changeset 5:6e18e0b098cd draft

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
author bgruening
date Sat, 21 Jan 2017 17:36:57 -0500
parents c47a7c52ac4f
children ee4be6eadd34
files cmalign._x_m_l_todo cmalign.xml cmbuild.xml cmpress.xml cmscan.xml cmsearch.xml cmstat.xml macros.xml test-data/cmalign_input2_tRNA5.c.cm test-data/cmalign_input_mrum_tRNAs10.fa test-data/cmalign_result_mrum-tRNAs10.out test-data/cmalignoutput test-data/cmbuild_input_tRNA5.sto test-data/cmbuild_results.cm test-data/cmcalibrate_input.cm test-data/cmpress_input_minifam.cm test-data/cmsearch_input1.cm test-data/cmsearch_input2.fa test-data/cmsearch_input2_mrum_genome.fa test-data/cmsearch_result.tabular test-data/cmsearch_result_tRNA5_mrum.out test-data/cmstat_input.cm test-data/cmstat_out.tabular test-data/metag-example.fa test-data/minifam.cm test-data/minifam.tar tool_dependencies.xml
diffstat 27 files changed, 94536 insertions(+), 542 deletions(-) [+]
line wrap: on
line diff
--- a/cmalign._x_m_l_todo	Mon Dec 19 15:27:06 2016 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,256 +0,0 @@
-<tool id="infernal_cmalign" name="Align sequences to a covariance model" version="1.1.0.2">
-    <description>against a sequence database (cmsearch)</description>
-    <parallelism method="multi" split_inputs="seqdb" split_mode="to_size" split_size="100" shared_inputs="" merge_outputs="outfile,multiple_alignment_output"></parallelism>
-    <requirements>
-        <requirement type="package">infernal</requirement>
-        <requirement type="package" version="1.1">infernal</requirement>
-        <requirement type="package" version="8.22">gnu_coreutils</requirement>
-    </requirements>
-    <command>
-<![CDATA[
-        ## a temp file is needed, because the standard tabular output from infernal is not usefull in Galaxy
-        ## it will be converted to a tab delimited file and piped to Galaxy
-        temp_tabular_output=\$(mktemp);
-
-        cmsearch
-            ## Infernal Options
-            --cpu "\${GALAXY_SLOTS:-12}"
-            -o /dev/null
-            --tformat $seqdb.ext ##target format: fasta, embl, genbank, ddbj, stockholm, pfam, a2m, afa, clustal, and phylip
-            $bottomonly
-            $toponly
-            $cyk
-            $notrunc
-            $max
-            $nohmm
-            $mid
-            ##$bitscore_thresholds
-            --tblout \$temp_tabular_output
-            $g
-            #if $A:
-                $A $multiple_alignment_output
-            #end if
-
-            #if $inclusion_thresholds_opts.inclusion_thresholds_selector == "--incE":
-                --incE $inclusion_thresholds_opts.incE
-            #elif $inclusion_thresholds_opts.inclusion_thresholds_selector == "--incT":
-                --incT $inclusion_thresholds_opts.incT
-            #end if
-
-            #if $reporting_thresholds_opts.reporting_thresholds_selector == "-E":
-                -E $reporting_thresholds_opts.E
-            #elif $reporting_thresholds_opts.reporting_thresholds_selector == "-T":
-                -T $reporting_thresholds_opts.T
-            #end if
-
-            ## CM file from the history or stored as database on disc
-
-            #if $cm_opts.cm_opts_selector == "db":
-                $cm_opts.database.fields.path
-            #else:
-                $cm_opts.cmfile
-            #end if
-
-            ## sequence file
-            $seqdb
-            2>&1
-            ;
-
-            ## 1. replace all lines starting # (comment lines)
-            ## 2. replace the first 18 spaces with tabs, 18th field is a free text field (can contain spaces)
-            sed -e 's/#.*$//' -e '/^$/d' -e 's/ /\t/g' -e 's/\t/ /18g' \$temp_tabular_output > $outfile
-
-]]>
-    </command>
-        <inputs>
-
-            <param name="seqdb" type="data" format="fasta" label="Sequence database"/>
-            <conditional name="cm_opts">
-                <param name="cm_opts_selector" type="select" label="Subject covariance models">
-                  <option value="db" selected="True">Locally installed covariance models</option>
-                  <option value="histdb">Covariance model from your history</option>
-                </param>
-                <when value="db">
-                    <param name="database" type="select" label="Covariance models">
-                        <options from_file="infernal.loc">
-                          <column name="value" index="0"/>
-                          <column name="name" index="1"/>
-                          <column name="path" index="2"/>
-                        </options>
-                    </param>
-                </when>
-                <when value="histdb">
-                    <param name="cmfile" type="data" format="txt" label="Covariance models file from the history."/>
-                </when>
-            </conditional>
-
-            <param name="g" truevalue="-g" falsevalue="" checked="False" type="boolean"
-                label="Turn on the glocal alignment algorithm" help="... global with respect to the query model and local with respect to the target database."/>
-
-            <param name="bottomonly" truevalue="--bottomonly" falsevalue="" checked="False" type="boolean"
-                label="Only search the bottom (Crick) strand of target sequences" help="in the sequence database"/>
-            <param name="toponly" truevalue="--toponly" falsevalue="" checked="False" type="boolean"
-                label="Only search the top (Watson) strand of target sequences" help="in the sequence database"/>
-
-            <param name="cyk" truevalue="--cyk" falsevalue="" checked="False" type="boolean"
-                label="Use the CYK algorithm, not Inside, to determine the final score of all hits" help=""/>
-            <param name="--acyk" truevalue="--cyk" falsevalue="" checked="False" type="boolean"
-                label="Use the CYK algorithm to align hits" help="By default, the Durbin/Holmes optimal accuracy algorithm is used, which finds the alignment that maximizes the expected accuracy of all aligned residues."/>
-
-            <param name="notrunc" truevalue="--notrunc" falsevalue="" checked="False" type="boolean"
-                label="Turn off truncated hit detection" help=""/>
-
-            <!-- accelleration pipeline -->
-
-            <param name="max" truevalue="--max" falsevalue="" checked="False" type="boolean"
-                label="Turn off all filters, and run non-banded Inside on every full-length target sequence" help="This
-                increases sensitivity somewhat, at an extremely large cost in speed."/>
-
-            <param name="nohmm" truevalue="--nohmm" falsevalue="" checked="False" type="boolean"
-                label="Turn off all HMM filter stages " help=""/>
-
-            <param name="mid" truevalue="--mid" falsevalue="" checked="False" type="boolean"
-                label="Turn off the HMM SSV and Viterbi filter stages" help=""/>
-
-
-            <!-- Options for model-specific score thresholding -->
-            <!--
-            <param name="bitscore_thresholds" type="select" label="Bit score thresholds" help="Curated CM databases may define specific bit score thresholds for each CM, superseding any thresholding based on statistical significance alone.">
-                <option value="" selected="true">None</option>
-                <option value=" - -cut_ga">GA (gathering) bit scores</option>
-                <option value=" - -cut_nc">NC (noise cutoff) bit score</option>
-                <option value=" - -cut_tc">TC (trusted cutoff) bit score</option>
-            </param>
-            -->
-            <!-- Options for inclusion thresholds -->
-
-
-            <conditional name="inclusion_thresholds_opts">
-                <param name="inclusion_thresholds_selector" type="select" label="Inclusion thresholds"
-                help="Inclusion thresholds are stricter than reporting thresholds. Inclusion thresholds control which hits are considered to be reliable enough to be included in an output alignment or in a possible subsequent search round, or marked as significant (”!”) as opposed to questionable (”?”) in hit output.">
-                    <option value="" selected="true">default</option>
-                    <option value="--incE">Use E-value</option>
-                    <option value="--incT">Use bit score</option>
-                </param>
-                <when />
-                <when value="--incE">
-                    <param name="incE" type="float" value="0.01" label="Use E-value" help="of &lt;= X as the hit inclusion threshold.">
-                        <sanitizer>
-                            <valid initial="string.printable">
-                                <remove value="&apos;"/>
-                            </valid>
-                        </sanitizer>
-                    </param>
-                </when>
-                <when value="--incT">
-                    <param name="incT" type="integer" value="0" label="Use bit score" help="of >= X as the hit inclusion threshold.">
-                        <sanitizer>
-                            <valid initial="string.printable">
-                                <remove value="&apos;"/>
-                            </valid>
-                        </sanitizer>
-                    </param>
-                </when>
-            </conditional>
-
-            <!-- Options controlling reporting thresholds -->
-
-            <conditional name="reporting_thresholds_opts">
-                <param name="reporting_thresholds_selector" type="select" label="reporting thresholds"
-                help="Reporting thresholds control which hits are reported in output files">
-                    <option value="" selected="true">default</option>
-                    <option value="-E">Use E-value</option>
-                    <option value="-T">Use bit score</option>
-                </param>
-                <when />
-                <when value="-E">
-                    <param name="E" type="float" value="10.0" label="Use E-value" help="of &lt;= X as the hit reporting threshold. The default is 10.0, meaning that on average, about 10 false positives will be reported per query, so you can see the top of the noise and decide for yourself if it’s really noise.">
-                        <sanitizer>
-                            <valid initial="string.printable">
-                                <remove value="&apos;"/>
-                            </valid>
-                        </sanitizer>
-                    </param>
-                </when>
-                <when value="-T">
-                    <param name="T" type="integer" value="0" label="Use bit score" help="of >= X as the hit reporting threshold.">
-                        <sanitizer>
-                            <valid initial="string.printable">
-                                <remove value="&apos;"/>
-                            </valid>
-                        </sanitizer>
-                    </param>
-                </when>
-            </conditional>
-
-            <param name="A" truevalue="-A" falsevalue="" checked="False" type="boolean"
-                label="Save a multiple alignment of all significant hits" help="... those satisfying inclusion thresholds"/>
-
-        </inputs>
-    <outputs>
-
-        <data format="tabular" name="outfile" label="cmsearch on ${on_string}"/>
-        <data format="tabular" name="multiple_alignment_output" label="cmsearch on ${on_string} (multi alignment)">
-            <filter>A is True</filter>
-        </data>
-
-    </outputs>
-    <help>
-<![CDATA[
-
-
-**What it does**
-
-cmalign aligns the RNA sequences to the covariance model (CM).
-
-
-The sequence file must be in FASTA or Genbank format. cmalign
-uses an HMM banding technique to accelerate alignment by default. By default,
-cmalign computes the alignment with maximum expected accuracy that is consistent with constraints
-(bands) derived from an HMM, using a banded version of the Durbin/Holmes optimal accuracy algorithm. cmalign takes special care to correctly align truncated sequences, where some nucleotides from the beginning (5’) and/or end (3’) of the actual full length biological sequence are not present in the input sequence. This behavior is on by default.
-
-
-
-**Output format**
-
-
-(1) target name: The name of the target sequence or profile.
-(2) accession: The accession of the target sequence or profile, or ’-’ if none.
-(3) query name: The name of the query sequence or profile.
-(4) accession: The accession of the query sequence or profile, or ’-’ if none.
-(5) mdl (model): Which type of model was used to compute the final score. Either ’cm’ or ’hmm’. A CM is used to compute the final hit scores unless the model has zero basepairs or the --hmmonly option is used, in which case a HMM will be used.
-(6) mdl from (model coord): The start of the alignment of this hit with respect to the profile (CM or HMM), numbered 1..N for a profile of N consensus positions.
-(7) mdl to (model coord): The end of the alignment of this hit with respect to the profile (CM or HMM), numbered 1..N for a profile of N consensus positions.
-(8) seq from (ali coord): The start of the alignment of this hit with respect to the sequence, numbered 1..L for a sequence of L residues.
-(9) seq to (ali coord): The end of the alignment of this hit with respect to the sequence, numbered 1..L for a sequence of L residues.
-(10) strand: The strand on which the hit occurs on the sequence. ’+’ if the hit is on the top (Watson) strand, ’-’ if the hit is on the bottom (Crick) strand. If on the top strand, the “seq from” value will be less than or equal to the “seq to” value, else it will be greater than or equal to it.
-(11) trunc: Indicates if this is predicted to be a truncated CM hit or not. This will be “no” if it is a CM hit that is not predicted to be truncated by the end of the sequence, “5’ ” or “3’ ” if the hit is predicted to have one or more 5’ or 3’ residues missing due to a artificial truncation of the sequence, or “5’&3”’ if the hit is predicted to have one or more 5’ residues missing and one or more 3’ residues missing. If the hit is an HMM hit, this will always be ’-’.
-(12) pass: Indicates what “pass” of the pipeline the hit was detected on. This is probably only useful for testing and debugging. Non-truncated hits are found on the first pass, truncated hits are found on successive passes.
-(13) gc: Fraction of G and C nucleotides in the hit.
-(14) bias: The biased-composition correction: the bit score difference contributed by the null3 model for CM hits, or the null2 model for HMM hits. High bias scores may be a red flag for a false positive. It is difficult to correct for all possible ways in which a nonrandom but nonhomologous biological sequences can appear to be similar, such as short-period tandem repeats, so there are cases where the bias correction is not strong enough (creating false positives).
-(15) score: The score (in bits) for this target/query comparison. It includes the biased-composition cor-rection (the “null3” model for CM hits, or the “null2” model for HMM hits).
-(16) E-value: The expectation value (statistical significance) of the target. This is a per query E-value; i.e. calculated as the expected number of false positives achieving this comparison’s score for a single query against the search space Z. For cmsearch Z is defined as the total number of nucleotides in the target dataset multiplied by 2 because both strands are searched. For cmscan Z is the total number of nucleotides in the query sequence multiplied by 2 because both strands are searched and multiplied by the number of models in the target database. If you search with multiple queries and if you want to control the overall false positive rate of that search rather than the false positive rate per query, you will want to multiply this per-query E-value by how many queries you’re doing.
-(17) inc: Indicates whether or not this hit achieves the inclusion threshold: ’!’ if it does, ’?’ if it does not (and rather only achieves the reporting threshold). By default, the inclusion threshold is an E-value of 0.01 and the reporting threshold is an E-value of 10.0, but these can be changed with command line options as described in the manual pages.
-(18) description of target: The remainder of the line is the target’s description line, as free text.
-
-
-For further questions please refere to the Infernal `Userguide <http://selab.janelia.org/software/infernal/Userguide.pdf>`_.
-
-
-]]>
-    </help>
-    
-    <citations>
-        <citation type="doi">10.1093/bioinformatics/btt509</citation>
-        <citation type="bibtex">
-            @ARTICLE{bgruening_galaxytools,
-                Author = {Björn Grüning, Cameron Smith, Torsten Houwaart, Nicola Soranzo, Eric Rasche},
-                keywords = {bioinformatics, ngs, galaxy, cheminformatics, rna},
-                title = {{Galaxy Tools - A collection of bioinformatics and cheminformatics tools for the Galaxy environment}},
-                url = {https://github.com/bgruening/galaxytools}
-            }
-        </citation>
-    </citations>
-    
-    
-</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/cmalign.xml	Sat Jan 21 17:36:57 2017 -0500
@@ -0,0 +1,241 @@
+<tool id="infernal_cmalign" name="cmalign" version="@VERSION@.0">
+    <description>Align sequences to a covariance model against a sequence database</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements" />
+    <expand macro="stdio" />
+    <command>
+<![CDATA[
+
+        cmalign
+            ## Infernal Options
+            --cpu "\${GALAXY_SLOTS:-2}"
+            -o '$outfile'
+
+            $alignment_algorithm_cont.alignment_algorithm.alignment_algorithm_selector
+            #if $alignment_algorithm_cont.alignment_algorithm.alignment_algorithm_selector=="--sample"
+                --seed $alignment_algorithm_cont.alignment_algorithm.seed
+            #end if
+            $alignment_algorithm_cont.notrunc_opt.notrunc
+            #if $alignment_algorithm_cont.notrunc_opt.notrunc=="--notrunc"
+                $alignment_algorithm_cont.notrunc_opt.sub
+            #end if
+            $speed_memory_cont.hmm_banding.banding_selector
+            #if $speed_memory_cont.hmm_banding.banding_selector=="--hbanded"
+                --tau $speed_memory_cont.hmm_banding.tau
+                --mxsize $speed_memory_cont.hmm_banding.mxsize
+                $speed_memory_cont.hmm_banding.fixedtau
+                --maxtau $speed_memory_cont.hmm_banding.maxtau
+            #end if
+            #if $speed_memory_cont.hmm_banding.banding_selector=="--nonbanded"
+                --mxsize $speed_memory_cont.hmm_banding.mxsize
+            #end if
+
+            #if $other_opts.mapali_opt.mapali_cond
+                --mapali '$other_opts.mapali_opt.mapali'
+                $other_opts.mapali_opt.mapstr
+            #end if
+
+            --informat $seqdb.ext
+            --outformat $other_opts.outformat_selector
+            $other_opts.dnaout
+            $other_opts.noprob
+            $other_opts.matchonly
+            $other_opts.ileaved
+
+            ##--small requirements according to cmalign.c
+
+            #if $alignment_algorithm_cont.alignment_algorithm.alignment_algorithm_selector=="--cyk" \
+                and $other_opts.noprob \
+                and $speed_memory_cont.hmm_banding.banding_selector=="--nonbanded" \
+                and $alignment_algorithm_cont.notrunc_opt.notrunc=="--notrunc"
+                    $speed_memory_cont.small
+            #end if
+
+            ## CM file from the history or stored as database on disc
+            #if $cm_opts.cm_opts_selector == "db":
+                $cm_opts.database.fields.path
+            #else:
+                '$cm_opts.cmfile'
+            #end if
+            ## sequence file
+            '$seqdb'
+
+]]>
+    </command>
+    <inputs>
+
+        <param name="seqdb" type="data" format="fasta" label="Sequence database"/>
+
+        <conditional name="cm_opts">
+            <param name="cm_opts_selector" type="select" label="Subject covariance models">
+              <option value="db" selected="True">Locally installed covariance models</option>
+              <option value="histdb">Covariance model from your history</option>
+            </param>
+            <when value="db">
+                <param name="database" type="select" label="Covariance models">
+                    <options from_file="infernal.loc">
+                      <column name="value" index="0"/>
+                      <column name="name" index="1"/>
+                      <column name="path" index="2"/>
+                    </options>
+                </param>
+            </when>
+            <when value="histdb">
+                <param name="cmfile" type="data" format="cm" label="Covariance models file from the history."/>
+            </when>
+        </conditional>
+
+        <param argument="-g" truevalue="-g" falsevalue="" checked="False" type="boolean"
+            label="Turn on the glocal alignment algorithm" help="... global with respect to the query model and local with respect to the target database."/>
+
+        <section name="alignment_algorithm_cont" title="Options controlling alignment algorithm" >
+            <conditional name="alignment_algorithm">
+                <param name="alignment_algorithm_selector" type="select" label="Options controlling alignment algorithm" help="">
+                    <option value="--optacc" selected="true">The Holmes/Durbin optimal accuracy algorithm (--optacc)</option>
+                    <option value="--cyk"> The CYK algorithm (--cyk)</option>
+                    <option value="--sample">Sample alignment of each seq from posterior distribution (--sample)</option>
+                </param>
+                <when value="--optacc"></when>
+                <when value="--cyk"></when>
+                <when value="--sample">
+                        <param argument="--seed" type="integer" value="0" label="set RNG seed to 'n'" help="if 0: one-time arbitrary seed"/>
+                </when>
+            </conditional>
+            <conditional name="notrunc_opt">
+                <param argument="--notrunc" truevalue="" falsevalue="--notrunc" checked="true" type="boolean"
+                label="Use truncated alignment algorithm" help=""/>
+                <when value=""></when>
+                <when value="--notrunc">
+                    <param argument="--sub" type="boolean" truevalue="--sub" falsevalue="" checked="false"
+                        label="Build sub CM for columns b/t HMM predicted start/end points" help=""/>
+
+                </when>
+            </conditional>
+        </section>
+
+        <section name="speed_memory_cont" title="Options controlling speed and memory requirements">
+            <conditional name="hmm_banding">
+                <param name="banding_selector" type="select" label="HMM banding">
+                    <option value="--hbanded" selected="true"></option>
+                    <option value="--nonbanded"></option>
+                </param>
+                <when value="--hbanded">
+                    <param argument="--tau" type="float" value="1e-7" min="1e-18" max="1.0"
+                        label="Tail loss probability for HMM bands" help="This is the amount of probability mass within the HMM posterior probabilities that is considered negligible."/>
+                    <param argument="--mxsize" type="integer" value="1028" min="1"
+                        label="Set the maximum allowable CM DP matrix size to 'x' megabytes" help=""/>
+                    <param argument="--fixedtau" type="boolean" truevalue="--fixedtau" falsevalue="" checked="false"
+                        label="Turn off the HMM band tightening strategy" help="Cmalign will attempt to iteratively tighten the HMM bands it uses to constrain the alignment by raising the tau parameter and recalculating the bands until the total matrix size needed falls below 'x' megabytes or the maximum allowable tau value (0.05 by default, but changeable with --maxtau) is reached."/>
+                    <param argument="--maxtau" type="float" value="0.05" min="1e-18" max="1.0"
+                        label="Set the maximum allowed value for tau during band tightening" help=""/>
+                </when>
+                <when value="--nonbanded">
+                    <param argument="--mxsize" type="integer" value="1028" min="1"
+                        label="Set the maximum allowable CM DP matrix size to 'x' megabytes" help=""/>
+                </when>
+            </conditional>
+            <param argument="--small" type="boolean" truevalue="--small" falsevalue="" checked="false"
+                label="Use small memory divide and conquer algorithm" help="Allows CM alignment within practical memory limits, reducing the memory required for alignment. WARNING: It can only be used when --cyk,--noprob,--nonbanded,--notrunc are all enabled"/>
+        </section>
+
+        <section name="other_opts" title="Other options">
+            <conditional name="mapali_opt">
+                <param name="mapali_cond" type="boolean" checked="false"
+                    label="Read the aligment file that used to build the CM" help="The alignment from the file is held fixed. This allows you to align sequences to a model with cmalign and view them in the context of an existing trusted multiple alignment."/>
+                <when value="true">
+                    <param argument="--mapali" type="data" format="fasta"
+                        label="The aligment file that used to build the CM" help=""/>
+                    <param argument="--mapstr" type="boolean" truevalue="--small" falsevalue="" checked="true"
+                            label="Use small memory divide and conquer algorithm" help=""/>
+                </when>
+                <when value="false"></when>
+            </conditional>
+            <param name="outformat_selector" type="select" label="" argument="--outformat">
+                <option value="Stockholm" selected="true">Stockholm</option>
+                <option value="Pfam">Pfam</option>
+                <option value="AFA">AFA: aligned fasta</option>
+                <option value="A2M">A2M</option>
+                <option value="Clustal">Clustal</option>
+                <option value="Phylip">Phylip</option>
+            </param>
+            <param argument="--dnaout" type="boolean" truevalue="--dnaout" falsevalue="" checked="false"
+                label="Output the alignments as DNA sequence alignments" help="... instead of RNA ones."/>
+            <param argument="--noprob" type="boolean" truevalue="" falsevalue="--noprob" checked="true"
+                label="Annotate the output alignment with posterior probabilities" help=""/>
+            <param argument="--matchonly" type="boolean" truevalue="--matchonly" falsevalue="" checked="false"
+                label="Only include match columns in the output alignment" help="Do not include any insertions relative to the consensus model."/>
+            <param argument="--ileaved" type="boolean" truevalue="--ileaved" falsevalue="" checked="false"
+                label="Output the alignment in interleaved Stockholm format of a fixed width" help="will only work for alignments of up to 100,000 sequences or a total of 100,000,000 aligned nucleotides"/>
+        </section>
+
+
+    </inputs>
+    <outputs>
+        <data  name="outfile" format="text" label="cmalign on ${on_string}"/>
+    </outputs>
+    <tests>
+        <test>
+            <conditional name="cm_opts">
+                <param name="cm_opts_selector" value="histdb"/>
+                <param name="cmfile" value="cmalign_input2_tRNA5.c.cm"/>
+            </conditional>
+            <param name="seqdb" value="cmalign_input_mrum_tRNAs10.fa"/>
+            <output name="outfile">
+                <assert_contents>
+                    <has_text text="GGAGCUAUAGCUCAAU..GGC"/>
+                </assert_contents>
+            </output>
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+
+
+**What it does**
+
+cmalign aligns the RNA sequences to the covariance model (CM).
+
+
+The sequence file must be in FASTA or Genbank format. cmalign
+uses an HMM banding technique to accelerate alignment by default. By default,
+cmalign computes the alignment with maximum expected accuracy that is consistent with constraints
+(bands) derived from an HMM, using a banded version of the Durbin/Holmes optimal accuracy algorithm. cmalign takes special care to correctly align truncated sequences, where some nucleotides from the beginning (5’) and/or end (3’) of the actual full length biological sequence are not present in the input sequence. This behavior is on by default.
+
+
+
+
+**Output format**
+
+
+(1) target name: The name of the target sequence or profile.
+(2) accession: The accession of the target sequence or profile, or ’-’ if none.
+(3) query name: The name of the query sequence or profile.
+(4) accession: The accession of the query sequence or profile, or ’-’ if none.
+(5) mdl (model): Which type of model was used to compute the final score. Either ’cm’ or ’hmm’. A CM is used to compute the final hit scores unless the model has zero basepairs or the --hmmonly option is used, in which case a HMM will be used.
+(6) mdl from (model coord): The start of the alignment of this hit with respect to the profile (CM or HMM), numbered 1..N for a profile of N consensus positions.
+(7) mdl to (model coord): The end of the alignment of this hit with respect to the profile (CM or HMM), numbered 1..N for a profile of N consensus positions.
+(8) seq from (ali coord): The start of the alignment of this hit with respect to the sequence, numbered 1..L for a sequence of L residues.
+(9) seq to (ali coord): The end of the alignment of this hit with respect to the sequence, numbered 1..L for a sequence of L residues.
+(10) strand: The strand on which the hit occurs on the sequence. ’+’ if the hit is on the top (Watson) strand, ’-’ if the hit is on the bottom (Crick) strand. If on the top strand, the “seq from” value will be less than or equal to the “seq to” value, else it will be greater than or equal to it.
+(11) trunc: Indicates if this is predicted to be a truncated CM hit or not. This will be “no” if it is a CM hit that is not predicted to be truncated by the end of the sequence, “5’ ” or “3’ ” if the hit is predicted to have one or more 5’ or 3’ residues missing due to a artificial truncation of the sequence, or “5’&3”’ if the hit is predicted to have one or more 5’ residues missing and one or more 3’ residues missing. If the hit is an HMM hit, this will always be ’-’.
+(12) pass: Indicates what “pass” of the pipeline the hit was detected on. This is probably only useful for testing and debugging. Non-truncated hits are found on the first pass, truncated hits are found on successive passes.
+(13) gc: Fraction of G and C nucleotides in the hit.
+(14) bias: The biased-composition correction: the bit score difference contributed by the null3 model for CM hits, or the null2 model for HMM hits. High bias scores may be a red flag for a false positive. It is difficult to correct for all possible ways in which a nonrandom but nonhomologous biological sequences can appear to be similar, such as short-period tandem repeats, so there are cases where the bias correction is not strong enough (creating false positives).
+(15) score: The score (in bits) for this target/query comparison. It includes the biased-composition cor-rection (the “null3” model for CM hits, or the “null2” model for HMM hits).
+(16) E-value: The expectation value (statistical significance) of the target. This is a per query E-value; i.e. calculated as the expected number of false positives achieving this comparison’s score for a single query against the search space Z. For cmsearch Z is defined as the total number of nucleotides in the target dataset multiplied by 2 because both strands are searched. For cmscan Z is the total number of nucleotides in the query sequence multiplied by 2 because both strands are searched and multiplied by the number of models in the target database. If you search with multiple queries and if you want to control the overall false positive rate of that search rather than the false positive rate per query, you will want to multiply this per-query E-value by how many queries you’re doing.
+(17) inc: Indicates whether or not this hit achieves the inclusion threshold: ’!’ if it does, ’?’ if it does not (and rather only achieves the reporting threshold). By default, the inclusion threshold is an E-value of 0.01 and the reporting threshold is an E-value of 10.0, but these can be changed with command line options as described in the manual pages.
+(18) description of target: The remainder of the line is the target’s description line, as free text.
+
+
+For further questions please refere to the Infernal `Userguide <http://eddylab.org/infernal/Userguide.pdf>`_.
+
+
+]]>
+    </help>
+
+    <expand macro="citations" />
+
+
+</tool>
--- a/cmbuild.xml	Mon Dec 19 15:27:06 2016 -0500
+++ b/cmbuild.xml	Sat Jan 21 17:36:57 2017 -0500
@@ -1,62 +1,96 @@
-<tool id="infernal_cmbuild" name="Build covariance models" version="1.1.0.2">
-    <description>from sequence alignments (cmbuild)</description>
-    <parallelism method="multi" split_inputs="alignment_infile" split_mode="to_size" split_size="10" shared_inputs="" merge_outputs="cmfile_outfile"></parallelism>
-    <requirements>
-        <requirement type="package">infernal</requirement>
-        <requirement type="package" version="1.1">infernal</requirement>
-        <requirement type="package" version="8.22">gnu_coreutils</requirement>
-    </requirements>
+<tool id="infernal_cmbuild" name="cmbuild" version="@VERSION@.0">
+    <description>Build covariance models from sequence alignments</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <parallelism method="multi" split_inputs="alignment_infile" split_mode="to_size" split_size="10" merge_outputs="cmfile_outfile"></parallelism>
+    <expand macro="requirements" />
+    <expand macro="stdio" />
     <command>
 <![CDATA[
-        cmbuild -F
-            #if $is_summery_output:
-                -o '$summary_outfile'
-            #end if
-
-            $model_construction_opts.model_construction_opts_selector
-            #if $model_construction_opts.model_construction_opts_selector == '--fast':
-                --symfrac $model_construction_opts.symfrac
+    cmbuild
+        -F
+        #if $is_summery_output:
+            -o '$summary_outfile'
+        #end if
+        ## to many outputs, is that one really needed?
+        ##-O $annotated_source_alignment_outfile
+        $model_construction_opts.model_construction_opts_selector
+        #if $model_construction_opts.model_construction_opts_selector == '--fast':
+            --symfrac $model_construction_opts.symfrac
+        #end if
+        $noss
+        $relative_weights_opts.relative_weights_opts_selector
+        #if $relative_weights_opts.relative_weights_opts_selector == '--wblosum':
+            --wid $relative_weights_opts.wid
+        #end if
+        --p7ere $controlling_filter_p7_hmm.p7ere
+        $controlling_filter_p7_hmm.p7ml
+        --EmN $controlling_filter_p7_hmm.EmN
+        --EvN $controlling_filter_p7_hmm.EvN
+        --ElfN $controlling_filter_p7_hmm.ElfN
+        --EgfN $controlling_filter_p7_hmm.EgfN
+        $effective_opts.effective_opts_selector
+        #if str($effective_opts.effective_opts_selector) == '--eent':
+            #if $effective_opts.ere
+                --ere $effective_opts.ere
             #end if
-
-            $noss
-
-            $relative_weights_opts.relative_weights_opts_selector
-            #if $relative_weights_opts.relative_weights_opts_selector == '--wblosum':
-                --wid $relative_weights_opts.wid
+            #if $effective_opts.eminseq
+                --eminseq $effective_opts.eminseq
             #end if
-
-            $effective_opts.effective_opts_selector
-            #if str($effective_opts.effective_opts_selector) == '--eent':
-                --ere $effective_opts.ere
-                --eminseq $effective_opts.eminseq
+            #if $effective_opts.ehmmre
                 --ehmmre $effective_opts.ehmmre
+            #end if
+            #if $effective_opts.eset
                 --eset $effective_opts.eset
             #end if
+        #end if
+        #if str($refining_opts.refining_opts_selector) == '--refine':
+            #if $refining_opts.refine_output:
+                --refine '$refined_multiple_alignment_output'
+            #else:
+                --refine /dev/null
+            #end if
+            $refining_opts.l
+            $refining_opts.gibbs_opts.gibbs_opts_selector
+            #if str($refining_opts.gibbs_opts.gibbs_opts_selector) == '--gibbs':
+                --seed $refining_opts.gibbs_opts.random_seed
+            #end if
+            $refining_opts.notrunc
+            $refining_opts.cyk
+        #end if
+        '$cmfile_outfile'
+        '$alignment_infile'
 
-            #if str($refining_opts.refining_opts_selector) == '--refine':
-                #if $refining_opts.refine_output:
-                    --refine $refined_multiple_alignment_output
-                #else:
-                    --refine /dev/null
-                #end if
-
-                $l
-                $refining_opts.gibbs_opts.gibbs_opts_selector
 
-                #if str($refining_opts.gibbs_opts.gibbs_opts_selector) == '--gibbs':
-                    $refining_opts.gibbs_opts.random_seed
+    #if $Calibrate.selector=="true"
+        && cmcalibrate
+            -L$Calibrate.L
+            #if $Calibrate.output_options_cond.selector == "extra"
+                #if str($Calibrate.output_options_cond.output_options) != 'None'
+                    #for j in $Calibrate.output_options_cond.output_options.value:
+                        --$j $getVar($j)
+                    #end for
                 #end if
-
-                $notrunc
-                $cyk
             #end if
-
+            #if $Calibrate.cont_exp_tails_fits.selector == "top_n"
+                --gtailn $Calibrate.cont_exp_tails_fits.gtailn
+                --ltailn $Calibrate.cont_exp_tails_fits.ltailn
+            #elif $Calibrate.cont_exp_tails_fits.selector == "frac"
+                --tailp $Calibrate.cont_exp_tails_fits.tailp
+            #end if
+            --seed $Calibrate.add_opts.seed
+            --beta $Calibrate.add_opts.beta
+            $Calibrate.add_opts.nonbanded
+            $Calibrate.add_opts.nonull3
+            $Calibrate.add_opts.random
+            #if str($Calibrate.add_opts.gc) != 'None'
+                --gc '$Calibrate.add_opts.gc'
+            #end if
+            --cpu "\${GALAXY_SLOTS:-2}"
             '$cmfile_outfile'
-            '$alignment_infile'
-      &&
-      cmcalibrate
-        -L 0.01 --cpu \${GALAXY_SLOTS:-2}
-        '$cmfile_outfile'
+    #end if
+
 ]]>
     </command>
         <inputs>
@@ -98,6 +132,15 @@
                 </when>
             </conditional>
 
+            <section name="controlling_filter_p7_hmm" title="Controlling Filter P7 HMM construction" >
+                <param argument="--p7ere" type="float" value="0.38" label="For the filter p7 HMM, set minimum rel entropy/posn to" help="Set the target mean match state relative entropy for the filter p7 HMM"/>
+                <param argument="--p7ml" type="boolean" truevalue="--p7ml" falsevalue="" checked="false" label="Define the filter p7 HMM as the ML p7 HMM" help="Use a mzimum likelihood p7 HMM built from the CM as the filter HMM"/>
+                <param argument="--EmN" type="integer" value="200" label="Number of sampled seqs to use for p7 local MSV calibration" help=""/>
+                <param argument="--EvN" type="integer" value="200" label="Number of sampled seqs to use for p7 local Vit calibration" help=""/>
+                <param argument="--ElfN" type="integer" value="200" label="Number of sampled seqs to use for p7 local Fwd calibration" help=""/>
+                <param argument="--EgfN" type="integer" value="200" label="Number of sampled seqs to use for p7 glocal Fwd calibration" help=""/>
+            </section>
+
             <conditional name="effective_opts">
                 <param name="effective_opts_selector" type="select" label="Options controlling effective sequence number" help="">
                     <option value="--eent" >entropy weighting strategy (--eent)</option>
@@ -105,24 +148,24 @@
                 </param>
                 <when value="--enone"/>
                 <when value="--eent">
-                    <param name="ere" type="float" value="0.59"
-                        label="Set the target mean match state relative entropy (--ere)" help=""/>
+                    <param name="ere" type="float" value=""
+                        label="Set the target mean match state relative entropy" help="(--ere)" optional="true"/>
 
                     <param name="eminseq" type="integer" value=""
-                        label="Define the minimum allowed effective sequence number (--eminseq)" help=""/>
+                        label="Define the minimum allowed effective sequence number" help="(--eminseq)" optional="true"/>
 
                     <param name="ehmmre" type="float" value=""
-                        label="Set the target HMM mean match state relative entropy (--ehmmre)" help=""/>
+                        label="Set the target HMM mean match state relative entropy" help="(--ehmmre)" optional="true"/>
 
                     <param name="eset" type="integer" value=""
-                        label="Set the effective sequence number for entropy weighting (--eset)" help=""/>
+                        label="Set the effective sequence number for entropy weighting" help="(--eset)" optional="true"/>
                 </when>
             </conditional>
 
             <conditional name="refining_opts">
                 <param name="refining_opts_selector" type="select" label="Options for refining the input alignment" help="">
+                    <option value="--refine">refine the input alignment</option>
                     <option value="" selected="true">No refinement</option>
-                    <option value="--refine">refine the input alignment</option>
                 </param>
                 <when value=""/>
                 <when value="--refine">
@@ -158,6 +201,59 @@
             <param name="is_summery_output" truevalue="" falsevalue="" checked="False" type="boolean"
                 label="Output a summery file?" help=""/>
 
+            <!-- calibrate options -->
+            <conditional name="Calibrate">
+                <param name="selector" type="boolean" checked="true" label="Calibrate the covariance model"
+                    help="A CM file must be calibrated with cmcalibrate before it can be used in cmsearch or cmscan. cmcalibrate is very slow. It takes a couple of hours to calibrate a single average sized CM on a single CPU"/>
+                <when value="false"/>
+                <when value="true">
+                    <param argument="-L" type="float" value="1.6" min="0.01" max="160" label="Total length of random sequences to search" help="Set random seq length to search in Mb (megabases)"/>
+                    <conditional name="cont_exp_tails_fits" >
+                        <param name="selector" type="select" label="Options controlling exponential tail fits">
+                            <option value="top_n">Fit the top 'n' hits/Mb in thehistogram</option>
+                            <option value="frac">Fit a fraction of the histogram</option>
+                        </param>
+                        <when value="top_n">
+                            <param argument="--gtailn" type="integer" value="250" min="0" label=" Fit the top 'n' hits/Mb in histogram for glocal modes" help=""/>
+                            <param argument="--ltailn" type="integer" value="750" min="0" label=" Fit the top 'n' hits/Mb in histogram for local modes" help=""/>
+                        </when>
+                        <when value="frac">
+                            <param argument="--tailp" type="float" min="0" max="0.6" optional="true" label="Set fraction of histogram tail to fit to exp tail" help=""/>
+                        </when>
+                    </conditional>
+                    <conditional name="output_options_cond">
+                        <param name="selector" type="select" label="Output extra files">
+                            <option value="extra">Output extra files</option>
+                            <option value="none" selected="true">Don't output extra files</option>
+                        </param>
+                        <when value="extra">
+                            <param name="output_options" type="select" label="Optional output files" multiple="true" display="checkboxes">
+                                <option value="hfile">save fitted score histogram(s)</option>
+                                <option value="sfile">save survival plot </option>
+                                <option value="qqfile">save Q-Q plot for score histograms </option>
+                                <option value="ffile">save lambdas for different tail fit probs</option>
+                                <option value="xfile">save scores in fit tail</option>
+                            </param>
+                        </when>
+                        <when value="none"/>
+                    </conditional>
+                    <section name="add_opts" title="Additional Options">
+                        <param argument="--seed" type="integer" value="181"
+                            label="RNG seed" help="If the seed is nonzero, stochas-tic simulations will be reproducible. If 0, the random number generator is seeded arbitrarily"/>
+                        <param argument="--beta" type="float" value="1e-15"
+                            label="Tail loss prob. for query dependent banding (QDB)" help="The beta parameter is the amount of probability mass excluded during band calculation, higher values of beta give greater speedups but sacrifice more accuracy than lower values."/>
+                        <param argument="--nonbanded" truevalue="--nonbanded" falsevalue="" checked="false" type="boolean"
+                            label="Turn off QDB during E-value calibration" help="This will slow down calibration"/>
+                        <param argument="--nonull3" truevalue="--nonull3" falsevalue="" checked="false" type="boolean"
+                            label="Turn off the null3 post hoc additional null model" help="This is not recommended unless you plan on using the same option to cmsearch and/or cmscan"/>
+                        <param argument="--random" truevalue="--random" falsevalue="" checked="false" type="boolean"
+                            label="use GC content of random null background model of CM" help="Use the background null model of the CM to generate the random sequences, instead of the more realistic HMM. Unless the CM was built using the --null option to cmbuild, the background null model will be 25% each A, C, G and U"/>
+                        <param argument="--gc" type="data" format="*" optional="true" label="Use GC content distribution from file" help="Generate the random sequences using the nucleotide distribution from the sequence file"/>
+                    </section>
+                </when>
+            </conditional>
+
+
         </inputs>
     <outputs>
         <data format="text" name="summary_outfile" label="cmbuild summary on ${on_string}">
@@ -175,7 +271,68 @@
             </filter>
         </data>
 
+        <!-- cmcalibrate additional output files -->
+        <data name="hfile" format="txt" label="hfile, an cmcalibrate additional output file, on ${on_string}">
+            <filter>
+                ((
+                Calibrate['selector'] is True and
+                Calibrate['output_options_cond']['selector'] == "extra" and
+                'hfile' in Calibrate['output_options_cond']['output_options']
+                ))
+            </filter>
+        </data>
+        <data name="sfile" format="txt" label="sfile, an cmcalibrate additional output file, on ${on_string}">
+            <filter>
+                ((
+                Calibrate['selector'] is True and
+                Calibrate['output_options_cond']['selector'] == "extra" and
+                'sfile' in Calibrate['output_options_cond']['output_options']
+                ))
+            </filter>
+        </data>
+        <data name="qqfile" format="txt" label="qqfile, an cmcalibrate additional output file, on ${on_string}">
+            <filter>
+                ((
+                Calibrate['selector'] is True and
+                Calibrate['output_options_cond']['selector'] == "extra" and
+                'qqfile' in Calibrate['output_options_cond']['output_options']
+                ))
+            </filter>
+        </data>
+        <data name="ffile" format="txt" label="ffile, an cmcalibrate additional output file, on ${on_string}">
+            <filter>
+                ((
+                Calibrate['selector'] is True and
+                Calibrate['output_options_cond']['selector'] == "extra" and
+                'ffile' in Calibrate['output_options_cond']['output_options']
+                ))
+            </filter>
+        </data>
+        <data name="xfile" format="txt" label="xfile, an cmcalibrate additional output file, on ${on_string}">
+            <filter>
+                ((
+                Calibrate['selector'] is True and
+                Calibrate['output_options_cond']['selector'] == "extra" and
+                'xfile' in Calibrate['output_options_cond']['output_options']
+                ))
+            </filter>
+        </data>
+
     </outputs>
+
+    <tests>
+        <test>
+            <param name="alignment_infile" value="cmbuild_input_tRNA5.sto"/>
+            <conditional name="Calibrate">
+                <param name="selector" value="true"/>
+            </conditional>
+            <output name="outfile">
+                <assert_contents>
+                    <has_text text="S     0    -1 0     1     4     0     1    88   108  -7.713  -8.959  -0.044  -5.412"/>
+                </assert_contents>
+            </output>
+        </test>
+    </tests>
     <help>
 <![CDATA[
 
@@ -268,24 +425,17 @@
   - *Turn on the local alignment algorithm*: allows the alignment to span two or more subsequences if necessary (e.g. if the structures of the query model and target sequence are only partially shared), allowing certain large insertions and deletions in the structure to be penalized differently than normal indels. The default is to globally align the query model to the target sequences.
   - *--gibbs sampling*: Modifies the behavior of --refine so Gibbs sampling is used instead of EM. The difference is that during the alignment stage the alignment is not necessarily optimal, instead an alignment (parsetree) for each sequences is sampled from the posterior distribution of alignments as determined by the Inside algorithm. Due to this sampling step --gibbs is non- deterministic, so different runs with the same alignment may yield different results. This is not true when --refine is used without the --gibbs option, in which case the final alignment and CM will always be the same. When --gibbs is enabled, the --seed "number" option can be used to seed the random number generator predictably, making the results reproducible. The goal of the --gibbs option is to help expert RNA alignment curators refine structural alignments by allowing them to observe alternative high scoring alignments.
   - *--Random seed*: Seed the random number generator with an integer >= 0. This option can only be used in combination with --gibbs. If the given number is nonzero, stochastic sampling of alignments will be reproducible; the same command will give the same results. If the given number is 0, the random number generator is seeded arbitrarily, and stochastic samplings may vary from run to run of the same command. The default seed is 0.
-   - *--Turn off the truncated alignment algorithm*: With --refine, turn off the truncated alignment algorithm. There is more information on this in the cmalign manual page.
+  - *--Turn off the truncated alignment algorithm*: With --refine, turn off the truncated alignment algorithm. There is more information on this in the cmalign manual page.
   - *--cyk algorithm*: With --refine, align with the CYK algorithm. By default the optimal accuracy algorithm is used. There is more information on this in the cmalign manual page.
 
+
 For further questions please refere to the Infernal Userguide_.
 
