changeset 2:be717b65851f draft

"planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/nanopolish commit dff183f4eb2d3df42917ec4fed0fbdb2ea11e19a"
author bgruening
date Fri, 29 May 2020 13:30:45 -0400
parents 449e9aeded2d
children 850347f034de
files macros.xml nanopolish_polya.xml test-data/all_fasta.loc.test test-data/methylation_calls.tsv test-data/polished.fa test-data/t2-polished.fa test-data/t2-variants.vcf test-data/t3_polished.fa test-data/t3_variants.vcf test-data/t4_polished.fa test-data/t4_variants.vcf test-data/variants.vcf
diffstat 12 files changed, 68 insertions(+), 13299 deletions(-) [+]
line wrap: on
line diff
--- a/macros.xml	Sun Jun 23 05:45:17 2019 -0400
+++ b/macros.xml	Fri May 29 13:30:45 2020 -0400
@@ -1,7 +1,8 @@
 <macros>
+    <token name="@VERSION@">0.13.2</token>
     <xml name="requirements">
         <requirements>
-        <requirement type="package" version="0.11.1">nanopolish</requirement>
+        <requirement type="package" version="@VERSION@">nanopolish</requirement>
             <yield/>
         </requirements>
     </xml>
--- a/nanopolish_polya.xml	Sun Jun 23 05:45:17 2019 -0400
+++ b/nanopolish_polya.xml	Fri May 29 13:30:45 2020 -0400
@@ -1,4 +1,4 @@
-<tool id="nanopolish_polya" name="Nanopolish polyA" version="0.11.1">
+<tool id="nanopolish_polya" name="Nanopolish polyA" version="@VERSION@+galaxy0">
     <description>- Estimate the length of the poly-A tail on direct RNA reads.</description>
     <macros>
         <import>macros.xml</import>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/all_fasta.loc.test	Fri May 29 13:30:45 2020 -0400
@@ -0,0 +1,1 @@
+draft	draft	draft	${__HERE__}/draft.fa
\ No newline at end of file
--- a/test-data/methylation_calls.tsv	Sun Jun 23 05:45:17 2019 -0400
+++ b/test-data/methylation_calls.tsv	Fri May 29 13:30:45 2020 -0400
@@ -1,316 +1,4 @@
 chromosome	strand	start	end	read_name	log_lik_ratio	log_lik_methylated	log_lik_unmethylated	num_calling_strands	num_motifs	sequence
-tig00000001	+	191153	191157	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-6.31	-130.59	-124.28	1	2	TATTACGACCGCTGA
-tig00000001	+	191181	191181	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.75	-101.63	-100.88	1	1	TTTGGCGTTGA
-tig00000001	+	191196	191215	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-11.45	-223.51	-212.05	1	3	CAGTGCGGCAAACAGCGGATAGAACGGGCT
-tig00000001	+	191229	191229	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-5.42	-101.51	-96.09	1	1	GGAGGCGTGCA
-tig00000001	+	191244	191244	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.28	-82.87	-80.59	1	1	AAAGGCGTTGT
-tig00000001	+	191255	191273	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-9.25	-167.61	-158.35	1	3	TCATGCGTTTGTGCGGTACATAACGCTGT
-tig00000001	+	191354	191354	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.06	-98.18	-94.12	1	1	GATTGCGTAAC
-tig00000001	+	191369	191374	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.70	-119.73	-118.02	1	2	ATACCCGGATCGTTCT
-tig00000001	+	191399	191420	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-14.84	-212.15	-197.31	1	4	AACAGCGGCGAACAGTCCGCCATCATCGGAAT
-tig00000001	+	191440	191440	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.39	-97.48	-95.10	1	1	ATAGCCGACCC
-tig00000001	+	191502	191524	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-7.13	-196.90	-189.78	1	5	CTTGGCGGGCGTTATAAATCGTACCGTCGTAGG
-tig00000001	+	191548	191562	d57afb7d-903e-46cf-a43d-0e17fb0949d8	2.03	-164.90	-166.93	1	3	CACAGCGAGGCGGAAAGGACGAGCC
-tig00000001	+	191576	191595	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-16.47	-198.51	-182.04	1	5	TTGCCCGCTGCGGTGCGACTTCCGCGATCA
-tig00000001	+	191606	191606	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.43	-106.24	-105.81	1	1	GCTCACGCAGG
-tig00000001	+	191632	191632	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-5.03	-101.77	-96.74	1	1	CAGTGCGCATC
-tig00000001	+	191646	191646	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.52	-102.26	-101.75	1	1	GCCACCGATAA
-tig00000001	+	191659	191671	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-6.16	-155.98	-149.82	1	3	CCATACGGGTTACGTGCCGTTTC
-tig00000001	+	191686	191686	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.12	-84.86	-83.73	1	1	TAAACCGGTGT
-tig00000001	+	191710	191715	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.66	-141.17	-139.51	1	2	AGCAACGCTCCGTGGT
-tig00000001	+	191741	191741	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.49	-76.49	-74.01	1	1	TATTGCGATCA
-tig00000001	+	191764	191764	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.28	-106.49	-104.21	1	1	TCACCCGGTGT
-tig00000001	+	191778	191778	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-8.95	-111.16	-102.21	1	1	CAGGGCGTTTA
-tig00000001	+	191820	191820	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.97	-129.21	-127.24	1	1	TAAAACGAAGT
-tig00000001	+	191835	191835	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.83	-101.24	-100.41	1	1	TTTATCGGCAT
-tig00000001	+	191854	191854	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-3.07	-94.72	-91.65	1	1	TTTGCCGCATG
-tig00000001	+	191878	191886	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-11.48	-176.19	-164.71	1	3	CATGGCGCGCCTTCGTGAA
-tig00000001	+	191901	191919	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-5.54	-179.90	-174.37	1	5	CAGATCGCCCATCGCTACGTCGGCGTTGC
-tig00000001	+	191931	191944	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-19.26	-177.78	-158.53	1	3	CAAGTCGGCACGGAACAGCGCCTC
-tig00000001	+	191977	192002	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-8.41	-244.04	-235.63	1	6	TTCCCCGCCGGATGGCGACGGAAAATTCGCCGCCCT
-tig00000001	+	192027	192029	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.80	-105.66	-104.86	1	2	TCAAACGCGCTGT
-tig00000001	+	192053	192064	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.40	-160.39	-157.99	1	3	ATAATCGACCAGTGCGCGGAAG
