
CGCTATTGGAGGATATGGCGAATCTGTATTGATGGCATTTGGCTCTATTATTACTCTTCTAGCCATAATC
GGCGCTTATGTGATGAGCATGTTTGGAGTTGCAAACATGGCTAATTACGACGGCGCATTGGCAAAGGCAT
TTGACATTAAGGAGATTATTGAAATCATACAGTCCGTCGGCGTTGTAAGAAGCGTAGGGGCATATATTGG
ATTGGCTATTATTTGCACTGCAATCTTTATGATTGTTGGACTATTGCTCTTCTTTGTATTCGGATTCTTT
GGAATAATCACTGGAACCTTAGGGTCCTATACTGCAGCAGGAGGCATATTCATTGCAGGAATTATCTTAG
GTTACTTCTTAATGCTATTCATTGTAAGTCCTTATATTTTGATTATGCAATCAAGAGTTGCTGGATTATT
ATATAACCTTCATTAAATCTAATTTTAGTTATTTTGGTGAGTTTATGGCTAGCATTACAGACATTATAAA
GGAAGGACTTAAATATCCATTCAATGACACTAGAAAGGTATTGATTCTTGGGCTAATATTCCTCATCTCT
GGGCTCATTTCCCTTTTCACACAGTATGTGGTTTATGATTCCATGACCCTTATGGTCAATGCCTCCCCAT
ATACCTCAGTTAATGGAATGTTTGCATCAATTCCTCCATCTAATTCAGCTTTAATTTTCCTGTCATGGAT
TGTAACATTCATTTTGTTCCTTTTCACTTCAGGATACATATATGATGTTATTAAATATGCAATAGATGGA
AGATACGAACTTCCAGACTTTGGCAATATATTTGCAATCCTTAAGAACGGATTACGCACATTAATTGTTG
GAATTGTTTATTCCATTGTGCCAGCTCTTATATTCATCCTTGGATTGATGCTGATGGTTAATGAGGCTTC
AGGTGAAGCTGTAAACATGTTTGGACTTATATTGCTTTTTGTTTCATTTATTGTTGCAATATTCATTTAT
CTTATTGAAGTCATTGCAATCTCACATATGGTTGAAAATGACAGTCTTAAGTCTGCATTCCAATTTAGTG
AGATCTTTGATATAATTTCAAATATGGGCTGGGGAAGATTTATCGGAGCCTTGATATTTGCTTTCATTGT
AATTGCAATAATTTCAATGTTCTTTGGAATGATATTCGGAGCAATATCTACTGGAATTGGCATATTGTTC
GATTCTGCATTGGTTTCAACTCTTGTTAGTTCTATATTGACTGGTTTGTTATTAAGTCCATATATCAGTA
TTGCTTTAGGCAGAATGTTTGGATCTGTTTATAAGGAGGCTATTAGTGAGTAATCTTATTGGTTTTAGCT
TAGAATTAGTTTAGAATTAATATTTTTGGTTTGGAATTAGTTTATTAGTTTAATTGCTTAGAATTAGTTT
AGAACTACTATATTTGGTTTGGAATTGTTTATTAGTTTAATTGCTTAGAATTAGTTTAGAACTTTCAATT
TTGGTTTGGAATTAGTTTATTAGTTTAATTGCTTAGAATTAGTTTAAAAATTATAATATGTAAATGGTGA
TAAAATGAAGTTTAATTCAAGAGTTTTAGGGATTTTATCTCTATTATTTGTTCTTACAATTCTTGTTTCA
AGTGTGGGGGCAGCAGAATATAAATTAACAGAAAAAGATTTTAATAATACCTTTAAAATAGGTATTCCAG
AAGGTACAGACTTCCAGCAAGATGCATATTCAAATATTGCTGCTGGTAATGTTAACTTTGCAATGAAAGT
TTTTGACAATATTGGAAATAATACTGATGGTGTTGTTTCTGTATTGTACTTTAAGGACTCTTCTTCTGAT
TCAAATCTTATTTCCGATGTGATTGATGATTTAAATAGCAGTGGGGAAGTTGTTGAAGAAAATGACAATT
ACATCATAGTTAAGAATAATTATGATGCTGAATGGAATGCTCCAGATGCCAGCACATCTTCAGATGAGTT
CTGGAGCTTTATCGGTGATTTATGCTCCTCTGGCTCTGATATGAACTTTGGAGATGGTGATTCAAATATC
CATCTTTCCGATGATGGAGTTAACATAGAAGATTCTAGTGCAAATGTATCATTTTCCAAAAATGGAATCT
ATGTTTCTGATTCCGATGGTCAGAATGTTTCCATAAGTTCTGAAGGAGTAAAAGTCTCTGGCGGGTCTTC
CAATGAGACAGTGGACGTAAATGCTGATGTGGATTCAGTCATGAATTCATATTCTGAATTTGCAGACTAT
TCTCTTTGCTTAAAGAATCCTAAAAAAGATCAATTGATTATTATTTGTGGTAATGATTTAGATCTATTAA
AGCAAATGGCAGACTCTGCTTCTTTCAAATAGGAATATAATTATTATTTGGATGAATGGGGGTGATGATT
CTTTTAAAAGATAATAAAATTCTTATTTGAATTTTATTTTCTTTTATTTTTTTATCCATAGTTTTTTTAT
TTTTTTTATTTTTCTTCCAAATTATTTTTTTATCCCTAATTTTCTTATTTTCTTTCTATTTTTTCTTATT
TTTATTATTTAACTCTTATTTTTCATAATTTCACATATAAATCAATCTAAAGAGATTAATTCTTCAATGG
ATTTATATAACTCTTCTAAAACAGAATAAACCTTATCTCCCATAATTATTTTAGGCTCCATATTGGCTCC
ATAGCTATTAATTTCTCGATTGCCATATTCTATTTCTATCTTCCAGGTGAATCCTCCATCTAATGTGCAG
CTTTCATAGACTTCCTCCAAGTCCCAAAGGCCTATCTTTTCAACGGCATCCCAAAATTCAATCCACTTTT
CTTCATCTATTTGATTTATATCTATTAATTCTGGATTTGGATTATTCACTAAAAGAGTGCCATTCAATAG
CTTAATTGACTTTGTTCCATCGATTTGATGAGAATATTTAATTTCTAGCTTTTTTGGAAGATAGTTATTG
GACATGATTTCAATCCTTAAAATTTTAATTGCTTTGATTTTTGAGATGATTTTAGAAGTTTTTGAAATGA
TTTTAGATAGTTTTAGAAATTATTATAGGTAGTTTTAGAAATGAATTGTTTTAAAAAGATAAATTTTTCA
AAAAAAAGGGCAGTATAATAAATTTATATATCATTTTATATTAATTAATATATAGACTATTTTATTAAAG
TTGGATGAAAATAAATTTAAATTTAAGTTTTAGAAATAAGATGAATTTAGAGGTGTTAAGTGATTAATAT
GATTAATTTAACAGATTATTTAGATAAACTATCCATAATTAAGGTTCTATCCTTCTTTTTATTAGTTATT
TTGGTCTTAACTCTAATTCCAATGATATTTGACTTTCATTTGGGAAGTCTATTTTTTAAATTTATCCTTT
ATCTTGTAATGCTTCTATTTTTTATTTATAAATTTAATTCTATCTCTAAAAAGAATTCTAGTTCAAATTT
TAATTATAATTCAAGTTCGAATAGGGATTCTAATTCAGTAAATAACTCTTCTCTTTCAGATGCTTTTAGA
AACGATTTAAACAGCATATTCAAGGTTTCTAAGATTTATCACATTCTATTTATTGTTTTAGCAAACATAC
TATTTGTATCTGCAATATACTTTGTATTAAGTTATTTGGGATCCATATCCATTATTCAGTTTAATGCCCC
TTTATTCGGTGATTTCACTGGTTTAGGCTTTGATGTAACGCTCCTTTACCTTATAACTGTAGTTATCCTA
TCTCCAATAATCGAAGAGTTTCTCTTTAGAGGAATCTTCTTACGAAGATTCAATCTTGAGCTTGACAATT
TGACACTTGCTATCTTGATTTCCTCAGTCTTATTTGGAATTTGTCATAACTTTGGAGGAATATTGGGAGC
TATTCTCTTTGGAATCTGCGTTTCCATTCTTTATGTCAAGTCCAGGAATGTATTAGTCCCTATTTTGGCT
CATTTCATTAACAATCTCATTTCCTTTTTGCTGGCCCTTATTGGAATAGAGAATTTCATTCATGGAAATA
GCATTGTCATTGCTTTAATAATCATTTTGGCCATTATAAGTAATTTTGTGCTCTTTAGAGCTATTGTATT
AGAGTGGCCTAAATCTTTTAAAGAATAGCCTTCAGAGCTAGTATGGGAGTGCTAAATCTTTTAAAGAATA
GTTTCTAGGGCTTTCTTCATTATGCTATTTTATTATCTTAAACTATTTTTCAAATCCCTATTTATTTTTA
ATATTTCAAGAATTAATCATAAAGTATATATAAAATATTAGTATAATCTATGTTTATGTTAAAATTTACT
GGAAAAGAAATAAGAGATTTAATAATATCATTCATTGTAATTGCTTTGGCATTCTCTATTCTTTATTCAA
ATCGTGATTTTAATGGAATTCTATTCATATTTCCAATAGTTGCAATAGGAGTAGGTGCCGGATTCATCTT
TCATGAATTAGGGCATAAGTTTGCAGCTATGCACTATGGATATTGGGCAGAATATCAATTATGGCCAACT
GGACTTGTCATTGCATTGGTAAGTTCCTTTTTCGGATTCATCTTTGCAGCTCCAGGAGCAGTTGTCATAT
ACAGTCAAGGAATGGAAAAGTCTGAGAATGGTTTGGTTTCACTTGCAGGTCCTGCAGTCAATATAGTCCT
TGGATTGATCTTTTTAGGTATTTTAAATTCATTAGGTCAGGTCACTGATTATAATGGCTATATCATAGCT
TTGATTTGCTTGCTTGGAACTAGAATTAATTTCTTCTTGGCAACATTTAACTTATTGCCTATCCCACCAT
TGGATGGATCTAAAGTTTTATCTTGGAATGCTCTTGTTTGGATAGTTGCATTTGCCATATCTGTTATATT
GCTTGTTGTCTATGGCGGTTACCTTGGATAGGGATTAAATAAAAGATATTTGAATTAAAGAAAAAAGGAT
CCTTTGCGATAGGAATCATTTTTTCAATATTTTTTCTTTTTAAATTTCAAAAAACTAAAAGTTTTAATAT
AAGAAATTATAAAAATATATAATACTTGAAAATATGATATGATTATTTTATAGATTTTTATTAAACTAAT
TTCATATTGATTTAATTATAAAAATTATTGTATAAAATTATTATCTAAAGAATTAAATTATTTTTATTGT
GATATTATGGCAAAGAAAGATGATAAATACAGTATGCCTATGAGTGGGGCAGGTTTAGTAAGATACTTTG
ATGACGAAAGTGTAGGTCCAAAGATAGCTCCAGAATACGTTATTGCTTTAACAGTTATTCTCGGTATCTT
TTGTTTCATTTTAAGATACTCCATATAAACAATCTGTTTATATACCTACTTTTTTTATTCTTTTTATCTT
ATTCTTACTATACTTTTTTTATTTTATTTTTTACTAATTAATAGTCTATTTTAGGTATCTTAATCACTTA
TTAGTCTATTTTAGGTCTTTTAACTATTTATTAGTCTATTTAGGTTTTTTAATCACTTATTGTCTATTTT
AGGTCTTTTAACTATTAACCTTAACATTTTAAGTTTTATTTATTGAACTTCTATTATTTTATATTTATTT
GCGCATATTGTTCAATTAAAAAATCTTAAAATTGTTCTGGCCTAAGAAATTATTAGTTTTCAAATGCTCT
GGTAATCTTTTTTAAATAGAAATTTTATAATATAATATGCATTTTCAAAAGGTTTTTAAGAGATGAATTT
CATTAAAAATAGTATGCTTTTAATTGAAAAATTTCATCTATGAAAAATATTATAAGATTTCAATTCCAAT
ATAATATTAGATGAAATAATAAAAAATTAATATTTTTTTATTAAGATTAAATTTTAAAAAACTGCTTGAA
ATAAGAATATTCAGCATATAAATGACTTTATATTTATCAATAATTTATGTATACACGTTTATTTTACAAA
AGGGATTATAATGGATTCTGGAATGGATTATTTTGAAAGATTGGAAAGTGAAACACAACGTCTCTACGAG
ATAGCAAATGAAGCAAGATCTAAGGGTTTTGATGTAGAGCTTGAAACAGAGATTCCAGTGGCAAAGGATT
TAGCAGAGCGTGTGGAAGGGCTTGTAGGTCCTAAAGGCATAGCTCGACGTATTAAAGAGCTAGAGGCTAC
TGGCATATCTCGTGAAGAGGTTGCATTTGAAATTGCAGCTGAGATTGCATCTCAAGAGTCTAGCGAAACT
GGAGCAAAGCTTGAAGCTGAGAAACAGGCTTTTGCAGATCAAGGCCTTCGTACAGCACTTGCTATCATCA
CTGAAGGGGTGGTTGCAGCGCCTTTGGAAGGTATTTCAGGTGTAAAGATTAAAAGTAATTCAGATGGCAC
AAAATATGTGGCAGTATACTTTGCAGGACCTATTCGTAGTGCAGGAGGTACTGCAGCAGCATTATCCGTT
CTCCTTGGTGATAAAATACGTGTAGCTACTGGACTTGACAGATTCAAGCCTACCGATGATGAGATTGAAA
GATATGTGGAAGAGGTAGAGCTTTACGAATCTGAAGTAACAAACCTTCAATACTCTCCGACTCCAGAGGA
AGTAAGGTTTGCAGCAAGAAGCATTCCTGTTGAAGTCAGCGGAGAGCCTACCGACCAGATTGAAGTTTCC
CACAGGGACCTTCCTCGTGTAGAGACCAATAACATTAGGGGAGGAGCCCTTCTTGCGATGGTTGAAGGGG
TTATTCAAAAGTCCAAGAAAATTCTAAAAATCTCTAAAAAACTCAATTTGGATAGCTGGGAATTTTTAGC
AGAGTATGCTAAAGGTATCGGCTCATCTCAAGAGGAAGAAAAGTCAGAAGAGGAAACTGAAGAAATCGTT
GAGGAAATCGACGATAATATTATTGATAAGGATGAATTGTTTGCCCATTCAAAATACGCCCACGATATCA
TTGGAGGAAGGCCTGTTTTAGGATACCCTTCTGAAAAGGGCGGTTTCAGACTAAGATATGGAAGATCTAG
AAACACTGGCCTTGCTACAATGGGGGTTCATCCGGCAACTATGGAACTATTGGAATTTTTAGCTGTCGGA
ACTCAACTTAAGATAGAAAGGCCTGGAAAGGGTAACTGTGTAGTTCCAGTTGATTCCATTGAAGGGCCTA
CAGTAAAATTAAAGTCTGGTGAGGTTCGCAGATTAGATTCCATAGCTGATGCAAGGGAAGTCAAGGGAAA
AGTGGTTGAAATACTCTTTTTAGGAGACATGCTTGTTGCATTCGGCGAATTCTTAAGAAACAACCAGCCT
ATGTTAGGCTCTTGCTGGTGTGAGGAATGGTGGATTGAGTGCATAAGAAACAGCGACAAATACAAATCAT
TCTCCAATGACAGCGAGCTTTATGACTATCTTATAGAGAGAGGAATCGATTTAAGCATTGAACATTTCAT
CTCACATGAAGACTCTTCAAAGTATATGGACTTTGATAGGGAAAGCTTCAATCTTAATTTCCTTGAGAAA
AAGCGTTATACTGCCGAAGAGGCCTTTAGAATCTCATATGACTTTAGTGTTCCACTTCACCCTGAATACA
CATATTATTATAATGACATATCCCGTGAGGACTTGGCTTATCTGAATGAATGGCTAGACACTAAAAGGGA
TTATCTGTCAACTGACTACTTGAATGGAGAGGATTTAATTCTTGATTTGGCTCCTCAAAAGAGAATCCTT
GAGATATTGGGATTGGTTCATAAGCTGATTGATAAAAAGGTAGTCATTGATAGGGATCATGCTTATGCCC
TAATGAAAACCGTTGGAAACGGCTCTGCATTAGAAGATAATGATGGGGACTTATCATCTGAAGTTAAAAC
AATAGATTATTCCAAATACCTTGATGATGACCATTATAAGTCAAAGGTTGTTGACATACTCAACGAAAAC
ATCGACTTTGAGATTATGGATAAGGCTCCATGCTATATAGGCACAAGGGTAGGACGTCCTGAAAAGTCTA
AGGAAAGGATGATGCGCCCTGCTCCTCATGTCCTTTTCCCAATTGGAAACAATGGAGGAAGCAGACGTCT
AGTGGCTGAAGCTGCCAAAAAGAGAAAAATCAATGTTGAAATTGCAAGAAGACAATGCACAAACCCTGAT
TGTGGATTAAGCTCATTCATGGCAATTTGCCCTCACTGCGGCGCTCCAACTGAAATCACCAAAGCAAGTC
AAAAGGACATTAACCTGTCCACCATGCTATCAAAGGCTTCAAATAACATTGGAGTTCGTAAGGTTGATGA
GGTTAAAGGTGTAATTGGTCTTATTTCAGAGGATAAGCTCCCTGAACCTTTAGAAAAAGGTATTCTTCGT
GCGAAAAATGGTGTCTTCACATTTAAGGAAGGAACCATTCGTCATGACTCTACAGACTTGCCTCTTACCC
ACTTCATTCCAAGGGAAATTGGCGTTACTGTTCCAAAATTAATCGAAATGGGATATACTCATGACTGCTA
TGGACAGGAAATAGTGAGCGATGACCAGATAATTGAACTGAAGGTTCAGGATATTGTAGTTTCAGACAAT
TGTGGCGATTACCTTGTAGGTGTAGCTAATTTCGTTGACGATCTATTGGAAAAGTATTATGGAATGGACC
GGTTCTATAATGTTGAGGACAAATATGACCTTATCGGCCATCTCATTGCAGGTCTTGCACCTCACACATC
AGCAGGGGTGTTGGGCCGTATTGTAGGATTCACTAAGGCATTGGGCTGTTATGCACACCCTTATTTCCAT
TCTGCAAAAAGGAGAAACTGTGACAGTGACGAAGATTCTGTCCTATTGCTTCTTGATGCTCTAATCAACT
TCTCCAAATCATATCTTCCTAGTACCCGTGGTGGAAGTATGGATGCTCCTTTGGTTTTATCCACACGTAT
AGACCCAGAGGAAATCGACGACGAATCACATAACCTGGACATATTTGAACGTTTCCCATTGGGATTCTAC
CAGAAAAGCCAAGAGCCTTTAAAGCCTGCAGATATGCTGGAATTTGTTGATAATGTTGAAATGCATCTTG
GAACTGACAGACAGTATCATGATTTGATGTTCTCACACCATACCTCAAACATTCATGCAGGGCCTAAGGT
TTGCCTTTACAAGCGTTTAGGCTCTATGAAAGAAAAGGTGGAGGCTCAAATTCATTTGGCAGAGCTCATC
CGTGCAGTAGACCAAAGAGGAGTTGTAGAAGGTGTTCTTTCATCCCACTTCCTGCCGGATATCATGGGAA
ATTCAAGGGCTTTCTCCAAGCAGAAGGTCAGATGCCCTAAATGTGGCGCCAAGTATAGAAGAATGCCTCT
TACAGGCAAGTGCAAATGTGGAGGGGACCTTATTCTAAGCGTTTCCAAGGGTTCTGTTGTGAAATATCTG
GAAATTTCCCAGAATCTTGTAAACAGGTATCCTGTTTCACATTATCTTGAGCAAAGATTGGAGATTCAAG
AGTTTGGTATCAATTCACTCTTTGAAAGTGATAAATCCAAGCAAAGCTCTCTTGATGTGTTCTTCGGCAA
ATAAATGTTAGGTATTCTTTATTAGATCTTTTAATCTTTATTAGTTCTTTTAATCTTTATTGATCTTTTA
ATCTTTATTAGATCTTTTAATCTCCTTTAACGAGGTTTTTAGATTTATTTTTTTATTAAATCTTTTAATC
TCATTTAACGAGGTTTTTAGATTTATTTTTCAGTAATTTTTTTACAAGTTATTTAACTGAACTAGTGAAA
ACTATCAAAGATATAAATTTGTTCGTAACAAGTCGAATGATTTATATACATCTTATGATAAATATTATTT
CGTGAAGTAACTAACATTATGTTTGTATACAAACAGTTAATGTGTTTACTAACTTTCGTATGATATCGAA
CAGATATTATACATCTAATTACATAATTATATTTACTTAAATTAATAATAAGCTCAATTTTATATATTAT
TTATATTTTAAGTATCATTTTTATAATTATAAAAGCAATTTAATTCTTTAGATTGCATTTAATCTTATAA
AAAAAGCAATTGGTGCTGGTTATTTATTTATTGGTCAGATTGCATTTAATTTTATAAAAAAAGCAATTAA
TGCTGGTCATTTCTTGATTGGTTAAATTGCTTATATGTTTCGATTTAAATCTTATAGATAATGGGTTTAA
AAATTAATGAAGGTGTTAAAGTGGAAAATGTGTATAATGTAGAAAATGATATTAGGAAAGCTAAAATCAC
TGTTAAGAAAAACAACGGTGTCTGTGAAGCTTTCAGTTATGAAAAATTGTTAAAGTCTTTAGTTATGGTT
GAAGCCCCATATTTTGAGTCTGAAAAGATTGTTTCAACTGTTGTAGAAAACTTATACGACGGTATCACTA
CTAAAGAAATCAAGAAGATCGTTTACGAATGCTTAGAAGAGGTTGACTCTGAGGCAGCTAACAAATATCT
CGCTAAGACTACCTTGAAGGTACGTTCCTCAAGAGATAAGATTGAACCATTCGACATGGCTAAGATTGCA
AGCACCCTTGTAGAGGAAACCGGTGCTTCCCAAGAGACTGCTTTTGAAATCGCATCTGAAGTATGGAAAG
AACTTAAAAAGCTCAATGTAGAATACCTCACTGCTCCTATGATTAGGGAAATCGTAAACACAAAGCTTGT
AGAGTATGGGCTTGAAGACTTAAGAAGCAGATACACCCGTTTAGGAATTCCTGTTTATAACATTACATCA
TTGATTGAAAATGGTAACAGAGACAATGCAAACATGATGCATAACCCTGAATCCATTCACAAATATGTTG
CTGATGAAGCATTGAAGCAATATGCTCTCTTGCATCTATTGCCATCACACTTGGCAGATGCACACATGTC
CGGTGACATTCACATTCACGATTTGGAATTCTTCGCTGGAAGACCATTAAACTGTCTCCAACATGATATA
AGGGCATTCATCAAATACGGCCTTAAAGTGGACGGTACAGGTGACCACACTTCTGTAGCTGCACCTCCTT
CCCATATGGAAACCTTGATGAACCATACTGGCGAAATCATGCTTGCAGCTCAACAGAACATGTCTGGTGG
ACAAGCTATGTCCCTTTGGAACGTATTTGTCGCTCCATTTGCAAGAGGAAGAACCTACGAAGAGGTAAAG
CAATCCATTCAAATGCTTGTCTACAACTTGAACATGGCTTATGCAGCAAGAGGATCACAAGTTCCATTTA
CCAGCATGCAATTGGAATTCGGCGTTCCAAACTTCTTAAAGGACGTAACTGCATACGGTCCTAAAGGACA
AGTCGTAGGTACTTACGCTGACTTTGAAGATGAAACCAGAATGATTCAAAGGGCATTCACTGAAATCTTG
CTTGAAGGAGATTCAGAAGGCAAGCCTCACCTATTCCCAAATACTATCTACACATTACGTGAAGAGACCT
TGAATGGTGACTATGATGATGACATGCTCCTTGTTCACGAGCTTTCAGCAAAATACGGATCTTCCTACTT
TGTAAACATGTTGCCTGACTACAGAGGTCAAATGGCTAACTATATGGGTTGCAGAACCTGTCTCCAGGAC
ACTTGGACCGGTGACTGGGAACAAGACTGTTTAAGAACTGGTAACCTCGCTTATGTAACCTTGAACATGC
CTAGAATCGGTTACCAATCCAATGATGAAGATGATGTATTCGAATACTTAGACAATTATATGGACTTAGC
TGTAGAAACCTTGATGATTAGAAGAAAGCAAGGTCTTAACTGCTTGAATAACTTTGACATCCTACCGTTC
CTTGACCAAGAGGTTGACGGAGAAACCTATTACAGAATCCAAAACTCAACCTTATCCTTTGGTTTCTGCG
GATTGAACGAAATGTTACTTGCATTGTTCGATGAAGGCATAGAAAACCCTGATGCTAACAAGTTCGGTAT
CAAATGTTTAGAATACATCAATGCAAGAGCAAAAGCATTGCAAGAGGAAACCGGACTCAGATGGTCTGTA
CTCCAGACCCCTGCTGAATCTACCGCTTACAGATTTGCAACCTTAGATAAGGAACAGTTCGGAGATAAGG
CAATCTTGCAAGGTGACAATGGAGCTAACTACTACACTAACTCCTCACATGTCCCTGTAAACTCTGACAT
TGCATTTGCTGACAAGATCAAAATCGAAGGCCAATACCATAAGCTAACTCCTGGAGGACACATCTTCCAT
GCATTCATGGGTGAATCCTACTCTGATCCTGAAGCATTGATGAGCCTTACCAATAAGATTGCAAGAAAAT
CAGACATTGGTTTCTGGGCTTACAGTTCAGCATTCAGTTTCTGCTTAAACTGTAAAACATTGATGAAAGG
ATTAAGCAACAAATGTCCTTCCTGTGGTGAATCTGCAGATGTAGAATGGTATGACAGAATTACTGGTTAC
GTACAACAAGTAGGTCATGCTAAATCTGCTAACGGCGGATGGAATGCAGGTAAACGTCAAGAATTAATTG
ACAGACGTAGATTTGAACAATAAGTTCAATCTACTTAATTTTTAATTTTTATTAAGAATTAATTTTAAGC
ATTTATATTTTATTTTAATTTTATTTTAATTTTATTTTAATTTTATTTTAATACTATTTTATAATTTTAT
TTTTTTAAACCATTATGTTTATTTTTTCAAATATTTAATACTGGGATTAATCTTGTTTTAGCCTTAGGAG
CAATATGGGATTAAGCTAGTGTTAATATTGAAAAATAATTTTATCATTTTAAAATTTAAGGGTTTTAGCT
TTTTTAAGTTAAAACTCTATTTTCCACTTAATAGGGTTCTTTTAGAATCCTATTTAAACCTTTATGGTTT
TTTTATTTTCTTATTTTTTTTGATTTATCTCTTATTAGTTCTGGATTGTTTTTATTACTATTTTTCATTA
CTCTTAGAATGTTTTTTATTATTTTTCATTACTTTTTGAATGTTTTTTTTATTATTTTTCATTACTTTTT
GAATGTTTTTTTATTATTTTTCATTATTTCTGGATTGTTTTTATTATTATTTTTCATTATTTCTAGATGT
TTTTATTATCATTTATATAATAAATTTTATAAGATCTTTTTCACTTAAGGTCTTAATTAATGAATTTTTG
AGTTTTTGCAATTAATTTTTTATAAGATGATAATAAAAATATATAATATGATAAAATATTAACATATTTG
CTTAATATTCTATTTTTATAATGATTAAAAATTTAAAAAATATTTTTAATTTTACTTCTAAAAACTTTCA
AATTTAATACAAATTAATTGATTGAATTTTAATAATTTGCAATAGAAAAAATAAATTAATTAAATTGAAA
GTACACTTTATAATTATTATGGTGAAACAATGAAACATTGGATTGAAAGAATCGCTGATGAATTAAATGA
AATGGATGTAGAAAAACATGTCATTGCAAGTGGTACATCTATCTCAGGTTCTATACATATAGGAAACTCT
TGCGATGTATTTATAGCAAATGCAATAGGAAAGGCTTTAAGAGAATTAGGCAATGATGCTGAAACCATTT
GGATAGCAGACGATCATGACCCTCTTAGAAAGGTTCCTTATCCACTTCCAGAATCCTATGACCAATACCT
TGGTATGCCTTATTCCATGATACCATGTCCTGAAGGATGCTGCAAGAACTTTGTAGAACACTTTGAAAAA
CCATTATTCAATGTTCTTGATGATTACGGCATAGAGATTATTCCTAAATCTGGTTTTGAGATGTATAAAG
ATGGGTCTTATCTTGAATCAATCAGAATCTCCCTTGAAAAGCATAATGAAATCAAGGCTATCTTTGACCA
ATACAGAAGAGAGCCTTTGGCAGACCACTGGTTGCCTTATAACCCTATCTGTGACGAATGTGGAAGGGTA
AACACCACTGAAGCATATGACTATGACGGAGACATTATTAAGTATAGGTGTGAATGTGGCCACGAAGGTG
AGATGGATATAAAATCAGGCAATGGTAAGCTTACCTGGAGAGTTGAATGGGCAGCAAGATGGAAGATCTT
TGGAACCACTTGCGAACCATTTGGAAAGGACCATGCAGCAGCTGGAGGATCCTACGATGTAAGTAGCGTT
ATATCAGAGGAAATCTTTGATTATCCTGCTCCTTATCCAGTTCCATATGAATGGATCACCCTTGACGGTG
AAGCGATGAGTAAGTCTCATGGTGTATTCTTCACTCCAGAGCAATGGCTAGAGATTGGACCAGCTGAAAG
TCTTAACTACTATCTATTCAGAAGCAAACCAATGAAATCTAAAGACTTTTCACCTAAAATGCCTTGGTTA
GACTTTATGGACACTTTTGATAGGGTGGAAAAGGTATTCTACGGCGAAGAGGAAGCTCCATCAGAAAAAG
AAGGCAGAAAATTCAAGAGCATTTATAAGATGGCTCAAATCAATCCAGATTCTCCATTACCTTTCAGACC
TCCATTTAGGTTCTTGGTAAATGCTTATCAGATTGTCGGTGAAAAGGACCTTGAGAAGATTTTTGCTATT
GTTAAAAAGAATTCTCAACTCACTAAAAGCTTTGCAGATAAGGAGTTTGAAGACTTAAGCGAACTTGAAG
TGTCTCAATTTAGTGAAAGGGTAGATAATGTAATCGCTTGGTTAGAGAAATATGCTCCTAAATTTGTCAA
GTTCCAAGTTCAATATGATTCCATTCCAAACTTGCCTCTTCCAGATGATCAGATTGCATTCCTAAAGGAT
CTTGCAGACTTAATGGAAGAGAAGGAGTTCTCATCTGCTGAAGAATTGCATGATAGCATGTATGAGATTT
TGGAAAGCCATGGATTAAAACCTCAAAAGGCATTCCAAGCTATTTATAAAATGATTCTTGGTCAAAAGCA
AGGTCCTAGAGCAGCTTCATTCTTGCTGTCTTTAGATAAGGACTTTGTTGTTAAGAGGTTAAGACAGGAA
GCTTAACTCAAGCTTTTTTCGCCTTCGGCGAAAAAACCTTGACCAAAATTTTTTTATGGCTGGGGAGTAC
CTTGCTCCTACAGTTTTACTTCTTTTTATTCCTATTTTATTTTTTAACTATTCTTTTTATTCTTATTTTC
TTATATAACTGTTTTTTTATTCCTATTTTTGTTTAATTGTTATTTTTTCCTTATTTCTCTTTTTAATTTA
TAAGCTATTTTATAGAAGTTATTTTTGTTCGTTATTATGGGAACTATTTATACGTTTAAAAAGAGTTTTA
TTAGTTGGATAAAAGTTTTAATGGTTTATTGGTGTAAAAAAAACTTTTATGGAGTTTGGTGTGTAAAAAA
AAGAAAAAATGATTAATTAATTGAATAATTAATTAATCTTTAAAGAATTATCTACCAGTAAGCTTGCTAA
AGAAACCTTTGCTAGATTCTTCTTCGAGTTGCTCAGTTAATTGTTGGTTTTTGTTTTTAAGAGAGTTGAT
AGTTTTATCCTTAGCGTTTAATTCGGTGTATAATCTATCATAATCCCTTTTCTTTTTGTCTAAGCTTTCA
TTAAGATTTTTAATTTCAGCTTCTAATTTAGCAATTTTGCCTCCGACACCATCAATTTCTTTTTGAGCTT
CTTCTTGAGTGGCTTTGACTTCTGCATTTTTGCTAGCTACTTCTGCCTTAAGAGAAGGAATGACATTGTC
ATTTAAGTCTTTGATTTCATCATTTTTCTCTTTGATTTTAGAATCTTTGCTTTTGATTAAGCTTTCTTTT
CTGTCAATTTCTGCGTCTTTTTCTTTGATTTCATTTTCCAATTTATCAATTTCAGAATGCAATTGTTCAA
TTGCTTCCTCTTTTTCTTGATAAATCTTGGTTACTTCATCTTCGTCAGTCTCTTCAGTTGGAATAGCTGC
TTTTTTCTCTTCCTCTTCAAGTCTTGCAGTCTCAAGTTCAACAACTAATTTTTCGATTTCGTTTAATCTT
ACTTTAGCTAATTGAAGACCAGCTCCTTTTTTTGCAACGCTTTCACTTAAGTCTGCATTGATTTCCAATT
GATCGAAGTATTTTTTGGTACTTGTTTCCAATGCATCTGTAAGCTCTTCCTTAAGCGCTTTTAACTTTTT
GTTGTCTTTTTTTAACTCAGGAATTACCTCATTGGTTAAATGATTTAATTCGCTTGCTTGGTTTTTGAGT
TTTGTGTCTTTATCAGCTAATTGCTTTTTTAAAGTTTCAATTTCTTCTTCTGAAATAAAAATCACCATCT
CGTTTACATTTCTAATTATCCAATTTATTCAAAAGCCTTATCAGATAATTAGGAGTTTTTCCAATCTTTT
TACTACTTATTTAACCATCTAATTAATATTCATTAGCCTTTCATCGATAATTTCATTATTCCTTCAATAA
TTAAGGTAATTATATTGGGTTTTGAAAATTGAAAAAATTTTAACAAAAATTAATTTTTCCAGACAGCTAA
ACTATTTATAAATTAGAATTTCTAATAATCTATAGATAAATATAAGTCAGTTACCATTTATAAATTTTAA
TATTTTTTTATAAACAATTATTAATTTAAATAATTATTTTTATTTGTTTTGTAATGAGTTTTGGTATGGT
TTTTTTTAGTTGTTTGGGGATTTGTTTGTTTTGTAATGAGTTTTGGTATGGTTTTTTTTAGTTGTTTGGG
GATTTGTTTGTTTTGTAATGAGTTTTGGTATGGTTTTTTTTTAGTTGTTTGGGGATTTGTTTGTTTTGTA
ATGAGTTTTGGTATGGTTTTTTTTAGTTGTTTGGGGATTTGTTTGTTTTGTAATGAGTTTTGGTATGGTT
TTTTTTTAGTTGTTTGGGGATTTGTTTGTTTTGTAATGAGTTTTGGTATGGTTTTAGTTAATTAAATCAT
AATTTAATGGATTTTGAAAAAATAGATTAAAAAAAAAATAAATAATAAATGAATAAGAGTTTATTCATTT
ATTTTACAACTTTAATTTTTGTATTAAAGACAGTGGCCCCATAGGTCTTAGTGGATGCGTACTGACTTTT
AATTGTATAGCTGCCTAATTTTACACTTACCTTTAATGTAGCCTGTCCTTTGCTATTGGTTGTTTTTGTA
TAGGTCTTTTTATTTAAAGTGAATTTCACTTTAGTGTTCTTTATGACCTTTCCATTAGCGTCCTTAAATG
TTGCTACGAAATTAGAGTTTTTGCGTATCTTAGTAGACTTTGCCTGCATCTTTGTTGTCTTTACAGTTAC
CTTGACTGTCTTTGAAGATCCTTTGTAGTAGTCATCTCCTCCAAATGAAACCTTTACATTATATGTGCCG
ACCTTTAGATTGATGTTGAATGTAGCGGCTCCATTTGCATTTGTTGTCCTTGTGTAAGTGTTTTTTCCAA
TGGTGAATTTGACTTTTTTGGACTTCATTGCTTTCTTATTATTGTCAAGCAATTTGACAGTTAATTGGCT
GCTGTTCTTATAGTATTTTACAAGGTTTTTAGCGCTTATTGAAGTGCTGTTCTTTAAGACAGTGATTTGC
ACTGTAATGTTTTTGTTTTTGTATTCTGGGTCCTTGAAAATAATGTTTGCAGTGTATTGGCCTGGCTTTA
ATCCGATATTCTGTTTAACGATTCCGTTTTCGTTTGTTGTCTTATTGTATGTTTTTCCTAAAAGTTCTAT
GCTTATAGTTTTATTGGAAAGAGGATTATTGTCGCCATCTGTCAGTTTTGCTTCCAATTGGCTTTCATTT
TTGTAGTATTTGGTCAGATTGCTTGTGCTAAGATTTGATTCCTTTTTCTGGACAACTGGAATTTCAATGA
TTTCATTGGTGATTTGTGCATAGACAGCATTGACACCTTTCACTGGGATGTAATTGTAGCTTGCTGTACC
ATTCTTTAAAGTTTTTGTTGCAATGGTCTTTTTATTGTCGTCGAAGAATTTAACGGTTAATGGTAGGTTT
ATATCCTCATTATATTCGTATATTTCTTTTGTATCGTTGTCAAAGTATTGCTTAATGCTTACAGTCAATG
TGTTCACTTCATCTGCTGAGATGTTTCCATTGCTTGATGTGAAAGTCATCATAAGCCATCTTGAAGCGTT
TATTTGACCTGGATCCTCATTATTGCTGTGAGGGGAATAGTAGTAAGAGCTTATGTTGTTTTGGCCCCAC
CAGCAGTATTGGACTGTAGCGTTGTCATCCAATGCAATATCTCCATAGAAAACGTTCTTTTGGATGTAGT
TATTGGTTATTGCACAGTTTATCATTGTAATCTCTGCATCTTGGAAGTTGTTTGTGACTGCTCCGTGGTT
TCCTGCATTGTTATAGTCAAAGATTGTATTGTAGACCTCTGTTACGACATGGTGTCCGCTTGGAGGTGCA
AGTATTGCTCCTGCATAGAATCTTACTCTGCAATTGAAGAAAAGGCTGTTGTTTATAAACATGTTTCCGT
GATTGCTTATTGCCCCTGCTGTATAGTTTGTGGTCTGGTTTATGAAACTGCAGTTGTTGATTGTTGCGTT
TCCTAAGCTGAGAAGCGCTGCTGCTGAATATATCGCATGATTATTGAGGAAATCTGTATTGTTGAGGGTT
ATTGTTCCTCCTGCTGCTATGCTTGCTCCCACACCTTTTTCAGCTGTTAGGGTGTTTTTCTCGAAAACTG
AGTTCTGGATGTTTGTCACTCCAAGTGTATAGATGGCTCCTCCATATTGTATTGCGCTATTGTTTAAAAT
GCTTGAGTTTATGATGGTCAATCTTCCTAAATTGTTGTAGATGGCTCCTCCATAGTAGTTTCCATAAGAG
TTTTTGATTGTAGAGTTGATTATGGTCAATTGTCCGCCTTCATTTATGATGGCTCCTCCATAGTCGCTTA
GGTTGCCGTCCTTATATGCATTTGTTAAAATAAGTCCGTTTAAGCTTAATTTTGCGCTGGAATTCATGAT
GAATAGCTGTGCCTTGTCTTCACCGTCGATTATAGTGGAATCTTCTCCATAGATGCTTAAGCTTTTTCCT
ATGCTTATGTTTTGGTTATTCTCTCCATTGTAAGTTCCGCTGGATAGGTATATGATTGAATCATCATCTG
CCTTGGATACTGCATGTTTTATGCTTTGGTATGGGCTTTTTTCACTTCCGTCTCCTGAATCGTCACTGCC
GTTTGTGGATACGTATATTGATTTGGATTCAGATAATTGGCTTTTGTCGCCTTTGCTTAAGCCATCATTA
ATTGCTATATTGTCGTTGATTTGATTTGATGCTGTGAATTCATTAATTAATGAATTATCATTAATATCGC
TTGATATTGAATTTTCACTAATAAATGAATCATCAGTTTCAATATTTGACAATTCGCTAGCATTAATGGT
GCCTATTAAGCTAAATGCTATTAAAATACTTATTAATATAATTAAAAATTGATATATTTGATTTTTAGTC
TTAATAGTTTGACCTCCTATATGGAATGTTTTTATATTCGAAATTTATACAATAACTCTTTTTATTATTT
TTACTATATATGTTTTATTTATATTCTTATGAGTTAAAACAAATGTTTTTAGTTATGATTTGTTTAATTA
AGTTAATTTGATTAATTTTTTTATAGTTTTAGGACGATTTTTTGATGATATCTTATTGCATATGGTTTTA
TGAGGTGGCTTATTTTTTATAGCTTTATTTTTTGCATATGGTTTTTATCATATAGCTTATTTTTTATAGT
TTTTATAAATTTTTAGAGATCTTTTATTAATTGAACATTTTTCAATTGTTTTTCCAAATATTAGTTTTCA
AATGCTAGCACAAGTTTAAATTATTATATTGTATATATAGAATATTGAAATTAGATTGGAATAATTTTTT
AAAAATTTTTTCATATGAGAATCCTAATTTTTATTAATATTTTCCATATAACAAATGTTAATAAAAATCA
TTAAATATTGGATTGTTCTAAAATAATAATGTTGTAATTTTTCTAAAAAAAATTTTATAAACAGCTTTAA
AACATATTTTATTTATAATTTAAAAAAGAGTTTTAAATGGTTTAATTTATCATTTTATTAAATTTTACTA
TTTAAATCATTATTTGAAGAATTTTAATATTTAATTTTTAAAAATAATTATTAATCGATTGCTGTTTATT
TATTTTAAAGATTATTTCAATTAACAGTTAAAAACTAGAAAGGATGATTTGATTGACTATTAAAAAAGAC
TTATTAGCGATAGGACATACTGCATTGGATTATATAATCACAGTAGATGAATTTCCAAAGGCTAACAATT
CAGCTCCTATGAAGACCATGCTAAACTTGAATGGGGGAGCTGCAGCTAATGTGGCTATGATTGGCGCAAG
CCTTGGATTGAAATCTGGATTGGTATCCGCTGTAGGTAAGGAATTTATTGACTCTCATTATCATAAGGAA
ATGACCAGATTAGGTGTTGACACTGAAGCGATGATTATTTCAGAGACTGAAAACACACCTACTGCTTTTG
TTATGACAAATAAAAATCAGGACCAGATTAGCTATTTCTACTGGGGAGCAGGTAAGGATTTCCATGATAG
TGAAGTTCCAAGGGAAAAGATAAAGGAATTTAAGGCAGTTCATTTGGCAACTGGAGATCCTCATTTCAAT
TGCAAATCTGGAATCGTTGCAAAGGAAGAGGAAAGATTGGTTTCATTCGATCCAGGTCAAGACCTTGGAA
TGTATAGTCCTAAAAAGCTTAAGGAAGTCATTAGCAATTCAAACATTCTTTTTGGAAACCATCATGAAAT
CAAAAGGATTCAAGAGTCATTGGCTGTTGACATTAACGGTTTGATGGAATTAGGTCCGGAAATTGTTCTT
ACAACTTGCGGTAAGGAAGGAAGCATAATCTATAGCCTTGATGAGGGCAAGTTTGAGATTGATTCCATCT
ATAGGCCTGCAGTTGATCCTACAGGTGCTGGAGACTCCTATAAGGCAGGATTCCTATCCCAATTTATTAA
TGGAAAGACATTAGAGGAATCTGCTAAGTTTGCATCTTCTGTTTCATCCTTTGTTGTGGAAAAGCAAGGA
TGTCAAACAAACATGCCTAGCTATGAAGATGCTTATAATAGAATGATGGACTTTTATTAGGTATAATTGA
TTGTTATTAATTAATTTGCCCTAAACTTCTTGATTTTTATAATAATGCTTAAATGATTGATTTTCAATCA
TTTCTTTTTTTTCTTTGTTTTTATCAAGCAATTTTTCATTTTAATTTTTTTTCTATTTTTCTGTTTTTTA
TTTTTATTGAATCATTTTTTGCTTAGTTTTTGGTTTTGTGTTTTTTTTATTTTTATTGAAAATTTTTTGC
AAAAATTAAAAAAGGCTTCTTTTAAAAAAATTGTTATAATAAAATATATTTGAGAAGTGTCAAAACTATT
TGATAAAAACCGATTTTTATGTCTTTATTTGAAAAAATAAGCATAAATAAATCGATAAGTTTATAATATA
AAAAAATATAATATTTAAATATAAAATCAAGGCCGATAGAATTAAATTAATATTTATTTAACTAAAATAT
ATTTTAGTTTTTCATATAAAGCATTTTTTAAGAAATAAATTAATATTTTAGTTTTTTTTAAACATACTCA
ATTAAATAACTTATAATTAATTTCTATTGATTTTATAATCATTTGGCTATAATTTTATAATTTATAATTT
TTATGGAGAGGGAAAATGACACAGATAAGCGATGCAAAAAAAGGCATATTAACTGAAGAAATGAAACATG
TTGCAAAAATCGAAAATGTTTCAGAAGACTTTATTTTAAGATCCGTTGCAAACGGTACTATCGTAATTCC
AAGCAATGTACACAGAGACATTGAAGCATCAGGTATTGGTGCAGGACTTAGAACAAAGGTCAACGCAACT
GTTGGAACTTCAACAGACATTGTAAACTTTGATGAGGAAGTATTGAAGGCACAGATTGCAATTGACCATG
GTGCAGACTGTCTTATGGAATTAAGTATCGGCGGAGACTTGGATGTAATAAGAAGAAGAGTTCTTGACAT
GTCCCCATTGCCTGTAGGATCTGTACCTGTCTATCAGGCTGCTATTGAAAGCATTAGAGAACATGGCTCT
GTAATTTATATGGATGAAGATGATTTATTCGGCGCCATTGAAAAGCAAGCTAAAGACGGTATTGACTTTA
TGGCTGTTCACAGCAGTATCAACATTGAAACCTTGACCCGTCTTAAACGGCAAGGACGTGTAACTGGTCT
TGTATCCCGTGGAGGATCCTTCATGTCTGGTTGGATTGTAGAGAATGAAAAGGAAAATCCATTATATGCT
AACTTTGATTATGTATTGGAAATTGCAAAGGAACATGATGTTGTACTTTCCCTTGCAAACGGTATGAGAG
CTGGTTCCATTGCTGACTCTACTGACCGTGCTCAAATCCAAGAATTGATTATCTTAGGAGAATTGATTGA
CAGGTCCCGTGAAGCTGGAGTCCAATGTATGATTGAAGGACCAGGTCACATTCCTATCAATGAGATACCA
ACCAATGTTATGATTCAAAAGAAAATGTGTTCAAACGCTCCTTTCTATATGTTAGGACCTATTGTATGTG
ATGTGGCACCTGGATATGACCACATTGTATCTGCAATCGGTGCAGCATCTTCAGCCAAAGCCGGAGCCGA
CTTCATCTGTTATGTAACCCCTGCTGAACACTTGGCGCTACCTTCCCCTGAAGATGTGAAAGAGGGAGTT
ATTGCAACTAGAATAGGAGCATATGCAGGTGACTTAGCTAGCGGTCAAATAGATGGTTCCCAAGACCTTG
CAATGGCTGAAGCAAGGAAAAAACTAGATTGGGAAGCTCAATATGAGTGTGCAATGTTCCCTGGCGCTGC
ACGTGCAAAAAGAGACCAAAGACCTCCTGAAGAGGAAGACACTTGTACAATGTGCGGTAACTACTGTGCT
GTAAAGATTGTAAATCAATGGTTGGATCAGTCTGATTCTGATCTTATTAAATAGACAAGCTTTTTGAGCC
TTCGGCTCAAAAACCTTGACCAAAATTTTTATTTAACTTGGGAGTGTCTTGCTCCAAAGTTATTTCTTTT
TTTACTACACTTTTTCTATTTTTGTTAATATTTAATTTTCATTCTTAATTCTTTTATTCTATTTCTCATT
TAATAGTTAATTCTATTTTTTCTATTTTTGTTAATCTTAAATTTTATTCTTAATTCTTTTATTCTATTTC
TCATTTAATAGTTAATTCTATTTTTTCTATTTTTGTTAATCTTAAATTTTATTCTTAATTCTTTTATTCT
ATTTCTCATTTAATAGTTAATTCTATTTTTTCATTCTTTTTGATTAATTTTACCAAAAATTACTTATGTT
TATATTTTTAGATATAAAATTAATAAATTAATTTCTTATTTTTTTATTGGAGGTCTTTTTCTGTATAATT
TTAATGAAAACACTAATTCTAATCCTAATCCCCCTGCTAAACGCATATTTTATTTGGATGCATTAAGGGC
ATTAGCAATTATCTGCGTAATTGCCATACATGCTTACGCATGCTCAAGGAATTTTGTTATTAGCGAATTG
GTGGGAAACTTACCTTCATTGAATTGGATTATTATTCAATTTTCAGGCAATACATTTAGAATAGGAGTAG
ATTTGTTTTTAATGTTGTCTGGTGCTTTATCTTTAGGTAGGGATTGGAAGATGAAGGACTTCTTTGCTCA
TAGATTCCCTAGAATAGTATATCCATTTTTATTTTGGAGCATCCTCTTAGGAACCATATTTCTTCTATTG
TCATATTATGATTCATTTAATGTGATAAGCTCATTTGATTTGGTTTCAATAGCCAATTACTTCTATGGAG
TATTTATGGGAATTATTGATTTCGCTAAGCCTTATTGGTACTTTTGGATGATTTTAGGGATTTATCTGAT
AATGCCTGTATTTAACAAATGGATTTTGCATTCTGATTTGGATGATCTTCTTTATTTCTTATTCTTCTGG
CTTATAACATGCTTGTTTGACTATACATTAGGAGTTGAATTTCCAATCAGATTGTCATACTTTACAAGTC
CGATAGGTTTGGTGGTTTTAGGCTATTATTTAAGATATACAAGGAGAATAATTCTAAATAACCAATATTT
TGCATTATTTTTGATTATTTTCTCAAGCCTATTGATGCTTGTCCTTTCGGCCATTTATTCAACAGACACT
CATTTCTATAATTTTAATATATATTCCATTTTAGTCAGCATGGAAGTTATAGGAGTGTTCTTATTGTTTA
AGAATTTCTATAAGTTTAATTTAAATATAGGGTTCTTCTCAAGGCCTGATGGATTCTTTAATAAATCAGT
TTATGCTTTGGCCAGGTATAGTTATGGCATATTTCTGATTCATAATGCATTTATATGTGTGTTGGTGCAC
TACTTGGGCAATACAGGCATTCCGCCAGTCTTATATATGATTATATTGTTTGTTGTTTCTTTACTCTGTT
CGGTGATTGTAATGGCTGTATTAAGTAGGATTCCTTATTTGAATAGGGTGATTGGTGTTAAATAGCAATT
TTTTGCTATTTTAACTCAATGATGTATGGATAGCAAGTCATTTTTGATGATTTGCTCATATATTTCTTAT
TTTATCAATTATTTATCTATTTTTTTTATGCTATCTTTTTTTAGGCTATCTTTTTTCATTATCTTGTTTT
CCAAGGTTTCATAGGAACAAATCCTTGTTCTCCTATTTGACTTTGCCCGTCCATAAGTAAATATTCCATT
AAATTATAAATGTCTTCCTTTTCATCATTGCATTGAACTAAGCTAATTACGTGACGGGTTTCATTTTTCA
ATATTTCATTTCCATTGAAATAGCTTGCATTTAAAAATGTATAATACTCGTCTGAGTTTTTAACTATCTT
AAATGCATCAAATTGGGATTTTACTTCTTTTACTATATTGAATGGAATGTTTTCCTGTTTTAGAGTACTC
CAAGCTAGCCTTTGGGCACTTCCCTTAACTCCAATGAATTCCAAATCGCTAAGGTCTCTTATTTTTTCTA
TAGGCTTTTCCTTTTTTGGGGAGATTAAGACAAGATGGTCATAGGCTATTGCTGTAAAGTTCAAGTCATT
TTCAAATGCAAGCAATGGATCGTCTAATGCTAAAATGTCAATCTGATTGCTTTTTGCAAGTTCATAAGCG
CTTTCATCGTCACTGCTGTAGATTAATGTCTTAAAGGGCAAGTCGTAGCTGATTGCTTGAAGCAGGCCTG
TTATGATGTGGCCTCCTGCAATGACAATCTCTTCTCTGTCTTCAAGGCGATTCTTATATTTGTGGTATGC
ATTAAGCAATTCATAGCCTTTTGGACTTAATTCAGAGCCTGAACCTATTGTAACAACTAATTTTTCACCA
AGTTTGTCTTCAGCATTTTTTATTCTTCTATTTAAAACAGAATGGGCTATTTTCAATTCTTTTGCTGTTT
TTCTTTGAGAATATGTTCGAGATAATGATTCTAAGGTTTCAAATAGTTTATGATTAAAGGATATTCCATT
GATTGTGATTCCAATTTCCGGTTCAATGATGGCTTTGCCCTTTTCATTATCAGTATTCTCTAGCATAATA
TCCCTCATTAAATAATTTTATATATTCAAAATAATATAATATTATTATCGAAATATAATTAATTTTTTTA
AAAGTTTTTTAGAAAATTTTTGTTTTTTCTTATTATTTCTTTGAATTTAAATTTGTTCTAATATGAATTT
ATTTATATTTTGTGTTTATTATAATTTTTTAATCGATTATTGTTAAAGAATTATTTTTTCATTTTTAAGG
TATAATTAATTTAGGTAGAGATTAAAATGGAATATATGAAAGACGCTATAGAAGCAATTTTAGATAATAT
ACGTGATGCTGAAGACTATTTAGTTGAAGAGGATGTTGCTACATTTATTGATATTATAACCTCTTGTGAG
AATATTTTTGTAACTGGTGCTGGAAGATCCGGTCTTGCAGCTAAAGCATTTGCTATGAGATTGATGCATT
TAGGATTAAGTTCCTATGTTGTAGGGGAAACCATTTCTCCAGCTATCAATGCTGATGACTGTATTTTAGC
TATCTCTGGTTCTGGAGAGACCAATACCATTGTAACTGCAGCGAAAATCTCCAAAAACAGAGGGGCTAAG
GTTTTAGCTTTAACAAGTTATCCTGAAAGCACTTTAGGTCAATTGGCAGATTGTGTTATTCTTGTAAAAG
GTAGGACAAAAGTTGAAGCGGATGATGAAAACTATCTTAAAAGACAAATCAAGGGAAATTATACTTCCTT
AACTCCACTTGGAACTGCATTTGAATTGACTTCATTGGTTTTCCTCGATGGTATGGTTTCTGAATTGATG
AATGCTATGGGAAAAACTGAAGCTGATTTGAAATTAAGGCACACTGTCTTAGAATAGTTGTTCTTCTTAT
TTCTTTCATTTTTTCTATTTTTATTTATTTAACTTATTTTAGTCTTTTTTTTATTTATTTAACTTTTTTT
AGTCTTTTTTTATTTATTTTACTTTTTTTAGTCTTTTTTCTATTTTTTTCTGGTTTATTTGGTCTTTTTT
TTATTTTAGTTTATTTTAGTCTTTTTTCTATTTTTTATCTGGTTTATTTTGGTTTTTTTATTTGCCTTCT
TTTATAAGTTTCAGTATTCTTATTCTATTTATTGCATCGATTTGTCCTATTTTATTATCTTTTTTTAGAT
ATTATATCAATATGAATAAGTTTTCTTAATCGTAAAAGCTCTAATTGGCCCTTTTTATTAATTTATTTCT
TATTCTTCGAATTTTAGAAAATTATTTATATTATTGAAATGAAAAATATTTCATGTTATACATATAATTT
AAGAATTTAGGTAATATTATGGAAAAGAAAACTACAATTATATTGGTTATTTTAATTGCTCTTATTGCAT
GCGGTGTTGGAATAACTTTATTCGCTTCACCATCATCTATTTCTACAGATGGGAATACCACAATAACTGA
TATGGCAAATAGGACTGTAAATATTTCAAGTAGTGTTGATAGGGTGGTTGCTACAAGTCCACCTATGACC
ACTATCGTTTATATGCTGGCACCTGAAAAATTGGTTGGTGTAAACTTCCAATGGACTGATGAGGAACTAA
AATATGTTCCGGATCAGTATAAGGATAAATTCCCAGTTATCGGTGGATGGTTTGGAAGTCAAGACGGTAA
TTATGAAGAGTTTATTGCTTCTGAGCCTAATTTGGTTATTGAAGGTATTGATGAAGGAATGGGTGTTGAC
CTATCAACTGTTGAAGAAAGACAGGAGAAGTTTGGTTCACTTCCTGTAGTGGCTGTAACTGACAATACAA
ATGTTACAAAGATAGACAATACGATAGAGTTCTTAGGCAAGCTTTTAGGTGCTGAAGATAAGGCAAATGA
GTTAATTGCTTTTAATGATAAGTATTTGTCTCAAGTTCAATCCACTGCAAGCAGCATTCCAGATTCTGAG
AAAAAATCTGTTTATTATGCTTCTGGTGAGGATGGATTATCCACTTATGCAAGTGGCGCTTCACATGGTC
AATTGATTTCTCTTGTTGGAGGCAAAAACGTAGCAGACACTGAAGTTAAGGATAGCGGAAGTGAATTGAC
TGTTTCCATTGAACAGGTAATGTCTTGGAATCCTGATGTTATTATAGCCACAGATGAGGACTTTTATAAT
AAGGTTTATAATGATTCCAAATGGGCTAGCGTAAAGGCAGTTAAGGACCATAGAGTATATCTTTCTCCAC
AGTCTCCATTTAAGTGGTTTGATAGGCCACCAGGTGCTAATATAATTATAGGAGTTCCTTGGACTGCTAA
GGTTATTTATCCAGATAAATATTCCAATATAGATATGGTTGGAGCTACTAAAGAGTTTTATAGCAATTTC
TATCATTATGGCTTAAGTGATGAACAGGCTAAAGAGATTCTAACTTCTTCTGGTCTAAAGGGGTCTGATT
TGTAGTTATTAACTTAATTGTTTGAGTTTGATTTAAGTTATTAGATCTCAAACTATAAGTTTTTAATTTT
TATTAATTTTTTATAATTAATAAGTATCATTCTAAATGTTTCGATAGGAGTTTATTTGCTTTCTTATCGA
TTCTTTTTTTATTATGTCGAATTATTTTAAGGATTTGTATATATGAGTGAAAATTCTTCCTTTTCTGTGG
ATAATCTGGTTATTTATCTGCTGCTAATAGCATTGCCAATCTTTTTGTTCTTTGTATCATTTATGTTAGG
TAGATATCCTGTGGCACCTATAGATGTTATAAAGACCATTCTAAGTCCTATATTTCCATCTTTGGCTGTG
TCTCCTGAATTGAATTCCATCGTCTTTACAATAAGGCTGCCTAGGATTATAGCGGCTTTGCTTGTTGGTG
CTGCCTTATCTATAGCTGGAGCTTCATTTCAGGGAATATTTAAAAACCCTCTTGTCTCTCCTGATCTTTT
AGGAGTATCTATGGGAGCAGGTTTTGGAGCGGCCATTGCTATTTTAGCAAATGCTGGAAATGCTTTGATT
CAACTTTCTGCCTTTGTCTTTGGTCTTATTGCAGTATTCATTACATTTTCAATATCAAAGACATATAAGG
CCGGAGGAATTTTACTCCTTGTGCTCTCTGGTACTGCAGTCTCTGCATTCTTCAATGCATTGATTTCAGG
AGCCAAATTTATGGCAGATCCTTATGATAAATTGCCTCAGATTACCTATTGGCTTATGGGCAGTCTCTCT
GCAGTTAATTTTGATAAGCTGGCAATGATAATCATTCCATTGGTGCTGGGAATAATTGTCGTCATGATTT
TAAGATGGCATTTGAATGTCCTCTCTATGGGTGATGAGGAAGCCCAATCATTGGGATTGAACCCATCAAG
ACTTAGATTGATTGTTATTATTGCCTGTACTTTAGTAACATCTGCTGCAGTTTCAATCAGTGGAATTATA
GGGTGGATAGGTCTTGTTGTTCCTCATATGACTCGTATAATTGTAGGTCCAGACCATAAGATACTTATTC
CAGCTTCATTAAGCATAGGGGCAAGTTTCCTATTGCTCATTGACAATATTTCAAGAACTTTCATATCAAT
TGAAATTCCTATTGGTATTTTAACTGCAATTATTGGTGTTCCTTTATTCCTTTACTTGCTTAGAAAAGGC
TATTCTGAGTGGAATTAGTATGGAGAGTGGATTTATTTGCTTAAGAATTGGCTATTCTGAGTGGAATTAA
TTTTTTGGAGAGTTTCTATGACAAAATTAGTAGAAGTTAAAGATGTTTCATTTTCCTATGACAAGGATTC
TCCGATTGTCTTTGAGAATATTAATTTCTCAATTGAAAAGGGGGATGTATTATGTATTCTCGGTCCAAAT
GGAACAGGCAAAACAACTTTGATAAAGACATTGAACGGTCTTCATAAGGTTAATTCCGGTGAGATACTCT
TAAATGGAACTAATATCAAGGAGCTTTCATTCAATGACATTGCAAAGCTTGTTGGATATATTCCTCAGGG
ACATATTCCTTCTTTTCCTTTTAAGGTATTCGATGTTGTATTGATGGGCAGGTCTCCTTATATCAATCTT
ACAGCTTCTCCAAGGGAGGAAGATAAGGAAATTGCTCTTAACGCTCTTAAGACTCTTGGAATAGAAGACT
TGAAGGACAAAAGCTATACCAATCTAAGTGGAGGAGAAAGACAATTGGTCTTTTTGGCAAGGGTATTGGC
TCAAGAGCCAGACCTTTTAATTCTTGATGAGCCTACAAATCATTTGGACTTTGGAAATCAGATAAAACTT
CTTGAAATGATTGAACAACTGTCCGAGCTTGGCCTTGCAGTCATCATGTCTTCACATTATCCAGATCATG
CATTTTTAGCAGCTTCTAAGGTAGCAATCATGAAAGACAAGAGCTTTATTGATTTTGGAACTCCAGAAGA
TGTTTTAACTGAAGAGAACTTGAATAAGGCATATGGCATAGATGTTAAGCTTGTTGAATTGGAAGACGAT
AGAAAAATATGTGTTCCTTTAAGGACTAATTTGGAGTTGGTTATGTCTAATTATTCTAAGAAGTACTCTA
AGGATTGATTTGCGGTTGCTTATGACTGATTATTCTAAGAAGTACTCTAAGGATTGATTTGGGGTTGCTT
ATGACTGATTATTCTAAGAAGTACTCTAAGGATTGATTATTTAAAAGTAATTATATAGTATAAAAATTAT
AATTTAATTAATTAGAAAAAATTCTTTAAAGAAAATTTATTTAGTTTATTTTAACAAAGTTTTGATTATT
TTATTTAAAACTTTATAAAAAACTTAAAAAGTATTTATTATTAAGTATGGTGTTAATATGGTAAGTGTAG
AAGACTATGAAGAACAATTAGCTAAAGCTGGTGAATTCCACGGAGAAATCTGTGGTGGAATAGCTATCGG
CACTAAACTTGCAATGTATGGTATGGAATTAATGGGCTTTGAATTAAACAAACGTCATAAAAACCTTATT
GTATTTTTAGAAATCGACAGATGCATGTCTGATGCAGTTCAATCAGTCACTAAATGTTCTATGGGTAAAA
GATCTCTTAAGCAAATGTATTATGGTAAATTTGCAGTGACTTTCTATAATATGGACACAGGGGAAGCCAT
TAGGGTTTCCGATGCAGATGCCAATAAGCAAGAAAAGAAAAGAGAAACCAGAGATGAAATGATTGAAAGA
TTTAAAAGAACTCCTGCTGAAGAGCTATTCAATGTGGAAAAGGTTCATGTTGAATTGCAACCTTCTCAAA
TGCCTGGAAAACCTCATACCAGTGTATTCTGTTCAGTATGTGGTGAAAAGGTTACTGACGGTCGCCATGT
AAACCGTGGCGGTAAGCCTGTATGTATTCCATGTGCAGAAGGCGCTTATTATGAGTTAATAGATGAATAA
TTTCATCTTTATTTCTTTTTTTTATAATTCTATTTTTTCTTAATTTTTCTAATTCTCTTTTTTCAGTATC
TGTTATTTTATCATATTTTAAATTTTTTTAATTTTTGGCTTTTTTATTTATTTTCTCTATGTTTATATGT
AGATAGCATTTCTTATTTTTTTATAATTTTTATATAATTTTCATTATTTTAAATATTCGATTAATTAAAT
TGACTAAATAATATTTGATTTATAAATTTAGTATGGCTATTTTTATTTTAATTGCATCTAAAATGAATCA
TAAAATTTATATGTATTTTCCGACAATATTTTTTTAGAATTGATGGTGATTGATAAGGCATTCTTTTAGA
ATATCTTTACAAAGTTTTAAAATTTAGTCATCAAAAAATAGTTTAAAAAGAAAAAGGAGTAAAATAGATT
AAATAAAAAAAGAAAGTAATATGTTTCAAATAAAGAAAAATAAAGAAAAAAATAAAAAATAAAAAATAAA
ATTAATTATTTTTTATTTAATTTGGAATCTCTGAATCTGGAACGTCATAAGCATAAACAACACTATAAAT
TCTATCCACCACATTTATCAAAGATCCTACAGATATTTCAATTGTGTTATTGCTGTCTAGGTAGTTTGAC
TTATCAAAGCTGAATGTACCTGTACCGTTTTCCACATAGAAATGAACTTCGGCCTTTTTGTCTGTATTTC
TATTTATTGTGGCATAGATGTCGAATTTAGCGAGATTGATTGCAAAAGTGCCGTTTTTATAGAAATTGAT
TTTATAAGTTCCATTTTCATATTCAAGGGTGTTGAACTTGATTGTAGTGGACTTGATTCTAGGACACATT
GTTCCAACCCCTACAATGCCGGTTTCATAGTCCCAGGTTCTAAGATTGTTTACGCCGTACCAGTTTGGAT
CTATCTTTAGCTTCATGCTGTCGTCCCATTGGCCGGCTCCATAGATTCCATTTGGATTTGCGCTCATTTC
ACCAAGAATCATTAGGCTAGGGCCTTCTGCATTTCTATAGATTGCATTGTCAGTTACCACTGGTTCAATT
GCATTTTCTGCCAGGTCATAGCCTTCGTTGAATCTGATTCCTTCAAGTGAGTTGTCTGCAATCAGATTTC
TTGTGATGACGATTCCTGTGCTCTTGTTTGCATCAACGGAAATTCCCATATAATTATTGCTGATATTGTT
ATCTGTGATTGTTATATTGGTTGCTGAATTATTAAGGAATGCTCCATAGCCTCTAGGGCCTTCTGGAACC
TCTTCTGTGTACCATCCGATATTGTCAATTATTGTATTGTTGTAAATTTGGGTGTTGGAGTTTCCAAATC
CGTATTTGATACCATAATTGTTTTCAGTAATGGTATTTTCTCTTATCACTGCATCATCGCTGTATTCCAT
ATAGATTCCGCTTTCAAAGTGGTCTATATTGTTTTGTTCAATCAATGTTGCTTTGCTGTTTAATATTTCA
ATTCCATGCCCTGGAAGTATTGTGCTTCCATTATTGTAATCAGTCATTTTAGATGAATCCAATATGTTGC
TTATTGTGTTTCCATCTATCACTGCTTCTTTTGTATTGTTAAGGATTATTCCATATCCTTCCCCATCTGT
GGAGTTTACATTTATATTAAAGAAGCTTACTCCAATATTACCCCCTCTTAAATTGAAAACAGGGCTTGCT
GATTTTCCATTTAATGTGGTATTTACGTCTGTGTAGATTAATAAGGTTTTGTTAATGTTTAGATTGACAT
CGTCGTAACTGTCACCTAAGAATTTTACATCATAATTTGGCTTAATTTCATCTATGATTCTTTGAATCTC
GTCGTTTTTAAGGCCTTTATCGATATAAGCGGTTTCTATCTCATCTGTTATTGTGATTGAATTTGTGTTT
GTTTTTGCATTGTACTGATCGTTTCCTAAGAATTTTGTGCTGATATTTTTATCATAGGCAAGATTTATTG
TAAGATATGCTAAGCCATCTGCATCTGTGGTTCTGTTATATGTCTTCTTGCCGATAGTGAAGCTTATCTT
TTCATTTTCCAATGGAATATTGTTTTTATCAGTAAGCTTTGCGCTGAACATTTGTCCTGATTTGTTGATA
