changeset 0:7739a9b0dd83 draft

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/nanopolish commit 89078a214cefd31d28da75ddebb21f546fba79df-dirty
author bgruening
date Wed, 19 Jun 2019 07:00:20 -0400
parents
children 449e9aeded2d
files macros.xml nanopolish_polya.xml test-data/30xpolyA-small-subset-results.tsv test-data/30xpolyA-small-subset-sequencing_summary.txt test-data/30xpolyA-small-subset-win-results-t3.tsv test-data/30xpolyA-small-subset-win-results.tsv test-data/30xpolyA-small-subset.fastq test-data/30xpolyA-small-subset.sorted.bam test-data/all_fasta.loc test-data/all_fasta.loc.sample test-data/draft.fa test-data/draft_single_seq.fa test-data/enolase_reference.fas test-data/eventalign-summary.txt test-data/fast5_files.tar test-data/fast5_files.tar.bz2 test-data/fast5_files.tar.gz test-data/fast5_files_30xpolyA-small-subset.tar test-data/fast5_files_30xpolyA-small-subset.tar.bz2 test-data/fast5_files_30xpolyA-small-subset.tar.gz test-data/methylation_calls.tsv test-data/polished.fa test-data/reads-draft.eventalign.sam test-data/reads.fasta test-data/reads.fasta.index test-data/reads.fasta.index.fai test-data/reads.fasta.index.gzi test-data/reads.fasta.index.readdb test-data/reads.sorted.bam test-data/t2-eventalign-summary.txt test-data/t2-polished.fa test-data/t2-variants.vcf test-data/t3_polished.fa test-data/t3_variants.vcf test-data/t4_polished.fa test-data/t4_variants.vcf test-data/variants.vcf tool-data/all_fasta.loc.sample tool_data_table_conf.xml.sample tool_data_table_conf.xml.test
diffstat 39 files changed, 67348 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Wed Jun 19 07:00:20 2019 -0400
@@ -0,0 +1,28 @@
+<macros>
+    <xml name="requirements">
+        <requirements>
+        <requirement type="package" version="0.11.1">nanopolish</requirement>
+            <yield/>
+        </requirements>
+    </xml>
+
+<!--        index outputs 
+        <data name="output_index" format="nanopolish_index" from_work_dir="reads.fasta.index"  />
+        <data name="output_index_fai" format="nanopolish_index_fai" from_work_dir="reads.fasta.index.fai"  />
+        <data name="output_index_gzi" format="nanopolish_index_gzi" from_work_dir="reads.fasta.index.gzi"  />
+        <data name="output_index_readdb" format="nanopolish_index_readdb" from_work_dir="reads.fasta.index.readdb"  />
+ -->      
+<!--      <output name="output_index" file="reads.fasta.index" />
+            <output name="output_index_fai" file="reads.fasta.index.fai" />
+            <output name="output_index_gzi" file="reads.fasta.index.gzi" />
+            <output name="output_index_readdb" file="reads.fasta.index.readdb" />
+ -->
+
+    <xml name="citations">
+        <citations>
+            <citation type="doi">10.1038/nmeth.3444</citation>
+            <citation type="doi">10.1038/nmeth.4184</citation>
+            <yield />
+        </citations>
+    </xml>
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/nanopolish_polya.xml	Wed Jun 19 07:00:20 2019 -0400
@@ -0,0 +1,126 @@
+<tool id="nanopolish_polya" name="Nanopolish polyA" version="0.1.0">
+    <description>- Estimate the length of the poly-A tail on direct RNA reads.</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements" />
+    <command detect_errors="exit_code"><![CDATA[
+        ln -s '$input_merged' reads.fasta && 
+        
+        #if $input_reads_raw.extension == 'fast5':
+            mkdir fast5_files && ln -s '$input_reads_raw' fast5_files/read1.fast5 &&
+
+        #else if $input_reads_raw.extension == 'fast5.tar':
+            ln -s '$input_reads_raw' fast5_files.tar &&
+            mkdir fast5_files && tar -xf fast5_files.tar -C fast5_files &&
+
+        #else if $input_reads_raw.extension == 'fast5.tar.bz2':
+            ln -s '$input_reads_raw' fast5_files.tar.bz2 &&
+            mkdir fast5_files && tar -xjf fast5_files.tar.bz2 -C fast5_files &&
+
+        #else:
+            ln -s '$input_reads_raw' fast5_files.tar.gz &&
+            mkdir fast5_files && tar -xzf fast5_files.tar.gz -C fast5_files &&
+
+        #end if
+
+        nanopolish index 
+        -d fast5_files/
+        #if $adv.input_seq_summary:
+          -s '$adv.input_seq_summary'
+        #end if 
+        reads.fasta &&
+
+        ln -s '$b' reads.bam &&
+        ln -s '${b.metadata.bam_index}' reads.bam.bai &&
+        #if $reference_source.reference_source_selector == 'history':
+            ln -f -s '$reference_source.ref_file' genome.fa &&
+        #else:
+            ln -f -s '$reference_source.ref_file.fields.path' genome.fa &&
+        #end if
+        
+        nanopolish polya
+        -r reads.fasta
+        -b reads.bam
+        -g genome.fa
+        --threads "\${GALAXY_SLOTS:-4}"        
+        #if $w and str($w).strip():
+          -w "${w}"
+        #end if  
+        > polya_results.tsv
+    ]]></command>
+    <inputs>
+      <!-- index inputs -->
+        <param type="data" name="input_merged" format="fasta,fastq" label="Basecalled merged reads.fa"/>
+        <param type="data" name="input_reads_raw" format="h5,fast5.tar.gz,fast5.tar.bz2,fast5.tar" label="Flat archive file of raw fast5 files"/>
+
+        <param type="data" argument="-b" format="bam" label="Reads aligned to the reference genome" />
+        <conditional name="reference_source">
+          <param name="reference_source_selector" type="select" label="Load reference genome from">
+            <option value="cached">Local cache</option>
+            <option value="history">History</option>
+          </param>
+          <when value="cached">
+            <param name="ref_file" type="select" label="Using reference genome" help="REFERENCE_SEQUENCE">
+              <options from_data_table="all_fasta">
+              </options>
+              <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
+            </param>
+          </when>
+          <when value="history">
+            <param name="ref_file" type="data" format="fasta" label="Use the following dataset as the reference sequence" help="REFERENCE_SEQUENCE; You can upload a FASTA sequence to the history and use it as reference" />
+          </when>
+        </conditional>
+
+        <section name="adv" title="Optional data inputs">
+            <!-- optional inputs -->
+            <param type="data" name="input_seq_summary" format="txt" optional="true" label="Sequencing summary file from albacore" help="(-s)"/>       
+        </section>
+        
+        <param argument="-w" type="text" optional="true"
+            label="only compute the poly-A lengths for reads in window STR (format: ctg:start_id-end_id)" />
+
+    </inputs>
+
+    <outputs>
+        <data name="polya_results" format="tabular" from_work_dir="polya_results.tsv" label="called methylation sites" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="input_merged" ftype="fastq" value="30xpolyA-small-subset.fastq" />
+            <param name="input_reads_raw" ftype="fast5.tar.gz" value="fast5_files_30xpolyA-small-subset.tar.gz" />
+            <param name="b" value="30xpolyA-small-subset.sorted.bam" />
+            <param name="reference_source_selector" value="history" />
+            <param name="ref_file" value="enolase_reference.fas" />
+            <!-- <param name="w" value="tig00000001:200000-202000" /> -->
+            <output name="polya_results" file="30xpolyA-small-subset-results.tsv" />
+        </test>
+         <test>
+            <param name="input_merged" ftype="fastq" value="30xpolyA-small-subset.fastq" />
+            <param name="input_reads_raw" ftype="fast5.tar.gz" value="fast5_files_30xpolyA-small-subset.tar.gz" />
+            <param name="b" value="30xpolyA-small-subset.sorted.bam" />
+            <param name="reference_source_selector" value="history" />
+            <param name="ref_file" value="enolase_reference.fas" />
+            <param name="w" value="YHR174W:600-900" />
+            <output name="polya_results" file="30xpolyA-small-subset-win-results.tsv" />
+        </test>
+         <test>
+            <param name="input_merged" ftype="fastq" value="30xpolyA-small-subset.fastq" />
+            <param name="input_reads_raw" ftype="fast5.tar" value="fast5_files_30xpolyA-small-subset.tar" />
+            <param name="b" value="30xpolyA-small-subset.sorted.bam" />
+            <param name="reference_source_selector" value="history" />
+            <param name="ref_file" value="enolase_reference.fas" />
+            <param name="w" value="YHR174W:600-900" />
+            <output name="polya_results" file="30xpolyA-small-subset-win-results-t3.tsv" />
+        </test>        
+    </tests>    
+    <help><![CDATA[
+        Usage: nanopolish polya [OPTIONS] --reads reads.fa --bam alignments.bam --genome genome.fa 
+        Estimate the length of the poly-A tail on direct RNA reads   
+
+        Quickstart tutorial and manual available at:
+        http://nanopolish.readthedocs.io/en/latest/quickstart_polya.html
+
+    ]]></help>
+    <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/30xpolyA-small-subset-results.tsv	Wed Jun 19 07:00:20 2019 -0400
@@ -0,0 +1,14 @@
+readname	contig	position	leader_start	adapter_start	polya_start	transcript_start	read_rate	polya_length	qc_tag
+453f3f3e-d22f-4d9c-81a6-8576e23390ed	YHR174W	0	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+3aa5f5e9-ff35-4e5d-a45b-f933ba6f53e1	YHR174W	1	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+453f3f3e-d22f-4d9c-81a6-8576e23390ed	YHR174W	9	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+4ed8103e-7338-4869-99a4-864f10adb88f	YHR174W	44	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+487eedb2-d957-4fa9-8c18-22d18d9d579e	YHR174W	116	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+f2b2e374-e463-4642-aaa3-f5a360b1f781	YHR174W	344	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+ab761bb7-ca33-4f3b-a83a-1b3964a9fcba	YHR174W	371	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+adc50c94-789e-4c49-b20d-1f1598a27bec	YHR174W	459	79.0	7649.0	11378.0	13048.0	115.85	59.19	PASS
+caae9035-fa35-4e56-8f2c-4defa2785f30	YHR174W	575	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+3789435a-c50f-44f0-a383-50412f7c5153	YHR174W	605	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+56f62749-403c-454d-930b-83d9057ce93f	YHR174W	635	70.0	5844.0	9869.0	10678.0	125.50	28.67	PASS
+a3237e11-476a-498e-beee-e79ef5c2f4ca	YHR174W	909	174.0	1249.0	4232.0	5123.0	111.56	27.96	PASS
+6134c169-e914-432a-a81d-77181378c671	YHR174W	911	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/30xpolyA-small-subset-sequencing_summary.txt	Wed Jun 19 07:00:20 2019 -0400
@@ -0,0 +1,14 @@
+filename	read_id	run_id	channel	start_time	duration	num_events	passes_filtering	template_start	num_events_template	template_duration	num_called_template	sequence_length_template	mean_qscore_template	strand_score_template	calibration_strand_genome_template	calibration_strand_identity_template	calibration_strand_accuracy_template	calibration_strand_speed_bps_template
+MINICOL596_20180206_FAH55913_MN19174_sequencing_throughput_LS_RNA_21456_30xpolyA_11237_read_1111_ch_186_strand.fast5	a3237e11-476a-498e-beee-e79ef5c2f4ca	0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f	186	4706.06607	6.69256	1317	True	0.1328	1317	6.55976	1317	458	9.089	-0.0007	filtered_out	-1.0	-1.0	0.0
+MINICOL596_20180206_FAH55913_MN19174_sequencing_throughput_LS_RNA_21456_30xpolyA_11237_read_1111_ch_114_strand.fast5	4d5344d1-618d-4116-9955-58937325ab81	0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f	114	5212.87815	16.99203	3123	True	1.43592	3123	15.55611	3123	1339	9.793	-0.0002	YHR174W	0.9687249660491943	0.900820255279541	0.0
+MINICOL596_20180206_FAH55913_MN19174_sequencing_throughput_LS_RNA_21456_30xpolyA_11237_read_1111_ch_117_strand.fast5	ed326f39-888c-4def-9336-5ea9998f8ff8	0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f	117	4600.60259	16.66335	3319	True	0.1328	3319	16.53054	3319	1376	9.102	-0.0002	YHR174W	0.9599359035491943	0.8940298557281494	0.0
+MINICOL596_20180206_FAH55913_MN19174_sequencing_throughput_LS_RNA_21456_30xpolyA_11237_read_1111_ch_398_strand.fast5	b9566e59-7f55-430b-a650-50e4e25efd8f	0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f	398	4906.15405	19.28918	3142	True	3.63977	3142	15.6494	3142	1316	9.558	-0.0003	YHR174W	0.972016453742981	0.874167263507843	0.0
+MINICOL596_20180206_FAH55913_MN19174_sequencing_throughput_LS_RNA_21456_30xpolyA_11237_read_1111_ch_178_strand.fast5	0681af58-5bc3-49b1-a7df-899a5fb96608	0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f	178	4751.95153	18.94721	3518	True	1.42331	3518	17.5239	3518	1345	9.458	-0.0004	YHR174W	0.9727782011032104	0.9060402512550354	0.0
+MINICOL596_20180206_FAH55913_MN19174_sequencing_throughput_LS_RNA_21456_30xpolyA_11237_read_1111_ch_470_strand.fast5	56f62749-403c-454d-930b-83d9057ce93f	0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f	470	4876.32371	12.34097	1820	True	3.27556	1820	9.06541	1820	693	9.147	-0.0009	filtered_out	-1.0	-1.0	0.0
+MINICOL596_20180206_FAH55913_MN19174_sequencing_throughput_LS_RNA_21456_30xpolyA_11237_read_1111_ch_124_strand.fast5	9fb6716f-89a8-4995-9c11-8206052e21aa	0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f	124	5102.39708	21.16202	3491	True	3.77656	3491	17.38546	3491	1317	9.076	-0.0002	YHR174W	0.9644300937652588	0.8990203738212585	0.0
+MINICOL596_20180206_FAH55913_MN19174_sequencing_throughput_LS_RNA_21456_30xpolyA_11237_read_1111_ch_185_strand.fast5	ad1abf81-31b4-4d68-8805-39bc5dd2854c	0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f	185	4035.69256	18.64608	3134	True	3.03818	3134	15.6079	3134	1347	8.833	-0.0004	YHR174W	0.9604200124740601	0.869787871837616	0.0
+MINICOL596_20180206_FAH55913_MN19174_sequencing_throughput_LS_RNA_21456_30xpolyA_11237_read_1111_ch_481_strand.fast5	adc50c94-789e-4c49-b20d-1f1598a27bec	0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f	481	5763.81906	14.04117	2061	True	3.77722	2061	10.26394	2061	880	9.785	-0.0006	filtered_out	-1.0	-1.0	0.0
+MINICOL596_20180206_FAH55913_MN19174_sequencing_throughput_LS_RNA_21456_30xpolyA_11237_read_1111_ch_5_strand.fast5	92f23fd6-df21-40a3-8089-971ab76d1928	0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f	5	5409.94754	17.43991	3133	True	1.83466	3133	15.60525	3133	1312	8.486	-0.0004	YHR174W	0.950647234916687	0.8781763911247253	0.0
+MINICOL596_20180206_FAH55913_MN19174_sequencing_throughput_LS_RNA_21456_30xpolyA_11237_read_1111_ch_70_strand.fast5	abb19cf7-f443-4d7a-9267-60cbcc63c1ea	0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f	70	5222.23705	17.76726	3285	True	1.40438	3285	16.36288	3285	1343	9.19	-0.0006	YHR174W	0.9666136503219604	0.8987435102462769	0.0
+MINICOL596_20180206_FAH55913_MN19174_sequencing_throughput_LS_RNA_21456_30xpolyA_11237_read_1111_ch_83_strand.fast5	25f527d1-40ac-4f1e-9e9a-51c19ebe469e	0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f	83	4816.32869	17.37616	3189	True	1.4917	3189	15.88446	3189	1324	8.695	-0.0002	YHR174W	0.9548022747039795	0.8769459128379822	0.0
+MINICOL596_20180206_FAH55913_MN19174_sequencing_throughput_LS_RNA_21456_30xpolyA_11237_read_1111_ch_469_strand.fast5	5247b83c-27db-483f-a2bb-4b2a27b97488	0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f	469	5135.93293	33.82802	6747	True	0.22709	6747	33.60093	6747	1385	9.436	-0.0001	YHR174W	0.9835293889045715	0.9275147914886475	0.0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/30xpolyA-small-subset-win-results-t3.tsv	Wed Jun 19 07:00:20 2019 -0400
@@ -0,0 +1,12 @@
+readname	contig	position	leader_start	adapter_start	polya_start	transcript_start	read_rate	polya_length	qc_tag
+453f3f3e-d22f-4d9c-81a6-8576e23390ed	YHR174W	0	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+3aa5f5e9-ff35-4e5d-a45b-f933ba6f53e1	YHR174W	1	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+453f3f3e-d22f-4d9c-81a6-8576e23390ed	YHR174W	9	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+4ed8103e-7338-4869-99a4-864f10adb88f	YHR174W	44	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+487eedb2-d957-4fa9-8c18-22d18d9d579e	YHR174W	116	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+f2b2e374-e463-4642-aaa3-f5a360b1f781	YHR174W	344	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+ab761bb7-ca33-4f3b-a83a-1b3964a9fcba	YHR174W	371	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+adc50c94-789e-4c49-b20d-1f1598a27bec	YHR174W	459	79.0	7649.0	11378.0	13048.0	115.85	59.19	PASS
+caae9035-fa35-4e56-8f2c-4defa2785f30	YHR174W	575	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+3789435a-c50f-44f0-a383-50412f7c5153	YHR174W	605	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+56f62749-403c-454d-930b-83d9057ce93f	YHR174W	635	70.0	5844.0	9869.0	10678.0	125.50	28.67	PASS
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/30xpolyA-small-subset-win-results.tsv	Wed Jun 19 07:00:20 2019 -0400
@@ -0,0 +1,12 @@
+readname	contig	position	leader_start	adapter_start	polya_start	transcript_start	read_rate	polya_length	qc_tag
+453f3f3e-d22f-4d9c-81a6-8576e23390ed	YHR174W	0	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+3aa5f5e9-ff35-4e5d-a45b-f933ba6f53e1	YHR174W	1	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+453f3f3e-d22f-4d9c-81a6-8576e23390ed	YHR174W	9	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+4ed8103e-7338-4869-99a4-864f10adb88f	YHR174W	44	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+487eedb2-d957-4fa9-8c18-22d18d9d579e	YHR174W	116	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+f2b2e374-e463-4642-aaa3-f5a360b1f781	YHR174W	344	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+ab761bb7-ca33-4f3b-a83a-1b3964a9fcba	YHR174W	371	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+adc50c94-789e-4c49-b20d-1f1598a27bec	YHR174W	459	79.0	7649.0	11378.0	13048.0	115.85	59.19	PASS
+caae9035-fa35-4e56-8f2c-4defa2785f30	YHR174W	575	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+3789435a-c50f-44f0-a383-50412f7c5153	YHR174W	605	-1.0	-1.0	-1.0	-1.0	-1.00	-1.00	READ_FAILED_LOAD
+56f62749-403c-454d-930b-83d9057ce93f	YHR174W	635	70.0	5844.0	9869.0	10678.0	125.50	28.67	PASS
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/30xpolyA-small-subset.fastq	Wed Jun 19 07:00:20 2019 -0400
@@ -0,0 +1,48 @@
+@6134c169-e914-432a-a81d-77181378c671 runid=0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f read=1000 ch=11 start_time=2018-02-06T15:03:43Z
+AAGGAAGCUUGGUCUCACUUUCAAGACCGCUGGUAUCCAAAUUGUUGCUGAUGAUUUGACUGUCACCAACCCAGCUAGAAUUGCUACCGCCAAAAGAAGGCUGCUGACGCUUUGUUGUUGAAGGUUAACCAAUUGGUACCUUCGAUGGCUCCAUCAAGGCUGCUCAAGACUUUCGCUGCUUAUUGGCUGCUUUCAUGGUUUCCAGAUCUGGUGAAACUGAAGACACUUCAUUGUGACUUGGUUGUCGGUCAAAAGAACUGGUCAAUCAAGACUGGUGCUCCAGCUAGAUCCGAAAGAUUGGCUAAGUUGAACCAAUUAGAAUCGAAGAAGAAUUGGUGACAAGGCUGUCUACGCCGGUGAAAAAUUCCUUUGUGACAAGUUGUAUCGCGUGAGUAGUGAACCGUGGCAAUCA
++
+$%''()&&*+0/&&#%%'),)&&9,-/1013:43558.::/67*,5,1/.'''')0314352&&'*-.47702356,,,3,+&&''*+*--&'-.&-*')(*+676500)*+-*010-&'('+),.,0-2:0-),(%'(,)*&*&&%$%'3211--0/0+13/0.0+++*,-,(*+/.0$%$)),&$'*%*-)&'&++*+(,,/()000720027-,,.500202))))*-*(*+)((*-,(),/+/21*+35/)+2,-.6/+/4*/-22+,,,32/,,-/,.-./103+.,883+,,,/1,-/10,))++,,81+,%&'1---3-+.-*+0++13--204+-,**-+))**.4/32+*)1/.*%&('%$#&'()*20231/-+,**((*+*+*',/-1)('%%%&$)+$%%
+@3aa5f5e9-ff35-4e5d-a45b-f933ba6f53e1 runid=0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f read=1000 ch=165 start_time=2018-02-06T14:26:34Z
+UAGAUUGUCUGUUGGUCGCUGGCUGUCUAAAGUUUACGCUAGAUUCGUCUACGACCCGUGGUAACCCCAUCGUGAAGUCGAAUUAACCACCGAAAAGGUGUUUCAGAUCUGUUCCACACUGGUGCCCACCGGUGUCCGGGUUUGGAAAUGAGAGAUGAAGACAAUCCAAGUGAUGGGUAAGGGUGUUAUGAACGCUGUCAACAACGUCAACACGUUUGCUGCUGCUUUGCCAAGGCCAACCAAGAUGUUAAGGACCAAAGAGCCGUCGAUGACUUUGUUGUCUUUGGAUGGUACCGCCAACAAGUCCAGGUAAGGUGCUGCCGCUAUCUUGGUGUUCUCCAUGGCCGCUGCUAGAGCCGCUGCUGCUGAAAAGAACGUCCAUUGUACCAACUUGACUUGUCUAAGUCCAAGACCCUCUCCAUACGUUUUGCCAGUUCCACUCUUGAACGUUUUGAACGGUGGUCCCACGCUGGUGGUGCUUUGGCUUUGCAAGAAUCUUUGAUUGCUCCAACUGGUGCUAAGACCUUCGCUGAAGCCAUGAGAAACUGUCAAGUUUACCACAACUUGAAGUCUUUGACCAAGAAGAGAUCGGUGCUUUGCCGGUAUUCCGGUGACGAAGGUGGUGUUGCUCCAAAACAUUCAAUCGCUGAAGAAGCUUUGGACUUGAUUGUUGACGCUAUCUCAAGGCUGCUGGUACGGUAAGGUCAAGAUCGGUUUGGACUGUGCUUCUCCUCUGAAUUCUUUCAAGGACAGACAGUACGACUUGACCAAGAACCCAGAAUCUGACAAUCCAAGUGGUUGGCUGGGUGUCGAAUUGGCUGUUUUGUACCUACUCCUCUGAUGAAGAGUACCCAAUUGUCUCCAUGAAGAUCCAUCAUUGCUGAAGAUGCUGGAAGCUUGGACCACUUCUCAAGACCGCUGGUAUCCAAAUUGUUGCUGAUGACUUGACUGUCAACCCAGCUAGAAUUGCUACCGAAAGAAGAAUCGCUGACGCUUUGUUGAAGGUUAACCAAAUCGGUACCUUGUCUUGAAUCCAUCAAGGCUGUUCUGAGACUUCGCUGCCAACUGUGGUGCUUCGGUUUCCCAUCCACAGAUCUGGUGAAACUGAAGACACUUCAUUGCUGACUUGGUUGUCGGUUUGAGAACUGGUCAAAAUCAAGACUGGUGCUCCAGCUAGAUCCGAAAGAUUGGCUAAGUUGAUUAAUUGUUGAGAAUCGAAGAAUGACAAGCUGUCUACGCCAGUGAAUUCCACCACGGUGACAAGUUGUAUCGUGAGUGAUCGUGCAAAAAAUAAUAU
++
+$&%(&3*'%)+/,)*(%-()1))1*('%,4*))/,(**',(((''')'%&&&&))--**0+(*&%181*(('''&%&((.036..(*(*-.((.2.10/,)4+(*+-,.))%(%)&'&&,3031/.*&*1*5++0/.((('-12/45015)))(*-,-4**-2)#('-,-+)))321,-,)//*,54/.14///-,,-*,-*/,+,+00.(('(+242342&..',0('((*)+(5,+0,1&/...2-)),*+*3,170*%()1*.*++-,1*)(-*/3-,))30405112)$(&(43)-''&,)(+(.)),-,/++,-+.-13++*)0*52-.0&%),,/.3350,-0/21323263+,//&/1-.-)/2/*4-.*)6.*,,+,+..,*)%%%%&20--,-054,-2,0,+-/'%)(-0-(#%&',/,343*30+'.&&*(,/.5/0.-30/271/0++3++*5/(*)(--/2510/.561-2(*-0)41339/,&)**,366/*)(*',&+),*+**11-,3.-,./.2415//0-,)*(1,'),/.,-,--0+&(,)-52/32,,0*)'))/-+-).,+00-,+)($,020-0/.-.431+*)'#$',).0.,/++0),1,-.42/1,,*-1*(')-)+0%.+02++*(),')/74,+('*+1-.3-.58+)&$'''''(,2)-()*,/7.,+++,),+(0'').++..+5,3/,3+),'*)()(%'+-+*02.1((&)*-(+,*+)'&+++0/.//01+2+)'&)*.,010802.20-.01/*73+*+()()&)./,)(')/.-0023:38//.+*,(&)&&')-,'(&&),&&+,)))*0)&((*,2---+-,('%,,+*).0./30**'%'&2/24,,3))**'+.,--**74.0%(&%$')%)(*0.))*').0/000142612/-/,,+))*+,1+-.--*2*(.-,51)(+,*--9-630,)&&(%&,-')'()*($)(-0+++))-.*0+($&(+,+3,4-58+,(%-/+40..,)'&-+0-+4.-*)())*()')%)$&)+*+/*(*)-.3/4+)*+,71,,$',+-5.6-,4,($((')34991197/-39/*,.442545),,)*11/455/--0118168508/1/**+/1,+,-.,,/2+*)(/*,,,-2-+)%+*+)*(*))'(*(*63-173+5*+-5))'('%&((('&*0,.-.1)(*&)(,('''',0('(*)(((),00%+*)+4*)**$('&,40/0/+4-./10)(&$'&&%*(+'#%'()'(.441,)'-#'"
+@caae9035-fa35-4e56-8f2c-4defa2785f30 runid=0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f read=1000 ch=155 start_time=2018-02-06T14:38:41Z
+CCAACUUGAAGUCUUUGACCAAGUAGAGAGAUCGGUGCUCUGCCGGUAACGUCGUCGGUGACGAAGGUGGUGUUGCUCCAAACAUUCAAACCGCUGGAGAAGCUUUGGACUUGAUUGUUGACGCUAUCAAGGCUGCUGGUCACGACAGUAAGGUCAAGAUCGGUUUGGACUGUCGCUUCCUCUGAAUUCUUCAAGGACGGUAAGUACGACUUGACUCAAGAACCCAGAAUCUGACAAUCCAAGUGGUUGACUGGGUGCUGGUGGCUGACCAUGUACCACUCCUUGAUGAAGAGAGAUCUACCCAAUUGUCUCCAUCGAAGAUCCAUUUGCUGAAGAUGACUGGGAAGCUUGGUCUCACUUCAAGACCGCUGGUAUCCAAAUUGUUGCUGAUGACUUGACUGUCACCAACCCAGCUAGAAUUGCUACCGCCAUCGAAAAGAGGCUGCUGACGCUUUGUUGUUGAAGGUUAACCAAAUCAAGUCCUUGUCUGAAUCCAUCAAGGCUGCUUCAAGACUUUGCUGCCAACUGGGGUGUCAUGGUUUCCCACAGAUCUGGUCGAAACUGAAGACACUUUCGUUGCUGACAUGGUUGUCGGUUUUGAGAACUGGUCAAAUCAAGACUGGUGCUCCAGCUAGAUCCGAAAGAUUGGCUAAGUUGAACCAAUUGUUGAGAAUCGAAGAAGAAUUGGGUGACAAGGCUGUACGCCGGUGAAAACUUCCACGGUGACAAGUUGUAUCGUCGUAGUGAACCGUGCAAAAAUUA
++
+$)$(&*,)/++(((+-,(--,0($&%((++,.*581-+,)+./98329/,**+,+554/-+***+(,')1())1)),-/9:2-*/+*35/5/1.--')(()'%'//(-,).(((-//34211-,****++1*+*+%*+1*)***))&'%+,*0,261---+87.98*8*)))*))'**(+$()+2,-(%,.'(+,('&*-*,-,(())).-.*''((+0..,-60//22/+3./.11,-*('(').+,,,.+*9--,%&&(%',(,,--*')-*,3-()((''/0///20.,*+,,.%&(5851,2/,+*+-0('%(*/*,57//5+150..1.--0/.,*(/-).*)/8,7'%&%$(+,&'+)).(&'*1/.,,2,13-610523,,+**0126-0*+,,)((*/,006../000004/4/,+)+/,--*(('*54***()%&(+-/76/,04/((0(0.-,+*,)3,02/52+'%.&%',+/0..'+,//**)'%(,*0.-1/****.-,**),-&&%(*+-*'+(17.,3/,*),..1+,3/+,/044,-,1)')-7.+**,/-2110(*.((//1010)'$%&*-%02/316+*)&&'(3)+-')**3.*+.6411126-,'&','--(()('','(62(+2,1-,02.,0)+./.28010.100015410/02,,2((4(0,61)**+5,0+)+(%%%%&)*-)+..71()()*&()/**))+1271)((('('&%$%'%))('&&$%#)*1/,&&$
+@3789435a-c50f-44f0-a383-50412f7c5153 runid=0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f read=1001 ch=306 start_time=2018-02-06T14:30:21Z
+UCGGUGCUCUGCCGGUAACGUCGGUGACAAGGUGGUGGUAAUUCCAAAACAAACCGCUGAAGAAAUGCUUGGACUUGAUUGUUGACGUUAUCAAGGCUGCUGGUCACGACGGUCUGUCAAGAUCGGUUUGGACUGUAUUGUUUCCACUGAAUUCAAGGACGGUUAGUACGUUGACUUGGACUUCAGAACCCAGAAUCUGACAAAUCCAAGUGGUAGCUGGUGCCGAAUUGGCUGGUUGUUGUCAUCCACUUGACGAAGAUCUCCCAAUUGUCUCCAUUGAAGAUCCAUUUGCUGAAGAUGAUAAGAAGUCGUGGUUCACUUCAAGUCGAGUUGUUACGGUAAUUGAUGACUUGACUGCUUCCAACCCAGGUAAGAAUUGCUACCGCCAAAAGAAGGCUGACGUUGUUGUUGAAGGUUAACCAAAUCGGUUUUGAUUGAAUUCCAUCAGGCUGCCAAGACUUCGCUUGGGUAUGGUUUCCCACAGAUUUGGUGAAAACUGAAGAAGACACUCAUUGCUGAUUGGUUGCAUGGUCAAAGAACUGGUCAAAUCAAGAUAGUGCCAGCUAGAUCCGAAAGAUUGGCUGGUUGAACCAAUUGUUGAGAAUCGAAGAAGAAUAAAAGCGACAAGGCUGCUUACCGGUGAAUUCCCACGGACAAGGUAAUAAUAUCGUUGAGUGUUCAAGCAAAAACAUCCCUACCAAAUU
++
+%$()'%$%$'&)-+225.)((),.++)),-+-)2,++%('',--,.95*)',,.))%,*,-''(&$$$&%&,**)/***1053/.*+/.+,***0+*,.,0//(&%&%(*2++',.+))3**,((5*00-,,++)(%('#('&'(#')/6))'+-./,**2*++&)'%$&%'+,/2232/)+)))+.+(+,)*12-()))),3.*+1.,,*0(*$+'..1+)&%$&(*(0*+/1)+'&''&&%$%)($%('))*-62-++((,7-75566)&&&+)&)$$&(*..10202.*,+,/-+)*'('*'')''$%&&&)&$%%)'''+)$%%&'*.()&$)1++'&()('()*$(--,-/.&*+.0//.3((&+')/-01/.)((&(.(()%&&(().(*(**%'%('*%()%)*,)*+-+1/,*)*),'+-',**)&'*()0.+//)(()*.&%#%''2++(*(#$$&,-)+)&(14+2*&0-*+,/.4.-4+++/97-*)(()'-.+++%&''&$%#$&&&'&'&/(&%$%(*)&$&*'++)*2//0.6**)+0(''''('*'%&$&&((,)*)),-(*0.-)&'%'',*1-0*+()('*'&**03.,-4/*+.(+*&-/4,''(*&)+'+(),'%%#&)***(2,*%(*)%)%)'(%''*''(&&&%&'$$&((('&%$%$&)'&'344%%$#&))$#&*&))%%
+@f2b2e374-e463-4642-aaa3-f5a360b1f781 runid=0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f read=1001 ch=203 start_time=2018-02-06T14:35:50Z
+GACAUGGCCGCUGCUAGAGCUGCUGCUGCUGAAAAGAACGUCCCAUUGUACCAACAUUGGCUGACUUGUCUUAAGUCCAAGACCACUCCAUACGUUUGCCAGUUCCAUCUUGAACGUUCAAACGGUGGUUCCCACCACUGGUGGUGCUUUGGCUUUGCAAGAAUCAUGAUUGCUCCAACUGGUGCUAAGACCUUCGAUAAAGAAUUGCUCCGAAGUUUACCACAACUUGAAGUCUUUGACCAAGAAGAUCGGUGCUUUGCCAGUAACGUCGGUGACGAAGGUGGUGUUGCUCCAAACAUUCAAACCGCUGAAGAAGCUUUGGACUUGAUUGUUGACGCUAUCAAGGCUGCUGGUCACGACGGUAAGGUCAAGAUGGUUUGGACUGUGCUUCCUCUGAAUUCAAGGACGGUAAGUACGACUUGGACUUAGAACCCAGAAUCUGACAAAUCCAAGUGGUUGACUGGUGCUCGAAUUGAACAUGUACCACUCACCGAUGAAGAGAUACCCAAUUGUUCCAUCGAAGAUCCAUUUGCUGAAGAUGAACUGGGAAGCUUGGUCUUCAAGACCGCUGGUAUCCAAAUUGUUGCUGAUGACUUGACUGUCACCAACCCAGCUAGAAUUGCUACCGCCAUAGAAGGCUGCUGACGCUCGUUGUUGAGGGUUAACCAAAUUGGGUACCUUGUCUGAAUCCAUCAAGGCUGCUCAAGACUCUUUGGUGCCAUUGAAGCGUCUGGGUUUCCCACAGAUCUGGUGAAAACUGAAGAGACUUCAUUGUUGAUUUGGUUGUCGGUUUGAAAGAACUGGUCAAAUCAAGACUGGUGCUCCAGCUAGAUCCGAAAAGAUUGGCUAAGUUGAUCAAUUGUUGAGAAUAAAGAAGGAAUUGGUGACAAGGCUUGUCUACGCCGGUGAAAUUCCACGGUGACAAGUUGUAUCGUGAGUAGUGAACCGCAAGCAAAAAAAAGAAAACAG
++
+$&$()+//4068731//++*,-116567--*254++-1-1)170-.++'&)+0.,+3-.-+-,,),-'&%(*&-+,..+)*),/,-.1.)%$$&(0.+38,*)**+(((*)*&)'+,'&)+-'((((&$(.2,&))$'+11070.)%+*+)-)+-*,*+-,0.,('*..050028465+++20135/2324*(%%'''(--)-1*54'/.-+6,'(+(&',*..-*++---+)&*.3+,2.1.,01/*''3+++**/-/15&1170/1.094-+*)*6.0-*0.)**3)))*,.6.*'/.(*;8*-,)*()+(+3*),103765632274375120-)*)+'(0*3)*+&.92-((((*2:63-5*/'&*+**+,4895,5,,,.-1++,',$'%(1**)&&*/)*+376641.-,+++6242'&'%+,-1,900.,4)()**+/7++1/30+,/.30/.1/5532((%)+0,+'&)&))))$&+$%('$('))+493,,+++.34.21..,-**0))((%.++.,+)*.-))-+*/)**-1'&'+0*-*)),'(1)%%'%%(+,.0,./2544286290000/.*))))-12/203.+,++()+.*0021...,,00415--++/-,6,'%&%',+6+.+**+).+),%*..+.*&'&*-)+0).127-/()32..0++++-+-+1,%1.+(-+1.2'&$$&+//+*((%*',''')**%%$$&&)&)$$%&,/(+,+/,*+43550384/,293*,-.30),))%()'&1//+110)'(*-2++'(1263,+++)'(8++-,+)26.,..2,,*-72*)))+0...'/00.11,024+)+00,1+,10'&)&)%$.+-++142/,/-)+1*+-/+&'-&**2+(''7(*,%&*((()*+./6751-00'((,+')),*))(/*+,'$$%%%&'''(''0/330/-&%&'(*,5772760&+44-&$$
+@487eedb2-d957-4fa9-8c18-22d18d9d579e runid=0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f read=1001 ch=313 start_time=2018-02-06T14:36:52Z
+AUCUCCACAAGGUGUCCACGAAGCUUGGAAAUGAGAUGAAGACAAAUCCAAGUGGAUGGUAAGGUGUUAUGAACGCUGUUCAACAACGUCAACAACGUCAUUGCUGCUGCUUCGUCAAGGCCAACCAAGAUGUUAAAGGACUUAAAGGCCGCGAUGACUUCUUGUUGUCUUGGAUGGUACCGUCAACAAGUCCAAGUUAGGUGCUAACGCUAACUUGGGUGUCUUCCAUGGCCGCUGCUAGAGCUGCUGCUGCUGAAAAGAACGUCCCAUUGUACCAACUUGUUGACUGUUACCAAGUCCAGACCUCUCCACCAUACGUUUUGCCAGUUCCAUUCUUGAACGUUUUGAACGGUGGUUCCCACGCUGGUGGUGCUUUGGCUUCUGCAAGAAUUUUGAUUGCUCCAACUGGUGCUAAGACCUUCGCUGAAGCCUUGAAUUGGUUCCGAAGUUUACCUUCUAUCGAAGUCUUUGACCAAGAAGAGAUACGGUGCUUCUGCCGGUAACGUCGGUGACGAAGGUGGUGGUGUUGCUCCAAAACAUUUCAAACCGUUGAAGAAGCUUUGGACUUGAUUGUGACGCUAUCAAGGCUGCUGGUCACGACGGUAAGGUCAAGAUCGGUUUGGACUGUGCUUCCAAAUUCAAGGACGGUGGUACGACUUGGACUUCAAGAACCCAGAAUCUGACAAAUCCAAGUGGUGCUGGUGUCGAAUUGGCUGAUCGGUACCAUCCUUGAUGAAGAGAUACCCAAUUGUUCCAUGAAGAUCCAUCCAAGACGACUGAAGCUUGGUUCUACUUCUUCAAGACCGCUGGUAUCCAAAUUGUUGCUGAUGACUUGACUGUCACCAACCCAGCUAGAAUUGCUACUGCCAUCGAAAAGAAAGGCUGCUGACGCUUUGUUGUUGAAGGUUAACCAAAACCGGUACCUUGUCUUGAAUCCAUCAAGGCUGCUCAAGACUCUUUCUUGUUGCCAUUGGGUGUUUCUGGUUUCCCACAGAUCUGGUGAAAACUGAAGACUUCAUUGCUGACUUGGUGCUAGUUUGAGAACUGGUCAAAUCAAGACUGGUGCUCCAGCUAGAUCCAAAGAUUGGCUAAGUUGAACCAAUUGUUGAGAAUCGAAGAAGAAUUGGGUGACAAGGCUGUUUACGUCAGUGAAUAUUCCUUCCACCGUCGACAAGUUGUAUCGUGAGUGUAAACCGUAAAACC
++
+#$&#**%((*/++0,1+'(&')'',05,&++'&)))*+032)('82*+2,--*.*+(6/*3.//,.4311053**&('*-+54./2,0-(('&,**+-+*,.)+--)(%%*,''+*+/*/.4/13/).,,+/.&(/+*,(($&,3),-.+*))),-++((&/.051//,61731/43,++1+&/'1'(/,./-7.-0.(1-,,++0+,.%//1-/328//-,+++-+((+./6../--,,(*+,58432*()'(*278.-/00/108-,-,-,,..,%$%%%)(+++0*)'$)&**+-*3+*,50*(&))&2*)&&'))0+*,..--006,+,,'*.-5+./*683,915534608.46.,,++/.++01-3153.-.''/&*%&0**38+1')*)).)(**/+,))*/1666/0,,-(1-)'(('(,'+,&)+0+41-/-,,-.62130*&(-%)('')%'+/*-*-/4.//(,.))2'*+-&(.51-+*(*&11714-,2++,,/4///--,-,1/,0/-0-,.03.-010+890**)-/+-:31,*,***0&'2)+.95/76366225214....%.--+01.1)*,++10.+-,***-+--))+*)+0.,-)/01*)%)*)*+++*,.*-*6,,)'%&*()+3)&'.*...4097-5+**)),+,-//95..,/+)))'&$93&(2,/*)**(%&),--,.32836-2.-03.('#)(&+*)&(-%*00.244*.,)%&*43,5+2*++,+(('*,+,.0-'%%#''(+),)&&&(+()447++)'$&%(*$')(++*(*+()-2-,&&/*52,12173/.,,,.53(655531//.+.2.06:1./2--./674/((%&$'1++)(%'54,(,,(,)))'&+*'&&$&'*)*,''%&**,,**(')/.65/(,'2)*7076-('&1,.4.--*'*2/1/,00,.+.0-,'(&(*)%('&,.*-.0)+)13((-,'&&'--/)+/,%))/+,+*+/-,+84*,('-)'))&'')+005794-**+.--*,$,.3234496./0254-84+*,2+)++,1)((&-)-/.--//+)*%(-'*1,/-,,20/8..3.3444//),.,..,0)(&')&***,+'''+*)*-,4-//+.141.'''&+(222*/$&'+',%%')%'+'#%(('%'+3/-,)*$$%&&(('#$&&&&%#&'+('$
+@4ed8103e-7338-4869-99a4-864f10adb88f runid=0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f read=1001 ch=312 start_time=2018-02-06T14:36:27Z
+UAUGGUAACCCAACCGUCGAAGUCGAAACUAUCUCCGAAAAGGGUGGUUCAGAAGAUCCAUUGUUCCUCUGGUGCCCACCGGUGUCCACAAGCUUUGGAAAUGAGAUGAAGACAAAAUCCAAGUGAUGGGUCUGGGUGUUAUGAACGCUGUCAACAACGUCAUCAUGUCAUUGCUGCUGCUUUCGUCAAGGCCAACCUAGAUGUUGGACCAAAGGCCGUGAUGACUUCUUGUUGUCUUUGAUGGUACCGCCAAGUCCAAGUUGGGUGUUAACGCUAUCUUUGGUGUCUACCAUGGCCGCUGCUAGAAGGUGCUGCUGCUGAAAAGAACGUCCUACUGUACCAACAUUGGCUGACUUGUUCUAAGUCCAAGACCUCUACCAUACGUUUUGCCAGUUCCAUUCUUGAACGUUUGAACGGUGGUUCCCACGUUGGUGGUGCUUUGGCUUUGCAAGAAUCAUGAUUGCUCCAACUGGUGCUAAGACCUUCGCUGAAGCCAAAGAAUUGGUUCCGAAGUUUACCACAACUUGAAGUCUUUGACCAAGAAGAGAUACGGUGCUUUGCCGGUAACGUCGGUGACAAGGGUGGUGUUAUCUCCAAACAUUCAAACCGUUGAAGAAGCUUUGGACUUGAUUGUUGACGCUAUCAAGGCUGGUCACCACGACGGUAAGGUCAAGAUCGGUUUGGACUGUGCUUCCUCUGAAUUCAAGGACGGUAAGUACCGCUACUUGGACUUCAAGAACUCCAGAAUCUGACAAUCCAAGUGGUUGACUGGUGUCGAAUUGGCUGACAUGUACCAUCCACCGAUGAAGAUACCCAAUUGUCUCCAUUUGAAGAUCCAUCUGCUGAAGAUGACUGGGAAGCUGGGUCUCACUUCAAGACCGCUGGUAUCCAAAUUGUUGAUGGCUUGACUGUUUCACCAACCCAGCUAGAAUUGCUACCGCCAUCGAAAAGAGGCUGCUGAUGCUGUUGUUGAAGGUUAACCAAAUUAGGUACCACCUUGUCUGAAUCCAUCAAGGCUGCUCAAGACUUUCGCUGCCAUUGGGUGUCAUGGGUUUCCCACAGAUUUGGUGAAACUGAAGACACUUCAUUGCUGACUUAAGUUGUCGGUUUGAGAACUGGUCAAAUCAAGACUGGUGCUCCAGCUAGAUCCGAAAGAUUGUUCUUGGUUGAACCAAUUGUUGAGAAUCGAAGAAGAAUUAGCGACAAGGCUGUCUACGCCGGUGAAAAUUCCACGGUGACAAGUUGUAACAUGCCGUGAGGAGUGAACCGUAGCAAAAACAAACC
++
+#$')++607700**,.00/4/+*'&.0,'(,$&$('%(-8--7,*1&*)&''*12334.-5,+,)'+&$+,3----,'*/110.,,/*(..+))5.1(86*,-,...08/,,+2551+-144*(*)*031+&'&-/-.21.0244+'%)().10071++**)''('-.--/1-356230*,4+(-0(+(,(7.522**+),/.+2%,*,*(&%(,*0&$()./.,-)',.-.6+-(*-630013/,,0+**-*),/-1/086*40())/3313+1)*')*-1+,.-)-,--++*304/5621+('**&)$(0244555440:95/6.(&$',$&%,+0+.-+,&%((&&$%'))2/.)0'().*''5*7/,./&%%%''$&%'()-11,-1/*5(1+)%)')2.01++-31,-4,+902-3+53,--,036106/-,,/31.4'(43+24-)3+,%%&'(261-.-0-.235322-214--/*+*(&%(*%$%-)15..1004/-,))-)2/.01*&'+(+0+,20++1*'&('*//3.32++6),,)***15.,+,../066525)'%&()/..01.,&,+'+0,01/(&$(-/1:40,20(''%%$'+5.64+),%'(3//2.-,2*)),*)+()'*+0.+*)+*'%'&&'$#%(&(*()',).14/10812.5+/04))+3423,+*(*,*-**+),'*+((-+,()*0(3,(&$%))'$&('/(-$%()*4..'/&$20/35-,,-1,,--*1,/.-(+&%'.%'-54.-++/2-2+),'(((($('+#$%%$'*$%*21./40+++*792915.,,*,1-()*&(3//0,++(+%2//0,/1-+,)*(()0***/-,&-,&&%%$%'(')3)&&&''++3.--543:410)'(')))4,,562-3.4+)&#'.'++201222+,,4,1-,(&%%'),,,'((270'(&+(&%$(&&((')'%/-&/..*+''+),,3,:-(/&+1*'(-'*,(*)***-./+/1,+,.0-1++,***,2**(*)'%%%&(*&%'('**(.)(((+55-5)*7*&,/056+6:61,393))*/,,*)'&+*&(/.22820*'''*.4137.:7560///26.0104/2-&$*,1*-/028+*)+0/041)((((,.*.3/+-/3,,($,&'/5.070611312,)3.338-2*,//,/-+-**($%#&&),.).',,-&&(**,0+/.+242*''(*%'&1*,*)*)*),*),)&%$$$%%)('''%'')++.+'&$&%+,75/)0.%%#
+@453f3f3e-d22f-4d9c-81a6-8576e23390ed runid=0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f read=1002 ch=120 start_time=2018-02-06T14:28:08Z
+UGAAGAUUGUUUGUUGGUAAACCGAUACUGUCUAAAGUUUAAGAUCUGCUUACGUUCCCGUGGUAACCCCAAUGAAGUUGAAACUAUUCAAGGGUUUACAAGAUCAUUGUCCAUCUGGUGCCUCCACCGGUGUCCACUGAGCUUGGAGCAAGAGAGAUGAAGACAAAUCCAAGUGGAUGAGUUAGGUUGUUGAACGCAUCGACAACGUCAACAACGUCAUUGUUGCUACUGUCACGUCCAAAGGCCAACCAAGAUGUGUGAGCCAAAAGGCUCGUCGAUGACUUUGUUGUCAAGACCGCCAUCUAGUCCAAGUAAAGGGUGCUAACGCUAUCAAGGUGUCUCACAUGGCCGUUAGAGCCGCUGUUGUUGAAAAGAACGUCCCAUUGUACCAACUUGUUGACUUGUCUAAGUUCAAGACCUCCACCAUACGUUUUGCCAGUUCCAUUUGAACGUUUGAACGGUGGUUCCCACGCUGGUGGUGCUCUGGCUUUAAUGAAUUUACAUGAUAUGGCCUCCUGGUGUUAAGACACACAAACUGUUCAGAAUUACUGGUUCCUCCGAAGUUUCACCUUUAUUAAAGUCUUUGACCAAGAAGAGAGAUCGGUGCUUGUCGGUAACGUCGGUUGACGAAGGUGGCGUUGCUCCAAAACUUGCCGCUGAAGCUUUGGACUUGAUUGCUGACGUAUUCAAGGCUGCUGGUUCCACGACGGUUGUCAAGAUCGGUUUGGACUAGCGCUUCCUCUGAAUUCACCAAGGACGGUAAGUACGACUUGACUUCAAGAACCCAGAAAUGUCAAAUCCGGUGGUUGACUGGUCGAAUUGGCUGACAUGUACCACUCCUCGAUGAAGAGAUACCCAAUUGUCCGAAGAUCCAUUUGCUGAAGAUGACUGAAGCUUGACACAUUCUCAAGACCGUAAGUAUCCAAAUUGUUGAUGACUUGACUGUUCCACAACCUGCUGAAUUGCUACGUUCGAAAAGAAUGCUGAUGCUUCUGUGAAUAACCAAAUCAGUCCACCUGUCUGAAUCCAUCAAGGUCGUCCAAGACUUUCGCUGUCAAAAGGUGUCAUCGGUUUCCCACAGAUAUGGCGAAACUGAAGACACUUCAUUGUUGACUUGGAUCGGUCGGUUUGAGAACUGGUCAAAUCUGAUUGAUCCAGCUAGAUACGAAAGAUUGGCUAAGUUGAACCAAUAAUAUGAGAAUGGAAGAAAAUGGUGACAAGGCUUUGUUUACGCCGGUUGAAAUUCCACCACGGUGACGGCGCUGUAUCGUCAAGUGACAUGUGGCAAAACUAUCAACCAUCCAUACAACCUACCCCACACCCAAUCCAGAUUGUGUUUUGUUGUCGCUAUGGCUGUCUAAAAGUUUUACGCUAGAUCCGUCUACGACUACCCGUGGUAACCCAACCGUCGAAGUCGAAUUAAACCACCGAAAAGGGUGUUUUCAGAUCCAUUGUUCCAUCUUGGUGCCUCCACCAAGGUGUCCGAAGCUUUGGAAAUGAGAUGAAGACAAAUCCAAGUGGAUGGGUCUAGGGUGUUAUGAACGCUGUCAACAACGUCAACAACGUCAUUGUUGCUGCUUUCGUCAAAGCCAACCAAGAUGUUAAGGACCAAAAGGCCGUCGAUGACUUCUUGUUGUCUUUGGAUGGUACCGCCAACAAGUCAAGUUGGGUGUUAUACGCUAUCUUGGGUGUCUCCAUGGCCGCUGCUAGAGCUGCUGCUGCUGAAAAGAACGUCCCAUUGGUACCAACUUGCUGACUUGUCUAAGUCCAAGACCUCUCCAUACGUUUGCCAGUUCCAUUCUUGAUACGUUUGAACGGUGGUUCCCACGCUGGUGGUGCUUUGGCUUUGCAAGAAUCAUGAUUGCUCCAACUGGUAAGACCUUCUGAAGCCAUGAGAAUUGGUUCAAGUCUACCACUAACUUGAAGUUCUUUGACCAAGAUAGAGAGAUACGGUGCUUGCCGGUAACGUCGGUGACGAAGGGUGGUGUUGCUCCAAACAGAGUAAGGACUUGAUUGUUGACGCUAUCAAGGCUGCUGGUCACGACGGUAAGGUCAAGAUCGGUUUGGACAAUGCUUCCUCUGAAUCUUAAGGACGGUAAGUACGACUUGGACUUCAAGAACCCAGAAUCUGACAAAUCCAAGUGGUUGACUGGUGUCGAAUUGGCUGAUCGUCACCACUCUCCUGAUGAAGAGAGAUACCCAAUUGUCUCCAUCGAAGAUCCAUCUGCUGAAGAUGACUGGGAAGGUCUUGUUCAUCUUCAAGACCGCUGGUAUCCAAAUUGUUGCUGAUGUUACUUGACUGUCACCACCAACCCAGCUAGAAUUGCUACCUUUGCCAUUGAGAGGCUGCUGACAAUCUUUGUUGUUGAAGGUUAACCAAAUUCGGUACCACUGUCUCUGAAUCCAUUCAAGGCUGCUCAAGACUUCAAUUGCCAACUUGGGGUGUACAAGUUUCCCACAGAUCUGGUGAAAACUGAAGACACUCUUCAUUGCUGACUUGGUUGUCGGUUUGAGAACUGGUCAAAUCAAGACUGGUGCUCCAGCUAGAUCCGAAAAGAUUGGCUAAGUUUAACCAAUUGUUGAGAAACCGAAGAAGAAUUGGGUGACAAAGAGCUGUCUACGCCAGUGAAAAACUUCCACCACGGUGACAAGUUGUAUCGUCGUGAGUAGUGAACCGUGGCAAAAAAAUAU
++
+$&%,)1.-*'''()(')(&*'$(&&'%%((((&*.1+,-'(*))&&%&(+)&'%$%*5/'&'-')-.61,&'%()-+.*''+*$+'&&'$(&-(-,*$').+*)*(*+'(**&(%+,(-+-*'*)%'()121-.-$%$%()'//'.%&&(***()+,*+.*(***7.-.22-*'(-''(((((&2,-..,&+.-('%%&%&%'((&'&%'((*-)*)((1,//01+,(*,*%&#'$%'*,1)*-2//3//+/.-)((&((''))(130-,(,(*(1///--$*''%$'&**+'($%)(+1,'&%')+).00-*/2'.4+*))*3)--**'&$%%*(,*)('(%)&'(.,-(%&%'(-01+)+)*,((,()350+-,(+*471)%%'(,200,++*))1*0((0)((%$))(+,-+..3($'*(--+*)()**(&$)(*2--+)'&./35/.)+)-*,0+-(*.'+'001))(%'.),,3**'(&*,*(-()**'*/.,&*%#&&'()%(&.&-$('')%*)*-)1))''*&'),%$&+)/,01602,)(',&&'(.()0-00,..(%$-&+')((-$&('%$*,,,))0*,*.,+))**))%,--**..,%--3280-.,*++/((('')-&,')-'&+..+15..61+&$$#$#(($%&*&..6,,*((.20+)+(%+*)('**,''(('-%$$#'-1.)&(((),0231,,&&'.+,-.612')&*%&(''')'*+(,&&)&&*$&&$'+,0..+,-.0-*(())(*(),.+('*',0056-34((*4+,-)''4-(+-,.)&,(/+-)++/+,.532,,-)))*(()*),-)))()*%%&'((2)(+()*(*0/*(&*('&'$%'(,,-,(.--,1+*).)//,*(&'%-%$(&-%$$%%%'%('(31,,(&%%&*'*'(*55)*)%&(%&&'()$'(-++)+%*($()'*,&((*,2353,)**+((%&%)-1,(,/+,.0/-),''.&(((&%(%)+,+19,.%&*'(&$%$%)&&,)--%0--+)))++(#'(*(&)))&()+&)%'/**',/**'$'''(('11/,'*-,%&((,,%'++%+06--..-/*))*'*'&(+,))+,,+401/('$'+*,,0-,'%*)1/,,3)()-21-,--,//)'&'()+**,++'%''*63)*.*,'%%&&&'*),**),.(''''(),)0+('+-)(+'(&&)-(),,-/*,'&%''('+''(*0,0**&(+('&)*'/.,,)/0(('&&$$$&&&%&$$$')('''&%$$%%%'%(06.&&)&&&&%&'')*)'$$%&&($$(./*%%$)+)')%&()*,62..,/21044.,-24643,,8+,.-,,+78.-)1++&(''.---+'-(('''),,.)%(53'((-*0-86-/+,-&&',6/-.,,-0+*-1&+'&)&',23(-0++*(+,,''2370.)*,()2/0)'%()54---0%(*$))&(,.)*(),&++-,/5-6+)2-*+,/.*-2,*,*)8/+)+-+(,.//+0++'&&)(3/)+.0-..1/+,++,-)+0--.-./,70-0.**''(,)*'/1530,*1-()+*.-,(+/,'..,/,)***'0*)-*+/2741+1*2*,,-+.+*&+)%)*'621,*-6.4-..81009/08,-((,1)(++2262/8.),*0*&%(+.)*&&)0)9--0(')&)%)'.*3.66656+**)),.1*++,,1,+134-*./10-09,)++'/('043+)&&&&(.-,.+&(%)%++'(1,0/'+)'&'&/+*(('&,0((6765463/(,&(++*&(+-(.--2.-2048.8-271++*&-1..41+*$,)+,,(+,0+/1*).,+'(*,*,1.*,+,+)&)).*&**)-*')%&*--+/*)&&))./,*-)+))'(&'$(&.)&')((&0.,/,)-)&+/2.*/./2)(#(%&%&()**/3000))0*+64755/*,+,9543,*(,*05,*,8)--+)*0..''$$''(()'))0'&)1.,+1),1.7694.,,-,2)4().0387,,+*+00:73311/.,./**+)/57,+3.))%&(-*,-(,&*,10.(%'')/+/**.0,00..///24659.-+-.)*6-70481/105/.,+-)-8'*225-,+2+0**,+.23232/-1-+.*/)).'$%%$&%*)'((&%)((,,-25/-,()()*+/74/+.+'$%$)'%'((+2)*&.(()'032--+2+./010.01-+((*%&&,*&%%$&%)(*,3/+*++*04,-..0554+,/+.40/,+)(('+*,/0-+*+))*')*(,-')'+-00.-'**5.1**)''%$%&*/,))'$&&&(-()+++*('&&&$'--,/0-60**/)0,3,0*3(75'/(+0/.,+(%,+*''(*,/4476('(*4,1,*,0*'*.1))'(*&$&'**-,*%%+,+13-*,+(($$*&+*(6+%),-4.+*+,***45*(+-//--,*)'&++)+./,353-,3**,./,-3:485//,+.1,.3002-6/*.24111.03**++4/00*+,+)+()&+/.0*,5++.)**+,03-)-.10-..*00,.,56,)'),+*/.-0/1.-5...--*3'&')&*),'((('02+75.052,)%(((*%))(++-2.-,00043''$%%%&,+++)(('&'(0*,&%%%''(17863,,&'
+@ab761bb7-ca33-4f3b-a83a-1b3964a9fcba runid=0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f read=1002 ch=225 start_time=2018-02-06T14:40:34Z
+ACAUUGAAAAGAGCGCCCAUUGUACCAACUUGGCUGACUUGUCUCAAGUCCAACCUCUCCAUCAUCUGCCAGUUCCAUUCUUGAACGUUUGAACGGUGGUCCCACGCUGGUGGUGCUUGGCUUUGCAAGAAUUUUGAUUGCUCCAUUGCUGGUGCUAAGACCUUCGUGAAGCCAUGAAGAAUUGGUUCCUGGUACCACAACUUGAAGUCUUGACCAAGAAGAGAGAUCGGUGCUCUGCCGGUAUCCGGUGACGAAGGUGGUGUUGGCUCCAAACAUUCUUGCUUGAAGAAGCUUUGGGACUUGAUUGGUUGACGCUAUCAAGGCUGCUGGGUUCACGACGGUAAGGUCAAGAUCGGUUUGGACUGUGUUCACCUCUGAAUUCUUUAAGGACGGUAUAGUACGACUUGGACUUCAAGAACCCAGAAUCUGACAAAUACCAAGUUGACUGGUGUCGAAUUGGCUGAUGUACCUUGAUGAAGAUACACCAAUUGUUCCAUGAAGAUCCAUUUGCUGAAGAUGACUGGGAAGCUUGGUCUACUUUCAAGACCGCUGGUAUCCAAAUUGUUGCUGAUGACUUGACUGUCACCAACCCAGCUAGAAUUGCUGCCAAAAGAAGGCUGUGACGUUUUGUUGUUGAGGUUAACCAAAUCGGUACCUGUCUGAAUCCAUCAAGGCUGCUCAAGACUCUUCAAUUGCCAUUAUUGGGUGUUCUGGUUUCCCACAGAUCUGGUGAAACUGAAGACACUGUCUGGUUUGUCGGUUUGAGAACUGGUCAAUCAAGACUGGUGCUCCAGCUAGAUCCGAAAGAUUGGCUAAAGGCAAUUACGCUGUGAGAAUCGUAGAGGAAUUGGGUGACAAGGCUGUCUUACGCCGGUGAAUUUCCACCACGGUGACAAAGUUGUAUUGCGAGGAAGUAGUGAACCGCAAGCAAAAACC
++
+$&&&(')53.'&$#%(2,,1.00130)('(0).(*,.003))&'%&)+++0&&'+&%%)+((&$'$,-/1/-+/.2((0&,--4-/.)11/00-/.*-*$()-%(''/3,+,-+-+55)6((73-./,,,+&(%(()00/677.0&$$&'--+,-7762,,))*)(**+-,-.+*))*(*0/0***,/-**/*%&('-..,/.--,*+*577--2..-5,.*)(('+&-.--'('--465/./%++/133*)'**,.(*2+-(,+('+-,/9/+)**&'+&&'%$%)(.1-**/-.6../48226/')(-*6430/,--3+6,+0.,*++)*('(**2.74530-/*++1+,-*.5.822000,'..(-&%,,+*+*,/,,(+)%0-1-,-3-.('',,----*6370-*,)).4,1/-20//-1+*-2-*,.+)+.-5+*(0()*)+.11./-.)-)+.*+-''&*&)($%(,0/)-))'(*%).+1/2+&)*/)*),**,/4+*/),--,,-,*+00****4/*,()/2,-(%%$$')(&'.+&&)--06644304/2/01)(+(+*11000/5776340++*0,//011.01/00.5.2++-*0/.12,*.+,+)('*)),,'**)%'((-0))).(.5/5/,81,,632.4+.)-*(',*+-.)&%(+(2*++/1+0()*+'&(*&(*)+))+'&*(.,05.,*-'&$%*)3+160'()/07025530294,++,.*$%$$&&'$+0533444-9-300+0041,,341-0(-(*.,,,/02,+)&,-,1/011///,+35.*+,4*4*))5'.($,-%*++&%)(+*-)0+*('%(')(*.../15./*))6,',&'*($)+&''-4..-,*&+-(**',+()*+(*,,+2..54)(%%&&&''(((&(&$&$&'(*)&'%''&*23/)'%
+@a3237e11-476a-498e-beee-e79ef5c2f4ca runid=0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f read=1111 ch=186 start_time=2018-02-06T14:39:56Z
+UUGGGAAGCUUGGUCUCACUUCAAGACCGCUGGUAUCCAAAUUGUUGCUGAUGACUUGACUGUCACCAACUACACAGCUAGAAUUGCUACUACCGCCAAAAGAAGGCUGCUGGCGCUUUGUUGUUGAGGUUAACCAAUUCGGUACCUUGUCUGAAUCCAUCAAGGCUGCUUCAGACUCGCUGCCAUUGGGUGUCAUGGUUUCCACAGAUUUGGUGAAACUGAAGACACUUCAUUGCUGACUUGGUUGUCGGUUUGAACUGGUCAAUCAAGACUGGUGCUCCAAUUAGAUCCGAAAGAUUGGCUAAGGUUGAACCAAUUUGUUGAGAAUCGAAGAAGAAUUGGGUGACAAGGCUGUCUACGCCGGUGGAAACUUCCACCACGGUGACGGUUGUAUCGUCGUGAGUAGUGAACCGCAGCAAAAAAACACCAUUCAACCCGCCCCACCUAUCCCAAAAUUA
++
+%*'+*(+,+1/6.)&%%&$&+&&++('/'(..55008090/+1+32701+)*+*+5444/0.+))+-()&'(*&,*,,',,.0.1-('&%%%&+*)+'(+2(+.,2+-3.+,0+++.5/*-5.4.''')+-5/4076--()4**0.24/1,1.7..932312.1.,02*+()-+,')'%&(++)(*+*6.*+-,,,.,62-,2(),+,5+,1)*-)76((,-3-4/-*-*((-/+,.-3475843477591,*.,3/..434-71.-40...175,+*'+'()+*++,1/)(.60,14011-+&'(('-+/.-.04+2/*+0++-031202.,-+*,./,.0+*,,.1+.,*''&$%%&'&*%,((()10#)*)+'*,*,10.-**,3+-*(&&%%&%&())*+*---,&'(%$$'&(3898)&%$'&'*'%&)&*((+,,,$(($&%(+(&)-,%$%
+@56f62749-403c-454d-930b-83d9057ce93f runid=0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f read=1111 ch=470 start_time=2018-02-06T14:42:46Z
+ACGCCCCGCCCAGAGGUGGUUGCUCCAAACAUUCAAACCGUUGAGGAAGCUUGACACUGAUUGUUGACAAUGUUCAAGGCUGCUGGUCACGACGGUAAGGUCAAGAUUAGAGUUGGACUGUGCUUUCCAUUGAAUUCUUCAAGGACGGUAAGUACGACUUGGACUUAGAACCCAGAAUUUGACAAAUCCAAGUAGCUGACUGGUGUCGAAUUGGCUGACAUGUACAACCACCUGAUGAAGAGAUACCCAAUUGUCUCCUCCGAAGAUCCAUUUGCUAAGAUGACUGGGAAGCUAAGUCUCACUUUCAAGACCGCUGGUAUCCAAAUUGUUGCUGAUGACUUGACUGUCACCAACCCAGCUAGAAUUGCUACCGCCAUCGAAAAGGCUGCUGACGCUUUGUUGUUGAGUUAACCAAAUCGGUACCUUGUCUGAAUCCAUUCAAGGCUGCUCGAGACUUCGUUGCCAACUGGGGUGUCUAGUUUUCCCACAGAUCUGGUGAAGGUAAGACAUCAUUGCUGACUUUGGUCGGUCGGUUUGAGAACUGGUCAAAUCUGGAUGGUGCUCCAGCUAGAUCCGAAGAUUGGCUAAGUUGAACCAAUUGUUGAGAAUCAGAAGAAAUUGGGUGACAAGGCUGUCUACGCCGGUGAAUUCCACGACAAGUUGUAUCGCGUGAGUAGUGAUCGCAAAAAACAU
++
+'%#%&'&%%)+$$&('&''&&&&'*),4-''*)&*.,--)),*)('+'%%(+**'%$('),13./,+*)(')+)&3.-.*+2*36/++**),.)..0-*2)(,20,.*'('')/)0426--+))+*''%'*/00/,&*))*-.,+-(/&$%0,,,+,)0445/+-(--1-03-)-.1+(.)*+/1)*4/0*)(-+/045315-11*))*3+2)2('()'**((&()(.)(+*+./113.*,)--06857/8+*+'(*($''%&2',01,*0*.+*'&)(+*+,+*31+)1,-0*()&%'()+)+)&'5003-.0125321736:443132.)11336621311131/,+.0/1861-+..**+4,4.-)'(,(+1*'$&*24-)+&')-100+*&,.-*6./0-)))*.-.2.45...16612-.//0**(3*)7.*)(%'&/)*6501*))))+*+&'(+(,*()%-103,+,-01*,/-*(+.-)+024406963+)&*'')+(**)%%%*****+.(),.),(&(&*)6/50+*,*03001750.7+-)'%)((',+/./0000/02313.1003--.4+2++,/)),,3132.1-/+10./.-/*&&'(0+06.1225/..*)+,('&&''%&&'')+'/.,/.,)+*(+,++.2031)''%'%&(((''%$(())'$%$'+360(+$#
+@adc50c94-789e-4c49-b20d-1f1598a27bec runid=0c640f6d456ec16c9dfc0e1a607256f68c2b0c2f read=1111 ch=481 start_time=2018-02-06T14:57:33Z
+GCUGUUUUGAACGGUGGUUCCCACGCUGGUGGUGCUUUGGCUUUGCAAGAAUUCAUGAUUGCUCCAACUGGUGCUAAGACCUCGCUGAAGCCAUGAGAAUUGGUUCGAAGGUCUACCACAACUUGAAGUCUUUGACCAAGAAGAGAUAUGGUGCUUCUGCCGGUAACGUCGGUGACGAAGGUGGUGUUGCUCCAAAACUAUCAAACCGCUGAAGAAGCUUUGGACUUGAUUGUUGGCGCUAUCAAGGCUGCUGGUCACGACGGUAAGGUCAAGAUGGUUUUGGACAAUGUUUCCUCUGAAUUCUCAAGGACGGUGAGUACGACUUGGACAUCAAGAACCCAGAAUCUGACAAAUCCAAGUGGUUGACUGGUGUCGAAUUGGGUGACCGUACCACUCCUUGAUGAAGAGAGAUACCCAAUUGUCUCCAUGAAGAUCCAUUUGCUGAAGAUGACUAAGGAAGCUAAGUCUCACUUCAAGACCGCUGGUAUCCAAAUUGUUGCUGAUGACUUGACUGUCACCAACCCAGCUAGAAUCGUUCGCCAUCGAAAAGAAGGCUGCUGACGCUUUGUUGUUGAAGGUGGUUAACCAAAUCGGUACCUUGUCUGAAUCCAUCAAGGCUGCUCAAGACUUUGCAGCCAACUGGGUGUCAUGGUUUCCCACAGAUUUGGUGAAACUGAAGACACUUCAUUGCUGACUUGGUUGUCGGUUUGAGAACUGGUCAAAUCAAGACUGGUGCUCCAGCUAGAUCCGAAAGAUUGGCUAAGUUGAACCAAUUGUUGAGAAUCGAAGAAGAAUUGGGUGACAAGGCUGUCUACGCCGGUGAAUUCCACCACGGUGACAAGUUGUAUCGCGUGAAGUGAACCGUAAGCAAAAAGAAACC
++
+$%%&(201*+1(())//23-83*+*(02/.3/1/,-+-.,*1020/46,.0,+,--..17-,,1+0'%+422368766++)%(&'++-0)-)'$%'(/3/56/8,,))'*'*%&%*)'-'+'(**/,0*)*56334081,,*)*(*,-.221,+/(&'(-2-5010-//376311///+/+*4./0750///05.51&&&)&(66331/,,,+&+)''/52+0,+,1303769,.*(%&((),/,1-+-0).0.,,-./,%*))-/*.)*,6...)1+:6*8,++/003'-*'+)(-.1.*)&)').).)+*'&%$&&%((())*,-+)&(*/2*+6+96412/)%'),+.6.,157/,,//++0-.-042234,/2/-3/(.1*('+**1.+*)(*%&)))*..-+)))*+,0:473/3()()/0--,3--,.2,+,+-)$,)./-.49+)'&&*-*2+/3'','&&&&(',%%(++0.-//4//0+600:61204/-,(,-/())*-655660+*,/,107.,,-,,+.3+%&&+').+(&&%'+1/)+.,.-/626110.(+..''/,0/**)*('-*,)(*(*/8**+(./.412.)(&,,-1)*/&()*,-,)*833144/,&,/*'+*-223+).+33+,3,*)+-2/'*0)%'+**))),3,-410*)*0/,.+++)*%&(5.4574402),*/(-3613/*+./250,,6,*8:--4:5...-62--*(+**+,/13(('*&+33*-30-3,--360+)(-).0/30.30113834203..40+60)*)3-(/0+3,.,,-++$''(&)-+000).&(&*$')&*'424334//3+('&%%%%((*+(&'')(*((&'()(+378/)65*(#
Binary file test-data/30xpolyA-small-subset.sorted.bam has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/all_fasta.loc	Wed Jun 19 07:00:20 2019 -0400
@@ -0,0 +1,1 @@
+draft	draft	draft	${__HERE__}/draft.fa
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/all_fasta.loc.sample	Wed Jun 19 07:00:20 2019 -0400
@@ -0,0 +1,1 @@
+draft	draft	draft	${__HERE__}/draft.fa
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/draft.fa	Wed Jun 19 07:00:20 2019 -0400
@@ -0,0 +1,46213 @@
+>tig00000001 len=4376233 reads=23096 covStat=7751.73 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+AGATGCTTTGAAAGAAACGCAGAATAGATCTCTATGTAATGATATGGAATACTCTGGTATTGTCTGTAAAGATACTAATGGAAAATATTTTGCATCTAAG
+GCAGAAACTGATAATTTAAGAAAGGAGTCATATCCTCTGAAAAGAAAATGTCCCACAGGTACAGATAGAGTTGCTGCTTATCATACTCACGGTGCAGATA
+GTCATGGCGATTATGTTGATGAATTTTTTCAAGTAGCGATAAAATCTTGTAAGAAGTAAAGATAATAATCTTGAAGCATTTTATCTCGCAACACCTGATG
+GACGATTTGAGGCGCTTAATAATAAAGGAGAATATATTTTATCAGAAATAGTGTCCCGGGATTGAGTTCAGTATGCATACCGTATCATGATTAATTTTAG
+TGCTTTTATTAGTGGGGCCTATAGGAGATTCAATGAAATATAGTTCAATATTTTCGATGCTTTCATTTTTATACTATTTGCCTGTAATGAGACAGCTGTT
+TACGGTTCTGATGAAAACATTATTTTTATGAGGTATGTGGAAAAATTACATTTAGATAAATACTCTGTTAAAAATACGGTAAAACTGAAACAATGGCGAT
+ACAATTAGCTGAAATATATGTTAGGTATCGCTATGGCGAACGGATTGCAGAAGAAAAACCATATTTAATTACGGAACTACCAGATAGTTGGGTTGTTGAG
+GGAGCAAAGTTACCTTATGAAGTTGCGGGTGGTGTATTTATTATAGAAATTAATAAGAAAAATGGATGTGTTTTGAATTTCCTACATAGTAAATAATGCT
+GGCGCTGATGGATGCGGATGGAAACATTGCGTGGAGCGGGGAGTATGATGAGTGGGGCAACCAGCTGAATGAAGAGAACCCGCATCACCTGCACCAGCCG
+TACCGGCTGCCGGGGCAGCAGTATGATAAGGAGTCGGGGCTGTACTACAACCGGAACCGGTACTACGATCCGTTGCAGGGCGGTATATCACCAGGACCCG
+ATAGGGCTGAGGGGGATGGAGTCTGTATGCGTATCCGCTGAATCCGGTGAATGGTATTGATCCATTAGGTTAAGTCCCGCAGATGTAGCGCTAATAAGAA
+GAAAAGATCAACTAAACCATCAAAGAGCATGGGATATATTATCTGATACTTATGAAGATATGAAGAGATTAAATTTAGGTGGGACTGATCAATTTTTCCA
+TTGTATGGCATTTTGTCGAGTGTCTAAATTAAATGACGCTGGTGTTAGCCGATCGGCGAAAGGGCTGGGTTATGAAAAAGAGATTAGAGATTACGGGTTA
+AATCTGTTCGGTATGTACGGCAGAAAAGTAAAGCTATCCCATTCTGAAATGATTGAAGATAATAAAAAGACTTGGCTGTAAATGACCATGGGTTGACATG
+TCCATCAACAACAGATTGCTCAGATAGATGTAGTGATTATATTAATCCAGCATAAAAAACGATAAAGGCTTTACAAGATGCTGGCTATCTCAAGTAATCT
+ATCAAAGATGATAATATTTATTTTTGCTATTATAATCATTGTTGTTTTATGCGTAATTACTTATCTTTATTTATACAAAGATGAATCTCTTGTAAGTAAA
+CATTACATAAACTATATGGCAATACCAGAAAATGATGGAGTTTTTACATGGCTCCCAGATTTTTTCCGCACGTAGCGGTGGATATATCAATATACACAAA
+TGTAGAAGATGATTATTTTTTCTTATTTTCCCTAACAAATGATGATGGGGTAGGTTTAAGAAAACATTGACAGTGAGGGCCAGGGAACAAGTGGCGAAAA
+TCGTATCAAAGAATGATCCAGATACAAAAAAGTGTGGTGTAAATATGGTAAGATACCAGGGCAAGGGATGGTGTAAACCTTTTTTGTTGGTGAAATTAAT
+GTTACGCATTATTTTATAACAAATATTGGAGCTGGATTGCCTGATGCTTGTGCAGAGTAATTGCTTGAATTAAGAGTCTATCCCATATCGAAGTCGTCAA
+CTTCGTAGTGAGGAAAAGTAAAATTCCTGACTGAGAAAAGACATGTCGGCTATTGTGTAAAGCCATATAGCTCAGACGATGAATATCTACTCGTATTCAG
+TTGTTTATTGAGGGTGAGTTCCGACCCTGAAACAACAAATAAAATGAACAGTCAGAGAGTTTACATAGAATTGCACTGGTCTTTTACGATATCTGACATT
+GTGTAATACATATTCAGCCATGCATTAATTAAAATGTTACGTGTTTAATGTGAGTCCCTATCTGAAAATAAATAATCCTTCCGGATTAAAATAAATTCTT
+GCCGGGAAAGAAAGAGGAAATAAACCATTAGCGGAAAACCAGCGGCACGCCAGGGTGACATGCCCCAGTACGGCGGCCCGATAGTCCAGGGTTCAGCGGG
+GTACTGATAGTCGCGCCGACTGCATCGAGAACTCCATACAACTTTTACGGAACGTCACCTGATAAAATTTGTTCAGTATCGTCTTTGAGATTCTCAAGGT
+TATGGAGTAACCAGACAGAACGGACACCACTGTCGGAGATAAAACCCCTGTTTACGCAGCTCGTTGCTGGCCCGGTGCTGACCATGTGTCGGGAAAGCGA
+CGGCGTAATCAACAACAGCCTGTTCAGTTGCCTCATCGGTACGGTTCTTAAGGTTAGGAGCGCGGCGACTACGATTAATCTGCGCATCCACACCGCCTTC
+AGCGACCAGTTCGCGGTAACGATAAAACGTATCACGCGAAACGCCCATGATTTTACAGGCTTTTGATACGTTGCTGAGTTCTTCAGCCAGATTGAGCAAA
+CCGGCTTTGTGTTTGATGACGGGATTGGCAGTATGAAGCATGAGAGTTACCTCTTGTTTTGGATAAGGATTCGACACTCATATCAAAACCGGTAACTCTC
+AACCTTTCAAGGCCATGTGTCAGATCAAGTCGCGACTAATACAAATACGTCCCTCATTACCGCGCCTTAACCCATTCCGCCACTTCCGCCCACTCACCGC
+GAAAGACAACTTTTTCCGCTTTTTCTCAAGCTGATAGCGATACATCGGGTCGTAATATTCTTCAAGTAACGGCACCAGCCAGGCCAGATGACCGTCGGTG
+CTGCCGGTGGTGAGTTGCGTTGTCAGTGCTGCATCCAGCCTTGCAGCCAGTTCGTTATAGCGCTGTAGCCCCAGCCGACGCTTAATCGCCGAAAGTCCGT
+GATGCAGGTATTCGCAATACTCCTGCCAGCCCTGTTCGTCGCCGTACGCGTGGGTAAAATCATGATGCATACGCAAGAAATACTCTTCGTTCAGGCGCTC
+AAGACGGATCTCAAACGGATCTTCTACCACCGCAATCGCCGCCTGAGTCATTCGCTCGCGCAGGCATTCCGGCAGGTGATTCGAACCGATCATCCGGCTT
+TCGTCTTCCAGCACCCACAGGCGCAAATTCTGACGGGCGTCGGTTTTAGCATTTCGGCAGCCAGCAGGTTTTCAAAACTCGCCTGGCTAAGTTGTGGTTG
+TAACGTGCGACCAAACGCCGAACCGCGATGACGCGCCAACCCTTCCAGATCAACACCGTTCGGCTGTTGCTGCACTAACAGCGTTTTACCGCTGCCGGTA
+CAACCGCCAATCAGCACTATCGGTTTTGTGCCAGTTCAATAGTCGCCTGAATCGCGGTCTGGCGCAGTGCCTTATAACCGCCTTCCACCAGCGGATAATC
+AATCCCCGCTGCATGCAACCAGCTTTGCACAATATGTGAGCGCTGACCGCCACGGGCGCAGCAGAGAATACCTTGCGGATTTTGCAGGCACGCTGCCCGC
+CAGGCGTCCATGCGCTGCTGACGAATTTCACCCGCCACCAGTTTATGTCCCAGCGCCAGCGCTGCGTCTGAGCCTTGCTGTTTATAGCAGGTGCCAACGG
+CGGCGCGTTCATCGTTATTCATTAACGGCAGATTGATAGCGGCGGGCATTGCGCCGTGCTCAAACTCGATAGGGGCGCGAACATCAATAATGGGCGTATC
+AGCAATCAGCAGGGCACGATAGTCCTGTTCCGTGTGTCTCTCTTGCATAGTTAAAAGTGAACCTCAAATCAGCTTGCGCGCTATTTTACGCGCCAACGCG
+CAAGGAAACTTGATTTTTAACTGCGTGGGTTGCCGAAAATTTCTAAAAATCCGCTGATTTCCGGCCTGCGCTGGGTAAACAAGGTCACAATATCTTCTAC
+CGCTTTGCCGCTGCCAAATTTGCGCCATGCCAGACTCAATGGCGAAGGAGGGCGCATCGTTGGGATTACCCGGCTGACCAGTTGTTGATTATCGATCATT
+GACTGGCAAAGCGATTTTGGCAAAAACCAATGCCAACGCCCGCCAGATGGGCGGCGATTTTCGTTTCCATATCGGGAACAATAATCTCTTTTGCCCTGGC
+AATCGCCAGGCGACGCGTTTGGTTAAGGTGCGGGCGCTGTCTTCAATATTGACCGCCGGAAAGCGCCGCAACTGCGCTTCTGTTAGCGGCTCTTCAACGT
+TCGCCAGCGGATGATCCGCCGCCATGACAAAGCGCCATTGCACCGATCCTAAGGGATCAAGACTAAAGGTATTTGCCAGCGCCTCAGTTCCCGTGACGCC
+GATAGCCAGCGAAAACCTTCGTACAATAGCGAGTCCCAGACGCCCATATAGATTTGTCGGGAGATGTGAAACTGGGTAAAGGGTAACGCTCATTCAGCCA
+CGCCAGCAACTGGGCGACGGCCTGGGGTTGTAGAGCAGGTTGTTGATGACAATATTCACCTGGCGTTCCACGCCATCATTCACCTGTTGCAGCTCGCTTG
+GCATACTTTCCAGCCAGCTCAGCCAGTCTCTGGCCTGGGAAAGTAGATGCTCGCCAGCCGCTGTCAACGTCACGCTGCGAGTCGTACGGAAAAACAGCGC
+TACTCCGGTATTCTCTTCCAGAAGTTTAATGCGATAACTGATCGTCGCCGTGGTTTTACATAATCGTTCTGCCGCTTTTGAAAAACTTCCTGTTTCAGCA
+ACCGCAATGAAAGTCCGCAAGGTTTCTGGATCGAACATCTTCAGGTATCCCCTTTAAATCCGCAAGTTGCGTGATTTTCTTATCCTCTGATTTATCAGTA
+TTTTTACATGATAACCCTGTTCAATTTGTGGACTAAATCTAGTTTTGGAAAAATATTCCAACTTTTGTATTGATGTTGTTCTCTTAAGGTTTTAGATTGC
+CTGTTATTGAAACCAAGCTGACCGGTCGGCGGTGGTTGAACGGAATTATGTTACAAGGACAAAAGATGAAACTTCAGGTATTACCGTTAAGTCAGGAAGC
+CTTTAGTGCTTATGGCGACGTAATCGAAACGCAGCAACGGGATTTTTCCATATTAACAATGGCCTGGTGGAGCGTTACCACGATTTGGCGCTGGTTGAGA
+TTCTTGAGCAAGACTGTACGCTTATCAGCATTAACCGCGCGCAACCGGCGAATCTGCCGCTGACCATTCACGAACTCGAACGTCATCCGCTGGGTACTCA
+GGCCTTTATCCCGATGAAAGGTGAGGTGTTTGTGGTGGTCGTGGCGTTAGGTGACGACAAACCAGACCTGTCAACGCTGCGGGCGTTTATCACCAACGGC
+GAACAGGGAGTGAATTACCATCGTAACGTCTGGCATCACCCACTTTTCGCCTGGCAGCGCGTCACCGATTTTCTGACCATCGATCGCGGCGGCAGTGACA
+ACTGTGATGTTGAAAGTATTCCTGAACAGGAACTCTGTTTTGCGTGACGCCTGCAACCGACTTGCATAAGATAAACTAATTGTTCATTGTTTATGCTCAC
+TTGTAGGTCGGAGTTAACGTAGGTATGACGGAAGTTAGACGGCGCGGCAGGCCAGGACAGGCGGAGCCTGTGGCACAGAAGGGCGCACAGGCGTTAGAGC
+GGGGAATTGCGATTCTGCAATATTTGGAAAAAGTGGGGAAGTTCGTCGGTTAGCGATATTTCTCTCAATCTGGATTTGCCGCTCTCCACGACCTTTCGCT
+TGCTGAAGGTTTTACAGGCAGCGGATTTTGTCTATCAGGACAGTCAATTAGGCTGGTGGCATATAGGATTAGGTGTCTTTAACGTCGGTGCGGCGTACAT
+CCATAACCGCGATGTCCTCTCCGTCGCCGGGCCGTTTATGCGCCGCCTGATGTTACTTTCCGGCGAAACGGTCAATGTCGCGATCCGTAACGGCAATGAA
+GCGGTATTAATTGGTCAGTTAGAGTGTAAATCGATGGTCAGGATGTGTGCGCCACTGGGCAGTCGTCTGCCACTGCATGCTTCCGGTGCGGGCAAAGCGC
+TGCTTTATCCGCTGGCGGAAGAGGAGTTGATGAGCATCATTCTGCAAACCGGTTTGCAGCAGTTTACGCCAACTACGCTTGTGGATATGCCCACCTTGCT
+GAAGGACCTGGAACAAGCGCGTGAACTGGGCTATACCGTAGATAAAGAAGAGCATGTTGTAGGTCTGAATTGCATAGCTTCAGCAATTTACGATGATGTC
+GGTAGTGTTGTTGCCGCTATCTCCATCTCCGGGCCTTCATCAAGACTGACAGAAGATCGTTTTGTCAGTCAGGGTGAGCTGGTCAGAGACACCGCCCGCG
+ATATCAGCACGGCGTTGGGACTGAAAGCACATCCATAATGTCTGTCGCATCCGCTCTGCGGAGCGGGTTTTGACAAAATTTGAAAGTTGGAAAAATTTTC
+CAATAAATAGAGGTAGGAATAAAATGGCAAAATGAGAGCCGTTGACGCGGCAATGTATGTGCTGGAGAAAGAAGGTATCACTACCGCCTTCGGTGTTCCG
+GGAGCTGCAATCAATCCGTTCTACTCAGCGATGCGTAAGCACGGCGGTATTCGTCACATTCTGGCGCGTCATGTGGAAGGTGCTTCGCACATGGCGGAAG
+GTTATACCCGCGCAACGGCAGGGAATATCGGCGTATGTCTGGGGACTTCCGGTCCTGCGGGCACGGACATGATCACCGCGCTCTATTCCGCTTCTGCTGA
+TTCCATTCCTATTCTGTGCATTACCGGCCAGGCACCGCGCGCCCGTCTGCATAAAGAAGATTTTCAGGCCGTAGATATTGAAGCAATTGCTAAACCGGTC
+AGCAAAATGGCGGTTACAGTTCGTGAAGCGGCGCTGGTGCCTCGCGTGCTGCAACAGGCATTTCACCTGATGCGTTCTGGTCGTCCGGGTCCGGTACTGG
+TGGATTTACCGTTCGACGTTCAGGTTGCGGAAATCGAGTTTGATCCTGACATGTACGAACCGCTGCCGGTCTACAAACCTGCTGCCAGCCGTATGCAGAT
+CGAAAAGCTGTAGAAATGTTAATCCAGGCCGAACGTCCGGTGATTGTTGCCGGGGCGGGGTAATTAATGCTGACGCAGCTGCACTGTTACAACAGTTTGC
+TGAACTGACCAGCGTTCCGGTGATCCCAACGCTAATGGGTGGGGCTGTATCCCGGACGATCATGAACTGATGGCCGGGATGGTGGGTCTGCAAACCGCGC
+ATCGTTACGGTAACGCAACGCTGCTGGCGTCTGACATGGTGTTTGGTATCGGTAACCGTTTTGCTAACCGTCATACCGGCTCGGTAGAGAAATACACCGA
+AGGGCGCAAAATCGTTCATATTGATATTGAGCCGACGCAAATTGGTCGCGTGCTGTGTCCGGATCTCGGTATTGTCTCTGATGCTAAAGCGGCGCTGACA
+CTGCTGGTTGAAGTGGCGCAGGAGATGCAAAAAGCGGGTCGTCTGCCGTGTCGTAAAGAATGGGTCGCCGACTGCCAGCAGCGTAAACGCACTTTGCTGC
+GCAAAACCCACTTCGACAACGTGCCGGTGAAACCGCAGCGCGTGTATGAAGAGATGAACAAAGCCTTTGGTCGCGATGTTTGTTATGTCACCACCATTGG
+TCTGTCACAAATCGCTGCGGCACAAATGCTGCATGTCTTTAAAGACCGCCACTGGATCAACTGTGGTCAGGCTGGTCCGTTAGGCTGGACGATTCCGGCT
+GCGCTAGGGTTTGTGCCGCTGATCCGAAACGCAATGTGGTGGCGATTTCTGGCGACTTTGACTTCCAGTTCCTGATTGAAGAGTTAGCTGTTGGCGCGCA
+GTTCAACATTCCGTACATCCATGTGCTGGTCAACAACGCTTATCTGGGGCTGATTCGTCAGTCACAACGCGCTTTTGACATGGACTACTGCGTGCAACTC
+GCTTTCGAGAATATCAACTCCAGTGAAGTGAATGGCTACGGTGTTGACCACGTAAAAGTAGCGGAAGGTTTAGGTTGTAAAGCTATTCGGGTCTTCAAAC
+CGGAAGATATTGCGCCAGCCTTTGAACAGGCGAAAGCCTTAATGGCGCAATATCGGGTACCGGTAGTCGTGGAAGTTATTCTCGAGCGTGTGACCAATAT
+TTCGATGGGCAGCGAACTGGATAACGTCATGGAATTTGAAGATATCGCCGATAACGCAGCGGACGCACCGACTGAAACCTGCTTCATGCACTATGAATAA
+GGAGATAAATAATGTTACGTTTCTCTGCTAATTTATCGATGTTATTTGGAGAATATGATTTTCTCGCCCGTTTTGAGAAAGCTGCGCAGTGTGGTTTTCG
+CGGCGTTGAATTTATGTTTCCTTATGACTACGACATTGAAGAATTAAAACATGTGCTGGCGAGTAATAAACTCGAACATACGCTGCACAATTTACCGGCG
+GGTGACTGGGCGGCGGGGAGCGCGGTATTGCCTGTATTCCTGGCCGTGAAGAAGAGTTTCGGGATGGCGTAGCAGCAGCGATTCGTTATGCCCGTGCGCT
+GGGTAATAAAAATTAACTGTCTGGTCGGTAAAACGCCGGCTGGTTTCAGCAGTGAACAGATTCACGCAACGCTTGTAGAAAACCTGCGTTATGCCGCGAA
+TATGCTGATGAAAGAAGATATTTTATTACTGATTGAACCTATTAACCATTTTGATATTCCTGGTTTCCATCTCACCGGAACTCGGCAGGCGCTGAAATTG
+ATTGATGATGTTGGTTGCTGCAATTTGAAAATTCAGTATGACATTTATCATATGCAGCGGATGGAAGGTGAATTAACCAACACCATGACTCAGTGGGCTG
+ATAAAATTGGTCACCTGCAAATTGCCGATAATCCGCATCGCGGCGAACCGGGAACCGGAGAAATTAATTATGATTATCTCTTTAAGGTAATCGAAAATTC
+TGACTACAACGGTTGGGTTGGGTGTGAATATAAACCCCAAACCACCACGGAAGCCGGTTTACGCTGGATGGATCCGTACCGTTAAAACGTAACGCTATTC
+AGACAATGCTTTTTAGGCCGCTAAGTTGGCAGGGGATCGTGTTGTCTGAATTCAGGAAAAGCGAAATTTAAAAGAGGTTAATTATGAAACTGGGATTTAT
+TGGCTTAGGCATTATGGGTACACCGATGGCCATTAATCTGGCGCGTGCCGGTCATCAATTACATGTCACGACCATTGGACCGGTTGCTGATGAATTACTG
+TCACTGGGTGCCGTCAGTGTTGAAACTGCTCGCCAGGTAACGGAAGCATCGGACATCATTTTATTATGGTGCCGGACACACCTCAGGTTGAAGAAGTTCT
+GTTCGGTGAAAATGGTTGTACCAAAGCCTCGCTGAAGGGCAAAACCATTGTTGATATGAGCTCCATTTCCCCGATTGAAACTAAGCGTTTCGCTCGTCAG
+GTGAATGAACTGGGCGGCGATTATCTCGATGCGCCAGTCTCCGGCGGTGAAATCGGTGCGCGTGAAGGACGTTGTCGATTATGGTTGGCGGTGATGAAGC
+GGTATTTGAACGTGTTAAACCGCTGTTTGAACTGCTCGGTAAAAATATCACCCTCGTGGGCGGTAACGGCGATGGTCAAACCTGCAAAGTGGCAAATCAG
+ATTATCGTGGCGCTCAATATTGAAGCGGTTTCTGAAGCCCTGCTATTTGCTTCAAAAGCCGGTGCGGACCCGGTACGTGTGCGCCAGGCGCTGATGGGCG
+GCTTTGCTTCCTCACGTATTCTGGAAGTTCATGGCGAGCGTATGATTAAACGCACCTTTAATCCGGGCTTCAAAATCGCTCTGCACCAGAAAGATCTCAA
+CCTGGCACTGCAAAGTGCGAAAGCACTTGCGCTGAACCTGCCAAACACTGCGACCTGCGAGGAGTTATTTAATACCTGTGCGGCAAACGGTGGCAGCCAG
+TTGGATCACTCTGCGTTAGTGCAGGCGCTGGAATTAATGGCTAACCATAAACTGGCCTGATACCCGCAATAAAATGGCCGATATCAGAAAATGAATCGGC
+CAGCAATATTAAAAAGAAAGCAGCCAAAGATGTTGCTTCAGTATTAAAAATAATATTTTTATTTTATTTGTTCCTCATAGCTAGATTAAAACAACGTTAT
+TCGATACGTGAAATTAAGAGGATTTATGGAACATCAGAGAAAACTATTCCAGCAACGCGGCTATAGCGAAGATCTATTGCCGAAAACGCAAAGCCAGCGG
+ACCTGGAAAACATTTAACTATTTTACCTTATGGATGGGTTCGGTTCATAACGTTCCCAATTATGTGATGGTCGGCGGCTTTTTATTCTCGGCTTGTCTAC
+CTTTAGTATTATGCTGGCAATTATCCTCAGCGCCTTTTCATTGCCGCGGTAATGGTATTAAACGGTGCTGCGGGCAGTAAATACGGTGTGCCTTTTGCCA
+TGATCCTGCGTGCTTCTTACGGTGTACGTGGTGCACTGTTTCCCGGATTATTAAGGGCGGAATTGCCGCCATCATGTGGTTTGGTTTGCAATGTTACGCG
+GGGTCACTGGCCTGCTTGATTCTGATTGGCAAAATCTGGCCGGGATTTTTAACTCTCGGTGGTGATTTCACTCTGTTAGGCCTTTCTCTACCGGGCTTAA
+TTACTTTCTTAATCTTCTGGCTGGTCAACGTTGGTATAGGTTTTGGCGGTGGCAAAGTTTTAAATAAATTCACTGCCATTCTTAACCCGTGCATCTATAT
+CGTTTTCGGCGGTATGGCGATTTGGGCGATTTCACTGGTCGGGATCGGTCCAATCTTTGACTACATTCCGAGCGGTATTCAGAAAGCAGAAAACGGTGGC
+TTCCTGTTCCTGGTGGTGATTAACGCGGTAGTTGCGGTCTGGGCGGCACCGGCGGTGAGCGCATCCGACTTTACGCAAAACGCCCACTCGTTTCGTGAGC
+AGGCGCTGGGGCAAACGCTGGGTTTAGTTGTGGCCTATATTCTGTTTGCGGTCGCCGGGGTATGTATTATTGCCGGAGCCAGTATTCACTACGGCGCTGA
+TACCTGGAACGTGCTGGATATTGTTCAGCGTTGGGACAGCCTGTTCGCCTCGTTCTTTGCGGTACTGGTTATTCTGATGACAACTATCTCCACTAACGCG
+ACCGGTAATATTATTCCAGCCGGTTATCAGATTGCCGCCATTGCACCGACAAAACTGACCTATAAAACGGCGTACTGATTGCCAGTATTATCAGCTTGCT
+GATCTGCCCGTGGAAATTAATGGAAAATCAGGACAGCATTTATCTTTTCCTCGATATTATCGGCGGAATGCTTGGTCCGGTAATTGGTGTCATGATGGCG
+CATTATTTTGTGGTGATGCGCGGACAAATTAATCTTGATGAACTGTATACCGCACCTGGCGATTATAAATATTACGATAACGGTTTTAACCTCACTGCGT
+TTTCAGTAACTCTGGTGGCCGTTATTTTATCTCTTGGCGGTAAGTTTATTCACTTTATGGAACCGTTATCGCGTGTTTCATGGTTTGTCGGCGTCATCGT
+CGCCTTTGCGGCCTACGCCTTATTAAAGAAACGTACAACAGCAGAAAAACAGGAGAGCAAAACCATAGGTTAATTAATCCCGATATTGAACATTGAGTTA
+AAACCAATCTGTATTTTACAAGGAGTTTGTTATGTCTTTTGATTTAATCATTAAAAACGGCACCGTTATTTTAGAAAACGAAGCTCGCGTTGTAGATATC
+GCCGTTAAAGGCGGAAAAATTGCTGCTATCGGTCAGGATCTGGGCGATGCAAAGAAGTTATGGATGCGTCTGGTCTGGTGGTTTCGCCGGGCATGGTTGA
+TGCGCACACCCATATTTCTGAACCGGGTCGTAGCCACTGGGAAGGTTATGAAACCGGTACTCGCGCAGCGGCAAAGGTGGTATCACCACCATGATCGAAA
+TGCCGCTCAACCAGCTGCCTGCAACGGTTGACCGCGCTTCAATTGAACTGAAGTTCGATGCCGCTAAAGGCAAGCTGACTATTGATGCGGCACAACTCGG
+TGGCCTGGTGTCTTACAACATCGACCGTCTGCATGAGCTGGATGAAGTGGGCGTTGTCGGCTTCAAATGCTTCGTTGCGACCTGTGGCGATCGCGGTATC
+GACAACGACTTCCGTGATGTAAACGACTGGCAGTTCTTCAAAGGTGCGCAGAAGCTGGGCGAACTGGGTCAGCCGGTGCTGGTGCACTGCGAAAACGCGC
+TGATTTGTGACGAACTGGGCGAAGAAGCGAAGCGTGAAGGTCGCGTAACCGCTCATGACTATGTGGCTTCGCGTCCGGTATTTACCGAAGTGGAAGCAAT
+TCGCCGCGTACTGTATCTGGCGAAAGTTGCTGGTTGCCGTCTGCACGTTTGCCACGTCAGCAGCCCGGAAGGTGTTGAGGAAGTGACTCGTGCACGTCAG
+GAAGGTCAGGACGTTACTTGTGAATCCTGCCCGCATTACTTTGTACTGGATACCGATCAGTTCGAAGAAATCGGTACTCTGGCGAAGTGTTCACCGCCGA
+TCCGCGATCTGGAAAACCAGAAAGGCATGTGGGAAAAACTGTTTAACGGTGAAATCGACTGCCTGGTTTCCGACCACTCTCCATGCCCGCCGGAAATGAA
+AGCCGGTAACATCATGAAAGCATGGGGCGGTATCGCCGGTCTGCAAAGCTGCATGGACGTGATGTTCGATGAAGCGGTACAGAAACGCGGTATGTCTCTG
+CCAATGTTCGGCAAATTAATGGCGACTAACGCAGCAGATATTTTCGGTCTGCAGCAAAAGGCCGTATCGCCCCAGGAAAGATGCCGACTTCGTCTTCATT
+CAGCCGAATAGCAGCTATGTTCTTACCAATGACGATCTGGAATATCGCCACAAAGTCAGCCCGTATGTTGGCCGTACCATTGGCGCGCGTATCACGAAAA
+CCATCTTACGTGGTGATGTGATTTACGACATTGAACAGGGCTTCCTGTTGCGCCGAAAGGTCAATTTATCCTTAAACATCAGCAGTAATCTGGCCCTGCA
+ATGCCCGTCCTTGCGGCGGGCATTCTCCGGTTAAGGTGTGTTTATGTTCAATTTTGCAGTCAGCCGCGAAAGCCTGTTATCAGGATTTCAGTGGTTTTCT
+TTATTTTTGCAACACGGTTGTGGTTCCTCCTACGCTACTTTCTGCTTTTCAGTTGCCGCAAAGTAGCCTGCTTACGCTCACGCAATATGCTTTTCTTGCT
+ACCGCACTGGCCTGCTTCGCTCAGGCGTTTTGCGGTCATCGTCGCGCTATTATGGAAGGGCCAGGTGGCCTGTGGTGGGGAACCATCCTTACTATCACCC
+TTGGTGAAGCATCGCGCGGGACACCGATCAACGATATCGCCACCAGCCTGGCAGTGGGGATTGCACTCTCCGGCGTGCTGACGATGTTGATTGGTTTTAG
+CGGATTAGGCCATCGCCTGGCACGGTTATTTACGCCGTCGGTGATGGTCTTGTTTATGTTGATGCTGGGCGCGCAGCTGACCACTATCTTTTCAAAGGTA
+TGCTCGGGCTGCCGTTTGGCATAGCCGACCCGAATTTTAAAATTCAGTTACCGCCGTTCGCGCTCTCGGTGGCGGTGATGTGCCTGGTACTGGCGATGAT
+TATCTTCCTGCCGCAACGTTTTGCCCGTTATGGCCTGCTGGTCGGCACCATAACCGGCTGGTTGTTGTGGTACTTTTGCTTTCCTTCTTCGCACTCGCTC
+TCCGGTGAGTTGCACTGGCAGTGGTTCCCGCTCGGCAGTGGCGGTGCTTTGTCGCCGGGAATTATTCTGACGGCGGTGATTACAGGTCTGGTAAATATCA
+GCAATACCTACGGTGCGATTCGGGGCACGGATGTTTTTATCCGCAGCAGGGCGCAGGGAATACGCGTTATCGTCGTAGCTTTGTGGCGACCGGATTTATG
+ACGCTGATAACCGTACCGCTGGCGGTAATTCCATTTTCACCGTTTGTTTCATCCATTGGTTTATTAACCCAGACTGGCGATTACACGCGGCGTTCGTTTA
+TTTATGGCAGCGTTATTTGCCTGCTGGTGGCGCTGGTTCCTGCACTCACGCGACTGTTTTGCAGTATCCCTTTACCCGTGAGTAGTGCGGTCATGCTGGT
+TTCTTATCTGCCTTTACTCTTTTCCGCGCTGGTGTTTAGCCAGCAAATAACGTTTACCGCTCGCAATATTTATCGACTCGCATTGCCGTTATTTGTCGGC
+ATATTTTTAATGGCATTACCGCCTGTGTATCTGCAAGACCTTCCATTAACGCTTCGTCCTCTGCTCAGTAACGGCTTATTGGTCGGGATTTTACTGGCTG
+TTCTTATGGATAACCTTATTCCGTGGGAACGCATCGAATAATTTGTTGAAAAGGATTGATAATGAAGATTGTCATTGCGCCAGACTCTTTTAAAGAGAGC
+TTAAGTGCAGAAAAATGTTGTCAGGCAATTAAAGCCGGGTTTTCGACCCTCTTTCCCGATGCGAACTATATCTGTTTGCCGATAGCGGATGGCGGCGAAG
+GGACGGTGGATGCGATGGTCGCCGCGACGGGCGGCAACATCGTGACGCTTGAAGTCTGCGGGCCGATGGGCGAAAAAGTGAATGCTTTTATGGCCTTACC
+GGCGACGGGAAAACGGCGGTGATTGAGATGGCGGCAGCAAGTGGCCTGATGCTGGTCGCGCCTGAAAAGCGTAATCCGTTGCTGGCCTCCAGTTTTGGTA
+CGGGGAGTTAATTCGTCATGCGCTGGATAACGACATTCGCCATATTATTCTCGGCATTGGCGGCAGTGCGACGGTCGACGGCGGTATGGGCATGGCGCAG
+GCGCTCGGTGTGCGTTTCCTTGATGCCGACGGTCAGGCGCTGGCGGCAAACGGTGGTAATTTAGCGCGCGTGGCAAGCATTGAGATGGATGAATGCGATC
+CGCGTCTGGCGAATTGCCATATTGAAGTAGCATGTGACGTTGATAACCCGCTGGTAGGGGCACGCGGCGCGGCGGCGGTGTTTGGCCCGCAAAAGGGGCA
+ACGCCGGAGATGGTCGAAGAACTTGAACAGGGCTGCAAAATTACGCCCGTGTTTTACAACAGCAAACTGAAATTAATGTCTGCCAGATGGCGGGCGGCGG
+CGCTGCGGGCGGTATGGGTATTGCGGCGGCGGTATTTCTCAATGCGGATATTAAACCGGGCATTGAAATTGTGTTGAATGCGGTCAATCTTGCGCAGGCA
+GTGCAGGGCGCAGCACTGGTGATTACCGGGGAAGGGCGCATCGACTCGCAAACGGCAGGCGGTAAAGCGCCGCTGGGTGTGGCGTCGGTGGCGAAGCAGT
+TTAATGTACCGGTGATTGGGATTGCTGGCGTATTGGGTGATGGCGTGGAAGTGGTGCACCAGTACGGCATTGACGCGGTATTCAGCATTTTGCCTCGTCT
+GGCACCTTTAGCCGAAGTGCTCGCCAGCGGTGAAACCAATCTCTTCAACAGCGCGCGAAATATTGCCTGCGCCATTAAAATAGGTCAGGGAATTAAAACT
+AACCCTTACCTTTAAAGCGGATGCGATTTATATCGCATAAGAGTGCAGTACTCATGCCGGATGCGGCATGAGTACCATATCCTTCCTGAAAATCGCGCAA
+ATTCTATATATTGCAGAGATCATGTAGGCCTGATAAGCGAAGCGCATCAGGCAATGTTAAAAAAGCCACGGTATAAACCGTGGCAAAATCCAACATAGCT
+AAAAATAATCAGGCGAGTGGTATGACTTAAATCTCTACGTCGCGGTTACAATCTTTCGAGTAAATATAGCTGAACGCTTCACCACGCCCTACACCATAAC
+CAGCCTGTAAAGAATAAGCGCCCATAAAGATGTAATCGCCTTTTTCACCGGGATCCAGTTATTGTCGAGGTTATAAACCCCTGACCGGAAAGAATATAGG
+CACCGTGTTCCTGAACGTGTGTTTCGATATAACCGTGGCTGGCACCTGGTGCAAAAGAGAGGATATGCATGTTCATATCAAAACCTAACTCTTTGGGCAG
+AAAATCCAGCAGAATAACATCGTCCATGCCTTCATAATGAATGCGTTCCAGTTCGCTGGCATTGCCAGAAACCAGCCACGGTGCATAGCCTTCTACCGGA
+ACATAGCGGCGCTTATATAAAAGATTTGGCTGTCTTCGGCCTGGGCGTTAACAAACGTCATTAAGGAGCCTGGCGGGCAATAAAGATAGCCACCTTCGCT
+TAAGGCAAATGTTTTGCCTTCGGCTTTGGCAGTGATATTTCCAGAGATCACATACAGGAACGTTTCAATGCCTTCGCCACCGAAGCCCTGTTGGTTGCCA
+CCGTTTTGATGCAGTGTGACCAGATAATCAACAAAAGAGGCACCCAGCTTTGGCGTGGAGAGGATTGTCGCGTCACAATTTTCAAAGCCCGGAATAATAT
+TTTTACCAGACCATCCGGGGTTAACAGTGCGAAATTACCGTGTTTAACAATCGCACGGTTAGCCAGTAAATCTTCGCGGTAACCGGTGACGTTATTTAAA
+TATCCCATTTATGACTCCTTATTTCTGCCAGGCAAGTTGATAAAGCATGAGTGCCAACGTTTTGACCCCTTCGGCAAGGTCGGTAATATTGGTGCGTTCC
+GCCGGGTTATGGCTGATCCCGTTGATGCTGGGGATAAAAATCATGCAGGTTGGTACGCGAGGCGCGAAAATTTGCGCGTCGTGCCCGGCACCACTGTGCA
+TCACCCGGTAATTCAGTTTTCTCTTTCACACAATTCTGTCAGGGTGGCGACCAGCTCCTTATTCATCGGCACGGGTTCTTCGTCCATCCATAAATCGATA
+TCAATACCAATGTCCATTTCATCGCAAATCGCCCGCATGTCGTTTTCTAACTGTTGGGTGAAATCGCGCAGCACGGCAGCGTCGGTATGACGACAATCAA
+TGGTGAACGTGGTTTTACCCGGCACCACATTTACCGTATTCGGGCGCGGCTCTACTTTGCCAAAGGTCAGAACCAGCGGATCGCCCATCCTTTTCGCTTT
+TTCGACCGACTGATGGCAAATGCGACTGAAAGCGTAAACTGTATCACGACGATAACCCATCGGCGTGGTGCCTGCATGGTTTGATTCGCCGTTCAGCGTT
+ACCGTATAACGACGCTGCCCGACAATTGCATTCACCACGCCAATTGATTGCCCATTACTTTCCAGCACACAGCCCTGTTCAATATGCAGTTCAACAAAGG
+CTTTAATATCCTGACGCGGAGTTAGTGGGGCGTTCGGAAGAGTAAATCCGCAAGCCTTCATCGCATCGACAAAACTATTTCCTTTGGCATCACAGATATT
+CCGCACGTCGTCAGGATTCGCCAGCCCAAAATATTTTACTGCCCCAGAAGACATACGGGAAGCGGCTGCCTTCTTCTTCTGCCATCGCCACCACTTCGAC
+CGTACGTAGCGGCGCGCCGTATTGCGTTTTCAGCCAGTCAATTGCCAGCCACGCCGCCAGCGCGCCGAATTGCCCGTCAAGGTTACCGCCGTTAACCACG
+GTATCGATATGCGAACCGCTCAGAACCACTTCCTGTGGATATTCGGTGCCATTCAGGCGACCGTATAAATTCCCACTTCATCGAAACGTGTTTCCAGCCC
+GCTTGCTGCCATTCTTTTTAAATTGCTGCTGGGTTTCCAGCCATTCCGGCGAATAAAGTAAACGGGTCATCCCACCCGCTGGGTCAGCGCCAAAAGAGGA
+AAGCCAGGGCAGCGTTTCTTCTATAGCTTGACGGAAATGTGTAATCATAAGAAAGTCCTGTCTCAATAATTATTGCGCAAAGGGATTTTTCGTTTCGTAT
+GACGTGTTATAAAGCGCGTCGGAAATTAAATACTGGTAAATATCATCAACAATTTCGATGCCTTCGACGGCGGCTTTGCGTTGTTTAATATCCTGATCCT
+GTCCGGGATAATAAACCTGATTAAAACCGGGCGCGGGGTAATGGCATTTAATTCGCGCATGGTCTGGCTAAGATGTTGACGGAATAATTCGCTGGAGGAG
+AAAAAGTTCGGATTAATAACTATATGTAATTGCCCCAAATTACGCCCTGCGTGTAAATCGTCATACATCGAACTAACCTGTCGCCCGAACGGTAAGCCGA
+GTAAGACGCCTGAGAGGACGTCAATCATCATCATCAGGCCATACCCTTTTGGCCCGGCGGCGGGGAGCAGAGCATGTACCGCGAACGGATCGGTTGTTGG
+TACACCGTTTTTATCGACCGCCCAGGTATCCGGGATAGACATATTACGCGAGCGGGCGTCGAGCACTTTTCCCCATGCCTGTACGGTAGTCGCCATATCA
+AAGGTAAGGATCTCGTCGCCTTCTCCCGGCGCGGCAAAGGCCAGGGGTTAGTACCGTAGTAAATTTCCGCGCCGCCAAACGGCACCACCATTGGATCGGA
+CTGGCACATCGAAATGCCAATGAATCCGGCGCGGGCTGCCTGCTGCACAAAATAAGAGATTGCGCCGCTGTGACCCATCCGGCTGATACCGACCACCGCA
+ACGCCATTTTGCTGGGCGGTTTTGATGGCATGTTCCATACCCATTTTCGCCGCGACCTGTCCGGCGGCATTGTCGGCATGTAAAATTGCCGAGCACGGCC
+CGGTTTCCTCAAGACGAAACTCCGGTTCGCGGTTGGTGCCGCCTTTTGAAATGCGTTCCGCGTAGTATTCCACGCGCACCGCGCCATGAGAGTGGATCCT
+CTGGCATCGGCGTAAACCAATACTTCAGCCACGGTTGCAGCGTGCTCACGTTTTAACCCAGCCTGGCAGAGTTTATTCTCAATTAGCTGGTGGAGTGTTT
+CCCGACTGATTTTCATCTGTCTTCCTTTTTAACGACGGTGTGAAGCATGACTGCAATTAACATACAGGAAAATATCTGGATTATGTGATCCAGACAGGCA
+AAAAATATAGTTAGAATTTATTTGATAATCCGCTCACTTTTAACCTGATTTTTAAAACAACAACGCTTATTAAAAATAATGAGTAATAGCCTGGTGGTTA
+TTTGAATTCTTTTGTTAATAATTCCTGTGTGATATTCATCACCTTATTTACTCGTTGTCATCGATACCGTAATCGCCACATTAACACTGCTCGTGCAATT
+GCCATGGGTGCAATTTTTAAGGAGTTGTTATGATCCACGCCTTTATTAAAAAGGGTGTTTTCAGGATTCGGTCAGTTTAATGATTATTTCACGAAAACTC
+AGCGAATCAGAAAATGTTGATGATGTTTCCGTAATGATGGGTACGCCCGCCAATAAAGCGTTATTAGATACCACAGGTTTCTGGCATGACGATTTTAATA
+ACGCCACGCCGAACGATATTTGCGTGGCAATTCGTAGCGAAGCGGCGGATGCGGGGATCGCGCAGGCGATTATGCAGCAGCTTGAAGAGGCGCTAAAACA
+ACTGGCGCAGGGTCAGGCAGCAGCCAGGCGTTGACGCAGGTGCGTCGCTGGGACAGTGCCTGTCAGAAATTACCCGATGCCAATCTGGCGCTGATTTCAG
+TGGCTGGCGAGTATGCGGCGGAGCTGGCAAACCAGGCGCTGGATCGCAACCTCAACGTGATGATGTTCTCCGATAACGTCACGCTGGAAGATGAAATCAA
+CTTAAAACCCGCGCGCGGGAAAAGGCTTGCTGGTGATGGGGCCGGACTGCGGTACGTCGATGATTGCCGGCACACCGCTGGCTTTGCTAACGTGATGCCG
+GAAGGCAATATTGGCGTCATTGGCGCTTCCGGTACCGGGATTCAGGAGCTGTGTTCGCAGATTGCGCTGGCAGGGAGGAATTACTCACGCGATTGGCCTT
+GGCGGGCGCGACCTCAGCCGTGAAGTGGGCGGCATCAGTGCGCTAACAGCGCTGGAAATGCTCAGTGCAGACGAGAAAAGCGAAGTGCTGGCATTTGTTT
+CAAAACCACCTGCCGAAGCTGTGCGTCTGAAAATTGTTAATGCCATGAAAGCAACCGGCAAACCGACGGTGGCGCTGTTTTAGGTTATACCCGGCGGTGG
+CCCGCGACGAGAATGTCTGGTTTGCCTCCTCGCTGGATGAGGCCGCACGCCTGGCTTGCCTGCTTTCACGCGTCACGGCGCGACGTAACGCAATAGCGCC
+TGTCAGCAGCGGATTTATTTGCGGTTTGTATACCGGCGGTACGCTGGCTGCCGAAGCGGCGGGATTACTTGCCGGACACCTTGGCGTGGAAGCCGACGAT
+ACCCATCAACATGGCATGATGCTGGACGCCGATAGCCACCAGATTATTGACCTCGGCGATGATTTCTACACCGTCGGGCGTCCCCATCCGATGATCGACC
+CAACCTTACGCAACCAGTTAATTGCCGATCTCGGCGCTAAACCGCAAGTGCGCGTGTTGCTGCTTGATGTCGTGATTGGCTTCGGTGCGACCGCCGATCC
+TGCCGCCTCGCTGGTGAGCGCCTGGCAAAAAGCCTGTGCCGCGCGTTTAGATAATCAACCACTGTATGCCATTGCCACGGTGACAGGCACTGAACGTGAC
+CCGCAATGCCGCTCGCAGCAAATCGCCACGCTGGAAGATGCGGGGATTGCGGTCGTGAGTTCGCTACCGGAAGCCACCTTGCTGGCGGCAGCGTTAATTC
+ATCCGCTCTCGCCTGCCGCACAGCAACACACACCGTCATTACTGGAAAACGTCGCCGTGATTAACATCGGATTACGCAGCTTTGCGCTGGAGCTACAAAG
+CGCCAGCAAACCGGTTGTGCATTACCAATGGTCGCCAGTCGCCGGTGGCAATAAAAACTGGCTCGTTTATTAGAACGTTTGCAATAAGGGGTTCCCATGT
+TTACATCAGTGGCGCAAGCCAATGCTGCGGTTATCGAACAAATTCGTCGCGCTCGTCCACACTGGCTGGATGTGCAACCGGCTTCTTCACTTATCAGCGA
+ACTAAACGAGGGCAAAACACTGCTTCACGCCGGGCCGCCAATGCGCTGGCAGGAGATGACCGGACCCATGAAAGGGGCGTGCGTGGGCGCATGTCTGTTC
+GAAGGTTGGGCGAAAGATGAAGCGCAGGCGCTGGCAATACTGGAGCAGGGGAAGTGAACTTCATTCCTTGTCACCATGTGAATGCCGTCGGGCCAATGGG
+CGGTATTACTTCTGCCAGTATGCCGATGCTGGTGGTTGAGAACGTGACCGACGGCAACCGGGCGTACTGCAACCTCAACGAAGGTATCGGCAAAGTGATG
+CGTTTTGGCGCTTACGGCGAAGATGTCCTGACTCGCCATCGCTGGATGCGCGATGTGTTAATGCCAGTATTAAGCGCGGCGCTGGGGCGCATGGAGCGCG
+GTATCGATCTCACGGCGATGATGGCGCAGGGCATTACGATGGGCGATGAGTTCCATCAACGCAATATTGCTTCCTCTGCACTGTTAATGCGTGCGCTGGC
+CCCACAAATTGCTCGCCTCGATCATGATAAACAGCACATCGCCGAAGTGATGGATTTCCTCAGCGTGACCGATCAGTTCTTCCTCAACCTCGCGATGGCT
+TACTGCAAGGCGGCGATGGATGCTGGCGCGATGATCCGCGCAGGCAGCATCGTCACGGCAATGACCCGCAACGGCAATATGTTCGGGATTCGGGTAAGCG
+GGCTGGGCGAACGCTGGTTTACTGCGCCTGTAAACACTCCGCAAGGTCTGTTTTCACCGGCTTCTCGCAGGAGCAGGCGAACCCGGATATGGGCGATAGC
+GCGATTACCGAAACCTTTGGTATCGGAGGTGCGGCAATGATCGCAGCGCCTGGCGTAACGCGCTTTGTCGGTGCGGGTGGCATGGAAGCGGCAAGAGCGG
+TATCTGAAGAGATGGCGGAAATTTACCTTGAACGCAATATGCAGTTGCAGATCCCAAGCTGGGATTTTCAGGGCGCGTGCCTGGGGCTGGACATTCGTCG
+CGTGGTAGAAACCGGCATTACGCCACTCATCAATACCGGTATCGCCCATAAAGAGGCGGGGATCGGGCAGATTGGCGCAGGCACCGTGCGGGCACCGCTG
+GCGTGCTTTGAACAGGCGCTGGAAGCACTGGCTGAAAGCATGGGTATTGGTTGAGGAACGCGCAATGACGATCATCCATCCTCTGCTTGCCAGTAGTAGC
+GCACCGAATTATCGCCAGTCCTGGCGGTTAGCGGGAGTGTGGCGGCGGGCGATTAACCTGATGACGGAAAGCGGCGAACTGTTAACGTTGCATCGTCAGG
+GTAGTGGTTTCGGCCCCGGAGGATGGGTGCTTCGCCGTGCGCAATTCGATGCGTTATGCGGTGGATTATGCGGCAATGAACGACCACAGGTTGTGGCTCA
+AGGATTCGCCTCGGGCGTTTCACGGTTAAACAGCCACAGCGTTATTGTTTGCTGCGTATTACGCCGCCTGCGCATCCTCAACCACTTGCAGCTGCATGGA
+TGCAACGCGCGGAGGAAACCGGGCTTTTCGGGCCACTGGCGTTGGCGGCAAGCGATCCGCTGCCTGCTGAGTTACGCCAGTTTCGTCACTGTTTTCAGGC
+CGCGCTCAATGGCGTTAAGACCGACTGGCGGCACTGGCTGGGTAAAGGCCCCGGATTAACGCCGAGTCATGATGACACGCTGAGCGGAATGCTGCTGGCG
+GCCTGGTATTATGGCGCTTTAGATGCGCGCTCCGGTCGTCCGTTTTTGCCTGTTCCGACAATCTGCAACTCGTTACCACAGCGGTGAGCGTCAGTTATTT
+ACGTTATGCCGCGCAAGGATATTTCGCCTCGCCACTCCTGCACTTTGTTCATGCTCTGAGTTGCCCGAAACGTACCGCTGTTGCGATTGATTCGCTGCTG
+GCGCTGGGGCATACGTCAGGGGCAGATACGCTGCTGGGGTTCTGGCTTGGCCAACAATTATTACAAGGAAAACCATGAAAACACTGGTTGTGGCTCTTGG
+GGCAACGCCTTACTCCAGCGCGGTGAGGCGCTGACGGCAGAAAATCAATATCGCAATATCGCCAGTGCTGTACCCGCGCTGGCACGCCTGGCCCGTTCTT
+ATCGGTTGGCGATTGTTCACGGCAACGGGCCGCAGGTGGGGCTGCTGGCATTGCAGAATCTGGCGTGGAAAGAGGTAGAACCGTATCCGCTGGATGTGCT
+GGTTGCGGAAAGCCAGGGGATGATTGGCTATATGCTGGCGCAGAGTTTGAGCGCACAGCCGCAGATGCCGCCCGTGACGACGGTGCTGACGCGCATTGAG
+GTTTCGCCTGATGATCCGGCGTTTTGCAGCCAGAGAAATTTATTGGTCCGGTTTATCAGCCAGAAGAACAAGAGGCACTGGAAGCGGCTTACGGCTGGCA
+GATGAAACGTGATGGTAAATATTTGCGCCGGGTGGTGGCGTCTCCGCAACCGCGTAAAATTCTCGACAGCGAAGCCATCGAGTTGTTGCTCAAAGAGGGC
+ATGTGGTGATTTGCAGTGGCGGCGGCGGTGTGCCTGTGACGGATGACGGAGCAGGAGTGAAGCAGTGATTGATAAAGATCTCGCCGCTGCGTTGCTCGCC
+GAGCAGATTAATGCAGATGGACTGGTGATCCTCACCGATGCTGATGCGGTATATGAAAACTGGGGAACGCCGCAGCAACGTGCCATTCGCCATGCCACAC
+CGGATGAGTTAGCGCCATTTGCCAAAGCCGATGGTTCGATGGGGCCGAATGTAACGGCGGTGAGTGGTTATGTCAGAAGCCGTGGTAAACCCGCGTGGAT
+TGGGGCGTTATCGCGAATTGAAGAGACGCTGGCGGGCGAAGCGGGGACCTGTATTTCGCTGTAGTCGTAGGCATTAGACATTTGTGCCTGATGCGACGCT
+TGACGCGTCTTATCAGGCCTACAACCGGTGCCGCATCCGGCAATTGGTGCACAATGCCTGATGCGATGCTTGACGCATCTTATCAGGCCTACAATGGGTA
+CCGGATCGGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCAAGAATAGAGCACCAGTTAACCGAACTTACTCTGCGCCCAAATCACGCCGCTGGCATA
+TTCCGGCGGCAGCAGCAGGATTAAGGCTTCCAGCGTCGCAGTCAGACGCGATGTGTCGCTGTCGGTCAAATTCAGATGCCCCACTTTACGCCCCGGACGG
+ACTTCTTTGTCGTACCAGTGCAGATGCACCAGCGGCAGTTTCAGCCAGTCATAATTCACATCGCTACCAATCAGATTGATCATCACCGACGGATTATTCA
+CCACTGGTTGCGGTAACGGCAGATCGGTAATCGCCCGCAGATGCAGCTCAAACTGGCTGATGCTGGCACCGTTTTGTGTCCAGTGACCGCTGTTATGCAC
+ACGCGGTGCCAGTTCGTTGATCAACAGACCTTGCGGGGTGACAAAACACTCCATCGCCATCACGCCCACATAGCCCAGCTCCTGCATAATCGCCGACAGC
+ATCTCTTCGGCTTGCGCCTGCTGCTGTGCGTTGGCCTGCGGAAAAGCGACGCTGGTGCGCAAAATACCGTCCTGATGCAGGTTATGCGTCAGCGGATAAA
+ACACGGTGCTGCCATCAAAGCCGCGCGCGCCAACCAGCGACACTTCACCAGAGAAGTTAATGCCCTGCTCGACAATACATTCGCCGTAACACTCTGCCGG
+TAACTGTTCGGTTTCATTTGCGCGTAAACGCCATTGACCGCGACCGTCATAACCACCAGTGCGACGCTTAACAATCGCCAGCTCACCTAAACGATCAAAC
+ACCGCAGGCCACTCGCTGCGTTCGGCAAGTAACTGCCACGGTGCAGTCGGCAGGTGGAGCTTATCGAAAAGCTGCTTCTGAGTCAGACGGTCAGCAATAA
+TCGGGAACACATCGCGGTTCACAAAGGCCGGATGGCGCGCCAGCTCGCGGGTTAATGCGGTTTCCGGCCAGCGTTCTATCTCAGCGGTAATCACGCTTTG
+TTGAAAAGGCACCGCCGCCGGTTCAGCGTCCAGCCCGACTGGCCAGACAGCAATGCCTAACGGTTCGCCTGCCTGACGCAGCATACGGCCTAACTGCCCG
+TTACCGAGGACGCAAACCTGTTTCATGCCGCACCTCGCGGGTCCGGGTTTTCCAGCACTTCGTCGGTCTGGGCTTTGCGCCAGTCATTCAGACGCTGGTG
+CAGTTCTTTATCATGAGTCGCAAGAATTTGTGCTGCCAGTAACGCCGCGTTTGCCGCGCCAGCTTTACCAATCGCCAGCGTACCCACCGGAATGCCGCGC
+GGCATTTGTACGATGGAGTAGAGGCTATCGACACCGCTCAGTGCGGCGCTCTGTACTGGCACGCCCAGCACCGGCACCAGCGTTTTGGCGGCAATCATGC
+CTGGCAGATGCGCTGCGCCGCCTGCGCCCGCAATAATCACCTGATAACCGTTCTCTTCGGCGCTTTCGGCGAAGCTGAACAGTTTATCGGGGTGCGGTGA
+GCAGAAACCACTTCAACGTGGTGCGGGACATTCAGGATTTCGAAGATTTCGGCGGCGAACTGCATGGTAGCCCAGTCGCTTTTGGACCCCATCACGATGG
+CGACACGCGCCGGATTATTGCGGGAAGACATGCGTCTTAAAACTCCTGTGGTGCACAACTCTCGGCTTTAGAGGGCACAGAGAATAGCACGGAAAGAGAG
+CAAGGAAAACGGTTGCGTGGCTGTGAAATCAGCAAAGTTGCGGGTTTTTAAAACGGAAAATGAATCAGCTCAACGTCATCCGCCGTGACTTTCACCATTG
+AACCTTCCGTATGCCAGGCACCCAGTACCACGCGAAAAGCAGGTTGCTGATTGGCGATAAGTTCATGCACCGCCGGGCGATGGGTATGCCCGTGGATCAG
+CCATTGCACCTGATGTTTTTCCATCGCACTGACCACCGCGTTTTGGTTAACGTCCATGATCGCCAGCGATTTACTGCTGTTGGCTTCTTTGCTGTTCGCG
+CGCATTCGCGCGGCAATGCGTTTGCGCACAAACAACGGCAGGGCGAGGAATAGCGTCTGCAGCCAGGGTTTGTGGACCTTGGCGCGAAAAGCCTGATAAC
+CCGCGTCATCGGTGCACAGCGTGTCGCCATGCATAATCAACACCCGGCGACCATAAAGTTCGAGCACCTTTTCTTCCGGCAATAACGTCATGCCACTTTC
+ACGGGCAAAGCGTTTGCCGAGCAGAAAATCACGGTTGCCATGAATGAAATAACAGGGAACGCCGGAATCGGACACCGCTTTGATCGCCGCCGCCATCTTG
+CGATGGAGTGGGTTGGGATCGTCGTCGCCAATCCATGCTTCAAACAGATCGCCAAGAATATACAGCGCGTCGGCCTTGCGGGCTTCCCCGCTAAAAACGC
+AGAAAACCGGCGGTGATCGCCGGTTCTTCCACGCAGAGATGAAGATCTGCAATAAAGAGTGTCGCCACGATTACTCGCTAACGGTCACGCTTTCAATGAT
+AACGTCTTCTTTTGGCACGTCCTGGTGCATACCGCTACGACCGGTTGCAACACCTTTGATTTTGTCTACCACGTCCATGCCGTCAACCACTTCAGCAAAC
+ACGCAGTAGCCCCAACCTTGCAGGCTTTCGCCAGAGAAGTTCAGGAAGTCGTTATCAACCACGTTGATGAAGAACTGTGCAGTTGCAGAGTGCGGAGCCT
+GAGTACGTGCCATTGCCAGCGTACCACGGGTATTTTCAGGCCGTTGTTGGCTTCGTTTTGATCGGTTCTTTGGTGGCTTTTGTTTCATGCCCGGTTCAAA
+ACCGCCGCCCTGAATCATAAAGCCGTTGATAACACGGTGGAAAATGGTGTTGTTGTAAAACCTTCGCGGCAGTAGTCCAGGAAGTTTTAACTGTTTCAGG
+TGCTTTATCGTCAAAAGTTTTGATGACAATATCGCCGTGATTGGTGTGGAAAGTAACCATTTTGCATCCTGTTCCGTTTGATTGGTGCTTCAACCCAGTT
+CGGGTCATATATAGGGTGGTGTTATAGCATAACCGCACGATCGGATCATCACGCAATGTATGCTGATTCGCGCGGGAAATATGGGTATTATACGCAACTC
+AATTACCCACACATGTCTAAACGGAATCTTCGATGCTAAAATCTTCAATACTCTGACACGCCAAAAGAGGAATTTAAGCCTATTCACGCCGGGGAAGTCG
+GCATGTACGTGTGTGGAATCACCGTTTACGATCTCTGTCATATCGGTCACGGGCGTACCTTTGTTGCTTTTGACGTGGTTGCGCGCTATCTGCGTTTCCT
+CGGCTATAAACTGAAGTATGTGCGCAACATTACCGATATCGACGACAAAATCATCAAACGCGCCAATGAAAATGGCGAAAGCTTTGTGGCGATGGTGGAT
+CGCATGATCGCCGAAATGCACAAAGATTTTGATGCTTTGAACATTCTGCGCCCGGATATGGAGCCGCGCGCGACGCACCATATCGCAGAAATTATTGAAC
+TCACTGAACAACTGATCGCCAAAGGTCACGCTTATGTGGCGGACAACGGCGACGTGATGTTCGACGTCCCGACCGATCCAACTTATGGCGTGCTGTCGCG
+TCAGGATCTCGACCAGCTGCAGGCAGGCGCGCGCGTTGACGTGGTCGACGACAAACGCAACCCAATGGACTTCGTTCTGTGGAAGATGTCGAAAGAGGGC
+GAACCGAGCTGGCCGTCTCCGTGGGGCGCGGGTCGTCCTGGCTGGCACATTGAATGTTCGGCAATGAACTGCAAGCAGCTGGGTAACCACTTTGATATCC
+ACGGCGGCGGTTCAGACCTGATGTTCCCGCACCACGAAAACGAAATCGCGCAGTCCACCTGTGCCCATGATGGTCAGTATGTGAACTACTGGATGCACTC
+GGGGATGGTGATGGTTGACCGCGAGAAGATGTCCAAATCGCTGGGTAACTTCTTTACCGTGCGCGATGTGCTGAAATACTACGACGCGGAAACCGTGCGT
+TACTTCCTGATGTCGGGCCACTATCGCAGCCAGTTGAACTACAGCGAAGAGAACCTGAAGCAGGCGCGTGCGGCGCTGGAGCGTCTCTACACTGCGCTGC
+GCGGCACAGATAAAACCGTTGCGCCTGCCGGTGGCGAAGCGTTTGAAGCGCGCTTTATTGAAGCGATGGACGACGATTTCAACACCCGGAAGCCTATTCC
+GTACTGTTTGATATGGCGCGTGAAGTAAACCGTCTGAAAGCAGAAGATATGGCAGCGGCGAATGCAATGGCATCTCACCTGCGTAAACTTTCCGCTGTAT
+TGGGCCTGCTGGAGCAAGAACCGGAAGCGTTCCTGCAAAGCGGCGCGCAGGCAGACGACAGCGAAGTGGCTGAGATTGAAGCGTTAATTCAACAGCGTCT
+GGATGCCCGTAAAGCGAAAGACTGGGCGGCGGCGGATGCGGCGCGTGATCGTCTTAACGAGATGGGGATCGTGCTGGAAGATGGCCCGCAAGGGACCACC
+TGGCGTCGTAAGTAATTGCGCTATTGCCGGATGCGAGTTTTCGCATCCGGTTATCGTCTGCGCCACCACAACATTCCCATCAGTAGCATCCCCGGCAACC
+ACACCCACATCAATTCAGAAATAATCACCTGATGCCCGTACGGCGTGGTGTAACGAGACAATGCAAACGGCGCGACTTTTATCACCTGCCAGGGAGCGAA
+AAAGCGTTCATCTGACCACGGCCACAGCCAGCCAACGCCTTTACCGCCAGTGGTTACCGAATCCAGCAAGCTGTGCGATAGCAACGAGACGGTTAAAACA
+GCCAGCAGCGAATCAGCCCAGCCCTGAACCATCGGCGTCCAATAAACACACATAACAGCGGGACAACAAACGCAAACACCAGCGAATGGGTAAACCCGCG
+ATGACCAAAAACATTGCCGTAAGCAACGCCAAATTTAAACGACAATACGTCGGCGTCGGGCAGCATCGCCAGGATGATTCCGGCAAATAACAGACGCGGA
+GGGATGACTTTCGAACCCAACCCTAAACCAATGCATAGGGGAACGGCGGCGTGCGTAATAACGGTTGGCATGATGGTCGCTTCGGCAAAATGTCGATGCT
+ATCAGCATGGATGAACGGGGCGTAGAGGGCAAAAGTCTGAAGAGAACCGGCCTGTTGATACAGGCCGGGAAAGGATCAGGCAACAACCTGTACGCTGTGA
+CCTGCAAAACTCACTGTCTGACCGGCGACGATTTTGCAGCGTTTGCGCGTTTCAACCGCACCGTCGACTTTCACCTGGCCTTCGGCAATCGCGATTTTCG
+CCTGCGCGCCGCTTTCGCTCCAGCCTTCCAGTTTCAGCAAGTCGCACAGCTCAACGTGCGGATGTTTACCTAAAGAAAATGTCGCCATGTTACTCATCCT
+GTGGATCATGATATTCAACGCACGCCTGTAGCGTGTTTTCAATCAGCGTGGCAACCGTCATCGGGCCAACGCCGCCGGGAACAGGCGTAATGTATGAGGC
+GCGTTTAGCCGCGTCTTCAAACACGACGTCGCCCACAACTTTGCCATTTTCCAGACGGTTGATGCCGACATCAATCACAATTGCGCCTTCTTTGATCCAG
+TCACCGGGAATAAAGCCTGGCTTGCCAACGGCAACGATCAATAGATCGGCATTTTCTACGTGATGACGCAGATTTTTAGTGAAGCGGTGAGTCACTGTAG
+TGGTGCAACCTGCCAGCAGCAGTTCCATGCTCATCGGGCGGCCAACGATATTCGATGCGCCAATCACCACGGCGTTGAGGCCGAAGGTATCAATGTTGTA
+ACGCTCAAGCAGCGTGACGATACCGCGCGGGGTGCAGGGACGCAGACGCGGCGCGCGCTGGCACAGACGACCGACGTTGTAAGGATGGAAACCGTCCACG
+TCTTTGTCCGGATGAATACGTTCCAGCACTTTGACGTTATCAATACCCGCCGGTAACGGCAGTTGAACCAGAATGCCATCGATGGTGTTGTCGGCATTCA
+GCGTATCGATAAGCTCCAGCAGCTCCGCTTCGCTGGTGGTTTCCGGAGGTCATAAGAGCGGAGACGAACCCGACTTCTTCACAAGCCTTGCGTTTGCTTG
+CGACATAAATTTGCGATGCAGGGTTACTACCCACCAGCACAACGGCCAGTCCTGGTGCCCGCAGTCCGGCTGCAATACGCGCCTGAACTTTTGAGCAACT
+TCAGAGCGCACCTGCTGCGCAATCGTTTTACCGTCAATAATCTTTGCTGCCATCAGAGAGGATTCCATCTGTTACGTAGATCGAAGGGATGCGCCTATTT
+TGTCAGAAGCGGGGCGCGCTGTCAGGTTTCGTTTCAGATTTATCGCGTGAAGCGACCTCTTGCGAAGGTGAGGCGCACCGTCGCTGAGACTGAAAGCTTC
+ATTTTCGTCCATGATGGCGTTGTAAATCTGGAACTGATTTATTTCCTTGTCTAAGGATTAAGATAATTTAAGAAATACCTGACAATATAAAAAGAATTTT
+CAGCCTGGTAATTTACCGCTTCAGGTCTATATTTGTGTTGAATATATTTTGCGCGGAAGTATTCATCTAACGGGGCTCTCTATTTTTAGAATAGAGTGCA
+TATTTTCAATTAAGACATTCTTAGAGGATAAAAGGAATTTACTACTATCAGTGTCTTAAATAAAGTAATCGGTTATATACGGATGTGGAGTCGATAAATG
+AGATTGAAGGAATATATATGAAATTAAGATTTATTTCGTCTGCGCTGGCTGCCGCACTATTCGCCGCTACGGGTAGTTATGCTGCCGTTGTAGATGGCGG
+TACAATTCACTTTGAAGGCGAACTGGTGAATGCTGCCTGTTCAGTGAATACTGACTCGGCAGACCAGGTTGTCACACTCGGTCAATATCGTACCGATATT
+TTCAATGCTGTTGGTAATACCTCTGCATTAATTCCATTCACCATTCAGTTGAACGACTGCGATCCTGTTGTTGCCGCTAATGCTGCCGTTGCATTTTCTG
+GTCAGGCTGATGCAATCAATGATAATTTATTGGCCATTGCATCCAGTACCAATACAACAACAGCAACGGGTGTCGGTATTGAAATACTTGATAATACATC
+CGCAATTCTCAAACCTGATGGGAATAGCTTCTCAACCAACCAGAACTTGATCCCCGGGACCAACGTTCTTCATTTTCTGCACGTTATAAAGGCACCGGTA
+CAAGTGCATCAGCAGGGCAAGCAAATGCTGACGCGACTTTTATTATGAGATATGAATAATCAAAACCACGTTGTTTTGAATTATATATCACGTCTTATAA