-tig00000001	+	192079	192079	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-7.16	-99.97	-92.81	1	1	GTGGGCGCAGT
-tig00000001	+	192107	192107	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.87	-96.22	-95.35	1	1	GGCAGCGGTTT
-tig00000001	+	192121	192121	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.94	-100.94	-100.00	1	1	ACTGGCGACCA
-tig00000001	+	192136	192146	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.34	-143.10	-138.77	1	4	ATTCTCGTCGCGATTCGCAAT
-tig00000001	+	192165	192172	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-7.29	-148.02	-140.72	1	2	ACACCCGAAATACGGGGC
-tig00000001	+	192188	192196	d57afb7d-903e-46cf-a43d-0e17fb0949d8	0.17	-154.51	-154.68	1	2	CTCTGCGGGTACACGTTCT
-tig00000001	+	192225	192225	d57afb7d-903e-46cf-a43d-0e17fb0949d8	2.26	-103.77	-106.03	1	1	AATACCGGGAT
-tig00000001	+	192240	192266	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.96	-234.92	-233.96	1	4	TAACCCGTGGCATCGATTTCATCGAGTTTTCCGCATG
-tig00000001	+	192278	192285	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-6.13	-137.22	-131.09	1	2	AACATCGTTGAGCGATAA
-tig00000001	+	192300	192316	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.51	-193.07	-191.56	1	3	ATTGCCGCCACATCGATATTACGACTT
-tig00000001	+	192343	192348	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.41	-136.59	-135.18	1	2	ATTCTCGCTGCGTGGT
-tig00000001	+	192363	192363	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.06	-104.78	-103.71	1	1	CAGTCCGGGCA
-tig00000001	+	192381	192381	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.53	-89.42	-88.89	1	1	CTAACCGCAAT
-tig00000001	+	192444	192444	d57afb7d-903e-46cf-a43d-0e17fb0949d8	0.25	-81.86	-82.11	1	1	TTTCTCGAATG
-tig00000001	+	192456	192465	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.84	-159.56	-154.72	1	3	GAAATCGATCGTGCCGGAAA
-tig00000001	+	192485	192485	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.80	-122.30	-119.50	1	1	TACCCCGCTGA
-tig00000001	+	192583	192583	d57afb7d-903e-46cf-a43d-0e17fb0949d8	2.93	-110.32	-113.25	1	1	CACTGCGGAAT
-tig00000001	+	192631	192631	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.05	-108.70	-104.65	1	1	CTGTACGCTGA
-tig00000001	+	192649	192649	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-3.96	-101.02	-97.06	1	1	TTAGTCGGTAG
-tig00000001	+	192660	192660	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.70	-111.11	-109.41	1	1	ACTAACGGGCA
-tig00000001	+	192682	192682	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-6.48	-153.07	-146.59	1	1	AAAGTCGAAGC
-tig00000001	+	192693	192693	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.02	-137.09	-137.07	1	1	TATTGCGATGA
-tig00000001	+	192723	192723	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.98	-144.16	-141.17	1	1	TTGTCCGCCTT
-tig00000001	+	192744	192744	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-3.27	-96.25	-92.98	1	1	TAGTGCGGCTG
-tig00000001	+	192815	192815	d57afb7d-903e-46cf-a43d-0e17fb0949d8	0.28	-92.85	-93.14	1	1	AAATACGGTTG
-tig00000001	+	192937	192937	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-5.15	-125.26	-120.11	1	1	AAAGCCGTATT
-tig00000001	+	192951	192951	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.67	-109.13	-106.46	1	1	TATTACGGCTT
-tig00000001	+	193006	193006	d57afb7d-903e-46cf-a43d-0e17fb0949d8	5.67	-298.32	-303.99	1	1	TAAACCGATAG
-tig00000001	+	193019	193019	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-11.73	-121.29	-109.57	1	1	AATACCGGTTT
-tig00000001	+	193039	193049	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-14.40	-214.10	-199.69	1	3	AATGGCGTGGGCGGGCGGGAT
-tig00000001	+	193072	193072	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-3.35	-102.28	-98.92	1	1	TTTGTCGCAGA
-tig00000001	+	193093	193093	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.02	-109.58	-105.56	1	1	AAATACGCAAA
-tig00000001	+	193112	193118	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-9.27	-163.53	-154.26	1	3	GTGTTCGACCGCGTTTG
-tig00000001	+	193149	193149	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.81	-107.68	-106.87	1	1	GCTGGCGCTGG
-tig00000001	+	193168	193168	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.18	-98.19	-94.02	1	1	TTTTCCGGCAT
-tig00000001	+	193187	193197	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-6.41	-169.08	-162.68	1	2	AGCACCGCCAGCAGGCGGAAC
-tig00000001	+	193236	193273	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-21.80	-281.25	-259.45	1	7	CACCCCGGTGAATCACGCGGGCGGCTAAATCGACGGTAACATCGGAAA
-tig00000001	+	193289	193300	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-15.15	-216.62	-201.46	1	4	ACCAGCGGATCGGGCGCGGTGG
-tig00000001	+	193317	193338	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-7.87	-231.84	-223.97	1	6	AGTGGCGGCGTAATGCGACGCGCAGACGGGCC
-tig00000001	+	193351	193351	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.24	-101.33	-101.08	1	1	CAATTCGCCAA
-tig00000001	+	193364	193364	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.12	-92.92	-90.81	1	1	CCAAACGGCTT
-tig00000001	+	193385	193430	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-23.93	-365.36	-341.44	1	9	TCATCCGCTCCGGCATCCAGCGCGGCGATTTTGTCGCTCTTCGCTGCGTGCGGAAA
-tig00000001	+	193446	193454	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.58	-134.21	-131.63	1	3	ATCACCGGCACCGCGCTCC
-tig00000001	+	193465	193474	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.64	-121.51	-116.87	1	3	ACTGGCGCAGGTCGCGGATA
-tig00000001	+	193499	193514	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.56	-164.92	-160.36	1	3	ACCATCGGGCAGGCCGAGATCGAGAA
-tig00000001	+	193537	193545	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-5.94	-137.73	-131.79	1	2	GCTTACGGGTTGCCGCTTC
-tig00000001	+	193559	193574	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.79	-163.43	-162.64	1	4	CAAGCCGCGTTGCAGCGTTTCGGCCT