TATGTTCTGTTGTAAGTTGTAAGTTCTGCAGCTGCTTTTGCTATTGTTATTGTATTTTCGGCACTTGCTG
ATGAATATGTGTCATCTCCGGCATACTTTGTTGTAATTGGGTATTTCTTAGTGTTTGCAAGGTTTATCTT
TAAGCTTGCTTGACCATTTTCATTTGTAGTTCTTGTGTATGTTTTTTTGCCTAATGTGAAGCTTATTTCC
TTGCTTGCTATTGGATTGCTGTTTGCATCCTTTAGGGTGACTGTGAAATTTTCACCGGATTTAGGAATGT
AGGTCTTATCTGAGCTTTCGATATTTACTTTGTTTGCACCAGTTTTGATTGTTATTGTATTGGACTTTGA
AACCTCGTTGTATTGGCTTGTCTTTTCGGATTTTGTAGTTATTGTGTATTTTCCAGTGTTTGCAAGGTTT
ATCTTTAAGCTTGCTTGACCATTTTCATCTGTAGTTCTTGTGTATGTTTTTTTGCCTAATGTGAAGCTTA
TTTCTTTATTTGCTATTGCCTTGTTGTTTGCATCCTTTAGGGTGACTGTGAAATTCTCTCCGGATTTTGG
CAATAGATCTATGTTTGAGCTTTCTATTTTAGGGGTTTGTTTTTTAACGGTTAATTTAATTGTTTTTGAG
CTTTTATTATAGTTTTCACTGCCTTTAAAGTTGATGTTGACAGTGTATGTCTTTGGATTTGATAGGCTTA
CCTTAAGATTTGCCTCACCGTTTTCGTCTGTAGTTCTTGTATATGTTGTTGAAATTCCAGAGATCTTGAA
TTGAAGGCTTTCTCCAGCTACAGGATTTCCGTTTTCATCAGTTAATCTTGCAGTAATCTTGTTTCCAGAG
TTTGGAACAAGACTCATATCTGTTGCATTGATTGTGGTGTTTCTATAGCTTCCAGGGATATCTGAGTCAT
TTACATCAAAGGTCGCATATGGGTTGATGGTATATACATTATAAAGCCCTGGGAAACATGCGGTTATCTT
ATTTCCACTTTCTTTAAACTCTTTGTCTGTAAGATTTACAGTTGCAGTTCCGTTTTCCATTAGGACAGTT
TTATAGATGTCTCCGCTTTGAGGCTCTGCATCGGTATTGTTTTTATTTAAATAGAAAGTCACATATATTG
AGCTTATGTCGCTTGCAACGATGCCGTTGACATCTACAATCGAAACAGAGTATACTCCTTTTTTGACTTG
GCTGATTGGACTGATCTCTAACTTATAGACCTCAGTTCCCCAAGTGGTGCTTGGAGCTTTAAAGAGAGTG
GATCCGCAAACGGTTTCGTCTCTGTAGAATGCATATCCAAGGTAGACTACAGTCTTTCCAATGTCCCAGT
CTCCATTTCCGTCCCCCACATAGACGTATAGATCATTTTCGCTGTCGTAAGTGAATGGGCCTCCGGCATA
TTTGCTGTATTCGATATGGTATGTGATTCTTTCGGTATGTCCTAAATAGTAATTGTTATTGTTTATCTCT
AGGGTTTCAGCTCCTCTGGATGCATCCATATTTCTTACACGATAGTCGTTTAGGACTCCGTATTGTCCGT
TTTGCTTGAGGAAGTTTCCTTTGATTTCAACTTTGGTGATATTTGAGTTAACATATATTCCAGCTCCGCT
TGAGCTTTTAGAATTTTGATTGTGACCAATGAAGTTGTTTAGGATGTATACATAATCTCCAGAGTAGAGG
TCTATTCCGCTATGCTGGTTATATGTGATATTGTTAGTGTGAATAGTTGTATCGTTGTTATTTATTCCTA
CATTGACACCTGTGACCTTGTTGTTTGTTATGTTATTGTTTGTTACGGTTGTTTTGCTTGAACCTGTAAT
GTTTATTCCAATGTTTGAATCCTTAATTAGGCAGTCAGCTATTTTTGTGTTTGTGGCATTTTCTATTCTT
ATTCCGTCACCGTCGCTGACTGTATTGATTGTACAGTTGATTATTTCTACATTCTCTGCTCCTCTTATGA
GTATTCCATAGTCGTCATAGTCACCATATGTGTTTGTTAGATTGAATCCCTTTAGGACTGTTCCGCTAGC
TTCAGGGCTTATGTAGAATATTCCATGTGCACCAGAGCCTTTTGTATTTGAAGGGCATGGGCTCATTGAT
GTTCCAATCTCGCTTATTATTGTCAGTGGCTTGTTAACTATGAAATGGCAGTGAACATATGACTTTCCGG
TTATTATGATTGTATCTCCAGCATTTGCACTGTCTATAGCGCTTTGAATGGTTGGATTAGACATTTGGTT
TTCATCTGAGCCGTCTACAGTGATTGTGGAGGATAGCTTGCTTGATTTTAGATTGGATTTTGCATTGCTT
TGTTCTAATTCGTCTTCCCTAATCTGATTAGATTTATTTAAATTTGAATCTAGTTCTGTTTCTCTATTTA
GGTTTGAATTGTCTATTCTTATGTCAGTTGGATTGTTTATATTGGAGTTATCGACATTATCGACATTATC
AATATTAGCGATATCCTCATTATTATCAATATTATTTATATTATCCATATTAATTTCTTCATTATCCGTT
GCAACAACAGATCCTATGCTTATTATTGTAATCAGTAATAATAAAGAAATTAATATTAAACTCTTATTCT
TCATATTTCTCACTTTCTAATTATATCAGATTTAATATTTAATATTTATTTTTTTTTAAATTATACAATT
ATTAAATACTTAATGATTATCTTTGCAGTTTGATAAAAATCTTAATTTTTGTATATATTAACTATTGTTA
TATTTATTTCTCATATTATATAAACTAATATTCATATCTTTATATTTTTATTTATTAATCTTTTTCTATA
ATATAATTAATTATTTTTACTTATTTAAGTTAATTCTAATATTATTTTTCTGAAATAATGTCTTATTTAG
CTTAAATTTGTAAAATTTCTTTCTTATTGGCTATAAAAAAAATGTATTTTTAATTGATTGTAATAATTAA
TTATTCTGGGTCTGACCTCAATATAACCCTAATTTTACTGTCTATTTTTGTACATTTGTCTTAAAAGTTA
CGAATTAAAAAAACATTTCTTTTCAAATGCTCTTAGATAATAGAGATTTCATATGGGAGGGATATATATC
ATCATGAAGACTTTTAGACAACAGCTATTGGAAGACCCTGAATTCCAGAACTACCTGTTGCAGAGACCGA
ACCTGACGGAGAGCAGCCTGCAGTCATACCTCAATGCCGCCACCAACTTCGTGAGGTTCACAGGGGAGCC
GTTCTACAAGACCGTGCATGAGCTCAGAAGCCAGCAGAACGATAGGATTGAGAACAACATCATCATAAGG
TTCAACCCGAACCAGTCAAGGATAAACATCATGCAGTTTGAGTTCATAGAATACCTCAAGGGAAGGGGCT
GCACCGAGGTGAGCATAGACTCCTATGTCAGGTACATGAGGACCATACTGAGCACCTTGGGAATCATACT
GCCCAAGTCTCCGAAGCTGGACGACACTCCACAGGACTGGTATCTCCTGACAAAGGACGACATAAAGTAT
GTCCTCGACACAGCAAATCTGCAGTACAAGGCGGTCATCAATTTCGCTGCCGTTACAGGACTGAGAGTGA
GGGACATGAGGTCATTGACCATCAAGGACTTCATGACTGCGACCGAGGAGTACCATGGCTGCACGGAGGT
CGAGGACTTCCTGGATTCAGCACCTGACGGGATGATAGGCTTCTGGGAGCTTTTCCCTCAAAAGACCAGA
AAGTTCAGGCTTCCCTGCAAGGTGTGCAACACCCCTGAAAGCAGCGACCTTTTGCTTTTCTCATTGAATG
AGCGTGTGAAGTACTTTGAATGGAAGAACGAGAAGGACGGCACTGACCTGAAGATCACCAAGAATGACCC
TCTCTTTGCAAGCCGCCAAAGGAAGTACAAGAACTTCATAGCGCCCAACAGCATAAGCTGGACCCTGTCC
CAATACAGCGAGAAGCTGAGCGCCGAGAGGGAAAGGGTCTTCAAGTACAAGCTGGAGCATGGCGAGATCA
GTCAGGAGACCTATGACGAAAGCGTTGCGACAATCCCCAAGTTCCATGCGCATGGGCTCAGGAAGTTCTT
CATCTCAACATTGGCTAAGAACCGTGTGGATGCAAGGATAAGCGCACTTATGGAAGGGCACAAGGCTCCG
CTGGTAACGGATAGCCACTACATCAACAACGATTACCTGAAGGAGACAATCAAGGAGGAGTACATGAGGT
GCATTCCTGACTTGAGCTTCGAGAATGTTGAGGTCCGTTTCCTTACAAGCGAGGAAAGGAAATCCTTGCA
GCAGAAGATAGATGAGCTTCAGGAAGAGAACGAGAACATGAAGAAGGACATGGAGAAGTACATTGACGAT
GCCGTCCATGAGAAGATGAAGGACGCCTTCGAGAACTGGCTGAACATTCAGGACTCAAAATGAATTTTCG
ATTTTGGAGAATAATGAAATTATTCTTCTTTTTTTACTTTTTTTAATAAAAACCACAAGCATATCTACAT
ACATCAATTCCTTTTCACTGATTCCAACACTACTTTTAATTAAATTAAATATCACTGTCATAATTATGGC
TACTGTTCATATAACTTATATTTTGATAAAATATGTAATTAATTAAATTTGCTTCAACTTGTTTTCCTGA
AACTGTGCCGAAAAACTTATAAGTGAAACTGCAATTTTTAACAATATGACATCAATATTATAATCATCTC
GTAATCACAAACACGGAAATTCATTAAGTTTATATATGTGAGTCAAAAGACCGAAAATTAGGAAACACTT
ATGGAGGTTGAAAATGAATACATTAAAAATAGAATGTTCAAAAGATGATTATATCATAAAGACTGCAAAG
GCAAATTCTGAAAATGAGTTGAAAGTTGAAGTTCCTGAGAACTGGAACTGCGACTATGTGAATGCTGTCC
TGTGGGAAGAGGACATCTGCGAAGTGCTTGAAAAGGGTGATGAAAGAATGCTTTTGATTCCTATGTGCGG
TGAACTGCTTCTTGAAGGAGTGCAGGAAGATGAATACATAAAGTACATTTGCCTTCCTGTAAAATATCAA
GATCAGATGGTTTTGATTGCAAAAATTTAATTTTTATTTTATGGAAAGTGTTATAGAGGCAGATTTTTCC
CTTGTTCAATAAAGGTTTTTACGAAAGCGTCAAATCTTGCCTTTTTTTCATTATCAGAAGCAAACCATCC
ATTTTTTATTTTAAAAGTAAGTACTGTGCCATTGTGCAATGTTAAAGTAACTAGTTCATTCACTTCCTGT
TCAGGATATTCCAATTCACAAACTTCATCATAATAAAGTTTAGTTGCGGTTCCATCAATATTTAATATCA
TCTTCTCTTTGTCAAAAAGAACTCTACACTCTTTATACTTTGCACGAGTCACTTTTTGTCTTGTATAGGT
TTCACTTGGATAATGCTGGCTAATTGAATTGAACTTGCCTCTTGATGTTACTGTTTGAGCAGGTATGCGC
ACTATCTCAGTTTCAGTCTTAGGCTTTCGAGTTCGTATTTTAATAGTATATGACCCTTGAATCATATTGT
GATAAGAGTTTTGTAAATAAATATTATACTCTTTTTCTAGATATTCTTCATATGCTTTATCTTTTGCTTG
AAGCTCTTGAATTTTCTTTTCATCTTCTATTAATATTGTACCGCAATCTGGGCAGATTTTCCCATAACTG
TCCATTACTTTTTTACATTTTGGACAATACTTTTTAGGTATGAATGTTTTAATATCAATGCCTTCTGACT
GAATTTCATCAATTTTTTTCATTGCTTCAATAATTTCATTTTCAGAGTAGTTCATTAAAACATAATGGAT
TATATCTTTTTTAAAAATAAATTTATCATATATGTTAAAATATGTGGAGAATAAAATTAATCTATCTTCA
TTATATAAATCGTCATATAATTTATAGAAGAGTTTTTCGTTTCTTGTCATATTATTTTTTGCTTTACTTT
CGATCTTAACTTTTTTCATTCCCATATTGTCATCCCCTTTTTAAAAATTAAAACATAATAATATTTTGTT
TTTCTATATTTAATTATTTTGTTAATTTTTTTACACTTGAAGATTGAGCTCGATTACTTTTCAAATGCTC
TACTCTGAATTTTATATGTAGCACTTAACCAATATTATATCATCTCTTGGTGAGAAATTTTTAAAAAAGA
CAGTCGAAATTCTTTTTTTTATGAAGGGGAAATTTCAATGAAAACACAAGATCTAATTAATATAATAAAT
GATGAGGAATCTCCTGTATTCCTCAACAGGGAAGTCTTTGAGATGGACTATGTGCCGGACATCTACAAAT
ACAGGGACGAGCAGCTGGCGAAAATGGCGATGTACTGCAATTCAATACCTGACAACATAGCTCCCAAGAA
CCTGCAATTGTGCGGAGGCAATGCGACAGGAAAGACCACAACATTAAAGCAGTTCTTCAAGATGTTGAAC
GAGGCTTTTCCAAACATAGTAACAGTCTACATCAACTGTCAGCTGTTCAACACAGAAAACACAGTCTACG
GAAAAATATACAACAAGCTGTACGGAGTAAAGGGCTCGATAAACGGCAAGTCAAACACCATGCTCTTCGA
CAAGATTGTCGCAAGGCTTAAGAAGGAAAATAAGATATTGATTATAGGCTTGGACGATTTTGACAGCTTC
AAGTCTCGCGATGGGCTCAACAAGATGCTTTACAACTTCCTGAGAATCCATGAGGCTGAGGAAGGCATAC
AGATCTGCATCTTCACCGTCAGCAACAAGGAGAATCTGAAGCTTGCTCCTTCCGTCGAGACAATCTTCAA
CAGGGTTCCGATATTCTTTGACCAGTACTCCTTGGAGCAGATGTACCACATACTGGACGACAGGTGCGCC
TTCGGTTTCTATCCTGGCGTGATAAGCGATGAGCTGGTGAGGGTTGTTGCCGGCAAGTCCTATGACCTGG
GCAATCTGAGGTATGGCATTAAGCTTCTGAGCGCTGCCGGTCAGAAGGCTGAAGTCTTTGGTGATGGAAA
GATAATAAGGAATTTTCTTGATTGAAATTCCTTTTTCCTCCTCTTTCATATATTTAAAAAGTTATGAATC
TAAAAGCGTATTTTTCAATTTCATTTTCTATAATTCTTACTGGGTCTCCATATGTCATGCCGTTTCCTGG
AGTGTGATATAAGAATTGGCCTTCAAAAAATCCTTCTTCAATTATTCTTTTTTGTTTCAATATTTTAGCC
AAGCCATCCAATTCATCAACAGGAATATTAAAATAGTATGAAGAACGAATGAATATTTTATCGTATTTTT
CATCGTCAATTTCAACATCAAATACATAACTTTCTTTTGCAGAACCAAAAACATCAAATTCAAATTGGAA
GTGTCCTAATGTCATTACAAACGCTCTATTATCGTTTAATATGTAAATTGAACAATCCTCTTCTAAATAA
TTTTTAAAAATTTCGTTTAATTCTTTAAGAGTAAAATCATACTTTATTTCATGTTTTAGTTTTGATTTAG
AATCCATTGATATAAAAATTTCATTTGTTGAATGGGATTTAAAAATATTAGTTATTTCGTATAATTTTCT
TTCTCGTCTAAGGAATAGTGGTGTCTTTTCATTTTGGGTTCTGTTCATTGGATAAGTAGAGGCTATTTGA
TTTATGCTCTGAGTATGTAATGTAGGATATTCTGATTTTTTATAAATTTCAAACCCAAAACTTTCTTCAA
TCAAGTTTACATCATCATAGAAATTTATAAAGTCCTGATCTCCTATTTCTCCATTTTTGTACCATTCTTC
TGCTTCATTTATAGGTATGTTACAATGAATACAGGATATGAAGGGGCTTCCTTTGCTTTCCATAGTTTCC
AATATAAGATTCATCTTTTCTTGAAGAGACATGCTGATTGTATCTTTTCCATCGCATTTTTCCAAAAACA
TTTTATCACCAAAATTTGAATAATGTTATATTTAAATATGTTAAACTATTTTTTTAAACTTTACTTTTTA
AATGAAATTTTTACACTTGAAATGCAACTACCCCTCGGGTCGGGTCGGGTCACGTTGACTGCTTATATAC
AACCTAAAACATAGAATAAAGTAGTTATTGTTAGTGAAATAATTTGTAAAAAATAGCGGTTTTTTATGAA
ATTTATTTTAAGAAAATCAGTCAAAATCAGTACTAGCTTCGCAGAGTAAAATGCAATATTGGCGTATTGT
AAATTACTCTCCACTAGCTGTTGCATGTAAAAAAAGAAAACATTGGACGTGTAATCATTCTTTTTATGCA
ACATTTTATATATTGAACTTTCAAATATTTAAAATCTTGCTTTTTATGGCTAAACAGCAGCTATTAAGCC
GTATTGATTTGAATCTACTTTTTTTAATATATTTCCAAAACTTTTTGCTTATTATCTAAAAATCTCATAA
AGAGATTATTTTTAGAAAATAAGAACAATTTAATCTCTATTTTTTATTTAAAAAGTTTTAAATACCAAGA
ATAACATATAACTAAATAAGGAAGATTATTTTAAGTTGGCGCTTGATAATTTTCCTTAAACTAAAATTTG
GACGTGTAATCATGGAAAAATTAATCGAAATTGACGGAGTTCAATACACAGAAGCCCAAATCAGAAGGGC
TTTAGCCATTGAACGAGACGTGCGCTCTCCTAATTTCGTTGATATGTTATTGGGAAAGATCAAACCTAGC
GAACTTGCAAGCAGAGTTTCTGAAAAAGGTGATGCCTAATGTGCTATGTGGGAAACACCAGGACATTGGT
CTATCACACAGAGGACTGCTTCTGCAACCACTGGCTGTTGAACGAGAACAAGACCATTCTAGAGGAAAAG
CCTGTAGACATGAAACCTTGCAGCTTCTGCAAACCACAGTTTGACACTGAATAGGTGTTGGATATGGTTG
CAGAGATGGTTGAAAACATCAGGAAAGGAGAAGGAGATGGATATTCCATCTACCCTCCTTTTTCCTGCAT
TGTTTTCCTACAAGGCAAAAAGTATTCCGAATGCTGCTGCAAGGCTGAGGCAAGGGATCAGAAGTTTGCA
CTTGTGAACCTTGTAGGCTTCAGAAGAGAGGATGTCAAGGTCATAGACCCAAGGACCAACGAGGAGCTGT
TCGTATGAGCATGCTTGCAGACTTCGAGCCTGCAAGGCTCCACAAGAGGACATGGGCTGAAAGGCATGAT
GTCGAAATCCTTGCTGTCATATGCCTTGCCATAAGCATTGCAATGCTACTTCTTTTCTTTGCGCTTGCAG
AGCCGACTGTTGCAGGAGTGATTTAGATGACTAAGGAATTTGAGGACTTCATGAGAAGGAACACAGGACT
GCTTGTTTTCTTGAGATGGGACACAGTGGCATATCTGAAATACCTTGAGTCCCATTATGACGAAAGGAAG
TACGAATGCGCTTACAGATTGTTGGAGGCAATCGACAATCTCTTTGACTTCTACCAGATAACCTTCAGCA
AAAAGACTGAAAGGGAAATTCCTGACCAGCTTTTTGAAAAGGACAAGATAAACAAAGGCTTCCTTTCACA
CATAGGAAAGGCTTGCAAAAAGCAGTCTGATTTTTACGGTCAGAGATGGAAGTCCACAAGAGGAATCAGA
GATGCCTACGGACACTATTCCGCAGGAAACTTCCTGTTTGCAGACATCTACGGTTGCCTGCACAGGATAA
GCGACGATTGCTACAGGATTTTGAACTTTAGCGAATATGAAATTGAGGAGAAAGCATGAATGAGATAGTT
ACTACAACTAACGAGAATAATGTACCTGTCGACGTTGACTATGCCATCGAGGAATGGAAGGCATACCAGC
GATTGACCAGAGAGCTATTGGACGAAACAGATTATCAGACACACAGAGGCAGGAAGTACAAGACCAAGAG
CGCTTGGCAGAAGTACGCACGTGCCTTCAACATAAACACACAGATAATCGACAAGGAAATCGTCAAGAAT
GACAAGGGAATCGTCATTGAGGCTGAGTATACTGTCAGAGCCACCTTGCCTAACGGACGCTTTGTCGAGT
CAGACGGAAGCTGCGACAGAAGAGAGTCCGGAAAGAGGGAAATGAGCAACCACAGCATAAAGGCGACAGC
CAAGACCCGTGCAACCAACAGAGCCATAAGCGAGCTCATCGGTGCAGGGGACGTCAGCGCTGACGAATTG
GATCCTGCATTCGACAAGGTGCAGCACAGCAAGACCAATCATGTCATTGAGGCGGAAGTTGCAGAGATAA
TTGAATCTCCGTATGACAAAAATGCGGGTTTTGAGACTGCCGACAAGATTGAGCCTGTGGATGAGGACCC
TGTCTGCAAGAATTGGGTGAAGACCATCTGCAAGACAATCAAGGCAGAGGGAAAGCCTTGCCTTAAAGGT
GTCCTCATCCAGAAGGCTAGGACCATAGGCACCATGACCGACGAGGAAAGGAACAGGCTCATCGAGTACA
TAAAGACACTTCCGAAGGGAGAGGTGAACCTCGATGATTGAGTGCATACAGGAAGAGGGAGACTTCACGG
ATTGGGAGGTTCCTTCCTCCTCTTCCGACATCAAGTACATAGTTTCAGTGGATGATGAGGGAAACCTGTT
CTGCAGCTGTCCTGACTTCTATTACAGGAAGTCCAGGATGAACCCTCACATCTCAAACCCTGAATCCTAT
TGCAAACACATCAGACAAGTCTTGGAGGAGGACAATAGATTGCAAATGCTCTAGCAAAATTTGAATTTTA
TTTATCGAACAAAGATTTTACCATATTAAAAGAGGTGAAATAATGGATAATATAAATAAGACAAAAACAA
GTTTAGCTAAGTTTGAAGAGTTTTTCAGCACTGTATACAAGGACGAAGTCATGGAAGTTTTGGAAAAGTA
TCCTGAGGAAAGGACATTGGTTGTGGACTATGAGAATTTGGAAATGTTTGATCCTGATTTGGCAGACTTG
TTGATTGAAAAGCCTGACGAAGTAATCGCAGCTTCACAGAAAGCAATCAAGAACATTGACCCATTGATGA
AAGATCCAAAGTTGGACATCAAATTCAAAAATGTGTCAAACTGCATTGATTTTGTGAATGCAGACAGCAA
ATACATTGGAAAGTTAATATCTTTTGAAGCCAAAGTCATGGAAGCTAAGGAACCTAAACCAATACTTGAC
ATTGCAGTCTATGAATGTAGGGGTTGCATGAGTTTGCGTGAAATACCTCAAACCATCAATTCAAGTTTAG
AACCATCACTATGTCCAGAATGTGGAGGGAGGTCTTTTAGACTGCTACAAGATGAATCAGAGTTCTTGGA
ATCACAGCTATTGATTGTCTCTTCTGATGACACTTCTAAAAGTTTAAAGGTTCTTCTGCTAAGGGATGAA
TGCTCTTTTGACTTGTATTCCATGGGTCAGGAAGTAAGAATAACTGGCATATTGAAATCTTTTTCTTCTA
ATTATGGATATGAATATTTTTTAGAATGCAATTTAATTGAAATATTAAATGATTCTGAAGATTCTGAATA
TGATGAATATGGCAACAGAAACAGTCCAGAGTATCGAACCTGGCAAAAAGTAGTCATAGATTCAGACAGA
GTATGCCAATGCTGTGGAGGATCTAAGCATTTGGAGGCTCACCATATCTTCAGCTATCAAAATAATCCAA
GTTACAGGGTTAATTTGGAGAACGGCATTGCTTTATGTAAATGGTGCCATAGCAAATACCATAGTTATTA
TGGCAAGGACGCCTCTCCAAAAAGCCTAATTAGATTCTTAAAAAGATTTGGGAGGTATGATGGCTAACAA
GATTAGAGTTAATCTCACGGTTGACCCTAATTTGTGGCAATTAGCAAAAGACAAGTTACCTTGCAGCAGA
AGCGAATTCTTTGAGAATCAGTTGAAGATGTTCTTAGGGATTGAAGATGACGAGTCGGAAATCATTAAGG
ACATCCAAACCAAAGAAAATGAGATTAACGCACTAAGAGACAAGTTATGTCATGTTCGCAAATCAAAGCA
GTTGAAATTGGAATCAAACAAATCTATGGAGAAGGCTATGGCAAGCTTAAACAGAATGCACAAGAAATAT
GGGAAAATCGGAGAGAACCAGATTAGGAACCTCGCCCATGTTCACAAGGTTGACTTTGATGACTTGAAGA
AGGAATGTCAGGACAACTGCATGAACATATTTGAATTTGCAGAAGTTCCTAAGCATGATAGCGTAATGTG
AAAAAAGGTTTATGAGACCCGAATAAGTATTAATACGTATTATAAGTATAAATACGTATTCCATAATTAT
TTGTTTTTTCAAAAAACCTTTATGGAAGTCGAGTAAGTATTGGTACGTATTATAAGTATAAATACGTATC
CTATACTTACTTTATTTTTTTTAAAATTTTTTATTTATTATATTATATTATTATAAATAATTTTTTTTTA
TTTATTTATTTATTTAATTGATGGAGTTGTTTTTGATGACAATTGGAAGTTTGGACAATTTTGGAAAGTC
AGATGGAGAAAACATGAACCCTGAAGATTTCGACTGTTCTGTTTTCTTTGAAATGTACAAGGCACTTTTT
GAGATATTGGATGTTGAAGTTGGCAGCTTCGCTGAACTCTTGGATGTGTACAAGAATGTCGAGATGGATT
ACACCTTGAAGAGACATGCCCTCAAGCAGAAGGAAATCCTTTACTGGTTCAATACCGACTGGAAGGAGGA
ACTTGGAAAGGAAAAGCCGACCGAAAAGGACAAGGAGAAATGGATCAGGCAGAAGATTGGTTATGACTCC
TTCGTGGTCGAGCAGCTAGAAGTCAAGCTCAAGCACATCAGAAGAATGTATGAAACCGCTTTGAAGCATT
CCTTTGAGGCAATAAAATGAATGTGAAAACAGTCATGAATGACCTTATAGGATTGTCAAAGGAGTTCGAG
GGAGTGGAATATGAGATTGAATCCAAAAATTCAATCTACTTCTATTCCTTTCCAAAGTACATGAAGGAAG
GCATTGTGATTCTGAAATATTCCGCAATCTATGACCTGCACACCATATTGAAAGGCATGGATGGAATCAT
AGTGGACATTCTGGAGGTTGAGGACAATCCTGGTGATGAGAAGAAGGATTTGCTATATGTGCAGATTGAG
GTGAAGGAATGATTAGCGACGAATGGGAAGAGGAATACTATGTCAAGGTCAACGAGGAACTGGAGCAGGT
GGAAGTCAGGTTTTTCAGCAAGGTCGACAGGCTCGTCTTTGCTCAATCCTACTCTTCTTCATCTTCCTTT
TCCTTTGAGGAGGCTGAAATCCTGTGCGACAGGATATGCGACATACTGACAAACGATTTGGGAAATGCCA
AGTATTATCTAGGAGGAAAAGATGAATTATAGGGAATGGGTTGCAAGCCAGTTCGAGCTGAGGATGACTG
AGGACGGAAGGGTTTGCTTCAAGACACCATGCAGCTACTACACATTTTCAAAGGAGGACTTTGAGATAAT
AAGGGAGATGTTCCTTAATTTCGAGTCCTGAATACACACCACAAAATCACCATGGAGCTATTTTTTATGT
TTTTATTCGTTTTGATCACCAGCTCCATGAATCATTTTCACACATAAGGAGCATTGCTTATGGATAGAAT
AAAGGAATTGAATGTATGCGGAACCTGCAAGCACAGCCATTTGATTCCAGACATCAACGGAGAGATAGCA
GTGAACATTTGCAGGATAGGTTCAGAGGCTGTCAACAAGGACGGAGGACTTACATATTGCGTAGACTGGA
CACCAAGGAGGAAGCTGTCATGAGGTTCAAGTGTCCGTACTGCGGAAAGGTGAAGGAAGTCAGTGCCTTT
AAAATCTTATTTAAATGGATTTTGCACCATGAGCTTAGGGTTTGGTGCGAAAAGTGCTTCTACAGCACCC
ATTGGCACTTGAAGCTATGGAGGAGAAACTATATCCGGAAGGAAGTCAAGCAAGCCAGACTCGAAAAGAA
GCAATGATAATATGTTAAGTAAAAAAGAAGCCATACAGATGACGCTGGACAATGAGAAGCACTATCCTGT
TAAGTGCAAGTACTGCGGAAAGCCGTTCACCAAGTCTCACAACAGGCAGATGTACTGTTCAGACAGTTGC
AGACGGAATGCCTTGAGGGAACAGAAGGCAAGATACCAGGCTAAAAGGAGGCTAAAAATAAAGCAGAAAG
TGCTGATTGTAGATGAATACAAGAAATACGGTTTGGGTAGCTATGGAACAAGTGCGAACGGACACAGAAA
GAACAATTTTTCACATGAGTACATGGCTATTCAAAAGGAGATGAAAAGAATAGGATTGAAGAGATAATCA
TAATCTTGTTTTCCTTATATTTTCTTCAAAATGTTTATTTGCCAATATAAATGTTTTTTCTTGGTTAAAA
TTAAATATTTTAGTTAATGAAGGTCTATGTACCCTAGCATATGAAGAAATATGTATTATTTCTTTATTGT
CTTTCCTCATCTCCTCATTGAATCTATCATTATGAAATTTAAAAAACATGTTCGGATTTTTTGGGCTACG
GAAATATAATTTTTTGTTTTGTAGGAAGTAATGGATATTTATTTTATAATTATAATTCCCATTTTCTAAT
ATATTTTTTATTTCATCAGATGTTGTTCCATAATTCACTTTATAAATAATATATTTCACAGGTAAACTTG
ATGGAAAAACTTTATATCTCATTAGCCCATCAATGACTTCAACATATTTGCTAGTTTTTTCATCATTAAT
ACTATTTGAGCTTCTTTTCACTTTTTTTTCAGGAATTATAACTCTTAGTTTATTTCCACAATAAATGCAG
AATTTATCATTTTCTTCTACTTTATTTCCACAGTTAGGACAAAATTTAGCCAAATACATTCACCTTCTTA
AATTATAATTAATTTTATCTTTAATTGTTATAAATAAAATACATTTCTAATTTTCCACTATGTTTGTTGA
AGAGGAACGAAGGAAAGACTGGAAAGCAATTCTCCCAAACAAACATAGCGGAAAATGATTCCATTTTTTG
CTATTTTTACAAATTGTTTTACATCATTTTTTCTGGTTTTTTCGTTTAGGTTGTTTCTTTTTTCCGGATT
TCAAAGGTAAAATCAAATCCATCATCTCGTTCGGTTATGGTTATGGAACGTTTTCTTTGCCAATTTAGGA
GATTGCTTTGCATATTCCTTCCTTCTCTTCAAGGGTTCGTGTTTGTCTGGGGACACGGCAGTTTTCATCA
CCCCTTTTTCCTGCCGTGCCCTTGGAAAACTCTGTTTGTTTAATATATTTCCTAGTTTGAAAAAATGTAG
AAGGTACATGACGTATCTTCTACTTTTTTTTTAGAAGATTTTCGAGAAGTGATTATGATGATTTATGATA
AAGCGACAGTTACAAGCCTCATAGTGGCTATCCTATTGCCATTGATGAGCATGTTAGGAATCGGAGAATT
GACTCAGAACTACATATTGGCAATAGTGAGCGGTATGATAGCCCTTGTGGTTTGGTACTACAACGAGAAG
CACAACAGCGATTTGGTGAGCGGAACCACCAAGTGCGACTGCGAGCTTTGCTATGGGGGAGACGATGAAG
CACTTATATGAGATAATCCCTTACAGGAGGACTGTTTGGATTACAGGGTTCCTGAAGACAACAGTCTCCT
CGGCAATGATAACCACTGGCGTAGTGATATTGTTCAACAGCATAACCGAGCACCCTTACTTCATGGAGTG
GGACGAGATAGGAATCGTTCTTGGAATCGTTTCCATCACCATCGCCTGCATTTACATAGCGATGATAGAC
AGATGGAAGGAACGCAGGAAGAAGGAGGAGCTTGACACGATAGAGGACTACATAAACAGGAAGGCTGAGG
AGATAGCGAACATGAAGGTATTGAGGAAACTTGAGGAATTGGAAGAGGAATGACTATGATAGAAATCAGC
ACCATAAAGATCACCGACATAAAGCCTGCCGAATACAATCCGAGGATAATGAGCCAGCTTGAACACACAA
AGCTCAGGAACTCCATGGAGACATTCGGAGTGGTTGACCCAATAATAATCAACCTGAAGAACAACCACAT
CATAGGAGGGCACCAAAGGTACGAGGTCCTTCTGGACAAGTCCATGGAGGACAACGAGTTCATAAAGGAG
CTCCACCTCATCAGGCTTGGAGATGTAGGCTGGGCATTCCCTGAGTCAGACCTCGAGGTCGAGGACGATG
ACCATGAGAAAGCCTTGAACCTGGCTCTCAACAACATCGAGGGTGAGTGGGACCTGCCAAAGCTGGAACC
CATATTGACAGATTTAAAGGATGTAGGATTCGACATTGAACTTACAGGATTCAGCGACATCGAGCTTACC
GAGCTCAATCTGGAGAACAACCTTGTCTTTGCGGAGGAGTTCGAGCCTGACGAGAGCGAGGAGGATGTCG
ACTTGGAGGACATTTACGATGAGCCTGTAAAGGAAATGCTCCAATGCCCTGCATGCGACCATGTTGATGT
TGTGAAAAGGTTCAAGAGAGTCGATTCACAAGGAGATTAGGAATGAAGATCTACTTGGCGGCAGCGGACA
CCATGAGCGAGGACATCATAAGGCTCCTGCCGGTTGCCAAAAGGCTTCACTGGAACCTGTTCAGCTACTA
CTATCTCCTGACCCTTAAGAAGATGGAGGACTATGACATCATAAGGAAGGCTTCAAAAAAGCGTCCTTAT
AGACAGCGGAGCGCACAGCTTCCAGAAGGGTAAGAAGGTTGACTGGGACAGGTTCACCAAGCAGTACGCC
GACTTCATACAGGACACGGACAACGAGAAGGTCCATGGATACTTCGAGATGGACGTCGACAACCTGCTGG
GATATGACAAGGTACTGGAATTGAGGTCTTTATTGGAGGAGGTCACGGACAAGGTGATACCCGTATGGCA
CAAGAACCGCGGAATCAAGGACTTCAAGCAGATGTGCCAGGACTACAATTTCGTCAGCATAAGCGGCTGG
AGAAACGAGGACGTCAAGGATGACCAGTTCATCCATTTCGTCAGGCATGCACACAGGAACGGCTGCAGGA
TTCACGGATTGGGATTGACACGGAGAAAGGTTCTCGACAGGGTTCCCTTCGACAGCGTCGACAGCAGCAG
CTGGCTCCAGACCATATTGTATGCAAGGCTTGGGCAGAAGCAGTTGGATTCCAAGTTCGCAACCGAAAGG
AGAGGCGATCTGGCGGTGCTGTCCTACATCAAGTGGATGAAGACACAAGAAGAGTACTACAAGAAATGGA
GACATTATCATGATTAATGAAAGGATAAGACCTTATTTGAATTTTAGCTTCAATGACAAGAAAGTCATTT
TCGTCACATTGTTCGTTGTGAGCAATCTGATAAGCAACCTGTTAGCCATCAAGGTTTTCAACTTGGGATT
TTGGGGATTGACAACCGATTGCGGAAATCTCCTGTTCCCGTTAGGATACCTTATGGCAGACGTGATTACA
GAAGTCTATGGAGAGAGGACAGCTCGAAGGGTCATATTGCTTGGGCTCTTTGCAAACATATTGCTGATTG
TGGCTACCACATTGACTGTCTACATGCCGTATCCAAGCTATTGGACAGGACAGGGAGCGTATGCCTACAT
GTTCGGATTCACTCCTAGAATCGTGCTTGCAGGGTTCATAGCATACTTGGTGGGACAGTTCGTGAATGCG
AGACTTATGGTGCTCATCAAGAAATGGACCAACAGCAAGTACCTGTTCATGAGGACAATCGGATCTACAC
TTGGAGGGGAGCTTTGTGATAGTTGCATATGCAGCAGCATTGCTTATTACGGTATTGTGCCTAACTCTGG
CATATTGCTATTTATTCTTATGCAGTATGTTGTTAAGGTTACTTGGGAAGTGGTGATGCAGCCTCTGACA
TACAAGTCAATCGCTTGGGCTAGAAAAGACGGATAGGTGATGGCAATGCCCGAACCTTGGGAAAGGCAAA
GGGACGAGAACGGAAAGCTTGAGCCAATAAAGGCATTCGAGTACTTCACCGAGTACCTGACAATGGACAA
GCCACGAAGCATGAGGGTTCTGTGCGAGAGGCTCGGCAAGAAAGATGGGTATATTAGGCAACTTCATGCC
TACTCATCCACATGGAACTGGGTCGAAAGGGCAGAGGCATACGATGAACACATAATATTGAAGAAACGGT
TAAGGAAAGAGAAGTTTTACGATGAACTTGTCGAATCCGAGCTTCCCAATTTAAGGAAACGGCTCGAATA
CTACAACAAGAATATGAATGACATCGAAACCGACATGACAACCAAGCCCACAAGCAAGGCTCATGCCTAT
GACAAGAACAGCAAGGCGCACAGCACAACCCTGAATGAAATATTGCTGATGATCGGCAAGCCTACCGAAA
TCAAGGAAACCAGCCTTGAAGCAGACATTGAAAGCGACAACAAGATTGATTTGGAGAACAGGGTCGAGGT
AGACATTACAAGCGACGAGTTCATGGAAAGCGAATTGGAATACATGAGAAAGATGATTGAAGAAAAGTGA
AGTATGATGTATGACAGCTGCAAGCAGGGTGAATGCTCACGGAACAATGGGTCTTGGAAGATGGAGCATT
TACATAAACAACGGATTCTGGAAGCCTAGGGACTTTGATGTCCTGATAATAGAGCTTCTGCAATATGCAA
TTCAGGGACGGGTGAGCGGCATATTGCTGGGAGTTCCCTCAAGGCACGGAAAGTCCACACTTATCAGTAA
GAACTTTTGCAGCTATTTTTTATCATATTTCCCTAATGAGCAGGTCATCCTTTCAAGCTATTCGCAAGGA
TTGGCAAGTGAGTTCGGAGGACAGGTGAAGGACATTGTCAATCATTACGGCTACCTTTCACCGTACAAGC
CGACCATCAGGTCTGATAGTAAGGCTAAAAACAAGTTCAAGCTCAATGAGCCTTATCGTGGACAGATGTT
GAGTGCAGGTGCTGGCGGTTCAATCATGGGATACGGTGCAGGTCTCCTTATTGTCGATGACCCTATCAAG
AACGTCGCTGAAGCCGAATCCAAGGTACGTCAGGCAAAGCTCAAGGACTGGTGGGGAGGAACCATCAAGT
CAAGGGTCCAGAGGAGAAGCAACGGACTTCCTCCTATCAAGATTGTCATTGCACAAAGACTTCATTTAAA
GGATTTGCATGGAATCATAAAGGAGACAGAGCCGACAATACCTGCAAATGACGCATTCAGGATTTTAAGG
AACGGAGGCTCAATCGACCCTAACACATGGGTTGACTTCAACCTTCCTGCAATCTGCGACAGCGAGGACG
ATATTCTTGGAAGAAAGATAGGTGAAGTGCTTTGGGAAGAGCAGAGAGACTATGAATGGCTCATGGCTGA
AAAGAGAAGCATGGGCTCATATCTCTTTAATAGTATCTATCAAGGACAGCCTGTAGAGCGTGATGGTGAG
ATATTTAAAAGAGAATGGTTTCAGGATGAGGTCAATCACAAGCTCACATGCCTCATTGACCCTAAGGACA
TTCCGAAGGACTTGCCTCAGCTCAGATATTGGGATTTCGGTGCAAGCGGAGACGCTGGTGACGGAACCTC
TGCAATCTTGACTAGCTATGATGGAGAATATCTGTATGTTCTGGATCTTGTTGCAGGAAAGTTTTCAAGT
CTTAAAGTATTGAAAACATTTAAGAGACTTTGTAAAAAGGACGGAAAACAAACTCGTGTAATGGTCGAGC
AGGAGCCTGGAAGTGGCTCAAAACTATTGATTAAGAAGTTTAGGAGAGAAGAGGATTTAAGAGGATACAA
TATTCGTGCAGATAAGGTTCAGGTCAGTAAAAAAGTCAGGGCTTTTGACCTTGAAGGTCTTGCAGAGGAC
AGGAGAATCAAGATGGTTCCAGCCCATTGGAACAATAAGTTGATTGACCAGTTGGTGGCATTTACAGGTG
AAGATGGTGGAGAGGATGATATAGTGGATACTATTACTGGCTCTTGCAGGTTCTGGACAAGACCTAGAAG
AAGAGTTAAAGCGTGATATTAAAATTTCCATGGTTTATTAGCATTTGGATGATATGAGTCGCTCCGCTCT
TTTTTTCTTCTTATTATTTCTTCTGATTTTCTTCTCAATTCAGTTTTCTTTTTTTCACTTTCTATTTCAT
TCATTAATTCTTCTTTGTTTCTTATTTCATCATTATTGATTTTTAATTCTAATTTCCATTGTGATGTATT
ATCTAAGGCATGCGCTTCATTAACAATTTTCTTATATTCTATTATTCTTTCTTCTTTTTGTATTTCTTTT
TTTAATTTTTCTTTAGTTATTACTTCAATATCCTCATCTATTTTCGATAATAATTTTCTTTGTGAGGTAT
CATTTAAGTCACTATCATTAACAATTCTCCTCAATTCAGTTTTCTTTTTTTCACTTTCTATTTCATTCAT
TAATTCTTCTTTGTTTCTTATTTCATCATTATTGATTTTTAATTCTAATTTCCATTGTGATGTATTATCT
AAGGCATGCGCTTCATTAACAATTTTCTTATATTCCGTTCTTCTTTCTATGCCTTTCTTTTTTTCTTCAG
TCATTTCTTTTATTAATTCCTCTTTAGTTGTTATTTCGTTACTTCCTATTTTTGATACTAATTTTTGTAT
TGTGACATAGTCTAATTTAAAATCTCTGTTATTATCATAAATAATATTTATAAATTCTATTCTTCTTATT
TCTTTTATTAATTCTTCTTTAGTTGTTATTTCGTTATGTCTTATTTTGGATTCTAATTCCCATTTTAAGT
CCCAATTTAAGTCACTATCATAAACAATTCTCCTCAATTCAGTTTTCTTTTTTTCTTCAATTATTTCTTC
ATTTAATTCTTCTTTGCTTCTTATTTTATTATTATCGATTTTTAATTTTAATTTCTTTACTGATGTAAAA
TCTAAGCCATATTCTCTCCTAACAATTCTCACATATTCTTTTAGCCTTCCTTTATTTTCATTTTCTTTTA
TTAATTCTTTTTCTTCTATGTTCTTTCTAAAACCATTTTTCTTTTTTTCACTTTCTATTTCATTCATTAA
TTCTTCTAGGCTCTTTATTTCAAAATTATTTACTTTGGATATTAATTTATAACATATGCTGTCGTATTTA
AAATATTTGCAATTATCATAAATAATACTTATAAATTCTCTTCTTCTTTTTATCTGCTTTTCATTTTCCT
CAATATATATCTTTATTTCGTCAGTATTAGTTATTTTTCCATTTTCTATTTTTTTAATTAAATCATGATT
TTTAAAAATAGGGATTATTAGTCCTGTTTGATATGCATAGTGTTTTAACCTTTCAATTCTCATCATTTCT
TGTTTCTTACTCATACAATCACGCTCTTTACCAATTAATCTTTAATCTATTTTTAGTTTGCTATAAATCT
TGCCCTATTTTTCCACCATGAATATTGAATATACTTTTTTTAGGAGGAATAATTATTGAGTAAGAATGCT
AAAGCAGACGCCTTTGTTGTGACCACTGAAGACGGATCCTATGACATTGTCGATGCAGATGTCTTGGAGA
GGTATGCAATAAAGAGCGAATCTGACGAGACAGGAAGCAAGCAGTTGAAGACTGATGGTTGGGAATATGA
TGATACATTGCTTGAGCCGTTGTATGACCCATTGCAGTTGTGTGAGCTATTGGAGATAAACACATATCAT
GAGAACTGTGTCGATGTTGTTGCAAGGGACAGTGCAGGAATAGGATATGACATAGTTCCAGTTACTGGAG
AGAAAGAAAAGGAACTTAACAAGCCAAAATTGACCAATTTTCTAGAAAACATCGAGCCTAATATCAATGA
ATTGCTGTACCAAATGAACTATGACAGAAGGGCTACTGGCTACGGAGCCTTGGAATTAATCAGAAAAGAT
AAATCGAAATCAGAGCCTGTTAACCTATCCCATATATCTTCTTACACTTTAAGAAGGACAAGTGATGGGA
AAAGAGTAAAGCAGAGAGTGGGAACAAAGACAGTATGGTTTGTAATCTATGGAAAGAACTATGACAAGGA
AGGCAATCTGTGCGATGTACACTCTGAGACAGGAGAGTTCCACCCTTACAATTCCTTAAGCAAGGAAGAA
AGGGCAAACGAGCTGTTGTGGACTATGGAATACACCACAAAAAGCAAGTACTACGGATTGCCTAAGATAG
TGGGTGCAATTCCAGCCATTTATAGCGACATAAGCCGTTCCAAGTACAATACCAGCTTCTTCAAGAACTA
CGGAATGCCATCATTCGCAGTCTTGGTAAGTGGAGACTTCGTGGACTATGGCCAGGAGGAGTTCCTTGAG
GACGGAACAAAGAATCCTGAATATGACGTTACAAAGACTCTGAAGTGGAAGATTTCACAGCAATTGAAGC
AGGCAATAAAGAACCCTCACAGTGCAGTAACAATCCTTGTCCCATCTGAGGGAGAGGAAGGTAATGTGGA
GATTGAACTGAAGCCGCTGAGTGTCGAGACCAAGGAGGCGAGCTTCAGACTCTTCAGGCAGGATAACAGG
GATGAAGTAATCCATGCACACAGGGTTCCTCCATACAAGGTCGGAATAAACGAGACAGGCAGTTTGGGTG
GAAGCAATATAGAGGGAGCCACCATAAACTACAAGAACGATGTGGTGCTACCAATCAGATTCAACGATGA
GTTTCTAATTAACCAAGTGATAAAGAATGACTTTAAGATAAAGGACTGGAGATTCAAGATAACGGAACAT
GACACAAGGGACTACACCACAGACATTGCAATAATCAAGGAACTGTTCCTTATGGCTTCAATCACTCCAA
GGCAGATCATCGAGAACATTGGCGAAAGGTTCGGTCTGACAGCTTCAGACAATCCTTTTTTAGATGAATA
CTACTTGAACAATGTTCCTTTGGAGAATGTATGGAATGGCGGTGATGTGCCGATGGAAGCGGAGACAGTT
CTTGACAGCTTGGAGAATGACTTGATGAAGGACGCAGGTGTTATGGATGAACAGCTTAGAGAGAAGAGAC
AGACTCGTGATGATGGCGCTCAAGGTGCGTCATTCAAAGAGGCAGATTCAGAATATCAAGAGAGAATACA
GAAGGCGTTTGATACTCGAAGAGCAGTGCAGTAGGGAGATTGCGGACTTCTTCAGAAGGCTTGAGAGGAA
AATCCACAAGGTCATGGATGAGCACTGGGAAAGCGAATTGGGTCTTTTCCATCTGAACAAGGTTTCAGAC
ATCATACAGGACAGCAGGCAGGAGTACTATGACATCCTGTTCAAGTACTGCAAGGACTCCTACATGAAGG
GAAGGGAAGCTACCGAAAGGAGATTCAACAGAAAACTGGAAAACATTAGCATGAAGGCAGATGTCAACAT
CACAAGACTTGAGGACCTGTTCAAGCCCGACCCTACTATAAGGTACAATCTCAACAATAAGGTCTTTCAG
GCTTCAGCCCATACAATGGACAGGGTCGACAATAGGATAATGGAGAACATAACCCAAAGCTATGATGACG
GATTAGGCATTGATGAGGCTAAGGACAGGCTGACCGTCGAGTACAATGGATTGAAGTCTTGGGAGGCACA
GAGGATTGCAAGGACCGAAATCAATTCAGCCCAGAATGACGGTGCCTTTGACGTCTATGGAGAGCTTGGA
GTTGAGTACCATCAGTGGTGGACTGCCCAGGACGAAAGAGTCAGGGAGACACCGCAGGCAGACCACAGGG
AACTTCACGGCAAGATAGTGAAGGTGGGCAACTCGTTCAGCAACGGGCTTCAGTATCCTGGAGACAGGAC
AGGCAGGATAGTTCACTGGATAAACTGCCGTTGCACAACCCTTCCGTTCCTCATGCCTCTCGGAAAGATG
GCTCCTCCAGGAATGATTGAGTTCACCGAAGAGGACCTGATTGACATTCCTAACTTCGAGATGCCTACAA
TAGATGACCTGATGAGGAGATACGAAGCTGTTGAACCCAAATCCCAGTGGATACTTGATGACTTTGAGGA
TTTGATCAACCTCAATGAAGATGAGGAAAGAAGGCTTGCTGAAATACAGGAAATCTTTAAGAGGAATGCT
AGAGACAATGTTCCTCCATCATATATTGTCCAAAGGCAGTATGACGAATTCATGCTTAGAAAGAACTTTG
CAGAGAATCTTAGAATGCTTAAAAGAGGACAGAATCCGTTCCTCAACGAGTCTGAAAAGCAGATGTTCAT
AAAGGATTACAGCAGGTTCCTAAAGCAGTACGAAAACGAGATAAGAATGAACAAGGAACTTCAGAAAATG
TATCCGAAGGAGTTTTCAAAGGTTGCAAAGGATGTCGACCTGCAATTCTACAGGGAGAACTACAACAATC
AGTTCAGCATTTACCATCCTGATGACATCAGGTCATTTGAAGTAACCTCCAAAACCTTGACTTCTGAGGA
GAGGGCTAGGCTGAAGGAAATCGAGAAGCTCTATCCTAAGGAATCCAAGAGAATCGCAAAGGAAATGGAC
TTGAAGTATTATGAGAAAAGACATCCTGAAAGATTTGGCAGGTTCATGGAGGAAGAGGAAAGGAAGAGGC
TGGCAAAAATTGAGAGGATGTATCCTAAGGAAACCTCCAAGATGGCAAATGAATTTGCTCCTAGAGATGT
CAGCAGGCTGAGAACCAAGGAGGACATTGACCTGTACGAGAAAAACTTCATCATGAACAAGTCATACAGG
AAGAAAGCCGATGAGATTGTGAACGGCAATGGCATGACAATAACAAGAAATGTGAAGTATGACCTGAAGG
GAAGATACGAGGACTACATCAACATAACTGACGATACGTTCGATGTTTTGAGGTTCAAGGACTACAATTG
CGAAATCTGGATCAGCAGCAAAAGCGAAGTGTCCACAGTCGAAATCATGCAAACTCTTGACAAGATTCCT
AGAAAGCTCATGAACCAAAACCACAACAGAATAATATTCTCTGCTGACAGGGATGTCTATAATCTCAAGA
AGAACCATTTCGTCGGAGGAGTTACAAAGAGAAAGGACAATGAAATTGTGATCTTCAAATGCAAGGAAGG
AATCCTTTCACAAACCAAAACCCTTGCTCATGAACTTGGACATGCTTGGGACAACAATCTGAGCAAGATT
GCCAATAGAGGAGGAGCCTACTATAAGGTTGCCGAAGAGGAAGGAGGATTTGTAACCTCATATGCAAGAA
AGGGCTTTGAAGTCTTCAAGACCCATTACAGCGAAGACTTTGCGGAAGCAATGGAACTGTATGTAACAAG
CCCTGAAAAACTGAGGAGAAAATTCCCAAAAAGATATGAGTTCATAAAGAACATGATGGAAGACGATTTG
TTCGTTTTGGGGCTCATCCCTTATTGAAAATGGATTTATATCCTATGAAAAACAAAAACATGATTAATTG
CTTTAAGATATTGGAGGTGCCGATATGATAATTGAAATTCCTGGAAATGACAGGACAGAAGAAATAAATT
TGCCGAACGGACAGTTTGTACTGATAACCTACTTGCAGGAAAATGACATGATGTCATTGCCTGACGGGAA
GTATGTCTGCCCATTCAGAATGATTCAGCTTTTCACTGAAGAGGGCGGTGAACTGATTGGAGAGTGCATT
GAGGAAAATCCTCACTACAACACTCGCTTCTACAATACTGTCTTTGAGCATTTGGATGAAGGAATTGAGT
ACAGATAATCTCACAATTCCTTTCCCTTTTCTATTTTTTTTAAAATATTCTCTTTTTTTACAACATTTTT
CCCTGCTTTTTTTTCAAATTTCAAAACCATTTAAAAATTCAGCCTTTTTTTCCAAAATTCCTCACTTTTT
CATGATTTCATGCTTTTTTTCCACCATGTCTAGTGAAAATAAGGAATTTTAAAAACCGTTCAAAAACCCC
TTCAGAGACCAATGAGAAGCCCTTGATTCCTCTTCAATCGGTTGAATTGTCGAGAGCTGAGTAATACTTT
TTAATTACGGTTTCCCAAAAAAGTATTACTGTTTTTCACATTCTCCGTCGGTTAAATCCGTTGTTCTTTA
TTCAGACTTGGGCTATATCAGGTTTTTTCATATAGCTTAATGATCCAACCATCTTTCCATACCAAGACCA
CTGACGAACCGGTCAGATTGTATTATTTTGACCACCAAAAATAATACTTTTTTCACCAAAAAAGACCGGA
ATCTCATTGGTTAGAACAGAATTGAGTTACCTTACAAGTGTAAAACTGAGCGTGGTTGCTCCAACCTTCC
TCAAACCTGTATATTTGAATTTATTCTCTTAACAGAGCGTTAATCTTTCTTATTTTCTCCAAAACATTTA
TATCTAAACGAATAATATAGTTTTTATTGTGTTTCCGTCCGTTTAGGAGAGAAAGAAGGAAGCACAGAGA
GGCGATTTCATGTTAAGAGTCGTAGAGAGAACCTATTATCAACAAGAAGAAATCAAGACACTAGACTGTC
GAATTAGAGAGGCAGGAGTCAACACTTACTCCCTTGCTCGTCAAGGAGCAGTTGACTATCCTACCTACGA
ATCCTACAACGAGGTGAGAGAGGAAAGGATAAAAGAGGCTAAGGAAAAATACGGTGAATCCTACTACTAT
CACTGGAGAGACGTTGAGACCTACTTCTATTACTTAGGAAGATTCTTTAGTGATTTGGAGGAAATCGAGA
AGTACTTAGAAAGGACTGTTACCTATAAGCCTCACAGAGAAGAACTTAAAGAAGCAATGGAAAGGTTAGA
CAAAAGATTCGAGGAAGTCATCAACGAGTTCTGGTATTCTCTTGAGGAATACGAGGATATAACCGAGGAT
GTACTTGAGCAGTTGAAAGAAGGTGATTGCACCGTTCATTGCGAATTCCTTATAAAAGAGTTTAAGAAAT
TCGTCAATGTCATATGCAGAATCATAAAACAAAACGAGATTAACCATAAGGAGTTTTAATCTCCTTTCTC
GTTACTTTTGAGGTGAGAATATGGACGCGATAAACGTTATCAACCAAAACAAGATATTAGTAGATGTTTT
GTACCGTGGGACTGTAAACCTGATTGACATCGTCATCGGTGATGCATTGGTCTATGACAATCCGACAGTT
GTAGTCAAGTGCTACACCACAGATTTGGCTTTTGCAACCACAGAGATTGATGAGATTGTATTAGAGAACG
AAGAATTTGAGTTATTAATAACTTACGAGGACGGAGAGTTCTCAATTTTGTTGAAGTCCCACAATCTTGG
GGAATTAGGATACATTGAATGGGTAATTTAGGTGGTTTTCGTATGGTTTTTGTCGATTTGTGCGAGAACG
AAATAGCAGACATGGTCGAGAGCTTCTATCGCAATGGAGACGGTAGCAGCAGGATATTGACCAACAGAGC
AGTTGGAGAGATAGTGGAGCACTACTGTTCCTTTGAAGTAGACGGTAGAATCACCACTAATCTCCGAGAT
TTCCTATTATATAGTGTTGTCTTATATGACACCATTGGAGAGGCTGTCGATGACGGAGTCAACCTTGAGG
AAGTGTTCATCATAGAAGACAGGAACTGCTACACAGGGAAGTCTCAAGTCATATTGATTGGAGGGTGAGA
AAAGTGGTGAATTGGTTGAAGGCTATTGGAGATAACTTCTCAGTGGATTATCTCCTTTTAGCATTATTCT
CTAGTGGAGATTTGATATTGGTTGCCATCGTTCTCAATTCTTATGGTGTCATCTCACCTGAGAATGTAAG
GGAACTGGTGATTGACTATATAAGTTACAGGAAAGTTGATATTTTTTGGAGACATCTAAGGAGACCTAGA
ATGAGTTTTGAAGATTATGTCTTAGACAATTTTGAAGAGATGGAAACTGGTGAACTCACCAGAGAGCAGG
TTGTTGAATTTGTCTCTCGACAAGAGAGGAAAGGACTCACCTTCTGCAATGAGATCTTCATTGCTGTGCC
TTTGAAGAAGGGGAGCAAGGACGATATCGTTGAGATATTGTGGAATGAGTATTTTGTGGAGGACTATAAG
GAGAACTGGTTAGAGCAACACGAGAATCTTGGTTGGAATGACTGGAAGAAACTTTTGAAGAAAGAGATAG
TTGAGAATGGTGGCGATGACTTCCAAATCTTTAGGAATCACCTGATTGACTGTGTCTTAATGGAGTATTG
AACGAGATTTTAAAGGAGACGTGATAGAATGACAATGAAAGTTACTTTTGAAGATGAGAACGGTGAGAGA
ACAGTCGAGTTCGGCGATGACGTCGATTTCGTTTTAATCGAAAGCGATGATGACGGAAACATTGAGATTC
GCGAAGGAGACTGGGAATTGGACGGAGATTCCGACGATGATTGGGAAGAGTACGATGACTGGGACGAGGA
GGAGTTCTGAGTGGACGAATTCGTTGAGACCCTGTTCGACACCTACTGGAAGGTGAATGAGAACGGAGAG
TACATGAGCCTTACCGATTGCGGTGATTTCTACATCGCAAAGGTTGCTCCCTGTGTTCGCAACTGGAGCA
TAGTGATAGAATGCAATTGCTTCTGTTTTCATTGCAAGGAATTTGTCTACCATGAGAACGGAGCAATACT
TGAGATAGGTATGGAGATTAGCTCTCTTTACCTAAGCCAAATGGAGATAAAAGATTTGAAGATATACATG
ATAGATTGTTAGAACGGTGATGATATGGGATTAGACATGTTTTTGGAAGGAATATTTGAACAAGACGGAG
AGAATGTAAGAGAACAGGTGATTTACTGGAGAAAGTCCAATCAGGTACACAACTGGTTCGTAGTCAACGC
TCAGGACGGAGAGGACAACTGCCAACCACACTCAGTAAGCAGAGAACAGTTAGAGGAACTAAGAGACCTA
TGCAGAGCAGTGCTCGCAGACAATGACAAGGCAGAGGAACTTCTCCCAACAAGACCTGGTTTCTTCTTTG
GTGCGATAGACTATGACGAATGGTACTACTACGATTTGCAGTACACCGTCGAGAAAATAGACGAAGTGCT
TAAAGACGACAGATACCTGTACTTTGAGTATTGCAGTTGGTGGTAGAAGGTGAGAATATGGAATGCCCTT
GCGATAATTGTGAGATGTTAAGAGAGAACGAACCAATCAAGGTGATTGACTGGAAGTCCAATTCTCCATT
TGGAATGGATTTGTATCACTTTGAGGACGGCTTCAGATGTTGCTATAATGGTGAGGAAAGCTTGAGAAAA
GAGGATCTAAGCAATCATGGTTGCAGATTAAGAGGAGGAATTTAGATGGAACTGATGACTAGGGAAATGG
AAGGGAAACTCAAATCCTTCCCTTTCTATTCCCAAGACGGAAAAGGAGATGACGCGATAGTGGTGATGAA
GTTCTTCAACCCTTACGGATTGGGAACTTGGTATGTATTGGAGGCAGAGAAACAGGAGAATGGTGATTAC
CTTTTCTTCGGATATGTTGAATCACCGATAACACCTGAATTCAACGAGTACGGTTACTTCTCATTGTCTG
AGTTGGAGAACCTTAAGATACCAATAAAAATCAATGGAATAACCGTGTCCTACGGTAGGATTGAAAGGGA
TTTGTACTTTGAAAGGGTGAGAATTGGAGACATAATAGGAAATTAGAGAGGAAGTGTTGAGAATGTTCGG
ACAGAAGAAAGAATTTGTCAAAAAGATGTATCATGTCGGAGACGTTGTCGAACTGGTTCATATGGACGAT
GCACAGGCTCCACCTAGTGGAACCAGAGGAGAAATACTCTTCGTAGACGATATTGGTCAAATCCATGTGA
GATGGGAGAACGGCTCAGGTCTGGCACTAATATATGGTGAGGACAGGTTCAAAGTTGTAGAGAGGAAAGG
AGAATAGGAGAGATTTGATGGATTTGTTGTATCTTTATGATGACCTGACTGCAAGGAGAGAAGTCTACGA
TTCAGTCGGATTGAGTTTTGTGGTCAAGTATAAATTCTCATCTCGTAAGGAAGCACAGGATTTCGCATTG
AAGTACGGTGCAGAACTGATTGAGGAATGATTGAACGGAGGAGATTAGGAATGAAGTACGATATTTTTAC
TATCTTGGATGAAATTTCAAGGAAGTTAGATGACGGTGAATTATCCGATGAGCAGGTTGATTTCCTGTTG
CAGATGGAGATTCTAGTAGAGGAAGGCACTATCACAGACGAGCAGGCACAAGATGTCATGAATGGAGATT
ATTAACTATCTCCATTTTCATTCCGGTGAGATATTAGGAGAGATTTAGATGATGAAATTAAGTTTGAAGG
AACTCGGTGAGGAAATTGAGATGATACTTGCAGAAGGTGGATTAACCTTTGATCAAGTCGATTATCTGTT
GTACTTGGAGACCTGCATTGCAGACGGAAGCATAACAGAGGAGCAGAAGAGAGAAATTATCTGTAGGGAC
TTCTAACAGTCTCTACCATTTTATCTTATTGTTTTGGTGAGAGAACAGGAGAGATTGATTATGTATTTGG
AAATTGACGAGGTCAAGTGCGAAAACATTGACAGAATTGAGTTTGACGATGTCGCAATGGAAATCGTCCT
GACAGACGAAAAGGTGTACGAGAGAATAAAGAGATGGCTCAAGTCCAATGAGATTGACTACGATTGCAGG
GAAGACCGGTATTTCGCCAATCTCATAGAATATGTCATTAGGATAACTTGGTGGTAACCGTGAGAGATGT
CGGATTCACCATTGAGGAACGGTTCTTCCTTACTGCTCAGGAATTGGAGTATTCCGAAGTGGGAGAGGAA
CACGAGAGCGTCATTGACAGAGCCATCGCATTGCTGTACACGAAGCTCAGAACCAGAGACTTCGAGTTCA
CCGACGAAGAACGGGAACTCTTGGAGGATGCTTTTGTCATTGTCAGCGACCAATAGAGCACAGGTGTTTT
TAGAGGGACTTTACGAAGTTCCTCTTTTTTTATGAATCACTATCTATGTATTTGGGTATAAATCGGAAAT
TCGTAAGGTCGACATGAGATATAAGACACCTGTTGTGAGATTCAACAGGTTATAATCATAACCATATGAA
TCTCATGGCATTCCTTTAAGGATTCACCCACGAAATCAGGGTTCCGTCTCGTGTGAGAACACAGGTTTAT
GAAGAATATTGAGATGCCATTCATTCAGGGAGTCAAGGGGTGAGATAGTGGACTCTCTGAAAAAGTCATG
TCTCGTGTGACGTTTGAAATAAAAATTAACGGAAATGGTCTAAATTGGTAAATTATCGGTAGTAAATGGG
TAATTTAGACCAAAGGAGTTAAAAAACCTTCAGAAGACCTGTGCTCAATGGAGCGATTGGGTATCTGAAA
AAGGAGTTGGTAAGAAAAGGTCATAGATGGGTGGAACGACGGTCGATGAGGAATCGTGTCATAGGGTACT
GCAACCGTAGACTGCTCCATGAAAAATTTCTGAAATTTTGACGGTGAAAATTGGGTAGGTGGCATTACAA
GTGAAAAAGTCTGTGCAGTCGCTTTCATTGAACGATGGCAAAAATCACTCACCGACTCTCTGAATGTGAT
TTTACACTTGTAATGGTGGTATTTCAAAAAGTATTACTCAGTAATACTTTTTTCCCAAAAAAGAACCAAA
AATACCAATAAAATAAGGTAAAGAAGGGTTCTGCATTAAGCTATCTGAAGGAAACCGTTCAGAGAAAAGT
GAGATTTCGTTCTCTCCTGTTCTCGCTGGTGATCTGTTGTCGAGAGAAAAACGGTTGTCCTTTTGTTTAG
GGTGTAATCAAGGCACCATAGAGCGTTGAAAAAATTTTCAGTTTTTGAGATTTTGAACTGAAATTTTTCC
CAAATCACTCAGTAGGAACTCAGTAAGCACTCAGTAGTTAGAGTGAATTTTTAAAAAATTTGATTTCTCA
AAACTTCAAGTAATAAATTATTAATCATCTAATCCGTAATGCCACCGAGGAGTTATCCAATGTTTTGGCA
CCTTCTTATCATAGTAATATTCTTCCCATTCTTCCAAAGTCCTAAATTTATGTATTCTTCTATTTTTCTT
CTTTAGAGAGTCACGAACTAATCTCAAATTTGGATCAATTTTATCAAGATTAACTAAAACAGTCTCATCA
GTAATCTCATTAATAGACATAATACGTACATCAGAATCAAAAGCATTTTTAACAATATCCTTTAGAATAT
ACGCGTCGCTAATTTTCTTTACAGCTTCAAGACGAACAAAATAATCAGAATCATTTTTAGCAACACTTAT
TAAAACAGATTCATCAGTAATCTTCTTAATAGTTTCACGTCGAATAGTGGAATTAATATCATTCTTAGCA
ATATCCTCTAAAACAGACTTATCATTAATCTTCTTTACAGCTTCAAGACGAACAAAATAATCAGAATCAT
TTTTAGCAACACTTATTAAAACAGATTCATCGCTAATTTTCCTTACAGCTTCAAGACGGACAGACGGATT
ATTATCCTTTTTAGCAATATTAGCTAAAACAGACTTATCATTTATCTTCCTTACAGCTTCAATACGAACT
ATCCAACTAGGGTCATTTTTAAGAACATAAGCTAAAACAGATGAGTCATTTATCTTCCTTACAGCTTCAC
GACGAACTTTAGAATCGGAAGCATTTTTAGCAAAATCGATTATAACAGTCTTATCATTTATCTTCCTTAC
AGCTTCAATACGCACATCCTCATCATTATTATTTTTTGCAAGTTTGATTATAATAGTCTCATCATTAATC
TTCTTAATAGCTTCAATACGAACTTTAGAATCGGAAGCATTTTTAGATATATTCTCTAAAACAGATTCAT
CATTAATATTCCTTACAGCTTCAAGACGGACATTCTCATCATTATTATTTTTAGCAATATCTTCTAAAAC
AGATGAGTCATTTATCTTCCTTACAGCTTCACGACGAACATCATAATCAGAAGCATTTTTAACAATATCA
ATTAAAACGTAATTATCACTAATCTTCCTAACTGCTTCAAGGCGAACATTAGAATCAGAACTCTTTTTAG