-.. _Userguide: http://selab.janelia.org/software/infernal/Userguide.pdf
+.. _Userguide: http://eddylab.org/infernal/Userguide.pdf
 
 ]]>
     </help>
-    <citations>
-        <citation type="doi">10.1093/bioinformatics/btt509</citation>
-        <citation type="bibtex">
-            @ARTICLE{bgruening_galaxytools,
-                Author = {Björn Grüning, Cameron Smith, Torsten Houwaart, Nicola Soranzo, Eric Rasche},
-                keywords = {bioinformatics, ngs, galaxy, cheminformatics, rna},
-                title = {{Galaxy Tools - A collection of bioinformatics and cheminformatics tools for the Galaxy environment}},
-                url = {https://github.com/bgruening/galaxytools}
-            }
-        </citation>
-    </citations>
+
+    <expand macro="citations" />
+
 </tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/cmpress.xml	Sat Jan 21 17:36:57 2017 -0500
@@ -0,0 +1,88 @@
+<tool id="infernal_cmpress" name="cmpress" version="@VERSION@.0">
+    <description> Prepare a covariance model database for cmscan</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements" />
+    <expand macro="stdio" />
+    <command>
+<![CDATA[
+    ## CM file from the history or stored as database on disc
+    #if str($cm_opts.cm_opts_selector) == "db":
+        cmfile_path='$cm_opts.database.fields.path'
+    #else:
+        ##'$cm_opts.cmfile'
+        cmfile_path='$cmfile'
+    #end if
+    &&
+    cmpress -F "\$cmfile_path" &&
+    ##cmpress creates four files in the same directory of the cm file
+    cd `dirname "\$cmfile_path"` &&
+    tar -cvf '$outfile' `basename "\$cmfile_path"`.i1*
+]]>
+    </command>
+    <inputs>
+        <conditional name="cm_opts">
+            <param name="cm_opts_selector" type="select" label="Subject covariance models &lt;cmdb&gt; ">
+                <option value="db" >Locally installed covariance models</option>
+                <option value="histdb" selected="True">Covariance model from your history</option>
+            </param>
+            <when value="db">
+                <param name="database" type="select" label="Covariance models">
+                    <options from_file="infernal.loc">
+                        <column name="value" index="0"/>
+                        <column name="name" index="1"/>
+                        <column name="path" index="2"/>
+                    </options>
+                </param>
+            </when>
+            <when value="histdb">
+                <param name="cmfile" type="data" format="cm" label="Covariance models file from the history."/>
+            </when>
+        </conditional>
+
+    </inputs>
+    <outputs>
+        <data format="tar" name="outfile" label="cmpress on ${on_string}"/>
+    </outputs>
+
+    <tests>
+        <test>
+            <conditional name="cm_opts">
+                <param name="cm_opts_selector" value="histdb"/>
+                <param name="cmfile" value="cmpress_input_minifam.cm"/>
+            </conditional>
+            <assert_stdout>
+                    <has_text text="Working...    done."/>
+            </assert_stdout>
+
+        </test>
+
+    </tests>
+    <help>
+<![CDATA[
+
+
+**What it does**
+
+Starting from a CM database <cmfile> in standard Infernal-1.1 format, construct binary compressed datafiles for cm-
+scan. The cmpress step is required for cmscan to work.
+
+**Input format**
+
+The <cmfile> must be have already been calibrated with cmcalibrate for cmpress to work.
+
+**Output format**
+
+
+
+For further questions please refere to the Infernal `Userguide <http://eddylab.org/infernal/Userguide.pdf>`_.
+
+
+]]>
+    </help>
+
+    <expand macro="citations" />
+
+
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/cmscan.xml	Sat Jan 21 17:36:57 2017 -0500
@@ -0,0 +1,287 @@
+<tool id="infernal_cmscan" name="cmscan" version="@VERSION@.0">
+    <description> Search sequences against collections of covariance models</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements"/>
+    <expand macro="stdio"/>
+    <command>
+<![CDATA[
+    ## a temp file is needed, because the standard tabular output from infernal is not usefull in Galaxy
+    ## it will be converted to a tab delimited file and piped to Galaxy
+    temp_tabular_output=\$(mktemp) &&
+
+    #if str($cm_opts.cm_opts_selector) == "histdb":
+        ln -s '$cm_opts.cmfile' cmdb.cm &&
+    #end if
+
+    tar xvf '$aux_files' &&
+    ln -s `find *.i1f` cmdb.cm.i1f &&
+    ln -s `find *.i1i` cmdb.cm.i1i &&
+    ln -s `find *.i1m` cmdb.cm.i1m &&
+    ln -s `find *.i1p` cmdb.cm.i1p &&
+
+    cmscan
+        --cpu "\${GALAXY_SLOTS:-2}"
+        --tblout '\$temp_tabular_output'
+        -o /dev/null
+        $g
+        #if $Z
+            -Z $Z
+        #end if
+        $verbose
+        $other_opts.notrunc
+        $other_opts.anytrunc
+        $other_opts.nonull3
+        #if $other_opts.smxsize <> 128.0
+            --smxsize $other_opts.smxsize
+        #end if
+        #if $other_opts.mxsize <> 128.0
+            --mxsize $other_opts.mxsize
+        #end if
+        $other_opts.cyk
+        $other_opts.acyk
+        $other_opts.bottomonly
+        $other_opts.toponly
+        #if str($inclusion_thresholds_opts.inclusion_thresholds_selector) == "--incE":
+            --incE $inclusion_thresholds_opts.incE
+        #elif str($inclusion_thresholds_opts.inclusion_thresholds_selector) == "--incT":
+            --incT $inclusion_thresholds_opts.incT
+        #end if
+        #if str($reporting_thresholds_opts.reporting_thresholds_selector) == "-E":
+            -E $reporting_thresholds_opts.E
+        #elif str($reporting_thresholds_opts.reporting_thresholds_selector) == "-T":
+            -T $reporting_thresholds_opts.T
+        #end if
+        $model_thresholds.cut_ga
+        $model_thresholds.cut_nc
+        $model_thresholds.cut_tc
+        #if $acceleration_huristics.acceleration_huristics_selector == "FZ"
+            --FZ $$acceleration_huristics.FZ
+        #else
+            $acceleration_huristics.acceleration_huristics_selector
+            #if $acceleration_huristics.acceleration_huristics_selector == "--mid"
+                --Fmid $acceleration_huristics.Fmid
+            #end if
+        #end if
+        ## CM file from the history or stored as database on disc
+        #if str($cm_opts.cm_opts_selector) == "db":
+            '$cm_opts.database.fields.path'
+        #else:
+            ##'$cm_opts.cmfile'
+            cmdb.cm
+        #end if
+        ## sequence file
+        '$seqdb'
+        &&
+        sed 's/ \+ /\t/g' '\$temp_tabular_output' > '$outfile'
+
+]]>
+    </command>
+    <inputs>
+        <param name="seqdb" type="data" format="fasta" label="Sequence database &lt;seqfile&gt;"/>
+
+        <conditional name="cm_opts">
+            <param name="cm_opts_selector" type="select" label="Subject covariance models &lt;cmdb&gt; ">
+                <option value="db" >Locally installed covariance models</option>
+                <option value="histdb" selected="True">Covariance model from your history</option>
+            </param>
+            <when value="db">
+                <param name="database" type="select" label="Covariance models">
+                    <options from_file="infernal.loc">
+                        <column name="value" index="0"/>
+                        <column name="name" index="1"/>
+                        <column name="path" index="2"/>
+                    </options>
+                </param>
+            </when>
+            <when value="histdb">
+                <param name="cmfile" type="data" format="cm" label="Covariance models file from the history."/>
+            </when>
+        </conditional>
+        <param name="aux_files" type="data" format="tar" label="Auxillury files" help="A tar file contains the four auxillury files suffixed .i1{fimp}. These files are generated after pressing the cm files using cmpress"/>
+
+        <param argument="-g" truevalue="-g" falsevalue="" checked="False" type="boolean"
+            label="Turn on the glocal alignment algorithm" help="... global with respect to the query model and local with respect to the target database."/>
+        <param argument="-Z" type="float" optional="true" min="0" label="Search space size in *Mb* for E-value calculations" help="Without the use of this option, the search space size changes for each query sequence"/>
+        <param argument="--verbose" truevalue="--verbose" falsevalue="" checked="False" type="boolean"
+            label="Be verbose" help="report extra information; mainly useful for debugging"/>
+
+
+
+        <!-- Options for inclusion thresholds -->
+        <conditional name="inclusion_thresholds_opts">
+            <param name="inclusion_thresholds_selector" type="select" label="Inclusion thresholds"
+            help="Inclusion thresholds are stricter than reporting thresholds. Inclusion thresholds control which hits are considered to be reliable enough to be included in an output alignment or in a possible subsequent search round, or marked as significant (”!”) as opposed to questionable (”?”) in hit output.">
+                <option value="" selected="true">default</option>
+                <option value="--incE">Use E-value</option>
+                <option value="--incT">Use bit score</option>
+            </param>
+            <when value=""/>
+            <when value="--incE">
+                <param name="incE" type="float" value="0.01" label="Use E-value" help="of &lt;= X as the hit inclusion threshold.">
+                    <sanitizer>
+                        <valid initial="string.printable">
+                            <remove value="&apos;"/>
+                        </valid>
+                    </sanitizer>
+                </param>
+            </when>
+            <when value="--incT">
+                <param name="incT" type="integer" value="0" label="Use bit score" help="of >= X as the hit inclusion threshold.">
+                    <sanitizer>
+                        <valid initial="string.printable">
+                            <remove value="&apos;"/>
+                        </valid>
+                    </sanitizer>
+                </param>
+            </when>
+        </conditional>
+
+        <!-- Options controlling reporting thresholds -->
+
+        <conditional name="reporting_thresholds_opts">
+            <param name="reporting_thresholds_selector" type="select" label="reporting thresholds"
+            help="Reporting thresholds control which hits are reported in output files">
+                <option value="" selected="true">default</option>
+                <option value="-E">Use E-value</option>
+                <option value="-T">Use bit score</option>
+            </param>
+            <when value=""/>
+            <when value="-E">
+                <param name="E" type="float" value="10.0" label="Use E-value" help="of &lt;= X as the hit reporting threshold. The default is 10.0, meaning that on average, about 10 false positives will be reported per query, so you can see the top of the noise and decide for yourself if it’s really noise.">
+                    <sanitizer>
+                        <valid initial="string.printable">
+                            <remove value="&apos;"/>
+                        </valid>
+                    </sanitizer>
+                </param>
+            </when>
+            <when value="-T">
+                <param name="T" type="integer" value="0" label="Use bit score" help="of >= X as the hit reporting threshold.">
+                    <sanitizer>
+                        <valid initial="string.printable">
+                            <remove value="&apos;"/>
+                        </valid>
+                    </sanitizer>
+                </param>
+            </when>
+        </conditional>
+
+        <section name="model_thresholds" title="Options controlling model-specific reporting thresholds" help="Curated CM databases may define specific bit score thresholds for each CM, superseding any thresholding based on statistical significance alone.">
+            <param argument="--cut_ga" truevalue="--cut_ga" falsevalue="" checked="false" type="boolean"
+                label="Use CM's GA gathering cutoffs as reporting thresholds" help="GA thresholds are generally considered to be the reliable curated thresholds defining family membership"/>
+            <param argument="--cut_nc" truevalue="--cut_nc" falsevalue="" checked="false" type="boolean"
+                label="use CM's NC noise cutoffs as reporting thresholds" help="NC thresholds are generally considered to be the score of the highest-scoring known false positive."/>
+            <param argument="--cut_tc" truevalue="--cut_tc" falsevalue="" checked="false" type="boolean"
+                label="use CM's TC trusted cutoffs as reporting thresholds" help="TC thresholds are generally considered to be the score of the lowest-scoring known true positive that is above all known false positives."/>
+        </section>
+
+        <conditional name="acceleration_huristics">
+            <param name="acceleration_huristics_selector" type="select" label="Options controlling acceleration heuristics" help="These options are, in order from least strict (slowest but most sensitive) to most strict (fastest but least sensitive)">
+                <option value="--max">Turn all heuristic filters off (--max)</option>
+                <option value="--nohmm">Skip all HMM filter stages, use only CM (--nohmm)</option>
+                <option value="--mid">Skip first two HMM filter stages (SSV and Vit) (--mid)</option>
+                <option value="--default" selected="true">Run search space size-dependent pipeline (--default)</option>
+                <option value="--rfam">Use a strict filtering strategy devised for large databases (more than 20 Gb) (--rfam)</option>
+                <option value="--hmmonly">Use HMM only, don't use a CM at all (--hmmonly)</option>
+                <option value="FZ">set filters to defaults used for a search space of size 'x' Mb (--FZ)</option>
+            </param>
+            <when value="--max">
+            </when>
+            <when value="--nohmm">
+            </when>
+            <when value="--mid">
+                    <param argument="--Fmid" type="float" value="0.02" label="P-value threshold for HMM stages"/>
+            </when>
+            <when value="--default">
+            </when>
+            <when value="--rfam">
+            </when>
+            <when value="--hmmonly">
+            </when>
+            <when value="FZ">
+                <param argument="--FZ" type="float" value="125" label="Size of search space in Mb"/>
+            </when>
+        </conditional>
+
+        <section name="other_opts" title="Other options">
+            <param argument="--notrunc" truevalue="--notrunc" falsevalue="" checked="False" type="boolean"
+                label="Skip truncated hit detection" help=""/>
+            <param argument="--anytrunc" truevalue="--anytrunc" falsevalue="" checked="false" type="boolean"
+                label="Allow full and truncated hits anywhere within sequences" help=""/>
+            <param argument="--nonull3" truevalue="--nonull3" falsevalue="" checked="false" type="boolean"
+                label="Turn off the null3 CM score corrections for biased composition" help="This correction is not used during the HMM filter stages."/>
+            <param argument="--mxsize" type="float" value="128.0" min="0.1"
+                label="Set the maximum allowable CM DP matrix size to 'x' megabytes" help=""/>
+            <param argument="--smxsize" type="float" value="128.0" min="0.1"
+                label="Set the maximum allowable CM search DP matrix size to 'x' megabytes." help=""/>
+            <param argument="--cyk" truevalue="--cyk" falsevalue="" checked="False" type="boolean"
+                label="Use the CYK algorithm, not Inside, to determine the final score of all hits" help=""/>
+            <param argument="--acyk" truevalue="--cyk" falsevalue="" checked="False" type="boolean"
+                label="Use the CYK algorithm to align hits" help="By default, the Durbin/Holmes optimal accuracy algorithm is used, which finds the alignment that maximizes the expected accuracy of all aligned residues."/>
+            <param argument="--bottomonly" truevalue="--bottomonly" falsevalue="" checked="False" type="boolean"
+                label="Only search the bottom (Crick) strand of target sequences" help="in the sequence database"/>
+            <param argument="--toponly" truevalue="--toponly" falsevalue="" checked="False" type="boolean"
+                label="Only search the top (Watson) strand of target sequences" help="in the sequence database"/>
+
+        </section>
+
+
+
+    </inputs>
+    <outputs>
+        <data format="tabular" name="outfile" label="cmscan on ${on_string}"/>
+    </outputs>
+    <tests>
+        <test>
+            <conditional name="cm_opts">
+                <param name="cm_opts_selector" value="histdb"/>
+                <param name="cmfile" value="minifam.cm" />
+            </conditional>
+            <param name="aux_files" value="minifam.tar" ftype="tar"/>
+            <param name="seqdb" value="metag-example.fa"/>
+            <output name="outfile">
+                <assert_contents>
+                    <has_text text="AAGA01015927.1"/>
+                </assert_contents>
+            </output>
+        </test>
+
+    </tests>
+    <help>
+<![CDATA[
+
+
+**What it does**
+
+cmscan is used to search sequences against collections of covariance models.
+For each sequence in <seqfile>, use that query sequence to search the target database of CMs in <cmdb>,
+and output ranked lists of the CMs with the most significant matches to the sequence
+
+**Input format**
+
+The <seqfile> may contain more than one query sequence. It can be in FASTA format, or several other common
+sequence file formats (genbank, embl, and among others), or in alignment file formats (stockholm, aligned fasta, and
+others).
+
+The <cmdb> needs to be press’ed using cmpress before it can be searched with cmscan. This creates four binary
+files, suffixed .i1{fimp}. Additionally, <cmdb> must have been calibrated for E-values with cmcalibrate before being
+press’ed with cmpress.
+
+NOTE: Please provid a tar file that contains the .cm file in addition to the four binary files, suffixed .i1{fimp},
+and specify the file type as "tar" before uploading the file. Otherwise Galaxy will not read the binary files properly.
+
+**Output format**
+
+The output format is designed to be human-readable.
+
+For further questions please refere to the Infernal `Userguide <http://eddylab.org/infernal/Userguide.pdf>`_.
+
+
+]]>
+    </help>
+
+    <expand macro="citations" />
+
+</tool>
--- a/cmsearch.xml	Mon Dec 19 15:27:06 2016 -0500
+++ b/cmsearch.xml	Sat Jan 21 17:36:57 2017 -0500
@@ -1,193 +1,236 @@
-<tool id="infernal_cmsearch" name="Search covariance model(s)" version="1.1.0.2">
-    <description>against a sequence database (cmsearch)</description>
-    <parallelism method="multi" split_inputs="seqdb" split_mode="to_size" split_size="500" shared_inputs="" merge_outputs="outfile,multiple_alignment_output"></parallelism>
-    <requirements>
-        <requirement type="package">infernal</requirement>
-        <requirement type="package" version="1.1">infernal</requirement>
-        <requirement type="package" version="8.22">gnu_coreutils</requirement>
-    </requirements>
+<tool id="infernal_cmsearch" name="cmsearch" version="@VERSION@.0">
+    <description>Search covariance model(s) against a sequence database </description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <parallelism method="multi" split_inputs="seqdb" split_mode="to_size" split_size="500" merge_outputs="outfile,multiple_alignment_output"></parallelism>
+    <expand macro="requirements"/>
+    <expand macro="stdio" />
     <command>
 <![CDATA[
         ## a temp file is needed, because the standard tabular output from infernal is not usefull in Galaxy
         ## it will be converted to a tab delimited file and piped to Galaxy
-        temp_tabular_output=\$(mktemp);
+        temp_tabular_output=\$(mktemp) &&
 
         cmsearch
             ## Infernal Options
-            --cpu "\${GALAXY_SLOTS:-12}"
+            --cpu "\${GALAXY_SLOTS:-2}"
             -o /dev/null
             --tformat $seqdb.ext ##target format: fasta, embl, genbank, ddbj, stockholm, pfam, a2m, afa, clustal, and phylip
             $bottomonly
             $toponly
             $cyk
+            $acyk
             $notrunc
-            $max
-            $nohmm
-            $mid
-            ##$bitscore_thresholds
+            $anytrunc
+            $nonull3
+            #if $smxsize <> 128.0
+                --smxsize $smxsize
+            #end if
+            #if $mxsize <> 128.0
+                --mxsize $mxsize
+            #end if
             --tblout \$temp_tabular_output
             $g
+            #if $Z
+                -Z $Z
+            #end if
             #if $A:
-                $A $multiple_alignment_output
+                $A '$multiple_alignment_output'
             #end if
-
             #if str($inclusion_thresholds_opts.inclusion_thresholds_selector) == "--incE":
                 --incE $inclusion_thresholds_opts.incE
             #elif str($inclusion_thresholds_opts.inclusion_thresholds_selector) == "--incT":
                 --incT $inclusion_thresholds_opts.incT
             #end if
-
             #if str($reporting_thresholds_opts.reporting_thresholds_selector) == "-E":
                 -E $reporting_thresholds_opts.E
             #elif str($reporting_thresholds_opts.reporting_thresholds_selector) == "-T":
                 -T $reporting_thresholds_opts.T
             #end if
-
+            $model_thresholds.cut_ga
+            $model_thresholds.cut_nc
+            $model_thresholds.cut_tc
+            #if $acceleration_huristics.acceleration_huristics_selector == "FZ"
+                --FZ $$acceleration_huristics.FZ
+            #else
+                $acceleration_huristics.acceleration_huristics_selector
+                #if $acceleration_huristics.acceleration_huristics_selector == "--mid"
+                    --Fmid $acceleration_huristics.Fmid
+                #end if
+            #end if
             ## CM file from the history or stored as database on disc
-
             #if str($cm_opts.cm_opts_selector) == "db":
                 $cm_opts.database.fields.path
             #else:
                 $cm_opts.cmfile
             #end if
-
             ## sequence file
-            $seqdb
+            '$seqdb'
             2>&1
-            ;
-
+            &&
             ## 1. replace all lines starting # (comment lines)
             ## 2. replace the first 18 spaces with tabs, 18th field is a free text field (can contain spaces)
-            sed -e 's/#.*$//' -e '/^$/d' -e 's/\s\+/\t/g' -e 's/\t/ /18g' \$temp_tabular_output > $outfile
+            sed -e 's/#.*$//' -e '/^$/d' -e 's/\s\+/\t/g' -e 's/\t/ /18g' \$temp_tabular_output > '$outfile'
 
 ]]>
     </command>
-        <inputs>
+    <inputs>
 
-            <param name="seqdb" type="data" format="fasta" label="Sequence database"/>
+        <param name="seqdb" type="data" format="fasta" label="Sequence database"/>
 
-            <conditional name="cm_opts">
-                <param name="cm_opts_selector" type="select" label="Subject covariance models">
-                  <option value="db" selected="True">Locally installed covariance models</option>
-                  <option value="histdb">Covariance model from your history</option>
+        <conditional name="cm_opts">
+            <param name="cm_opts_selector" type="select" label="Subject covariance models">
+              <option value="db" selected="True">Locally installed covariance models</option>
+              <option value="histdb">Covariance model from your history</option>
+            </param>
+            <when value="db">
+                <param name="database" type="select" label="Covariance models">
+                    <options from_file="infernal.loc">
+                      <column name="value" index="0"/>
+                      <column name="name" index="1"/>
+                      <column name="path" index="2"/>
+                    </options>
                 </param>
-                <when value="db">
-                    <param name="database" type="select" label="Covariance models">
-                        <options from_file="infernal.loc">
-                          <column name="value" index="0"/>
-                          <column name="name" index="1"/>
-                          <column name="path" index="2"/>
-                        </options>
-                    </param>
-                </when>
-                <when value="histdb">
-                    <param name="cmfile" type="data" format="cm" label="Covariance models file from the history."/>
-                </when>
-            </conditional>
+            </when>
+            <when value="histdb">
+                <param name="cmfile" type="data" format="cm" label="Covariance models file from the history."/>
+            </when>
+        </conditional>
+
+        <param argument="-g" truevalue="-g" falsevalue="" checked="False" type="boolean"
+            label="Turn on the glocal alignment algorithm" help="... global with respect to the query model and local with respect to the target database."/>
+        <param argument="-Z" type="float" min="0" optional="true" label="Calculate E-values as if the search space size is 'x' megabases (Mb)" help=""/>
+
+        <param argument="--bottomonly" truevalue="--bottomonly" falsevalue="" checked="False" type="boolean"
+            label="Only search the bottom (Crick) strand of target sequences" help="in the sequence database"/>
+        <param argument="--toponly" truevalue="--toponly" falsevalue="" checked="False" type="boolean"
+            label="Only search the top (Watson) strand of target sequences" help="in the sequence database"/>
+
+        <param argument="--cyk" truevalue="--cyk" falsevalue="" checked="False" type="boolean"
+            label="Use the CYK algorithm, not Inside, to determine the final score of all hits" help=""/>
+        <param argument="--acyk" truevalue="--cyk" falsevalue="" checked="False" type="boolean"
+            label="Use the CYK algorithm to align hits" help="By default, the Durbin/Holmes optimal accuracy algorithm is used, which finds the alignment that maximizes the expected accuracy of all aligned residues."/>
 
-            <param name="g" truevalue="-g" falsevalue="" checked="False" type="boolean"
-                label="Turn on the glocal alignment algorithm" help="... global with respect to the query model and local with respect to the target database."/>
-
-            <param name="bottomonly" truevalue="--bottomonly" falsevalue="" checked="False" type="boolean"
-                label="Only search the bottom (Crick) strand of target sequences" help="in the sequence database"/>
-            <param name="toponly" truevalue="--toponly" falsevalue="" checked="False" type="boolean"
-                label="Only search the top (Watson) strand of target sequences" help="in the sequence database"/>
-
-            <param name="cyk" truevalue="--cyk" falsevalue="" checked="False" type="boolean"
-                label="Use the CYK algorithm, not Inside, to determine the final score of all hits" help=""/>
-            <param name="--acyk" truevalue="--cyk" falsevalue="" checked="False" type="boolean"
-                label="Use the CYK algorithm to align hits" help="By default, the Durbin/Holmes optimal accuracy algorithm is used, which finds the alignment that maximizes the expected accuracy of all aligned residues."/>
+        <param argument="--notrunc" truevalue="--notrunc" falsevalue="" checked="False" type="boolean"
+            label="Skip truncated hit detection" help=""/>
+        <param argument="--anytrunc" truevalue="--anytrunc" falsevalue="" checked="false" type="boolean"
+            label="Allow full and truncated hits anywhere within sequences" help=""/>
+        <param argument="--nonull3" truevalue="--nonull3" falsevalue="" checked="false" type="boolean"
+            label="Turn off the null3 CM score corrections for biased composition" help="This correction is not used during the HMM filter stages."/>
+        <param argument="--mxsize" type="float" value="128.0" min="0.1"
+            label="Set the maximum allowable CM DP matrix size to 'x' megabytes" help=""/>
+        <param argument="--smxsize" type="float" value="128.0" min="0.1"
+            label="Set the maximum allowable CM search DP matrix size to 'x' megabytes." help=""/>
 
-            <param name="notrunc" truevalue="--notrunc" falsevalue="" checked="False" type="boolean"
-                label="Turn off truncated hit detection" help=""/>
-
-            <!-- accelleration pipeline -->
-
-            <param name="max" truevalue="--max" falsevalue="" checked="False" type="boolean"
-                label="Turn off all filters, and run non-banded Inside on every full-length target sequence" help="This
-                increases sensitivity somewhat, at an extremely large cost in speed."/>
-
-            <param name="nohmm" truevalue="--nohmm" falsevalue="" checked="False" type="boolean"
-                label="Turn off all HMM filter stages " help=""/>
-
-            <param name="mid" truevalue="--mid" falsevalue="" checked="False" type="boolean"
-                label="Turn off the HMM SSV and Viterbi filter stages" help=""/>
+        <!-- accelleration pipeline -->
+        <conditional name="acceleration_huristics">
+            <param name="acceleration_huristics_selector" type="select" label="Options controlling acceleration heuristics" help="These options are, in order from least strict (slowest but most sensitive) to most strict (fastest but least sensitive)">
+                <option value="--max">Turn all heuristic filters off (--max)</option>
+                <option value="--nohmm">Skip all HMM filter stages, use only CM (--nohmm)</option>
+                <option value="--mid">Skip first two HMM filter stages (SSV and Vit) (--mid)</option>
+                <option value="--default" selected="true">Run search space size-dependent pipeline (--default)</option>
+                <option value="--rfam">Use a strict filtering strategy devised for large databases (more than 20 Gb) (--rfam)</option>
+                <option value="--hmmonly">Use HMM only, don't use a CM at all (--hmmonly)</option>
+                <option value="FZ">set filters to defaults used for a search space of size 'x' Mb (--FZ)</option>
+            </param>
+            <when value="--max">
+            </when>
+            <when value="--nohmm">
+            </when>
+            <when value="--mid">
+                    <param argument="--Fmid" type="float" value="0.02" label="P-value threshold for HMM stages"/>
+            </when>
+            <when value="--default">
+            </when>
+            <when value="--rfam">
+            </when>
+            <when value="--hmmonly">
+            </when>
+            <when value="FZ">
+                <param argument="--FZ" type="float" value="" label="Size of search space in Mb"/>
+            </when>
+        </conditional>
 
 
-            <!-- Options for model-specific score thresholding -->
-            <!--
-            <param name="bitscore_thresholds" type="select" label="Bit score thresholds" help="Curated CM databases may define specific bit score thresholds for each CM, superseding any thresholding based on statistical significance alone.">
-                <option value="" selected="true">None</option>
-                <option value=" - -cut_ga">GA (gathering) bit scores</option>
-                <option value=" - -cut_nc">NC (noise cutoff) bit score</option>
-                <option value=" - -cut_tc">TC (trusted cutoff) bit score</option>
+
+        <!-- Options for model-specific score thresholding -->
+
+        <section name="model_thresholds" title="Options controlling model-specific reporting thresholds" help="Curated CM databases may define specific bit score thresholds for each CM, superseding any thresholding based on statistical significance alone.">
+            <param argument="--cut_ga" truevalue="--cut_ga" falsevalue="" checked="false" type="boolean"
+                label="Use CM's GA gathering cutoffs as reporting thresholds" help="GA thresholds are generally considered to be the reliable curated thresholds defining family membership"/>
+            <param argument="--cut_nc" truevalue="--cut_nc" falsevalue="" checked="false" type="boolean"
+                label="use CM's NC noise cutoffs as reporting thresholds" help="NC thresholds are generally considered to be the score of the highest-scoring known false positive."/>
+            <param argument="--cut_tc" truevalue="--cut_tc" falsevalue="" checked="false" type="boolean"
+                label="use CM's TC trusted cutoffs as reporting thresholds" help="TC thresholds are generally considered to be the score of the lowest-scoring known true positive that is above all known false positives."/>
+        </section>
+
+        <!-- Options for inclusion thresholds -->
+        <conditional name="inclusion_thresholds_opts">
+            <param name="inclusion_thresholds_selector" type="select" label="Inclusion thresholds"
+            help="Inclusion thresholds are stricter than reporting thresholds. Inclusion thresholds control which hits are considered to be reliable enough to be included in an output alignment or in a possible subsequent search round, or marked as significant (”!”) as opposed to questionable (”?”) in hit output.">
+                <option value="" selected="true">default</option>
+                <option value="--incE">Use E-value</option>
+                <option value="--incT">Use bit score</option>
             </param>
-            -->
-            <!-- Options for inclusion thresholds -->
-
-
-            <conditional name="inclusion_thresholds_opts">
-                <param name="inclusion_thresholds_selector" type="select" label="Inclusion thresholds"
-                help="Inclusion thresholds are stricter than reporting thresholds. Inclusion thresholds control which hits are considered to be reliable enough to be included in an output alignment or in a possible subsequent search round, or marked as significant (”!”) as opposed to questionable (”?”) in hit output.">
-                    <option value="" selected="true">default</option>
-                    <option value="--incE">Use E-value</option>
-                    <option value="--incT">Use bit score</option>
+            <when value=""/>
+            <when value="--incE">
+                <param name="incE" type="float" value="0.01" label="Use E-value" help="of &lt;= X as the hit inclusion threshold.">
+                    <sanitizer>
+                        <valid initial="string.printable">
+                            <remove value="&apos;"/>
+                        </valid>
+                    </sanitizer>
+                </param>
+            </when>
+            <when value="--incT">
+                <param name="incT" type="integer" value="0" label="Use bit score" help="of >= X as the hit inclusion threshold.">
+                    <sanitizer>
+                        <valid initial="string.printable">
+                            <remove value="&apos;"/>
+                        </valid>
+                    </sanitizer>
                 </param>
-                <when value=""/>
-                <when value="--incE">
-                    <param name="incE" type="float" value="0.01" label="Use E-value" help="of &lt;= X as the hit inclusion threshold.">
-                        <sanitizer>
-                            <valid initial="string.printable">
-                                <remove value="&apos;"/>
-                            </valid>
-                        </sanitizer>
-                    </param>
-                </when>
-                <when value="--incT">
-                    <param name="incT" type="integer" value="0" label="Use bit score" help="of >= X as the hit inclusion threshold.">
-                        <sanitizer>
-                            <valid initial="string.printable">
-                                <remove value="&apos;"/>
-                            </valid>
-                        </sanitizer>
-                    </param>
-                </when>
-            </conditional>
+            </when>
+        </conditional>
 
-            <!-- Options controlling reporting thresholds -->
+        <!-- Options controlling reporting thresholds -->
 
-            <conditional name="reporting_thresholds_opts">
-                <param name="reporting_thresholds_selector" type="select" label="reporting thresholds"
-                help="Reporting thresholds control which hits are reported in output files">
-                    <option value="" selected="true">default</option>
-                    <option value="-E">Use E-value</option>
-                    <option value="-T">Use bit score</option>
+        <conditional name="reporting_thresholds_opts">
+            <param name="reporting_thresholds_selector" type="select" label="reporting thresholds"
+            help="Reporting thresholds control which hits are reported in output files">
+                <option value="" selected="true">default</option>
+                <option value="-E">Use E-value</option>
+                <option value="-T">Use bit score</option>
+            </param>
+            <when value=""/>
+            <when value="-E">
+                <param name="E" type="float" value="10.0" label="Use E-value" help="of &lt;= X as the hit reporting threshold. The default is 10.0, meaning that on average, about 10 false positives will be reported per query, so you can see the top of the noise and decide for yourself if it’s really noise.">
+                    <sanitizer>
+                        <valid initial="string.printable">
+                            <remove value="&apos;"/>
+                        </valid>
+                    </sanitizer>
                 </param>
-                <when value=""/>
-                <when value="-E">
-                    <param name="E" type="float" value="10.0" label="Use E-value" help="of &lt;= X as the hit reporting threshold. The default is 10.0, meaning that on average, about 10 false positives will be reported per query, so you can see the top of the noise and decide for yourself if it’s really noise.">
-                        <sanitizer>
-                            <valid initial="string.printable">
-                                <remove value="&apos;"/>
-                            </valid>
-                        </sanitizer>
-                    </param>
-                </when>
-                <when value="-T">
-                    <param name="T" type="integer" value="0" label="Use bit score" help="of >= X as the hit reporting threshold.">
-                        <sanitizer>
-                            <valid initial="string.printable">
-                                <remove value="&apos;"/>
-                            </valid>
-                        </sanitizer>
-                    </param>
-                </when>
-            </conditional>
+            </when>
+            <when value="-T">
+                <param name="T" type="integer" value="0" label="Use bit score" help="of >= X as the hit reporting threshold.">
+                    <sanitizer>
+                        <valid initial="string.printable">
+                            <remove value="&apos;"/>
+                        </valid>
+                    </sanitizer>
+                </param>
+            </when>
+        </conditional>
 
-            <param name="A" truevalue="-A" falsevalue="" checked="False" type="boolean"
-                label="Save a multiple alignment of all significant hits" help="... those satisfying inclusion thresholds"/>
-
-        </inputs>
+        <param argument="-A" truevalue="-A" falsevalue="" checked="False" type="boolean"
+            label="Save a multiple alignment of all significant hits" help="... those satisfying inclusion thresholds"/>
+        <param argument="--noali" type="boolean" truevalue="--noali" falsevalue="" checked="false"
+            label="Omit the alignment section from the main input" help="This can greatly reduce the output volume"/>
+        <param argument="--verbose" type="boolean" truevalue="--verbose" falsevalue="" checked="false"
+            label="Include extra search pipeline statistics in the main output" help="They include filter survival statistics for truncated hit detection and number of envelopes discarded due to matrix size overflows."/>
+    </inputs>
     <outputs>
 
         <data format="tabular" name="outfile" label="cmsearch on ${on_string}"/>
@@ -196,6 +239,18 @@
         </data>
 
     </outputs>
+    <tests>
+        <test>
+            <conditional name="cm_opts">
+                <param name="cm_opts_selector" value="histdb"/>
+                <param name="cmfile" value="cmsearch_input1.cm"/>
+            </conditional>
+            <param name="seqdb" value="cmsearch_input2.fa"/>
+            <output name="outfile" file="cmsearch_result.tabular"/>
+
+        </test>
+    </tests>
+
     <help>
 <![CDATA[
 
@@ -210,7 +265,7 @@
 
 **Input**
 
-The CM query file must have been calibrated for E-values with cmcalibrate. As a special exception, any models CM query files that have zero basepairs need not be calibrated. 
+The CM query file must have been calibrated for E-values with cmcalibrate. As a special exception, any models CM query files that have zero basepairs need not be calibrated.
 
 
 **Options**
@@ -223,67 +278,60 @@
 
 - *Use the CYK algorithm, not Inside, to determine the final score of all hits*: If selecting "yes", the CYK algorithm instead of the CM Inside algorithm (the SCFG analog of the HMM Forward algorithm) is used.
 
-- *Use the CYK algorithm to align hits*: By default, the Durbin/Holmes optimal accuracy algo-
-rithm is used, which finds the alignment that maximizes the expected accuracy of all aligned
-residues.
+- *Use the CYK algorithm to align hits*: By default, the Durbin/Holmes optimal accuracy algorithm is used, which finds the alignment that maximizes the expected accuracy of all aligned residues.
 
 - *Turn off truncated hit detection*: Turns off truncated hit detection and will reduce the running time most significantly for target files that include many short sequences.
 
-- *Turn off all filters, and run non-banded Inside on every full-length target sequence*: This
-increases sensitivity somewhat, at an extremely large cost in speed.
+- *Turn off all filters, and run non-banded Inside on every full-length target sequence*: This increases sensitivity somewhat, at an extremely large cost in speed.
 
 - *Turn off all HMM filter stages*: The CYK filter, using QDBs, will be run on every full-length target sequence and will enforce a P-value threshold of 0.0001. Each subsequence that survives CYK will be passed to Inside, which will also use QDBs (but a looser set). This increases sensitivity somewhat, at a very large cost in speed.
 
--*Turn off the HMM SSV and Viterbi filter stages*:Sets remaining HMM filter
-thresholds to 0.02 by default. This may increase sensitivity, at a significant cost in speed.
+- *Turn off the HMM SSV and Viterbi filter stages*:Sets remaining HMM filter thresholds to 0.02 by default. This may increase sensitivity, at a significant cost in speed.
 
-- *Inclusion thresholds*: *Use E-value* - Use an E-value as the hit inclusion threshold. The default is 0.01, meaning that on average, about 1 false positive would be expected in every 100 searches with different
-query sequences. *Use Bit Score* - Instead of using E-values for setting the inclusion threshold, instead use a bit score as the hit inclusion threshold. By default this option is unset.
+- *Inclusion thresholds*: *Use E-value* - Use an E-value as the hit inclusion threshold. The default is 0.01, meaning that on average, about 1 false positive would be expected in every 100 searches with different query sequences. *Use Bit Score* - Instead of using E-values for setting the inclusion threshold, instead use a bit score as the hit inclusion threshold. By default this option is unset.
 
 
 **Output Options**
 
-- *reporting thresholds*: Hits are ranked by statistical significance (E-value). By *default*, all hits with an E-value <= 10 are reported. The following options allow you to change the default *E-value* reporting thresholds, or to use *bit score* thresholds instead. 
-
-
-Output Example:
+- *reporting thresholds*: Hits are ranked by statistical significance (E-value). By *default*, all hits with an E-value <= 10 are reported. The following options allow you to change the default *E-value* reporting thresholds, or to use *bit score* thresholds instead.
 
 
-# cmsearch :: search CM(s) against a sequence database
-# INFERNAL 1.1.1 (July 2014)
-# Copyright (C) 2014 Howard Hughes Medical Institute.
-# Freely distributed under the GNU General Public License (GPLv3).
-# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
-# query CM file:                         tRNA5.cm
-# target sequence database:              tutorial/mrum-genome.fa
-# number of worker threads:              8
-# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+Output columns:
+
+(1)  rank
+
+(2)  E-value
+
+(3)  score
+
+(4)  bias
+
+(5)  sequence
+
+(6)  start
+
+(7)  end
+
+(8)  mdl
+
+(9)  trunc
+
+(10)  gc
+
+(11)  description
+
+----   --------- ------ -----  ----------- ------- -------   --- ----- ----  -----------
+
+!   1.3e-18   71.5   0.0  NC_013790.1  362026  361955 -  cm    no 0.50  Methanobrevibacter ruminantium M1
+
+!   3.3e-18   70.2   0.0  NC_013790.1 2585265 2585193 -  cm    no 0.60  Methanobrevibacter ruminantium M1
 
 
-The second section is a list of ranked top hits (sorted by E-value, most significant hit first):
-
-rank     E-value  score  bias  sequence      start     end   mdl trunc   gc  description
-----   --------- ------ -----  ----------- ------- -------   --- ----- ----  -----------
-(1) !   1.3e-18   71.5   0.0  NC_013790.1  362026  361955 -  cm    no 0.50  Methanobrevibacter ruminantium M1 
-(2) !   3.3e-18   70.2   0.0  NC_013790.1 2585265 2585193 -  cm    no 0.60  Methanobrevibacter ruminantium M1 
-
-
-
-For further questions please refere to the Infernal `Userguide <http://selab.janelia.org/software/infernal/Userguide.pdf>`_.
+For further questions please refere to the Infernal `Userguide <http://eddylab.org/infernal/Userguide.pdf>`_.
 
 ]]>
     </help>
-    <citations>
-        <citation type="doi">10.1093/bioinformatics/btt509</citation>
-        <citation type="bibtex">
-            @ARTICLE{bgruening_galaxytools,
-                Author = {Björn Grüning, Cameron Smith, Torsten Houwaart, Nicola Soranzo, Eric Rasche},
-                keywords = {bioinformatics, ngs, galaxy, cheminformatics, rna},
-                title = {{Galaxy Tools - A collection of bioinformatics and cheminformatics tools for the Galaxy environment}},
-                url = {https://github.com/bgruening/galaxytools}
-            }
-        </citation>
-    </citations>
-   
-    
+    <expand macro="citations" />
+
+
 </tool>
--- a/cmstat.xml	Mon Dec 19 15:27:06 2016 -0500
+++ b/cmstat.xml	Sat Jan 21 17:36:57 2017 -0500
@@ -1,30 +1,25 @@
-<tool id="infernal_cmstat" name="Summary statistics" version="1.1.0.1">
-    <description>for covariance model (cmstat)</description>
-    <requirements>
-        <requirement type="package">infernal</requirement>
-        <requirement type="package" version="1.1">infernal</requirement>
-        <requirement type="package" version="8.22">gnu_coreutils</requirement>
-    </requirements>
+<tool id="infernal_cmstat" name="cmstat" version="@VERSION@.0">
+    <description>Summary statistics for covariance model </description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements"/>
+    <expand macro="stdio" />
     <command>
 <![CDATA[
         ## a temp file is needed, because the standard tabular output from infernal is not usefull in Galaxy
         ## it will be converted to a tab delimited file and piped to Galaxy
-        temp_tabular_output=\$(mktemp);
+        ##temp_tabular_output=\$(mktemp);
 
         cmstat
-
             #if str($cm_opts.cm_opts_selector) == "db":
                 $cm_opts.database.fields.path
             #else:
                 $cm_opts.cmfile
             #end if
 
-            > \$temp_tabular_output
-            ;
+            > $outfile
 
-            ## 1. replace all lines starting # (comment lines)
-            ## 2. replace the first 18 spaces with tabs, 18th field is a free text field (can contain spaces)
-            sed -e 's/#.*$//' -e '/^$/d' -e 's/ /\t/g' -e 's/\t/ /18g' \$temp_tabular_output > $outfile
 
 ]]>
     </command>
@@ -51,6 +46,21 @@
     <outputs>
         <data format="tabular" name="outfile" label="cmstat on ${on_string}"/>
     </outputs>
+    <tests>
+        <test>
+            <conditional name="cm_opts">
+                <param name="cm_opts_selector" value="histdb"/>
+                <param name="cmfile" value="cmstat_input.cm"/>
+            </conditional>
+            <output name="outfile" >
+                <assert_contents>
+                    <has_text text="idx"/>
+                    <has_text text="accession"/>
+                    <has_text text="nseq"/>
+                </assert_contents>
+            </output>
+        </test>
+    </tests>
     <help>
 <![CDATA[
 
@@ -86,21 +96,10 @@
      relative entropy, the more the model will rely on structural conservation relative sequence conservation when identifying homologs.
 
 
-For further questions please refere to the Infernal `Userguide <http://selab.janelia.org/software/infernal/Userguide.pdf>`_.
+For further questions please refere to the Infernal `Userguide <http://eddylab.org/infernal/Userguide.pdf>`_.
 