-tig00000001	+	193586	193627	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-18.60	-323.64	-305.04	1	9	AAAGACGCGCATCCCGTCGCCCTCCAGCGCCGTGCGCAGAAAGCGACGAATA
-tig00000001	+	193658	193658	d57afb7d-903e-46cf-a43d-0e17fb0949d8	0.97	-117.93	-118.90	1	1	CAGAACGTTTG
-tig00000001	+	193720	193720	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.95	-127.43	-122.49	1	1	TAACACGAAAA
-tig00000001	+	193740	193754	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-8.88	-177.02	-168.14	1	4	CCTTCCGGTCGGTTGAACGCGGTAA
-tig00000001	+	193769	193769	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.92	-137.15	-132.23	1	1	GCCCCCGTACA
-tig00000001	+	193783	193787	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.84	-129.85	-129.01	1	2	ACTATCGCCCGACAA
-tig00000001	+	193815	193824	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.16	-139.59	-138.43	1	2	TACCCCGGTACTGCCGACTC
-tig00000001	+	193838	193840	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.69	-98.95	-96.25	1	2	ATTCCCGCGAGCA
-tig00000001	+	193860	193860	d57afb7d-903e-46cf-a43d-0e17fb0949d8	0.48	-134.56	-135.04	1	1	AATATCGTCTG
-tig00000001	+	193878	193892	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.28	-175.73	-173.45	1	3	CCTGGCGGAAGACCGGGGCCGTTAT
-tig00000001	+	193922	193940	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.76	-162.32	-159.55	1	3	ATTTTCGCCCTCAACGTGGGCATCGATAC
-tig00000001	+	193952	193965	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-10.70	-154.90	-144.21	1	3	AATTTCGGCCTGCGCACCCGCATA
-tig00000001	+	193977	193979	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.46	-132.25	-129.79	1	2	TTCACCGCGTTCT
-tig00000001	+	194005	194005	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.34	-85.39	-85.05	1	1	GCACCCGTTCA
-tig00000001	+	194021	194027	d57afb7d-903e-46cf-a43d-0e17fb0949d8	0.05	-149.49	-149.55	1	2	TGGCCCGTCAACGTGGA
-tig00000001	+	194043	194043	d57afb7d-903e-46cf-a43d-0e17fb0949d8	1.50	-119.23	-120.73	1	1	GTCAGCGGTTC
-tig00000001	+	194070	194082	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-10.65	-198.17	-187.52	1	3	ATGGGCGACGATAAACCCGGTTC
-tig00000001	+	194100	194108	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-9.20	-138.38	-129.18	1	3	TGCAGCGCGCTGCCGACTA
-tig00000001	+	194124	194124	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.91	-82.94	-81.03	1	1	TCCAGCGTTAA
-tig00000001	+	194153	194156	d57afb7d-903e-46cf-a43d-0e17fb0949d8	1.97	-131.98	-133.95	1	2	AAAGCCGCCGGACT
-tig00000001	+	194167	194169	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-6.43	-114.11	-107.68	1	2	GAATTCGCGCCAT
-tig00000001	+	194197	194197	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-7.06	-144.53	-137.47	1	1	CCAGTCGGGTA
-tig00000001	+	194221	194228	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-9.56	-144.24	-134.68	1	2	GCTGACGGATCTCGCTGG
-tig00000001	+	194239	194243	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-15.66	-161.01	-145.35	1	2	CCTGGCGGGCGTGGG
-tig00000001	+	194258	194258	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.43	-98.16	-93.72	1	1	TCCTTCGCTTG
-tig00000001	+	194270	194274	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-14.45	-134.14	-119.70	1	2	CAGATCGAGCGTTAA
-tig00000001	+	194304	194317	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-7.69	-195.84	-188.15	1	4	AGCACCGTAAGCGGCGTGCGTAAA
-tig00000001	+	194328	194337	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-12.15	-221.03	-208.87	1	3	TCATGCGAAAGCGCCGCCAG
-tig00000001	+	194348	194353	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.86	-142.04	-141.18	1	2	CAGGGCGTTGCGGATC
-tig00000001	+	194365	194369	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.82	-107.74	-106.92	1	2	GTTCACGTTCGCTTG
-tig00000001	+	194380	194382	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-5.39	-118.38	-112.99	1	2	CCATCCGCGCCTG
-tig00000001	+	194393	194413	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-7.13	-251.77	-244.64	1	4	TTCTTCGCTGGCGGTTAGCGTCAGCCGCTCA
-tig00000001	+	194429	194445	d57afb7d-903e-46cf-a43d-0e17fb0949d8	4.53	-174.56	-179.08	1	3	ATTGGCGACTAACAGCGTAAACGTCTC
-tig00000001	+	194458	194458	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-7.60	-105.49	-97.89	1	1	GCAGGCGCTGC
-tig00000001	+	194469	194469	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.29	-119.66	-118.37	1	1	TGTTCCGGGAT
-tig00000001	+	194485	194485	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.20	-86.11	-85.91	1	1	ACTGGCGCAGA
-tig00000001	+	194496	194496	d57afb7d-903e-46cf-a43d-0e17fb0949d8	1.40	-73.29	-74.69	1	1	TTCCCCGCTCC
-tig00000001	+	194515	194515	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-3.24	-84.19	-80.96	1	1	CAGCCCGTAGG
-tig00000001	+	194527	194539	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-6.27	-169.45	-163.19	1	3	TTTCTCGCCGCTTTTAGCGGCAA
-tig00000001	+	194554	194587	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-11.73	-318.94	-307.21	1	7	TGGTACGGTACACCGGGTAACGTGTCGGTGCCCGCGCCCGCAGG
-tig00000001	+	194617	194638	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.96	-222.53	-220.56	1	5	CACTGCGCGATGGCATCGTCCCACGGCGTCAT
-tig00000001	+	194650	194650	d57afb7d-903e-46cf-a43d-0e17fb0949d8	0.66	-126.20	-126.85	1	1	CCTTGCGGATG
-tig00000001	+	194662	194662	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.27	-96.98	-94.71	1	1	GTTAACGGCTG
-tig00000001	+	194676	194685	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-5.74	-152.45	-146.71	1	2	TTTACCGTTGTCATCGGGCA
-tig00000001	+	194705	194705	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.75	-107.29	-104.54	1	1	GACTGCGGGCA
-tig00000001	+	194716	194716	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.36	-93.50	-92.13	1	1	TGAAACGTGGA
-tig00000001	+	194736	194736	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.34	-89.34	-87.99	1	1	TTGTTCGCTGG
-tig00000001	+	194748	194773	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-19.02	-262.71	-243.69	1	4	GGCAGCGATATCCTGCGGACTGCGGCCCACCGCCAG
