Mercurial > repos > bgruening > infernal
changeset 5:6e18e0b098cd draft
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
| author | bgruening |
|---|---|
| date | Sat, 21 Jan 2017 17:36:57 -0500 |
| parents | c47a7c52ac4f |
| children | ee4be6eadd34 |
| files | cmalign._x_m_l_todo cmalign.xml cmbuild.xml cmpress.xml cmscan.xml cmsearch.xml cmstat.xml macros.xml test-data/cmalign_input2_tRNA5.c.cm test-data/cmalign_input_mrum_tRNAs10.fa test-data/cmalign_result_mrum-tRNAs10.out test-data/cmalignoutput test-data/cmbuild_input_tRNA5.sto test-data/cmbuild_results.cm test-data/cmcalibrate_input.cm test-data/cmpress_input_minifam.cm test-data/cmsearch_input1.cm test-data/cmsearch_input2.fa test-data/cmsearch_input2_mrum_genome.fa test-data/cmsearch_result.tabular test-data/cmsearch_result_tRNA5_mrum.out test-data/cmstat_input.cm test-data/cmstat_out.tabular test-data/metag-example.fa test-data/minifam.cm test-data/minifam.tar tool_dependencies.xml |
| diffstat | 27 files changed, 94536 insertions(+), 542 deletions(-) [+] |
line wrap: on
line diff
--- a/cmalign._x_m_l_todo Mon Dec 19 15:27:06 2016 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,256 +0,0 @@ -<tool id="infernal_cmalign" name="Align sequences to a covariance model" version="1.1.0.2"> - <description>against a sequence database (cmsearch)</description> - <parallelism method="multi" split_inputs="seqdb" split_mode="to_size" split_size="100" shared_inputs="" merge_outputs="outfile,multiple_alignment_output"></parallelism> - <requirements> - <requirement type="package">infernal</requirement> - <requirement type="package" version="1.1">infernal</requirement> - <requirement type="package" version="8.22">gnu_coreutils</requirement> - </requirements> - <command> -<![CDATA[ - ## a temp file is needed, because the standard tabular output from infernal is not usefull in Galaxy - ## it will be converted to a tab delimited file and piped to Galaxy - temp_tabular_output=\$(mktemp); - - cmsearch - ## Infernal Options - --cpu "\${GALAXY_SLOTS:-12}" - -o /dev/null - --tformat $seqdb.ext ##target format: fasta, embl, genbank, ddbj, stockholm, pfam, a2m, afa, clustal, and phylip - $bottomonly - $toponly - $cyk - $notrunc - $max - $nohmm - $mid - ##$bitscore_thresholds - --tblout \$temp_tabular_output - $g - #if $A: - $A $multiple_alignment_output - #end if - - #if $inclusion_thresholds_opts.inclusion_thresholds_selector == "--incE": - --incE $inclusion_thresholds_opts.incE - #elif $inclusion_thresholds_opts.inclusion_thresholds_selector == "--incT": - --incT $inclusion_thresholds_opts.incT - #end if - - #if $reporting_thresholds_opts.reporting_thresholds_selector == "-E": - -E $reporting_thresholds_opts.E - #elif $reporting_thresholds_opts.reporting_thresholds_selector == "-T": - -T $reporting_thresholds_opts.T - #end if - - ## CM file from the history or stored as database on disc - - #if $cm_opts.cm_opts_selector == "db": - $cm_opts.database.fields.path - #else: - $cm_opts.cmfile - #end if - - ## sequence file - $seqdb - 2>&1 - ; - - ## 1. replace all lines starting # (comment lines) - ## 2. replace the first 18 spaces with tabs, 18th field is a free text field (can contain spaces) - sed -e 's/#.*$//' -e '/^$/d' -e 's/ /\t/g' -e 's/\t/ /18g' \$temp_tabular_output > $outfile - -]]> - </command> - <inputs> - - <param name="seqdb" type="data" format="fasta" label="Sequence database"/> - <conditional name="cm_opts"> - <param name="cm_opts_selector" type="select" label="Subject covariance models"> - <option value="db" selected="True">Locally installed covariance models</option> - <option value="histdb">Covariance model from your history</option> - </param> - <when value="db"> - <param name="database" type="select" label="Covariance models"> - <options from_file="infernal.loc"> - <column name="value" index="0"/> - <column name="name" index="1"/> - <column name="path" index="2"/> - </options> - </param> - </when> - <when value="histdb"> - <param name="cmfile" type="data" format="txt" label="Covariance models file from the history."/> - </when> - </conditional> - - <param name="g" truevalue="-g" falsevalue="" checked="False" type="boolean" - label="Turn on the glocal alignment algorithm" help="... global with respect to the query model and local with respect to the target database."/> - - <param name="bottomonly" truevalue="--bottomonly" falsevalue="" checked="False" type="boolean" - label="Only search the bottom (Crick) strand of target sequences" help="in the sequence database"/> - <param name="toponly" truevalue="--toponly" falsevalue="" checked="False" type="boolean" - label="Only search the top (Watson) strand of target sequences" help="in the sequence database"/> - - <param name="cyk" truevalue="--cyk" falsevalue="" checked="False" type="boolean" - label="Use the CYK algorithm, not Inside, to determine the final score of all hits" help=""/> - <param name="--acyk" truevalue="--cyk" falsevalue="" checked="False" type="boolean" - label="Use the CYK algorithm to align hits" help="By default, the Durbin/Holmes optimal accuracy algorithm is used, which finds the alignment that maximizes the expected accuracy of all aligned residues."/> - - <param name="notrunc" truevalue="--notrunc" falsevalue="" checked="False" type="boolean" - label="Turn off truncated hit detection" help=""/> - - <!-- accelleration pipeline --> - - <param name="max" truevalue="--max" falsevalue="" checked="False" type="boolean" - label="Turn off all filters, and run non-banded Inside on every full-length target sequence" help="This - increases sensitivity somewhat, at an extremely large cost in speed."/> - - <param name="nohmm" truevalue="--nohmm" falsevalue="" checked="False" type="boolean" - label="Turn off all HMM filter stages " help=""/> - - <param name="mid" truevalue="--mid" falsevalue="" checked="False" type="boolean" - label="Turn off the HMM SSV and Viterbi filter stages" help=""/> - - - <!-- Options for model-specific score thresholding --> - <!-- - <param name="bitscore_thresholds" type="select" label="Bit score thresholds" help="Curated CM databases may define specific bit score thresholds for each CM, superseding any thresholding based on statistical significance alone."> - <option value="" selected="true">None</option> - <option value=" - -cut_ga">GA (gathering) bit scores</option> - <option value=" - -cut_nc">NC (noise cutoff) bit score</option> - <option value=" - -cut_tc">TC (trusted cutoff) bit score</option> - </param> - --> - <!-- Options for inclusion thresholds --> - - - <conditional name="inclusion_thresholds_opts"> - <param name="inclusion_thresholds_selector" type="select" label="Inclusion thresholds" - help="Inclusion thresholds are stricter than reporting thresholds. Inclusion thresholds control which hits are considered to be reliable enough to be included in an output alignment or in a possible subsequent search round, or marked as significant (”!”) as opposed to questionable (”?”) in hit output."> - <option value="" selected="true">default</option> - <option value="--incE">Use E-value</option> - <option value="--incT">Use bit score</option> - </param> - <when /> - <when value="--incE"> - <param name="incE" type="float" value="0.01" label="Use E-value" help="of <= X as the hit inclusion threshold."> - <sanitizer> - <valid initial="string.printable"> - <remove value="'"/> - </valid> - </sanitizer> - </param> - </when> - <when value="--incT"> - <param name="incT" type="integer" value="0" label="Use bit score" help="of >= X as the hit inclusion threshold."> - <sanitizer> - <valid initial="string.printable"> - <remove value="'"/> - </valid> - </sanitizer> - </param> - </when> - </conditional> - - <!-- Options controlling reporting thresholds --> - - <conditional name="reporting_thresholds_opts"> - <param name="reporting_thresholds_selector" type="select" label="reporting thresholds" - help="Reporting thresholds control which hits are reported in output files"> - <option value="" selected="true">default</option> - <option value="-E">Use E-value</option> - <option value="-T">Use bit score</option> - </param> - <when /> - <when value="-E"> - <param name="E" type="float" value="10.0" label="Use E-value" help="of <= X as the hit reporting threshold. The default is 10.0, meaning that on average, about 10 false positives will be reported per query, so you can see the top of the noise and decide for yourself if it’s really noise."> - <sanitizer> - <valid initial="string.printable"> - <remove value="'"/> - </valid> - </sanitizer> - </param> - </when> - <when value="-T"> - <param name="T" type="integer" value="0" label="Use bit score" help="of >= X as the hit reporting threshold."> - <sanitizer> - <valid initial="string.printable"> - <remove value="'"/> - </valid> - </sanitizer> - </param> - </when> - </conditional> - - <param name="A" truevalue="-A" falsevalue="" checked="False" type="boolean" - label="Save a multiple alignment of all significant hits" help="... those satisfying inclusion thresholds"/> - - </inputs> - <outputs> - - <data format="tabular" name="outfile" label="cmsearch on ${on_string}"/> - <data format="tabular" name="multiple_alignment_output" label="cmsearch on ${on_string} (multi alignment)"> - <filter>A is True</filter> - </data> - - </outputs> - <help> -<![CDATA[ - - -**What it does** - -cmalign aligns the RNA sequences to the covariance model (CM). - - -The sequence file must be in FASTA or Genbank format. cmalign -uses an HMM banding technique to accelerate alignment by default. By default, -cmalign computes the alignment with maximum expected accuracy that is consistent with constraints -(bands) derived from an HMM, using a banded version of the Durbin/Holmes optimal accuracy algorithm. cmalign takes special care to correctly align truncated sequences, where some nucleotides from the beginning (5’) and/or end (3’) of the actual full length biological sequence are not present in the input sequence. This behavior is on by default. - - - -**Output format** - - -(1) target name: The name of the target sequence or profile. -(2) accession: The accession of the target sequence or profile, or ’-’ if none. -(3) query name: The name of the query sequence or profile. -(4) accession: The accession of the query sequence or profile, or ’-’ if none. -(5) mdl (model): Which type of model was used to compute the final score. Either ’cm’ or ’hmm’. A CM is used to compute the final hit scores unless the model has zero basepairs or the --hmmonly option is used, in which case a HMM will be used. -(6) mdl from (model coord): The start of the alignment of this hit with respect to the profile (CM or HMM), numbered 1..N for a profile of N consensus positions. -(7) mdl to (model coord): The end of the alignment of this hit with respect to the profile (CM or HMM), numbered 1..N for a profile of N consensus positions. -(8) seq from (ali coord): The start of the alignment of this hit with respect to the sequence, numbered 1..L for a sequence of L residues. -(9) seq to (ali coord): The end of the alignment of this hit with respect to the sequence, numbered 1..L for a sequence of L residues. -(10) strand: The strand on which the hit occurs on the sequence. ’+’ if the hit is on the top (Watson) strand, ’-’ if the hit is on the bottom (Crick) strand. If on the top strand, the “seq from” value will be less than or equal to the “seq to” value, else it will be greater than or equal to it. -(11) trunc: Indicates if this is predicted to be a truncated CM hit or not. This will be “no” if it is a CM hit that is not predicted to be truncated by the end of the sequence, “5’ ” or “3’ ” if the hit is predicted to have one or more 5’ or 3’ residues missing due to a artificial truncation of the sequence, or “5’&3”’ if the hit is predicted to have one or more 5’ residues missing and one or more 3’ residues missing. If the hit is an HMM hit, this will always be ’-’. -(12) pass: Indicates what “pass” of the pipeline the hit was detected on. This is probably only useful for testing and debugging. Non-truncated hits are found on the first pass, truncated hits are found on successive passes. -(13) gc: Fraction of G and C nucleotides in the hit. -(14) bias: The biased-composition correction: the bit score difference contributed by the null3 model for CM hits, or the null2 model for HMM hits. High bias scores may be a red flag for a false positive. It is difficult to correct for all possible ways in which a nonrandom but nonhomologous biological sequences can appear to be similar, such as short-period tandem repeats, so there are cases where the bias correction is not strong enough (creating false positives). -(15) score: The score (in bits) for this target/query comparison. It includes the biased-composition cor-rection (the “null3” model for CM hits, or the “null2” model for HMM hits). -(16) E-value: The expectation value (statistical significance) of the target. This is a per query E-value; i.e. calculated as the expected number of false positives achieving this comparison’s score for a single query against the search space Z. For cmsearch Z is defined as the total number of nucleotides in the target dataset multiplied by 2 because both strands are searched. For cmscan Z is the total number of nucleotides in the query sequence multiplied by 2 because both strands are searched and multiplied by the number of models in the target database. If you search with multiple queries and if you want to control the overall false positive rate of that search rather than the false positive rate per query, you will want to multiply this per-query E-value by how many queries you’re doing. -(17) inc: Indicates whether or not this hit achieves the inclusion threshold: ’!’ if it does, ’?’ if it does not (and rather only achieves the reporting threshold). By default, the inclusion threshold is an E-value of 0.01 and the reporting threshold is an E-value of 10.0, but these can be changed with command line options as described in the manual pages. -(18) description of target: The remainder of the line is the target’s description line, as free text. - - -For further questions please refere to the Infernal `Userguide <http://selab.janelia.org/software/infernal/Userguide.pdf>`_. - - -]]> - </help> - - <citations> - <citation type="doi">10.1093/bioinformatics/btt509</citation> - <citation type="bibtex"> - @ARTICLE{bgruening_galaxytools, - Author = {Björn Grüning, Cameron Smith, Torsten Houwaart, Nicola Soranzo, Eric Rasche}, - keywords = {bioinformatics, ngs, galaxy, cheminformatics, rna}, - title = {{Galaxy Tools - A collection of bioinformatics and cheminformatics tools for the Galaxy environment}}, - url = {https://github.com/bgruening/galaxytools} - } - </citation> - </citations> - - -</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/cmalign.xml Sat Jan 21 17:36:57 2017 -0500 @@ -0,0 +1,241 @@ +<tool id="infernal_cmalign" name="cmalign" version="@VERSION@.0"> + <description>Align sequences to a covariance model against a sequence database</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="stdio" /> + <command> +<![CDATA[ + + cmalign + ## Infernal Options + --cpu "\${GALAXY_SLOTS:-2}" + -o '$outfile' + + $alignment_algorithm_cont.alignment_algorithm.alignment_algorithm_selector + #if $alignment_algorithm_cont.alignment_algorithm.alignment_algorithm_selector=="--sample" + --seed $alignment_algorithm_cont.alignment_algorithm.seed + #end if + $alignment_algorithm_cont.notrunc_opt.notrunc + #if $alignment_algorithm_cont.notrunc_opt.notrunc=="--notrunc" + $alignment_algorithm_cont.notrunc_opt.sub + #end if + $speed_memory_cont.hmm_banding.banding_selector + #if $speed_memory_cont.hmm_banding.banding_selector=="--hbanded" + --tau $speed_memory_cont.hmm_banding.tau + --mxsize $speed_memory_cont.hmm_banding.mxsize + $speed_memory_cont.hmm_banding.fixedtau + --maxtau $speed_memory_cont.hmm_banding.maxtau + #end if + #if $speed_memory_cont.hmm_banding.banding_selector=="--nonbanded" + --mxsize $speed_memory_cont.hmm_banding.mxsize + #end if + + #if $other_opts.mapali_opt.mapali_cond + --mapali '$other_opts.mapali_opt.mapali' + $other_opts.mapali_opt.mapstr + #end if + + --informat $seqdb.ext + --outformat $other_opts.outformat_selector + $other_opts.dnaout + $other_opts.noprob + $other_opts.matchonly + $other_opts.ileaved + + ##--small requirements according to cmalign.c + + #if $alignment_algorithm_cont.alignment_algorithm.alignment_algorithm_selector=="--cyk" \ + and $other_opts.noprob \ + and $speed_memory_cont.hmm_banding.banding_selector=="--nonbanded" \ + and $alignment_algorithm_cont.notrunc_opt.notrunc=="--notrunc" + $speed_memory_cont.small + #end if + + ## CM file from the history or stored as database on disc + #if $cm_opts.cm_opts_selector == "db": + $cm_opts.database.fields.path + #else: + '$cm_opts.cmfile' + #end if + ## sequence file + '$seqdb' + +]]> + </command> + <inputs> + + <param name="seqdb" type="data" format="fasta" label="Sequence database"/> + + <conditional name="cm_opts"> + <param name="cm_opts_selector" type="select" label="Subject covariance models"> + <option value="db" selected="True">Locally installed covariance models</option> + <option value="histdb">Covariance model from your history</option> + </param> + <when value="db"> + <param name="database" type="select" label="Covariance models"> + <options from_file="infernal.loc"> + <column name="value" index="0"/> + <column name="name" index="1"/> + <column name="path" index="2"/> + </options> + </param> + </when> + <when value="histdb"> + <param name="cmfile" type="data" format="cm" label="Covariance models file from the history."/> + </when> + </conditional> + + <param argument="-g" truevalue="-g" falsevalue="" checked="False" type="boolean" + label="Turn on the glocal alignment algorithm" help="... global with respect to the query model and local with respect to the target database."/> + + <section name="alignment_algorithm_cont" title="Options controlling alignment algorithm" > + <conditional name="alignment_algorithm"> + <param name="alignment_algorithm_selector" type="select" label="Options controlling alignment algorithm" help=""> + <option value="--optacc" selected="true">The Holmes/Durbin optimal accuracy algorithm (--optacc)</option> + <option value="--cyk"> The CYK algorithm (--cyk)</option> + <option value="--sample">Sample alignment of each seq from posterior distribution (--sample)</option> + </param> + <when value="--optacc"></when> + <when value="--cyk"></when> + <when value="--sample"> + <param argument="--seed" type="integer" value="0" label="set RNG seed to 'n'" help="if 0: one-time arbitrary seed"/> + </when> + </conditional> + <conditional name="notrunc_opt"> + <param argument="--notrunc" truevalue="" falsevalue="--notrunc" checked="true" type="boolean" + label="Use truncated alignment algorithm" help=""/> + <when value=""></when> + <when value="--notrunc"> + <param argument="--sub" type="boolean" truevalue="--sub" falsevalue="" checked="false" + label="Build sub CM for columns b/t HMM predicted start/end points" help=""/> + + </when> + </conditional> + </section> + + <section name="speed_memory_cont" title="Options controlling speed and memory requirements"> + <conditional name="hmm_banding"> + <param name="banding_selector" type="select" label="HMM banding"> + <option value="--hbanded" selected="true"></option> + <option value="--nonbanded"></option> + </param> + <when value="--hbanded"> + <param argument="--tau" type="float" value="1e-7" min="1e-18" max="1.0" + label="Tail loss probability for HMM bands" help="This is the amount of probability mass within the HMM posterior probabilities that is considered negligible."/> + <param argument="--mxsize" type="integer" value="1028" min="1" + label="Set the maximum allowable CM DP matrix size to 'x' megabytes" help=""/> + <param argument="--fixedtau" type="boolean" truevalue="--fixedtau" falsevalue="" checked="false" + label="Turn off the HMM band tightening strategy" help="Cmalign will attempt to iteratively tighten the HMM bands it uses to constrain the alignment by raising the tau parameter and recalculating the bands until the total matrix size needed falls below 'x' megabytes or the maximum allowable tau value (0.05 by default, but changeable with --maxtau) is reached."/> + <param argument="--maxtau" type="float" value="0.05" min="1e-18" max="1.0" + label="Set the maximum allowed value for tau during band tightening" help=""/> + </when> + <when value="--nonbanded"> + <param argument="--mxsize" type="integer" value="1028" min="1" + label="Set the maximum allowable CM DP matrix size to 'x' megabytes" help=""/> + </when> + </conditional> + <param argument="--small" type="boolean" truevalue="--small" falsevalue="" checked="false" + label="Use small memory divide and conquer algorithm" help="Allows CM alignment within practical memory limits, reducing the memory required for alignment. WARNING: It can only be used when --cyk,--noprob,--nonbanded,--notrunc are all enabled"/> + </section> + + <section name="other_opts" title="Other options"> + <conditional name="mapali_opt"> + <param name="mapali_cond" type="boolean" checked="false" + label="Read the aligment file that used to build the CM" help="The alignment from the file is held fixed. This allows you to align sequences to a model with cmalign and view them in the context of an existing trusted multiple alignment."/> + <when value="true"> + <param argument="--mapali" type="data" format="fasta" + label="The aligment file that used to build the CM" help=""/> + <param argument="--mapstr" type="boolean" truevalue="--small" falsevalue="" checked="true" + label="Use small memory divide and conquer algorithm" help=""/> + </when> + <when value="false"></when> + </conditional> + <param name="outformat_selector" type="select" label="" argument="--outformat"> + <option value="Stockholm" selected="true">Stockholm</option> + <option value="Pfam">Pfam</option> + <option value="AFA">AFA: aligned fasta</option> + <option value="A2M">A2M</option> + <option value="Clustal">Clustal</option> + <option value="Phylip">Phylip</option> + </param> + <param argument="--dnaout" type="boolean" truevalue="--dnaout" falsevalue="" checked="false" + label="Output the alignments as DNA sequence alignments" help="... instead of RNA ones."/> + <param argument="--noprob" type="boolean" truevalue="" falsevalue="--noprob" checked="true" + label="Annotate the output alignment with posterior probabilities" help=""/> + <param argument="--matchonly" type="boolean" truevalue="--matchonly" falsevalue="" checked="false" + label="Only include match columns in the output alignment" help="Do not include any insertions relative to the consensus model."/> + <param argument="--ileaved" type="boolean" truevalue="--ileaved" falsevalue="" checked="false" + label="Output the alignment in interleaved Stockholm format of a fixed width" help="will only work for alignments of up to 100,000 sequences or a total of 100,000,000 aligned nucleotides"/> + </section> + + + </inputs> + <outputs> + <data name="outfile" format="text" label="cmalign on ${on_string}"/> + </outputs> + <tests> + <test> + <conditional name="cm_opts"> + <param name="cm_opts_selector" value="histdb"/> + <param name="cmfile" value="cmalign_input2_tRNA5.c.cm"/> + </conditional> + <param name="seqdb" value="cmalign_input_mrum_tRNAs10.fa"/> + <output name="outfile"> + <assert_contents> + <has_text text="GGAGCUAUAGCUCAAU..GGC"/> + </assert_contents> + </output> + </test> + </tests> + <help> +<![CDATA[ + + +**What it does** + +cmalign aligns the RNA sequences to the covariance model (CM). + + +The sequence file must be in FASTA or Genbank format. cmalign +uses an HMM banding technique to accelerate alignment by default. By default, +cmalign computes the alignment with maximum expected accuracy that is consistent with constraints +(bands) derived from an HMM, using a banded version of the Durbin/Holmes optimal accuracy algorithm. cmalign takes special care to correctly align truncated sequences, where some nucleotides from the beginning (5’) and/or end (3’) of the actual full length biological sequence are not present in the input sequence. This behavior is on by default. + + + + +**Output format** + + +(1) target name: The name of the target sequence or profile. +(2) accession: The accession of the target sequence or profile, or ’-’ if none. +(3) query name: The name of the query sequence or profile. +(4) accession: The accession of the query sequence or profile, or ’-’ if none. +(5) mdl (model): Which type of model was used to compute the final score. Either ’cm’ or ’hmm’. A CM is used to compute the final hit scores unless the model has zero basepairs or the --hmmonly option is used, in which case a HMM will be used. +(6) mdl from (model coord): The start of the alignment of this hit with respect to the profile (CM or HMM), numbered 1..N for a profile of N consensus positions. +(7) mdl to (model coord): The end of the alignment of this hit with respect to the profile (CM or HMM), numbered 1..N for a profile of N consensus positions. +(8) seq from (ali coord): The start of the alignment of this hit with respect to the sequence, numbered 1..L for a sequence of L residues. +(9) seq to (ali coord): The end of the alignment of this hit with respect to the sequence, numbered 1..L for a sequence of L residues. +(10) strand: The strand on which the hit occurs on the sequence. ’+’ if the hit is on the top (Watson) strand, ’-’ if the hit is on the bottom (Crick) strand. If on the top strand, the “seq from” value will be less than or equal to the “seq to” value, else it will be greater than or equal to it. +(11) trunc: Indicates if this is predicted to be a truncated CM hit or not. This will be “no” if it is a CM hit that is not predicted to be truncated by the end of the sequence, “5’ ” or “3’ ” if the hit is predicted to have one or more 5’ or 3’ residues missing due to a artificial truncation of the sequence, or “5’&3”’ if the hit is predicted to have one or more 5’ residues missing and one or more 3’ residues missing. If the hit is an HMM hit, this will always be ’-’. +(12) pass: Indicates what “pass” of the pipeline the hit was detected on. This is probably only useful for testing and debugging. Non-truncated hits are found on the first pass, truncated hits are found on successive passes. +(13) gc: Fraction of G and C nucleotides in the hit. +(14) bias: The biased-composition correction: the bit score difference contributed by the null3 model for CM hits, or the null2 model for HMM hits. High bias scores may be a red flag for a false positive. It is difficult to correct for all possible ways in which a nonrandom but nonhomologous biological sequences can appear to be similar, such as short-period tandem repeats, so there are cases where the bias correction is not strong enough (creating false positives). +(15) score: The score (in bits) for this target/query comparison. It includes the biased-composition cor-rection (the “null3” model for CM hits, or the “null2” model for HMM hits). +(16) E-value: The expectation value (statistical significance) of the target. This is a per query E-value; i.e. calculated as the expected number of false positives achieving this comparison’s score for a single query against the search space Z. For cmsearch Z is defined as the total number of nucleotides in the target dataset multiplied by 2 because both strands are searched. For cmscan Z is the total number of nucleotides in the query sequence multiplied by 2 because both strands are searched and multiplied by the number of models in the target database. If you search with multiple queries and if you want to control the overall false positive rate of that search rather than the false positive rate per query, you will want to multiply this per-query E-value by how many queries you’re doing. +(17) inc: Indicates whether or not this hit achieves the inclusion threshold: ’!’ if it does, ’?’ if it does not (and rather only achieves the reporting threshold). By default, the inclusion threshold is an E-value of 0.01 and the reporting threshold is an E-value of 10.0, but these can be changed with command line options as described in the manual pages. +(18) description of target: The remainder of the line is the target’s description line, as free text. + + +For further questions please refere to the Infernal `Userguide <http://eddylab.org/infernal/Userguide.pdf>`_. + + +]]> + </help> + + <expand macro="citations" /> + + +</tool>
--- a/cmbuild.xml Mon Dec 19 15:27:06 2016 -0500 +++ b/cmbuild.xml Sat Jan 21 17:36:57 2017 -0500 @@ -1,62 +1,96 @@ -<tool id="infernal_cmbuild" name="Build covariance models" version="1.1.0.2"> - <description>from sequence alignments (cmbuild)</description> - <parallelism method="multi" split_inputs="alignment_infile" split_mode="to_size" split_size="10" shared_inputs="" merge_outputs="cmfile_outfile"></parallelism> - <requirements> - <requirement type="package">infernal</requirement> - <requirement type="package" version="1.1">infernal</requirement> - <requirement type="package" version="8.22">gnu_coreutils</requirement> - </requirements> +<tool id="infernal_cmbuild" name="cmbuild" version="@VERSION@.0"> + <description>Build covariance models from sequence alignments</description> + <macros> + <import>macros.xml</import> + </macros> + <parallelism method="multi" split_inputs="alignment_infile" split_mode="to_size" split_size="10" merge_outputs="cmfile_outfile"></parallelism> + <expand macro="requirements" /> + <expand macro="stdio" /> <command> <![CDATA[ - cmbuild -F - #if $is_summery_output: - -o '$summary_outfile' - #end if - - $model_construction_opts.model_construction_opts_selector - #if $model_construction_opts.model_construction_opts_selector == '--fast': - --symfrac $model_construction_opts.symfrac + cmbuild + -F + #if $is_summery_output: + -o '$summary_outfile' + #end if + ## to many outputs, is that one really needed? + ##-O $annotated_source_alignment_outfile + $model_construction_opts.model_construction_opts_selector + #if $model_construction_opts.model_construction_opts_selector == '--fast': + --symfrac $model_construction_opts.symfrac + #end if + $noss + $relative_weights_opts.relative_weights_opts_selector + #if $relative_weights_opts.relative_weights_opts_selector == '--wblosum': + --wid $relative_weights_opts.wid + #end if + --p7ere $controlling_filter_p7_hmm.p7ere + $controlling_filter_p7_hmm.p7ml + --EmN $controlling_filter_p7_hmm.EmN + --EvN $controlling_filter_p7_hmm.EvN + --ElfN $controlling_filter_p7_hmm.ElfN + --EgfN $controlling_filter_p7_hmm.EgfN + $effective_opts.effective_opts_selector + #if str($effective_opts.effective_opts_selector) == '--eent': + #if $effective_opts.ere + --ere $effective_opts.ere #end if - - $noss - - $relative_weights_opts.relative_weights_opts_selector - #if $relative_weights_opts.relative_weights_opts_selector == '--wblosum': - --wid $relative_weights_opts.wid + #if $effective_opts.eminseq + --eminseq $effective_opts.eminseq #end if - - $effective_opts.effective_opts_selector - #if str($effective_opts.effective_opts_selector) == '--eent': - --ere $effective_opts.ere - --eminseq $effective_opts.eminseq + #if $effective_opts.ehmmre --ehmmre $effective_opts.ehmmre + #end if + #if $effective_opts.eset --eset $effective_opts.eset #end if + #end if + #if str($refining_opts.refining_opts_selector) == '--refine': + #if $refining_opts.refine_output: + --refine '$refined_multiple_alignment_output' + #else: + --refine /dev/null + #end if + $refining_opts.l + $refining_opts.gibbs_opts.gibbs_opts_selector + #if str($refining_opts.gibbs_opts.gibbs_opts_selector) == '--gibbs': + --seed $refining_opts.gibbs_opts.random_seed + #end if + $refining_opts.notrunc + $refining_opts.cyk + #end if + '$cmfile_outfile' + '$alignment_infile' - #if str($refining_opts.refining_opts_selector) == '--refine': - #if $refining_opts.refine_output: - --refine $refined_multiple_alignment_output - #else: - --refine /dev/null - #end if - - $l - $refining_opts.gibbs_opts.gibbs_opts_selector - #if str($refining_opts.gibbs_opts.gibbs_opts_selector) == '--gibbs': - $refining_opts.gibbs_opts.random_seed + #if $Calibrate.selector=="true" + && cmcalibrate + -L$Calibrate.L + #if $Calibrate.output_options_cond.selector == "extra" + #if str($Calibrate.output_options_cond.output_options) != 'None' + #for j in $Calibrate.output_options_cond.output_options.value: + --$j $getVar($j) + #end for #end if - - $notrunc - $cyk #end if - + #if $Calibrate.cont_exp_tails_fits.selector == "top_n" + --gtailn $Calibrate.cont_exp_tails_fits.gtailn + --ltailn $Calibrate.cont_exp_tails_fits.ltailn + #elif $Calibrate.cont_exp_tails_fits.selector == "frac" + --tailp $Calibrate.cont_exp_tails_fits.tailp + #end if + --seed $Calibrate.add_opts.seed + --beta $Calibrate.add_opts.beta + $Calibrate.add_opts.nonbanded + $Calibrate.add_opts.nonull3 + $Calibrate.add_opts.random + #if str($Calibrate.add_opts.gc) != 'None' + --gc '$Calibrate.add_opts.gc' + #end if + --cpu "\${GALAXY_SLOTS:-2}" '$cmfile_outfile' - '$alignment_infile' - && - cmcalibrate - -L 0.01 --cpu \${GALAXY_SLOTS:-2} - '$cmfile_outfile' + #end if + ]]> </command> <inputs> @@ -98,6 +132,15 @@ </when> </conditional> + <section name="controlling_filter_p7_hmm" title="Controlling Filter P7 HMM construction" > + <param argument="--p7ere" type="float" value="0.38" label="For the filter p7 HMM, set minimum rel entropy/posn to" help="Set the target mean match state relative entropy for the filter p7 HMM"/> + <param argument="--p7ml" type="boolean" truevalue="--p7ml" falsevalue="" checked="false" label="Define the filter p7 HMM as the ML p7 HMM" help="Use a mzimum likelihood p7 HMM built from the CM as the filter HMM"/> + <param argument="--EmN" type="integer" value="200" label="Number of sampled seqs to use for p7 local MSV calibration" help=""/> + <param argument="--EvN" type="integer" value="200" label="Number of sampled seqs to use for p7 local Vit calibration" help=""/> + <param argument="--ElfN" type="integer" value="200" label="Number of sampled seqs to use for p7 local Fwd calibration" help=""/> + <param argument="--EgfN" type="integer" value="200" label="Number of sampled seqs to use for p7 glocal Fwd calibration" help=""/> + </section> + <conditional name="effective_opts"> <param name="effective_opts_selector" type="select" label="Options controlling effective sequence number" help=""> <option value="--eent" >entropy weighting strategy (--eent)</option> @@ -105,24 +148,24 @@ </param> <when value="--enone"/> <when value="--eent"> - <param name="ere" type="float" value="0.59" - label="Set the target mean match state relative entropy (--ere)" help=""/> + <param name="ere" type="float" value="" + label="Set the target mean match state relative entropy" help="(--ere)" optional="true"/> <param name="eminseq" type="integer" value="" - label="Define the minimum allowed effective sequence number (--eminseq)" help=""/> + label="Define the minimum allowed effective sequence number" help="(--eminseq)" optional="true"/> <param name="ehmmre" type="float" value="" - label="Set the target HMM mean match state relative entropy (--ehmmre)" help=""/> + label="Set the target HMM mean match state relative entropy" help="(--ehmmre)" optional="true"/> <param name="eset" type="integer" value="" - label="Set the effective sequence number for entropy weighting (--eset)" help=""/> + label="Set the effective sequence number for entropy weighting" help="(--eset)" optional="true"/> </when> </conditional> <conditional name="refining_opts"> <param name="refining_opts_selector" type="select" label="Options for refining the input alignment" help=""> + <option value="--refine">refine the input alignment</option> <option value="" selected="true">No refinement</option> - <option value="--refine">refine the input alignment</option> </param> <when value=""/> <when value="--refine"> @@ -158,6 +201,59 @@ <param name="is_summery_output" truevalue="" falsevalue="" checked="False" type="boolean" label="Output a summery file?" help=""/> + <!-- calibrate options --> + <conditional name="Calibrate"> + <param name="selector" type="boolean" checked="true" label="Calibrate the covariance model" + help="A CM file must be calibrated with cmcalibrate before it can be used in cmsearch or cmscan. cmcalibrate is very slow. It takes a couple of hours to calibrate a single average sized CM on a single CPU"/> + <when value="false"/> + <when value="true"> + <param argument="-L" type="float" value="1.6" min="0.01" max="160" label="Total length of random sequences to search" help="Set random seq length to search in Mb (megabases)"/> + <conditional name="cont_exp_tails_fits" > + <param name="selector" type="select" label="Options controlling exponential tail fits"> + <option value="top_n">Fit the top 'n' hits/Mb in thehistogram</option> + <option value="frac">Fit a fraction of the histogram</option> + </param> + <when value="top_n"> + <param argument="--gtailn" type="integer" value="250" min="0" label=" Fit the top 'n' hits/Mb in histogram for glocal modes" help=""/> + <param argument="--ltailn" type="integer" value="750" min="0" label=" Fit the top 'n' hits/Mb in histogram for local modes" help=""/> + </when> + <when value="frac"> + <param argument="--tailp" type="float" min="0" max="0.6" optional="true" label="Set fraction of histogram tail to fit to exp tail" help=""/> + </when> + </conditional> + <conditional name="output_options_cond"> + <param name="selector" type="select" label="Output extra files"> + <option value="extra">Output extra files</option> + <option value="none" selected="true">Don't output extra files</option> + </param> + <when value="extra"> + <param name="output_options" type="select" label="Optional output files" multiple="true" display="checkboxes"> + <option value="hfile">save fitted score histogram(s)</option> + <option value="sfile">save survival plot </option> + <option value="qqfile">save Q-Q plot for score histograms </option> + <option value="ffile">save lambdas for different tail fit probs</option> + <option value="xfile">save scores in fit tail</option> + </param> + </when> + <when value="none"/> + </conditional> + <section name="add_opts" title="Additional Options"> + <param argument="--seed" type="integer" value="181" + label="RNG seed" help="If the seed is nonzero, stochas-tic simulations will be reproducible. If 0, the random number generator is seeded arbitrarily"/> + <param argument="--beta" type="float" value="1e-15" + label="Tail loss prob. for query dependent banding (QDB)" help="The beta parameter is the amount of probability mass excluded during band calculation, higher values of beta give greater speedups but sacrifice more accuracy than lower values."/> + <param argument="--nonbanded" truevalue="--nonbanded" falsevalue="" checked="false" type="boolean" + label="Turn off QDB during E-value calibration" help="This will slow down calibration"/> + <param argument="--nonull3" truevalue="--nonull3" falsevalue="" checked="false" type="boolean" + label="Turn off the null3 post hoc additional null model" help="This is not recommended unless you plan on using the same option to cmsearch and/or cmscan"/> + <param argument="--random" truevalue="--random" falsevalue="" checked="false" type="boolean" + label="use GC content of random null background model of CM" help="Use the background null model of the CM to generate the random sequences, instead of the more realistic HMM. Unless the CM was built using the --null option to cmbuild, the background null model will be 25% each A, C, G and U"/> + <param argument="--gc" type="data" format="*" optional="true" label="Use GC content distribution from file" help="Generate the random sequences using the nucleotide distribution from the sequence file"/> + </section> + </when> + </conditional> + + </inputs> <outputs> <data format="text" name="summary_outfile" label="cmbuild summary on ${on_string}"> @@ -175,7 +271,68 @@ </filter> </data> + <!-- cmcalibrate additional output files --> + <data name="hfile" format="txt" label="hfile, an cmcalibrate additional output file, on ${on_string}"> + <filter> + (( + Calibrate['selector'] is True and + Calibrate['output_options_cond']['selector'] == "extra" and + 'hfile' in Calibrate['output_options_cond']['output_options'] + )) + </filter> + </data> + <data name="sfile" format="txt" label="sfile, an cmcalibrate additional output file, on ${on_string}"> + <filter> + (( + Calibrate['selector'] is True and + Calibrate['output_options_cond']['selector'] == "extra" and + 'sfile' in Calibrate['output_options_cond']['output_options'] + )) + </filter> + </data> + <data name="qqfile" format="txt" label="qqfile, an cmcalibrate additional output file, on ${on_string}"> + <filter> + (( + Calibrate['selector'] is True and + Calibrate['output_options_cond']['selector'] == "extra" and + 'qqfile' in Calibrate['output_options_cond']['output_options'] + )) + </filter> + </data> + <data name="ffile" format="txt" label="ffile, an cmcalibrate additional output file, on ${on_string}"> + <filter> + (( + Calibrate['selector'] is True and + Calibrate['output_options_cond']['selector'] == "extra" and + 'ffile' in Calibrate['output_options_cond']['output_options'] + )) + </filter> + </data> + <data name="xfile" format="txt" label="xfile, an cmcalibrate additional output file, on ${on_string}"> + <filter> + (( + Calibrate['selector'] is True and + Calibrate['output_options_cond']['selector'] == "extra" and + 'xfile' in Calibrate['output_options_cond']['output_options'] + )) + </filter> + </data> + </outputs> + + <tests> + <test> + <param name="alignment_infile" value="cmbuild_input_tRNA5.sto"/> + <conditional name="Calibrate"> + <param name="selector" value="true"/> + </conditional> + <output name="outfile"> + <assert_contents> + <has_text text="S 0 -1 0 1 4 0 1 88 108 -7.713 -8.959 -0.044 -5.412"/> + </assert_contents> + </output> + </test> + </tests> <help> <![CDATA[ @@ -268,24 +425,17 @@ - *Turn on the local alignment algorithm*: allows the alignment to span two or more subsequences if necessary (e.g. if the structures of the query model and target sequence are only partially shared), allowing certain large insertions and deletions in the structure to be penalized differently than normal indels. The default is to globally align the query model to the target sequences. - *--gibbs sampling*: Modifies the behavior of --refine so Gibbs sampling is used instead of EM. The difference is that during the alignment stage the alignment is not necessarily optimal, instead an alignment (parsetree) for each sequences is sampled from the posterior distribution of alignments as determined by the Inside algorithm. Due to this sampling step --gibbs is non- deterministic, so different runs with the same alignment may yield different results. This is not true when --refine is used without the --gibbs option, in which case the final alignment and CM will always be the same. When --gibbs is enabled, the --seed "number" option can be used to seed the random number generator predictably, making the results reproducible. The goal of the --gibbs option is to help expert RNA alignment curators refine structural alignments by allowing them to observe alternative high scoring alignments. - *--Random seed*: Seed the random number generator with an integer >= 0. This option can only be used in combination with --gibbs. If the given number is nonzero, stochastic sampling of alignments will be reproducible; the same command will give the same results. If the given number is 0, the random number generator is seeded arbitrarily, and stochastic samplings may vary from run to run of the same command. The default seed is 0. - - *--Turn off the truncated alignment algorithm*: With --refine, turn off the truncated alignment algorithm. There is more information on this in the cmalign manual page. + - *--Turn off the truncated alignment algorithm*: With --refine, turn off the truncated alignment algorithm. There is more information on this in the cmalign manual page. - *--cyk algorithm*: With --refine, align with the CYK algorithm. By default the optimal accuracy algorithm is used. There is more information on this in the cmalign manual page. + For further questions please refere to the Infernal Userguide_. -.. _Userguide: http://selab.janelia.org/software/infernal/Userguide.pdf +.. _Userguide: http://eddylab.org/infernal/Userguide.pdf ]]> </help> - <citations> - <citation type="doi">10.1093/bioinformatics/btt509</citation> - <citation type="bibtex"> - @ARTICLE{bgruening_galaxytools, - Author = {Björn Grüning, Cameron Smith, Torsten Houwaart, Nicola Soranzo, Eric Rasche}, - keywords = {bioinformatics, ngs, galaxy, cheminformatics, rna}, - title = {{Galaxy Tools - A collection of bioinformatics and cheminformatics tools for the Galaxy environment}}, - url = {https://github.com/bgruening/galaxytools} - } - </citation> - </citations> + + <expand macro="citations" /> + </tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/cmpress.xml Sat Jan 21 17:36:57 2017 -0500 @@ -0,0 +1,88 @@ +<tool id="infernal_cmpress" name="cmpress" version="@VERSION@.0"> + <description> Prepare a covariance model database for cmscan</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements" /> + <expand macro="stdio" /> + <command> +<![CDATA[ + ## CM file from the history or stored as database on disc + #if str($cm_opts.cm_opts_selector) == "db": + cmfile_path='$cm_opts.database.fields.path' + #else: + ##'$cm_opts.cmfile' + cmfile_path='$cmfile' + #end if + && + cmpress -F "\$cmfile_path" && + ##cmpress creates four files in the same directory of the cm file + cd `dirname "\$cmfile_path"` && + tar -cvf '$outfile' `basename "\$cmfile_path"`.i1* +]]> + </command> + <inputs> + <conditional name="cm_opts"> + <param name="cm_opts_selector" type="select" label="Subject covariance models <cmdb> "> + <option value="db" >Locally installed covariance models</option> + <option value="histdb" selected="True">Covariance model from your history</option> + </param> + <when value="db"> + <param name="database" type="select" label="Covariance models"> + <options from_file="infernal.loc"> + <column name="value" index="0"/> + <column name="name" index="1"/> + <column name="path" index="2"/> + </options> + </param> + </when> + <when value="histdb"> + <param name="cmfile" type="data" format="cm" label="Covariance models file from the history."