CGACATCAGCCAAAACAGATTCATCATCAATATTCTTTACAGATTCGCGACGAACATTAGAATCAGAACT
CTTTTTAGTGAATAGGTTAGATATATCATTCCAAGGCAAACCTCTTTTTAAAACTTTCTGCCTCAATTCT
CCAAAAGATGAAGCAATGATATTTCCTCTCCCTCTTTCAGTTACATATAAATAACTCCAAGTGTTATCAT
TTTGTCGCTCAATCTTATAATCTATAACATTTTCTTTAGCCATAACTTCTCCTTCTTTGTTTTTTCACTT
AATTGAAATTTTAACAAAATTTCTATAATAAATAAGATGGAGTTCAGTAGTTAGAGAAAAATAAAAAAAT
TTTAGTTTTCTTAAATTTACTATTACAGAACTAAATTAAATGCAAAAATTTAATCCATCTTGGTTTCCTT
TTGGCAATTGTTGCATTTTTTGCCATGACTTCGCAGTTTAATTAATAAATCACATTCCTCCTCCATAAAA
CATTAAAATCAATATAATACATATAACCAATAATATTGGAATAATAATTGCTGACCATACCTTACTTTTT
CCTGTTGACCCGTATCCTATTGACCTGTAATATTCATCAATAGTCATCACGTTTCTTTCTCTTTCTCTTT
CTCTCTTTTCTCTTTTAATACTATTTCTTTCATTTGCTTTCCTAATTCTTTCATTCCTTTTTATTCTTTT
TTCTTCACTCTTTTCTCTTTCTCTCTTATCACTTTTAATCCTATTTCTTTCATTCTCTCTTCTAATTCTT
TCATTTCTTTTTATTCTTTCTCTTTCTCTTTCTTCTATTTTAATCCTATTTCTTTCTAGTCTTTCCTTTC
TTTCTCTTTCTTTTTCTATCTTTTCTCTTTCTTTTTCTCTCTTTTCTCTTTCTAGTCTTTCCTTTCTTTC
TCTTTCAAATTGTTCAGTTCTTTCTCTTTCAAATTGTTCCTTTGCTTCTTTAATAGCTCTTTCAAATTGT
TCAGTTCTTTCTCGTTCTCTTTCAATTTTTTCTATTGTTAATTGTTCTACTTTCTCCATTTCAGCATTAA
TATCGAAAGCACCATGGTTAAATTTGCATTTGCATTTATCACATTGCCATTTAATATTAGTATCTTCACA
TTTTGAAACACGTGGACTAAAACAATTAGGACATTTGACTACCATTATTAACCCTCTACATACAAAACAA
TTAAAAAGTAAATCGCTATGTTACGCTTCGGTTTAAAGAAGTTATTAAACACTTAACATTAATCCTTATT
TTTCTTATTTAAATGATTTATTGTAAACATTATAAAAGTTTTGTTAAATATTTTTTCATTTTTTCTAATT
TTCCACTATGTTGGTTGAAGGCTATAAGCCTGTTCACCGAATTTAGCTATTTTTTGGAGTGATTAATATT
TTAGAGGTTGTTACCAAATCAAGAGATTCCTTGCTTATTACTGCTCCAGTACTGATTCCAGGTGAAAGGG
ATTGTGAGTTTGACTACGGAGAGGAGCCGTTGACCGAGGGTCAGATAAGGCAGATTGCACATGAGTATCT
GGCAAATTACAGCCTTGTCGACAAGAACCATGAGTTCTTCGAGACCAGAGAAGTTATAGGAGTTCCTGTG
GAGTCATATATAACAAACGAGCCTATAAGCCTCAAGGGCTTGGACGGAACAGTCAATGAGTATCCAAAAG
GAACCTGGATAGCCACCACAAGGATAACTGATGAAGAGGAGATGGAAAAGGCACTCAATGGAGAGTACAC
TGGATACAGCATAACAACTGTGAGCAAGAAGTTCGCAGACAAGCAGATCCAGCTGCCTAGAAGAGTCCTG
ATGAAAGACATCAAGGACCCAGTGGGTTTCACCATAAGCCTTGTCAGGAAGCCTTGCGTAAGAGGAGCTA
AATTTTGCAGTATGAAAGAAGATATAGAGAACGGTGATGTTGTGAGCGAAAATATAGACGATAAGTTGGA
AGAGGAAACCAAAGGTTTCGTGCAGTCCATCAAGGGAATCTTCAACAAGGAAGATAAGGATGAAGACAAG
AATCCTGAAGATGAGGATATCGAATTGGACATCAAAGCCATTGTGGATGAGGTAACCAAGGATTTCGTAA
ACACCGACGATTTCGAGACATTCAAGAATGAGTTGGAAAAGGCTTTGAGCGACAAGTTCGAGACTCTTGG
AGCAGAACTTTTCAAGTCCTTGAAGAAATCCTTGGAGAAGGACAAGGCTGAAGAAGCCAAAAATCAGGAA
GATGACGAAAGCGATGAGGATGATGATGAGGAAGAGGCAAAGGACAATGGAGAGGCACAGAACGTCCAGT
CCAGCAAATCCATTCCGAATCATGACATCAAGGACAACCAGAAGGTTGCAAAGACCGGAGCCGCACGTGT
CTATGAAATCATGGGCAGGGACAACACAGGCTCTGCAGTCAGGAAATTATAATCATACATCAACAGTTTT
ATTTTAGGAAAGAAGTGTAACTATGGGAAACGAAGCTACTTTAAACCAATTGGTAAACGAGCAGGAAAAG
GCAGTCTTCAAGTCCATGAGGACTGACATGGAGACAGGAAAGGCTGTATTGAACGTCGAGCAGCTAGGTT
ACTTCCTTAGAGAAGCAACATTAGACAATACAATTTTAAGAGATGCGGACTTCAAGCTGATGAAATCATT
CAAGAAGCATCTCAACAGGGTAGGAATAAACGGAAGGGTCCTCACAAACGGATATGACGTGAACGGCGAG
ACCGACCCTGAGATTCCTGCGGCTGACGTCGACTTCGGAGCAAACGAGTTGGACGTCAAGAAGCTCAAGG
CAATGTGCGAAATCGAGGATGACGAGAAGGAGGACAACATGACACAAGCCCAGTTCGAGCAGACCCTTCT
CCAGATGATGGGAGAAAGGATTGGAGAGGACTTGGAATACTGGGCATTGTTTGCTGACAGCGAAGTTGCA
AGAAGCGACGACCCTCTTCTCAACACAAATGACGGATGGCTCAAGAAATGCGCAAACCACATATCCAGCA
GGTCAATAGCTCCTAGCAATGGAATGTTTGACATTGAGGACGGTCCTGAAGCGATGTTCGACGCAATGAT
CAAGGCATTGCCTCCAAGATTCAGGAAAAACAGGAGAATGCTCAAGTTCTATGTTCCTTTTGAAGTCGAG
GACGCATACAGGAACATCCTCATAAACAGGGGAACTGGCTTGGGTGATTCCGCACAGATAGGGTTCAACG
CCTTGTCCTACAAGGGAATACCTATCGAGCACTGCTCCACCTTGGACGATGAGGACGGAAGGGGAATGCT
CGGCAACAGAGTATGTTCCATGCTCACAAACCCTAAGAACTTGGCTTACGGAATATGGAAGAATCTTTCT
GTAGAGCCTGAAAGGATTGCCAAGAACGAGCTCACAAGATACTGGTTCCGTATCCGCGGCGATGTGGACT
ACTACTTCCGTAACGGAGCAGTTGTAAGCGTAATGAATTCAAGCGATGCGGAGGCGTTGCCTGAACTCTC
CAGAGCATAATGGTATGATTTCGCATATCATTGTGCTTCTCATTTGCTTTATAGGATTGGTTGAGGCGAT
ACTGATGGCATTGGTTGATTGGGAGGACTTGGCAATATCCGTTCGCAAGTCTCCTAGAAAGCTTTATAAT
GTTTTGAAGGATGAGTTAGGTCTTCCTGAATGGAACGAACTGTCTGTGATTGAAAGGAGAAGCATGAAGA
AAAGGTATGCTGTCATAAGAGATTCCTTTCCTGAGTTGCCTCCATGGGAAGAACTTTCCGTCATAGACAG
GAGAAGCCACAAGAGACTCTACAAACTTATCAAATCAGTTTATGATGGAGACTATGATGACAGTCCAAGC
TTGGAAGGTCCACCAGCAGCAGTCGGTCCTCAGAAGGAGATTCCATTGGAAGAGGCAGAGTATCCTTGAT
TGAGGAGATGGCAATATGACTTGGATTGGTACGGAAGATGTCATCGAGTTCACAGGAGTCAAGCCTCAGA
CATTCAGGTTCGAGAAGGGAGACACCTCCAGCCTGGAAACATTGCTTGAGAAGTGGATTCTGCAGGCAGA
AGGACTTATAATATCCTACTGCAACTACGATTTCAATGACTTGGAGGAGATACCTCCAGCAGTTGTTAAT
GTCTGCCTTAGGCTCACTGCAAACATGGTCGCATTGGCACAGGCAAGGAAGGACACTCCTGTAATTCAGG
TCAAGGAATGGAACGTGCAGACTGTCAGTTCCAACATATTCTCAAATGACTTGAAAAGGGACTTGACCCC
TTTCGTGCATGAAAGGAAAAGCTACAAAGGAGACGAGATTGACTTCTTCGTCATCACTGGAGATGATGAC
TCTTGGTGAAATTGCAGATTGACGTTGAGGAACTCAAGCCATTGGAGCCAAGGTTCAAAAAGGTTGCCAA
AAGGACAGTTGTGTTGACTGCAAATGAATTGCAGAGAAACCTCAAGAAGTTGAGTCCTGTGGATCATGGA
AGGCTTCAGGGCTCTTGGGTAATCTTCCAGACAGGAGAATTGGAAAGGACTGTGAAAAGCAGTGCAAAGT
ATGCCATTTTCGTGAATGACGGAACAGGACTGTACGGTCCTTTGGGTCATAAGATAAGACCTAAGAACGG
AAAGTTCTTAGCCTTTACACCAAACAAAGGAAAGTTCAAGGGAAAGCTTGTTGTGGTTCCATGGACTAGA
GGACAGAAGCCTCAGAGGTTTGTTGAGAGAAGCATGGAAATGACTGAAAGGAGAGTGCAGGAATTCATGA
TAAGGGCAATGATGGAGATGGACTCATGAGATTCGTAAATACTGCTTCGCTTGTTCCTCAGACTGTCAAG
GCATATCTTGAAAGGGAAATCTGCGAAGGAGGGTTGCTTGAGGATGTAGAGACACTCATTCCGTCCGTGA
ACAGCGACGTTCCTGTTGACCCACCTGCGATATGGATAGTCCAGCACCCCACTACCAGATGGTCTGGCAG
TCAGCCAAATCTCTCAAACAAGATAGCTATGTCAGTCCCTTTCGAGTTCGTATGCGTGGAATACAGCGAT
GACTTGGAAGAGGCTGAGATATTGGGAATAAGCCTAGCCAGCAGGGTTGGCTCAAGCCTGATGAAGAACT
TCAACAAGGTGAAAGTTGATGATTCCATGCCGAACAGGTTCTTCCACAAGCTGGAGTTCGAGACATTGTA
TCCGGTAGGAGAGGTAACGGTTGTGGGAAAGAGCGAAAGGATACCTGCAACCAGCATCATTTTTAATTTC
GTTTATGTTGTTGATTGGTTGAAATGTAATAGAAGATATGATTAAGGAGAATTTTTATGGGAATTCGTGT
TGTAGGAATGAAGGAAGAGGCAAGGTATGGAGTTGCGGAGTCAGCGCCGGACTTCCATCAGGAAGTTAGC
AAGGCAAAGGCTTCCTTGAACTCCACTCCGAACACAAAGTCAAGCGGCTCAAGGATGAAGAAGAAGGCAC
GTGCAGGCGTGTACAAGCCTACTGCCAACATCGAAGGTGAAGTTGACTTGAAGAGGATAGGACATTATCT
CAAGGCTTTCCTGGACAATTACCATTTTACTGACGGAGGCTCCAATCCAAACGTCCATGAGTTCTGGGGC
GGAGAGAACAATAAATTGTCAAGCTTCACTCTTTGGGTAACTTTTGACATATTTGAGAAGACCATCGTTG
GCTCATTGCTTGACAACTTCAAGATGGAGGTGAGCGACGAGTACATGAAGTTCACCGCTGACTTTGTCTA
CAAGACAGAGGAAAGCGATGAGATTGAGAACATTGAGCTCTATAAGGTGAAGCTTCTTGACGGCGATTGG
GCATTGATGTTCTATGACGTTTCCGTTGAGATAGACGAGAACGCTCCTCCAGGAATTGTTTCAAGTTTCA
GTTTTGACGGAAAGAACAACATCAATGTGGACAAGACTATCGGCTTAGGAAGCAGAGGTCCGCAGAGGAA
GGCTGCTGCTCAAGGAAGGGACATATCCATTTCCTTTGTCTCCACTTTGGAAAGGGAGACCTTGGAGCTG
ATTCAAAAGGCTGAATACGGAGAGGTAGGCACAGAACCGTCTGAATGTAAGTTGTGCAAGATTCCATTGA
AGCTCATCTGCAATGTCTGTGAGGACACAACCGACAGGCTTGAGATCACTTTCCCTGAATGTATCTTTGC
TGTGGACTATGAGTTGAGCGAGGCTGACGAGATTGAGGTTACCTTCAACTTGGACGCCATGGGAACAGGA
TATGCCACAAAGTTGGACGGAACCCGCGTATTGACTGACATGTATTGCAGGCTTGTGAATGACCAGCCTG
AGATAAAGAGCGGAGAGGGTGTTACAAGCGCCACCGTAAGGCTCACTGTCAAGGACGATAATAATCAGCC
TGTGGCAAGCAATGCAGTAACTATTGTGAATAGAGTTACTGATGAGAGCTATGAGGCGACCACAGGCAGT
GCAGGAGGCTGCTCCTTCAATGATGTGGAGCCTGGAAGGTATGATGTCATCGTTGAAGGATATGATGTTG
TTGCAGGAAGCATAATCTCTGTCAATGACGATGAGGAAAGCTTTGACATTACTGTAGAGGAAATTGAAGA
GGATTAGGTATTATGGTTGTAGTTAAGAAATCCGATATTTTAAAGGGCGTAAAAAAGATTGAAAAGGTGA
AGATTGAGGCTTTGGACGGAGACGAGATGTACTTGAGACCGTTGTCCCAAGCCGAGATCAACGAGGTCGA
CGAGATTGAGGCAAAGGCTATGGGAATCTTCGAGACCAACGAGACCGCACACAGGGGAAGAAGGCAGAAG
CCTAAGAGTGTGGTTGAGAGCAAAGGAAAGATAAATCTCGAATTGCAGCAGAAGGCACAGCACCAAGCCA
AGACCAAGGCAATCTTCTTATCTTTAGATAATGAGAAGAATGTGGGAGAGGAGGCTTGGTCCGAAACCGA
GATTGAGCAAATGCCTCACAAACTATTTGAGGAACTTTTCAATCATGTGAAAAGGTTGAGTGGAATAGAA
CTCGATGAGGATGACGTGGATACCTTTCATTAAATCAAAGGAAGGTAGGCAGATTCTATGGTTGGATTAC
TGTGGCTACCATTTAACAAGGTGTCAAAGTGATTTGACCATACTTCAAACATTATTCCTTGCAAAAGGAA
GACTTGAACTATATCAGGAAATGAATAAAGTGGAAGAAAGTAAATTTTAGCTATTTTTCAGGAGTGAAGG
AGATTGCCGTCAAGCAATGTAATGAACATAATAGTCAAGGCAGAGGACATGGCATCATCTGTCGCCCAAA
AGGTTGAAAACAGCTTCAGGAAATTGGGAAACACAATAGACAGCACCTTCACCACATCTCTTTCAAACAC
CAAGTTCAATCAGGAACTCACTTCTTTTGGAACAGACTTGGACAAGGTAACCCAAAGGCTGAAGCAGGTA
GGCGTGAACGGTCAGTCCAGCTTCAACCAGCTTACAAATGCTGAAAGGAGAACCTTGGAAAAGCTGAGCG
AATTTGATCCAGTATCAGCACAGGTTCTTCAGCATCTGTCAAGAATCGGAATCACCGGTCAGCAGACATT
CAACCAATTGTCGGTTTCCGAGCAGAAGTCATTGATGAACATGAAGTCAACCGCTCAGCAGCTGGAGGAA
GTAAATTCCAAGCTGAGAGTTGTGGGAATCGGTGCGGCTCAGGCAGCGAACATGCTGAACCAGATGAAGC
TTGACCCAAGCGTTGGCTCCAATCTGGACAGGGCTAAGCTGAAGGTTTCCGAGATGGGCTATTCCCTTGA
CAGCACAAAAGGGAAGATACTTGTCTTGGGCACAGCAATCCAGACCAGCTTGGGCAACAAGTGGGACTCA
ATCAAGACCAAGGTTCAGACCACAGCCACAAACATTAGGACAGCATTGGGAAATGCACTGACTTCCGTGA
AGTCAAAGGTCCAGAACTTGGGAAATGCCTTCAGCGGTCTTGGAGGAATAATATCCTCTGCAATCGGTGC
GATAGGAATGGCTTCCATCTCACAGCTGACTGTTGGCTTGGCTATGAACCGTGAGAGGATGACTGCCTTG
ACAAACGCCACAATGGGAGGCGCTAAGGCAGGAGATCAGCTGCTCAACGGATTCACAGGCGTGAACAAGG
TCTTCAAGGACTTGAATGGAAACTCAACAAACTACTTCATGGGTCTTGACGAGATGACTAACCACAGCCT
TGTCTCATTGGACGATTTGGGACAGGCTATGTCAACAATCAAGATGTCCACAGGAATGAGCAATGAGGAA
TTGATGATGTTCTCAAGCACCGTGAACGATGTTGGACAGAGAGCCATTTTGATGGGAAAGAGCGGTGAGG
AGGCGATTTCCCTCATGCAAGCGGCAGGAAGAGGTCTGAACGGCGAGTTTGACATGCTGAAGACAAACTT
CGGAATCACCAAGGACACCCTTACTGACCTTGGATGGAGTGGTGCCGCTGACGATGTCAAGGGCTATCAG
GAGGCATTGGACAAGGCTCTTGAGAAGGGTGGAGACATGGACGGAATGCTCGACACCACAACAGGACACC
TTGAGACATTGAAGAAGAACTTCCGTGTTGCAGGAAGGCATGTGGGAGAGATGTTCACTCCATACATAGA
CATGGCAGTCCAGAAACTGAATGGCTTGAAGGAGACATGTCCTGGCTTGTTTGAGAACCTTGTCATGATA
GCGGGTGCAGTGAGCGGATTTGCCACTGTGGCTCCAAGCATTGCTCCTATGATAAGCGTCTTTGGAGATG
TGGGAAGTGCGATAAAGAGGACAGCAGGATTCTTGGGACTGATGGAGGTTGCAGAGGACGCAGTAACCTT
GAAGTCAACATTCCTGACAATAGCTCAGATTGCAGGCGCTGACGCAGCTGTGCTTCAGACTGCCGCAAAC
AGCGGTTTGACTGCAAGCTTCTGGGCAATGGCTGCTGCAATCTTGGCTAACCCTTTGACTTGGGTTGCAG
TTGCACTTATAGCCATTGCAGTAGCAGTCTATGAGGTCGGAAAGAGTTTCGGATGGTGGTCTGATATAGG
CTCCATGATTGGTGCTGTTTGGGCAGGAATCCAAAGGCTTTGGAGCGCCTTCATAAACAATCCTAACGTG
CAAGGATTCCTGAAGGACCTGTCTAACGCATGGAATGACATATGCGAGGCATTGGCACCAGTCATCGATT
GGGCTAGGAAGGCTTGGGCTGAGCTGTTCCCTCCTAGCGCCACAGGAAGCTTTGACATTGTCAGGGCGAT
AATTGACGTTTTCGGACAGTTGGGAGACTTCTTAGGCAAGGTTGTGAATGCCGTAAAATCTGCTTGGAAC
GCATTGGGAGGATTTGCCGGATTCCTTCCTATGCTGTTGGGACCTGTAGGAATGGTTGTCATGGCTTTGA
GAATGATTGTCTGCATACTTTTAGGTTGCAGTCCAGGCATAGTTCCTGCATTGCAGAAAACACAGTCAGT
GTTCATGAGCGTTTTCGGTGCAATTGCAGAGTTCATTGGAGGTGCTGTAAGCAATGTTGTAGCCATTCTC
ACAAGGATAATATCTGCATTGACAGGAATCTTCACTCGTGTGAGTTCAATAGTGAGCACATATCTGGCTA
AGATGATAAGTTCCGTGATCTCTTGGGCTTCATCCATTGTCAGCAAGGCAAAGAGTGCAAGTTCCAAGTT
CCTGACAAATGTTGTGAATTACTTCAGCAAGTTGCCAAGCAAGGTCTGGAACCATCTGAAGAACATCATT
CAAAAGGTTACCAGTTGGGCGACTTCAATTGTCTCCAAGGGAAAGAATGCTGCCAGCAAGTTCCTGACTG
CTGTGGTGAACCATTTCAGCAAGTTGCCAGGAAAGGTCGGCACCTATGTCTCCAATACTGCAAGCAGGAT
TTCATCCGGTGCCAACAAGTGGGTTTCCAATGCTCGAAGCAAGGCTTCAAGCACAGTGAGTGCCGTTACA
GGACCAATCAGCAAGTTGCCGGGAAAGGTCTACAATGAGTTCATGGGAATAGGCTCACGAATGCTGAGTG
CAGGAAGCGCACTTGTTTCAAAGGCTCGTCAGATAGGAAGCAACATAGTCAGCGGACTGTTGAATGCCAT
GAACATTCACTCTCCAGGTACAATTCAGCAGAAGGTTGTTGCAGAATTTGAGAACACCCTTTCACGTGTA
GGTAGCATGGATTCAACTGCTCTTGATGTCGGGCAATCCGTAGGTAACAGCATTGTCCGTGGATTCACTG
ATTTCGGCTTGGATACCGGTAGCTTCAATGCGGACTATTCCACAGACTACAATCTCAACAGGAAAAATGA
CGATAACCTTGACGTGAACATAAAGCAGGAACTGGAATTCGTGTTTGACTTCAAGAATCTGCCTAATGAT
GTAGATGAGGACAAGCTATTGGAAATGCTTAAGGAAATGGTTACCGACAAGAGCGTCATACAGGCTCTCG
TGAGCAATCCTGATTTCCAAAGCATGGACACAAAGGTGAAGAACAGCATAATCGCAAAGGTCAAGAGAGC
AAGAGGTGTCTAGAATGGCAAGTGTTACAAAATATCCGAGCAACGTTTCACAGACCACTGGAGGAAAGTT
CGTGTCCTTCAGCAATCTGGCAAACATAAAGAACAATGCTGACGGAGCGCATGCCGTGAGCAGTGTTCTT
ATCAAAAGCAAGAAGCAGTCTCCAAACAGACCGTCCACAGTCTCATGCAAAGGCTTCGGATTCAGCCTTC
CTGAAGGTGCTGAACCTACTAAAATCACAGTAACTTATAGGCATAGGAAGAATGCTGGAAGCGACTACAG
CTCAAAGAACAAGACTCACATATGCAACATCGGAGGACCTACAATCTCACTTTTAGGAGTCAGCGGATTC
AGCAGCAAGGGAAGCGGGTGCACCACCACTATGACCACTCACACAAAGGCTTTCAGCGTTCATGGAAAGC
TCTCTAGAGCACAAGTAAATAGTGCAAATTTTGGAGTGAAGCTTGACTATCCTACCAACAGCAACACCTA
CAACGGATACATGAGGATAAGCTATGTCCGTGTTACTGTCGAGTACATCACAAGCCAGTACAGCGTAAGC
GTCAAGCATGTCAGCGGAACCTATGAGGATGAGGACTATGTGGTCTCATTAGGCATAAGCAACAAGAACC
TCACAAGCTACAACCCTACATGCACGCTGACGGTTCCTGCTGGATTCACCTATAAGGGCGTTACAGGTGC
AGCCACCGGAACCGTAACAAAGGTCAACAACAGGACTTTCAGCTGGAACCCTCAGCTGCAGGGCAGGGCA
GGAAGCAGGCAGATAAGCCTTGCATTTGAGCCTAATGTAACATTTCCGGAAGGCACTGACTCATATTCTG
GAACATTCAGACTGTCCGAGAGCCTTAACGGTGCAAACAGTAGCCTCAATGCCGTCATCAGCAAGAGACC
TGCTCCTTCAGGCAGCGAGACTGCTGGCGAATCGACACAAGTCTTGGAGAACGAGGACACATTAAGCGGA
AACGATTCCTATCTCATCCTCAATGTAGGCGAGGAGTTCCTTTTCTCCGTCGAGTTCACTGATGCTGAGA
ATGCTGTCTATAATCGCATAGGCAATGGAGAGGACGATTGGGGAAGGATTGCATTGACATTGTTCAAGCT
TGTCGACGGCAGTTGGATCGGAAGGAGCCATTACGATGTGTCAACCCAATTGGAGTATGACGAATCAATT
CCTGAGGAAGTTGCATTGGCTGAAGGCGACAAGTGGAGCCTCAATAAGACATTGAGCATAGGTCAGGTCG
GAACATACAGGTTCTCCTTGAGATACGAGAACGAGCACAACCATGAGCTTGACTATGACATGAGGCAGTT
CCTTGCCTATGTCAGACCTTCCGAGGAACAGTTGGGCAATCCTTGCTTCACTGTCTTGAGGCTGTCCGAT
GAGGAGTGCGACAGGCTTGGAAGCCTCCACACATACATCGCACAGGCATACATGAAGCACATTACAGATG
ACACACATCCTCGGGACTGGTACAGGAACCTTCGCCTTGGAGTGTTCAACAATGCAATAGCCGATAACAT
AACAGTAACCTCCGAAGAGGTCGACGGTGAAATCATTGAAACTGTTGAGGACAGCACAGACTATGAAAGC
CTCACCAATGAGGACATCTTCAATAATGCCGAATACTGGAGCGATGCCTTGGCAAATGTGAATGAGTTCG
ACAATCTGGAATGCGAGTTCACCTACAATGAGGACTATCCTCTCTGCATCATCATGACCGGAGACTACAA
TGAGGCTGATGGCTATGATTATGATGTGGGAACTGTCGAATACACAAATCCTTGCATAGTTGAGAAGGAT
GTCTACAAGCAAAGAGAACCCAGCGGAAACTATCCTATTCCTTTGGAGAATGTTCTCTCAAATGACGATT
CAAGCGAATTGGGAATAGAGCAGTTCAACATCAGCACTCCAATAATCCTCTACACTCTTCCCTTCGATGA
GGGCTACGGCACCAACGAGGAGATGACTATAAGGGGAATCGAGGTTAGCGGAACACTTGAGCAGAGCGAT
GAGCTTACAGTGAATGCTAAGCTCAAGTCTCCAACTGGAATAAGCGGTACAAGAAGCATTATCATCGAGG
AGAATGACCTGACCCTTGACAGCACAAACGAGTTCAGGATTGGAGGGTTCGGAGACCTTTGGGGCTTCTC
CACATTTGACCTTACAAATCTTGATGACTTTGAACTTGAGCTAACCGTGAACAACAATATACATGATACT
GAGGCAAACATAAATTTCCAGGACGTGAAGATAACATTCTATCTTGAATTCATACAGGACCAGAAGATAA
ACATCAAGATAAATGAAGAGGACCTAAGCTTTTATGGGGTTTTCACCGATGACGTTATCATTCCTGAAGG
GCTTGAGACAGATACTAGCTTCCTTACGATAGACGGCACCGACACAAATGACGCATATAGGCAGAACATC
AAGGAAAAGGAGATTGAGCTTATTCTCTACATTGCAGAATGCGATTTCCAAAGCAGCACTGACATGCTGA
GGCAACTGTCAAAGGTTCTCGTGAATGAAAGGGATGACTATAACCGTCCGATTCCCAACAGGATTGAGTT
CTCGCACTATCCTGACGTCTATTTTGAGTATGTGATGGAGAGCGCATTGAGCGTCGAGTCAGACATCAGC
ACCTACAACATAAAGGCGAAGCTCACCATTCCTAGCGGAACTGCCTTCAGCAAGAAGACCTATTCCACAG
GAGTAGATGGCTATGTTCAGGGAATTGCTCCTGTCAATCCTGTAATAACATTCAAGCCTCAGAGCGACAC
CGTTGAAATCCTTGAAAGGAAGAGCGGACAGAGGTTCAACATGACCTACACTGCTGGATGGGAAACAATG
ATTGCAGAGATAGACTGCGAAAGCCATACTGTTGTTCTGAAAACGGATGAGGACGATTCCGAGATGACTG
ACATAAGCGGAGCATGCGACTTCAATGTGGACTGGTTCAGCCTTCATGGAGAGTATCAGTTTGAAGGGAC
AGGGTGCAACATAAGGACAGTAAGCTACAACGAGAGGTGGTGATTATGGGCATAGCTATTGTTGTTATGG
ACAATGAGGAGAACTTCCTGCAATTCCTTGACCCTGATTTATGCACCATCAATGAGACCATAGAGGAATT
GGGCTTGAGGACTTTGGAGTTCAACTACAAGTTTCAGGACTATGTTGAGGACAGGGATCTTTTCAGGATA
GGTAACAAGATCTGGATTAGCAATTCCCAGAGCTTGGAGGACTGCCTTTATGTGATAAACACTCCTGTGG
AGAACAGCGTCTATCAGGAGAACTACTTTGCATGCGAGATTGAGGAGGTCTTGGCTGAGCTATACTATGC
TCCATTGTTCAGCCAGACCGAACTGACAAGTGCCAACGGCTTCACATTGAGGACCACCAACGGAGAGCAG
ACCGTTGATGTGGACTGGAATGCCCTGAACTACTGGTTCGGATTGTATTTCAATATAGGTGTTGTTCAGG
AATGCTTGGGAACCTATGCGAACAGGATAACTGTAAACGGAACAATGAACCGTTTGAACCTTCTTAGAAG
CATTGAGGAGCAGACTGGAAATCGCTTTGTAACAAGGTATGAGAAGGACTTGCTTGACAACACCATACAT
CGCTATCTGGATTTCCTGAATCCTGTGAACGTGAGCAAGAACTGGAAATTGAACATCGAGTACGATTTCA
TCTATGAGGATGACGGTGAGTACTGTGAGGCATACACAAGCGATGGAAATCCTATAAGCGAAATATATGA
TGACATCGAGGAGGAGGACGATATTGTGGACTTCCCTCCATCAACTCCAAGGCTTAACGTTGATCCTGAA
GGCATTGAGTTCAGGATAGTGAACGAGGACTTTGAGGTCATCAACAGCGACGGAAATGTCTATGTTGATG
ACAGACAGCAGACTCCTCTTGTCTGGAGCAGTGCGAGCGTTGGCTTTACAGGCGAGAACAGGCATGTCCT
AATCACATTGTCCAAGGAGAAAAGCTTCGTGGAACTGAGCGTCAATGGGAAAAGCTTTGTGATGTTGGAC
AATGCAGTTGGCGATGTTGTGAGCACAGGATTTGTGAACCCAAGCAGTGAGCCGGTGCAGAGGAGCAGCA
CTGTAATCCCTGACGATTCGTATTTTGAAATCTTTGATGTCAGCAGGAACAGGGCTGTCTTCCGCACCTG
CATAAACAGGGAGATCGGGCATGTGCATGAGGAGGTGCTTGACTTCGGATACAACTTGGAGGAGGTGTTC
TTTGAGACAAACGAGGAGGACACATTCACAGCCATAAGCCCTGTGCTGAGCCTTGATGACGATTCCGAGG
GTCTCACCAGAGCCAATATGAACACCATAATCAGTAACTACACTAATCTCAGCATACCTAAGGGGAAGAT
TATCCCGATGATTCTTGAAAGGGTGAACGTCAAGGCAACAACACTTGCCAATGCAAAGTCAAGCTTGGGC
ACTTTTGATGTGAGCAGGAACTACTATTCAAGACCCGTGCAGCCGAATGACAGCATTGACACATCAGACA
GCTCAAACAACACTTGGGAGTTCTGGAGGGCGACAGCTTACTGGAGAGCTCCGTTTGCAAAGTTCGGCGG
AGACTTGCACGTGGCGACCGATGCCGTCCTCAAGACACAGTACACTGACATCAGCGGAAGGTCCGACAAT
GGAGACGAAAGGAGAGTTACAAGACCCAAGATGGGCATGGTGGAGACAGGCGATGAGGACGCCTATGCAA
TCTACAATGATGTGGCATTGAAGCTCAAGGAGAAGATGTATCCTGAATTCAATGTTTCCGTGGATGTTGC
AAATCTCCGAAAGGGAAGGTTCAATGACTACAGCCTCTACGATAAGGTTTACATAAAGCTACCCAACTCC
ACTGAGCTTGTTACCGCTCGCGTGACAAAGACAGTGAAGGACGCCAATGACATTTCAAGGAACACGGTTG
AGCTGTCAAACTACACCTTCAGCTCCACCATAAAGAACATTCAGAATGAGACATTCATCGACGCCTACAA
CGTCAGCTTCAAGTATCCTAACAGCAAGACCCTTTCTGCAAGGCTTGTGAACCTTGACTATGACAATTCC
AATCCGGATTCCGTTCAGTATCCTGCAAACCAGATGATAACGTTCACAGTTTACAATAAGGATAGCCAGT
CCATAGTTGCCTCCTACAACAAGCTAACCAATGCACAGGGCTATGCAACAATCAACATGAAGTACGATCC
TGGAAACTATGAGATCGACATAGGATTCGGAGGGGACGAGGAATACCTTGACTGCTCAACATCCGTTGAA
GCCAATGTCTACGGAAAGAAGGTTGTGGAGAAGCCTGTTGTGGTGAAGACAAAGTCCAAGACAACCAAGA
AGACATCCTCCAAGAAAAAGGCTTCTTCCAAGAGTACTGCCAAGACCAAAGCAAAGACCAGGAGCACCAA
GAGATACTACAGCAAGTACGGCGTTAGCCCTGACGGAAAGTATCTCATGGCGATAGGTCGCCCAAGCGCA
AGCGGAGAGCTTGCGAAATACGGATACAAGTTTTACAGGACAGTGTTCGTAAGGAAATGCCCTATGTGCG
GAAGCACTGAGATCTACTGGTCAATCTTCTGGGCAGGAAACGAGCATGGAAGCTGGGGAAAGTTCCCTGC
TACCGGAAGGAGAGAATCAGGCTCCGCAGAAGGTCAAATCTTTTGCAAGAAGTGCGATGCGGACTGGTCA
ATCTTCGGGAACAACCACAATTCAAGCCATAAGGACTTGAAGATTTACAAGAAGCCTGCAAGGAGCACAA
AGTCAGAAGCCTACACCTTGAAGAAGGGCAAGATGTACTATGACACAGTAACAGTAACCGTCAAGGAGAA
GAAGAACACAAGCTCCAAGGAAAGGGTTGTGTTGGCTAATGACATTCCTAAAGCCATTGTGCAGTTGGCT
TTGAGCATTGTGGGAAACAGTACAGGTCTTGCTGCTGCGAAGAAGATAGCGAAGTGGTGCGGACACAAGA
GGAACCTGAAATGGGTTGAATACAGGAACTTCAAGCATGGAGTCTCTTGGGTTCGCAGGAAGAGGAAATG
CAACTGCTGCGATGGTGCAAGGTTCATGCTTACGCTGATGGACGCAGCAGGTTGCACTGAGAAGTTGAGG
TTGCAGTATGTGAATGTGAGCGGAGGCAAGGGAGGTCATGTGTTCACCAAGATAACTGTCAAGGAGACAG
GCTCTTGGTGCTATGTAGACCCCACCTGCAAGTTCGAGAACGGAAAGAACCCTTGGAACCACTACATCAA
GGGATACGGCAGTCCTCCAGGGCATGTCTACAATTACAATGGTCCGATCAATCCGCCATTTTAGGAGTTG
AATATATGGTCGAGAAGATTACAGTGAGTCCTCAGGAAGTCAGAGGATACGGAAATGTTGTTGATGAGAA
GGAATTGGAAGATTACGGAAGCTACAGGTGTGATGTGAGCGAGAGCTCGGAGGTGATCAAGGGAGTTGAG
GAAAGGATATTCAGCGTTTCTGGTGTTCCTGCTCCTGCTCTGAGCATTGCCAATGTTACTGAGGACACTC
GCAGGGGCAGGTGCGCCCACATCTCCGCCTCATTTGAGGATGGGGAAGGCGATGGCTTGGATGATAAGGC
AATTTCCCTTAAAAGCGGCGATGATGTCCTTGCAACCATTACAACTGGAAGTGGAGAAAACGTGTTTGAT
GTGGTCCTTTATGATAGCGCTCAGCTCTATGCTGTCTTTGATGGAGATGACTATTATCCTCCTGCTGTCA
GCGAAGCAATCACAGTCAATCCTGCAAAGTCATTATGGGATGTCGAGTTCATCCTTGACGAGGAGGAGTA
TGAGGTTGGAGACACAGCCATACTGTCAGGGACCGTCGGAACGATTGTTGACGAGATTGTTGACGGAGAG
ATTGTTACCCGCAGGCAAATGGAGGCGAATGTTACATTGACTCTAGTAACGGATTTAGGAATAAGGCGCT
GCTCCACCAATGCCAACGGAGAGTTTGTGCTTCAGGTGCCGAACATTCAGCAGAACCAATGGAGAGTAGT
CATAGCCGCCACTAGCACCCATCTGGTCTTCAATGGCTTGATTGATGTTCCTGTCCATGACTATTCCTTA
GTGATTTCAGGATCCGAAAATTCAACTGCCGCCTCCACTATATTGGTGGTCGGTCTCACCGACTTCAACA
GCATGGTAGAGGGAGCAACAATATCCATCGCTGGAAGCGACGGCTCATCATACACCGCTGTAACGGATTC
GATGGGAGGAGCAACAGTGAATGTGGGCAGACTGAACGGAGCCACAACATTCACTGCCACTTACGGCAAT
GTCTCCTCAACGGTTACGGTTGTGCCTCCTTTGGACTGGTACGATGCGTCAAACTACACCGCAGGCTCAG
GCAGAATGCCTTCCTCAAGGGCAAGTTCAATCTATTTGCAGGCTGTGGGCGGAAGATGGCTCAACAAGGA
GTTTACTGACAGTGAGTCATATGTCCTCGAGTTCGACCTTATCCTGAGCAAGAACAACCGTGAGGGTTTC
TACTTCGGTGCAAACCCTAACTCAAACACAAACTCAGGAATCTCAATCTTCAAGGACATCTCAAACACCA
TGATTGAGACATTCGATTCCACAGGCACTGCAATAAGGCTTGAAAGCTCATTGTCAGGAAGCTATTTCAA
CACAGGCACTCATCACATAAGGATTGAAAGGGACTATGATGTAGCCTACATATACTTTGACGAGGACCTG
ATATTCGAGTTTGATGATGAGATATTGAGCTATGGTGCGGAGGATCAGATGTACAATACCGTCGGAATCC
TATCTTGGGGCTCAGGCATCATCGAGTTCGGAAACTTTGAGTTGAGTGATTGAATATGAATGATGAAAGT
TGCAGAAATTGTGTCTTCAGGAATGAGGATTATCCTCCTTTCTATTGCGATTTTGGAGATGACAATCCTG
TTATATGTACAGTGAAGATGAAGAAGATGAGAGAATACAAGAAAGAGAAGTTAAGGAGTTGTTTGGATGG
TTAGATTCAGCAGAGACATGCTCCAGGACGGAGCGAAGAGAATGTTCAAGTGGCTAAGAAAGGGCGAAGG
GTTGCCTAACTACTTGATAATGTATGACATGGACAGGAATAAGGAGTATAAGTTGGTTCCAAAGGAATAT
GCAGGACTGTATGAGTCCAGAAACATATTCTGGATTAAGAACGGAAGGGAGCCTAACTATGTTACACTGA
CTTCCGTTGCAAGGAATCCTCTTGTGATGGACTACCAGAACACCAATTACACCTGTTGCCCAACCAGTTT
GTCCCTTGCCTCACAAATGCTATATCACTATAAGTCAGAAAGTGAATGCGCTAAGGCTTTGGGAACTAGC
AAGGGCAGTGGAACAAGCCCTGCACAGCTGATAGCCAATGCTCCGAAGTTAGGGTTCAAGATAATTCCTA
TCAAAAGAGACAGCAAGGAAGTGAAGAAATACTTGAAGAAAGGTTTCCCTGTAATCTGCCATTGGCAAGT
GAACCAGAGCAGGAACTGCAAGGGAGACTATACTGGAAACTTCGGTCATTACGGTCTCATTTGGGACATG
ACCTCAACCCACTATGTTGTGGCAGATCCTGCCAAGGGAGTCAACAGGAAGTACAAATTCAGCTGCCTCG
ACAATGCTAACAAGGGCTACAGGCAGAACTACTATGTTGTCTGTCCTGCATAGGTTACTTTGCACATGCT
CTGTAACAACCTTTTTATGTTGTCGAGTGCAACTATATTATACAGGACATGGCTTTTTCCTTTGATATTG
TGAAGGGAGTAACCATATATACAAGCCATGTTCGATTTGAGATTATCCTTAGTGGTTTGGTACATGAAGG
ATGTAAAGGATAATCTCTCCCTACTCTCATTCTTATTTTTTTTCAAACATTTTTTTACTTTTCAAACGCT
CTTAGGTATCCTCTTTATATGCTGAAGTCCAATGTATTATCAGGAGGCATGAAAGTTTTTTTTCTCACTA
CTTCTTGCTTTTTTTACTTCTGGGTGTACTATTTTTCCTTTTGTGCCTCTGAAGAGATTATCCTTAGGAA
GTTGGTTTTGCAGAACTCTTCTGTTTTTTGGGATAGCAAGGATAATCTCTACCCACTCTCCACTCCACAA
AAAGTTTTTATACCTTGAAACTAAATTTATTATTACAGGGCTAATCCTTTACTAAACCTTTACTCAATTA
CATATCACCCCCTTTACATATGTTTTTTTATAAGGAGGATTAGTCCTTTTTTTTAAACTTTTTTTTAGAA
ATTTTTATTATTAATAACATTTCATATTATAATATAGTTAATATAATATTGAGGGTTTAGATGAAAAAAC
ATTGCTTTTATTTTTTAGGGGACAGTTTTGCCGATATATGCAATGAAGCCATGTTTTGTGAAAAACATTT
AGTAGAAGGAAACTATTTGGATTCAATTATCCGTGCAGGAAAGGCTTCAGAGATAATAACTGTAAACATT
TGTGAACTTGAAGGTCAAGATGGCTTAATAAGCTCTGGTCAGAAGAAAAGATTGGAAATGCTTGGATATA
AGGGTATCATTTCTTATGATATTTATAAAAGATTAAACCATATTCGTAAAATTAGAAATAAGGCTGTCCA
TGGGCATTTAAGTGATATTGAAGACAATGCAAATATTCTGCATGCCTATCTGTATCTAATTTGCGCATAT
TTCTATAAGGAATATAGAGACACTAATTTTTCAGCGGAAGATTATACGGGCCCTATTATGGACATTGCCT
CTAAGCCTAAAGAGACTGCTTCAGAGACTTCAGAGGATAATGAAAATATTGGAGAGTTTATTTCAAGTCC
ATTGGATGATTATCTTTTTGAAAAGTATGATGACAGTTACCTGTTAAATGAACTGTCTAAACTTAAGGAC
TCTTCAAAGGAAGCTGTTGAAGACGATAACTTAAGCGAATTTAAGGAATATCTTCATATTGACAGATCTA
TTCAAGAAGATTTTTTAAAGGCATTGAACAGAGCCACTAGTTTTAATTCATCTCATCTGATTATGCTTTG
CGGTAGTGTTGGAGATGGGAAATCACACTTGATTGCAAATTTAAAAAAGAAAAACCCTGAACTCTTTAAT
CAATTTGCTATCCATTATGATGCTACAGAGAGTTTTGATCCTGAAAAGAATGCAATAGACACTTTAGCCT
CAGTATTGGAACCTTTCAATGACAATAATCTTAACAATTCGACAGAAAAACTTATTTTAGCCATTAACTT
GGGTGTATTGAACAATTTCCTGGAATCATCTTATGCTAATGAAGATTACACTAAACTCAAGTTAATTATA
GAAGAAGCGAACATATTTGAATCTAATGAGGTTTCAGATAACATTTATGGAGATAAGGTTAGTTTTGTCA
CTTTCAGTGATTACAACATGTTTGAATTGAATGATGATGAAAATTCAAACTACACATCATCAAAGTACAT
CTCTTCCCTATTTAATAAGATAACCCAAAAGGAGGATACAAACCCTTTTTATGTTGCATATCTCAAGGAT
AAGGACTCTCACTTTATCAATCCTATAATCTATAATTATGAGATGCTGATGGATGAGGAGGTCCAGAAGA
CAATCATTGATTATTTAATCAAGATTTTCATAAAATACAGAAAAATCATTTCAACTAGAGACTTATTGAA
CTTCATTTATGAGATAATAGTTCCTCCGGAATTCCTGAAAAGTGAGGATTTGGACAATATCAATGATTTC
ATGGACTATTCATTGCCTAATTTACTCTTCGGATATCCAGAAAGGTCAGATTTATTGAAGCTATGCAATG
AATTGGATCCGACATTGCATCGTAATGAATCTTTAGATAAGTTCATAATAGACTTGAACATTAATGACGA
TACTGAAAAGATATTAAATCGTTATTTTGATTTCACTCGTTTTAATTTCCTTGAAGAGTATGGAGAGTAT
CTGGTTGATTTTAGGGAGTTTAACAATTCTGAAAAAGAGAAGGTCACCAATATTCTAATTAGGTTTGCAG
TATTCTATGGAAAGAGCATTATCAAGAATAATTTCAAGGATAAGGTTTATTTAAATTATTTAAAATATCT
GTATGCCTATAATACACAGTCTCATAAGGATTACAAATATCTGTTCACTGAAGTTAAGGACGCTATTTTT
AATTGGAAAGGTTCCTATAAGAAGAATACTATATGTATTGACACTTTGGATTCATTTAAAGTGTATAAAA
ATTTAAAATTAAAACCATCTGTTGATAAATTTGAAAAAAGTTTATTAGATGGTCTCTTTTTAGGAAATAG
ATTTAAAACAGATATAAAAATTTATTTTTCAGTTGAATCTAACAAAAAGAAAATACCTTTAAATGTTGAT
TTTTCATTATATCAATACATAATGAAATTATATAATGGTTTTAAGCCTAATCAATCAGATAAAGACGATT
TAATAATTTTAGATGAATTTATTAATAATTTATTAGATGAAGATACAGATGATGATTTATATGTAATTAG
TTTAGAAACTTATGAAGAATTTTTATTTGAGTCAAATGATTTTGGCACTTTTGAATTTAAGAGGGGTTAA
AAATGGATTTTTCAGAAAATTATAATATATTATTAAAACAAATGACTTGTGATGTAAATAAAAGGAAATT
AATACATCAGATTAATCAAAATTCTCCATTGTTACCTTTTAAAACTAATACTCCTAAAAAAGCTAATTTT
GAAAATGGTTTTGATATAATATTGGGTGAATTATCCAGAATCTTATTAAATAAAACTATTGAAAAAAATT
TTAAATTAGATAATATTGTTTCAAATTTAATTGATAATAATATTGAAATTGAAGATGGAACTAAGGAGTA
TATAACAAAATTGCTAAATGAATATTTATTCGATGAAAAAAATGATTTAAAAATATCTCATCCGAATTTG
TATTTATATATTCCTCTTTCAAATAATAAAAGTTCTAATGGAGAACAGGAAGTAGCATTGTTTTTAAGAG
ATATTTTTTGTAAGAATAATCAAAATCTTATTAACTTTTTTGAATCATATGATTCAAATCACATTATCTT
AAATTTAATTTTAAAAAATACTCCTAATTTACATCATAAAATAACTGAAACTAAGTATGTAATTCATTTT
GAGGAAATTGCAAATTTATTTAATGAAGATATCAATTATGCAATACTTTATAAGAAATTTTTTATGGAAA
ACATTGGTAATATTTTTGCTTATTACTATTTCTTTTATATCTCTCAATTAATTCTAAAAATTTCTAAAGG
CTTTAATGATAATAATGAATTTGAAAAATTGTACTATTTATTGGACTGGGAATCTGCAAGTAAAAATCGT
AAATCATTAAATAGTTATAGTTTACTAAAACATCATTCTAAACCATTATATGCAAAAATGGCAGTCATAG
ATCAAATAAATACACTATTAGGTACAAATAATTTATTGGAAAAAGATATTTCAGAATATTTTAATAATTT
GGACATCAATTCTAAAAATAATTTTTTACATTTTCTTAAAAAATGGGTTTCAGATTATAGGTATGTAAGG
AATTTTGATGATAAAGAATTACCAGATAATTTATTAGAATTAACTGAAATTCTTTTTGAAAGTTTAAAAA
ATGAAAAACTGGGTGTGGATGGAGCTGTACAATCTAGGTACGCTTTAAATCTTGAAGATATAGCTAAAAA
ATATTTGTTAAAGCGTAGAGGTTCGTATGGTTATGTATTAAATATTAATAGAGATATGTTGCTTGTTTTA
ACTGCATTATGTGTTAAAGATAAGAAAATTAAGTTAAATCAACTATTTATTGAATTTGAGAAAAGAGGAG
TTTATTTTGACAAATATTCAAAAGAAGAAGTAGTAAATTTTTTAACTAAATTAAATTTAATTGACAAGAA
AAGTGATAGTGGAGATGCTCAATATGTTAAACCAGTTTTATGATTATCTATCTAATAAATTACTAAATTA
TTTTGATGATACTAAGATTTTAAGTGGTGAAAAATTTTTCATTAGTTTTGATGAAGATGACCAAATAATG
TCTTTTTATAATAGTTTAAGAAGTATTGCAGAAACTAATTTTTCTTGTTCTGAATTCATATATGTCCATA
CTATTTCAGGAAAGGAATATAATACTTATTCCATAAACATTAATGGAGTCAAATTTGTCATTTCTGAAAG
TTTAACAATTAACGTAGATTTCTTAGTTACTTTAAGAAATCAAGTTACTTCTCAAGAGGGTGTTTGGAAG
GATACTGCATTATTAGTTATCTGTAATGAAGCAATAGATAGTATTGGAAAAGGTATGAGAAATTTACAGA
AAGAAGGAATGCCATTAAATGTAAAATCTATTTCAAAAAATTTAGAGGATGAAATTAACGATTCTCAAAT
TCTTAACTATTCCGATAAGCAAATCGCTAAGTTTTCTTTGAATATTCAAGAAGAAGAATTGTTTCAAACA
ACATTATGGGATTATGAAACTATCTTATCAATAATCAACAAGGGTTTTGTTAGTGATGAAGATTTAAGAG
AGTTGAATCTTTTTAAAGATGACCAACTAAATCAAAATTCTCCTCAAAAGATGTTAAAAAGATTAAAAGA
AAATTATGACACATTTAATGAAGTAAATAAATTTTCACAATATGGAGATAAAAAAGAACAGCTTAAAAAT
ATGTTTACTGATTCTGGAGTTTCTATTTTAAGTAAAGATGACTGGTATAAAGCAGAATGGAAAATGGTTA
AAAAATCAAAGGATGACTTTATTAATCAACAAAATCCTTTAAATTACAATGAAAATCTTGAAAAAATCAC
AGAAAATGGCTTAAATTATTGGGAAATTCCTAACTCATTTACTAAAACTGGAAAAAGAAAACGAAATATC
ATTGTTTTTAATCCAAATCATTCTCATGAAGTTAGTTTAAAGTTCAGTTTTGATCAGATTCTTAGTAATT
CATTCCTTAATACAAATTCAAAAAAATTCACTATTGCAAGAGGCAAATCATTAATAGTCAATTTTACTCT
GGATTCTAGTGAACCAATTTTCAAAACTATAAAATATAAACATAAAAATGAAAATATCTCTGAATTTACT
TTTAATATTGTTGTTTTGAATTTTGAGCCTGAAATTTTTAATTCTATTAAATCTCGTTTTAGTGTCAATG
TCAAATCTAAACAGATTATTGTAACAAATGATGAGGATAGTTTTGATATTGTTTTTGGTACTGGTTCAAA
AGAAATAGAGAAATTAATTAAAGAAAATGGTGAAAAGTTATATCTTTATGATGATGAATCTTTAATAATT
TCTGAACAATCTCCTGCTTGGAATGATGGAAAATTAAGTTTTAAATTATATAAAGACAATAATTATGCCC
CATTTTTGATTAAAGAAAAATCTAAGAAAACACTGCCAGTAAATTCCTATGTAATTTGGAATTTGAAAAG
AAGAAATATGGAAAACTTTATTTTTAATGGAGTAAAAGCTGTTCAAGATGTAAACAGTTTCTATCTCGTA
GAAGAATTTAAAGAATTTCTAAAAATGGAACGAGAAATCATTAAACAGGACATATTTTATGCTAAAAGGA
ATATTGATGGTTCTTTAGAAAAAATTGAAGTTTCATTCAGTAACGAGTTAGAAACTGCTTACATGGACAT
ATTTAATTATTATAAGACTTTTGATGATTCTCCAGAAGACAATCTTCCAAGTTTAGTTTATTTAAATGAT
GATTTAAAAGAGTTATATAAGAAATTTATAACTATCTTCAATAAGGAAATATCAGAAATTGAAGAGAATT
CTATTTTGTCTGATTTTAAATATAAAAAGAATTTGCTTAAGTTAGGTCGTATTGAAACTGATAACAAAAT
AATGTATTCTCCATTATCTCCACTAAATATCGCTTATCAATTAGAAGTTTCTAAACAATGCGGAAATGAG
GATTTATCCGTAAATATATTAGAACGGTTAGTTCCAAATAACTTAATTCCTTATATTTGTTCAGATGATG
GAAAAGAATTGTTTAGACCTATTTATCAAGAAGAAGCTCATGAATGGTTGATTTATGAGAAAAGTGAAGA
AGTATCAATTGGAACAACAAATGTATTTATTTCTAATGTTGTTACTGAAAAACTTAATCAATTTGTCAAA
CATTTTAATTACTTATTTAGTTTTAACAACTCCTCACCAATTAAAATTAACTTAATCAATATAAAAGATG
ATAAAGAAGTTGTGAAAGGAGTATTTAATTTTATTAGATCTAGATTGCCTGATAAAACTAAAACAAAAAA
AGTTATTCCTGTTGAAATCAATATTTACAACGACGCTGAAAAGAGTTCTTTTGACAATTTATTTGATTGT
CAGTCTGAAATTCAGTTACTGGAAGAATTTGGAATTAAAAAATTAAAATCAGATATTTTTGATCCTATAG
ATATTATCCATATGATTCAAAATAATATTTCATATTATAAACATCCATTTAAAAAAGAAGAATATGAATA
TGCTCATCTTTCTTTCTATAAAGTCAAATCACATAACAATATTGCAAATGACAATATGGATAAAATTGAA
ACTGGATTATCTTTAAACGGTTTATTATCTTCAGTTACATCAACTACTAAACATTCAGAATATAGAACGG
GTTTCGGTACAAACAATATTTTAAATATGAGTAATCCTCTTATTAAAACAGTGATTAACTTGAACGAACT
TGTTGAGAATAGCAAGAACTTTGGAAAAAATACTTATTCAAAAAATAAATCAGTTATCACTACTGTTGAA
TTAGAAGAAGACAATATTGAAGAATTGTACGACAAATCTCATTGGGTAACATTTATTGAACCTACATTTG
GTATCGAATACTTTGACAGTTCTGATAGTAATTTGATCATTATTCATTACAGCGATCAATATAGTTCCTC
TAGCAAGTATGATACTATTACTGTAACTAATAAATCAACACAATATGAGGAAATTATAAGAGATTTCCTC
CAATCTAAATATGTAAAAGTTACAGATGAAGAATTGTATGATGTAATAAAGATGTTTAATTCAATTAATG
GTGAATGGTTACTTAGAGTAATTTCTAATTCCGGCCATTATGATAGGGAAAAATTAAGTATTATTTCTGC
TATTAAATATTGCTTATCCATTTTGGACCATAAAGATATTGTTTGGATTCCAGTTTCTATGGAAGAAATC
TTAAGAATTGCAGGAAATGTTAAATTAGATAAAAATAAAGGAATTTTTGACTCTAAGTTAATAAAAGGAA
ATCATAGTGATGATCTGCTATTCATTGGTGTAAAATTCAATGAAGATAATAGAATCGAAGTTATATTCTA
CCCAATCGAAGTTAAAATAGGTTTGAATAATGCTTCAACTATTAAAAAAGGTAAAAGTCAATTAGATAAT
ACTTATAAACTTCTTAAAACTCAACTACAAAATATTAATGTAGAGAATTCTGAATTTAGAAATAAATTCT
TTAGAAATTTCTTCATCCAAATATTATTGTCCAATGAGCAAAAATTAGTAACTAATCATATTTGGGATGA
AAAAGGATTGGATAGAATTGAAGAATTCAAAGCAGAACTATTAAATGATGAATATGATATTTTATATGGT
TTAGAAGAGTACATTGGTAAAGGTTCTTTGGTTTCATTTAAAAAAGAATCTCATCACATCTCTATCTATA
TGGATGTTGATAAGCAAGTAATTGAGTTACCAGAAGATTTTGCTTATTACGGTTTAGCCACTCCTATAAG
AGAAATCCATGATGAGATTCAGTCAGACAATACAGATATTCTTGCAGAAACATTGTTATCACATGTAGAT
ATAAGTGAAATTAGAGCAAAGAATAATGATATATGCGATTCAAATGAGGATATGTCAATAGATGATGATT
TTGATAATTTAAGTGAATTTGAGGATAGTTTTATTGAAGAAGAATCAGAAATTTCTGAAGAGCCTGATGA
AGAATTAACTGATGCAACTTCAAGCAGTGATAATGAATCAATTGAGAATATTGGAGAATCTCCTTCTAAA
ATTTCTAATGTCAGAGCATTAATTGGAACTCAGAAGGGTTATAATCATAAAGTTTATTGGGAATTTGGAC
ATCCTTCTTTAGCAAATAGGCATATGTTAATTCAAGGAAAATCTGGACAAGGTAAAACATATTTCATTCA
ACGAATGTTAAAAGAGTTGTCTATTCAAGGCATTCCTAGCATAATTATTGATTATACTGATGGATTCAAG
CCTTCTCAATTAGAACCTAATTTTAAAGACTCTTTAGGAGATAAAATAAGCCAATATTTTGTTGTAAAAG
AAAATTTCCCAATAAATCCATTTAAACGAAACACTATCATGATTGATAAGGACATATTTATTGAAGAAGA
CAACAGCACTATTGCGAGCCGATTTAAATCTATCATTAATTCTGTTTATGGGCTAGGTATTCAACAGTCC
AATACTTTATATCAAACAGTTTTAGATTGCTTGGATAAGTATGATGATAATTTTGATTTGAATATCCTAA
AAGAAGAAATTCTAAAAGACGAATCAAATAGTGCACAAACAGTCTTGAATAAATTAAATGAGTTATTGGA
TAAAAATCCGTTCGCATCCACTGATTTCGACTGGTCTGTCTTAGATAATAAAGACGGTAAAGTTTACATT
ATCCAATTAACTGCACTTTCTAAGGATATACAGACAATTATAACTGAATTCATCCTTTGGGATTTATGGA
ATTACAAATTAACAAATGGTAGTGAAGATAATCCTTTCATTGTTGTTTTAGATGAAGCTCATAATCTTGA
TTTTTCCAATGACTCTCCATGTAGTAAAATTCTTAAAGAAGGCAGGAAATTTGGATGGTCTGGGTGGTTT
GCAACACAATCTGTTAAAGGATCTATGAAAATTGATGAAATAGCTAAATTAGAGAATGCAGATGAGAAGA
TATATTTCCATCCAACGGATGTTTCAACAATAGCTAAAGATTTGTCAAAAGACAATGAAGATAAAAAAAT
ATATGAAAAAGAGTTATCTCAATTGACAAAAGGATATTGTATTGTTCAAGGGTCTGCAATAGATTCAAGT
GGCAATTTGTATCAGCCAAATCCTGTAACTGTAAAAATTGAGGAGATAAGTTTTGATGAAAATTAATTTG
ATTGAATAAAGTATTATAGTTTTTTTGAGGGTTAGATATGGAAAGTAAAGACAGAATAGAGAATACTATT
TTCAATGATAAAAGAATGGATGCTTATATAGACAAATATTTTGAAGAGTTTACTCTGAGTTCTGAACAAG
AAGAGGCACTGAATATTTGGATAGATAAATTAAATAACGATCAATTAACAAGTGAAAAAGGGAATTATCA
TAATTTTTTTGAAATTATTCTTGAAGATTTACTTGGTTATAAACGTTCTGATGTTAAACATGAAGAGAAT
ATTGGTGATGAAGGCCATCCTGTAGAGTTTGTATTAGAAAAAGATGGAAAAGATTATGTGATTATAGAAC
TAAAAGGAACAACTTATAAAGACCTCACTAAAAGAAGACCTGGACAGCAATCACCAGTAGAGCAAGCTAC
AAATTATGCTAGTGCTAAAAAAGAAACTGAATGGGCTACAGTTTCAAATTATGATGAATTTAGATTTTTT
AATCCAACAGCAAGAGATAATTATATTTCATTCAAGTTTAGGCAATTGAAAGATTTGGAAATCTTTAAAA
AATTTTTATTAGTATTCAGTAAATTTTCACTTATCGATGAAGACATACCTAAAAAATTACTTAATGAAAC
AAAAGTCATTGAAAGAGAATTAGAAAATGAATTTTATCAATTGTATAGTGACACTAGATTAATGATTATT
AAGGAATTGGAATATTCTTCAGAAGATATTAATAGGATTGAAGCAATAAAATTATCTCAAATAATATTAA
ATAGATTTATTTTCCTTTGTTTTGCAGAAGATTTAGCGCTTATGGAGGAAGAGACAACTGCTGATGTATT
ATTAACACCTTTAAAGCATAGAAATTTAATCGGAAATACAATGTGGAATAGGTTAAATGAATTATTTATT
TTTGCAAATCAAGGAAATAAACATAGGAGAATACCTGCATTTAATGGAGGATTATTTGAGGATGATTTAT
CTAATTTGAAAATAAGGGATGAAATTGAAGATAGGTCTTTCTTTGAAAATTGGAATTTAAAAGAAGATTT
TGAAGACAAATATGAGGATATTGCTAAACTAATTGGAGTTTATAAAGATACTCTTAATCCAATTTTCATT
AATTTATTAATAATTTCTACATATGACTTTGATTCAGAACTTGATGTAAATATCTTAGGACATATTTTTG
AAAACAGTATTAGCGATATTGAAGAGTTAAAAAATGATAATCAAGAGCAAAGAAAAAAAGATGGAGTGTA
TTACACTCCAGAATATATTACAGATTATATTTGTAGAAATACAATTATTCCATATTTAAGTATTTCTGGT
AAAGCCAGCACAGTTCATGAATTATTATACGAATATGAATCATCTAATTCATTGGATGTTTTAGATTCAA
AATTAACTAACATCAAAGTTCTAGATCCTGCCTGTGGTAGTGGGAGCATGTTAAATAAATCAGTAGATAT
ATTATTTGAAATTCATGAAGCATTACATGCAAGTAAATATGCTGGAGATTCATCTTTAGATAGATTTTTT
GATAGTTTAGAAAAACGAAAGGAAATTATAAGTAATAATATTTATGGGGTTGATTTGAACGAGGAGTCCG
TTGAAATTACTAAATTATCCTTATTCCTAAAATTAGCAACTACTGTTGGACTTAAAGAAGGGTTTCAACT
TCCTAGTTTAGATAAACATATTAAATGTGGGGATTCATTAGTGGATGATGAGTCAATTGCCGGAAATAAA
GCATTTAACTGGTATGAATCATTTTCAGAAGTTTTTGAAAGTGGCGGATTTGATATTATTGTAGGAAATC
CTCCGTATGTGGATATTAAAGAAATGGATGAAAAAACAGCAAAATACATATTTGATAATTATGAAACTTC
TTTTAACAGGATAAATTTATATTCTACATTTGTGGAAAAAAGTTATTATTTGCTAAAAAATGAAGGGATT
TTTTCATTTATCATGCCTAATTCCATTTTATTTAATTCTACTTACTCTAAAATCAGAGAACTAATTCTTA
ATAATACATCCATATTAAATATTGTAAGAACTTCTGATGATGTTTTTAAAGATGCTAAAGTGGAACCTAT
TATTTTAATCTTCAAAAAAGGATATGATGAAGGAAATAAGACTAAGATACTTATAAAAAAAGATGATATG
GATGAAATTCCAATAAATAATTATTCAGAACATTTCTTTACACAAGAAAGATGGTTTGAAAATAATTCAA
TAATTAATATTTTTTCAGATGATTTTACTTTTGATTTATTAAAGAAAATTGATGGAAATAATGAAAGATT
AATTGATTATTGTGATTTTAGTTTAGGTTTAACTCCTTATGATAAATATAAAGGTATGAGTGAGGATATT
ATTAAAAATAGAAAATTCCATTCAAAAATAAAACTTGACGATACTTTTAAAGAATTATTGGATGGGTCCG
ATATTACAAGATATAATGTAAAATGGGGCGAAAAAGAATATATTAAATATGGGGACTGGTTAGGAGCACC
TCGGGAAGAAAAATTCTTTAAAAATCCTAGAATTTTAATAAGACAGATTTTATCTATAGCTCCTAAGGAA
TCTCGAAAAAGGATTTTTGCCGCTTACACAGAAGAAGAATTATATAACGCTCAAATTGCTTTTAATTTAG
TATTGAAAGAAGGCTTTGATGATAAAAATTTATTGAAATATTTTTTAGGAATAATTAATTCTAAAATGAT
GACTTGGTATTATGAAGAAAGATTTATGGATAAAAATAAAAAGAATTTTGCAAAAATTTTGATTGAAAAT
GCTAAAAATCTTCCAGTCATTATTAATTCAAATTTTTTAGATGAGATAGTATCTAATGTGGATTCAATAA
TAGAGTTAAATAAAGAGTTTTATAGTGTAAGAAATGCATTTCAAACATGGCTTAAAATAGAATTTGAAAT
TGAAAAACTCTCTAAGAAACTAGAAAACTATTATGATTTAAACTTTGAAGAATTCTTAAAAGAGATAAAA
AAGAAAAAAGTAGTCATTAGACCAAATCAAATACAGGACTTGTCCGAATTATTTAATGAAAGTTTAGGAA
AAATAGAATATCTGCAAAGAGAGATTAAAGAAGCAGACGAAAAAATTAACCTACTGGTCTATGAATTATA
TGGTTTAAATCATGAAGAAATAGAAATTATAGAAAATAGCTTTAATGATTAATTTATGGACGATGAAACA
TTAATCCTAATTGAATACATCAGAAACGCGCCAACAAGAGAAATGGTGCTTAAGTCATTTGAAGGAGTGG
ACTTTATAAGACCAATCCAAATTTCTAGGAAAACAGGCATTCACCCAAACAATGTCAGCAAGAAATTAAA
GGATCTTCGCGAACATGAACTGGTCTATGTCATAAATCCTGAGTACCATGTTCCTAAACTTTACAGGCTT
ACTGAAAAGGGTAAAAATATGCTTCAATTCTTGTAGAAAATCAACCTTTTTTCAACAAAACTCTTTTTAT
TTATGGATACATGTACATGCCTTCACGGTTTTACAGCACTTTCACATTTTTCAAAAAACATAATTTTAAA
TATTAGTTCGCATATATTAAAATTATATATTATATTATTTTGACAATTGCAAAAATTTTAAATTTTTGTT
ATATTGGGGTCAGAATAAGGATAATAATTAATTATATTGTTTTTATTTTTTTAAAAAATAGAAATTTTTT
CTTATGAAAAATAAGGATTGGCAATTGCCTTTAAAAAAATAGTGGGTTTTTTTTTTTTAAAAAGTATCCT
TTAAAATAATAAGAAATATCTTCTAAACTAATAAATGGAATAATTAGGAAGAATAAAAAAATAAAATATG
AAAAGTAATTTAAATTACTTTTCAAAAATTAGAACTTATTTTATAGTAAGTTTAGCACTTGCACTTACTG
CTTTGTAGGTGTTGTCACCTGCATATTTAGCAGTGAAGCTGTAAGTTCCTTTCTTATTGATACTTACTTT
AACAGTAGCTACACCTTTAGAGTTGGTAGTTCCAGTGTAAGTTTTGCCGTTTACAGTGAAACTGATCTTC
TTATTAGCGATTACACTGCCTTGTTCGGTTTTGAAGGTAGCGCTAATGGATTTGGTTTTAGCGGATGCTT
TGTAAGTAGCAGCTTTGGTAGTTAATTTAGGAGTTTGAGCGGCTACGTTAATTAAGTATACTCCAAATGA