+CAAAGTAATGTACCGGTTGTCTGAAGCGGTATGGTGGCAATGTAAATCGAAATCATGTTCACTTTGTATCATGCCGCTTTATTAAATGAAAAGGGAATGA
+TGTGTTGTAAGAAACCAAAGCAATCATTTCTTTATATTCCTTATTTTGCCGTCAGGAATACACAAGGCGTATTAACTATGATGACTAAAATAAAGTTATT
+GATGCTCATTATATTTTATTTAATCATTTCGGCCAGCGCCCATGCTGCCGGAGGGATCGCATTAGGTGCCACGCGTATTATTTATCCCGCTGATGCTAAA
+CAGACTGCGGTATGGATTAGAAATAGCCATACCAATGAGCGCTTTCTGGTCAATTCGTGGATTGAAAACAGCAGCGGTGTAAAGAAAAGTCATTCATCAT
+TACACCGCCACTGTTTGTTAGTGAACCCAAAAGCGAAAATACTTTGCGTATTATTTACACCGGTCCACCGCTGGCAGCAGATCGTGAGTCTCTGTTCTGG
+ATGAATGTTAAGACGATCCTTCGGTAGATAAAAATGCATTGAACGGCAGGAATGTTTTGCAACTGGCGATTTTATCGCGCATGAAATTATTTCTCCGTCC
+AATTCAATTACAAGAATTACCCGCAGAAGCGCCGGACACACTCAAGTTTTCGCGATCCGGTAACTATATCAATGTTCATAATCCATCACCTTTTATGTCA
+CCCTGGTTAACTTACAAGTGGGCAGCCAAAAGTTGGGGAATGCTATGGCTGCACCCAGAGTTAATTCACAAATTCCCTTACCCTCAGGAGTGCAGGGAAA
+GCTGAAATTTCAGACCGTTAATGATTATGGTTCAGTAACTCCGGTCAGAGAAGTGAACTTAAACTAACCGAATCATCTGACAATATCAGAGCTAATTATG
+AAAATACCCACTACTACGGATATTCCGCAGAGGTATACCTGGTGTCTGGCCGGAATTTGTTATTCATCTCTTGCCATTTTACCCTCCTTTTAAGCTATGC
+GGAAAGTTATTTCAACCCGGCATTTTTATTAGAGAATGGCACATCCGTTGCTGATTTATCGCGCTTTGAGAGGTAATCATCAACCTGCGGGCGTGTATCG
+GGTGGATCTCTGGCGTAATGATGAGTTCATTGGTTCGCAGGATATCGTATTTGAATCGACAACAGAAAATACAGGTGATAAATCAGGTGGGTTAATGCCC
+TGTTTTAACCAGGTACTTCTTGAACGAATTGGCCTTAATAGCAGTGCATTTCCCGAGTTAGCCCAGCAGCAAAACAATAAATGCATCAATTTACTGAAAG
+CTGTACCTGATGCCACAATTAACTTTGATTTTGCAGCGATGCGCCTGAACATCACTATTCCTCAGATAGCGTTGTTGAGTAGCGCTCACGGTTACATTCC
+GCCTGAAGAGTGGGATGAAGGTATTCCTGCTTTACTCCTGAATTATAATTTCACCGGTAACAGAGGTAATGGTAACGATAGCTATTTTTAGTGAGCTCAG
+CGGGATTAATATTGGCCCGTGGCGTTTACGCAACAATGGTTCCTGGAACTATTTTCGCGGAAATGGATATCATTCAGAACAGTGGAATAATATTGGCACC
+TGGGTACAGCGCGCCATTATTCCGCTGAAAAGTGAACTGGTAATGGGAGACGGCAATACAGGAAGTGATATTTTCGATGGCGTTGGATTTCGTGGTGTAC
+GGCTTTATTCTTCTGATAATATGTATCCTGATAGCCAGCAAGGGTTTGCCCCAACGGTACGTGGGATTGCCCGTACGGCGGCCCAGCTAACGATTCGGCA
+AAATGGTTTTATTATCTATCAAAGCTATGTTTCCCCGGCGCTTTTGAAATTACAGATTTGCACCCGACATCTTCAAATGGCGATCTGGACGTCACCATCG
+ACGAGCGCGATGGCAATCAGCAGAATTACACAATTCCGTATTCAACAGTGCCAATTTTACAACGCGAAGGGCGTTTCAAATTTGACCTGACGGCGGGCGA
+TTTTCGTAGCGGTAATAGTCAGCAATCATCGCCTTTCTTTTTCAGGGTACGGCACTCGGCGGTTTACCACAGGAATTTACTGCCTACGGCGGGACGCAAT
+TATCTGCCAATTACACCGCCTTTTATTAGGGCTGGGGCGCAATCTCGGGAACTGGGGCGCAGTGTCGCTGGATGTAACGCATGCGCGCAGTCAGTTAGCC
+GACGCCAGTCGTCATGAGGGGATTCTATTCGCTTCCTCTATGCGAAATCGATGAACACCTTCGGCACCAATTTTCAGTTAATGGGTTACCGCTATTCGAC
+ACAAGGTTTTATACCCTTGATGATGTTGCGTATCGTCGAATGGAGGGTACGAATATGATTACGACGGTGAGCATCGCGATGAACCGATAATCGTGAATTA
+CCACAATTTACGCTTTAGCCGTAAAGACCGTTTGCAGTTAAATGTTTCACAATCACTTAATGACTTTGGCTCGCTTTATATTTCTGGTACCCATCAAAAT
+ACTGGAATACTTCGGATTCAGATACGTGGTATCAGGTGGGGTATACCAGCAGCTGGGTTGGCATCAGTTATTCGCTCTCATTTTCGTGGAATGAATCTGT
+AGGGATCCCCGATAACGAACGTATTGTCGGACTTAATGTTTCAGTGCCTTTCAATGTTTTGACCAAACGTCGCTACACCGGGAAAATGCGCTCGACCGCG
+CTTATGCCTCCTTTAACGCCAACCGTAACAGCAACGGGCAAAATAGCTGGCTGGCAGGTGTAGGTGGGACCTTACTGGAAGGCCACAACCTGAGTTATCA
+CGTAAGCCAGGGTGATACCTCGAATAATGGGTACACGGGCAGCGCCACGGCAAACTGGCAGGCCGCTTACGGTACGCTGGGGGCGGGTATAACTACGACC
+GCGATCAACATGACGTTAACTGGCAGCTGTCTGGCGGTGTGGTCGGGCATGAAAATGGCATAACGCTGAGCCAGCCTTTAGGGGATACCAATGTTTTGAT
+TAAAGCGCCTGGCGCAGGCGGTGTACGCATTGAAAATCAAACTGGCATTTTAACCGACTGGCGCGGCTATGCGGTGATGCTGTATGCCACGGTTTATCGG
+TATAACCGTATCGCGCTTGATACCAATACGATGGGGAATTCCATCGATGTTGAAAAAATATTAGCAGCGTTGTGCCGACGCAAGGCGCGTTGGTTCGTGC
+CAATTTTGATACCCGCATAGGCGTGCGGGCGCTCATTACCGTTACCCAGGGCGGAAAACCGGTGCCGTTTGGATCACTGGTACGGGAAAACAGTACCGGA
+ATAACCAGTATGGTGGGTGATGACGGGCAAGTTTATTTAAGTGGTGCGCCATTGTCTGGTGAATTACTGGTTCAGTGGGGAGACGGCGCGAACTCACGCT
+GCATTGCGCACTATGTATTGCCGAAGCAAAGCTTACAGCAAGCCGTCACTGTTATTTCGGCAGTTTGCACACATCCTGGCTCATAAAGGAAATTATCAAT
+AAGATAATCTGCAGATTATTATTGGCGATGGCATGTTTGTGTCTGGCAAACATATCCTGGGCTACTGTTTGTGCAAATAGTACTGGCGTAGCAGAAGATG
+AACACTATGATCTCTCAAATATCTTTAATAGCACCAATAACCAGCCAGGGCAGATTGTTGTTTTACCGGAAAAATCCGGCTGGGTAGGTGTCTCAGCAAT
+TTGTCCACCCGGTACGCTGGTGAATTATACATACCGTAGTTATGTCACCAACTTTATTGTTCAGGAAACTATCGATAATTATAAATATATGCAATTACAT
+GATTATCTATTAGGTGCGATGAGTCTGGTTGATAGTGTGATGGATATTCAGTTCCCCCGCAAAATTATATTCGGATGGGAACAGATCCTAACGTTTCGCA
+AAACCTTCCATTCGGGGTGATGGATTCTCGTTTAATATTTCGTTTAAAGGTTATTCGTCCCTTTATTAACATGGTGGAGATCCCCAGACAGGTGATGTTT
+ACCGTGTATGTGACATCAACGCCTTACGATCCGTTGGTTACACCTGTTTATACCATTAGTTTTGGTGGCCGGGTTGAAGTACCGCAAAACTGCGAATTAA
+ATGCCGGGCAGATTGTTGAATTTGATTTTGGTGATATCGGCGCATCGTTATTTAGTGCGGCAGGGCCGGGTAATCGACCTGCTGGTGTCATGCCGCAAAC
+CAAGAGCATTGCGGTCAAATGTACGAATGTTGCTGCGCAGGCTTATTTAACAATGCGTCTGGAAGCCAGTGCCGTTTCTGGTCAGGCGATGGTGTCGGAC
+AATCAGGATTTAGGTTTTATTGTCGCCGATCAGAACGATACGCCGATCACGCCTAACGATCTCAATAGCGTTATTCCTTTCCGTCTGGATGCAGCTGCGG
+CAGCCAATGTCACACTTCGCGCCTGGCCTATCAGTATTACCGGTCAAAACCGACCGAAGGGCCGTTTAGCGCGCTGGGGTATTTACGCGTCGATTATCAA
+TGAGGTACGGAGAATGAGAAGAGTACTCTTTAGCTGTTTCTGCGGGCTACTGTGGAGTTCCAGTGGATGGGCAGTTGACCCTTTAGGAACGATTAATATC
+AATTTGCACGGTAACGTTGTTGATTTCTCCTGTACCGTAAACACAGCGGATATTGATAAGACGGTAGATTTAGGCAGATGGCCTACGACACAACTACTGA
+ACGCTGGCGATACCACGGCACTCGTCCCTTTAGCCTGCGGCTGGAGGGATGTCCTCCGGGTTCAGTTGCGATTTTATTTACGGGAACGCCGGCATCCGAT
+ACCAACCTGCTGGCTCTGGATGATCCCGCAATGGCACAAACCGTCGCCATCGAATTACGTAATAGCGATCGCTCCCGGCTCGCACTGGGGAGGCGAGCCC
+GACTGAGGAAGTAGATGCAAATGGCAATGTCACACTAAACTTTTTGCCAATTATCGAGCGTTAGCCAGCGGTGTTCGGCCAGGTGTGGCGAAAGCGGATG
+CGATATTTATGATCAATTATAATTAATATTATATTAATTCGTATAATTTGGCGTAGTCGATAAGCTCTACAATTGAATGCAAACCTAGCTTGCCATAAAT
+ATTAGATTTATGCGCACTAACTGTTTTATTGCTAAGTAATAACTTATCGGCAATTTCTTTATTAGATAATCCGCTAACCAGATAACGTAATATGGTCACT
+TCACGATTAGATAGCACAGTGACCGTTGAACTATTCGTACTACATTTATTGCTTTTATATAGTTAAGCGTTTCGCTGGGAAAAACGTGTATCCGGAGAGG
+ATCATCTGAACGGCATGAAAAATATCATTCTGATCATTGCATTTACTGACAAAACCGTTAGCACCAGCTTGTATCGCTCTGCCAGCATAAAAGCATTCTG
+ATTTCGATGATAAAATAACACTTTCACTGTGCTCTGGATTTGTTTGATCCTTTTCAGGAAGGTAAAACCGTCTGTTCCGGGCAAGTCTATATCCATAATG
+ATTAAATCAACAGGACGGGTTCGGAGATAATCGATGGTTATGCGATAATCATCCGTTTTCAGGACAATCTGCAATTCACTGTTTTTGCAACAGAACTTCA
+ATAGACATTCTGATGATAGGATGAGTATCCATAATGATCACCGACGTTGGTTTCATAGTTACCAGTCTCATAGGAGCGGACAATTTTCCGTTAGGTCGGG
+AAATTGTACTTTGATACATGAAAATACGGGTTTTCTTGATTCAGACGCGCAGCGGTGTGCGTTTGTTTGCCGCTATAGCGAAATAAATCAGAAAATCAGA
+CGCGGTCGTTCACTTGTTCAGCAACCAGATCAAAAGCCATTGACTCAGCAAGGGTTGACCGTATAATTCACGCGATTACACCGCATTGCGGTATCAACGC
+GCCCTTAGCTCAGTTGGATAGAGCAACGACCTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATTACAATTCAATCAGTTACGCCTTC
+TTTATATCCTCCATAATTTCAGAGTGGGACATATTTGGGACATTATCACCAAAATGTCGTCTATTTTCCTCGCATGCTCTGTCAAATGATTAGGCGCAAG
+GTGAGCATACCTACGAACCATTTCTATGGACTCCCATCCGCCCATTTCCTGAAGCACTGATAATGGGACGCCTGACTGAATCAGCCAGCTTGCCCAGGTG
+TGTCTGAGGTCATGGAAACGGAAATCTTCAATTCCTGCACGACGACAAGCTGATAGCCATGATGTCTTGCTGTCGATGCGCATCTTCCTGACCGCAGGCG
+TTGATGTTCCATCTGCTCGCTTAGCCGCCTTGGTATGTACAAACACCCATTTGTGATGCTTGCCTATTTGATCACGCAACACTTTACAGGCGGTATCGTT
+CAGCGCCACACCAATGGCGCGGTTTGATTTGCTCTCTTCTGGATTCACCCAGGCAACTCGTCGCTGCATGTCGATTTGTTGCCATTCCAGATTATGATGT
+TCGACTTTCTCAGACCAGTTGCCAGCGCAAACTTGACGACAGATTTCAGTGGTTCGGGGCACTCATCAATAAGGCGTTTTGCTTCCTCCTTTTCCAGCCA
+TCTGACTCGCTTGTTTCTGACCGCTGGTATCTTGATGACAGGCGCTTTTTCCAGCCACTTCCAGTCGCGTTCTGCAGCACGGAGAATGGCCTTTATCATG
+GCAAGATGCTTTGCCTTTGTCTGAGTTGATACTGGCTTTGGTTCATAAACAGGCAGTTCTTTACCTTTCCTGATGGCGGCCTGAACTTTCTGTTTCCATA
+TTTCTTTCGTCTTTCTGTTATGCATTCTGCTTACAGCAGAGTAAATCTTTGCCTCCGAGATATCTTTAAGCCTTATACCCTCAAAATGTTCAAGCCAGAA
+CTCAATCCGGCTTTTATCTGAATCGAGAGATTTTTATCAGCTTTTTCCTCAAGCCATCTTAGGCAGGCCTCTTCAAAAGTGACATCAGGTAAATCCCTAG
+CTTTTCTACTCGCCAGAGTTCTGCTTTTCGCTTGTCGTGCAACTCCTGAGCTTGCCGTTTGTCCTTTGTGCCAAGAGATTCCTTAATTCGTTTCCCGCCC
+GGGAGCGAATACGAGGCATACCATATTTCATTTCTGCGGAAGAGTGACATTTTCTTTCCTCTGTTATGCCATCACCCGCGCTCACCTGGACAGTATGCAG
+CGGAGACTGAAGCGCCGCAATGCAGGCTTGCCGTGTTGTGAGGTACCCGGATATTATCGTGAGGATGCGTCATCGCCATTGCTCCCCAAATACAAAACCA
+ATTTCAGCCAGTGCCTCGTCCATTTTTCGATGAACTCCGGCACCATCTCGTCAAAACTCGCCATGTACTTTTCATTCCGCTCAATCACGACATAATGCAG
+GCCTTCACGCTTCATGCGCGGGTCATAGTTGGCAAAGTACCAGGCATCTTTTCGCGTCACCCACATGCTGTACTGCACCTGGGCCATGTAAGCCGATTTT
+ATTGCCTCGAAACCACCGAGCCGGAATTTCATGAAATCCCGGAGGTACGAGTATTGCCGGAAGCGTGGCCTGTATCCGGATGCAGAGTCTTATCCGTGGA
+AATCGAACGCGCATTACTGGTTGGTTACCAACTTGTACCAGAACATGCGGGCCAATGCGCTGGCTGACGCGGAATTACGGCGCAAGGCTGCCGATGAACT
+GACCTGTATGACAGCGCGAATTAACCGTGGTGAGACGATACCTGAACCAGTAAAACAACTTCCTGTTATGGGCGGTAGACCTCTAAATCGTGCACAGGCT
+CTGGCGAAGATCGCAGAAATTAAAGCTAAGTTCGGACTGAAAGGAGCAAGTGTATGACGGGCAAAGAGGCAATTATTCATTACCTGGGGACGCATAAGAG
+CTTCTGTGCACAGGACGTTGCCGCGGTAACAGGCGCAACCGTAATCTGATCTTACCCAGCAATAGTGGACACGCGGCTAAGTGAGTAAACTCTCAGTCAG
+AGGTGACTCACATGACAAAACAGTATCAACCAGTAAAACCCCGTAAACAGCATTCGCCTGAATTTCGCAGTGAAGCCCTGAAGCTTGCTGAACGCATCGG
+TGTTACTGCCGCAGCCCGTGAACTCAGCCTGTATGAATCACAACTCTACAACTGGCGCAGTAAACAGCAAAATCAGCAGACGTCTTCTGAACGTGAACTG
+GAGATGTCTACCGAGATTGCACGTCTCAAACGCCAGCTGGCAGAACGGGATGAAGAGCTGGCTATCCTCCAAAAGGCCGCGACATACTTCGCGAAGCGCC
+TGAAATGAAGTATGTCTTTATTGAAAAACATCAGGCTGAGTTCAGCATCAAAGCAATGTGCCGCGTGCTCCGGGTGGCCCGCAGCGGCTGGTATACGTGG
+TGTCAGCGGCGGACAAGGATAAGCACGCGTCAGCAGTTCCGCCAACACTGCGACAGCGTTGTCCTCGCGGCTTTACCCGGTCAAAACAGCGTTACGGTGC
+CCCACGCCTGACGGATGAACTGCGTGCTCAGGGTTACCCCTTTAACGTAAAACCGTGGCGGCAAGCCTGCGCCGTCAGGGACTGAGGGCAAAGGCCTCCC
+GGAAGTTCAGCCCGGTCAGCTACCGCGCACACGGCCTGCCTGTGTCAGAAAATCTGTTGGAGCAGGATTTTTACGCCAGTGGCCCGAACCAGAAGTGGGC
+AGGAGACATCACGTACTTACGTACAGATGAAGGCTGGCTGTATCTGGCAGTGGTCATTGACCTGTGGTCACGTGCCGTTATTGGCTGGTCAATGTCGCCA
+CGCATGACGGCGCAACTGGCCTGCGATGCCCTGCAGATGGCGCTGTGGCGGCGTAAGAGGCCCCGGAACGTTATCGTTCACACGGACCGTGGAGGCCAGT
+ACTGTTCAGCAGATTATCAGGCGCAACTGAAGCGGCATAATCTGCGTGGAAGTATGAGCGCAAAAGGTTGCTGCTACGATAATGCCTGCGTGGAAAGCTT
+CTTTCATTCGCTGAAAGTGGAATGTATCCATGGAGAACACTTTATCAGCCGGGAAATAATGCGGGCAACGGTGTTTAATTATATCGAATGTGATTACAAT
+CGGTGGCGGCGGCACAGTTGGTGTGGCGGCCTCAGTCCGGAACAATTTGAAAACAAGAACCTCGCTTAGGCCTGTGTCCATATTACGTGGGTAGGATCAA
+CCAGCATAAATCAGGCTGCGGCTAAAATGGCGCGGGCAGGAATCCTGGTCGTTGATGGTAAGGTCTGGCGAACGGTGTATTACCGGTTCGCTACCAGAGA
+AGAATGGGAAGGAAAGGTGAGCACGAATCTGATTTTAAGGAGTGTCGCCAGAGTGCCGCGATGAAACGGGTATTGAGGGTATATAAAAGAACATCAATGG
+GAACACAATGATGAAACAGGTGAGTTGAGTTCAAACTGTAGTACAATTCTCTCCAGTTTGAACAGGAAAGAATATGCTATGAACCCTTATATTTATCTTG
+GTGGTGCAATACTTGCAGAGGTCATTGGTACAACCTTAATGAAGTTTTCAGAAGGTTTTACACGGTTATGGCCATCTGTTGGTACAATTATTTGTTATTG
+TGCATCATTCTGGTTATTAGCTCAGACGCTGGCTTATATTCCTACAGGGATTGCTTATGCTATCTGGTCAGGAGTCGGTATTGTCCTGATTAGCTTACTG
+TCATGGGGATTTTTCGGCCAACGGCTGGACCTGCCAGCCATTATAGGCATGATGTTGATTTGTGCCGGTGTGTTGATTATTAATTTATTGTCACGAAGCA
+CACCACATTAAAATAATTTGTTTCTAAACGACTAAAATATGGAGGCTCTTATATTTATATGAGCCTCGTTTTATGCTTTTGTTAATGTCTTTATTTTTTA
+TGTATTCTTTTGTGCTTTCAAGATTATGGCGTAAGAAAATTGCAATACGATTATTGTTGTATATTCAAGATAATGTGACCTTAATTGTCTTTTTAAATAA
+AAATAAACAAAAATTATATCCCACCACTAAGGTTTATAAAAGCATACGTTAGCAGGTGTCACCATGAAAAAGCCATAGCATATATGCGATTTTCATCACC
+AGGTCAGATGTCTGGCGACTCATTAAACCGACAGAGAAGACTTATTGCTGAATGGTTAAAGGTAAATAGTGATTATTATCTTGATACCATAACATATGAA
+GATTTAGGATTAAGTGCATTCAAAGGAAAGCATGCACAATCAGGAGCTTTTTCGGAATTTTTAGATGCTATAGAGCATGGTTATATATTGCCAGGAACTA
+CATTGTTAGTTGAAAGTCTGGACAGACTTTCAAGAGAAAAAGTCGGTGAAGCGATTGAACGTCTGAAATTGATTTTGAATCACGGTATTGATGTTATAAC
+TCTTTGCGACAATACAGTCTATAATATTGACTCTTTGAATGAGCCATATTCATTAATAAAAGCCATACTTATAGCACAAAGGGCAAATGAAGAAAGCGAG
+ATAAAGTCAAGTCGGGTTAAATTATCATGGAAGAAAAACGGCAGGATGCACTGGAATCAGGTACGATTATGACGGCGTCTTGTCCGAGATGGCTCTCCTT
+AGATGACAAAAGAACGGCTTTTGTTCCAGACCCCGACAGGGTGAAAACTATTGAGCTAATTTTTAAACTCAGGATGGAAAGGCGCTCATTGAATGCAATA
+GCCAAGTATTTAAATGATCATGCTGTAAAGAATTTCTCAGGAAAAGAAAGTGCATGGGGACCTTCTGTAATTGAAAAATTATTAGCGAATAAAGCTCTGA
+TAGGTATTTGCGTACCTTCATATCGTGCAAGAGGGAAGGGATAAGTGAAATCGCTGGCTATTATCCCAGAGTCATATCAGATGATTTGTTTTACGCTGTA
+CAGGAAATTCGGTTGGCACCTTTGGTATTAGCAATAGTAGCAAGAATCCTATGCTAATAAATCTACTTCGAACAGTTATGAAGTGTGAGGCTTGTGGTAA
+TACCATGATTGTTCATGCGGTATCTGGAAGTTTGCATGGCTATTATGTTTGTCCGATGAGAAGATTACATCGATGTGACAGGCCATCAATAAAAAGAGAT
+TTGGTTGATTATAATATCATTAATGAATTGCTTTTAATTGTAGCAAAATTCAACCAGTTGAAAACAAGAAAGATGCTAATGAAACTTTAGAGTTAAAAAT
+TATTGAGCTTCAGATGAAAATTAATAATTTAATCGTTGCATTGTCTGTCGCGCCTGAAGTTACCGCTATAGCAGAGAAAATAAGACTATTAGATAAGGAA
+TTACGAAGGGCTTCGGTATCATTGAAAACTTTGAAGAGTAAAGGTGTAAATTCATTCAGTGATTTTTATGCTATTGACTTAACCAGTAAAATGGACGAGA
+GTTATGCCGTACACTTGCCTATAAAACATTCGAAAAATCATAATTAATACGGATAATAAAACCTGTGATATCTATTTTATGAATGGCATTGTTTTTAAAC
+ACTATCCTTTAATGAAAGTAATATCCGCCCAGCAGGCGATAAGTGCTCTCAAATATATGGTTGATGGTGAGATTTATTTCTAAATAATGATCTCGGATTT
+TAAGTTATGCTATGGTGATAAAGTGCAAGACAGAATTAATTATCTTTGACGAAACTTAATGGGTAATTACTTTGTTTGCTCCCACAAGCGAGTTTTGTAC
+GGCTGTATTGGGGTAGTAAATGAGCTATACAATCTTAATCATTTGTTAGGTGAGAACTCTTGGTCGCAGATTCAAATACTGAAAATACGTGACAAATTAT
+TATGAGCAAAATGGTGTATGTCACGTATTTTGAATGGTAGGTTAAAAATAACACCGACTTTCGTAGGTGTTACTAATAATAAAGCAGAGTTTTTAGATAG
+TATCAATGTGCTTTGTGTATATTGTGGCAAATAATTGGGTTGGGGTACAATTGTGATTGCTTTTGCATGAACATTGCGCCTTTATGCATAATGAGATAAA
+GGAATATCAAATAAAATAACGATAGGTCATAACAAAGAGGTTTTATGAAAACACTTATCGTTTCAACTGTATTGGCATTCATAACATTTTCTGCGCAGGC
+TGCAGCATTTCAGGTCACTAGTAATGAAATAAAAACAGGAGAGCAACTTACAACGTCTCATGTCTTTTCTGGATTTGGGTGTGAAGGTGGTAATACATCG
+CCCTCATTAACCTGGTCTGGTGTTCCTGAAGGTACCAAAAGCTTTGCCGTAACTGTATATGATCCAGATGCACCTACAGGCAGTGGTTGGTGGCATTGGA
+CTGTTGTTAATATTCCAGCAACAGTAACATATTTGCCCGTTGATGCAGGGAGACGTGATGGAACAAAACTGCCGACTGGTGCTGTTCAAGGCCGAAATGA
+TTTTGGCTATGCTGGGTTTGGTGGCGCATGTCCTCCTAAAGGAGATAAACCACATCATTACCAGTTTAAAGTATGGGCTCTAAAACTGAAAAGATTCCTG
+TAGATTCTAACTCCAGCGGAGCGTTAGTTGGTTATATGCTTAATGCTAATAAAATCGCAACCGCTGAGATAACACCAGTTTATGAGATAAAGTAGGGTGA
+GAGTATGCTGGCAAGAGGTAAGACTAACTTAAAGATCGAAGAAATACGGATGCATAAACATCATGAGATTCATAGGGTTAAGCCTCTTATGCCAGCTTTG
+TGTCGTATCCGTCAGGGAAAGAAAGTTATCAATTGGGAGACGCATACTTTAACTGTTGATAATAATCAAATAATATTATTTCCTTGTGGTTATGAATTTT
+ATATTGAGAATTATCCTGAAGCAGGGCTTTATCTTGCAGAAATGCTTTACTTACCCATTGATTTAATTGAGAGTTTCCAAAACTTTATACGGTAACTGAT
+CAAATACGTAACAAAACAAGTTTCTTTTTACCTCAGAATCCTGAGTTAATATATTGTTGGGAGCAACTAAAACATCTGTTTCCCGAGGCTTCTCAACTAA
+AATTCAGGAGCACTTAGCAATGGGCGTTCTACTTTCGTTAGGAGTGAATCATGTTAATCATTTACTTTTATCATATAGTAAACAATCATTGATAAGTCGT
+TGTTATAACCTGCTGCTATCCGAACCCGGCACAAAATGGACAGCAAACAAGGTTGCTCGATATCTCTACATTTCTGTTTCTACATTACATCGCCGTCTAG
+CAAGCGAGGGGTAAGTTTCAAAGTATACTGGACGATGTGAGGTTAAATAATGCGTTGTCTGCTATACAAACGACGGTAAAACCTATAAGCGAGATTGCCA
+GAGAAAATGGTTATAAGTGTCCTTCTCGTTTTACTGAAAGATTTCATAATCGTTTTAATATAACACCAAGAGAGATAAGAAAAGCTTCCAGAGAGTAAAA
+GTGTTTTAAGAAGGAGCAATTCTATCGATTTTGATTTTGGGAAATCAACACGGCATAATTATGTCACCGGAGCCTGAACAACTCCGGTGACTTCTGCGCT
+AAACGGGGACGTTTATGCGCACATACAATCAAACTCTCTTCTCCTTCACAGATGCAGAAATGCACCTGCAATTCTTTGCATCTAGCGTTTGACCTCTGCG
+GAGGAAGCGTGAACCTCTCACAAGACGGCATCAAATTACATCGCGGCAACTTCACCGCTATCGGTCGGCAGATCCAGCCTTATCTGGAGGAGGGCAAATG
+CTTTCGCATGGTGCTTAAACCGTGGCGTGAGAAACGCAGTCTTTCCCAGAATGCACTCAGCCACATGTGGTACAGCGAAATCAGTGAATACCTCATCAGC
+AGGGGTAAAACGTTCGCCACTCCAGCTTGGGTAAAGATGCTCTCAAACACACATATCTCGGTTATGAAACCAAAGACCTGGTTGATGTCGTAACCGGTGA
+TATCACCACTATCCAGTCGTTACGCCATACCTCCGATCTTGATACCGGAGAGATGTATGTCTTCCTGTGTAAGGTTGAAGCCTGGGCGATGAATATTGGT
+TGCCACCTGACTATTCCACAGAGCTGCGAGTTCCAGCTGCTGCGCGACAAGCAGGAGGCGTAATGGCTACACCGCTTATTCGTGTCATGAACGGACACAT
+CTACAGAGTACCAAATCGTCGTAAGCGTAAACCTGAGCTGAAGCCATCCGAAATACCAACACTGCTCGGATATACCGCCAGCTTGGTTGATAAAAATGGT
+TGCGACTGGCAGCAAGGAGGAGTCATGGCTGATTTGAGAAAAGCAGCGCGTGGTCGGGAATGCCAGGTAAGAATCCCTGGCGTATGTAATGGCAACCCTG
+AAACGTCTGTACTGGCACATATCCGGCTGACTGGATTGTGCGGCACCGGTACGAAACCGCCAGACCTGATTGCCACCATTGCATGTTCTGCCTGCCACGA
+CGAAATCGACCGCCGCACGCATTTTGTTGACGCTGGATATGCAAAAGAATGCGCGCTGGAAGGTATGGCGAGAACACAGGTTATCTGGCTGAAAGAGGGG
+TTATTAAGGCGTGAATACCTACAGCATCACATTACCCTGGCCTCCGAGCAATAATCGCTATTACCGCCATAATCGCGGGCGCACGCACGTCAGCGCAGAG
+GGCAGGCATACCGCGATAACGTCGCCCGAATCATTAAAAACGCAATGCTGGATATCGGCCTGGCTATGCCTGTGAAAATCCGCATTGAGTGCCACATGCC
+GGATCGCCGTCGCCGTGACCTGGATAATCTGCAAAAGCCGCTTTTGACGCACTCACTAAAGCAGGTTTCTGGCTGGATGATGCTCAGGTCGTTGATTACC
+GCGTTGTGAAGATGCCTGTTACCAAAGGTGGGAGGCTGGAACTGACCATCACCGAAATGGGGAATGAATGATGTTTGAGTTTAATATGGCAGAACTTCTT
+CGCCACCGCTGGGGGCGTCTGCGCTTATATCGTTTCCCCGGTTCTGTTTTGACCGATTACCGAATACTGAAGAATTACGCCAAAACCCTGACAGGAGCAG
+GAGTATGAAGTCAGAGATAACAATCAACTAATACTGTTTTGTTGATTTTTGCTTGTAATTGGCGTTCTGGTCTGATTTTTGTGGAGTAAGTTGATGCGTG
+ATATTCAGATGGTTCTTGAGCGTTGGGGAGCGTGGGCGGCTAATAATCATGAAGATGTGACCTGGTCGTCCATTGCCGCCGGTTTTAAGGGATTAATTAC
+TTCAAAAGTAAAATCTCGCCCGCAATGTTGTGACGATGACGCGATGATCATTTGCGGGTGCATGGCCCGTCTGAAAAGAACAACAGCGATTTGCACGATT
+TATTAGTAGATTATTATGTAGTCGGTATGACATTCATGTCACTGGCAGGTAAGCATTGCTGCTCTGATGGTTATATCGGGAAAAGGTTACAGAAGGCTGA
+GGGCATAATTGAAGGGATGTTAATGGCATTAGATATCCGGTTAGAGATGGATATCGTTGTTAATAACTCTAATTAATATGCCAATTGTTTACTAAAAATT
+ATTAAAATGGGGCGTTGAGACGCCCCAAAAATAAAGGGTAATATATAACAGAAGGTTTATATAGTTAGAAGCAAGGTTGTGCTTCTAAAGGAAGTGGCTT
+GAGGGAGCCACTTATATGTTGGGGAGGCAACGCCTCCCGCAACATATCTTTTCGTAATCAGATTAGAACTGGTAAACCAGACCTACAGCAACGATGTCAT
+CAGTGCTTACACCGAGTGCTTTAGGGAAGGTGCGAATAAGCGGGAAATTCTTCTCGGCTGACTCAGTCATTTCATTTCTTCATGTTTGAGCCGATTTTTC
+TCCCGTAAATGCCTTGAATCAGCCTATTTAGACCGTTTCTTCGCCATTTAAGGCGTTATCCCCAGTTTTAGTGAGATCTCTCCCACTGACGTATCATTTG
+GTCCGCCCGAAACAGGTTGGCCAGCGTGAATAACATCGCCAGTTGGTTATCGTTTTCAGCAACCCCTTGTATCTGGCTTTCACGAAGCCGAACTGTCGCT
+TGATGATGCGAAATGGGTGCTCCACCCTGGCCCGGATGCTGGCTTTCATGTATTCGATGTTGATGGCCGTTTTGTTCTTGCGTGGATGCTGTTTCAAGGT
+TCTTACCTTGCCGGGGCGCTCGGCGATCAGCCAGTCCACATCCACCTCGGCCAGCTCCTCGCGCTGTGGCGCCCTTGGTAGCCGGCATCGGCTGAGACAA
+ATTGCTCCTCTCCATGCAGCAGATTACCCAGCTGATTGAGGTCATGCTCGTTGGCCGCGGTGGTGACCAGGCTGTGGGTCAGGCCACTCTTGGCATCGAC
+ACCAATGTGGGCCTTCATGCCAAAGTGCCACTGATTGCCTTTCTTGGTCTGATGCATCTCCGGATCGCGTTGCTGCTCTTTGTTCTTGGTCGAGCTGGGT
+GCCTCAATGATGGTGGCATCGACCAAGGTGCCTTGAGTCATCATGACGCCTGCTTCGGCCAGCCAGCGATTGATGGTCTTGAACAATTGGCGGGCCAGTT
+GATGCTGCTCCAGCAGGTGGCGGAAATTCATGATGGTGGTGCGGTCCGGCAAGGCGCTATCCAGGGATAACCGGGCAAACAGACGCATGGAGGCGATTTC
+GTACAGAGCATCTTCCATCGCGCCATCGCTCAGGTTGTACCAATGCTGCATGCAGTGAATGCGTAGCATGGTTTCCAGCGGATAAGGTCGCCGGCCATTA
+CCAGCCTTGGGGTAAAACGGCTCGATGACTTCCACCATGTTTTGCCATGGCAGAATCTGCTCCATGCGGGACAAGAAAATCTCTTTTCTGGTCTGACGGC
+GCTTACTGCTGAATTCACTGTCGGCGAAGGTAAGTTGATGACTCATGATGAACCCTGTTCTATGGCTCCAGATGACAAACATGATCTCATATCAGGGACT
+TGTTCGCACCTTCCTTAGTGAAGTCATTTTTGTCAAGCAGGTTGATTTTGTAATCAACGAAAGTAGACATATTTTTGTTGAAGTAATAGGTTGCACCTAC
+ATCAACATATTTGACTAAGTCCTGATCGCCCCATACTCCAAGATCCTTACCTTTAGATTGCAGGTAAGCAACGGACGGACGCAGACCGAAATCGAACTGA
+TATTGTGCAACAGCTTCGAAGTTTTGGGCTTTATTAGCAACGAAGTGATCAGCAAATACAGTCATATTCTGGGTTTCAGAATAGGTAGTGGCCAGGTAAA
+TGTTGTTAGCGTCATATTTCAGACCTGCGGCCCAAACTTCTGCATTTTACCGGAAGCAAATACTTCAGGAAGAACTTTCCCTGCATTAACTTGAGTGTCG
+GTACGATCAGATTTCGCATAAGTTGCACCGATACCGAATCCTTCGTATTCATAGGTAGCAGAGAAACCGAAGCCATCACCGTTACCTTCAGTGTAGTTAT
+CGAAATCGCTACGATCGTTTTGCCTTGGTACTGAGCAGCAAAGTTCAGACCATCAACCAGACCAAAGAAGTCGTTGTTACGATAGGTTGCAACACCAGTT
+GCACGTTGAGTCATGAACACGTCGGTTTGAGTCCAAGTGTCACCACCGAATTCTGGCAGGACGTCAGTCCACGCACCGATGTCGTATGCTACACCGTAGT
+TACGGCCGTAATCGATGGAGCCGTAGTCACCGAATTTCAGGCCAGCGAAGGCAAGACGGGTTTTATCTTTGGAGGAACCTTGAGATTCAGCGCGGTTGCC
+TTTGAATTCATATTCCCACTGACCGAAACCAGTCAGTTGATCGTTGATTTGGGTTTCACCTTTGAAGCCAAGACGGGCATAAGTAGTATCACCATCATCT
+GCATCATTAGAGGAGAAGTAGTGCTTAGCATTAACTTTCCCGTACAGATCCAGCTTGTTACTGTCTTTATTATAAATTTCAGCTGCCTGAGCAGACATCG
+CCATTAGTACTGATGCAGCTACAGCAGAAATTGCCACTGTTAATTTTTTCATCGTGAGCCCTTTTTGAACTATTATTAAAAATGATGTCACTGCGCGATA
+AATATTCATCTAATCAATGTGATTATTTCAAGATGTAAGTTTTGGTTTCTCGTTTGATTTGTGAAGTAGATCTCTATTTTTATCTGAACTTTTTCTATCG
+AATCCTATTCATGGCTCTTGGCTGAATAAAAATAAATCTATTAGCCAATTTATATTAACGGCTGTTATTTATAAGTGCTCTATAATTTGAAGGTTCAATT
+TAAACCGGCTAAAAATAACACTGGAAATTATTTTTGGTTATTTGTTGAGATTTGCTTATGTATTTGTAGTGGTGTTTTCAATACTCGGTAGCATTCTCTC
+AAATATCATTTAGTGGTTTACGTACGTAAAAATTGGTTATGCTGTTAAGAGTGGTTACTTCGTCACACAGCTTAAACCCGCCGTCGAGCGGGTTTTCCAT
+TTTGAGTCTCGATATTAGCTGATAACCCAATACCTGAGTTATTCACTGACTCCGAGTCTGTTACGTTTCGTAGTATTCCTCAATTTACACCCGCTTTGTC
+TGCGAGGTGGGGTTATGAAATCCATGGATAAGTTAACAACGGGTGTCGCCTATGGCACCTCAGCAGGTAGTGCCGGGTACTGGTTTTACAGCTGCTAGAT
+AAAGTCACTCCTCACAGTGGGCAGCAATAGGTGTGCTGGGTAGCCTGGTATTTGGCCTGCTGACGTACCTGACAAACCTTTATTTCAAGATTAAAGAAGA
+TAAGCGCAAGGCTGCGAGAGGTGAATAATGCCTCCATCATTACGAAAAGCCGTTGCTGCTGCTATTGGTGGCGGAGCAATTGCTATAGCATCAGTGTTAA
+TCACTGGCCCAAGTGGTAACGATGGTCTGGAAGGTGTCAGCTACATACCATACAAAGATATTGTTGGTGTATGGACTGTATGTCACGGACACACCGGAAA
+AGACATCATGCTCGGTAAAACGTATACCAAAGCAGAATGCAAAGCACTCTTGAATAAAGACCTTGCCACTGTCGCCAGACAAATTAACCCGTATATCAAA
+GTCGATATACCGGAAACAACGCGCGGCGCTCTTTACTCATTCGTTTACAACGTGGGTGCTGGCAATTTTAGAACATCGACGCTTCTTCGCAAAATAAACC
+AGGGCGATATCAAAGGCGCATGTGATCAGCTGCGTCGCTGGACATACGCTGGCGGTAAGCAATGGAAAGGCCTGATGACTCGTCGTGAGATTGAGCGTGA
+AGTCTGTTTGTGGGGGCAACAGTGAGCAGAGTAACCGCGATTATATCCGCTCTGATTATCTGCATCATCGTCAGCCTGTCATGGGCGGTCAATCATTACC
+GTGATAACGCAATCGCCTACAAAGTCCAGCGCGACAAAATGCCAGAGAACTGAAGCTAGCGAACGCGGCAATTACTGACATGCAGATGCGTCAGCGTGAT
+GTTGCTGCGCTCGATGCAAAATACACGAAGGAGTTAGCTGATGCGAAAGCTGAAAATGATGCTCTGCGTGATGATGTTGCCGCTGGTCGTCGTCGGTTGC
+ACATCAAAGCAGTCTGTCAGTCAGTGCGTGAAGCCACCACGGCCTCCGGCGTGGATAATGCAGCCTCCCCGACTGGCAGACACCGCTGAACGGGATTATT
+TCACCCTCAGAGAGAGGCTGATCACTATGCAAAAACAACTGGAAGGAACCCAGAAGTATATTAATGAGCAGTGCAGATAGAGCTGACCATATCGATGGGC
+AACTCATGCAATTATTTTGAGCAATACACGCGCTTCCAGCGGAGTATAAATGCCTAAAGTAATAAAACCGAGCAATCCATTTACGAATGTTTGCTGGGTT
+TCTGTTTTAACAACATTTTCTGCGCCGCCACAAATTTTAGCTGCATCGACAGTTTTCTTCTGCCCAATTCCAGAAACGAAGAAATGATGGGTGATGGTTT
+CCTTTGGTGCTACTGCTGTCTGTTTGTTTTGAACAGTAAATGTCTGTTGAGCACATCCTGTAATAAGCAGGGCCAGCGCAGTAGCGAGTAGCATTTTTTC
+ATGGTGTTATTCCCGATGCTTTTTGAAGTTCGCAGAATCGTATGTGTAGAAAATTAAACAAACCCTAAACAATGAGTTGAAATTTCATATTGTTAATATT
+TATTAATGTATGCCAGGTGCGATGAATCGTCATTGTATTCCCGGATTAACTATGTCCACAGCCCTGACGGGGAACTTCTCTGCGGGAGTGTCCGGGAATA
+ATTAAAACGATGCACACAGGGTTTAGCGCGTACATGTATTGTATTATGCCAACACCCCGGTGCTGACACGGAAGAAACCGGACGTTATGATTTAGCGTGG
+AAAGATTTGTGTAGTGTTCTGAATGCTCTCAGTAAATAGTAATGAATTATCAAAGGTATAGTAATATCTTTTATGTTCGTGGATATTTGTAATCCATCGG
+AAAACTCCTGCTTTAGCAAGATTTTCCCTGTATTGCTGAAATGTGATTTCTCTTGATTTCAACCTATCATAGGACGTTTCTATAAGATGCGTATTTCTTG
+AGAATTTAACATTTACAACCTTTTTAAGTCCTTTTATTAACACGGTGTTATCGTTTTCTAACACAATGTGAATATTATCTGTGGCTAGATAGTAAATATA
+ATGTGAGACATTGTGACGTTTTAGTTCAGAATAAAACAATTCACAGTTTAAATCTTTTCGCACTTGATCGAATATTTCTTTAAAAATGGCAACCTGAGCC
+ATTGGTAAAACCTTCCATGTGATACGAGGGCGCGTAGTTTGCATTATCGTTTTATCGCTTCAATCTGGTCTGACCTCTTTGTGTTTTGTTGATGATTTAT
+GTCAAATATTAGGAATGTTTTCAATTAATAGTATTGGTTGCGTAACAAAGTGCGGTCCTGCTGGCATTCTGGAGGAAATACAACCGACAGATGTATGTAA
+GCCAACGTGCTCAAACCTTCATACAGAAAGATTTGAAGTAATATTTTAACCGCTAGATGAAGAGCAAGCGCATGGAGCGACAAAATGAATAAAGAACAAT
+CTGCTGATGATCCCTCCGTGGATCTGATTCGTGTAAAAATATGCTTAATAGCACCATTTCTATGAGTTACCCTGATGTTGTAATTGCATGTATAGAACAT
+AAGGTGTCTCTGGAAGCATTCAGGGCAATTGAGGCAGCGTTGGTGAAGCACGATAATAATATGAAGGATTATTCCTGGTGGTTGACTGATCACCATAACT
+GCTAATCATTCAAACTACTTAACCTGTGACAGAGCCAACACGCAGTCTGTCACTGTCAGGAAAGTGGTAAAACTGCAACTCAATTACTGCAATGCCCTCG
+TAATTAAGTGAATTTACAATATCGTCCTGTTCGGAGGGAAGAACGCGGGATGTTCATTCTTCATCACTTTTAATTGATGTATATGCTCTCTTTTCTGACG
+TTAGCCTCCGACGGCAGGCTTCAATGACCCAGGCTGAGAAATTCCCGGACCCTTTTGCTCAAGAGCGATGTTAATTTGTTCAATCATTTGGTTAGGAAAG
+CGGATGTTGCGGGTTGTTGTTCTGCGGGTTCTGTTCTTAGTTGACATGAGGTTGCCCCGTATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTAC
+GTTAAGTTGATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTGGTTTGATGGCGTAGATGCACGTTGTGACATGTAGATGATAA
+TTATTATCATTTTGTGGGTCCTTTCCGGCGATCCGACAGGTTACGGGGCGGCGACCTCGCGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGTGT
+TTCCGTTCTTCTTCGTCGTAACTTAATGTATTTATTTAAAATACCCCTGAAAGAAAGGAAACGACAGGTGCTGAAAGCGAGCTTTTGGCCTCTGTCGTTT
+CCTTTCTGTTTTTGTCCGTGGAATGTGCAATGGAAGTCAACAAAAGCAGCTGGCTGACATTTTCGGTGCGAGTATCCGTACCATTCAGAACTGGCAGGAA
+CAGGGAATGCCCGTTCTGCGAGGCGGTGGCAAGGGTAATGAGGTGCTTTATGACTCTGCCGCCGTCATAAAATGGTATGCCGAAAGGGATGCTGAAATTG
+AGAACGAAAAGCTGCGCCGGGAGGTTGAAGAACTGCTGCAGGCCAGCGAGACAGATCTCCAGCCAGGGACTATTGAGTACGAACGCCATCGACTTACGCG
+TGCGCAGGCCGATGCACAGGAGCTGAAAATGCCAGAGACTCCGCTGAAGTGGTGGAAACCGCATTCTGTACTTTCGTGCTGTCGCGGATCGCAGGTGAAA
+TTGCCAGTATTCTCGACGGGATCCCCTGTCGGTGCAGCGGCGTTTTCCGGAACTGGAAAACCGACATGTTGATTTCCTGAAACGGGATATCATCAAAGCC
+ATGAACAAAGCAGCCGCGCTGGATGAACTGATACCGGGGTTGCTGAGTGAATATATCGAACAGTCAGGTTAACAGGCTGCGGCATTTTGTCCGCGCCGGG
+CTTCGCTCACTGTTCAGGCCGGAGCCACAGACCGCCGTTGAATGGGCGGATGCTAATTACTATCTCCCGAAAGAATCCGCATACCAGGAAGGGCGCTGGG
+AAACACTGCCCTTTCAGCGGGCCATCATGAATGCGATGGGCAGCGACTACATCCGTGAGGTGAATGTGGTGAAGTCTGCCCGTGTCGGTTATTCCAAAAT
+GCTGCTGGGTGTTTATGCCTACTTTATAGAGCATAAGCAGCGCAACACCCTATTCCAGCTGGCTTCGTGGCTGTTTTCAACAGTGATGAGTCATCGTGGC
+ATCTCGTTGAAGATCATCGGGGTAAAACGGTTTATGACGTAGCGTCAGGGGACGCGTTATTTATTTCTGAACTCGGTCCGTTACCGGAAAATGTTACCTG
+GTTATCGCCGGAAGGGAGTTTCAGAAGTGGAACGGTACAGCCTGGGTGAAAGATGCAGAAGCAGAAAAACTGTTCCGGATTCGGGAGGCGGAAGAAACAA
+AAACAGCCTGATGCAGGTAGCCAGTGAGCATATTGCGCCACTTCAGGATGCTGTAGATCTGGAAATCGCAACGGAGGAAGAAACCTCATTGCTGGAAGCC
+TGGAAAAATATCGGGTGTTGCTGAACCGTGTTGATACATCAACTGCACCTGATATTGAGTGGCCTACGAACCCTGTCAGGGAGTAATCATTGATTATGCC
+GCAGCACGTCTTAAGCAAGAACATGCTGCGGTTGGATGCTATTTTTCCTGAAGCGGAAAACATTACTACAGTACCTTGAACCTTGGTTTTAACATTCTCG
+AAATGCTCTGAGAGTATATGTTAAGCCTTCTTCGGAATCTTTTGTGTTTGAAAAGATGCCTTTCTGATTGTAAATGCGCATCAGTTTTGACCGAAGCTAT
+TGTGCACAACTCCATCGCCAAGAATTGTGGCTCCGTATAGAGTTCCATCGTCAGTTAAGGCCTGCGCCGCATTGCGTATTACACAGCTTTTGTAGATATA
+TTTCCAGGCAGGCAGTGAAGAAGGTAAGACATGGAAATGGAATCAAATTGACCATGTAACGCCGCGGGATAAGGTTCAAAACATCATGGCTAATTTTATG
+TTTAATTTTGATTCCCCAGCCCTTGTAGATGCCGCGTTCAGGCTAGCTTCGTTCAAATCCATTAAAGATATCAGACTACTCTCAGGTACGTGAGTAAGGT
+AAAACCCAGTTCCAACACCAATATCCAGATGGTTGTTACCTAAATGTTCCAGAAAGTGTGGAAGAAGGTGTTCCTTTGTAGGACATCCCCATGCAAGCCG
+ATTTGATACTCCCAAAACCCACCAGTCATAAAGCTTTAGGGTAAGTGGTGTGTAAATTCTAGCCCCATCATCTGTGTTTTTATTAATTTCACCATGTTAT
+AGTTTTATTTGTGAATTAAATCAATTATGGCAATGAATTACAAGGGGTTAAATGCTGCCGCAGCATAGCGATATTGAAATAGCCTGGTATGCTTCAATAC
+AGCAGGAGCCGAATGGCTGGAAGACCGTCACCACACAGTTCTACATCCAGGAATTCAGTGAGTATATTGCGCCACTGCAGGATGCTGTAGATCTGGAAAT
+CGCAACGGAGGAAGAAAGATCGTTGCTGGAAGCCTGAAAAGTATCGGGTGCTGCTAAACCGTGTGGACACTTCCGTAGCACCAGATATCGAGTGGCTTAT
+TCAACCATAATAAACAGTATGTATATCATAGGTTATTAATTGTGAGTTTTTCGGTGTGTTATTTGTTTGTTTGATGTTATGCTTTTGCGCCCCAAAAGGT
+TGTTTAGATGTATTTTATCAATTGATTTTCAATATCGTTTAATAAAGAAAAATTAAGCAAGCTGGATGTTGGTTTTGTTAATTGAATGGTTCTAATAATG
+TTTTTACTGTTGTTGAATGTGACTTGATAAGAAATGCAAGTAAAAATGATACTCTTTTATTTTAAATTCAAACGGTTGACATATATATAGCAAGAGGTTT
+CAGGTGCGTTGTAGTGAGTTTATGTTAATAAAAAGCATAGTAAGCGTTGAAAAATGTAACTTTGAAATAAGTTAGAATAAAAACAACATACATATAATAA
+TTTAATCTTAAATGAAATTTATTAAAATTTGCAAACTATAATTTTGTGTATAAAATATAAATGCACATCATCCTGATTATGATTGTGTATTTAATTGGTT
+GTTATTTGACTACTATCAACTTGTTTTAATTTTATGATAGGTGCAAGATGGATTATGTTTGCTCCGTAGTTTTCATCTGTCAATCATTTGATTTAATTAT
+AAACAGGAGAGTTATCTCGTTCAAAAAAATTCATTGTTTATTGTAAGCGACAAAATTAGAAGGGAGTTACCAGTATGCCCCTCTAAACTAAGAATTGTTG
+ATATAGATAAGAAAACATGTTTATCCTTTTTATCGACGTGAATAATGAGCTGCCTGGCAAATTTACTCTTGATAAGAATGGCTATATTGCTGAAGAGGAA
+CCTCCATTATCGCTTGTTTTTCTCTGTTTGAAGGGATTAAAATAGCAGACTCACACTCCCTTTGGTTAAAAGAAAGACTATGTATATCCTTACTTGCCAT
+GTTCAAAAACGCGAAAGTGTAAATTCATTTATACTAACAAATATAAATACATTTACCTGTAAAATTACTGGAATAATCAGTTTTAATATTGAGCGGCAAT
+GGCATTTAAAAGATATTGCGGAATTGATTTATACGAGTGAAAGTTTAATAAAAAAAGATTAAGGGATGAAGGAACGTCATTTACTGAAATATTGAGAGAT
+ACTAGGATGAGGTATGCAAAAAACTCATAACTTCAAACTCTTATTCTATCAATGTCGTAGCCCAGAAATGTGGCTATAACAGTACTTCATATTTCATATG
+TGCATTTAAAGATTATTATGGTGTCACGCCATCTCATTATTTTGAGAAAATAATCGGCGTCACAGATGGAATAAACAAAACAATTGACTGATAATGTTTA
+TTACAAGTTGTCTACATGTTAATTATAATATTATACAGCGTTTTTTGATGTGATATTCTGGAACCATTAATTTGTAATTGGGTTGCTGTCGCCTATTTTA
+TACATACTATAATTGATGGTTTTCTATGTGATTTAGTTAATAACCTTCTGGGTTTATTTTAAGGGTTAATTGTTACATTGAAATGGCTAGTTATTCCCCG
+GGGCGATTTTCACCTCGGGGAAATTTTAGTTGGCGTTCTTAAAATGTGTACTTAAGACCAGCAGTAGTGATGAAGTTATAGTTTTCTATACCTGCTCCAT
+TTTGCTGTAGTCTGAAGTGTTATTATTGTGATCATAAAGTGAAGTATTACCTTTTTATTCGTAACCCGATTCCATGCGCCTTCAACATAAACTTTTGCGT
+TAGGTGTGACGTAATAACCTGCATTGACTGCAACAGAATAGTAATTTTGGTCTTTGACCTTACTGCGATAAGTGATTCTTTTCCCGGGTCATAGTGTTCA
+TCGTTATCAGATGATTCCACCCAGCCGCTGTATTTAAATGTGCCACCGAGTTCAAAATCTTCATAACGATAACTTCCAGTCAAGCCAATGTAGGGCATTT
+TAAAACGTTGTTTGTAGCCGATTGCTCTTTCTCCATTCGGGAAGGAGCCGATATCATCTCTGAATCCCTCCTCAGAACTGTAGATATAGGAACCACCTCT
+GGCTGTAAAGCTATAACGGCTTTCCTGATATCCGGCCATGAGTCCCAGGCGGTAATTGGGTTCGTTGAGGAGCCAGCCTTTGATATTCAGATCAAATTCG
+TTGGCATAATTGAGTTGTGTATCAGGGTGTCTACTTTCATCCGTCCAGGTTCCGGGGTTACTGGAATCCATCCAGTCCTGATCGACCATATTGCCACCTC
+GGCTGCCGAGAGTTGTCCAGCCAGCAGCCCCGATAGATATCTGGGGCATCAAATCCCAATTAATTGCACCTTTAATAATTGCAGCGTTATTGAATTTCCA
+GTCGAGTTGACTGACTTTTCGGCCTCCTTCTTCGGCTAGATAAACACGCTCTTTTGTTTTTCCGCTCAGAGTTCCAAGACTAATGTCCGCATTTATGTTG
+TCAGGAGTAAACGATAAAGTCTCGGTAGAAGCAAAAGAGCTGATCGCAATAGGGGTTGTCAGGACTATTCCCAGAAGTTTCGCCCGCATAAAGTTCTCCA
+TTCAATCGTTTTAATGATTGAATATGTATTTTATATCTAACTTAATGAGTCAATTACATATTGCTCCACTGTTTATATTTTGTTTAGTATTGAATGATTA
+TCACAATGCGCTATCTGTTTTGGTTTAATTATCTGTTATTGTTTCATATTTCGGTTTTACTGTGTGGTTTTTATGCTTTTGTGGTGCTTTTATCTATTTA
+AGTGCCATGCCTTTAGAGGCATATAAGCGAAAATAGCATGAGGTTTATCCTCAATTACTATGTTTTTAGTACAAAAAGAGGGACAAAACTGAGACACATA
+AGGCCTCGCAATGGCTTGCAAGGCTTTACATGTTTTGAGGTAGTGGGACGTGTGAGCGCAGAGATGGCGCGGTAAGTTGTTGACTTAAAATGTCGTTCTA
+GGAACTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATTTCTTCCTCATTTATGCCCGTCTTATCCGTTTCCGCTTTGCCCTTCACCA
+CATCACTTTTTGTCGCTGTTTGGCGAGATAATTCAACGGTGTCAGGCCGTAAAACGCCTTAAAACAGAGATAAAGTACGACGTGCTGCTATAGCCACATA
+ATTGCGCCACCTGAGTGATATTTTTGTTATCCATCAATAACATCTGTACGGCGTAACGCATACGACACTCTGTGACAATCTGGCTATAGCTGGTATTTTC
+GTTTTTAATTTCTTTTGAGCAGGCTGGGGCTTAAACATAGCGAACTGGCGACAATTCGCAGATTCCAGTAATGCTGAATATCGCTTTGAATAATGCGGCA
+GACGCTGTCGCGGACGCTGCTGCGTAAGATATACATCAGTAGGGCAATAAACCGCGATTGCTCAAGAAAGTTAGACAATACGGTAAAAGCAATGCGCGCG
+TCAACTCCGCTTCGCAGGGTCTGCTGGGTTGCTGCTTGCTGTGGTTGGCGGCTAGCCGGAACACTTCCGGTGTACGGCTATGACAAGCGATAACCGGGGT
+TGCCAGCCGCGACCAGGGCTTTACACAGGTTAAGTTCTTATTTAAAACAACAGATAATCGTTGATGATGTTACGGTTGATGTGGGTGATTAATACGTGAT
+TTAACGTTGAGAGTTCAATGACGTTATTGTTGCACGCGAAGGCGGCCAGGTAGTTTTCGGAAGGGTAAACGTAGCATGGTTATTGACGCTTACCTCTACC
+TCTTTTCGGTCAGGATCACCACGCAAGGTTCACTGCTGCTCAATTGCATTTCGCACTCCTCAGATATCAGAAACTCCGCTCAAAGGATCTATGCTTCCTG
+CATGAGTGATCGGCCCGTTCGCCGATAACGATCTTCTTTCTTTAGCACGCTTTTAGCAATTAATCTTGATGGAATTCTGATGAGAGCGAAAGAGGTAAGC
+CAGGTCGTACCCGACTTACCTGGAGGAGATTTAATACTCGAGAATGCCGTGCGCGACGGGCAAATAGCGCAGAGAGAAATAGAGAGTGTCTTTACCGCAA
+GAGGAACGTTTCGCTAACAGCGAGGCAATTTCTGCGTCCGGTTTCGGTTTCGCTGTAAAGGTTTTGCCTTTGCCGGCGACAAAAGTTCATAAACAACGCC
+GCTGGCAGGGCGGGACTTTGGCAATCGGCGCTGGCCTGTAAATAACGTTCACGCTGTTCAGCGGTCAGTTTATCCACGCCGCTGCCATCCTGTACCCAGA
+CATTAACGCCGGTTGCTTTAACGTGTTCCAGCAGTTGGCGATAGCCATCGGGCGACATGTTTCCGGCGAAAAACTACTGATATAAACCGGTTTTGCTGAA
+ACATCGCTAATCAGCCGCTGCGCGTTGTTTAACCATGTTAGCAAAGGCTGACGGGCGGCTTCGCTGCGCCAGTTCAGGTCGTCAATTTCCGCGCTGATGT
+ACCAGCCATCCGGCGTTATGCCAGGCGCGGCGCTCCATAATCTGGCTTGCTGGAGATCGGCAGCCAGCAGGCGATTAAGATAGCTTTCCAGCGCTGCGGA
+CGACTGTTTCTGGTGCATAAAAATTCCGGATCGGCGTTCAGCCCGACAATAAGCTTCAGACCAGCCTGTTGCGCAGCTGCGGCCCGCTTAAACAATAACG
+TGCGCTGTTCTGGCTGGGTAAATGCATCGCCGTAACGGGTCCATTGCAAAACAAGGGTATCGAAGCCTTGCAAACGTAACTGACTCATCAGCCCCTGCCA
+CTGGGTATCGGTAACCTGACTATCTCGGTTTTGTGGTTGCCAGATAATACCTTTCATCGCAAAGGAAAAAGGGCTGACCAAAAGCAGTGTCAGCAATACG
+AAAATGAACTTACGCATTTACCAGTGCACTCCAATGGTGAGAAACGCGTTGTTGCGCTCTCCGTTACGTTGATTAATCGCCTTAAAGGTATGTTGATACT
+CGACGCCGAGACTGACTTTGTGCGGCCAGGCGTCGTAGTGCGTCTCGCCGGTCCAGATATTCCAGCGGACCCCGACTCCGCCAAGCTGCGCGCCCTGAGT
+GCCTTTATCACGATAGCCGTTGTCCTGAACGTGAGCGTAAGGCTCAATAGTCTGTCCGTTAGCTACCTTCTGATGCCAGCTGACGCGATAATCTGCCGTC
+CACGCCTGAATATCCTGGCGGATATATTGCGCCGCATCGAGGTACAGGTTTTGGGCAAACCAGCCTGAACCGTTCGGGTGCCATTCGTCGCTGTATTTGC
+CGCCATTAAAGAATGAGGCGCTGGCGCGCAGCATGGTATCGGATGCGCCATTTTGGCCGTTCAGCGGCAACTGCTGTTCGACGGCGATGAAAAGATCTGA
+TCGCGCAGCGGCTTCCAGCGCAGACCGGTGCCGGACATCGGATTTTTCACCGGCATCATCACCCCGTTTTCTCCGGTATCGGCAAAGACGCGGCTATAAA
+CTGAGAGCAGGTCGCCTTCCAGCAGCATATTGCGTCCGATGCGGTACTCGGCTTCCAGTTGTCCGTAGCTACGATAGCTTTTCCCTGGCGCTGCGCCGCC
+GACATTATTGTTAGCGGTACTCATTGCGCCGGAACGCAAGCCGATGGAAGAATCGAAACTGAACGTCCAGCGGCGACCGACCTCCTCATGCAAACGGCGG
+AAATTGAAGCGTTGTTGATTTTGTTCTGGGGTCAGTGGGGTTATCAGCGCCTGATTATCAATGTCATCAATCACCAGCCGGGCGTAGTGCTGCGTCGCAG
+GCATGTCATCCAGACGCTGGTTCACGTAGGCCAGTTGTCGGATCAGTGCCGGATCGTCCGGAAGCCCTTTATGCGCCGGTTCGAGCATTTCCCGCGACTG
+TGCGATATCACCGCTATCCCACAAGGCGTAACCAAGCGCTGCCTGGGTGTTGCTATTATTCGGTTCCAGTTCCAGCGCGGCGCGCAAATCACTCACCGCG
+GCCGGGACATTATGACGTTGGCGATAAATTGTCGCCCGCGCAACGTAAGCGTTGGCAGAAGGCGCAATATTGATTGAGCGCGTGAGATCGTTCAGTGCGA
+GTTCCGGCTGACCAGGAATGTAACGTTGCGCATGCAGCCACCAGTAGAGGGCATTGCTTCCCAGTCCACGTTTTTCTGCCTGTTGTAGCCAGCGATCGCG
+AGCCGCACCATTTCCTGCCGCCTGGGCGGTATTGGCAGCAGCAAGCAGATCCTCATTGCTCATGTCGTGAAGACTGATTTTCTGCCAGGCCGCCAGTGCG
+GTGGCGTAGTCCTCAACCTGATACGCCTGATAGGCTACCGCACGATGTTGCCAGGCGCTCGGTTGTCGTTGTTCGGCCTGAAGCCATGCATACAACGCCA
+CACCGGGTAGCGTGTCCCGATAACACTTTGCCAGACGGTTCCAGGCGGCGGCATCGTAGGAAGGCGACATATCGCCCAGCAAGCGAACTATTGCCGGGCA
+ATTATCTGCAATACCCGGCAACTGACTTTGCCACTGACGTTGCTCCGCCAGCGGTAAGGGTTTCGATAAAATCGCCACCTTCGCCGGCGTTGCCAGGTAA
+GGATGACTTTCCAGCAGAGACGCCAGTCGCGCCATTAAAGTCTGGCTGACACGCGCATCGCCCTGGAAAGGATAGCGTTGCAGCAATAAATCGGCAGCTT
+CGCGTGACTGCTCGTTCTGCATCAGTTGCCAGGTTAGTTGATCCAGGCGGGTAAGATTTGCCGGTTCTTGCTGATACAGCAATCGTGCCAGACGCAGAGC
+TTCAGCCTTGTTACGGGTCGCCACGCTGACAGCATAACGCTCCTCAAGCATTTCATTGGCGGGGAGGGTGGCGAGCAGTTTTGCGCTGCGTCGTACTGAC
+CTTCTTTAACAGCACCGGTAGCGTCGCGCCAACAACATACTGGCGGTTGTCGGCAAACTGTACCGTATAATTCGCCAACGCCTGAACGGGGTTAGCGCTG
+TATTTAGATAACAGATAGAGCCAACTTTTCTCTTGTGCGTCCGTGGTAAATAGTGGCTTATTTTCAATGAGATAATGCTGGAGGCGTGCTTTTTCGCCAC
+GATAAGCCAGCGCGGTCGCGTAAGTAATATATGACTGAGGATCGGTGAAGATCCCCTGTGATTGCAGTGCCAGGATCCGATCGTCCAGCTGCCCGGCAAG
+AAGCACGTCAAACCACTGACGGCGTTCTGCCGCGCTTAATGTGTTCTGCTGGCGTGCTTCATTGTATAGCGTATCTGCCTGGGACCATTGTTTCAGGTAG
+ATTGCCCGTTGCAGCAGATCGGTTCGCAGCGTTTTTCCTTCCGGCGATGCAGCAAACGTCGCATCGTTCAGTTGCGCTCTGGCGACAGGTAACTGTGCCA
+GCCGCAGGGCATTCTGCCCGACTTCACTGCGACAACGCAGGGTCGGCGCAGCATCGCACGCTTTTGCTGGGCAAGCAGTTCTTCAACTGTCGTAACGCTT
+TTCACTTCAACCGGAATAGCCGCCAGACTGCGCTCAAGTCGGGCATCTCCTGGGTGACGTTTCAGTTGATCCTCAAGCAACAGCCGCGCCCGGTCATCAT
+GACCAAAATGGCGATAGGCTTCCGCAAGGTATAAAGTCAGCGGAATATTATCCGGCACCTGCTGGTGTATATATTCAAATTCGCGGATGGCGGTTGCTTC
+GTCGTTATTTTTCTGTGCCTTCAGCGCTTTATCGAGACGGGGATAAATAACAAAATGGCGATAATCGCTCAGCCCCAGCTCTTCTGCGCTGGTGCCGATA
+TTGTCTGCGAGTGCGCTGGTACTCAATAAAGACGTCAGCAGTAAACCAGACCATCCGATGACGCGATTAAGGTTATTCTCCTTCATTTTCGGACTCCAGT
+TGCGCAACCTGTTCTGTGTTTAAACCTGCTTTGAGTAATAGTGATTGCATCGAAACTTGTAATTCGCGTTGAATTGTCAGGACGCGATCCAACGTTTCCT
+GGCTGATAACGCCTTCGGTGACCAAAAACTTGCCGAGCGGCAGAGAACTGCGTTCATGGCGCAATAACAACACGTTAATTGCTGAACGATTAATATGACC
+GAGCGTGGTCAGTATTTCGGCGAACAGGAACTGATGCGGCACATATTGCCGCCAGATTTCACCGGCCTGCTGTTCCGTGAGCCACTGATGCTGAACCGCA
+TTGTACAACATTGCCCGCGGATCGTGACCGCGTCGGCGTGCATACCAGTGACGTAACCCTGTGACAATTTGTCCCCGCAGAACAATGACGTAACGCACTT
+TGCGTCCGACTTTACGCGTCAGGGCCGCCAGCGAAACCGGGTCAATACCATCTTCACTGCCGACAATTAACTCGTCATTTTCCAGACGCAGCGGCAGTAC
+CGCATAATGCAGCGCCACGGAGGCCGGCATTTCGGCAATCAGCGAGGAAGGGATCTGCCAGGCATCGATGGATTCCCACGCCACGCCGTTTTGCTCTGCC
+AGCGCCTGTGCCAGCTGCTCGGCGCTAATCAGCCCTGCATCAGCATTGAACCGCCCAGGCGTAGACCTTCGACGCGATTACGCAGTGCTGTATCGAGTTG
+TTCTTCAGTGATGACCTGATTTTCCAGCAGAATTTGACCTAACGGGCGCAACGAGCGGGTATCGCCAGTCACGCTGGGGAAGTCATGCGTTGTTTTATCC
+CACGCCACGCGACGTGGATCGCCGTGTTGAAGTACCTGTTTTAGCGCGCGCCAGTTGGCCATGAAGTTAATCAGGTTGCCCCAGAAAAGACGCAGGACGG
+AAAGCAGCCCCTGCGTCAGGCCGTAGTAGCCAGTAACGAAAATCACCCGCTGCACGATGCGGTTAACCATCAAACCAAAGTTTAGCCACAGCAGGGTCAT
+TAACCATGCGCTGCCGCTGAAAATAGAAAGGAAATGCCAGGCATCGGGCCACAAACTTTCATACGCCAGCAACAGCAAAGCTGGATCATCACCAGCATCG
+CGAGGAAGCTGACAAAGTTACTGATTGCCCTTTGCGGTCGCGCCAGAGAAAGTAGTTCAGCGTCAGGCTGGAGGTCCATTTATGGGTTTTAAAGCCTTGG
+AAAACAATGCCGATGATCCAGCGGGATTTTGTCGAACCGCAGTCGAAAAGGTATCGGGGAAATATTCGCGCACGCAGATCATGTTTGATGTCCGCGCGTG
+CTGTAAAATTTACGCTGCTCGCGTTCTTTGGCTTCGTCCACCACCGGAAAACGGACAAAATTTCCGTCATACCTTTTTCTTTCAGGCGGAAGCCAATGTC
+GTAATCTTCAGTAAGACTCTGCACGTCGAAAGCAATACCGTCACCGTCAGCTAACAGTGCGGTCACGGCGCGGCGGCTGAAACAGGTGCCGACGCCTGCG
+CTGGGCACTTGTCCGGCGAGGGCTTCACGCACCGGAACATCTTTGCCATGCAGCTCTGAAAACTCATCAATGTAAGTCATGCTGGTGAAGTGCGTCCATT
+CGCGTTCGAACGGATACACCGGGATCTGAATCAGATCTTTACGCTCGACCAGATAGTTGAACAGACGCAATTCCATCGGTGAAATCACATCTTCGGCGTC
+ATGCAGAATAAAACCAGCAAAAGCGAAATTGGCGCTACGCTCAAATTGGGTGATGGCGTCCAGCACGTTGTTCAGACAGTCGGCTTTGCTGGTGGGGCCA
+GGACGCGCGCAGACTACCTTATGCACATTCGGGAAGCGAGCGCACACTTCGTCAACATCACGCTGAGTATCGGGGTCGTTGGGGTAGGTGCCAACAAAGA
+TATGATAGTTTTCGTAGTCGAGCGTGGTCGCCGCCAGCTCGGCCATATTGCCGATGACGCCCGTTTCATTCCACGCCGGAACCATAATCGCTAACGGTTT
+TCATCTGGTTTATACAGTTCGCGGTAACTCATTCGCGGGTAGCGGCGATAAACACTCAACTTGCGTTTAATGCGGCGTACCCAGTAGACGACATCAATAA
+AAATCGTCCAGCCCGCTGATGAACATGATGACCGCTAACGTTATCGCGATTACTTTTAAGCCGTAGAGCCAGGTAGCAAAAACATCAAGAAGCCAGTCCA
+CACAAAACCTTACATTAACGCTGGTTATGTTTAGGGTGGCGTATATTAAGGTTTTTATGAATTGTGACAGCTTTTACCATTAATAGGTATGACTATTGCG
+GCACGTTATTTTTACACTGGTTATAAAAGTTGCCGTTTGCTGAAGGATTAAGCGGGTAATGTGATAACAAACCTTGTCCCCGCGCATCCGACGTTACCGC
+AACCGTGCCTTTATGCGCGACAACAATCGATTTCACTATCGCCAGGCCAATACCGCTACCTTCACCTTTTCGCTGGCGGGAGGGTCAACGCGATAGAAAC
+GGTCAAACAATCGCGGTAAGTGCTCGGGCGCAATGGGCGTACCGGGGTTTTCGACGATAACTTGCACCAGGTGATCGACCGTCTGACAGCGCACTACAAT
+TGTCTCTCCGGTTGGCGTATAACGCAGGGCGTTCGAAAGCAGGTTGCTTAGCGCCCGACGCAGCATCAGCGGATCGCCCGCGACCTGACACTTGTCGCCA
+ACAAACCGCAACTCCACGCCGCGATCTTCCGCTAACGCCTCGAAAAAATCGAACACTTTGCCGACTTCATCCGCCAGGTTGAGCATTTTCTTTTCGGGGA
+TTAGCTGGTTGTTATCGGCCTGAGCGAGAAACAGCATATCGCTGACCATTTTCGCCATTCGCGTCAGCTCTTCGAGATTAGAGTAGAGCACATCTTCCAG
+CTCCTTCTGGCTGCGCGACTGGCTGAGGGCGATTTCGGTTTGCGTTATGAGATTCGTAATTGGTGTGCGAATTTCGTGAGCGATATCCGCTGAGAAATTG
+GACTGGCGGGTAAAGACATCCTCAATACGCTCGATCATATGGTTGAACGACAGTACCAGCTGTTCCAGCTCAATGGGCACGGTCTGCGGGTCGAGGCGAA
+CGTCGAGATCTTTCGAGGTAATATTCTGGATTTGACGGCTGACGCTGCGGATCGGCGCGTGACCTTTATGTACCGCCAACAGTACGATAAAGACGATCAG
+GATGCTGATTACCGATGCGGTCATAATAAGTTTATTCATCAAATCATTTATGTAATGAAGATGAAAATCGATCGAAAGCGCGATGTAGAGCGTATAAATC
+GGTTTGCCGTCCACCAACGGGCCAACCGGCAAGTTAATCATCCGCCAGTTGCTGTGTTCCATATGCCCGTGACCGTGGCCTGGCATCATCATCGTCGGGC
+CGGAAAGGAGATACACCTCGCCACCCTGAGCGTCTTTATCGGGTATGGCGTCACGCGTAAACTCGCGGATATCCGGCGCACCGGGGAGTGATACACCGTT
+TTACCCTGACTATCTGCCAGGGAAATCAACACATTGGAATAACCACTGACGATATCTTCCAGCGTCATTAAGCGTCGGGCTTGCGTTTCGTCAGGGTGAT
+TTAGTACCCGTTCAAGGGTGGCGCTAATCTCTTTAAATCATTAATATCCTGCTCGGCAAAATGAACTTTTACTGAGTGGATCATGATCCATGCAAAGGCG
+AAAAACGCCGCGATGGTGGCCAGGCTGATAAAAAGGTCAGGCGGGTTGCCAGCGAAAACGGGCGCTGAAATGGCTTACTGACCATCCGGCACCTCAAGCA
+TGTAACCCACGCCGCGCACGGTCTGAATTAGCTTCGGCTCAAAGTCGTTGTCGATTTTGCCGCGCAGCCGCTTCACCGCCACATCAATAGCATTGGTATC
+GCTGTCAAAATTCATGTCCCATACCTGCGAGGCGATAAGCGAGCGGGGCAGCACTTCGCCCTGATGGCGAAGGAAGAACTCCAGCAGAGTAAACTCTTTA
+CTGGTCAAAGTGATGCGCGTGCCGCTGCGGGTGACTTTGCGGCTGACGAGATCGACCATCAAATCGGCAACCTGAAACTGACTTTCGATAATCACCGCCG
+CCCCGCGCCGCAGTAATGTGCGCACCCGCGCCAGCAGTTCAGCAAAAGCGAATGGCTTCACCAGGTAGTCATCTGCCCCAACTCCAGCCCCTTGACGCGA
+TGTTCAATGGTGCCAAGCGCGGTAAGCAACAGAATCGGCATCCCTTTATTGGCGGAGCGTAACATGCGCACGATATCCCAGCCGTTCACGTCCGGCAGCA
+TAATATCGAGGATTATCAGATCATAATCACCGGTCATCGCCAGATGGTAGCCATTCAGCCCGTTGTCGGCCAAATCGACCACAAAACCGGCTTCGGTTAA
+CCCTTTGGTCAAGTATTCTCCGGTTTTCTTTTCATCTTCGACAATCAACAGTTTCATATTTCCTCCGCATGTTGCCCGGGCAATTCTAGAGTAGCGGGAT
+CAGATGGCAATCGCTTATTGGCAAAATGACAATTTTGTCATTTTTCTGTCACCGGAAAATCAGAGCCTGGCGAGTAAAGTTGGCGGCATAAAATCACCAG
+AAATTATGAGCCTATGTCTCCTTGTAAACTTCTGCCATTTTGTGTGGCCCTTGCGCTAACCGGTTGTTCACTGGCACCGGATTATCAGCGTCCGGCAATG
+CCCGTGCCGCAGCAGTTCTCACTCAGCCAGAACGGCCTGGTTAACGCAGCAGATAACTATCAGAACGCGGGCTGGCGCACCTTTTGTTGATAATCAGGTG
+AAGACGCTGATTAGCGAGGCGCTGGTGAATAATCGGGATTTGCGCATGGCGACGCTGAAAGTGCAGGAGGCACGGGCGCAATATCGTCTGACCGATGCCG
+ACCGCTACCCACAGCTCAATGGCGAGGGCAGCGGCAGCTGGAGCGGTAATCTTAAAGGGAATACCGCCACGACACGGGAGTTTTCGACCGGCCTTAACGC
+CAGCTTTGACCTCGATTTTTCGGTCGCTTAAAGAACATGAGCGAAGCCGAGCGACAAAATTATTTAGCCACTGAGGAAGCTCAGCGCGCGGTGCATATTC
+TGCTGGTTTCTAATGTCGCGCAAAGCTATTTCAATCAGCAACTGGCGTATGCGCAATTGCAAATAGCCGAAGAAACGCTGCGTAATTATCAGCAGTCATA
+TGCGTTTGTCGAAAACAACTGTTGACAGGTAGCAGTAATGTTCTGGCGCTGGAACAGGCTCGCGGGGTGATAGAAAGTACCCGCAGCGACATCGCTAAAC
+GTCAGGGGAACTGGCGCAGGCGAATAATGCATTGCAACTGTTGCTGGAAGCTACGGCAAGCTGCCGCAAGCGCAGACAGTAAACAGCGACAGCCTGCAAA
+GCGTTAAATTACCGGCGGGATTGTCGTCGCAAATCTTATTGCAGCGCCCGGATATTATGGAAGCTGAACACGCGTTAATGGCGGCTAATGCCAATATTGG
+CGCTGCACGCGCGGCATTTTTCCGTCTATAAGCCTGACCAGCGGAATATCGACCGCCAGTAGCGATCTATCGTCATTATTTAACGCCAGCAGCGGGATGT
+GGAATTTTATACCCAAAATTGAGATCCCCATTTTTAATGCCGGACGCAACCAGGCCAATCTGGATATCGCCGAAATTCGCCAGCAGCAGTCGGTGGTGAA
+TTATGAACAGAAAATCCAGAACGCCTTTAAAGAAGTGGCAGATGCGCTGGCATTACGTCAAAGCCTGAACGATCAAATTAGCGCCCAGCAGCGTTATCTG
+GCATCGCTGCAAATTACTTTGCAACGGGCGCGGGCATTATATCAGCACGGCGCAGTAAGTTATCTGGAAGTGCTGGATGCCGAGCGTTCTTTATTTGCAA
+CCCGACAAACTTTACTTGATCTGAATTATGCCCGTCAGGTTAACGAAATTTCTTTGTATACCGCACTTGGTGGCGGTTGACAGCAATATACTCGTCATAC
+TTCAAGTTGCATGTGCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTTATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAAT
+TATTTAGAGTATGACTTTTAACTCAGGAGAGAATAAATGAAAAAGCACTGCAAGTCGCAATGTTCAGTCTGTTTACCGTTATTGGCTTTAATGCCCAGGC
+TAACGAACATCATCATGAAACCATGAGCGAAGCACAACCACAGGTTATTAGCGCCACTGGCGTGGTAAAGGGTATCGATCTGGAAAGCAAAAATCACCAT
+CCATCACGATCCGATTGCTGCCGTGAACTGGCCGGAGATGACCATGCGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAA
+GTGGCGTTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAACCCAGGTTTAATGAGATGAAAAAATCGCGCTTAT
+TATCGGCAGCATGATCGCGGGCGGTATTATTTCTGCGGCAGGTTTTACCTGGGTTGCAAAGGCGGAACCGCCTGCAGAAAAACGTCGACCGCAGAACGTA
+AAATCTTATTCTGGTACGACCCAATGTATCCCAATACGCGGTTCGATAAACCAGGTAAATCGCCGTTTATGGATATGGATCTGGTGCCGAAATATGCCGA
+TGAAGAGAGTTCTGCGTCTGGTGTGCGCATTGACCCGACTCAGACGCAGAATCTGGGGTGAAAACGGCTACCGTCACGCGCGGACCGCTGACTTTTGCCC
+AGAGTTTCCCGGCGAATGTCAGTTACAACGAGTATCAGTATGCCATTGTGCAGGCTCGCGCTGCCGGGTTTATCGACAAGGTGTATCCGCTTACCGTGGG
+CGATAAAGTACAAAAGGGCACACCGCTTCTCGACCTGACCATTCCTGACTGGGTGGAAGCGCAGAGTGAGTATTTACTGCTGCGCGAAACCGGCGGTACG
+GCGACCCAGACTGAAGGCATTCTTGAGCGGCTGCGACTGGCGGGAATGCCGGAGGCGGATATTCGCCGCCTGATCGCCACGCAAAAATCCAGACTCGCTT
+TACGCTCAAAGCGCCCATTGATGGCGTGATCACCGCGTTTGATCTGCGCGCGGGAATGAATATCGCCAAAGATAACGTGGTAGCGAAAATTCAGGGTATG
+GACCCGGTGTGGGTCACTGCTGCGATCCCGGAGTCTATCGCCTGGCTGGTGAAAGATGCCTCGCAGTTTACCCTCACCGTTCCGGCGCGACCGGATAAAA
+CACTCACCATCCGCAAATGGACGCTGCTACCTGGCGTGGATGCCGCGACCCGCACGCTGCAGCTGCGTCTGGAAGTCGACAACGCCGACGAGGCGCTAAA
+ACCGGGCATGAACGCCTGGTTGCAACTCAACACCGCCAGCGAACCGATGCTGCTCATTCCGTCACAAGCGCTGATTGATACCGGCAGCGAACAGCGGGTG
+ATTACCGTTGATGCCGACGGGCGCTTTGTACCGAAACGCGTTGCTGTTTTCCAGGCATCGCAAGGCGTCACCGCATTACGCTCTGGTCTGGCGGAAGGTG
+AAAAGGTGGTTTCCAGCGGCCTGTTCCTGATTGATTCCGAAGCCAATATTTCTGGCGCACTGGAGCGGATGCGCTCTGAAAGTGCTACCCATGCGCATTG
+AGGGAATAACCAATGATTGAATGGATTATTCGTCGCTCGGTGGCGAACCGTTTTTGGTGCTGATGGGCGCGTTGTTTCTGAGCATCTGGGGCACCTGGAC
+CATCATTAATACGCCAGTGGATGCGCTGCCGGATCTCTCCGATGTGCAGGTTATTATTAAAACCAGCTATCCCGGTCAGGCACCACAAATCGTTGAAAAT
+CAGGTGACTTATCCGCTAACCACCACCATGTTGTCGGTGCCTGGCGCGAAGACTGTGCGCGGTTTCTCACAGTTTGGCGACTCTTATGTGTATGTCATTT
+TCGAAGATGGCACCGATCCGTACTGGGCGCGTTCGCGGGTGCTGGAGTACCTCAACCAGGTACAGGGTAAGCTGCCTGCGGGAGTCAGCGCCGAGCTGGG
+GCCAGATGCCACGGGTGTTGGCTGGATCTATGAATATGCACTGGTGGATCGCAGCGGTAAGCACGATCTGGCCGATTTACGCTCATTACAGGACTGGTTT
+CTCAAATATGAGCTGAAAACCATCCCTGACGTTGCGGAAGTGGCGTCGGTGGGCGGTGTGGTGAAAGAGTATCAGGTGGTTATCGATCCCCAGCGCCTGG
+CGCAGTATGGCATCAGTCTCGCCGAAGTAAAAGCGCGCTGGATGCTTCAAACCAGGAAGCGGGCGGTTCGTCGATCGAACTGGCGGAAGCGGAATATATG
+GTGCGCGCCAGCGGCTATCTGCAAACGCTCGACGACTTTAATCACATCGTTTTAAAAGCCAGTGAAAATGGCGTGCCCGTTTATCTGCGCGATGTTGCGA
+AGGTCCAGATTGGCCCGGAGATGCGCCGGGGCATTGCCGAACTAAACGGCGAAGGCGAAGTGGCGGGCGGGTGGTGATCCTGCGATCCGGCAAAACGCCC
+GAGAAGTGATCGCCGCCGTGAAGGACAAACTGGAAACGCTGAAAAGTAGTCTGCCGGAAGGCGTGGAGATAGTTACAACATACGATCGCAGCCAGCTCAT
+TGACCGCGCCATCGACAACCTCAGCGGCAAGTTGCTGGAAGAGTTTATTGTGGTGGCGGTAGTCTGTGCGCTGTTTCTCTGGCATGTGCGCTCGGCGCTG
+GTGGCGATTATTTCGTTGCCGCTGGGGTTGTGTATTGCTTTTATTGTCATGCACTTCCAGGGACTGAATGCCAATATTATGTCGTTGGGTGGCATTGCGA
+TTGCCGTCGGGGCGATGGTCGATGCTGCTATCGTCATGATCGAGAATGCGCATAAACGGCTGGAAGAGTGGCAGCACCAGCATCCTGACGCCACGCTGGA
+TAATAAAACGCGCTGGCAGGTGATCACCGATGCGTCTGTTGAAGTGGGGCCGGCGCTATTTATCAGTCTGCTGATTATCACGTTGTCGTTTATCCCGATC
+TTCACCCTGGAAGGGCAGGAAGGGCGTCTGTTTGGCCCGTTGGCGTTCACCAAAACGTATGCGATGGCGGGTGCGGCGCTGCTGGCGATCGTAGTGATCC
+CGATCCTGATGGGCTACTGGATCCGTGGCAAAATTCCGCCGGAAAGCAGTAACCCGCTCAATCGCTTTTGATTCGTGTTTATCATCCGCTGTTGCTGAAA
+GTACTGCACTGGCCGAAAACCACGCTGCTGGTGGCGGCGCTTTCGGTGCTGACGGTTCTCTGGCCGCTCAATAAAGTTGGCGGGGAATTTTACCGCAGAT
+CAATGAAGGCGACTTGTTGTATATGCCATCGACGCTGCCGGGGATTTCCGCAGCAGAGGCGGCGAGTATGCTGCAAAACCGACAAGCTAATTATGAGCGT
+ACCTGAAGTGGCGCGGGTATTTGGCAAAACCGGGAAAGCGGAAACCGCCACCGATTCTGCTCCGCTGGAGATGGTAGAAACGACCATCCAGCTTGCCGCA
+GGAGCAGTGGCGGCCAGGCATGACGATGGACAAAATCATTGAGGAACTGGATAACACCGTGCGGCTGCCGGGGCTGGCGAATCTGTGGGTGCCGCCAATT
+CGTAACCGTATCGATATGCTCTCAACCGGCATTAAAAGCCCCATCGGCATTAAAGTTTCCGGCACTGTGCTGGCGGATATCGACGCGATGGCTGAGCAAA
+TTGAAGAAGTAGCGCGAACGGTGCCAGGCGTAGCTTCTGCGCTTGCCGAGCGGCTGGAAGGTGGGCGCTATATCAACGTTGAGATTAACCGTGAAAAGCC
+GCACGTTACGGTATGACGGTGGCGGATGTGCAGTTGTTTGTGACTTCTGCGGTGGGCGGGGCGATGGTTGGCGAAACGGTGGAAGGGATTGCCCGTTATC
+CAATTAATCTGCGTTATCCGCAAAGCTGGCGCGATAGTCCGCAGGCACTGCGCCAGCTGCCGATCCTGACGCCGATGAAGCAGCAAATCACCCTGGCAGA
+CGTGGCCGACATTAAAGTCTCTACCGGACCGTCGATGCTGAAAACCGAGAATGCGCGCCCGACGAGCTGGATTTATATCGATGCCCGCGATCGTGACATG
+GTGTCGGTGGTTCACGATTTGCAAAAAGCGATAGCTGAAAAGTGCAGTTAAAACCGGGCACCAGCGTGGCATTCTCCGGGCAGTTCGAGCTACTGGAGCG
+CGCCAACCATAAGCTTAAACTCATGGTGCCGATGACGTTGATGATTATCTTCGTGCTGTTGTATCTGGCGTTCCGTCGGGTGGGCGAAGCGTTGCTGATT
+ATCAGCAGCGTACCGTTTGCGCTGGTGGGCGGCATCTGGTTGCTGTGGTGGATGGGCTTTCATCTTTCCGTGGCGACGGGCACTGGCTTTATCGCCCTCG
+CCGGGGTCGCCGCCGAATTTGGCGTGGTGATGCTGATGTATTTACGTCACGCCATAGAGGCCGTGCCGTCGTTGAATAATCCACAAACATTCAGCGAGCA
+GAAGCTGGATGAGGCGTTATATCACGGCGCGGTCCTGCGCGTGCGCCCGAAAGCGATGACGGTGGCGGTGATTATCGCCGGTCTGCTGCCGATTCTGTGG
+GGAACGGGGCTGGTTCAGAGGTGATGAGCCGGATTGCCGCGCCGATGATTGGCGGCATGATCACCGCACCTTTGCTGTCGCTGTTTATTATCCCGGCGGC
+GTATAAGCTGATGTGGCTGCACCGACATCGGGTACGGAAATAAAAGCAGGATACCCCGTTTAACCGTGTGGATTGTGTCTTGCGACGATGGGCACTAAAT
+GTTAAAAGGTGCCCTCAACAAAAAGACACACAGGGGAAAGGCGTGAAAACGCGTCAACCGTATCGGAAGATACTGCGTCGAATCAAGAGCCGACGCTTCA
+TCGCGGATTACATAACCGTCATATTCAACTGATTGCGTTGGGTGGCGCAATTGGTACTGGTCTGTTTCTTGGCATTGGCCCGGCGATTCAGATGGCGGGT
+CCGGCTGTATTGCTGGGCTACGGCGTCGCCGGGATCATCGCTTTCCTGATTATGCGCCAGCTTGGCGAAATGGTGGTTGAGGAGCCGGTATCCGGTTCAT
+TTGCCCACTTTGCCTATAAATACTGGGGACCGTTTGCGGGCTTCCTCTCTGGCTGGAACTACTGGGTAATGTTCGTGCTGGTGGGAATGGCAGAGCTGAC
+CGCTGCGGGCATCTATATGCAGTACTGGTTCCCGGATGTTCCAACGTGGATTTGGGCTGCCGCCTTCTTTATTATCATCAACGCCGTTAACCTGGTGAAC
+GTGCGCTTATATGGCGAAACCGAGTTCTGGTTTGCGTTGATTAAAGTGCTGGCAATCATCGGTATGATCGGCTTTGGCCTGTGGCTGCTGTTTTCTGGTC
+ACGGCGGCGAGAAAGCCAGTATCGACAACCTCTGGCGCTACGGTGGTTTCTTCGCCACCGGCTGGAATGGGCTGATTTTGTCGCTGGCGGTAATTATGTT
+CTCCTTCGGCGGTCTGGAGCTGATTGGGATTACTGCCGCTGAAGCGCGCGATCCGGAAAAAGCATTCCAAAAGCGGTAAATCAGGTGGTGTATCGCATCC
+TGCTGTTTTACATCGGTTCACTGGTGGTTTTACTGGCGCTCTATCCGTGGGTGGAAGTGAAATCCAACAGTAGCCCGTTTGTGATGATTTTCCATAATCT
+CGACAGCAACGTGGTAGCTTCTGCGCTGAACTTCGTCATTCTGGTAGCATCGCTGTCAGTGTATAACAGCGGGTTTACTCTAACAGCCGCATGCTGTTTG
+GCCTTTCTGTGCAGGGTAATGCGCCGAAGTTTTGACTCGCGTCAGCCGTCGCGGTGTGCCGATTAACTCGCTGATGCTTTCCGGAGCGATCACTTCGCTG
+GTGGTGTTAATCAACTATCTGCTGCCGCAAAAGCGTTTGGTCTGCTGATGGCGCTGGTGGTAGCAACGCTGCTGTTGAACTGGATTATGATCTGTCTGGC
+GCATCTGCGTTTTCGTGCAGCGATGCGACGTCAGGGCGTGAAACACAGTTTAAGGCGCTGCTCTATCCGTTCGGCAACTATCTCTGCATTGCCTTCCTCG
+GCATGATTTTGCTGCTGATGTGCACGATGGATGATATGCGCTTGTCAGCGATCCTGCTGCCGGTGTGGATTGTATTCCTGTTTATGGCATTTAAAACGCT
+GCGTCGGAAATAAGGCATTCACGCTACATCCGACAAAACGATGTCAACCATCCGAAACCGCTCTCATCCATTCGATGAGAGCGGTTTTTAATTACTGCTT
+AAATGCACCCGCCAGAGAGCGAATATCATTGCCGGTTGGCGACTGATGAAGTCGCAGACCAAACTCTTCGACAATCGCAAATATGTGATCGAATATATCA
+GCCTGAATGCTTTCATATTCCAGCCACACCACGGTGTTAGTAAACGCGTAGATCTCGAGCGGTAAACCGTTATCACCTGGAGCCAGTTGGCGTACCATTA
+AGGTCATATCTTTACGAATCCGCGGATGGTTACGCAGATATTCGTTCAGATAGGCACGAAAGGTTCCAATATTGGTCATTCGGCGCAGATTTAATACCGA
+CTCCGTAGAACCTTGCTGGCGATTCCACTCATTAATTTCCTGATGGCGGCTGGTTAAATAAGGCTTTAACAAATGCGCTTTATTCAGACGTTGCATTTCG
+TCTTCATCAAGAAAACGAATACTGGTGACATCAATACTGATACTGCGCTTAATACGTCGCCCGCCAGATGCTGACATCCCGCTCCAGTTTTTAAAGGAGT
+CAGAAACCAGAGACCAGGTGGGAATAGTGGTAATGGTATTGTCCCAGTTACGCACTTTGACGGTGGTTAACCCAATATCGATCACCGCGCCATCCGCGCC
+GTATTTCGGCATCTCCAGCCAGTCGCCCAGTTTCAGCATATCGTTCGCGGAAAGCTGAATACCTGCCACCAGACCAAGAATCGGATCTTTAAATACCAAC
+ATCAGCACGGCAGCCATTGCACCAAGACCGCTGATCAGAATCGCTGGCGACTGACCAATCAGCAGCGAGATCATCAAAATGCCGACCAGAATCGCGCCGA
+TCAGTTTAATCCCTGAAATATCCCTTTCAGCGGTAACTGAGATGCTGCCGGGAATTTCTGCGCCAGATTCAAAATAACATCCAGCAACGAGAAGACTGAA
+AGCAGCGCATACATCATGATCCACAACTGCGCGCAGGTAGTCAGAATATCTGCCGCTTCGGTGCCTTTTGCAGCCAGAATACCGCCTGAATATTGACGAT
+AATCCCCTGCAGGGTAAAAGCTAAACGGTGGAAGAGTTTATTCTGGGTAATGATTTGCAACCAAAGCCGTGAACTGGCGATGGCACGTTTTCGAAGGTCC
+GCAGTACCACCCAATGCAAAATAATATGCACCACGACGGCGGTCAGAAAATAATACCGAAAATCATCACCATCGAGGTGGTGTGATCGATCTCAATACCC
+GCTAAATCTTCAACCTGGGATATTAAATCCTGCATAACGTCTCCTTTATACAACAGCAGCCTATGATGACGGCTGAAACAGGGTTATGCAAATCAGGAGA
+ATCTGAGAGGAAATAGCCGGGCAGATGCCCGGCAAGAGAGAATTACACTTCGGTTAAGGTGATGTTTTGCGGCAGACGAGATTTCGGCAGCGTAGCGTTA
+AAATCTTCAACGCTGTGATGACCTACCGGAACAACCACCAGACTGGTGTAGCCTTTCTCTTTCAGACCAAATTCTGCATCGAGGATGGCGGCGTCAAAAC
+CTTCGATGGGTACCGCGTCCAGACCCAGAGCCGCCACGCCGAGCAGGAAGTTACCGACGTTGAGATAAACCTGTTTTGCCATCCACTCTGCATCATCATG
+CAGATCTTTACGGTGCATATCAGCGAAGAACTTGCGACCTTTATCGTTCGCGGCTTTCGCTTCCGGCGTGGCAAAGCGGCCATCGGCATCTTCCTGGTCA
+ACAACCAGCTTCAGCCAGACATCGTCCATCGCGGTTTTGCACAGAACACCACGACGTGCGAGGCATCAAGCATTTTACGCTCGTTGAACACGTAATTACC
+GGCAGCGGATTTGGCAACACGCGCTTTACCTTCTTCCGTGCTGGCAACAATAAAATGCCACGGCTGGGAGTTGGTGCTGGATGGGCTGTATTGCAGTAGC
+GTTTTGATCTGCTCGGCCTGTTCCGGGGTAAGTTTTTGCTGGCATCAAATGCCTTAGTGGAATGACGCTTTAAGGCGACAGAAATGATATCCATAAAGAC
+TCCATGTGAAAGTAATTTTGCGTGCCAGCAGATTACAAGGTTCAACGAGAAATGGTAAGCGAGAAAAATGCGCTATAGATTTCCGCTTTAGCCTGGACGC
+ACTCTTTTTGATCGCGTTTAGCCAGACCATCAACCACCAGATTCCACGAATCGTTGATCAGATCGCGAAGTAACGCTTCGGAGATTTCTTCGCCGGGATA
+CACTGAAATCCAGTGCTTTTTATTCATGTGATACCCTGGCTTAATGCTTGGGTATATTTGCTGATTTAACAGGGATTTTGTGGATCGGACTTCAGATTGA
+TAAAGGGACGCCGCGTAGCTCCGACGACAGCATAAAAATCTTGCCGCCAATTTTAAAACATCGAACTCCGGGCCAAAAGGCCAGCAAAGCTCGACAAAGG
+GTAACTCAAGGGCCAGGCGTTTCGCCGTTTCGTGCAGTGATTGCTTATCCATAAACGTTCCTTTAGGCGAAGGAGAATAAGCAAAGTATGCCGCGAAGTA
+CGGCGATAATCGACGTTTAATCCGCCAGCGAGAACCAGCGTCGCCAGATAAAGCGCAGAACAAAATACTCAATAGCGCCCAGCACTAAAACCACAGACAA
+AACAATAAAGTGTAAAGCTGACTAAGATCCATCAGATGGAACATGGTCACCAGTTTTGTGCCAGCGCCAGCCCCAGTGCGGGGCGGGCAGCAGCAGGCAA
+GAGAGGAAAGCCATCAGCAAAATGCCTGCTGCGGTGGTCAAGGTTTCTAAAGGGTGTTTCATAACATTGTTAAATGTAAGTTAAAACACCATTGTCAGGG
+ATATTCTTCTGTAAGGCAATTCCCGGCTTAGTCACCGGCCCAGATCTCACAATGCTTTTCACCAGCCCAATCAGCGAGCCGCCATCGGCGACGAAATCGC
+GCATTAGCTGCGCTTCATTCAGACCGCTGACGACCTGGCGATGCAGGGCCTCAATCGCGCTCGATGCACCAATTTTATGTGCGGAAGGGGCGATTTTTCC
+AGCAATCGCAAGGTATCTTCCGTTAGCGGTCGACGATCTCCAGTGTGCGGATCGGTGATGACGCCTTCAAGCCCATAGCGACAGGCCTGGAAACGGTTGA
+ATTTATACAGCAGGTAATCTTTTTCCTGATGTTTAAACGGGCGTTCCGTCAGTAACCAGTGGGCGGTAGCCTGAATTAATCCCGCCATATTTACTGCGTG
+GCTAAGGGTTAACGGGGTATCCATCACCCGAACCTCCACCGTGCCAAAATGAGGACTGGGGCGAATATCCCAGTGCAGATCTTTAATGCTGTCGATCATC
+GTGGTGTAACTCAGACAGCGAAACAGGGCTTCAAATTGTTGCCAGTTACTGACCCACGGCATCGGGCCATTATCAGGAAAGGCGGAAAAATATTCGGTCG
+TGAGGAGGCAAAACGCGTATCCGTTCCCTGCATATATGGCGACGCGGCGGAAAGGGCGATAAAGTGCGGCACAAATCGTGACAAGCCGTGCAGCAAATAA
+ATGGCGTCATCGCCACTGGCGCAGCCAACATGGACATGCTGACCAAAACGGTCGCCTGCTGAATGAGATAACCAAAGTTTTCCAGCGTGCGTTGATAGCG
+TTCGTTATCGCATACCTCCTGACGCTGCCATTTCTGAAACGGGTGCGTGCCACCGCCGCAAATTTCCAGATGATGGTCTGTGGCTGCCTGCAATACGACT
+TTCTGCATCGCTGAAAACTGCCCGGCAGCCTGGTTGATATCACGGCAAACATCCGTCGCCAGCTCCAGCATACTTTCGGTGATATCGTGCTTTACCTCTC
+CGGCCGTGATCTTATTTTTAACCGCGTCAATCAGCATTGAAGAGTCCTGGCTTAAGTCATAGCCCGGCGGATTAACCACCTGCATTTCCAGTTCAATACC
+GAGGGTAAAAGGTTCAGAAACATGAAAATCGGGTAATGGCATAGGTTTCTCTTATGTTGGCGTTTTCTATTCAGTATAGAAGTCGGAGCGGCTGGGCGAG
+ATGCGGAAGTTCTGGAATGTTTCTTTTTGGTGATGGTGAACTGATGGTGCCTGAAGCAATTTGGCTACTTTTGCAATGTGACAAGTTATGGCAGTGCTGA
+CTGGTGGCGAAGAATTTTGACGATTGAGTCATGCAGAAAAACGGGTTCAGCTTCAGTTGATTAAATGAGGTGAGAAGTCCGAAACAGGACTCACTGTATA
+AATAAACAGCTATTTTGTTGAGGAAGGGTAAGATAACGGCGGGTGCCTGAAGCTTTCCGGTTTCAGGTTTACTCTGAGGTCTGGAAAGATGAAGCCCCAG
+GAGATATTTCTATCAACCCTGGGGCTGCCACTCCAAACCCGAACAATTTGGATGGTAGTCCCTTCTTCGCATGGAGGCAATATAAACATGCTGACGAAAT
+ATGCCCTTGCGGCAGTCATAGTGCTGTGTTTAACGGTGCTGGGATTTACGCTTCTGGTCGGAGACTCGCTGTGTGAGTTTACGGTGAAGGAACGTAATAT
+TGAGTTTAAGGCTGTTCTCGCTTACGAACCGAAGAAGTAGCCGTTGTGCGGGAGTAATCCCATAAGCGCTAACTTAAGGGTTGTGGTATTACGCCTGATA
+TGATTTAACGTGCCGATGAATTACTCTCACGATAACTGGTCAGCAATTCTGGCCCATATTGGTAAGCCCGAAGAACTGGATACTTCGGCACGTAATGCCG
+GGGCTCTAACCCGCCGCCGCGAAATTCGTGATGCTGCAACTCTGCTACGTCTGGGGCTGGCTTACGGCCCCGGGGATGTCATTACGTGAAGTCACTGCAT
+GGGCTCAGCTCCATGACGTTGCAACATTATCTGACGTGGCTCTCCTGAAGCGGCTGCGGAATGCCGCCGACTGGTTTGGCATACTTGCCGCACAAACACT
+TGCTGTACGCGCCGCAGTTACGGGTTGTACAAGCGGAAAGAGATTGCGTCTTGTCGATGGAACAGCAATCAGTGCGCCCGGGGCGGCAGCGCTGAATGGC
+GACTACATATGGGATATGATCCTCATACCTGTCAGTTCACTGATTTTGAGCTAACCGACAGCAGAGACGCTGAACGGCTGGACCGATTTGCGCAAACGGC
+AGACGAGATACGCATTGCTGACCGGGGATTCGGTTCGCGTCCCGAATGTATCCGCTCACTTGCTTTTGGAGAAGCTGATTATATCGTCCGGGTTCACTGG
+CGAGGATTGCGCTGGTTAACTGCAGAAGGAATGCGCTTTGACATGATGGGTTTTCTGCGCGGGCTGGATTGCGGTAAGAACGGTGAAACCACTGTAATGA
+TAGGCAATTCAGGTAATAAAAAGCCGGAGCTCCTTTCCGGCACGTCTCATTGCCGTATCACTTCCTCCCGAAAAGCATTAATCAGTAAAACCCGACTGCT
+CAGCGAGAATCGTCGAAAAGGACGAGTAGTTCAGGCGGAAACGCTGGAAGCAGCGGGCCATGTGCTATTGCTAACATCATTACCGGAAGATGAATATTCA
+GCAGAGCAAGTGGCTGATTGTTACCGTCTGCGATGGCAAATTGAACTGGCTTTTAAGCGGCTCAAAAGTTTGCTGCACCTGGATGCTTTGCGTGCAAAGG
+AACCTGAACTCGCGAAAGCGTGGATATTTGCTAATCTACTCGCCGCATTTTTAATTGACGACATAATCCAGCCATCGCTGGATTTCCCCAAGTGCCGGAT
+CCGAAAAGAAGAACTAACTCGTTGTGGAGAATAACAAAATGGTCATCTGGAGCTTACAGGTGGCCATTCGTGGACAGTATCCTGACAGCCTACAAAACGC
+AATTGAAGAACGCGAGGCATCGTCTTAACGAGGCACCGAGGCGTCGCATTCTTCAGATGGTTCAACCCTTAAGTTAGCGCTTATGGGAGTAATCCCCGCA
+TATCCGGTTGTCAGGTCAGGATGGTAAGGCACCTGCTTTACACTTTCGCCCGTGGTCAGTGATGGCTGCGGGCGAATCGTACCAGATGTTGTCAATTAAT
+CGTGTTGGCACAGCGTTATGACTATCTTTTCTTTTATCTGCCAGTGCACAGCAAACATCTCATTCTCACGATGAATGATGACCTGCTGTTTATTCCAGCT
+AATTATCTGATAGTCCAGAAAACCTGCATCAGTTTGGATCTCACTTGCCTTAAATGCGCTCTCTTTGGCGGAAAATGCCAGTGTCAGCGCCAGAGAAAAG
+GCTAAACCGCAGTCTGCGAGTCGCTCGTGTTCCGCTGGTGTAATAATGTTGTCTGTCAATTCTCTTGCGGTTTGTACAGAAAAATTTCTTCTATATCAAT
+GCCAATCGGTTGACGAGATACCACGGCTAATGCCGTAGTCCCACAGTGGCTAATACTGCCGTATACCTCCGCAGGCCAGACAGGTTGGCGTAGCTCGCCG
+ATTGCGGGCACACATTTATAGCCATATTCCCGCAAAGCATAAACAGCAGCGATCCGTCCGGCTAAATGCTCTGTTTTACGTTTACGTCCAGCGTGTTGCA
+GTTGTGCGTAGTGCGGCAGCCAGAGTAAATCCTGCTCACAAAAATTCGCCGGATCGAACTCAACAAAATGCAGCGTATGTCCGGCAAAGGGAGGGAGGTA
+TGCGTAGTTTTCATATCGACCATATTCGAGACTGATGACAAACGCAAAACTGCCTGATGCGCTACGCTTATCAGGCCTACATGGTCCTGCAATATATTGA
+ATTGGCAAGATTTTTGTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCATGAACGACGCGCACTTTGTCAACAATCTGACGTTAGCATCAGAAGTGGGT
+GTTTACGCTCATATACCACGTACGTCCCGGCTCGTTATAGGTATACGCCCCGGCACCGGCGATATAGTTGGCCCTGCCAAATCGCCCGTGGTCTGGGCAT
+TACCCGCACGCCACAAACGTTTGTCGAACAGATTGTCCACGCCGCCGGTCAGACTGACATTCTTCGTCACATCCCAGGTCGCGCTCAGGCCAACAATGCT
+GTAAGGACTAATTTCTTTGGTTTCCGGTCCAACCGCTGGCTGACCTTTATAGTTGTACTTCTTCGGCTGCTGCTTGCCGTACCAGGTGAAGGTCGTTTGC
+ATCGACAAATCTTCCCGTGCCTGCCAGCTCAGCGTTGAGTTCAACGTATACTCCGGGATGATCGACAAACGGTCGCCCGTGGTTTTGTTTTCACTCTTCA
+GCATATAAGTGATGTTATTGGTCCACATCACCGTTTCGCTAACCGGTACGTTTAACGATCCTTCCAGACCTTCAACCACCGCTTTCGGCACGTTATCCCA
+CTGATAGAGATCGGTGCCGACTGCGTTTTGCCCTACAGCCACATAGCCCGCTTCAATCTTATTGCGATAATCGTTACGGAACCAGGTGACGCCCGCCAGC
+CACCCGTCGCGTTTGAACTCCAGACCAATCTCTTTGTTGATGCTGGTTTCTGCTTTCAGGTCATCGTTACCTTGCAGATAGCAGCCGCCCGCGCTGGCAT
+AGCAACCCTGACCTTTACTGTAGAGAATGTAGTTCGGGTTAGTCTGGTACAGGCTCGGCGCTTTATAAGCACGGGCGATGCCCATTTTCAGCGTGAAGTC
+ATCGCCTAAACCTTGCGATATGTTCAGCGCCGGGCTCCAGTTATTGCCGACAATACTGTGATGATCGAAACGCAGCCCCGGCGTTACGATGGTGCTGTCA
+GTCAGCTCCATGTTGTTTTCGGCAAACAGCGAGAAAATTTCTGCTTTTGAATACGGGCTACGGTCGGTGGTACTCACGCCATCAATAGCGCCACCGGTAT
+TCGTTCCGGTCAGTGCCTGGGTGTTGGAACTTAAGTCCTTCATCCGTTGCTGATTCCACTCCGTACCCAGCGTCAGCGTCTGGTTAACGAGGAAATCAAT
+CGGCAGGTTAACTTCGCTGTGCAGCATCACGTCATCAAGATCGATATCGACGAAATCCTGTGTCGCTTTTTCGTTAAATTTCCTTCGGTACCGCCCGCCA
+GACCTTCCGGAATACGCGAGTTACGGGTGTGTTCGTACTGCACCCAGTTGCTGGTGGTCACGCCGTTATCCCAGCCACCGTTCCAGGTCAGCGCGTAGTT
+CTGGCGATACAGACGGTTGGTTTCATCGCCATATTTCGAGCGGGTATAGGAATCGGAGTTGGTATTCTGGGTGTCGCCCGCATACAGGTTACCCTGGCGG
+CTGTAACCTGCTTCCAGTTCCAGCGATTGCAATGGCGCGAAATCCCAGCGCACCACGCCATTAATATCTTTGTTGATTACCCCTTCGCGCCCGGCTGGTA
+ACGTCGTGGCATACGTTCCGGCACGCGCGGACTGATGGCCCTGGTTGATATCCCACGCGTCAGCCTGGGTTTTGTCGAGGTTGCCATACAAACGGAAGCT
+GAATTCGTCGCCCAGCGGACCGGTCAGGCTAAAGTTAGTGCGTTTGGTGGCACCTTCCTCTTTATGTTCTGGCGCATTGAAATATGCGTCCCAGGAGCCG
+TGCCACTCGCCGCTGCCTTTTTGGTAATGATGTTAACCACGCCGCCCGCCGCGCCGTTGCCATAACGCGCAGCTGCCGGACCACGCAGAACTTCAATACG
+TTCAATCATTTCAGGTGGCACCCAGGAAGTATCACCACGGGTATCGCGCTCGCCACGCCAGCCCTGACGCACCGAGTTACGGCTGCTTACCGGCTTGCCG
+TCAATCAAAATCAGCGTGTTTTCCGGACCCATACCGCGAATATCAATCTGTCGGTTATTCCCACGCTGACCACTGGTGGAGTTACCGGTCAGGTTAACGC
+CTGGCATGGTACGGATGATCTTCGACACATCGCGGGCAACCGGGTTTTGCGGATTTCATCTGCGGTGATGGTCGAAACGCCAGGCGCCTGTAAGTTCTGC
+TCGGCGGCGGTAACGACAATAGTATCGTCATGTGAAACAGGAGTATCGGTCGGCTCTTGTGCCTGCGCTACCCCATAAATCCCCAGATTGACCAACAAGG
+CCAGGGAATGAATCTTCTTGTTCATTGTTTTATTCCTGCATTTTGCCACGAATTGCAACTGTCGGGCATGGTCGTCATCAACACGACGCATCCGCTACCG
+CGAAAACCTTTGATCCTGAAAGACACGCAGTGCAGTTGGTTAATTAATGTCCGCGCTTCCCACGGCGCGCCATTACGCTATTGCAAATGCAAATAGTTAT
+CAATAATATTATCAATATATTTCTGCAATCAATGAAAAATTGCACAGTAAACATGGGGTTATGGTGTGACGGCGTTAAAAGTAGGAAGTGAGAGCTGGTG
+GCAGTCGAAACATGGCCCGGAATGGCAGCGTCTGAATGACGAAATGTTTGAGGTCACTTTCTGGTGGCGTGATCCCCAAGGTTCTGAAGAATACTCGACG
+ATAAAGCGCGTATGGGTCTACATCACTGGTGTGACCGATCACCATCAGAACAGCCAGCCCCAGTCGATGCAGCGAATTGCAGGCACTAACGTCTGGCAGT
+GGACGACACAACTCAATGCCAACTGGCGCGGCAGCTACTGCTTTATTCCCACCGAACGCGATGACATTTTTCTGTACCATCCCCGATCGCCTCGAATTGC
+GCGAAGGCTGGCGAAAACTATTACCCCAGGCGATAGCCGATCCGCTGAACCTACAAAGCTGGAAAGGCGGGCGAGGGCACGCTGTTTCTGCACTCGAAAT
+GCCGCAAGCGCCTCTGCAACCGGGATGGGATTGTCCGCAAGCGCCAGAAATACCTGCCAAAGAAATTATCTGGAAAAGTGAACGGTTGAAAAGTCACGGC
+GTGTATGGATTTTACCACCGGCGATGCAACAGCAGAAGAACGCCCGCTGGCAGTTTTGCTCGATGGCGAATTTTGGGCGCAAAGTATGCCCGTCTGGCCA
+GTGCTGACTTCGCTGACCCATCGTCAGCAACTTCCTCCCGCCGTGTATGTGTTGATCGACGCTATCGACACCACGCACCGCGCCCACGAACTGCCGTGTA
+ATGCGGATTTCTGGCTCGCAGTACAGCAAGAGTTATTACCCCTGGTGAAAGCTATTGCCCTTTAGCGATCGTGCCGATCGCACCGTGGTTGCCGGGCAGA
+GTTTTGGTGGGCTTTCCGCGCTGTATGCCGGACTGCACTGGCCTGAACGCTTTGGCTGTGTATTAAGCCAGTCAGGATCGTACTGGTGGCCGCATCGGGG
+CGGGCAGCAAGAGGGCGTGTTACTTGAAAAGCTAAAAGCTGGTGAAGTTAGCGCCGAAGGTCTGCGCATTGTGCTGGAAGCGGGTATTCGCGAGCCGATG
+ATCATGCGGGCCAATCAGGCGCTGTATGCGCAATTACACCCCATAAAGAATCCATTTTCTGGCGTCAGGTTGACGGCGGACATGATGCGCTTTGTTGGCG
+CGGTGGCTTGATGCAGGGGCTAATCGACCTCTGGCAACCACTTTTCCATGACAGGAGTTGAATATGGCATTCAGTAATCCCTTCGATGATCCGCAGGAGC
+GTTTTACATATTGCGCAATGCGCAGGGGCAATTCAGTCTGTGGCCGCAACAATGCGTCTTACCGGCAGGCTGGGACATTGTGTGTCAGCCGCAGTCACAG
+GCGTCCTGCCAGCAGTGGCTGGAAGCCCACTGGCGTACTCTGACACCGACGAATTTTACCCAGTTGCAGGAGGCACAATGAGCCAGCATTTACCTTTGGT
+CGCCGCACAGCCCGGCATCTGGATGGCAGAAAAACTGTCAGAATTACCCTCCGCCTGGAGCGTGGCGCATTACGTTGAGTTAACCGGAGAGGTTGATTCG
+CCATTACTGGCCCGCGCGGTGGTTGCCGGACTAGCGCAAGCAGATACGCTGCGGATGCGTTTTACGGAAGATAACGGCGAAGTCTGGCAGTGGGTCGATG
+ATGCGCTGACGTTCGAACTGCCAGAAATTATCGACCTACGAACCAACATTGATCCGCACGGTACTGCGCAGGCATTAATGCAGGCGGATTTGCAACAAGA
+TCTGCGCGTCGATAGCGGTAAACCACTGGTCTTTCATCAGCTGATACAGGTGGCGGATAACCGCTGGTACTGGTATCAGCGTTATCACCATTGCTGGTCG
+ATGGCTTTAGTTTCCCGGCCATTACCCGCCAGATCGCCAATATTTACTGCACATGGCTGCGTGGCGAACCAACGCCTGCTTCGCCATTTACGCCTTTCGC
+TGATGTAGTGGAAGAGTACCAGCAATACCGCGAAAGCGAAGCCTGGCAGCGTGATGCGGCATTCTGGGCAGAACAGCGTCGTCAACTGCCGCCGCCCGCG
+TCACTTTCTCCGGCACCTTTACCGGGGCGCAGCGCCTCGGCAGATATTCTGCGCCTGAAACTGGAATTTACCGACGGGGAATTCCGCCAGCTGGCTACGC
+AACTTTCAGGTGTGCAGCGTACCGATTTAGCCCTTGCGCTGGCAGCCTTGTGGCTGGGGCGATTGTGCAATCGTATGGACTACGCCGCCGGATTTATCTT
+TATGCGTCGACTGGGCTCGGCGGCGCTGACGGCTACCGGACCCGTGCTCAACGTTTTGCCGTTGGGTATTCACATTGCGGCGCAAGAAACGCTGCCGGAA
+CTGGCAACCCGACTGGCAGCACAACTGAAAAAATGCGTCGTCATCAACGTTACGATGCCGAACAAATTGTCCGTGACAGCGGGCGAGCGGCAGGTGATGA
+ACCGCTGTTTGGTCCGGTACTCAATATCAAGGTATTTGATTACCAACTGGATATTCCTGATGTTCAGGCGCAAACCCATACCCTGGCAACCGGTCCGGTT
+AATGACCTTGAACTGGCCCTGTTCCCGGATGTACACGGTGATTTGAGTATTGAGATCCTCGCCAATAAACAGCGTTACGATGAGCCAACGTTAATCCAGC
+ATGCTGAACGCCTGAAAATGCTGATTGCCCAGTTCGCCGCGGATCCGGCGCTGTTGTGCGGCGATGTCGATATTATGCTGCCAGGTGAGTATGCGCAGCT
+GGCGCAGCTCAACGCCACTCAGGTTGAGATTCCAGAAACCACGCTTAGCGCGCTGGTGGCAGAACAAGCGGCAAAACACCGGATGCTCCGGCGCTGGCAG
+ATGCGCGTTACCTGTTCAGCTATCGGGAAATGCGCGAGCAGGTGGTGGCGCTGGCGAATCTGCTGCGTGAGCGCGGCGTTAAACCAGGGGACAGCGTGGC
+GGTGGCACTACCGCGCTCGGTCTTTTGACCCTGGCACTCCATGCGATAGTTGAAGCTGGAGCGGCCTGGCTACCGCTGGATACCGGCTATCCGGACGATC
+GCCTGAAAATGATGCTGGAAGATGCGCGTCCGTCGCTGTTAATTACCACCGACGATCAACTGCCGCGCTTTAGCGATGTTCCCAATTTAACAAGCCTTTG
+CTATAACGCCCCGCTTACACCGCAGGGCAGTGCGCCGCTGCAACTTTCACAACCGCATCACACGGCTTATATCATCTTTACCTCTGGCTCCACCGGCAGG
+CCGAAAGGGGTAATGGTCGGGCAGACGGCTATCGTCAACCGCCTGCTTTGGATGCAAAATCATTATCCGCTTACAGGCGAAGATGTCGTTGCCCAAAAAC
+GCCGTGCAGTTTTGATGTCTCGGTGTGGGAGTTTTTCTGGCCGTTTATCGCAGGGGCAAAACTGGTGATGGCTGAACCGGAAGCGCACCGCGACCCGCTC
+GCTATGCAGCAATTCTTTGCCGAATATGGCGTAACGACCACGCACTTTGTGCCGTCGATGCTGGCGGCATTTGTTGCCTCGCTGACGCCGCAAACCGCTC
+GCCAGAGTTGCGCGACGTTGAAACAGGTTTTCTGTAGTGGTGAGGCCTTACCGGCTGATTTATGCCGCGAATGGCAACAGTTAACTGGCGCGCCGTTGCA
+TAATCTATATGGCCCGACGGAAGCGGCGGTAGATGTCAGCTGGTATCCGGCTTTTGGCGAGGAACTGGCACAGGTGCGCGGCAGCAGTGTGCCGATTGGT
+TATCCGGTATGGAATACGGGTCTGCGTATTCTTGATGCGATGATGCATCCGGTGCCGCCGGGTGTGGCGGGTGATCTCTATCTCACTGGCATTCAACTGG
+CGCAGGGCTATCTCGGACGCCCCGATCTGACCGCCAGCCGCTTTATTGCCGATCCTTTTGCCCCAGGTGAACGGATGTACCGTACCGGAGACGTTGCCCG
+CTGGCTGGATAACGGCGCGGTGGAGTACCTCGGGCGCAGTGATGATCAGCTAAAATTCGCGGGCAGCGTATCGAACTGGGCGAAATCGATCGCGTGATGC
+AGGCGCTGCCGGATGTCGAACAAGCCGTTACCCACGCCTGTGTGATTAACCAGGCGGCTGCCACCGGTGGTGATGCGCGTCAATTGGTGGGCTATCTGGT
+GTCGCAATCGGGCCTGCCGTTGGATACCAGCGCATTGCAGGCGCAGCTTCGTGAAACATTGCCACCACATATGGTACCGGTGGTTCTGCTGCAACTTCCA
+CAGTTACCACTTAGCGCCAACGGCAAGCTGGATCGCAAAGCCTTACCGTTGCCTGAACTGAAGGCACAAGCGCCAGGGCGTGCGCCGAAAGCGGGCAGTG
+AAACGATTATCGCCGCGGCATTCTCGTCGTTGCTGGGGTGTGACGTGCAGGATGCCGATGCTGATTTCTTCGCGCTTGGCGGTCATTCGCTACTGGCAAT
+GAAACTGGCAGCGCAGTTAAGTCGGCAGGTTGCCCGCCAGGTGACGCCGGGGCAAGTGATGGTCGCGTCAACTGTCGCCAAACTGGCAACGATTATTGAT
+GCTGAAGAAGACAGCACCCGGCGTATGGGATTCGAAACCATTCTGCCGTTGCGTGAAGGTAATGGCCCGACGCTGTTTTGTTTCCATCCTGCGTCCGGTT
+TTGCCTGGCAGTTCAGCGTGCTCTCGCGTTATCTCGATCCACAATGGTCGATTATCGGCATTCAGTCACCGCGCCCCAATGGCCCCATGCAGACGGCGGC
+AAACCTGGATGAAGTCTGCGAAGCGCATCTGGCAACGTTACTTGAACAACAACCGCATGGCCCTTATTACCTGCTGGGGTATTCCCTTGGCGGTACGCTG
+GCGCAGGGTATTGCGGCGCGACTGCGTGCCCGTGGCGAACAGGTGGCATTTCTTGGCTTGCTGGATACCTGGCCGCCAGAAACGCAAAACTGGCAGGAAA
+AAGAAGCTAATGGTCTGGACCCGGAAGTGCTGGCGGAGATTAACCGCGAACGCGAGGCCTTCCTGGCAGCACAGCAGGGAAGTACTTCAACGGAGTTGTT
+TACCACCATTGAAGGCAACTACGCTGATGCTGTGCGCCTGCTGACGACTGCTCATAGCGTACCGTTTGACGGTAAAGCGACGCTGTTTGTTGCTGAACGC
+ACACTTCAGGAAGGTATGAGTCCCGAACGCGCCTGGTCGCCGTGGATAGCGGAGCTGGATATCTATCGTCAGGATTGTGCGCATGTGGATATTATCTCTC
+AGGGACGTTTGAAAAATTGGGCCGATTATTCGCGCAACGCTAAACAGGTAAATTAATATTATTTATAAACCCATAATTACAGAAAATAATTATGGGTTTT
+TATTTGTTTGATTTATAGGTTTGATGAATATTTCTCTTAAATAGAGTGAATGTTGCATTCAGTGGAAGGAATTTACAAACTTCAGCTTCGGATAATTATC
+ACCAACTGGTAAAGTGAGCGCCGTGGAGATTTCCCCTATTGGACTCATTTTCAGGTTATACCCCATGTCATCACTGAATATTAAACAGGAAGTGACGCTC
+ATTTTCCCGATTATCCTCTGGCGTCGCCCAGTAATAATGAAATTGATTTACTTAATCTAATCTCAGTTTTATGGCGGGCCAAAAACGGTCATGGCGGTCG
+TTTTGCGTTTGCCTGCGCAGGCTTGCTGATCTCTTTCATCCTGCCGCAAAATGGACCAGCGCGGCGGTTGTCACGCCTCCAGAACCTGTTCAGTGGCAAG
+AGTTGGAGAAATCATTCACTAAGCTTCGTGTGCTGGATCTGGATATCAAAATTGATCGTACAGAAGCATTTAACCTGTTTATCAAGAAGTTTCAGTCGGT
+TAGCTTGCTGGAAGAGTACCTGCGTTCATCACCTTATGTGATGGACCAATTAAAGAGGCGAAAATCGACGAACTGGATTTGCATCGCGCAATTGTCGCAT
+TGAGCGAAAAATGAAAGCGGTTGATGACAATGCCAGTAAGAAAAAGATGAACCGTCACTGTATACCTCCTGGACGCTAAGTTTTACCGCGCCAACCAGTG
+AAGAGGCGCAGACCGTTTTGAGCGGGTATATCGATTATATCTCTACGTTGGTGGTGAAAGAGTCGCTAGAAAACGTCCGTAATAAACTGGAGATCAAAAC
+CCAGTTTGAAAAGAAAAACTGGCTCAGGATCGCATTAAAACGAAAAATCAACTTGATGCAAACATTCAGCGCCTCAATTATTCACTCGACATTGCCAACG
+CGGCAGGAATTAAAAGCCCGTTTACAGTAATGGTCAGGCCGTTAAAGATGACCCCGATTTTTCTATTTCTCTCGGTGCAGACGGTATTGAACGCAAACTG
+GAAATAGAAAAAGCGGTCACTGACGTTGCGGAACTGAACGGTGAATTACGTAATCGGCAGTATCTTGTCGAGCAATTAACAAAAGCACATGTCAACGATG
+TGAATTTTACGCCGTTTAAATATCAGTTAAGCCCGTCATTGCCAGTGAAAAAGACGGTCCGGGTAAGGCGATTATTGTGATCCTTTCCGCGTTGATCGGC
+GGGATGGTGGCTTGTGGTGGCGTGCTGTTGCGCTATGCGATGGCATCCAGAAAACAGGATGCCATGATGGCAGACCACTTAGTTTAACTATTTGCGGTTG
+AAGGTGCCGTTCGTCCGAGCGGCACCACAAGCGGCGTTCCGGCAACTGGATCGTCAATGATCATGCAGCGCAGACCATAAATGCGCTCAATCAGTTCAGC
+AGTGACAATCTCCTTCGGCGCTCCCTGAGCAACAATTTTCCCTTCCCGCAATGCAATCAAATGGCTGGCGTAACGACAGGCCTGATTAAGATCGTGCAGC
+ACCGCCGCCAGGGTATAGCCTTTTCGCGGTTCAGTTCGCTTAACAACTCCAGCAAATCAATCTGATGACTGATATCCAGCCAGGTCGTGGGTTCGTCGAG
+CAGCATAATTGCCGTTTCCTGGGCCAGCACCATCGCGATCCACGCTCGCTGGCGTTGTCCGCCAGAAAGGGTATCCACGCTTTGATCTGCCAGATGAGTT
+ATTCCCGTGGCCTGCATTGCTTTCGTTACCGCTTCTTCATCCTCTTTGCGCCAGCGGGTAAACAGCGGTTGATGCGGATAACGTCCACGCGCCACCAGCT
+CCTGCACGGTGATATCGCCCGGCGTGGTAGCATTTTGCGCCAACAGACCAATCCGGCGTGCAACCTCTTTACTGGCGTAATGTTGAATGTGCTCGCCATC
+CAGCCAGACATGCCCATGAGCAGGCGTCATCAGGCGGCTTAAGGTACGCAGTAACGTGGATTTACCGCAGCCATTTGGCCCGATAATTGCCGTGAAGTGA
+CCATCAGGTATTTCTACAGTCAGATTTTCCGCAACGGTATATTTGCCATATCCCAGGGTTAACTGTTCGCCGCGCAAACGGGCTACTGATTCGGTCATTT
+TTGCGAGACTCCTGAATTAACAAGACGATAAGGTAAATACCGCCGAGGCTGACGGTAACGACGCCAACCGGAAGTTGATACGGCATAAACAGTTGTTGGG
+CGCAGAGATCGGCCGCCAGCAGTAACAGCGCCCCATAGCGCCGCCTGGGTTAGCCCCAGCGAGCGGTGCCGCTAATGCGTCGGGCAATGTGCGGTGCGAC
+TAAAGCAATAAAGGAAATCGGCCCGGCAAGCGCTGTTGCCGCAGCGGTAAGCACCACTGCAACCAGCATCATTAACAGACGCGAACGTTCGACGCTGACG
+CCCAGCGCACACGCGGTATCATCGCCCATTTCCAGCAAGCGCATCCGGCGTACCAGTAAGGCGGCGGCAATGAGCATCAATATAATGATGGGTGCGGAAG
+GCGAGGTTTTGCCCACGTCAGGCCGTTGAGCGATCCGGCATTCCACAAACCTGCTGTTAGCGCCGTTTCTAAAGACGCTTTCAGCAACAGCCAGGTATTA
+AAGGCCACCAGCATGGCGCGAACGCCGATACCGATAATAATCAACCGAAAGGTGTCGATGCCGTTGCGCCAGGCGAGCAGCCAGACCAGCAGCGAAGTGA
+CAATGCCGCCCACCATTGCTGACAGCGCGATAGCCGTCAGGTCCTGACCAAACAGCACCATCGCCACCAGCACGCCGCTCCACGCCCCGGTGTTAAAGCC
+CATTACGTCAGGGCTGCCGAGCGGGTTACGCATCAGCGACTGAAAAATCGCGCCACTGACGCCCAGTGCTGCGCCAATCAACAGCGCCATCAGCACGCGT
+GGTAAACGCCATTCGGTGACCACCATCGTCATACTGCGCGGCGCATCGCCCATCAGCGCGGCGAATACCTGCGAGGTTTCCAGCGTGACGGCACCGCTGC
+GTAATCCCCAGATACCTGCAACCACACAGGCGGAAACCAGCAGCAAACAGGTGATGAGTAATCGGCGAGAGACGTAAATCATGCACCACCTCGCGTTTTA
+CGTCGCACGAGGAAGATCAGCACCGGTGCACCAATAAACGCACTGACCACAGAAACGCGCAGTTCGCCGGGCACAATCACCCGCCCGATGATATCGGCAA
+ACAGCAGCAGGGCAGGGTAGCAAGTAGCGTGACGGGCAGCGACCAGCGATGATCGGCACCCACCAGCCAACGCGCCATATGCGGCATCATCAGGCCAATA
+AAGGCAATCGGGCCAACTATTGCCGTCGCACTACCACAAAGCACGGTAATCGCCAGCAGACCAATCAACTGTGTGCGCGCCACGCGACTGCCCAGCGCCG
+TCGCGGTGTCGCTGCCGAGGCTCAAACTGTTCAGCGCGCGACTCAGTAATAGCGCAGTTGCTCCGGCGATCAGCACCGGGATCAGCACCACTTTTAAGGT
+ATGTAGATTGCGAATATCCAGCGAACCGGCTTGCCAGAAACGCAACTGATCGTAGACGTCAGGATTAAGCAGGGCGATGCCGCTGGTCAGTCCTTCCAGC
+ACCGCCGCCAGCGCCACGCCCGCCAGGGTTAAACGCACCGGACTTAACTGCCCGCCGCCCTGACTGCCGGTAAAGGCAACAATCAATGAGGCCACCAGCG
+CCCCGGCGAAGGCCATCGCCAGTTGTTCCTGCGCGGAAGAGTAACCAAACAGCGCCGCACCCAGCACAATGGCAAAGCTGGCTCCGGCGTTCACGCCAAG
+CAAGCCGGGGTCGGCAAGTGGGTTTCGGGTGAGGGTTTGCATTAACGCCCCGGCAAGGCCAAGCGCGCCGCCTGCCAGTAAACCGGCAAGGGTACGCGGC
+AGCCGCGCGTCGAGCACGATGGTGCAGTCGGCGCTCTGGCAGGTGCCGGAGAAGGCCTCCAGCACTACGGAAGCGGGGAGTGATTTTGCCCCAATGAGCA
+GGCTTAATGCCGTCGCGATAATCAGTAATAACAGCAATCCGGGCACGGCAATGGCGCGTGTCACGGCAACAGAACCAGACATACGAACTTCCATGATAAT
+GAAATTAATTATCGTTATCGATCTTATTTGGATATGTTAGCATGTGCAGCCTAAGAATAGGTATTTAAAATATTTGATGGCAAGGCATTGTAATGAATAA
+ACAATCCTGGCTGCTTAACCTCAGCCTGTTGAAAACGCACCCGGCGTTTCGCGCAGTATTCCTCGCTCGTTTCATCTCAATTGTGTCTCTGGGTTTGCTC
+GGCGTCGCGGTGCCGGTGCAGATCCAGATGATGACACATTCCACCTGGCAGGTGGGGCTTTCGGTGACGCTGACCGGCGGCGCGATGTTTGTTGGCCTGA
+TGGTCGGCGGTGTGCTGGCGGATCGCTATGAGCGCAAAAGTGATTTTGCTGGCGCGCGGCACCTGTGGCATTGGCTTCATTGGACTGTGCCTTAATGCAC
+TGCTGCCGGAGCCGTCATTGCTGGCAATCTATTTACTTGGTTTATGGGATGGTTTTCGCATCGCTTGGCGTTACGGCGCTATTGGCGGCGACACCAGCAC
+TGGTAGGGCGTGAAAACTTAATGCAGGCCGGGGCGATCACCATGTTGACCGTGCGTCTGGGGTCGGTGATTTCGCCCATGATTGGCGGTTTATTGCTGGC
+GACCGGTGGCGTAGCCTGGAACTACGGGCTGGCGGCGGCGGGCACGTTTATTACCTTGCTACCGTTGTTAAGCCTTCCGGCGTTGCCACCGCCACCGCAG
+CCGCGTGAGCATCCGTTGAAATCATTACTGGCAGGATTTCGTTTTCTGCTTGCCAGCCCGCTGGTGGGCGGGATTGCGCTGCTGGGTGGTTTATTGACGA
+TGGCGAGCGCGGTGCGGGTACTGTATCCGGCGCTGGCTGACAACTGGCAGATGTCAGCGGCACAGATTGGTTTTCTCTACGCGGCGATCCCGCTCGGCGC
+GGCTATTGGTGCGTTAACCAGCGGGAAGCTGGCACATAGTGCGCGACCAGGGTTATTGATGCTGCTCTCCACGCTGGGATCGTTCCTCGCCATTGGTCTG
+TTTGGCCTGATGCCGATGTGGATTTTAGGCGTGGTTTGTCTGGCGCTGTTCGGCTGGTTGAGTGCGGTCAGCTCGTTGCTGCAATACACAATGCTGCAAA
+CGCAAACCCCGGAAGCGATGTTAGGGCGGATTAACGGTTTGTGGACGGCGCAGAACGTGACGGGCGATGCCATAGGCGCGGCGCTGCTGGGTGGTTTGGG
+CGCGATGATGACACCGGTTGCTTCCGCAAGCGCGAGCGGTTTTGGTTTGTTGATTATCGGCGTGTTGTTATTGCTGGTGCTGGTGGAGTTGCGACATTTT
+CGCCAGACGCCGCCGCAGGTGACAGCGTCCGACAGTTAATGCTTAAAACAGCGCCTTAAGCCTATCCAGCACTTGCATGGCGCTGTAGTAATCCAGACGG
+AACGTCTCGGTTCCCAGCGCATAAACCTGCTTGTTTTGTACTGCAGGCAGGTGCGCGAGCAGCGGATTAGCATAAATAGCATCGGCATCTTTCTGATCAC
+CGGCGAACAGGAATAGTGACTCGCCATTTAACCCTGCAGCCAGATTTTCCCCACCAAGCTGAATGATGTCATGGCGTTTACCCTGACTTTGGCTGGCATT
+TAACCCTGCGGGTAACTTCGCCAGCGTAAAGCCGAGTTGTTCCAGCATCTGCCCTTGTGCTGATTCTGGCGTCCAGAGATTGGCACTGTGTGCAGCGGCA
+GTATAGACAATGGCAGTGACCGGCTGCGGCGGTAATTTGATTTGCTCTTTCGCCGCCGCCAGTTGCTTATCAAACTGCGCAATCCGCTCTGCCGCTTGTT
+TCTCATGCCCGGTAATTTCGCCAAGTTGCGTTAACAGCGACTGCCAGCTTTTGTCGTCGTAATTGATGATTAATGTCGGGGCGATGGTGGAAAGCTGATC
+ATACAGTGCCAGCGCCGAATCCCCGCCGGTTGCGCTAATTAAAATCAGATCCGGCATTTGCGCGGCAACGGCTTCGGCGCTCGGTTCGCCGATATAGAGC
+CGTTGCAGTTTGCGTTCTTTCGCCACCTTGCTCCACTGGCGTAAAAGCCCTGGTCATCCGCGACGCGGTTATTCGGCGTGGTCGCGCCGCTGGCGATCAC
+CGGAGCATCAATCGCCAGCAGTGAGCCGGTCAGGGTGACGCTGGTGGAAACAATACGCTGCGGCTGGCTTTCCAGTGTATGTGTGCCACGGCTGTCAGTA
+ATCTGACGCGGCCAGTCAGCGGCCTGAACTGCGGCTATTCCTGAAAGCAAAAGTCCTGTTAATAGAAGGGCGTTGCGGTAGAGCGGGGCGAGTCTCACAA
+ATCAGCTTCCTGTTATTAATAAGGTTAAGGGCGTAATGACAAATTCGACAAAGCGCACAATCCGTCCCTCGCCCCTTTGGGGAGAGGGTTAGGTGAGGAA
+CAGCCAGCACTGGTGCGAACATTAACCCTCACCCCAGCCCTCACCCTGGAAGGGAGAGGGGCAGAACGGCGCAGGACATCACATTGCGCTTATGCGAATC
+CATCAATAATGCTTCTCATTTTCATTGTAACCACAACCAGATGCAACCCCGAGTTGCAGATTGCGTTACCTCAAGAGTTGACATAGTGCGCGTTTGCTTT
+TAGGTTAGCGACCGAAAATATAAATGATAATCATTATTAAAGCCTTTATCATTTTGTGGAGGATGATATGGATACGTCACTGGCTGAGGAAGTACAGCAG
+ACCATGGCAACACTTGCGCCCAATCGCTTTTTCTTTATGTCGCCGTACCGCAGTTTTACGACGTCAGGATGTTTCGCCCGCTTCGATGAACCGGCTGTGA
+ACGGGGATTCGCCCGACAGTCCCTTCCAGCAAAACTCGCCGCGCTGTTTGCCGATGCCAAAGCGCAGGGCATCAAAAATCCGGTGATGGTCGGGGCGATT
+CCTTCGATCCACGTCAGCCTTCGTCGCTGTATATTCCTGAATCCTGGCAGTCGTTCTCCCGTCAGGAAAAACAAGCTTCCGCACGCCGTTTCACCCGCAG
+CCAGTCGCTGAATGTGGTGGAACGCCAGGCAATTCCGGAGCAAACCACGTTTGAACAGATGGTTGCCCGCGCCGCCGCACTTACCGCCACGCCGCAGGTC
+GACAAAGTGGTGTTGTCACGGTTGATTGATATCACCACTGACGCCGCCATTGATAGTGGCGTATTGCTGGAACGGTTGATTGCGCAAAACCCGGTTAGTT
+ACAACTTCCATGTTCCGCTGGCTGATGGTGGCGTCCTGCTGGGGCCAGCCCGGAACTGCTGCTACGTAAAGACGGCGAGCGTTTTAGCTCCATTCCGTTA
+GCCGGTTCCGCGCGTCGTCAGCCGGATGAAGTGCTCGATCGCGAAGCAGGTAATCGTCTGCTGGCGTCAGAAAAGATCGCCATGAACATGAACTGGTGAC
+TCAGGCGATGAAAGAGGTACTGCGCGAACGCAGTAGTGAGTTACACGTTCCTTCTTCTCCACAGCTGATCACCACGCCGACGCTGTGGCATCTCGCAACT
+CCCTTTGAAGGTAAAGCGAATTCGCAAGAAAACGCACTGACTCTGGCCTGTCTGCTGCATCCGACCCCGCGCTGAGCGGTTTCCGCATCAGGCCGCGACC
+CAGGTTATTGCTGAACTGGAACCGTTCGACCGCGAACTGTTTGGCGGCATTGTGGGTTGGTGTGACAGCGAAGGTAACGGCGAATGGGTGGTGACCATCC
+GCTGCGCGAAGCTGCGGGAAAATCAGGTGCGTCTGTTTGCCGGAGCGGGGATTGTGCCTGCGTCGTCACCGTTGGGTGAGTGGCGCGAAACAGGCGTCAA
+ACTTTCTACCATGTTGAACGTTTTGGATTGCATTAAGGAGCGAGGATGAGCATTCCATTCACCCGCTGGCCGGAAGAGTTTGCCCGTCGCTATCGGGAAA
+AAGGCTACTGGCAGGATTTGCCGCTGACCGACATTCTGACGCGACATGCTGCGAGTGACAGCATCGCGGTTATCGACGGCGAGCGACAGTTGAGTTATCG
+GGAGCTGAATCAGGCGGCGGATAACCTCGCGTGTAGTTTACGCCGTCAGGGCATTAAACCTGGTGAAACCGCGCTGGTACAACTGGGTAACGTCGCTGAA
+TTGTATATTACCTTTTCGCGCTGCTGAAACTGGGCGTTGCGCCGGTGCTGGCGTTGTTCAGCCATCAGCGTAGTGAACTGAACGCCTATGCCAGCCAGAT
+TGAACCCGCATTGCTGATTGCCGATCGCCAACATGCGCTGTTTAGCGGGGATGATTTCCTCAATACTTTCGTCACAGAACATTCCTCCATTCGCGTGGTG
+CAACTGCTCAACGACAGCGGTGAGCATAACTTGCAGGATGCGATTAACCATCCGGCTGAGGATTTTACTGCCACGCCATCACCTGCTGATGAAGTGGCCT
+ATTTCCAGCTTTCCGGTGGCACCACCGGCACACCGAAACTGATCCCGCGCACTCATAACGACTACTACTACAGCGTGCGTCGTAGCGTCGAGATTTGTCA
+GTTCACACAACAGACACGCTACCTGTGCGCGATCCCGGCGGCTCATAACTACGCCATGAGTTCGCCAGGATCGCTGGGCGTCTTTCTTGCCGGAGGAACG
+GTTGTTCTGGCGGCCGATCCCAGCGCCACGCTCTGTTTCCCATTGATTGAAAAACATCAGGTTAACGTTACCGCGCTGGTGCCACCCGCAGTCAGCCTGT
+GGTTGCAGGCGCTGATCGAAGGCGAAAGCCGGGCGCAGCTTGCCTCGCTGAAACTGTTACAGGTCGGCGGCGCACGTCTTTCTGCCACCCTTGCGGCGCG
+TATTCCCGCTGAGATTGGCTGTCAGTTGCAGCAGGTGTTTGGCATGGCGGAAGGGCTGGTGAACTACACCCGACTTGATGATAGCGCGGAGAAAATTATC
+CATACCCAGGGTTACCCAATGTGTCCGGATGACGAAGTATGGGTTGCCGATGCCGAAGGAAATCCACTGCCGCAAGGGGAAGTCGGACGCCTGATGACGC
+GCGGGCCGTACACCTTCCGCGGCTATTACAAAGTCCACAGCACAATGCCAGCGCCTTTGATGCCAACGGTTTTACTGTTCCGGCGATCTGATCTCTATTG
+ATCCAGAGGGTTACATCACCGTGCAGGGGCGCGAGAAAGATCAGATTAACCGTGGCGGCGAGAAGATCGCTGCCGAAGAGATCGAAAACCTGCTGCTGCG
+CCACCCGGCGGTGATCTACGCCGCACTGGTGAGCATGGAAGATGAGCTGATGGGCGAAAAAGCTGCGCTTATCTGGTGGTAAAAGAGCCGCTGCGCGCGG
+TGCAGGTGCGTCGTTTCCTGCGTGAACAGGGTATTGCCGAATTTAAATTACCGGATCGCGTGGAGTGTGTGGATTCACTTCCGCTGACGGCGGTCGGGAA
+AGTCGATAAAAACAATTACGTCAGTGGCTGGCGTCACGCGCATCAGCCTGAAGGAGAGAACACGATGGCTATTCCAAAATTACAGGCTTACGCACTGCCG
+GAGTCTCACGATATTCCGCAGAATAAAGTTGACTGGGCCTTTGAACCGCAACGTGCCGCGTTGTTAATCCATGATATGCAGGACTATTTTGTCAGCTTCT
+GGGGCGAGAACTGCCCGATGATGGAGCAGGTGATCGCGAATATTGCTGCGCTGCGCGACTACTGCAAACAGCACAATATCCCGGTTTATTACACCGCCCA
+GCCGAAAGAGCAGAGCGATGAAGATCGGGCGCTGTTGAATGATATGTGGGGCCGGGCCTGACCCGCTCGCCGGAACAGCAAAGGTGGTGGATCGCCTGAC
+GCCAGATGCCGACGACACGGTGCTGGTGAAGTGGCGCTACAGCGCGTTTCATCGTTCTCCGCTGGAGCAAATGCTGAAAGAGAGTGGACGTAACCAGCTG
+ATTATTACCGGGGTATATGCCCACATTGGCTGTATGACCACCGCAACCGACGCATTTATGCGCGATATTAAACCGTTTATGGTGGCGGATGCGCTGGCCG
+ATTTCAGCCGTGACGAGCATTTGATGTCGCTGAAATATGTGGCCGGACGTTCTGGCCGGGTGGTGATGACTGAAGAATTACTGCCAGCACCTATCCCCGC
+CAGCAAAGCGGCGCTGCGTGAGGTGATCCTGCCGTTGCTGGACGAGTCCGATGAACCGTTCGATGACGACAACCTGATCGACTACGGTCTGGATTCGGTG
+CGCATGATGGCGCTGGCGGCGCGCTGGCGCAAAGTGCATGGTGATATCGACTTTGTCATGCTGGCGAAAACCCGACCATCGACGCCTGGTGGAAGCTACT
+CTCCCGCGAGGTGAAATAATGGATTTCAGCGGTAAAAATGTCTGGGTAACCGGCGCAGGTAAAGGTATCGGCTACGCCACGGCGCTGGCGTTTGTTGAGG
+CGGGAGCGAAAGTTACAGGTTTTGATCAAGCGTTCACTCAGGAGCAATATCCCTTTGCGACCGAAGTGATGGATGTTGCCGACGCTGCGCAGGTCGCGCA
+AGTGTGTCAGCGACTGTTAGCTGAAACGGAGCGACTGGACGCGCTGGTCAATGCGGCGGGAATTTTACGCATGGGCGCGACCGATCAGCTCAGTAAAGAG
+GACTGGCAGCAGACTTTTGCGGTTAACGTCGGCGGTGCGTTTAACCTGTTCCAGCAAACCATGAACCAGTTTCGCCGTCAGCGGGCGGGGCGATTGTCAC
+TGTGGCGTCCGACGCCGCGCACACGCCGCGTATTGGCATGAGTGCTTATGGCGCATCGAAAGCGGCGCTGAAAAGCCTGGCGTTGAGCGTCGGGCTGGAA
+CTGGCGGGTAGCGGCGTGCGCTGTAATGTGGTTTCGCCTGGCTCCACCGACACCGATATGCAACGCACGCTGTGGGTGAGCGATGACGCCGAAGAACAGC
+GTATTCGCGGCTTTGGCGAGCAGTTTAAACTCGGCATTCCGCTGGGGAAAATCGCCCGTCCACAAGAGATCGCCAACACGATTTTGTTCCTCGCCTCTGA
+CCTCGCCAGCCATATTACCCTACAGGATATTGTGGTCGATGGCGGCTCAACGCTGGGGGCATAAGCATGATCTGGAAACGCCATTTAACGCTCGACGAAC
+TGAACGCCACCAGCGATAACACAATGGTGGCGCATCTGGGAATTGTGTATACCCGTCTGGGCGATGATGTGCTGGAAGCCGAAATGCCGGTTGATACCCG
+TACTCATCAGCCGTTCGGTTTACTACATGGCGGCGCGTCGGCGGCGCTGGCGGAAACGCTGGGATCGATGGCCGGATTTATGATGACCCGCGACGGACAG
+TGTGTGGTAGGCACAGAACTTAATGCAACACACCATCGCCCGGTGTCTGAGGGAAAGGTACGCGGCGTCTGCCAGCCGCTGCATCTTGGTCGGCAAAATC
+AGAGCTGGGAAATCGTCGTTTTCGATGAACAGGGGCGGCGTTGCTGCACTTGTCGGCTGGGTACGGCAGTTTTGGGATGAACCCGACAGAATTAGATGAG
+ATTGCAGGAAAACTCGGTTAACGGAGTGATCGAGTTAACATTGTTAAGTTAAATATTGGTTTCAACTCCGATTTACATGGTTGCTGTGTTGTTAAATTGT
+ACAAAGATGTTATAGAAACAAAATGTAACATCTCTATGGACACGCACACGGATAACAACTATGAACAAATCAGGAAATACCTCGTCTGGACAGTGCTCTC
+TGTAATGGGAGCATTTGCTCTGGGATACATTGCTTTAAATCGTGGGGAACAGATCAACGCGCTGTGGATTGTGGTGGCGTCGGTCTGTATCTATCTGATC
+GCTTACCGTTTTATGGGCTGTATATCGCCAAAATGTGCTGGCGGTTGACCCGACGCGTATGACGCCAGCGGTGCGCCATAACGACGGGCTGGACTATGTG
+CCGACGGACAAGAAAGTGCTGTTCGGTCACCATTTTGCGGCCATTGCCGGAGCAGGTCCGCTGGTGGGGCCGGTACTGGCGGCGCAAATGGGCTACCTGC
+CGGGGATGATCTGGCTGCTCGCTGGGGTGGTTCTCGCCGGTGCGGTGCAGGATTTCATGGTGCTGTTTGTTTCTACGCGCCGTGACGGTCGCTCGCTGGG
+TGAGCTGGTCAAAGAAGAGATGGGGCCAACCGCCGGGGTGATTGCGCTGGTGGCCTGCTTTATGATCATGGTCATTATCCTTGCAGTGCTGGCGATGATC
+GTGGTGAAAGCCCTGACTCATAGCCCGTGGGGAACATATACCGTTGCGTTCACCATTCCGCTGGCGCTGTTTATGGGGATCTACCTGCGCTATCTGCGTC
+CGGGGCGTATTGGCGAAGTGTCGGTCATCGGTCTGGTATTCCTGATTTTCGCCATTATCTCTGGCGGCTGGGTGGCAGAAAGTCCGACCTGGGCACCGTA
+CTTTGACTTTACCGGCGTGCAGTTGACCTGGATGCTGGTGGGTTACGGTTTTGTGGCGGCGGTGCTGCCGGTGTGGTTACTGCTGGCCCCGCGTGACTAC
+CTCTCTACCTTCCTGAAAATCGGGACTATCGTCGGTCTGGCGGTAGGCATTTTGATTATGCGCCCGACGCTGACCATGCCTGCGCTGACCAAATTTGTCG
+ATGGCACTGGCCCGGTATGGACCGGTAACCTGTTCCCGTTCCTGTTTATCACCATCGCCTGTGGCGCGGTGTCTGGCTTCCATGCGCTGATCTCTTCTGG
+GACCACGCCGAAGATGCTGGCGAACGAAGGGCAGGCGTGCTTTATCGGCTACGGTGGGATGTTAATGGAATCCTTCGTGGCGATTATGGCGCTGGTTTCC
+GCCTGTATCATCGATCCGGGCGTGTATTTTGCCATGAACAGCCCGATGGCGGTGCTGGCTCCGGCAGGGACGGCGGATGTGGTCGCTTCTGCCGCGCAGG
+TGGTGAGTAGCTGGGGCTTTAGCATTACACCAGATACGCTAAACCAGATTGCCAGCGAAGTGGGTGAACAGTCGATCATTTCCCGTGCGGGCGGTGCGCC
+GACGCTGGCGGTGGGGATGGCCTACATTCTGCACGGCGCGCTGGGCGGCATGATGGATGTGGCGTTCTGGTATCACTTCGCCATTTTGTTTGAAGCACTG
+TTTATTCTGACGGCGGTGGATGCAGGTACGCGTGCTGCGCGCTTTATGTTGCAGGATCTGCTGGGCGTGGTGTCTCCTGGCCTGAAGCGGACCGATTCAC
+TGCCTGCTAACCTGCTGGCAACAGCGCTGTGCGTACTGGCGTGGGGCTACTTCCTCCATCAGGGCGTGGTCGATCCGCTGGGCGGCATTAACACTCTGTG
+GCCGCTGTTTGGTATTGCCAACCAGATGCTGGCAGGGATGGCGCTGATGCTCTGTGCCGTGGTGTTGTTCAAGATGAAACGTCAACGTTACGCCTGGGTG
+GCGCTGGTACCAACGGCCTGGCTGCTGATTTGTACCCTGACCGCAGGCTGGCAGAAAGCGTTTAGCCCGGATGCGAAAGTCGGCTTCCTGGCCATTGCTA
+ATAAGTTCCAGGCAATGATCGACAGCGGCAATATTCCGTCGCAGTATACTGAGTCACAGCTGGCGCAACTGGTGTTCAACAACCGTCTGGATGCCGGGTT
+AACCATCTTCTTTATGGTGGTCGTGGTGGTTCTGGCACTGTTCTCGATTAAGACGGCACTTGCGGCATTGAAAGATCCGAAGCCAACGGCGAAAGAAACG
+CCGTATGAACCAATGCCGGAAAATGTCGAGGAGATCGTGGCGCAGGCAAAAGGCGCACACTAAAGTCAGAGTGAGGGGGATGTTGGCGAATGTTGGCTTA
+GTGCCCAGGGTTCCTCTCACCTAACCCTCTCCCCGGTGGGGCGAGGGACTGACCGAGCGCGTTGATAGCATTTGTAGGCCGGATAAGGCGTTCACGCCGC
+ATCCGGCACTCTTTCAGCAACATGGTTAGCGGAGGCCAAGATGTTTGATTCACTGGCAAAAGCCGGAAAATATTTAGGTCAGGCGGCGAAGCTGATGATT
+GGTATGCCTGATTACGACAACTATGTCGAACATATGCGGGTTAACCATCCCGATCAAACGCCGATGACCTACGAAGAGTTTTTCCGTGAGCGGCAGGACG
+CGCGCTACGGTGGAAAGGCGGCGCGCTGCTGCTAAATTTGTACGTCAGGCTTTAAACGATTCCACTTTTTGAACGCTGCACGCAACGTATCTGGTGTCAG
+CGTGACTGGCAGGTAATGAATGGACTCCACCGGACGCAGGGTGTGGGCAATCACTTTGTCGATCTCCGCCTGATTATTGATATCCACTTCCAGCTCCGCC
+AGTGTAGTCGGCAGATGAAAACGCTGATACGCTCCAGTTAATTGCGCCAGCACATCATCCTGACCCAGCAAGGCGCTTTGCACCAGAATTCCGTAGGCGA
+CTTTGGTGCCGTGGAGAAACTTCTCGGTTTGCGGCAGCACGGTCAGACCGTTATGCACGGCATGAGCTGCCGCCACACGCGTAAAACGATCGCCCAGACC
+ACCAACCATCCCACCACCAGCAATAATAGCATCCACCACATCGCAAAATGATTGCGTTAACTGTTGATTTTGCTGATCGCTCAGCGCCTGTTCGCTACTG
+TTTAACAAGACGTCGCGAATGGCTTGCGCATTATTGATCCCCAGTCGCACGGTTAGCGGCAACGTTTCTGGTTGCGGAGCCAGCACCACCGCTTCATACC
+ATTTCGCCAGCGTGTCACCGATCCCCGCCAGCAGATATTGTTGCGGTGCATTGAGGATAATCTCCGGTTCCACCAGCACCATAAAATTGGCGTCGTCGAA
+AATCTCATAATGCAGCGCCTGTCCGGCATCATTATACCAGACGGAGAGCGGTGTCCAGGCGGCGCAGGTGGCGGCGATCGTCGGAACGGCAACAAACGGC
+AGACCGAGACGGCGGGCGAGGGCTTTCGCGGTGTCGAGCAGTGCACCGCCACCGACGCCAATCACCACGCTGCGGTCGTCACCGGACTCAGCCGCCAGTT
+GTTGTACATCGCTTTCGCTGCAATGACCGCGAAACAAAATATGCTTTGCCCTGGCAGTCCAAACGCTGGCGGAAGTTTGGTTTGCGCCGCAGCAATGGCG
+CGTTTGCCGTAGATCCACACCGCGCGAGAAAGTTGTTCATCAGTGAAAAATCGTGCAGGTGATTGAAACTTCCTGGATGTGAAAAGTAGTTAGCCGGGCC
+GACGACCACGCGGATAGGATTGTGAGGCATGTTGTGTTGTCCTTATTGTTTTATTTAGACATCTAAACGTCTTGATTGCCAAATACTAGCATCGTGTTAT
+AGTGCCTTCAACACGCAACTTCGTCAGGTACAATAAAATGACAAATAACCCTCTGATTCCACAAAGCAAACTTCCACAACTTGGCACCACTATTTTCACC
+CAGATGAGCGCGCTGGCGCAGCAACACCAGGCGATTAACCTGTCGCAAGGCTTTCCTGATTTTGATGGTCCGCGCTATTTACAGGAGCGGCTGGCGCACC
+ACGTTGCACAGGGGCAAACCAATACGCGCCCATGACCGGCGTGCAGGCCTTGCGCGAGGCGATTGCTCAGAAAACGGAACGTTTGTATGGCTATCAACCA
+GATGCCGATAGCGATATCACCGTAACGGCAGGGGCGACGGAAGCGTTATACGCGGCGATTACCGCACTGGTGCGCAATGGCGATGAAGTGATTTGTTTTG
+ATCCCAGCTATGACAGTTACGCCCCCGCCATCGCGCTTTCTGGGGAATAGTGAAGCGTATGGCACTGCAACCACCGCATTTTCGCGTTGACTGGCAGGAA
+TTTGCCGCATTATTAAGCGAGCGCACCAGACTGGTGATCCTCAACACTCCGCATAACCCCAGTGCAACTGTCTGGCAGCAGGCTGATTTCGCCGCTTTGT
+GGCAGGCGATCGCCGGGCACGAGATTTTGTCATTAGCGATGAAGTCTACGAGCACATCAACTTTTCACAACAGGGCCATGCCAGTGTGCTGGCGCATCCG
+CAGCTGCGTGAGCGGGCAGTGGCGGTTTCTTCATTTGGCAAGACCTATCATATGACCGGCTGGAAAGTGGGTTATTGTGTTGCGCCAGCGCCCATCAGCG
+CCGAAATTCGCAAGGTACATCAGTATCTGACCTTTTCGGTGAATACCCCGGCACAGCTGGCGCTTGCTGATATGCTACGTGCAGAACCTGAGCATTATCT
+TGCGTTACCGGACTTTATCGCCAGAAGCGCGATATTCTGGTGAATGCTTTAAATGAAAGCCGGCTGGAGATTTTACCGTGTGAAGGTACATACTTTTGCT
+GGTGGATTACAGCGCGGTTTCTACCCTGGATGATGTTGAGTTTTGCCAGTGGCTGACGCAGGAGCACGGCGTAGCGGCGATTCCGCTGTCGGTGTTTTGC
+GCCGATCCTTCCCACATAAACTGATTCGTCTCTGTTTTGCCAAGAAGGAATCGACGTTGCTGGCAGCAGCTGAACGCCTGCGCCAGCTTTAGCTATTTAA
+CCGTCCAGGCGCGGGAATATTGACGGTCGGCAAACAACTCTTGCAGGCCGTTAATTTGCTTCAGGCGCAGCACTTCGTCGCTGTCCATTCCCAGCTCTTT
+GCCAATTTTATTATCGTCCCATCCCAACTGGCTAAGTTCACGGACGATTTCCGACATGGCGGTGATTTGATGGCGTCCACGAGCGCGATTATGACGAATA