-tig00000001	+	194785	194785	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-5.89	-128.85	-122.95	1	1	GCTTTCGACAT
-tig00000001	+	194804	194850	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-28.96	-435.88	-406.92	1	9	AGTGCCGTGTGCGTTGCTCGCGGTAACGGGCTACCCGCGCCTGATAACGCACGCCAG
-tig00000001	+	194868	194868	d57afb7d-903e-46cf-a43d-0e17fb0949d8	0.55	-104.89	-105.44	1	1	GTTCCCGATCA
-tig00000001	+	194880	194883	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-5.07	-113.22	-108.15	1	2	CAGCCCGACGGTTA
-tig00000001	+	194896	194898	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-5.79	-137.39	-131.61	1	2	ATCACCGCGAAGG
-tig00000001	+	194928	194949	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-21.10	-254.35	-233.26	1	6	AGAGACGGCGAGCGTGCCGCGTGGGGCGATAA
-tig00000001	+	194963	194963	d57afb7d-903e-46cf-a43d-0e17fb0949d8	0.25	-105.67	-105.92	1	1	GAGATCGAAAC
-tig00000001	+	194984	194984	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.20	-87.54	-87.35	1	1	AATGACGGTGG
-tig00000001	+	195007	195007	d57afb7d-903e-46cf-a43d-0e17fb0949d8	0.70	-96.51	-97.22	1	1	GCCAGCGTCCA
-tig00000001	+	195021	195021	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.49	-115.53	-113.04	1	1	AATAGCGCCAC
-tig00000001	+	195035	195035	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.38	-91.25	-86.87	1	1	CACCACGCCAA
-tig00000001	+	195065	195075	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-6.43	-169.51	-163.07	1	2	GTTGGCGGCATCAAACGCCAT
-tig00000001	+	195110	195134	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-18.69	-244.99	-226.30	1	6	GATAACGGCGCATAACGCGGCGGCAACCACGCATC
-tig00000001	+	195154	195154	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.76	-123.67	-121.91	1	1	GTACACGCCAC
-tig00000001	+	195175	195206	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-16.71	-312.48	-295.77	1	7	AAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTG
-tig00000001	+	195222	195224	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.86	-138.40	-133.55	1	2	TCAAGCGCGACCA
-tig00000001	+	195239	195264	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-26.95	-243.96	-217.01	1	6	CTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCA
-tig00000001	+	195275	195313	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-19.60	-292.23	-272.62	1	9	GCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAA
-tig00000001	+	195328	195328	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-3.77	-122.19	-118.42	1	1	CTTGCCGAGAT
-tig00000001	+	195342	195359	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-20.22	-267.93	-247.71	1	3	GTTCACGGGCATAACGCACTACCGCTTT
-tig00000001	+	195371	195371	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.83	-132.24	-129.41	1	1	TCTTCCGCTGG
-tig00000001	+	195392	195400	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-10.38	-121.03	-110.66	1	3	GTTGCCGTCTCCGCGCCCA
-tig00000001	+	195413	195427	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-12.09	-195.58	-183.48	1	3	TCCTGCGCCAGACGTAAGGCGCTGA
-tig00000001	+	195441	195460	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.09	-206.14	-204.05	1	4	TTGCCCGACGTTTTTTCCGGTAAGCGGTGC
-tig00000001	+	195489	195500	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.90	-132.50	-129.60	1	3	TACACCGCGTGCCAGACGCTAC
-tig00000001	+	195511	195535	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-24.17	-247.65	-223.48	1	7	CCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACC
-tig00000001	+	195547	195553	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-6.65	-146.89	-140.24	1	2	GTTTTCGCTGCCGGTGT
-tig00000001	+	195565	195565	d57afb7d-903e-46cf-a43d-0e17fb0949d8	0.71	-95.69	-96.40	1	1	ATGGCCGATGC
-tig00000001	+	195581	195590	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-6.45	-176.91	-170.47	1	5	AGGATCGCGTCGCGCGTGTG
-tig00000001	+	195608	195608	d57afb7d-903e-46cf-a43d-0e17fb0949d8	1.28	-100.34	-101.62	1	1	CTCTTCGCCAG
-tig00000001	+	195621	195630	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-16.67	-147.76	-131.09	1	3	TGCCCCGCCAGGCGCGCATT
-tig00000001	+	195646	195663	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-15.28	-271.32	-256.04	1	5	ATCAACGCGATCGGCAGTACGGCGCAGT
-tig00000001	+	195676	195685	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-13.44	-169.65	-156.21	1	3	CAGTTCGCGCAGGGCGATCA
-tig00000001	+	195702	195702	d57afb7d-903e-46cf-a43d-0e17fb0949d8	0.47	-109.73	-110.19	1	1	CTTTGCGGAAA
-tig00000001	+	195720	195735	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-7.26	-160.33	-153.06	1	4	AATGGCGCGCTCCGCCTGCCCGGCAA
-tig00000001	+	195764	195781	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-11.25	-194.91	-183.66	1	4	TCAGCCGCTGGCGCAGATCGTCCGGGGC
-tig00000001	+	195803	195842	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-13.12	-319.49	-306.37	1	8	CACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACC
-tig00000001	+	195855	195864	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-17.87	-144.90	-127.03	1	3	AATTCCGGTGACGCCGCTGA
-tig00000001	+	195900	195906	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-10.20	-173.23	-163.03	1	2	CTGAACGTTGACGGTAG
-tig00000001	+	195945	195945	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.26	-79.43	-78.17	1	1	TTCTTCGATAT
-tig00000001	+	195959	195959	d57afb7d-903e-46cf-a43d-0e17fb0949d8	0.37	-102.63	-102.99	1	1	GCCAGCGTTTG
-tig00000001	+	195971	195971	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.28	-98.20	-96.93	1	1	GATGACGGGAA
-tig00000001	+	195982	195982	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-3.62	-92.62	-89.00	1	1	CCTGGCGCATT
-tig00000001	+	195994	196002	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-9.70	-158.17	-148.47	1	2	CTGTGCGCCAGTTCGTCCA
-tig00000001	+	196018	196044	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-34.70	-285.95	-251.25	1	7	ATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGAT
-tig00000001	+	196056	196056	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-7.25	-93.56	-86.31	1	1	AAACTCGCTGA
-tig00000001	+	196067	196093	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-15.54	-188.59	-173.06	1	5	TATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAG
-tig00000001	+	196122	196125	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.64	-118.73	-114.09	1	2	CATGGCGGCGGTAT
-tig00000001	+	196136	196140	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.45	-122.03	-121.58	1	2	CTTTTCGCCCGTGGG
-tig00000001	+	196155	196155	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-6.18	-116.11	-109.92	1	1	TACCACGCCAA
-tig00000001	+	196180	196190	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-9.23	-151.52	-142.29	1	3	CCTTGCGCCCGCAGTCGCTGG
-tig00000001	+	196210	196210	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-5.24	-87.61	-82.37	1	1	AGCATCGCCCA
-tig00000001	+	196224	196227	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.32	-93.95	-92.64	1	2	CTTCCCGACGCCTG
-tig00000001	+	196242	196242	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-8.42	-98.86	-90.44	1	1	GGCACCGAAGA
-tig00000001	+	196264	196274	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-7.40	-153.07	-145.67	1	4	TTCCCCGATGCGGCGCGGCAG
-tig00000001	+	196294	196319	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-20.72	-275.40	-254.68	1	5	GCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
-tig00000001	+	196342	196342	d57afb7d-903e-46cf-a43d-0e17fb0949d8	0.57	-104.62	-105.19	1	1	TCCAGCGCCAG
-tig00000001	+	196372	196380	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.43	-156.34	-154.91	1	2	ACAACCGGCTGGCCGATAT
-tig00000001	+	196396	196396	d57afb7d-903e-46cf-a43d-0e17fb0949d8	1.44	-134.99	-136.42	1	1	ACCAGCGGTTG
-tig00000001	+	196416	196426	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-6.62	-221.91	-215.29	1	2	TTTTGCGATCAGTTGCGTGAG
-tig00000001	+	196440	196440	d57afb7d-903e-46cf-a43d-0e17fb0949d8	0.25	-115.77	-116.02	1	1	TTCAACGCTGA
-tig00000001	+	196451	196466	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-19.79	-191.89	-172.10	1	5	GATTACGCGCTTTCGCCACGCGTGGG
-tig00000001	+	196483	196492	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-13.17	-168.95	-155.78	1	3	CAGGCCGCCGCTTGCGGGTG
-tig00000001	+	196514	196527	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.58	-167.41	-164.83	1	3	CAGCCCGCTTGCCGATGCCGTCAC
-tig00000001	+	196542	196576	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-10.76	-265.14	-254.39	1	7	TCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAAT
-tig00000001	+	196589	196595	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-8.03	-145.20	-137.17	1	3	AGCAACGCGTGCGGCTA
-tig00000001	+	196629	196629	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.16	-111.95	-110.80	1	1	CTGACCGCCAG
-tig00000001	+	196643	196643	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.16	-125.07	-122.91	1	1	GCTCCCGCCAG
-tig00000001	+	196677	196690	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-14.11	-199.11	-185.00	1	4	TCTGCCGTTGCCGACGGGCGACCA
-tig00000001	+	196706	196712	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-5.19	-124.89	-119.70	1	2	ATAGCCGTTGCCGGTAA
-tig00000001	+	196727	196749	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-10.89	-216.64	-205.75	1	5	CTGCCCGATTAATGCCGAACCGCGCACCGTATC
-tig00000001	+	196762	196770	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.93	-162.65	-160.72	1	2	CTTCACGAATCAACGAACC
-tig00000001	+	196810	196810	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-3.06	-122.79	-119.73	1	1	CAGTACGGTGG
-tig00000001	+	196823	196834	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-7.13	-156.55	-149.42	1	3	AGCAGCGGGTAAACGCCGCCAG
-tig00000001	+	196874	196878	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-6.24	-125.46	-119.22	1	2	AATGCCGGACGTAAT
-tig00000001	+	196909	196915	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.12	-135.11	-132.98	1	2	CAGACCGCAAACGGTCA
-tig00000001	+	196945	196952	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.90	-121.66	-118.76	1	2	GATACCGATAAACGGCAC
-tig00000001	+	196975	196975	d57afb7d-903e-46cf-a43d-0e17fb0949d8	0.39	-103.67	-104.06	1	1	CAGACCGTAAA
-tig00000001	+	196992	196995	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-10.95	-126.53	-115.58	1	2	AGTTACGGCGCAAC
-tig00000001	+	197011	197018	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.91	-113.49	-108.57	1	2	AGAAGCGGTAAGCGGTTT
-tig00000001	+	197032	197041	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-6.23	-110.37	-104.14	1	2	ACTCACGCCTTTAACGCCAG
-tig00000001	+	197059	197059	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.34	-94.50	-94.16	1	1	AAAGACGATAA
-tig00000001	+	197071	197071	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-5.44	-113.41	-107.97	1	1	CAAGGCGTTGA
-tig00000001	+	197084	197084	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.69	-91.33	-90.64	1	1	ATCACCGCACT
-tig00000001	+	197098	197108	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-14.59	-181.26	-166.67	1	3	GATTGCGGAGTCGGGCGAATG
-tig00000001	+	197132	197132	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-3.98	-115.68	-111.70	1	1	TTCAGCGCATT
-tig00000001	+	197144	197168	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-11.53	-203.81	-192.28	1	6	AACTGCGGATACGTTGCCGCGAATGCCGCCGGAAT
-tig00000001	+	197179	197197	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.24	-206.36	-204.13	1	3	AATGGCGAAGTATTTCGCCACATCGTTGG
-tig00000001	+	197222	197229	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-7.84	-122.20	-114.36	1	2	GTCAGCGAGCCACGGGTC
-tig00000001	+	197266	197266	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-3.83	-103.66	-99.83	1	1	CACCTCGATCA
-tig00000001	+	197279	197279	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.07	-97.61	-93.54	1	1	TTGGTCGGGTT
-tig00000001	+	197290	197296	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-10.74	-123.56	-112.81	1	2	AGAGTCGAGATCGACCA