/> + </when> + </conditional> + + </inputs> + <outputs> + <data format="tar" name="outfile" label="cmpress on ${on_string}"/> + </outputs> + + <tests> + <test> + <conditional name="cm_opts"> + <param name="cm_opts_selector" value="histdb"/> + <param name="cmfile" value="cmpress_input_minifam.cm"/> + </conditional> + <assert_stdout> + <has_text text="Working... done."/> + </assert_stdout> + + </test> + + </tests> + <help> +<![CDATA[ + + +**What it does** + +Starting from a CM database <cmfile> in standard Infernal-1.1 format, construct binary compressed datafiles for cm- +scan. The cmpress step is required for cmscan to work. + +**Input format** + +The <cmfile> must be have already been calibrated with cmcalibrate for cmpress to work. + +**Output format** + + + +For further questions please refere to the Infernal `Userguide <http://eddylab.org/infernal/Userguide.pdf>`_. + + +]]> + </help> + + <expand macro="citations" /> + + +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/cmscan.xml Sat Jan 21 17:36:57 2017 -0500 @@ -0,0 +1,287 @@ +<tool id="infernal_cmscan" name="cmscan" version="@VERSION@.0"> + <description> Search sequences against collections of covariance models</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio"/> + <command> +<![CDATA[ + ## a temp file is needed, because the standard tabular output from infernal is not usefull in Galaxy + ## it will be converted to a tab delimited file and piped to Galaxy + temp_tabular_output=\$(mktemp) && + + #if str($cm_opts.cm_opts_selector) == "histdb": + ln -s '$cm_opts.cmfile' cmdb.cm && + #end if + + tar xvf '$aux_files' && + ln -s `find *.i1f` cmdb.cm.i1f && + ln -s `find *.i1i` cmdb.cm.i1i && + ln -s `find *.i1m` cmdb.cm.i1m && + ln -s `find *.i1p` cmdb.cm.i1p && + + cmscan + --cpu "\${GALAXY_SLOTS:-2}" + --tblout '\$temp_tabular_output' + -o /dev/null + $g + #if $Z + -Z $Z + #end if + $verbose + $other_opts.notrunc + $other_opts.anytrunc + $other_opts.nonull3 + #if $other_opts.smxsize <> 128.0 + --smxsize $other_opts.smxsize + #end if + #if $other_opts.mxsize <> 128.0 + --mxsize $other_opts.mxsize + #end if + $other_opts.cyk + $other_opts.acyk + $other_opts.bottomonly + $other_opts.toponly + #if str($inclusion_thresholds_opts.inclusion_thresholds_selector) == "--incE": + --incE $inclusion_thresholds_opts.incE + #elif str($inclusion_thresholds_opts.inclusion_thresholds_selector) == "--incT": + --incT $inclusion_thresholds_opts.incT + #end if + #if str($reporting_thresholds_opts.reporting_thresholds_selector) == "-E": + -E $reporting_thresholds_opts.E + #elif str($reporting_thresholds_opts.reporting_thresholds_selector) == "-T": + -T $reporting_thresholds_opts.T + #end if + $model_thresholds.cut_ga + $model_thresholds.cut_nc + $model_thresholds.cut_tc + #if $acceleration_huristics.acceleration_huristics_selector == "FZ" + --FZ $$acceleration_huristics.FZ + #else + $acceleration_huristics.acceleration_huristics_selector + #if $acceleration_huristics.acceleration_huristics_selector == "--mid" + --Fmid $acceleration_huristics.Fmid + #end if + #end if + ## CM file from the history or stored as database on disc + #if str($cm_opts.cm_opts_selector) == "db": + '$cm_opts.database.fields.path' + #else: + ##'$cm_opts.cmfile' + cmdb.cm + #end if + ## sequence file + '$seqdb' + && + sed 's/ \+ /\t/g' '\$temp_tabular_output' > '$outfile' + +]]> + </command> + <inputs> + <param name="seqdb" type="data" format="fasta" label="Sequence database <seqfile>"/> + + <conditional name="cm_opts"> + <param name="cm_opts_selector" type="select" label="Subject covariance models <cmdb> "> + <option value="db" >Locally installed covariance models</option> + <option value="histdb" selected="True">Covariance model from your history</option> + </param> + <when value="db"> + <param name="database" type="select" label="Covariance models"> + <options from_file="infernal.loc"> + <column name="value" index="0"/> + <column name="name" index="1"/> + <column name="path" index="2"/> + </options> + </param> + </when> + <when value="histdb"> + <param name="cmfile" type="data" format="cm" label="Covariance models file from the history."/> + </when> + </conditional> + <param name="aux_files" type="data" format="tar" label="Auxillury files" help="A tar file contains the four auxillury files suffixed .i1{fimp}. These files are generated after pressing the cm files using cmpress"/> + + <param argument="-g" truevalue="-g" falsevalue="" checked="False" type="boolean" + label="Turn on the glocal alignment algorithm" help="... global with respect to the query model and local with respect to the target database."/> + <param argument="-Z" type="float" optional="true" min="0" label="Search space size in *Mb* for E-value calculations" help="Without the use of this option, the search space size changes for each query sequence"/> + <param argument="--verbose" truevalue="--verbose" falsevalue="" checked="False" type="boolean" + label="Be verbose" help="report extra information; mainly useful for debugging"/> + + + + <!-- Options for inclusion thresholds --> + <conditional name="inclusion_thresholds_opts"> + <param name="inclusion_thresholds_selector" type="select" label="Inclusion thresholds" + help="Inclusion thresholds are stricter than reporting thresholds. Inclusion thresholds control which hits are considered to be reliable enough to be included in an output alignment or in a possible subsequent search round, or marked as significant (”!”) as opposed to questionable (”?”) in hit output."> + <option value="" selected="true">default</option> + <option value="--incE">Use E-value</option> + <option value="--incT">Use bit score</option> + </param> + <when value=""/> + <when value="--incE"> + <param name="incE" type="float" value="0.01" label="Use E-value" help="of <= X as the hit inclusion threshold."> + <sanitizer> + <valid initial="string.printable"> + <remove value="'"/> + </valid> + </sanitizer> + </param> + </when> + <when value="--incT"> + <param name="incT" type="integer" value="0" label="Use bit score" help="of >= X as the hit inclusion threshold."> + <sanitizer> + <valid initial="string.printable"> + <remove value="'"/> + </valid> + </sanitizer> + </param> + </when> + </conditional> + + <!-- Options controlling reporting thresholds --> + + <conditional name="reporting_thresholds_opts"> + <param name="reporting_thresholds_selector" type="select" label="reporting thresholds" + help="Reporting thresholds control which hits are reported in output files"> + <option value="" selected="true">default</option> + <option value="-E">Use E-value</option> + <option value="-T">Use bit score</option> + </param> + <when value=""/> + <when value="-E"> + <param name="E" type="float" value="10.0" label="Use E-value" help="of <= X as the hit reporting threshold. The default is 10.0, meaning that on average, about 10 false positives will be reported per query, so you can see the top of the noise and decide for yourself if it’s really noise."> + <sanitizer> + <valid initial="string.printable"> + <remove value="'"/> + </valid> + </sanitizer> + </param> + </when> + <when value="-T"> + <param name="T" type="integer" value="0" label="Use bit score" help="of >= X as the hit reporting threshold."> + <sanitizer> + <valid initial="string.printable"> + <remove value="'"/> + </valid> + </sanitizer> + </param> + </when> + </conditional> + + <section name="model_thresholds" title="Options controlling model-specific reporting thresholds" help="Curated CM databases may define specific bit score thresholds for each CM, superseding any thresholding based on statistical significance alone."> + <param argument="--cut_ga" truevalue="--cut_ga" falsevalue="" checked="false" type="boolean" + label="Use CM's GA gathering cutoffs as reporting thresholds" help="GA thresholds are generally considered to be the reliable curated thresholds defining family membership"/> + <param argument="--cut_nc" truevalue="--cut_nc" falsevalue="" checked="false" type="boolean" + label="use CM's NC noise cutoffs as reporting thresholds" help="NC thresholds are generally considered to be the score of the highest-scoring known false positive."/> + <param argument="--cut_tc" truevalue="--cut_tc" falsevalue="" checked="false" type="boolean" + label="use CM's TC trusted cutoffs as reporting thresholds" help="TC thresholds are generally considered to be the score of the lowest-scoring known true positive that is above all known false positives."/> + </section> + + <conditional name="acceleration_huristics"> + <param name="acceleration_huristics_selector" type="select" label="Options controlling acceleration heuristics" help="These options are, in order from least strict (slowest but most sensitive) to most strict (fastest but least sensitive)"> + <option value="--max">Turn all heuristic filters off (--max)</option> + <option value="--nohmm">Skip all HMM filter stages, use only CM (--nohmm)</option> + <option value="--mid">Skip first two HMM filter stages (SSV and Vit) (--mid)</option> + <option value="--default" selected="true">Run search space size-dependent pipeline (--default)</option> + <option value="--rfam">Use a strict filtering strategy devised for large databases (more than 20 Gb) (--rfam)</option> + <option value="--hmmonly">Use HMM only, don't use a CM at all (--hmmonly)</option> + <option value="FZ">set filters to defaults used for a search space of size 'x' Mb (--FZ)</option> + </param> + <when value="--max"> + </when> + <when value="--nohmm"> + </when> + <when value="--mid"> + <param argument="--Fmid" type="float" value="0.02" label="P-value threshold for HMM stages"/> + </when> + <when value="--default"> + </when> + <when value="--rfam"> + </when> + <when value="--hmmonly"> + </when> + <when value="FZ"> + <param argument="--FZ" type="float" value="125" label="Size of search space in Mb"/> + </when> + </conditional> + + <section name="other_opts" title="Other options"> + <param argument="--notrunc" truevalue="--notrunc" falsevalue="" checked="False" type="boolean" + label="Skip truncated hit detection" help=""/> + <param argument="--anytrunc" truevalue="--anytrunc" falsevalue="" checked="false" type="boolean" + label="Allow full and truncated hits anywhere within sequences" help=""/> + <param argument="--nonull3" truevalue="--nonull3" falsevalue="" checked="false" type="boolean" + label="Turn off the null3 CM score corrections for biased composition" help="This correction is not used during the HMM filter stages."/> + <param argument="--mxsize" type="float" value="128.0" min="0.1" + label="Set the maximum allowable CM DP matrix size to 'x' megabytes" help=""/> + <param argument="--smxsize" type="float" value="128.0" min="0.1" + label="Set the maximum allowable CM search DP matrix size to 'x' megabytes." help=""/> + <param argument="--cyk" truevalue="--cyk" falsevalue="" checked="False" type="boolean" + label="Use the CYK algorithm, not Inside, to determine the final score of all hits" help=""/> + <param argument="--acyk" truevalue="--cyk" falsevalue="" checked="False" type="boolean" + label="Use the CYK algorithm to align hits" help="By default, the Durbin/Holmes optimal accuracy algorithm is used, which finds the alignment that maximizes the expected accuracy of all aligned residues."/> + <param argument="--bottomonly" truevalue="--bottomonly" falsevalue="" checked="False" type="boolean" + label="Only search the bottom (Crick) strand of target sequences" help="in the sequence database"/> + <param argument="--toponly" truevalue="--toponly" falsevalue="" checked="False" type="boolean" + label="Only search the top (Watson) strand of target sequences" help="in the sequence database"/> + + </section> + + + + </inputs> + <outputs> + <data format="tabular" name="outfile" label="cmscan on ${on_string}"/> + </outputs> + <tests> + <test> + <conditional name="cm_opts"> + <param name="cm_opts_selector" value="histdb"/> + <param name="cmfile" value="minifam.cm" /> + </conditional> + <param name="aux_files" value="minifam.tar" ftype="tar"/> + <param name="seqdb" value="metag-example.fa"/> + <output name="outfile"> + <assert_contents> + <has_text text="AAGA01015927.1"/> + </assert_contents> + </output> + </test> + + </tests> + <help> +<![CDATA[ + + +**What it does** + +cmscan is used to search sequences against collections of covariance models. +For each sequence in <seqfile>, use that query sequence to search the target database of CMs in <cmdb>, +and output ranked lists of the CMs with the most significant matches to the sequence + +**Input format** + +The <seqfile> may contain more than one query sequence. It can be in FASTA format, or several other common +sequence file formats (genbank, embl, and among others), or in alignment file formats (stockholm, aligned fasta, and +others). + +The <cmdb> needs to be press’ed using cmpress before it can be searched with cmscan. This creates four binary +files, suffixed .i1{fimp}. Additionally, <cmdb> must have been calibrated for E-values with cmcalibrate before being +press’ed with cmpress. + +NOTE: Please provid a tar file that contains the .cm file in addition to the four binary files, suffixed .i1{fimp}, +and specify the file type as "tar" before uploading the file. Otherwise Galaxy will not read the binary files properly. + +**Output format** + +The output format is designed to be human-readable. + +For further questions please refere to the Infernal `Userguide <http://eddylab.org/infernal/Userguide.pdf>`_. + + +]]> + </help> + + <expand macro="citations" /> + +</tool>
--- a/cmsearch.xml Mon Dec 19 15:27:06 2016 -0500 +++ b/cmsearch.xml Sat Jan 21 17:36:57 2017 -0500 @@ -1,193 +1,236 @@ -<tool id="infernal_cmsearch" name="Search covariance model(s)" version="1.1.0.2"> - <description>against a sequence database (cmsearch)</description> - <parallelism method="multi" split_inputs="seqdb" split_mode="to_size" split_size="500" shared_inputs="" merge_outputs="outfile,multiple_alignment_output"></parallelism> - <requirements> - <requirement type="package">infernal</requirement> - <requirement type="package" version="1.1">infernal</requirement> - <requirement type="package" version="8.22">gnu_coreutils</requirement> - </requirements> +<tool id="infernal_cmsearch" name="cmsearch" version="@VERSION@.0"> + <description>Search covariance model(s) against a sequence database </description> + <macros> + <import>macros.xml</import> + </macros> + <parallelism method="multi" split_inputs="seqdb" split_mode="to_size" split_size="500" merge_outputs="outfile,multiple_alignment_output"></parallelism> + <expand macro="requirements"/> + <expand macro="stdio" /> <command> <![CDATA[ ## a temp file is needed, because the standard tabular output from infernal is not usefull in Galaxy ## it will be converted to a tab delimited file and piped to Galaxy - temp_tabular_output=\$(mktemp); + temp_tabular_output=\$(mktemp) && cmsearch ## Infernal Options - --cpu "\${GALAXY_SLOTS:-12}" + --cpu "\${GALAXY_SLOTS:-2}" -o /dev/null --tformat $seqdb.ext ##target format: fasta, embl, genbank, ddbj, stockholm, pfam, a2m, afa, clustal, and phylip $bottomonly $toponly $cyk + $acyk $notrunc - $max - $nohmm - $mid - ##$bitscore_thresholds + $anytrunc + $nonull3 + #if $smxsize <> 128.0 + --smxsize $smxsize + #end if + #if $mxsize <> 128.0 + --mxsize $mxsize + #end if --tblout \$temp_tabular_output $g + #if $Z + -Z $Z + #end if #if $A: - $A $multiple_alignment_output + $A '$multiple_alignment_output' #end if - #if str($inclusion_thresholds_opts.inclusion_thresholds_selector) == "--incE": --incE $inclusion_thresholds_opts.incE #elif str($inclusion_thresholds_opts.inclusion_thresholds_selector) == "--incT": --incT $inclusion_thresholds_opts.incT #end if - #if str($reporting_thresholds_opts.reporting_thresholds_selector) == "-E": -E $reporting_thresholds_opts.E #elif str($reporting_thresholds_opts.reporting_thresholds_selector) == "-T": -T $reporting_thresholds_opts.T #end if - + $model_thresholds.cut_ga + $model_thresholds.cut_nc + $model_thresholds.cut_tc + #if $acceleration_huristics.acceleration_huristics_selector == "FZ" + --FZ $$acceleration_huristics.FZ + #else + $acceleration_huristics.acceleration_huristics_selector + #if $acceleration_huristics.acceleration_huristics_selector == "--mid" + --Fmid $acceleration_huristics.Fmid + #end if + #end if ## CM file from the history or stored as database on disc - #if str($cm_opts.cm_opts_selector) == "db": $cm_opts.database.fields.path #else: $cm_opts.cmfile #end if - ## sequence file - $seqdb + '$seqdb' 2>&1 - ; - + && ## 1. replace all lines starting # (comment lines) ## 2. replace the first 18 spaces with tabs, 18th field is a free text field (can contain spaces) - sed -e 's/#.*$//' -e '/^$/d' -e 's/\s\+/\t/g' -e 's/\t/ /18g' \$temp_tabular_output > $outfile + sed -e 's/#.*$//' -e '/^$/d' -e 's/\s\+/\t/g' -e 's/\t/ /18g' \$temp_tabular_output > '$outfile' ]]> </command> - <inputs> + <inputs> - <param name="seqdb" type="data" format="fasta" label="Sequence database"/> + <param name="seqdb" type="data" format="fasta" label="Sequence database"/> - <conditional name="cm_opts"> - <param name="cm_opts_selector" type="select" label="Subject covariance models"> - <option value="db" selected="True">Locally installed covariance models</option> - <option value="histdb">Covariance model from your history</option> + <conditional name="cm_opts"> + <param name="cm_opts_selector" type="select" label="Subject covariance models"> + <option value="db" selected="True">Locally installed covariance models</option> + <option value="histdb">Covariance model from your history</option> + </param> + <when value="db"> + <param name="database" type="select" label="Covariance models"> + <options from_file="infernal.loc"> + <column name="value" index="0"/> + <column name="name" index="1"/> + <column name="path" index="2"/> + </options> </param> - <when value="db"> - <param name="database" type="select" label="Covariance models"> - <options from_file="infernal.loc"> - <column name="value" index="0"/> - <column name="name" index="1"/> - <column name="path" index="2"/> - </options> - </param> - </when> - <when value="histdb"> - <param name="cmfile" type="data" format="cm" label="Covariance models file from the history."/> - </when> - </conditional> + </when> + <when value="histdb"> + <param name="cmfile" type="data" format="cm" label="Covariance models file from the history."/> + </when> + </conditional> + + <param argument="-g" truevalue="-g" falsevalue="" checked="False" type="boolean" + label="Turn on the glocal alignment algorithm" help="... global with respect to the query model and local with respect to the target database."/> + <param argument="-Z" type="float" min="0" optional="true" label="Calculate E-values as if the search space size is 'x' megabases (Mb)" help=""/> + + <param argument="--bottomonly" truevalue="--bottomonly" falsevalue="" checked="False" type="boolean" + label="Only search the bottom (Crick) strand of target sequences" help="in the sequence database"/> + <param argument="--toponly" truevalue="--toponly" falsevalue="" checked="False" type="boolean" + label="Only search the top (Watson) strand of target sequences" help="in the sequence database"/> + + <param argument="--cyk" truevalue="--cyk" falsevalue="" checked="False" type="boolean" + label="Use the CYK algorithm, not Inside, to determine the final score of all hits" help=""/> + <param argument="--acyk" truevalue="--cyk" falsevalue="" checked="False" type="boolean" + label="Use the CYK algorithm to align hits" help="By default, the Durbin/Holmes optimal accuracy algorithm is used, which finds the alignment that maximizes the expected accuracy of all aligned residues."/> - <param name="g" truevalue="-g" falsevalue="" checked="False" type="boolean" - label="Turn on the glocal alignment algorithm" help="... global with respect to the query model and local with respect to the target database."/> - - <param name="bottomonly" truevalue="--bottomonly" falsevalue="" checked="False" type="boolean" - label="Only search the bottom (Crick) strand of target sequences" help="in the sequence database"/> - <param name="toponly" truevalue="--toponly" falsevalue="" checked="False" type="boolean" - label="Only search the top (Watson) strand of target sequences" help="in the sequence database"/> - - <param name="cyk" truevalue="--cyk" falsevalue="" checked="False" type="boolean" - label="Use the CYK algorithm, not Inside, to determine the final score of all hits" help=""/> - <param name="--acyk" truevalue="--cyk" falsevalue="" checked="False" type="boolean" - label="Use the CYK algorithm to align hits" help="By default, the Durbin/Holmes optimal accuracy algorithm is used, which finds the alignment that maximizes the expected accuracy of all aligned residues."/> + <param argument="--notrunc" truevalue="--notrunc" falsevalue="" checked="False" type="boolean" + label="Skip truncated hit detection" help=""/> + <param argument="--anytrunc" truevalue="--anytrunc" falsevalue="" checked="false" type="boolean" + label="Allow full and truncated hits anywhere within sequences" help=""/> + <param argument="--nonull3" truevalue="--nonull3" falsevalue="" checked="false" type="boolean" + label="Turn off the null3 CM score corrections for biased composition" help="This correction is not used during the HMM filter stages."/> + <param argument="--mxsize" type="float" value="128.0" min="0.1" + label="Set the maximum allowable CM DP matrix size to 'x' megabytes" help=""/> + <param argument="--smxsize" type="float" value="128.0" min="0.1" + label="Set the maximum allowable CM search DP matrix size to 'x' megabytes." help=""/> - <param name="notrunc" truevalue="--notrunc" falsevalue="" checked="False" type="boolean" - label="Turn off truncated hit detection" help=""/> - - <!-- accelleration pipeline --> - - <param name="max" truevalue="--max" falsevalue="" checked="False" type="boolean" - label="Turn off all filters, and run non-banded Inside on every full-length target sequence" help="This - increases sensitivity somewhat, at an extremely large cost in speed."/> - - <param name="nohmm" truevalue="--nohmm" falsevalue="" checked="False" type="boolean" - label="Turn off all HMM filter stages " help=""/> - - <param name="mid" truevalue="--mid" falsevalue="" checked="False" type="boolean" - label="Turn off the HMM SSV and Viterbi filter stages" help=""/> + <!-- accelleration pipeline --> + <conditional name="acceleration_huristics"> + <param name="acceleration_huristics_selector" type="select" label="Options controlling acceleration heuristics" help="These options are, in order from least strict (slowest but most sensitive) to most strict (fastest but least sensitive)"> + <option value="--max">Turn all heuristic filters off (--max)</option> + <option value="--nohmm">Skip all HMM filter stages, use only CM (--nohmm)</option> + <option value="--mid">Skip first two HMM filter stages (SSV and Vit) (--mid)</option> + <option value="--default" selected="true">Run search space size-dependent pipeline (--default)</option> + <option value="--rfam">Use a strict filtering strategy devised for large databases (more than 20 Gb) (--rfam)</option> + <option value="--hmmonly">Use HMM only, don't use a CM at all (--hmmonly)</option> + <option value="FZ">set filters to defaults used for a search space of size 'x' Mb (--FZ)</option> + </param> + <when value="--max"> + </when> + <when value="--nohmm"> + </when> + <when value="--mid"> + <param argument="--Fmid" type="float" value="0.02" label="P-value threshold for HMM stages"/> + </when> + <when value="--default"> + </when> + <when value="--rfam"> + </when> + <when value="--hmmonly"> + </when> + <when value="FZ"> + <param argument="--FZ" type="float" value="" label="Size of search space in Mb"/> + </when> + </conditional> - <!-- Options for model-specific score thresholding --> - <!-- - <param name="bitscore_thresholds" type="select" label="Bit score thresholds" help="Curated CM databases may define specific bit score thresholds for each CM, superseding any thresholding based on statistical significance alone."> - <option value="" selected="true">None</option> - <option value=" - -cut_ga">GA (gathering) bit scores</option> - <option value=" - -cut_nc">NC (noise cutoff) bit score</option> - <option value=" - -cut_tc">TC (trusted cutoff) bit score</option> + + <!-- Options for model-specific score thresholding --> + + <section name="model_thresholds" title="Options controlling model-specific reporting thresholds" help="Curated CM databases may define specific bit score thresholds for each CM, superseding any thresholding based on statistical significance alone."> + <param argument="--cut_ga" truevalue="--cut_ga" falsevalue="" checked="false" type="boolean" + label="Use CM's GA gathering cutoffs as reporting thresholds" help="GA thresholds are generally considered to be the reliable curated thresholds defining family membership"/> + <param argument="--cut_nc" truevalue="--cut_nc" falsevalue="" checked="false" type="boolean" + label="use CM's NC noise cutoffs as reporting thresholds" help="NC thresholds are generally considered to be the score of the highest-scoring known false positive."/> + <param argument="--cut_tc" truevalue="--cut_tc" falsevalue="" checked="false" type="boolean" + label="use CM's TC trusted cutoffs as reporting thresholds" help="TC thresholds are generally considered to be the score of the lowest-scoring known true positive that is above all known false positives."/> + </section> + + <!-- Options for inclusion thresholds --> + <conditional name="inclusion_thresholds_opts"> + <param name="inclusion_thresholds_selector" type="select" label="Inclusion thresholds" + help="Inclusion thresholds are stricter than reporting thresholds. Inclusion thresholds control which hits are considered to be reliable enough to be included in an output alignment or in a possible subsequent search round, or marked as significant (”!”) as opposed to questionable (”?”) in hit output."> + <option value="" selected="true">default</option> + <option value="--incE">Use E-value</option> + <option value="--incT">Use bit score</option> </param> - --> - <!-- Options for inclusion thresholds --> - - - <conditional name="inclusion_thresholds_opts"> - <param name="inclusion_thresholds_selector" type="select" label="Inclusion thresholds" - help="Inclusion thresholds are stricter than reporting thresholds. Inclusion thresholds control which hits are considered to be reliable enough to be included in an output alignment or in a possible subsequent search round, or marked as significant (”!”) as opposed to questionable (”?”) in hit output."> - <option value="" selected="true">default</option> - <option value="--incE">Use E-value</option> - <option value="--incT">Use bit score</option> + <when value=""/> + <when value="--incE"> + <param name="incE" type="float" value="0.01" label="Use E-value" help="of <= X as the hit inclusion threshold."> + <sanitizer> + <valid initial="string.printable"> + <remove value="'"/> + </valid> + </sanitizer> + </param> + </when> + <when value="--incT"> + <param name="incT" type="integer" value="0" label="Use bit score" help="of >= X as the hit inclusion threshold."> + <sanitizer> + <valid initial="string.printable"> + <remove value="'"/> + </valid> + </sanitizer> </param> - <when value=""/> - <when value="--incE"> - <param name="incE" type="float" value="0.01" label="Use E-value" help="of <= X as the hit inclusion threshold."> - <sanitizer> - <valid initial="string.printable"> - <remove value="'"/> - </valid> - </sanitizer> - </param> - </when> - <when value="--incT"> - <param name="incT" type="integer" value="0" label="Use bit score" help="of >= X as the hit inclusion threshold."> - <sanitizer> - <valid initial="string.printable"> - <remove value="'"/> - </valid> - </sanitizer> - </param> - </when> - </conditional> + </when> + </conditional> - <!-- Options controlling reporting thresholds --> + <!-- Options controlling reporting thresholds --> - <conditional name="reporting_thresholds_opts"> - <param name="reporting_thresholds_selector" type="select" label="reporting thresholds" - help="Reporting thresholds control which hits are reported in output files"> - <option value="" selected="true">default</option> - <option value="-E">Use E-value</option> - <option value="-T">Use bit score</option> + <conditional name="reporting_thresholds_opts"> + <param name="reporting_thresholds_selector" type="select" label="reporting thresholds" + help="Reporting thresholds control which hits are reported in output files"> + <option value="" selected="true">default</option> + <option value="-E">Use E-value</option> + <option value="-T">Use bit score</option> + </param> + <when value=""/> + <when value="-E"> + <param name="E" type="float" value="10.0" label="Use E-value" help="of <= X as the hit reporting threshold. The default is 10.0, meaning that on average, about 10 false positives will be reported per query, so you can see the top of the noise and decide for yourself if it’s really noise."> + <sanitizer> + <valid initial="string.printable"> + <remove value="'"/> + </valid> + </sanitizer> </param> - <when value=""/> - <when value="-E"> - <param name="E" type="float" value="10.0" label="Use E-value" help="of <= X as the hit reporting threshold. The default is 10.0, meaning that on average, about 10 false positives will be reported per query, so you can see the top of the noise and decide for yourself if it’s really noise."> - <sanitizer> - <valid initial="string.printable"> - <remove value="'"/> - </valid> - </sanitizer> - </param> - </when> - <when value="-T"> - <param name="T" type="integer" value="0" label="Use bit score" help="of >= X as the hit reporting threshold."> - <sanitizer> - <valid initial="string.printable"> - <remove value="'"/> - </valid> - </sanitizer> - </param> - </when> - </conditional> + </when> + <when value="-T"> + <param name="T" type="integer" value="0" label="Use bit score" help="of >= X as the hit reporting threshold."> + <sanitizer> + <valid initial="string.printable"> + <remove value="'"/> + </valid> + </sanitizer> + </param> + </when> + </conditional> - <param name="A" truevalue="-A" falsevalue="" checked="False" type="boolean" - label="Save a multiple alignment of all significant hits" help="... those satisfying inclusion thresholds"/> - - </inputs> + <param argument="-A" truevalue="-A" falsevalue="" checked="False" type="boolean" + label="Save a multiple alignment of all significant hits" help="... those satisfying inclusion thresholds"/> + <param argument="--noali" type="boolean" truevalue="--noali" falsevalue="" checked="false" + label="Omit the alignment section from the main input" help="This can greatly reduce the output volume"/> + <param argument="--verbose" type="boolean" truevalue="--verbose" falsevalue="" checked="false" + label="Include extra search pipeline statistics in the main output" help="They include filter survival statistics for truncated hit detection and number of envelopes discarded due to matrix size overflows."/> + </inputs> <outputs> <data format="tabular" name="outfile" label="cmsearch on ${on_string}"/> @@ -196,6 +239,18 @@ </data> </outputs> + <tests> + <test> + <conditional name="cm_opts"> + <param name="cm_opts_selector" value="histdb"/> + <param name="cmfile" value="cmsearch_input1.cm"/> + </conditional> + <param name="seqdb" value="cmsearch_input2.fa"/> + <output name="outfile" file="cmsearch_result.tabular"/> + + </test> + </tests> + <help> <![CDATA[ @@ -210,7 +265,7 @@ **Input** -The CM query file must have been calibrated for E-values with cmcalibrate. As a special exception, any models CM query files that have zero basepairs need not be calibrated. +The CM query file must have been calibrated for E-values with cmcalibrate. As a special exception, any models CM query files that have zero basepairs need not be calibrated. **Options** @@ -223,67 +278,60 @@ - *Use the CYK algorithm, not Inside, to determine the final score of all hits*: If selecting "yes", the CYK algorithm instead of the CM Inside algorithm (the SCFG analog of the HMM Forward algorithm) is used. -- *Use the CYK algorithm to align hits*: By default, the Durbin/Holmes optimal accuracy algo- -rithm is used, which finds the alignment that maximizes the expected accuracy of all aligned -residues. +- *Use the CYK algorithm to align hits*: By default, the Durbin/Holmes optimal accuracy algorithm is used, which finds the alignment that maximizes the expected accuracy of all aligned residues. - *Turn off truncated hit detection*: Turns off truncated hit detection and will reduce the running time most significantly for target files that include many short sequences. -- *Turn off all filters, and run non-banded Inside on every full-length target sequence*: This -increases sensitivity somewhat, at an extremely large cost in speed. +- *Turn off all filters, and run non-banded Inside on every full-length target sequence*: This increases sensitivity somewhat, at an extremely large cost in speed. - *Turn off all HMM filter stages*: The CYK filter, using QDBs, will be run on every full-length target sequence and will enforce a P-value threshold of 0.0001. Each subsequence that survives CYK will be passed to Inside, which will also use QDBs (but a looser set). This increases sensitivity somewhat, at a very large cost in speed. --*Turn off the HMM SSV and Viterbi filter stages*:Sets remaining HMM filter -thresholds to 0.02 by default. This may increase sensitivity, at a significant cost in speed. +- *Turn off the HMM SSV and Viterbi filter stages*:Sets remaining HMM filter thresholds to 0.02 by default. This may increase sensitivity, at a significant cost in speed. -- *Inclusion thresholds*: *Use E-value* - Use an E-value as the hit inclusion threshold. The default is 0.01, meaning that on average, about 1 false positive would be expected in every 100 searches with different -query sequences. *Use Bit Score* - Instead of using E-values for setting the inclusion threshold, instead use a bit score as the hit inclusion threshold. By default this option is unset. +- *Inclusion thresholds*: *Use E-value* - Use an E-value as the hit inclusion threshold. The default is 0.01, meaning that on average, about 1 false positive would be expected in every 100 searches with different query sequences. *Use Bit Score* - Instead of using E-values for setting the inclusion threshold, instead use a bit score as the hit inclusion threshold. By default this option is unset. **Output Options** -- *reporting thresholds*: Hits are ranked by statistical significance (E-value). By *default*, all hits with an E-value <= 10 are reported. The following options allow you to change the default *E-value* reporting thresholds, or to use *bit score* thresholds instead. - - -Output Example: +- *reporting thresholds*: Hits are ranked by statistical significance (E-value). By *default*, all hits with an E-value <= 10 are reported. The following options allow you to change the default *E-value* reporting thresholds, or to use *bit score* thresholds instead. -# cmsearch :: search CM(s) against a sequence database -# INFERNAL 1.1.1 (July 2014) -# Copyright (C) 2014 Howard Hughes Medical Institute. -# Freely distributed under the GNU General Public License (GPLv3). -# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -# query CM file: tRNA5.cm -# target sequence database: tutorial/mrum-genome.fa -# number of worker threads: 8 -# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - +Output columns: + +(1) rank + +(2) E-value + +(3) score + +(4) bias + +(5) sequence + +(6) start + +(7) end + +(8) mdl + +(9) trunc + +(10) gc + +(11) description + +---- --------- ------ ----- ----------- ------- ------- --- ----- ---- ----------- + +! 1.3e-18 71.5 0.0 NC_013790.1 362026 361955 - cm no 0.50 Methanobrevibacter ruminantium M1 + +! 3.3e-18 70.2 0.0 NC_013790.1 2585265 2585193 - cm no 0.60 Methanobrevibacter ruminantium M1 -The second section is a list of ranked top hits (sorted by E-value, most significant hit first): - -rank E-value score bias sequence start end mdl trunc gc description ----- --------- ------ ----- ----------- ------- ------- --- ----- ---- ----------- -(1) ! 1.3e-18 71.5 0.0 NC_013790.1 362026 361955 - cm no 0.50 Methanobrevibacter ruminantium M1 -(2) ! 3.3e-18 70.2 0.0 NC_013790.1 2585265 2585193 - cm no 0.60 Methanobrevibacter ruminantium M1 - - - -For further questions please refere to the Infernal `Userguide <http://selab.janelia.org/software/infernal/Userguide.pdf>`_. +For further questions please refere to the Infernal `Userguide <http://eddylab.org/infernal/Userguide.pdf>`_. ]]> </help> - <citations> - <citation type="doi">10.1093/bioinformatics/btt509</citation> - <citation type="bibtex"> - @ARTICLE{bgruening_galaxytools, - Author = {Björn Grüning, Cameron Smith, Torsten Houwaart, Nicola Soranzo, Eric Rasche}, - keywords = {bioinformatics, ngs, galaxy, cheminformatics, rna}, - title = {{Galaxy Tools - A collection of bioinformatics and cheminformatics tools for the Galaxy environment}}, - url = {https://github.com/bgruening/galaxytools} - } - </citation> - </citations> - - + <expand macro="citations" /> + + </tool>
--- a/cmstat.xml Mon Dec 19 15:27:06 2016 -0500 +++ b/cmstat.xml Sat Jan 21 17:36:57 2017 -0500 @@ -1,30 +1,25 @@ -<tool id="infernal_cmstat" name="Summary statistics" version="1.1.0.1"> - <description>for covariance model (cmstat)</description> - <requirements> - <requirement type="package">infernal</requirement> - <requirement type="package" version="1.1">infernal</requirement> - <requirement type="package" version="8.22">gnu_coreutils</requirement> - </requirements> +<tool id="infernal_cmstat" name="cmstat" version="@VERSION@.0"> + <description>Summary statistics for covariance model </description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio" /> <command> <![CDATA[ ## a temp file is needed, because the standard tabular output from infernal is not usefull in Galaxy ## it will be converted to a tab delimited file and piped to Galaxy - temp_tabular_output=\$(mktemp); + ##temp_tabular_output=\$(mktemp); cmstat - #if str($cm_opts.cm_opts_selector) == "db": $cm_opts.database.fields.path #else: $cm_opts.cmfile #end if - > \$temp_tabular_output - ; + > $outfile - ## 1. replace all lines starting # (comment lines) - ## 2. replace the first 18 spaces with tabs, 18th field is a free text field (can contain spaces) - sed -e 's/#.*$//' -e '/^$/d' -e 's/ /\t/g' -e 's/\t/ /18g' \$temp_tabular_output > $outfile ]]> </command> @@ -51,6 +46,21 @@ <outputs> <data format="tabular" name="outfile" label="cmstat on ${on_string}"/> </outputs> + <tests> + <test> + <conditional name="cm_opts"> + <param name="cm_opts_selector" value="histdb"/> + <param name="cmfile" value="cmstat_input.cm"/> + </conditional> + <output name="outfile" > + <assert_contents> + <has_text text="idx"/> + <has_text text="accession"/> + <has_text text="nseq"/> + </assert_contents> + </output> + </test> + </tests> <help> <![CDATA[ @@ -86,21 +96,10 @@ relative entropy, the more the model will rely on structural conservation relative sequence conservation when identifying homologs. -For further questions please refere to the Infernal `Userguide <http://selab.janelia.org/software/infernal/Userguide.pdf>`_. +For further questions please refere to the Infernal `Userguide <http://eddylab.org/infernal/Userguide.pdf>`_. ]]> </help> - <citations> - <citation type="doi">10.1093/bioinformatics/btt509</citation> - <citation type="bibtex"> - @ARTICLE{bgruening_galaxytools, - Author = {Björn Grüning, Cameron Smith, Torsten Houwaart, Nicola Soranzo, Eric Rasche}, - keywords = {bioinformatics, ngs, galaxy, cheminformatics, rna}, - title = {{Galaxy Tools - A collection of bioinformatics and cheminformatics tools for the Galaxy environment}}, - url = {https://github.com/bgruening/galaxytools} - } - </citation> - </citations> - - + <expand macro="citations" /> + </tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Sat Jan 21 17:36:57 2017 -0500 @@ -0,0 +1,35 @@ +<macros> + <xml name="requirements"> + <requirements> + <requirement type="package">infernal</requirement> + <requirement type="package" version="1.1.2">infernal</requirement> + <requirement type="package" version="8.22">gnu_coreutils</requirement> + </requirements> + </xml> + <token name="@VERSION@">1.1.2</token> + <xml name="stdio"> + <stdio> + <exit_code range="1:" /> + <exit_code range=":-1" /> + <regex match="Error:" /> + <regex match="Exception:" /> + </stdio> + </xml> + <xml name="citations"> + <citations> + <citation type="bibtex">@article{Nawrocki15112013, +author = {Nawrocki, Eric P. and Eddy, Sean R.