TGCTTCATATTCATCGTCACCGAGGAATGCTACAGCAAAGGTGTATCCTCCTTTGTATCCTAAATTAATT
TTAAGTTGAGCTACACCATTTTCATTTGTGGTTTTAGTGTATTCTTTACCGTTAAATCCAATTTTGACTT
CTTTGTTTACTAAAGGATTGCCTTCTGCATCAAGTAAGGTTGCGTTGAAGTAATTGTCATTTGTGTCACC
GGTATTAGGTGCTAAAGTGACAACTGACATATTGTTAGCATTGATTTGGGTAGCTGTTCTTTTAGTTGCA
GTGTTTTTGAATGAAACTTGAGCGCTGCTTGCAGCAAGGTCGTTAGTTCCGGCAAATTCAACGGCAACAG
TTTGGGCAGTAGCGTTTTCATCAATTGGTACATTGATTACAGCCTTACCGTTTTCATCAGTTTCGATTTC
AGTTGCATTTCCATCGTCGATTTTGTAGGAAAGGGTTTGTCCTGCTTGAGGAGCGCCGTTTACGTCTACC
AATTCAACAGTGACGGTTCCATCTGCTGCAGCGATTTCTGCAATGTTGATGGAGGTTACTGCTTTATCTG
CTGCAGGAATTACAGTACCATTTTCATTGTCCCAGTCAGCATACCATACGGTTACAGGGGTAATGCCTGC
GTCTAAGTTGTTGTTAACGATTGCAATAGGTGCATATGGGTTTAAAGGACCAGAGTTACTTAAGATGTAC
ATGAAAGTAATGCCTTCAGGATTAGCCCCTGCAGTTGCGGTAATGGTGTTGCCTGTAATGTTTATGTCAC
CGATCTTACTTGGGTATCCGTGTGCTGTGTTACCTGATTCAGCTTTCATAAAGATAGATCCTTCATTTGC
TTCAATAGTGTTATCAGCAATGATGTATCCGTTAGCTGCTTTTTGAGTACTGATTATAGGTAAATCTTTA
AAGATTACGTTTCCTTTGTCATCAACACAGTATCCGCATCTGATGAAACTGTTGTTAGCGATTACACATC
CTTGGGTGGAAGCTCCACCGAAGTAGATAGCATAACAGTTGTCGATGAAAGTGTTGTCGGTCATGATGTT
GTTACCTGAGTTACTTGCAATGGAAATAGCGTCAAGAACTTGTCCTTCAAAGGTACATCCGGTTACGGTA
ATGTCGTGGGAACCCATAAGGTTAATTGCTTTAGTACCGTATTCTTTTTTACCGCCGTTGGTTACTTGTT
CGGATGAACCGTTGAAGTAAGAGTTGGTAATGCTACAGAAAGATGCGCCTTTACCGTATACACCGCTACT
CCAGTCGATGAATTTACAGTTGTCTACAGTACCGTTTTCAATAGCTAATTGGATAGCATATCCTGATACT
TGTTCTCCATAGTTTTTGTGGCCGTCAGTGTTAATGAAGGTAATTCCTTCAAAAGCAGTTCCAGCTTCAT
TTGCAATGAAGAGTGCTCCGCTACCACCTTGGGATGCACCGCTAGCTTTAATGACAGTGTCTTGACCTTT
GATGGTAACTTGTTTAGTTACATTAAATGTTGTATCAACGTCATATGTCTTGTTTTCTAATTCAATTGTG
TCTCCAGGTTTAGCATTATCAAGCTTAGTTTGGATGTCTTGTGCATCAGCACTAGCTGTAAGAGGAGCAA
CTTTTTCGTCTGCAACATCGTCTACATCTGCAGCATCGTTTATATATGTGACATCAGCATCTGCTGCTGC
AACTGCAGAGACAGAAATAGCTACTAATAATACTAAAAGGAGGGATAAGATAATTTTTTTATTCATATTT
TTTCTCCATTAATATTAAATCAGATTTTTTAGATCTTATTTTTAAAAATTTAACTTGTTTTTCTTTTAAT
TAAAATGTAATAAAATTACTTTTTAAATAAAAACTAATATTAATATTCAAATTCTTATTATCTTTATTTT
CAAAAGATAATTGCTAATTTAATTGATTTTATCTAATGCTAACTAGTTAAACGATTTAAATAACTTTAAG
GGAATTAGTTAAGCTTTAACTAAAAATTGTTTAAATTATTAAACTTAATCAAATAACAATTATTTTATTA
ATATTAGTAATAATATGTTTTGTTGATATGCAATATATATCTTATGGTTATAATTATTTTTGTTTATTTC
TTATAATTTATATTAATATTTGTAATTTTTTATTAAAATTTAAAAATAATAGTTTATTTTACTTTAATAT
ATTTTAAAATTTATTATAATGTTTATTTTTCAATTTAAAGTTTAAAAAGTGATATGAATTATAATATTTT
TAATCTTATTTTATTTTAAAAAATTCTTATTTTTTTAGAAATTTTCATCGATTTATATGTATTTTTTATA
TTTTTTCATTATAATATGAAATATATTTTAGAAAGATATTTATATATTGAATAATAAACTACAGTTCATA
TTAATTATGTTTTAATTCAAGTTTATATCCTTTTTATAATTGTTATAAACTTTTATAAATCGAATACTTT
AGGGCTAATTTAACCATCAAATATCGATATTTTTCTATTGATTTGTATCATAAGGTATATGGTTAAGCCA
AAAAACTATAAATTTGGTTTATATTGAATTTTTATATTCTTGGCAGGAGTTTTATTATTCTAATAAATTT
TCTGCCAAATTATGTATTATATTGTTAAATTAAAAAAAAGGACAAATGTCGTTATCCATATTTGTTCTGG
TTATAGGAGGTGGATTTATTAATAAAAGAATATTATTAATATTCGTATTTCTAATATTCTTCATAAGTAT
TGGATCTGTAGTTGCAAATGATTTAGATTCAAATTCAGTCAATCAAGACAATTATATTTCTGATGTAGAT
TCTTTTGATGGTTCTAATTCGGTTTTGTCCAGTTCTAATTTGGATAGTTCTATTGATAAGGATAATTATT
TAAATTTAGATTCTAATAATAATTTAAATTTAGATTCTGATAAGAATTCTGTTTCAGGTTCTGATTTGAA
TTTAAATAATGCTGATTTAATTAATTCTGTTTCAGGTTCTGATTTGAATTTAAATAATGCTGATTTAATT
AATAATTCAACTACTAATGATTCAAGCAATTCAAATAATTCAAATAATTTAGAAAATCTTACTAATTTAG
ATGATTCTAAAGGTGCTTCTAATCAAAAGCCTCAAAAGTATCTTATTCCTAATGACAGTTCTATAGGTTC
TGCATATATCCAAAAGATCATTGATAATGCTGCACCTGGAAGTACAATTCAATTTACAGGTTCCTTCTAT
AAAAATATTTATCTGAAAATAGATAAAGCTCTAAACATTATAAGTAAATCTGGCACTGTGATAAATTCAA
GCTATCGTTTGCCTGTATTTACTATATCAAGAGGAGGATCTGGAACAAATATTTCAGGTTTTACAGCAAA
TCTTGCAAATTCCTTTGTAGAGGCAAGTGATGTGTCCGATATAAGCATATCAAAAAATAAAATCTTTACA
AAACGGAAAGCTATTGTCCTCGAAAATGTTTTTAATTCAAAGATTGTAAGGAATAGTTTCCTAAGATTTG
AAACTGCCATTGACATTTCAAAATCTGGCGGATTGACCATATCCAATAATAATATAACTCCAGATAACGG
ATACAATGTGGGAATTAGCTTAAAAGACATTTATAGAGACAAGGTTAGCATATTAAACAATAATATCACT
GGCCATGACAGACGTATAGAATCCACAGGCATTTACTTCGGGCCAAACGCTAAGAATGTATTGATTGAAG
GAAATATTATAGATGAATGGTATACTGGTGTAGATTTCCCTAATTCTGTAAATAATGTTTCCATTTTAAA
CAATACCCTCAATCACAATGGTGATGGAGTAATCATTAACGGATGGATTAATAATTTCACTTTTAATAAG
AATGTAGTCACTAATACTGGAAGAGTTGGAGTTCTATTTGACTATGATTTTTATGGAACAAAAGGGGATT
TCACTTTAGAGAAGAATTTCTTTACCCAAAGCGGACAGTTGGATTTAAGAAACACTGGAGACCAGGCAGT
AACTATTGGTGAAAACTTTGCTAGCAGACGTTGTGTTAGGGTTGCCATGAAAAATGGATTTTCCATTAAA
ACCCGTCAAAATGGAAATGGCTATTATTTCTCAATTGTGGATAAGAATTCCAGGGGAGTAAGCGGGCTTC
CTAACTTTAGTGCTACAATCAGCATCAATGGAGTTTCCTATAATGTCAATTTCATAAATTCTGTTGCTTA
TGTTGAAGTTGATGGCGCTAGCGGCGAAAATGATGAGGTCCTTCTTGATGTTGGTGAAGACAAGCGTAAG
CTTAGCGATTGGGGAGAGACTCAAAATCTTAGTTCCAGTGAAATGGAATACTATAAAAAGATTTATGATG
ATTTGATCAAATCTATGGTAGAAGAGACTAATAATGATAATCAGGACATGAAAAAGGTAGAAGATAAGAA
TGGAACAGGCTCCACTCCAAGTGGTGGAAACGGCGGAGGCGACTCTGGTATTTCAGACGGTCGTTCTTCT
GTAAGTTCAAATGGAGATTCCTCTCCTGCAAGTGCAGGAACTTCTAATGTGGCAGCAAGTTCTGCATCTT
CATCTGCGGGCCCTTCTGCAGCTCAAGCAGACACTCCTGAAAGTTCTACTGTAAAATCATTGTCACTTGA
TGAGGAAACCTTTAGAGTTGCTGGTGTTGGTGGATTAGTCTTCTTGATTATTTGTGTAATTGGATTATAC
TACCGTGAAGATATTATGGATATGATTAAAGAATAATAATTGCTTAAATTAGTTATTATTCTTTTAAATT
TTATTTTTTTCTTTTTTTATAAATTTTTACTTACTTTTTATTATTTTTACTTATTTTTATTCATTTTTAC
TTATTTTTATTTACATTTATTCATTTTTACTTATTTTTATTCATTTTTACTTACTTTTTCTTATTTTTAC
TTAGTTTTTCTTCATAATTTGGTTTTTTTGCGATGATTATCCAAATATTTATATTCGAGCATAGAAATTT
TATATATTTTCGATATGTTTATATAATCACATTTTAAATATATTAATGATTAAACTAATATGTGATTAAC
TATGATGGATTTAATTTTTGAATATCTGATTGTTTTTATTTTATTATTTGCCACAAATATAGCATTTTTA
CTAAGATATTCTAGTTTTAATAAAAATAAATTTATTCCATTTGTTTTAGGCTATGCTATTATAGTATTTG
CATTAACTTTTGTATTTTCTTCCTTGAATTTACAAAAGGAATCCATAGATTTTATTCCGTATATTTTATT
TGCTGTTAGTGCTTTAATGCTAATTATTTCAATTCGATATGTGGGATTTGGAAAGAATTATGGAATAAAT
GATGATAAAGTTGTTTTATATGGCACTATTTTATCTTCATTCTTATCTATTGGGGCATTGGCTTTAGGTT
TAAAATCAGATAATCTTTTCTTATCTGGTCTTGAATTAGCTATTCTTTCTGTTGTAGTTATCTTTTTAGT
TTATAAAATCTCAAAAATATTCAACAATGCTAAAAGACCATATTATGCAGTCATTGGTGAATATATGTTT
TTAGAATTTATTTTGCTTCTTATTTTAGCTTTAACCTTCTCTAGCGTAAGAGAATTGGATTATTCAATGT
TTGGATCTTTTCTAATTCTTACTCCTACATATAAGGTGCTATATATGATTATAGCAATTGTCATTTTGCT
TGTTTTAGGGGTTTTATATAATGATTGGGTTTTAAAAAGGCTAAAAAGGAAGTAATTCTTTATTTATCTA
TTAATTGTTAATTCTTTTGTTATTTGTTAATTGCTAATTGTTATTATTGTTACTTTAGTTATATTGGCGA
ATTTAATTAGAATTTTTAATATTTATTTATCAATTTATTATAATTTTTATAGGTGTGAAAATGATACTTC
AAGGTACGGAAATATTGACTTCGTTTATCCATATTGTTTCTGAAAGCTTGCTGGCACCTGTTGTAATTGT
TTTAGTTATATTCTTAATCTATGCAATTTTAAGCTTTGGCGGATTTTTAAATGAATGGTTTACAAAAAAG
CCATTGAAATCTGCAGGATTGGAAAAGTTATTGCAAGACATTTCAAGCTCCGATAGTCCTGAAGACTTAA
AGGCTGTTATAGATGCCAGCGCTTTGTATAAAGAGCAAAAAGAAATTCTTGTAAAGATAACTGATAATTA
TAATTTAGGTCCAGAGGCAAGAAAGGCTTTTGCAAGTAAACTTATTGAAGAGGAAGAAAGCAATCTGCTT
AAATTAACAACTAAAACAGATATTTTAGTAAGATTAGGCCCTATATTTGGTCTTCTTGGTACTTTAATAC
CATTAGGTCCTGGACTTTCTGCTTTAGGTACTGGGGATATTACCACTCTTGCCCAATCCTTGACAATTGC
TTTTGATACAACTGTCACTGGTTTGACTATTGGTGCATTAGGTTATATTGTTTCTAAATATAGAAAGCAA
TGGTATGAAAGTGATTTGACTACAACTGAGACAATTGCAGAGGCTATTTTAGAAAAATTGAATCAGTTTT
AATTCCTTATATTATATTAATTAATTTGGATGATTGGATTAATTTTTATAGCATAAAATGGTTTATTTTA
ATTATTTGATACACATTTAAGGTGATTAAATGTTAAGAAAAAGAAAACGTTTTAGTGATGATGGCGATGA
GGATCCTATGTCTGGGATTTCAAATCTTTCAGATGCAATGCTTGTGCTTGCTTTAGGGTTTTTGATTTTT
GCCATTATGGCTCTTCAGGTAAATCCTGATATGATGGCTAAGACTCAGGAGTCTCAAGCACAACAGGCCA
CTTCTCAAGTGAGCACAGGTCAGGACTTTAATAGTAGTGCCAATGCAGGTGCCTCTTTAGAGCAGTCTGG
TTATTCTGAGGTGGGAAAAGTTTATAAAGATCCTGATACTGGTAAATTAGTCATGGTTCAGGGTTGACGT
AAATTTAAAACTTTTTTCACTATTTTTTTATTTTAGTTCTTTTATTATCTTATTTTTATTTTTAGTTCTT
TTTTTATCTTATTTTATTTTTAGTTCTTATTTTTATATGGTTCTTTTTTAATATTTTGTTATTTGATTTA
TATTATAAAATAATTATAATATAATTGCTAAAAAAAGTATTATTTGGGATATATTGGTGTGTTTGAAAAG
AGAAAAAAAGTTTTTTTTTTTAAAATTGCTAAAAGTTTAAAACATTGCTTTAAAAAGTTTAAAGTAAGTT
TTTTTAAAAAAAGTTTAAAGTAATTTTTTAAAAAAAGTTAAAAAAAAGTTAAAAAAAAGAATCAAAGTAA
ATAAAAGAACCAATAATCAAATCAATTCTCTATTTACTTAACAATTTTATTTTATAACCACTTTTTGAGA
TTTGCTAATAGCCTTATAAGTATTGTCTCCTGCAAAATTAGCTGTGTAAGTGTAGGTTCCTTTTTTAGTT
AATTTTATGGTAATTGTAGCGATTCCTTTTGTGTTTGTTTTTCCGGAGTATGTTTTTCCATTAACTTTTA
TGGTAAGCTTTTTGGACTTAAGCACAGTCTTGCCGGATTTGAGAGTGACTTGTATTTTCTTAGTGGCTGC
TTTTTTGAATGTGTACTTCTTGACAGTCAAGTTTGTTGAAAGCGGATTTAAGGTAAGCTTTCCCTTTTTT
GGAAACTGAATTATAGATATTGTCCCCTGCAAAACTTGGGCAGTGAAAGTGTATGTGCCTTTCTTGCTTA
GGCTTATCTTAGCGCTTGCAACACCTTTTGAGTTTGTTGTTGCAGTGTATGTTTTTCCATTTACAGTGAA
AGTGACCTTCTTATTGGCTAAAGCCTTATTGTTTTTGTCTTTTAAGGTAGCAGTTAAAGTTTTTGTTTTT
GCATTTACGTTATAGCTAACTGTCTTTGGAGTGATTGTGGCATTTTTCTTAATGATTGTCACAGTTGAAA
CGTCAAATGCACTTGCATAGCTTTCATCACCTAGGAAGTAAACTGCAAATGTGTAAACTGAAGTGTAAGC
TAAGGTTAATTTTACCTTTGCTATTCCATTTTCATCGCTTGTCCTATCATAGATTTTGCCATTGAATCCT
ATCTGAATTGTCCTGTTGATTACAGGATTGACATTTTGATCTATCAATTTCACTTCATAATAGCTTGGAG
TGTCATTAGTGTTTTTATCATAGGTTGTAATAGTCATGTTAGGGCATATTAGGGCGGTATTTAAGATAGG
GTCCGCCTTTTGAATAACAAAGTCGTCTTTTAATACGTAATCGTTATTCTTAAGGGTGTTTATGCCGTTT
AGCTTGTTGCCTGAAACCAATACGAATCCTGTACTTTGACCTGTTTGGCCTACTGTCCTATCGGATTTTA
TATTAAGAAGCACTGTATCATTGATATTGCTGTCTGGATTTATAGGCAAGATTGTACAGTTGCTTATTTT
TATATTGGCAAGATCAATATAAGTTGTGCCGTAATTCTCTCCATTTGCAAGCACAATGTTTTCATTTCCA
TTTACATAAAATGTAACATTGGTAATTGTTATATTCTTTGGACCTCCTTCAGATTTAGGATCTATTATAA
ATAGATCAGTTAAATTGTTCTGATTGTATATATTTCCCCCATTGATTGTAAGGTCTTTATTCAAGCTAAC
TGACTTTTCTAAGGTGAAGTTCTTATCAGTTAAAAGGAGACTGTCTCCAGGCTTTGTATTATCGAGGTTT
ATTGCCTTTTGAATGGAATTTGCATCGCTTTTTCCATCTGTTGATGGTTTTACAATCCAATTGTTTCCGC
CGGTGCTGACTCCATCTGAAAGAGATTTGTCATTAATGTCTTTGCTAATGTCTTCTGTAGCAATTTCATT
GATTGAATTGTCATTGGATGAAATTGAATCTTGATTGTCTGCTATAATGTCTGCTGCTGAAACTGCAGAG
ACAGATATTGCAATCAATAGGACCAATAGAAAAGACATTATAATCTTTTTATTGTTCATAATTTTCCTCC
TATTAAATTCTATAGGGTATAAATTTAGAGTATAAATTTTATTATAATAATAGTTTTATGTAATAATATT
TAATATTCATTTTTTAAAACCTATTAAATATTATTTAATTTTTTTATATTCATTTATTAAAACCTATTAA
ATATTATTTAATTTCTTAAAATATATAATATTAATTGTAGATTTTTTGTACATTAATGTTCAATTATTTC
TATTTTTTACATATATCCTTATGTTTTAACTTGGTTTTATTTTTTAATTTATCATTATTAATCATGATAA
ATATTAGTTCTATTTGTTATTTTTATAAAATCTGCAAATGTTTAGTTTAACCTAATTAATATATCGTTTT
TTATATAGTGTTTCATGTCGTTTAATTTTTACTTATTTTTAGCTTTTAAGTTAGTTTAACAATTATCTAA
CAAATTTTTTTTTAATTTTTTTCAATTTTATAAAATATTCTTGCATATCTTATTTTTTTTAAAAAAATCT
TTCTTTTTTGCGAAATGAATAATCATATATATTAATTTATTATCATTTTTATCATATTTAAGCGTTTCAT
TTTCTTTATTCCTATTATCCTATTGGTTTTATAATATTCGATATAATTATTATTTCATATGGTTTAAAAA
GCATCTTCTAAAAAAATAATTTTATCCTTTAAAATAGATATTTGTTCATTATTTATTGGTATTTAATCGT
TATGAACTATTTTTTCGTTAGAAAAATTTTACACTCTTCATATATAAGTCTTTTCTTTTGATTTTAATAG
CAAAGTCTTTTTATATGAATGATAAATAATTATAATTAATGCTCTCTTTATGTGCACATATTGAATATGT
GTTGAGAGTATTGATAATTATATGGGATAATTAAAATAAAGAAGTTGAGATATAATGAGTTTTAAAAGTC
CTGCAGATACTGCAAAAGCAGTTGCATCTGCAGCTACCGCAAAAGGTGAAATGCCTATCATAAAACTTGC
TATTTTAGGTTTCTTAGCAGGTGCATACATTGCATTCGGAGGTTTACTTGCAGAAGTAGCAAATACTGGT
GCTATTGCTGGTGGAGTTCCAGTAGGTATTTCTAAATTATTATTCGGGGCAGTGTTCCCTGTAGGTTTAA
TTATGGTTGTTATCTGTGGATCTGAATTATTCACTGGTGACGTAATGTTTATGACTATGGGTCTTTTAGA
CGGTAAAACTGATATCATGGGCTTACTCAAAAACTGGGTAGGTAGTTGGGTATTCAACTTAATCGGTGGT
CTCTTCGTTGCTTACGTACTTGCTTACTTAACTGGTATTATGGTACCTGAAGCATTCGCTGGCGGTGCAA
TTACCATTGCTAACACTAAAGCATTAGGTGGAGCTACCTTCATGGCAGCTGGTAAATCAACTGCTTCTTT
AACTTGGGTACAATGTTTCCTTAGAGGTATCGGTTGTAACTGGTTAGTATGTTTAGCTGTATACTTAGCT
AACGCTGCTGACGATGTAGTAGGTAAATTCTTCGGAATTTGGTTCCCAATCATGGCGTTTGTATGTATTG
GATTTGAGCACAGTGTCGCAAACATGTTCTTCATCCCATTAGGTATCTTCTTAGGTGCTGAAGTAACCTG
GGCACAATTCTTCATCAACAACTTAATTCCTGTAACCTTAGGTAACATCGTTGGTGCTGCTGTATTCGTA
GCATGTGCTTACTGGTTCGTATACTTACGCGACTAAATAGTTTATAAATATTTGGCTTTAATTAGACTAA
AATAAATATAGACTATATAAAAATTATATTTAAGAGATTTTCTCTTAAATCATAATTTTTTAAAACCAAA
AATTAAAAATATAAATAAAAAATATTTTTTATTTGTGCTTTTTTAAGTATGAATAAATGGCAATCGGGAT
TTAGATCTCGAATCTTTAATCCTTGATTGCAAAATGCTTATTGGAGAATATTTATCTTGAAACCTAATAA
ATATTCTCATATCAATAAGTGATCTTAACAATTCAATAATTATATTTATAATATTTATAATAAAGTGAAA
TCAATTGGAGTTTTTTCAGAATGTCTAATTGAGTTTTATCAGACTGATCACTTTATTATCAAATATCATT
ACAATTTCACAATTCATGATTATAATAAATAATTATTATAATATTCTATTATATATAAGAAATCACAATT
AATTTAAATCGGATTATTTCAGCGATTTAAATTATATCATTATCATACTATTGCAATTGATTTTTTTGCA
ATTTTCATGATTGTTATTTATATATAAATAATAAATAAAAAATATTGTCAATTATCTTTTATTGAATTTC
ATTAGACACAATTCACAATACTCGACACAATTCACAATACGTTTTGAAATATTTAGTAAAAATAATTTTG
AAACTTTTAACAATAAATTTAATGAAATTTAAGAGTTAATTTAACAATTAAATTAATTTATTAATAAAAG
TTTTCATCGTTTACGCAATAATTGATTTTGTCAATAGAACTTAAATCAAAAAATAAAAACCTTGATTAAA
AAATGGAGATTATAAAATGGTTGAGATAAAATATGTACCATCTATTTGTCCTTACTGTGGTACCGGCTGT
GGTATTAACTTTGTGGTCAAAGATGGCAAAATTATTGGTGTAGAACCTTGGAAAAGACACCCAGTTAATG
AAGGTAAAGTATGTCCAAAAGGTAACTTTGGATACCAATTCATTAACCACCCAGACAGATTAACTACTCC
GTTAATCAAAGAAAACGGTGAATTCAGAGAAGCTTCCTGGGATGAAGCTTTAGATTTAGTAGCTAGCACT
CTTAAAAAATATGCTGACACTGATCCTAACAAATTAGGATTCTACGCATGTGCTAGATCTCCTAACGAAA
ACATTTACATAACCCAAAAGTTAGCAAGAGCTGGTTGTGGAACCCAAAACGTAGACCACTGTGCACGTAT
CTGTCACGGTCCTACTGTAGCTGGTCTCGCTACCACCTTCGGTTCAGGTGCATCCACCAACGGTTATGAC
AGTATTGAAGAAGCTGACTTCATTTTCTGTATCGGTTCCAACAACATGGAAGCACACCCATTATTCGGAC
GTAAAATCATCAGAGCTATTAAAAACGGTGCAAAATTAGTAGTAGCTGACCCAAGATTCACTCCTACTGC
AAAATTAGCTCACGAATACATGCAATTCAAGACCGGTACTGACGTAGCTTTAATGAACGGTATGATCAAA
ATCATCATTGAAAATGGTTTACAAGATGATGAGTTCATTAAAAACAGAACCAAAGGCTACGAAGAAATGA
AAGAAGTAGCTATGAAATACGACCTTGACAAAGTAGCTGAAATTACCGAAGCTGACCCTGAACAAATTGA
ACGTGTAGCTTTAGAATATGCTCAAGCTGAAAACGCAGCTATTGTATACTCTTTAGGTATTACCGAACAC
TCTCACGGTGCAGATAACGTAATGTCCACCGCTAACTTAGCTATGTTAACCGGTAACGTAGGTAAGATTG
GTGGAGGAGTAAACCCATTAAGAGGACAAAACAACGTACAAGGTGCTTGTGATATGGGTGCATTACCTTC
TGACTATGTCGGATACCAAAAAGTTGCAAACCCTGAAATTACCAAAAAATTCTCAGACGCTTATCAAATC
GAATTACCAACCACTCCTGGTTTAACCTTAGTCGAAATGATGAACGCTGCTCACTCTGGTGACTTAAAAG
TATTATACATCCACGGTGAAGACCCTGTTCTCTCCGATGCAGATATTAAACACACCAAAGAAGCAATTGC
AAACTTAGAAATGTTAATCGTTCAAGAATTATTCATGACCGACACCGCTGCTGAAGCAGACGTAGTATTA
CCTGCTGCAGGTTGGGGTGAACAAGAAGGTACCTTCACTTCCGGTGAAAGAAGAGTTCAATGGTTACGTA
AAGCTCAAGAACCACCTGAAGGAACCATGCTTGACTGGAAGATCATGGAAGAAATTGCTGTTAGAATGGG
CAGACCAAGAGAATTATTCCACTACGAAAACGCTGCTGAAATTTGGGAAGAAATCAGAGAACTCGCTCCT
TCCTACTACGGAATTACTCACGAAAGATTACTCAAACCTGAAGGTGTCCACTGGCCATGCCTTGACCCAG
AAGATCCTTGTGAACCATTAATGCACAAAGACAAATTCGCACACCCAGACGGTTTAGGTGTATTCCAAGC
ATTAGAACACAGAGGTCCTGTCGAAGTTGTAGATGATGAATACCCATTATTATTAACTACTACCCGTATC
TTGTTCCACTATCACGCTGCAATGACCAGAAGATGTGAAACCTTAGATAAGGAAGTACCTACCGGATTCA
TCGAAATCAACACTGAAGACGCAGCAGAAAGAGGAATTCTTAACAACGAAATAGTAAAAGCTTACTCCAG
AAGAGGAGAAATCGAAATTCCTGCTCGTGTAACCGACGACATTAAGAAAGGTATCGTAAACATTCCTATG
CACTTTACCGAATGTGCAGCTAACATGTTAACTAACTCCGATTCTTTCGACCCTAAATGTAAGATGGTTG
AATTAAAAGCTTGTGCTATTCAAGTAGAAAAATTATAAGTGAGGAATAAGGAGTAGATAATATGGCTGTA
AATGTAAATGATATGTTTTATGCATACTCTGGTAATGAAGCAATTAAAGAAAAAGGAGAATATGGTGGTG
TAGTAACTACCATCATGAAATACTTACTCGAAGAAGGTATTGTCGACGCTGTTGTTGCTGTAGAAGAAGC
AGCTGACCTTTACGACGCAAAACCTATTCTCATAACCGACCCTGAAGATGTAATCAAATCTGCAGGATCC
CTTCACTGCGGTACATTAAACTTAGCAAAATTCGTATCCAAATACTTAGACGGTGCAAGAGATATGAAAA
TTGCAGTTACCACAAAACCATGTGACGCAATGACCTTAAAAGAGTTAATGAGAAAGAGAAAAGTAATCGA
AGAAAACGTAATCATGATTGGTGTAAACTGTGGAGGAACCATGCCTCCTGTACCAACTATGAAAATGATT
CGTGACGTATATGAATTAGACCCTGCAGATGTCATCAAAGAAGAAATTTCCAAAGGAAAACTCATTATGG
AAACCGCTGAAGGCGAAAAAGCAATTTCTATTGATGAACTCGAAGAAGAAGGTATGGGTAGAAGAGAAAA
CTGTCAAAGATGTACCATGAACATCCCAACCAACGCTGATTTAGCTTTAGGTAACTGGGGAGTTATCGGT
GAATTAGCAGGAAAAGCAACCTTTGTAGAAGTTTGCTCTGAAAAAGGTGCAGACATCTTAGATAAAGTTA
TTGAAGCTGGTTTAATTGAAACCCAAGAACCAATCGAAAAAGGTGTAACAATCCGTGCTAACATCGACGG
AATCATGGTTAAACAAGCAATGGCACAAAGAGAAAAAGACTTTGCTGGAACCTCCGGTGACATTTTAGAA
GTATTTGCAGAATACAAAGAAGAATTCTCCAAATGTATGAAATGTTACGGTTGCCGTGAAGCATGTCCTC
TCTGTTTCTGTGACGACTGCTGTCTTGAAGCTGAAGGTCCTGAATGGGTACCTGGCGGATACACTCCTGC
AGCTCCATTCTTCCACTTAACCCGTATGGTACACATGGTTGACGCATGTACTAACTGTGGTCAATGTTCT
GAAGTATGTCCTTGTGAAATTCCAGTATCCAAAGTATGGGCTACTGTAAACCAAAAGGTCAGAGACATCT
TCGGTTACTACAGTGGTGTAGACAACGAAGAACCATTACCATTCACTGAATTTGGTCCTAAATCATACAG
ACAATACTAAATTCGTTGGTTAAAAAGATATTAGAATAAATTTTAGTTATTGTAAAACTTTGTAATAAGT
ATTTTCTTAAAAATAAGGAATTGCCTAAGATATCTTATTATATTCGTTTTACAATTTTCTATTTTTATTC
ATTTTTTTATTTTTTAATTAATAATTTTAAAAATAGTCACCTCTTATTCACTCATTTCTATAATGAATGC
TATTTTTAGATTATTTAATTAAAATTTATATTCTCTTTATTTATTTTTTTAATTTGATTCATTTCATTTT
GTTTTTAAATTTAATTTATTTATAATTTCTCCCTGCTCTTTTTCTTAAATTTCTTCATTGTAGATAATTT
TATCTACGATTATTTATTCCAGGGGTTTATTTGAATGAATTAAATTTAAAAATGATTTTTTTAAATTAAA
AGAGATTATTGATTTATATTTTTAATTAAGAGGGATTATTGATTTTATATTTTTAATTAAGAGAGATTTA
TATTGATTTTTATAAATTTAGAGAGATATAATTTATATAACTAGTTTATGGTGTAAAAATGAGAATTATT
TCAATTGTAGGCTTAAAAAATACAGGAAAGACTTCACTTACAAGCAAGATAATCAAGGAATTGACCAATA
GGGAATTTAAGGTAGCAAGCATAAAGCATTCTCATCACCAAATGGAAATGGATCATGAGGGTACAGACAC
CTACAAGCAAATGGAGTCAGGCTCTGATTTTGTTGTGGGAATTGGAGGCCGCACCTATTTCAATATCAAT
GAAAGACTTGACTTGGAACGTATTCTATTCTTAATAAAGCTTATTGAAAATCCTGATTTTGTGGTTATAG
AGGGATTCAAGAGCTATCCTTATGCAAAGATAGCAACCTGCAAAGAGGTGGAAGACGAATACACAATCAA
AACAGTAAATTCATTTGAAATAACAGATGAAGAGCTTCTAGATCTTGTAGACCTTATAGAAGAAAGGTCC
TATGACATCCTAGATACATTATTCGTTAGTGACTGTGGCTATAATGATGCAAGTATAATAGGTCAGGCAT
TTGCACAAGGAAAACTGGATTATAATCCCGATACTCAAGCGGAAGTTAATTTAGCCATCGATGGAATCAA
TATAGGGCTAAATAAGTTTGTAAGCAATTATATTAAGCAAACTGTATTGGGCATATTGAATCCACTTAAA
ATCAAGGAATATGGTGTGGAAGACTTTGAGAATATTGACCTAACAATAAAAAACAAAAAGGATTAAATCA
AGATTTAAATTTAAAAAACTTTTTTAAAGATAGAATTATATATTAAGATAGTAATAATATATTTATCAAT
TAATTTTTCAATTAATAATTATTATTCAATAATAATTTTATTCAATTAATATTCATTATTCAATAATAAT
TCATTATTCAATTAATTTTTCAATTAATAATTTATTATTCAATTAATTTTTTAATTTTAGTATTTAGGTG
ATTATATGGCTTGTAATGATGATTTTGAAAACAATGTGACTTTAGCAATCAATGGCAATGATATTGAATT
AAACAAATTTACAGATGATATTATTAAAGAAACCATTCTTGGATTATTGAAAGCTATTAAAACTTCTGAA
TATGGTGTAGATGAAGTTAAGGATGTTGAAATAACAATAAAGAATGAATAGTTATTTTATGATTTAAATT
ATTTTTAATTTTAATTTTAATTTTTTTTTTTATTTTTATGAATTAATTTTTTATTTTTTTAAGTTTTATT
ATGGGGTTTATGGATGAAGGATAAAGTTAGAGACGATTATGAAAGGCCAATTATTTCACTTAGGATTTCT
ATAACCAATCGTTGCAATGTCAATTGCATATACTGCCACCACGATGGCATGCTGGACTCATCTTCTGAAA
TGACTCCTGATGAAATATACGAGATCTGCAGAATTGCAAAGAAATTAGGTGTTGAAAAGATACGCCTATC
TGGAGGCGAACCACTTGTTCGCCCTGACATAGTTGAAATTGTAGAGAAGGTCAACTCACTTGACTTTCGT
GACATTTCAATCACAAGCAATGGAATATTTTTAGACAAATTAGCAGGTCCTCTAAAGGATGCAGGATTAG
ACAGAATCAATGTCAGTTTAGACACACTTGATGAAGAAACCTATAAAATGATTGTGGGGAAAAACGTTTT
AGAGAGAGTAAAGAAAGGAATCATTGAATCTTGTGCAGTTGGTATGTATCCAGTTAAGATAAACATGGTA
GTTATGAACAATATCAACAATGATGAGATTATGGACATGTTTGAATTCACCAAGAAACATGGTGTTATCC
TTCAGCTTATTGAAATAATTGAGTCTGAAAGCTGTGATGACAATGACTTCAATTCCAAGTATCACTATCC
TTTAGCTGAATTTGAAAAGCATCTTGCTGAAATTGCAGATGAGATAAAGGTTAGGGAGTTTATGCAGGAT
AGGAAAAAATATTTCATTGACGGCGGAGAGATAGAGGTTGTTCACCCTGTTGACAATACCAATTTCTGCA
AGAACTGTACAAGACTTAGAATTACTCCCGAGGGAAAGATCAAGCCTTGCCTTCTTAGAAATGATAATCT
TGTAAATCTTATTGAATTTATTAGAGAAGGAGCCTCTGATGAGGAGCTCATTGACATATTCTTAAAGGGA
ATTCATAATAGGGAACCTTTTTATAAGGAAGAAAATTAGTTAATTTCTTAAAAAAAAGCATAATCCTATT
TAATTAATTATAATTTTCGCTATTTTTCAATTAAAAAAGAAAAAGAGTTTATTTAAACTCTTTTTAATTA
CGGGTTCTAGAAAATTGAAAAATTTTCAAGGACTTTTTCTTCTTCTTTTACTATTATTTACACTATTTAT
TGGCCTTTTCTTAATTCCAAACAAATAGTTTTTAATGGCCAATCCTTTTTCAAAAAAAATTATTCTTTTT
CTTTAAAATACGTATTCTTATTAGTTCTCTAAAAGTTTTTCAAAAAGTATTTTAAATTTTCGGTAAAAAT
AATTGGGAAAAAATCTGATTGAATTTTTTAAAAAAAATAGAAATTAAATTTTTCGGTAGAATTAATTTTG
GAAAAAATCTGATTGAATTTTTTTAAAGAAATAGAAATTAAATTTTTCGGTAGAATTAATTTTGGAAAAA
ATCTGATTGAATTTTTTTAAAGAAATAGAAATTAAATTTTTCGGTAGAATTAATTTTGGAAAAAATTGGA
TAGGATTTTAAAAAATCAAAAAATAGTCATCTAAAAAAAATAAAAATAAAAAGAATAGTGAAAAGCTATT
CTTTTTTTTTTTAAAATTTATTTTATTGTTAATTTTGCTTTTTTGCTTACTGCAGCGTATGTATTGTCTC
CAGCGAATTTGGCAACGAAGCTATATGTTCCTTTCTTATTCAAACTGACGTTTACAGTAGCAACACCTTT
GGCGTTGGTCTTAGCAGAATAAGTTTTTCCATTCACAACGAATGAAACTTTCTTATTGGCAAGTACTTTA
CCACTTGCTGCCTTGAATGTTGCACTTAAAGTTTTGGTTTTTGTAGTTGCTTTGTAAGATTTGTTTGGAA
CGGTTAGAGTGCCTTTTTGCGCTTTTACGGTGATTTTTGATACAACGAAAGAACCGTTATAATCATCATC
GCCGAGGTAGCATATAGCAAATGTGTAAATGTCTGCTTTGATGAGGTTGATTTGTAATTTAGCAGATCCA
TTTTCATCAGTTGTCCTATTATAGACCTTACCATTGAATCCAATTTGAATAGGTTTATTCGCTAAAATAT
TACCCTCACTGTCCTTGAGAATGACATTGAAGTATTTGCCGATACGTCCATCAACTTTAGTGTCGATAGC
AGTTGTTTCCATATCCTTATAAATGATTTGGGTGGCTTTTCTCTCATGAGTTATGTTTTGAGGACCTGTA
GAATTGGTAGTTACTGTTGCAGTGCCGTTCACATATTCTATAGGGTATTCTTTACCATCGACAACAACAG
TTTCGATTTTAGTAGCATTAGCCAAGGCTTCTTCTAATTGGTCAGTTAAATTGTCAACTATTTGATTAGC
ATTTTCTAGGTCGTTAGCTATTTTAGTTGCATTAACTTTAGCTTCTTCCAATTGGGTTGTTAGATTGTCA
ACTGTTTGATTGGCATTTTCTAGGTCGTTAGCTATTTTAGTTGCATTAACTTTAGCTTCTTCCAATTGAT
GAGTTAAATCATTGATGGTTTGATCATTATTGGCTTGTGCTTCTTCTAATTGGCGAGTTAAATCATCAAC
TATTTGATTAGCATTTTCTAGGTCGTTAGCTATTTTAGTTGCATTGGTTTGGGCATCATTTAATTGGCCA
GTTAGATTGTCTACTATTTGATTAGCATTTGTTTGGTCGTTAGCTATTTTAGTTGCATTGGTTTGGGCTT
CATTCAATTGATGAGTTAAATCATTGATTGTTTGAGTAGCATTGGCTTGTGCTTCTTCCAATTGGGCGAT
TAATTTATCAACTATTTGATTAGCAATTGTTAGATTGTTAGCCAGGTTAGTTGCGTTTGTTTGTGCTTCT
TCCAATTGACCAGTTAAATCAGTAATATTTTCTTTAAGCTTTTCAATCTCCTCCGGCATATTGGTTGTAA
TGGCAGTGCCATTTACAGCAGGAATAGAATATTCAACGCCATCAACAACAACAGTGATATTGCCAATCCT
GCAATCAACAATATTAACGGTTTTGCTTGCTTCCTTATGGTTGTCATTAGGAACTGTTGTTATGGTCAAT
GTGTGATTTCCAGATTCCAAATCATCTGGAATTGTAACGATGTTTTCATTAAGCTCAACGTTCTCGCCAT
CGATATCAGCAGATATTCCAATAGCACCATCAGTTGTTACAGCAAGGTTGATGGATTCGCCATAATAAAG
GACAATATCATTAACATTAATGGTAGAATTGACTTTTCTAACTGTTATTGTTGCATTCTTGCTTACCTCA
TTGTGATTTTCATCAGTAATAGTTGTTACTTCCAATATATAGCTGTCTGCACTTAAATTTAATACAGTTA
TAGTATTTCCTCTAACGAAAACAATGGCTTCATCATGATTTATTACTTTGGCCTCAACACCAGTTGCGTT
AGTGAATGATATTTCACCAGATCCCATATCCTTATAATCAAATTCAATATCACTGACTGTCAATGTTGAA
TTGGCTTTATTGACCTTTAAAGTTCCCCTTGCGCTTGCATTGGTATAAATCTCATCTCTGGAATATTCAA
CAATGACCTCATATTCATCAGCAGCAAGAATTCCAAGTGAAATTGTTTCATTTAAATCCAAATCTGCAAA
TGTATAATCTGATTTTTTGCCTTTTAATGTTATATTGACTTTGCCGGTAGCAGCAGACTCATAATTAAGA
GCAATTGCTATGTTGTTGCCGTATGTAAGTTCATCGGATTCAACTGATAGGTTTGGATTTGATTTTATAT
TGTTTATTTCAATAGAATATGCGACGTTTTCAACTTTTGCAGTTACGCTTCCAGTTCCTAAACTAGTTGG
ATTGTATATGACAGTTTCCCCTAATTTAGCAATGCTATCGACATCACCCTTAGTTGCAGTCAATGTTAAA
TTAACAGGCTGTAACTGGCTATTGTCATAATCAGATATTCCTGTAGCGTTATATGAATATAGCTTAAATG
AGATATCTGATGAATTTAAAATTTCAACTGGATTTGGATCTGCTGTAGCATTCAAGAAGAGCCAAGTACT
AATTTCCACGTTAGTAGTTAATGGTTCAGTATCAAAATTGCTTGCATTATTTCCGAACCAGTTGTAATCT
GCATTGGAAGTGGAATCACTATTAACAAAATATATTGCAACGACATCATTATTCAGGAAAATATTGTCAT
TGATTGATAAATTTCGCTTATTTGTATTATTGAAGTATAAAACACCATTATCGCCACTGTTATTCACAAA
AATAGAAGCAGAAACAACACCATCATTAGCAAACCAGTATAGAGCGCCACTCCTATTAGCTGAATTATTT
ACAAAACTGCAATCAGAAACAACACCCCTAGCACCGGAATCCCAATAGATAGCAGCACCACTCTTATTAG
CTGAATTATTTACAAAACTACAATTAGAAACAGTACCGCCAGCAGCTTCATTCCATAAGATGGCACCACC
ATCATTGGCGGAATTATTCACAAAACTGCAATCAGAAATAGCACCGTTCAAACCTTCATTCCATACTATA
GCACCACCATCATAGCTCTTAGCAGAATTGTTCACAAAGATACAATCAGAAACAACTCCATTGGCAGCGT
TCCAAAAGATAGCACCACCATATTTCTTAGCAGAATTGTTCACAAAACTGCAATCAGAAACAACTCCATT
GGCACCGTGCCAATAGATAGCACCACCATGTTCATCAGTAACAGTGCTATTCACAAAACTGCAATCAGAA
ACATTACCATTAGCACCATTCCAATAGATAGCAGCTCCATACATCTTAGCTGAATTATTTACAAAACTGC
AATCAGAAACAATACCTCTAGCGCCGGAATACCAATAGATAGCACCACCATTGCCGTCTATTTTAGCATT
AGCGAATGTAATGTTATTGATTTCTACATCATCTGCTTGAATACGGAATATTCTTGCCATTCCGGTAGCA
TCTATGGTATAATTATTTCCAACAATTGTCAAAGGTCGATTAATATTTATTCCATTTTTAAATTTACTGT
CAAAAAGTGAGTTATAGATGAAATCATTATCCAAAATAATAGTGTCATTATCGTTGCGGTTTATGAGATT
GTTCAAGTCACGGAATGTTGTTCCATCTGAGATTTTTAATCTTGTAGTGTAGAAGGCATTTTCTATTGAT
GCTGTTAGCATGCATTCGGCACTCTCTGGAGTGTAGTGAACCTTTTCTCCCAGTTTGGCTTGGGTAGTAT
TGATCCTTCCGTTAGTTGGAGTCACTGTTAAGTTAATCTCTTTCAAACGGCTGCTATCATATTCTGATAC
TCCAGAAGGAGCATAAGCATATAATTTAAATATAATGTCGCATGAATCAAGAATAGAAATTCCTTCCGGT
TCTGATGTAGCATTCAAGAACAGCCAAGTATTCATTTCCATATTATTGCTTGTTGGCGCTATATCGCAAT
TAGTTGCATTATTTCCAAACCAGTTGTAATCTGCATTGGAAGCGGAATCATTTCTCACAAAATAGATTGC
AACGGCATCATTGTTCAGGAAAATATTATGATTGATTGTTAAATTTTGACCAAAGTTTTGATTATTGAAA
TAGATGGCACCGTTATCAGCACTGTTATTCACAAAAATACAGCCGGAAACATTACCATTATTTTTTTCCC
AATATATTGCTCCACCATTACGCACAGCGGAATTATTCACAAAACTGCAATCAGAAACAACACCATCATT
ACTGCTCCAATAGATAGCACCGCCCTGTATGGCAGAATTATTCATGAAACTGCAATCAGAAACAACGCTG
TCATCACTGACTTGCCACATGATTGCACCACCATTATTGGCGGAATTATTCATGAAACTGCAATCAGAAA
CAATACTGCCAGTGCTTCCATAGAACGCTACAGCACCAGCCATTACAGCACTATTATTTTCAAAAAGACA
ACTGGAAAGATTAGCATTGGCTCCTTGCCAGTAGATAGCGCCACCGTATCCGTTTGAGATGGCATTTGTG
AATGTAATGTTTTTGATTTTTACATTGTCTGCTTGAATATGGAATATTCTGACCATTTCAGCAGCATTTA
TTGTATGTCCATTTCCGATAATTGTCACAGGACGATCAATGACTATTCCATCTGTAAAATTATAGTCGAA
TGTTGAGTTATAAGTGTAATCTCTATCCAAAACAATAGTGTTATTATTATTGGCGTTTATGATATAATCT
AAGTCAAAGAATGTTGTTCCATCTGTGATTTTTAATGTTGTAGTGTAGGAGGCATTTTCTATTGATGCTG
TTAGTGTTCCGATTCCATCACTCTCTGGAATGTACTGAACAGTTTTTCCAAGCTCCGTCTTGGTAGTATT
GAATATTCCATTTGTTGGAGTTAATGTCAAGTCGACAGCTTTCAAACGGATGTTGTCATATTCTGATACT
TCAGAAGGAGTGTAAGCATATAATTTAAACGCGATGTCTAATGAATCTAAAATAGAAATCATATCCGGAT
TTACAGTTGTATTCAGGAAAAGCCAAGTATTTATTTCAGCATTATTAGCTACTGGTGCTATATCATAATT
TGTTGCATTGTTTCCAAACCAGTTGTAATCTGTATTGGAATCAGAATCATTTTTATCAAAATAGATTGCA
ACACCATTATTATTCAGGAAAATATTATCATTGATTGTCAAATGGGAAGTGGAATTATCATTTCTGAAAA
ATATGGTACCGGTATTAGCGCGGTTATTCACAAAAACACTGCTGGAAACAATGCCTCCCGCACGATTCAT
CCAGATGGCACTGCCGTTAGAGGATGCTTTGTTACCGTTAAAGCTAGAATTTTCTACAGTGGCATGGCTC
TCAAAGTCAATAGCACCACCAAATTTAGCAGAGTTATTGGTAAAATTACAATCTGTTGCTTTACCATTGC
CCTTAAATAAAATTGCGCCACCTTCAGTAGCATTGTTTTCAGTAAAGCTGGAATTTGTTACTTCACCATT
CTTATAAAATACATATTTGCACCTCTCAAAATACCTATCAGAACGTATATCAGTAGCGCAATTCTTAACA
AAAATACAGTTTTTTACAGTACTGTCCTCTGAAAAGAAGATTGCACCGCCATCCTGTGCTTTATTATTGG
TGAAATTAGAATTTTCTACAGTACCTGCTCCATTAAAGTAAACTGCACCACCTTGCTTATCAGCCTCATT
ATCAGTGAAATTACAATTTCTTACATCCCCGGAGGTATAAAAGACAATTCCGCCGCCATACTCATCCCAT
GCTTCATTCTTAATAAAAGTGGAATTTTCTACAGTACCATCCGCTGTAAACCAAATTGCACCGCTGTCTC
CTGCTAGGTTATCAGTAAAATTACAATTTGTTACTTCGCCATCTTCCTCAAAGGAAACTGCACCTCCGTG
AAAAGCTGAGTTTTTAGCAAAACTGCAATTTTCTAATTTGCCAGCGCTGGCATTCCAATAGATAGCGCCG
CCATCACCTGAAAGTTCTGCTGCTTTGTTTTCAGTAAAATTACAATTTGATATCTTAGTAGCTCCATAAA
TCTTGACTGCACCACCATCGTTGGCAGAATTCTTATCAAAACTGCAATTTTCCAATTTACCATTGCCATA
AATCTCAATTGCACCTCCAGAGTCATGAGCCTTATTATTAGTGAAAGTACAATTTATCGCATTACCATTT
GTATTAAAGCAAATTGCACCAGCCCATGAAAAATACCCTTGAGCGGTGTTATTGGTAAAGTTACAATTTA
TCGCATTACCTGTACCATTAAAGCAAACAGCACCGCCTCCTCCTAAAATATCATAAACAGCAGTGTTATT
GACAAAAGTACAATTTTCTATAGTACCACTTTCCTCAAAGCAAACTGCACCACCAGAGTATACCGCTTGG
TTATAGCTGAAATTACAATTTATTGCTTTGCTGTTATCTTTATAAAAGTATACTGCACCGGCAGCGTTTG
CAGAGTTATTAATAAAATTACAATATTCAATGGTACCGGACTTTTCAAAGTCAATCGCAGCGCCCTCATC
ATCTGTATTGCCTAGATCATCTGTAGTTACATTGGCGTTTTTAATGGTTAGGTTTTTAATTGTTACACCG
GAAGCAGTTACTTTAAATGCTCGAATAGTTGATCCGGCCATATCTATAATCGCACCATTACCATCAATAA
CACTATTGCTAATTGATATTATGATTGTATCGCCACTATCATAAGTATAGTAATCGTGTGTCAATACAAT
ATTTCCTCCAGCGCCAATCTCGCTAGATAGCCCGGAATATGTCCCTGGATCCTCCCTTAATTCATCTGAA
TCATTTCCAGCATATACAAATTTTTCATCATTTGCTTTAATAAGTTCTTCATCATAGTTGTCATTTGCAT
TTGAAACGTCATCAATGACTGTTTCATCTAAAATAAGTTCTTCATTCTCATCAGCACTAATAATATCATC
TGTAAGATCGTCTGCTGCGCTTGCAGCAGAAAGGCTAAAGAGAACAAGTAAAGTTAATATTATATATATA
CCTCTTTGGATTTTCATTCTCCTCGTCACCTAGAAATAATTTTTAATTAGTTATAAATTTATACCATAAA
TTATATATTGATTTTGATTTATTAACTTCATTTAGTATTTTACTTATAGAATTTTACTTAATTAGTATTT
TAATTCATTTAGTATTTTACTTATAGAATTTTACTTAATTAGTATTTTAATTCATTTAGTATTTTTCAAT
GAATTTTTTTTTTTTAATGTTTTTCTATTTCCTTTAATATTTTTTCTATGGTTTTCAATTAGATAATTTT
CCCATTTTAATTTAAAATTTTTTCAAGATTCTCTTTATAATTTTATAAAATTTTTTAATTTTTTCAAGAG
TCTCTTTATAAATTTATAAAAATTTTTTTAATATTTTTCATGAATTTTGCATGTTTTTTTATTAGAAAAT
CATCATCAAAATAGGTATGTGTACTTACTACACCATAATTGTGTGTATTTACTACACATTTTTTAGATTG
GCCTAAATAATTTGAAATTTTTAAAAAATTCGATATAAAATTGCTTACATATTGGAGATATAATTCATTG
ATTTTTCACCAATTTTTTAGATTTTTTATTTCTTTTAAAATAGTTTAAAAATAAAAATTATAATTATGAA
TGATAATATGAAAATAATGATGATAATATAATTGTATTAACAGATATAATAATTATTTTATTTATAAATA
ATAAATTAAACTATTATTAAGAAAGATAAATTATTTTCGAAAAGTGTATATACCACACACTCCTATATAA
GTCTTTTTACTTTAGTCTAAATATGTACCTTTTATATGTATACATAATAAATATAATAATGTACACATGG
TGAATTTATGCCAAAACATATCGTATCAGGACTAAAATATTTAGAAAGTGTCGAGCTTAGAAAAAGAGGG
CTGTCCCAAAAGGAGATTTCATCTGAAATTGGTGTGGACAGATCAACTATTTCTCACTACTTGAACGGCC
GAAACATTTCTGCCGATTCAATCGAGCTTGCTAAAGTTATTTTAGAGCTGAATCCTAAGGATTTTATATT
AATTGCAAGAGTTTTGTTTGGAGATTATAACGAAATTCGTCAACTTATTAGCATTTTTAATATGAATCAT
TATGACCCGCAGATAGATGACGGATGTATTGGTTGTGGATTGTGTGTAGATTTGTGTGAAGTGAAGTCTA
TTAGCTTAGACTCATTAAAAGCAAAGATAAACCCTCGTTATTGTTGTGGCTGTCTTATGTGTGTTGAAGA
TTGCCCGACAAATTCAATAAAGATTTTGGAGGTATAAAATGGTCAAAAATATTAAAGAAACAGAAGGCAA
AAACTTCTGCATTAAAAGATCATTAGGCGAAGAAAGAGTATTGTCTTTCAAAGATCACGTCTGTGTCGGT
TGCGGACTCTGTGAAGCAACCTGTCCTGTAGAAGCTATCTCTCTTGATGAAGTAGCTCCTATCGAACGTA
AATATGTAGACACTTATTTCAGTGGTCATGAAAAGATTGCTCAAAACTATGCTCTTTTCACTAATGATAA
CGAAATCAAAGCAAAATTAGATATTTGCGAAGATAAATGTGTTCTCTGTGGTTTATGTAGTGGAGTATGT
CCAGCAGGTGCATTAGAACTTGCTATTGATGGCGTATCCATTAAAGAAAATGAAGCTTACCCACATCTTG
TCACTTCAGCTGAAATTGATGAAGACAAATGTTTATTCTGTAAGAAATGTGAAGCTGCATGTCCTAGGGA
GTCAATTACTATCGACAGAAAATTACCTAACCGTGCAGACCTTGTAACCGGTGAAATCGAAGTGGATGAA
GAAGAATGTATCTACTGTGGCGCTTGTGCTGAATTATGTCCTGCTGAAGCTATCGTAGTGGACAAGGCAA
CCGGCGAAGAAAGCATTGTCATTGACAAGGAAAAATGTGTATACTGTCTCGTATGTAAGAAAGCATGTCC
TGTTGACGCTATCAAAGCAGTATGTAGATCCTGTTCCTACGGCGAATACGATCTTGACCCTGCTAAAGCA
GCAATTACAGGTAACGCTATCATTGATTCTGAAACCTGTATTAAATGTGGATGGTGTGAAGGAGTCTGTC
CTGCTGATGCAGCTACTGTAAAACAAGCATTCAAAGGTACTCTCGAAATCGACGAAGAAAAATGTGGTAC
CTGTGGAGCATGTATTGACGTATGTCCATGTAATGTCTTGTCCTTCCCTAAATCAACTGGTCCTGGAGAC
AGAGGAACTCACTTAGTTAAAGAAGAAGATTACTGTATCCACTGTGGTGCTTGTGCAAAAGTATGTCCTA
ACGAAGCATTAACAGTAACTAGAACTGATGTTGACTACACCCCAACAAGTTCTAAATCTTGGATTGCAGC
ATTCGAAGCTTTAAAAAATTAATTTGATTGGTGATTATTTATGGAACTTAAAGTAGATCAAGATAAATGT
TTAGGTTGTGGAGTATGTGTTATCGCATGTCCTGTAAACGCTTCCATCAGTCCGGAAAACGCTGGAGGAC
ACGGTTCCAAAACAACCGAAACTATTATGATGGTTGAAAACGGATTTATTAAATTATTCAGTGTGGACAA
ATGTGATAAATGTGGTACTTGCCAAATGTTCTGTCCAACTGAAGCTATATGGTTAGAATAGGAGTGATAA
CATGCATTACGCAAATACTTATTTAGAAAGACCAGTAGTTGGAGATTTAGAAAACGTAGCTCAAGAAGGT
ACTACCAAAGTACTCAAATGTATGTTAAACACCGGTTCTGACATATATCAAGGAGCTTGTAAGAAAAGAG
GTTCCACCTTAAAGGAAGAATATAAGAACGCTTCCGGTACCTGTTATATGGATCCTCGTGACATGGTAAA
ATTAGGTGTTAAAAACTGGGACACCGTACTTGTAAAGACTGACTATGGTGAAGTTGTCTTAAACGCAGCA
AAATCAAGAGATGCTCCTCACGAAGGTACCATTTTTGTATGTAAAGGTCCATGGGCTAACACTATCGTAA
GCCACGAAACCTACTGCTGTTCAGACCCTACCTACAAAGGTATTCACGCTACTGTAGAAAAAACCGACAG
AAAAGTTCTACTCATGGCAGACTTAATGAGATGGGCATACAAAAAATATGTTGACGAAGAAGATGACGAC
GTTATTGAAAACATGGAATCCTTAGGTGAAAGACCAGTTTATAACTGACGTAAATGGGAGGAGTTGATTG
ATCATGACATATGAGCCACCTGTAACTGATTACGATTATATTGTAGAAAACTGTACTTGTGCATTTTGCG
GTTGTAACTGTGACGACTTAGATTTCTTAGTTAAAAACGGTCACGTGGTTGCCGTAAGACACGCATGCAG
ATTAGGTGCAAGTAAGGTAATGGAAGATATGGACCAAAGATTACTTGTGCCAATGGTAAGAAACGAAGAA
GGAGTTCTTGAAGAGGTTGACTGGGACACTGCACTTGACACTGCAGCTGAATACATTGCAAACTCCATCA
GACCTGTATTCTACGGTTGGTCTGAAACTTCCACCGAATGTATGAAAGAAGGTGTGGAATTAGGAGAATA
CATCGGAGCAGTTCTCGATAACCAAGCAACCATCTGTCACGGTCCAAGTCTACAAGCTATGCAAAACGCA
GGTTACCCTATCCAAACCTTAGGGGAAGTTAAAAACAGAGCTGACGTTATTGCATACTCTGGAAGCAACG
CTATGAACTCTCACCCAAGACACTTAGCAAGATATGCTGCATTCCCTCGTGGATACTTCAGACAAAGAGG
AAGATTCGACAGAACCGTTATCACTATGGACCCTAAATTCTCAGACACTGCAAAAATGTCTGACAAATGG
ATTGGTTTCGAACAAAACGGTGACTACGGTTTCTACAACGCTTTAAGAGCTGTACTCAAAGGTAAAAAGT
TACAATCTGAATCCGTTTCCGGTATTCCAGCAGAAGACATCTATGAATTAGCTGCTGAAATGGAAGCTGC
AGAATTCGGTGTTCTCTTCTTCGGTTTAGGTTTAACCCACACCTTAGGTAAGCAAAGAAACATTGACATC
GCGATTAAATTGGTACAAGACTTAAACACCAACAGTAAATGGGGACTCACTCCAATGAGAGGTCACTTTA
ACGTAAACGGTTTCAACATCTTCATGGCTTACGAAACCGGTTGGGCATTCGGTGTAGACTTCTGTAGAGG
ATACGGAAGATATATGATGGGTGAAACCAACACAATCGACTTACTCGTTAGAAAAGAACCAGACTGTTTC
ATGGTTATTGCAGCTGACCCTGGTGCTCACTTCCCTAACGGAGCAAACCAACACTTAGCTGACATTCCAG
TTATCCAAATCGATATTCACTGGGGACCATCCACCGAGCTTGCTGATGTAGTACTTCCTGGATCATTCAT
TTCTGTAGAATGTGGAGGTACCAGTTACCGTATGGACGGTGTTCCTATCTGGATGAAAAAAGCTATCGAC
AAACCTGAAACCTGTCGTGATGACGAATGGATTGTACGTGAATTGAAAGAAAGAGTAATGAAACTCAGAG
AAGAACCTAACGTAGCAGATGAATACGTTCCTAATGAAGGTCTCGCATGTCTCTTAGATAAGTAAGGTGA
TTTTTATGGAATATATACTTAAAAATGGTATTGTTTACGACCCTGCTAATGAAGTAAACGGAGAAAAAAT
GGATATCTGCTTCAAGGATGGTAAAATCGTTGAAGACGTATCCGCTGACGCAGAAGTATTAGACGTCACT
GATAAAATTGTAATGCCTGCTGGTGTAGACCCTCACGCTCACGTTGCAGGACCAAAATTGGTTGTAGGTA
GATTATACAGACCAGAAGATGAAAGAAGAGGAGTAGCTCAAAAAACCAAAACAACCAGAGCAGAGGCTGG
TTTCTCTATCCCAAGTTGTCCTACCACTGGATACAGATACTCAAGAATGGGATACGGTACCGTTTGTGAA
GCAGCTATGCCTCCTTTAGAAGCAAAACACACACACGAAGAAATTAACACTATTCCTAACATTGACATTA
ACCCATTGCCACTCTTTGGTAACAACTGGTTTGTAATGGAATATGCTAGAGAAAACAGAATTGACGATTT
GGCAGCATTCATTGCAGCAATGTTAAGAGTATCTAAAGGATACGGTGTAAAAATCGTAAACCCATGTGGT
TCAGAAGCGTGGGGATGGGGTATGAACGTACACGGATACGATGATAAGGCTCCATACTTTGACGTAACCT
CCAGAGAAGTTGTAAGAGCTTTAGCAAAAGCAAACGAAAAATTAGGACTTCCACACTCTATACACATCCA
CCCTAACGATTTAGGTCACCCTGGAAACGTTCCTACTACCATTGCAACTTTAGACTCAATCAAAGACATT
GCAAAATCAACTAAACCATCTGCTTCCGTAAGAGATCAAACCATCCACTGTACTCACTTACAGTTCCACT
CCTACACAGGAAACAGCTGGAAGGATGCAGCATCTGGTGCTGAAGAATGTGCTGACTTCATTAACAAGAA
CCCATATGTAACTTGTGACGTAGGTCAAGTAACCTTCGACGAAACCACTACAATGACTGCAGACGCTCCT
ATGGAATACGACTTGTTTAAGATTTCTGGATTAAAATGGGCTAACAAGGACATTGAATGTGAAACCGCAG
CAGGTATCATTCCATGTATCTACTCTCCTAAGACTCCAGTAAGTACCTTACAATGGGCTATCGGTCTTGA
ATTGTTCTTGCACATTGAAAACCCATGGCAAGTATGTCTAACCACTGACCACCCTAACGCAGGTCCTTTC
ATCAGATATCCAAAGATCATCTCCTGGTTGATGAGTGCTCCTAAGAGGATGGAAATGATTGACAATGGTG
AAGTGCACAAATGGGCTTCCAAAAGAACTGGCTTAGCTGGTCTTGAAAGAGAATACGACTTCTATGAAAT
CGCTACAATCTCCAGAGCAGCTCCTGCAAGAATCCACGGATTTGCTGACAGAGGCGCACTTACCCCTGGC
TACAACGCAGATATTGCAGTATATGACATCAACCCTAATGACTTTGACCCATCCAGAGACCCTGAAGGTG
TTGAAAAAGCATTCAGCAATGCTTACTACACTATCAAAGATGGTCAAATCGTTGTTAAAGATGGTGACAT
TGTATCTACAAAACAAAGCCACACCATTTGGACCAACGTCATAGGATACGAAGAAGAGGAAAAACAAATC
ATAGACAGCATAATGCCTTTCTTCACTCAATACTATTCTGTCAAATGGGAAAACTATCAAGTACACGACC
ACTATGTACCTAACCCTACTGTAGTGGATGTAGAAGCTAAATAAGGAGAGTGTTTATTAATGAAAACTAT
TACTTTTGATCAAAAGAAAACTTCTTCAATTGCTTTAGAATTTGATGAGTTAATCACTGATAACATTTAC
GCTTGGACCGAAGAGGACTTTGCAGAATACAAAGTTCCTATAGGAAACTCCAGATTCCCAATCACTGATT
ACTTTGACATCACCGTTGAAGGAGAAGCAGAATCTCCTGCTGAAGTCAAAATGATTTTAAACGGAGATTG
TAACAGAGTAAAATACATCGGCTGTAAAATGAGCGCTGGTGAAGTAGTTGTTAACGGTGACGCTGACCTT
CACGTAGGTGCAGAAATGTCTGGCGGAATTGTTACCGTATTCGGTAATGTAGCAGCTCACGCCGGTCGTG
AAATGAAAGGTGGAAAACTCGAAATTATGGGTAATACCAAAGAATTCTGTGGTGCATCCTATATCGGTGA
ATGGAGAGGTATGTCCGGTGGAGAAATCATCATCCACGGAAACGCTGGAAAACAATGTGGTGAATGTTTA
GTCGGTGGTAAGATCCACGTTTTAGGTGACTGTGATATTCTCGCAGGTATTCACATGACTAAAGGTACCA
TTGAAATCGATGGTAATGTTAACCGTTGGCCTGGCGGTCAGATGAAAAACGGTAACATAGTCATCCACGG
TAAAGTAGGAAGATTACTTGAAGGTTTCGTAGAACAAGGAATCGTCACAGACCCTGAATTAGATGGAGTC
ACTTATCCTGGCAGATACATCGAATACAAAGGGGACATTGCTTTAAACGGTAAAGGTACCTTATTAATCG
ATGCTGAGAAAAACAGAGACAGATTATCTACCTGGATTGAAGAAGACGACGAATATAACGCAATTAGAGA
ATACAGAGACCAATAATTCAAACTTTTTAAAAAAAAGTTTGCTTATAGATCTAGAAAAAGATAATTAGAA
TCTTGTATGATTTAAGGTTTGTTTAAATTTTAAAGCAGCATAGGTTCTAATTTACTCCCAATCTTTTTCT
ATTTTTCTATTTTTTCTTTTTTATTCTCTTTTTTTATTTTTTTTATTTTTTTAATAATTATTTTTATTAT
TTTAATTATTTCAATTATTTCAATAATTTTTATAATTTCTTAAGTCATAATTTAATTAATTTCTAATGCT
CGATTTTTATTGATTTAAATTTATTAATTGAGCTTCAGTTTTTAATCTTTATTAATTGAGCTTCAGTTTT
TTCAATCTTTTAAATTGATTTGTTAATTAATTAAATTATCATTTATATGAATTAATTATATAATTATTAT
GTGTAATTTTAATTTAAATGAACTTATATGAAAATGGTGTAAATATGGTCAAGGAAATACTTATGGACCC
AGATGATATTATAGAATATGTAAGAAATGAAGTAAAAGTTGATGATATTTTTGAATTGTCTTATAATAGG
GTGTTTGCTCCAGGAACTGTGCTTGGAATCACTCCTGAAGATGAGGAAACCGGTGAAGGATTGATTCTTT