 ]]>
     </help>
-    <citations>
-        <citation type="doi">10.1093/bioinformatics/btt509</citation>
-        <citation type="bibtex">
-            @ARTICLE{bgruening_galaxytools,
-                Author = {Björn Grüning, Cameron Smith, Torsten Houwaart, Nicola Soranzo, Eric Rasche},
-                keywords = {bioinformatics, ngs, galaxy, cheminformatics, rna},
-                title = {{Galaxy Tools - A collection of bioinformatics and cheminformatics tools for the Galaxy environment}},
-                url = {https://github.com/bgruening/galaxytools}
-            }
-        </citation>
-    </citations>
-  
-    
+    <expand macro="citations" />
+
 </tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Sat Jan 21 17:36:57 2017 -0500
@@ -0,0 +1,35 @@
+<macros>
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package">infernal</requirement>
+            <requirement type="package" version="1.1.2">infernal</requirement>
+            <requirement type="package" version="8.22">gnu_coreutils</requirement>
+        </requirements>
+    </xml>
+    <token name="@VERSION@">1.1.2</token>
+    <xml name="stdio">
+        <stdio>
+            <exit_code range="1:" />
+            <exit_code range=":-1" />
+            <regex match="Error:" />
+            <regex match="Exception:" />
+        </stdio>
+    </xml>
+    <xml name="citations">
+        <citations>
+            <citation type="bibtex">@article{Nawrocki15112013,
+author = {Nawrocki, Eric P. and Eddy, Sean R.},
+title = {Infernal 1.1: 100-fold faster RNA homology searches},
+volume = {29},
+number = {22},
+pages = {2933-2935},
+year = {2013},
+doi = {10.1093/bioinformatics/btt509},
+abstract ={Summary: Infernal builds probabilistic profiles of the sequence and secondary structure of an RNA family called covariance models (CMs) from structurally annotated multiple sequence alignments given as input. Infernal uses CMs to search for new family members in sequence databases and to create potentially large multiple sequence alignments. Version 1.1 of Infernal introduces a new filter pipeline for RNA homology search based on accelerated profile hidden Markov model (HMM) methods and HMM-banded CM alignment methods. This enables ∼100-fold acceleration over the previous version and ∼10 000-fold acceleration over exhaustive non-filtered CM searches.Availability: Source code, documentation and the benchmark are downloadable from http://infernal.janelia.org. Infernal is freely licensed under the GNU GPLv3 and should be portable to any POSIX-compliant operating system, including Linux and Mac OS/X. Documentation includes a user’s guide with a tutorial, a discussion of file formats and user options and additional details on methods implemented in the software.Contact: nawrockie@janelia.hhmi.org},
+URL = {http://bioinformatics.oxfordjournals.org/content/29/22/2933.abstract},
+eprint = {http://bioinformatics.oxfordjournals.org/content/29/22/2933.full.pdf+html},
+journal = {Bioinformatics}
+}</citation>
+        </citations>
+    </xml>
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cmalign_input2_tRNA5.c.cm	Sat Jan 21 17:36:57 2017 -0500
@@ -0,0 +1,563 @@
+INFERNAL1/a [1.1.1 | July 2014]
+NAME     tRNA5
+STATES   230
+NODES    61
+CLEN     72
+W        89
+ALPH     RNA
+RF       no
+CONS     yes
+MAP      yes
+DATE     Mon Jun 27 12:35:45 2016
+COM      [1] ./src/cmbuild tRNA5.cm tutorial/tRNA5.sto
+COM      [2] cmcalibrate tRNA5.cm
+PBEGIN   0.05
+PEND     0.05
+WBETA    1e-07
+QDBBETA1 1e-07
+QDBBETA2 1e-15
+N2OMEGA  1.52588e-05
+N3OMEGA  1.52588e-05
+ELSELF   -0.08926734
+NSEQ     5
+EFFN     3.725586
+CKSUM    3535941971
+NULL     0.000  0.000  0.000  0.000 
+EFP7GF   -5.5288 0.72958
+ECMLC    0.85563    -4.01853     2.43520     1600000      300168  0.003998
+ECMGC    0.39437   -17.41037    -4.06685     1600000       77168  0.005183
+ECMLI    0.73047    -3.70982     3.57712     1600000      245977  0.004879
+ECMGI    0.44078   -12.13534    -0.86006     1600000       57603  0.006944
+CM
+                                             [ ROOT    0 ]      -      - - - - -
+     S     0    -1 0     1     4     0     1    89   108  -7.419  -8.664  -0.055  -5.118                 
+    IL     1     1 2     1     4     3    28    90   110  -2.817  -4.319  -0.613  -2.698                  0.000  0.000  0.000  0.000 
+    IR     2     2 3     2     3     4    30    90   110  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR    1 ]      -     74 - a - -
+    MR     3     2 3     5     5     4    32    89   108  -7.593  -0.028  -7.408  -7.620  -8.512          0.474 -1.199  0.305 -0.089 
+     D     4     2 3     5     5     1    24    87   107  -5.352  -0.707  -2.978  -4.409  -2.404         
+    IR     5     5 3     5     5     3    28    89   109  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    2 ]      1     73 g c - -
+    MP     6     5 3    10     6     5    32    88   107  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.831 -2.997 -3.795  0.617 -3.618 -4.452  0.854 -3.918 -3.870  2.837 -4.276 -0.713  1.871 -3.843 -1.175 -2.703 
+    ML     7     5 3    10     6     3    26    86   106  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR     8     5 3    10     6     3    25    86   106  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D     9     5 3    10     6     0    21    84   103  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    10    10 5    10     6     3    27    87   107  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    11    11 6    11     5     3    27    87   107  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    3 ]      2     72 C G - -
+    MP    12    11 6    16     6     5    31    86   105  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -4.097 -3.805 -3.998  0.021 -3.009 -4.646  3.103 -3.661 -3.977  1.529 -4.392 -1.585  0.835 -4.247 -0.625 -2.808 
+    ML    13    11 6    16     6     2    25    84   104  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    14    11 6    16     6     2    25    84   104  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    15    11 6    16     6     0    21    82   101  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    16    16 5    16     6     3    27    85   105  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    17    17 6    17     5     3    27    85   105  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    4 ]      3     71 c g - -
+    MP    18    17 6    22     6     5    29    84   103  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.141 -2.880 -3.222  0.733 -2.762 -4.023  2.237 -3.232 -3.242  1.678 -3.747  0.537  1.616 -3.340 -0.447 -2.158 
+    ML    19    17 6    22     6     2    25    82   102  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    20    17 6    22     6     2    24    82   102  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    21    17 6    22     6     0    20    80    99  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    22    22 5    22     6     3    26    83   103  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    23    23 6    23     5     3    26    83   103  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    5 ]      4     70 g c - -
+    MP    24    23 6    28     6     5    28    82   101  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.477 -2.737 -3.484  0.861 -3.437 -4.224  1.956 -3.685 -3.594  2.509 -4.028  0.683  0.624 -3.528 -1.017 -2.419 
+    ML    25    23 6    28     6     2    24    80   100  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    26    23 6    28     6     2    24    80   100  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    27    23 6    28     6     0    20    78    97  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    28    28 5    28     6     3    25    81   101  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    29    29 6    29     5     3    25    81   101  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    6 ]      5     69 g c - -
+    MP    30    29 6    34     6     5    26    80    99  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -2.565  0.048 -2.684  1.825 -2.755 -3.485  0.996 -3.019 -2.788  2.050 -3.293 -0.374  0.757 -2.774  0.549 -1.819 
+    ML    31    29 6    34     6     2    23    78    98  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    32    29 6    34     6     2    23    78    98  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    33    29 6    34     6     0    19    76    96  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    34    34 5    34     6     2    24    79    99  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    35    35 6    35     5     3    24    79    99  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    7 ]      6     68 c g - -
+    MP    36    35 6    40     6     5    24    78    97  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.250 -3.161 -3.321  0.517 -2.657 -4.117  2.088 -3.215 -3.310  1.474 -3.823 -1.143  2.088 -3.483  0.783 -2.234 
+    ML    37    35 6    40     6     2    22    77    97  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    38    35 6    40     6     2    21    77    96  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    39    35 6    40     6     0    19    75    95  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    40    40 5    40     6     2    23    77    97  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    41    41 6    41     5     2    23    77    97  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    8 ]      7     67 A U - -
+    MP    42    41 6    46     4     4    22    76    95  -7.543  -7.750  -0.035  -6.164                 -3.769 -3.134 -3.802  3.011 -3.544 -4.775  0.728 -3.793 -3.752  0.821 -4.250 -0.784  1.443 -4.133 -1.238 -2.690 
+    ML    43    41 6    46     4     1    21    76    96  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR    44    41 6    46     4     1    20    76    96  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D    45    41 6    46     4     0    19    74    94  -4.568  -4.250  -2.265  -0.520                 
+    IL    46    46 5    46     4     2    22    77    97  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR    47    47 6    47     3     2    21    76    96  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    9 ]      8      - U - - -
+    ML    48    47 6    50     3     2    20    73    93  -8.524  -0.014  -7.178                         -2.549 -2.369 -3.320  1.822 
+     D    49    47 6    50     3     0    18    72    92  -6.174  -1.687  -0.566                         
+    IL    50    50 3    50     3     2    20    75    95  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   10 ]      9      - A - - -
+    ML    51    50 3    53     2     1    19    72    92  -9.006  -0.003                                  1.048 -1.964  0.381 -1.421 
+     D    52    50 3    53     2     0    18    71    91  -8.445  -0.004                                 
+    IL    53    53 3    53     2     1    19    73    93  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ BIF    11 ]      -      - - - - -
+     B    54    53 3   124    55     0    18    71    91                                                 
+                                             [ BEGR   42 ]      -      - - - - -
+     S    55    54 1    56     3     0     0    36    55  -8.524  -0.014  -7.178                         
+    IL    56    56 2    56     3     1     1    39    59  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   43 ]     45      - A - - -
+    ML    57    56 2    59     3     1     1    36    55  -8.524  -0.014  -7.178                          1.385 -1.618 -1.684 -0.412 
+     D    58    56 2    59     3     0     0    35    54  -6.174  -1.687  -0.566                         
+    IL    59    59 3    59     3     1     1    38    57  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   44 ]     46      - G - - -
+    ML    60    59 3    62     3     1     1    35    54  -8.524  -0.014  -7.178                         -2.700 -4.060  1.885 -3.430 
+     D    61    59 3    62     3     0     0    34    53  -6.174  -1.687  -0.566                         
+    IL    62    62 3    62     3     1     1    37    56  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   45 ]     47      - g - - -
+    ML    63    62 3    65     3     1     1    34    52  -8.524  -0.481  -1.832                          0.586 -2.024  0.919 -1.466 
+     D    64    62 3    65     3     0     0    33    52  -6.174  -1.687  -0.566                         
+    IL    65    65 3    65     3     1     1    36    55  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   46 ]     48      - U - - -
+    ML    66    65 3    68     3     1     1    33    51  -8.062  -0.019  -6.716                         -1.668 -1.633 -2.411  1.667 
+     D    67    65 3    68     3     0     0    31    50  -8.417  -0.227  -2.808                         
+    IL    68    68 3    68     3     1     1    35    54  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   47 ]     49      - C - - -
+    ML    69    68 3    71     5     1     1    31    50  -7.593  -0.028  -7.408  -7.620  -8.512         -1.578  1.336 -2.466 -0.059 
+     D    70    68 3    71     5     0     0    30    49  -4.959  -0.803  -4.221  -2.596  -2.508         
+    IL    71    71 3    71     5     1     1    32    51  -2.408  -0.496  -4.087  -5.920  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   48 ]     50     66 C G - -
+    MP    72    71 3    76     6     2     2    30    49  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -4.063 -3.835 -3.975  1.367 -2.984 -4.641  3.137 -3.636 -3.945  0.196 -4.368 -1.641  0.814 -4.253 -0.622 -2.801 
+    ML    73    71 3    76     6     1     1    29    48  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    74    71 3    76     6     1     1    29    48  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    75    71 3    76     6     0     0    27    45  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    76    76 5    76     6     1     1    30    49  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    77    77 6    77     5     1     1    30    49  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   49 ]     51     65 g c - -
+    MP    78    77 6    82     6     2     2    28    47  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.269 -3.002 -3.316  0.607 -2.825 -4.080  1.486 -3.318 -3.360  2.123 -3.845 -0.940  1.986 -3.442  0.799 -2.268 
+    ML    79    77 6    82     6     1     1    27    46  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    80    77 6    82     6     1     1    27    46  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    81    77 6    82     6     0     0    25    44  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    82    82 5    82     6     1     1    28    47  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    83    83 6    83     5     1     1    28    47  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   50 ]     52     64 g c - -
+    MP    84    83 6    88     6     2     2    26    45  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.573 -3.001 -3.543  0.634 -3.168 -4.231  1.794 -3.603 -3.657  2.626 -4.078 -0.813  0.766 -3.618  0.675 -2.477 
+    ML    85    83 6    88     6     1     1    25    44  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    86    83 6    88     6     1     1    25    44  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    87    83 6    88     6     0     0    23    42  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    88    88 5    88     6     1     1    26    45  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    89    89 6    89     5     1     1    26    45  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   51 ]     53     63 g c - -
+    MP    90    89 6    94     6     2     2    24    43  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.680 -2.656 -3.624  1.495 -4.000 -4.305  0.538 -4.011 -3.825  2.937 -4.200 -0.344  1.037 -3.597 -1.457 -2.574 
+    ML    91    89 6    94     6     1     1    24    43  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    92    89 6    94     6     1     1    24    43  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    93    89 6    94     6     0     0    22    41  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    94    94 5    94     6     1     1    24    43  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    95    95 6    95     5     1     1    24    43  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   52 ]     54     62 G C - -
+    MP    96    95 6   100     4     2     2    22    41  -7.543  -7.750  -0.035  -6.164                 -5.814 -3.622 -6.104 -0.561 -6.715 -5.090 -1.814 -6.360 -4.961  3.816 -5.237 -1.382 -2.178 -5.150 -3.925 -4.967 
+    ML    97    95 6   100     4     1     1    24    43  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR    98    95 6   100     4     1     1    23    42  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D    99    95 6   100     4     0     0    22    41  -4.568  -4.250  -2.265  -0.520                 
+    IL   100   100 5   100     4     1     1    25    44  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   101   101 6   101     3     1     1    24    43  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   53 ]     55      - U - - -
+    ML   102   101 6   104     3     1     1    20    38  -8.524  -0.014  -7.178                         -2.549 -2.369 -3.320  1.822 
+     D   103   101 6   104     3     0     0    19    38  -6.174  -1.687  -0.566                         
+    IL   104   104 3   104     3     1     1    23    42  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   54 ]     56      - U - - -
+    ML   105   104 3   107     3     1     1    18    37  -8.524  -0.014  -7.178                         -2.549 -2.369 -3.320  1.822 
+     D   106   104 3   107     3     0     0    18    37  -6.174  -1.687  -0.566                         
+    IL   107   107 3   107     3     1     1    22    41  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   55 ]     57      - C - - -
+    ML   108   107 3   110     3     1     1    17    36  -8.524  -0.014  -7.178                         -3.081  1.849 -3.880 -2.250 
+     D   109   107 3   110     3     0     0    17    35  -6.174  -1.687  -0.566                         
+    IL   110   110 3   110     3     1     1    21    39  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   56 ]     58      - G - - -
+    ML   111   110 3   113     3     1     1    16    34  -8.524  -0.014  -7.178                         -0.198 -2.380  1.409 -1.835 
+     D   112   110 3   113     3     0     0    16    34  -6.174  -1.687  -0.566                         
+    IL   113   113 3   113     3     1     1    20    38  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   57 ]     59      - A - - -
+    ML   114   113 3   116     3     1     1    14    33  -8.524  -0.014  -7.178                          1.878 -3.490 -3.019 -3.147 
+     D   115   113 3   116     3     0     0    15    33  -6.174  -1.687  -0.566                         
+    IL   116   116 3   116     3     1     1    19    37  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   58 ]     60      - U - - -
+    ML   117   116 3   119     3     1     1    13    31  -8.524  -0.014  -7.178                         -1.468 -0.407 -2.235  1.418 
+     D   118   116 3   119     3     0     0    13    32  -6.174  -1.687  -0.566                         
+    IL   119   119 3   119     3     1     1    18    36  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   59 ]     61      - U - - -
+    ML   120   119 3   122     2     1     1     1     1       *   0.000                                 -1.239  0.314 -2.046  1.064 
+     D   121   119 3   122     2     0     0     0     0       *   0.000                                 
+    IL   122   122 3   122     2     1     1    13    28  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ END    60 ]      -      - - - - -
+     E   123   122 3    -1     0     0     0     0     0                                                 
+                                             [ BEGL   12 ]      -      - - - - -
+     S   124    54 1   125     1     0     3    49    68   0.000                                         
+                                             [ BIF    13 ]      -      - - - - -
+     B   125   124 1   126   173     0     3    49    68                                                 
+                                             [ BEGL   14 ]      -      - - - - -
+     S   126   125 1   127     4     0     0    30    48  -0.035  -7.164  -6.572  -7.212                 
+                                             [ MATP   15 ]     10     26 G C - -
+    MP   127   126 1   131     6     2     2    30    48  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -4.768 -3.151 -4.805  0.251 -5.796 -4.949 -0.981 -5.231 -4.514  3.516 -4.857  0.895 -1.246 -4.551 -3.005 -3.683 
+    ML   128   126 1   131     6     1     1    28    47  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   129   126 1   131     6     1     1    28    47  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   130   126 1   131     6     0     0    26    45  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   131   131 5   131     6     1     1    29    48  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   132   132 6   132     5     1     1    29    48  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   16 ]     11     25 c g - -
+    MP   133   132 6   137     6     2     2    28    46  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -4.380 -4.331 -4.172 -0.461 -2.935 -4.679  2.953 -3.697 -4.172 -0.278 -4.524 -2.247  2.367 -4.479 -0.580 -2.998 
+    ML   134   132 6   137     6     1     1    27    45  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   135   132 6   137     6     1     1    26    45  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   136   132 6   137     6     0     0    24    43  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   137   137 5   137     6     1     1    27    46  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   138   138 6   138     5     1     1    27    46  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   17 ]     12     24 g c - -
+    MP   139   138 6   143     6     2     2    26    44  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.838 -2.993 -3.801  0.619 -3.635 -4.454  0.839 -3.930 -3.877  2.852 -4.281 -0.708  1.851 -3.845 -1.190 -2.710 
+    ML   140   138 6   143     6     1     1    25    44  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   141   138 6   143     6     1     1    25    44  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   142   138 6   143     6     0     0    24    42  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   143   143 5   143     6     1     1    26    44  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   144   144 6   144     5     1     1    25    44  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   18 ]     13     23 c g - -
+    MP   145   144 6   149     4     2     2    24    42  -7.543  -7.750  -0.035  -6.164                 -3.454 -3.490 -3.467  0.042 -2.692 -4.152  2.807 -3.318 -3.483  0.166 -3.945 -1.653  0.946 -3.679  1.162  0.637 
+    ML   146   144 6   149     4     1     1    25    44  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR   147   144 6   149     4     1     1    24    43  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D   148   144 6   149     4     0     0    23    42  -4.568  -4.250  -2.265  -0.520                 
+    IL   149   149 5   149     4     1     1    26    45  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   150   150 6   150     3     1     1    25    44  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   19 ]     14      - A - - -
+    ML   151   150 6   153     3     1     1    20    39  -8.524  -0.014  -7.178                          1.878 -3.490 -3.019 -3.147 
+     D   152   150 6   153     3     0     0    20    39  -6.174  -1.687  -0.566                         
+    IL   153   153 3   153     3     1     1    24    43  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   20 ]     15      - g - - -
+    ML   154   153 3   156     3     1     1    19    38  -8.524  -0.014  -7.178                          0.586 -2.024  0.919 -1.466 
+     D   155   153 3   156     3     0     0    19    37  -6.174  -1.687  -0.566                         
+    IL   156   156 3   156     3     1     1    23    42  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   21 ]     16      - U - - -
+    ML   157   156 3   159     3     1     1    18    36  -1.899  -0.464  -7.178                         -1.468 -0.407 -2.235  1.418 
+     D   158   156 3   159     3     0     0    16    35  -6.174  -1.687  -0.566                         
+    IL   159   159 3   159     3     1     1    18    36  -2.374  -0.363  -5.074                          0.000  0.000  0.000  0.000 
+                                             [ MATL   22 ]     18      - G - - -
+    ML   160   159 3   162     3     1     1    16    34  -8.524  -0.014  -7.178                         -2.700 -4.060  1.885 -3.430 
+     D   161   159 3   162     3     0     0    16    35  -6.174  -1.687  -0.566                         
+    IL   162   162 3   162     3     1     1    20    39  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   23 ]     19      - G - - -
+    ML   163   162 3   165     3     1     1    14    33  -8.524  -0.014  -7.178                         -2.700 -4.060  1.885 -3.430 
+     D   164   162 3   165     3     0     0    15    33  -6.174  -1.687  -0.566                         
+    IL   165   165 3   165     3     1     1    19    38  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   24 ]     20      - u - - -
+    ML   166   165 3   168     3     1     1    11    23  -1.854  -0.481  -7.178                         -0.664 -0.325 -0.613  0.939 
+     D   167   165 3   168     3     0     0     9    20  -6.174  -1.687  -0.566                         
+    IL   168   168 3   168     3     1     1    11    22  -2.396  -0.357  -5.096                          0.000  0.000  0.000  0.000 
+                                             [ MATL   25 ]     22      - A - - -
+    ML   169   168 3   171     2     1     1     1     1       *   0.000                                  1.878 -3.490 -3.019 -3.147 
+     D   170   168 3   171     2     0     0     0     0       *   0.000                                 
+    IL   171   171 3   171     2     1     1    13    28  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ END    26 ]      -      - - - - -
+     E   172   171 3    -1     0     0     0     0     0                                                 
+                                             [ BEGR   27 ]      -      - - - - -
+     S   173   125 1   174     3     0     0    32    50  -8.524  -0.014  -7.178                         
+    IL   174   174 2   174     3     1     1    35    54  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   28 ]     27      - g - - -
+    ML   175   174 2   177     5     1     1    31    50  -7.593  -0.028  -7.408  -7.620  -8.512          0.512 -2.047  0.983 -1.490 
+     D   176   174 2   177     5     0     0    30    49  -4.959  -0.803  -4.221  -2.596  -2.508         
+    IL   177   177 3   177     5     1     1    32    51  -2.408  -0.496  -4.087  -5.920  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   29 ]     28     44 c g - -
+    MP   178   177 3   182     6     2     2    30    49  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -2.996 -2.785 -3.094  0.747 -2.684 -3.890  2.204 -3.144 -3.118  1.704 -3.626  0.455  1.175 -3.212  0.643 -2.072 
+    ML   179   177 3   182     6     1     1    29    48  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   180   177 3   182     6     1     1    29    48  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   181   177 3   182     6     0     0    27    45  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   182   182 5   182     6     1     1    30    49  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   183   183 6   183     5     1     1    30    49  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   30 ]     29     43 c g - -
+    MP   184   183 6   188     6     2     2    28    47  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.660 -3.462 -3.663  0.355 -2.818 -4.407  2.681 -3.427 -3.639  1.512 -4.115 -1.306  1.763 -3.844 -0.432 -2.489 
+    ML   185   183 6   188     6     1     1    27    46  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   186   183 6   188     6     1     1    27    46  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   187   183 6   188     6     0     0    25    44  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   188   188 5   188     6     1     1    28    47  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   189   189 6   189     5     1     1    28    47  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   31 ]     30     42 a u - -
+    MP   190   189 6   194     6     2     2    26    45  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.311 -3.146 -3.360  2.221 -2.772 -4.127  2.025 -3.303 -3.378  0.846 -3.868 -1.127  1.693 -3.528 -0.491 -2.313 
+    ML   191   189 6   194     6     1     1    25    44  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   192   189 6   194     6     1     1    25    44  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   193   189 6   194     6     0     0    23    42  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   194   194 5   194     6     1     1    26    45  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   195   195 6   195     5     1     1    26    45  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   32 ]     31     41 g c - -
+    MP   196   195 6   200     6     2     2    24    43  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.453 -2.737 -3.468  0.855 -3.398 -4.215  1.983 -3.656 -3.568  2.448 -4.006  0.791  0.648 -3.520 -0.989 -2.403 
+    ML   197   195 6   200     6     1     1    24    43  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   198   195 6   200     6     1     1    24    43  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   199   195 6   200     6     0     0    22    41  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   200   200 5   200     6     1     1    24    43  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   201   201 6   201     5     1     1    24    43  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   33 ]     32     40 c g - -
+    MP   202   201 6   206     4     2     2    22    41  -7.543  -7.750  -0.035  -6.164                 -3.332 -2.890 -3.380  1.837 -3.037 -4.188  2.208 -3.435 -3.424  1.867 -3.910 -0.719  0.913 -3.503 -0.696 -2.309 
+    ML   203   201 6   206     4     1     1    24    43  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR   204   201 6   206     4     1     1    23    42  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D   205   201 6   206     4     0     0    22    41  -4.568  -4.250  -2.265  -0.520                 
+    IL   206   206 5   206     4     1     1    25    44  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   207   207 6   207     3     1     1    24    43  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   34 ]     33      - c - - -
+    ML   208   207 6   210     3     1     1    20    38  -8.524  -0.014  -7.178                         -1.256  0.893 -2.113  0.579 
+     D   209   207 6   210     3     0     0    19    38  -6.174  -1.687  -0.566                         
+    IL   210   210 3   210     3     1     1    23    42  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   35 ]     34      - U - - -
+    ML   211   210 3   213     3     1     1    18    37  -8.524  -0.014  -7.178                         -2.549 -2.369 -3.320  1.822 
+     D   212   210 3   213     3     0     0    18    37  -6.174  -1.687  -0.566                         
+    IL   213   213 3   213     3     1     1    22    41  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   36 ]     35      - g - - -
+    ML   214   213 3   216     3     1     1    17    36  -8.524  -0.014  -7.178                         -0.763 -1.427  0.837  0.325 
+     D   215   213 3   216     3     0     0    17    35  -6.174  -1.687  -0.566                         
+    IL   216   216 3   216     3     1     1    21    39  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   37 ]     36      - u - - -
+    ML   217   216 3   219     3     1     1    16    34  -8.524  -0.014  -7.178                          0.037 -0.330 -0.381  0.496 
+     D   218   216 3   219     3     0     0    16    34  -6.174  -1.687  -0.566                         
+    IL   219   219 3   219     3     1     1    20    38  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   38 ]     37      - c - - -
+    ML   220   219 3   222     3     1     1    14    33  -8.524  -0.014  -7.178                          0.403  0.783 -1.648 -0.649 
+     D   221   219 3   222     3     0     0    15    33  -6.174  -1.687  -0.566                         
+    IL   222   222 3   222     3     1     1    19    37  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   39 ]     38      - A - - -
+    ML   223   222 3   225     3     1     1    13    31  -8.524  -0.014  -7.178                          1.037 -1.963  0.397 -1.419 
+     D   224   222 3   225     3     0     0    13    32  -6.174  -1.687  -0.566                         
+    IL   225   225 3   225     3     1     1    18    36  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   40 ]     39      - a - - -
+    ML   226   225 3   228     2     1     1     1     1       *   0.000                                  0.957  0.166 -1.522 -0.764 
+     D   227   225 3   228     2     0     0     0     0       *   0.000                                 
+    IL   228   228 3   228     2     1     1    13    28  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ END    41 ]      -      - - - - -
+     E   229   228 3    -1     0     0     0     0     0                                                 
+//
+HMMER3/f [i1.1.1 | July 2014]
+NAME  tRNA5
+LENG  72
+MAXL  152
+ALPH  RNA
+RF    no
+MM    no
+CONS  yes
+CS    yes
+MAP   yes
+DATE  Mon Jun 27 12:35:45 2016
+COM   [1] ./src/cmbuild tRNA5.cm tutorial/tRNA5.sto
+NSEQ  5
+EFFN  4.575195
+CKSUM 3535941971
+STATS LOCAL MSV       -8.3361  0.72958
+STATS LOCAL VITERBI   -9.7423  0.72958
+STATS LOCAL FORWARD   -2.8398  0.72958
+HMM          A        C        G        U   
+            m->m     m->i     m->d     i->m     i->i     d->m     d->d
+  COMPO   1.54533  1.43782  1.21668  1.37396
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  0.00000        *
+      1   2.27104  2.21243  0.67362  1.28194      1 G - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      2   2.71979  0.53764  1.58904  1.92505      2 C - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      3   2.13247  1.12928  1.19870  1.36023      3 c - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      4   2.06386  1.33928  0.73468  2.02995      4 g - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      5   1.11916  2.01343  1.13651  1.51879      5 a - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      6   2.27600  1.26221  1.56184  0.90503      6 u - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      7   0.55854  2.34742  2.06069  1.58488      7 A - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      8   3.41131  3.24840  3.95063  0.09549      8 U - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      9   0.62589  2.93067  1.09257  2.57049      9 A - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     10   2.58478  3.48701  0.15236  3.34349     10 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     11   3.04360  0.66824  2.81745  0.96766     11 C - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     12   2.27167  2.22390  0.66329  1.29638     12 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     13   2.70763  0.72972  2.52177  0.99171     13 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     14   0.06447  4.06946  3.72356  3.85378     14 A - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     15   0.96309  2.96228  0.71023  2.58952     15 g - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     16   2.58013  1.68600  3.11568  0.36438     16 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.36284  1.23646  4.27667  0.09305  2.42079  1.09861  0.40547
+     17   3.50204  4.46790  0.06149  4.01568     18 G - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     18   3.50204  4.46790  0.06149  4.01568     19 G - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     19   1.92921  1.61736  1.81487  0.70632     20 u - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.37560  1.20654  4.27667  0.09038  2.44862  1.09861  0.40547
+     20   0.06447  4.06946  3.72356  3.85378     22 A - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     21   2.10278  2.68978  0.46988  1.68787     23 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     22   1.38592  0.72007  2.05285  2.00384     24 c - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     23   1.05742  2.98038  0.61496  2.79344     25 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     24   3.52889  0.29960  3.29055  1.64863     26 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     25   1.01810  2.97712  0.66580  2.60482     27 G - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     26   2.11085  1.15042  1.18985  1.35443     28 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     27   2.42824  0.83921  1.56647  1.30573     29 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     28   1.09889  1.29935  2.02826  1.33756     30 a - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     29   2.06898  1.31812  0.74979  2.01303     31 g - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     30   1.36950  1.15928  1.31013  1.81850     32 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     31   2.40938  0.72219  3.02139  0.97894     33 c - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     32   3.41131  3.24840  3.95063  0.09549     34 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     33   2.03026  2.49922  0.75131  1.15581     35 g - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     34   1.37091  1.61913  1.64530  1.03536     36 u - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     35   1.09596  0.79030  2.66885  1.94670     37 c - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     36   0.63350  2.92991  1.08102  2.56892     38 A - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     37   0.68448  1.23998  2.57183  2.04128     39 A - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     38   2.05098  1.42195  1.06925  1.24869     40 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     39   2.25157  1.00742  1.23141  1.43664     41 c - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     40   1.49091  2.19537  1.18474  1.02809     42 u - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     41   1.46309  1.66242  0.76188  2.18914     43 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     42   1.84429  1.51321  0.88732  1.56112     44 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     43   0.38710  2.63412  2.69028  1.70743     45 A - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     44   3.50204  4.46790  0.06149  4.01568     46 G - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     45   0.96309  2.96228  0.71023  2.58952     47 g - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.37560  4.27667  1.20654  1.46634  0.26236  1.09861  0.40547
+     46   2.76487  2.70273  3.28806  0.18312     48 U - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.03964  3.94071  3.94071  1.46634  0.26236  0.08877  2.46575
+     47   2.65665  0.41541  3.29031  1.45884     49 C - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     48   1.72807  0.51473  2.49712  1.94920     50 C - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     49   2.23405  1.71156  1.13675  0.93787     51 u - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     50   2.24174  1.47214  0.80734  1.52210     52 g - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     51   1.62002  2.40165  0.60094  1.81254     53 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     52   3.13623  4.03650  0.08313  3.98115     54 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     53   3.41131  3.24840  3.95063  0.09549     55 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     54   3.41131  3.24840  3.95063  0.09549     56 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     55   3.81775  0.07857  4.34279  3.20425     57 C - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     56   1.55092  3.20619  0.37228  2.84263     58 G - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     57   0.06447  4.06946  3.72356  3.85378     59 A - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     58   2.58013  1.68600  3.11568  0.36438     60 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     59   2.39994  1.14144  2.97016  0.61874     61 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     60   4.11656  0.10126  3.89068  2.82057     62 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     61   1.95700  0.67131  2.21870  1.43159     63 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     62   2.18076  0.86710  1.10730  1.99196     64 c - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     63   1.27825  1.21396  1.24116  1.99945     65 c - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     64   2.19639  2.68263  0.47103  1.62938     66 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     65   1.68678  2.30864  2.17351  0.50798     67 U - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     66   1.21618  1.66846  0.95030  2.05201     68 g - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     67   2.09329  1.05549  1.48837  1.19416     69 c - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     68   2.26917  0.96322  1.25225  1.47369     70 c - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     69   1.53154  1.55221  1.02428  1.54664     71 g - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     70   2.18028  1.66521  0.48878  2.47139     72 G - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     71   1.37162  0.72882  2.04389  2.00766     73 c - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     72   1.04988  2.29119  1.14633  1.46503     74 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.01418  4.26268        *  1.46634  0.26236  0.00000        *
+//
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cmalign_input_mrum_tRNAs10.fa	Sat Jan 21 17:36:57 2017 -0500
@@ -0,0 +1,30 @@
+>mrum-tRNA.1
+GGAGCUAUAGCUCAAUGGCAGAGCGUUUGGCUGACAUCCAAAAGGUUAUGGGUUCGAUUC
+CCUUUAGCCCCA
+>mrum-tRNA.2
+GGGCCCGUAGCUCAGUUGGGAGAGCGCUGCCCUUGCAAGGCAGAGGCCCCGGGUUCAAAU
+CCCGGUGGGUCCA
+>mrum-tRNA.3
+GGGCCCAUAGCUUAGCCAGGUAGAGCGCUCGGCUCAUAACCGGGAUGUCAUGGGUUCGAA
+UCCCAUUGGGCCCA
+>mrum-tRNA.4
+AGGCUAGUGGCACAGCCUGGUCAGCGCGCACGGCUGAUAACCGUGAGGUCCUGGGUUCGA
+AUCCCAGCUAGCCUA
+>mrum-tRNA.5
+CCCGACUUAGCUCAAUUUGGCAGAGCGUUGGACUGUAGAUCCAAAUGUUGCUGGUUCAAG
+UCCGGCAGUCGGGA
+>mrum-tRNA.6
+GCUUCUAUGGGGUAAUCGGCAAACCCAUCGGACUUUCGAUCCGAUAAUCCGGGUUCAAAU
+CCCGGUAGAAGCA
+>mrum-tRNA.7
+GCUCCGAUGGUGUAGUCCGGCCAAUCAUUUCGGCCUUUCGAGCCGAAGACUCGGGUUCGA
+AUCCCGGUCGGAGCA
+>mrum-tRNA.8
+GCGGUGUUAGUCCAGCCUGGUUAAGACUCUAGCCUGCCACGUUAGAGACCCGGGUUCAAA
+UCCCGGACGCCGCA
+>mrum-tRNA.9
+GCCGGGGUGGCUCAGCUGGUUAGAGCGCACGGCUCAUAGGGUAACUAAGCGUGCUCUGAC
+UUUUUUCCUGGGAUACCGUGAGAUCGCGGGUUCGAAUCCCGCCCCCGGCA
+>mrum-tRNA.10
+GGUUCUAUAGUUUAACAGGUAAAACAACUGGCUGUUAACCGGCAGAUAGGAGUUCGAAUC
+UUCUUAGAACCG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cmalign_result_mrum-tRNAs10.out	Sat Jan 21 17:36:57 2017 -0500
@@ -0,0 +1,26 @@
+# STOCKHOLM 1.0
+#=GF AU Infernal 1.1
+
+mrum-tRNA.1          GGAGCUAUAGCUCAAU..GGC..AGAGCGUUUGGCUGACAU........................................CCAAAAGGUUAUGGGUUCGAUUCCCUUUAGCCCCA
+#=GR mrum-tRNA.1  PP ****************..***..******************........................................***********************************
+mrum-tRNA.2          GGGCCCGUAGCUCAGU.uGGG..AGAGCGCUGCCCUUGCAA........................................GGCAGAGGCCCCGGGUUCAAAUCCCGGUGGGUCCA
+#=GR mrum-tRNA.2  PP ****************.****..******************........................................***********************************
+mrum-tRNA.3          GGGCCCAUAGCUUAGCcaGGU..AGAGCGCUCGGCUCAUAA........................................CCGGGAUGUCAUGGGUUCGAAUCCCAUUGGGCCCA
+#=GR mrum-tRNA.3  PP *********************..******************........................................***********************************
+mrum-tRNA.4          AGGCUAGUGGCACAGCcuGGU.cAGCGCGCACGGCUGAUAA........................................CCGUGAGGUCCUGGGUUCGAAUCCCAGCUAGCCUA
+#=GR mrum-tRNA.4  PP ***************999***.*******************........................................***********************************
+mrum-tRNA.5          CCCGACUUAGCUCAAUuuGGC..AGAGCGUUGGACUGUAGA........................................UCCAAAUGUUGCUGGUUCAAGUCCGGCAGUCGGGA
+#=GR mrum-tRNA.5  PP *********************..******************........................................***********************************
+mrum-tRNA.6          GCUUCUAUGGGGUAAU.cGGC.aAACCCAUCGGACUUUCGA........................................UCCGAUAA-UCCGGGUUCAAAUCCCGGUAGAAGCA
+#=GR mrum-tRNA.6  PP ****************.****.*******************........................................********.9*************************
+mrum-tRNA.7          GCUCCGAUGGUGUAGUccGGCcaAUCAUUUCGGCCUUUCGA........................................GCCGAAGA-CUCGGGUUCGAAUCCCGGUCGGAGCA
+#=GR mrum-tRNA.7  PP ********************9999*****************........................................********.**************************
+mrum-tRNA.8          GCGGUGUUAGUCCAGCcuGGU.uAAGACUCUAGCCUGCCAC........................................GUUAGAGA-CCCGGGUUCAAAUCCCGGACGCCGCA
+#=GR mrum-tRNA.8  PP ***************999***.*******************........................................********.**************************
+mrum-tRNA.9          GCCGGGGUGGCUCAGC.uGGU.uAGAGCGCACGGCUC----auaggguaacuaagcgugcucugacuuuuuuccugggauaCCGUGAGAUCGCGGGUUCGAAUCCCGCCCCCGGCA
+#=GR mrum-tRNA.9  PP ****************.****.************995....678************************************************************************
+mrum-tRNA.10         GGUUCUAUAGUUUAAC.aGGU..AAAACAACUGGCUGUUAA........................................CCGGCAGA-UAGGAGUUCGAAUCUUCUUAGAACCG
+#=GR mrum-tRNA.10 PP ****************.****..******************........................................********.9*************************
+#=GC SS_cons         (((((((,,<<<<___..___.._>>>>,<<<<<_______~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~>>>>>,,,,,<<<<<_______>>>>>))))))):
+#=GC RF              gCcggcAUAGcgcAgU..GGu..AgcgCgccagccUgucAa~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~gcuggAGgUCCgggGUUCGAUUCcccGUgccgGca
+//
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cmalignoutput	Sat Jan 21 17:36:57 2017 -0500
@@ -0,0 +1,26 @@
+# STOCKHOLM 1.0
+#=GF AU Infernal 1.1.2
+
+mrum-tRNA.1          GGAGCUAUAGCUCAAU..GGC..AGAGCGUUUGGCUGACAU........................................CCAAAAGGUUAUGGGUUCGAUUCCCUUUAGCCCCA
+#=GR mrum-tRNA.1  PP ****************..***..******************........................................***********************************
+mrum-tRNA.2          GGGCCCGUAGCUCAGU.uGGG..AGAGCGCUGCCCUUGCAA........................................GGCAGAGGCCCCGGGUUCAAAUCCCGGUGGGUCCA
+#=GR mrum-tRNA.2  PP ****************.****..******************........................................***********************************
+mrum-tRNA.3          GGGCCCAUAGCUUAGCcaGGU..AGAGCGCUCGGCUCAUAA........................................CCGGGAUGUCAUGGGUUCGAAUCCCAUUGGGCCCA
+#=GR mrum-tRNA.3  PP *********************..******************........................................***********************************
+mrum-tRNA.4          AGGCUAGUGGCACAGCcuGGU.cAGCGCGCACGGCUGAUAA........................................CCGUGAGGUCCUGGGUUCGAAUCCCAGCUAGCCUA
+#=GR mrum-tRNA.4  PP ***************999***.*******************........................................***********************************
+mrum-tRNA.5          CCCGACUUAGCUCAAUuuGGC..AGAGCGUUGGACUGUAGA........................................UCCAAAUGUUGCUGGUUCAAGUCCGGCAGUCGGGA
+#=GR mrum-tRNA.5  PP *********************..******************........................................***********************************
+mrum-tRNA.6          GCUUCUAUGGGGUAAU.cGGC.aAACCCAUCGGACUUUCGA........................................UCCGAUAA-UCCGGGUUCAAAUCCCGGUAGAAGCA
+#=GR mrum-tRNA.6  PP ****************.****.*******************........................................********.9*************************
+mrum-tRNA.7          GCUCCGAUGGUGUAGUccGGCcaAUCAUUUCGGCCUUUCGA........................................GCCGAAGA-CUCGGGUUCGAAUCCCGGUCGGAGCA
+#=GR mrum-tRNA.7  PP ********************9999*****************........................................********.**************************
+mrum-tRNA.8          GCGGUGUUAGUCCAGCcuGGU.uAAGACUCUAGCCUGCCAC........................................GUUAGAGA-CCCGGGUUCAAAUCCCGGACGCCGCA
+#=GR mrum-tRNA.8  PP ***************999***.*******************........................................********.**************************
+mrum-tRNA.9          GCCGGGGUGGCUCAGC.uGGU.uAGAGCGCACGGCUC----auaggguaacuaagcgugcucugacuuuuuuccugggauaCCGUGAGAUCGCGGGUUCGAAUCCCGCCCCCGGCA
+#=GR mrum-tRNA.9  PP ****************.****.************995....678************************************************************************
+mrum-tRNA.10         GGUUCUAUAGUUUAAC.aGGU..AAAACAACUGGCUGUUAA........................................CCGGCAGA-UAGGAGUUCGAAUCUUCUUAGAACCG
+#=GR mrum-tRNA.10 PP ****************.****..******************........................................********.9*************************
+#=GC SS_cons         (((((((,,<<<<___..___.._>>>>,<<<<<_______~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~>>>>>,,,,,<<<<<_______>>>>>))))))):
+#=GC RF              gCcggcAUAGcgcAgU..GGu..AgcgCgccagccUgucAa~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~gcuggAGgUCCgggGUUCGAUUCcccGUgccgGca
+//
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cmbuild_input_tRNA5.sto	Sat Jan 21 17:36:57 2017 -0500
@@ -0,0 +1,16 @@
+# STOCKHOLM 1.0
+
+tRNA1             GCGGAUUUAGCUCAGUUGGG.AGAGCGCCAGACUGAAGAUCUGGAGGUCC
+tRNA2             UCCGAUAUAGUGUAAC.GGCUAUCACAUCACGCUUUCACCGUGGAGA.CC
+tRNA3             UCCGUGAUAGUUUAAU.GGUCAGAAUGGGCGCUUGUCGCGUGCCAGA.UC
+tRNA4             GCUCGUAUGGCGCAGU.GGU.AGCGCAGCAGAUUGCAAAUCUGUUGGUCC
+tRNA5             GGGCACAUGGCGCAGUUGGU.AGCGCGCUUCCCUUGCAAGGAAGAGGUCA
+#=GC SS_cons      <<<<<<<..<<<<.........>>>>.<<<<<.......>>>>>.....<
+
+tRNA1             UGUGUUCGAUCCACAGAAUUCGCA
+tRNA2             GGGGUUCGACUCCCCGUAUCGGAG
+tRNA3             GGGGUUCAAUUCCCCGUCGCGGAG
+tRNA4             UUAGUUCGAUCCUGAGUGCGAGCU
+tRNA5             UCGGUUCGAUUCCGGUUGCGUCCA
+#=GC SS_cons      <<<<.......>>>>>>>>>>>>.
+//
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cmbuild_results.cm	Sat Jan 21 17:36:57 2017 -0500
@@ -0,0 +1,558 @@
+INFERNAL1/a [1.1.2 | July 2016]
+NAME     dataset_743
+STATES   230
+NODES    61
+CLEN     72
+W        89
+ALPH     RNA
+RF       no
+CONS     yes
+MAP      yes
+DATE     Wed Nov  2 15:35:29 2016
+COM      [1] cmbuild -F --fast --symfrac 0.5 --wpb --p7ere 0.38 --EmN 200 --EvN 200 --ElfN 200 --EgfN 200 --eent --refine /dev/null /home/wanli/galaxy/database/files/000/dataset_750.dat /home/wanli/galaxy/database/files/000/dataset_743.dat
+PBEGIN   0.05
+PEND     0.05
+WBETA    1e-07
+QDBBETA1 1e-07
+QDBBETA2 1e-15
+N2OMEGA  1.52588e-05
+N3OMEGA  1.52588e-05
+ELSELF   -0.08926734
+NSEQ     5
+EFFN     3.725586
+CKSUM    3535941971
+NULL     0.000  0.000  0.000  0.000 
+EFP7GF   -5.5288 0.72958
+CM
+                                             [ ROOT    0 ]      -      - - - - -
+     S     0    -1 0     1     4     0     1    89   108  -7.419  -8.664  -0.055  -5.118                 
+    IL     1     1 2     1     4     3    28    90   110  -2.817  -4.319  -0.613  -2.698                  0.000  0.000  0.000  0.000 
+    IR     2     2 3     2     3     4    30    90   110  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR    1 ]      -     74 - a - -
+    MR     3     2 3     5     5     4    32    89   108  -7.593  -0.028  -7.408  -7.620  -8.512          0.474 -1.199  0.305 -0.089 
+     D     4     2 3     5     5     1    24    87   107  -5.352  -0.707  -2.978  -4.409  -2.404         
+    IR     5     5 3     5     5     3    28    89   109  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    2 ]      1     73 g c - -
+    MP     6     5 3    10     6     5    32    88   107  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.831 -2.997 -3.795  0.617 -3.618 -4.452  0.854 -3.918 -3.870  2.837 -4.276 -0.713  1.871 -3.843 -1.175 -2.703 
+    ML     7     5 3    10     6     3    26    86   106  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR     8     5 3    10     6     3    25    86   106  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D     9     5 3    10     6     0    21    84   103  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    10    10 5    10     6     3    27    87   107  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    11    11 6    11     5     3    27    87   107  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    3 ]      2     72 C G - -
+    MP    12    11 6    16     6     5    31    86   105  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -4.097 -3.805 -3.998  0.021 -3.009 -4.646  3.103 -3.661 -3.977  1.529 -4.392 -1.585  0.835 -4.247 -0.625 -2.808 
+    ML    13    11 6    16     6     2    25    84   104  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    14    11 6    16     6     2    25    84   104  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    15    11 6    16     6     0    21    82   101  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    16    16 5    16     6     3    27    85   105  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    17    17 6    17     5     3    27    85   105  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    4 ]      3     71 c g - -
+    MP    18    17 6    22     6     5    29    84   103  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.141 -2.880 -3.222  0.733 -2.762 -4.023  2.237 -3.232 -3.242  1.678 -3.747  0.537  1.616 -3.340 -0.447 -2.158 
+    ML    19    17 6    22     6     2    25    82   102  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    20    17 6    22     6     2    24    82   102  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    21    17 6    22     6     0    20    80    99  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    22    22 5    22     6     3    26    83   103  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    23    23 6    23     5     3    26    83   103  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    5 ]      4     70 g c - -
+    MP    24    23 6    28     6     5    28    82   101  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.477 -2.737 -3.484  0.861 -3.437 -4.224  1.956 -3.685 -3.594  2.509 -4.028  0.683  0.624 -3.528 -1.017 -2.419 
+    ML    25    23 6    28     6     2    24    80   100  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    26    23 6    28     6     2    24    80   100  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    27    23 6    28     6     0    20    78    97  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    28    28 5    28     6     3    25    81   101  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    29    29 6    29     5     3    25    81   101  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    6 ]      5     69 g c - -
+    MP    30    29 6    34     6     5    26    80    99  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -2.565  0.048 -2.684  1.825 -2.755 -3.485  0.996 -3.019 -2.788  2.050 -3.293 -0.374  0.757 -2.774  0.549 -1.819 
+    ML    31    29 6    34     6     2    23    78    98  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    32    29 6    34     6     2    23    78    98  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    33    29 6    34     6     0    19    76    96  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    34    34 5    34     6     2    24    79    99  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    35    35 6    35     5     3    24    79    99  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    7 ]      6     68 c g - -
+    MP    36    35 6    40     6     5    24    78    97  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.250 -3.161 -3.321  0.517 -2.657 -4.117  2.088 -3.215 -3.310  1.474 -3.823 -1.143  2.088 -3.483  0.783 -2.234 
+    ML    37    35 6    40     6     2    22    77    97  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    38    35 6    40     6     2    21    77    96  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    39    35 6    40     6     0    19    75    95  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    40    40 5    40     6     2    23    77    97  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    41    41 6    41     5     2    23    77    97  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    8 ]      7     67 A U - -
+    MP    42    41 6    46     4     4    22    76    95  -7.543  -7.750  -0.035  -6.164                 -3.769 -3.134 -3.802  3.011 -3.544 -4.775  0.728 -3.793 -3.752  0.821 -4.250 -0.784  1.443 -4.133 -1.238 -2.690 
+    ML    43    41 6    46     4     1    21    76    96  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR    44    41 6    46     4     1    20    76    96  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D    45    41 6    46     4     0    19    74    94  -4.568  -4.250  -2.265  -0.520                 
+    IL    46    46 5    46     4     2    22    77    97  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR    47    47 6    47     3     2    21    76    96  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    9 ]      8      - U - - -
+    ML    48    47 6    50     3     2    20    73    93  -8.524  -0.014  -7.178                         -2.549 -2.369 -3.320  1.822 
+     D    49    47 6    50     3     0    18    72    92  -6.174  -1.687  -0.566                         
+    IL    50    50 3    50     3     2    20    75    95  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   10 ]      9      - A - - -
+    ML    51    50 3    53     2     1    19    72    92  -9.006  -0.003                                  1.048 -1.964  0.381 -1.421 
+     D    52    50 3    53     2     0    18    71    91  -8.445  -0.004                                 
+    IL    53    53 3    53     2     1    19    73    93  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ BIF    11 ]      -      - - - - -
+     B    54    53 3   124    55     0    18    71    91                                                 
+                                             [ BEGR   42 ]      -      - - - - -
+     S    55    54 1    56     3     0     0    36    55  -8.524  -0.014  -7.178                         
+    IL    56    56 2    56     3     1     1    39    59  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   43 ]     45      - A - - -
+    ML    57    56 2    59     3     1     1    36    55  -8.524  -0.014  -7.178                          1.385 -1.618 -1.684 -0.412 
+     D    58    56 2    59     3     0     0    35    54  -6.174  -1.687  -0.566                         
+    IL    59    59 3    59     3     1     1    38    57  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   44 ]     46      - G - - -
+    ML    60    59 3    62     3     1     1    35    54  -8.524  -0.014  -7.178                         -2.700 -4.060  1.885 -3.430 
+     D    61    59 3    62     3     0     0    34    53  -6.174  -1.687  -0.566                         
+    IL    62    62 3    62     3     1     1    37    56  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   45 ]     47      - g - - -
+    ML    63    62 3    65     3     1     1    34    52  -8.524  -0.481  -1.832                          0.586 -2.024  0.919 -1.466 
+     D    64    62 3    65     3     0     0    33    52  -6.174  -1.687  -0.566                         
+    IL    65    65 3    65     3     1     1    36    55  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   46 ]     48      - U - - -
+    ML    66    65 3    68     3     1     1    33    51  -8.062  -0.019  -6.716                         -1.668 -1.633 -2.411  1.667 
+     D    67    65 3    68     3     0     0    31    50  -8.417  -0.227  -2.808                         
+    IL    68    68 3    68     3     1     1    35    54  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   47 ]     49      - C - - -
+    ML    69    68 3    71     5     1     1    31    50  -7.593  -0.028  -7.408  -7.620  -8.512         -1.578  1.336 -2.466 -0.059 
+     D    70    68 3    71     5     0     0    30    49  -4.959  -0.803  -4.221  -2.596  -2.508         
+    IL    71    71 3    71     5     1     1    32    51  -2.408  -0.496  -4.087  -5.920  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   48 ]     50     66 C G - -
+    MP    72    71 3    76     6     2     2    30    49  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -4.063 -3.835 -3.975  1.367 -2.984 -4.641  3.137 -3.636 -3.945  0.196 -4.368 -1.641  0.814 -4.253 -0.622 -2.801 
+    ML    73    71 3    76     6     1     1    29    48  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    74    71 3    76     6     1     1    29    48  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    75    71 3    76     6     0     0    27    45  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    76    76 5    76     6     1     1    30    49  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    77    77 6    77     5     1     1    30    49  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   49 ]     51     65 g c - -
+    MP    78    77 6    82     6     2     2    28    47  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.269 -3.002 -3.316  0.607 -2.825 -4.080  1.486 -3.318 -3.360  2.123 -3.845 -0.940  1.986 -3.442  0.799 -2.268 
+    ML    79    77 6    82     6     1     1    27    46  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    80    77 6    82     6     1     1    27    46  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    81    77 6    82     6     0     0    25    44  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    82    82 5    82     6     1     1    28    47  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    83    83 6    83     5     1     1    28    47  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   50 ]     52     64 g c - -
+    MP    84    83 6    88     6     2     2    26    45  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.573 -3.001 -3.543  0.634 -3.168 -4.231  1.794 -3.603 -3.657  2.626 -4.078 -0.813  0.766 -3.618  0.675 -2.477 
+    ML    85    83 6    88     6     1     1    25    44  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    86    83 6    88     6     1     1    25    44  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    87    83 6    88     6     0     0    23    42  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    88    88 5    88     6     1     1    26    45  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    89    89 6    89     5     1     1    26    45  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   51 ]     53     63 g c - -
+    MP    90    89 6    94     6     2     2    24    43  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.680 -2.656 -3.624  1.495 -4.000 -4.305  0.538 -4.011 -3.825  2.937 -4.200 -0.344  1.037 -3.597 -1.457 -2.574 