-tig00000001	+	197309	197321	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-19.75	-174.93	-155.19	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	+	197332	197350	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-19.10	-254.78	-235.68	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	+	197363	197420	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-27.10	-454.05	-426.95	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	+	197433	197433	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.44	-112.56	-112.11	1	1	ACTGACGGATC
-tig00000001	+	197456	197470	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-10.82	-157.11	-146.28	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	+	197482	197509	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-14.79	-224.63	-209.85	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	+	197520	197530	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-16.31	-157.97	-141.67	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	+	197543	197543	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.07	-85.46	-83.39	1	1	ATCACCGTTTT
-tig00000001	+	197562	197577	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-6.99	-173.14	-166.15	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	+	197590	197599	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.40	-147.71	-147.31	1	2	AATACCGCCTTTGACGATAT
-tig00000001	+	197612	197620	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.55	-157.76	-153.21	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	+	197631	197631	d57afb7d-903e-46cf-a43d-0e17fb0949d8	0.48	-83.96	-84.44	1	1	GCACACGAGAA
-tig00000001	+	197654	197657	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.45	-110.73	-110.28	1	2	ACCAGCGGCGTGGC
-tig00000001	+	197670	197672	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-11.69	-135.15	-123.46	1	2	CCTGACGCGCAAC
-tig00000001	+	197683	197683	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.14	-130.50	-128.37	1	1	CTGATCGACTT
-tig00000001	+	197701	197701	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-8.38	-134.63	-126.24	1	1	AACATCGGTAG
-tig00000001	+	197719	197719	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.98	-111.46	-108.48	1	1	ACCACCGTTAG
-tig00000001	+	197736	197749	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-9.83	-142.27	-132.44	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	+	197763	197779	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-3.23	-171.34	-168.12	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	+	197791	197816	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-15.39	-248.46	-233.07	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	+	197837	197837	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-3.51	-108.71	-105.20	1	1	TGGAGCGACTG
-tig00000001	+	197848	197856	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-12.19	-153.41	-141.22	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	+	197868	197878	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.79	-128.11	-123.31	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	+	197895	197906	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.80	-156.14	-151.34	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	+	197921	197921	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.54	-112.10	-107.56	1	1	GCCAGCGAAGC
-tig00000001	+	197935	197948	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-11.33	-190.78	-179.45	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	+	197960	197969	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-7.20	-148.61	-141.41	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	+	197982	197999	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-11.71	-213.36	-201.65	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	+	198014	198014	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.62	-100.31	-99.69	1	1	GGTGCCGGTTT
-tig00000001	+	198035	198051	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-10.41	-191.10	-180.69	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	+	198064	198068	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-7.71	-108.99	-101.28	1	2	CTGCACGTCCGCTGG
-tig00000001	+	198087	198089	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.82	-87.52	-85.70	1	2	ACATTCGCGCCTA
-tig00000001	+	198100	198123	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-6.32	-212.65	-206.34	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	+	198137	198137	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-3.24	-124.04	-120.80	1	1	CAGGCCGCCAA
-tig00000001	+	198171	198171	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.76	-101.28	-99.52	1	1	AGCAGCGCCAC
-tig00000001	+	198183	198188	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-6.84	-106.44	-99.59	1	2	AGTACCGTTACGCTGA
-tig00000001	+	198203	198233	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-15.19	-245.62	-230.43	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	+	198250	198250	d57afb7d-903e-46cf-a43d-0e17fb0949d8	3.48	-116.88	-120.36	1	1	AAAGACGATAG
-tig00000001	+	198289	198313	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-18.31	-227.39	-209.09	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	+	198326	198336	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.16	-134.04	-131.87	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	+	198352	198364	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-14.48	-232.62	-218.14	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	+	198399	198415	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-15.15	-162.42	-147.27	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	+	198427	198485	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-35.57	-450.05	-414.48	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	+	198513	198513	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.35	-116.08	-113.74	1	1	ACCATCGCAGG