}, +title = {Infernal 1.1: 100-fold faster RNA homology searches}, +volume = {29}, +number = {22}, +pages = {2933-2935}, +year = {2013}, +doi = {10.1093/bioinformatics/btt509}, +abstract ={Summary: Infernal builds probabilistic profiles of the sequence and secondary structure of an RNA family called covariance models (CMs) from structurally annotated multiple sequence alignments given as input. Infernal uses CMs to search for new family members in sequence databases and to create potentially large multiple sequence alignments. Version 1.1 of Infernal introduces a new filter pipeline for RNA homology search based on accelerated profile hidden Markov model (HMM) methods and HMM-banded CM alignment methods. This enables ∼100-fold acceleration over the previous version and ∼10 000-fold acceleration over exhaustive non-filtered CM searches.Availability: Source code, documentation and the benchmark are downloadable from http://infernal.janelia.org. Infernal is freely licensed under the GNU GPLv3 and should be portable to any POSIX-compliant operating system, including Linux and Mac OS/X. Documentation includes a user’s guide with a tutorial, a discussion of file formats and user options and additional details on methods implemented in the software.Contact: nawrockie@janelia.hhmi.org}, +URL = {http://bioinformatics.oxfordjournals.org/content/29/22/2933.abstract}, +eprint = {http://bioinformatics.oxfordjournals.org/content/29/22/2933.full.pdf+html}, +journal = {Bioinformatics} +}</citation> + </citations> + </xml> +</macros>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmalign_input2_tRNA5.c.cm Sat Jan 21 17:36:57 2017 -0500 @@ -0,0 +1,563 @@ +INFERNAL1/a [1.1.1 | July 2014] +NAME tRNA5 +STATES 230 +NODES 61 +CLEN 72 +W 89 +ALPH RNA +RF no +CONS yes +MAP yes +DATE Mon Jun 27 12:35:45 2016 +COM [1] ./src/cmbuild tRNA5.cm tutorial/tRNA5.sto +COM [2] cmcalibrate tRNA5.cm +PBEGIN 0.05 +PEND 0.05 +WBETA 1e-07 +QDBBETA1 1e-07 +QDBBETA2 1e-15 +N2OMEGA 1.52588e-05 +N3OMEGA 1.52588e-05 +ELSELF -0.08926734 +NSEQ 5 +EFFN 3.725586 +CKSUM 3535941971 +NULL 0.000 0.000 0.000 0.000 +EFP7GF -5.5288 0.72958 +ECMLC 0.85563 -4.01853 2.43520 1600000 300168 0.003998 +ECMGC 0.39437 -17.41037 -4.06685 1600000 77168 0.005183 +ECMLI 0.73047 -3.70982 3.57712 1600000 245977 0.004879 +ECMGI 0.44078 -12.13534 -0.86006 1600000 57603 0.006944 +CM + [ ROOT 0 ] - - - - - - + S 0 -1 0 1 4 0 1 89 108 -7.419 -8.664 -0.055 -5.118 + IL 1 1 2 1 4 3 28 90 110 -2.817 -4.319 -0.613 -2.698 0.000 0.000 0.000 0.000 + IR 2 2 3 2 3 4 30 90 110 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 1 ] - 74 - a - - + MR 3 2 3 5 5 4 32 89 108 -7.593 -0.028 -7.408 -7.620 -8.512 0.474 -1.199 0.305 -0.089 + D 4 2 3 5 5 1 24 87 107 -5.352 -0.707 -2.978 -4.409 -2.404 + IR 5 5 3 5 5 3 28 89 109 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 2 ] 1 73 g c - - + MP 6 5 3 10 6 5 32 88 107 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.831 -2.997 -3.795 0.617 -3.618 -4.452 0.854 -3.918 -3.870 2.837 -4.276 -0.713 1.871 -3.843 -1.175 -2.703 + ML 7 5 3 10 6 3 26 86 106 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 8 5 3 10 6 3 25 86 106 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 9 5 3 10 6 0 21 84 103 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 10 10 5 10 6 3 27 87 107 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 11 11 6 11 5 3 27 87 107 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 3 ] 2 72 C G - - + MP 12 11 6 16 6 5 31 86 105 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -4.097 -3.805 -3.998 0.021 -3.009 -4.646 3.103 -3.661 -3.977 1.529 -4.392 -1.585 0.835 -4.247 -0.625 -2.808 + ML 13 11 6 16 6 2 25 84 104 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 14 11 6 16 6 2 25 84 104 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 15 11 6 16 6 0 21 82 101 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 16 16 5 16 6 3 27 85 105 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 17 17 6 17 5 3 27 85 105 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 4 ] 3 71 c g - - + MP 18 17 6 22 6 5 29 84 103 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.141 -2.880 -3.222 0.733 -2.762 -4.023 2.237 -3.232 -3.242 1.678 -3.747 0.537 1.616 -3.340 -0.447 -2.158 + ML 19 17 6 22 6 2 25 82 102 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 20 17 6 22 6 2 24 82 102 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 21 17 6 22 6 0 20 80 99 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 22 22 5 22 6 3 26 83 103 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 23 23 6 23 5 3 26 83 103 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 5 ] 4 70 g c - - + MP 24 23 6 28 6 5 28 82 101 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.477 -2.737 -3.484 0.861 -3.437 -4.224 1.956 -3.685 -3.594 2.509 -4.028 0.683 0.624 -3.528 -1.017 -2.419 + ML 25 23 6 28 6 2 24 80 100 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 26 23 6 28 6 2 24 80 100 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 27 23 6 28 6 0 20 78 97 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 28 28 5 28 6 3 25 81 101 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 29 29 6 29 5 3 25 81 101 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 6 ] 5 69 g c - - + MP 30 29 6 34 6 5 26 80 99 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -2.565 0.048 -2.684 1.825 -2.755 -3.485 0.996 -3.019 -2.788 2.050 -3.293 -0.374 0.757 -2.774 0.549 -1.819 + ML 31 29 6 34 6 2 23 78 98 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 32 29 6 34 6 2 23 78 98 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 33 29 6 34 6 0 19 76 96 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 34 34 5 34 6 2 24 79 99 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 35 35 6 35 5 3 24 79 99 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 7 ] 6 68 c g - - + MP 36 35 6 40 6 5 24 78 97 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.250 -3.161 -3.321 0.517 -2.657 -4.117 2.088 -3.215 -3.310 1.474 -3.823 -1.143 2.088 -3.483 0.783 -2.234 + ML 37 35 6 40 6 2 22 77 97 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 38 35 6 40 6 2 21 77 96 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 39 35 6 40 6 0 19 75 95 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 40 40 5 40 6 2 23 77 97 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 41 41 6 41 5 2 23 77 97 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 8 ] 7 67 A U - - + MP 42 41 6 46 4 4 22 76 95 -7.543 -7.750 -0.035 -6.164 -3.769 -3.134 -3.802 3.011 -3.544 -4.775 0.728 -3.793 -3.752 0.821 -4.250 -0.784 1.443 -4.133 -1.238 -2.690 + ML 43 41 6 46 4 1 21 76 96 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 44 41 6 46 4 1 20 76 96 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 45 41 6 46 4 0 19 74 94 -4.568 -4.250 -2.265 -0.520 + IL 46 46 5 46 4 2 22 77 97 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 47 47 6 47 3 2 21 76 96 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 9 ] 8 - U - - - + ML 48 47 6 50 3 2 20 73 93 -8.524 -0.014 -7.178 -2.549 -2.369 -3.320 1.822 + D 49 47 6 50 3 0 18 72 92 -6.174 -1.687 -0.566 + IL 50 50 3 50 3 2 20 75 95 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 10 ] 9 - A - - - + ML 51 50 3 53 2 1 19 72 92 -9.006 -0.003 1.048 -1.964 0.381 -1.421 + D 52 50 3 53 2 0 18 71 91 -8.445 -0.004 + IL 53 53 3 53 2 1 19 73 93 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ BIF 11 ] - - - - - - + B 54 53 3 124 55 0 18 71 91 + [ BEGR 42 ] - - - - - - + S 55 54 1 56 3 0 0 36 55 -8.524 -0.014 -7.178 + IL 56 56 2 56 3 1 1 39 59 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 43 ] 45 - A - - - + ML 57 56 2 59 3 1 1 36 55 -8.524 -0.014 -7.178 1.385 -1.618 -1.684 -0.412 + D 58 56 2 59 3 0 0 35 54 -6.174 -1.687 -0.566 + IL 59 59 3 59 3 1 1 38 57 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 44 ] 46 - G - - - + ML 60 59 3 62 3 1 1 35 54 -8.524 -0.014 -7.178 -2.700 -4.060 1.885 -3.430 + D 61 59 3 62 3 0 0 34 53 -6.174 -1.687 -0.566 + IL 62 62 3 62 3 1 1 37 56 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 45 ] 47 - g - - - + ML 63 62 3 65 3 1 1 34 52 -8.524 -0.481 -1.832 0.586 -2.024 0.919 -1.466 + D 64 62 3 65 3 0 0 33 52 -6.174 -1.687 -0.566 + IL 65 65 3 65 3 1 1 36 55 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 46 ] 48 - U - - - + ML 66 65 3 68 3 1 1 33 51 -8.062 -0.019 -6.716 -1.668 -1.633 -2.411 1.667 + D 67 65 3 68 3 0 0 31 50 -8.417 -0.227 -2.808 + IL 68 68 3 68 3 1 1 35 54 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 47 ] 49 - C - - - + ML 69 68 3 71 5 1 1 31 50 -7.593 -0.028 -7.408 -7.620 -8.512 -1.578 1.336 -2.466 -0.059 + D 70 68 3 71 5 0 0 30 49 -4.959 -0.803 -4.221 -2.596 -2.508 + IL 71 71 3 71 5 1 1 32 51 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000 + [ MATP 48 ] 50 66 C G - - + MP 72 71 3 76 6 2 2 30 49 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -4.063 -3.835 -3.975 1.367 -2.984 -4.641 3.137 -3.636 -3.945 0.196 -4.368 -1.641 0.814 -4.253 -0.622 -2.801 + ML 73 71 3 76 6 1 1 29 48 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 74 71 3 76 6 1 1 29 48 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 75 71 3 76 6 0 0 27 45 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 76 76 5 76 6 1 1 30 49 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 77 77 6 77 5 1 1 30 49 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 49 ] 51 65 g c - - + MP 78 77 6 82 6 2 2 28 47 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.269 -3.002 -3.316 0.607 -2.825 -4.080 1.486 -3.318 -3.360 2.123 -3.845 -0.940 1.986 -3.442 0.799 -2.268 + ML 79 77 6 82 6 1 1 27 46 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 80 77 6 82 6 1 1 27 46 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 81 77 6 82 6 0 0 25 44 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 82 82 5 82 6 1 1 28 47 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 83 83 6 83 5 1 1 28 47 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 50 ] 52 64 g c - - + MP 84 83 6 88 6 2 2 26 45 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.573 -3.001 -3.543 0.634 -3.168 -4.231 1.794 -3.603 -3.657 2.626 -4.078 -0.813 0.766 -3.618 0.675 -2.477 + ML 85 83 6 88 6 1 1 25 44 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 86 83 6 88 6 1 1 25 44 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 87 83 6 88 6 0 0 23 42 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 88 88 5 88 6 1 1 26 45 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 89 89 6 89 5 1 1 26 45 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 51 ] 53 63 g c - - + MP 90 89 6 94 6 2 2 24 43 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.680 -2.656 -3.624 1.495 -4.000 -4.305 0.538 -4.011 -3.825 2.937 -4.200 -0.344 1.037 -3.597 -1.457 -2.574 + ML 91 89 6 94 6 1 1 24 43 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 92 89 6 94 6 1 1 24 43 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 93 89 6 94 6 0 0 22 41 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 94 94 5 94 6 1 1 24 43 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 95 95 6 95 5 1 1 24 43 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 52 ] 54 62 G C - - + MP 96 95 6 100 4 2 2 22 41 -7.543 -7.750 -0.035 -6.164 -5.814 -3.622 -6.104 -0.561 -6.715 -5.090 -1.814 -6.360 -4.961 3.816 -5.237 -1.382 -2.178 -5.150 -3.925 -4.967 + ML 97 95 6 100 4 1 1 24 43 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 98 95 6 100 4 1 1 23 42 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 99 95 6 100 4 0 0 22 41 -4.568 -4.250 -2.265 -0.520 + IL 100 100 5 100 4 1 1 25 44 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 101 101 6 101 3 1 1 24 43 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 53 ] 55 - U - - - + ML 102 101 6 104 3 1 1 20 38 -8.524 -0.014 -7.178 -2.549 -2.369 -3.320 1.822 + D 103 101 6 104 3 0 0 19 38 -6.174 -1.687 -0.566 + IL 104 104 3 104 3 1 1 23 42 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 54 ] 56 - U - - - + ML 105 104 3 107 3 1 1 18 37 -8.524 -0.014 -7.178 -2.549 -2.369 -3.320 1.822 + D 106 104 3 107 3 0 0 18 37 -6.174 -1.687 -0.566 + IL 107 107 3 107 3 1 1 22 41 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 55 ] 57 - C - - - + ML 108 107 3 110 3 1 1 17 36 -8.524 -0.014 -7.178 -3.081 1.849 -3.880 -2.250 + D 109 107 3 110 3 0 0 17 35 -6.174 -1.687 -0.566 + IL 110 110 3 110 3 1 1 21 39 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 56 ] 58 - G - - - + ML 111 110 3 113 3 1 1 16 34 -8.524 -0.014 -7.178 -0.198 -2.380 1.409 -1.835 + D 112 110 3 113 3 0 0 16 34 -6.174 -1.687 -0.566 + IL 113 113 3 113 3 1 1 20 38 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 57 ] 59 - A - - - + ML 114 113 3 116 3 1 1 14 33 -8.524 -0.014 -7.178 1.878 -3.490 -3.019 -3.147 + D 115 113 3 116 3 0 0 15 33 -6.174 -1.687 -0.566 + IL 116 116 3 116 3 1 1 19 37 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 58 ] 60 - U - - - + ML 117 116 3 119 3 1 1 13 31 -8.524 -0.014 -7.178 -1.468 -0.407 -2.235 1.418 + D 118 116 3 119 3 0 0 13 32 -6.174 -1.687 -0.566 + IL 119 119 3 119 3 1 1 18 36 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 59 ] 61 - U - - - + ML 120 119 3 122 2 1 1 1 1 * 0.000 -1.239 0.314 -2.046 1.064 + D 121 119 3 122 2 0 0 0 0 * 0.000 + IL 122 122 3 122 2 1 1 13 28 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ END 60 ] - - - - - - + E 123 122 3 -1 0 0 0 0 0 + [ BEGL 12 ] - - - - - - + S 124 54 1 125 1 0 3 49 68 0.000 + [ BIF 13 ] - - - - - - + B 125 124 1 126 173 0 3 49 68 + [ BEGL 14 ] - - - - - - + S 126 125 1 127 4 0 0 30 48 -0.035 -7.164 -6.572 -7.212 + [ MATP 15 ] 10 26 G C - - + MP 127 126 1 131 6 2 2 30 48 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -4.768 -3.151 -4.805 0.251 -5.796 -4.949 -0.981 -5.231 -4.514 3.516 -4.857 0.895 -1.246 -4.551 -3.005 -3.683 + ML 128 126 1 131 6 1 1 28 47 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 129 126 1 131 6 1 1 28 47 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 130 126 1 131 6 0 0 26 45 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 131 131 5 131 6 1 1 29 48 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 132 132 6 132 5 1 1 29 48 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 16 ] 11 25 c g - - + MP 133 132 6 137 6 2 2 28 46 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -4.380 -4.331 -4.172 -0.461 -2.935 -4.679 2.953 -3.697 -4.172 -0.278 -4.524 -2.247 2.367 -4.479 -0.580 -2.998 + ML 134 132 6 137 6 1 1 27 45 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 135 132 6 137 6 1 1 26 45 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 136 132 6 137 6 0 0 24 43 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 137 137 5 137 6 1 1 27 46 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 138 138 6 138 5 1 1 27 46 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 17 ] 12 24 g c - - + MP 139 138 6 143 6 2 2 26 44 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.838 -2.993 -3.801 0.619 -3.635 -4.454 0.839 -3.930 -3.877 2.852 -4.281 -0.708 1.851 -3.845 -1.190 -2.710 + ML 140 138 6 143 6 1 1 25 44 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 141 138 6 143 6 1 1 25 44 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 142 138 6 143 6 0 0 24 42 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 143 143 5 143 6 1 1 26 44 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 144 144 6 144 5 1 1 25 44 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 18 ] 13 23 c g - - + MP 145 144 6 149 4 2 2 24 42 -7.543 -7.750 -0.035 -6.164 -3.454 -3.490 -3.467 0.042 -2.692 -4.152 2.807 -3.318 -3.483 0.166 -3.945 -1.653 0.946 -3.679 1.162 0.637 + ML 146 144 6 149 4 1 1 25 44 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 147 144 6 149 4 1 1 24 43 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 148 144 6 149 4 0 0 23 42 -4.568 -4.250 -2.265 -0.520 + IL 149 149 5 149 4 1 1 26 45 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 150 150 6 150 3 1 1 25 44 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 19 ] 14 - A - - - + ML 151 150 6 153 3 1 1 20 39 -8.524 -0.014 -7.178 1.878 -3.490 -3.019 -3.147 + D 152 150 6 153 3 0 0 20 39 -6.174 -1.687 -0.566 + IL 153 153 3 153 3 1 1 24 43 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 20 ] 15 - g - - - + ML 154 153 3 156 3 1 1 19 38 -8.524 -0.014 -7.178 0.586 -2.024 0.919 -1.466 + D 155 153 3 156 3 0 0 19 37 -6.174 -1.687 -0.566 + IL 156 156 3 156 3 1 1 23 42 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 21 ] 16 - U - - - + ML 157 156 3 159 3 1 1 18 36 -1.899 -0.464 -7.178 -1.468 -0.407 -2.235 1.418 + D 158 156 3 159 3 0 0 16 35 -6.174 -1.687 -0.566 + IL 159 159 3 159 3 1 1 18 36 -2.374 -0.363 -5.074 0.000 0.000 0.000 0.000 + [ MATL 22 ] 18 - G - - - + ML 160 159 3 162 3 1 1 16 34 -8.524 -0.014 -7.178 -2.700 -4.060 1.885 -3.430 + D 161 159 3 162 3 0 0 16 35 -6.174 -1.687 -0.566 + IL 162 162 3 162 3 1 1 20 39 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 23 ] 19 - G - - - + ML 163 162 3 165 3 1 1 14 33 -8.524 -0.014 -7.178 -2.700 -4.060 1.885 -3.430 + D 164 162 3 165 3 0 0 15 33 -6.174 -1.687 -0.566 + IL 165 165 3 165 3 1 1 19 38 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 24 ] 20 - u - - - + ML 166 165 3 168 3 1 1 11 23 -1.854 -0.481 -7.178 -0.664 -0.325 -0.613 0.939 + D 167 165 3 168 3 0 0 9 20 -6.174 -1.687 -0.566 + IL 168 168 3 168 3 1 1 11 22 -2.396 -0.357 -5.096 0.000 0.000 0.000 0.000 + [ MATL 25 ] 22 - A - - - + ML 169 168 3 171 2 1 1 1 1 * 0.000 1.878 -3.490 -3.019 -3.147 + D 170 168 3 171 2 0 0 0 0 * 0.000 + IL 171 171 3 171 2 1 1 13 28 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ END 26 ] - - - - - - + E 172 171 3 -1 0 0 0 0 0 + [ BEGR 27 ] - - - - - - + S 173 125 1 174 3 0 0 32 50 -8.524 -0.014 -7.178 + IL 174 174 2 174 3 1 1 35 54 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 28 ] 27 - g - - - + ML 175 174 2 177 5 1 1 31 50 -7.593 -0.028 -7.408 -7.620 -8.512 0.512 -2.047 0.983 -1.490 + D 176 174 2 177 5 0 0 30 49 -4.959 -0.803 -4.221 -2.596 -2.508 + IL 177 177 3 177 5 1 1 32 51 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000 + [ MATP 29 ] 28 44 c g - - + MP 178 177 3 182 6 2 2 30 49 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -2.996 -2.785 -3.094 0.747 -2.684 -3.890 2.204 -3.144 -3.118 1.704 -3.626 0.455 1.175 -3.212 0.643 -2.072 + ML 179 177 3 182 6 1 1 29 48 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 180 177 3 182 6 1 1 29 48 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 181 177 3 182 6 0 0 27 45 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 182 182 5 182 6 1 1 30 49 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 183 183 6 183 5 1 1 30 49 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 30 ] 29 43 c g - - + MP 184 183 6 188 6 2 2 28 47 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.660 -3.462 -3.663 0.355 -2.818 -4.407 2.681 -3.427 -3.639 1.512 -4.115 -1.306 1.763 -3.844 -0.432 -2.489 + ML 185 183 6 188 6 1 1 27 46 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 186 183 6 188 6 1 1 27 46 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 187 183 6 188 6 0 0 25 44 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 188 188 5 188 6 1 1 28 47 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 189 189 6 189 5 1 1 28 47 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 31 ] 30 42 a u - - + MP 190 189 6 194 6 2 2 26 45 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.311 -3.146 -3.360 2.221 -2.772 -4.127 2.025 -3.303 -3.378 0.846 -3.868 -1.127 1.693 -3.528 -0.491 -2.313 + ML 191 189 6 194 6 1 1 25 44 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 192 189 6 194 6 1 1 25 44 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 193 189 6 194 6 0 0 23 42 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 194 194 5 194 6 1 1 26 45 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 195 195 6 195 5 1 1 26 45 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 32 ] 31 41 g c - - + MP 196 195 6 200 6 2 2 24 43 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.453 -2.737 -3.468 0.855 -3.398 -4.215 1.983 -3.656 -3.568 2.448 -4.006 0.791 0.648 -3.520 -0.989 -2.403 + ML 197 195 6 200 6 1 1 24 43 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 198 195 6 200 6 1 1 24 43 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 199 195 6 200 6 0 0 22 41 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 200 200 5 200 6 1 1 24 43 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 201 201 6 201 5 1 1 24 43 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 33 ] 32 40 c g - - + MP 202 201 6 206 4 2 2 22 41 -7.543 -7.750 -0.035 -6.164 -3.332 -2.890 -3.380 1.837 -3.037 -4.188 2.208 -3.435 -3.424 1.867 -3.910 -0.719 0.913 -3.503 -0.696 -2.309 + ML 203 201 6 206 4 1 1 24 43 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 204 201 6 206 4 1 1 23 42 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 205 201 6 206 4 0 0 22 41 -4.568 -4.250 -2.265 -0.520 + IL 206 206 5 206 4 1 1 25 44 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 207 207 6 207 3 1 1 24 43 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 34 ] 33 - c - - - + ML 208 207 6 210 3 1 1 20 38 -8.524 -0.014 -7.178 -1.256 0.893 -2.113 0.579 + D 209 207 6 210 3 0 0 19 38 -6.174 -1.687 -0.566 + IL 210 210 3 210 3 1 1 23 42 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 35 ] 34 - U - - - + ML 211 210 3 213 3 1 1 18 37 -8.524 -0.014 -7.178 -2.549 -2.369 -3.320 1.822 + D 212 210 3 213 3 0 0 18 37 -6.174 -1.687 -0.566 + IL 213 213 3 213 3 1 1 22 41 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 36 ] 35 - g - - - + ML 214 213 3 216 3 1 1 17 36 -8.524 -0.014 -7.178 -0.763 -1.427 0.837 0.325 + D 215 213 3 216 3 0 0 17 35 -6.174 -1.687 -0.566 + IL 216 216 3 216 3 1 1 21 39 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 37 ] 36 - u - - - + ML 217 216 3 219 3 1 1 16 34 -8.524 -0.014 -7.178 0.037 -0.330 -0.381 0.496 + D 218 216 3 219 3 0 0 16 34 -6.174 -1.687 -0.566 + IL 219 219 3 219 3 1 1 20 38 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 38 ] 37 - c - - - + ML 220 219 3 222 3 1 1 14 33 -8.524 -0.014 -7.178 0.403 0.783 -1.648 -0.649 + D 221 219 3 222 3 0 0 15 33 -6.174 -1.687 -0.566 + IL 222 222 3 222 3 1 1 19 37 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 39 ] 38 - A - - - + ML 223 222 3 225 3 1 1 13 31 -8.524 -0.014 -7.178 1.037 -1.963 0.397 -1.419 + D 224 222 3 225 3 0 0 13 32 -6.174 -1.687 -0.566 + IL 225 225 3 225 3 1 1 18 36 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 40 ] 39 - a - - - + ML 226 225 3 228 2 1 1 1 1 * 0.000 0.957 0.166 -1.522 -0.764 + D 227 225 3 228 2 0 0 0 0 * 0.000 + IL 228 228 3 228 2 1 1 13 28 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ END 41 ] - - - - - - + E 229 228 3 -1 0 0 0 0 0 +// +HMMER3/f [i1.1.1 | July 2014] +NAME tRNA5 +LENG 72 +MAXL 152 +ALPH RNA +RF no +MM no +CONS yes +CS yes +MAP yes +DATE Mon Jun 27 12:35:45 2016 +COM [1] ./src/cmbuild tRNA5.cm tutorial/tRNA5.sto +NSEQ 5 +EFFN 4.575195 +CKSUM 3535941971 +STATS LOCAL MSV -8.3361 0.72958 +STATS LOCAL VITERBI -9.7423 0.72958 +STATS LOCAL FORWARD -2.8398 0.72958 +HMM A C G U + m->m m->i m->d i->m i->i d->m d->d + COMPO 1.54533 1.43782 1.21668 1.37396 + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 0.00000 * + 1 2.27104 2.21243 0.67362 1.28194 1 G - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 2 2.71979 0.53764 1.58904 1.92505 2 C - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 3 2.13247 1.12928 1.19870 1.36023 3 c - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 4 2.06386 1.33928 0.73468 2.02995 4 g - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 5 1.11916 2.01343 1.13651 1.51879 5 a - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 6 2.27600 1.26221 1.56184 0.90503 6 u - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 7 0.55854 2.34742 2.06069 1.58488 7 A - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 8 3.41131 3.24840 3.95063 0.09549 8 U - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 9 0.62589 2.93067 1.09257 2.57049 9 A - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 10 2.58478 3.48701 0.15236 3.34349 10 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 11 3.04360 0.66824 2.81745 0.96766 11 C - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 12 2.27167 2.22390 0.66329 1.29638 12 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 13 2.70763 0.72972 2.52177 0.99171 13 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 14 0.06447 4.06946 3.72356 3.85378 14 A - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 15 0.96309 2.96228 0.71023 2.58952 15 g - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 16 2.58013 1.68600 3.11568 0.36438 16 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.36284 1.23646 4.27667 0.09305 2.42079 1.09861 0.40547 + 17 3.50204 4.46790 0.06149 4.01568 18 G - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 18 3.50204 4.46790 0.06149 4.01568 19 G - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 19 1.92921 1.61736 1.81487 0.70632 20 u - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.37560 1.20654 4.27667 0.09038 2.44862 1.09861 0.40547 + 20 0.06447 4.06946 3.72356 3.85378 22 A - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 21 2.10278 2.68978 0.46988 1.68787 23 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 22 1.38592 0.72007 2.05285 2.00384 24 c - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 23 1.05742 2.98038 0.61496 2.79344 25 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 24 3.52889 0.29960 3.29055 1.64863 26 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 25 1.01810 2.97712 0.66580 2.60482 27 G - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 26 2.11085 1.15042 1.18985 1.35443 28 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 27 2.42824 0.83921 1.56647 1.30573 29 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 28 1.09889 1.29935 2.02826 1.33756 30 a - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 29 2.06898 1.31812 0.74979 2.01303 31 g - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 30 1.36950 1.15928 1.31013 1.81850 32 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 31 2.40938 0.72219 3.02139 0.97894 33 c - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 32 3.41131 3.24840 3.95063 0.09549 34 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 33 2.03026 2.49922 0.75131 1.15581 35 g - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 34 1.37091 1.61913 1.64530 1.03536 36 u - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 35 1.09596 0.79030 2.66885 1.94670 37 c - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 36 0.63350 2.92991 1.08102 2.56892 38 A - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 37 0.68448 1.23998 2.57183 2.04128 39 A - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 38 2.05098 1.42195 1.06925 1.24869 40 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 39 2.25157 1.00742 1.23141 1.43664 41 c - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 40 1.49091 2.19537 1.18474 1.02809 42 u - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 41 1.46309 1.66242 0.76188 2.18914 43 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 42 1.84429 1.51321 0.88732 1.56112 44 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 43 0.38710 2.63412 2.69028 1.70743 45 A - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 44 3.50204 4.46790 0.06149 4.01568 46 G - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 45 0.96309 2.96228 0.71023 2.58952 47 g - - , + 1.38629 1.38629 1.38629 1.38629 + 0.37560 4.27667 1.20654 1.46634 0.26236 1.09861 0.40547 + 46 2.76487 2.70273 3.28806 0.18312 48 U - - , + 1.38629 1.38629 1.38629 1.38629 + 0.03964 3.94071 3.94071 1.46634 0.26236 0.08877 2.46575 + 47 2.65665 0.41541 3.29031 1.45884 49 C - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 48 1.72807 0.51473 2.49712 1.94920 50 C - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 49 2.23405 1.71156 1.13675 0.93787 51 u - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 50 2.24174 1.47214 0.80734 1.52210 52 g - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 51 1.62002 2.40165 0.60094 1.81254 53 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 52 3.13623 4.03650 0.08313 3.98115 54 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 53 3.41131 3.24840 3.95063 0.09549 55 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 54 3.41131 3.24840 3.95063 0.09549 56 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 55 3.81775 0.07857 4.34279 3.20425 57 C - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 56 1.55092 3.20619 0.37228 2.84263 58 G - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 57 0.06447 4.06946 3.72356 3.85378 59 A - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 58 2.58013 1.68600 3.11568 0.36438 60 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 59 2.39994 1.14144 2.97016 0.61874 61 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 60 4.11656 0.10126 3.89068 2.82057 62 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 61 1.95700 0.67131 2.21870 1.43159 63 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 62 2.18076 0.86710 1.10730 1.99196 64 c - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 63 1.27825 1.21396 1.24116 1.99945 65 c - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 64 2.19639 2.68263 0.47103 1.62938 66 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 65 1.68678 2.30864 2.17351 0.50798 67 U - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 66 1.21618 1.66846 0.95030 2.05201 68 g - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 67 2.09329 1.05549 1.48837 1.19416 69 c - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 68 2.26917 0.96322 1.25225 1.47369 70 c - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 69 1.53154 1.55221 1.02428 1.54664 71 g - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 70 2.18028 1.66521 0.48878 2.47139 72 G - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 71 1.37162 0.72882 2.04389 2.00766 73 c - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 72 1.04988 2.29119 1.14633 1.46503 74 a - - : + 1.38629 1.38629 1.38629 1.38629 + 0.01418 4.26268 * 1.46634 0.26236 0.00000 * +//
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmalign_input_mrum_tRNAs10.fa Sat Jan 21 17:36:57 2017 -0500 @@ -0,0 +1,30 @@ +>mrum-tRNA.1 +GGAGCUAUAGCUCAAUGGCAGAGCGUUUGGCUGACAUCCAAAAGGUUAUGGGUUCGAUUC +CCUUUAGCCCCA +>mrum-tRNA.2 +GGGCCCGUAGCUCAGUUGGGAGAGCGCUGCCCUUGCAAGGCAGAGGCCCCGGGUUCAAAU +CCCGGUGGGUCCA +>mrum-tRNA.3 +GGGCCCAUAGCUUAGCCAGGUAGAGCGCUCGGCUCAUAACCGGGAUGUCAUGGGUUCGAA +UCCCAUUGGGCCCA +>mrum-tRNA.4 +AGGCUAGUGGCACAGCCUGGUCAGCGCGCACGGCUGAUAACCGUGAGGUCCUGGGUUCGA +AUCCCAGCUAGCCUA +>mrum-tRNA.5 +CCCGACUUAGCUCAAUUUGGCAGAGCGUUGGACUGUAGAUCCAAAUGUUGCUGGUUCAAG +UCCGGCAGUCGGGA +>mrum-tRNA.6 +GCUUCUAUGGGGUAAUCGGCAAACCCAUCGGACUUUCGAUCCGAUAAUCCGGGUUCAAAU +CCCGGUAGAAGCA +>mrum-tRNA.7 +GCUCCGAUGGUGUAGUCCGGCCAAUCAUUUCGGCCUUUCGAGCCGAAGACUCGGGUUCGA +AUCCCGGUCGGAGCA +>mrum-tRNA.8 +GCGGUGUUAGUCCAGCCUGGUUAAGACUCUAGCCUGCCACGUUAGAGACCCGGGUUCAAA +UCCCGGACGCCGCA +>mrum-tRNA.9 +GCCGGGGUGGCUCAGCUGGUUAGAGCGCACGGCUCAUAGGGUAACUAAGCGUGCUCUGAC +UUUUUUCCUGGGAUACCGUGAGAUCGCGGGUUCGAAUCCCGCCCCCGGCA +>mrum-tRNA.10 +GGUUCUAUAGUUUAACAGGUAAAACAACUGGCUGUUAACCGGCAGAUAGGAGUUCGAAUC +UUCUUAGAACCG
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmalign_result_mrum-tRNAs10.out Sat Jan 21 17:36:57 2017 -0500 @@ -0,0 +1,26 @@ +# STOCKHOLM 1.0 +#=GF AU Infernal 1.1 + +mrum-tRNA.1 GGAGCUAUAGCUCAAU..GGC..AGAGCGUUUGGCUGACAU........................................CCAAAAGGUUAUGGGUUCGAUUCCCUUUAGCCCCA +#=GR mrum-tRNA.1 PP ****************..***..******************........................................*********************************** +mrum-tRNA.2 GGGCCCGUAGCUCAGU.uGGG..AGAGCGCUGCCCUUGCAA........................................GGCAGAGGCCCCGGGUUCAAAUCCCGGUGGGUCCA +#=GR mrum-tRNA.2 PP ****************.****..******************........................................*********************************** +mrum-tRNA.3 GGGCCCAUAGCUUAGCcaGGU..AGAGCGCUCGGCUCAUAA........................................CCGGGAUGUCAUGGGUUCGAAUCCCAUUGGGCCCA +#=GR mrum-tRNA.3 PP *********************..******************........................................*********************************** +mrum-tRNA.4 AGGCUAGUGGCACAGCcuGGU.cAGCGCGCACGGCUGAUAA........................................CCGUGAGGUCCUGGGUUCGAAUCCCAGCUAGCCUA +#=GR mrum-tRNA.4 PP ***************999***.*******************........................................*********************************** +mrum-tRNA.5 CCCGACUUAGCUCAAUuuGGC..AGAGCGUUGGACUGUAGA........................................UCCAAAUGUUGCUGGUUCAAGUCCGGCAGUCGGGA +#=GR mrum-tRNA.5 PP *********************..******************........................................*********************************** +mrum-tRNA.6 GCUUCUAUGGGGUAAU.cGGC.aAACCCAUCGGACUUUCGA........................................UCCGAUAA-UCCGGGUUCAAAUCCCGGUAGAAGCA +#=GR mrum-tRNA.6 PP ****************.****.*******************........................................********.9************************* +mrum-tRNA.7 GCUCCGAUGGUGUAGUccGGCcaAUCAUUUCGGCCUUUCGA........................................GCCGAAGA-CUCGGGUUCGAAUCCCGGUCGGAGCA +#=GR mrum-tRNA.7 PP ********************9999*****************........................................********.************************** +mrum-tRNA.8 GCGGUGUUAGUCCAGCcuGGU.uAAGACUCUAGCCUGCCAC........................................GUUAGAGA-CCCGGGUUCAAAUCCCGGACGCCGCA +#=GR mrum-tRNA.8 PP ***************999***.*******************........................................********.************************** +mrum-tRNA.9 GCCGGGGUGGCUCAGC.uGGU.uAGAGCGCACGGCUC----auaggguaacuaagcgugcucugacuuuuuuccugggauaCCGUGAGAUCGCGGGUUCGAAUCCCGCCCCCGGCA +#=GR mrum-tRNA.9 PP ****************.****.************995....678************************************************************************ +mrum-tRNA.10 GGUUCUAUAGUUUAAC.aGGU..AAAACAACUGGCUGUUAA........................................CCGGCAGA-UAGGAGUUCGAAUCUUCUUAGAACCG +#=GR mrum-tRNA.10 PP ****************.****..******************........................................********.9************************* +#=GC SS_cons (((((((,,<<<<___..___.._>>>>,<<<<<_______~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~>>>>>,,,,,<<<<<_______>>>>>))))))): +#=GC RF gCcggcAUAGcgcAgU..GGu..AgcgCgccagccUgucAa~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~gcuggAGgUCCgggGUUCGAUUCcccGUgccgGca +//
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmalignoutput Sat Jan 21 17:36:57 2017 -0500 @@ -0,0 +1,26 @@ +# STOCKHOLM 1.0 +#=GF AU Infernal 1.1.2 + +mrum-tRNA.1 GGAGCUAUAGCUCAAU..GGC..AGAGCGUUUGGCUGACAU........................................CCAAAAGGUUAUGGGUUCGAUUCCCUUUAGCCCCA +#=GR mrum-tRNA.1 PP ****************..***..******************........................................*********************************** +mrum-tRNA.2 GGGCCCGUAGCUCAGU.uGGG..AGAGCGCUGCCCUUGCAA........................................GGCAGAGGCCCCGGGUUCAAAUCCCGGUGGGUCCA +#=GR mrum-tRNA.2 PP ****************.****..******************........................................*********************************** +mrum-tRNA.3 GGGCCCAUAGCUUAGCcaGGU..AGAGCGCUCGGCUCAUAA........................................CCGGGAUGUCAUGGGUUCGAAUCCCAUUGGGCCCA +#=GR mrum-tRNA.3 PP *********************..******************........................................*********************************** +mrum-tRNA.4 AGGCUAGUGGCACAGCcuGGU.cAGCGCGCACGGCUGAUAA........................................CCGUGAGGUCCUGGGUUCGAAUCCCAGCUAGCCUA +#=GR mrum-tRNA.4 PP ***************999***.*******************........................................*********************************** +mrum-tRNA.5 CCCGACUUAGCUCAAUuuGGC..AGAGCGUUGGACUGUAGA........................................UCCAAAUGUUGCUGGUUCAAGUCCGGCAGUCGGGA +#=GR mrum-tRNA.5 PP *********************..******************........................................*********************************** +mrum-tRNA.6 GCUUCUAUGGGGUAAU.cGGC.aAACCCAUCGGACUUUCGA........................................UCCGAUAA-UCCGGGUUCAAAUCCCGGUAGAAGCA +#=GR mrum-tRNA.6 PP ****************.****.*******************........................................********.9************************* +mrum-tRNA.7 GCUCCGAUGGUGUAGUccGGCcaAUCAUUUCGGCCUUUCGA........................................GCCGAAGA-CUCGGGUUCGAAUCCCGGUCGGAGCA +#=GR mrum-tRNA.7 PP ********************9999*****************........................................********.************************** +mrum-tRNA.8 GCGGUGUUAGUCCAGCcuGGU.uAAGACUCUAGCCUGCCAC........................................GUUAGAGA-CCCGGGUUCAAAUCCCGGACGCCGCA +#=GR mrum-tRNA.8 PP ***************999***.*******************........................................********.************************** +mrum-tRNA.9 GCCGGGGUGGCUCAGC.uGGU.uAGAGCGCACGGCUC----auaggguaacuaagcgugcucugacuuuuuuccugggauaCCGUGAGAUCGCGGGUUCGAAUCCCGCCCCCGGCA +#=GR mrum-tRNA.9 PP ****************.****.************995....678************************************************************************ +mrum-tRNA.10 GGUUCUAUAGUUUAAC.aGGU..AAAACAACUGGCUGUUAA........................................CCGGCAGA-UAGGAGUUCGAAUCUUCUUAGAACCG +#=GR mrum-tRNA.10 PP ****************.****..******************........................................********.9************************* +#=GC SS_cons (((((((,,<<<<___..___.._>>>>,<<<<<_______~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~>>>>>,,,,,<<<<<_______>>>>>))))))): +#=GC RF gCcggcAUAGcgcAgU..GGu..AgcgCgccagccUgucAa~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~gcuggAGgUCCgggGUUCGAUUCcccGUgccgGca +//
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmbuild_input_tRNA5.sto Sat Jan 21 17:36:57 2017 -0500 @@ -0,0 +1,16 @@ +# STOCKHOLM 1.0 + +tRNA1 GCGGAUUUAGCUCAGUUGGG.AGAGCGCCAGACUGAAGAUCUGGAGGUCC +tRNA2 UCCGAUAUAGUGUAAC.GGCUAUCACAUCACGCUUUCACCGUGGAGA.CC +tRNA3 UCCGUGAUAGUUUAAU.GGUCAGAAUGGGCGCUUGUCGCGUGCCAGA.UC +tRNA4 GCUCGUAUGGCGCAGU.GGU.AGCGCAGCAGAUUGCAAAUCUGUUGGUCC +tRNA5 GGGCACAUGGCGCAGUUGGU.AGCGCGCUUCCCUUGCAAGGAAGAGGUCA +#=GC SS_cons <<<<<<<..<<<<.........>>>>.<<<<<.......>>>>>.....< + +tRNA1 UGUGUUCGAUCCACAGAAUUCGCA +tRNA2 GGGGUUCGACUCCCCGUAUCGGAG +tRNA3 GGGGUUCAAUUCCCCGUCGCGGAG +tRNA4 UUAGUUCGAUCCUGAGUGCGAGCU +tRNA5 UCGGUUCGAUUCCGGUUGCGUCCA +#=GC SS_cons <<<<.......>>>>>>>>>>>>. +//
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmbuild_results.cm Sat Jan 21 17:36:57 2017 -0500 @@ -0,0 +1,558 @@ +INFERNAL1/a [1.1.2 | July 2016] +NAME dataset_743 +STATES 230 +NODES 61 +CLEN 72 +W 89 +ALPH RNA +RF no +CONS yes +MAP yes +DATE Wed Nov 2 15:35:29 2016 +COM [1] cmbuild -F --fast --symfrac 0.5 --wpb --p7ere 0.38 --EmN 200 --EvN 200 --ElfN 200 --EgfN 200 --eent --refine /dev/null /home/wanli/galaxy/database/files/000/dataset_750.dat /home/wanli/galaxy/database/files/000/dataset_743.dat +PBEGIN 0.05 +PEND 0.05 +WBETA 1e-07 +QDBBETA1 1e-07 +QDBBETA2 1e-15 +N2OMEGA 1.52588e-05 +N3OMEGA 1.52588e-05 +ELSELF -0.08926734 +NSEQ 5 +EFFN 3.725586 +CKSUM 3535941971 +NULL 0.000 0.000 0.000 0.000 +EFP7GF -5.5288 0.72958 +CM + [ ROOT 0 ] - - - - - - + S 0 -1 0 1 4 0 1 89 108 -7.419 -8.664 -0.055 -5.118 + IL 1 1 2 1 4 3 28 90 110 -2.817 -4.319 -0.613 -2.698 0.000 0.000 0.000 0.000 + IR 2 2 3 2 3 4 30 90 110 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 1 ] - 74 - a - - + MR 3 2 3 5 5 4 32 89 108 -7.593 -0.028 -7.408 -7.620 -8.512 0.474 -1.199 0.305 -0.089 + D 4 2 3 5 5 1 24 87 107 -5.352 -0.707 -2.978 -4.409 -2.404 + IR 5 5 3 5 5 3 28 89 109 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 2 ] 1 73 g c - - + MP 6 5 3 10 6 5 32 88 107 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.831 -2.997 -3.795 0.617 -3.618 -4.452 0.854 -3.918 -3.870 2.837 -4.276 -0.713 1.871 -3.843 -1.175 -2.703 + ML 7 5 3 10 6 3 26 86 106 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 8 5 3 10 6 3 25 86 106 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 9 5 3 10 6 0 21 84 103 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 10 10 5 10 6 3 27 87 107 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 11 11 6 11 5 3 27 87 107 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 3 ] 2 72 C G - - + MP 12 11 6 16 6 5 31 86 105 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -4.097 -3.805 -3.998 0.021 -3.009 -4.646 3.103 -3.661 -3.977 1.529 -4.392 -1.585 0.835 -4.247 -0.625 -2.808 + ML 13 11 6 16 6 2 25 84 104 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 14 11 6 16 6 2 25 84 104 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 15 11 6 16 6 0 21 82 101 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 16 16 5 16 6 3 27 85 105 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 17 17 6 17 5 3 27 85 105 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 4 ] 3 71 c g - - + MP 18 17 6 22 6 5 29 84 103 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.141 -2.880 -3.222 0.733 -2.762 -4.023 2.237 -3.232 -3.242 1.678 -3.747 0.537 1.616 -3.340 -0.447 -2.158 + ML 19 17 6 22 6 2 25 82 102 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 20 17 6 22 6 2 24 82 102 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 21 17 6 22 6 0 20 80 99 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 22 22 5 22 6 3 26 83 103 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 23 23 6 23 5 3 26 83 103 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 5 ] 4 70 g c - - + MP 24 23 6 28 6 5 28 82 101 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.477 -2.737 -3.484 0.861 -3.437 -4.224 1.956 -3.685 -3.594 2.509 -4.028 0.683 0.624 -3.528 -1.017 -2.419 + ML 25 23 6 28 6 2 24 80 100 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 26 23 6 28 6 2 24 80 100 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 27 23 6 28 6 0 20 78 97 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 28 28 5 28 6 3 25 81 101 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 29 29 6 29 5 3 25 81 101 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 6 ] 5 69 g c - - + MP 30 29 6 34 6 5 26 80 99 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -2.565 0.048 -2.684 1.825 -2.755 -3.485 0.996 -3.019 -2.788 2.050 -3.293 -0.374 0.757 -2.774 0.549 -1.819 + ML 31 29 6 34 6 2 23 78 98 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 32 29 6 34 6 2 23 78 98 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 33 29 6 34 6 0 19 76 96 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 34 34 5 34 6 2 24 79 99 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 35 35 6 35 5 3 24 79 99 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 7 ] 6 68 c g - - + MP 36 35 6 40 6 5 24 78 97 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.250 -3.161 -3.321 0.517 -2.657 -4.117 2.088 -3.215 -3.310 1.474 -3.823 -1.143 2.088 -3.483 0.783 -2.234 + ML 37 35 6 40 6 2 22 77 97 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 38 35 6 40 6 2 21 77 96 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 39 35 6 40 6 0 19 75 95 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 40 40 5 40 6 2 23 77 97 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 41 41 6 41 5 2 23 77 97 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 8 ] 7 67 A U - - + MP 42 41 6 46 4 4 22 76 95 -7.543 -7.750 -0.035 -6.164 -3.769 -3.134 -3.802 3.011 -3.544 -4.775 0.728 -3.793 -3.752 0.821 -4.250 -0.784 1.443 -4.133 -1.238 -2.690 + ML 43 41 6 46 4 1 21 76 96 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 44 41 6 46 4 1 20 76 96 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 45 41 6 46 4 0 19 74 94 -4.568 -4.250 -2.265 -0.520 + IL 46 46 5 46 4 2 22 77 97 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 47 47 6 47 3 2 21 76 96 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 9 ] 8 - U - - - + ML 48 47 6 50 3 2 20 73 93 -8.524 -0.014 -7.178 -2.549 -2.369 -3.320 1.822 + D 49 47 6 50 3 0 18 72 92 -6.174 -1.687 -0.566 + IL 50 50 3 50 3 2 20 75 95 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 10 ] 9 - A - - - + ML 51 50 3 53 2 1 19 72 92 -9.006 -0.003 1.048 -1.964 0.381 -1.421 + D 52 50 3 53 2 0 18 71 91 -8.445 -0.004 + IL 53 53 3 53 2 1 19 73 93 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ BIF 11 ] - - - - - - + B 54 53 3 124 55 0 18 71 91 + [ BEGR 42 ] - - - - - - + S 55 54 1 56 3 0 0 36 55 -8.524 -0.014 -7.178 + IL 56 56 2 56 3 1 1 39 59 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 43 ] 45 - A - - - + ML 57 56 2 59 3 1 1 36 55 -8.524 -0.014 -7.178 1.385 -1.618 -1.684 -0.412 + D 58 56 2 59 3 0 0 35 54 -6.174 -1.687 -0.566 + IL 59 59 3 59 3 1 1 38 57 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 44 ] 46 - G - - - + ML 60 59 3 62 3 1 1 35 54 -8.524 -0.014 -7.178 -2.700 -4.060 1.885 -3.430 + D 61 59 3 62 3 0 0 34 53 -6.174 -1.687 -0.566 + IL 62 62 3 62 3 1 1 37 56 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 45 ] 47 - g - - - + ML 63 62 3 65 3 1 1 34 52 -8.524 -0.481 -1.832 0.586 -2.024 0.919 -1.466 + D 64 62 3 65 3 0 0 33 52 -6.174 -1.687 -0.566 + IL 65 65 3 65 3 1 1 36 55 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 46 ] 48 - U - - - + ML 66 65 3 68 3 1 1 33 51 -8.062 -0.019 -6.716 -1.668 -1.633 -2.411 1.667 + D 67 65 3 68 3 0 0 31 50 -8.417 -0.227 -2.808 + IL 68 68 3 68 3 1 1 35 54 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 47 ] 49 - C - - - + ML 69 68 3 71 5 1 1 31 50 -7.593 -0.028 -7.408 -7.620 -8.512 -1.578 1.336 -2.466 -0.059 + D 70 68 3 71 5 0 0 30 49 -4.959 -0.803 -4.221 -2.596 -2.508 + IL 71 71 3 71 5 1 1 32 51 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000 + [ MATP 48 ] 50 66 C G - - + MP 72 71 3 76 6 2 2 30 49 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -4.063 -3.835 -3.975 1.367 -2.984 -4.641 3.137 -3.636 -3.945 0.196 -4.368 -1.641 0.814 -4.253 -0.622 -2.801 + ML 73 71 3 76 6 1 1 29 48 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 74 71 3 76 6 1 1 29 48 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 75 71 3 76 6 0 0 27 45 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 76 76 5 76 6 1 1 30 49 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 77 77 6 77 5 1 1 30 49 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 49 ] 51 65 g c - - + MP 78 77 6 82 6 2 2 28 47 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.269 -3.002 -3.316 0.607 -2.825 -4.080 1.486 -3.318 -3.360 2.123 -3.845 -0.940 1.986 -3.442 0.799 -2.268 + ML 79 77 6 82 6 1 1 27 46 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 80 77 6 82 6 1 1 27 46 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 81 77 6 82 6 0 0 25 44 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 82 82 5 82 6 1 1 28 47 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 83 83 6 83 5 1 1 28 47 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 50 ] 52 64 g c - - + MP 84 83 6 88 6 2 2 26 45 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.573 -3.001 -3.543 0.634 -3.168 -4.231 1.794 -3.603 -3.657 2.626 -4.078 -0.813 0.766 -3.618 0.675 -2.477 + ML 85 83 6 88 6 1 1 25 44 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 86 83 6 88 6 1 1 25 44 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 87 83 6 88 6 0 0 23 42 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 88 88 5 88 6 1 1 26 45 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 89 89 6 89 5 1 1 26 45 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 51 ] 53 63 g c - - + MP 90 89 6 94 6 2 2 24 43 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.680 -2.656 -3.624 1.495 -4.000 -4.305 0.538 -4.011 -3.825 2.937 -4.200 -0.344 1.037 -3.597 -1.457 -2.574 + ML 91 89 6 94 6 1 1 24 43 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 92 89 6 94 6 1 1 24 43 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 93 89 6 94 6 0 0 22 41 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 94 94 5 94 6 1 1 24 43 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 95 95 6 95 5 1 1 24 43 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 52 ] 54 62 G C - - + MP 96 95 6 100 4 2 2 22 41 -7.543 -7.750 -0.035 -6.164 -5.814 -3.622 -6.104 -0.561 -6.715 -5.090 -1.814 -6.360 -4.961 3.816 -5.237 -1.382 -2.178 -5.150 -3.925 -4.967 + ML 97 95 6 100 4 1 1 24 43 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 98 95 6 100 4 1 1 23 42 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 99 95 6 100 4 0 0 22 41 -4.568 -4.250 -2.265 -0.520 + IL 100 100 5 100 4 1 1 25 44 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 101 101 6 101 3 1 1 24 43 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 53 ] 55 - U - - - + ML 102 101 6 104 3 1 1 20 38 -8.524 -0.014 -7.178 -2.549 -2.369 -3.320 1.822 + D 103 101 6 104 3 0 0 19 38 -6.174 -1.687 -0.566 + IL 104 104 3 104 3 1 1 23 42 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 54 ] 56 - U - - - + ML 105 104 3 107 3 1 1 18 37 -8.524 -0.014 -7.178 -2.549 -2.369 -3.320 1.822 + D 106 104 3 107 3 0 0 18 37 -6.174 -1.687 -0.566 + IL 107 107 3 107 3 1 1 22 41 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 55 ] 57 - C - - - + ML 108 107 3 110 3 1 1 17 36 -8.524 -0.014 -7.178 -3.081 1.849 -3.880 -2.250 + D 109 107 3 110 3 0 0 17 35 -6.174 -1.687 -0.566 + IL 110 110 3 110 3 1 1 21 39 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 56 ] 58 - G - - - + ML 111 110 3 113 3 1 1 16 34 -8.524 -0.014 -7.178 -0.198 -2.380 1.409 -1.835 + D 112 110 3 113 3 0 0 16 34 -6.174 -1.687 -0.566 + IL 113 113 3 113 3 1 1 20 38 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 57 ] 59 - A - - - + ML 114 113 3 116 3 1 1 14 33 -8.524 -0.014 -7.178 1.878 -3.490 -3.019 -3.147 + D 115 113 3 116 3 0 0 15 33 -6.174 -1.687 -0.566 + IL 116 116 3 116 3 1 1 19 37 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 58 ] 60 - U - - - + ML 117 116 3 119 3 1 1 13 31 -8.524 -0.014 -7.178 -1.468 -0.407 -2.235 1.418 + D 118 116 3 119 3 0 0 13 32 -6.174 -1.687 -0.566 + IL 119 119 3 119 3 1 1 18 36 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 59 ] 61 - U - - - + ML 120 119 3 122 2 1 1 1 1 * 0.000 -1.239 