+GTCGCGGCGATGCGTTGATTACGCGTACCTTCCAGACAGGTCACCGGCAAATAACCTTTAAGCGTAATTTTAATGATGATGAGCCTTTACCAATTTCATG
+GCGGTGAAAACCATCCACGATTTCCATGGCATTTTTATCCGTATGTGTGACCACAATGGGTTGGGTAAAACCATCTATTTCAATGGATTTTGCAGCAGTT
+TTTTCGGGTGGTGCCACGTTGTTTGGGTTGTAATCATTAGGCATAAGTTGGCTGTTTTAACCCACAGAACGCAATCCACTGGCTCTTCACGAAAGGGCTA
+ACCTGATGGATCGCCATGCGGATTTCATTAATCGCTTTGATGCGATCATCTTCCGGCAAGCTGGCGAGAAATTGCGTTAAATCCTGCGTTAATCGTTGTT
+GCATAGTATCCCCATTCCTGACGTTTTCCTTTTATCCGTTCGTTATAACGCTGATAGTTCTTCGATTTTGTGGGGCTAAATGATAATGCCCGACACCAGT
+AATCGTTATTGAGTAAAACTTTGCATATCCGCCGCCAGGAGGGATATCTTTCGCGCCAATGTCCCCTTGCTGGGTTTGTGGAACCTCGATGCCTTTTTCT
+GATACCAGTGCAAATAAATGGCGATTTTATTGCGGTAATGCTCAGCTGTTTTTCCGGCATGCTATTGAGCAGCAATAATGCATATTCTTGCCAGTCTAAA
+TGTTCTGGCTTGAGGATTTTCCGATGCCCATAGAAATGATTGTCATGTCCGGCGTAAATGCCGCCACTTTTACCCCGCTGACTCGTGCGCACATAGCAGC
+CCAGCGATCCGGTTCGATAACGTGATAGAGCCATAATCCTTGTCGTTGCTCCGGGCCAAAAGGTTCGCAAATTCGCATATGACGCAGAGGAACGCCTGCC
+TGATACATTAGGTTATACAGTGGGTTGCAGAGACTTTGATGATTTGCATACCAGGTCCAGATATCAGCCACTTTCCAGTCGTAAATGGGGTAAATGTACC
+AGCTATGACCGCCTGGTGCGGCCGTAGTCCAGGGTTTATCGTCGGCAAAACGTTGTTTATTTAAACTGGCGATGGCGACAAAACGGTTGTAGGACTCATC
+CGCACGGATGCCGATCATCATCGCCGCCGGACGTTTTGTGAAAACCATTCGGCAAACTCACGTACAAATTGTTCGAAGGTCATGCCTGGCTGGTAAAAGC
+AGAAAAAGTCAGGGTCGGTTATCGCATCTTGGGGAGGTTGACGTACCCATTCGACATCAGGTTCCCAGCACTGCCATTCGGGTTGGTATTGTGAAAGGGA
+ATTTTGCGTCGTAAGCGGGAGCGCAACCCAGTAAAACTCTTCGATGACATCGGTGTACAACTCGCGCAGGGACTGAACATAGTTAATGGTGCAAGAGAAT
+TGCGCCTCCCAGTCGATAAACAAAACGCAGATTTTTGCCCATTTGTCGGGCAAGTTCGGCTGTCAGATGCAGCATTAAACCAGAGTCTTTGCCGCCAGAA
+AATGAGACACAAACGCGGGGTAGGGTGTTGAGTGTCCAGGTAATACGCTCTCGTGCAGCTTCCAGAATATTGAGCGGAAGAGGAATTTTATAAATAGACA
+TCTGAAGACGCTCTCTGAACGTTACAGGGTGATCAGTGAGATAAGTCTGTTAATTATAAAGTAAACACTGTAAAGCAGAGTGTTTTATTTTTCATTCGCG
+CTGTGAATAAATAGATGAAAGTTATAGTAGCTGTCTGTAGTTATATATCAAAACTCTCATTTAGACGGTCAATAAATCGGGAGAACACCAAATTATTTAA
+AGAAGATTTATTATAGGAAATGTAAAGCTTTATTGAAGGTAACGGATGTTCTAGTTTTATCTCTTTTAAGTTAAGAAAGTCACGGTAGGAATTATAAAGT
+TCATAGGGACTATTCCCAGTAAATCTGTAACTGCAATGCTATTAATGATTGTCAGCAAAGAGGAACCACGAAATGAGATTTTGCGATTCATAAATCTCTC
+GTCTATTTCCATTTGAATATCATCAACCCCTGCTGATTTAGATATTAATTGGGTGAACTCTTCTGCCATAATTTGTTCATAAGTGCTATTGTCAGTAATT
+CGTGGATGCCTATTACTACAAATTAGAGTATTGCGAATCGTATGCAATGGCATGCAAATGACGGAACGGCTGATCACTGGCATTTGGGTGATCACCAGAT
+CGGCTTTGCGGTGAACCAACAGTTCTTCAGCATTCTCTGCTGACATGAGGATATCATGGCACTCAATCTCGACAGAGGAATCTTGCCGTAGGCAGCGGAT
+CAACATACTATTATTAGAGCAAGAAATGAGCTGAGGGCCGTAGATAATAAAGTTTTTCTTTAGTTCGGACTTATTGACTATATTAATTGTTTGTTCAAGG
+CCTCTGAGATTTTTCTCAAGATGGTGATGCAGATTTAACCCTGTTGTCGTCGGCGCGATACCTTTTCCTGAGCGAATGAATAAAGGGTCATTAAATTGCG
+CACGTAAGCGTTGTAACGACTGGCTCACGGCTGATGGGGTGATATATAGTGATTCAGCAGCTTTGCTAATGCTTAAATGCTGGTAAATACACTCAAATAT
+GACAAGAAGATTTAAGTCGAACTTTTCAAGTCGTAGAGATTGGCCATACACTACTCCGGTTATATTTTTCTTCCATGATATATTCACTTAATCAATGTTT
+TTGCGTATATATTTTTATTGATTATGTTTTTGCTTAACTCAGGATTAAGTTTTTCTAAAATAGCACAGCCACTTAGGGCAGAGCGAGCAATTCATGCTTT
+TAGGATGGTTGAAAAGCAGGGATATAGTTCAACCATCCATGAATTACCTTTTATTTATTCCCCATAATGATATTAAGCGTTTTCTGATCGGGCAACCCCA
+CGGCCTGTTGTAGCGTATTTTCCTTACTCATGTAATAGATAGCCGGCGTGACATTTGCCCCAGATCGTCCATCAGTTTCTCATTGTCACTTAACACTTTC
+ATTTGCTCTGTACTTACGTTTGCAGGCACGTTTAGCTTAAGCTTGCCACCAGAGGCTTCATATTGTTGCCAGGTTTTGCGGGATCTTTGGAGGCAAGAAT
+TGCCGCTGCTGTCGCCGGGCTTTCTGGCTTGATAACCCCAACCAACAATGTTCTTAATTGCACTTTGCCAGAATCTACCCACGGGCGCGCCTGCTGCCAG
+AACTGTTTACAATATGGGCAGAACGGATCGGCGAAGACGTAGACAATGACCGGCGCATCTTTTTACCGTCGAGGAGCCAGTGGGATTGTTCCATCCGTTG
+CCACATTTCGCGTCCGGCTGGTGCGTAAATTTCTTTTCGATAAGTGTGTTACTCAGGTTTTCACCTTTCTCGTTGTACATGTAACCAGAGATAGCGTGCT
+TACCATCTGGAGTCAGGTAGATGGTGACGCCCATATCCTGATACTTTCCGAGATAACCTTTCATTCCTCCGGGGCATCGAATGTTTTGATGATTGTAATG
+CCCTGTTTTCAATCGCTTTTACTGGAGCAGGAAGTTCCTCTGCGAAGGCGATTGCAGGAAGCAGAGCCAGTAAAAGTATCTTTTAACATTAATTTGTCCT
+TTTCAGTCAGTGCAAAAGTCGAGTAAAAGGCATAACCTATCACTGTCATAGGTAAGAGCTTAGATCAGGTGATTGCCCTTTGTTTATGAGGGTGTTGTAA
+TCCATGTCGTTGTTGCATTTGTAAGGGCAACACCTCAGCCTGCAGGCAGGCACTGAAGATACCAAAGGGTAGTTCAGATTACACGGTCACCTGGAAAGGG
+GCCATTTTACTTTATCGCCGCTGGCGGTGCAAAGTTCACAAAGTTGTCTTACGAAGGTTGTAAGGTAAAACTTATCGATTTGATAATGGAAACGCATTAG
+CCGAATCGGCAAAATTGGTTACCTTACATCTCATCGAAAACACGGAGGAAGTATAGATGTCCTTGATTAACACCAAAATTAAACCTTTTAAAACCAGGCA
+TTCAAAACGGCGAATTCATCGAAATCACCGAAAAGATACCGAAGGCCGCTGGAGCGTCTTCTTCTTCTACCCGGCTGACTTTACTTTCGTATGCCCGACC
+GAACTGGGTGACGTTGCTGACCACTACGAAGAACTGCAGAAACTGGGCGTAGACGTATACGCAGTATCTACCGATACTCACTTCACCCACAAAGCATGGC
+ACAGCAGCTCTGAAACCATCGCTAAAATCAAATATGCGATGATCGGCGACCCGACTGGCGCCCTGACCCGTAACTTCGACAACATGCGTGAAGATGAAGG
+TCTGGCTGACCGTGCGACCTTCGTTGTTGACCCGCAGGGTATCATCCAGGCAATCGAAGTTACCGCTGAAGGCATTGGCCGTGACGCGTCTGACCTGCTG
+CGTAAAATCAAAGCAGCACAGTACGTAGCTTCTCACCCAGGTGAAGTTTGCCCGGCTAAATGGAAAGAAGGTGAAGCAACTCTGGCTCCGTCTCTGGACC
+TGGTTGGTAAAATCTAAATTTCCTTCGTCTTTCACGCCATAGCGGCGTTGGCGTCGCCCGCTCACCCCGGTCACTTACTTGTGTAAGCTCCCGGGATTCA
+CAGGCTAGCCGCCTTGCTCTGACGCGAAATACTTCGGAAATTCACCTAATTCTTCGGGTGCTGCGGCACCGATTTTCTTCCGCACCATGATGCAAGCTGC
+ATCCAGGTAGCCGCAGAGGCCGCTTGCATGATGATGTTTAAAGCCCAGGAGATAAACATGCTCGACACAAATATGAAAACTCAACTCAAGGCTTACCTTG
+AGAAATTGACCAAGCCTGTTGAGTTAATTGCCACGCTGGATGACAGCGCTAAATCGGCAGAAATCAAGGAACTGTTGGCTGAAATCGCAGAACTGTCAGA
+CAAAGTCACCTTTAAAGAAGATAACAGCTTGCCGGTGCGTAAGCCGTCTTTCCTGATCACCAACCCAGGTTCCAACCAGGGCCACGTTTTGCAGGCTCCC
+CGCTGGGCCACGAGTTCACCTCGCTGGTACTGGCGTTGCTGTGGACCGGTGGTCATCCGTCGAAAGAAGCGCAGTCTCTGCTGGAGCAGATTCGCCATAT
+TGACGGTGATTTTGAATTCGAAACCTATTACTCGCTCTCTTGCCACAACTGCCCGGACGTGGTGCAGGCGCTGAACCTGATGAGCGTACTGAACCCGCGC
+ATCAAGCACACTGCAATTGACGGCGGCACCTTCCAGAACGAAATCACCGATCGCAACGTGATGGGCGTTCCGGCAGTGTTCGTAAACGGGAAAGAGTTTG
+GTCAGGGCCGCATGACGTTGACTGAAATCGTTGCCAAAATTGATACTGGCGCGGAAAAACGTGCGGCAGAAGAGCTGAACAAGCGTGATGCTTATGACGT
+ATTAATCGTCGGTTCCGGCCCGGCGGGTGCAGCGGCAGCAATTTACTCCGCACGTAAAGGCATCCGTACCGGTCTGATGGGCGAACGTTTTGGTGGTCAG
+ATCCTCGATACCGTTGATATCGAAAACTACATTTCTGTACCGAAGACTGAAGGGCAGAAGCTGGCAGGCGCACTGAAAGTTCACGTTGATGAATACGACG
+TTGATGTGATCGACAGCCAGAGCGCCAGCAAACTGATCCCAGCAGCAGTTGAAGGTGGTCTGCATCAGATTGAAACAGCTTCTGGCGCGGTACTGAAAGC
+ACGCAGCATTATCGTGGCGACCGGTGCAAAATGGCGCAACATGAACGTTCCGGGCGAAGATCAGTATCGCACCAAAGGCGTGACCTACTGCCCGCACTGC
+GACGGCCCGCTGTTTAAAGGTAAACGCGTAGCGGTTATCGGCGGCGGTAACTCCGGCGTGGAAGCGGCAATTGACCTGGCGGGTATCGTTGAGCACGTAA
+CGCTGCTGGAATTTGCGCCAGAAATGAAAGCCGACCAGGTTCTGCAGGACAAACTGCGCAGCCTGAAAAACGTCGACATTATTCTGAATGCGCAAACCAC
+GGAAGTGAAAGGCGACGGCAGCAAAGTCGTTGGTCTGGAATATCGAGATCGTGTCAGCGGCGATATTCACAACATCGAACTGGCCGGTATTTTCGTCCAG
+ATTGGTCTGCTGCCGAACACCAACTGGCTCGAAGGCGCAGTCGAACGTAACCGCATGGGCGAGATTATCATTGATGCGAAATGCGAAACCAACGTGAAAG
+GCGTGTTCGCAGCGGGTGACTGTACGACGGTTCCGTACAAGCAGATCATCATCGCCACTGGCGAAGGTGCCAAAGCCTCTCTGAGTGCTTTTGACTACCT
+GATTCGCACCAAAACTGCATAAGAAGAAGTAAGATTCACCTGCAATTGCTTAGCCGCCGGGGTCAAACCTGGCGGCTTTTTATGGCATTAAAAGCCCCGC
+CGGGATGGCTCCGGGCAGGGCGGGATACTTATTCTGGCAATTAACGCACAACCAGCACCGGCAGATTGGCGTGGCGGATCACGCTCGAGGCGTTAGAACC
+TAACAGATGGGTCGAAATCGATGGGTTGCGAGAACCAATAACTACAACATCAGCCCCAGTTCTTCTGCCAACTCATTGACTTCATCCCGCACGCTACCAA
+AACGGACATGTTGTTTAATGCGGGAAGGATCGATGGTGAAGTGGCTGACCATCGTTTGCAGACGTTCTTGTGCTTCATGTTGCAGATGCTCTTCAAAACG
+ACGCACATCAGCGGCAAAACGGTGCAGGCTCAGGCTGGCTGACCCGGGTAGTACGTGAAGTAGATGAATAACTCCGTCATCCTGGGCGAGGAATTCAGCG
+TGGCGAACAGCTTTGTCGCTCAATTCCATTTCAAATACATCAACTGGCATAATGATTGTCTTATACATAACCCTTTCTCCTGTTAATCATGAACAAATCA
+TTCGCCATGATTATAATATTTATCCCTGATATTTGTCTGGTTCTTTTTCCTTACGAACTGTTTCTGTGATGAATATATTCTCACTGAACACCAGGAATTC
+TCCCAAAACCTGTGGTACCGCCCGTTTTCCCGCTGTGATAGCTACCCTTAAAGACTGACTCTTTTTGAACTGTCTCTGGAGGTTGCATGAAAGCATTGAC
+TTATCACGGCCCACATCACGTTCAGGTAGAAAATGTTCCCGATCCGGGCGTTGAACAGGCAGATGATATTATTCTGCGTATTACGGCAACGGCGATCTGT
+GGCTCTGACCTCCATCTTTATCGAGGCAAAATACCTCAGGTTAAACATGGCGATATTTTTGGTCATGAATTTATGGGGAAGTAGTTGAAACCGGAAAGGA
+CGTAAAAATTTGCAAAAGGCGACCGAGTGGTAATTCCGTTCGTCATTGCTTGTGGCGACTGTTTTTCTGTCGATTGCAACAATATGCCGCCTGCGAAAAT
+ACCAATGCGGGTAAAGGCGCTGCGCTCAATAAAAACAGATACCAGCTCCAGCGGCATTGTTTGGTTATAGTCACCTGTATGGCGGCGTTCCTGGTGGGCA
+GGCGGAATATGTCCGCGTCCCTAAAGGGAATGTGGGGCCGTTTAAAGTACCGCCTTTGCTTTCAGATGATAAAGCGCTTTTCCTTTCTGATATTCTGCCA
+ACGGCATGGCAGGCAGCAAAAATGCGCAGATCCAACAAGGTTCAAGCGTTGCAGTCTATGGTGCTGGTCCTGTGGGATTGTTGACAATCGCCTGTGCACG
+GTTGCTCGGTGCGGAACAGATTTTTGTTGTTGATCATCATCCCTACCGCTTGCATTTCGCCGCCGACCGCTACGGCGCGATCCCGATTAATTTTGATGAA
+GACAGCGATCCGGCACAGTCAATTATTGAACAAACGGCAGGTCACCGGGGCGTGGATGCAGTAATAGACGCCGTCGGTTTTGAAGCGAAAGGCAGCACCA
+CGGAAACGGTGCTGACTAACCTGAAACTGGAGGGCAGCAGCGGTAAAGCGTTGCGTCAGTGTATTGCGGCGGTCAGGCGTGGCGGCATTGTTAGCGTACC
+GGGCGTCTACGCTGGATTTATTCACGGTTTCCTGTTTGGCGACGCCTTTGATAAAGGGTTGTCGTTTAAAATGGGACAGACCCACGTTCACGCATGGCTG
+GGAGAATTATTACCGTTAATTGAGAAAGGATTACTGAAACCAGAAGAAATTGTTACCCACTATATGCCGTTTGAAGAGGCCGCCCGGGGATATGAGATTT
+TCGAAAAACGTGAAGAGGAGTGCCGTAAGGTGATTCTGGTACCCGGTGCACAAAGCGCAGAGGCGGCGCAGAAGGCGGTTTCAGGTCTGGTGAATGCGAT
+GCCGGGGGAACAATATGATCGTCAGGAGTGGTTTTCGAGGTAAAGGACAGCCATGACGATAATCGCCGCCATAATCAGAAATCCTATCAGGATGTAAAAT
+GCTTCTGCCATGGTTATTCCCACAAACGAAACGGAATAATTTTGCAGCAAAAGTGAACAGTGAGAACCAGGAAAAATTGCTGATTTTGCGTAAAGAGGAT
+GCGAGTGCATCCTCTGGGCAAAGCGAGTTATCGCTTGTGCAGATGGGATTAAAGCAGGTAGTCGCCAGCAGCTTCTGGCTGGTATTCGAGTTCCAGCACT
+TCAAGGTGGGTTGCAACGCCGCCCGGAAGTTCCCAGTGAATGGAATCGCCAACGCGCAGCCCCAGCAGTGCGGCACCTACCGGAGCCATAACGGAAAGCT
+GAGTATTGCTATCGGTCATTTTGCCGGATACACCAGCGTGCGCACACGCACTTCGCCATCGCTAAGATTGCGGAATTTAACCCGGCTGTTCATTGTCACC
+ACGTCGTGTGGCATCTCTTCTGGCGAACACATTTGGGCGCGATCCAACTCTGCGTTTAACGCGTCGGCGATTGGCAAACCAGCATAGGCGGGTTGCTCCA
+GCAGAATATCGATGCGTTCGGCATCCAGGTCGTTAATGATGATAGTTGGTCTGGACATTTTTACTCCATGTCGTCGGTGCTGCGAGTGTCGCAGATAAAC
+ATACCAAAGAAAACCCTCACCGTCAGGCGGCGAGGGTTTAACTCACATGATGATACTGACTGTTGCTCACTCTTTGAAGTGATTTGCGTCACATTCAGGG
+AATTCCTCAATGCAGCGCATTATGTATAAATCTTAATCGCCTTGGTTTATGGAAGACGAATTAGCGTGTTTTGTAAATCAGATGATTAATAACCCGCTTT
+ATCAATCACAAAGGTTTTGCCACAGTTACCTGGGTGAGGTTGTGGCAAGAATGAGTTTGCAGAAAGCGGAGCGTTGATGGCGTCAGCTTTGATCGAGATC
+TGAATTTCAGTCAAATACGCAGGGTTACCCTGGCACGTTAGCTTAACTGCTTTCACGTTCTCTTTTCCCCAGCTTTTGGCAAAGGCGGCGTCAAAGTCAC
+GGCGGCTCACTGTTTTACCGTAATTATCCGCAAGGAATTTTCCGGCTTCGCTCTCTTTAATTTCTTGATTCAGGCGTACCATCGTACCGAAGTATGCGTC
+CGGATCAAAACCAAAGCAGGCACCGTGTTTGGCATATTCGTAGCGTTCCAGGCAGGAACGTCCGCCAGCTCCTGGCATGACTTCACTTAGTTTAGCGGCC
+GTTTCCAGTGATAATCCGGTTTCCGGCGATGAACACATTCGGCTGGCGCGCGCTTCTGGTAGATTCGGGATTGGGCGAGTAGCGCAACCGAAGCGCATCC
+AGCGGCGTTCATCAACACCACGGGCAGCAACCGATTTAGGCAATCCTGGCCACAGACCATGTACGGTCAGAAAATCAGCTTTGTTGGTCGTTTCGGTTTG
+CAGGCGACATTCATCTCGTTCGTTACGATTTCGATCGTGTTGACTCTGGCAAAATCCGGTTTGCCAGGAGAGGGCCAGGACATAGCGATCAAAATCGCCA
+TACTGTTTTGCCTGCAACGCTAAGGCGTTGGCAGAAGAGAAGGAAGCAGAGAAACCGCGAGCAACGCGGCGTTACGCCAGAATGCTTTCATAATGGGTGT
+GGAACTCATACATACACTGAATACTATCTATTAAATCATAAAAAGCCCGCCAGGTGGGCTTACCTGGCGGGCGTGATGATTTATTCAGCGTTTGGCGAAC
+GTATTAGTTCCACATGGCGAGAATCGGCCAGCCAACCAACAGCAACATAGAGATGTAAATCACCCCGAAGATTGCGCCAAGACGCCAGTAATCTTTTGAT
+TTCACATAGCCACAGCCGTAAATAATCACCCCAGGACCGGTTGCATACGGCGTCAGACAGCCCATGATACCGATAGACAGCACCAGCAGGATACACAGTT
+GTTCCATTGGTACGCCCGGAATACCTTTACCGACGGCCAGAATAACCGGCAGCATGGTTGCGGTGTGCGCAGACAGGCTGGCAAACAGGTAGTGTGCAAA
+GTAGAACACCAGAACCAGTACAATCACCGTTGCGTTTGGTGAGAATCCTTCCAGGTGCGTACTCATGGTACCGGCGAACCAGTCAATAAAACCAGAACGA
+GTCAGGCCGTTAGCCATCACAACCAGAGTTGCCAGGTTGACCAGTGTGTTCCATGCGCTGTTATAGCGGGTAATGTCTTTCAAGGCACAACGTGCAGGGC
+CAGCATTAGCGAAACTGCCAGCAGACCAACCGCAGTAGCATTAATGACTTCACTGCCAAATACCCACAAACCTAAGCTGAGCAATACAAGGCCAATCAGT
+GTCCACTCTCTGCGTGTCAGCGCACCCATGGTTTTCAGTTCATCACCCGCCCAGGTTGCCACTTCTTCACTGTGTGTGATTTCCGGTTTGTACAGCACGT
+AGGAAAGCCACGGCGCAATGATAAGCAAGATAACCCCAACCGGCAGGAAGCAGAGGAACCACTGCAACCAGCTAATCTGGATACCGGCAATTTTGCTGAC
+GAACTCCAGACCCAGCACGTTTGGTGCCGCACCGGTGACAAACATGGACGAACTCAGACTGGTACTAATGACCATCATCCACATCAAATAGCCGCCAATA
+CGACGCGCGGACGGATCGTTCGGGAATGATTTAAACAACGGCGGCAGGTTTTAATGACCGGAAAACCGTACCCCGGTACGCGCGGTGTTGGAAGGTGTAA
+ACGGTGCCAGCAGAATGTCGATAATGACAATCGCATAACCCAACGTCAGCGTGCGTTTGCCCATGAATTTCACCAGGAAAAGGGCAATGCGACGACCTAA
+CCCGGAAACTTCATACCCTAATGCAAAATAAATGCGCCAAATACCAGCCATACCGTGGTGCTGGAAAACCAGCCAGGCCCCATTTCAGCGCCTGTTTTGC
+GCATTAAACGCTGGGTCAGCTAATTCTTTGGCATCAAAGAGCAGGTAATTACTGCCAATAACGCAAATAGTAACCGCAATAAAACTGATCGCTGTTGCCG
+GAATTGGCTCGAGGATCATGCCGACAATCATTGCCACAAACACAGCGAAGTAATGCCATGCCTGCGGCGGCATACCGTCGGGGACAGGGATAAGAAACAT
+GACACCCATCACCACCAGTGGGGCCAATAGTTTCCATATATTATCTTTTGCTAAAGACATACGGGTTCTCCGAAAATTAATATTTCCAAATTTATCAAGT
+GCTTAAATAATTAAATCTGTGCTAAAACCAGGTAAGGATCAGTAGGTCAGCACTGCCGCCTGGACTGAGATTTCGTTCGATACACTCCCTGTCGAACTGC
+CGGAGATAATCGAGATCGGCGGGGTTCGAATGCCCCTTTGCAATAATGTTTGCGCCTCGCGCTGTAGCCAGCGCAGGCCCCTCGCCACCGCGCGATGCAA
+CGTTGGTATCGCCGTTGATCGCCATCAGTAGGAGCAAGGTATCGAGCAATGCCAGTTCAGGATCTAACCCTGATCCAGCAGAGTGAGGTAATGCGGCAAG
+GCGTGATTGATCACCAGTGGATAACCCGCTTCGGCTTCACCGCGTGCGCCGGTAAGGCCAAGCTGTTGGTACAACCGTTGACCTGCCGTCAGTTGTGAAT
+TATTGGTACGCAGTTCGCGATCGGTCAGGCCACGGCAGAAACTTGCCGCCGTAGAACAAACGGTTGTTGGCGTTACCGGTTGGTTGAGTTGAAGCAAACG
+GCCAATTGCCGCACATAGCAGCCCTAAAGAAAAATGCTGCCTTTATGCGTGTTTACGCCCGCAGTGGCGCGGAACATATCACCTTCGCAAGCCATACCAA
+TTGGGCGTAATCCGTGGAGTACCGCTTCTGGTGCCATTTCCGCACTACAGGCACCAAATTCAATGAAACGGGGTAGCCAGCCCTGAATCGCCAGCGCGCT
+GCGGTGGAAATCTTCCAGCGCCATATCTTTGTGCGCACCGCAGTTAATGCGATCCACGAGGCCTGGTTTCGGTGACAGATTGACTTCAGTCAGCATGGCG
+CGCCAGCCCAGCAGGGCGTACTCATCGATTAATGACGTCGCAAGCTTTGTGGTTTTAGTTGACGTTGCAGGCATCGACATCGTTCAGCAGTGCCTCCATG
+CGGTTGAGTAAATCGGTCAGTTGATGGGTTTTCCACGCGCGCAGACGGCTGCGCTTTGTTCGCACAACAGGCAGCGGCGAGGCGGCAGTGAATAGTCGCG
+GCGGGAGAATTTCGCCTTCGGGCGTCAGGACATCGATATCCCATAACCGCCCGAGAGGATGACTATGTTCAAGCTCAATGGTGGCGAGCTTGAGGTCGCG
+AGCCGGGGCGGCAATGCTCAACATGCCCTCCGGCCCGCTGGCGGAAACCAGTGCAGCCTGCTCCTGAATTTGCCAGCCCTGTTTTGCGGCTAAGGCACGC
+AAGGCTGTCACGCCATGATTAAAAATTCGGCGTGTGACCTCGCTGTCTTTAATCGGCCCAGGCGCAACCACGGTAAAGGAGACCAGTGGAACAGGATGGC
+GCTTGAGCCAGACGTGTTGCCGTGCTTGCCTTTCATCCCGGCTGACGAGCAGCTCGGGAATTGATACCGCATGGTGGCTGGCGAGTTCAGGAAGCAGGTG
+CATGGCTTATTCCTTCACCTGATGCACAACATCGATCACCGAGCCATCGCGGTAACGCACAACGGCAACGACGCGGTCTGTGAATTCAATCGGCTGTGGT
+TCACCGGTCAGCAGACGCGCACGTTCGCGCAGCCACTCAATGGAAACCACTTTAATGCCCGCTTCCTGCAGACGTTCTGCCAGTTCCGGACGTGCCGGGT
+TAACTGCGATACCGTGGTCTGTGACCAGAATATCGACACTGGAGCCTGGGGTGATGCAGGTCAGTACGTTATCCACCAGAGTCGGAATACGACCGCGTAC
+CAGCGGCGCGACGATGATGGAAAGCGCAGAGGCAATCGCGGTATCGCAGTGACCACCGGAAGCACCACGCAGTACGCCGTCAGAGCCGGTCAGCACGTTA
+ACGTTGAACTGGGTGTCAATTTCCAGCGCGCTCAGTACCACCACGTCGAGACGATCAACCGATGCGCCTTTCGAACCCCAGTTAGCGTACTGGTTGGCGC
+TGATTTCGATGTGATTGGGGTTACGGGCCAGCGATTGCGCAGCATGGCTGTCAAAGCTCTGCACATCCAGCAGTTTGCGGATCAGACCTTTTTCGTGCAG
+GTCAACCATCGTCGCGGTAATACCGCCAAGGGCGAAGTCGGCGCGAATATCGCGGCTACGCATTTTGTCTTCCAGGAAACGGGTTACCGCCAGCGATGCG
+CCGCCGGTGCCGGTTTGCATGGAGAAACCTTCTTTGAAGTAGCCAGAGTTGACAATCACATCCGCAGCGCTACGGGCAATAAGCAGTTCGCGCGGGTTAG
+TGGTCATACGGGTCGCGCCAGCGCCGATTTTGCAGCATCGCCAACGCGGTCAACTTTGACGATCAAATCAACCTGATCTTGCTCAATGCTTGCCGGATTA
+TGCGGATAAGGCAGCAGTTCTTCGGTAAGCATCACGACCTGTTTTGCGTTGTCGGCATCAACTATTGCATAGCCGAGGAGCCGCAGCAGGCTTTACCGGT
+GTAGCCGTTGGCATTACCGAATTCATCACAGGACGGGACGCCGAGGAAAGCCACGTCGATATTCAGTTCGCCGCTCTGTACCAGATGCACACGACCGCCG
+TGAGAGTGGATCTGCACCGGTTCTGCCAGCAGACCACGGGAGATCTCTTCCGCCAGTGGACCACGCAGGCCGGAGGTATAAATGCGGGTAACCACGCCCT
+GGCGAATGTGTTCTACCAGCGGCGCATGGCAATCACTCAGGAGCTGGACGCCAGGGTCAGGTTTTAAAGCCCATCTTCGCGATGACGTCCATCACCATAT
+TGACGGTCAGGTCACCGCCACGGAAAGCGTGATGGAAGGAAACCGTCATGCCGTCCTGTAAACCAGAGCGACGAATCGCTTCTTCCAGGTTGGCGCACAG
+TTTGCGATCGCGCGCTTTTTCAGCCTGGTAGGTTTGCTTTGGCGAGTTCTGGAAAGCGGCAAGATCGCATTCAGCGCGACGATTCCAGGCCGCTACCCGT
+TCTTGTCGTTGAGATTGTTCAATTTTCTGCGTCATTTTGATTGCCTTATTCTTCGCGGATGCCGGAAAGTTCTGCACGGGAGAGCACCAGACGGGCGCGA
+TCGATAACCGGACCGTCCACCATCTTGCCGTTCAGGGAAACCACGCCGAGGCCTTCGCGAGCGGCGGCTTCAGCGGCTTCTACGACGCGGCGGGCGTGAT
+CCACTTCTTTCTGGGTCGGTGCGTAGAGGTTGTGCAGCAGATCAATCTGACGCGGGTTGATCAGCGATTTGCCGTCAAAGCCCAGCTGTTTGATGTGGGC
+GGCTTCTTGCAGAAATCCGGCTTCGTTGTTAGCGTCGGAATAGACGGTATCGAACGCCTGAATACCCGCAGAGCGCGCGGCCTGCAAAATGGAACAGCGT
+GCGAACAGCAGTTCAGTTCCTTCCGGGAGCGTTCTGTACGCAGGTTGCGCACATAGTCTTCTGCACCGAGGGCGATACCGATCAAACGCTCGGAAGCGTG
+AGCGATTTCCACTGCGCGGGTAATCCCCAGCGGAGATTCAATCGCCGCCAGCAGGCCGGTGCTGCCGGGTTCACGACCACAGGCTTTTTCGATACGCAGG
+ATCTCTTTTCAATATCCAGAACATCCTGAGCGGTATCGGTTTTCGGCAGACGCACAACGTCCGCACCACCGCGAACGACGGCTTCCAGGTCGTTAACACC
+CCATTCGGAATCCAGCGCGTTGACACGCACAATGGTTTCAATATCGCGATACAGCGGATGTTGCAGCGCGTGGTAAACCATGCGGCGGGCGGTGTCTTTT
+CACGCAATGCTACGGAGTCTTCGAGGTCAAACATCAGGGCATCAGCCGGGTAGATGAAGGAGTTGCTGACCATCGCGGCATTGGCACCAGGCACAAACAA
+CATGCTGCGGCGGGTGCGAGTTTTACGTTGTTGCAGCGAAGCGGAAATCATTGGCAATCCTCCCATGGCAGAGCCGGGATACCGCTGGCGCGTGCCAGCA
+GGGCTTCCAGTCGTGCACGTAAAATGCAGTCCAGTGCGCCTTTGTCATCGACATTCAGCTGTACGCCGCGCACGTTGTAGCGGGCGAGAACGTCCAGAAT
+GGTGGTGCGAATTGCATCGCCAAACTGTTTCTCAACGCTGCTATTGATTTGCAGGTCGATATCCTGCGTATCGAGTGGGGCGATGCGTATCATCACATCC
+CCAGACTCAAGGGTGCCTGCAACGGCGGGCTGGTTTATTTTCATTTTTCACCTGTTTCTCATGCGGGGTCTTTTGACGAGCTGCCGCGTCCTGGCGGGAG
+TGCTCAAGCAGGTTCTGCAAATAATGCAGCGTGACTGCAGGGACCAGCGGCGCGATAGCCGTGAGATCGTTTTTCGCCAGCAGTTGACGTACCCGGGAAG
+CGGATATCGGCATCTCCTGGTAACGCAGCCGCTCAATTTCAACCAGTTCGATGGGCGGTGCGGAGATAGTCGGCGTTTCCAGCCAGTAGCGCATATCCTG
+GTTGTACTGGGCGGTAACGCGACAAAGGGTTCAGTACCGACAAAGCGGTGAGTTACACCCAGCGCGGGAGCGAGGTACTGACGGAAAATCTTCAGATCAA
+TTTCGGTGTAACAATGGTTAATGACGCTCTGTTCTTTAATGAAGTAGCAAGGAACGTAGCGCGGGAGATGATGTATTCGGAGCCACGATGCACAGTCAGG
+CGTGGAATATCGGCGGTGCCTTTTAACACCAAATCCAGCCGGTCTTCATAGGGGAAGCGTGAAGAATCTTCTTTGACTAAAACAGATGCAACCAGTCGCA
+CTGTGCCGCAGCCTGTTGAATCAGATAACGGTGACCATTCGTAAAGGGATTGGCGTTCATCACAATGCAGCCAATCTTGTTCCCTGGATGACGAAATTTT
+TCAGCGATTCGGCATAGCGTTTCAGTCGCGTGGCGCTGTTTTCCATCAGCACCATCACGCCGGGTACGCTGGTCAGCGTGGAAAAACCGCACTGGCGGAA
+CAGCGCCTCGTATTCGGTTTTGGTATAAATAAACAGATGCGTGCTGTGCCGCTCATAGGCGAGGTTTATCAATTCAGTGGCTAATGTCAGCGCCAGTCCT
+TCACCGCGGACGGATTCACTGATAGCAACGCATTTAATAATATTTCCGGCAATTCCACCGCACGCGATAAGCTTTTCATCGCGGGTTACGGTAATAAATA
+CTTCGACTGTGGTGTCAACGCTCAAATCATTTTCATGCAGGAATTGGGCGATTTCCGCCATTTTTATTTTCTGAACGTTTTACGCGGGTGAAAATATCAT
+TGCCGAACATAATAAATAGTATCCTGAAGGTGCATGTTGTTATCGATTTGCAACGAATGTTGTTCAATGTTGCAAACTGATAACCTTTATTTTCACTTGG
+GAGAAAGGGGTGATCGAGGTATATCTTTTTCTCCTTTCGCTATACATCCTAAGGAGTATTTCGGCGTGAAATTTTGATTTATTTCACATAGAGTTAGTGG
+TTTTTATTTATTTAATGATTTTAAGTTTTTAATTAATGTAATTACGAAATGACTCGCAGGTTTAAGTGATTTAATTGATTTAATGAATAAAATTTGCCAC
+GATCATAATTAATATCTATGTATTTTGATTCAACATTTTAATTACATCCGTCAAAGAGGCTCGGGACAACCCGCAAGGAAAACAATGTTGCAGCTTAACG
+AGAATAAACAGTTTGCATTTTTCCAAAGACTGGCATTTCCGCTGCGTATCTTTTGCTGATTCTGGTGTTCTCAATATTTGTCATTGCAGCCCTGGCGCAA
+TATTTTACGGCCAGTTTTGAGGACTATTTAACGCTTCATGTACGCGACATGGCAATGAATCAGGCGAAAATTATTGCCTCCAATGACAGTGTCATCTCTG
+CGGTGAAAACGCGTGACTACAAACGGCTGGCGACCATCGCTAACAAATTACAAAGAGATACCGATTTTGATTATGTGGTGATTGGGGACCGGCACTCGAT
+CCGCCTTTACCATCCTAATCCGGAGAAAATTGGTTATCCTATGCAGTTCACCAAACAGGGCGCGCTGGAGAAAGGGAGAGCTACTTCATTACCGGGAAAG
+GGTCAATGGGGATGGCGATGCGCGCCAAAACGCCAATCTTTGATGACGATGGAAAAGTCATCGGCGTGGTGTCGATTGGCTACCTGGTGAGTAAAATCGA
+TAGCTGGCGGGCTGAGTTTTATTACCGATGGCAGGTGTGTTTGTCGTGCTGTTAGGGATTCTGATGTTGCTGTCGTGGTTCCTGGCCGCGCATATCCGTC
+GGCAGATGATGGGCATGGAGCCAAAGCAAATCGCACGCGTGGTCCGTCAGCAAGAGGCGCTGTTTAGTTCGGTTTATGAAGGGCTGATTGCGGTGGATCC
+GCATGGTTACATTACCGCCATCAATCGTAACGCAAGAAAGATGCTGGGGCTGAGTTCCCCGGACGGCAATGGTTGGGTAAACCCATTGTTGAAGTGGTCA
+GGCCCGCCGATTTCTTTACCGAACAGATTGATGAAAAACGTCAGGATGTGGTGGCGAACTTTAACGGTCTGAGCGTTATTGCCAACCGGGAAGCTATTCG
+TTCAGGTGATGATTTGCTGGGGCCATTATCAGCTTTCGTAGTAAAGACGAAATTTCCACCCTCAATGCGCAACTGACGCAAATAAAACAATACGTTGAGA
+GCCTTCGTACATTGCGACACGAGCATCTCAATTGGATGTCGACGCTCAATGGTCTGTTGCAGATGAAAGAGTATGATCGCGTGCTGGCGATGGTGCAGGG
+GAGTCTCAGGCCCAGCAACAGCTTATTGACAGCCTGCGCGAGGCGTTTGCCGATCGCCAGGTGGCGGGGCTGCTTTTGGTAAAGTGCAGCGCGCCGGGAA
+CTGGGGCTAAAATGATCATTGTCCCCGGTAGCCAGCTTTCGCAACTGCCGCCAGGACTGGATAGCACCGAGTTTGCAGCCATTGTGGGCAATTTACTTGA
+TAACGCCTTCGAAGCCAGCCTGCGTAGCGATGAAGGAAACAAGATCGTTGAATTATTCCTCAGCGATGAAGGCGATGATGTGGTGATTGAAGTCGCCGAT
+CAGGGCTGCGGCGTTCCAGAGTCTCTACGAGACAAAATATTTGAGCAGGGGTCAGTACGCGTGCTGACGAGCCCGGTGAACATGGCATTGGGTTGTACTT
+GATTGCCAGCTACGTAACGCGCTGCGGTGGTGTTATCACTCTCGAAGATAATGATCCCTGCGGTACCTTATTTTCAATCTATATTCCGAAAGTGAAACCT
+AATGACAGCTCCATTAACCCTATTGATCGTTGAGGACGAAACGCCGCTGGCAGAGATGCATGCGGAATATATTCGTCACATTCCCGGATTCAGTCAGATA
+TTACTGGCGGGAAATCTGGCGCAGGCCCGAATGATGATCGAGCGTTTTAAGCCGGGGCTAATCTTGCTCGATAACTATCTTCCTGACGGTAGAGGGATTA
+ATTTACTGCATGAACTGGTGCAGGCGCATTATCCCGGCGACGTGGTGTTTACCACTGCAGCCAGCGATATGGAAACGGTGTCTGAAGCCGTACGTTGTGG
+TGTATTTGATTATCTCATTAAGCCCATTGCCTATGAACGGCTGGGGCAAACGCTAACCCGTTTCCGCCAGCGTAAACATATGCTGGAAAGTATTGATAGC
+GCCAGCCAGAAGCAAATTGATGAGATGTTTAATGCTTATGCTCGCGGTGAACCTAAGGACGAGCTACCGACCGGCATTGACCCCTTGACGCTAAACGCGG
+TGCGAAAACTGTTTAAAGAGCCTGGTGTGCAACATACGGCAGAAACGGTGGCGCAGGCACTGACCATCAGCCGCACCACTGCCAGGCGTTATCTTGAATA
+TTGCGCCAGCCGCCATCTGATTATTGCTGAAATTGTTCACGGCAAAGTTGGCAGACCACAACGCATATACCACAGTGGGTGACATGATAAAGCCGGAGGA
+AACTTGCCTCCGGCATTACTATTTACTTGCCTGTGACCGCTGCTGCCGTTCCTGGCACCATCAGCTCTGTAGCAACGATAACAATCACCAAACCAACAAG
+CACCGGTACCGAGGTGCGTTTTACGACTTCAAACGGCGAGATCTTCGCCATCCCGGCAACCGCAACGACTACGCCAGAAACGGGCGAAAGGGTACGGCCA
+AGGTTTGACGCCTGCAGCATCGGGATAGTCAAATACGCCGGGTTAATGCCGGAAGAGTGCGCCAGTTTCGGGATCATCTCAACAAACGCATAAAACGGCG
+CATTGCCTGAACCGGTCGTGACTGCCGCCAGCATTGTCAGAATCACCAATACCAGCATCAGGATGATACTCGCCGAACCAAACGAGGTAGCGATAGAAAT
+CAGACTTTGAATAAAGCCGATGGTGCTAAGCCCTGAGCGAATACCCCAGCGGCAACCAGCAGCATCACCACGTTAGCAAACGCATCTGCCATCCCGCGAT
+AAGCCACTTCCAGACCAGAGAAAACTTTCTGGGTATTAAAGCTGCGGAGGAACTCCAGAATGGAGGCAATCAGCATACAAATCACCAGAATAGTGATGAT
+GTGTAATTGCGGACCCCATTTACCGTCAAAATCAGTACACCGATGATCGGCGTGAACGGCAAAATGGCATAAAACGCAGGAGCAGTGGTGGTGATTTCAC
+TGACATCTAACATTTCATGAGAGATGTGCTCTTTTTATCCAGATAACGTTGCCAGAAGAAGTGGGCGATCGCCATGCCGATAATTGCAGCAATTGAGATA
+GGCAGCGTCGTTTTGAAGGCGAAGTCAATCAGCGACATTTCGGAAGCTTGCGCCGCCAGCACCACATCCCCTGAAGTCGGTGCGAGAATAATCGCCGCCG
+GGGAGGCACAAATGGCAGCAGCTGCGCCACGACTGATACCAACGTTTACCATCACCGGAAATAGGGTTGCCATCAGCAAAACACCCAGACCGGTTGCGGA
+AGAGACGGCCAGAGACATCAGACAGGCGACAAAATAGGCGGCAATCATCAGCAGGTAAGGGAGTTAATATACTGCAATGGTTTTGACGCCAGCTTGACCA
+CCATATCATTCGCGCCGATATGGGTCATGTAAGCGGCAAATCCACACAGCATCATAATCATCATGCCGAGGTCGCCGCCGCGGCTCATTAGTAATATTTT
+AACGTATTCAACGATATCCGTGGCGCTGTAGCCTGTTGAAGCCTGGCTGGACGGTAACACTTTGTGCCCCATAATGGCACTGATAATCAGCAATAACAGG
+CCACCGACAAATAACACACCAGTGGCGGAATACCCTTTAATGATGTAGCGAGCTACACCCACAATAACCACAACCCCAATAAGGAGCTCAATGAATGTCA
+GCATAATTTTTCCTGTCTCCAGGCCCCAAAGTAAATAATAAAAATTCCTAAAGCTTAAGGAAAAATATGCCCAATAAATTGGCGATGAATGCTGATTAAA
+ATCAAGAAAAACTGCCATTAAGACATTGAAGTTGCTGTTTTATACATAGATAACAAAACGCATATTTAGCGGTTGGCAATTATCACATAATAATGTGTGC
+AAATTGATGGTGGATTGATGCAAATTTGTTAATTGCAATGGTGTTAGCTGCGGCTGTGCGCTCAAAAATAATCTAATATGAGCATAGGTTGACGATATAT
+ATTATATACTTCGTTAAGATGATTGTTGTATCTCGTTAAAAATAAAATAATTTTTCCTTGATTGCATTTTGTCATCAAAAAGACTTGGTTTTTCTTTTTG
+ACTATTCCCATCGCAGAAAACGACGCATCATCTTTAATCGATGCGCGGAAATATTTAACTTGAACAAGCGGAAATAAATAGAGCAGCTATTCAGATTATT
+CTTTATGTTGGGTCTATTAAGGTTATGTTAATTGTAGCTTTGCTATGCTAGTAGTAGATTTTTGATAAATGTTTTATGGTCACAAATGAACGTGAGTAAA
+TATGTCGCTATCTTTTCCTTTGTTTTTATTCAGTTAATCAGCGTTGGTAAAGTTTTTGCTAACGCAGATGAGTGGATGACAACGTTTAGAGAAAATATTG
+CACAAACCTGGCAACAGCCTGAACATTATGATTTATATATTCCTGCCATCACCTGGCATGCACGTTTCGCTTACGACAAAGAAAAACCGATCGCTATAAC
+GAGCGACCGTGGGGTGGCGGTTTTGGCCTGTCGCGTTGGGATGAAAAGGAAACTGGCATGGCCTGTATGCCATGGCATTTAAGGACTCGTGGAACAAATG
+GGAACCGATTGCCGGATACGGATGGGAAAGTACCTGGCGACCGCTGGCGGATGAAAATTTTCATTTAGGTCTGGGATTCACCGCTGGCGTAACGGCACGC
+GATAACTGGAATTACATCCCTCTCGGTTCTACTGCCATTGGCCTCCGTGGGTTATGGCCCAGTGACTTTTCAGATGACCTACATTCCGGGTACCTACAAC
+AATGGCAATGTGTACTTTGCCTGGATGCGCTTTCAGTTTTGAGACAAATGAAGTTTTAGTAACTTCTTTAAAATCAATAGCTAAAATAAGTAACATCAAA
+AATAACGCGACTTTTATCACTTTTAGTAGTAAAGTTACACTGGACAAAGCGTACCACAATTGGTGTACTGGTAACCGACACAGCATTTGTGTCTATTTTT
+CATGTAAAGGTAATTTTGATGTCTAAGATTAAAGGTAACGTTAAGTGGTTTAATGAGTCCAAAGGATTCGGTTTCATTACTCCGGAAGACGGCAGCAAAG
+ACGTGTTCGTACACTTCTCTGCAATCCAGACTAATGGTTTTAAAACTCTTGCTGAAGGTCAGCGCGTAGAGTTCGAAATCACTAACGGTGCCAAAGGCCC
+TTCTGCTGCAAACGTAATCGCTCTGTAAGATACGTCAGCAAGAATTCAAAACCCGCTTAATCAGCGGGTTTTTTGTCTTTAGTGTGCGGTTGAGGCCGAA
+AACAGCCAGAATGCCAGTGCGGTCATGGCAAAGACCCCAGAAGGTTGACGAAAACGTTCAGTAATGCCCAGCCAAAGCGGCCCTCTTGTAACAAAACACC
+ACTTCTGCCGAAAATGTTGAGAAGGTTGTTAGACCGCCACAAAATCCGGTGGTGATTAATACTTTCCACACTGGATCAATGTTCGTCATCCTGCTGAACC
+ATGCGAATCCTATTCCTATGATGAATGCCCCAATCAGGTTTGCTGTCAGCGTCCCCAACGGAATCGCCTGATGCAGTGGGTTAAATCGCATACTTAACAG
+CCATCTCGCCACGCTTCCCGTACCACCGCCAATAAAACTGCTAAAAGAAGTTGTAACACTGCAAAATCCTGCTATTTGATTTGTATGAGTGATAAGTGTA
+ACGCCGAATAATCGTCGTTGGCGAATTTTACGACTCTGACAGGAGGTGGCAATGCTGGTTGCCGCAGGACAGTTTGCTGTTACATCTGTGTGGGAAAAGA
+ACGCTGAGATTTGTGCCTCGTTGATGGCGCAGGCGGCGGAAAACGACGCATCGCTGTTTGCCCTGCCGGAAGCATTGCTGGCGCGCGATGATCATGATGC
+AGATCTATCGGTTAAATCAGCACAGCTGCTGGAAGGCGAATTCCTCGGACTTTACGGCGAGAAAGTAAACGTAACATGATGACGACAATTCTGACGATTC
+ATGTTCCTTCAACGCCGGGGCGCGCATGGAATATGCTGGTGGCACTTCAGGCAGGAAACATCGTCGCCCGTTATGCCAAACTGCATCTCTATGATGCATT
+TGCCATTCAGGAATCACGCCGTGTTGATGCTGGTAATGAAATCGCTCCGTTACTGGAGGTGGAAGGGATGAAGGTCGGTCTGATGACCTGTTATGACTTA
+CGCTTTCCAGAGCTGGCGCTGGCACAGGCATTACAGGAGCTGAAATCCTGGTACTTCCTGCCGCCTGGGTTCGCGGGCCGCTCAAAGAGCATCACTGGTC
+AACGTTGCTTGCCGCTCGTGCGCTGGATACCACCTGTTATATGGTGGCGGCGGGGAGTGCGGGAACAAAAATATCGGTCAAAGCCGGATTATAGATCCCT
+TTGGCGTCACCATTGCGGCAGCGTCAGAAATGCCTGCACTCATTATGGCGGAAGTGACGCCCGAACGTGTGCGTCAGGTGCGCGCGCAACTGCCCGTCTT
+AAACAACCGTCGCTTTGCGCCGCCGCAATTATTATGATGTTTTTACTCGGCGCTTGATTCACCTTGTTACAGATTGCTATTGTGTGCGCGCGTCGAATGA
+CCGTTAATATTCTCTGGTTTTAAGGCGCGTTCTGTTGCCGGTTATATGTCAAGAAGGTATCTATGGGTGAGATTAGTATTACCAAACTGCTGGTAGTTGC
+GGCGCTGGTCGTTCTGCTGTTTGGGACTAAGAAGTTACGTACGCTGGGCGGAGACCTTGGAGCGGCCATTAAAGGGTTCAAGAAGGCGATGAATGATGAC
+GATGCTGCGGCGAAAAAGGCGCAGACGTTGATCTTCAGGCTGAAAAGCTCTCTCATAAAGAGTGACGTGGCGAGCAGGACGCTCCTCAATATCTTGTTCG
+ATACAAAACCCGCTTCAAAAGCGGGTTTTATCAGACAGATGTAAGTAATTATTACAGGATTACTTAACTTCCATCCCTTTCGCCTGCAAATCGGCGTGGT
+AAGAAGAGCGGACAAACGGACCGCATGCAGCATGGGTAAAGCCCATCGCCAGCGCTTCGGCTTTCATTTCGTCGAACTCATCCGGGCTAACGTAACGTTG
+AACCGGCAGGTGATGGCGGCTTGGCTGCAAATATTGCCCCAGCGTTAACATCGTCACACCATGACGGCGCAGGTCGCGCATTACCTCAATAATTTCTTCA
+TTGGTTTCACCCAGTCCCACCATCAGACCAGACTTGGTCGGGATTTCCGGATGCGCTTCTTTAAAGCGTTCCAGCAGCTTCAGCGACCAGTTGTAATCTG
+CACCAGGCCGTACCTGACGGTAAATACGCGGTACGTTTTCCAGGTTATGGTTGAACACATCTGGTGGCGTTGCAGTCAGAATATCCAGAGCACGATCCAT
+ACGACCGCGGAAATCCGGCACCAGAGTTTCAATTTTGATTTGCGGGCTTTTTCCCGAATGGCAGTAATGCAATCCGCAAAGTGCTGGGCACCGCCATCGC
+GCAGGTCATCACGGTCAACGGAGGTGATAACCACATAACGCAGCGCCATATCGGCAATGGTCTGCGCCAGTTTCACTGGTTCATTGGCATCAGGAGCTAC
+CGGGCGACCGTGGGCAACATCACAGAACGGACAACGGCGGGTACAAATAGCGCCGAGGATCATAAACGTTGCTGTGCCGTGGTTGAAGCATTCCGCCAGG
+TTAGGGCAGGAGGCTTCCTCGCAGACAGAATGCAGGCCATTTTGCGCATTGCGGCTTTGATGCCCTGGATACGTGTAGAGTCCGCTGGAAGCTTGATTTT
+CATCCATTCCGGCTTGCGCAGCAGGGCTTCGCGCTCTGTTGCCACGTTTTTAACCGGGATAAGGGCCATCTTATCGGCATCGCGGTATTTAACACCGCGT
+TCCATCACAATGGGTTTACTCATAGCGTGCGTGTTCCAGTTGCGAATTACGAAGGAAAGCGTTTCAATTCAATAGATTGTTGTAATTATCAACTATTTTT
+GAATTAACGACTGGCAGTATATCATTGAAACGGACCTGAAAGCAGCCAAAGCGGTCGCGAAAATGTAAAATTGTTGTTGGATTGTGCCATTTTATCGTTC
+TGCGCTGTGATCTGGCTGTAACAATACTTTTCAAAATGCATTACGGATAACATCTATTACTCCGTGCAGGATGGGATCACGCAGGCTGAATTTGTTGTAG
+TGGATAGAGAAATCTATTTGCTCCTCATTTAAGGACGGAAAAGGCAGTTTTCCAGCGGCCAGCAGCGGCTAAACAGGTTATAAAACGGCTGGGAATAATC
+GCTAACATGTCACTGTTGGCAACCAGTGCAGCGATTGTCAAAATGTTGTAGCTGGTGAAATTGATTTGCCGGTCCGGAAACATTTCTTGAACTCTCTGCC
+GCAGACCGCTGAAATTTTGCTCTTCCGGTAACAGAAGTACATGCGCAGCGTTGTCGATAGTCTCTCTGTCATCTTCTAAAGAGAGTAGTGGATTTCCTCG
+CGGCAAATTAACACCATATTGTCGGTGAACAGAACATGATGTTGCACCGTACGATTGGTGCAAAACATGTTATCGATGATGAGATCGGTTTGAAACTGAC
+TGAGTTGGTTTTCCGCGTCGCTGATGGGCGGGTTGCGCAGTAAAAGCTGCGGATAGTGAGTTTTAATCGCCCGATAGATGACAGGAAGGACCAGTGCTCC
+GACCGAGGGAGTGGTCGCAATAGTTATCGTTCGTTGCTTATCATAGCTTCCTTCGATATCCAGCGCGCCAAGAATGGACTCAAGGCCCTGACTGATATAC
+TCATGTAGATGCATCGCAAATGCGGTAGGAGTGACACCCTGGCCTTTGCGAATAAACAATGGGTCAGGGAATATAACGCGCAGTTTCTGAATAGACTGAC
+TGATTGCCGAGGGGTCAGATTAAGCACTTTCGCTGCATTAACGATCCCTTTATGTACATATACAGCTTCAAAAATAGTCAGAAGGTTAAGATCAATATTT
+CGTAAGGTTGTAAATATTTGTGGTTTACCTTCTGACGACTTTCTGCTTAAACAGGGTTCAATTTGATTATTACTATCCACGCACTTACTCCAATTTTATT
+CATGGAAAAATAATATTTAAAAATTACAATAATCTTATGTCTAATTGGAACGGAACGCTTTTGCTCACCATAATCAACTATTTCAATAGGTTAATCAATG
+GGGTGAGTTACGGAGCAAGGCGTGGCACCGCATTTCTGCAAGTGATAAAGAAAATATACAAACGCGAAGGAGATGTAAAGCATTAGCAGATATTATGAGT
+AATGACCCAGTGTAAATTGGGCCATTGATGTATGGAATTAAGCGGTAATATATTCGAAGTCCGGATTGTTTAGTAGCGCTAAAATATTTTCCAGTAAACG
+TGGAGCAATATTATTAGTCGTCGCTTCGGGTTTCCATTGTGATATTTTAGCCATTTCCATTCCGGCATACCCACAAGGATTAATACGTAAAAATGGTGAA
+AGATCCATATTGACGTTTAATGCCAGACCGTGGAATGAACAACCGCGTCGAATACGTAAACCCAGTGAGCAAATTTTCTTTTCCCCAACATAGACACCTG
+GCGCGTCAGCCCGAGGATGCGCTTCTATACCCAGTTCAGCCAGGGTATTCACCACTGTTTGCTCAAGCAAGGTCACCAGTTCACGCACACCGAGTTTACG
+GCGTTTCAGGTTAAGCAACACATACATCACCTGTTGCCCCGGCCCGTGATAAGTCACCTGCCCACCGCGATCGCTCTGGATCACCGGAATATCACCCGGC
+ATTAAAATGTGCTCCGCTTTTCCTGCCTGACCTTGGGTGAATACCGGATAGTGCTCGACCAGCCAGATTTCATCAAGGGTACTATCATCGCGGGTATCGG
+TGAATTCATGCATAGCCTGGGAGATTGGCTCGTAAGGCTGAAGACCGAGCTGGCGGACAAGAATTTTATCCTGATACAAAACGGCATCTCCGTGGAGAAT
+GAGTAAAAGTGGGGAAAAGTATATCACAGCGAGGAGGGGAGTTACCCGACCAGGAGCCGGGTAACGGAGAAGCGAGTTACAGAACCATGCGGACAATATC
+GATTTTGCCCAGTTCTTCATACAGTGTTTCAACCTGCTCGATATGAGTGGCGTTGATAGTGATAGATACCGAGTGGTAGTTGCCTTTGCTGCTTGGTTTT
+ACCGTTGGGGTGTAGTCACCTGGCGCATGGCGCTGTACCACTTCAACCACCTGATCAACCAGCTCAGGTAACGCCTGCCCCATAACTTTGTAAGTAAAAG
+GAGTAGGGAATTCAAGCAGTTCGTTAAGTTTGGTTTTCATGTCAGCTCCGGCGTAACGTAATTAAATAGCAACTCCGCCAGAAGGCGGGAGTTTTTACTG
+ATGCTTAGTATATGGGGACGGAAATTACACTTTCAAGTGTTTAATTTTAACCAAACCAGTGATGGAACATTAATTTAATGTAATCAATGATTTTGCCGAA
+GAAGTTACCTTCCGGGATTTCTTGCAACACAACCAGCGGGCGTTGCTCGATCGTTTTGCCATCAAGCTGGAAGTTGATAGTTCCGACGACCTGATTCTTT
+TGCAGCGGCGCATGCAATTCACTGCTGTTCAGCACATAGCTGGCTTTCAGATCTTTCATGCGACCACGCGGAATGGTCAGGTACACGTCTTTATCAACCC
+CTAACGAAGCGCGATCAGAATCACCAAACCAAACCGGTTCAGAGGCGAACTCTTTACCTACTTTCAGTGGGTTAACGGTTTCAAAGAAACGGAAGCCCCA
+GGTTAGCAGTTTTTACTTTCGGCTTCACGGCCTTTAAAAGTACGTCCGCCCATTACCGCAGAAATCAAGCGCATCTGGCCTTCAGTCGCAGAAGCAACAA
+GGTTGTAACCTGCTTTGTCAGTGTGTCCGGTTTTGATGCCGTCGACATTCAGGCTGTTATCCCATAACAGGCCGTTACGGTTCAGCTGGCGAATACCGTT
+AAACGTAAATTCTTTTCTTTATAGATCGAGTATTCATTCGGTACGTCACGGATCAATGCCTGGCCGATCAGCGCCATATCTCGCGCGGAGCTGTACTGAC
+CATCAGCATCCAGACCATGTACCGTCTGGAAGTGGGTATTTTCAGGCCCAGTGCGTTAACGTAGCTGTTCATCAAGCCAACAAAAGCGTCCTGGCTACCA
+GCGGCAAAATCGGCCATGGCGACACAAGCATCGTTACCCGATTGCAGGTTAATACCGCGGATCAGCTGAGAAACCGGAACCTGCATGCCCGGTTTGAGGA
+ACATCAGCGAAGAACCTTTAAACACCGGGTTACCGGTGGCCCATGCGTCGTTGCCGATAGTGACTAAATCAGTTTCTTTAAATTTACCGGCTTTCATTGC
+CTGGCCGATAACGTAACTGGTCATCATTTTGGTCAGGCTGGCAGGATCGCGGCGGACATCTGCGTTCTGTTCGGCGAGCACTTTGCCGGAGTTATAGTCA
+ATCAGGATGTAGGACTCCGCATCGATCTGCGGTACACCCGGGATCATAGTTTTGATATTCAGGTCATCGGCATGTGCAGCAGAGATAAAGGCTGTGCAAA
+GAGCCGTGGTGAGCGCCAGGCGCTTCATGATACGAGCGGAAAAATGGTATTCATGGTCTGAACTACGACATCCGTGATGGAATTAAAAAGTGCCCTACTA
+TAGCAAATGCACTACCGGCAGGCATCTGACTTTCCGCGTGACTTTGTTAACGTCATTTACAGAAATTGACACATCAGATGCCTGCTTTACGCTACTGCGC
+GGTAGTAATAAATGACTGTAATTGGGCTTCGGTTTGCAAACGTTGCTGCAAGGTACTGGCTTCGGCTTTGCTGGCGAATGGGCCAAGCTGGATCCGCCAG
+ACCGCGCCATTTTGAGTTACGCGACCGGGGACGCCGAACTTCTGTCCCAGTTGCTGTTGGTACTGTTGCGCACGAGCCTGATCGCTTACGGCCCCGACTT
+GCACCATAAAGTTGCCGCTGGCGCTTTGCGAGACGGCTTGCGGTGTCACCATTGCAGGCGAGGTTGCAGGCGTTGTCGACGGAGCTGTAACAACGGGCTG
+TGGCGCAGGCGTCGGTTCGCTGCCTTCCAGTACACCAGGCGCTAAGGTCGTTGGTGCGCCGAGGAAACCGCTACTGGTTACCGGCGCGCCGGTCGGATCT
+TCGCTTTTAGCGTCGAATTACTGACCGGAAGAATGTCACCCTGCGGGCCAGACACTGAACTTGTTCCCGCGCCACCGCTTAAATCGGGAGGTGCAGGCAG
+GGCGTAAGTCTGTTTGGCGACTGTGGTACAAGCCATACCAGGACCAGAAAGCGAACCATCCTGGGCAACAATAATCGGATCGATACGAACTTTGGTGTTG
+TTTGACGTGTTAAGACGGTCAGCTGCCGCGCGAGAAAGTGAAATAACGCGGTCGTTGCCGTAAGGGCCGCGATCATTAATGCGCACCACGATCATTCGCC
+CGTTAGCCAGGTTAGTGATTCTGGCGTAGCTGGGGATCGGAAGCGTTGGATGGGCTGCCGTCAGCTGTGTCGGATCGAATGCTTCGCCAGAGGCCGTCAG
+GTTACTGCCGGGTTCGGCATCATAGATTGCCGCCAGTCCCGCCTGGCTAAATCGAGACGGATCCTGCACGATTTTGTAGCTTTTACCGTCGCGCTGGTAA
+TCCTGATTTGCCGTCGCGTTCAGTGGTTCGAAACGCGGGTCCGCCCGCTAATTTCAACTATAGGGCCGTTACATACCGCAGGCTGCGGTACACTTACCGT
+CTGTTGCTGACCATCATCGCTTGTACATGCCGCGAGCATTCCTGCCGCGATGCAGATCCCGAGCCACTGCTTACGCATTGCGCACCTCTTACACGCTTTT
+CGACAACATTTTCCTGTGGGTGTGGATTGACATTACAATCCCGAACCCAGCCATCAGCACAATTAGCGCCGATCCTCCATAACTGACCAGTGGGAGCGGA
+ACCCTACAACCGGCAGAATACCGCTTACCATACCAATATTTACGAAGACATAAACGAATAATATCAGCATTAAGCCGCCAGCCATGACGCGACCAAAGGT
+GGTTTGCGCTCTGGCGGCTATCCACAGCCCGCGCATGATCAGCAGAATGTAGAGAGCGAGCAGAATCAGAATGCCCACTAATCCCAGCTCTTCCGCCAGT
+ACCGCGAAGATAAAGTCAGTATGGCGTTCGGGGAGAAATTCAAGCTGTGACTGAGTGCCGTGCAGCCAGCCTTTGCCGCGTAATCCGCCGGAGCCAATAG
+CAATTTTAGACTGAATAATGTGATAGCCCGCGCCGAGTGGGTCTGATTCCGGTCCAGGAGCATCATTACGCGCTGGCGCTGGTAATCATGCATCAGGAAG
+AACCACAGAATCGGAATGAACGCCGCTACCAGCACTACTGCGACGCCAATCAGACGCCAGCTAAGGCCAGAGAGGAACAGTACAAACAGACCGGAAAGCG
+CAACGAGGATTGATGTTCCCAGGTCAGGCTGTGCAGCCACCAGCAGCGTGGGCATAAATATCAGCACCAGCGCGATGCCAGTGTTCTTCAACGATGGCGG
+GCAAACGTCGCGGTTGATAAAGCGCGCAACCATCAGTGGTACGGCTATTTTGGCAATTTCCGACGGCTGAAAACGAACAATACCGAGGTCCAGCCAGCGT
+TGAGCACCTTTAGAGATGGCACCGAAAGCATCTACCGCCACCAGCAAAATAATACAGATGATATAGAGATAGGGGCCCAGCCTTCATAAACGCGTGGAGG
+AATTTGCGCCATCACCACCATGATGACCAGACCCATCGCGATTTGGCCGATTTTACGCTCCATCATGCCAATATCCTGACCGCTGGCGCTCCAGATAACC
+AGGGCGCTGTAAACCAGCAATGCCAGTAAGATCAGCAGCATTGTGGGATCGAGATGGACTTTATCCCAGAATGTTTTTATTCGGATTATCCGTCATGATT
+AATGGTCCTCCGCTGCGGCAACCGCTGGATTTTCCGCAGGCAGATCGGTGTTGTTATCACCCAGCATAATGTGGTCGAGGATCTGGCGCATCAGTGTACC
+AACCGCCGGACCCGCACCACCGTTCTCCAGAATCATGGCGACAGCCACTTGCGGATTGTTGTATGGCGCAAAGGCGGTCATCAGTTTGTGGTCACGTAAA
+CGCTCGGCAATTTTGTGCGCATTATAGGTTTCGTTCGCTTTCAGACCGAAGACCTGAGCGGTACCGGATTTCGCCGCAATTTTGTACGGTGCGCTAGCAA
+AGTATTTATGCGCCGTACCGTTAGGGCGGTTAGCAACACCGTACATACCGTCTTTCGCCAGCTCCCAGTAACCGGAATGAATATCGCCGACGGGCGGTTC
+ATGCGGCTGTACCCATGGCACCTGTTTGCCGTCTTCGGCGGTGCTCATCAGCAAATGAGGAACCTTCACGATACCGTCATTAATCAGGATCATCAGTGCC
+TTACTCATCTGGATTGGGGTCGCTGTCCAGTAACCCTGACCGATACCAACCGGAATGGTGTCACCCTGATACCACGGTTTTTAAAGCGTTTCTGTTTCCA
+TTCGCGGGTAGGCATGTTGCCGGAACGTTCTTCCGCCAGGTCGATACCGGTGTAATGACCATAACCGAATTTACCCATCCATTCGGAGAGGCGATCGATC
+CCCATATCGTAGGCCACCTGATAGAAGAAGGTATCCGCAGATTCTTCCAGCGATCTTGTGACATTCAGACGCCCGTGGCCCCATTTTTCCAGTCACGATA
+ACGTTTTTCCGAACCTGGCAGTTGCCACCAGCCTGGGTCAAACAGCGTCGTATTGCGCGTGATCACCCCGGCGCTCAATGCCGAAACCGCCACATAGGGT
+TTAACTGTAGACGCGGGAGGATAAACCCCTGTGTGGCGCGGTTCACCAGCGGTGTATTCGGATCGTTCAACAAGGCGGAATAATCTTTGCTGGAGATACC
+GTCAACAAACAAGTTTGGGTCATAACTAGGCGTGGAAACCAGCGCCAGCACCCCACCTGTACGCGGATCGGTGACTACCACAGCTGCGCGGCTACCCGCC
+AGCAGCGTTTCAATATATTGCTGGAGTTTGAGATCCAGCGTCAGGTAAATATCGTGTCCGGCTTGCGGTGGTACTTCTTTTAACTGGCGAATAACACGCC
+CACGGTTGTTAACTTCAACCTCTTCATAACCGGTCTGACCGTGCAGCACATCTTCATAGTAACGCTCAATGCCCAGCTTACCGATATCATGCGTTGCCGC
+ATAGTTGGCCAGTTTGCCGTCATTATTCAGGCGTTCGACGTCTTTATCGTTGATTTTCGACACATAGCCGATGACGTGGGTCAACGCCGAACCGTAAGGA
+TAGTAACGACGTTTATAGCCTTTAACTTCGACACCCGGAAAACGGTACTGATTGACGGCAAAGCGAGCTACTTGTACTTCGGTCAGGTTAGTTTTCACCG
+GAATAGAGGTGAAACGGTGTGAACGTGCGCGCTCTTTTCGGAATGCAGCAATATCGTCATCGGTCAGATCTACCACGCTGCGCAAAGCGTCCAGCGTTTG
+CTGCACGTTATCGACTTTCTCCGGCATCATTTCTATCTGGTAGATAGTGCGGTTGAGGGCCAGAGGGATACCGTTACGATCGTAGATAATGCCGCGGCTG
+GGCGCGATAGGCACCAGCTTAATGCGGTTTTCATTAGAGCGGGTCTGGTAGTCGGTAAAGCGAACAATTTGCAGATTATACAGGTTGGCGATAAGCACGC
+CGGTCAGCAGCAAAATCCCCAAAAGGCGACCAGCGCCCGGCGCACAAACAGCGCGGACTCTGCCGTATAGTCGCGAAAAGAGTTCTGTAGTTTCATCCGC
+TGCGTTTTCTACTCAAAGCTCCCTTATCACTCACGGTGATAAGGATGGTTGGTGGTGATGCTCCACGCCCGGTACAGACTCTCTGCGACCAGCACGCGAA
+CCAGCGGATGGGGAGGGTAAGCGCCGACAGCGACCAGCTCTGCTCAGCCGCCGCTTTACAGGCAGGCGACAACCCTTCAGGCCCGCCAATCAGTAGACTG
+ACGTCGCGACCATCCAGCTTCCAGCGTTCCAGCTCAGCGGCTAACTGCGGCGTATCCCAGGGCTTGCCTGGAATATCGAGGGTGACAATGCGGTTTTGCC
+TGCGGCCGCCAACATCTGCTCACCCTCTTTGTCGAGTATGCGCTTGATGTCCGCATTCTTGCCGCGTTTTCCGGCCGGAATTTCAATCAGCTCGAAGGGC
+ATATCTTTCGGAAAACGACGCAGGTACTCGGTAAAACCGGTTTGTACCCAGTCCGGCATTTTCGTTCCCACGGCGACAAGTTGCAGCTTCACGCATTAAC
+TCCAGAGTTTTTCCAGTTCATACAGGCGACGGCTCTCTTCCTGCATGACATGGACAATCACATCGCCCAAATCCACGACAATCCAGTCGGCGCTGTTTTC
+ACCTTCTACGCCGAGCGGTAACAGGCCCGCTGCGCGAGACTCCTGCACAACGTGGTCAGCAATGGACATAACATGACGGCTGGACGTACCCGTACAGATG
+ATCATGCAGTCGGTGATGCTGGATTTGCCCTGAACGTCTAAGGCGATGATGTCCTGACCTTTGAGGTCATCAATTTTGTCGATAACAAAATCCTGGAGTG
+CTTTACCCTGCAAGTTTTCCCCTGGGTGAATCAAATAGATAAAATGGTCTGTCAGTATACCTGAACCAGAGGCGATTTCGGGACAATTGTCGCCGAATCG
+GCTTTCGAAAGTGGGCTATCATCCCACCCCGCGCCGCAGATTGCATCGCCATTTTGTAAAACAATTTCTACAAAGTCGTGTCTGGCGGAAAAAGTCTGGC
+TGCGGAGAATATCAGCCTGCCCGGGTCTGTCAATGGTCGTTGCGGCTTACCCGTAAAAACAGAAAAGTCATGCATTCTCGACCCCGATGGCACGGCTATT
+GAGGACGCGTAGCGTCGCGAATTTTGGTTGATATCAATGGCGCTCCAACACCCTGGTCAACGCGAAAATGCCACATAGCTTCGGCAGGCATGCCAATTAA
+ACGGGCGATTAACAGACTCAGTACACCCTGATGGCTGACGACTAAAATATTCTGATAGTGCTGAAATTCACTAAGCCTTGCGATAAAGCGTTCCACACGT
+TGCGAAAATGCCTGAAATCCTTCACCGTTCGTGGGGATTGCATGCTGCCAGTCATTGCACCACGCGCTATAGTTTTCGGCATCTTCTTGCATGAGGTCGC
+GATGATGTCGCATCTCCCAGTCGCCAAAACATTTCGTTGAGTTCAGGTATGATTTGCACGGGGAGCTGGCGGTCACTGAGAACCAGTCGCGCGGTATGCT
+GTGCCCGTTCCAGTTCACTGCATAAAACCAGATCAAAGGAAACACCATGTAGCAGCGTATGCAGATTTTGCGCTTGCTCAATACCGCGCGCGGTCAGGGG
+TGGGCGCATGACCGCTGTAAAGACCATCGATATTCGCTTGCGTTTCACCATGACGAATTAACCACAGTCGCATCATGCCCTCCGTAACGACAGGTATCAG
+CGATACAAGCCTTGTTGGTTAATGTAAGTCAGTACCGGTTCCGGCAATAAATCCTCACATGATTCACCGTTTTGCAAACGTTCGCGGATGATGGTCGCCG
+AGATGTTAAACCACGGCGTTTCAGCCAGATAAATTTTACCGGCAGGCTGAAGGTGAAGATCTTCCGGGTTATGTGTCAAATGATCTTCCAGCCATTGCTG
+GTATTGCGGTTGCGCCATTTCAAGTGGGTAACCTGGACGCCGACAGACGATCAAATGTGCATTGTCGAGTATCGTTTCGTATTCGTACCAGGTCGGAAAG
+GTCAGCAGTGAATCCTGACCAATAATAAACGCCAGCGGCACGTCCGGTCCTTGTTCCTGCCGCCACTCTTTCAGTGTTTGCGCAGTGTAAGAGGGGCATT
+GCGCTTTAGCTCGCGTTCATCAAGAGTAAATAATGGCTTGTCGGCAATCGCCAGTTCAAGCATGTGTTTACGCTGCACGCTGTTCGCTTCCGGCTGGGGA
+CGATGCGGAGGAACATTATTAGGGATGATTGTGACCCGCGTCAGACCAATCAAATTCGCCAGCGTTTCCACGGGTTTTAGATGACCATAGTGCACCGGAT
+CAAAGGTGCCGCCAAACAGAGCCTGTAAAGATTTCATATCAACCGTCGATAAATACGTCCGCCAGGGGTTTATGGCACAACAGAAGAGATAACCCTTCCA
+GCTCTGCCCACACTGACTGACCGTAATCTTGTTTGAGGGTGAGTTCCGTTCGTGTCAGGAGTTGCACGGCCTGACGTAACTGCGTCTGACTTAAGCGATT
+TAACGCCTCGCCCATCATGCCCCGGCGGTTCTGCCATACCCGATGCTTATCAAACAACGCACGCAGTGGCGTATGGGCAGACTGGCGTTTCAGGTTAACC
+AGTAACAACAGTTCACGTTGTAATGTGCGCAACAAAATAACCGGTTCGCTGCCTTCCAGACGCAGTTGCTGAAGAATATGCAATGCGCGCTTACTTTTTC
+CCATCAACAAAGCATCAACCCAATGAAAGGGGTGAAATGCGCGGCATCATTCACCGCCTGTTCAACGCGCGGTAATGTCAATTTGCCGTCTGGCCAGAGC
+AGCGATAAACGCTCCAGTGCCTGAGCCAGCGCCAGCAGGTTACCTTCATAACAGTAGCAGAGCACCTGATTTGCCGCGTCATCCAGTTCTAAGTTGAGCT
+GTTTTGCGCGCGCAGCAACCCAGCGGGGAAGCTGAGCCTGCTCCGGTGTCTGACAGGTCACCTGCACGCTGCGATTCGCAAGCGCAGTAAACCAGGCGGC
+ATTTTCTTGCGCTTTGCTTAATTTATTACCGCGGACGATCAACAGCAGGTCGTCATGCAGAAGTCCGGTGAGTGTGAGAAGTTGCTCATTGATCGCCGCA
+TTCGGTCCGTTTTCTGGTAACAACAGCAATAGCGTTTGTCGACTGGCAAACAGACTCATAGCCTGGCATAACGAAAGATCGCATTCCAGTCAGTGTTGGG
+ATCAATGGAAAAGTGTGGTGTTCTTCGAATCCTTGTGCCGCAGCTACCTGACGAACAGCGTCCTGGCTTTCCTGCAATAACAGAGGATCGTTACCAAGTA
+AAGATACGCCGCGCGCAGCCCTTCATTGAGCTGCGCGCGGAGTTGTTCCGGGTACAACCGAATCATCAGTTACCCAGCGTGGTGGAGACGCGTGCAGGCG
+TTGCCGGAGTATCCGTTGTGGTCGACGTCTGTTCTTCGTCGGAACGAATATCCGCAGCACGGATGCTTGGCAGCTTACGAATCAGCTGTTCGGCAGCACG
+GTCGTACATCTCTTTACGATCATGTCTTGTTCGTTATCTTTCGCTAACGCCATTTGCGGGTTATCGAAGAACGAACGGAAGACTTTGGCGCTAATCGGGT
+AGATATCACGGCCGGGGATCAACACGGTCGCATTAACCGTCATGATCATCTGATACTCTGCTGTTTGACCGTTACGGAATACCGATGCGGTATCTTTCGC
+GATGCTCACTTTACCCAAACGCAAGGATGGAACGTCCTTACGCGTGGTTTCTTTATCAAGCAACTCGACACCATTCAGACGTAACTGGTTACGCACCGCA
+CGGCTTAATGGCCCGTTCGGATCGCCTGAGTCCAGGATCATGACCTTCATAGTGGAAGGAACCTGCGTGGTATCACGCAGATGCCAGCCACACCCGGCGG
+TGATTAACACCGCCAGAGATAACAACAATGTTGCCAGATATCGCACGCTTCCTCCCGCGCTTAGCCAACGACCAGATTGAGGAGTTTACCTGGTACGTAA
+ATCACTTTACGTACAGTAACGCCATCAAGATATTTTGCTACCAGATGTTCCTGGCCAGCACGTTCGCGAACCTGTTCTTCCGTTGCGTCCACCGGAACGG
+TGATTTTGGCACGGACTTTACCGTTAACCTGCACCACGACCAGCGTGGAGTCTTCCACCATCGCTTTTTCGTCAGCAACCGGCCACGGCGCGTTGTCGAT
+ATCGCCTTCGCCTTTCAGTTCCTGCCACAGCGTGAAGCAGATGTGCGGGGTGAACGGGTTAAGCATACGGACAACGGCCAGCAGTGCTTCCTGCATCAGA
+GCGCGATCCTGCTCGCCATCGGTTGGTGCTTTCGCCAGTTTGTTCATCAGCTCCATAATCGCCGCAATTGCGGTGTTGAAGGTCTGACGACGGCCGATAT
+CATCGGTCACTTTAGCGATCGTTTTATGCACATCGCGACGCAGCGCTTTCTGATTTTCAGTCAGCGCATCAACGTTCAGTGCCGCAACATCACCTTTTGC
+TGTGTGCTCGTAAACCAGTTTCCAGACACGTTTCAGGAAGCGGTTAGCCCTTCCACACCGGATTCCTGCCATTCGAGAGTCATATCAGCCGGAGAAGCAA
+ACATCATAAACAGACGAACGGTGTCCGCGCCGTAACGTTCAACCATCACCTGCGGGTCGATACCGTTGTTCTTCGACTTGGACATTTTGCTCATGCCGGT
+ATAAACCAGTTCATGGCCTGCCGCATCTTTCGCTTTCACGATACGGCCTTTCTCGTCACGTTCAACGATAGCATCAACCGGGGAAACCCAGTTACGTTCG
+CCGTTTTCGCCAACATAGTAGAAGGCATCTGCCAGCACCATACCCTGACACAGCAACTGTTTCGCTGGTTCGTCAGAGTTCACCATGCCTGCATCACGCA
+TCAGTTTGTGGAAGAAGCGGAAGTAGAGCAGGTGCATAATGGCGTGTTCAATACCACCAATGTAGATATCCACCGGCAGCCAGTAGTTAGCCGCTTCGGA
+ATCCAGCATACCTTCTTTGTACTGCGGGCAAGTGTAGCGCGCATAGTACCAGGAGGACTCCATAAAGGTGTCGAAAGTGTCGGTTTCACGCAGTGCTGGC
+ATACCGTTAACGGTAGTTTTCGCCCACTCGGATCTGCTTTAATCGGGCTGGTAATGCCGTCCATTACCACATCTTCCGGCAGGATCACCGGCAGCTGGTC
+GTCCGGGGTCGGCATTACGGTACCGTCTTCCAGCGTCACCATCGGAATCGGCGCGCCCCAGTAACGCTGACGGGAAACACCCCAGTCGCGCAGGCGGTAG
+TTCACTTTACGCTCGCCAACGCCCATCGCAGTCAGTTTATCGGCGATGGCGTTGAAGGCCGCTTCATGGTCAAGACCGTTGAACTCGCCAGAGTTGAACA
+GCACGCCTTTTCAGTCAGGGCTTGCTGAGAAAGATCTGGCTCAGAGCCGTCAGCTGCCAGGATAACCGGTTTGATGTTCAGGCCGTATTTAGAGGCAAAC
+TCGTAGTCGCGCTGGTCGTGCCCCGGTACCGCCATAACTGCGCCCGTGCCGTACTCCATCAATACGAAGTTTGCTGCCCAAACGGGAATTTCTTCGCCCG
+TTAATGGGTGAACCGCTTTAAAGCCAGTATCGACGCCTTTTTCTCCATCGTCGCCATTTCAGCTTCGGCAACTTTGGTGTTACGGCATTCGTCAATAAAG
+GCCGCCAGTTCAGGATTATTTTCCGCCGCTTTCTGCGCCAGCGGATGACCCGCAGCTACCGCCAGGTAGGTACAACCCATAAAGGTGTCCGGGCGGGTAG
+TGTAAACGGTCAGCGTGTTGTCATAGTCGTTAACGTTGAAGGTGATCTCCACGCCTTCGGAACGACCGATCCAGTTACGCTGCATGGTTTTAACGGTGTC
+TGGCCAGTGATCCAGTTTATCCAGATCGTTGAGCAGCTCGTCAGCGTAAGCAGTGATTTTGATAAACCACTGCGGGATCTCTTTACGTTCAACTTTGGTA
+TCGCAGCGCCAGCAGCAGCCGTCGATAACTTGTTCGTTCGCCAGTACGGTCTGGTCGTTCGGGCACCAGTTGACCGCAGAAGTCTTCTTATATACCAGGC
+CTTTTTATACAGCTCGGTGAAGAATTTCTGTTCCCAACGGTAGTATTCCGGCGTACAGGTTGCCAGCTCGCGGCTCCAGTCATAACCAAAGCCCAGCATT
+TTGAGCTGGTTTTCATATACGCGATGTTGTCGTACGTCCACGGTGCCGGAGCGGTGTTGTTTTCACCGCCGCGCCTTCCGCAGGCAGACCAAACGCGTCC
+CAGCCGATCGGCTGCAGGACGTTTTGCCCAGCATACGCTGGTAGCGGGCGATCACGTCACCGATGGTGTAGTTACGTACGTGGCCCATGTGTAGTCGACC
+AGAAGGATAGGGAAGCATAGACAGGCAGTAATACTTCTCTTTGCTCTCGTCTTCGGTTACTTCAAATGTGCGCTTCTCATCCCAATGAAGCTGTACTTTG
+GATTCTATCTCTTCCGGGCGGTATTGCTCTTGCATGGCAGCCAGTGGTCCTGTTTTCAATACGGCTACAAATGTAGCGTTGAGGTGGTTTTCAGATCCGC
+ATAGCATAGCCCAAACGTCCGCGTCAAAACAGCCTTTCGCGCACTCGACGTTGAAATGATGCCCGGATTATTCATACATTAATTTACAGAGTTTGTGGGC
+GTATTAGCAAAGCAAGGAACAAAGAACGTCTATTATTATAGTCAGTTAACGACCCGGGAGATGAAACGATGAACAAGGTTGCTCAATATTACCGTGAACT
+GGTTGCGTCACTGAGCGAACGCCTGCGCAATGGCGAACGTGATATCGACGCACTGGTGGAACAGGCGCGCGAGCGCGTAATAAAACAGGGGAGTTAACGC
+GAACCGAGGTCGATGAGCTGACGCGAGCTGTCAGACGTGACCTGGAAGAGTTCGCCATGAGCTATGAAGAGAGCCTGAAAGAAGAATCTGACAGCGTCTT
+TATGCGGGTGATTAAAGAAAGCTTGTGGCAGGAGCTGGCAGACATCACCGATAAAACGCAGCTTGAATGGCGCGAAGTTTTCCAGGACCTCAATCATCAT
+GGGGTTTATCACAGCGGAGAAGTGGTCGGGCTGGGAAATCTGGTCTGCGAGAAATGTCACTTCCATCTCCCGATCTACACACCGGAAGTGCTGACGCTAT
+GCCCGAAATGTGGTCATGACCAGTTCCAGAGACGCCCGTTTGAGCCGTAATAGTCTGATTTCGCACAGCAATAAAGAGAATATGGGCCGAATGAAATTCC
+CCGGCCCTTGTTTTTATCTCTACAGTAAATCTTCAGTCTCACGAATTTCCTGACTGACATCTCTGGTTCCGGATGACTGAACTTTACGATACAGGTCGAG
+AGCCTGTCGGAGATCGACAGGTCTTCCTTCTCCGTAGTGATACATAATGGCCAGGTTATACCAGGCAGTGGCGTCATTGCATTCAGCGGCTTTCGTAAAC
+CATTCAAAGGCAGCCTGATAATCTTTCTCAACGCCTTGTCCGTGTTTATACATATAACCGATGTTGACGTAAGCGCCGACGCTCCCTGAGCGGCAGCCTT
+CAGATACCAGTACATCGCTTGCTTATAGTCCTGGTCCACCCTTCGCCAGCGTTATAATCCCATGCAATTTGAAACTGGGCGTGCCGATTACCCTGCTGTG
+CGCTTTTCAAATACCAGAATGCGGCGAGTGTCTTGTTTTGAGCAACGCCTTTTCCGTCTTCATAAAGATCGGCCAGATTGTTTTGCGCGTCACTATGGCC
+TTGTAATGCAGCTTGTTTGTACCAGAAAAATGCCAGCGCATAGTCTTTTGCGACTCCGTTGCCATTTCTGTACATCCACCCAAGATTATTTTGCGCATAA
+GACATTCCGCTCTCCGCGGCTATCTGATACCAGACAACCGCTTCTTTATAATTGGGGCTTCTCCACGATCCAGTGTCCAGCCAAGGGCGTTGGAAGCGAA
+AGTATGGCCTTGTAGGGCAGCTTTTTCAGCCAGAAGATGGCTTGCTCATTATCTTTATGACGGCTTTTATCCTCGGTATACTTTTGCCCTAAGGAATACT
+GTGCTTCACAATGACCTTGCTCAGCGGCCAGCTTCAGCCAGTAAAAGGCTTTTTCGTCGTCCGGAGAATCAATTGCGCTATCGCGATTATAATAAAACCC
+AACAATATATTGAGCCTCGCAATCGCCTTTTTCAGCACGTTCGATAATCTCATCTATTGATAAATTATCGCAGCAACTTGACGTGAAAATCATTATCATT
+TCCTTATGGTTGCAGATAAAACATATTATATTTTTATGTGTTCCATTTTGCGTAAGCCTTATTTTATGCGTATTATGTCGCGTCAGAAAAGTATAAATAA
+ACGAGCCTCGCAATGCGGCTAATATTCATTTAATGAATATTTAAGGATAAATTATATGGACATGGAGTCGCAAAAATATTGTTTGCACTTTCCACTCCGA
+TGGAAATACGCAATGAATGCTGTTTACCTTCGCATTCATCACCCAAAATGTATTTAGGTACATGCTTTTTGACCTTTCTTCCTCATGGGGAATTGATGAC
+CGTGATGACCTGCTGCGCACAATTCACCGAATGATCGATAACGGTCATGCCGCTCGGTTGGCAGGGTTTTATCACCGCTGGTTTCGTTATTCGCCATGTG
+AATGGCGTGACTATCTTGCTGAACTAAATGAGCAAGGTCAGGCTTATGCGCAATTTGTCGCCAGCACCGCCGAATGCTGTGGCGAAGGGGAATCAAAGCC
+TGGGATTATGTCCGGATGGGTTTTAAGCCGAATGGGCGTACTTAATAACTGGTTGAGCGAAGAAGAAAGTCTATGGATCCAGTCGCGCATTCATCTACGG
+GCTCTACGTTATTATAGTAACTGGCGGCAATACTTTGCCGGTTATACCTTTGGTCGGCAATATTGGCAGTCTCCCGAAGATGATCATCTGCCTTTATTAC
+GCGAATTCTTAGCGCGTAAAGAATACGACGATTCCGGCAATGATATGTTTTATCAATTATTTGCCAGTGATGATGCGTATTACCCTACCTTGTCCTGGCA
+ACCATTGGCTTACTATTCTGCATGCCCGGAAACGCTTAAGGATATGAGCGACCTATGAAAAATTGCTGGAAGATCCTCGATATAGAGGAAACGACTGACG
+TCGATATTATCCGCCGCGCTTATCTGGCGCTGTTACCGTCCTTTCATCCAGAAACCGATCCGCAGGGTTTTAAACAACTTCGTCAGGCGTATGAGGAGGC
+GCTACGGATTGCGCAGTCGCCTGCTAAATCTGTTTGGCAACCAGAAGAATATGAGGTAGCAGAACATGAAATTCTGCTCGCCTTTCGTGCGTTACTTGCC
+TCTGATAGTGAACGTTTTCTGCCCTCCGCCTGGCAGCGATTCATTCAGCAATTAAATTATTGCTCGATGGAGGAGATTGATGAATTACGCTGGTCGCTGT
+GCACAATCGCCATGAACACTGCCCATTTATCCTTCGAGTGCGTGGTGTTATTAGCAGAAAGATTGCGGTGGTTACAGGAGGAAAATACCGGGGAAATAGA
+CGAAGAAGAACTGGAATCCTTTTATATGCCATTGCGAAGGGAATGTTTTAACTTCCAGACCATTCTGCATCTGCCCGTTGCCGTGCAAAATGACACCATC
+GATTTTTACCAAATGTTCGCTCGGATTTGGTCATCGCATCCACAATGGCTGACATTGTATTTAGCGCAACATCGCGCAGTGATTATCCCCGATGATGCAA
+AACTGCACAGAAATTTACTCCGCTGGTATAGCGCAGGTCGCCTGGATATCCCCGAACTTCTGGATTACGCCCAGTCATGGCGGGAAACTGAACCTGATAA
+TGAAGATGCGCCTTATTATGAATACGCGCAACGCGTCTATTGTGGAGAAGGCGAAAGCCTGTTGGCAGAACTTTGTGACTACTGGCGCGAGTATCCCTCC
+ACCCAGGCGGATGCTTTAATGTTGCAATGGTGCCGTCAGCATCGGGTCGATTATTACCCATTACTGGTGATGATGATTGAAGCGCGTGATCTGGTTAACG
+ATCAGGAAAACCGCTACTTTATGTCCCCGGCGACAGCGCCCGTACGCGTTTTCATTTATACGAAATACTCAGCGATGAAAAACTCTCTGCGCTGGGGCGT
+TCACTGGTCGAGATGGTTTTGCACAAAGGACGTAAGCCGCGGATCTCACTCACGCGTGATACAGAACATACCTTATGGCCATTATATCTAGTTGCCAAAC
+AATTAGTGCAGGCCTGCCAACCTACAGAAGAATCATTAATGCCGATTGTGAGCCGCCTTGATGCAGAAAATCGTTGTCCACTGGAAGCATTAATTATTCG
+TCGATTATTAATTCAGGCGGCGAATTTTACCGAGAAGCAAACTGTTGAACCGGAGCCGCAACCGCAGCCAATGCCCGTTGACGATGGTGGGCCAGGCTGT
+CTGGGCATCATTAAAATTATTTTCTATATTTTTATCTTTGCTGGTTTGATAGGAAAATACTCCATCTGTTCGGGTGACAGTCGACGTTAATGTGCGGGAA
+GCCCGGCAAGTAATCTTTCCGCATTTTGTAATGTTGTTTGGCGGTCAGTTTTAACCATTTTTGAGATTCATAATGGTTAACATTAATACCTGAGCCATTT
+CTGTAGATCAAACCTAAAGTATATTGAGCATGAGCATACCCTTGTTCAGCTGCTTCCTTATACCAGAGAATTGCTTTACGGGTGTCGGGTTTGACCCCAG
+ACCTTTGAGGTAGATCCACCCCAGTTTACTTTGCGCGCGTGGATTTTCCTGTTCCGCTGATTGCTCATACCAGTATCTCGCCTGTGTATAATCCAGTGGT
+TTACCGTCGCTACCATGAAGATAAAATTCTCCAAGGCGATATTGCGACGTTGAGTGACCATGAATCGCGGAAAGCTCCGTGGCTGCCGTGGTGAATGGAA
+GACTGCCCGGTGAGCTTAAATAATCAAAGGCATAATTCACCATGGCTTTATCACGCAACGTCGTTTTCTTGGGTTGGCTAATACAGGTAATTGCTGCAAC
+TATAAAAATTGCGAATATATACATTAATTTTTTATTCATGTGTGAATGCTTCGATTTTCTTTTTATTTTGAAAGCGTCAAGTTTATACTCATCAATAATA
+AAAAGTAGTCAGTTAATGCACTTAAGGGATTATTAACAAATGAATAAGGAAGAACAATATCTTCTTTTGCGCTTTCTGCGCCCATGGAAATACTTAATCA
+GGGTTGCAAACCCGCGCATGACTCGCCAAAATGTATACTGGGATAAAAGAATTCGAGCTCTCATCATCCTGGGAATAAATAATCGTGATGATTTAATTCA
+GACTATTTATCAGATGACTGATGATGGTCATGCCAATGATTTAGCTGGCTTATATCTGACATGGCATCGCTCTTCCCTGAAGAGTGGAAAGCATTAATTG
+CTGGTGGCTCGGAGAGAGGGTTGATTTATACCCAATTCGTTGCCCAAACCGCTATGTGCTGTGGGGAAGGGGAATCAAAGCCTGGGATTATGTTCGAATG
+GGGTTTCTGTCACGGGTCGGTGTGCTCAACAAGTGGCTGACGGAAGAAGAGAGTTTATGGCTGCAATCGCGCGTCTATGTACGAGCTCACCATTACTATC
+ACAGCTGGATGCACTATTTTTCCGCCTATTCGTTAGGACGTCTCTACTGGCAATCTTCTCAGTGCGAAGACAACACTTCGCTACGCGAGGCGCTAACCCT
+GTACAAATACGATAGCGCCGGGAGTCGTATGTTCGAAGAGCTGGCAGCGGGAAGCGATCGTTTCTATGCCACGCTTCCCTGGCAGCCATTAACTGTCCAG
+TCTGAATGCCCGGTAACGCTTAAGGATGTGAGCGACCTATGAAAACATGTTGGCAAATCCTCGAAATTGAAAGCACGACGCAAATAGACATTATCCGCCA
+GGCTTATCTTGCTCGCTTACCGTTGTGTCATCCCGAAACCGATCCGCAAGGGTTTAAAGCATTACGCCAGGCCTATGAAGAGGCCCTGCGACTGGCGGTA
+AATCCTGTCGAGGAAGCAGATGATGAAGAAAAGATGCTGCCGCTGAACATGAAATACTACGTGCATTCAGGACATTACTGGATTCAGAAAGTGATCGTTT
+TCAGCCTTCCGCCTGGCAGAAATTTATTCAGCAATTAAATACCTGGAACATGGAGGATGTCGATCAATTACGCTGGCCGCTGTGTGCAATCGCCATAGAA
+GCGCGATATCTTTCATTAAATTGTGCTTCTTTGCTGGCAGAGCGTTTGAACTGGCATTCATTTAATGACAGCGAAGGAATGGATGAGGAAGAAAGGAGGC
+TTTTCTTGAGGCCATTCAGGCTGGTGATTGTTTCGATTTCCTTAGCCTTCTGGAATATCCCATTGCGTTGCAGAACCAGACTGTTGAGTATTACTTCGCG
+CTGGAACGTTGCTGCCGTTACCATCCTGACTATGTCACTGCGTTTTGGCGATGGAAGGTCCGTGGTTAATTCCTGATGATGCAAAGTTACATCGCAAACT
+GTTGCGCTGGTACAGCTCGGTGCAAACAGGTATGGCGGAACTCATTCCTGTCGCTCAACAGTGGCAAACGGAAGAACCAGAAAGCGAAGATGCCCGGTAT
+TACTTGTGTGCACAACGTTTGTACTGCGGCGAGGGGAAAGCCTGCTTGCCGATCTCTGCGCGTACTGGGAAAGTTACCCATCTACACAAGCTGATAATTT
+GTTGTTGCAGTGGAGCAAGCGTCATTGCCCGGATTATTTCGCGTTATTAGTGATGGTTATCGAAGCGCGGAGCATGGTAGATGCGCAAGGTCAACCGCTG
+AAATATGTTCCTGGTGAGAGCGCCCGGACGCGGCTGTTATGGGCGGAGATTTTACATAGCGGAAAATTATCGCCGTTAGGTCAATCGTTTATTGAGTCGT
+TATTCTTCAAGCGCAAAGCATGGGCGTGGTGGAAATCGAGAGTCGGTAGCGAGACAGAGCAAGATTCACCGTTCCTGGATTTGTATCGGGTAGCGGAACA
+GGTAGTACTTGAAGCGTTTCCGAAACAAGAGATGCTGGCCCGTCTTAATACAAGGCTGGAAGGCGGAGATGCTCATCCATTAGAGGCCATTGTCACCCGG
+ATGCTTTTGACGAAAGTGAAACTCGAGCCGGAGGATGAAGATGTCGATGAGCCAACACCTGAAAATCATGAAGAAAAATGATGAGGGTGAAAAACCACAG
+AGCATTACCAGCATTATCAAAATCAGTTTAACGGTGCTGGTGATAGGTTATGCTCTCGGCAAAATCGCGATGTTGTTTAGCTGACGATGTGTTTTTGCGC
+CGATGCCGGATGCAGCGTTTACGCCGCATCCGGCAGCCGTGTTTATGGGATCTCAATGGCTAAATAATCGCTCGCCCGCCGCCGAACTTCATCCACGCGG
+GCCATATCGTTTGACTGCAACGCCGCATCAAAATCGGTGATCACCCGGCCGATCTCTTCTCGCTCGTCACCCAGCGCCCGCGCCCACAACTCTTCCAGTT
+TGGCTTTAAAGGTGCGATTGATGAGCATATCGCGCGGATAAATTTTCAATGCGGATAACCGCGTCCGACTCTCTTCAATCTGCTGCGCGCTCAATGTTAC
+CGGGCTGTGGTTAATCACTCTGGACTTAACGCTGCCGTCTTCCAGAAGCACGTCAACTTCAAGCAACCCGTTGATATCATAACTAAAGCGAATATCAATC
+GACTGATAAGCCCCGGTTTTCTTCAACGGCACATCGAAGGATTCCACCAGAATGTTGTTTTAACTTTGTGGTTTTCTCCTGATAGACGTTAACCGTAATT
+GAATCCTGTTCCGGGTGCATGGTTGAATAAGTTTCTACACGCGACACGGGCACAGTGGTGTTTCGTTCAATAATCGGCGAGAAAATGCCGGAAACGCCCT
+GGCGGTTAACTTCAACGCCCAACGAGTAAGGGCAAATATCAGTGAGGATTACCTCTTCAATATCTTCACTGCGTAAGCGGCAGGCGGCCTGGATTGCTGC
+GCCCAGCGCGACAATGGTGCTCGGATCGTAACTTTGATACGGTAATTTGCCAAACAGACGCACGGCGATTCGCTGCACCAGCGGCATTTGTGACGCGCCG
+CCAACCAGCACCAGACTGTCGATTTGACTCGGCTTCAGACGCGCATCGCGCAACGCCTGTTCAATCGGCACTCGCAAGCGATTGAGCAGCGGCAACCACA
+AATCTTCCAGTTCGTTCTCGTAAAATTCGCATTCCCGCGTTTCTTCCTGATACTGCCAGCGAATGTGCAATGGCGATTGATTGCTACATTTTGCCGCTTC
+CACACAGGCGTACAAGGCTGCCAGTTCACTCTCGTTAAGCGTGGTCCTGGCGACATCCGCGCGTTTTAAAACCTCATCGACCAGCATATGGGTAAAATCT
+TCGCCACCAAGAAAGTTGTCGCCAGCGGAGGCGTGAACTTCAATCACCGGCGTGGCGTACTCAAGCACCGTAACGTCAAACGTGCCGCCACCGAGATCAA
+ACACCAGCGAACGGGTATTTTGTTGGGTATGCAGGCCATACGCCATCGCAGCTGCTGTGGGTTCATTAATTAAGCGTACCGCATTTAACCCGGCTAACTC
+CGCTGCTAAACGGGTATGCTTGCGTTGTTCATCGCTGAAATAAGCCGGAACGGAGATCACCACATCTTTAATCGGACGTTGCAGAAATTCTTCGGCATCT
+TCTTTTAATGAGCGTAATACCAAAGAGGACAGTTCTGGCGCGTTAAATGTGTCGCTGCCTAACCGCCAGTTGGTATTACTGCCCATTGCACGTTTAAATA
+ACGCTGCCGTTTTATCCGGATGCGAAGTACGCCGTGATACAGCCGGTTTTCCGACTAAAATATGATTATTTTCATCCATGCTAATTATGGATGGTGTTAA
+ATATTCACCGAACTTATTTGGAATTAATTGCGCGGCACCGTCTTTCCAGACGGCAATTAAACTATTGGTAGTACCGAGATCGATACCAATGGCGAGTTCT
+GCATTATCCATTGCATTTATATCTTGAAAGAAAAGAGATAAACAGATTAAGACCACCCAGGTAACGCGTGGTGATCTTAATCAATGACGTGTTAAGCGTA
+AAATTTCAGACGATCAGCCAGTAAATCAACAAAGCCCTGACGATCAACATCGACCATTACGGTGGCATTCGGTTTATTGCCTGTCAGATAATAATAATCA
+ACAACCGTCATACCCTGGGTATATTTCCCTGTGTTTCCACGCCAACCCAGCGCTCAACAGAGGTAAATAACTCCGGTTTCAACAGCCAGGCGATGGTGCA
+TGGGTCATGCAGTGGTGCGCCGACAAAGCCCCATTTTTCGTCTTTATGATATTCGAGGAAGAAATCCAGCAGTTCGGCAACAATGGTTGAAACAGGGTTA
+CCAATCGCGCGGAAACGCTCGGTGTCTTCAACGTGGATTTGTGCTTTATGAGTAACATCCAGACCGGCCATCACCACCGGGATCCCTGACTGGAAGACAA
+TTTCTGCCGCTTCCGGGTCAACGTAAATATTAAATTCAGCCGCAGGCGTCCAGTTACCCAGCCCCATAGCGCCACCCATAATCACGATACGGGCAATTTT
+GCTATGCAGTTCCGGATGGCTATTGAGCAGCAAGGCAACGTTAGTTTGCGGTCCGGTAGACACAATGGTGACAGGTTCCGCACTTTCACGCAGCGTTTTC
+GCCATCAGCTCTACCGCCGTACAGTTTTGCGGTGCGAATGTCGGTTCCGGTAATGCCGGGCCGTCGAGACCGCTTTCGCCGTGCACATTGTCCGCGATAA
+TCAACTCACGCATTAACGGTTTTACCGCGCCGCCTGCTACCGGAATATCGGTGCGATTAAGCAAGGTCAGCATACGCAGAACATTGCGTAAGGTTTTTCT
+GGTGTCTGGTTTCCGGCGGAAGACGTAATTGCTTTGACATCAAGCTCTGGTGAGGCGAGGGCGAGAACTATTGCGATAGCGTCGTCATGACCTGGGTCGC
+AATCTAACAGAATTGGCAGTGCCATTGTTGCTCCTTGTTGTGTGCTTCTTTGCGACAAGGGTAACGCCAGGATGTAACAGATACGAGGGGCGAAACGATA
+AAGCGTGAGATGGCGCGCAATTGGGTATGCGCGCCAGAGTGATTAATGCAGGATTTTCGCGAGGAAGTCTTTTGCGCGGTCCGATTTCGGATCATCGAAG
+AAAGCGTCTTTCGGCGAGTCTTCGACAATTTTACCCTCGTCCATAAAGATCACCCGATTCGCCACTTTACGGGCAAAGCCCATTTCGTGGGTCACCACCA
+TCATGGTCATTCCTTCGTTCGCCAGTTCCACCATCACGTCCAGTACTTCGTTGATCATCTCCGGATCCAGCGCCGATGTCGGTTCGTCAAACAGCATCGC
+AATAGGATCCATACACAACGCGCGAGCGATTGCCACACGCTGCTGCTGACCGCCGGAAAGCTGCGCCGGAAACTTATTGGCGTGAGCAGAAAGCCCGACA
+CGCTCCAGCAGTTTCAGGGCTTTTCACGAGCCGGCGCTTTATCGCGTTTAAGCACTTTCACCTGCGCCAGGGTCAGGTTTTCGATAATCGACAGATGAGG
+AACAGCTCGAAATGCTGGAATACCATCCCGACGCGGGAACGCAGCTTTGCCAGATCGGTTTTCTTGTCGTTAACCACGATACCATCGACGGTGATTTCAC
+CTTGCTGCACCGGTTCGAGGCCGTTGACGGTTTTAATCAGCGTTGATTTGCCGGAACCAGACGGGCCGCAAACCACCACCACTTCGCCTTTTTCACTTCG
+GTTGAGCAGTCGGTCAGCACCTGAAAGTGACCATACCATTTTGAAACATTTTTCAGGGTAATCATTATGCTGTCCTTCTTTCAAGTAGCTGACCAACAAC
+GACGCGCTAAGACTAATAACGAAATAAACAAATCCGGCAAACAGGATCATCTCAACCTGCGTACCATCACGCTCACCAATGGTTGAGGCGGTACGGAAGA
+AATCGGCCAGGGATAACACATACACCAGTGAGGTATCCTGGAACAGTACGATGCCCTGAGTGAGCAGCAGCGGCACCATCGCGCGGAACGCCTGCGGCAG
+AATAATCAGTTTCATCGACTGCCAGTGAGTCATTCCCAACGCCAGCGCGGCGCTCGATTGACCACGAGAAATACTTTGAATACCAGCACGGATAATCTCT
+GAATAGTAGGCCGCTTCAAACATCGAAAACGCCACCATCGCCGAAATTAAACGGATATCATTTTTGGCGATAATCCCAGCACGTTTTGCAGAAAACCCGG
+CACGATCAGGTAAAACCACAGCAAAACCATAACTAAAGGAATCGAGCGGAATACGTTAACGTAGGCTTTGGCAAACCACGCCACGGGCGCAAAGCTGGAT
+AAACGCATCACCGCCAGCATCGTGCCCCACAAAATACCAATCACTACCGCCGTGACGGTGATTTTCAGGGTGATCACCAGCCCGTCGAGCAGATATGGCA
+GGGAAGGGACAATGGAACTCCAGTCAAACTCGTACATTATTTGCCCCCATGTTGCCAGGCAGGCGAACTTTACGTTCAACCAGCGTCATCACCAGCATGA
+TAAAAGCGTTAATCAACACATACGCCAGCGTAATGGCGGTAAACGACTCCCAGGCATGGGCTGAGTAATCGAGCAATTTACCCGCCTGCGCCGCCATATC
+CACCAGACCGATAGTCGAGGCGATGGCGGAGTTTTTCACCAGGTTCATCATCTCTGAGGTCATCGGCGGGACGATAACGCGATAAGCATTAGGCAGCAGT
+ACGTATCGATAAGCCTGCGGTAGCGTCAGGCCCATCGCCAGCGCGGCATTTTTGCCCTCGCGGCAGCGACTGAATCGCGGCGCGTACCTGTTCGCAAACA
+CGGGCGGCGGTAAACAGCCCCAGGCAGAGCATGGATGAAAGGAAAACTGAATATTGGGATCCAGCTCGGCCTTAAACCACATGCCGATTTTCTCCGGCAG
+CAGCTCCGGGATCACCAGATACCAGGTAAAGAATTGCACAATCAACGGCACGTTGCGGAACAGTTCGACATACAACGTACCCAGACCAGAGAGAAAACGG
+TTTGGAACGGTACGTAAAATGCCGAAAAATGAACCGACGAGGAAAGCGATAATCCAGGCGCAGATCGACAAAGCGATCGTCACCTGAAAACCACTCCAGA
+TCCAACCAAGATAGGTGGTGTTGCCGAACGGGGCTTGTTGTAAAAAATACCCCAGTTCCAGTCTATAGACATAAATCTACTCCAGAAAAAGAGGGTAGCA
+GCGTTAACTGCTACCCTCGAAGATTGTTACCCAGCGTATTGCGGTTTTCAGGCCCGATGGGGAACGACCATCAGGCGTATAGTCTGTCCGTGCTACGTAA
+CAATCGAGAGGGCTGGAATTTCCGCCCCTGGTTCTTGTAATTAGTTCAGTGCCTTGTCATTCGGTTCTTTGAACAGTGCTTTCATTTCGTCTGACAGTTC
+GAAATTCATGTTCAGGTTTTTCGGCGGAATTGGATTTTTGAACCACTTATCAAACCATTTTTCCGCTTCACCGGAGGTCTGCACCTGAGCGATGGTGTCA
+TCCATCAGCTTTTGAACTGCGGATCATCTTTACGCAACATACAACCGTAGGCCTCCTGAGACTGCGGCTTGCCGACGATTTCCCAGTTGTCTGGTTTCTT
+CGCTTTCGCACGTTCACCGGCCAGCAGAGCGTCATCCATCATAAAGGCAACGGCACGACCGCTTTCCAGGGTGCGGAAAGAGTCACCGTGATCTTTGGCG
+CTGATGATGCGCATATTCATTTTTGCTCTTCATTCAGTTTGTTGAGCAAAACTTCAGAGGTAGTGCCGGAAGTGACGACTACGGCTTTGTCTTTCAGGTT
+GGCAAAATCTTTGATATCGCCACCCTTTTGGTCAACAGGCGCGTACCGACCACGAAAATAGTGTCAGAGAAAGCCGCCTGTTTTGGCGTTCGACGTTGTT
+GGTGGTAGAACCACATTCAAAATCGAAAGTGCCGTTTTGCAGCAGTGGAATACGGTTTTGTGAGGTAATCGGAATCAGTTTTACCTGCAAGTCCGGTTTG
+TTGAGTTTCTTTTCACTGCTTCAACAATGGCGTTGGAGTAATCCTGCGAGTAACCCACCACTTTTGCTGATTGTCGTAATAAGAGAAAGGCACTGAAGAT
+TCACGGTGACCGACGACAATCACACCGTTTTGGCGATTTTGTCCAGAGTACTGCCCGCTGCCGGGGCGGCGTCATCTGCCTGTGCCAGTCCTGCGGAAAG
+CGCCAGGGCGAGGATTGCTGTGGCAGGTTTACGTAATTGCATATCCAACTCCTTTATCTTCTGCGTTAAGAACGCATGGATACCCGTTGTGAGTGTTTGT
+GTTGTTATCGTCTGCAACTTTATTGTGCAGTGTTGTGCCTGTTAGGAAAGTGCGAATAAGCGGGGAAATTCTTCTCGGCTGACTCAGTCATTTCATTTCT
+TCATGTTTGAGCCGATTTTTCTCCCGTAAATGCCTTGAATCAGCCTATTTAGACCGTTTCTTCGCCATTTAAGGCGTTATCCCCAGTTTTAGTGAGATCT
+CTCCACTGACGTATCATTTGGTCCGCCCGAAACAGGTTGGCCAGCGTGAATAACATCGCCAGTTGGTTATCGTTTTTCAGCAACCCTTGTATCTGGCTTT
+CACGAAGCCGAACTGTCGCTTGATGATGCGAAATGGGTGCTCCACCCTGGCCCGGATGCTGGCTTTCATGTATTCGATGTTGATGGCCGTTTTGTTCTTG
+CGTGGATGCTGTTTCAAGGTTCTTACCTTGCCGGGGCGCTCGGCGATCAGCCAGTCCACATCCACCTCGGCCAGCTCCTCGCGCTGTGGCGCCCCTTGGT
+AGCCGGCATCGGCTGAGACAAATTGCTCCTCTCCATGCAGCAGATTACCCAGCTGATTGAGGTCATGCTCGTTGGCCGCGGTGGTGACCAGGCTGTGGGT
+CAGGCCACTCTTGGCATCGACACCAATGTGGGCCTTCATGCCAAAGTGCCACTGATTGCCTTTCTTGGTCTGATGCATCTCCGGATCGCGTTGCTGCTCT
+TTGTTCTTGGTCGAGCTGGGTGCCTCAATGATGGTGGCATCGACCAAGGTGCCTTGAGTCATCATGACGCCTGCTTCGGCCAGCCAGCGATTGATGGTCT
+TGAACAATTGGCGGGCCAGTTGATGCTGCTCCAGCAGGTGGCGGAAATTCATGATGGTGGTGCGGTCCGGCAAGGCGCTATCCAGGATAACCGGGCAAAC
+AGACGCATGGAGGCGATTTCGTACAGAGCATCTTCCATCGCGCCATCGCTCAGGTTGTACCAATGCTGCATGCAGTGAATGCGTAGCATGGTTTCCAGCG
+GATAAGGTCGCCGGCCATTACCAGCCTTGGGGTAAAACGGCTCGATGACTTCCACCATGTTTTGCCATGGCAGAATCTGCTCCATGCGGGACAAGAAAAT
+CTCTTTTCTGGTCTGACGGCGCTTACTGCTGAATTCACTGTCGGCGAAGGTAAGTTGATGACTCATGATGAACCCTGTTCTATGGCTCCAGATGACAAAC
+ATGATCTCATATCAGGGACTTGTTCGCACCTTCCTTAGGTAACATTTAGTTTGGCTAAATGTAAAGATATTGCTGTTTTATTGTTTGTTTTGCGAGATGC
+GCCGCACCATTCCGAAGCAAAATTCTTAAAATGCACTCTTTTAGTGCTACCGCTGGATTACTGTGGTGCAACTAGGTTGTACTGATGCTGTTTCAGGGTT
+TGCCTTGTATAACAAAGCAATAGATGTGCCAAAGTTGGATAGGAGAATATTGTTATCCGGATAATGCACTGATGCCGCATCCGGTGAGCGTGCCGAAATA
+TGGGATGTATTCCGGCACGATAAGAAGGGATTATTTACGTCGCTGACGCAGACTCATCAACACAGCAGCAAAACCAAACAATGCCGTCAGCACCCACAGC
+GGCCAGTTGCCGGTACGTGCGTATGGTGTGAGTCCGGTGGTCGGCGTCACGTTAGTGGTTAACACCTCGCGGGTGAACTGCGGGATCATCGCCTGAATCT
+CACCCTGCGGGCCAATCACCGCCGTAATGCCGTTGTTGGTGCTGCGCAACAGTGGCGCGCCAGCTCCAGCGCACGCATTCGCGCCATCTGGAAGTGTTGC
+CATGGACCAATAGATTTACCAAACCACGCATCGTTGGAGATAGTCAGCAGATAGTCGGTATCCGGGCGGAAGTTATCGCGCACTTGCTCGCCGAGAATGA
+TCTCGTAGCAAATAGCCGCAGTAAGCTCAATACCATTTGCCGACAGCGGCGGCTGGATATATGGCCCACGGCTGAACGACGACATCGGCAGATCAAAGAA
+CGGTGCTAACGGACGCAGAATCGACTCCAGCGGGACAAACTCGCCAAACGGCACCAGATGGTTTTGTTATAGCGATCGGCTGATTCGTAGCTGTACGGCG
+CACCTTTACCCAGCGTGATGATGGTGTTGTAGGTATCGTAGCGGTTCTGCTTATTGAGACGCGCGTCGACAATCCCGGTTACCAGCGAGCTACCTTTATC
+ACGCAACTCACCGTCCAGTGCTTTGAGGAACGGTTGCTGATTAATTTCCAGATCGGTTATCGCCGACTCCGGCCAGATAATCAACGATGATTTGCCCATC
+AGCGGTGCCGTTGCGTTGTAGTAAATCTTCAGCGTATTAAGAAGCTGGCCTTCGTCCCATTTCAGCGATTGCGGAATATCGCCCTGAACCATCGAAACCT
+GAATGGTTTTCTCCGGTTGTGGGGTAAACCACTGGATGTAACGCAGCGGGAAGGGAAGGGCAAACAGCACGACGGCCACCACCAGCGGACGCCAGTTGCG
+TTTGACCAACGCCAGTGCCAGCAGGCCACTAACCATCATCAGCAGGAAGTTAATGGCTTCCACGCCCATTATCGGTGCCAGCCCTTTAACGGGCCATCAA
+TCTGGCTATAGCCGAACTGTAACCACGGGAAGCCGGTCAGTACCCAACCGCGCAGAAACTCGGTCACTTGCCAGAGGGCAGGGCGGCAATCGCTACGCGC
+AGCCAGGTGGTTTTCGGCCACAGACGCGACAGCACGCCAGCAAACAGTCCGGTATACAGCGACAAATACGCCGCCAGCAGCACCACCAGGAAGATGTTAA
+CCGGGCCAGGCATTCCGCCAAAGGTCGCGATGCTGACATAGACCCAGTTAATACCGCTGCCAAAGAGGCCAAATCCCCAGCAAAGCCAATAGCGGCAGAC
+TGGAGTGGACGGCGGTTAAAGGTCAACGCCTGAAGCCCCATCAGCGAAATAATCGCCGCAGGCCAGACGTCGTAAGGAGAAGGCCAGCGTTCCGCAGGCA
+CCGAATAATAACGCCAGCAGCAGGCGAATGCGCTGGCGTTCAATTAATGAGGCAAAAGCCATGTAGTTATCTATCCAGTTTCGGTTTTATTCATCCAGCT
+TCGGCTGGGGTGAGTCATCCGGGATTTTGACATGAACCTGAATAATACGCCGACTGTCGGCCATCGCCACTTTGAACTGGTAACCGTCGATGTCGATAGT
+TTCGCCACGCGCCGGAAGATGCCCAAATGCCTGCATCACCAGACCACCGATAGTGTCGACTTCTTCATCGCTAAAGTGGGTGCCGAACGCTTCGTTGAAG
+TCTTCAATGGAAGCCAGTGCGCGTACGGTCCAGGTATGACGACTCAGCTGACGGAAGTCGATATCATCTTCTTCGTCATACTCGTCTTCAATCTCACCAA
+CAATCAGTTCCAGGATGTCTTCAATGGTCACCAGACCGGAAACCCCACCGAATTCGTCAATAACGATCGCCATGTGGTAACGCTGAGAGCGAAACTCTTT
+CAGCATCCGGTCTACGCGCTTACTTTCAGGAACGACAACCGCCTGACGTAACACTTTGTCCATGCTGAAGGCTTCAGCATCGCTGCGCATAAACGGCAGC
+AAGTCTTTCGCCATCAGAATCCCTTCAATGTGATCTTTGTCTTCGCTAATCACCGGGAAACGTGAGTGGGCGGACTCGATGATGACATCAAGACATTCGT
+CCAGCGTCTGGTTGCGTTTCAGGGTAATCATCTGGGAGCGGGGATCATGATGTCGCGAACGCGTTGGTCTGCGATGTCCATCACCCTTCGAGCATATCGC
+GCGTATCTTCGTCGATAAGGTCGTTCTGCCCGGAATCACGGATCAGCGCCAGCAGTTCGTCACGGTTTTCGGTTCACCGTGGAAAAGTTGGCTGAGTAAC
+AGGAGAAAAATCCTTCTTGTTGCTTATCGTGTCACTACTGTGTGAATTGTCGTCGCTCATGGCGTCGTATGGGTTCTCATGTTAGTTAATCAAAACGCCG
+TCGTTAATCACCAACGGCGGGGACGTCTGCCAGTCAAATGCCTGGCAAATTATTCTTTCTCGGCAATGTACGGATCCTCATAGCCCAGAGCAAGCATAAT
+CTCTGTTTCGAGGGCTTCCATTTCTTCTGCTTCGTCATCTTCGATGTGATCGTAACCTAACAAATGCAGACTGCCGTGCACCACCATATGCGCCCAGTGC
+GCCTCCAGTGGTTTGCCTTGCTCCTGAGCTTCCTTCTCAACCACCTGACGGCAGATAACCAGATCGCCCAGTAGCGACATTTCCATGCCAGGCGGCACTT
+CAAACGGGAAGGAGAGCACGTTGGTCGGCTTATCCTTACCGCGATAGGTCAGATTCAGACTGTGGCTTTCGGCGGTATCGACCACGCGAATCGTCACTTC
+CGATTCTTCCTGAAACTGCGGGATCACCGCATTCAGCCATGTCTGAAACTGGCTCTCTTCCGGTAACCCGGAATTATCTTCACATGCCAGTTGTAAATCG
+AGGATCACCTGACTCATTTTGTTCCTGTTCTTCGCGCTTGCGTTCTGCTGCCAGCGCCGCTTTTCGTTTTGTTCGGCTTCTTCCCAGGCTTCATAGGCGT
+TAACGATACGCGCCACCACAGGGTGACGAACCACGTCTTCGCTGTGGAAGAAGTTAAAGCTGATCTCTTCGACATCGGCCAGCACTTCGATGGCGTGACG
+TAAGCCTGATTTAGTATTACGCGGCAGGTCGATCTGTGTGACGTCGCCGGTGATAACCGCTTTTGAGTTAAAACCGATACGGGTCAGGAACATCTTCATC
+TGTTCGATGGTGGTGTTCTGGCTCTCATCGAGAATGATAAACGCGTCGTTCAGCGTACGACCACGCATATAGGCCAGCGGTGCGACTTCAATAACGTTGC
+GCTCAATCAGTTTCTCGACTTTCTCAAAGCCCAGCATTTCAAACAGCGCGTCGTACAGCGGGCGCAGATACGGGTCTACTTTCTGGCTTAAATCGCCAGG
+CAGGAAGCCCAGTTTCTCACCGGCTTCTACTGCCGGACGAGTCAGCAGAATACGGCGAATTTCCTGACGCTCCAGGGCATCAACTGCCGCAGCCACTGCC
+AGGTAGGTTTTACCCGTACCCGCCGGGCCAACGCCGAAGGTAATGTCATGGTCGAGAATATTGGCGATGTACTGCGCCTGGTTTGGCGTGCGCGGCTTAA
+TTACGCCGCGTTTGGTTTTGATATTGACCGCTTTGCCGTACTCCGGCACGCTCTCCGCGCTTTGCTCCAGTACCCGCGCTTCTTTAATCGCAAGGTGGAT
+CTGTTCCGGTTCGATATCCTGAATCTGACCGCGCATCGGGGCAGTATCGACATACAGGCTACGCAGAATGTCTGCCGCAGCGGTGACGCAAATCGGACGG
+CCGGTCAGTTTAAAGTGGTTATCGCGGCGATTGATCTCGATGCCGAGACGGCGTTCGAGCTGCTTGATGTTGTCATCAAACGGGCCGCACAGGCTCAACA
+GACGCGCATTGTCTGCTGGCTCCAGGGTGATTTCGCGAGTGTCTATGTTCAAACCGTTCCTCTTATCTGTATGCCGCCGGAAGCTGAACATTCACCGGCC
+TATAAGGAAATTATTCACGCCACAGGAAAAAGGCGCAAGCATTGCAATAAAGATGGGGATAAAGAGAGAAAACAAGGCCCACCGGAACGGCAGGCCTGAG
+AATTACGGCTGATAATAACCCACGCCAAGGTCGTTTTCTTTGCGGGTACGGGCAATCACTGATTCCGGTGTTTCTGCCACGCGCAGACCCATTTCATCTT
+CAGTACGCACCACTTTACCGCGCAGAGAGTTCGGGTAGACGTCGGTAATTTCTACATCGACGAATTTACCGATCATATCCGGCGTGCCTTCGAAGTTGAC
+CACGCGGTTATTTTCCGTACGCCCGGAAAGCTCCATGATGCTCTTACGCGATGTACCTTCTACCAGAATACGCTGGGTGGTGCCGAGCATCCGGCGGCTC
+CACGCCATCGCTTGCTGATTAATGCGCTCTTGCAGAATATACAGACGCTGCTTCTTCTCTTCTTCCGGAACATCATCAACCATATCGGCGGCTGGTGTAC
+CCGGACGTGCAGAAGATAAAGCTGTAGCTCATGTCGAAATTGACGTCGGCAATCAGCTTCATCGTTTTCTCGAAGTCTTCGGTGGTTTCGCCAGGGAAGC
+CAACGATGAAATCAGAACTGATCTGAATATCTGGACGCGCCGCACGCAGTTTACGGATGATCGCTTTGTACTCCAGCGCCGTATGGGTACGGCCCATCAG
+GTTCAGAATGCGATCGGAACCGCTCTGTACCGGCAGATGCAGGAAGCTCACCAGCTCCGGCGTGTCGCGATACACTTCGATGATATCGTCGGTGAATTCG
+ATCGGATGGCTGGTGGTAAAGCGAATACGATCGATCCCGTCGATCGCAGCAACCAGACGCAGCAGATCGGCAAACGATCCGGTGGTGCCGTCGTAGTTTT
+CACCACGCCAGGCGTTCACGTTCTGACCGAGCAGGTTGACTTCACGCACGCCCTGAGCCGCAAGCTGGGCAATCTCAAACAGAATATCGTCGGACGGACG
+GCTTACCTCTTCACCACGGGTGTAAGGCACCACGCAGTAGGTGCAATATTTATTGCAGCCTTCCATGATGGAGACAAACGCGGTCGGCCCTTCGGCGCGC
+GGTTCCGGTAGACGGTCAAACTTCTCGATTTCCGGGAAGCTGATATCTACAACCGGGCTGCGGTCGCCACGCACGGAGTTGATCATCTCCGGCAGACGGT
+GCAGCGTTTGCGGCCCAAAAATAATATCGACATAGTGGGCGCGCTGGCGAATGTGCTCGCCTTCTTGCGATGCCACGCAGCCACCGACGCCGATAATCAG
+GTCTGGATTCTTCTCTTTAACAGTTTCCAGCGACCCAACTGATGGAAGACTTTTCCTGAGCCTTCTCGCGGATTGAGCAGGTGTTCAGCAGCAGCACATC
+CGCTTCTTCCGCCACGTCGGTCAGTTGATAGCCGTGGGTGGCATCCAGCAGATCGGCCATCTTCGATGAATCGTACTCGTTCATCTGACAGCCCCAGGTT
+TTAATATGGAGTTTTTGGTCATCGACTTGCTCTTGCGAAATAGTAGCCAGGAATGCAGGGCGCATAGTGTAATGCTTTGCTGCCGTTGTGACCAGTATGA
+GCGTTATCAGCCCTTAGGGTAAAAATCCTGTAAACTTAAAGCATATTGCTAACAGGATGATTGACCATGACAAATCAACCAACGGAAATTGCCATTGTCG
+GCGGAGGAATGGTCGGCGGCGCACTGGCGCTGGGGCTGGCACAGCACGGATTTGCGGTAACGGTGATCGAGCACGCAGAACCAGCGCCGTTTGTCGCTGA
+TAGCCAACCGGACGTGCGGATCTCGGCGATCAGCGCGGCTTCGGTATCATTGCTTAAAGGGTTAGGGTCTGGGATGCAGTACAGGCTATGCGTTGCCATC
+CTTACCGCAGACTGGAAACGTGGGAGTGGGAAACGGCGCATGTGGTGTTTGACGCCGCTGAACTTAAGCTACCGCTGCTTGGCTATATGGTGGAAAACAC
+TGTCCTGCAACAGGCGTTGTGGCAGGCGCTGGAAGCGCATCCGAAAGTAACGTTACGTGTGCCAGGCTCGCTGATTGCGCTGCATCGCCATGATGATCTT
+CAGGAGCTGGAGCTGAAAGGCGGTGAAGTGATTCGCGCGAAGCTGGTGATTGGTGCCGACGGCGCAAATTCGCAGGTGCGGCAGATGGCGGGAATTGGCG
+TTCATGCATGGCAGTATGCGCAGTCGTGCATGTTGATTAGCGTCCAGTGCGAGAACGATCCCGGCGACAGCACCTGGCAGCAATTTACTCCGGACGGACC
+GCGTGCGTTTCTGCCGTTGTTTGATAACTGGGCATCGCTGGTGTGGTATGACTCTCCGGCGCGTATTCGCCAGTTGCAGAATATGAATATGGCACAGCTC
+CAGGCGGAAATCGCGAAGCATTTCCCGTCGCGTCTGGGTTACGTTACACCGCTTGCCGCTGGTGCGTTTCCGCTGACGCGTCGCCATGCGTTGCAGTACG
+TGCAGCCAGGGCTTGCGCTGGTGGGCGATGCCGCGCATACCATCCATCCGCTGGCGGGGCAGGGAGTGAATCTTGGTTATCGTGATGTCGATGCCCTGAT
+TGATGTTCTGGTCAACGCCCGCAGCTACGGCGAAGCGTGGGCCAGTTATCCTGTCCTCAAGCGTTACCAGATGCGGCGCATGGCGGATAACTTCATTATG
+CAAAGCGGTATGGATCTGTTTTATGCCGGATTCAGCAATAATCTGCCACCACTGCGTTTTATGCGTAATCTCGGGTTAATGGCGGCGGAGCGTGCTGGCG
+TGTTGAAACGTCAGGCGCTGAAATATGCGTTAGGGTTGTAGCCTTACAACATTGCCGGATGCGTGCCAACCGTAGGTCGGATAAGACGCGGCAGCGTCGC
+ATCCGACATTGAAGGATAAGACGTGTCAACATCGCATTCGACATTGAATGAACGCAGAAAGCAAAAGCTCGCCGAAGCGAGCTTTTTAATGTGGCTGGGG
+TACGAGGATTCGAACCTCGGAATGCCGGAATCAGAATCCGGTGCCTTACCGCTTGGCGATACCCCAACTGGGTGCACTTACAAGGTAAGCGTCTTGAATA
+AATTGGCTGGGGTACGAGGATTCGAACCTCGGAATGCCGGAATCAGAATCCGGTGCCTTACCGCTTGGCGATACCCCAACAAATTGGTTTTGAATTTGCC
+GAACATATTCGATACATTCAGAATTTGGTGGCTACGACGGGATTCGAACCTGTGACCCCATCATTATGAGTGATGTGCTCTAACCAACTGAGCTACGTAG
+CCAGATTGTTTCTTCGATGGCTGGGGTACCTGGATTCGAACCAGGGAATGCCGGTATCAAAACCGGTGCCTTACCGCTTGGCGATACCCCAATAACCGGG
+CGGTGAACCGCTTACTCGAAGAAGATGGCTGGGGTACCTGGATTCGAACCAGGGAATGCCGGTATCAAAACCGGTGCCTTACCGCTTGGCGATACCCCAT
+CCGTACAACGCTTTCTGGTGAATGGTGCGGGAGGCGAGACTTGAACTCGCACACCTTGCGGCGCCAGAACCTAAATCTGGTGCGTCTACCAATTTCGCCA
+CTCCCGCAAAAAGATGGTGGCTACGACGGGATTCGAACCTGTGACCCCATCATTATGAGTGATGTGCTCTAACCAACTGAGCTACGTAGCCATCTTTTTT
+CGCGATACCTTATCGGCGTTGCGGGGCGCATTATGCGTATAGAGCCTTGCAGCGTCAACCTCTTTTCAAGGAAAATTGCTCGAAAGTGACTGTTTGGTTA
+GGTTGCGAACAGCGTGGCGCTATATTCGTCAATTATTGTTTACTTTGTGTTTTTCCCACCCTACAGCCATTCTTTTGTCATACAGGATGAAATTCGGAAT
+TTAACAATAGTGGTGGGAAATTAATCTATGAAATACTGGCCTACAGTGATGAGTTGTCAAACAGTGATGTGGCAAACCCGGAACATTTCCTTACTGCATA
+TCAGAATCAACAAGCACCTCAATAACTGAAACAGCCCCGGATTTCACCGGGGCTGTTTCGCATTTCTTACTTATACGCCGACTGGTGAACACCAACCGCG
+CGACCAGACGGATCGTCCATTTTCTTGAACGCTTCATCCCATTCGATCGCTTTAGCGGAAGAACAAGCGACGGAAGGACCGCCCGGCACGCACTCAGCGG
+CGCTCGGAAGCGGGAATAGTTCTTCAAAGATCTCCCGATACAAGTACGCTTCTTTAGAGGTTGGCGTGTTGTACGGGAAGCGGAAGCGGGCAGTTTCCAG
+TTGCTGATCAGAAACCTGCTGCGCAGCCACTTCTTTCAGGGTGTCGATCCAACTGTAACCGACGCCATCGGAGAACTGCTCTTTCTGCCGCCAGGCCACG
+CTTGCAGGCAGATACGCTTCAAAACATTCACGCAGGATGTGTTTTTCCATTTTGCCGTTACCGCACATTTTATCCTGTGGGTTAATACGCATCGCCACAT
+CAAGGAATTTTTGTCGAGGAACGGAACGCGTGCTTCCACGCCCCAGGCTGACATCGCTTTGTTGGCACGCGCGCAGTCATACATATGCAGGGCCAGCAGT
+TTACGCACCGTCTCTTCATGCAGTTCTTTGGCATTCGGTGCTTTGTGGAAGTAAAGATAACCGCCGAACACTTCATCAGAACCTTCACCGGACAGCACCA
+TTTTAATGCCCATCGCCTTGATCTTACGCGACATTAAATACATCGGTGTTGAAGCGCGAATAGTGGTCACATCATAAGTTTCGATGTGGTAAATCACGTC
+GCGGATGGCATCCAGACCTTCCTGTACAGTGAAGTGAATTTCGTGATGCACCGTGCCCAGATGGTTTGCCACTTCCTGGGCTGCTTTCAGATCCGGTGAA
+CCCGGCAGACCTACAGCAAAGGAGTGTAACTGCGGCCACCAGGCTTCAGAGCGTTCCTGATCTTCCACGCGACGGGCTGCGTATTTCTTGGTGATAGCGG
+AAATAATTGAGGAATCCAGACCACCAGAAAGCAGCACACCGTAAGGCACATCAGACATCAGATGGCTTTTAACTGAATCTTCCAGTGCCTGACGCAGCTC
+GTTTTGTCGGTCACGTTATCTTTCACCGCATCGTAGTCGAACCAGTCGCGATGATAGTAAGAACGGATTTCGCCGTCCTGGCTCCACAAATAGCTCCCCG
+CCGGGAACTCTTTAATCGTGCGGCAAACTGGCACCAGCGCTTTCATTTCTGAGGCCACATACAGCTGACCGTGTTCGTCATACCCCATATACAGTGGGAT
+GATCCCCAGATGGTCGCGACCAATCAGGTAGGCATCTTTTTCGCTGTCGTACAGTGCAAAGGCAAACATGCCCTGCAAGTCGTCGAGAAATTCCGGCCCT
+TTTCCTGATACAGCGCGAGGATCACTTCACAGTCAGACCCGGTCTGGAACTGGTAACGATCGCCATATTCGGCGCGCAATGCCTGGTGGTTGTAGATTTC
+ACCGTTTACCGCCAGTACGTGGGTTTTGTTGGTTGTAGAGGTTGCGCCCCGCGTTAACGTCAACAATTGACAGACGTTCGTGGGCGAGAATGGCGTTATC
+GCTGGCATAAATACCGGACCAGTCCGGGCCACGATGACGCATCAGGCGTGACAGCTCGAGGGCTTTCTTACGCAGCTCAACTGCGTCTGTTTTGATATCG
+AATACGCCAAAATTGAACACATAACCTTCTCCGTTAACCTGGTATTTGTTGCTTGTTGTGTTTGCTTGTTTAAAAATGCCGCAAAGCAGCACTGTGCGCA
+AGCGATTTGGCGGTGAAAAATAAAAACGTAATGGTGATTGTCGATTGGTGAAAAAGGTCTGGTGTGAGGATATATTTATTGATGAATCGATAATTTTTAG
+CGGGTTTTATTGAATGTTTATATTTTACGGGGCCAAATTGCTGACAAAGTGCGATTTGTTCATGCCGGATGCGGCGTGAACGCCTTATCCGGCCTACAAA
+AGCATGAAAATTCAATATATTGCAGGAGCTGCGTAGGCCTGATAAGCGTAGCGCATCAGGCAGTTTGGCGTTTGTCATCAGAGCCAACCACGTCCGCAGA
+CGTGGTTGCTATTCAGATAACGTCGATTTCAGCGACTGACGGGTAAATCCAGCTGGGGCGGAAAGGCATACTGTCGATATCGTCGAGCGACGAAACACCA
+GAAAGCACCAGAATCGTCTCCAGACCTGCCTGGAAGCCGGCCAGAATATCGGTACGCAGGTTATCGCCGACAATCACCGTTTCTTCCGAATGCGCCTGCA
+TTTTGTTTAATGCTGCGCGGATGATCCACGGGCTGGGCTTACCAACATAGAACGGTTTGCGCCCGGAGATTTTCTCAATCCCTGCACACAACGCGCCACA
+AGCGGGATAAAACCGCGCCCGTGGGTGTCCGGATTGGTGGCGATAAAACGTGCACCGTTAGCGACGAAATAGGCTGCTTTATGCATCATGTCCCAGTTGT
+AGGAACGCGTTTCGCCAACAATCACGAAATCAGGGTTCACATCGGTAATAGTGAAACCGGCTTTGTACAGTTCATGAATCAGTGCGCCTTCGCCCACCAC
+ATACGCTTTCTTGCCTTCCTGGCGACGCAGGAAATCGGCAGTCGCCATCGCAGAGGTATAAAACACGCTGTCAGGTACATCGACACCTGCGGTGGCAAAG
+CGGTTCGCCAGATCTTGCCCAGTCTGCGAAGGATAGTTGGTCAGCAACACCAGCGGCAGGCCTTTATCCATAATCCCGTGCAAAATTCCGCTGCACCCGG
+TACGGCGACGTTATCGTGCATCAGCACGCCGTCGATATCGCAAATTACATTTTTAATGGTCATGGACTACCCAGAATATTGACAACAATAAGCGCCACTA
+TAAAAGCACATTAATTTTCCAGCAAATGCTGGAGCAAAATACCGTTGAGCATGGCGCGTTTTACCAGCGCAAAGCGCCGATTGCCGAGCGGTGATCCAGC
+TCAGAACGTACCACCGGCAGATTAGTGCGAAACGCCTTCAGCGCCTGGGTATTAATGCAGCTTTCAATAGCAGGGAGCAGCACTTTATCGGCTTCGGTGA
+TTTCACCGGCAATAACAATTTTTGCGGATTAAATAAGTTGATAGCAATGGCGATGGTTTTACCCAGATGACGACCGACATACTCAATTACTTCCGACGCC
+AGACTATCGCCTTTGTTCGCGGCTTTGCAGATAGTTTTGATGGTGCAGTCGTCCAGCGGCACGCGGCTCTGGTAGCCCTGCTTTAACAGATTCAACACCC
+GTTGTTCAATGGCAGCGTTGGCAGCGATAGTTTCCAGGCAGCCAAAGTTGCCGCAGTGGCAGCGTTCACCCAGCGGTTCGACCTGAATATGGCCAATTTC
+ACCGACGTTGCCGTTGCGGCCAATAAAAATGCGCCCGTTAGAGATAATCCCGGCCCCGGTTCCGCGATGGACACGCACCAGAATGGAGTCTTCGCAATCC
+TGACTTGCACCGAAGTAGTGCTCCGCCAGCGCCAGACTACGGATATCGTGACCAACGAAACAGGTCACTTTAAAACGTTCTTCCAGAGCTTCTACCAGCC
+CCCAGTTTTCTACCTGAATATGCGGCATGTAATGAATTTTGCCGCTGTCCGGGTCAACAAGCCCTGGCAGGATCACCGAAATCGCGATCAGCTCGCGCAG
+TTTGCGCTGGTAGCTATCAATAAACTGAGCAATGGCATTCAACAGGGCATGTTCCAGCGTTTGCTGGGTACGTTCCGGCAGCGGGTAATGTTCTTCTGCC
+AGCACTTTGCTGCTGAGATCAAACAGAGTGATGGTGGCGTCATGACGACCAAGCCGTACGCCGATTGCGTGGAAATTGCGGGTTTCGGTGACGATGGAGA
+TAGCGCGGCGGCCCCGGTGGAGGCCTGCTGATCAACTTCTTTGATCAGCCCGCGTTCGATAAGCTGACGCGTAATTTTGGTTACGCTGGCGGGGGCAAGC
+TGGCTTTGCTCGGCAATCTGAATCCGCGAGATTGGCCCGTACTGGTCAATCAGGCGATAAACCGCCGCGCTGTTAAGCTGTTTTACGAGATCAACATTAC
+CTATCTGAGCTTGTCCGCCTGGTGTCATACTTTCTCTTATTGAGTTACGACCTCGTTACCGTTAACGATGGTCTTGGTGATTTTAAAATCAGGTGTGAAT
+GCAGTCAGGTTGGCTACTTTACCTGCGGCGAGTGTGCCGAGACGTTTCTCAACGCCAATCGCACGCGCCGGATAGAGCGTCGCCATACGTAGCACTTCAT
+CCAGTGCGATACCGCAATGTTCGACCAGATTACGCACGCCTTCAATCATGGTTAAGGATGAACCGCTTAACGTACCGTTCTCATCCACACAAAGTCCGTT
+ACGGTAGTATATTGTTTTACCCGCAAAATGAACTGTTCAATGTTGGCACCTGCTGGCGCGGTGGCGTCAGTAACCAGACACAGTTTGTCGCCTTTCAGAC
+GTTTAGCGTTGCGAATGTTGGCGTAATCAACATGCAGGCCATCAGCAATAATACCGCAATAAATGTCAGCTTCGTCGAGGATCGCGCCCGCCAGGCCAGG
+TTCACGACCGGTAATATACGGCATCGCGTTGTACAGATGGGTGGCAAAGGTAATCCCCGCGCGGAAACCGGCTTTTGCTTCTTTCAACGTCGCGTTGGAG
+TGACCGGCAGAAACCACAATCCCGGCATTTGCCAGTTTGCTGATGACTTCCGCAGGAACCATTTCCGGTGCCAGGGTCACTTTGGTAATGACGTCGGCGT
+TTTCACACAGGAAATCGACCAGCGCGGCATCAGGCTTACGCACAAAATTCGGATTATGGGTGCCTTTTTACCAGATTCAGCCACGGACCTTCCAGATGCA
+GACCTAACGCCTGATTCGGATGTTTTGCCAGGTACTCGCGCATAACGCGCACGCCCTGTTTCATCAGCTCATCGCTGGTGGTGATAAGCGTCGGCAGATA
+GTTAGTACAGCCTGATTTCTCATTGGCTTTCTGCATGATTTCCAGCGTTTCCACGCTGACCGCTTCAGCGGTGTCGTTAAACTGTACGCCGCCGCAGCCG
+TTTAACTGCACATCGATAAAACCGGGGAGAGAATGGCCCCGTTCAGTGAACGTTGTTCGATCTCTGGCGGCAGTTCCGCTACCGGACAGACGCTTTTAAT
+CAGGCCATCAGCGATAACAACCGCGTGGTCATCAAGAAATTCGTGGCCGGTAAAGATCCGGCCCTGGGTTAATGCATACATTCTGACCCCCGATTTTAAA
+AATATTGCCCTGAGCAAGGAGCCAGGGCAGGGATAACAATTACAGACCTTTGATATTTTCTGCTTCTAATTCATTGAAATATCTTAAAGTCTTAACTTTC
+AGCTCCATGGTGGAAGGTTCATCGCACACCATGATCGCTTTCGGATGCAGTTGCAGACAGCTGATGGTCCACATATGGTTCACGCAACCTTCAACGGCGG
+CCTGCAGCGCCAGTGCTTTCTGGCTACCCAGCACCAGAATCATCACTTCTTCGGCATCCAGCAGTGTACCAACACCGACAGTCAGGGCATATTTTGGCAC
+CTGATTAACATCGTTATCAAAGAAACGAGAGTTTGCGACGCGAGTGTCATGAGTCAGGGTTTTGATACGAGTACGAGAAGCCAGAAGACGCCGGTTCGTT
+AAATGCAATATGACCGTCGTTACCTACACCGCCCATAAACAGATGAATTTTTCCGTAAGAACGGATTTTTCTTCATACTGGCGGCACTCGGCGTCGATAT
+CCGGGGCGTTGCCGTTGAGAAGGTTGATGTTTTCTGCTGGAATATCAACGTGATCGAAGAAATTACGGTGCATAAAGCTGTAGTAGCTTTCCGGATGCTC
+TTTCGGCAGACCGACATATTCGTCCATGTTGAAGGTGACAACGTGCTTAAAGCTGACCTGGCCTGCTTTATGCATTTCGACTAACGCTTTATAGGTGGTC
+ATCGGCGTGCCGCCAGTCGGCAGGCCCAGTACAAACGGACGATCGGCAGTCGGTTTGAACGCATTGATACGATTGACGATATGGCGAGCAGCCCATTTGC
+CGACCTGTTCAGCGGTAGTCAGGGGATCAGTCTCATTATTCACCTCAATAAGTAAAATGTAAGCCGTTGGCGGATTAGGCATCTTTAAGCGTAACCTGGA
+TTTGCGCAGACAGGCGTCAATCCGACCTGATTTTGAATGATAAAATAAGTTTTCTGGTTTAGCCAGTAAAGGGAGTGATAATAACGATATTTGGTGACAA
+AACTCACAAAGACACGCGTTTAATTTGCGATACGAATTAAATTTTCACACACTCTGTAGCAGATGATCTAACAATCTGATTACAGAACATCGGCAGTACA
+ATTTGCAGCAAAATAAAAATACGGCTTGAAACGAGCCAAATAGGGTTCTCGTAGGGGAATAAGATGAATATTTTAGGTTTTTCCAGCGACTCGGTAGGGC
+GTTACAGCTCCCTATCGCGGTGCTGCCGGTGGCGGCACTGTTGCTGCGATTCGGTCAGCCAGATTTACTTAACGTTGCGTTTATTGCCCAGGCGGGCGGT
+GCGATTTTGATAACCTCGCATTAATCTTCGCCATCGGTGTGGCATCCAGCTGGTCGAAAGACAGCGCTGGTGCGGCGGCGCTGGCGGGTGCGGTAGGTTA
+CTTTGTGTTAACCAAAGCGATGGTGACCATCAACCCAGAAATTAACATGGGTGTACTGGCGGGTATCATTACCGGTCTGGTTGGTGGCGCAGCCTATAAC
+CGTTGGTCCGATATTAAACTGCCGGACTTCCTGAGCTTCTTCGGCGGCAAACGCTTTGTGCCGATTGCCACCGGATTCTTCTGCCTGGTGCTGGCGGCCA
+TTTTGGTTACGTCTGGCCGCCGGTACAGCACGCTATCCATGCAGGCGGCGAGTGGATCGTTTCTGCGGGCGCGCTGGGTTCCGGTATCTTTGGTTTCATC
+AACCGTCTGCTGATCCCAACCGGTCTGCATCAGGTACTGAACACCATCGCCTGGTTCCAGATTGGTGAATTCACCAACGCGGCGGGTACGGTTTTCCACG
+GTGACATTAACCGCTTCTATGCCGGTGACGGCACCGCGGGATGTTCATGTCCGGCTTCTTCCCGATCATGATGTTCGGTCTGCCGGGTGCGGCGCTGGCG
+ATGTACTTCGCAGCACCGAAAGAGCGTCGTCCGATGGTTGGCGGTATGCTGCTTTCTGTTGCTGTTACTGCGTTCCTGACCGGTGTGACTGAGCCGCTGG
+AATTCCTGTTCATGTTCCTTGCTCCGCTGCTGTACCTCCTGCACGCACTGCTGACCGGTATCAGCCTGTTTGTGGCAACGCTGCTGGGTATCCACGCGGG
+CTTCTCTTTCTCTGCGGGGCTATCGACTACGCGTTGATGTATAACCTGCCGGCCGCCAGCCAGAACGTCTGGATGCTGCTGGTGATGGGCGTTATCTTCT
+TCGCTATCTACTTCGTGGTGTTCAGTTTGGTTATCCGCATGTTCAACCTGAAAACGCCGGGTCGTGAAGATAAAGAAGACGAGATCGTTACTGAAGAAGC
+CAACAGCAACACTGAAGAAGGTCTGACTCAACTGGCAACCAACTATATTGCTGCGGTTGGCGGCACTGACAACCTGAAAGCGATTGACGCCTGTATCACC
+CGTCTGCGCCTTACAGTGGCTGACTCTGCCCGCGTTAACGATACGATGTGTAAACGTCTGGGTGCTTCTGGGGTAGTGAAACTGAACAAACAGACTATTC
+AGGTGATTGTTGGCGCGAAAGCAGAATCCATCGGCGATGCGATGAAGAAAGTCGTTGCCCGTGGTCCGGTAGCCGCTGCGTCAGCTGAAGCAACTCCGGC
+AACTGCCGCGCCTGTAGCAAAACCGCAGGCTGTACCAAACGCGGTATCTATCGCGGAGCTGGTATCGCCGATTACCGGTGATGTCGTGGCACTGGATCAG
+GTTCCTGACGAAGCATTCGCCAGCAAAGCGGTGGGTGACGGTGTGGCGGTGAAACCGACAGATAAAATCGTCGTATCACCAGCCGCAGGGACAATCGTGA
+AAATCTTCAACACCAACCACGCGTTCTGCCTGGAAACCGAAAAGGCGCGGAGATCGTCGTCCATATGGGTATCGACACCGTAGCGCTGGAAGGTAAAGGC
+TTTAAACGTCTGGTGGAAGAGGGTGCGCAGGTAAGCGCAGGGCAACCGATTCTGGAAATGGATCTGGATTACCTGAACGCTAACGCCCGCTCGATGATTA
+GCCCGGTGGTTTGCAGCAATATCGACGATTTCAGTGGCTTGATCATTAAAGCTCAGGGCCATATTGTGGCGGGTCAAACACCGCTGTATGAAATCAAAAG
+TAATCTGCTTTATGCCTGATGCGACGCTTGAGCGTCGCATCCAACAATGACAAGCGGTGGAGATCTTCTCTGCCGCTTTTTCATCAATCATCCCCATAAT
+CCTTGTTAGATTATCAATTTTAAAAACTAACAGTTGTCAGCCTGTCCCGCTTATAAGATCATACGCCGTTATACGTTGTTTACGCTTTGAGGAATCCACG
+ATGAGTGAGGCAGAAGCCCGCCCGACTAACTTTATCCGTCAGATCATCGATGAAGATCTGGCCAGTGGTAAGCACACCACAGTACACACCCGTTTCCCGC
+CGGAGCCGAATGGCTATCTGCATATTGGCCATGCGAAATCTATCTGCCTGAACTTCGGGATCGCCCAGGACTATAAAGGCCAGTGCAACCTGCGTTTCGA
+CGACACTAACCCGGTAAAAGAAGATATCGAGTATGTTGAGTCGATCAAAACGACGTAGAGTGGTTAGGTTTTCACTGGTCTGGTAACGTCCGTTACTCCT
+CCGATTATTTTGATCAGCTCCACGCCTATGCGATCGAACTGATCAATAAAGGCCTGGCGTACGTTGATGAACTGACGCCGGAACAGATCCGCGAATACCG
+CGGCACCCTGACGCAACCGGGTAAAACAGCCCGTACCGCGACCGCAGCGTTGAAGAGAACCTGGCGCTGTTCGAAAAATGCGTGCCGGTGGTTTTGAAGA
+AGGTAAAGCCTGCCTGCGTGCGAAAATCGACATGGCTTCACCGTTTATCGTGATGCGCGATCCGGTGCTGTACCGTATTAAATTTGCTGAACACCACCAG
+ACTGGCAACAAGTGGTGCATCTACCCGATGTACGACTTCACCCACTGCATCAGCGATGCCCTGGAAGGTATTACGCACTCTCTGTGTACGCTTGAGTTCC
+AGGACAACCGTCGTCTGTACGACTGGGTACTGGACAACATCACGATTCCTGTTCACCCGCGCCAGTATGAGTTCTCGCGCCTGAATCTGGAATACACCGT
+GATGTCAAGCGTAAGTTGAACCTGCTGGTGACCGACAAGCACGTTGAAGGCTGGGATGACCCGCGTATGCCGACCATTTCCGGTCTGCGTCGTCGTGGTT
+ACACTGCGGCTTCTATTCGTGAGTTCTGCAAACGCATCGGCGTGACCAAGCAGGACAACACCATTGAGATGGCGTCGCTGGAATCCTGCATCCGTGAAGA
+TCTCAACGAAAATGCGCCGCGCGCAATGGCGGTTATCGATCCGGTGAAACTGGTTATCGAAAACTATCAGGGCGAAGGCGAAATGGTTACCATGCCGAAC
+CATCCGAACAAACCGGAAATGGGCAGCCGTCAGGTGCCGTTTAGCGGTGAGATTTGGATTGATCGCGCCGATTTCCGCGAAGAAGCTAACAAGCAGTACA
+AACGTCTGGTGCTGGGTAAAGAAGTGCGTCTGCGTAATGCTTATGTGATTAAGGCAGAACGCGTCGAGAAAGATGCCGAAGGTAATATCACCACCATCTT
+CTGTACTTATGACGCCGATACCTTAAGCAAAGATCCGGCAGATGGTCGTAAAGTCAAAGGTGTTATTCACTGGGTGAGCGCGGCACATGCGCTGCCGGTT
+GAAATCCGTTTGTATGACCGTCTGTTCAGCGTGCCTAACCCAGGTGCTGCGGATGATTTCCTGTCGGTGATTAACCCGGAATCGCTGGTGATCAAACAGG
+GCTTTGCTGAACCGTCGCTGAAAGATGCGGTTGCGGGTAAAGCATTCCAGTTTGAGCGTGAAGGTTACTTCTGCCTCGATAGCCGCCATTCTACGGCGGA
+AAAACCGGTATTTAACCGCACCGTTGGGCTGCGTGATACCTGGGCGAAAGTAGGCGAGTAATTTTAAGTTTCGCTATGCCGGATGGGGCGTTTACGTCGC
+ATCCGGCAAGGAACAGAACAGTTTCAAACGCTAAATTGCCTGATGCGCTACGCTTATCAGGCCTACATGATCTCTGCAATATATTGAGTTTGCGTGCTTT
+TGTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCAAGAAACAACAAACAATCCAAAACGCCGCGTTCAGCGGCGTTTTTCTGCTTTCTTCGCGAATTAA
+TTCCGCTTCGCAATTTATCCATAAAATAAATTTAAAATAACAAAACATAATTAAATAAAATGTAACCGCTTTCATCTTGCTGGAATTTCACGCTTTTATT
+CTTCTGCAAGCCTTTCAACCGCAAACTTAAGCCTTGTAACAAAATCATCAAAATATGTGCGGTTGCTCATGTTCTTACATTCTGGTTACAGAAAGAGATT
+GATAATTCGCGTCGCGAAAAATAGTCTGTTCCTGTAGTCAGCGAGACTTTTCTCAACGCTACTTTTTAATTTTTATTTTTCGCTGTTCACCTTTGGTGCA
+GCAATTTATACGTCAAAGAGGATTAACCCATGCGTACGTTTAGTGGCAAACGTAGTACGCTGGCGCTGGCTATCGCCGGTGTTACAGCAATGTCGGGCTT
+TATGGCAATGCCGGAGGCTCGCGCCGAAGGATTCATCGACGATTCAACCTTAACCGGCGGTATCTATTACTGGCAGCGTGAACGCGACCGTAAAGATGTT
+ACCGACGGCGACAAATACAAAACCAACCTTTCTCACTCCACCTGGAATGCCAACCTCGATTTTCAGTCCGGTTATGCTGCTGATATGTTCGGCCTTGATA
+TTGCTGCGTTTACGGCGATTGAAATGGCGGAAAACGGCGACAGCTCCCACCCGAACGAAATCGCGTTTTCAAAAGTAATAAAGCCTATGACGAAGACTGG
+TCCGGCGACAAAAGCGGTATAAGCCTGTATAAAGCTGCGGCCAAATTTAAATACGGTCCGGTTTGGGCGAGGGCAGGTTACATTCAGCCAACTGGTCAAA
+CGCTGTTAGCGCCGCACTGGAGCTTTATGCCAGGTACTTATCAGGGGCGGAAGCCGGGGCGAATTTTGATTACGGCGATGCTGGTGCGTTGAGTTTCTCC
+TACATGTGGACCAACGAATACAAAGCGCCGTGGCATCTGGAAATGGATGAGTTTTATCAGAACGATAAAACCACCAAAGTTGATTATCTGCACTCCTTTG
+GGGCGAAATACGACTTCAAAAATAACTTCGTACTGGAAGCGGCATTTGGTCAGGCGGAAGGGTATATCGATCAATATTTTGCCAAAGCCAGCTACAAATT
+TGATATCGCCGGTAGCCCGTTAACCACCAGCTACCAGTTCTACGGTACCCGAGATAAAGTTGACGATCGCAGCGTCAACGACCTTTATGACGGCACCGCC
+TGGCTGCAAGCGTTGACCTTTGGTTACCGGGCGGCTGACGTAGTGGATTTGCGCCTCGAAGGCACCTGGGTTAAGGCTGACGGTCAGCAGGGATACTTCC
+TGCAACGTATGACTCCAACCTACGCTTCCTCAAACGGTCGCCTGGATATCTGGTGGGATAACCGTTCTGACTTCAACGCCAACGGCGAAAAGCGGTCTTC
+TTCGGTGCGATGTATGACCTGAAAACTGGAATCTTCCAGGCTTCGCCATCGGCGCTTCCTACGTTTACGCATGGGATGCTAAACCTGCGACCTGGCAGAG
+CAATCCGGATGCGTACTACGACAAAACCGGACTATTGAAGAGTCTGCCTACAGCCTGGATGCGGTCTATACCATTCAGGACGGTCGCGCCAAAGGCACGA
+TGTTCAAACTGCATTTCACCGAATACGACAACCACTCCGACATCCCAAGCTGGGGCGGTGGTTACGGCAACATCTTCCAGGATGAGCGTGACGTGAAATT
+TATGGTAATCGCACCATTCACCATCTTCTGATGCCCGACGCGGCAGGTTTTGTGCCTGCCGCACGTTTGAGGAATTTGCTATGAAAAACTGATTCTCATC
+GCCATAATGGCATCGGGGCTGGTAGCTTGTGCGCAATCAACCGCGCCACAGGAAGACAGTCGTCTGAAAGAGGCATACAGCGCCTGTATCAACACCGCAC
+AAGGTTCGCCAGAAAAATTGAAGCCTGCCAGAGCGTGTTAAACGTGCTGAAGAAAGAGAAACAACATCAGCAGTTTGCCGACCAGGAAAGTGTACGCGTA
+CTGGATTATCAGCAGTGTCTGCGTGCAACGCAAACCGGAAATGATCAGGCGGTGAAAGCCGATTGTGATAAAGTCTGGCAGGAAATACGCAGTAATAACA
+AATAAGTGAGAGCTGTAACTCTCGCTTTTCTTATTTCCTTGCATAAAAAGCCAACCCGCAGGTTGGCTTTTCTCGTTCAGGCTGGCTTATTTGCCTTCGT
+GCGCATGTTCATCTTCGCGGCAATCGCCTTCGGCACAGTGACCGTAAAGATAGAGACTGTGGTTAGTCAGGCGAATGCCATGTTTTGCGGCAATTTCACG
+CTGACGCGCTTCGATGGAATCATCACTAAATTCGATAACCTTGCCGCAGTCGAGGCAGATCAGGTGATCGTGGTGATGTTGCTGTGTCAGTTCAAATACG
+GATTTACCGCCTTCAAAATTGTGGCGGGTGACGATACCAGCGTCGTCAAACTGGTTCAGTACGCGATATACCGTAGCCAGACCAATTTCTTCACCCATAT
+CGATCAGACGTTTGTATAAATCTTCCGCACTGACGTGATGGTTGTCCGGCTCCTGAAGAACTTCCAGGATTTTTAAACGAGGAAGCGTTACTTTCAGGCC
+AGCTTTCTTTAGGGCGGTATTGTTATCAGTCATGCGGAATCTGTCCTGTTACTAAGCGGTTCACTTCATTAGAAGAAGTGACAGAATTTGCTCTTGAGAT
+AATGCGTATCATTATAGAATTGCCACGCCTAAATGAAAACCACAAGTCCCTGGCAAATATTGTTAATAAAAACGTGGCACAGCTTACATTTACAACGGCA
+AGGCCACTTGAACACCGGGACATTGTACAGGTACAACAGCAAAAGTTACAAATTTGTAGCAATTATTTTGATTGGCATTATCTATTAATACGGCGTAGAC
+ATGAGTCTACGCCGCATCACATCAGGCATTGAGAATTTCGTCGAGATGCAACTCTTCAGAAATCTGTTTAACCCATTTTTCTACACGTTCAGCGGTCAGT
+TCCGGCTGACGGTCTTCGTCGATAGCCAGACCGACAAAGTGGTCGTCATCTGCCAGACCTTTTGATGCTTCGAAATGATAGCCCGCAGTTGGCCAGTGAC