+    ML    91    89 6    94     6     1     1    24    43  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    92    89 6    94     6     1     1    24    43  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    93    89 6    94     6     0     0    22    41  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    94    94 5    94     6     1     1    24    43  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    95    95 6    95     5     1     1    24    43  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   52 ]     54     62 G C - -
+    MP    96    95 6   100     4     2     2    22    41  -7.543  -7.750  -0.035  -6.164                 -5.814 -3.622 -6.104 -0.561 -6.715 -5.090 -1.814 -6.360 -4.961  3.816 -5.237 -1.382 -2.178 -5.150 -3.925 -4.967 
+    ML    97    95 6   100     4     1     1    24    43  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR    98    95 6   100     4     1     1    23    42  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D    99    95 6   100     4     0     0    22    41  -4.568  -4.250  -2.265  -0.520                 
+    IL   100   100 5   100     4     1     1    25    44  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   101   101 6   101     3     1     1    24    43  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   53 ]     55      - U - - -
+    ML   102   101 6   104     3     1     1    20    38  -8.524  -0.014  -7.178                         -2.549 -2.369 -3.320  1.822 
+     D   103   101 6   104     3     0     0    19    38  -6.174  -1.687  -0.566                         
+    IL   104   104 3   104     3     1     1    23    42  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   54 ]     56      - U - - -
+    ML   105   104 3   107     3     1     1    18    37  -8.524  -0.014  -7.178                         -2.549 -2.369 -3.320  1.822 
+     D   106   104 3   107     3     0     0    18    37  -6.174  -1.687  -0.566                         
+    IL   107   107 3   107     3     1     1    22    41  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   55 ]     57      - C - - -
+    ML   108   107 3   110     3     1     1    17    36  -8.524  -0.014  -7.178                         -3.081  1.849 -3.880 -2.250 
+     D   109   107 3   110     3     0     0    17    35  -6.174  -1.687  -0.566                         
+    IL   110   110 3   110     3     1     1    21    39  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   56 ]     58      - G - - -
+    ML   111   110 3   113     3     1     1    16    34  -8.524  -0.014  -7.178                         -0.198 -2.380  1.409 -1.835 
+     D   112   110 3   113     3     0     0    16    34  -6.174  -1.687  -0.566                         
+    IL   113   113 3   113     3     1     1    20    38  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   57 ]     59      - A - - -
+    ML   114   113 3   116     3     1     1    14    33  -8.524  -0.014  -7.178                          1.878 -3.490 -3.019 -3.147 
+     D   115   113 3   116     3     0     0    15    33  -6.174  -1.687  -0.566                         
+    IL   116   116 3   116     3     1     1    19    37  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   58 ]     60      - U - - -
+    ML   117   116 3   119     3     1     1    13    31  -8.524  -0.014  -7.178                         -1.468 -0.407 -2.235  1.418 
+     D   118   116 3   119     3     0     0    13    32  -6.174  -1.687  -0.566                         
+    IL   119   119 3   119     3     1     1    18    36  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   59 ]     61      - U - - -
+    ML   120   119 3   122     2     1     1     1     1       *   0.000                                 -1.239  0.314 -2.046  1.064 
+     D   121   119 3   122     2     0     0     0     0       *   0.000                                 
+    IL   122   122 3   122     2     1     1    13    28  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ END    60 ]      -      - - - - -
+     E   123   122 3    -1     0     0     0     0     0                                                 
+                                             [ BEGL   12 ]      -      - - - - -
+     S   124    54 1   125     1     0     3    49    68   0.000                                         
+                                             [ BIF    13 ]      -      - - - - -
+     B   125   124 1   126   173     0     3    49    68                                                 
+                                             [ BEGL   14 ]      -      - - - - -
+     S   126   125 1   127     4     0     0    30    48  -0.035  -7.164  -6.572  -7.212                 
+                                             [ MATP   15 ]     10     26 G C - -
+    MP   127   126 1   131     6     2     2    30    48  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -4.768 -3.151 -4.805  0.251 -5.796 -4.949 -0.981 -5.231 -4.514  3.516 -4.857  0.895 -1.246 -4.551 -3.005 -3.683 
+    ML   128   126 1   131     6     1     1    28    47  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   129   126 1   131     6     1     1    28    47  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   130   126 1   131     6     0     0    26    45  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   131   131 5   131     6     1     1    29    48  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   132   132 6   132     5     1     1    29    48  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   16 ]     11     25 c g - -
+    MP   133   132 6   137     6     2     2    28    46  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -4.380 -4.331 -4.172 -0.461 -2.935 -4.679  2.953 -3.697 -4.172 -0.278 -4.524 -2.247  2.367 -4.479 -0.580 -2.998 
+    ML   134   132 6   137     6     1     1    27    45  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   135   132 6   137     6     1     1    26    45  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   136   132 6   137     6     0     0    24    43  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   137   137 5   137     6     1     1    27    46  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   138   138 6   138     5     1     1    27    46  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   17 ]     12     24 g c - -
+    MP   139   138 6   143     6     2     2    26    44  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.838 -2.993 -3.801  0.619 -3.635 -4.454  0.839 -3.930 -3.877  2.852 -4.281 -0.708  1.851 -3.845 -1.190 -2.710 
+    ML   140   138 6   143     6     1     1    25    44  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   141   138 6   143     6     1     1    25    44  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   142   138 6   143     6     0     0    24    42  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   143   143 5   143     6     1     1    26    44  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   144   144 6   144     5     1     1    25    44  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   18 ]     13     23 c g - -
+    MP   145   144 6   149     4     2     2    24    42  -7.543  -7.750  -0.035  -6.164                 -3.454 -3.490 -3.467  0.042 -2.692 -4.152  2.807 -3.318 -3.483  0.166 -3.945 -1.653  0.946 -3.679  1.162  0.637 
+    ML   146   144 6   149     4     1     1    25    44  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR   147   144 6   149     4     1     1    24    43  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D   148   144 6   149     4     0     0    23    42  -4.568  -4.250  -2.265  -0.520                 
+    IL   149   149 5   149     4     1     1    26    45  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   150   150 6   150     3     1     1    25    44  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   19 ]     14      - A - - -
+    ML   151   150 6   153     3     1     1    20    39  -8.524  -0.014  -7.178                          1.878 -3.490 -3.019 -3.147 
+     D   152   150 6   153     3     0     0    20    39  -6.174  -1.687  -0.566                         
+    IL   153   153 3   153     3     1     1    24    43  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   20 ]     15      - g - - -
+    ML   154   153 3   156     3     1     1    19    38  -8.524  -0.014  -7.178                          0.586 -2.024  0.919 -1.466 
+     D   155   153 3   156     3     0     0    19    37  -6.174  -1.687  -0.566                         
+    IL   156   156 3   156     3     1     1    23    42  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   21 ]     16      - U - - -
+    ML   157   156 3   159     3     1     1    18    36  -1.899  -0.464  -7.178                         -1.468 -0.407 -2.235  1.418 
+     D   158   156 3   159     3     0     0    16    35  -6.174  -1.687  -0.566                         
+    IL   159   159 3   159     3     1     1    18    36  -2.374  -0.363  -5.074                          0.000  0.000  0.000  0.000 
+                                             [ MATL   22 ]     18      - G - - -
+    ML   160   159 3   162     3     1     1    16    34  -8.524  -0.014  -7.178                         -2.700 -4.060  1.885 -3.430 
+     D   161   159 3   162     3     0     0    16    35  -6.174  -1.687  -0.566                         
+    IL   162   162 3   162     3     1     1    20    39  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   23 ]     19      - G - - -
+    ML   163   162 3   165     3     1     1    14    33  -8.524  -0.014  -7.178                         -2.700 -4.060  1.885 -3.430 
+     D   164   162 3   165     3     0     0    15    33  -6.174  -1.687  -0.566                         
+    IL   165   165 3   165     3     1     1    19    38  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   24 ]     20      - u - - -
+    ML   166   165 3   168     3     1     1    11    23  -1.854  -0.481  -7.178                         -0.664 -0.325 -0.613  0.939 
+     D   167   165 3   168     3     0     0     9    20  -6.174  -1.687  -0.566                         
+    IL   168   168 3   168     3     1     1    11    22  -2.396  -0.357  -5.096                          0.000  0.000  0.000  0.000 
+                                             [ MATL   25 ]     22      - A - - -
+    ML   169   168 3   171     2     1     1     1     1       *   0.000                                  1.878 -3.490 -3.019 -3.147 
+     D   170   168 3   171     2     0     0     0     0       *   0.000                                 
+    IL   171   171 3   171     2     1     1    13    28  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ END    26 ]      -      - - - - -
+     E   172   171 3    -1     0     0     0     0     0                                                 
+                                             [ BEGR   27 ]      -      - - - - -
+     S   173   125 1   174     3     0     0    32    50  -8.524  -0.014  -7.178                         
+    IL   174   174 2   174     3     1     1    35    54  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   28 ]     27      - g - - -
+    ML   175   174 2   177     5     1     1    31    50  -7.593  -0.028  -7.408  -7.620  -8.512          0.512 -2.047  0.983 -1.490 
+     D   176   174 2   177     5     0     0    30    49  -4.959  -0.803  -4.221  -2.596  -2.508         
+    IL   177   177 3   177     5     1     1    32    51  -2.408  -0.496  -4.087  -5.920  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   29 ]     28     44 c g - -
+    MP   178   177 3   182     6     2     2    30    49  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -2.996 -2.785 -3.094  0.747 -2.684 -3.890  2.204 -3.144 -3.118  1.704 -3.626  0.455  1.175 -3.212  0.643 -2.072 
+    ML   179   177 3   182     6     1     1    29    48  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   180   177 3   182     6     1     1    29    48  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   181   177 3   182     6     0     0    27    45  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   182   182 5   182     6     1     1    30    49  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   183   183 6   183     5     1     1    30    49  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   30 ]     29     43 c g - -
+    MP   184   183 6   188     6     2     2    28    47  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.660 -3.462 -3.663  0.355 -2.818 -4.407  2.681 -3.427 -3.639  1.512 -4.115 -1.306  1.763 -3.844 -0.432 -2.489 
+    ML   185   183 6   188     6     1     1    27    46  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   186   183 6   188     6     1     1    27    46  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   187   183 6   188     6     0     0    25    44  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   188   188 5   188     6     1     1    28    47  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   189   189 6   189     5     1     1    28    47  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   31 ]     30     42 a u - -
+    MP   190   189 6   194     6     2     2    26    45  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.311 -3.146 -3.360  2.221 -2.772 -4.127  2.025 -3.303 -3.378  0.846 -3.868 -1.127  1.693 -3.528 -0.491 -2.313 
+    ML   191   189 6   194     6     1     1    25    44  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   192   189 6   194     6     1     1    25    44  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   193   189 6   194     6     0     0    23    42  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   194   194 5   194     6     1     1    26    45  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   195   195 6   195     5     1     1    26    45  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   32 ]     31     41 g c - -
+    MP   196   195 6   200     6     2     2    24    43  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.453 -2.737 -3.468  0.855 -3.398 -4.215  1.983 -3.656 -3.568  2.448 -4.006  0.791  0.648 -3.520 -0.989 -2.403 
+    ML   197   195 6   200     6     1     1    24    43  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   198   195 6   200     6     1     1    24    43  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   199   195 6   200     6     0     0    22    41  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   200   200 5   200     6     1     1    24    43  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   201   201 6   201     5     1     1    24    43  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   33 ]     32     40 c g - -
+    MP   202   201 6   206     4     2     2    22    41  -7.543  -7.750  -0.035  -6.164                 -3.332 -2.890 -3.380  1.837 -3.037 -4.188  2.208 -3.435 -3.424  1.867 -3.910 -0.719  0.913 -3.503 -0.696 -2.309 
+    ML   203   201 6   206     4     1     1    24    43  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR   204   201 6   206     4     1     1    23    42  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D   205   201 6   206     4     0     0    22    41  -4.568  -4.250  -2.265  -0.520                 
+    IL   206   206 5   206     4     1     1    25    44  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   207   207 6   207     3     1     1    24    43  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   34 ]     33      - c - - -
+    ML   208   207 6   210     3     1     1    20    38  -8.524  -0.014  -7.178                         -1.256  0.893 -2.113  0.579 
+     D   209   207 6   210     3     0     0    19    38  -6.174  -1.687  -0.566                         
+    IL   210   210 3   210     3     1     1    23    42  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   35 ]     34      - U - - -
+    ML   211   210 3   213     3     1     1    18    37  -8.524  -0.014  -7.178                         -2.549 -2.369 -3.320  1.822 
+     D   212   210 3   213     3     0     0    18    37  -6.174  -1.687  -0.566                         
+    IL   213   213 3   213     3     1     1    22    41  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   36 ]     35      - g - - -
+    ML   214   213 3   216     3     1     1    17    36  -8.524  -0.014  -7.178                         -0.763 -1.427  0.837  0.325 
+     D   215   213 3   216     3     0     0    17    35  -6.174  -1.687  -0.566                         
+    IL   216   216 3   216     3     1     1    21    39  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   37 ]     36      - u - - -
+    ML   217   216 3   219     3     1     1    16    34  -8.524  -0.014  -7.178                          0.037 -0.330 -0.381  0.496 
+     D   218   216 3   219     3     0     0    16    34  -6.174  -1.687  -0.566                         
+    IL   219   219 3   219     3     1     1    20    38  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   38 ]     37      - c - - -
+    ML   220   219 3   222     3     1     1    14    33  -8.524  -0.014  -7.178                          0.403  0.783 -1.648 -0.649 
+     D   221   219 3   222     3     0     0    15    33  -6.174  -1.687  -0.566                         
+    IL   222   222 3   222     3     1     1    19    37  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   39 ]     38      - A - - -
+    ML   223   222 3   225     3     1     1    13    31  -8.524  -0.014  -7.178                          1.037 -1.963  0.397 -1.419 
+     D   224   222 3   225     3     0     0    13    32  -6.174  -1.687  -0.566                         
+    IL   225   225 3   225     3     1     1    18    36  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   40 ]     39      - a - - -
+    ML   226   225 3   228     2     1     1     1     1       *   0.000                                  0.957  0.166 -1.522 -0.764 
+     D   227   225 3   228     2     0     0     0     0       *   0.000                                 
+    IL   228   228 3   228     2     1     1    13    28  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ END    41 ]      -      - - - - -
+     E   229   228 3    -1     0     0     0     0     0                                                 
+//
+HMMER3/f [3.1b3 | July 2016]
+NAME  dataset_743
+LENG  72
+MAXL  152
+ALPH  RNA
+RF    no
+MM    no
+CONS  yes
+CS    yes
+MAP   yes
+DATE  Wed Nov  2 15:35:30 2016
+COM   [1] cmbuild -F --fast --symfrac 0.5 --wpb --p7ere 0.38 --EmN 200 --EvN 200 --ElfN 200 --EgfN 200 --eent --refine /dev/null /home/wanli/galaxy/database/files/000/dataset_750.dat /home/wanli/galaxy/database/files/000/dataset_743.dat
+NSEQ  5
+EFFN  4.575195
+CKSUM 3535941971
+STATS LOCAL MSV       -8.3361  0.72958
+STATS LOCAL VITERBI   -9.7423  0.72958
+STATS LOCAL FORWARD   -2.8398  0.72958
+HMM          A        C        G        U   
+            m->m     m->i     m->d     i->m     i->i     d->m     d->d
+  COMPO   1.54533  1.43782  1.21668  1.37396
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  0.00000        *
+      1   2.27104  2.21243  0.67362  1.28194      1 G - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      2   2.71979  0.53764  1.58904  1.92505      2 C - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      3   2.13247  1.12928  1.19870  1.36023      3 c - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      4   2.06386  1.33928  0.73468  2.02995      4 g - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      5   1.11916  2.01343  1.13651  1.51879      5 a - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      6   2.27600  1.26221  1.56184  0.90503      6 u - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      7   0.55854  2.34742  2.06069  1.58488      7 A - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      8   3.41131  3.24840  3.95063  0.09549      8 U - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      9   0.62589  2.93067  1.09257  2.57049      9 A - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     10   2.58478  3.48701  0.15236  3.34349     10 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     11   3.04360  0.66824  2.81745  0.96766     11 C - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     12   2.27167  2.22390  0.66329  1.29638     12 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     13   2.70763  0.72972  2.52177  0.99171     13 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     14   0.06447  4.06946  3.72356  3.85378     14 A - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     15   0.96309  2.96228  0.71023  2.58952     15 g - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     16   2.58013  1.68600  3.11568  0.36438     16 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.36284  1.23646  4.27667  0.09305  2.42079  1.09861  0.40547
+     17   3.50204  4.46790  0.06149  4.01568     18 G - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     18   3.50204  4.46790  0.06149  4.01568     19 G - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     19   1.92921  1.61736  1.81487  0.70632     20 u - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.37560  1.20654  4.27667  0.09038  2.44862  1.09861  0.40547
+     20   0.06447  4.06946  3.72356  3.85378     22 A - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     21   2.10278  2.68978  0.46988  1.68787     23 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     22   1.38592  0.72007  2.05285  2.00384     24 c - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     23   1.05742  2.98038  0.61496  2.79344     25 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     24   3.52889  0.29960  3.29055  1.64863     26 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     25   1.01810  2.97712  0.66580  2.60482     27 G - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     26   2.11085  1.15042  1.18985  1.35443     28 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     27   2.42824  0.83921  1.56647  1.30573     29 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     28   1.09889  1.29935  2.02826  1.33756     30 a - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     29   2.06898  1.31812  0.74979  2.01303     31 g - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     30   1.36950  1.15928  1.31013  1.81850     32 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     31   2.40938  0.72219  3.02139  0.97894     33 c - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     32   3.41131  3.24840  3.95063  0.09549     34 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     33   2.03026  2.49922  0.75131  1.15581     35 g - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     34   1.37091  1.61913  1.64530  1.03536     36 u - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     35   1.09596  0.79030  2.66885  1.94670     37 c - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     36   0.63350  2.92991  1.08102  2.56892     38 A - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     37   0.68448  1.23998  2.57183  2.04128     39 A - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     38   2.05098  1.42195  1.06925  1.24869     40 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     39   2.25157  1.00742  1.23141  1.43664     41 c - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     40   1.49091  2.19537  1.18474  1.02809     42 u - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     41   1.46309  1.66242  0.76188  2.18914     43 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     42   1.84429  1.51321  0.88732  1.56112     44 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     43   0.38710  2.63412  2.69028  1.70743     45 A - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     44   3.50204  4.46790  0.06149  4.01568     46 G - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     45   0.96309  2.96228  0.71023  2.58952     47 g - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.37560  4.27667  1.20654  1.46634  0.26236  1.09861  0.40547
+     46   2.76487  2.70273  3.28806  0.18312     48 U - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.03964  3.94071  3.94071  1.46634  0.26236  0.08877  2.46575
+     47   2.65665  0.41541  3.29031  1.45884     49 C - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     48   1.72807  0.51473  2.49712  1.94920     50 C - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     49   2.23405  1.71156  1.13675  0.93787     51 u - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     50   2.24174  1.47214  0.80734  1.52210     52 g - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     51   1.62002  2.40165  0.60094  1.81254     53 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     52   3.13623  4.03650  0.08313  3.98115     54 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     53   3.41131  3.24840  3.95063  0.09549     55 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     54   3.41131  3.24840  3.95063  0.09549     56 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     55   3.81775  0.07857  4.34279  3.20425     57 C - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     56   1.55092  3.20619  0.37228  2.84263     58 G - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     57   0.06447  4.06946  3.72356  3.85378     59 A - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     58   2.58013  1.68600  3.11568  0.36438     60 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     59   2.39994  1.14144  2.97016  0.61874     61 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     60   4.11656  0.10126  3.89068  2.82057     62 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     61   1.95700  0.67131  2.21870  1.43159     63 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     62   2.18076  0.86710  1.10730  1.99196     64 c - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     63   1.27825  1.21396  1.24116  1.99945     65 c - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     64   2.19639  2.68263  0.47103  1.62938     66 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     65   1.68678  2.30864  2.17351  0.50798     67 U - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     66   1.21618  1.66846  0.95030  2.05201     68 g - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     67   2.09329  1.05549  1.48837  1.19416     69 c - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     68   2.26917  0.96322  1.25225  1.47369     70 c - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     69   1.53154  1.55221  1.02428  1.54664     71 g - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     70   2.18028  1.66521  0.48878  2.47139     72 G - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     71   1.37162  0.72882  2.04389  2.00766     73 c - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     72   1.04988  2.29119  1.14633  1.46503     74 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.01418  4.26268        *  1.46634  0.26236  0.00000        *
+//
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cmcalibrate_input.cm	Sat Jan 21 17:36:57 2017 -0500
@@ -0,0 +1,570 @@
+INFERNAL1/a [1.1.2 | July 2016]
+NAME     dataset_838
+STATES   233
+NODES    62
+CLEN     73
+W        90
+ALPH     RNA
+RF       no
+CONS     yes
+MAP      yes
+DATE     Thu Dec 15 13:43:26 2016
+COM      [1] cmbuild -F --fast --symfrac 0.5 --wpb --p7ere 0.38 --EmN 200 --EvN 200 --ElfN 200 --EgfN 200 --eent /home/wanli/galaxy/database/files/000/dataset_839.dat /home/wanli/galaxy/database/files/000/dataset_838.dat
+COM      [2] cmcalibrate Downloads/download.cm
+PBEGIN   0.05
+PEND     0.05
+WBETA    1e-07
+QDBBETA1 1e-07
+QDBBETA2 1e-15
+N2OMEGA  1.52588e-05
+N3OMEGA  1.52588e-05
+ELSELF   -0.08926734
+NSEQ     2
+EFFN     1.902344
+CKSUM    1256650105
+NULL     0.000  0.000  0.000  0.000 
+EFP7GF   -2.8151 0.73715
+ECMLC    0.80543    -3.96449     2.80237     1600000      279383  0.004295
+ECMGC    0.42297   -15.07779    -2.84171     1600000       70757  0.005653
+ECMLI    0.67085    -3.93573     3.92167     1600000      233559  0.005138
+ECMGI    0.43319   -10.87224     0.43591     1600000       53640  0.007457
+CM
+                                             [ ROOT    0 ]      -      - - - - -
+     S     0    -1 0     1     4     0     1    90   110  -6.854  -8.100  -0.081  -4.553                 
+    IL     1     1 2     1     4     3    27    91   111  -2.817  -4.319  -0.613  -2.698                  0.000  0.000  0.000  0.000 
+    IR     2     2 3     2     3     4    29    92   112  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR    1 ]      -     74 - a - -
+    MR     3     2 3     5     5     5    30    90   110  -7.084  -0.039  -6.900  -7.112  -8.004          0.711 -1.386  0.490 -0.798 
+     D     4     2 3     5     5     1    23    88   109  -5.352  -0.707  -2.978  -4.409  -2.404         
+    IR     5     5 3     5     5     3    27    90   110  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    2 ]      1     73 g c - -
+    MP     6     5 3    10     6     6    31    89   109  -9.103  -9.042  -0.021  -7.819  -8.099  -8.494 -3.271 -2.721 -3.286  0.880 -2.952 -4.020  1.406 -3.346 -3.336  2.423 -3.790 -0.527  1.874 -3.393 -0.601 -2.220 
+    ML     7     5 3    10     6     3    25    87   107  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR     8     5 3    10     6     3    25    87   107  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D     9     5 3    10     6     0    20    85   105  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    10    10 5    10     6     3    26    88   109  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    11    11 6    11     5     3    27    88   108  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    3 ]      2     72 C G - -
+    MP    12    11 6    16     6     5    30    87   107  -9.103  -9.042  -0.021  -7.819  -8.099  -8.494 -4.534 -4.439 -4.227 -0.672 -2.948 -4.641  3.546 -3.756 -4.276 -0.430 -4.538 -2.386  0.568 -4.605 -0.654 -3.116 
+    ML    13    11 6    16     6     3    24    85   105  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    14    11 6    16     6     2    24    85   105  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    15    11 6    16     6     0    20    83   103  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    16    16 5    16     6     3    26    86   107  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    17    17 6    17     5     3    26    86   106  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    4 ]      3     71 g c - -
+    MP    18    17 6    22     6     5    29    85   105  -9.103  -9.042  -0.021  -7.819  -8.099  -8.494 -3.399 -2.852 -3.384  0.778 -2.912 -4.071  2.215 -3.369 -3.430  2.395 -3.863 -0.655  0.991 -3.497 -0.541 -2.295 
+    ML    19    17 6    22     6     2    24    83   103  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    20    17 6    22     6     2    24    83   103  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    21    17 6    22     6     0    19    81   101  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    22    22 5    22     6     3    25    84   105  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    23    23 6    23     5     3    26    84   104  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    5 ]      4     70 g c - -
+    MP    24    23 6    28     6     5    27    83   103  -9.103  -9.042  -0.021  -7.819  -8.099  -8.494 -3.685 -2.520 -3.739  0.996 -4.349 -4.510  0.110 -4.031 -3.653  2.956 -4.094  1.654 -0.173 -3.846 -1.845 -2.615 
+    ML    25    23 6    28     6     2    23    81   101  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    26    23 6    28     6     2    23    81   101  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    27    23 6    28     6     0    19    79    99  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    28    28 5    28     6     3    25    82   103  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    29    29 6    29     5     3    25    82   102  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    6 ]      5     69 A U - -
+    MP    30    29 6    34     6     5    25    81   101  -9.103  -9.042  -0.021  -7.819  -8.099  -8.494 -3.778 -2.813 -3.798  3.323 -4.129 -5.190  0.170 -3.841 -3.690  1.093 -4.237 -0.291 -0.248 -4.380 -1.771 -2.632 
+    ML    31    29 6    34     6     2    22    79   100  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    32    29 6    34     6     2    22    79    99  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    33    29 6    34     6     0    19    77    97  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    34    34 5    34     6     3    23    80   101  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    35    35 6    35     5     3    23    80   100  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    7 ]      6     68 U A - -
+    MP    36    35 6    40     6     5    23    79    99  -9.103  -9.042  -0.021  -7.819  -8.099  -8.494 -4.174 -3.998 -4.014 -0.294 -2.959 -4.580  1.369 -3.654 -4.019 -0.038 -4.393 -1.898  3.320 -4.326 -0.636 -2.845 
+    ML    37    35 6    40     6     2    21    78    98  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    38    35 6    40     6     2    21    78    98  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    39    35 6    40     6     0    18    76    96  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    40    40 5    40     6     2    22    78    99  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    41    41 6    41     5     2    22    78    98  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    8 ]      7     67 u a - -
+    MP    42    41 6    46     4     3    21    77    97  -6.937  -7.144  -0.054  -5.558                 -3.032 -2.716 -3.091  1.906 -2.672 -3.917  1.568 -3.103 -3.103  1.300 -3.601 -0.598  2.047 -3.280 -0.404 -2.050 
+    ML    43    41 6    46     4     2    20    77    97  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR    44    41 6    46     4     1    19    76    97  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D    45    41 6    46     4     0    18    75    96  -4.568  -4.250  -2.265  -0.520                 
+    IL    46    46 5    46     4     2    21    78    99  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR    47    47 6    47     3     2    21    77    98  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    9 ]      8      - U - - -
+    ML    48    47 6    50     3     2    19    74    94  -7.954  -0.021  -6.608                         -1.467 -1.466 -2.199  1.613 
+     D    49    47 6    50     3     0    18    73    93  -6.174  -1.687  -0.566                         
+    IL    50    50 3    50     3     2    20    76    97  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   10 ]      9      - A - - -
+    ML    51    50 3    53     2     1    18    73    93  -8.344  -0.004                                  1.714 -2.351 -1.985 -1.891 
+     D    52    50 3    53     2     0    17    72    92  -8.445  -0.004                                 
+    IL    53    53 3    53     2     1    19    74    94  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ BIF    11 ]      -      - - - - -
+     B    54    53 3   124    55     0    17    72    92                                                 
+                                             [ BEGR   43 ]      -      - - - - -
+     S    55    54 1    56     3     0     0    36    55  -7.954  -0.021  -6.608                         
+    IL    56    56 2    56     3     1     1    40    59  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   44 ]     45      - A - - -
+    ML    57    56 2    59     3     1     1    36    55  -7.954  -0.021  -6.608                          1.714 -2.351 -1.985 -1.891 
+     D    58    56 2    59     3     0     0    35    54  -6.174  -1.687  -0.566                         
+    IL    59    59 3    59     3     1     1    39    58  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   45 ]     46      - G - - -
+    ML    60    59 3    62     3     1     1    35    54  -7.954  -0.021  -6.608                         -1.559 -2.775  1.719 -2.162 
+     D    61    59 3    62     3     0     0    34    53  -6.174  -1.687  -0.566                         
+    IL    62    62 3    62     3     1     1    37    57  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   46 ]     47      - a - - -
+    ML    63    62 3    65     3     1     1    34    53  -7.954  -0.445  -1.937                          0.698 -1.388  0.507 -0.799 
+     D    64    62 3    65     3     0     0    33    52  -6.174  -1.687  -0.566                         
+    IL    65    65 3    65     3     1     1    37    56  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   47 ]     48      - U - - -
+    ML    66    65 3    68     3     1     1    33    52  -7.537  -0.028  -6.191                         -0.748 -0.887 -1.429  1.318 
+     D    67    65 3    68     3     0     0    32    51  -7.898  -0.338  -2.290                         
+    IL    68    68 3    68     3     1     1    36    55  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   48 ]     49      - C - - -
+    ML    69    68 3    71     5     1     1    32    51  -7.084  -0.039  -6.900  -7.112  -8.004         -1.716  1.617 -2.539 -1.135 
+     D    70    68 3    71     5     0     0    31    50  -4.959  -0.803  -4.221  -2.596  -2.508         
+    IL    71    71 3    71     5     1     1    32    51  -2.408  -0.496  -4.087  -5.920  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   49 ]     50     66 C G - -
+    MP    72    71 3    76     6     2     2    31    50  -9.103  -9.042  -0.021  -7.819  -8.099  -8.494 -4.534 -4.439 -4.227 -0.672 -2.948 -4.641  3.546 -3.756 -4.276 -0.430 -4.538 -2.386  0.568 -4.605 -0.654 -3.116 
+    ML    73    71 3    76     6     1     1    30    48  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    74    71 3    76     6     1     1    29    48  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    75    71 3    76     6     0     0    27    46  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    76    76 5    76     6     1     1    31    50  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    77    77 6    77     5     1     1    30    49  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   50 ]     51     65 g c - -
+    MP    78    77 6    82     6     2     2    29    48  -9.103  -9.042  -0.021  -7.819  -8.099  -8.494 -3.267 -2.724 -3.283  0.878 -2.942 -4.019  1.414 -3.339 -3.332  2.409 -3.787 -0.532  1.888 -3.392 -0.592 -2.217 
+    ML    79    77 6    82     6     1     1    28    46  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    80    77 6    82     6     1     1    27    46  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    81    77 6    82     6     0     0    25    44  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    82    82 5    82     6     1     1    29    48  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    83    83 6    83     5     1     1    28    47  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   51 ]     52     64 G C - -
+    MP    84    83 6    88     6     2     2    27    46  -9.103  -9.042  -0.021  -7.819  -8.099  -8.494 -4.726 -3.086 -4.823  0.211 -5.210 -4.688 -0.578 -5.065 -4.317  3.634 -4.655 -0.784 -0.964 -4.457 -2.615 -3.700 
+    ML    85    83 6    88     6     1     1    26    45  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    86    83 6    88     6     1     1    26    45  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    87    83 6    88     6     0     0    24    43  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    88    88 5    88     6     1     1    27    46  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    89    89 6    89     5     1     1    26    45  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   52 ]     53     63 g c - -
+    MP    90    89 6    94     6     2     2    25    44  -9.103  -9.042  -0.021  -7.819  -8.099  -8.494 -3.267 -2.724 -3.283  0.878 -2.942 -4.019  1.414 -3.339 -3.332  2.409 -3.787 -0.532  1.888 -3.392 -0.592 -2.217 
+    ML    91    89 6    94     6     1     1    24    43  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    92    89 6    94     6     1     1    24    43  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    93    89 6    94     6     0     0    23    42  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    94    94 5    94     6     1     1    25    44  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    95    95 6    95     5     1     1    24    43  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   53 ]     54     62 G C - -
+    MP    96    95 6   100     4     2     2    23    42  -6.937  -7.144  -0.054  -5.558                 -4.726 -3.086 -4.823  0.211 -5.210 -4.688 -0.578 -5.065 -4.317  3.634 -4.655 -0.784 -0.964 -4.457 -2.615 -3.700 
+    ML    97    95 6   100     4     1     1    24    43  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR    98    95 6   100     4     1     1    23    42  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D    99    95 6   100     4     0     0    22    41  -4.568  -4.250  -2.265  -0.520                 
+    IL   100   100 5   100     4     1     1    25    44  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   101   101 6   101     3     1     1    24    43  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   54 ]     55      - U - - -
+    ML   102   101 6   104     3     1     1    20    39  -7.954  -0.021  -6.608                         -1.467 -1.466 -2.199  1.613 
+     D   103   101 6   104     3     0     0    19    38  -6.174  -1.687  -0.566                         
+    IL   104   104 3   104     3     1     1    23    42  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   55 ]     56      - U - - -
+    ML   105   104 3   107     3     1     1    19    37  -7.954  -0.021  -6.608                         -1.467 -1.466 -2.199  1.613 
+     D   106   104 3   107     3     0     0    18    37  -6.174  -1.687  -0.566                         
+    IL   107   107 3   107     3     1     1    22    41  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   56 ]     57      - C - - -
+    ML   108   107 3   110     3     1     1    18    36  -7.954  -0.021  -6.608                         -1.716  1.617 -2.539 -1.135 
+     D   109   107 3   110     3     0     0    17    36  -6.174  -1.687  -0.566                         
+    IL   110   110 3   110     3     1     1    21    40  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   57 ]     58      - G - - -
+    ML   111   110 3   113     3     1     1    16    35  -7.954  -0.021  -6.608                         -1.559 -2.775  1.719 -2.162 
+     D   112   110 3   113     3     0     0    16    34  -6.174  -1.687  -0.566                         
+    IL   113   113 3   113     3     1     1    20    38  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   58 ]     59      - A - - -
+    ML   114   113 3   116     3     1     1    15    33  -7.954  -0.021  -6.608                          1.714 -2.351 -1.985 -1.891 
+     D   115   113 3   116     3     0     0    15    33  -6.174  -1.687  -0.566                         
+    IL   116   116 3   116     3     1     1    19    37  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   59 ]     60      - u - - -
+    ML   117   116 3   119     3     1     1    13    31  -7.954  -0.021  -6.608                         -0.697  0.451 -1.474  0.728 
+     D   118   116 3   119     3     0     0    13    32  -6.174  -1.687  -0.566                         
+    IL   119   119 3   119     3     1     1    18    36  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   60 ]     61      - u - - -
+    ML   120   119 3   122     2     1     1     1     1       *   0.000                                 -0.698  0.466 -1.475  0.716 
+     D   121   119 3   122     2     0     0     0     0       *   0.000                                 
+    IL   122   122 3   122     2     1     1    13    28  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ END    61 ]      -      - - - - -
+     E   123   122 3    -1     0     0     0     0     0                                                 
+                                             [ BEGL   12 ]      -      - - - - -
+     S   124    54 1   125     1     0     4    50    69   0.000                                         
+                                             [ BIF    13 ]      -      - - - - -
+     B   125   124 1   126   176     0     4    50    69                                                 
+                                             [ BEGL   14 ]      -      - - - - -
+     S   126   125 1   127     4     0     0    31    49  -0.045  -6.828  -6.235  -6.875                 
+                                             [ MATP   15 ]     10     26 G C - -
+    MP   127   126 1   131     6     2     2    31    50  -9.103  -9.042  -0.021  -7.819  -8.099  -8.494 -4.726 -3.086 -4.823  0.211 -5.210 -4.688 -0.578 -5.065 -4.317  3.634 -4.655 -0.784 -0.964 -4.457 -2.615 -3.700 
+    ML   128   126 1   131     6     1     1    29    48  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   129   126 1   131     6     1     1    29    48  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   130   126 1   131     6     0     0    27    46  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   131   131 5   131     6     1     1    30    49  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   132   132 6   132     5     1     1    30    49  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   16 ]     11     25 c g - -
+    MP   133   132 6   137     6     2     2    29    47  -9.103  -9.042  -0.021  -7.819  -8.099  -8.494 -3.645 -3.572 -3.530  0.166 -2.488 -4.110  2.664 -3.192 -3.541  0.423 -3.935 -1.548  2.309 -3.788 -0.162 -2.413 
+    ML   134   132 6   137     6     1     1    27    46  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   135   132 6   137     6     1     1    27    46  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   136   132 6   137     6     0     0    25    44  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   137   137 5   137     6     1     1    28    47  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   138   138 6   138     5     1     1    28    47  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   17 ]     12     24 g c - -
+    MP   139   138 6   143     6     2     2    27    45  -9.103  -9.042  -0.021  -7.819  -8.099  -8.494 -3.267 -2.724 -3.283  0.878 -2.942 -4.019  1.414 -3.339 -3.332  2.409 -3.787 -0.532  1.888 -3.392 -0.592 -2.217 
+    ML   140   138 6   143     6     1     1    26    45  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   141   138 6   143     6     1     1    26    45  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   142   138 6   143     6     0     0    24    43  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   143   143 5   143     6     1     1    26    45  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   144   144 6   144     5     1     1    26    45  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   18 ]     13     23 c g - -
+    MP   145   144 6   149     4     2     2    25    43  -6.937  -7.144  -0.054  -5.558                 -3.062 -2.991 -3.078  0.453 -2.412 -3.763  2.525 -2.992 -3.107  0.713 -3.560 -1.119  1.151 -3.287 -0.202  1.395 
+    ML   146   144 6   149     4     1     1    25    44  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR   147   144 6   149     4     1     1    25    44  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D   148   144 6   149     4     0     0    24    43  -4.568  -4.250  -2.265  -0.520                 
+    IL   149   149 5   149     4     1     1    27    46  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   150   150 6   150     3     1     1    26    45  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   19 ]     14      - A - - -
+    ML   151   150 6   153     3     1     1    22    40  -7.954  -0.021  -6.608                          1.714 -2.351 -1.985 -1.891 
+     D   152   150 6   153     3     0     0    21    40  -6.174  -1.687  -0.566                         
+    IL   153   153 3   153     3     1     1    25    43  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   20 ]     15      - a - - -
+    ML   154   153 3   156     3     1     1    20    39  -7.954  -0.021  -6.608                          0.698 -1.388  0.507 -0.799 
+     D   155   153 3   156     3     0     0    20    38  -6.174  -1.687  -0.566                         
+    IL   156   156 3   156     3     1     1    24    42  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   21 ]     16      - u - - -
+    ML   157   156 3   159     3     1     1    19    38  -7.954  -0.445  -1.937                         -0.697  0.451 -1.474  0.728 
+     D   158   156 3   159     3     0     0    19    37  -6.174  -1.687  -0.566                         
+    IL   159   159 3   159     3     1     1    23    41  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   22 ]     17      - U - - -
+    ML   160   159 3   162     3     1     1    18    37  -7.537  -0.028  -6.191                         -0.748 -0.887 -1.429  1.318 
+     D   161   159 3   162     3     0     0    17    36  -7.898  -0.338  -2.290                         
+    IL   162   162 3   162     3     1     1    21    40  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   23 ]     18      - G - - -
+    ML   163   162 3   165     3     1     1    17    35  -7.954  -0.021  -6.608                         -1.559 -2.775  1.719 -2.162 
+     D   164   162 3   165     3     0     0    16    35  -6.174  -1.687  -0.566                         
+    IL   165   165 3   165     3     1     1    20    39  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   24 ]     19      - G - - -
+    ML   166   165 3   168     3     1     1    15    33  -7.954  -0.021  -6.608                         -1.559 -2.775  1.719 -2.162 
+     D   167   165 3   168     3     0     0    15    33  -6.174  -1.687  -0.566                         
+    IL   168   168 3   168     3     1     1    19    38  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   25 ]     20      - g - - -
+    ML   169   168 3   171     3     1     1    13    25  -1.972  -0.445  -6.608                         -0.334  0.192  0.338 -0.322 
+     D   170   168 3   171     3     0     0    10    22  -6.174  -1.687  -0.566                         
+    IL   171   171 3   171     3     1     1    13    25  -2.100  -0.452  -4.800                          0.000  0.000  0.000  0.000 
+                                             [ MATL   26 ]     22      - A - - -
+    ML   172   171 3   174     2     1     1     1     1       *   0.000                                  1.714 -2.351 -1.985 -1.891 
+     D   173   171 3   174     2     0     0     0     0       *   0.000                                 
+    IL   174   174 3   174     2     1     1    13    28  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ END    27 ]      -      - - - - -
+     E   175   174 3    -1     0     0     0     0     0                                                 
+                                             [ BEGR   28 ]      -      - - - - -
+     S   176   125 1   177     3     0     0    32    51  -7.954  -0.021  -6.608                         
+    IL   177   177 2   177     3     1     1    36    55  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   29 ]     27      - a - - -
+    ML   178   177 2   180     5     1     1    32    51  -7.084  -0.039  -6.900  -7.112  -8.004          0.698 -1.388  0.507 -0.799 
+     D   179   177 2   180     5     0     0    31    50  -4.959  -0.803  -4.221  -2.596  -2.508         
+    IL   180   180 3   180     5     1     1    32    51  -2.408  -0.496  -4.087  -5.920  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   30 ]     28     44 c g - -
+    MP   181   180 3   185     6     2     2    31    50  -9.103  -9.042  -0.021  -7.819  -8.099  -8.494 -3.715 -3.704 -3.557 -0.032 -2.461 -4.079  2.720 -3.195 -3.586  0.182 -3.949 -1.773  1.122 -3.840  1.943 -2.473 
+    ML   182   180 3   185     6     1     1    30    48  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   183   180 3   185     6     1     1    29    48  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   184   180 3   185     6     0     0    27    46  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   185   185 5   185     6     1     1    31    50  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   186   186 6   186     5     1     1    30    49  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   31 ]     29     43 C G - -
+    MP   187   186 6   191     6     2     2    29    48  -9.103  -9.042  -0.021  -7.819  -8.099  -8.494 -4.534 -4.439 -4.227 -0.672 -2.948 -4.641  3.546 -3.756 -4.276 -0.430 -4.538 -2.386  0.568 -4.605 -0.654 -3.116 
+    ML   188   186 6   191     6     1     1    28    46  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   189   186 6   191     6     1     1    27    46  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   190   186 6   191     6     0     0    25    44  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   191   191 5   191     6     1     1    29    48  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   192   192 6   192     5     1     1    28    47  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   32 ]     30     42 A U - -
+    MP   193   192 6   197     6     2     2    27    46  -9.103  -9.042  -0.021  -7.819  -8.099  -8.494 -3.778 -2.813 -3.798  3.323 -4.129 -5.190  0.170 -3.841 -3.690  1.093 -4.237 -0.291 -0.248 -4.380 -1.771 -2.632 
+    ML   194   192 6   197     6     1     1    26    45  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   195   192 6   197     6     1     1    26    45  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   196   192 6   197     6     0     0    24    43  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   197   197 5   197     6     1     1    27    46  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   198   198 6   198     5     1     1    26    45  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   33 ]     31     41 g c - -
+    MP   199   198 6   203     6     2     2    25    44  -9.103  -9.042  -0.021  -7.819  -8.099  -8.494 -3.399 -2.852 -3.384  0.778 -2.912 -4.071  2.215 -3.369 -3.430  2.395 -3.863 -0.655  0.991 -3.497 -0.541 -2.295 
+    ML   200   198 6   203     6     1     1    24    43  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   201   198 6   203     6     1     1    24    43  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   202   198 6   203     6     0     0    23    42  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   203   203 5   203     6     1     1    25    44  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   204   204 6   204     5     1     1    24    43  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   34 ]     32     40 g c - -
+    MP   205   204 6   209     4     2     2    23    42  -6.937  -7.144  -0.054  -5.558                 -3.526 -2.500 -3.557  2.082 -3.985 -4.395  0.429 -3.836 -3.552  2.834 -4.007 -0.120  0.119 -3.682 -1.529 -2.458 
+    ML   206   204 6   209     4     1     1    24    43  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR   207   204 6   209     4     1     1    23    42  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D   208   204 6   209     4     0     0    22    41  -4.568  -4.250  -2.265  -0.520                 
+    IL   209   209 5   209     4     1     1    25    44  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   210   210 6   210     3     1     1    24    43  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   35 ]     33      - C - - -
+    ML   211   210 6   213     3     1     1    20    39  -7.954  -0.021  -6.608                         -1.716  1.617 -2.539 -1.135 
+     D   212   210 6   213     3     0     0    19    38  -6.174  -1.687  -0.566                         
+    IL   213   213 3   213     3     1     1    23    42  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   36 ]     34      - U - - -
+    ML   214   213 3   216     3     1     1    19    37  -7.954  -0.021  -6.608                         -1.467 -1.466 -2.199  1.613 
+     D   215   213 3   216     3     0     0    18    37  -6.174  -1.687  -0.566                         
+    IL   216   216 3   216     3     1     1    22    41  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   37 ]     35      - u - - -
+    ML   217   216 3   219     3     1     1    18    36  -7.954  -0.021  -6.608                         -0.363 -0.937  0.342  0.519 
+     D   218   216 3   219     3     0     0    17    36  -6.174  -1.687  -0.566                         
+    IL   219   219 3   219     3     1     1    21    40  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   38 ]     36      - u - - -
+    ML   220   219 3   222     3     1     1    16    35  -7.954  -0.021  -6.608                          0.558 -0.842 -1.047  0.571 
+     D   221   219 3   222     3     0     0    16    34  -6.174  -1.687  -0.566                         
+    IL   222   222 3   222     3     1     1    20    38  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   39 ]     37      - a - - -
+    ML   223   222 3   225     3     1     1    15    33  -7.954  -0.021  -6.608                          0.628  0.246 -1.103 -0.315 
+     D   224   222 3   225     3     0     0    15    33  -6.174  -1.687  -0.566                         
+    IL   225   225 3   225     3     1     1    19    37  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   40 ]     38      - a - - -
+    ML   226   225 3   228     3     1     1    13    31  -7.954  -0.021  -6.608                          0.698 -1.388  0.507 -0.799 
+     D   227   225 3   228     3     0     0    13    32  -6.174  -1.687  -0.566                         
+    IL   228   228 3   228     3     1     1    18    36  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   41 ]     39      - a - - -
+    ML   229   228 3   231     2     1     1     1     1       *   0.000                                  0.628  0.246 -1.103 -0.315 
+     D   230   228 3   231     2     0     0     0     0       *   0.000                                 
+    IL   231   231 3   231     2     1     1    13    28  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ END    42 ]      -      - - - - -
+     E   232   231 3    -1     0     0     0     0     0                                                 
+//
+HMMER3/f [3.1b3 | July 2016]
+NAME  dataset_838
+LENG  73
+MAXL  164
+ALPH  RNA
+RF    no
+MM    no
+CONS  yes
+CS    yes
+MAP   yes
+DATE  Thu Dec 15 13:43:26 2016
+COM   [1] cmbuild -F --fast --symfrac 0.5 --wpb --p7ere 0.38 --EmN 200 --EvN 200 --ElfN 200 --EgfN 200 --eent /home/wanli/galaxy/database/files/000/dataset_839.dat /home/wanli/galaxy/database/files/000/dataset_838.dat
+NSEQ  2
+EFFN  1.628906
+CKSUM 1256650105
+STATS LOCAL MSV       -8.5184  0.73715
+STATS LOCAL VITERBI  -10.4826  0.73715
+STATS LOCAL FORWARD   -2.6863  0.73715
+HMM          A        C        G        U   
+            m->m     m->i     m->d     i->m     i->i     d->m     d->d
+  COMPO   1.47076  1.39566  1.26733  1.42298
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  0.00000        *
+      1   1.93554  1.65715  0.96626  1.25713      1 g - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+      2   2.82012  0.35286  2.54849  1.83556      2 C - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+      3   2.00424  1.20191  0.98969  1.64544      3 g - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+      4   1.87354  2.44340  0.41370  2.31917      4 G - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+      5   0.53128  2.34938  1.53172  2.29704      5 A - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+      6   2.58639  1.62982  2.28826  0.46633      6 U - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+      7   1.38468  1.54821  1.52008  1.14484      7 u - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+      8   2.26593  2.29030  2.76601  0.31181      8 U - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+      9   0.23431  2.86460  2.62614  2.53179      9 A - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     10   2.35339  2.85006  0.24040  2.80018     10 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     11   2.36315  0.89679  2.07651  0.98716     11 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     12   1.94223  1.65192  0.97261  1.24884     12 g - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     13   2.11261  1.00158  1.82880  1.04648     13 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     14   0.23431  2.86460  2.62614  2.53179     14 A - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     15   0.91793  2.28477  1.06301  1.87441     15 a - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     16   1.81039  1.10283  2.34106  0.89586     16 u - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.33427  3.73767  1.34581  1.46634  0.26236  1.09861  0.40547
+     17   1.82572  1.94090  2.28977  0.52082     17 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.06440  3.46780  3.46780  1.46634  0.26236  0.16798  1.86670
+     18   2.30534  3.12204  0.23733  2.69597     18 G - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     19   2.30534  3.12204  0.23733  2.69597     19 G - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     20   1.57379  1.27789  1.18703  1.56547     20 g - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.33427  1.34581  3.73767  0.17384  1.83528  1.09861  0.40547
+     21   0.23431  2.86460  2.62614  2.53179     22 A - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     22   1.73793  1.99628  0.88761  1.28505     23 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     23   1.40058  1.07188  1.48214  1.69265     24 c - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     24   1.13668  2.23736  0.79225  2.12401     25 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     25   2.99476  0.28499  2.66857  2.05123     26 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     26   0.91793  2.28477  1.06301  1.87441     27 a - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     27   2.44995  0.86440  2.19692  0.96430     28 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     28   2.83282  0.35078  2.55365  1.83749     29 C - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     29   0.53070  2.35068  1.53174  2.29916     30 A - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     30   2.00633  1.20137  0.98908  1.64602     31 g - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     31   1.28301  2.25438  0.68949  2.15394     32 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     32   2.39558  0.32068  2.95885  2.02994     33 C - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     33   2.26593  2.29030  2.76601  0.31181     34 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     34   1.60034  1.99549  1.17547  1.03972     35 u - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     35   1.01126  1.93561  2.07335  1.00474     36 u - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     36   0.96800  1.24226  2.10248  1.56411     37 a - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     37   0.91793  2.28477  1.06301  1.87441     38 a - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     38   0.96800  1.24226  2.10248  1.56411     39 a - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     39   2.38672  0.79160  2.07045  1.11225     40 c - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     40   1.88903  1.08176  1.08725  1.75655     41 c - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     41   2.53186  1.78457  2.16649  0.44935     42 U - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     42   2.11226  2.72003  0.30387  2.58756     43 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     43   1.77763  2.35781  0.46620  2.21683     44 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     44   0.23431  2.86460  2.62614  2.53179     45 A - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     45   2.30534  3.12204  0.23733  2.69597     46 G - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     46   0.91793  2.28477  1.06301  1.87441     47 a - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.33427  3.73767  1.34581  1.46634  0.26236  1.09861  0.40547