0.314 -2.046 1.064 + D 121 119 3 122 2 0 0 0 0 * 0.000 + IL 122 122 3 122 2 1 1 13 28 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ END 60 ] - - - - - - + E 123 122 3 -1 0 0 0 0 0 + [ BEGL 12 ] - - - - - - + S 124 54 1 125 1 0 3 49 68 0.000 + [ BIF 13 ] - - - - - - + B 125 124 1 126 173 0 3 49 68 + [ BEGL 14 ] - - - - - - + S 126 125 1 127 4 0 0 30 48 -0.035 -7.164 -6.572 -7.212 + [ MATP 15 ] 10 26 G C - - + MP 127 126 1 131 6 2 2 30 48 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -4.768 -3.151 -4.805 0.251 -5.796 -4.949 -0.981 -5.231 -4.514 3.516 -4.857 0.895 -1.246 -4.551 -3.005 -3.683 + ML 128 126 1 131 6 1 1 28 47 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 129 126 1 131 6 1 1 28 47 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 130 126 1 131 6 0 0 26 45 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 131 131 5 131 6 1 1 29 48 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 132 132 6 132 5 1 1 29 48 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 16 ] 11 25 c g - - + MP 133 132 6 137 6 2 2 28 46 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -4.380 -4.331 -4.172 -0.461 -2.935 -4.679 2.953 -3.697 -4.172 -0.278 -4.524 -2.247 2.367 -4.479 -0.580 -2.998 + ML 134 132 6 137 6 1 1 27 45 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 135 132 6 137 6 1 1 26 45 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 136 132 6 137 6 0 0 24 43 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 137 137 5 137 6 1 1 27 46 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 138 138 6 138 5 1 1 27 46 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 17 ] 12 24 g c - - + MP 139 138 6 143 6 2 2 26 44 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.838 -2.993 -3.801 0.619 -3.635 -4.454 0.839 -3.930 -3.877 2.852 -4.281 -0.708 1.851 -3.845 -1.190 -2.710 + ML 140 138 6 143 6 1 1 25 44 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 141 138 6 143 6 1 1 25 44 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 142 138 6 143 6 0 0 24 42 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 143 143 5 143 6 1 1 26 44 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 144 144 6 144 5 1 1 25 44 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 18 ] 13 23 c g - - + MP 145 144 6 149 4 2 2 24 42 -7.543 -7.750 -0.035 -6.164 -3.454 -3.490 -3.467 0.042 -2.692 -4.152 2.807 -3.318 -3.483 0.166 -3.945 -1.653 0.946 -3.679 1.162 0.637 + ML 146 144 6 149 4 1 1 25 44 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 147 144 6 149 4 1 1 24 43 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 148 144 6 149 4 0 0 23 42 -4.568 -4.250 -2.265 -0.520 + IL 149 149 5 149 4 1 1 26 45 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 150 150 6 150 3 1 1 25 44 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 19 ] 14 - A - - - + ML 151 150 6 153 3 1 1 20 39 -8.524 -0.014 -7.178 1.878 -3.490 -3.019 -3.147 + D 152 150 6 153 3 0 0 20 39 -6.174 -1.687 -0.566 + IL 153 153 3 153 3 1 1 24 43 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 20 ] 15 - g - - - + ML 154 153 3 156 3 1 1 19 38 -8.524 -0.014 -7.178 0.586 -2.024 0.919 -1.466 + D 155 153 3 156 3 0 0 19 37 -6.174 -1.687 -0.566 + IL 156 156 3 156 3 1 1 23 42 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 21 ] 16 - U - - - + ML 157 156 3 159 3 1 1 18 36 -1.899 -0.464 -7.178 -1.468 -0.407 -2.235 1.418 + D 158 156 3 159 3 0 0 16 35 -6.174 -1.687 -0.566 + IL 159 159 3 159 3 1 1 18 36 -2.374 -0.363 -5.074 0.000 0.000 0.000 0.000 + [ MATL 22 ] 18 - G - - - + ML 160 159 3 162 3 1 1 16 34 -8.524 -0.014 -7.178 -2.700 -4.060 1.885 -3.430 + D 161 159 3 162 3 0 0 16 35 -6.174 -1.687 -0.566 + IL 162 162 3 162 3 1 1 20 39 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 23 ] 19 - G - - - + ML 163 162 3 165 3 1 1 14 33 -8.524 -0.014 -7.178 -2.700 -4.060 1.885 -3.430 + D 164 162 3 165 3 0 0 15 33 -6.174 -1.687 -0.566 + IL 165 165 3 165 3 1 1 19 38 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 24 ] 20 - u - - - + ML 166 165 3 168 3 1 1 11 23 -1.854 -0.481 -7.178 -0.664 -0.325 -0.613 0.939 + D 167 165 3 168 3 0 0 9 20 -6.174 -1.687 -0.566 + IL 168 168 3 168 3 1 1 11 22 -2.396 -0.357 -5.096 0.000 0.000 0.000 0.000 + [ MATL 25 ] 22 - A - - - + ML 169 168 3 171 2 1 1 1 1 * 0.000 1.878 -3.490 -3.019 -3.147 + D 170 168 3 171 2 0 0 0 0 * 0.000 + IL 171 171 3 171 2 1 1 13 28 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ END 26 ] - - - - - - + E 172 171 3 -1 0 0 0 0 0 + [ BEGR 27 ] - - - - - - + S 173 125 1 174 3 0 0 32 50 -8.524 -0.014 -7.178 + IL 174 174 2 174 3 1 1 35 54 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 28 ] 27 - g - - - + ML 175 174 2 177 5 1 1 31 50 -7.593 -0.028 -7.408 -7.620 -8.512 0.512 -2.047 0.983 -1.490 + D 176 174 2 177 5 0 0 30 49 -4.959 -0.803 -4.221 -2.596 -2.508 + IL 177 177 3 177 5 1 1 32 51 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000 + [ MATP 29 ] 28 44 c g - - + MP 178 177 3 182 6 2 2 30 49 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -2.996 -2.785 -3.094 0.747 -2.684 -3.890 2.204 -3.144 -3.118 1.704 -3.626 0.455 1.175 -3.212 0.643 -2.072 + ML 179 177 3 182 6 1 1 29 48 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 180 177 3 182 6 1 1 29 48 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 181 177 3 182 6 0 0 27 45 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 182 182 5 182 6 1 1 30 49 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 183 183 6 183 5 1 1 30 49 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 30 ] 29 43 c g - - + MP 184 183 6 188 6 2 2 28 47 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.660 -3.462 -3.663 0.355 -2.818 -4.407 2.681 -3.427 -3.639 1.512 -4.115 -1.306 1.763 -3.844 -0.432 -2.489 + ML 185 183 6 188 6 1 1 27 46 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 186 183 6 188 6 1 1 27 46 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 187 183 6 188 6 0 0 25 44 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 188 188 5 188 6 1 1 28 47 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 189 189 6 189 5 1 1 28 47 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 31 ] 30 42 a u - - + MP 190 189 6 194 6 2 2 26 45 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.311 -3.146 -3.360 2.221 -2.772 -4.127 2.025 -3.303 -3.378 0.846 -3.868 -1.127 1.693 -3.528 -0.491 -2.313 + ML 191 189 6 194 6 1 1 25 44 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 192 189 6 194 6 1 1 25 44 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 193 189 6 194 6 0 0 23 42 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 194 194 5 194 6 1 1 26 45 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 195 195 6 195 5 1 1 26 45 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 32 ] 31 41 g c - - + MP 196 195 6 200 6 2 2 24 43 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.453 -2.737 -3.468 0.855 -3.398 -4.215 1.983 -3.656 -3.568 2.448 -4.006 0.791 0.648 -3.520 -0.989 -2.403 + ML 197 195 6 200 6 1 1 24 43 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 198 195 6 200 6 1 1 24 43 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 199 195 6 200 6 0 0 22 41 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 200 200 5 200 6 1 1 24 43 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 201 201 6 201 5 1 1 24 43 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 33 ] 32 40 c g - - + MP 202 201 6 206 4 2 2 22 41 -7.543 -7.750 -0.035 -6.164 -3.332 -2.890 -3.380 1.837 -3.037 -4.188 2.208 -3.435 -3.424 1.867 -3.910 -0.719 0.913 -3.503 -0.696 -2.309 + ML 203 201 6 206 4 1 1 24 43 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 204 201 6 206 4 1 1 23 42 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 205 201 6 206 4 0 0 22 41 -4.568 -4.250 -2.265 -0.520 + IL 206 206 5 206 4 1 1 25 44 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 207 207 6 207 3 1 1 24 43 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 34 ] 33 - c - - - + ML 208 207 6 210 3 1 1 20 38 -8.524 -0.014 -7.178 -1.256 0.893 -2.113 0.579 + D 209 207 6 210 3 0 0 19 38 -6.174 -1.687 -0.566 + IL 210 210 3 210 3 1 1 23 42 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 35 ] 34 - U - - - + ML 211 210 3 213 3 1 1 18 37 -8.524 -0.014 -7.178 -2.549 -2.369 -3.320 1.822 + D 212 210 3 213 3 0 0 18 37 -6.174 -1.687 -0.566 + IL 213 213 3 213 3 1 1 22 41 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 36 ] 35 - g - - - + ML 214 213 3 216 3 1 1 17 36 -8.524 -0.014 -7.178 -0.763 -1.427 0.837 0.325 + D 215 213 3 216 3 0 0 17 35 -6.174 -1.687 -0.566 + IL 216 216 3 216 3 1 1 21 39 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 37 ] 36 - u - - - + ML 217 216 3 219 3 1 1 16 34 -8.524 -0.014 -7.178 0.037 -0.330 -0.381 0.496 + D 218 216 3 219 3 0 0 16 34 -6.174 -1.687 -0.566 + IL 219 219 3 219 3 1 1 20 38 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 38 ] 37 - c - - - + ML 220 219 3 222 3 1 1 14 33 -8.524 -0.014 -7.178 0.403 0.783 -1.648 -0.649 + D 221 219 3 222 3 0 0 15 33 -6.174 -1.687 -0.566 + IL 222 222 3 222 3 1 1 19 37 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 39 ] 38 - A - - - + ML 223 222 3 225 3 1 1 13 31 -8.524 -0.014 -7.178 1.037 -1.963 0.397 -1.419 + D 224 222 3 225 3 0 0 13 32 -6.174 -1.687 -0.566 + IL 225 225 3 225 3 1 1 18 36 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 40 ] 39 - a - - - + ML 226 225 3 228 2 1 1 1 1 * 0.000 0.957 0.166 -1.522 -0.764 + D 227 225 3 228 2 0 0 0 0 * 0.000 + IL 228 228 3 228 2 1 1 13 28 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ END 41 ] - - - - - - + E 229 228 3 -1 0 0 0 0 0 +// +HMMER3/f [3.1b3 | July 2016] +NAME dataset_743 +LENG 72 +MAXL 152 +ALPH RNA +RF no +MM no +CONS yes +CS yes +MAP yes +DATE Wed Nov 2 15:35:30 2016 +COM [1] cmbuild -F --fast --symfrac 0.5 --wpb --p7ere 0.38 --EmN 200 --EvN 200 --ElfN 200 --EgfN 200 --eent --refine /dev/null /home/wanli/galaxy/database/files/000/dataset_750.dat /home/wanli/galaxy/database/files/000/dataset_743.dat +NSEQ 5 +EFFN 4.575195 +CKSUM 3535941971 +STATS LOCAL MSV -8.3361 0.72958 +STATS LOCAL VITERBI -9.7423 0.72958 +STATS LOCAL FORWARD -2.8398 0.72958 +HMM A C G U + m->m m->i m->d i->m i->i d->m d->d + COMPO 1.54533 1.43782 1.21668 1.37396 + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 0.00000 * + 1 2.27104 2.21243 0.67362 1.28194 1 G - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 2 2.71979 0.53764 1.58904 1.92505 2 C - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 3 2.13247 1.12928 1.19870 1.36023 3 c - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 4 2.06386 1.33928 0.73468 2.02995 4 g - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 5 1.11916 2.01343 1.13651 1.51879 5 a - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 6 2.27600 1.26221 1.56184 0.90503 6 u - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 7 0.55854 2.34742 2.06069 1.58488 7 A - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 8 3.41131 3.24840 3.95063 0.09549 8 U - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 9 0.62589 2.93067 1.09257 2.57049 9 A - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 10 2.58478 3.48701 0.15236 3.34349 10 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 11 3.04360 0.66824 2.81745 0.96766 11 C - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 12 2.27167 2.22390 0.66329 1.29638 12 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 13 2.70763 0.72972 2.52177 0.99171 13 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 14 0.06447 4.06946 3.72356 3.85378 14 A - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 15 0.96309 2.96228 0.71023 2.58952 15 g - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 16 2.58013 1.68600 3.11568 0.36438 16 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.36284 1.23646 4.27667 0.09305 2.42079 1.09861 0.40547 + 17 3.50204 4.46790 0.06149 4.01568 18 G - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 18 3.50204 4.46790 0.06149 4.01568 19 G - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 19 1.92921 1.61736 1.81487 0.70632 20 u - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.37560 1.20654 4.27667 0.09038 2.44862 1.09861 0.40547 + 20 0.06447 4.06946 3.72356 3.85378 22 A - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 21 2.10278 2.68978 0.46988 1.68787 23 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 22 1.38592 0.72007 2.05285 2.00384 24 c - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 23 1.05742 2.98038 0.61496 2.79344 25 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 24 3.52889 0.29960 3.29055 1.64863 26 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 25 1.01810 2.97712 0.66580 2.60482 27 G - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 26 2.11085 1.15042 1.18985 1.35443 28 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 27 2.42824 0.83921 1.56647 1.30573 29 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 28 1.09889 1.29935 2.02826 1.33756 30 a - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 29 2.06898 1.31812 0.74979 2.01303 31 g - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 30 1.36950 1.15928 1.31013 1.81850 32 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 31 2.40938 0.72219 3.02139 0.97894 33 c - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 32 3.41131 3.24840 3.95063 0.09549 34 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 33 2.03026 2.49922 0.75131 1.15581 35 g - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 34 1.37091 1.61913 1.64530 1.03536 36 u - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 35 1.09596 0.79030 2.66885 1.94670 37 c - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 36 0.63350 2.92991 1.08102 2.56892 38 A - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 37 0.68448 1.23998 2.57183 2.04128 39 A - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 38 2.05098 1.42195 1.06925 1.24869 40 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 39 2.25157 1.00742 1.23141 1.43664 41 c - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 40 1.49091 2.19537 1.18474 1.02809 42 u - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 41 1.46309 1.66242 0.76188 2.18914 43 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 42 1.84429 1.51321 0.88732 1.56112 44 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 43 0.38710 2.63412 2.69028 1.70743 45 A - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 44 3.50204 4.46790 0.06149 4.01568 46 G - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 45 0.96309 2.96228 0.71023 2.58952 47 g - - , + 1.38629 1.38629 1.38629 1.38629 + 0.37560 4.27667 1.20654 1.46634 0.26236 1.09861 0.40547 + 46 2.76487 2.70273 3.28806 0.18312 48 U - - , + 1.38629 1.38629 1.38629 1.38629 + 0.03964 3.94071 3.94071 1.46634 0.26236 0.08877 2.46575 + 47 2.65665 0.41541 3.29031 1.45884 49 C - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 48 1.72807 0.51473 2.49712 1.94920 50 C - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 49 2.23405 1.71156 1.13675 0.93787 51 u - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 50 2.24174 1.47214 0.80734 1.52210 52 g - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 51 1.62002 2.40165 0.60094 1.81254 53 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 52 3.13623 4.03650 0.08313 3.98115 54 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 53 3.41131 3.24840 3.95063 0.09549 55 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 54 3.41131 3.24840 3.95063 0.09549 56 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 55 3.81775 0.07857 4.34279 3.20425 57 C - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 56 1.55092 3.20619 0.37228 2.84263 58 G - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 57 0.06447 4.06946 3.72356 3.85378 59 A - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 58 2.58013 1.68600 3.11568 0.36438 60 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 59 2.39994 1.14144 2.97016 0.61874 61 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 60 4.11656 0.10126 3.89068 2.82057 62 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 61 1.95700 0.67131 2.21870 1.43159 63 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 62 2.18076 0.86710 1.10730 1.99196 64 c - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 63 1.27825 1.21396 1.24116 1.99945 65 c - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 64 2.19639 2.68263 0.47103 1.62938 66 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 65 1.68678 2.30864 2.17351 0.50798 67 U - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 66 1.21618 1.66846 0.95030 2.05201 68 g - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 67 2.09329 1.05549 1.48837 1.19416 69 c - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 68 2.26917 0.96322 1.25225 1.47369 70 c - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 69 1.53154 1.55221 1.02428 1.54664 71 g - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 70 2.18028 1.66521 0.48878 2.47139 72 G - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 71 1.37162 0.72882 2.04389 2.00766 73 c - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 72 1.04988 2.29119 1.14633 1.46503 74 a - - : + 1.38629 1.38629 1.38629 1.38629 + 0.01418 4.26268 * 1.46634 0.26236 0.00000 * +//
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmcalibrate_input.cm Sat Jan 21 17:36:57 2017 -0500 @@ -0,0 +1,570 @@ +INFERNAL1/a [1.1.2 | July 2016] +NAME dataset_838 +STATES 233 +NODES 62 +CLEN 73 +W 90 +ALPH RNA +RF no +CONS yes +MAP yes +DATE Thu Dec 15 13:43:26 2016 +COM [1] cmbuild -F --fast --symfrac 0.5 --wpb --p7ere 0.38 --EmN 200 --EvN 200 --ElfN 200 --EgfN 200 --eent /home/wanli/galaxy/database/files/000/dataset_839.dat /home/wanli/galaxy/database/files/000/dataset_838.dat +COM [2] cmcalibrate Downloads/download.cm +PBEGIN 0.05 +PEND 0.05 +WBETA 1e-07 +QDBBETA1 1e-07 +QDBBETA2 1e-15 +N2OMEGA 1.52588e-05 +N3OMEGA 1.52588e-05 +ELSELF -0.08926734 +NSEQ 2 +EFFN 1.902344 +CKSUM 1256650105 +NULL 0.000 0.000 0.000 0.000 +EFP7GF -2.8151 0.73715 +ECMLC 0.80543 -3.96449 2.80237 1600000 279383 0.004295 +ECMGC 0.42297 -15.07779 -2.84171 1600000 70757 0.005653 +ECMLI 0.67085 -3.93573 3.92167 1600000 233559 0.005138 +ECMGI 0.43319 -10.87224 0.43591 1600000 53640 0.007457 +CM + [ ROOT 0 ] - - - - - - + S 0 -1 0 1 4 0 1 90 110 -6.854 -8.100 -0.081 -4.553 + IL 1 1 2 1 4 3 27 91 111 -2.817 -4.319 -0.613 -2.698 0.000 0.000 0.000 0.000 + IR 2 2 3 2 3 4 29 92 112 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 1 ] - 74 - a - - + MR 3 2 3 5 5 5 30 90 110 -7.084 -0.039 -6.900 -7.112 -8.004 0.711 -1.386 0.490 -0.798 + D 4 2 3 5 5 1 23 88 109 -5.352 -0.707 -2.978 -4.409 -2.404 + IR 5 5 3 5 5 3 27 90 110 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 2 ] 1 73 g c - - + MP 6 5 3 10 6 6 31 89 109 -9.103 -9.042 -0.021 -7.819 -8.099 -8.494 -3.271 -2.721 -3.286 0.880 -2.952 -4.020 1.406 -3.346 -3.336 2.423 -3.790 -0.527 1.874 -3.393 -0.601 -2.220 + ML 7 5 3 10 6 3 25 87 107 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 8 5 3 10 6 3 25 87 107 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 9 5 3 10 6 0 20 85 105 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 10 10 5 10 6 3 26 88 109 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 11 11 6 11 5 3 27 88 108 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 3 ] 2 72 C G - - + MP 12 11 6 16 6 5 30 87 107 -9.103 -9.042 -0.021 -7.819 -8.099 -8.494 -4.534 -4.439 -4.227 -0.672 -2.948 -4.641 3.546 -3.756 -4.276 -0.430 -4.538 -2.386 0.568 -4.605 -0.654 -3.116 + ML 13 11 6 16 6 3 24 85 105 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 14 11 6 16 6 2 24 85 105 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 15 11 6 16 6 0 20 83 103 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 16 16 5 16 6 3 26 86 107 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 17 17 6 17 5 3 26 86 106 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 4 ] 3 71 g c - - + MP 18 17 6 22 6 5 29 85 105 -9.103 -9.042 -0.021 -7.819 -8.099 -8.494 -3.399 -2.852 -3.384 0.778 -2.912 -4.071 2.215 -3.369 -3.430 2.395 -3.863 -0.655 0.991 -3.497 -0.541 -2.295 + ML 19 17 6 22 6 2 24 83 103 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 20 17 6 22 6 2 24 83 103 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 21 17 6 22 6 0 19 81 101 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 22 22 5 22 6 3 25 84 105 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 23 23 6 23 5 3 26 84 104 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 5 ] 4 70 g c - - + MP 24 23 6 28 6 5 27 83 103 -9.103 -9.042 -0.021 -7.819 -8.099 -8.494 -3.685 -2.520 -3.739 0.996 -4.349 -4.510 0.110 -4.031 -3.653 2.956 -4.094 1.654 -0.173 -3.846 -1.845 -2.615 + ML 25 23 6 28 6 2 23 81 101 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 26 23 6 28 6 2 23 81 101 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 27 23 6 28 6 0 19 79 99 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 28 28 5 28 6 3 25 82 103 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 29 29 6 29 5 3 25 82 102 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 6 ] 5 69 A U - - + MP 30 29 6 34 6 5 25 81 101 -9.103 -9.042 -0.021 -7.819 -8.099 -8.494 -3.778 -2.813 -3.798 3.323 -4.129 -5.190 0.170 -3.841 -3.690 1.093 -4.237 -0.291 -0.248 -4.380 -1.771 -2.632 + ML 31 29 6 34 6 2 22 79 100 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 32 29 6 34 6 2 22 79 99 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 33 29 6 34 6 0 19 77 97 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 34 34 5 34 6 3 23 80 101 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 35 35 6 35 5 3 23 80 100 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 7 ] 6 68 U A - - + MP 36 35 6 40 6 5 23 79 99 -9.103 -9.042 -0.021 -7.819 -8.099 -8.494 -4.174 -3.998 -4.014 -0.294 -2.959 -4.580 1.369 -3.654 -4.019 -0.038 -4.393 -1.898 3.320 -4.326 -0.636 -2.845 + ML 37 35 6 40 6 2 21 78 98 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 38 35 6 40 6 2 21 78 98 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 39 35 6 40 6 0 18 76 96 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 40 40 5 40 6 2 22 78 99 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 41 41 6 41 5 2 22 78 98 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 8 ] 7 67 u a - - + MP 42 41 6 46 4 3 21 77 97 -6.937 -7.144 -0.054 -5.558 -3.032 -2.716 -3.091 1.906 -2.672 -3.917 1.568 -3.103 -3.103 1.300 -3.601 -0.598 2.047 -3.280 -0.404 -2.050 + ML 43 41 6 46 4 2 20 77 97 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 44 41 6 46 4 1 19 76 97 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 45 41 6 46 4 0 18 75 96 -4.568 -4.250 -2.265 -0.520 + IL 46 46 5 46 4 2 21 78 99 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 47 47 6 47 3 2 21 77 98 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 9 ] 8 - U - - - + ML 48 47 6 50 3 2 19 74 94 -7.954 -0.021 -6.608 -1.467 -1.466 -2.199 1.613 + D 49 47 6 50 3 0 18 73 93 -6.174 -1.687 -0.566 + IL 50 50 3 50 3 2 20 76 97 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 10 ] 9 - A - - - + ML 51 50 3 53 2 1 18 73 93 -8.344 -0.004 1.714 -2.351 -1.985 -1.891 + D 52 50 3 53 2 0 17 72 92 -8.445 -0.004 + IL 53 53 3 53 2 1 19 74 94 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ BIF 11 ] - - - - - - + B 54 53 3 124 55 0 17 72 92 + [ BEGR 43 ] - - - - - - + S 55 54 1 56 3 0 0 36 55 -7.954 -0.021 -6.608 + IL 56 56 2 56 3 1 1 40 59 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 44 ] 45 - A - - - + ML 57 56 2 59 3 1 1 36 55 -7.954 -0.021 -6.608 1.714 -2.351 -1.985 -1.891 + D 58 56 2 59 3 0 0 35 54 -6.174 -1.687 -0.566 + IL 59 59 3 59 3 1 1 39 58 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 45 ] 46 - G - - - + ML 60 59 3 62 3 1 1 35 54 -7.954 -0.021 -6.608 -1.559 -2.775 1.719 -2.162 + D 61 59 3 62 3 0 0 34 53 -6.174 -1.687 -0.566 + IL 62 62 3 62 3 1 1 37 57 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 46 ] 47 - a - - - + ML 63 62 3 65 3 1 1 34 53 -7.954 -0.445 -1.937 0.698 -1.388 0.507 -0.799 + D 64 62 3 65 3 0 0 33 52 -6.174 -1.687 -0.566 + IL 65 65 3 65 3 1 1 37 56 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 47 ] 48 - U - - - + ML 66 65 3 68 3 1 1 33 52 -7.537 -0.028 -6.191 -0.748 -0.887 -1.429 1.318 + D 67 65 3 68 3 0 0 32 51 -7.898 -0.338 -2.290 + IL 68 68 3 68 3 1 1 36 55 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 48 ] 49 - C - - - + ML 69 68 3 71 5 1 1 32 51 -7.084 -0.039 -6.900 -7.112 -8.004 -1.716 1.617 -2.539 -1.135 + D 70 68 3 71 5 0 0 31 50 -4.959 -0.803 -4.221 -2.596 -2.508 + IL 71 71 3 71 5 1 1 32 51 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000 + [ MATP 49 ] 50 66 C G - - + MP 72 71 3 76 6 2 2 31 50 -9.103 -9.042 -0.021 -7.819 -8.099 -8.494 -4.534 -4.439 -4.227 -0.672 -2.948 -4.641 3.546 -3.756 -4.276 -0.430 -4.538 -2.386 0.568 -4.605 -0.654 -3.116 + ML 73 71 3 76 6 1 1 30 48 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 74 71 3 76 6 1 1 29 48 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 75 71 3 76 6 0 0 27 46 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 76 76 5 76 6 1 1 31 50 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 77 77 6 77 5 1 1 30 49 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 50 ] 51 65 g c - - + MP 78 77 6 82 6 2 2 29 48 -9.103 -9.042 -0.021 -7.819 -8.099 -8.494 -3.267 -2.724 -3.283 0.878 -2.942 -4.019 1.414 -3.339 -3.332 2.409 -3.787 -0.532 1.888 -3.392 -0.592 -2.217 + ML 79 77 6 82 6 1 1 28 46 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 80 77 6 82 6 1 1 27 46 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 81 77 6 82 6 0 0 25 44 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 82 82 5 82 6 1 1 29 48 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 83 83 6 83 5 1 1 28 47 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 51 ] 52 64 G C - - + MP 84 83 6 88 6 2 2 27 46 -9.103 -9.042 -0.021 -7.819 -8.099 -8.494 -4.726 -3.086 -4.823 0.211 -5.210 -4.688 -0.578 -5.065 -4.317 3.634 -4.655 -0.784 -0.964 -4.457 -2.615 -3.700 + ML 85 83 6 88 6 1 1 26 45 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 86 83 6 88 6 1 1 26 45 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 87 83 6 88 6 0 0 24 43 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 88 88 5 88 6 1 1 27 46 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 89 89 6 89 5 1 1 26 45 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 52 ] 53 63 g c - - + MP 90 89 6 94 6 2 2 25 44 -9.103 -9.042 -0.021 -7.819 -8.099 -8.494 -3.267 -2.724 -3.283 0.878 -2.942 -4.019 1.414 -3.339 -3.332 2.409 -3.787 -0.532 1.888 -3.392 -0.592 -2.217 + ML 91 89 6 94 6 1 1 24 43 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 92 89 6 94 6 1 1 24 43 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 93 89 6 94 6 0 0 23 42 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 94 94 5 94 6 1 1 25 44 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 95 95 6 95 5 1 1 24 43 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 53 ] 54 62 G C - - + MP 96 95 6 100 4 2 2 23 42 -6.937 -7.144 -0.054 -5.558 -4.726 -3.086 -4.823 0.211 -5.210 -4.688 -0.578 -5.065 -4.317 3.634 -4.655 -0.784 -0.964 -4.457 -2.615 -3.700 + ML 97 95 6 100 4 1 1 24 43 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 98 95 6 100 4 1 1 23 42 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 99 95 6 100 4 0 0 22 41 -4.568 -4.250 -2.265 -0.520 + IL 100 100 5 100 4 1 1 25 44 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 101 101 6 101 3 1 1 24 43 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 54 ] 55 - U - - - + ML 102 101 6 104 3 1 1 20 39 -7.954 -0.021 -6.608 -1.467 -1.466 -2.199 1.613 + D 103 101 6 104 3 0 0 19 38 -6.174 -1.687 -0.566 + IL 104 104 3 104 3 1 1 23 42 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 55 ] 56 - U - - - + ML 105 104 3 107 3 1 1 19 37 -7.954 -0.021 -6.608 -1.467 -1.466 -2.199 1.613 + D 106 104 3 107 3 0 0 18 37 -6.174 -1.687 -0.566 + IL 107 107 3 107 3 1 1 22 41 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 56 ] 57 - C - - - + ML 108 107 3 110 3 1 1 18 36 -7.954 -0.021 -6.608 -1.716 1.617 -2.539 -1.135 + D 109 107 3 110 3 0 0 17 36 -6.174 -1.687 -0.566 + IL 110 110 3 110 3 1 1 21 40 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 57 ] 58 - G - - - + ML 111 110 3 113 3 1 1 16 35 -7.954 -0.021 -6.608 -1.559 -2.775 1.719 -2.162 + D 112 110 3 113 3 0 0 16 34 -6.174 -1.687 -0.566 + IL 113 113 3 113 3 1 1 20 38 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 58 ] 59 - A - - - + ML 114 113 3 116 3 1 1 15 33 -7.954 -0.021 -6.608 1.714 -2.351 -1.985 -1.891 + D 115 113 3 116 3 0 0 15 33 -6.174 -1.687 -0.566 + IL 116 116 3 116 3 1 1 19 37 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 59 ] 60 - u - - - + ML 117 116 3 119 3 1 1 13 31 -7.954 -0.021 -6.608 -0.697 0.451 -1.474 0.728 + D 118 116 3 119 3 0 0 13 32 -6.174 -1.687 -0.566 + IL 119 119 3 119 3 1 1 18 36 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 60 ] 61 - u - - - + ML 120 119 3 122 2 1 1 1 1 * 0.000 -0.698 0.466 -1.475 0.716 + D 121 119 3 122 2 0 0 0 0 * 0.000 + IL 122 122 3 122 2 1 1 13 28 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ END 61 ] - - - - - - + E 123 122 3 -1 0 0 0 0 0 + [ BEGL 12 ] - - - - - - + S 124 54 1 125 1 0 4 50 69 0.000 + [ BIF 13 ] - - - - - - + B 125 124 1 126 176 0 4 50 69 + [ BEGL 14 ] - - - - - - + S 126 125 1 127 4 0 0 31 49 -0.045 -6.828 -6.235 -6.875 + [ MATP 15 ] 10 26 G C - - + MP 127 126 1 131 6 2 2 31 50 -9.103 -9.042 -0.021 -7.819 -8.099 -8.494 -4.726 -3.086 -4.823 0.211 -5.210 -4.688 -0.578 -5.065 -4.317 3.634 -4.655 -0.784 -0.964 -4.457 -2.615 -3.700 + ML 128 126 1 131 6 1 1 29 48 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 129 126 1 131 6 1 1 29 48 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 130 126 1 131 6 0 0 27 46 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 131 131 5 131 6 1 1 30 49 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 132 132 6 132 5 1 1 30 49 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 16 ] 11 25 c g - - + MP 133 132 6 137 6 2 2 29 47 -9.103 -9.042 -0.021 -7.819 -8.099 -8.494 -3.645 -3.572 -3.530 0.166 -2.488 -4.110 2.664 -3.192 -3.541 0.423 -3.935 -1.548 2.309 -3.788 -0.162 -2.413 + ML 134 132 6 137 6 1 1 27 46 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 135 132 6 137 6 1 1 27 46 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 136 132 6 137 6 0 0 25 44 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 137 137 5 137 6 1 1 28 47 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 138 138 6 138 5 1 1 28 47 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 17 ] 12 24 g c - - + MP 139 138 6 143 6 2 2 27 45 -9.103 -9.042 -0.021 -7.819 -8.099 -8.494 -3.267 -2.724 -3.283 0.878 -2.942 -4.019 1.414 -3.339 -3.332 2.409 -3.787 -0.532 1.888 -3.392 -0.592 -2.217 + ML 140 138 6 143 6 1 1 26 45 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 141 138 6 143 6 1 1 26 45 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 142 138 6 143 6 0 0 24 43 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 143 143 5 143 6 1 1 26 45 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 144 144 6 144 5 1 1 26 45 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 18 ] 13 23 c g - - + MP 145 144 6 149 4 2 2 25 43 -6.937 -7.144 -0.054 -5.558 -3.062 -2.991 -3.078 0.453 -2.412 -3.763 2.525 -2.992 -3.107 0.713 -3.560 -1.119 1.151 -3.287 -0.202 1.395 + ML 146 144 6 149 4 1 1 25 44 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 147 144 6 149 4 1 1 25 44 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 148 144 6 149 4 0 0 24 43 -4.568 -4.250 -2.265 -0.520 + IL 149 149 5 149 4 1 1 27 46 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 150 150 6 150 3 1 1 26 45 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 19 ] 14 - A - - - + ML 151 150 6 153 3 1 1 22 40 -7.954 -0.021 -6.608 1.714 -2.351 -1.985 -1.891 + D 152 150 6 153 3 0 0 21 40 -6.174 -1.687 -0.566 + IL 153 153 3 153 3 1 1 25 43 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 20 ] 15 - a - - - + ML 154 153 3 156 3 1 1 20 39 -7.954 -0.021 -6.608 0.698 -1.388 0.507 -0.799 + D 155 153 3 156 3 0 0 20 38 -6.174 -1.687 -0.566 + IL 156 156 3 156 3 1 1 24 42 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 21 ] 16 - u - - - + ML 157 156 3 159 3 1 1 19 38 -7.954 -0.445 -1.937 -0.697 0.451 -1.474 0.728 + D 158 156 3 159 3 0 0 19 37 -6.174 -1.687 -0.566 + IL 159 159 3 159 3 1 1 23 41 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 22 ] 17 - U - - - + ML 160 159 3 162 3 1 1 18 37 -7.537 -0.028 -6.191 -0.748 -0.887 -1.429 1.318 + D 161 159 3 162 3 0 0 17 36 -7.898 -0.338 -2.290 + IL 162 162 3 162 3 1 1 21 40 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 23 ] 18 - G - - - + ML 163 162 3 165 3 1 1 17 35 -7.954 -0.021 -6.608 -1.559 -2.775 1.719 -2.162 + D 164 162 3 165 3 0 0 16 35 -6.174 -1.687 -0.566 + IL 165 165 3 165 3 1 1 20 39 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 24 ] 19 - G - - - + ML 166 165 3 168 3 1 1 15 33 -7.954 -0.021 -6.608 -1.559 -2.775 1.719 -2.162 + D 167 165 3 168 3 0 0 15 33 -6.174 -1.687 -0.566 + IL 168 168 3 168 3 1 1 19 38 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 25 ] 20 - g - - - + ML 169 168 3 171 3 1 1 13 25 -1.972 -0.445 -6.608 -0.334 0.192 0.338 -0.322 + D 170 168 3 171 3 0 0 10 22 -6.174 -1.687 -0.566 + IL 171 171 3 171 3 1 1 13 25 -2.100 -0.452 -4.800 0.000 0.000 0.000 0.000 + [ MATL 26 ] 22 - A - - - + ML 172 171 3 174 2 1 1 1 1 * 0.000 1.714 -2.351 -1.985 -1.891 + D 173 171 3 174 2 0 0 0 0 * 0.000 + IL 174 174 3 174 2 1 1 13 28 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ END 27 ] - - - - - - + E 175 174 3 -1 0 0 0 0 0 + [ BEGR 28 ] - - - - - - + S 176 125 1 177 3 0 0 32 51 -7.954 -0.021 -6.608 + IL 177 177 2 177 3 1 1 36 55 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 29 ] 27 - a - - - + ML 178 177 2 180 5 1 1 32 51 -7.084 -0.039 -6.900 -7.112 -8.004 0.698 -1.388 0.507 -0.799 + D 179 177 2 180 5 0 0 31 50 -4.959 -0.803 -4.221 -2.596 -2.508 + IL 180 180 3 180 5 1 1 32 51 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000 + [ MATP 30 ] 28 44 c g - - + MP 181 180 3 185 6 2 2 31 50 -9.103 -9.042 -0.021 -7.819 -8.099 -8.494 -3.715 -3.704 -3.557 -0.032 -2.461 -4.079 2.720 -3.195 -3.586 0.182 -3.949 -1.773 1.122 -3.840 1.943 -2.473 + ML 182 180 3 185 6 1 1 30 48 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 183 180 3 185 6 1 1 29 48 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 184 180 3 185 6 0 0 27 46 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 185 185 5 185 6 1 1 31 50 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 186 186 6 186 5 1 1 30 49 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 31 ] 29 43 C G - - + MP 187 186 6 191 6 2 2 29 48 -9.103 -9.042 -0.021 -7.819 -8.099 -8.494 -4.534 -4.439 -4.227 -0.672 -2.948 -4.641 3.546 -3.756 -4.276 -0.430 -4.538 -2.386 0.568 -4.605 -0.654 -3.116 + ML 188 186 6 191 6 1 1 28 46 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 189 186 6 191 6 1 1 27 46 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 190 186 6 191 6 0 0 25 44 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 191 191 5 191 6 1 1 29 48 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 192 192 6 192 5 1 1 28 47 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 32 ] 30 42 A U - - + MP 193 192 6 197 6 2 2 27 46 -9.103 -9.042 -0.021 -7.819 -8.099 -8.494 -3.778 -2.813 -3.798 3.323 -4.129 -5.190 0.170 -3.841 -3.690 1.093 -4.237 -0.291 -0.248 -4.380 -1.771 -2.632 + ML 194 192 6 197 6 1 1 26 45 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 195 192 6 197 6 1 1 26 45 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 196 192 6 197 6 0 0 24 43 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 197 197 5 197 6 1 1 27 46 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 198 198 6 198 5 1 1 26 45 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 33 ] 31 41 g c - - + MP 199 198 6 203 6 2 2 25 44 -9.103 -9.042 -0.021 -7.819 -8.099 -8.494 -3.399 -2.852 -3.384 0.778 -2.912 -4.071 2.215 -3.369 -3.430 2.395 -3.863 -0.655 0.991 -3.497 -0.541 -2.295 + ML 200 198 6 203 6 1 1 24 43 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 201 198 6 203 6 1 1 24 43 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 202 198 6 203 6 0 0 23 42 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 203 203 5 203 6 1 1 25 44 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 204 204 6 204 5 1 1 24 43 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 34 ] 32 40 g c - - + MP 205 204 6 209 4 2 2 23 42 -6.937 -7.144 -0.054 -5.558 -3.526 -2.500 -3.557 2.082 -3.985 -4.395 0.429 -3.836 -3.552 2.834 -4.007 -0.120 0.119 -3.682 -1.529 -2.458 + ML 206 204 6 209 4 1 1 24 43 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 207 204 6 209 4 1 1 23 42 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 208 204 6 209 4 0 0 22 41 -4.568 -4.250 -2.265 -0.520 + IL 209 209 5 209 4 1 1 25 44 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 210 210 6 210 3 1 1 24 43 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 35 ] 33 - C - - - + ML 211 210 6 213 3 1 1 20 39 -7.954 -0.021 -6.608 -1.716 1.617 -2.539 -1.135 + D 212 210 6 213 3 0 0 19 38 -6.174 -1.687 -0.566 + IL 213 213 3 213 3 1 1 23 42 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 36 ] 34 - U - - - + ML 214 213 3 216 3 1 1 19 37 -7.954 -0.021 -6.608 -1.467 -1.466 -2.199 1.613 + D 215 213 3 216 3 0 0 18 37 -6.174 -1.687 -0.566 + IL 216 216 3 216 3 1 1 22 41 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 37 ] 35 - u - - - + ML 217 216 3 219 3 1 1 18 36 -7.954 -0.021 -6.608 -0.363 -0.937 0.342 0.519 + D 218 216 3 219 3 0 0 17 36 -6.174 -1.687 -0.566 + IL 219 219 3 219 3 1 1 21 40 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 38 ] 36 - u - - - + ML 220 219 3 222 3 1 1 16 35 -7.954 -0.021 -6.608 0.558 -0.842 -1.047 0.571 + D 221 219 3 222 3 0 0 16 34 -6.174 -1.687 -0.566 + IL 222 222 3 222 3 1 1 20 38 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 39 ] 37 - a - - - + ML 223 222 3 225 3 1 1 15 33 -7.954 -0.021 -6.608 0.628 0.246 -1.103 -0.315 + D 224 222 3 225 3 0 0 15 33 -6.174 -1.687 -0.566 + IL 225 225 3 225 3 1 1 19 37 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 40 ] 38 - a - - - + ML 226 225 3 228 3 1 1 13 31 -7.954 -0.021 -6.608 0.698 -1.388 0.507 -0.799 + D 227 225 3 228 3 0 0 13 32 -6.174 -1.687 -0.566 + IL 228 228 3 228 3 1 1 18 36 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 41 ] 39 - a - - - + ML 229 228 3 231 2 1 1 1 1 * 0.000 0.628 0.246 -1.103 -0.315 + D 230 228 3 231 2 0 0 0 0 * 0.000 + IL 231 231 3 231 2 1 1 13 28 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ END 42 ] - - - - - - + E 232 231 3 -1 0 0 0 0 0 +// +HMMER3/f [3.1b3 | July 2016] +NAME dataset_838 +LENG 73 +MAXL 164 +ALPH RNA +RF no +MM no +CONS yes +CS yes +MAP yes +DATE Thu Dec 15 13:43:26 2016 +COM [1] cmbuild -F --fast --symfrac 0.5 --wpb --p7ere 0.38 --EmN 200 --EvN 200 --ElfN 200 --EgfN 200 --eent /home/wanli/galaxy/database/files/000/dataset_839.dat /home/wanli/galaxy/database/files/000/dataset_838.dat +NSEQ 2 +EFFN 1.628906 +CKSUM 1256650105 +STATS LOCAL MSV -8.5184 0.73715 +STATS LOCAL VITERBI -10.4826 0.73715 +STATS LOCAL FORWARD -2.6863 0.73715 +HMM A C G U + m->m m->i m->d i->m i->i d->m d->d + COMPO 1.47076 1.39566 1.26733 1.42298 + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 0.00000 * + 1 1.93554 1.65715 0.96626 1.25713 1 g - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 2 2.82012 0.35286 2.54849 1.83556 2 C - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 3 2.00424 1.20191 0.98969 1.64544 3 g - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 4 1.87354 2.44340 0.41370 2.31917 4 G - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 5 0.53128 2.34938 1.53172 2.29704 5 A - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 6 2.58639 1.62982 2.28826 0.46633 6 U - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 7 1.38468 1.54821 1.52008 1.14484 7 u - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 8 2.26593 2.29030 2.76601 0.31181 8 U - - , + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 9 0.23431 2.86460 2.62614 2.53179 9 A - - , + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 10 2.35339 2.85006 0.24040 2.80018 10 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 11 2.36315 0.89679 2.07651 0.98716 11 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 12 1.94223 1.65192 0.97261 1.24884 12 g - - < + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 13 2.11261 1.00158 1.82880 1.04648 13 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 14 0.23431 2.86460 2.62614 2.53179 14 A - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 15 0.91793 2.28477 1.06301 1.87441 15 a - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 16 1.81039 1.10283 2.34106 0.89586 16 u - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.33427 3.73767 1.34581 1.46634 0.26236 1.09861 0.40547 + 17 1.82572 1.94090 2.28977 0.52082 17 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.06440 3.46780 3.46780 1.46634 0.26236 0.16798 1.86670 + 18 2.30534 3.12204 0.23733 2.69597 18 G - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 19 2.30534 3.12204 0.23733 2.69597 19 G - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 20 1.57379 1.27789 1.18703 1.56547 20 g - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.33427 1.34581 3.73767 0.17384 1.83528 1.09861 0.40547 + 21 0.23431 2.86460 2.62614 2.53179 22 A - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 22 1.73793 1.99628 0.88761 1.28505 23 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 23 1.40058 1.07188 1.48214 1.69265 24 c - - > + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 24 1.13668 2.23736 0.79225 2.12401 25 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 25 2.99476 0.28499 2.66857 2.05123 26 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 26 0.91793 2.28477 1.06301 1.87441 27 a - - , + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 27 2.44995 0.86440 2.19692 0.96430 28 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 28 2.83282 0.35078 2.55365 1.83749 29 C - - < + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 29 0.53070 2.35068 1.53174 2.29916 30 A - - < + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 30 2.00633 1.20137 0.98908 1.64602 31 g - - < + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 31 1.28301 2.25438 0.68949 2.15394 32 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 32 2.39558 0.32068 2.95885 2.02994 33 C - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 33 2.26593 2.29030 2.76601 0.31181 34 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 34 1.60034 1.99549 1.17547 1.03972 35 u - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 35 1.01126 1.93561 2.07335 1.00474 36 u - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 36 0.96800 1.24226 2.10248 1.56411 37 a - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 37 0.91793 2.28477 1.06301 1.87441 38 a - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 38 0.96800 1.24226 2.10248 1.56411 39 a - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 39 2.38672 0.79160 2.07045 1.11225 40 c - - > + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 40 1.88903 1.08176 1.08725 1.75655 41 c - - > + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 41 2.53186 1.78457 2.16649 0.44935 42 U - - > + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 42 2.11226 2.72003 0.30387 2.58756 43 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 43 1.77763 2.35781 0.46620 2.21683 44 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 44 0.23431 2.86460 2.62614 2.53179 45 A - - , + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 45 2.30534 3.12204 0.23733 2.69597 46 G - - , + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 46 0.91793 2.28477 1.06301 1.87441 47 a - - , + 1.38629 1.38629 1.38629 1.38629 + 0.33427 3.73767 1.34581 1.46634 0.26236 1.09861 0.40547 + 47 1.82572 1.94090 2.28977 0.52082 48 U - - , + 1.38629 1.38629 1.38629 1.38629 + 0.06440 3.46780 3.46780 1.46634 0.26236 0.16798 1.86670 + 48 2.39558 0.32068 2.95885 2.02994 49 C - - , + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 49 2.82007 0.35287 2.54847 1.83555 50 C - - < + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 50 1.93986 1.65192 0.97340 1.24897 51 g - - < + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 51 2.34658 2.84349 0.24246 2.79056 52 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 52 1.94038 1.65192 0.97323 1.24894 53 g - - < + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 53 2.34693 2.84383 0.24235 2.79106 54 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 54 2.26593 2.29030 2.76601 0.31181 55 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 55 2.26593 2.29030 2.76601 0.31181 56 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 56 2.39558 0.32068 2.95885 2.02994 57 C - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 57 2.30534 3.12204 0.23733 2.69597 58 G - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 58 0.23431 2.86460 2.62614 2.53179 59 A - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 59 1.81039 1.10283 2.34106 0.89586 60 u - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 60 1.81068 1.09350 2.34184 0.90321 61 u - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 61 3.00308 0.28386 2.67186 2.05286 62 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 62 1.40018 1.07245 1.48219 1.69206 63 c - - > + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 63 2.99483 0.28498 2.66860 2.05124 64 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 64 1.39930 1.07371 1.48229 1.69078 65 c - - > + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 65 2.09668 2.70224 0.31051 2.56386 66 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 66 1.29468 1.69346 1.37752 1.23812 67 u - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 67 0.53113 2.46484 1.46640 2.34049 68 A - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 68 2.52828 1.78440 2.16542 0.45004 69 U - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 69 2.54850 0.71164 2.25714 1.11990 70 c - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 70 1.88844 1.08198 1.08743 1.75627 71 c - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 71 2.11092 2.71850 0.30443 2.58552 72 G - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 72 1.40959 1.06246 1.48726 1.69195 73 c - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.04879 3.73767 3.73767 1.46634 0.26236 1.09861 0.40547 + 73 0.90952 2.28340 1.07370 1.87338 74 a - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02469 3.71357 * 1.46634 0.26236 0.00000 * +//