+CAACGATGGTTGCACCGCGCGGTTCAATGATGTCGCGGATGGTGCCCAATGCGTCGCAGAAATATTCGGCGTAATCTTCCTGGTCACCACAACCAAACAG
+CGCAACCAGTTTGCCGTTGAAATCAATCTCTTCGAGAGTCGGGAAGAAGTCATCCCAGTCACACTGCGCTTCGCCGTAATACCAGGTTGGGATGCCCAGC
+AGCAGAATGTCATAAGCTTCCAGATCTTCTTTGCTGCTTTTGCAATGTCATGGACATCGGCAACGTCTTTACCAAGCTGTTTTGAATCATTTTTGCGATA
+TTTTCGGTATTACCGGTGTCGCTGCCGAAAAAGATGCCAGTGATAGCCATGAGTGAAATAACCTCTTGAAACTTATTGAAATGGGGTGGAAAATTGCCCA
+CGGATAAAGGCAATCATAGCAGAACAGGCAGTCTTGCGGAATCAGCAAACGAGCAGGACTGCACACTGTGCTACATGAAAGTGGAAATTTAAACGATGCC
+CTGACTACGCAGCGCCGCCAGTTGCTGCATTAACATCTCTTCGATCAGTTCGCTACGGCTCATATTGCGCGACTCCGCCAGCTCGTTCAGCGCCTCGACA
+GCTTCCGCGTTCAGCTTCAGTTCGACACGCTTAAGGCCACGTACTTTGTCGCGTTTTAGCTGGTTGCGTTTATTAATACGCAGCTGTTCATCGCGCGAAA
+GCGGATTAGTTTTCGGTCGTCCCGGTCGACGCTCGTGCGCGAACAGATCTAATGTCGTACGGTCCGTTTGTTCTTTGGCCATGATCTTGGTGACTTCGGG
+GAAACAATCAGCCAGGCCTCTGCCCGGATGGATAGCGCGCCATAATACATCAGCGCGATGAGTCACGCCAACGCCCACGCGCGGAAAGCGACGCGGACGC
+TGGGTTTTAATCAGTTGCGTTAATCATTGAGATAGCGACGGATAGCGCGTAATACCGCATCCGGTTTTCAGCATGGACCCAGTGACCCGCGCCTGCAATC
+ACATGCGCCCGTGCCTGTGGAAATTGAGCCAGTAAATCATCACGGTACTGCTCGCTAACATACGGAGAATTGCCGCCAGGGATAAACAGGGCAGGGTGAT
+CCCATGCCGGGATTTTCTCCCAACCTACAATATGCGGATACTGATCCCACAATACCGGCACGTTAAAGCGCCACTCCCCGTCAACAAAAGATTTCAGCAG
+AAACTGAATCACCCTTCTTCATTAAGATGCTGGCGCATTATTGCTGCTGCTTGCTGGCGAGTTTGTGCGTCCGATTCACTGACCGCGTTGATAGCCGCAA
+AATCTCATCATGACGGCGTACGTGATAGTCGACCGGCGCGATATCGATCGCCACCAGTTTATCGATGCGATCGGAGGCTAGTGCAGTAAGTGCCATTACC
+GCTTTACCGCCCATGGAGTGACCGATAAATGTTGCTTTGTCGATCTGCTGTGCATCCAGAGTATCAACAAGATCCTGCGCCATCGCCGGGTAATTCATTA
+CCGGATCTCTCGGTGAAAGACCGTGGTTACGCATATCAACCTGGATGATATTGTGATCGTTTACCAGATCGCGAGCCAGTACGCCAAGGTTGTCGAGGCT
+GCCAAACAGACCGTGGACAAGAACGATGGGAGAATTATTGTGCTGGTTTTGTGCAGTTTGCGCGCGGATATTCAATTTCATGGCAAAGTTCTTTTTCGCG
+TTGTCGGGTTAGGGTATTATGTTGACCATTGTGCCACAGGGCTGCAACAAATAAGGTTTATTCCGAGTTTTTCTGCAAGCCAGGCTTGACGCTATCCGCT
+GCCGGGATTTATTCATATACTCCTGGCGACTTGTATTCAGCTAAGACACTGCACTGGATTAAGATGAAAACGATTGAAGTTGATGATGAACTCTACAGCT
+ATATTGCCAGCCACACTAAGCATATCGGCGAGAGCGCATCCGACATTTTACGGCGTATGTTGAAATTTTCCGCCGCATCACAGCCTGCTGCTCCGGTGAC
+GAAAGAGGTTCGCGTTGCGTCACCTGCTATCGTCGAAGCGAAGCCGGTCAAAACGATTAAAGACAAGGTTCGCGCAATGCGTGAACTTCTGCTTTCGGAT
+GAATACGCAGAGCAAAAGCGAGCGGTCAATCGCTTTATGCTGCTGTTGTCTACACTATATTCTCTTGACGCCCAGGCGTTTGCCGAAGCAACGGAATCGT
+TGCACGGTCGTACACGCGTTTACTTTGCGGCAGATGAACAAACGCTGCTGAAAAATGGTAATCAGACCAAGCCGAAACATGTGCCAGGCACGCCGTATTG
+GGTGATCACCAACACCAACACCGGCCGTAAATGCAGCATGATCGAACACATCATGCAGTCGATGCAATTCCCGGCGGAATTGATTGAGAAGGTTTGCGGA
+ACTATCTAAAACGTTGCAGACAAAGGACAAAGCAATGGCAATCCACAATCGTGCAGGCCAACCTGCACAACAGAGTGATTTGATTAACGTCGCCCAACTG
+ACGGCGCAATATTATGTACTGAAACCAGAAGCAGGGAATGCGGAGCACGCGGTGAAATTCGGTACTTCCGGTCACCGTGGCAGTGCAGCGCGCCACAGCT
+TTAACGAGCCGCACATTCTGGCGATCGCTCAGGCAATTGCTGAAGAACGTGCGAAAAACGGCATCACTGGCCCTTGCTATGTGGGTAAAGATACTCACGC
+CCTGTCCGAACCTGCATTCATTTCCGTTCTGGAAGTGCTGGCAGCGAACGGCGTTGATGTCATTGTGCAGGAAAACAATGGCTTCACCCCGACGCCTGCC
+GTTTCCAATGCCATCCTGGTTCACAATAAAAAGGTGGCCCGCTGGCAGACGGTATCGTGATTACACCGTCCCATAACCCGCCGGAAGATGGTGGAATCAA
+ATACAATCCGCCAAATGGTGGCCCGGCTGATACCAACGTCACTAAAGTGGTGGAAGACAGGGCCAACGCACTGCTGGCCGATGGCCTGAAAGGCGTGAAG
+CGTATCTCCTCGACGAAGCGATGGCATCCGGTCATGTGAAAGAGCAGGATCTGGTGCAGCCGTTCGTGGAAGGTCTGGCCGATATCGTTGATATGGCCGC
+GATTCAGAAAGCGGGCCTGACGCTGGGCGTTGATCCGCTGGGCGGTTCCGGTATCGAATACTGGAAGCGTATTGGCGAGTATTACAACCTCAACCTGACT
+ATCGTTAACGATCAGGTCGATCAAACCTTCCGCTTTATGCACCTTGATAAAGACGGCGCGATCCGTATGGACTGCTCCTCCGAGTGTGCGATGGCGGGCC
+TGCTGGCACTGCGTGATAAGTTCGATCTGGCGTTTGCTAACGACCCGGATTATGACCGTCACGGTATCGTCACTCCGGCAGGTTTGATGAATCCGAACCA
+CTACCTGGCGGTGGCAATCAATTACCTGTTCCAGCATCGTCCGCAGTGGGGCAAAGATGTTGCCGTCGGTAAAACGCTGGTTTCATCTGCGATGATCGAC
+CGTGTGGTCAACGACTTGGGCCGTAAACTGGTAGAAGTCCCGGTAGGTTTCAAATGGTTTGTCGATGGTCTGTTCGACGGCAGCTTCGGCTTTGGCGGCG
+AAGAGAGTGCAGGGCTTCCTTCCTGCGTTTCGACGGCACGCCGTGGTCCACCGACAAAGACGGCATCATCATGTGTCTGCTGGCGGCGGAAATCACCGCT
+GTCACCGGTAAGAACCCGCAGGAACACTACAACGAACTGGCAAAACGCTTTGGTGCGCCGAGCTACAACCGTTTGCAGGCAGCTGCGACTTCCGCACAAA
+AGCGGCGCTGTCTAAGCTGTCTCCGGAAATGGTGAGCGCCAGCACCCTGGCAGGTGACCCGATCACCGCGCGCCTGACTGCTGCTCCGGGCAACGGTGCT
+TCTATTGGCGGTCTGAAAGTGATGACTGACAACGGCTGGTTCGCCGCGCGTCCGTCAGGCACGGAAGACGCATATAAGATCTACTGCGAAAGCTTCCTCG
+GTGAAGAACATCGCAAGCAGATTGAGAAAGAAGCGGTTGAGATTGTTAGCGAAGTTCTGAAAAACGCATTTAATAAAAAAGGGCGGTCGCAAGATCGCCC
+TTTTTACGTATGACAAACACAGAATTGCCTGATGCGCTACGCTTATCAGGCCTACGAGGATGGTGCAATATATTGAATTTAAGCGATTTTGTAGGCCGGA
+TAAGGCGTTCACGCCGCATCCGGCAAAACAACGAACACTTTGTCAACAAACTGAGTAGCTCAAGGAAATCCCAATGAAGACCAACAGGAGTCTGGTCGTC
+ATAGTGTCACTAATTACCGCCACATTACTGCTGACTGCATGCGCCCAACCTGAACAATCATCATTAGCTGGCGACTGGTTACTGACCCTAAAGATAAAAC
+CAGAGGATTAACGGGTAGCATTGCGGTAAATATTGCACCTTTCCGGTGTAAGACAAATTGCCGTGGTGATAACTTACCTGATAATACCCGCCGCTGGCAG
+TTGTCAGGCGGGAACGAAAAGAACTTACTTATCTTCATAATATGTCAGCACAAGAAAGGTCGGTTTAAATCCCGGTTGGCAATGCTACACCTCATTTTTA
+TGCGGGTTTGCCAGGGCAAGCCCGGCACTCGACCGATAGTCAATGAGGATTATGTCAGCGAAAGCGGATTTTTGGCTCGATGATGCATGTCGGGATTATT
+GAGTTACGACGCTGCCAGTCAGAAAATTGCCAGCAAGAATTGAAAGCGATAAATACACATTAAAATAGTGAGTCCGGGAATGAAACCCGGACCTGAACAT
+GTCTTATTGCGTGAATGTTTCTTTCATTTGATACTGCATTTCCCAGAGTTCAGTAAGCGAAATAACTTTTCTTGTTCTTGCTTCTTCACTTTGTACCCAT
+AAGAAAGGGTAGAACGTGAAGGCTTCCGTTGCCGATAATTTTATTACGTCTTCTCGCCATTGCTGCCATCGTACATTTTCATAGAAGGTATCTAAATCAC
+CGGATAATGCCCACTGAAGAAACTCAGAATATCCAACTTCCAGACTTTCCCAATTCAGCGTATCTGGCGCAAAATAATAAACGCAGCCAGTATCTTCCCC
+AAGATCGCCACCATTAAGAGCAAAATTACCCCTGCGACATCGTCAGCGATGGGTAAAGCCCGCACGCCTGCGAATTCAGGGCGTTGTGTCCAACTTACTG
+GATCTCGTGGCAACCGGGGTGACCAGATCCTGCTATGCGTAACTAACCATTATCAATCAGCAGACCTCCGGAGCCATAGACAAGCGCACCCATCGGTGAT
+TTTGTTGTCACCTGTAATTGATAAAGTGCGGTTTCGGCTAAATCTTTATTAACCGGTAAGAGTTCGGTATGGTTTGTGGCGTCTTTTAACCAGTTCTGGA
+TTATTGGCCAGGCTGAATCTTCAGTATTTACTAACTGATTCATTTCACGCATCGCTACTTGCTCCTTGTGTGCTACGGTGTCATTTATGATGAGGAATTG
+TATGGAACATTTTTAAATATTAAGTTCCTTATATTTGAATAAAAATGACTTTATCCATACATTGCCACTTTTTCAAAGCATAAACCGATACCCAATACCG
+GTTTCAGTAATAAAATGGCGAGGCCGGGCCGGATCCTGTTCCAGTTTTTGTCGCAGATGCCCCATATAATTACGCAAATAGTTGCTGTGTTCGATCGCGT
+TTAGACCCTACATCTGCCGGATGCGGCATAAATAACGAACTATTTGCCAACAAACAGAAAGGGCGATCATTCAATCGCCCTTTTTACTTTGTTTTATTAA
+CCGTGTTTATTTTTCAGTTCAAAGCGTGGTGATACCAGACCATACAGTGTCCAACCAAGGAAGGTCACGATGGAACCGTACAGCATGGCTTCTTCCCCGG
+ATGAGTACAGCGCATAAAAGCTATACATCGCGCCAACAAAAGCAACAAAGTTTGCAACTTTCGCTTTTGAGGGGGCACATTAGCGACCTTCTGAATAATG
+ACTAATGCCGCCATTGACAGAATATACGGAATGATATTGGTCACCACGGCCAGGTTAACCAGCACGTTGAACTGACTGTTTAGCGACGGGCTAATGGTCA
+TCAGTGCCAATCCACTCTGAATAATCACAATGGTCAACATTCCCTGCACCGGTGCATCCACTTTGGTTACACGGGAGAAAATTTTAGGAAGTAGCCTTCA
+TCAGATGAAGATTTAAACACCTGGGCAATGGTGAACTGCCAGCCAAGTAGCGAACCGCAGCAGGACATCACCATCAGCGCCATAATGACTTTACCCACTT
+CCGGCGTGAACATCTGCGCGAAGGCCAGACCAAATGGTGCCGTTGAATTTGCCAGCTCCATATTTGGCACAATCCCGGCAATCACGTTGGTGGAGACGAT
+ATAAATCACCGCCGCACCTAACGTACCGCCGAGTACCGCGATTGGCACATTACGTTCCGGGTTTTCCACTACATCAGTATTCGCACACGCAGACTCCAGA
+CCAAGAAAAGCCCACAGCGTCATAGCGATGGAAGAACCTACCGCACTGAAGAACGGTGCATGATGCGGATTCCAGGAATCAACGTACAGCGTCGGGCTAA
+ACCAGAACCAGCCAATAATGCACAGACCGACGACCGGAATAATGACCCCACACGGTAATGCTACTGATTTGCCCGGTAATGCGCGCACCACCAAAGTTAG
+CCACGGTACAAATCCACAGCACCCCGATGGTCGCAAGACCAATCTGCACTGGCGACAAACTCGCGCCGAGCAGTTCGGTGCCGTAACCAACCGCCGAAAT
+AGCAATCGCGACGTTAGCAATCAGCAGTGAGACGCCGTAGGTATAGTTCGCCATAAAGTTACCGGATTTACCGAAAGCATACTCGGCATAACCGCCCATA
+CCGCCTGATTTACGGCTGAACATACCGCATTTTGCGAATGCCCATGCCAGTGCCATTGAGCCTACGGCTGTCACCAGCCAGGAGATAATTGAGATTGTCC
+CGACTTCGGCAAGCTTTGTCGGCAGCATGATGATACCGGAGCCCATCATGTTGACCATCGTCAGTATGGTTAACTGAACGACGCCCATTTTGTTCGATTT
+AGCCTGACTCATAATTTTTCCCTTTCAACAGGGTGCTTTGCGCATCACGAGGCTTGATGACATAGCACCAAACTTGCTTACGACCATCATGTTCTTCGAT
+ATAGACACCCTGCAGCTCCGGTGCAAAACCTGGCAGCAGGTTGATCCCTTCTTCCAGAGCGCTGAAGTAACGCAGAACAGCACCACCCCAGATTTCACCC
+GGAACAACACACAGCACACCCGGAGGATAAGGAAGCGCACCTTCGGCAGCGATACGGCCTTCTGCATCCGGCAGACGAACCAGTTCCACTTCACCGCGTA
+AATAGGCGTAGTTGGCTTCTTGCGGATTCATGCTGACGCGTGGGAAGTGCTCCTTACGGAACATCTCTTTTTGCAGTTGTTTCACGTTGTGGCGGGCATA
+CAAATCATGCATTTCCTGACACAACTGACGCAGGGTATAACCGGCGTAGCGCTCTTCATGCTGTTTGTAGATGGAAGGTAGCACTTCTGCTAATGGCGCG
+TCGGACTCAAGCAGTTTTTCGAAGCGTACCAGCAGGGCAACAAGTTGCTGAAGTTTGGCCATATCTTCTGCCGGAGTCAGCAGGAAGAGGATGGAGTTAA
+GATCGCATTTTTCCGGCACTACGCCATTTTCGCGCAGGAAGTTAGCAAGAATCGTCGCGGGTACACCGAACGCTTCATATTCGCCGTTACGTGCATCAAT
+ACCTGGGGTTGTCAGCAACAGTTTGCATGGATCGACAAAGTATTGATTCTCTGCATAGCCTTCAAAAGAATGCCAGTGTTCCCCTGGTACAAACTGGAAG
+AAGCGCAGATCAACCGCAATTTGCGCTGTTTCATACGACTGCCAGGGTTTACCATCCACCAGTTCAGGTACGAACGGACGAATATGCTGACAGTTATCGA
+GGATCAGTTTGCGGGCATTAATGCCATTTACCACACAATCCATCCACATATTACGACCGCTGACACCTTCATGCATTTTGGCGTTGATATTCAGTGCGGC
+AAACAGCGGATAGAACGGGCTGGTGGAGGCGTGCATCATAAAGGCGTTGTTCATGCGTTTGTGCGGTACATAACGCTGTTGCCCTTTGATGTGGCTGTCT
+TTTTATGAATTTGTGAAGTCTGAGAAAACCAGCCTGTTGTTTATGCACAGATTGCGTAACCAGAATACCCGGATCGTTCTCATTAAGATCCAGCAACAGC
+GGCGAACAGTCCGCCATCATCGGAATAAACTGTTCATAGCCGACCCATGCTGAGTCAAACAGGATGTAGTCACACAGATGACCAATTTTATCCACCACTT
+GGCGGGCGTTATAAATCGTACCGTCGTAGGTGCCTAACTGAATCACAGCGAGGCGGAAAGGACGAGCCTCTTTGCCCGCTGCGGTGCGACTTCCGCGATC
+AGCTCACGCAGGTAACTTTCTTCAAAACAGTGCGCATCAATGCCACCGATAAAGCCATACGGGTTACGTGCCGTTTCCAGATAAACCGGTGTTGCACCAG
+CCTGTAGCAACGCTCCGTGGTGGTTAGATTTGTGGTTATTGCGATCAAACAGCACCAGATCACCCGGTGTTAGCAGGGCGTTTAAAACCACTTTGTTAGA
+AGATGAAGTGCCATTTAAAACGAAGTAGGTTTTATCGGCATTAAACACTTTTGCCGCATGTTGCTGTGCAATGCATGGCGCGCCTTCGTGAATCAGCAGA
+TCGCCCATCGCTACGTCGGCGTTGCACAAGTCGGCACGGAACAGCGCCTCACCAAAGTATTCCACAAACTGATTCCCCGCCGGATGGCGACGGAAAATTC
+GCCGCCCTGATGACCAGGGCAATCAAACGCGCTGTTACCTTGATTGACATAATCGACCAGTGCGCGGAAGAAAGGTGGGCGCAGTTGAGTTTCATAATGG
+CTGGCAGCGGTTTCTAACTGGCGACCATAAAATTCTCGTCGCGATTCGCAATTCTCAAAGACACCCGAAATACGGGGCAAATACTCTGCGGGTACACGTT
+CTTGATTTTCAGTAGCAATAAATACCGGGATGCCATAACCCGTGGCATCGATTTCATCGAGTTTTCCGCATGTAACATCGTTGAGCGATAAAACTATTGC
+CGCCACATCGATATTACGACTTTCATTAATGTAGATACATTCTCGCTGCGTGGTAAAACAGTCCGGGCAAGAATCACTAACCGCAATTTTAATTTTGACA
+TTTTTCATCTCTTTATTTTAGGTAATAGCAGGTCCTCAATTTCTCGAATGAGAAATCGATCGTGCCGGAAAAAGCAAAGTTACCCCGCTGATAAATAAAT
+CAGGTAGATTGCTTTTTCAGAATGCAGAAACCCTTACCAGTCAGGTGGCTGATAATACAAGGGTTAACAGAGAATGAGCACTGCGGAATACAGGCATATG
+CCTGTAATACAGAGAGTCAGGAAGACCTGTACGCTGAAGTGCCCTTAGTCGGTAGACTAACGGGCATTGAAGAAGTGAAAGTCGAAGCTATTGCGATGAG
+CAAACTTCATAATATGAGTTGTCCGCCTTATATGGGGCATAGTGCGGCTGTTATTTTCCATTTAATTTACCTTTCCTGATGTGAATGAAGGTGAAGATAT
+TCTATCCAGGAAATACGGTTGAACTGTGAAGGTGATCAATAAAAATGATCAATCTTAATTTATTTAATGATGAGCTTTTTACTCAGTAATATAAAATATT
+GAATTGTTATTTTTGTGTGTTGTTTAAGATAAAAAGCCGTATTTATTATTACGGCTTTAATTAATAAAAGGCAGGCTGTATTAAAATTAATATTCAAAGC
+ATAAACCGATAGCCAATACCGGTTTCAGTAATGAAATGGCGTGGGCGGGCGGGATCCTGTTCCAGTTTTTGTCGCAGATGTCCCATATAAATACGCAAAT
+AGTGACTGTGTTCGACCGCGTTTGGCCCCACACCTGGTTAAGGAGCTGGCGCTGGGTGAGTACTTTTCCGGCATTGTTGAGCAGCACCGCCAGCAGGCGG
+AACTCAATTGGTGTGAGATGCACCTCTTCCTCACCCCGGTGAATCACGCGGGCGGCTAAATCGACGGTAACATCGGAAAATTTTACCAGCGGATCGGGCG
+CGGTGGTGGCAGAGTGGCGGCGTAATGCGACGCGCAGACGGGCCTGCAATTCGCCAATGCCAAACGGCTTACTCAGATAATCATCCGCTCCGGCATCCAG
+CGCGGCGATTTTGTCGCTCTTCGCTGCGTGCGGAAAGCACAATCACCGGCACCGCGCTCCACTGGCGCAGGTCGCGGATAAACTCAATCCCATCACCATC
+GGGCAGGCCGAGATCGAGAATAATCAAATCTGGCTTACGGGTTGCCGCTTCCAGCAAGCCGCGTTGCAGCGTTTCGGCCTCAAAGACGCGCATCCCGTCG
+CCCTCCAGCGCCGTGCGCAGAAAGCGACGAATAGCCTGTTCATCTTCAACAATCAGAACGTTTGTCACATATCCTCATGAAATTCTTCAAGTTCAGGGCA
+GTTTGCTGGGAAGTGTAACACGAAAACAGGCACCACCTTCCGGTCGGTTGAACGCGGTAATAGTGCCCCCGTACATCCACTATCGCCCGACAAATTGCCA
+GTCCAAGCCCTACCCCGGTACTGCCGACTCTTTATTCCCGCGAGCAAACTTATCAAATATCGTCTGCTCCTGGCCTGGCGGAAGACCGGGGCCGTTATCC
+CAGACATCCAGTTGTAGATTTTCGCCCTCAACGTGGGCATCGATACCAATTTCGGCCTGCGCACCCGCATATTTCACCGCGTTCTCCAGCAGATTAATCA
+GCACCCGTTCAAAGAGTGGCCCGTCAACGTGGATTAAGGTCAGCGGTTCTGGCAGAGAAAGATTGATGGGCGACGATAAACCCGGTTCCAGCATTTGCAG
+CGCGCTGCCGACTACTTCTTCCAGCGTTAACCACTCTTTCTTCAAATTAAAGCCGCCGGACTGAATTCGCGCCATATCCAGTAGATTATTCACCAGTCGG
+GTAGTGTTCAGCACATGCTGACGGATCTCGCTGGCCTGGCGGGCGTGGGGTGATCCTTCGCTTGCCAGATCGAGCGTTAAGATTTCTGCCTGACCAAACA
+GCACCGTAAGCGGCGTGCGTAAATCATGCGAAAGCGCCGCCAGCAGGGCGTTGCGGATCTGTTCACGTTCGCTTGCCATCCGCGCCTGTTCTTCGCTGGC
+GGTTAGCGTCAGCCGCTCAAGGGCATTGGCGACTAACAGCGTAAACGTCTCCAGCAGGCGCTGCTGTTCCGGGATCATCAACTGGCGCAGATTCCCCGCT
+CCACCACCACCAGCCCGTAGGTTTTCTCGCCGCTTTTAGCGGCAAAATCTGGTACGGTACACCGGGTAACGTGTCGGTGCCCGCGCCCGCAGGCAGGCCT
+TTATCAAAACTCCACTGCGCGATGGCATCGTCCCACGGCGTCATTCCTTGCGGATGTGTTAACGGCTGCAATTTACCGTTGTCATCGGGCAACAACACCT
+GACTGCGGGCATGAAACGTGGAGGCAATAAATTGTTCGCTGGTGGCAGCGATATCCTGCGGACTGCGGCCCACCGCCAGAGCTTTCGACATTTCATATAA
+GTGCCGTGTGCGTTGCTCGCGGTAACGGGCTACCCGCGCCTGATAACGCACGCCAGCAGTAAGGTTCCCGATCACCAGCCCGACGGTTAACATCACCGCG
+AAGGTCAGCAGATATTGCACATCAGAGACGGCGAGCGTGCCGCGTGGGGCGATAAAAAGAGATCGAAACTCACTACATTAATGACGGTGGCAACCACTGA
+AGGCCAGCGTCCATAAAATAGCGCCACCACCACCACGCCAAGCAGATACAGCATCACCAGGTTGGCGGCATCAAACGCCATCAGCCACTGCATGGCAATT
+AAGGTGATAACGGCGCATAACGCGGCGGCAACCACGCATCCCTGAATTTGTACACGCCACTTGTCTTTAAAAGAGCGGTTATCCGGCGCGTTGTTAATCG
+TGCGGGCGGGTGGTTCATCAAGCGCGACCAGCACCTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCAGCAAACGTTTCCCGACGCCACCAGCGGCGC
+GAGGCCGGGCGACCGAGAATAATCTTGCCGAGATTATGTTCACGGGCATAACGCACTACCGCTTTCTCTTCCGCTGGATCAGAAAGTGTTGCCGTCTCCG
+CGCCCAGTTCCTGCGCCAGACGTAAGGCGCTGAGAATTGCCCGACGTTTTTTCCGGTAAGCGGTGCAGGGCAGGGGTTTCAACATACACCGCGTGCCAGA
+CGCTACCCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACCAGTTTTCGCTGCCGGTGTTATGGCCGATGCATAAAAGGATCGCGTCGCGCGTGTGCCAC
+TTTCTCTTCGCCAGGATGCCCCGCCAGGCGCGCATTTGCTCATCAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTT
+TGCGGAAAAATGTTCAATGGCGCGCTCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGGGGCAAGTCCACCAGCA
+CCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACCTGAATTCCGGTGACGCCGCTGACCACATCATTCAGACTTTCCAGATGCTGAA
+CGTTGACGGTAGTGAAAACATCAATGCCAGCTTCCAGCAGTTCTTCGATATCCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAG
+TTCGTCCATTAAGATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGATCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAGA
+ACAGCCAGCCCTTCCAGCATGGCGGCGGTATCTTTTCGCCCGTGGGTTTCTACCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCGCTGGGCTT
+CTGCCAGCATCGCCCAGGTCTTCCCGACGCCTGCACAGGCACCGAAGAAAACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAGCAGACGATCG
+GGGTCGGGACGTAAGGGTTCGTTATTCATCAAGTTTATCCAGCGCCAGATTGAGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAGCGGT
+TGTTGGCTGTATTTTGCGATCAGTTGCGTGAGCTGTTCAACGCTGAGATTACGCGCTTTCGCCACGCGTGGGATTTGCCAGGCCGCCGCTTGCGGGTGAT
+ATTATTGTCCAGCCCGCTTGCCGATGCCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCT
+ATTAGTTTATCCAGCTCAGGGTTACTGACCGCCAGATTGCTCCCGCCAGAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAA
+AATAGCCGTTGCCGGTAAAATTCTGCCCGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCAT
+TGCCCCAGTACGGTGGTCAGCAGCGGGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACC
+TCACCAGACCGCAAACGGTCAGCAGTAAATCAATGACTTTGATACCGATAAACGGCACCAGCAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAA
+CATGGCAGAAGCGGTAAGCGGTTTATAACTCACGCCTTTAACGCCAGGGGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCG
+GAGTCGGGCGAATGCAGGCACATGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGT
+TGGCAATGCTGAAGGTGGTCAGCGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGAC
+CATATTGCCCGCCTCTTTCGCCGCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTC
+ATCGCTACCAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAG
+CAATCGCGGCGGCAGTCAGACGGTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGAC
+GATATCTTTCAGCGCAATAACGCCCAGCACACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCCTGACGCGCAACCTGATCGACTTTTTGATCAACA
+TCGGTAGGGAAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCC
+GGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACTGCACATCGCGCTCGCGCAGGTTAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCC
+TTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTCATCCACGCCCTGCGCGGGGATAAACTCCGACGCCTGACGGTTACC
+GAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATC
+CGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCAT
+TACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTT
+TTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATAC
+GCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCA
+ATAACTTCACCATCGCAGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATA
+TTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTA
+GCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGG
+TCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGT
+GTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGG
+ATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCT
+TTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAG
+TTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGG
+CGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTAC
+GTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAAC
+CGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACA
+GGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCC
+AGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCG
+ATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAAC
+GGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCG
+CTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACC
+CATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCT
+GGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACA
+AAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCAC
+CGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAA
+CGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGAT
+CAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCAC
+GCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAA
+GTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAG
+CAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGA
+TACAAAAGGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTG
+CCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCG
+AAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTGTATCAGGAAGATGTTCAGAGG
+AATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCT
+TTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACA
+TGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCG
+GCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAG
+CAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATAC
+TCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGT
+GGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCG
+CAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGG
+TGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCG
+GCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGT
+TACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGC
+GCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATG
+GTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGT
+ATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAG
+GAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGG
+ATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCC
+TGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCA
+CACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCG
+GTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACA
+GTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAAC
+GGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGA
+CCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGA
+CCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAA
+ACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTA
+AAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACT
+GGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTG
+GAGTACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGC
+ACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAG
+CACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCG
+GAGCTGCACCCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAG
+AGAAAACCGACCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGCGG
+ACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGG
+GCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGAT
+TTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAG
+TCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGG
+AAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCA
+CTGCGACCATCGCGGCCTGCCGCTGGCCCTTATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAG
+AACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGC
+AGGGGCGATATATCACTCAGGATCCGATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAG
+AAACACTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGT
+GTCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCAAGACCAACGGGGAGAATCAAAAGGAGATGGTCTATGGGGCCAGGTAAAGCAAGTAATGATACA
+AAAGAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGT
+ATTGCCTGATATATTCACACCTATAAATTTAGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAA
+ATAACATTGGACGTTTTATTAGATTTGTATTCACCGGAGTGATGTAATGAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAA
+TACTATTCTTTTCCATGCATAGACTTTCACTATTAGACTCCACTCGTGATGTGAGCGAGTTAATTAGTCTCATGTCTTATGGAATGATGGTAATATGTTT
+TCCAACAGGCATAGTATTCTTTATTGCTCTAATATTTATAGGGACTGTATCAGACATTATTGGCGTAAGGATTGATAGTAAGTATATTATGGCGATAATA
+ATATGGCTTTATTTTCTGTCAGGAGGGTATATTCAATGGTTTGTATTAAGTAAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATAT
+GTAACCTGGGCATTGATATCCCGTATGCCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCACCCTCAGCATGTGGCCGGA
+TAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACGGAGAAAACCGACCTCATCCCGGAAGGGTTATCCGCACGG
+ATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGCCGCTATCT
+TTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTGTGGCGACGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGG
+TACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTG
+AAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGCGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCC
+GGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTG
+GAGCAGATGCAAAACCAGATGGACCCGGTGTACACGCCGGCGCGAAAAATCCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCGCTTGTCAGCA
+CGGAAGGGGCAACAGAATGGTGCGCAGAATACGATGAATGGGGCAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGG
+GCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGAGGTATATCACTCAGGATCCGATTGGGCTGAAG
+GGGATGGAATTTTTATCAGTATCCGCTGAATCCGGTTCAGTATATAGATTCAATGGGACTGGCATCAAAATATGGACACTTAAATAATGGCGGATATGGA
+GCGAGACCCAACAAACCGCCTACGCCCGATCCAAGTAAATTGCCGGACATAGCGAAACAATTAAGACTGCCATATCCTATTGACCAGGCCAGTAGTGCGC
+CTAATGTTTTCAAAACATTCTTCAGAGCATTAAGCCCTTACGACTACACACTGTATTGCAGGAAGTGGGTAAAACCAAATCTGACTTGTACGCCACAGGA
+TGATTCCCAGTATCCAGGGATGGATACAAAGACAGCAAGTGATTACCTGCCACAGACAAATTGGCCAACAACTCAATTACCACCAGGATATACTTGTGCA
+GAACCCTATTTATTCCCAGACATTAATAAACCCGATGGGCCAGCAACAGCAGGGATAGATGATTTGGGTGAAATTTTAGCTAAGATGAAACAGAGAACAT
+CGAGAGGAATAAGAAAATGAAAAGAGTTTTGTTCTTTTTGCTGATGATATTTGTTAGTTTTGGTGTTATAGCTGATTGCGAAATACAAGCTAAAGATCAT
+GATTGTTTTACTATTTTCGCTAAGGGTACTATTTTTCCGCGTTTCCTGTCTTAAATAATAAAGCCATGTGGAGATGGTATCAGAATGAGGACATCGGTGA
+GTATTATTGGCAAACAGAACTGGGTACATGTAAAATAATAAATTCACACCAAGCGGGGCGAGACTCTTAATTCGCGTCGGGTCACTACGCCTTAATGAAA
+ATCATGCCATCAAAGGAACGTTGCAGGAGTTGATAAATACAGCAGAAAAACGGCGTTTCTCGGCGATCGGTTTAGAAGTTATATAAGAGCGGGTATCTAT
+CAAAAAGAGCAGTGATCCAGTTCAGTTGTTGGCAGTCCTTGATAATTCAATCATGGTAAAATATTTTAAAGATGAGAAACCAACTTATGCTCGAATGACA
+GCACATCTCCCGAACAAAATGAGTCTTACGAATGTTTAATAAAGATACAGCATGAACTAATTCGTAGTGAAGAGAAATAAAATCTCTTCCTGAGAAAACA
+AATTAATCATTGTGAAAAATTATATAACTCATGGAATAGGTGTTTATTTTGCGTTCCATTTGCAGGAAAGATCACGTAACGCTACTTTTTGTACTAAATA
+ATTCGAATTTTAAGTTCAACAATTGAGATACTACTTATTGTCTAAAGCTGTTTTCATAGCTTATACATGATCAAATACTCCTTACATAAATAAGGTGAAC
+AAATGGAACTTAAAAATTGATGGAACATATTTCTATTACACCCGATTACAGACAAGCCTGGAAAGTGGTGCATAAATTGTCAGATATTCTACTGTTGACT
+ATTTGTGCCGTTATTTCTGGTGCAGAAGGTTGGGAAGATATAGAGGATTTCGGGGAAACACATCTCGATTTTTGAAGCAATATGGTGATTTTGAAAATGG
+TATTCCTGTTCACGATACCATTGCCAGAGTTGTATCCCAGGAAAGATCACGTAACGCTACTTTTTGTACTAAATAATTCGCATTTTATGTTTAAAAATTG
+AGATATTCCTTATTACCTAAAGCTGTTTTTCATAGCTTATACATGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGA
+ACATATTTCTATTATTCCCGATTACAGATAAGCCTGGAAAGTAGAGCATAAATTGTCAGGCATCCTACTATTGACTATTTTTGCCGTTATTTCTGGTGCA
+GAAAGTTGGGAAGATATAGAGGATTTCGGGGAAACACATCTCGATTTCTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACTATTG
+CCAGAGTTGTATCCTGTATCAGTCCTGCAAAATTTCACGAGTGCTTTATTAACTGGATGCGTGATTGCCATTCATCAAATGATAAAGACGTCATTGCAAT
+TGATGGAAAAACGCTCCGGCACTCTTATGACAAGAGTCGCCGCAGGGAGCGATTCATGTCATTAGTGCGTTCTCAACAATGCACAGTCTGGTCATCGGGC
+AGATCAAGACGGATAAGAAATCCAATGAGATCACAGCTATCCCTGAACTTCTTAACATGCTGGATATTAAAGGAAAAATCATCACAACTGATGCGATGGG
+TTGCCAGAAAGATATTGCAGAGAAGATACAAAAACAGGGAGGTGATTATTTATTCGCTGTAAAGGAAACCAGGGCGGCTTAATAAAGCCTTTGAGGAAAA
+ATTTCCGCTGAAAGAATTAAATAATCCAGAGCATGACAGTTACGCAATGAGTGAAAAGAGTCACGGCAGAGAAGAAATCCGTCTTCATATTGTTTGCGAT
+GTCCCTGATGAACTTATTGATTTCACGTTTGAATGGAAAGGACTGAAGAAATTATGCGTGGCAGTCTCCTTTCGGTCAATAATAGCAGAACAAAAGAAAG
+AGCCAGAAATGACGGTCAGATATTATATCAGTTCTGCTGATTTAACCGCAGAAAAGTTCGCCACAGCAATCCGAAACCACTGGCACGTGGAGAATAAGCT
+GCACTGGCGTCTGGACGTGGTAATGAATGAAGACGACTGCAAAATAAGAAGAGGAAACGCCGCAGAATTATTTTCAGGGATACGGCACATCGCTATTAAT
+ATTTTAACGAATGATAAGGTATTCAAGGCAGGGTTAAGACGTAAGATGCGAAAAGCAGCCATGGATAGAAACTATCTCGCGTCAGTCCTTGCGGGGAGCG
+GGCTTTCGTAATCTTTCCCTGCTTTTGTACTAAATAATTCGCATTTTATGTTTAAAATTGAGATATTCCTTATTACCTGAAGCTGTTTTTATTGCTTATA
+CATGATCAAATACTTCTTACATAATTAAGGAGAACAAAATGGAACTTAAAAATTGATGGAACATATTTCTATTATCCCCGATTACAGACAAGCCTGGAAA
+GTGGAACATAAATTATCGGATATTCTACTGTTGACTATTTGTGCCGTTATTTCTGGTGCAGAAGGCTGGGAAGATATAGAGGATTTTGGGGAAACACATC
+CCGATTTTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACCATTGCCAGAGTTGTATCCTGTATCTGTCCTGCGAAATTTCATGAG
+AGCTTTATTAACTGGATGCTTGACTACCATTCTTCAGATGATAAAGACGTCATCGCAATTGATGGAAAAATACACCGGCATTCTTATGACAAGAGTCGCC
+GTAAGGGAGCGATTCATGTCATTAGTGCGTTCTCAACAATGCACAGTCTGGTCATCGGACAGATCAAGACGGATAAGAAATCCAATGAGATCACAGCTAT
+CCCTGAACTTCTTAACATGCTGGATATTAAAGGAAAAATCATCAAAACCGATGCGATGGGTTGCCAGAAAGATATTGCAGAGAAGATACAAAAACAGGGA
+GGTGATTATTTATTCGCTGTAAAGGAAACCAGGGGCGGCTAAATAAAGCCTTCGAGGAAAAATTTCCGCTGAAAGAATTAAATAATCCCAAGCATGACAG
+TTACGCAATTAGTGAAAAGAGTCACGGCAGAGAAGAAACCCGTCTTCATATTGTTTGCGATGTCCCTGATGAGCTTATTGATTTCACGTTTGAATAGAAA
+GGGCAGCTATGGTTAGAAACTACCTGACGTCAGTCCTTGCGGGAGCAGGCTTTCGTAAATTTGTCCTGCTACAACAGGATTAACTTCACAAATATCATTT
+CTCAACGTCTACACTTACTCCTGTAAACCGCTCAGGAGCAGTAATGAATCTACAACGATTTGATGACAGCACCCTAATCCGTATCTTTGCCCTTCATGAG
+TTACATCGACTGAAAGAACATGGCTTAACGCGCGGGGCGCTTCTCGATTATCACAGCCGCTATAAACTCGTCTTTCTGGCGCATTCTCAGCCGGAGTACC
+GCAAACTTGGCCCGTTCGTGGCTGATATTCACCAGTGGCAAAATCTGGATGACTATTACAACCAGTACCGCCAACGCGTAGTTGTTTTGCTTTCTCACCC
+CGCCAACCCGCGCGATCACACCAATGTTTTGATGCACGTTCAGGGTTATTTTCGCCCGCATATTGATTCCACAGAACGCCAGCAGCTGGCTGCGCTTATC
+GACAGTTATCGCCGTGGCGAGCAACCACTTCTTGCGCCGCTGATGCGTATCAAACACTATATGGCGCTTTATCCTGACGCCTGGCTTTCAGGGCAGCGTT
+ATTTCGAACTTTGGCCGCGTGTGATTAACTTGCGCCATTCAGGAGTTTTATGACTACCCATCTGGTCTGGTTTCGCCAGGATTTACGTCTGCACGATAAT
+CTCGCACTGGCTGCCGCCTGCCGCAATTCGTCTGCACGCGTGCTGGCGTTGTATATCGCTACACCACGCCAGTGGGCGACGCATAACATGTCGCCGCGTC
+AGGCTGAACTTATCAATGCTCAACTGAATGGGCTACAAATAGCGCTTGCGGAAAAGGTATTCCTTTATTGTTCCGTGAAGTGGATGACTTTGTCGCCAGT
+GTCGAAATAGTTAAACAGGTGTGCGCGGAAAACAGCGTTACCCACCTGTTTTATAACTATCAGTATGAAGTGAATGAGCGGGCGCGGGATGTGGAAGTTG
+AAAGAGCGCTGCGTAACGTGGTGTGTGAAGGATTTGATGACAGCGTGATCCTGCCGCCTGGCGCGGTGATGACCGGTAATCACGAGATGTACAAAGTCTT
+TACGCCTTTTAAGAATGCCTGGCTGAAACGGCTGCGGGAAGGGATGCCGGAGTGCGTCGCTGCGCCAAAAGTTCGTAGTAGCGGATCGATAGAGCCCTCG
+CCATCCATTACGCTGAATTATCCTCGTCAGTCTTTCGATACTGCGCATTTTCCGGTGGAAGAAAAAGCGGCGATTGCGCAATTACGCCAGTTTTGCCAGA
+ACGGTGCCGGAGAATATGAGCAACAACGAGATTTTCCGGCAGTGGAAGGCACCAGCCGTTTGTCGGCCAGCCTGGCAACGGGCGGGTTATCGCCTCGCCA
+GTGCTTGCATCGCTTGTTGGCTGAACAGCCGCAGGCGCTGGACGGTGGGGCCGGTAGTGTCTGGCTTAATGAGCTGATCTGGCGCGAGTTTTACCGTCAC
+CTGATAACGTATCACCCCTCGTTGTGTAAACATCGTCCATTTATTGCCTGGACGGATCGTGTACAGTGGCAGAGCAATCCCGCACATTTACAGGCCTGGC
+AGGAAGGCAAAACGGGATACCCGATTGTTGATGCCGCTATGCGTCAGCTTAACAGCACTGGCTGGATGCATAACAGGCTACGGATGATTACAGCCAGTTT
+TCTGGTGAAAGATTTATTGATCGACTGGCGCGAAGGCGAGCGATATTTCATGTCGCAGCTGATTGATGGTGATTTGGCAGCCAATAACGGTGGCTGGCAG
+TGGGCCGCTTCAACCGGAACCGATGCAGCGCCGTATTTTCGTATTTTCAACCCGACAACCCAGGGCGAGAAATTTGATCATGAGGGCGAGTTTATCCGCC
+AGTGGCTACCGGAACTGCGCGATGTGCCAGGAAAGTGGTGCATGAGCCGTGGAAGTGGGCGCAGAAAGCAGGTGTGACGCTGGATTATCCGCAACCGATA
+GTCGAGCACAAAGAAGCGAGAGTACAAACGTTGGCAGCGTATGAGGCGGCGCGGAAGGGGAAATAACAGACGCGTCAGGCAATCGAGCCCAGATGCCGGA
+TGCGGCGTGAACGCCTTATCCAGCCTACAAATTTGTGCAAATTCAATAAATTGCAGGAAATACGTAGGCCTGATAAGACGCGTCAAGCGTCGCATCAGGC
+ATCGGTGCTGGCCTATTAAGACTCCAGCGCCAGCGCGCGGTTTCTGAATTTCAGCGCCTGATACAGCCAAATCATCAGTACCAGTCCTACACACGCCAGT
+GCGCCCCAGGTAATTTGATCAAATACTTCAATATATGCATTGATGGAGTAGTTGATCGCCCCGGAAGCATCAAACGAAGCCTGCGATGTCTGATCGGCAA
+TCACGCCCGCCAGATAGTTCGCGATCGCGCCAGAAAGCAGCATGTAGATGCCGGTTAATACGCCGGTCACACCGGGGATTTCAATGCGCGTAATTTGCGA
+CATGGCAACCGGGTCGATAAACAGTTCCGCAAAGCCCATCACCGCCAGGCCTAATACCATCAGTGGCAGAGAAGAGTGACCATACATTGCGGACCAGCGG
+GCGCTTAAGGTCAGAATGCAGAATCCGGCGCTCATCAGGCCAAGGCCAAGAGCAAATTTCCCCAGATGCGCACGGTACGATTACCCGCGACACTCTCTTT
+ACCACCCACGCCAGGAACACACCGCACAGCATAACTGCGAAGGCATTAATCGACTGGAACATCGCGGTCGGAACGGTATAACCAAACATATCGCGGTTAA
+CGAAGCGGTCGATATAAAGGCTAATCGAGCTACCGCCCTGTTGTGCGAAGGCCCAGAACAACATACTGAAGAAGGTGAGCGTCACAATCAGCCCCAGCTC
+CTTCCGCTGTTTCTGGTTTTCTGCTTTGCGATAAATTTTTGCCAGTACACCCAGGCCAATAATAGTCGCGACAATTAAGGCGTATACCGACCACTCTTTC
+CAGAACAGTATGGTAATCAGTGCAGGCGTTGCCACCAGCAGAACCAGCAGCCATCCCCAGTTCGGCAGGAGAAAGTTTGTCGCACGCAGTACTTTTTGTT
+AACGCCGCGGGTATGAGTGAAATGACGATTGCCACATAAGAAAATGACCAGACCCGCGATCATGCCAACCGCCGCCAGGCCAAAGCCCATCGCCCAGCTG
+TACTCTTCCTGGGCGTAACCACAGGCGATAGGTGCGATAATAGACCCCACGTTACCCGCCGCATACATCAGCGAGAAACCGCCATCACGACGCGGATCGG
+TTGGCTCATACAGCTCGCCGAGCAGACAGCTTACGTTAGATTTAAACAGGCCATAGCCGCAGACGATAATCGCCAGGGACAGATAGAGGAATGACGGATG
+GATCTCACTGGCACCCAGCACCACATGACCGATCGCCATCAACAACGCCCCCAGCATCACCGCCATGCGATTGCCGAGAACTTTATCCGCCAAAAGCCAC
+CGAGGATTGGCGTGACATACACCAGCGAACAGTAGGCGCTAAATAACTCGTAGGCGTGAGTATCGTTGTATTTTAGTTGATTGGTGAGATAGAGAATCAG
+CAGGGCACGCATGCCGTAAAAGCTAAAATATTCCCAGATTTGCAGCGCAACGACATAGTAAATAGCGCGCGGCTGTGATGCGTGTTTATTCATAATAATT
+CCACAATTGACGGCAACGTCACGTAATAGTTGCGCGGCGTGCTTGTGTTTCCTTAAAGTTAAAACTTTGATACAGATCTGATTATTTATGCAATATGCTG
+TCTGATTGCATAAATATACATTAACTGAAGCGTGATGATATAAACAATTTGCGTCTTTTGGCGTCGGGTTTGTTTCTTAATATGTCAAAAGATTGGCTAT
+CGACGAACTGGCGAGGTAACGCTATGTTAACGGTGTAGCTATCAGAATACGGAAGGCGCGAAGATGAAAAACACCGAACTGGAACAACTGATTAACGAAA
+AACTGAACAGCGCGGCGATTAGTGATTACGCGCCGAATGGTTTGCAGGTGGAAGGCAAAGAGACGGTGCAAAAATTGTTACCGGTGTCACCGCCAGCCAG
+GCTTTGCTCGATGAGGCAGTGCGTCTGGGCGCGGATGCGGTCATTGTGCATCATGGCTACTTCTGGAAAGGAGAGTCTCCGGTCATTCGCGGAATGAAGC
+GTAACCGTTTAAAAACGTTGCTGGCGAATGATATCAACCTGTATGGCTGGCATTTGCCGCTTGACGCACATCCTGAGCTGGGCAATAACGCACAGCTGGC
+GGCGTTACTGGGGATCACGGTCATGGGCGAAATTGAGCCGTTGGTGCCGTGGGGCGAACTGACCATGCCTGTGCCGGGACTGGAGCTGGCTTCCTGGATT
+GAAGCGCGTCTGGGACGTAAGCCGTTATGGTGTGGCGATACCGGACCTGAGGTGGTCCAGCGCGTCGCCTGGTGCACGGGCGGCGGGCAAAGTTTTATCG
+ATAGCGCCGCGCGTTTTGGCGTGGATGCTTTTATTACTGGCGAAGTTTCTGAACAGACCATTCATTCAGCCCGCGAGCAGGGATTGCATTTTATGCTGCA
+GGTCACCATGCCACTGAACGTGGTGGTATTCGCGCATTGAGCGAGTGGCTGAATGAAAATACCGATCTTGATGTGACCTTTATTGATATTCCTAATCCTG
+CATAACGAATAATCAGAGGATCGAAAGTGCAACGAGCGCGTTGTTATCTGATAGGTGAAACGGCGGTAGTGCTGGAACTGGAACCGCCGGTGACGCTGGC
+TAGCCAGAAACGGATCTGGCGACTGGCGCAGCGTCTGGTGGATATGCCGAATGTGGTTGAAGCCATTCCCGGCATGAACAATATCACGGTGATTTTGCGT
+AATCCTGAGTCGCTGGCGCTGGATGCCATAGAGCGTTTGCAACGCTGGTGGGAGGAGAGCGAGGCGCTGGAGCCGGAGTCTCGCTTTATTGAAATTCCGG
+TGGTTTACGGTGGTGCAGGCGGACCGGATTTGGCGGTGGTCGCGGCGCATTGCGGGTTGAGCGAAAAACAGGTTGTTGAATTGCACTCCTCCGTGGAATA
+CGTGGTCTGGTTTTAGGTTTTCAACCGGGCTTCCCGTATCTCGGGAGTTTGCCGGAACAACTACACGCCACGGCGCGCTGAACCGCGCTTACTCGTTCCG
+GCAGGTTCTGTCGGGATCGGCGGGCCGCAGACTGGTGTTTATCCGCTGGCAACGCCGGGTGGCTGGCAGTTGATTGGTCATACCTCACTCAGCCTGTTTG
+ATCCGGCGCGTGACGAACCCATCTTATTACGTCCGGGAGACAGCGTGCGCTTTGTACCGCAGAAGGAGGGAGTATGCTGAAGATTATTCGTGCGGGCATG
+TATACCACTGTGCAGGATGGCGGTCGTCACGGTTTTCGCCAGTCGGGTATCAGCCACTGCGGCGCACTGGATATGCCCGCGTTACGCATTGCTAACCTAC
+TGGTGGGTAATGACGCCAATGCCCCCGCGCTGGAGATCACGCTCGGTCAGTTAACTGTTGAGTTCGAAACTGATGGGTGGTTTGCTCTGACGGGTGCCGG
+TTGCGAAGCGCGGCTGGATGATAATGCCGTCTGGACCGGCTGGCGATTGCCGATGAAAGCAGGCCAGCGTTTAACGCTTAAACGCCCGCAGCACGGGATG
+CGCAGTTATCTGGCGGTCGCGGGTGGTATTGATGTTCCGCCGGTAATGGGCTCATGCAGCACCGATCTCAAAGTGGGGATTGGCGGGCTGGAAGGCCGTT
+TACTGAAGGATGGTGACCGACTCCCGATTGGCAAATCGAAGCGTGATTCTATGGAAGCGCAGGGCGTTAAACAGCTGCTGTGGGGCAACCGCATTCGCGC
+CTTGCCGGGGCCGGAATATCATGAGTTCGATCGCGCCTCGCAGGATGCATTCTGGCGTTCGCCCTGGCAGCTTAGCTCGCAAAGTAACCGCATGGGCTAT
+CGCTTACAGGGGCAAATTTTAAAACGCACCACCGATCGCGAACTGTTATCTCACGGTTTGTTACCGGGCGTGGTGCAGGTGCCACATAACGGGCAGCCGA
+TTGTGTTGATGAACGACGCACAGACCACCGGTGGTTACCCGCGTATTGCCTGTATCATTGAGGCTGATATGTACCATCTGGCGCAAATTCCGCTCGGTCA
+GCCGATTCATTTTGTCCAGTGTTCACTGGAAGAGGCACTAAAAGCACGGCAAGATCAGCAACGTTATTTTGAACAATTAGCGTGGCGGCTGCACAATGAA
+AATTGACCTGAACGCCGATCTGGGCGAAGGCTGCGCCAGCGACGCAGAGCTATTAACGCTGGTTTCCTCTGCCAATATTGCCTGTGGATTTCATGCAGGC
+GATGCGCAAATCATGCAGGCTTGCGTGCGTGAAGCAATAAAAATGGTGTCGCGATTGGCGCTCACCCGAGTTTTCCCGACAGGAAAATTTTGGTCGCAGC
+GCCATGCAGCTGCCGCCAGAAACCGTTTACGCCCAGACGCTGTATCAAATTGGCGCGCTGGCAACGATTGCCCGTGCGCAAGGCGGCGTAATGCGTCATG
+TCAAACCGCACGGCATGTTGTACAACCAGGCGGCGAAAGAAGCACAACTGGCAGACGCCATCGCCAGAGCGGTATACGCTTGCGATCCAGCATTGATTCT
+CGTCGGGCTGGCGGGAAGCGAGCTGATTCGTGCAGGCAAGCAATATGGTCTGACAACGCGCGAGGAAGTGTTTGCCGATCGCGGTTATCAGGCTGACGGC
+TCGCTGGTGCCGCGAAGCCAGTCAGGCGCGTTGATTGAAAACGAAGAACAGGCGCTGGCGCAAACGCTGGAGATGGTGCAACACGGCAGAGTCAAAAGTA
+TCACCGGCGAATGGGCAACGGTCGCGGCGCAAACGGTCTGCCTGCATGGCGACGGCGAGCACGCACTGGCGTTCGCCCGCCGACTACGCTCTGCATTTGC
+CGAAAAGGGATTGTTGTCGCAGCATAACCCCGATTAATAAAGAATGAAAAAGGATATCACCATGCCTGAAGGCCCGGAGATCCGCCGTGCAGCGGATAAC
+CTGGAGGCGGCGATCAAAGGCAAACCACTAACTGATGTCTGGTTTGCCTTCCCGCAGTTAAAACCTTATCAATCACAACTTATCGGTCAACACGTTACCC
+ATGTGGAAACGCGTGGTAAGGCGTTGTTAACTCATTTTTCCAACGACTTAACGCTCTACAGCCATAATCAGCTTTACGGCGTCTGGCGCGTGGTTGATAC
+CGGCGAAGAGCCGCAGACCACGCGAGTATTGCGGGTAAAACTGCAAACGGCTGACAAAACCATTCTGCTTTATAGCGCCTCGGATATTGAGATGTTGACC
+CCGGAACAACTGACCACGCATCCGTTTTACAACGCGTTGGTCCCGATGTGCTGGATCCGAATCTGACGCCGGAGGTGGTGAAAGAACGATTATTGTCGCC
+GCGCTTTCGTAACCGTCAGTTTGCTGGATTACTGCTCGATCAGGCGTTTCTGGCTGGGCTTGGCAATTATTTGCGGGTGGAGATCCTCTGGCAGGTTGGG
+TTGACTGGAAATCATAAAGCGAAAGATCTCAATGCGGCGCAACTGGATGCACTCGCACACGCGTTACTGGAGATTCCTCGATTTTCCTACGCTACGCGGG
+GCAGGTGGATGAGAATAAGCATCATGGGGCGCTGTTTCGCTTTAAGGTTTTCATCGAGATGGCGAACCGTGCGAACGTTGTGGCAGCATCATTGAGAAAA
+CCACGCTGTCATCTCGCCCGTTTTACTGGTGCCCTGGCTGCCAGCACTAGGCCGACCGCTTCGGCGCATAGGTTGAAATAAACCGCGCAATGGCAGGCCC
+TGTCAGCAAAATACTGAACAGGCGTAGGGTTTGCATCGCCATAATGAGCGCCATATCGGCATTGCTCCCTGCGGCGATGACCGCCACGGTATCAAGCCCG
+CCGGGGCTGGTGGCGAGGTAGGCAGTCATAAAATCAATGTGCATAAACCGGGTCAGCCCCACGCCATACCCGCACAAATAGCCAGCAGAGCAAAATCGAC
+AGCAGGATTTGCGGTAGCGGGCGTAGTGCCCGCAGTAAGATTTGTTTATCGAAACCAAGACCAATCCGCCAGCCAATTGCCATATACGCCATCGCCAGCA
+GCCATTCCGGTAGTTCGATGGTGATGAGCTGACCAGACTGGAGCACTGCGCCCGCCAGCATCGGGATGAGCATCGTGCCGGAAGGAAGACGCAGCAGGCA
+TCCCACTGTACCGGCAACGACCGCGAGCAAAATAGTAAGCAGGAGATTAATGCTCACTGGCGGGAACCAGACGATATGCTGGTTAACCGCTTCAGCGTTA
+TCGCCCAGCATCATGCGGGTGACCAGAACAGCGGCCCCGCGACGAACAGCACTCGCAGATATTGCATAAACGCCACCAGGCGAATATCTGCGCCGTAATC
+TTGCGCCATAGCGACCATTGCCGCCGCGCCGCCAGGAGAGGAGCCCCAGGCACCGGTATTTCCAGGCAATGAGCTATAGCGCACCAATAACCAACCCACA
+ATGGCGCTGGAAAGCAGCGTTACCAGTAAAATTGCAAGCACGATCGGCCAGTTGACGGCCAGGGTGGTGAGAATCGAACCAGTGAGGTTTTGCGCAATCA
+TGCAGCCAAGAATGGCCTGGGCGGCGAGAAAAGCAGAGCGGGGAAGTTGCAGAGTAATTCCGCGCATACTAAAGATGATCCCGGCGATCATCGGCCCAAA
+TAGCGCCGCCGGGAGATGTACCGCGAGGAAACCAATAGAAAGGAGAAGTGATAGCACACATAACATTCCCCACTGCAAAACTGGCATCCTTCGCTCCTCA
+TTATTTTCTCTTTGGTGTATCGATACAGCATAAAGAAAGCTGGGCCAGGAAAAATAACAGCAATCAAGGAAAAGGGGAAAATCAGCAATTTTCTGAAAGA
+GATGCCCTTTCCGGCGGCAAAGGGCATCATGGTAAATCAGTTATAGTTAATCTTAAAAGCACCACTGTATCGAAGGGGCCAGCCTCGATGGGGTGCCTGG
+AATGGACGAAAGTTCAGCCGTATAGGTTTTTCGTAGACCAACATGTCACTGGTGAAATCGGCGTATTCAGCATATTTATTGAAGGTATAAGGCGAGGCGT
+TTTCATCCAGTAAACGTAGCTTCAGACCATTACCAATCAACAATGCTTTATCTTCTTCAACCAACGTTTCTTCGGTATAAAAGGAGGAACTGACTTTAAA
+TCCGTCGGTGCATTGATCGTTTTGGCTCTTGGTCGTTTTAATACTGAACGTTTTCGACATTGTGTGGCGACGTATATCCAGCAAATTAAATTTACCAAAA
+TCAATCACCTGTGTTTCCGGTGAAATGGAAAAATTGACGCTGCAATCCAGCACGCGAATGTTTTCCAGACCAGTAATATGATATTTCAGGTTTTGGGCAG
+TAGGGTCTTCGTTAACGCTACCGGCACCGTCAAATTGCACGACGATATAGTCGCTAAGCGTACTTTGATAATCATGCGGCGGCATTTCTCGTATTTTGAC
+GTATAACCGCATGCGAGCGAGAAAGGTACGCGACATATGAATATTAGCGGGATCGCCCGAGCAAATTTTGTTCTGCCATCCCATCGCGATGATCTGCTCA
+GGGTATAAATATCAATGTTCTTACTGTCGATACACTGGTTAGTGTCGATGCGACTTTTCCCAGACTGGCATCGTAATCGACACCGTTGTATGTCACGCCG
+AGTTGATAATAACGATCCTGCACCCCGGATAGGGTTTACCCAGGCGTAGACATGCTCGCTTTCAAAGTTGCCGTTGGTATTGTTGTCACAATAGACGGGA
+ATTTTAATATCGTCAGATTCCCAGATCTTATCACCGGGTTTGGCATTGCCTGGTACAGCAAACGGTTGAATCGCTTCTGATTTTTCTACTGCGCCACCAG
+ATGTACCAAAATAGCAGTTCAGCGCCATTGCAGACTTCAACGGCAGAAATAACAGGCAGATGACGAGCAACAATCCCTTGCCAGCACTCATTTCGCCTCC
+ACTGCTTGTAAACGGCATTGTCCGCTGCAGTTGAGCGTCGTCATGCGTAATGCGCCGTAATCATCCATGTAACCGAGATAAAACTGGCTGCCGCTATAAC
+TTCCGGTGTTTGTGTTGACCGTACTAAAGGTGCAACCATCACGGTTTTGAAGCCTGGGAGAACGCCTTTTCATTTCTCCCCAGATAGGCAATGGTCAGAT
+AATACGCGGTAGGATTTTTCAGTGTCAGTTGGTTGCCCTGCTGGCTGACCTGTAACTGCAGTTCGACCTTTTCTCCTGCTTTCTTGCGTAATGCAGCCGG
+TCGCCAGAACAATTTAATACGACTTTGAATAGCGACCTGAAGTATCGCATGGTCGCTGCTTTATCCGGAGCGGGAGGAATTTCGCGCATATTGTAGAAAA
+ATAGCGTTTCGCGATCGCCAGGTAATTGTGTGGTTGAGGCTTGTTTCACAACCCGCACCTGCGATGTCGCTTTCGGTTCCAGACGTTGAATAGGGGCAAA
+GCGACCAGAAGAGCATCGCTTTTCTCCCTTTTTCATTTTCTATCCAGGAATAAGCAAGATAAGGCAGTTTGTCACTTTGGTTTTCGATACGCAGGCTGGT
+GGCTTTGTCATTGGCGTTAAACACAATGCGTGTGCGATCGGGTTGCACCGCAGCATTGCAACCAAGCTGATGGTTAACAACATTAAGGGTAATCCTTTAA
+TAAATGTCATTCTCTTTTCCTTAATTAATGACAAGGTAAAATCAGGCGTTTGGTCGTGTCTTCCAGACGTTCTGGCAGATGAATAATGCAGCTTTGCTCA
+CCCCAGACCACGGTAAACAGTTGATTTTCAGCGACACCGCTTAACCAGGCATGTCCTTCCTCGCCAACCATACCCACGCTAATGCCGCTGTCATCCTGGC
+GGATATCCGCACCGAGGGGAGGAACTGACCGCTGGCGTTGCGTATGATGACGTTAACGTCTTTACCGGAACGGGAAGCCAGTGATTTGTAACCTATCGCG
+CCTTCAATCCATGTTTCCTTGATGACGTTTTCTGCAACTGTTACGCCGTCGGGTAAGTCATTCATGTTCACCGCCACGGTGGAAGGCTGGTAACTGGAAA
+TCAACGGCACCACCGCAATGCCAAAATGGTTGGTGTAGTCGAGATTGCCCTGAACCGGAATATCTGCCACGCCATCGGTGCTGACCATCAGGCGTGGTTC
+ATTGGTGGAGCTGCGGCGATGAAATGCTGCACCATATTGGGTTGCGGTGAAAGAACCGCTCCAGCTGCTGCTGACGGAACTGTAATCACTGGCGGCATAG
+GTACCAGAAATATCCCACTCACCCGCTGAACTCAGGTGCTGATAGTTACCGCTCACCTGGGCTCCATTGTCCGGACGATCGGATTGCAGTCCGGCAGACA
+TGCCCCAGCTATTACGTTCATCCAGCGTATCGTTCCACGACATGCGGTGTATGGTGCTGTGGCTACTGTTTTGCATGTCATAGCCAACCCGACCACCGTT
+ACCGAAGGGGAGCGAAATCGACAGATAAATCTGGTTGTCGCGATCTTTATCTTCGTAGTGGGTCGTATTGAATGACGTCGAAATCGAGATATCTCTCCAG
+TCACCAATATCAACATTAAAACCTGCTGTGATGTTGGCGGTCGTGGAGGCGTCTGCATTCCACCAGGTTTGATGTAGCAGGTTGGCGTAAAGATTGAGGT
+TTAGTGGGGTAATCGGTTGGCCCACGGATAAGCTGATCGTCTGTTTTCGTCCTGCGCATCGCTGTCGTTGTATTTGTGATCCAGATAGTTGGCGTAGCTG
+TGAAAATGACGATCTGAGAAGCGATAAGCGGCGAGCGAAATCGTGCTGTTGGTGGCATCCACTTGTTTGCTGTAATTAAAACGGTAGCTTAAGCCCCGCT
+CGTCCTGCTGAGTATCAAAATGGCTACTGGCCCAGGTGACATCAAAGGACAGTGCGCCAAGCCACAGCATATTTTGCCCGATACCCATTGCGGCAGAATG
+GTAGTCATCATCAGAAATCAGCAGGCCGCCGTACAGCGAGGTGTTTGAGAGCATCCCCAGGAAACTTCATTGCTAAAAAGGTTTCATTTTCAGTTTGATG
+TGACATGGAAGGCCGTGGCTGACCCGCGGCCAATTTATAGCGAACCTGTCCCTGGCGAGTCAGGAAGGGCGTCGATGCTGCCGAAACCTGGAAATTGTTC
+ACCCGACCATCTTCTTCCGTCACTTTGACATCCAGCGTGCCCTGAACAGACTGATTGAGGTCATCAATAATAAACGGGCCTGGCGGGACTTTTTCTGGTA
+AATGACGCGGCCTGATTGACTGATCGTCACCGTGGCATTGGTCTGTGCAATACCGCTAATTTGTGGGGCGTAGCCACGCAGCTCCCGGTAACATTCGATC
+GTCACTCGCCAGTGCCGCGCCGGTATAAGAAAAACCATCGAAAATATTGGAACTGAAATCGGTTTCGCCGAGGGTTAACTTAGAGCCTAATTGCGGTAAT
+GGACGAAAAGATAGGTGCGCGATATTCCGCCTGACTGGTCATGGTTATCTTCGCTATCGGTCTTATTAAGCTGGTAATCACTGCGTAAGCGCCATGCCCC
+GGCGTTAATTCCGGCGGTACCGTAGGCATTCAGGTTAGTGCTGCTGCTGCCGTCCTGTGGGCGGTAGCTGCTGGCAAACAAGTTGTAATCCATCAGGACA
+CCGGCAACACCTTCTTTCCATGTAGAGGGGAGCCCAGTTTTCTGAGTGCCACGCCAGCCAGGCTTGCGGAATACTAATATTCAGTTGCTGATTGGCTTGA
+TCGAAATTAAAGAGCATTTCAGGTCGGGAACTGAAATCAATACACCGATCTATCTGTGGCAAGGACTGACGGATATCTGGTTTTAAACCAAATTTATCGA
+CCAGTGAATCATTGATGCATGGAATGGTTTTGTCACCCTTTTTGCCAGTTAATTTTTGCCCATTACTGATTTTGTTGTTATTCACCGCAACGCTAACAAA
+ATATTCACCGGGAGCAATGACTCCTTTTCCTTTAATAATGAAATATCAATGCGGTCGCGCATTGATTTATCGAGAACATTCAGATTGAATTCGACCGCCA
+TTGCGCAAGGCATCGCCATGACCAGGCAGGATACAAAGAGAGTCGATAAATATTCACGGTGTCCATACCTGATAAATATTTTATGAAAGGCGGCGATGAT
+GCCGCCAAAATAATACTTATTTATAATCCAGCACGTAGGTTGCGTTAGCGGTTACTTCACCTGCCGTGACATCGACTGCATTATCAATTTGTTCCATCCA
+GGCGAAAAAGTTCAGCGTCTGTTCTGATGAGCTTGCATCCAGGTCAAGATCTGGCGCGGCTGAACCTAATACGATGTTACCGTCATTTTGTCCATCAGTC
+GTACACCGACCCCAGTTGCTTCGCCTGCACTGGTGTTGCTCAACAAAGGCGTAGCACCAGTTGTCTTAGCCGTGCTATCGAAGGTTACGCCAACTTTGGA
+TACCGGCATTCCGCTACCGTTGTCAGAAGCAGGCAGATCACAGTTGATCAAGCGAATGTCGACGGCCACTTTATTGCTATGATGCTCCCGGTTTATATGG
+GTTGTCGTGACTTGTCCAAGATCTATGTTTTTATCAATATCTTCTGGATGAATTTCACAAGGTGCTTCAATAACCTCCCCTTAAAGTGAATTTCGCCAGA
+ACCTTCATCAGCAGCATAAACAGGTGCAGTGAACAGCAGAGATACGGCCAGTGCGGCCAATGTTTTTGTCCTTTAAACATAACAGAGTCCTTTAAGGATA
+TAGAATAGGGTATAGCTACGCCAGAATATCGTATTTGATTATTGCTAGTTTTAGTTTTGCTTAAAAATATTGTTAGTTTTATTAAATGCAAAACTAAATT
+ATTGGTATCATGAATTTGTTGTATGATGAATAAAATATAGGGGGTATAGATAGACGTCATTTTCATAGGGTTATAAATGCGACTACCATGAAGTTTTTAA
+TTGAAAGTATTGGGTTGCTGATAATTTGAGCTGTTCTATTCTTTTAAATATCTATATAGGTCTGTTAATGGATTTTATTTTTACAATTTTTGTGTTTAGG
+CATATAAAATCAACCCGCCATATGAACGGCGGGTTAAAATATTTAACTTAGCAATCAACCATTAACGCTTGATATCGCTTTTAAAGTCGCGTTTTCATAT
+CCTGTATACAGCTGACGCGGACGGGCAATCTTCATACCGTCACTGTGCATTTCGCTCCAGTGGGCGATCCAGCCAACGGTACGTGCCATTGCGAAAATGA
+CGGTGAACATGGAAGACGGAATACCCATCGCTTTCAGGATGATACCAGAGTAGAAATCGACGTTCGGGTACAGTTTCTTCTCGATAAAGTACGGGTCGTT
+CAGCGCGATGTTTTCCAGCTCCATAGCCACTTCCAGCAGGTCATCCTTCGTGCCCAGCTCTTTCAGCACTTCATGGCAGGTTTCACGCATTACGGTGGCG
+CGCGGGTCGTAATTTTTGTACACGCGGTGACCGAAGCCCATCAGGCGGAAAGAATCATTTTGTCTTTCGCACGACGAACAAATTCCGGAATGTGTTTAAC
+GGAGCTGATTTCTTCCAGCATTTTCAGCGCCGCTTCGTTAGCACCGCCGTGCGCAGGTCCCCACAGTGAAGCAATACCTGCTGCGATACAGGCAAACGGG
+TTCGCACCCGAAGAGCCAGCGGTACGCACGGTGGAGGTAGAGGCGTTCTGTTCATGGTCAGCGTGCAGGATCAGAATACGGTCCATAGCACGTTCCAGAA
+TCGGATTAACTTCATACGGTTCGCACGGCGTGGAGAACATCATATTCAGGAAGTTACCGGCGTAGGAGAGATCGTTGCGCGGGTAAACAAATGGCTGACC
+AATGGAATACTTGTAACACATCGCGGCCATGGTCGGCATTTTCGACAGCAGGCGGAACGCGGCAATTTCACGGTGACGAGGATTGTTAACATCCAGCGAG
+TCGTGATAGAACGCCGCCAGCGCGCCGGTAATACCACACATGACTGCCATTGGATGCGAGTCGCGACGGAAAGCATGGAACAGACGGGTAATCTGCTCGT
+GGATCATGGTATGACGGGTCACCGTAGTTTTAAATTCGTCATACTGTTCCTGAGTCGGTTTTTCACCATTCAGCAGGATGTAACAAACTTCCAGGTAGTT
+AGAATCGGTCGCCAGCTGATCGATCGGGAAACCGCGGTGCAGCAAAATACCTTCATCACCATCAATAAAAGTAATTTTAGATTCGCAGGATGCGGTTGAA
+GTGAAGCCTGGGTCAAAGGTGAACACACCTTTTGAACCGAGTACGGATATCAATAACATCTTGACCCAGCGTGCCTTTCAGCACATCCAGTTCAACAGCT
+GTATCCCCGTTGAGGGTGAGTTTTGCTTTTATCAGCCATTTAAGGTCTCCTTAGCGCCTTATTGCGTAAGACTGCCGGAACTTAAATTTGCCTTCGCACA
+TCAACCTGGCTTTACCCGTTTTTATTTGGCTCGCCGCTCTGTGAAAGAGGGAAAACCTGGGTACAGAGCTCTGGGCGCTTGCAGGTAAAGGATCCATTGA
+TGACGAATAAATGGCGAATCAAGTACTTAGCAATCCGAATTATTAAACTTGTCTACCACTAATAACTGTCCCGAATGAATTGGTCAATACTTCCACACTG
+TTACATAAGTTAATCTTAGGTGAAATACCGACTTCATAACTTTTACGCATTATATGCTTTTCCTGGTAATGTTTGTAACAACTTTGTTGAATGATTGTCA
+AATTAGATGATTAAAATTAAATAAATGTTGTTATCGTGACCTGGATCACTGTTCAGGATAAAACCCGACAAACTATATGTAGGTTAATTGTAATGATTTT
+GTGAACAGCCTATACTGCCGCCAGGTCTCCGGAACACCCTGCAATCCCGAGCCACCCAGCGTTGTAACGTGTCGTTTTCGCATCTGGAAGCAGTGTTTTG
+CATGACGCGCAGTTATAGAAAGGACGCTGTCTGACCCGCAAGCAGACCGGAGGAAGGAAATCCCGACGTCTCCAGGTAACAGAAAGTTAACCTCTGTGCC
+CGTAGTCCCCAGGGAATAAGAACAGCATGTGGGCGTTATTCATGATAAGAAATGTGAAAAACAAAGACCTGTTAATCTGGACCTACAGACCATCCGGTTC
+CCCATCACGGCGATAGCGTCCATTCTCCATCGCGTTTCCGGTGTGATCACCTTTGTTGCAGTGGGCATCCTGCTGTGGCTTCTGGGTACCAGCCTCTCTT
+CCCCTGAAGGTTTCGAGCAAGCTTCCGCGATTATGGGCAGCTTCTTCGTCAAATTTATCATGTGGGGCATCCTTACCGCTCTGGCGTATCACGTCGTCGT
+AGGTATTCGCCACATGATGATGGATTTGGCTATCTGGAAGAAACATTCGAAGCGGGTAAACGCTCCGCCAAAATCTCCTTTGTTATTACTGTCGTGCTTT
+CACTTCTCGCAGGAGTCCTCGTATGGTAAGCAACGCCTCCGCATTAGGACGCAATGGCGTACATGATTTCATCCTCGTTCGCGCTACCGCTATCGTCCTG
+ACGCTCTACATCATTTATATGGTCGGTTTTTCGCTACCAGTGGCGAGCTGACATATGAAGTCTGGATCGGTTTCTTCGCCTCTGCGTTCACCAAAGTGTT
+CACCCTGCTGGCGCTGTTTTCTATCTTGATCCATGCCTGGATCGGCATGTGGCAGGTGTTGACCGACTACGTTAAACCGCTGGCTTTGCGCCTGATGCTG
+CAACTGGTGATTGTCGTTGCACTGGTGGTTTACGTGATTTATGGATTCGTTGTGGTGTGGGGTGTGTGATGAAATTGCCAGTCAGAGAATTTGATGCAGT
+TGTGATTGGTGCCGGTGGCGCAGGTATGCGCGCGGCGCTGCAAATTTCCCAGAGCGGCCAGACCTGTGCGCTGCTCTCTAAAGTCTTCCCGACCCGTTCC
+CATACCGTTTCTGCGCAAGGCGGCATTACCGTTGCGCTGGGTAATACCCATGAAGATAACTGGGAATGGCATATGTACGACACCGTGAAAGGGTCGGACT
+ATATCGGTGACCAGGACGCGATTGAATATATGTGTAAAACCGGGCCGGAAGCGATTCTGGAACTCGAACACATGGGCCTGCCGTTCTCGCGTCTCGATGA
+TGGTCGTATCTATCAACGTCCGTTTGGCGGTCAGTCGAAAAACTTCGGCGGCGAGCAGGCGGCACGCACTGCGGCAGCAGCTGACCGTACCGGTCACGCA
+CTGTTGCACACGCTTTATCAGCAGAACCTGAAAACCACACCACCATTTTCTCCGAGTGGTATGCGCTGGATCTGGTGAAAACCAGGATGGCGCGGTGGTG
+GGTTGTACCGCACTGTGCATCGAAACCGGTGAAGTGGTTTATTTCAAAGCCCGCGCTACCGTGCTGGCGACTGGCGGAGCAGGGCGTATTTATCAGTCCA
+CCACCAACGCCCACATTAACACCGGCGACGGTGTCGGCATGGCTATCCGTGCCGGCGTACCGGTGCAGGATATGGAAATGTGGCAGTTCCACCGACCGGC
+ATTGCCGGTGCGGGCGTACTGGTCACCGAAGGTTGCCGTGGTGAAGGCGGTTATCTGCTGAACAAACATGGCGAACGTTTTATGGAGCGTTATGCGCCGA
+ACGCCAAAGACCTGGCGGGCCGTGACGTGGTTGCGCGTTCCATCATGATCGAAATCCGTGAAGGTCGCGGCTGTGATGGTCCGTGGGGCCACACGCGAAA
+CTGAAACTCGATCACCTGGGTAAAGAAGTTCTCGAATCCCGTCTGCCGGGTATCCTGGAGCTTTCCCGTACCTTCGCTCACGTCGATCCGGTGAAAGAGC
+CGATTCCGGTTATCCCAACCTGTCACTACATGATGGGCGGTATTCCGACCAAAGTTACCGGTCAGGCACTGACTGTGAATGAGAAAGGCGAAGATGTGGT
+TGTTCCGGGACTGTTTGCCGTTGGTGAAATCGCTTGTGTATCGGTACACGGCGCTAACCGTCTGGGCGGCAACTCGCTGCTGGACCTGGTGGTCTTTGGT
+CGCGCGGCAGGTCTGCATCTGCAAGAGTCTATCGCCGAGCAGGGCGCACTGCGCGATGCCAGCGAGTCTGATGTTGAAGCGTCTCTGGATCGCCTGAACC
+GCTGGAACAATAATCGTAACGGTGAAGATCCGGTGGCGATCCGTAAAGCGCTGCAAGAATGTATGCAGCATAACTTCTCGGTCTTCCGTGAAGGTGATGC
+GATGGCGAAAGGGCTTGAGCAGTTGAAAGTGATCCGCGAGCGTCTGAAAATGCCCGTCTGGATGACACTTCCAGCGAGTTCAACACCCAGCGCGTTGAGT
+GCCTGGAACTGGATAACCTGATGGAAACGGCGTATGCAACGGCTGTTTCTGCCAACTTCCGTACCGAAAGCCGTGGCGCGCATAGCCGCTTCGACTTCCC
+GGATCGTGATGATGAAAACTGGCTGTGCCACTCCTGTATCTGCCAGAGTCGGAATCCATGACGCGCCGAAGCGTCAACATGGAACCGAAACTGCGCCCGG
+CATTCCCGCCGAAGATTCGTACTTACTAATGCGGAGACAGGAAAATGAGACTCGAGTTTTCAATTTATCGCTATAACCCGGATGTTGATGATGCTCCGCG
+TATGCAGGATTACACCCTGGAAGCGGATGAAGGTCGCGACATGATGCTGCTGGATGCGCTTATCCAGCTAAAAGAGAAAGATCCCAGCCTGTCGTTCCGC
+CGCTCCTGCCGTGAAGGTGTGTGCGGTTCCGACGGTCTGAACATGAACGGCAAGAATGGTCTGGCCTGTATTACCCCGATTTCGGCACTCAACCAGCCGG
+GCAAGAAGATTGTGATTCGCCCGCTGCCAGGTTTACCGGTGATCCGCGATTTGGTGGTAGACATGGGACAATTCTATGCGCAATATGAGAAAATTAAGCC
+TTACCTGTTGAATAATGGACAAAATCCGCCAGCTCGCGAGCATTTACAGATGCCAGAGCAGCGCGAAAAACTCGACGGGCTGTATGAATGTATTCTCTGC
+GCATGTTGTTCAACCTCTTGTCCGTCTTTCTGGTGGAATCCCGATAAGTTTATCGGCCCGGCAGGCTTGTTAGCGGCATATCGTTTCCTGATTGATAGCC
+GTGATACCGAGACTGACAGCCGCCTCGACGGTTTGAGTGATGCATTCAGCGTATTCCGCTGTCACAGCATCATGAACTGCGTCAGTGTATGTCCGAAGGG
+CTGAACCCGACGCGCGCCATCGGCCATATCAAGTCGATGTTGTTGCAACGTAATGCGTAAACCGTAGGCCTGATAAGACGCGCAAGCGTCGCATCAGGCA
+ACCAGTGCCGGATGCGGCGTGAACGCCTTATCCGGCCTACAAGTCATTACCCGTAGGCCTGATAAGCGCAGCGCATCAGGCGTAACAAAGAAATGCAGGA
+AATCTTTAAAACTGCCCCTGACACTAAGACAGTTTTAAAGGTTCCTTCGCGAGCCACTACGTAGACAAGAGCTCGCAAGTGAACCCCGGCACGCACATCA
+CTGTGCGTGGTAGTATCCACGGCGAAGTAAGCATAAAAAGATGCTTAAGGGATCACGATGCAGAACAGCGCTTTGAAAGCCTGGTTGGACTCTTCTTACC
+TCTCTGGCGCAAACCAGAGCTGGATAGAACAGCTCTATGAAGACTTCTTAACCGATCCTGACTCGGTTGACGCTAACTGGCGTTCGACGTTCCAGCAGTT
+ACCTGGTACGGGAGTCAAACCGGATCAATTCCACTCTCAAACGCGTGAATATTTCCGCCGCCTGGCGAAAGACGCTTCACGTTACTCTTCAACGATCTCC
+GACCCTGACACCAATGTGAAGCAGGTTAAAGTCCTGCAGCTCATTAACGCATACCGCTTCCGTGGTCACCAGCATGCGAATCTCGATCCGCTGGGACTGT
+GGCAGCAAGATAAAGTGGCCGATCTGGATCCGTCTTTCCACGATCTGACCGAAGCAGACTTCCAGGAGACCTTCAACGTCGGTTCATTTGCCAGCGGCAA
+AGAAACCATGAAACTCGGCGAGCTGCTGGAAGCCCTCAAGCAAACCTACTGCGGCCCGATTGGTGCCGAGTATATGCACATTACCAGCACCGAAGAAAAC
+GCTGGATCCAACAGCGTATCGAGTCTGGTCGCGCGACTTTCAATAGCGAAGAGAAAAACGCTTCTTAAGCGAACTGACCGCCGCTGAAGGTCTTGAACGT
+TACCTCGGCGCAAAATTCCTGGCGCAAAACGCTTCTCGCTGGAAGGCGGTGACGCGTTAATCCCGATGCTTAAAGAGATGATCCGCCACGCTGGCAACAG
+CGGCACCCGCGAAGTGGTTCTCGGGATGGCGCACCGTGGTCGTCTGAACGTGCTGGTGAACGTGCTGGGTAAAACCGCAAGACTTGTTCGACGAGTTCGC
+CGGTAAACATAAAGAACACCTCGGCACGGGTGACGTGAAATACCACATGGGCTTCTCGTCTGACTTCCAGACCGATGGCGGCCTGGTGCACCTGGCGCTG
+GCGTTTAACCCGTCTCACCTTGAGATTGTAAGCCCGGTAGTTATCGGTTCTGTTCGTGCCCGTCTGGACAGACTTGATGAGCCGAGCAGCAACAAAGTGC
+TGCCAATCACCATCCACGGTGACGCCGCAGTGACCGGGCAGGGCGTGGTTCAGGAAACCCTGAACATGTCGAAAGCGCGTGGTTATGAAGTTGGCGGTAC
+GGTACGTATCGTTATCAACAACCAGGTTGGTTTCACCACCTCTAATCCGCTGGATGCCCGTTCTACGCCGTACTGTACTGATATCGGTAAGATGGTTCAG
+GCCCCGATTTTCCACGTTAACGCGGACGATCCGGAAGCCGTTGCCTTTGTGACCCGTCTGGCGCTCGATTTCCGTAACACCTTTAAACGTGATGTCTTCA
+TCGACCTGGTGTGCTACCGCCGTCACGGCCACAACGAAGCCGACGAGCCGAGCGCAACCCAGCCGCTGATGTATCAGAAAATCAAAAACATCCGACACCG
+CGCAAAATCTACGCTGACAAGCTGGAGCAGGAAAAGTGGCGACGCTGGAAGATGCCACCGAGATGGTTAACCTGTACCGCGATGCGCTGGATGCTGGCGA
+TTGCGTAGTGGCAGAGTGGCGTCCGATGAACATGCACTCTTTCACCTGGTCGCCGTACCTCAACCACGAATGGGACGAAGAGTACCCGAACAAAGTTGAG
+ATGAAGCGCCTGCAGGAGCTGGCGAAACGCATCAGCACGGTGCCGGAAGCAGTTGAAATGCAGTCTCGCGTTGCCAAGATTTATGGCGATCGCCAGGCGA
+TGGCTGCCGGTGAGAAACTGTTCGACTGGGGCGGTGCGGAAAACCTCGCTTACGCCACGCTGGTTGATGAAGGCATTCCGGTTCGCCTGTCGGGTGAAGA
+CTCCGGTCGCGGTACCTTCTTCCACCGCCACGCGGTGATCCACAACCAGTCTAACGGTTCCACTTACACGCCGCTGCAACATATCCATAACGGGCAGGGC
+GCGTTCCGTGTCTGGGACTCCGTACTGTCTGAAGAAGCAGTGCTGGCGTTTGAATATGGTTATGCCACCGCAGAACCACGCACTCTGACCATCTGGGAAG
+CGCAGTTCGGTGACTTCGCCAACGGTGCGCAGGTGGTTATCGACCAGTTCATCTCCTCTGGCGAACAGAAATGGGGCCGGATGTGTGGTCTGGTGATGTT
+GCTGCCGCACGGTTACGAAGGGCAGGGGCCGGAGCACTCCTCCGCGCGTCTGGAACGTTATCTGCAACTTTGTGCTGAGCAAAACATGCAGGTTTGCGTA
+CCGTCTACCCCGGCACAGGTTTACCACATGCTGCGTCGTCAGGCGCTGCGCGGGATGCGTCGTCCGCTGGTCGTGATGTCGCCGAAATCCCTGCTGCGTC
+ATCCGCTGGCGGTTTCCAGCCTCGAAGAACTGGCGAACGGCACCTTCCTGCCAGCCATCGGTGAAATCGACGAGCTTGATCCGAAGGGCGTGAAGCGCGT
+AGTGATGTGTTCTGGTAAGGTTTATTACGACCTGCTGGAACAGCGTCGTAAGAACAATCAACACGATGTCGCCATTGTGCGTATCGAGCAACTCTACCCG
+TTCCCGCATAAAGCGATGCAGGAAGTGTTGCAGCAGTTTGCTCACGTCAAGGATTTTGTCTGGTGCCAGGAAGAGCCGCTCAACCAGGGCGCATGGTACT
+GCAGCCAGCATCATTTCCGTGAAGTGATTCCGTTTGGGGCTTCTCTGCGTTATGCAGGCCGCCCGGCCTCCGCCTCTCCGGCGGTAGGGTATATGTCCGT
+TCACCAGAAACAGCAACAAGATCTGGTTAATGACGCGCTGAACGTCGAATAAATAAAGGATACACAATGAGTAGCGTAGATATTCTGGTCCCTGACCTGC
+CTGAATCCGTAGCCGATGCCACCGTCGCAACCTGGCATAAAACCCGGCGACGCAGTCGTACGTGATGAAGTGCTGGTAGAAATCGAAACTGACAAAGTGG
+TACTGGAAGTACCGGCATCAGCAGACGGCATTCTGGATGCGGTTCTGGAAGATGAAGGTACAACGGTAACGTCTCGTCAGATCCTTGGTCGCCTGCGTGA
+AGGCAACAGCGCCGGTAAAGAAACCAGCGCCAAATCTGAAGAGAAAGCGTCCACTCCGGCGCAACGCCAGCAGGCGTCTCTGGAAGAGCAAAACAACGAT
+GCGTTAAGCCCGGCGATCCGTCGCCTGCTGGCTGAACACAATCTCGACGCCAGCGCCATTAAAGGCACCGGTGTGGGTGGTCGTCTGACTCGTGAAGATG
+TGGAAAACATCTGGCGAAAGCCCCGGCGAAAGAGTCTGCTCCGGCAGCGGCTGCTCCGGCGGCGCAACCGGCTCTGGCTGCACGTAGTGAAAAACGTGTC
+CCGATGACTCGCCTGCGTAAGCGTGTGGCAGAGCGTCTGCTGGAAGCGAAAAACTCCACCGCCATGCTGACCACGTTCAACGAAGTCAACATGAAGCCGA
+TTATGGATCTGCGTAAGCAGTACGGTGAAGCGTTTGAAAAACGCCACGGCATCCGTCTGGGCTTTATGTCCTTCTACGTGAAAGCGGTGGTTGAAGCCCT
+GAAACGTTACCCGGAAGTGAACGCTTCTATCGACGGCGATGACGTGGTTTACCACAACTATTTCGACGTCAGCATGGCGGTTTCTACGCCGCGCGGCCTG
+GTGACGCCGGTTCTGCGTGATGTCGATACCCTCGGCATGGCAGACATCGAGAAGAAAATCAAAGAGCTGGCAGTCAAAGGCCGTGACGGCAAGCTGACCG
+TTGAAGATCTGACCGGTGGTAACTTCACCATCACCAACGGTGGTGTGTTCGGTTCCCTGATGTCTACGCCGATCATCAACCCGCCGCAGAGCGCAATTCT
+GGGTATGCACGCTATCAAAGATCGTCCGATGGCGGTGAATGGTCAGGTTGAGATCCTGCCGATGATGTACCTGGCGCTGTCCTACGATCACCGTCTGATC
+GATGGTCGCGAATCCGTGGGCTTCCTGGTAACGATCAAAGAGTTGCTGGAAGATCCGACGCGTCTGCTGCTGGACGTGTAGTAGTTTAAGTTTCACCTGC
+ACTGTAGACCGGATAAGGCATTATCGCCTTCTCCGGCAATTGAAGCCTGATGCGACGCTGACGCGTCTTATCAGGCCTACGGGACCACCAATGTAGGTCG
+GATAAGGCGCAAGCGCCGCATCCGACAAGCGATGCCTGATGTGACGTTTAACGTGTCTTATCAGGCCTACGGGTGACCGACAATGCCCGGAAGCGATACG
+AAATATTCGGTCTACGGTTTAAAAGATAACGATTACTGAAGGATGGACAGAACACATGAACTTACATGAATATCAGGCAAAACAACTTTTGCCCGCTATG
+GCTTACCAGCACCGGTGGGTTATGCCTGTACTACTCCGCGCGAAGCAGAAGAAGCCGCTTCAAAATCGGTGCCGGTCCGTGGGTAGTGAAATGTCAGGTT
+CACGCTGGTGGCCGCGGTAAAGCGGGCGGTGTGAAAGTTGTAAACAGCAAAGAAGACATCCGTGCTTTTGCAGAAAACTGGCTGGGCAAGCGTCTGGTAA
+CGTATCAAACAGATGCCAATGGCCAACCGGTTAACCAGATTCTGGTTGAAGCAGCGACCGATATCGCTAAAGAGCTGTATCTCGGTGCCGTTGTTGACCG
+TAGTTCCCGTCGTGTGGTCTTTATGGCCTCCACCGAAGGCGGCGTGGAAATCGAAAAAGTGGCGGAAGAAACTCCGCACCTGATCCATAAAGTTGCGCTT
+GATCCGCTGACTGGCCCGATGCCGTATCAGGGACGCGAGCTGGCGTTCAAACTGGGTCTGGAAGGTAAACTGGTTCAGCAGTTCACCAAAATCTTCATGG
+GCCTGGCGACCATTTTCCTGGAGCGCGACCTGGCGTTGATCGAAATCAACCCGCTGGTCATCACCAAACAGGGCGATCTGATTTGCCTCGACGGCAAACT
+GGGCGCTGACGGCAACGCACTGTTCCGCCAGCCTGATCTGCGCGAAATGCGTGACCAGTCGCAGGAAGATCCGCGTGAAGCACAGGCTGCACAGTGGGAA
+CTGAACTACGTTGCGCTGGACGGTAACATCGGTTGTATGGTTAACGGCGCAGGTCTGGCGATGGGTACGATGGACATCGTTAAACTGCACGGCGGCGAAC
+CGGCTAACTTCCTTGACGTTGGCGGCGGCGCAACCAAAGAACGTGTAACCGAAGCGTTCAAAATCATCCTCTCTGACGACAAAGTGAAAGCCGTTCTGGT
+TAACATCTTCGGCGGTATCGTTCGTTGCGACCTGATCGCTGACGGTATCATCGGCGCGGTAGCAGAAGTGGGTGTTAACGTACCGGTCGTGGTACGTCTG
+GAAGGTAACAACGCCGAACTCGGCGCGAAGAAACTGGCTGACAGCGGCCTGAATATTATTGCAGCAAAGGTCTGACGGATGCAGCTCAGCAGGTTGTTGC
+CGCAGTGGAGGAAATAATGTCCATTTTAATCGATAAAACACCAAGGTTATCTGCCAGGGCTTTACCGGTAGCCAGGGACTTTCCACTCAGAACAGGCCAT
+TGCATACGGCACTAAAATGGTTGGCGGCGTAACCCCAGGTAAAGGCGGCACCACCCACCTCGGCCTGCCGGTGTTCAACACCGTGCGTGAAGCCGTTGCT
+GCCACTGGCGCTACCGCTTCTGTTATCTACGTACCAGCACCGTTCTGCAAAGACTCCATTCTGGAAGCCATCGACGCAGGCATCAAACTGATTATCACCA
+TCACTGAAGGCATCCCGACGCTGGATATGCTGACCGTGAAAGTGAAGCTGGATGAAGCAGGCGTTCGTATGATCGGCCCGAACTGCCCAGGCGTTATCAC
+TCCGGGTGAATGCAAAATCGGTATCCAGCCTGGTCACATTCACAAACCGGGTAAAGTGGGTATCGTTTCCCGTTCCGGTACACTGACCTATGAAGCGGTT
+AAACAGACCACGGATTACGGTTTCGGTCAGTCGACCTGTGTCGGTATCGGCGGTGACCCGATCCGGGCTCTAACTTTATCGACATTCTCGAAATGTTCGA
+AAAGATCCGCAGACCGAAGCGATCGTGATGATCGGTGAGATCGGCGGTAGCGCTGAAGAAGAAGCAGCTGCGTACATCAAAGAGCACGTTACCAAGCCAG
+TTGTGGGTTACATCGCTGGTGTGACTGCGCCGAAAGGCAAACGTATGGGCCACGCGGGTGCCATCATTGCCGGTGGGAAAGGGACTGCGGATGAGAAATT
+CGCTGCTCTGGAAGCCGCAGGCGTGAAAACCGTTCGCAGCCTGGCGGATATCGGTGAAGCACTGAAAACTGTTCTGAAATAAATATCTGTAATAAGAAAT
+AGCCCTCGCCGCTTCCCTCTACAGGAATGGCGAAGGGCTGTCGGTTTCGACATGGTTGGCCATCGTATGATGGCCTTTTGTGCTTATCGCGATGATTTTC
+GCTGCGCTATCAGGGTAAATTTATAGTCATCGGTATTAAAAGCGTTGCGGCTATATTCAAACACCCGACCATCAACTAAATATCCACGCGATACTTTTCA
+AGAATCGGCTTTGTCTGGCTGATATTAAGCAGACGGCTCATCTCTTCGGTTGGCATCAGAGGAATGATTTCCTGTTCGCTACGATCGATAACCATTTTCT
+TCACTTCTTCGATAAAGTGATATTTCGAATTTTCCATGACCTGCCAGGTGAGATCCGGGAACAACGCAAGCGGCATCCAGGTTTCTTCCAGCGCCATTGG
+CTTTTGCTTGCGATAGCGCACGCGCTTCACATGCCACACACGATCCTGCGGGGTGATTTGTAGCTGTTGCTGAAGAAAATCGTCAGCCGGAATCACTTCG
+AATATCAGAACTTCACTGTGTGTATCGACGTGACGGTCCGACAGTTTTCATCAAAACTGGTTAACTGAAAAATATCGTAATTGACCCGCTCTTCTTTGAC
+GTAAGTCCCGCTGCCCTGAATGCTTTCGAGGATCTGCTGCTCGACTAGCTGGCGCAAAGCCTGACGCACCGTAACCCGGCTGACGCCAAACTCTGTTTGT
+AGCGCTGATTCAGTGGGTAACGCATCGCCAGGTTTAAGCTCGCCACGCGCAATTTGTTCACGAATGCGATCGGCAATCTGCCGGTATAAGGGCTTGTGTC
+CCATTTTTAGTATCTCATTAATACGAATTTAACCATTATGCCCGATAAATTCATCCTGTAAATAATACAAATACAATACAAATAATTTCAATCAAGTGAA
+ATTGATCACATAATGGTATTGTTTTATCGGGCACACTGGCGCGACTATAAAACGATCAAGTGAGGATCATGATGAATCTGACGACTCTGACCCACCGCGA
+TGCGTTGTGTCTGAATGCGCGCTTTACCAGCCGTGAAGAGGCCATCCACGCGTTGACTCAACGTCTTGCTGCTCTGGGGAAAATTTCCAGTACTGAGCAA
+TTTCTGGAAGAAGTGTATCGCCGTGAAAGCCTTGGCCCGACCGCCTTAGGTGAAGGGTTGGCTGTGCCGCATGGCAAAACTGCTGCGGTAAAGAAGCGGC
+GTTTGCGGTCGCCACACTCAGCGAGCCGCTTCAGTGGGAAGGCGTTGATGGCCCGGAAGCAGTTGATTTAGTGGTGCTGCTGGCGATTCCCCAATGAAGC
+GGGTACTACGCATATGCAACTGCTGACAGCGCTGACCACGCGCCTTGCGGATGATGAGATTCGGGCGCGTATACAGTCGGCGACGACGCCTGATGAGTTG
+CTCTCGGCGCTGGATGACAAGGAGGCACGCAACCTTCTGCCTCTTTTTCCAACGCGCCAACTATCGTCTGCGTAACGGCCTGTCCGGCGGGTATTGCTCA
+CACCTATATGGCTGCGGAATATCTGGAAAAAGCCGGACGCAAACTCGGCGTAAATGTTTACGTTGAAAAACAAGGCGCTAACGGCATTGAAGGGCGTTTA
+ACGGCGGATCAACTCAATAGTGCAACCGCCTGTATTTTTGCGGCTGAAGTCGCCATCAAGGAGAGTGAGCGTTTTAATGGCATTCCCGCGCTTTCAGTGC
+CTGTTGCCGAGCCGATTCGCCATGCAGAAGCGTTGATCCAACAAGCGCTTACCCTCAAGCGTAGCGATGAGACGCGTACCGTACAGCAAGATACGCAACC
+GGTGAAAAGTGTCAAAACGGAGCTGAAACAGGCACTGTTGAGCGGAATCTCTTTGCCGTACCGTTGATTGTCGCGGGGGCACGGTGCTGGCGGTCGCGGT
+ATTACTGTCGCAAATCTTCGGGCTACAAGATCTGTTTAATGAAGAAAACTCCTGGCTGTGGATGTACCGCAAGCTGGGCGGCGGGCTGCTCGGAATTTTG
+ATGGTACCGGTGCTCGCGGCCTATACCGCCTATTCTCTGGCAGATAAACCGGCGTTAGCGCCAGGCTTTGCGGTTGGACTTGCCGCCAACATGATCGGCT
+CCGGGTTTCTCGGCGCGGTCGTTGGCGGATTGATAGCCGGTTACTTGATGCGCTGGGTGAAAATCACTTGCGTCTTAGCAGTAAATTCAATGGATTCCTG
+ACTTTTATCTCTACCCGGTGCTCGGTACGTTGGGAGCGGGCAGTCTGATGCTGTTTGTGGTGGGGAACCTGTCGCCTGGATCAATAACTCGCTTACCGCC
+TGGCTGAACGGTCTGTCAGGAAGTAACGCGCTGTTGCTGGGTGCCATTCTCGGTTTTATGTGTTCCTTTGACCTTGGAGGGCCAGTGAATAAAGCCGCTT
+ATGCATTCTGCCTGGGCGCAATGGCGAACGGCGTTTACGGCCCGTATGCCATTTTCGCCTCCGTCAAAATGGTTTCGGCATTTACCGTAACCGCTTCCAC
+GATGCTCGCACCGCGCCTGTTTAAAGAGTTTGAAATTGAGACCGGAAATCCACCTGGCTGTTAGGGCTGGCAGGTATTACCGAAGGGCGATCCCGATGGC
+GATTGAAGATCCGCTGCGGGTTATTGGTTCGTTTGTGCTGGGCTCTATGGTAACGGGCGCTATTGTCGGTGCGATGAATATCGGCCTTTCGACACCCGGT
+GCCGGCATTTTCTCGCTCTTTTACTTCATGATAATGGCGCGGGCGGTGTTATGGCGGCAATTGGCTGGTTTGGCGCGGCATTGGTGGGGCTGCAATCTCG
+ACTGCAATTCTCCTGATGTGGCGGCGTCACGCGGTTAAGCATGGCAACTATCTGACTGATGGCGTAATGCCATAAACAAAAAGGAAACGACGATGAAAGC
+AGTATCTCGCGTTCACATCACCCCGCATATGCACTGGGATCGAGAGTGGTATTTCACCACCGAAGAGTCACGTATTCTGCTGGTCAATAATATGGAAGAG
+ATCCTGTGCCGACTGGAACAGGACAACGAATACAAATATTACGTACTCGACGGGCAAACGGCGATCCTCGAAGATTATTTCGCGGTGAAACCGGAAAACA
+AAGACCGTGTGAAGAAACAGGTAGAAGCCGGCAAGTTGATTATCGGCCCCTGGTATACCCAGACCGATACCACGATTGTTTCTGCGGAATCCATCGTCCG
+TAATCTGATGTACGGAATGCGTGACTGCCTCGCGTTTGGCGAGCCGATGAAAATAGGTTATTTACCAGATTCCTTTGGCATGTCCGGGCAACTGCCGCAT
+ATCTACAATGGATTTGGCATTACCCGCACCATGTTCTGGCGCGGATGTTCGGAGCGCCACGGTACTGATAAAACCGAGTTTTGTGGCAAAGCAGTGACGG
+TAGCGAAGTGACGGCGCAGGTGCTGCCGCTGGGCTACGCCATCGGTAAGTACTTACCTGCCGACGAAAACGGATTACGTAAACGCCTCGACAGTTATTTT
+GACGTGCTGGAAAAAGCGTCTGTAACCAAAGAGATTTTGCTGCCGAATGGGCATGACCAGATGCCATTGCAGCAAAATATCTTCGAAGTGATGGATAAGC
+TACGTGAGATCTACCCTCAACGTAAGTTTGTGATGAGCCGCTTTGAAGAGGTATTTGAGAAGATCGAAGCGCAGCGAGATAATCTGGCAACCCTGAAAGG
+GGAATTTATTGATGGCAAATATATGCGCGTGCATCGCACCATCGGTTCTACGCGTATGGATATCAAAATTGCCCACGCGCGTATTGAAAATAAGATTGTT
+AATCTGCTGGAACCGCTGGCAACACTGGCCTGGACGTTGGGTTTTGAATACCACCACGGCTTGCTGGAGAAAATGTGGAAAGAGATCTTAAAAATCATGC
+CCACGACAGTATCGGCTGCTGCTGTAGTGACAAAGTTCATCGCGAAATCGTCGCCCGCTTCGAACTGGCTGAAGACATGGCGGATAATCTGATTCGTTTC
+TACATGCGCAAAATTGCCGACAACATGCCGCAGAGCGACGCCGACAAACTCGTCCTGTTTAACCTGATGCCCTGGCCGCGTGAAGAAGTTATCAACACCA
+CTGTGCGGCTGCGCGCCAGCCAGTTTAATTTGCGGGACGATCGCGGTCAGCCTGTACCGTATTTTATTCGCCATGCCCGTGAGATCGATCCAGGCCTAAT
+CGATCGGCAAATAGTTCATTACGGTAATTACGATCCCTTTATGGAGTTTGATATACAGATCAACCAGATTGTCCCTTCTATGGGCTATCGCACGCTTTAT
+ATCGAAGCGAATCAGCCTGGCAACGTAATTGCGGCAAAAGTGACGCTGAAGGGATACTGGAAAATGCTTTCTGGCAAATTGCGCTCAATGAGGATGGTTC
+TCTGCAACTGGTAGATAAAGACAGCGGTGTGCGCTATGACCGGGTATTGCAAATTGAAGAAAGCTCTGATGATGGTGATGAATATGACTATTCACCCGCA
+AAGAAGAGTGGGTAATTACCGCAGCGAACGCGAAACCGCAATGCGATATTATTCATGAAGCCTGGCAGAGCAGGGCTGTTATCCGCTATGACATGGCAGT
+GCCGCTCAATTTGTCAGAACGCAGCGCCCGGCAATCCACTGGCAGAGTAGGGTGGTGTTGGTTGTCACTCTTAGTCATAACAGCAGGCGTATTGATGTGG
+ATATCAATCTTGATAACCAGGCTGACGATCATCGCCTTCGTGTCCTGGTCCCTACACCTTTAACACCGACAGTGTTCTGGCAGATACGCAGTTTGGTTCG
+CTAACGCGCCCCGTGAACGACAGTGCAATGAACAACTGGCAGCAAGAAGGCTGGAAAGAAGCGCCGGTTCCGGTATGGAATATGCTCAACTATGTTGCCT
+TACAGGAAGGGCGTAACGGCATGGCTGTCTTTAGCGAAGGGTTACGTGAATTTGAAGTCATCGGTGAAGAGAAGAAAACCTTTGCCATTACGTTGCTGCG
+TGGCGTGGGCTTACTGGGCAAAGAAGATCTGCTTTTAAGGCCTGGGCGGCCTTCGGGAATTAAAATGCCAGTCCCGGACTCACAACTACGTGGTCTGCTT
+TCTTGTCGCCTAAGTTTATTGAGTTATACCGGTACGCCAACCGCCGCTGGTGTAGCTCAGCAGGCGCGAGCATGGCTGACTCCAGTACAGTGTTACAACA
+AAATCCCATGGGATGTGATGAAGCTCAACAAAGCCGGATTCAACGTGCCGGAAAGTTATAGTTTGTTGAAAATGCCCCAGTGGGATGCCTGATAAGCGCA
+CTTAAGAAAGCTGAAGACCGACAAGAAGTGATTTTACGGCTGTTTAATCCGGCTGAATCAGCAACCTGTGATGCGACTGTTGCTTTCAGTCGCGAGGTGA
+TTTCTTGCTCAGAAACGATGATGGATGAACACATTACCACCGAGGAAAATCAAGGTTCAAATCTATCGGGGCCTTTTTACCCGGCCAGTCACGGACGTTC
+AGTTACCGGCTTGCCTGAATAGCAATCAAACCGAAGCCACATATGCGCGGCCAGATTGTTGACAAAGGGCGCTTTGTTCATGCCGGATACGGCATGAACG
+CTTTATTCGGTCTACAAAAGCAGGCAAATTCAATATATTGCAGAGATGATGTAGACACTGGCAAGCGTAGCGCATCAGGTAATTTTGCGTTTATCTTCAC
+TCTCAAGCCACGTATATGTGGCTTTATTTTTAACAAAATAATAACCCTGGGTGAGTTAATTATAATATAATTATAAGTTAACTAAATGTTAATATTGGCG
+GGGTGGATTTATGCCTTTATTAGTAATCCTGAAACTCTGCGTCGTATTAGCCAGTGACCAAAAAGAATTAAGGTCAACCGTGCTGTTTTTGCTTCGTCTC
+TTTTATCTTTAATTGCCAACCGAAACTAATTTCAGCCTTATAACTCACACATTTTAAACATAAATGTCACTAAAGTTACCTTATTGAAACATGATTAACA
+TAATTTGTAGGAATTGATATTTATCAATGTATAAGTCTTGGAAATGGGCATCAAAAAGAGATAAATTGTTCTCGATCAAATTGGCTGAAAGGCGGTAATT
+TAGCTATAAATTGATCACCGTCGAAAAATGCAAATTTGCTTCAACAAAACCTGTTTATTGTAAGGATTTTGCGGCGTAATATATACGTGGGATCAATTTG
+AGTTTTTATTAACATGTTTGCAACCTTTCTTTACGCCGTTTTGTGTGCATTCACATGGTATGATGAAAGTGTTCAAACAAATTTCTATTGGGGCATGCGT
+GTGACCCTTTCTAACGGGGTTCACTCTCGGAGTCTTCATGCGATGAGCAAGGAGTCATGATGTTAGATATAGTCGAACTGTCGCGCTTACAGTTTGCCTT
+GACCGCGATGTACCACTTCCTTTTGTGCCACTGACGCTCGGTATGGCGTTCCTGCTGGCCATTATGGAAACGGTCTACGTCCTCTCCGGCAAACAGATTT
+ATAAAGATATGACCAAGTTCTGGGGCAAGTTGTTTGGTATCAACTTCGCTCTGGGTGTGGCTACCGGTCTGACCATGGAGTTCCAGTTCGGGACTAACTG
+GTCTTACTATTCCCACTATGTAGGGGATATCTTCGGTGCGCCGCTGGCAATCGAAGGTCTGATGGCCTTCTTCCTCGAATCCACCTTTGTAGGTCTGTTC
+TTCTTCGGTTGGGATCGTCTGGGTAAAGTTCAGCATATGTGTGTCACCTGGCTGGTGGCGCTCGGTTCAAACCTGTCCGCACTGTGGATTCTGGTTGCGA
+ACGGCTGGATGCAAAACCCAATCGCGTCCGATTTCAACTTTGAAACTATGCGTATGGAGATGGTGAGCTTCTCCGAGCTGGTGCTTAACCCGGTTGCTCA
+GGTGAAATTCGTTCACACTGTAGCGTCTGGTTATGTGACTGGCGCGATGTTCATCCTCGGTATCAGCGCATGGTATATGCTGAAAGGTCGTGACTTCGCC
+TTCGCTAAACGCTCCTTTGCTATCGCTGCCAGCTTCGGTATGGCTGCTGTTCTGTCTGTTATTGTTCTGGGTGATGAATCCGGCTACGAAATGGGCGACG
+TGCAGAAAACCAAACTGGCTGCTATTGAAGCCGAGTGGGAAACGCAACCTGCGCCTGCTGCCTTTACTCTGTTCGGCATTCCTGATCAGGAAGAGGAGAC
+GAACAAATTTGCGATTCAGATCCCTTACGCACTGGGCATCATTGCAACGCGTTCCGTGGATACCCCGGTTATCGGCCTGAAAGAGCTGATGGTGCAGCAT
+GAAGAACGCATTCGTAACGGGATGAAGGCGTACTCTCTGCTCGAACAACTGCGTTCTGGTTCTACCGACCAGGCGGTTCGTGACCAGTTCAATAGCATGA
+AGAAAGACCTCGGTTACGGTCTGCTGCTGAAACGCTATACGCCAAACGTGGCTGATGCGACTGAAGCGCAGATTCAACAGGCAACCAAAGACTCCATCCC
+GCGTGTAGCGCCGCTGTACTTTGCGTTCCGTATCATGGTGGCGTGTGGCTTCCTGCTTCTGGCAATCATCGCGCTCTCTTTCTGGAGTGTCATCCGCAAC
+CGCATTGGCGAGAAAAATGGCTTCTGCGCGCCGCGCTGTACGGTATTCCGCTGCCGTGGATTGCTGTAGAAGCGGGCTGGTTCGTGGCTGAATATGGCCG
+CCAACCGTGGGCTATCGGTGAAGTGCTGCCGACAGCTGTGGCGAACTCGTCACTGACCGCAGGCGATCTCATCTTCTCAATGGTGCTGATTTGCGGCCTG
+TATACCCTGTTCCTGGTGGCAGAATTGTTCTTAATGTTCAAGTTTGCACGCCTCGGCCCAAGCAGCCTGAAAACCGGTCGCTATCACTTTGAGCAGTCTT
+CCACGACTACTCAGCCGGCACGCTAAGACAGGAGTCGTCAAATGATCGATTATGAAGTATTGCGTTTTATCTGGTGGCTGCTGGTTGGCGTTCTGCTGAT
+TGGTTTTGCAGTCACTGACGGTTTCGACATGGGGTGGGCATGCTCACCCGTTTCCTCGGTCGTAACGACACCGAGCGTCGAATTATGATTAACTCCATTG
+CACCACACTGGGACGGTAACCAGGTTTGGCTGATCACCGCGGGCGGCGCACTCTTTGCTGCCTGGCCGATGGTCTATGCCGCTGCGTTCTCCGGCTTCTA
+TGTGGCGATGATCCTCGTGCTGGCGTCTTTGTTCTTCCGTCCGGTCGGTTTTGACTACCGCTCCAAGATTGAAGAAACCCGCTGGCGTAACATGTGGGAC
+TGGGGCATCTTCATTGGTAGCTTCGTTCCGCCGCTGGTAATTGGTGTAGCGTTCGGTAACCTGTTGCAGGGCGTACCGTTCAACGTTGATGAATATCTGC
+GTCTGTACTACACCGGTAACTTCTTCCAGTTGCTTAACCCGTTCGGCCTGCTGGCAGGCGTGGTGAGCGTAGGGATGATCATTACTCAGGGCGCAACCTA
+TCTGCAAATGCGTACCGTGGGCGAACTGCACCTGCGTACCCGTGCAACGGCTCAGGTGGCTGCGCTGGTGACACTGGTCTGTTTCGCACTGGCTGGCGTA
+TGGGTGATGTACGGTATCGATGGTTATGTCGTGAAATCGACAATGGACCATTACGCAGCCTCTAACCCACTGAATAAAGAAGTGGTTCGTGAAGCTGGCG
+CATGGCTGGTTAACTTCAACAACACGCCAATTCTGTGGGCTATTCCGGCACTGGGTGTGGTTCTGCCGCTGCTGACCATCCTGACTGCACGTATGGATAA
+AGCCGCGTGGGCGTTTGTGTTCTCCTCCCTGACGCTGGCCTGCATCATCCTGACAGCCGGTATCGCAATGTTCCCGTTTGTGATGCCGTCCAGCACCATG
+ATGAACGCAAGTCTGACAATGTGGGATGCAACTTCCAGCCAGCTGACGCTTAACGTCATGACCTGGGTTGCGGTGGTTCTGGTACCGATCATTCTGCTCT
+ACACCGCCTGGTGTTACTGGAAAATGTTCGGTCGTATCACCAAAGAAGATATTGAACGTAACACCCACTCTCTGTACTAAGTAAGGAGCTAAAAATGTGG
+TATTTCGCATGGATTCTGGGAACGCTTCTTGCCTGTTCGTTTGGGGTAATCACCGCGCTGGCGCTTGAACACGTCGAATCAGGCAAAGCCGGTCAAGAAG
+ACATCTGATGAGTAAGATTATCGCGACTTTGTATGCGGTAATGGACAAGCGCCCCTGCGGGCGCTTTCCTTCGTGATGGCGCTTCTGTTAGCAGGATGTA
+TGTTTTGGGACCCATCTCGTTTTGCCGCGAAGACCAGTGAACTGGAAATCTGGCATGGTTTATTGCTGATGTGGGCCGTCTGTGCTGGTGTGATTCACGG
+CGTGGGCTTTCGTCCGCAGAAGGTTCTTTGGCAAGGGATTTTTGCCCATTGCTTGCCGATATTGTTCTCATTGTCGGGCTGATTTTCTTCTTCTTTAAAT
+CAGAATTCTCTTTAAAAATTATGGGCCGCTCCAGGCCCATAAATTTTACGCTCCTTAACTTGCCCTCATTCCCAAACCTCAATCGCGCGCGTATAGTAGC
+AGCGTTTAAAAGCTCTAACTTTTGTTGCATTACCGGGATGTAAAGTGAATACAACGCTGTTTCGATGGCCGGTTCGCGTCTACTATGAAGATACCGATGC
+CGGTGGTGTGGTGTACCACGCCAGTTACGTCGCTTTTATGAAAGAGCACGCACAGAGATGCTGCGTCATCATCACTTCAGTCAGCAGGCGCTGATGGCTG
+AACGCGTTGCCTTTGTGGTACGTAAAATGACGGTGGAATATTACGCACCTGCGCGGCTCGACGATATGCTCGAAATACAGACTGAAATAACATCAATGCG
+TGGCACCTCTTTGGTTTTCACGCAACGTATTGTCAACGCCGAGAATACTTTGCTGAATGAAGCAGAGGTTCTGGTTGTTTGCGTTGACCCACTCAAAATG
+AAGCCTCGTGCGCTTCCCAAGTCTATTGTCGCGGAGTTTAAGCAGTGACTGACATGAATATCCTTGATTTGTTCCTGAAGGCTAGCCTTCTGGTTAAACT
+TATCATGTTGATTTTGATTGGTTTTTCAATCGCATCTTGGGCCATTATTATCCAGCGGACCCGTATTCTTAACGCAGCGGCGCGCGAAGCCGAAGCGTTT
+GAAGATAAATTCTGGTCTGGAATCGAACTCTCGCCTCTATCAAGAGAGCCAGGGAAACGGGATAATCTGACTGGTTCGGAACAAATCTTTACAGCGGGTT
+CAAAGAGTTTGTGCGCCTGCATCGTGCCAATAGCCATGCGCCGGAAGCCGTAGTGGAAGGGGCGTCGCGTGCTATGCGTATCTCCATGAACCGTGAACTT
+GAAAATCTGGAAACGCACATTCCGTTCCTCGGTACGGTTGGCTCCATCAGCCCGTATATTGGTCTGTTTGGTACGGTCTGGGGATCATGCACGCCTTTAT
+CGCCCTCGGGGCGGTAAAACAAGCAACACTGCAAATGGTTGCGCCCGGTATCGCAGAAGCGTTGATTGCGACTGCAATTGGTCTGTTTGCCGCTATCCCG
+GCAGTTATGGCCTACAACCGCCTCAACCAGCGCGTAAACAAACTGGAACTGAATTACGACAACTTTATGGAAGAGTTTACCGCGATTCTGCACCGCCAGG
+CGTTTACCGTTAGCGAGAGCAACAAGGGTAAGCCATGGCCAGAGCGCGTGGACGAGGTCGTCGCGATCTCAAGTCCGAAATCAACATTGTACCGTTGCTG
+GACGTACTGCTGGTGCTGTTGCTGATCTTTATGGCGACAGCGCCCATCATCACCCAGAGCGTGGAGGTCGATCTGCCAGACGCTACTGAATCACAGGCGG
+TGAGCAGTAACGATAATCCGCCAGTGATTGTTGAAGTGTCTGGTATTGGTCAGTACACCGTGGTGGTTGAGAAAGATCGCCTGGAGCGTTTACCACCAGA
+GCAGGTGGTGGCGGAAGTGTCCAGCCGTTTCAAGGCCAACCCGAAAACGGTCTTTCTGATCGGTGGCGCAAAAGATGTGCCTTACGATGAAATAATTAAA
+GCACTGAACTTGTTACATAGTGCGGGTGTGAAATCGGTTGGTTTAATGACGCAGCCTATCTAAACATCTGCGTTTCCCTTGCTTGAAAGAGAGCGGGTAA
+CAGGCGAACAGTTTTGGAAACCGAGAGTGTCAAAGGCAACCGAACAAAACGACAAGCTCAAGCGGGCGATAATTATTTCAGCAGTGCTGCATGTCATCTT
+ATTTGCGGCGCTGATCTGGAGTTCGTTCGATGAGAATATAGAAGCTTCAGCCGGAGGCGGCGGTGGTTCGTCCATCGACGCTGTCATGGTTGATTCAGGT
+GCGGTAGTTGAGCAGTACAAACGCATGCAAAGCCAGGAATCAAGCGCGAAGCGTTCTGATGAACAGCGCAAGATGAAGGAACAGCAGGCTGCTGAAGAAC
+TGCGTGAGAAACAAGCGGCTGAACAGGAACGCCTGAAGCAACTTGAGAAAGAGCGGTTAGCGGCTCAGGAGCAGAAAAAGCAGGCTGAAGAAGCCGCAAA
+ACAGGCCGAGTTAAAGCAGAAGCAAGCTGAAGAGGCGGCAGCGAAAGCGGCGGCAGATGCTAAAGCGAAGGCCGAAGCAGATGCTAAAGCTGCGGAAGAA
+GCAGCGAAGAAAGCGGCTGCAGACGCAAAGAAAAAGCAGAAGCAGAAGCCGCCAAAGCCGCAGCCGAAGCGCAGAAAAAGCCGAGGCAGCCGCTGCGGCA
+CTGAAGAAGAAAGCGGAAGCGGCAGAAGCAGCTGCAGCTGAAGCAAGAAAGAAAGCGGCAACTGAAGCTGCTGAAAAGCCAAAGCAGAAGCTGAGAAGAA
+AGCGGCTGCTGAAAAGGCTGCAGCTGATAAGAAAGCGGCAGCAGAGAAAGCTGCAGCCGACAAAAAGCAGCAGAAAAGCGGCTGCTGAAAAGGCAGCAGC
+TGATAAGAAAGCAGCGGCAGAAAAAGCCGCCGCAGACAAAAAGCGGCAGCGGCAAAAGCTGCAGCTGAAAAGCCGCTGCAGCAAAAGCGGCCGCAGAGGC
+AGATGATATTTTCGGTGAGCTAAGCTCTGGTAAGAATGCACCGAAAACGGGGAGGGGCGAAAGGAACAATGCTTCGCCTGCCGGGAGTGGTAATACTAAA
+ACAATGGCGCATCAGGGGCCGATATCAATAACTATGCCGGGCAGATTAAATCTGCTATCGAAAGTAAGTTCTATGACGCATCGTCCTATGCAGGCAAAAC
+CTGTACGCTGCGCATAAAACTGGCACCCGATGGTATGTTACTGGATATCAAACCTGAAGGTGGCGATCCCGCACTTTGTCAGGCTGCGTTGGCAGCAGCT
+AAACTTGCGAAGATCCCGAAACCACCAAGCCAGGCAGTATATGAAGTGTTCAAAAACGCGCCATTGGACTTCAAACCGTAATCGCGATGTTGACTGTTCG
+GACGGTCAACATCAGGCACCGGTTGCCACGGGGTTCTGGTAGTTTTGTGTATTTTAGTTTGTTAACATTCTGCTAAATTATCGTGGGCCATCGGTCCAGA
+TAAGGGAGATATGATGAAGCAGGCATTACGAGTAGCATTTGGTTTTCTCATACTGTGGGCATCAGTTCTGCATGCTGAAGTCCGCATTGTGATCGACAGC
+GGTGTAGATTCCGGTCGTCCTATTGGTGTTGTTCCTTTCCAGTGGGCGGGGCCTGGTGCGGCACCTGAAGATATTGGCGGCATCGTTGCTGCTGACTTGC
+GTAACAGCGGTAAATTTAATCCGTTAGATCGCGCTCGTCTGCCACAGCAGCCGGGTAGTGCGCAGGAAGTACAACCAGCTGCATGGTCCGCACTGGGCAT
+TGACGCTGTAGTTGTCGGTCAGGTCACCCGAATCCGGATGGTTCTTACAATGTTGCTTATCAACTTGTTGACACTGGCGGCGCACCGGGTACTGTACTTG
+CTCAGAACTCGTACAAAGTGAACAAGCAGTGGCTGCGTTATGCTGGTCATACCGCCAGTGATGAAGTGTTTGAAAAACTGACCGGCATTAAAGGTGCGTT
+CCGTACTCGTATTGCCTACGTTGTTCAGACCAACGGCGGTCAGTTCCCGTATGAACTGCGCGTATCTGACTATGACGGTTACAACCAGTTTGTCGTTCAC
+CGTTCACCGCAGCCGCTGATGTCTCCGGCGTGGTCACCAGACGGTTCTAAACTGGCTTATGTGACCTTCGAAAGCGGTCGTTCCGCGCTGGTTATTCAGA
+CGCTGGCAAATGGCGCTGTACGTCAGGTGGCTTCATTCCCGCGTCACAACGGTGCACCTGCATTCTCGCCAGACGGCAGCAAACTGGCATTCGCCTTGTC
+GAAAACCGGTAGTCTGAACCTGTACGTAATGGATTTGGCTTCTGGTCAGATCCGCCAGGTGACTGATGGTCGCAGTAACAATACCGAACCGACCTGGTTC
+CCGGATAGCCAGAACCTGGCATTTACTTCTGACCAGGCCGGTCGTCCGCAGGTTTATAAAGTGAATATCAACGGCGGTGCGCCACAACGTATTACCTGGG
+AAGGTTCGCAGAACCAGGATGCGGATGTCAGCAGCGACGGTAAATTTATGGTAATGGTCAGCTCCAATGGTGGGCAGCAGCACATTGCCAAACAAGATCT
+GGCAACGGGAGGCGTACAAGTTCTGTCGTCCACGTTCCTGGATGAAACGCCAAGTCTGGCACCTAACGGCACTATGGTAATCTACAGCTCTTCTCAGGGA
+TGGGATCCGTGCTGAATTTGGTTTCTACAGATGGGCGTTTCAAAGCGCGTCTTCCGGCAACTGATGGACAGGTCAAATTCCCTGCCTGGTCGCCGTATCT
+GTGATAATAATTAATTGAATAGTAAAGGAATCATTGAAATGCAACTGAACAAAGTGCTGAAAGGGCTGATGATTGCTCTGCCTGTTATGGCAATTGCGGC
+ATGTTCTTCCAACAAGAACGCCAGCAATGACGGCAGCGAAGGCATGCTGGGTGCCGGCACTGGTATGGATGCGAACGGCGGCAACGGCAACATGTCTTCC
+GAAGAGCAGGCTCGTCTGCAATGCAACAGCTGCAGCAGAACAACATCGTTTACTTCGATCTGGACAAGTACGATATCCGTTCTGACTTCGCTCAAATGCT
+GGATGCACATGCAAACTTCCTGCGTAGCAACCCGTCTTACAAAGTCACCGTAGAAGGTCACGCGGACGAACGTGGTACTCCGGAATACAACATCTCCTGG
+GTGAACGTCGTGCGAACGCCGTTAAGATGTACCTGCAGGGTAAAGGCGTTTCTGCAGACCAGATCTCCATCGTTTCTTACGGTAAAGAAAAACCTGCAGT
+ACTGGGTCATGACGAAGCGGCATACTCCAAAACCGTCGTGCGGTACTGGTTTACTAAGAGAATTGCATGAGCAGTAACTTCAGACATCAACTATTGAGTC
+TGTCGTTACTGGTTGGTATAGCGGCCCCTGGGCCGCTTTTGCTCAGGCACCAATCAGTAGTGTCGGCTCAGGCTCGGTCGAAGACCGCGTCACTCAACTT
+GAGCGTATTTCTAATGCTCACAGCCAGCTTTAACCCAACTCCAGCAACAACTTTCTGATAATCAATCCGATATTGATTCCCTGCGTGGTCAGATTCAGGA
+AAATCAGTATCAACTGAATCAGGTCGTGGAGCGGCAAAAGCAGATCCTGTTGCAGATCGACAGCCTCAGCAGCGGTGGTGCAGCGGCGCAATCAACCAGC
+GGCGATCAAAGCGGTGCGGCGGCATCAACGACGCCGACAGCTGATGCTGGTACTGCGAATGCTGGCGCGCCGGTGAAAAGCGGTAATGCAAACACGGATT
+ACAATGCAGCTATTGCGCTGGTGCAGGATAAATCCCGCCAGGATGACGCAATGGTGGCATTTCAGAATTTCATCAAAATTACCCTGATTCAACTTACCTG
+CCAAACGCCAATTATTGGCTGGGTCAGTTAAACTACAACAAGGGTAAAAAGATGATGCGGCGTACTATTTTGCTTCGGTAGTGAAAAACTATCCGAAGTC
+ACCAAAGGCTGCAGATGCGATGTTTAAAGTCGGCGTCATCATGCAGGACAAAGGTGACACCGCAAAAGCGAAAGCCGTATACCAGCAGGTTATCAGTAAA
+TACCCTGGTACTGATGGCGCTAAACAGGCACAAAACGTCTGAACGCGATGTAATGCATAACACACGACCAGAAGTCGCATTATTTCTGGTCGTGTCGTGC
+GAATCATAAGCAGTTGAGTGATCTACATCGAAATTTTGTTGCGCTCAAGTCTGAAATCAGTAATATATGCCGCCGTTGCCACGGGATATCAAACAAACCG
+AAAGCAACGAAAAGTGGGTCGTTAGCTCAGTTGGTAGAGCAGTTGACTTTTAATCAATTGGTCGCAGGTTCGAATCCTGCACGACCCACCAATCGCTAAG
+GTGGAAGCGGTAGTAAAACGTGAAGGATAACGTTGCATGAGCAACGGCCCGAAGGGCGAGACGAAGTCGAGTCATCCTGCACGACCCACCACTAACATAG
+TTAGTTGTAGTATCCAGCGTAGTATCGGGTGATTAGCTCAGCTGGGAGAGCACCTCCCTTACAAGGAGGGGTCGGCGGTTCGATCCCGTCATCACCCACC
+ACCGGGTCGTTAGCTCAGTTGGTAGAGCAGTTGACTTTTAATCAATTGGTCGCAGGTTCGAATCCTGCACGACCCACCAGTTTTAACATCGAAGACAGAT
+GTTAAGCGTGTAGGATAACGTTGCGTCAGCAACGGCCCGTAGGGCGAGCGAAGCGAGTCATCCTGCACGACCCACCACTAATGACGGTGGGTTCGGTGGA
+AGTAGTTTGTAGTATCCAGCGCAGTATCGGGTGATTAGCTCAGCTGGGAGAGCACCTCCTTACAAGGAGGGTCGGCGGTTCGATCCCGTCATCACCCACC
+ACTCGGGTCGTTAGCTCAGTTGGTAGAGCAGTTGACTTTAATCAATTGGTCGCAGGTTCGAATCCTGCACGACCCACCAGTTTTAACATCAAACTCAGAT
+GTTAAGCGTGAAGGATAACGTTGCGCCAGCAACGGCCCGTAGGGCGAGCGAAGCGAGTCATCCTGCACGACCCACCAATCTTAAAGATTGGCCCCGAGTA
+AAAATCTTTCAGGTAACACCCGTATGGGTCGTTAGCTCAGTTGGTAGAGCAGTTGACTTTAATCAATTGGTCGCAGGTTCGAATCCTGCACGACCCACCA
+ATTTAAAGGTGGTTACTGGTAGAGAACGTGAAGGATAACGTTGCGTTAGCAACGGCCCGAAGGGCGAGACGAAGTCGAGTCATCCTGCACGACCCACCAT
+CCTGAATGATTAAGGCAGCATAATCCCGCAAGGGGTCGTTAGCTCAGTTGGTAGAGCAGTTGACTTTAATCAATTGGTCGCAGGTTCGAATCCTGCACGA
+CCCACCATGTAAAAAGCGCCCTAAAGGCGCTTTTTGCTATCTGCGATACTCAAAGATTCGAACCTGCAGCAGGTTTGAGTTGAGCGCAGCGAAACAACGG
+AGCCGCTCGCGGCGACGGCCCGAAGGGCGAGCGAAGCGAGTCATCCTGCACGACCCACCATGTAAAAAGCGCCCTAAAGGCGCTTTTTGCTATTCAGGCA
+TCCTCAATTTCACTTTGTAAACCTGATGACATCGTCAGAGCTTACTGTGCAAGCAACTCTATGTCGGTGGAATTAGGCGTAAAATGACGCATCCTGCACA
+TTAGGCGTAATTCGAGTGACTTTTCCCCACCATTCGACTATCTTGTTTAGCATATAAAACAAATTACACCGATAACAGCGAATATTACGCTAATGTCGGT
+TTTAACGTTAAGCCTGTAAAACGAGATGGTAAGATGAGCGTAATGTTTGATCCAGACACGGCGATTTATCCTTTCCCCGAAGCCGACGCCGTTAAGCATT
+GATGAAAAGCGTATTACCGCGAGAAGATAAAACGTCTGCTAAAAGAACGTAATGCGGTGATGGTTGCCCACTACTATACCGATCCCGAAATTCAACAACT
+GGCAGAAGAAACCGGTGGCTGTATTTCTGATTCTCTGGAAATGGCGCGCTTCGGTGCAAAGCATCCCGCTTCTACTTTGTTAGTCGCTGGGGTGAGATTT
+ATGGGAGAAACCGCCAAAATTCTCAGTCCGGAAAAACAATTCTGATGCCGACACTTCAGGCTGAATGTTCACTGGATCTCGGCTGCCCTGTTGAAGAATT
+TAACGCATTTTGCGATGCCCATCCCGATCGTACTGTCGTCGTCTACGCCAACACTTCTGCTGCGGTAAAAGCGCGCGCAGATTGGGTGGTAACTTCAAGC
+ATTGCCGTCGAACTTATTGATCATCTTGATAGTTTGGGTGAAAAATCATCTGGGCACCCGACAAACATCTGGGGCGTTACGTGCAAAACAGACGGGTGGA
+GACATTCTATGCTGGCAGGGTGCCTGTATTGTGCATGATGAATTTAAGACTCAGGCGTTAACCCGCTTGCAAGAAGAATACCCGGATGCTGCCATACTGG
+TGCATCCAGAATCACCACAAGCTATTGTCGATATGGCGGATGCGGTCGGTTCCACCAGTCAACTGATCGCTGCTGCGAAAACATTGCCACATCAGAGGCT
+TATTGTGGCAACCGATCGGGGTATTTTCTACAAAATGCAGCAGGCGGTGCCAGATAAAGAGTTACTGGAAGCACCAACCGCAGGTGAGGGTGCAACCTGC
+CGCAGCTGCGCGCATTGTCCGTGGATGGCCATGAATGGCCTTCAGGCCATCGCAGAGGCATTAGAACAGGAAGGAAGCAATCACGAGGTTCATGTTGATG
+AAAGGCTGCGAGAGGGCGCTGGTGCCGCTCAATCGTATGCTGGATTTTGCGGCTACACTACGTGGATAACGAATAATAAGGCGTAACGTTACGCTTTGGG
+GAAAGATGGATTTTTAGTGTGCAGAATATCCTGGTACATATACCAATAGGGCAGGCGGTTATGATCTCTCATGGATCGAAGCGGTAGGCACGATCGCCGG
+GTTGCTGTGTATTGGCCTTGCCAGTCTGGAGAAGATCAGCAACTACTTCTTTGGCCTGATCAACGTCACCTTGTTTGGCATTATTTTCTTTCAGATTCAG
+CTGTATGCCAGCCTGCTATTACAGGTGTTTTTCTTTGCCGCGAATATTTACGGTTGGTATGCGTGGTCGCGACAAACCAGTCAGAACGAGGCGGAGTTGA
+AAATTCGCTGGTTGCCATTGCCGAAGGCACTCAGCTGGTTGGCGGTTTGCGTTGTTTCGATTGGTCTGATGACGGTATTTATCAATCCGGTGTTTGCATT
+TTGACCCGCGTGGCAGTCATGATCATGCAAGCATTAGGATTACAGGTTGTGATGCCTGAACTGCAACCGGACGCTTTCCCGTTCTGGGATTCATGCATGA
+TGGTGTTATCTATCGTGGCAATGATTCTGATGACGCGTAAGTATGTGGAAAACTGGCTGTTGTGGGTGATTATTAACGTGATTAGCGTCGTTATTTTTGC
+ACTTCAGGGCGTTTACGCCATGTCTCTGGAGTACATCATCCTGACCTTTATTGCGCTCAACGGCAGCCGGATGTGGATCAACAGCGCACGTGAAAGAGGC
+TCACGCGCGCTGTCCCATTAATGGTGATGATGTGAATGGCCAGACACCCCTTCATTCAGGTGGCAGTCTGGCCCATGACAAGGTTGATATTCCATCTGAA
+TGGTGGCGTGCTCAATCTGATAGTGATCCATCAGGTAGTGTTGGATCTGATCCAACAAGGCATCGTGATCGTGTGGCGGGATCACCTGCACATGCAACGT
+CATCACCGGCTTCTCGCCTACCATCCATACATGTACATGGTGCACATTGCGGACTTCCGGGATTTCCGGCACATACGACGCTTCAGTTCAGCGATATCCA
+GCGATACCGGTGCACCTTCAAGTAATTCATTCACGCTATCTTTCAACAGTCGCCACGCGCTACGCAGAACCAGAAGCGACACCAGTATCGAGAGAATGGG
+GTCAGCAGGTGTCCAGCCAGTCCAGATAATAATCAACGCGGCAATAATAGCCCCAACCGAACCCAGCAGGTCCCCGAGCACATGCAGTGCCGCTGCTCGT
+ACGTTGAGGTTTTTCTTCGCTGCCGTGATGAAGTAACCAGAAAGAAAGTATATTTGCCAGCAACCCAGCCACGGCAATTGCCATCATCATGCCGCCCTCG
+ACCGGACGCGGCGTGCGGAAGCGTTCTATCGCCTCCCAGACAATCAAAATGGTAATTACCACGAGGGCTATGGCATTCACAAACGCCGCGAGCGTGGTCA
+GTCTTAGCCAACCGAAAGTGTGGCGAATGGTGGGAGGACGACGTGAAAATTGCACGGCGAGTAGGGCGAAAAGCAGGGCGGCAGTATCGGTCAACATATG
+ACCCGCATCGGCCAGCAATGCCAGAGAACCAGAAAGAAAACCACCAACGACTTCTACCAGCATAAACCCGGCAGTCACGCCGAAAGCATACAACAAGCGA
+CGAGCATTATTATCTTCTGGCAGGTGTGAGGACGTGTGTGAGTGTGAGTGCGCCATGACGAGTCATCCCTTAATTATTCTCACTTAACTTTATGACATCA
+TACTGCTTTTAGAAGTGAAAATTAAAAGGAGAGACTCCGCTCTCCCATTATTGGCTATTTTGCAGGGTTACTGCGTGGTACCGTCGGTTTTGGTATCGAC
+ATCATTATTGATGCCATCACCGGTTTGTACCTTTTATTGATATCCGGACAGCGACCATCTTTGCACATGGTGTTCTTGTGCTCTTCATCTTTGGTCATTC
+CGTCATTGTTCATTGAAGAACCATCCGAATGCAGCATTGTGCCGCCAGAACCGGTATTTACCCCGTTATTGTCGACGTTATTTGGCGCGACATTTTCACG
+GGCGTCAGGGCTACCTGGCCCGCATCAGCTGCGGCGTTTGCCTGGCCGTTATTAGTTTGCGCTCCGCTATCGGCAGCCAGTGCGGCACCGCTGGCAAGGC
+TTAGAGTGGCAGTCAGAAATAATGTGGCCAGTTTTGTCATTTTCATAGGATGCTCCTGTTATGGTCGTTATGTCGGATAACCTCTTCCAACAGTGCATTT
+GCAGGTGAATATAAGGCATTGGTTTAAGATTTCAGCCAGGTTATGAAACGCAGCAGAGAATCTTGAAATAATTAACAAACAAAGGAGTTACAGTTAGAAA
+TTGTAGGAGAGATCTCGTTTTTCGCGACAATCTGGCGTTTTTCTTGCTAATTCCAGGATTAATCCGTTCATAGTGTAAAACCCCGTTTACACATTCTGAC
+GGAAGATATAGATTGGAAGTATTGCATTCACTAAGATAAGTATGGCAACACTGGAACAGACATGAATTATCAGAACGACGATTTACGCATCAAAGAAATC
+AAAGAGTTACTTCCTCCTGTCGCATTGCTGGAAAAATTCCCCGCTACTGAAAATGCCGCGAATACGGTTGCCCATGCCCGAAAAGCGATCCATAAGATCC
+TGAAAGGTAATGATGATCGCCTGTTGGTTGTGATTGGCCCATGCTCAATTCATGATCCTGTCGCGGCAAAAGAGTATGCCACTCGCTTGCTGGCGCTGCG
+TGAAGAGCTGAAAGATGAGCTGGAAATCGTAATGCGCGTCTATTTTGAAAAGCCGCGTACCACGGTGGGCTGGAAAGGGCTGATTAACGATCCGCATATG
+GATAATAGCTTCCAGATCAACGACGGTCTGCGTATAGCCCGTAAATTGCTGCTTGATATTAACGACAGCGGTCTGCCAGCGGCAGGTGAGTTTCTCGATA
+TGATCACCCCACAATATCTCGCTGACCTGATGAGCTGGGGCGCAATTGGCGCACGTACCACCGAATCGCAGGTGCACCGCGAACTGGCATCAGGGCTTTC
+TTGTCCGGTCGGCTTCAAAATGGCACCGACGGTACGATTAAAGTGGCTATCGATGCCATTAATGCCGCCGGTGCGCCGCACTGCTTCCTGTCCGTAACGA
+AATGGGGCATTCGGCGATTGTGAATACCAGCGGTAACGGCGATTGCCATATCATTCTGCGCGGCGGTAAAGAGCCTAACTACAGCGCGAAGCACGTTGCT
+GAAGTGAAAGAAGGGCTGAACAAAGCAGGCCTGCCAGCACAGGTGATGATCGATTTCAGCCATGCTAACTCGTCCAAACAATTCAAAAAGCAGATGGATG
+TTTGTGCTGACGTTTGCCAGCAGATTGCCGGTGGCGAAAAGGCCATTATTGGCGTGATGGTGGAAAGCCATCTGGTGGAAGGCAATCAGAGCCTCGAGAG
+CGGAGCCGCTGGCCTACGGTAAGAGCATCACCGATGCCTGCATCGGCTGGGAAGATACCGATGCTCTGTTACGTCAACTGGCGAATGCAGTAAAAGCGCG
+TCGCGGGTAAGGTTTAATTGTCGGATGCGCCGTCAGAGTGGCGTATCCGATGAATCACCACAGGCCTGATAAGTCGCGCAGCGTCGCATCAGGCAATGTG
+CTCCATTGTTAGCAACAAAAGCCGACTCACTTGCAGTCGGCTTTCTCATTTTAAACGAATGACGTTTACTTCGCTTTACCCTGGTTTGCAACCGCCGCTG
+CTTTCGCTGCGATCTCGTCAGCATTACCCAGATAATAGCGTTTCAGCGGTTTGAAATTCTCGTCGAACTCATACACCAGCGGCACGCCAGTCGGGATATT
+AAGCTCAAGAATCTCTTCTTCGCTCATGTTATCAAGATATTTCACCAGCGCACGTAAAGAGTTACCGTGTGCAGCGATGATCACGCGCTCACCGCTCTTC
+ATACGCGGCAGAATAGTTTCATTCCAGTAAGGGATCACGCGGTCAATGGTCAGCGCCAGGCTTTCCGTCAGCGGCAGTTCTTTCTCGCTCAGTTTCGCGT
+AACGCGGATCGTGACCCGGATAACGCTCATCATCTTTAGTCAGTTCCGGCGGAGTCACTGCAAAACCACGACGCCACTGTTTCACCTGCTCGTCGCCATA
+CTTTTCAGCAGTTTCCGCTTTGTTCAGACCCTGCAACGCACCGTAGTGACGTTCGTTCAGTTTCCAGGATTTCTCAACGGGCAGCCATGCCTGATCCAGT
+TCGTCCAGCACATTCCACAGGGTATGGATAGCGCGTTTCAGCACAGAAGTGTAAGCAAAGTCAAAGCTGTAACCTTCCTCTTTCAGCAGCTTACCTGCTG
+CTTTTGCTTCGCTTACGCCTTTCTCAGACAGATCCACGTCGTACCAACCGGTGAAACGGTTTTCTTTGTTCCACTGACTTTCGCCATGACGAACCAGAAC
+CAGCTTAGTTACAGCCATATACTTACTCCTCAAATCATCTTTTAATGATAATAATTCTCATTATATTGCCGCGACGAAGCAACAGCAATGCTTACGCATA
+ACCATAGCGAAAATAGTGGCGCAGTGTAAGGTTGTTGTGAATATTGAGTTGCAAATATGTCGGTGTTTGCTGGTGATTTGAACAATATGAGATAAAGCCC
+TCATGACGAGGGCGTAACATTACTCAGCAATAAACTGATATTCCGTCAGGCTGGAATACTCTTCGCCAGGACGCAGGAAGCAGTCCGGTTGCGGCCATTC
+AGGGTGGTTCGGGCTGTCCGGTAGAAACTCGCTTTCCAGAGCCAGCCCTTGCCAGTCGGCGTAAGGTTCGGTTCCCCGCGACGGTGTGCCGCCGAGGAAG
+TTGCCGGAGTAGAATTGCAGAGCCGGAGCGGTGGTGTAGACCTTCAGCTGCAATTTTTCATCTGCTGACCAGACATGCGCCGCCACTTTCTTGCCATCGC
+CTTTGGCCTGTAACAAGAATGCGTGATCGTAACCTTTCACTTTGCGCTGATCGTCGTCGGCAAGAAACTCACTGGCGATGATTTTGGCGCTGCGGAAATC
+AAAAGACGTTCCGGCGACAGATTTCAGGCCGTCGTGCGGAATGCCGCCTTCATCAACCGGCAGATATTCGTCCGCCAGAATCTGCAACTTGTGATTGCGC
+ACGTCAGACTGCTCGCCGTCAAGATTGAAATAGACGTGATTAGTCATATTCACCGGGCAAGGTTTATCAACTGTGGCGCGATAAGTAATGGAGATACGGT
+TATCGTCGGTCAGACGATATTGCACCGTCGCGCCGAGATTACCCGGGAAGCCCTGATCACCATCATCTGAACTCAGGGCAAACAGCACCTGACGATCGTT
+CTGGTTCACAATCTGCCAGCGACGTTTGTCGAACCCTTCCGGCCCGCCGTGCAGCTGGTTAACGCCCTGACTTGGCGAAAGCGTCACGGTTTCACCGTCA
+AAGGTATAACGGCTATTGGCGATACGGTTGGCATAACGACCAATAGAGGCCCCAGAAACGCGGCCTGATCCTGATAGCATTCCGGGCTGGCACAGCCGAG
+CAGCGCCTCGCGGACGCTGCCATCGGAAAGCGGAATACGGGCGGAAAGTAAAGTCGCACCCCAGTCCATCAGCGTGACTACCATCCCTGCGTTGTTACGC
+AAAGTTAACAGTCGGTACGGCTGACCATCGGGTGCCAGTGCGGGAGTTTCGTTCAGCACTGTCCTGCTCCTTGTGATGGTTTACAAACGTAAAAGTCTCT
+TTAATACCTGTTTTGCTTCATATTGTTCAGCGACAGCTTGCTGTACGGCAGGCACCAGCTCTTCCGGGATCAGCGCGACGATACAGCCGCCAAATCCGCC
+GCCGGTCATGCGTACGCCACCTTTGTCGCCAATCACAGCTTTGACGATTTCTACCAGAGTGTCAATTTGCGGCACGGTGATTTCGAAATCATCGCGCATA
+GAGGCATGAGACTCCGCCATCAACTCGCCCATACGTTTCAGGTCGCCTTGCTCCAGCGCGCTGGCAGCTTCAACGGTGCGGGCGTTTTCAGTCAGTATAT
+GACGCACGCGTTTTGCCACGATCGGGTCCAGTTCATGCGCAACAGCGTTGAACTCTTCAATGGTGACATCACGCAGGGCTGGCTGCTGGAAGAAACGCGC
+ACCGGTTTCGCACTGTTCACGACGGGTGTTGTATTCGCTGCCAACCAGGGTACGTTTGAAGTTACTGTTGATGATGACGACAGCCACACCTTTGGGCATG
+GAAACTGCTTTGGTCCCCAGTGAGCGGCAATCGATCAGCAAGGCATGATCTTTCTTGCCGAGCGCGGAAATTAGCTGATCCATGATCCCGCAGTTACAGC
+CTACAAACTGGTTTTCTGCTTCCTGACCGTTAAGCGCGATTTGTGCGCCGTCCAGCGGCAGATGATAAAGCTGCTGCAATACGGTTCCGACCGCGACTTC
+CAGTGAAGCGGAAGAACTTAACCCGGCACCCTGCGGCACATTGCCGCTGATCACCATGTCCACGCCGCCGAAGCTGTTGTTACGCAGTTGCAGATGTTTC
+ACCACGCCACGAACGTAGTTAGCCCATTGATAGTTTTCATGTGCGACAATGGGCGCATCGAGGGAAAACTCGTCGAGCTGATTTTCATAATCGGCTGCCA
+TCACGCGAACTTTACGGTCATCGCGTGGTGCACAACTGATCACGGTTTGATAATCAATCGCGCAGGGCAGAACGAAACCGTCGTTGTAGTCGGTGTGTTC
+ACCAATCAAATTCACGCGGCCAGGCGCCTGAATGGTGTGAGTGGCAGGGTAGCCAAATGCGTTGGCAAACAGAGATTGTGTTTTTCTTTCAGACTCATTT
+CTTACACTCCGGATTCGCGAAAATGGATATCGCTGACTGCGCGCAAACGCTCTGCTGCCTGTTCTGCGGTCAGGTCTCGCTGGGTCTCTGCCAGCATTTC
+ATAACCAACCATAAATTTACGTACGGTGGCGGAGCGCAGCAGAGGCGGATAAAAGTGCGCGTGCAGCTGCCAGTGTTGATTCTCTTCGCCATTAAATGGC
+GCGCCGTGCCAGCCCATAGAGTAGGGGAAGGAGCACTGGAAGAGGTTGTCATAACGACTGGTCAGCTTTTTCAACGCCAGCGCCAGATCGCTGCGCTGGG
+CGTCGGTCAAATCGGTGATCCGTAAAACGTGGGCTTTGGGCAGCAGTAGCGTTTCGAACGGCCAGGCAGCCCAGTAAGGCACGACGGCTAACCAGTGTTC