+     47   1.82572  1.94090  2.28977  0.52082     48 U - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.06440  3.46780  3.46780  1.46634  0.26236  0.16798  1.86670
+     48   2.39558  0.32068  2.95885  2.02994     49 C - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     49   2.82007  0.35287  2.54847  1.83555     50 C - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     50   1.93986  1.65192  0.97340  1.24897     51 g - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     51   2.34658  2.84349  0.24246  2.79056     52 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     52   1.94038  1.65192  0.97323  1.24894     53 g - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     53   2.34693  2.84383  0.24235  2.79106     54 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     54   2.26593  2.29030  2.76601  0.31181     55 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     55   2.26593  2.29030  2.76601  0.31181     56 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     56   2.39558  0.32068  2.95885  2.02994     57 C - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     57   2.30534  3.12204  0.23733  2.69597     58 G - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     58   0.23431  2.86460  2.62614  2.53179     59 A - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     59   1.81039  1.10283  2.34106  0.89586     60 u - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     60   1.81068  1.09350  2.34184  0.90321     61 u - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     61   3.00308  0.28386  2.67186  2.05286     62 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     62   1.40018  1.07245  1.48219  1.69206     63 c - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     63   2.99483  0.28498  2.66860  2.05124     64 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     64   1.39930  1.07371  1.48229  1.69078     65 c - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     65   2.09668  2.70224  0.31051  2.56386     66 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     66   1.29468  1.69346  1.37752  1.23812     67 u - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     67   0.53113  2.46484  1.46640  2.34049     68 A - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     68   2.52828  1.78440  2.16542  0.45004     69 U - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     69   2.54850  0.71164  2.25714  1.11990     70 c - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     70   1.88844  1.08198  1.08743  1.75627     71 c - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     71   2.11092  2.71850  0.30443  2.58552     72 G - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     72   1.40959  1.06246  1.48726  1.69195     73 c - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.04879  3.73767  3.73767  1.46634  0.26236  1.09861  0.40547
+     73   0.90952  2.28340  1.07370  1.87338     74 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02469  3.71357        *  1.46634  0.26236  0.00000        *
+//
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cmpress_input_minifam.cm	Sat Jan 21 17:36:57 2017 -0500
@@ -0,0 +1,2830 @@
+INFERNAL1/a [1.1rc1 | June 2012]
+NAME     tRNA5
+STATES   230
+NODES    61
+CLEN     72
+W        89
+ALPH     RNA
+RF       no
+CONS     yes
+MAP      yes
+DATE     Tue Jun 12 17:22:37 2012
+COM      [1] ./cmbuild tRNA5.cm ../tutorial/tRNA5.sto
+COM      [2] ./cmcalibrate ./tRNA5.cm
+PBEGIN   0.05
+PEND     0.05
+WBETA    1e-07
+QDBBETA1 1e-07
+QDBBETA2 1e-15
+N2OMEGA  1.52588e-05
+N3OMEGA  1.52588e-05
+ELSELF   -0.08926734
+NSEQ     5
+EFFN     3.725586
+CKSUM    3535941971
+NULL     0.000  0.000  0.000  0.000 
+EFP7GF   -5.5288 0.72958
+ECMLC    0.85563    -4.01853     2.43520     1600000      300168  0.003998
+ECMGC    0.39437   -17.41037    -4.06685     1600000       77168  0.005183
+ECMLI    0.73047    -3.70982     3.57712     1600000      245977  0.004879
+ECMGI    0.44078   -12.13534    -0.86006     1600000       57603  0.006944
+CM
+                                             [ ROOT    0 ]      -      - - - - -
+     S     0    -1 0     1     4     0     1    89   108  -7.419  -8.664  -0.055  -5.118                 
+    IL     1     1 2     1     4     3    28    90   110  -2.817  -4.319  -0.613  -2.698                  0.000  0.000  0.000  0.000 
+    IR     2     2 3     2     3     4    30    90   110  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR    1 ]      -     74 - a - -
+    MR     3     2 3     5     5     4    32    89   108  -7.593  -0.028  -7.408  -7.620  -8.512          0.474 -1.199  0.305 -0.089 
+     D     4     2 3     5     5     1    24    87   107  -5.352  -0.707  -2.978  -4.409  -2.404         
+    IR     5     5 3     5     5     3    28    89   109  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    2 ]      1     73 g c - -
+    MP     6     5 3    10     6     5    32    88   107  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.831 -2.997 -3.795  0.617 -3.618 -4.452  0.854 -3.918 -3.870  2.837 -4.276 -0.713  1.871 -3.843 -1.175 -2.703 
+    ML     7     5 3    10     6     3    26    86   106  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR     8     5 3    10     6     3    25    86   106  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D     9     5 3    10     6     0    21    84   103  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    10    10 5    10     6     3    27    87   107  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    11    11 6    11     5     3    27    87   107  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    3 ]      2     72 C G - -
+    MP    12    11 6    16     6     5    31    86   105  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -4.097 -3.805 -3.998  0.021 -3.009 -4.646  3.103 -3.661 -3.977  1.529 -4.392 -1.585  0.835 -4.247 -0.625 -2.808 
+    ML    13    11 6    16     6     2    25    84   104  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    14    11 6    16     6     2    25    84   104  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    15    11 6    16     6     0    21    82   101  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    16    16 5    16     6     3    27    85   105  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    17    17 6    17     5     3    27    85   105  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    4 ]      3     71 c g - -
+    MP    18    17 6    22     6     5    29    84   103  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.141 -2.880 -3.222  0.733 -2.762 -4.023  2.237 -3.232 -3.242  1.678 -3.747  0.537  1.616 -3.340 -0.447 -2.158 
+    ML    19    17 6    22     6     2    25    82   102  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    20    17 6    22     6     2    24    82   102  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    21    17 6    22     6     0    20    80    99  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    22    22 5    22     6     3    26    83   103  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    23    23 6    23     5     3    26    83   103  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    5 ]      4     70 g c - -
+    MP    24    23 6    28     6     5    28    82   101  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.477 -2.737 -3.484  0.861 -3.437 -4.224  1.956 -3.685 -3.594  2.509 -4.028  0.683  0.624 -3.528 -1.017 -2.419 
+    ML    25    23 6    28     6     2    24    80   100  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    26    23 6    28     6     2    24    80   100  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    27    23 6    28     6     0    20    78    97  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    28    28 5    28     6     3    25    81   101  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    29    29 6    29     5     3    25    81   101  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    6 ]      5     69 g c - -
+    MP    30    29 6    34     6     5    26    80    99  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -2.565  0.048 -2.684  1.825 -2.755 -3.485  0.996 -3.019 -2.788  2.050 -3.293 -0.374  0.757 -2.774  0.549 -1.819 
+    ML    31    29 6    34     6     2    23    78    98  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    32    29 6    34     6     2    23    78    98  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    33    29 6    34     6     0    19    76    96  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    34    34 5    34     6     2    24    79    99  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    35    35 6    35     5     3    24    79    99  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    7 ]      6     68 c g - -
+    MP    36    35 6    40     6     5    24    78    97  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.250 -3.161 -3.321  0.517 -2.657 -4.117  2.088 -3.215 -3.310  1.474 -3.823 -1.143  2.088 -3.483  0.783 -2.234 
+    ML    37    35 6    40     6     2    22    77    97  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    38    35 6    40     6     2    21    77    96  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    39    35 6    40     6     0    19    75    95  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    40    40 5    40     6     2    23    77    97  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    41    41 6    41     5     2    23    77    97  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    8 ]      7     67 A U - -
+    MP    42    41 6    46     4     4    22    76    95  -7.543  -7.750  -0.035  -6.164                 -3.769 -3.134 -3.802  3.011 -3.544 -4.775  0.728 -3.793 -3.752  0.821 -4.250 -0.784  1.443 -4.133 -1.238 -2.690 
+    ML    43    41 6    46     4     1    21    76    96  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR    44    41 6    46     4     1    20    76    96  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D    45    41 6    46     4     0    19    74    94  -4.568  -4.250  -2.265  -0.520                 
+    IL    46    46 5    46     4     2    22    77    97  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR    47    47 6    47     3     2    21    76    96  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    9 ]      8      - U - - -
+    ML    48    47 6    50     3     2    20    73    93  -8.524  -0.014  -7.178                         -2.549 -2.369 -3.320  1.822 
+     D    49    47 6    50     3     0    18    72    92  -6.174  -1.687  -0.566                         
+    IL    50    50 3    50     3     2    20    75    95  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   10 ]      9      - A - - -
+    ML    51    50 3    53     2     1    19    72    92  -9.006  -0.003                                  1.048 -1.964  0.381 -1.421 
+     D    52    50 3    53     2     0    18    71    91  -8.445  -0.004                                 
+    IL    53    53 3    53     2     1    19    73    93  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ BIF    11 ]      -      - - - - -
+     B    54    53 3   124    55     0    18    71    91                                                 
+                                             [ BEGR   42 ]      -      - - - - -
+     S    55    54 1    56     3     0     0    36    55  -8.524  -0.014  -7.178                         
+    IL    56    56 2    56     3     1     1    39    59  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   43 ]     45      - A - - -
+    ML    57    56 2    59     3     1     1    36    55  -8.524  -0.014  -7.178                          1.385 -1.618 -1.684 -0.412 
+     D    58    56 2    59     3     0     0    35    54  -6.174  -1.687  -0.566                         
+    IL    59    59 3    59     3     1     1    38    57  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   44 ]     46      - G - - -
+    ML    60    59 3    62     3     1     1    35    54  -8.524  -0.014  -7.178                         -2.700 -4.060  1.885 -3.430 
+     D    61    59 3    62     3     0     0    34    53  -6.174  -1.687  -0.566                         
+    IL    62    62 3    62     3     1     1    37    56  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   45 ]     47      - g - - -
+    ML    63    62 3    65     3     1     1    34    52  -8.524  -0.481  -1.832                          0.586 -2.024  0.919 -1.466 
+     D    64    62 3    65     3     0     0    33    52  -6.174  -1.687  -0.566                         
+    IL    65    65 3    65     3     1     1    36    55  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   46 ]     48      - U - - -
+    ML    66    65 3    68     3     1     1    33    51  -8.062  -0.019  -6.716                         -1.668 -1.633 -2.411  1.667 
+     D    67    65 3    68     3     0     0    31    50  -8.417  -0.227  -2.808                         
+    IL    68    68 3    68     3     1     1    35    54  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   47 ]     49      - C - - -
+    ML    69    68 3    71     5     1     1    31    50  -7.593  -0.028  -7.408  -7.620  -8.512         -1.578  1.336 -2.466 -0.059 
+     D    70    68 3    71     5     0     0    30    49  -4.959  -0.803  -4.221  -2.596  -2.508         
+    IL    71    71 3    71     5     1     1    32    51  -2.408  -0.496  -4.087  -5.920  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   48 ]     50     66 C G - -
+    MP    72    71 3    76     6     2     2    30    49  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -4.063 -3.835 -3.975  1.367 -2.984 -4.641  3.137 -3.636 -3.945  0.196 -4.368 -1.641  0.814 -4.253 -0.622 -2.801 
+    ML    73    71 3    76     6     1     1    29    48  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    74    71 3    76     6     1     1    29    48  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    75    71 3    76     6     0     0    27    45  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    76    76 5    76     6     1     1    30    49  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    77    77 6    77     5     1     1    30    49  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   49 ]     51     65 g c - -
+    MP    78    77 6    82     6     2     2    28    47  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.269 -3.002 -3.316  0.607 -2.825 -4.080  1.486 -3.318 -3.360  2.123 -3.845 -0.940  1.986 -3.442  0.799 -2.268 
+    ML    79    77 6    82     6     1     1    27    46  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    80    77 6    82     6     1     1    27    46  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    81    77 6    82     6     0     0    25    44  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    82    82 5    82     6     1     1    28    47  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    83    83 6    83     5     1     1    28    47  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   50 ]     52     64 g c - -
+    MP    84    83 6    88     6     2     2    26    45  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.573 -3.001 -3.543  0.634 -3.168 -4.231  1.794 -3.603 -3.657  2.626 -4.078 -0.813  0.766 -3.618  0.675 -2.477 
+    ML    85    83 6    88     6     1     1    25    44  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    86    83 6    88     6     1     1    25    44  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    87    83 6    88     6     0     0    23    42  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    88    88 5    88     6     1     1    26    45  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    89    89 6    89     5     1     1    26    45  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   51 ]     53     63 g c - -
+    MP    90    89 6    94     6     2     2    24    43  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.680 -2.656 -3.624  1.495 -4.000 -4.305  0.538 -4.011 -3.825  2.937 -4.200 -0.344  1.037 -3.597 -1.457 -2.574 
+    ML    91    89 6    94     6     1     1    24    43  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    92    89 6    94     6     1     1    24    43  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    93    89 6    94     6     0     0    22    41  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    94    94 5    94     6     1     1    24    43  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    95    95 6    95     5     1     1    24    43  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   52 ]     54     62 G C - -
+    MP    96    95 6   100     4     2     2    22    41  -7.543  -7.750  -0.035  -6.164                 -5.814 -3.622 -6.104 -0.561 -6.715 -5.090 -1.814 -6.360 -4.961  3.816 -5.237 -1.382 -2.178 -5.150 -3.925 -4.967 
+    ML    97    95 6   100     4     1     1    24    43  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR    98    95 6   100     4     1     1    23    42  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D    99    95 6   100     4     0     0    22    41  -4.568  -4.250  -2.265  -0.520                 
+    IL   100   100 5   100     4     1     1    25    44  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   101   101 6   101     3     1     1    24    43  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   53 ]     55      - U - - -
+    ML   102   101 6   104     3     1     1    20    38  -8.524  -0.014  -7.178                         -2.549 -2.369 -3.320  1.822 
+     D   103   101 6   104     3     0     0    19    38  -6.174  -1.687  -0.566                         
+    IL   104   104 3   104     3     1     1    23    42  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   54 ]     56      - U - - -
+    ML   105   104 3   107     3     1     1    18    37  -8.524  -0.014  -7.178                         -2.549 -2.369 -3.320  1.822 
+     D   106   104 3   107     3     0     0    18    37  -6.174  -1.687  -0.566                         
+    IL   107   107 3   107     3     1     1    22    41  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   55 ]     57      - C - - -
+    ML   108   107 3   110     3     1     1    17    36  -8.524  -0.014  -7.178                         -3.081  1.849 -3.880 -2.250 
+     D   109   107 3   110     3     0     0    17    35  -6.174  -1.687  -0.566                         
+    IL   110   110 3   110     3     1     1    21    39  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   56 ]     58      - G - - -
+    ML   111   110 3   113     3     1     1    16    34  -8.524  -0.014  -7.178                         -0.198 -2.380  1.409 -1.835 
+     D   112   110 3   113     3     0     0    16    34  -6.174  -1.687  -0.566                         
+    IL   113   113 3   113     3     1     1    20    38  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   57 ]     59      - A - - -
+    ML   114   113 3   116     3     1     1    14    33  -8.524  -0.014  -7.178                          1.878 -3.490 -3.019 -3.147 
+     D   115   113 3   116     3     0     0    15    33  -6.174  -1.687  -0.566                         
+    IL   116   116 3   116     3     1     1    19    37  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   58 ]     60      - U - - -
+    ML   117   116 3   119     3     1     1    13    31  -8.524  -0.014  -7.178                         -1.468 -0.407 -2.235  1.418 
+     D   118   116 3   119     3     0     0    13    32  -6.174  -1.687  -0.566                         
+    IL   119   119 3   119     3     1     1    18    36  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   59 ]     61      - U - - -
+    ML   120   119 3   122     2     1     1     1     1       *   0.000                                 -1.239  0.314 -2.046  1.064 
+     D   121   119 3   122     2     0     0     0     0       *   0.000                                 
+    IL   122   122 3   122     2     1     1    13    28  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ END    60 ]      -      - - - - -
+     E   123   122 3    -1     0     0     0     0     0                                                 
+                                             [ BEGL   12 ]      -      - - - - -
+     S   124    54 1   125     1     0     3    49    68   0.000                                         
+                                             [ BIF    13 ]      -      - - - - -
+     B   125   124 1   126   173     0     3    49    68                                                 
+                                             [ BEGL   14 ]      -      - - - - -
+     S   126   125 1   127     4     0     0    30    48  -0.035  -7.164  -6.572  -7.212                 
+                                             [ MATP   15 ]     10     26 G C - -
+    MP   127   126 1   131     6     2     2    30    48  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -4.768 -3.151 -4.805  0.251 -5.796 -4.949 -0.981 -5.231 -4.514  3.516 -4.857  0.895 -1.246 -4.551 -3.005 -3.683 
+    ML   128   126 1   131     6     1     1    28    47  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   129   126 1   131     6     1     1    28    47  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   130   126 1   131     6     0     0    26    45  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   131   131 5   131     6     1     1    29    48  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   132   132 6   132     5     1     1    29    48  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   16 ]     11     25 c g - -
+    MP   133   132 6   137     6     2     2    28    46  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -4.380 -4.331 -4.172 -0.461 -2.935 -4.679  2.953 -3.697 -4.172 -0.278 -4.524 -2.247  2.367 -4.479 -0.580 -2.998 
+    ML   134   132 6   137     6     1     1    27    45  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   135   132 6   137     6     1     1    26    45  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   136   132 6   137     6     0     0    24    43  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   137   137 5   137     6     1     1    27    46  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   138   138 6   138     5     1     1    27    46  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   17 ]     12     24 g c - -
+    MP   139   138 6   143     6     2     2    26    44  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.838 -2.993 -3.801  0.619 -3.635 -4.454  0.839 -3.930 -3.877  2.852 -4.281 -0.708  1.851 -3.845 -1.190 -2.710 
+    ML   140   138 6   143     6     1     1    25    44  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   141   138 6   143     6     1     1    25    44  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   142   138 6   143     6     0     0    24    42  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   143   143 5   143     6     1     1    26    44  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   144   144 6   144     5     1     1    25    44  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   18 ]     13     23 c g - -
+    MP   145   144 6   149     4     2     2    24    42  -7.543  -7.750  -0.035  -6.164                 -3.454 -3.490 -3.467  0.042 -2.692 -4.152  2.807 -3.318 -3.483  0.166 -3.945 -1.653  0.946 -3.679  1.162  0.637 
+    ML   146   144 6   149     4     1     1    25    44  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR   147   144 6   149     4     1     1    24    43  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D   148   144 6   149     4     0     0    23    42  -4.568  -4.250  -2.265  -0.520                 
+    IL   149   149 5   149     4     1     1    26    45  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   150   150 6   150     3     1     1    25    44  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   19 ]     14      - A - - -
+    ML   151   150 6   153     3     1     1    20    39  -8.524  -0.014  -7.178                          1.878 -3.490 -3.019 -3.147 
+     D   152   150 6   153     3     0     0    20    39  -6.174  -1.687  -0.566                         
+    IL   153   153 3   153     3     1     1    24    43  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   20 ]     15      - g - - -
+    ML   154   153 3   156     3     1     1    19    38  -8.524  -0.014  -7.178                          0.586 -2.024  0.919 -1.466 
+     D   155   153 3   156     3     0     0    19    37  -6.174  -1.687  -0.566                         
+    IL   156   156 3   156     3     1     1    23    42  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   21 ]     16      - U - - -
+    ML   157   156 3   159     3     1     1    18    36  -1.899  -0.464  -7.178                         -1.468 -0.407 -2.235  1.418 
+     D   158   156 3   159     3     0     0    16    35  -6.174  -1.687  -0.566                         
+    IL   159   159 3   159     3     1     1    18    36  -2.374  -0.363  -5.074                          0.000  0.000  0.000  0.000 
+                                             [ MATL   22 ]     18      - G - - -
+    ML   160   159 3   162     3     1     1    16    34  -8.524  -0.014  -7.178                         -2.700 -4.060  1.885 -3.430 
+     D   161   159 3   162     3     0     0    16    35  -6.174  -1.687  -0.566                         
+    IL   162   162 3   162     3     1     1    20    39  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   23 ]     19      - G - - -
+    ML   163   162 3   165     3     1     1    14    33  -8.524  -0.014  -7.178                         -2.700 -4.060  1.885 -3.430 
+     D   164   162 3   165     3     0     0    15    33  -6.174  -1.687  -0.566                         
+    IL   165   165 3   165     3     1     1    19    38  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   24 ]     20      - u - - -
+    ML   166   165 3   168     3     1     1    11    23  -1.854  -0.481  -7.178                         -0.664 -0.325 -0.613  0.939 
+     D   167   165 3   168     3     0     0     9    20  -6.174  -1.687  -0.566                         
+    IL   168   168 3   168     3     1     1    11    22  -2.396  -0.357  -5.096                          0.000  0.000  0.000  0.000 
+                                             [ MATL   25 ]     22      - A - - -
+    ML   169   168 3   171     2     1     1     1     1       *   0.000                                  1.878 -3.490 -3.019 -3.147 
+     D   170   168 3   171     2     0     0     0     0       *   0.000                                 
+    IL   171   171 3   171     2     1     1    13    28  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ END    26 ]      -      - - - - -
+     E   172   171 3    -1     0     0     0     0     0                                                 
+                                             [ BEGR   27 ]      -      - - - - -
+     S   173   125 1   174     3     0     0    32    50  -8.524  -0.014  -7.178                         
+    IL   174   174 2   174     3     1     1    35    54  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   28 ]     27      - g - - -
+    ML   175   174 2   177     5     1     1    31    50  -7.593  -0.028  -7.408  -7.620  -8.512          0.512 -2.047  0.983 -1.490 
+     D   176   174 2   177     5     0     0    30    49  -4.959  -0.803  -4.221  -2.596  -2.508         
+    IL   177   177 3   177     5     1     1    32    51  -2.408  -0.496  -4.087  -5.920  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   29 ]     28     44 c g - -
+    MP   178   177 3   182     6     2     2    30    49  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -2.996 -2.785 -3.094  0.747 -2.684 -3.890  2.204 -3.144 -3.118  1.704 -3.626  0.455  1.175 -3.212  0.643 -2.072 
+    ML   179   177 3   182     6     1     1    29    48  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   180   177 3   182     6     1     1    29    48  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   181   177 3   182     6     0     0    27    45  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   182   182 5   182     6     1     1    30    49  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   183   183 6   183     5     1     1    30    49  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   30 ]     29     43 c g - -
+    MP   184   183 6   188     6     2     2    28    47  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.660 -3.462 -3.663  0.355 -2.818 -4.407  2.681 -3.427 -3.639  1.512 -4.115 -1.306  1.763 -3.844 -0.432 -2.489 
+    ML   185   183 6   188     6     1     1    27    46  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   186   183 6   188     6     1     1    27    46  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   187   183 6   188     6     0     0    25    44  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   188   188 5   188     6     1     1    28    47  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   189   189 6   189     5     1     1    28    47  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   31 ]     30     42 a u - -
+    MP   190   189 6   194     6     2     2    26    45  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.311 -3.146 -3.360  2.221 -2.772 -4.127  2.025 -3.303 -3.378  0.846 -3.868 -1.127  1.693 -3.528 -0.491 -2.313 
+    ML   191   189 6   194     6     1     1    25    44  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   192   189 6   194     6     1     1    25    44  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   193   189 6   194     6     0     0    23    42  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   194   194 5   194     6     1     1    26    45  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   195   195 6   195     5     1     1    26    45  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   32 ]     31     41 g c - -
+    MP   196   195 6   200     6     2     2    24    43  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.453 -2.737 -3.468  0.855 -3.398 -4.215  1.983 -3.656 -3.568  2.448 -4.006  0.791  0.648 -3.520 -0.989 -2.403 
+    ML   197   195 6   200     6     1     1    24    43  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   198   195 6   200     6     1     1    24    43  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   199   195 6   200     6     0     0    22    41  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   200   200 5   200     6     1     1    24    43  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   201   201 6   201     5     1     1    24    43  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   33 ]     32     40 c g - -
+    MP   202   201 6   206     4     2     2    22    41  -7.543  -7.750  -0.035  -6.164                 -3.332 -2.890 -3.380  1.837 -3.037 -4.188  2.208 -3.435 -3.424  1.867 -3.910 -0.719  0.913 -3.503 -0.696 -2.309 
+    ML   203   201 6   206     4     1     1    24    43  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR   204   201 6   206     4     1     1    23    42  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D   205   201 6   206     4     0     0    22    41  -4.568  -4.250  -2.265  -0.520                 
+    IL   206   206 5   206     4     1     1    25    44  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   207   207 6   207     3     1     1    24    43  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   34 ]     33      - c - - -
+    ML   208   207 6   210     3     1     1    20    38  -8.524  -0.014  -7.178                         -1.256  0.893 -2.113  0.579 
+     D   209   207 6   210     3     0     0    19    38  -6.174  -1.687  -0.566                         
+    IL   210   210 3   210     3     1     1    23    42  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   35 ]     34      - U - - -
+    ML   211   210 3   213     3     1     1    18    37  -8.524  -0.014  -7.178                         -2.549 -2.369 -3.320  1.822 
+     D   212   210 3   213     3     0     0    18    37  -6.174  -1.687  -0.566                         
+    IL   213   213 3   213     3     1     1    22    41  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   36 ]     35      - g - - -
+    ML   214   213 3   216     3     1     1    17    36  -8.524  -0.014  -7.178                         -0.763 -1.427  0.837  0.325 
+     D   215   213 3   216     3     0     0    17    35  -6.174  -1.687  -0.566                         
+    IL   216   216 3   216     3     1     1    21    39  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   37 ]     36      - u - - -
+    ML   217   216 3   219     3     1     1    16    34  -8.524  -0.014  -7.178                          0.037 -0.330 -0.381  0.496 
+     D   218   216 3   219     3     0     0    16    34  -6.174  -1.687  -0.566                         
+    IL   219   219 3   219     3     1     1    20    38  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   38 ]     37      - c - - -
+    ML   220   219 3   222     3     1     1    14    33  -8.524  -0.014  -7.178                          0.403  0.783 -1.648 -0.649 
+     D   221   219 3   222     3     0     0    15    33  -6.174  -1.687  -0.566                         
+    IL   222   222 3   222     3     1     1    19    37  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   39 ]     38      - A - - -
+    ML   223   222 3   225     3     1     1    13    31  -8.524  -0.014  -7.178                          1.037 -1.963  0.397 -1.419 
+     D   224   222 3   225     3     0     0    13    32  -6.174  -1.687  -0.566                         
+    IL   225   225 3   225     3     1     1    18    36  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   40 ]     39      - a - - -
+    ML   226   225 3   228     2     1     1     1     1       *   0.000                                  0.957  0.166 -1.522 -0.764 
+     D   227   225 3   228     2     0     0     0     0       *   0.000                                 
+    IL   228   228 3   228     2     1     1    13    28  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ END    41 ]      -      - - - - -
+     E   229   228 3    -1     0     0     0     0     0                                                 
+//
+HMMER3/f [i1.1rc1 | June 2012]
+NAME  tRNA5
+LENG  72
+MAXL  152
+ALPH  RNA
+RF    no
+MM    no
+CONS  yes
+CS    yes
+MAP   yes
+DATE  Tue Jun 12 17:22:38 2012
+COM   [1] ./cmbuild tRNA5.cm ../tutorial/tRNA5.sto
+NSEQ  5
+EFFN  4.575195
+CKSUM 3535941971
+STATS LOCAL MSV       -8.3361  0.72958
+STATS LOCAL VITERBI   -9.7423  0.72958
+STATS LOCAL FORWARD   -2.8398  0.72958
+HMM          A        C        G        U   
+            m->m     m->i     m->d     i->m     i->i     d->m     d->d
+  COMPO   1.54533  1.43782  1.21668  1.37396
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  0.00000        *
+      1   2.27104  2.21243  0.67362  1.28194      1 G - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      2   2.71979  0.53764  1.58904  1.92505      2 C - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      3   2.13247  1.12928  1.19870  1.36023      3 c - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      4   2.06386  1.33928  0.73468  2.02995      4 g - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      5   1.11916  2.01343  1.13651  1.51879      5 a - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      6   2.27600  1.26221  1.56184  0.90503      6 u - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      7   0.55854  2.34742  2.06069  1.58488      7 A - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      8   3.41131  3.24840  3.95063  0.09549      8 U - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+      9   0.62589  2.93067  1.09257  2.57049      9 A - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     10   2.58478  3.48701  0.15236  3.34349     10 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     11   3.04360  0.66824  2.81745  0.96766     11 C - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     12   2.27167  2.22390  0.66329  1.29638     12 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     13   2.70763  0.72972  2.52177  0.99171     13 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     14   0.06447  4.06946  3.72356  3.85378     14 A - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     15   0.96309  2.96228  0.71023  2.58952     15 g - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     16   2.58013  1.68600  3.11568  0.36438     16 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.36284  1.23646  4.27667  0.09305  2.42079  1.09861  0.40547
+     17   3.50204  4.46790  0.06149  4.01568     18 G - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     18   3.50204  4.46790  0.06149  4.01568     19 G - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     19   1.92921  1.61736  1.81487  0.70632     20 u - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.37560  1.20654  4.27667  0.09038  2.44862  1.09861  0.40547
+     20   0.06447  4.06946  3.72356  3.85378     22 A - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     21   2.10278  2.68978  0.46988  1.68787     23 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     22   1.38592  0.72007  2.05285  2.00384     24 c - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     23   1.05742  2.98038  0.61496  2.79344     25 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     24   3.52889  0.29960  3.29055  1.64863     26 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     25   1.01810  2.97712  0.66580  2.60482     27 G - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     26   2.11085  1.15042  1.18985  1.35443     28 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     27   2.42824  0.83921  1.56647  1.30573     29 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     28   1.09889  1.29935  2.02826  1.33756     30 a - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     29   2.06898  1.31812  0.74979  2.01303     31 g - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     30   1.36950  1.15928  1.31013  1.81850     32 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     31   2.40938  0.72219  3.02139  0.97894     33 c - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     32   3.41131  3.24840  3.95063  0.09549     34 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     33   2.03026  2.49922  0.75131  1.15581     35 g - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     34   1.37091  1.61913  1.64530  1.03536     36 u - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     35   1.09596  0.79030  2.66885  1.94670     37 c - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     36   0.63350  2.92991  1.08102  2.56892     38 A - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     37   0.68448  1.23998  2.57183  2.04128     39 A - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     38   2.05098  1.42195  1.06925  1.24869     40 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     39   2.25157  1.00742  1.23141  1.43664     41 c - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     40   1.49091  2.19537  1.18474  1.02809     42 u - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     41   1.46309  1.66242  0.76188  2.18914     43 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     42   1.84429  1.51321  0.88732  1.56112     44 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     43   0.38710  2.63412  2.69028  1.70743     45 A - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     44   3.50204  4.46790  0.06149  4.01568     46 G - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     45   0.96309  2.96228  0.71023  2.58952     47 g - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.37560  4.27667  1.20654  1.46634  0.26236  1.09861  0.40547
+     46   2.76487  2.70273  3.28806  0.18312     48 U - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.03964  3.94071  3.94071  1.46634  0.26236  0.08877  2.46575
+     47   2.65665  0.41541  3.29031  1.45884     49 C - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     48   1.72807  0.51473  2.49712  1.94920     50 C - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     49   2.23405  1.71156  1.13675  0.93787     51 u - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     50   2.24174  1.47214  0.80734  1.52210     52 g - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     51   1.62002  2.40165  0.60094  1.81254     53 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     52   3.13623  4.03650  0.08313  3.98115     54 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     53   3.41131  3.24840  3.95063  0.09549     55 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     54   3.41131  3.24840  3.95063  0.09549     56 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     55   3.81775  0.07857  4.34279  3.20425     57 C - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     56   1.55092  3.20619  0.37228  2.84263     58 G - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     57   0.06447  4.06946  3.72356  3.85378     59 A - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     58   2.58013  1.68600  3.11568  0.36438     60 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     59   2.39994  1.14144  2.97016  0.61874     61 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     60   4.11656  0.10126  3.89068  2.82057     62 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     61   1.95700  0.67131  2.21870  1.43159     63 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     62   2.18076  0.86710  1.10730  1.99196     64 c - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     63   1.27825  1.21396  1.24116  1.99945     65 c - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     64   2.19639  2.68263  0.47103  1.62938     66 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     65   1.68678  2.30864  2.17351  0.50798     67 U - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     66   1.21618  1.66846  0.95030  2.05201     68 g - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     67   2.09329  1.05549  1.48837  1.19416     69 c - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     68   2.26917  0.96322  1.25225  1.47369     70 c - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     69   1.53154  1.55221  1.02428  1.54664     71 g - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     70   2.18028  1.66521  0.48878  2.47139     72 G - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     71   1.37162  0.72882  2.04389  2.00766     73 c - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02817  4.27667  4.27667  1.46634  0.26236  1.09861  0.40547
+     72   1.04988  2.29119  1.14633  1.46503     74 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.01418  4.26268        *  1.46634  0.26236  0.00000        *
+//
+INFERNAL1/a [1.1rc1 | June 2012]
+NAME     5S_rRNA
+ACC      RF00001
+DESC     5S ribosomal RNA
+STATES   366
+NODES    91
+CLEN     119
+W        194
+ALPH     RNA
+RF       no
+CONS     yes
+MAP      yes
+DATE     Wed Jun 13 05:38:49 2012
+COM      [1] ./cmbuild 5S_rRNA.cm 5S_rRNA.sto
+COM      [2] ./cmcalibrate 5S_rRNA.cm
+PBEGIN   0.05
+PEND     0.05
+WBETA    1e-07
+QDBBETA1 1e-07
+QDBBETA2 1e-15
+N2OMEGA  1.52588e-05
+N3OMEGA  1.52588e-05
+ELSELF   -0.08926734
+NSEQ     712
+EFFN     7.433868
+CKSUM    4276491820
+NULL     0.000  0.000  0.000  0.000 
+GA       16.00
+TC       22.36
+EFP7GF   -8.5723 0.71822
+ECMLC    0.67926    -7.69058     0.61964     1600000      339385  0.003536
+ECMGC    0.40924   -15.61533    -6.37104     1600000       17582  0.022751
+ECMLI    0.59553    -5.30857     3.39282     1600000      213627  0.005617
+ECMGI    0.42140   -10.60787    -1.63456     1600000       17550  0.022792
+CM
+                                             [ ROOT    0 ]      -      - - - - -
+     S     0    -1 0     1     4     1     1   194   299  -8.149  -9.394  -0.213  -2.920                 
+    IL     1     1 2     1     4    29    67   196   300  -2.817  -4.319  -0.613  -2.698                  0.000  0.000  0.000  0.000 
+    IR     2     2 3     2     3    31    69   196   300  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR    1 ]      -    231 - c - -
+    MR     3     2 3     5     5    33    71   195   299  -8.108  -0.047  -7.923  -5.495  -9.027         -0.544  0.804 -1.352  0.234 
+     D     4     2 3     5     5    25    62   193   297  -6.511  -0.673  -2.947  -4.924  -2.327         
+    IR     5     5 3     5     5    29    67   195   299  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    2 ]      3    230 g c - -
+    MP     6     5 3    10     6    34    72   194   298  -9.727  -9.667  -0.015  -8.101  -8.723  -9.118 -1.796 -1.228 -2.016  1.254 -1.861 -2.412  1.479 -2.183 -2.024  1.795 -2.414 -0.380  1.313 -0.945  0.075 -1.147 
+    ML     7     5 3    10     6    27    64   191   296  -6.518  -6.864  -1.441  -1.146  -3.216  -4.243  0.732 -0.637 -0.336 -0.145 
+    MR     8     5 3    10     6    27    64   191   296  -7.290  -6.019  -1.258  -5.997  -1.028  -4.211  0.222 -0.274 -0.145  0.141 
+     D     9     5 3    10     6    23    59   187   291  -9.543  -8.241  -3.847  -4.518  -4.150  -0.276 
+    IL    10    10 5    10     6    29    66   193   297  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    11    11 6    11     5    29    67   193   297  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    3 ]      4    229 c g - -
+    MP    12    11 6    16     6    33    71   192   296  -9.745  -9.685  -0.014  -8.461  -8.541  -9.136 -1.398 -1.972 -1.476  1.153 -1.599 -2.821  1.776 -0.759 -2.037  0.970 -2.079  0.278  1.380 -1.338  0.141 -0.885 
+    ML    13    11 6    16     6    27    64   190   294  -6.344  -6.690  -1.181  -1.099  -6.540  -4.070  0.333 -0.380 -0.240  0.170 
+    MR    14    11 6    16     6    27    63   189   293  -7.205  -5.934  -1.598  -5.912  -0.804  -4.126  0.194 -0.386 -0.232  0.309 
+     D    15    11 6    16     6    23    58   185   289  -9.494  -8.193  -2.948  -4.237  -3.482  -0.468 
+    IL    16    16 5    16     6    28    65   191   295  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    17    17 6    17     5    28    66   191   295  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    4 ]      5    228 u a - -
+    MP    18    17 6    22     6    33    69   190   294  -9.759  -9.698  -0.015  -8.475  -8.386  -8.870 -1.644 -2.086 -1.824  1.626 -1.973 -2.951  1.748 -1.634 -2.136  0.978 -2.655 -0.610  1.757 -2.023 -0.041 -1.316 
+    ML    19    17 6    22     6    26    63   188   292  -6.271  -6.617  -1.280  -1.026  -6.467  -3.997  0.441 -0.436 -0.185  0.034 
+    MR    20    17 6    22     6    26    63   187   292  -7.197  -5.926  -1.268  -5.904  -1.038  -4.118  0.659 -0.499 -0.404 -0.063 
+     D    21    17 6    22     6    22    58   183   287  -9.291  -7.990  -3.650  -4.469  -3.455  -0.361 
+    IL    22    22 5    22     6    28    65   189   293  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    23    23 6    23     5    28    65   189   293  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    5 ]      6    227 u a - -
+    MP    24    23 6    28     6    32    68   188   292  -9.772  -9.711  -0.015  -8.139  -8.446  -9.162 -0.763 -2.036 -2.097  1.027 -2.020 -2.946  1.296 -2.420 -1.632  1.715 -2.736 -0.453  1.899 -1.579 -0.128 -1.280 
+    ML    25    23 6    28     6    26    62   186   290  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    26    23 6    28     6    26    62   185   289  -7.058  -5.787  -1.489  -5.765  -0.899  -3.979  0.325 -0.225 -0.338  0.138 
+     D    27    23 6    28     6    22    57   181   285  -9.224  -7.923  -3.602  -2.895  -4.419  -0.453 
+    IL    28    28 5    28     6    27    64   187   291  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    29    29 6    29     5    27    64   187   291  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    6 ]      7    226 G C - -
+    MP    30    29 6    34     6    31    66   186   290  -9.774  -7.769  -0.032  -6.644  -8.225  -8.530 -3.181 -2.552 -3.646  1.620 -4.346 -2.749  0.395 -3.915 -3.660  3.062 -4.315 -0.334  0.058 -3.571 -1.821 -1.707 
+    ML    31    29 6    34     6    26    62   184   288  -6.379  -6.725  -1.383  -0.926  -6.575  -4.104  0.436 -0.573  0.060 -0.101 
+    MR    32    29 6    34     6    25    61   183   287  -7.003  -5.732  -1.640  -5.710  -0.817  -3.923  0.430 -0.428 -0.185  0.043 
+     D    33    29 6    34     6    21    56   179   283  -9.083  -7.781  -3.418  -4.083  -4.277  -0.341 
+    IL    34    34 5    34     6    27    63   185   289  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    35    35 6    35     5    27    63   185   289  -2.454  -0.478  -5.965  -4.133  -5.239          0.000  0.000  0.000  0.000 
+                                             [ MATP    7 ]      8    224 c g - -
+    MP    36    35 6    40     6    30    65   184   288  -5.817  -9.701  -0.039  -8.478  -8.378  -8.822 -2.820 -2.924 -2.968  0.422 -1.344 -3.630  2.734 -2.971 -2.991  0.517 -0.986 -1.247  1.006 -2.946  1.099 -2.061 
+    ML    37    35 6    40     6    25    61   182   286  -6.555  -6.901  -1.581  -0.771  -6.751  -4.280  0.051  0.251 -0.638  0.177 
+    MR    38    35 6    40     6    25    60   181   285  -7.030  -5.759  -1.577  -5.737  -0.849  -3.951  0.435 -0.508 -0.024 -0.057 
+     D    39    35 6    40     6    21    56   177   281  -9.095  -7.793  -3.590  -4.272  -4.290  -0.308 
+    IL    40    40 5    40     6    27    62   183   287  -2.909  -2.344  -0.766  -4.827  -5.603  -5.263  0.000  0.000  0.000  0.000 
+    IR    41    41 6    41     5    27    62   183   287  -2.155  -0.546  -6.097  -4.265  -5.371          0.000  0.000  0.000  0.000 
+                                             [ MATP    8 ]     10    221 g c - -
+    MP    42    41 6    46     6    28    63   182   286  -9.763  -9.702  -0.031  -7.050  -6.738  -9.153 -2.984 -2.237 -2.955  1.376 -3.587 -2.872  0.367 -3.481 -2.686  2.522 -2.374  1.760  0.115 -3.153 -1.397 -1.809 
+    ML    43    41 6    46     6    25    60   180   284  -6.543  -6.889  -1.094  -1.149  -6.739  -4.269  0.168 -0.707  0.472 -0.189 
+    MR    44    41 6    46     6    24    59   179   284  -7.018  -5.747  -1.601  -5.725  -0.837  -3.939  0.391 -0.410 -0.218  0.107 
+     D    45    41 6    46     6    21    55   176   280  -9.112  -7.810  -3.607  -4.120  -4.307  -0.315 
+    IL    46    46 5    46     6    26    61   181   285  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    47    47 6    47     5    26    61   181   285  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    9 ]     11    220 g c - -
+    MP    48    47 6    52     6    27    61   180   284  -6.541  -9.698  -0.027  -8.474  -8.754  -9.149 -2.268 -1.533 -1.674  1.708 -2.475 -3.114  1.010 -0.949 -2.496  2.234 -3.069 -0.049  0.804 -2.447 -0.668 -0.965 
+    ML    49    47 6    52     6    24    59   178   282  -6.463  -6.809  -1.103  -1.154  -6.659  -4.188  0.377 -0.624  0.184 -0.126 
+    MR    50    47 6    52     6    23    57   177   281  -7.173  -5.902  -1.772  -5.880  -0.718  -4.094  0.180 -0.389 -0.344  0.395 
+     D    51    47 6    52     6    21    55   175   279  -9.103  -7.801  -3.598  -4.280  -4.297  -0.306 
+    IL    52    52 5    52     6    25    60   179   283  -2.778  -2.492  -0.769  -4.696  -5.472  -5.133  0.000  0.000  0.000  0.000 
+    IR    53    53 6    53     5    25    59   179   283  -2.464  -0.474  -5.975  -4.143  -5.249          0.000  0.000  0.000  0.000 
+                                             [ MATP   10 ]     13    218 c g - -
+    MP    54    53 6    58     4    25    59   178   282  -7.038  -1.402  -0.726  -6.708                 -2.407 -2.556 -2.445  0.605 -0.506 -3.248  2.369 -2.741 -2.621  0.551 -2.224 -1.018  1.406 -2.575  1.227 -1.654 
+    ML    55    53 6    58     4    23    57   176   281  -3.782  -3.843  -0.508  -2.694                  0.372 -0.435 -0.113  0.059 
+    MR    56    53 6    58     4    21    56   175   280  -5.009  -4.038  -1.905  -0.642                  0.720 -0.627 -0.337 -0.130 
+     D    57    53 6    58     4    20    55   174   279  -4.619  -3.556  -2.316  -0.570                 
+    IL    58    58 5    58     4    24    58   177   281  -1.754  -2.115  -1.185  -4.923                  0.000  0.000  0.000  0.000 
+    IR    59    59 6    59     3    24    58   177   281  -2.897  -0.249  -5.357                          0.000  0.000  0.000  0.000 
+                                             [ MATL   11 ]     15      - C - - -
+    ML    60    59 6    62     3    23    57   175   280  -7.340  -0.015  -7.889                         -1.142  1.269 -1.129 -0.555 
+     D    61    59 6    62     3    20    54   173   277  -6.613  -1.932  -0.459                         
+    IL    62    62 3    62     3    23    57   176   280  -1.478  -0.772  -4.178                          0.000  0.000  0.000  0.000 
+                                             [ MATL   12 ]     17      - A - - -
+    ML    63    62 3    65     3    22    56   174   279  -9.238  -0.043  -5.190                          1.618 -2.024 -1.559 -1.537 
+     D    64    62 3    65     3    20    54   173   277  -6.565  -1.139  -0.901                         
+    IL    65    65 3    65     3    22    56   175   279  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   13 ]     18      - U - - -
+    ML    66    65 3    68     3    21    55   174   278  -7.315  -0.017  -7.612                         -1.363 -1.257 -1.909  1.549 
+     D    67    65 3    68     3    19    53   172   276  -6.802  -2.197  -0.372                         
+    IL    68    68 3    68     3    21    55   174   278  -1.478  -0.771  -4.178                          0.000  0.000  0.000  0.000 
+                                             [ MATL   14 ]     20      - A - - -
+    ML    69    68 3    71     2    20    54   173   277  -9.775  -0.002                                  1.515 -2.000 -1.109 -1.220 
+     D    70    68 3    71     2    19    53   172   276  -8.491  -0.004                                 
+    IL    71    71 3    71     2    20    54   173   277  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ BIF    15 ]      -      - - - - -
+     B    72    71 3    73   231    19    53   172   276                                                 
+                                             [ BEGL   16 ]      -      - - - - -
+     S    73    72 1    74     4     0    15   129   233  -0.026  -7.673  -6.956  -7.720                 
+                                             [ MATP   17 ]     21    146 c g - -
+    MP    74    73 1    78     6     2    16   129   233  -9.782  -8.043  -0.017  -8.497  -8.777  -9.172 -3.373 -3.179 -3.463  0.465 -2.670 -4.202  2.529 -3.480 -3.486  2.100 -3.111 -0.838  1.150 -3.271 -0.560 -2.356 
+    ML    75    73 1    78     6     1    11   127   231  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    76    73 1    78     6     1     9   127   231  -7.003  -5.732  -1.640  -5.710  -0.817  -3.923  0.398 -0.458 -0.065 -0.003 
+     D    77    73 1    78     6     0     6   124   229  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    78    78 5    78     6     1    12   128   232  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    79    79 6    79     5     1    12   128   232  -2.444  -0.482  -5.955  -4.123  -5.229          0.000  0.000  0.000  0.000 
+                                             [ MATP   18 ]     22    144 c g - -
+    MP    80    79 6    84     4     2    14   127   231  -4.502  -6.156  -0.099  -6.926                 -3.050 -3.094 -3.187  0.605 -1.829 -3.853  2.881 -2.966 -3.062  0.701 -2.544 -1.265  1.353 -3.172  0.098 -2.198 
+    ML    81    79 6    84     4     1    10   126   230  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR    82    79 6    84     4     1     7   125   229  -4.827  -3.856  -1.668  -0.784                  0.398 -0.458 -0.065 -0.003 
+     D    83    79 6    84     4     0     6   124   228  -4.568  -4.250  -2.265  -0.520                 
+    IL    84    84 5    84     4     1    12   127   231  -1.295  -2.498  -1.331  -5.809                  0.000  0.000  0.000  0.000 
+    IR    85    85 6    85     3     1    11   126   230  -1.626  -0.676  -4.326                          0.000  0.000  0.000  0.000 
+                                             [ MATL   19 ]     27      - a - - -
+    ML    86    85 6    88     3     1    12   125   229  -9.591  -0.008  -7.909                          0.638 -1.266  0.332 -0.377 
+     D    87    85 6    88     3     0     5   123   227  -5.620  -0.734  -1.403                         
+    IL    88    88 3    88     3     1    10   125   229  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   20 ]      -    142 - u - -
+    MR    89    88 3    91     3     1    12   124   228  -9.591  -0.012  -7.148                          0.341 -0.452 -1.252  0.662 
+     D    90    88 3    91     3     0     3   122   226  -6.390  -1.568  -0.620                         
+    IR    91    91 3    91     3     1     9   124   228  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   21 ]      -    141 - U - -
+    MR    92    91 3    94     5     1    11   123   227  -8.270  -0.018  -7.924  -8.298  -9.189         -0.766  0.066 -1.672  1.037 
+     D    93    91 3    94     5     0     2   121   225  -5.397  -0.679  -3.024  -4.455  -2.449         
+    IR    94    94 3    94     5     1     6   123   227  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   22 ]     28    140 g c - -
+    MP    95    94 3    99     6     2    11   122   226  -7.484  -9.721  -0.020  -8.300  -8.778  -9.173 -3.200 -2.453 -3.204  1.362 -2.989 -3.462  1.363 -3.631 -3.429  2.711 -3.885 -0.322  0.839 -3.112 -0.997 -2.023 
+    ML    96    94 3    99     6     1     4   120   224  -6.259  -6.605  -1.297  -1.014  -6.455  -3.984  0.355 -0.381 -0.206  0.119 
+    MR    97    94 3    99     6     1     4   119   224  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    98    94 3    99     6     0     0   115   220  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    99    99 5    99     6     1     6   121   225  -2.677  -2.939  -0.696  -4.595  -5.371  -5.031  0.000  0.000  0.000  0.000 
+    IR   100   100 6   100     5     1     6   121   225  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   23 ]     30    139 c g - -
+    MP   101   100 6   105     6     2    10   120   224  -7.456  -9.721  -0.020  -8.498  -8.777  -9.172 -2.004 -2.124 -2.134  1.185 -2.010 -2.928  2.101 -2.511 -2.256  1.454 -1.687 -0.537  1.265 -2.121  0.100 -0.938 
+    ML   102   100 6   105     6     1     3   118   222  -6.262  -6.609  -1.292  -1.017  -6.458  -3.988  0.350 -0.380 -0.212  0.129 
+    MR   103   100 6   105     6     1     3   118   222  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   104   100 6   105     6     0     0   114   218  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   105   105 5   105     6     1     5   119   223  -2.679  -2.942  -0.695  -4.597  -5.373  -5.034  0.000  0.000  0.000  0.000 
+    IR   106   106 6   106     5     1     5   119   223  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   24 ]     32    138 g c - -
+    MP   107   106 6   111     6     2     9   118   222  -7.621  -9.722  -0.020  -8.222  -8.778  -9.173 -2.352 -2.057 -2.508  1.888 -2.495 -2.537  1.364 -2.767 -2.579  1.896 -3.103  0.082  1.188 -2.616 -0.421 -1.454 
+    ML   108   106 6   111     6     1     3   116   220  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   109   106 6   111     6     1     3   116   220  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   110   106 6   111     6     0     0   113   217  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   111   111 5   111     6     1     4   117   221  -2.666  -2.929  -0.703  -4.584  -5.360  -5.021  0.000  0.000  0.000  0.000 
+    IR   112   112 6   112     5     1     4   117   221  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   25 ]     34    137 c g - -
+    MP   113   112 6   117     6     2     7   116   220  -8.008  -9.721  -0.018  -8.255  -8.777  -9.172 -2.393 -2.482 -2.419  1.090 -1.881 -3.301  2.106 -2.796 -2.611  1.602 -2.620 -0.947  1.570 -2.594  0.226 -1.700 
+    ML   114   112 6   117     6     1     2   115   219  -6.268  -6.614  -1.285  -1.023  -6.464  -3.993  0.431 -0.429 -0.185  0.042 
+    MR   115   112 6   117     6     1     2   115   219  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   116   112 6   117     6     0     0   112   216  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   117   117 5   117     6     1     4   115   219  -2.640  -2.903  -0.719  -4.558  -5.334  -4.995  0.000  0.000  0.000  0.000 
+    IR   118   118 6   118     5     1     3   115   219  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   26 ]     36    136 g c - -
+    MP   119   118 6   123     4     2     5   114   218  -5.944  -3.971  -0.138  -6.499                 -2.262 -1.457 -2.460  0.918 -2.557 -1.755  0.790 -2.487 -2.162  2.508 -2.972 -0.402  0.943  0.285 -0.541 -1.476 
+    ML   120   118 6   123     4     1     1   114   218  -3.770  -3.952  -0.502  -2.681                  0.398 -0.453 -0.073  0.002 
+    MR   121   118 6   123     4     1     1   114   218  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D   122   118 6   123     4     0     0   112   216  -4.568  -4.250  -2.265  -0.520                 
+    IL   123   123 5   123     4     1     3   121   225  -1.253  -2.895  -1.245  -5.381                  0.000  0.000  0.000  0.000 
+    IR   124   124 6   124     3     1     2   127   231  -0.255  -3.301  -4.045                          0.000  0.000  0.000  0.000 
+                                             [ MATL   27 ]     40      - a - - -
+    ML   125   124 6   127     3     1     3    73   122  -9.174  -0.009  -7.828                          0.532 -1.107  0.508 -0.584 
+     D   126   124 6   127     3     0     0    71   121  -7.362  -0.610  -1.563                         
+    IL   127   127 3   127     3     1     1    73   123  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   28 ]     41      - A - - -
+    ML   128   127 3   130     3     1     2    72   121  -4.684  -0.064  -7.749                          1.177 -0.946 -1.261 -0.318 
+     D   129   127 3   130     3     0     0    69   118  -6.306  -1.558  -0.626                         
+    IL   130   130 3   130     3     1     2    78   128  -0.554  -1.750  -5.545                          0.000  0.000  0.000  0.000 
+                                             [ MATL   29 ]     52      - a - - -
+    ML   131   130 3   133     3     1     1    69   118  -7.402  -0.032  -5.991                          0.960 -0.382 -1.560 -0.077 
+     D   132   130 3   133     3     0     0    67   117  -5.659  -0.708  -1.442                         
+    IL   133   133 3   133     3     1     1    69   118  -1.976  -0.531  -4.214                          0.000  0.000  0.000  0.000 
+                                             [ MATR   30 ]      -    118 - G - -
+    MR   134   133 3   136     3     1     2    68   117  -7.564  -0.014  -7.892                         -0.308 -2.145  1.433 -1.906 
+     D   135   133 3   136     3     0     0    66   115  -6.685  -1.301  -0.775                         
+    IR   136   136 3   136     3     1     1    68   117  -1.968  -0.535  -4.207                          0.000  0.000  0.000  0.000 
+                                             [ MATR   31 ]      -    116 - A - -