CTCTTCAGCTTAATGGTGAACTCTTGAATCAGGCAGTAGACATTGATTTGCATGCAGTTAAGGATGAAAT
CATTGAAGCACGTCATTTGCCTGGTGGAGATGAGGATAAATTGATTGTCATTGAAGCTACATTGTAGCTT
TTTTATTATTTTTTTTTTTAACAATTTTTTTTATAATTCATTAATTAGTTTGATTAAGTACAAATAATTT
TATATATTAGAAACAATATACTATAATTATAAACCTAATATTAAAAATATTTTAAAGCTTGATTTTTTAA
AGTCAAGAATTTAATTAATAATAATAGTAGAACTGTAATGAAAATAATTAACCTTAGGAGGTCTCTAGAT
GGTCGATAAGGAATTAACAATGACTTCTGATGAAGTTCTAGATTATATTAAAAATAATTTTAAAGAATTT
GATAAAGTGGATATTGCATACAATCGTGTTTCTGCAAAAGGAGACATATTAGGTGTGGATCTTTCTGATT
ATAAAGGAAAACCAAGTTGCAGAGTGATGATAGCTTTAGATGGTGAAATCATTTCCGATACCATTGAAGT
GGACTTTGAGGAGTATAAGGAAGACATTATTGAATTGCATCACTGGCCTAAAGACGAATCAAAGGAATCT
GTTTATATTGAGGTAATTTAGTCAAACTTCAAACTTTTAGAAAAAGTTTGATCAAAATCTTTATCTCCGG
AATTTTCATTTCCAAAAATTGTATCTCTATATTCTTAAAAGAAGTTTGATTAAATTTTATCTCAAGAATT
AAGTTTTGAAAAAGGCTATAATATTTAGAAACCTTATATTTTTATCTCAATCCTTTCTTTTTTAATTTTC
TTTTTCTTTTTAGTCTTTTTCTAATTTTCTTTTTTTTATTGAAACAATTTTTCATTTATTTTTTTTATTA
AAACAATTTTTCATTTTTTTTGAAACAATTTTTTTAATGCTTTTTTATTTTTTCTATTATTACAAAATCA
GCTTATTTTTAATTCAGATAGGATTGGACTATTCTTCCAGCAATATTGTATTTTTAGGATCTACTTTTAT
ATGGTCTGGAACTACAAACTCATGCTCGCGGATTTGCTTTTCACGTTTCCACCATAAGCCGTTTGCTAAA
GTTATCTCCCATTCGAAAGGCATTTCCAATAGGCTTGAATTTTCAGTGTCAAATGAATTTACTTCATCTT
TTTTGGCTGGAGCAAAGTCATGCGCTCTTATTCCAATATGGGTTATGTTTGGTGAGATTTTTTCAGAGAC
TTCCAATGTCAGTCCCCAGTCTAGGGATTTGAGATGATAATCATCTATAATTTCAATTCTAGATGTGTTC
TTGCATCCTGTAAGTCTGGCAACATCGAGTTTTTTAGGATTTTCAAAGATTTCATGAGTTTCCCCCTTTG
CAATGATTTTTCCTTTATCCAATATGATAAGCTCATCGCAGAACTGGAATGCCTCGTCACGGTCGTGGGT
TACTAGAACTGAAAATCCGTCAAAGTCCTTTAATGAATTAACAAGTTCTATACGCAATTGTTCCTTTAGG
AAGGTGTCCATGGCGCTGAATGGCTCGTCCAATAGGATAACATCAGGTCCATAGGCCAATATTCTAGCTA
ATGCAACCCTTTGCTGCTGGCCTCCGGATAATTGTCTGGGATATCTCTTTTCAAGTCCTTCAAGATGGAA
TCTCTTTATCATTTCAGATACTGTTTTTTCCCTTTTCTCTTTGGATACACCGATTCCGATGTTTTCCTCA
ACAGTCATATTGGGAAATAGGGCATAGTTTTGAAACAGGTAGCCTACGTTTCTTTTTTGAGGCTTTAGAT
TGATCTTTTTTTCTGAATCAAAATATATGTTTTCCTCATCCATCTTTAGGCTAATGATTCCGGTGTCTGG
ATTTACAATCCCTGCAATGGATTTTAAGGTCATGCTTTTACCGCATCCTGAAGGGCCGAGAATGCCTAAA
CATCCTTTATTTAACTTAAAATCAATATCTAATTCAAATTCTTTAAGTTCCTTTTGGATATTTACTTTTA
AGAATTTTTCACTCATATTCCATCACTCGCAAGATAAAAAAATAAAAATAAAGTTCAAAAAATAGATTAT
ATTATTGCTCATAAATCAGGCTCATGTCTTCTATTGGTAAGACAGTTTCAACGGCTTTTGCTTCAATATT
TATTCCTTTTTCCTTGATTGCAGCAATTAAATTCAATCCGCTTCCTGTAACTATTCCAAAGTTATAATTA
TCTACCTTTGCATTATAGACTAATTCTCTTGGTTTTCCTACTTTAAATATGGAAAATCCTTCTTTGCTTA
TCTTCTCCAATATTTCCTCTGTTTCAGGCCTTGCGATGTATGGGACCTCTTTGATTGATGCAAGGATTTT
CTTAGGGTTTTTTCGTTTGGCTATTTGGGTCAAATCTTTAAAGATGAATATCTTATGTGGATCGATTGAT
GACCCGTTGTATGAAATCATTTCAACAAATAAAGGTGGCTTTCCAAGCTCTAAAAGTCCTCCGTATTGTG
GTGTGCTCATTATTCCGTTTTTGATTAGGATTCCATCAATGCTAAGGCTGCAGACTGTAGCTATTCCCAC
TTTGCTTTTGTCATCTGGATGGTCAACTATGCTGAAATGGGAATTCATGTATTTTGGAAGTGCCTTGTAT
GTCTTTTTCATAATGCTTATTGCATCGTCAAGATCTTCCTTCTGGAGGTATGAAATGTTGGACACTATGT
TTCCATGACCTGTTTCAATGTCATAATCGACCTGATTCACTCTGTTTAATGATTTGGTAAGTATGAATGG
TGTTTTCTTGTAATCCACCTTTTTAGCATGCTTTATCTTATGCTTGGAGGATTCAAGCTCTTTTAGCTTA
TTGTAGTTTATGAATTCCTCACCTGTCTTTATATCCACCTTATAGTTCATCTCTTGAGCTGCGCAGAATG
GGGTGATTCCTCCAATTATGGATATTCCAACCATTCCTTCTGGAACTGGAATTCCTAAAATGTTTTCGCT
GATTTCTCCGATTTCAAGGATTCCTCCAATTCCTGCTTTTTCAAGCTTTTCGAAGATTTCTTTAGCTTTT
TCTAGACCACTTTCTGGAATTATTCTGAAGTTTGCAGGAATTGTTCCGGTACCATGCTCCGCAACTTCAA
GGACAGAGGTCATTCCTTTTGCTATGAATGCATCCAATGGAGTGATGGAGGTTTTCCTATAGGAGATAAG
CTCTGAAAACTTGGTTGGATAGTAATCCTCAATATCTACAAGCCCGCCATATTGTGGGATTGAAGGGATT
CCGTTCTTTAAGAAGACTCCATCTATGGTTGTACCACAGATGGTTTTCATCACATATCCCTTTTTGCCGT
TGATTTCAGTCTTTTTGGCATTTATCAGTGGGCTTACGCAGACTCCTGCTGCAAATACTTCCTTAATTAT
GTCGAATGCCTTATTTTCAAGGATGTTTGAAGTGTTTACTATTACATTTCCTTCCTTTTTCTTATAGTCA
AAGTCGGTGAGATAGATTCTTTCCTTGAATTTGGACAGTGTGAAGTCTACCTGGTCGTAGATTAGGCCCT
TTTCCAGTTTGCTTTTTCCAAGCTCGGTGATAACTCTGCCAGAGTATCCTTGTTTTTCTGTATATCCCTT
TTCATCAAGAATTTGCATATGATAGCGGACTGCACGCTCGCCAAGGTTGTATCCTTTGGTCTTAAGTTCG
TCTGCTATTACCTTTGAGCCTATTGGCTTTTCATGGGTGTTTAAGATTCTTAGGATTTCTATCATTCTAT
GTTCGGACTCTGACATATAATCTCCTGCTTTCTAAAGGATTTATAAAAATAAGTTTGATTGAAAGGTTGT
CTTTAATAAAGATTAATCAATGTTTTTTAGTTTTTTATAAAAATAAAAAGTAGCTATTTAAAATTTAAAT
AGCTATAAATTTAAAATACCTAATTAGTAATTTATGCCTGGAATATTTCAAGCGGAGTTTTATTTACTAG
TTTACACTAGGAATATTTCAAGCAGTGTTTTATTTAGTAATTTAAGTATTTCTTATGTTCGTAATTGAAC
ACTTGGACTCTGTATTCATCCCATTCTTCATACTTTGCAGATAAGAATGCATTGAATATATGTTCTCCAA
GAGCTTCTTTCATGATTTCACTTTCTTCAAAGGTGTGGTATGCTTCCCATAGACTGGAAGGGAGCAATTC
TATGCCTTTCTCTTCCCTTTCTTCATCGGTCAATTCATAAATGTTGATCTCAACAGATTCTCCCGGGTCG
ATTTTGTTTTTTATTCCATCCATACCTGCCTCAAGCATTACTGCAAATGCAAGGTAAGGGTTGCAGGTAG
GGTCTGGGCTTCTGTATTCAATACGGGTGGCTTTTCCACGTGCTGCAGGCACTCTTATTAAGGTTGACCT
GTTTTGAATACCATAAGTGATGTAAACTGGAGCCTCATATCCTGGAACCAATCTTTTGTATGAGTTTACG
ATAGGGTTGGTCACTGCGGTTATTGCTGCAGAGTGTTTTAACAATCCACCAATAAACCACATAGCTTCTT
GGGACAATCCAGTTTCACTGTTTTCATCATAGAAGATGTTTTCACCATCCTTGAATAGACTTTGGTGACA
GTGCATTCCACTTCCGCTTTCTCCAAAGAATGGCTTAGGCATGAAAGTCACTCTGTAGTCGAATCCATCG
AAATCAGCCATATTTGCCACAATCGCTTTGATTGCTTGCTTGAATGTAATCACTGCATCTGCAGTTTTTA
ATGCATCATCGGAACTTGAATGCGATTTCGTTTTGGCCAAGGAACCCACTTCGTGGTGGCTTGCTTCTAC
TTCAAAGCCTAATTCCTGTAAATTGGTAGTGATTTCTCTTCTGAAGTCAGTTCCCTTATCTACAGGCTCT
ACATCAAAGTATCCTGCAGTATCGTGAGGAATTGGGTATCCGTCATCGTCTGTGTCTACAATGAAGAATT
CAGGTTCAGGTCCTATGTTGTAGGTGTAGCCTTCTTCCTTGATTTTTGCTAAAGCTTTTTTAAGGATTCC
TCTTGGGTCCCCTTCAAATGGCTCTCCGTTAGGATTATAGATGTCACATATGAATCTGCAGGATGCAGAC
TCTTCAGGTCTCCATGAAAGGGGTGAATAAGTGCTGATATCTGGCTTTAAGACGAGGTCGCTTCCTTCGA
TTCCAACAAAACCAGGGATGGATGATCCGTCAAATAGGATTCCATCAGTGAATAAGTCTTCCATATTGTC
CAATTCACAAGGAATTGACACATTCTTTGGAATTCCATGTAAATCAACAAATTGGAGTCTAATAAACTTG
ATATTGTCTGCTTTCATTCTTTCCATAATATTTTGAATTCTTTTTTCCATTAAATCATTCTCCATAATCT
TTGGAATATTATAAACTTAATCGCAATAAATTTTCTAAAAAATTAATATTAAATTATATTTTCTTAAAAT
TATATTTTCTAAGAATTATATTTTCTAAAAATTATTTTTCTAAAAAGTATATTTCTAAAATTATATTTTC
TTCGGAAATATATTTCCATCTATAATATTATATTAATTTTTTTAATATATTATTTTATCTATCTTATAGT
TTTTAAATCTTAAGGATTAGTTTATTTTTTTTAATATTTTTCATTATTTTATTTAATTTTTTGTTAAAAT
TTTAGAAATAATTTAATTTTATTAGTAAAAATTGAACAAATAACTATTCATTTATAAATTATCTTAAAAA
AAGACGTTTTTGATTATCCTATAGTTATGCAATGGTCGATAGGCATGATCTGGTGGCTTCTCTTTAGTGT
ATAGTGATATCTGTGGTATTTTTAGTGTTTTGTTTTAGTTTTTTGGGGGGTTCTGTAGTTTTGTTTTTGG
GTTTTTTTTAGTGTTTTGTTTTAGGTTTTTTGGGGGGTTCTGTAGTTTTGTTTTTGGGTTTTTTTTAGTG
TTTTGTTTTAGGTTTTTGAAGACTCAATAGAAATATCTATTGTAGATTTCATTGCTTTGTTGATTAAACT
CTACATTTTCTTACTAAATATAATAATTTTTTTGATAACTTATATATTGCATATTCTTTATATTATATTA
TATAATTTATAATAATATTAATCATAATAATGTAGACATAATAATTTTGTCTTAATAATTCGAAGGTTTG
ATATAATGAATGATAAAACAAATGATTTTTTCAGTGAATATTTATCAGGATTATGTCTGGATTTTGATGA
ATCCACTTTAATTGCTCCAAATAAGAATGGAGAAAAGGAAAAATGCATAATTGAAAAGTCAGAATATGAA
ATTAAAAAAGATAATTTAGTTGGATTTGCAAAGTCCAATTCAATTTCAATCAATGAGCTTATATTGGCAA
GTTTAACTTTAACACTTAATAAATTCAATTTTTCAAATGAAACCTTAATTTTCAATCAAAATAATGTTCC
ATTTGCTGCTAAATTTGAAAACAGACAAATTTCAATTAGGGAATTTTTAGAAAAAATTCATGAGAATTAT
ATTAAAACATTGGAATTCGATGAGTATTTTGATAAGGATGACCTTCCTTTAAATCCGGAATTTTATTTTA
CGTTCGATGAGGATTTAAAATCAGATGCAGAATATTCCAATTATCTAAGCATTGTTGAAAATGATGAAAC
TGTTTCTCTCTTTTTATCTTATAATGATGAATTATATACAAAGGAGTTCATCAATCTATTCATATCAAGC
CTTGAAAAAATCCTTGAAGAAATAGCCACTTCGGATATTGATAAGACAAATATCTGCGACATTGCTATTG
TAGGTGAAAATGAAGATCTCATCTTCACTGAAGTTGAAATGCCTTTGATTCACAGGCGTTTTGAAAAGCA
GGCTGTGGAGAAGGGGGATGAGATTGCTCTTGTTGCAAGCGATGCCACATTGACTTACAAGCAATTGGAT
GAAAAGGCAAATGTCATTGCAAATGCATTGATAGCTAAGGGAGTCAAGCCGAAAAGCAATGTCTTAGTTA
TGCTTTCAAGGGATAGCAATCTGATTGCTTCCATTTTAGGTATCCTTAAGGCAGGCTGCGCATTCATTCC
AATCGATCCTGAATACCCTCAAGAGAGAATAAACTACATCTATGAAAACAGTCAGGCAGATTATATTATT
GCCAACGAATCTGGAGAAAAGTCTTTAGACATTGAAGAGTTGCTTAAGGATGGCAATTCAGATGATCCTG
AGCTTGATGTTGACCCGGATGATTTGGCCTATATGATCTACACTTCAGGGTCCACAGGAAATCCGAAAGG
TGTAATGATCAGCCACAAAAACATCTGCAATCAGGCTTCAAATCCAAAATCCACTTATGAAAGTTTGCTT
TGCATTACAACCATCTCTTTTGACGTGTCTGTTGACGACATATTGACATCCCTTTCAAATGGATTGAAAT
TGGTACTTGCTGATGATGTTCAAATCAAAAATATTCCAGCTCTAATCAAGTTAATTGATGAAAACAAGCC
TGAAATTTTAGAAATTACTCCTTCAAGAATGGGGTCTTATCTTGAGGTAAAGGAATTCTGCAATGTCATA
TCCTGCTTTAAGTGTATTTTCATTGGAGGAGAGAAATTTTCATCAAAAGTTTATGAAGATTTAAGAAAAT
ATAGTGATGCTGTCGTCTATAACAGTTACGGCCCAACAGAAACAACAATCACCTCAAACAACAAGGCGGT
TACTGATGTAAACGATTTGACTGTGGGGCTTCCTCATATTAATTATGTCACCGATGTTCGTGACATTGAC
GGCAAATTGGTCCCTGATGGTGTAATGGGTGAACTGTACATTGGAGGTACCGGTGTAGGAAAAGGATACT
ACAACATGCCAGAAAAAACTGCAGAAGTGTTCCTGACCATCAATAACATTCCATATTACAGAAGCGGAGA
CTATGCAATTAAGCTTCCAAATGGCGAAATCGACATTAAGGGAAGAATTGACAACCAAATCAAACTCAGA
GGATTAAGAATAGAAATCGGCGAAATCGAGTCTAACGTTGGCAAATATCCAAATATCAAACAGGCTGTAG
TTGTAATTAAAGAGATTAACGATAATGAACATCTATGCGCTTATTACACTGCCGATGAAGAGATTGATAG
TGATGATTTAAAAGAGTTTTTAAAAGACCGCCTTACTCGTTATATGGTTCCTACTGTCTTCATGCAGCTT
GATGAGATGCCACAAACACCAAACGGCAAGACAGACTTGAAACAACTGCCAGTGCCACAGCTTAAATTGT
CATTTACCCTTCCAGAGAGTGAAACTGAAATAATCTTGCATGAAATTGCTTCATCAATCAGCAAAACAAA
GGAATTCGGTACTACCGATGATTTGTATGCTATTGGATTTACTTCATTGACACTGATGAAATTAAATGCA
AGGATTTATGAGGAAATGGGTGTTAATTTAGATATTATTTCATTATTGAATGATCCTACAATTAAAAATA
TTGCAAAGGAAATAGAAAACAATGATATTCTGGACTTGAATGGTGTAATAGAATCATCTAAGGATATGGT
TTATTATCCATTGACAGAAAATCAAATGGGAATCTATTATGAGTGCATTCAAAGCGGCGAGCTTGCACAA
TATAATCTCCCATCAGTAATAAGATTTGGCAGTGAAATTGATGCTGACAGATTACATGACGCTATCATCA
AGACAATTGAGGCATATCCTTATCTTAAAACCAGAATTGTTCTAGAAAAAGGTAAAGTGATGCTTAAACG
TGATGATTCAATAGATATTGATGATATTCCAATTATTAATGTTGATAGTATTTCCGATGAGCAAATCGAA
AAGGAAAATCTAAAGCTATTTGATTTGCATAATGACCAGTTATTCAGATTTAAAATCTATAAGACTCCTA
GCGAAACAATTTTATTCTCAGATGTCCACCATATCATTTCCGATGGTGAATCCTTAGATAAGCTCTTTAC
AAATATTTCCAATGCATATCAAGGAATTGAAATTGAAAAGGAAACAATCAACGGTTACATTAACAGCATA
ATTGAAAGTGAGAATGAGAACAGTGAAAAATATGAACTGTCTAGAAAGTTCTTCCAGGATAAGTTAACTC
AAGAAATTGATTCCACTGTACTCACTCCAAATCTCAACGGCAATTTTGAAGAGGGAATTTTAAAATCAAT
TTCCAAAAATATCGACTCCGAATTGGTCAACAGGTTTTGCAGTGAAAACAGGATAACCCCTAATGTTTTA
TTCATGGCAGTAACCATGCTCAACCTAAACAAGTACACATTCAATGACAAAACTTTGATTACAACCATTT
TCAATGGAAGGTCAAACTCATCCTACATCAACACACAGGCATTGCTGGTTAAAACCCTTCCGATTGTTTC
AATCAATGATGATAGGACATTGTCATTTAAGGAATATTTAAGTTCAGTCAATGACATCTGGATGGAAACC
ATCAATCATTCTGATTATCCTTATACTAAGATCTCTGAAGAGTTTGGATTGAAACCAGAGTTTTTCTATG
CCTACAATAATCTTGATGCTGAAGAAATTGCAATTGATGGCAAGACTTATAAAGTCAAATATTTGAAATC
ACTTGAAGTCAATTATAAGATATCTTTGGAAGTTAATGAGACTTGGGACAATATTGAATTATTCCTTGAG
TACAATGACCAATTGTATAGCGCAGATTACATTGACACCTTCTTAAATTGCATCATCGATGTAATAAATC
AATTAATTGAATCGGATATTGAAGAATTAAGCATTGGTGAAATAGAATTGGGTAAAGGTATAGAGACACC
CTTATCATTTACACCTGTTGATATGCCTATTTTACATAAGCGATTTGAAAAACAGGTAACTGATAAAGGT
GATGAAACCGCTCTTGTTGCAAGTGATGCCACATTGACTTACAGGCAATTGGATGAAAAGGCAAATGTCA
TTGCAAATGCTTTGATTAAAAGAGGAGTCAAGCCGAAAAGCAATGTTTTAGTGATGCTTTCAAGGGACAG
CAATCTGATTGCTTCTATTTTGGGAATCCTTAAGGCAGGCTGTGCATTCATCCCAATCGATCCAGAATAT
CCTCAAGAGAGAATAAACTACATTTATGAAAACAGCCAAGCGGATTATATTATTGCTAACGAATCTGGAG
AAAAGTCTTTAGACATTGAAGAGCTGCTTAAGGAAGGCGATTTTGAAAATCCTGATGTTGATGTTGGCCC
TGATGATTTGGTCTATATGATTTACACTTCAGGATCCACTGGTAATCCGAAGGGTGTAATGATTAGCCAT
GAAAATATCTGCAATCAGGTTTCAAACCCTAAATCCTCTTATGATAGTCTTCTTTGCATTACAACCATAT
CTTTTGACGTGTCTGTTGACGACATATTGACATCTCTTTCAAATGGATTGAAACTGATACTTGCTGATGA
TGTTCAAATCAAAAATATTCCTGCTTTGATTAGGTTAATTGATGAGAATAAGCCTGAAATTTTGGATAGT
ACTCCTTCAAGACTTGCCTCCTATCTTGAGGTAAAGGAATTCTGCAATGTCATATCCTGCTTAAAGTGCA
TTTTCATCGGAGGGGAGAAATTTTCAGCAAAAGTCTATGAAGATTTAAGAAAATATAGTGATGCTGTCGT
CTATAACAGTTACGGTCCAACAGAAACAACAATCACCTCAAACAACAAGGCGGTTACTGATGTAAACGAT
TTGACTGTGGGGCTTCCTCATATTAATTATGTCACTGATGTTCGTGACATTGACGGCAAATTGCTTCCTA
ATGGTGTAATGGGTGAATTATACATTGGAGGTACCGGTGTTGGAAAAGGATACTATAACTTGCCTGAAAA
AACCCAAGAGGTGTTTTTGACTATCGATGGCATTCCATATTACAGAAGCGGAGACTATGCAATCCAACTT
CCAAATGGCGAAATCGACATTAAGGGAAGAATTGACAACCAAATCAAACTCAGAGGATTAAGAATAGAAA
TCGGCGAAATTGAAACCAATATTGGCCAATATCCTGATATAAGGCAAGCTGTTGTTGTAATTAAGGAAAT
CAACAACAACGACCATTTATGTGCTTATTACACTGCCGATGAAGAGATCGATACTGAGAATCTAAAAGAG
TTTTTAAAAGATCGCCTCACTCGTTATATGGTTCCGACTGTGTTTATGCAGCTTGATGAGATGCCTCAAA
CCCCAAACGGCAAGACAGACTTGAAACAGCTCCCTGAACCTCAGCTTAAGTTGGCTTTGGTGATGCCTGA
GAGTGAAACTGAAGAAAGATTATATGATATTGTCTCATCTCTTGTGGATGCTGATGAGTTTGGTATTACA
GATGACTTATATGCCATTGGATTTACCTCTTTGACATTAATGAAATTAAATTCCATAGTCTATGAGCAAA
TGGGGGCGAATTTAGACATTTCCATATTATTCAATGAGCCAACAGTTAAAAACTTTGCAATAGAAATTGA
CAATTCCTTTGAAAAGGATTCTGGCCTTGAAGAGCTTATAGAATCAGCTAAAGGCTTGGAATATTATCCG
TTGACTGAAAATCAATTAGGGATTTACTATGAATGTATGCAAAATCCGGATGTGATTAAGTATACGATGC
CTACAACAGTAAGATTTGACAGTGATCTTGATGCAAATAGACTTAAACAGGCAGTCATTGACACTATTGA
AGCACATCCATATATTAAAACAAGAATTGTAAATAATGATGGTGAATTAAGGCAGAAAAGATGTGATGAT
GTGGCAATCGACGATATTGAAATTGTTAAAGTCGATAGCATTAGCGATGAGGACATTGTCCGAAATGATG
TGGGTCCGATTTCTATAGAGGACAGTCAATTGTTCAAATTCAAAATATATGAAACCCCTGATGAGATTGT
CTTATTCTCAGATTTCCATCATATAATCACTGATGGAGTATCCCAAAACAATTTATTTAGAGATATAGCC
GATATCTATGAAAATAGAGAAATATCCGAAGAGATAATCGATGGATATATCTACAGTCTTTTGGAAAAAG
AAGCCGAAAACAGTGAAATATATCAATCTGCAGAGGCATTTTTCGATGATAAGTTAACTCAAGGAATAGA
ATCCACTGTTCTGACTCCAGACCTTAATGGAAATCCTGATGAGGGTAAAATAAAAAATCTTTCCTATGCT
TTTGATTCAGAATTGATTAATGAGTTCTGCAATGATAATTCCATAAGCAAAAATGCCTTGTTTATGGCAG
GCACAATTTTAAACCTGAACAAATTCACATTCTCTGATAAGACATTGATAACAACAATATTCAATGGAAG
GTCAAGTCCAAGCTATTTCAATACTCAAGGATTTTTGGTAAAAACCGTTCCGTTTATTATCAATAATGAA
AACAGGCAGGCATCACTTAGGGATTTCATTAAATCCATTGACCAAAGCTGGAAAGATACCTTGACAAACA
GTGCATATCCATATATTAAGATAGCTGAGAAATATCAATTAAAACCTGAATTCTTCTATGCTTATCATGA
ATTCCTAGAGTCTGATGAAATGATGATAAATGGCAAGGAGTACATTCCACAAGAATTAGCTGGGGTTGAT
ATGGTTACAGTTGAATCCAAAATCAATCTAGCTGTTTATGATAATGGTGATGAGTTTAATCTTATTTTGG
AATATAACGACCAGCTCTACAGTGAAGATTATGTTAAAACATTCATAGAATCCCTGAAGAGCATTTTAGT
TCAATTCCTTGAAAATGATATGGACAATTATAGAATCTGTGATGTAAAATTAAAGGATGATGAGGAAGTG
CATGAATTTGTTGATGTGGAAATTCCATTTATCCATAAGCGTTTTGAAAAGCAAGTTGATGAGGCTCCCG
AAAAGATTGCATTAATTGCAAGCGATGGCTCATGGACCTATGGTGAACTTAACCAAAAGGCAAATCGTGT
TGCCAATGCTCTTATAAACAAGGGAATCAAAGCCAACAGCAATGTCTTGGTAATGCTTCCAAGGGACAGC
AATCTCATTTCAGCTATTTTAGGTGTCTTAAAGGCAGGCTGTGCATTCATACCTATTGATATTAACTATC
CTAGGGGCAGAATCGATTATATTTTTGAAAACAGTCAGGCAGATTATCTTATAGCAGATAGGGGAATTGA
AAATTCAATTGACATTAATGAATTGCTCCAAGAGGAGAATGCCTCAAATCCTCAAGTGGAAATTGATCCA
GATGATTTGGCTTATATGATTTACACTTCAGGTTCTACAGGTAATCCTAAGGGAGTAATGACCAGCCATA
TGAATATTACAAACTTATTCTCCAAAGATGAGGGTAGTGTAATTTATAATGCATATTCAAAAATGAAAAG
GACTCTTGCCCTTTCAACAGTATCTTTTGATGCATTTCTGCTTGATTTCATGCCATTGACCTTCGGTTTG
GAAGTGGTGCTGGCTAACGATAGTGAAATAAAGAATATTAAGGAATTGGCTGAATTGGTTAAAAGAGAAA
AACCGGATTCACTTACATTTTCCGCACCATCAAGGTTTAAGCAATATCTGGAATATGAGGAATTCGCCAA
ACAAGTACCTGACTTCAGGTATATTGGTCTTGGTGGAGAGATGGTACCTCAAGACCTAATTTCACGACTT
TTAGAGTATCCTAATTTAGAATTGTATAATATTTACGGCCCGACTGAAACAACAGTGACATGCAATACCC
ATAAGCTTAGTGATGCGGAGAATATAACTGTTGGAAGGGCCCTCCACAATTGCATAACTGAAGTCAGGGA
TATTGATGGAAAACTGGTTCCTAATGGAGTGATGGGAGAATTATACATCGGAGGTAAAGGAGTATCTAGA
GGATATTACAATATGGAAGAAAAAACCAAGGAAGTATTCCTATCTATTAATGATATTCCATATTATAGAA
GCGGTGACTATGCAATTGAACTTCCAAATGGTGATTTAGTAATTAAAGGAAGAATCGACAATCAGATTAA
GTTAAGGGGATTGAGGATAGAGCTTGGTGAAATCGAATCCAATATTGCCAGATTCCCACATATGAAGCAG
ATTGTAGTTGTGATTAAGGAAATCAATAATGCTGAACATTTATGCGCTTATTTCACAGCTGATGAAGAGA
TAGACATAAAGCTCTTGAAAAGGTATCTGGGAAATAAGCTGACTGAATATATGGTTCCAACCGTATTTAT
GCAGCTTGATGAGATGCCAATATCTCCAAATGGCAAGACAGACATTAAGAGACTTCCAAAGCCAAAATTA
AATCTGGATTATGTTGAAGCTGAAGGGGAAACTGAAGAAAAGTTAGTTGAACTTGTTTCATCCATTGCCA
ATACAACTAACTTCGGCACAACAGACAATCTATATGAATTGGGCTTCTCTTCCTTAACATTAATGAAATT
GAACTCAATGATCTTCAATGAAATGAATGTGAATATTGACATAACTTCATTGTTTACAAATCCGACAATC
AAGTCCCTTGCAGATAAGATTGACAATAATATAGAATTTGAAATAGACATTGATGAAATCATTGAGACTG
CAAAGGATATGGATTATTTCCCATTGACCTCAAATCAGATGGGAATCTACTATGAGTGCATGCAGACTGA
AAAAATCAAATACACCATGCCATATGCAATAAGGTTTGAAAGCAGCATCGATCCTTATAAGCTTAAGGAC
GCCGTTATCAGGACTGTTGATGCACATCCATATCTCAAGACAAGGATTATCAATACTGATGATGGAAAGA
TATTGCAAAAGAGATGTGACGACGTTGAAATCGAGGAGATAGAAATCGTCGAAATAGATTCTATCAGCAA
TAGGCAGATAATGGACAGGGACATAAAGCCAATTCCATTGGATGATAATCAGCTATTGAGATTTAAGATT
TATAAGACACCTACAGAAACAATATTGTTTGCTGATTTCCATCATATCATTACAGATGGAGTTTCTCAAG
GCATTTTCTTCAATGATTTGGCTAAGGCATATAACAATGAGGAAATCGAGGCTGAAAAAATTGATGGATA
TGAATACAGCCTGATTGAAGAGAAAATTTCCCTTAGCGAAGTCTCAGAGAATTTCTTCAAGAAACAGTTT
AGTCAAGGCATTGAATCAACTGTTCTAACTCCAAATATGAATGGCAATCCAGATATTGGAAACATTAAGC
TCATTTCAGATCAGGTAGGCTCCAGTTTTGTCAGGCACTTCTGTAAGGACTATTCAATAAGTCCGAACGT
TTTATTTATGGGCGCTACACTTTTATGCCTTAATAAATTTACATTCAGCGGAAAATCATTGATTACAACA
ATCTTCAATGGTAGGTCAAACTCAAATTATGACAATACTCAAGGAATGTTGGTTAAAACATTGCCTATCA
TTGTAAATGCTGAAAATCGTGACATGATGGTTGAAGATTATATAAAATTGGTTGATAAGGCCTGGAAAGA
TGCATTGACCCATAGCAATTATCCCTACACAAAGCTTGCAGAGGATTATCAGTTAAAGCCGGAATTCTTC
TATGCATTCCATGAATCATTAAAAAGTAAAGTTGAGCTTGATGGCAGGACTTATGAGGCGATTGACCTTG
ACGGTACTGTTTCAACTGATTATAAGATAAACTTGGATATCTTTGATGATGGGGAATTTATTACATTGTA
TTTGGAGTATAATGATCAAATCTATACAGAAGAGTATGTTAATCAGTTCATACGTTCAATAAAATATATC
TTATTCCAGTTCTTTGTACATGATATGGATAAATTGAGAATAAGGGATATTGAATTGGTTGAAGGGGAAA
TTCCAGAGTTTGAAGAGATTGACACTCCGATTATTCATAAGCGCTTTGAAAAGCAGGTTGTTGAAAAGCC
AGGTGATGTGGCATTGGTTGCAAGTGATGCCACCTTAACTTATGGGGACTTGAATGAGAAAAGCAATAGG
ATTGCAAATGCATTGATTAGGCGGGGCGTAAAGCCTAGAAGCAATATTCTCATAATGCTTAAGAGGGATA
GCAATTTGATTGCTTCCATTTTAGGTGTCCTGAAGGCAGGATGCGCATATGTTCCTATCGATCCCGAATA
CCCTTCCGAAAGAATCAACTACATTTATGAAAACAGCCAGGCGGATTATATCATAAGCTATGAGACTTCA
GAGAATTCATTAAATGTTTATGAGCTTCTTGAAGAGGAAATTGTTGTAAATCCAAATGTTGAGGTTCTTC
CGGATGATTTGGCCTATATGATCTACACTTCAGGCTCAACAGGCAATCCTAAAGGTGTGATGATTAGTCA
TAAGAACATCTGCAATCAGGCTCAAAACCCTAAATCCACTTATGATAGTCTTCTTTGCATTACAACCATC
TCTTTTGACGTATCTGTTGATGACATATTGACATCCCTTTCAAATGGATTGAAATTGATATTGGCTGATG
ATGTTCAAATCAAAACTCTTCCGGAACTTATTAAATTGATTGATGAGAATAAGCCTGAGGCTTTAGAGAT
CACTCCTTCAAGAATAGGCTCTTATCTTGAATTGGAAGAGTTCTGTAATGTGATTTCTTGTTTAAAATGT
ATTTTCCTTGGAGGCGAGCAGTTTTCAGCAAAAGTCTATGAAGACTTGAGAAAATATAGTGATGCTGTTG
TCTATAACAGTTACGGTCCGACCGAAACAACAATCACCTCAAACAACAAGGCAGTTACTGATGTAAATGA
TTTGACTGTAGGGCCTCCTTTAAAAAATTATGTCACCGATGTTCGCGACATTGACGGCAAGTTGGTCCCT
AATGGGGTAATGGGTGAATTGTACATTGGAGGTATGAGCGTTGGAAAAGGATACTACAATATGCCTGAAA
AGACAGAAAAAGTTTTCTTAACCATCAATGGCATTCCATATTACAGAAGCGGAGACTATGCAATCCAACT
TCCAAATGGAGAGATTGACATTAAGGGAAGAATTGACAATCAGATCAAACTCAGAGGATTGAGAATAGAA
ATCGGTGAAATCGAATCAAACATTGGCAAATATCAGGATATAAGGCAGGCTGTTGTTGTGATTAAAGAGA
TTAACAATGTTGATCACTTATGCGCTTATTACACTGCTAATTGCGAAATTGACTCTGATGATTTAAAGGA
GTTTTTAAAGGACCGCCTTACTAATTATATGATACCGACAGTGTTTGTGCAGCTTGATGAGATGCCTCAA
ACTCCAAACGGCAAAACGGATATCAAAAGACTTCCGCAGCCAAAAGTGGAATTGAATTATGTGGCTCCGA
AAACAAGGCTTGAACATGAGATCTGTGCAATATTTTCATCTATATTGAATATAGAAACAGTTGGTGTAGA
GGATAATTTCTTTGAAATCGGTGGAACATCACTTATTGCATCAAAATTAATTATTGAACTTCTTAAACAG
GGATATAGTGTAAGATATGATGACATATTCAGGAATAAAACTCCTAGAGCACTGGCGAAATTATTGTCTG
GTGAAGACATTGGCGAAGAGGACTTGGATTTAACTGATGATATCATCAAAAACTACAATTATGGCGAAAT
CAATGAGCTTCTCCAAGAGAATACATGGGAAAACTTCTTTGATGGTGAAAATCTGGAATTGGGCAATGTC
CTATTGACTGGAGCTACAGGATTTTTAGGAATCCATATCCTATATGAATTCATCAAAAGTGAGGAAGGAA
AGATCTATTGTATGTTAAGGAAAGGCAAGTTTGATTCCTGTCAGGAACGGTTGATTGATGTGATGAATGA
TTACTTTGATGAGGATTTCACTGATCTCGTCGGCTCACGCATCATTCCAATCGAAGGGGACATAACTGAA
ATCGATGATTTTAAACAGCTTGAGGATGAGCCTATTGATACGGTGATAAATTCGGCCGCACTTGTAAAGC
ATTATACTGCCGATGATTATATCTTCAGGGTGAATGTCGATGGAGTAATCAATGGACTTAAATTTGCCCA
AACTAGAAATAACATAAAATATGTACAGATATCAACAATCAGCGTTCTTTCATCATACTCCTTAAATGAA
GAGGCATATCCGAATCAGGAATATGATGAAAGGACATTATATTATGAGCAGGATCTAGAAAACAAATATG
TATGCAGTAAGTTTTTAGCTGAAAGGGCGGTTCTGCAAGCTGCAACTAAAGGGCTTCCAGTAAAGATAAT
CAGAGTTGGAAATCTTATGAGCCGTTATTCAGATGGTGTGTTCCAGAAAAATTATGATACAAATGCATTT
TTAAATAACATTAAAACCATTAAAAAATTAGGAGCTATGAATCCTGCAATGGCTAGTGAAAAGGTTGACA
TGAGTCAAATAGATTATGTTGCAAAGGGAATACTTGCATTGTCTAAGACTCCAGAGAAATCCAGGGTATT
CCATTGTATGAATAATCATTATATTTCCCATAGGGATATTGTTGATGCATTGAATACATACGGTTACGGA
ATTGAAGAAGTGGATTTCGAAGAATTCAAACAGATTTACGAACAAAACATGAATGAGAATATACAGGGTA
TAATAACTGCCGATTTTTCAATTGATGACTTTGATGAGGAAGACGATTTCGAGGAGAATGTGGAAATTGA
ACAGACTGTTGATATTCTTCATTCGTTAGGATTTGATTGGCCTGAAGCAGATGAAGAGTATCTTAAACGA
TTGTTTGATTATTTGAATAAGTTTGATTATTTTGAATAAATGGTGGATTAATGTCAAATGAAATTATTTC
TCTTAATTTTGAATAAAAGGTGAATTCGTGTCAAATGAAATTATTTCTCTTAATTTTGAATAAAAGGTGG
ATAGTATGTCAAATGAAATATAACTCATAAATTTAGGGAATTGTTGTTGCCGTCACTGCTTATAGCTATG
GCTTTAAACATAGCTTCAGTCGTTGATGCAAGTTTTGTATCAACCTTTATCGGACACAATGCACAGGCGG
CTTTACAGGTCTTAGAGCCTTTGGTATTGTTAATTACAATATTTGAATGGCTGTTTGGACTGGGAGGTCA
AATTTTAGCTTTGAATAAAAAGGCGGAATTTGATGAAGGTGGAAGCAATCATTATTTCACAACTGCAATG
CTTGCAACAATAGTTCTATCAGTTTTGATTTTATTGGTATGCTTTTTATTTAAAGATTCCTTAATTAATC
TATTGCATCCGACTGCTGGAGCACTGCCTTATGTAAACGCATATAGTCCATATTTATTCATCAGTTTCCC
AATTGCAACTATCTTGGGAGTATTATGTCAATTTATTCGTGTTGACGGGCAACCGAATTTTGCTTCAGGA
GTAATTATTGTTGCAAATATTATCAATATAATTTTAGATTATCTCTTCCTTGGTGTTTTTCATATGGGCA
TTGAAGGGGCATCACTTGCGATGATGATAGGTTATGCAGTTGGATTATTGTGTACTTTAAAGTATCATTT
TGATTCAAAAAGAACTTTCCGATTCGTTTTTTCCGAATTGAAATTTGGGACTTGGATACGCTCAACAATT
GAAATAATCAAGATAGGTCTTCCAGGGGCAAGCATGGGCTTCTTTAATGTATTGTTGATCTATATCATGA
ATTTAATTGTTGGCGGAGTTTTAGGAGAGCTGGGCTTGGATATATTCAATGTATGTGTGGTTGCATTGCT
TTTAATAAGCATTTTAATCATGGGATTCGCCGAAACATTATCTTCCATTGTTCCTATTTATTATGCCCAA
AATGATTTCTATAATCTTCATCATATTGTGCGAAATTCAATTATAATAACATTGGTCTGTTCGGTGATAT
TCACTGCATTCCTCTTAATATATCCTGATGGTCTATTGATGTTTTTCAAACTTCACCAAACCGCTAATGA
TGGATTAGTGGAAAATGCGATTAGGATATACTCATTGGCATTCATACCTATGGCATTTTCAACTATGCTC
TTGTTTTATTATGAAGGGATTGAAAGAACTGTGGAATCTGGAATCATTACAGTCATTTCTGAATTTCTTG
GACCATTATTTTTTACATACCTATTATATCCATTCATAGGCATAACCAGCGTTTGGCTATCTTTCCCTTT
AGGTTTTATTCTATCAATAGTTGCTGTATCCATTTATGTTAAGGTGGTTGAAAGAAAAGATAGCGAATAT
TCAGGATTGTTTTTCATTAGAAGGGGATTGATTGAAAAAACAAGAAATTACACTTTAGAAAGCAAGAATG
ATGCTGTGAAATCTGAAATGTTTAATCATTTAAAGAGTTTGAATGTGGATGATTCATCTATTGAAACATT
GGATAAGATTATAGGTACCATATTTGATTCAAACAATGAAAAAGTCCATGTGGAGATATTATTGATTGAT
TATGGTGATAAGATAGTTATCAATATGAAAGATGAGGGAAATAGAGAAGTGATGAAGGATATTGAAAAGT
CCTTTTCCCAAGATAAAATCAAAGTTAGTGAAGTGTTGGGATTTAATAATGTAGAATATTTGATTGATGG
GGCCTAGTTTTAGGGCGTTAAAAATCAGGGGTTTTTTATTATTTGGACTCCATTGGTCCTTTCCCATTCA
TTAAATCGATATCCAAATTCATAAGAATAAGTTTAGGTATTTTTGGTGCTGTATGATTTGGTGCTGTATG
AAAAAAGGGGTTTTAGAATGGTTATAATTCTAAAACACTAAAAGATTCTAAGTTTAATAGATCAAAATTA
AGTATCTTTGGAGCATAGGTGACTTCTCCAATGCCTGTAATTAACTTATAAGCTTCAAATGCTTCCAAGC
ACCCCACTATATTTGGGGTAGGTCCAATTACAGGAGGAACTCCCTTTGTTAATTTTGATATTTCCTCTTT
TGTTTCCTCTCCCAGTTCCTTTCCAAGGGATGGAAGTGAGAACATCTCTTCATAGGACTTGGTGTCCTTT
GTAAATACTGTAACCTGTCCTTTTGTTCCGTGGATTGCTCCATGGACATAAGGAATGCCGTTTTCCCTTG
CAAATCTTGTTAGGATCACTCTTGTATAGAGATTGTCCAATGCATCCAATATTACATCGCAGTCCTTGAA
GTATTCCACATTATCCTCATTGATGAATTCGTTGATTGCAGTTACTTTTGTGTATGGGTTGGTTAATCTT
ACTTTTTCTTTTGAAACATCTGCTTTAGAAAGTCCTAATGTGTCTATGCTACTCATCGCTTGTCTGTTTA
AGTTGGATAAGTCAAATTCATCCTTATCTACAATGATTAATTCTCCTATTCCCATACGTGCAAGCATTAA
AATTGTTTCTCCTCCAATGCCTCCACATCCTATGACTGCTACTTTAGCATCTTTAAATCTTGTCTGTTGG
CTTTTACTTACAATGCCCATTTGACGGGTTGCTATATCCCAGTATCCAAATCCTTTATATCTTTCTGGCA
CATTTCCACATTCCTATAAATTTTTTTAAATAATTACTATAATTTTTTTCTAAATAATTCTTATATGTTT
CATTATTAATTATGTCTTGAAATCTCTTATTAATATATATCGTAAATCCTTATTTAATATTTTATCATCA
TCATATATAACAATTGTTATTTTTTTATCTCATTCATGGATTCTGAACAAATATTTCATTTAAAATTAAG
TGGGTTTGCACTGGATTTAAAGACTTATCTCACTAGAAATAGTCGTATTTTCGCCCAAAGAACTCATCTA
CCTTCTTTAAGTCTTCAGAGATGTGAATCATTTGTGGGCAATGATATAGGCAGTCATCGCAGTGTATGCA
TTTGTCTGCCCTTGTGTCGCTTTCCAATGAGAAATAGTGCATGGCGCTTCCTGCAGGGTTATTCAGCATT
TTTGCAATATTGTACTCCCTGAAGCATCCTGCAACATCCACTCCGTGAGGGCATGGCATGCAGTATTGGC
ATCCTGTACAGTCATTTCCCTTTCTTTGCTTATATTCCCATGCAACTTCCTTGATTAGGTTCAAGTCATT
TTTGCTGATTGAGTTTATTTCGGACTTATTTGCTATCTCAATGTTTTCCTTGACCTGTTGGATTGAATTC
ATTCCGCTGAGTACTGTATCGACTTCTTCCATATTCCAGAGATATTGAAATGCCCATTCAAGAGGAGTTC
TCTTTTCCTCTGCAGTGTCCCAAAGGTCCATAATGTCTTGAGGAATGTTCTGGATTAGTCGTCCTCCTCT
AAGAGGTTCCATAATCATAGTTCCAAGGCCCATCTTGTGAATGTATTCCACCCCTTCCCTTCCGGACTGA
TATCTCTCGTCCAGATAGTTCAATTGGGTAAGGCCAAACTCAAACTTGTCATAGTCATCTACAATGTCTA
CTATCCAATCCATTTCAGTATGGGCAGAAAAACCAATGTGCTTTACTTTTCCACTTTCTAAAAGACTGTC
CATAAATTCAAATGCACCAATTTCCCTATACATTTTCCAATAGTCTTCATTAAGGCTATGAAGCATGTAT
AAGTCAATGCAATCTGTTTGAAGATCTTTCATTTGGCTTTCAAAGATTTTTTCCATGTCTTCTTTTGTCT
CTATCAGCCAGCTTGGCATTTTTGCAGTCAATAAAACTTCGTCTCTATAAGAATGCTCATTTAGGAAGTT
TCCAATGTACTCTTCACACTTTCCTTTTCCAGATAAGTTATTTGCATGATATGAATAAGCAGTATCAATA
ATATTTATTCCATTATCTATTCCATAACTTAAGATTTCATCAGATGTTTTAACATCAATTTGATCATTAG
TTTCAAAATGAGGCAATCTCATTGCTCCAAATCCTAAAATGGAAACTTTTTCTCCAGTTTTTCCTAAAGT
TCTATATTTCATTGTGTTACCTGTTGATTTATTAAAATATTTAATAATTTTTTATTTTTAATTTTATAGA
TATTTTAATATTGGTCTTTTTACTTAATATCATTTTTTAATAAGATTTTTAATAGATTTTTTAGGTTTTT
TATAGGTTTTTTTATAAGATAATAGTGAGCTTAAAACTTGTAAAATCATGTCTTTTGAATTGACATTTTT
TTTTAAATAAAGAGGGTCCGCCAAAAAGCTATTTTTTTAAAAAAGTTTAAAATTTTCAATTTTTTAAGTT
ATTTATTTTAGTTATTTTTTTAAAATTCGATGTTTTTTCTATTGTTTTCTTTTAATTTTGGTGCTTGCAC
CTTGAAAAAATTTTTTACTTGTTAATTATTCTTTAAATATGAAATAAAGCAATAATATTATAGTAAACTT
TATATACTACTTTAAACATAAATAATATCAACAAAGGGTTAATATTTTGGTGTTATTTATGGTTAAAAGA
ATTCCTGATGAAGAACAAATAAAATTAGGCATTAGAACTTTAGATTTTAACATTCCAGAGGATCATATTT
CTCGTTTTGTTGTGGATTTCATTGACGAATATTATCCTCTTTTAGGAATCAAAGAAAATAAAAAGAAGAA
AGGGCGTGACAGTTTTCCTGTGAAAGAGATGTTAAAATTGCTTATTTATGCTAAAATCGAGCATATTGAT
AGTATGAGATTCTTAGCAGACATGGTAAAATATCATGACGTATATAAATTCGTTGGAAATGGAATTTGTC
CTTCAGAACGATCATTACAACGATACAGAGAAAAATACGGCAAATATTACAATGAATTGTTAAAAGCAAC
CTTAAAAAAAGCTTCAGATGTGGATTACACTGATTTCAACGAAGTTTCCATTGACGGAACCATCAAAAAA
GCATACAATTCAAAAAATAAAGTGATCACAGAAAAAGAAACTGAAATATTAACCCGTTACTTCGAAGGAG
GCCGTGTAAGTCAGGAAGAGCTAGATAAACTCCATAAACCGGCCCGAGAGATTCTTGAAAATAAAAAAAT
CAGCAACCAAGAAAAATTATACCTCTTGGATGACATTAAAACACAATTCACACTGTCTGGTCAAAAATCA
GTGCCAGTAACCGACATAGAAGCACGTTGGATGAAAAGCAAGAAAGGAAACTCACAAATAAGCTATAATA
TCCAATCTGCAGTCGATTACGATACAAAAATGATTTGTGCAATAAACGTCGTACAAGCCCCTACAGACCA
TTACCAATTGCCAAAAATCGTAGATAAGGCAATAAACAACACAAACGTAATACCAAGATTCGTATTGGCA
GATACAATCTATCTGAATGAAGAAAGCTTATCATATCTTGCAGATAATCAAATAAATGGAGTTATACCAG
ATAGAAAGCAATCCAAGGAAAAAATCGGAAGATTGAACAAGAACCCATATCACAAGGATCACTTCAAATA
CTTCCCTGAAATTGATGCATTTGAATGTCCAGAAGGCCAAATAATGTATTTTTTCAACAAATACACTGAA
AAAAATGATGATTTGGACAAGCCAGACAAAATTAAGCGTTTATATTCCAATTATGGTGCTTGTAAGGCTT
GCAATTGCCGTGAAAACTGCCTTTCATCCACCCAAACCCACAGAACAATCACCGAATATGGCGGAAGTTT
AAAGAAAGCAATGTGGGAAAAAATGGAAACAGAGGAATATAAGGAAGAATATGCAAAAAGGTCATCTGTC
GAAGGACCTTTTGGCATTTTAAAGGAACAATTCCATATAGAAAGCGAAGTAGTGATAGGAAAAACAAAGA
CAGAAGAAAGAATACTATTAGATGCCGTGGCTTATAATTTAATACGATTATTTAACTTAGAACAAGAAAT
AAAAAATGATAAAGAAGATATAGTTGATTTCTGTGAGAAAATTTCTGTCCAAGAGAAATTAGAGGTCAGA
GCAACCATATTTTAACTGGTGTTGTCAAAATTTTATTTTGGCGGACACCCTAAAAAATTAAAGATTTAAT
AAGTAGTTGAAATAGATTATTATCTATAACTATATTTTAAAAGGTGCACTTAATATCTTATGAGGTTTGC
AGAATGAAAAGAACAATTAATGAAAGATGGGAATTATGGTATAATCGAATCTTGCCATATATTATAATTT
TTGATTTTATATTGATTACAGTTTCACTCATACTAAATGTTTCAGAACCTACAATGGCTCACATTGAACA
TTTTGACCTTTTAGTCTGCATAATCCTTTTGGGAGAATTCTTTTATTTTTTATACAAGGCACCGTCAAAG
AAAAAGTTCCTGCTTGACAGGGATATCTTCTGCTTTTGATTGCATCAATACCATTTGATTTTATAATTGA
ACTATTTATGCCCGTTAATTTTCCAGGAACCATTTTAGGATACCTTAGAATGTTAAGGTTAATAAGGGTG
ATAAGCTTTGCCCGAATGGGGTCCTTTGAAGATTTCTTCAAAAAGACAGAGTTTCACAAAATCATAATTG
CAATAGCAATCATTATAATGACATTCACAGCTCTGTTTTACGTGTTTGGAACCAGCTACAATCCTTTTGA
TTATTTCTATTTTGTTATAGTGGCACTGACAACTGTTGGATTTATTGACAAACCCCTTAAAAAATAATTC
ATAATTAATGTAAGCTCATTTTTGAGAATAGATTTAGCACCCCTACACCTATAATGATAAGTAAAAGTCC
AAGGATAGCAGCCCAATCAGGGGTCTGTTTGAAAGCGATAATCCCTACAATTGTCACAAGCACGATTCCC
AATGCTGACCAAATGGCATATGCAACTCCTATTGGTGCTGTTTTTAGGCAGTTGCTGAGACTGTAAAATG
ATAATATGTATAATATGATTGATGCTATTGTTGGCAATGGTTTAGTGAAACCTTCAGCAACTTTTAACAG
TGATGTGGCACTGGTTTCAAATAGAATTGCAAGTAAAAGATAAGCAATATTATTCATTTTTGGTTTCCCC
CATATTTTAACTGTTCAAATTCTTTTTTAATTTTTTCCAGTTCCTCTCCATGATATTCCTCTTCAAGATT
GAAAATGGCGAGTTCGTATAATATGTTTTGAAGCCTGTGGCCTTTTTCAGTCAGGTGATATGATGTTTCA
TTATCTTTGATGTTTTTTTCGATGATGTTGTTTTCTTCCAGTTCCTTAAGTCTTTGTGTTAGGATTTTAT
TGGACAGTTCAGGCTTGTCCTCTTTGAAATCGCTGAAATATTTTTTTCCAAGAATCATGTCCCTTAAAAT
GTATACTGTCCATTTGTTTTTAATAAGATTCAGATTTTTTTCAAATTGACAGTATGGGGGCAGTTTATCA
AATTTTCTTTTAATTGTCATTTTTGCACCTATTGTTAAATTTAAACCTTTTCCTTTAAATATTTTTAAAA
AGTATTACTTTAAAGAGGATATCACACGGTTACTTATTATTTTTGTTACCTTTTTGTTACAAAACCTTTT
AATTGTAGTTTATTTATAATATAATTTAAAACACAAATTATGGAAAGTGAATTAAATGAAAGAAAAAATA
TTTATCAATGGAAGAGGAGGATGTGGAAAGAGCACATTCATATCATTAATTGCAAAGGAATTGTCAAAAA
ACAATAAAGTATTAATAATTGATATGGATGAGGGAAACCTCGGATTGAACAAGATGCTTAATGTTGATGT
TGCAGACACTTCATTAATGGAATATTATGGTGGAAGAGATAAGATAATGGGTGAAATTTTAAAAGTAGGA
ATTAAAGGTATGGTTTTAGAAAAAATCAACCTGAAAGATGACGCAGCCTCAGATTCAATAGATATTTTGG
ATAATATGAAATTATCAGATTTACCTTCCGATTATGTGACATGGAACGGAAATATAGGATTCATTGAATC
CGGAAAAATCAACGACCCTGATGAAGGCTGTGCCTGTCCGATGGGAAATCTTACAAGAGACTTCCTAAAT
CACATTGAATTACAAGACAATGAAGTAATATTGGTCGACACCTCAGCGGGAATAGAACACATTGGAAGAG
GAGTAATTGAGTCTGCAGACAAACTCATTTCAATAGTTGACCCGTCAAGCGATGCAATATTGTTGGCAAA
TAAAATAGGATCATTATCAAAAGAGGCATCCAAAGAATATATGGTAATATTGAATAAAATTGATGAAAAT
ACTAAAGATTTGGTATTGGAACAATTGGATGATGACATATCTGTCGTTGGGGAACTTGAATATAATTCAC
ACATAGCTCAAAGCAACCTTTCCCAAAAAGAAATTAACCTTGAGGAAGTAGAAGGTGAAATTAAGGAAAT
CTGTGCAAAAATTTAAAGATTTGATTAAGATTTAAATTTCAATAGGGCGCATGGTGCAATAATGGATTTG
CTTTTTTATGTTGTTTTGCTGTTGATTGGAGGTTGCTTTGCAGGTTTCATGGCAGGCCTTTTGGGGATTG
GCGGTGGAATTGTAATCACTCCAATCCAATATTATCTTTTAACCTCAATTGGATGTGATCCTAAAACGTC
CCTAACGGTTACCTTTGCAACAGGTCTTGCAGTTATCTGTGTCACGATGATAAACAGTACACGAAAGCAC
AAACAAAACAATCTAATAGTAAAACAGCACCTAAAACCAATGATGGTCTTTGGTTTTGTAGGTGCCATTC
TGGGTGCAGTCATATCTCAATACATAGATGTTGAGGTTTTAAAGATTTTGTTTGGTGTAATATGTATAGT
ATCAACAGTATTTTTAGTTTTAATAAAATCTCCTACCTCTTTAGATAATATTAAAACTGATGCAGGATTA
TTTTACTCTATTGCATTTGCATGTGGTCTTGCAAGCGGATTGATAGGTCCCGCAGGAGGAGCATTTATCA
TACCGATTTTCGTGGCATATTTGAGATATCCAATAACAAATACTATCGGAACAACTTCAGCATTAAGCAT
CGCAACCACACTTGCAGGGGTAATCTGTTATATTGTTTTAGGTTGGGGTGTTCAAGGATTGCCGGATTTT
TCATTAGGTTATGTCAACTTGCTTCAATTCGTATTTTTAACAATAACTAGCATTATTGTATCCGGATATG
CTGCTAACCTATCTAAAAAAATCAATCCTACAAAATTAAAAGCGCTGCAGGTAATCGTAATATCATATAT
TGGCCTTCAAATGATGGGTGTATTCGACATAATATTAAGCATAATATAATTTTGATTTGTATGTATAAGG
TATGGAAAAATTGTATTGGTTGTGGGGAATGTGCAAAGGCATGTGATTTTAATCTGATTCAAACATTTGA
TGATTATATTCTGATGGATATTGAAAAGTGCAGGCATTGCTCAAAATGTGTAGAAACTTGTCAAAACAAT
GTTTTTACAAAATCAGTTATTTTTAAACACTTTTTATATCTATTATATTATAAGATTAAAAAATCTTAGG
ATAATTGAAAAATTGATGAGTATCTCATAACAGTTAAGATTTTTATATAGGTTAATGGTTTGTATGTCCA
ATTTTTGTAAGGCATTTGACAAGTTATATTTGTTTGTTAAATGTGGAAACAAAATTCACTAAAAAGTAGT
AGATAATTTAAAGTGTGTTACGCCAACAGCAACATGAAGCTAGTCAAAAGGAACAAAAAGTTGCACAATC
TTGATTCTCCTTTGTTGATTGGTGATGTTAAAGATGATGATGTTGTAAAAAAGGTTAGAGAACATTGTTT
CATTGAAACTCACGAAAAAGTTCTACCACTTATGCATATTTTTCAATCAACTTTATACAAATATTTTGAA
TTAATATTCATGAAAAGAAAAAGTAGCTATTAATTATATATAATTTAAAAAAGTAAAATATTATTAATTA
ACATAATTGAGGTATTTTATGAAAGGGCATGCGAAAGTTGTCATACTTATGTTCTCTCTACACTACTTTT
TTTAGAAATCATGATAATTAAATATTTTCATCTATACTGGGTGAAACTGGGATGGTGGAAATACAAATCC
TGAACATCTACTATAATCACTGACATAACCTGAACCAACTAATGATGCAAAGGTAACTACTTGAGTATTA
TTGGAAAAGTTGAGGGTAAGATGCTGAAATTATTTATAAACAATTGATGACAAGCAATTATTGTTACGCC
AACTCCAACATGAAGCTGGTCAAAAGGAACCAAAAGTTGCATAATCCAGATTCGCCCTTGCTGATTGGGG
AAGTTAAAGATGGTGATGTTGTAAAAGAGGTTAATGAACCCAGCTATATTGATTCACAAACTAGGTTGCT
TTGATTTTTAGTTTTGCAATATTGGGGTATGTTTATATTAAGAGAAAATTACATTTTCAATAGAGACAAT
CTCTGCTTTACCTGCATTCAATACTATTGAACTGGCCCACATTATGGAAGGCGAGGAAGTTTAATGTACA
AGATTGTGTTTAAAGAAAAAAGAAGAAGAGAAAACTATCTGACAATACTTTTAGCAAAGTTTACGGCTTC
GTTTATATCTTCTTCGTTTGGATGACCTCTATGAACGAATTTAAATTGTCCTCTGCAATGGAATTCTCTA
TCATCCATGTTTAATCCACATTTTTCAGCTTCTTTTTTTATTTGCTTATAGGTTGATTCGATAAGAGCTG
CGGATGAGACATTAACAATACTTCCAACATTCACATCAATATTTTTGAGGAATTCCTTGACTTTTGAATC
TGCTCCAGCATTATATACACTATTTCCCAAGAACAATATGTCAACATCTTCGTTTAAAGGTTCATCTATT
GTTTTTGGAGCAACACCGATAGCTTCACCTATTGCTTCTGCAAGTTTTTCAGTATTTCCAGTTTTTGAAT
AATATCTTATTGCAATTTTCATTTTAAAACCTTCCTTGAATTGTATTACTACTCACAAACCCAACTAATT
AACTCATTAATTTGGCTTTGTTGGTCGTCTTTACTTTCAAATCCTTTAGGATCATTGTTTTCACTACACA
TAACATTTTTGTGAGCACCAAATCTTAATACTCCAAATTCAAATGCGACATGTTCAGCTACAGGTGTGTA
ATCTGCTTCTCCTCCACCATAGCTGAATACTATACCTATTTTTTTTGATTCGTCTGGTGCTTTCATCTCT
TTTGCAGGATTGAATTTGGAATAGAATCTGTCAATTAAAGCATCGACCATTCCAGGAAGCCTTCCAAAGA
AAATAGGGGTGATAATAAATGCACCGTCACATTCTTCCAGATCATTGATTAAATCATATGCATCATCTTG
AACTATGCATTCGTCTTTTGCCTTACAAGCATTATCAGCTTGACAAAATCCGATTTCTTTATCTTTTATA
TTGAATATTTCAACGTCTCCATCAATTTTTTCTTTGATGAAATTTGCAATTGCATATGAGTTTCCTTTTC
TTGTACTTCCATTTATAACGATATATTTTGCCATAATTAATACTCTCCTTTGTTGAAATAACTTTAAAGT
TATTATATATTATGATATATGAGATCGTATTAATATAGTTAATCGTTATATAAATGTAGCAGGTGCATAA
TGGTAACCTTTAACAACACTATAGAAACATTTTTAAATTCACTCCTACAAAGACTATTACATGAGTGAAA
GTGATGAAATAATCAAAAGACTGGACAGAATAGAAAATGAATTGATTACAATAAAAGAAAATAATTACAA
TCAAAACCTTCAAACTGCCATTGAAAGCATTAGGGACACCTACTCTAATTCAATCAAGAAAAATTTTGCA
GACAATCTGGGGGAGAAGTGTAGTGAATTTTATCTCCCAAATTGCAAAAATGAAGAGTGCAAACAATTTA
TAGTCCAAGAGTTCAAAGAACTTTTTTTAAATACTCAAGAAACAGACCTCAACAAACTTAATGAACAGCT
GGATGAAAAATTTTATTCTGTATGTGGCGTAGAATGTAGTCCATGCTACAATAACTTTAAGGAATACTTC
TTTGAAGAGTTGAAGATGATCAATTCCATTAATGTGTCATATGAACTTAATGAAAATGAACCGATTGAAA
AGTTGGATGTGGATATGTTAATTTCCGATGTATTTGAACCGTTATCGAGCAAGCAAAGGGTTATCATAAT
AGAATCGTTATATGTAGAAAACAAATCATATACTCAACTTTCACATTTAACTAAATTAAGGGGAGGAAAC
CTACTGTTCCACCTTGAAAAACTACAGGATGCAGGTTTAATCTCACAAAAACAAGACCGTGGCGAATACC
TGCTCACAAAAAAAGGTTATACAACTTTGTCCTTAATAAATCAATTTCAAAAATTAATGTAATTACAATA
ATTGGCCACATTTATACGGGTTATAATGTGTCATTGAGAAAGAATTTGCCAAGCAATATTGTTTTCACTG
TTCACGAACAAATTTCACTATACGTATCGGAGAATTTGGTTATTATTATGCCCACGCCAATATGGAACTG
GTCAAAAGGAACCAGAAGTGACACAATCCTAATTCTCCGTTGATACTTGCTGAGATTAAAGAGAGGGAGT
TGTAAAAGAGGTAAATGACCCAGCTATATTGACAGCCAACAAACATTGATTTGATTTCGCCAATAAAATT
ATTGTTTTGAAATTATAATATTGTTATCATTCTTAAATATTGTTTTATTTTATTTTAATCGTTTATTATT
AAAATAAATAATTTTAAATAGTTTATAATTAATAATATCTATAAAAATATGATTAAATTTTTTATTTATT
TTTTTTGATATATTTCTTAAAATAAATTAGTAATTGCTTAAATAAAATTAGTATAATTACTTAAATATGA
ATAGTATAATTACTTAATTGGTGGTATGTGGAATATATTAAAAGATATGTTTTGCATATAATGTAATATT
TATAATTTTAAAACTAAATTATTATCATGAAAAAGTTTTTGAGTGTTGCATTAAAATTCCAATGGAAAAC
AATAGTGTTTATTTTCGCATTAATAATCATTCAGACATTCGTTCAAATGGAAATAATTGATTTGTTCGGT
GCGGCTTTGACTGGAGTCAAAGAACAGAACGTTGATTTGCTTTTCAAATCAGGATTATATATGTTAATGT
ATACCGTCATTTCAATGATTGCCGTTTATGTCATCTCTTTTCTCACAACAAGAGTGGCTTCAAAATCAGC
ATATACTGTCCGTGAGAAAATATTCCATATTCTGATGAACTTGCCTCGTGAGGAAATTGATAAATTTAAA
ATTTCAGGGCTAGTTACAAGGTCAACCAGAGGTATGTCCTCCGAACAGGGATTTATAGTGATGATACTCG
AACAGTTAATGCTTATTCCAGTTACATTCGTAGCAATTGTATATGAAATAGCATTGATTGATGGAACTTA
TGCATTATTTTTCTTAGGATTTATTGGTGTTCTTTCTGCAATCATAATTTTTAGAATGAAACAGATTGTG
GAAATATTTTTCAGAGCTAAAAAGACATATGGTAAACTAAATTTATTATTCTTATCCAAAATCAATGATA
TAGCTGGCAGGATTCCATTTAACAAACAGGAGTATGAAGTCGAATTTGAAAAGGCATGTGAGAACTCCTA
TGATAAAAATGTCATCTATATTAAAAGTCAATGTTACCTCGGACCAATATTAATGTGGGGTTTATATGTT
ATTGTCCTGGTTACATTGGCAATGGTTAATTCAGGATACACCATTGGATTTGAAACTGATAGTGTAATTG
ATTCATTCATTATTCTGGTATATGTTGCCTACTTCATCACTACTCTAGCTAATATTCCTGCATTAATTGA
CAGATGGCCACGTGCATATGCCACTTCTGTGCGTTTGGAGGAAGTCTTGAATATTGAAGATAAAATCATA
AAATCCAATACAAATGATAATCTGAAGGAAATAGAGATTGTTGAGGAGGATATTGCTCAAGAGGCTAAGG
GCATATGGGATGAAAGAAAGGGTATCTCTGAAAAATTCACTGCATTGTTAAAAGAGGATAAGGCCAAAGT
AAGAATATCAATGATTTTACTTACGATATCCACATTGTGCATGGTTTATGCCCCAAAAGTTGCCGGAAAA