-tig00000001	+	198527	198527	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-5.22	-119.69	-114.47	1	1	AATATCGCCAG
-tig00000001	+	198545	198569	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-12.87	-252.93	-240.06	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	+	198585	198619	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-12.49	-271.53	-259.04	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	+	198660	198670	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-9.95	-148.35	-138.39	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	+	198684	198710	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-21.92	-243.87	-221.96	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	+	198728	198782	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-26.13	-377.14	-351.01	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	+	198812	198821	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-6.73	-160.22	-153.49	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	+	198834	198855	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-13.21	-243.02	-229.81	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	+	198872	198872	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-3.94	-97.17	-93.23	1	1	TTCACCGCTTC
-tig00000001	+	198884	198892	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-8.86	-138.03	-129.17	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	+	198907	198914	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-10.07	-156.30	-146.23	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	+	198927	198927	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.49	-86.01	-83.52	1	1	GTTTACGACTC
-tig00000001	+	198972	198987	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-8.25	-188.45	-180.20	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	+	199013	199013	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-5.36	-116.27	-110.91	1	1	CAGTGCGCCAA
-tig00000001	+	199028	199034	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.07	-143.29	-139.22	1	2	CAACACGGTGCCGATTA
-tig00000001	+	199056	199088	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-20.48	-248.72	-228.24	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	+	199112	199117	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-10.66	-131.31	-120.65	1	2	ACCAGCGAACCGGCAA
-tig00000001	+	199133	199133	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.06	-90.37	-86.31	1	1	ATCACCGGGAT
-tig00000001	+	199147	199156	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-8.67	-141.70	-133.03	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	+	199172	199172	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.85	-104.36	-101.52	1	1	CAGAACGCCAG
-tig00000001	+	199193	199193	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-5.46	-124.05	-118.60	1	1	CAGAACGGAGA
-tig00000001	+	199204	199228	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-9.96	-258.24	-248.28	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	+	199240	199255	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-12.30	-171.53	-159.23	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	+	199267	199267	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.64	-116.42	-113.78	1	1	CACTTCGCTAA
-tig00000001	+	199280	199280	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.47	-136.63	-136.16	1	1	CCATGCGGGCC
-tig00000001	+	199300	199336	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-26.44	-336.53	-310.09	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	+	199352	199355	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.89	-102.34	-99.45	1	2	ACCAGCGTCGGGGT
-tig00000001	+	199393	199402	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-7.42	-189.22	-181.80	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	+	199423	199430	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-8.69	-147.23	-138.54	1	2	TATTCCGGTGTACGACCA
-tig00000001	+	199446	199446	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.53	-100.76	-100.22	1	1	CAGCCCGGCAA
-tig00000001	+	199459	199459	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-6.50	-111.84	-105.34	1	1	AACACCGCCAG
-tig00000001	+	199485	199485	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-0.71	-85.71	-85.00	1	1	CATGCCGTAAA
-tig00000001	+	199500	199509	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-5.11	-131.96	-126.85	1	3	AGAACCGACACCGCCGAACA
-tig00000001	+	199543	199543	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.36	-106.33	-101.97	1	1	CACATCGGCAC
-tig00000001	+	199557	199570	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.76	-184.25	-179.49	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	+	199582	199593	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-6.38	-159.31	-152.93	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	+	199606	199621	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-11.61	-180.07	-168.46	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	+	199644	199652	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-10.66	-120.29	-109.63	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	+	199687	199687	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.50	-133.93	-129.42	1	1	CTGTCCGTGCC
-tig00000001	+	199740	199746	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-6.35	-128.60	-122.25	1	2	CACCACGCCTACGCAGA
-tig00000001	+	199770	199770	d57afb7d-903e-46cf-a43d-0e17fb0949d8	2.25	-95.37	-97.62	1	1	GACATCGCCCA
-tig00000001	+	199786	199802	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-3.34	-165.53	-162.19	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	+	199833	199836	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-7.96	-130.97	-123.01	1	2	CACAGCGCCGTTGG
-tig00000001	+	199854	199854	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.32	-108.36	-104.03	1	1	AAGATCGCCAG