+    MR   137   136 3   139     3     1     2    67   116  -9.587  -0.008  -7.904                          1.903 -3.559 -3.485 -3.546 
+     D   138   136 3   139     3     0     0    65   114  -6.482  -1.660  -0.573                         
+    IR   139   139 3   139     3     1     1    67   116  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   32 ]      -    115 - A - -
+    MR   140   139 3   142     3     1     1    66   115  -9.587  -0.009  -7.612                          1.899 -3.448 -3.427 -3.532 
+     D   141   139 3   142     3     0     0    64   113  -6.482  -1.660  -0.573                         
+    IR   142   142 3   142     3     1     1    66   115  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   33 ]      -    114 - U - -
+    MR   143   142 3   145     5     1     1    65   114  -8.268  -0.027  -8.083  -6.672  -9.187         -1.293 -1.179 -0.842  1.374 
+     D   144   142 3   145     5     0     0    63   112  -5.419  -0.689  -2.933  -4.476  -2.470         
+    IR   145   145 3   145     5     1     1    65   114  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   34 ]     54    113 g u - -
+    MP   146   145 3   150     6     2     2    64   113  -9.775  -9.714  -0.015  -8.491  -8.235  -9.166 -1.136 -0.090 -2.376  1.409 -2.098 -2.200  1.071 -0.591 -1.633  0.686 -1.874  1.701  0.712 -2.152 -0.486 -0.975 
+    ML   147   145 3   150     6     1     1    62   112  -6.268  -6.615  -1.329  -0.987  -6.464  -3.994  0.399 -0.461 -0.059 -0.007 
+    MR   148   145 3   150     6     1     1    62   111  -7.100  -5.829  -1.440  -5.808  -0.924  -4.021  0.338 -0.285 -0.367  0.189 
+     D   149   145 3   150     6     0     0    59   108  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   150   150 5   150     6     1     1    63   112  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   151   151 6   151     5     1     1    63   112  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   35 ]     55    112 c g - -
+    MP   152   151 6   156     4     2     2    62   111  -6.850  -8.508  -0.029  -6.922                 -2.645 -2.777 -1.695  0.445 -1.899 -2.894  2.900 -2.644 -2.840  0.427 -2.830 -1.184  0.975 -2.957  0.651 -1.895 
+    ML   153   151 6   156     4     1     1    61   110  -3.772  -3.954  -0.501  -2.684                  0.343 -0.305 -0.247  0.111 
+    MR   154   151 6   156     4     1     1    60   109  -4.852  -3.881  -1.667  -0.779                  0.423 -0.501 -0.020 -0.050 
+     D   155   151 6   156     4     0     0    58   108  -4.568  -4.250  -2.265  -0.520                 
+    IL   156   156 5   156     4     1     1    62   111  -1.772  -2.455  -1.023  -4.941                  0.000  0.000  0.000  0.000 
+    IR   157   157 6   157     3     1     1    61   111  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   36 ]     57      - A - - -
+    ML   158   157 6   160     3     1     1    60   109  -4.761  -0.077  -6.039                          1.304 -1.926 -0.585 -0.733 
+     D   159   157 6   160     3     0     0    56   105  -6.203  -1.716  -0.552                         
+    IL   160   160 3   160     3     1     1    68   117  -0.538  -1.786  -5.562                          0.000  0.000  0.000  0.000 
+                                             [ MATL   37 ]     68      - C - - -
+    ML   161   160 3   163     3     1     1    44    73  -4.692  -0.063  -7.892                         -2.686  1.783 -3.106 -1.796 
+     D   162   160 3   163     3     0     0    43    71  -5.840  -0.604  -1.623                         
+    IL   163   163 3   163     3     1     1    45    73  -1.723  -0.602  -4.714                          0.000  0.000  0.000  0.000 
+                                             [ MATR   38 ]      -    111 - A - -
+    MR   164   163 3   166     3     1     1    43    72  -5.140  -0.053  -7.043                          1.660 -1.403 -2.209 -2.021 
+     D   165   163 3   166     3     0     0    41    70  -6.390  -1.568  -0.620                         
+    IR   166   166 3   166     3     1     1    44    72  -2.198  -0.442  -4.437                          0.000  0.000  0.000  0.000 
+                                             [ MATR   39 ]      -    109 - A - -
+    MR   167   166 3   169     5     1     1    42    71  -8.269  -0.025  -8.085  -6.836  -9.188          1.281 -0.532 -1.819 -0.748 
+     D   168   166 3   169     5     0     0    41    69  -5.405  -0.674  -3.032  -4.463  -2.457         
+    IR   169   169 3   169     5     1     1    42    71  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   40 ]     71    108 c g - -
+    MP   170   169 3   174     6     2     2    41    70  -9.777  -6.793  -0.027  -8.493  -8.385  -8.453 -2.108 -2.357 -2.020  0.732 -0.671 -3.032  2.600 -2.545 -2.376  0.709 -1.329 -0.854  1.131 -2.460  0.259 -1.573 
+    ML   171   169 3   174     6     1     1    39    68  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   172   169 3   174     6     1     1    39    68  -7.083  -5.812  -1.663  -5.790  -0.790  -4.004  0.544 -0.507 -0.260  0.006 
+     D   173   169 3   174     6     0     0    37    65  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   174   174 5   174     6     1     1    41    69  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   175   175 6   175     5     1     1    40    69  -2.512  -0.456  -6.023  -4.191  -5.296          0.000  0.000  0.000  0.000 
+                                             [ MATP   41 ]     72    106 g c - -
+    MP   176   175 6   180     6     2     2    39    68  -9.775  -9.715  -0.013  -8.491  -8.771  -9.166 -2.851 -1.013 -2.733  0.931 -2.826 -3.771  1.936 -3.126 -2.974  2.289 -3.437 -0.714  1.315 -2.980 -0.771 -2.081 
+    ML   177   175 6   180     6     1     1    38    66  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   178   175 6   180     6     1     1    37    66  -7.083  -5.812  -1.445  -5.790  -0.924  -4.003  0.229 -0.092 -0.419  0.192 
+     D   179   175 6   180     6     0     0    35    63  -9.092  -7.790  -3.587  -4.269  -4.286  -0.309 
+    IL   180   180 5   180     6     1     1    39    67  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   181   181 6   181     5     1     1    38    67  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   42 ]     73    105 G C - -
+    MP   182   181 6   186     6     2     2    37    66  -6.017  -9.720  -0.035  -8.497  -8.776  -8.924 -4.084 -2.336 -3.937  0.870 -4.760 -4.547  0.892 -4.526 -3.543  3.251 -4.592 -0.407 -0.045 -3.817 -1.750 -2.897 
+    ML   183   181 6   186     6     1     1    36    64  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   184   181 6   186     6     1     1    36    64  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   185   181 6   186     6     0     0    33    61  -9.092  -7.790  -3.587  -4.269  -4.286  -0.309 
+    IL   186   186 5   186     6     1     1    38    67  -1.176  -3.765  -1.219  -5.420  -6.196  -5.857  0.000  0.000  0.000  0.000 
+    IR   187   187 6   187     5     1     1    36    65  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   43 ]     78    104 a u - -
+    MP   188   187 6   192     4     2     2    35    64  -6.951  -9.391  -0.044  -5.615                 -3.456 -2.853 -3.157  2.648 -3.594 -4.334  0.545 -3.424 -3.630  1.852 -4.110 -0.409  1.354 -3.601 -1.342 -2.543 
+    ML   189   187 6   192     4     1     1    34    63  -2.408  -4.532  -1.293  -1.473                  0.368 -0.385 -0.191  0.094 
+    MR   190   187 6   192     4     1     1    34    62  -4.102 -12.528  -0.390  -2.485                  0.368 -0.385 -0.191  0.094 
+     D   191   187 6   192     4     0     0    32    60 -12.978 -14.248  -2.277  -0.334                 
+    IL   192   192 5   192     4     1     1    34    63  -2.872  -4.374  -0.585  -2.753                  0.000  0.000  0.000  0.000 
+    IR   193   193 6   193     3     1     1    35    63  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   44 ]      -    103 - C - -
+    MR   194   193 6   196     3     1     1    33    62  -9.584  -0.008  -7.902                         -2.828  1.825 -3.959 -1.985 
+     D   195   193 6   196     3     0     0    31    60  -6.529  -1.706  -0.551                         
+    IR   196   196 3   196     3     1     1    34    62  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   45 ]      -    102 - A - -
+    MR   197   196 3   199     5     1     1    32    61  -6.478  -0.058  -8.082  -7.979  -5.588          1.272 -1.440 -1.901 -0.077 
+     D   198   196 3   199     5     0     0    31    59  -5.431  -0.786  -3.058  -4.489  -2.106         
+    IR   199   199 3   199     5     1     1    32    61  -2.479  -0.468  -5.991  -4.158  -5.264          0.000  0.000  0.000  0.000 
+                                             [ MATP   46 ]     80    100 u a - -
+    MP   200   199 3   204     6     2     2    31    60  -9.758  -9.698  -0.013  -8.474  -8.754  -9.149 -0.561 -2.210 -2.229  0.728 -1.441 -3.080  1.145 -2.543 -2.140  0.582 -2.860 -0.860  2.665 -1.351 -0.331 -1.241 
+    ML   201   199 3   204     6     1     1    30    59  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   202   199 3   204     6     1     1    30    58  -7.001  -5.730  -1.597  -5.708  -0.842  -3.922  0.425 -0.425 -0.185  0.047 
+     D   203   199 3   204     6     0     0    27    56  -9.568  -8.266  -4.063  -4.745  -4.763  -0.215 
+    IL   204   204 5   204     6     1     1    31    59  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   205   205 6   205     5     1     1    30    59  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   47 ]     81     99 C G - -
+    MP   206   205 6   210     4     2     2    29    58  -4.782  -1.465  -0.754  -6.889                 -4.926 -4.877 -3.370 -0.988 -1.932 -5.295  3.525 -4.311 -4.748 -0.824 -4.376 -2.776  0.219 -5.048  0.496 -3.576 
+    ML   207   205 6   210     4     1     1    29    58  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR   208   205 6   210     4     1     1    28    56  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D   209   205 6   210     4     0     0    27    55  -5.059  -4.304  -2.756  -0.375                 
+    IL   210   210 5   210     4     1     1    32    61  -0.932  -2.911  -1.611  -5.997                  0.000  0.000  0.000  0.000 
+    IR   211   211 6   211     3     1     1    21    39  -1.678  -0.598  -5.212                          0.000  0.000  0.000  0.000 
+                                             [ MATL   48 ]     86      - C - - -
+    ML   212   211 6   214     3     1     1    18    36  -9.210  -0.009  -7.865                         -1.743  1.502 -2.606 -0.504 
+     D   213   211 6   214     3     0     0    17    36  -6.968  -1.888  -0.470                         
+    IL   214   214 3   214     3     1     1    22    40  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   49 ]     87      - C - - -
+    ML   215   214 3   217     3     1     1    17    35  -9.221  -0.009  -7.875                         -3.361  1.857 -3.332 -2.471 
+     D   216   214 3   217     3     0     0    16    35  -6.830  -2.343  -0.333                         
+    IL   217   217 3   217     3     1     1    21    39  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   50 ]     88      - A - - -
+    ML   218   217 3   220     3     1     1    15    34  -9.221  -0.009  -7.875                          1.335 -2.439  0.000 -1.772 
+     D   219   217 3   220     3     0     0    15    34  -6.830  -2.343  -0.333                         
+    IL   220   220 3   220     3     1     1    20    38  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   51 ]     89      - U - - -
+    ML   221   220 3   223     3     1     1    14    32  -9.221  -0.028  -5.855                         -2.222 -2.344 -3.184  1.799 
+     D   222   220 3   223     3     0     0    14    33  -6.830  -2.290  -0.346                         
+    IL   223   223 3   223     3     1     1    19    37  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   52 ]     90      - C - - -
+    ML   224   223 3   226     3     1     1    12    31  -9.203  -0.009  -7.857                         -1.082  1.147 -1.771  0.029 
+     D   225   223 3   226     3     0     0    13    31  -7.063  -2.576  -0.278                         
+    IL   226   226 3   226     3     1     1    18    36  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   53 ]     91      - c - - -
+    ML   227   226 3   229     2     1     1     1     1       *   0.000                                  0.206  0.710 -1.859 -0.097 
+     D   228   226 3   229     2     0     0     0     0       *   0.000                                 
+    IL   229   229 3   229     2     1     1    13    28  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ END    54 ]      -      - - - - -
+     E   230   229 3    -1     0     0     0     0     0                                                 
+                                             [ BEGR   55 ]      -      - - - - -
+     S   231    72 1   232     5     0    13    61    83  -6.354  -0.038  -6.989  -7.993  -9.193         
+    IL   232   232 2   232     5     1    11    62    85  -2.321  -0.504  -4.207  -6.039  -5.313          0.000  0.000  0.000  0.000 
+                                             [ MATP   56 ]    149    214 g u - -
+    MP   233   232 2   237     6     2    14    61    83  -5.601  -9.717  -0.042  -8.493  -8.773  -9.168 -1.636  0.740 -5.238  0.183 -5.051 -1.269  0.932 -2.364 -0.585  0.265 -0.597  2.641 -0.778 -2.207 -1.438 -1.470 
+    ML   234   232 2   237     6     1     9    60    82  -6.334  -6.680  -1.375  -0.939  -6.529  -4.059  0.353 -0.541  0.126 -0.082 
+    MR   235   232 2   237     6     1     8    59    82  -7.001  -5.730  -1.598  -5.708  -0.842  -3.922  0.345 -0.378 -0.217  0.137 
+     D   236   232 2   237     6     0     5    57    80  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   237   237 5   237     6     1    11    61    84  -1.727  -1.960  -1.404  -5.201  -5.977  -5.638  0.000  0.000  0.000  0.000 
+    IR   238   238 6   238     5     1    11    60    82  -2.634  -0.413  -6.145  -4.313  -5.419          0.000  0.000  0.000  0.000 
+                                             [ MATP   57 ]    153    212 C G - -
+    MP   239   238 6   243     6     2    12    59    81  -9.779  -9.718  -0.013  -8.494  -8.774  -9.169 -3.298 -3.513 -3.457  0.374 -2.240 -4.100  3.048 -3.290 -3.634  0.764 -4.170 -1.289  1.346 -3.740 -0.483 -2.293 
+    ML   240   238 6   243     6     1     8    58    81  -6.326  -6.673  -1.387  -0.932  -6.522  -4.052  0.264 -0.365 -0.309  0.281 
+    MR   241   238 6   243     6     1     7    58    80  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   242   238 6   243     6     0     5    56    79  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   243   243 5   243     6     1     9    59    81  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   244   244 6   244     5     1     9    58    81  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   58 ]    154    211 c g - -
+    MP   245   244 6   249     4     2    10    57    79  -6.277  -5.206  -0.071  -6.921                 -2.671 -2.103 -2.824  0.712 -2.475 -3.661  2.326 -2.929 -2.423  1.732 -3.251 -0.077  1.347 -2.958 -0.109 -1.906 
+    ML   246   244 6   249     4     1     8    58    80  -3.185  -3.998  -0.564  -2.727                  0.264 -0.365 -0.309  0.281 
+    MR   247   244 6   249     4     1     6    57    79  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D   248   244 6   249     4     0     5    56    78  -4.568  -4.250  -2.265  -0.520                 
+    IL   249   249 5   249     4     1     9    59    81  -1.617  -2.052  -1.303  -5.180                  0.000  0.000  0.000  0.000 
+    IR   250   250 6   250     3     1     9    58    81  -1.199  -0.929  -4.680                          0.000  0.000  0.000  0.000 
+                                             [ MATL   59 ]    157      - a - - -
+    ML   251   250 6   253     3     1     8    53    74  -9.591  -0.029  -5.769                          0.521 -0.810  0.056 -0.067 
+     D   252   250 6   253     3     0     4    52    73  -5.620  -0.734  -1.403                         
+    IL   253   253 3   253     3     1     7    54    75  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   60 ]      -    206 - a - -
+    MR   254   253 3   256     5     1     8    52    73  -8.254  -0.017  -8.069  -8.282  -9.173          0.499 -0.615 -0.650  0.374 
+     D   255   253 3   256     5     0     3    51    72  -5.561  -0.589  -3.188  -4.619  -2.613         
+    IR   256   256 3   256     5     1     6    53    74  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   61 ]    158    205 g c - -
+    MP   257   256 3   261     6     2     7    51    72  -9.782  -9.722  -0.013  -8.498  -8.778  -9.173 -3.594 -1.398 -3.549  1.954 -4.170 -4.226  0.385 -4.106 -3.471  2.874 -2.402 -0.261  0.099 -3.037 -1.742 -2.565 
+    ML   258   256 3   261     6     1     4    50    71  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   259   256 3   261     6     1     4    50    71  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   260   256 3   261     6     0     2    48    69  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   261   261 5   261     6     1     5    51    72  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   262   262 6   262     5     1     5    51    72  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   62 ]    159    204 g c - -
+    MP   263   262 6   267     4     2     5    49    70  -8.306  -8.513  -0.021  -6.927                 -1.295  0.457 -1.630  1.135 -1.565 -2.793  1.178 -2.053 -1.599  1.373 -2.416 -0.453  1.063 -1.302  0.966 -1.223 
+    ML   264   262 6   267     4     1     3    50    71  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR   265   262 6   267     4     1     3    49    70  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D   266   262 6   267     4     0     1    48    69  -4.568  -4.250  -2.265  -0.520                 
+    IL   267   267 5   267     4     1     4    51    72  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   268   268 6   268     3     1     4    50    71  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   63 ]    160      - g - - -
+    ML   269   268 6   271     3     1     3    47    68  -9.258  -0.253  -2.649                         -0.554 -0.996  0.887 -0.048 
+     D   270   268 6   271     3     0     1    46    67  -6.174  -1.687  -0.566                         
+    IL   271   271 3   271     3     1     4    49    70  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   64 ]    161      - U - - -
+    ML   272   271 3   274     3     1     3    46    67  -9.015  -0.256  -2.637                         -0.193 -0.886 -1.555  1.166 
+     D   273   271 3   274     3     0     1    44    65  -8.350  -3.863  -0.107                         
+    IL   274   274 3   274     3     1     4    48    69  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   65 ]    162      - A - - -
+    ML   275   274 3   277     3     1     3    45    66  -4.064  -0.098  -7.424                          1.539 -1.920 -1.512 -1.063 
+     D   276   274 3   277     3     0     1    44    65  -9.082  -0.539  -1.690                         
+    IL   277   277 3   277     3     1     3    46    67  -1.665  -0.644  -4.480                          0.000  0.000  0.000  0.000 
+                                             [ MATL   66 ]    165      - G - - -
+    ML   278   277 3   280     3     1     2    44    65  -9.485  -0.013  -7.059                         -2.479 -2.794  1.834 -3.172 
+     D   279   277 3   280     3     0     0    43    64  -6.623  -0.349  -2.288                         
+    IL   280   280 3   280     3     1     2    45    66  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   67 ]      -    203 - a - -
+    MR   281   280 3   283     3     1     1    43    64  -9.584  -0.593  -1.574                          0.614 -0.294 -1.162  0.271 
+     D   282   280 3   283     3     0     0    42    63  -6.527  -1.705  -0.551                         
+    IR   283   283 3   283     3     1     2    44    65  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   68 ]      -    202 - g - -
+    MR   284   283 3   286     5     1     2    42    63  -4.454  -0.087  -7.522  -7.734  -8.626         -0.265 -0.497  0.441  0.140 
+     D   285   283 3   286     5     0     0    41    62  -7.581  -0.126  -5.207  -6.638  -4.599         
+    IR   286   286 3   286     5     1     1    43    64  -2.453  -0.450  -6.192  -4.359  -5.465          0.000  0.000  0.000  0.000 
+                                             [ MATP   69 ]    166    199 U A - -
+    MP   287   286 3   291     4     2     2    41    62  -8.305  -5.965  -0.040  -6.926                 -4.488 -4.475 -4.409 -0.719 -3.382 -5.027  1.108 -4.080 -4.404 -0.572 -4.824 -2.471  3.143 -3.043  1.527 -2.776 
+    ML   288   286 3   291     4     1     1    42    64  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR   289   286 3   291     4     1     1    42    63  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D   290   286 3   291     4     0     0    41    62  -4.578  -4.259  -2.275  -0.516                 
+    IL   291   291 5   291     4     1     1    44    65  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   292   292 6   292     3     1     1    43    65  -1.245  -0.912  -4.429                          0.000  0.000  0.000  0.000 
+                                             [ MATL   70 ]    167      - A - - -
+    ML   293   292 6   295     3     1     1    38    57  -9.591  -0.008  -7.909                          1.858 -2.993 -3.037 -2.961 
+     D   294   292 6   295     3     0     0    36    55  -5.628  -0.742  -1.389                         
+    IL   295   295 3   295     3     1     1    39    57  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   71 ]      -    195 - A - -
+    MR   296   295 3   298     5     1     1    37    56  -8.273  -0.042  -8.089  -7.454  -5.973          1.838 -2.853 -3.067 -2.586 
+     D   297   295 3   298     5     0     0    35    54  -5.358  -0.713  -2.985  -4.416  -2.377         
+    IR   298   298 3   298     5     1     1    37    56  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   72 ]    168    194 c g - -
+    MP   299   298 3   303     6     2     2    36    55  -9.766  -9.705  -0.014  -8.482  -8.563  -9.156 -2.733 -2.856 -2.334  0.391 -1.204 -3.734  2.965 -2.980 -2.657  0.480 -0.477 -1.162  0.963 -3.045 -0.470 -2.022 
+    ML   300   298 3   303     6     1     1    35    54  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   301   298 3   303     6     1     1    35    54  -7.032  -5.761  -1.670  -5.739  -0.795  -3.953  0.382 -0.511  0.049 -0.059 
+     D   302   298 3   303     6     0     0    33    52  -9.387  -8.085  -3.882  -4.564  -4.582  -0.246 
+    IL   303   303 5   303     6     1     1    36    55  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   304   304 6   304     5     1     1    35    54  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   73 ]    169    193 u g - -
+    MP   305   304 6   309     4     2     2    34    53  -8.278  -7.058  -0.037  -6.130                 -1.928 -2.061 -2.121  0.801 -2.074 -2.890  1.304 -2.300 -2.147  0.660 -2.027 -0.759  1.157 -0.534  2.057 -0.401 
+    ML   306   304 6   309     4     1     1    35    54  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR   307   304 6   309     4     1     1    34    53  -4.870  -3.899  -1.767  -0.725                  0.284 -0.323 -0.303  0.230 
+     D   308   304 6   309     4     0     0    33    52  -4.886  -4.568  -2.281  -0.477                 
+    IL   309   309 5   309     4     1     1    36    55  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   310   310 6   310     3     1     1    35    54  -1.478  -0.771  -4.178                          0.000  0.000  0.000  0.000 
+                                             [ MATL   74 ]    170      - a - - -
+    ML   311   310 6   313     3     1     1    31    50  -9.227  -0.009  -7.881                          0.580 -1.175  0.193 -0.122 
+     D   312   310 6   313     3     0     0    30    49  -6.742  -1.612  -0.592                         
+    IL   313   313 3   313     3     1     1    34    53  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   75 ]    171      - g - - -
+    ML   314   313 3   316     3     1     1    30    49  -9.238  -0.020  -6.368                         -0.459 -0.427  0.710 -0.163 
+     D   315   313 3   316     3     0     0    29    48  -6.561  -1.896  -0.472                         
+    IL   316   316 3   316     3     1     1    33    52  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   76 ]    172      - G - - -
+    ML   317   316 3   319     3     1     1    29    48  -9.229  -0.184  -3.085                         -0.463 -1.613  1.387 -1.590 
+     D   318   316 3   319     3     0     0    28    47  -6.704  -1.917  -0.463                         
+    IL   319   319 3   319     3     1     1    32    51  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   77 ]    173      - a - - -
+    ML   320   319 3   322     3     1     1    28    47  -6.927  -0.221  -2.901                          0.878 -1.108  0.203 -0.868 
+     D   321   319 3   322     3     0     0    26    45  -8.136  -2.091  -0.393                         
+    IL   322   322 3   322     3     1     1    31    50  -1.411  -0.809  -4.230                          0.000  0.000  0.000  0.000 
+                                             [ MATL   78 ]    176      - U - - -
+    ML   323   322 3   325     3     1     1    27    45  -9.255  -0.027  -5.898                         -1.601 -1.701 -2.543  1.674 
+     D   324   322 3   325     3     0     0    26    44  -7.602  -0.454  -1.917                         
+    IL   325   325 3   325     3     1     1    28    46  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   79 ]      -    191 - G - -
+    MR   326   325 3   328     3     1     1    26    44  -9.508  -0.011  -7.330                         -1.105 -1.898  1.554 -1.595 
+     D   327   325 3   328     3     0     0    24    43  -7.463  -1.821  -0.491                         
+    IR   328   328 3   328     3     1     1    27    45  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   80 ]      -    190 - U - -
+    MR   329   328 3   331     3     1     1    25    43  -9.525  -0.012  -7.176                         -1.149 -0.282 -1.838  1.291 
+     D   330   328 3   331     3     0     0    23    42  -7.300  -1.374  -0.718                         
+    IR   331   331 3   331     3     1     1    26    44  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   81 ]      -    189 - c - -
+    MR   332   331 3   334     3     1     1    24    42  -9.551  -0.013  -7.065                         -0.182  0.552 -0.244 -0.308 
+     D   333   331 3   334     3     0     0    22    40  -7.012  -2.107  -0.396                         
+    IR   334   334 3   334     3     1     1    25    43  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   82 ]      -    188 - C - -
+    MR   335   334 3   337     3     1     1    23    41  -9.548  -0.038  -5.361                         -1.373  1.223 -1.695 -0.043 
+     D   336   334 3   337     3     0     0    21    40  -7.050  -1.960  -0.443                         
+    IR   337   337 3   337     3     1     1    24    42  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   83 ]      -    187 - u - -
+    MR   338   337 3   340     5     1     1    22    40  -6.182  -0.050  -6.897  -6.857  -8.403          0.071 -0.302 -0.292  0.403 
+     D   339   337 3   340     5     0     0    21    39  -5.938  -0.751  -3.347  -4.995  -1.945         
+    IR   340   340 3   340     5     1     1    22    41  -2.497  -0.461  -6.008  -4.176  -5.282          0.000  0.000  0.000  0.000 
+                                             [ MATP   84 ]    177    185 G C - -
+    MP   341   340 3   345     6     2     2    21    39  -9.753  -7.711  -0.032  -6.430  -8.749  -9.144 -3.738 -1.220 -3.660  1.069 -4.231 -4.192  0.897 -4.219 -3.985  3.097 -3.019 -0.212 -0.026 -3.460 -1.127 -2.680 
+    ML   342   340 3   345     6     1     1    21    39  -6.371  -6.717  -1.407  -0.909  -6.567  -4.096  0.364 -0.417 -0.308  0.211 
+    MR   343   340 3   345     6     1     1    21    39  -7.075  -5.804  -1.713  -5.782  -0.764  -3.996  0.304 -0.211 -0.244  0.080 
+     D   344   340 3   345     6     0     0    19    38  -9.472  -8.170  -3.967  -4.649  -4.666  -0.231 
+    IL   345   345 5   345     6     1     1    21    39  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   346   346 6   346     5     1     1    20    39  -2.456  -0.477  -5.967  -4.134  -5.240          0.000  0.000  0.000  0.000 
+                                             [ MATP   85 ]    178    183 g c - -
+    MP   347   346 6   351     4     2     2    19    37  -8.238  -8.445  -0.092  -4.176                 -3.289 -2.479 -3.398  1.153 -3.711 -3.984  1.173 -2.892 -3.369  2.939 -3.394 -0.326  0.462 -3.390 -0.867 -2.386 
+    ML   348   346 6   351     4     1     1    20    39  -4.016  -4.199  -0.422  -2.862                  0.032  0.132 -0.654  0.318 
+    MR   349   346 6   351     4     1     1    20    38  -4.910  -3.939  -1.750  -0.727                  0.405 -0.307 -0.323  0.094 
+     D   350   346 6   351     4     0     0    19    37  -4.967  -4.648  -2.664  -0.376                 
+    IL   351   351 5   351     4     1     1    22    40  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   352   352 6   352     3     1     1    21    39  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   86 ]    179      - G - - -
+    ML   353   352 6   355     3     1     1    15    34  -9.156  -0.009  -7.810                         -1.525 -2.476  1.650 -1.581 
+     D   354   352 6   355     3     0     0    15    33  -7.525  -2.057  -0.407                         
+    IL   355   355 3   355     3     1     1    20    38  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   87 ]    180      - u - - -
+    ML   356   355 3   358     3     1     1    14    32  -9.176  -0.013  -7.052                         -0.102 -0.626 -0.627  0.826 
+     D   357   355 3   358     3     0     0    14    32  -7.343  -1.405  -0.699                         
+    IL   358   358 3   358     3     1     1    19    37  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   88 ]    181      - G - - -
+    ML   359   358 3   361     3     1     1    12    31  -9.208  -0.010  -7.512                         -0.723 -1.500  1.340 -0.976 
+     D   360   358 3   361     3     0     0    13    31  -7.003  -2.247  -0.355                         
+    IL   361   361 3   361     3     1     1    18    36  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   89 ]    182      - A - - -
+    ML   362   361 3   364     2     1     1     1     1       *   0.000                                  1.472 -1.591 -1.296 -1.040 
+     D   363   361 3   364     2     0     0     0     0       *   0.000                                 
+    IL   364   364 3   364     2     1     1    13    28  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ END    90 ]      -      - - - - -
+     E   365   364 3    -1     0     0     0     0     0                                                 
+//
+HMMER3/f [i1.1rc1 | June 2012]
+NAME  5S_rRNA
+ACC   RF00001
+DESC  5S ribosomal RNA
+LENG  119
+MAXL  305
+ALPH  RNA
+RF    no
+MM    no
+CONS  yes
+CS    yes
+MAP   yes
+DATE  Wed Jun 13 05:38:49 2012
+COM   [1] ./cmbuild 5S_rRNA.cm 5S_rRNA.sto
+NSEQ  712
+EFFN  13.626495
+CKSUM 4276491820
+STATS LOCAL MSV       -9.0439  0.71822
+STATS LOCAL VITERBI  -10.6642  0.71822
+STATS LOCAL FORWARD   -3.7829  0.71822
+HMM          A        C        G        U   
+            m->m     m->i     m->d     i->m     i->i     d->m     d->d
+  COMPO   1.39167  1.39007  1.29965  1.47117
+          1.38629  1.38629  1.38629  1.38629
+          0.05356  3.91429  3.43585  1.07010  0.42003  0.00000        *
+      1   1.57270  1.57116  1.17285  1.29016      3 g - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02780  4.70662  3.99624  1.46634  0.26236  0.90410  0.51904
+      2   1.65891  1.20987  1.47581  1.26293      4 c - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.01864  4.71595  4.65487  1.46634  0.26236  1.04577  0.43297
+      3   1.34714  1.37511  1.75716  1.15622      5 u - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.01959  4.72746  4.55144  1.46634  0.26236  0.61461  0.77838
+      4   1.69588  1.79779  1.21836  1.03513      6 u - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.01857  4.74011  4.63959  1.46634  0.26236  1.04432  0.43376
+      5   1.52658  2.45758  0.49731  2.42002      7 G - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02074  4.74989  4.43334  1.46634  0.26236  1.08855  0.41054
+      6   2.65240  0.62738  2.06097  1.31602      8 C - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.04661  3.35102  4.55680  0.43774  1.03703  1.05455  0.42825
+      7   1.70979  2.65586  0.40336  2.51591     10 G - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02899  4.74769  3.91674  1.46634  0.26236  1.12622  0.39194
+      8   1.28477  1.83759  0.90079  1.84620     11 g - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.03342  3.72513  4.73791  0.61513  0.77777  1.45097  0.26702
+      9   2.31976  0.84209  2.16015  1.03399     13 c - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02462  4.33761  4.48696  1.03997  0.43613  1.51654  0.24778
+     10   2.45611  0.41228  2.19079  1.96421     15 C - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02236  4.31671  4.73618  1.02385  0.44505  1.36859  0.29365
+     11   0.20537  3.06618  2.62740  2.70616     17 A - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.04187  4.73821  3.43420  1.46634  0.26236  0.62267  0.76897
+     12   2.60685  2.42805  2.90421  0.24433     18 U - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02351  4.30386  4.63393  1.02017  0.44712  1.63317  0.21730
+     13   0.26748  3.13355  2.24951  2.45716     20 A - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.01879  4.72790  4.62806  1.46634  0.26236  0.42448  1.06164
+     14   2.57941  0.86014  1.09883  1.78488     21 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.01743  4.75130  4.75130  1.46634  0.26236  1.13301  0.38870
+     15   2.36997  0.57026  2.10902  1.51513     22 C - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.05931  3.01700  4.75130  0.83467  0.56919  1.03317  0.43986
+     16   0.90060  2.45897  1.09110  1.75850     27 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01742  4.75221  4.75221  1.46634  0.26236  1.09861  0.40547
+     17   1.71422  1.74408  0.69796  1.91399     28 g - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02471  4.14943  4.75221  0.87603  0.53859  1.09861  0.40547
+     18   1.72877  1.13375  1.38033  1.38958     30 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02489  4.13837  4.75221  0.86780  0.54451  1.09861  0.40547
+     19   1.22601  1.67974  1.18678  1.53751     32 g - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02388  4.20206  4.75221  0.91621  0.51088  1.09861  0.40547
+     20   1.82077  1.17814  1.39299  1.26614     34 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02191  4.33961  4.75221  1.02983  0.44172  1.09861  0.40547
+     21   1.98037  2.15703  0.71674  1.35490     36 g - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.09133  3.84013  2.72124  1.21872  0.35042  1.09861  0.40547
+     22   0.98487  2.28671  0.95347  1.96961     40 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01848  4.69335  4.69335  1.46634  0.26236  0.30043  1.34899
+     23   0.49496  2.14028  2.42981  1.68886     41 A - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.05718  3.06999  4.69331  1.99775  0.14577  0.97514  0.47343
+     24   0.64790  1.65526  2.77810  1.49764     52 A - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02964  4.30823  4.15117  1.00448  0.45608  0.96339  0.48061
+     25   1.28229  1.68148  0.94961  1.89973     54 g - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.01923  4.74510  4.57079  1.46634  0.26236  0.78065  0.61269
+     26   2.43411  0.49500  2.45157  1.52972     55 C - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02297  4.26475  4.74996  0.96824  0.47764  1.03801  0.43720
+     27   0.40404  3.18918  1.81688  2.05073     57 A - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.06634  3.11556  3.92035  2.06001  0.13634  1.13329  0.38857
+     28   3.67248  0.10594  3.73261  2.97237     68 C - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.06452  3.04269  4.21477  0.67007  0.71677  0.60588  0.78877
+     29   2.13576  0.66485  1.87806  1.53894     71 C - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02051  4.74623  4.45563  1.46634  0.26236  1.17909  0.36753
+     30   1.85625  1.29320  0.99900  1.60393     72 g - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.01755  4.74447  4.74447  1.46634  0.26236  0.83664  0.56768
+     31   2.20725  2.10061  0.36588  2.60333     73 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.04165  3.45375  4.69184  1.40153  0.28266  1.16524  0.37375
+     32   0.68689  2.79585  1.39447  1.67220     78 A - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.04734  4.32126  3.41266  1.01590  0.44954  1.18388  0.36541
+     33   1.83090  1.85964  2.10055  0.57694     80 U - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.01790  4.72530  4.72530  1.46634  0.26236  1.71247  0.19896
+     34   3.79453  0.20705  3.79151  1.95219     81 C - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.05921  3.18450  4.12929  1.24682  0.33886  1.78832  0.18301
+     35   2.90483  0.28145  3.48391  1.83344     86 C - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.01801  4.71889  4.71889  1.46634  0.26236  1.31945  0.31100
+     36   4.31814  0.06420  3.84075  3.59807     87 C - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.01788  4.72615  4.72615  1.46634  0.26236  1.78832  0.18301
+     37   0.40001  3.66651  1.34962  3.10601     88 A - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.01788  4.72615  4.72615  1.46634  0.26236  1.78832  0.18301
+     38   3.20464  3.38919  3.98738  0.09746     89 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.03141  4.72615  3.81407  1.46634  0.26236  1.72973  0.19520
+     39   2.39314  0.50020  2.80681  1.41942     90 C - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.01811  4.71341  4.71341  1.46634  0.26236  1.92913  0.15697
+     40   1.23881  0.79185  3.11276  1.54747     91 c - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.48661  0.97912  4.64059  0.37658  1.15902  1.08021  0.41480
+     41   2.81178  4.02911  0.10519  3.81861     99 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.01841  4.72669  4.66810  1.46634  0.26236  1.77818  0.18506
+     42   0.57850  2.10798  1.74759  1.94084    100 A - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02682  4.03975  4.72615  0.81563  0.58405  0.57645  0.82529
+     43   0.41879  2.66590  3.17692  1.46574    102 A - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01751  4.74685  4.74685  1.46634  0.26236  1.28637  0.32334
+     44   3.67689  0.08476  4.61351  3.07803    103 C - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01751  4.74685  4.74685  1.46634  0.26236  0.98434  0.46791
+     45   1.74791  1.54842  2.61140  0.61647    104 U - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.01746  4.74990  4.74990  1.46634  0.26236  1.12529  0.39239
+     46   2.81561  0.40853  1.98800  1.97660    105 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.01745  4.75042  4.75042  1.46634  0.26236  1.16524  0.37375
+     47   1.74090  0.98476  1.20765  1.88251    106 c - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.03029  3.85424  4.75042  0.68082  0.70563  0.97736  0.47209
+     48   1.69103  2.20712  0.56236  1.99666    108 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02105  4.75221  4.40648  1.46634  0.26236  1.09861  0.40547
+     49   0.41869  1.75438  3.03565  2.11172    109 A - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.04671  3.29767  4.74864  0.41684  1.07624  0.88187  0.53445
+     50   0.18616  2.39246  3.25322  3.22384    111 A - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01841  4.75221  4.64546  1.46634  0.26236  1.09861  0.40547
+     51   2.15968  2.59901  0.33029  2.39060    112 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.01743  4.75124  4.75124  1.46634  0.26236  1.13548  0.38753
+     52   1.99092  1.68847  1.76029  0.67997    113 U - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02101  4.75124  4.41060  1.46634  0.26236  1.13548  0.38753
+     53   2.71619  2.39754  1.96965  0.35179    114 U - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01749  4.74772  4.74772  1.46634  0.26236  1.15128  0.38014
+     54   0.04579  4.05772  4.26774  4.30801    115 A - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01748  4.74870  4.74870  1.46634  0.26236  1.22549  0.34759
+     55   0.04372  4.15974  4.31311  4.28473    116 A - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03044  4.36063  4.06230  1.05150  0.42988  1.22549  0.34759
+     56   1.64438  3.09190  0.33484  3.07913    118 G - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.08231  2.66710  4.65024  2.63483  0.07443  0.60758  0.78673
+     57   2.03390  0.54539  2.09112  1.79571    136 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.01838  4.75140  4.64837  1.46634  0.26236  1.03960  0.43633
+     58   1.52176  1.48233  0.98571  1.70710    137 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.01743  4.75127  4.75127  1.46634  0.26236  1.03112  0.44100
+     59   1.76484  1.36388  1.53229  1.02980    138 u - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.01808  4.75221  4.67944  1.46634  0.26236  1.09861  0.40547
+     60   1.73738  1.55301  0.93663  1.51203    139 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.01790  4.75156  4.69902  1.46634  0.26236  1.05069  0.43031
+     61   2.12817  0.76181  1.64809  1.50639    140 c - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02050  4.75174  4.45242  1.46634  0.26236  1.06389  0.42329
+     62   2.09944  1.30232  2.78698  0.60887    141 U - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01747  4.74919  4.74919  1.46634  0.26236  0.90932  0.51550
+     63   1.12553  1.73856  2.43550  0.88627    142 u - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.04236  3.41604  4.75221  0.46214  0.99407  1.09861  0.40547
+     64   1.77559  2.31390  0.48082  2.17625    144 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02168  4.35708  4.75221  1.04522  0.43327  1.09861  0.40547
+     65   1.99260  1.18843  0.79101  2.24834    146 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02812  4.00162  4.66233  0.91433  0.51214  1.09861  0.40547
+     66   1.64687  1.88570  0.55608  2.49894    149 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.04965  3.22389  4.75140  0.87204  0.54145  1.03960  0.43633
+     67   2.56624  0.47903  2.14111  1.68056    153 C - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.01742  4.75221  4.75221  1.46634  0.26236  1.09861  0.40547
+     68   2.15733  1.00783  1.21874  1.49720    154 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.03138  3.80477  4.75221  0.86423  0.54711  1.09861  0.40547
+     69   0.99113  2.03017  1.29946  1.49232    157 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01742  4.75221  4.75221  1.46634  0.26236  1.09861  0.40547
+     70   1.19472  2.61899  0.60614  2.53982    158 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.01742  4.75221  4.75221  1.46634  0.26236  1.09861  0.40547
+     71   1.24026  1.82926  1.40481  1.18828    159 u - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.01742  4.75221  4.75221  1.46634  0.26236  1.09861  0.40547
+     72   1.95830  2.18302  0.67121  1.44771    160 G - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.19183  4.75221  1.79625  1.46634  0.26236  1.09861  0.40547
+     73   1.55882  2.14991  2.71916  0.49891    161 U - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.19692  4.58108  1.78080  1.46634  0.26236  3.05495  0.04827
+     74   0.23906  3.10495  2.67677  2.31241    162 A - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.08653  2.64901  4.40880  0.39562  1.11861  0.33907  1.24630
+     75   3.62515  3.42756  0.07760  4.16362    165 G - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01882  4.67558  4.67558  1.46634  0.26236  0.19530  1.72930
+     76   3.99979  2.47170  3.85289  0.13237    166 U - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.01742  4.75179  4.75179  1.46634  0.26236  1.11454  0.39759
+     77   0.07219  3.66285  3.88658  3.75189    167 A - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03589  4.75179  3.62636  1.46634  0.26236  1.11454  0.39759
+     78   2.49136  0.52239  1.77889  1.86254    168 C - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.01831  4.73365  4.67299  1.46634  0.26236  1.63506  0.21684
+     79   2.11626  1.82158  2.01907  0.53620    169 U - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02368  4.73310  4.22667  1.46634  0.26236  1.34238  0.30276
+     80   0.94450  2.38605  1.19603  1.52905    170 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01780  4.73043  4.73043  1.46634  0.26236  1.06105  0.42479
+     81   1.87335  1.67110  0.79683  1.57215    171 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02584  4.73836  4.08903  1.46634  0.26236  1.33289  0.30614
+     82   1.78785  2.61906  0.35502  2.83618    172 G - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.14243  4.73219  2.08789  1.46634  0.26236  1.35137  0.29960
+     83   0.71157  2.28284  1.18444  2.29048    173 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.17124  4.11308  1.95885  1.13798  0.38635  1.47233  0.26057
+     84   2.79616  2.89597  3.57998  0.15568    176 U - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.04233  4.50810  3.49232  1.46634  0.26236  0.12141  2.16870
+     85   1.88005  2.10188  0.44719  2.45612    177 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.01788  4.72621  4.72621  1.46634  0.26236  1.78725  0.18323
+     86   1.91363  1.87173  0.54393  2.13590    178 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.06554  4.72621  2.90807  1.46634  0.26236  1.68621  0.20484
+     87   2.69048  3.32857  0.19843  2.57321    179 G - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.01872  4.68040  4.68040  1.46634  0.26236  1.45838  0.26476
+     88   1.51105  1.89131  1.83563  0.75729    180 u - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02171  4.69481  4.39573  1.46634  0.26236  0.91534  0.51146
+     89   2.05144  2.56458  0.37643  2.22382    181 G - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.01927  4.71687  4.59125  1.46634  0.26236  1.66416  0.20992
+     90   0.29095  2.71621  2.42987  2.31996    182 A - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.04715  4.71862  3.29334  1.46634  0.26236  0.71546  0.67132
+     91   2.47068  0.59877  1.73304  1.66474    183 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02467  4.21079  4.65319  0.95576  0.48535  1.07936  0.41523
+     92   2.89420  0.47590  1.87196  1.77483    185 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.05748  3.92054  3.32331  0.73698  0.65116  1.29130  0.32146
+     93   1.37382  1.59599  1.56526  1.09326    187 u - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02220  4.70365  4.35072  1.46634  0.26236  0.93069  0.50134
+     94   2.70116  0.45182  2.69372  1.47501    188 C - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01909  4.72094  4.60525  1.46634  0.26236  1.56378  0.23489
+     95   1.59909  0.89795  1.52264  1.75807    189 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03973  4.72318  3.50443  1.46634  0.26236  1.58431  0.22953
+     96   2.48033  1.58308  2.92502  0.41965    190 U - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03300  4.70445  3.75467  1.46634  0.26236  1.94125  0.15493
+     97   2.34430  2.82881  0.25091  2.70445    191 G - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03823  4.26890  3.75046  1.02079  0.44677  0.26158  1.46896
+     98   1.86517  1.88933  0.66192  1.72544    193 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.01770  4.73642  4.73642  1.46634  0.26236  1.57174  0.23279
+     99   1.88522  2.46689  0.40614  2.33160    194 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.01770  4.73642  4.73642  1.46634  0.26236  0.55403  0.85479
+    100   0.08342  3.58390  3.96156  3.40421    195 A - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03080  3.83084  4.75179  1.21753  0.35092  1.11454  0.39759
+    101   0.41950  3.71717  1.22796  3.67176    199 A - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.50360  3.26420  1.02883  0.50271  0.92858  1.11454  0.39759
+    102   1.70888  1.75276  0.97385  1.31673    202 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02688  4.32288  4.32288  1.46634  0.26236  0.06204  2.81085
+    103   0.91309  1.59202  2.35632  1.20252    203 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.01751  4.74691  4.74691  1.46634  0.26236  0.80652  0.59133
+    104   1.73667  1.12534  1.22471  1.58226    204 c - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.01742  4.75221  4.75221  1.46634  0.26236  1.09861  0.40547
+    105   2.77242  0.65646  2.34478  1.13030    205 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.03256  4.75221  3.75477  1.46634  0.26236  1.09861  0.40547
+    106   1.00645  1.87472  1.88017  1.11315    206 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.05717  3.15522  4.34765  0.98140  0.46966  0.55253  0.85682
+    107   1.72914  1.42318  0.88514  1.77810    211 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.01749  4.74809  4.74809  1.46634  0.26236  1.24603  0.33918
+    108   1.84084  2.28406  0.44435  2.32070    212 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.04716  3.28632  4.74769  0.41295  1.08381  1.24603  0.33918
+    109   2.37248  1.54265  1.73356  0.66110    214 U - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.49067  0.97186  4.66650  0.06906  2.70706  0.85635  0.55288
+    110   1.48119  2.39208  0.57363  2.13945    218 G - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.03365  4.17785  4.03062  0.90154  0.52078  1.12641  0.39185
+    111   2.16176  1.00295  1.84034  1.02355    220 c - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02893  4.73565  3.92493  1.46634  0.26236  0.79240  0.60286
+    112   2.75950  0.92211  2.41708  0.79891    221 u - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.03010  3.90722  4.65105  1.00936  0.45327  1.42673  0.27456
+    113   2.04876  2.54679  0.34674  2.45590    224 G - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02530  4.24522  4.54223  0.96670  0.47858  0.58562  0.81364
+    114   2.71006  0.53694  2.43661  1.34141    226 C - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.01757  4.74327  4.74327  1.46634  0.26236  1.03468  0.43903
+    115   1.08825  1.31970  1.57541  1.66571    227 a - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.01877  4.74068  4.61906  1.46634  0.26236  1.05467  0.42818
+    116   1.30500  1.90432  1.23739  1.23870    228 g - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02945  4.73682  3.89949  1.46634  0.26236  1.14082  0.38501
+    117   1.54949  1.81702  1.11385  1.21456    229 g - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02360  4.71593  4.24251  1.46634  0.26236  1.36142  0.29611
+    118   1.63641  1.13762  1.36145  1.47643    230 c - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.09479  4.70311  2.50877  1.46634  0.26236  1.59070  0.22788
+    119   1.91428  0.72686  2.48256  1.25317    231 c - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.00992  4.61824        *  1.46634  0.26236  0.00000        *
+//
+INFERNAL1/a [1.1rc1 | June 2012]
+NAME     Cobalamin
+ACC      RF00174
+DESC     Cobalamin riboswitch
+STATES   592
+NODES    163
+CLEN     191
+W        460
+ALPH     RNA
+RF       no
+CONS     yes
+MAP      yes
+DATE     Wed Jun 13 05:40:07 2012
+COM      [1] ./cmbuild Cobalamin.cm ../tutorial/Cobalamin.sto
+COM      [2] ./cmcalibrate Cobalamin.cm
+PBEGIN   0.05
+PEND     0.05
+WBETA    1e-07
+QDBBETA1 1e-07
+QDBBETA2 1e-15
+N2OMEGA  1.52588e-05
+N3OMEGA  1.52588e-05
+ELSELF   -0.08926734
+NSEQ     431
+EFFN     6.652168
+CKSUM    2307274568
+NULL     0.000  0.000  0.000  0.000 
+GA       39.00
+TC       39.00
+NC       38.79
+EFP7GF   -9.3826 0.71319
+ECMLC    0.69050    -9.55632    -0.82028     1600000      499982  0.002400
+ECMGC    0.33713   -30.56949   -21.45119     1600000        8652  0.046232
+ECMLI    0.68481    -7.98572     0.30786     1600000      351369  0.003415
+ECMGI    0.38286   -21.23885   -13.16656     1600000        8796  0.045475
+CM
+                                             [ ROOT    0 ]      -      - - - - -
+     S     0    -1 0     1     4     0     1   460   771  -8.175  -8.382  -0.025  -6.528                 
+    IL     1     1 2     1     4    86   133   462   774  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR     2     2 3     2     3    86   133   462   774  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    1 ]      1      - u - - -
+    ML     3     2 3     5     3    86   132   461   772  -9.129  -0.009  -7.783                          0.192 -0.324 -0.320  0.331 
+     D     4     2 3     5     3    80   128   458   769  -6.226  -1.577  -0.618                         
+    IL     5     5 3     5     3    85   132   461   773  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    2 ]      2      - u - - -
+    ML     6     5 3     8     3    85   131   460   771  -9.131  -0.009  -7.785                          0.129 -0.155 -0.410  0.328 
+     D     7     5 3     8     3    79   127   457   768  -6.174  -1.687  -0.566                         
+    IL     8     8 3     8     3    84   131   460   772  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    3 ]      3      - a - - -
+    ML     9     8 3    11     3    84   130   459   770  -9.131  -0.009  -7.785                          0.349  0.003 -0.625  0.105 
+     D    10     8 3    11     3    78   126   456   767  -6.174  -1.687  -0.566                         
+    IL    11    11 3    11     3    83   130   459   771  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    4 ]      4      - a - - -
+    ML    12    11 3    14     3    84   130   458   769  -9.131  -0.009  -7.785                          0.314 -0.335 -0.248  0.166 
+     D    13    11 3    14     3    77   125   455   766  -6.174  -1.687  -0.566                         
+    IL    14    14 3    14     3    82   129   458   770  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    5 ]      5      - a - - -
+    ML    15    14 3    17     3    83   129   457   768  -9.131  -0.009  -7.785                          0.495 -0.371 -0.748  0.289 
+     D    16    14 3    17     3    77   124   454   765  -6.174  -1.687  -0.566                         
+    IL    17    17 3    17     3    81   128   457   769  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    6 ]      6      - u - - -
+    ML    18    17 3    20     3    82   128   456   767  -9.131  -0.009  -7.785                          0.164 -0.374 -0.119  0.247 
+     D    19    17 3    20     3    76   123   453   764  -6.174  -1.687  -0.566                         
+    IL    20    20 3    20     3    81   127   456   768  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    7 ]      7      - u - - -
+    ML    21    20 3    23     3    81   127   455   766  -9.131  -0.009  -7.785                          0.082 -0.109 -0.425  0.344 
+     D    22    20 3    23     3    75   122   452   763  -6.174  -1.687  -0.566                         
+    IL    23    23 3    23     3    80   126   455   767  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    8 ]      8      - g - - -
+    ML    24    23 3    26     3    80   126   454   765  -9.131  -0.009  -7.785                          0.058 -0.422  0.170  0.121 
+     D    25    23 3    26     3    74   121   451   762  -6.174  -1.687  -0.566                         
+    IL    26    26 3    26     3    79   125   454   766  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    9 ]      9      - a - - -
+    ML    27    26 3    29     3    79   125   453   764  -9.131  -0.009  -7.785                          0.332 -0.477 -0.179  0.189 
+     D    28    26 3    29     3    73   120   450   762  -6.174  -1.687  -0.566                         
+    IL    29    29 3    29     3    78   125   453   765  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   10 ]     10      - a - - -
+    ML    30    29 3    32     3    78   124   452   763  -9.131  -0.009  -7.785                          0.284 -0.018 -0.378  0.036 
+     D    31    29 3    32     3    72   119   449   761  -6.174  -1.687  -0.566                         
+    IL    32    32 3    32     3    77   124   452   764  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   11 ]     11      - a - - -
+    ML    33    32 3    35     3    77   123   451   762  -9.131  -0.009  -7.785                          0.100  0.027 -0.007 -0.129 
+     D    34    32 3    35     3    72   119   448   760  -6.174  -1.687  -0.566                         
+    IL    35    35 3    35     3    76   123   451   763  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   12 ]     12      - c - - -
+    ML    36    35 3    38     3    76   122   450   761  -9.131  -0.009  -7.785                         -0.230  0.204 -0.120  0.105 
+     D    37    35 3    38     3    71   118   447   759  -6.174  -1.687  -0.566                         
+    IL    38    38 3    38     3    76   122   450   762  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   13 ]     13      - g - - -
+    ML    39    38 3    41     3    76   121   449   760  -9.131  -0.009  -7.785                          0.009 -0.100  0.156 -0.079 
+     D    40    38 3    41     3    70   117   446   758  -6.174  -1.687  -0.566                         
+    IL    41    41 3    41     3    75   121   449   761  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   14 ]     14      - a - - -
+    ML    42    41 3    44     3    75   120   448   759  -9.131  -0.009  -7.785                          0.083 -0.134  0.049 -0.008 
+     D    43    41 3    44     3    69   116   445   757  -6.174  -1.687  -0.566                         
+    IL    44    44 3    44     3    74   120   448   760  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   15 ]     15      - u - - -
+    ML    45    44 3    47     3    74   119   447   758  -9.468  -0.009  -7.786                         -0.170  0.079 -0.663  0.510 
+     D    46    44 3    47     3    69   115   445   756  -5.620  -0.734  -1.403                         
+    IL    47    47 3    47     3    72   119   447   759  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   16 ]      -    441 - c - -
+    MR    48    47 3    50     3    73   118   446   757  -9.468  -0.009  -7.786                         -0.254  0.366 -0.228  0.027 
+     D    49    47 3    50     3    67   113   443   755  -6.390  -1.568  -0.620                         
+    IR    50    50 3    50     3    72   118   446   758  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   17 ]      -    440 - c - -
+    MR    51    50 3    53     3    72   117   445   756  -9.468  -0.009  -7.786                         -0.108  0.286 -0.568  0.237 
+     D    52    50 3    53     3    66   112   442   754  -6.390  -1.568  -0.620                         
+    IR    53    53 3    53     3    71   117   445   757  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   18 ]      -    439 - u - -
+    MR    54    53 3    56     3    71   116   444   755  -9.468  -0.009  -7.786                          0.079 -0.400 -0.004  0.249 
+     D    55    53 3    56     3    65   111   441   753  -6.390  -1.568  -0.620                         
+    IR    56    56 3    56     3    70   116   444   756  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   19 ]      -    438 - c - -
+    MR    57    56 3    59     3    70   115   443   754  -9.468  -0.009  -7.786                          0.036  0.206 -0.277 -0.006 
+     D    58    56 3    59     3    64   110   440   752  -6.390  -1.568  -0.620                         
+    IR    59    59 3    59     3    69   115   443   755  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   20 ]      -    437 - u - -
+    MR    60    59 3    62     3    70   114   442   753  -9.468  -0.009  -7.786                          0.103  0.022 -0.337  0.163 
+     D    61    59 3    62     3    63   109   439   751  -6.390  -1.568  -0.620                         
+    IR    62    62 3    62     3    68   114   442   754  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   21 ]      -    436 - a - -
+    MR    63    62 3    65     3    69   113   441   752  -9.468  -0.009  -7.786                          0.238  0.190 -0.636  0.051 
+     D    64    62 3    65     3    62   108   438   750  -6.390  -1.568  -0.620                         
+    IR    65    65 3    65     3    67   113   441   753  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   22 ]      -    435 - a - -
+    MR    66    65 3    68     3    68   112   440   751  -9.468  -0.009  -7.786                          0.314 -0.441 -0.057  0.083 
+     D    67    65 3    68     3    61   107   437   749  -6.390  -1.568  -0.620                         
+    IR    68    68 3    68     3    66   112   440   752  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   23 ]      -    434 - g - -
+    MR    69    68 3    71     3    67   111   439   750  -9.468  -0.009  -7.786                          0.134 -0.461  0.181  0.059 
+     D    70    68 3    71     3    60   106   436   748  -6.390  -1.568  -0.620                         
+    IR    71    71 3    71     3    65   111   439   751  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   24 ]      -    433 - u - -
+    MR    72    71 3    74     3    66   111   438   749  -9.468  -0.009  -7.786                          0.188 -0.403 -0.088  0.218 
+     D    73    71 3    74     3    60   105   435   747  -6.390  -1.568  -0.620                         
+    IR    74    74 3    74     3    65   110   438   750  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   25 ]      -    432 - u - -
+    MR    75    74 3    77     3    65   110   437   748  -9.468  -0.009  -7.786                          0.112 -0.175 -0.451  0.380 
+     D    76    74 3    77     3    59   104   434   746  -6.390  -1.568  -0.620                         
+    IR    77    77 3    77     3    64   109   437   749  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   26 ]      -    431 - u - -
+    MR    78    77 3    80     3    65   109   436   747  -9.468  -0.009  -7.786                          0.020 -0.033 -0.127  0.128 
+     D    79    77 3    80     3    58   103   433   745  -6.390  -1.568  -0.620                         
+    IR    80    80 3    80     3    63   108   436   748  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   27 ]      -    430 - u - -
+    MR    81    80 3    83     3    64   108   435   746  -9.468  -0.009  -7.786                         -0.038 -0.179  0.062  0.136 
+     D    82    80 3    83     3    57   102   432   744  -6.390  -1.568  -0.620                         
+    IR    83    83 3    83     3    62   107   435   747  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   28 ]      -    429 - u - -
+    MR    84    83 3    86     3    63   107   434   745  -9.468  -0.009  -7.786                          0.083 -0.101 -0.195  0.182 
+     D    85    83 3    86     3    56   101   431   743  -6.390  -1.568  -0.620                         
+    IR    86    86 3    86     3    61   106   434   746  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   29 ]      -    428 - g - -