ACAGTTGATTTATTGGCTTCCAATTGGAATTCAACTAATGACCCTGCTATCTACATTAGTCTTGCCCTGT
TGCTGGTATTGTATTCAGTAGGATATCTGTTTAAATTACCTCCAAAGAGAATCATGGGGGCCACAGGTGA
AAAAGTAGCATATGATTTAAGAGTGAAATTATTTGATAAGCTTGATGCTGTTGGTTCCGATTTCATTCAG
GAAAATTCAAAGGGTCTTGTTCTATCCAGACTAAACAACGATGTGATGAACATCAGGGAGTTTGTTTCAT
CTAAATTTACTGAAATTTATGCGCAGATTCTATTTATAGTCTTTGTAATAGTGTTGATTGTGATGACAGA
CTTCAGGTTGAGCTTAATATACCTTGTGATATTGCCGGTTTATGCCGTTTGCTTTTATGTATGTGATGTC
AAATCTAAAAACTATTACGATGGTCATCAAATGCAGTTGGGGAGATTGATGAGCTATTTTGAAAGAGGCC
TGTCAAATCGTGATTCATTCCATGAAAAAGGGTTTAAAAAAATGAATCAAACTGTAATTGACTATTATGT
CAAATCCAAAAACGTTACTAATTTTATGGTGCCTGTTACAACCCTTTTAACAAATATAAGTAAGATAACT
GTTTATATTGCGGGGATTTACTTTTTAGCAGGTAATGAGATTCAGATAGGGACTCTATTGGCAGTTATTA
TGTATGGGCAATTATTAACAGATCCTATTAAAAAGCTAAGTTCCTCGATGGCCACTATTGAAACTTCATT
TTCAAGCATCAAAAGGATATTTGCAATCATTGACTATAAAAACGATAAATAATTGAATTTCAATCATCTT
GATGTCTGATGTAAGCTCAATTATTCTTGCAATTTGAATTGATGCTTTTTTTGAATAATTCTTTGAGGTT
TCATAATCCGATTTGCCATTGATGATTGGTGTTGTTGTAAAAGAAGTCAATGAACTCAGTTATATTGATT
TACAACAAAAATTATTTTAAACTAAATTATATTATTTTCCTTCTAGACGTTTAATATCTAAAATCATTTG
ATCAAAGTCAGAAATGAAGTTTTCATCTTGCACTACTCTGAATTTTTCATATTTTTCAAGCACATGTTCT
CGTGCTTCTTCAGCAGATATCTTACCTTTGCCAACAAGAATTGGCAGCCTTCGAAGTTTAAGGTAGTCAT
CCAGCAGTTCTTTCCAATCTTTCATACCCATTGGGATTCTATCCTCTGCGCGTGATTCGGCTAAATTCAA
AAAACCTTCTACTAAACTATTTAATCTTGATAATTCATTTTGATTCAAATAATTTTTGGATATGACCACG
TCACTTTGTAGTATTTTTCCATTTGGTGCTTTTTTCCAGGTTGTCAAGCCCATATGAGGATTTTCAATAT
CGCTTCGTGTTTCTATGAGTTCTGCTGCAGTATGGTTGCTTATTGCAAATATCAGTTTGTTTTGTACTGT
GGCAAAGAATTCTTTTGTTATGTCTGCATCTTTGTTATAATCAAAGCTTGTTGCATAAATGTCTGTGATT
TTTTGATTGAATCTTCTCTCTGAAGCCCTTATTTCTCGTATGGTTTCTAATAATTCATCGAAATAGTCTT
CTGTAAATCTTCCACCTTTTTTCAGAAGTTCTTTATCGATGACAAATCCTTTTATCATATATTCCTTTAA
TATTTTATTGGCCCAACGGCGGAACTGTGTTGCTTCTTTACTGTTTATTCTGTATCCTATTGATATGATT
GCGTCAAGATTATACCATTTTTGGGGCCTACCTCGATTATTTGATTTTTTTAAGGATTTCTTAATAAAAT
TGGGATTGTCTTTAAAAAGGTCTTTAGAAGATATGCTTACTTCTTTTTCATCTAGCTCTCCTTCTTGGAT
TATATTTGAGAAATGCATTGAAATATTGGCTGATGTTGTTCCAAATATTTCTGCTATGACTTTTTGACTT
GACCATAATGTTTCGTTTCCAATTATAAACTCAGCTTCTATATCGTTCTGTTCGCTTTTGTATAGTAACT
TTTCAATAAGTTTGAATTCGGGCATACACTTCCTCCTTGGTTTAATTTAAAAATTTTTATAATTGGTTTT
ATATATGTTAATGATTATTATATCCAATTTTTGTTAGAGCATTTGATAAGTAATATTTGTTTAATATCTA
TTGCTAAAGTAGTAGATAATTCCGCTACTTTTCGCCCTTATCTGTTCGTATGTTGTAGAACAAATTTCAC
TAAAAGTAGTAGATAATTTCTATATTGTTACGCCAACAGCAACATGAAGTTGGTCAAAAGGAACCAGAAG
TTGCATGATCCAGATTCACCGTTGCTGATTGGGGATGTTAAAGATGGGGATGTTGTAAATGAAGTTAATG
AACCTAGCTATATTGATTTACAAACTAAGTTGTTTTGACTTTTAGTTTTTTTTTTAAAAAATAATTCATA
ATTAATGTAAGCTCATTTTTGAGAATAGATTTAGCACCCCTACACCTATAATGATAAGTAAAAGTCCAAG
GATAGCAGCCCAATCAGGGGTCTGTTTGAAAGCGATAATCCCTACAATTGTCACAAGCACGATTCCCAAT
GCTGACCAAATGGCATATGCAACTCCTATTGGTGCTGTTTTTAGGCAGTTGCTGAGACTGTAAAATGATA
ATATGTATAATATGATTGATGCTATTGTTGGCAATGGTTTAGTGAAACCTTCAGCAACTTTTAACAGTGA
TGTGGCACTGGTTTCAAATAGAATTGCAAGTAAAAGATAAGCAATATTATTCATTTTTGGTTTCCCCCAT
ATTTTAACTGTTCAAATTCTTTTTTAATTTTTTCCAGTTCCTCTCCATGATATTCCTCTTCAAGATTGAA
AATGGCGAGTTCGTATAATATGTTTTGAAGCCTGTGGCCTTTTTCAGTCAGGTGATATGATGTTTCATTA
TCTTTGATGTTTTTTTCGATGATGTTGTTTTCTTCCAGTTCCTTAAGTCTTTGTGTTAGGATTTTATTGG
ACAGTTCAGGCTTGTCCTCTTTGAAATCGCTGAAATATTTTTTTCCAAGAATCATGTCCCTTAAAATGTA
TACTGTCCATTTGTTTTTAATAAGATTCAGATTTTTTTCAAATTGACAGTATGGGGGCAGTTTATCAAAT
TTTCTTTTAATTGTCATTTTTGCACCTATTGTTAAATTTAAACCTTTTCCTTTAAATATTTTTAAAAAGT
ATTACTTTAAAGAGGATATCACACGGTTACTTATTATTTTTGTTACCTTTTTGTTACAAAACCTTTTAAT
TGTAGTTTATTTATAATATAATTTAAAACACAAATTATGGAAAGTGAATTAAATGAAAGAAAAAATATTT
ATCAATGGAAGAGGAGGATGTGGAAAGAGCACATTCATATCATTAATTGCAAAGGAATTGTCAAAAAACA
ATAAAGTATTAATAATTGATATGGATGAGGGAAACCTCGGATTGAACAAGATGCTTAATGTTGATGTTGC
AGACACTTCATTAATGGAATATTATGGTGGAAGAGATAAGATAATGGGTGAAATTTTAAAAGTAGGAATT
AAAGGTATGGTTTTAGAAAAAATCAACCTGAAAGATGGCGCAGCCTCAGATTCAATAGATATTTTGGATA
ATATGAAATTATCAGATTTACCTTCCGATTATGTGACATGGAACGGAAATATAGGATTCATTGAATCCGG
AAAAATCAACGACCCTGATGAAGGCTGTGCCTGTCCGATGGGAAATCTTACAAGAGACTTCCTAAATCAC
ATTGAATTACAAGACAATGAAGTAATATTGGTCGACACCTCAGCGGGAATAGAACACATTGGAAGAGGAG
TAATTGAGTCTGCAGACAAACTCATTTCAATAGTTGACCCGTCAAGCGATGCAATATTGTTGGCAAATAA
AATAGGATCATTATCAAAAGAGGCATCCAAAGAATATATGGTAATATTGAATAAAATTGATGAAAATACT
AAAGATTTGGTATTGGAACAATTGGATGATGACATATCTGTCGTTGGGGAACTTGAATATAATTCACACA
TAGCTCAAAGCAACCTTTCCCAAAAAGAAATTAACCTTGAGGAAGTAGAAGGTGAAATTAAGGAAATCTG
TGCAAAAATTTAAAGATTTGATTAAGATTTAAATTTCAATAGGGCGCATGGTGCAATAATGGATTTGCTT
TTTTATGTTGTTTTGCTGTTGATTGGAGGTTGCTTTGCAGGTTTCATGGCAGGCCTTTTGGGGATTGGCG
GTGGAATTGTAATCACTCCAATCCAATATTATCTTTTAACCTCAATTGGATGTGATCCTAAAACGTCCCT
AACGGTTACCTTTGCAACAGGTCTTGCAGTTATCTGTGTCACGATGATAAACAGTACACGAAAGCACAAA
CAAAACAATCTAATAGTAAAACAGCACCTAAAACCAATGATGGTCTTTGGTTTTGTAGGTGCCATTCTGG
GTGCAGTCATATCTCAATACATAGATGTTGAGGTTTTAAAGATTTTGTTTGGTGTAATATGTATAGTATC
AACAGTATTTTTAGTTTTAATAAAATCTCCTACCTCTTTAGATAATATTAAAACTGATGCAGGATTATTT
TACTCTATTGCATTTGCATGTGGTCTTGCAAGCGGATTGATAGGTCCCGCAGGAGGAGCATTTATCATAC
CGATTTTCGTGGCATATTTGAGATATCCAATAACAAATACTATCGGAACAACTTCAGCATTAAGCATCGC
AACCACACTTGCAGGGGTAATCTGTTATATTGTTTTAGGTTGGGGTGTTCAAGGATTGCCGGATTTTTCA
TTAGGTTATGTCAACTTGCTTCAATTCGTATTTTTAACAATAACTAGCATTATTGTATCCGGATATGCTG
CTAACCTATCTAAAAAAATCAATCCTACAAAATTAAAAGCGCTGCAGGTAATCGTAATATCATATATTGG
CCTTCAAATGATGGGTGTATTCGACATAATATTAAGCATAATATAATTTTGATTTGTATGTATAAGGTAT
GGAAAAATTGTATTGGTTGTGGGGAATGTGCAAAGGCATGTGATTTTAATCTGATTCAAACATTTGATGA
TTATATTCTGATGGATATTGAAAAGTGCAGGCATTGCTCAAAATGTGTAGAAACTTGTCAAAACAATGTT
TTTACAAAATCAGTTATTTTTAAACACTTTTTATATCTATTATATTATAAGATTAAAAAATCTTAGGATA
ATTGAAAAATTGATGAGTATCTCATAACAGTTAAGATTTTTATATAGGTTAATGGTTTGTATGTCCAATT
TTTGTAAGGCATTTGACAAGTTATATTTGTTTGTTAAATGTGGAAACAAAATTCACTAAAAAGTAGTAGA
TAATTTAAAGTGTGTTACGCCAACAGCAACATGAAGCTGGTTAAAAAGAACCAAAAGTTGCATAATCCTA
ATTCGCCATTGCTGATTGGTGAGGTAAAAGAGAGTGATGATGTAAAGGAAGTTAATGAACCTAGCTATAT
TTATTGACAAACCCCTTAAAAAAAATAAAAGATTAAAATATATGTATTGATATATGTATTAATATGGAGA
TTTTTAAAGTTGTCTGTGAATTAATAATTCCAATTTTAATATTTGGTGTGTTATTTGCAGTTGGAAAATT
TATTCATGTAAGATTATTGAATAGTAAAAGCAGAATTTTAAATCCAGGAGAATATTTCCCTGATGAGGAA
CTTGAAACATTAAAGCAAGTTTATTATTTGGTAATGATGTTAATATTCTTTGCTTTTATATTATACATCA
TGATAGTTCAAGCTAATGAGGTATTCGCGATTGCTGTTTTACAAATTCTTGTGTCAGTCTATGTCGCTTT
AACTTTGGATTATAGTTATTTGAAAAATAAGATATTGTTCTTCCTCTTGGTTCCTTTTGAAGCTATAATA
TTCCTTGTTTTCAATGATTTTCTAATGATTTGGCCAATTTATTTGATGCATATTCTTGTTTATGCATATT
TCATCAAGGTATACTTCGATAAATTTAGGAAATATACTGAAACAAATGGGCTTGGAATAACAATCATACT
ATTATTCGCTATAGTTTTTATAAGCTTCATTATCACACTATTTGTGGAAGGTGTTGAACCTTTAAATTCT
GCTGTAATGGTTTCAAATGCATTTACAAGTAATGGTTATGCAATACTTGGTAACTCAGGCATTGGTAAAT
TGACCAGTTTGGTTTTAGTTTGGAGCGGATACATCATATCTGGTGTAGGTACTGCAACATTAACCGCTGC
AATTATGATGAGACATAATCAAAAACGTGAAAAAGAGTTAAACAAACGTTTAGATGAGTTGGAATCATTA
ATTAAAAATAGTAATAATAAAGAATAAGATATGGATTAATTGTGCCCATATCTTTTCTATTCTTGTTTTT
AACTACTTATTTTTTTTTAGATATGGTTGGTGGTGACCATATCTTATTGTTTTTTCTATTATTTTTTAAC
ATTTAAATTACAGTTATTTATAGTTTTTTTAGTGTTAGTTATTTTTTTAATTCAGCTAAATTCTCTTTTA
ATAGTTTATAGATGTTTTCTGCACCGATGATTTCATCATCGCTGACATTCCAGCTTGAAGGGTACAATAT
GAACGGTTTGGATTGATCTCCGCCTGCTCCTCCATGGCTTCCAACCAATTCTTCAAATGCACATACCTCA
TCAGCTTCCTCATCATAGAAACTGTTAACCAAGATATCTGGTGTATGTTCAAATGAACTGGTTCTTTTTA
GATGTTTAACGATATTGTCTCCAAATCCAAGAAGAGGGTTTTCACCATCGATTTCATCCCTGTCTAAGTA
GTATGTTCCATTCTTTCCAATGGCTAAATCGCCATGTTCTTGGGATTTAACTAAAATAAAACCAACATAT
TCATTATTTATAAGGCCAGGTATCAGTTCAGGGAAATAGCTGTTAAGTTCCTCATAGCTTAATCTATTAG
TCCATTGGGTTAAATAGATCATTGCAAGGTTACCTGAAGCCAGTACAATTACTTCAGAGTCACTTAATTC
CTTAGCTTCTTCTTTCTCTTTCTCTATTTTTTTATCTTTTCTTGCAAATGGAGTGTAATCCCCTACAAAA
TGGTCATCATTTGAAGTCATTTTTGCAAACATGGTCATGTCTTCTGGAAGCAATGATTTTACAAAGTCCT
CAAAGGTTTGACCATATCTTTGGGTAAATGTGGCTCCGTTTGTTTGGCCATGGTCAGATTGAATTACGAA
TTGATAATCTCTTGGAGAATATTTGTTTGCATCGGTCAAGTGTTTGATTTGCTGGTCCATTTGCCTTAAT
GCTATCCATGCGTCACTGTCTCTGACTCCAGAGTGGTGAGCTATTTCGTCATAGCCTAAATATGTTGAGT
ATGCAACATCAACATCTCCAACCATCATGTCTCCGATTAAGGTTGAAGTGTTGATTTCTCTCATAAAGAC
GTTTGTAGCAGCTCTTGTTGGAATATAAGCTATTCCACGGTTGATTCTTGGCCTTATGTTTTTGATGGAA
TGTGTGATTTGTGACCAGATTTCACGTACAATATCTGCAAGGAACAATGAGACAATACGTGCAAAATTGC
TTGGATTGGAAAATACTGAGTACCATGCCTTATTATAGAGTTTTCCAAAGTCCATTATCTTACTGAATGT
AAATATTACATTGTCAGTATCTCCAGAGAATAAATTAGATCTGCTTGCTCCATTTTCTACAAGCAATCCA
TTACCATCTGAAATTCTCTTTTCCAATTCCGGCACATTGCTGATTCCAGAGCATTGCATCATCTGATTGC
CATTGCTCTTTTCTATCCATCTGAATGCAACGATGCCTTCATTATTTCCATGAAGGATTCCTGCCTGGCT
TGCACCGGTTTGGGAAGACAAGTCAGTTTCCCACATTCTAAGATTGTAGTCTTCGCTTTCAATCATTTTT
TTAAGAGTTGGCATGTCTCCTTTTTCAACTGCTTCACATAAAACATTATATGCAAGTCCGTCAATTTCAA
CGATTATAACGCCTGGATAATCCTTGACTTCATTTTTTGCATTCTTTTTGGCATCATTTAAAACGGATCT
GTAATAGGAACTGTCATCATTAATTGTTATTAAGCTAGATAGCACTGTTGTAACGGCCGCCATTCCTAAA
GGTGCAAGAATCATTGCAGCACCTTTGATTTCTATTCCAAATGATGGTGCGAGTAATTGAAGAAGGAGTC
CGTTTAATATTAATGAACCTATTCCGAAGGTCAATACTAAAAATGGCATAGCTATTCTTGTTAAAATAGG
CCAGAGTATTGCATTTACTATACCTAGGAATAATACTAAAAGGAATATGTCACCAGTTTGGCTAATTTCG
ACTCCTAAACCTAAAATACTTATAAGATATATTCCTATCATATTTCCAATAAATACGATTAAACTTCTTT
TTAAACTTTTTTTCGGAATTTCTTTTCCCTTAATAATTTCCATATAATCAGCGCCAAGTATTAATTTTAA
AATTTTAGAACAAAGTAGGTTTGTAAATTAAACATTATATATTTAAAGTTTGTACTTTATAGTATATATT
CTAATGAAAATTAATTATTTATTCTTTTGTATTGTTCATTGTTATTTTTTTTAATCTTTTTTATCTATTT
TCTAATCTTTTTTTATCTTATCTTTTTAAATCGTTAATCTTTTTTATCTATTTTCTAATCTTTTTTTATC
TTATCTTTTTAAATCGTTAATCTTTTTTATCTATTTTCTAATCTTTTTTTATCTTATCTTTTTAAATCCT
TAATCTTTTAAATTCTTATTTTTAATTCTTATTTTTTTTAAACAAATTTTAAATATTACTTTTTAAAAAA
AATATTAATGTCTCATTAGAGAGTTTTAAAATTATATTATGGGTGTTAATATGGAAATAATGGAAATAAT
TAAAGATTCTTTTCTATTTCCATCTAAAAACTTAGGAACCTTCTCAATTTATGTTGTATTGTCAGTATTA
GTTGCAACATTTACTTTTGGAGGAATATTCTCCTATTTATTAGGGTTTATTGGCTCTGAGTACATTTTAA
TAGGCGGATTAACTCTTGTATTTGCAATGTTAATTGGATGGGTAATGTCTGGTTATGAAATCAGCATTAT
TAAATCTGGTATTGACCTTGATGATGAAGTTCCTGAGTTTAAATGGTGGGATAATTTTATTACAGGTTTT
TTAAACTTTATTGTTGCAATCGTTTACTTTATAATTCCTGCTTTTATTGTGGGAGTTGTAGGATATCTTA
TAAATATTAATGACAAACTTATGGCAGTTGCTCAAGAGATTTCTTCACTCTATCCAAATATTTTCTTGAC
AAGTTCTCCGGATATTGCATTTGAGGCATTGTCTCAAGCAATAATTGAATTAATAGTTCCTTTAGCTATT
CTCATTATTGTTGCTCTAATTGTATTTGTAATCTTTTTATTCCTCCAATCCATGGCTGAAGCAAGATTGG
CAAATACGGGTAGTTTAAGTGAAGCTTTAAACATTTTTGAAGCAGCTAAAGATATAAAACGAATTGGTGT
ACGTAAAGTAATTATAGTAATCTTATTAGTTTTTGTAATTATTGGTGTTATTGGGATGGTTACATCTGTT
ATATTTAACTATGTGCCAACATTATCAATTCTTTCAATTATAATAAGCCCATACTTAGTATTCTTTGCTC
AAAGGGCTACTGGATTATTATATTCTGATATAGCTTAATATTTTAAGCTATTCTTTTTTCTTTTTTTTTA
AATCTGTTTTTAGTTTATTATTTTAAATTAGGTCTTATCTTTTTTTTTATCAGTGTGTTCACAATAACTT
AATTTTTTAGGGATTAAACTTCATTTATACCTTTAAATCTTTAAAATGATGTTTCTATGGTTTAGATATG
TAAATCTTTAATTATTGGTTGAAAAACTTTAAAAAGAAGTAATGATTTTTTTATTGGTTAAAATAAATTT
AAAAATTTAGTTCATGTGGTATAGTTGAAAAATTTAAAAAAAAGTTATAAGCAATCAAAAGATTGCTTAT
TTAATTTTTTGGTGCTACATATAACCTTACACCTTGGGTGATTAAAGCTACGCCTATAAGTACTGCAGCG
AAAATCGGTTGGGTAAGTGAAAAGCCTCCAAGGCCTAATGCAATAACACCTAAGATTATAATCAATATTG
AAGCAATCTTTGATACGCCTTCTCCTGCAAAGATACCTGCTACACCTATTAAGATCATTAAGATACCAAT
AATGTAGAATTGGAATCCTAAAAGGAAGGACAATGCATCAATGTTGAATATGAATAGCAAACCGAATATG
ATTGCAAGAATTCCAATAATTATATTGAGTGCTGAAAATTCGGTTAGAATTGATGCTATACCTAAGAATA
GTAAGCTAACTCCAATCATGATGGATACTAATCCGGAACTAACCAAAGGGAAAATTATGAAAATTAATCC
TAAAATTATGGATAATATTCCAGATACTTTATTAGGTTCCATGTTTTTCCTCCTAAATTTTTATTACTCA
CTTAAGTGAGAAATTTAAAAGCATTTATGCTTTTAATATTAATTATGTAGGTATTAATATTTAATTATTG
ACTTAGTTATCATAGTATTTTAAGAATTTGCTTTTATAACACAAAATAAGCAAAAATAGAAATTATTTAT
TTTAAAATTTTTATGAAAAAATAGATTTATTTGTTTAAAAAATTCATAAGAAAAAATAGAAATTTTGTTT
AAAAATCAAGAAAAAATTAAAATTAAAAAAAAGAATAATGAGAGATTAACTCTCATTGTTTAATTTTGTT
ATCCTTTAGCCGTAACGTTAGAAGGAAAACCACTCCCATAATGAGAGCTGTTACCTGCATTACGAATGCC
ATGGTATTTTGAATAATGATGTTTGCAACATCTACAAGGGTACTGTCCTGTTTAAGATCATCTATAGTAG
CAACTTTTTGGAAGTAATTTGCAACTTCAAGTTGGAATTGTTCGTCTCCTGAATGATCTGGTGCATAGGT
ATCGACAGCAGTGCTGATACCGCCCATAACTCCGAGAATTAAAATTATTCCAATAACTGCTGTACCCATT
GATTCACCTAATGAGGTACCGGTTGAATTAACACCTGATGCGTTATTTTGACTTTCTGCAGGAATATTGC
TTAATGAAATATCAGTACATAAAGCCATAATGAAACCAAGTCCAGCACCTAATACTAATAATCCTGGTAA
TAATGTCCAAAGTGTTGTATCAAGTCTAAATTGATAACTTAACATTAAACATCCAATAATTGCCATTATG
CATCCTATTGCCATAATTTTCTTGTGACTTAATTTTTCTGTTAAACTTGGAGCCAATACTGCAAAAATAA
GCAAACCTAAAGTTAATGGAAGAGTAGTCACACCAGTATTGAATGCATTTAACTGCAATACGCTTTGCAA
GAATAGGGAAACTGCAAATAATCCCCCACCCATTGCAAGGTAAGATAATAACAAAATTATAGTTCCTACA
CGTAAATTTCTGTCTTTAAATAGTTCCATATCAAGTAATGGTACTTTGCCATTTCTTTTTCTTCTGATTT
CAAAGTATGCAAAGGCAACTAATGCAATTAATCCTACTACAATTATGCCTATGCTTGTTGTGAAATCTTT
AGATAGTGACAAGATACCTAGTACTAATAAAACAAGGCCGATAAATGAAATTATAGCGCCTGAAATGTCT
AAATCGCTTCTAGATTCAGTAGGTTCGAAATGAGGTATGCTATTTCTGAATATTAAAATAACGAAAACGA
TTATCAATTCAACTGCAAATCCATATCTCCAACTTAAAAATGTTGTCATGACCCCACCGAAGAGTGGGCC
TACAGCGGCTGCAACTGCACCCATAACACCTACAATCGCCAAAGCAACTGTACGTTTTTCACCAGAATAT
GTTCCACTTATGATGGAAACGGTTGCAGGCATCATTAATGCACCAGCAACACCTTCAATTGCTGCCCATC
CAACAAATAACATTCCAGCACTTGAACTTATTGATGCGGTGAATGTACCTACACCATAAAGAGCAGTACC
TATTAAAAACAGTTTCTTTTTATCCACTATGTCTTGAAGCTTTGCACTTAAGAGCATAAATGCTGCAGTG
ATGAGAGTATAAAATGACATGATTGATTGAATTGTACTGACGTCAGTATTCAAGTCAACAACAACCTGTG
AAATACTCACATTCATGAATGTAGCGTCTAAAGCTACAATAAAGGAAGCAAGAGCCACGACTATTAGTGG
AACCCAAGAATTTTCCTTAATGGTTTCATTCATATTTTTTAATCCTCCAATAATTATCACATTTAACCGT
ATGGTCTAATATAAAAATCATAATTAGTTTATGTTTTTTATAGGGACATTATGTCATATGTAATTCTCTT
TTTGTTTAATTAAATAGTTTTGGATATTTTTTAAGGAGTTGCCTTATTTTTTGATTTTTTGGAGTTTAAC
TTCAATATTTTGGTTGAAAACAACTTACTTTGGAAAATGAAGCCCTTATTGTATATATTTATTTATTAAC
CATATTATTTTCATATTAGTCTTGTAAAATTAGTTTATTGTTTTGTCTTAAGTTTGTTATGGATGGTTAA
TTATTATATTAGTCTTGTAAAATTAGTTTATTATGTATTAAATTTGTTAAGAATGACTAATTATTATATT
AATACTGTAAAATTAGTTAATTATGTATAAAATTTGATAAAATTAGTTAAAAAAAGAGTTATGATGTAAA
GATTCCTGGGATTGGATGCCGGGGGCGGGATTCGAACCCGCGATCTCACGGTATCCCAGGAAAAAAGTCA
GAGCACGCTTAGTTACCCTATGAGCCGTGCGCTCTAACCAGCTGAGCCACCCCGGCATCAGACAGTAATA
AAATTTATATTGTTTATAGTTTATATACTTTTGGTTTTATTCGATTTTTTTCAATAATTTTTTATAGAAC
TTTTATCATAATTATATAATGATATAATAATAAGTTGAAAAATATTTGGAATTTCATAGTTTGTGGAGTT
TCATTGAAAAGAATATTTGGAATTTCATAGTTTGTGGAGTTTCATTGAAAAATATTTTAAGATTCACTTT
TATTATTAATTTTTTAAAAAAACAGAGGTTATATTTATGAGCAATGTTAAAGACATGTCTCTTGCGGATG
AAGGTATTCGTAAGATCAAATGGGTTCAAAAGCATATGCCTGTTCTTGAACATATTAAAAAACAATTTGA
AGAAGAAAAGCCTTTTGAAGGAATCACTATTGGTTCATGTTTACATTTAGAACCTAAAACTGTTAATTTA
GGTTTGACCTTACAAGCTGGTGGCGCTGAAGTTGCAATGACTGGCTGCAATCCATTATCCACTCACGATG
ATGCTGCAGCAGGTGCAGCAGCTCTCGGATTACACATATACGGCTGGAGAGAACAAACTGATGAAGAATA
CTACGAAGCTATCGACAATGTACTTTCCCACAAGCCAGATGTAATCATCGACGACGGTGCAGACATGATC
ATGTACCTTCACGAAAAACGCCCAGAGCTATTGGAAAACATCAAAGGGGCTTGTGAAGAGACAACAACCG
GTGTACACAGATTGGAAGCAATGCATGCAGACGGAGCACTTAAGTTCCCAGTCATCGCAGTAAACGACGC
ATACACCAAATATTTATTTGACAACCGTTACGGAACCGGACAATCCTCCCTTGACGCAATCATGGGAACC
ACCAACATGCTTATCGCAGGTAAAAACGTAGTCGTCTGCGGATACGGCTGGTGCGGTCGTGGAGTAGCAT
CAAGAGCAGCAGGACTCGGAGCAAACGTAATTGTAACAGAAGTAGACCCAATCAGAGCACTTGAAGCAAG
AATGGATGGTTACAGAGTAATGAAAATTAGAGAAGCAGTGAAAATCGCAGACCTTGTAGTAACCGTAACA
GGAAACATAGACATCATCCATGGAGATGACTTCAAATACATGAAAGACGGATGCATGCTCTCAAACTCAG
GCCACTTCAATGTGGAAATCAACAGAGGCGACCTTGAAGCACAATCAGTAAGCTGCGAAGAGGTTAGAGA
AAGCATTGAAATGTTTACCATGAAAGACGGCAGAAAAATTTATCTTTTAGCAGACGGAAGACTTGTAAAC
CTTGCAGCAGCAAGAGGACAAGGACACCCTGCTGAAATCATGGACATGAGTTTTGCTGTGCAAGCATTAT
CTGCCAAATACATTGTAGAAAATGACTTGTCATTAGGTGTTGAAAAGGCACCGGACAGCATTGATGATGA
AGTTGCCAGATTAAAGCTTAAAGCTATGGGAATTGAAATTGACGACCTTTCCGAACGTCAGAAAGATTAT
CTTGCGGACTGGAGAGAAGGTACTTAATTTCACCTTCAATCTTTATTATTTTTTTAAAATTATTCTCATT
TAAATGGTTGATTTTTTTATTTTATATTAAATTCATAATCATTTAAATGGTTAATTTTTTATTTTTATTT
TAAATTTATCCTCTTTTAGAGGATTAATTTTTTCTATTTATTTTTATTTTTTATTTATTTTCATTTTTAT
AATCTATTTGATTTTAATAATTTAATTAACTGATATCATGTCTTATTTTCGCTATATTGATAATGGAGAA
GGCCCTACAAAGCTATTTATCGGAGGAGTTCATGGGGATGAAGGCAAGCATGTCCTTCCTTTAATCAAGC
TTCTAAAAAGAGAGGATTTTTCCTCTGGACAGATTTACATTTATAATTTTGACAGGACTCCATATATCTC
TACAATACATAGGGAATTTTATCAATCAGAACAAGGCAAGAAGATATTGGATTTGGTAGATTATTACAAG
CCTGATTTTTATACAGAACTTCATTCATATAATATTAAGCATTTTGATAGATTGACTAGTCTTGATAGGC
TTGACAGCGAAGGGATTCCTCCTTTAATCGATTGTGGTCAATATGTATTGTGCAGTTCTGTTTCTCCTTT
GATTAGACGTAAGCATTTCACTAAAGAAGCAATATGTCAAACTTTAGAGTTTCCTATATTCAGAGGAGAA
GACTTAAAGCTTAGTGATGATGAATTGCTTGAAAAATACGATTTTGATTATGACTTGTCTGTAAAGGAGT
ATATGGCCTTTTTAAGACTGATTACCCTTAGCAAGAATAGGGATGACTTTGAAAAAAGAGTTTTAAAGGA
TTATAAGAAACAGGCTGATCTTGCTTTAAAATACGTTAAAATAATTTATGGATTGAATTTTCCACGTTAT
TAGGGTATTTTCTATTCTTATGTTTTAATTCCCACTTGTTGGGGCTTTTTTCTTATTTTTTATGGTTTTT
ATTTTCCACGTATTTTGAGTATTTATTTTTTTATTTATTTATTTATTTTTTAAAAATAGTTGAGATTGGG
TTTAAATTAATTAAAACCAATCTTCTAAGCTTTTTTGGGTTGAACTTAATTTTTTTAGCTTGTCTGCAAC
ATTTAGGACTCTAGTCTCAGAGAATCCATGTTCTTCGCACATGAATTCACAGAGTTTTTCCTTATCCGCG
CTTTTAAACTTAATCTTATAGTCTGTATTGACATCATGGCTTAAGAATATTTCTCTAAGCTCATCTGGTT
CAACTTCAACATCAGTAATTCCCTTTTGAACCAATATGTCTTCAAGACTATTCTGTCTGATTAATTTAAG
CCCAGTTTTTGCACCGATTCCATAGATTCCTTCATTGAAGTCGGTTCCTACCATCAATGCAACATCCACT
AATTGTTCTCTGCTAAGGTCTATCTCTGTTAGGACCTTATCAAGTTCAAGATATTCGAGGTTTGATAGTC
CTCCGCTTAATGTAAGGTTTCTTATGATACGAGGTGCTCCAAAGAGTAAGCAGTCATAATCTTGGGAAGC
AACGGCCCAAGCATCTCCATTTTTAACCATATATGCTCCTTGAGCTTCACCCTCTCCTTTTGCCTGTACA
TAGGGGATTCCCATATATTCAAGAAGTTTTTTAGAGGATTCTATAATGTAAGGTGATAATCTGGAGCTTC
TTATTGCATATTTTCTGGCCTCTTCAATGTTTCCTGCTGCCTTTGCCTCTTCATACTTCTGGTTTGCCTC
TTCCCTTAAGGCCCTTCTTTTTTCAACGGTTTTTGTCTTATATTCTGAGACATCTCCATCAAATACATAG
ACTGGTTTTATTCCTTTATCCACTATTGAAGCTGTTCTATATAGAATTCCGCTTAAATGGGATGTTACAT
TTCCATTTGCATCCATTAAGGGACTGCCGTCCCTTTGGCGAATTCCAGATAGGAATTGATAAAGTGTGTT
ATATGCATCTATTGCTACAGTTCTGCCTTCTAAATCCTTTAGGTTTATCTCTTCGGCAGTAACTATATCC
TTAAACTTAACTCCCATATCATCCACCTTAATTTTTCATTTTGAAAGTTTAACTATTTTTTTCTTATAAG
ATACTTATATTCTTATTTTACTAAATAATTTTTTGGCAATCAGATTTCAGTAAAATAACTAATAGGGAAG
TATTCCTTAATCCACATTAGAATTTCACCATCTTTGATTATTGTATAATCCCTTGCAAGGAAATCCTCAT
CTGTATTATAGATTTCAATCAATTTGTCGTTTGCCTTTTCCATATCGATAATGTTTATCTCTCTTCTGGA
TTCAATATGGTATTTCTTCAATATTCTTCCTATAGGGATGTCTGCCCTAACCAAGTCCTCTTTGATTTCT
TTACTCAATCTTTTTAAAGGAATATAGGATTTAGCATAAATCAAAGGCTGTTCGTCCTTGTGCATTATGA
TTTCTCTAAAGTTGACCTCATCGCCAACATCCACATTGACAAGCTTTGCGCTTTCGGCTGTTGCCTCTTC
GAAATGTTGCTCTAGGGTCTTTAAAGCAATTTTTCCATAAAGCACATCTAAAATGGCTGTAATTGAGCCA
TCTGTGGTCATAAGGATTTTTTGAGTGTTTGAAAAGTTTTGATTGTACTTTTCTTCAACTTGATTAATCT
TTTCAATCAATCTTACATTGATGTCATTATCTGTAGTTGCCATTTTTATAACTTCCTAAATTATGATAAT
ATTGTCCAAAATCTTATTTTTTTTAAATAGTAATTTTAAGCATTATTATAATTAAATATTGATTTTAAAC
ATAATTATAAGCTATCTGGGTTTTGTATGAATCCAGAGACTGCAGATGCAGCTACAACTCCTGCATTTGC
AAGGTATACTGATGAATTAGGATCTCCCATTCTTCCCTTGAAGTTTCTGTTTGTAGATGAGATGCTTGTT
TCCCCTTCGGATAAGACTCCCATATGTCCTCCAAGGCATGGTCCACATCCAGGATTTGATACAATCGCTC
CAGCATCCAGGAATGTTTTGATATAACCTAAATCCATTGCCTTTTGATAGATTTCCTTGGATGCAGGGAT
AATAATTAATCTTACATCGTCATGGACTTGCTTGCCTTCTAGGACTGCTGCAGCTTGTGCAAGGTCATTG
AGCCTTCCGTTTGTGCATGATCCAATAAATCCTTGGTCTATATGGGTTCCTTCCACTTTTGAGAGAGGAT
TGACATTGTCAACATCATTTGGACAGGCTATTTGGGCTTCCATATCATCTACATTGAAGAGATATTCCTT
GAGATAGTTTGAGTCCTTGTCTGATTTTATTATATTCAATTGGTCTTTGCTTTTGCCGGTTCTATTGCAG
ACATACTCTATTGTTGCCTTGTTTGGCTCCATTATTCCGTTTTTAGCTCCCATCTCAATTGCCATATTTG
TCATGGTCATTCGGCTTTCAACATCCAGATTGTCTATTGTCTCTCCGCAGAACTCTGCAGTGTTGTAGGT
TGCTCCGGCAATTCCTATCTCTCCTATTATGTTTAGAATAAGGTCCTTGGATGTTATTCCTGGCCTTAAG
CTTCCTTCAACTTCTATCTTTAATGCTTCAGGAACCATAAACCATGTCTTTCCAGTTGCATAGACCATTG
CTAGGTCAGTTGCACCCATTCCTGTTGAAAATGCTCCGAATGCACCGTATGTGCATGTGTGTGAGTCTGC
ACCGACGATGACCATTCCAGGCTCAACATGTCCCTTTTCAGGAAGAACCTGATGGCATATACCTTCTCCA
TGAATGTAATGGCTTTTTATGCCTTGGGTCTTGATAAAGTTTCTTGCTACCTTTTGAAACTCTGCAGATC
CTATTGTATTTGCTGGAATGTTGTGGTCAAAGACAATGACTATCTTTTCATTGTCCCATACCTTATCTGT
GATTTTTTCAAAGGTTTTTATTGCAGGAGGTGAAGTTCCATCGTGGGACATGGCTAAATCGACGCCAATT
TCAATTATTTCTCCCGGTTCGACTTCGTGGCCTGCTTTTTGAGATAATATTTTTTCTGTAATATTCAAGT
TTAATCTCCTTTTCAAATTAAATATCTTAAGAAATCTTTAATTAATTTATTAAATTTTAATAATTAGTTT
TATCACTAATTTTTATTTACTATTTTTAGTTTAATTTTTAAGATTATAAATTTATTTATTTAAATCTTTT
ATTTTAAATTAAATTGGCTAAAATCAAGACTTATATATTAACTAAGTTAAGTATTAATTTAAAAAAAATA
AATGTTGATTATTAAAAATCAACATAAAAACGATTTAATCCCAAATTGGGATAATATATATAATCTGCTA
TCTTGATTAACTATAAGTCAACATAATTAGCATCAATGCTTCTTACAATGTCTTTAAATACATTATCATC
AATGTATTTTCCTTCTTCTCTGCTTTCTTTGACTTTTTTAACTATCTGACAAAGCTGATCATTTGTAACC
TTAAATCCGCATTCATCTAATTTTGCCTTAACAGCTCTGCATCCTGAATGCTTTCCTAAGACTAATTGTC
TCTTTTGTCCTACAAGCTCTGGAAGATATGGCTCATATGTAAGAGGCTCTTCAATCACTGCATCCACATG
GATTCCAGATTCATGTCTGAATACGTTTTTACCTACAACAGGCTTATTATAAGGAATTCCAAGCTTTGTC
TTTTCTGCAACAAGCTCTGAAAGCTCTTGAATGTATTTGGTCTTAAATCCTAAATCCTTTCCATATAAGA
TTTTTAGAGACATTACAAGCTCTTCAAGTGATGCGTTTCCTGCCCTTTCTCCGATTCCATTTACAGTTGT
TGAAACAGCGGAACCTCCTGCTAAAAGTCCGTAAATTGAGTTTATTACAGCAAGACCAAAGTCATTATGA
CAATGCATTGCAATATCGACATTTGTGACTTTTCTAAGCTCTTTGATTAGGAAAGTGATTCCTTGAGGAG
TTATTGCTCCTACTGTGTCTGCAATATGAACCCTGTCTGCCCCATAGCTTTCCGCTTTGGAGTAGGTTCT
CTTTAAGAAGTCCAAGTCAGTTCTTGTAGCATCTTCTGCTGAGAATGCTACGAACAATCCATGGTCCTTA
GCGTATTCAATGGATTTCATGCAAATATTCAAGGCTTCCTGTCTTTTGATATGCATCTTGTGCTCTAAAT
GAATGTCTGAGGTTCCCATGAATGTGATTATTCCATCAACATCACAGTCAAGAGCCTTATCGATGTCTGC
TCTTTTAGTTCTTGCAAGACAGATAATCTGTGCATCCAAGCCTTCATTTGCTATTGCCTTTACGGCATCT
GCTTCACGGCTTGAAACGATAGGGAATCCCGCTTCAATCTGATGAATTCTAAATTGATCTAATTTTCTAG
CAATCTCTAATTTGTCTTCCTTTGAAAAACAGACCCCTGGAGTTTGTTCTCCATCTCTTAAGGTAGTATC
ATAAATTGTTATGTTTTTTGGGAATTTATATTCCTCTTCCTTGTTAAAGGGACTGATATAATATTGCATT
TTCACATCTCTTTATGTCTTTAATTAGTTAATTGAATAATTTTTTCTATATTTTAATAGATTATTTTAAT
ATAATAAGTTTTCTATTTGAACTTATGAATTGCTAATTTTAATTATCTCTTTAGGACTATTTGAATTTTT
GAATTTGTAATTTTAATTATCTCTTAGAACTTTAAACCTTTTTATTTGTCCTGCTCTTCTAGCAATTCCA
AATAGGAAGTTCGCTCGAAGCCATCAGTAATTCCCAATTGCTCAAATAGGTCAAATATTTTATCTTGAGC
TTCATTATAATCGGAACCGTCCTCCAATGCAATCTCTATTTCCATATATGGATCAAGGCCCTCTACATCA
TCTAAGCTTATCTCAAAATTCTCAAGCTTAAAATACTCTCTGTTCTTTTTGACTGTTCTAACTTCGATAA
ATCCTAGATTCTCAAAGATTTTTGCACATTTGTCGCTGTCTTCGATTTTCATTTCAACTTCTTCTCGAGT
CTTGCTTTTGCTGTCTATCTTAGGGCCTTTATAGGTTATAAACAAGTTATGGGATTTTTCTGTTTTGGTT
TCTCTTATCCTTAAGGCCTCATCAGTCTTTGCAAAGTCATTTACAGGGCTGTTGAAATATCTGTCTATCT
GCTTTTCTGTTTTTGTTTTTATTGCATTGATTTCGTTTAATTTGACTTTTATATCTTCAAAATTATTTAT
CTTAGCTTTAACTTCTACTTCTATCATCTTATCACTTTAAATGTTAATTATATTTATCATTCACTTTAAA
ACTTAATCCTAGTTCATCTTTCATTCAAATATTCCTTTTAAATTTTTTATTTTTCATTTTACAACTATAG
TCTTAATATATATACTTTTCCCCTTATTCTTTAATAAATCATTCTAAAGATTTTTTATTCGTAATTATTA
GAATAATTTTTATTAATACTTTTGTTAAAGTTCATAATATTTTTACCGATTTTTAAATTTTTTTCAATTA
AGTTTATATACTATTTAAATAATATATTTTATTAGTAAAAATTTTATAAAAAATTTATTAATTTTACCGT
TTTTTTATTAAGTTTTTTTCATTATAAAACTAAAATTATATTAATTTTTTAAAATGTTTACTTACTTTTT
TTAAATTTGATTTGGAGGTATTAAGTTGACCGATGTTGATATAAAAATAGAAAACATTGTGGCTTCTGCT
AGCATTGGTAAAGACATTGTTCTTACTGAAGTTGCAAAAGCATTAGAAGGCGTCGATTTCAATAGAGAAC
AGTTTCCAGGTCTAGTTTTTAAACTTCAAGACCCTAAGACTGCTGCTTTAATTTTTAGTTCCGGCAAACT
TGTTTGTACTGGCGCTAAATCTATCGATGATTCAAAGTTAGCTATTAAGAAAACTGTCGACCTTATGAGA
ACTATTGATACCGAGATTCCTCATGAGTTTGATATTAAAATTCAAAATATTGTTGCTTCTGCAAATTTAC
AATCCACATTAAATTTAGAAGCAGTTGCTTTGGAATTGGAAAACACCGAGTACGAACCTGAACAATTCCC
AGGTTTAGTGTACCGTTTATCTGATCCTAAAGTAGTTTTATTATTATTCGGTTCCGGTAAAGTTGTTTGT
ACCGGCGCTAAAACCAAACAAGACGCTAGGTTAGGTGTTGAAAACGCTAAAGCTAGACTTAGCGAATTGG
ACTTAATATAATTTGGTGATATATTTGATTAAACTTGTAGTATTTGACTTAGATAATGTTATTATTGATG
GTGAGGGCATAGATGAGATTGGAAAATTGGTAAATATTGAAGATCAAATTGCAAAAATCACCGAGCAGGC
AATGCAAGGTGAAATCGACTTCGAAACATCCATTAAAAAAAGAGTAGGACTTCTTAAGGGAGCTTCTACT
GATGATATTAAAACATTAGCTAATGAAATGCCTCTAATGGAAGGTGCTGAAGAAACCGTTTCCTCTTTAA
AGGAAAATGGTTTTGATGTAGCTATTATAAGTGGCAGTTTTGATATTATTGCCGATATTATTAAGGAAAA
ACTCAATGTGGATAATGTATTCACAAATTCACTTGTTGAAGAAGACGGGATCTTGACAGGTGAAGTTACT
GGACCATTGGTATCTGGTTCAAAAGTAGATGTTTTATCTAAATTCATTGAAGACAAGGGCTATTCTTTAG
AGGAATGTGTTGCTGTCGGAGATGGAGCTAATGACATTTCTATGATTGAATCTGCTGGATACGGCATTGC
ATTCAATGCAAAGCCTGCCTTAAAGGAAAATGCAGACATCATTGTAGAAACCCGTAATCTTACTGACGTC
CGTGACGTCATTATTAACTTAAATTCTGAAAACACTGAAGAAGGTGCTGACGTGGATAAAGAAGTTGAAA
TTGAAACTGAAGTAGTTGAATCTACTGATGTAGTTGTCGAAAATCAAGAAGAACAAGTTGCAGATGCAAC
TGAAGAAGTAGTTGAAGTAGAAGAAGCAGAAGAAGCTGTTGAAGAAGCAGTTGAAACTGAAGAAGAAGCA
GTTGAAGAAGAAACTGTAGAAGCTGAAGAGGAAGCTGTTGAAGAAGAAGCAGAAGAAGCTGTTGAAGCTG
AGGAAGAAGCTGAAGAAATCGAAGAAGCTGCTGAAGAGGAAGCAGAAGAAGCTACCGAAGAAGAAGCTAT
TGAAGAGGCCGAAGAGGAAGCTGATGAAGAAGTAGTTGAAGAGGCTGAAGAAGAAGTAGCTGAAGAAGAA
GCAGAAGAGATTGAAGAAGCTGTTGAAGAAGAGGCTGAAGAAGAAGTAGCTGAAGAAGCTGCAGATGAAG
AAGTAGTTGAAGAAGCTGCTGAAGAAGAAGCAGAAGAAGCTACCGAAGAGGAAGCTGCTGAAGAAGAAGC
TAAAGAAGAAAAGCCTAAAAAGTCTAAAAAGTCTAAAAACACTCTTCCTGAACCTGATTTCGAATTAGCT
GATACTATCGAAGGAGTCAGAGCTCAAAAAGATGAAAGAGAAGCAAAAATTGCTCAAGTTGCTGACGAAA
GAGAAGCATTCAATAGAGAAGCTAAAGAGCAACGTAAAATACGTGATGAATTAAACACTGAATTAAAATT
AAACTTAGCAAAAGCTATTGAATTCAGAGATCAACGTAATGAAATCAACAGAGAAGTTGAAGAAAACAAA
AGAGCTCGTAACAAAGTAAATGAAGAGATTAAAAATCTCGAATGGTCTTCTGGTAAAAAAGATAGAATCA
GAATTGAAAACGAAATCAAGAAGATTGATAAAATCATTGAAACCAGAGTTTTAGACATTAAAAAGGAAAA
TCAGCTTGTAAAAACTGCTAACGATTTAAGAAAACAACTTGCAGAAATTACAGAAGACAACAAAGTAAAA
GAAGAAGCTGAAAAGCTTAAAAAGCAATCTGAAGAATACCACGCTAAAGTTGTCGAACTTTCCGAACAAG
CTCAAGAAGCTCACGAACAAATGCTTTCTTACTTTAGGAAAACTGATGAAATCAGAACTGCTGCAGATGA
AGCACACAAGTTATTCATCCAAGCTAGGAAAAACGCTTCTGCTAAACATGAAGAATTTAAAGTCATTTTA
AGTGAAATTCATGTTATTAATAAAAGATTAGGAAGCAACAGAGCTAGAAGAAGAAAATCTGAGAAAACTA
GCAATGCTCCTGGTAAAAGAAATCGTGAAGAGAAAGAGAAAGCTGAAGCTATCTTTGATAAGTTTAAAAA
CGGTAAAAAATTATCAACTGAAGAGCTTTTACTCTTGCAAAAATATGATATTAATTAATTAAATTCTTTT
TTAATTTAATTTTTTTATTTTTATTTTTTTCTAAATCGATTTTTTTGATTTTTTATTTTAAACCTATTTT
TTTATTTATTTAGATATTTTTTTATTATCTATTTTTCTTATATTTTTATTTCTATTTTTATTTCATTTTT
TTATTATATTTTTATTTCTACTTTTCTTATATTTTTATTATTAAACTTATTTTCTTATTTAAATAATTTT
AAATACTTAATTTAGCATTTATAATAGTATTTACACTTATTTTTTAATATTAATATTTTTTCTATTTTTA
AGATTAAAGCAATTTCTCAAAATCACAATCTCAAAATATAAGTAAAGTTAATATAATAGTTAAATCTAAC
TTTATTATTGAACTTTAGAAATTTGAATTTTAATATGAATTTAGATGTCGATTTTCAAGATTTGATTTAA
AATTTTTATTTCTAAAATCATGAATTATTCTTATTTTATAAATATCTTATTTTAATGGATGATATTATGG
ATTTGGAAAATAAAAAAGATGATAAAAATCAAAATAAAGAAGAAATAATTGAATCTAGTGAAAAAGAAGT
TAAAATGGAAATATGTTATACCTGCGGTAAGGAGTTTGATATGAATTCTGACGAAGGCGCTCATTACCAT
TATGGTGAATATCCAATGTGCGGCTATTGCACTAACTTCTTTGGATTCTATAAGGAAGATATGATGGGTG
GCAAGGCAAAAAAGGAATAAAATAAATATTTATAAAATTATTATAATATTATTTAATATTATTTAAGAAG
CATTTTATAATATCAGTATTTACGCCTAATAATTGTAAAAATTGCTTAATTTATAATAAATTATTTATAT
ATCTTGCAAGGCCACATCAATATTGTTTCCAACTTAAAGCAATATTGACTTAACTTAGTTTTGTTGTTTT
CCAAAAATAGAAAGTCTTAAATATTAAAATTGAATTAAAATATTTATAATTTCAACTAAATTTTTTTACA
AAATTATTTGGATAGTAATTTTTATATAATTTTGTTTATCCTTTAATAATTATTTAAATTATTATTTTAG
GTAATTTAATTAAATTTTTTCAATAAATTATTTTTATTTTTATGTGATAACATGCATGAAGTGATTATTT
CAGAAAAACCAAAGTCTGCTGAGAAGATAGCAAAGGCACTTTCTCCAAATGCCCAAAAGAAGAAATATAA
TAGAAAGATCAACTATTGGGAATTTGAAGAAAACGGCAAAAAGACCACTGTCCTATCTGCAGTGGGACAT
TTGTACTCATTGACTTCTGCTAGTTCCAGAGACAGATTAGGTTTTGATTTGACTTGGGTTCCAGCTTATG
AGGTGGAAAAGCAAAAATATACAAGGGATTACATCAATGCAATTAAAAAACTCTCAAAAGGTGCAGATAA
GTTTGTTCATGCTTGCGATTACGATGTTGAAGGAACCTTAATCGGATACAATGCATTGAAATATGCATGT
GGAAACAATGCCGAAGCAAAGGCATCCCGTATGAAATTTTCAACATTGACTAAGAAGGATATCGTAGAGG
CATACAATACAATGAGGGACATTGACATTCGTCAAGTGGATCATGGTATTGCAAGGCATATGCTTGACTA
TTATTATGGTATGAATATCTCTTCAGCCTTGATGAAGGCTGTAAGGGCCTCTAGCTCAAGATTTATTAGC
TTATCCGCCGGACGTGTACAGACTCCAACCCTTTCTATTTTAGTTGATAGGGAAAAGGAGATTCAATCCT
TTGTTCCGGAACCTTATTGGATGATCAAGGCTAAATCTGACTATGATATCATAGCAGACCATGTCGAAGG
AAAGATATTTGATGAAGAGCGAGCTAAAAAGATTTATGCTGACTGTCAAGGTGCTGATGCTGATGTGACA
AGTGTTAAGGTTACAGAATCCATTAGAAAACCTCCTATTCCATTCAATTTAGGAGGACTTCAGTCTGAAG
CACATACTGTCTTTGGATTCTCTCCTAAAAGGACTCAAGTTGCAGCTCAAAACCTTTATGTTGGAGGATA
TACATCCTATCCTCGTACATCATCTCAAAAGCTGCCTGAATCCTTGGATTTCAAAAACATTTTTGCAGGG
CTTGCTAAAGACCCTGAATTCAAGAAGCATATCTTTGACTTACCTGCTAAGCTTAAGCCTAATGAAGGTA
AAAAGACTGATGCAGCGCACCCTGCTATACACCCTACAGGAGTATTGCCTTCCAATCTATCTGCAGATGA
GGCTAAGATTTACAGCTTGATTGTTTATAGGTTCATCAGCGTATTTTCCGAAAACTCCAAGCTTGAAACC
ATGAAGGTCAACTTAAAGGTTGCAGATGAGAAGTTCACCTTTTCCAGAAAAAGAGTCTCTTATGAAGGTT
GGCTAAAGCATTATCCGTTTAAAAAGCAGGAAAATGATGCATTCCCTCCTATAAATAAGGGAGATCAACT
AAAAATCCATAAGATTTTAGTTGAAGAGAAGGAAACCAAACCTCCTGCCAGATATAATGAGGCTTCACTT
ATCAAGGAACTGGAAAAGAGGGAATTGGGAACTAAGGCCACCCGTGCAGACATTGTTGCCAAGCTTTATG
ATAGAAAATACATTGAAGGCAAGAAGATTGAGGTCAAGCCTTTAGGAATCAATATCATAGACACCTTAAA
CGAGTATTGTAAGGACCTGACAAGCGAGGAGCTAACCCGTGAGTTTGAAAGGGAACTTGAAGGAATCGAT
ACTGATAAGTATACAAAGGAGCAGATTCTTGAAAACGGTGAAAAGGAAGTCAAGACCATTTTAGCTGAAA
TCAACCAAAACAAGAAGCAAATCGGTGAAAAGCTTTATGGAGCATATCAGGAAACCAATGTGGTTGGAGA
GTGCAGCTGCGGAGGAAAACTGATAAAAAGATATTCTCCAAGAACAAAGAACACCTTTGTAGGATGCTCC
AATTTCCCAAAATGTAAGGTTACCTATTCCCTGCCAAAGGGAGCGAATATGCTAAAGAAGACATGCCCTA
CCTGCGGTTTGCCTATGATTTCCATTAAAAAGGCAAGCGGAAAGGGAAGAGATCATGTCTGCCTTGATTC
AAATTGTGGAAAGGATGTAAGCAGACGCCAAGCTCCTGAAGTTGTTGGAAAATGTCCGGAATGTGGCAAG
GACCTTTTAAAACGTTCTGGCAGATATGGAGAATTTGTAGGATGCTCTGGATTCCCAAGGTGCCGCTTCA
CTTGTTCTGTTGATGAGTTGAACAATCTTGGCAAAGATAAAAATAAGGAAGATGTAAAAGAGAATAAGGG
TGTTTCTAAGAAGATAGTAAGGTCTGAGGCTAAATAATTGTTTTTAGTCTTAGATTAAGGTCTTAGAGTA
AATAATTCTTTTTCTTTTACTTTTAATTATTATTTTTCTTTTTTTTATAAAATAAACTAATTTTCATAAT
CTTTCAATTTTTATTTTTTTTTTAAATTTTACTCTTTTTATCATATTTTTAATTCAATTTTTCAGTTTTC
ATATTTTTTTATCATTTTTTCAATAATTTTCTAAAATTTAATAAAATATTTTATTCTATAACTATCAAAC
TATTATTTCAAATTCTTTCTTATTTTTACTTATTTTACCCATATTAATTTCAATTACTCTTATTTTTTAC
CGCAATAAAAATAATATTCTTATATTTTATCTAACTAATATTTTTATTGTATTTAATAAAGTTACACATC
GATATAATTTTTTATTAACTATAATTAAATTATTATTACTCTTTTTTCAAATGACTTTATTTGAACTTTT
ATTTGCACATATTGGCGATTTTTTAAAAAATTAGTTTAGTAGAAACTTTTATATGTATATAAAATGTATA
TTTAATTATTATTAAATTTAGATTGATTTTTTTAAATCTTAATTTTAGTTTAATAATTAATTATATGTTA
TTAAAGATGTATTTTAAAATATATTAATAACAATTTTACAAATAAATGAATTTTTTTACTTTATATAAAA
TTCTAAGCAATTTTAATAGGTAAAATTCATTTTTACTATAAATAACGGTTTATTATGGTCATATGTTTTC
ACAAAAAATGAAAGTTAAGAATTGTCTAAATATTTGGCTATAAAAAACGGTTTTATTTAAAAATATTCGA
ATATTTAATGTACGAGGATTTTATATGGAAAAACAACAAGTAAAAACAATTTTAAAATCTGTGGTTATCA
TAGCTATATTGCTTATTATTGTTTTTGGTCTTAGGGCTCAATCTGTAGATATTGGAGGAGTTCCTAATGA
ACTTAAATCACACTATGTAGACGAAAACGGTCTTCCTTATTTCAGTGAAATGGACTCATACTTCAACTAC
AGGATGACCGAGAATTATATGGATCATGGATACTTTGGTGACACTAAGGTAAACGGTACCGGTTGGGATA
TGCATTCATACTTCCCTTCAGGTAGGGCAGTAGGTGATTATCAACCGATGATTGCTTATGTGACTTCGTT
CCTATATGGAATAATAAATATGTTCCAGGAAATGTCTCTTCTTGAAGTGGCGTTTTGGACTGGGGCTATT
GTTTCCTCACTTGCTGTAATTCCTACTTACATATTCACAAGAAGGATTACAAACGACTATGGAGCAATTG
CGGCCTCATTGATTGTAGTATTAGGTCCAAACTATATTTCACACACATTCGCAGGATTTTTCGATACAGA
TATGTTCAACATAACCTTGCCTTTATTCTTCATACTGTTCTTTGTTGAAGCTTTAAAAACTGATAAGCTA
TCATACAGAATCATATTCTCCTTATTAGCAGTAGCTTCAATAGCGCTCTATTCCCTTTCATGGACAGGTT
ATATGTTTTATGTTGCTGTAATGGTATTGGTTATGATTGTGTTCTTTGTATTATGCTTCTATTTCAATAT
TGAGATTTTAGAACCATTTAAGAACTATGGAAATAAACTGGAATGGCTGATTAATCAGAAGGAATTGTTT
GCTACATTAATTGTATTGGTTGTAGGTCTAATTGGATTATTATTAGCCGTCGGAGTAGGTGGAATTATTG
AAGGTATTACCGGCCTTACAGGAGGTTTCACCCTTCAAGCAGGTGCTGCTGACGTATGGCCTAACGTACT
TATTTCCGTTGCGGAAATGCAAATTCCTAATTTAGTGACTGGAGGACTTGTAGGTTCATTCCTCGCTAAC
ACCGGTGGAGTAGTAAACGGGGTTGGAGGAATTGTATGTTTATTCGGTGTGCTTATTGTATTGTACACTT
TTGTTCAAAGATTATTCAGACTCAACTCTGTTAAAGTTAAAGGAGACACTGCAAAACCTCACAAATCCAA
ACGAAAAGCTACCTCTGTAAGAACCGAACAAAAGAGATTCAGCGTTTCTTTAAAAGACATTGGATCATTT
GGATCAACCGATGAAATCAACAAAAGCAAACGTCACACAGTGCTTTACTTAAGTCTCTTCTTTGTATGGA
TTGTATCATCTGCAATTGCAGTAACTCAAGGTACAAGGTTTATTCAGGTATTAGTAGTACCTATGGGTAT
TTGTGCAGGTATATTCGTCGGATATGCTGTAGACTATGTCAAGAATAATGTGGACAACGATAAGGTATTA
TTATTGATTGCTGTTATCGCATCTATCTTGATTGCACTTCCAATCACTCAAATCGCTTATGGTTTGGATA
ATGCAATGACTATAGGTTTAGTAGTCTTAGTTATTCTTTTGGCAATTTCAGCAATTGTGATTTATGCTAA
AAAATCCATTAAGGACTCTGATGTTTCAATCAAGAAGGCTTTGGTTGTAGTGCTAATCACTCTCGCTTTG
GTATCTCCAACCGTTTGTGGTGCTTTCCAAACCACTGCAGCTACCGTTCCAGGTTCAAGCGACCCTATGT
GGTTTGCTATGGATTATGTTAAAGAAAACTCTACCAATGACACTGTAATCATATCCTGGTGGGACTTCGG
TTACCTATTCCAAGTTGCATCTGACCATCCTACTTCTTTCGATGGGGGTTCCCAGACAGGGGATCGTGCA
TACTGGGTAGGTAAGTCATTGACTACGTCTGACTATGCCCAATCTAAAGGAATCCTGCAGATGTTGGCAA
CTACAGGTAGCAATGCATCTATGCTATTGTCTGAGTACACAGGCAGCAATGTGACTGCAGTTCACGCATT
GGATGAGACCTTAGGTAAAAGCAGATCTGAGGCTCAAAAGATTTTAACAAGCAAGTATAACCTTACTAAT
GACCAAGCTAAAGCTGTTGTAAAACAGTCACATCCAAGCAATCCTAACAACGTTTCATTCGTTTTAAGTT
CAGATATGATTGGAAAAGCTGGATGGTGGTCTTACTTTGGTTCTTGGAACTTTGATACCCTAAACAGTAC
CAACTATCAATATTACATGGCTAACGACTATGTTCCTATCAAGCAGAACACACAAGGAAACATTACAATC
CTTAATGAAAGCGGTATTATATACCAAGCTGTTGTAAACAGAGGCAAGAACGGTACCAACGAAACTACAG
CTCAAATGGAAACCATTTGGGACAATAACCGTAGTAAAATTGACCTAAACGGTACCGAATATAACCCACT
TAAGGCAAGCAATCTTATTTGTATTGAAAACAGTTATTTAACTGTTAACAAGACCTTGAATAAGGACGGT
AATTACACCTTATACCTTTTAGGTTCCGGTGATGATTATACTGCCATATTGATGGATAATAATCTTAAAG
ACTCTGTATTTACCAGACTCTTCCTTTTAGGTGGTATAGGTCAAGACACTTTCGAGCTAAGTAATATGCA
AGATGGTGTATCTGTTTGGACTCTGAGAGACGGATCATCAAATTCTGATGACGCAGGTTCACAGTAACGT
TTGTTAATTAAAATTAAATACAAATAAGTAATTTTTATAAGCTTTTAGAATTTTTATATTTTAATGAGTC
TTATAATTATTTACTTATACTTTTTTTATTTTTTCCTTTTTTTTTAATCAGATTAACTTCTATTTCTTTA
AATAACTATTCTTTTTAGTCTATTTTTTCTAATATTCTATTTTTTAAGTTATTTAAATAGATTCATTTTT
CTAATCTTTTATTAAAAAGAGATAATAACTATTTATCCAGTATTTTTAAACTTGTTTTACCGTAGATTTT
ATATGTTAAAAATGCTATAGTTATATTATAATAAATTTATTAATGTTCTTTGATTATTCCCAAAGAATCG
CTAATTAAACTTAAAATTTAAATCCAAGTAAATTATAATCGGGGTTTAAAATATCAATTAATTAAATTAT
TCATATTAATTCAATTAAAACAAATTATTTATCAATCAATTTTATAACTGGGGAGTTTATGACTATAGAA
GAAAAAATTAAAGCTATTGAAGAGGAAATTCAAAAGACACCTTATAACAAAGCTACTTCTCATCACATAG
GAAAATTAAAGGCTAAGATTTCTAAACTTAAGGAAGAGCAAATCAAAAGAAGTAGCGGTGGAACTAAAGG
TGAAGGTTTCCACATTAAAAAAAGCGGAGATGCTACTGCTGTTTTAGTAGGTTTCCCATCTGTAGGTAAA
TCTACATTGCTTAATGAAATCACAAATGCTGAAAGTAAGGTTGGAGCTTATCAATTCACTACATTAGAAA
TCATTCCAGGGGTCATGGAATATAATAATGCTCAGATTCAAATATTTGACATTCCAGGAATCATTACAGG
TGCTGCAGGTGGTAAAGGTAGAGGAAAAGAGATCTTATCTGTAGCAAGAACTGCTGACTTGATTATTGTG
GTCTTGGATGTTCTCAACCCTCAACACATTAATGTTATCTTAAAGGAGCTTAGAAATGTAGGTGTAAGGC
CAAATGAGACCAAGCCAGATGTTAGAATCAAAAAGACACGTAAAGGTGGAGTCAATGTTTCATCAACCGT
TCCTTTAACCTATTTGGATGAAAAGACCATTAGGTCAATCATCAATGAATATGGAATACACAATGCAGAT
GTCCTATTTAGGGATGATGTCACAATCGATCAGTTCATTGATGTGATTGAGGCCAATAAGTCCTATGTTC
CAATGATGGTTCTCTTAAATAAGGTGGATTTGGTAGATGAACATTATCTAAATGAAATCAAGAAGGAACT
TCCTCCATTCATTCCGATCTCTGCAGATAAACAGTTAAATATTGAAGCACTTAAAGAAGAGATATTTAAT
AATTTAAACCTTATCAGGGTTTATCTAAAGCCACAAGGAAGAAAAGCGGATATGGAAGATCCATTGGTTG
TTAAAAAAGGTTCTACCGTAATTGATGTCTGTGGAAAACTTCACAGAGAGTTTGTTAAAAACTTCAGACA
TGCAAAGATTTGGGGAACTTCAGTAAAATTCCCAGGTCAAAAGGTAGGTCCAGACCATGTCGTAGAGGAT
GAAGACATTCTAAGGATTATTTTAAAGAAATAAGCTTAAATGAACTAATTGCATAAAAAATTAATCTTAA
AAATTATTTTTTCATTATTTAATCTTAATAAATTATTTTTTTAATTAATTTATATTCATAAATTATTTTT
TAAATACAATAATAAAATAAATTATTTTTAAAATAATTAATTTTAAAAAATTATTTTTTAAATAAATAAG
TTTTATAATAGAATTCAGTTTAGCACAGAATTCATTTTTAAGAAGGGATTTAATGTCTATTTCAGATAAA
ATCGAAGAAAATAAAGTAATATTCATATCAGGAACTCCATGTACTGGTAAAACTACAATTGCAACTAAAC
TAAATGATTTCTTAACCAACAATGGATTCAATTCTTATTTTATAAAAATAAATGATTTTGCCATTGAAAA
TGATTTGGTTTTAGGCAAGGACCCAGACAAATTGTATACAGTTATAGACATTGGCAGACTTGATGAAGTC
TTAAATAAGGAGATTAATAATTTTCTTGATGAAAACTCTTCAGATGATTCTAAAATAGTTGTTGTTGAAG
GACATCTGTCCCATTTGTGCAATGGTGCAGATAAGATGATAATTCTTCGATTAAATCCAGAAAAACTCCT
CAAAAGACTTGAAGAGCGAAAGTATAGTGAAAACAAAATTCATGAAAATCTTGAAGCAGAGGCTTTGGCT