+GGTTTCGACAACGGTACGGCTACCGTCTGCCAGCTCGCGCTGAACATAATCCACCAGCATTGGTGATTTCTGTTCGGCAAAATATTCTTTGCAGGCGGTC
+TTCGCGCTCAGCTTCGTTAGGCAGGAAGCTATTTGCCCAAATCTGACCGTGCGGATGCGGGTTAGAGCAGCCCATCGCCGCGCCTTTGTTTTCAAAACCT
+GCACCCATGGGTACGTTTTCCCCAGTTCTGCGGTTTGCTCCTGCCAGGTTTTGACGATTTCCGTCAATGCTGCAACGCTGAGCTCTGGCAGCGTTTTACT
+GTGATCCGGTGAAAAGCAGATCACCCGGCTGGTGCCGCGCGCGCTCTGGCAACGCATCAGCGGATCGTGACTTTCTGGCGCATCTGGCGTGTCAGACATC
+AAAGCCGCAAAGTCATTAGTGAAAACGTAAGTCCCGGTGTAATCGGGGTTTTATCGCCTGTCACCCGCACATTACCTGCGCAGAGGAAGCAATCTGGATC
+GTGCGCAGGTAACACCTGTTTGGCTGGCGTTTCCTGCGCCCCTGCCAGGGCGCTTAGCGCGGTGCGGTGAAACCAGAATCCATTGCCCGGTGAGCGGGTT
+GTAGCGGCGATGTGGATGATCAACGGGATTAAATTGCGTCATGGTCGTTCCTTAATCGGGATATCCCTGTGGATGGCGTGACTGCCAGTGCCAGGTGTCC
+TGCGCCATTTCATCGAGTGTGCGCGTTACGCGCCAGTTCAGTTCACGGTCGGCTTTGCTGGCGTCCGCCCAGTAGGCCGGAAGGTCGCCCTCGCGACGCG
+GTGCAAAATGATAATTAACCGGTTTGCCGCAGGCTTTGCTGAAGGCATTAACCACGTCCAGCACGCTGTTGCCTACGCCAGCGCCGAGGTTGTAGATGTG
+TACGCCTGGCTTGTTCGCCAGTTTTTCCATCGCCACGACGTGACCGTCCGCCAGATCCATTACGTGGATGTAATCGCGTACGCCAGTACCATCTTCGGTC
+GGATAATCGTTACCAAAAATCGCCAGCGAGTCGCGACGGCCTACAGCAACCTGGGCGATGTATGGCATCAGGTTATTCGGAATGCCTTGCGGATCTTCGC
+CCATATCGCCCGACGGATGCGCGCCAACCGGGTTGAAGTAGCGCAGCAGGGCAATGCTCCAGTCCGGCTGGGCTTTTGCAGATCGGTGAGGATCTGTTCC
+ACCATCAGCTTGCTTTTGCCGTAAGGGCTTTGCGGTGTGCCGGTCGGGAAGCTTTCAACGTATGGAATTTTGGGCTGATCGCCATAAACGGTGGCGGAGG
+AGCTAAAATAAAGTTTTGACGTTAGCGGCGCGCATGGCGCTAATCAGGCGCAGAGTGCCGTTGACATTGTTGTCGTAATATTCCAGCGGTTTTGTACCGA
+TTCGCCCACGGCTTTCAGCCCGGCGAAGTGGATCACGGTGTCGATAGCGTGATCGTGCAGGATCTCGGTCATCAACGCTTCGTTACGAATATCGCCTTCA
+ACAAACGTTGGATGTTTGCCGCCTAAACGCTCGATAACAGGCAGTACGCTGCGCTTACTGTTACAGAGGTTATCAAGAATGATGACATCATGACCGTTTT
+GCAGTAATTGCACACAGGTATGACTTCCAATGTAACCGCTACCACCGGTAACCAGAACTCTCATAATTCGCTCCATTAGGCTTATGGTATGAAATAACCA
+TAGCATAACAAAGATGCGAAAAGTGTGACATGGAATAAATTAGTGGAATCGTTTACACAAGAATTTAGCCGTTTTTATGCGCGATTAAGTGATTATAAAA
+CAGAGGGTTTATGAATGATTGCGCTTTTATCTGAAAAAGACGCGGTTTCATGCCTGCATGCGTCGAACCGTTGGCCGGAGAGGGTGCTAAGGCCGCCTCC
+GGCAAGGTCAGCACTACCGACTCAATATATTTTTGTCAGCACATAGCGATAGAGTCCACCGTCCGGCACGAACTCAAGACGATGGGTAATACAGGCAGGC
+GCATCTTCAGCGTGGTGCGAAACAAACAACAATTGCGTTTCACCTTCGCTAATCAGCACATCAACAAAACGGCGGATAAGCTGGCGATTCAGCGGATCAA
+GCCCCTGTAGTGGTTCATCGAGAATAAGCAACGTCGGATGTTTCACCAGTGCGCGGACAATCAGCGCCAGACGCTGCTGTCCCCAGGAAAGACTATGGAA
+CGGAGCGTCAGCCGTGCGTTTATCAATGCCGAGAATATCCAGCCACTGCTGCACCAGTTTTGCTGGCGATCCGAAACGGCCTGATAAATGCCAATCGAAT
+CAAAATAGCCAGAAAGAATCACATTACGCACGGTAGTGCTGACCCGGTAATCCAGATGCAAACTACTGCTGACGTAACCGATATGCTTTTGATATCCCAG
+ATGGTTTCGCCGCTGCCGCGACGTCGTCCGAAAAGCGTCAAATCGTTGCTGTAACCTTGCGGATGATCGCCAGTAACCAGGCTTAATAACGTCGATTTTC
+CTGCACCATTTGGCCCGACAATTTGCCAGTGTTCGCCTGGATTCACCTGCCAGCTAAGGTTATTAAGAATGGGGCGATCGTTATAAGAAACCACGCCATT
+GTTCAGCACAATGCGCGGTTCGTTGGCGGGTAAGGCGTGACGTGCTGAAGGTTCATCCGGCTCCGGCAGTTGCACACCTTCAAGCTGTTCACTATGCGCC
+AGTTGCGCGACGAGTGCTTGTTGGAGCAGTTCCTCTTTAGCGCCAGTTTCCGCTAACGTGCAATCCGCCAGCACGCCAGCAAACTGGACAAACTCCGGGA
+TCTCATCGAAGCGATTGAGCACCAGTACCAGAGTAATACCGGACTGATGTAACGAGGCGAGTCGCTCAGCCAGCTGCTGACGTGAGGCAACATCCAGGCC
+ATCGAACGGCTCATCAAGAATCAACAAGTCAGGCTCCGACATCAGCGCCTGACACAGCAGGGTTTTTCGCGTCTCGCCAGTGGAAAGGTATTTAAAGCGT
+CGGTCGAGGAGGGCGGTAATACCGAACTGCTGCGCCAGTTGCATGCAACGCGGTGCATCCTTTACTTCATCCTGAATGATCTCAGCCGTAGTGCGTCCGG
+TGTCATCTTCGCCAGGGCCGAGCATATCGGTGTTATTCCGCTGCCATTCGTCGCTGACGAGTTTTTGCAATTGCTCGAAGGAGAGACGAGTGATGTGGGA
+AAACTGGCTTTGCCGTTCACCTTTCAAAAGCGGAAGTTCCCCGCCAGCGCGCGGGCCAGGGCCGATTTCCGCTTCCATTCGAACCGACAAACGCCCAACT
+ATCACCCGCGTTTAACGTTAGCTGAGGCAATTGCAGCGTTTTTGTGTCGCTAAGACGAAACGTGCCTTGCAAAATTTGCAACGATGACATTTTATATCCC
+ACTTTGTGCAGCGATTACTGACAGGGATACGTGTTTCATAACAAATTGTCAACACGCTTAGCACAGCGTGGCGATAATCACGCTGTCGGCATTAAAGTAG
+GCCGTGACATTCTGTCCTTGCTGAAGAGAAGTCGCTTCATTTACCGGCACTGTGGCGCACAGTGTTTGCCCGTCGGGTAGCGCCATTAATACTTCGCACT
+GCTCTGCGCCGCGCTCAATATGACTAATAATACCCGGTAATTGGTTGTCAGCGTTTTGCGCGACCGCCTCGTCCTGAGTAATACCTACCCACGGCGCTTT
+TAGCAATATCAACACTTCTTTGCCTTCATCCAGCCCCAGACGCGCGCCGCTTTGTGCGGTAATTGCGACTTTCAGGCGTGTTTTCCGTCAGCCAGTAAGA
+CATCAACATGCTGTTGAACGTCATCATGATCGCGGGCGGTGATGGTACCGAACCACTGGTTACGGGCGCTGGTTTGCAGTGAAAACGTGAGATCGCGGCC
+AGCAGGCTGTTCAGCGGCAGGGCGTCATCGTCACTTAACACATCAAAGGCTTTTGCTGGATTTGCGCCAGTAAGTCATAGAGCTGAATCAGTCGCTGACC
+ATAGCGGGTCAGTACTGCGCCGCCGCCACCTTTACCGCCTGTTGCGCGCTCGACCAGAATATGCTCACTTAACTGATTCATCTCGTTAATGGCATCCCAG
+GCGCTTTATAGCTAATACCGGCATCTTTCGCTCCTGGCTAATGGAACCGGAAAGCGCAATGTGTTTTAGTAGCGAAATGCGGCGCGGGTCGGCGAATAAT
+TTTGTTGGAGCTTAAGGGTGAGAAGGATTTCGGCCTGCATAACAATGTCCTGGCAAAAGTCTTATTGTGACGGAAAACGAACGCCACGCAAAGCTGACCG
+CACAAAAGGGAGTGCTTTTCTGTGCTTAGCGGTTAGAATAGTCTCATGACTATATCTGGAGTTGACCATGTTAGAGTTATTAAAAGTCTGGTATTCGCCG
+TAATCATGGTACCTGTCGTGATGGCCATCATCCTGGGTCTGATTTACGGTCTTGGTGAAGTATTCAACATCTTTTCTGGTGTTGGTAAAAAGACCAGCCC
+GGACAAAATCATTGATTCCCTGAATGCCCGCTTAGTCGGGCATTTTCTTTCTCAACTTCCTGCTTTTCCTGCCGATATTTTTCTTATCTACCTCACAAAG
+GTTAGCAATAACTGCTGGGAAAATTCCGAGTTAGTCGTTATATTGTCGCCTACATAACGTTACATTAAGGGGTTACCAATGGCTCGTAAATGGTTGAACT
+TGTTTGCCGGGGCGGCACTCTCTTTCGCTGTTGCTGGCAATGCACTGGCAGATGAAGGAAAATCACGGTGTTCGCCGCCGCATCACTGACTAACGCAATG
+CAGGACATTGCTACGCAGTTTAAAAAGAGAAAGGCGTGGATGTGGTTTCTTCTTTCGCTTCGTCATCTACTCTCGCCCGTCAGATTGAAGCGGGTGCGCC
+TGCGGATCTGTTTATTTCTGCCGATCAGAAATGGATGGATTATGCGGTTGATAAAAAGCGATCGATACAGCTACGCGTCAGACACTGCTCGGCAATAGCC
+TGGTCGTTGTAGCACCGAAAGCCAGCGTGCAGAAAGATTTCACCATCGACAGCAAAACCAACTGGACTTCACTGCTGAATGGCGGTCGCCTGGCGGTTGG
+CGATCCGGAACATGTTCCCGCTGGCATTTATGCAAAAGAAGCACTGCAAAAACTGGGCGCATGGGATACGCTCTCTCCGAAACTGGCCCCAGCGGAAGAT
+GTTCGTGGGGCGCTGGCGCTGGTCGAACGTAACGAAGCGCCTCTGGGCATTGTCTACGGTTCTGACGCAGTTGCCAGCAAAGGGTAAAGTGGTTGCCACC
+TTCCCGGAAGATTCACATAAAAAGTGGAATATCCGGTTGCTGTTGTGGAAGGGCATAACAATGCGACAGTGAAAGCATTTTATGATTATCTGAAGGGACC
+GCAGGCAGCGGAAATCTTTAAACGTTACGGATTTACAATCAAGTAATGATACTGACCGATCCAGAATGGCAGGCAGTTTTATTAAGCCTGAAAGTTTCTT
+CCCTGGCTGTGCTGTTTAGCCTGCCGTTTGGGATCTTTTGCCTGGTTACTGGTGCGTTGCACGTTTCCGGGCAAAGCTCTGCTCGACAGCGTACTGCATC
+TACCGCTGGTGTTACCGCCCGTGGTCGTCGGTTACTTATTATTAGTTTCGATGGGACGGCGCGGATTTATCGGTGAACGTCTGTATGACTGGTTTGGTAT
+TACCTTCGCCTTTAGCTGGCGCGGCGCGGTTCTCGCTGCCGCCGTCATGTCGTTTCCGCTGATGGTGCGGGCAATTCGTCTGGCGCTGGAAGGGTTGATG
+TCAAACTGGAACAGGCCGCAAGAACACTGGGGCCGGGCGCTGGCGCGTTTTCTTTACTATCACGTTACCGCTGACCTTACCGGGAATTATTGTTGGTACG
+GTACTGGCTTTTGCTCGTTCTCTCGGTGAGTTTGGTGCAACCATCACCTTTGTGTCGAACATTCCTGGTGAAACGCGAACCATTCCTTCTGCCATGTATA
+CCCTGATCCAGACCCCGGCGAAAGTGGAGCGGCGAGACTGTGCATTATTTCTATTGCGCTGGCGATGATCTCCTGTTGATTTCAGAATGGCTGGCCAGAA
+TCAGCCGTGAACGGGCGGGGCGCTAATCATGCTGGAACTGAATTTTTCCCAGACGTTGGGCAACCATTGCCTGACTATTAATGAAACGCTGCCCGCCAAT
+GGCATCACTGCTATCTTTGGCGTCTCCGGTGCCGGAAAAACTTCGCTGATTAACGCCATCAGTGGACTGACGCGCCCGCAAAAGGGCGGATTGTCCTCAA
+TGGGCGGGTACTAAATGATGCCGAAAAGGTATCTGCCTGACGCCGGAAAAGCGTCGCGTTGGCTATGTTTTTCAGGATGCGCGGCTGTTCCCGCATTACA
+AAGTGCGTGGCAATCTGCGCTACGGCATGTCGAAAAGTATGGTCGATCAGTTCGATAAGCTGGTGGCGCTTTTAGGCATTGAACCGTTGCTTGACCGTTT
+ACCAGGCAGCCTGTCCGGAGGCGAAAAACAGCGCGTGGCGATTGGTCGGGCTTTGCTGACAGCACCGGAATTGCTGTTGCTGGATGAACCGCTGGCGTCA
+CTGGATATTCCGCGTAAACGCGAACTGTTGCCTTATCTGCAACGGCTGACACGGGAAATCAACATTCCGATGTTGTATGTCAGCCATTCGCTGGATGAGA
+TCCTCCATCTGGCAGACAGAGTGATGGTACTGGAAAACGGTCAGGTGAAAGCCTTTGGCGCGCTGGAGGAAGTGTGGGGCAGTAGCGTGATGAATCCGTG
+GCTGCCGAAAGAGCAACAAAGTAGCATTCTGAAAGTGACGGTGCTTGAGCATCATCCGCATTACGCGATGACCGCGCTGGCGCTGGGCGATCAGCATTTG
+TGGGTCAATAAGCTGGACGAACCGCTGCAAGCTGCGCTACGTATCCGCATTCAGGCTTCCGATGTTTCTCTGGTTTTACAACCGCCGCAGCAAACCAGCA
+TTCGTAACGTATTGCGGGCAAAAGTTGTTAATAGTTATGACGACAACGGCCAGGTGGAAGTGGAACTGGAAGTCGGCGGTAAAACGCTGTGGGCGCGTAT
+CAGCCCGTGGGCCAGGGATGAACTGGCGATCAAACCTGGCCTGTGGCTGTACGCGCAAATTAAAGTGTGTCGATAACCGCCTGATTAAATCAGGTGGCTA
+TAAATGAACTGGGCAATGCTGTCGGTGGTGTTATCACCAATCACAATGTTGGCGCGCGCTTTTACCGCGTCATCGGCGTTGCCCATCGCCACGCCTGTAC
+CAGCGGCTTCCAGCATACTGATATCATTAAAGTTATCGCCGAATGCCACGACGTTTTCCATCGACCAACCTTGCGCCTCAACCCATTTCGTCAAACGTTT
+ACCTTTGCTGTTGCCGCCGCGTGCAATATCAACCTGATCGTGCCAGGACCATTCACACTCCAGTCCCAGTTCATGTTCGACATGCTTACCAAAATGCTGC
+AATTGCGGCAGGTCATCGTGCGTCAGGGCGAACTTCCATACGGCGTTAACTTGTTGCGCCGTTTCAGCCAGAGAAGCGACTTGTGTGAAAGTCGGACGCT
+GTTCCGGCGGCAGGGTTTGCGCCCAGTTAGATGTGCGAATGACATGCCCGGTCGGGTGCTCATAGACCATTGCATCATCGACATACATCAGACCGTGAAT
+GTGGTGTTCATTCAGCATCTCAATGAGTTGCAGGGCTTTAATAACGGGCATTGGGTCCGCTTCCAGCACGGTTTTGCATGATAATCATACAAATAGGTGC
+CATTACAGCAAATAGCAGGTGTATCCAGCGCCAGCGCCTGATAAAAGGATGAATAGCGACGTGATGGCGACCTGTGACGATGATTAATTGATAGCCTGCT
+TCGCGAGCGCGGGCCAGGGCTTCTATCGATGAAGGAAGCAGGGTCTTTTCGGGGTCAATAAGGTGCCGTCTAAGTCGAGAGCAATCACGCGTGTGGTCAT
+GGCGTATTCCAGATTAAGGTTAAGAATTTTCGTCTGCGCGAATGGTACACCGATACCACTATCGGACAAAATTCTGCGTTTTAATTCAGCATTCACCGCC
+AAAAGCGACTAATTTTAGCTGTTACAGTCAGTTGCTAAATGCAAAGGAGCATTCATGAAGCAAACAGTTTATATCGCCAGCCCTGAGAGCCAGCAAATTC
+ACGTCTGGAATCTGAATCATGAAGGCGCACTGACGCTGACACAGGTTGTCGATGTGCCGGGGCAGGTGCAGCCGATGGTGGTCAGCCCGGACAAACGTTA
+TCTCTATGTTGGTGTTCGCCCTGAGTTTCGCGTCCTGGCGTATCGTATCGCCCCGGACGATGGCGCACTGACCTTTGCCGCAGAGTCTGCGCTGCCGGGT
+AGTCCGACGCATATTTCCACCGATCACCAGGGGCAGTTTGTCTTTGTAGGTTCTTACAATGCGGGTAACGTGAGCGTAACGCGTCTGGAAGATGGCCTGC
+CAGTGGGCGTCGTCGATGTGGTCGAGGGGCTGGACGGTTGCCATTCCGCCAATATCTCACCGGACAACCGTACGCTGTGGGTTCCGGCATTAAAGCAGGA
+TCGCATTTGCCTGTTTACGGTCAGCGATGATGGTCATCTCGTGGCGCAGGACCCTGCGGAAGTGACCACCGTTGAAGGGCCGGCCCGCGTCATATGGTAT
+TCCATCCAAACGAACAATATGCGTATTGCGTCAATGAGTTAAACAGCTCAGTGGATGTCTGGGAACTGAAAGATCCGCACGGTAATATCGAATGTGTCCA
+GACGCTGGATATGATGCCGGAAAACTTCTCCGACACCCGTTGGGCGGCTGATATTCATATCACCCCGGATGGTCGCCATTTATACGCCTGCGACCGTACC
+GCCAGCCTGATTACCGTTTTCAGCGTTTCGGAAGATGGCAGCGTGTTGAGTAAAGAAGGCTTCCAGCCAACGGAAACCCAGCCGCGCGGCTTCAATGTTG
+ATCACAGCGGCAAGTATCTGATTGCCGCCGGGCAAAAATCTCACCACATCTCGGTATACGAAATTGTTGGCGAGCAGGGGCTACTGCATGAAAAAGGCCG
+CTATGCGGTCGGGCAGGGACCAATGTGGGTGGTGGTTAACGCACACTAACCGCTGATTTACCCGGCGCAGTCTCTCCTGCGCCGGTGTATTAACCTATCT
+CCTGTAACGCGTGTCTCTGGCGTTCGACGATATTGGTCCACAAATTGTCTTTATCGTCAGTCCATAAATTAATCAGCAAGGCAAAAAGCGTTCTGCTGCT
+GGAGAAAGTACGGCATCTTTACGGCGAATTATTCCCAATGTTCGACGTATAACGGGTTCCACCAATGGGATACCAATAATCGAAGAATAGGGCGCATGAG
+GCATTGCCAGGCCAGGAAGCGCCGAAATCCCCAGTCCCGCCTCCACCAGTCCTAATGACGTCGAAAGATGACGCACTTCGTAAAACCAGTCCAGCTTCCA
+GGGCTTGTCGGCCAGCTGTTGTTCTATCAACAGTCGGTTGCCGCTGGAGGAGCGTACGCCAATCATTTTGTAACCCACTAACTCCTGCCATTCTACAAGC
+TGCTTTTGGCCAATGGATGGTCACGCCGACAGGCCAGCACGAACGGCTCGTTGACCAGTGGGGTAAAATCAATGGATGAATTTGTGACGTTGTTCATGTT
+TATGCCAAAGTCTGATTCGTTACACAGCACCGATTCCATGCAATTATTCGTGCCTTGTTCCAGAATCCGCACTTTAATATTGGGATACAGCTCATTAAAT
+TTACCGATTGCCAGCGGTAAAAATAAAATACTGCGGTCGGAATACACGCTAACGTCACCATACCACGATGATAAGCATTCATATCACGAATATTAAAAGC
+GTTTCATCGAATTTCTTTATTAATTCCCGCGCCTCCGGGAGCAACCTTTTCCTGCTTTTGTTAACGTAACCTTGCGAGTTGTACGCTCAAATAGTTGAAC
+ATGTAAATCTTCCTCCATCTTTTTATTCTTCGCGTTAATGCAGGTTGCGTAATATTGAGTAATTTAGCGGCATTGTTAAACGAACTGGACTCTGCCAGTA
+TGACAAATGCCTTCATACTTGATAATTCATGCTTCATTATTACTCCGGAAAATGGAAGCGACGATTTTGGGTGGCTGGCCGTTAAAATTTTAACTGCATT
+TAGCCAACTTAAATTAATGAAAAATGTTATTAATCGTTGAGCTAAAGTCATTAGAGATGCTTTGCCCTTAATGTAACCATATCGCAATAAGTTATGTTTT
+TAAATTGAGGGCATTATTATGAAAAAATACCCTGCGTGATGATGCGAGGTGGAACCTCGAGGGCGCGTTCCTGTTAGCGGAACATTTACCCGAAGATCAA
+ACGCAGCGCGATAAAATATTGATGGCAATTATGGGTTCCGGTAACGATCTGGAAATTGACGGTATTGGCGGCGGTAATCCACTGACCAGTAAAGTCGCCA
+TTATTAGCCGTTCCAGCGATCCGCGTGCTGATGTCGATTATCTGTTTGCGCAGGTAATCGTTCATGAGCAACGTGTCGATACCACGCCTAACTGCGGCAA
+TATGCTGTCTGGTGTTGGGGCATTCGCCATTGAAAATGGTTTGATTGCAGCGACTTCGCCAGTTACTCGCGTACGTATCCGCAACGTCAATACGGGTACG
+TTCATCGAAGCTGATGTGCAAACGCCAAATGGTGTTGTCGAGTACGAGGGTAGCGCCAGAATTGACGGCGTACCGGGTACTGCCGCACCGGTTGCGCTCA
+CTTTCCTGAATGCCGCTGGAACCAAAACCGGAAAAGTTTTCCCGACTGATAATCAGATTGATTATTTTGACGATGTCCCGGTGACCTGTATCGATATGGC
+GATGCCAGTCGTCATTATTCCGGCTGAATATCTGGGAAAAACAGGTTATGAATTACCGGCGGAACTGGATGCCGACAAAGCATTATTAGCCCGCATTGAA
+TCTATCCGTCTACAAGCGGGTAAAGCAATGGGCTTAGGTGATGTCAGTAATATGGTTATCCCTAAACCTGTGCTTATTTCTCCAGCGCAGAAAGGCGGGG
+CAATTAATGTGCGTTATTTTATGCCGCATTCTTGCCATCGCGCGCTGGCGATAACCGGTGCTATTGCTATTTCCAGTAGTTGTGCATTGGAAGGCACCGT
+CACCCGACAAATCGTCCCTTCTGTAGGATACGGCAATATCAATATTGAACACCCCAGTGGTGCGCTCGACGTTCATTTAAGTAATGAAGGTCAGGATGCC
+ACGACGTTACGCGCATCTGTTATTCGGACGACCAGAAAAATATTTTCCGGTGAAGTTTATCTTCCTGAAAAATTCGTTGTCAGGATAAGGACAATCAATA
+AAGGACTTCTGTATGAGTCATACAGAAAGAACAGGATTTTAAATGAATAAGAAATCGTTATGGAAGCTAATTCTGATATTAGCGATCCCATGTATTATTG
+GTTTTATGCCAGCTCCGGCAGGATTAAGCGAACTGGCGTGGGTGCTTTTGGTATTTACCTGGCGGCCATTGTGGGGCTGGTTATCAAGCCTTTCCCGGAA
+CCTGTCGTACTGTTAATTGCCGTTGCTGCCTCAATGGTGGTGGTCGGTAACTTATCCGACGGTGCGTTTAAAACCACCGCCGTATTAAGCGGTTACTCTT
+CAGGTACCACCTGGCTGGTGTTCTCGGCGTTTACCTTAAGCGCCGCATTTGTGACCACCGGTTTAGGTAAACGTATTGCCTATCTGCTGATTGGTAAAAT
+CGGTAACACCACGCTGGGTCTGGGTTACGTTACGGTATTCCTCGATCTGGTACTGGCTCCGGCAACACCGTCTAACACCGCGCGTGCGGGCGGCATTGTG
+TTACCGATCATCAACAGCGTGGCGGTGGCTTTGGGGTCCGAACCGGAAAAAGTCCGCGTCGTGTCGGACATTACCTGATGATGTCCATTTACATGGTCAC
+CAAAACCACCAGCTATATGTTCTTTACCGCAATGGCGGGGAACATTCTGGCGCTGAAAATGATCAACGACATTCTGCACCTGCAAATTAGCTGGGGTGGA
+TGGGCGCTGGCAGCCGGATTGCCGGGCATCATTATGCTGCTGGTCACCCCGCTGGTGATTTACACCATGTATCCACCAGAAATTAAGAAGGTGGATAACA
+AAACCATCGCTAAAGCGGGCCTTGCCGAACTAGGACCGATGAAAATCCGCGAAAAATGCTGCTCGGTGTCTTTGTGCTGGCGCTGCTGGGCTGGATTTTC
+AGTAAGTCTCTGGGGTTGATGAATCCACCGTGGCAATCGTTGTTATGGCAACCATGCTGCTGCTGGGTATCGTTACCTGGGAAGACGTGGTTAAAAATAA
+AGGCGGCTGGAATACCTTAATCTGGTACGGCGGTATTATCGGCTTAAGCTCCTTATTATCGAAAGTTAAATTCTTCGAATGGTTAGCTGAAGTCTTTAAA
+ATAACCTGGCATTTGATGGTCACGGTAACGTTGCTTTCTTCGTTATTATTTTCCTCAGCATTATCGTGCGTTATTTCTTCGCTTCCGGTAGTGCCTATAT
+CGTTGCTATGTTACCGGTATTTGCCATGCTGGCGAACGTCTCCGGCGCACCGTTAATGTTAACCGCGCTGGCACTGTTGTTCTCCAACTCCTATGGCGGC
+ATGGTTACTCACTATGGCGGCGCGGCAGGTCCGGTCATCTTTGGCGTGGGTTATAACGATATTAAATCCTGGTGGTTGGTCGGTGCGGTACTGACGATAT
+TAACCTTCCTGGTGCATATCACCCTCGGCGTGTGGTGGTGGAATATGCTGATCGGCTGGAACATGCTGTAAATATTCTCGTCATACTTCAAGTTGCATGT
+GCTGCGTCTGCGTTCGCTCACCCCAGTCACTTACTTATGTAAGCTCCTGGGGATTCACTCGCTTGTCGCCTTCCTGCAACTCGAATTATTTAGAGTATAT
+CCATTTATTATCTTTCTGCGCACTTCACGGTGCGCAGATATCTGGAGCATTTGATGATCAAGTTATCTGAAAAAGGCGTGTTTCTCGCCAGTAATAACGA
+AATAATTGCCGAAGAACATTTCACCGGCGAAATTAAAAAGAAGAAGCCAAAAAGGCACTATTGCCTGGTCTATTCTCTCTTCGCATAATACGTCCGGAAA
+TATGGATAAACTTAAAATTAAGTTTGATTCATTAGCCTCTCACGATATTACCTTTGTTGGTATTGTACAGACCGCTAAAGCGTCCGGTATGGAACGTTTC
+CCGCTGCCGTATGTGCTGACCAACTGCCATAACTCACTCTGCGCCGTCGGCGGCACTATTAACGGTGATGACCATGTTTTTGGTTTATCGGCGGCCCAGC
+GTTATGGCGGTATTTTGTGCCTCCGCATATTGCGGTCATCCATCAATATATGCGTGAGATGATGGCAGGCGGCGGCAAAATGATCCTCGGGTCAGACAGC
+CACACCCGTTACGGTGCATTAGGGACAATGGCAGTCGGTGAGGGCGGCGGTGAGTTGGTAAAACAGCTGCTTAATGACACCTGGGATATCGACTATCCGG
+GCGTGGTTGCGGTGCATCTGACCGGAAAACCTGCGCCGTATGTGGGGCCACAGGATGTGGCGCTGGCTATCATTGGCGCGGTGTTCAAAAACGGTTACGT
+CAAAACAAAGTCATGGAGTTCGTTGGACCGGGCGTTAGCGCGCTCTCTACCGATTTCCGTAACAGCGTTGACGTGATGACCACTGAAACGACCTGTTTAA
+GTTCTGTCTGGCAAACCGATGAAGAAGTCCATAACTGGCTGGCGCTGCACGGTCGCGGCCAGGATTACTGCCAGCTTAACCCTCAACCGATGGCGTACTA
+CGATGGCTGCATCAGCGTTGATTTAAGCGCCATCAAACCAATGATTGCGCTGCCGTTCCACCCGAGCAACGTGTATGAAATCGACACACTGAACCAGAAC
+CTGACCGACATTCTGCGTGAGATTGAAATTGAGTCCGAACGCGTGGCGCACGGTAAAGCCAAACTCTCGCTGCTGGATAAAGTGGAAAATGGTCGCCTGA
+AAGTGCAGCAGGGGATTATCGCGGGCTGTTCTGGCGGTAACTACGAAAACGTCATCGCGGCGGCGAATGCACTGCGCGGTCAATCCTGTGGCAATGACAC
+CTTCTCGCTGGCAGTTTACCCGTCATCACAGCCGGTGTTTATGGATCTCGCCAAAAAGGTGTGGTAGCAGATTTGATTGGCGCAGGCGCAATCATCAGAA
+CCGCGTTCTGCGGCCCATGCTTTGGCGCGGGCGATACGCCAATCAACAACGGTTTGAGTATTCGCCACACCACGCGTAACTTCCCGAACCGCGAAGGCTC
+TAAGCCAGCTAATGGGCAGATGTCAGCGGTGGCGTTGATGGACGCTCGTTCTATCGCTGCGACTGCGGCAAACGGTGGCTATTTAACCTCTGCCAGCGAA
+CTTGATTGCTGGGACAACGTGCCGGAGTACGCCTTCGATGTAACGCCGTATAAAACCGTGTTTATCAGGGCTTTGTGAAAGGGGCAACTCAGCAACCGCT
+GATTTACGGGCCGAACATTAAAGACTGGCCGGAATTGGGTGCGCTGACTGACAATATCGTCCTGAAAGTGTGCTCGAAGATCCTCGACGAAGTGACCACC
+ACCGACGAACTGATTCCTTCCGGTGAAACCTCTTCTTATCGTTCAAATCCGATTGGTCTGGCGGAGTTTACCCTGTCTCGCCGCGATCCCGGTTATGTTA
+GCAGAAGTAAAGCGACTGCTGAGCTGGAAAATCAGCGTCTGGCGGGGAATGTCAGCGAGCTGACAGAGGTGTTTGCGCGCATTAAGCAGATTGCTGGTCA
+GGAGCATATTGATCCGCTGCAAACTGAAATTGGCAGCATGGTCTATGCGGTGAAACCAGGCGATGGTTCTGCGCGTGAACAGGCGGCGAGCTGCCAGCGT
+GTGATTGGCGGTCTGGCGAATATTGCCGAGGAGTACGCGACTAAACGCTATCGTTCTAACGTCATCAACTGGGGATGTTACCGCTGCAAATGGCGGAAGT
+ACCAACCTTTGAAGTGGGGATTACATTTACATCCCTGGCATTAAAGCGGCGCTGGATAATCCGGGTACGACGTTTAAAGGTTATGTGATCCATGAAGATG
+CGCCGGTAACGGAAATTACGCTCTATATGGAAAGTCTGACTGCTGAAGAGCGCGAGATTATCAAGGCGGGTAGTTTGATTAACTTCAATAAAACCGTCAG
+ATGTAAAAAGCGCCATGTGAATGTAGGTCGCATTCGGCACTTATTGTCGGATGCGATGCTTGCGCATCTTATCCGACCTACGAATCGCATCGAATCTGTA
+GGCCAGATAAGGCATTTTCGCAGCATCCGGCACTTATTGTCGGATGCGATGCTTGCGCATCTTATCCGACCTACAAATCGCATCGAACCGTAGGCCGGAT
+AAGGCGTTTACGCCGCATCCGGCAAATAGTTAATTGCTCTTACTTCTTCGCCTCTGCAACCACTTTACTACCCACGCCGCGGTTATTGTATTCCCACATG
+CGGTTGTAGTTAGTGTCATTCAGATTGCGCTGTATTTCGTCGTTATCATCTACGCTGCCGGTATTACCCGCAAACGGACGATTAGAGATCACCGCATCGG
+CCCACGGTTTAGCCGTGTTAAAACCTTCGTTGATGGCGCTATCACGGATCACCACCTGACCGTTGGTATTGGCATCAACATCCAGCGAGCGGCCCAGTTG
+CGCCACACCATCACCGAAAGCATTGAAACGGCTGTTTACGGCGAGGAAACCGTAGTAAATGTTGGACAGCGTAGCCGGTGCAAACACATACGCTTCTTGC
+TGAGTACGTGAGTTCACCACGCGGAATTCGGTGTTATCGAACACCACTGCGCCGCGACCAGAAACGATATCCACATCCCTTCAATGTAGCTGTTGGTCAC
+CAGCGTACGCGGCTGACGATTCGTTTCCAGACGGTTCTGCACACCGCTGTTGGTGACAAAGAAGGTGTTCTGACGACCGAGAATGTTAACGTTGTTAATC
+TGTACCTGGTCACCATCAGTACGCAGTGCCACCGCCGGATGGTTACCTGCATCTACGCTATCGCCCAGCGTGTTTTCGATGGTCAGATTTTGCAGTTGCA
+GGCCATTGTTTTGTGACCAGAAGACCGCAGAGCAGAGAACACCGATACTGTCGCTGCGTTTGCTCTGGCAGCTATCGTACATATACCACGCTGGTTTACC
+TGGCATATATTTGCCGCGCGGGTTGACGTCGTGACGCCAGTCGGCAGGGCTCATGCCACCATCAAGGGAAAGCCCAATCTTCACATCAATCGGTTTTCAC
+CTGTACCGTACAGAGTAATTCCACCCGGAGCGGCAGGGACATATACCGTTCCCTGATACTCACCAGGCATCACGGCAATATACTGGCGCTTGTTGGTACG
+CTTGATAATTGCCGCATCTACCGCCGCCTGAATCGTGGTATGCGTTACACCTTGAGTGCCCGCCGGGCCGACAACAAAGTCAGGTTGCGCAGGCAGGGTA
+ATCGGGGAAGGATTCCACGCTGCAGCACCTGGTGTCAGGGATGCAAAATAGTGTTGAGCATCGAAATTCTGCGCTTCTTTGCCGACAGAATCGGGCGAGA
+AGAGGTACCAGGCGCGGTTTGATCAGAAGGACGTTGATCGGGCGGGGTTGAGCTACAGGCGGTCAGCGTCACGCCAAAAGCCAATGCCAGCGCCAGACGG
+GAAACTGAAAATGTGTTCACAGGTTGCTCCGGGCTATGAAATAGAAAAATGAATCCGTTGAAGCCTGCTTTTTATACTAACTTGAGCGAAACGGGAAGGT
+AAAAGACAAAAGTTGTTTTAATACCTTTAAGTGATACCAGATGGCATTGCGCCATCTGGCAGAGTGATTAACTAAACATCGCAGTAATCGAGGCGCTTGC
+CAGAGAGTGGAAATGAACGTTAAACCCGACCATCGCGCCGCTGGCACCTTCATCGACATCAATACGTTCTATATCCAGCGCGTGAACGGTAAAAATGTAG
+CGATGAGTTTCGCCTTTCGGCGGTGCTGCGCCATCGTACCCGGTTTTACCAAAGTCGGTACGCGTCTGCAAAACGCCGTCTGGCATTGCTACCAGACCAG
+AGCCAAACCCTTGCGGTAATACGCGGGTATCAGCGGGTAAGTTAACAACTACCCAGTGCCACCAGCCGGAGCCGGTTGGCGCATCCGGGTCGTAGCAGGT
+GACAACAAAACTTTTCGTTCCCGCAGGAACATCATCCCACGCCAGATGCGGTGAAATATTATCGCCATCGTAACCCATGCCGTTAAAGACATGACGATGC
+GGCAATTTATCGCCATCGCGCAGATCGTTACTGATGAGTTTCATGAACCCTCCTTTCTTGTTTGCAGAAAGTGTAGCCAGAAACCCTCACGCGGACTTCT
+CGTTATTGGCAAAAATGTTTCATCCTGTACCGCGCGGTTAACCGCTGCGGTCAGACGCTGCAACTGTTGCGGGAGAATAATATAGGGCGGCATCAGGTAA
+ATCAGTTTGCCAAAAGGCCGGATCCAGACACCCTGTTCGACAAAGAATTTTGCAGCGCCGCCATATTCACCGGATGAGTGGTTTCGACCACGCCAATGGC
+CCCAGTACGCGCACATCGGCAACCATTTCGGCATCACGGGCGGGGCAAGTTGCTCGCGCAGCTGTACTTCAATATCCGCCACCTGTTGCTGCCAGTCGCC
+AGATTCGAGAATCGCCAGGCTGGCGTTTGCTGCCGCGCAGGCCAGCGGATTGCCCATAAAGTTGGCCCATGCATAAAGCAACCGGCTTCACCGTTACTGA
+TGGTTTCTGCAACCTCGCGCGTGGTGAGTGTGGCGGAAAGGGTCATTGTGCCGCCGGTTAAGGCTTTACCGAGGCACAAAATGTCCGGCGCGATTTCTGC
+ATGTTCACAGGCAAACAGTTTCCCGGTACGACCAAATCCAGTGGCGATCTCGTCGGCAATCAGCAAGATACCTTCGCGATCGCATATTTTGCGGATTCGT
+TTTAACCATTCCGGATGGTACATGCGCATCCCGCCTGCGCCCTGGACAATCGGCTCAATGATCACCGCCGCGATTTCATGACGATGCGCCGCCATCAGGC
+GGGCAAAGCCCACCATATCGCGCTCATCCCATTCGCCATCCATGCGGCTTTGCGGGGCGGGAGCAAACAGGTTTTCTGGCAGGTAGCCTTTCCACAGACT
+GTGCATTGAGTTATCCGGATCGCACACCGACATCGCGCCAAAGGTATCGCCATGATAACCATTGCGGAAGGTCAGAAAACGCTGGCGCGCTTCGCCTTTG
+GCTTGCCAGTACTGCAACGCCATTTTCATCGCCACTTCCACCGCTACGGAACCGGAGTCCGCGAGAAAACGCACTCCAGCGGTTGCGGCGTCATCGCCAC
+CAGTTTGCGGCACAGCTCAATGGCTGGCGCATGGGTGATACCGCCAAACATCACATGCGACATGGCATCAATTTGCGACTTCATCGCCGCATTAAGCTGC
+GGGTGATTGTAGCCGTGGATCGCCGCCCACCAGGACGACATACCGTCAACCAGGCGTCTGCCGTCAGACAAAATCAGCTCGCAACCTTCGGCGCTCACCA
+CCGGATAAACCGGCAGAGGGAGGTCATGGATGTGTATGGGTGCCAGATATGGCGTTGGTCAAAGGCAAGATCGTCCGTTGTCATAATCGACTTGTAAACC
+AAATTGAAAAGATTTAGGTTTACAAGTCTACACCGAATTAACAACAAAAACACGTTTTGGAGAAGCCCCATGGCTCACCGCCCACGCTGGACATTGTCGC
+AAGTCACAGAATTATTTGAAAAACCGTTGCTGGATCTGCTGTTTGAAGCGCAGCAGGTGCATCGCCAGCATTTCGATCCTCGTCAGGTGCAGGTCAGCAC
+GTTGCTGTCGATTAAGACCGGAGCTTGTCCGGAAGATTGCAAATACTGCCCGCAAAGCTCGCGCTACAAAACCGGGCTGGAAGCCGAGCGGTTGATGGAA
+GTTGAACAGGTGCTGGAGTCGGCGCGCAAAGCGAAAGCGGCAGGATCGACGCGCTTCTGTATGGGCGCGGCGTGGAAGAATCCCCACGAACGCGATATGC
+CGTACCTGGAACAAATGGTGCAGGGGTAAAAGCGATGGGGCTGGAGGCGTGTATGACGCTGGGCACGTTGAGTGAATCTCAGGCGCAGCGCCTCGCGAAC
+GCCGGGCTGGATTACTACAACCACAACCTGGACACCTCGCCGGAGTTTTACGGCAATATCATCACCACACGCACTTATCAGGAACGCCTCGATACGCTGG
+AAAAAGTGCGCGATGCCGGGATCAAAGTCTGTTCTGGCGGCATTGTGGGCTTAGGCGAAACGGTAAAAGATCGCGCCGGATTATTGCTGCAACTGGCAAA
+CCTGCCGACGCCGCCGGAAAGCGTGCCAATCAACATGCTGGTGAAGGTGAAAGGCACGCCGCTTGCCGATAACGATGATGTCGATGCCTTTGATTTTATT
+CGCACCATTGCGGTCGCGCGGATCATGATGCCAACCTCTTACGTGCGCCTTTCTGCCGGACGCGAGCAGATGAACGAACAGACTCAGGCGATGTGCTTTA
+TGGCAGGCGCAAACTCGATTTTCTACGGTTGCAAACTGCTGACCACGCCGAATCCGGAAGAAGATAAAGACCTGCAACTGTTCCGCAAACTGGGGCTAAA
+TCCGCAGCAAACTGCCGTGCTGGCAGGGGATAACGAACAACAGCAACGTCTTGAACAGGCGCTGATGACCCCGGACACCGACGAATATTACAACGCGGCA
+GCATTATGAGCTGGCAGGAGAAAATCAACGCGGCGCTCGATGCGCGGCGTGCTGCCGATGCCCTGCGTCGCCGTTATCCGGTGGCGCAAGGAGCCGGACG
+CTGGCTGGTGGCGGATGATCGCCAGTATCTGAACTTTTCCAGTAACGATTATTTAGGTTTAAGCCATCATCCGCAAATTATCCGTGCCTGGCAGCAGGGG
+CGGAGCAATTTGGCATCGGTAGCGGCGGCTCCGGTCACGTCAGCGGTTATAGCGTGGTGCATCAGGCACTGGAAGAAGAGCTGGCCGAGTGGCTTGGCTA
+TTCGCGGGCACTGCTGTTTATCTCTGGTTTCGCCGCTAATCAGGCAGTTATTGCCGCGATGATGGCGAAAGAGGACCGTATTGCTGCCGACCGGCTTAGC
+CATGCCTCATTGCTGGAAGCTGCCAGTTTAAGCCCGTCGCAGCTTCGCCGTTTTGCTCATAACGATGTCACTCATTTGGCGCGATTGCTTGCTTCCCCTG
+TCCGGGGCAGCAAATGGTGGTGACAGAAGGCGTGTTCAGCATGGACGGCGATAGTGCGCCACTGGCGGAAATCCAGCAGGTAACGCAACAGCACAATGGC
+TGGTTGATGGTCGATGATGCCCACGGCACGGGCGTTATCGGGGAGCAGGGCGCGGCAGCTGCTGGCTGCAAAAGGTAAAACCAGAATTGCTGGTAGTGAC
+TTTTGGCAAAGGATTTGGCGTCAGCGGGGCAGCGGTGCTTTGCTCCAGTACGGTGGCGGATTATCTGCTGCAATTCGCCCGCCACCTTATCTACAGCACC
+AGTATGCCGCCCGCTCAGGCGCAGGCATTACGTGCGTCGCTGGCGGTCATTCGCAGTGATGAGGGTGATGCACGGCGCGAAAACTGGCGGCACTCATTAC
+GCGTTTTCGTGCCGGAGTACAGGATTTGCCGTTTACGCTTGCTGATTCATGCAGCGCCATCCAGCCATTGATTGTCGGTGATAACAGCCGTGCGTTACAA
+CTGGCAGAAAACTGCGTCAGCAAGGCTGCTGGGTCACGGCGATTCGCCCGCCAACCGTACCCGCTGGTACTGCGCGACTGCGCTTAACGCTAACCGCTGC
+GCATGAAATGCAGGATATCGACCGTCTGCTGGAGGTGCTGCATGGCAACGGTTAATAAACAAGCCATTGCAGCGGCATTTGGTCGGGCAGCCGCACACTA
+TGAGCAACATGCAGATCTACAGCGCCAGAGTGCTGACGCCTTACTGGCAATGCTTCCACAGCGTAAATACACCCACGTACTGGACGCGGGTTGTGGACCT
+GGCTGGATGAGCCGCCACTGGCGGGAACGTCACGCGCAGGTGACGGCCTTAGATCTCTCGCCGCCAATGCTTGTTCAGGCACGCCAGAAGGATGCCGCAG
+ACCATTATCTGGCGGGAGATATCGAATCCTGCCGTTAGCGACTGCGACGTTCGATCTTGCATGGAGCAATCTCGCAGTGCAGTGGTGCGGTAATTTATCC
+ACGGCACTCCGCGAGCTGTATCGGGTGGTGCGCCCCAAAGGCGTGGTCGCGTTTACCACGCTGGTGCAGGATCGTTACCCGAACTGCATCAGGCGTGGCA
+GGCGGTGGACGAGCGTCCGCATGCTAATCGCTTTTACCGCCAGATGAAATCGAACAGTCGCTGAACGGCGTGCATTATCAACATCATATTCAGCCCATCA
+CGCTGTGGTTTGATGATGCGCTCAGTGCCATGCGTTCGCTGAAAGGCATCGGTGCCACGCATCTTCATGAAGGGCGCGACCCGCGAATATTAACGCGTTC
+GCAGTTGCAGCGATTGCAACTGGCCTGGCCGCAACAGCAGGGGCGATATCCTCTGACGTATCATCTTTTTGGGAGTGATTGCTCGTGAGTAAACGTTATT
+TTGTCACCGGAACGGATACCGAAGTGGGGAAAACTGTCGCCAGTTGTGCACTTTACAAGCCGCAAAGGCAGCAGGCTACCGGACGGCAGGTTATAAACCG
+GTCGCCTCTGGCAGCGAAAAGACCCCGGAAGGTTTACGCAATAGCGACGCGCTGGCGTTACAGCGCAACAGCAGCCTGCAGCTGGATTACGCAACAGTAA
+ATCCTTACACCTTCGCAGAACCCACTTCGCCGCACATCATCAGCGCGCAAGAGGGCAGACCGATAGAATCATTGGTAATGAGCGCCGGATTACGCGCGCT
+TGAACAACAGGCTGACTGGGTGTTAGTGGAAGGTGCTGGCGGCTGGTTTACGCCGCTTTCTGACACTTTCACTTTTGCAGATTGGGTAACACAGGAACAA
+CTGCCGGTGATACTGGTAGTTGGTGTGAAACTCGGCTGTATTAATCACGCGATGTTGACTGCACAGGTAATACAACACGCCGGACTGACTCTGGCGGGTT
+GGGTGGCGAACGATGTTACGCCTCCGGGAAAACGTCACGCTGAATATATGACCACGCTCACCCGCATGATTCCCGCGCCGCTGCTGGGAGATCCCTGGCT
+TGCAGAAAATCCAGAAAATGCGGCAACCGGAAAGTACATAAACCTTGCCTTGTTGTAGCCATTCTGTATTTGGTTAAATTGCGAGCGAGATCGCGTCTTC
+GATTGACTGCAATTTAACCAATTAAATTCTAAAATAATCACGAAAAATTTTACTTCCGCCTCATGCGGCGAATGTGGAATTGCCCAGGCGGCGGGGATAG
+GGTTGGAGACAGTTATCCACTATTCCTGTGGATAACCATGTGTATTAGAGTTAGAAAACACGAGGCAAGCGAGAGAATACGCGGCTTGCACGCGAATTGG
+CGTTAAAGACGGCTCAAAGAAATATCTTTTATTTTTAACTGGTTAGATAAATGCAATGGCAGTCACTGAACAGGCATCTCTTGCCATAAAACTGTCATCA
+CTCATCTTGACAAATGTTAAAAAGCCGTTGCTTTGGGGATAACCCGGTAAGGCCGGAGTTTTATCTCGCCACAGAGTAAATTTTGCTCATGATTGACAGC
+GGAGTTTACGCTGTATCAGAAATATTATGGTGATGAACTGTTTTTATCCAGTATAATTTGTTGGCATAATTAAGTACGACGAGTAAAATTACATACCTGC
+CCGCCCAACTCCTTCAGGTAGCGACTCATGAGTAAACCGTTCAAACTGAATTCCGCTTTTAAACCTTCTGGCGATCAGCCAGAGGCGATTCGACGTCTCG
+AAGAGGGCTGGAAGATGGCCTGGCGCACCAGACGTTACTTGGCGTGACTGGCTCAGGAAAACCTTCACCATTGCCAATGTCATTGCTGACCTTCAGCGCC
+CAACCATGGTACTTGCGCCCAACAAAACGCTGGCGGCCCAGCTGTATGGCGAAATGAAAGAGTTCTTCCCGGAAAACGCGGTGGAATATTTCGTTTCCTA
+CTACGACTACTATCAGCCGGAAGCCTATGTACCGAGTTCCGACACTTTCATTGAGAAAGATGCCTCGGTTAACGAACATATTGAGCAGATGCGTTTGTCC
+GCCACCAAAGCGATGCTGGAGCGGCGTGATGTGGTTGTGGTGGCGTCTGTTTCCGCGATTTATGGTCTGGGCGATCCTGATTTATATCTCAAGATGATGC
+TCCATCTCACGGTCGGTATGATTATCGATCAGCGCGCGATTCTGCGCCGACTGGCGGAGCTGCAATACGCTCGTAATGATCAAGCATTCCAGCGTGGTAC
+TTTCCGCGTTCGTGGCGAGGTGATAGATATCTTCCCGGCAGAATCGGATGACATTGCACTTCGCGTGGAACTGTTTGACGAGGAAGTGGAACGATTGTCG
+TTATTTGACCCGCTGACCGGGCAGATTGTTTCCACTATTCCACGTTTTACCATCTACCCGAAAACGCACTACGTCACACCGCGCGAGCGCATCGTACAGG
+CGATGGAGGAGATCAAAGAAGAGCTGGCCGCCAGACGCAAAGTGCTGTTGGAAAACAACAAACTGCTGGAAGAGCAGCGGCTGACCCAGCGTACCCAGTT
+TGATCTGGAGATGATGAACGAGCTGGGCTACTGTTCGGGGATTGAAAACTACTGCGCTTCCTCTCCGGTCGTGGACCGGGTGAGCCACCGCCGACGCTGT
+TTGATTACCTGCCTGCCGATGGGCTGCTGGTCGTCGATGAATCTCACGTCACCATTCCACAAATTGGCGGCATGTATCGCGGTGACCGGGCGCGTAAAGA
+GACACTGGTGGAGTACGGCTTCCGCCTGCCATCAGCGCTGGATAACCGTCCGCTTAAGTTTGAAGAGTTCGAAGCATTAGCGCCGCAAACCATCTATGTT
+TCGGCGACGCCGGGTAATTACGAGCTGGAAAAATCCGGCGGCGATGTGGTGGATCAGGTGGTGCGTCCAACCGGATTGCTTGACCCGATTATCGAAGTGC
+GGCCGGTGGCGACACAGGTTGATGATCTTCTTTCGGAGATTCGTCAGCGAGCGGCAATTAACGAACGCGTACTGGTCACCACACTGACCAAGCGGATGGC
+GGAAGATCTTACCGAATATCTCGAAGAACATGGCGAGCGCGTGCGTTATCTTCACTCAGATATCGACACCGTCGAACGTATGGAGATTATCCGCGACTTG
+CGTCTGGGTGAGTTCGACGTGCTGGTAGGGATCAACTTACTGCGCGAAGGTCTGGATATGCCGGAAGTGTCGCTGGTGGCGATCCTCGACGCTGACAAAG
+AAGGCTTCCTGCGTTCCGAACGTTCGTTGATCCAGACCATTGGTCGTGCGGCACGTAACGTTAACGGTAAAGCGATTCTCTACGGCGATAAGATCACCCC
+ATCAATGGCGAAAGCGATTGGCGAAACCGAACGTCGCCGTGAGAAACAGCAGAAGTACAACGAGGAACACGGAATTACGCCGCAAGGCTTGAACAAGAAA
+GTGGTCGATATCCTGGCGCTGGGGCAGAACATTGCCAAAACCAAAGCGAAGGGCAGAGGAAAATCGCGCCCGATTGTTGAGCCGGATAATGTGCCGATGG
+ATATGTCGCCTAAAGCGTTGCAGCAGAAAATCCATGAGCTGGAAGGGTTGATGATGCAACACGCGCAGAATCTGGAGTTCGAAGAAGCGGCGCAAATTCG
+TGACCAGTTGCATCAGCTGCGTGAGCTGTTTATCGCGGCATCGTAACAGGATAGCGAAGAAGACTGATGACAAACGGAAAACAGCCTGATGCGCTACGCT
+TATCAGGCCTACATTTTCTCCGCAATATATTGAATTTGCGCGGTTTGTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCATAAACAACGCGCACTTTGT
+CTTCAATAGGAAGCCGGAATTTTCCTTCGGATTTCCGTTAACCTAAAGCCTGTAACGCCTTTTCCAGCGCGTTATGTAACAACTGGCGGTCATGACGATA
+CGGAATATCGCTGGCCTCCAGTACCTCCTGGATCACAATCCGCTCTTTCACCGCCGAGACATCCACTTTTGGCCCGACGATGACCGCATCAATGACCTTT
+TACCAACATACTGCTCCATAATTGCCAGCTTGCTTTCCAGCTTCAAATTAGCCGCAGGTAAACTCAACTCACGCCCCAGATTGCCGATATAAACCATCGG
+CGCTGGCGTGCGGCGTAATGCCTGGGCGATTTCCTTCAGCAGCAGAATTGGCATCAGGCTGGTATAAAACTGCCAGGCCCAATAATGATGAGATCCGCTT
+CATTGATAGCGTGAACCGCCTCACGCGTTGCGGGTACATTAGGCGTTAACAATAACTCTTGAATCGGCGTAGTTAACTGGTCGATATTGACCTCGCCGTA
+AACTTCATGCCCTGATCGTCAATCGCCATCAGATCAACAGGATGCTCTGACATTGGAATCAAATGCGTATCCACTTTCAGCAGATTACGAATTAAATTGA
+TGGCTTCCAGAGGCCGCACGCTAAGGTGATCCAGCGCCTTTAACATCAAGTTTCCGAGATTATGACCGGAAAGTTCGCCATTGCCACCAAAACGGTATTC
+AAACATCGCGGAGGCGACGCTCGGTTCCGTTATCAGCTGGTTGAGGCAGTTGCGCATATCGCCCCAGGCAATGCCGCCTTCTGAACGGCGAATACGCCCC
+GTCGAGCCACCATTATCGGTGGTGGTGACGATACCCGTTAAACGAGAACCCAAAGACGAAAGTGATGAGAGAACGCGTCCCAGTCCATGCCCTCCGCCGA
+GAGCAACGACACGATCAAGATCAGCCAGCGTACGATTGCGCATATAGTTTCCTGGAGTCAGATTATCCGCGCTACAGTAGCGCAAATTGCGGGAAACAGC
+AATTAACCTGCCAATATTGAGGATACAAACTATTTTCTTCTACCTCTAAAGGACGATGCACGCTATGCCTCCCTGATGATGTATATCAAAGTAAAACCGC
+CATTTTCCCTTATTCTGTAGCGAAATAGCACGATCATGACGCTATATACATGATTACATAGCGAAAGTGTGGATGGTAAAAATCTCATTTACACGCTAGT
+ATCGGCATAACCACTAAACACTCTAGCCTCTGCACCTGGGTCAACTGATACGGTGCTTTGGCCGTGACAATGCTCGTAAAGATTGCCACCAGGGCGAAGG
+AAGAAATGACTTCGCCTCCCGTATCTGGAAAGGTGTACATGGCTTCACAACTGACTGATGCATTTGCGCGTAAGTTTTACTACTTGCGCCTGTCGATTAC
+CGATGTGTGTAACTTTCGTTGCACCTACTGCCTGCCGGATGGCTACAAACCGAGCGGCGTCACCAATAAAGGCTTTCTTACCGTCGATGAAATTCGCCGG
+GTTACGCGCGCCTTCGCCAGACTGGGCACCGAAAAGTGCGCCTGACAGGAGGAGAGCCGTCTTTACGCCGCGACTTTACCGATATCATCGCCGCTGTGCG
+GGAAAACGACGCTATCCGCCAGATTGCGGTCACAACCAATGGTTACCGTCTGGAACGCGATGTGGCGAGCTGGCGCGATGCGGGACTTACTGGCATTAAC
+GTCAGTGTCGACAGTCTGGACGCCCGCCAGTTTCACGCTATTACCGGGCAGGATAAATTCAACCAGGTCATGGCAGGGATTGATGCTGCATTTGAGGCCG
+GTTTTGAGAAGGTCAAAGTCAATACCGTGCTGATGCGTGATGTTAATCATCACCAGCTCGACACCTTTCTGAACTGGATCCAGCATCGCCCTATCCAGCT
+GCGTTTCATCGAACTGATGGAAACGGGCGAGGGCAGCGAGCTCTTCCGTAAGCATCACATCTCTGGTCAGGTTCTGCGTGACGAGCTACTGCGTCGCGGC
+TGGATCCACCAATTACGTCAACGCAGCGACGGTCCCGCGCAAGTCTTTTGCCATCCAGATTACGCCGGAGAGATTGGCCTTATCATGCCGTATGAAAAGA
+CTTCTGCGCCACTTGCAACCGCCTGCGCGTTTCCTCCATTGGTAAACTCCATCTCTGCCTGTTTGGTGAAGGCGGCGTTAACCTGCGCGATCTGCTGGAA
+GACGATACCCAGCAACAGGCGCTGGAAGCGCGTATTTCAGCGGCGCTGCGGGAGAAGAAACAGACCCATTTCCTGCATCAAAACAACACCGGTATTACGC
+AAAACTTATCGTACATTGGCGGCTAAAACGTCAAAAGGAGAGATCAGATGAGTCAGGTAAGCACTGAATTTATCCCGACCCGTATTGCTATTCTTACGGT
+TTCTAATCGTCGCGGTGAAGAAGACGATACCTCCGGTCACTATCTGCGCGATTCGGCGCAAGAAGCGGGCCATCACGTTGTCGATAAAGCCATTGTGAAA
+GAAAACCGCTACGCTATTCGCGCTCAGGTATCTGCGTGGATCGCCAGCGACGATGTACAAGTGGTATTGATTACGGGTGGTACTGGCCTGACGGAAGGTG
+ATCAGGCTCCCGAAGCATTGCTGCCGTTGTTCGACCGTGAAGTTGAAGGTTTTGGTGAAGTGTTCCGGATGTTGTCGTTTGAAGAGATTGGCACTTCCAC
+GTTGCAATCTCGTGCGGTAGCGGGCGTCGCCAACAAAACGCTGATTTTCGCCATGCCGGGTTCGACCAAAGCGTGCCGTACCGCATGGGAAAATATCATC
+GCGCCGCAGCTGGATGCCCGTACGCGTCCGTGTAATTTCCATCCACATTTGAAGAAATAAGTATGTCGCAACTGACCCATATCAACGCCGCTGGCGAAGC
+GCACATGGTGGATGTCTCCGCCAAAGCGGAAACCGTGCGTGAAGCGCGGGCGGAAGCCTTTGTCACCATGCGCAGCGAGACGCTGGCGATGATTATTGAT
+GGTCGCCACCACAAAGGCGACGTATTTGCCACTGCGCGTATTGCCGGTATTCAGGCGGCAAAACGCACCTGGGATCTGATCCCGCTCTGTCATCCGCTGA
+TGCTCAGCAAAGTTGAAGTCAATTTACAGGCCGAGCCGGAGCACAATCGGGTGCGTATAGAAACCTTATGCCGCCTGACCGGGAAAACCGGTGTCGAAAT
+GGAAGCATTAACCGCGGCCTCCGTGGCGGCGCTGACCATTTATGACATGTGCAAAGCGGTGCAAAAGATATGGTGATTGGTCCGGTACGTTTGCTGGCGA
+AGAGCGGCGGCAAGTCGGGTGACTTTAAGGTGGAAGCGGATGATTAAAGTTCTTTTTTCGCCCAGGTGCGCGAGTTGGTGGGAACAGATGCAACCGAAGT
+GGCTGCGGATTTCCCAACTGTTGAAGCGTTACGCCAGCACATGGCTGCGCAGAGCGATCGCTGGGCGCTGGCGCTGGAAGATGGCAAATTACTGGCTGCC
+GTCAACCAGACGCTGGTGAGTTTTGACCATCCGCTGACTGACGGCGACGAAGTAGCTTTCTTCCCGCCGGTAACCGGAGGTTAAGATGGCAGAAACCAAA
+ATTGTTGTTGGTCCGCAGCCGTTCAGCGTAGGAGAAGAGTACCCGTGGCTGGCGGAGCGTGACGAAGACGGTGCGGTAGTCACCTTTACTGGTAAGGTGC
+GCAACCATAACCTGGGCGACAGCGTCAACGCATTAACCCTCGAACACTATCCGGGGATGACTGAAAAGCACTGGCAGAAATTGTTGATGAAGCGCGTAAC
+CGCTGGCCGCTGGGGCGCGTCACTGTGATTCACCGCATCGGGGAATTATGGCCGGGCGATGAAATCGTTTTTGTCGGTGTCACCAGTGCGCATCGCAGCA
+GTGCGTTTGAAGCCGGGCAGTTTATTATGGATTATCTCAAAACCCGCGCACCGTTCTGGAAGCGCGAAGCCACGCCGGAAGGCGACCGCTGGGTTGAAGC
+TCGGGAGAGCGATCAGCAGGCGGCAAAACGCTGGTAGTTTTTGTTAGCCGGATAAGGCACCGCTGCGTCCGGCAATTTCACCGCTCAGTACATACGTTTA
+CGCTGCGTCGATGCACAGCCTCATCATTTTGCAGTATCCTTAAGATATTCCTTATATCTTCAGGAGATCGTCATGGACAGATTCCCACGTTCTGATTCAA
+TCGTACAACCCCGGGCTGGCTTGCAAACTTATATGGCTCAAGTCTATGGCTGGATGACCGTTGGCTTGTTGCTGACCGCATTTGTTGCCTGGTATGCGGC
+TAATTCCGCGGCCGTGATGGAGCTGTTGTTCACTAACCGTGTCTTTTAATCGGTCTGATCATCGCGCAATTAGCATTGGTTATTGTGTTATCAGCGATGA
+TTCAAAAGCTGAGCGCAGGTGTAACGACGATGCTCTTTATGCTTTATTCGGCGCTGACGGGTCTTACGCTTTCCAGTATATTCATTGTCTATACCGCTGC
+TTCTATCGCCAGTACTTTCGTCGTTACTGCCGGGATGTTCGGCGCAATGAGCCTGTACGGTTACACCACGAAGCGCGATTTAAGTGGCTTTGGCAATATG
+CTGTTTATGGCGTTAATCGGCATTGTGCTGGCATCGCTGGTCAACTTCTGGTTGAAAAGCGAAGCATTGATGTGGGCAGTTACCTACATCGGCGTGATTG
+TCTTTGTCGGATTGACGGCGTATGACACGCAGAAACTGAAAAATATGGGTGAGCAGATTGATACCCGCGACACGTCGAACCTGCGCAAATATTCCATTCT
+TGGCGCGTTAACCTTGTATCTGGACTTCATCAACCTGTTCCTGATGTTGTTGCGGATCTTCGGCAACCGCCGTTAATTCTTTTCACCATCACTATCCCGG
+CCATGTGTCGGGATTTTTTCTTACTAAAAACGACACTTAACAAGTACCAGGTATAAAATATGCCTTATGGACGAGCGGAAGCGTTTTCTGTATCCATAAA
+TGCAAAAGTATTTTGTATGCGTGGTTTTAAATTTATTGATGGTGAATATTAATATTTTTCTAAGGATAACTAAAAGAATGGAATCATACTCGCAAAACAG
+CAATAAATTAGATTTTCAGCACGAGGCCAGGATATTAAACGGTATATGGCTCATTACCGCTTTAGGTTTGGTGGCAACCGCAGGACTAGCCTGGGGAGCT
+AAGTATATCGAAATTACGGCAACCAAATATGATTCACCACCAATGTATGTCGCCATAGGGTTATTATTACTTTGTATGTATGGCTTAAGTAAGGATATCA
+ACAAGATAAATGCCGCCATCGCGGGCGTAATATATCTGTTTTACTCTCTTTGGTGGCGATTGTCGTTGCAAGTTTAGTTCCTGTATATGCCATTATCATC
+GTGTTCAGCACTGCGGGCGCGATGTTTTAATCAGTATGCTGGCCGGTTTATTATTTAATGTTGATCCTGGTTCTCACCGTTTTATCATTATGATGACGTT
+GACAGGGTTGGCCCTGGTAATCATCGTGAATGCGGCATTAATGAGTGAACGGCCCATTTGGATAATAAGTTGCTTAATGATTGTGTTATGGTCAGGCATT
+ATCTCGCATGGACGAAATAAGCTCCTTGAATTGGCGGGGAAATGCCATAGTGAAGAGTTGTGGAGTCCGGTTCGTTGCGCTTTTACAGGTGCATTAACAC
+TCTATTACTATTTTATCGGCTTCTTTGGGATACTTGCCGCGATAGCTATAACGCTTGTCTGGCAAAGGCATACGCGTTTTTCATTATTAGCCGTAAATGC
+ACATACTAAAGAACTTAACTAAACTTCACATCGCCGCTTCATTTTTCGCCCGTAGCTTCTTCGCCTGGCTTTCCAGCAACAGGTAACAGATCAGCGCCAG
+CAGCAGTGGGATAAAGTAATACAGCACACGGTAAGCGAGTAGGGCGGCGATAATTGTACCTTTGGAGGTATGCTCCCCAGCCAGTAGTGCGATAAACACC
+GCTTCCAGCACACCGATCCCCGCCGGAATATGCACGATGACGCCAGCAATACTACTAACCAGTAACACGCCCAGTACAAAGAAATAGTTCACGCTTTGAC
+CAAGTAACAGCCAGATAATCGCCCCCATTACCATCCAGTTAACGCTGGAAATCAGCATCTGAGCGAGGGCGAATTTCCATGAAGGCAGCACCAGCTTTTG
+CCCTTTGATGGTCATATGGCGGTGCTTCGCGAAAGCGCAAAACCACAAATAAACCGCGATAATCATCAGTAAGCCAATGCCGAGAATACGCAGCGTAGTT
+TGATCGACATACCAGTGATCCGGCAACTCCACCACGCCTGCGGTAAAGATAATCCCTGCCAGTAAAATGTAGCCCAGCCAGTTGGTGGTAATACTGAGCG
+AGAAAATCCGCGTAATAGTGCTACCGGGCAACCCCAGACGAGAGTACAAACGATAGCGCATACCAATGCCGCCGACCCAGGTACTGAGCGTCAGGTTGAA
+GGCGTAGCAGATAAACGACACCAGCATCACCTGGCGCTTCGCCAGTTTGTGACCGCAGTAAAAGCGGGCGAGCAGGTCATAGCAGCCGTAAATCAGATAG
+CTGACGACCACCAGCCCGACCGCACTAAGCAGCGCAACGCGATTGTAGTCGCGGATGACCTTCCAGACCTCTTCCCAGTCCACTTTTTGGCGTAGACCAC
+CAGCAACACAATCACCGCGATAAAAACAGCCAGGTGAGGATCTTCTTTGCTAAGCGCCAGCGCGGGTGTGATTTACTCATCAGGGTTTTACCCCGTGTTT
+TCAGTTTCTACCCGATCCTGCGTTTCCATTGTCGGTTGTGCGGGCGGATCAACCTGCGCCAGACGTGGCGTGTGTGCCGGAAGCCAGCCAACCAGCGCCG
+GGAAGTGGCGTAAAAGTGGAACGCCAGCACGCTTTTGGTCAGGTTCCACCAGGTGCGTTTGGGCAGCATGGTTTCATCCACCTGCTGACAATCTGCGGCA
+ATAATGCCGTTCAGATTATCGCGCAGCGTCTGGTTAAAATGACGATCGTGGATGATGACATTTGCTTCGAGATTCAGTGACAAACTGAGCGGATCGAGAT
+TACTGGACCCTACTGTCGCCCAGTGATCGTCCATCAATGCCACTTTGCCGTGGAGCGGGCGGCGGCGGTACTCAAAACCTGAACGCCGCCTTTAACCAGA
+TAGTTATACAGCAAGCGCGCACCGACTCTGACAATCGGCATATCCGGTTCGCCCTGAATGATCAGTTTGATCCGCACCCGCGCCGTGCCGCTTTACGCAA
+GGCGTGTAAAATCGATAGCCGGGGAAGAAGTAGGCGTTGGCGATAATCACTTCCCGCCGCGCCTGAGTGAGCATTTTCAAATAATGGCGTTCAATATCAT
+CGCGATGTTCTTCGTTATCGCGCCAGACCAGCAATACCTGCGCTTCTCCCGGCTGGCGGTTCTCTTCCGCTTTGTGATGACGTCGCCACCAGCGTCGTGC
+CGCGCTCTGTCCAGGCAGGTTTTCCAGCTCAAACTGGAGAATATCTTCGACAATCGGCCCTTCAAGGCGTACCGCGTAATCCTGTTTAGCCTCTGGACCG
+TAGCTGGACATATGCTCGGCGGAGTAATTCAGCCCGCCAATAAAGGCTATACGCGCGTCGATCACCACAATTTTGCGATGCATCCGGCGAAACACATTGG
+TGCGCATACCAAAAGGCGAGGGCGGGGATCGTAGTAGCGGAACACTACGCCAGCTGCCGTCAGTTCATTGACAAACTCATCGCTGAGATCCGGCGAACCG
+TAGCCATCCAGCAAGACTTCCGCTTTAACCCGCGTTGCGCTGCTGCCAGTAGTGCCGCATGCAGTTGTTTGCCGACGTCATCCTCAAACCAGATAAACGT
+TTCAAGAATGATGCGTTCTTGTGCCTCGCCAATCGCCTTAAACACCGCGGGATAATATTGCTCGCCGTTTTCCAGCAACTGGATCTTATTGCCTTCGCGC
+CAGCTACATTTCATAAATGAATCTCCGCACTTAAAGGGCATGATCAGAAAGGTGTCGCCATGTCCGCAGCGGCAACGCGGTTGGCGCGCTGGCGCTGGCA
+TTTTGACGTAGATCCTGTCCAGTCGTAGTAGAGGAAATTGCACCGGAAACGTGCGCGCCGGGCGTCCGTGGGCGCGGGTAAAAATCTCATCCAGTCCGGC
+CTGCACTTTAACGGATGATTAGCTTTTGCCGCCAGTCATTGAAATCACCCGCCACCAATACCGGTTCGCCGTCCGGTAGCTCATTCACCCATTCGGCGAG
+CATCGCAAGCTGCGCCTGACGGTGCGCCTCACGCAGGCCCAGATGTACGCACATCACATGAATCGCTTTTCCGGTCATCGGCGGCACAATGCGGCAGTAG
+AGCACGCCGCGCTTTTCCGCACCATCGACCGAAACATCGCGATTCTCATAATGTTCAATGGGATAACGCGACAGTACGGCGTTGCCGTGATGCCCTTCCG
+GGTATACGGCATTGCGACCGTAGGCAAAATCGCTCCACATAGTGTCGGCGAGAAACTCGTAGTGCGAGGTATCGGGCCAGTTTTCCACATGCAGCGGATG
+AACTTCGTGCGCGCCCATCACTTCCTGCAGGCAAACAATATCGGCGCTGACGGTACGCACGGCGTCGCGAAGTTCCGGCAAAATGAAGCGTCGGTTAAAC
+GCGGTAAAGCCTTTGTGAATATTGATGGTGAGCACCTTGAACGAAAATTGTTGTGTTTGATCGGGCATAATTTTCCTGTCTTTGCCTCTTATCTCATTGA
+AATAGTGTAGTCGGCGTCACAAAAGGTGCGGTCTTACGGAATTTTCCGTAAAGTTCGGTACTCTGAGTAAGTAGAGATAAATTCTTCAGGAGAGAAGCCA
+TGAAGTGGCAACAACGTGTTCGTGTCGCAACGGGTCTAAGTTGCTGGCAGATTATGTTGCATTTACTGGTAGTGGCGCTGCTGGTGGTGGGCTGGATGAG
+TAAGACTCTGGTTCACGTCGGCGTGGGATTATGCGCACTGTATTGTGTCACGGTAGTGATGATGCTGGTGTTTCAGCGCCACCCCGAGCAACGCTGGCGT
+GAGGTGGCAGACGTGCTGGAAGAGCTGACCACGACCTGGTATTTTGGCGCAGCGCTGATTGTGCTGTGGCTGTTGTCCCGCGTTCTGGAAAACAACTTTT
+GCTGGCAATTGCAGGGCTGGCAATCCTTGCCGGCCCGGCGGTAGTGTCTTTGCTGGCGAAAGATAAGAAGTTACATCACCTTACGTCTAAACATCGCGTA
+CGCCGCTGACCCTGTCGTGGCCGTTATCACCAGTAGCGGCCACAAACTATTCCACACAATATCCAGACTCGCATCCTTCAAATAAATCTGCTTGGTAATG
+TCCGTAAAGTGGCGAATAGGGTTAATCCACGTCAGGTTTTGCAGCCATACCGGCATGTTTTCCACCGGAGAAACGTAACCGGAAAGGAGAATGGCGGGCA
+TCATAAAGACAAACACGCCGATAAACGCCTGCTGTTGTGTTGAACAGAGTGATGAAATCAACAGACCGAATCCCACCAGCGATAAACCATAAATCACCAT
+CGTAAAGTAGAACAGCGCCAGCGATCCGGCGAAGGGATTTGATACGCCCAGATACCAATCGCCAGCACAATGGTGGCCTGGAAGGTGGCGACAATTAACG
+CCGGTACGGCTTTGCCGATGAAGATCTGCCAGGTGGTGAGCGGCGAAACCAGTAGCTGATCGAGCGTACCTTGTTCACGTTCGCGGGCGACGGAAAGTGA
+AGTGACGATCATTACGCCGATAGTGGTGATCATGGCGATCAGTGACGGCACCACAAACCATTTGTAGTCGAGATTCGGGTTATACCAGTTGCGTACCACC
+AGCTCGCTGTTGTTAGGTTTCGGTTTTCCTTCCAGCAGCTCCTGCTGATAATTTTGACGATCTGTTGCAGGTAGTTGGCGGCAATTTGCGCACTGTTGGA
+GTTACGCCCGTCGAGGATCAACTGCAAAGGCGCGGTCTGGAAGGTATCCAGTTTGCGCGAGAAGTCAGCCGGGAAACGCACCAGTAGTAACGCCTTTGTG
+TGTCGATGGTTGGGCGGATCTCCTGTGGGCTTTTCAGCAGCAGCACATGAGTAAAGGCGCTGGCGCGGGCAAAACGTTGGGTCAGCTCCACCGAATGCTC
+GCCGTTATCTTCATCGTAGATGGCGATGGTGGCGTTAGTCACTTCCAGCGTGGCGGCGAACGGGAACAGGATCACCTGAATTAGCACGGGTAAAATCAGA
+ATCGCGCGGGTTTGCGGTTCGCGCAGCAACGACTGCAACTCTTTGCGGATTAACGTCCATAAGCGATGAAACATGCTCTTCTCCTAATCCAGCCGACGTT
+TGGTTTTCAGCCACGTCAGGCCGATAAACATCACCGCCGAAGCGATCAAAAACAGCACGTTTACCACCAGCACCACTGGAATATTCCCGGCGAGGAACAG
+GCTTTGCAGGGTGCTGACGAAATAACGAGCGGGAATAATGTACGTCACCGCGCGGATCACCGCGGGCATACTGTCGATCTGAAAAATAAAGCCGGAAAGC
+ATAATCGACGGCAGAAAAGCGGCGTTCAGGGCGACCTGAGCGGCATTGAACTGGTTGCGGGTAATCGTGGAAATCAGCAGCCCCATCCCCAGGGTACTGA
+GTAAAACAGGCTGGAGATAAAAACAGAATCAGCAGCGACCCGCGATACGGCACGCCGAGAATAAACACTGACACCAGCATACACAGCAACATCGCCAGCA
+TCCCGAGAAAGTAATAAGGGATCAGCTTACACAGCAGCAGTTCCGTGCGGGTAATCTCCGTAGAGAGCAGAGCCTCCATGGTGCCGCGTTCCCATTCTCG
+CGCCACCACCAGCGAGGTGAGAATCGCGCCGATGACCGTCATGATAATGGTCACCGCACCGGGGATAATGAAGTGCTGGCTAATCGCCGCCGGGTTAAAC
+CAGTAGCGGGTTTGTACATCAATAAGCGGTTCAAAAGTCTGCCCGTTGTCCTCCGCTCGCTGCATTTGCCAGATCTGCCAGATCCCTTCGACATACCCTG
+TACAAAGTTAGCGGTATTCGGCTCACTGCCGTCGGTGATCACCTGAATCGGTGCGGTGGCGTTGGCGCGCTCCATCTGTTCCGCAAAATCCACCGGAATA
+ACCACCAGACCGCGAATTTTCCCCGCCTGCATTTTGGCGATCAGTTCCTGACGGTTATCGCTGATGGTGGCGTCGATGTAGGGCGAACCGGTCATGGTGT
+GGTGAAATCCAGCGCCGCTTCGCTACGCTGTTCCAGTAAAATCCCGACCCGCAGCTTGCTGGAGTCGAGGTTAATGCCGTAACCAAAATAAACAGCAGTA
+GCAGCGGGATCACTACCGCAATCAGCCAGCTACTCGGATCGCGAACGATCTGCCGCGTCTCTTTAACGCACAGCGCCCGTACGCGACGCCAGGACAGGAT
+CGGGTTACTCATTGCTATGCTCCTTATCCCAGTCGTGGATCAACTGAATAAAGGCTTGCTCCATGGTGGGATCGGGTTGCTCATCGTTAGCCGACTGTGC
+TTTCAAATCGTCCGGCGTGCCGCTGGCGATTAATTTCCCGCGGTACACCAGGCCGATGCGGTCGCAATATTCCGCTTCATCCATAAAGTGGGTGGTGACC
+ATCACCGTGACGCCTTTCTCTACCATGCTGTTGATGTGCAGCCAAAATTCACGGCGGGTGAGGGGTCAACGCCGGAAGTCGGTTCGTCGAGAAACAGAAT
+GTCCGGTTCATGCATCAGCGAACAGGCCAGCGCCAGCCGCTGTTTAAAACCTAATGGCAGTTCATCGGTGGCGTGGGAGGCGATACTTTTCAGGCCGAAC
+GCCTCGCTCATGCGGGAGATTTTTCGTTCTGCGCCCGACCGCGTAAGCCATACACACCAGAGAAAAAGCGTAAATTCTGTTCGACCGTCAGGTTACCGTA
+GAGCGAAAATTTTTGCGCCATATAGCCGAGATGCTGGCGCGCTTTACCGGAACTCTCTTTCAGATCCATCCCCAGCACCAGCGCCTGGCCGGAAGTCGGC
+ACCAGCAAACCGCACATCATCTTAAAGGTGGTCGATTTACCCGCGCCGTTTGGCCCCAGCAAACCAAAAATCTCCCCACGTTTAACGGCAAAGTTGACGT
+GATCGGTGGCGGCAAAATCCCCAAATTTCTTGGTCAGTTCTTTCGCTTCGATCACCGTCTCGCCGGGTGTGCCTTCTACCGTATGTAATATTGCGCCCAG
+CGGCGATTCCGAGGTTCCGGCACCGCCCAGCAAATCAATAAACGCATCTTCAAAACGCGGCGTAGTTTCGTTGATGTTGATTTCCGGCATCCCGTCGGCA
+TGGCGAATATCGTCTGGTGTGGCCTCTTTTTGAGGATCAGACGTACCGATTTCCCCTGAATCATGCCGTCGCTGACCTGCGGCAGTTTCAAGGCGCGTTG
+CAACAGTTTGCGGTTGCCCTCGTGTGGACTGGTCATCAGAAAGCTGCGTCCGGCCATGGTTTGTGTCAGGGCTTTTGGTTCTCCCTGATACAGCAACTCG
+CCTTCGTTCATCAGTAACACGTCACGGCACTGCTCGGCTTCGTCGAGATACGAGGTACTCCAGAGGATTAACATCCCTTCGCCCGCCAGCTCATGCACCA
+TCTGCCACAGTTCGCGCCGTGAGATAGGGTCAACGCCGACGCCGGGTTCATCGAGCAGCAACACTTTCGGTTCGCCCACCAGGGTACAGGCCAGACCGAG
+TTTTTGTTTCATCCCACCGGAGAGCTTGCCCGCCAGGCGTCCGGTAAACGGCCCAAGAGACGTAAACTCCAGCAGGCGAGCAAAGTTTGCTTACGTGCCT
+CGCCGGTGACGCTGCGCAAATCCGCGTACAGATTGAGGTTCTCCATCACCGTGAGATCTTCATACAGACCAAATTTCTGCGGCATATAACCGAGCACGGC
+GTGCAGCGCGCCGTCGTTTTGATCGGATCAAAGCCAATCACCGTGGCACTGCCGCTGTCGGGTTTCAGTAATCCCGCCAACATCCGCATCAGCGTGGTTT
+TACCTGCACCGTCCGGCCCCACCAACCCCGTCACATAACCGGCGTGAATGGTACAATCGAGCGGCGCGACGGCGGGCTTGTCCATGCCCGGAAAGCGTTT
+TTCCAGGCCGTTCAGCGTGATAACGGCATCATTCATGTCCTGCCTCGTCACCGAATTGTACCGTCACTGGCATTCCCTGGCGTAACGCATCATCGGCGTC
+GGTCACCACAATACGCAGGCGATAGACGAGGTCGGTACGCAGATCCGGCGTTTCGACGGTTTTCGGGGTAAATTCAGCAGTCGGCGAAACGAAACCAATC
+TGCCCGTGATACGGCTTGTCCGGGCGACCATCGGTATAAAGCAGCACTTTGCGCCCCGGCTGGGCCTGGTCAAGATTACGTTCATCAACATAAGCGCGCA
+CCCACACCGGACGCGTTAGTGAAACGGTAAACACCGTGCCACCTTCATTGAGGACCGTGCCTGGCTCCACCGCGCGCGTTAACAGCGTGCCATCAGACGG
+GGCTATCAACGTTGAGTCCTGTAAATTCAACTCCGCCTGCGCCAGTTGCGCCTGCGCCTGTTCGAGGCTGGCTTTCGCCTGAGCGATGTCCTGTTCACGG
+TTACCGGAACGGTACTGACGCAATTTATCCTGTGCTGATTTCAGCGTTGCCTGCGCCTGGTCGCGCGAGGAGCGGGCATTTTCCAGGTCATTTGCCGAAA
+TAGTGCGGCTTTTCCACAACCCTTGCTGGCGGTTATAGAAGTTCTGCGCATAGTCATAGGCGGCTTGCGCCTGTTTCACCGCTGCGGCGGCCTGAGCGAT
+TTCTTCATTGCGATACCCGGCAAGCATCAGGTCATACTGCGCCTGTGCCACCGAAACACCCGCTTTCGCCTGCATCAGGGCAATCTCATACGGCTTGTGA
+TCCAGTTCGCCCAGCACCTGGCCCGCTTTGATAGCATCACCTTCGTCCACCGCCAGCGATTCAACGCGCCCCCAACACGGAAACTAAGATTTACCGTACG
+AATATCCACGTTGCCATACAGCGTCAGGCCGTTATCCTGGCGGCTTTGATACCACCAGTAGCCTCCGGCAACCACGGCGGCAAGTACCACTACCGCCAAT
+CCGATCACGACAGGTTTTTCATCACTACAAACTCCTTTGCGATAATCCTTGCAAAATCAGGTCGATATGACAGGTCACCGTCTGGTTGATCAGTTCGGTC
+TTTTCTTCATCGAACGCGGTCCAGCCGGTACGTAACAGAATTGTTTCTTTGCCAAGACGGAACGCCAGAATCTCACCAATCAACGCATGGGTATGAAGGA
+TCATGCGGGTGTCATTGGCGTCGCAGCCGGTCCAGGCGGCAATCAGGCGTGTCAGGTGGCTGTGTAGCGGACTAATCACCTGTTCGTGCACCAGGTGGTA
+GGCTGCCGTGGGAGAGCTGCTCACGGGAGATAAACTTGCTGAGGTTGACGGTGTCATCCTGGGTGAGCAGCTTAATCATGTTCCTGCAGGCGCGAAGGAT
+CAGTTCACGGATGGCAGCCCGATCAGGCTGTGGTTGCGCGAACAAGCGTTCGGCTTCCTCGGCATGCGGACGGAACTGCTCGCCAATAAAATCGGCAATC
+CACTGGGCGCAGGCGAGGTACAAATCTTCTTTCGAACCGAAGTAGTAGGTGATGGCAGCGATATTCTGCCCGGCCTGGGCGGCTATCTCGCGAGTGGTGG
+CGTTCATTCCATATTCACCAAACTGCGCCAGTGCGGCAGCAATCAGCTGTTTTTCGCCTGTTCACCCTTGATTGTCATGGCAGGATTATTCATCGCACAG
+TCCATTCTTAATCAAATGATTGATTAAGATTATGACTCCATAGGGGAGTTGTCCAGTATGGCTAAGAATTTTAGCAACGCCAGTCACAGGGATAATTTAT
+GCGCTGCGTCACAAAACTGCTACACTCCGCTCCCTCATGACATTGTGGTTTTGTCATTTTCCTTTTCAGTATCTCCTGAAAACTACACCGGTAACGGTCG
+GGGCGGTTCGGAGTAGTTATGTCTTTCGATTCTTTGGGTTTAAGCCCTGATATCCTGCGCGCCGTTGCCGAGCAGGGTTACCGTGAACCCACCCTATTCA
+GCAGCAGGCGATCCCTGCGGTGCTGGAAGGCCGCGACCTGATGGCTAGCGCCCAGACCGGCACCGGCAAAACAGCGGGCTTTACGCTGCCGCTGTTGCAA
+CACCTGATCACTCGCCAGCCGCACGCCAAAGGGCGTCGTCCGGTACGTGCGCTCATTCTTACCCCGACCCGTGAACTGGCGGCGCAGATTGGCGAAAACG
+TCCGTGATTACAGCAAATACCTGAACATTCGTTCGCTGGTGGTGTTTGGTGGTGTGAGTATTAACCCGCAGATGATGAAACTGCGTGGCGGCGTTGATGT
+GCTGGTGGCAACCCGGGACGTTTGCTGGACCTGGAACATCAGAATGCAGTGAAGCTGGATCAGGTTGAAATCCTCGTCCTCGATGAAGCTGACCGCATGC
+TCGACATGGGCTTTATCCACGATATCCGTCGCGTGTTAACAAAACTACCTGCGAAGCGCCAGAACCTGTTATTCTCCGCGACCTTCTCTGACGATATTAA
+AGCCCTGGCGGAAAAACTGTTGCACAACCCGCTGGAAATCGAAGTGGCACGCCGCAATACCGCGTCTGATCAGGTGACCCAGCACGTTCACTTTGTCGAT
+AAGAAACGCAAACGCGAATTGCTGTCGCACATGATTGGGAAAGGAACTGGCAGCAGGTGCTGGTGTTTACCCGTACCAAACACGGCGCTAACCATCTGGC
+TGAACAGCTCAATAAAGATGGCATCCGTAGTGCGGCGATCCACGGCAATAAATCGCAAGGTGCGCGTACTCGTGCGCTGGCTGATTTTAAATCGGGCGAT
+ATTCGTGTACTGGTGGCAACTGACATCGCTGCGCGCGGCCTGGATATTGAAGAGCTGCCGCACGTCGTCAACTATGAACTGCCAAACGTACCTGAAGATT
+ATGTCCACCGTATCGGGCGTACCGGTCGTGCGGCTGCTACCGGTGAAGCGTTGTCGCTGGTGTGTGTTGATGAACACAAACTGCTGCGTGATATCGAAAA
+ACTGCTGAAAAAGAGATCCCGCGCATTGCGATTCCGGGCTATGAGCCGGACCCGTCAATCAAAGCCGAACCGATCCAGAACGGTCGCCAGCAACGTGGCG
+GCGGCGGTCGTGGGCAAGGTGGTGGTCGCGGTCAACAGCAACCACGCCGTGGGGAAGGTGGCGCAAAATCTGCAAGCGCGAAACCTGCAGAAAAACCGTC
+TCGCCGCCTCGGCGATGCCAAACCGGCAGGCGAACAACAACGTCGCCGCCGTCCGCGTAAACCTGCCGCTGCGCAGTAATCTTTTATGCCGGGCTATGCC
+CGGCATCAGGCTGATGAACAAACGCAAAACTGCCTGATGCGCTACGCTTATCAGGCCTACGTGAACTCTGCAATATATTGAATTTGCATGCTTTTGTAGG
+CCGGATAAGGCGTTTACGCCGCATCCGGCATTTCACAACAAGCACTTGTCAGCAATTTGAGAACACGGGAAAAATTTATCTGTTTTACCGCCCATAAGCC
+ACCGAGACGTTACTTCTCTATAGCCAATTGTTCGCGCAACTCCATTAAAAGGTAGCCCAGTCGATTCTTGCCCTTACCATGACCACCGTCTCCCCAGTAA
+GCATCGTTTTCCGTATGCTCAACCAGTTTTGCGGGCGCGGTTGCCAGCAAGAGCGCACGCAGTTCTGCATGCTGTTCGAATTTAGCGCGAAGTGCTTTTC
+GCATCACCTGTTCTTTGACCGACTCCCAGTTTTACGCAGAGGCTTAGAACGATCGCGCCCCATGCGTGCGGCGACCATAGGGGAAGAAACCCGACGGATC
+TCTTCGCGGTATTTTTCATCAAGGAATTTTTGTGCCTGAAAATAGTGTTCTGAGGTAGGCCAGGTTTTCCCGTCAACCTTGATGGGCCAGGCGGCAAAGT
+TAGAAAAATCACCGTAGTCATCGCTGGTGCTGTAGAAATTTATGATGGTGTCTTGCATGACGTGTTGGATCCTTTGTGCTCGAACGGGCATTAAACCGCA
+TTATGTTGGTGGTTATTGCGAGCCGCTTTCCAGAAACAGAAAACCATTACCCCTGAAAACCGAAAAATGCCACAATATTGGCTGTTTATACAGTATTTCA
+GGTTTTCTCATGGCATTAACCGCCGCGCTTAAAGCGCAAATTGCCGCCTGGTATAAGGCGCTTCAGGAACAGATCCCCGACTTTATTCCCCGTGCGCCGC
+AGCGGCAGATGATTGCGGACGTCGCCAAAACGCTGGCCGGAGAAGAAGGGCGACATCTGGCGATTGAAGCCCCACCGGCGTTGGGAAAACGCTCTCTTAT
+TTGATTCCCGGCATCGCCATTGCCCGCGAAGAGCAAAAACGCTGGTGGTGAGTACCGCCAACGTGGCATTGCAGGATCAGATTTACAGCAAAGATTTACC
+GCTGCTGAAAAGATCATTCCCGATCTTAAATTCACTGCCGCTTTTGGGCGTGGGCGCTACGTTTGTCCGCGTAATCTGACGGCGCTCGCCAGTACTGAAC
+CCACGCAACAGGATCTGCTGGCGTTTCTTGACGACGAACTGACGCCGAACAATCAGGAAGAGCAAAACGTTGTGCGAAGCTGAAGGGCGATCTCGATACT
+TATAAATGGGATGGTCTGCGCGATCATACTGATATCGCTATAGATGACGATCTCTGGCGTCGTTTAAGTACCGACAAAGCCAGCTGCCTCAACCGCAATT
+GTTACTACTATCGTGAATGCCCGTTTTTGTCGCTCGTCGGGAGATTCAGGAAGCGGAAGTGGTGGTGGCAAACCATGCGCTGGTGATGGCGGCGATGGAA
+AGCGAAGCGGTATTGCCTGACCCGAAAATTTACTGCTGGTGCTGGACGAAGGCCATCACCTGCCGGATGTGGCGCGGGATGCGCTTGAGATGAGCGCCGA
+AATCACCGCGCCGTGGTATCGGCTACAGCTGGACTTGTTCACGAAACTGGTCGCTACCTGCATGGAGCAGTTTCGCCCGAAGACCATCCCACCGCTGGCG
+ATCCCTGAACGTTTGAATGCGCATTGTGAAGAGTTGTATGAGCTTATCGCCTCGTTAAACAACATTCTCAATCTCTACATGCCTGCCGGGCAGGAGGCAG
+AGCACCGTTTTGCGATGGGCGAACTGCCAGATGAAGTGCTGGAGATCTGCCAGCGGCTGGCAAAACTCACCGAGATGCTGCGTGGCCTGGCGGAGTTATT
+TCTTAACGATTTAAGTGAGAAAACCGGCAGCCATGACATTGTACGTCTGCATCGGTTGATTTTGCAGATGAACCGCGCGTTGGGGATGTTCGAGGCGCAA
+AGCAAACTCTGGCGGCTGGCTTCGCTGGCGCAATCTTCCGGTGCACCGGTGACCAAATGGGCGACGCGGGAAGAGCGCGAAGGGCAGCTACACCTCTGGT
+TTCACTGCGTGGGAATACGTGTCAGCGATCAGCTGGAAAGGCTGCTGTGGCGCAGTATTCCGCACATTATTGTCACCTCCGCAACCTTGCGTTCGCTGAA
+CAGTTTTTCGCGTTTGCAGGAGATGAGTGGTCTGAAAGAGAAAGCGGGCGACCGTTTTGTGGCGCTGGATTCCCCTTTAACCACTGCGAACAGGGCAAAA
+TTGTTATTCCCCGGATGCGCGTTGAGCCTTCCATCGACAACGAAGAGCAGCATATTGCCGAAATGGCGGCCTTTTTCCGTAAGCAGGTGGAGAGCAAAAA
+CATCTCGGTATGTTGGTACTGTTTGCCAGCGGACGGGCGATGCAGCGCTTTCTCGACTATGTGACGGATTTACGTCTGATGTTGCTGGTTCAGGGCGATC
+AGCCGCGTTACCGTTTAGTTGAACTGCACCGCAAACGCGTCGCCAACGGTGAGCGCAGCGTGCTGGTGGGCTTACAGTCATTTGCCGAAGGGCTTGATTT
+GAAAGGTGATCTGCTCAGCCAGGTGCATATCCACAAAATCGCTTTTCCGCCCATCGACAGCCCGGTGGTGATCACCGAAGGGAATGGCTGAAAAGCCTCA
+ACCGCTATCCGTTTGAGGTGCAAAGCCTGCCGAGCGCCTCGTTTAACCTGATTCAGCAGGTTGGGCGACTGATTCGAAGCCACGGTTGCTGGGGCGAAGT
+GGTTATCTACGACAAACGCTTGCTGACCAAAATTATGGCAAGCGACTACTGGATGCATTACCGGTATTTCCGATAGAGCAACCGGAAGTCCCTGAAGGTA
+TAGTTAAAAGAAAGAAAAACGAAATCCCCACGCCGTCGGCGGCGTTAATGATGTGAGTCAGGTAAGGAGTCGTAAATGGACTATCGCAAAATCATTAAAG
+AGATCGGGCGCGGGAAAAACCACGCGCGCGATTTAGACCGGGATACTGCGCGCGGTCTGTATGCTCATATGCTCAATGGTGAAGTCCCTGACCTTGAGTT
+GGGCGGCGTATTGATTGCGCTGCGTATCAAAGGAGAAGGGGAAGCAGAGATGCTCGGCTTTTACGAAGCCATGCAAAATCACACCATCAAGCTGACGCCG
+CCAGCAGGCAAGCCGATGCCGATTGTCATCCCCAGTTACAACGGCGCGCGTAAACAGGCCAACCTGACGCCGTTGTTGGCGATTCTCCTGCACAAACTCG
+GTTTTCCTGTGGTGGTTCACGGGGTTAGCGAAGATCCAACCCGCGTGCTGACTGAAACCATTTTGAATTGATGGGTATTACGCCAACGTTGCACGGCGGG
+CAGGCGCAGGCGAAGCTCGACGAACATCAACCGGTGTTTATGCCAGTCGGCGCGTTTTGCCCGCCGCTGGAAAACAACTGGCGATGCGCTGGCGGATGGG
+CGTGCGTAACAGTGCACATACCCTGGCGAAACTGGCGACGCCATTTGCCGAAGGTGAGGCGCTGCGTCTTTCCAGCGTTTCGCATCCGGAATACATTGGA
+CGCGTCGCGAAGTTCTTTAGCGATATCGGCGGGCGGGCGCTACTAATGCATGGTACTGAAGGTGAAGTGTATGCTAATCCGCAGCGCTGCCCGCAGATCA
+ATCTCATTGACCGTGAAGGGATGCGGGTGCTGTATGAAAACAGGACACTGCTGGTAGCGAGTTACTGCCACAAGCAAAAGATCCGGAAACCACGGCGCAG
+TGGATTGAGCGTTGCCTTGCTGGCAGCGAACCGATTCCCGAATCGCTGAAAATCCAGATGGCTTGCTGCCTGGTGGCTACGGGTGAAGCGGCAACTATCA
+GCGACGGCCTGGCGCGCGTTAATCAGGCATTTTAATTCTTTTCTCAGCCGGATGAGCCATGTCATCCGGCTTTTACCCCACCGCAATATGAAATTCCTGC
+ATCTTTATTGACCTTCCACGCCCGGCGTGCAGCATAAAAATACAACAAACACATAACATAAACAGGAGTTAACCATGGAAAGTGGTCATCGCTTTGATGC
+TCAGACGCTGCACAGTTTTATTCAGGCTGTATTTCGTCAGATGGGTAGCGAGGAACAAGAAGCGAAATTAGTTGCCGATCATTTAATCGCGGCAAACCTG
+GCAGGGCATGATTCACATGGTATTGGCATGATCCCAAGCTATGTACGCTCCTGGAGTCAGGGGCACCTGCAAATTAACCATCATGCCAAAACCGTTAAAG
+AGGCGGGGCGGCGGTCACGCTCGATGGCGATCGCGCATTTGGTCAGGTCGCGGCACATGAAGCGATGGCGCTGGGGATTGAGAAAGCGCATCAGCACGGT
+ATTGCCGCCGTGGCGCTACATAACTCGCATCATATCGGCCGTATCGGTTACTGGGCGGAGCAGTGTGCAGCGGCGGGTTTGTCTCTATCCACTTTGTTAG
+CGTGGTCGGTATTCCAATGGTCGCGCCGTTCCACGGTCGCGACAGCCGCTTTGGCACCAATCCGTTCTGTGTGGTTTTCCTCGTAAAGATAATTTCCCGC
+TGTTGCTTGATTACGCCACCAGCGCCATTGCATTTGGCAAAACCCGCGTCGCCTGGCATAAAGGCGTCCCCGTGCCGCCAGGTTGCCTGATTGACGTTAA
+CGGCGTGCCGACGACCAATCCGGCGGTAATGCAGGAGTCGCCGTTGGGTTCGCTGTTGACCTTTGCCGAACATAAAGGCTACGCCCTTGCAGCGATGTGT
+GAAATTCTTGGCGGGCGCTTTCCGGCGGTAAAACGACGCATCAGGAAACGTTACAAACCAGTCCCGATGCCATTCTTAACTGCATGACCACTATCATCAT
+CAACCCGGAACTCTTCGGCGCGCCGGATTGTAACGCGCAGACCGAAGCCTTTGCCGAGTGGGTGAAAGCCTCGCCGCATGATGATGATAAGCCGATTTTG
+CTACCGGGCGAGTGGAAGTGAACACGCGTCGCGAACGGCAGAAGCAGGGGATTCCACTGGATGCGGGAAGCTGGCAGGCCATTTGTGATGCAGCGCGGCA
+GATTGGTATGCCGGAAGAGACGTTGCAGGCTTTCTGTCAGCAGTTAGCCAGCTAAAAAAGCCCGTCCAGTGGCGGACGGGCAAACAAGGGTAACATAGGA
+TCAATGAGGGTTAGAGCATATGCGTCTGTCGGCAAACAGACAGGAAATACTTGTGCTGGACGTAGCGTAAACGCCTGATCCGTCCAACGGTTCGGATTTT
+GTAGGCCTGATAAGACGCGGTAGCGTCGCATCAGGCATCTGTTGCCGGATGCGGCGTAAACGCCTTATCCGTCCTACGAATTACTTATAAATTACCGCAG
+TACCGCTTAATTTATTGTTGTTGGTGGCGGAAGTGATGCTGTATCCACTGGCACCGGCTGCCGCGGCTTTCTCAGCCAGTTTCGCTTCCAGGGCATCGAG
+GGTGGATGCGCCATCGGCAGAAACCACGCCGATTTTATTCATGTTCTGTGCCTGGGATGCCGTTACCGGTTCCGCCGCGAACACGCCAAATGACAGAGTT
+GAAAGAGCCATAGCAGCAACAACAGTATTGATAGTTTTCATAATTAATCTCTCGCAGGTGATTTTTGTATAAGTGACGTTGTTTCGTCGATGTGATGAGT
+ATCACGTTTTTACGAGAGATAAAATCGAAGAGAATTGACCGCCTTGTTCAAATAAATTGATTGATATCTAACCTACTGATAAACCATTTATTTGTTGTAC
+TTATGAACTTGTTTTATACCGCGTGGCAGTCACAGCAGCGTTAAAGGCACGGAATGACACGCAAAATACAAATTATACTCGCTATGCATCTCGCCAGTTG
+TAGTTAACGTAACTGGCTGTCTTTCGAACCTCTGCGATTATATCCTGTATAAGCTGGTTTTGTAAATCTTTCTCCTGCTGACAATGAATACATAAGCGCA
+CGCCAGGAATGGCTTCCCGACGGGCCTGCGGGATGGGGCACCGCACTCTTCACATTCATCCAGGCTTTCGCCGCGCGGAATTTCACCCCGAGCGCGGGCA
+ATCGCATCTTCAATTGTACTGTTGATCTGTTCGTTGACGGCGTCATCGTTAGCCCAACCGGATGCCATATCGACCTCCCCATATCAATACTTGTACAGTT
+AAGTGTAGCTAATCCAGGGACGAACTCGGGCAGTTCAAGCATCAGATCTCCGACCATTCCCGCAGCAGATTATGATAAAGATTAAGCAGCGACAGGATCT
+CTTCACTTTCGCCGTAGCGGCTTTTCAGCGACTGAATATTGTTGTCCAGTTCAAACAGCATGGCGCGCTTTTTATCATCGCGGATCATCGACTGGATCCA
+CATAAATGATGCCACTCGTACGCCGCGGGTTACGGGTGTCACGCAATGCAGGCTGCTGGAGGGATACAACACGAGATCGCCTGCCGGGAGTTTTACCCGA
+TGTTGTCCGAAGGTGTCATTAACGACCAGTTCGCCGCCGTCGTAGCTTTGTGGATCGCTTAAAACAGCGTGGCAGAAAGGTCAGTACGCATCCAGCCGTT
+TTGTGGATGGCTGCGTACTGCGCCATCCACATGGAAACCATAGGTTTCATTGTTCTGATAGCGATTAAACAGCGGCGTGGAAAGGGTACGCGGCAAGGCC
+GCGGCAAAGAATAAAGCATGTTGGTTAACCGCGTTCAGCACCTCATTTTGCAGGGCGGCGTATAACGTGCTGCGGGTGTCGACCTGTTGATTGTTCTTAA
+CTTGCGCACCTTGTGCGCCGGTGGTGACGCGTCCATCCACCCATTCGGCTTGTTCCAGTTGTTCGCGAAAACGAGCGACGTCCTGTGGCGATAACACGCC
+GGGAATGTGGTACATCATACAATTTCTCCAAAAGTGGGGCCTGCGCCCCACATCTGAATCAGAAATGCATATTGGCTGTGAGCAAGAAGGTTCTTGGCTC
+GCCCGGGTGATAACGGTAGCCGCTCTTGTTGATTGAGGCGACGTAATCGGTATCAAACAGGTTGTAAACGTTTAGCTGGAAGTCGAGATTGCGATTAACT
+CGATACCCCAGTTTGGCATCGGCGACCCAGTAACCTTCGGTAAACGCTGGCGTTCCCACCGCGCCGTCTGAACCTTTATGCATACTGCCGATATAGCGTG
+CGCCCGCGCCAACAGAGATATCGTCGGTTGCCTGATATTGGCTCCATAAGGTGAAGGCGTGCTCCGGGGTATACGGCAGCGATGAGGAACCATCCTGGGC
+AACATCTTTGCCGTTTTGATGGTTGCTTTTGCTGGGTATAGCCGCCAATCACCTGCCACGCGGGAGTGATATTCCCGGCCACGGATATCTCATAGCCTTC
+GACGCGTTTCTTACCGTATTGCGAGTAAGTTCCGTCATCATTTTGCTCAACTTCATTTTCGATATCAGTGCGGAACAGCGCGGCGGTGAGCAACAGACGT
+TTATCCAGAACCTGCCATTTGGTGCCAATCTCGCTGGTGTTGGCTTTTGCGGTTTAAAATCGGTGCGGTTGGCACTGTTACCGCTGCCAGACTGCGCAAG
+GGCGAAGTTGTTGCCGCCCGGAGGCTGCTGGGAAACGGCATAGTTAATATAGACATTGCCGTTTTCCGTCAGGTGATACAGCGCCCCGGCTTTCCAGTTC
+ATCAGATTGCCCGACTTGGCGGTGTCGACGGTGGTGACCGGAGAACCTTTGCCACACCAGTTGGGCAGGTGATGGCACCGCGTCCGCTGCCGCCGCAGGC
+GGTGGCACTGTCATATTCAGTATGATAATTATCCAGACGGATCCCGCCGTTCAGCTCAAAATCACGGGTGATTTGCAGCGTATCAAAGGCGTAAATTGCG
+AAGGTATCCGTCTGACCATTGGCGTTTGCGCCGTTGCGCGTCAGGCCGCCGGGATGAATGCTGCTGTCAGGATGATAAATATTTACCGCGGGTAACGTCA
+CCGGATTAACGCCGTAGTTAGTCTGCGTTTCACGGGTAAATTCCACGCCGGTACTGACATCATGACCGATAGAACCGGTATAGAACGTCGAGGTCAGGTT
+GGTCTGGTTGGTGAGAATTTTATTACTCACATCTTTGGTATTCGCCGTGCGTGACCAGGTCCAGCTATTCACATCGCTGGTGGGCTGAGTAATATTCGAC
+GCCCCGCCCATAATCGCCGTCATCAGGTAATCCTGCTTTACGCGCGACCAACGGGTAGTATTGCGAATGGTGGTGTTATCGTTGATGTCGTGCTCAAAAC
+GCATGGTGGCGGTGTCGGTGGTCGAATCGTCGTAATCGGAATCCGTGCCGTAAAAGTTATGAGTATCAACTTTTCCGGAATGATTCAGGGCCGCCGTTCC
+CGCAGATGGGGCAGAATAGCCCGGCAAACCGATGGTCGGAATGCCGCCGTCTGGCGTGTTGTGCTGGGTGACATGCAGATAATTAAGATACAAACGATTC
+GCTGTACCAAGGCCAAAAGCGACAGAAGGGGCGACGCCGTAACGCTCATTTTGACTTTGTCGCGTCCGGCATCGTGCGTTTTTCGCCCATTACATTCAGG
+CGCACCGCGGTGGTATCACCAATGACCTGATTGACGTCCAGCGTGCCGCGGCGGAACCAGGCGCTGCCAATACTGGCGGAGGCGTCAATGCCGGAATCAT
+TGCGCGGCTGCTTGCTGATCATATTGATCGAGCCTGTCGGTGCGCTGCGCCCGTAGTCGGTGCCGGACGGCCCTTTAATCACTTCGACCTGCTCGGTATT
+GAAGGTGTCGCGCGAGACGCTGCCGATATCGCGAATGCCATCAATATAAATACTGTTAGAGGTATCGGCACCACGCATATAAATGGCGTCGCCAGTGGTG
+GAGTTACCGTTCTCACCCGCAAAAACGCACCCACGCCGGGGACGTTTTGAGCGCGTCGGTAAGGTTGGTTGCGCCCTGATCTTTAATCACTTGTTCAGAA
+ATTACCGTCATCGTGCGGGTAGTATCCGCTACCGGACGCGAGAATTTCGGATCGGCAGATTGTTGTGGCGCATAAAGCGAAGGCGTTGATGCTTCGACAA
+CCAGCGTGTCATCCGCGTTAGTTTGCCCTTCGGCGGCGAGTGCCTGAGCCACAGGCGTGATGCCAATACAAAGACCGGCAAAGAACGTGAGCGAATGAAA
+TTGTCTGGCAGGAAATTGCGATTGTTTTCCATTTTGCAGGTGACTTTTTCTTATATGTTGAAATTTTCACTGCCACGAGAAAGCCTCTGCGGATGCGATG
+CCACTGTTAATCCCGTGATAGTGCTCGTGAAAGTGATAATAATTTTGATAAGCATTATCACTTGGAGCGATTTTCTATCACCCATTGCGCGAAAAAGAAA
+TACATTTATTTACATTGAGTTCATATTTGATGTTTTTGATTACAAAACAGACGAAAACTGCATCCAGAGGCGAATGCAGTTACGTTGGTGGGGTTATTTG
+TAGATGGTTGCAGTACCGAACATCTGGTCATTTCCGCCTGCGGAATTAATGACATAACCTTTCGCGCCTTGTTCGCGCGCTTTTTCTGCCAGTTTATCCT
+CCAGATCGCTTAGGTTTGATGCGCCAGTTGCCGAAACGGTACCGGCGGGCCGTAGCTGACCGCTGTCCAGGTTACTCATCGGTTGCGCGGCATAAGCCGT
+GAGAGAGATTCCGCTCAGGACGGTGGCAATCAGTAGTGTGAGGCACTTTTTCATAATGACATCCTCATAAATACAACGGGTAGTGCCTGATAAGTGTAGG
+TCGCCTGCGCGATGCAAATGACGCAAAAATTGACAGAGATGTGCTTATTTTTGAACGATATATTTTACAAAATAAGACAAATCAATGACATGCATAATGC
+TGATTTTATGATGAATTGCCATAAACCATAGCCATGTTAAGGTTTTGGGGAATGATAAACGCAGCCAGATATTTACCCTGTCGCGTTATGCGGGTATCTT
+ACGCCGCTGCTTAAAGGAGAATGCTATGTCCGCCCAGAAACCGGGGTTGCATCCGCGCAACCGTCATCACAGCCGCTACGATCTCGCCACGCTTTGTCAG
+GTCAATCCTGAACTCAGGCAATTCCTCACGCTTACACCCGCCGGGGAGCAAAGCGTAGACTTTGCCAATCCGCTGGCGGTGAAGGCGCTCAATAAGGCGT
+TGCTGGCCCATTTTACGCCGTAGCGAACTGGGATATCCCCGACGGTTTCTCTGCCCACCAGTACCGGGCCGGGCGGATTATATTCATCACCTTGCCGATT
+TACTGGCAGAAGCAAGCGGAACAATTCCAGCGAATGCCAGCATTCTGGATATCGGCGTTGGTGCGAACTGTATTTATCCGCTGATTGGCGTACATGAATA
+TGGCTGGCGTTTTACCGGTAGTGAAACCAGCAGCCAGGCGTTAAGCAGTGCGCAGGCGATTATCAGTTCTAATCCGGGGCTTAACCGCGCCATTCGTCTG
+CGTCGGCAAAAGAGAGTGGGGCGATTTTTAACGGCATCATCCATAAAACGAGCAATACGACGCGACCTTGTGTAACCCGCCATTCCACGATTCCGCCGCT
+GCGGCACGGGCAGGTAGTGAGCGTAAACGCCGTAACCTGGGGCTGAACAAAGACGATGCACTGAACTTTGGCGGCCAGCAACAGGAGTTGTGGTGTGAAG
+GCGGTGAAGTCACCTTTATCAAAAGATGATTGAAGAGAGCAAAGGCTTCGCGAAGCAGGTGATGTGGTTTACATCACTGGTATCTCGTGGTGAAAACTTA
+CCGCCGTTGTATCGTGCCCTGACGGACGTGGGCGCGGTGAAGGTGGTTAAAAAGAGATGGCCCAGGGCAAAAGCAGAGTCGCTTTATTGCCTGGACCTTT
+ATGAACGACGAGCAGCGCCGCCGTTTTGTCAATCGCCAGCGTTAAAGCGTTGGTTCCCCGGCGGTAACGGTTCAGCCGGGGTCGCGCCCGGAGCAGGCAG
+CACCTGATAAGTCTGCACTGGCGCGCGAACGCCCGCCAGGTCGAAATGTTTTTCACCTGGCTGTCGAGGGCAAAGCGTACCGTCCACTGTTTGAGTGGCA
+GCGTGGTGAACGAAACACGCAGTGTAAACGCGGTATTGCTTAAGCCGACAATCCCGGCAAAATTCGGTTCACCAATAATCAGCCCGCGAATTTCTTCGTT
+TTCCATTAATTCCGCTACCGCATCTTTCAGTGCCTGATTGGCTTTATCAGCATCTTCATGGCGATCAACATCATAATTTGCCACCACCGAACCAATGCCG
+CGGACAAAGTTAGCAAAGGTGGTTATCGAAGACCACGGAATGATGTGATACGCCCCGGTATCCTGTCGTACGCCCACGGAGCGAATCGACATCCGTTCCA
+CTGTGCCGGTCAACGGCCCGATAGTCACCAAATCTCCAGTGTTCATGCCGTTTTCAAACTGAATAAATACCCCGGTGATAATATCTTTCACCAGCGTTTG
+CGAACCAAACGAGATAGCCAGACCTAATGCCCCGGCACCTGCCAGCAATGGCGCGATATTGACGCCGATTTCCGACAACACAATCATGATGGTGATGGTA
+CTGATAATCACCGCCAGCGCGTTACGAAACAGCGTAAGCAGGGTACGCGTGCGGGCGCTGGGTAGCGGGCGGCCATGAATATCCGAAGCCAGCCGGTTTT
+CGATCAAACTGGCGAGCACCGTCCAGCCAACCGCCGAGAAGAAAGAATGAGTGCGATACGGATCAGGATATCTACGGTTTTCTGCCCCGCGCCGTTTTGC
+AGCCAGTTCCAGAAATCGAACAATCCCCATGCGCTCAACAGCAACATTACCGCCACGCAGACTGTCAGAATACGCGCCGTTTTCAGCGCCGCCGACAGCC
+AGCCATTCAACCGTTTTGCAGCTCCGGATAGTTACGCTGAGTATGTGGCGAGAGAGTGATGGTTTTCGCCAGCCAGCGGGAAAACATACCGGAAACAAAC
+GCTGCGATACCAATAATCGCCAGGCTGCGCACCGTTGCACCCATCATAAATTTCAGGCTGTTGCCCGGATCGAACAACGAAAAGAAAAACAGCACGATAA
+AATAGGCGCTTGCCAGCCAGTGCCACACCAGCGCAAAGGCGCGGATAAACAGGCTGAAAAAGGCCAGCGAATGCTCCGCGAAGTTGAGCAAATGCTGGGT
+AATCTCTTTTATTACGAAAGATCAGGTACAACGCCCAGACGGTCATGCACAGCATAATGATGACGTTCGCCAGCGCACCTATCTGTACATTCACCTGATT
+AGAGATAATCGGCACGGCCACAATCAGGCCATAACCTATCAAACTGCTTAACCAGCTCAGGCGACGACTCCAGTAACGGGCGCTCTCGTCCTGAATCGTG
+AACGGGCGCAGCTCCGCCACGTTTGGGCAAAAATCAGGCGTAGTACGGCTTTGAAAAATTCAATGAGGGCAAAGGCGTTGAGAAACAAACTTTGTTGGAA
+AGCGATGGTGCGACTGCCTGCATTCAGGTTGTCGCTTAATACCTGGCCGACAAATAATGTCAGGGCCAGTAACAGCAGGTCGATAATAAACGCCCCGATA
+ATCATCGCCGGAAGCTGCAACCAGTTGCTGCGCTCACGATTTTTGCCGCGCCCACTGACCCATTTTGCGATACAGCGGCAGTGCGCACAGGCGAATCAGC
+CAGTAAAACCAAACACTAATACCGCTAACATTGAAAAATGGGTCAGCGCATTGCTGAAGGTTTGTGGATTAAACGGCTTATGCGGGGAGCCGGTGATATT
+GCGATAAAGTTGCCCGAAGCGGGCGGAAAGGGCTTCACCATAATGGCGGCTGACTTCGGTGACCTTTTGCAGCACGGTTTGCTCTTCGACCAGCGTCGGC
+GGCACTATTTTGGTACCGGTTCAGCAGGGGCGTAGCGGCAACGGTGCGCAACTGGTCGATCAACTCTTTACGCGAGGTGTCATTATCCAGCACATCCGCC
+AGTGCGCCATAGGCCGCTTTTTTGTTCGATATCCGGTTCCGGGGCCGGTTCAGTCGTTGAGTCCGTTGTCGTTGTGGTTGTAACGCCGGGTATGGATACC
+GCGTGGGCAGGTGCGCCCAGCAGGCAGAAGAGGATGAACAGGATCCACCGCATGACTCCTCCAGTGAGAAAATAGAGCAAAAGATAAGTATAGATGCTGG
+AGGAGGGGCGATTTTAAATGAGAGGAATCTGGTGTGCCTCCCTTTCGGGTGAAAGGGAGGAAGGGATATTAAGCAGGTTGCTGACAACGTGCGGGCTTTT
+TGCCGGATGCGGCGTGAACGCCTTATCCGTCCTACAAGTTCATGCAATTTTAATAAGTTGCCAGATATCCTGTAGGCCTGATAAGCGTAGCGCATCAGGC
+AATGTGTCTTATTAAGAGACGTGCTGCAAAATTCCTGCAAGCGCTGGCTCGGCGGGTTCTTGATCAACACCTGCGGATTGCCATCTTCCGCAATCCGGCC
+TTTGTCGATAAAGATCAGCCGCGAAGCTACTTTCTCGGCAAAACCGATTTCGTGGGTCACGATCACCATCGTCATCCCTTCTTCAGCCAGATCCTGCATA
+ACCTTCAGCACTTCATGGCGCAGTTCCGGGTCAAGAGCGGAAGTCGGTTCATCAAACAGCATCATTTTCGGCTTCACCGCCAGCGCGCGGGCAATCGCCA
+CACGCTGCTGTTGACCACCAGAAAGTTCGGAAGGGTAGTGATGTGCACGTTCTGCCAGACCGACTTTCGCCAGCAGCTCACGTGCCAGTTTTTCCGCCTC
+TTCTTTGTTCGCGCCACGCACGCGTAGCGGGCCAAACATGACGTTTTCCAGCGCTGTCAGATGCGGGAAGAGGTAAAACTGCTGGAACACCATACCTGCT
+TCCTGGCGAATCAGGCGCTCGTCAACTTTCGGATCGTTAACCTTCAGGCCATCGACAATCAGATCGCCGGAGGTGATTTCTTCCAGTTTGTTGATGCAGC
+GCAGCAGGGTCGATTTACCGGAACCGGACGGCCCGATAATCACCACGACTTCGCCCTGGGCAATGTTCAAATCGATATTGTGCAGCACCTGGGTTGGGCC
+AAAGTGCTTGGAGACGTTTTAAATTCAATCACAGGATTTTCATCCTTCTTTCCAGACGACGCAGAATAAAGCTCAGCACCAGGGTAATAATCAGATAGAA
+CACCGCCACGGCGCTCCAGATCTCAAGGGCGCGGAAGTTACCGGCAATAATTTCTTGCCCCTGACGGGTCAGTTCCGCCACGCCGATCACAATAAACAGC
+GAGGTGTCTTTAATGCTGATGATCCACTGGTTACCCAGCGGCGGCAGCATACGACGCAGTGCCAGCGGTAAAATGACGTAGCGAATGGTTTCCCAACGTG
+AAAGACCGAGCGCCAGTCCTGCTTCACGAAAACCTTTGTGGATAGACAGCACCGCACCACGCGTGATTTCCGCAATATACGCGCCGGAGTTGATCATGAT
+GGTGACCACCGCCGCAGTAAATGGGTCGATGCGTAAGTCGTTAAACGCCATCGGCAGGGCGAAATAAATAAACATCACCTGGACGACGATAGGTGTGCCG
+CGGATCACTTCAATAAAGACCAGCGCGACGTGGTTGGCTATCCAACCTCCGAAGGTGCGTGCAAAACCTGCCAGCAATCCGATTACCAGACCGCCTGCCA
+GACCGAGGACCGAAATCCACAGGGTCATTTTGGCACCTTCAATCAGAAGCGGAATGGCAGGCCAGATGGCACTCCAGTCAAACTGCATATGTTGTTCCTG
+TTACCGTGGTGTAAATAATCAAATTCAGGGTAATTAATGGCCCCGGAGCGGGTTTGCGCCCTCACCTAATCCTCTCCCCATAGGGAGAGGAACTGCCAGT
+GCGTTTTACAGGTGTAGCGTTATTATTTCGGTTCAGTACCGAACCATTTTTGTAGATTTCGTTGTAAGTTCCGTTCTCGCGCAGGGTTTTCAACGCGCCG
+TTGACTTTGTCACGCAGCTCGTCGCTACCTTTCGGGAACGCAATACCGTATTGCTGCGCTTCCAGAGAGTCACCTACCGCTTTGAACTGACCGTTACCGG
+CGGTTTTGATGAAGTACAGAATGTTTGGCGTATCGTGCAGAACGGCGTCTGCGCGGTTGGTGCCCAGTTCCATATAGGCGTTATCGATGTTCGGGAACTG
+ACGCAGATCTTTAGTTTTGATGTTTGCTTTCGCGTAATCAACGGAGCCAGTACCGCTCTTCACAGCAACCACTTTCCCGTCGAGATCTTTCACGCTTTTC
+ACATCGTTATTGTTAGCTTTCACCATCACTAACAGGCCGCTTTTGTAGTAGCCGTCAGAGAAATCGATCGCTTTTTACGCTCGTCGGTGATGGTAATGCC
+CGCCAGCGCCAGATCGACGTTTTGGTTTGCAGTGCCGGAATGATCCCACTGAAATCCATCGGCTTCAGTTCGTAATCCAGCTTCAGCTCTTTAGCGATGG
+CAGCCCACAGATCAACGTCAAAGCCCACATATTTATCGCCCTGTTTAAATTCAAACGGAACGAAGGCGGTATCCGTCGCGACAACTAATTTTTATCCGCG
+GCATGAGAAGAAACCGCAAAAGCCAGGGTCAGTGCAGCCAGTGAAACTTTTAATACAGACTTCATAGCATTTCCTTTTTCTATCCACGGGACGATCCCTG
+CGTGACATTCACATATATGAAAAATCGTGCCAGTTTTGCAACTCCTTGATTTTTCGAGATGCGGCAAAAACGTGATGCACGATTTATAGGGCAATACCCT
+GAAGATGCACCATTCTGGGGCACCAATCTGGTGCGCTAAAATTGTGCACTCAACACAGTGATTATTTAGCGTAAAACCTGATGAAAAACAATCTTTATGT
+AACGATTGTGTGATGATGTGGATACAAAAATTTACTTAATCAGCTGGAGATAGCAGATGGATGCACTAAATAAGTGCGTTGAGGTGGGCTGCAAAACAAA
+ACGGCCTCCTGTCAGGAAGCCGCTTTTATCGGGTACTAAAGTTCTGCACCATCAGCGATGGATTTATTCGATGTTAGACTCGATAAACCACAGGAATTTA
+TCCAGGTCGCGAGACGCGGCGGTCAGGATATCTGCGGTGTCGTCATCTTTCGCTTCGCCAATCGCTTTGCGTACGTCATTAGCGACGATTGCGTAACGGT
+CAGCCAGTTCTTTCAGGTGATCCTGAACGTTGTGGATGTCCAGCGGGTAACTTTTCAGCGGGTTTTGCTGTTGATAACTTGAGTGGTCCCCAGAGCTACA
+CCGCCCAGCTGCACTGCACGTTCTGCCATGGTATCCAGATGATCGATCAGTGCGGTGCGGAAGCCATCCAGCATTTCATGTACGGCAATGAAGTTAGCGC
+CGCGCATGTTCCAGTGCGCTTGTTTGGTAATCAAAGAAAGATCAATAAACTGGATAACCTGGCGATTCAGCAACTCTACTGTTGCTTTTTCTCGCTGTCG
+GAGACATCGTTGCGGGTATAAAGCAGATTGGTCGCTTTTGATTTAACTAATTTAGCGGTACTCATAATTTCATATCCTCTTGATGTTATGTCCCAGTAAT
+TAACGAGATTAAGTATAGCACCGGCTATGTGTTCCGCTATTCTGGCTGTTCCTATCACACTAATAGTGGTAACAAGCGTGAAAAACAAAACTAATAAAGA
+TTCAATGAGTTAGATATATTGATAAGAACAATTCTTATTTATCTGCTCGCCAGGAATTTTCGGAATAAATATGCTTTTGCATAATTCGATATATAAAGAC
+GGTGTAGAGGAAAAGTAGCGAGAAATTCTGCATGGTTATGCATAACCATGCAGAAATGTAAATTTAATTAATGTCTAATTCTTTTATTTTGCTCTCTTTG
+CGTACTGTCAGCGTAGACCCCATTGAAGCGGCGATGATAGCGCCGAGCGCCAGTAGCTGTATGGGTGTCAGTGTTTCTCCGAGGAAAATCATCCCGGAAA
+CGGCAGCCAGCGCCGGTTCCATGCTCATCAGCGTACCAAATGTCCGTGTTGGCAAACGGGTGAGGGCAATCATTTCCAGCGAATAAGGCAGAGCGGTCGA
+GAGAATAGCGACAGCCAGACCCAATGGAATAACCGACCAGTGCCAGAGTGCTTCACCAGCCTGAAGCGCTCCAATTGGCACGAAAATTAACGCTGCAATC
+AACGAACCAATTGCCACCGTCGCAGGGCCATGTTCCGCTCCTGCGCGTTGCCCACTTAAAATGTAAATAGCCCAACAAGCCCCGGCCCCAGTGCCAGCGC
+ACAGCCGGTTAAATCGACATGGGAAACGTCTTGCCCCAGCGGTAGCAGGAACCACAGACCAAGAACCGCCAGCACAACCCAGACGAAATCTACCGGGCGA
+CGAGAAGAGAACAGCGCCACCGCCAGTGGTCCGGTGAACTCCAGCGCCACCGCAATACCCAGCGGTACTGTCTGAATAGAAAGATAAAAAGATAATTCAT
+CCCACCCAGCGAAACGCCGTAAAACAACAGCGGTAACCGTTGCTCTTTGGCAAAGCGCAGTCGCCATGGCTTAAAGAACGCGATGAGGATCAGCGTTCCT
+AATGCCAGACGCAGCGCAGTGACACCCGGTGCGCCCACCAGAGGAAAAAGTGACTTAGCTAACGAGGCTCCACCCTGAATAGACGCCATGGCAACGAGCA
+ATATGACTATTGGTAACCAGACCGGCATTTTACGTAATGAACCAGGCATCCTTTCTCCCACAAATATCTAGACTTAAGTAAAGCGTGGAGTGTACTGGAT
+ATACCCAATGCTGGTTGAGCATTTGTTGAAAAATTTTCCCCGTTTTGACTAAAATGCGCCAGGATTGATGGAATCATTAGTCTGGTGATTAGGAATAATC
+TGGATGAATGACAGGAAAACATGCGTAATACTTACGCAGTTCTCTGAAAAAGTGATTTAAATTTAGATGGATAGCGGTGTATGGAAACGTTCTGTTACAT
+GAAATGGCCCGTTAGACATCACAAATCGCGAAGAGTTTCCCATTAATTTTGATATATTTAAAACTTAGGACTTATTTGAATCACATTTGAGGTGGTTATG
+AAAAAATTGCATGTCTTTCAGCACTGGCCGCAGTTCTGGCTTTCACCGCAGGTACTTCCGTAGCTGCGACTTCTACTGTAACTGGCGGTTACGCACAGAG
+CGACGCTCAGGGCCAAATGAACAAAATGGGCGGTTTCAACCTGAAATACCGCTATGAAGAAGACAACAGCCCGCTGGGTGTGATCGGTTCTTTCACTTAC
+ACCGAGAAAAGCCGTACTGCAAGCTCTGGTGACTACAACAAAACCAGTACTACGGCATCACTGCTGGTCCGGCTTACCGCATTAACGACTGGGCAAGCAT
+CTACGGTGTAGTGGGTGTGGGTTATGGTAAATTCCAGACCACTGAATACCCGACCTACAAACACGACACCAGCGACTACGGTTTCTCCTACGGTGCGGGT
+CTGCAGTTCAACCCGATGGAAAACGTTGCTCTGGACTTCTCTTACGAGCAGAGCCGTATTCGTAGCGTTGACGTAGGCACCTGGATTGCCGGTGTTGGTT
+ACCGCTTCTAATCACTTTGGTGATATAAAAATCCGCCTCTCGGGGCGGATTTTTGTTTTAAGGTTTCGGGTCGAAAATATCGGTTCCGAGATGGTTGTAA
+TCCACCTTCTGTAACTGGAAGTTGGTGATGTATATCGGCCCGGCTTTCTTCTCAGATATAAACGGGTATTTGATGTTAATTTCCTTCGCTTTAATCCCCG
+TCCACTGGGAGAAAAAGCCTAAGAAGTCATTGGCTGAGCGGCGGGCTTTAATCACACGATGCGCTTTATCGTCGCTGGAAATGACCATAAAAGGCACCTG
+GAAATTTTGCTGATATTTATCATCATGGGCAAGGTATTGCACGTCTTTACCGCGCTCTTTAAAGGCCAGACCGTGGTCAGAAAAGTAAACCAGCGAGAAG
+CTGCTGCCGCTGTTGCGTAACTGATCGTACAGCTTGCGCAGTAAATCGTCCGTTTGCGTCATGGTATAGAGATAGCACGACGTTTCTTTCGATTGCACAA
+AGGTTTCGTATTTTCCTTGTGTCCTGTCGCAGGCCTGCGGATGTGAGCCCATCAGATGTAGAACAATCAGCTGCGGTTGCGAGTGCTCTTGCGCCAGCAC
+TTGAGCGGTCATATCCAGTAACGCTTCGTCTTTGGTGTTTTATCTGCTTCAAAATTACCTTCTTTCAGGAAGTACACTTCATCTGCTCGTTTGGCGATGC
+TGGCGATAGCGGTATCGTATTCGCCGATTTGACCCTGGTTGGAAACCACCAGGTCTGGAAGCCCGCGCGATTTGCCAGGGTGACAAAGTTATCCTGAAAC
+TGTGGTTTGCCATCGACAACGCGATTGAGCGTTAAGCCAAGCGATTTCTGCGTGGAGCCACTGGCGGCAATGTAGTCAGCAAATATCAAACCGTTAACGC
+TGCTGGCAAACGGGGTATTGTCCCAGTGACCGCCAAAGGCACCGAGGGCATCGCGACGCGCGCTTTCACCGATCACCACCACATAGGTCTGATACTTCGG
+CTTAACGGCAGTGACCGTCCAGGTATCTTTCATTCCGGAAAGTTTTGCCATCCGTTCTTGCTCTTCAATCACCTCGTTATTATTGACGATGACATCCTTA
+GCAAAACGAAATACCGGATAGCCAGTATCTTTCAGTTTAAATACGCCACCCCAGGCCAGGTTTTGCACGGGAGCAACAAAAATGTCGCCACACTGAATAC
+CAGACACAGGCTGTCGAAGGTATTCCAGCGCGCTTTTCATTCTCTTTTTCGCCTGATTGCTATTACGCCGAGCGCAAAATAAATAAGCCGACCAGGTAGC
+TGTACCACGGAAAAATCGTCAGGATTTCGGTCGACTCTTCCATATTGGTGGAGTGCAATGCCAGCAATGTATTGAAATTAGGCGCGCCGTAGGCCTGAGC
+AAAGGGAAATAACAAGCCGCCACCAGCGAACTGACACCGACCAGAACTTTTTGTACGCGAGGCAATGTTCGCCATAGCAAAAGCAAAATAGCCGTAAACG
+CAGCGGTGTAGAGCAAACTGAAGGGTAACCTAAGCCGAGGTTAATTAATAGCGACTGTAAAAGTAGAACGCAGTCCACGGGCTAAATACCCGGCTACGGG
+TAACAAGCGATTCTTTGAGGGTTAAATTCATATGCCACTATCGTAACAAACGCCATGTGCTTACCCTGGCGTCAAGGGTCAATACCTGCAAGAGTGCGTG
+AAGAGTGGAAAGGGTCCGCATCCGCGAGCCGCAATATACGCAGGGCTGCAAGAAGATAGAGCGAGCCGCCGTTCAGGTCAACTACTGACGAACAAATCTT
+TTGCGAAGGGATTGCAAATCCGACAAAAGTGGGGTTTTCAGACCAAAACGCGTTATGCCTGCATGAAAGCAGGAGTGAAGCGGCGTACCGCGACGCCGCT
+ATTTATCGGAAGGTTTATCTTGCTGCGGTTTGTTGTTGACCATATCGCACAACATAGAGAGCAGCATTAACCGTACTTTAAAGGAGAATGACTAAACACG
+CGCATACACCTCTTGAACTCATTCATAAGACCTCCTGACTTGCTAATCCCGTCGATCCTTGAGGGATGATTGCATTACATACAGATATAGCACAGGCTAT
+ATTATATAGCTATTGCTAAAACGTTAATTTTTGTACCTTCGCAACTCTGGTTTACAATGTGCGCACGAAATGAGAACGCTATGTATGCGTCACCATAATG
+AGGAAGCACAATGAGTCGTCGCGCAGGTACGCCAACAGCAAAAAAGTGACGCAGTTAGTGAACGTGGAAGAGCACGTTGAAGGGTTCCGCCAGGTCAGAG
+AGGCGCATCGGCGCGAGCTTATTGATGATTACGTTGAGCTGATTTCTGACTTGATCAGGGAAGTGGGGAAGCTCGTCAGGTGGACATGGCTGCTCGTCTG
+GGAGTTTCGCAACCGACGGTGGCTAAAATGCTTAAGCGGCTGGCAACCATGGGGCTGATTGAAATGATCCCTGGCGTGGCGTGTTTTAACGGCAGAAGGA
+GAGAAGCTGGCGCAGGAAAGCCGCGAGCGACATCAGATAGTCGAAAATTTCTTGTTGGTGTTGGGCGTCAGTCCGGAAATCGCCCGTCGCGACGCGGAAG
+GCATGGAGCACCATGTTAGTGAAGAGACGCTCGACGCTTTTCGTTTGTTTACCCAGAAACACGGTGCCAAATGAGCCTGCCTTTTTACGCACGCTGCAAG
+GCGATCGTTTTTCAGTTATTAATTCTTGTTGGTATCGGATTAAGCTTTTTCGTGCCCTTTGCACCGAAATCCTGGCCTGCTGCTATCGACTGGCACACCA
+TCATCACCTTAAGCGGCCTGATGCTGCTGACCAAAGGTGTGGAGTTAAGCGGTTATTTTGATGTGCTGGGGCGCAAAATGGTGCGCCGCTTTGCTACGGA
+GCGTCGGCTGGCGATGTTTATGGTGCTGGCGGCGGCGCTGCTTTCTACCTTTCTGACCAACGATGTCGCGCTGTTTATTGTTGTTCCGCTGACTATCACG
+CTAAAAGACTGTGTGAGATCCCGGTTAATCGGCTGATTATTTTTGAGGCGCTGGCAGTCAACGCTGGTTCGCTACTGACGCCAATTGGCAACCCGCAAAA
+TATTCTTATCTGGGGACGTTCTGGTCTTTCGTTTGCCGGATTTATTGCCCAAATGGCACCGCTGGCTGGCGCAATGATGCTGACGCTCCTGCTCCTGTGC
+TGGTGTTGTTTCCCTGGAAAGGCGATGCAATACCATACGGGGTGCAAACACCGGAGTGGAAACCGCGGCTGGTGTGGAGTTGTCTGGGGCTGTATATCGT
+CTTTCTGACGGCGCTGGAGTTCAAACAAGAGCTGTGGGGACTGGTGATTGTGGCGGCAGGCTTTGCGCTGCTGGCACGTCGCGTGGTGCTCAGTGTGGAC
+TGGACGCTGCTGCTGGTGTTTATGGCGATGTTTATCGACGTCCATTTACTGACCCAGCTTCCAGCGTTGCAAGGCGTGTTGGGTAACGTGAGTCATCTAT
+CTGAACCCGGGTTATGGTTAACGGCAATCGGTTTATCGCAGGTGATCAGTAACGTGCCGAGTACCATATTGTTGCTGAACTATGTGCCGCCGTCTTTATT
+ACTGGTATGGGCGGTAAACGTAGGTGGCTTTGGGTTATTACCCGGATCGCTGGCAAATTTGATTGCGCTACGTATGGCGAACGATCGCCGCATCTGGTGG
+CGTTTCCATCTCTATTCAATACCGATGCTGTTGTGGGCGGCGTTGGTGGGATATGTTTTGTTAGTTATACTCCCGGCCAACTAGGGTCTGGCAAATAAAA
+AGGCGGATTATGAGTCCGCCTTTTGCTTTAAGTTTTGAAGATTAATTCAGACGAACCGGCATCCCGGAGCGGTTTTAATCGCTTCATCAAGAACAACCTG
+GTCAACATCTGGCTGACCGGTCACTGTCTGCACGCTCTTCGTCAGGGTAATTGGCACAATTTCCTGACCTTCAAACTGGGCTTCGGTGGTAGACAGCGGG
+TTATGGACTTCAATATAACGGCTGCCGTCTGGCTCGGTGGTCGCTTTTACCGGCTCATCAATAAACTGTACGCGGGTACCGACCGGTACTTTCTCGAACA
+GGAATTTGATGTCTTCGTTACGCAGACGCACACAACCATGACTTACACGCAGGCCGATACCGAAGTTGGCGTTGGTGCCATGGATAGCATACAGGCGACC
+GATATAGAGTGCATACAGCCCCATCGGGTTATCCGGACCTGCCGGAACGACAGCCGGAAGCGGTTCGCCCGCAGCGCGGTACTCTGCGTGCATTTTGGCG
+GTCGGCGTCCAGGTCGGGCCTGCTTTTTACGCTCAACTTTGGTGGTCCAGTTGATAGGCGTATCTTTGCCTAACTGACCAATGCCGATCGGCAGCACGAT
+AACGGTGTTGGTCCCTTTCGGATAGTAATAAAGACGCATCTCAGCACTGTTAATGACGATGCCTTCATGAACGGTATCCGGCAGGATCAGCTGCTGCGGA
+ATGTTCAGTACAGTACCGCCTTTCGGCAGGAAGGTATCCACACCCGGGTTCGCTTCCATCATATTGGAAAGCCCCATCTGGTACTCGGCGGCAAAATACT
+CCAGCGGCTGAGTGTTACCTTCAGGAATGGTGATCACCTGATTCTGACCAACCAGGCGACTCCGTCGGTTGGCAGAGGATAAGTTACCGCAGAGGCGGTA
+CTGCAAAAGCCGACAACAGCGAAGGCCGCTGCGAATAATGTTTTCAATTTCATATTCATGTTAAGCGAGATTTTGTGCCTGGCAGGCCATTGGGTTGAGA
+ATATTAGAGTATTGGAAGCGCATTATAAGTTCATTCCAGCTCACAGTGAAATCAGATGTGTACGAAATCACATTTTTGCCTTTGGCTTGAGTGTAGACCT
+TAAGCGAGGAGCAGGATCTTCTTTCAGACTTATGGCATAATGCGCGGTTTGTCATATCTCTTTTCAGGATACGCCTGTGTTAGTTTCCAGTAACGTCACC
+ATGCAGTTCGGCAGTAAGCCGTTGTTTGAAAACATTTCCGTCAAATTTGGCGGCGGCAACCGTTACGGCCTGATTGGCGCGAACGGTAGTGGTAAATCCA
+CCTTTATGAAGATCCTCGGCGGCGACCTTGAGCCGACGCTGGGTAACGTTCCCTCGATCCCAACGAGCGCATTGGTAAACTGCGTCAGGATCAGTTTGCC
+TTTGAAGAGTTCACTGTGCTGGATACGGTGATCATGGGGCATAAAGAGTTGTGGGAAGTGAAGCAGGAGCGCGACCGCATCTATGCTTTGCCGGAAATGA
+GTGAAGAAGACGGCTATAAAGTGGCCGATCTGGAAGTTAAATACGGCGAAATGGACGGTTACTCTGCGGAAGCTCGCGCCGGTGAACTGTTGCTTGGCGT
+GGGAATTCCAGTGGAACAGCACTACGGCCCGATGAGTGAAGTTGCTCCTGGCTGGAAGCTGCGTGTGCTTCTGGCGCAGGCGCTGTTTGCTGATCCGGAT
+ATTCTCCTGCTCGACGAACCGACCAACAACCTCGACATCGACACCATTCGCTGGCTGGAACAGGTGCTGAACGAGCGTGACAGCACCATGATCATCATCT
+CGCACGACCGTCACTTCCTTAACATGGTCTGTACCCACATGGCGGATCTGGATTACGGCGAGCTGCGCGTTTATCCGGGTAACTACGATGAGTACATGAC
+GGCGGCGACCCAGGCGCGTGAACGTCTGCTGGCCGATAACGCCAAGAAGAAAGCGCAGATTGCTGAGTTGCAATCTTTCGTTAGCCGCTTTAGCGCCAAC
+GCCTCGAAATCTCGCCAGGCAACTTCGCGCGCGCGCCAGATTGATAAAATCAAACTGGAAGAGGTGAAAGCCTCCAGCCGTCAGAACCCGTTCATCCGTT
+TTGAACAGGATAAGAAACTGTTCCGTAACGCGCTGGAAGTGGAAGGTCTGACCAAAGGGTTTGATAACGGTCCGCTGTTTAAAAATCTCAACCTGCTGCT
+GGAAGTGGGTGAAAAACTGGCGGTACTGGGTACCAACGGCGTCGGTAAATCAACGCTGCTGAAAACGCTGGTGGGCGATCTGCAACCGGACAGCGGCACC
+GTAAAATGGTCTGAGAACGCGCGCATTGGTTACTATGCTCAGGACCACGAATATGAGTTTGAAAATGATCTGACCGTGTTCGAATGGATGAGCCAGTGGA
+AGCAGGAAGGCGATGACGAGCAGGCGGTACGCAGTATTCTCGGTCGTTTGCTGTTCAGCCAGGACGACATCAAAAGCCAGCTAAAGTGCTTTCCGGTGGG
+GAAAAGGGCGGATGCTGTTTGGTAAGTTAATGATGCAGAAGCCGAACATTCTGATCATGGACGAACCGACCAACCACCTGGATATGGAATCCATTGAGTC
+GCTGAACATGGCACTGGAACTGTATCAGGGCACGCTGATCTTTGTTTCACACGACCGTGAGTTCGTAAGCTCCTGGCGACCCGCATTCTGGAAATCACCC
+CGGAACGCGTGATCGACTTTAGCGGTAATTACGAAGATTACCTGCGTAGTAAAGGGATCGAGTAGTGATTATCCGTCACCCCGATACTGTCGGGGTGACG
+GCGGCTGATGACAATGCAAAATAGCCTGATGCGCTACGCTTATCAGGCCTACGCAGTACCTGCAATATATTGAATCTGCAGGACTTTGTAGGCCGGATAA
+GGCGTTAACGCCGCATCAGGCATTAACAAAGCGCATTTGTCAGCAATCTGAGTAACGTCGAATCGATTTTCTTAATCCCACATCAATTCACTTCCATTAA
+TTCTCAAACATCCATGCCCAACGCTCGCTTACCGTGAATGTTGAGGTCGGCAAGCGTAAAGCGTCCTTCCCAGTTTGTTTCATAGTCCTCGCGCGGGAAG
+TCGCCCGGCGATGCGCCTTTTCCAGTGCGGCCTTCACCTTGTGCGCGTAGGCAAGATTTTCTCGCACATCGGTGCCGCAGGAATGTACATCACGTTGCCC
+CAACCTTGTTGATTTTCAACGGGGCAACGGAATGGATGACGTCGCAGTGCCACCAGACGGAGTCTCCGGCTTCGAGTTTTGGAATGCTGGTTAACGCCTC
+AATCAACAGTGGATGCCATTGCTCTGATACCGGCAATACTCTTCCGGGCGCTACGCCGCACAGTTCATCCTCCGGCACATCATCAAGCAGCGGACGTAAC
+AGTACGTACGCCATAGCTTCAGGAATGGGCACGACGTGCAGCAGCCCCTGACCAGGCAGCATATCAGAGAGCGCTGTCCAGCCCTGGAATGTCCGAAACA
+CGGAACATTTGGTGGTGTTGTCCACCGTGTACTCTTCAACTTCCGTACGATGTGCCGCATGCCAGGGATCATATTGCGCCAGATTGCCATTAAAGACGTT
+GGCGAAAACGCGCTGATACGCTGGAAGCAGCCAGCGTTCCAGTGCCCCGGAGTCGGTATGCGCTCCAAGACCTTTGGAGGTCGTTCCGGGCGGACGGCGG
+CGGATACGGTCAGGGTAGATGACGCTCACATCCGGGTTAAACCATTGCTTTCCATCACTTTCAAATGTCCACAGACGATTGAGAAACGACTGCGCATTCG
+CCATTTCTTCACTCTGGCGGGCCTGCATTTGCGCCTGCGACCAGTAGATGGGGTAAATCTCGGGACGTGAAGCGCTGAGCGTCCCGAAGAAATTATCGCC
+GGGGCCTTTGTAGACCTCGTCAAAGCGGTTGCGGTCCAGATAGTCCAGCATCGACTGATCCCAGCCTAGCGCTTGTTCGCGGGGAAATGGCCTTTATCAC
+CGCACAACCGCGACGTTTAATCTGTTCGCGCTGCTCTGCAGTAACATGACCTGCTTTGATATCGGCATAAGACAGCACCGGCCAGACGGCATCGCCCTGT
+GCTTTGAGTGCGTTGATTTCAGCCACTCGCGTGGCAATGTCATCGCTTAGCTGATTAAAGATCTGCTGGACGTCGCCAAGCTGCGCCCGCAGCGCGTGCT
+TCATCTGACGGATAGCTGCTTTGTGATCGGCAGGCAATGTGTCGCTGGTAAAAGTAGAAGCCATAACCACCTCTCATTAACTTTCATTCGAAACCATTCT
+GATTTGCATGTGACAATATAAGTTATAAATAAGTTAATGCAAGTTTAATGATTTGATGTGATGTACAGGATGTAAAAAGGGAAAACCGGAGCGCACGGCT
+CCGGTAGAGAGGTCAGCTGTTAAAAGGGATGTGTTATCCAGCACCGCCTGAATCACATTCAGCGCGCCTTCATGATTATTATCATCGGTAGCGTAACGGG
+CGATTTGTTTAATGTTTTCCGCAGCATTGCCCATCGCAAAGGAATAACGCGCCATTTTCAGCATCTCCGCATCGTTACCGCTGTCGCCAATCGCTACCAC
+ATTTTGCGGTGACAGATCCCAGCGTTTCAGTAACCGCGAAATACCGTTTGCTTTATGTAGACCGGGAATAATCAGGTCGATAAAGCCAAAACCACTGGTA
+ACGGGTTTCATAATGCCATCGAGCGCTACGTGCAGTTTGTCGATCACTAACGGGATTTGTTCATCCGGCAGGTTGAGCGAAAACTTGAACAGTACGTCGT
+CAATCTCCTGATAATCTTTACAGGTTTCAGGCGATGGTAGTGTTTTGCCATCAGTGCGACAAATGCTTCGGGGCATTTTCGCTGACATATGCACTTTGCA
+GACCGCAGGCGACAAAATTGAGTTGCTTATCTTTTAGCAACTCGCCAATAACAATCCGCGATTCATGTCGGGTCAGTTCGCCGTGGAACAACTGCTTGCC
+ATGTTCGTAAACCAGTGCGCCGTTTTCCGCGACAAAGAGATCTCATCCTTTAGCTCAGGAAAGAATGAAATAAGCTGGTAATACTGATTACCGCTGGCAA
+CAACGAACTTAATGCCGCGCTTTTTCAGTTCCTGATATTGCGCCATAAAACGTGGTTGGTTGTACGTTTTGGCGTCGTTAAGAAAAGTACCGTCCATGTC
+TGTGACGATAACTTTTACGCTCATAGGTGTGCTCCTGGCTCGAAAATGAAACCGTAACAGTGTAATAACAATGTGACGCAGAGCACAAATTATATTTCGA
+ATGAAAGTAAGGATGAAATTGATGATGTGAATGATTTAGCCCGGCGACGACGCCGCCGGGCCGAGGAGATTACAGCATATGTTCAGTACGGGCGATGATA
+TCGTCCTGAGCGTCTGGAGAGCGCGGTGAAGAACGCGGAATAGCCCGCGACACGCACTACCAGATCGCGATACTGATCGGGATGTTTTTCGCATCCAGCA
+GCGTTTCGCGGGAAACGATGTTGTACTGAATATGCCAGCCTTTATGCACTTCAAAGAAGGTACGCAGCAGGATCATCAGTTTCTGCTTGTCAGATTCGTT
+CTCCAGCGTTGCCGGATTCAGTTTCTGGTTGAGCAACACGCCGCCGAGAATCGCTGCCGTAGGCAGTTTACCCACTGAGCCAATGACCGCAGTAGGGCCA
+AGATGGTCAGTACCGGAGGCCGGGCTTGCGCCTTCTGCCAGCGGGGTGTGGGCTTTACGCCCGTCCGGTGTTGCCATAGTCTGCGCGCCAAACGGTACGT
+TAGCGGAGATTGATGACGTACCCGCGTAATAGTTGCCGCCAACCGGACCACGACCGTAGCGCGGATTATGGTACTGTTTCAGTTCGTCGATATAGGTCTG
+ATAAGCGCGAGCCAGCAGCGTATCGACAGTATCATCGTCGTTGCCGTACTTCGGCGCACCGTTAATCAGCCGCTGACGCAGCTGCTCGTGAGTCAGGCCG
+TCGAAGTCATCTGCCAGTGCGGCAGCAAGCTGTTGCTGACCAATCGCACCTTGTTCAAACACCAGTTTCTTCACTGCCGCCAGGCTGTTGCCGAGGTTGG
+CAATGCCGACCTGCAGGCCAGAAACCCAGTCATATTTCGCGCCGCCTTGCTTGATACTTTTCGCTCGCTCAATACAGTCATCCACCAGCGCCGAGCAGAG
+AATATCGTGCACGTTCTCTTCCAGCATGGTGTCGACGACATATTCGATTTCGATTGATTTGCGGGTGTAGTAACGGATTTGCGTATCCCACGCGTCCATC
+ACTTCATCGAAGTTGTTGAAGTTACCTGCCGACAACGCTTTTCTTGTGGCAGGAACACTTTGCCGCTGGTGGCATCATGCCCGCCTTCCAGCGCCGCCAG
+CATCACGCGGGCGAAGTTGATAAAGCTCATGCCGGTACAGCGATAGCCCCATTTGCCACCGACGGCGGTTTCTATACAACCAATCGCTGCGTAGTCATAA
+GCGTCCTGCGGTTCAATACCGAGTTTAATAAATTCCGGGATCACGATTTCGTCGTTGTTGAACGCCGGCATCCCGAAGCCGCAACGGATCACCTGTACGC
+AGGCGTCGAGGAAATCGTTGCTCATTCCTGCATGGTAACGCACGCTGAGGTTAGGCTGAGTGGAACGCAGGCGACCGCAGGATTCGAGGATCGCGTAAGA
+GAGTGGATTCACCGCGTCCATTGGTTGACCATCAACCAGATTTTGCCCGCCAATAGTGACGTTCTGATACAGCGGACTTCCCGCAGAGGCTTTTGAGTGT
+GAGCCGGAGCGGATCTTGTTCACTTCCAGCAGTTTCAGCCAGCAGCTATGCAGCATCTCGATGGCGTGTTCGCGATCCAGCGTCTGGTTGAGTTCAACGT
+CGCGGCGATAGTACGGGTAGAGATACTGGTCCATACGACCAAACGATACTGAGTGACCGTTAGATTCGATCTGCAAAATCAACTGGATGAAGTAACACAG
+TTGCAGCGCCTGCCAGAAAGTCTGCGGCGGCTGGTGGGCGATAAGATCGCAGTTTTCTGCCATCGCCAGCAGTTCATCGCGACGGCTTTCGCGGGTTTCG
+GTCGCGGCCATTTCACGCGCCAGGGCAGCGAAACGTTCAATGTGTTCACTGACTGCCACCAGCACGATATCAATCGCTTTCAGGAATTGCTCACCGTGTA
+AATCTTCCAGCACCGTCAGGTTGATGCGCGAGCGACGTTCCGCTACTTCCTCGCGCAGACCATCAAGCCCTTTTCCAGCAGCAGCGGGAAATTCACCGCC
+AGGTGCGCATCGCCGGAGGTCATATTGCCTTCCGCTTTAATGATTCCGGTCGCCAGCAGACCTTTTGCTCATCGGTAAACATGCCGTAGCAGCGATCCTG
+TACGGTCTGACCGCGCCACCACGGGCACACTTCATGCAGAACGCGTTTGTTCTCTTCGCTCACCGCAAAGCCAGCACCGGGACGATCTGCCAGATCATCA
+ATCTCTTTTCGATCCACGAGACAGTATATTCCGGGAAGATCGGCGCGGCGCGAACTTCGCTTGCCTGGTTGCCAATGATCAACTCATCGTGTTTGATCCA
+GATGGTGCGATTCGCCAGGTGATGCGCCAGTGCCAGCGCGCGACGTACCGGGATCGGCTTATCGAGATGTTGTTGATACATCTCGGTATAGTGCTGCGCG
+CGCTCGGTACAGACTGGCGGTTTCACAATATGCACCAGCGCATTTTTGTGCTTTAATGCGGTCGCTGAGCGTGTCCAGTTTCAGTGTGGTCATGGTTGTT
+ATCCTCGTAAGGTCGCGGTTAACCCTTTCTGGCAGGCATACTGCTGGGCAAAGTCGAGCAGTTCTGGCGCATCAAGCGGTTTTCCGGGGCGTCATAGGGC
+AGATTAAGTAAGTGATATTTGTTGATGCCCAGCGTGTGGTAGGGCAGAAAATGAATTTCGCCAACGTGCAGCTCGTCGGCGGCAAAATCGGTAATGGCTT
+TTACAGAGGTTTCGTCGGCATTAAAGCCCTGAATCAGCGGCACGCGGATAATGATTTTTGCCCGCTGCGGCGAGTTTTTCAGGTTATCCAGCACTCTGGC
+GGCGTTACCGTCGGTCCACTGTTTAAACGGCGCGTCGGCAACGTGTTTTAAATCGGCAAGAAACAGATCGATATAGGGCAGAGAAGGGGCGATATATTTC
+CACGGCACATGCAGACAGGTTTCTACCGCAGTATGAATGCCTGCCTCGTGGCTGGCTTGCAGTAGCGCCATCGCCATTTCCGGCTGCATAAAGGGCTCAC
+CACCCGAAAGCGTTAAACCGCCGCCGCTGCGATCGTAAAACGGTTTATCGCGCAGAACGGTCGTCATGATCTCCTCAACGCTTTTCACTTCACCACACAC
+GGTTAATGCCTGTGTCGGACAGCAGTCGGTTAACGCCGTCAGATGCTCCGGGGTTAACTTTTCCCGATGAATAAGCAAACCATTCAGCGCGCGCTCAATC
+ACTTCCGGCGCGGCCTTAGCGCACAGCTCGCAGCCTTCCAGACACAGTCGTGCGTCATACAGCAGATCCTGCGTGCGGGCGCGGCTTTCCGGTTCTGACA
+CCAGCGGCAGCCCAGCGAACAGCCTTTAAGAAATACGACCGTGCGGATACCGGGGCCATCATGGGTCGAGTAGCGCTGAATATTGAAAATCATAGTTGCC
+TCTCTATTTCGTTCAAGCATTAAAATACTTTCGAATGAAAGTTAGATTGATGTGCGTCAACTGTTCAGAGAGTTTTCCCGTGATAGTCTACATTCAGACA
+AAAGTACATTTTGAGGATGGTTATGGAACTGTATCTGGATACTTCAGACGTTGTTGCGGTGAAGGCGCTGTCACGTATTTTCCGCTGGCGGGTGTGACCA
+CTAACCCAAGCATTATCGCCGCGGGTAAAACCGCTGGATGTTGTGCTTCCGCAACTTCATGAAGCGATGGGCGGTCAGGGGCGTCTGTTTGCCCAGGTAA
+TGGCTACCACTGCCGAAGGGATGGTTAATGACGCGCTTAAGCTGCGTTCTATTATTGCGGATATCGTGGTGAAAGTTCCGGTGACCGCCGAGGGGCTGGC
+AGCTATTAAGATGTTAAAAGCGGAAGGGATTCCGACGCTGGGAACCGCGGTATATGGCGCAGCACAAGGGCTGCTGTCGGCGCTGGCAGGTGCGGAATAT
+GTTGCGCCTTACGTTAATCGTATTGATGCTCAGGGCGGTAGCGGCATTCAGACTGTGACCGACTTACACCAGTTATTGAAAATGCATGCGCCGCAGGCGA
+AAGTGCTGGCAGCGAGTTTCAAAACCCCGCGTCAGGCGCTGGACTGCTTACTGGCAGGATGTGAATCAATTACTCTGCCACTGGATGTGGCACAACAGAT
+GATTAGCTATCCGGCGGTTGATGCCGCTGTGGCGAAGTTTGAGCAGGACTGGCAGGAGCGTTTGGCAGAACGTCGATTTAACCGGACGTTCTGCATCCTC
+ATAAATTGCTGATGACGTGGCGGAGTGCCGCGTCTTATCAGGCCTGGAGGTGGCAATTACTGCCCACACACCTCACACCCCGGATTACGCATCAGTTTCA
+TTTCGCGAAACTGACAGGTCATCGCATCGTACATGACGATTTTCCCGCTGGCCGGTTTGCCATAACCTGCCAGCATTTTGATCGCTTCCATTGCCTGCAA
+CGAACCAATTACGCCGATCAACGGTGCCATTACGCCTGCTTCCACGCAGGTTAATGCATTTTCACCAAACAAACGGCTAAGGCAGCGATAGCACGGTTCA
+CCGTCCTGATAAGTAAAGACGGTGATTTGACCTTCCATACGAATTGCCGCGCCGGAAACCAGCGGTACCTTCGCGGCAAAACAGCCTGCGTTCAGTTGAT
+TACGTACCGCAACGTTATCCGTACAGTCGAGCACCAGATCGTGTTCAGCAATCAATGCTGCAAGTTCTGCGTCATCCAGCAGTGCATTGACTGGCGTAAT
+CGCGATATGTGGGTTGATCCGCGTCAGGGCGTCACGGGCGGATTCCACCTTCGGTTGCCCGACCGTGGCATCACTGTGCAGTGTCTGGCGTTGCAGATTC
+GAGAGCGAAACCGTGTCGAAGTCGAGCAGCGTCAGGTTACCGACACCGGCGCTTGCCAGATACTGCGAGGCTGCACAGCCGAGGCCGCCCAGGCCCACTA
+TCAGCACGCGAGAATCTTTCAGCGCCTCCTGGCCGTCAAAATCAAAGCCGCGCAGAATGATTTGCCGGTTGTAGCGCAGCATCTCCTGATCGCTGAGTTC
+CGCCATTACAGGCCTCCGAACAACGCGTTAAACGGTTCTACTTCCACCCATTCGCCCACTTCCACATTGCCGCGATCGCGTTCCAGCACGATAAAGCAGT
+TGCCGAGGCTAAAGGAGCTAAATATATGTGAACCCTGATGTCCGGTGGTCGTCACTTCCAGTTCGCCATCGGCGTTGCGTTGCAGCACGCCGCGCTGGAA
+ATCAAGACGTCCTGGCGTTTTTCAGGCGGGACGCTGTGCGTACGCTGGCGCGCGGGCAGGCCGCTGGCGGTGTTACCGCTTAGTTTTGCCAGCAAAGGCT
+GTACCAGTTGATAGAAGGTCAGCGTCGCTGAAACCGGGTTGCCCGGCAGGCCGCAGAACCAGCTATTGCTGAGTTTACCGAACGCGAACGGTTTACCTGG
+TTTAATCGCCAGCTTCCAGAAGGCGATCTCCCCAGCTCTTCAAGAATCGTTTTGGTGTAATCCGCCTCACCCACTGAAACACCGCCGGAACTGATCACCA
+CATCCGCCTGGCTGTCGGCTTCAATAAATGCGGCGCGCAGGGCATGGGGATCGTCGCGGATAATCCCTAAGTTAATTACCTCGCATCCCAACTGTTCTAA
+CATCAGGTGTACGGCGAGACGGTTGGTATCGTAGATTTGGCCGTCGCCCAGCGGCTGACCGGGCAACTGGAGTTCATCACCGGTAGAAAAAGCGCTACAC
+GCACTTTACGAATCACCGGAACTTCGGCAATCCCCAGTGAAGCAATTACTGGCAGCTCTGCGGTAGTCAGGCGAGTTCCCGCCGGGAAAACAACCGCACC
+TGCAGAGATATCTTCACCGCGACGGCGAATATTTTGCCCGCTACGCACTTCAGCAGTAAAACGCACGCCATTGTCCATTTGTTCAGTCTGCTCCTGCATC
+ACCACCGCTTCGCAGCCTTCCGGCACCGGCGCACCGGTCATAATACGAATGCAGGTACCCGCAGGCCATTCACCATGGTATGGCTGACCGGCAAAGGATT
+TACCGGCAACGGGCAGCGGTTGCCCGGAGGCAATATCGGCTAAACGCACCGCGTAGCCGTCCATTGCGGAGTTATCAAACCCCGGAACATCAAGCGGCGA
+AACGACATCGCTCGCCAGAATACGACCAAAACACTGTACCAGTGGCAGCGTTTCCTGGGCGGTCAGTGGGGTGACGCGAGAAAGCATCTCATTAAGCGCG
+GTGTCGAGCGACATCAATCCGGTGGTAAATTCCATGAAAACACTCCTGCGGAGGCAAAATCGAATTTGCCTATTATGTCAGAAAACGCCACAGACTGTAT
+GCCACCTCGGGCGTAGCGCTGGGTCCTGCCTTTACATGCCATATCCATCTTTCTATATTCAAAAATTGAATGAGTAATTCATAAAAATTCTGATATTTAT
+AGCAAAAGTGGCGAACCACCCTTAATGGACGAATACTATGGGCAAAGCAGTCATTGCAATTCATGGTGGCGCAGGTGCAATTAGCCGCGCGCAGATGAGT