+    MR    87    86 3    89     3    62   106   433   744  -9.468  -0.009  -7.786                          0.143 -0.128  0.150 -0.199 
+     D    88    86 3    89     3    55   100   430   742  -6.390  -1.568  -0.620                         
+    IR    89    89 3    89     3    60   105   433   745  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   30 ]      -    427 - a - -
+    MR    90    89 3    92     5    62   105   432   743  -8.155  -0.019  -7.970  -8.182  -9.074          0.295 -0.462 -0.174  0.215 
+     D    91    89 3    92     5    54    99   429   741  -5.352  -0.707  -2.978  -4.409  -2.404         
+    IR    92    92 3    92     5    59   103   432   743  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   31 ]     16    426 g c - -
+    MP    93    92 3    97     6    61   104   431   742  -9.704  -9.643  -0.014  -8.420  -8.699  -9.094 -1.415 -1.836 -1.598  1.186 -1.576 -2.244  1.452 -2.078 -1.764  1.615 -2.117 -0.269  1.542 -1.947  0.137 -0.910 
+    ML    94    92 3    97     6    56   100   428   740  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    95    92 3    97     6    56    99   428   740  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    96    92 3    97     6    51    94   423   735  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    97    97 5    97     6    58   102   430   741  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    98    98 6    98     5    58   102   430   741  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   32 ]     17    425 a u - -
+    MP    99    98 6   103     6    59   102   429   741  -9.704  -9.643  -0.014  -8.420  -8.699  -9.094 -1.642 -1.330 -1.649  1.749 -1.863 -2.105  1.616 -1.840 -1.978  0.893 -2.155 -0.605  1.282 -1.385  0.470 -0.844 
+    ML   100    98 6   103     6    55    99   426   738  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   101    98 6   103     6    55    98   426   738  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   102    98 6   103     6    51    94   422   733  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   103   103 5   103     6    57   100   428   740  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   104   104 6   104     5    57   100   428   739  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   33 ]     18    424 u a - -
+    MP   105   104 6   109     6    58   100   427   739  -9.704  -9.643  -0.014  -8.420  -8.699  -9.094 -1.669 -1.421 -1.713  1.438 -1.139 -2.661  1.639 -2.003 -1.923  0.744 -2.357 -0.491  1.889 -1.792 -0.036 -0.977 
+    ML   106   104 6   109     6    54    98   425   736  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   107   104 6   109     6    54    97   424   736  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   108   104 6   109     6    50    93   421   732  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   109   109 5   109     6    56    99   426   738  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   110   110 6   110     5    56    99   426   737  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   34 ]     19    423 G C - -
+    MP   111   110 6   115     6    56    99   425   737  -9.704  -9.643  -0.014  -8.420  -8.699  -9.094 -4.129 -0.716 -3.976  0.875 -4.999 -3.719 -0.159 -4.637 -4.342  3.350 -4.278 -0.303 -0.369 -3.670 -1.735 -2.951 
+    ML   112   110 6   115     6    53    96   423   735  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   113   110 6   115     6    53    96   423   734  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   114   110 6   115     6    50    93   420   731  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   115   115 5   115     6    54    97   424   736  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   116   116 6   116     5    54    97   424   736  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   35 ]     20    422 G C - -
+    MP   117   116 6   121     6    54    97   423   735  -9.704  -9.643  -0.015  -8.420  -8.220  -9.094 -5.280 -2.748 -5.263 -0.123 -6.269 -5.043 -1.298 -5.871 -4.525  3.727 -5.233 -1.042 -1.493 -3.243 -3.351 -4.221 
+    ML   118   116 6   121     6    52    95   422   733  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   119   116 6   121     6    52    95   421   733  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   120   116 6   121     6    50    93   419   731  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   121   121 5   121     6    53    96   422   734  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   122   122 6   122     5    53    96   422   734  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   36 ]     21    421 U G - -
+    MP   123   122 6   127     4    52    95   421   733  -8.173  -8.380  -0.712  -1.385                 -4.222 -3.227 -3.253 -0.577 -3.258 -4.806  1.264 -3.926 -3.690 -0.396 -4.615 -2.283  0.767 -3.388  3.242 -3.107 
+    ML   124   122 6   127     4    51    94   420   732  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR   125   122 6   127     4    51    93   420   732  -4.837  -3.866  -1.733  -0.748                  0.331 -0.272 -0.270  0.118 
+     D   126   122 6   127     4    50    92   419   730  -4.568  -4.250  -2.265  -0.520                 
+    IL   127   127 5   127     4    52    95   421   733  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   128   128 6   128     3    52    94   421   732  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   37 ]     22      - u - - -
+    ML   129   128 6   131     2    50    93   419   731  -5.880  -0.025                                  0.007 -1.000  0.287  0.351 
+     D   130   128 6   131     2    49    92   418   730  -8.986  -0.003                                 
+    IL   131   131 3   131     2    50    93   420   731  -1.820  -0.480                                  0.000  0.000  0.000  0.000 
+                                             [ BIF    38 ]      -      - - - - -
+     B   132   131 3   133   189    49    92   418   730                                                 
+                                             [ BEGL   39 ]      -      - - - - -
+     S   133   132 1   134     4     0     0    97   194  -0.034  -7.580  -6.987  -6.664                 
+                                             [ MATP   40 ]     25     68 c g - -
+    MP   134   133 1   138     6     2     2    97   194  -9.698  -9.637  -0.015  -8.414  -8.188  -9.089 -2.580 -2.840 -2.827  0.994 -2.515 -3.615  2.416 -2.851 -2.940  1.127 -2.820 -1.006  1.883 -3.071 -0.318 -1.922 
+    ML   135   133 1   138     6     1     1    94   192  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   136   133 1   138     6     1     1    94   192  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   137   133 1   138     6     0     0    90   188  -9.190  -7.889  -3.686  -4.368  -4.385  -0.286 
+    IL   138   138 5   138     6     1     1    96   193  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   139   139 6   139     5     1     1    96   193  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   41 ]     26     67 c g - -
+    MP   140   139 6   144     6     2     2    95   192  -9.696  -9.636  -0.014  -8.412  -8.692  -9.087 -3.442 -3.244 -3.540  0.483 -1.880 -4.385  2.845 -3.272 -3.497  0.786 -3.587 -0.954  1.691 -3.701 -0.345 -2.282 
+    ML   141   139 6   144     6     1     1    93   191  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   142   139 6   144     6     1     1    92   190  -7.013  -5.742  -1.651  -5.720  -0.809  -3.934  0.462 -0.451 -0.188  0.019 
+     D   143   139 6   144     6     0     0    89   187  -9.190  -7.889  -3.686  -4.368  -4.385  -0.286 
+    IL   144   144 5   144     6     1     1    94   192  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   145   145 6   145     5     1     1    94   191  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   42 ]     27     66 c g - -
+    MP   146   145 6   150     4     2     2    93   190  -8.163  -8.370  -0.036  -5.778                 -2.045 -2.146 -1.992  0.998 -2.099 -3.081  2.234 -2.525 -2.056  1.279 -2.210 -0.673  1.463 -1.970  0.192 -1.355 
+    ML   147   145 6   150     4     1     1    91   189  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR   148   145 6   150     4     1     1    90   187  -4.838  -3.867  -1.735  -0.746                  0.397 -0.482 -0.017 -0.031 
+     D   149   145 6   150     4     0     0    88   186  -4.701  -4.382  -2.398  -0.466                 
+    IL   150   150 5   150     4     1     1    92   190  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   151   151 6   151     3     1     1    92   190  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   43 ]     28      - c - - -
+    ML   152   151 6   154     3     1     1    91   188  -9.106  -0.009  -7.760                         -0.316  0.331 -0.099  0.008 
+     D   153   151 6   154     3     0     0    86   183  -6.611  -2.124  -0.395                         
+    IL   154   154 3   154     3     1     1    91   189  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   44 ]     29      - u - - -
+    ML   155   154 3   157     3     1     1    90   187  -9.106  -0.335  -2.285                         -0.216  0.080 -0.253  0.314 
+     D   156   154 3   157     3     0     0    83   181  -6.611  -2.124  -0.395                         
+    IL   157   157 3   157     3     1     1    91   189  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   45 ]     30      - u - - -
+    ML   158   157 3   160     3     1     1    90   188  -8.783  -0.139  -3.486                          0.007 -0.050 -0.234  0.238 
+     D   159   157 3   160     3     0     0    75   173  -8.620  -4.133  -0.089                         
+    IL   160   160 3   160     3     1     1    90   188  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   46 ]     31      - u - - -
+    ML   161   160 3   163     3     1     1    89   187  -1.430  -0.684  -7.312                          0.131 -0.287 -0.057  0.169 
+     D   162   160 3   163     3     0     0    61   158  -8.942  -1.501  -0.633                         
+    IL   163   163 3   163     3     1     1    94   191  -0.272  -2.583  -7.696                          0.000  0.000  0.000  0.000 
+                                             [ MATL   47 ]     54      - a - - -
+    ML   164   163 3   166     3     1     1    24    44  -8.847  -0.011  -7.501                          0.185 -0.317 -0.027  0.109 
+     D   165   163 3   166     3     0     0    21    41  -8.412  -3.925  -0.103                         
+    IL   166   166 3   166     3     1     1    25    46  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   48 ]     55      - a - - -
+    ML   167   166 3   169     3     1     1    23    43  -8.847  -0.011  -7.501                          0.197 -0.292 -0.122  0.161 
+     D   168   166 3   169     3     0     0    19    40  -8.412  -3.925  -0.103                         
+    IL   169   169 3   169     3     1     1    24    45  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   49 ]     56      - a - - -
+    ML   170   169 3   172     3     1     1    21    42  -8.847  -0.032  -5.645                          0.127 -0.160 -0.001  0.019 
+     D   171   169 3   172     3     0     0    18    39  -8.412  -3.791  -0.113                         
+    IL   172   172 3   172     3     1     1    23    44  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   50 ]     57      - g - - -
+    ML   173   172 3   175     3     1     1    20    41  -8.828  -0.362  -2.188                         -0.088 -0.658  0.610 -0.153 
+     D   174   172 3   175     3     0     0    17    38  -8.476  -3.989  -0.098                         
+    IL   175   175 3   175     3     1     1    23    43  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   51 ]     58      - u - - -
+    ML   176   175 3   178     3     1     1    20    40  -3.522  -0.143  -7.135                          0.064 -0.119 -0.146  0.176 
+     D   177   175 3   178     3     0     0    15    35  -9.267  -2.025  -0.410                         
+    IL   178   178 3   178     3     1     1    21    42  -1.298  -0.846  -4.762                          0.000  0.000  0.000  0.000 
+                                             [ MATL   52 ]     63      - g - - -
+    ML   179   178 3   181     3     1     1    14    33  -8.664  -0.013  -7.318                         -0.063 -0.161  0.264 -0.078 
+     D   180   178 3   181     3     0     0    13    31  -8.928  -2.929  -0.206                         
+    IL   181   181 3   181     3     1     1    19    37  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   53 ]     64      - a - - -
+    ML   182   181 3   184     3     1     1    13    31  -8.718  -0.012  -7.372                          0.361 -0.375  0.115 -0.215 
+     D   183   181 3   184     3     0     0    11    30  -8.800  -2.619  -0.260                         
+    IL   184   184 3   184     3     1     1    18    36  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   54 ]     65      - a - - -
+    ML   185   184 3   187     2     1     1     1     1       *   0.000                                  0.107 -0.265  0.047  0.081 
+     D   186   184 3   187     2     0     0     0     0       *   0.000                                 
+    IL   187   187 3   187     2     1     1    13    28  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ END    55 ]      -      - - - - -
+     E   188   187 3    -1     0     0     0     0     0                                                 
+                                             [ BEGR   56 ]      -      - - - - -
+     S   189   132 1   190     3    38    79   400   712  -9.131  -0.139  -3.470                         
+    IL   190   190 2   190     3    39    81   402   713  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   57 ]     69      - u - - -
+    ML   191   190 2   193     3    40    80   400   712  -9.002  -0.010  -7.656                         -0.357 -0.346 -1.184  0.994 
+     D   192   190 2   193     3    34    75   397   709  -7.649  -3.162  -0.179                         
+    IL   193   193 3   193     3    39    80   401   712  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   58 ]     70      - u - - -
+    ML   194   193 3   196     3    39    79   399   711  -3.765  -0.120  -7.382                         -0.685 -0.618  0.325  0.559 
+     D   195   193 3   196     3    34    75   397   709  -7.649  -0.763  -1.302                         
+    IL   196   196 3   196     3    38    79   400   711  -1.135  -0.963  -4.979                          0.000  0.000  0.000  0.000 
+                                             [ MATL   59 ]     77      - A - - -
+    ML   197   196 3   199     3    38    78   398   710  -9.098  -0.012  -7.274                          1.776 -2.632 -2.040 -2.546 
+     D   198   196 3   199     3    32    73   395   707  -6.732  -2.042  -0.419                         
+    IL   199   199 3   199     3    37    78   399   710  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   60 ]     78      - A - - -
+    ML   200   199 3   202     3    37    77   397   709  -9.099  -0.020  -6.360                          1.828 -3.015 -2.669 -2.566 
+     D   201   199 3   202     3    32    73   395   706  -6.722  -2.013  -0.429                         
+    IL   202   202 3   202     3    37    77   398   709  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   61 ]     79      - a - - -
+    ML   203   202 3   205     5    37    76   396   708  -8.118  -0.034  -6.146  -8.145  -9.037          0.596 -0.934 -0.019 -0.031 
+     D   204   202 3   205     5    31    72   394   706  -5.357  -0.565  -4.618  -2.993  -2.906         
+    IL   205   205 3   205     5    35    75   396   708  -2.408  -0.496  -4.087  -5.920  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   62 ]     80    420 a u - -
+    MP   206   205 3   210     6    36    75   395   707  -5.135  -9.634  -0.054  -8.410  -8.690  -9.085 -2.619 -2.241 -2.760  2.549 -2.737 -2.931  1.439 -3.028 -2.907  1.408 -3.433 -0.751  0.994 -2.920 -0.621 -1.917 
+    ML   207   205 3   210     6    32    72   393   705  -3.225  -6.770  -1.413  -1.178  -6.619  -4.149  0.240 -0.222 -0.287  0.192 
+    MR   208   205 3   210     6    32    71   393   704  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   209   205 3   210     6    28    68   389   701  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   210   210 5   210     6    34    74   394   706  -2.907  -3.442  -0.500  -5.097  -5.874  -5.534  0.000  0.000  0.000  0.000 
+    IR   211   211 6   211     5    34    74   394   706  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   63 ]     83    419 G C - -
+    MP   212   211 6   216     6    34    73   393   705  -9.704  -9.643  -0.014  -8.420  -8.699  -9.094 -6.422 -4.033 -6.849 -0.422 -7.712 -5.476 -2.611 -7.122 -5.397  3.852 -5.662 -1.811 -2.916 -5.622 -4.770 -5.699 
+    ML   213   211 6   216     6    31    71   391   703  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   214   211 6   216     6    30    70   391   702  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   215   211 6   216     6    28    67   388   700  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   216   216 5   216     6    32    72   392   704  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   217   217 6   217     5    32    72   392   704  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   64 ]     84    418 G C - -
+    MP   218   217 6   222     4    32    71   391   703  -8.175  -8.382  -0.022  -6.796                 -4.010 -3.490 -5.198 -0.126 -6.220 -5.140 -1.294 -5.737 -4.946  3.731 -2.929 -1.104 -1.571 -4.785 -3.336 -4.122 
+    ML   219   217 6   222     4    30    70   390   702  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR   220   217 6   222     4    29    68   389   701  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D   221   217 6   222     4    28    67   388   699  -4.568  -4.250  -2.265  -0.520                 
+    IL   222   222 5   222     4    31    71   391   703  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   223   223 6   223     3    31    71   391   702  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   65 ]     85      - G - - -
+    ML   224   223 6   226     3    31    70   389   701  -9.131  -0.009  -7.785                         -3.346 -4.973  1.933 -4.288 
+     D   225   223 6   226     3    27    66   387   698  -6.174  -1.687  -0.566                         
+    IL   226   226 3   226     3    30    70   390   701  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   66 ]     86      - A - - -
+    ML   227   226 3   229     3    30    69   388   700  -9.131  -0.009  -7.785                          1.943 -4.562 -4.027 -4.280 
+     D   228   226 3   229     3    26    66   386   698  -6.174  -1.687  -0.566                         
+    IL   229   229 3   229     3    29    69   389   700  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   67 ]     87      - A - - -
+    ML   230   229 3   232     3    29    68   387   699  -6.379  -0.024  -7.786                          1.943 -4.562 -4.027 -4.280 
+     D   231   229 3   232     3    26    65   385   697  -5.620  -0.734  -1.403                         
+    IL   232   232 3   232     3    28    67   387   699  -2.030  -0.659  -3.040                          0.000  0.000  0.000  0.000 
+                                             [ MATR   68 ]      -    417 - A - -
+    MR   233   232 3   235     3    28    67   386   698  -9.453  -0.009  -7.771                          1.927 -4.294 -3.530 -4.052 
+     D   234   232 3   235     3    25    64   384   695  -6.642  -1.820  -0.501                         
+    IR   235   235 3   235     3    28    67   386   698  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   69 ]      -    416 - G - -
+    MR   236   235 3   238     3    27    66   385   697  -9.453  -0.009  -7.771                         -1.120 -2.512  1.639 -1.997 
+     D   237   235 3   238     3    24    63   383   695  -6.642  -1.820  -0.501                         
+    IR   238   238 3   238     3    27    66   385   697  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   70 ]      -    415 - A - -
+    MR   239   238 3   241     3    26    65   384   696  -9.453  -0.009  -7.771                          1.922 -4.227 -3.414 -3.989 
+     D   240   238 3   241     3    24    63   383   694  -6.642  -1.820  -0.501                         
+    IR   241   241 3   241     3    26    65   385   696  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR   71 ]      -    414 - G - -
+    MR   242   241 3   244     2    25    64   383   695  -9.659  -0.002                                  0.017 -2.697  1.376 -2.067 
+     D   243   241 3   244     2    24    63   382   694  -4.695  -0.057                                 
+    IR   244   244 3   244     2    25    64   384   695  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ BIF    72 ]      -      - - - - -
+     B   245   244 3   498   246    24    63   382   694                                                 
+                                             [ BEGR  100 ]      -      - - - - -
+     S   246   245 1   247     3     2    35   345   656  -9.131  -0.009  -7.785                         
+    IL   247   247 2   247     3     1    35   346   658  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL  101 ]    156      - A - - -
+    ML   248   247 2   250     5     2    35   345   656  -8.155  -0.019  -7.970  -8.182  -9.074          1.378 -2.450 -0.001 -2.193 
+     D   249   247 2   250     5     0    29   342   654  -4.959  -0.803  -4.221  -2.596  -2.508         
+    IL   250   250 3   250     5     1    33   344   656  -2.408  -0.496  -4.087  -5.920  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP  102 ]    157    413 C G - -
+    MP   251   250 3   255     6     3    34   344   655  -9.704  -9.643  -0.014  -8.420  -8.699  -9.094 -8.267 -8.326 -7.131 -4.520 -5.509 -7.052  3.964 -7.137 -7.856 -4.427 -5.439 -6.391 -2.854 -8.246 -3.952 -6.655 
+    ML   252   250 3   255     6     1    30   341   653  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   253   250 3   255     6     1    29   341   653  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   254   250 3   255     6     0    26   338   649  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   255   255 5   255     6     1    32   343   654  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   256   256 6   256     5     1    32   343   654  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP  103 ]    158    412 u a - -
+    MP   257   256 6   261     6     3    33   342   653  -9.704  -9.643  -0.014  -8.420  -8.699  -9.094 -4.103 -3.766 -4.098  0.072 -3.298 -4.869  1.439 -3.869 -4.068  1.749 -4.544 -1.350  2.859 -4.280 -0.879 -2.894 
+    ML   258   256 6   261     6     1    29   340   652  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   259   256 6   261     6     1    28   339   651  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   260   256 6   261     6     0    25   337   648  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   261   261 5   261     6     1    31   341   652  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   262   262 6   262     5     1    31   341   652  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP  104 ]    159    411 G C - -
+    MP   263   262 6   267     4     2    31   340   651  -8.175  -8.382  -0.022  -6.796                 -6.851 -4.158 -7.565 -1.341 -8.069 -5.487 -2.912 -7.680 -5.509  3.899 -5.750 -1.991 -3.273 -5.776 -5.133 -6.416 
+    ML   264   262 6   267     4     1    28   339   650  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR   265   262 6   267     4     1    26   337   649  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D   266   262 6   267     4     0    25   336   648  -4.568  -4.250  -2.265  -0.520                 
+    IL   267   267 5   267     4     1    30   339   651  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   268   268 6   268     3     1    29   339   651  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL  105 ]    160      - U - - -
+    ML   269   268 6   271     3     1    29   338   649  -9.131  -0.009  -7.785                         -3.233 -2.752 -3.996  1.881 
+     D   270   268 6   271     3     0    24   335   647  -6.174  -1.687  -0.566                         
+    IL   271   271 3   271     3     1    28   338   650  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL  106 ]    161      - A - - -
+    ML   272   271 3   274     3     1    28   337   648  -9.131  -0.009  -7.785                          1.014 -1.816  0.454 -1.612 
+     D   273   271 3   274     3     0    23   334   646  -6.174  -1.687  -0.566                         
+    IL   274   274 3   274     3     1    27   337   649  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL  107 ]    162      - A - - -
+    ML   275   274 3   277     3     1    27   336   647  -4.966  -0.054  -7.786                          1.389 -1.897 -1.140 -0.603 
+     D   276   274 3   277     3     0    22   334   645  -5.620  -0.734  -1.403                         
+    IL   277   277 3   277     3     1    26   336   647  -2.113  -0.466  -4.473                          0.000  0.000  0.000  0.000 
+                                             [ MATR  108 ]      -    410 - c - -
+    MR   278   277 3   280     3     1    26   335   646  -9.468  -0.009  -7.786                         -1.914  0.947 -2.836  0.737 
+     D   279   277 3   280     3     0    20   332   643  -6.390  -1.568  -0.620                         
+    IR   280   280 3   280     3     1    25   335   646  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR  109 ]      -    409 - G - -
+    MR   281   280 3   283     3     1    25   334   645  -9.468  -0.009  -7.786                         -3.663 -5.118  1.943 -4.402 
+     D   282   280 3   283     3     0    19   331   642  -6.390  -1.568  -0.620                         
+    IR   283   283 3   283     3     1    24   334   645  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR  110 ]      -    408 - A - -
+    MR   284   283 3   286     3     1    24   333   644  -9.468  -0.009  -7.786                          1.880 -3.254 -3.105 -3.358 
+     D   285   283 3   286     3     0    18   329   641  -6.390  -1.568  -0.620                         
+    IR   286   286 3   286     3     1    23   333   644  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR  111 ]      -    407 - g - -
+    MR   287   286 3   289     5     1    23   332   643  -6.174  -0.034  -7.970  -8.182  -9.074          0.344 -1.458  0.994 -1.415 
+     D   288   286 3   289     5     0    17   328   639  -5.352  -0.707  -2.978  -4.409  -2.404         
+    IR   289   289 3   289     5     1    21   331   643  -2.493  -0.463  -6.004  -4.172  -5.278          0.000  0.000  0.000  0.000 
+                                             [ MATP  112 ]    165    405 g c - -
+    MP   290   289 3   294     6     2    23   331   642  -9.704  -9.643  -0.014  -8.420  -8.699  -9.094 -2.903 -2.176 -2.257  1.279 -3.463 -1.940  0.753 -3.581 -3.314  2.812 -3.759  0.477  0.370 -3.114 -1.274 -1.063 
+    ML   291   289 3   294     6     1    18   326   638  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   292   289 3   294     6     1    17   325   636  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   293   289 3   294     6     0    13   313   625  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   294   294 5   294     6     1    20   329   641  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   295   295 6   295     5     1    20   329   641  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP  113 ]    166    404 c g - -
+    MP   296   295 6   300     6     2    21   329   640  -8.410  -9.643  -0.018  -8.016  -8.699  -9.094 -4.099 -3.864 -4.100  0.298 -3.148 -4.876  2.902 -3.775 -4.035  1.504 -4.524 -1.601  1.464 -4.280 -0.573 -2.835 
+    ML   297   295 6   300     6     1    17   323   634  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   298   295 6   300     6     1    16   321   632  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   299   295 6   300     6     0    13   308   620  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   300   300 5   300     6     1    19   327   639  -2.616  -2.879  -0.735  -4.534  -5.310  -4.971  0.000  0.000  0.000  0.000 
+    IR   301   301 6   301     5     1    19   327   638  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP  114 ]    168    403 G C - -
+    MP   302   301 6   306     6     2    19   327   638  -9.702  -9.642  -0.032  -8.418  -8.698  -6.116 -3.475 -2.555 -3.684  1.473 -4.326 -4.336  0.568 -2.903 -3.877  3.063 -4.344 -0.333  0.393 -3.487 -1.541 -2.683 
+    ML   303   301 6   306     6     1    16   318   629  -6.277  -6.623  -1.271  -1.032  -6.473  -4.003  0.457 -0.447 -0.187  0.022 
+    MR   304   301 6   306     6     1    15   315   627  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   305   301 6   306     6     0    12   302   614  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   306   306 5   306     6     1    17   325   636  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   307   307 6   307     5     1    17   325   636  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP  115 ]    169    402 g c - -
+    MP   308   307 6   312     4     2    17   325   637  -1.339  -3.567  -0.982  -6.153                 -2.682 -1.659 -2.709  1.495 -3.311 -3.381  0.837 -3.462 -1.980  2.795 -3.534 -0.071  0.486 -2.725 -1.077 -2.144 
+    ML   309   307 6   312     4     1    14   306   618  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR   310   307 6   312     4     1    13   303   615  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D   311   307 6   312     4     0    12   295   607  -4.948  -4.629  -1.457  -0.829                 
+    IL   312   312 5   312     4     1    17   333   645  -0.943  -2.045  -2.097  -8.121                  0.000  0.000  0.000  0.000 
+    IR   313   313 6   313     3     1    20   343   654  -0.085  -4.177  -8.885                          0.000  0.000  0.000  0.000 
+                                             [ MATL  116 ]    180      - a - - -
+    ML   314   313 6   316     3     1    14   233   443  -9.115  -0.009  -7.769                          0.326 -0.641  0.234 -0.107 
+     D   315   313 6   316     3     0    11   231   441  -6.468  -1.428  -0.697                         
+    IL   316   316 3   316     3     1    14   234   444  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL  117 ]    181      - g - - -
+    ML   317   316 3   319     3     1    13   232   442  -9.126  -0.009  -7.780                          0.287 -0.393  0.350 -0.427 
+     D   318   316 3   319     3     0    10   230   440  -6.286  -1.618  -0.596                         
+    IL   319   319 3   319     3     1    13   233   443  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL  118 ]    182      - a - - -
+    ML   320   319 3   322     3     1    12   231   441  -9.128  -0.009  -7.783                          0.687 -0.804  0.299 -0.769 
+     D   321   319 3   322     3     0     9   229   439  -6.230  -1.571  -0.621                         
+    IL   322   322 3   322     3     1    12   232   442  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL  119 ]    183      - g - - -
+    ML   323   322 3   325     3     1    11   230   440  -9.131  -0.015  -6.821                          0.125 -0.111  0.170 -0.219 
+     D   324   322 3   325     3     0     8   228   438  -6.174  -1.687  -0.566                         
+    IL   325   325 3   325     3     1    11   231   441  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL  120 ]    184      - c - - -
+    ML   326   325 3   328     3     1    10   229   439  -9.125  -0.009  -7.779                         -0.126  0.238  0.038 -0.189 
+     D   327   325 3   328     3     0     8   227   438  -6.298  -1.811  -0.510                         
+    IL   328   328 3   328     3     1    11   230   440  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL  121 ]    185      - a - - -
+    ML   329   328 3   331     3     1     9   228   438  -9.462  -0.391  -2.082                          0.248  0.019 -0.350  0.021 
+     D   330   328 3   331     3     0     7   227   437  -5.696  -0.713  -1.432                         
+    IL   331   331 3   331     3     1    11   229   439  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR  122 ]      -    335 - c - -
+    MR   332   331 3   334     3     1    11   228   438  -9.088  -0.011  -7.406                         -0.343  0.677 -0.933  0.123 
+     D   333   331 3   334     3     0     5   226   436  -8.762  -0.644  -1.482                         
+    IR   334   334 3   334     3     1    10   228   438  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR  123 ]      -    334 - a - -
+    MR   335   334 3   337     3     1    10   227   437  -9.369  -0.009  -7.687                          0.848 -0.739 -0.308 -0.335 
+     D   336   334 3   337     3     0     4   224   434  -7.529  -1.921  -0.453                         
+    IR   337   337 3   337     3     1     9   227   437  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR  124 ]      -    333 - g - -
+    MR   338   337 3   340     3     1    10   226   436  -9.390  -0.009  -7.707                          0.343 -1.007  0.546 -0.370 
+     D   339   337 3   340     3     0     3   223   433  -7.359  -2.388  -0.317                         
+    IR   340   340 3   340     3     1     8   226   436  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR  125 ]      -    332 - u - -
+    MR   341   340 3   343     3     1     9   225   435  -9.393  -0.009  -7.710                         -0.101 -0.346  0.149  0.228 
+     D   342   340 3   343     3     0     3   222   432  -7.332  -1.733  -0.529                         
+    IR   343   343 3   343     3     1     7   225   435  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR  126 ]      -    331 - a - -
+    MR   344   343 3   346     3     1     8   224   434  -9.413  -0.009  -7.731                          0.401 -0.735  0.061  0.050 
+     D   345   343 3   346     3     0     2   222   432  -7.139  -1.022  -0.998                         
+    IR   346   346 3   346     3     1     6   224   434  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR  127 ]      -    330 - a - -
+    MR   347   346 3   349     3     1     7   223   433  -9.453  -0.009  -7.771                          0.576 -0.924  0.296 -0.407 
+     D   348   346 3   349     3     0     1   220   431  -6.642  -1.173  -0.872                         
+    IR   349   349 3   349     3     1     5   223   433  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR  128 ]      -    329 - g - -
+    MR   350   349 3   352     3     1     6   222   432  -9.468  -0.009  -7.786                         -0.195  0.040  0.086  0.052 
+     D   351   349 3   352     3     0     1   219   429  -6.390  -1.568  -0.620                         
+    IR   352   352 3   352     3     1     5   222   432  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR  129 ]      -    328 - g - -
+    MR   353   352 3   355     3     1     5   221   431  -9.468  -0.009  -7.786                         -0.236 -0.064  0.497 -0.353 
+     D   354   352 3   355     3     0     0   218   428  -6.390  -1.568  -0.620                         
+    IR   355   355 3   355     3     1     4   221   431  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR  130 ]      -    327 - a - -
+    MR   356   355 3   358     3     1     5   220   430  -9.468  -0.010  -7.466                          0.502 -0.604 -0.006 -0.105 
+     D   357   355 3   358     3     0     0   217   427  -6.390  -1.568  -0.620                         
+    IR   358   358 3   358     3     1     3   220   430  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR  131 ]      -    326 - a - -
+    MR   359   358 3   361     5     1     4   219   429  -5.865  -0.052  -7.406  -8.181  -6.836          0.263 -0.220  0.145 -0.260 
+     D   360   358 3   361     5     0     0   216   426  -5.368  -0.697  -2.995  -4.426  -2.420         
+    IR   361   361 3   361     5     1     2   219   429  -2.355  -0.490  -6.068  -4.235  -5.341          0.000  0.000  0.000  0.000 
+                                             [ MATP  132 ]    186    323 c g - -
+    MP   362   361 3   366     6     2     6   218   428  -9.695  -9.635  -0.017  -7.563  -8.691  -9.086 -0.456 -1.579 -0.252  1.042 -1.679 -1.532  1.541 -2.165 -1.782  1.291 -2.275 -0.366  1.370 -1.527  0.033 -0.811 
+    ML   363   361 3   366     6     1     1   215   426  -6.285  -6.632  -1.346  -0.970  -6.481  -4.011  0.413 -0.365 -0.233  0.059 
+    MR   364   361 3   366     6     1     1   215   425  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   365   361 3   366     6     0     0   210   420  -9.205  -7.904  -3.701  -2.730  -4.400  -0.476 
+    IL   366   366 5   366     6     1     2   217   427  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   367   367 6   367     5     1     2   217   427  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP  133 ]    187    322 c g - -
+    MP   368   367 6   372     6     2     6   216   426  -9.692  -8.261  -0.017  -8.408  -8.688  -9.083 -1.390 -1.525 -1.222  1.072 -1.463 -2.152  1.791 -1.764 -1.743  1.204 -2.579  0.085  1.426 -1.656  0.106 -1.037 
+    ML   369   367 6   372     6     1     1   214   424  -6.466  -6.813  -1.040  -1.221  -6.662  -4.192  0.609 -0.565 -0.214 -0.095 
+    MR   370   367 6   372     6     1     1   213   423  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   371   367 6   372     6     0     0   208   418  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   372   372 5   372     6     1     2   215   425  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   373   373 6   373     5     1     2   215   425  -2.434  -0.486  -5.945  -4.113  -5.219          0.000  0.000  0.000  0.000 
+                                             [ MATP  134 ]    188    320 c g - -
+    MP   374   373 6   378     6     2     5   214   424  -9.704  -7.671  -0.020  -8.420  -8.699  -8.745 -2.767 -2.782 -2.917  0.910 -2.099 -3.580  2.495 -2.874 -2.524  1.269 -3.489 -0.589  1.588 -3.064 -0.216 -1.825 
+    ML   375   373 6   378     6     1     1   211   422  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   376   373 6   378     6     1     1   211   421  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   377   373 6   378     6     0     0   207   417  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   378   378 5   378     6     1     1   213   423  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   379   379 6   379     5     1     2   213   423  -2.303  -0.514  -6.003  -4.170  -5.276          0.000  0.000  0.000  0.000 
+                                             [ MATP  135 ]    189    317 c g - -
+    MP   380   379 6   384     6     2     4   212   422  -9.703  -9.642  -0.020  -8.419  -7.670  -8.311 -2.686 -2.313 -2.937  1.112 -2.292 -3.765  2.110 -3.105 -2.986  1.971 -3.524 -0.778  1.433 -2.958 -0.284 -1.871 
+    ML   381   379 6   384     6     1     1   210   420  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   382   379 6   384     6     1     1   209   419  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   383   379 6   384     6     0     0   205   416  -9.067  -7.766  -3.563  -4.245  -4.262  -0.315 
+    IL   384   384 5   384     6     1     1   211   421  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   385   385 6   385     5     1     1   211   421  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP  136 ]    190    316 c g - -
+    MP   386   385 6   390     6     2     4   210   420  -9.697  -9.637  -0.027  -7.942  -7.153  -7.679 -2.082 -2.466 -2.598  1.064 -2.213 -3.240  2.113 -2.807 -2.595  1.421 -3.047 -0.788  1.870 -2.588 -0.194 -1.748 
+    ML   387   385 6   390     6     1     1   208   418  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   388   385 6   390     6     1     1   207   417  -7.049  -5.778  -1.687  -5.756  -0.890  -3.242  0.548 -0.509 -0.216 -0.037 
+     D   389   385 6   390     6     0     0   204   415  -9.115  -7.813  -3.610  -4.292  -4.309  -0.303 
+    IL   390   390 5   390     6     1     1   209   419  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   391   391 6   391     5     1     1   209   419  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP  137 ]    191    315 c g - -
+    MP   392   391 6   396     4     2     2   208   418  -8.143  -2.764  -0.261  -6.087                 -2.042 -2.018 -2.182  1.037 -2.087 -2.681  2.348 -2.418 -1.930  0.985 -2.242 -0.687  1.552 -2.371 -0.096 -1.205 
+    ML   393   391 6   396     4     1     1   207   417  -3.782  -3.965  -0.497  -2.694                  0.470 -0.456 -0.189  0.013 
+    MR   394   391 6   396     4     1     1   205   415  -4.937  -3.966  -1.833  -0.683                  0.633 -0.566 -0.268 -0.084 
+     D   395   391 6   396     4     0     0   204   414  -4.802  -4.483  -2.499  -0.429                 
+    IL   396   396 5   396     4     1     1   207   418  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   397   397 6   397     3     1     1   207   417  -1.783  -0.558  -5.063                          0.000  0.000  0.000  0.000 
+                                             [ MATL  138 ]    192      - A - - -
+    ML   398   397 6   400     3     1     2   206   416  -9.095  -0.012  -7.247                          1.036 -0.579 -0.873 -0.447 
+     D   399   397 6   400     3     0     0   203   413  -6.773  -2.286  -0.348                         
+    IL   400   400 3   400     3     1     1   206   416  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL  139 ]    193      - a - - -
+    ML   401   400 3   403     3     1     1   205   415  -9.092  -0.017  -6.663                          0.410 -0.245 -0.296  0.018 
+     D   402   400 3   403     3     0     0   202   412  -6.810  -1.510  -0.644                         
+    IL   403   403 3   403     3     1     1   205   415  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL  140 ]    194      - u - - -
+    ML   404   403 3   406     3     1     1   204   414  -9.101  -0.073  -4.396                          0.150  0.050 -0.586  0.250 
+     D   405   403 3   406     3     0     0   201   411  -6.684  -1.491  -0.656                         
+    IL   406   406 3   406     3     1     1   204   414  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL  141 ]    195      - a - - -
+    ML   407   406 3   409     3     1     1   203   413  -9.053  -0.325  -2.325                          0.998 -0.836 -0.639 -0.322 
+     D   408   406 3   409     3     0     0   199   409  -7.245  -2.758  -0.242                         
+    IL   409   409 3   409     3     1     1   204   414  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL  142 ]    196      - a - - -
+    ML   410   409 3   412     5     1     1   203   413  -1.657  -0.592  -7.606  -7.818  -6.626          0.336 -0.406 -0.406  0.297 
+     D   411   409 3   412     5     0     0   198   408  -6.876  -0.689  -6.137  -4.512  -1.675         
+    IL   412   412 3   412     5     1     1   206   416  -0.296  -2.583  -6.078  -9.511  -8.784          0.000  0.000  0.000  0.000 
+                                             [ MATP  143 ]    225    311 G C - -
+    MP   413   412 3   417     6     2     2   199   409  -9.599  -9.539  -0.025  -8.315  -8.595  -6.773 -2.790 -2.248 -2.374  1.287 -3.697 -4.020  0.385 -3.863 -2.944  3.068 -3.082  0.100  0.105 -3.289 -1.420 -2.039 
+    ML   414   412 3   417     6     1     1   197   408  -6.591  -6.937  -0.919  -1.346  -6.787  -4.317  0.861 -0.737 -0.467 -0.217 
+    MR   415   412 3   417     6     1     1   197   407  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   416   412 3   417     6     0     0   196   406 -10.339  -9.038  -0.675  -5.517  -5.534  -1.610 
+    IL   417   417 5   417     6     1     1   198   408  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   418   418 6   418     5     1     1   198   408  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP  144 ]    226    310 C G - -
+    MP   419   418 6   423     6     2     2   197   407  -9.694  -9.633  -0.014  -8.410  -8.690  -9.085 -3.988 -3.801 -4.011  0.341 -2.521 -4.810  3.011 -3.696 -3.938  1.269 -4.442 -1.495  1.180 -4.191 -0.247 -2.753 
+    ML   420   418 6   423     6     1     1   196   406  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   421   418 6   423     6     1     1   195   405  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   422   418 6   423     6     0     0   193   403  -9.276  -7.975  -3.772  -4.454  -4.471  -0.268 
+    IL   423   423 5   423     6     1     1   196   407  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   424   424 6   424     5     1     1   196   406  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP  145 ]    227    309 C G - -
+    MP   425   424 6   429     4     2     2   195   405  -8.159  -8.366  -0.023  -6.780                 -7.882 -8.002 -5.896 -4.172 -4.954 -6.853  3.953 -6.695 -7.440 -4.066 -6.869 -6.130 -2.408 -7.822 -3.497 -6.235 
+    ML   426   424 6   429     4     1     1   194   404  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR   427   424 6   429     4     1     1   193   404  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D   428   424 6   429     4     0     0   192   402  -4.782  -4.463  -2.479  -0.436                 
+    IL   429   429 5   429     4     1     1   195   405  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   430   430 6   430     3     1     1   195   405  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL  146 ]    228      - A - - -
+    ML   431   430 6   433     3     1     1   193   403  -9.453  -0.009  -7.771                          1.942 -4.536 -4.002 -4.254 
+     D   432   430 6   433     3     0     0   191   402  -5.806  -0.622  -1.589                         
+    IL   433   433 3   433     3     1     1   193   404  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR  147 ]      -    308 - A - -
+    MR   434   433 3   436     3     1     1   192   402  -9.468  -0.009  -7.786                          1.855 -3.129 -2.970 -2.832 
+     D   435   433 3   436     3     0     0   190   400  -6.390  -1.568  -0.620                         
+    IR   436   436 3   436     3     1     1   192   403  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR  148 ]      -    307 - A - -
+    MR   437   436 3   439     3     1     1   191   401  -9.468  -0.009  -7.786                          1.930 -4.291 -3.863 -3.859 
+     D   438   436 3   439     3     0     0   189   399  -6.390  -1.568  -0.620                         
+    IR   439   439 3   439     3     1     1   191   402  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR  149 ]      -    306 - G - -
+    MR   440   439 3   442     5     1     1   190   400  -8.155  -0.020  -7.970  -8.182  -8.548         -3.159 -4.760  1.921 -3.953 
+     D   441   439 3   442     5     0     0   188   398  -5.352  -0.707  -2.978  -4.409  -2.404         
+    IR   442   442 3   442     5     1     1   190   400  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP  150 ]    229    305 C G - -
+    MP   443   442 3   447     6     2     2   189   399  -9.703  -9.642  -0.014  -8.419  -8.699  -9.094 -6.221 -6.357 -5.595 -2.514 -4.007 -5.779  3.820 -4.954 -5.721 -2.433 -5.802 -4.494 -0.114 -6.126 -1.753 -4.519 
+    ML   444   442 3   447     6     1     1   187   397  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   445   442 3   447     6     1     1   186   397  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   446   442 3   447     6     0     0   181   392  -9.068  -7.767  -3.564  -4.246  -4.263  -0.314 
+    IL   447   447 5   447     6     1     1   188   398  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   448   448 6   448     5     1     1   188   398  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP  151 ]    230    304 U G - -
+    MP   449   448 6   453     6     2     2   187   398  -9.703  -9.642  -0.017  -7.975  -8.263  -9.094 -5.401 -5.483 -5.003 -1.736 -1.996 -5.334  0.859 -4.431 -5.059 -1.633 -3.463 -2.009 -0.133 -5.409  3.560 -3.898 
+    ML   450   448 6   453     6     1     1   185   395  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   451   448 6   453     6     1     1   185   395  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   452   448 6   453     6     0     0   180   390  -9.068  -7.767  -3.564  -4.246  -4.263  -0.314 
+    IL   453   453 5   453     6     1     1   186   397  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   454   454 6   454     5     1     1   186   396  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP  152 ]    231    303 g c - -
+    MP   455   454 6   459     6     2     2   185   396  -9.700  -9.639  -0.015  -8.043  -8.696  -9.091 -4.163 -2.671 -4.036  0.785 -4.999 -3.458  0.013 -4.656 -4.342  2.998 -4.609  1.847 -0.433 -3.878 -2.185 -3.000 
+    ML   456   454 6   459     6     1     1   183   393  -6.280  -6.626  -1.267  -1.035  -6.476  -4.006  0.325 -0.374 -0.240  0.176 
+    MR   457   454 6   459     6     1     1   183   393  -7.009  -5.738  -1.647  -5.716  -0.812  -3.930  0.333 -0.375 -0.231  0.161 
+     D   458   454 6   459     6     0     0   179   389  -9.068  -7.767  -3.564  -4.246  -4.263  -0.314 
+    IL   459   459 5   459     6     1     1   184   395  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   460   460 6   460     5     1     1   184   394  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP  153 ]    232    302 g c - -
+    MP   461   460 6   465     6     2     2   183   394  -9.700  -7.947  -0.035  -8.416  -8.696  -6.193 -3.677 -2.786 -3.513  1.343 -3.913 -4.320  0.956 -4.024 -3.878  2.860 -4.259 -0.332  0.953 -3.490 -0.589 -2.547 
+    ML   462   460 6   465     6     1     1   182   392  -6.275  -6.621  -1.335  -0.980  -6.471  -4.000  0.334 -0.281 -0.263  0.116 
+    MR   463   460 6   465     6     1     1   181   391  -7.009  -5.738  -1.582  -5.716  -0.850  -3.930  0.398 -0.474 -0.034 -0.022 
+     D   464   460 6   465     6     0     0   178   388  -9.068  -7.767  -3.352  -4.246  -4.263  -0.339 
+    IL   465   465 5   465     6     1     1   183   393  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   466   466 6   466     5     1     1   182   393  -2.444  -0.482  -5.955  -4.123  -5.229          0.000  0.000  0.000  0.000 
+                                             [ MATP  154 ]    233    300 c g - -
+    MP   467   466 6   471     6     2     2   181   392  -9.685  -9.625  -0.081  -8.401  -8.681  -4.425 -2.094 -2.300 -2.323  1.251 -1.724 -3.099  1.934 -2.612 -2.374  1.661 -3.011 -0.487  1.579 -2.364 -0.242 -1.484 
+    ML   468   466 6   471     6     1     1   180   390  -6.275  -6.621  -1.335  -0.980  -6.471  -4.000  0.451 -0.443 -0.186  0.027 
+    MR   469   466 6   471     6     1     1   179   390  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   470   466 6   471     6     0     0   177   387  -9.430  -8.128  -3.925  -4.607  -4.625  -0.239 
+    IL   471   471 5   471     6     1     1   181   391  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   472   472 6   472     5     1     1   181   391  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP  155 ]    234    299 c g - -
+    MP   473   472 6   477     4     2     2   180   390  -8.029  -8.236  -0.461  -1.910                 -1.652 -1.680 -1.964  1.265 -1.901 -2.798  2.179 -2.160 -2.041  1.090 -2.004 -0.583  1.391 -1.895 -0.101 -1.206 
+    ML   474   472 6   477     4     1     1   179   389  -3.776  -3.959  -0.499  -2.688                  0.334 -0.281 -0.263  0.116 
+    MR   475   472 6   477     4     1     1   178   388  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D   476   472 6   477     4     0     0   176   386  -5.794  -5.475  -3.389  -0.211                 
+    IL   477   477 5   477     4     1     1   180   390  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   478   478 6   478     3     1     1   180   390  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL  156 ]    235      - c - - -
+    ML   479   478 6   481     3     1     1   178   388  -8.586  -0.013  -7.240                          0.039  0.042 -0.103  0.017 
+     D   480   478 6   481     3     0     0   176   386  -9.088  -0.775  -1.274                         
+    IL   481   481 3   481     3     1     1   178   389  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL  157 ]    236      - g - - -
+    ML   482   481 3   484     3     1     1   177   387  -8.951  -0.010  -7.605                         -0.110 -0.494  0.430  0.023 
+     D   483   481 3   484     3     0     0   173   384  -7.957  -0.748  -1.321                         
+    IL   484   484 3   484     3     1     1   177   387  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL  158 ]    237      - c - - -
+    ML   485   484 3   487     3     1     1   176   386  -9.082  -0.009  -7.736                         -0.056  0.296 -0.565  0.182 
+     D   486   484 3   487     3     0     0   167   377  -6.941  -2.454  -0.305                         
+    IL   487   487 3   487     3     1     1   176   386  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL  159 ]    238      - a - - -
+    ML   488   487 3   490     3     1     1   175   385  -9.082  -0.009  -7.736                          0.637 -0.273 -0.718  0.014 
+     D   489   487 3   490     3     0     0   164   374  -6.941  -1.377  -0.721                         
+    IL   490   490 3   490     3     1     1   175   385  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL  160 ]    239      - a - - -
+    ML   491   490 3   493     3     1     1   174   384  -1.538  -1.438  -1.803                          0.410  0.026 -0.613 -0.000 
+     D   492   490 3   493     3     0     0   133   343  -6.615  -1.429  -0.694                         
+    IL   493   493 3   493     3     1     1   185   396  -0.126  -3.610  -8.972                          0.000  0.000  0.000  0.000 
+                                             [ MATL  161 ]    298      - g - - -
+    ML   494   493 3   496     2     1     1     1     1       *   0.000                                 -0.101  0.022  0.174 -0.114 
+     D   495   493 3   496     2     0     0     0     0       *   0.000                                 
+    IL   496   496 3   496     2     1     1    13    28  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ END   162 ]      -      - - - - -
+     E   497   496 3    -1     0     0     0     0     0                                                 
+                                             [ BEGL   73 ]      -      - - - - -
+     S   498   245 1   499     1     0     4   208   431   0.000                                         
+                                             [ BIF    74 ]      -      - - - - -
+     B   499   498 1   500   553     0     4   208   431                                                 
+                                             [ BEGL   75 ]      -      - - - - -
+     S   500   499 1   501     4     0     0   197   419  -0.028  -7.580  -6.987  -7.406                 
+                                             [ MATP   76 ]     89    141 c g - -
+    MP   501   500 1   505     6     2     2   197   419  -3.661  -9.642  -0.132  -8.418  -8.698  -9.093 -3.107 -2.990 -3.229  0.760 -2.619 -4.068  2.202 -3.247 -2.827  1.733 -3.773 -1.142  1.858 -3.373  0.073 -1.913 
+    ML   502   500 1   505     6     1     1   194   417  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   503   500 1   505     6     1     1   194   416  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   504   500 1   505     6     0     0   188   411  -9.075  -7.773  -3.570  -4.252  -4.270  -0.313 
+    IL   505   505 5   505     6     1     1   196   418  -3.687  -3.615  -0.335  -5.605  -6.381  -6.041  0.000  0.000  0.000  0.000 
+    IR   506   506 6   506     5     1     1   195   418  -2.440  -0.483  -5.951  -4.119  -5.225          0.000  0.000  0.000  0.000 
+                                             [ MATP   77 ]     91    139 c g - -
+    MP   507   506 6   511     6     2     2   195   417  -9.703  -9.642  -0.014  -8.418  -8.698  -9.093 -2.481 -2.517 -2.663  1.024 -2.331 -3.831  2.576 -3.104 -3.019  1.557 -3.565 -1.021  1.212 -3.057 -0.367 -2.002 
+    ML   508   506 6   511     6     1     1   192   415  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   509   506 6   511     6     1     1   192   414  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   510   506 6   511     6     0     0   187   410  -9.075  -7.773  -3.295  -4.252  -4.270  -0.345 
+    IL   511   511 5   511     6     1     1   194   416  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   512   512 6   512     5     1     1   193   416  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   78 ]     92    138 c g - -
+    MP   513   512 6   517     6     2     2   193   415  -8.304  -9.643  -0.022  -7.238  -8.699  -9.094 -3.911 -3.696 -3.948  0.627 -3.064 -4.766  2.923 -3.665 -3.879  1.282 -4.390 -1.410  1.327 -4.114 -0.421 -2.412 
+    ML   514   512 6   517     6     1     1   190   413  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   515   512 6   517     6     1     1   190   412  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   516   512 6   517     6     0     0   185   408  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   517   517 5   517     6     1     1   192   414  -2.621  -2.884  -0.732  -4.539  -5.315  -4.975  0.000  0.000  0.000  0.000 
+    IR   518   518 6   518     5     1     1   192   414  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   79 ]     94    137 G C - -
+    MP   519   518 6   523     6     2     2   191   413  -8.281  -9.638  -0.027  -7.934  -8.354  -7.143 -5.261 -2.847 -5.261  0.353 -6.295 -5.141 -1.060 -5.806 -4.973  3.696 -5.245 -1.205 -1.504 -4.811 -3.392 -4.185 
+    ML   520   518 6   523     6     1     1   189   411  -6.354  -6.700  -1.379  -0.933  -6.550  -4.079  0.368 -0.407 -0.057 -0.009 
+    MR   521   518 6   523     6     1     1   187   410  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   522   518 6   523     6     0     0   184   407  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   523   523 5   523     6     1     1   190   412  -2.622  -2.885  -0.732  -4.540  -5.316  -4.976  0.000  0.000  0.000  0.000 
+    IR   524   524 6   524     5     1     1   190   412  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   80 ]     96    136 G C - -
+    MP   525   524 6   529     4     2     2   189   411  -7.303  -8.357  -0.035  -6.081                 -4.198 -2.700 -4.047  0.805 -4.532 -3.649 -0.044 -4.690 -4.384  3.439 -3.512 -0.501 -0.413 -3.873 -2.181 -3.015 
+    ML   526   524 6   529     4     1     1   187   410  -3.849  -4.032  -0.470  -2.761                  0.625 -0.561 -0.262 -0.080 
+    MR   527   524 6   529     4     1     1   185   408  -4.828  -3.857  -1.665  -0.785                  0.433 -0.431 -0.185  0.040 
+     D   528   524 6   529     4     0     0   183   406  -4.738  -4.419  -2.435  -0.452                 
+    IL   529   529 5   529     4     1     1   188   411  -1.726  -2.409  -1.071  -4.895                  0.000  0.000  0.000  0.000 
+    IR   530   530 6   530     3     1     1   188   411  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   81 ]     98      - U - - -
+    ML   531   530 6   533     3     1     1   187   409  -9.111  -0.017  -6.685                         -1.722 -1.726 -2.468  1.684 
+     D   532   530 6   533     3     0     0   181   404  -6.540  -1.292  -0.784                         
+    IL   533   533 3   533     3     1     1   187   409  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   82 ]     99      - G - - -
+    ML   534   533 3   536     3     1     1   186   408  -9.119  -0.009  -7.773                         -1.212 -2.231  1.620 -1.831 
+     D   535   533 3   536     3     0     0   175   398  -6.410  -1.270  -0.802                         
+    IL   536   536 3   536     3     1     1   185   408  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   83 ]    100      - a - - -
+    ML   537   536 3   539     3     1     1   185   408  -1.827  -0.495  -6.831                          0.524  0.223 -0.814 -0.275 
+     D   538   536 3   539     3     0     0   148   370  -6.174  -1.687  -0.566                         
+    IL   539   539 3   539     3     1     1   199   422  -0.119  -3.694  -8.861                          0.000  0.000  0.000  0.000 
+                                             [ MATL   84 ]    132      - a - - -
+    ML   540   539 3   542     3     1     1    15    34  -9.125  -0.013  -7.059                          0.629 -1.245  0.550 -0.818 
+     D   541   539 3   542     3     0     0    16    34  -6.296  -1.513  -0.651                         
+    IL   542   542 3   542     3     1     1    20    38  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   85 ]    133      - A - - -
+    ML   543   542 3   545     3     1     1    14    32  -9.126  -0.009  -7.780                          1.741 -2.127 -2.071 -2.388 
+     D   544   542 3   545     3     0     0    14    33  -6.283  -1.717  -0.550                         
+    IL   545   545 3   545     3     1     1    19    37  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   86 ]    134      - a - - -
+    ML   546   545 3   548     3     1     1    12    31  -9.127  -0.009  -7.781                          0.977 -1.156 -0.748 -0.018 
+     D   547   545 3   548     3     0     0    13    32  -6.259  -1.772  -0.526                         
+    IL   548   548 3   548     3     1     1    18    36  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   87 ]    135      - U - - -
+    ML   549   548 3   551     2     1     1     1     1       *   0.000                                 -0.582 -1.266 -0.484  1.138 
+     D   550   548 3   551     2     0     0     0     0       *   0.000                                 
+    IL   551   551 3   551     2     1     1    13    28  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ END    88 ]      -      - - - - -
+     E   552   551 3    -1     0     0     0     0     0                                                 
+                                             [ BEGR   89 ]      -      - - - - -
+     S   553   499 1   554     3     0     0    25    43  -9.131  -0.009  -7.785                         
+    IL   554   554 2   554     3     1     1    29    48  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   90 ]    142      - G - - -
+    ML   555   554 2   557     3     1     1    25    43  -9.131  -0.009  -7.785                          0.717 -2.809  1.009 -2.323 
+     D   556   554 2   557     3     0     0    24    43  -6.174  -1.687  -0.566                         
+    IL   557   557 3   557     3     1     1    28    47  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   91 ]    143      - C - - -
+    ML   558   557 3   560     5     1     1    24    42  -8.155  -0.019  -7.970  -8.182  -9.074         -4.093  1.920 -4.749 -3.051 
+     D   559   557 3   560     5     0     0    23    41  -4.959  -0.803  -4.221  -2.596  -2.508         
+    IL   560   560 3   560     5     1     1    24    42  -2.408  -0.496  -4.087  -5.920  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   92 ]    144    155 u a - -
+    MP   561   560 3   565     6     2     2    23    41  -9.704  -9.643  -0.014  -8.420  -8.699  -9.094 -3.455 -3.281 -3.540  1.382 -2.981 -4.367  1.560 -3.489 -3.536  1.328 -4.057 -1.215  2.554 -3.684 -0.660 -2.102 