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmpress_input_minifam.cm Sat Jan 21 17:36:57 2017 -0500 @@ -0,0 +1,2830 @@ +INFERNAL1/a [1.1rc1 | June 2012] +NAME tRNA5 +STATES 230 +NODES 61 +CLEN 72 +W 89 +ALPH RNA +RF no +CONS yes +MAP yes +DATE Tue Jun 12 17:22:37 2012 +COM [1] ./cmbuild tRNA5.cm ../tutorial/tRNA5.sto +COM [2] ./cmcalibrate ./tRNA5.cm +PBEGIN 0.05 +PEND 0.05 +WBETA 1e-07 +QDBBETA1 1e-07 +QDBBETA2 1e-15 +N2OMEGA 1.52588e-05 +N3OMEGA 1.52588e-05 +ELSELF -0.08926734 +NSEQ 5 +EFFN 3.725586 +CKSUM 3535941971 +NULL 0.000 0.000 0.000 0.000 +EFP7GF -5.5288 0.72958 +ECMLC 0.85563 -4.01853 2.43520 1600000 300168 0.003998 +ECMGC 0.39437 -17.41037 -4.06685 1600000 77168 0.005183 +ECMLI 0.73047 -3.70982 3.57712 1600000 245977 0.004879 +ECMGI 0.44078 -12.13534 -0.86006 1600000 57603 0.006944 +CM + [ ROOT 0 ] - - - - - - + S 0 -1 0 1 4 0 1 89 108 -7.419 -8.664 -0.055 -5.118 + IL 1 1 2 1 4 3 28 90 110 -2.817 -4.319 -0.613 -2.698 0.000 0.000 0.000 0.000 + IR 2 2 3 2 3 4 30 90 110 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 1 ] - 74 - a - - + MR 3 2 3 5 5 4 32 89 108 -7.593 -0.028 -7.408 -7.620 -8.512 0.474 -1.199 0.305 -0.089 + D 4 2 3 5 5 1 24 87 107 -5.352 -0.707 -2.978 -4.409 -2.404 + IR 5 5 3 5 5 3 28 89 109 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 2 ] 1 73 g c - - + MP 6 5 3 10 6 5 32 88 107 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.831 -2.997 -3.795 0.617 -3.618 -4.452 0.854 -3.918 -3.870 2.837 -4.276 -0.713 1.871 -3.843 -1.175 -2.703 + ML 7 5 3 10 6 3 26 86 106 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 8 5 3 10 6 3 25 86 106 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 9 5 3 10 6 0 21 84 103 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 10 10 5 10 6 3 27 87 107 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 11 11 6 11 5 3 27 87 107 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 3 ] 2 72 C G - - + MP 12 11 6 16 6 5 31 86 105 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -4.097 -3.805 -3.998 0.021 -3.009 -4.646 3.103 -3.661 -3.977 1.529 -4.392 -1.585 0.835 -4.247 -0.625 -2.808 + ML 13 11 6 16 6 2 25 84 104 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 14 11 6 16 6 2 25 84 104 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 15 11 6 16 6 0 21 82 101 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 16 16 5 16 6 3 27 85 105 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 17 17 6 17 5 3 27 85 105 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 4 ] 3 71 c g - - + MP 18 17 6 22 6 5 29 84 103 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.141 -2.880 -3.222 0.733 -2.762 -4.023 2.237 -3.232 -3.242 1.678 -3.747 0.537 1.616 -3.340 -0.447 -2.158 + ML 19 17 6 22 6 2 25 82 102 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 20 17 6 22 6 2 24 82 102 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 21 17 6 22 6 0 20 80 99 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 22 22 5 22 6 3 26 83 103 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 23 23 6 23 5 3 26 83 103 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 5 ] 4 70 g c - - + MP 24 23 6 28 6 5 28 82 101 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.477 -2.737 -3.484 0.861 -3.437 -4.224 1.956 -3.685 -3.594 2.509 -4.028 0.683 0.624 -3.528 -1.017 -2.419 + ML 25 23 6 28 6 2 24 80 100 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 26 23 6 28 6 2 24 80 100 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 27 23 6 28 6 0 20 78 97 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 28 28 5 28 6 3 25 81 101 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 29 29 6 29 5 3 25 81 101 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 6 ] 5 69 g c - - + MP 30 29 6 34 6 5 26 80 99 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -2.565 0.048 -2.684 1.825 -2.755 -3.485 0.996 -3.019 -2.788 2.050 -3.293 -0.374 0.757 -2.774 0.549 -1.819 + ML 31 29 6 34 6 2 23 78 98 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 32 29 6 34 6 2 23 78 98 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 33 29 6 34 6 0 19 76 96 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 34 34 5 34 6 2 24 79 99 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 35 35 6 35 5 3 24 79 99 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 7 ] 6 68 c g - - + MP 36 35 6 40 6 5 24 78 97 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.250 -3.161 -3.321 0.517 -2.657 -4.117 2.088 -3.215 -3.310 1.474 -3.823 -1.143 2.088 -3.483 0.783 -2.234 + ML 37 35 6 40 6 2 22 77 97 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 38 35 6 40 6 2 21 77 96 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 39 35 6 40 6 0 19 75 95 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 40 40 5 40 6 2 23 77 97 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 41 41 6 41 5 2 23 77 97 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 8 ] 7 67 A U - - + MP 42 41 6 46 4 4 22 76 95 -7.543 -7.750 -0.035 -6.164 -3.769 -3.134 -3.802 3.011 -3.544 -4.775 0.728 -3.793 -3.752 0.821 -4.250 -0.784 1.443 -4.133 -1.238 -2.690 + ML 43 41 6 46 4 1 21 76 96 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 44 41 6 46 4 1 20 76 96 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 45 41 6 46 4 0 19 74 94 -4.568 -4.250 -2.265 -0.520 + IL 46 46 5 46 4 2 22 77 97 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 47 47 6 47 3 2 21 76 96 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 9 ] 8 - U - - - + ML 48 47 6 50 3 2 20 73 93 -8.524 -0.014 -7.178 -2.549 -2.369 -3.320 1.822 + D 49 47 6 50 3 0 18 72 92 -6.174 -1.687 -0.566 + IL 50 50 3 50 3 2 20 75 95 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 10 ] 9 - A - - - + ML 51 50 3 53 2 1 19 72 92 -9.006 -0.003 1.048 -1.964 0.381 -1.421 + D 52 50 3 53 2 0 18 71 91 -8.445 -0.004 + IL 53 53 3 53 2 1 19 73 93 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ BIF 11 ] - - - - - - + B 54 53 3 124 55 0 18 71 91 + [ BEGR 42 ] - - - - - - + S 55 54 1 56 3 0 0 36 55 -8.524 -0.014 -7.178 + IL 56 56 2 56 3 1 1 39 59 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 43 ] 45 - A - - - + ML 57 56 2 59 3 1 1 36 55 -8.524 -0.014 -7.178 1.385 -1.618 -1.684 -0.412 + D 58 56 2 59 3 0 0 35 54 -6.174 -1.687 -0.566 + IL 59 59 3 59 3 1 1 38 57 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 44 ] 46 - G - - - + ML 60 59 3 62 3 1 1 35 54 -8.524 -0.014 -7.178 -2.700 -4.060 1.885 -3.430 + D 61 59 3 62 3 0 0 34 53 -6.174 -1.687 -0.566 + IL 62 62 3 62 3 1 1 37 56 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 45 ] 47 - g - - - + ML 63 62 3 65 3 1 1 34 52 -8.524 -0.481 -1.832 0.586 -2.024 0.919 -1.466 + D 64 62 3 65 3 0 0 33 52 -6.174 -1.687 -0.566 + IL 65 65 3 65 3 1 1 36 55 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 46 ] 48 - U - - - + ML 66 65 3 68 3 1 1 33 51 -8.062 -0.019 -6.716 -1.668 -1.633 -2.411 1.667 + D 67 65 3 68 3 0 0 31 50 -8.417 -0.227 -2.808 + IL 68 68 3 68 3 1 1 35 54 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 47 ] 49 - C - - - + ML 69 68 3 71 5 1 1 31 50 -7.593 -0.028 -7.408 -7.620 -8.512 -1.578 1.336 -2.466 -0.059 + D 70 68 3 71 5 0 0 30 49 -4.959 -0.803 -4.221 -2.596 -2.508 + IL 71 71 3 71 5 1 1 32 51 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000 + [ MATP 48 ] 50 66 C G - - + MP 72 71 3 76 6 2 2 30 49 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -4.063 -3.835 -3.975 1.367 -2.984 -4.641 3.137 -3.636 -3.945 0.196 -4.368 -1.641 0.814 -4.253 -0.622 -2.801 + ML 73 71 3 76 6 1 1 29 48 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 74 71 3 76 6 1 1 29 48 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 75 71 3 76 6 0 0 27 45 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 76 76 5 76 6 1 1 30 49 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 77 77 6 77 5 1 1 30 49 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 49 ] 51 65 g c - - + MP 78 77 6 82 6 2 2 28 47 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.269 -3.002 -3.316 0.607 -2.825 -4.080 1.486 -3.318 -3.360 2.123 -3.845 -0.940 1.986 -3.442 0.799 -2.268 + ML 79 77 6 82 6 1 1 27 46 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 80 77 6 82 6 1 1 27 46 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 81 77 6 82 6 0 0 25 44 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 82 82 5 82 6 1 1 28 47 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 83 83 6 83 5 1 1 28 47 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 50 ] 52 64 g c - - + MP 84 83 6 88 6 2 2 26 45 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.573 -3.001 -3.543 0.634 -3.168 -4.231 1.794 -3.603 -3.657 2.626 -4.078 -0.813 0.766 -3.618 0.675 -2.477 + ML 85 83 6 88 6 1 1 25 44 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 86 83 6 88 6 1 1 25 44 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 87 83 6 88 6 0 0 23 42 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 88 88 5 88 6 1 1 26 45 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 89 89 6 89 5 1 1 26 45 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 51 ] 53 63 g c - - + MP 90 89 6 94 6 2 2 24 43 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.680 -2.656 -3.624 1.495 -4.000 -4.305 0.538 -4.011 -3.825 2.937 -4.200 -0.344 1.037 -3.597 -1.457 -2.574 + ML 91 89 6 94 6 1 1 24 43 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 92 89 6 94 6 1 1 24 43 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 93 89 6 94 6 0 0 22 41 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 94 94 5 94 6 1 1 24 43 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 95 95 6 95 5 1 1 24 43 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 52 ] 54 62 G C - - + MP 96 95 6 100 4 2 2 22 41 -7.543 -7.750 -0.035 -6.164 -5.814 -3.622 -6.104 -0.561 -6.715 -5.090 -1.814 -6.360 -4.961 3.816 -5.237 -1.382 -2.178 -5.150 -3.925 -4.967 + ML 97 95 6 100 4 1 1 24 43 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 98 95 6 100 4 1 1 23 42 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 99 95 6 100 4 0 0 22 41 -4.568 -4.250 -2.265 -0.520 + IL 100 100 5 100 4 1 1 25 44 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 101 101 6 101 3 1 1 24 43 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 53 ] 55 - U - - - + ML 102 101 6 104 3 1 1 20 38 -8.524 -0.014 -7.178 -2.549 -2.369 -3.320 1.822 + D 103 101 6 104 3 0 0 19 38 -6.174 -1.687 -0.566 + IL 104 104 3 104 3 1 1 23 42 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 54 ] 56 - U - - - + ML 105 104 3 107 3 1 1 18 37 -8.524 -0.014 -7.178 -2.549 -2.369 -3.320 1.822 + D 106 104 3 107 3 0 0 18 37 -6.174 -1.687 -0.566 + IL 107 107 3 107 3 1 1 22 41 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 55 ] 57 - C - - - + ML 108 107 3 110 3 1 1 17 36 -8.524 -0.014 -7.178 -3.081 1.849 -3.880 -2.250 + D 109 107 3 110 3 0 0 17 35 -6.174 -1.687 -0.566 + IL 110 110 3 110 3 1 1 21 39 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 56 ] 58 - G - - - + ML 111 110 3 113 3 1 1 16 34 -8.524 -0.014 -7.178 -0.198 -2.380 1.409 -1.835 + D 112 110 3 113 3 0 0 16 34 -6.174 -1.687 -0.566 + IL 113 113 3 113 3 1 1 20 38 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 57 ] 59 - A - - - + ML 114 113 3 116 3 1 1 14 33 -8.524 -0.014 -7.178 1.878 -3.490 -3.019 -3.147 + D 115 113 3 116 3 0 0 15 33 -6.174 -1.687 -0.566 + IL 116 116 3 116 3 1 1 19 37 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 58 ] 60 - U - - - + ML 117 116 3 119 3 1 1 13 31 -8.524 -0.014 -7.178 -1.468 -0.407 -2.235 1.418 + D 118 116 3 119 3 0 0 13 32 -6.174 -1.687 -0.566 + IL 119 119 3 119 3 1 1 18 36 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 59 ] 61 - U - - - + ML 120 119 3 122 2 1 1 1 1 * 0.000 -1.239 0.314 -2.046 1.064 + D 121 119 3 122 2 0 0 0 0 * 0.000 + IL 122 122 3 122 2 1 1 13 28 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ END 60 ] - - - - - - + E 123 122 3 -1 0 0 0 0 0 + [ BEGL 12 ] - - - - - - + S 124 54 1 125 1 0 3 49 68 0.000 + [ BIF 13 ] - - - - - - + B 125 124 1 126 173 0 3 49 68 + [ BEGL 14 ] - - - - - - + S 126 125 1 127 4 0 0 30 48 -0.035 -7.164 -6.572 -7.212 + [ MATP 15 ] 10 26 G C - - + MP 127 126 1 131 6 2 2 30 48 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -4.768 -3.151 -4.805 0.251 -5.796 -4.949 -0.981 -5.231 -4.514 3.516 -4.857 0.895 -1.246 -4.551 -3.005 -3.683 + ML 128 126 1 131 6 1 1 28 47 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 129 126 1 131 6 1 1 28 47 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 130 126 1 131 6 0 0 26 45 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 131 131 5 131 6 1 1 29 48 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 132 132 6 132 5 1 1 29 48 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 16 ] 11 25 c g - - + MP 133 132 6 137 6 2 2 28 46 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -4.380 -4.331 -4.172 -0.461 -2.935 -4.679 2.953 -3.697 -4.172 -0.278 -4.524 -2.247 2.367 -4.479 -0.580 -2.998 + ML 134 132 6 137 6 1 1 27 45 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 135 132 6 137 6 1 1 26 45 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 136 132 6 137 6 0 0 24 43 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 137 137 5 137 6 1 1 27 46 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 138 138 6 138 5 1 1 27 46 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 17 ] 12 24 g c - - + MP 139 138 6 143 6 2 2 26 44 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.838 -2.993 -3.801 0.619 -3.635 -4.454 0.839 -3.930 -3.877 2.852 -4.281 -0.708 1.851 -3.845 -1.190 -2.710 + ML 140 138 6 143 6 1 1 25 44 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 141 138 6 143 6 1 1 25 44 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 142 138 6 143 6 0 0 24 42 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 143 143 5 143 6 1 1 26 44 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 144 144 6 144 5 1 1 25 44 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 18 ] 13 23 c g - - + MP 145 144 6 149 4 2 2 24 42 -7.543 -7.750 -0.035 -6.164 -3.454 -3.490 -3.467 0.042 -2.692 -4.152 2.807 -3.318 -3.483 0.166 -3.945 -1.653 0.946 -3.679 1.162 0.637 + ML 146 144 6 149 4 1 1 25 44 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 147 144 6 149 4 1 1 24 43 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 148 144 6 149 4 0 0 23 42 -4.568 -4.250 -2.265 -0.520 + IL 149 149 5 149 4 1 1 26 45 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 150 150 6 150 3 1 1 25 44 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 19 ] 14 - A - - - + ML 151 150 6 153 3 1 1 20 39 -8.524 -0.014 -7.178 1.878 -3.490 -3.019 -3.147 + D 152 150 6 153 3 0 0 20 39 -6.174 -1.687 -0.566 + IL 153 153 3 153 3 1 1 24 43 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 20 ] 15 - g - - - + ML 154 153 3 156 3 1 1 19 38 -8.524 -0.014 -7.178 0.586 -2.024 0.919 -1.466 + D 155 153 3 156 3 0 0 19 37 -6.174 -1.687 -0.566 + IL 156 156 3 156 3 1 1 23 42 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 21 ] 16 - U - - - + ML 157 156 3 159 3 1 1 18 36 -1.899 -0.464 -7.178 -1.468 -0.407 -2.235 1.418 + D 158 156 3 159 3 0 0 16 35 -6.174 -1.687 -0.566 + IL 159 159 3 159 3 1 1 18 36 -2.374 -0.363 -5.074 0.000 0.000 0.000 0.000 + [ MATL 22 ] 18 - G - - - + ML 160 159 3 162 3 1 1 16 34 -8.524 -0.014 -7.178 -2.700 -4.060 1.885 -3.430 + D 161 159 3 162 3 0 0 16 35 -6.174 -1.687 -0.566 + IL 162 162 3 162 3 1 1 20 39 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 23 ] 19 - G - - - + ML 163 162 3 165 3 1 1 14 33 -8.524 -0.014 -7.178 -2.700 -4.060 1.885 -3.430 + D 164 162 3 165 3 0 0 15 33 -6.174 -1.687 -0.566 + IL 165 165 3 165 3 1 1 19 38 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 24 ] 20 - u - - - + ML 166 165 3 168 3 1 1 11 23 -1.854 -0.481 -7.178 -0.664 -0.325 -0.613 0.939 + D 167 165 3 168 3 0 0 9 20 -6.174 -1.687 -0.566 + IL 168 168 3 168 3 1 1 11 22 -2.396 -0.357 -5.096 0.000 0.000 0.000 0.000 + [ MATL 25 ] 22 - A - - - + ML 169 168 3 171 2 1 1 1 1 * 0.000 1.878 -3.490 -3.019 -3.147 + D 170 168 3 171 2 0 0 0 0 * 0.000 + IL 171 171 3 171 2 1 1 13 28 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ END 26 ] - - - - - - + E 172 171 3 -1 0 0 0 0 0 + [ BEGR 27 ] - - - - - - + S 173 125 1 174 3 0 0 32 50 -8.524 -0.014 -7.178 + IL 174 174 2 174 3 1 1 35 54 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 28 ] 27 - g - - - + ML 175 174 2 177 5 1 1 31 50 -7.593 -0.028 -7.408 -7.620 -8.512 0.512 -2.047 0.983 -1.490 + D 176 174 2 177 5 0 0 30 49 -4.959 -0.803 -4.221 -2.596 -2.508 + IL 177 177 3 177 5 1 1 32 51 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000 + [ MATP 29 ] 28 44 c g - - + MP 178 177 3 182 6 2 2 30 49 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -2.996 -2.785 -3.094 0.747 -2.684 -3.890 2.204 -3.144 -3.118 1.704 -3.626 0.455 1.175 -3.212 0.643 -2.072 + ML 179 177 3 182 6 1 1 29 48 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 180 177 3 182 6 1 1 29 48 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 181 177 3 182 6 0 0 27 45 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 182 182 5 182 6 1 1 30 49 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 183 183 6 183 5 1 1 30 49 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 30 ] 29 43 c g - - + MP 184 183 6 188 6 2 2 28 47 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.660 -3.462 -3.663 0.355 -2.818 -4.407 2.681 -3.427 -3.639 1.512 -4.115 -1.306 1.763 -3.844 -0.432 -2.489 + ML 185 183 6 188 6 1 1 27 46 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 186 183 6 188 6 1 1 27 46 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 187 183 6 188 6 0 0 25 44 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 188 188 5 188 6 1 1 28 47 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 189 189 6 189 5 1 1 28 47 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 31 ] 30 42 a u - - + MP 190 189 6 194 6 2 2 26 45 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.311 -3.146 -3.360 2.221 -2.772 -4.127 2.025 -3.303 -3.378 0.846 -3.868 -1.127 1.693 -3.528 -0.491 -2.313 + ML 191 189 6 194 6 1 1 25 44 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 192 189 6 194 6 1 1 25 44 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 193 189 6 194 6 0 0 23 42 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 194 194 5 194 6 1 1 26 45 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 195 195 6 195 5 1 1 26 45 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 32 ] 31 41 g c - - + MP 196 195 6 200 6 2 2 24 43 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.453 -2.737 -3.468 0.855 -3.398 -4.215 1.983 -3.656 -3.568 2.448 -4.006 0.791 0.648 -3.520 -0.989 -2.403 + ML 197 195 6 200 6 1 1 24 43 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 198 195 6 200 6 1 1 24 43 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 199 195 6 200 6 0 0 22 41 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 200 200 5 200 6 1 1 24 43 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 201 201 6 201 5 1 1 24 43 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 33 ] 32 40 c g - - + MP 202 201 6 206 4 2 2 22 41 -7.543 -7.750 -0.035 -6.164 -3.332 -2.890 -3.380 1.837 -3.037 -4.188 2.208 -3.435 -3.424 1.867 -3.910 -0.719 0.913 -3.503 -0.696 -2.309 + ML 203 201 6 206 4 1 1 24 43 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 204 201 6 206 4 1 1 23 42 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 205 201 6 206 4 0 0 22 41 -4.568 -4.250 -2.265 -0.520 + IL 206 206 5 206 4 1 1 25 44 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 207 207 6 207 3 1 1 24 43 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 34 ] 33 - c - - - + ML 208 207 6 210 3 1 1 20 38 -8.524 -0.014 -7.178 -1.256 0.893 -2.113 0.579 + D 209 207 6 210 3 0 0 19 38 -6.174 -1.687 -0.566 + IL 210 210 3 210 3 1 1 23 42 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 35 ] 34 - U - - - + ML 211 210 3 213 3 1 1 18 37 -8.524 -0.014 -7.178 -2.549 -2.369 -3.320 1.822 + D 212 210 3 213 3 0 0 18 37 -6.174 -1.687 -0.566 + IL 213 213 3 213 3 1 1 22 41 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 36 ] 35 - g - - - + ML 214 213 3 216 3 1 1 17 36 -8.524 -0.014 -7.178 -0.763 -1.427 0.837 0.325 + D 215 213 3 216 3 0 0 17 35 -6.174 -1.687 -0.566 + IL 216 216 3 216 3 1 1 21 39 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 37 ] 36 - u - - - + ML 217 216 3 219 3 1 1 16 34 -8.524 -0.014 -7.178 0.037 -0.330 -0.381 0.496 + D 218 216 3 219 3 0 0 16 34 -6.174 -1.687 -0.566 + IL 219 219 3 219 3 1 1 20 38 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 38 ] 37 - c - - - + ML 220 219 3 222 3 1 1 14 33 -8.524 -0.014 -7.178 0.403 0.783 -1.648 -0.649 + D 221 219 3 222 3 0 0 15 33 -6.174 -1.687 -0.566 + IL 222 222 3 222 3 1 1 19 37 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 39 ] 38 - A - - - + ML 223 222 3 225 3 1 1 13 31 -8.524 -0.014 -7.178 1.037 -1.963 0.397 -1.419 + D 224 222 3 225 3 0 0 13 32 -6.174 -1.687 -0.566 + IL 225 225 3 225 3 1 1 18 36 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 40 ] 39 - a - - - + ML 226 225 3 228 2 1 1 1 1 * 0.000 0.957 0.166 -1.522 -0.764 + D 227 225 3 228 2 0 0 0 0 * 0.000 + IL 228 228 3 228 2 1 1 13 28 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ END 41 ] - - - - - - + E 229 228 3 -1 0 0 0 0 0 +// +HMMER3/f [i1.1rc1 | June 2012] +NAME tRNA5 +LENG 72 +MAXL 152 +ALPH RNA +RF no +MM no +CONS yes +CS yes +MAP yes +DATE Tue Jun 12 17:22:38 2012 +COM [1] ./cmbuild tRNA5.cm ../tutorial/tRNA5.sto +NSEQ 5 +EFFN 4.575195 +CKSUM 3535941971 +STATS LOCAL MSV -8.3361 0.72958 +STATS LOCAL VITERBI -9.7423 0.72958 +STATS LOCAL FORWARD -2.8398 0.72958 +HMM A C G U + m->m m->i m->d i->m i->i d->m d->d + COMPO 1.54533 1.43782 1.21668 1.37396 + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 0.00000 * + 1 2.27104 2.21243 0.67362 1.28194 1 G - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 2 2.71979 0.53764 1.58904 1.92505 2 C - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 3 2.13247 1.12928 1.19870 1.36023 3 c - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 4 2.06386 1.33928 0.73468 2.02995 4 g - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 5 1.11916 2.01343 1.13651 1.51879 5 a - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 6 2.27600 1.26221 1.56184 0.90503 6 u - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 7 0.55854 2.34742 2.06069 1.58488 7 A - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 8 3.41131 3.24840 3.95063 0.09549 8 U - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 9 0.62589 2.93067 1.09257 2.57049 9 A - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 10 2.58478 3.48701 0.15236 3.34349 10 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 11 3.04360 0.66824 2.81745 0.96766 11 C - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 12 2.27167 2.22390 0.66329 1.29638 12 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 13 2.70763 0.72972 2.52177 0.99171 13 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 14 0.06447 4.06946 3.72356 3.85378 14 A - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 15 0.96309 2.96228 0.71023 2.58952 15 g - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 16 2.58013 1.68600 3.11568 0.36438 16 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.36284 1.23646 4.27667 0.09305 2.42079 1.09861 0.40547 + 17 3.50204 4.46790 0.06149 4.01568 18 G - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 18 3.50204 4.46790 0.06149 4.01568 19 G - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 19 1.92921 1.61736 1.81487 0.70632 20 u - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.37560 1.20654 4.27667 0.09038 2.44862 1.09861 0.40547 + 20 0.06447 4.06946 3.72356 3.85378 22 A - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 21 2.10278 2.68978 0.46988 1.68787 23 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 22 1.38592 0.72007 2.05285 2.00384 24 c - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 23 1.05742 2.98038 0.61496 2.79344 25 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 24 3.52889 0.29960 3.29055 1.64863 26 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 25 1.01810 2.97712 0.66580 2.60482 27 G - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 26 2.11085 1.15042 1.18985 1.35443 28 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 27 2.42824 0.83921 1.56647 1.30573 29 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 28 1.09889 1.29935 2.02826 1.33756 30 a - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 29 2.06898 1.31812 0.74979 2.01303 31 g - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 30 1.36950 1.15928 1.31013 1.81850 32 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 31 2.40938 0.72219 3.02139 0.97894 33 c - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 32 3.41131 3.24840 3.95063 0.09549 34 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 33 2.03026 2.49922 0.75131 1.15581 35 g - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 34 1.37091 1.61913 1.64530 1.03536 36 u - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 35 1.09596 0.79030 2.66885 1.94670 37 c - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 36 0.63350 2.92991 1.08102 2.56892 38 A - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 37 0.68448 1.23998 2.57183 2.04128 39 A - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 38 2.05098 1.42195 1.06925 1.24869 40 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 39 2.25157 1.00742 1.23141 1.43664 41 c - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 40 1.49091 2.19537 1.18474 1.02809 42 u - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 41 1.46309 1.66242 0.76188 2.18914 43 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 42 1.84429 1.51321 0.88732 1.56112 44 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 43 0.38710 2.63412 2.69028 1.70743 45 A - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 44 3.50204 4.46790 0.06149 4.01568 46 G - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 45 0.96309 2.96228 0.71023 2.58952 47 g - - , + 1.38629 1.38629 1.38629 1.38629 + 0.37560 4.27667 1.20654 1.46634 0.26236 1.09861 0.40547 + 46 2.76487 2.70273 3.28806 0.18312 48 U - - , + 1.38629 1.38629 1.38629 1.38629 + 0.03964 3.94071 3.94071 1.46634 0.26236 0.08877 2.46575 + 47 2.65665 0.41541 3.29031 1.45884 49 C - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 48 1.72807 0.51473 2.49712 1.94920 50 C - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 49 2.23405 1.71156 1.13675 0.93787 51 u - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 50 2.24174 1.47214 0.80734 1.52210 52 g - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 51 1.62002 2.40165 0.60094 1.81254 53 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 52 3.13623 4.03650 0.08313 3.98115 54 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 53 3.41131 3.24840 3.95063 0.09549 55 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 54 3.41131 3.24840 3.95063 0.09549 56 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 55 3.81775 0.07857 4.34279 3.20425 57 C - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 56 1.55092 3.20619 0.37228 2.84263 58 G - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 57 0.06447 4.06946 3.72356 3.85378 59 A - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 58 2.58013 1.68600 3.11568 0.36438 60 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 59 2.39994 1.14144 2.97016 0.61874 61 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 60 4.11656 0.10126 3.89068 2.82057 62 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 61 1.95700 0.67131 2.21870 1.43159 63 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 62 2.18076 0.86710 1.10730 1.99196 64 c - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 63 1.27825 1.21396 1.24116 1.99945 65 c - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 64 2.19639 2.68263 0.47103 1.62938 66 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 65 1.68678 2.30864 2.17351 0.50798 67 U - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 66 1.21618 1.66846 0.95030 2.05201 68 g - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 67 2.09329 1.05549 1.48837 1.19416 69 c - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 68 2.26917 0.96322 1.25225 1.47369 70 c - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 69 1.53154 1.55221 1.02428 1.54664 71 g - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 70 2.18028 1.66521 0.48878 2.47139 72 G - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 71 1.37162 0.72882 2.04389 2.00766 73 c - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02817 4.27667 4.27667 1.46634 0.26236 1.09861 0.40547 + 72 1.04988 2.29119 1.14633 1.46503 74 a - - : + 1.38629 1.38629 1.38629 1.38629 + 0.01418 4.26268 * 1.46634 0.26236 0.00000 * +// +INFERNAL1/a [1.1rc1 | June 2012] +NAME 5S_rRNA +ACC RF00001 +DESC 5S ribosomal RNA +STATES 366 +NODES 91 +CLEN 119 +W 194 +ALPH RNA +RF no +CONS yes +MAP yes +DATE Wed Jun 13 05:38:49 2012 +COM [1] ./cmbuild 5S_rRNA.cm 5S_rRNA.sto +COM [2] ./cmcalibrate 5S_rRNA.cm +PBEGIN 0.05 +PEND 0.05 +WBETA 1e-07 +QDBBETA1 1e-07 +QDBBETA2 1e-15 +N2OMEGA 1.52588e-05 +N3OMEGA 1.52588e-05 +ELSELF -0.08926734 +NSEQ 712 +EFFN 7.433868 +CKSUM 4276491820 +NULL 0.000 0.000 0.000 0.000 +GA 16.00 +TC 22.36 +EFP7GF -8.5723 0.71822 +ECMLC 0.67926 -7.69058 0.61964 1600000 339385 0.003536 +ECMGC 0.40924 -15.61533 -6.37104 1600000 17582 0.022751 +ECMLI 0.59553 -5.30857 3.39282 1600000 213627 0.005617 +ECMGI 0.42140 -10.60787 -1.63456 1600000 17550 0.022792 +CM + [ ROOT 0 ] - - - - - - + S 0 -1 0 1 4 1 1 194 299 -8.149 -9.394 -0.213 -2.920 + IL 1 1 2 1 4 29 67 196 300 -2.817 -4.319 -0.613 -2.698 0.000 0.000 0.000 0.000 + IR 2 2 3 2 3 31 69 196 300 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 1 ] - 231 - c - - + MR 3 2 3 5 5 33 71 195 299 -8.108 -0.047 -7.923 -5.495 -9.027 -0.544 0.804 -1.352 0.234 + D 4 2 3 5 5 25 62 193 297 -6.511 -0.673 -2.947 -4.924 -2.327 + IR 5 5 3 5 5 29 67 195 299 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 2 ] 3 230 g c - - + MP 6 5 3 10 6 34 72 194 298 -9.727 -9.667 -0.015 -8.101 -8.723 -9.118 -1.796 -1.228 -2.016 1.254 -1.861 -2.412 1.479 -2.183 -2.024 1.795 -2.414 -0.380 1.313 -0.945 0.075 -1.147 + ML 7 5 3 10 6 27 64 191 296 -6.518 -6.864 -1.441 -1.146 -3.216 -4.243 0.732 -0.637 -0.336 -0.145 + MR 8 5 3 10 6 27 64 191 296 -7.290 -6.019 -1.258 -5.997 -1.028 -4.211 0.222 -0.274 -0.145 0.141 + D 9 5 3 10 6 23 59 187 291 -9.543 -8.241 -3.847 -4.518 -4.150 -0.276 + IL 10 10 5 10 6 29 66 193 297 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 11 11 6 11 5 29 67 193 297 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 3 ] 4 229 c g - - + MP 12 11 6 16 6 33 71 192 296 -9.745 -9.685 -0.014 -8.461 -8.541 -9.136 -1.398 -1.972 -1.476 1.153 -1.599 -2.821 1.776 -0.759 -2.037 0.970 -2.079 0.278 1.380 -1.338 0.141 -0.885 + ML 13 11 6 16 6 27 64 190 294 -6.344 -6.690 -1.181 -1.099 -6.540 -4.070 0.333 -0.380 -0.240 0.170 + MR 14 11 6 16 6 27 63 189 293 -7.205 -5.934 -1.598 -5.912 -0.804 -4.126 0.194 -0.386 -0.232 0.309 + D 15 11 6 16 6 23 58 185 289 -9.494 -8.193 -2.948 -4.237 -3.482 -0.468 + IL 16 16 5 16 6 28 65 191 295 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 17 17 6 17 5 28 66 191 295 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 4 ] 5 228 u a - - + MP 18 17 6 22 6 33 69 190 294 -9.759 -9.698 -0.015 -8.475 -8.386 -8.870 -1.644 -2.086 -1.824 1.626 -1.973 -2.951 1.748 -1.634 -2.136 0.978 -2.655 -0.610 1.757 -2.023 -0.041 -1.316 + ML 19 17 6 22 6 26 63 188 292 -6.271 -6.617 -1.280 -1.026 -6.467 -3.997 0.441 -0.436 -0.185 0.034 + MR 20 17 6 22 6 26 63 187 292 -7.197 -5.926 -1.268 -5.904 -1.038 -4.118 0.659 -0.499 -0.404 -0.063 + D 21 17 6 22 6 22 58 183 287 -9.291 -7.990 -3.650 -4.469 -3.455 -0.361 + IL 22 22 5 22 6 28 65 189 293 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 23 23 6 23 5 28 65 189 293 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 5 ] 6 227 u a - - + MP 24 23 6 28 6 32 68 188 292 -9.772 -9.711 -0.015 -8.139 -8.446 -9.162 -0.763 -2.036 -2.097 1.027 -2.020 -2.946 1.296 -2.420 -1.632 1.715 -2.736 -0.453 1.899 -1.579 -0.128 -1.280 + ML 25 23 6 28 6 26 62 186 290 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 26 23 6 28 6 26 62 185 289 -7.058 -5.787 -1.489 -5.765 -0.899 -3.979 0.325 -0.225 -0.338 0.138 + D 27 23 6 28 6 22 57 181 285 -9.224 -7.923 -3.602 -2.895 -4.419 -0.453 + IL 28 28 5 28 6 27 64 187 291 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 29 29 6 29 5 27 64 187 291 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 6 ] 7 226 G C - - + MP 30 29 6 34 6 31 66 186 290 -9.774 -7.769 -0.032 -6.644 -8.225 -8.530 -3.181 -2.552 -3.646 1.620 -4.346 -2.749 0.395 -3.915 -3.660 3.062 -4.315 -0.334 0.058 -3.571 -1.821 -1.707 + ML 31 29 6 34 6 26 62 184 288 -6.379 -6.725 -1.383 -0.926 -6.575 -4.104 0.436 -0.573 0.060 -0.101 + MR 32 29 6 34 6 25 61 183 287 -7.003 -5.732 -1.640 -5.710 -0.817 -3.923 0.430 -0.428 -0.185 0.043 + D 33 29 6 34 6 21 56 179 283 -9.083 -7.781 -3.418 -4.083 -4.277 -0.341 + IL 34 34 5 34 6 27 63 185 289 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 35 35 6 35 5 27 63 185 289 -2.454 -0.478 -5.965 -4.133 -5.239 0.000 0.000 0.000 0.000 + [ MATP 7 ] 8 224 c g - - + MP 36 35 6 40 6 30 65 184 288 -5.817 -9.701 -0.039 -8.478 -8.378 -8.822 -2.820 -2.924 -2.968 0.422 -1.344 -3.630 2.734 -2.971 -2.991 0.517 -0.986 -1.247 1.006 -2.946 1.099 -2.061 + ML 37 35 6 40 6 25 61 182 286 -6.555 -6.901 -1.581 -0.771 -6.751 -4.280 0.051 0.251 -0.638 0.177 + MR 38 35 6 40 6 25 60 181 285 -7.030 -5.759 -1.577 -5.737 -0.849 -3.951 0.435 -0.508 -0.024 -0.057 + D 39 35 6 40 6 21 56 177 281 -9.095 -7.793 -3.590 -4.272 -4.290 -0.308 + IL 40 40 5 40 6 27 62 183 287 -2.909 -2.344 -0.766 -4.827 -5.603 -5.263 0.000 0.000 0.000 0.000 + IR 41 41 6 41 5 27 62 183 287 -2.155 -0.546 -6.097 -4.265 -5.371 0.000 0.000 0.000 0.000 + [ MATP 8 ] 10 221 g c - - + MP 42 41 6 46 6 28 63 182 286 -9.763 -9.702 -0.031 -7.050 -6.738 -9.153 -2.984 -2.237 -2.955 1.376 -3.587 -2.872 0.367 -3.481 -2.686 2.522 -2.374 1.760 0.115 -3.153 -1.397 -1.809 + ML 43 41 6 46 6 25 60 180 284 -6.543 -6.889 -1.094 -1.149 -6.739 -4.269 0.168 -0.707 0.472 -0.189 + MR 44 41 6 46 6 24 59 179 284 -7.018 -5.747 -1.601 -5.725 -0.837 -3.939 0.391 -0.410 -0.218 0.107 + D 45 41 6 46 6 21 55 176 280 -9.112 -7.810 -3.607 -4.120 -4.307 -0.315 + IL 46 46 5 46 6 26 61 181 285 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 47 47 6 47 5 26 61 181 285 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 9 ] 11 220 g c - - + MP 48 47 6 52 6 27 61 180 284 -6.541 -9.698 -0.027 -8.474 -8.754 -9.149 -2.268 -1.533 -1.674 1.708 -2.475 -3.114 1.010 -0.949 -2.496 2.234 -3.069 -0.049 0.804 -2.447 -0.668 -0.965 + ML 49 47 6 52 6 24 59 178 282 -6.463 -6.809 -1.103 -1.154 -6.659 -4.188 0.377 -0.624 0.184 -0.126 + MR 50 47 6 52 6 23 57 177 281 -7.173 -5.902 -1.772 -5.880 -0.718 -4.094 0.180 -0.389 -0.344 0.395 + D 51 47 6 52 6 21 55 175 279 -9.103 -7.801 -3.598 -4.280 -4.297 -0.306 + IL 52 52 5 52 6 25 60 179 283 -2.778 -2.492 -0.769 -4.696 -5.472 -5.133 0.000 0.000 0.000 0.000 + IR 53 53 6 53 5 25 59 179 283 -2.464 -0.474 -5.975 -4.143 -5.249 0.000 0.000 0.000 0.000 + [ MATP 10 ] 13 218 c g - - + MP 54 53 6 58 4 25 59 178 282 -7.038 -1.402 -0.726 -6.708 -2.407 -2.556 -2.445 0.605 -0.506 -3.248 2.369 -2.741 -2.621 0.551 -2.224 -1.018 1.406 -2.575 1.227 -1.654 + ML 55 53 6 58 4 23 57 176 281 -3.782 -3.843 -0.508 -2.694 0.372 -0.435 -0.113 0.059 + MR 56 53 6 58 4 21 56 175 280 -5.009 -4.038 -1.905 -0.642 0.720 -0.627 -0.337 -0.130 + D 57 53 6 58 4 20 55 174 279 -4.619 -3.556 -2.316 -0.570 + IL 58 58 5 58 4 24 58 177 281 -1.754 -2.115 -1.185 -4.923 0.000 0.000 0.000 0.000 + IR 59 59 6 59 3 24 58 177 281 -2.897 -0.249 -5.357 0.000 0.000 0.000 0.000 + [ MATL 11 ] 15 - C - - - + ML 60 59 6 62 3 23 57 175 280 -7.340 -0.015 -7.889 -1.142 1.269 -1.129 -0.555 + D 61 59 6 62 3 20 54 173 277 -6.613 -1.932 -0.459 + IL 62 62 3 62 3 23 57 176 280 -1.478 -0.772 -4.178 0.000 0.000 0.000 0.000 + [ MATL 12 ] 17 - A - - - + ML 63 62 3 65 3 22 56 174 279 -9.238 -0.043 -5.190 1.618 -2.024 -1.559 -1.537 + D 64 62 3 65 3 20 54 173 277 -6.565 -1.139 -0.901 + IL 65 65 3 65 3 22 56 175 279 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 13 ] 18 - U - - - + ML 66 65 3 68 3 21 55 174 278 -7.315 -0.017 -7.612 -1.363 -1.257 -1.909 1.549 + D 67 65 3 68 3 19 53 172 276 -6.802 -2.197 -0.372 + IL 68 68 3 68 3 21 55 174 278 -1.478 -0.771 -4.178 0.000 0.000 0.000 0.000 + [ MATL 14 ] 20 - A - - - + ML 69 68 3 71 2 20 54 173 277 -9.775 -0.002 1.515 -2.000 -1.109 -1.220 + D 70 68 3 71 2 19 53 172 276 -8.491 -0.004 + IL 71 71 3 71 2 20 54 173 277 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ BIF 15 ] - - - - - - + B 72 71 3 73 231 19 53 172 276 + [ BEGL 16 ] - - - - - - + S 73 72 1 74 4 0 15 129 233 -0.026 -7.673 -6.956 -7.720 + [ MATP 17 ] 21 146 c g - - + MP 74 73 1 78 6 2 16 129 233 -9.782 -8.043 -0.017 -8.497 -8.777 -9.172 -3.373 -3.179 -3.463 0.465 -2.670 -4.202 2.529 -3.480 -3.486 2.100 -3.111 -0.838 1.150 -3.271 -0.560 -2.356 + ML 75 73 1 78 6 1 11 127 231 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 76 73 1 78 6 1 9 127 231 -7.003 -5.732 -1.640 -5.710 -0.817 -3.923 0.398 -0.458 -0.065 -0.003 + D 77 73 1 78 6 0 6 124 229 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 78 78 5 78 6 1 12 128 232 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 79 79 6 79 5 1 12 128 232 -2.444 -0.482 -5.955 -4.123 -5.229 0.000 0.000 0.000 0.000 + [ MATP 18 ] 22 144 c g - - + MP 80 79 6 84 4 2 14 127 231 -4.502 -6.156 -0.099 -6.926 -3.050 -3.094 -3.187 0.605 -1.829 -3.853 2.881 -2.966 -3.062 0.701 -2.544 -1.265 1.353 -3.172 0.098 -2.198 + ML 81 79 6 84 4 1 10 126 230 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 82 79 6 84 4 1 7 125 229 -4.827 -3.856 -1.668 -0.784 0.398 -0.458 -0.065 -0.003 + D 83 79 6 84 4 0 6 124 228 -4.568 -4.250 -2.265 -0.520 + IL 84 84 5 84 4 1 12 127 231 -1.295 -2.498 -1.331 -5.809 0.000 0.000 0.000 0.000 + IR 85 85 6 85 3 1 11 126 230 -1.626 -0.676 -4.326 0.000 0.000 0.000 0.000 + [ MATL 19 ] 27 - a - - - + ML 86 85 6 88 3 1 12 125 229 -9.591 -0.008 -7.909 0.638 -1.266 0.332 -0.377 + D 87 85 6 88 3 0 5 123 227 -5.620 -0.734 -1.403 + IL 88 88 3 88 3 1 10 125 229 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 20 ] - 142 - u - - + MR 89 88 3 91 3 1 12 124 228 -9.591 -0.012 -7.148 0.341 -0.452 -1.252 0.662 + D 90 88 3 91 3 0 3 122 226 -6.390 -1.568 -0.620 + IR 91 91 3 91 3 1 9 124 228 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 21 ] - 141 - U - - + MR 92 91 3 94 5 1 11 123 227 -8.270 -0.018 -7.924 -8.298 -9.189 -0.766 0.066 -1.672 1.037 + D 93 91 3 94 5 0 2 121 225 -5.397 -0.679 -3.024 -4.455 -2.449 + IR 94 94 3 94 5 1 6 123 227 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 22 ] 28 140 g c - - + MP 95 94 3 99 6 2 11 122 226 -7.484 -9.721 -0.020 -8.300 -8.778 -9.173 -3.200 -2.453 -3.204 1.362 -2.989 -3.462 1.363 -3.631 -3.429 2.711 -3.885 -0.322 0.839 -3.112 -0.997 -2.023 + ML 96 94 3 99 6 1 4 120 224 -6.259 -6.605 -1.297 -1.014 -6.455 -3.984 0.355 -0.381 -0.206 0.119 + MR 97 94 3 99 6 1 4 119 224 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 98 94 3 99 6 0 0 115 220 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 99 99 5 99 6 1 6 121 225 -2.677 -2.939 -0.696 -4.595 -5.371 -5.031 0.000 0.000 0.000 0.000 + IR 100 100 6 100 5 1 6 121 225 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 23 ] 30 139 c g - - + MP 101 100 6 105 6 2 10 120 224 -7.456 -9.721 -0.020 -8.498 -8.777 -9.172 -2.004 -2.124 -2.134 1.185 -2.010 -2.928 2.101 -2.511 -2.256 1.454 -1.687 -0.537 1.265 -2.121 0.100 -0.938 + ML 102 100 6 105 6 1 3 118 222 -6.262 -6.609 -1.292 -1.017 -6.458 -3.988 0.350 -0.380 -0.212 0.129 + MR 103 100 6 105 6 1 3 118 222 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 104 100 6 105 6 0 0 114 218 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 105 105 5 105 6 1 5 119 223 -2.679 -2.942 -0.695 -4.597 -5.373 -5.034 0.000 0.000 0.000 0.000 + IR 106 106 6 106 5 1 5 119 223 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 24 ] 32 138 g c - - + MP 107 106 6 111 6 2 9 118 222 -7.621 -9.722 -0.020 -8.222 -8.778 -9.173 -2.352 -2.057 -2.508 1.888 -2.495 -2.537 1.364 -2.767 -2.579 1.896 -3.103 0.082 1.188 -2.616 -0.421 -1.454 + ML 108 106 6 111 6 1 3 116 220 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 109 106 6 111 6 1 3 116 220 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 110 106 6 111 6 0 0 113 217 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 111 111 5 111 6 1 4 117 221 -2.666 -2.929 -0.703 -4.584 -5.360 -5.021 0.000 0.000 0.000 0.000 + IR 112 112 6 112 5 1 4 117 221 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 25 ] 34 137 c g - - + MP 113 112 6 117 6 2 7 116 220 -8.008 -9.721 -0.018 -8.255 -8.777 -9.172 -2.393 -2.482 -2.419 1.090 -1.881 -3.301 2.106 -2.796 -2.611 1.602 -2.620 -0.947 1.570 -2.594 0.226 -1.700 + ML 114 112 6 117 6 1 2 115 219 -6.268 -6.614 -1.285 -1.023 -6.464 -3.993 0.431 -0.429 -0.185 0.042 + MR 115 112 6 117 6 1 2 115 219 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 116 112 6 117 6 0 0 112 216 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 117 117 5 117 6 1 4 115 219 -2.640 -2.903 -0.719 -4.558 -5.334 -4.995 0.000 0.000 0.000 0.000 + IR 118 118 6 118 5 1 3 115 219 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 26 ] 36 136 g c - - + MP 119 118 6 123 4 2 5 114 218 -5.944 -3.971 -0.138 -6.499 -2.262 -1.457 -2.460 0.918 -2.557 -1.755 0.790 -2.487 -2.162 2.508 -2.972 -0.402 0.943 0.285 -0.541 -1.476 + ML 120 118 6 123 4 1 1 114 218 -3.770 -3.952 -0.502 -2.681 0.398 -0.453 -0.073 0.002 + MR 121 118 6 123 4 1 1 114 218 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 122 118 6 123 4 0 0 112 216 -4.568 -4.250 -2.265 -0.520 + IL 123 123 5 123 4 1 3 121 225 -1.253 -2.895 -1.245 -5.381 0.000 0.000 0.000 0.000 + IR 124 124 6 124 3 1 2 127 231 -0.255 -3.301 -4.045 0.000 0.000 0.000 0.000 + [ MATL 27 ] 40 - a - - - + ML 125 124 6 127 3 1 3 73 122 -9.174 -0.009 -7.828 0.532 -1.107 0.508 -0.584 + D 126 124 6 127 3 0 0 71 121 -7.362 -0.610 -1.563 + IL 127 127 3 127 3 1 1 73 123 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 28 ] 41 - A - - - + ML 128 127 3 130 3 1 2 72 121 -4.684 -0.064 -7.749 1.177 -0.946 -1.261 -0.318 + D 129 127 3 130 3 0 0 69 118 -6.306 -1.558 -0.626 + IL 130 130 3 130 3 1 2 78 128 -0.554 -1.750 -5.545 0.000 0.000 0.000 0.000 + [ MATL 29 ] 52 - a - - - + ML 131 130 3 133 3 1 1 69 118 -7.402 -0.032 -5.991 0.960 -0.382 -1.560 -0.077 + D 132 130 3 133 3 0 0 67 117 -5.659 -0.708 -1.442 + IL 133 133 3 133 3 1 1 69 118 -1.976 -0.531 -4.214 0.000 0.000 0.000 0.000 + [ MATR 30 ] - 118 - G - - + MR 134 133 3 136 3 1 2 68 117 -7.564 -0.014 -7.892 -0.308 -2.145 1.433 -1.906 + D 135 133 3 136 3 0 0 66 115 -6.685 -1.301 -0.775 + IR 136 136 3 136 3 1 1 68 117 -1.968 -0.535 -4.207 0.000 0.000 0.000 0.000 + [ MATR 31 ] - 116 - A - - + MR 137 136 3 139 3 1 2 67 116 -9.587 -0.008 -7.904 1.903 -3.559 -3.485 -3.546 + D 138 136 3 139 3 0 0 65 114 -6.482 -1.660 -0.573 + IR 139 139 3 139 3 1 1 67 116 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 32 ] - 115 - A - - + MR 140 139 3 142 3 1 1 66 115 -9.587 -0.009 -7.612 1.899 -3.448 -3.427 -3.532 + D 141 139 3 142 3 0 0 64 113 -6.482 -1.660 -0.573 + IR 142 142 3 142 3 1 1 66 115 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 33 ] - 114 - U - - + MR 143 142 3 145 5 1 1 65 114 -8.268 -0.027 -8.083 -6.672 -9.187 -1.293 -1.179 -0.842 1.374 + D 144 142 3 145 5 0 0 63 112 -5.419 -0.689 -2.933 -4.476 -2.470 + IR 145 145 3 145 5 1 1 65 114 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 34 ] 54 113 g u - - + MP 146 145 3 150 6 2 2 64 113 -9.775 -9.714 -0.015 -8.491 -8.235 -9.166 -1.136 -0.090 -2.376 1.409 -2.098 -2.200 1.071 -0.591 -1.633 0.686 -1.874 1.701 0.712 -2.152 -0.486 -0.975 + ML 147 145 3 150 6 1 1 62 112 -6.268 -6.615 -1.329 -0.987 -6.464 -3.994 0.399 -0.461 -0.059 -0.007 + MR 148 145 3 150 6 1 1 62 111 -7.100 -5.829 -1.440 -5.808 -0.924 -4.021 0.338 -0.285 -0.367 0.189 + D 149 145 3 150 6 0 0 59 108 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 150 150 5 150 6 1 1 63 112 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 151 151 6 151 5 1 1 63 112 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 35 ] 55 112 c g - - + MP 152 151 6 156 4 2 2 62 111 -6.850 -8.508 -0.029 -6.922 -2.645 -2.777 -1.695 0.445 -1.899 -2.894 2.900 -2.644 -2.840 0.427 -2.830 -1.184 0.975 -2.957 0.651 -1.895 + ML 153 151 6 156 4 1 1 61 110 -3.772 -3.954 -0.501 -2.684 0.343 -0.305 -0.247 0.111 + MR 154 151 6 156 4 1 1 60 109 -4.852 -3.881 -1.667 -0.779 0.423 -0.501 -0.020 -0.050 + D 155 151 