GTCTGTTCTGCAGAAGCTTATGACTTATATGATGATAAGGCCAGTGAAATAGACACTACAAATAAATCTG
TTGATGAGACTCTTGAGCTTGTTCTTAAAATCATTACTGGTGAACTAGAATCTCCTGTAGGCTCTGTTGA
TTTTATGGATTGGTTTTTATTATAATAATTGTTTTTATTTTTACATTTAAACCATTTTAAGAAACTATTT
TTTTTAGTTTTTTCTATTCAAACTCAAACTATAGAAAAGTTTTTTAAATAGAAAAAACATATCTTATCAT
AATATTCCTCTTGTACTATATATTATAGGAATATTTATTTTATTACTTTCTTTTTAAATTGCTTAAAAAC
TTGATTTCTCATCAAAATCTACTTTTATTTTAGCAATATATTATTTTAAAGAGATTATACTACGTATAAG
AGGGGTATGTTTGGCTAGAGGAAAAAGACCAAAATGGATGATTGATATAGCTCAAGAACGTATGGATATT
CTTTTTAATCGTGCAGAAAAAGAATATAAGAAGAATCCGGAGAGATCCCATCGTTACATAGAGCTAGCTC
GAAACATTTCCAAGAAATACAATACAAAAATTCCCCAGCCATGGAACCGAAGATATTGTAAGAAATGCTA
CAAGTTCTTGGTTCCCGGTCACAACTGCGCTGTCCGGCTAATTAATAATGAAATTAATATATATTGTGGC
GAGTGTGGCCATGTTATGAAAATTCCTTACATCAGGGAAAAAAAGTTAAAAAGGAGAGCTAAAATTGACT
CTTACACTTTCAAAAAAAGAGATTATGAATGAAGCTCGTTCCGCTATGACAATCAATATTGGAAAAGCTG
GTGTTAACGATAATGTTATTGAAGAGATTAAACGTCAGTTAAAATCCAATCCTATTATTAAATTACGATT
TGCTAAAAATGTAGCAAGAAATAAAGATGATTTAATTAACAGCATTGTTGAAGGCACTAAATCCCAACTC
ATTGATGTTAGAGGGAATGTTGCTGTTATTTATAAGAAACAATCTCATTAAGCCATTCGCTTAGAGTTAC
AGACACCAGTCTTAGGTGAATTGGATTAAGTGAGATTATAACATATTAATTGGAGAAATTTATGTGACAA
CTGTATTTGATGTTCCTGCAGAGTTATTGATTAATACTGTTGCAGATGAATTTAAAGATAATAATGATAA
AATCGTTGCCCCTGAATGGACAAAACTTGTTAAAACTGGTGTTCACAAAGAAAGAAAACCAGAAAACATC
GACTGGTGGTATGTAAGATGCGCTTCTATTTTAAGAAGAGTCTATATTGACGGACCAGTTGGAGTAAGAA
GTTTAAGAACCTTCTATGGCGGTAAAAAAGATAGAGGCGTAAACCCTGAAAAATTCAGAAAAGGTAGTGG
ATCTATTGTTAGAGTAGCTCTACACCAATTAGAAGATGCAGGATACGTAGAAAAAGTCGATGCTGGAAGA
ATTATTACTCCGCAAGGTAGATCTTTCTTAGATAATACTTCTGCTGAATTAATTAAAGACATTCCAGAAC
TTTCAAAATATTAAATGAAGATTTTTAAGATTGAATTGATCTAGCGCTTTATGCTTTGATTGATTCATTG
AATAATAATTTAAATTTATGGGGATTTTAAAATGAGTGAACTTGATGAATTACGTAAAAAACGTATGGCT
GAACTGCAAAGACAGGCCGCTATGAATGCTGATCCGCAGATGGCTCAACAGCAAATGGCTCAACAGCAGA
TGGCTCAGCAACAATTAGCTCAACAGCAAGAAATGGAAGCTCAGTTGAAACAAGCTATGAGACAGATCTT
AACTCCAGAAGCTCGTGGAAGATTGGATAACTTAAGATTGACCAAGCCTGAGTTAGTACAAAACATTGAG
ATTCAATTGCTTCAATCAGCTCAAGCAGGTTCTCTTAGAGGCAAAGTAACTGATGAACAACTTAAAGTTT
TGCTTAAAAATCTCATGGGTCAAAAAAGGGAAATTCATATTACAAGAAGATAATCTTTAATTTAAAGTTA
ATCTTAATTTTCTTTTATAATAAATTGATTTTTTTAAGATAAAATGAAAGCTTGTGTTCTTTATAGCGGT
GGCAAAGACAGTTCATTGATGGGATACATCCTCAATCAATTAGGCTTTGACGTTGAACTGGTCACTGCAA
ATTTTGGTGTTTACGATTCATACATTCCAGCTTCAAAGTCTGCAGAGTCCATTGGATTGAAGCATAGGGT
TTTAAACCTGGACATTTCCATCTTGGAAAAGGCTGTAGACATGATTTTAGAAGACGGATTTCCTAATGAG
GGAATCAAGTATCTTCATGAGGCTGTTGTTGAGGAAGTGGCAAATCATTATGATTTGGTTGCTGACGGTA
CAAGAAGGGATGACAAGACCCCTAAACTCAATAGAAATCAAATAAGGAGCTTGGAAGACAGAAAAGATGT
CCAATACATGAATTTGGATAGTTTTGGCTATAAGACCATCAAATATCTTGTAGGAAATCTTTTTGAATTG
AAGCATGAAAAGAGCAATAAGGATACAAGTTCAGACTATGAGGTTGAAATTCGATTGCTGATTGACCAAA
AAGGTGGAAATTCATCTGAAATATTCCCAGAACATTATCAGACTAATGTGGTCGGATTAAAATAATTATG
CAAATTGCAATCAATCAATTTCTAATTATTCTTTAAACAAAATAATTATGCAAATTGCAATCAATCAATT
TCTAATTATTCTAAAAGATTTAAGTTATTTATTCAAAATTAAGATTTATTATATAATTCGCGGTGAAAAA
ATGAGTAGAAACAAACCATTAGCTAAGAAATTAAGAATGGCTAAAGCTAATAAACAAAACAGAAGAATCC
CAATTTGGGCTTATGGTAAGACTCAACGTAAATTAAGATACAGACCTAAGCCTAGACATTGGAGAAGAAA
TGATCTTAAAGTATAGGAGTGTTTAGTATGGCAGAAGAATTAGAAAGAACTTATGTTATTCCACTTAGAA
AAGTTAAAAATGTCAAAAGAACTATAAGAGCTCCTAGAGCTATTAGAGAAGTTCAAAACTTTTTAATGAA
ACATATGAAAGCTGAAGAAGTAAAAATTGACGCTTCTATAAATGAATTTATTTGGGAAAGAGGAATTCAA
AAAATCCCTTCCAAAGTAAAGGTAATTGCAGTAAAAGATGAAGAAGGTATTGTCAGAGCAACTTTAGCAG
AAAACTAAATTTGCTTATGCTATATTTAATCATCTTTCAAACTAACTTTAAGAAGCAATAATTTAAAACT
TTTTTAAGTGATTTAAACAACTTATAATAATTTTTAAGTTTTAATAAGTAATTTTTAAGTGATTTAAACA
ACTTATAATAATTTTTAAGTTTTAATAAGTAATTTTAAATAAACTTTTAAAAGCAATTTAAATAACTTTA
AGAAGGAATTAATATGCTGAAAAGAATTAATTTAACCGGAAACCCTAATTTAGGTGTTTACATATCTGTT
AATGATGAAATAGCTATTGTTCCTTTTAATGTTCCTGTTGAAATGGAATCTGTTATTAAAGAGACCTTAG
AAGTCGACATCATTAAGACTTCCATTGCAGGCTCTAACCTAAACGGTGTTTTAGCAACAGGAAATTCTAA
TGGATTTTTAGTTTCTCCCTTTACATATGACAGAGAAATTGAACTATTGGAATCTGCAGGCATAAATGTT
GCAAAGCTTCCAGGCAAATACACTGCCATTGGAAACATAATTGCTGTAAATGATTATGGTGCCCTTGCAG
GTCCTAATATTGGGGAAGAAACAATCAAGGTTATTGAAGATACTTTAAAGGTTCCAGTAAAGATTTATCC
ATTTGCAGACACTAAGATTGTAGGTTCTGCAAGCATAGTTACCAATAAAGGAGCTTTATTGCATAGGGAT
ACAATCTCTGAAGAGATTGATTTCATTGAAGACTTCTTTAAGGTTGAAGCAAACATTGGAACTGTATGCA
AAGGAATGCCTCTTGTAGGTGCTTGTGGTATAGCCAATTCCCAAGGTGTAATGGTTGGGGAAAGTACTAC
AGGTCCTGAGATGGCTAGAATTGAAGAATCTTTAGGCTTTTTAGACTTTGGTAATTTCTAAATAGTTAAG
ATTCTTTTTTAAAGTATTTATTTACAGATATGATGTATTAATTGATTTAAAAGATTTTAATCAATTGATT
ATTATCTAAATTCAATGATTCAATTAAGTCAATTAATTTAGTATGATGATTAATTATAGTATTATAAGAA
GGTTTTATTATGATAACTAAAAATTATAGAGTTAAAGGTAGCTTCGTAATGGGTAGTGAAACACAAGTTT
TCACTAAAGAGTTAAGAGCTATTAAAGAAGAAGACATTTATGAAAAGCTTTATTCTATCTTCGGAAGTAA
ACATAGAATAAAAAGAAATCAAATCAAAATTGATTCAATTGAAGAAATCAGCGATGACGAAGTGGAAGAT
CCTATCGTACAAGCGATTCTTTAAATTTTTCATTTATTTGATTTTTTATTAAATTTTTTAACTATCATTA
CGGATGAAATAATCTTAAGGTGTTAAAATGGAAGACCAGCAAAAATTACAACAAATTTTAAGTCAACTTG
AAGTTTACAAGCAACAATCTGAGTTATATAAGACTCAAATCGATGCTGTTCAAGCTTCACTTGCTGAAAT
TAAAATCTTAGAATCTACATTAGATGACATTAGTGGTAAAGACACCATAGAAACTTTAGTTCCTCTTGGT
GCTGGCTCCTTCATTAATGCAGAGATTAAAAATGAAGATAAAGTTATTATGAGCCTCGGTTCAGGTGTTG
CTGTTTCCAAGACTTTTGCAGAAGCTAAGGAAACCACTGCTGCACAGAAAAAAGAGCTTGAAGAGACTTT
AGATAAGTTATTTGCAGATCTTCAACAAATAACTGACATTGTAGCTCAGCTATCTCCGCAAGCTGAACAG
TTGATGGCTAAAGCTCAAGCGCAAATGGGACAGCCTCTTTATTAGTTCCATTTCTTTTATTTAATTAACT
TTATCTATTTTTTTATATTTTTCTTAATTTTTCTATTTTTAATATTTTTTTATATTTTAACATTTTTTTA
ATTTTTATTTTAACTAATTTTTATTTATTTTTCTTATTTTTGTATTTTAATAATTATGCACGTTTTTTAC
ACAAAACTCTTATTTTCCTATTCTAAAAGTTTTTTAATTTTAATCGCTTTTATCAATTTCATTATTTTTA
TTTAAGCAAAACAATGAAAAGTTTATAAATTTTTAAATATAAAACTATTAATAGTTAAAACTTTAAATTA
TATCTAACAATTTGTTAATATAATATTCAAAATAAAACAATTATAAAACATTTTAAATAAACAAAATAAT
CGATTTTGTTTTAAATTTTTTTAAATTAATACTTATTGGCAGGGATAAACTTGTTTAGTTCATTAAAGAA
AAAATTTGCTGATGCAAGTAGCAAATTAAGAAATAAGGTAGAAGAAGAAGCTAAAGATGAAGATAACATT
GAATTAATCGAAGAGTCTAAAGATGAATTTGATGACATCGACGAAGATCTCATCGAATATATTGATGAAG
AAGATGAAGATGACGATTGGGACTTCGATGATATTGATAAAGAAGATAAATCTAAGGAAGAGCCTAAAGA
GGAATCTAAAGAGGAATCTAAAGAGGAATCTAAAGAGGAATCTGTAGAAGAAACAGTTGATGAGGCTATA
GAAGAAGTCGAAGATGTTTCTGCAGATGAAGATTCTGATGAAGAAGTAAAAGATTCTGATGAAGAAAAAA
AGGATTCTGAAGAAAAGGATTCAAAAGATAAAAAAGAAAAATCCGGTTTCTTCTCATTCTTAAAACGTGG
TAAGAAAGAAGATAAAAAAGAGGATGAAGAAGAAATTGAAGATTCTAAAGAAGAGGAAGTTCCAGAAGAA
GAAGTCAAAGAAGCATCAGATGAGGAAGTTCCAGAAGAAGAAACATCAGAAGAGGAGTCTGAAGAGGAAG
TTCCAGAGGAAGAGATAGAAGAATCTGAAGCTGAACCAGTTGAAGAAACTGTTGAAGAGGAAGCAGAAGA
ATCTGAAGCTGAACCAGTTGAAGAAGCTGTTGAAGAGGAAGCAGAAGAAACTGAAGAAGCAAAAGAAGAA
ACTTCCGAAGAGGATGAAGAAGAAAAGCCTAAAAAGAAACGTTCCCTATTTAGACGTGGTAAAAAAGACA
AAGAGAAGGATTCAGAAGAGGAATTCGATGCAGAAGAGGCTAAAGGCAAAGGTGGATTCCTATCATTCAT
CCGTGAAAAGACTATCTCTGAAGATGATGTTGAAGACATTCTATTCGAACTTGAATTGGGCCTATTGGAA
TCAGACGTTGCAATGGACGTATCCAGTGTCGTTGTAGATTCAGTCAAAAACGACCTTGTCGGTCAAAAAA
TTAAAAGAAGCAGTGACATAGAGGAATATACCTATGAAGCCCTTAAAAAGGCAGTTTACAACATTATAAA
CATTGAAGGAAAGTCCATGACCGAGCTTCTTGAAGAGAAGGTCGCTCAAGGAGAGCCTCTTGTCGTCATG
CTTGTCGGTATTAATGGTACAGGAAAAACAACTACAATAGGCAAATTAGCTAACTTTTACATTAAAAAAG
GTTACACTCCAGTTATTGCAGCATCAGACACATTCAGAGCAGGGGCTATTGAGCAGGTTGCCTATCATGC
AGATAAGTTGGGTGTCAAATTAATCAAGCATGAGAAAGGTTCAGACCCAGCAGCTGTCGCTTTCGATGCA
GTTCAGCATGCAAAGGCCAAAGGCAAAGAGCTTGTATTGATTGACACTGCCGGAAGAATGCAAACAAATA
CCAATCTTATGGATGAAATGAAGAAGATTAGAAGGGTCTCCAAGCCGGACCTTGTTGTATTTGTAGGAGA
TGCTTTAACCGGAAATGACGCAACCGAACAGGCAAGAAAATTCAATGAAGCCATTGACATCGATGGAGTA
ATCCTTACCAAGGCAGATGCGGACTCTAAAGGAGGAGCAGCACTGTCAGTTGGTTATATCATTCAAAAGC
CAATTCTCTTCTTGGGAATGGGTCAATCCTATGATGATATTAAGGAATATGATCCTGATTGGATGCTAGA
GCAAATATTCTCTTAAATTTATTATTTGTTAGCCTTAAAGGCTAACTTTTCTCTATTTTTTAAAAACTTA
TTTTTTTTAATTTTAGTACCTATTTTTTTAAAACTTATTACTTTTTCTAATTTCAAAATATTTTTTAAAC
TATAAAAAATGCTATTTTATCCATTTTCAAATCAATCTTTAGTTCAATCCATAGCCCTTCACATAAATGT
CCTTAAATTCTAGTTTCATTTTATTAATCCTAAAATAATTTATTTTAACTAATTCAATAATGCCCTTATT
CCATTTTAGATTTATAAATCTAAATTTATTGCTTTATAAAGTTAAATTTATATAGTAATTTTTAATAATA
TAATAGTGTAATAATAATTAATTAATTCAAAAATTAATTAACAAATTATTAATCCATATTCTTGAACGAT
ATTTATTCTTAATTACTTTTAAATAATAAAATTCGTTCTTTTATTTTTCAATTTTTTATGGTGTGATTAT
GAATTTAGACAGTAACGTTAAAACCGGATTGATTGTAGCTATTTCTATAATTTTCCTTTTTGTTTTATCA
TTGTTTATTACTAGTGCACCAACAGGAGTGGATAATTCTGCTCGTTTCGGAATTTTGACACTGCTTCCTC
CTCTTATAGCGATTGCTTTAGCATTTATTACTAAAGAAACTATTCTATCACTATTCGTTGGAGTTTTCGT
TGGTGAATTCATGGTTTCAGTAAGTGATTTAAACATCATCAGCTCTGCAGTTAATGCATTTTTAGCTATG
GGTGGTCAAATCATCTCATGTATGGCTGATCCATGGAACGCTGGTATTGTCCTCCAATGTCTGCTCATTG
GTGGTGTAATCCAATTAATTACAAAAATGGGAGGAGCAAAAGCGTTAGCTGATGCTTTGGCTAAACGTGC
TGACACTCCTAGAAAAGCTCAACTTATTACTGAATTTTTAGGATTATGTGTATTCTTTGATGACTATGCT
AACTCCTTGATTGTAGGTCCTATCATGAGACCTGTTATGGACAAGCTTAAGGTTTCAAGGGAAAAATTAG
CATTTGTAGTAGACGCAACTGCAGCTCCAGTTGCAGGTATTGCTATTATTTCCACTTGGATCGGTCTTGA
AATCAGTTTGATTACTCAAGGTTTCGAATCAATCGGCATGAATGTAAGCGGATTCGGAATATTCCTTCAG
ACCATTCCATTCAGGTTCTATAACATTTTAATCTTGATTTTCATTGTTATCTCTGCAGTTACCCTGTATG
AGTTCGGTCCAATGAAAGAGGCAGAGAAAAGGGCTCGTGCAAGAAAAGCTGATGAACCTGTTAAATCTCT
TGAAGCAACCAGCTTTGATGATGTAAAACCTGTCGAAGGCATTAAATTATCCGTATGGAATGCTATCATT
CCTATTGCAGTCTTAATTATCGGCGCTCTTATAGCATTCTACTGGAGTGGTTACACTACCATCTTAGGCG
GTGAAGACCAAGCGCTCATTCATTTAATGAAAACTTCTCCATTATCCTTCAACGGTATCTTTGAGGCATT
ATCTGCTTCAGATGCATCTGTAGCCCTCTTCCAAGCTGCATTGCTTGCTTCCATTGTAGCTATCGTTATG
GCAGTTCTCCAAAAGATCCTGACTATCGAAGAGGCAATTAGCGAATGGATTGGCGGTATGAAGACAATTG
TTATCACTGGTGTAATCTTGCTTCTCGCTTGGTCCTTAGGTGGAGTAATCGGAGACATAGGAACTGCTGA
TTACTTGGTTGGAATATTGAAGGACACAATCCCTGTATTCATCTTGCCAACCTTGATCTTTATCCTAGGC
GCATTGATTTCCTTTGCAACAGGTACTTCCTATGGTACAATGAGTATCCTTATGCCACTTACAATCCCTC
TCGCTTGGGCTGTAAACCCTGATATGGGATTTGTTATCGTCTGTACAAGTGGTGTATTGACTGGTGCTAT
CTTCGGTGACCACTGTTCACCTATTTCAGATACAACCATTCTATCCTCTATGGGAACAAGCTGTGACCAT
ATTGACCACGTCCGGACACAGATATACTATGCAATATTCGTTGCATCAATATCAATCATATTCGGATATA
TCCCAGCAGGATTCGGTATCCCATGGTATATTTCAATCCCTGTAGCTATTGTAGTGGATGTTTCATTGGG
ATTAAGAAGGTGATTGGGTGAAAAAGGTAGACCTTTCGATGGACCTCGATGAAGAAGAAGCCGAAGAGGC
TGCTTAATTCATGATTTAATCGAAAAGTCTTTAAATAAGGTGAAAGGATTTAGGAAACTTAAATTATTAT
TTAAGTTTCTCTTTTTATTTTTTTATAAAATCATTATTTTTATTATTTATTTAAGTTTTTTAATTATTTA
TTTCATTTAAAAGCTATTTTTCAGATATTTCTATTAAAAAGAGTTATTGGCTATTATTTAACTATTTTGA
TTAATTAATTAAATTATTTTAATTCTAATTTGAATTTCATTAATTAATTAAAATAAAATTTTTAAATCAT
AAAATTTAAAGTATATTTATCAAATGTTTTAAGTTTAGAAAATTATTTAAGTATATTTATTAAGCGTTTT
AAGTTTGGATAATTATTTTAATATATTTTTTCAGTGTTTTAAGATTATTTAGTAGTGATTTTTATGGCAA
ACAGTAATCAGTCTGAATGGGATAGTAACATTGCATTTATTTTGGCAATGATTGGTTCTGCAGTTGGTTT
AGGAAATATTTGGCGTTTTCCAAATGTTCTATACTCCCACGGTGGAGGATCATTCATGATTCCTTATATC
GTATCCCTATTCCTTTTAGGAATATCATTTGTACTTGTGGAATATGCTGTAGGATACAGATTCAAGTCCT
CCCTAATCAAGGTTCTATATTCTGTCAAAAGCAAATTGGAGCCTGTAGCCTGGTTTATCGCCCTAATCGT
CTTTCTCATAACAACATATTACATATGTGTAGTGGGATGGGACTTGATATATGTGGTCTTAAGCTTTACA
AAGGCATGGGGCTCAAATCCAGACCTTTTCTTCTCAAGCATTGTCCTTCAATCAACAGATTCCATTGAAG
GGCTTCTCCATATTGTTCCTATGGTATTTATATCCGTACTTGCATTATGGGCTGTTGCATGGTACATTAT
TCAAAAGGACTTAAATGACGGCATAGGTAAGGTAAGTAAGTTACTGCTTCCTTTGCTTTTGATTATTGTT
GTTACAATCGTTTTGTTCTCACTGACCTTGCCTGGAGCTTCAATAGGCTATACCCAAATTTTTACTCCTG
ATTGGAGTGCCCTAACTGACTTGAATGTTTGGCTTGCTGCCTTTGGACAGATCGTATTCTCCCTTAGCTT
AGGAATGTCCATTGCACTTACATATGCAAGCTACCTTCCTGAAGGCTCTAAATTAACAGACAATGCTTTA
ATCGTTGCATTTTCAAATTCTGGATTTGAAATCTTCAATTCAATCGGAATATTCTCAATACTTGGTTTTA
TGACCTTAAACACAGGCATTCCATTTGACCAACTGGTTACTGAAGGAACAGGCTTGGCATTTGTTGTTTT
CCCTAAGGTATTCAATATAATGGGTCCTTGGGCTACAATCATCGGTCCGCTCTTCTTCCTATGCATTCTC
TTTGCTGGTGTAACCTCTGTAATGGCATTGCTTGAGGTGGTCTGCTATTCAATCTCTGAAAAGTTCAACT
TCTCTAGAAGAAAATCAGCAACAATAGTCTGCATTATAGGATTTATAGTATCTGTAATATTTACAACAAG
TGCTGGAAGCATGATTTTAGGAATATTCGATGCATTCCTAAACAATATCGCACTCTTATTTGCAGTTCTT
CTTGAATGCATCATATTCGGTTGGATCTATAATTTTGACAATCTCATAGAGACATTAAACAATAATTCAA
ATATAAAGGTAGGAAAAGTCTGGAAAAATGTAATTAAATTCATACTCCCAATCTGCATATGCTGATTATG
GATTCAAGGAGTTTCTGACATTATTGCAGCAGATAATCCTATTAGCAGTGCAGTAATATTGACTTTAACT
GTAATTGTAATAGTGGTTCCCTTTATATTCACATACCTCCCTGCAAAAAACCCAGAATTTTATAATAAGG
TAGAAGACTAATGGTCTTTTACTTTTTTAATTCTTTTTTTTAAAACGTTTTCTTTTATCCTTTTTTTAAC
TCTTTTATCCTTTTTTTAATTCTTTTATCCTTTTTTTAATTCTTTTATCCTTTTTTTAATTCTTTTATCC
TTTTTTTAATTCTTTTATCCTTTTTTTAATTCTTTTATCCTTTTTTTAATTCTTTTATCCTTTTTTTAAC
TCTTTTATCCTTTTTTTAATTCTTTTTTCATTGCCCTTATCAATTAGTTGGACTTTTTTCTTTTTGGCCT
ATTTTTTCACTTTTTCTATTTTGCTTAATCATTTCTCTTGAGATTCAATTTCAATTTTTAATAAAATTTT
CACAAGTTTTTTAAATAAGTAAGTTGTAATATATAGTAATAGTAAATATTAATTAAATTAATTAATAAAA
AAATGATTATTTAATTTTAAATTTAATTTTAAATTGTCAAAACCAATTTACCTAATTCTTTTAGAAGGCA
ATCAAATGGATGATGAAACTAATAACAATCAATGGAACAGTTCAACAAGCTTCATACTTGTCATGGTAGG
ATCCATCATAGCATTGGCAGGGATTTGGAGATTTTCCTATCTTATTTATGAAAACGGAGGGGGCAGCTTC
CTAATCCCATACATATTAGCCATCGTTATCATGGTCATCCCCCTTCTTGTCCTTGAGTTTGGAGTGGGAT
TCAAATACAAGGCAAGCCTGCCAAGGATATTTTACAATATCAAGTCTGAATTTGAAATAGTGGCATGGTT
TATCCTTTTCCTAATATTCATAGTCCTAATCTGCTATACTTGCATAATGTCCTGGGACCTTATCTACATA
GTCCTAAGTTTATTTAAAGGATGGGGCAATAATCCTAGTGTTTTCTTTACAACCACCCTACTTCATAGCA
CCTCTAATCCATATGGCTTAACTTACCTTGTAGTTCCTATTGGAATCGGCCTCATATTAATCTGGGCCTT
GATATATTTCATATCTCGAAGGGAAATAAATAGGGGAATATCATTAGTGACAAAATTTTCCCTGGCATTG
ACATTTGTTCTCGTCATCATCCTTTCAGTCTTTGCCCTTCAATTGCCAGGATCCAGAACTGGCCTTATGG
CCTTGTTCAATCCAAATTGGGAATATCTCTTGGACTATAACATTTGGCTCACTGCATTCGGACAGCTTAT
ATTTTCCTATGGCCTTGCATATGGAATCGCAAGCACATATTCCTCCTATCTTCCAGAGGACAGCAAGCTT
ATAGACAGCGCATGGGTTATTGTTCTAATCAGCCTAATATTCGAAATTCTGATGTCTGTTCTCATATTTG
CATTGCTTGGACATATGGCATTGGGAAAGAACATGCCTATTACAAGCCTTGTAAGCGACAGCTTCTCATT
GATATTTGTGGTTTTCCCTAATGTATTCAATGTGATGGGCTCATGGGCAACAATAATAGGTCCATTGTTC
TTTATGGTTATATTTATAGGGGGATTAGGTGCATTATTTGCTCTTATAGAGCCTTTGGCAAATGCAATAT
GCGAAAAGTTCATTTGGACTAAGGATAGGGCAATAAAGACATTGGTCTTGGCAGGACTCTTTGCATCTTT
CATATTTGCAACAGGAATGGGAGAGTATTTCCTTAGGATAGTTGACGGCTTCATAACCCAATTTGCAATA
ATTCTAGTTGTTTTGGTAGAGATATTAGTATTCGGATGGCTTTTTGACCTTGATGATATAAGAAATGTTT
TAAACAATAATTCTAGAATAAAGCTCGGAAAATATTGGGTCTATCTAATCAAGTTTGCAATTCCGATTCT
TCTTATTGTAATCTGGATATTGGGAGTTTATAATTTGATTATAACTGGAGACAGGCAAAGCCTTCTTGTT
CAGTCCATTTTAGCTTCAATCATTGTTATTGTGCCTCTAGCTCTAACTGTAGCTCCATTTAATGGAGAAT
ATTCTCTTGGCTCAATTACAGGAGGATATAATTACTTTAGGGACAGTGGGGATGATGAAGAGGCCAAATC
AAATTCAAAGCCAGACTTAAAGTCCAGATTCACATCAAGATTCACATCTAAGGATAATGATGTTGATAAT
GGCACTGAAGGCTATGAAGAGAAGACCTATGTTGAAAAGACAATAGATGACTATGAGGGCTATGATGGTG
TAGTGGCAATCACAGATGATGAAGAGGAAAATTCCAGCCTTAAATCCAGATTCAGTTGGGACAAGTTTAA
AAAGTCTAAAAATGGTAAGAATGTTTTAAATAATGTTGATTTGTCTGCGAAAGAGTTTGATCCTCCAAGC
GATGATGATTATGATGATTATGAAACTTATAATAGTTTAGATGATGGTTATAGCCAAGGCTCTGATGATT
TTGATAATAGTATGGATGATTATAGGTCTAAATCTAAGTCCAAATCTAAATCCAAATCTAAATCCAAATC
TAAATCCAAATCTAAATCAGAATCTAAGTCATTATTTGAAAAGATTAATTTATTTAATAAAGACCAAGGA
GAGAATGATTATTTGGATGATAATTATGGCTATAATTCTAATGATAATTATGAAGATGATGATTCCTCCT
TTGAAGATGTCTTCGATGATTTTGATTATATAACTCCTATAAGGGAAGAAGAACCTAAATCTAAACCTAA
AACAAAGTCTAAACCAAAATCTAAAACAAATTCCAAATCAAAATCTAAGGCTAAAGGTGGAAATAAAAAA
CCTAAATTCATTAGTGCTGAGGATCTTGATGGAATTGAAAGTTTAGATGATTTAAGTAGCCAGCCTAATA
AGAAACCTGCTTCTAAAAAGACTTCTGCTTCTAAAAAGAAATCAAGTTCAAAATCTAAAAAGGAATCTGG
CTCTAAATCCAAAAAAGCATCAGAACCTAAAGAAGAACCTAAACCTAAAGAAGAAGAAATAGAATATGAA
GAGTTCTCAGATGATTTCTTTGATGATGGTGTATTTGGAGAGGAAGGCTATGAAGCTCTTCTAGACGATT
ATGTGGAACCGAAACCAAAATCCAAAAAGAAAAAGGCATCTTCCAAATCTGACCAATCTACACCTAGGGA
TTCTAAACCCTATTATGATTATGAAAAGAAAGGATCAGATTCTGTTTTTAATTTAGATGATTAAAAATCA
TCTAATACTTTATTTTTTTATCTCTTATCTTTTTTTAGTCCATTTCTTTACCTATTTAACTATTTCTATT
CCTATTATTTTCTATCATTTTCATTTTTTATCATTATTTGTTCATGATTTTTCAATTAATTTACATATTT
ATCCATATTTTCAAAATATAAAATTTATAAAAGATAAAAACATACCTATAATTATCAAAATAGGTGATTA
TATGGATAAAAAAATGACAGTTTTATTGGTTGCCCTATTTTGCCTTCTCTGTGTAGGCTCATATCTAATC
TTTGAACCTGCCAGGCATATAAGCTATCATGAGGTCAATCTCACTGACACCTGCGTTGCAAAGGTCCCGG
TAACCGATAAGGTATCTTCATATACAGACAACTTAAACATTCACTACTATTCCGATTATGAAAACGATCT
TAACATTACAAGTTTTTATGATGTGGCTCCGGAATCTTCGTCTCAAGGGCATCTGAGAATGGACAATCTT
AAAAAGGAAGTTTTAGGTACGGAAAAGGGAAGTGCAGGCAATCTCACTTATTATAAAAACAATAATGCCG
GAACTTACACAATGTATGTTGAAGATAGAATGTCACATAATTATATTTTGCTTTCCGCTAAGGACTTAAC
AATTTTCACTAATGTATATTCTAGCTTAGAGGCTAGAATTGTGGTAAATGAAACTGATATTGATAGTTTG
GACTCAAGCTATGCTTAATTTTGGCTTTATTTTAGTTAAAAGATAACTTCTATATTTAGTCAACTTAAGA
TTAGTTTTTAATTTAGATGATTAGCAATCATCTATTATTTTATTTTTAATTGTATTTTTAATTGTATTTT
TAATTGTGTTTTTATTTGTATTTTAACTCTCATGAATTATTTTTAAAAAAACAACTTATTTTATTACTGG
ATTGATGAACTTATGAACACTGCAGAGATTTTAGTCAATTTGCTTGAAAGGGATGGAAATGAATTTATCT
TTGGCCATCCAGGTGAACAGATACTTCCATTTTATAAGGCATTGAAGGACTCTTCAATCAGCCATATCCT
AACAAGGCATGAACAAGCTGCAGCCCATGCTGCAGATGCATATGCGAGGGTTTCTGGTGAATACGGCATT
TGCATATCAACTGCAGGTCCCGGTGCCATGAATCTGGTCATGGGAGCCTCCACAGCATTCAAGGATTCTG
TTCCAATGCTTGTGATAACCGGAGACAATGACTATGATAAAAAGGACTCTGACATTTTTCAGTCATTTCC
TATAAACTCTGTCTTTGAGAATATATCAATTAAAAGCTTCCATCCTTATGATGGGAAATCCGCTGTTTAC
AATATGATTGAAGCATTGATTCTTCTTCATAAGTTTCCAAAAGGTCCTGTTCATATCAATCTCTCTAGAG
ATGTACTTTTAGAAGAGATTGATTTTGATTCTATTGATTTAAGAGATATTGGTCTATCTAATATTCCTTC
TTTGAATCTTAATGATTCTGATATAATTGAAAACTTTGATCTTTTTGATGATTCTTTAGATAATTTATAT
GACTTTTCACAAAAGTTATCCGCTGATGTAGATATAACTATTCAATCAGCTATTAAAAAATTAAAGGATT
CGTCAAAACCATTAGTCATACTAGGAAATGGTATAGTTTGGTCAAAAGCTACTTTTAAATTAAGCGACTT
TTTAAGTAAAACTATGCTTCCAGTTGTTACCACATATCACTCAAAGGGAATAGTCAGTGACCATGACAGA
TTGAACCTTGGGATAGTAGGTCTTAGGGGAAACTCATTGTCAAATTATGCTTATGAGAATTCAGATTGCA
TTTTGGTTCTAGGTGCCAAACTCTCTGAACGTACAATCGGTGCTTCCGACTTTGACATTGCCAAGGAAAA
GATGATACATGTTAATATTGATGAGAATTGCTTAAAGGGAAAAATTAATATTTGCATGGATGTTAATGAG
TTCTTGGACTGTCTTTTGGATGAATTAGATCAAGATAATGGAACATTTGATTATGATGATGGATGGATAG
ATGAGATCTACTCCAATTATGAGGAATTGATTGTTGGTGGAATTGAAGAAGTGGAAGAAAACTTTAATCC
ATTAAGGCCTCCTTATGCGATTAATAGGATTATAGATGCTTTTAAAGGAGCATATTTCCTATCAGATGCA
GGAACCCATACGACATGGACTACTTTGCTTGCAAAAAGCGATTCATTCGGCAAGCTTTTGTTTTCAGGTG
GCTTTGGTCCTATGGGATATAGCCTTCCAGGGTCCATTGGTGTTGCATTTGCCTTAAAGAAGAGAGGAAT
TGATGAAAGGGTGCTTGTCATCTGTGGTGATGGAGATATTCAAATGGTAATTCAGGAATTGGCTACAATT
AGGGAATATGATTTGAATATTGATATTTTTATAATCAATAACTCTCAGTTAGGAATAATAAGACAATGGG
AAGAGACTGTTTATGACTTTGATAAGTATCAGGTTGACCTTATTAATCCAGACTTTGCTAAATTGGCTGA
TGCATATGGTGTTGATTCTATGAAGGTGGAATCTAAGGAAGACCTTCAATTGGCTATTGAGATGTCTTTG
GATTCAAATAAGGCATTTTTAGCTGATGTATGTGTTTGTGAAGAGAATATTCCTATGCCTAAAAAATAGT
GTATTGCTTTAAAAGTTAGTTTAACTAATTTTTTTTATTGGTTTAAAAACTCTTTTAAGAGTTTATCTTT
ATTTTTTCCAATAAATTCAGTGTATTTTTCATCAATCGCTTCTATTTGATAATCTTCATTTTCAGCTTTT
TTTAATAGATAAGCTATTGGCTCTATTTCTAAATGGGATATTATTCTTTGAGCTTTTTTATTATCTTTGT
TCTCTTTATTTTTATTTTTATTTTTATCTTTAGTTTTGGATGGGTTTGCATTGATTGAAATGATATCTAC
TTTGAATATGAAATATATTTCATCTTCAAATATGGTAAAAGCTTCGCTAAATTCGTAAATTGTTTCTTTA
TTGAAGCTATTTATTATTTCTAGTCCATCCATGGTATCACTTTATTTGTTTGCTTATTCTTTATCTGGTT
CTTCTTTAAATTTAGATTTTGGTTTAAGTTTCTTTTTCTTCTTTTTTATCTAATTCTTCTTTGGAGTTTT
CTTTAATTTCAGTGTCTTTTTCTTTTTTATCTAATTCTTCTTTGGAGTTTTCTTTAATTTCAGTGTCTTT
TTCTTTTTTATATAATTCTTCTTTGGAGTTTTCTTTAATTTCAGTGTCTTTTTCTTTTTTATATAATTCT
TCATTGGAGTTTTCTTTTTCTTCATTTTCTTTATCTTTGGCTTTTTTATAAGCATAAATTACTTTAATCA
ATTCTCTAATGTCCTTTTTGCTTACTAAAATTAAGCTATAAAATATTATTTTCAGTAGATTTATCTTTAA
TTCCAATTGTCCTTCAAAATCAGTGATTATCTCTGTAAATCTAGGATCTACAGTTAATGAAACTGGCTTT
TTACTATTTACTATAGCTCCTATTGACCATATCCAACTTGCTATCTTGACTGTGGTGAAAGAGTCGCTTA
GGCCTAGTATCAAGTGTCCTTCGAGTTTCTTTATATCAATTGATTTTAGAATGTCCTTTAGATATTTCTT
TAATTCTTTCTTTGATTTAATTAGCTCTTTTAGGATAGGTTTAATTTCATTGTATTTTTCCATCAGGCCT
TTTTTGTCTTTGGACTCTTCTTCCTCTCCATCTTCTTCTTTTTCCTCTTCGGATTCTGTAGCCTTGTCTT
CAGAGCTATCTTTTGTAAAAATAGGGATTTTAAGCAGAGTTATCTTTAATTTGTATCTGGCTTCTGCTTT
TTCCTTTTCAACAGTTAGAATTATTCTTAAACCATTGTATAGGATTATTGAAAATATGATAATTAAGGCG
ATTAGTATAATTAAAATAAGATTTAAGATCATTTCTATCGCCTTTTCATATTTTGATTCTTTTTAACTTT
TAATTTTTATTTATAAATCAAAGCTTTAAATTGGTTTTTTAAGTTATTTTAGGATTTAAATTTCTTAATT
TTTCAAGTTGATTCAGTTTAAACAGCAAAATAGACTTATTAGTCATCTATTTCAATGCCTAATGATTCTT
CTGCTTCTTCTACTTCTTCTTCAACCTTTTCTTTTAGGTCTGATTCTTCAACAGCATCTTCGACCTTTTC
TTTTATGTCTGCGTCTTGGATATCAACTTCACTTACGTCATCAACATCTATGTAGTCGTCATTGCCTTTT
GATGGGAGGAACTCTTTTAAGACATCAGTTAGGATTAATCCGATTTCGTTTAATGTCTTGTTGGTTTGGT
TTCCTTTTGATAGGTTGATTGTCCTTATTTCATCAACTCCACTGTTTCCTTTTGATACGACAACCATGGT
TATAGGTTCAACGCTTACACCTGCACCGGTTCCGGCAAGTGAATTATCAGCCTTTTGCTCTCCTATTCCG
AATCCTACTGCAGCTTTGGATACAGGGATTAATAATTTGTCTTCAGTTTCTATTGCGTCTCCAATATAGT
TGCTAATGTGAATAAGCTTTCTTAATTCTTCTACAGTTGTTTTAATTGGTTCTTCATCAATCATTCTTTT
ATCTCCTTATTTTTTATTTATATATTTTAATCTTTTAAAATTATAAAATACTTGATTTATTATTAGTTTT
AATAAATTATATTTATTTCGATATGGCTTTTTAATAGTTATATATGCTAAATCTTTATTGCTTGGATAGT
TAAATAAAAGATTAAATTTATTCGGCGATTAAAATTAAGTTAAAATTATTGATTTTGTAAAATAAGTAAA
ATTAAGAGTTTGTTTGTAAAAAGAGAAAAAAAGAGAATAAATGGAAGTTAAGAGTAATTACTCCCAACTT
GAATAAAAATTTTGATCAAACTTTTTCTAAAAGTTTGAATTTGATGTAATGGTTCGCAAGAGCAGCCACA
CCGGCACCTGCATCTTCAACTAATCCTAATCCTTTTAAGGTTAATCCTAATGCAGTGAAAGTGATAGCTA
ATTCTTGATAGTTGATTACACCCATATGTCCAATTCTGAATATGTTTCCTTTAAGGTGGTCTTGTCCCCC
TGCTAATTGGACTTTATATTTGTTGAGCATGGTTCCTCTGATTTGGTCGTCATTTGCTCCTTCTGGCATT
TTTACTGCAGTTACAGTTGCAGAGGATACAGCTTCATCAGGGAATAATTCAAGACCTAAAGCTTTAACAG
CATCTCTTGATGCAGCTGCTGCTGTGTGGTGTCTTTCTATTCTGTTTTCAAGACCTTCCTCATGGAGAAC
TTCAAGAGCAGCCTTTAATGCATAGATCAATGATACAGATGGAGTATAAGGGGTTTGAGCAGGGTCCTTA
TTACCGTTTGCTCTGTATTTAGGCATGTTCAAGTAGTAATTGTTGTCTTCTACCTTTTCACATGCTGCCC
ATGCGTCGTCATTGAATGTGATTGCTGCAAGGCCTGGAGGTGCGGCGAGACATTTTTGAGAACCGGTTAC
ACATGCGTCAATGTGGTATTTGTCCACATCCACATAGTCTCCTCCTAAAGAGGATACTGTGTCTACAATG
AATAATGCATCGTGGTTTTTCATTACTTCTCCCACTTCTTTGATAGGTGCGGCAACACCGGTTGAGGTTT
CATTGTGTACCATGGTGATTGCTTTAATGTCTTCGTCTTTTTCTAAGGCTTCTTCAACAAGGTCTGGAGT
TACAGCGGTTCCCCATTCAACATCTAACTGTACGGATTCGATTCCATGCATCTTGGAGATGTCTGCAAAT
CTTTCACCGAATTTTCCGCCTACTACATTTAATATTTTATCTCCTCTGTTGACAAGGTTTGAGACTGCTG
CTTCCATTGCAGAAGTTCCAGAACCTGTTAGGATATAAGAATCATTTTTAGTTTGGAAAGTTTTAGACAT
TAATTTGGTTGTTTCTGTATAGATTTCTCCAAATTCGTCTCCTCTGTGGTTTACAACAGCTTTGCTCATT
GCTTGTAATACTCTTGGGTCTGCAGTTGTTGGACCTGGGAGCATTAATAATATTTCGTTCATTTATTTTC
CTCCAATCATAAATAAGAATTATAATGCTTGATTTGAATAATTTAATTTTAATATTAATTGATTATATTT
TAATTTATTAAATAATGTCAAGCTATATATAAATTATTTTTTTAATAGTTTTTAAATATTTTGTCGGCAA
TTTGTTTTCTTTATGGATTTTGTAATTTTCATTGATATCTTTTTATTTTTTTTCTTTATGGATTTTGTAA
TTTCTGTAGTTTTGTTTTCTTTATGGATTTTGCTGTTTCAATGATATTTTTTCTTATGCTTTTTCTAATT
TCTGATATTATTTTAGTTTATTCTTAATTCGCTTAACTTCGATTTTATTTAGGGCAATTTTTATAAAGGA
CTTTCTAAAGAATAATAATTATAATATTTTAATGAGGTTTTTTATGAGTTTTAGAACAAAAAGAGTAATT
ATATCCACCTTATTAGTAATGATATATGAATTCTTTCTGATGAAATATCTTTTTTTACTCTTTGGAGGAT
TGGATGACATTTATTTGCTTTTACTCACTATTTTATTCGGTATATTGAATATGGTTCCCATGTTCTTTGA
GGAAAAGAAGTCAAGGCCTATTACAAGGCTTCTTGATACGATATCAGGATTTTGGATATGGATGTCTCTC
TTTTACTTATTTGTCATATTGATTATCTATATCGGAGGAGTCTATATTGATTGGCCGTTTTATATTATAG
TCATTCTAGTTCTTCTTGTTCCATTATTGACAGTCTATTCCTATTTCCATGCACATAAGATCATTATTCA
TGAAAGGACAATCCAAATGGATAATATTAATGAGGATATCAACATTGCCCACCTTTCTGACGTTCATTTC
GGCTCAACAAGGCATGATAAGATCATTAGGGATCTTTCTGATAAATTGAAGGAGCTTTCAGATTATTGTG
ACTTGGCAATTATCAGTGGAGACATTGTTGATGGGTCCTCTGCTATTGAAGAGGATGATTTTCTACCTCT
TAAGGATGTGAATATGCCTATAGTCTTTACACCAGGCAATCATGACTCATATCTGGATATTGAGGACGTC
TTTGGGGCATGCAGAAATGCAGGCATTATTGTTCTAGACGATGAGGGAATGGAATTCGGCAATCTTAATA
TATTTGGAATGACATTCATCTTTGGAATGACCCGCAAGTTTGAAGAGTTTGAAGTAGTCAGCACAGGTGT
ATTAGGGGATTTCGTTAAGGAAGATAAGGTGAATATTATCATTTTCCATGTTCCTAAAAACTGGGAGGAC
TTTTCTAAATTAGGATTTGACATTCAATTGTCTGGCCATACTCATGGAGGCCAGTTCCATCCACTTACTT
GGATATGCGATCTTATTTGGTATAACAGAGGTCTTTTTAAAGCTAATATTGGTGGCAAGGACAGGTATTT
GCATGTTACTACTGGTGTAGGCTCTATGGATTATCCTTTTAGATGGGGTACTGATTCAGAGATAGTTGTT
CTAAAATTAAGAAAGAATGATTAGTTTAGATTGATAGTGAATTTAATGGATTGATTTAGGTAAATCATTA
TTTAAATTGTCCTAATTATTATTAATTTTATTTATAATGCTTTTGAGTTATCGGAATTCTATTAGAAAAA
CATTAGGTATGTGTTGTTATGCTTAAAAGAACAGTTAAAAAGAATGGAGATGAATTATTTCCTCTTGGAT
TGGGAGCTATGCGACTTCCAACTAAAAACAATTCAATTGATAAGGATTTGGCTCGTGAATTTATCCTTTA
TGCAATTGACAATGGAATAAATTATATAGACACTGCATATGCCTATCATGGTGGAGAAAGCGAGTCCTTT
TTAGGAGATATATTGTCTTTAACTGATTCCGATGGAGTAAAATACAGGGATAAAGTCAAATTGTCCACCA
AATCACCTTCTTGGATGGTAAGGTCAAGGGAGGACTTTGATGCCTTTTTAAATGAACAGTTAAGGCGACT
TAAAACAGACTGCATTGATTATTATTATCTTCATACAATCGATTTAAGCATATTAGAGCGTCTTAAGGGA
TTGGGAGTTTATGAGTTTCTAGAAAAAGCACGTTCAGAGGGAAAGATCAAGAATATTGGATTCTCCTATC
ATGGCGCACCTAATGAGTTCAATGACTTGATTGACGACTATGATTGGGACATGGTTCTTGTTCAATACAA
TTATCTGGATGTGAATGCACAGGCAGGAATTCGCGGAATCAGATATGCATATGAGAATGATGTGGCTGTA
TTCATTATGGAACCTTTAAAAGGAGGAATACTCGCTGGAGAATTGCCTAAGGAAGTTGATGGGCTGTTTA
AAGGTGTCGATTCCAATAAGTCTTCAGTGGATTGGGCTTTAAGTTGGGTCTTAAACCAAAAGGAAGTCAC
TTGCGTACTCTCTGGAATGGGTTCTATAGAGCAGATAAAGGAAAATATGAATATTGCAGAGAGAGTTGAA
GTGGATTCATTGTCTGATGATGAATTGGCTGTATTGGAGAAGGCTCAAGGAATCTTCAATTCAATGATGA
AAATAAATTGCACAGGCTGCGGCTATTGTCTTCCTTGCCCTAAGGGAGTAAACATTCCAGATTGCTTTAA
TATTTATAATGAGAAATATTTGTTTAATAAAAAAGCATTTGGACCTATTCCCGGTGCTATGGTGAATTAT
TATATGGTTGTTGGTGGAATAACCAATAAGCAGTCAAATGCAGGTCTTTGCAATCATTGCGGTAGGTGTA
AAAGATTGTGTCCTCAGTCATTAGACATTCCAAGCCATTTAGATAGTGTAAAGTCTGAATTCGAGAAGTT
TGGATTTAATTATCAGATTAAGTTTATTAGAAATATTGCAATGCCTTCTATAAATAAGATATCTAAGGTA
TTTGATGTCTTTAAGCATTCTTAATTGTTATAATGTATTTTGAAGTTTAGCTTCTTTTTTTAACTATTCT
TAATAGTTTATGCTTTAATCTAACCTTTTTTTTTATTTATAGGGATAAGAACCCCTATAAATTTATTTAA
TTTTAATTTTTACTTATTTTATTTTTAGTTTCAGTTCTACTTATTTTATTGTAAGTTTTGAACTTTCACT
TATTTTTATAGAGGGTTTTAGAGTTCTGTTTATTTTATTGTAAGTTTTGAACTTTTAGTTACCTTCTTAT
AAGTACTGTCTCCTCCAAACTGAACTGTAAAACTATAAGTTCCTTTTTTGCTTAAAGAGACCTTTACACT
TGCTAAACCTTTACTGTTTGTATTTGCAGTGTATACCTTTCCATTAAGTGTAAAACTAATCTTCTTGCCT
GCAAGGACATGTCCTCTAGATGATTTAAGAGTAGCAGTCAAAGTCTTGGTCTTTGCACTTGATTTATATG
TTTTAGCACTTGTGCTTAAGACTGGAATCTGTTCAGTCACATTGATTAAAGCAACATTAAAGCTTCCCTT
ATAATAATCATCTCCTAAGAATGCTATTGCAAAGGTATAATGGTTGACATATTTTAAGTTGATTTGAAGC
CTTGCCTCTCCTGTTTCATTTGTTGTTCTATTGTATTTGACTCCATTAAATCCAATAAAGACTTGTTTGC
CAGATAATGGTTTTCCATCTTCATCCAACAATTGGAAGCGGAAATATTCTCCAATACGTCCTTCTATATT
TGAATCAAAAGCAATTGTATTCATGTTTGTGTATTTGAATGTTGTATTTATTCTATTTATTCTCACACTT
GCACTTGCATTTGATCCTGTATAGTTCTCATTTCCCGCAAAGACTATGATTGCCTTATAAGTGTCTGGAA
CTAGATCTTTAGTTGAAACTTTGATTTGTCCTGAAGAATCTGTAGTGTAGTTCTTTTTGCCGTTTAAGTC
AACAGACACTTTAAAACCACTTAATGGATTTTTCTTGCTGTCTTTTAAACTAATAACTAGGTTCTGATTG
TCTCCATATCTTGCAGTGACATTGCTTGCAGTCAATTTGCCGGAAATTTTATTTACAGTTATTTTCGCTG
TAGCATTTGATTTTTCGTAAATTTCGTTTCCTTCAAATCTAATCATTGCTGTATGGTTTTTTGCAGGTAA
ACTGCTTGTTGGAACTTTTATTTGCCCATCAGAATTAGTAGTGTAATTTTTAATACCCTCTAATTCAACT
GAGATACTTGCATTATGGATAGGCTTATTATCTTTGTCTTTTAGGCTAACTGTCAAATATTTATCTTCCT
TATAGTTTACTGTCATGTCTGTTCCATTTAAAATGCTTGGAATTTTTAATATTTCTATATCTGATTCTGT
GCTGGCCTTGTTATAGTTTCCATTGCCTTCAAATGTGATCTTTGCTGTGTAATTGTTAGGAATCAATCCT
TTTATTTCCACTATTGCTTGTCCATTATCATCTGTTGTATAATTATTCATTCCGTTCAGGTCAACAGTTA
GTTCAACCCCGCTTACTGGGTCTCCATTGACGTCTTTTAGTCTAATCACCAATTCTTTAGTTATATTATA
GATTGTTGTGATATTATTTGCAGTTATTTCTGTATTTAGCTTATTCACTATTAGTCTTACACTTGCATTT
GAAAATCTGTAGCTTTCATCTCCTTCATAGATGATCTTTGCTATGTATTCATTTGAATCCAATCCTTTTG
TTGGGACTTTTATCTCTCCCTTTGAATTAGTTGTATAGTTATTTGTGCCATTAAGTTCAACAATCAGCTT
TGCATTGGCTATCGGTTTTCCTGTGAGGTCGGTTAATCTTGCTATGATGTAGTCATCCTTTTTATAATCT
GTTGTTAGGTTTTCTGCTGTTATTTTGGTCCTTATTTTATTACTTGAAATTACATATACACTTGCATTGG
AATCAAGATGGTTTTCATCTCCTTGGAATCTTATTAGGATGTTTGCAGTTCCTTCCTTAATTGTATTTAT
TTCCCCTGTCTTTGAATCTACTTCGACTGCGCTTCCATCTGACTTGAAGCTTATGTTTCCAATGTCCTCT
GGGTTAGTTATGTATTGGCCTTCATCATCTATAACATAGAAAGTGTAGTTGACTTTTGAGTTCTCTCCTA
TGCCTAGGTCTATTGTGTCATTTGTTGGAACTATTTTTGTTCCTGCCTTATTCACTATAAGGCTTTCGCT
TATGTTCTCCTCTAGGAATGACCTATCTCCTGAATATTCTATTCTTACGTTGTAACTGTCCCTATTTATG
ACTCCAAGGAATATTGTCTTGTTCAGGGTCATGTTTTCAAAGAGGTATTCATTATTTTCTCCCATTAGTC
TTATTGTGACATTTCCTCCTGCAAAGTCATTGTAATTAAGCTTGATTGATGCATTTCTGCTATAGTTTAT
CTCTTTAGTATCCATTGCAATTTTTGAGGATACTCTCCTGTTTGTTAGATTTATGCTGTATCCACTCTTA
TCTATTGCTCCTCTTATTGTATCTCTTCCCCCTTCTATTGCAGTATAGTTTATCGGCTCATTGAAACTGG
CGCTTGTCTTGTCAAATCTTCCCCTTTCTGCACTTAAGTTTAGCTTGGTGTCTGTTATTAGGGAATTGTC
ATATTCACTTATCAATATTCCGTCATAGGAATATAATTTAAATAAGATTTGGGAGCTTTCAAAGGCATTC
ACTATTTTTGGATTTGCTGTTCCATTTAAAAATAGCCAATCACTAAGGGTTACATTTGGGCTATTGTCAT
ATTCGAAGCTAGTGTTTGGATTCAAATTATAATTGCTTGCATTGTTTCCAAACCAATTATTGCTTCCGTT
GAAAGTTCTGACATTGTCGAAATAGATTTCACTATTCTTATTGTTTAAGATGATGTTATAGTTAAGATTT
GAAGAATATCCCTCATAGTAGATTGCTCCCCCATGATTTGCATTATTGTTGGCGATTGTGTTTAGGCTTA
TTATTCCCTTATATCTATCCCAGTAGATTGCTCCTCCATTGTCGGATGCATTGTTGTTTTTTATTGTATT
GTTTATTATCATTGCATAATCCATGCTGACGTAAAGTGCTCCTCCATCGTAGGATGCAATGTTGCTTTCC
ATTGTATTGTTGATTATGCTTACATTATTTCCATAGCAAAGTATTCCTCCTCCGCTATATCCGCTGTTGT
TTGTGAATGTGTTGTTTATTATCTCTCCACTAGTTATTATTATGCTGATGGCTCCTCCTCTGTAGGATGC
GTTGTTGTTTGTGAATGTGTTGTTTATTATCTCTCCTATCTCTCCTCTTATGCTGATAGCCCCTCCTTCT
TCAGAGGCGTAGTTGTTTTTGAATGTGTTGTTTATTATTCTTCCTATTTCTCCTTCCCAGAGAATGGCGC
CTCCATTGTCGTCGGATGCAATGTTGCTTTCCATTGTATTGTTGATCATGCTTAGATTATCTGCATAGCA
GATCATTCCGCCTCCTTTATATCCGCTGTTGTTTGTGAATGTGTTGTTTATTATCTCTCCACTGCTTGCT
ATTAGGTAGATGGCGCCTCCATCGTAGGATGCGCTGTTGTTTGTGAATGTGTTGTTTATTATTATTCCTC
TCTCTACTGTTATGGTGATGGCACCTCCTCCATCGAATGCGCTGTTGTTTTTGAATGTGTTGTTTATTAT
TCTTCCATTGTCTCCTTCCCAGAGAATGGCGCCTCCATTATATCCGCTGTTGTTTGTGAAATTGCTTTGA
ATCAGGGTTCCGTCAGCTCCTTTCCAGTATATGGCTCCTCCGTCACTGTCGTAGGTGTCCTCATATCCAT
TTCCGTTTATAAGGGAAATATTATTTATTGTGACATTGTCTCCATTTATATTGAAGATGCGTGAGGAGTT
TAATCCGTTTATTGTAAATCCGTTTCCATTAATGATTAGGCTGCGGTTGACATTGATTCCCTCTTTAAAT
TCAAAGTCTATATCATCATGATATGTGTAATTTCCGCTTATATTGATTTCATTATTGCTGTTGTTGTTGA
TGAGTTGGTTCAAGTCATAGAATGTGGTTCCGTCAGTGACTAAAAACTCCATTATTTCAAATTCTGAATC
TATATTTGCAATATTTCCGATTATTCTCTCAACATTGATGATTTCTGTTTCATATATTGTTGTTTTTCCT
AAAAGATTACTGTTCGGATTTAAGATTCCATGCTCTGCATGTGCTGTTAGATTGAATGGAAGCTTTCTAT
CATCATAGTTGCTTATTTTCTTTGTATTCTTATTGAAAGAGGATAGGGTAAATGTGATTTCAAAGCTGAT
CGGATTCTCCAGTGAGACCTGGTTGCTTTCTCCATTTAGGAATATCCAATTTGTGCAGCCTTCATATGGC
ACCTCATCATAGTTCAGCAGAGTGTTTCCAAACCAGTTATCGTGTATATTGCTTTTAGGGGAATTGTTTA
GATATATTTTATTGCCTTCAGTGTTTAGGATAATGTTTTGATTAATCTCTATCTCTGAGATGTACAATCC
TATTGCTGTTCCATAATTGGCATGACTTTCAGTGATTATGGACTTTTCTAAGCTTCCATTTGCAAGGGAG
AATTGAACTGCCCCTCCTAAATCTGCAGTGTTGTTTGTAAATATGCAATTGGAGATGTTTCCGGATTCAT
AGACGTTTATTGCACCTCCGCTTTTTTCGGCAAGGTTATCTATGAAGGTGCAGTTGGAAACGGAGGCATT
CCTTTCAATGTAAATGGCTCCCCTCCTTTATAAAATCTCAATCCATCTGATTCGTCGTTTAAAGCAATAT
TGCCTATGAATGTACAGTCTCTTACTGTTCCTCCTTTCTGTAAATAGATTGCGCCCCCTCCTTTCATTAT
TCTCTCTTCAATTTTGGATTGGGCTGTGTTGTTTTGGAAAATGCAGTTATTGAGTATCTCTACTTGAGGA
CAATAGATTGCGCCGCCAGAACCTTTTGCAGTGTTAAATGTGAAATTGCAGTTATTTTCTATCCTTCCGC
CATAGTTAAGCCAAAATAGGGCTCCTCCCTCTTGGCCTCCAGTATTGTTATGGAAGGTGCAACCATCTTT
TATGGTGGCTCCGCCGGTATGGAAAAACATTGCCCCTCCCTTTTGGGCTTCGTTTCCAATGAAATTGCAG
TTTATTATGGTGCCGTCATCCCCTTGTCCATTGCTATAATAATCTGTTAGATTTGTATTTCCCCAAAAGA
TGGCTCCTCCAGATGTTGCCATATTGTCTGTAAAGTTACAGTTGCTGATATTTCCATTTTTTCCAAGCCA
TAGGATGGCTCCTCCCTTGTCAGATTTTCCATTTGCAAAATTGACGTTTGTAATGGTCACATTGTCTGCA
GTGATTATGAAGATTCGTCCTTCATCCAATCCGTTTATTGTAATGCCGTTTCCATTCAGCTTTAAGCTGC
GGTTGATGTATATCCCATTTATAAATCCGGAATCTGCGCTGGAATTAAATGTGTAATTGCTATCTAATGT
GATTTCACTATTGCTGTTATTGTTTATGGTCTGATTTAAGAGCCAGAATGAGGATCCTTCTATATTTGTG
GTTTTTATCACTTCAATGGATTGGTCATTGGAATTTTCAACCATTAATCGGGCTTTATATGTTTTTGGAT
TCAAGTCAATCGGCAGGCTTCCCTCATCCCTTAAGATGTGGGATGTTGTAAGATTTGAGGAACTTAATAT
TTCAGTGTCAATGTAGGTGCAGTCCTCTTCCAAGAGGACATAATCGCAATTTAGGCTAATTGTATGGTTG
TTGGGGTTGTCTATGTTTATTAGATTATTTAGATTGGTGAATGAGTCTGTTTCTTCATCTTTAAGACTTG
TTTTCTTATTTTCCTTAGAAATAACTTTGTTGTCTTCTAGGCTAATTTCTTTATTGGTGCTTGATTCCAC
TATTTCTTTAGTCTTAGTTATCGAAAGATCCTGATTTGTTTCTTCTAAAACTAGTCCTTGATTATTGTCT
TGGCTAATAGGGTCATTTGCATCAGATGCAGCAACTGCAGAGACACTGATTATGCAAATAAGAGCTATTA
GCAGAATAAATAAATATTTTTTGAATTTCATTTAGACGCTTCCCCATATATTAGTCCTTAAATATTAATA
GTTCTATTTAAAAAATTATTTAATTATTTCTAATTTTTTATTGTTTTATTAATAGTTAACTAGGATTAGT
GTTTTTTAGTTGTTTTGGTTCTAGAAGGAGTAGTTTTTAGTTTTATTTATGAGGGCTTGTTTGTTAAAGT
AAAAAAAGAATGTAGGTTATGTAATAAGAAGAATAATAATTTTAAAAAGGGTTTTATTAAAATAGTAAAA
GATTATTTTTTTTATTAAATTAGTTAGTGGTTTAAAAAGGGTTTTATTAAAATAGTAAAAGATTATTTTT
TTTATTAAATTAGTTAGTGGTTTAAAAAGGGTTTTATTAAAATAAAAAAAGATTCTAGCTTCTATTATAA
ATAAAAGCTAGATTTAAATATAATTTTATAGAATTTAAAGACTTTAGGCTTATTTTATAGTAAGCTTTTC
ACTTTTACTTATCTTCTTATAAGTACTATCTCCTGCATATTGGACTGTAAAGTTATAAGTTCCTTTCTTG
TTTAGACTTACATTCACAGTTGCTATGCCCTTTGAATTGGTATTTGCACTATATGTTTTTCCATTGACAG
TAAAAGTAATCTTTTTGTCCGGAATTGCTGTTCCCTTATAGGATTTCAATGTTGCAGTCAATGCCTTTGT
CTTTGCACTTGCCTTATATGTCTTAGGGCTTGTGGATAAGCTTGGAGTCTGTTCGCTTACACTGATAATT
GCAAAATTGAATGATCCGCTATAGTTTTCATCTCCAAGGAATGCTATGGCAAATGTGTAATTGTTTGCAT
ATTTCAGGTTTATCTGAAGCCTTGCCTCTCCTGTTTCATTTGTTGTACGGTTGTATTTAACTCCATTAAA
TCCAATGAAGACCTGTTTTCCGGATAATGGCTTTCCATATTCGTCAAGCAATTGGAAACTGAAATACTCT
CCTACTCTTCCTTCAATATTTGAATCAAATGCAGTTGTATTCATGTCTGTGTAGTTAAGTGCAGTTTTGA
CTCTTTTTATGACCACGCTTGCGCTTGTGTTTGAAGAGGTGTAGTTCTCATTTCCAGCAAAAGTAATGGT
CGCGTTGTAAGTGTCTGGAACTATGTTTTTGCTTGGAACATTCACCTGTCCATTAGAGTCGGTAGTGTAG
TCCTTTTTGCCATCTATCTCAACAGAGACTTTAGCTCCGCTTATTGGATTGCCTTGGCTGTCCTTTAGAG
TGACTATCATGCTTTGGTTTGAGCCATATTTTGCGCTGACATTTGTAGCGCTTATTTCGGTGCTCTCTTT
TTCTATTGTGACCTTTGCTGTTGCATTTGATCCAATATAGATATTGTCGCCTTCAAATGCTATGTTTGCA
GTATAGTTTCCAGCAGCCAATGACTTTGTTGGCACTTTTACCTCTCCGTTGGAGTCTGTTGTGTAATTTT
TAACTCCGTCCAGATCTACAAGTATATTCAAACCGCTTATGGCATTTCCATCAATGTCCTTTAAGGTGAC
TATCATATCTTTATTTACATTGTATTTTGTGATTGTGTCTGTTGCATTCAGCCTTGTATCTAGTTTAGTT
ATGTTTATGCTTGCGCTTGCGTTTGCTTCTGTGTAGTTTTCATTGCCTGCAAAGCTTATATTTGCCACAT
ATATGTTTGGAAGCAAGTCTTTAGTAGGGATTTTTATTTGTCCGTTTCCATCTGTCTTATAAGTTTCGCT
TCCATTTAGGTATACAGTAAGCTCGGCACCGCTTATAGGTCCTGATGCACTGTCCTTTAAGCTCACTATC
AGGTAATCTTCAGTATGATATTTGTTTGTGATATTGTTTGAAGTCAATCTAGGATTATCCTTCTCGATTG
TAACTCCTGCTGTTGTGTTTGCTGGCAAGTACTTATCATTTCCTTCAAATTCTATGCTTGCAGTATAGTT
TCCAGCAGCCAATGACTTTGTTGGGACTTTTATCTCTCCGTTGGAGTCTGTAGTGTAATTTGTTTTATTG
ATTAAGTCTACAATCAATATGGCTCCGCTTATTGACTTGTTTTTACTATCCTTTAAGGCAACCTTAAGGT
ATCCTTCAGCATTATATGTTACAGTAATGTTTTCGGCAGTTAACTTAGCCATTTCCCTGCCGATTGTTAT
GTTTACAGTTGCATTTGAAGGGGCATAGTCTTTGCTTCCAGAGAATTTTATTGTGATTGTGGCCTGTCCT
TTATCGATTGCCTCAATATCTCCGCTTCCATTGACTTTGACCACATTTGTGTCATTGCTTGTGAAAGTGA
CATCTCCAACTGCATTGCTTGGATTTATGGTATAGTTTATCTTTGACTTATCGCCAATTATTAAGACTAT
TTCTTCCTTTTGTGGAATTATTTTGGTTTCTATGACTTTAATCTCTGAGAGGGCAGTTGTTTCATATTCC
CAATATATCTCATCTCCAGGATATGAAAATGTGACATTGTATTTGCCAAGATCAAAACCATTGTTTTTAA
TTTCAATAATTCTTTTCCCATCCTTTATGCTGCCTTCAGTCAGATTGATTTCCCTTCCAATGTCTCCTGT
AAGAATTATCTTTCCTGTGGCATCCTTATCTAGCTTTATGCTAAACATGACTCCGTTAGTGTCATTTACA
TAGATCTCATAGGATGTCACTGTCATATTCGGATTCTTTTGATTTATTTTCAATTTTTCATCTGCGGTCT
TACTTGCTCTTGAGAATTGATTATCTCCTGAATAGAATACAGTAACGGTATATTCGTCTGGCAAAATGGA
CTCTGTAATTGTGATAGTCTTGTTTAAAGGAATGTTTTCTATTGTTTTTTCGTGTGTACTTCCTTTAAAG
CTGATGTTTACTGTTCCTGTAGCCTCATCCTCATATCCGAGATGGAGGGTAATATTGTCTCCGTAGTCGA
TTTCGCTAGGATTAACAGATACCTCTAATTTAGGGTCATTTACGATTTCAAAGAAGATGCTATCTGTTAT
CCATTCCATTTTTCCAGTTATGCTTCCTGTTCCTACCTCATTTGCAGTATAGTTGATTGGGTCATCCAAT
CCTGCAGTCTCCTTATTAATGCTTCCCTTTGTTTGGCTTAAGCTTAATTGGATAGTTGGCAGTAAGGAAT
TGTCATATTCTGTTATTTTTTTAGTCTTTTTATTGTAGAGCCATAGCTTGAATTTCACTTCAGTTGGAAT
ATTGAATGGTGCAGGGTTTGGATTTGCTGTTGCATTTAAAAACAACCAGGTTTGTGAGTATTCATAAGGT
TCTGAATATTGTGTAGCATTGTTTCCAAACCAATTAGCTTCGATTGTATAGTCGGATTCATTCCAGTAGA
TTGCATTTGTCTTATTTAGGATAATGTTGTTTGTTATGGTTGAATGGCCTATTCCTTTTAATGTTATAGT