+CTGCAACAGGAATTACGCTACATCGAGGCGTTGTCTGCCATTGTTGAAACCGGGCAGAAAATGCTGGAAGCGGGCGAAAGTGCGCTGGATGTGGTGACGG
+AAGCGGTGCGTCTGCTGGAAGAGTGTCCACTGTTTAACGCCGGAATTGGCGCTGTCTTTACGCGTGATGAAACCCATGAACTGGACGCCTGTGTGATGGA
+TGGTAACACCCTGAAAGCCGGTGCGGTGGCGGGCGTTAGTCATCTGCGTAATCCGGTTCTTGCCGCCCGGCTGGTGATGGAGCAAAGCCCGCATGTGATG
+ATGATTGGCGAAGGGCAGAAAATTTTGCGTTTGCTCGTGGCATGGAGCGCGTCTCGCCGGAGATTTTCTCCACGTCTTTGCGTTATGAACAACTACTGGC
+AGCGCGCAAGGAAGGGCAACCGTCCTCGACCATAGCGGTGCGCCACTGGATGAAAAACAGAAAATGGGCACCGTGGGGCCGTGGCGTTGGATTTAGACGG
+CAATTTGGCGGCAGCCACGTCCACAGGCGGAATGACCAATAAATTACCCGGACGAGTTGGCGATAGTCCCTTAGTGGGTGCCGGATGCTACGCCAATAAC
+GCCAGTGTGGCGGTTTCTTGTACCGGCACGGGCGAAGTCTTCATCCGCGCGCTGGCGGCATATGACATCGCCGCGTTAATGGATTACGGCGGATTAAGTC
+TCGCGGAAGCCTGCGAGCGGGTAGTAATGGAAAACTCCTGCGCTTGGCGGTAGCGGTGGCTTAATCGCTATCGACCATGAAGGGAATGTCGCGCTACCGT
+TTAACACCGAAGGAATGTATCGCGCCTGGGGCTACGCAGGCGATACGCCAACCACCGGTATCTACCGTGAAAAGGGGACACCGTTGCCACACAGTGATGA
+ACTTGATGCCGGTAATGTGCTGGCGGTTGAAAATCTGAATATTGCCTTTATGCAGGACCAGCAGAAAATAGCTGCGGTCCGCAATCTCTTTAGTCTGCAA
+CGCGGTGAGACGCTGGCAATTGTTGGCGAATCCGGCTCCGGTAAGTCAGTGACTGCGTTGGCATTGATGCGCCTGTTGGAACAGGCGGGCGGTTTAGTAC
+AGTGCGATAAAATGCTGTTGCAGCGGCGCAGTCGCGAAGTGATTGAACTTAGCGAGCAGAACGCTGCACAAATGCGCCATGTTCGCGGTGCGGATATGGC
+GATGATATTTCAGGAGCCGATGACATCGCTGAACCCGGTATTTACTGTGGGTGAACAGATTGCCGAATCAATTCGTCTGCATCAGAACGCCAGTCGTGAA
+GAAGCGATGGTCGAGGCGAAGCGGATGCTGGATCAGGTACGCATTCCTGAGGCACAAACCATTCTTTCACGTTATCCGCATCAACTCTCTGGCGGGATGC
+GCCAGCGAGTGATGATTGCGATGGCGCTGTCATGCCGCCCGGCGGTGCTGATTGCCGATGAGCCAACCACCGCGCTGGATGTCACTATTCAGGCGCAGAT
+CCTGCAATTAATCAAAGTATTGCAAAAGAGATGTCGATGGGCGTTATCTTTATCACTCACGATATGGGCGTGGTGGCAGAGATTGCCGATCGGGTACTGG
+TGATGTATCAGGGCGAGGCGGTGGAAACGGGTACCGTCGAACAGATTTTCATGCACCGCAACATCCTTACACCCGTGCGCTGTTAGCTGCTGTTCCGCAA
+CTTGGTGCGATGAAAGGGTTAGATTATCCCCGACGTTTCCCGTTGATATCGCTTGAACATCCAGCGAAACAGGCCCCCATCGAGCAGAAAACGGTGGTGG
+ATGGCGAACCTGTTTTACGAGTGCGTAATCTTGTCACCCGTTTCCCTTTGCGCAGCGGTTTGTTGAATCGCGTAACGCGGGAAGTGCATGCCGTTGAGAA
+AGTCAGTTTTGATCTCTGGCCTGGCGAAACGCTATCGCTGGTGGGCGAGTCTGGCAGCGGTAAATCCACTACCGGGCGGGCGTTGCTGCGCCTGGTCGAA
+TCGCAGGGCGGCGAAATTATCTTTAACGGTCAGCGAATCGATACCTTGTCACCCGGCAAACTTCAGGCATTACGCCGGGATATTCAGTTTATTTTTCAGG
+ACCCTTACGCTTCGCTGGACCCACGTCAGACCATCGGTGATTCGATTATCGAACCGCTGCGTGTACACGGTTTATTGCCAGGTAAAGACGCGGCTGCACG
+CGTTGCGTGGTTGCTGGAGCGCGTGGGCCTGTTACCTGAACATGCCTGGCGTTACCCGCATGAGTTTTCCGGCGGTCAGCGCCAGCGCATCTGCATTGCT
+CGCGCGTTGGCATTGAATCCAAAGTGATCATTGCCGACGAAGCCGTTTCGGCGCTGGATGTTTCTATTCGCGGGCAGATTATCAACTTGTTGCTCGATCT
+CCAGCGTGATTTCGGCATTGCGTATCTGTTTATCTCCCACGATATGGCGGTGGTAGAGCGGATTAGTCATCGTGTGGCGGTGATGTATCTCGGGCAAATT
+GTTGAAATTGGTCCACGGCGCGCGGTCTTCGAAAACCCGCAGCATCCTTATACGCGTAAATTACTGGCGGCAGTTCCGGTCGCTGAACCGTCCCGACAAC
+GACCGCAGCGTGTACTGCTGTCGGACGATCTTCCCAGCAATATTCATCTGCGTGGCGAAGAGGTGGCAGCCGTCTCGTTGCAATGCGTCGGGCCGGGGCA
+TTACGTCGCACAACCACAATCAGAATACGCATTCATGCGTAGATAACATTCAGGCGGAGAATAAAATGGCAAGAGCTGTACACCGTAGTGGGTTAGTGGC
+GCTGGGCATTGCGACAGCGTTGATGGCATCTTGTGCATTCGCTGCCAAAGATGTGGTGGTGGCGGTAGGATCGAATTTCACCACGCTCGATCCGTATGAC
+GCAAATGACACGTTATCTCAGGCCGTAGCGAAATCGTTTTACCAGGGGCTGTTCGGTCTGGATAAAGAGATGAAACTGAAAAACGTGCTGGCGGAGAGTT
+ATACCGTTTCCGATGACGGCATTACTTACACCGTGAAATTGCGGGAAGGCATTAAATTCCAGGATGGCACCGATTTCAACGCCGCGGCGGTGAAAGCGAA
+TCTGGACCGGGCCAGCGATCCGGCGAATCATCTTAAACGCTATAACCTGTATAAGAATATTGCTAAAACGGAAGCGATCGATCCGACAACGGTAAAGATT
+ACCCTCAAACAGCCGTTCTCAGCGTTTATTAATATTCTTGCCCATCCGGCGACCGCGATGATTTCACCGGCAGCGCTGGAAAAATATGGCAAGGAGATTG
+GTTTTATCCGGTGGGAACCGGACCGTATGAACTGGATACCTGGAATCAGACCGATTTTGTGAAGGTGAAAAATTCGCGGGTTACTGGCAGCCAGGATTGC
+CCAAACTGGACAGCATAACCTGGCGTCCGGTGGCGGATAACAACACCCGCGCGGCAATGCTGCAAACCGGTGAAGCGCAGTTTGCTTTCCCCATTCCTTA
+CGAGCAGGCCACACTGCTGGAGAAAAACAAAATATCGAGTTGATGGCCAGTCCGTCAATTATGCAGCGTTATATCAGTATGAACGTGACGCAAAAGCCGT
+TCGATAACCCGAAGGTCCGTGAGGCGCTGAATTACGCCATTAACCGTCCGGCGCTGGTGAAAGTTGCCTTTGCGGGCTATGCAACGCCAGCTACTGGTGT
+GGTACCGCCAAGTATCGCCTACGCGCAAAGTTATAAACCGTGGCCTTACGATCCAGTGAAAGCGCGCGAATTACTGAAAGAGGCGGGATATCCCAACGGT
+TTCAGTACCACGCTGTGGTCGTCACATAACCACAGCACCGCGCAGAAAGTGCTGCAATTTACCCAGCAGCAGTTAGCGCAGGTCGGGATTAAAGCCCAGG
+TGACTGCGATGGATGCCGGACAGCGGGCGGCAGAAGTTGAAGGTAAAGGGCAAAAAGAGAGCGGCGTGCGGATGTTCTACACTGGCTGGTCGGCTTCAAC
+CGGCGAAGCGGACTGGGCACTATCGCCGCTGTTTGCCTCGCAGAACTGGCCACCGACGCTGTTTAATACCGCGTTTTACAGCAATAAACAGGTGGATGAC
+TTCCTGGCTCAGGCACTGAAAACTAATGATCCGGCGGAAAAGACCCGCTTATATAAGGCGGCGCAGGATATCATCTGGCAAGAATCGCCGTGGATCCCGC
+TGGTGGTAGAAAAACTGGTGTCGGCACACAGTAAAACCTGACCGGTTTTGGATCATGCCAGACACCGGCTTCAGCTTTGAAGACGCGGATTTGCAATAAG
+CAACGCAGGAGTGGAATGCTTAATTACGTTATCAAACGCTTACTGGGGTTGATTCCGACGCTGTTTATCGTCTCGGTGCTGGTGTTTTATTTGTCCATAT
+GCTGCCCGGCGATCCGGCGCGATTGATTGCCGGGCCCGAAGCTGATGCGCAGGTTATAGAACTGGTGCGTCAGCAGCTGGGGTTGGATCAGCCGCTGTAT
+CACCAGTTCTGGCACTATATCAGCAATGCTGTGCAGGGGATTTTGGCCTGTCGATGGTGTCGCGTCGTCCGGTTGCCGATGAGATTGCCAGCCGCTTTAT
+GCCAACGCTGTGGCTGACCATAACCAGTATGGTCTGGGCGGTTATATTTGGTATGGCGGCGGGAATTATCGCCGCCGTCTGGCGTAACCGTTGGCCGGAT
+CGATTGAGTATGACCATTGCGGTGTCGGGGATCTCGTTTCCGGCATTTGCTCTGGGGATGCTTTTAATTCAGGTATTCTCCGTTGAACTGGGCTGGCTGC
+CTACCGTGGGAGCAGACAGTTGGCAGCACTACATTTTACCCTCCCTGACGCTCGGCGCGGCAGTGGCCGCCGTGATGGCGCGCTTTACCCGCGCGTCGTT
+TGTCGATGTTTTAAGCGAAGATTATATGCGTACCGCGAGGGCGAAAGGGTGAGCGAAACCTGGGTTGTCCTCAAACACGGGCTACGTAACGCGATGATCC
+CGGTAGTGACCATGATGGGCTTACAGTTTGGCTTTTGCTCGGTGGTTCCATCGTTGTGGAGAAAGTTTTCAACTGGCCGGGACTTGGACGCTTACTCGTT
+GACTCCGTAGAAATGCGTGATTACCCGGTGATTCAGGCGGAAATTCTGCTTTTCTCGCTGGAATTTATTCTTATCAACTTAGTGGTGGATGTGCTTTACG
+CCGCCATTAACCCGGCTATCAGGTACAAGTAAGGATGCGACTATTTAACTGGCGACGTCAGGCGGTGTTAAACGCCATGCCACTGGTCAAACCTGACCAG
+GTACGTACACCGTGGCATGAATTCTGGCGACGATTTCGCCGTCAGCATATGGCGATGACCGCCGCATTATTCGTTATTTTATTGATTGTGGTGGCCATTT
+TGCACGCTGGATCGCTCCCTATGACGCCGAAAATTATTTTGATTATGACAATCTGAATAACGGACCTTCTTTGCAGCACTGGTTTGGCGTCGATTCACTG
+GGGCGTGACATTTTCAGCCGTGTCCTGGTTGGTGCGCAAATCTCGCTGGCGGCGGGCGTGTTTGCCGTGTTTATCGGTGCGGCGATCGGGACGTTGCTGG
+GCTTGCTCGCTGGATATTATGAAGGCTGGTGGGATCGGCTGATCATGCGCATTTGCGATGTGCTGTTTGCCTTCCGGGTATTTTACTGGCGATCGCTGTT
+GTTGCGGTGTTGGGAAGCGGCATTGCTAACGTGATTATTGCAGTCGCCATTTTTCCATCCCCGCGTTTGCCCGCCTGGTGCGCGGCAACACGCTGGTGTT
+GAAACAGCAAACCTTTATTGAGTCAGCACGCAGTATTGGTGCCAGCGATATGACCGTTTTGTTGCGTCATATCCTGCCTGGGACCGTCTCTTCTATCGTG
+GTGTTTTCACCATGCGCATTGGTACCTCGATTATCTCTGCCGCCAGCCTCTCATTTCTCGGCCTCGGTGCGCAGCCGCCGACACCAGAGTGGGGAGCAAT
+GCTCAATGAGGCTCGAGCGGATATGGTTATCGCGCCGCATGTCGCTGTTTTTCCGGCCCTGGCTATTTTTCTGACCGTACTGGCGTTCAATTTGTTGGGC
+GATGGTTTACGCGATGCGCTGGATCCGAAAATTAAAGGATAGTTACGTTTGAATATTGCTTGAAAGGGTAATCACCTCACAGGAAATTATTGCCCTAAGC
+AAGTGTTGTAACTTTCTGCTGATTTTGTAGAATCGGGTAATTTGGTTAAAAGCCGCAGCAAGGGACAATTTTGCAGCGGCACAGCGTTCAGATAGTTATT
+TTGTTAAATGTATTAACATGCTGAGTTTATACGAAAAGATAAAGATAAGGCTGATAATTTTATTTTTATTGGCAGCACTGTCATTTATTGGTCTTTTTCA
+TCATTAACTATCAACTGGTATCGGAGCGCGCGGTAAAACGTGCCGATAGCCGCTTTGAACTTATTCAGAAAAACGTTGGCTATTTCTTTAAAGATATTGA
+ACGTTCGGCCCTGACATTAAAGGACTCACTGTATTTATTAAAAATACAGAGGAGATTCAACGCGCCGTGATTCTTAAAATGGAAATGATGCCATTTTTAG
+ACTCGGTGGGACTGGTACTTGATGATAATAAATATTATCTTTTTTCGCGGAGGGCGAATGATAAAATCGTTGTTTATCATCAGGAACAAGTAAATGGACC
+GCTTGTCGACGAGTCAGGGCGGGTTATTTTTGCCGATTTTAACCCATCGAAACGACCGTGGTCGGTGGCTTCAGATGACTCTAACAACAGCTGGAATCCG
+GCATACAATTGCTTTGATCGTCCGGGTAAAAATGTATCTCTTTTACGCTACACATCAACGGCAAAGATCACGATTTGTTAGCGGTGGATAAAATTCATGT
+CGATTTAAACTGGCGATATCTGAACGAGTATCTTGATCAAATCAGCGCTAATGATGAAGTTCTATTTTTGAAACAAGGCCATGAGATCATTGCCAAGAAT
+CAACTCGCTCGTGAAAAACTGATTATTTATAATAGCGAAGGTAATTATAATATTATTGATTCTGTCGATACTGAATATATCGAAAAACATCAGCGGTGCC
+AAACAACGCATTATTCGAAATCTATTTTTATTATCCTGGCGGTAATTTATTGAACGCATCAGATAAACTTTTTATCTGCCGTTTGCGTTCATTATTATCG
+TATTGCTGGTGGTTTATTTAATGACCACTCGTGTGTTCCGTCGGCAATTTTCTGAAATGACAGAGCTGGTTAATACGCTGGCGTTTTGCCTGACTCAACG
+GATCAAATCGAGGCTCTGAAAATTCGTGAAGGCGATGCGAAAGAGATTATCAGCATCAAAAATTCGATCGCGGAAATGAAAGATGCCGAAATTGAACGGT
+CAAATAAATTGCTCTCACTGATCTCTTACGATCAGGAAAGTGGTTTTATTAAAAATATGGCGATTATTGAGTCTAACAATAATCAGTATCTGGCTGTGGG
+GATCATCAAACTGTGTGGTCTGGAAGCCGTGGAAGCGGTGTTTGGTGTTGATGAGCGCAATAAAATCGTCAGGAAATTGTGTCAGCGAATTGCCGAGAAA
+TATGCGCAATGCTGCGATATCGTGACATTCAATGCCGATCTCTATTTACTTCTGTGTCGGGAAAATGTACAGACATTTACCCGTAAAATAGCGATGGTAA
+ACGATTTTGACAGCAGCTTTGGCTACCGCAATCTGCGCATCCATAAGTCTGCCATTTGTGAACCTTTGCAGGGGAAAACGCCTGGAGTTACGCAGAAAAA
+CTGAAACTGGCGATTTCCAGTATCCGTGACCATATGTTCTCAGAGTTTATTTTCTGTGATGACGCGAAACTCAACGAAATAGAAGAGAATATCTGGATTG
+CGCGTAATATTCGCCATGCAATGGAAATTGGCGAACTATTCCTCGTCTATCAACCGATCGTTGATATTAACACCCGCGCCATTCTGGGCGCGGAGGCGTT
+GTGCCGTTGGGTGTCTGCGGAGCGGGGATCATTTCACCGCTGAAGTTCATTACCATTGCTGAAGATATCGGGTTTATCAATGAGCTGGGTTATCAGATTA
+TTAAAACGGCAATGGGTGAATTCAGACATTTTAGTCAGCGTGCGTCGCTGAAGGATGATTTCTTACTGCATATTAATGTTTCGCCCTGGCAGTTAAACGA
+ACCACACTTTCATGAGCGTTTTACCACCATCATGAAAGAAAATGGCCTGAAGGCGAACAGCCTCTGTGTTGAGATCACTGAAACCGTGATCGAGCGAATT
+AATGAACATTTTATCTCAATATTGAACAACTGCGTAAACAAGGGGTACGGATATCGATTGATGACTTTGGCACCGGTTTGTCAAACCTGAAACGTTTTAT
+GAAATTAATCCAGACAGCATAAAGGTGGACTCGCAATTCACCGGCGATATTTTCGGTACTGCGGGAAAAATTGTGCGCATTATTTTCGACCTGGCACGCT
+ATAACCGGATCCCGGTGATTGCGGAAGGCGTAGAGAGCGAAGACGTTGCGCGCGAATTAATCAAATTAGGATGTGTTCAGGCTCAGGGTATCTGTACCAG
+AAACCCATGCCATTCTCCGCCTGGGATAAAAGTGGAAAATTAGTAAAAGAGTAGTTTACGTATGTCCAGAATCAATAAGTTCGTACTTACAGTCAGTCTG
+CTGATTTTTATCATGATTTCAGCAGTTGCCTGCGGGATCTACACTCAAATGGTAAAGGAACGGGTGTATAGCCTGAAACAGTCCGTTATTGATACTGCTT
+TTGCGGTGGCAAATATTGCTGAATATCGGCGTAGCGTGGCAATTGATCTTATCAACACGCTAAATCCCACGGAGGAACAGCTGTTGGTTGGTTTGCGCAC
+AGCTTACGCCGACTCGGTTTCCCCTCTTATTTGTACGATGTCGGTCCTTATCTGATTTCCAGTGACGAATGTATTCAGGTAAAGGAGTTCGAGAAAAATT
+ATTGTGCAGATATTATGCAGGTTGTGAAGTATCGACATGTCAAAAATACAGGGTTTATCTCTTTGACGGTAAAACCTTCGTCTATTACCTCTATCCGGTA
+ACTCACAATCGTAGTCTGATATTTTTGCTTGGTCTGGAGCGTTTTTCTTTACTGTCAAAATCGCTGGCGATGGACAGCGAGAACCTGATGTTCTCTCTAT
+TTAAGAACGGTAAACCGGTGACCGGTGATGAATATAATGCTAAAACGCCATCTTCACCGTTTCGGAAGCGATGGAGCACTTCGCCTATTTGCCGACCGGA
+TTGTATGTATTTGCGTATAAAAAGATGTTTATTTGCGGGTTTGTACATTGATTATTTTCTTTGCCGCATTGGTGGCAGTGATATCGGGTGCCAGTTGCCT
+CTATCTGGTACGCAGAGTGATTAATCGTGGTATTGTGGAGAAAGAAGCCATCATTAATAACCATTTTGAACGCGTACTGGATGGCGGGCTTTTCTTTTCG
+GCTGCCGATGTCAAAAACTCTACAGTATGTATAACTCGGCGTTCCTGGACGACCTGACCAAAGCAATGGGCAGAAAATCCTTTGACGAAGATTTAAAAGC
+GCTGCCGGAAAAAGGCGGTTATTTGTGCCTGTTTGACGTCGATAAATTCAAAAACATTAACGACACCTTCGGTCATTTGCTGGGCGATGAAGTGTTGATG
+AAAGTGGTGAAAATCCTTAAATCACAGATCCCGGTAGATAAAGGTAAAGTCTACCGCTTCGGCGGTGACGAATTTGCGGTGATTTATACGGGTGGAACGC
+TGGAAGAGTTGCTATCGATTCTAAAAGAAATCGTTCATTTCCAGGTGGGAAGCATTAATTTAAGTACCAGTATCGGTGTAGCACATTCAAATGAATGTCC
+TACCGTCGAACGCTTGAAAATGCTGGCGGATGAGCGGCTGTATAAGAGTAAGAAAAACGGCAGGGCACAGATTAGCTGGCAGTAATCATTATTCGCAGGC
+CGGACAAATGATTTTGCCCGGCCTGAATTAATTAAACCCGGCTACCCCACAAATCGTACTCATCGGCGTGCTCGACTTTCACACGCAGGATATCACCCGG
+CTTAACGTTGGTTTCACCATTGAGATAAACCGCGCCGTCGATTTCCGGTGCATCTGCCATGCTGCGACCAATCGCGCCTTCTTCGTCCACTTCGTCGATA
+ATCACCAGAATTTCACGGCCCACTTTCTCTTGCAGGCGCTCGGCGGAAATCTGCTGCTGCAGCTGCATGAAACGGTTCCAGCGTTCTTCTTTAACTTCTT
+CCGGAACCTGGTCAGGCAGGGCATTGGCGTCTGCACCTTCAACCGGGCTGTATTTAAAGCAGCCAACGCGATCCAGACGCGCTTCTTTCAGGAAGTCGAG
+TAGCATCTGGAAATCTTCTTCTGTCTCGCCAGGAAGCCGACAATAAAGGTTGAGCGTAGGGTCAGTTCCGGGCAGATTTCGCGCCACTGTTTGATGCGCG
+CCAGTTGGCGATCTACAGAACCCGGACGCTTCATCAGTTTGAGAATGCGCGGGCTGGCGTGCTGCAACGGAATGTCCAGATACGGCAGGATTTTGCCTTC
+TGCCATCAGTGGGATGACGTCGTCCACATGCGGATAAGGGTAAACGTAGTGCAGACGTGTCCAGATCCCCAGTTTCGATAACTGTTCGCACAGGCTGACC
+ATGCTGGTTTTACCGGCTCGCCGTTGTGGAAGCCAGTACGATGTTTAACATCAACGCCATAGGCGGAAGTATCCTGCGAGATCACCAGAATCTCTTTAAC
+GCCCGCATCTACCAGACGTTTCGCTTCACTTAACACTTCGCCAATCGGACGGCTCACCAGGTCGCCGCGCATAGACGGAATAATGCAGAAGGTGCAGCGG
+TGATTACAGCCTTCAGAAATTTTCAGATAGGCATAATGACGCGGCGTCAGTTTCACACCTTGTTCTGGCACCAGGCTCAGGAATGGGTTGTGTTTCGGTT
+TTGGCACGTAGTGATGAACGTGCTCCAGAACCTGCTCATAGCTATGAGGCCCGGTGATTTCCAGCACTTTCGGGTGGACTTCGCGGATCTGATCTTCTTT
+GCCCCAGACAACCGGTCACAATAACCTTGCCGTTTTCATTCAACGCTTCACCAATGGCTTCCAGTGATTCTTGTACCGCGCTGTCAATAAAGCCGCAGGT
+GTTGACGATCACCATGTCCGCATCGTCATAGCTCGGTACCACGTCATAACCTTCAGTGCGGAGTTCGGTGAGAATACGCTCTGAATCAACAAGGTTTTCG
+GACAGCCAAGGAAACAAAGCCGATTTTCGGCTGGGGAGTTACTTTGCTCATAGCTTAAAAATATTCAGTTACAGGAAAGGTCAGGGCAGGGATTCTACAG
+AGTTCTGGATAAAATTTGTATCGCAATCTCATTCGCTGGCGGAGGCGAAGGAAATGTAAATTTTGTTAATTCGGCGTGAAGAATTGATCCTGGACAGCAT
+TTTGCTCAAAAATAGCCATACTATTTAATTGCAACAAGGCTGGGAAGAGGAGGATCGAAGTATGTTCGTTGACAGACAGCGAATCGATCTGCTGAACCGG
+TTGATCGACGCACGCGTTGACCTCGCCGCATACGTGCAACTGAGGAAGGCAAAGGATACATGTCCGTCAGCGAAAGCAATCATCTACGAGATAACTTTTT
+AAACTGAATCGCGAACTGCACGATAAATCGCTGCGGTTGAATCTTCATCTGGATCAGGAAGAGTGGAGTGCTCTTCATCATGCTGAAGAAGCATTAGCGA
+CAGCCGCAGTATGTTTGATGAGTGGGCACCATGATTGCCCGACTGTTATTACCGTCAACGCCGATAAGCTTGAAAATTGTCTGATGAGCTTAACGCTGAG
+TATCCAGAGCCTGCAGAAGCACGCCATGCTTGAGAAGGCCTGAAAACTAAGGGGAGAAAGCGTCTCCCCTTCATGTTTAAGTTTTGTAAAATGAATTTGT
+TATCTCCTCCACTGACTACGCTTTAAGCCAGAGTCAATCCGGAGGCGTTATGCATCGACAATCCTTTTCCTTGTGCCCCTTATTTGTCTTTCTTCCGCTC
+TCTGGGCGGCTCCTGCAACGGTAAATGTCGAAGTACTGCAAGACAAACTCGACCATCCCTGGGCACTGGCCTTTTACCCGATAATCACGGTATGTTAATC
+ACTCTGCGCGGCGGCGAGTTGCGTCACTGGCAAGCAGGAAAAGGATTATCTGCGCCGCTTTCCGGAGTTCCGGACGTTTGGGCGCACGGGCAGGGCGGCC
+TGCTGGACGTGGTTTTAGCGCCTGATTTTGCTCAGTCTCGCCGCATCTGGTTAAGTTATTCCGAAGTTGGCGATGATGGCAAAGCCGGAACTGCTGTGGG
+TTATGGCCGCTTAAGTGATGATCTCTCAAAGTGACCGACTTCCGCACCGTCTTTCGCCAGATGCCAAAACTGTCTACCGGCAACCATTTTGGCGGGCGGC
+TGGTATTCGACGGTAAAGGTTATCTTTTATTGCTCTGGGCGAAAACAATCAGCGCCCGACGGCGCAGGATCTGGATAAATTACAGGGCAAACTGGTGCGT
+CTGACCGACCAGGGCGAAATCCCGGATGATAATCCTTTATAAAGGAATCCGGTGCGCGCGCCGAGATCTGGTCTTATGGCATTCGTAATCCGCAAGGAAT
+GGCGATGAATCCGTGGAGTAATGCACTGTGGCTGAATGAACATGGCCCGCGCGGTGGTGATGAAATTAATATCCCGCAAAAGGCAAAACTACGGCTGGCC
+GCTGGCAACCTGGGGAATCAACTATTCAGGCTTTAAGATACCGGAAGCGAAAGGGAGATCGTCGCCGGGACCGAGCAACCTGTTTTTACTGGAAAGATTC
+GCCCGCTGTGAGCGGCATGGCCTTCTATAACAGCGATAAATTCCCCAGTGGCAGCAAAATTATTTATTGGCGCGCTGAAAGATAAAGATGTCATTGTGAT
+GAGCGTCAACGGCGACAAAGTGACAGAAGATGGCCGTATTTTAACGGACAGAGGGCAGCGAATTCGTGATGTTCGCACTGGACCCGACGGTTATTTATAC
+GTTCTCACCGACGAGTCCAGTGGGGAATTACTTAAAGTTAGCCCACGCAATTAGCTAACGGGAATCATCACCACTTTGCGCACTGCGGGGCGTTCAGTGA
+GTTGCTGATACCAGCGTTGCAGATTTGGACGCGGTGTCCAGGTCAGGCCAACGTTAAACAAATTGTAGATGAACGGTGCGATAGCGATATCGCCCACACC
+AAACTCGTCGCCAGAGAACCATTTTACTTTTGCCAGTTCCGCATCGAGCAGGGCAAACAGGGCGTCGCACTCTTTGCAACTGGCATCAATGGCGGCCTGA
+TCGCGCTCTTCCGGTGGTGTTCTGACTAATCCCATCAGGATCCCGCGATGAGCATTACTGAGCGTCTGGTTTGCCCAGTCCATCCATTTTTCCGCTTCCG
+CACGACGTGCCGGTGAGTCGATCCACAGGCGTTTTTGCCCGTACTGTGCCGCCAGATAGCGGACAATGGCGTTTGATTCCCAAAGAATGAGATCACTTTC
+GTCGTCACGCAACAACGGCACCAGCCCGTTAGGGTTCATCGCCAGAAAATCAGCATCGTGATTTATCCCAAACTCACGGCCCGCGAGAATTTGCTCATAA
+GGTAGTTCCAGTTCTTCGAGCGTCAGCAATACTTTTTACGTTAGTTGAATTATTCCGACCCCACAGCGTAATCATACTCACCCCTTTCCGACAGGCAGCC
+ACAGGCTGAACAGGACTCCGATGGTGAAGTAAAGTTAACTTTTAGCAACAGCTGGCAAAAATGACACCAGAAGCAGCGAAGCGGCAGGATATTGCATAAA
+CTTTAAAAACTTTACCAACTTACGGTTTCTTTAAGTTTGTGTGTGCGTTATTAATCACCAAACTTATCATACGGCGATATAACGTATTTTTTTGAATGGA
+TACTCGGGTGGCATTTATGACGCAATACTCCTCTCTCCTTCGTGGTCTTGCAGCGGGTTCTGCATTTTATTCCTTTTGCCCCAACGGCATTCGCGGCGGA
+ACAAACCGTTGAAGCGCCGAGCGTGGATGCGCGTGCATGGATTTTAATGGATTACGCCAGCGGTAAAGTGCTGGCAGAAGGCAATGCGGATGAGAAACTG
+GATCCCGCGAGCCTGACTAAAATCATGACCAGCTATGTGGTTGGGCAGGCGCTTAAGGCCGATAAGATTAAACTCACCGATATGGTGACGGTCGGTAAAG
+ATGCCTGGGCGACGGAAATCCGGCACTGCGTGGTTCATCGGTAATGTTCCTCAAACCGGGCGATCAGGTTTCGGTGGCAGACTTGAACAAAGGTGTGATT
+ATCCAGTCCGGTAATGACGCCTGTATTGCGCTGGCTGATTACGTTGCCGGGAGCCAGGAGTCATTTATTGGTCTGATGAATGGTTATGCCAAAAACTGGG
+TCTGACCAACACTACCTTCCAGACGGTGCACGGCCTGGATGCGCCGGGGCAGTTCAGCACCGCGCGCGATATGGCATTGCTGGGTAAAGCATTGATCCAC
+GATGTGCCGGAAGAGTACGCCATTCATAAAGAGAAAGAGTTCACCTTCAACAAAATTCGTCAGCCTAACCGTAACCGTCTGCTGTGGAGCAGCAATCTGA
+ATGTTGATGGCATGAAGACAGGAACCACGGCAGGCGCGGGATATAATCTGGTTGCTTCGGCTACCCAGGGCGATATGCGTTTAATCTCCGTAGTGTTGGG
+GGCGAAAACCGACCGTATCCGTTTTAATGAGTCTGAGAAATTATTGACCTGGGGTTTCCGCTTCTTTGAAACCGTGACGCCAATTAAACCTGATGCCACC
+TTTGTGACTCAGCGCGTCTGGTTTGGTGATAAGAGCGAAGTGAATCTCGGGGCAGGTGAAGCGGGCTCAGTGACCATACCGCGTGGGCAGCTGAAAACCT
+GAAAGCGAGTTATACGTTAACGGAACCGCAGCTTACCGCACCGCTGAAAAAGGTCAGGTTGTCGGGACCATTGATTTCCAGCTTAACGGTAAATCCATTG
+AGCAGCGTCCGCTGATCGTGATGGAAAATGTGGAAGAGGGCGGATTCTTTGGTCGGGTGTGGGATTTCGTGATGATGAAATTCCATCAGTGGTTCGGCAG
+CTGGTTCTCTTAATCTTCTGATAACCGGATGGCGCGAAACGTCATCCGGTTATACGTCATTAATACATCAACTTAATGCGCTGCGTCTGCGCGTACTTCA
+CATACTCATCTTCCGGGCAACAATCGCTCACCACAATATCAAAGCGTTTCAGGTCACCCATGCGCGCCGGACGCACCTTGCCAAATTTACTGTGGTCGAC
+AACCAGCACATGCTTTTGCGCCATCGACATGGCCCAGTGTTTTACCGGCAACTCTTCAAGATTAAAACAGGTAGCGCCTTTACTGACATGCACGCCCGCC
+GCAGAATAAAAAGCGATATCCGGGCAAAATTATTCAGCGTTTGCTGAAAATCGATGGGTTTGAAAATGGCGTTGCTGGCGTGAAATTCACCACCGCAAAG
+AAACGCGCGGCAATGGGGTTTCTCTTTCAGCGCCAGAAAGGTATTTAGCGAATAACAAACGGCGGTAAAGGGATTTCATTATCAATCGCTTCAATAATCC
+ACGGCGTGGTGGTGCCACAGTCAAAAAGAGGGTCTGATCGGGTTCTACCAGCGTCGCAGCCAGTTTTGCCGCCCGGCGTTTTTCTTCCACCAGGCGGGAT
+TTTTGATCGCTTAACAGGTAATGGCTGGCACTGCGCGGTTCCAGAACAATATAGCCGCCGAGCAAAACGACGGGCGCACTGTGGTTGTTCAGATCGCGAC
+GAATCGTCATCTCCGAAACCCCAAGCAGGGCGGCGGCGTCTTTAAGATGTAACTTATCGCTGCGTTTTAATTCTTGCAGCAGCTGCCCGATACGCTCTTC
+GCGACGTGTTTCCATAATCCCTCTGAATAGTTATTGAAGCGAGCCGCTCAATACTACACTTTTAGCAGAGATCAGTCACGCACCCAGCCTTTGCGGATCG
+GTAATGCAAAACAGACGCGATACCACGATTGCAGACGTTGATAGAGTTTATGCCCCATCGCTTGCCAGATAATCTGGGCACTAAGGCAGCCAATCATACC
+TGCCAGCAATCCACCGAGCATATCCAGCGGCCAGTGGACGCCAAGATAAACGCGCGACCAGGCAATGACGACGGCCAGCACCATTAAAAGTGAGCCGGAC
+CACAGGCGATGCCAGCATAAAATGCCAGTGCAAAGGTGAAAATCACCGTACCGTGATCGCTTGGGAATGAGTCATCCGCCGCATGATGCAGGAAGTTATA
+GCCGATATTTTCGACAAAGGGTCGGTCGTGCGGAAAAAGATGTCCCATCGTCCAGGACACAAACAGGCTGACCGCCAGCGCGATAGCGATTTTATCACCA
+GTTGCCGTTGTGCTGTAAGCCCCCACAACCAAAGTACCACGGCCAGCAACGGCACCACGGTAATCAAATCTTTAGCAATAAAAATCGCCAACGAGATCAT
+CCACGGAGCCGAGTCTGGCGTCGCGTTAATAAGAGAGAATAGAGAGATTCAAATTTTCCAGCATAACTTCCCGACGCAAAGTGATTAAAAGGAGCCAATA
+CAGGCAAGTCGTTGAGAATAAAGTGCAGGTTAAACTGGGTAAAGCGGCATCGTCTTATTTCCCTCAAGCGGCCTGTTTACGGTGGGTGATTGTAACGGGC
+ATAGGTTAAATAAAACTTAAAGAAAGCGTAGCTATACTCGTAATAATGTAAGAATGTGCTTAACCGTGGTTTCAGCTACAAAATTCGCTTTCTCGTTAGC
+TGCGCTTTTATTAAACTCTGCGCGATTATTATTGGCGAAGAAATTGCATGCAAAATAAATTAGCTTCCGGTGCCAGGCTTGGACGTCAGGCGTTACTTTT
+CCCTCTCTGTCTGGTGCTTTACGAATTTTCAACCTATATCGGCAACGATATGATTCAACCCGGTATGTTGGCCGTGGTGGAACAATATCAGGCGGGCATT
+GATTGGGTTCCTACTTCGATGACCGCGTATCTGGCGGGCGGGATGTTTTACAATGGCTGCTGGGGCCGCTGTCGGATCGTATTGGTCGCCGTCCGGTGAT
+GCTGGCGGGAGTGGTGTGGTTTATCGTCACCTGTCTGGCAATATTGCTGGCGCAAAACATTGAACAATTCACCCTGTTGCGCTTCTTGCAGGGCATAAGC
+CTCTGTTTCATTGGCGCTGTGGGATACGCCGCAATTCAGGAATCCTTCGAAGAGGCGGTTTGTATCAAGATCACCGCGCTGATGGCGAACGTGGCGCTGA
+TTGCTCCGCTACTTGGTCCGCTGGTGGGCGCGGCGTGGATCCATGTGCTGCCCTGGGAGGGATGTTTGTTTTGTTTGCCGCATTGGCAGCGATCTCCTTT
+TCGGTCTGCAACGAGCCATGCCTGAAACCGCCACGCGTATAGGCGAGAAACTGTCACTGAAAGAACTCGGTCGTGACTATAAGCTGGTGCTGAAGAACGG
+CCGCTTTGTGGCGGGGCGCTGGCGCTGGGATTCGTTAGTCTGCCGTTGCTGGCGTGGATCGCCCAGTCGCCGATTATCATCATTACCGGCGAGCAGTTGA
+GCAGCTATGAATATGGCTTGCTGCAAGTGCCTATTTTCGGGGCGTTAATTGCGGGTAACTTGCTGTTAGCGCGTCTGACCTCGCGCCGCACCGTACGTTC
+GCTGATTATTATGGGCGGCTGGCCGATTATGATTGGTCTATTGGTCGCTGCTGCGGCAACGGTTATCTCATCGCACGCGTATTTATGGATGACTGCCGGG
+TTAAGTATTTATGCTTTCGGTATTGGTCTGGCGAATGCGGGACTGGTGCGATTAACCCTGTTTGCCAGCGATATGAGTAAAGGTACGGTTTCTGCCGCGA
+TGGGAATGCTGCAAATGCTGATCTTTACCGTTGGTATTGAAATCAGCAAACATGCCTGGCTGAACGGGGCAACGGACTGTTTAATCTCTTCAACCTTGTC
+AACGGAATTTTGTGGCTGTCGCTGATGGTTATCTTTTAAAAGATAAACAGATGGGAAATTCTCACGAAGGGTAAAAAATGCCTGACTGCTTTGTGCGATC
+AGGCATTCTCGAATTAATGGTGATGGTCGTCAATCTGGTGTTCGATAACCATCCCTTCACCTACGCTGGCAAGATGGCGAACATAAGGATGCGGGCGGTA
+AGCCGGAGCTGGCGCAGGAGCCACATAGACGGTTTGCGGCACAGTCGCGACGCTGACCGCTTGTGGAACGCTGACTGAATCAGGAACCACAACCACTTTG
+TATCCACTCGGCACATCGACGGTGACACTTTGCGCCATCGCCACACCAGTAAAGCCCATTAAAAGCGCGCCCAACAGTAGACAATTTTTCATAATCATTT
+CGCCTGAAATAATGCAGCGGGTTAATTTCCGCGAATTATGCAGCCTTCATTCAGGCATTGTGTTGCCGGGCGTGCTGCCGGTTTTATTGGTCAAATGGCG
+CTTCGTGTTTAAGAACTTTATCGATCACATCCAGTACGCCTTCACGGTTATTGGAGCCTGCGCGGTATTTTGCCGCTGCGACGACCGCGCTACCGGCATT
+TTCCATTGCAAAACTAAAGCCTGCCTGACGCAGCATCTCAATATCGTTACCGCCATCGCCAAAGACCACCACTTCGCTGTCGTCTATTCCCCATAATTTC
+TGCAGTTGGCGAAGGCCATTGGCTTTATGTACGCCGGGGATAATCAGATCGATGCTGCCGTTGCCGGTGTGGACCGACACCATAATATCGCCGATGGCCT
+CATGTAATGCTTTTTGTACTTGTGGAATCAGTTCATCGGAAAGATTCAGGCCAAACTTAAAGAAGATATCCTCTAAGTTGTCAAAGTTATCGACGTATTC
+CAGACGGTGATAATACATTTCCGCCACCGTTTTCATGGCATCGTCATATTTTTGAGTGTATAGGCACTATTTTTCCGCAGGCAATAATTTCCACTTCCGG
+GCGCGTCAGCAAATGTTCCACGACAGTAGCAAACGCATCCTTCGATAGCTCGCCATTAAAAACATCTTTGCCTTCGCTCACTACCCAGCCGCCGTTTTCA
+GCCACAAAGGCAATTTCATTAGCAATTTCAGGGAAGAAAGAGATCAACTGATAATATTGATTCCCGCTGGCGACTACAAAGCGAATTCCTTGTGCTTTCA
+TTTGCTGATACTGAGCCATAAACCGCTCACGGTTATAGGTTTTGATCGCTTAAGAAAGTACCATCCATGTCTACCGCAATTAATTTAATGCTCATCAACT
+ATTCTCCATCGCCGTCTGCGTTTTGGTATCGGGTTTGGCGACGGCTTTCGCGACAATAGCCGCGAGAATAACCAGCGCCAGTACAACCAGCATTGCACTA
+CGTAATCCATAATGTTCGCCGAGATAGCCCAGCAGCGGCGGCCCGACGAGGAAAGCCAGATAACCGGTCGTTGCTACCACACTGACGCGGGTTGGTGCAT
+CGGGGCCGGTATCGCTGGCGGCAGAAATGGTCAGCGGGAAGCCCAGCGAGGCACCCAGTCCCCAGAGTACAACAGACACCCCAGCGACCCAGGCGCTATC
+GACAAAATAATCAGCCCAATACCCAACGCCCCCATTAGTGCACTGGCCCGAACCACGGCAACGCGACTGTAACGGTCGATGAACCAACCGCCGGTGAAGC
+GTCCAACGGTCATCCCCAGGGTAAAACCGGCATAAATCAGCGAGCCGGAAGTAGGGCTAAAACCGTGACCGTCAACCATTAATAAGGGTAACCAGTCGTT
+GGCAGAACCTTCGGCAAAGGCCATCGCCAGCACCACAACACCTATCAGCAGCAACTGGATATCGCGATAAAAGGTACGCCTTTTTCGCCATGCTGGGTGC
+CATCGGCAGCATTTTGCCCGTACCGTCAGGGATTGCCTGAATGGCGATATAAATAGGTGCGATACCTACCAGCGCCGCCAATAAAATGTGCACCGTTGCC
+GGAACGCCAAAGGCCGTCAGTGCCATCCCGACACCTGCGCCTGCCAGCGTGCCCAGGCTATAAAACCGTGCATCATCGGCAAAACCGTCTTATTCATTTC
+TCGCTCAACGGCAGCACCTTCAACGTTTATCGCCACTTCCGCAGAACCAAAACTTGCCCCAAAGACGCCGAGACCAACGGCAAAGAGCAGGGGCGATGTC
+AGCCAGAGTGCCAGACTTAATATCATCATCCCGATCAATGCGCAGGACATCGTGACCAGGATGACATTACGTGTCCCAAAGCGTTTCACTAACCACGCCG
+AGCAGAGAATACCGCTCATCGAACCGATCGACAGACCAAAGAGAACACCGCCCATTTCAGCGATCGAGACAGAGAGAATATCGCGGATAGCAGGCGTACG
+GGTTGCCCAGGACGCCATTAACAGGCCTGGCAAAAGAAGAACATAAACAGCGCCCAGGTTCGGCGTTTCAATGCATTACGTGAAGAATTTACGGTCATAG
+ATCACGTCAAAATAAGAAGAGGGAAGACAACATTAGCAAGGTTGTGTACATTTGTACACAATTGCAGAGAGGAAATGACATGCGTCGCGCTAACGATCCG
+CAACGGCGAGAAAAATTATCCAGGCCACGCTGGAGGCGGTGAAACTTTACGGAATACATGCTGTTACGCACCGCAAAATTGCTACCCTTGCCGGGGTACC
+GTTGGGATCGATGACCTACTATTTTTCAGGAATTGATGAGTTGTTACTGGAGGCGTTCAGCAGTTTTACTGAGATCATGTCCCGGCAATATCAGGCATTT
+TTAGCGATGTTAGTGATGCTCCGGGCGCATGCCAGGCTATCACCGATATGATCTACAGCTCACAGGTTGCAACGCCGGATAACATGGAGCTGATGTACCA
+GCTCTACGCGCTGGCTAGCCGAAAACCGCTATTAAAAACGGTAATGCAAAACTGGATGCAGCGCAGTCAGCAAACGCTCGAACAATGGTTTGAACCCGGA
+ACCGCCCGCGCGCTTGATGCGTTTATTGAGGGATGACGCTGCATTTTGTCACCGACCGTAAGCGCTATCGCGCGAGGAGATTTTGAGGATGGTTGAGAGG
+GTTGCAGGGTAGTAGATAAGTTTTAGATAACAAAACCCATCAACCTTGAACCGAAATGGCGGGGTTGATGGGCTCCACAAAATGGGGACATCAAAGAAAA
+GCAGTGGCACTAATTAAGACTGATGCCCTGCGGAAAAGTTCTGCGGTTGTGCAAAAATTTCATTTTCAGGGCAACTTCAGTTTTATCCTAATCCTGGCCA
+TACCATGACGATGATTGTCCCTGCCAGCGTCAGCAGGACGTTGGCGATTGCATAGGTGCCCGCATAGCCCAGCGCCGGGATGTTACTGCGAGCTGTATCA
+CTGATGATCTCCATTGCCGGCGCGCAGGTACGTGCGCCCATCATTGCGCCGAACAACAGCGCGCGGTTCATTCGCAATACATAAGCACCGAACAAGAAAC
+AGATAACCACGGGCACCAGACTGACAATCAATCCGGCAATCAACATCTGACCGCCAATCGCGCCCAGGCCGTTATTAATACCGCTACCGGCGCTCAGACC
+AACGCCTGCCATAAACACCATCAAGCCGAACTCTTTCACCATGCTTAATGCACCCTGCGGAATGTAACCGAAGGTCGGGTGGTTAGCACGCATAAAGCCC
+AGCATAATTCCGGCGAATAACAACCCGGCAGCGTTCCCCATGCCGAAACTGAATGTGCTGAACTGGAAGGTGATCATCCCGATCATCAGCCCAATAACAA
+AGAAGGCGCAGAATGCCAGCAGGTCAGTGACCTGGCTGTGAATCGAGATAAAGCCGATGCGATCGGCGATGGTTTTACGCGGCGGGCATCGCCGCTGACT
+TGTAAAACGTCACCTTTGTTAAGCACGACGTTGTCATCTATCGGCATCTCAATCTGGCTACGAATGACGCGGTTAAGGAAGCAACCGTGATCGGTCAACT
+TCAGTTGTGCGAGACGTTTACCTACAGCGTTATGGTTTTAACGACCACTTCTTCAGTGACGATACGCATGTCGAGAAGGTCACGATCGAAAACTTCTTTA
+CCGTTACGGAAGCTGGGATCGAGTCGGGCATGGGCGTCGGGATAGCCTACCAACGCTATTTCATCGCCCATTTGTAGCACGGCATCACCGTCTGGATTTG
+CCAGAATCCCGTTACGTCGAATACGTTCAATGTAGCAGCCGGTTTGTCGATAAATACCCAGTTCACGCAGATTTTGCCGTCGGTCCAGGCCACCAGTTCC
+GGGCCGACGCGATAGGCGCGGATCACCGGTAAATAAACCTTACGGTTGGCATCAGTGTCCAGGCCACGTTCGCGGGCGATTTGCTGGGCGCTGGTCTGTA
+AGTCCTGATGCTGCAATTTCGGCAAGTAACGCGCACCAACAATCAAACTCACCAGACCGATTAAATAGGTTAAGGCATACCCGAGGCTCAGATTATCCAG
+TGCCAGTGAGAGCTGCCTGCTTTCCATGCCGGAATGACGCAGTGTATCGCCAGCACCGACCAGAACCGGTGTCGACGTCATAGAGCCTGCTAACATACCG
+GCCGTCAGGCCAATATCCCAGCCAAACAGCTTACCTAACCCTAAGGCGATCACCAGCGCACTGCCAACCATCACCAGTGCTAACATTAGGTAATTTTTCC
+CATCGCGAAAAAAATGGAAAAAGTTCGGTCCGGCTTCGACCCCGACGCAGAAAATAAACAGCATAAAGCCAAGATTAAGCGCATCGGTGTTAATGCTGAA
+ATGTTGTTGGCCTAATAACAGCGATACGACTAAAACGCCAATGGAATTACCCAGTTGGATCGAACCAAGTCGTAACTTTCCGAGACATAGCCCAAGCGCG
+AGGACCACAAATAATAACAGAATGTAATTCCCATTTAACAATTCGGCGACGTTTATATTCACGGAGGCTAACTTCTTGTTTACTAGTAAGCTGTTGAAAG
+AAATGGTAATTTACGATAATGTTTTTACCAGAATTCAGGGCGCAGATTCATTCAGCGCACCTAAACGATAGTAAAGTAACAATATATTTTACTAGTGTAA
+TCACATTAGGTATCAACGGCTATATGAATTGCGTTGGCCTATATTAGCATGGAATGCGAAGCGGCTTTATCTTACTGAACGCCACACTGGCGAAAAATGT
+GTTCGATAGACGCAGTGTCAGGAGGAACGAGTGAAACATAAACAACGTTGGGCGGGGCAATCTGCTGTTTTGTCCTCTTCATTGTGGTGTGCCTTTTCTG
+GCGACGCACATGAAAGGCGCTTTTCGGGCTGCCGGGCATCCTGAAATCGGCTTGCTATTTTTCATTCTTCCTGGAGCAGTCGCCAGCTTCTTTTCAGCGT
+AGAGAAGTCCTGAAACCTCTGTTTGGCGCAATGCTGGCGGCACCCTGTTCGATGCTCATTATGCGGCTGTTTTTTCACCGACGCGCTCATTCTGGCAAGA
+GCTGGCATGGTTACTAAGCGCGGTGTTCTGGTGTGCGCTGGGGCACTGTGTTTCTTATTTATCAGTAGTTTGTTTAAACCACAGCACAGAAAAATCAGTA
+AAGCCCTCAACGCGAGGGCTTGTCAGACGATCAGGCGTCCAGATTTTCTTTCACCCATGCAGCAAAATCGGTATAGCCGCCGATATGTTGCTGATCGACA
+AAAATCTGCGGCACGGTTTCTACGGGTTTACCTGCCTTTGTTGTAGATCTTCTTTAGTGATCCCTTCCGCACGAATATCTACATACTGATACTGAAAATC
+ATCGCGTTCATTGCTCAATTTCTCAGCCAGATCTTTTGCACGCACACAGTAAGGGCAACCCGAACGACCAAAAATAACGGTTTGCATTATTTCTCTCCTC
+ATAGATTTATGCCTGTAATGATCACGCTAAAATGTATTCGCTGAAAGTAGGTTTAACCTGTTGCATTAATTGCTAAAAGCTATAACTGTTAAACACAATA
+CAGTGAAAAGTTTTAGACTGAAGGCTCACTTTGCAGAGGGAAGCGTATGCGCGCGATCGGTAAATTGCCTAAAGGCGTGTTGATACTGGAATTTATCGGA
+ATGATGCTACTGGCGGTGGCGCTGCTGTCGGTAAGCGACTCCCTGTCGCTGCCTGAGCCATTTTCTCGGCCAGAAGTGCAGATTCTGATGATTTTTCTCG
+GTGTTTTGCTCATGCTTCCCGCTGCGGTGGTGGTTATTCTTCAGGTGGCAAAACGTCTTGCCCCACAGCTGATGAACCGTCCACCGCAATATTCACGTTC
+AGAAAGAGAAAAGATAATGACGCCAACCATTGAACTTATTTGTGGCCATCGCTCCATTCGCCATTTCACTGATGAACCCATTTCCGAAGCGCAGCGTGAG
+GCGATTATTAACAGCCCGTGCGACGTCCAGTTCCAGTTTTTGCAGTGCAGTAGCATTATTCGCATTACCGACAAAGCGTTACGTGAAGAACTGGTGACGC
+TGACCGGCGGGCAAAACACGTAGCGCAAGCGGCGGAGTTCTGGGTGTTCTGTGCCGACTTTAACCGCCATTTACAGATCTGTCCGGATGCTCAGCTCGGC
+CTGGCGGAACAACTGTTGCTCGGTGTCGTTGATACGGCAATGATGGCGCAGAATGCATTAATCGCAGCGGAATCGCTGGGATTGGGCGGGGTATATATCG
+GCGGCCTGCGCAATAATATTGAAGCGGTGACGAAACTGCTTAAATTACCGCAGCATGTTCTGCCGCTGTTTGGGCTGTGCCTTGGCTGGCCTGCGGATAA
+TCCGGATCTTAAGCCGCGTTTACCGGCCTCCATTTTGGTGCATGAAAACAGCTATCAACCGCTGGATAAAGGCGCACTGGCGCAGTATGACGAGCAACTG
+GCGGAATATTACCTCACCCGTGGCAGCAATAATCGCCGGGATACCTGGAGCGATCATATCCGCCGAACAATCATTAAAGAAAGCCGCCCATTTATTCTGG
+ATTATTTGCACAAACAGGGTTGGGCGACGCGCTAAAACCGCCACGTCGATGTATGATACGCGGGCTTTGACCAGGTCTGACAGAGAGGTGCAGGGTGAAA
+ATTGCCATATTGTCCCGGGATGGAACGCTCTATTCGTGTAAGCGGCTGCGTGAAGCCGCTATACAGCGCGGTCACCTGGTTGAAATTCTTGATCCGCTTT
+CTTGCTACATGAACATAAATCCTGCGGCGTCTTCTATTCACTACAAAGGCCGCAAGTTACCCCATTTTGACGCAGTGATCCCGCGTATTGGCACCGCCAT
+TACCTTTATGGGACGGCGGCACTGCGCCAGTTCGAGATGCTGGGGAGCTATCCGCTCAATGAGTCGGTCGCCATTGCCCGGGCGCGTGACAAATTGCGTT
+CCATGCAACTGCTGGCGCGTCAGGGCATCGACCTGCCTGTCACGGGCATTGCGCATTCGCCGGATGATACCAGCGATTTAATCGACATGGTCGGTGGTGC
+GCCGCTGGTGGTCAAGTTGGTTGAAGGCACGCAGGAATTGGCGTCGTGCTGGCGGAGACGCGTCAGGCGGCGGAAAGCGTGATTGACGCTTTCCGCGGTC
+TGAACGCGCATATTCTGGTGCAGGAATATATCAAAGAGGCGCAAGGGTGCGATATCCGCTGTCTGGTTGTTGGCGATGAAGTGGTCGCTGCGATTGAACG
+GCGGGCGAAAGAGGGCGATTTTCGTTCCAATTTGCATCGTGGCGGCGCGGCAAGCGTCGCCAGTATCACACCACAGGAGCGTGAAATCGCGATAAAAGCC
+GCGCGAACGATGGCGCTGGACGTTGCTGGTGTGGATATTCTGCGTGCTAATCGCGGGCCGTTGGTGATGGAGGTGAATGCGTCGCCGGGGCTGGAAGGAA
+TAGAAAACCACCGGTATCGACATCGCGGGTAAAATGATCCGCTGGATCGAACGCCACGCTACGACAGAATATTGCCTGAAAACGGGTGGTTAGTCGCAAT
+CACATTACTGATCATGGTTTTGCCTGCGCTTTTGCGTAAGCTGTGCCGGTCTTTTATCGAAAGAGGTTGTACAAAATTATGACATCGCTGGTCGTTCCTG
+GTCTGGATACGCTGCGTCAATGGCTCGATGACCTGGGGATGAGTTTTTGAATGTGATAACTGTCAGGCTCTGCATCTGCCCCATATGCAGAATTTCGACG
+GTGTCTTTGATGCCAAAATCGATCTGATCGATAACACGATCCTGTTTTCTGCCATGGCGGAAGTCCGACCTTCAGCCGTATTGCCGCTGGCGGCGGATTT
+ATCTGCCATCAATGCCAGTTCGCTGACCGTGAAAGCATTTCTTGATATGCAGGATGATAATCTGCCAAAGCTGGTGGTTTGCCAGTCTTTATCCGTTATG
+CAGGGCGTAACCTATGAGCAGTTTGCATGGTTCGTGCGTCAGAGCGAAGAGCAGATTTCGATGGTCATTCTTGAAGCTAATGCCCATCAACTGCTGTTAC
+CGACTGATGATGAAGGGCAAAACAACGTTACCGAAAACTATTTCCTCCACTGATAACTCCTTTCGAGCACGCAGTCGCTGGTGCAGCGGCTGCGCGCTGC
+AAAATTATCTGCTGTTTTAACCTTTTCTTAAAGATTATTTCACTTCTCTTGTGTCGATTTGGCTTTATCACATAGAGCAAATATGCATAAAAATTTGTTA
+AATACCGTTTTTAATCCGAGCTATAGTCTCAAACCCTGGCTAAAGTTATTCTTGCGATGCTTTTATATAGCGAGCAGTGCTGGCCGGGAGAAAGTTCTCT
+TTTCTTACACCGCGCCGATAAAAATATGCACGTTTATTGCATATCTTTCAGTGTGACAACTTTTGTTCGTTTGTTAACGAACTTTCAGAAGGAAAGAGAT
+ATGACCGCCTTAAATAAAAAATGGCTATCGGGTCTGGTTGCGGGTGCTCTGATGGCCGTCTCTGTCGGCACGCTCGCGGCTGAACAAAAACACTCCACAT
+TTATAACTGGTCTGATTATATCGCCCCGGACACGGTGGCCAATTTTGAAAAGAAACCGGTATTAAAGTCGTCTACGATGTTTTCGACTCTAACGAAGTAC
+TGGAAGGCAAATTAATGGCCGGGAGTACCGGCTTTGATCTGGTGGTTCCATCTGCCAGCTTTCTGGAGCGCCAGTTGACTGCGGGAGTTTTCCAGCCGCT
+GGACAAAAGCAAATTGCCGGAGTGGAAGAATCTCGACCCGAACTGCTGAAGCTGGTCGCCAAACACGATCCCGACAATAAATTTGCTATGCCCTATATGT
+GGGCGACGACCGGGATTGGCTATAACGTTGATAAAGTTAAAGCGGTGCTGGGCGAAAACGCGCCCGTCGATAGCTGGGACTTGATCCTCAAACCTGAAAA
+TCTGGAAAAACTGAAAAGCTGCGGTGTCTCTTTCCTGGATGCGCCAGAAGAAGTTTTGCTACCGTGTTGAATTATCTCGGCAAAGATCCCAACAGCACTA
+AAGCGGATGATTACACCGGACCGGCAACAGATCTGCTGTTAAAGCTGCGCCCGAACATTCGTTATTTCCATTCATCTCAATACATTAACGACCTGGCAAA
+CGGCGATATTTGCGTCGCTATCGGCTGGGCAGGTGATGTCTGGCAGGCGTCAAACCGCGCGAAGGAAGCGAAGAATGGCGTGAATGTCTCGTTCTCGATT
+CCAAAAGAAGGGGCGATGGCGTTCTTTGATGTATTCGCCATGCCTGCGGATGCCAAAACAAAGACGAAGCCTATCAGTTCCTGAATTACCTGCTGCGCCC
+GGATGTAGTAGCGCATATTTCCGACCATGTGTTCTATGCCAACGCCAATAAAGCAGCCACGCCGCTGGTGAGTGCGGAAGTCCGTGAGAACCCAGGTATT
+TATCCGCCTGCGGATGTTCGTGCGAAGCTGTTCACTCTGAAAGTGCAGGATCCGAAAATCGACCGTGTGCACCCGCGCGTGGACCAAAGTGAAGAGCGGA
+AAATAATCCGCAGTCGTAGATGCCGGAGGGCGCACCACACCCGCCGGCAATTCGCACCATTATGGTGCGCTTGCACACATTCAATGCCGGAGAGCAGCCG
+TGAATGACGCTATCCCTCGCCCGCAGGCGAAAACCCGTAAGGCGCTGACGCCGCTATTAGAAATCCGCAACCTGACCAAATCCTACGATGGTCAACATGC
+GGTGGATGATGTCAGCCTGACCATCTACAAAGGTGAAATCTTCGCGCTGCTGGGCGCATCCGGCTGTGGCAAGTCCACGCTGCTGCGTATGCTGGCAGGT
+TTCGAACAACCTTCTGCCGGACAGATAATGCTTGATGGCGTCGATTTGTCACAGGTTCCGCCTTACCTGCGCCCCATCAATATGATGTTTCAGTCTTACG
+CGCTGTTTCCGCATATGACCGTGGAACAGAACATCGCTTTTGGCCTGAAACAGGACAAACTACCGAAAGCGGAAATTGCCAGCCGGGTCAATGAGATGCT
+CGGCCTGGTGCATATGCAGGAGTTCGCCAAACGCAAACCGCATCAGCTTTCCGGTGGTCAGCGACAACGTGTGGCCCTGGCCCGAAGCCTTGCGAAGCGC
+CCGAAACTATTACTGCTCGATGAGCCGATGGGCGCGTTGGATAAAAAGCTGCGTGACAGGATGCAGCTTGAAGTGGTGGATATTCTGGAGCGCGTCGGTG
+TGACTTGTGTGATGGTCACCCACGATCAGGAAGAGGCGATGACCATGGCGGGGCGCATCGCCATTATGAATCGTGGGAAATTTGTCCAGATTGGCGAACC
+GGAAGAGATCTACGAGCATCCGACTACCCGCTATAGCGCCGAATTTATTGGCTCGGTAAACGTCTTTGAAGGCGTACTCAAAGAGCGTCAGGAAGATGGC
+CTGGTGCTTGATTCGCCGGGGCTGGTGCATCCACTGAAAGTCGACGCGGATGCCTCGGTGGTCGATAACGTGCCGGTACATGTGGCGCTGCGCCCGGAAA
+AATCATGCTTTGCGAAGAGCCGCCCGCCAATGGTTGTAACTTCGCGGTGGGGAGGTGATACATTGCCTATCTCGGCGATCTTTCGGTGTATCACGTTCGT
+CTGAAAAGTGGGCAGATGATTAGCGCCCAGCTACAAAACGCCCATCGTCATCGTAAAGGGTTACCGACCTGGGGCGACGAAGTGCGTTTGTGCTGGGAAG
+TGGACAGCTGTGTGGTGCTGACGGTTTAAGGAGCAAAGATGAGTACACTTGAACCTGCTGCCCAGTCGAAACCGCCGGGCGGATTTAAGCTGTGGTTGTC
+GCAGCTGCAAATGAAGCATGGGCGCAAACTGGTCATTGCGTTGCCATATATCTGGTTGATCTTGCTGTTTCTGCTGCCATTTCTGATTGTCTTTAAAATA
+AGCCTGGCGGAGATGGCGCGCGCTATTCCACCTTATACCGAACTGATGGAGTGGGCTGACGGGCAACTGTCCATCACTCTTAATCTCGGTAATTTTCTGC
+AACTGACCGACGATCCGCTCTATTTCGATGCTTATCTCCAGTCGCTACAGGTGGCTGCGATTTCGACATTTTGCTGTTTACTGATCGGCTATCCGCTGGC
+GTGGGCGGTGGCGCACAGTAAGCCTTCGACCCGTAATATTTTATTACTACTGGTGATCCTGCCGTCGTGGACCTCGTTTCTGATCCGCGTTTATGCCTGG
+ATGGGAATATTAAAAACAACGGTGTGCTGAATAATTTTCTGCTGTGGCTGGGGTTATCGATCAACCGCTGACCATTCTGCATACCAATCTGGCCGTTTAT
+ATCGGCATTGTTTACGCTTACGTGCCGTTTATGGTACTGCCGATTTATACCGCGTTGATTCGTATTGATTATTCGCTGGTGGAAGCAGCGCTGGATCTCG
+GTGCACGACCGCTGAAAACGTTCTTTACTGTGATCGTGCCGCTGACTAAAGGTGGGATTATTGCCGGATCGATGCTGGTGTTTATCCCGGCTGTGGGCGA
+GTTTGTGATCCCGGAACTGCTCGGTGGCCCGGACAGCATCATGATCGGGCGCGTGCTATGGCAAGAGTTTTTCAATAACCGCGACTGGCCGGTGGCCTCG
+GCGGTAGCGATCATCATGTTGCTGCTGCTAATTGTGCCGATAATGTGGTTCCACAAACACCAGCAAAAAGCGTGGGAGAACACGGATGAATAATTTACCG
+GTAGTTCGTTCGCCCTGGCGGATTGTGATTTTGCTGCTGGGCTTTACCTTTCTCTACGCGCCAATGCTGATGCTGGTTATCTATTCGTTTAACAGCTCGA
+AGCTGGTGACGGTGTGGGCCGGCTGGTCAACGCGCTGGTATGGTGAGTTATTGCGCGATGACGCGATGATGAGTGCGGTTGGTTTAAGTCTGACAATTGC
+GGCCTGTGCGGCGACGGCGGCGGCGATCCTCGGAACTATTGCGGCGGTGGTGCTGGTGCGCTTTGGCAGGTTTCGCGGATCAAATGGCTTTGCCTTTATG
+ATCACCGCGCCGCTGGTAATGCCAGATGTCATCACGGGCTTGTCGCTGTTGTTATTATTCGTCGCGCTTGCTCATGCCATTGGCTGGCCTGCGGACCGCG
+GTATGCTCACCATCTGGCTGGCGCATGTCACTTTTTGTACGGCTTATGTGGCGGTCGTTATTTCTTCAAGATTGCGGGAACTGGATCGCTCGATAGAAGA
+AGCAGCGATGGATCTCGGTGCGACGCCGCTGAAAGTGTTTTTCGTCATTACGCTACCGATGATCATGCCCGCGATCATTTCTGGCTGGTTACTGGCTTTT
+ACTTTGTCGCTTGATGATCTGGTGATCGCCAGCTTTGTTTCCGGGCCGGAGCCACCACGTTACCGATGCTGGTCTTTTCCAGCGTGCGGATGGGGGTGAA
+TCCGGAAATCAACGCCCTGGCAACATTGATCCTCGGCGCGGTCGGAATTGTCGGATTTATCGCCTGGTATCTGATGGCTCGCGCAGAAAAACAGCGGATA
+CGCGACATCCAGCGTGCAAGACGTGGCTGAAGACACTAAAATTTGCCAACCTGGCTACATAATGCCGCGCATGTCGCGGCATTGTTTTCATGGAAGACGA
+AACGTTGGGATTTTTAAGAAAACATCTTCATCTCATGCTCGCCTGAATGTGCCTGCGCTGGTGCAGGTGGCGGCGCTCGCCATTATTATGATCCGTGGCC
+TCGACGTGCTGATGATTTTCAATACGCTGGGCGTGCGCGGTATTGGCGAGTTCATTCATCGCAGCGTACAAACCTGGAGTTTAACGCTGGTCTTTTAAGC
+AGTCTGGTGCTGGTTTTCATTGAGATCTGGTGTGCGTTTTCACTGGTGAAAGGGCGTCGCTGGGCGCGCTGGCTATATCTGCTGACACAAATCACCGCCG
+CAAGTTACTTGTGGGCGGCTTCGCTGGGTACGGTTATCCGGAGCTGTTCAGCATTCCCGGTGAATCAAAACGTGAAATCTTCCATAGCCTGATGCTGCAG
+AAGCTGCCGGATATGCTCATCCTGATGCTGCTGTTCGTTCCCTCGACCAGTCGGCGGTTCTTCCAGTTGCAATAATGTGTATAATCGTCGCCCCTGATGA
+TGTGAAGGTCAATGTATGCAGTGCGCACTTTACGACGCGGGTCGCTGTCGTTCCTGTCAGTGGATAATGCAGCCGATTCCAGAGCAACTCTCCGCTAAAA
+CCGCCGATCTTAAAAATCTGCTCGCCGACTTTCCGGTTGAGGAATGGTGCGCGCCGGTGTCAGGCCCGGAACAAGGGTTTCGTAATAAAGCCAAAATGGT
+GGTGAGTGGTAGCGTTGAAAACCACTGCTCGGTATGCTGCATCGCGATGGCACACCAGAAGACCTTTGTGACTGCCCGCTTTATCCTGCCTCATTTGCGC
+CCGTTTTGCGGCGCTAAAACCGTTTATCGCCCGAGCGGGGTTAACGCCCTACAACGTGGCGCGTAAGCGTGGCGAACTGAAATACATTCTGCTGACTGAA
+AGCCAGAGTGATGGAGGCATGATGCTGCGCTTTGTACTGCGTTCTGATACCAAGCTGGCGCAACTGCGTAAGGCGCTGCCGTGGTTACACGAACAACTAC
+CGCAGCTGAAAGTTATTACCGTCAATATTCAGCCGGTACATATGGCGATTATGGAAGGGGAGACGGAGATCTACCTGACCGAACAACAGGCACTGGCGGA
+GCGTTTTAATGACGTACCGCTGTGGATCCGTCCGCAAAGTTTCTTCCAGACTAATCCGGCGGTCGCCAGCCAGTTGTACGCCACCGCGCGCGACTGGGTA
+CGACAGCTGCCGGTTAAACATATGTGGGATCTGTTCTGCGGTGTGGGGGCTTTGGTTTACACTGCGCGACGCCTGACATGCAGTTAACCGGGATCGAAAT
+TGCATCAGAGGCCATTGCCTGTGCAAAGCAGTCAGCCGCTGAACTGGGCTTAACGCGTTTGCAATTTCAGGCGCTGGACTCCACTCAGTTTGCCACCGCT
+CAGGGGATGTGCCGGAGCTGGTGCTGGTTAACCCGCCGCGCCGCGGCATTGGTAAACCGCTGTGTGATTATCTCTCAACGATGGCACCGCGTTTTATCAT
+CTACTCCAGCTGTAACGCCCAAACTATGGCGAAAGATATCCGCGAACTGCCTGGGTTTCGTATTGAACGGGTGCAGCTTTTCGATATGTTCCCGCATACC
+GCGCACTATGAAGTGCTGACGCTGCTGGTGAAGCAATAAAAAGCCGCATGTGCGGCTTCAGATTGCTGACAAAGTGCGCGTTGTTTATGCCGGATGCGGC
+GTAAACGCCTTATCCGGCCTACAAAAGCGTGCAAATTCAATACATTGCATGGGCCATGTAGGCCTGATAAGCGTAGCGCATCAGGCAATTTTACCTTTGT
+CATCAGTCTCAAGCCGCGGTTGCGGCTTTCTGAATCTTACTGTGGGAACCACTGGTCACTGATTTTTGATAAGTACCGTCAGCTTTAATTGCTGCCAGCG
+CGTTATTCAGTTTTTCCAGCAGGGCTTTGTTATCCGGACGTACAGCGATGCCCAGGCCGGTGCCAAAATATTGCGGATCGGTCACTTTCTCAGTAGCAAC
+ACCAAGTTGTGGATTGGTTTTCAGCCATTCGTTTACCACCGCTGTGTCACCAAATACCCCATCAATACGACCATTTTTCAGATCGATAAAGGCATTCTGA
+TAACTGTCATAAGAGACAGTTTTCACTTCCGGGTGCTGATCCTGAATATATTTCTGGTGCGTAGTACCGTTTTCCATCCCAATACGTTTGCCTTTCAGAT
+CGGCAAACGTTTTGTAGGTATCTTTTGGCAATCACGACGGCTGAGTTTTCATAGTAGGGCGTGGTAAACGATACCTGTTTGCTACGCTCCGGGTGATATC
+CATACCGGAGATTACGGCGTCATATTTTCTGAATTTCAGGGACGGGATCAGGCTGTCGAACGCGTGATTAGTAAAAGTACATTCTGCCTGCATTTGTTTG
+CACAAGGCTTTTGCCAGATCGATATCAAAGCCGACAATCTCATTATTAGCACCTATAGATTCAAAGGGTGGATAGGTGGCTGAAACGCCAAAATTGATTT
+TCTCTGCGGCAGAAGCACCGAAAGTAAAGGAAGCAAGTAAAGCGGCAAGAACTAACTTTTTCATGATGGAACTCCCGTCTGTCAATCTTATGATTTTTGG
+CCGTGTCTGCGGCATGGGATAACAATGCCATCAAGTGAATTTATATGCAATAAACATGATTAAATAATTTAAATGAAATAAAAAGACGGACAACTTAGTG
+GGTTGTCCGTCTTCATTATAAGAATTTATGCACTATGTAGGCCGGATAAGGCGTCCCCGCCGCATCCGGCACAGGCACTGCTGATGTCTGATGCGACGCT
+GGCGCGTCTTATCAGACCTACAAAACCCCGGCGAATGTACGCAGCCACATTAATTTCGCCGTTCGAATGCCAGCGCTTTGCGCTCGATCAGACGCATCAT
+CAGCGTCAGCAGGCCGTTAACGACCAGGTAAATAATCCCTGCCGCACCGAACACCATTACATCGTAGGTGCGTCCGTACAACAACTGGCTGTATCCCATC
+ACTTCCATCAGCGTAATGGTGTATGCCAGAGAGGTACTTTTGAATACCAGCACCACTTCGTTGGAATAAGAAGAGAGCGAGCGTTTAAAGGCATACGGCA
+GCAGGATCGCCAGCGTATCTTTTTGCTCATTCCCAGGGCGCTACAGGACTGCCACTGACCTTCCGGGATCGCACGAATTGCACCGTAAAACAGCTGCGTG
+GTATACGCCGCACTATTCAGCGACAACGCAATCAGCGCACATAACCACGGTTCTGACAACAAATGCCACAGTGCCGGATACTCCTGCAAAGTCGGAAACT
+GGCCCGGCCCGTAATAAATCAGGAAGATCTGCACCAGCAGCGGCGTACCGGTAAACAGCGTGATATAACCCGCACCAGCCACACCAGCACCGGCGTTTTC
+AGCGTCAGGATGATGGTAAAATCAATGCCAGAATCAGTGCCACAATCAGCGAGGCAACGGTTAGCGTCAGGCTGGTGTGTAGCCCTTTCATCAGTTCGGG
+TAAATACTCAAACATTAGCTGGGCCTCCGCTCAAAACGTGTCGCGCGCAGGTCAATGCGTTTGAGAATGTACTGACTGAGCAGGGTGATCACCAGGTAAA
+TCGCCGCCGCCACAATGTACCAGGTAAATGGTTCCTGGGTACGAGTAGCGATGCTTTTGTTTGCAGCATTAAATCATTCACACTAATCAAACTGACCAGC
+GCGGTATCTTTCAGCAGCACCAGCCACTGGTTACCGAGGCCAGGCAGCGCATGACGCCACATCTGCGGCATCACCAGACGGAAAAAGATAGCCGATTTCG
+ACAGCCCCAGCGCCTGACCAGACTCCACTGACCCACCGGCACCGCTTTCAACGCGCCCCGAAGCGTTTGCGAGGCATAGGCGGCATACAGCAGTGACAGA
+GCGATGACACCACAAAGGAACGGGCTAACGTCGAAGTTCTCAATGTCCATCTGCACTGGGATCTGCACGAACCCAAGATTGATAGTGAAGCCATCCGAAA
+GCGTCAGCAGCAGCTGCGAGGAGCCAAAATAGATAAACAGCACCACCAGAATTTCTGGCAGGCCACGCAGAATGGTTACCAGCGCTGAACCTGCCCACGC
+GACAGGACGCCATTTTGCCGACTCCCATACCGCAAAGAACATCGCCAGCGCCAGCCCGACAATCAATGCACAAACGGCAAGGCCGACGGTCATCCCGGCG
+GCGCTTGCTAAAGGAAAAATTCATTCATCAGGAATTACTTCTGGAACCATTTGTTGTAGATGGTTTCGTAAGTGCCATCTTTCTTCACTTTTCCAGCGCA
+GTGTTGAGTTTCTGCTGCAGCTCAGTGTTGCCCTGACGTACCGCGATGCCGAGGCCAGTGCCGAAGTAATCTTTATCGGTCACTTTGTCGCCCACCGCCG
+CCAGTTTCGGGTTATCTTTCAGCCACTCAGTGACCACTGCGGTGTCACCGAAGACGCCGTCGATACGCCCGTTTTGCAGATCCAGTTTTGCGTTCTGGTA
+GCTGTCATACGGAACGGTAGTGATTTCCGGGTGCTTATCCATAATGAATTTCTGGTGTGTCGTCCCGTTCTGTACGCCGACTTTTTGCCTTTCAGCTGAT
+CAACACTGGTGTATTTGCCTTGCTGACCCACAAACAGGGCAGAGTTGTCATAGTACGGGGTGGTAAACAGCACCTGCTTTTCACGCTCCGGAGTGATATC
+CATGCCCGCCATCACGGCTTCTACGCGACGGAATTTCAGGCTTGGGATCAGGCTGTCAAACGCCTGGTTAGAGAAAGTGCAGGTTGCATCAATCTCTTTA
+CACAGCGCTTGTGCCAGGTCGACGTCAAAACCAACGATCTGGTTGTTTGCATCAATCGATTCAAACGGAGGATAGGAGGCTTCGGTAGCAAAACGAATGG
+TTTCGGCAGCTGTGGCGGAAAGACTAAAACCTGCAATTAACGCGGCAATCAGAACTTTTTCATTGTTGTTATCCCGAATCTTAGTGAGAGAGATAGTTTT
+AAATGCTTCGGTTTGCGGCTCGGTAAAGCAGCTCGCGTCGCCTTGTTCTACGATATGACCATTTTCCATATACACCACTCGGCTGGCGGTTTTACGCGCC
+ACTTCAACTTCGTGGGTGACGATCACCTGGGTAATATTCGTTTCTGCCAGCTCACGAATGATGCTGACGATTTGTGCCGTAATTTCCGGGTCCAGTGCGG
+CGGTCGGTTCATCGAACAGCAGTACCTGCGGTTCCATCATCAACGCACGGGCAATAGCAACACGCTGCTGCTGACCACCAGAAAGATGCAGCGGGTAACG
+ATCGCTATAAGGTTTGAGACGCAGACGTTCCAGCAGTTTTCTGCACGGGCCAGCGCCTGATCTTTACTCAACCCCAGTACACGGCAGGGCGCTTCAATCA
+GGTTTTGCTGCACGGTCAGATGCGGCCACAGGTTGTATTGCTGAAACACCATGCCAACGTTACGACGCAAATCGCGAATCGCTTTGTCAGAGGGTGTTTT
+GGTGAAATCGAAATGGTTGCCTGCAATGTTGAGCGTACCGGAGCGCGGCATCTCAAGCAGATTGAGTACACGCAGCAGCGAGCTTTTACCCGCGCCGCTG
+GGGCCAAGTAACACCAGCGTTTCGCCCTGTGGGCAATCCAGCGTGATATCGAACAGCGCCTGATGCGCGCCGTAGAAGCAATTAATGCCGTTTAATTGAA
+TACTCATTGACACTCGTATACTGGCAGTCTGATAGCTATTGAGGTCGAAGATAGTACCTTTGACAGAATAATTATGCAATATTTCTGCTTTAAAAGTTAA
+AAGCAAAGCGCATTATTCAATAAACATAGCACAAAATAACGGGGCGGTGGTCGGCGAGCATAAATGTCGGCATTCCTCACGAAATGCCGGACAATTTACG
+GGGTTTATTGGTTGATCAAGGCGTTAGCGATTCTCGATGGACTGACGGAGCGTACCCGCCGTGGCATGAACGCTACCGCCTAAGTAACGCACATCGTCGA
+TGACCCAACACTGGCCTTCCTGAATCATTAACACTTCATCCTGCCAACCCTGGTCACCCTGTTTGAGATCCACGCGCAATGGAATGTTACGGGCATCACG
+ATTAGGGATAGTCGATGCACTGGCAACGTGGGCGCTATCTGGCAAGGTGGTTCGACTGGAGAATGGATCGTTGGTCAGTAGTTCCCGATGGTTATTATCC
+CGGAGGCATCGCTAAGCAGTGTCGCCAGTTTGTCGCTCAGATAAGGGCGCAAGGCGGTGATGTCGTTGCTGCGGTGCAAAATGCGGTAGTCATAAAATTG
+CTGGGCCACGTTATCCGGGCCTCCTTCAACGCAAGGACCACTGCGTGTGCCGTTATCTTTATAAGCTGGAGTGACTGTGGTGCAGGCACTGAGGAGCAGT
+GCGCAGGGGATAAGCATTGTCAATTTGCTGTAGCGCATAATGATTTCCTTATAAGCGATCGCTCTGAAAGCGTTCTACGATAATAATGATATCCTTTCAA
+TAATAGCGTATCAGTCTGATAATGCTTTTGAGATCGAAGGCTTAGCAAACAAGGAGATCGATCATGCAATTTTCTACAACCCCAACTCTGGAAGGCCAGA
+CCATCGTTGAATATTGCGGTGTGGTGACCGGCGAAGCGATTTTAGGTGCCAATATTTTCCGTGATTTCTTTGCCGGTATCCGCGATATCGTTGGCGGACG
+TTCCGGTGCGTATGAAAAGAACTGCGTAAAGCACGGGAGATCGCCTTTGAGGAATTAGGCTCCCAGGCGCGGGCGCTGGGGCCGATGCCGTCGTCGGTAT
+TGATATCGACTACGAAACGGTCGGGCAAAACGGCAGTATGCTGATGGTTAGCGTCAGCGGTACGGCGGTGAAAACGCGTCGATGAGAAGATTCTTCTGGC
+TGGTCGCTGCCGCTCTGTTATTGGCAGGGTGTGCAGGCGAAAAGGCATTGTCGAGAAAGAGGATATCAGCGATACCCGACGCCAGGCGCAGGCGGCGTAT
+CCGCGCATTAAAGTGCTGGTGATCCACTACACCGCAGATGATTTTGATAGCTCGCTGGCGACACTGACCGATAAGCAGGTCAGCTCGCATTATCTGGTCC
+CTGCGGTACCACCGCGATACAACGGTAAACCGCGCATCTGGCAACTGGTGCCGGAACAAGAACTGGCCTGGCATGCGGGGATTAGCGCCTGGCGCGGGGC
+AACGCGCCTTAACGACACCTCTATTGGCATTGAGCTGGAAAACCGTGGCTGGCAAAATCGGCCGGAGTGAAATATTTTGCCCCGTTTGAACCGGCACAGA
+TTCAGGCGCTTATTCCACTGGCGAAAGATATTATTGCCCGTTATCACATCAAGCCGGAAAACGTAGTGGCACATGCGGATATCGCACCGCAGCGCAAAGA
+CGATCCGGGGCCATTATTTCCCTGGCAGCAACTGGCGCAGCAGGGATTGGTGCCTGGCCGGATGCGCAGCGGGTTAACTTTACCTTGCCGGGCGCGCGCC
+GCACACACCGGTAGATACCGCGTCATTGCTGGAGCTTTTGGCGCGCTACGGTTATGACGTTAAACCTGATATGACACCGCGCGAGCAGCGGCGCGTGATT
+ATGGCATTCCAGATGCATTTCCGCCCGACGTTATATAACGGCGAAGCGGATGCAGAAACTCAGGCGATTGCCGAAGCATTGCTGGAGAAATACGGGCAGG
+ATTAGCGCGGCAGTTTTCCGTGGTCGCGTAGCCAGGCGGCAGTTTTCTCGATACCTTCATCCAGGGTGATGACCGGCTGATAACCTAACTCTTCCTGCGC
+ACGCGTAATATCCAGCGTAAAGTCAAAATTCAACTTGGAGACGCCGTAGTGGGTCAGCGGCGGCTCTTTTGCTGACTTGCGGCCTAAACGCTCCATGCTG
+CGGGCGATCATATCCAGCATCGGGTAGGGGACGGAACGAATACGACAGTCAATATTCAACTCGTCGATCAGCTTCTGCACGATGCTGCGCAGTGTGCGAT
+GCTCGCCGTTGGTGATGTTGTACACACGCCCGGAAGGTAGCTTATCGCAGGCTTCCTGGCTTGCCAGCCACATTGCGTGCACGGCATTTTCATAGTAGGT
+CATATCGACCAGCGCACTGCCGCCATGCGGTAACAGAATACTGCCGTAGTGGTGCATCATATGCGCCAGACGGGGAATAAAGACTTTATCGTGCGGTCCG
+AACAGACTTTGTGGGCGCAGAATAGTAAAGCGCGTTTGTGGATTCGCCTGCGAAAGCATATTGATCACTTCTTCGCTGGCTGCTTTGCTGCGGGCAAACT
+CGTTGGCGAAGCGGTGAGGGCGAAAATCTTCTTTAATATCGCGATGGTGGTGATAATCGAAGTACAGGAGGGGAAGAGATATGAATAAAGTTACGCACAC
+CCCAGGCGACAGCCCATTCACCCAGGCGGCGAGTGGCGCGAACGTTAGCCAGATCGAAAGCCTGTTGTGTCCCCAGGGTGAGGTAAAGCTGGAGCAGTGC
+CACAGCGTATCAATGCCCGCGAGCATCACTTTAGCTTGTGATGAAACCAGCTCGGTCAGATCCGCCGGAACAAACTCTGCGCCCATTTTTCCAGCAATTT
+GCCCATTGCCTCGTTGCGACCGGTCGCTCGCACGCTGATGCCTTTCTGGCATAAAAACTCTACCGCGTTTCGACCTAAGCCGCTGGTGGCGCCGGTAACC
+AGTACCTTCATATCAATCCACTGTTGTTGAGAAAATAACGTGCGCATTCTTCCGTGATTTCCCCATGATGCAATGGGAAACATGAAAGAATAACGCAGGT
+TTTGTCGATTAATCTGTGCTTTGTTCTGCCAGTCTGGCGATTTGTTTTGCCATTCCGCGAAAAATAAACAGATGCGCGGGGATCATCAATAACCAGTAAA
+ACAGCCCCGGCATACCGTGCGGATGCCAGAAAGCGCGGACATCGATAGTACGATAGTCGCCTTTATCTTCCAGGCTAAAACACAGTCGTCCCAGCCCCGG
+CGCTTTCATGCCAAATAACAACGTAAGTTGTTTTCCGGTTCAACGACAATCACTTTCCAGCTATCCACCGCATCGCCAGTCTGTAAATATTCGCGCTCCG
+GGCGGCCTTTCGCCAGCTTATGACCGATCGCGCGGTCCATCAACGCCCGTGTCTGCCACAAAATATTGCCAAAGAAATAACGCTCTTTACCGCCGATTTG
+GTTCACTACCTGCCATAAAGCAGCAAGGCTGGCGGACGTTTTAACGGTAAACCCCGCCTGTTTGGCAAAATAACCGTACTCCGGTCGCCAGCGGGCAAAG
+GCCTGAGCGTCGTAGCCCCAGTCGCTGGAGTTGACCAGTTTTCCTCCTCTTTCAACGTGCTACGTACCGCGTCATCGAAAGCGATCAGCCGTTGTGGGAT
+GAGTGCACGTAGCGCGGTATCATCCGCCAGCAGATCGTGTTTCAGCCCCTGAATCAACGCCCTGGCGGTGGTGGGCGGTACGGAAGTAATCACATTGAGA
+AACCACACCGAAATCCAGCGGGTGGGGAGGGGATGGGGATCAACCAGCGGCGCTTACCGCTCACCGCCATAAAATGTTCAAACTGTTGCTGATAACTGAG
+CACCTCTGGTCCGGCGGCTTCGAAGATGCGGTGTTCGCTGGCCGGATGATCTAACAACGCAACCAGATAGTGCAGCAAGTTTTCCAGCGCAATGGGCGTG
+GTGCGTGAACGAACCCAGCGCGGAGGCGTTAAGACTGGCAGGTTGTAGACCATATCGCGCATGACTTCGAACGCCGCGGAACCTGCGCCAACGATAATTC
+CGGCCCGCAGTTCGGTCACGGGTACATTCGCTTCACGCAGAATGTCCGCCGTAGCCTGACGAGCACGCAGATGATCCGACTGCTCATGTGGCGGGGCCTG
+CAACGAACTAAGAAAGATTAATTGCTTAACTGGTACTTCACGTAGCGCATCGCGGACGTTGAGAGCCACCTGGCGCTCCTGAGCGATAAAATCGCCGCCT
+TCGCCCATGCTGTGCACCAGAAAATAGACCGTATCGATATCCTGCAACAGGGCCGGTAGGTTATCCGGCCAGCTGAGATCGACTTTATGGCAACTGACGT
+TTGCCAGTTGCAGCTTTGCAAGCCTGTCGACATGACGTGCCGCCGCCAGGATCTGATGCCCTTGCTGGCTGAGTGTGCGCACCAGATGCTGACCAATGTA
+GCCACTGGCACCGAGAACTAAAATGCGTTGCGGCACGTCTCTCCTTAACGCGCCAGGAATGCACGCCAGTGGGCGGCGACTTCCGCCAGTTGTTCGCGCG
+AGACGTCAAGATGCGTCACCAGGCGGACAATCGGCGAGGCGTTAATCAGCACGTTTCTCGCTTTCATGTATTCGCCTAACGCGGCAGCATTTTCTTCCCC
+GACGCGAACAAACAGCATATTGGTGTCCTGACGCATCACATCCGCGCCTGCTTCACGCAGCTGCTCCGCCATCCAGGCAGCGTTGTCGTGGTCTTCCTGC
+AAGCGCGCAACGTTATTTTCAGGGCATATATCCCGGCGGCAGCCAGAATGCCGGACTGGCGCATCCCGCCACCTGTCATTTTCCGCCAGCGAATGGCACG
+TTTAATGTAATCACGATTACCGACGAGTAATGAACCGACTGGCGTCCCAAGACCTTTCGACAGGCAAATGGTGAACGAATCACAATATTGCGTGATCTCT
+TTCAGTTCGCAGCCGTAAGCCACCACGGCATTAAAGATGCGCGCACCGTCAACATGCAGCGCCAGATTGCGCTCGCGGGTAAATTCCCATGCTTCTTTCA
+GGTATTCCCGCGGCAACACTTTGCCGTTGTGGGTGTTTTCCAGACTGAGTAATTTGGTGCGGGCGAAATGGATATCGTCGGGTTTGATTTTCATCGCCAC
+TTTATCCAGCGGTAGCGTGCCGTCGGCAGCCGCGTCTATGGGTTGCGGTTGAATACTGCCCAGCACCGCCGCGCCACCGGCTTCAAACAGATAGTTATGC
+GCGGCCTGACCGACAATATACTCTTCGCCGCGTTCGCAGTGACTGAGCAGAGCGACCAGGTTGGCCTGAGTGCCGGTAGGCAGAAAAATGGCGGCTTCTT
+TACCGGAAAGCTCTGCTGCGTAGTCCTGCAGAGCATTAACGGTAGGGTCGTCTCCGTAAACGTCGTCCCCAACCGGGGCGGCCATCATCGCTTCGAGCAT
+GGCGCGGCTTGGTCGGGTAACGGTATCACTGCGTAAATCAATCATGGCATGTCCTTATTATGACGGGAAATGCCACCCTTTTACCTTAGCCAGTTTGTTT
+TCGCCAGTTCGATCACTTCATCACCGCGTCCGCTGATGATTGCGCGCAGCATATACAGGCTGAAACCTTTGGCCTGTTCGAGTTTGATCTGCGGTGGAAT
+GGCTAACTCTTCTTTGGCGACCACCACATCCACCAACACCGGACCGTCGATGGAGAAGGCGCGTTGCAGGGCTTCATCAACTTCAGACGCTTTTCTACAC
+GGATACCCGTAATGCCGCACGCTTCGGCAATGCGGGCAAAGTTTGTGTCGTGTAGTTCGGTGCCGTCAGTCAAATAGCCACCAGCTTTCATCTCCATCGC
+CACAAAGCCCAGCACGCTGTTGTTAAAGACGACAATTTTCACTGGCAGTTTCATCTGCACTACTGAGAGGAAATCGCCCATCAACATGCTAAAACCGCCA
+TCGCCGCACATGGCGACCACCTGACGTTCTGGCTCTGTCGCCTGCGCACCCAGCGCCTGCGGCATGGCGTTAGCCATCGAACCGTGGTTAAACGAACCTA
+ACAGGCGACGCTTGCCGTTCATTTTAGATAACGTGCCGCCCACACCGTTGGCGTACCAACGTCACAGGTGAAAATAGCGTCATCGGCGGCAAAATGACTA
+ATTTGCTGCGCCAGATATTGCGGGTGAATGGCTTTCTCGCTCGGTTTAGCTAAATCGTCCAGCCCTTTGCGGGCGTCGCGGTAATCTTCCAGCGCTTTAT
+CCAGAAACTTGCGATCGGCTTTTTCTTCCACCAATGGAAGCAATGCACGCAGAGTCGACTTGATATCGCCGACCAGTGCCATATCCACCTTGCTGTGAGC
+GCCGATGCTGGCTGGGTTGATATCAATCTGAATGATTTTGGCATCGGTCGGGTAGAAGGCGCGGTAGGGAAATTGCGTGCCGAGTAGCACTAACGTGTCG
+GCGTTCATCATGGTATGGAAACCTGACGAGAAGCCGATTAACCCGGTCATTCCAACATCATACGGATTATCGTATTCGACATGTTCTTTACCGCGCAGGG
+CATGAACAATAGGCGCTTTAATTTTCCCGGCAAACTCAACTAACTCTTTATGCGCCCCCGCGCAGCCGCTGCCACACATCAGGGCGATATTGCTGGAATA
+ACGCAGCAGTTGCGCCAGTTTGCGTAACTCTTCTTCTTCCGGCGTCACGACTGGTTGTGGCGCATGATACCAGTGCATGGTTGCCCCTTCTGGCGCAGGT
+TTTAACGCCACGTCGCCTGGTAACACGACAACCGAAACGCCACGGTTAAGCACCGCTTTGCGCATGGCAATCGCCAGTACTTGTGGGATCTGCTCCGGGC
+TGGAAACCAGCTCGCAATAGTGACTACATTCGCGGAATAGCTCTTGTGGGTGGGTTTCCTGGAAATAGCCGCTGCCAATTTCGCTGGAGGGAATATGAGC
+GGCAATCGCCAGTACCGGAACGTGATTGCGGTGGCAATCGAACAGGCCGTTGATTAAGTGCAGGTTGCCGGGGCCGCACGATCCGGCGCAGACCGCCAGT
+TCTCCGCTAAGTTGTGCTTCAGCGCCAGCGGCAAAGGCCGCCACTTCTTCGTGGCGGGTGGACATCCACTCGATGGTGCCCATGCGATTAAGACTGTCAC
+TAAGACCGTTCAGAGAGTCGCCTGTGACTCCCCAGATGCGTTTCACCCTGCCGATTCGAGTGTTTTGGCGATATAAGCTGCAACCGTTTGTTTCATGGTT
+CTCCATCTCCTGAATGTGATAACGGTAACAAGTTTAGTTCATCTGACGGAGGGGAAGGGATGGGAGAGAAAGGAGGCACTAACGGTTAAATAGCCCGATG
+AAAGGAATATCATCGGGCATAAGGCGATTATGCGAGAACCAAACCCCTGCGGATGGCAGGAGCAGGCCAGTACGTAACCTTCAGCGATTTCGGCGTCGGT
+CAGCGTCATTGTGCTGCTCACCGTATATTCACCGGAAACCACTTTTGTCTTACAGCAGCCGCAAACACCCGCACGGCAGGCAGCGACAACCGGAACGTTA
+TTGCTTTCCAGCGCCTCCAGTAGCGTGGTGCCAACCGGGGCGTAAAATTCTCGTGCCGGTTGCAGTTTGGTGAATTTCAGACCGCTGGTCGCCGCTTCTG
+CTACTGGGGTGAAGAATTTCTTTAAAGAAACGCGTCACGCCGAGCGCTTTCACTTCCTGCTCTACCCAATCCATATACGGAGCCGGGCCGCAGGTCATCA
+CGGTACGTGAAGCTAAGTCAGGTACACCTGCCAGCAGTTCGCGAGTGAGACGACCAGCGATAAAGCCTTCGGTAACGTTATTTTCTGCCACCAGCGTTAC
+CGGATAGTTACGCCACTCATCGGCGAAAATAACATCCTGCGGCGTACGCACGTTGTAGATCACCCGCACATCGGCCTGTGGACGGTTCTTCGCAAGCCAG
+CGACGCATCGACATAATCGGCGTGACGCCGCAGCCTGCCGCCAGCAACAGGAATTTATCTTCTGCTTTATCGTCGCAGGTAAATTCCCCATCGCGTCCGA
+AAGCCAGAGATAATCACCGCGTTTTACATCGCGCGTCAGCCACTGGGAGCCGACACCGTCATCAATCCGCCGCACGGTCAGGGTGATATATTCACTCACG
+CCTGGCGTGGAGGAAATGGTAAGCACGCAGCGTTTCCGCTGAGTTTCGCACGCTGACCAGTGCATATTGCCCGGCGCGATATGGGTAGTAATCGTGGCAA
+ATCAGGAAATCGTCCACACATCCGGCGTTTCTTGCGTAATGTGATGAACCTGCATCCGCCACGGGCATTGATTCGTTGGCATCGTCATCGACAAACTCCT
+TACGCGCTCAACAGTTGCTTCATGTCTTCTTCAACAGTGGTGATAGAACGCAGGCCGAATTTCTCGTTCAGCACCGCCAGCAGGTCTGGTGTCAGGAAAC
+CAGGTGCAGTCGGGCCGGTGACGATATTTTTCACGCCCAGAGAAAGCAGCGTCAGCAGAATGACGATCGCTTTCTGTTCAAACCAGGAGAGCACCAGCGA
+CAGCGGCAGATCGTTGACACCGCAGCCCAGTTTCTCTGCCAGAGTGACAGCCAGAATAATCGCTGAGTAAGCATCGTTACATTGACCTGCATCTACCAGA
+CGCGGCAGACCTTCGATATCGCCAAACTCAAGTTTGTTAAAGCGATATTTACCACAGGCGAGGGTCAGGATCAGGCAGTCATCCGGCACGCTGGTGGCGA
+AATCGGTGAAGTAGTGGCGCTCGCCGCGTGCGCCGTCACAGCCACCAAGCAGGAAGATATGACGCAGTTTTCACGGCTCACCAGATCAATCAGCGTATCA
+GCAGCGCCAAGCAGCGTCTGGCGACCAAAACCCACGGTGATAAGGTGCGGAATTTCGCTGTACGGGAAGCCTGCCATCTGTTGCGCCTGGGTGATAACCG
+CAGAGAAATCATCACCGTCCAGATGACGCACGCCAGGCCAGCCAACAATGCTGCGGGTCCAGATACGATCGTCATAAGCGCCTACGGTTGGGTCGATGAT
+GCAGTTCGAGGTCATCACGATGGGGCCAGGGAAACGAGCGAACTCCACTTGCTGATTCTGCCAGCCGCTGCCGTAGTTACCGACCAGATGCTTGAATTTA
+CGCAGCTCCGGGTAGCCATGCGCAGGCAGCATTTCGCCGTGGGTGTAGACATTAACGCCCGTGCCTTCGGTCTGTTCCAGCAGGTTGTAGAGATCTTTGA
+GATCGTGACCGGAAATCAGAATGCATTTACCCGCCGTCGCTTTGACGTTGACCTGGGTTGGCGTCGGGTGACCGTATTTACCGGTTTCGCCTGCATCCAG
+AATGCTCATCACTTTGAAGTTCATCTGGCCGATTTCCATTGAACACTCAAGAAGCGCGTTCATATCGGCAGGCCAGGTCCCCAGCCACGCCATGATTTTA
+TGGTACTGGGCATAAATATCGTTGTCGTATTGACCGAGAACATGCGCGTGTTCCATATAGGCCGCCGCACCTTTCAGGCCATACAGGCACAGCAGACGCA
+GGCCGAGAATGTTTTCGCCAATCGCCGCTTTATCTTTGTTAGGGTAAATTCTGCTGCCTGACGTTGCAGCTCGCCGAGATCGTCGCTCACCAGTTGCAGG
+TCAGCCATCGGGTTATCGACGCGCGCGTTGGCATCTACAGCCAGGCATTGCGCTTTCAGCGCCTCGCGCAGGGCAATCGCTTCACGAGCGTAGCCGACAA
+TACGCGGAGAATCGAAGTTAACGTTGGTCAGGGTTGAGAAAAGGCACGTGGCGCGAAGCTGTCAACATCGTGGTTGATGATGCCGTATTCACGCGCTTTT
+ACCGCCCAGGCAGAAAGCCCTTGCAGCGCCGCGATGAGTAAATCCTGAAGGTCAGAAGTTTCCGCCGTTTTACCACACATCCCCTGCGCGTATGAGCAGC
+CGTTTCCTGCCGGAGTACGGATAGTTTGTTCACATTGCACACAAAACATGATCACACCTTTTAAAGTTATATTTAATATACATGTTTAAGGTTAAGACGC
+TTAACGCGGGGATAAAAGGGATTTTTCATGCAACTTTAAGGGAGATTGATTTAGCGCAATTTTGGCGGCAGGGATCTACCGCCAGAGAGGTATTACGCAG
+AGAAAAAGGCGATGAGGATCGGCACTAACAGGCTAAGAATAAAACCGTGAACAATTGCCGCCGGGACCATATCCAGCCCGCCAGTACGTTGAAGAACGGG
+CAGGGTGAAATCCATTGATGTGGCACCGCATAAGCCCAGTGCAGTAGAGCGGCTGCGGCGAATCAGCCCAGGGATCAACATAATAGCAATCAGTTCACGG
+GCCAGATCATTAAAAACGCCGCGCTCCCGATTACCGGACCAAAAGATTCGGTCAATAAAATACCGGAAAGAGAATACCAGCCGAAACCGGAGGCCATTGC
+CAGCGCGGTATTGATGGGGAGATCAAGAATAAAGGCGTTAATTAAACCACCAATTAATGAACTGACAACCACCACCACGGCGACAATCATTCCCCGGCGA
+TTAAGGACAATCTGCTTTAAGGTCATGCCATTATTGCGCAACTGAATACCAACGAGGAAAAGTAGCAAAATTAACGTGTATTCACTGGCTTCGGTCGCGT
+GTTGTAAGAAAGCCAGTCCACTTAGACCAATGGCAAAACCAATCACTACTACGCCGCACAGTTTTAGCGACTCCAGCGCCATCGCAATACGCGACGGAGT
+TTTCTTGCTGATGGTGGTTGCGCCACGGCAGGCCTCGCTCCAGCCACATCAGGGCGGCAATATTACACAGTAAAATAACGGTAATACTGACGGCAGAATA
+ATGCAGAATCGCCAACAGGTTACTGGCGAGGTTATCGAGAAACGCCAGACTGATACCCATAAAAAGAGAATAAGGTAAACCATCCAGCTTAATAGCTGAT
+TAATAACTTTAACGCAGCTTGTTGGCGAAGCGGAATGAGGTAACCCACAATCAGGGGAACCAGAATGATTAACAGCCCAGAAAACATGAAAACCCAGTCC
+TTGCAAAGATGAAGTCGAAATGCGCGATGACACACTACTGAAAGCGGAAGGACGAGTAAAGTTGCAATTAAAAGGAAATGTTATGCATAAGGAGCAGTAG
+AGTATTCGTTTTCATTTAAAGATATTCTTGCGCTTTAATTACAAACTGCACCGATGTTGGTGGCGTCAAAATCGCCGAGGCGTTCCCTGAAGGCCGGGGC
+AGCCCACATGGATGTGGGCTGAGGGCGCGTTTTACAGGGATGTTACCTCGCGCCCGACCCGGTAGCCGTAAGGGATAAGTCGAGGGCACCGCGCAGCGGC
+GATTTTGTTCGCCAGAGCCGGGGTGCAGGGGCGGCGGCGATTGGCCGCCCCTGCGCGCTCCTTGCGCCAGTGGCAATATGTTGCTTAGCTCATGAAAGGA
+GCGCAACAAGATGATGAATCAACATATAACAACATCTTAAAAAGGCCTGACATTACGCCAGGCCTTCTGCGTTAATTAATCACGCTTTTCCAGCAGGGTC
+CGGTAAATCAGACCACCGATAATGCCGCCGACAATTGGCACCACCCAGAAGAACCACAGTTGTTCTAATGCCCAGCCGCCCTGGAAGATAGCAACCGCGG
+TGCTGCGCGCCGGGTTAACAGAAGTGTTAGTCACCGGAATACTAATTAAGTGAATCAGGGTTAAGGCCAGACCAATAGCGATCGGCGCAAAACCTGCCGG
+CGCGAATTTGTCGGTTGCGCCGTGGATCACCAACAGGAAACCTGCACTCAATACCAGTTCAACTACCAGCGCGGAAAGCATGGAATAACCGCCTGGTGAA
+TGCTCGCCATAACCGTTAGAAGCAAAACCGCTGGCTGCCGCGTCAAAACCCGTTTTACCACTGGCAATTAAATACAGCAGCGCCGCTGCAACAATACCGC
+CGACAACCTGGGCAATTACGTAGCCAACGACTTCTTTTGCCGGAAAACGTCCGCCAGCCCATAAACCAATAGTGACCGCCGGGTTAAAATGACCACCAGA
+AATATGACCAACAGCAAAGGCCATCGTCAGAACGGTCAGACCGAACGCCAACGCCACGCCGGCAAAACCAATGCCTAATTCCGGGAAGCCTGCGGCCAGT
+ACAGCACTACCACAGCCACCAAAACAAGCCAGAAAGTACCAAAACATTCAGCTGCTAATTTTCTGAACATATCCACCACAATTAAAAATTGACCCTGTGA
+AAAATATGGTCGTTTTATAGGGTCGTCGTAAAAAGTGACGACGGAAATAATGCGCGGCTATTTTAAAACGAAGGCGAGTCATTCACCAGATAAATAAATC
+CAGTAAATTTGATTTAGGGCAACAGCGGGTTGCCCCATATAGTCATTTGTCTGATTGACAGTGTAGTGCACGCAAAAGATTTAATCCTTTAGGCGTAATA
+AAAATAATTTATCATGCTAATTATTTGATTTTGTTGTTTTGCAGACTTATCAGCAAGAGGGAGTATAACGCGATTATTCGCTCATTTTTCAGACATTTGC
+CATGCTTAAATGTGATGTCATCACGTATTAGCAAGGCCTTTCCCGTTATACTGCCAGCGTAAAGGATAAGTCACATATTTCTGGAGGGATATGATTCTTG
+AGCGCGTTGAAATTGTGGGTTTTCGCGGTATCAACCGTTTGTCGTTGATGCTGGAACAAAACAACGTCCTGATTGGGGAGAACGCGTGGGGTAAATCCAG
+CTTGCTGGACGCCTTAACTCTGCTGCTATCGCCAGAATCAGATCTCTACCATTTTGAGCGCGACGATTTCTGGTTCCCGCCGGGAGATATCAACGGGCGA
+GAACATCATCTGCATATTATTTTGACCTTCCGCGAATCGCTGCCAGGCCGACATCGGGTTCGCCGTTATCGGCCGCTGGAAGCGTGCTGGACGCCATGCA
+CCGATGGCTATCACCGTATTTTTATCGTCTGGAAGGGAGAGTGCGGAAGACGGCAGCGTGATGACACTGCGCAGTTTTCTCGATAAAGACGGACATCCGA
+TTGATGTCGAGGATATTAACGATCAGGCACGCCATCTGGTGCGTTTAATGCCGGTGCTGCGCTTGCGTGATGCCCGTTTTATGCGCCGTATTCGTAACGG
+CACGGTGCCAAATGTCCCTAATGTGGAAGTCACCGCGCGCCAGCTCGATTTCCTCGCCCGTGAGTTATCCTCACATCCGCAAAATCTCTCTGATGGGCAG
+ATTCGTCAGGGACTTTCCGCAATGGTACAGCTGCTTGAGCATTATTTCTCTGAGCAGGGGCCGGACAGGCGCGATATCGTTTAATGCGGCGGCGAGCCAG
+CAATGAGCAACGAAGCTGGCGCTATCTGGATATCATCAACCGGATGATTGACCGACCTGGTGGGCGCTCGTATCGGGTTATTTTGCTCGGCCTATTTGCT
+ACTTTGTTGCAGGCAAAAGGCACATTGCGACTGGATAAAGACGCCCGTCCATTGTTGCTGATCGAAGATCCAGAAACCCGTTTACACCCCATTATGCTTT
+CAGTTGCCTGGCATCTGTTGAATCTTCTGCCATTGCAGCGCATTGCCACCACCAACTCGGGTGAGTTGCTTTCGTTAACGCCGGTAGAGCATGTTTGCCG
+ACTGGTACGTGAGTCCTCGCGCGTTGCCGCCTGGCGTCTGGGGCCGAGTGGCTTGAGTACCGAAGATAGCCGACGCATATCCTTTCACATTCGTTTTAAC
+CGTCCGTCATCGCTGTTTGCACGCTGCTGGTTGCTGGTGGAAGGGAAACGGAAACCTGGGTTATCAATGAACTGGCGCGTCAGTGCGGACATCATTTTGA
+TGCCGAAGGGATCAAGGTCATTGAGTTTGCCCAGTCCGGGCTAAAGCCACTGGTTAAATTTGCCCGCCGAATGGGGATTGAATGGCATGTACTGGTCGAT
+GGCGATGAAGCAGGGAAGAAATATGCCGCTACGGTACGCAGCCTGTTGAATAACGATCGGGAAGCCGAACGAGAACATTTAACGGCGTTACCGGCGCTGG
+ATATGGAACATTTTATGTATCGCCAGGGATTTTCCGATGTGTTCCACCGCATGGCGCAAATCCCGGAAAATGTACCGATGAATCTACGCAAAATTATCTC
+GAAAGCGATCCATCGCTCTTCCAAACCCGATCTTGCCATTGAAGTGGCAATGGAGGCAGGACGTCGTGGTGTGGACTCCGTACCGACGCTGCTGAAAAAA
+TGTTCTCACGCGTGCTGTGGCTGGCGCGCGGTCGCGCGGATTAACCGCGAAACATCGTGGCCATTTGTGGCTGAATAGCGTCGAGCATCTCATAGCGCCG
+ACGGTATTCAGCCCGTTTTACTGGCGATTTCGGCAATCTCTTTCGTGCTATCTGTGCTGGAAGGCGGTAATGGCGTTCAGCATCACATACGCCGCCAACC
+GATTCCCAGAAAGCGTTGTAATCAGCGTGGATCTTGCCTTCTTTATCGCGATAACGCAGGCTGCGGTAAATATGCGTTTCATTGCTGACGGCAATAATCT
+GCTCTACCTGCAAACGTTGGGCAAACAGACAGGCCGCTTCCATCACGAGGCGTTTGGGAATAGCCCGTGGCAGGCTTTCGTCGCATTCTGGATTTCCTGA
+TGTGGAATTTCCCATTTTGCGCCTTGCAGTCCGCCAATAAACATCGTTCTTTTCCCTGATATTCACACAGGGTAAACGTGATCTCTGCCAGAGGAATACC
+TTCGCTGTTGCGGAACAGGATTGTGCTGTCACCTTCTTTATCCATTGAGATCATCATGGTCAGCTCAAGCGTGAACTGCTCGCCGTTTTGCCTTCCAGCT
+TCGCCAGTTGCAGCCCGGGGTATTCAAATATAAGCTGAATTCTTCCGCCGACATACATTCGCGGAGTAACGCATAATGGTAACGTAACGCCTCCAGCAAT
+TGCTTACGGCTAAGATTCGCCGCAAGGTAAGGGCGATGCAGACGCACAGGCAGTCGCGGCTGGCGCGTTAACAATACATTGAGATTAGGCCAGTGGGAAA
+GTTCGTTCATCCACTCAACGCTTAAACGCGGCATAATCAACGAGCGCAGCAAAATTTCTGGCGAAAACTACGGCGATGCCAGAATTTACCCGGCCGACAC
+TGTCCACGTGCCAGACTAAGAAAAAGTGACAGGCTGCTGAGAGATTCAGATGGCGTAAAGGTCCGTTCAGTTAGCTGCGACATATTCATGAAATCAATGG
+TTATACATGGCGTCGATTTCACCATTGCGTATCTTAACCAAACATCAATAGTGTGATTACTAACGTAAATTTTAGGGTTTTGTTGATATTTCGTTGAAGT
+TAATGACCCGGATTGGCATATGGAGTATTCAGAAAATTTATGAAAAAGCGGAAAACCGTGAAGAAGCGTTACGTTATTGCGCTGGTGATAGTCATCGCCG
+GACTGATTACGTTATGGAGAATTCTTAACGCACCCGTGCCGACTTATCAGACGCTGATTGTGCGCCCCGGTGATTTACAGCAAAGCGTGCTGGCGACCGG
+AAAGCTGGACGCGCTGCGTAAGGTTGATGTGGGCGCGCAGGTCAGCGGTCAGTTGAAAACTCTGTCGGTGGCGATTGGCGATAAAGTAAAAAGACCAGCT
+TTTAGGGTTATTGATCCTGAACAGGCTGAAAACCAGATTAAGGAGGTCGAAGCAACGCTGATGGAGCTACGTGCGCAGCGGCAGCAGGCGGAAGCGGAGC
+TGAAACTGGCGCGGGTGACGTATTCCCGTCAGCAACGTCTGGCACAAACGAAGGCTGTTTCACAGCAGGATCTCGACACCGCCGCGACGGAGATGGCTGT
+GAAACAGGCGCAAATTGGCACCATTGACGCGCAAATCAAGCGCAATCAGGCTTCTCTCGATACGGCTAAAACCAATCTCGATTACACTCGCATCGTTGCC
+CCGATGGCCGGGGAAGTCACGCAAATCACCACTCTGCAAGGCCAGACGGTGATTGCCGCACAACAAGCACCGAACATTCTGACGCTGGCAGATATGAGCG
+CCATGCTGGTAAAAGCGCAGGTTTCTGAAGCGGATGTAATCCACCTGAAGCCGGGGCAAAAGCCTGGTTTACGGTGCTTGGCGATCCACTGACGCGCTAC
+GAGGGCAAATCAAGGATGTACTACCGACGCCGGAAAAGGTTAACGACGCTATTTTCTATTACGCCCGTTTTGAAGTCCCCAACCCCAATGGTTTGCTGCG
+GCTGGATATGACTGCGCAAGTGCATATTCAGCTCACCGATGTGAAAAATGTGCTGACGATCCTCTGTCGGCGTTAGGCGATCCGGTTGGCGATAATCGTT
+ATAAAGTCAAATTGTTGCGTAATGGTGAAACACGCGAGCGTGAAGTGACGATTGGCGCACGTAACGATACCGATGTTGAGATTGTCAAAGGGCTTGAAGC
+GGGCGATGAAGTGGTGATTGGTGAGGCCAAACCAGGAGCTGCACAATGACGCCTTTGCTCGAATTAAAGGATATTCGTCGCAGCTATCCTGCCGGTGATG
+AGCAGGTTGAGGTGCTGAAGGGCATCAGCCTCGATATTTATGCGGGTGAGATGGTCGCGATTGTTGGCGCTTCGGGTTCCGGTAAATCGACCCTGATGAA
+TATTCTCGGCTGTCTGGATAAGGCCACCAGCGGCACCTATCGCGTCGCCGGTCAGGATGTTGCCACGCTGGACGCCGATGCGCTGGCGCAACTGCGCCGC
+GAGCATTTCGGCTTTATTTTCCAGCGTTACCATTTGCTTTCGCATTTAACCGCCGAGCAGAACGTTGAAGTACCCGCCGTCTATGCTGGTCTTGAGCGGA
+AACAGCGACTGCTTCGTGCCCAGGAGTTGCTGCAACGGCTGGGGCTGGAAGACCGTACAGAGTATTATCCGGCACAGCTTTCGGGTGGTCAGCAACAGCG
+CGTCAGCATCGCGCGGGCATTGATGAACGGTGGTCAGGTAATTCTTGCCGATGAACCAACCGGCGCACTGGACAGCCATTCTGGCGAAGAGGTGATGGCG
+ATCCTGCATCAGCTGCGCGATCGTGGGCATACGGTGATTATCGTCACCCACGATCCGCAGGTCGCTGCTCAGGCCGAGCGGGTGATCGAAATTCGCGACG
+GCGAAATTGTGCGCAATCCTCCGCCATTGAAAAAGTGAATGTTACTGGCGGGACGGAACCTGTTGTCAACACGGTGTCTGGCTGGCGGCAGTTTGTCAGC
+GGTTTTAACGAGGCGCTGACGATGGCATGGCGGGCGCTGGCAGCGAATAAAATGCGTACTTTACTGACCATGCTGGGGATTATTATCGGTATTGCGTCGG
+TGGTTTCCATTGTCGTGGTGGGTGACGCCGCCAAACAAATGGTGCTGGCGGATATTCGTTCTATTGGTACGAATACTATTGATGTCTATCCGGGAAAGAT
+TTTGGCGATGACGATCCGCAATATCAGCAGGCGCTGAAGTACGACGACTTAATCGCCATCCAAAACAACCGTGGGTCGCCTCAGCCACACCTGCCGTCTC
+GCAAAACCTGCGCCTGCGTTATAACAATGTTGATGTTGCTGCCAGTGCCAATGGCGTGAGCGGCGATTATTTTAATGTCTATGGCATGACCTTCAGTGAA
+GGAAACACCTTTAATCAGGAGCAGCTGAACGGTCGTGCGCAGGTCGTGGTTCTCGACAGTAATACTCGCCGCCAGCTTTTCCCCATAAAGCAGATGTGGT
+TGGCGAGGTGATTCTGGTCGGCAATATGCCCGCCAGAGTCATTGGTGTGGCGGAAGAAAAACAGTCGATGTTTGGTAGCAGTAAAGTGCTGCGTGTCTGG
+CTACCTTACAGCACGATGTCCGGGCGAGTTATGGGCCAGTCGTGGCTTAACTCCATTACTGTCAGGGTGAAAGAAGGATTTGACAGCGCCGAGGCGGAAC
+AGCAACTCACGCGTTTACTTTCACTGCGCCACGGAAAGAAGGATTTCTTTACCTGGAACATGGACGGCGTCTTGAAAACTGTTGAAAAGACCACACGTAC
+TTTACAACTGTTTCTGACGCTGGTGGCGGTGATTTCGCTGGTGGTGGGCGGTATTGGTGTAATGAATATTATGCTGGTGTCAGTGACCGAGCGGACGCGG
+AAATTGGCATTCGCATGGCTGTAGGTGCGCGAGCAAGCGATGTTTTGCAACAGTTCCTGATCGAAGCCGTACTGGTTTGCCTGGTCGGTGGCGCGTTGGG
+AATAACACTGTCACTGTTAATTGCTTTCACCTTGCAGCTTTTCTTACCCGGCTGGGAGATTGGTTTTCACCGTTGGCGCTGCTGCTGGCGTTTCTCTGCT
+CGACGGTCACCGGGATTTTATTTGGCTGGTTACCCGCACGAAATGCGGCACGACTGGATCCAGTAGATGCTCTGGCACGAGAGTAATTTTGAGATAAAAA
+TGCCAGCCGATCGGGCTGGCATTTTGCCTTTAGGATGTACACAATGAGACAGAAGAGCTATGCGACTGCCGCTTCTACTTCGACGGGCACAATAACACTG
+GCGTGATTGCCTTTTGGCCCCTGGTGGACATCAAACTGAACGGATTGTCCAGCTTTTAGCGTTCTGTAACCATCCATCTGAATGGTGGAATAATGAGCGA
+AAATATCTTCGCCGCCGCCTTCAGGGCAGATGAAACCAAACCCTTTGGCATTGTTGAACCACTTAACAGTACCCTTTTCCATGCTTCGACATCCTTCGCA
+AATCTTATACAAGTAAGATGGAATAAACCGGGGTCAGAGAGGGGCTGTTCAAAACCTCGCCAACTCTAGAAATACAATTTAGAGAATTAGGGCGAGCCGT
+CAAGCATTTGACAGGGGACAAGGGGCAGGTATGAATCAAAATTTGAAGCAGTTAACGCTATTGACAGGAATGTGACAGATGTCGCTGATGCCAACGATAG
+ATGATAGTTATCTATCATGTGGAGTAGATTGGTCAGGCAAATAAGCTCTTGTCAGCGGCAGGGCGTTCTGCCGATAACCGTAACCGAAGATGATAACTGA
+CAATGGGTAAAACGAACGACTGGCTGGACTTTGATCAACTGGCGGAAGAAAAGTTCGCGACGCGCTAAAACCGCCATCTATGTATAAAGTGATATTAGTC
+AATGATGATTACACTCCGATGGAGTTTGTTATTGACGTGTTACAAAAATTCTTTTCTTATGATGTAGAACGTGCAACGCAATTGATGCTCGCTGTTCACT
+ACCAGGGAAGGCCATTTGCGGAGTCTTTACCGCCGAGGTTGCAGAAACCAAAGTGGCGATGGTGAACAAGTACGCGAGGAGAATGAGCATCCATTGCTGT
+GTACGCTAGAAAAGCCTGAATGCAGGCATAAAAATTGGGGAGGTGCCTATGCTCAATCAAGAACTGGAACTCAGTTTAAATATGGCTTTCGCCAGAGCGC
+GCGAGCACCGTCATGAGTTTATGACCGTCGAGCACTTGTTACTGGCGCTGCTCAGTAACCCATCTGCCCGGGAGGCGCTGGAAGCGTGTTCTGTGGATTT
+GGTTGCGCTCCGTCAGGAACTGGAAGCCTTTATTGAACAAACCACACCCGTTCTGCCTGCCAGTGAAGAGGAGCGCGACACACAGCCGACGCTGAGTTTT
+CAGCGTGTACTGCAACGTGCGGTCTTCCATGTCCAGTCCTCCGGTCGCAATGAGGTTACCGGTGCAAACGTTCTGGTCGCTATCTTTAGCGAACAGGAGT
+CGCAGGCGGCATATCTGTTGCGTAAACATGAAGTCAGCCGTCTCGATGTGGTGAACTTTATCTCTCATGGCACGCGTAAAGACGAGCCGACACAGTCTTC
+TGATCCTGGCAGCCAGCCAAACAGCGAAGAACAAGCTGGTGGGGAGGAACGTATGGAGAATTTCACGACGAACCTGAATCAGCTTGCGCGCGTGGGCGGA
+ATCGACCCACTGATTGGTCGTGAGAAGGAGCTGGAGCGTGCTATTCAGGTTCTCTGCCGTCGCCGTAAAACAACCCGCTGCTGGTGGGGAATCTGGTGTC
+GGTAAAACCGCGATTGCGGAAGGTCTTGCCTGGCGAATTGTTCAGGGCGATGTGCCGGAAGTGATGGCTGACTGTACGATTTACTCTCTCGATATCGGTT
+CTCTGTTAGCGGGCACAAAATATCGCGGCGACTTTGAAAAACGTTTTAAAGCGTTGCTCAAGCAGCTGGAGCAGGACACTAACAGCATCCTGTTTATTGA
+TGAGATCCACACCATTATCGGTGCGGGTGCAGCGTCTGGTGGTCAGGTCGATGCGGCTAACCTAATCAAACCGTTGCTCTCCAGCGGTAAAATTCGTGTA
+ATTGGTTCGACAACCTATCAGGAGTTCAGCAACATTTTCGAGAAAGACCGTGCTCTGGCGCGTCGCTTCCAGAAAATTGATATTACTGAACCGTCGATCG
+AAGAAACTGTTCAAATCATCAATGGCCTGAAACCGAAGTATGAAGCGCACCACGACGTGCGTTATACCGCAAAAGCGGTGCGTGCGGCGGTAGAGCTGGC
+GGTGAAATACATTAACGATCGTCATCTGCCGGATAAAGCCATTGATGTTATCGACGAAGCGGGCGCTCGCGCACGCCTGATGCCGGTAAGCAAACGCAAG
+AAAACCGTTAATGTGGCGGATATTGAGTCCGTGGTGGCCCGTATTGCACGCATTCCAGAGAAGAGTGTTTCTCAGAGTGATCGTGATACCCTGAAAACCT
+CGGCGATCGCTTGAAAATGCTGGTCTTCGGTCAGGATAAAGCCATTGAGGCGCTGACTGAAGCCATTAAGATGGCGCGTGCAGGTTTAGGTCACGAACAT
+AAACCGGTTGGTTCGTTCCTGTTTGCCGGCCCTACCGGGGTCGGGAAAACAGAGGTGACGGTACAGCTTTCGAAAGCTTTGGGCATTGAGCTTCTGCGCT
+TTGATATGTCCGAGTATATGGAACGCCATACCGTCAGCCGTCTTATTGGTGCGCCTCCGGGATACGTTGGTTTTGATCAGGGCGGTTTGCTGACTGATGC
+GGTCATCAAGCATCCACATGCGGTGCTGCTGCTGGACGAAATCGAGAAAGCGCACCCGGACGTGTTCAATATTCTGTTGCAGGTGATGGATAACGGTACG
+CTGACCGATAACAACGGACGCAAAGCAGACTTCCGTAACGTGGTGCTGGTGATGACCACCAACGCCGGGGTACGGGAAACTGAGCGCAAATCCATTGGTC
+TTATCCACCAGGATAACAGCACCGATGCGATGGAAGAGATCAAGAAGATCTTTACACCGGAATTCCGTAACCGTCTCGACAACATTATCTGGTTTGATCA
+TCTGTCAACCGACGTGATCCATCAGGTGGTGGATAAATTCATCGTCGAGTTGCAGGTTCAGCTGGATCAGAAAGGTGTTTCTCTGGAAGTGAGCCAGGAA
+GCGCGTAACTGGCTGGCCGAGAAAGGTTACGACCGGGCAATGGGCGCTCGTCCGATGGCGCGTGTCATCCAGGACAACCTGAAAAACCGCTCGCCAACGA
+ACTGCTGTTTGGTTCGCTGGTGGACGGCGGTCAGGTCACCGTCGCGCTGGATAAAGAGAAAATGAGCTGACTTACGGATTCCAGAGTGCACAAAAGCACA
+AGGCGGAAGCAGCGCATTAATCTGATTGTTAGGTAGGTTGGTCAAGTCCGTAATCTCGAAAGAGGTTACGGACTTTTGTTTATGGGTGGAGGAGGTTCAG
+ACCCTTTTTAATGATGATGGTAAGTTGTTGATAATTAGTGCTGCGGGAAGGTAAGGATAAAAAGGGTGCTGCAGGAGAATGGGATGGTTTTGCTTTATTA
+ACAACGGGCTAAACGTGTAGTATTTGAGTTCACTGCCGTACAGGCAGCTTAGAAATTCACAGGTAACATACTCCACCCGCCCACCATGTTCACTGCCGTA
+CAGACAGATAAAATGCGAAAAAGCTCGCACTTTCGTACGAGCTCTTCTTTAAATATGGCGGTGAGGGGGATTCGAACCCCGATACGTTGCCGTATACACA
+CTTTCCAGGCGTGCTCCTTCAGCCACTCGGACACCTCACCAAATTGTTTTGCTACCAAACCTCATGGGTGGCAACGGGCGCTACTATAGGAGTTGGAGTA
+AAACGGTCAAGAAGAATTTTAATGATAATTATTGTTTGCTCATACTGTAAACAAGTTGTGCAGTATATCTACATCGAGACAAGTTACGGACTTATACTTC
+CAAAGTACTTCATACATATCACAAAATAAAAGGCCGGTTAAACCGACCTTTACTCGTTCTTTCTCTTCGCCCATCAGGCGGTAAAACAATCAGCGACTAC
+GGAAGACAATGCGGCCTTTGCTCAGGTCGTACGGGGTCAGTTCAACAGTCACTTTGTCGCCCGTCAGGATGCGGATGTAGTTTTGCGCATTTTACCGGAG
+ATGTGTGCAGTAACCACGTGACCGTTTTCTAACTCTACGCGGAACATGGTATTAGGCAACGTTTCAAGAACGGTACCTTGCATTTCAATATTGTCTTCTT
+TGGCCATCTAATCCTCTGGGGTATCACTACCGTAATTTGAACCGGCAAGATAATGCCGAAGTTCTGTAAATAAGTAAAGATTTGCGCGCTAAATCGCAAC
+AAACAGGTTCGGCACATTACTCCGAAAACACACGGCTAAGCCGCACCAAAAGCGCAACGTATAAGGGAGCGGTGAGATAAACGATGGGCGTTACCTGACG
+CGAAAAATTCCTTATCGGCAGCGGGGTAATGAGCGTAACCAACTCTGCGACCGCAATTATAACACTCTGGGGAGAAATGTGCCGAAAACATTCATTCTTG
+TGGTGAAAACAAGCATCGTGGTACCCAGAAATTATTCGGCAATCGTCCGAGGCGCATTTGATTGAGATAATTAAGGTAATCCCGGCGGGAATTTCGCAGG
+CACCAAGCGATGCTGTGTGATCGTTAAGGACCTGGCAGTCGATAAGCTTACCGCCATGACCGATAAATTCCTCACAGAATACCAGAAGCGCCGTTTTAGA
+CGCATTTTCCATCCGGCTGAACATGGACTCGCCACAAAATAGCGTTCCCTGGGCCACGCCGTACATACCGCCGACAAGCTCATCTTCACGCCAGACTTCA
+ATGGAGTGGGCATGGCCGAGTTCGTGAAGGCGATGGTAGGCTTCGACCACGCCACGCGTGATCCAGGTTCCTTCTTCGCGATCGCTGGCACAGCCTTCAA
+TGACCTGACCAAAAGCGTAATTCATCGTGACACGATAGGGCGAGCGTTTATGAAATCGCTTCATACTACGGCTGATATGCAGTGATTCTGGCCATAGCAC
+CGCGCGGATCGGGCGACCACCAGAGGATGGGGTCGCCTGGAGAAAACCACGGAAAAATACCACGCTGGTAAGCCATTAACAGGCGCGCAGGGCTAAGATC
+GCCCCAAGTGCCAGCAGGCCGTTAGGCTCACGTAATGCGCCTTCCGGGAAGGGAAGGCTATTGAATGGCGAGAAAGCTGAACCAGGCGCATGACCGCAAA
+ACTCCACGCAAGTCGGATCGTTCAATAATAGCTTACAAACCCTGCTTGAACTGGTAATAACGCCCCTGTCTGGCAAGCAGTTCTGCGTGAGTACCTTGCT
+CAATAATTTGCCCGTTGTCCATCACTATTATTTGTTGGAAACGAGAGAGTCCGCGAAGTCGATGGGTGACCATTAACACCGTTTTCTCACGCATCATTTC
+TGCAAGCAATTCAAGGATCTGGCTTTCGGTTGTGGCATCTAAGCCTTCGGTAGGTTCATCCAGCAACACCAGTGGCGCATCATGTAACAGCGCACGGGCG
+ATAGCCAGACGGCGCAGTTCACCACCGGAGAGCTGGCGTCCGCCTTCACCTAACCAACTGTTGAGACCTGCATCCTCGAGCAGCTTTTCCAGGCCAACGC
+GACGCAAGATCTCCGACAGAGCCTCATCACTACTGCCAGGCGAGGCGAGTAAAGATTATCACGCAGCGTGGCGCTAAACAGATGCACTCGCTGAGGAACA
+ACGCTGATGGTCTGTCGTAGAGCCGCTTCATTCAGGCTGGCTATGGGGCTATCGTTAAGCAAAATCTCGCCCTGTTGCGGGTCCCATGCGCGGGTCAGCT
+GTTGTAACAGTGTTGATTTGCCGCATCCGGTTCGCCCGAGAATCGCTATATGTTCCCCGGCGTTTACCTGAAGAGAAATCCCTTTAAGTGCCTGTTGAGA
+TTGCTCCGGATAAGTGAACTGAACATCCCGTAACGTCAGCGAAACGCGATCGGCAACACGAGTTTGGGTATCAGGAAAGGTGACCTCCGGTTTTGATCCG
+TTAAGTCAGAGATACGTACGGCAGAGGCAATGACTTGCCCCAGATGCTGAAATGCACCCGTTACTGGTGCCAGTGCTTCAAACGCGGCTAACGCGCAGAA
+GACAAACAGGGCAATTAACGCGCCGGGTTGAGCATTGCCGCCAACGCCGCCAGACGCCATCCACAGCATCAGGATCACCGCTAACGCGCCAATGAGCAGC
+ATTATCGCTTGCGACAATGCGGTCAGTTCAGATTGACGGCGTTGCGCTTCCAGCCATTGAATTTCTGTATTCTCTAGTTGCGTGCGATAACGATCGCTGG
+CACCAAAATGGTCAGCTCAGCTTGCCCTTGCAGCCAGGCCGTCAGTTGTTGGCGATACTGTCCGCGAAGATGAGTCAGATTTTGCCCGGTGCTTTTTCCC
+GCACGATAAAACAGCGGTGGCATCAGGAAAAGCGTCAGTAACATAATGCCGCCCAGCGTAAAGGCGAGGGTGAAATCAAGGAAACTTAACCCGATTGTCA
+CCACCATAATCACCACAAAAGCGCCCACCAGCGGCGAGATAACGCGCAGGTAAAGATGATCGAGCGTATCAACATCCGCCACCACGCGATTGAGCAATTC
+GCCCTGACGATAGCGCGCCAGTCCGGCAGGGGAGAGGGGCAGCAATTTGCTGAAGGTGTAAATGCGCAGATGCTGCAACACGCGGAAAGTCGCGTCGTGA
+CTTACCAGACGTTCAAAATAGCGCCCGGCAGTACGGGTGATTGCTGCGCCACGCACGCCCGCAGCGGGTAGCATATAGTTGAAGCTGTACAGTCCGGCAA
+CCCCGCAACCGCTGAGGCCGAGAGGAACCAGCCGGAAAGTGTCAACAGACCGATACTGGCGAGCAGCGTCACAATTGCCAGCACAATACCAAGACTTAAC
+ATCCATTTATGACGTTTATACAGTGCCAGATAGGGTAGCAAAGCGCGCATTTAAATCTCCTCCTGACGATGGGCCAGTAATGTGGCGAATGGGCCACCAG
+CCACACTTAATTCCGCGTAACGTCCTTGCTCAATAATCCGGCCATCCTGCATAACCCAAATGACATCCCAGTCAGCAAGATCTTCTAACTGGTGGGTGAC
+CATTAACGTTGTCTGGCGCAGAGAGGCGGCATTCAGCGCCTCCATTACGCGCTGTTCACTGTGAGCATCAAGGCTGGCAGCGGGTTCATCCAACAGTAAT
+AGCGAACAGGATTTAGTAACGCACGGGCCACCGCCACGCGCTGCGCCTGCCCCACGGAAAGGCGGGCAGCCTGGTCGCCAACAGGCGTATCAACGCCTTG
+TGGGAGGAGCGGTAGAAACTCGCTGACCCAGGCGTTATCCAGCGCTGCTTGTAATTCTTGTTCGCTGGCATCAGGTCGCGCCAGTAGTACGTTATCCCGC
+AATGTTGCTGCCGGTAATTGTGGGTTTTGCCCAACCCAGGAGAGATGTTTACGCCATGATTCTGGTGATAAATCGCGTAATTCTATCCCGTTGATTCGTA
+GCGATCCCTGATATGAGAGAAAACCAGAAAGCGCGTTCAGCAGTGAGCTTTACCTGAACCGCTGCGACCAACCAACACCGCACGTTGGCCTGCTGGCAAA
+GTAAAGTTCAGCGGTCCGGCCAGCGTTTTACCTTCCGGCGACGTGATAAACAGCTCCTCGGCCTCAATGGTCACCGGATCGGTCGATGCTAATTCCGCCT
+CACCACGTTGCGGATGGGCGAGCGGGGTTTCCATAAACGTTTTCAGACTGTCAGCTGCGCCAACAGCCTGGGCTTTAGCATGATAAAACGTACCGAGATC
+GCGTAATGGCTGGAAAAACTCTGGCGCAAGGATCAGGGCCAGAAAACCCGCAGCCAGCGTCACACCGGTATCGTAGTGACCAAAATCCAGCTCGCCGAGA
+TAGGAAAACCAAAGTAGACCGCCACCAGAGCAATTGACAGCGAGGTAAAAATTCGAGAATGCCGGAGGATAAAACGCCAGCCGTAGCACTTCCATTGTCC
+GTTGGCGGAAATCTTCCGAAGCAGAACGAATACTTTCAATTTCAGCTTCACCACGACCAAAAATACGCAATGTTTCCATGCCGCGCAGGCGATCGAGGAA
+ATGCCCACTTAAGCGAGCAAGAGCGAGAAAGTTACGTCGGTTAGCATCGGCAGCCCCATTCCAACCAGCGCCATAAACAACGGAATTAACGGTGCAGTGC
+CCAGCAGAATGAGCGCCGCAGCCCAGTTAGAGGGAAGATTGCCACCACAATCAGCAACGGCACCGACACTGCCAGCGCCATTTGCGGCAGATAGCGTGCA
+TAGTAATCATGCATATCGTCAATTTGCTCGAGTACCAGCGTCGCCCAGCTCCCCGCAGGTTTACCCTGAATCCACGCTGGCCCTGCTTGTTGCAGACGGT
+CGAGAACCTGACGGCGGATGGCAAAGCGGATATGCTGCCCGGCGTGATAACCCACCCGTTCGCGTAACCAGACCACCCATGCGCGCAGTACAAAGGTCAG
+AACCAGTAACGTAAAGGGAAGCAGCAGGGCTTCACGGGGAATATTCTCCATAATCATATGTTGCAGAATTCGCGCCATGAACCAGGCCTGGGCAATGATC
+AATATGCCGCTCACAAAGCCCAGCAGACGAGAAATATTCAGCCAACGTTGGGAGATGACGCTTTGCTGTTTTAACCAGCGGGTTAACTCTTTTGACGAGA
+TTTATTCATTGCACGCTTAGCAGGTGAGTTATCAGAATTATTTGCAGAGCAATGTTACAACGGGGAAAATAAAGGCGACCCATAGTCGCATGGTGTCGCC
+TTCTTTACTTTTGTTACTGATTTGTAAAATTATTTTGCGTCAGCTAAACCATCGAGGTAGCGTTCCGCATCAAGTGCTGCCATGCAGCCTGTACCGGCCG
+AAGTAATGGCCTGGCGATAAATGTGATCCATCACGTCGCCTGCGGCAAAGACGCCAGGAATGCTGGTCTGGGTGGCATTACCATGAATACCCGACTGTAC
+TTTGATGTAGCCGTTTTCCAGTTCCAGCTGCCCTTCGAAAATCGCAGTATTCGGGCTGTGACCGATAGCAACAAACAGACCGGCAACGTCGAGTGACTCG
+ATGTTATCGCTGTTTTGCGTATCGCGCAGACGAACGCCAGTGACACCCATTTGATCGCCGGTCACTTCTTCCAGCGTACGGTTGGTGTGCAGAATGATGT
+TGCCGTTCTCCACTTTATCCATCAGGCGCTTAATGAGGATTTTTCCGCGCGGAAACCGTCACGGCGGTGAATCAGATGCACTTCCGAAGCGATGTTAGAC
+AGATACAGCGCCTCTTCAACCGCGGTATTGCCGCCGCCGATGACCGCAACTTTCTGGTTGCGATAGAAGAAACCGTCGCAGGTTGCACAAGCAGAAACCC
+CACGGCCTTTAAAGGCTTCTTCAGAGGGCAGGCCGAGATAGCGTGCAGAAGCTCCGGTGGCAATAATCAGCGCGTCGCAAGTGTATTCGCCGTTATCGCC
+ATTCAGACGGAACGGACGGTTTTGCAGATCCACCTTGTTGATATGATCAAAAATGATCTCAGTTTCAAACTTGGTGGCATGTTCGTGCATGCGCTCCATT
+AATAACGGACCGGTCAGATCGTTTGGATCGCCAGGCCAGTTTTCCACTTCCGTGGTGGTGGTCAGTTGGCCGCCTTTTTCCATGCCGGTAATCAGCACAG
+GTTGCAGGTTGGCGCGCGCCGCGTAGACAGCAGCGGTGTATCCCGCCGGGCCTGAACCCAGGATAAGCAGTTTACTGTGTTTGGTCGTGCCCATGAGATC
+CCCATAGTTGTTGGCAGACAATGGGCAGGATTGTAGGGAATTTACAGACGTAAAAAGAGTATGACGATTTTGTTAACAATTTGTGCAATCGGCAGCATCG
+ATAAGCAGGTCAAATTCTCCCGTCATTATCACCTCTGCTACTTAAATTTCCCGCTTTATAAGCCGATTAAATGATGAATAAACGCCCTGTTAATGAATAT
+CTGGCATGTTGTACTAAAATCGATGTTTTGCTTTGACAATCCCTGGTGTTTTGCGAAAACATTCGAGGAAGAAAAAACAGTATTCTTATATGCGCATAAC
+CATGCATGTAAATACCATGTTTACCGTGCTAGTGAAATCTACGTATGGCGTGGACAGACGCCATTCGTGATGTCGATAGCTGCCACAAGGCAACGGTCTT
+CTCACCGTAGACCCAGGCATTGCGCGCCGTGAATCTTCATGATTTCGGTCTATCGTGACGGGTAGCGACTCTGAACAGTGATGTTTCAGGGTCAGACAGG
+AGTAGGGAAGGAATACAGAGAGACAATAATAATGGTAGATAGCAAGAAGCGCCCTGGCAAAGATCTCGACCGTATCGATCGTAACATTCTTAATGAGTTG
+CAAAGGATGGGCGTATTTCTAACGTCGAGCTTTCTAAACGTGTGGGACTTTCCCCAACGCCGTGCCTTGAGCGTGTGCGTCGGCTGGAAAGACAAGGGTT
+TATTCAGGGCTATACGGCGCTGCTTAACCCCCATTATCTGGATGCATCACTTCTGGTATTCGTTGAGATTACTCTGAATCGTGGCGCACCGGATGTGTTT
+GAACAATTCAATACCGCTGTACAAAACTTGAAGAAATTCAGGAGTGTCATTTAGTATCCGGTGATTTCGACTACCTGTTGAAAACACGCGTGCCGGATAT
+GTCAGCCTACCGTAAGTTGCTGGGAAACCCTGCTGCGTCTGCCTGGCGTCAATGACACACGGACATACGTTGTTATGGAAGAAGTCAAGCAGAGTAATCG
+TCTGGTTATTAAGACGCGCTAACACGGAACAGGTGCAAAATCGGCGTATTTTGATTACACTCCTGTTAATCCATACAGCAACAGTACTGGGGTAACCTGG
+TACTGTTGTCCGTTTTAGCATCGGGCAGGAAAAGCCTGTAACCTGGAGAGCCTTTCTTGAGCCAGGAATACATTGAAGACAAAGAAGTCACATTGACAAA
+GTTAAGTAGCGGCCGCCGCCTTCTGGAGGCGTTGCTGATCCTTATTGTCCTGTTTGCCGTCTGGTTGATGGCTGCCTTACTAAGCTTTAACCCTTCGGAC
+CCCAGCTGGTCGCAAACGGCCTGGCATGAACCTATCCATAATTTAGGTGGGATGCCCGGTGCGTGGTTGGCAGATACGCTGTTCTTTATTTTTGGCGTGA
+TGGCTTACACCATTCCCGTCATTATTGTCGGCGGTTGTTGGTTTGCCTGGCGTCATCAGTCCAGCGACGAATACATTGATTATTTTGCCGTTTCGCTACG
+CATCATTGGCGTTTTGGCGCTCATCCTTACCTCCTGTGGTCTGGCGGCAATCAACGCTGACGATATCTGGTATTTTGCCTCCGGTGGCGTCATTGGCAGC
+TTACTAAGCACTACGCTACAACCACTGCTACACAGTAGCGGGGAACTATTGCGCTGCTCTGCGTTTGGGCAGCGGGCCTGACGTTGTTCACCGGTTGGTC
+ATGGGTGACCATTGCTGAAAAACTCGGCGGCTGGATTTTAAACATTCTCACCTTCGCCAGTAATCGTACCCGTCGCGATGATACCTGGGTCGATGAAGAT
+GAGTATGAAGACGACGAAGAGTATGAAGATGAAAATCACGGCAAACAGCATGAATCACGCCGTGCCCGTATTCTTCGCGGCGCGCTAGCGCGTCGTAAAC
+GGTTGGCGGAAAAATTCATTAATCCGATGGGGCGGCAAACAGACGCTGCGTTGTTCTCCGGTAAGCGGATGGATGATGACGAAGAGATTACCTACACTGC
+ACGCGGTGTGGCTGCCGACCCGGACGACGTCCTATTTTCGGGCAATCGTGCAACGCAGCCAGAATATGACGAATACGATCCATTATTAAACGGTGCGCCA
+ATTACCGAACCTGTCGCTGTAGCAGCTGCTGCTACCACGGCGACACAAAGCTGGGCTGCGCCGGTTGAACCTGTGACTCAGACGCCGCCTGTTGCCTCTG
+TTGATGTTCCACCTGCGCAACCTACAGTAGCCTGGCAGCCTGTACCGGGTCCACAAACGGGAGAGCCGGTTATTGCTCCTGCACCGGAAGGTTACCCACA
+GCAGTCACAATATGCGCAGCCTGCAGTGCAATATAATGAGCCGCTGCAACAACCAGTACAGCCGCAGCAGCCGTATTATGCACCTGCAGCTGAACAACCT
+GCGCAACAGCCGTATTATGCCCCTGCGCCAGAACAACCGGTGGCAGGTAACGCCTGGCAAGCCGAAGAGCAGCAATCCACTTTTGCTCCACAGTCTACAT
+ACCAGACTGAGCAAACTTATCAGCAGCCAGCCGCTCAGGAGCCGTTGTACCAACAGCCGCAACCCGTTGAACAGCAGCCTGTTGTGGAGCCTGAACCCGT
+TGTAGAAGAGACAAAACCCGCGCGTCCGCCGCTTTACTACTTTGAAGAAGTTGAAGAGAAGCGAGCCCGTGAACGTGAACAACTTGCGGCCTGGTATCAA
+CCGATTCCAGAACCGGTTAAAGAACCAGAACCGATCAAATCTTCGCTGAAAGCACCTTCTGTTGCAGCAGTACCTCCAGTAGAAGCCGCTGCCGCTGTTT
+CCCCGCTGGCATCTGGCGTGAAAAAGCGACACTGGCGACGGGGCTGCCGCAACCGTTGCCGCGCCAGTCTTCAGTCTGGCAAATAGCGGTGGACCGCGTC
+CTCAGGTCAAAGAGGGATTGGTCCGCAGTTGCCACGACCGAAACGTATCCGCGTGCCAACTCGTCGTGAACTGGCGTCTTACGGTATTAAGCTGCCCTCA
+CAGCGTGCGGCGGAAGAAAAAGCCCGTGAAGCCCAGCGCAATCAGTACGATTCTGGCGATCAGTACAACGATGATGAAATCGATGCGATGCAGCAGGATG
+AACTGGCACGTCAGTTCGCCCAGACACAGCAGCAACGCTATGGCGAACAGTATCAACATGATGTGCCCGTAAACGCAGAAGATGCAGATGCTGCGGCAGA
+GGCTGAACTGGCTCGTCAGTTTGCGCAAACTCAACAACAACGTTATTCCGGCGAACAACCGGCTGGGGCGAATCCGTTCTCGCTGGATGATTTTGAATTT
+TCGCCAATGAAAGCGTTGCTGGATGATGGTCCACACGAACCGTTGTTTACGCCAATTGTTGAACCTGTACAGCAGCCGCAACAACCGGTTGCACCGCAGC
+AGCAATATCAGCAGCCGCAACAACCAGTTCCGCCGCAGCCGCAGTATCAGCAGCCACAACAGCCGGTTGCGCCGCAGCCACAATATCAGCAGCCGCAACA
+ACCGGTTGCGCCACAGCAGCAATATCAGCAGCCGCAACAACCGGTTGCGCCGCAGCAGCAGTATCAGCAGCCACAACAGCCAGTTGCGCCACAACCGCAG
+GATACCCTGCTTCATCCGCTGTTGATGCGTAATGGCGACAGCCGTCCGTTGCATAAACCGACGACGCCGCTGCCTTCTCTGGATTTGCTGACACCGCCGC
+CGAGCGAAGTGGAGCCGGTAGATACCTTTGCGCTTGAACAAATGGCTCGCCTGGTGGAAGCGCGTCTGGCTGATTTCCGTATTAAAGCCGATGTCGTCAA
+TTACTCTCCGGGGCCGGTTATCACTCGCTTTGAATTGAACCTGGCACCGGGCGTAAAAGCGGCGCGCATTTCTAACTTGTCACGGGACCTTGCCCGTTCA
+CTTTCGACGGTGGCGGTGCGTGTCGTTGAAGTTATTCCTGGCAAACCCTATGTAGGTCTGGAGTTACCGAATAAAAACGACAAACCGTTTATCTGCGCGA
+AGTTTTGGATAACGCCAAATTCCGCGATAATCCGTCGCCATTAACCGTGGTGCTGGGTAAAGATATCGCCGGTGAGCCGGTGGTTGCCGATCTGGCGAAA
+ATGCCGCACTTGTTGGTTGCGGGGACTACCGGTTCCGGTAAATCTGTCGGTGTGAACGCGATGATCCTGAGCATGCTTTATAAAGCACAGCCAGAAGATG
+TGCGTTTCATCATGATCGACCCGAAAATGCTGGAGCTTTCGGTTTATGAAGGCATTCCGCATCTGTTAACGGAAGTCGTTACTGATATGAAAGATGCCGC
+CAACGCGCTGCGCTGGTGTGTTAACGAGATGGAGCGTCGGTATAAACTGATGTCTGCGCTGGGTGTGCGTAATCTGGCGGGTTATAACGAAAAATTGCTG
+AAGCCGATCGCATGATGCGTCCGATTCCAGACCCGTACTGGAAGCCGGGTGACAGTATGGATGCCCAGCATCCGGTGCTGAAAAAGAACCATACATTGTG
+GTGTTGGTTGACGAATTTGCCGACCTGATGATGACGGTAGGTAAAAAGTGGAAGAGCTGATAGCACGTCTGGCGCAAAAGCCCGTGCCGCGGGTATCCAC
+CTCGTACTGGCAACTCAGCGTCCATCGGTTGATGTTATTACTGGTCTGATTAAAGCGAATATTCCGACCCGTATCGCCTTTACCGTATCCAGTAAGATTG
+ACTCACGTACCATTCTTGATCAGGCTGGCGCGGAATCACTGCTGGGTATGGGGATATGCTCTACTCTGGGCCGAACTCCACGTTGCCGGTACGTGTCCAT
+GGTGCTTTTGTTCGCGATCAGGAAGTTCATGCCGTGGTGCAGGACTGGAAAGCGCGTGGTCGCCCACAGTATGTTGATGGCATCACCTCCGACAGCGAAA
+GCGAAGGTGGTGCGGGTGGTTTCGATGGCGCTGAAGAACTGGATCCGTTGTTCGATCAGGCGGTGCAGTTTGTCACTGAAAAAAAGCGTCAATTTCTGGC
+GTACAGCGTCAGTTCCGCATTGGTTATAACCGTGCAGCGCGTATTATCGAACAGATGGAAGCGCAGGGATTGTCAGCGAACAGGGGCACAACGGTAATCG
+TGAAGTGCTGGCCCCACCGCCGTTTGACTAACTAATGCATCGTATGCCGGATAAGGCGCGGTAGCGTCGCATCCGGCACTCTATCAACTGAAAATTCAGT
+ATTTTCTTCTTTCCTCAAGCTGATTATTAGCCTGGAATAGAGAGTAGAGGAACTCCCGATCGGGAGTGACGTAATTTGAGGAATAATGATGAAAAAATTG
+CCATCACCTGTGCATTACTCTCAAGCTTAGTAGCAAGCAGCGTTTGGGCTGATGCCGCAAGCGATCTGAAAAGCCGCCTGGATAAAGTCAGCAGCTTCCA
+CGCCAGCTTCACACAAAAAGTGACTGACGGTAGCGGCGCGGCGGTGCAGGAAGGTCAGGGCGATCTGTGGGTGAAACGTCCAAACTTATTCAACTGGCAT
+ATGACACAACCTGATGAAAGCATTCTGGTTTCTGACGGTAAAACACTGTGGTTCTATAACCCGTTCGTTGAGCAAGCTACGGCAACCTGGCTGAAAGATG
+CCACCGGTAATACGCCGTTTATGCTGATTGCCCGCAACCAGTCCAGCGACTGGCAGCAGTACAATATCAAACAGAATGGCGATGACTTTGTCCTGACGCC
+GAAAGCCAGCAATGGCAATCTGAAGCAGTTCACCATTAACGTGGGACGTGATGGCACAATCCATCAGTTTAGCGCGGTGGAGCAGGACGATCAGCGCAGC
+AGTTATCAACTGAAATCCCAGCAAAATGGGGCTGTGGATGCAGCGAAATTTACCTTCACCCCGCCGCAAGGCGTCACGGTAGATGATCAACGTAAGTAGA
+GGCACCTGAGTGAGCAATCTGTCGCTCGATTTTTCGGATAATACTTTTCAACCTCTGGCCGCGCGTATGCGGCCAGAAAATTTAGCACAGTATATCGGCC
+AGCAACATTTGCTGGCTGCGGGAAGCCGTTGCCGCGCGCTATCGAAGCCGGGCATTTACATTCTATGATCCTCTGGGGCCGCCGGGTACCGGCAAAACAA
+CTCGCTGAAGTGATTGCCCGCTATGCGAACGCTGATGTGGAACGTATTTCTGCCGTCACCTCTGGCGTGAAAGAGATTCGCGAGGCGATCGAGCGCGCCC
+GGCAAAACCGCAATGCAGGTCGCCGCACTATTCTTTTGTTGACGAAGTTCACCGTTTCAACAAAAGCCAGCAGGATGCATTTCTGCCACATATTGAAGAC
+GGCACCATCACTTTTATTGGCGCAACCACTGAAAACCCGTCGTTTGAGCTTAATTCGGCACTGCTTTCCCGTGCCCGTGTCTATCTGTTGAAATCCCTGA
+GTACAGAGGATATTGAGCAAGTACTAACTCAGGCGATGGAAGACAAAACCCGTGGCTATGGTGGTCAGGATATTGTTCTGCCAGATGAAACACGACGCGC
+CATTGCTGAACTGGTGAATGGCGACGCGCGCCGGGCGTTAAATACGCTGGAAATGATGGCGGATATGGCCGAAGTCGATGATAGCGGTAAGCGGGTCCTG
+AAGCCTGAATTACTGACCGAAATCGCCGGTGAACGTAGCGCCCGCTTTGATAACAAAGGCGATCGCTTTTACGATCTGATTTCCGCACTGCATAAGTCGG
+TACGTGGTAGCGCACCCGATGCGGCGCTGTACTGGTATGCGCGAATTATTACCGCTGGTGGCGATCCGTTATATGTCGCGCGTCGCTGTCTGGCGATTGC
+GTCTGAAGACGTCGGTAATGCCGATCCACGGGCGATGCAGGTGGCAATTGCGGCCTGGGATTGCTTTACTCGCGTTGGCCCGGCGGAAGGTGAACGCGCC
+ATTGCTCAGGCGATTGTTTACCTGGCCTGCGCGCCAAAAGCAACGCTGTCTACACTGCGTTTAAAGCCGCGCTGGCCGATGCTCGCGAACGCCCGGATTA
+TGACGTGCCGGTTCATTTGCGTAATGCGCCGACGAAATTAATGAAGGAAATGGGCTACGGGCAGGAATATCGTTACGCTCATGATGAAGCAAACGCTTAT
+GCTGCCGGTGAGGTTTACTTCCCGCCGGAAATAGCACAAACACGCTATTATTTCCCGACAAACAGGGGCCTTGAAGGCAAGATTGGCGAAAAGCTCGCCT
+GGCTGGCTGAACAGGATCAAAATAGCCCCATAAAACGCTACCGTTAATGTTATCGTTGCGGTAATGTTGTTACTGTATCCCTGTGGTCGCAGGCTGTGGC
+CACATCTCCCATTTAATTCGATAAGCACAGGATAAGCATGCTCGATCCCAATCTGCTGCGTAATGAGCCAGACGCAGTCGCTGAAAACTGGCACGCCGGG
+GCTTTAAGCTGGATGTAGATAAGCTGGGCGCTCTTGAAGAGCGTCGTAAAGTATTGCAGGTCAAAACGGAAAACCTGCAAGCGGAGCGTAACTCCCGATC
+GAAATCCATTGGCCAGGCGAAAGCGCGCGGGGAAGATATCGAGCCTTTACGTCTGGAAGTGAACAAACTGGGCGAAGAGCTGGATGCAGCAAAAGCCGAG
+CTGGATGCTTTACAGGCTGAAATTCGCGATATCGCGCTGACCATCCCTAACCTGCCTGCAGATGAAGTGCCGGTAGGTAAAGACGAAAATGACAACGTTG
+AAGTCAGCCGCTGGGGTACCCCGCGTGAGTTTGACTTTGAAGTTCGTGACCACGTGACGCTGGGTGAAATGCACTCTGGCCTCGACTTTGCAGCTGCAGT
+TAAGCTGACTGGTTCCCGCTTTGTGGTAATGAAAGGGCAGATTGCTCGCATGCACCGCGCACTGTCGCAGTTTATGCTGGATCTGCATACCGAACAGCAT
+GGCTACAGTGAGAACTATGTTCCGTACCTGGTTAACCAGGACACGCTGTACGGTACGGGTCAACTGCCGAAATTTGCTGGCGATCTGTTCCATACTCGTC
+CGCTGGAAGAAGAAGCAGACACCAGTAACTATGCGCTGATCCCAACGGCAGAAGTTCCGCTGACTAACCTGGTGCGCGGTGAAATCATCGATGAAGATGA
+TCTGCCAATTAAGATGACCGCCCACACCCCATGCTTCCGTTCTGAAGCCGGTTCATATGGTCGTGACACCCGTGGTCTGATCCGTATGCACCAGTTCGAC
+AAAGTTGAAATGGTGCAGATCGTGCGCCCAGAAGACTCAATGGCGGCGCTGGAAGAGATGACTGGTCATGCAGAAAAGTCCTGCAGTTGCTGGGCCTGCC
+GTACCGTAAAATCATCCTTTGCACTGGCGACATGGGCTTTGGCGCTTGCAAAACTTACGACCTGGAAGTATGGATCCCGGCACAGAACACCTACCGTGAG
+ATCTCTTCCTGCTCCAACGTTTGGGATTTCCAGGCACGTCGTATGCAGGCACGTTGCCGCAGCAAGTCGGACAAGAAAACCCGTCTGGTTCATACCCTGA
+ACGGTTCTGGTCTGGCTGTTGGTCGTACGCTGGTTGCAGTAATGGAAAACTATCAGCAGGCTGATGGTCGTATTGAAGTACCAGAAGTTCTGCGTCCGTA
+TATGAACGGACTGGAATATATTGGCTAATACCCAATTTTTCTGAATCTAAAAGCGCCTGCGGGCGCTTTTTGTCTCCCTTGATACCGAACAATAATTACT
+CCTCACTTACACGTAATACTACTTTCGAGTGAAAATCTACCTATCTCTTTGATTTTCAAATTATTCGATGTATACAAGCCTATATAGCGAACTGCTATAG
+AAATAATTACACAATACGGTTTGTTACTGGAATCAATCGTGAGCAAGCTTGAGTGAGCCATTATGAAAACGAAAATCCCTGATGCGGTATTGGCTGCTGA
+GGTGAGTCGCCGTGGTTTGGTAAAACGACAGCGATCGGCGGCCTGGCAATGGCCAGCAGCGCATTAACATTACCTTTTAGTCGGATTGCGCACGCTGTCG
+ATAGCGCCATTCCAACAAAATCAGACGAAAAGGTTATCTGGAGCGCCTGTACAGTTAACTGTGGTAGTCGCTGCCCGCTACGTATGCACGTCGTGGACGG
+TGAAATCAAATATGTCGAAACGGACAATACCGGCGATGACAATTACGACGGCCTGCACCAGGTTCGCGCCTGCCTGCGTGGGCGTTCCATGCGTCGCCGT
+GTCTACAATCCGGACCGCCTGAAATATCCGATGAAACGAGTCGGGGCGCGCGGTGAAGGCAAATTCGAGCGCATTAGCTGGGAAGAAGCCTACGACATCA
+TCGCGACCAATATGCAGCGCCTGATCAAAGAGTACGGCAACGAGTCTATCTATCTGAACTATGGCACCGGTACGCTGGGCGGCACCATGACCCGCTCCTG
+GCCGCCGGGAAATACCCTGGTCGCGCGGCTGATGAACTGCTGCGGCGGCTATCTGAACCATTACGGCGACTACTCCTCCGCGCAAATTGCGGAAGGTTTG
+AACTATACCTACGGCGGCTGGGCAGATGGCAACAGCCCGTCGGATATCGAAAACAGTAAGCTGGTAGTGCTGTTTGGTAATAACCCTGGCGAAACGCGAA
+TGAGTGGCGGTGGGGTGACTTACTATCTTGAACAGGCACGCCAGAAATCTAATGCCCGCATGATCATCATCGATCCGCGCTATACCGACACCGGTGCCGG
+GCGCGAAGATGAGTGGATCCCTATTCGTCCGGGAACAGATGCCGCACTGGTTAACGGTCTGGCGTACGTCATGATCACTGAAAACCTGGTGGATCAGGCA
+TTCCTCGATAAATATTGCGTTGGCTACGATGAGAAAACCCTGCCAGCCAGTGCGCCGAAAAATGGCCACTATAAAGCTTATATTCTGGGTGAAGGGCCAG
+ATGGCGTGGCTAAAACGCCGGAATGGGCCTCGCAAATCACTGGTGTTCCGGCAGACAAAATCATCAAATTGGCTCGTGAAATCGGTAGTACCAAACCGGC
+GTTTATCAGCCAGGGATGGGGCCCGCAGCGTCACGCTAACGGTGAAATCGCAACCCGTGCTATCTCGATGCTGGCGATTCTGACCGGTAACGTTGGTATT
+AACGGAGGCAACAGCGGCGCGCGTGAAGGTTCATACAGCTTACCGTTTGTCCGTATGCCGACCTTGGAAAACCCGATCCAGACCAGCATTTCGATGTTTA
+TGTGGACCGATGCCATTGAACGTGGCCCGGAAATGACGGCGCTGCGTGATGGTGTACGCGGGAAAGATAAGCTGGATGTGCCGATCAAAATGATCTGGAA
+CTATGCCGGTAACTGCCTGATTAACCAGCATTCTGAAATCAACCGTACCCATGAAATCCTTCAGGATGATAAGAAGTGCGAGCTGATTGTGGTTATCGAC
+TGCCACATGACCTCATCGGCGAAATATGCTGACATCCTGCTGCCTGACTGCACCGCTTCCGAACAGATGGACTTTGCGCTGGATGCATCCTGCGGGAATA
+TGTCTTACGTGATTTTCAACGATCAGGTGATTAAACCGCGCTTTGAATGTAAGACCATCTATGAAATGACCAGCGAACTGGCAAAACGTCTTGGCGTTGA
+GCAACAGTTTACTGAAGGCCGTACCCAGGAAGAGTGGATGCGGCATCTGTATGCCCAGTCGCGGGAAGCGATTCCTGAACTGCCAACGTTTGAAGAGTTC