6 156 4 0 0 58 108 -4.568 -4.250 -2.265 -0.520 + IL 156 156 5 156 4 1 1 62 111 -1.772 -2.455 -1.023 -4.941 0.000 0.000 0.000 0.000 + IR 157 157 6 157 3 1 1 61 111 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 36 ] 57 - A - - - + ML 158 157 6 160 3 1 1 60 109 -4.761 -0.077 -6.039 1.304 -1.926 -0.585 -0.733 + D 159 157 6 160 3 0 0 56 105 -6.203 -1.716 -0.552 + IL 160 160 3 160 3 1 1 68 117 -0.538 -1.786 -5.562 0.000 0.000 0.000 0.000 + [ MATL 37 ] 68 - C - - - + ML 161 160 3 163 3 1 1 44 73 -4.692 -0.063 -7.892 -2.686 1.783 -3.106 -1.796 + D 162 160 3 163 3 0 0 43 71 -5.840 -0.604 -1.623 + IL 163 163 3 163 3 1 1 45 73 -1.723 -0.602 -4.714 0.000 0.000 0.000 0.000 + [ MATR 38 ] - 111 - A - - + MR 164 163 3 166 3 1 1 43 72 -5.140 -0.053 -7.043 1.660 -1.403 -2.209 -2.021 + D 165 163 3 166 3 0 0 41 70 -6.390 -1.568 -0.620 + IR 166 166 3 166 3 1 1 44 72 -2.198 -0.442 -4.437 0.000 0.000 0.000 0.000 + [ MATR 39 ] - 109 - A - - + MR 167 166 3 169 5 1 1 42 71 -8.269 -0.025 -8.085 -6.836 -9.188 1.281 -0.532 -1.819 -0.748 + D 168 166 3 169 5 0 0 41 69 -5.405 -0.674 -3.032 -4.463 -2.457 + IR 169 169 3 169 5 1 1 42 71 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 40 ] 71 108 c g - - + MP 170 169 3 174 6 2 2 41 70 -9.777 -6.793 -0.027 -8.493 -8.385 -8.453 -2.108 -2.357 -2.020 0.732 -0.671 -3.032 2.600 -2.545 -2.376 0.709 -1.329 -0.854 1.131 -2.460 0.259 -1.573 + ML 171 169 3 174 6 1 1 39 68 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 172 169 3 174 6 1 1 39 68 -7.083 -5.812 -1.663 -5.790 -0.790 -4.004 0.544 -0.507 -0.260 0.006 + D 173 169 3 174 6 0 0 37 65 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 174 174 5 174 6 1 1 41 69 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 175 175 6 175 5 1 1 40 69 -2.512 -0.456 -6.023 -4.191 -5.296 0.000 0.000 0.000 0.000 + [ MATP 41 ] 72 106 g c - - + MP 176 175 6 180 6 2 2 39 68 -9.775 -9.715 -0.013 -8.491 -8.771 -9.166 -2.851 -1.013 -2.733 0.931 -2.826 -3.771 1.936 -3.126 -2.974 2.289 -3.437 -0.714 1.315 -2.980 -0.771 -2.081 + ML 177 175 6 180 6 1 1 38 66 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 178 175 6 180 6 1 1 37 66 -7.083 -5.812 -1.445 -5.790 -0.924 -4.003 0.229 -0.092 -0.419 0.192 + D 179 175 6 180 6 0 0 35 63 -9.092 -7.790 -3.587 -4.269 -4.286 -0.309 + IL 180 180 5 180 6 1 1 39 67 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 181 181 6 181 5 1 1 38 67 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 42 ] 73 105 G C - - + MP 182 181 6 186 6 2 2 37 66 -6.017 -9.720 -0.035 -8.497 -8.776 -8.924 -4.084 -2.336 -3.937 0.870 -4.760 -4.547 0.892 -4.526 -3.543 3.251 -4.592 -0.407 -0.045 -3.817 -1.750 -2.897 + ML 183 181 6 186 6 1 1 36 64 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 184 181 6 186 6 1 1 36 64 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 185 181 6 186 6 0 0 33 61 -9.092 -7.790 -3.587 -4.269 -4.286 -0.309 + IL 186 186 5 186 6 1 1 38 67 -1.176 -3.765 -1.219 -5.420 -6.196 -5.857 0.000 0.000 0.000 0.000 + IR 187 187 6 187 5 1 1 36 65 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 43 ] 78 104 a u - - + MP 188 187 6 192 4 2 2 35 64 -6.951 -9.391 -0.044 -5.615 -3.456 -2.853 -3.157 2.648 -3.594 -4.334 0.545 -3.424 -3.630 1.852 -4.110 -0.409 1.354 -3.601 -1.342 -2.543 + ML 189 187 6 192 4 1 1 34 63 -2.408 -4.532 -1.293 -1.473 0.368 -0.385 -0.191 0.094 + MR 190 187 6 192 4 1 1 34 62 -4.102 -12.528 -0.390 -2.485 0.368 -0.385 -0.191 0.094 + D 191 187 6 192 4 0 0 32 60 -12.978 -14.248 -2.277 -0.334 + IL 192 192 5 192 4 1 1 34 63 -2.872 -4.374 -0.585 -2.753 0.000 0.000 0.000 0.000 + IR 193 193 6 193 3 1 1 35 63 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 44 ] - 103 - C - - + MR 194 193 6 196 3 1 1 33 62 -9.584 -0.008 -7.902 -2.828 1.825 -3.959 -1.985 + D 195 193 6 196 3 0 0 31 60 -6.529 -1.706 -0.551 + IR 196 196 3 196 3 1 1 34 62 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 45 ] - 102 - A - - + MR 197 196 3 199 5 1 1 32 61 -6.478 -0.058 -8.082 -7.979 -5.588 1.272 -1.440 -1.901 -0.077 + D 198 196 3 199 5 0 0 31 59 -5.431 -0.786 -3.058 -4.489 -2.106 + IR 199 199 3 199 5 1 1 32 61 -2.479 -0.468 -5.991 -4.158 -5.264 0.000 0.000 0.000 0.000 + [ MATP 46 ] 80 100 u a - - + MP 200 199 3 204 6 2 2 31 60 -9.758 -9.698 -0.013 -8.474 -8.754 -9.149 -0.561 -2.210 -2.229 0.728 -1.441 -3.080 1.145 -2.543 -2.140 0.582 -2.860 -0.860 2.665 -1.351 -0.331 -1.241 + ML 201 199 3 204 6 1 1 30 59 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 202 199 3 204 6 1 1 30 58 -7.001 -5.730 -1.597 -5.708 -0.842 -3.922 0.425 -0.425 -0.185 0.047 + D 203 199 3 204 6 0 0 27 56 -9.568 -8.266 -4.063 -4.745 -4.763 -0.215 + IL 204 204 5 204 6 1 1 31 59 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 205 205 6 205 5 1 1 30 59 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 47 ] 81 99 C G - - + MP 206 205 6 210 4 2 2 29 58 -4.782 -1.465 -0.754 -6.889 -4.926 -4.877 -3.370 -0.988 -1.932 -5.295 3.525 -4.311 -4.748 -0.824 -4.376 -2.776 0.219 -5.048 0.496 -3.576 + ML 207 205 6 210 4 1 1 29 58 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 208 205 6 210 4 1 1 28 56 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 209 205 6 210 4 0 0 27 55 -5.059 -4.304 -2.756 -0.375 + IL 210 210 5 210 4 1 1 32 61 -0.932 -2.911 -1.611 -5.997 0.000 0.000 0.000 0.000 + IR 211 211 6 211 3 1 1 21 39 -1.678 -0.598 -5.212 0.000 0.000 0.000 0.000 + [ MATL 48 ] 86 - C - - - + ML 212 211 6 214 3 1 1 18 36 -9.210 -0.009 -7.865 -1.743 1.502 -2.606 -0.504 + D 213 211 6 214 3 0 0 17 36 -6.968 -1.888 -0.470 + IL 214 214 3 214 3 1 1 22 40 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 49 ] 87 - C - - - + ML 215 214 3 217 3 1 1 17 35 -9.221 -0.009 -7.875 -3.361 1.857 -3.332 -2.471 + D 216 214 3 217 3 0 0 16 35 -6.830 -2.343 -0.333 + IL 217 217 3 217 3 1 1 21 39 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 50 ] 88 - A - - - + ML 218 217 3 220 3 1 1 15 34 -9.221 -0.009 -7.875 1.335 -2.439 0.000 -1.772 + D 219 217 3 220 3 0 0 15 34 -6.830 -2.343 -0.333 + IL 220 220 3 220 3 1 1 20 38 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 51 ] 89 - U - - - + ML 221 220 3 223 3 1 1 14 32 -9.221 -0.028 -5.855 -2.222 -2.344 -3.184 1.799 + D 222 220 3 223 3 0 0 14 33 -6.830 -2.290 -0.346 + IL 223 223 3 223 3 1 1 19 37 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 52 ] 90 - C - - - + ML 224 223 3 226 3 1 1 12 31 -9.203 -0.009 -7.857 -1.082 1.147 -1.771 0.029 + D 225 223 3 226 3 0 0 13 31 -7.063 -2.576 -0.278 + IL 226 226 3 226 3 1 1 18 36 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 53 ] 91 - c - - - + ML 227 226 3 229 2 1 1 1 1 * 0.000 0.206 0.710 -1.859 -0.097 + D 228 226 3 229 2 0 0 0 0 * 0.000 + IL 229 229 3 229 2 1 1 13 28 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ END 54 ] - - - - - - + E 230 229 3 -1 0 0 0 0 0 + [ BEGR 55 ] - - - - - - + S 231 72 1 232 5 0 13 61 83 -6.354 -0.038 -6.989 -7.993 -9.193 + IL 232 232 2 232 5 1 11 62 85 -2.321 -0.504 -4.207 -6.039 -5.313 0.000 0.000 0.000 0.000 + [ MATP 56 ] 149 214 g u - - + MP 233 232 2 237 6 2 14 61 83 -5.601 -9.717 -0.042 -8.493 -8.773 -9.168 -1.636 0.740 -5.238 0.183 -5.051 -1.269 0.932 -2.364 -0.585 0.265 -0.597 2.641 -0.778 -2.207 -1.438 -1.470 + ML 234 232 2 237 6 1 9 60 82 -6.334 -6.680 -1.375 -0.939 -6.529 -4.059 0.353 -0.541 0.126 -0.082 + MR 235 232 2 237 6 1 8 59 82 -7.001 -5.730 -1.598 -5.708 -0.842 -3.922 0.345 -0.378 -0.217 0.137 + D 236 232 2 237 6 0 5 57 80 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 237 237 5 237 6 1 11 61 84 -1.727 -1.960 -1.404 -5.201 -5.977 -5.638 0.000 0.000 0.000 0.000 + IR 238 238 6 238 5 1 11 60 82 -2.634 -0.413 -6.145 -4.313 -5.419 0.000 0.000 0.000 0.000 + [ MATP 57 ] 153 212 C G - - + MP 239 238 6 243 6 2 12 59 81 -9.779 -9.718 -0.013 -8.494 -8.774 -9.169 -3.298 -3.513 -3.457 0.374 -2.240 -4.100 3.048 -3.290 -3.634 0.764 -4.170 -1.289 1.346 -3.740 -0.483 -2.293 + ML 240 238 6 243 6 1 8 58 81 -6.326 -6.673 -1.387 -0.932 -6.522 -4.052 0.264 -0.365 -0.309 0.281 + MR 241 238 6 243 6 1 7 58 80 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 242 238 6 243 6 0 5 56 79 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 243 243 5 243 6 1 9 59 81 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 244 244 6 244 5 1 9 58 81 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 58 ] 154 211 c g - - + MP 245 244 6 249 4 2 10 57 79 -6.277 -5.206 -0.071 -6.921 -2.671 -2.103 -2.824 0.712 -2.475 -3.661 2.326 -2.929 -2.423 1.732 -3.251 -0.077 1.347 -2.958 -0.109 -1.906 + ML 246 244 6 249 4 1 8 58 80 -3.185 -3.998 -0.564 -2.727 0.264 -0.365 -0.309 0.281 + MR 247 244 6 249 4 1 6 57 79 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 248 244 6 249 4 0 5 56 78 -4.568 -4.250 -2.265 -0.520 + IL 249 249 5 249 4 1 9 59 81 -1.617 -2.052 -1.303 -5.180 0.000 0.000 0.000 0.000 + IR 250 250 6 250 3 1 9 58 81 -1.199 -0.929 -4.680 0.000 0.000 0.000 0.000 + [ MATL 59 ] 157 - a - - - + ML 251 250 6 253 3 1 8 53 74 -9.591 -0.029 -5.769 0.521 -0.810 0.056 -0.067 + D 252 250 6 253 3 0 4 52 73 -5.620 -0.734 -1.403 + IL 253 253 3 253 3 1 7 54 75 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 60 ] - 206 - a - - + MR 254 253 3 256 5 1 8 52 73 -8.254 -0.017 -8.069 -8.282 -9.173 0.499 -0.615 -0.650 0.374 + D 255 253 3 256 5 0 3 51 72 -5.561 -0.589 -3.188 -4.619 -2.613 + IR 256 256 3 256 5 1 6 53 74 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 61 ] 158 205 g c - - + MP 257 256 3 261 6 2 7 51 72 -9.782 -9.722 -0.013 -8.498 -8.778 -9.173 -3.594 -1.398 -3.549 1.954 -4.170 -4.226 0.385 -4.106 -3.471 2.874 -2.402 -0.261 0.099 -3.037 -1.742 -2.565 + ML 258 256 3 261 6 1 4 50 71 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 259 256 3 261 6 1 4 50 71 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 260 256 3 261 6 0 2 48 69 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 261 261 5 261 6 1 5 51 72 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 262 262 6 262 5 1 5 51 72 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 62 ] 159 204 g c - - + MP 263 262 6 267 4 2 5 49 70 -8.306 -8.513 -0.021 -6.927 -1.295 0.457 -1.630 1.135 -1.565 -2.793 1.178 -2.053 -1.599 1.373 -2.416 -0.453 1.063 -1.302 0.966 -1.223 + ML 264 262 6 267 4 1 3 50 71 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 265 262 6 267 4 1 3 49 70 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 266 262 6 267 4 0 1 48 69 -4.568 -4.250 -2.265 -0.520 + IL 267 267 5 267 4 1 4 51 72 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 268 268 6 268 3 1 4 50 71 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 63 ] 160 - g - - - + ML 269 268 6 271 3 1 3 47 68 -9.258 -0.253 -2.649 -0.554 -0.996 0.887 -0.048 + D 270 268 6 271 3 0 1 46 67 -6.174 -1.687 -0.566 + IL 271 271 3 271 3 1 4 49 70 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 64 ] 161 - U - - - + ML 272 271 3 274 3 1 3 46 67 -9.015 -0.256 -2.637 -0.193 -0.886 -1.555 1.166 + D 273 271 3 274 3 0 1 44 65 -8.350 -3.863 -0.107 + IL 274 274 3 274 3 1 4 48 69 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 65 ] 162 - A - - - + ML 275 274 3 277 3 1 3 45 66 -4.064 -0.098 -7.424 1.539 -1.920 -1.512 -1.063 + D 276 274 3 277 3 0 1 44 65 -9.082 -0.539 -1.690 + IL 277 277 3 277 3 1 3 46 67 -1.665 -0.644 -4.480 0.000 0.000 0.000 0.000 + [ MATL 66 ] 165 - G - - - + ML 278 277 3 280 3 1 2 44 65 -9.485 -0.013 -7.059 -2.479 -2.794 1.834 -3.172 + D 279 277 3 280 3 0 0 43 64 -6.623 -0.349 -2.288 + IL 280 280 3 280 3 1 2 45 66 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 67 ] - 203 - a - - + MR 281 280 3 283 3 1 1 43 64 -9.584 -0.593 -1.574 0.614 -0.294 -1.162 0.271 + D 282 280 3 283 3 0 0 42 63 -6.527 -1.705 -0.551 + IR 283 283 3 283 3 1 2 44 65 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 68 ] - 202 - g - - + MR 284 283 3 286 5 1 2 42 63 -4.454 -0.087 -7.522 -7.734 -8.626 -0.265 -0.497 0.441 0.140 + D 285 283 3 286 5 0 0 41 62 -7.581 -0.126 -5.207 -6.638 -4.599 + IR 286 286 3 286 5 1 1 43 64 -2.453 -0.450 -6.192 -4.359 -5.465 0.000 0.000 0.000 0.000 + [ MATP 69 ] 166 199 U A - - + MP 287 286 3 291 4 2 2 41 62 -8.305 -5.965 -0.040 -6.926 -4.488 -4.475 -4.409 -0.719 -3.382 -5.027 1.108 -4.080 -4.404 -0.572 -4.824 -2.471 3.143 -3.043 1.527 -2.776 + ML 288 286 3 291 4 1 1 42 64 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 289 286 3 291 4 1 1 42 63 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 290 286 3 291 4 0 0 41 62 -4.578 -4.259 -2.275 -0.516 + IL 291 291 5 291 4 1 1 44 65 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 292 292 6 292 3 1 1 43 65 -1.245 -0.912 -4.429 0.000 0.000 0.000 0.000 + [ MATL 70 ] 167 - A - - - + ML 293 292 6 295 3 1 1 38 57 -9.591 -0.008 -7.909 1.858 -2.993 -3.037 -2.961 + D 294 292 6 295 3 0 0 36 55 -5.628 -0.742 -1.389 + IL 295 295 3 295 3 1 1 39 57 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 71 ] - 195 - A - - + MR 296 295 3 298 5 1 1 37 56 -8.273 -0.042 -8.089 -7.454 -5.973 1.838 -2.853 -3.067 -2.586 + D 297 295 3 298 5 0 0 35 54 -5.358 -0.713 -2.985 -4.416 -2.377 + IR 298 298 3 298 5 1 1 37 56 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 72 ] 168 194 c g - - + MP 299 298 3 303 6 2 2 36 55 -9.766 -9.705 -0.014 -8.482 -8.563 -9.156 -2.733 -2.856 -2.334 0.391 -1.204 -3.734 2.965 -2.980 -2.657 0.480 -0.477 -1.162 0.963 -3.045 -0.470 -2.022 + ML 300 298 3 303 6 1 1 35 54 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 301 298 3 303 6 1 1 35 54 -7.032 -5.761 -1.670 -5.739 -0.795 -3.953 0.382 -0.511 0.049 -0.059 + D 302 298 3 303 6 0 0 33 52 -9.387 -8.085 -3.882 -4.564 -4.582 -0.246 + IL 303 303 5 303 6 1 1 36 55 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 304 304 6 304 5 1 1 35 54 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 73 ] 169 193 u g - - + MP 305 304 6 309 4 2 2 34 53 -8.278 -7.058 -0.037 -6.130 -1.928 -2.061 -2.121 0.801 -2.074 -2.890 1.304 -2.300 -2.147 0.660 -2.027 -0.759 1.157 -0.534 2.057 -0.401 + ML 306 304 6 309 4 1 1 35 54 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 307 304 6 309 4 1 1 34 53 -4.870 -3.899 -1.767 -0.725 0.284 -0.323 -0.303 0.230 + D 308 304 6 309 4 0 0 33 52 -4.886 -4.568 -2.281 -0.477 + IL 309 309 5 309 4 1 1 36 55 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 310 310 6 310 3 1 1 35 54 -1.478 -0.771 -4.178 0.000 0.000 0.000 0.000 + [ MATL 74 ] 170 - a - - - + ML 311 310 6 313 3 1 1 31 50 -9.227 -0.009 -7.881 0.580 -1.175 0.193 -0.122 + D 312 310 6 313 3 0 0 30 49 -6.742 -1.612 -0.592 + IL 313 313 3 313 3 1 1 34 53 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 75 ] 171 - g - - - + ML 314 313 3 316 3 1 1 30 49 -9.238 -0.020 -6.368 -0.459 -0.427 0.710 -0.163 + D 315 313 3 316 3 0 0 29 48 -6.561 -1.896 -0.472 + IL 316 316 3 316 3 1 1 33 52 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 76 ] 172 - G - - - + ML 317 316 3 319 3 1 1 29 48 -9.229 -0.184 -3.085 -0.463 -1.613 1.387 -1.590 + D 318 316 3 319 3 0 0 28 47 -6.704 -1.917 -0.463 + IL 319 319 3 319 3 1 1 32 51 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 77 ] 173 - a - - - + ML 320 319 3 322 3 1 1 28 47 -6.927 -0.221 -2.901 0.878 -1.108 0.203 -0.868 + D 321 319 3 322 3 0 0 26 45 -8.136 -2.091 -0.393 + IL 322 322 3 322 3 1 1 31 50 -1.411 -0.809 -4.230 0.000 0.000 0.000 0.000 + [ MATL 78 ] 176 - U - - - + ML 323 322 3 325 3 1 1 27 45 -9.255 -0.027 -5.898 -1.601 -1.701 -2.543 1.674 + D 324 322 3 325 3 0 0 26 44 -7.602 -0.454 -1.917 + IL 325 325 3 325 3 1 1 28 46 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 79 ] - 191 - G - - + MR 326 325 3 328 3 1 1 26 44 -9.508 -0.011 -7.330 -1.105 -1.898 1.554 -1.595 + D 327 325 3 328 3 0 0 24 43 -7.463 -1.821 -0.491 + IR 328 328 3 328 3 1 1 27 45 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 80 ] - 190 - U - - + MR 329 328 3 331 3 1 1 25 43 -9.525 -0.012 -7.176 -1.149 -0.282 -1.838 1.291 + D 330 328 3 331 3 0 0 23 42 -7.300 -1.374 -0.718 + IR 331 331 3 331 3 1 1 26 44 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 81 ] - 189 - c - - + MR 332 331 3 334 3 1 1 24 42 -9.551 -0.013 -7.065 -0.182 0.552 -0.244 -0.308 + D 333 331 3 334 3 0 0 22 40 -7.012 -2.107 -0.396 + IR 334 334 3 334 3 1 1 25 43 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 82 ] - 188 - C - - + MR 335 334 3 337 3 1 1 23 41 -9.548 -0.038 -5.361 -1.373 1.223 -1.695 -0.043 + D 336 334 3 337 3 0 0 21 40 -7.050 -1.960 -0.443 + IR 337 337 3 337 3 1 1 24 42 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 83 ] - 187 - u - - + MR 338 337 3 340 5 1 1 22 40 -6.182 -0.050 -6.897 -6.857 -8.403 0.071 -0.302 -0.292 0.403 + D 339 337 3 340 5 0 0 21 39 -5.938 -0.751 -3.347 -4.995 -1.945 + IR 340 340 3 340 5 1 1 22 41 -2.497 -0.461 -6.008 -4.176 -5.282 0.000 0.000 0.000 0.000 + [ MATP 84 ] 177 185 G C - - + MP 341 340 3 345 6 2 2 21 39 -9.753 -7.711 -0.032 -6.430 -8.749 -9.144 -3.738 -1.220 -3.660 1.069 -4.231 -4.192 0.897 -4.219 -3.985 3.097 -3.019 -0.212 -0.026 -3.460 -1.127 -2.680 + ML 342 340 3 345 6 1 1 21 39 -6.371 -6.717 -1.407 -0.909 -6.567 -4.096 0.364 -0.417 -0.308 0.211 + MR 343 340 3 345 6 1 1 21 39 -7.075 -5.804 -1.713 -5.782 -0.764 -3.996 0.304 -0.211 -0.244 0.080 + D 344 340 3 345 6 0 0 19 38 -9.472 -8.170 -3.967 -4.649 -4.666 -0.231 + IL 345 345 5 345 6 1 1 21 39 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 346 346 6 346 5 1 1 20 39 -2.456 -0.477 -5.967 -4.134 -5.240 0.000 0.000 0.000 0.000 + [ MATP 85 ] 178 183 g c - - + MP 347 346 6 351 4 2 2 19 37 -8.238 -8.445 -0.092 -4.176 -3.289 -2.479 -3.398 1.153 -3.711 -3.984 1.173 -2.892 -3.369 2.939 -3.394 -0.326 0.462 -3.390 -0.867 -2.386 + ML 348 346 6 351 4 1 1 20 39 -4.016 -4.199 -0.422 -2.862 0.032 0.132 -0.654 0.318 + MR 349 346 6 351 4 1 1 20 38 -4.910 -3.939 -1.750 -0.727 0.405 -0.307 -0.323 0.094 + D 350 346 6 351 4 0 0 19 37 -4.967 -4.648 -2.664 -0.376 + IL 351 351 5 351 4 1 1 22 40 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 352 352 6 352 3 1 1 21 39 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 86 ] 179 - G - - - + ML 353 352 6 355 3 1 1 15 34 -9.156 -0.009 -7.810 -1.525 -2.476 1.650 -1.581 + D 354 352 6 355 3 0 0 15 33 -7.525 -2.057 -0.407 + IL 355 355 3 355 3 1 1 20 38 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 87 ] 180 - u - - - + ML 356 355 3 358 3 1 1 14 32 -9.176 -0.013 -7.052 -0.102 -0.626 -0.627 0.826 + D 357 355 3 358 3 0 0 14 32 -7.343 -1.405 -0.699 + IL 358 358 3 358 3 1 1 19 37 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 88 ] 181 - G - - - + ML 359 358 3 361 3 1 1 12 31 -9.208 -0.010 -7.512 -0.723 -1.500 1.340 -0.976 + D 360 358 3 361 3 0 0 13 31 -7.003 -2.247 -0.355 + IL 361 361 3 361 3 1 1 18 36 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 89 ] 182 - A - - - + ML 362 361 3 364 2 1 1 1 1 * 0.000 1.472 -1.591 -1.296 -1.040 + D 363 361 3 364 2 0 0 0 0 * 0.000 + IL 364 364 3 364 2 1 1 13 28 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ END 90 ] - - - - - - + E 365 364 3 -1 0 0 0 0 0 +// +HMMER3/f [i1.1rc1 | June 2012] +NAME 5S_rRNA +ACC RF00001 +DESC 5S ribosomal RNA +LENG 119 +MAXL 305 +ALPH RNA +RF no +MM no +CONS yes +CS yes +MAP yes +DATE Wed Jun 13 05:38:49 2012 +COM [1] ./cmbuild 5S_rRNA.cm 5S_rRNA.sto +NSEQ 712 +EFFN 13.626495 +CKSUM 4276491820 +STATS LOCAL MSV -9.0439 0.71822 +STATS LOCAL VITERBI -10.6642 0.71822 +STATS LOCAL FORWARD -3.7829 0.71822 +HMM A C G U + m->m m->i m->d i->m i->i d->m d->d + COMPO 1.39167 1.39007 1.29965 1.47117 + 1.38629 1.38629 1.38629 1.38629 + 0.05356 3.91429 3.43585 1.07010 0.42003 0.00000 * + 1 1.57270 1.57116 1.17285 1.29016 3 g - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02780 4.70662 3.99624 1.46634 0.26236 0.90410 0.51904 + 2 1.65891 1.20987 1.47581 1.26293 4 c - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.01864 4.71595 4.65487 1.46634 0.26236 1.04577 0.43297 + 3 1.34714 1.37511 1.75716 1.15622 5 u - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.01959 4.72746 4.55144 1.46634 0.26236 0.61461 0.77838 + 4 1.69588 1.79779 1.21836 1.03513 6 u - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.01857 4.74011 4.63959 1.46634 0.26236 1.04432 0.43376 + 5 1.52658 2.45758 0.49731 2.42002 7 G - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02074 4.74989 4.43334 1.46634 0.26236 1.08855 0.41054 + 6 2.65240 0.62738 2.06097 1.31602 8 C - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.04661 3.35102 4.55680 0.43774 1.03703 1.05455 0.42825 + 7 1.70979 2.65586 0.40336 2.51591 10 G - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02899 4.74769 3.91674 1.46634 0.26236 1.12622 0.39194 + 8 1.28477 1.83759 0.90079 1.84620 11 g - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.03342 3.72513 4.73791 0.61513 0.77777 1.45097 0.26702 + 9 2.31976 0.84209 2.16015 1.03399 13 c - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02462 4.33761 4.48696 1.03997 0.43613 1.51654 0.24778 + 10 2.45611 0.41228 2.19079 1.96421 15 C - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02236 4.31671 4.73618 1.02385 0.44505 1.36859 0.29365 + 11 0.20537 3.06618 2.62740 2.70616 17 A - - , + 1.38629 1.38629 1.38629 1.38629 + 0.04187 4.73821 3.43420 1.46634 0.26236 0.62267 0.76897 + 12 2.60685 2.42805 2.90421 0.24433 18 U - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02351 4.30386 4.63393 1.02017 0.44712 1.63317 0.21730 + 13 0.26748 3.13355 2.24951 2.45716 20 A - - , + 1.38629 1.38629 1.38629 1.38629 + 0.01879 4.72790 4.62806 1.46634 0.26236 0.42448 1.06164 + 14 2.57941 0.86014 1.09883 1.78488 21 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.01743 4.75130 4.75130 1.46634 0.26236 1.13301 0.38870 + 15 2.36997 0.57026 2.10902 1.51513 22 C - - < + 1.38629 1.38629 1.38629 1.38629 + 0.05931 3.01700 4.75130 0.83467 0.56919 1.03317 0.43986 + 16 0.90060 2.45897 1.09110 1.75850 27 a - - - + 1.38629 1.38629 1.38629 1.38629 + 0.01742 4.75221 4.75221 1.46634 0.26236 1.09861 0.40547 + 17 1.71422 1.74408 0.69796 1.91399 28 g - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02471 4.14943 4.75221 0.87603 0.53859 1.09861 0.40547 + 18 1.72877 1.13375 1.38033 1.38958 30 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02489 4.13837 4.75221 0.86780 0.54451 1.09861 0.40547 + 19 1.22601 1.67974 1.18678 1.53751 32 g - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02388 4.20206 4.75221 0.91621 0.51088 1.09861 0.40547 + 20 1.82077 1.17814 1.39299 1.26614 34 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02191 4.33961 4.75221 1.02983 0.44172 1.09861 0.40547 + 21 1.98037 2.15703 0.71674 1.35490 36 g - - < + 1.38629 1.38629 1.38629 1.38629 + 0.09133 3.84013 2.72124 1.21872 0.35042 1.09861 0.40547 + 22 0.98487 2.28671 0.95347 1.96961 40 g - - - + 1.38629 1.38629 1.38629 1.38629 + 0.01848 4.69335 4.69335 1.46634 0.26236 0.30043 1.34899 + 23 0.49496 2.14028 2.42981 1.68886 41 A - - - + 1.38629 1.38629 1.38629 1.38629 + 0.05718 3.06999 4.69331 1.99775 0.14577 0.97514 0.47343 + 24 0.64790 1.65526 2.77810 1.49764 52 A - - - + 1.38629 1.38629 1.38629 1.38629 + 0.02964 4.30823 4.15117 1.00448 0.45608 0.96339 0.48061 + 25 1.28229 1.68148 0.94961 1.89973 54 g - - < + 1.38629 1.38629 1.38629 1.38629 + 0.01923 4.74510 4.57079 1.46634 0.26236 0.78065 0.61269 + 26 2.43411 0.49500 2.45157 1.52972 55 C - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02297 4.26475 4.74996 0.96824 0.47764 1.03801 0.43720 + 27 0.40404 3.18918 1.81688 2.05073 57 A - - - + 1.38629 1.38629 1.38629 1.38629 + 0.06634 3.11556 3.92035 2.06001 0.13634 1.13329 0.38857 + 28 3.67248 0.10594 3.73261 2.97237 68 C - - - + 1.38629 1.38629 1.38629 1.38629 + 0.06452 3.04269 4.21477 0.67007 0.71677 0.60588 0.78877 + 29 2.13576 0.66485 1.87806 1.53894 71 C - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02051 4.74623 4.45563 1.46634 0.26236 1.17909 0.36753 + 30 1.85625 1.29320 0.99900 1.60393 72 g - - < + 1.38629 1.38629 1.38629 1.38629 + 0.01755 4.74447 4.74447 1.46634 0.26236 0.83664 0.56768 + 31 2.20725 2.10061 0.36588 2.60333 73 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.04165 3.45375 4.69184 1.40153 0.28266 1.16524 0.37375 + 32 0.68689 2.79585 1.39447 1.67220 78 A - - < + 1.38629 1.38629 1.38629 1.38629 + 0.04734 4.32126 3.41266 1.01590 0.44954 1.18388 0.36541 + 33 1.83090 1.85964 2.10055 0.57694 80 U - - < + 1.38629 1.38629 1.38629 1.38629 + 0.01790 4.72530 4.72530 1.46634 0.26236 1.71247 0.19896 + 34 3.79453 0.20705 3.79151 1.95219 81 C - - < + 1.38629 1.38629 1.38629 1.38629 + 0.05921 3.18450 4.12929 1.24682 0.33886 1.78832 0.18301 + 35 2.90483 0.28145 3.48391 1.83344 86 C - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.01801 4.71889 4.71889 1.46634 0.26236 1.31945 0.31100 + 36 4.31814 0.06420 3.84075 3.59807 87 C - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.01788 4.72615 4.72615 1.46634 0.26236 1.78832 0.18301 + 37 0.40001 3.66651 1.34962 3.10601 88 A - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.01788 4.72615 4.72615 1.46634 0.26236 1.78832 0.18301 + 38 3.20464 3.38919 3.98738 0.09746 89 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.03141 4.72615 3.81407 1.46634 0.26236 1.72973 0.19520 + 39 2.39314 0.50020 2.80681 1.41942 90 C - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.01811 4.71341 4.71341 1.46634 0.26236 1.92913 0.15697 + 40 1.23881 0.79185 3.11276 1.54747 91 c - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.48661 0.97912 4.64059 0.37658 1.15902 1.08021 0.41480 + 41 2.81178 4.02911 0.10519 3.81861 99 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.01841 4.72669 4.66810 1.46634 0.26236 1.77818 0.18506 + 42 0.57850 2.10798 1.74759 1.94084 100 A - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02682 4.03975 4.72615 0.81563 0.58405 0.57645 0.82529 + 43 0.41879 2.66590 3.17692 1.46574 102 A - - - + 1.38629 1.38629 1.38629 1.38629 + 0.01751 4.74685 4.74685 1.46634 0.26236 1.28637 0.32334 + 44 3.67689 0.08476 4.61351 3.07803 103 C - - - + 1.38629 1.38629 1.38629 1.38629 + 0.01751 4.74685 4.74685 1.46634 0.26236 0.98434 0.46791 + 45 1.74791 1.54842 2.61140 0.61647 104 U - - > + 1.38629 1.38629 1.38629 1.38629 + 0.01746 4.74990 4.74990 1.46634 0.26236 1.12529 0.39239 + 46 2.81561 0.40853 1.98800 1.97660 105 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.01745 4.75042 4.75042 1.46634 0.26236 1.16524 0.37375 + 47 1.74090 0.98476 1.20765 1.88251 106 c - - > + 1.38629 1.38629 1.38629 1.38629 + 0.03029 3.85424 4.75042 0.68082 0.70563 0.97736 0.47209 + 48 1.69103 2.20712 0.56236 1.99666 108 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02105 4.75221 4.40648 1.46634 0.26236 1.09861 0.40547 + 49 0.41869 1.75438 3.03565 2.11172 109 A - - - + 1.38629 1.38629 1.38629 1.38629 + 0.04671 3.29767 4.74864 0.41684 1.07624 0.88187 0.53445 + 50 0.18616 2.39246 3.25322 3.22384 111 A - - - + 1.38629 1.38629 1.38629 1.38629 + 0.01841 4.75221 4.64546 1.46634 0.26236 1.09861 0.40547 + 51 2.15968 2.59901 0.33029 2.39060 112 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.01743 4.75124 4.75124 1.46634 0.26236 1.13548 0.38753 + 52 1.99092 1.68847 1.76029 0.67997 113 U - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02101 4.75124 4.41060 1.46634 0.26236 1.13548 0.38753 + 53 2.71619 2.39754 1.96965 0.35179 114 U - - - + 1.38629 1.38629 1.38629 1.38629 + 0.01749 4.74772 4.74772 1.46634 0.26236 1.15128 0.38014 + 54 0.04579 4.05772 4.26774 4.30801 115 A - - - + 1.38629 1.38629 1.38629 1.38629 + 0.01748 4.74870 4.74870 1.46634 0.26236 1.22549 0.34759 + 55 0.04372 4.15974 4.31311 4.28473 116 A - - - + 1.38629 1.38629 1.38629 1.38629 + 0.03044 4.36063 4.06230 1.05150 0.42988 1.22549 0.34759 + 56 1.64438 3.09190 0.33484 3.07913 118 G - - - + 1.38629 1.38629 1.38629 1.38629 + 0.08231 2.66710 4.65024 2.63483 0.07443 0.60758 0.78673 + 57 2.03390 0.54539 2.09112 1.79571 136 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.01838 4.75140 4.64837 1.46634 0.26236 1.03960 0.43633 + 58 1.52176 1.48233 0.98571 1.70710 137 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.01743 4.75127 4.75127 1.46634 0.26236 1.03112 0.44100 + 59 1.76484 1.36388 1.53229 1.02980 138 u - - > + 1.38629 1.38629 1.38629 1.38629 + 0.01808 4.75221 4.67944 1.46634 0.26236 1.09861 0.40547 + 60 1.73738 1.55301 0.93663 1.51203 139 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.01790 4.75156 4.69902 1.46634 0.26236 1.05069 0.43031 + 61 2.12817 0.76181 1.64809 1.50639 140 c - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02050 4.75174 4.45242 1.46634 0.26236 1.06389 0.42329 + 62 2.09944 1.30232 2.78698 0.60887 141 U - - - + 1.38629 1.38629 1.38629 1.38629 + 0.01747 4.74919 4.74919 1.46634 0.26236 0.90932 0.51550 + 63 1.12553 1.73856 2.43550 0.88627 142 u - - - + 1.38629 1.38629 1.38629 1.38629 + 0.04236 3.41604 4.75221 0.46214 0.99407 1.09861 0.40547 + 64 1.77559 2.31390 0.48082 2.17625 144 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02168 4.35708 4.75221 1.04522 0.43327 1.09861 0.40547 + 65 1.99260 1.18843 0.79101 2.24834 146 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02812 4.00162 4.66233 0.91433 0.51214 1.09861 0.40547 + 66 1.64687 1.88570 0.55608 2.49894 149 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.04965 3.22389 4.75140 0.87204 0.54145 1.03960 0.43633 + 67 2.56624 0.47903 2.14111 1.68056 153 C - - < + 1.38629 1.38629 1.38629 1.38629 + 0.01742 4.75221 4.75221 1.46634 0.26236 1.09861 0.40547 + 68 2.15733 1.00783 1.21874 1.49720 154 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.03138 3.80477 4.75221 0.86423 0.54711 1.09861 0.40547 + 69 0.99113 2.03017 1.29946 1.49232 157 a - - - + 1.38629 1.38629 1.38629 1.38629 + 0.01742 4.75221 4.75221 1.46634 0.26236 1.09861 0.40547 + 70 1.19472 2.61899 0.60614 2.53982 158 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.01742 4.75221 4.75221 1.46634 0.26236 1.09861 0.40547 + 71 1.24026 1.82926 1.40481 1.18828 159 u - - < + 1.38629 1.38629 1.38629 1.38629 + 0.01742 4.75221 4.75221 1.46634 0.26236 1.09861 0.40547 + 72 1.95830 2.18302 0.67121 1.44771 160 G - - - + 1.38629 1.38629 1.38629 1.38629 + 0.19183 4.75221 1.79625 1.46634 0.26236 1.09861 0.40547 + 73 1.55882 2.14991 2.71916 0.49891 161 U - - - + 1.38629 1.38629 1.38629 1.38629 + 0.19692 4.58108 1.78080 1.46634 0.26236 3.05495 0.04827 + 74 0.23906 3.10495 2.67677 2.31241 162 A - - - + 1.38629 1.38629 1.38629 1.38629 + 0.08653 2.64901 4.40880 0.39562 1.11861 0.33907 1.24630 + 75 3.62515 3.42756 0.07760 4.16362 165 G - - - + 1.38629 1.38629 1.38629 1.38629 + 0.01882 4.67558 4.67558 1.46634 0.26236 0.19530 1.72930 + 76 3.99979 2.47170 3.85289 0.13237 166 U - - < + 1.38629 1.38629 1.38629 1.38629 + 0.01742 4.75179 4.75179 1.46634 0.26236 1.11454 0.39759 + 77 0.07219 3.66285 3.88658 3.75189 167 A - - - + 1.38629 1.38629 1.38629 1.38629 + 0.03589 4.75179 3.62636 1.46634 0.26236 1.11454 0.39759 + 78 2.49136 0.52239 1.77889 1.86254 168 C - - < + 1.38629 1.38629 1.38629 1.38629 + 0.01831 4.73365 4.67299 1.46634 0.26236 1.63506 0.21684 + 79 2.11626 1.82158 2.01907 0.53620 169 U - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02368 4.73310 4.22667 1.46634 0.26236 1.34238 0.30276 + 80 0.94450 2.38605 1.19603 1.52905 170 a - - - + 1.38629 1.38629 1.38629 1.38629 + 0.01780 4.73043 4.73043 1.46634 0.26236 1.06105 0.42479 + 81 1.87335 1.67110 0.79683 1.57215 171 g - - - + 1.38629 1.38629 1.38629 1.38629 + 0.02584 4.73836 4.08903 1.46634 0.26236 1.33289 0.30614 + 82 1.78785 2.61906 0.35502 2.83618 172 G - - - + 1.38629 1.38629 1.38629 1.38629 + 0.14243 4.73219 2.08789 1.46634 0.26236 1.35137 0.29960 + 83 0.71157 2.28284 1.18444 2.29048 173 a - - - + 1.38629 1.38629 1.38629 1.38629 + 0.17124 4.11308 1.95885 1.13798 0.38635 1.47233 0.26057 + 84 2.79616 2.89597 3.57998 0.15568 176 U - - - + 1.38629 1.38629 1.38629 1.38629 + 0.04233 4.50810 3.49232 1.46634 0.26236 0.12141 2.16870 + 85 1.88005 2.10188 0.44719 2.45612 177 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.01788 4.72621 4.72621 1.46634 0.26236 1.78725 0.18323 + 86 1.91363 1.87173 0.54393 2.13590 178 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.06554 4.72621 2.90807 1.46634 0.26236 1.68621 0.20484 + 87 2.69048 3.32857 0.19843 2.57321 179 G - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.01872 4.68040 4.68040 1.46634 0.26236 1.45838 0.26476 + 88 1.51105 1.89131 1.83563 0.75729 180 u - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02171 4.69481 4.39573 1.46634 0.26236 0.91534 0.51146 + 89 2.05144 2.56458 0.37643 2.22382 181 G - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.01927 4.71687 4.59125 1.46634 0.26236 1.66416 0.20992 + 90 0.29095 2.71621 2.42987 2.31996 182 A - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.04715 4.71862 3.29334 1.46634 0.26236 0.71546 0.67132 + 91 2.47068 0.59877 1.73304 1.66474 183 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02467 4.21079 4.65319 0.95576 0.48535 1.07936 0.41523 + 92 2.89420 0.47590 1.87196 1.77483 185 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.05748 3.92054 3.32331 0.73698 0.65116 1.29130 0.32146 + 93 1.37382 1.59599 1.56526 1.09326 187 u - - - + 1.38629 1.38629 1.38629 1.38629 + 0.02220 4.70365 4.35072 1.46634 0.26236 0.93069 0.50134 + 94 2.70116 0.45182 2.69372 1.47501 188 C - - - + 1.38629 1.38629 1.38629 1.38629 + 0.01909 4.72094 4.60525 1.46634 0.26236 1.56378 0.23489 + 95 1.59909 0.89795 1.52264 1.75807 189 c - - - + 1.38629 1.38629 1.38629 1.38629 + 0.03973 4.72318 3.50443 1.46634 0.26236 1.58431 0.22953 + 96 2.48033 1.58308 2.92502 0.41965 190 U - - - + 1.38629 1.38629 1.38629 1.38629 + 0.03300 4.70445 3.75467 1.46634 0.26236 1.94125 0.15493 + 97 2.34430 2.82881 0.25091 2.70445 191 G - - - + 1.38629 1.38629 1.38629 1.38629 + 0.03823 4.26890 3.75046 1.02079 0.44677 0.26158 1.46896 + 98 1.86517 1.88933 0.66192 1.72544 193 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.01770 4.73642 4.73642 1.46634 0.26236 1.57174 0.23279 + 99 1.88522 2.46689 0.40614 2.33160 194 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.01770 4.73642 4.73642 1.46634 0.26236 0.55403 0.85479 + 100 0.08342 3.58390 3.96156 3.40421 195 A - - - + 1.38629 1.38629 1.38629 1.38629 + 0.03080 3.83084 4.75179 1.21753 0.35092 1.11454 0.39759 + 101 0.41950 3.71717 1.22796 3.67176 199 A - - > + 1.38629 1.38629 1.38629 1.38629 + 0.50360 3.26420 1.02883 0.50271 0.92858 1.11454 0.39759 + 102 1.70888 1.75276 0.97385 1.31673 202 g - - - + 1.38629 1.38629 1.38629 1.38629 + 0.02688 4.32288 4.32288 1.46634 0.26236 0.06204 2.81085 + 103 0.91309 1.59202 2.35632 1.20252 203 a - - - + 1.38629 1.38629 1.38629 1.38629 + 0.01751 4.74691 4.74691 1.46634 0.26236 0.80652 0.59133 + 104 1.73667 1.12534 1.22471 1.58226 204 c - - > + 1.38629 1.38629 1.38629 1.38629 + 0.01742 4.75221 4.75221 1.46634 0.26236 1.09861 0.40547 + 105 2.77242 0.65646 2.34478 1.13030 205 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.03256 4.75221 3.75477 1.46634 0.26236 1.09861 0.40547 + 106 1.00645 1.87472 1.88017 1.11315 206 a - - - + 1.38629 1.38629 1.38629 1.38629 + 0.05717 3.15522 4.34765 0.98140 0.46966 0.55253 0.85682 + 107 1.72914 1.42318 0.88514 1.77810 211 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.01749 4.74809 4.74809 1.46634 0.26236 1.24603 0.33918 + 108 1.84084 2.28406 0.44435 2.32070 212 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.04716 3.28632 4.74769 0.41295 1.08381 1.24603 0.33918 + 109 2.37248 1.54265 1.73356 0.66110 214 U - - > + 1.38629 1.38629 1.38629 1.38629 + 0.49067 0.97186 4.66650 0.06906 2.70706 0.85635 0.55288 + 110 1.48119 2.39208 0.57363 2.13945 218 G - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.03365 4.17785 4.03062 0.90154 0.52078 1.12641 0.39185 + 111 2.16176 1.00295 1.84034 1.02355 220 c - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02893 4.73565 3.92493 1.46634 0.26236 0.79240 0.60286 + 112 2.75950 0.92211 2.41708 0.79891 221 u - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.03010 3.90722 4.65105 1.00936 0.45327 1.42673 0.27456 + 113 2.04876 2.54679 0.34674 2.45590 224 G - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02530 4.24522 4.54223 0.96670 0.47858 0.58562 0.81364 + 114 2.71006 0.53694 2.43661 1.34141 226 C - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.01757 4.74327 4.74327 1.46634 0.26236 1.03468 0.43903 + 115 1.08825 1.31970 1.57541 1.66571 227 a - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.01877 4.74068 4.61906 1.46634 0.26236 1.05467 0.42818 + 116 1.30500 1.90432 1.23739 1.23870 228 g - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02945 4.73682 3.89949 1.46634 0.26236 1.14082 0.38501 + 117 1.54949 1.81702 1.11385 1.21456 229 g - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02360 4.71593 4.24251 1.46634 0.26236 1.36142 0.29611 + 118 1.63641 1.13762 1.36145 1.47643 230 c - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.09479 4.70311 2.50877 1.46634 0.26236 1.59070 0.22788 + 119 1.91428 0.72686 2.48256 1.25317 231 c - - : + 1.38629 1.38629 1.38629 1.38629 + 0.00992 4.61824 * 1.46634 0.26236 0.00000 * +// +INFERNAL1/a [1.1rc1 | June 2012] +NAME Cobalamin +ACC RF00174 +DESC Cobalamin riboswitch +STATES 592 +NODES 163 +CLEN 191 +W 460 +ALPH RNA +RF no +CONS yes +MAP yes +DATE Wed Jun 13 05:40:07 2012 +COM [1] ./cmbuild Cobalamin.cm ../tutorial/Cobalamin.sto +COM [2] ./cmcalibrate Cobalamin.cm +PBEGIN 0.05 +PEND 0.05 +WBETA 1e-07 +QDBBETA1 1e-07 +QDBBETA2 1e-15 +N2OMEGA 1.52588e-05 +N3OMEGA 1.52588e-05 +ELSELF -0.08926734 +NSEQ 431 +EFFN 6.652168 +CKSUM 2307274568 +NULL 0.000 0.000 0.000 0.000 +GA 39.00 +TC 39.00 +NC 38.79 +EFP7GF -9.3826 0.71319 +ECMLC 0.69050 -9.55632 -0.82028 1600000 499982 0.002400 +ECMGC 0.33713 -30.56949 -21.45119 1600000 8652 0.046232 +ECMLI 0.68481 -7.98572 0.30786 1600000 351369 0.003415 +ECMGI 0.38286 -21.23885 -13.16656 1600000 8796 0.045475 +CM + [ ROOT 0 ] - - - - - - + S 0 -1 0 1 4 0 1 460 771 -8.175 -8.382 -0.025 -6.528 + IL 1 1 2 1 4 86 133 462 774 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 2 2 3 2 3 86 133 462 774 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 1 ] 1 - u - - - + ML 3 2 3 5 3 86 132 461 772 -9.129 -0.009 -7.783 0.192 -0.324 -0.320 0.331 + D 4 2 3 5 3 80 128 458 769 -6.226 -1.577 -0.618 + IL 5 5 3 5 3 85 132 461 773 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 2 ] 2 - u - - - + ML 6 5 3 8 3 85 131 460 771 -9.131 -0.009 -7.785 0.129 -0.155 -0.410 0.328 + D 7 5 3 8 3 79 127 457 768 -6.174 -1.687 -0.566 + IL 8 8 3 8 3 84 131 460 772 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 3 ] 3 - a - - - + ML 9 8 3 11 3 84 130 459 770 -9.131 -0.009 -7.785 0.349 0.003 -0.625 0.105 + D 10 8 3 11 3 78 126 456 767 -6.174 -1.687 -0.566 + IL 11 11 3 11 3 83 130 459 771 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 4 ] 4 - a - - - + ML 12 11 3 14 3 84 130 458 769 -9.131 -0.009 -7.785 0.314 -0.335 -0.248 0.166 + D 13 11 3 14 3 77 125 455 766 -6.174 -1.687 -0.566 + IL 14 14 3 14 3 82 129 458 770 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 5 ] 5 - a - - - + ML 15 14 3 17 3 83 129 457 768 -9.131 -0.009 -7.785 0.495 -0.371 -0.748 0.289 + D 16 14 3 17 3 77 124 454 765 -6.174 -1.687 -0.566 + IL 17 17 3 17 3 81 128 457 769 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 6 ] 6 - u - - - + ML 18 17 3 20 3 82 128 456 767 -9.131 -0.009 -7.785 0.164 -0.374 -0.119 0.247 + D 19 17 3 20 3 76 123 453 764 -6.174 -1.687 -0.566 + IL 20 20 3 20 3 81 127 456 768 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 7 ] 7 - u - - - + ML 21 20 3 23 3 81 127 455 766 -9.131 -0.009 -7.785 0.082 -0.109 -0.425 0.344 + D 22 20 3 23 3 75 122 452 763 -6.174 -1.687 -0.566 + IL 23 23 3 23 3 80 126 455 767 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 8 ] 8 - g - - - + ML 24 23 3 26 3 80 126 454 765 -9.131 -0.009 -7.785 0.058 -0.422 0.170 0.121 + D 25 23 3 26 3 74 121 451 762 -6.174 -1.687 -0.566 + IL 26 26 3 26 3 79 125 454 766 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 9 ] 9 - a - - - + ML 27 26 3 29 3 79 125 453 764 -9.131 -0.009 -7.785 0.332 -0.477 -0.179 0.189 + D 28 26 3 29 3 73 120 450 762 -6.174 -1.687 -0.566 + IL 29 29 3 29 3 78 125 453 765 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 10 ] 10 - a - - - + ML 30 29 3 32 3 78 124 452 763 -9.131 -0.009 -7.785 0.284 -0.018 -0.378 0.036 + D 31 29 3 32 3 72 119 449 761 -6.174 -1.687 -0.566 + IL 32 32 3 32 3 77 124 452 764 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 11 ] 11 - a - - - + ML 33 32 3 35 3 77 123 451 762 -9.131 -0.009 -7.785 0.100 0.027 -0.007 -0.129 + D 34 32 3 35 3 72 119 448 760 -6.174 -1.687 -0.566 + IL 35 35 3 35 3 76 123 451 763 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 12 ] 12 - c - - - + ML 36 35 3 38 3 76 122 450 761 -9.131 -0.009 -7.785 -0.230 0.204 -0.120 0.105 + D 37 35 3 38 3 71 118 447 759 -6.174 -1.687 -0.566 + IL 38 38 3 38 3 76 122 450 762 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 13 ] 13 - g - - - + ML 39 38 3 41 3 76 121 449 760 -9.131 -0.009 -7.785 0.009 -0.100 0.156 -0.079 + D 40 38 3 41 3 70 117 446 758 -6.174 -1.687 -0.566 + IL 41 41 3 41 3 75 121 449 761 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 14 ] 14 - a - - - + ML 42 41 3 44 3 75 120 448 759 -9.131 -0.009 -7.785 0.083 -0.134 0.049 -0.008 + D 43 41 3 44 3 69 116 445 757 -6.174 -1.687 -0.566 + IL 44 44 3 44 3 74 120 448 760 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 15 ] 15 - u - - - + ML 45 44 3 47 3 74 119 447 758 -9.468 -0.009 -7.786 -0.170 0.079 -0.663 0.510 + D 46 44 3 47 3 69 115 445 756 -5.620 -0.734 -1.403 + IL 47 47 3 47 3 72 119 447 759 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 16 ] - 441 - c - - + MR 48 47 3 50 3 73 118 446 757 -9.468 -0.009 -7.786 -0.254 0.366 -0.228 0.027 + D 49 47 3 50 3 67 113 443 755 -6.390 -1.568 -0.620 + IR 50 50 3 50 3 72 118 446 758 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 17 ] - 440 - c - - + MR 51 50 3 53 3 72 117 445 756 -9.468 -0.009 -7.786 -0.108 0.286 -0.568 0.237 + D 52 50 3 53 3 66 112 442 754 -6.390 -1.568 -0.620 + IR 53 53 3 53 3 71 117 445 757 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 18 ] - 439 - u - - + MR 54 53 3 56 3 71 116 444 755 -9.468 -0.009 -7.786 0.079 -0.400 -0.004 0.249 + D 55 53 3 56 3 65 111 441 753 -6.390 -1.568 -0.620 + IR 56 56 3 56 3 70 116 444 756 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 19 ] - 438 - c - - + MR 57 56 3 59 3 70 115 443 754 -9.468 -0.009 -7.786 0.036 0.206 -0.277 -0.006 + D 58 56 3 59 3 64 110 440 752 -6.390 -1.568 -0.620 + IR 59 59 3 59 3 69 115 443 755 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 20 ] - 437 - u - - + MR 60 59 3 62 3 70 114 442 753 -9.468 -0.009 -7.786 0.103 0.022 -0.337 0.163 + D 61 59 3 62 3 63 109 439 751 -6.390 -1.568 -0.620 + IR 62 62 3 62 3 68 114 442 754 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 21 ] - 436 - a - - + MR 63 62 3 65 3 69 113 441 752 -9.468 -0.009 -7.786 0.238 0.190 -0.636 0.051 + D 64 62 3 65 3 62 108 438 750 -6.390 -1.568 -0.620 + IR 65 65 3 65 3 67 113 441 753 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 22 ] - 435 - a - - + MR 66 65 3 68 3 68 112 440 751 -9.468 -0.009 -7.786 0.314 -0.441 -0.057 0.083 + D 67 65 3 68 3 61 107 437 749 -6.390 -1.568 -0.620 + IR 68 68 3 68 3 66 112 440 752 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 23 ] - 434 - g - - + MR 69 68 3 71 3 67 111 439 750 -9.468 -0.009 -7.786 0.134 -0.461 0.181 0.059 + D 70 68 3 71 3 60 106 436 748 -6.390 -1.568 -0.620 + IR 71 71 3 71 3 65 111 439 751 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 24 ] - 433 - u - - + MR 72 71 3 74 3 66 111 438 749 -9.468 -0.009 -7.786 0.188 -0.403 -0.088 0.218 + D 73 71 3 74 3 60 105 435 747 -6.390 -1.568 -0.620 + IR 74 74 3 74 3 65 110 438 750 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 25 ] - 432 - u - - + MR 75 74 3 77 3 65 110 437 748 -9.468 -0.009 -7.786 0.112 -0.175 -0.451 0.380 + D 76 74 3 77 3 59 104 434 746 -6.390 -1.568 -0.620 + IR 77 77 3 77 3 64 109 437 749 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 26 ] - 431 - u - - + MR 78 77 3 80 3 65 109 436 747 -9.468 -0.009 -7.786 0.020 -0.033 -0.127 0.128 + D 79 77 3 80 3 58 103 433 745 -6.390 -1.568 -0.620 + IR 80 80 3 80 3 63 108 436 748 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 27 ] - 430 - u - - + MR 81 80 3 83 3 64 108 435 746 -9.468 -0.009 -7.786 -0.038 -0.179 0.062 0.136 + D 82 80 3 83 3 57 102 432 744 -6.390 -1.568 -0.620 + IR 83 83 3 83 3 62 107 435 747 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 28 ] - 429 - u - - + MR 84 83 3 86 3 63 107 434 745 -9.468 -0.009 -7.786 0.083 -0.101 -0.195 0.182 + D 85 83 3 86 3 56 101 431 743 -6.390 -1.568 -0.620 + IR 86 86 3 86 3 61 106 434 746 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 29 ] - 428 - g - - + MR 87 86 3 89 3 62 106 433 744 -9.468 -0.009 -7.786 0.143 -0.128 0.150 -0.199 + D 88 86 3 89 3 55 100 430 742 -6.390 -1.568 -0.620 + IR 89 89 3 89 3 60 105 433 745 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 30 ] - 427 - a - - + MR 90 89 3 92 5 62 105 432 743 -8.155 -0.019 -7.970 -8.182 -9.074 0.295 -0.462 -0.174 0.215 + D 91 89 3 92 5 54 99 429 741 -5.352 -0.707 -2.978 -4.409 -2.404 + IR 92 92 3 92 5 59 103 432 743 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 31 ] 16 426 g c - - + MP 93 92 3 97 6 61 104 431 742 -9.704 -9.643 -0.014 -8.420 -8.699 -9.094 -1.415 -1.836 -1.598 1.186 -1.576 -2.244 1.452 -2.078 -1.764 1.615 -2.117 -0.269 1.542 -1.947 0.137 -0.910 + ML 94 92 3 97 6 56 100 428 740 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 95 92 3 97 6 56 99 428 740 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 96 92 3 97 6 51 94 423 735 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 97 97 5 97 6 58 102 430 741 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 98 98 6 98 5 58 102 430 741 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 32 ] 17 425 a u - - + MP 99 98 6 103 6 59 102 429 741 -9.704 -9.643 -0.014 -8.420 -8.699 -9.094 -1.642 -1.330 -1.649 1.749 -1.863 -2.105 1.616 -1.840 -1.978 0.893 -2.155 -0.605 1.282 -1.385 0.470 -0.844 + ML 100 98 6 103 6 55 99 426 738 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 101 98 