+    ML   562   560 3   565     6     1     1    22    40  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   563   560 3   565     6     1     1    22    40  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   564   560 3   565     6     0     0    20    38  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   565   565 5   565     6     1     1    23    41  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   566   566 6   566     5     1     1    22    41  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   93 ]    145    154 G C - -
+    MP   567   566 6   571     6     2     2    21    39  -9.704  -9.643  -0.014  -8.420  -8.699  -9.094 -5.320 -3.543 -5.310 -0.178 -6.205 -5.105 -1.278 -5.852 -5.008  3.730 -5.260 -1.157 -0.942 -4.463 -3.139 -4.249 
+    ML   568   566 6   571     6     1     1    21    39  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   569   566 6   571     6     1     1    20    39  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   570   566 6   571     6     0     0    19    37  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   571   571 5   571     6     1     1    21    39  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   572   572 6   572     5     1     1    20    39  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   94 ]    146    153 c g - -
+    MP   573   572 6   577     4     2     2    19    37  -8.175  -6.329  -0.577  -1.671                 -2.403 -2.561 -1.074  0.558 -2.361 -3.409  2.606 -2.791 -1.629  0.502 -2.179 -1.054  0.998 -2.722  1.191 -1.750 
+    ML   574   572 6   577     4     1     1    20    38  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR   575   572 6   577     4     1     1    20    38  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D   576   572 6   577     4     0     0    19    37  -4.568  -4.250  -2.265  -0.520                 
+    IL   577   577 5   577     4     1     1    21    40  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   578   578 6   578     3     1     1    20    38  -1.509  -0.750  -4.209                          0.000  0.000  0.000  0.000 
+                                             [ MATL   95 ]    147      - C - - -
+    ML   579   578 6   581     3     1     1    16    34  -8.626  -0.013  -7.281                         -2.291  1.737 -2.902 -1.608 
+     D   580   578 6   581     3     0     0    15    33  -9.008  -0.147  -3.399                         
+    IL   581   581 3   581     3     1     1    20    38  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   96 ]    148      - C - - -
+    ML   582   581 3   584     3     1     1    14    33  -7.602  -0.014  -7.785                         -3.611  1.894 -3.897 -2.900 
+     D   583   581 3   584     3     0     0    14    33  -6.174  -1.687  -0.566                         
+    IL   584   584 3   584     3     1     1    18    37  -1.467  -0.780  -4.167                          0.000  0.000  0.000  0.000 
+                                             [ MATL   97 ]    150      - C - - -
+    ML   585   584 3   587     3     1     1    12    31  -9.131  -0.009  -7.785                         -2.892  1.826 -3.164 -2.259 
+     D   586   584 3   587     3     0     0    13    32  -6.174  -1.687  -0.566                         
+    IL   587   587 3   587     3     1     1    18    36  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   98 ]    151      - C - - -
+    ML   588   587 3   590     2     1     1     1     1       *   0.000                                 -3.022  1.825 -3.061 -2.226 
+     D   589   587 3   590     2     0     0     0     0       *   0.000                                 
+    IL   590   590 3   590     2     1     1    13    28  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ END    99 ]      -      - - - - -
+     E   591   590 3    -1     0     0     0     0     0                                                 
+//
+HMMER3/f [i1.1rc1 | June 2012]
+NAME  Cobalamin
+ACC   RF00174
+DESC  Cobalamin riboswitch
+LENG  191
+MAXL  565
+ALPH  RNA
+RF    no
+MM    no
+CONS  yes
+CS    yes
+MAP   yes
+DATE  Wed Jun 13 05:40:08 2012
+COM   [1] ./cmbuild Cobalamin.cm ../tutorial/Cobalamin.sto
+NSEQ  431
+EFFN  4.955421
+CKSUM 2307274568
+STATS LOCAL MSV      -10.2356  0.71319
+STATS LOCAL VITERBI  -12.2484  0.71319
+STATS LOCAL FORWARD   -3.9056  0.71319
+HMM          A        C        G        U   
+            m->m     m->i     m->d     i->m     i->i     d->m     d->d
+  COMPO   1.37169  1.39466  1.27962  1.51293
+          1.38629  1.38629  1.38629  1.38629
+          0.02747  4.30141  4.30141  1.46634  0.26236  0.00000        *
+      1   1.24903  1.60847  1.61442  1.15831      1 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02747  4.30141  4.30141  1.46634  0.26236  1.09861  0.40547
+      2   1.28810  1.50313  1.67262  1.15831      2 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+      3   1.15107  1.40604  1.80386  1.29489      3 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+      4   1.17200  1.61837  1.56685  1.26114      4 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+      5   1.05945  1.63618  1.87848  1.18480      5 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+      6   1.26505  1.64168  1.48588  1.21129      6 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+      7   1.31715  1.47442  1.68272  1.14783      7 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+      8   1.32907  1.67506  1.29915  1.29020      8 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+      9   1.16103  1.70529  1.52242  1.24850      9 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     10   1.19074  1.42180  1.65009  1.33677     10 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     11   1.30224  1.39853  1.41443  1.43527     11 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     12   1.50100  1.28191  1.49114  1.29291     12 c - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     13   1.35762  1.47876  1.30931  1.40730     13 g - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     14   1.31290  1.49861  1.37774  1.36504     14 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     15   1.47301  1.35416  1.83542  1.04113     15 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     16   1.56669  1.49706  1.32024  1.20262     16 u - - [
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     17   1.32645  1.42500  1.63172  1.20905     17 u - - [
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     18   1.46904  1.39537  1.67427  1.09462     18 u - - [
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     19   1.78940  2.60005  0.40247  2.40788     19 G - - [
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     20   2.46303  3.25924  0.18850  3.03221     20 G - - [
+          1.38629  1.38629  1.38629  1.38629
+          0.02886  4.30301  4.20475  1.46634  0.26236  1.09861  0.40547
+     21   2.51359  1.65266  2.33680  0.46069     21 U - - [
+          1.38629  1.38629  1.38629  1.38629
+          0.43464  4.30161  1.08188  1.46634  0.26236  1.13245  0.38897
+     22   1.35810  2.00708  1.23173  1.14986     22 u - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.06064  3.46340  3.59302  1.07139  0.41936  0.07930  2.57386
+     23   1.84998  1.06106  1.64778  1.19009     25 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02913  4.29706  4.19284  1.46634  0.26236  1.23494  0.34369
+     24   2.14055  0.81160  1.82270  1.28491     26 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02764  4.29557  4.29557  1.46634  0.26236  1.26639  0.33107
+     25   1.74697  1.14831  1.50564  1.24949     27 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.03585  4.29557  3.83581  1.46634  0.26236  1.26639  0.33107
+     26   1.54986  1.20248  1.47840  1.34988     28 c - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02786  4.28758  4.28758  1.46634  0.26236  1.41869  0.27711
+     27   1.49431  1.35814  1.57714  1.16510     29 u - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.23264  4.28758  1.64082  1.46634  0.26236  1.41869  0.27711
+     28   1.36162  1.44145  1.56201  1.21249     30 u - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.11271  4.08903  2.40982  1.46634  0.26236  2.84723  0.05976
+     29   1.28483  1.59033  1.44657  1.25854     31 u - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.43884  1.08725  4.01314  2.03437  0.14014  1.03059  0.44129
+     30   1.25151  1.60951  1.42593  1.29589     54 a - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.03277  4.12758  4.12758  1.46634  0.26236  2.70096  0.06950
+     31   1.24432  1.59277  1.48738  1.26395     55 a - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.03277  4.12758  4.12758  1.46634  0.26236  2.70096  0.06950
+     32   1.28610  1.51456  1.40997  1.34862     56 a - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.04600  4.12758  3.54597  1.46634  0.26236  2.60916  0.07645
+     33   1.41087  1.82088  1.01927  1.45531     57 g - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.24914  4.11635  1.58852  1.46634  0.26236  2.74642  0.06631
+     34   1.32560  1.48659  1.50548  1.25070     58 u - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.11856  2.38894  3.90819  0.81808  0.58210  1.39558  0.28461
+     35   1.39712  1.51745  1.24496  1.40458     63 g - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.03669  4.01682  4.01682  1.46634  0.26236  2.01890  0.14249
+     36   1.13883  1.65204  1.33482  1.49191     64 a - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.03549  4.04945  4.04945  1.46634  0.26236  1.80326  0.18004
+     37   1.29835  1.57886  1.37963  1.31253     65 a - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.03507  4.08745  4.03532  1.46634  0.26236  0.14800  1.98361
+     38   1.50621  1.65719  0.96089  1.58462     66 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02759  4.29706  4.29706  1.46634  0.26236  1.23494  0.34369
+     39   1.44993  2.02331  0.73190  1.88256     67 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02759  4.29706  4.29706  1.46634  0.26236  1.23494  0.34369
+     40   1.35698  1.80609  0.94002  1.67318     68 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.10644  4.29706  2.43770  1.46634  0.26236  1.08710  0.41127
+     41   1.59433  1.61591  2.15457  0.72921     69 u - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02975  4.22279  4.22279  1.46634  0.26236  2.16315  0.12213
+     42   1.75563  1.78780  1.21150  1.01577     70 u - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.09873  2.54557  4.16175  0.93597  0.49792  0.50480  0.92539
+     43   0.18529  3.05983  2.68023  2.92449     77 A - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02969  4.28236  4.17052  1.46634  0.26236  1.36635  0.29442
+     44   0.14561  3.28917  3.04657  2.98177     78 A - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.03498  4.28280  3.88404  1.46634  0.26236  1.34629  0.30138
+     45   0.99239  1.98269  1.41716  1.38946     79 a - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02812  4.27831  4.27831  1.46634  0.26236  0.53850  0.87616
+     46   1.01112  1.61883  1.43287  1.61226     80 a - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.07775  2.79232  4.30301  0.43563  1.04088  1.09861  0.40547
+     47   2.75429  3.92257  0.11139  3.81845     83 G - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     48   2.40943  3.16848  0.19849  3.03444     84 G - - (
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     49   3.42596  4.48014  0.06350  4.03549     85 G - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     50   0.05799  4.17225  3.81999  3.96354     86 A - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     51   0.05799  4.17225  3.81999  3.96354     87 A - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.03866  3.75681  4.22919  0.91930  0.50883  1.09861  0.40547
+     52   1.98485  1.19479  1.38870  1.16979     89 u - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.15295  2.05346  4.30197  0.19920  1.71141  1.12383  0.39309
+     53   1.80953  0.98290  1.45828  1.47225     91 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02746  4.30197  4.30197  1.46634  0.26236  1.05001  0.43068
+     54   2.12473  0.78072  1.65792  1.46135     92 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.03041  4.10911  4.30301  1.24043  0.34145  1.09861  0.40547
+     55   2.27798  3.18927  0.20690  3.14186     94 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.03940  4.10561  3.80952  1.23672  0.34296  1.09861  0.40547
+     56   1.97289  2.52928  0.36130  2.47146     96 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.03518  4.13066  3.99042  1.27291  0.32852  1.22411  0.34817
+     57   2.39794  2.42314  2.91164  0.26649     98 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.03252  4.29044  4.00101  1.46634  0.26236  0.84185  0.56372
+     58   2.12246  2.83568  0.29870  2.52819     99 G - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02764  4.29529  4.29529  1.46634  0.26236  0.82203  0.57899
+     59   1.03873  1.27112  1.91741  1.52055    100 a - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.33219  1.32689  4.05405  2.83033  0.06081  1.09861  0.40547
+     60   0.96734  2.17495  1.05322  1.84845    132 a - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.03026  4.29918  4.12093  1.46634  0.26236  0.98453  0.46779
+     61   0.21364  2.76149  2.68069  2.80264    133 A - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02752  4.29960  4.29960  1.46634  0.26236  1.12436  0.39283
+     62   0.74560  2.10816  1.87250  1.38489    134 a - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02750  4.30036  4.30036  1.46634  0.26236  1.16162  0.37539
+     63   1.71454  2.15172  1.72721  0.64267    135 U - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.04216  4.30036  3.58554  1.46634  0.26236  0.98338  0.46848
+     64   2.71649  0.41386  2.35761  1.72511    136 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02858  4.28879  4.23684  1.46634  0.26236  0.87015  0.54281
+     65   3.36738  0.23292  3.03863  2.07621    137 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02758  4.29754  4.29754  1.46634  0.26236  0.88594  0.53158
+     66   1.69232  1.78272  0.69453  1.90771    138 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02849  4.30301  4.22919  1.46634  0.26236  1.09861  0.40547
+     67   1.67759  1.56646  0.87794  1.66732    139 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.03118  4.06533  4.30197  1.19599  0.36011  1.12383  0.39309
+     68   1.38783  1.50067  1.02718  1.77556    141 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02746  4.30197  4.30197  1.46634  0.26236  1.05001  0.43068
+     69   0.91704  3.02785  0.72974  2.66149    142 g - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     70   3.85775  0.07816  4.37197  3.18350    143 C - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     71   1.71082  1.54306  1.58455  0.91500    144 u - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     72   2.54863  3.25208  0.18737  2.91906    145 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     73   1.83593  0.98469  1.77869  1.21026    146 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.34599  4.30301  1.27671  1.46634  0.26236  1.09861  0.40547
+     74   2.65086  0.25011  3.13070  2.23485    147 C - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.03753  3.99454  3.99454  1.46634  0.26236  0.09257  2.42572
+     75   3.55139  0.10145  3.88052  3.05445    148 C - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.03054  4.10115  4.30301  1.23201  0.34489  1.09861  0.40547
+     76   3.09709  0.16005  3.41311  2.66237    150 C - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     77   3.15616  0.16050  3.35905  2.64617    151 C - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.03591  3.82825  4.30301  0.97688  0.47238  1.09861  0.40547
+     78   1.67375  2.02800  0.67613  1.75863    153 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     79   3.13040  0.21826  3.06048  2.24890    154 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     80   1.02773  1.71250  1.38934  1.54867    155 a - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     81   0.47482  2.84179  1.40971  2.58407    156 A - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     82   4.66963  0.05039  4.42310  3.58393    157 C - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     83   2.35508  1.60399  1.41086  0.77634    158 u - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     84   3.21686  4.14500  0.07529  4.09820    159 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     85   3.32178  3.06599  3.85044  0.10978    160 U - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     86   0.72178  2.49732  1.11300  2.27072    161 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     87   0.47223  2.52370  2.10602  1.74581    162 A - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.05701  3.17273  4.30301  0.60144  0.79412  1.09861  0.40547
+     88   1.64272  1.95345  0.68060  1.84231    165 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+     89   2.29700  0.79125  1.56793  1.43679    166 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.03007  4.12935  4.30301  1.26208  0.33277  1.09861  0.40547
+     90   1.62425  2.12686  0.59558  2.02127    168 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.04665  4.30301  3.44050  1.46634  0.26236  1.09861  0.40547
+     91   1.53385  1.98006  0.70846  1.87188    169 g - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.47052  1.03914  3.83680  0.80946  0.58896  0.68160  0.70483
+     92   1.16284  1.81195  1.25459  1.43181    180 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02770  4.29317  4.29317  1.46634  0.26236  0.93285  0.49994
+     93   1.18545  1.66626  1.18203  1.61554    181 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02753  4.29950  4.29950  1.46634  0.26236  1.05667  0.42711
+     94   0.93241  1.91902  1.21546  1.81355    182 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02748  4.30130  4.30130  1.46634  0.26236  1.02115  0.44657
+     95   1.28651  1.48782  1.29968  1.49040    183 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03142  4.30301  4.05109  1.46634  0.26236  1.09861  0.40547
+     96   1.43733  1.26401  1.38804  1.46813    184 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02754  4.29912  4.29912  1.46634  0.26236  1.18982  0.36280
+     97   1.21299  1.39886  1.63233  1.34576    185 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03436  4.29912  3.90210  1.46634  0.26236  0.93790  0.49667
+     98   1.40965  1.43807  1.46404  1.24797    186 u - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02761  4.29639  4.29639  1.46634  0.26236  0.85213  0.55601
+     99   1.55994  1.33069  1.44048  1.24222    187 u - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    100   1.89287  1.01007  1.55168  1.29728    188 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02819  4.30301  4.24993  1.46634  0.26236  1.09861  0.40547
+    101   1.77387  1.24694  1.22697  1.38724    189 g - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.03325  4.30227  3.95444  1.46634  0.26236  1.11662  0.39658
+    102   1.77291  1.21736  1.49016  1.17502    190 u - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.03928  4.29662  3.69258  1.46634  0.26236  1.24430  0.33988
+    103   1.73193  1.07778  1.61973  1.25612    191 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.03285  4.28527  3.98767  1.46634  0.26236  1.45861  0.26469
+    104   0.70716  1.77667  1.94796  1.63378    192 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02985  4.28048  4.16221  1.46634  0.26236  1.53614  0.24234
+    105   1.11080  1.56555  1.59636  1.35055    193 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03293  4.27874  3.98822  1.46634  0.26236  1.00202  0.45750
+    106   1.27579  1.37483  1.78268  1.20491    194 u - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.06832  4.28448  2.95165  1.46634  0.26236  0.98474  0.46766
+    107   0.73169  1.92893  1.80573  1.56422    195 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.22641  4.25420  1.66914  1.46634  0.26236  1.87509  0.16646
+    108   1.16046  1.65815  1.66644  1.18010    196 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.41154  1.16203  3.70838  2.03591  0.13991  0.52992  0.88832
+    109   1.61650  2.21820  0.57490  2.04142    225 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.04107  4.21611  3.66991  1.46634  0.26236  0.24656  1.52089
+    110   2.25402  0.72012  1.68521  1.50093    226 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02770  4.29313  4.29313  1.46634  0.26236  1.31552  0.31243
+    111   4.23605  0.06956  4.23057  3.26516    227 C - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02770  4.29313  4.29313  1.46634  0.26236  1.31552  0.31243
+    112   0.05908  4.15412  3.80293  3.94426    228 A - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02852  4.29313  4.23698  1.46634  0.26236  0.76932  0.62237
+    113   3.82674  0.15572  3.67076  2.33344    229 C - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02745  4.30223  4.30223  1.46634  0.26236  1.11768  0.39607
+    114   3.19380  1.80053  2.78276  0.31210    230 U - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02874  4.30223  4.21388  1.46634  0.26236  1.11768  0.39607
+    115   1.98207  2.49547  0.36412  2.46572    231 G - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.02748  4.30097  4.30097  1.46634  0.26236  1.14744  0.38192
+    116   1.70509  1.92458  0.72241  1.67811    232 g - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.04557  4.30097  3.47408  1.46634  0.26236  1.00757  0.45429
+    117   1.66942  1.29492  1.33808  1.28962    233 u - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.09836  4.28545  2.52687  1.46634  0.26236  1.45540  0.26567
+    118   1.58062  1.16732  1.55528  1.30261    234 c - - <
+          1.38629  1.38629  1.38629  1.38629
+          0.28654  4.21702  1.45072  1.46634  0.26236  2.14038  0.12512
+    119   1.33853  1.38808  1.47844  1.34621    235 a - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.03847  3.97031  3.97031  1.46634  0.26236  0.52815  0.89086
+    120   1.42747  1.72121  1.13357  1.34957    236 g - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.03072  4.19127  4.19127  1.46634  0.26236  0.49884  0.93455
+    121   1.40107  1.21924  1.77184  1.24413    237 c - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02830  4.27213  4.27213  1.46634  0.26236  1.65779  0.21141
+    122   0.96679  1.58100  1.85815  1.35491    238 a - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.02830  4.27213  4.27213  1.46634  0.26236  0.91406  0.51232
+    123   1.11167  1.39406  1.79584  1.35893    239 a - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.88674  1.13571  1.32121  2.73074  0.06739  0.93930  0.49577
+    124   1.41921  1.40317  1.30448  1.42309    298 g - - _
+          1.38629  1.38629  1.38629  1.38629
+          0.06536  4.00696  3.09934  1.46634  0.26236  0.36472  1.18544
+    125   1.51135  1.70103  1.01611  1.44863    299 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02997  4.21564  4.21564  1.46634  0.26236  0.45890  0.99962
+    126   1.46144  1.47285  1.16177  1.48769    300 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.03310  4.01861  4.22801  1.16690  0.37299  0.65015  0.73808
+    127   1.94880  0.80894  1.68656  1.48250    302 c - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02908  4.30096  4.19266  1.46634  0.26236  1.05826  0.42627
+    128   2.72600  0.66760  2.35358  1.11917    303 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02749  4.30068  4.30068  1.46634  0.26236  1.04611  0.43279
+    129   2.29258  3.17240  0.22742  2.80505    304 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02745  4.30223  4.30223  1.46634  0.26236  1.11768  0.39607
+    130   2.57119  3.83935  0.13376  3.60280    305 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02745  4.30223  4.30223  1.46634  0.26236  1.06153  0.42453
+    131   3.31630  4.35512  0.07285  3.85691    306 G - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    132   0.06799  4.02102  3.72609  3.74207    307 A - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    133   0.12440  3.37600  3.22292  3.14761    308 A - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03758  4.30301  3.75681  1.46634  0.26236  1.09861  0.40547
+    134   3.47514  4.38163  0.06100  4.15326    309 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02770  4.29313  4.29313  1.46634  0.26236  1.31552  0.31243
+    135   1.74136  1.80652  0.63371  2.04118    310 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.14056  4.29313  2.14162  1.46634  0.26236  0.76932  0.62237
+    136   2.25350  0.67361  1.96722  1.40544    311 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.19943  1.88515  3.54059  0.36964  1.17436  0.20914  1.66750
+    137   1.45303  1.79575  0.94189  1.55948    315 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02778  4.29044  4.29044  1.46634  0.26236  0.82159  0.57934
+    138   1.33711  1.62108  1.07658  1.61469    316 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02750  4.30033  4.30033  1.46634  0.26236  1.02843  0.44250
+    139   1.59573  1.32387  1.11122  1.59959    317 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.03300  3.96710  4.30227  1.20083  0.35803  1.06354  0.42347
+    140   1.48415  1.73740  0.90035  1.65601    320 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.04274  4.10749  3.67348  1.23871  0.34215  1.09861  0.40547
+    141   1.44435  1.61858  1.15286  1.38554    322 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02776  4.29108  4.29108  1.46634  0.26236  1.12814  0.39102
+    142   1.40571  1.55095  1.17735  1.44959    323 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.04238  3.61931  4.22032  0.91514  0.51159  0.80334  0.59390
+    143   1.20106  1.55628  1.31423  1.51629    326 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02746  4.30196  4.30196  1.46634  0.26236  1.04974  0.43083
+    144   1.05221  1.78861  1.40931  1.42991    327 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    145   1.49934  1.45993  1.09172  1.56623    328 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    146   1.47915  1.38803  1.35751  1.32689    329 u - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03756  4.30301  3.75783  1.46634  0.26236  1.09861  0.40547
+    147   1.00379  1.98481  1.21493  1.61257    330 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.05421  4.29315  3.24141  1.46634  0.26236  1.31505  0.31261
+    148   1.11639  1.86426  1.36646  1.33743    331 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.04171  4.26738  3.61797  1.46634  0.26236  1.72054  0.19719
+    149   1.42431  1.62657  1.31546  1.22291    332 u - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03085  4.25447  4.12398  1.46634  0.26236  1.87211  0.16700
+    150   1.14948  2.03156  1.05479  1.59060    333 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.04257  4.25249  3.59543  1.46634  0.26236  1.89332  0.16319
+    151   0.82935  1.87300  1.59969  1.56999    334 a - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.21304  4.23918  1.72904  1.46634  0.26236  2.02426  0.14167
+    152   1.56867  0.97776  1.99356  1.27541    335 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.45592  1.08792  3.53302  3.16434  0.04316  0.15270  1.95466
+    153   2.05045  0.80580  1.79099  1.35557    402 c - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02941  4.28431  4.18658  1.46634  0.26236  0.61205  0.78141
+    154   2.24494  0.66984  1.98301  1.40804    403 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02747  4.30162  4.30162  1.46634  0.26236  1.03453  0.43912
+    155   1.63401  1.66923  0.71089  2.07741    404 g - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    156   2.15756  0.80085  1.81542  1.29947    405 c - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.03766  3.75365  4.30301  0.91683  0.51047  1.09861  0.40547
+    157   1.14333  2.30801  0.75936  2.17315    407 g - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    158   0.10661  3.45503  3.29926  3.42253    408 A - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    159   3.59485  4.56947  0.05577  4.10934    409 G - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    160   2.45255  0.78219  3.06353  0.89208    410 c - - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    161   4.24403  0.09177  4.00893  2.89719    411 C - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    162   0.85847  1.51397  1.45667  2.09441    412 a - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    163   3.82888  4.69993  0.04299  4.48772    413 G - - >
+          1.38629  1.38629  1.38629  1.38629
+          0.03758  4.30301  3.75681  1.46634  0.26236  1.09861  0.40547
+    164   1.36130  3.02690  0.47678  2.59789    414 G - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02770  4.29313  4.29313  1.46634  0.26236  1.31552  0.31243
+    165   0.07478  3.97737  3.48635  3.78518    415 A - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02770  4.29313  4.29313  1.46634  0.26236  1.31552  0.31243
+    166   2.07870  3.00820  0.28215  2.63992    416 G - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02770  4.29313  4.29313  1.46634  0.26236  1.31552  0.31243
+    167   0.07110  4.01580  3.54964  3.82272    417 A - - ,
+          1.38629  1.38629  1.38629  1.38629
+          0.02770  4.29313  4.29313  1.46634  0.26236  0.76932  0.62237
+    168   3.22566  0.23966  2.88893  2.13928    418 C - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    169   3.99717  0.12957  3.78951  2.51888    419 C - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.03710  4.30301  3.77709  1.46634  0.26236  1.09861  0.40547
+    170   1.83247  1.54414  1.46722  0.92654    420 u - - )
+          1.38629  1.38629  1.38629  1.38629
+          0.02769  4.29360  4.29360  1.46634  0.26236  0.78025  0.61303
+    171   1.92483  2.45259  0.39512  2.35988    421 G - - ]
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    172   3.31990  0.21477  3.08295  2.19556    422 C - - ]
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    173   2.71639  0.42788  2.38356  1.66192    423 C - - ]
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    174   1.25076  1.81371  1.23869  1.34361    424 g - - ]
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    175   1.54434  1.70196  1.17488  1.21954    425 g - - ]
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    176   1.40798  1.46982  1.27683  1.40050    426 g - - ]
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    177   1.18394  1.69593  1.51954  1.23206    427 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    178   1.27564  1.49766  1.31220  1.47900    428 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    179   1.31428  1.47326  1.53565  1.24883    429 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    180   1.38664  1.52439  1.37112  1.27829    430 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    181   1.35245  1.43180  1.49281  1.28095    431 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    182   1.29898  1.51481  1.69904  1.12553    432 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    183   1.25000  1.66010  1.46572  1.22942    433 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    184   1.28242  1.69982  1.29083  1.32849    434 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    185   1.17156  1.68621  1.44410  1.31327    435 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    186   1.22009  1.28821  1.81175  1.32553    436 a - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    187   1.30308  1.39524  1.62633  1.25919    437 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    188   1.34275  1.28056  1.58864  1.35950    438 c - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    189   1.31677  1.65824  1.41232  1.21084    439 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    190   1.43270  1.22474  1.77469  1.21077    440 u - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.02743  4.30301  4.30301  1.46634  0.26236  1.09861  0.40547
+    191   1.51542  1.17791  1.56046  1.33817    441 c - - :
+          1.38629  1.38629  1.38629  1.38629
+          0.01381  4.28939        *  1.46634  0.26236  0.00000        *
+//
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cmsearch_input1.cm	Sat Jan 21 17:36:57 2017 -0500
@@ -0,0 +1,563 @@
+INFERNAL1/a [1.1.1 | July 2014]
+NAME     tRNA5
+STATES   230
+NODES    61
+CLEN     72
+W        89
+ALPH     RNA
+RF       no
+CONS     yes
+MAP      yes
+DATE     Mon Jun 27 12:35:45 2016
+COM      [1] ./src/cmbuild tRNA5.cm tutorial/tRNA5.sto
+COM      [2] cmcalibrate tRNA5.cm
+PBEGIN   0.05
+PEND     0.05
+WBETA    1e-07
+QDBBETA1 1e-07
+QDBBETA2 1e-15
+N2OMEGA  1.52588e-05
+N3OMEGA  1.52588e-05
+ELSELF   -0.08926734
+NSEQ     5
+EFFN     3.725586
+CKSUM    3535941971
+NULL     0.000  0.000  0.000  0.000 
+EFP7GF   -5.5288 0.72958
+ECMLC    0.85563    -4.01853     2.43520     1600000      300168  0.003998
+ECMGC    0.39437   -17.41037    -4.06685     1600000       77168  0.005183
+ECMLI    0.73047    -3.70982     3.57712     1600000      245977  0.004879
+ECMGI    0.44078   -12.13534    -0.86006     1600000       57603  0.006944
+CM
+                                             [ ROOT    0 ]      -      - - - - -
+     S     0    -1 0     1     4     0     1    89   108  -7.419  -8.664  -0.055  -5.118                 
+    IL     1     1 2     1     4     3    28    90   110  -2.817  -4.319  -0.613  -2.698                  0.000  0.000  0.000  0.000 
+    IR     2     2 3     2     3     4    30    90   110  -1.925  -0.554  -4.164                          0.000  0.000  0.000  0.000 
+                                             [ MATR    1 ]      -     74 - a - -
+    MR     3     2 3     5     5     4    32    89   108  -7.593  -0.028  -7.408  -7.620  -8.512          0.474 -1.199  0.305 -0.089 
+     D     4     2 3     5     5     1    24    87   107  -5.352  -0.707  -2.978  -4.409  -2.404         
+    IR     5     5 3     5     5     3    28    89   109  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    2 ]      1     73 g c - -
+    MP     6     5 3    10     6     5    32    88   107  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.831 -2.997 -3.795  0.617 -3.618 -4.452  0.854 -3.918 -3.870  2.837 -4.276 -0.713  1.871 -3.843 -1.175 -2.703 
+    ML     7     5 3    10     6     3    26    86   106  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR     8     5 3    10     6     3    25    86   106  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D     9     5 3    10     6     0    21    84   103  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    10    10 5    10     6     3    27    87   107  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    11    11 6    11     5     3    27    87   107  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    3 ]      2     72 C G - -
+    MP    12    11 6    16     6     5    31    86   105  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -4.097 -3.805 -3.998  0.021 -3.009 -4.646  3.103 -3.661 -3.977  1.529 -4.392 -1.585  0.835 -4.247 -0.625 -2.808 
+    ML    13    11 6    16     6     2    25    84   104  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    14    11 6    16     6     2    25    84   104  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    15    11 6    16     6     0    21    82   101  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    16    16 5    16     6     3    27    85   105  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    17    17 6    17     5     3    27    85   105  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    4 ]      3     71 c g - -
+    MP    18    17 6    22     6     5    29    84   103  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.141 -2.880 -3.222  0.733 -2.762 -4.023  2.237 -3.232 -3.242  1.678 -3.747  0.537  1.616 -3.340 -0.447 -2.158 
+    ML    19    17 6    22     6     2    25    82   102  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    20    17 6    22     6     2    24    82   102  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    21    17 6    22     6     0    20    80    99  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    22    22 5    22     6     3    26    83   103  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    23    23 6    23     5     3    26    83   103  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    5 ]      4     70 g c - -
+    MP    24    23 6    28     6     5    28    82   101  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.477 -2.737 -3.484  0.861 -3.437 -4.224  1.956 -3.685 -3.594  2.509 -4.028  0.683  0.624 -3.528 -1.017 -2.419 
+    ML    25    23 6    28     6     2    24    80   100  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    26    23 6    28     6     2    24    80   100  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    27    23 6    28     6     0    20    78    97  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    28    28 5    28     6     3    25    81   101  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    29    29 6    29     5     3    25    81   101  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    6 ]      5     69 g c - -
+    MP    30    29 6    34     6     5    26    80    99  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -2.565  0.048 -2.684  1.825 -2.755 -3.485  0.996 -3.019 -2.788  2.050 -3.293 -0.374  0.757 -2.774  0.549 -1.819 
+    ML    31    29 6    34     6     2    23    78    98  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    32    29 6    34     6     2    23    78    98  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    33    29 6    34     6     0    19    76    96  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    34    34 5    34     6     2    24    79    99  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    35    35 6    35     5     3    24    79    99  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    7 ]      6     68 c g - -
+    MP    36    35 6    40     6     5    24    78    97  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.250 -3.161 -3.321  0.517 -2.657 -4.117  2.088 -3.215 -3.310  1.474 -3.823 -1.143  2.088 -3.483  0.783 -2.234 
+    ML    37    35 6    40     6     2    22    77    97  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    38    35 6    40     6     2    21    77    96  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    39    35 6    40     6     0    19    75    95  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    40    40 5    40     6     2    23    77    97  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    41    41 6    41     5     2    23    77    97  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP    8 ]      7     67 A U - -
+    MP    42    41 6    46     4     4    22    76    95  -7.543  -7.750  -0.035  -6.164                 -3.769 -3.134 -3.802  3.011 -3.544 -4.775  0.728 -3.793 -3.752  0.821 -4.250 -0.784  1.443 -4.133 -1.238 -2.690 
+    ML    43    41 6    46     4     1    21    76    96  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR    44    41 6    46     4     1    20    76    96  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D    45    41 6    46     4     0    19    74    94  -4.568  -4.250  -2.265  -0.520                 
+    IL    46    46 5    46     4     2    22    77    97  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR    47    47 6    47     3     2    21    76    96  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL    9 ]      8      - U - - -
+    ML    48    47 6    50     3     2    20    73    93  -8.524  -0.014  -7.178                         -2.549 -2.369 -3.320  1.822 
+     D    49    47 6    50     3     0    18    72    92  -6.174  -1.687  -0.566                         
+    IL    50    50 3    50     3     2    20    75    95  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   10 ]      9      - A - - -
+    ML    51    50 3    53     2     1    19    72    92  -9.006  -0.003                                  1.048 -1.964  0.381 -1.421 
+     D    52    50 3    53     2     0    18    71    91  -8.445  -0.004                                 
+    IL    53    53 3    53     2     1    19    73    93  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ BIF    11 ]      -      - - - - -
+     B    54    53 3   124    55     0    18    71    91                                                 
+                                             [ BEGR   42 ]      -      - - - - -
+     S    55    54 1    56     3     0     0    36    55  -8.524  -0.014  -7.178                         
+    IL    56    56 2    56     3     1     1    39    59  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   43 ]     45      - A - - -
+    ML    57    56 2    59     3     1     1    36    55  -8.524  -0.014  -7.178                          1.385 -1.618 -1.684 -0.412 
+     D    58    56 2    59     3     0     0    35    54  -6.174  -1.687  -0.566                         
+    IL    59    59 3    59     3     1     1    38    57  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   44 ]     46      - G - - -
+    ML    60    59 3    62     3     1     1    35    54  -8.524  -0.014  -7.178                         -2.700 -4.060  1.885 -3.430 
+     D    61    59 3    62     3     0     0    34    53  -6.174  -1.687  -0.566                         
+    IL    62    62 3    62     3     1     1    37    56  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   45 ]     47      - g - - -
+    ML    63    62 3    65     3     1     1    34    52  -8.524  -0.481  -1.832                          0.586 -2.024  0.919 -1.466 
+     D    64    62 3    65     3     0     0    33    52  -6.174  -1.687  -0.566                         
+    IL    65    65 3    65     3     1     1    36    55  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   46 ]     48      - U - - -
+    ML    66    65 3    68     3     1     1    33    51  -8.062  -0.019  -6.716                         -1.668 -1.633 -2.411  1.667 
+     D    67    65 3    68     3     0     0    31    50  -8.417  -0.227  -2.808                         
+    IL    68    68 3    68     3     1     1    35    54  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   47 ]     49      - C - - -
+    ML    69    68 3    71     5     1     1    31    50  -7.593  -0.028  -7.408  -7.620  -8.512         -1.578  1.336 -2.466 -0.059 
+     D    70    68 3    71     5     0     0    30    49  -4.959  -0.803  -4.221  -2.596  -2.508         
+    IL    71    71 3    71     5     1     1    32    51  -2.408  -0.496  -4.087  -5.920  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   48 ]     50     66 C G - -
+    MP    72    71 3    76     6     2     2    30    49  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -4.063 -3.835 -3.975  1.367 -2.984 -4.641  3.137 -3.636 -3.945  0.196 -4.368 -1.641  0.814 -4.253 -0.622 -2.801 
+    ML    73    71 3    76     6     1     1    29    48  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    74    71 3    76     6     1     1    29    48  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    75    71 3    76     6     0     0    27    45  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    76    76 5    76     6     1     1    30    49  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    77    77 6    77     5     1     1    30    49  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   49 ]     51     65 g c - -
+    MP    78    77 6    82     6     2     2    28    47  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.269 -3.002 -3.316  0.607 -2.825 -4.080  1.486 -3.318 -3.360  2.123 -3.845 -0.940  1.986 -3.442  0.799 -2.268 
+    ML    79    77 6    82     6     1     1    27    46  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    80    77 6    82     6     1     1    27    46  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    81    77 6    82     6     0     0    25    44  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    82    82 5    82     6     1     1    28    47  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    83    83 6    83     5     1     1    28    47  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   50 ]     52     64 g c - -
+    MP    84    83 6    88     6     2     2    26    45  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.573 -3.001 -3.543  0.634 -3.168 -4.231  1.794 -3.603 -3.657  2.626 -4.078 -0.813  0.766 -3.618  0.675 -2.477 
+    ML    85    83 6    88     6     1     1    25    44  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    86    83 6    88     6     1     1    25    44  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    87    83 6    88     6     0     0    23    42  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    88    88 5    88     6     1     1    26    45  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    89    89 6    89     5     1     1    26    45  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   51 ]     53     63 g c - -
+    MP    90    89 6    94     6     2     2    24    43  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.680 -2.656 -3.624  1.495 -4.000 -4.305  0.538 -4.011 -3.825  2.937 -4.200 -0.344  1.037 -3.597 -1.457 -2.574 
+    ML    91    89 6    94     6     1     1    24    43  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR    92    89 6    94     6     1     1    24    43  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D    93    89 6    94     6     0     0    22    41  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL    94    94 5    94     6     1     1    24    43  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR    95    95 6    95     5     1     1    24    43  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   52 ]     54     62 G C - -
+    MP    96    95 6   100     4     2     2    22    41  -7.543  -7.750  -0.035  -6.164                 -5.814 -3.622 -6.104 -0.561 -6.715 -5.090 -1.814 -6.360 -4.961  3.816 -5.237 -1.382 -2.178 -5.150 -3.925 -4.967 
+    ML    97    95 6   100     4     1     1    24    43  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR    98    95 6   100     4     1     1    23    42  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D    99    95 6   100     4     0     0    22    41  -4.568  -4.250  -2.265  -0.520                 
+    IL   100   100 5   100     4     1     1    25    44  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   101   101 6   101     3     1     1    24    43  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   53 ]     55      - U - - -
+    ML   102   101 6   104     3     1     1    20    38  -8.524  -0.014  -7.178                         -2.549 -2.369 -3.320  1.822 
+     D   103   101 6   104     3     0     0    19    38  -6.174  -1.687  -0.566                         
+    IL   104   104 3   104     3     1     1    23    42  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   54 ]     56      - U - - -
+    ML   105   104 3   107     3     1     1    18    37  -8.524  -0.014  -7.178                         -2.549 -2.369 -3.320  1.822 
+     D   106   104 3   107     3     0     0    18    37  -6.174  -1.687  -0.566                         
+    IL   107   107 3   107     3     1     1    22    41  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   55 ]     57      - C - - -
+    ML   108   107 3   110     3     1     1    17    36  -8.524  -0.014  -7.178                         -3.081  1.849 -3.880 -2.250 
+     D   109   107 3   110     3     0     0    17    35  -6.174  -1.687  -0.566                         
+    IL   110   110 3   110     3     1     1    21    39  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   56 ]     58      - G - - -
+    ML   111   110 3   113     3     1     1    16    34  -8.524  -0.014  -7.178                         -0.198 -2.380  1.409 -1.835 
+     D   112   110 3   113     3     0     0    16    34  -6.174  -1.687  -0.566                         
+    IL   113   113 3   113     3     1     1    20    38  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   57 ]     59      - A - - -
+    ML   114   113 3   116     3     1     1    14    33  -8.524  -0.014  -7.178                          1.878 -3.490 -3.019 -3.147 
+     D   115   113 3   116     3     0     0    15    33  -6.174  -1.687  -0.566                         
+    IL   116   116 3   116     3     1     1    19    37  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   58 ]     60      - U - - -
+    ML   117   116 3   119     3     1     1    13    31  -8.524  -0.014  -7.178                         -1.468 -0.407 -2.235  1.418 
+     D   118   116 3   119     3     0     0    13    32  -6.174  -1.687  -0.566                         
+    IL   119   119 3   119     3     1     1    18    36  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   59 ]     61      - U - - -
+    ML   120   119 3   122     2     1     1     1     1       *   0.000                                 -1.239  0.314 -2.046  1.064 
+     D   121   119 3   122     2     0     0     0     0       *   0.000                                 
+    IL   122   122 3   122     2     1     1    13    28  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ END    60 ]      -      - - - - -
+     E   123   122 3    -1     0     0     0     0     0                                                 
+                                             [ BEGL   12 ]      -      - - - - -
+     S   124    54 1   125     1     0     3    49    68   0.000                                         
+                                             [ BIF    13 ]      -      - - - - -
+     B   125   124 1   126   173     0     3    49    68                                                 
+                                             [ BEGL   14 ]      -      - - - - -
+     S   126   125 1   127     4     0     0    30    48  -0.035  -7.164  -6.572  -7.212                 
+                                             [ MATP   15 ]     10     26 G C - -
+    MP   127   126 1   131     6     2     2    30    48  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -4.768 -3.151 -4.805  0.251 -5.796 -4.949 -0.981 -5.231 -4.514  3.516 -4.857  0.895 -1.246 -4.551 -3.005 -3.683 
+    ML   128   126 1   131     6     1     1    28    47  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   129   126 1   131     6     1     1    28    47  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   130   126 1   131     6     0     0    26    45  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   131   131 5   131     6     1     1    29    48  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   132   132 6   132     5     1     1    29    48  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   16 ]     11     25 c g - -
+    MP   133   132 6   137     6     2     2    28    46  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -4.380 -4.331 -4.172 -0.461 -2.935 -4.679  2.953 -3.697 -4.172 -0.278 -4.524 -2.247  2.367 -4.479 -0.580 -2.998 
+    ML   134   132 6   137     6     1     1    27    45  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   135   132 6   137     6     1     1    26    45  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   136   132 6   137     6     0     0    24    43  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   137   137 5   137     6     1     1    27    46  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   138   138 6   138     5     1     1    27    46  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   17 ]     12     24 g c - -
+    MP   139   138 6   143     6     2     2    26    44  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.838 -2.993 -3.801  0.619 -3.635 -4.454  0.839 -3.930 -3.877  2.852 -4.281 -0.708  1.851 -3.845 -1.190 -2.710 
+    ML   140   138 6   143     6     1     1    25    44  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   141   138 6   143     6     1     1    25    44  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   142   138 6   143     6     0     0    24    42  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   143   143 5   143     6     1     1    26    44  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   144   144 6   144     5     1     1    25    44  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   18 ]     13     23 c g - -
+    MP   145   144 6   149     4     2     2    24    42  -7.543  -7.750  -0.035  -6.164                 -3.454 -3.490 -3.467  0.042 -2.692 -4.152  2.807 -3.318 -3.483  0.166 -3.945 -1.653  0.946 -3.679  1.162  0.637 
+    ML   146   144 6   149     4     1     1    25    44  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR   147   144 6   149     4     1     1    24    43  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D   148   144 6   149     4     0     0    23    42  -4.568  -4.250  -2.265  -0.520                 
+    IL   149   149 5   149     4     1     1    26    45  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   150   150 6   150     3     1     1    25    44  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   19 ]     14      - A - - -
+    ML   151   150 6   153     3     1     1    20    39  -8.524  -0.014  -7.178                          1.878 -3.490 -3.019 -3.147 
+     D   152   150 6   153     3     0     0    20    39  -6.174  -1.687  -0.566                         
+    IL   153   153 3   153     3     1     1    24    43  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   20 ]     15      - g - - -
+    ML   154   153 3   156     3     1     1    19    38  -8.524  -0.014  -7.178                          0.586 -2.024  0.919 -1.466 
+     D   155   153 3   156     3     0     0    19    37  -6.174  -1.687  -0.566                         
+    IL   156   156 3   156     3     1     1    23    42  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   21 ]     16      - U - - -
+    ML   157   156 3   159     3     1     1    18    36  -1.899  -0.464  -7.178                         -1.468 -0.407 -2.235  1.418 
+     D   158   156 3   159     3     0     0    16    35  -6.174  -1.687  -0.566                         
+    IL   159   159 3   159     3     1     1    18    36  -2.374  -0.363  -5.074                          0.000  0.000  0.000  0.000 
+                                             [ MATL   22 ]     18      - G - - -
+    ML   160   159 3   162     3     1     1    16    34  -8.524  -0.014  -7.178                         -2.700 -4.060  1.885 -3.430 
+     D   161   159 3   162     3     0     0    16    35  -6.174  -1.687  -0.566                         
+    IL   162   162 3   162     3     1     1    20    39  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   23 ]     19      - G - - -
+    ML   163   162 3   165     3     1     1    14    33  -8.524  -0.014  -7.178                         -2.700 -4.060  1.885 -3.430 
+     D   164   162 3   165     3     0     0    15    33  -6.174  -1.687  -0.566                         
+    IL   165   165 3   165     3     1     1    19    38  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   24 ]     20      - u - - -
+    ML   166   165 3   168     3     1     1    11    23  -1.854  -0.481  -7.178                         -0.664 -0.325 -0.613  0.939 
+     D   167   165 3   168     3     0     0     9    20  -6.174  -1.687  -0.566                         
+    IL   168   168 3   168     3     1     1    11    22  -2.396  -0.357  -5.096                          0.000  0.000  0.000  0.000 
+                                             [ MATL   25 ]     22      - A - - -
+    ML   169   168 3   171     2     1     1     1     1       *   0.000                                  1.878 -3.490 -3.019 -3.147 
+     D   170   168 3   171     2     0     0     0     0       *   0.000                                 
+    IL   171   171 3   171     2     1     1    13    28  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ END    26 ]      -      - - - - -
+     E   172   171 3    -1     0     0     0     0     0                                                 
+                                             [ BEGR   27 ]      -      - - - - -
+     S   173   125 1   174     3     0     0    32    50  -8.524  -0.014  -7.178                         
+    IL   174   174 2   174     3     1     1    35    54  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   28 ]     27      - g - - -
+    ML   175   174 2   177     5     1     1    31    50  -7.593  -0.028  -7.408  -7.620  -8.512          0.512 -2.047  0.983 -1.490 
+     D   176   174 2   177     5     0     0    30    49  -4.959  -0.803  -4.221  -2.596  -2.508         
+    IL   177   177 3   177     5     1     1    32    51  -2.408  -0.496  -4.087  -5.920  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   29 ]     28     44 c g - -
+    MP   178   177 3   182     6     2     2    30    49  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -2.996 -2.785 -3.094  0.747 -2.684 -3.890  2.204 -3.144 -3.118  1.704 -3.626  0.455  1.175 -3.212  0.643 -2.072 
+    ML   179   177 3   182     6     1     1    29    48  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   180   177 3   182     6     1     1    29    48  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   181   177 3   182     6     0     0    27    45  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   182   182 5   182     6     1     1    30    49  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   183   183 6   183     5     1     1    30    49  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   30 ]     29     43 c g - -
+    MP   184   183 6   188     6     2     2    28    47  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.660 -3.462 -3.663  0.355 -2.818 -4.407  2.681 -3.427 -3.639  1.512 -4.115 -1.306  1.763 -3.844 -0.432 -2.489 
+    ML   185   183 6   188     6     1     1    27    46  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   186   183 6   188     6     1     1    27    46  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   187   183 6   188     6     0     0    25    44  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   188   188 5   188     6     1     1    28    47  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   189   189 6   189     5     1     1    28    47  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   31 ]     30     42 a u - -
+    MP   190   189 6   194     6     2     2    26    45  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.311 -3.146 -3.360  2.221 -2.772 -4.127  2.025 -3.303 -3.378  0.846 -3.868 -1.127  1.693 -3.528 -0.491 -2.313 
+    ML   191   189 6   194     6     1     1    25    44  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   192   189 6   194     6     1     1    25    44  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   193   189 6   194     6     0     0    23    42  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   194   194 5   194     6     1     1    26    45  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   195   195 6   195     5     1     1    26    45  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   32 ]     31     41 g c - -
+    MP   196   195 6   200     6     2     2    24    43  -9.364  -9.303  -0.018  -8.080  -8.360  -8.755 -3.453 -2.737 -3.468  0.855 -3.398 -4.215  1.983 -3.656 -3.568  2.448 -4.006  0.791  0.648 -3.520 -0.989 -2.403 
+    ML   197   195 6   200     6     1     1    24    43  -6.250  -6.596  -1.310  -1.005  -6.446  -3.975  0.368 -0.385 -0.191  0.094 
+    MR   198   195 6   200     6     1     1    24    43  -6.988  -5.717  -1.625  -5.695  -0.829  -3.908  0.368 -0.385 -0.191  0.094 
+     D   199   195 6   200     6     0     0    22    41  -9.049  -7.747  -3.544  -4.226  -4.244  -0.319 
+    IL   200   200 5   200     6     1     1    24    43  -2.579  -2.842  -0.760  -4.497  -5.274  -4.934  0.000  0.000  0.000  0.000 
+    IR   201   201 6   201     5     1     1    24    43  -2.408  -0.496  -5.920  -4.087  -5.193          0.000  0.000  0.000  0.000 
+                                             [ MATP   33 ]     32     40 c g - -
+    MP   202   201 6   206     4     2     2    22    41  -7.543  -7.750  -0.035  -6.164                 -3.332 -2.890 -3.380  1.837 -3.037 -4.188  2.208 -3.435 -3.424  1.867 -3.910 -0.719  0.913 -3.503 -0.696 -2.309 
+    ML   203   201 6   206     4     1     1    24    43  -3.758  -3.940  -0.507  -2.670                  0.368 -0.385 -0.191  0.094 
+    MR   204   201 6   206     4     1     1    23    42  -4.809  -3.838  -1.706  -0.766                  0.368 -0.385 -0.191  0.094 
+     D   205   201 6   206     4     0     0    22    41  -4.568  -4.250  -2.265  -0.520                 
+    IL   206   206 5   206     4     1     1    25    44  -1.686  -2.369  -1.117  -4.855                  0.000  0.000  0.000  0.000 
+    IR   207   207 6   207     3     1     1    24    43  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   34 ]     33      - c - - -
+    ML   208   207 6   210     3     1     1    20    38  -8.524  -0.014  -7.178                         -1.256  0.893 -2.113  0.579 
+     D   209   207 6   210     3     0     0    19    38  -6.174  -1.687  -0.566                         
+    IL   210   210 3   210     3     1     1    23    42  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   35 ]     34      - U - - -
+    ML   211   210 3   213     3     1     1    18    37  -8.524  -0.014  -7.178                         -2.549 -2.369 -3.320  1.822 
+     D   212   210 3   213     3     0     0    18    37  -6.174  -1.687  -0.566                         
+    IL   213   213 3   213     3     1     1    22    41  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   36 ]     35      - g - - -
+    ML   214   213 3   216     3     1     1    17    36  -8.524  -0.014  -7.178                         -0.763 -1.427  0.837  0.325 
+     D   215   213 3   216     3     0     0    17    35  -6.174  -1.687  -0.566                         
+    IL   216   216 3   216     3     1     1    21    39  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   37 ]     36      - u - - -
+    ML   217   216 3   219     3     1     1    16    34  -8.524  -0.014  -7.178                          0.037 -0.330 -0.381  0.496 
+     D   218   216 3   219     3     0     0    16    34  -6.174  -1.687  -0.566                         
+    IL   219   219 3   219     3     1     1    20    38  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   38 ]     37      - c - - -
+    ML   220   219 3   222     3     1     1    14    33  -8.524  -0.014  -7.178                          0.403  0.783 -1.648 -0.649 
+     D   221   219 3   222     3     0     0    15    33  -6.174  -1.687  -0.566                         
+    IL   222   222 3   222     3     1     1    19    37  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   39 ]     38      - A - - -
+    ML   223   222 3   225     3     1     1    13    31  -8.524  -0.014  -7.178                          1.037 -1.963  0.397 -1.419 
+     D   224   222 3   225     3     0     0    13    32  -6.174  -1.687  -0.566                         
+    IL   225   225 3   225     3     1     1    18    36  -1.442  -0.798  -4.142                          0.000  0.000  0.000  0.000 
+                                             [ MATL   40 ]     39      - a - - -
+    ML   226   225 3   228     2     1     1     1     1       *   0.000                                  0.957  0.166 -1.522 -0.764 
+     D   227   225 3   228     2     0     0     0     0       *   0.000                                 
+    IL   228   228 3   228     2     1     1    13    28  -1.823  -0.479                                  0.000  0.000  0.000  0.000 
+                                             [ END    41 ]      -      - - - - -
+     E   229   228 3    -1     0     0     0     0     0                                                 
+//
+HMMER3/f [i1.1.1 | July 2014]
+NAME  tRNA5
+LENG  72
+MAXL  152
+ALPH  RNA
+RF    no