+CGCAAGCAGGGGATCTTTAAAAGCGCGACCCACAAGGGCATCACGTTGCTTATAAAGCCTTCCGTGAAGATCCGCAGGCAAACCCACTGACTACGCCATC
+GGGCAAAATTGAGATTTATTCGCAGGCGCTGGCTGACATTGCCGCTACCTGGGAATTGCCTGAAGGCGATGTGATCGATCCACTGCCGATCTACACGCCG
+GGCTTTGAAAGTTATCAGGATCCGCTGAACAAACAGTATCCGCTGCAGCTTACAGGTTTCCACTATAAATCTCGCGTTCACTCAACTTACGGCAACGTTG
+ATGTGCTGAAAGCGGCTTGCCGTCAGGAAATGTGGATCAACCCGCTTGATGCCCAAAACGCGGTATCCACAACGGCGATAAAGTCAGGATCTTTAACGAT
+CGTGGTGAGGTTCATATTGAGGCGAAAGTGACGCCACGAATGATGCCGGGTGTGGTCGCACTGGGTGAAGGTGCCTGGTATGACCCGGATGCAAAACGTG
+TCGATAAGGGTGGTTGTATTAACGTACTGACCACTCAACGTCCGTCTCCTCTCGCTAAGGGAATCCGTCACATACAAACCTTGTTCAGGTTGAAAAGGTG
+TAAGGAGTAACCGATGACAACCCAGTATGGATTTTTATTGATTCCAGCCGTTGCACCGGTTGCAAAACCTGCGAGCTGGCCTGTAAAGACTACAAAGATT
+TGACGCCAGAAGTCAGCTTCCGCCGCATTTATGAATATGCTGGCGGCGACTGGCAGGAAGATAACGGTGTCTGGCACCAGAACGTGTTTGCCTACTATCT
+GTCGATTTCATGTAACCACTGCGAAGATCCGGCTTGTACTAAAGTCTGCCCGAGCGGTGCGATGCATAAACGTGAAGATGGTTTTGTTGTGGTCGATGAA
+GATGTGTGCATTGGCTGCCGCTACTGCCATATGGCTTGCCCGTATGGCGCACCGCAATATAACGAAACGAAAGGCCATATGACCAAATGCGATGGTTGTT
+ATGACCGTGTTGCGGAGGGTAAAAAGCCGATCTGTGTTGAATCTTGTCCGCTGCGGGCGCTGGATTTCGGCCCTATCGACGAGCTGCGTAAAAACATGGC
+GATCTGGCGGCCGTTGCGCCGTTGCCGCGAGCTCACTTTACCAAACCGAATATTGTGATCAAACCCAATGCCAATAGCCGCCCGACCGGGGATACCACTG
+GCTATCTGGCAAACCCGAAGGAGGTGTGAGATGGGAAGTGGATGGCATGAATGGCCGCTGATGATCTTCACGGTCTTCGGGCAATGTGTAGCAGGTGGTT
+TTATCGTTCTGGCTTTGGCGCTGCTCAAAGGCGACCTGCGAGCAGAAGCCCAGCAGCGTGTTATCGCCTGCATGTTTGGTTTATGGGTGCTGATGGGCAT
+TGGCTTTATCGCCTCTATGCTCCATCTTGGTTCACCAATGCGCGCTTTTAACTCGCTCAACCGGGTAGGGGCTTCAGCACTCAGTAACGAAATCGCCAGC
+GGTTCGATCTTTTTGCCGTAGGCGGCATCGGCTGGTTGCTGGCAATGCTGAAAAAGCTGTCACCGGCATTGCGTACGCTGTGGCTGATAGTGACGATGGT
+TCTTGGCGTCATCTTTGTCTGGATGATGGTGCGTGTGTATAACAGCATTGATACCGTTCCGACCTGGTACAGCATCTGGACGCCGATGGGCTTCTTCCTG
+ACGATGTTTATGGGCGGCCCGTTACTGGGTTACCTGTTGTTGAGTCTGGCTGGCGTCGATGGCTGGGCGATGCGTCTGCTGCCAGCAATTTCTGTACTGG
+CACTGGTAGTGAGTGGCGTGGTGTCAGTGATGCAGGGCGCAGAGCTGGCGACTATTCATAGTTCTGTGCAGCAGGCCGCAGCGCTGGTGCCGGACTATGG
+TGCGCTGATGTCCTGGCGGATCGTGCTTTTGGCCGTTGCCCTGTGCTTGTGGATTGCACCACAGCTAAAGGTTATCAGCCTGCGGTTCCGCTACTTTCTG
+TATCATTCATTCTGCTTCTGGCAGGGGAATTAATCGGTCGCGGCGTATTCTATGGTTTGCATATGACCGTGGGGATGGCCGTCGCAAGCTAATCATAACA
+ACCGGGGTTTCGGCCCCGGTTCTCTTTATTTCTGCTTCGTTAACGTGTCATAACTGGTCATCAAATTACGATAATCAGGAATGTGGTTAGAGAACAACGT
+CGCCAGTCCTTCAATATCATTACGCCAGTCGCGATGCAGCTCGCACGCCACGCCGAACCATGTCATCAATTGCGCACCAGCTTGCGACAAGCGATCCCAT
+GCCGAATGCCGGGTAATTTCATTAAAGGTCCCTGACGCGTCAGTCACGACAAAGACGTCAAACCCTTCTTCAATGGCTGAAAGCGCCGGGAATGCCACGC
+AAACTTCGGTTACCACACCGGCAATAATTAACTGTTTTTACCTGTCGCTTTGACAGCTTTTACAAAATCTTCGTTATCCCAGGCGTTAATATTTCCCGGG
+CGAGCAATGTAAGGTGTATCGGGGAATTGTGCTTTCAGTTCTGGAACTAATGGGCCGTTAGGACCGGTTTCAAAACTGGTGGTAAGAATAGTTGGTAAGT
+TGAAATACTTAGCCAGGTCACCCAGCGCCAGCACGTTATTTTAAACTTATCGGGTTCGATATCCCGTACAAGGGAAAGTAAACCAGCCTGGTGATCAACA
+AGCAAAACGGCAGCATCATTTTTATCAAGACGAACATACGGTTTGGTCATCCTCTTCTCCTTTCGAGAGTCAGTGGTACGTCTGAAATCGATCAGACGCG
+ATGCATTGCTCTGAAAGCATAGACGGGAAATATGAGTTTGCTGTGACCATGAAATTTTTCGACTGAACGAAGCGTATGAAATTTGTGTTAGTTCAATAAA
+ACAATCAGATGAGACTAATCATCTCTTCAGCATTAGCGTTATGAATGAGTAATATAAATCGATAATACCGCCGCTGGGATATCGCGTATTTTCACCCATT
+GACAATGTTTTTGGCGGTGGCATGATGCGCATGAAATTTGAACTTCCTCACGGTTTTAATTCATGTCCACGTATACCCAGCCTGTCATGCTTTTGCTGTC
+TGGCCTGCTTTTGTTGACTCTGGCGATTGCGGTGTTAAATACACTCGTGCCGCTTTGGCTCGCCCAGGAACACATGTCCACATGGCAGGTAGGCGTTGTC
+AGCTCATCCTATTTTACCGGCAACCTTGTCGGTACATTGCTGACAGGGTATGTCATTAAGCGCATTGGCTTTAACCGCAGCTATTATCTGGCCTCCTTCA
+TTTTTGCCGCTGGCTGTGCCGGCCTTGGCCTGATGATTGGATTCTGGAGCTGGTTGGCTTGGCGTTTTGTCGCGGGCGTCGGCTGTGCCATGATTTGGGT
+GGTTGTTGAGAGCGCGCTGATGTGCAGTGGGACGTCACGTAACCGTGGGCGTTTGCTTGCTGCGTATATGATGGTTTATTACGTGGGAACGTTTTAGGCC
+AGTTACTGGTCAGCAAAGTTTCAACCGAGCTGATGTCCGTATTGCCGTGGGTTACAGGTTTGACGTTGGCAGGATCTTACCGCTGTTGTTTACGCGTGTG
+CTGAATCAGCAGGCTGAAAACCATGATTCGACGTCAATTACGTCAATGCTAAAACTCCGTCAGGCGCGGCTTGGCGTGAATGGCTGCATTATCTCAGGAA
+TCGTTCTGGGATCTCTATATGGCCTGATGCCGCTGTACCTCAATCACAAAGGGTGAGCAATGCCAGCATTGGTTTCTGGATGGCGGTACTGGTCAGTGCG
+GGTATCCTTGGACAATGGCCGATTGGACGTCTGGCGGATAAGTTTGGTCGACTGCTGGTGTTGCGTGTTCAGGTCTTTGTCGTCATTCTCGGCAGTATCG
+CGATGCTTAGCCAGGCGGCGATGGCCCCAGCGTTATTCATCCTCGGTGCCGCTGGCTTTACGCTATATCCGGTGGCGATGGCATGGGCTTGCGAGAAAGT
+TGAACATCATCAACTGGTGGCGATGAACCAGGCCTTACTGTTGAGCTATACTGTGGGAAGTCTGCTTGGCCCGTCATTTACCGCTATGCTAATGCAGAAT
+TTCTCCGATAATTTATTGTTTATCATGATCGCCAGCGTATCGTTTATCTATTTGCTGATGCTGCTGCGCAACGCCGGTCATACGCCGAAACCCGTTGCTC
+ACGTGTAAATGAATTCAAGCAGAGTGTGAACTTACTGTTTCACACTCTGCTTTTTGTTTCTTCTATCTGACTTGCTTTATTCCAAATTTTATTCGTTTAA
+AAATAAAATGTGCAGCAGGTTATAATTTTGCATTTCGCTATTTCCGCACTTCTTATTTGCCGCGCATAATCCCTCGTTTTACCGATGCCCTTTAATTTTG
+GCGAAGGATTTGTCTATGGCTGGGAATGTTCAGGAAAAACAGTTGCGATGGTACAACATTGCGCTGATGTCTTTATCACTGTCTGGGGTTTTGGCAACGT
+TGTTAATAACTATGCCAACCAGGGGCTGGTGGTTGTTTTTCATGGGTGTTTATCTTTGCACTCTATTTCACACCTTATGCGCTAATTGTTGGTCAGTTAG
+GCTCGACCTTCAAAGATGGGAAGGGCGGGGTCAGTACCTGGATTAAACACACGATGGGACCCGGACTGGCTTATCTCGCCGCGTGGACCTACTGGGTGGT
+GCATATTCCCTATCTGGCACAAAACCCCAGGCAATTCTGATTGCGCTCGGTTGGGCGATGAAAGGCGACGGTTCGCTAATCAAAGAATATTCAGTCGTAG
+CGTTACAGGGTTAACGCTGGTGCTGTTTATCTTCTTTATGTGGGTTGCTTCACGCGGTATGAAATCGCTGAAAATCGTCGGTTCTGTGGCAGGGATTGCT
+ATGTTTGTTATGTCACTCCTGTATGTGGCGATGGCGGTAACCGCGCCTGCAATTACTGAAGTGCATATTGCGACCACAAACATTACCTGGGAAACGTTCA
+TTCCTCATATCGACTTTACCTACATTACCACTATTTCAATGCTGGTTTTCGCGGTTGGCGGAGCAGAGATTTCTCCTTACGTTAATCAAACGCGCAACCC
+AGGAAAAGAATTTCCAAAGGGATGTTATGCCTGGCGGTGATGGTTGCGGTTTGTGCCATTCTGGGCTCGCTGGCGATGGGGATGATGTTTGATTCGCGTA
+ATATCCCGGATGACTTAATGACCAACGGTCAGTATTACGCCTTTCAGAAGCTGGGCGAGTATTACAACATGGGTAATACTTTAATGGTGATTTACGCCAT
+TGCGAATACCCTGGGACAAGTAGCGGCGCTGGTATTCTCGATTGATGCCCCGCTTAAAGTGCTATTAGGTGATGCTGACAGCAAATATATTCCAGCCAGT
+TTATGTCGTACCAACGCTTCTGGTACGCCCGTTAATGGCTATTTTCTGACCCTGGTACTGGTGGCGATTCTGATTATGCTGCCGACTCTCGGCATTGGTG
+ATATGAACAATCTCTATAAATGGCTGTTGAACCTTAATTCGGTAGTGATGCCGCTGCGTTATTTATGGGTATTTGTTGCATTTATTGCAGTCGTTCGCTT
+GGCGCAGAAATATAAACCAGAATATGTCTTTATTCGTAATAAGCCTCTGGCAATGACCGTCGGGATTTGGTGTTTTGCCTTTACCGCCTTTGCCTGTTTG
+ACGGGGATCTTCCCGAAAATGGAAGCCTTCACTGCAGAGTGGACCTTCCAGTTGGCGCTGAATGTTGCAACGCCGTTTGTGCTGGTAGGATTAGGACTGA
+TATTCCCGCTGCTGGCGCGTAAAGCGAATAGTAAATAATTATTGTGGTCGGTGACGCTGACTCTGGCAGATCTGACCCGTTTTACATAATCGAGAAATGC
+GCGCAAGCCGCAGGACATATACTGGCGGTTTGGATAATAGATCTGGAAGCCTGGACGCTCTGTGCTCCAGTCTTCCAGTACACATTCTAAACGACCAGTA
+TCAAGGTACTCCTTGATCTGTTCATAGAGCAGATACCCGATACCAGCACCCATCAAAACGGCCTCCAGTTCAGCATCAACATCATCCAGAATGATATTTC
+CTGCGACAGCAATTTCCAGCTCCTTTGCAAATTGCCAGTGGAAAGGTTTGCCGCTGGGATAACGAAAACAACACATTGATGATTAAGCAGATCATGAGGA
+TGGCGGGGTTTGCCATATCTTGCAAAGTACTCTGGCGTTGCTGCTACACATAATTTCACTGGCGGGCCGATCGCCACGCTGATCATATCTTTTCGACGAT
+GCAACTAAGTCGAACGCCAGCGTCAAAGCCCTGTTGGACGATATCGACAAGAGAGTCGTCAGTTGTGAGCTCGACTTTAATATCAGGATATTCACGTGTG
+AAACCAACCAGTAAAGACATTAAAATATACGTGCAGCTACCCGGGCGGCATTGATTTTGAGCGTTCCTGTCGGTGTCAGACGAAAATCATTCATCTCATC
+TAACATGATCTGAATTTCGTCGAAAGCTGGGCGCAATCGTTCATAGAGATTAGAACCCGCTTCCGTTAACGATACGCTTCGGGTTGTCCGATTGAATAAG
+CGAATTTTAAGACGTTGTTCCAGTGTTTTAATACTATGGCTAATGGCGGACGAGGATAAGCCTAACTCATCGCCCGCTGCACGAAAGCTTTGATTACGGG
+CCACGGCAAAGAAAGTGGCAAAGTCAGACATATTCATCCGCATTAGTGAAAATCCTTCATTAACTCATCCTGAATCATCACGTTTACAGGATTATGCCGC
+CTGCGTAAAGTGCGCTCCAGAACTTAACGTGGAGGTAAAATTATGCAGTCTGAACGTATTTATTTGGTATGGGCCCATCCTCGTCATGATTCATTGACCG
+CACATATTGCTGATGCGATCCATCAGCGGGCAATGGAGCGGAAAATACAGGTGACGGAACTCGATTTATATCGGCGTAATTTCAACCCAGTGATGACGCC
+GGAAGATGAACCAGACTGGAAGAATATGGATAAACGTTATTCTCCAGAGGTTCATCAGCTTTATTCAGAGCTGCTTGAACATGACACGTTAGTGGTGGTT
+TTCCTCTCTGGTGGTACAGCTTCCCGGCAATGCTAAAGGATATATTGACAGAGTATGGAATAATGGGCTGGCTTATGGAGATGGGCACAAATTACCATTC
+AATAAAGTTCGTTGGGTGGCGCTGGTTGGAGGAGACAAAGAATCATTTGTCCAGATGGGCTGGGAAAAATATAAGCGATTATTTAAAAATATGTGCAGTT
+ATCTTGGTATTGAAGATGCCGATGTCACTTTCTTGTGTAATACAGTGGTATTCGATGGGGAAGAACTTCACGCGAGCTATTATCAGTCGTTATTATCTCA
+GGTACGGGATATGGTAGATGCACTATAAGATGTGTTAAAACGCTGTAGCAGAATGAAGCGCGGAATAAAAAGCGGCAACTCAATAAAGTTGCCGCTTTAC
+GGGAAATTAGAACATTACCTTATGACCGTACTGCTCAAGAATGCCTTTCACGCGTTCCATGGTCTCTTTCTTCGGTGGTTTAACACCGTCGAGTTTGTAC
+TCTTCACCCATTGCCACCCATTTGTGTTTGCCCAGCTCGTGGTAGGGGAGAAGCTCGATTTTCTCAACGTTGCCCATATCACGGGTAAATTCACCGAGGC
+GATGCGCTGAATCGTCATCGTCAGACCAGCCTGGGACAACAACGTAGCGGATCCACACCTTCACATTTTTGTTCGCCAGATATTTAGCGAACTCCAGCGT
+GCGGTGGTTGGAAACTCCAACCAGATTTTGGTGGATCTCGTCGTTCATCTGTTTGAGATCGAGCATTACCAGGTCGGTTACTTCCAGCAGTTCATCAATC
+ACCGGATCGTAACGACGAACAAAACCGTTGGTGTCCAGACAGGTATGAATGCCTTCTTTTTGCAGGCGCGGAACCAGTCACGAACAAACTCAGCTTGCAG
+GATTGCTTCACCGCCGGATGCGGTAACGCCGCCGCCGGAAGCGTTCATAAAGTGGCGATAGGTCACCACTTCCTTCATCAAATCTTCAACGGTAACTTCT
+TTACCGCCATGCGTGTCCCAGGTGTCGCGGTTATGACAATACAGGCAGCGCATCAGGCAGCCCTGGAAAAAGGTGATAAAGCGAATACCTGGGCCGTCTA
+CGGTTCCACAGGATTCAAAGGAGTGAATGCGACCAATAACTGACATTGCGGTGTTTCTCCAGATGTGGCCCATCTGAGGCCGTGTTGGTGCGCAGCTCGA
+AGGCTACGTCGAGTCTGTTTTGGCAGTCACCTTAAAGTATAGATAGCTGACAAAAGGCTCTCGCGCTAAAAGGCCCCACTTTCGTGGAGCCTTTATTGTA
+CGCTTTTACTGTACGATTTCAGTCAAATCTAATTACATAGATTGAGTGAAGGTACGAGTAATAACGTCCTGCTGCTGTTCTTTAGTCAGCGAGTTGAAAC
+GTACTGCGTAGCCAGATACACGGATGGTCAGCTGCGGATATTTTTCCGGGTTTTCCATCGCGTCGAGCAGCATTTCACGGTTCATCACGTTAACGTTCAG
+GTGCTGACCACCTTCGATGGATGCTTCGTGGTGGAAGTAACCATCCATCAGACCAGCCAGGTTGGTCTTACGAACTTCGTCGTCTTTACCCAGTGCGTTC
+GGAACGATAGAGAAGGTGTAGGAGATACCATCTTTAGCGTAAGCAAACGGCAGTTTAGCAACGGAAGTCAGAGAGGCTACTGCACCTTTCTGGTCACGAC
+CGTGCATCGGGTTAGCACCCGGTCCGAACGGCGCGCCAGCACGACGACCGTCTGGGGTGTTACCCGTTTTCTTACCATACACAACGTTAGAAGTGATGGT
+CAGAACAGACTGAGTCGGGATAGCGTCACGGTAGGTGTGCAGTTTCTGAATTTTCTTCATGAAACGTTCTACCAGGTCAACAGCCAGGTCATCTACACGC
+GGATCATTGTTACCAAACTGCGGGTATTCGCCTTCGATTTCGAAGTCGATAGCCAGACCGTCTTCGTCACGAATCGGTTTAACTTTCGCATATTTGATTG
+CAGACAGGAGTCAGCAGCAACGGACAGACCAGCGATACCACACGCCATGGTGCGGATAACGTCACGGTCGTGCAGCGCCATCAGAGAGGCTTCGTAGCTG
+TACTTGTCGTGCATGTAGTGGATGATGTTCAGTGCAGTGATGTACTGTTTAGCCAGCCAGTCCATGAAGTGATCCATGCGCTCCATCACTTCATCATAGT
+TCAGGACATCGCCTTTGATCGGTTCAGACTTCGGACCAACCTGCATTTTCAGTTTTTCGTCAACGCCGCCGTTGATTGCGTACAGCATGGTTTTCGCCAG
+GTTTGCACGCGCACCGAAGAACTGCATTTGTTTACCAACGATCATCGGGCTTACGCAGCAAGCAATAGCGTAGTCATCGTTGTTGAAGTCCGGACGCATC
+AGGTCATCGTTCTCATACTGCAGAGAAGAGGTGTCGATGGACACTTTAGCGGCGAATTTCTTGAAGTTCAGCGGCAGTTTTCAGACCACAGAATGGTCAT
+GTTCGGTTCCGGAGACGGACCCATGGTGTACAGGGTGTTCAGGAAACGGAAGCTGTTTTGGTAACCAGGGTACGACCGTCGAGGCCCATACCACCGATAG
+ATTCGGTTGCCCAGATCGGGTCGCCAGAGAACAGTTCATCGTATTCCGGAGTACGCAGGAAGCGAACCATACGCAGTTTCATGACCAGGTGGTCAACCAT
+TTCCTGCGCTTCTTGTTCGGTGATCTTGCCAGCTTTCAGGTCACGTTCGATGTACACATCCAGGAAGGTGGAGGTACGACCGAAGGACATTGCAGCACCG
+TTCTGAGACTTAACAGCAGCCAGGTAGCCGAAGTAAGTCCACTGGATAGCTTCCTGAGCGTTGGTAGCCGGACCAGAGATGTCGTAGCCGTATTTCGCAG
+CCATTTCTTTCATCTGACCCAGAGCGCGGTGCTGTTCAGCGATTTCTTCGCGCAGACGGATAGTCTGTTCCAGGTTTACGCCGTTTTCCAGATCAGCCTG
+CAGAGAAGTGAACTGTGCCAGTTTGTCTTTCATCAGGTAGTCGATACCGTACAGCGCAACGCGACGGTAGTCACCGATGATACGGCCACGGCCATATGCA
+TCTGGCAGACCGGTCAGAACACCAGATTTACGGCAACGCAGGATGTCCGGAGTGTAAACGTCGAACACGCCCTGGTTGTGAGTTTTACGGTATTCAGTGA
+AGATTTTTGATCATCGGATCCAGTTCGCGGTTGTACGCTTTGCAGGAACCTTCGATCATTTTGATACCACCGAACGGGATAAGAGCACGTTTCAGCGGAG
+CTTCAGTCTGCAGACCAACGATTTTCTCAAGCTGCTTGTTGATGTAGCCAGCGTCGTGAGAGGTGATGGTGGAAGCAACAGCGGTGTCAAAGTCAACTGG
+CGCGTGAGTGCGGTTTTCCAGTTTAACGCCTTCCATTACTTTGTCCCACAGGGTGGTGGTCGCTTCAGTAGCGCCAGCCAGAAGGACTCGTCACCCTCGT
+ACGGAGTGTAGTTTTTCTGAATGAAGTCACGGACGTTTACTTCATTCTGCCAGTCACCTTTGGTAAAACCTTCCCAGGCTGTGGCTAACTTTTCATTAAG
+CTCGGACATGTAACACCTACCTTCTTAAGTGGATTTTTATTTACTGCGTACTTCGACAACCATTAATGGTGGTCGTTTTCACGCAGGTAAATGACCCAGT
+ATGTCAACCCAACCAACAAACCACCACCGATAATGTTGCCGATCGTAACCGGAATCAGGTTATCAGTGATGAAATTCATCACGGTCAGGTGAGAAAAATT
+TTCCGGTGCAGAACCGACTGCGGTCCAAAATTCCGGGGATGCGAAGTCGCGGATTACAATACCCATCGGGATCATAAACATGTTTGCGATACTGTGCTCA
+AAACCGCTGGCAACAAACATCGCGACCGGCAGCACCATAATGAACGCTTTGTCCATCAGGCTGCGGCCAGAATAACTCATCCATACTGCCAGACATACCA
+TCAGGTTTGCCAGGATACCAAGACAGACGGCCTCAATAAAAGTATGGTGCACTTTGTGGTCGGCGGTTTGTAGGACGTTTAGTCCCCATTGACCATTTGC
+GGTCATATACTCGCCGGAAAGCCACATTAAAAGTACAAACAGCAGTGCGCCGACCAGGTTGCCAAAATAGACATTTAGCCAGTTTTTCGCCAACTGACCC
+CAGGTGATGCGCCCACTCGCCTTAGCAACAACAATCAACACGGTGGAAGTAAAGAGATCGGCTCCGCAGACAACACAAAGAATCAGCCCCAGAGAGAAGC
+AAATGCCGCCAACCAGTTTTGCCATGCCGAAGGGCATTGTGCCTGTGCCAGTGGTTGCTGTGATATAGAAGACGAATGCGATTGAGATGAAAACACCGGC
+GGTAATCGCCAGATAGAAAGTCTTAAGCGGATGTTTCGTTGCTTTATAGACACCCGCCTCTTCGGCCACTTTGGCCATTGCAGCAGGAAGTAAAAGATCA
+AAAGGGTTGTCAGCTTTCACACTAACTCTCTCTTTATTAAGTCGGCGACGAGATACTAACAAAGCATTATAGATGAGAAATTGATATAGATCATATCTCG
+CCTGGCTTATAGGCCCGTAACTCGCATGGTTTTATGCAAATACGGAGTAAATATTTGATTATCCAAATAAAAATAAATTTTAAAATTAACAAATGAGTTG
+AATTTTTCCGCATCCTCCGCTAAAACAGTTAATTAAAAGGAGCATCAGGCGAATAAAGTAACAATATCGATCGTATTTATTAAATACAAATTACCGATAT
+TTAACCTTATAATTACAATTATTTTATTAATGCAAATATATGTAAAGCGGGGCATTAAAAACGCCCCGTAATATAACTCAGACTAATCATTAAGCCTACA
+TTGCGTAGGCTATTTGATTTTATTTTGCCCAGAATGCTGCTTTGGCGCGCTGCAGCTTTTCGTAGGCCTTCAACAACGACTGATGTGCAGCAAACGCGTG
+CAGATCGCTATCTACCGGTTGCAGGCCGTAAAACGCCGCTTCGCCGCTCATTGCCGCACTGGCGGCTTCTACGGCATCTGCGCCGTACATGCGAACAAAC
+GCATTCAGATATTGCAGCGGCTGGCGATCTTCTTCCTGTGCCAGTAATAACAACGTTTGCAGGCAGCGATAATAGTTGGCGCGTTCCGGACTAAATACTG
+ATGAGTTAAACTCCATCGTCCATTCGGTCCAGACCAGAGCCTGTTCCAGATCGCCACCAGCCAGCGCCAGCATGGCTTTTAATTCACCGATACGCAGGGT
+GTACCAACCGTTATCCGACCCGGTCGCCAGACCCAACAGCTCACGCACGCGGGTAAAGTCATCAAAACCTTCTTCATCCAGTTGCTCGATGAGGTTCAGG
+TAATCTTCTTTTCCCACTCGCTGCCTGGTAGCGAAAGAATCGTTTCACGTAAATGGCTGCCCATACTGTTATTCGCGAGCCACAGATCTTCAGCCGGATA
+AATATCGGACATGCCAGGCACGATAATACGGCAAGCATAAACGCCCAGATGCTCGTAATCGGCAATATAAACTTCTTTATCTTCTTTGTTGAAGATAGCC
+ATCAGTGTGGCGAACTCTTCTTCCGTGGTGCCGGAGAAATTCCAGTCCACAAACGGATAATCGGCATCCTGCTTGAACAGGTCCCAGGAGATTAAACCGC
+TGGAATCGATAAAGTGCGTTTCGAGGTTGGTATGTTCAGCGACTTCTTCATCATCGAAGGTTGGCGGAGTAAACACATCCAAATCTTTCAGGCCACGACC
+TTGCAGCAGCTCGGTCACGGTACGTTCCAGTGCTACGCCAAAATCAGGATGCGCACCGAAAGAGGCAAAGCAGGTACCGTTAGCAGGATTGAACAGTACC
+ACGCAAATCACCGGATACTGGCCGCCAAGCGAACCGTCATAAGCGAAGATTGGGAAACCCTCCGCTTCCAGCGTTTCGATGGCTTCAACTACTGCTGGGT
+AACGCGCCAGCACGTCTGCCGGGATCTCTGGCAGGCTGATGCTTTCAGCAATAATGCGGTTTTTCACGTAGCGTTCGAAAACTTCAGACAATCCCTGAAC
+GCGTGCTTCGTTGCGGGTATTACCTGCGGACATACCGTTGGAGACGTACAGGTTACCAATGATATTCATCGGAATATAAACGGTCTGATTGTCGGACTGA
+CGCGTAAACGGCAGGCCGCAAATACCACGATCTTCGTTACCGGATTGTAGGTCAATCAGCATGCTGCCGGTCAGTTCATTCTCCGGATCATAAAACGCGC
+GCAGACGGTCATCGAGCAGCCCTTCTGGCACATCGTCATTTTCGGTCAGTGGGAACCATTTTTCGTTGGGATAATGCACGAACGGACCGTTGGCGATGGT
+TTCGCCCAGCCAGAAGTCCGCAAAAAGTAGTTGGTTGAGAGACGCTCGAAATATTCACCGAGTGCAGAAGCCAGCGCCGCTTTCTTGGTTGCGCCTTTAC
+CGTTGGTAAAACACAGTGCGCACTCTTTGTCGCGAATATGTACAGACCAGACGTTAGGCACGGATTCAGCCAGGAGGCCTCTTCAATCTGAAAGCCGAGG
+TCTGAAAGTTTTGCTGGAAGCGAGCGATGGAATCTTCCAGAGCGGCATCTTTGCCGGGGATAAATGTTTGCGTCATGAAAATCACTTTAGTCGTACGGAA
+AGCGCGCAATAATACGGGTTTTATCTCAAAGGCGCTATCACCGCCGCCATGCCGATGAACTGTTGACTATGCTTTTAGCGGATAAACCACGTTAAGAGCA
+TAAAAATGAAGGCGTTCGATCTCCACCGTATGGCATTTGATAAAGTGCCTTTGATTTCCTTGGCGAAGTTGCACTACGTAGTCTTTATACCTTTGTACTG
+GTCTTTTGTTCCTCAAAATGACCGGAAGACGCGGTGTGCGGCAGATGTCGCTGTTTGAAGTTTTAATCATTCTGACGCTGGGATCAGCGGCGGGAGATGT
+GGCGTTTTATGATGATGTGCCGATGGTCCCGGTACTTATCGTCTTTATTACTCTGGCGTTGTTATACCGCCTGGTAATGTGGTTGATGGCGCACAGTGAA
+AAACTGGAAGATCTTCTGGAAGGCAAGCCAGTTGTCATTATTGAAGATGGCGAGCTGGCCTGGTCGAAACTCAATAACTCCAACATGACGGAATTTGAGT
+TCTTTATGGAGCTACGATTGCGTGGCGTGGAGCAGCTGGGGCAGGTACGTCTGGCGATTCTCGAAACCAACGGGCAAATCAGTGTCTATTTCTTTGAAGA
+TGACAAGGTGAAACCGGGTTTACTTATTTTACCCAGTGATTGTACGCAGCGTTACAAAGTGGTGCCGGAGTCGGCGGACTATGCCTGTATTCGTTGTAGT
+GAAATCATTCATATGAAAGCGGGGAAAACAATTATGTCCGCGCTGTGCAAATCCAGAATGGACGAAGGCAAGTCGGGCAAAACGGGTGACCTGACAGTAA
+AACATCGGCTTTTGCTAATAATCCGAGAGATTCTTTTGTGTGATGCAAGCCACATTTTGCCCTCAACGGTTTTACTCATTGCGATGTGTGTCACTGAATG
+ATAAAACCGATAGCCACAGGAATAATGTATTACCTGTGGTCGCAATCGATTGACCGCGGGTTAATAGCAACGCAACGTGGTGAGGGAAATGGCTCAAATC
+TTCAATTTTAGTTCTGGTCCGGCAATGCTACCGGCAGAGGTGCTTAAACAGGCTCAACAGGAACTGCGCGACTGGAACGGTCTTGGTACGTCGGTGATGG
+AAGTGAGTCACCGTGGCAAAGAGTTCATTCAGGTTGCAGAGGAAGCCGAGAAGGATTTTCGCGATCTTCTTAATGTCCCTCCAACTACAAGGTATTATTC
+TGCCATGGCGGTGGTCGCGGTCAGTTTGCTGCGGTACCGCTGAATATTCTCGGTGATAAAACCACCGCAGATTATGTTGATGCCGGTTACTGGGCGGCAA
+GTGCCATTAAAGAAGCGAAAAATACTGCACGCCTAATGTCTTTGACGCCAAAGTGACTGTTGATGGTCTGCGCGCGGTTAAGCCAATGCGTGAATGGCAA
+CTCTCTGATAATGCTGCTTATATGCATTATTGCCCGAATGAAACCATCGATGGTATCGCCATCGACGAAACGCCAGACTTCGGCGCAGATGTGGTGGTCG
+CCGCTGACTTCTCTTCAACCATTCTTTCCCGTCCGATTGACGTCAGCCGTTATGGTGTAATTTACGCTGGCGCGCAGAAAAATATCGGCCCGGCTGGCCT
+GACAATCGTCATCGTTCGTGAAGATTTGCTGGGCAAAGCGAATATCGCGTGTCCGTCGATTCTGGATTATTCCATCCTCAACGATAACGGCTCCATGTTT
+AACACGCCGCCGACATTTGCCTGGTATCTATCTGGTCTGGTCTTTAAATGGCTGAAAGCGAACGGCGGTGTAGCTGAAATGGATAAAATCAATCAGCAAA
+AGCAGAACTGCTATATGGGGTGATTGATAACAGCGATTTCTACCGCAATGACGTGGCGAAAGCTAACCGTTCGCGGATGAACGTGCCGTTCCAGTTGGCG
+GACAGTGCGCTTGACAAATTGTTCCTTGAAGAGTCTTTTGCTGCTGGCCTTCATGCACTGAAAGGTCACCGTGTGGTCGGCGGAATGCGCGCTTCTATTT
+ATAACGCCATGCCGCTGGAAGGCGTTAAAGCGCTGACAGACTTCATGGTTGAGTTCGAACGCCGTCACGGTTAATGCCGAAATTTTGCTTAATCCCCACA
+GCCAGCCTGTGGGGTTTTATTTGTTGTAGAGAGTTGAGTTCATGGAATCCCTGACGTTACAACCCATCGCTCGTGTCGATGGCACTATTAATCTGCCCGG
+TTCCAAGAGCGTTTCTAACCGCGCTTTATTGCTGGCGGCATTAGCACACGGCAAAACAGTATTAACCAATCTGCTGGATAGCGATGACGTGCGCCATATG
+CTGAATGCATTAACAGCGTTAGGGTAAGCTATACGCTTTCAGCCGATCGTACGCGTTGCGAAATTATCGGTAACGGCGGTCCATTACACGCAGAAGGTGC
+CCTGGAGTTGTTCCTCGGTAACGCCGGAACGGCAATGCGTCCGCTGGCGGCAGCTCTTTGTCTGGGTAGCAATGATATTGTGCTGACCGGTGAGCCGCGT
+ATGAAAGAACGCCCGATTGGTCATCTGGTGGATGCGCTGCGCCTGGGCGGGGCGAAGATCACTTACCTGGAACAAGAAAATTATCCGCCGTTGCGTTTAC
+AGGGCGGCTTTACTGGCGGCAACGTTGACGTTGATGGCTCCGTTTCCAGCCAATTCCTCACCGCACTGTTAATGACTGCGCCTCTTGCGCCGGAAGATAC
+GGTGATTCGTATTAAAGGCGATCTGGTTTCTAAACCTTATATCGACATCACACTCAATCTGATGAAGACGTTTGGTGTTGAAATTGAAAATCAGCACTAT
+CAACAATTTGTCGTAAAAGGCGGGCAGTCTTATCAGTCTCCGGGTACTTATTTGGTCGAAGGCGATGCATCTTCGGCTTCTTACTTTCTGGCAGCAGCAG
+CAATCAAAGGCGGCACTGTAAAAGTGACCGGTATTGGACGTAACAGTATGCAGGGTGATATTCGCTTTGCTGATGTGCTGGAAAAATGGGCGCGACCATT
+TGCTGGGGCGATGATTATATTTCCTGCACGCGTGGTGAACTGAACGCTATTGATATGGATATGAACCATATTCCTGATGCGGCGATGACCATTGCCACGG
+CGGCGTTATTTGCAAAGGCACCACCACGCTGCGCAATATCTATAACTGGCGTGTTAAAGAGACCGATCGCCTGTTTGCGATGGCAACAGAACTGCGTAAA
+GTCGGCGCGGAAGTGGAAGAGGGCACGATTACATTCGTATCACTCCTCCGGAAAAACTGAACTTTGCCGAGATCGCGACATACAATGATCACCGGATGGC
+GATGTGTTTCTCGCTGGTGGCGTTGTCAGATACACCAGTGACGATTCTTGATCCCAAATGCACGGCCAAAACATTTCCGGATTATTTCGAGCAGCTGGCG
+CGGATTAGCCAGGCAGCCTGAATGAACAACGGGCAATAAATAGCCAAATCTTTCTTTATCAAAACGTCGGCACATTGTCGGCGTTTTTTCGACCTTGTGA
+GTCATTTTGATTAATGGTAGCGTCGCTTGTCAATGTAAGTTGTTGATACATAATATTTATATATGATTAATCAACGGATGATTCACATGAAGAATACTAA
+ATTACTGCTGGCGATTGCGACCTCTGCAGCATTACTGACAGGGTGTCAAAATACCCACGGTATTGATACCAATATGGCTATCAGCTCCGGTTTAAATGCC
+TATAAAGCAGCAACATTAAGCGATGCCGATGCAAAAGCGATTGCCAATCAGGGCTGTGCCGAAATGGACAGCGGCAATCAAGTCGCAAGTAAATCCAGCA
+AGTACGGTAAACGTCTGGCAAAAATCGCCAAAGCATTGGGTAACAATATTAATGGCACGCCGGTCAACTATAAGGTTTATATGACCAGCGACGTCAACGC
+ATGGGCGATGGCGAACGGCTGTGTTCGTGTCTACAGTGGCCTGATGGACATGATGAATGACAACGAAATTGAAGGCGTTCTGGGCCATGAACTGGGCCAC
+GTCGCGTTGGGTCACTCGCTGGCTGAAATGAAAGCTTCTTATGCGATCGTTGCCGCACGCGATGCCATTTCAGCTACCAGCGGTGTGGCTTCCCAGCTTT
+CCGCTCACAATTAGGTGATATCGCAGAAGGCGCTATCAATGCTAAATACTCCCGTGATAAAGAGTCCGAAGCAGATGATTTCTCCTTTGATCTGTTGAAG
+AAACGTGGCATCAGCACCCAGGGGCTGGTTGGCAGCTTTGAAACACTGGCTAGCCTGGATGGCGGTCGCACCCAGTCCATGTTTGACTCTCACCCACCAT
+CAACAGAGCGTGCGCAACACATCCGTGATCGTATCGCCTCTGGTAAGTAAATCATTGTCATCTTTCGGGCTGGTCTTCTGCCAGCCCGCTATAATTGCGC
+AATAAATCCCCATCTGAATACAGACAAAACTGGTTTTGCACACAACGTTAACGATTTGTGGCGTCGGCGCGTATAATGCGCGCGGTTATGTTAACGGTAC
+GCCTGTTTTAAGGAGATAAAGATGACGGCAATTGCCCCGGTTATTACCATTGATGGCCCAAGCGGTGCAGGAAAGGCACCTTGTGTAAGGCTATGGCGGA
+AGCGTTGCAATGGCATCTGCTGGACTCGGGTGCAATTTATCGCGTACTGGCATTGGCGGCATTACATCACCATGTTGATGTTGCGTCGGAAGATGCGCTG
+GTACCGCTGGCATCCCATCTGGATGTACGTTTTGTGTCGACCAATGGCAATCTGGAAGTGATCCTCGAAGGGGAAGATGTCAGCGGCGAAATTCGTACTC
+AGGAAGTGGCGAATGCAGCTTCACAAGTCGCGGCATTCCCACGCGTTCGTGAAGCATTATTGCGTCGCCAACGCGCGTTTCGCGAATTACCAGGTCTGAT
+TGCCGATGGCCGCGACATGGGAACGGTGGTATTCCCTGATGCACCAGTGAAAATTTTCCTTGACGCCTCCTCGGAAGAACGTGCGCATCGCCGCATGCTA
+CAGTTGCAGGAGAAGGGCTTTAGTGTTAACTTTGAGCGCCTTTGGCCGAGATCAAAGAACGCGACGACCGCGATCGTAACCGAGCGGTAGCGCCACTGGT
+TCCGGCAGCCGATGCTTTAGTGTTGGATTCCACCACCTTAAGCATTGAGCAAGTGATTGAAAAGCGCTACAATACGCGCGCCAGAAATTGGCTCTCGCAT
+AAGCGACCGAATTTGCAGTACCCCGTTGCAATGGAATGACAGCGGGTATGTTAAACAACCCCATCCGGCATGGAGCCAGGTGGACGTTAAATATAAACCT
+GAAGATTAAACATGACTGAATCTTTTGCTCAACTCTTTGAAGAGTCCTTAAAGAAATCGAAACCCGCCCGGGTTCTATCGTTCGTGGCGTTGTTGTTGCT
+ATCGACAAAGACGTAGTACTGGTTGACGCTGGTCTGAAATCTGAGTCCGCCATCCCGGCTGAGCAGTTCAAAACGCCCAGGGCGAGCTGGAAATCCAGGT
+AGGTGACGAAGTTGACGTTGCTCTGGACGCAGTAGAAGACGGCTTCGGTGAAACTCTGCTGTCCCGTGAGAAAGCTAAACGTCACGAAGCCTGGATCACG
+CTGGAAAAAGCTTACGAAGATGCTGAAACTGTTACCGGTGTTATCAACGGCAAAGTTAAGGGCGGCTTCACTGTTGAGCTGAACGGTATTCGTGCGTTCC
+TGCCAGGTTCTCTGGTAGACGTTCGTCCGGTGCGTGACACTCTGCACCTGGAAGGCAAAGAGCTTGAATTTAAAGTAATCAAGCTGGATCAGAAGCGCAA
+CAACGTTGTTGTTTCTCGTCGTGCCGTTATCGAATCCGAAAACAGCGCAGAGCGCGATCAGCTGCTGGAAAACCTGCAGGAAGGCATGGAAGTTAAAGGT
+ATCGTTAAGAACCTCACTGACTACGGTGCATTCGTTGATCTGGGCGGCGTTGACGGCCTGCTGCACATCACTGACATGGCCTGGAAACGCGTTAAGCATC
+CGAGCGAAATCGTCAACGTGGGCGACGAAATCACTGTTAAAGTGCTGAAGTTCGACCGCGAACGTACCCGTGTATCCCTGGGCCTGAAACAGCTGGGCGA
+AGATCCGTGGGTAGCTATCGCTAAACGTTATCCGGAAGGTACCAAACTGACTGGTCGCGTGACCAACCTGACCGACTACGGCTGCTTCGTTGAAATCGAA
+GAAGGCGTTGAAGGCCTGGTACACGTTTCCGAAATGGACTGGACCAACAAAACATCCACCCGTCCAAAGTTGTTAACGTTGGCGATGTAGTGGAAGTTAT
+GGTTCTGGATATCGACGAAGAACGTCGTCGTATCTCCCTGGGTCTGAAACAGTGCAAAGCTAACCCGTGGCAGCAGTTCGCGGAAACCCACAACAAGGGC
+GACCGTGTTGAAGGTAAAATCAAGTCTATCACTGACTTCGGTATCTTCATCGGCTTGACGGCGGCATCGACGGCCTGGTTCACCTGTCTGACATCTCCTG
+GAACGTTGCAGGCGAAGAAGCAGTTCGTGAATACAAAAAGGCGACGAAATCGCTGCAGTTGTTCTGCAGGTTGACGCAGAACGTGAACGTATCTCCCTGG
+GCGTTAAACAGCTCGCAGAAGATCCGTTCAACAACTGGGTTGCTCTGAACAAGAAAGGCGCTATCGTAACCGGTAAAGTAACTGCAGTTGACGCTAAAGG
+CGCAACCGTAGAACTGGCTGACGGCGTTGAAGGTTACCTGCGTGCTTCTGAAGCATCCCGTGACCGCGTTGAAGACGCTACCCTGGTTCTGAGCGTTGGC
+GACGAAGTTGAAGCTAAATTCACCGGCGTTGATCGTAAAACCGCGCAATCAGCCTGTCTGTTCGTGCGAAAGACGAAGCTGACGAGAAAGATGCAATCGC
+AACTGTTAACAAACAGGAAGATGCAAACTTCTCCAACAACGCAATGGCTGAAGCTTTCAAAGCAGCTAAAGGCGAGTAATTCTCTGACTCTTCGGGATTT
+TTATTCCGAAGTTTGTTGAGTTTACTTGACAGATTGCAGGTTTCGTCCTGTAATCAAGCACTAAGGGCGGCTACGGCCGCCCTTAATCAATGCAGCAACA
+GCAGCCGCTTAATTTGCCTTTAAGGAACCGGAGGAATCATGACCAAGTCAGAATTGATAGAAAGACTTGCCACCCAGCAATCGCACATTCCCGCCAAGAC
+GGTTGAAGATGCAGTAAAGAGATGCTGGAGCATATGGCCTCGACTCTTGCGCAGGGCGAGCGTATTGAAATCCGCGGTTTCGGCAGTTTCTCTTTGCACT
+ACCGCGCACCACGTACCGGACGTAATCCGAAGACTGGCGATAAAGTAGAACTGGAAGGAAAATACGTTCCTCACTTTAAACCTGGTAAAGAACTGCGCGA
+TCGCGCCAATATTTACGGTTAAGTTTTTACTCAAACTTGAACGAGAGAAAAGCACCTGTCGGGTGCTTTTTCATTCTCTAATCTGGAACTGGAAGCTGCC
+TCGCAGAGTTTTGAACAGTTTTCACCCTTTCGTTAAATTCTTCTGAATATGCCTCGGGAACGCAAAATTCCCACCAGACAACCGCTCAACAAAGTTGCAC
+ACTTTCCATAAACAGGAGGGTGCATGAAAATAACGACAGTCGGTGTATGCATAATTAGCGGAATTTTTCCGTTGCTGATTTTGCCCCAATTGCCTGGGAC
+ATTAACCCTTGCGTTTCTGACTCTCTTCGCCTGCGTACTGGCATTTATCCCTGTTAAAACCGTCCGTTATATCGCGCTGACGTTGCTGTTTTCGTTTGGG
+GCATATTATCAGCAAAGCAAATTTTGTGGGCAGGAGAAACCTTAACTGGCGCGACGCAGGATGCAATTGTTGAGATCACTGCAACTGACGGCATGACCAC
+TCATTACGGTCAAATTACTCATCTACAAGGTCGACGTATATTCCCTGCGTCAGGTCTCGTGATGTATGGCGAATATCTTCCGCAAGCGGTTTGTGCTGGA
+CAACAATGGTCAATGAAACTCAAAGTTCGTGCAGTTCATGGCCAACTTAATGATGGCGGCTTTGATAGCCAGCGTTATGCCATTGCCCAGCATCAGCCGC
+TCACCGGCCGTTTTCTGCAGGCAAGTGTCATTGAACCGAATTGTAGCCTGCGTGCACAGTATCTGGCGTCACTACAAACAACGCTGCAACCCTATCCGTG
+GAATGCGGTTATTCTTGGTTTAGGTATGGGGAACGGTTATCCGTCCCCAAAGAAATCAAAATATCATGCGCGATACTGGAACGGCGCATTTAATGGCGAT
+ATCGGGATTGCACATCGCTTTTGCGGCGTTGCTGGCTGCCGGACTCATTCGCAGTGGACAAATTTTTCTGCCTGGGCGCTGGATCCACTGGCAAATACCA
+TTAATTGGCGGAATCTGCTGTGCTGCTTTTATGCCTGGTTGACGGGAATGCAACCTCCTGCATTGCGTACCATGGTGGCGCTTGCTACGTGGGGAATGCT
+TAAGTTAAGTGGGCGACAGTGGAGTGGCTGGGATGTATGGATATGTTGTCTGGCGGCAATTTTGCTGATGGATCCTGTTGCCATTCTCTCGCAAAGTTTA
+TGGCTCTCTGCCGCTGCGGTCGCGGCATTGATATTTTGGTATCAGTGGTTTCCCTGTCCTGAGTGGCAACTGCCGCCGGTATTGCGTGCAGTTGTTTCCC
+TCATCCATCTGCAACTGGGAATCACACTTCTGCTTATGCCCGTGCAAATCGTCATATTTCATGGCATTAGTCTGACCTCGTTTATTGCAAATCTATTAGC
+AATTCCCTTGGTGACATTTATCACGGTTCCGTTGATCCTCGCCGCGATGGTTGTGCATTTAAGCGGGCCGTTAATCCTGGAGCAAGGGTTATGGTTTCTT
+GCCGACCGGTCTTTGGCTTTACTTTTCTGGGGTTAAAGAGTTTGCCGGAAGGGTGGATCAACATTGCTGAATGTTGGCAATGGCTATCATTTTCCCCATG
+GTTCTTACTGGTGGTATGGCGATTAAACGCCTGGCGAACGTTGCCAGCAATGTGTGTGGCTGGAGGCTTGCTGATGTGCTGGCCGCTGTGGCAAAACCTC
+GACCTGACGAGTGGCAGCTGTACATGCTTGATGTCGGGCAAGGGCTGGCAATGGTGATAGCCAGAAACGGCAAAGCGATTCTCTATGACACAGGACTGGC
+CTGGCCTGAAGGGGATAGTGGGCAACAACTGATTATCCCCTGGCTCCACTGGCATAATCTTGAACCGGAAGGCGTTATTCTGAGCCATGAACATCTGGAT
+CACCGGGGAGGGCTGGATTCAATATTGCATATATGGCCGATGTTATGGATCAGAAGTCCGTTAAACTGGGAACATCATCAGCCCTGTGTGCGTGGCGAAG
+CGTGGCAATGGCAAGGATTGCGTTTCAGCGCGCACTGGCCTTTACAAGGTAGCAACGATAAAGGAAATAACCATTCCTGTGTGGTTAAGGTTGATGACGG
+GACGAATAGCATTCTTCTAACCGGTGATATTGAAGCCCCAGCTGAACAAAAGATGCTAAGCCGTTACTGGCAGCAAGTGCAGGCAACATTGCTTCAGGTA
+CCTCACCATGGCAGTAATACCTCATCATCGTTGCCATTAATTCAGCGAGTGAATGGAAAAGTGGCACTCGCATCGGCATCGCGCTATAACGCATGGCGAC
+TGCCCTCTAACAAAGTTAAGCATCGCTATCAACTGCAAGGATATCAATGGATTGATACTCCACATCAAGGTCAAACAACGGTCAATTTTTCAGCGCAAGG
+CTGGCGGATTAGCAGCCTCAGGGAGCAAATTTTACCTCGTTGGTATCATCAGTGGTTTGGCGTGCCAGTGGATAACGGGTAGAATATGCGGCTATTTCAA
+CAAATGCTGGTTTTGAATGCATAACGACAAAGATCTCTACGTGGCAGACATTCCGCCGACTGTGGCCAACCATTGCGCCTTTCAAAGCGGGTCTGATCGT
+GGCGGGCGTAGCGTTAATCCTCAACGCAGCCAGCGATACCTTCATGTTATCGCTCCTTAAGCCACTTCTTGATGATGGCTTTGGTAAAACAGATCGCTCC
+GTGCTGGTGTGGATGCCGCTGGTGGTGATCGGGCTGATGATTTTACGTGGTATCACCAGCTATGTCTCCAGCTACTGTATCTCCTGGGTATCAGGAAAGG
+TGGTAATGACCATGCGTCGCCGCCTGTTTGGTCACATGATGGGAATGCCAGTTTCATTCTTTGACAAACAGTCAACGGGTACGCTGTTGTCACGTATTAC
+CTACGATTCCGAACAGGTTGCTTCTTCTTCTTCCGGCGCACTGATTACTGTTGTGCGTGAAGGTGCGTCGATCATCGGCCTGTTCATCATGATGTTCTAT
+TACAGTTGGCAACTGTCGATCATTTTGATTGTGCTGGCACCGATTGTTTCGATTGCGATTCGCGTTGTATCGAAGCGTTTTCGCAACATCAGTAAAACAT
+GCAGAACACCATGGGGCAGGTGACCACCAGCGCAGAACAAATGCTGAAGGGCCACAAAGAAGTATTGATTTTCGGTGGTCAGGAAGTGGAAACGAAACGC
+TTTGATAAAGTCAGCAACCGAATGCGTCTTCAGGGGATGAAAATGGTTTCAGCCTCTTCCATCTCTGATCCGATCATTCAGCTGATCGCCTCTTTGGCGC
+TGGCGTTTGTTCTGTATGCGGCGAGCTTCCCAAGTGTCATGGATAGCCTGACTGCCGGTACGATTACCGTTGTTTTCTCTTCAATGATTGCACTGATGCG
+TCCGCTGAAATCGCTGACCAACGTTAACGCCCAGTTCCAGCGCGGTATGGCGGCTTGTCAGACGCTGTTTACCATTCTGGACAGTGAGCAGGAGAAAGAT
+GAAGGTAAGCGCGTGATCGAGCGTGCGACTGGCGACGTGGAATTCCGCAATGTCACCTTTACTTATCCGGGACGTGACGTACCTGCATTGCGTAACATCA
+ACCTGAAAATTCCGGCAGGGAAGACGGTTGCTCTGGTTGGACGCTCTGGTTCGGGTAAATCAACCATCGCCAGCCTGATCACGCGTTTTACGATATTGAT
+GAAGGCGAAATCCTGATGGATGGTCACGATCTGCGCGAGTATACCCTGGCGTCGTTACGTAACCAGGTTGCTCTGGTGTCGCAGAATGTCCATCTGTTTA
+ACGATACGGTTGCTAACAACATTGCTTACGCACGGACTGAACAGTACAGCCGTGAGCAAATTGAAGAAGCGGCGCGTATGGCCTACGCCATGGACTTCAT
+CAATAAGATGGATAACGGTCTCGATACAGTGATTGGTGAAAACGGCGTGCTGCTCTCTGGCGGTCAGCGTCAGCGTATTGCTATCGCTCGAGCCTTGTTG
+CGTGATAGCCCGATTCTGATTCTGGACGAAGCTACCTCGGCTCTGGATACCGAATCCGAACGTGCGATTCAGGCGGCACTGGATGAGTTGCAGAAAACCG
+TACCTCTCTGGTGATTGCCCACCGCTTGTCTACCATTGAAAAGGCAGACGAAATCGTGGTCGTCGAGGATGGTGTCATTGTGGAACGCGGTACGCATAAC
+GATTTGCTTGAGCACCGCGGCGTTTACGCGCAACTTCACAAAATGCAGTTTGGCCAATGATCGAAAAATCTGGTCTGGTGAATCCCTTTGTGGCGGCTAT
+TGCTGCCACTCTCCTGGTTGTATGGCCTGGTGAGTGGCGCGATCCGTCTTTGCTATAAACTAAAACTGAAGCGCGCCTGGCGTGCCCCGTACCGGTTGTC
+GTGGTTGGTAATCTCACCGCAGGCGGCAACGGAAAACCCCGGTCGTTGTCTGGCTGGTGGAACAGTTGCAACAGCGCGGTATTCGCGTGGGGTCGTATCG
+CGGGATATGGTGGTAAGGCTGAATCTTATCCGCTGTTATTGTCGGCAGATACCACAACAGCACAGGCGGGTGATGAACCTGTGTTGATTTATCAACGCAC
+TGATGCGCCTGTTGCGGTTTCTCCCGTTCGTTCTGATGCGGTAAAAGCCATTCTGGCGCAACACCCTGATGTGCAGATCATCGTAACCGACGACGGTTTA
+CAGCATTACCGTCTGGCGCGTGATGTGGAAATTGTCGTTATTGATGGTGTGCGTCGCTTTGGCAATGGCTGGTGGTTGCCGGCGGGGCCAATGCGTGAGC
+GAGCGGGCGCTTAAAGTCGGTTGATGCGGTAATCGTCAACGGCGGTGTCCCTCGCAGCGGTGAAATCCCCATGCATCTGCTGCCGGGTCAGGCGGTGAAT
+TTACGTACCGGTACGCGTTGTGACGTTGCTCAGCTTGAACATGTAGTGGCGATGGCGGGGATTGGGCATCCGCCGCGCTTTTTGCCACGCTGAAGATGTG
+TGGCGTACAACCGGAAAAATGTGTACCGCTGGCCGATCATCAGTCTTTGAACCATGCGGATGTCAGTGCGTTGGTAAGCGCCGGGCAAACGCTGGTAATG
+ACTGAAAAGATGCGGTGAAATGCCGGGCCTTTGCAGAAGAAAATTGGTGGTATTTGCCTGTAGACGCACAGCTTTCAGGTGATGAACCAGCGAAACTGCT
+TACGCAACTAACCTTGCTGGCTTCTGGCAACTAGTTACGCCGCGGCAGCGTTCGATTGATGGAGTCATGAATGTCGCTGCCGCACCTCTCCTTGCTGATG
+CGCGTAATCTTCACCTTGCCGCACAAGGCCTGTTAAACAAACCCCGCCGTCGAGCGTCGTTGGAGGATATTCCGGCAACGATCTCCCGCATGTCCTTGCT
+GCAAATCGATACCATCAATATTGTTGCCCGTAGTCCATATCTGGTGCTTTTCAGTCGTCTGGGAAATTATCCTGCCCAGTGGCTGGATGAGTCTCTGGCG
+CGTGGCGAATTAATGGAATACTGGGCGCATGAAGCCTGCTTTATGCCGCGTAGCGACTTTCGTCTTATTCGCCACCGCATGCTGGCACCTGAAAAAATGG
+GCTGGAAATACAAAGACGCCTGGATGCAGGAACATGAGGCGGAAATTGCACAGTTAATTCAGCATATTCATGATAAGGGGCCGGTACGTTCAGCCGATTT
+TGAGCATCCTCGTAAAGGTGCAAGCGGCTGGTGGGAATGGAAGCCGCATAAACGGCATCTGGAAGGTTTATTTACTGCCGGAAAGGTGATGGTGATTGAA
+CGGCGCAACTTCCAGCGCGTTTATGATTTAACCCACCGTGTCATGCCTGACTGGGATGATGAGCGCGATCTCGTTTCGCAAACAGAAGCAGAAATCATCA
+TGCTGGATAACAGTGCGCGTAGCCTGGGAATATTCCGCGAACAGTGGCTGGCAGATTACTATCGGCTGAAACGTCCGGCACTGGCGGCGTGGCGCGAAGC
+GAGGGCTGAACAGCAGCAAATCATTGCTGTGCATGTTGAAAAATTGGGCAATCTTTGGCTGCATGATGATTTGCTGCCGCTACTCGAGCGAGCGCTGGCC
+GGAAAGCTCACTGCAACGCACAGCGCGGTACTTTCGCCTTTGATCCTGTTGTCTGGGATCGCAAACGCGCAGAGCAGCTTTTGATTTTAGCTACCGGCTG
+GAGTGCTATACCCCAGCGCCGAAACGCCAGTATGGCTATTTTGTTCTGCCGTTATTACATCGTGGGCAATTAGTTGGGCGAATGGATGCCAAAATGCATC
+GCCAGACAGGCATCCTTGAAGTTATCTCTGTGGTTACAGGAAGGTATTAAACCAACGACAACGCTGCAAAAGGGCTACGTCAGGCGATTACTGATTTCGC
+TAACTGGCAGCAGGCAACGCGGGTGACATTAGGATGCTGCCCGCAAGGCCTCTTTACTGATTGCCGCACCGGCTGGGAAATAGACCCCGTCGCATAAATG
+ATTATGATAAGATTTATGCATTCATAACCCGATCCATCTGGAGGAACTATGGATCATCGTCTGCTTGAAATCATTGCCTGCCCGGTTTGCAACGGAAAAC
+TTTGGTATAACCAGGAAAACAAGAGCTTATTTGCAAACTGGACAACCTCGCTTTCCCGCTGCGTGATGGCATTCCAGTGTTGCTGGAAACGGAAGCCCGC
+GTGCTGACTGCTGATGAGAGTAAATCATGAGTTTTGTGGTCATTATTCCCGCGCTACGCGTCCACGCGTCTGCCCGGTAAACCATTGGTTGATATTAACG
+GCAAACCCATGATTGTTCATGTTCTTGAACGCGCGCGTGAATCAGGTGCCGAGCGCATCATCGTGGCAACCGATCATGAGGATGTTGCCCGCGCCGTTGA
+AGCCGCTGGCGGTGAAGTATGTATGACGCGCGCCGATCATCAGTCAGGAACAGAACGTCTGGCGGAAGTTGTCGAAAAATGCGCATTCAGCGACGACACG
+GTGATCGTTAATGTGCAGGGTGATGAACCGATGATCCCTGCGACAATCATTCGTCAGGTTGCTGATAACCTCGCTCAGCGTCAGGTGGGTATGGCGACTC
+TGGCGGTGCCAATCCACAATGCGGAAGAAGCGTTTAACCCGAATGCGGTGAAAGTGGTTCTCGACGCTGAAGGGTATGCACTGTACTTCTCTCGCGCCAC
+CATTCCTTGGGATCGTGATCGTTTTGCAGAAGGCCTTGAAACCGTTGGCGATAACTTCCTGCGTCATCTTGGTATTTATGGCTACCGTGCAGGCTTTATC
+CGTCGTTACGTCAACTGGCAGCCAAGTCCGTTAGAACACATCGAAATGTTAGAGCAGCTTCGTGTTCTGTGGTACGGCGAAAAATCCATGTTGCTGTTGC
+TCAGGAAGTTCCTGGCACAGGTGTGGATACCCTGAAGATCTTGAGCGCGTTCGCGCTGAAATGCGCTAATTTCACTTCACGACACTTCAGCCAATTTTGG
+GAGGAGTGTCGTACCGTTACGATTTTCCTCAATTTTTCTTTTCAACAATTGATCTCATTCAGGTGACATCTTTATATTGGCGCTCATTATGAAAGCAGTA
+GCTTTTATGAGGGTAATCTGAATGGAACAGCTGCGTGCCGAATTAAGCCATTTACTGGGCGAAAACTCAGTCGTATTGAGTGCGTCAATGAAAAAGCGGA
+TACGGCGTTGTGGGCTTTGTATGACAGCCAGGGAAACCCAATGCCGTTAATGGCAAGAAGCTTTAGTACGCCCGGAAAAGCCCGACAACTGGCATGGAAA
+ACCACCATGCTGGCAAGAAGTGGGACTGTCCGTATGCCGACTATTTATGGTGTGATGACGCATGAAGAACACCCCGGCCCCGATGTCCTGCTACTGGAGC
+GGATGCGTGGTGTTTCGGTGGAGGCACCAGCCCGAACACCAGAACGCTGGGAACAACTCAAAGACCAAATCGTTGAAGCCTTACTGGCCTGGCACCGTCA
+GGACAGTCGCGGTTGCGTCGGCGCGGTCGACAATACTCAGGAAAATTTCTGGCCCTCATGGTACCGGCAACATGTTGAAGTGCTATGGACCACGCTCAAT
+CAGTTCAATAACACCGGTCTGACGATGCAGGATAAGCGGATCCTGTTTCGCACTCGCGAATGTCTCCCGGCATTATTTGAAGGCTTTAACGACAATTGTG
+TGCTGATTCACGGTAACTTCTGTTTACGCAGCATGTTGAAAGATTCGCGCAGCGATCAGTTACTGGCGATGGTCGGGCCGGGACTAATGCTTTGGGCACC
+GCGAGAATACGAACTGTTCCGACTAATGGATAATTCTCTGGCGGAAGATTTGCTCTGGAGTTACCTGCAACGCGCGCCAGTGGCGGAGTCGTTCATCTGG
+CGGCGTTGGTTGTATGTGTTATGGGATGAAGTTGCGCAACTGGTTAATACCGGACGATTTAGTCGGCGCAACTTCGATCTGGCATCAAAATCACTCTTGC
+CGTGGCTCGCCTGACGAACCTTTAGCCACTGCCAGATACGGCCAAGCGTTTCATAGCCAACACGATCGCTATGCATCAACCAGACCGGAGAAGGGATTGC
+CCGTTCCCACGGGTTAAGCGGCGAGTCGATGGCCAACTGATTCGCCGGGGCTGGTAGCGGATTTAACCCTTCCTGCTGAAAAAGATCATCGCCCGCGGCA
+GATGTGATGCGGAGGTCACCAGCAGGAAAGGGCGTCACCAATCGCCTGTTTCACTGCTGCAGCTTCTTCTTCGGTATCTTTGGCAAATCCAGGGTGATAA
+TTTGCTCGCGCGGCACGCCCAGCGATTGCGCAACTCTGGCACCTACTTCCGCTGTACTCACCGTATTGGTTTTGCTACGCCTCCCGTGAAGATCAGTTTT
+GATCCCGGATTTTCGCGCCATAAGCGAATACCTTCATTCAGGCGTGGCAGACTGTTATTGATTAAATTAGAGCTCGGTGCCCACTGCGGGTTCCAGGTAT
+AACCACCTCCGAGCACCACGATATAGTCCACTTTTGCGAATTATTCCATGTCGGATAGGTGCTTTCGATGGGACGCAGCAGGCGGTCGGCTACCGGTTGC
+AAACTCAATAACAAGAGCGCCAGCCACCCAATGCTAATAAAAATCTTCCCGGTTTTGAAAACGGCTAAACCACAGCAGCGCCAGGCCAGCGCCAATAATC
+AACAACATCAGCGGAAGTGGCAGCAACATATTGCCAATCACTTTTTCAGTGTAAAAGCATCCTTTCTGGTTCCTTTTTAACCATATAGCAAGGGATCGCC
+AGCGATATTACACCAGACGGGTTCATTCTCGCCGTGGCTGTGACAAAATAGCGTCTTTATCAGAAAACGTCTTAGCCAACCGGTGGAGAAAGCAATGCAG
+GATCGCAATTTTGATGATATTGCGGAAAAGTTTTCCCGTAACATTTACGGCACCACCAAAGGGCAGCTTCGACAGGCTATTCTGTGGCAGGATCTCGATC
+GCGTGCTGGCGGAAATGGGCCCGCAAAACTGCGTGTGCTGGATGCTGGCGGTGGAGAAGGGCAGACCGCAATCAAAATGGCCGAGCGTGGGCATCAGGTC
+ATTTTATGCGATCTTTCTGCGCAGATGATCGACCGCGCAAAACAGGCGGCAGAAGCAAAGGTGTGAGCGACAACATGCAATTTATACATTGCGCCGCTCA
+GGATGTTGCTTCGCATTTGGAAACGCCCGTTGATCTGATATTGTTCCATGCGGTGCTCGAGTGGGTGGCTGATCCCCGCAGCGTATTGCAGACCCTCTGG
+TCAGTGTTGCGTCCAGGCGGCGTGTTGTCGTTAATGTTCTACAATGCGCATGGTTTGTTGATGCATAACATGGTCGCCGGGAATTTTGATTACGTGCAGG
+CGGGAATGCCGAAAAAGAAAAACGGACGCTTTCGCCAGATTATCCACGCGACCCGGCGCAGGTTTATCTGTGGCTGGAAGAAGCTGGTTGGCAAATTATG
+GGTAAGACAGGCGTTCGCGTGTTTCATGATTATCTGCGCGAGAAACACCAGCAGCGCGACTGCTATGAAGCATTACTTGAATTAGAAACGCGTTATTGCC
+GTCAGGAACCGTATATTACCCTGGGGCGTTATATTCATGTCACCGCGCGCAAACCGCAGAGCAAGGATAAAGTATGAGTGAATTTTCCCAGACAGTCCCC
+GAACTGGTTGCCTGGGCCAGAAAAATGACTTCTCCATCTCGCTGCCGGTAGACCGACTCTCTTTTCTGCTGGCGGTTGCCACGCTGAACGGCGAGCGTCT
+GGATGGTGAGATGAGTGAAGGCGAGCTGGTGGATGCATTCCGCCATGTGAGTGATGCGTTTGAGCAAACCAGCGAAACCATCGGCGTGCGCGCCAATAAC
+GCGATCAACGACATGGTGCGTCAACGTCTGCTGAACCGCTTTACCAGCGAGCAGGCGGAAGGGAACGCAATTTACCGTCTGACGCCGCTCGGCATCGGCA
+TTACTGACTACTACATCCGTCAGCGCGAGTTTTCTACGCTGCGTCTTTCTATGCAGTTGTCGATTGTGGCGGGTGAGCTCAAACGCGCAGCAGATGCCGC
+CGAAGAGGGCGGTGATGAATTTCACTGGCACCGTAATGTCTATGCGCCACTGAAATATTCGGTAGCAGAAATTTTCGACAGTATCGACCTGACGCAACGT
+CTGATGGACGAACAGCAGCAGCAGGTGAAGGACGATATCGCCCAGTTGCTGAACAAAGACTGGCGGGCGGCGATTTCCAGCTGTGAATTGTTGCTTTCGG
+AAACTTCCGGAACGCTGCGTGAATTGCAGGATACGCTGGAAGCGGCAGGCGACAAATTGCAGGCTAATCTGTTGCGCATTCAGGATGCGACGATGACCCA
+TGACGATCTGCATTTCGTCGATCGTCTGGTGTTCGATCTGCAGAGCAAACTCGATCGTATTATCAGTTGGGGCCAGCAATCCATCGACTTGTGGATTGGC
+TACGACCGCCACGTACACAAATTTATTCGTACCGCGATCGATATGGATAAAAACCGCGTCTTTGCTCAGCGGTTACGTCAGTCGGTACAAACCTATTTTG
+ATGAGCCGTGGGCGCTAACTTATGCCAATGCCGATCGTCTGCTGGATATGCGTGACGAAGAGATGGCACTGCGCGATGAAGAAGTGACTGGGGAACTTCC
+TGAGGATCTGGAATACGAAGAGTTTAACGAGATCCGCGAACAGCTGGCGGCGATCATCGAAGAACAACTTGCCGTGTACAAAACCAGACAAGTGCCGCTG
+GATCTTGGTCTGGTGGTACGCGAATATCTGTCACAGTATCCGCGTGCACGTCACTTTGACGTTGCGCGTATTGTTATTGATCAGGCGGTACGTCTTGGCG
+TAGCGCAAGCAGATTTCACCGGACTGCCAGCGAAATGGCAGCCGATTAATGATTACGGAGCCAAGGTACAGGCGCATGTCATCGACAAATATTGAACAAG
+TGATGCCGGTTAAGCTGGCGCAGGCGCTGGCGAATCCGTTATTTCCGGCGCTGGACAGCGCCTTACGTTCAGGACGCCATATTGGCCTCGACGAACTGGA
+TAATCATGCATTCCTGATGGATTTTCAGGAATATCTGGAAGAGTTTTACGCGCGTTATAACGTTGAGCTTATTCGCGCACCAGAAGGGTTCTTCTATTTA
+CGCCCACGTTCCACCACGCTGATCCCTCGTTCCGTCTTGTCGGAACTGGATATGATGGTCGGGAAAATCCTCTGTTATCTCTATCTCAGCCCGGAACGGC
+TGGCGAATGAGGGATTTTCACCCAGCAGGAACTGTACGACGAACTGCTCACCCTGGCCGATGAAGCAAAACTGCTGAAACTGGTGAACAACCGTTCAACC
+GGTTCAGACGTTGACCGTCAGAAGTTGCAGGAGAAAGTACGTTCTTCGCTCAACCGTCTGCGTCGTTTAGGCATGGTGTGGTTTATGGGCCACGACAGCA
+GCAAGTTTCGCATTACCGAATCGGTGTTCCGCTTCGGAGCCGATGTGCGTGCTGGCGACGATCCCCGTGAAGCACAGCGTCGCCTGATTCGTGATGGCGA
+AGCAATGCCGATTGAAAATCATCTGCAACTCAACGATGAAACCGAAGAGAATCAGCCAGATAGCGGAGAGGAAGAATAATGATTGAACGCGGTAAATTTC
+GCTCACTGACGCTGATTAACTGGAACGGCTTTTTGCCCGAACTTTTGACCTTGACGAGCTGGTCACGACGCTTTCTGGCGGTAACGGGCGGGTAAATCCA
+CCACCATGGCGGCGTTCGTTACGGCGCTGATCCCCGACCTGACCCTGCTGCATTTCCGTAACACTACGGAAGCCGGGGCCACCAGCGGTTCGCGCGATAA
+AGGTCTGCACGGTAAGCTGAAAGCGGGTGTCTGTTATTCGATGCTCGACACCATTAACTCGCGCCACCAGCGCGTGGTGGTCGGTGTGCGTCTGCAACAG
+GTTGCCGGACGCGATCGTAAAGTGGATATCAAGCCGTTTGCCATTCAGGGACTGCCGATGTCGGTGCAGCCGACACAGCTGGTGACCGAAACCCTGAACG
+AACGCCAGGCGCGCGTGCTGCCGCTTAACGAGCTGAAAGACAAGCTCGAGGCGATGGAAGGCGTGCAGTTTAAACAGTTCAACTCCATTACTGATTACCA
+CTCGCTGATGTTCGATCTGGGCATCATCGCGCGTCGTCTGCGCTCCGCATCTGACCGTAGCAAATTCTATCGTCTGATCGAAGCTTCGCTGTATGGCGGG
+ATCTCCAGTGCCATTACCCGTTCTCTGCGCGACTACCTGTTGCCAGAAAACAGCGGCGTGCGTAAAGCGTTCCAGGACATGGAAGCGGCGCTGCGTGAAA
+ACCGTATGACGCTGGAAGCGATTCGTGTCACCCAGTCGGACCGCGACCTGTTTAAGCATCTGATCAGCGAAGCCACCAACTACGTGGCGGCGGACTACAT
+GCGTCACGCCAACGAGCGCCGTGTCCATCTCGACAAAGCCCTGGAGTTTCGTCGCGAGCTACATACTTCGCGTCAGCAACTGGCGGCTGAGCAGTACAAA
+CACGTCGATATGGCGCGTGAGCTGGCAGAGCACAACGGTGCCGAAGGCGATCTGGAAGCGGATTATCAGGCGGCCAGTGATCACCTGAACCTGGTGCAAA
+CCGCACTGCGTCAGCAGGAGAAGATCGAACGCTACGAAGCGGATCTCGATGAGCTGCAGATCCGTCTGGAAGAGCAAAATGAAGTGGTGGCAGAAGCCAT
+CGAACGCCAGCAAGAGAATGAGGCTCGTGCGGAAGCTGCCGAACTGGAAGTGGACGAGCTGAAAAGCCAGCTTGCTGACTACCAGCAGGCGCTGGACGTC
+CAGCAAACGCGCGCGATCCAGTATAACCAGGCGATTGCTGCGCTTAATCGTGCCAAAGAACTGTGCCATCTGCCGGACTTAACCGCCGACTGCGCCGCCG
+AATGGCTGGAAACCTTCCAGGCGAAAGAGCTGGAAGCGACTGAAAAATGCTCTCTTGAGCAGAAAATGAGCATGGCGCAAACCGCGCACAGCCAGTTTGA
+GCAGGCTTATCAGCTGGTGGTGGCAATCAACGGCCCACTGGCGCGTAACGAGGCGTGGGATGTCGCTCGCGAACTATTGCGCGAAGGGTCGATCAGCGTC
+ACCTGGCAGAGCAGGTTCAGCCGCTGCGGATGCGATTAAGCGAACTGGAACAGCGTCTACGCGAGCAGCAAGAAGCTGAGCGTCTGCTGGCAGATTTCTG
+CAAACGTCAGGGCAAGAATTTTGATATCGACGAACTGGAAGCCCTGCATCAGGAACTGGAAGCACGCATTGCCTCTCTTTCCGATAGCGTGTCTAACGCC
+CGTGAAGAGCGCATGGCACTGCGCCAGGAGCAGGAACAGCTGCAGTCTCGCATTCAGAGTTTGATGCAGCGTGCGCCGGTTTGGCTGGCAGCGCAAAACA
+GTCTCAACCAGTTGAGCGAACAGTGCGGCGAAGAGTTTACCTCCAGCCAGGACGTCACCGAATATCTGCAACAGTTGCTGGAGCGTGAGCGAGAGGCGAT
+TGTTGAACGCGATGAAGTGGGCGCGCGCAAAACGCCGTCGATGAAGAGATCGAACGTTTAAGCCAGCCTGGCGGCTCTGAAGATCAGCGTCTGAACGCGC
+TGGCGGAGCGTTTTGGTGGTGTGCTGCTGTCAGAAATTTATGACGACGTTAGCCTGGAAGATGCGCCGTACTTCTCAGCGCTGTATGGCCCGTCACGCCA
+CGCCATCGTGGTGCCAGATCTGTCACAGGTAACTGAACACCTGGAAGGCTTGACCGATTGCCCGGAAGATCTCTATCTGATCGAAGGAGATCCGCAGTCA
+TTCGATGACAGCGTGTTCAGCGTTGATGAGCTGGAAAAAGCGGTAGTGGTGAAAATCGCCGATCGTCAGTGGCGTTATTCACGTTTCCCGGAAGTGCCGC
+TGTTTGGTCGTGCTGCGCGTGAAAGCCGTATTGAAAGCCTCCATGCCGAGCGTGAAGTGCTTTCCGAACGCTTCGCCACGCTCTCCTTTGATGTACAGAA
+AACTCAGCGTCTGCATCAGGCGTTCAGCCGCTTTATCGGCAGTCATCTGGCGGTTGCGTTTGAGTCTGACCCGGAAGCAGAAATCCGTCAACTGAACAGC
+CGTCGCGTCGAACTGGAGCGGGCGTTAAGTAATCATGAAAATGATAACCAGCAGCAGCGTATTCAGTTTGAGCAGGCGAAAGAGGGCGTTACGGCGCTGA
+ACCGCATTCTGCCGCGTCTCAACCTGTTGGCTGATGACAGCCTGGCGGATCGCGTCGATGAAATCCGCGAACGTCTGGATGAAGCCCAGGAAGCCGCGCG
+TTTTGTTCAGCAGTTTGGCAATCAACTGGCGAAACTGGAACCGATTGTTTCGGTATTGCAGAGCGACCCGGAACAGTTCGAACAGTTAAAGAAGATTACG
+CGTACTCTCAGCAGATGCAGCGCGATGCCCGTCAGCAGGCGTTTGCCCTGACGGAAGTGGTGCAGCGTCGTGCGCACTTTAGCTATTCTGACTCGGCAGA
+AATGCTTAGCGGTAACAGCGATCTCAACGAAAAACTGCGTGAACGTCTGGAACAGGCGGAAGCGGAGCGTACCCGCGCTCGCGAAGCGTTGCGCGGTCAC
+GCAGCGCAGTTGAGTCAGTACAACCAGGTGCTGGCTTCGCTGAAAAGTTCTTACGACACCAAAAAGAGCTACTCAACGATCTGCAACGTGAATTGCAGGA
+TATCGGCGTGCGTGCTGATAGCGGGGCAGAAGAGCGGGCGCGTATTCGCCGTGACGAGCTGCATGCGCAACTGAGCAATAACCGTTCACGCCGCAATCAA
+CTGGAAAAGCGCTTACCTTCTGCGAAGCGGAGATGGACAACCTGACCCGCAAACTGCGCAAGCTGGAGCGGGATTACTTTGAGATGCGCGAGCAGGTAGT
+GACCGCCAAAGCGGGCTGGTGTGCGGTGATGCGCATGGTGAAAGATAACGGCGTTGAGCGCCGCTTACACCGTCGTGAGCTGGCTTATCTCTCCGCTGAT
+GATTTGCGTTCCATGTCGGATAAGGCGTTAGGTGCGCTGCGTCTGGCGGTGGCGGATAACGAACATCTGCGCGACGTGCTGCGCATGTCGGAAGATCCGA
+AACGTCCGGAGCGTAAAATTCAGTTCTTCGTGGCGGTTTATCAGCATCTGCGTGAACGTATTCGTCAGGATATTATTCGTACCGATGATCCGGTGGAAGC
+TATCGAACAGATGGAGATTGAACTTAGCCGTCTGACCGAAGAATTAACCTCCCGTGAACAGAAACTGGCGATCAGTTCCCGCAGCGTGGCGAACATCATT
+CGCAAAACCATTCAGCGCGAGCAGAACCGTATCCGTATGCTCAACCAGGGTTGCAGAACGTATCGTTTGGTCAGGTGAACAGCGTGCGTCTCAACGTGAA
+CGTGCGTGAAACGCACGCCATGCTACTGGATGTGCTCTCTGAACAGCACGAGCAGCATCAGGATCTGTTTAACAGCAACCGTTTGACCTTCTCGGAAGCG
+CTGGCGAAACTGTATCAACGTCTTAACCCGCAGATTGATATGGGGCAGCGCACGCCGCAGACCATCGGTGAAGAACTGCTGGATTACCGCAACTATCTGG
+AAATGGAAGTTGAGGTTAACCGTGGTTCCGATGGCTGGCTGCGCGCAGAGTCTGGTGCATTGTCGACCGGTGAGGCGATTGGTACCGGTATGTCGATTCT
+GGTGATGGTGGTACAAAGCTGGGAAGATGAATCTCGCCGCCTGCGCGGTAAAGATATCTCTCCTTGCCGCCTGCTGTTCCTCGATGAAGCAGCGCGACTG
+GATGCTCGTTCTATCGCCACGCTGTTTGAATTGTGTGAGCGTTTGCAAATGCAACTCATCATCGCAGCGCCGGAAAATATCAGCCCGGAGAAAGGCACCA
+CCTATAAACTGGTGCGTAAAGTCTTCCAGAATACCGAACACGTTCATGTCGTCGGCCTGCGAGGATTTGCGCCGCAACTCCTGAAACGCTTCCAGGAACT
+GACGAAGCGCCTTCAGGCGAGTTAAAATTAAGGCGGCAGCAATGCCGCCTTTTCTTTCCGAAAACTCCGTTTCTGCACTAAAAAGTGGCACATTACGGCG
+CGCTTTTCTTTAAACTTCTTTACATTAGGTTATGTAAAACGTATCGGCGTTTATATACTGAAGATAAGCCTGATGAGTAACAGGCTTGCTCGTCATACTT
+TCGTGAGTATTGGCGTTGTACAGGCAAGTCGTAAAATAACAGCCTGGCTATTCAGAGTATGATAAAACAGGGGCAAGGGATGTTGCTTAATATGATGTGT
+GGTCGTCAGCTGTCGGCAATCAGTTTGTGCCTGGCCGTAACATTCGCTCCACTGTTCAATGCGCAGGCCGATGAGCCTGAAGTAATCCCTGGCGACAGCC
+CGGTGGCTGTCAGTGAACAGGGCGAGGCACTGCCGCAGGCGCAAGCCACGGCAATAATGGCGGGGATCCAGCCATTGCCTGAAGGTGCGGCAGAAAAGCC
+CGCACGCAAATCGAATCTCAATTACCCGCAGGTTACAAGCCGGTTTATCTTAACCAGCTTCAACTGTTGTATGCCGCACGCGATATGCAACCCATGTGGG
+AAAACCGTGATGCTGTTAAAGCCTTCCAGCAACAGCTGGCAGAGGTGGCGATTGCCGGTTTCCAGCCGCAGTTTAATAAATGGGTAGAGTTACTGACCGA
+TCCTGGTGTTAACGGGATGGCACGCGACGTGGTGCTCTCTGATGCGATGATGGGCTATCTCCATTTCATTGCAAATATTCCGGTCAAAGGCACTCGCTGG
+CTATATAGCAGTAAACCTTATGCACTTGCAACGCCGCCGCTCTCGGTGATTAACCAATGGCAGCTGGCGCTGGATAAAGGTCAATTGCCTACGTTTGTTG
+CAGGACTGGCACCGCAGCATCCGCAATATGCGGCGATGCATGAATCGTTACTGGCCTTACTCTGTGACACCAAACCGTGGCCCCAACTGACCGGCAAAGC
+AACGTTGCGCCCAGGGCAGTGGAGTAACGACGTACCGGCGTTGCGCGAAATATTGCAACGCACAGGCATGTTGGACGGGGGCCGAAAATTACTCTACCTG
+GCGATGACACGCCAACTGACGCGGTAGTCAGCCCATCCGCTGTTACTGTTGAAACAGCAGAAACTAAGCCGATGGATAAGCAAACGACGTCTCGTAGTAA
+ACCTGCGCCTGCCGTTCGCGCCGCCTACGATAATGAACTGGTGGAAGCCGTTAAACGTTTTCAGGCATGGCAAGGATTGGGGGCAGATGGTGCTATTGGC
+CCGGCAACACGTGACTGGTTAAACGTAACGCCCGCCCAGCGTGCTGGTGTGTTGGCTCTCAACATCCAGCGATTGCGCTTGCTGCCAACAGAGCTTTCTA
+CCGGGATCATGGTTAACATTCCGGCCTATTCGCTGGTCTACTATCAGAACGGCAATCAGGTGCTGGATTCGCGAGTCATTGTCGGTCGCCCCGATCGCAA
+AACGCCGATGATGAGCAGTGCCCTTAACAACGTAGTGGTAAACCCGCCGTGGAACGTACCTCCAACTCTGGCACGCAAAGATATTCTGCCAAAAGTGCGC
+AACGATCCGGGATATCTCGAAAGCCATGGCTATACGGTGATGCGCGGCTGGAACAGCAGAGAAGCGATTGACCCATGGCAGGTTGACTGGTCTACAATCA
+CGGCCTCGAATTTACCGTTCCGCTTCCAGCAGGCTCCAGGCCCACGGAACTCGCTGGGGCGCTATAAATTCAATATGCCGAGTTCAGAGGCCATTTATTT
+GCATGACACGCCGAACCACAATCTGTTCAAGCGTGATACACGCGCATTGAGCTCAGGCTGTGTACGAGTGAATAAAGCTTCCGATCTGGCGAATATGCTG
+TTGCAGGATGCAGGCTGGAATGACAAACGTATTTCTGATGCGCTGAAGCAGGGTGATACACGTTACGTCAATATTCGGCAGTCGATTCCGGTGAATCTCT
+ACTACCTGACGGCCTTTGTTGGTGCAGATGGTCGTACCCAGTATCGTACAGATATTTACAATTATGATCTGCCTGCGCGATCCAGCTCGCAAATCGTATC
+GAAAGCGGAACAATTAATCAGGTAAATGAAGTAGTTCGGGGAAATCAGTTGTCGTAATAATTAGCATGATTGGGGCGATTCTCTGCAGCCCCGTCACTGC
+TGGGGTTGAGTCATCTTGACGTCTGCTTTACGGGCGGTTAAGGTGCCTCTTGTGCGCCAGAAGTGCATATAAACGATAACATTGACCTGTAGACTTGATT
+ATCATGGACAAATTCGACGCTAATCGCCGCAAATTGCTGGCGCTTGGTGGCGTTGCACTCGGTGCCGCCATCCTGCCGACCCTGCGTTTGCAACACTCTC
+TACCCCACGCCCGCGCATTTTGACACTCAATAATCTTCATACCGGAGAGTCAATCAAAGCGGAGTTTTTCGATGGCAGAGGCTATATTCAGGAAGAATTG
+GCAAAACTTAACCATTTTTCCGCGATTACCGCGCGAACAAAATAAAGTCCATCGACCCAGGATTATTCGACCAGTTGTATCGCCTGCAAGGGTTGTTAGG
+CACGCGCAAACCGGTGCAACTCATTTCCGGTTATCGTTCTATTGATACCAACAATGAACTACGCGCCCGCAGCCGTGGAGTAGCGAAGAAAAGCTATCAC
+ACTAAAGGCCAGGCGATGGATTTCCATATTGAAGGTATCGCGTTAAGCAATATTCGCAAAGCCGCGTTATCTATGCGCGCAGGTGGTGTAGGATATTATC
+CACGTAGTAACTTTGTGCATATTGATACCGGGCCAGCACGGCACTGGTAGTAATTGCTTAACGAAACAGGGGCAGTATGAACTATCGTATTATTCCGGTC
+ACCGCATTCTCCCAGAACTGTTCATTAATCTGGTGTGAACAAACCCGTCTGGCCGCACTGGTCGATCCTGGCGGCGATGCGGAAAAATCAAACAGGAAGT
+TGATGACAGCGGCCTGACACTGATGCAGATCCTGCTGACGCATGGTCATCTGGACCACGTTGGCGCAGCGGCGGAACTGGCGCAACATTACGGCGTGCCG
+GTTTTCGGCCCGGAAAAGAAGATGAGTTCTGGCTGCAAGGCTTGCCTGCGCAAAGTCGTATGTTTGGTCTGGAAGAGTGCCAGCCGCTGACGCCAGATCG
+TTGGCTGAACGAAGGCGATACCATCAGCATAGGGAATGTGACTTTACAGGTGTTACATTGCCCTGGGCATACGCCGGGTCATGTCGTGTTTTTGATGATC
+GGGCAAAGCTGCTGATTTCTGGCGATGTTATTTTCAAAGGCGGAGTAGGGCGCAGTGACTTCCCGCGTGGCGATCATAATCAACTGATTTCTTCAATCAA
+AGATAAATTGCTGCCACTGGGGATGACGTGATATTTATTCCGGGTCACGGACCATTATCCACACTTGGTTATGAACGCCTGCATAATCCCTTCCTGCAAG
+ACGAAATGCCCGTCTGGTAAGGCACATAAAAAGCCCGCTTTTAATGCTGGCCTGGATTTCTGGCAAAGTGCGCTTTGTTTATGCCGGATGCGGCACGAGC
+GCCTTATCCGGCCTACAAAATCGTGCAAATTCAAAATATTGCAGGGGACGCGTAGGCCTGATAAGCGTAGCGCATCAGGCAATGTTGCGTTTGTCATCAG
+TCTCAGCCCGCTTTTCAGCGGGCTTCATTGTTTTAATGCTTACAGCACTGCCACAATCGCTTCGCACAGCGGAGCCATGTTATCTGGTGTCATCCCGGCC
+ACATTTACGCGACCAGAAGCAACCGCATATACGCCAAACTCTTCGCGCAGACGCAGCACTTGTTCTTTTGTCAGGCCACTGAAGGAGAACATGCCGTTCT
+GTTTGATGATAAAGCTGAAGTCGCGGTTTGCGCCTTTTTCCTGCAGCGTATTGACGAACAACTGACGCATACGCTGAATACGCTGGCGCATATCAGTCAG
+CTCTTGTTCCCAAATCGCACGTAACGCATCGTTGCTCAGGATGGTGGCAACAACAGAAGCGCCGTGTGCTGGTGGGTTAGAGTAGTTAGCGCGAATCGCC
+GCTTTCATTTGGCTGAATGCGCGATCAACGGTTTCACTGTCGGCAGCAACCAGAGTACAAGCGCCAACACGCTCGTTGTACAGGCCAAAGTTTTAGAGTA
+GGAACTGGCAACAATCAGCTCTTTATGCATAGCCGCGAAAGCGCGCAGTCCTTCAGCATCTTCTTCCAGACCACGGGCAAAACCCTGGTAAGCGAAGTCA
+AACAGCGGTAACCAGCCTTTCTCAACGGAGAGTTGTGCCAGTGTTTGCCATTGTTCCAGCGTAGGGTCGATACCGGTTGGGTTATGGCAGCAGCCATGGA
+ACAGCACTACGTCGCCAGCCTGAGCTTCATTCAGGCTGTTAATCAGTGCATCGAAGTCAAGAGTGTGATTTTCCGCATCATAATAAGCGTATTCACGAAC
+TTCCAGACCTGCAGAGTTAAAGACGCTCTTATGGTTCGGCCAGCTTGGGTTGCTCACCCACACGCTTAACGCTGGTATTTTTGCCAGGAAATCGGCAGCC
+ACGCGTAGTGCGCCAGTGCCCCCGGAGTCTGTGCCGTGCGAGCACGTTTGTCATTGATCAGGGCGCTACCTTTACCAAACAGCAGTTCCTGAGTGCAGCG
+ACCAAATTCAGGGATGCCGTCAATGCCGAGGTAATTTTTGGTGGTTTCATTTTCGAGCAGATACTGTTCAGCCTTTTCACGCTGGTCAGTACCGGGGTTT
+TGCCCGTCTCATCTTTATAGACACCAATCCCGAGGTTAATTTTGCCGGGACGTTCATCGGCACGAAACAGATCGGCCAGGCCCAGAATCGGGTCGGCAGG
+AGCGGCGGTAATGTTCTCAAACATGACGAGGTTCCATTATGGTTACAGAAGGAAGTCCGCTATCAGGGTAACGGGAGATTTACAAAATTCCAACTATTAC
+TGATGAAAACGCAGGCTGTTTTGCAAGACGTGAGATTGCTCTGGAAGGTATAAAAAACAGGACCAAAGTCCTGTTTTTCGGCATTTAACAAAGAGGTGTG
+CTATTAGAACTGGTAAACGATACCCACAGCAACGGTGTCGTCTGAACCTACGCCCAGTTTGTTGTCAGAATCGATCTGGTTGATGATGTAGTCAACATAG
+GTGGACATGTTTTGTTGAAGTAGTAGGTTGCGCCCACTTCAAAGTAGTTCACCAGATCAACATCACCGATACCTTCTACGTCTTTCGCTTTAGATTTGGT
+GTAAGCGATGGACGGACGCAGACCGAAATCGAACTGGTATTGCGCAACTAACAGAACGTCTTGCGTTTTGTTGGCGAAGCCGCTGGTGTTTGTAAATTTA
+TTAGTGATCGGCGTAGCGTTACGGGTTTCACCGTAGTTCGCTGCCAGGTAGATGTTGTTCGCGTCGTACTTCAGACCAGTAGCCCACTGTTCAGCTTTTT
+ACCGTTGCCAAGAGGTTGAGCTTCTTGCAGGTTGGTACGGTCAGCTGCACCATAAGCACCAACGATACCAAAGCCTTCGTATTCGTAGCTGATAGAACCG
+CCAACACCGTCGCCGTTAGAACGGCGTGCAGTGTCACGCTCGTTTTACCCAGGTACTGAACAGCGAAGTTCAGGCCATCAACCAGACCAAAGAAGTTGGA
+GTTACGATAGGTAGCAACGCCGCCAACACGACCAACGAAGAAGTCATCGCTGTATGCAGTATCACCACCAAATTCTGGCAGCATATCGGTGTAACCCAGT
+GCATCATAAACCACACCGTAGTTACGGCCGTAATCGAAAGAACCAACGTCAGCGTATTTAAGACCCGCGAATGCCAGACGCGTTTTGTTACCAGTTTGAG
+CGTCAGCGCCTTCAGAGTTGTTACCCTGGAAGTTATATTCCCACTGACCATAACCGGTCAGATCGGAATTGATTTGAGTTTCCCTTTAAAACCAAGACGG
+GCATAGGTCATGTCGCCATTGCCACCGTAACTGTTTTCACCGTTACCCTTGGAAAAATAATGCAGACCAACAGCTTTACCGTACAGATCTACTTTGTTGC
+CATCTTTGTTATAGATTTCTGCAGCGTTTGCAGTACCTGCTACTAACAGAGCAGGGACGATCACTGCCAGAATATTGCGCTTCATCATTATTTATTACCC
+TCATGGTTTTTATGACACCTGCCACTGCCGTCAATAAGTTCTGTCAATAAAAATTTACGGAACTATTGATGAGAGTTTGGTGTCTTTATGTGTCTGCAGG
+CATCTTTCCATTCAAACTAACGTTTCGCTACCGTGAAAGTGCTACAAAGATAAAGATTTGGTTTCAAAAGAAAAATATGTAACCAAAAGTAAAATTTAAG
+GAACTTTGTGAACACCGTCATATTTCCATAGAGACGTGATGATATTTACAGCAATTTTAATCTATTTATATGATTTCCTTATATTTAAATTAACTAAACG
+GAAATTTTGTTTCTGATGGAAACTTTATCGACCTGGCACAAAATCTTCTTTCAGACATCCAGAATGCCAAAAATAGTATGAAAATTGTGCTATTAGCTAA
+GAAAAACTAATCCGCAATAAGAATGCGGATTAGTTTTTGCGCGTAAATGTTGCAATGTAATATTCCGTAACAGGATGATCGTTATGGCGGGGTTGCAAAT
+AGATTGCTTGACTTAACAAACAGATAACTTGACAGAAAAGATAAAAAGAGCCAGCGGGCGCTGGCTCTTGAAGACGCTAAATTAGAAGCTGGCGTTACGC
+GGAGTACGTGGGAACGGAATCACATCACGTACGTTTTGCACGCCAGTTACGTAAGCAATCAGACGTTCAAAACCAAGACCGAAACCTGAATGCGGAACAG
+TACCGTAGCGACGCAGATCGCGATACCACCAGTAATCTTCTTTATTCAGGCCCATTTCCAGCATACGCTCGTCCAGCACGTCCAGACGTTCTTCACGCTG
+GGAGCCACCAATGATCTCACCGATGCCCGGAGCCAGAACGTCCATAGCCGCAACGGTTTTACCGTCTTCGTTAAGGCGCATATAGAACGCTTTAATATCT
+TTCGGATAGTTTTTAACCACTACCGGTGCTTTAAAGTGTTCTTCCGCCAGATAACGCTCATGCTCAGAAGAGATCGACTCCCCAGTAAACCGGGTTTTCA
+AACTTCCTGCCGCAGTTTTCGAGAATGGTCACTGCGTCGGTATAATCCACCTGCGCAAAATCGGCTTCAATGAAGCGTTCCAGACGTGAAACGGCATCTT
+TATCTACGCGTTCAGCGAAGAATTTCATGTCGTCAGCGCGTTCTTCGAGAACCGCTTTGAAGACATATTTCAGCATGGCTTCAGCCAGACCCGCAATATC
+GTTCAGGTTAGCAAACGCCACTTCCGGCTCCAGCATCCAGAATTCCGCCAGGTGACGGCTGGTGTTGGAGTTTTCAGCACGGAAAGTCGGGCCGAAGGTA
+TAAATTTTGGACAATGCGCAAGCGTAGGTTTCGCCGTTCAACTGGCCAGATACGGTCAGGAAAGACTCTTTACCAAAGAAGTCTTTGTCGAAATCCACTT
+TGCCCTGATCGTTACGCGGCAGGTTTTCCAGATCCAGCGTAGAAACGCGGAACATTTCGCCTGCACCTTCGGTATCAGATGCGGTAATCAGTGGCGTTGA
+AACCCAGAAGAATCCCTGCTCGTTAAAGAAGCGATGCAGCGCCTGCGCCAGCGTATGGCGAACGCGCGCGACGGCACCAATCAGGTTTGTGCGCGGACGC
+AGGTGAGCGACTTCACGCAGATACTCAATGCTGTGGCGTTTTGCCGCCATCGGGTAAGTGTCTGGATCTTCAACCCAACCAGCAACTTCAACCTTGCTGG
+CCTGAATTTCAAATTGTTGCCCCTGGCCCGGCGACGCCACGACTTTACCCGTCACAATGACCGAGCAGCCGGTGGTCAGACGCAGGACGTCTTCATTGTA
+ATTGGGCAGAGAATTATTGATGACAGCCTGTACAGGATCAAAGCAGGAACCGTCATAAACGGCGAGGAAGGAGATGCCAGCTTTTGAATCTCGGCGGGTA
+CGTACCCATCCGCGCACGGTGACTTCGCTGTCAACGGCTACACGGCCCTGGAGTACGTCGGCTACAGGCACAACGCTCATAATATTCTCTCTGTTAATAG
+TCGGAAAAATAAACACTTGTCCACCCGTAAATGGGGATACCTATGTTACCTGGCATCTGCAATCAGACAAGCAGAATTCGCAAATGCAGCGAAAGATTTC
+GGAATTAAAGGTAAAAAAGGAGCCGATTAGCTCCTGATGATATTAACTGGCTTTTTAATATGCGGAAGGTCGAACGCTTTGCGCAGCGCCCGAACAAACG
+CTTTATCATGGCAGATAGTTTTGCCAGGGCTGTCAGAAAGTTTCGCCACCGGTTTACCGTTACACTCTACCAACTTAATGACAATATTCAGGGTTTTACC
+TGGGGATATCGCAGGTCAGGCGAGTCCCAATACCAAAACTTAATTGCACGCGGGAAGAGAAGTGGCGGTATAGCTCAACCGCTTTGCGTAAATCCAGATT
+GTCAGAGAAAACCAGCGTTTTACTCTGTGGATCAATTCCCAGCTTTTCATAATGTGCAATGGCTTTTTCACCCCATTCAACCGGGTCGCCAGAGTCATGA
+CGCAGGCCCTGATACCGACTAGCGAACTCGACACCGAAATCACGCAGGAAAGCATCCATAGTGATGCAGTCGGTTAATGCAATGCCAAGTTGGTCGGGAT
+ACTCTTCCAGCCAGGCAGCAAGTGCAGCTCGCTGGCTGTTGGCTAGATCCGGGCTGATTTGCTGATGTGCCTGGAACCATTCGTGTGCCTGTGTTCCCAT
+CGGCGTGAGGGAAAGCCGACGCGCCAGATCGTAGTTGCTGGTGCCCACAAACCAGGATTCCTGTTGCAGACGCTTAACGATGGTTTCTTGTACTTCGCGA
+GAAAACGGCGACGGGTGCCAAAATCCATCAGATGGAAGCGCGACATATCAAGACCGGCGGTTAACGCCGAGAAGTCGACTAATTTGCTTTCCAGCGTGTC
+GAGGGCTTGCGCAACGTCGGCCTGCGGTGAGCGATAGCGATGTACCATTTCACTGATAACCGCCAGCAAAGGAACTTCCCAGAGGATGACTTCACGCCAC
+GGGCCGCTTAAACGAATATCCAGCTTGCCATTATCGTTGGACACGGTGACTTGTTCCGGGTTAAAGCGGAACTCGCGTAACCAGTTAAGATAGTCGGCCT
+TAAAGAAAGGCAGGGCAGAAAGCCACTGATATTCATCATCCTGCAGGCGCAGGTGCTGCATCGCCTGAACCTGTTCACGAATAGCATCGGCATAAATACC
+CAGCAGATCGTCACCTCGGCAACGAAACTCCGCCGCGACATGCACATCGTAATAGTGATGAAACACGGCTTGCTGCATATGCAACTTATAAGCATCTGTA
+TCCAGCAACGAGTGCAGAACAGGAGAAGCGAATTGTGTCATAGGTGCGCAGTAGCGTCCTCGTACAGGAGCGTTTAGTACAATAAACATCTTCAGGAACT
+GCTGGAGTATACCTTGTTTCGCAATTTATTGAACCCCGATCACACCATATGCCACCTTTCTGGTCGATGGCATTACGCGGTGTATGTTATAAAATGTAGC
+AATAAAGGCGTTTGTACCTGAAAAGATGAAGATTCTGCATAGCGCGATTTACGCAACAGGAATAGACTGAACACCAGACTCTATAAAAGATGCTAAAGGT
+TATTTATGACTCAACAGCCACAAGCCAAATACCGTCACGATTATCGTGCGCCGGATTACCAGATTACTGATATTGACTTGACCTTTGACCTCGACGCGCA
+AAAGACGGTCGTTACCGCGGTCAGCCAGGCTGTCCGTCATGGTGCATCAGATGCTCCCCTTCGTCTCAACGGCGAAGACCTCAAACTGGTTTCTGTTCAT
+ATTAATGATGAGCCGTGGACCGCCTGGAAAGAAGAAGAGGGCGCACTGGTTATCAGTAATTTGCCGGAGCGTTTTACGCTTAAGATCATTAATGAAATAA
+GCCCGGCGGCGAATACCGCGCTGGAAGGGCTTTATCAGTCAGGCGATGCGCTTTGCACCCAGTGTGAAGCCGAAGGTTTCCGCCATATTACGTATTATCT
+CGACCGCCCGGACGTGCTGGCGCGTTTTACCACCAAAATTATTGCCGATAAAATCAAATATCCCTTCCTGCTTTCCAATGGTAACCGCGTTGCGCAAGGC
+GAACTGGAAAACGGACGCCATTGGGTACAGTGGCAGGACCCGTTCCCGAAACCGTGCTACCTGTTTGCGCTGGTGGCAGGCGACTTTGATGTACTGCGCG
+ATACCTTTACCACGCGTTCTGGTCGCGAAGTAGCACTGGAGCTGTACGTCGATCGCGGCAACCTTGATCGCGCGCCGTGGGCGATGACCTCGCTGAAAAC
+TCCATGAAATGGGATGAAGAACGCTTTGGCCTGGAGTATGACCTCGACATCTATATGATCGTCGCGGTGGATTTCTTCAATATGGGCGCAATGGAGAATA
+AGGGGCTGAATATCTTTAACTCCAAATATGTGCTGGCCCGCACCGACACCGCCACCGACAAAGATTACCTCGATATTGAACGCGTTATCGGCCATGAATA
+TTTCCATAACTGGACCGGTAACCGAGTGACCTGTCGCGACTGGTTCCAGCTCAGCCTGAAAGAAGGTTTAACCGTCTTCCGCGATCAGGAGTTCAGCTCT
+GACCTTGGTTCCCGCGCAGTTAACCGCATCAATAATGTACGCACCATGCGCGGATTGCAGTTTGCAGAAGACGCCAGCCCGATGGCGCACCCGATCCGCC
+CGGATATGGTCATTGAGATGAACAACTTCTACACCCTGACCGTTTACGAGAAGGGCGCGGAAGTGATTCGCATGATCCACACCCTGCTTGGCGAAGAAAA
+CTTCCAGAAAGGGATGCAGCTTTATTTCGAGCGTCATGATGGTAGTGCAGCGACCTGTGACGACTTTGTGCAGGCGATGGAAGATGCGTCGAATGTCGAT
+CTCTCCCATTTCCGCCGTTGGTACAGCCAGTCCGGTACACCGATTGTGACCGTCAAAGACGACTACAATCCGGAAACCGAGCAGTACACCCTGACCATCA
+GCCAGCGCACGCCAGCCACGCCGGATCAGGCAGAAAAACAGCCGCTGCATATTCCGTTTGCCATCGAACTGTATGATAACGAAGGCAAAGTGATCCCGTT
+GCAGAAAGGCGGTCATCCGGTGAATTCCGTGCTGAACGTCACTCAGGCGGAACAGACCTTTGTCTTTGATAATGTCTACTTCCAGCCGGTGCCTGCGCTG
+CTGTGCGAATTCTCTGCGCCAGTGAAACTGGAATATAAGTGGAGCGATCAGCAACTGACCTTCCTGATGCGTCATGCGCGTAATGATTTCTCCCGCTGGG
+ATGCGGCGCAAAGTTTGCTGGCAACCTACATCAAGCTGAACGTCGCGCGTCATCAGCAAGGTCAGCCGCTGTCTCTGCCGGTGCATGTGGCTGATGCTTT
+CCGCGCGGTACTGCTTGATGAGAAGATTGATCCAGCGCTGGCGGCAGAAATCCTGACGCTGCCTTCTGTCAATGAAATGGCTGAATTGTTCGATATCATC
+GACCCGATTGCTATTGCCGAAGTACGCGAAGCACTCACTCGTACTCTGGCGACTGAACTGGCGGATGAGCTACTGGCTATTTACAACGCGAATTACCAGA
+GCGAGTACCGTGTTGAGCATGAAGATATTGCAAAACGCACTCTGCGTAATGCCTGCCTGCGTTTCCTCGCTTTTGGTGAAACGCATCTGGCTGATGTGCT
+GGTGAGCAAGCAGTTCCACGAAGCAAACAATATGACTGATGCGCTGGCGGCGCTTTCTGCGGCGGTTGCCGCACAGCTGCCTTGCCGTGACGCGCTGATG
+CAGGAGTACGACGACAAGTGGCATCAGAACGGTCTGGTGATGGATAAATGGTTTATCCTGCAAGCCACCAGCCCGGCGGCGAATGTGCTGGAGACGGTGC
+GCGGCCTGTTGCAGCATCGCTCATTTACCATGAGCAACCCGAACCGTATTCGTTCGTTGATTGGCGCGTTTGCGGGCAGCAATCCGGCAGCGTTCCATGC
+CGAAGATGGCAGCGGTTACCTGTTCCTGGTGGAAATGCTTACCGACCTCAACAGCCGTAACCCGCAGGTGGCTTCACGTCTGATTGAACCGCTGATTCGC
+CTGAAACGTTACGATGCCAAACGTCAGGAGAAAATGCGCGCGGCGCTGGAACAGTTGAAAGGGCTGGAAAATCTCTCTGGCGATCTGTACGAGAAGATAA
+CTAAAGCACTGGCTTGAAATAACCGAATGGCGGCAATAGCGCCGCCATTCGGGGAATTTACCCTGTTTTCTCAGGCGAGTTTCAGATTCACCACGTTGCA
+TCACCCGTTGCAACACCTCCGCTTCCAGCTCCGCTAATCGCACCGACCCTAATCGACGCGGACGGGGATATCCACTGTCAAATCCAGACCAATTTTTCCT
+CTTCAATTAACAGCACCCGGTCAGCCATCGCTACCGCTTCGCTCACATCATGCGTCACCAACAGTACGGTAAAGCCGTGCTCCTGCCAAAGTGACACAAT
+CAAATCCTGCATCTCGAGTCGCGTTAAGGCGTCCAGCGCCCCGAGCGGTTCATCAAGCAACAATAATCCCGGTCGATGAATCAACGCTCTTGCCAGCGCC
+ACTCGCTGTTTCTGCCCGCCAGAAAGTGCGGCAGGCCATTCCCTGCGCGATTCTCCAGTCCTACCGCAGCCAACGCTCGACGTGCGGCATCGCGCCACTG
+GCCTTTAAGGCCTAACCCAACGTTATCAATCACCGATTTCCACGGTAGCAGACGCGCATCCTGAAACATCATTCGCGTGTCTTCCTGAATTTCAGCCAGC
+GGTGTGGTGCCCGCTAACACATCGCCTGCGGTTGGCGTTTCCAGACCTGCCAGCAGGCGCAGCAGGGTACTTTTGCCACCACCGCTGCGGCCCACCACCG
+CCACAAACTGACCTGCCGGAATATGTAAATCCAGTTGGTTCAGGACGATATTTTCCGCGTAATGTTTGCTTACTGCATTGAGCAACAATGGCGTGCCCTG
+GTTCAGACGAGCAGTATTCATACCGTGGCCTCCTTCAAATGATAAGCCGGGTTCCAGCGCAACCAGAGGCGCTCTAACAGCTGCGCGCTGACGTCAGCCA
+GTTTGCCGAGCAGGGCGTAAAGAATAATAGCGACTACCACCACGTCCGTTTGCAAAACTCCCGCGCATTCATCGCCAGATAACCAATGCCTGAATTGGCA
+GAAATGGTTTCGGCAACAATCAGCGTCAGCCACATCAGGCCCAACGCAAAACGCACGCCGACCATAATTGAGGGCAGGGCACCAGGCAGGATCACATGGA
+TAAACAGCGGTATGCCGGATAATCCATAGCTACGCGCCATCTCCACCAACCCGCGATCGATATTACGGATGCCATGCCAGGTGTTGATATAAATGGGGAA
+TAGCGTACCGAGCGCCACCAGAAAGATTTTGCGGATTCATCAATGCCAAACCACAAAATCACCAGCGGGATCAGCGCCAGATGCGGCACGTTGCGCAACA
+TCTGAATTGAGGTATCCAGCAGCCGTTCTCCCCAGCGAGATAGCCCGCTAATCAGTCCCAAAATCAACCCCAGCGATCCGCCAATTGAAAAGCCAATCAG
+CGCCCGCCAGAGCTGATCGCCAGATGCTGCCACAGTTCGCCGCTGGCGGAGAGCGTCCAGAACGCCGTCACCACTCCTTCCGGTGAAGGCAAAATACGCG
+TCGACAGCCAGCCAACCGAGGAGGCCAGTTGCCACACCGCCACGATGCCCACCGGTAAAACCAGGGGCAACGCGCAATAACCACTTCTTCACTGGCGTTG
+CCATTATTTCTTCCTTAGCTTTGCGCGACTTTACGGGGATAAAATCATTCGCCACCGCTTCGCCTTGCGGATTCAGCGGCTGCGGCTGGGGAATTTCCGG
+GATGGCGACATCCAGAAGCGGGAACAGCAACTCGCCAACCCGATACGCTTCTTCCAGATGCGGATAGCCCGAAAGCACAAAACTGTCGATGCCAAGCGCG
+GCATATTCGTTGATTCGCGCAGCGACCGTAGGACCATCGCCCACCAGCGCCGTCCCGGCACCGCCGCGCACTAAGCCAACGCCCGCCCATAAATTGGGGC
+TGATCTCCAGATTGTCGCGCTTGCCGTTATGTAACGCCGCCATTCGCTGTTGCCCTACGGAATCCGTCCGGGCGAATGCGGCCTGTGCTTTGGCGATAGT
+TTCATCATCAAGATGCGAGATTAACCGCTCGGCGGCCTGCCACGCTTCGTCGTTAGTTTCACGAACAATCACATGCAGACGAATACCGAAACGAATTTTG
+CGTCCATGCGCGGCAGCTTTCGCCCGCACTTGTTCGATTTTCTCTTTAACCAGTTCCGGCGGTTCGCCCCAGGTGAGGTAGAGATCAACCTGTTCTGCCG
+CCAGCTCCTGGGCGACATCTGACGATCCGCCAAAGTAAAGTGGCGGATACGGCTGTTGAATCGCCGGGAAGAGCAGTTTTGCTCCGCGCACATGAATATG
+TTTACCGTTGAAATCGACGGTTTCTCTCTGCAATAAACGCCGCCAGACCTGGGTAAATTCCGCCGAGGCTTCGTAGCGCTCGCTATGATCAAGGAACACT
+CCGTCGCCTGCCAGCTCTTGTGGATCGCTGCCTGTGACCAGGTTAAACAACGCACGTCCATTTGAGAGACGGTCAAGCGTGGCGGCCTGGCGGGCGGCAA
+CGGTAGGTGAGGTTACGCTGGGACGCAGGGCGACAAGAAACTTCAGCCGCTGCGTCACCGGGATCATCGATGCGGCAACCAGCCACGCATCTTCGCAGGA
+GCGCCCCGTTGGAATTAGCACACCGGTATAGCCAAGACGATCCGCCGCTTGCGCAATTTGTTGCAGATAACCGTGATCAACCGGGCGTGAACCTTCTTCC
+GTTCCCAGATAATGCCCGTCACCGTGGGTCGGTAAAACCAGAACATATTCAGACTCATAATTGTTTTCCTTCCAGTTGAGTGGGCTGCCAGATGCGCTGG
+CGAATATCGACTTTTTCGGCACCAGACGATTTTCATAAAACAGATCTGCCGTTTGCTGCTGTAAGGCGGCAACCTCGGCGTTAACCGGTTTGATGGTGGT
+AGGAGGGCGATGATCTAAGTAAGAGGCAATCACCGGTGCCGGTAAGCCCATCGTTTTGCCAGTAAAGCGATGCTTTGCTCGCGCTGGCTGCGGGTTAACG
+CATCGGCCTCACTAAAGGTTGCCAGTACGCCCTGAATAAAGCGCCGTTTTTTCTGCATAGGGACGAGCTGCCAGATAAAACGATCCAGTTTGATTGAGAT
+CGGTGCCGTCTTTCAGCACCCGCACGCCGCCCTGTAATAATGCAGCAGAGTAGTAGGGATCCCAGATAGCCCAGGCGTCAACGTTACCTTGCTGGAACGC
+GGCGCGGGCATCAGCGGGCGTCAGGTAAGTGGGTTGGATATCGGTAAACTTAAGTCCGGCCTGACGCAGTGCACGCAGTAAAGGTTGTGTGAACTGGAAC
+CTTTCTGAAAGGCAACTTTGTGACCTTTAAGATCGGCTACGGTTTTGATCGGGCTGTTTTCTGCCACCAGAATCACTTCGGCTTTGGGCTTCGGTGGCTC
+GACGCCCACGTACACCAAATCAGCCCCGGCAGCCTGGGCAAAGATTGGCGGAATATCCCCGGTACTGCCGAGATCAATACTGCCAACGTTTAACGCTTCC
+AACATTTGCGGACCCGCGGGGAACTCCACCCAGGAGATTTTTGATTCCGGATAGCGTTTTTCCAGTAACTGGTGGCTTTTGCCAGCACCATACCAATACT
+GCCTTTCTGATAGCCTATACGTAACGCTTCAGGCGAGGATTCTGCAGCAACCGCAAAGTAGAGACGCTAAGCAATCCCGCCAGCGCCAGTTTAATGATGT
+TACGCATGGGCATTACCTCGCAGAGACAGAAGGTCAGGAACCTGAACATCGCGGCGGTGCAATGCCTGCCAGAAAGTTTCTAGCGCGGTATCAAGACGGG
+TTTGCAGATTTGGCGTGAACTGGGGTCTGTGATGGTAATCAATTACTTGTGAGTCATCGGCAAACACGCCGTGCAGGATCTCCTGAGCTTTCAGTGCGCT
+TAAAACTGGTTTAAGGGCATAATCGACCGCCAGCAGATGGGCCACGGTACCGCCCGTCGCCAGCGGTAGCACCACTTTGCCTTGCAAAGCGCGTTCTGGC
+AGCAGGTCGAGCAGGGTTTTCAACGCACCGGAATAGGCGGCTTTATACACAGGCGTGGCGACAATCAGCCCATCGGCCTGTTGCAGCTGTTCGGTGAAGG
+TCTTGAGTGCCGGACTATCGAAACGAGCATAAAGTAGATCTTCCGGGGCGAAGTTTTGCAGATTCCAGTGATAAACCTCTACATCCAGGCCATTTAGTTT
+TTCCCGCGCATATTCCAGCAAGGAGCTGGAGCGAGAAGGAAAGCGAGGACTACCCGCCAGGGTGATGACGCATACTCTCTCCTTATAACCAATTGTTCTT
+TTTGTTAACATTGATAACAATTCGGTCAGTCTGTCGGAGAGACAAGAAAATTCCAAATATAAATTTTGTGTATCTTTTTCTGAAAATAAACTAAAGAAAG
+GGCTTTATATATCACGCATATTTATTTATTGGATAGTCATTAGATGTTGAATCAATGAATTACTCGTTCAGTTAATATTTAAATATTCATGAAATCTATA
+AATTAAAGATTTGTCACTTATTGGATTTAGTATGCTTGATTTAAATGGCGGACAATTATTGTTATTATTAAGTCTAATGTCATTTAAAGGCATTATCATA
+TTTACGAAGAGATCAGGATGATAACGATGAAAAAAGTGTATTGACGGCGTTTATAACTGTGGTATGTGCAACGTCCAGCGTTATGGCTGCTGATGATAAT
+GCTATCACGGATGGCTCAGTAACATTTAATGGTAAAGTTATTGCTCCAGCTTGTACCCTGGTAGCTGCGACGAAAGATTCCGTGGTGACTTTGCCAGATG
+TTAGTGCCACGAAGTTGCAAACCAATGGTCAGGTTTCTGGCGTGCAAATTGATGTGCCAATTGAATTAAAAGATTGTGATACTACCGTAACAAAAATGCA
+ACGTTCACCTTTAATGGCACTGCGGATACTACTCAGATTACAGCGTTTGCTAACCAGGCCTCATCTGATGCTGCTACAAACGTGGCCCTGCAAATGTATA
+TGAATGATGGTACAACGGCCATCACGCCAGACACAGAAACCGGGAACATTTTGTTGCAGGATGGAGATCAGACGTTGACTTTAAAGTTGATTATATCGCT
+ACGGGGAAAGCGACTTCAGGTAATGTGAATGCGGTAACAAATTTCCATATTAACTATTATTAATAGAACTCATTAATTGTTTTATTAATTAGTACCCTCC
+AGTGTTCTGGAGGGATATTCATATTTTTAAGAGTGACTATTTATGAAAACTTGCATAACAAAGGGAATTGTGACCGTAAGTTTAACGGCAATATTACTCA
+GCTGCTCATCCGCATGGGCGGCAGGTAAAGGCGGGATTGGACTTGCAGCAACACGTCTTGTTTATTCAGAAGGTGAAGAGCAAATTTCACTGGGTGTACG
+TAACACCAGTCCGGATGTTCCTTATCTTATTCAGTCATGGGTGATGACCCCAGATAATAAAAATCAGCAGACTTTATTATTACACCACCGCTATTTGTGC
+TGAATCCGGCAAATGAGAATCTGTTACGCATTATGTACATTGAGCGCCGTTGGCGAAAGACAGAGAAACCCTTTTCTTCACTAGCGTACGGGCAGTCCTT
+CAACAACGAAGCGGAAAGAGGGAAATACCCTGAAGATTGCCACACAAAGCGTCATCAAACTTTTCTGGCGACCAAAAGGTTTAGCGTATCCCTTAGGCGA
+GGCTCCGGCGAAACTGCGTTGCACTTCGTCAGCTGACATGGTTACGGTCAGTAACCCAACACCTTATTTCATTACCCTGACAGACCTGAAAATAGGTGGA
+AAAGTAGTTAAAAATCAAATGATTTCCCCTTTGATAAATACCAATTTTCTCTGCCAAAGGGGCCAAAATAGCAGCGTAACGTATCGAACCATCAATGACT
+ACGGGGCGGAAACGCCGCAACTCAACTGTAAATCGTAAGCCGTCTTCAGTTAAGAGAGCGAGATGTATAGAACTCATCGACAACACAGCCTGTTAAGCTC
+TGGTGGAGTGCCATCGTTTATTGGTGGGCTGGTGGTGTTTGTGTCGGCAGCGTTCAATGCACAAGCTGAAACCTGGTTCGATCCTGCTTTTTCAAAGATG
+ATCCTCAATGGTGGCCGATTTGTCTCGTTTCGAAAAGGACAAAAATAACGCCAGGGTTTATCGTGTCGATATTGTTCTGAATCAGACAATTGTAGATACG
+CGCAACGTCAATTTTGTTGAGATAACGCCAGAGAAGGGATTGCCGCCTGTTTGACGACTGAAAGCCTGGATGCAATGGGTGTTAATACTGATGCGTTTCC
+GGCTTTTAAACAACTGGACAAACAAGCGTGTGTGCCATTGGCGGAGATTATTCCGGATGCCAGCGTAACGTTTAATGTGAATAAACTCCGTCTGGAAATT
+TCAGTACCGCAAATCGCCATCAAAAGTAATGCCCGTGGTTATGTCCCCTGAACGTTGGGATGAAGGGATCAACGCGCTATTACTGGGATATTCGTTTAGC
+GGGGCTAACAGTATTCATAGCAGCGCAGACAGTGATTCTGGCGACAGCTATTTTCTGAATTTAAACAGTGGCGTTAATTTAGGCCCATGGAGATTGCGCA
+ACAATTCAACATGGAGTCGTAGTAGTGGCCAAACCGCAGAATGGAAGAATCTCAGCAGCTATTTGCAACGGGCGGTTATTCCTCTGAAAGGCGAACTGAC
+CGTAGGTGATGATTATACTGCAGGCGATTTTTCGATAGTGTCAGCTTTCGTGGTGTGCAGCTGGCGTCAGATGACAACATGCTGCCAGACAGCCTGAAAG
+GGTTTGCGCCTGTGGTGCGTGGTATCGCCAAAAGCAATGCCCAGATAACGATTAAGCAAAATGGTTACACCATTTACCAAACTTATGTATCGCCTGGTGC
+TTTTGAAATTAGTGATCTCTATTCCACGTCGTCGAGCGGTGATTTGTTAGTTGAAATCAAAGAAGCGGACGGCAGCGTCAATAGCTACAGCGTACCGTTC
+TCCAGTGTGCCATTACTCCAGCGTCAGGGGCGAATCAAATACGCGGTGACACTGGCGAAATACAGAACCAATAGTAATGAACAGCAGGAGAGCAAATTTG
+CCCAGGCCACGTTGCAGTGGGGCGGACCGTGGGGAACGACCTGGTATGGTGGTGGACAATATGCTGAATATTACCGTGCCGCCATGTTTGGTCTGGGATT
+TAACCTCGGCGATTTCGGAGCAATTTCGTTCGATGCGACCCAGGCGAAGAGTACGCTAGCAGATCAAAGCGAACATAAAGGTCAGTCATATCGTTTTCTG
+TATGCCAAAACGCTCAACCACTTGGGCACTAACTTTCAATTGATGGGCTATCGCTATTCGACGTCGGGTTTCTACACCCTTTCCGACACCATGTATAAAC
+ATATGGATGGCTACGAATTTAATGACGGTGATGATGAAGATACGCCGATGTGGTCGCGTTATTACAATTTGTTTTACACCAAACGTGGCAAACTGCAGGT
+CAATATCTCCCAGCAATTAGGCGAGTACGGTTCGTTTTATTTAAGTGGTAGCCAGCAAACTTACTGGCATACGGATCAACAGGATCGGCTATTACAGTTT
+GGCTACAACACGCAAATTAAAGATCTTTCGCTGGGGATTTCCTGGAACTACAGTAAGTCCCGTGGTCAACCTGATGCTGATCAGGTGTTTGCTCTAAATT
+TTCCCTGCCGCTCAATCTGTTGCTCCCCAGAAGTAATGATAGCTATACCAGGAAAAAATTACGCCTGGATGACCTCTAACACCAGTATCGATAACGAAGG
+GCACACTACACAAAACCTGGGTTTAACGGAGACATTACTCGATGACGGTAACCTGAGCTACAGCGTGCAACAGGGATATAACAGCGAGGGAAAACGGCTA
+ATGGTAGCGCCAGCATGGATTACAAAGGGCGTTTGCGGATGCCCGAGTGGGCTACAACTACAGCGATAACGGCAGTCAACAACAACTGAACTACGCTCTT
+TCAGGCAGTTTAGTTGCCCATTCACAGGGCATTACCCTGGGGCAATCGCTGGGGAAACTAACGTTCTGATTGCAGCACCAGGCGCAGAGAATACTCGTGT
+GGCGAACAGCACCGGGCTGAAAACTGACTGGCGCGGATATACCGTTGTTCCTTATGCCACTTCTTATCGGGAAAATCGAATCGCACTTGATGCGGCGTCG
+TTAAAACGTAACGTGGATCTTGAAAATGCAGTAGTCAACGTGGTTCCCACCAAAGGGGCGTTGGTTCTGGCGGAGTTCAATGCCCATGCGGGTGCAAGGG
+TATTAATGAAAACATCAAAGCAGGGTATACCGCTGCGTTTTGGCGCGATAGCGACGCTGGACGGCGTACAGGCTAATAGCGGCATAATTGATGATGATGG
+CTCGCTCTATATGGCGGGTTTACCGGCGAAGGGAACAATAAGCGTGCGCTGGGGCGAAGCTCCCGATCAAATTTGTCATATCAATTACGAGCTTACCGAA
+CAACAAATTAACTCTGCGATTACGCGAATGGATGCCATATGCAGATAATCTTTGGAGAAAAATGCGTGTCATTACTACGACTATTTTTGCCGCCGTCTTA
+ATGTTATGGTGCGCTCAAACCGCTGCTTATAGCGGGCAGTGTCATACTACTCAGGGAATCCGTATATTGGCGTCAATTTTGGCGTTAAAACCCTGGAGGA
+AGAAGCAAATACGGCAGGGGTAGTTAAAGACAAATTTTATCAGTGGAACGAATCGAATGATTATTATGTTTCCTGTGATTGCGATAAAGACAATGTCAGA
+AGTGGCCGATGGGCATTCGCCGCGGATTCACCGTTAGTCTATTTAGGCGACAACTGGTACAAAATTAATGACTATCTTGCCGCCAAAGTTTTATTGCAGG
+TTAAAGGCAGTTCTCCTACTGCGGTTCCTTTCGAAAACGTGGGCACAGGGGATACCCGATGGCATATTTGCGACCCTGGCGGTCAACGTTTAGGTGGGCA
+GGGGCAAGCGGTAATAGCGGTAGCTTTTCCCTGAAAATATTGCAGCCGTTCGTTGGCTCGGTCGTCATTCCTCCTATGGCGCTGGCGCGATTATATGAAT
+GCTACAACATACCCGCAGGTGATTCCTGCACGACTACAGGTACACCGGTTTTAGTGTATTACCTGTCTGGTACGATCAATTCACTTGGCTCATGTTCCGT
+CAATGCCGGAGAGACAATTGAAGTTGATTTAGGTGATGTCTTCGCTGCCAATTTCCGTGTTGTAGGGCATAAACCTCTTGGGGCCAGAACGGCAGAACTT
+GCAATTCCAGTCAGGTGTAACACGGGAAACGCGGGATTAGTTAATGTCAACCTGAGTCTGACGGCAACCACAGACCCCAGCTATCCCCAGGCGATTAAGA
+CGTCACGTCCTGGCGTGGGCGTGGTGGTGACCGATAGCCAGAACAACATTATTTCCCCTGCTGGTGGAACATTACCGCTCTCTATTCCTGATGATGCAGA
+CAGTATCGCGCGAATGAATGTCTATCCAGTCAGCACGACAGGTGTACCACCAGAAACCGGGCGATTTGAAGCCACGGCAACGGTGAGAATAAATTTTGAT
+TAACGCGTGAACGTATGAAGAAAAAACGATATTTCAGTGCGTTATCTTGTTCTTTAGCATTCTTAACATCCATGTCGGGATGGCTGGGCCTGAACAAGTT
+AGTATGCATATTTATGGGAATGTGGTCGATCAGGGCTGTGATGTCGCCACCAAAAGTGCATTACAAAATATTCATATTGGTGATTTTAATATCAGTGATT
+TTCAGGCCGCGAATACCGTAAGCACTGCTGCTGATTTGAATATCGATATCACCGGTTGTGCCGCTGGTATTACTGGCGCGGACGTCCTTTTAGCGGCGAG
+GCTGACACCCTTGCGCCGACACTGCTCAAACTAACTGACACAGGCGGAAGCGGTGGTATGGCAACGGGGATTGCCGTGCAAATTCTTGATGCGCAAAGTC
+AGCAAGAAATCCCGCTCAATCAGGTCCAGCCTCTTACGCCCTTAAAAGCCGGGGATAACACACTCAAATATCAACTTCGTTATAAGTCCACAAAGGCGGG
+AGCAACGGGCGGTAATGCGACGGCGGTTCTCTATTTTGATCTGGTTTACCAGTGAAGGAGTGATGTTGAAACGGATAATCTGGATTCTGTTCTTATTGGG
+ATTAACGTGGGGCTGTGAGCTATTTGCCCATGATGGCACGGTCAACATTAGCGGATCGTTTCGCCGTAATACATGCGTGCTGGCACAGGATAGCAAGCAA
+ATCAATGTGCAGTTAGGCGATGTCTCGCTGACACGTTTTTCTCATGGGAATTATGGCCCGGAGAAATCTTTCATCATTAATTTGCAGGATTGCGGAACAG
+ATGTCAGCACGGTTGACGTCACCTTTTCAGGAACCCCGACGGAGTGCAGAGCGAAATGTTGTCCATTGAAAGTGGTACGGATGCAGCCAGCGGGCTGGCA
+ATTGCGATTCTGGATGATGCGAAGATATTGATTCCGCTTAACCAGGCGAGTAAAGACTACAGCCTACATAGCGGTAAGGTGCCATTAACTTTTATGCGCA
+ATTGCGACCTGTCAATAGCGATGTGCAGTCGGGTAAAGTGAATGCCAGCGCGACATTTGTACTTCATTATGACTAATACGTGGAACAGATTGGCGCTCTT
+GATTTTCGCCGTTTTATCGCTGCTGGTGGCGGGTGAATTGCAGGCAGGAGTGGTGGTCGGCGGAACGCGATTTATCTTTCCGGCAGACAGAGAATCGATA
+TCTATTTTACTGACTAATACCAGTCAGGAATCCTGGCTTATTAACAGTAAAATCAACCGCCCAACGCGTTGGGCCGGGGAAGCGTCGACAGTGCCAGCAC
+CATTACTGGCCGCTCCGCCACTTATTCTCCTGAAGCCCGGTACGACAGGCACGTTGCGCTTGCTGAGAACGGAAAGCGACATCTTGCCTGTGGATCGCGA
+AACGCTATTTGAGTTAAGCATTGCCAGCGTGCCATCCGGCAAAGTTGAAAATCAGAGCGTAAAAGTGGCGATGCGCTCGGTATTTAAACTGTTCTGGCGA
+CCCGAAGGTTTGCCGGGCGACCCGCTGGAAGCTTATCAACAATTACGCTGGACACGGAATTCGCAGGGTGTACAACTCACTAACCCAACGCCTTATTACA
+TTAACCTGATTCAGGTGAGTGTAAATGGTAAAGCGTTAAGTAATGTGGGAGTTGTGCCGCCTAAAAGCCAGCGTCAGACAAGCTGGTGTCAGGCAATCGC
+ACCGTGTCATGTCGCCTGGCGGGCGATAAATGATTACGGCGGGTTGAGTGCAAAGAAGGAGCAAAATCTGCCCTGAAACAGGTTCGGAAAACGTTTGCGT
+TTTTTGCCGCAGGTCAATTCCCTTTGGTCCGAACTCGCACATAATACGCCCCCGGTTTGCACACCGGGAATCCAGGAGAGTTCATGTACTACCCCTTCGT
+TCGTAAAGCCCTTTTCCAGCTCGATCCAGAGCGCGCTCATGAGTTTACTTTTCAGCAATTACGCCGTATTACAGGAACGCCGTTTGAAGCACTGGTGCGG
+CAGAAAGTGCCTGCGAAACCTGTTAACTGCATGGGCCTGACGTTTAAAAATCCGCTTGGTCTGGCAGCCGGTCTTGATAAAGACGGGGAGTGCATTGACG
+CGTTAGGCGCGATGGGATTTGGATCGATCGAGATCGGTACCGTCACGCCACGTCCACAGCCAGGTAATGACAAGCCGCGTCTCTTTCGTCTGGTAGATGC
+CGAAGGTTTGATCAACCGTATGGGCTTTAATAATCTTGGCGTTGATAACCTCGTAGAGAACGTAAAAGGCCCATTATGACGGCGTCCTGGGTATTAACAT
+CGGCAAAAATAAAGATACGCCAGTGGAGCAGGGCAAAGATGACTATCTGATTTGTATGGAAAAATCTATGCCTATGCGGGATATATCGCCATCAATATTT
+CATCGCCGAATACCCCAGGATTACGCACGCTGCAATATGGTGAAGCGCTGGATGATCTCTTAACCGCGATTAAAAATAAGCAAAATGATTTGCAAGCGAT
+GCACCATAAATATGTGCCGATCGCAGTGAAGATCGCGCCGGATCTTTCTGAAGAAGAATTGATCCAGGTTGCCGATAGTTTAGTTCGCCATAATATTGAT
+GGCGTTATTGCAACCAATACCACACTCGATCGTTCTCTTGTTCAGGGAATGAAAAATTGCGATCAAACCGGTGGCTTAAGTGGTCGTCCGCTTCAGTTAA
+AAGCACCGAAATTATTCGCCGCTTGTCACTGGAATTAAACGGTCGCTTACCGATCATCGGTGTTGGCGGCATCGACTCGGTTATCGCTGCGCGTGAAAGA
+TTGCTGCGGGTGCCTCACTGGTGCAAATTTATTCTGGTTTTATTTTTAAAGGTCCGCCGCTGATTAAAGAAATCGTTACCCATATCTAATTATTTCTTCG
+AATTCCTCTTTATAAGATAATCAGGGCTTTATTTTCAGCCCTGGTTGTTTTATATTCATCGCTGTTGCTTATTTAGACATTTTGTACTTTTATTGTTGAG
+GTTATTAAGCGAAGCGACAATGGATTGTGTTGCTGCGGTTTTATAGGGTAGGGGAGAGGCAGATGCGAATTAAACCAGACGATAACTGGCGTTGGTATTA
+CGATGAAGAGCACGATCGAATGATGCTCGATTTAGCCAATGGTATGCTATTTCGCTCACGTTTTGCGCGCAAGATGTTGACTCCAGATGCCTTTTCTCCC
+GCAGGCTTTTGCGTTGACGACGCCGCGCTCTATTTCTCTTTGAAGAAAAGTGCCGCGATTTTAATTTATCTAAAGAACAAAAGCCGAACTGGTGCTGAAT
+GCACTGGTAGCAATTCGCTATCTCAAACCGCAAATGCCGAAAAGCTGGCATTTTGTTTCCCATGGTGAAATGTGGGTGCCCATGCCGGGCGATGCGGCCT
+GCGTTTGGTTGAGCGATACTCACGAGCAGGTCAATTTGCTGGTCGTTGAATCTGGCGAAAATGCCGCACTATGCCTGCTGGCACAACCCTGCGTTGTTAT
+TGCGGGTCGCGCGATGCAGTTGGGCGACGCCATTAAAATCATGAACGACAGGCTGAAACCGCAGGTTAATGTTGACAGCTTCAGCCTCGAACAGGCAGTC
+TAACGCGCCAACTTAAGTGCAGTCTTCGGTACACAGCTACAGCAAAGAATGGTGCCATCATCGCCCATTGCTGATTTTTCAGCGGCGTGACTTCGCCTTC
+TAAAAGCTGAACACGGCAACTTCCACAAATGCCCGCGCGGCAAGAATAAGGATACGAATTCCCTGATTTTCTAATTGCTCCAGCAACACCTGTTGGTTAT
+TTCCACGAAATGCCTGTCCCTGCCAGTCAATATCTACATTTGCGTCCGGTTGTTGCGTGATGTTGGCGGTATCATCAGCGGCAGCTGCGCCGTAAATTTT
+GCCGGAGCCGTTGCCAGAATTTCCACCTCATCGCCAACGCGAATCACGCCGCTATTACGGGCAATTAAATTCTGACCAAAATCGACATCGCCGTTATCCT
+GGGCAGTGCGGAAAGATTGCAATGTTTTTAATGGTTCGCCTGCCGGATGTTTTGCCCTTTTCTGGGCTGACGGTGGTGAAAATACAGCGGCTACAAGGTT
+TAACCACATCAAACACCACATCACCAATGCGAATCACTTTCCAGCGATCTTCTTCCCAGGCTGACGCGCCGGAAACCACCAGATTGGGGCGGAATTGCTC
+CATTTTACACTGGCCGGACAACGTTGTTGGAGATCACGTAACGAGGCTTCGTTAGCAAGAAGGTAAGGATAGCCATCAGCAAATGACAGAGGTACAGTGT
+TGTGGCGTTTCACGCGCCGGGTCATTTGTGGCCCCACCCAGCGTAATTGCACTTCGCGGGAGAAAATCCACTTAGCCATTTGTTGATCGCGTCTGGCGCA
+ATTCGCGCGGTAAAATGTGTGCCCCAAACTTCGGTTGGTGCGTCTTGTGTGGCGAAATCAGCAAAACGAACATATGCGCTACTGCCATCTGGTGCGGTGA
+GATGCAAGCCATCATGCACAGGTGAAGGAGTAAACCGTACCATCTGGGGAAACTGGCGAGCGGTAATAAACGTACCGTCAGGTTCCGTGATCATAAAGAT
+GCGATCGAAGGCCAGACCACTGACATCTGCCAGAGCATGTGTAAGACCAATGCCGCGCATCGATTTAACAGGATGAATAAAAGCCGGATTAATGTCGCCA
+CGGTGCGGTCCTCAAATGAAAATAAGCCCTCAACTTTATGACATGACGCGCTTATTAGCTATAATGCGCAACAATTTTCTTAGCGCCTGTCCCATTAGGC
+TATTTTATTTGTCAGTTTGGCCCTGGGTTATGCTCGAAATCCTCACGTACTTGTGTACGCTCCGGTTTCTCCGCGCTGTCCATGTCCAGACTGACTGCAA
+CAATTACGCCTACTGCGGTAGGCTCTTAGAGTAAAAGTGACGATATGAATTCTCTGTTTGCCAGTACGGCCCGTGGGCTGGAAGAGCTGTTAAAACTGAA
+CTGGAAAACCTGGGGCCGTTGAATGCCAGGTGGTTCAGGGTGGGGTCCATTTCAAGGGCGACACACGGCTTGTTTACCAGAGCCTGATGTGGAGCCGCCT
+GGCCTCGCGTATTATGTTGCCGCTGGGCGAGTGTAAGGTTTACAGCGATTTAGACCTCTATCTCGGTGTTCAGGCGATCAACTGGACAGAGATGTTTAAT
+CCTGGCGCGACCTTCGCTGTCCACTTCAGTGGTTTGAATGACACCATCCGCAACAGTCAGTACGGCGCGATGAAAGTGAAAGACGCGATCGTCGATGCTT
+TCACGCGGAAAAATCTGCCGCGTCCAAATGTTGATCGCGATGCGCCGGATATCCGCGTTAACGTCTGGCTGCATAAAGAAACCGCCAGTATCGCTCTTGA
+TCTGAGTGGTGATGGTTTACATCTGCGTGGCTATCGCGATCGTGCTGGTATTGCGCCGATCAAAGAAACCCTGGCAGCCGCTATTGTGATGCGATCCGGC
+TGGCAGCCAGGAACACCGCTGCTCGATCCGATGTGTGGTTCCGGTACGTTGCTGATTGAAGCAGCGATGCTGGCGACCGATCGCGCACCAGGCTTGCACC
+GTGGGCGTTGGGGCTTTAGCGGCTGGGCGCAGCATGATGAAGCTATCTGGCAGGAAGTGAAAGCGGAAGCGCAAACTCGCGCCCGTAAAGGCCTGGCTGA
+GTATAGCTCTCATTTTACGGTTCGGACAGCGACGCACGGGTGATTCAACGTGCACGCACTAACGCCCGTCTTGCGGGATTGGTGAACTGATCACCTTTGA
+GGTGAAAGATGTCGCGCAACTGACCAATCCGCTGCCGAAAGGGCCGTACGGCACAGTGTTGAGCAACCCGCCATACGGGGAACGTCTGACAGCGAACCGG
+CGCTGATTGCGCTGCATAGCCTGCTGGGTCGGATCATGAAAACCAGTTTGGTGGCTGGAATCTCTCTTTGTTTAGTGCCTCGCCGGATCTGCTAAGCTGC
+TTGCAGCTGCGTGCAGACAAACAGTACAAGGCGAAAACGGCCCGCTGGACTGCGTACAGAAAAATTACCACGTTGCCGAAAGCACTCCAGACAGCAAACC
+GGCGATGGTAGCGGAAGACTACACCAACCGCCTGCGTAAGAACCTCAAAAATTCGAGAAGTGGGCTCGCCAGGAAGGGATTGAATGTTACCGCCTGTATG
+ACGCCGATCTGCCAGAATATAACGTTGCCGTTGACCGTTATGCCGACTGGGTGGTGGTGCAGGAGTATGCGCCGCCAAAACTATTGATGCTCACAAAGCG
+CGTCAGCGTCTGTTCGATATTATCGCTGCAACCATTTCGGTACTGGGGATTGCGCCAAACAAACTGGTGCTGAAAACCCGTGAACGCCAGAAGGGCAAAA
+CCAATACCAGAAACTGGGCGAGAAGGGCGAGTTTCTTGAAGTTACCGAATATAACGCTCACTTGTGGGTGAACCTGACGGATTATCTCGATACTGGTCTG
+TTCCTCGATCACCGCATCGCCCGTCGTATGCTCGGTCAGATGAGCAAAGGCAAAGATTTCCTCAACCTGTTCTCTTATACCGGCAGCGCCACCGTGCATG
+CGGGATTAGGCGGTGCACGCAGCACCACCACCGTGGATATGTCGCGTACTTATCTGGAATGGGCAGAACGCAACCTGCGTCTGAATGGCCTGACCGGGCG
+TGCGCATCGCCTGATTCAGGCCGATTGCCTGGCGTGGCTGCGTGAGGCAAATGAACAGTTCGATCTGATCTTTATCGATCCGCCAACCTTCTCTAACTCA
+AAACGAATGGAAGATGCGTTTGATGTTCAGCGCGATCATCTGGCGCTGATGAAAGATTTGAAACGTCTGCTGCGTGCAGGTGGGACGATCATGTTCTCGA
+ACAACAAACGTGGCTTCCGTATGGATCTCGACGGCCTGGCAAAACTGGGACTGAAAGCACAAGAAATTACGCAAAAACGCTCTCCCAGGATTTCGCCCGT
+AACCGCCAGATCCACAACTGCTGGCTGATTACCGCAGCCTGAAAGGAATAGTAATGTCATTAATCAGTATGCATGGCGCATGGCTGTCGTTCAGCGACGC
+GCCGCTTCTCGATAACGCAGAACTGCATATCGAAGATAACGAACGTGTTTGTCTGGTGGGCCGCAACGGCGCAGGCAAATCGACGTTAATGAAAATCCTC
+AACCGTGAACAAGGGCTGGATGACGGTCGCATTATTTACGAGCAAGATTTGATTGTAGCGCGTCTGCAACAGGATCCGCCGCGTAACGTTGAGGGTAGCG
+TTTATGATTTCGTTGCCGAAGGCATTGAAGAACAAGCGGAATATCTGAAACGCTATCACGATATTTCGCGCCTGGTGATGAACGACCCGAGCGAGAAAAA
+TCTCAACGAACTGGCGAAGGTTCAGGAACAGCTGGATCACCACAACCTGTGGCAGCTGGAAAACCGCATCAACGAAGTGCTGGCGCAACTGGGGTTAGAT
+CCTAACGTTGCGCTGTCGTCGCTTTCCGGCGGCTGGTTGCGTAAAGCGGCATTAGGACGCGCGCTGGTGAGTAATCCGCGCGTGCTGTTGCTTGATGAAC
+CGACAAACCACCTGGATATTGAAACCATCGACTGGCTGGAAGGGTTTTGAAAACTTTCAACGGGACGATTATTTTCATCTCCCACGACCGTTCGTTTATC
+CGCAATATGGCGACGCGCATTGTTGATCTCGATCGCGGCAAGCTGGTGACCTATCCAGGGAATTACGACCAGTACCTGCTGGAAAAGAAGAAGCCCTGCG
+CGTGGAAGAATTACAAAATGCCGAGTTCGATCGCAAACTGGCGCAGGAAGAGGTGTGGATCCGCCAGGGATCAAAGCACGCCGTACCCGTAATGAAGGCC
+GCGTACGCGCCCTGAAAGCGATGCGTCGCGAACGTGGTGAACGTCGCGAAGTGATGGGTACCGCAAAGATGCAGGTGGAAGAGGCCAGCCGCTCCGGTAA
+AATCGTTTTCGAAATGGAAGACGTTTGCTACCAGGTTAACGGTAAGCAACTGGTGAAAGATTTTTCTGCCCAGGTTCTACGTGGCGACAAAATTGCCCTG
+ATTGGTCCGAATGGGTGCGGCAAAACCACGCTGCTAAAACTGATGCTCGGTCAGCTTCAAGCGGACAGCGGGCGTATTCACGTTGGCACCAAACTGGAAG
+TGGCTTATTTCGATCAGCACCGCGCGGAACTGGATCCCGATAAAACGGTGATGGATAACCTTGCCGAAGGTAAGCAAGAGGTGATGGTTAACGGCAAGCC
+ACGCCACGTATTGGGCTATTTGCAGGACTTTCTGTTCCATCCGAAACGGGCGATGACGCCGGTACGTGCGCTTTCTGGCGGTGAGCGGAACCGCTTGCTG
+CTGGCGCGTTTGTTCCTCAAACCAAGCAACTTATTGATTCTTGACGAACCGACCAACGATCTTGATGTCGAAACGCTGGAACTGCTGGAAGAACTGATCG
+ACAGCTATCAGGGCACGGTATTGCTGGTTAGCCACGATCGTCAGTTTGTCGATAACACCGTTACAGAATGTTGGATCTTCGAAGGCGGCGGTAAAATTGG
+TCGTTATGTCGGCGGTTATCATGATGCCCGTGGTCAGCAAGAGCAGTATGTGGCGCTCAAACAGCCTGCGGTGAAAAACCGAAGAAGCCGCCGCGGCAAA
+AGCAGAAACTGTAAAACGCAGCAGTAGCAAACTAAGCTATAAATTGCAGCGCGAACTGGAGCAGCTACCGCAATTGCTCGAAGATCTGGAGGCGAAGCTG
+GAAGCCCTACAGACGCAAGTGGCGGATGCTTCCTTCTTCAGTCAGCCGCATGAGCAGACGCAAAAGTGCTTGCTGATATGGCTGCTGCAGAGCAGGAGCT
+GGAGCAAGCCTTTGAACGCTGGGAGTATCTTGAAGCGTTAAAAATGGTGGCTGATCGCAAAATAGTCGATTTAAACAGAGACAGCTGACAACGGTAAAAT
+TGCCTGATGAACTGGGTTTATCAGGCATGAAACCAACACTTTGTTAGTCATCTGTAAAATAGCGCATCATTAAGGAGTACCAATGTGCGAACATCATCAT
+GCCGCGAAGCACATCCTGTGCTCGCAGTGTGACATGCTGGTGGCGTTACCGCGCCTTGAGCATGGTCAGAAAGCGGCATGTCCCCGGTGTGGCACAACGT
+TAACCGTGGCGTGGGATGCCCTCGGCAGCGTCCCACCGCCTATGCGTTGGCTGCACTGTTCATGCTGTTGCTGTCCAACTTGTTTCCTTTGTGAATATGA
+ACGTTGCAGGAGTTACCAGTGAAATTACATTACTGGAAATTCCCGGCGTGCTTTTTCTGAGGACTACGCCAGCCTCGGCACCTTTTTCCTGTTGTTTGTG
+CAACTGGTTCCCGCGTTTTGTCTGATAACCATTCTGTTACTGGTGAATCGCGCGGAATTACCGGTCCGTTTAAAGAGCAACTGGCACGGGTGCTTTTTCA
+ACTCAAAACCTGGGGAATGGCGGAGATTTTCCTCGCGGGTGTGCTGGTCAGTTTCGTTAAACTGATGGCTTACGGCAGCATTGGGGTAGGCAGCAGCTTT
+CTCCCCTGGTGTTTATTTTGTGTCCTGCAACTGCGCGCTTTTCAGTGCGTTGATCGTCGCTGGTTATGGGACGACATCGCCCCGATGCCAGAACTGCGCC
+AGCCGCTAAAACCAGGCGTCACGGGGATACGTCAGGGGCTGCGTTCGTGCTCCTGTTGTACGGCAATCCTTCCTGCTGATGAACCCGTGTGCCCGCGTTG
+TAGTACCAAAGGGTACGTTCGGCGTAGAAACAGCCTGCAGTGGACACTCGCGCTGCTTGTAACGTCCATCATGCTGTATCTTCCGGCTAATATTTTGCCC
+ATCATGGTGACGGATTTATTAGGCTCGAAGATGCCGTCGACGATTCTCGCTGGGGTCATTCTGTTATGGAGCGAAGGCTCTTATCCCGTCGCTGCGGTGA
+TCTTTCTGGCCAGTATTATGGTGCCAACGTTAAAGATGATCGCCATCGCGTGGCTGTGTTGGGATGCCAAAGGGCATGGCAAGCGCGACAGTGAAAGAAT
+GCATTTGATTTATGAAGTTGTTGAGTTTGTAGGCCGCTGGTCGATGATTGACGTTTTCGTTATCGCGGTGCTCTCGGCGCTGGTGCGTATGGGAGGTTTA
+ATGAGTATTTATCCGGCAATGGGTGCATTAATGTTTGCTTTAGTCGTCATAATGACAATGTTTTCTGCTATGACGTTTGACCCGCGTTTGTCGTGGGATC
+GTCAACCTGAATCAGAGCATGAGGAGTCCTGACAGTATGGAATCTAATAATGGGGAAGCCAAAATCCAGAAAGTGAAGAACTGGTCTCCCGTGTGGATAT
+TTCCTATCGTCACGGCGCTCATTGGGGCCTGGGTTCTTTTTATCATTACAGCCATCAGGGACCGGAAGTGACCTGATCACCGCGAATGCGGAAGGAATTG
+AAGGTGGCAAAACCACCATTAAAAGCCGTAGCGTTGACGTCGGCGTGGTTGAAAGCGCCACACTGGCTGATGATTTGACGCACGTTGAAATCAAAGCGCG
+GCTGAATTCCGGTATGGAAAAATTGCTGCATAAAGACACCGTCTTTTGGGTGGTGAAACCGCAGATTGGTCGCGAAGGGATTAGCGGCCTGGGAACGCTG
+CTGTCTGGAGTTTATATCGAACTGCAGCCAGGCGCGAAAGGCAGCAAAATGGATAAATACGATTTGCTGGACTCGCCACCGTTGGCCCCGCCTGATGCGA
+AAGGTATCCGTGTGATTCTCGATAGCAAAAGCCGGGCAGCTCTCGCCAGGAGATCCGGTGCTGTTCCGTGGCTATCGGGTAGGTTCGGTTGAAACCAGCA
+CCTTCGATACACAAAAACGCAATATCAGCTATCAACTGTTCATCAATGCACCTTATGACCGACTGGTGACCAACAATGTTCGCTTCTGGAAAGATAGTGG
+CATTGCGGTTGATCTGACGTCAGCAGGGATGCGTGTGGAGATGGGCTCATTGACAACGCTGCTGAGTGGCGGTGTCAGCTTTGATGTGCCGGAAGGTCTG
+GATTTAGGGCAGCCAGTGGCACCGAAAACAGCTTTCGTTTTGTATGATGATCAGAAGAGCATTCAGGATTCGTTGTACACCGATCACATTGATTATCTGA
+TGTTCTTTAAAGATTCGGTACGCGGTCTGCAACCGGGAGCTCCGGTAGAGTTCCGGGTATTCGCCTGGGTACCGTAAGCAAAGTGCCATTCTTTGCGCCG
+AATATGCGTCAGACATTTAACGATGATTACCGTATTCCGGTACTGATTCGTATCGAGCCAGAGCGGCTGAAAATGCAGCTTGGCGAAAATGCGGATGTTG
+TTGAGCACCTTGGCGAATTGTTGAAACGTGGTTTACGCGGATCGCTGAAAACCGGAAACCTGGTCACTGGTGCACTGTATGTTGATCTCGATTTCTATCC
+AAATACGCCTGCAATAACCGGTATTCGTGAATTTAATGGTTATCAGATTATCCCGACCGTTAGCGGCGGCCTGGCGCAAATCCAGCAACGACTGATGGAA
+GCGTTGGATAAGATCAACAAACTGCCATTGAATCCGATGATTGAACAGGCAACCAGTACGCTTTCTGAAAGTCAGCGCACAATGAAAAACCTGCAAACGA
+CGCTGGATAGCATGAACAAGATCCTCGCTAGCCAGTCGATGCAGCAGTTGCCGACGGATATGCAGTCAACGTTGCGTGAATTGAATCGCAGCATGCAGGG
+CTTCCAGCCTGGCTCCGCAGCCTACAACAAGATGGTGGCGGATATGCAGCGCCTTGATCAGGTGTTGCGAGAACTGCAACCGGTGCTGAAAACGCTCAAT
+GAGAAGAGTAACGCGCTGGTATTTGAAGCGAAGGACAAAAAGATCCAGAGCCGAAGAGGGCGAAACAATGAAAAAGTGGCTAGTGACGATTGCAGCACTG
+TGGCTGGCCGGATGCAGCTCCGGCGAAATTAATAAAACTATTACCAGTTACCTGTGGTGCAGAGCGGTACACAAAGTACCGCCAGCCAGGGCAATCGTCT
+GTTATGGGTAGAGCAGGTCACTGTTCCTGACTATCTGGCGGGGAATGGTGTGGTTTATCAAACCAGTGATGTGAAGTATGTGATTGCCAACAACAACTTG
+TGGGCCAGCCCGTTGGATCAACAGTTGCGCAACACCCTGGTTGCCAACCTGAGTACGCAACTGCCCGGCTGGGTGGTTGCCTCCCAGCCTCTGGGAAGCG
+CCCAGGACACGCTCAATGTTACCGTAACGGAGTTTAACGGTCGCTATGATGGCAAGGTCATTGTCAGTGGTGAGTGGCTGTTGAACCACCAGGGACAACT
+GATCAAACGTCCGTTCCGTCTGGAAGGAGTGCAAACTCAGGATGGTTACGATGAGATGGTTAAAGTGCTGGCCGGTGTCTGGAGTCAGGAAGCCGCTTCT
+ATTGCACAAGAGATAAAGCGTCTACCTTAATTATAAAGATTTGTAAATATAACCGTCTCCGGTATGTTGCCTGAGGCGGTTTTTTGTCTCTAACGTGCGG
+AAAAATTTGTTCCTCTTCACATTTTTGTACAACCGACATGCCCGTGTAGCTCACAAATATGACAGTGGCGTGAATTTTGCGCATTGACGGCAGTTATGAT
+TCGCGGTATTGCTTAACTGTGATTGCACATTTAGTAATCACTGTTTTCTTTTCCACCAGAAACCAGTATGAGGGAAACGAGGCATGAAGAGACAAAACGA
+GATCGCCTGGAACGGGCACATCAACGTGGTTATCAGGCCGGCATCGCCGGACGCTCAAAAGAAATGTGTCCCTATCAGACGCTGAATCAAAGGTCACAAT
+GGCTGGGAGGCTGGCGAGAAGCCATGGCGGACAGGGTAGTAATGGCCTGATTCTGTCTCTTTAAAGAAACCTCCGCATTGCGGAGGTTTCGCCTTTGATA
+CTCTGTCTGATTATAATCAGAAGGCAGACGTATCCTGGAACAGACCGACTTTCAGGTCGCTGGCGGTATAGATCAGACGACCATCAACCAGCACTTCGCC
+ATCCGCCAGGCCCATAATCAGACGACGGTTAACAATGCGTTTAAAGTGAATACGGTAGGTCACTTTTTCGCTGTCGGCAGTACCTGACCAGTGAATTTCA
+CTTCGCCAACGCCCAGCGCGCGGCCTTTACCTTCGCCGCCCAGCCAGCCGAGGTAGAACCCTACCAGCTGCCACATTGCGTCCAGGCCCAGGCATCCCGG
+CATAACCGGATCGCCAATAAAGTGGCATCCGAAGAACCACAGATCCGGATTGATATCCAGTTCTGCTTCAACATACCCTTTGTCGAAGTTACCACCCGTT
+TCGGTCATTTTGACCACACGGTCCATCATCAGCATGTTCGGTGCTGGCAATTGCGGGCCTTTAGCGCCAAACAGTTCACCGCGACCAGAGGCAAGAAGGT
+CTTCTTTGTATAGGATTCGCGTTTATCTACCATGTTCTCTGTAAGCCTTATTTTATTGAAGCACGCAGGATAGCTAACACGTGTACGCTGAACAAGTCCG
+ATCAGTTCGGAATAAACCAGTTCAGCCAACGTAATGGCCATGGAAAACGGTGACGTCCTTCCTGTTGCGATGCTTGCGCGATACGTTCCTGGATGGTTTG
+CATCAGCGTCGTTTGGCCTTCGCCATCCCACACCAGATTTAATAATAACGGCAGTGCGTCAGTCACATCGTCTACTGCCCAGATGGTGAATTTGCCTTCT
+TCTACCGCTTTCACCAGTTCACTGTGAAGACTTAAATGGCGAACGTTAGCTGTGGGGATAATGACACCTTGTTTCCCGGTTAACTCACGTTGCTGGCAAA
+TAGCAAAGAAGCCTTCGATTTTCTCATTTAAACCACCGACCGGCTGGGCGCGACCGAACTGATCGACTGAACCTGTGATAGCGATACTCTGATTCACCGG
+CACATCGGCGAGGGCGCTTATCAGGGCGCAGAGTTCAGCCATCGAGGCACTATCTCCATCAACTTCACTGTATGACTGCTCAAATGTCAGCGATGCTGAG
+AAGGGGATCTGTTGCTCAAGCTGTAGTTCCGACATCAGGAACGCTTGCATGATCATCATCCCTTTCGCATGGATATTGCCGCCAAGCTCCGCTTTGCGTT
+CGATGTCGGTGAATTCACCATCGCCAATATGCACAACGCAGCTAATGCGAGAAGGTTCGCCAAAAGCGCGTGGATGACCCGGAAATTCAATGACCGAAAG
+GGCGTTAATTTGCCCGATGCGTTCGCCTTCGGTTTCAATCAGGATTTGCTCCTGAAGGATCTCATCCTGCATACGTTCAGCGAGGAAACCTTCGCGCCAT
+TCACGCTGCTGCAGCATTAAGTTTAGCTGCTCGCCGGAGAAGGTGTCGCCATCACACAGGAGGCGACCTCTTTACACTGGCGGAGGATCCACTGCGGGCT
+AAGCGGAAGTGTTTCTTGTTCACCGGTGTAGCGTGCTGCTTCGCGGATAAGTATCGGCCAGGCATCCGCTCCCGGTGCAGGTAAGTGATTATGTCTGGCG
+GTAAATGTCACCCAGCGACACCACTGGGTTACTGACTCCGCATCGACAATCTGCAGAGTATCTTCAAATTCGCTATAAATAGCCTGCTCTGAAAGCTCTG
+GCTCCATCTCCTGGAAATCAGCCAATGATTCGCGTTCGCCTACCAGAATGACTTTCAGCTTCAATGGCATCGAAGGCACAGAGACGGGGAGAGGGCGCGA
+CTCATCAAACGCAACCCAGTCAAAACGCTCGCGGTTAACGATATTTTCAGCCGCATCCACAGCAGAGGTTGCGCCAGCAGTGTACGCAAAGAGATAATGA
+GAATACCGCCATTTGCCTGATGCACCAGACCAGGCTGCAGGGTAATGTCGCCATTAAACTGGCGCAGGCAGCCAAAGAGTTGCTCCGCTTCTACCCAGTC
+GGCAGCGACAACTTGCGTTAAAGTCGCAAAATTATCATCTGCACTCACTGCGTGACGTAAGCGGATGGAGTGGCCGGAAACCTCATAGTGACCGCCCACC
+AGTTGGCCTGCATCGCTTTGTAGCGTACGCGCGGCATTGGCAATAAGATTCAGATACTCAGACTCTTCCGGGGCCTTCGCCAGCATAAAGAGGAGGATGC
+TCGCGTATGCAGCAACTGCTCCAGCGCAAATTGCAGCCGCGGTTGAGTATCACTGAATAAAGGATCGTTTTCGTCAATCAAATGTGGCTGAGCAAATATT
+TCCTGATAGCTATCGGTATCAGGAACCAGGTCACGCCATGCAAGTTTCGTAATGGTCAAAGTTGATGTTTTTAGTCTGTTGTCAAAGCCGCGATTATACC
+GTAACCGGCACTACAGCACACGTAGAAAGCACCGACAATACTCCTGGCATGGGCGTTAAAGCTCACAGGATGGAGATTCTTTTCTTCACTGGCCTAAAAG
+CTGATATTCTGTAAAGAGTTACACGGTAACATTGAGATCGCTATGAAATATCAACAACTTGAAAATCTTGAAAGCGGTTGGAAATGGAAGTATCTGGTTA
+AGAAGCATCGCGAAGGGAGTTAATCACCCGTTACATAGAAGCCAGTGCCGCCCAGGAAGCCGTCGATGTGTTGCTCTCGCTGGAAAATGAACCCGTGCTG
+GTAAATGGCTGGATTGACAAGCATATGAATCCGGAACTGGTCAATCGCATGAAGCAAACCATTCGGGCAAGACGAAAGCGCCATTTTAATGCGGAACACC
+AGCATACGCGCAAAAATCGATCGATCTGGAATTTATTGTCTGGCAACGTCTGGCTGGTCTTGCGCAGCGTCGCGGTAAAACGCTTTCTGAAACGATTGTT
+CAGCTGATTGAAGATGCGGAAAACAAAGAGAAATACGCGAATAAAATGTCTTCTCTGAAGCAGGATCTGCAGGCATTGCTGGGTAAGGAATAACTGACGA
+AAGTCAGTTCAATTTACTAAAGGCAAAAAACCCGCAGCAGCGGGTTTTCTACCAGACGAGAACTTAAGCCTGCGGCTGAGTTACAACGTCTTTGATACCT