6 103 6 55 98 426 738 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 102 98 6 103 6 51 94 422 733 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 103 103 5 103 6 57 100 428 740 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 104 104 6 104 5 57 100 428 739 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 33 ] 18 424 u a - - + MP 105 104 6 109 6 58 100 427 739 -9.704 -9.643 -0.014 -8.420 -8.699 -9.094 -1.669 -1.421 -1.713 1.438 -1.139 -2.661 1.639 -2.003 -1.923 0.744 -2.357 -0.491 1.889 -1.792 -0.036 -0.977 + ML 106 104 6 109 6 54 98 425 736 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 107 104 6 109 6 54 97 424 736 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 108 104 6 109 6 50 93 421 732 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 109 109 5 109 6 56 99 426 738 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 110 110 6 110 5 56 99 426 737 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 34 ] 19 423 G C - - + MP 111 110 6 115 6 56 99 425 737 -9.704 -9.643 -0.014 -8.420 -8.699 -9.094 -4.129 -0.716 -3.976 0.875 -4.999 -3.719 -0.159 -4.637 -4.342 3.350 -4.278 -0.303 -0.369 -3.670 -1.735 -2.951 + ML 112 110 6 115 6 53 96 423 735 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 113 110 6 115 6 53 96 423 734 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 114 110 6 115 6 50 93 420 731 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 115 115 5 115 6 54 97 424 736 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 116 116 6 116 5 54 97 424 736 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 35 ] 20 422 G C - - + MP 117 116 6 121 6 54 97 423 735 -9.704 -9.643 -0.015 -8.420 -8.220 -9.094 -5.280 -2.748 -5.263 -0.123 -6.269 -5.043 -1.298 -5.871 -4.525 3.727 -5.233 -1.042 -1.493 -3.243 -3.351 -4.221 + ML 118 116 6 121 6 52 95 422 733 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 119 116 6 121 6 52 95 421 733 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 120 116 6 121 6 50 93 419 731 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 121 121 5 121 6 53 96 422 734 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 122 122 6 122 5 53 96 422 734 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 36 ] 21 421 U G - - + MP 123 122 6 127 4 52 95 421 733 -8.173 -8.380 -0.712 -1.385 -4.222 -3.227 -3.253 -0.577 -3.258 -4.806 1.264 -3.926 -3.690 -0.396 -4.615 -2.283 0.767 -3.388 3.242 -3.107 + ML 124 122 6 127 4 51 94 420 732 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 125 122 6 127 4 51 93 420 732 -4.837 -3.866 -1.733 -0.748 0.331 -0.272 -0.270 0.118 + D 126 122 6 127 4 50 92 419 730 -4.568 -4.250 -2.265 -0.520 + IL 127 127 5 127 4 52 95 421 733 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 128 128 6 128 3 52 94 421 732 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 37 ] 22 - u - - - + ML 129 128 6 131 2 50 93 419 731 -5.880 -0.025 0.007 -1.000 0.287 0.351 + D 130 128 6 131 2 49 92 418 730 -8.986 -0.003 + IL 131 131 3 131 2 50 93 420 731 -1.820 -0.480 0.000 0.000 0.000 0.000 + [ BIF 38 ] - - - - - - + B 132 131 3 133 189 49 92 418 730 + [ BEGL 39 ] - - - - - - + S 133 132 1 134 4 0 0 97 194 -0.034 -7.580 -6.987 -6.664 + [ MATP 40 ] 25 68 c g - - + MP 134 133 1 138 6 2 2 97 194 -9.698 -9.637 -0.015 -8.414 -8.188 -9.089 -2.580 -2.840 -2.827 0.994 -2.515 -3.615 2.416 -2.851 -2.940 1.127 -2.820 -1.006 1.883 -3.071 -0.318 -1.922 + ML 135 133 1 138 6 1 1 94 192 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 136 133 1 138 6 1 1 94 192 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 137 133 1 138 6 0 0 90 188 -9.190 -7.889 -3.686 -4.368 -4.385 -0.286 + IL 138 138 5 138 6 1 1 96 193 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 139 139 6 139 5 1 1 96 193 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 41 ] 26 67 c g - - + MP 140 139 6 144 6 2 2 95 192 -9.696 -9.636 -0.014 -8.412 -8.692 -9.087 -3.442 -3.244 -3.540 0.483 -1.880 -4.385 2.845 -3.272 -3.497 0.786 -3.587 -0.954 1.691 -3.701 -0.345 -2.282 + ML 141 139 6 144 6 1 1 93 191 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 142 139 6 144 6 1 1 92 190 -7.013 -5.742 -1.651 -5.720 -0.809 -3.934 0.462 -0.451 -0.188 0.019 + D 143 139 6 144 6 0 0 89 187 -9.190 -7.889 -3.686 -4.368 -4.385 -0.286 + IL 144 144 5 144 6 1 1 94 192 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 145 145 6 145 5 1 1 94 191 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 42 ] 27 66 c g - - + MP 146 145 6 150 4 2 2 93 190 -8.163 -8.370 -0.036 -5.778 -2.045 -2.146 -1.992 0.998 -2.099 -3.081 2.234 -2.525 -2.056 1.279 -2.210 -0.673 1.463 -1.970 0.192 -1.355 + ML 147 145 6 150 4 1 1 91 189 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 148 145 6 150 4 1 1 90 187 -4.838 -3.867 -1.735 -0.746 0.397 -0.482 -0.017 -0.031 + D 149 145 6 150 4 0 0 88 186 -4.701 -4.382 -2.398 -0.466 + IL 150 150 5 150 4 1 1 92 190 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 151 151 6 151 3 1 1 92 190 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 43 ] 28 - c - - - + ML 152 151 6 154 3 1 1 91 188 -9.106 -0.009 -7.760 -0.316 0.331 -0.099 0.008 + D 153 151 6 154 3 0 0 86 183 -6.611 -2.124 -0.395 + IL 154 154 3 154 3 1 1 91 189 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 44 ] 29 - u - - - + ML 155 154 3 157 3 1 1 90 187 -9.106 -0.335 -2.285 -0.216 0.080 -0.253 0.314 + D 156 154 3 157 3 0 0 83 181 -6.611 -2.124 -0.395 + IL 157 157 3 157 3 1 1 91 189 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 45 ] 30 - u - - - + ML 158 157 3 160 3 1 1 90 188 -8.783 -0.139 -3.486 0.007 -0.050 -0.234 0.238 + D 159 157 3 160 3 0 0 75 173 -8.620 -4.133 -0.089 + IL 160 160 3 160 3 1 1 90 188 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 46 ] 31 - u - - - + ML 161 160 3 163 3 1 1 89 187 -1.430 -0.684 -7.312 0.131 -0.287 -0.057 0.169 + D 162 160 3 163 3 0 0 61 158 -8.942 -1.501 -0.633 + IL 163 163 3 163 3 1 1 94 191 -0.272 -2.583 -7.696 0.000 0.000 0.000 0.000 + [ MATL 47 ] 54 - a - - - + ML 164 163 3 166 3 1 1 24 44 -8.847 -0.011 -7.501 0.185 -0.317 -0.027 0.109 + D 165 163 3 166 3 0 0 21 41 -8.412 -3.925 -0.103 + IL 166 166 3 166 3 1 1 25 46 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 48 ] 55 - a - - - + ML 167 166 3 169 3 1 1 23 43 -8.847 -0.011 -7.501 0.197 -0.292 -0.122 0.161 + D 168 166 3 169 3 0 0 19 40 -8.412 -3.925 -0.103 + IL 169 169 3 169 3 1 1 24 45 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 49 ] 56 - a - - - + ML 170 169 3 172 3 1 1 21 42 -8.847 -0.032 -5.645 0.127 -0.160 -0.001 0.019 + D 171 169 3 172 3 0 0 18 39 -8.412 -3.791 -0.113 + IL 172 172 3 172 3 1 1 23 44 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 50 ] 57 - g - - - + ML 173 172 3 175 3 1 1 20 41 -8.828 -0.362 -2.188 -0.088 -0.658 0.610 -0.153 + D 174 172 3 175 3 0 0 17 38 -8.476 -3.989 -0.098 + IL 175 175 3 175 3 1 1 23 43 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 51 ] 58 - u - - - + ML 176 175 3 178 3 1 1 20 40 -3.522 -0.143 -7.135 0.064 -0.119 -0.146 0.176 + D 177 175 3 178 3 0 0 15 35 -9.267 -2.025 -0.410 + IL 178 178 3 178 3 1 1 21 42 -1.298 -0.846 -4.762 0.000 0.000 0.000 0.000 + [ MATL 52 ] 63 - g - - - + ML 179 178 3 181 3 1 1 14 33 -8.664 -0.013 -7.318 -0.063 -0.161 0.264 -0.078 + D 180 178 3 181 3 0 0 13 31 -8.928 -2.929 -0.206 + IL 181 181 3 181 3 1 1 19 37 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 53 ] 64 - a - - - + ML 182 181 3 184 3 1 1 13 31 -8.718 -0.012 -7.372 0.361 -0.375 0.115 -0.215 + D 183 181 3 184 3 0 0 11 30 -8.800 -2.619 -0.260 + IL 184 184 3 184 3 1 1 18 36 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 54 ] 65 - a - - - + ML 185 184 3 187 2 1 1 1 1 * 0.000 0.107 -0.265 0.047 0.081 + D 186 184 3 187 2 0 0 0 0 * 0.000 + IL 187 187 3 187 2 1 1 13 28 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ END 55 ] - - - - - - + E 188 187 3 -1 0 0 0 0 0 + [ BEGR 56 ] - - - - - - + S 189 132 1 190 3 38 79 400 712 -9.131 -0.139 -3.470 + IL 190 190 2 190 3 39 81 402 713 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 57 ] 69 - u - - - + ML 191 190 2 193 3 40 80 400 712 -9.002 -0.010 -7.656 -0.357 -0.346 -1.184 0.994 + D 192 190 2 193 3 34 75 397 709 -7.649 -3.162 -0.179 + IL 193 193 3 193 3 39 80 401 712 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 58 ] 70 - u - - - + ML 194 193 3 196 3 39 79 399 711 -3.765 -0.120 -7.382 -0.685 -0.618 0.325 0.559 + D 195 193 3 196 3 34 75 397 709 -7.649 -0.763 -1.302 + IL 196 196 3 196 3 38 79 400 711 -1.135 -0.963 -4.979 0.000 0.000 0.000 0.000 + [ MATL 59 ] 77 - A - - - + ML 197 196 3 199 3 38 78 398 710 -9.098 -0.012 -7.274 1.776 -2.632 -2.040 -2.546 + D 198 196 3 199 3 32 73 395 707 -6.732 -2.042 -0.419 + IL 199 199 3 199 3 37 78 399 710 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 60 ] 78 - A - - - + ML 200 199 3 202 3 37 77 397 709 -9.099 -0.020 -6.360 1.828 -3.015 -2.669 -2.566 + D 201 199 3 202 3 32 73 395 706 -6.722 -2.013 -0.429 + IL 202 202 3 202 3 37 77 398 709 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 61 ] 79 - a - - - + ML 203 202 3 205 5 37 76 396 708 -8.118 -0.034 -6.146 -8.145 -9.037 0.596 -0.934 -0.019 -0.031 + D 204 202 3 205 5 31 72 394 706 -5.357 -0.565 -4.618 -2.993 -2.906 + IL 205 205 3 205 5 35 75 396 708 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000 + [ MATP 62 ] 80 420 a u - - + MP 206 205 3 210 6 36 75 395 707 -5.135 -9.634 -0.054 -8.410 -8.690 -9.085 -2.619 -2.241 -2.760 2.549 -2.737 -2.931 1.439 -3.028 -2.907 1.408 -3.433 -0.751 0.994 -2.920 -0.621 -1.917 + ML 207 205 3 210 6 32 72 393 705 -3.225 -6.770 -1.413 -1.178 -6.619 -4.149 0.240 -0.222 -0.287 0.192 + MR 208 205 3 210 6 32 71 393 704 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 209 205 3 210 6 28 68 389 701 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 210 210 5 210 6 34 74 394 706 -2.907 -3.442 -0.500 -5.097 -5.874 -5.534 0.000 0.000 0.000 0.000 + IR 211 211 6 211 5 34 74 394 706 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 63 ] 83 419 G C - - + MP 212 211 6 216 6 34 73 393 705 -9.704 -9.643 -0.014 -8.420 -8.699 -9.094 -6.422 -4.033 -6.849 -0.422 -7.712 -5.476 -2.611 -7.122 -5.397 3.852 -5.662 -1.811 -2.916 -5.622 -4.770 -5.699 + ML 213 211 6 216 6 31 71 391 703 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 214 211 6 216 6 30 70 391 702 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 215 211 6 216 6 28 67 388 700 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 216 216 5 216 6 32 72 392 704 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 217 217 6 217 5 32 72 392 704 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 64 ] 84 418 G C - - + MP 218 217 6 222 4 32 71 391 703 -8.175 -8.382 -0.022 -6.796 -4.010 -3.490 -5.198 -0.126 -6.220 -5.140 -1.294 -5.737 -4.946 3.731 -2.929 -1.104 -1.571 -4.785 -3.336 -4.122 + ML 219 217 6 222 4 30 70 390 702 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 220 217 6 222 4 29 68 389 701 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 221 217 6 222 4 28 67 388 699 -4.568 -4.250 -2.265 -0.520 + IL 222 222 5 222 4 31 71 391 703 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 223 223 6 223 3 31 71 391 702 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 65 ] 85 - G - - - + ML 224 223 6 226 3 31 70 389 701 -9.131 -0.009 -7.785 -3.346 -4.973 1.933 -4.288 + D 225 223 6 226 3 27 66 387 698 -6.174 -1.687 -0.566 + IL 226 226 3 226 3 30 70 390 701 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 66 ] 86 - A - - - + ML 227 226 3 229 3 30 69 388 700 -9.131 -0.009 -7.785 1.943 -4.562 -4.027 -4.280 + D 228 226 3 229 3 26 66 386 698 -6.174 -1.687 -0.566 + IL 229 229 3 229 3 29 69 389 700 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 67 ] 87 - A - - - + ML 230 229 3 232 3 29 68 387 699 -6.379 -0.024 -7.786 1.943 -4.562 -4.027 -4.280 + D 231 229 3 232 3 26 65 385 697 -5.620 -0.734 -1.403 + IL 232 232 3 232 3 28 67 387 699 -2.030 -0.659 -3.040 0.000 0.000 0.000 0.000 + [ MATR 68 ] - 417 - A - - + MR 233 232 3 235 3 28 67 386 698 -9.453 -0.009 -7.771 1.927 -4.294 -3.530 -4.052 + D 234 232 3 235 3 25 64 384 695 -6.642 -1.820 -0.501 + IR 235 235 3 235 3 28 67 386 698 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 69 ] - 416 - G - - + MR 236 235 3 238 3 27 66 385 697 -9.453 -0.009 -7.771 -1.120 -2.512 1.639 -1.997 + D 237 235 3 238 3 24 63 383 695 -6.642 -1.820 -0.501 + IR 238 238 3 238 3 27 66 385 697 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 70 ] - 415 - A - - + MR 239 238 3 241 3 26 65 384 696 -9.453 -0.009 -7.771 1.922 -4.227 -3.414 -3.989 + D 240 238 3 241 3 24 63 383 694 -6.642 -1.820 -0.501 + IR 241 241 3 241 3 26 65 385 696 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 71 ] - 414 - G - - + MR 242 241 3 244 2 25 64 383 695 -9.659 -0.002 0.017 -2.697 1.376 -2.067 + D 243 241 3 244 2 24 63 382 694 -4.695 -0.057 + IR 244 244 3 244 2 25 64 384 695 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ BIF 72 ] - - - - - - + B 245 244 3 498 246 24 63 382 694 + [ BEGR 100 ] - - - - - - + S 246 245 1 247 3 2 35 345 656 -9.131 -0.009 -7.785 + IL 247 247 2 247 3 1 35 346 658 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 101 ] 156 - A - - - + ML 248 247 2 250 5 2 35 345 656 -8.155 -0.019 -7.970 -8.182 -9.074 1.378 -2.450 -0.001 -2.193 + D 249 247 2 250 5 0 29 342 654 -4.959 -0.803 -4.221 -2.596 -2.508 + IL 250 250 3 250 5 1 33 344 656 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000 + [ MATP 102 ] 157 413 C G - - + MP 251 250 3 255 6 3 34 344 655 -9.704 -9.643 -0.014 -8.420 -8.699 -9.094 -8.267 -8.326 -7.131 -4.520 -5.509 -7.052 3.964 -7.137 -7.856 -4.427 -5.439 -6.391 -2.854 -8.246 -3.952 -6.655 + ML 252 250 3 255 6 1 30 341 653 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 253 250 3 255 6 1 29 341 653 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 254 250 3 255 6 0 26 338 649 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 255 255 5 255 6 1 32 343 654 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 256 256 6 256 5 1 32 343 654 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 103 ] 158 412 u a - - + MP 257 256 6 261 6 3 33 342 653 -9.704 -9.643 -0.014 -8.420 -8.699 -9.094 -4.103 -3.766 -4.098 0.072 -3.298 -4.869 1.439 -3.869 -4.068 1.749 -4.544 -1.350 2.859 -4.280 -0.879 -2.894 + ML 258 256 6 261 6 1 29 340 652 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 259 256 6 261 6 1 28 339 651 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 260 256 6 261 6 0 25 337 648 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 261 261 5 261 6 1 31 341 652 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 262 262 6 262 5 1 31 341 652 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 104 ] 159 411 G C - - + MP 263 262 6 267 4 2 31 340 651 -8.175 -8.382 -0.022 -6.796 -6.851 -4.158 -7.565 -1.341 -8.069 -5.487 -2.912 -7.680 -5.509 3.899 -5.750 -1.991 -3.273 -5.776 -5.133 -6.416 + ML 264 262 6 267 4 1 28 339 650 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 265 262 6 267 4 1 26 337 649 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 266 262 6 267 4 0 25 336 648 -4.568 -4.250 -2.265 -0.520 + IL 267 267 5 267 4 1 30 339 651 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 268 268 6 268 3 1 29 339 651 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 105 ] 160 - U - - - + ML 269 268 6 271 3 1 29 338 649 -9.131 -0.009 -7.785 -3.233 -2.752 -3.996 1.881 + D 270 268 6 271 3 0 24 335 647 -6.174 -1.687 -0.566 + IL 271 271 3 271 3 1 28 338 650 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 106 ] 161 - A - - - + ML 272 271 3 274 3 1 28 337 648 -9.131 -0.009 -7.785 1.014 -1.816 0.454 -1.612 + D 273 271 3 274 3 0 23 334 646 -6.174 -1.687 -0.566 + IL 274 274 3 274 3 1 27 337 649 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 107 ] 162 - A - - - + ML 275 274 3 277 3 1 27 336 647 -4.966 -0.054 -7.786 1.389 -1.897 -1.140 -0.603 + D 276 274 3 277 3 0 22 334 645 -5.620 -0.734 -1.403 + IL 277 277 3 277 3 1 26 336 647 -2.113 -0.466 -4.473 0.000 0.000 0.000 0.000 + [ MATR 108 ] - 410 - c - - + MR 278 277 3 280 3 1 26 335 646 -9.468 -0.009 -7.786 -1.914 0.947 -2.836 0.737 + D 279 277 3 280 3 0 20 332 643 -6.390 -1.568 -0.620 + IR 280 280 3 280 3 1 25 335 646 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 109 ] - 409 - G - - + MR 281 280 3 283 3 1 25 334 645 -9.468 -0.009 -7.786 -3.663 -5.118 1.943 -4.402 + D 282 280 3 283 3 0 19 331 642 -6.390 -1.568 -0.620 + IR 283 283 3 283 3 1 24 334 645 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 110 ] - 408 - A - - + MR 284 283 3 286 3 1 24 333 644 -9.468 -0.009 -7.786 1.880 -3.254 -3.105 -3.358 + D 285 283 3 286 3 0 18 329 641 -6.390 -1.568 -0.620 + IR 286 286 3 286 3 1 23 333 644 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 111 ] - 407 - g - - + MR 287 286 3 289 5 1 23 332 643 -6.174 -0.034 -7.970 -8.182 -9.074 0.344 -1.458 0.994 -1.415 + D 288 286 3 289 5 0 17 328 639 -5.352 -0.707 -2.978 -4.409 -2.404 + IR 289 289 3 289 5 1 21 331 643 -2.493 -0.463 -6.004 -4.172 -5.278 0.000 0.000 0.000 0.000 + [ MATP 112 ] 165 405 g c - - + MP 290 289 3 294 6 2 23 331 642 -9.704 -9.643 -0.014 -8.420 -8.699 -9.094 -2.903 -2.176 -2.257 1.279 -3.463 -1.940 0.753 -3.581 -3.314 2.812 -3.759 0.477 0.370 -3.114 -1.274 -1.063 + ML 291 289 3 294 6 1 18 326 638 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 292 289 3 294 6 1 17 325 636 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 293 289 3 294 6 0 13 313 625 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 294 294 5 294 6 1 20 329 641 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 295 295 6 295 5 1 20 329 641 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 113 ] 166 404 c g - - + MP 296 295 6 300 6 2 21 329 640 -8.410 -9.643 -0.018 -8.016 -8.699 -9.094 -4.099 -3.864 -4.100 0.298 -3.148 -4.876 2.902 -3.775 -4.035 1.504 -4.524 -1.601 1.464 -4.280 -0.573 -2.835 + ML 297 295 6 300 6 1 17 323 634 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 298 295 6 300 6 1 16 321 632 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 299 295 6 300 6 0 13 308 620 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 300 300 5 300 6 1 19 327 639 -2.616 -2.879 -0.735 -4.534 -5.310 -4.971 0.000 0.000 0.000 0.000 + IR 301 301 6 301 5 1 19 327 638 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 114 ] 168 403 G C - - + MP 302 301 6 306 6 2 19 327 638 -9.702 -9.642 -0.032 -8.418 -8.698 -6.116 -3.475 -2.555 -3.684 1.473 -4.326 -4.336 0.568 -2.903 -3.877 3.063 -4.344 -0.333 0.393 -3.487 -1.541 -2.683 + ML 303 301 6 306 6 1 16 318 629 -6.277 -6.623 -1.271 -1.032 -6.473 -4.003 0.457 -0.447 -0.187 0.022 + MR 304 301 6 306 6 1 15 315 627 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 305 301 6 306 6 0 12 302 614 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 306 306 5 306 6 1 17 325 636 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 307 307 6 307 5 1 17 325 636 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 115 ] 169 402 g c - - + MP 308 307 6 312 4 2 17 325 637 -1.339 -3.567 -0.982 -6.153 -2.682 -1.659 -2.709 1.495 -3.311 -3.381 0.837 -3.462 -1.980 2.795 -3.534 -0.071 0.486 -2.725 -1.077 -2.144 + ML 309 307 6 312 4 1 14 306 618 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 310 307 6 312 4 1 13 303 615 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 311 307 6 312 4 0 12 295 607 -4.948 -4.629 -1.457 -0.829 + IL 312 312 5 312 4 1 17 333 645 -0.943 -2.045 -2.097 -8.121 0.000 0.000 0.000 0.000 + IR 313 313 6 313 3 1 20 343 654 -0.085 -4.177 -8.885 0.000 0.000 0.000 0.000 + [ MATL 116 ] 180 - a - - - + ML 314 313 6 316 3 1 14 233 443 -9.115 -0.009 -7.769 0.326 -0.641 0.234 -0.107 + D 315 313 6 316 3 0 11 231 441 -6.468 -1.428 -0.697 + IL 316 316 3 316 3 1 14 234 444 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 117 ] 181 - g - - - + ML 317 316 3 319 3 1 13 232 442 -9.126 -0.009 -7.780 0.287 -0.393 0.350 -0.427 + D 318 316 3 319 3 0 10 230 440 -6.286 -1.618 -0.596 + IL 319 319 3 319 3 1 13 233 443 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 118 ] 182 - a - - - + ML 320 319 3 322 3 1 12 231 441 -9.128 -0.009 -7.783 0.687 -0.804 0.299 -0.769 + D 321 319 3 322 3 0 9 229 439 -6.230 -1.571 -0.621 + IL 322 322 3 322 3 1 12 232 442 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 119 ] 183 - g - - - + ML 323 322 3 325 3 1 11 230 440 -9.131 -0.015 -6.821 0.125 -0.111 0.170 -0.219 + D 324 322 3 325 3 0 8 228 438 -6.174 -1.687 -0.566 + IL 325 325 3 325 3 1 11 231 441 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 120 ] 184 - c - - - + ML 326 325 3 328 3 1 10 229 439 -9.125 -0.009 -7.779 -0.126 0.238 0.038 -0.189 + D 327 325 3 328 3 0 8 227 438 -6.298 -1.811 -0.510 + IL 328 328 3 328 3 1 11 230 440 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 121 ] 185 - a - - - + ML 329 328 3 331 3 1 9 228 438 -9.462 -0.391 -2.082 0.248 0.019 -0.350 0.021 + D 330 328 3 331 3 0 7 227 437 -5.696 -0.713 -1.432 + IL 331 331 3 331 3 1 11 229 439 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 122 ] - 335 - c - - + MR 332 331 3 334 3 1 11 228 438 -9.088 -0.011 -7.406 -0.343 0.677 -0.933 0.123 + D 333 331 3 334 3 0 5 226 436 -8.762 -0.644 -1.482 + IR 334 334 3 334 3 1 10 228 438 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 123 ] - 334 - a - - + MR 335 334 3 337 3 1 10 227 437 -9.369 -0.009 -7.687 0.848 -0.739 -0.308 -0.335 + D 336 334 3 337 3 0 4 224 434 -7.529 -1.921 -0.453 + IR 337 337 3 337 3 1 9 227 437 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 124 ] - 333 - g - - + MR 338 337 3 340 3 1 10 226 436 -9.390 -0.009 -7.707 0.343 -1.007 0.546 -0.370 + D 339 337 3 340 3 0 3 223 433 -7.359 -2.388 -0.317 + IR 340 340 3 340 3 1 8 226 436 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 125 ] - 332 - u - - + MR 341 340 3 343 3 1 9 225 435 -9.393 -0.009 -7.710 -0.101 -0.346 0.149 0.228 + D 342 340 3 343 3 0 3 222 432 -7.332 -1.733 -0.529 + IR 343 343 3 343 3 1 7 225 435 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 126 ] - 331 - a - - + MR 344 343 3 346 3 1 8 224 434 -9.413 -0.009 -7.731 0.401 -0.735 0.061 0.050 + D 345 343 3 346 3 0 2 222 432 -7.139 -1.022 -0.998 + IR 346 346 3 346 3 1 6 224 434 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 127 ] - 330 - a - - + MR 347 346 3 349 3 1 7 223 433 -9.453 -0.009 -7.771 0.576 -0.924 0.296 -0.407 + D 348 346 3 349 3 0 1 220 431 -6.642 -1.173 -0.872 + IR 349 349 3 349 3 1 5 223 433 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 128 ] - 329 - g - - + MR 350 349 3 352 3 1 6 222 432 -9.468 -0.009 -7.786 -0.195 0.040 0.086 0.052 + D 351 349 3 352 3 0 1 219 429 -6.390 -1.568 -0.620 + IR 352 352 3 352 3 1 5 222 432 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 129 ] - 328 - g - - + MR 353 352 3 355 3 1 5 221 431 -9.468 -0.009 -7.786 -0.236 -0.064 0.497 -0.353 + D 354 352 3 355 3 0 0 218 428 -6.390 -1.568 -0.620 + IR 355 355 3 355 3 1 4 221 431 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 130 ] - 327 - a - - + MR 356 355 3 358 3 1 5 220 430 -9.468 -0.010 -7.466 0.502 -0.604 -0.006 -0.105 + D 357 355 3 358 3 0 0 217 427 -6.390 -1.568 -0.620 + IR 358 358 3 358 3 1 3 220 430 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 131 ] - 326 - a - - + MR 359 358 3 361 5 1 4 219 429 -5.865 -0.052 -7.406 -8.181 -6.836 0.263 -0.220 0.145 -0.260 + D 360 358 3 361 5 0 0 216 426 -5.368 -0.697 -2.995 -4.426 -2.420 + IR 361 361 3 361 5 1 2 219 429 -2.355 -0.490 -6.068 -4.235 -5.341 0.000 0.000 0.000 0.000 + [ MATP 132 ] 186 323 c g - - + MP 362 361 3 366 6 2 6 218 428 -9.695 -9.635 -0.017 -7.563 -8.691 -9.086 -0.456 -1.579 -0.252 1.042 -1.679 -1.532 1.541 -2.165 -1.782 1.291 -2.275 -0.366 1.370 -1.527 0.033 -0.811 + ML 363 361 3 366 6 1 1 215 426 -6.285 -6.632 -1.346 -0.970 -6.481 -4.011 0.413 -0.365 -0.233 0.059 + MR 364 361 3 366 6 1 1 215 425 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 365 361 3 366 6 0 0 210 420 -9.205 -7.904 -3.701 -2.730 -4.400 -0.476 + IL 366 366 5 366 6 1 2 217 427 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 367 367 6 367 5 1 2 217 427 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 133 ] 187 322 c g - - + MP 368 367 6 372 6 2 6 216 426 -9.692 -8.261 -0.017 -8.408 -8.688 -9.083 -1.390 -1.525 -1.222 1.072 -1.463 -2.152 1.791 -1.764 -1.743 1.204 -2.579 0.085 1.426 -1.656 0.106 -1.037 + ML 369 367 6 372 6 1 1 214 424 -6.466 -6.813 -1.040 -1.221 -6.662 -4.192 0.609 -0.565 -0.214 -0.095 + MR 370 367 6 372 6 1 1 213 423 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 371 367 6 372 6 0 0 208 418 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 372 372 5 372 6 1 2 215 425 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 373 373 6 373 5 1 2 215 425 -2.434 -0.486 -5.945 -4.113 -5.219 0.000 0.000 0.000 0.000 + [ MATP 134 ] 188 320 c g - - + MP 374 373 6 378 6 2 5 214 424 -9.704 -7.671 -0.020 -8.420 -8.699 -8.745 -2.767 -2.782 -2.917 0.910 -2.099 -3.580 2.495 -2.874 -2.524 1.269 -3.489 -0.589 1.588 -3.064 -0.216 -1.825 + ML 375 373 6 378 6 1 1 211 422 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 376 373 6 378 6 1 1 211 421 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 377 373 6 378 6 0 0 207 417 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 378 378 5 378 6 1 1 213 423 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 379 379 6 379 5 1 2 213 423 -2.303 -0.514 -6.003 -4.170 -5.276 0.000 0.000 0.000 0.000 + [ MATP 135 ] 189 317 c g - - + MP 380 379 6 384 6 2 4 212 422 -9.703 -9.642 -0.020 -8.419 -7.670 -8.311 -2.686 -2.313 -2.937 1.112 -2.292 -3.765 2.110 -3.105 -2.986 1.971 -3.524 -0.778 1.433 -2.958 -0.284 -1.871 + ML 381 379 6 384 6 1 1 210 420 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 382 379 6 384 6 1 1 209 419 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 383 379 6 384 6 0 0 205 416 -9.067 -7.766 -3.563 -4.245 -4.262 -0.315 + IL 384 384 5 384 6 1 1 211 421 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 385 385 6 385 5 1 1 211 421 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 136 ] 190 316 c g - - + MP 386 385 6 390 6 2 4 210 420 -9.697 -9.637 -0.027 -7.942 -7.153 -7.679 -2.082 -2.466 -2.598 1.064 -2.213 -3.240 2.113 -2.807 -2.595 1.421 -3.047 -0.788 1.870 -2.588 -0.194 -1.748 + ML 387 385 6 390 6 1 1 208 418 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 388 385 6 390 6 1 1 207 417 -7.049 -5.778 -1.687 -5.756 -0.890 -3.242 0.548 -0.509 -0.216 -0.037 + D 389 385 6 390 6 0 0 204 415 -9.115 -7.813 -3.610 -4.292 -4.309 -0.303 + IL 390 390 5 390 6 1 1 209 419 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 391 391 6 391 5 1 1 209 419 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 137 ] 191 315 c g - - + MP 392 391 6 396 4 2 2 208 418 -8.143 -2.764 -0.261 -6.087 -2.042 -2.018 -2.182 1.037 -2.087 -2.681 2.348 -2.418 -1.930 0.985 -2.242 -0.687 1.552 -2.371 -0.096 -1.205 + ML 393 391 6 396 4 1 1 207 417 -3.782 -3.965 -0.497 -2.694 0.470 -0.456 -0.189 0.013 + MR 394 391 6 396 4 1 1 205 415 -4.937 -3.966 -1.833 -0.683 0.633 -0.566 -0.268 -0.084 + D 395 391 6 396 4 0 0 204 414 -4.802 -4.483 -2.499 -0.429 + IL 396 396 5 396 4 1 1 207 418 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 397 397 6 397 3 1 1 207 417 -1.783 -0.558 -5.063 0.000 0.000 0.000 0.000 + [ MATL 138 ] 192 - A - - - + ML 398 397 6 400 3 1 2 206 416 -9.095 -0.012 -7.247 1.036 -0.579 -0.873 -0.447 + D 399 397 6 400 3 0 0 203 413 -6.773 -2.286 -0.348 + IL 400 400 3 400 3 1 1 206 416 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 139 ] 193 - a - - - + ML 401 400 3 403 3 1 1 205 415 -9.092 -0.017 -6.663 0.410 -0.245 -0.296 0.018 + D 402 400 3 403 3 0 0 202 412 -6.810 -1.510 -0.644 + IL 403 403 3 403 3 1 1 205 415 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 140 ] 194 - u - - - + ML 404 403 3 406 3 1 1 204 414 -9.101 -0.073 -4.396 0.150 0.050 -0.586 0.250 + D 405 403 3 406 3 0 0 201 411 -6.684 -1.491 -0.656 + IL 406 406 3 406 3 1 1 204 414 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 141 ] 195 - a - - - + ML 407 406 3 409 3 1 1 203 413 -9.053 -0.325 -2.325 0.998 -0.836 -0.639 -0.322 + D 408 406 3 409 3 0 0 199 409 -7.245 -2.758 -0.242 + IL 409 409 3 409 3 1 1 204 414 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 142 ] 196 - a - - - + ML 410 409 3 412 5 1 1 203 413 -1.657 -0.592 -7.606 -7.818 -6.626 0.336 -0.406 -0.406 0.297 + D 411 409 3 412 5 0 0 198 408 -6.876 -0.689 -6.137 -4.512 -1.675 + IL 412 412 3 412 5 1 1 206 416 -0.296 -2.583 -6.078 -9.511 -8.784 0.000 0.000 0.000 0.000 + [ MATP 143 ] 225 311 G C - - + MP 413 412 3 417 6 2 2 199 409 -9.599 -9.539 -0.025 -8.315 -8.595 -6.773 -2.790 -2.248 -2.374 1.287 -3.697 -4.020 0.385 -3.863 -2.944 3.068 -3.082 0.100 0.105 -3.289 -1.420 -2.039 + ML 414 412 3 417 6 1 1 197 408 -6.591 -6.937 -0.919 -1.346 -6.787 -4.317 0.861 -0.737 -0.467 -0.217 + MR 415 412 3 417 6 1 1 197 407 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 416 412 3 417 6 0 0 196 406 -10.339 -9.038 -0.675 -5.517 -5.534 -1.610 + IL 417 417 5 417 6 1 1 198 408 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 418 418 6 418 5 1 1 198 408 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 144 ] 226 310 C G - - + MP 419 418 6 423 6 2 2 197 407 -9.694 -9.633 -0.014 -8.410 -8.690 -9.085 -3.988 -3.801 -4.011 0.341 -2.521 -4.810 3.011 -3.696 -3.938 1.269 -4.442 -1.495 1.180 -4.191 -0.247 -2.753 + ML 420 418 6 423 6 1 1 196 406 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 421 418 6 423 6 1 1 195 405 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 422 418 6 423 6 0 0 193 403 -9.276 -7.975 -3.772 -4.454 -4.471 -0.268 + IL 423 423 5 423 6 1 1 196 407 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 424 424 6 424 5 1 1 196 406 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 145 ] 227 309 C G - - + MP 425 424 6 429 4 2 2 195 405 -8.159 -8.366 -0.023 -6.780 -7.882 -8.002 -5.896 -4.172 -4.954 -6.853 3.953 -6.695 -7.440 -4.066 -6.869 -6.130 -2.408 -7.822 -3.497 -6.235 + ML 426 424 6 429 4 1 1 194 404 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 427 424 6 429 4 1 1 193 404 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 428 424 6 429 4 0 0 192 402 -4.782 -4.463 -2.479 -0.436 + IL 429 429 5 429 4 1 1 195 405 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 430 430 6 430 3 1 1 195 405 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 146 ] 228 - A - - - + ML 431 430 6 433 3 1 1 193 403 -9.453 -0.009 -7.771 1.942 -4.536 -4.002 -4.254 + D 432 430 6 433 3 0 0 191 402 -5.806 -0.622 -1.589 + IL 433 433 3 433 3 1 1 193 404 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 147 ] - 308 - A - - + MR 434 433 3 436 3 1 1 192 402 -9.468 -0.009 -7.786 1.855 -3.129 -2.970 -2.832 + D 435 433 3 436 3 0 0 190 400 -6.390 -1.568 -0.620 + IR 436 436 3 436 3 1 1 192 403 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 148 ] - 307 - A - - + MR 437 436 3 439 3 1 1 191 401 -9.468 -0.009 -7.786 1.930 -4.291 -3.863 -3.859 + D 438 436 3 439 3 0 0 189 399 -6.390 -1.568 -0.620 + IR 439 439 3 439 3 1 1 191 402 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 149 ] - 306 - G - - + MR 440 439 3 442 5 1 1 190 400 -8.155 -0.020 -7.970 -8.182 -8.548 -3.159 -4.760 1.921 -3.953 + D 441 439 3 442 5 0 0 188 398 -5.352 -0.707 -2.978 -4.409 -2.404 + IR 442 442 3 442 5 1 1 190 400 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 150 ] 229 305 C G - - + MP 443 442 3 447 6 2 2 189 399 -9.703 -9.642 -0.014 -8.419 -8.699 -9.094 -6.221 -6.357 -5.595 -2.514 -4.007 -5.779 3.820 -4.954 -5.721 -2.433 -5.802 -4.494 -0.114 -6.126 -1.753 -4.519 + ML 444 442 3 447 6 1 1 187 397 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 445 442 3 447 6 1 1 186 397 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 446 442 3 447 6 0 0 181 392 -9.068 -7.767 -3.564 -4.246 -4.263 -0.314 + IL 447 447 5 447 6 1 1 188 398 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 448 448 6 448 5 1 1 188 398 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 151 ] 230 304 U G - - + MP 449 448 6 453 6 2 2 187 398 -9.703 -9.642 -0.017 -7.975 -8.263 -9.094 -5.401 -5.483 -5.003 -1.736 -1.996 -5.334 0.859 -4.431 -5.059 -1.633 -3.463 -2.009 -0.133 -5.409 3.560 -3.898 + ML 450 448 6 453 6 1 1 185 395 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 451 448 6 453 6 1 1 185 395 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 452 448 6 453 6 0 0 180 390 -9.068 -7.767 -3.564 -4.246 -4.263 -0.314 + IL 453 453 5 453 6 1 1 186 397 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 454 454 6 454 5 1 1 186 396 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 152 ] 231 303 g c - - + MP 455 454 6 459 6 2 2 185 396 -9.700 -9.639 -0.015 -8.043 -8.696 -9.091 -4.163 -2.671 -4.036 0.785 -4.999 -3.458 0.013 -4.656 -4.342 2.998 -4.609 1.847 -0.433 -3.878 -2.185 -3.000 + ML 456 454 6 459 6 1 1 183 393 -6.280 -6.626 -1.267 -1.035 -6.476 -4.006 0.325 -0.374 -0.240 0.176 + MR 457 454 6 459 6 1 1 183 393 -7.009 -5.738 -1.647 -5.716 -0.812 -3.930 0.333 -0.375 -0.231 0.161 + D 458 454 6 459 6 0 0 179 389 -9.068 -7.767 -3.564 -4.246 -4.263 -0.314 + IL 459 459 5 459 6 1 1 184 395 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 460 460 6 460 5 1 1 184 394 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 153 ] 232 302 g c - - + MP 461 460 6 465 6 2 2 183 394 -9.700 -7.947 -0.035 -8.416 -8.696 -6.193 -3.677 -2.786 -3.513 1.343 -3.913 -4.320 0.956 -4.024 -3.878 2.860 -4.259 -0.332 0.953 -3.490 -0.589 -2.547 + ML 462 460 6 465 6 1 1 182 392 -6.275 -6.621 -1.335 -0.980 -6.471 -4.000 0.334 -0.281 -0.263 0.116 + MR 463 460 6 465 6 1 1 181 391 -7.009 -5.738 -1.582 -5.716 -0.850 -3.930 0.398 -0.474 -0.034 -0.022 + D 464 460 6 465 6 0 0 178 388 -9.068 -7.767 -3.352 -4.246 -4.263 -0.339 + IL 465 465 5 465 6 1 1 183 393 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 466 466 6 466 5 1 1 182 393 -2.444 -0.482 -5.955 -4.123 -5.229 0.000 0.000 0.000 0.000 + [ MATP 154 ] 233 300 c g - - + MP 467 466 6 471 6 2 2 181 392 -9.685 -9.625 -0.081 -8.401 -8.681 -4.425 -2.094 -2.300 -2.323 1.251 -1.724 -3.099 1.934 -2.612 -2.374 1.661 -3.011 -0.487 1.579 -2.364 -0.242 -1.484 + ML 468 466 6 471 6 1 1 180 390 -6.275 -6.621 -1.335 -0.980 -6.471 -4.000 0.451 -0.443 -0.186 0.027 + MR 469 466 6 471 6 1 1 179 390 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 470 466 6 471 6 0 0 177 387 -9.430 -8.128 -3.925 -4.607 -4.625 -0.239 + IL 471 471 5 471 6 1 1 181 391 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 472 472 6 472 5 1 1 181 391 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 155 ] 234 299 c g - - + MP 473 472 6 477 4 2 2 180 390 -8.029 -8.236 -0.461 -1.910 -1.652 -1.680 -1.964 1.265 -1.901 -2.798 2.179 -2.160 -2.041 1.090 -2.004 -0.583 1.391 -1.895 -0.101 -1.206 + ML 474 472 6 477 4 1 1 179 389 -3.776 -3.959 -0.499 -2.688 0.334 -0.281 -0.263 0.116 + MR 475 472 6 477 4 1 1 178 388 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 476 472 6 477 4 0 0 176 386 -5.794 -5.475 -3.389 -0.211 + IL 477 477 5 477 4 1 1 180 390 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 478 478 6 478 3 1 1 180 390 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 156 ] 235 - c - - - + ML 479 478 6 481 3 1 1 178 388 -8.586 -0.013 -7.240 0.039 0.042 -0.103 0.017 + D 480 478 6 481 3 0 0 176 386 -9.088 -0.775 -1.274 + IL 481 481 3 481 3 1 1 178 389 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 157 ] 236 - g - - - + ML 482 481 3 484 3 1 1 177 387 -8.951 -0.010 -7.605 -0.110 -0.494 0.430 0.023 + D 483 481 3 484 3 0 0 173 384 -7.957 -0.748 -1.321 + IL 484 484 3 484 3 1 1 177 387 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 158 ] 237 - c - - - + ML 485 484 3 487 3 1 1 176 386 -9.082 -0.009 -7.736 -0.056 0.296 -0.565 0.182 + D 486 484 3 487 3 0 0 167 377 -6.941 -2.454 -0.305 + IL 487 487 3 487 3 1 1 176 386 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 159 ] 238 - a - - - + ML 488 487 3 490 3 1 1 175 385 -9.082 -0.009 -7.736 0.637 -0.273 -0.718 0.014 + D 489 487 3 490 3 0 0 164 374 -6.941 -1.377 -0.721 + IL 490 490 3 490 3 1 1 175 385 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 160 ] 239 - a - - - + ML 491 490 3 493 3 1 1 174 384 -1.538 -1.438 -1.803 0.410 0.026 -0.613 -0.000 + D 492 490 3 493 3 0 0 133 343 -6.615 -1.429 -0.694 + IL 493 493 3 493 3 1 1 185 396 -0.126 -3.610 -8.972 0.000 0.000 0.000 0.000 + [ MATL 161 ] 298 - g - - - + ML 494 493 3 496 2 1 1 1 1 * 0.000 -0.101 0.022 0.174 -0.114 + D 495 493 3 496 2 0 0 0 0 * 0.000 + IL 496 496 3 496 2 1 1 13 28 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ END 162 ] - - - - - - + E 497 496 3 -1 0 0 0 0 0 + [ BEGL 73 ] - - - - - - + S 498 245 1 499 1 0 4 208 431 0.000 + [ BIF 74 ] - - - - - - + B 499 498 1 500 553 0 4 208 431 + [ BEGL 75 ] - - - - - - + S 500 499 1 501 4 0 0 197 419 -0.028 -7.580 -6.987 -7.406 + [ MATP 76 ] 89 141 c g - - + MP 501 500 1 505 6 2 2 197 419 -3.661 -9.642 -0.132 -8.418 -8.698 -9.093 -3.107 -2.990 -3.229 0.760 -2.619 -4.068 2.202 -3.247 -2.827 1.733 -3.773 -1.142 1.858 -3.373 0.073 -1.913 + ML 502 500 1 505 6 1 1 194 417 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 503 500 1 505 6 1 1 194 416 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 504 500 1 505 6 0 0 188 411 -9.075 -7.773 -3.570 -4.252 -4.270 -0.313 + IL 505 505 5 505 6 1 1 196 418 -3.687 -3.615 -0.335 -5.605 -6.381 -6.041 0.000 0.000 0.000 0.000 + IR 506 506 6 506 5 1 1 195 418 -2.440 -0.483 -5.951 -4.119 -5.225 0.000 0.000 0.000 0.000 + [ MATP 77 ] 91 139 c g - - + MP 507 506 6 511 6 2 2 195 417 -9.703 -9.642 -0.014 -8.418 -8.698 -9.093 -2.481 -2.517 -2.663 1.024 -2.331 -3.831 2.576 -3.104 -3.019 1.557 -3.565 -1.021 1.212 -3.057 -0.367 -2.002 + ML 508 506 6 511 6 1 1 192 415 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 509 506 6 511 6 1 1 192 414 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 510 506 6 511 6 0 0 187 410 -9.075 -7.773 -3.295 -4.252 -4.270 -0.345 + IL 511 511 5 511 6 1 1 194 416 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 512 512 6 512 5 1 1 193 416 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 78 ] 92 138 c g - - + MP 513 512 6 517 6 2 2 193 415 -8.304 -9.643 -0.022 -7.238 -8.699 -9.094 -3.911 -3.696 -3.948 0.627 -3.064 -4.766 2.923 -3.665 -3.879 1.282 -4.390 -1.410 1.327 -4.114 -0.421 -2.412 + ML 514 512 6 517 6 1 1 190 413 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 515 512 6 517 6 1 1 190 412 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 516 512 6 517 6 0 0 185 408 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 517 517 5 517 6 1 1 192 414 -2.621 -2.884 -0.732 -4.539 -5.315 -4.975 0.000 0.000 0.000 0.000 + IR 518 518 6 518 5 1 1 192 414 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 79 ] 94 137 G C - - + MP 519 518 6 523 6 2 2 191 413 -8.281 -9.638 -0.027 -7.934 -8.354 -7.143 -5.261 -2.847 -5.261 0.353 -6.295 -5.141 -1.060 -5.806 -4.973 3.696 -5.245 -1.205 -1.504 -4.811 -3.392 -4.185 + ML 520 518 6 523 6 1 1 189 411 -6.354 -6.700 -1.379 -0.933 -6.550 -4.079 0.368 -0.407 -0.057 -0.009 + MR 521 518 6 523 6 1 1 187 410 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 522 518 6 523 6 0 0 184 407 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 523 523 5 523 6 1 1 190 412 -2.622 -2.885 -0.732 -4.540 -5.316 -4.976 0.000 0.000 0.000 0.000 + IR 524 524 6 524 5 1 1 190 412 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 80 ] 96 136 G C - - + MP 525 524 6 529 4 2 2 189 411 -7.303 -8.357 -0.035 -6.081 -4.198 -2.700 -4.047 0.805 -4.532 -3.649 -0.044 -4.690 -4.384 3.439 -3.512 -0.501 -0.413 -3.873 -2.181 -3.015 + ML 526 524 6 529 4 1 1 187 410 -3.849 -4.032 -0.470 -2.761 0.625 -0.561 -0.262 -0.080 + MR 527 524 6 529 4 1 1 185 408 -4.828 -3.857 -1.665 -0.785 0.433 -0.431 -0.185 0.040 + D 528 524 6 529 4 0 0 183 406 -4.738 -4.419 -2.435 -0.452 + IL 529 529 5 529 4 1 1 188 411 -1.726 -2.409 -1.071 -4.895 0.000 0.000 0.000 0.000 + IR 530 530 6 530 3 1 1 188 411 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 81 ] 98 - U - - - + ML 531 530 6 533 3 1 1 187 409 -9.111 -0.017 -6.685 -1.722 -1.726 -2.468 1.684 + D 532 530 6 533 3 0 0 181 404 -6.540 -1.292 -0.784 + IL 533 533 3 533 3 1 1 187 409 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 82 ] 99 - G - - - + ML 534 533 3 536 3 1 1 186 408 -9.119 -0.009 -7.773 -1.212 -2.231 1.620 -1.831 + D 535 533 3 536 3 0 0 175 398 -6.410 -1.270 -0.802 + IL 536 536 3 536 3 1 1 185 408 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 83 ] 100 - a - - - + ML 537 536 3 539 3 1 1 185 408 -1.827 -0.495 -6.831 0.524 0.223 -0.814 -0.275 + D 538 536 3 539 3 0 0 148 370 -6.174 -1.687 -0.566 + IL 539 539 3 539 3 1 1 199 422 -0.119 -3.694 -8.861 0.000 0.000 0.000 0.000 + [ MATL 84 ] 132 - a - - - + ML 540 539 3 542 3 1 1 15 34 -9.125 -0.013 -7.059 0.629 -1.245 0.550 -0.818 + D 541 539 3 542 3 0 0 16 34 -6.296 -1.513 -0.651 + IL 542 542 3 542 3 1 1 20 38 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 85 ] 133 - A - - - + ML 543 542 3 545 3 1 1 14 32 -9.126 -0.009 -7.780 1.741 -2.127 -2.071 -2.388 + D 544 542 3 545 3 0 0 14 33 -6.283 -1.717 -0.550 + IL 545 545 3 545 3 1 1 19 37 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 86 ] 134 - a - - - + ML 546 545 3 548 3 1 1 12 31 -9.127 -0.009 -7.781 0.977 -1.156 -0.748 -0.018 + D 547 545 3 548 3 0 0 13 32 -6.259 -1.772 -0.526 + IL 548 548 3 548 3 1 1 18 36 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 87 ] 135 - U - - - + ML 549 548 3 551 2 1 1 1 1 * 0.000 -0.582 -1.266 -0.484 1.138 + D 550 548 3 551 2 0 0 0 0 * 0.000 + IL 551 551 3 551 2 1 1 13 28 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ END 88 ] - - - - - - + E 552 551 3 -1 0 0 0 0 0 + [ BEGR 89 ] - - - - - - + S 553 499 1 554 3 0 0 25 43 -9.131 -0.009 -7.785 + IL 554 554 2 554 3 1 1 29 48 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 90 ] 142 - G - - - + ML 555 554 2 557 3 1 1 25 43 -9.131 -0.009 -7.785 0.717 -2.809 1.009 -2.323 + D 556 554 2 557 3 0 0 24 43 -6.174 -1.687 -0.566 + IL 557 557 3 557 3 1 1 28 47 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 91 ] 143 - C - - - + ML 558 557 3 560 5 1 1 24 42 -8.155 -0.019 -7.970 -8.182 -9.074 -4.093 1.920 -4.749 -3.051 + D 559 557 3 560 5 0 0 23 41 -4.959 -0.803 -4.221 -2.596 -2.508 + IL 560 560 3 560 5 1 1 24 42 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000 + [ MATP 92 ] 144 155 u a - - + MP 561 560 3 565 6 2 2 23 41 -9.704 -9.643 -0.014 -8.420 -8.699 -9.094 -3.455 -3.281 -3.540 1.382 -2.981 -4.367 1.560 -3.489 -3.536 1.328 -4.057 -1.215 2.554 -3.684 -0.660 -2.102 + ML 562 560 3 565 6 1 1 22 40 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 563 560 3 565 6 1 1 22 40 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 564 560 3 565 6 0 0 20 38 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 565 565 5 565 6 1 1 23 41 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 566 566 6 566 5 1 1 22 41 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 93 ] 145 154 G C - - + MP 567 566 6 571 6 2 2 21 39 -9.704 -9.643 -0.014 -8.420 -8.699 -9.094 -5.320 -3.543 -5.310 -0.178 -6.205 -5.105 -1.278 -5.852 -5.008 3.730 -5.260 -1.157 -0.942 -4.463 -3.139 -4.249 + ML 568 566 6 571 6 1 1 21 39 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 569 566 6 571 6 1 1 20 39 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 570 566 6 571 6 0 0 19 37 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 571 571 5 571 6 1 1 21 39 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 572 572 6 572 5 1 1 20 39 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 94 ] 146 153 c g - - + MP 573 572 6 577 4 2 2 19 37 -8.175 -6.329 -0.577 -1.671 -2.403 -2.561 -1.074 0.558 -2.361 -3.409 2.606 -2.791 -1.629 0.502 -2.179 -1.054 0.998 -2.722 1.191 -1.750 + ML 574 572 6 577 4 1 1 20 38 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 575 572 6 577 4 1 1 20 38 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 576 572 6 577 4 0 0 19 37 -4.568 -4.250 -2.265 -0.520 + IL 577 577 5 577 4 1 1 21 40 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 578 578 6 578 3 1 1 20 38 -1.509 -0.750 -4.209 0.000 0.000 0.000 0.000 + [ MATL 95 ] 147 - C - - - + ML 579 578 6 581 3 1 1 16 34 -8.626 -0.013 -7.281 -2.291 1.737 -2.902 -1.608 + D 580 578 6 581 3 0 0 15 33 -9.008 -0.147 -3.399 + IL 581 581 3 581 3 1 1 20 38 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 96 ] 148 - C - - - + ML 582 581 3 584 3 1 1 14 33 -7.602 -0.014 -7.785 -3.611 1.894 -3.897 -2.900 + D 583 581 3 584 3 0 0 14 33 -6.174 -1.687 -0.566 + IL 584 584 3 584 3 1 1 18 37 -1.467 -0.780 -4.167 0.000 0.000 0.000 0.000 + [ MATL 97 ] 150 - C - - - + ML 585 584 3 587 3 1 1 12 31 -9.131 -0.009 -7.785 -2.892 1.826 -3.164 -2.259 + D 586 584 3 587 3 0 0 13 32 -6.174 -1.687 -0.566 + IL 587 587 3 587 3 1 1 18 36 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 98 ] 151 - C - - - + ML 588 587 3 590 2 1 1 1 1 * 0.000 -3.022 1.825 -3.061 -2.226 + D 589 587 3 590 2 0 0 0 0 * 0.000 + IL 590 590 3 590 2 1 1 13 28 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ END 99 ] - - - - - - + E 591 590 3 -1 0 0 0 0 0 +// +HMMER3/f [i1.1rc1 | June 2012] +NAME Cobalamin +ACC RF00174 +DESC Cobalamin riboswitch +LENG 191 +MAXL 565 +ALPH RNA +RF no +MM no +CONS yes +CS yes +MAP yes +DATE Wed Jun 13 05:40:08 2012 +COM [1] ./cmbuild Cobalamin.cm ../tutorial/Cobalamin.sto +NSEQ 431 +EFFN 4.955421 +CKSUM 2307274568 +STATS LOCAL MSV -10.2356 0.71319 +STATS LOCAL VITERBI -12.2484 0.71319 +STATS LOCAL FORWARD -3.9056 0.71319 +HMM A C G U + m->m m->i m->d i->m i->i d->m d->d + COMPO 1.37169 1.39466 1.27962 1.51293 + 1.38629 1.38629 1.38629 1.38629 + 0.02747 4.30141 4.30141 1.46634 0.26236 0.00000 * + 1 1.24903 1.60847 1.61442 1.15831 1 u - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02747 4.30141 4.30141 1.46634 0.26236 1.09861 0.40547 + 2 1.28810 1.50313 1.67262 1.15831 2 u - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 3 1.15107 1.40604 1.80386 1.29489 3 a - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 4 1.17200 1.61837 1.56685 1.26114 4 a - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 5 1.05945 1.63618 1.87848 1.18480 5 a - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 6 1.26505 1.64168 1.48588 1.21129 6 u - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 7 1.31715 1.47442 1.68272 1.14783 7 u - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 8 1.32907 1.67506 1.29915 1.29020 8 u - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 9 1.16103 1.70529 1.52242 1.24850 9 a - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 10 1.19074 1.42180 1.65009 1.33677 10 a - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 11 1.30224 1.39853 1.41443 1.43527 11 a - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 12 1.50100 1.28191 1.49114 1.29291 12 c - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 13 1.35762 1.47876 1.30931 1.40730 13 g - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 14 1.31290 1.49861 1.37774 1.36504 14 a - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 15 1.47301 1.35416 1.83542 1.04113 15 u - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 16 1.56669 1.49706 1.32024 1.20262 16 u - - [ + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 17 1.32645 1.42500 1.63172 1.20905 17 u - - [ + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 18 1.46904 1.39537 1.67427 1.09462 18 u - - [ + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 19 1.78940 2.60005 0.40247 2.40788 19 G - - [ + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 20 2.46303 3.25924 0.18850 3.03221 20 G - - [ + 1.38629 1.38629 1.38629 1.38629 + 0.02886 4.30301 4.20475 1.46634 0.26236 1.09861 0.40547 + 21 2.51359 1.65266 2.33680 0.46069 21 U - - [ + 1.38629 1.38629 1.38629 1.38629 + 0.43464 4.30161 1.08188 1.46634 0.26236 1.13245 0.38897 + 22 1.35810 2.00708 1.23173 1.14986 22 u - - , + 1.38629 1.38629 1.38629 1.38629 + 0.06064 3.46340 3.59302 1.07139 0.41936 0.07930 2.57386 + 23 1.84998 1.06106 1.64778 1.19009 25 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02913 4.29706 4.19284 1.46634 0.26236 1.23494 0.34369 + 24 2.14055 0.81160 1.82270 1.28491 26 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02764 4.29557 4.29557 1.46634 0.26236 1.26639 0.33107 + 25 1.74697 1.14831 1.50564 1.24949 27 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.03585 4.29557 3.83581 1.46634 0.26236 1.26639 0.33107 + 26 1.54986 1.20248 1.47840 1.34988 28 c - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02786 4.28758 4.28758 1.46634 0.26236 1.41869 0.27711 + 27 1.49431 1.35814 1.57714 1.16510 29 u - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.23264 4.28758 1.64082 1.46634 0.26236 1.41869 0.27711 + 28 1.36162 1.44145 1.56201 1.21249 30 u - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.11271 4.08903 2.40982 1.46634 0.26236 2.84723 0.05976 + 29 1.28483 1.59033 1.44657 1.25854 31 u - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.43884 1.08725 4.01314 2.03437 0.14014 1.03059 0.44129 + 30 1.25151 1.60951 1.42593 1.29589 54 a - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.03277 4.12758 4.12758 1.46634 0.26236 2.70096 0.06950 + 31 1.24432 1.59277 1.48738 1.26395 55 a - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.03277 4.12758 4.12758 1.46634 0.26236 2.70096 0.06950 + 32 1.28610 1.51456 1.40997 1.34862 56 a - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.04600 4.12758 3.54597 1.46634 0.26236 2.60916 0.07645 + 33 1.41087 1.82088 1.01927 1.45531 57 g - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.24914 4.11635 1.58852 1.46634 0.26236 2.74642 0.06631 + 34 1.32560 1.48659 1.50548 1.25070 58 u - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.11856 2.38894 3.90819 0.81808 0.58210 1.39558 0.28461 + 35 1.39712 1.51745 1.24496 1.40458 63 g - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.03669 4.01682 4.01682 1.46634 0.26236 2.01890 0.14249 + 36 1.13883 1.65204 1.33482 1.49191 64 a - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.03549 4.04945 4.04945 1.46634 0.26236 1.80326 0.18004 + 37 1.29835 1.57886 1.37963 1.31253 65 a - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.03507 4.08745 4.03532 1.46634 0.26236 0.14800 1.98361 + 38 1.50621 1.65719 0.96089 1.58462 66 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02759 4.29706 4.29706 1.46634 0.26236 1.23494 0.34369 + 39 1.44993 2.02331 0.73190 1.88256 67 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02759 4.29706 4.29706 1.46634 0.26236 1.23494 0.34369 + 40 1.35698 1.80609 0.94002 1.67318 68 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.10644 4.29706 2.43770 1.46634 0.26236 1.08710 0.41127 + 41 1.59433 1.61591 2.15457 0.72921 69 u - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02975 4.22279 4.22279 1.46634 0.26236 2.16315 0.12213 + 42 1.75563 1.78780 1.21150 1.01577 70 u - - , + 1.38629 1.38629 1.38629 1.38629 + 0.09873 2.54557 4.16175 0.93597 0.49792 0.50480 0.92539 + 43 0.18529 3.05983 2.68023 2.92449 77 A - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02969 4.28236 4.17052 1.46634 0.26236 1.36635 0.29442 + 44 0.14561 3.28917 3.04657 2.98177 78 A - - , + 1.38629 1.38629 1.38629 1.38629 + 0.03498 4.28280 3.88404 1.46634 0.26236 1.34629 0.30138 + 45 0.99239 1.98269 1.41716 1.38946 79 a - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02812 4.27831 4.27831 1.46634 0.26236 0.53850 0.87616 + 46 1.01112 1.61883 1.43287 1.61226 80 a - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.07775 2.79232 4.30301 0.43563 1.04088 1.09861 0.40547 + 47 2.75429 3.92257 0.11139 3.81845 83 G - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 48 2.40943 3.16848 0.19849 3.03444 84 G - - ( + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 49 3.42596 4.48014 0.06350 4.03549 85 G - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 50 0.05799 4.17225 3.81999 3.96354 86 A - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 51 0.05799 4.17225 3.81999 3.96354 87 A - - , + 1.38629 1.38629 1.38629 1.38629 + 0.03866 3.75681 4.22919 0.91930 0.50883 1.09861 0.40547 + 52 1.98485 1.19479 1.38870 1.16979 89 u - - < + 1.38629 1.38629 1.38629 1.38629 + 0.15295 2.05346 4.30197 0.19920 1.71141 1.12383 0.39309 + 53 1.80953 0.98290 1.45828 1.47225 91 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02746 4.30197 4.30197 1.46634 0.26236 1.05001 0.43068 + 54 2.12473 0.78072 1.65792 1.46135 92 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.03041 4.10911 4.30301 1.24043 0.34145 1.09861 0.40547 + 55 2.27798 3.18927 0.20690 3.14186 94 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.03940 4.10561 3.80952 1.23672 0.34296 1.09861 0.40547 + 56 1.97289 2.52928 0.36130 2.47146 96 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.03518 4.13066 3.99042 1.27291 0.32852 1.22411 0.34817 + 57 2.39794 2.42314 2.91164 0.26649 98 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.03252 4.29044 4.00101 1.46634 0.26236 0.84185 0.56372 + 58 2.12246 2.83568 0.29870 2.52819 99 G - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02764 4.29529 4.29529 1.46634 0.26236 0.82203 0.57899 + 59 1.03873 1.27112 1.91741 1.52055 100 a - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.33219 1.32689 4.05405 2.83033 0.06081 1.09861 0.40547 + 60 0.96734 2.17495 1.05322 1.84845 132 a - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.03026 4.29918 4.12093 1.46634 0.26236 0.98453 0.46779 + 61 0.21364 2.76149 2.68069 2.80264 133 A - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02752 4.29960 4.29960 1.46634 0.26236 1.12436 0.39283 + 62 0.74560 2.10816 1.87250 1.38489 134 a - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02750 4.30036 4.30036 1.46634 0.26236 1.16162 0.37539 + 63 1.71454 2.15172 1.72721 0.64267 135 U - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.04216 4.30036 3.58554 1.46634 0.26236 0.98338 0.46848 + 64 2.71649 0.41386 2.35761 1.72511 136 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02858 4.28879 4.23684 1.46634 0.26236 0.87015 0.54281 + 65 3.36738 0.23292 3.03863 2.07621 137 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02758 4.29754 4.29754 1.46634 0.26236 0.88594 0.53158 + 66 1.69232 1.78272 0.69453 1.90771 138 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02849 4.30301 4.22919 1.46634 0.26236 1.09861 0.40547 + 67 1.67759 1.56646 0.87794 1.66732 139 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.03118 4.06533 4.30197 1.19599 0.36011 1.12383 0.39309 + 68 1.38783 1.50067 1.02718 1.77556 141 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02746 4.30197 4.30197 1.46634 0.26236 1.05001 0.43068 + 69 0.91704 3.02785 0.72974 2.66149 142 g - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 70 3.85775 0.07816 4.37197 3.18350 143 C - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 71 1.71082 1.54306 1.58455 0.91500 144 u - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 72 2.54863 3.25208 0.18737 2.91906 145 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 73 1.83593 0.98469 1.77869 1.21026 146 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.34599 4.30301 1.27671 1.46634 0.26236 1.09861 0.40547 + 74 2.65086 0.25011 3.13070 2.23485 147 C - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.03753 3.99454 3.99454 1.46634 0.26236 0.09257 2.42572 + 75 3.55139 0.10145 3.88052 3.05445 148 C - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.03054 4.10115 4.30301 1.23201 0.34489 1.09861 0.40547 + 76 3.09709 0.16005 3.41311 2.66237 150 C - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 77 3.15616 0.16050 3.35905 2.64617 151 C - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.03591 3.82825 4.30301 0.97688 0.47238 1.09861 0.40547 + 78 1.67375 2.02800 0.67613 1.75863 153 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 79 3.13040 0.21826 3.06048 2.24890 154 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 80 1.02773 1.71250 1.38934 1.54867 155 a - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 81 0.47482 2.84179 1.40971 2.58407 156 A - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 82 4.66963 0.05039 4.42310 3.58393 157 C - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 83 2.35508 1.60399 1.41086 0.77634 158 u - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 84 3.21686 4.14500 0.07529 4.09820 159 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 85 3.32178 3.06599 3.85044 0.10978 160 U - - - + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 86 0.72178 2.49732 1.11300 2.27072 161 a - - - + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 87 0.47223 2.52370 2.10602 1.74581 162 A - - - + 1.38629 1.38629 1.38629 1.38629 + 0.05701 3.17273 4.30301 0.60144 0.79412 1.09861 0.40547 + 88 1.64272 1.95345 0.68060 1.84231 165 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 89 2.29700 0.79125 1.56793 1.43679 166 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.03007 4.12935 4.30301 1.26208 0.33277 1.09861 0.40547 + 90 1.62425 2.12686 0.59558 2.02127 168 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.04665 4.30301 3.44050 1.46634 0.26236 1.09861 0.40547 + 91 1.53385 1.98006 0.70846 1.87188 169 g - - < + 1.38629 1.38629 1.38629 1.38629 + 0.47052 1.03914 3.83680 0.80946 0.58896 0.68160 0.70483 + 92 1.16284 1.81195 1.25459 1.43181 180 a - - - + 1.38629 1.38629 1.38629 1.38629 + 0.02770 4.29317 4.29317 1.46634 0.26236 0.93285 0.49994 + 93 1.18545 1.66626 1.18203 1.61554 181 g - - - + 1.38629 1.38629 1.38629 1.38629 + 0.02753 4.29950 4.29950 1.46634 0.26236 1.05667 0.42711 + 94 0.93241 1.91902 1.21546 1.81355 182 a - - - + 1.38629 1.38629 1.38629 1.38629 + 0.02748 4.30130 4.30130 1.46634 0.26236 1.02115 0.44657 + 95 1.28651 1.48782 1.29968 1.49040 183 a - - - + 1.38629 1.38629 1.38629 1.38629 + 0.03142 4.30301 4.05109 1.46634 0.26236 1.09861 0.40547 + 96 1.43733 1.26401 1.38804 1.46813 184 c - - - + 1.38629 1.38629 1.38629 1.38629 + 0.02754 4.29912 4.29912 1.46634 0.26236 1.18982 0.36280 + 97 1.21299 1.39886 1.63233 1.34576 185 a - - - + 1.38629 1.38629 1.38629 1.38629 + 0.03436 4.29912 3.90210 1.46634 0.26236 0.93790 0.49667 + 98 1.40965 1.43807 1.46404 1.24797 186 u - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02761 4.29639 4.29639 1.46634 0.26236 0.85213 0.55601 + 99 1.55994 1.33069 1.44048 1.24222 187 u - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 100 1.89287 1.01007 1.55168 1.29728 188 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02819 4.30301 4.24993 1.46634 0.26236 1.09861 0.40547 + 101 1.77387 1.24694 1.22697 1.38724 189 g - - < + 1.38629 1.38629 1.38629 1.38629 + 0.03325 4.30227 3.95444 1.46634 0.26236 1.11662 0.39658 + 102 1.77291 1.21736 1.49016 1.17502 190 u - - < + 1.38629 1.38629 1.38629 1.38629 + 0.03928 4.29662 3.69258 1.46634 0.26236 1.24430 0.33988 + 103 1.73193 1.07778 1.61973 1.25612 191 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.03285 4.28527 3.98767 1.46634 0.26236 1.45861 0.26469 + 104 0.70716 1.77667 1.94796 1.63378 192 a - - - + 1.38629 1.38629 1.38629 1.38629 + 0.02985 4.28048 4.16221 1.46634 0.26236 1.53614 0.24234 + 105 1.11080 1.56555 1.59636 1.35055 193 a - - - + 1.38629 1.38629 1.38629 1.38629 + 0.03293 4.27874 3.98822 1.46634 0.26236 1.00202 0.45750 + 106 1.27579 1.37483 1.78268 1.20491 194 u - - - + 1.38629 1.38629 1.38629 1.38629 + 0.06832 4.28448 2.95165 1.46634 0.26236 0.98474 0.46766 + 107 0.73169 1.92893 1.80573 1.56422 195 a - - - + 1.38629 1.38629 1.38629 1.38629 + 0.22641 4.25420 1.66914 1.46634 0.26236 1.87509 0.16646 + 108 1.16046 1.65815 1.66644 1.18010 196 a - - - + 1.38629 1.38629 1.38629 1.38629 + 0.41154 1.16203 3.70838 2.03591 0.13991 0.52992 0.88832 + 109 1.61650 2.21820 0.57490 2.04142 225 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.04107 4.21611 3.66991 1.46634 0.26236 0.24656 1.52089 + 110 2.25402 0.72012 1.68521 1.50093 226 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02770 4.29313 4.29313 1.46634 0.26236 1.31552 0.31243 + 111 4.23605 0.06956 4.23057 3.26516 227 C - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02770 4.29313 4.29313 1.46634 0.26236 1.31552 0.31243 + 112 0.05908 4.15412 3.80293 3.94426 228 A - - - + 1.38629 1.38629 1.38629 1.38629 + 0.02852 4.29313 4.23698 1.46634 0.26236 0.76932 0.62237 + 113 3.82674 0.15572 3.67076 2.33344 229 C - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02745 4.30223 4.30223 1.46634 0.26236 1.11768 0.39607 + 114 3.19380 1.80053 2.78276 0.31210 230 U - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02874 4.30223 4.21388 1.46634 0.26236 1.11768 0.39607 + 115 1.98207 2.49547 0.36412 2.46572 231 G - - < + 1.38629 1.38629 1.38629 1.38629 + 0.02748 4.30097 4.30097 1.46634 0.26236 1.14744 0.38192 + 116 1.70509 1.92458 0.72241 1.67811 232 g - - < + 1.38629 1.38629 1.38629 1.38629 + 0.04557 4.30097 3.47408 1.46634 0.26236 1.00757 0.45429 + 117 1.66942 1.29492 1.33808 1.28962 233 u - - < + 1.38629 1.38629 1.38629 1.38629 + 0.09836 4.28545 2.52687 1.46634 0.26236 1.45540 0.26567 + 118 1.58062 1.16732 1.55528 1.30261 234 c - - < + 1.38629 1.38629 1.38629 1.38629 + 0.28654 4.21702 1.45072 1.46634 0.26236 2.14038 0.12512 + 119 1.33853 1.38808 1.47844 1.34621 235 a - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.03847 3.97031 3.97031 1.46634 0.26236 0.52815 0.89086 + 120 1.42747 1.72121 1.13357 1.34957 236 g - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.03072 4.19127 4.19127 1.46634 0.26236 0.49884 0.93455 + 121 1.40107 1.21924 1.77184 1.24413 237 c - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02830 4.27213 4.27213 1.46634 0.26236 1.65779 0.21141 + 122 0.96679 1.58100 1.85815 1.35491 238 a - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.02830 4.27213 4.27213 1.46634 0.26236 0.91406 0.51232 + 123 1.11167 1.39406 1.79584 1.35893 239 a - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.88674 1.13571 1.32121 2.73074 0.06739 0.93930 0.49577 + 124 1.41921 1.40317 1.30448 1.42309 298 g - - _ + 1.38629 1.38629 1.38629 1.38629 + 0.06536 4.00696 3.09934 1.46634 0.26236 0.36472 1.18544 + 125 1.51135 1.70103 1.01611 1.44863 299 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02997 4.21564 4.21564 1.46634 0.26236 0.45890 0.99962 + 126 1.46144 1.47285 1.16177 1.48769 300 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.03310 4.01861 4.22801 1.16690 0.37299 0.65015 0.73808 + 127 1.94880 0.80894 1.68656 1.48250 302 c - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02908 4.30096 4.19266 1.46634 0.26236 1.05826 0.42627 + 128 2.72600 0.66760 2.35358 1.11917 303 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02749 4.30068 4.30068 1.46634 0.26236 1.04611 0.43279 + 129 2.29258 3.17240 0.22742 2.80505 304 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02745 4.30223 4.30223 1.46634 0.26236 1.11768 0.39607 + 130 2.57119 3.83935 0.13376 3.60280 305 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02745 4.30223 4.30223 1.46634 0.26236 1.06153 0.42453 + 131 3.31630 4.35512 0.07285 3.85691 306 G - - - + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 132 0.06799 4.02102 3.72609 3.74207 307 A - - - + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 133 0.12440 3.37600 3.22292 3.14761 308 A - - - + 1.38629 1.38629 1.38629 1.38629 + 0.03758 4.30301 3.75681 1.46634 0.26236 1.09861 0.40547 + 134 3.47514 4.38163 0.06100 4.15326 309 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02770 4.29313 4.29313 1.46634 0.26236 1.31552 0.31243 + 135 1.74136 1.80652 0.63371 2.04118 310 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.14056 4.29313 2.14162 1.46634 0.26236 0.76932 0.62237 + 136 2.25350 0.67361 1.96722 1.40544 311 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.19943 1.88515 3.54059 0.36964 1.17436 0.20914 1.66750 + 137 1.45303 1.79575 0.94189 1.55948 315 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02778 4.29044 4.29044 1.46634 0.26236 0.82159 0.57934 + 138 1.33711 1.62108 1.07658 1.61469 316 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02750 4.30033 4.30033 1.46634 0.26236 1.02843 0.44250 + 139 1.59573 1.32387 1.11122 1.59959 317 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.03300 3.96710 4.30227 1.20083 0.35803 1.06354 0.42347 + 140 1.48415 1.73740 0.90035 1.65601 320 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.04274 4.10749 3.67348 1.23871 0.34215 1.09861 0.40547 + 141 1.44435 1.61858 1.15286 1.38554 322 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02776 4.29108 4.29108 1.46634 0.26236 1.12814 0.39102 + 142 1.40571 1.55095 1.17735 1.44959 323 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.04238 3.61931 4.22032 0.91514 0.51159 0.80334 0.59390 + 143 1.20106 1.55628 1.31423 1.51629 326 a - - - + 1.38629 1.38629 1.38629 1.38629 + 0.02746 4.30196 4.30196 1.46634 0.26236 1.04974 0.43083 + 144 1.05221 1.78861 1.40931 1.42991 327 a - - - + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 145 1.49934 1.45993 1.09172 1.56623 328 g - - - + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 146 1.47915 1.38803 1.35751 1.32689 329 u - - - + 1.38629 1.38629 1.38629 1.38629 + 0.03756 4.30301 3.75783 1.46634 0.26236 1.09861 0.40547 + 147 1.00379 1.98481 1.21493 1.61257 330 a - - - + 1.38629 1.38629 1.38629 1.38629 + 0.05421 4.29315 3.24141 1.46634 0.26236 1.31505 0.31261 + 148 1.11639 1.86426 1.36646 1.33743 331 a - - - + 1.38629 1.38629 1.38629 1.38629 + 0.04171 4.26738 3.61797 1.46634 0.26236 1.72054 0.19719 + 149 1.42431 1.62657 1.31546 1.22291 332 u - - - + 1.38629 1.38629 1.38629 1.38629 + 0.03085 4.25447 4.12398 1.46634 0.26236 1.87211 0.16700 + 150 1.14948 2.03156 1.05479 1.59060 333 g - - - + 1.38629 1.38629 1.38629 1.38629 + 0.04257 4.25249 3.59543 1.46634 0.26236 1.89332 0.16319 + 151 0.82935 1.87300 1.59969 1.56999 334 a - - - + 1.38629 1.38629 1.38629 1.38629 + 0.21304 4.23918 1.72904 1.46634 0.26236 2.02426 0.14167 + 152 1.56867 0.97776 1.99356 1.27541 335 c - - - + 1.38629 1.38629 1.38629 1.38629 + 0.45592 1.08792 3.53302 3.16434 0.04316 0.15270 1.95466 + 153 2.05045 0.80580 1.79099 1.35557 402 c - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02941 4.28431 4.18658 1.46634 0.26236 0.61205 0.78141 + 154 2.24494 0.66984 1.98301 1.40804 403 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02747 4.30162 4.30162 1.46634 0.26236 1.03453 0.43912 + 155 1.63401 1.66923 0.71089 2.07741 404 g - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 156 2.15756 0.80085 1.81542 1.29947 405 c - - > + 1.38629 1.38629 1.38629 1.38629 + 0.03766 3.75365 4.30301 0.91683 0.51047 1.09861 0.40547 + 157 1.14333 2.30801 0.75936 2.17315 407 g - - - + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 158 0.10661 3.45503 3.29926 3.42253 408 A - - - + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 159 3.59485 4.56947 0.05577 4.10934 409 G - - - + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 160 2.45255 0.78219 3.06353 0.89208 410 c - - - + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 161 4.24403 0.09177 4.00893 2.89719 411 C - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 162 0.85847 1.51397 1.45667 2.09441 412 a - - > + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 163 3.82888 4.69993 0.04299 4.48772 413 G - - > + 1.38629 1.38629 1.38629 1.38629 + 0.03758 4.30301 3.75681 1.46634 0.26236 1.09861 0.40547 + 164 1.36130 3.02690 0.47678 2.59789 414 G - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02770 4.29313 4.29313 1.46634 0.26236 1.31552 0.31243 + 165 0.07478 3.97737 3.48635 3.78518 415 A - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02770 4.29313 4.29313 1.46634 0.26236 1.31552 0.31243 + 166 2.07870 3.00820 0.28215 2.63992 416 G - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02770 4.29313 4.29313 1.46634 0.26236 1.31552 0.31243 + 167 0.07110 4.01580 3.54964 3.82272 417 A - - , + 1.38629 1.38629 1.38629 1.38629 + 0.02770 4.29313 4.29313 1.46634 0.26236 0.76932 0.62237 + 168 3.22566 0.23966 2.88893 2.13928 418 C - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 169 3.99717 0.12957 3.78951 2.51888 419 C - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.03710 4.30301 3.77709 1.46634 0.26236 1.09861 0.40547 + 170 1.83247 1.54414 1.46722 0.92654 420 u - - ) + 1.38629 1.38629 1.38629 1.38629 + 0.02769 4.29360 4.29360 1.46634 0.26236 0.78025 0.61303 + 171 1.92483 2.45259 0.39512 2.35988 421 G - - ] + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 172 3.31990 0.21477 3.08295 2.19556 422 C - - ] + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 173 2.71639 0.42788 2.38356 1.66192 423 C - - ] + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 174 1.25076 1.81371 1.23869 1.34361 424 g - - ] + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 175 1.54434 1.70196 1.17488 1.21954 425 g - - ] + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 176 1.40798 1.46982 1.27683 1.40050 426 g - - ] + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 177 1.18394 1.69593 1.51954 1.23206 427 a - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 178 1.27564 1.49766 1.31220 1.47900 428 a - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 179 1.31428 1.47326 1.53565 1.24883 429 u - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 180 1.38664 1.52439 1.37112 1.27829 430 u - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 181 1.35245 1.43180 1.49281 1.28095 431 u - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 182 1.29898 1.51481 1.69904 1.12553 432 u - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 183 1.25000 1.66010 1.46572 1.22942 433 u - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 184 1.28242 1.69982 1.29083 1.32849 434 a - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 185 1.17156 1.68621 1.44410 1.31327 435 a - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 186 1.22009 1.28821 1.81175 1.32553 436 a - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 187 1.30308 1.39524 1.62633 1.25919 437 u - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 188 1.34275 1.28056 1.58864 1.35950 438 c - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 189 1.31677 1.65824 1.41232 1.21084 439 u - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 190 1.43270 1.22474 1.77469 1.21077 440 u - - : + 1.38629 1.38629 1.38629 1.38629 + 0.02743 4.30301 4.30301 1.46634 0.26236 1.09861 0.40547 + 191 1.51542 1.17791 1.56046 1.33817 441 c - - : + 1.38629 1.38629 1.38629 1.38629 + 0.01381 4.28939 * 1.46634 0.26236 0.00000 * +//
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/cmsearch_input1.cm Sat Jan 21 17:36:57 2017 -0500 @@ -0,0 +1,563 @@ +INFERNAL1/a [1.1.1 | July 2014] +NAME tRNA5 +STATES 230 +NODES 61 +CLEN 72 +W 89 +ALPH RNA +RF no +CONS yes +MAP yes +DATE Mon Jun 27 12:35:45 2016 +COM [1] ./src/cmbuild tRNA5.cm tutorial/tRNA5.sto +COM [2] cmcalibrate tRNA5.cm +PBEGIN 0.05 +PEND 0.05 +WBETA 1e-07 +QDBBETA1 1e-07 +QDBBETA2 1e-15 +N2OMEGA 1.52588e-05 +N3OMEGA 1.52588e-05 +ELSELF -0.08926734 +NSEQ 5 +EFFN 3.725586 +CKSUM 3535941971 +NULL 0.000 0.000 0.000 0.000 +EFP7GF -5.5288 0.72958 +ECMLC 0.85563 -4.01853 2.43520 1600000 300168 0.003998 +ECMGC 0.39437 -17.41037 -4.06685 1600000 77168 0.005183 +ECMLI 0.73047 -3.70982 3.57712 1600000 245977 0.004879 +ECMGI 0.44078 -12.13534 -0.86006 1600000 57603 0.006944 +CM + [ ROOT 0 ] - - - - - - + S 0 -1 0 1 4 0 1 89 108 -7.419 -8.664 -0.055 -5.118 + IL 1 1 2 1 4 3 28 90 110 -2.817 -4.319 -0.613 -2.698 0.000 0.000 0.000 0.000 + IR 2 2 3 2 3 4 30 90 110 -1.925 -0.554 -4.164 0.000 0.000 0.000 0.000 + [ MATR 1 ] - 74 - a - - + MR 3 2 3 5 5 4 32 89 108 -7.593 -0.028 -7.408 -7.620 -8.512 0.474 -1.199 0.305 -0.089 + D 4 2 3 5 5 1 24 87 107 -5.352 -0.707 -2.978 -4.409 -2.404 + IR 5 5 3 5 5 3 28 89 109 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 2 ] 1 73 g c - - + MP 6 5 3 10 6 5 32 88 107 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.831 -2.997 -3.795 0.617 -3.618 -4.452 0.854 -3.918 -3.870 2.837 -4.276 -0.713 1.871 -3.843 -1.175 -2.703 + ML 7 5 3 10 6 3 26 86 106 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 8 5 3 10 6 3 25 86 106 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 9 5 3 10 6 0 21 84 103 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 10 10 5 10 6 3 27 87 107 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 11 11 6 11 5 3 27 87 107 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 3 ] 2 72 C G - - + MP 12 11 6 16 6 5 31 86 105 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -4.097 -3.805 -3.998 0.021 -3.009 -4.646 3.103 -3.661 -3.977 1.529 -4.392 -1.585 0.835 -4.247 -0.625 -2.808 + ML 13 11 6 16 6 2 25 84 104 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 14 11 6 16 6 2 25 84 104 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 15 11 6 16 6 0 21 82 101 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 16 16 5 16 6 3 27 85 105 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 17 17 6 17 5 3 27 85 105 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 4 ] 3 71 c g - - + MP 18 17 6 22 6 5 29 84 103 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.141 -2.880 -3.222 0.733 -2.762 -4.023 2.237 -3.232 -3.242 1.678 -3.747 0.537 1.616 -3.340 -0.447 -2.158 + ML 19 17 6 22 6 2 25 82 102 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 20 17 6 22 6 2 24 82 102 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 21 17 6 22 6 0 20 80 99 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 22 22 5 22 6 3 26 83 103 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 23 23 6 23 5 3 26 83 103 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 5 ] 4 70 g c - - + MP 24 23 6 28 6 5 28 82 101 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.477 -2.737 -3.484 0.861 -3.437 -4.224 1.956 -3.685 -3.594 2.509 -4.028 0.683 0.624 -3.528 -1.017 -2.419 + ML 25 23 6 28 6 2 24 80 100 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 26 23 6 28 6 2 24 80 100 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 27 23 6 28 6 0 20 78 97 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 28 28 5 28 6 3 25 81 101 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 29 29 6 29 5 3 25 81 101 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 6 ] 5 69 g c - - + MP 30 29 6 34 6 5 26 80 99 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -2.565 0.048 -2.684 1.825 -2.755 -3.485 0.996 -3.019 -2.788 2.050 -3.293 -0.374 0.757 -2.774 0.549 -1.819 + ML 31 29 6 34 6 2 23 78 98 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 32 29 6 34 6 2 23 78 98 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 33 29 6 34 6 0 19 76 96 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 34 34 5 34 6 2 24 79 99 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 35 35 6 35 5 3 24 79 99 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 7 ] 6 68 c g - - + MP 36 35 6 40 6 5 24 78 97 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.250 -3.161 -3.321 0.517 -2.657 -4.117 2.088 -3.215 -3.310 1.474 -3.823 -1.143 2.088 -3.483 0.783 -2.234 + ML 37 35 6 40 6 2 22 77 97 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 38 35 6 40 6 2 21 77 96 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 39 35 6 40 6 0 19 75 95 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 40 40 5 40 6 2 23 77 97 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 41 41 6 41 5 2 23 77 97 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 8 ] 7 67 A U - - + MP 42 41 6 46 4 4 22 76 95 -7.543 -7.750 -0.035 -6.164 -3.769 -3.134 -3.802 3.011 -3.544 -4.775 0.728 -3.793 -3.752 0.821 -4.250 -0.784 1.443 -4.133 -1.238 -2.690 + ML 43 41 6 46 4 1 21 76 96 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 44 41 6 46 4 1 20 76 96 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 45 41 6 46 4 0 19 74 94 -4.568 -4.250 -2.265 -0.520 + IL 46 46 5 46 4 2 22 77 97 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 47 47 6 47 3 2 21 76 96 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 9 ] 8 - U - - - + ML 48 47 6 50 3 2 20 73 93 -8.524 -0.014 -7.178 -2.549 -2.369 -3.320 1.822 + D 49 47 6 50 3 0 18 72 92 -6.174 -1.687 -0.566 + IL 50 50 3 50 3 2 20 75 95 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 10 ] 9 - A - - - + ML 51 50 3 53 2 1 19 72 92 -9.006 -0.003 1.048 -1.964 0.381 -1.421 + D 52 50 3 53 2 0 18 71 91 -8.445 -0.004 + IL 53 53 3 53 2 1 19 73 93 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ BIF 11 ] - - - - - - + B 54 53 3 124 55 0 18 71 91 + [ BEGR 42 ] - - - - - - + S 55 54 1 56 3 0 0 36 55 -8.524 -0.014 -7.178 + IL 56 56 2 56 3 1 1 39 59 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 43 ] 45 - A - - - + ML 57 56 2 59 3 1 1 36 55 -8.524 -0.014 -7.178 1.385 -1.618 -1.684 -0.412 + D 58 56 2 59 3 0 0 35 54 -6.174 -1.687 -0.566 + IL 59 59 3 59 3 1 1 38 57 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 44 ] 46 - G - - - + ML 60 59 3 62 3 1 1 35 54 -8.524 -0.014 -7.178 -2.700 -4.060 1.885 -3.430 + D 61 59 3 62 3 0 0 34 53 -6.174 -1.687 -0.566 + IL 62 62 3 62 3 1 1 37 56 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 45 ] 47 - g - - - + ML 63 62 3 65 3 1 1 34 52 -8.524 -0.481 -1.832 0.586 -2.024 0.919 -1.466 + D 64 62 3 65 3 0 0 33 52 -6.174 -1.687 -0.566 + IL 65 65 3 65 3 1 1 36 55 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 46 ] 48 - U - - - + ML 66 65 3 68 3 1 1 33 51 -8.062 -0.019 -6.716 -1.668 -1.633 -2.411 1.667 + D 67 65 3 68 3 0 0 31 50 -8.417 -0.227 -2.808 + IL 68 68 3 68 3 1 1 35 54 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 47 ] 49 - C - - - + ML 69 68 3 71 5 1 1 31 50 -7.593 -0.028 -7.408 -7.620 -8.512 -1.578 1.336 -2.466 -0.059 + D 70 68 3 71 5 0 0 30 49 -4.959 -0.803 -4.221 -2.596 -2.508 + IL 71 71 3 71 5 1 1 32 51 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000 + [ MATP 48 ] 50 66 C G - - + MP 72 71 3 76 6 2 2 30 49 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -4.063 -3.835 -3.975 1.367 -2.984 -4.641 3.137 -3.636 -3.945 0.196 -4.368 -1.641 0.814 -4.253 -0.622 -2.801 + ML 73 71 3 76 6 1 1 29 48 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 74 71 3 76 6 1 1 29 48 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 75 71 3 76 6 0 0 27 45 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 76 76 5 76 6 1 1 30 49 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 77 77 6 77 5 1 1 30 49 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 49 ] 51 65 g c - - + MP 78 77 6 82 6 2 2 28 47 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.269 -3.002 -3.316 0.607 -2.825 -4.080 1.486 -3.318 -3.360 2.123 -3.845 -0.940 1.986 -3.442 0.799 -2.268 + ML 79 77 6 82 6 1 1 27 46 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 80 77 6 82 6 1 1 27 46 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 81 77 6 82 6 0 0 25 44 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 82 82 5 82 6 1 1 28 47 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 83 83 6 83 5 1 1 28 47 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 50 ] 52 64 g c - - + MP 84 83 6 88 6 2 2 26 45 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.573 -3.001 -3.543 0.634 -3.168 -4.231 1.794 -3.603 -3.657 2.626 -4.078 -0.813 0.766 -3.618 0.675 -2.477 + ML 85 83 6 88 6 1 1 25 44 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 86 83 6 88 6 1 1 25 44 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 87 83 6 88 6 0 0 23 42 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 88 88 5 88 6 1 1 26 45 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 89 89 6 89 5 1 1 26 45 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 51 ] 53 63 g c - - + MP 90 89 6 94 6 2 2 24 43 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.680 -2.656 -3.624 1.495 -4.000 -4.305 0.538 -4.011 -3.825 2.937 -4.200 -0.344 1.037 -3.597 -1.457 -2.574 + ML 91 89 6 94 6 1 1 24 43 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 92 89 6 94 6 1 1 24 43 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 93 89 6 94 6 0 0 22 41 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 94 94 5 94 6 1 1 24 43 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 95 95 6 95 5 1 1 24 43 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 52 ] 54 62 G C - - + MP 96 95 6 100 4 2 2 22 41 -7.543 -7.750 -0.035 -6.164 -5.814 -3.622 -6.104 -0.561 -6.715 -5.090 -1.814 -6.360 -4.961 3.816 -5.237 -1.382 -2.178 -5.150 -3.925 -4.967 + ML 97 95 6 100 4 1 1 24 43 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 98 95 6 100 4 1 1 23 42 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 99 95 6 100 4 0 0 22 41 -4.568 -4.250 -2.265 -0.520 + IL 100 100 5 100 4 1 1 25 44 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 101 101 6 101 3 1 1 24 43 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 53 ] 55 - U - - - + ML 102 101 6 104 3 1 1 20 38 -8.524 -0.014 -7.178 -2.549 -2.369 -3.320 1.822 + D 103 101 6 104 3 0 0 19 38 -6.174 -1.687 -0.566 + IL 104 104 3 104 3 1 1 23 42 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 54 ] 56 - U - - - + ML 105 104 3 107 3 1 1 18 37 -8.524 -0.014 -7.178 -2.549 -2.369 -3.320 1.822 + D 106 104 3 107 3 0 0 18 37 -6.174 -1.687 -0.566 + IL 107 107 3 107 3 1 1 22 41 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 55 ] 57 - C - - - + ML 108 107 3 110 3 1 1 17 36 -8.524 -0.014 -7.178 -3.081 1.849 -3.880 -2.250 + D 109 107 3 110 3 0 0 17 35 -6.174 -1.687 -0.566 + IL 110 110 3 110 3 1 1 21 39 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 56 ] 58 - G - - - + ML 111 110 3 113 3 1 1 16 34 -8.524 -0.014 -7.178 -0.198 -2.380 1.409 -1.835 + D 112 110 3 113 3 0 0 16 34 -6.174 -1.687 -0.566 + IL 113 113 3 113 3 1 1 20 38 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 57 ] 59 - A - - - + ML 114 113 3 116 3 1 1 14 33 -8.524 -0.014 -7.178 1.878 -3.490 -3.019 -3.147 + D 115 113 3 116 3 0 0 15 33 -6.174 -1.687 -0.566 + IL 116 116 3 116 3 1 1 19 37 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 58 ] 60 - U - - - + ML 117 116 3 119 3 1 1 13 31 -8.524 -0.014 -7.178 -1.468 -0.407 -2.235 1.418 + D 118 116 3 119 3 0 0 13 32 -6.174 -1.687 -0.566 + IL 119 119 3 119 3 1 1 18 36 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 59 ] 61 - U - - - + ML 120 119 3 122 2 1 1 1 1 * 0.000 -1.239 0.314 -2.046 1.064 + D 121 119 3 122 2 0 0 0 0 * 0.000 + IL 122 122 3 122 2 1 1 13 28 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ END 60 ] - - - - - - + E 123 122 3 -1 0 0 0 0 0 + [ BEGL 12 ] - - - - - - + S 124 54 1 125 1 0 3 49 68 0.000 + [ BIF 13 ] - - - - - - + B 125 124 1 126 173 0 3 49 68 + [ BEGL 14 ] - - - - - - + S 126 125 1 127 4 0 0 30 48 -0.035 -7.164 -6.572 -7.212 + [ MATP 15 ] 10 26 G C - - + MP 127 126 1 131 6 2 2 30 48 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -4.768 -3.151 -4.805 0.251 -5.796 -4.949 -0.981 -5.231 -4.514 3.516 -4.857 0.895 -1.246 -4.551 -3.005 -3.683 + ML 128 126 1 131 6 1 1 28 47 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 129 126 1 131 6 1 1 28 47 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 130 126 1 131 6 0 0 26 45 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 131 131 5 131 6 1 1 29 48 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 132 132 6 132 5 1 1 29 48 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 16 ] 11 25 c g - - + MP 133 132 6 137 6 2 2 28 46 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -4.380 -4.331 -4.172 -0.461 -2.935 -4.679 2.953 -3.697 -4.172 -0.278 -4.524 -2.247 2.367 -4.479 -0.580 -2.998 + ML 134 132 6 137 6 1 1 27 45 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 135 132 6 137 6 1 1 26 45 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 136 132 6 137 6 0 0 24 43 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 137 137 5 137 6 1 1 27 46 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 138 138 6 138 5 1 1 27 46 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 17 ] 12 24 g c - - + MP 139 138 6 143 6 2 2 26 44 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.838 -2.993 -3.801 0.619 -3.635 -4.454 0.839 -3.930 -3.877 2.852 -4.281 -0.708 1.851 -3.845 -1.190 -2.710 + ML 140 138 6 143 6 1 1 25 44 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 141 138 6 143 6 1 1 25 44 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 142 138 6 143 6 0 0 24 42 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 143 143 5 143 6 1 1 26 44 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 144 144 6 144 5 1 1 25 44 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 18 ] 13 23 c g - - + MP 145 144 6 149 4 2 2 24 42 -7.543 -7.750 -0.035 -6.164 -3.454 -3.490 -3.467 0.042 -2.692 -4.152 2.807 -3.318 -3.483 0.166 -3.945 -1.653 0.946 -3.679 1.162 0.637 + ML 146 144 6 149 4 1 1 25 44 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 147 144 6 149 4 1 1 24 43 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 148 144 6 149 4 0 0 23 42 -4.568 -4.250 -2.265 -0.520 + IL 149 149 5 149 4 1 1 26 45 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 150 150 6 150 3 1 1 25 44 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 19 ] 14 - A - - - + ML 151 150 6 153 3 1 1 20 39 -8.524 -0.014 -7.178 1.878 -3.490 -3.019 -3.147 + D 152 150 6 153 3 0 0 20 39 -6.174 -1.687 -0.566 + IL 153 153 3 153 3 1 1 24 43 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 20 ] 15 - g - - - + ML 154 153 3 156 3 1 1 19 38 -8.524 -0.014 -7.178 0.586 -2.024 0.919 -1.466 + D 155 153 3 156 3 0 0 19 37 -6.174 -1.687 -0.566 + IL 156 156 3 156 3 1 1 23 42 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 21 ] 16 - U - - - + ML 157 156 3 159 3 1 1 18 36 -1.899 -0.464 -7.178 -1.468 -0.407 -2.235 1.418 + D 158 156 3 159 3 0 0 16 35 -6.174 -1.687 -0.566 + IL 159 159 3 159 3 1 1 18 36 -2.374 -0.363 -5.074 0.000 0.000 0.000 0.000 + [ MATL 22 ] 18 - G - - - + ML 160 159 3 162 3 1 1 16 34 -8.524 -0.014 -7.178 -2.700 -4.060 1.885 -3.430 + D 161 159 3 162 3 0 0 16 35 -6.174 -1.687 -0.566 + IL 162 162 3 162 3 1 1 20 39 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 23 ] 19 - G - - - + ML 163 162 3 165 3 1 1 14 33 -8.524 -0.014 -7.178 -2.700 -4.060 1.885 -3.430 + D 164 162 3 165 3 0 0 15 33 -6.174 -1.687 -0.566 + IL 165 165 3 165 3 1 1 19 38 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 24 ] 20 - u - - - + ML 166 165 3 168 3 1 1 11 23 -1.854 -0.481 -7.178 -0.664 -0.325 -0.613 0.939 + D 167 165 3 168 3 0 0 9 20 -6.174 -1.687 -0.566 + IL 168 168 3 168 3 1 1 11 22 -2.396 -0.357 -5.096 0.000 0.000 0.000 0.000 + [ MATL 25 ] 22 - A - - - + ML 169 168 3 171 2 1 1 1 1 * 0.000 1.878 -3.490 -3.019 -3.147 + D 170 168 3 171 2 0 0 0 0 * 0.000 + IL 171 171 3 171 2 1 1 13 28 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ END 26 ] - - - - - - + E 172 171 3 -1 0 0 0 0 0 + [ BEGR 27 ] - - - - - - + S 173 125 1 174 3 0 0 32 50 -8.524 -0.014 -7.178 + IL 174 174 2 174 3 1 1 35 54 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 28 ] 27 - g - - - + ML 175 174 2 177 5 1 1 31 50 -7.593 -0.028 -7.408 -7.620 -8.512 0.512 -2.047 0.983 -1.490 + D 176 174 2 177 5 0 0 30 49 -4.959 -0.803 -4.221 -2.596 -2.508 + IL 177 177 3 177 5 1 1 32 51 -2.408 -0.496 -4.087 -5.920 -5.193 0.000 0.000 0.000 0.000 + [ MATP 29 ] 28 44 c g - - + MP 178 177 3 182 6 2 2 30 49 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -2.996 -2.785 -3.094 0.747 -2.684 -3.890 2.204 -3.144 -3.118 1.704 -3.626 0.455 1.175 -3.212 0.643 -2.072 + ML 179 177 3 182 6 1 1 29 48 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 180 177 3 182 6 1 1 29 48 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 181 177 3 182 6 0 0 27 45 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 182 182 5 182 6 1 1 30 49 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 183 183 6 183 5 1 1 30 49 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 30 ] 29 43 c g - - + MP 184 183 6 188 6 2 2 28 47 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.660 -3.462 -3.663 0.355 -2.818 -4.407 2.681 -3.427 -3.639 1.512 -4.115 -1.306 1.763 -3.844 -0.432 -2.489 + ML 185 183 6 188 6 1 1 27 46 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 186 183 6 188 6 1 1 27 46 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 187 183 6 188 6 0 0 25 44 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 188 188 5 188 6 1 1 28 47 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 189 189 6 189 5 1 1 28 47 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 31 ] 30 42 a u - - + MP 190 189 6 194 6 2 2 26 45 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.311 -3.146 -3.360 2.221 -2.772 -4.127 2.025 -3.303 -3.378 0.846 -3.868 -1.127 1.693 -3.528 -0.491 -2.313 + ML 191 189 6 194 6 1 1 25 44 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 192 189 6 194 6 1 1 25 44 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 193 189 6 194 6 0 0 23 42 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 194 194 5 194 6 1 1 26 45 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 195 195 6 195 5 1 1 26 45 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 32 ] 31 41 g c - - + MP 196 195 6 200 6 2 2 24 43 -9.364 -9.303 -0.018 -8.080 -8.360 -8.755 -3.453 -2.737 -3.468 0.855 -3.398 -4.215 1.983 -3.656 -3.568 2.448 -4.006 0.791 0.648 -3.520 -0.989 -2.403 + ML 197 195 6 200 6 1 1 24 43 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094 + MR 198 195 6 200 6 1 1 24 43 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094 + D 199 195 6 200 6 0 0 22 41 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319 + IL 200 200 5 200 6 1 1 24 43 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000 + IR 201 201 6 201 5 1 1 24 43 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000 + [ MATP 33 ] 32 40 c g - - + MP 202 201 6 206 4 2 2 22 41 -7.543 -7.750 -0.035 -6.164 -3.332 -2.890 -3.380 1.837 -3.037 -4.188 2.208 -3.435 -3.424 1.867 -3.910 -0.719 0.913 -3.503 -0.696 -2.309 + ML 203 201 6 206 4 1 1 24 43 -3.758 -3.940 -0.507 -2.670 0.368 -0.385 -0.191 0.094 + MR 204 201 6 206 4 1 1 23 42 -4.809 -3.838 -1.706 -0.766 0.368 -0.385 -0.191 0.094 + D 205 201 6 206 4 0 0 22 41 -4.568 -4.250 -2.265 -0.520 + IL 206 206 5 206 4 1 1 25 44 -1.686 -2.369 -1.117 -4.855 0.000 0.000 0.000 0.000 + IR 207 207 6 207 3 1 1 24 43 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 34 ] 33 - c - - - + ML 208 207 6 210 3 1 1 20 38 -8.524 -0.014 -7.178 -1.256 0.893 -2.113 0.579 + D 209 207 6 210 3 0 0 19 38 -6.174 -1.687 -0.566 + IL 210 210 3 210 3 1 1 23 42 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 35 ] 34 - U - - - + ML 211 210 3 213 3 1 1 18 37 -8.524 -0.014 -7.178 -2.549 -2.369 -3.320 1.822 + D 212 210 3 213 3 0 0 18 37 -6.174 -1.687 -0.566 + IL 213 213 3 213 3 1 1 22 41 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 36 ] 35 - g - - - + ML 214 213 3 216 3 1 1 17 36 -8.524 -0.014 -7.178 -0.763 -1.427 0.837 0.325 + D 215 213 3 216 3 0 0 17 35 -6.174 -1.687 -0.566 + IL 216 216 3 216 3 1 1 21 39 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 37 ] 36 - u - - - + ML 217 216 3 219 3 1 1 16 34 -8.524 -0.014 -7.178 0.037 -0.330 -0.381 0.496 + D 218 216 3 219 3 0 0 16 34 -6.174 -1.687 -0.566 + IL 219 219 3 219 3 1 1 20 38 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 38 ] 37 - c - - - + ML 220 219 3 222 3 1 1 14 33 -8.524 -0.014 -7.178 0.403 0.783 -1.648 -0.649 + D 221 219 3 222 3 0 0 15 33 -6.174 -1.687 -0.566 + IL 222 222 3 222 3 1 1 19 37 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 39 ] 38 - A - - - + ML 223 222 3 225 3 1 1 13 31 -8.524 -0.014 -7.178 1.037 -1.963 0.397 -1.419 + D 224 222 3 225 3 0 0 13 32 -6.174 -1.687 -0.566 + IL 225 225 3 225 3 1 1 18 36 -1.442 -0.798 -4.142 0.000 0.000 0.000 0.000 + [ MATL 40 ] 39 - a - - - + ML 226 225 3 228 2 1 1 1 1 * 0.000 0.957 0.166 -1.522 -0.764 + D 227 225 3 228 2 0 0 0 0 * 0.000 + IL 228 228 3 228 2 1 1 13 28 -1.823 -0.479 0.000 0.000 0.000 0.000 + [ END 41 ] - - - - - - + E 229 228 3 -1 0 0 0 0 0 +// +HMMER3/f [i1.1.1 | July 2014] +NAME tRNA5 +LENG 72 +MAXL 152 +ALPH RNA +RF no