GTTGCCGTTTAAGGCAGTGTTGTTTATAAAGATATTTCTATAGACATCACCTGTTCTGAATATGAGAATT
GCACCTCCATAATAATCTGCAGAGTTTCTTATAAAAATGCAATCTGTGATGAAAGTATTATATTCAGCAT
AAATTGCTCCTCCTCCTTTACCGCTTTCACTTTCAGGTTTTGCACTGTTTTCCATAAAAGAGCAGTTGCT
TATCTTACCATTTTCGCCATGACAAAAAATAGCTCCTCCTCCTCTGGATATGCCATCACTGGTACGACCA
TAGGCTATATTATTATTAAACTCACAGTTATTGCTTATGGTTCCGTTATCTCCACGCCAGAAAACGGCAC
CGCCAGAATCTCCTGCACTATTGGCAGTGAAGTTGGTGTTATTGCATATGATCCCATCATTTCCTTTCCA
AGTGATGGCGCCTCCTTGTCCACCGGCACGATTATTATGGAAATAGGAGTTGCATATGGTTCCATTATTG
GCATACCAGTAAACTGCACCACCTTCTCCGCCTCCGCCATTTTCCCAGGCCTCTCCATTTCCTACATTCG
CTTTATTGGAGATGAAATTAGAGTTTATTATAATTCCATCTTTAGCTATTGTTTGGTCAGCTGTACCTTC
AAATTCGTCATCTCCCCAGAAAACGGCACCGCCATATTTAGTGGCTGTGTTGTAAGTAAAGTTACAATTG
ATTATCTTCCCATTGTCTCCTTGCCAGTAAATTGCGCCACCATAATCTGATCTACCTCCTGTGAAAATGA
TGTTTTTAAGGGTAACATTTTCTGAAGTAATATGGAAGACTCTGTTATTTTGGGATGCATTTAATGTATG
CCCTTGCCCGTCAATGATTAGGGGACGATCGATTCTTATGCCTTTCTCACCGCCGATGTAGTCACGGTCT
AAAGTGATTGTAGTGTTATGGCGGGTGGTTTCATCCTCATTTATTAGATAATTTAAATCGGTAAAATTGC
CTGGGCTATTTTCCTTAAGCTGTGGCTTTTCAATTTTATAATTCTTGTCTTCTAAAGCTATATTTGTTGA
GGGTCCATTTTCTTCTAATACAATGTCCTGATTGTTATTATCATTGATTATCTTGTTTGAATCGTCAGTA
GCTATTGATGAGTCATCTGCAGCACTTATTGCAGAGATGCTTATCATGCAAACAAGAAATATCATTATTA
TGTATGAATATCTTTTTAATTTCATTTACTTTTCCCCTATTATAATTTTTTTAAATTATTTATATCTTTA
TTTGAATAATTATTTAATTATTTCTAATATGTTCTCTAATACTTAACTAGTTCAATATTGTTCTATATCA
GTATATAAGTCGATCTAGTAATTTAGGGGGATTAGAAAGAGTTATTTGATAAATTAATTCGTGTAAAATG
ATTTATGTTTTATTAAAACTAGTTTTTGTTGAATTTTAAAAAAATAAAAAAAGGTTCTAGCTTCTATAAG
ACTTATAAAAGCTAGATTTAAATAAAAATTTTATATTTCTTATTAGATTTATTAGGGGTTTGTATGATTT
GATGAATATTATTCAAAATCTTTAATTTCTCTTTATTATTGGAAACTTTTAAGAATTTATAAGTATTATT
AAAGACAGAATATAAATCAATAAAAAAACTGAAGTGTTTCATATGAAGAATATATTAATATCCAATGATG
ATGGGGTTATGGGTCCTGGGATATTGGCTAGCAAGCAGGCTCTTGAAGGGCTTGCCAATGTGGTTGTCGT
AGCTCCTCAGGAAAACAACAGCGCTGTAGGCCGCAAGGTCAATATCATGAAGCATATGTATTTGGAAAAC
TATGAATTGGCTGATGGAAGCATGGCTTATGGCTTGTCTGGAACTCCTGCAGATTCTGTTAATGTGGGGA
TTAATTATGTGTGTGATGAGGTTCCAGATCTTGTTGTAACTGGAATAAATCCTGGAATAAACATCAGCAG
ATTGCAGATAACAACATCTGGAACTGTCTGTGCAGCGATTGAAGCTGTTGGTTTAGGCATTCCAGCCATT
GCATGCTCATTGTTTTTGGATGACGATTGCTTTAAGCAGGATGATGAGGGCAATTGGTATGTGGATACAG
ATTACAGTTTTGCTCAAAAGATCCTTGCAAAACTTGTAAAGAAGGTATTGGATGAGGGCATGCCAGATGG
CGTTGACTTATTTAATCTTAATATTCCATCTAAGCCATTATCGGATAAGATTAAGATTACAAGACTTGCA
GATAGCATGCTGAAGTTTAATATTCTTGAAAGGGTTGATGATGATGGCAATGATACTGTCATGAATGTTC
CGGAACTGATTGAGGATTATGAGGAAGGAACCGATGGATATTGCTTGCTTGTTGAGAGGAGGCCAAGTCT
TACTCCTTTGAATGTTCATTTTGGTGCTGAAATTAGTAATTTGGAAGATTGGGAGTTTTAGTTTTTAATT
AAAATTATTTAAATTTAATATTATTTGAAATAGATTACTTAAATTAGAATCATTTAAAATTAGGATATTT
TAAATTAGAACTATTTAAATTAGAATCATTTAAAATTAGAACTATTTAAATTAGAATTATTTAAATCATT
AAGGATGTTTTAATATGGATATAAATGAATGGGAAGAATGGTATGAAGAGATTCTTAATACCTTTGGATT
TCGTAGGGAAGATGATGAGAAGACTGCAGACCTATTGGATGAAATCCTTGCAGATCATGGTTTTTTGACC
ATTGATGAGTTCTATGATGAGATCATGCTTAAGAAGGGATACACTGATAAGTTTATTGTCTTTGGAGCAG
GACCTTCATTGAAGGAGCATATAAGATTCTTGAAGGAAAACTATGACTTAAGCAAATACATGCTTGTATC
TGCCGATGGGGCTACAACAGCCCTTTTGGAAGAGGATGTCGTTCCAGATATTGTTGCAACTGACTTAGAC
GGCAAGATGTCTGACCTTTTGACTGCAAATTCACTTGGCTCATACTTTGTGATTCATGCCCATGGAAACA
ATGAGGAGCTTATTGACCTATGGACAACAAGCTTTAATAAGATCCTTGGAACAACCCAGTCTGTTCCAGT
AGGCAATCTCTATAACTTTGGAGGATTCACTGATGGAGATAGGGCAATGTTCTTTGTTGTAGAGCTTGGT
GCAAAAGAGATGGTTCTTGCTGGAATGGACTTTGGAACAGTTGTAACCAAGTATTCAAGGCCAAACATTG
AGGGTGAGACAGGCCCTGCCGATGAGATAAAGACTAAAAAGCTTATTTTTGCTGAAAGGTTATTAAATTG
GATTAGGGAAAATGAGGATGTGGAAGTGATTAATTTAATCGATAGTTAATTTTCTACATATTCTTTTATT
TTTTGTTTATTTTTTAATTTATTTCTTATTTTTTGATTATATTATATTTTTTAACTTTGTTTGATGTTTA
GGGTTTTTATCATGAAAGAAATTGAATTTGACTTAAAGAACAATCCGTTTTATAATTTCCTATCTTCAAG
ATATAGCATGTCTGCACGTTTGAATGTGGAGAAGATGTGGAATTATTCAAAGGAAAATGATCTTTCCTTT
TTTACATTATCTCTTGCTGCTTTAATCAACAGCTTGAATGAAATCCCTGAAATGAGACGAAGGATAGTGA
ATGGAAAGGTCATTGAATATGATTATCTGGATGCAGTTTGCCCGATAATGGATGAGGATAGCGGAATCTA
TAAGGAGATGAGGGTAAAGGCTCCCCAGAGATTTGATGAGATATTGGATTGGCATGATTATGTTCAAGAG
CATGAAAGGAAGATTTTAAATGGAACAGAAGACGCTTTTGAGGTGAAGACTACCGAAAGAGATGAGCTGA
ATATTGCCAATTTCTCTTGCATTCCTTGGGTGGATTTTGATTCAATCACAAATTGCACAGCAAGCTCCAA
TCAGATTCAGCCTTTGATAACTTGGGGAAAGGTCAATGAGGATTATGAAATGACTGTGGCTATAACAGTT
AGCCATATCTTTGTAAATGGGCGAGAGTTAGCTTATTTTTATCAATTCGCTCAGGACAATTTTAATAATC
TTTTTTAGATTTTTTTAATGCTTTTTTTATTATTTAATATAGTATTACATTGGAGTGTAATAAAAAAGGT
GATTTTTATTACATTGGAGTGTAATTAAAACTAGGGATTTTATTGCATTGGAGTGTAATAAAAAAGGTGA
TTTTTATTACATTGGAGTGTAATAAAAAAGGTGATTTTTATTACATTGGAGTGTAAAAGCATATATTTAC
TAATTGCAATGAATTGAAAATTATTTATTCAATTGCAAAAAAAACTTTTCAAATTTAAAGAAGTTTTTTA
TATTACTTACAATATAATTAATCATATGGCAATAGAAGATATTTTGATGTTTGACGAGACAATATTTAAT
GATATAAATGCATTCAATCCAGACTATATGCCACCTAACTATAATTTTAGAGACAGTCAGATGGAAGGAA
TGGCTATGGCTATACGCCCTGCCATAAGAGGTGGACGTCCAACCAATTCAGTAATATTAGGATCATGCGC
TACAGGTAAGACAACTGCAATTAAAAAGGTATTTGAATTGGTTGAAAAGACTACAGATAAAGTGGTTTGT
GTTTATATCAATTGTCAGCTTCACACTACACGTTTTGGAATCTTTTCTCAAATTCATAAAAAGATATTTG
GACATCAGCCTCCAGAGACTGGAGTTCCATTCTCAAGGGTATATGAAAAGGTTATGGATAAACTTTCCTC
AGATGGAAAGTCTCTTATTGTTGCCTTTGATGATGTAAACTATCTATTCCAGACTCCTCATGCAAACAAG
GTATTCTATGATATCCTTAGGGCCTATGAGGAATATGAAGGGGTAAGAACAGGAATCTTTGCAATCCTTT
CAGACTTGGAGTTTCGATTCGCCCTTGACAAGAATGTAAATACCGTATTCATTCCTCAAGACATTGTATT
TCCGCCTTATAACTATAGCGAGATATTCAGCATTCTAAAGGATAGGGCTAAGGCAGGATTCTTCCCAGGT
GTTGTCTCTGATGAAATCATTGAAGAGATAGCCAATCAGACCTATGAAGTAGGTGACTTGAGAGTGGGAA
TTGACCTTTTAAGGGTTAGCGGAAACATTGCCGAATCCAATGCAAGCAGAACCATAGAATTGGAGCATGT
TGAAGAGGCAGTTGCAAAGCAAGGCTCTGTTAATCTTATGGAAACAATCAATTCATTGAATGACTTAGAA
AAAACCATGATCAAGGTCTTAATTGATAGGGATGAGGTTGTTACAGCAGGAGCATTGTCTAAGGAATTTA
AGGAGCAGGCTGGAGTAAGCTATGCGACATTCAACAGAACCCTTGAAAAGTTGGAATTCTTAAGATTGGT
TGATACAAGGTATACAGGAAAAGGAGTAAGAGGCAATTCCAGGGAGATAATTTTAAGATTCTCTCCAGAG
GATATTAAACGTTGCAATCTTTAGATAATTCATACTCTTTGTCTATTTATTTTAAGTTGTTCTTATTTAA
GGGTTTTTTTTTTATTAAAACTCTTATTAAGCCCGCCCAATGCTTATTCAACTTTTTTTTAACTCTTTTT
ATTTTTTTTCATATTTTTATCAACTTTTTTTTAACTCTTTTTAGCTTTTTTCATTTTTACATTTTTATAA
CTTCTATTTTAGTATTTATTTAGTAAAATAAGTATCTATTCGTATTTAATTAATAAAAAGAGCAATATAA
TTGGTAAATAAATAAACGAATTATTTTAAATCTTATAAAAAAAAGAAAATTATTAAAGGATGTGTTGTGT
TTTATATTAAATCTAGCTATGTGAGAAGTTTTAGATTAAATATAAATTCTTGTTTCGATTTATTCAATTA
TTAAAATATTAAATTTGGGTCATTTTTTTAAATGATTAATTTAATAGTTTTTTAAAATAAAGCGGCTGTG
AATACTATGCAGGATAATATTCATAGTTTTATAGTATTGATTGCACACATCCTTTAATAGATAATGGGTT
TGGTTATTTATACCGCGAACATTTGTTCTAGGCTTTTTTTTATGCCATGAACATTTGTTTTAGGCTTTTT
TTATACTCAGAACATTTTTCTAAGATACTTTTACTCAGATATTCTGAGGAGTGTTTATTTATACCCAGAG
CATAAAATCTGGGCTTGGAGCTGCACTTACAGCTAAAATAGATAAAAGCAATACTGTAAACACTACAAAT
ATTACCATGCAATCTTTAATGTTTATTCTAAGGTTGTTGAAAGTCAAAGGATCTCTTAAATTTTGTTTTT
TTCTTAAATCACAAGTTCTGTTATTATGGCTTACCATCATTTTCACCTCGCCTTTAGTTAAATTTTTTCA
TGTGTACTAATAGTAAGTTTTAAAGAGTATATAAAAAAAGAGCAAGAGAGCATTTGAAAACTAATCAAGG
TGTATTTCAAGTGTAAAATTGCACTGATATTTAGAGTGTTTTAATTGTTAATATGAAATTTTTAAGAGAT
TTTTTCATCTCTTTTTAAGCCTTAGATTTTTAAGTGATTTTTCAATTTATTTTATATATCATTAAATTAG
AAATAATATTAGAAACTAATAAATGATTTTAATTCATTGTGGTGCAATTATGAGTGAAAATAATCAAAGG
GAGAAAAAATTCGAATATTTTGAAGTTACTGCAGATATTGGATTTTATGCTTATGGTAATACTCTGGAAG
AGGCTTACGAAAATGCTGCTTTAGCTATGTTTAATGTGGTGACTGATATAGATAAGGTTAAAACTAGCGA
AACCCGTGAGTTTGAGGTCGAATCAGAGGATTTGGTTTCTCTTTTATATGATTATTTGGATGAGTTCTTA
TTCCTTCAAGATACTGAATTCTTGTTTTTCAGTGAGTTTAAGGTTGATATAGATAAAACAGAGGATGGTT
ATAAGTTAAATTGCATTGCATCTGGTGAGGAAATCAATTGGGACGTTCATGTTCCACGCTCTGAAGTTAA
GGCCATCACTTTTCATAAGATGTGTGTAAAAAAGGAAGATGGTGTTTTTAAGCTTAGGGCTATTTTGGAT
TTGTAAGACTTCTTTTTAATCTATTTTTATCCTATTTTTCTTAAAACTCTATTTAATTCCTTTAACAATC
TTTTAAGCTATTTTTATTCAATTTTTCTTAAAACTCTATTTAATTCCTTTAACAATCTTTTAAGCTATTT
TTTAAATATTTTATTAATAATCTATTTCCAGTTATTTTTATTCGAAGGAATTTAAACAATTAATTTTAAA
TGTATTATAAAACAAAATATAATAACAATTAAAACTATAATTTAATTTATAATTTCTATGCAGAAGTTTT
ATTTAAATTTAATTTATAATTTCTATGCAGAAGTTTATTTAAATTTAATTTATAATTTTTATGCAAAAGT
TTTATTTTAATTTTAATCATTAAGTGATACTATGTCAATTAGAGAAAGTCTTGTAAAAGTTAGAGAAAAT
GTTTGGGAACTTCCAAGTGACTATAAGAAGGAAATGAGAGTTCCTGGAAGGATGTATCTTGATGATGAAG
CTGTAAAGACCATTGAAGAAGGTGCTCTTGAACAGGTTTCAAATGTGGCCTGCATGCCTGGTATTCAAGG
GGCATCAATCGCCATGCCTGATATTCACTTCGGATACGGTTTCAGCATAGGAGGAGTAGGTGCATTCAAT
TATAATAACGGTGTTGTAAGTCCTGGAGGAGTGGGCTTTGACATTAACTGTGGAGTAAGAATGCTTAGGA
CCAATCTTACTGAAGATGAAATCAAGCCGCATCTTAAGGAGCTTACAGAGGTTCTCTTTAAAAACATTCC
ATCAGGTGTTGGAAGCAAAGGTCAGATAAGGCTTAAGGACAATGAGATCAATGAGGTTCTTGATTATGGT
GCCTGGTGGGCAGTTGAACGTGGATTCGGCTGGGAAGAAGACCTAAAATTCCTTGAAGAGAATGGGAGAA
TGGAAGAGGCCGAATCTGAAGTCGTAAGCAAAAAGGCTAAAAAAAGAGGAGTTCCTCAATTAGGTTCATT
AGGTTCTGGAAACCACTTCCTTGAGGTTCAAAAGATTGAGGAAGTCTATGACGATAATGTTGCAAAGGCA
TTTGGTCTAGAGCCTGGAAATGTTACAATAATGATTCACAGCGGTTCAAGAGGCTGCGGACACCAAATCT
GTTCTGATTATTTAAGAAAGATGGATAAGGCTTATAGAAACTATAAGATCAAGCTTCCAGACAGACAATT
GGCATGTGCTCCTATTGACTCTCCAGAGGCTACAGGATACCTTAAGGCTATGGCTGCAGGTGCAAACTAT
GCTTGGGCTAACCGTCAGATGATGTCCCATTGGGTAAGGCAATCCTTTGAAGAGGTATTTAAGAGGGATG
CAGAAGATATGGGAATGAGCACAATCTATGATGTTGCCCATAACATTGCTAAAAAGGAAGTCCATAAGGT
TAAAAATTCCCATATGGAAGTTCTTGTTCACAGAAAAGGTGCAACCCGTGCATTCTGTCCTGGAAGACGT
GAGATTCCTAAGGAATATCGTGATGTAGGTCAGCCTGTCCTTATTCCTGGAACCATGGGAACCGCTTCAT
ATATCTTGCATGGTACTGATGTTGCTATGGAAGAGACCTTTGGATCCACTGCACATGGTGCTGGAAGGGT
ATTGTCCAGAACTGCTGCTAAAAAGCAATACACTGCTAAGGATATTGAAAAAGAATTGAATGATAAGGGA
ATTCATGTAAAAGCTAATTCAGCTCCTGTGTTAGCTGAAGAGGCTCCTGGTGCATATAAGAATGTGGATT
CTGTTGTTAAGACCTCTCACGATGCTGGCATTGCTAAGCTGGTTGCTAAGGTTGTTCCACTAGCAGTTAC
AAAAGGATAGTTCTTAATAGGTTTAAAAGGCTTAATTAAGAATTTAGTTTGATTTATAGAATTTAAAAAG
GACATCTGTCCTTTTTCATTTACTTTTTTTTTAAAACTAGTTTATTTATATTAATTTTTCATTATTTATT
TTTGCGAGGTTATTTATATGATTGCAATTATTGGAGGAAGCGGTGTCGATGAGATTACAGACATGGCAGA
ATCAATAGAGAAAAAGATAGTAGATACCGAATATGGCTCTGTACAGGTTTCTCTATTTGAAATTGAAGGA
AAAGAAGTTGTTTTCCTTCCAAGACATTCAGAAGGACATACCTGTCCTCCACATAAGATTAACTTTAAGG
CAAATATCATGGCCTTAAAGGAGTTAGGGGTTAGTCAGATTTTAGCTACAAATGCAGTAGGTTCAGTTGA
TTTGGAAATTGGCCCGGGATCCATAGTAATTCCAGATGACTTCTTGGACTTTACTGTAAATAGGGATAGG
ACATTCTATGACGATGATGTTGTTCATATTGACATGAGCGAGCCTTACTGCAATAGGCTTAGAAATGCAT
TGCTAGAGAATTCTGATTGTGTAAATGGAGGTCTTGTAGATGGTGGAACCCATATTTGTACAGAAGGACC
TAGATTTGAAACTCCATCTGAAATCAGGATGTTTAAAATGATTGGCGGAACTGTTGTGGGAATGACTACA
TTACCTGAAGCTGTTCTTGCAAGGGAAAAGGAGATGTGCTATGCTTCCATAGCCATTGTATCCAATTATT
GCACTTCCATTGCCAAGCATAAATTAGGAGTGGAAGAGATAATTGAAATAATGGCTGTAAAAAAGGAAGA
ATTGATTAGTCTTCTGTTTAATACAATTAAGAATCTGCCTGTAGACTATGATTGTGAATGCCATCATGCA
TTAGGTGATGCGGAGTTTTAATCAATTATTTTAAAATAAGAAATTAAGAGAGGAAACTCTCTTAATTATA
AAAATATTTATTTTATTCTCTTTTTTTTTATTTTAGAACTAAAATTTATTAATTCTGTCTTTTTTAGTGC
TATTTTTTTTTAATTAGGTCTCTTTAGAACTAAAATTTTTTAATTCTGTCTTTTTTAGTGCTATTTTTTT
TTAATTAGGTCTCTTTTTTTATTTTCACACTAATTTTCTTTATCTAAGTCCTAAAAACCCCATAATAAAT
TCTGAAAATGCAGTTGAGAAATATGCTTCGATTGGAGCGGCAATAAGTAAGAGGATTGTTGCAATAACCA
TTAGCACTATGCTCTGAATCAGTGTCTTTTTAGTCATCTCAAATGCGTCAGAGGCCCCATTTGTATCCTT
GCTTCTAAATGCCTTTATGAACCTCCAAATGAATAGGAACAATAGTATTCCAGCTGCGGACTGAAGGACT
GTTGCAGTAATTTCAAATATTCCATGGGGAATTAGGTAAATTAGGTATAAGATTCCTCCATTTGGCATGA
AATGATTGAATAATTGTCCAATGCTTCCTAAATTTAATGCATTGTATCCTAGCAATACAATTGCAGCAAT
TCCAAAGAATACTGATGCAAGGTATGTAATGATTCCTCCAAGTTCGTTATGGATGAAAAGTTCAATTGCG
CTGCTTTGGGCTCCTCCAGGACCATTCATTGCAGTTACATTGCTTGCAATGGCCTGCATTTTCGGACCGG
TTATAATCCAAGCTGCAATGAAAACTATTATAAAAAATGCATATAGTCCTATTATTAGTTTCTTATTGTC
TTTTAGGGATTCTATAAATAACTCTTTTATATTCATATCTTTTATTTTATATTTTTGAATTTATATAATT
TTTTAATGCTGTTTTTCTCATTGTTAATTCCACTTAAATTTATAAAATGTAAAACTTTATATATAACCGT
GCCCTTATATCTTGTAAGCATTAAAGTTTGAATATTGGTATTGAATTGATTGGTTTCATTAATCTAATTC
ATTAATGAATTCATTTGATTTGGTATTGGTATTTGATTTTAATGTACGCCAATGATTTCACCACAAGTAA
GAATTTTTACACCTTTTAAAACTACTATATTGTTTCTTTCTTGTTCATATTTTAATATACTCTATGCACC
ATTTAATCATAGTTAATCACTCCTTGATTTGTTTTGCATTGTTTGTCATTTGTGTATCATCTTATAGGGT
TTTTCTTCTTTCTTTTGGTAAATCATTGGGATTTAAATAGATCAGGGGTGGGTTTCTTCCCAATATTGTC
AGGACAAGAAGGGGTAGTCCTGATTTAAAGATATTGGGATGATTGGTGGGTATATAATTATTCTATTAAT
TGAAGTTGATTTATTGGATGGTTTTTGTATGAATTGATTATTTTTCGGCTTTTAAACAATTCATATGATT
ATTGTTTTTTAAATTGGTTTTGAATCTAATAGATTAATTATTCTATCTATTTAAGCTCTTAATATTTGAT
TTAGACTATAATCTATATTTGTGAGCATTTAAGCTCTAAATATTAATTTGGATATTTGGGCTATTTAGAA
AAGAACTTTCTTTTTAGAGGTATTTTTCATGAATGAATTTGGACAATTACAATTAATCTGGATTAGAAGA
CTTGCAAGAGAAACTGGTAGAATTACTGCATTGATAGAAGCTGGAAATCTTTCTGTAATTGATTTGGTCA
GATATAAAAAGAGCATTTCATCAATGGATGGATTTTGTCGTTTTGTAATTGAATCTCAAGATTGGGATGA
TGTTAGAAGAATTCCTGAAATTGTTGAAGATGTTGAAGAAAAGTTATTCTTGCACTTTTATGAAATGATC
GACAGATTCGATGGAGAAGGAGCTCATTTAGACTTTTCCAAAGAAGATGAGGGTAAGATATGCTTAAATT
TCGACGATGCTTCTTTAGAGGACATTGTATTTACAATCATTGATGACGAAGACATTGATGTGTTTTTATA
ATTTCATCTTCTTTTAAATTCTTTTTTTTTGTTTTTTAAGAATAAGGATTTTTTTATGAGGTCAAATATT
TTTTTCAAATGAGTAATGCTTTTTTTTCATTCCAAAGATTTTTATTTTTTATTAGAATCATTAATAAATA
TGTCTTCGATTTTCACATCAAATTTATGGGCTATTTTAAAGGCTAATTCCAATGACGGATCATTTTTATT
ATTTTCAATCAATACAATTGTCTGTCTGCTAACGCCTAATTCATCTGCTAATTCCTTTTGAGTAATATTT
TCTATTGCCCTATATATTTTTAGATTATTTCTCATTTTATCACAAAAATTTCTTCTTTTATATGTTTATT
AATTTCTAATATTATTTATTTTAGGTATAGTTTATTTTACTTAATGTTTAATATTATTTACTTTATGTTA
AATATATTTTACTATTATTATATATTTATATAGGATTATGAATATATATTCATAATGTAATTTATAGTAA
TTTTGATTTGTTTTTTATTTAACAATTAGAATTCTTGTTGAATTTAATATAAGGTGATTAATATGGAAAA
TCTTTTAAATTTAAAATATACTTGTAAAGACTGTGATTTTACTTGGATAACATTAAATGGAGAACATAGC
ATTTGTCCTAAGTGCCATAGTGAAAATATTGATTTATTAGGAGAAGTAAAGGATTTGGATATTGAAGCAA
TTCTTGCTCATAATAAAATGAGGGGAGGATGTTGTGGTTCTGCACGTGGAAAAGGTCCTTTGACATGTGG
AAAACCAATGCCTGACCATGCAAATCCAAATATTCCTCATCATAACCACAATAAGAAAACTTGTTGTGGA
TACAATGAATAATTTTATTTTTATATTTATTTCCTTGTTATGCGGGTGTTTGCCTAATTTATAGCATTTA
GAATTAAAATTAACTCCAACTTTATTATTTTGCTTTTATTTTAGGCAACACTCATTTTTATTTAATTTCC
CTCTTTAATATTTTAATTTAATTATTAAAACCTATTTTTATTTTTTTTTATTTTTTTCTTGTTTTTTGGG
GGTTTTGGTCTTATTATTTTTTAGGTTTTTTATATCCTTTTCAATTATCACATTTTTTATTTTATTTTAT
CAAGTCTATTTTTCTATAATTTTTAATCTAATTTCATTCAAATCTATTATGTTCATAATTTAAATTTATT
TTATATTTTATATAATAGTTAATTTTTGATTTAATAGTCAATTTCCTATTTTTTTCAAATTTAAATAACA
AACTATTTATTATAAAGAAAATATAAATAAATAATAAGATATTATTTTAATTGACTTATTTAATATTCTT
AACTTGATTATTAAATTAATTATATCATTTTGGAGGATTACTAATGAATGTAAGTGATTTAAAAAGAGAC
CATTATATGCTAAAGGGTCCCCTTGCAAAGCAAGGCTATGACTGGTGGTGGCATTCCCTCACTGCATACA
ATAAGGAAACTGGGGAACCAAGACCTTTCTTTATAGAATACTTTGTGTGCAATCCTGCTCTTGCTGAGGA
TGAGCCTACCTTAGGCCAAGACCCTAAAAACATTGAAGCAGGGAAAAAGCCATCCTACTGTATGCTGAAG
GTAGGAGCATGGGGTAAGGAGCCTAAGCAGATTCATAATTTCTATTCCATGAAGGATTTCGAATGTCCAG
ATGACAAGTTGGATGTTAAGATTGGAGAGTTCAGCTTAACTGAAAAACATATGACCGGATACTGTAAGGT
TACAGAGGAGGAAGCACGTGACCATCCGGAGTACATGTGTGATGCAGGAGAGATGAAATGGGACTTGGAC
ATTGACAAGCAAATCACTTTTAATGTGGGATATGGAGCTAACACTCTCTTTAGAAAACTTAATTCATTTG
AAATGTTTTGGCATGCTGAAGGAATAAAGACTCAATACAGCGGAACCATTGAGCTTGATGGGGTCGAATA
TGAGGTTATTCCAGAAAAGTCATTCGGATATGCCGACAAGAACTGGGGAGCAGACTTTACAAGCCCTTGG
CTATGGATCTCCTCATGCAATCTAACAAGCCTCATTACTGGAGAGAAGCTTAACAACTCTGCCTTTGAAG
CAGGTGGAGGAAAGCCTAAGGCATTTGGTATTTCACTTCCTAGAAAGCTTCTGATAGGATTCTATTATGA
AGGAAAGATGTATGAATATAACTTTGCAAGATTCTGGAATATGGTAAAGGTTGATTTCGGATTTAAGGAA
GGTGAAGAGTTGAATGAATGGTTTATCAATGCAAGTAATAAGGACAGCAAGATGGAAATGAAGCTTTATT
GCAAGCGTGATGAGATGTTGCTCTTTAATTATGAAGCTCCAACCGGTAAGAAGCTACACACCCGTCTTTG
GAATGGTGGTAACGGCTTTGGTGAGATAAAGCTTATGAAAAAAGGACGGCACATTGATTGACCATGTAAA
GATAGAGAATGCAGGTTGTGAATACGGAGAATATGATGATGATAGGACTCATAATGTTATAGATGACAGA
TAAAGAATATTTTCCTTCTTCCATCCCATATGAATTGGAATGGGGAAATACTTCTTATTATCTTTTATTT
TTTCATTATGAGTTATTTTTTTTTAAATTTCATACTTTAATTAGTTAAGAGTCGATATTATGTTGTGGAC
AGATTTTATTGTTTTGGCGATTGTTTATATTTATGTGGTTGCAATTTTTATACTGTCTGAGAAGGTCTTA
AAGAGCAGGCCAGAGGTCTCCCGTAAGTTTTTACATATTATGGTAGGTAATATGATATTTGCCATGCCAT
TCTTCTCAGATCCTTGGATTATGCTTTTATTCATTACCTTGCCTGTAACTGTGGCACTATTCTTCCTTAC
AGAGTACTCCCCTATTCAGATTGAAAACAGCGTTACCGAATCCGGACATGCATTAGGACTCCTCTTTTAT
GCATTGATTTGGTCCATATTGCTCTTTGTCTACCCAATCATGCTTGATCCTAACTATCTTTGGATTGTAG
CAATGGCAATCGTTCCATTGGTATATGGTGACGGATTTGCTGCTCTTGTTGGAGGAAAATGGGGTACAAT
CAAATATCATGTATTTGGAGGAGAGAAAACTGTTGTAGGTTCCCTTGCAATGCTTTCTGTAACTGCAGTT
CTTTCTGTATTTGTTTGGGTGTTCTACAGTTCAATAGGATACACTCTTCCAGAGCTTAATTTATGGTATA
TATTGCTTATATCAGCAGTTGCAACATTGTGTGAAGCTCTCAGTTATGGTGGTGTGGACAACCTTACTGT
TCCTGCTGTAACTTCCGTTTTGTATTATATTGTTGCGACCGTCCTCTAAAAAAGCAAGCTTTAATACCCA
AGCTTTTTTGGCCTTCGGGTGAAAAAACCTTGACCAAAATTTTTATCAGGGCTGTTGTCGAATGGCCCTT
TTTTATCTCTTTTTTATCATAAATCTTTTTTTTTTATAGTGTTTTAAGCTGGTTGAATGGCCCTTTTTTA
TCTCTTTTTTATCTCTTTTTATAGTATCTTTTTATGTTAAACTTCTTTTTCAATAGTTATTTTTTCCAAG
TTTTTAATTATTCTTATAGTCAATATTAAAAAAATTATCATTTGATTAAAATATTATCAATTGATAAAAT
TTTTATCTTTTTTTATAAATATTATCATTATGTTCAATAATTTTTAATAATATTAATATTTCATTCAATA
AAAAAGAAAGTTTTATATAAATTTTTCAACAAACCATTATTTGTCAAGCTATCATTTTCAAAAATGCTTT
TTTGTTTTTTTAATTTCTTTTGAAAATAGCTAAGATTATAAGACTATCAATATATCAATGGTTGAATCTA
TTGCATATGATTATAGTTTTAAGAAGGTGTTAATATGAAATGATATGCTATTTAGGGGCCTGAATTTTTT
TATGTATGAAATCGTTCAGATTTTCTATATTTTTATTCATTACCCTATAAAAATGTATTTATTTCTAAAA
ATACAATTGTATTATTAGTTATATAAAAAAATAGGTCTTTAATATCGTTAAATTTAAATAATATGCTTTA
CAAATATATTATTGGCGATAATAATGAAGCATAGATTAAATTTAGATAATAAAGACCCAAATTATATTTT
GTTGAAAGAAATATTTAAAATTATGGATTCTAGAAAATCCAAAAGTATATTAGCATCCTATGGATTTAAA
AACTTAAATAGAACAATATTTACTTTTAAAATTATATTTATAAGTATGTTCTTTGGAATTGACATTCCAT
TCATTTTAAACGAGCTTAAATCCAAAAAAGAACTTCGCAAATACTTTAATATTTCTGAAGTTTTGACTGC
AGATCAAGTTTATAAAATTTTTTCAGAAATAAACTCTGAAAAACTTATAAAATGTTTAAACAGAATCTTA
AACTCAAGGAATATGGTTAAAAGAAGAGGAAAAAAGACTTTTATTGTTGATGCGACCCCAGTGGACGTAG
ATATTAATTTCCACAGAAATAAAAAGACTAAAGAACATCTGGAAAAAATTAATCTCAAATGGAGTTATTC
ATCCTCTAAAGGTTATTATATTGGATTTAAAGCAACTGTTGTATTAGATTATGATTCTATGAATCCTGTT
TGTATTTTAGTCCACTCTGGAGCTCCAAACGATGCAAAACTTTTCGAAGAAATTTTAGAAAACCTTCAAA
AAAGACGAATAATCAGAAAAGGAGACACATTAATCTTTGATAAAGGATATTACAGCTATAAAAACTACCA
AATCGGAATCAGCAAATACAAAATCATTCCTTTCATTTTTCCAAAAGAAAAATTCAGCAGAACCCGATTG
GATGACATTTTAACTTATTTACTAGCCGTATTTAACAAAACAAAGAGAATAATGAAAGAAAAAAGATTAT
ACAATAGTTTAAAAATGGAATTAATGAAAAAAATAGATTCATGGGAAAAATTTAAACCAATAAGGGGCAA
AATAGAAGATTTTTTCAAATTATTAAAACAAGGCTTGAATATGAGAGAAATCCACAAATATACTCCAAAA
TCAGTAGAAAAAACCGTTTATCTAAATGTATTTTTGGGAGCACTGATTATATCACAAGGATTTTACTCAA
AAACGGCCATACAACAATTATCTGAAAACTAAAATCGTCAGGCCCCTAAATTATTTTTTTTATCCAGATT
TTTCTTATTTTTTTAATAATTTTCTTATTTTTTTTCAACTTTGTTCTTATTTTTTCAAATAATATTTTGA
CTTTTTCTTTTTTATAAATTTTTTTCACTAAAAATGCTAAAGTTTATTTTTTATTAAAATGATTTATTTT
ACTTATAAAAATATTTTAATAATTATTTAATAAAAATCATAATTTTAAACTTTGTTTTTATGAATTTAAT
TATTTTAAAAATTTTATAATCTTTTTAAAAGCGTTTAAATTAAAATAACTTTTGGTTAATAAAATCGAAA
GCTTTATATGCTATGAAGTTCAACTATTATTTAGTTACAAAAACTAACTAAAAGATTTGCATTAATAATT
ATTGGTAAATTTTTTAAAAATTCTTTCAATTCTTTATTTGGTTAATTAAAATTATTTATTTAATTTTAAA
CGATTGATTAAATGAATTTAAGGAATTTTACTGGAATTTATTCTTCTAATTATTTATTGATGATTAAACT
GTATCTCTATTGGTTATTCAAATAAAATGACGCTCTTAAAATCTTTAGTTTAATTTTAATGTATTTATGA
ATATTTAGTTTCATTTGTAGTCTGGAGAGATCTTTTATTTGATGATTGATTGGATACGACATTGGCTGAA
TAATTTTAAGAATAATTCTAAACAATTGATATTTCTGTGCCTCCAATAATTATTAATAATCTTTTAGGGG
TGAACTGGAATCAATTAATTTAATTAAAATTGATAATGATTTTGGTTTATGTAACTGAAATCTATTGATT
GAACAATTAAAAAAATTAGTATATTACGAAATTAATTATCTAAAAACGATTTAATCGGATTTAACCGATT
TAAAATAGCATATAACAAATTAGTCGAATTATTATATTTACATTTATTATTATTTATTCACAAAAAACGT
AAAGGAGTTGAAAACATGACTGATGTAGAACTTAAAATCAAAGTTGCAGAAACCTTGTCTCAAAATGATG
TAGGCAAAAACATTGCTAAATTGGATATGGAATCCATGTTTAAGCTCGGCTTAAAAGACGGAGACATTAT
CGAAATAGTCGGATCTAAAAACACTGCAGCTATTGCTGTCGCTTCTCAATCTGATATGGAAACAATCATC
AGGATTGACGGTACCACCCGTAAGAATTCCGGTGCTTCAATAGGAGAGGAAGTTACCATCAGAAGAGCAG
ATGTAAAGGAAGCTAAAAAAATAGTCCTCGCTCCTATCGATGCAAGAATCAGGATTGGTGGTGACTTTAA
CAGGGCATTCGCAAATCAAGTCATGGTTCAAGGCGACTTGATAAACACTGGAATCAAGACCCCTCAAAGA
AGGGTTTCAGGAAGCGGATTCTTTGATGATATCTTTGATGACCTTATGAATGTGCCTGGAATAGGTGCAA
TGAGCCAGATCAAGTTGGCTGTTGTAAGCACAAGCCCTGGAGGTGTTGTAAAAGTTGGCCCTAACACTAA
ATTGGAAATAAATGAAGAGCCAGTTGACATCTCTAAATTGGAAGGTGTATCCAATCTTGTAGATATCAGT
TACGATGACATTGGCGGTTTGAAGGAGGAAGTCAAGAAGGTAAGGGAAATGATTGAGATTCCTCTTAAGA
AACCGGAATTATTTGAAAAATTAGGTATCTCACCTCCAAAAGGTGTATTGATGCATGGTCCTCCTGGAAC
CGGTAAGACCTTGCTTGCAAAGGCTGTAGCAAATGAAAGTGATGCACACTTCATTGTAATAAACGGTCCT
GAAATCATGAGCAAATATGTTGGAGGCTCTGAAGAGAACCTTAGGGAATTCTTTGAAGAAGCTGAAGAGA
ATGCTCCATCAATTATCTTCATTGATGAATTGGATGCAATTGCTCCAAAACGTGAAGAGACCAATGGTGA
AGTGGAAAGAAGAACTGTTGCACAGCTTTTAACCTTGATGGATGGTCTTAATTCAAGAGGTCAAGTTGTT
GTAATCGGAGCAACAAACAGACCTGATTCACTTGACGGCGCTCTTAGAAGACCTGGAAGATTTGACCGTG
AAATTGAAATCGGCGTTCCAGATAAGGATGAGCGTAAGGAAATCATGGAAATCCACACAAGAGGAATGCC
TCTTGCAGAGGATGTTGACTTGGACCAAATCGCAAATACAACCCATGGATTTGTAGGTGCAGATCTTGAG
GCATTGGCTAAGGAAGCTGCTATGAGGGTTGTAAGAAGAATCATTCCGGATTTAGGTTCAGACGATGAGA
TTCCACCTGAAGTCCTTGAAAAGCTTGTGGTAACCAAGGAAGACTTTAAGTCTGCCCAAAGGGAGATTCA
GCCTTCAGCTTTAAGGGAAGTCCTTGTACAAGTTCCAAATGTAACTTGGGATGATGTAGGTGGATTGGAT
GACGCTAAACAGGAATTGAAGGAAGCTGTCGAATGGCCATTGAAATATCCTAACAAGTTCAAGGAATTTG
GAGTCAGACCTCCTAAAGGAACCTTGCTCTATGGTATTCCAGGTACTGGTAAGACCATGCTTGCAAAAGC
AGTTGCAAATGAAAGTGAAGCTAACTTCATTGCAATCAAGGGACCTGAACTCCTCTCTAAATGGGTTGGA
GAATCTGAAAAAGGAGTAAGGGAAGTCTTTAGAAAGGCAAGACAGACTGCTCCTACTGTAATCTTCTTTG
ATGAGATTGATTCAATTGCAAGCTCAAGAGGAGGCGAATCTGGAGATTCTGGAGTAACCAAACGCGTTGT
AAATCAATTGTTAACCGAAATCGACGGTCTTGAAGAGCTAGAGGATGTTGCAATCATTGCAGCAACCAAC
AGACCAGACATTATCGATCCAGGTCTCATGAGACCAGGAAGATTTGACAGACACATTAAGGTGGACGCTC
CTAATGAGGACGCTAGACTTGCAATATTCAAGGTTCACACCAAAGACATGCCTCTTGCTAAGGATGTAAA
GCTTAAGAAATTAGCTAAACGTGCTGAAGGATATGTTGGAGCTGACATTGAAGCAGTTTGCCGTGAAGCA
GCTATGCTAGCTTTAAGGGATGATATTGAAGCAAAAGAAGTTTCAGCAAAATTCTTTGACGAGGCTATGG
ATAAGGTGAAGCCAAAAAGCAGTAATGAAGAAGAATTGATCCAATACTTCTAGATTGGATTAATCTAAGA
CTTATAGCAAAACTTTAAAAAACTTTAAGTAATGGATAGGTCTTTCTAAAAAAAGTTTCTATTCATTACT
TTTCCTCCTATTAAATCCTTAAAGGGTTTTTTTATTCTTATGATTTATCTTAAACTGTTTCCCCTTAAAT
AGAGTTAATCAGTTTATAAACTCGTTTATGATTCTCAAATCTTAAACCATAAACAAATATACACTAAAAC
ACCTGTAAAGAATTAAATAATGGATTAAAGATTAATTTAATTTATTTTTCTTTAATTCATTATTTTTTTA
ATCTATTTTTATTCTTATCATATTATTTTTTTATTTAAACTATTTAGAAAATTTTATTAGTCTTCTTTAT
TTAAATATTTGGAGAATTTTATTAATCTCCTTATTTAAACTATTAGAAAATTTTATTAATCAAATATAAT
AAAATAATTATAACACACGTTAATAATTTTTTTAATTTAGTTTAATTGGCAAATATGATATATTTATTAT
TTTTAGGATAAACAGTTGATTGTCAGGTGTTTTTTATGGATAGGCATGTGATTGAAGCATTAGGTAGGGC
TAGAATAACAGTGGAAAATGGGAAGGTTGTTGATGTAGGAGAGCCTATGATTGAATATTGTCCTTTATTT
GACAAGCATAGGGGAATAAAGGAACTTACAAAAGAGGAAATAGAAAAAAACATTCAATTTAGAATAGATG
ACTTTGGAATGTGTACTAAAAATCGTCAATTAAGACTTAAAGACTTTTTATCCTTTGGAATATCTGAAAT
ATTGTCTACATTGCTTGATGAGAATCTTATTGACTGTGCAGTCATGGTTTGTGAAGGATGTGGAACTGTC
CTTGTAACCGAAAGTGAGATGGCTCAGGGAGTTGGAGGAAGAGTCTCTGGACTTGTTGAAACAAGTCCTA
TTTCCCAGAGCTTTATTTGGAAGAGTTTTGGTCAAGATCGTGTTGTTGACAGCGAGACTGCAAGAATAGA
TCAGGTGGATGGCCTTAGATTGGCTATTGACAATGGATATAAGAACATTGCAGTAACAATTTGCCTTGCT
GAAGATGGAATCATTCTTAGGGAATTGGAAAAGGAATATGAAGACATTAATGTCTATATATTTGCAGTCC
ATTCAACAGGCCTTGGAAGAGAAGAAGCAGAAATAATATTTGATACTGCGGATGTGGTTACAGGATGTGC
TTCAAAGCATCTTAGGGATATTGGAAAGGAGCTAAAGGTTTTCTCTGTAGGAACTTCAATTCCAATTTTT
GCTGCAAGCGATAAGGGTGAGGAGTTTATTAAATTAAGATTGGATAAAATAGGTGGGCCAAAAAAGAAAA
CTGGTAATTCCAAACAGCCTAATCCTTTAGTTTAGGATGTTTTTTATTAATTTTCTTAATTTATTGGCTT
ATTTTTATTTAAAATTTCCATTAAATTATTTTATTTAGATTTCATTAATTATTTTATTTAAATTTCTTAA
ATATTTTAATTTATTTTTTAATCCCTTTTTCCTATTTTTTAAGTTTATTTTCCAATTTTTTCTGGTTTTT
AGTCAATTTTAGATTAATTTTAAATACAAATTAAAACATAAATACTATATTATATACATTCAAATAAAAA
ATTAAATTAATTAATGGAGATTTTAAATGTCAAAAGATGTGGTTTTAATATTATCAGGAGGTTTAGACTC
TACTACATTATTATATAAATTATTAAATGAAGGAAATAATGTCACTGCACTCAGTTTCAACTATGGCCAA
AAGGCTGCTATAGAGATTGAACGTGCAAGTGAGATATGTAAAATGAACGATGTAAATCATTTTGTTTTTG
ATATAAGAAATATTGTAGACTTGCTTAGCAGCAGCTTAACCGATAAGGATAATGACAATGTTCAAGAGCC
AAAAAGCACTGTTGTTCCAAGCAGAAATACAATCTTGCTTGAGCTTGCAACTGCATTTGCAATAAGCAAC
AACTTAGAGGAAGTTTATTATGGTGCAATCAAGGCAGACACTGGCGACTATCCAGACACCACTCCTGAAT
TCTTAAAGCAGATAAATGAATTAAATAAGGTTAATAATTATGAATACATTCCAGTTTGTGCTCCTTTTAT
TGATACAGATAAAAAGGATGTTGTAAAGCTTGCTTTAGAGTTAGGAGTGCCTATTGAAAAGACTTGGAGT
TGCTATGTAAACAATGACGGAACTCCTTGTGGGGAATGCTTTAGCTGCAAGTCAAGAATAGAAGCTATAA
AAGAAGCTAAGGAAGAATTAGGTATTGAATAATATTTTTGAAATAAATGGCAATTTGCTATTTTTAATGA
TTATTATAAAATGTATGTAATGGAAATTAATTGGAGGTTATTTATGTTAACATTAGTATCAGAACACAGA
ATATATGGCTGTCACAAGCTAAAGGACCAAGGAGGAAAGTGTACACAATGGCATGGACACCAATATAGAG
TTATATTAACTTTACAGGCTCCTTATAAGGATTTGGATTATAGAAATATGATCATGGACACCTATGACAT
TGAAGCTATCTTTAATGAGTTCATTGGTGTGGATCATTTGAATTTAAATGAATTCATGGATTCTGAAAAT
CCTACCATGGAAGAGATGAGCAAATTCTTCTATGATGGTCTTAAGGATAAGATTGAATGCTTGGTAAGCG
TTGGAGTTTATGAAACTCCTGAAACTGGAGTTACCTATACTCCTATGGAATAGTTTTTTTCTCTCTTTAT
TTGTGAGAAAGTTTTTTATTTCCTCTTTATTTTGTGAGAAGGTTTTTTCTCTTTTATTTGTGATAAATAT
ATTTAGGTGATTAAAATTAAGGTAAGTGAAATATTCACATCATTTCAAGGCGAAGGGCCTTATATAGGGA
CTCCTGCAACTTTCTTAAGATTGTATGGATGCAATCTTAACTGCCCATGGTGTGACACTGATATCTCCAC
ATATGAAATTCTATCAGTGGATGAGGTCTTTGAGATACTTATGACTCAAATGGAGTTTAATAATATAAGG
ATATTGGTTATAACTGGTGGAGAGCCTACATTGCAGATGGAAGAGCTTAAGCGTTTGATTAAGGAAATTC
CAGATGAGATTAAGATTCAAATCGAAACAAACGGTTCAATTTTTGAATACGTTCCAGAAATCGATTATGT
GATAAGTCCGAAGGAAGATAAGGAAACCGTATTTAAGAACTATTATAAATATGATAATGTGTTCTTTAAG
TTTGTTATTTGCTCACAGGAGGATATTGATGAGGTCATTTATCTAAAGGATAAATATAATTATGATAAAA
CCATATGGCTTCAAGGAGAGTTTAGCAAGGATGGTGAAATGGCAGACTTGATTAGGGAGAATTTCCCTCA
TTTGGAGAATGTTAAGTTGTCTGTTCAAACTCATAAATATTTGAATCAAAGATGATATTTTGAAAACAAT
ATCCTTTCATTTTTGAACTATGTTTATTTTTGAAAATATTGTCTTTCATATTTGAACTTTGTTTATTTTG
TTTAAGAATTTTATTAAAAATATACTTATATGATTAAAACATATATTAGTATAGTGATAGATGGATAATT
TTATAATTTATATTTAAAAATTAAGTGTGGAAATTATGTATAAAAAGATTATATTACCAACTGATGGATC
TGAATATTCTAATAGAGAAATTTTAAGAGCTACTAAGTTATTAGCTGAAGATGGAGAAGTCATTATTCTT
TCTGTTGCAACAGAATTAAGAAAAACTGCTTTCCAAAGAAGCAAAGATATTGATAGGGCTAATAAGGAGT
CTATTCAAGAAGCTAAAGAATATGTTGCAGCTATGAAAAAAGGATTTGATGACAGCGTAAATGTCAGGAC
TAAAGTCGTTGTAGGATTTCCAGCTGAAGCTATTAATCAAGTTGCAGAAGAGGAAGGGGCTGATTTGATT
ATTATTGCTTCTTCAGGTAAAAGAGGGCTTCATAGGTTTGTTATTGGAAGCGTTGCTGAAAAGGTACTTA
AAGATTCTGAAATTGATGTGTTATTAGTTCATGATTAATCTTTTAGATTAATTTTTTTCTCTTTTTTTTT
ATTTCAGACTATTCTTTATTTTTTTTATTTCTAACTACTATTTTTTTATTTTTTTATTTCAGATTATTTT
TTTTTATTTTTAACTACTATTTTTTTTATTTTTTTATTTCAGAGTATTCTTTTATTATTTTTTTTATTTT
TAACTACTATTTTTTTTATTTTTTTATTTCAGACTATTTAACATTGTTTTTTTATTTAAACTACTATTTT
CCTTATTTTTTATAAAAATTCTTTTTAATTCTTACTTTAATTTTCTTAAATTGTATTTTATCTAATTAAA
TTTATTGTATATTCAATTTAAATTGATATCAGTTCTTTATTTCTTAATTGTAACATTTTATACCCTTTAA
GTAACAAAATATTTAAATACTGGAAAGATAAAATTATATTTAACAAATAATTATTTTAAGTAAAATTTAA
GAAAAAATATTTTTTACTAAGGTTATAGAGGATGATTAATATGGCGGATAAAAAACCTACTGCAGAAAAC
TGGCCTGTTGTAAGTGGAGATTATATTGTAGGAGATCCAGAAAGCCCTGTTGCTGTAACCACATTGGCTT
CTCACAATGAAGACATTCCTGCAGCTGCTGGCGCAGCCATTGCTGGACCTTGCAAGACTGAAAACCTTGG
AATTGAAAAGGTTGTTGCAAACATCATTTCAAACCCTAACATAAGATTTTTGATTTTATGTGGTGCTGAA
GTGCAAGGACACATTACAGGTCAAAGTTTTAAGGCATTATATGAAAACGGCTGTGACCCTGAGAAAAAGA
AAATCACTGGAGCTACTGGAGCTATTCCTTTTGTAGAAAACATTCCAATGGAAGGTGTTGAACGATTCCA
ACAACAATTGGAACTTGTTGATATGATTGACAACGAAGACGGTGGAGCAATCACTGCAAAAGTTAAGGAA
TGCATAGAAAAAGATCCTGGTGCTTTTGAAGAGGATTCTTTAGTGATTAAGATTGATGAAGAAAGATATT
CTAAAAAAAGCAGTTTTGTGGAATCTTCATCTGAAAGTGAAAAAATAGAATCCGAAGCATAATTCTTAAT
TGAATTGGCCTATTTTTAATTTCTATTTTTTTTTATTCTTTTTTTTAATAAAAATAGTTTTTTTTAGGAA
TTATTTTTTTAATTCATCTATTTATTGTTCTTTTTTTATAAAAATAAGTATTTCTGCTCTTTTTTTAATA
GAAATAGTTTTTTTTAGGAATTATTTTTTTAATTCATCTATTTTTGCTCTTTTAAGAGGCATATTTTTTA
AAAATAAGTATTCTTTTTTTAATAAACAAATTTCTTTTAAAGCATTAAAACAAATTTAAATGATGTCTGG
TGTATTAAAATAAATTTAAGGGAGTTAAAACATTTAATAAGCTAAATAGAGTATATAGATTATTCAAATG
ATATGAACTTTAATTTATTAAATTATTTTAAGAATTTTAAGGATTTGTCTGCAATTCCTTTCATCATTTC
TTCATGCTTTCTGATTTCCTCTTCTGTGTAATCACTTAAAATGAAATGATGATACTCTTCATAAAGCTTA
ATGATTTCTTCAAAGGATTCTTTGCCTTTTTCAGTTAAGTATAACTGACGACGGGTATTGTTCTTTTCAT
CAACTTTCTTATAGATAAATCCTTTTTTTTCTAATATCTTGTATGTCTTTGCAATATTTGCTTCTGAAAC
AAATAAGTTTCGAGCAATTTCCCTTTGGCTTATCCCTTCATTATAATAGATTTCACCTAAAAATTTAGAT
TCTGCCTTATTGATATTTAAATCATTTACATGGGTTTTTAAAAACTTTTCAAATGCCTTGTGCATTACAT
AAATGGAATTGAATAGGCTTACTTCGTCATTGAATATTGATTCTTTTTTCATTTTCGCCCCTCAAATTTA
AGTTTGTCAATTATTATTTTGTTCAATCTAGTATAAAAATCTTTTTTTATTTAAAAATAGATATAATTTT
TATTTTACTATTTGTTTGATTATTAGATTAACTTTTTTTTATAAGTTTGTTTATATTTTTTATATTTTTT
TTAAACAATTTAATTTTTAAAATTTGGCCGTTTTTTCATTATTTTGGCTCAAAGTCTTTTTTTAGTTAAG
ATAGGTTAATTTTGTTTAATTTTTTAGTCTTAATTCGGTATAGTATTATTGATTTTCAAGTTTATTAAAA
TTTTGGTTCCTTCCTATGCTTTCAAACTAAAATTATAAAACTTATGTTAAGGGAGCTTTTTAAAAAAAGT
TTTATGGAATCTTTAGTTAAATGCATTTAAGATCAGTTCTTATGGTTTTTTTTAACTATTAAATGTGGTT
TGTTAAATGGGGTTTAAGCTATAAAAAATAGTTTTATGGGGTTTTTAATTAAATAACTAAAAAATTAAAT
GAAATTAGGAGATTAAATCCCCTAATTAAAATTAAAAATTAATTGAACTTATATAGCAGTCCATCCACCG
TCAACACAGATTAATTGACCGGTACAGAAGCTGGATGCGTCAGATGCTAAGTAGATTGCAAGTCCGTCTA
ATTCACCAGGTTTACCTAATCTGCCTGCTGGACAGTATGCTGCAATGAGATCCATGAATCCGTCCATTTC
AATGGAGTCAACAGTTAATTCGGTTTCGAATACTGCAGGGCCGATTGCGTTTACGGTAATGTTGTATTTA
GCCCATTCTACAGCTAAGTTTTTGGTTAAGTTCATTACTGCACCTTTTGCAGAGGAGTATGCGCTGATAC
CTCCGCCAGGGAAGATAACTCTACTGTGGATGGAACCGATGTTGATGATTTTACCGTATTCTTGTTCAAT
CATGATTTCTCCAACAGCTTTACACATGTAGTATACACCTGTTAAGTCGATGTGGATGTGTCTTGCCCAT
TCTTCGTTGGATTGGTCTACAACCATTTTGTTGTTACCCATACCCGCTGCGTTTACGAGAATGTCAATTC
TTCCATATGCGTCCATTACTTTTTGAACGGATGCGGTAATGCTGTCATAATCTCCGACATCTGTAACAGC
GTACATTACTTCAGTACCAAATTTGTCTTCGATTTCTTTTACGTTTTCTTGTAATCTTTCTTCTCTTCTT
GCGAATAAAGCTAATTTAGCACCTTGGCTTGCGTAAGCTTGTGCAATTTGCCAACCTAATCCGGAAGAAG
CACCGGTTACAACTGCTACTTTGTCTTTTATGTCGAAATAATTTTTCATTGTAATTCTCCTTTAATTTAA
TTCCAATTTTTTTTAAATATTGGATATATAATTATTTAGTTTTTTAATTATTTAAATGTTTTTTATTCAT
TTTTTTTGAACTATGTTAAGTTATTAAACTTTTTTCCATATAGTTAATTGTTATTTTGTTCAATTTTATT
AATTTTTATTGAAACAAGTATTCTTTTTAATCAACATATCTTTTTTATGTCGAAAAAAATCAAATAATTT
TATAAATTTTTTAGTTTAAATCAATTAGAACTATTTTTTTGCTGTGGATTTTCAATATGTTTTTTCAAGT
TTCTTAAGTTGGACTGTTTTTTAGATAAATTAATTAAATAATAAATTACATATTTTATATTGTTATAGTA
ATTAGGATTTTTTAGATTTAAAAAATTATTTTAAAAGATTATTAAACTAATGATTATAAAAGATTTACTA
AGATATTCATTTAAACTAAGGTGTTTTAATGACTCAAATGACTGAAGCTAAGAAAGGCAATGTAACCCCT
GAGATGCAAGCTGTTGCTGAATTTGAAAGAGTAGATGTTGGAAAGATTCTAAACGGACTTGCAAGTGGTA
GAATAGTAATTCCAAAGAATATTAATAGAGATACAAAGGCTTGCGGTATTGGTCAGGGCTTAACAACCAA
AATCAATGCAAATATAGGATCTTCAAGCAAAATCGAAGACATTGATTTGGAGATTAAAAAAGCAAAATTG
GCAGTTGATTTTGGTGCAGATGCAATCATGGACCTAAGCACAGGACCTAAATTATTAGAGTTCAGGGAAA
GGATAATGGACTCAGTGGATGTGGCCATTGGAACTGTCCCTATCTATGAAGCAGGGGTAGTTACATTAAA
TAAGGGCAATGAAATAATAGATATGGATGAGGATGACATATTCAATTCCATAATCCATCAGGCAAAGGAT
GGGGTTGACTTCATGACCCTTCACTGTGGAATCAATCAGGATTTGGTCTATAAACTTCAAGAGGCTAAAA
GAATGATGGGTATTGTAAGCAGAGGAGGAACTTTCCTCGCTTCTTGGATATTGCATAATGAAAAGGAAAA
CCCATTATATTCAAATTATGATTATTTGCTTGAGATTGCATTGGAATATGATATAACTCTCTCATTAGGT
GACGGACTTCGTCCGGGATGCCAGTCTGATGCAACAGACACTTCCCAGATTCAGGAGCTTGTAACCTTGG
GAACCCTTGTAAAGAGAGCACAGGAAGCGGGAGTTCAGACAATGGTTGAAGGGCCAGGACATGTTCCCCT
TAATCAGATAAGGGCAAATATGGAGATTCAAAAGACATTGTGTCATGGCGCTCCATTCTATGTATTAGGG
CCTATTGTAACTGATTTGGCTCCAGGCTATGATCATATCACTTCAGCTATTGGAGGAGCAATTGCAGCAT
CAAGCGGAGCTGACTTCCTATGTTATGTGACTCCAGCAGAGCATCTCTCACTTCCATCCCTTGAAGACGT
TAAGGAAGGAGTCATTGCAAGCAAGATTGCTGCCCAAGCTGCAGATGTTGCTTTAGGATTGGACACTGCA
TGGGAGAAGGAAGTGGAAATGGCACAGGCTCGTAAAAACTTTGATTGGGAAAAGCAGTTTGATTTAGCTT
TTGATAGTGTAAAGCCACGTCATTATAGGAATAAGTGTGAATTGGATGATGATGAGATGTGTGCTATGTG
CGGAGAGTATTGTGCGGTAAAGATAGCTAAAGGTGACTTTTAGTTAGTTTTTCTTCAGTTATGGTTTAAG
GTGACTTTTAAATAATATTAATTAGGTAATTAAATCTCTAAAGAGACTTTTAGGGGGTTAAAACATGAAA
TACGAAGAACTTGTTAATGTTTATGAGGCATTAGGTGCAACTACAAAAAGATTAGAGAAAACAGAGATAT
TGGCAGATTTTCTTAAAACAGTGGAACTAGAAGATTTACAGAAGATTACTTTAATGGCTTTAGGTCGTGT
TTTTCCTCCTTGGAGTGAAGAGGAACAGGGAATTGGCGATAAGCTTGTTATGAAAGCTGTAGGAGATGCT
GTAGGAGTCTCTGTAGCAGTAGTTGAAGATGCAATCAGAGATGAAGGAGACATTGGAGCAGCTGCAGAGA
AGCTTTACGGCAAAAAGACTCAAATGACTTTCTTCTCACAGCCCTTGACAGTTAACTTTGTCTATAATCA
GCTGAGAAAATTGGCCAAAATAACTGGAAACAGGTCCACAGCCAAAAAGATCTCAAACATTTTGGAATTA
TTGTCATCTGCATCTGCACTTGAAGCTAAATACATTTGCCGAACCATATTGGAAGAACTTAGAATCGGTG
TAGGTGAAGGAATCATTCGTGATGCAATTTCACAAGCCTTTGGTGTTGATAAGGCACTTGCTGAGAGGGC
ACATATGCTTACAAATGATTTAGGCCTTGTTGCAAAGGTTGCAAAGGAAGAAGGTGAAGATGGCCTTAAA
AAACTTTCATTAATTCCAGGAAGGCCTGTCAAGCCAATGCTTGCCCAATTGTCTGAGGGAATTGAAATAA
GCATAAATGAAATGGGTTGTGCACTTTGTGAGACAAAATACGATGGAATTCGTATGCAGGTTCATAAGAA
GGATGATGAGATTACAATATTCACTCGCAGACTGGAGAATGTGACTATGGCCCTTCCAGAGGCAGTTGAC
CTAATCAGGGAAGCTTTCCCAGATGAGGACTTCATTGCAGAAGGTGAAATCATAGCAATCCGTGATGGAA
AGCCGACTACATTCCAGAACATCCTTCAGAGAGTCAGAAGAAAACATAATATTGAAGAAGCTATGGAAAA
GGTTCCTATTAAGATTTATCTATATGATTTGCTCTACTTTAAGGAGCCAACCATTGATGAGCCGATAATC
AAGCGTCGTGAAATATTGGAAAGTGTAGTGGATTGCTCAAATCCTAATTTGGCCCTCAGTTCCCTTGTCA
AGGTAGGTCCAGATAATATTGATGATGCAGTGGATTTATTCAATAAGTCAATTGAAGGGGGACATGAAGG
AATCATGATTAAAGACTGCGATGAGCCTTATATTCCAGGAATTAGAGGCAAAAAAATGCTAAAGCTTAAG
GCAGAGCCTGAAACATTGGATGCAGTTGTAATCGGTGGAGTTAAAGGAATAGGCAAAAGGGGAGACTTTA
TAGGCTCTTATGTGATTGCCCTTCGAGATGAGAATGACCAGTTGCAGCCTATTGCTCATGTAGGAACCGG
TCTTTCAGATGATGACTTGGCAAATCTCACTGAAAAGATGGAAGCTCTTAAGATAACTGAAAAGGGAACT
AGAATAACTGTTCATCCTAAGATAGTCTTTGAGATAGCTTATAGTGAGATTGTAAAGAGTCCAGAGTATA
GTGCAGGTTATTCATTGCGTTTCCCTGTAGTTAAAAGGATAAGGGATGATAAAGGCGTTGATGACATTGA
TACAATTGAAAGATTAGAGTCTATGTTTAAGGGATAGACTTAAAATCTTCTTTTTTTATTTTAATTCATT
ATTTTTATCCATTTTTTATCTATTTTTCATTATTTTTTATTATTTTTTATTTTTATCCATTTTTTATCTA
TTTTTCATTATTTTTTATTATTTTTTATTTTTATCCATTTATTGCTTCTTTTTATTAATTTTATTATATT
TTTATTTGTATTTTTAGTATAGTCTTATTTTCTATCGTTTTTCCACAATCATATCAATTTCACATTTTTA
AATCAATTTCATATTCTTAAGTAAATTTTACGAGATGACATCAATTTTACGAAATCAAATCAATTTTACA
TTCTTAAATCAATTTTTACTTCTAATTTTTACTCAAATCACCATTTTAAGTTAGATTTAAATATATCTTC
CTAAATAAAGATATTTACTCAATTTTTTAAAAAAGGTGATTCAATGGAATTGAATGATGAAATAATATTT
AAAGTTGCACTGATTACTGCATTGGTCGGAATGATTGGGATGCTAGCTTTTGCCTCTTATATTGAACCAA
AGGAGATAACAATCAATGAAATTACAAGAAACAATATTGGTGAGACAGTTTCTGTCTCTGGTGTTGTAGA
GTCGGTTAAATTATCCTCAAGCGGAAGCTCCTGCTTTCTGGAGCTAAATGACGGAACAGGTAAAATAAAT
GTCATTGTTTTCGAATCGGTTTTAGTGGAGCTTAAAGATGCTGGAAACGACTTAAATGATTTTAAAGGTC
ATAATATAAAAGTTGTAGGCAGCATAACAGAATATAAGTCTTCTATGGAATTGATTTTAGCTAATTCCAA
TTCAATTAAATTGGAATCTTAGTTTTTTATGGGACTTAGCATATTCTAATCGGAATCTAATTTTTCTAAA
ACTTTGTTTTATTTTTTATTTTTTAATTTAAGTCTTTGTCAGTAGCTTAATATAAAATTATATGCTATTT
TTTTAACATTTATATGGTTTAAAAAACATATTAATAATTATAAATTAAAAGGGGGTAGCATATGACTATT
TATTTAACATCTTCAAAAATGTATGAAAAGGATAAATTAGTATTGCCTAATATCATTAAAGAAGAATTTG
ATTGCATAGAATTAAATGAAGACACCATATTTGATTGGGCTATTGAAGATGACAAAATCATTCTTAAACC
TAGAAATATAGTTACAACTGACGATATTATAGGTATTATAGATGATGATGGTGGAGAATGGGATATTGAT
AATGAAATTTATTCCTTATGAATATTGGATATTAGAGGTGAAAATATGGGGTTTTTAGCTAGTTCTAAGA
TTTATGGGGATTATCAAATAGATATTCCCAAGGAAGTTATAGAAGAATTCAATGTGGAAAGAGATTCTAT
TATGGAATGGATTATTAATGAAGATGGAAGAATTTCCATTAATTTCAGAAAGAAATATTCTATAAAAGAT
TTGGTAGGTGCTTTTCATCTGGATGATGAAGTCAGTTCTGTTGATTTAAAAAGAAGTTTGTATGAGTAGA
TGGTTAATTTTAATAAAATATTTAAACTTTATAAACAAAAATATATTTAGATCTTAAAGGTATGTATTTA
ATTTAATCTTTTTAATTAAAAGTAATTAATAATTCCTTATTATTGGCAAAAAATTTAGAATTAAATGTCA
TATTAATTTATTTAGTTAATTTAATTTTACAAAGGGTCATAAAATGGTAGAAAAACGATTATTTGGTACA
TTTGGTGTAAGAAGAAACTGCGAAATGATGGTGTTGACTCCTGAATTTGCATCCAGACTTGCCGCAAGTT
ATGGATCTATTGTGCAAGGGACCGTAGCCATTGGAGGAGATACAAGGACAAGCACTCCAATGCTTAAACA
TGCAATCACTGCAGGTTTGCTCTCTTCAGGCTGTGATGTTGTGGATTTAGGAATCCTCCCAACTCCTGCT
ATTCAA