+TTAACTTCGATCTCTACGCGACGATCCGGAGCCAGGCAGTCGATCAGTGCAGCACGCTGTTTCACGTTGTCACAGGTGTTGCCAGTAACCGGGTTGGATT
+CGCCCATACCACGTGCGGAGATCTTGTCTGCCGGGATACCTTTGGAGATCAGGTAATCAACAACAGACTGAGCACGGCGCTCGGACAGACCCTGGTTGTA
+AGCGTCAGAACCGATGCGGTCGGTGTAACCCAGAACAACTACGGAACCGTCTTTCGGATCCAGGTTGCTCAGCTGGCTGTACAGCTGATCCAGAGCAGCC
+TGACCTTCCGGTTTCAGGGTTGCTTTGTTGAAGTTGAACAGAACGTCAGACTTCAGAGTGAAGTGCTTGGTCTGTACTTCCGGTGCCGGAGCTGGAGCCG
+GAGCAACTACTGGAGCTGCTTCGCCCTGACCGAAACGGTAGGAAACACCCAGGCTCAGCATGCCGTTGTCCGGACGAGTGCCGATGGTGTGTGCGTCACC
+GATGTTGTTGGTCCACTGGTATTCCAGACGGGTAGCGATTTCAGGAGTGATCGCGTACTCAACACCGCCAGCGAAGACCGGAGAAACGCCGGTGTCGTGG
+TTTTACCATAAACGTTGGATTTAGTGTCTGCACGCCATACCATGCCACCCAGACGAGTGTAGATGTCCAGGTCGTCAGTGATTGGGTAACCCAGTTTAGC
+GGTCAGTTGAACGCCCTGAGCTTTGTATGCACCGTTTTCAACGCTGCCTTTGTACGGCATACGACCTAACCAGTCGTAACCCATTTCAAAGCCAACATAC
+GGGTTAACCTGGTAACCACCAAAAGCACCAGCGCCCAGTTGGTTTTCATGGGTCGGGCCATTGTTGTTGATGAAACCAGTGTCATGGTACTGGGACCAGC
+CCAGTTTAGCACCAGTGTACCAGGTGTTATCTTTCGGAGCGGCCTGCGCTACGGTAGCGAAACCAGCCAGTGCCACTGCAATCGCGATAGCTGTCTTTTT
+CATTTTTGCGCCTCGTTATCATCCAAAATACGCCATGAATATCTCCAACGAGATAACACGGTTAAATCCTTCACCGGGGATCTGCTCAATATTAACTCTA
+CCGATATCTTCGGCTTATGCCGAGCACCCTGGCGATGTAAAGTCTACAACGTAGTTGAAAACTTACAAGTGTGAACTCCGTCAGGCATATGAAAAAAAGT
+CTTGTATAAGGTATGTTTAATCTTTTTGTCAGCGACAATTTACAGAAGAGAATCGCGGAAACCGCTTCAGACAAGCCTCCGCAAGGAAAATTAGTCACGA
+CTGAAAGCATTGGCTGGGCGACAAAAAGTTCCAGGATTAATCCTAAATTTACTTAATGATACAAATTAGAGTGAATTTTTAGCCCGGAAAGTTGTCTCGT
+GGCGTGAGAGGATGCGCTTACCGGACGCATAATAAACCCCATAGCGTTACCTTCATTTGCCGCATCAACAAGTTCAGCATGCTCTTCTTCAGTCAAATCA
+TCTGCCAACCAACCGATCACCACACTGTAATTGCCCGTGCGTAAAGCGCGAACCATTGACTCCACAGTGTGGCAAGGGGAGAGCTGGCTAATCTGCATTA
+CTTTCGTTAAGGGTAGCCCAGATGCCTGAACCCATTCCCGACTCAGTTTTTGTTGCGGTGTTAACCAGAGTTGCCAGCGCGATTGCTGACCGAGTTGCTG
+TAACAATGGCAACAGTAGAAGTTGCGTCATCATGGGCTGATCTTCGCGATAGACAACTTCACTGATAAGCCCGGCTGTAGTGTTTTCCGTAGAGACACGC
+GCAATTTTACTTGCTGCGGATGAGAACGACGAAGAACGATGTGCATAGCCTGAAGTGTACATAATCAATCCAGCCCTGTGAGTTACTGTATGGATGTACA
+GTACATCCAGTGACAACAAAGATCAACCCTATTTTCGGAAAGAGCCTCGCAAATTTTGTCGTTGGTGACGGGAAAACATAAATTAATCTTGCCCCTTAAG
+AATAAGTTGCCTATTTTCGTAGTTAACGGATCCGTTAATGTGAATCATTCTTTTATGTTATGATTTTAAAGGAATTTTATGAAAAGCCTCTCCTATAAGC
+GGATCTATAAATCACAAGAATACCTGGCAACGTTGGGCACAATTGAATACCGATCATTGTTTGGCAGTTACAGCCTGACCGTTGACGACACGGTGTTTGC
+GATGGTTTCTGATGGTGAGTTGTATCTTCGGGCTTGTGAGCAAAGTGCACAGTACTGTGTAAAACATCCGCCTGTCTGGCTGACATATAAAAGTGTGGCC
+GATCCGTTACCCTCAATTACTATCGGGTTGATGAAAGTCTATGGCGAAATCAACTGAAGCTGGTGCGTCTGTCGAAATATTCTCTCGATGCAGCGCTGAA
+AGAGAAAAGCACGCGCAATACCCGGGAAAGACTGAAAGATTTGCCCAATATGTCTTTTCATCTGGAAGCGATTCTCGGGGAGGTGGGGATTAAGGATGTA
+CGGGCGTTACGTATACTTGGGGCAAAAATGTGTTGGTTGCGACTGCGGCAGCAAAACAGTCTGGTGACAGAAAAGATTCTGTTTATGCTTGAAGGTGCCA
+TTATCGGCATTCATGAAGCTGCGCTCCCGGTGGCACGCCGCCAGGAGCTTGCAGAATGGGCTGACTCTCTTACGCCGAAACAGGAGTTTCCTGCGGAACT
+TGAGTAATCTGGCGTTGCAGACGACCAATCTCAGGCAGTAATGCAATCAATAATCCAACTTGTTGTACGACCAGAGGTTCTTTGCTGTCTGCCCGTGGTT
+CAAGTTGCTGCATCCGCTGTTTCAGGCTAGCTAATGCCTCATTGACGCGTTCTTCATCAGCAGGTTGATGATGTAACGCGTCATCAACATAGCAAACTGC
+GTCATCAAGAAACGCCAGAATTTCAGGATTAGTTAACTGCTCCCGGTGAGCACCGAGGGCTGAGATATAGCTGGTAAACGTATGGTTAAGGCACAGCAAC
+CGAAACGCGGCTTCGCGAATTTGCGGGGTAACGTTCGGCTCGCTGGACATATTTGATACCACCGACGCCAGCTCAGCATCACGGTTGTGTGCATCGCGGC
+GGGCAATACGATACGCCAGACGGTTATCACGCCCTGATGGTATTGCTCCAGTATGGCATCGAGATACCGACAGTTGGCCTCTGTGGCGCGTTCGAGCATG
+CGCGGCAGATTGCGAAACTGCCAGTCAGGCCAGATGTAGCTCACTGCCGCCCACGCAATGGCACAACCAATCAGCGTATCGATTACGCGAGGTAACGCTA
+CTTCAAAACCTTCACCCAGTAAGTTAAAACACAGTAGCACCAAAAGTGTGATGAACATCGTTGCATGAGCGTATTGCACGTTACGGAAGGCAAAAAGAGC
+ACGCCGGTAATAACCAGCAGCACCAGCTGCCCTTCCAGTGATGGCACAAACCACAGCACAGGAATGCCAATGGCGATACCTACCAGCGTACCAATAATCC
+TTAACTTCAGGCGGTGGCGCGTGGCGTTATAGTTTGGCTGGCAGACAAACAAACTTGTCAGCAAGATCAATACCCGTGATGCATTCCGGTTATCTGAATG
+ATGGCGTAGCCGAAGCACAACACCAGCGACATTCTTACCGCATGACGGAAGAGGGCGGATTCCGGCGTGAAGTGACGGCTAAGACGCAGCCAGATATCAC
+TCAACCCGTGCGGGCTGTCATCAGCGAGCTCATTTTCGTCATTATTATGGGGTAGTGCCTGGGCCTGTTCTGATTCAATTGTTGCCAGTTGGGCATCAAT
+GGCGCGTAAATTGTTCAGCAAAATCCCAGTGTTTTGAGTAAATCGGCGGGTGCGCCGTTATCGCGCATCCGCTCCAGCGCAGCATCAATATGCGTAAAGC
+GCGCTCAAAATGCGGATCATGTTGATAAGGCTGACGCAACAAAATACAGCGTGACAGTTGCTGGCACGCCTGGCCCTGCATCGACATCAGCCGCTGAAAA
+CGGAACAGCACGTCGCTGTGGCGAAAATGTTCACGCAATGTTTGATACTGAATATGAGAAGAGCTGGCACGCTCGTGAATATCCTGTGCGACAAAGTAAT
+AATGCAGCGTGCGACGCGTTCCCCGTTGACCACGATCGCCACGTAAGCGGGTCAGCAGCGAGAGTTTCGTCTGATTCAATGTCGCCATCAGCAGACCGTT
+GGCGAGAGCCAAATCGTACAGCGGTGCCTGGCTTTGATCTTCAATATCAGGATCAAACATGCGCGACTTGAGCTCAAGATAACGCGCCAGTTGTTCATAG
+CAACGCGCCAGGTTGTCCTGCAGCGGGCGGACCGGGAACAGCAGATGACCAATAAGTGTCAGGACGTTGTACCAGACGGCACCGGCCAGCAGATACATCG
+GCTGCTGATACCAGTGCTCATACAGTGATGTTCCCAACATAGTGTAAATGGCGATCAGCAATGCACCGAAGGCAATTGTTGCATAGCGTTGACCCAGACC
+GCCGAGCAAAATGAAGCCGCTGGTAGAGAGCGTTAAGCCAATCGCAAATAGCCAGGGCCAGGAAACAGCAATTCTACTGAGGCCGAGGCGATAAAAAGCA
+GAACAGCGTAATGATGAGGTTACGCAAACGTCCCGCCAGTCGGTCATCGAGATCGGTCAGCGCCGCTGCCACCATCCCCAGCGTTAGCGGAATCGTCAGT
+TTTACATCACCCAGCCACCACGGAAACGCTGTGGTTCCACAAAGCGCAATAAAAATACGCGCGTAATACAGCCAGGCGCTGTTCCAGGTATAGCGTTTGA
+GCAAAGGACTTAGCATAAAGGCCATATTAGTGGATTATTCAAAACGACGACGTGCATTGGCTTCACGCGCAGCTTGCGCTGTTTCTACCGATACCACGCG
+ACGACCAACCGGCCATAGTGCAATAGCGGCAATTTTAAAGTTCGCAATGCCGACAGGAATGCCAATGATTGAAATACATTGTGCGATGCCCGTTGCAATG
+TGCATCAGGCATAACCACCAGCCAAAGAAAATCAGCCAGAAAATATTCAATACCGTACCGCCAGTATTCAGCAGCACATTTTGCCAGCCGGGTTCAGTTC
+ATCGACATGAATAGCTTCATTGCCATAAGGCACCAGAGACAGTTTAGTGATCTCCCAGCAGGATCGTGTCAGCGGTAAGGTAAAATCAGCACAATACTGA
+CCAGAGTCGCCAACAGCCAGCCCAGAGTGGTGGCAAATCCGCCAAGCACAAAGTTCAGAATGTTCAAAACGGTACGCATAAAACCTCGCTTTACTGTGGT
+TTTCAGTAATGGGCGGCAATTGTAACGTTTTTGGGCTGGAGCACGTTTTCTCTGACGGTTACACTGATAAGAAATAATTTCGTGTGGATCTACAGAGTCA
+TGGAACTGAAAGCGACAACGCTTGGAAAACGTCTGGCACAGCACCCTTACGATCGGGCGGTGATCCTCAATGCCGGGATTAAAGTCTCCGGCGATCGCCA
+CGAATACCTTATTCCTTTCAATCAATTACTGGCGATTCACTGTAAGCGCGGTCTGGTATGGGGCGAGCTGGAATTTGTACTGCCGGACGAAAAAGTGGTG
+CGTCTGCACGGCACCGAATGGGGCGAGACGCAGCGTTTTACCATCATCTTGATGCTCACTGGCGGCGGTGGAGTGGCGAGATGAGCGAAATTGCGTCTGG
+TGTTTTACGCCAGCAACTGGATTTGATTGCCACGCGCACTGGGGAAAATAAATGGCTGACGCGTGAGCAAACCTCTGGCGTGCAGCAACAAATCCGCCAG
+GCTTTGTCGGCGTTGCCGTTGCCGGTTAACCGACTGGAAGAATTCGATAACTGCCGTGAGGCGTGGCGTAAATGTCAGGCCTGGTTGAAAGATATTGAAA
+GCGCTCGGTTGCAGCATAACCAGGCGTATACCGAAGCCATGCTTACCGAGTATGCGGATTTTTCCGCCAGGTCGAGTCTTCACCGCTGAATCCGGCGCAG
+GCCCGGGCAGTCGTTAATGGCGAGCATTCTCTGTTAGTGCTGGCAGGTGCAGGAAGCGGAAAAACGTCGGTGCTGGTGGCCCGTGCAGGCTGGTTGCTGG
+CGCGTGGTGAAGCGTCCCCTGAGCAAATTTTATTGCTGGCGTTTGGTCGCAAAGCCGCTGAAGAGATGGACGAGCGGATTCGCGAACGGCTACATACCGA
+AGACATTACCGCACGCACGTTTCATGCGCTGGCGCTGCATATTATTCAGCAGGGCAGCAAAAAGTTCCGATAGTCAGCAAACTGGAAAATGATACCGCTG
+CCCGTCATGAACTCTTTATTGCTGAGTGGCGCAAGCAATGCAGCGAAAAGAAAGCGCAGGCGAAGGGCTGGCGGCAATGGCTGACGGAAGAAATGCAGTG
+GTCAGTGCCAGAAGGTAACTTCTGGGATGATGAAAAATTACAGCGTCGCCTTGCCTCTCGCCTCGATCGCTGGGTAAGTCTGATGCGGATGCACGGTGGT
+GCACAGGCAGAAATGATTGCCAGTGCACCCGAAGAGATTCGCGATCTGTTCAGTAAACGTATCAAGTTGATGGCCCCGTTATTAAAAGCCTGGAAAGGTG
+CGCTGAAGGCAGAAAACGCTGTCGATTTTTCGGGCCTTATTCATCAGGCGATTGTGATTCTGGAGAAAGGTCGCTTTATCAGCCCGTGGAAGCATATTCT
+GGTTGATGAATTTCAGGATATCTCGCCGCAGCGGGCAGCGTTGTTAGCGGCATTACGCAAGCAAAACAGTCAGACGACGTTGTTCGCTGTTGGTGATGAC
+TGGCAGGCGATTTACCGATTCAGCGGTGCGCAAATGTCGCTCACCACCGCTTTCCATGAAAACTTTGGTGAAGGCGAACGCTGTGATTTAGACACGACTT
+ACCGTTTTAACAGTCGTATCGGTGAGGTGGCAAACCGGTTTATTCAGCAGAACCCAGGCCAGCTGAAAAAGCCGCTAAACAGCTTAACCAATGGAGACAA
+AAAGCCGTCACGTTATTGGATGAGAGTCAACTTGACGCTTTGCTGGATAAGCTCTCTGGTTATGCCAAACCGGAAGAGCGCATTCTGATCCTGGCGCGTT
+ACCATCACATGAGGCCTGCCAGCCTGGAAAAAGCGGCAACACGCTGGCCGAAGTTGCAAATCGACTTTATGACCATTCATGCCAGCAAAGGGCAACAGGC
+GGATTACGTCATCATCGTTGGCTTGCAGGAGGGAAGTGATGGTTTTCCGGCTGCGGCGCGGAGTCGATTATGGAAGAGGCGCTACTGCCACCGGTTGAGG
+ATTTCCCGGACGCTGAAGAACGGCGGTTAATGTACGTGGCGCTGACCCGGGCACGCCATCGGGTATGGGCACTGTTTAACAAAGAGAATCCCTCTCCTTT
+GTGGAAATACTGAAAAATCTGGATGTGCCGGTGGCGAGAAAACCGTAAGAAACAGGTGGCGTTTGCCACCTGTGCAATATTACTTCAGACGGTCCGCGAG
+ATAACGCTGATAATCGGGGATCAGAATATCGACCGCGTCGTTGAAATGCGGCGACTGGATTATGAAGTCTGCCGTTGCCACGTTGGTGGCGACCGGAATG
+TTCCATACCGTCGCCAGACGCAGCAAGGCTTTCACGTCAGGATCGTGCGGCACGGCATTTAGTGGATCCCAGAAGAAAATCAATACATCAATTTTCCCTT
+CTGAGATCAATGCGCCAACCTGCTGGTCACCCCCATTGGGCCACTCAACATCGCGTTGACGTTCATGCCGGTCGCGCGGGAAATTAAGTTACCGGTAGTG
+CCTGTTGCATACAGTACGTGTTGTTCCAGTAACGGTTGATGCCGTTCCACCCAGCTCATCAGCATTTGTTTGCAGTGATCGTGTGCCACCAGCGCAATAT
+GTTTCCGCGCAGGTAAAGTGCGAGTCGTCAGTTCCATAATGTACATCCGTAGTTAACTTTCCTACAGATTACTGTAAGCACTTATCGCTGCAAGATAAAG
+ACCGAAAAGCCTGCGCACAGGCACAAAAATCTCAGGAAGATGGTTGTTTTTCCGCCCACTGCAGGAAAGTATTTCGCGTTTGTGGGTCAGCCAGTTTAAA
+CCAATACTTCAGCCGTTGTTCTGTGAGCACCTGAGACTGCGGTGGAATAGCATCCAGCTCGGAAACACCCGAAAGCAGCGTACTGTCATCTGCCATCATC
+GTGGCAAATTGCGGTAGTGAAGCGCGTTTCGCGGATTTGTTATAGCGTTCAACCTCGACCTCATAATCAATCGTTTTTGCCGTTGAGGTAATGGCGAGAA
+TATCCAGCTTTACCGGAATCGGCGTCGCATCGCCATCCAACAATTCAAGGCGCGGCGCGGCATCAAAATGGTTAGCTTCCCGCTCATTCTCCAGGCGAGG
+CAGGCGAAAATTGACCTGGTTGATGAGCTGGGTATTAAAACTGACCACCAGCGGTGGGGAGATATACAGCCGTTCTTCACTATTGGAAAGATGAATCGTC
+TTCTCAACGCGAAACACTAACTGATGCGGTCCATTATCCAGTTCAATGCTGTCCGCACCGCGCAGCAGAGAGCTGGAAACCTTCTTGCCGTCGAGTACCA
+GAAGATCGACATCGGTTGAAAGCCGCAGCGTGGTGGCAAAACGGATACCGGCAAACATAATGCAATCAAGGTGGTCACGATGCCGGTTTTCATAGGTAGC
+TCCTGTCAAAAGACCGCCCGAATAATAATGTGTCAAAATTTTTCTTTAATCATACTTACTAACATATAGACATATTTCCCGCTTTTGCTCTCATTCATTC
+GTATTAGCTGCATGGTTGGCATGTCGGCTTTGTCGTACACTTTGTTAAACAGTCTGGAGGAAATAATGAAAGAAACCGATATTGCAGGCATTTTAACGTC
+CACTCACACCATTGCGCTGGTGGGGCAAGCGACAAACCCGATCGTCCCAGCTATCGCGTGATGAAATATCTACTCGACCAGGGTATCACGTCATTCCGGT
+TTCGCCAAAGTTGCCGGCAAAACGCTGCTGGGCCAGAAGGGTATGGCACGCTGGCAGACGTTCCGGAAAAGTCGATATGGTCGATGTTTTCCGTAATTCA
+GAAGCGGCGTGGGGCGTGGCACAGGAAGCTATTGCCATTGGCGCGAAAACTCTCTGGATGCAACTGGGGGTGATTAATGAGCAAGCGGCAGTACTGGCAC
+GGGATGCCGGGTTAAATGTGGTGATGGATCGCTGCCCGGCTATTGAGATCCCTCGCCTGGGCCTGGCCAAATAAAATCCCCGGAAGGCAAAACCTTCCGG
+GGATTTGTTCAGGATTAGTTACGCAGACGCGGGGCCTGGAGTTGTTTGCGGATGGTCTGCGCCAGCTCATCCATGGATGGCTGTTCAGGATGTTCATCCT
+GCAATTCGCTACTTAGCTGGGCTTCAGCCAGGTAGGTATGAACCGGTAGGCCGTTATCGTCCTCCATCACTACGTGATACCACGGAGCGGCGCGAAGCTC
+GTCATTCACCGCCAGCTCATCAGGCGACGGTTCAGAGAGCGAATAAACCGGGTCGATATCCACGACCACTCCGAGATAACCTAACAGGGAATGGCGGACC
+TGCTGGCCGATACCGAATTTGCTGGCAATCATAGTCACCTCCCGGAAATCTTTACCTTTGATATAAGGGTAAAATTCCACATTTCAAGTTACATGACGCG
+ACAGGCAAACCCTTTCAGATATAGCCCTTCCGGATAGGTAGCGATCACCGGATGATCGGCTGCCTGACGGAACTGCTCTATAAATTGTACATCACGACCG
+GCATCAATTGCGGCATCCGCGATGATTTTCTGAAATAAATCGCTGGTCATCAGACCGGAACAGGAGAAAGTCAGGAGAATACCGCCTTCATTCAGCAGCT
+GAATCGCCAGCATGTTGATGTCTTTATAACCACGACACGCGCCCATCAACTGGCTTTTATTCTCAACAAACTTCGGCGGGTCCATCACGATAACGTCAAA
+TTTTTCACCGCGATCGCGATAAGTACGCAGCAATTTAAAGACATCATCACGGACAAACTCAGCCTTGCTCAGATCCAGTTTGTTCAGCTCAACGTTCTGC
+CGTGCAATATCCAGCGCTTCCTGGGAGGTATCAACGCTGACAACCTGGCTGCAACCGCCCATCAGTGCCGATACGGCGAAACCACCGGTATAGGAGAAAC
+AGTTCAGCACACGTTTATTTTCAACGTAGCGGCGGGTAGCCAGGCGGCTATCACGCTGGTCCAGGTAGTAGCCCGTTTTGTGTCCGTGCTGAATATCCAC
+CAGCAGTTTCATTCCGTGTTCTTCAATCGGCAGCAGGGCAGGTGGCAACTCGCCGGTGACGGGGCCCTGGGTCAGCTCCATTCCTTCTTTTTACGTACCG
+CGACGTCGCTGCGATCGTAAATCGAACATTCCGGGTACAGCGTTTGCAGGGCACTAATTAATGCCGCGCGCTGATATTCTGCCCCAGCACTCAGCAGTTG
+CAGCACCAGAAAATTACCGAAACGATCGATAGTAATACCCGGCAGGCCATCAGATTCTCCGGCGATTAAACGATAGCTGTCGAGGCCATCTTTTGCGCCA
+GCCAGTCACGCCATTTTGTGCTTGTTGCAAACGGCGGGAAAAAAGCAATGTCGATAGACTCAGACGGGTCAAACGTCCAGACGCGCGCCCGGATTTGCGA
+AGCTGGCGAATAAGCGCCGCGTGCTAACCATTTTCCTGATGATCAACAATATCGATGGTTTCACCGAGGCTGGCTTTACCTTCCATGCGGGCAACGGCCC
+GGAAAAGACCCACGGATGGCGACGAAGTAATGATTTTTCGCGCCCTTTGGCTAACACTAAACGTACACTCATAATTTACTTTTCTGTCGATGCAAAGAAA
+TGGGCGTCATTGTCCGGAGTTTTCCATGGATTTGCAACGCGTCCATTAAGGATAAGGAGAGCAGCAATGTCGAAAGTCTGCATAATTGCCTGGGTTTACG
+GGCGAGTTCAGGGCGTAGGATTTCGCTACACCACACAGTACGAAGCGAAAAGACTGGGTTTAACCGGGTACGCCAAAATCTTGACGATGGCAGCGTGGAA
+GTGGTTGCTTGCGGTGAAGAAGGGCAGGTGGAAAAATTAATGCAGTGGTTAAAGAGTGGCGGCCCGCGTTCTGCGCGTGTAGAACGGGTGCTCAGCGAGC
+CGCATCATCCCTCGGGGAATTAACCGATTTTCGTATCCGTTAAATACATTTTACCGGTTTTGGCAGGCCAGCAATTTTGGTGGCTTGCTTAGCCGGACCT
+TTCGGAAACAGTCGGTATAAATAGCGGCTGTTACCTTTTCTTCGCCAAATTTATTCGCCATCGCTTTTACCAGCATACGAATCGCCGGAGAAGTATTGAA
+TTCCAGATAGAAATCACGCACAAAACGCACCACTTCCCAGTGTTCCGGTGACAGCGAAATCCCTTCGTTCTCTGCAATCACCACAGCCAGCGGCTCACTC
+CACTGGCTGCTTTCTTTGAGATAGCCTTCGGTATCCGTTTCTATCTCTTTACCTTCGAAGATCAGCATAATTATTACTACCTTAATCAGACTGGCGGCAG
+TGTAACAAAAACAAAGCCCCGCATAAAGCGAGGCTATGAAAGTGTTAGCGGGTGAGATTAATCGCGGCTAGCGAAGCCCAGAATGCTCAGCAGGCTGACG
+AAGATGTTGTACAGCGAAACATACAGGCTAACCGTGGCACGAATATAGTTCGTCTCACCGCCATGAATGATGTTGCTGGTTTCAAACAAGATAGCGCCAG
+AGGAGATCAGAATGAAGACCGCGCTGATCGCCAGATGCAGAGCAGGCAGCTGCAGGAAGATATTCGCAACCATACCAATCAGCACCACCACAATACCCGC
+CATCAGCATACCGCCGAGGAACGACATATCTTTGCGGGTGGTCAGCACATATGCAGAGCAGCAGAAGAACACTAACGCCGTTCCGCCCAGTGCCATAGCG
+ATTACGTCACCCATTCCGGCAGACAGATAGGTGTTCAGAATAGGTCCGAGGATATAACCCAGAAAACCGGTAAAGGCGAATGCGGAGATAATCCCGGTCG
+GCTTATTCGCCGTTTTATAGGTCAGGAACATCAAACCATACATACCCACCAGCGTCAGAATCAGACCCGGAGATGGCAGCATCAGCACCGTACTGGCAGT
+TGCGGTAATCGCCGAAAAGGCCAGCGTCAGGCTCAGCAGAAAATAGGTATTACGCAGCACCTTATGGGTGCTAAGCAGTGATGTACGGTCATGTGAAGAA
+CTAACAATACGATCCATTGAGTCACTCTCTATGACAGATGTAATTAATTAAGCAGCATAATGATAATGCGTAAGGGCACCCAGAAGTTTTACCCATCTTT
+ACGCATTTGATCTGGAACAGGTTTAACAGCGGATTATCAGGTCATTAAGCAAATATAACGCCCTGAGAATTTCGACAGGCAAAGAAAAGGGTTAGCATTT
+AGCTAACCCTTATCTTATTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCGGTGCCTTCAACCGCTCGGCCAC
+ACTTCCGGAATGACGCGCACTATAAACATCCCGATGCGGCGTGTAAACCCTAATTTGTTTGTTTGCCTGAAAAACAGCCAAAAGTGCATTGATAGCGTGA
+AATAACAGCAGATTGATCATTTCATCACCATGAATTCCTTCTCTTTTACTCGTTTAGCAACCGGCTAAACATCCCCACCGCCCGGCCAAAAGAAAAATAG
+GTCCATTTTTATCGCTAAAGATAAATCCACACAGTTTGTATTGTTTTGTGCAAAAGTTTCACTACGCTTTATTAACAATACTTTCTGGCGACGTGCGCCA
+GTGCAGAAGGATGAGCTTTCGTTTTCAGCATCTCACGTGAAGCGATGGTTTGCCTTGCTACAGGGACGTCGCTTGCCGACCATAAGCGCCCGGTGTCCTG
+CCGGTGTCGCAAGGAGGAGAGACGTGCGATATGAATAACGAGGAAACATTTTACCAGGCCATGCGGCGTCAGGGCGTTACCCGGCGCAGCTTTCTCAAAT
+ATTGTAGTCTGGCTGCCACGTCGCTGGGATTAGGCGCGGGAATGGCACCAAAGATTGCCTGGGCGCTGGAGAACAAACCGCGCATTCCGGTGGTATGGAT
+CCACGGTCTGGAATGCACCTGCTGTACCGAATCTTTTATCCGCTCCGCTCACCCACTGGCGAAGGACGTCATCCTTTCCTGATTTCCCTCGATTACGACG
+ATACTTTGATGGCTGCCGCCGGAACCCAGGCGGAAGAAGTCTTTGAAGACATCATCACGCAATACAATGGCAAATATATCCTCGCAGTAGAAGGTAATCC
+GCCGCTGGGCGAGCAGGGGATGTTCTGTATCAGCAGCGGTCGACCGTTTATTGAGAAACTCAAACGTGCCGCTGCCGGAGCCAGCGCGATTATCGCCTGG
+GGAACCTGCGCGTCCTGGGGCTGCGTGCAGGCCGCGCGACCCAATCCGACGCAGGCAACGCCTATCGACAAAGTCATCACCGACAAACCCATTATCAAAG
+TACCTGGCTGCCCGCCGATCCCGGATGTGATGAGCGCCATCATTACTTACATGGTGACCTTTGATCGCTTGCCAGATGTCGACAGAATGGGCCGTCCGCT
+GATGTTCTATGGTCAGCGAATCCACGATAAATGCTATCGCCGCGCCCACTTCGACGCCGGAGAGTTCGTCCAGAGTTGGGATGATGACGCTGCCCGCAAA
+GGTTACTGCCTGTACAAAATGGGCTGCAAAGGGCCTACCACCTATAACGCCTGTTCCTCCACACGCTGGAATGATGGCGTTTCTTTCCCAATCCAGTCTG
+GTCACGGCTGCCTGGGCTGTGCGGAAAATGGTTTCTGGGATCGCGGTTCGTTCTACAGCCGCGTGGTCGATATTCCGCAAATGGGTACTCATTCCACCGC
+CGATACCGTCGGTTTAACCGCGCTTGGCGTGGTGGCAGCGGCTGTTGGTGTGCACGCAGTCGCCAGCGCCGTTGACCAGCGCAGACGTCATAACCAGCAA
+CCTACAGAAACCGAACATCAGCCAGGCAATGAGGATAAACAGGCATGAGCACTCAGTACGAAACTCAGGGATACACCATCAATAATGCCGGACGCCGCCT
+GGTGGTCGACCCGATTACGCGCATCGAAGGCCACATGCGCTGCGAAGTGAATATTAACGATCAGAATGTGATCACCAATGCCGTCTCCTGCGGCACCATG
+TTTCGCGGGCTGGAGATCATCCTACAAGGGCGCGACCCGCGCGATGCGTGGGCGTTCGTTGAACGTATCTGCGGCGTCTGTACTGGCGTACACGCCCTGG
+CTTCGGTTTACGCCATCGAAGATGCTATCGGTATTAAAGTGCCGGACAACGCCAATATCATCCGCAACATTATGCTGGCAACGCTCTGGTGCCACGATCA
+TCTGGTGCACTTCTATCAGCTTGCCGGGATGGACTGGATCGATGTGTTAGATGCGCTGAAAGCCGACCCGCGGAAAACCTCCGAACTGGCGCAAAGTCTC
+TCCTCTTGGCCGAAATCATCCCCTGGCTATTTCTTCGACGTACAAAACCGCCTGAAAAATTTGTTGAAGGCGGGCAGTTGGGGATCTTCCGCAATGGCTA
+CTGGGGCACCCGCAGTACAAACTGCCGCCAGAAGCTAACCTGATGGGCTTTGCCCACTATCTCGAAGCTCTCGATTTCCAGCGTGAAATTGTCAAAATCC
+ACGCGGTCTTTGGCGGTAAAACCCGCATCCAAACTGGATTGTCGGCGGGATGCCTTGCGCCATCAACATTGACGAAAGCGGCGCGGTCGGGGCAGTCAAT
+ATGGAACGCCTGAACCTGGTGCAGTCAATTATCACCGCACGGCGGACTTCATTAACAACGTGATGATCCCCGACGCCTTAGCCATCGGTCAGTTCAACAA
+ACCGTGGAGCGAAATCGGCACTGGTCTTTCTGATAAATGCGTTCTCAGCTACGGCGCATTCCCGGATATTGCCAACGACTTTGGCGAGAAAAGTCGCTGA
+TGCCTGGCGGCGCGGTGATTAACGGCGACTTCAACAATGTGCTGCCAGTGGATTTGGTTGATCCGCAGCAGGTGCAGGAGTTTGTCGACCACGCCTGGTA
+TCGATATCCCAACGATCAGGTCGGGCGTCATCCGTTCGATGGCATCACCGACCCGTGGTACAACCCCGGCGATGTCAAAGGCAGCGATACCAACATTCAG
+CAGCTGAATGAACAGGAACGCTACTCGTGGATCAAAGCGCCACGCTGGCGCGGTAACGCGATGGAAGTGGGCCGCTGGCGCGCACGTTAATCGCTTATCA
+CAAAGGCGATGCTGCGACCGTTGAGTCGGTCGATCGCATGATGTCGGCGTTGAACCTGCCGCTTTCCGGTATCCAGTCAACGTTAGGCCGCATTTTGTGC
+CGCGCGCACGAAGCGCAGTGGGCCGCAGGTAAGTTGCAGTATTTCTTCGACAAGCTGATGACCAACCTGAAAACGGCAATCTCGCCACTGCTTCCACGGA
+AAAATGGGAACCTGCAACCTGGCCGACAGAGTGCCGTGGTGTCGGTTTTACCGAAGCGCCGCGCGGGGCGTTAGGCCACTGGGCCGCCATTCGCGATGGC
+AAGATTGATCTCTACCAGTGCGTGGTGCCGACCACCTGGAACGCCAGCCCGCGCGATCCCAAAGGGCAGATTGGCGCTTATGAAGCGGCGCTGATGAACA
+CCAAAATGGCGATCCCCGAGCAACCGCTGGAGATCCTGCGTACTCTGCACAGCTTTGACCCGTGCCTCGCCTGTTCAACACACGTGCTGGGCGACGACGG
+TAGCGAGCTGATCTCCGTGCAGGTGCGTTAACAGCGAAGGAGAATCATCATGCAACAGAAAAGCGACAACGTTGTCAGCCACTATGTCTTTGAAGCGCCA
+GTGCGCATCTGGCACTGGTTGACGGTGTTATGCATGGCGGTGTTGATGGTCACCGGATACTTTATCGGCAAGCCGCTACCTTCCGTCAGCGGCGAGGCGA
+CGTATCTGTTCTATATGGGCTACATCAGGTTAATTCACTTCAGCGCCGGGATGGTTTTACCGTGGTTTTGCTGATGCGGATCTACTGGGCTTTTGTTGGC
+AATCGATACTCCCGCGAGCTGTTTATCGTGCCGGTATGGCGTAAAGCTGGTGGCAGGGCGTGTGGTATGAAATCCGCTGGTATCTGTTTCTGGCAAAACG
+TCCGAGTGCCGATATAGGCCATAATCCCATCGCCCAGGCGGCGATGTTCGGCTATTTCCTGATGTCGGTCTTTATGATCATCACTGGTTTTGCGCTGTAC
+AGCGAACACAGCCAGTACGCTATTTTGCGCCGTTCCGTTATGTGGTGGAATTTTTCTACTGGACGGGTGGCAACTCAATGGACATTCACAGCTGGCATCG
+GCTGGGGATGTGGCTGATTGGCGCGTTTGTGATCGGTCATGTCTACATGGCGCTGCGTGAAGACATCATGTCCGACGACACGGTGATCTCCACCATGGTC
+AACGGCTACCGTAGCCACAAATTTGGCAAAATAAGTAACAAGGAGCGTTCATGAGCGAGCAACGCGTGGTGGTCATGGGGCTGGGCAACCTGCTGTGGGC
+CGATGAAGGCTTCGGCGTGCGGGTGGCGGAACGGCTGTATGCCCATTACCACTGGCCCGAGTATGTGGAGATTGTCGATGGCGGTACTCAGGACTGAACT
+TGCTGGGGTATGTCGAAAGCGCCAGCCATCTGTTGATTCTCGATGCCATTGACTACGGGCTGGAACCTGGAACGCTGCGAACCTATGCCGGAGAACGCAT
+TCCGGCTTATCTCAGCGCGAAGAAAATGAGCCTGCATCAGAACAGTTTCTCCGAAGTGTTGGCGCTGGCGGATATCCGCGGACATCTGCCAGCACATATT
+GCCCTCGTCGGTCTGCAACCCGCAATGCTCGACGACTACGGCGGTAGCCTGAGCGAACTGGCACGGGAGCAACTGCCCGCTGCGGAACAGGCGGCGCTGG
+CGCAGCTTGCTGCGTGGGGAATTGTGCCGCAACCGGCTAATGAATCGCGCTGTCTCAATTATGACTGTCTGTCGATGGAAAATTACGAAGGCGTTCGCTT
+GCGCCAGTACCGGATGACACAGGAGGAGCAGGGATGAGCAACGACACGCCATTTGATGCGTTGTGGCAACGAATGCTGGCGCGCGGCTGGACGCCAGTCA
+GTGAATCCCGTCTTGACGACTGGCTTACGCAAGCGCCAGACGGCGTGGTGTTATTAAGCAGTGACCCGAAACGCACGCCAGAGGTCAGCGATAATCCGGT
+AATGATTGGCGAATTACTGCGCGAGTTTCCCGACTATACATGGCAGGTGGCGATTGCTGACCTTGAGCAGAGCGAAGCCATCGGCGATCGCTTTGGCGTC
+TTTCGCTTTCCTGCCACTTTAGTGTTTACCGGCGGAAACTATCGCGGCGTGCTGAATGGTATTCACCCGTGGGCGGAACTGATAAACCTGATGCGCGGGC
+TTGTCGAACCGCAGCAGGAGCGTGCCTCATGAGCGAAACTTTTTCCATCTGCTGGGGCCAGGAACGCAACCGAACGATGACAGTTTCAGCATGAATCCAC
+TGCCGATCACCTGTCAGGTGAATGATGAACCGAGTATGGCGGCCCTGGAGCAATGTGCTCACAGCCCGCAGGTGATTGCGCTGTTAAACGAGTTACAACA
+TCAACTAAGCGAACGCCAACCGCCGTTGGGCGAGGTGCTGGCAGTCGATCTGTTAAATCTCAACGCCGACGATCGTCACTTTATCAATACGCTTCTCGGG
+GAAGGGAAGTGTCAGTGCGCATTCAGCAGGCTGACGACAGTGAAAGTGAAATACAGGAGGCGATCTTCTGCGGATTATGGCGGGTGCGCAGACGTCGCGG
+CGAAAAGTTGCTGGAGGACAAACTGGAGGCTGGCTGCGCGCCGCTGGCGTTGTGGCAGGCGGCAACGCAAAATCTCTTGCCGACAGATTCGCTGTTACCG
+CCGCCCATTGATGGCCTGATGAATGGCCTACCGTTGGCGCATGAGTTACTGGCACATGTACGTAACCCCGACGCGCAGCCGCACAGCATTAATCTGACGC
+AATTACCCATCAGCGAGGCTGATCGGCTTTTCTCTCACGTCTCTGTGGGCCGGGAAATATTCAGATTCGTACCATTGGCTATGGCGAGAGCTATATCAAC
+GCCACGGGGTTACGCCATGTCTGGCATTTACGCTGTACGGACACCTTAAAAGGCCCGTTACTGGAAAGTTATGAAATCTGCCCAATACCGGAAGTGGTGC
+TGGCAGCGCCAGAAGATTTGGTCGACTCTGCGCAGCGGCTTAGCGAGGTATGTCAGTGGCTGGCGGAAGCTGCACCGACGTAAAAAGACGGTAAGTATCG
+CTTTCAGTCTTATGAATATCGCAATCGGCGAATACCTCTGGTCGTAGAGTTTCAGGATAAAGAGGAGATCTACCATTATCGGGTTATTTTTCTCTTCGCC
+TACAGGAGTGCGCATGTGGGATGTCATTGATTTATCGCGCTGGCAGTTTGCTCTGACCGCGCTGTATCACTTTTATTTGTACCCTTACCCTGGGGCTGAT
+TTTTGCTGGCTATTATGGAAACCATTTACGTGGTCACCGGCAAAACAATCTACCGCGATATGACGCGCTTCTGGGGTAAGCTCTTCGGTATCAATTTTGC
+TCTTGGCGTGGCTACCGGCCTGACCATGGAGTTTCAGTTTGGTACTAACTGGTCATTCTATTCCAACTATGTGGGCGATATTTTTGGCGCACCGCTGGCG
+ATGGAAGCATTAATGGCCTTCTTCCTCGAATCCACCTTTGTCGGGCTGTTCTTCTTCGGCTGGCAACGGCTGAATAAATACCAGCACCTGCTGGTGACGT
+GGCTGGTGGCGTTCGGTTCAAATCTCTGCGTTGTGGATATTGAATGCCAACGGTTGGATGCAATACCCGACCGGTGCGCATTTTGATATCGACACCCTGC
+GTATGGAGATGACCAGCTTCAGCGAGCTGGTCTTTAATCCGGTCAGCCAGGTGAAATTTGTGCACACCGTAATGGCGGGCTACGTGACCGGGGCCATGTT
+TATTATGGCGATCAGCGCCTGGTATTTACTGCGCGGACGGGAGCGCAATGTCGCATTACGCTCGTTTGCCATCGGTTCCGTCTTCGGTACTCTGGCGATT
+ATCGGTACCCTGCAACTCGGAGACAGTTCTGCGTATGAAGTCGCGCAAGTACAACCGGTAAAACTGGCGGCGATGGAAGGAGTGGCAAACGGAACCTGCA
+CCTGCACCGTTCCATGTGGTTGCCTGGCCGGAACAGGATCAAGAGCGTAACGCCTTTGCCCTCAAAATTCCCGCGCTGCTAGGGATCCTCGCCACTCACT
+CATTAGATAAACCCGTGCCGGGTCTGAAGAATTTGATGGCTGAAACCTACCCACGCTTGCAACGCGGACGTATGGCCTGGCTGTTAATGCAGGAAATATC
+GCAAGGCAATCGTGAGCCGCATGTGTTGCAGGCATTCCGGGGACTGGAAGGTGACCTGGGCTACGGCATGTTGCTCTCCGCTATGCGCCGGATATGAATC
+ATGTCACAGCCGCACAGTACCAGGCGGCGATGCGTGGCGCGATACCTCAGGTTGCGCCGGTATTCTGGAGTTTCCGCATCATGGTGGGCTGTGGTTCCCT
+GCTGCTACTGGTGATGCTGATTGCGCTTGTCCAGACGCTGCGTGGCAAAATCGACCAGCATCGCTGGGTGCTGAAAATGGCGCTCTGGAGTTTGCCGTTG
+CCGTGGATTGCGATTGAAGCCGGGTGGTTTATGACCGAGTTTGGTCGTCAGCCGTGGGCGATACAGGACATCTTACCGACATACTCCGCGCACTCCGCTT
+TAACCACAGGACAACTGGCTTTCTCACTGATCATGATCGTAGGGCTTTACACCCTGTTCTTAATCGCCGAAGTCTACCTGATGCAGAAATATGCCCGTCT
+GGGGCCGAGCGCGATGCAGAGTGAACAACCGACGCAGCAACAGGGGTAAAGGAGAAAATCATGTTTGATTATGAAACATTGCGCTTCATCTGGTGGCTGC
+TGATTGGCGTGATCCTGGTGGTCTTTATGATCTCCGACGGATTTGACATGGGGATCGGCTGTCTGCTGCCGCTGGTGGCGCGTAATGATGATGAACGCCG
+GATAGTGATAAACAGCGTTGGTGCACACTGGGAAGGCAACCAGGTCTGGTTGATCCTCGCTGGTGGGGCATTATTTGCCGCCTGGCCCAGAGTGTATGCA
+GCGGCGTTTTCCGGCTTTTGTGGCGATGATCCTGGTGCTGTGCTCACTGTTCTTCCGCCCGCTGGCCTTTGATTATCGCGGAAAAATCGCCGATGCACGC
+TGGCGTAAAATGTGGGACGCCGGTCTGGTCATCGGCAGTCTGGTGCCGCCGGTAGTCTTCGGTATCGCCTTCGGCAACTTGTTGCTCGGCGTGCCGTTTG
+CCTTCACACCGCAATTACGCGTGGAGTATCTCGGCAGCTTCTGGCAACTGCTGACGCCATTCCCTTTATTGTGCGGATTGCTCAGCCTTGGGATGGTGAT
+TTTGCAAGGTGGCGTCTGGTTACAACTGAAAACTGTTGGTGTGATTCATCTGCGTTCACAGCTGGCGACCAAACGCGCTGCACTGTTGGTGATGCTGTGC
+TTTTGCTGGCGGGTTACTGGCTGTGGGTCGGTATTGATGGCTTTGTACTGCTCGCCCAGGATGCTAACGGTCCTTCCAATCCGTTAATGAAACTGGTGGC
+AGTGCTACCTGGTGCCTGGATGAATAATTTTGTCGAGTCGCCCGTTTTGTGGATCTTCCCGCTGCTGGGATTCTTCTGCCCATTGCTGACGGTGATGGCG
+ATTTATCGTGGTCGCCCGGGTTGGGGATTTTTGATGGCATCATTGATGCAATTTGGCGTGATTTTCACGGCAGGCATCACGCTGTTCCCCTTTGTCATGC
+CGTCAAGCGTGAGTCCGATCTCCAGCCTGACGTTGTGGGACAGTACTTCCAGTCAGCTGACGCTGAGCATTATGTTGGTAATCGTGCTGATATTTTTGCC
+CATTGTGTTGCTCTACACTCTCTGGAGCTACTACAAAATGTGGGGCGCATGACAACAGAAACTCTCCGCCGTAACGAAAACGAGTTGTACTAAGGAGCAG
+AAACAATGTGGTATTTACTTTGGTTCGTCGGCATTTTGTTGATGTGTTCGCTCTCCACCCTTGTGTTGGTATGGCTGGACCCGCGTCTGAAAAGTTAACG
+AACGTAGGCCTGATGCGGCGCATTAGCATCGCATCAGGCAATCAATAATGTCAGATATGAAAAGCGGAAACATATCGATGAAAGCGATCTTAATCCCATT
+TTATCTCTTCTGATTCCGTTAACCCCGCAATCTGCATTCGCTCAGAGTGAGCCGGAGCTGAAGCTGGAAAGTGTGGTGATTGTCAGTCGTCATGGTGTGC
+GTGCTCCAACCAAGGCCACGCAACTGATGCAGGATGTCACCCCAGACGCATGGCCAACCTGGCCGGTAAAACTGGGTTGGCTGACACCGCGCGGTGGTGA
+GCTAATCGCCTATCTCGGACATTACCAACGCCAGCGTCTGGTAGCCGACGGATTGCTGGCGAAAAGGGCTGCCCGCAGTCTGGTCAGGTCGCGATTATTG
+CTGATGTCGACGAGCGTACCCGTAAAACAGGCGAAGCCTTCGCCGCCGGGCTGGCACCTGACTGTGCAATAACCGTACATACCCAGGCAGATACGTCCAG
+TCCCGATCCGTTATTTAATCCTCTAAAACTGGCGTTTGCCAACTGGATAACGCGAACGTGACTGACGCGATCCTCAGCAGGGCAGGAGGGTCAATTGCTG
+ACTTTACCGGGCATCGGCAAACGGCGTTTCGCGAACTGGAACGGGTGCTTAATTTTCCGCAATCAAACTTGTGCCTTAAACGTGAGAAACAGGACGAAAG
+CTGTTCATTAACGCAGGCATTACCATCGGAACTCAAGGTGAGCGCCGACAATGTCTCATTAACCGGTGCGGTAAGCCTCGCATCAATGCTGACGGAGATA
+TTTCTCCTGCAACAAGCACAGGGAATGCCGGAGCCGGGGTGGGGAAGGATCACCGATTCACACCAGTGGAACACCTTGCTAAGTTTGCATAACGCGCAAT
+TTTATTTGCTACAACGCACGCCAGAGGTTGCCCGCAGCCGCGCCACCCCGTTATTAGATTTGATCAAGACAGCGTTGACGCCCCATCCACCGCAAAACAG
+GCGTATGGTGTGACATTACCCACTTCAGTGCTGTTTATCGCCGGACACGATACTAATCTGGCAAATCTCGGCGGCGCACTGGAGCTCAACTGGACGCTTC
+CCGGTCAGCCGGATAACACGCCGCCAGGTGGTGAACTGGTGTTTGAACGCTGGCGTCGGCTAAGCGATAACAGCCAGTGGATTCAGGTTTCGCTGGTCTT
+CCAGACTTTACAGCAGATGCGTGATAAAACGCCGCTGTCATTAAATACGCCGCCCGGAGAGGTGAAACTGACCCTGGCAGGATGTGAAGAGCGAAATGCG
+CAGGGCATGTGTTCGTTGGCAGGTTTTACGCAAATCGTGAATGAAGCACGCATACCGGCGTGCAGTTTGTAATGATAAAAAGAGCATTCAGTTACCTGAA
+TGCTCTGAGGCTGATGACAAACGAAGAACTGTCTAATGCGTAGACCGGAAAAGGCGTTCACGCCGCATCCGGCCACTTTCAGTTTTACTCTTTCTCGGAG
+TAACTATAACCGTAATAGTTATAGCCGTAACTGTAAGCGGTGCTGGCGCGTTTAATCACACCATTGAGGATAGCGCCTTTAATATTGACGCCTGCCTGTT
+CCAGACGCTGCATTGACAAACTCACCTCTTTGGCGGTGTTCAAGCCAAAACGCGCAACCAGCAGGCTGGTGCCAACAGAACGCCCCACGACCGCGGCATC
+ACTCACCGCCAGCATCGGCGGCGTATCGACAATCACCAGATCGTAATGGTCGTTCGCCCATTCCAGTAATTGACGCATCCGATCGCGCATCAGCAGTTCA
+GACGGGTTAGGTGGCACCTGACCGCGAGTAATCACATCAAAGCCTCCTTTGCCAAAATGCTGGATCACTTTGTTGAGCTCATCTTTACCTGCCAGATATT
+CCGACAAGCCATGTTCATTACTCACGGTAAACAGGTTATGCGAATAACCACGGCGTAAGTCGGCATCAATAAATAACACTTTTGATCGGACTGGGCGATC
+ACCGCTGCCAGAGTTGAACTGACAAACGTTTTACCACTGTCTGGCGTCGCACCGGTGATCATTAGAATGTTATTCTCCGTCTCCATCATAGCGAAATGCA
+GACTGGTTCGTAGCGCACGTACGGCTTCCACAGCAGAATCCGCCGGGTTATCCACCGCCAGGAAGGGATATTTTAGTACGATGGCGCTGCTGATTAGAAA
+ATAAATTTTTCTTACGCAGACGGGTGCGTTTATCCAGCCACTCGGACATTGGGATAGTGGCATAAACGCTGATGCCGTGCTCTTCCAGTTGTTCCGGGCT
+TCTACACCACGACGCAACATCGCACGCGCCAGCACGGCACCCACAGAAATAAACAGGCCAAGAATAAAACCAAGCACCACGTTCAACGCTTTTTCGGTTT
+CACTGGCTGCGGCTGAGTGACTGCCGGGTCGATAATCCGCACGTTACCAATGGCACTGGATTTCGAAATACTCAACTCCTGCTGGCGGTTAAGTAATTGC
+AGATATACCGCACGGCCCGCTTCTACGTCACGACTTAAACGCAACACTTCCTGTTGGGTGGAAGGCATTGCCGATACCCGCTTATTCAGGCGTTTGCGTT
+CTTGCTCCAGCGTCTGGCGTTTTTCCAGCAGCGCACGATAAGTTGGGTGATCTTTCTTATACAGCTGGGAGATCTCTGCCTCGCGGAAGGTCAGCTCATT
+GAGTTGATTATCAACGTTCACAATCTGCTCAAGAACGGCTTTGGCTTCCAGGTTAAGGTCAACCGAATCGCGCTGCTGGCGATAAACGTTGAGTTTTTCT
+TCCGCTTGGTCCAGCTCGCTGCGCACTTCAGGTAACTGGCGCTGTAAGAATTCAAGGCTTTGTGAATCCTGCGCCGCCTGGCGAGCGATATTCTGTTGCA
+AATAGTTGTTAGCGATGCTGTTCAGAATACGAGTAATCAACTGGGGATCATCACCAGTCATGGTAAGTTCCAGCATCCCGCTTTCTTTACTGCGTTCGCT
+AACGGTAAAGGTTTCCTGCAATGCGTTAATCGCTTCCAGTTCGGTACGCTGGCTCAGGACAAACTGTGTTCCTGGTTTGGCCTTAATGTCCGCGATAGTC
+AGCGCAACGCCATCTTTTTCCAGACGCTGGCCGACCATACCATTGACGGTGAACTCTTCACCTTCCAGTGTATAGTGGCCGTTTTCCCAACCGTGAGTGT
+CAGTTGCTGATCCTGACCATTCAGTTGTGGAATATGCATCCAGCTGATCGCCAGCTCACCTGGTTTTCTTTGGTTAATCTCGCCCAGCCGCGACCCACAA
+TCGGAAAATACTTCTGCTCAACTATGTCGCGCAGATTCAGTTCAGCAATGGTTTTACCGAGAATCATGCGCGATTGCAGCAGTTGGATCTCCGGTGCAGA
+CTCGGGCGATGAGTTAGGGATCATATCGCTCAGGCCGCTGAGAATGGCGTTGCCCTGTTTTTGCTCAACCTGGACCAGAGTATCTGCCTGATAAATTGGT
+GTGCTTAACAGCGAGTAAGCGACAGCGATCAGCGTGAATAACGCGGTCACGCTGATAATAAACTTACGGTGATCCCATAACTCGCCGACCAGACGAAGCA
+GATCGATCTCATTTTCCTGAGTGCTGCCTGGTGGCGTATTCATATTTTTAGTTGTCATCGTATTTTATAAACTCAAATTACCGGCTGAGGCGCTTCGCCC
+ATTCCTGACTGGCGCGCTCCAACATACCGTAGACATGTTCAAATGCGTCCTGACTTTTACGATAGGGATCCGGGATCTCTTTCTGTTCCAGCCATTGCCC
+AAACAGCATTGTCTTCCCGCGGACCTCGGGAGCAATTGCGGTAACCTGAGCAATATGTTCCGACTCCATTGCCAGAATCAGATCGTAATTTCGTGCCATC
+TCAGCAGTGAGCTTACGTCCGGCATGTCCTTCAAGAGATACGCCATGATTAGCGGCAACATCTGCCGCTGTCGCATCTGCAGGGTGTTTTACCAGACCAT
+GAACACCTGCCGATTTGACTTTACGCCCGGCAGACGTTTACGCAGCAAGCGCTCGCCAATGGGCGAACGGCAAATGTTGCCGGTACAAACCACCAGGATT
+GAGTTAAATTTTAGTTGGGCCATGTTTGAATCCACCGTGAAGTCTCTGTCAGGTCATGCACCCGGAAATCGTCGGTACCAGCAGAGAAATCACACGGTTC
+CAACGAGCCAGCGGCGCGGTAGTGACATAAACAATGTCGTAAGGTTCAAGCTGGAATTCCGTTCCGAGTATCATTGCCGATGCGTCCTTCGCATTCAGCT
+GATAAATATTGGCGATTTTGCCATTCTGCTTGTTTTGCGTTGCACGAATAACAAAATCCCCGTCGCATCAGCGACATCCTGATTCATACCCTCAGCGTTA
+CCCAGCGCTTCCGCCAGGGTCATACCGCTGCGGTCCATTTTCAGCGTGCTCTGTTTACCCACTTCACCCATCACGAAGACTTTCAGATCATCGTTGCGCG
+GAATAAATAAAATATCGCCCGGGTGCAGCAGTTTGTTCTGGCGCAAGTCGCCACGCTGCATCAGCGCATAGAGGTTCACTTTGGTCTTTACGCCATTCTG
+GGTGAGCACCACGTTGCGCCAGTCTGCATCTGCGGTCAGACCGCCCGCGGCGTTAATCGCATCCATGATGGTCAGAGGAATATTGGTAATCGGCTGCTGA
+CCCGATTTGCTGACTTCGCCGGTGACGTACGCTTTTTGCGATCGGAACGCCGCGACGCTGACATCGACTTGCGGGCTTTCAATGACTGAATCGAGACGCG
+CTGTAATCTCGTTGCGTACCTGGGTAAGTGTTTTCCGGCCACTTTCAGGCGACCAATATAGGGTAGAAAATCGCACCATCGGCGTTAACCCAGTTGCCGG
+TATCACTGGCGCTACGGTATTGCCCTGCGGGGTGGTTAGTTCCGGTGATCCCAGACCGTAACCATCAACACATCACCAATCCCGATACGATATTCATAGT
+TTGCGATTTGCTGCTCCAGCTCCGGGTTAGCCTGCGACATAATCGGTTTGGCGCGCAACTGATCAATCAATCCTGGCGTGACGGGATAGATATTGACCAT
+TTTGTCCAGGTCATACTGATTGTCAGGTAGTTCAATGACATCCTTGTTACTGGTCGATAAATTCTGACCAGGAACAAGGGTACATGCTGTCAAAGACAGA
+ACAGCCAATGTCAGTACCGAAAACTTAAAATGTTCTTTTCATTGGTTTATATTTATCAGTCAATGTAATGTTATGAATTACGTCAGGTTATTGTCCAACC
+GGTACTTCTCGCTCTGCCGTCATTGGATAGAGCTGGTATTTGCGTGACAGCATTTGTCCACCATCACGCGTCAATGGTGTCCACGAAACCACCGCGCGGT
+TGCGGTTAGGTCCAATGGTCATCAAGTCGAATGGAATCGAGATATAAAACCTTTACTAAAGCCGCCTTCGCCGTAGTCATCTTTAGATACGTTACTGATT
+GCCGCCCATACCCCTACCGCCACGCCGCTGTCAAAGCGTTTGGCGACGTCGATCGTTGCGCCTTTATCTTTTGCCAGATATTGCCCAACGCTAAGTTTCA
+TCAGTACGCCATTGAGCGTCGGCGGGTTCCAGTAAGCCGTCACGAAACCTGTTGGCGTGGAATAATCGGTGAAACGCATCATGTTGTCCCAGTCACGTTG
+CTTCACGTAGTTAACGTCCACACCCAGCGCCCAGCAGGCATCTAGCGGGCGATAAAGCAGCTCGGAACCGACACCGGCGTACATCGTTTCCAGATAACCG
+CCATACACCTGGCCATAGAAACCATTGCCTAAGTCAGCAAAATAGTTCGCCTGCAAGTTGTTGAGATAAACGTCATTGCGAACGTAGTCACGGATATGCG
+TGCGCACGCGGGGCAGGGTAGAGTCCGCGGGCAACAGCGAAGACTTAAACTTGTCGTAGTTGTTGTAAATATTGGTGAAAATACCGCCATCAAGCAGCAG
+GTGGTCGGTAAACCAGTAGCGGGCACTGGACATCAGCCCCAGCTGGAACATATAGAAATCTTCCGGGCCGCCCAGCGACTGTGAAAGTGTTGGGTTGAAA
+GAGTAGCTAAAGCGATCTTCACGAATACGGTAGCCCCGACCAAAGGCAGAAAGATCTTCAGCTTCAACACGTTGTTGTTGCAGTGGCTCTGATTGACCAG
+GCGCTGTACCTGCCAGCTGTTTGCGCAGGCTGGCTACGTCGGTTTCGGTAGTCACCATCGCCATATGCTCGCGCTTTTGCGTCACGCTAATCTTCTCAAC
+GCCTTGCGGCAGGTTATTCACCAGAATCCGGTTGGCACGATCGACCGCTTCACGAGAGTCACGGTATTTGTATTGCTGACCAGACATATACAGTGTCTTA
+TCGCGTAGCTGAATTTCTGGCGCGTCAAAGCCCGCGTTATACTTCAGGGCGGTAAGTTGGTTTGCTACCGTGGTGTACTGCAATCCTTCAGATTCAGGCG
+CAGGTTGATATGCCGGTTTTGGCGTATCGCGCAGGGCAGGGCGCAGATCGTTGAAATTGGTCCGTAACGTGAAGCCAAACATCAACGTGTTACCGCGTTC
+ATAACTCAGGTTGAGATCTGCCCAGCTGGCAGCGCGATAAACTGCGCCGACGTTGAAATGGCTTGCCTGAGGCAGTTTGCCAGCGAAATCATTCTGGTAA
+TTGTTTCCATCGTATTCGAGTTTCAGACGCAGGGGATTCCACGGCGTTTGATACTCAATGCCGCCAAAGATGGAAGCCGGGCCACGAAAGATATCGCTAA
+AGCTGATATCGCCCGCATCGTGAGACTCTGCGCGATGACAATATTTATCGCTCACCCGGCAAAACGGGTTGGTAATATTGCCCGCATTACCGGCGTAGCC
+CCATGCCATCGAGGGTGAAATCAAATGGCCCCGCTTGCTTGCTGGCCACCAGATACTCACCGTCAAACAGACCCGTACCAGCAATATCACGTTTACCAAA
+CGCCACTTGCGGTAGCCAGTAACCTTCTTCCCACAGGCGAAGTTTAAAATCGAATGATTTGTCTTTGTATGACTGATCGCCGCTGAAATCTTCCCACTGG
+CTATATTTGCGTGTGCGCACATCCGTATAACGAATGGTGCCTTCCAGCCATGGGAACAGCGCCACGGAGGTGGAGTAGAACCGGTATTGATCGTTATCCC
+GGTAGTTGACGCTGAATTCACCTTCCGGTGCGATGCGCGCATTTGGCATCTGCAACAATCCTGTGCCGCCAAAGTCTGATTGCGACGAACCCAGCGGATC
+CGGGTAGGTTAATACTTCAGCATGACAGGCACTGGAGACGGCAATGGCCAGGCAGCTTAAAGATAAGAATTCTTCTTCATCAGTCAGGAACACGTTGCGT
+TAAAACAGACACAATCTGGTCATTTAAATCAGCATATTTTTCGGGCAGTACATGCGCAGAAAAGCCCAACCAAAGCTGGCTGCCAGGCGGTGGTTCCACA
+TGTCTTTTATTCCACAGGGCAACAGGGGCGACGACAGTCTCACCCTCAGGCGTAATCACCATAACGTTATTCTTGTCCGCGCCTGCAAGGCGGGGTGATC
+TTGCAGATAATCGGTAACGCTACGGCCTGCCTGCCAGGGCAATTGCCCGGCCCCAGAAACCGCACCCAGCAGAGTAATAGTCACCGGACGCTGTACGGTA
+TAGAGCGTATAGTCCCCGACCAACGGGGATTGCTGTTCTCATCCACTCGTACAAAATCAGGGTCCAGTTTGACCGGTAAGCGACCAGTGATATTGAGATT
+GAGTAACTGCTGGCGCACGGATTTAATCGTTGCCGCCACATCGTCGTCAGCTTCTGCTTCCCAGGAAGCAAGCTGTGCCATGACATGTTGGTAGTCTTTA
+AGCGCTTTAGCTTTCGCCGCAGAGTCGGTCAGCAAGGCACCAGGCCACCAGAGGCGATCGCGCAGTTGCGGTTGTGTCACCAACTGGACAACATTTTCCA
+CGGGGCCAACGGAAAGTGTCTGTTGTTCGCCAGGCAGATAAATAGTCACCGTTCCTTGCGCAAAGGCATGGGGTGTCATTACGTAAAGTACGCTGGCAAT
+GAAATACGACTGTAATTTATTCATGGTGCGGGTTTAAGAAACGTCATTTCTACGGGAATAACCCTGCGCCTAACATTTGCCGACTTTGACGAACCTGGCC
+AGTAGCCGAATCGACCCAGAATGTGTTTTGCCACTGTTTTTCTGGCCGCGTGGAAGTCACCTCTTCCTGCCAGACATTACACAGCACATTGCGACCCGCA
+ATATTCAGCGTCTCTAATCCAGCAAAGGAAAAGTAGAACTCAGGGTCGCAGAGCGAAAATGGTTGTCTTCACTCCAGAGAATATCGCGCGTCCAGCGGCT
+GCCATCTTTATTGCCAGCGCGTTACGCAGAGGGTCCTGCCCGGAATTTGTCACTTCCAGCAGATTATTATTAAGTTTGACGGTTTTAAAAGACGTCCATT
+GTGGGTAACCAGCATGGCGTTATCCTGGGATAACCATTTGCTTTGTTCTTGTTCTATATATCCCAGTACCACAAAGATTCGTTGCCCTTCATTAAGGCGT
+AAATACATAGTGGAATAAGGCAACGCCTGGATCTGCTGATCCGCTACGGTGATATCCTGATTATCGAAAAGGCTGGCGCGAAATGTATCGACCATACTTT
+GCTGGCTGTGCGTACATCCCGCAAGAAATAGTGCGAAAATCGATAAAATAAGAGGGCGCACCTTTAATCCTTGAAAGGTTAATTAAAAATGCAAATCTCT
+AAAGCCCGGTACGAATATCGCAACCGGGTATCATTTAACTTTAATTTCGACGCGTTAAAGCAGTATTAGCGTGTAGTGGACGTGGTGGTTGAGGTGTTAT
+GAGAACCGCCATCGCCACTGTCATTTGCTGCAACAACTGCCAACGTCGCCACACCAACAGCCGTTGCCACACCGACAACTGTCGCCGTGCCGACAGCGCC
+AGCAGCCACGCCACCAGTGGTAGTAGCAGTCGTGGTTGCGCCGGTAGTGGTCGTTGTGGTGCCAGTAGTACCCGTCGTTGCCTCGGTCCCGTTTGTTGCT
+TCAGGGGCAGCAAACGCAGCTGGCGTCGTCAACATGAAGGCCATAAGGATTGCAGAAAGCTTGTGTTTCATAACTTTTCCTTTATTCATCGCATGGACAA
+TACGGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTGAGGTTCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACT
+GACGGGGTGGTGCGTAACGGCAAAAGCACTGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTT
+CTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACAGCCCGCATTATGGGCGTTGGCCTCAACACGATTTT
+CCGCCATTTAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGGATACGT
+CGGGGCTAAATCGCGCCAGCGCTGGCTGTTTTACGCGTATGACAGGCTCCGGAAGACGGTTGTTGCGCACGTATTCGGTGAACGCACTATGGCGACGCTG
+GGGCGTCTTATGAGCCTGCTGTCACCCTTTGACGTGGTGATATGGATGACGGATGGCTGGCCGCTGTATGAATCCCGCCTGAAGGAAAGCTGCACGTAAT
+CAGCAAGCGATATACGCAGCGAATTGAGCGGCATAACCTGAATCTGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTG
+GAGCTGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACCGACAATACGTACGCTTGAGATCAGGATTGTC
+TACTTTGAGTATAACATCCTTGTGAAATCTCCTTTCCTCATACCGCTTGCACTATATACTGCGGGTAGGAAAGGCGCGCAGAGGGAAATATAAGATTGTT
+AACTATCCCCTCTGGAAATACGACTTGTGAGCATAAGATAAATCTTAGCAAAATACAAATTAAAGATAAGGAAATTGTTACGAAAGCTATTAATTATTGT
+TGGTAATATAGTTTCAAGTGGTACTATAACTGGCTGTTAAATGGCATTTATAACTATTAGGTGCAGAGATATTCGCTTAAATGGATTAGTTTCTTTGTGG
+AAAAGTAACTGATGTTATAATGTATGATGTTGACTATTTCACTATTCCAATAAAACCAGTCAGCTTTAAACAAGCAGCGTCATATTAAGAGATAAACATT
+TGCCGCTGTTGGTCCTCGCAGGCCATTTACGCGGCAAAATTCCACACGTAATCCTGGTATAAGCACTTCTGCGTCGCGGGAGTGAATGCGGAAATATGGA
+CCTGAACTTCTTTACGACCGTCGGAGGGATAATGAATCCTTTGCCGCTTTTGCGATCAAAGGTTTTGACAATTCCTGTCATTTTACGGGACAAACAAATT
+CCTTACTGAAAATACTGCGCTGCACTATACGGGGTTAATAAAATAAAGCCAGCGATATTTAAGACCGCCGGACGGCTAAAATAAAATTTGCTTAATCTCA
+ATTATCATGCGTTAATAGCTGCGTCGGTTTGAAAGACAGACAGCATACAAAGTAGTTTACTAAAGCAGTTCTCATTATCAGGCATTATCCCTTCTTTTGA
+GTCTCTCTCCTGAACACTAAGTAGTTTCTGTATTAAAGCCCTGTTTGCCGAAAGGCCCAAAATGAAGGAAGTAAAATATGTCTAATAAAATGACTGGTTT
+AGTAAAATGGTTTAACGCAGATAAAGGTTTTGGCTTTATCACTCCTGATGATGGCAGCAAAGACGTTTTCGTCCATTTCACCGCCATCCAGAGCAATGAA
+TTCCGCACGCTGAACGAAAATCAGAAAGTTGAATTTTCTATTGAGCAGGGGCAACGTGGCCCCGCGGCAGCGAACGTTGTTACGCTCTAAGGTTGCCATT
+ATTACTCAACATCTCCATTTCCGCTGTCCATGTTGTCATGGTTCACAGTACCGCACATCGGCATTCGATGTGACGGAGCGAAACCCTTTGGGCGCTAAGT
+GTATTTTTGTAAATCGACGATGATCACCTTTGATAACGTCGCGCTGCAAATACGCACTGACCATGCGCCGCTGGATTTCACAAAATAATATCAGGCTCCC
+TCGTGGAGCCTTTTTATATCTGCCTTATTTTTCTTCAACGCTGTATGTATAGTAAGCGATAACCTGTTGATTATTGAATCTTTCGGGGAGATGGCTTATA
+ACATTTCTTACCTGACCAGGGTACCGGGAACCAACACCTTACTGGCGTGTTGCTGTCTTTTAAGACCAGAAGAGGTTAACAGTGAATATTGAAGAGTTAA
+AAACAAGCCGAAACGGAAATCGCCGACTTTATCGCGCAAAAATCGCCGAGCTGAACAAGAATACAGGAAAGAAGTCTCTGAAATTCGCTTCACCGCACGA
+GAAAAATGACCGGGCTTGAAAGTTATGATGTCAAAATCAAAATAATGTGATTTTGTGAACATCACCCGTGCGAGGTGATGTTCCGCTTGTTGCTAATTTA
+GTGACCAATCATTGGCGCTTGTGGAATTAAGCGTCGGTACAATTCCTCCGGCACCGGGCTTTGCCATACTCCCGCATACATTGCGTAACCAATCACCGCA
+AACATAATCCCCAGAACCAGTAGCGTCATTAACCAGCCAGACAACGCAAAGGCTTTTTATTTGCCGCAGGTTTTGCAGTGAAAAGGTCAATGTTGAGGCT
+ACCGGACATGACTCTACGCAAGTCATACAGCCGGTACATTCCACTGTTCGTACCTGAATTAATTTATCGACCGGGATCCGTGATGGGCAATTTTTGCGCA
+TTTGCCACAGTCGATACAACTTTCGGCATTGCGACGAATCTTAAACGGCGACAATAGCGAAACCACGCCCATCAGCGCGCCATATGGGCAAAGATAACGA
+CACCAGGCATGGCGAATAAACAGGCTGGCAATCAGCAAAACGGTCACGCTGATTAATGTCGCGGTCCCCATATGACGAAAGAAATCGAGCATTTTAACGT
+CCATCACCACGCTGTAGGGCGACAACATAAAATAGTGAATCGCCTGAGCGGGCATCAATAACGCGATATAGATAAAAACTCAACAGCAAATACTTCACGC
+CGCGCAGAGGAATATCCAGCCAGCGGGGAAGGACACATTGCCGACCAAACAGTTTGTTACCGAGATCGCCGATTAATTCAGAAAGCGTACCAACCGGGCA
+TAACCATGAGCAAAAGGCCTTTTGAGTAATAGACTGATGACGATAAAAGCGACCAATAACAGCATCGCGGCGGCGTGGACGGACGGTAACTGACCTGTTA
+CAAGGCTATATTTCAGATTCATCAGCCCGGCAATCGGTAGCCAGCCTTCGATACCTCCCGGTCTGGCGACAAATGTCGTGCTACTTGCCGTTTCGTAATA
+GCGCACCCAATACCAGAACGTGATGGCAATATAAATATTCATTGCCAACAGTAATAATTGCGTCGCTTTACGCCAGGTCGTGGCATTACGCCAGTCATTC
+CACGGTAATTTGCCGCCCGTCGTGCCTGGCCGCCGCTGCCAGCGGGTTCTTTATTCTCTGCCATGATTTTGCCAGTCCGTTAAGTTGTATACCAAATGCC
+ACTATTCTAGTTGTTCTTAACTGGCTGATATTGATTCAAATCGCGTTCAGGTCTTTCTTATGCAACCATGCTTCCAGAGCGGCAACACTGCGTGTAATTT
+CTTCGTGTGGAAGGGGCAGATAATGGCTGCTGCTCCAGTTGTGCGCATAGCTGGCTGGCGATATGCATTCCCAGACTCGAGCAACTGCTTTTTAGCTGAT
+GCGCGGCACGCTTTATTTTCTCGCTATCCTGACTGGCGCGGGCAATGTCGATTTCATCGAGAAGCGGCAGGGCATGTTGTGTAAATAATACCAGCCATTC
+GTGGATCTTCTCCGTCCCCATTAACTGAGCATCTTCATTGAGTTGCGATACATCCAGCGATTGATCATTATTGACTTGCAGTTGGAGATAGTGCGCCAGT
+AACTGACCGAGCACTTCACGCGGCACCGGTTTAGGGATAATCCCGCGGAATAATGAACTGGTACGCTGGCGCAGCGTTTCGTCAATGACATGGGCGCTAA
+AGCCAATCAAAACCAGCGACGGATATTGCTGTGCCAGTTGTCGGGCAAGCGTAATGCCGTCGATATCCGGCAGATCAAAATCCACCAGTGCGGCAGCAAA
+CGGTTCGCTATTTTGCAGTGTCTCTAAAGCCTGCGCGGCATTGCCAACAGCAACAATCTGCGCACCACTGGTTTTCAGCATCTCAATGGTAATTCGCTGG
+GTTAGCGGGTTATCTTCAATTAACAGCAAACGTAAACCGTCAAGACGCACCGCCTGATTGACTGTTTTGGCACGGGTGCCGTGGCAACACGTAACGGCAA
+GCGTAAACAAAACAGCTTCCAACCTCCGGCGTGCTGGTGGCGCTCAGTTCGCCGCCCATCGCCTGGGCCAGACGGCTACTGATAGTCAGTCCCAGCCCGG
+TGCCGCCGCGTTTGCCGCTTACCTGCACAAATGGCTGGAAGATTTCTGCCAGTTTCGCGGGATCAATACCGCAGCCGCTGTCTTCCACTTCGACCAGCCA
+TTGCTCGCCATCAGTGCGACTACGCAGGATAATGTACCCTTCGTCAGTAAAACGCAGGGCGTTGCTCAACAGGTTGGTTATAACCTGACGAATACGTCGT
+GGATCGCCCATTAACGCGCACGGCATATCATCGGCAATTGCCGTTGCCAGGCGAATCGGGCGACCTTTCACCCGTCCGCTCATTAATTGCAGGGTACTTT
+CCAGCAGCGGGCGCGGTTCAAAGGGCTCATCGCTGACCGAAACATTCTTGCCACCTGCTTCGATAGCGGAATAATCGAGAATATCGTTGAGGATGGTCAG
+CAACGATTCACCAGAGTCAGTAATTGCCCGCAAATCATCACGCTGGGCGTTAAGTGCGGGGTTATCTGCCAGCAGTTGAGCAGTGCCGAGAATACCGTAC
+AGCGGTGTGCGGATCTCATGGCTCATCGCCGCCAGAAACGCCGATTTTGCCTGGCTGGCTTTTCTGCTTCCGCCCGTGCCTGTCGGTGTTCTATCACCAG
+TTCCTGCAATTCAGCTGTACGCGCTTTGACCTGCGCCGCCAGCTGTTCGCGGTGGCGATTCAGTGCATGAACATTGCTGCGAAACGCATCCATCAGCCGC
+CCGATGGTATCCAGCTCCCGTACGCCAGCGGTTTCCGGAAAGGGAGTCAATATCACCGTCCAGCAGCCGTTGCAGCGCCTGCGTTTGTTCGGCAAGTGGA
+CGCGTGACTGAGCGATAAACCACGCGCCAGAGGATCAGAATCAGTGCGCAAAGTGAAACCATCCCCAGCAATAACAGGCTGTATTGCCCGCGTGCACTCG
+CTTTTTCCAGATGCGCCAGTCCGTGCTGATTACGCAGCTCAATGGTGTCGACCAGCTGACTGACTTCGCTACTAAACTGCGCGAACTGGGCGATGTTATT
+TTGTGCGAGAGTTTGTAGGTGATTGCTGATTTCACTGTCCTGCTGATACAGCGCCAGCAAATCGCTATATTGGCTAACGGTAGTTAACGTTGTTGCGACC
+TGCGCACGAACACCCGGATCTTCAATGCGTATTTGCCGACGTTGCAGAATTTTCACCGCATTATTGAGCTGCTTTTCCAGCGTTGGTGCATTTTCTGGAT
+CTGCTCCAGCCCCAGATTCATCACCATTTGCTGCACCCGCAGAGCGCTAAGGCGCAGTTCATTCATCTGGTTAACATACTCAAGATCGATATCAATCAGC
+CGATCGAGTGCACTTTCAGCAGCCTGACGCTGATCTTGTTCGATCAAATCGTAAATCCCGGCCTGGGTCGCTCCAGCGGAAGTTGTCGCATTATTCGCCT
+GACCTTGCGCCAGGCGTGCGATCTCATCGGCGGCAGCGACTATCTGCTGACTGAGTTGCTGTTGTTGCTGGCGCAGTTGCAAACGCTGCCCCACCAGTTC
+CCCTTGCTGACGTAACGAACGGGAGATCTCCTGCTCCTGTTGTTCAATAGCGGTGGTATCAAAACCTTGTTCCCGTAACGCTTGCAGCAACGCATTAATC
+TTCAGGCTTTGTGCGGTGAGCATTCGCCCCTGCGCCTGCCACATCTTTTCGTTATCGGCACTGGTCAGGTTCTGCGCGGCGAAAAGTTCCCAGGCGCTGG
+CTTCGCTCAACTGGCGCGCCATATTCATGGTAGGAATCAATGCCTGAGTGTTGTCTTTTCCACCTGGCTGATAAAGCGCAGGTTGTACCATCCCACCAGG
+GTACTGGTCAGGGTTAACAGCGCCATCAGGGCAAAGCCCATCCAGAGTCTTCGGGTCAGGGTTAAATTCACGGTCGGTGCACTTTAGGTGAAAAGGTTGA
+GTCGCAAAGCGGAATGCATCTAGCATAAAGCCTTATTATTGATGAGGCTATCATGCGCGTACTGCTATTTTTACTTCTTTCCCTTTTCATGTTGCCGGCA
+TTTTCGGCTGATAACCTGTTGCGCTGGCATGATGCGCAGCATTTCACGGTGCAAGCCTCTACGCCGCTTAAAGCCAAACGCGCATGGAAACTGTGCGCGC
+TTTATCCCAGCCTGAAAGATTCATATTGGTTATCGTTGAACTATGGTATGCAGGAGGCTGCTCGCCGCTACGGTGTGGATTTAAAAGTGCTGGAGGCAGG
+CGGCTACAGCCAGTTGGCTACCCAGCAAGCACAAATCGACCAGTGTAAACAGTGGGGCGCAGAGGCCATTTTGCTCGGTAGTAGCACGACCTCATTTCCC
+GACCTGCAAAAGCAGGTAGCAAGTCTGCCGGTGATCGAACTGGTAAATGCTATTGATGCTCCCCAGGTGAAAAGCCGCGTTGGTGTGCCCTGGTTTCAGA
+TGGGCTATCAACCGGGGCGATATCTGGTGCAATGGGCGCACGGTAAACCACTGAATGTGCTGTTGATGCCCGGACCCGATAACGCCGGGGGCAGTAAGGA
+GATGGTCGAGGGTTTTCGCGCAGCCATTGCCGGAAGCCCGGTGCGTATTGTTGATATTGCGCTTGGTGATAACGATATTGAAATCCAGCGTAACCTGTTG
+CAGGAGATGCTGGAACGCCATCCAGAAATCGACGTCGTTGCCGGAACGGCCATTGCGGCAGAGGCGGCAATGGGGAAGGGCGTAACCTGAAAACGCCGCT
+TACCGTGGTGTCGTTTTATCTTTCACATCAGGTGTATCGCGGGCTGAAGCGGGGAAGAGTGATTATGGCTGCCAGCGATCAAATGGTCTGGCAGGGGAAC
+TGGCGGTTGAGCAGGCCATCAGGCAATTACAGGGCAATCGGTTTCTGATAATGTCAGCCCACCGATTTTAGTTCTGACGCCGAAAAATGCCGACCGTGAA
+CATATTCGCCGCTCGCTGTCACCAGGGGATTTCGTCCGGTCTATTTTTATCAGCACACATCAGCGGCTAAGAAATAACCTTCACCATGTTGCGTCACCAG
+TAAATCCGCGCTGAGTTTATGACGTAAACGACGAATTAACACATCGACGGTGCGCAGGTCAGGGTTTTCCACCCGACGCGCAGAAAGCATACGTAGCAGA
+CGTTCACGGCTGAGAATTTCGCCCGGATTCGTCACAAATGCCACCAACATTTCATACTCTGCGCGGGTCAGTTTAATCGGCTCGCCATCCCGCTCCAGCG
+TATGGCGCGACACATTCAGGCAATAACCGGCAAAGCGATAGCAGTTGTCCTGAGTGTGCGGTTGAGCTTGTCGCGCGAGGTCGATTCGCCAGAGCAGATT
+TTTCACCCGTACTACCAGTTCGCGCAGTTCCAGCGGTTTGGTGACGTAATCGTCTGCGCCCATTTCCAGCCCAACAATACGGTCAATCCGATCGCTGCGT
+CCGGTAACCAGAATAATCCCCACCGTTGAGCGTTCTCGCAGGGCGCGGGTTAACATCAGGCCATTTTCATCGGGTAAGTTGATATCCAGCAGAATTAAAT
+CTACCGACTGATTCTGCATAATTTCCCGTAGCCCAGCACCGCTCGCCGTAACGGAAACGGTATACCCCTCCTGAGTGAAGTAGGATTGTAATCGCGCCTG
+GGTAACCGGCTCATCTTCAACAATAACAATGTGATGTGGCATCAGAGGGTTTTACTCATTCTGTTCATATCTGTTCATATTCTGCCGTAAGCCGTTCATC
+CTGACCAGTGCCGCTGTTCATATTTGCTCATTAAGATCGCTTCACTAAACCATAATTCTACAGGGGTTATTATGCGGAAACTCTGGAACGCGCTACGCCG
+ACCCAGTGCTCGTTGGTCGGTACTGGCGCTGGTCGCAATTGGGATTGTGATTGGCATTGCGCTGATTGTATTGCCACACGTTGGGATCAAAGTCACCAGC
+ACAACCGAATTTTGTGTCAGTTGCCACAGTATGCAACCGGTGTATGAAGAATATAAACAGTCGGTGCATTTCCAGAACGCCTCCGGCGTGCGAGCTGAAT
+GCCATGACTGTCATATCCCGCCGGATATTCCAGGCATGGTGAAGCGCAAACTGGAAGCGAGCAATGATATCTACCAGACCTTTATTGCTCACTCCATTGA
+TACACCTGAAAATTCGAAGCCAAACGCGCGGAACTTGCCGAGCGTGAATGGGCGCGAATGAAAGAAAACAACTCGGCAACCTGCCGCTCCTGCCATAACT
+ACGATGCGATGGATCATGCGAAGCAGCATCCTGAAGCAGCACGTCAGATGAAGGTGGCAGCGAAAGATAATCAATCCTGCATCGACTGTCATAAAGGTAT
+TGCCCACCAGTTACCGGATATGAGTAGCGGCTTCCGTAAGCAGTTCGATGAGCTGCGCGCCAGTGCTAATGACAGTGGTGACACGCTGTACTCTATTGAT
+ATTAAGCCAATTTATGCGGCGAAAGGCGATAAAGAAGCCTCTGGTTCTCTGCTGCCTGCTTCGGAAGTGAAAGTCCTTAAACGTGACGGCGACTGGCTGC
+AAATTGAAATTACCGGCTGGACGGAAAGCGCCGGACGTCAGCGTGTACTCACCCAATTCCCAGGTAAACGCATCTTTGTTGCCTCGATTCGTGGTGATGT
+GCAGCAGCAGGTAAAAACGCTGGAGAAAACCACCGTTGCCGACACCAATACCGAGTGGAGCAAGTTGCAGGCCACTGCGTGGATGAAGAAAGGCGACATG
+GTGAACGATATCAAACCGATCTGGGCTTATGCGGATTCGTTGTACAACGGCACCTGTAACCAGTGCCACGGCGCACCGGAAATCGCCCACTTTGACGCTA
+ACGGTTGGATCGGCACGCTCAACGGCATGATTGGCTTTACCAGTCTCGATAAACGTGAAGAACGCACCTTGTTGAAATATCTGCAAATGAATGCGTCTGA
+CACCGCAGGTAAGGCTCACGGCGATAAGAAGGAAGAAAAATAATGAACAATAACGATCTCTTTCAGGCATCACGTCGGCGTTTTCTGGCACAACTCGGCG
+GCTTAACCGTCGCCGGGATGCTGGGGCCGTCATTGTTAACGCCGCGACGTGCGACTGCGGCGCAAGCGGCGACTGACGCTGTCATCTCGAAAGAGGGCAT
+TCTTACCGGGTCGCACTGGGGGCTATCCGCGCGACGGTGAAGGATGGTCGCTTTGTGGCGGCAAAACCGTTCGAACTGGATAAATATCCGTCGAAAATGA
+TTGCCGGATTGCCGGATCACGTACACAACGCGGCGCGTATTCGTTATCCGATGGTACGCGTGGACTGGCTGCGTAAGCGCCATCTCAGCGATACCTCCCA
+GCGCGGTGATAACCGTTTTGTGCGCGTGAGCTGGGATGAAGCCCTCGACATGTTCTATGAAGAACTGGAACGCGTGCAGAAAACTCACGGGCCGAGTGCC
+TTGCTGACCGCCAGTGGTTGGCAATCGACGGGGATGTTCCATAACGCTTCGGGGATGCTGGCGAAAGCTATTGCCTTGCATGGTAATAGCGTTGGTACGG
+GCGGAGATTACTCTACCGGTGCTGCGCAGGTGATCCTGCCGCGCGTAGTCGGTTCGATGGAAGTGTATGAACAGCAAACCTCCTGGCCGCTGGTATTGCA
+GAACAGCAAAACCATTGTGCTGTGGGGCTCCGATTTGCTGAAAACCAGCAAGCGAACTGGTGGTGCCCGGATCACGATGTTTATGAATATTACGCGCAGC
+TAAAAGCGAAAGTCGCCGCCGGTGAAATTGAGGTCATCAGCATCGATCCGGTTGTCACATCCACCCATGAGTATCTGGGGCGCGAGCATGTGAAGCACAT
+TGCGGTTAACCCGCAAACTGACGTGCCGCTGCAACTGGCGCTGGCACATACGCTGTACAGTGAAAACCTGTACGACAAAACTTCCTTGCTAACTACTGTG
+TGGGTTTTGAGCAGTTCCTGCCGTATCTGCTGGGTGAGAAAGACGGTCAGCCGAAAGATGCCGCATGGGCTGAAAAACTGACCGGCATTGATGCCGAAAC
+CATTCGTGGGCTGGCGCGGCAGATGGCGGCGAACAGAACGCAAATTATTGCTGGCTGGTGCGTGCAGCGTATGCAGCACGGTGAACAGTGGGCGTGGATG
+ATTGTGGTTCTGGCGGCGATGCTGGGGCAAATTGGCCTGCCAGGTGGTGGTTTTGGTTTTGGCTGGCACTACAACGGCGCAGGCACGCCGGGGCGTAAAG
+GCGTTATTCTGAGTGGTTTCTCCGGCTCTACGTCGATTCCGCCTGTTCACGACAACAGTGACTACAAAGGCTACAGCAGCACTATTCCGATTGCCCGTTT
+TATCGATGCGATCCTCGAACCGGGGAAAGTGATCAACTGGAACGGTAAATCGGTAAAACTGCCGCCGCTGAAAATGTGTATTTTGCCGGAACTAACCCAT
+TCCATCGCCATCAGCAGATCAACCGCATTATTGAAGGCTTGCGCAAGCTGGAAACGGTTATCGCCATAGATAACCAGTGGACCTCAACCTGCCGCTTTGC
+CGATATCGTACTGCCTGCGACCACGCAGTTTGAGCGTAACGATCTCGACCAGTACGGCAATCACTCCAACCGTGGCATTATCGCCATGAAACAGGTGGTG
+CCGCCGCAGTTCGAGGCGCGCAACGACTTCGATATTTTCCGCGAGCTGTGCCGTCGCTTTAATCGCGAAGAAGCCTTTACCGAAGGGCTGGACGAAATGG
+GCTGGCTGAAACGCATCTGGCAGGAAGGTGTACAGCAAGGCAAAGGACGCGGCGTTCATCTGCCAGCGTTTGATGACTTCTGGAATAACAAAGAGTACGT
+CGAGTTTGACCATCCGCAGATGTTTGTTCGCCACCAGGCATTCCGCGAAGATCCGGATCTCGAACCGCTGGGCACGCCGAGTGGCCTGATTGAGATCTAC
+TCGAAAACTATCGCCGATATGAACTACGACGATTGTCAGGGGCATCCGATGTGGTTTGAGAAAATCGAACGCTCCACGGTGGGCCTGGCTCGCAAAAGTA
+TCCGTTGCATCTGCAATCTGTGCATCCGGATTTCCGACTTCACTCGCAGTTATGTGAGTCGGAAACGCTGCGTCAGCAATATACGGTAGCGGGTAAAGAG
+CCAGTATTCATTAACCCGCAGGATGCCAGCGCGCGCGGTATTCGTAACGGTGATGTGGTACGCGTCTTTAACGCTCGCGGTCAGGTGTTGGCAGGGGCAG
+TGGTTTCTGACCGCTATGCACCCGGCGTGGCACGAATTCACGAAGGGCATGGTACGATCCAGATAAAGGCGGCGAGCCTGGTGCGCTGTGCAAATACGGT
+AACCCCAACGTGTTGACCATCGACATCGGTACATCGCAGCTGGCGCAGGCGACCAGTGCGCACACTACGCTGGTGGAAATTGAGAAGTACAACGGAACAG
+TGGAGCAGGTGACGGCGTTTAACGGCCCCGTGGAGATGGTGGCGCAGTGCGAATATGTTCCCGCGTCGCAGGTGAAATCATGACCACGCTGACAGCACAA
+CAGATTGCCTGTGTTTACGCCTGGCTAGCGCAGTTGTTCTCCCGTGAGCTGGACGATGAACAACTGACGCAAATCGCCAGTGCGCAGATGGCTGAATGGT
+TTTCGTTGCTGAAAAGCGAACCGCCGCTCACTGCGGCGGTGAACGAGCTGGAAAACCGTATTGCCACGCTGACAGTACGTGACGATGCCCGTCTGGAACT
+GGCCGCGGACTTTTGCGGCCTGTTTCTGATGACCGACAAACAAGCGGCGCTGCCGTATGCATCGGCCTACAAACAGGACGAGCAAGAGATTAAACGCTTG
+TTAGTTGAGGCAGGGATGGAAACCAGCGGCAATTTCAACGAACCGGCAGATCATCTGGCGATCTATCTCGAATTGCTCAGCCATCTGCATTTTCGCTGGG
+AGAGGGACCGTTCCTGCGCGAAGAATCGACAGTTTGCGGCAAAAACACTGACGGCGCTGTGGCAATGGTTACCAGAGTTTGTTGCGCGTTGTCGTCAGTA
+TGACAGCTTTGGTTTTACGCGGCACTAAGCCAGTTATTGCTGGTGTTAGTGGAGTGCGACCACCAAAACAGATAACGTCGTTTGTGCGCCTGAAAAGACG
+CGTTTAGCGTCGCATCAGGCATTATGGCGCAGTTGCCGGATGCGGCGTGAACGTCTTATCCGGCCCACAGGAACTGTAATCTTTGTAGACCGGTTAAGAT
+GCGTCATCGCATCCGGCAAACACACATCACGGATGAGCTACAAACCGGGAAAGCCGCTGGCGCAGCAGGCGGTTTTCCTGCTTCAGGTGCGCAATATCAT
+CCATTAACGTCAGCGCCACCGCGATCCCCGGCCAGTCCAGAGCCAGTTCATGACGCAGGCGTACCGCGCGTTGCACCACAATGGCGGCATGGTCGTCAAA
+TACCCAGGTTGTTTCCTGGATCTCACGCGGTTCAACCACCCCAAACCGACAATTTCATTCAACTCCTCTTCAGAGATGCCGGTATGCAGGCAAAATTCGG
+TAATAGTAAAAGTCACCGTAACATTAGCCATTATGCTTTCCCCAATCTTTACGTGGATCAAAAGACGACTGGGCGTCTGCCAGTTGCTGCCACAGCGCGG
+CAGTGTTTTCATCCGGTTTCGGCGGCATCACGATTTTCAGTACCGCATACAGATCGCCGGTCTGTTTTTGCTCACCAGACCTTTGCCTTTAACGCGCAAT
+CGTTGCCCGGCCTGGCTGCCTGGCGGGATAGTCAGCAAAATGCTTTCTTTCAGTGTTGGAACGGTGACTTTAGCACCCAGCGCCGCTTCCCACGGGCTAA
+CCGGCACCACAATTTCCAGATCCTGGCCGACAATATCAAACAGCGGATGTGGCGCAATATGAATCACCAGCCACAAATCGCCATTTGGACCGCCGTTTTC
+GCCCGGCGTCCCCTGGCCTTTCAGACGGATGCGTTGACCATTGCCGACGCCCGCCGGGATCTTCACATTCAGCGTTTTCGGAATTTCCTGTTCGATCATG
+CCAAAGGCGTTATAAACCGGCAGGTTATAGCTGATGGTACGCTTATGCTCAGTAAGCGTTTCTTCGAGGAATACCGCCACTTCGATTTCAATATCGTGGC
+CGCGTGTGGCGGGGCGTTGACGGCTCTGGCGGGCATGCTGACCGAAAATTGACGAGAAGATATCGTCAAAATCTTCGGCGTTAAAACTCTGACCGTCGCC
+ATGGTGGAACTGACGGTTAAATTGCGGATCGTTGCGATGTTGCCACATCTGATCATACTCAGCGCGACGTTGTTCATCACTTAACACTTCCCAGGCTTCA
+GCGACCTCTTTGAAGCGGGCTTCGGCATCCGGTTCTTTGCTGACATCAGGATGGTATTTGCGGGCAAGTCGACGATAGGCGGTCTTGATTGTCTTGAGAT
+CGTCCGTCGGTTTCACGCCCATGATGGCGTAATAATCCTTTAATTCCATAGCGTTATCTCGCGTAAATCAACACAAATTGAAGGAACCCTGTAAGGTAAC
+TCCTATAAGTGTAGGGTAATCCTCAAAATTTCATATGCCAACACAGAATATGTTATTGAAATCATCGCGGAGAGGAGGTCGCCATCAAGATGGGTTGCTG
+AACATATTTTAAACAGGTGAAAAGGGTGAGCGATTTTTGATAGTTGAACCAGGCACTTTAAGTTTAACTAGGGCGTCATTATTTATTAAATTTTATAGAC
+GCTATATATGGGTAGTAATATACATGGAATTAGTTGCACTGCAAATAATTATTTGAAACAGGCCTGGAACGATATAAAAATGAGTACGAAAAAATCAAAC
+ATATTCAATCACGCTTTTGAAAACACACTGGTGTGTTTTATGCGGTTATACAATGAACTCAGACGTAAAGTAAATGAAGAGGATACTCCATGTCTGGAAT
+GTGAATCACTAGAAAAAGAATTTGAGGAAATGCAGAATGATAATGATCTATCATTATTTATGAGAATATTGCGTACTAATGATACACAAATTTATTCAGG
+GTTTCAGGAGGTATTACATATACTATACAATATGTTCGAGATATTGATATTGTTAGAGTGTCCTTGCCGGGCAGAGCTTCAGAGTCTATCACAGATTTTA
+AAGGTTATTATTGGTATAACTTTATGGAGTATATTGAAAACATTAATGCGTGTGATGATGTTTTTCTGAGTATTGTTTTGATGATGAAAATATAAGTGTC
+CAGCCAGAGCGGATAAATACGCCGGGAATATCTGATTTGGATTCTGACATTGATTTGTCTGGTATATCTTTTATTCAGCGTGAAACTAACCAGGCATTAG
+GATTAAAATATGCTCCTGTAGATGGCGATGGATATTGTCTGTTAAGAGCTATACTGGTTTTAAAACAACATGATTATTCATGGGCGCTGGTCAGTTATAA
+GATGCAAAAGGAAGTTTACAACGAATTCATTAAAATGGTTGATAAAAAACGATCGAGGCTCTTGTTGATACGGCATTCTATAATCTCAGGGAAGATGTAA
+AGACGTTATTTGGCGTTGATCTACAATCTGACAACCAAATTCAGGGCAGAGTAGTCTTATGTCATGGAGCTTTCTGTTTTTAAAAACAATTCATTGATAG
+TTGCTTGAATAACGAAAAATGTATCCTGCATTTACCCGAGTTTATATTTAATGATAACAAGAACTTGCTTGCTTTAGATACCGACACGTCGGATAGGATT
+AAAGCGGTGAAGAATTTTCTTGTTGTTCTTTCAGATAGCATTTGCTCATTATTTATTGTTAATAGTAATGTGGCATCAATCTCCTTGGGGAATGAATCCT
+TTTCAACAGATGAAGATCTTGAGTATGGTTATTTAATGAACACTGGCAATCATTATGACGTTTACCTCCCTCCTGAACTTTTGCTCAGGCTTACAAGTTA
+AACAATAAGGAAATGAATGCGCAACTCGACTATTTAAATCGTTATGCAATTTAATGGCAAAGGCATATGCTAAAACCATTGTTATTAGTCTCACACTTTT
+TATTGGTAAATATTGTCTCTGTATTGGTAACGCCGCAGATATTCTGTTTAGCCACAGGTGCAATTATCAGCGGCGTACGCGAGGCAGGGGCTAATCAGGC
+ATAGTTTGCGTCAAACCTTGCCTGTTTTGAAGATGTATATAGAAAACAGGCGTTCAACAAGCCATTTTGCGAACCTGTTCCCGGAAAAAGTCATATTTCT
+GTCACACTCTTTAGTGATTGATAACAAAAGAGGTGCCAGGAATGAACAAAACGCTAATCGCCGCAGCTGTGGCAGGGATAGTTTTACTCGCTTCAAACGC
+TCAGGCACAAACCGTACCGGAAGGCTATCAGCTACAGCAAGTGCTCATGATGAGCCGCCATAACTTACGCGCCGCTGGCGAACAATGGCAGTGTGCTGGA
+GCAGTCGACGCCGAATAAATGGCCAGAATGGGACGTCCCCGGTGGGCAACTCACCACCAAAGGTGGCGTGCTCGAAGTGTATATGGGCCATTACATGCGT
+GAATGGCTGGCAGAGCAGGGGATGGTGAAATCGGGGAATGCCCGCCGCCGTACACCGTTTATGCCTATGCCAATAGTCTGCAACGTACCGTTGCGACCGC
+ACAGTTCTTTATTACCGGCGCATTCCGGGTGTGATATTCCTGTGCATCACCAGGAAAAATGGGCACTATGGACCCAACCTTTAACCCGGTGATCACCGAT
+GATTCCGCCGCATTCAGTGAACAGGCGGTGGCGGCAATGGAGAAAGAGCTCAGCAAACTCCAGCTTACCGACAGCTACCAGCTACTGGAAAAATCGTTAA
+CTATAAAGATTCCCCTGCCTGTAAAGAGAAACAACAGTGTTCGCTGGTGGATGGCAAAATACCTTTAGCGCCAAGTATCAACAAGAACCAGGTGTTTCCG
+GGCCGCTGAAAGTCGGCAACTCGCTGGTAGATGCGTTTACTTTGCAATATTACGAAGGTTTTCCGATGGATCAGGTGGCCTGGGGAGAAATCAAATCTGA
+CCAGCAGTGGAAGGTGTTGTCGAAGCTTAAAACGGCTACCAGGACAGCCTGTTTACCTCACCGGAAGTGGCGCGCAATGTTGCGAAACCGCTGGTCAGTT
+ATATCGACAAAGCTCTGGTCACCGATCGCACCAGCGCACCGAAAATTACAGTGTTGGTTGGGCACGACTCAACATTGCCTCTCTGTTAACGGCGCTGGAT
+TTCAAACCGTATCAGTTGCATGACCAGAACGAACGCACGCCGATTGGCGGCAAAATCGTTTTCCAGCGTTGGCATGACAGCAAAGCCAATCGCGATTTGA
+TGAAAATTGAATATGTGTATCAGAGTGCGGAACAGTTACGTAATGCCGATGCGTTAACCCTGCAGGCACCTGCGCAGCGTGTGACGCTGGAATTAAGCGG
+TTGCCCGATAGACGCTGATGGTTTCTGCCCGATGGATAAGTTTGATAGCGTGTTGAATGAAGCGGTGAAATAACAGAAAACTCCCCGCGAGAAGCGGGGA
+GTCGCTGGTTAAACGTTTTACGTTCGATGGTCTGTTCGCCCCAAAAAGCGAATCTTTATCGGTCTTAGCAAAGGCTTTGACTAACACTTCATCACTACCT
+TCTTCCCAAATCTTTTCCGCCATTTTTCGTCGTACCCGGCGACTTCGAAAATGGCCTCGGCTATTTCCGGCGACGTATTGCGCAGAGATGCCCATTCACC
+GACGTGATGAGCTTTCGCTTCTTGAGTTGGCATGCGTATCCTCCTGTTGAAGATTAGCCGTTAAGTTTAACTGCCAGACCTGCGACATATTCCCCTGATA
+ACGAGCAATAGACAGTTCTTCCTGGCTGGGCTGGCGTGAACCGTCACCGCCTGCGATGGTGGTTGCGCCGTACGGCGTACCGCCGCGAACCTGTGAAACG
+TCAAATAATTCCTGCGCTGCGTAGCCAATAGGGACAATTACCATGCCGTGATGCGCAAGGGTCGTCCAGGTGGATGTGATGGTTTGTTCCTGACCGCCGC
+CAGTACCGGTGGAACTAAAGACGCTCGCCAGTTTTCCGTATAGTGCGCCGGAAGCCCACAGGCCGCCCGTCTGGTCGAGGAAGGTACGCATTTGACCGGA
+CATGTTGCCAAAGCGGGTAGGTGTACCAAAATAATGGCGTCGTAATCGGCCAGTTCTTGCGGGGTTGCAACCGGTGCAGTTTGCGTTTTACCGCCTGCTT
+TTTCAAATAATTGCGGCGGCATGGTTTCCGGTACACGCTTAACGACAACTTCAGCGCCATCCACTTTGCTTGCACCCTCAGCGACTGCGCGTGCCATCGT
+TTCAATATGTCCGTACATGGAATAATAAAGCACCAGAACTTTAGCCATTTCTAACCACTCCTCGTGTTATCTCTATTCCGTAGCGATTCGCTACCACTTA
+TTTAAAGATAAGACGTCCTTTTCAGAGTGCAAATTTCACAACCACTTATTTGATTTATAACAACTTTCACAAGCACGTAATTTTGTCGCAAAATGACACA
+TTTTTATCTCATCGCGTTTTTTAATCATAAGAGCGGCTTATGGATAATTATTGGAGATGATATCTATTCTCGCTAAGAAGCTGTTGCAGGATATTACCAA
+ACGCGGGTCTGCCCGCGTCAGTTCACTAAGCTTAGTCCCACGTAGCGAAAATATGGCAGCCGCCATACGCCGCGTTAATTCTATGCAATATGATGTCTAT
+ACCCAGACGGAGGTCAGTAATGGCAAACCATCGAGGCGGTTCCGGCAATTTTGCAGAAGACCGCGAAAGAGCATCAGAAGCAGGTAAAAGGTGGACAGCA
+CAGCGGGGTAATTTCAAGAATGACCCGCAGCGCGCATCTGAAGCAGGTAAAAAGGTGGTAAGAGCAGTCACGGCAAAAGCGACAACTAGCCGGGCTAATC
+AATGACGAATGCATTTTTGTCTGTAGCTCGTCAAAAGCCATCACCGCCGGTTACCCGGTGGTTGATACTGATGACAAATGTAAGCTTGCCTGATGCGCGA
+TGCTTATCAGGCCTACCAGAAGATTGCAATATATTGAATTTGCACTGTTTTGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCATGAACAATGCGTAC
+GTTGTCAACAATCTGCACCGCCGGTAACCCCGGCGGTTTTCTGTTTATGGCTCCTGATGAACAACTTCTGGCGGTGGAACGTCAACCAACTTTCTGCTTA
+ACAACGCATTGAGTAAAATCGCGCCAAAGGTTGCTGTACCAATCCCTCCCAACGTAAAACCGCCCAGCGTGAGAGCAAAATCACCCGCGCCCAGCACTAA
+GGTTACTGCGACCATAATCAAATTACCGTTCTGGCTTAAATCGACACGGTTTTGTACCCATATCCTTGCGCCTGCGACGGCAATCAGCCCGAACACAACA
+ATTGATGCACCACCAATAACCGCGGCCGGAATGGTATGAATCAGCGCACCAAATTTCGGTGAAAAGCCCAACAGCATGGCGATGACGGCAGCAGCAACAA
+ACACCAGCGTCGAGTAGACTTTGGTCACGGCCATCACACCGATATTTTCAGCATAGGTGGTCACGCCGCTACCGCCGACAGAGCCGGAAAGCATCGTTGC
+CAGACCATCGCCTACGAATGCCCGCCCCATATACGGGTCCATATTGCGTCCGGTCATCCCGGCGACTGCCTTGAGATGACCTAAGTTTTCCGCCACCAGA
+ATCACCGCCACGGGCGCAATCAGCATCATTGCCTGACCATTAAAAGCAGGAGTGGAAAAATGTGGCAGACCGAACCAGGCAGCATGGCTGACGAGAGTAA
+AATCGACGGCTTTTCCCAGCCCTAAAACGTTGGTCATCACGCCATACAGCAGACAGGCGACAATTAATCCTACGAGAATCAATAACCGCTGGATCATGCC
+ACGGGTAAACACCGCCACCAGCCCAATACACAGCACCGTCATTACCGCCATCCAGCTATCAAAGGCCGAAGCCGATACACTTTTCACTGCGATAGGCGCT
+AAGTTCAGGCCAATCGCCATCACCACCGCACCCGTCACCACCGGCGGCATCAGTCGTTCAATCCAGCGCGTACCGATTTTCATCACCACCAGGCCAATGA
+CGGTATAAACCAGCCCACAGGCGATAATCCCGCCCAGCGCAATGCTGATATTCGGGTTAATGCCCTGACCGTTAAAGCCCGTCGCGGCGATCACCACGCC
+GACAAAAGCCGCGCTGGAGCCGAGATAACTGGGGACGCGCCCGCCGGTAATAAAGAAAACAGTAACGTGCCGATCCCCGACATTAAAATGGAAAGATTGG
+GATCCAGCCCCATCAGAATCGGCATTAACACCGTCGCGCCAAACATCGCCACCGCGTGTTGAACGCCCATTACTGCCGTCTGAGCAAACGGCAATCGTTC
+ATCCGGCGCGACCACGCCGCTCTCTGTAGAGGTCGATTTTAACTGCCAGTGAGGAAAACCGAACATTGCCATCAGCTGTCTCCTTAAGGAGGTTAACAAG
+CAGGGCGCATCAGCGCGTGATAACTGCGATCGAACCACACCAGCCCGTAGGGTGTGGTGTGACGATGAATCGCTTCGATGGCGCAAAACAGAATGTCGTG
+GGTGCCGACGCTCACCACCTGGCTGATACGGCAGTCAAACGAAACCAGAGCCTCTTCCAGTTGCGGGCATCCGGTCACCCCGTCTGCCAGCGGGCGGCGG
+CAAAGCGGTGTTCCATGGGCGTTTTGCCGCCAAAAGGTTTGAAAGCGGCTCCTGCCCGGCGCTAAGTGTATTTACACACAGCGTTCGATTTTCATTGAAT
+GCCGGCCAGACGGACGCCCCACGATTCAGGCACACCAGTAATGTGGGCGGCGTATCGGTCACACTGCAGACGGCGCTGGCGGTGAACCCGGCGCGCCCGG
+CTGGACCGTCCGTGGTGATAATATTGACCGCCGCGCCCATGCAGGACATCGCATCGCGAAAAGTTTGTTGATCGACAATGTTCATAGTTTGCTCCTTACA
+ACAGCCCGCAGGCTTCTTCAAAGGACAGACGTGGCAGGCGCGCATAAAGCTTGCTGCTATCGCCATAGCCGATATTAATCAGCAGATTGCTCTTCAGCGT
+GCTGCCCGTAAAAAGGCGTCGTCCACGTGTTGACGGTCAAAGCCCGACATCGGGCCGGTATCCAGTCCCAGCGCCCGGCAGGCGACGATCAGATAGGCCG
+CCTGCATGGAACTGTTGCGAAACGCTGTTTCTTCGGCAAGTTGTGGGCTGGAGGTAAACCAACTGCGGGCATCACCGTGGGGAAACAGTAGTGGTAACCG
+TTCATAAAATTCACTGTCCCAGGCGACGATAGCGGTGACGGGCGCGGTCAGGGTTTTTGCAGATTGCCGCTGGAAAGTGCCGGGCGCAGACGTTCTTTTC
+CTTCTGCCGTGCGGGTAAACACGATCCGTGCCGGAGAACAGTTAGCTGATGTCGGCCCCATTTCATCAGGGCATAAATCTCCCGTAACGTCTCATCGCTG
+ACGGGTGTCTCCCGCCAGCCGTTGTGAGTGCGGGCATCGGTGAACAGGGTGCTAAGCGCACCTGGGCTAACGGCTTCGTTCATAGCAATTCCTTACAGGG
+CGGCTTCACGGTGATGTAACAGGCTGGCAAGCCCGTTGAGTAACAGAGCATTAAACGTTTCGGGATCGGTCACGTTGCAGGCGTGTCCGCCATAGGGCAT
+CACCATTTTCTGGCTATCGGGCAGGGCGGCATGAAGTTCACTGGAACATGCTGTTGGCACCAGCAGATCATCACTGGCGCAGATGATTTGCACCGGGCAG
+CGGATGCGATCCGCATGGTGACTAAAGTCAGCGCGTTTGAGGGCGTTAAGTCGACGCAGTAAATTATTTTGCCCTGAAAATGCGCCAGTGCCAGCGCGTC
+TTCTGCCTCCAGGCGAGGTGCGCGGGCCGCCATCCAGTCGGCGGGATAGAGGAACAACGGCTGCGCTTCCACCCATGCCTGCGCGCCGCCGCTATACAGT
+AATCGTTCGCGAACCTGAAAACAGCGGCGCGTATGGGCGTTTATTCGTAGCCAGCCGTTAACGCTGATCAGCACAGTTACCGACGCGGGATAATCCAGCG
+CCAGCTGCATTCCCACCAGCGCACCGAGCGCATGGCCGACCACTGCGTAATGCTCAATCCCTGCGGCTACCAGCGCCTGATGCAGTTCCGCTGCCATCTG
+GGCGATACTGTAATCTTCTGCCAGCGTGTCGGGATTATTGCCGGTGCCGCGCTGGTCGTAACAGACTACCTGATACTCCTGCTCCAGCACCGCCAGTTGC
+GGTAACCAGTAACTGCCGCTACCCCAAGACCCGAAATCAACACCACTACGGGCGCATCAGCATAAGGGGAGGTGAGAGTGAAAGTTTCATCGCGGCCTCA
+CTTGGCGATATGCGCAATTGTGGCGATTTCCACCAGCGCGTCAGGTTTTACCAGTCCGCACTGAATGCAGAATCGCGCCGGTTTATCACCCGGAAAAACT
+CGGCGTAGATTTCGTTAATCGCGGCGTAATTTTTCCAGTCGGTAATAAAGATGCTGTTGAAGGTCACATCCGCCATCGTGCCACCCGCCGTCTCGATCAC
+CTTGCGGATAGTTTCCAGAACGTGGCGGGTTTGCGCCTTTGGGTCATCGGCAAACAGCACGTTATTATGTTGATCAAAAGCCAGCGTACCGGAGACATAC
+ACCACGCCATCAGCCAGCGTGCCGGGAACGAAGGGGCCAGCGGTGCGCTGCTGCCAGCGGGAATAATTACGGATTTTGGCATCGTTAAACTCCTTAAGCG
+ATATGAGCAAAGGACGTGGGAGAAAGCGCGTCGCAGAATGTTTCGACGTCGCTGACCCAGCCAAAAAGGTTTCGATATTGAACAACGCGGCTTTCTGCGC
+AAATTTCGGCCCCGCCTGGTGAGTTGCGTCTTCAAGCACCACGCCGAAATACTCCAGAAAAAGCCGTCGCGTAGCGTCGATTCGACGCAGACGTTGGTAG
+CGATGCCGGTGAAAACCAGATGGCGTATTCCGCGGCTGCGCAAAATGCTGTCCAGCGGCGTATTGAAGAAACCGCTGTAGCGCGGCTTCGGCAGCACAAT
+ATCGCCAGGCTGCGGCACCAGTTCATCCACCAGTTGATAATCCCAGGAGCCTTTCGCCAGCAATTTCCCCTGCAGCTGCGGCTGCTTACGCATGGTTTTC
+AGGGCGTTCGATTTATGAAAATTCGGTGAGCCGGGTCCGCCAGCCTCGACATACTGTTCATCCCAGCCATTTTGAAACCAGATGATCAGCATCCCTGCCG
+CTCGCGCTGCGGTCACGGCGGTTTGAATGTTGGCAATGACCGGGCGAGTGGTTGAGACATCAAACCCGGCGAGATCTAAGTAGCCGCCTGGCGTGGCATA
+AGCGTTTTGCATATCCACCACGATCAGCGCACTTTGCTGCGGATCGAAGGTAATGGCTTCCGGTCGAGCGGTTAAGGTCGTCATCATGCCACCTCCTGAG
+TCAGCGCAGGTAGATGGGCGCGGCATTGCATCAGTGGTTGAATGCGCTCGCCGAAGGTTTCGATTCCCGACAGAAAATCGTCGAAGGTTAACAGCACGCC
+TTCGGCACCAGGCACGCTTGCGACTTCATCTAACATGCGCGCGACACTGGCGTAAGAACCGACTAACGTCCCCATATTGATGTTTACCGCCGAAGTGGGA
+TCGGCCATCTGACGAACGTTGGTGTCAGTACCGGAGCGGGTATCTTTCTGACTTTGTTCGGTTAGCCAGCTTAACGCCTCTTCATCCGCGCCCGCTTTGT
+AGTGTTCCCATTTGGCGCGAGCGGCATCGTCGGTTTCATCGGCAATCACCATAAACAACACATAAGAGCCAACGTCGCGTCCGGTTTGCTCTGCGGCCTG
+TTTCATCCGCGCAGCGGTCGGGGCGAAAGCCGTGGGTGTATTTACGCCTTTGCCGAAACAGAAGTTGAAATCGGCATACCGGGCGGAGAACGCCATGCCA
+GCGTCGCTTTGCCCGGCGCAGATCACTTTCATGGGGACACTCGGTTGCGGACTCACGCGACAATCATTCATGGTGAAAAATCGCCTTTAAAATCGCTTTT
+CCCCGTGCCCCACAGGTCGCGCAGCACCTGAACATATTCGGTGAGATAGTCGTAACGACGGGAGAAATAGTCATCGCCAGGCCAGATACCCATCTGCTCA
+TACTCGGGCTTTTGCCAGCCAGTCACGAGGTTGACGCCAAAACGCCCGCCAGAGATGGAGTCGATGGTTGCGGCCATACGGGCGACGATTGCCGGAGGTA
+ACGTTAAGGTGGCAGCAGTGGCGTAAATCTGAATGCGCGAGGTCACGGCCGCCAGCCCCGCCATCAAGGTGAACGACTCAAGGTTGTGATCCCAGAACTC
+AGTTTTGCCGCCAAAGCCACGCAGTTTGATCATCGACAGGGCGAAATCGAAATGGTAGTGCTCCGCTTTTTGCACAATGGCTTTATTCAGTTCAAAGGTC
+GGCATGTACTGCGGCGCGTGGGTCGAAATGAGCCAGCCGTTGTTGCCAATAGGTACGAATACGCCAATTTTCATCATCAACCTCTCTTCGTCTCGTAAAG
+TGAAAGTCAGACGGGGCGCTGCATCCTGCATATCCTTTTCAGCCGCGTATTGGCTTGTTTGCAAAGCGGATGCCAGTTTTAAAAAGTTAATGTTATTAAT
+CTGTTAACATTACGTTATCTAAAATATCTGGTAAAAGTGGACTAAACGGTCAAAACAGTTGCACATAAAACATGCATCTGTGCGCGATGAGAGTGCAGAA
+GGTCGAGGCCGGGCGGGGTTTTGCTATCCTGTTGCCAATCTACAAGAGGGGAGAGCGCATGACGCAAGGCGCAGTGAAAACAACGGGTAAACGTTCGCGC
+GCAGTAAGCGCGAAGAAAAAGCGATTCTTAGCGCAGCACTGGACACTTTTTCACAATTCGGTTTTCACGGCACAAGGCTGGAGCAGATCGCAGAGTTGGC
+GGGTGTTTCAAAACCAATCTGCTGTATTACTTTCCGTCAAAAGAGGCGCTGTATATTGCCGTGCTGCGGCAGATTCTCGATATCTGGCTGGCACCGTTAA
+AAGCGTTTCGTGAAGATTTCGCCCCGCTGGCGGCGATCAAAGAGTACATCCGTCTGAAGCTGGAAGTCTCACGCGATTATCCGCAGGCTTCGCGCCTGTT
+CTGTATGGAGATGCTGGCAGGCGCGCCGCTGTTAATGGATGAACTGACGGGCGATTTGAAGGCATTAATTGATGAGAAATCGGCGCTGATTGCCGGTTGG
+GTCAAAAGCGGCAAACTCGCGCCGATTGATCCGCAGCATTTGATTTTTATGATTTGGGCTTCCACTCAACATTACGCCGATTTCGCCCCTCAGGTGGAGG
+CGGTGACAGGCGCGACGTTGCGCGATGAGGTATTTTCAATCAAACGGTTGAAAACGTGCAGCGGATTATTATTGAGGGATTCGACCACGTTAAAGATGCC
+GGAGGAGGTTGTAACATCCTCCGGCTACCTGTTTAACCTATAGTCATTAAGCTGGCGTTACCGCCAGCGGCAGCGGTATTCACACTCAGCGAACGCTCGA
+TATACAGCCGTTCCAGAAGGATATTGCTTTCGCCACGGGCAAAACCCTGCACCGAAACAATTGTGCCATCCCGCGCGGCAACTGCTTCACACAATGCGCG
+AAGCTGATCCGAATCACCGTGGAAGATCACCGCATCAAACGGTTGAGCGGTTATATTTTCCGCTTTCGCCAGTTGAATACGTTCGCTGACTGCCGATGGC
+AATGCCTTCACTAACTGACGATGCAGCGCGTCATCCGGCCACAGTACCTGGCTGCCCACCGCCAGCACGGCGGCGAGCTGAGTCAGCGCATCCTGCTCAT
+CATCGGCAATACACAACACGCGCTCACGCGGCAGCAGCGTCCAGGTGTTGCGTTCACCCGTCGGCCCCGGCAGCAATCGTTGTGTTCCTGCCTGCGCCAG
+CTCGCCATATTGCGTACATAACGCCTGCAATTCTGGACGATTTGCTGCCCATTCCCGCAGTGCATTTAGCGGCTGAGTCAATGCGGCTTTCAACTGCGCA
+TCGACCGGATACTTTGCATCCTGACGCGCGAGCGTCACTGCCAGCGCACTTTCCGGGCGATTCGCCAGCAGACGGTAGAGATAGAGCGGACCGCCTGCTT
+TCGGCCCGGTACCGGACAACCCTTCGCCGCCGAACGGCTGCACACCAACCACTGCGCCCACCATATTACGGTTAACATACAGGTTACCAACATGGGCCGA
+GCCAGTGACCTGGGCGATGGTTTCATCAATGCGCGTATGGACGCCAAGCGTCAGACCATAACCGGAAGCGTTAATCTGCTCGATCAGCTCTGGTAGCTGG
+TTACGGTTGTAACGCACCACATGCAGCACCGGACCAAAGACCTCTTTTGCAATTCGGCAAAGTCATCCAGTTCGATCAGCGTCGGGGCGACAAAGGTGCC
+GCTTTGCCATTCACGGGCATCTTCGCTGTTTTCCCGCACCGCCTGGAACACCGGACGGCCTTTGCTACGCATGGTCTGAATATGGCGCTCAATATTGGCT
+TTCGCTTCGCTATCAATCACTGGACCGATATCGGTGGTCAGGCGACCCGGATTACCCATCCGGCATTCGGCCATTGCGCCGCGCAGCATTTTCAACGTGT
+GGTCGGCAATCTCATCTTGCAGGCACAGCACGCGCAGCGCCGAACAACGCTGACCCGCACTGTCGAACGCCGAGGCCAGTACATCCACGACGACCTGTTC
+GGTCAGTGCTGAAGAATCGACAATCATCGCGTTCATGCCGCCGGTTTCAGCGATGAGCGGAATAGGGCGACCCTGAGCGTCCAGGCGGCTGGCGATATTG
+CGCTGCAGTAACGTAGCGACTTCGGTTGAACCGGTAAACACCCCGCGCACGCGATCATCACCCGTCAGTTGCGCGCCCACGGTTTCACCCCGACCTGGCA
+GCAATTGCACCACGCCTGGCGGTACACCCGCTTCCAGCAAAATGGCGATCCCTTGCGCGGCAATCAGCGGCGTTTGTTCTGCCGGTTTTGCCAGCACGCT
+GTTACCTGCCGCCAGTGCGGCGGCGATCTGCCCGGTGAAAATAGCCAGCGGGAAGTTCCACGGACTGATACACACCACAGGCCCTAATGGACGGTGGGTT
+TCGTTAGCGAAATCATCCCGCACCTGTCCGGCGTAGTAGTGGAGAAAATCGACCGCTTCGCGCACTTCGGCAATGGCGTTACTGAAGGTTTTTCCGGCCT
+CACGCACCAGAATACCAATCAGTTGCTGCATCTGGCTTTCCATCAGCACGGCAGCGCGGTGCAAAATCGCTGCGCGTTCAGCCGGAGGCGTGGCAAACCA
+GATTGGCGCGTTATTAACCGCACTTTCCAGCGCCTGTTCTACTTCACGCGGCGTGGCTTCACGCACATAGCCCACAATATCTTTCGGTTCCGCAGGGTTA
+ATAACGGGCGACATCTCACCTGCCGCTACCGGTTGTTCCAGCATTGGCAAGGCCTGCCATTTTGCAGTGCACTATTGAGCAGGGCAGAGGAGAGCGAGGC
+CAGGCGGTGTTCGTTAGCGAGATCCAGCCCTGCCGAGTTGTCGCGCCCGTGACCGTAAAGATCGCGCGGCAGGGGAATTTTCGGATGCGGTAATCCAGTT
+TGCCCTTCCTGTTGCGCCAGTTTTCTACAGCAGTGACCGGATCGGCGACCAGTTCATCCAGTGGCAAAGAGGTGTCGGCAATACGGTTAACAAACGAGGT
+GTTAGCACCGTTTTCCAGCAGGCGACGCACCAGATACGCCAACAGCGTTTCATGTGTGCCAACCGGAGCATAAATACGACACGGACGGTTAAGTTTGCCG
+TCGGCAACTTTCCCGGTGACCTGCTCATACAGTGGCTCGCCCATACCATGCAGGCACTGGAACTCGTACTGACCCGGGTAGTAGTTCTGCCCCGCCAGTT
+GATAAATCGCCGCCAGCGTATGGGCGTTGTGCGTCGCGAACTGCGGGTAGATTAGATTCGGCACCGCCAGCAGCTTTTCGCACAGGCGAGATAAGAAACG
+TCGGTATACACCTTGCGGGTATAAACCGGATAACCTTCAAGGCCGTCCATCTGCGCACGCTTAATTTCACTATCCCAGTACGCGCCTTTCACCAGGCGAA
+TCATCAGACGGCGACGGCTGCGGGTGGCGAGATCAATCAGGTAATCGATCACCAACGGGCAGCGTTTTTGATAAGCCTGAATAACAAAACCGATGCCGTT
+CCAGCCTGCCAGTTCCGGCTCGAAACAGAGTTTTTCCAGCAGATCGAGGGAGATCTCCAGGCGATCGGACTCTTCGGCGTCAATGTTGATACCAATATCG
+TACTGACGCGCCAGCAGGGTGAGTGATTTCAGACGCGGGTAAAGCTCTTCCATTACCCGGTCATACTGGGCGCGGCTATAACGCGGATGCAGCGCCGACA
+GTTTGATTGAAATGCCCGGCCCTTCATAGATGCCACGACCGTTAGACGCTTTACCGATGGCGTGAATCGCCTGCTGATAGGAAACCATATACGCCTGTGC
+ATCTGCGGCGGTCAGCGCGGCTTCGCCCAGCATATCGTAAGAGTAACGGAAACCTTTCTCTTCCAGCTTGCGGGCATTGGCTAACGCTTCCGCGATGGTT
+TCGCCAGTGACGAACTGCTCACCCATCAGGCGCATCGCCATATCCACACCTTTGCGGATCAGCGGTTCACCGCTTTTACCGATAATGCGGTTCAGCGAGC
+GGGAGAGGCTGGCTTCGTTATGGGTGGAAACCAGTTTGCCAGTAAACAGCAGCCCCAGGTGGCGGCATTAACAAACAGTGACGGGCTACGACCAATGTGT
+GACTGCCAGTTACCGTTGCTGATTTTGTCGCGAATTAACGCGTCGCGGGTGGCTTTGTCGGGAATACGCAACAACGCTTCCGCCAGACACATCAGCGCCA
+CGCCTTCCTGCGATGACAGCGAAAACTCCTGCAATAACCCTGGACCATACCTGCGCGACCACTGGCATTTTTGATTACGCAGTTTATCGGCCAGCTGATA
+CGCCAGTTTGTGCGCCTGTTCAGCAACTGGCTGCGGCAGGCGGGCTTGTTCCAGCAGCATAGAAACCGCTTCGGTTTCCGGGCGGCGATAGGCCGCGGTG
+ATCGCGGCGCGGGAAACCGACTGGGGCAATATTTGCTCGGCAAAGTCGAGGAATGGCTGGTGTGGTTCCTCTGCCGGAGTCGGTGCTTCATCGCTCTCAT
+TGGCCGCGCCAGAAAGCAGCGCAGGTAGCTCCGGCAGAGTATCGCTGTTTTCCAGTTGTTCGAGATAAGAAAAATCGCCTGCTTAATTAACCAGTGTGGT
+GTGCGATCGATACGTGTCGCGGCAGACTTAATACGCTCACGCGTCGCGTCGTCCAGCTTAACCCCCATGGTGGTGGTTCCCATGCCATTACTCCTGTTGT
+TCAGAAAGGTGCAACTTAACGTTATCGTGAAATATCCATGATGTTGCAACTTTGTGCAACCATGTTAAATGTGACATGCGTAGCAAGCTTAAAAATGAAT
+GAAATGTTAATAAAAGAAATCGATATGACAGGGATTAAAAAATAACTCAGACTTTTCTCTGCGGCAGTTAACATTTTGAAAGGTGCAACCGCAAAAATGT
+GAGAGAGTGCAACCTGATGAAAAATAGTGTCGCTGAGCACTAAAATTTAATGTAAATGGTGTGTTAAATCGATTGTGAATAACCAGCGCTTCCGGCAGGA
+TACGGTCGCCCTGGTAAAACATAAACTCTGTTACCCCGTTCCGGTGGCAGATATAACGGCAAGTTTCGACATTGCCGATAATAATTTTGGAGACTTTAGA
+TGGCTATTAGCACACCGATGTTGGTGACATTTTGTGTCTATATCTTTGGCATGATATTGATTGGGTTTATCGCCTGGCGATCAACGAAAACTTTGACGAC
+TATATTCTGGGCGGTCGTAGTCTTGGGCCATTCGTGACGGCATTATCGGCGGGTGCGTCGGATATGAGCGGCTGGCTGTTAATGGGGTTGCCGGGCGCTG
+TTTTTCTTTCCGGGATTTCCGAAAGCTGGATCGCCATTGGCCTGACATTAGGCGCGTGGATTAACTGGAAGCTGGTGGCCGGGCGGTTGCGTGTGCATAC
+CGAATACAACAATAACGCCTTAACACTGCCGGATTATTTCACCGGGCGCTTTGAAGATAAAGCCGCATTTTGCGCATTATCTCTGCGCTGGTTATTTTGC
+TGTTCTTCACCATTTATTGCGCTTCGGGCATTGTGGCAGGCGCGCGTCTGTTTGAAAGTACCTTTGGCATGAGCTACGAAACGGCTCTGTGGGCGGGCGC
+TGCGGCGACGATCCTTTACACCTTTATTGGCGGTTTCCTCGCGGTGAGCTGGACTGACACTGTACAGGCCAGCCTGATGATTTTGCCCTGATCCTGACGC
+CGGTTATCGTCATTATCAGTGTCGGTGGCTTTGGTGACTCGCTGGAAGTGATCAAACAAAAGAGCATCGAAAACGTTGATATGCTCAAAGGTCTGAACTT
+TGTTGCCATTATCTCACTGATGGGTTGGGGCTGGGTTACTTCGGGCAGCCGCACATTCTGGCGCGTTTTATGGCGGCGGATTCTCACCACAGCATTGTCC
+ATGCGCGTCGTATTAGTATGACCTGGATGATCCTCTGCCTGGCAGGGCGGTGGCTGTCGGCTTCTTTGGGATTGCTTACTTTAACGATCATCCGGCGTTG
+GCTGGTGCGGTAAATCAGAACGCCGAGCGTGTGTTTATCGAACTGGCGCAAATTCTGTTTAACCCGTGGATTGCCGGGATTCTGCTGTCGGCAATTCTGG
+CGGCGGTAATGTCAACCTTAAGTTGCCAGCTGCTGGTGTGCTCCAGTGCGATTACCGAAGATTTGTACAAAGCGTTTCTGCGTAAACATGCCAGCCAGAA
+AGAGCTGGTGTGGGTAGGGCGTGTGATGGTGCTGGTGGTGGCGCTGGTGGCGATTGCGCTGGCGGCAAACCCGGAAAACCGCGTGCTGGGCTTAGTGAGC
+TACGCGTGGGCAGGCTTTGGCGCGGCGTTTGGTCCAGTGGTGCTGTTCTCGGTGATGTGGTCACGCATGACGCGTAACGGTGCGCTGGCGGGGATGATCA
+TCGGTGCGCTGACGGTTATCGTCTGGAAACAGTTCGGCTGGCTGGGACTGTACGAAATTATTCCGGGCTTTATCTTCGGCAGTATTGGGATTGTAGTGTT
+TAGTTTGTTGGGTAAAGCGCCGTCAGCGGCGATGCAAAACGCTTTGCCGAGGCCGATGCGCACTATCATTCGGCTCCGCCGTCACGGTTGCAGGAAAGCT
+AAGGGACTTAGCCTGCGGCGGTTTTGTTTGGCTTCAGCAGCGGGTTGCGCTCCCTTAATGTGCCTCGCCATATAAATTGAATGGTGCAGGAGCGCGCAGG
+GCGGCCAATCGCCGCCGCCCCTGCTGTCCCGGCCTTCGGGGAACGCTTCAGCGATTTTGACGCCACCAACACCCGAGCTGTTATTATGTTCCGGGCAAAA
+GTTAGATTTGATAATCGCGGATGGACGAAATTGCTTGATACACCCGCTTATCAGTTTTACATGGAAGCTCTGATGCATTGAGTCTGGACAGTTTTGTCGG
+CTGGATACGGCGTTTACGCGGCATCCGGCAAGAACACATGGTTCTTTGCAAACAATCCCATCTTTCTACCCTGGAATAATCGTTTATATCCCTTGGCATT
+ACCTCTCTTTGTTTACATTCCAACATCATTTTATAAACATTCCGCTTGTGTTTTTCTTTGCCGTAATGATAATCGCTATCACTGCGATTTACTTTTCTTT
+GCATAGATTGACTCAGAAAAACGTTTAAGGGTGGGTGGCATGTTTGTTCCGTTTCTCATTATGTTGCGCGAAGGACTTGAAGCCGCGCTGATTGTCAGTT
+TGATTGCCAGCTATCTTAAGCGTACCCAGCGAGGCCGATGGATTGTGTGATGTGGATTGGCGTGTTGCTTGCCGCTGCGTTGTGCCTGGGCTTGGGTATC
+TTCATTAACGAAACCACCGGCGAATTTCCGCAAAAGAACAGGAACTGTTTGAAGGTATCGTGGCGGTGATCGCCGTGGTGATCCTTACCTGGATGGTTTT
+CTGATGCGCAAAGTGTCGCGCAACGTCAAAGTGCAACTGGAACAGGCAGTCGATAGCGCATTGCAGCGTGGAAATCATCATGGCTGGGCGCTGGTGATGA
+TGGTCTTTTGCCGTTGCAAGGGAAGGGCTGGAGTCGGTCTTTTTCCTGCTGGCGGCATTTCAACAAGATGTCGGGATCTGGCCGCCGCTGGGTGCAATGC
+TCGGTCTTGCTACTGCCGTGGTGCTAGGCTTCCTGCTCTACTGGGGCGGTATTCGCCTCAATCTTGGTGCATTTTTAAATGGACCAGCCTGTTTATTCTC
+TTCGTCGCCGCAGGGCTGGCAGCTGGTGCCATTCGCGCATTTCATGAAGCCGGATTGTGGAACCACTTTCAGGAAATCGCCTTCGATATGAGTGCGGTGC
+TCTCAACTCACTCGCTGTTTGGCACGCTGATGGAAGGGATTTTGGCTATCAGGAAGCGCCGAGCGTCAGCGAAGTCGCCGTCTGGTTTATTTATCTCATC
+CCGGCGCTGGTGGCATTTGCTCTGCCACCACGCGCAGGGGCGACAGCGTCTCGCTCCGCGTAACAAATACGACGCAAACTCTTGCTTAGTTACAACATAC
+TTTAAAGGGATAGTCTCGTCATGACCATTAACTTCCGCCGTAACGCATTGCAGTTGAGCGTGGCTGCGCTGTTTTCTTCTGCTTTTATGGCTAACGCCGC
+TGATGTGCCGCAGGTCAAAGTGACCGTGACGGATAAGCAGTGCGAACCGATGACCATTACGGTTAACGCCGGGAAAACACAGTTCATTATTCAGAACCAC
+AGCCAGAAGGCGCTGGAGTGGGAGATCCTCAAAGGCGTGATGGTGGTGGAAGAGCGGAAAATATCGCCCCTGGCTTTAGCCAGAAAATGACGGCGAATTT
+ACAGCCTGGCGAATACGATATGACCTGCGGTCTGCTGACTAACCCGAAAGGGAAGTTGATCGTCAAAGGTGAGGCAACGGCGGATGCGGCGCAAAGTGAT
+GCGCTGTTAAGTCTTGGTGGTGCAATTACTGCATATAAAGCGTATGTCATGGCGGAAACCACGCAGCTGGTGACCGACACCAAAGCCTTTACCGACGCGA
+TTAAAGCAGGCGATATCGAAAAAGCGAAAGCACTGTATGCACCGACGCGCCAGCACTATGAGCGTATTGAACCGATTGCTGAACTGTTCTCCGATCTGGA
+TGGCAGCATTGACGCCCGTGAAGATGATTACGAGCAAAAGCCGCCGACCCAAAATTCACTGGTTTCCACCGTCTGGAAAAGCATTGTTTGGCGACAACAC
+CACCAAAGGGATGGATCAGTACGCTGAGCAGCTTTATACCGATGTGGTCGATTTGCAAAACGCATCAGTGAACTGGCTTTCCCACCTTCAAAGTGGTCGG
+CGGCGCAGCCGGACTGATTGAGGAAGTGGCAGCCAGCAAAATTAGCGGTGAAGAAGATCGCTACAGCCACACCGATCTGTGGGATTTCCAGGCTAACGTT
+GAAGGCTCGCAGAAAATTGTCGATTTGCTGCGTCCACAACTGCAAAAGCCAACCCGGAACTGCTGGCAAAAGTCGATGCCAACTTTAAAAGGTCGATACC
+ATTCTGGCGAAATACCGTACTAAAGACGGTTTTGAAACCTACGACAAATTGACCGATGCCGACCGGAATGCACTGAAAGGACCGATTACTGCGCTGGCGG
+AAGATCTGGCGCAACTTCGCGGTGTGCTGGGACTGGATTAAGCGTTATGCAGTATAAAGATGAAAACGGCGTGAATGAACCGTCACGCCGACGTTTACTG
+AAAGTGATAGGTGCACTGGCGCTGGCGGGAAGTTGTCCGGTCGCTCATGCACAAAAACGCAAAGTGCGCCGGGTACGCTTTCACCGGATGCTCGCAATGA
+GAAACAGCCGTTTTATGGTGAGCATCAGGCAGGATCCTGACGCCACAACAGGCCGCAATGATGCTGGTGGCGTTTGATGTGCTTGCCAGCGATAAAGCCG
+ATCTTGAGCGGTTGTTTCGCTTGTTGACTCAGCGTTTTGCTTTTCTGACTCAGGGCGGAGCAGCACCAGAAACGCCAAATCCGCGCCTGCCACCACTCGA
+TTCCGGCATTCTTGGCGGCTACATTGCGCCCGATAATCTCACCATCACGTTATCGGTGGGTCACTCATTGTTTGATGAGCGCTTTGGCCTTGCGCCACAG
+ATGCCAAAAGCTGCAGAAGATGACGCGTTTCCCCAACGACTCGCTGGATGCGGCGTTATGTCATGGTGATGTGTTGCTACAGATTTGCGCCAACACCCAG
+GACACGGTTATCCATGCGCTGCGCGATATCATCAAACACACGCCGGATTTGCTCAGTGTGCGCTGGAAGCGGGAAGGGTTTATTTCCGATCACGCGGCGC
+GTAGTAAAGGCAAAGAGACGCCGATTAATTTGCTGGGTTTCAAAGACGGCACTGCCAATCCCGATAGCCAGAATGATAAGTTGATGCAAAAAGTGGTGTG
+GGTAACGGCAGATCAGCAGGAGCCTGCGTGGACAATCGGTGGCAGCTATCAGGCAGTACGCTTGATTCAGTTTCGAGTGGAATTTTGGGACAGAACGCCG
+CTGAAAGAACAGCAGACGATTTTTGGCCGTGATAAGCAAACCGGTGCGCCGCTGGGAATGCAGCATGAGCATGATGTGCCTGATTACGCCAGCGACCCGG
+AAGGAAGGTGATCGCGCTGGACAGCCATATCCGGCTGGCGAATCCCCGCACGGCGGAGAGTGAGTCCAGCCTGATGCTGCGTCGTGGCTACAGTTATTCA
+CTGGGCGTCACCAACTCCGGGCAACTGGATATGGGGTTGCTGTTTGTCTGCTACCAACACGATCTGGAAAAAGGCTTCCTGACAGTACAAAAAGGCTCAA
+TGGCGAAGCGCTGGAGGAATACGTTAAACCTATCGGCGGCGGTTATTTTTGCGCTGCCGGGGGTGAAGGACGCGAACGATTATTTCGGAAGCGCGTTATT
+GCGGGTTTAATGTTTTTAGGCGGATAAGGCATTTGTGCGCAGATGCCTGATGCGACGCTTGCGCGTCTTATCATGCCTACAATCAGTGCGGGTTTGGTAG
+GCTGGATAAGGCGTTCACGCCGCATCCGGCGATCGTGCACTGATGCCTGATGCAAATCCTGCTGAAAGCACACAGCTTTTCATCACTGTCATCACTCTGT
+CATCTTTCCAGTAGAAACTAATGTCACTGAAATGGTGTTTTATAGTTAAATATAAGTAAATATATTGTTGCAATAAATGCGAGATCTGTTGTACTTATTA
+AGTAGCAGCGGAAGTTCCCGGCAGTGATAGTCAGTCACTATGGAGATCGCGGATGGTAACGTCCTGTACTGGACATGTTTTAGATAATCAACGCGCCACC
+ACTCGCGGAGTTTTCTCCTCCGGTAGTCATCTCGTCACTTTGCATTTTCAACCTCATCCTTTCTTTTCATGTGTTACCGACGCCGTAAACGGTGCGCGTA
+GCCGTTTTTCGGCATTTTATCCAAAAGCAAACTATGGCTTACAAGGAAGCCAACCCTCTGATGTTCGTGCGCATAATCGCGCTGCCAACGGCGCGTGTGA
+TGAATACAAACAACTCAAGGTGCTCTCCATGGGAAGACAAAAGCAGTGATCAAAGCTCGTCGCGAGGCAAAACGTGTGCTGAGACGGGATTCGCGCAGCC
+ATAAGCAGCGTGAAGAAGAATCGGTCACCTCGCTTGTGCAGATGGGCGGCGTAGAAGCCATTGGTATGGCCCGCGACAGTCGCGATACTTCGCCCATCCT
+CGCGCGAAATGAAGCGCAATTGCACTATCTGAAGGCTATTGAGAGTAAGCAGCTGATATTCGCCACGGGCGAAGCCGGGTGCGGAAAAACCTGGATCAGC
+GCAGCAAAAGCGGCAGAGGCCCTGATACATAAGGATGTCGACAGGATTATCGTCACCCGTCCAGTTCTGCAAGCCGATGAAGATCTTGGCTTCTTACCTG
+GAGATATCGCAGAAAAGTTTGCTCCTATTTTCGCCCGGTCTACGACGTGCTGGTCCGGCGCTTAGGGCTTCCTTTATGCAGTACTGCCTGCGACCGGAAA
+TAGGGAAGGTGGAAATTGCGCCGTTCGCCTATATGCGTGGACGTACCTTTGAAAATGCAGTCGTCATTCTTGACGAGGCGCAGAATGTGACTGCCGCGCA
+AATGAAAATGTTTTAACCCGCCTCGGGGAGAACGTGACGGTTATCGTCAACGGTGATATCACGCAATGCGATTTGCCTCGCGGCGTGTGCTCCGGATTAA
+GTGACGCGCTGGAACGTTTCGAAGAAGATGAAATGGTTGGGATCGTCCGGTTCGGTAAAGAGGACTGCGTACGTTCGGCACTTTGCCAACGTACGCTGCA
+TGCCTACAGTTAAGTGTGTTATCGGTGCAGAGCCCGGGCGAACCGGGCTTTGTTTTGGGTGTTTATGCCCGGACTAGCGCTTTTTCTGAAACAACCATTT
+TATTTGCCCTGGCTGGTGAAGTGTACGCTCATCCTGTGGCTTTTTGTAGTTGCTGATAGAGCTCATCAGGTATTGCTAAGCTCTCTGCATATTCTTGCGG
+CGTATATTGGTAGGCTGCATGATGCTGCTGTTTTGAAAACGCAGCTTATTGTACAGCGCCCAGACAATTAACACGACGGCATTCGCCACTGCCAGCAAAA
+ATAGAACTGAAGTCGGCTTCTGGCCTCGCTTTGCCAGTAATAACCCGTCAGCAGATCCATGGCGAATAAGAATATGAACAACGCAAATAATGTCCACAAG
+ATGGTTGTGGCAACATAATCAACCAGTAAACGTACTGGTGATTGTCGGGTCGTAATAATTAAATTGTTCATATTAACCTCTCAGAATCCCGCGATCGGGA
+CTTACCCAACGGGCGCGTTGCTTTTAGGCATCAACATGACTCGTGTAAATGATACCAATGTCGTTGCCAGGCTCAGCATCCAGAAAATAACCGGGAACCA
+AATAATCCAGAAAAGCGATGAAGTCAGATTATGCTCATAGCGATTCTCGATCATCAGGCTGACAATAAATTGCAGTAAACATAACGTACACAATAATATT
+CCGGCAGTATGTGTCGCAGCGATATGTGTCAATTCAATATTTAACGGTACACCGGCAAGTTGGACTGCGTAAATAATGAAACCGACCAGGCAGGTGAAGG
+CCCATATTGTCGTCAGGCAGTATTCAAAAACAGCGGCCACATTCGAAAGTTTTCTTTGCGCCACAACCTTGTCATATTTTTGAGGAATACTTCTGCACCG
+CCCTGAGCCCAGCGCAGGCGCTGTTTCCACAGCCCTTTAACGTTTCAGGCATTAATATCCAGCACAGTGCCCGTGGCTCGTAAAAATCGTCCACTGATTC
+AACTGCAGCTTCCAGCTAATATCAATATCTTCGGTGATCATATCGTCACTCCAGTAACCCACTTCTGCCAGGGCGCTGCGACGAAATGCGGCAATAACAC
+CGGAAACGGTAAATACGTTTCCATAGATACGCTGGGTTCGCTTGATCAAACCAATAATTGAGGAATACTCGCCAACCTGAATTTTACCCACCAGGGTAGA
+ACGTGTTCGAATACGAGGATTACCGGTTACGGCACCCACACGCGGGTTGTACAACATCGGTTCCACAATATATGCCGCCGCATCGCGGTCTAATAACGCA
+TCGCCATCAATGCACACCAGATATTCACTTTTCGCCGCGGCAGCTCCGGTTTTAAGCGCAATGGCTTTCCCTGGTTTTGCGCCAGATGAATGACCCGCAA
+ATGGGGAATTTGTGCAGCCATGCGATCCAGGATGGCACGGGTTTTATCTGTTGAACCGTCATTTACGGCAATAACTTCAATGTTCTCATAACGCTGTGCT
+AAAGCGGCGTGTATGGTTTCCTCAACGTTTTCTCCTCATTAAAACAGGGAATGATAATGGAGATAGACGGATTATCTTTCAACTGGGGAGCTGGTGCGTT
+TTCTCCCCACGGCCAGTGGCGTTCACGATAGACCCAGAAATAGACGCCGCCAACAATCCACATAATGGACATAAAAACGGCCAGAAGAAAACGAACCTCA
+TCATCAGTTCACCAGAGTGAAAGTACGCTACGCATAGGGGTATGCATAACACCAGACATAATATAAAAACGATACGATGCGATTAATCATTTTTCGGATA
+CCAGGCTGTTGAAAACTCAGGACGAATAAGGTCTATTTCAGGTTGGTTATGCAGAAAATTGTCGGGATAATAACCATAGTTTTCACTCCATTCAGTTGTA
+ATAGGCTCATCCAGTGAGCGAGTTGTTGCGAAGAAATAGCCTGATGCTGACCATTTTTCTGCCAGTTTTGTGCCTGTAATTCTAAAATAGATTTGTCTTT
+AGCCTGAGGGATGTTTTTAATTTGATTGGTCAATTGTATTAACCATTGGTCAGCCGATTTTTCTGCGACACCTTCCAGATAAGGCATAGCCATAATAGCG
+GTCCAGTCATAGCTTTTAGGAAATCAGCATAATTCTGTGCAAACCAGGCTTCACTTTCAGGTTGTATTACCGGAAGTGCAAAAATATTTCGTGCAGTTTT
+AATATGTGGACCGCGAATGGCTTTTACGCGCGCACTAAGTTCTAAAGTGAAGTCAGTTAACGCACGACTTTTAAAGCGGGCCCACTGTTTAAATTGCTCC
+GGGTTTTGTCGAATTTCGCTCAGACTCCCGCTAAAGCCTGCTTGCTGATAAGCCGTGATAGCCGGTGCACTGGCATCTTCATAATCTGAAAGCAAAGCAT
+CATCGTGGAACAATATGCCATCAAAAGCAGCATGTCCGGCAAGATCTTCATATAACATGCCAACTTGTGCTCTGACTCTGTCATCGAAAGGAGAGAGACG
+GTGATATTGTTCAGGATGAATTTGTGCTTTTTCTCCCTGTTGGTAAGTATTTTACTCGCGTTAATGTGGGATCTAAATCCCAGCTTAATACCGGCATCCA
+CGCATAGATGTTTACACCTGAGCGGGTACGTAATTGCCAGGCAACCCGACTAAAATATCTGCTTTCATTGGTAGCAAACGATTTGGAAACCAGACCTCTT
+TGACCAGCCCATCACCATCGGGATCAGCAAATGCCTGCAAATACACGGTTGATATTTGCATATCTTTCACCCGCTGAATTAGCACATCAATATTGCGATC
+CATTTGCTGGAGGTTTTCGTCATAAACGTAATCAAGATCGATATGCATTATCCGTTGTGGTGATTTTTCCTGTACGGTAATAATTTGCTGGGCAAACTCT
+TTTAATGAGGATTATTGGCGATTAATACCCGCGGAATGGAATCAATTGCGACGCATTTGCCAAACCTGATTCAAGGGTGAAGAACATGTCATAACCGAGT
+TTTTAATTCCTCTATCGCTATGCCATTCGCTTCGCCATAAGGCCAAACAAAACGTGTGGATTTACCTCAACCTTTGTACGCAGGTATTCCGTCATTTTAC
+AGCATCCAGACGAATTCTTTCCCGGTATTCTGCTGCGGTTTCATACCGTGCGTGGTCAGTAAAATATGCACGATTTACATATACAGGCAATAAGCTGCCG
+GTGGCATTAGCCTGAATACCGTAGTGAGAATTCCATGTATGAGAAGCGAGCTCAACGAGCCGGGAACGCGCAACTTCTCGCACTTGTTGCCACGTGGCAA
+AATATTCTCGATCGACCAACTCATCGCCAAATTTTACTTGTTTATCCGCTGGCGTATCGACCCAACTGCCGACGGGGCCCATACAGCAGGCCACTGGAAG
+GCCTGAAGAATTGGGAAGACGCGGGTATAAAAACTCTGGTAGCCGTCATCAAAGTCAGCACTACAGCTTTTTCCGGTAGCGGTTTTCCTCCTCGATGTGC
+TTCACGAATTTGAGCAATACTGACCGGTTGATAACCGTTCTCGCGCAGCCAGGCAAATTGTTCACGCAGTGCTGATGTCCGCACTGACATAAAACGCTGG
+TCGGCAGCTTCGTCTTCAACGTTATGCCATGAAATCGCTACAAAACCATTATGCGGCCACGGTTGCTCGGCGAGTAAAGATTCGCGATCCTGTGGCGGTA
+TAAATGATGTTCTTGACTGGCTAATGCACGCGGTGAGCATAATTATACTCACCAGCATCAGGAGATATTTATTTCCATTACGTAACATATTTATCCTTAA
+AATCTGAATGTCATATCGAATTCAACGTATAAGTTGTGTTCTCTGTCACCGTCATAAGGTCGTTTTCCCAGCGTAGCGTTGCGCCAGCATCAATCACGTC
+ATTCCAACTAATGCGTTGCCCGTAGCCGAGTTGGGTGACGACATCCGTGCCATAATGTTTTGCCAGGAGGCACCAACACCTGCGCTGAATATTTGCTCCC
+AGCTATTTTCATAGCTTCGCCATAACAAATGGCTTGCCTCAAATGCCGGAACAATATCGAACGTTTTTATAGGGTTGTAGTATGGGGTATCGTGTTCTGT
+ATTTTGTTCGTAATACAGACTGGGTAGGAAATCGACAATCAAATATGGTGAAGACCAGATGCGTTCCTGACCCTCAAGTGAGACTTCATGACGCTGGTTA
+CTGTCGGAAAAATCAGTGAAAGCCCAGGAGACACCGTACTTACGCCGCTCATTTTGATACCAGCGAACATAAGCCTGAGCACTGTTGCCTGTAACACCAT
+TTTTCATTGCCCGTAATGGAACGCGGTGAGAGAGGCGTTCCAGTTGCGAACCAATACGCCAGTTATCATTAAAATCATACCAGCCAGACAGGCGCGCGCC
+GGGTTTATGCTCATGATTGAAAACGCGTTCAGCGTACTCTGCCTCGAGCCAGATATTACGTGACCGCCACTCAACACCCGCAAGCCAGTCGCGAACAATC
+CCTTTTCCTTCGCTAAATTGTCCATCGGCATAACCGAATCCAGCAAAACCGCGCCAGTTATCCTTCAGCGGTGGTGAATAAACGATGGTGGTTAAGTCGA
+CATCATGTTTACCACTATCCGGGCCTTCGGCATCAATTCCTGTTGAGCCAGCGATACGAAGCTCTGCAAGATTATGTACATCAACCGCACGTTTTAATCG
+TACAACGCCGGGATCTTGCGGTTCACGTTCGACAACATCGTGCGTTAAGACAGCTGCCTGCTGCCATTCTTGTAACGTTAATGCTGTCCAGGCTTGTTCA
+ACCTCCAGATTAATATTACGTGGCTCGATCACTTCTGCTTTTTAATTCATTTTCTGCTGCACGAGGCCAACCGCGGGCTTGTAACACACTCGCGTAATCA
+ATGCGCAGTCCCTGATTTCCTGGTGCGTTATAAGCAAGCTCTCTGGCTGTCATTTCAGCCTGAGGAAGATCATTACTATATTTTGCTACGGTTGAGAGAA
+ACGAATGCCCTGTAACCAGGTATCATTCGGGATGCTCGTAGGCGTGCCCATTAACCGAAGGAAAGGCGGCGAAGTATTAATGGTATGTTGGGTGACAGTT
+AGCGCGCCCGGATAATTTTCACTCTCCAGGTGGCTGTAAAGAGATCCGCAAGTTCTTCATCGGATAAATCCGGGGCAATGGTCTCCTTGTGATAAAGAGC
+TCGGTCATTATTGACTGTGCTTTTTCGGCTGATGATCTTTGAGATAAGCCGATGCAACCCAATATTGCCCCAGGGCGGAATAATTTGCCCCGTCTTTTTA
+ATCGCTGATAGTGAGAAATAACGTCTTTATAACGATCGCGAGTTAATAACGCGCCAAGATGATCAACCTGAATACGCTGGTACTGGGCAGTGCGGTCTGG
+GTTATCGTGCCACAGAATTTCTAATGCAGCGTATTGGGCGAGGGCGCGATCGGCAATGGCATAACGTTCACTTTCACTGCGCGTAGGCATAAACGACAGT
+CTGACCAGTTCGGCATGAATATCAGCGCGAATATCTGGCGTTAAATTGGCATCGTCAATCGCGGCAGCAAGTTGATTATTACGTAATGCCTGCACGTATT
+CTGTGGGATATTGTTGCGTAGATGCATTTTCAGGTAATGACTCTGTCATCGCCCGTAATTCATCCTGATGACGCCCCGCCAGTTTATAGATATAGGCTTC
+TGCGAGTAAATTGGCTTTGTCCGGTGCTCCAGAGTTAAGCTGCTTAAGTTTAACCAGCGCAGTATCATAGTGACCAGCATCTGCCAGGGTTAAAATTTGT
+CCCCGTTGATAATCCTTATTTTGCGGCTCCAGAGAGCGCCTTTTGCCACAGTGTAAGCGAGTTTTGCCATTGTTGCAGGTTACGATAAGCGACGGCGACA
+GCTGCATAACCACGCGCTGGTAATTGCTGATGACGGTAGCGGTTGTAAACGGTAATAACCTGTTTATCTTGCCCGGCCCATAAGGCAATCTGTAACCAGT
+CAGCAATTTGGTTATTGCTGAGTGCTGATTTTAGTGCAAACCATGACAAAGCTGGCTGAGTATTACCCTTGCGAGCTTCAATAATCAATGCATCATAGGC
+GTTATTAACAGCACTCTTCGCCGCGGGACTCGCTGCTAAAAATGCGGCAGTAAGAAGTTTCAAAGCCCATTTGGTTTTCGGGCACCTTTTTCTGCTACTT
+GAATACATCCTGTATTACTCCATGTATTGCCAAAATCTCTCTGTATCTAATTACAGGTAACTGAAAAGAAAGATATTTTTGCACCTCATAATCCGTTATT
+AAACGCGGAAGAGAGACGTGAATTGTTGATGATGAGAAGAAGAAATGATGAGCAGAGTGTCCATATAAAATCCTTTTCTCGCCCGAAAATCCATTCCAAT
+GATGAGGATCTTCAGGAATACGGCATAAATCCCAATGCCTTTTTCAAAATAAATTAGGATTAAAATAATTAAATCAGTAAATTCCGATGCATGATTTCGG
+ATTTTCGAAAGTCCTGATGAAAGGCTGCGCTACGGCACTCACGGATTTAATTGTTATTCCTAATGTATCTATGAATTAATGTTTTATAAGGATTTTCTAT
+AACCATTTATAAGTATTTTCAAGCCTGGCTTGTTGCAAACAATGTATAAAGCACTTAGGCAATAATAATTACATTCAGCAACTATCATCATCGGTATTGT
+TTGTGGGCGGAATTTCATATTGACAACAGTACAGTTCTTATATCTATTAATAATAGAAAGGGATCTACAACCTACAGATTGGTGTAGCTTTATGGAAAAA
+GACTATTTGAGAATTAGTAGTACTGTATTAGTGAGCTTATTGTTTGGGCTTGCTTTGGTTTTGGTGAATAGTTGGTTTAATCAGCCAGGCGTTGAGGAAG
+TTGTTCCACGATCAACCTATCTGATGGTAATGATTGCTTTATTTTTATCGATACTGTTGCATTTATTTTTATGCAGTTGTATTTCATTTATGACCGTAGG
+CAATTTTCAAACTGTGTACTTAGTTTGGCTTTTCTGAGTTGTTTGATTTACTTTGTTATAACCGTCATTATCATTCAGCAAATTATTGAGGAGCGTTTGA
+CAAGCAGTGTTGTCCAAAATGACATTGCAATCTATTATTTGTTTCGTCAGATGAGTTTGTGCATATTAATATTTCTGGCATTGGTGAATAAAGTTAGTGA
+AAACACAAAACAGCGCAATTTATTTTCCAAAAAATGACTTTGTGCATAAGTTTGTTTTTGTTTTGGGGGCCGATAGTTGCTCACATACTTTCTAGTCATT
+ATGAGAGCTACAATTTACACATTGCCGAGTTAACCAATGAAAATGGTCAGGTGGTTTGGAAAGCCTCATATGTTACCATAATGATTTTCATGTGGTTAAC
+CTTGCTTTCGGTTAATCTATACTTTAATGGTTTACGCTATGATATCTGGAATGGAGTGACGGTGATTGCTTTTGTGCCGTACTGTACAATATCTCTCTGT
+TATTTATGAGCAGGTATAGCGTGTCCACTTGGTATATTAGTCGCACTATTGAAGTAGTCAGTAAGTTAACCGTTATGGTAATATTTATGTGCCATATATT
+CAGTGCGCTACGAGTAACAAAGAACATTGCACATCGCGATCCCTTAACCAATATATTTAACAGAAATTATTTTTAATGAACTGACAGTTCAATCAGCATC
+AGCCCAAAACGCCTTATTGCGTCATGATTATGGATATCGACCACTTCAAAAGTCAACGACACCTGGGGCATCCGGTTGGCGATCAGGTGATAAAACAGTG
+GTGAATATCATTGGGAAAAGCATACGACCAGATGACCTTTTAGCGCGCGTCGGCGGCGAAGAGTTTGGCGTCTTGCTGACGGACATCGATACTGAACGTG
+CGAAAGCTTTAGCGGAAAGGATTCGGGAAAATGTTGAGCGTTTAACTGGCGATAATCCTGAATACGCTATACCACAAAAAGTGACGATTAGTATTGGCGC
+TGTTGTGACTCAGGAAAATGCGTTAAACCCAAATGAGATCTATCGACTGGCTGATAACGCACTTTACGAGGCGAAAGAGACCGGGCGTAATAAGGTGGTT
+GTGAGGGATGTGGTGAATTTTGTGAGTCACCATAAAGCGGCATTTTGATCCTACCCACGTAATATGGACACAGGCCTAAGCGAGGTTCTTGTTTTCAAAT
+TGTTCCGGACTGAGGCCGCCACACCAACTGTGCCGCCGCCACCGATTGTAATCACATTCGATATAATTAAACACCGTTGCCCGCATTATTTCCCGGCTGA
+TAAAGTGTTCTCCATGGATACATTCCACTTTCAGCGAATGAAAGAAGCTTTCCACGCAGGCATTATCGTAGCAGCAACCTTTTGCGCTCATACTTCCACG
+CAGATTATGCCGCTTCAGTTGCGCCTGATAATCTGCTGAACAGTACTGGCCTCCACGGTCCGTGTGAACGATAACGTTCCGGGGCCTCTTACGCCGCCAC
+AGCGCCATCTGCAGGGCATCGCAGGCCAGTTGCGCCGTCATGCGTGGCGACATTGACCAGCCAATAACGGCACGTGACCACAGGTCAATGACCACTGCCA
+GATACAGCCAGCCTTCATCTGTACGTAAGTACGTGATGTCTCCTGCCCACTTCTGGTTCGGGCCACTGGCGTAAAATCCTGCTCCAACAGATTTTCTGAC
+ACAGGCAGGCCGTGTGCGCGGTAGCTGACCGGGCTGAACTTCCGGGAGGCCTTTGCCCTCAGTCCCTGACGGCGCAGGCTTGCCGCCACGGTTTTACGTT
+AAAGGGTAACCCTGAGCACGCAGTTCATCCGTCAGGCGTGGGGCACCGTAACGCTGTTTTGACCGGGTAAAAGCCGCGAGGACAACGCTGTCGCAGTGTT
+GGCGGAACTGCTGACGCGTGCTTATCCTTGTCCGCCGCTGACACCACGTATACCAGCCGCTGCGGGCCACCCGGAGCACGCGGCACATTGCTTTGATGCT
+GAACTCAGCCTGATGTTTTCAATAAAGACATACTTCATTTCAGGCGCTTCGCGAAGTATGTCGCGGCCTTTTGGAGGATAGCCAGCTCTTCATCCCGTTC
+TGCCAGCTGGCGTTTGAGACGTGCAATCTCGGTAGACATCTCCAGTTCACGTTCAGAAGACGTCTGCTGATTTTGCTGTTTACTGCGCCAGTTGTAGAGT<