-tig00000001	+	199868	199868	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.46	-113.43	-110.97	1	1	CTGCACGAAGT
-tig00000001	+	199883	199883	d57afb7d-903e-46cf-a43d-0e17fb0949d8	0.85	-125.22	-126.07	1	1	CAGTGCGGTTG
-tig00000001	+	199899	199908	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-7.98	-161.32	-153.33	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	+	199931	199943	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-14.03	-149.42	-135.39	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	+	199956	199956	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.68	-105.80	-103.12	1	1	TTGATCGCTTC
-tig00000001	+	199998	199998	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.25	-91.07	-88.82	1	1	TGTTGCGCTCC
 tig00000001	+	200009	200009	d57afb7d-903e-46cf-a43d-0e17fb0949d8	3.49	-126.31	-129.80	1	1	TTCAACGGTAT
 tig00000001	+	200046	200046	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-1.33	-98.68	-97.34	1	1	TGCAGCGCACC
 tig00000001	+	200081	200081	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-2.51	-109.65	-107.14	1	1	AACAACGCCAC
@@ -337,283 +25,6 @@
 tig00000001	+	200742	200742	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.67	-107.20	-102.53	1	1	GATACCGGAAG
 tig00000001	+	200773	200773	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-4.93	-124.32	-119.38	1	1	GATTTCGCAAA
 tig00000001	+	200784	200788	d57afb7d-903e-46cf-a43d-0e17fb0949d8	-9.11	-148.71	-139.60	1	2	ATCTGCGGGCGGGGT
-tig00000001	+	192165	192172	3221ccdb-0395-4983-8a44-e5558664096f	-3.09	-133.25	-130.16	1	2	ACACCCGAAATACGGGGC
-tig00000001	+	192188	192196	3221ccdb-0395-4983-8a44-e5558664096f	-3.84	-154.57	-150.73	1	2	CTCTGCGGGTACACGTTCT
-tig00000001	+	192225	192225	3221ccdb-0395-4983-8a44-e5558664096f	-11.27	-122.34	-111.07	1	1	AATACCGGGAT
-tig00000001	+	192240	192266	3221ccdb-0395-4983-8a44-e5558664096f	-18.44	-269.42	-250.99	1	4	TAACCCGTGGCATCGATTTCATCGAGTTTTCCGCATG
-tig00000001	+	192278	192285	3221ccdb-0395-4983-8a44-e5558664096f	-5.31	-132.12	-126.82	1	2	AACATCGTTGAGCGATAA
-tig00000001	+	192300	192316	3221ccdb-0395-4983-8a44-e5558664096f	-22.46	-185.63	-163.17	1	3	ATTGCCGCCACATCGATATTACGACTT
-tig00000001	+	192343	192348	3221ccdb-0395-4983-8a44-e5558664096f	-9.57	-149.76	-140.19	1	2	ATTCTCGCTGCGTGGT
-tig00000001	+	192363	192363	3221ccdb-0395-4983-8a44-e5558664096f	-1.87	-134.95	-133.09	1	1	CAGTCCGGGCA
-tig00000001	+	192381	192381	3221ccdb-0395-4983-8a44-e5558664096f	-4.31	-105.83	-101.52	1	1	CTAACCGCAAT
-tig00000001	+	192444	192444	3221ccdb-0395-4983-8a44-e5558664096f	-9.50	-133.90	-124.40	1	1	TTTCTCGAATG
-tig00000001	+	192456	192465	3221ccdb-0395-4983-8a44-e5558664096f	-18.70	-152.89	-134.19	1	3	GAAATCGATCGTGCCGGAAA
-tig00000001	+	192485	192485	3221ccdb-0395-4983-8a44-e5558664096f	-6.32	-98.38	-92.05	1	1	TACCCCGCTGA
-tig00000001	+	192583	192583	3221ccdb-0395-4983-8a44-e5558664096f	-2.06	-100.35	-98.29	1	1	CACTGCGGAAT
-tig00000001	+	192631	192631	3221ccdb-0395-4983-8a44-e5558664096f	-3.85	-89.25	-85.40	1	1	CTGTACGCTGA
-tig00000001	+	192649	192649	3221ccdb-0395-4983-8a44-e5558664096f	-9.49	-137.03	-127.54	1	1	TTAGTCGGTAG
-tig00000001	+	192660	192660	3221ccdb-0395-4983-8a44-e5558664096f	-5.03	-151.55	-146.52	1	1	ACTAACGGGCA
-tig00000001	+	192682	192682	3221ccdb-0395-4983-8a44-e5558664096f	-8.79	-159.49	-150.70	1	1	AAAGTCGAAGC
-tig00000001	+	192693	192693	3221ccdb-0395-4983-8a44-e5558664096f	-1.22	-140.98	-139.76	1	1	TATTGCGATGA
-tig00000001	+	192723	192723	3221ccdb-0395-4983-8a44-e5558664096f	-1.50	-93.91	-92.41	1	1	TTGTCCGCCTT
-tig00000001	+	192744	192744	3221ccdb-0395-4983-8a44-e5558664096f	-3.27	-88.50	-85.23	1	1	TAGTGCGGCTG
-tig00000001	+	192815	192815	3221ccdb-0395-4983-8a44-e5558664096f	-4.42	-124.79	-120.37	1	1	AAATACGGTTG
-tig00000001	+	192937	192937	3221ccdb-0395-4983-8a44-e5558664096f	-0.72	-106.53	-105.81	1	1	AAAGCCGTATT
-tig00000001	+	192951	192951	3221ccdb-0395-4983-8a44-e5558664096f	-1.06	-117.21	-116.15	1	1	TATTACGGCTT
-tig00000001	+	193006	193006	3221ccdb-0395-4983-8a44-e5558664096f	0.55	-117.02	-117.57	1	1	TAAACCGATAG
-tig00000001	+	193019	193019	3221ccdb-0395-4983-8a44-e5558664096f	-1.58	-128.50	-126.92	1	1	AATACCGGTTT
-tig00000001	+	193039	193049	3221ccdb-0395-4983-8a44-e5558664096f	-20.23	-196.15	-175.92	1	3	AATGGCGTGGGCGGGCGGGAT
-tig00000001	+	193072	193072	3221ccdb-0395-4983-8a44-e5558664096f	-3.70	-106.35	-102.65	1	1	TTTGTCGCAGA
-tig00000001	+	193093	193093	3221ccdb-0395-4983-8a44-e5558664096f	-2.77	-85.74	-82.97	1	1	AAATACGCAAA
-tig00000001	+	193112	193118	3221ccdb-0395-4983-8a44-e5558664096f	-9.19	-130.73	-121.54	1	3	GTGTTCGACCGCGTTTG
-tig00000001	+	193149	193149	3221ccdb-0395-4983-8a44-e5558664096f	1.10	-90.95	-92.05	1	1	GCTGGCGCTGG
-tig00000001	+	193168	193168	3221ccdb-0395-4983-8a44-e5558664096f	-0.18	-111.50	-111.33	1	1	TTTTCCGGCAT
-tig00000001	+	193187	193197	3221ccdb-0395-4983-8a44-e5558664096f	-13.80	-147.25	-133.45	1	2	AGCACCGCCAGCAGGCGGAAC
-tig00000001	+	193236	193273	3221ccdb-0395-4983-8a44-e5558664096f	-41.90	-392.08	-350.18	1	7	CACCCCGGTGAATCACGCGGGCGGCTAAATCGACGGTAACATCGGAAA
-tig00000001	+	193289	193300	3221ccdb-0395-4983-8a44-e5558664096f	-18.44	-229.38	-210.94	1	4	ACCAGCGGATCGGGCGCGGTGG
-tig00000001	+	193317	193338	3221ccdb-0395-4983-8a44-e5558664096f	-26.58	-238.52	-211.94	1	6	AGTGGCGGCGTAATGCGACGCGCAGACGGGCC
-tig00000001	+	193351	193351	3221ccdb-0395-4983-8a44-e5558664096f	-3.31	-109.76	-106.45	1	1	CAATTCGCCAA
-tig00000001	+	193364	193364	3221ccdb-0395-4983-8a44-e5558664096f	-8.44	-106.87	-98.43	1	1	CCAAACGGCTT
-tig00000001	+	193385	193430	3221ccdb-0395-4983-8a44-e5558664096f	-28.63	-380.69	-352.06	1	9	TCATCCGCTCCGGCATCCAGCGCGGCGATTTTGTCGCTCTTCGCTGCGTGCGGAAA
-tig00000001	+	193446	193454	3221ccdb-0395-4983-8a44-e5558664096f	-11.70	-150.71	-139.01	1	3	ATCACCGGCACCGCGCTCC
-tig00000001	+	193465	193474	3221ccdb-0395-4983-8a44-e5558664096f	-5.63	-161.34	-155.71	1	3	ACTGGCGCAGGTCGCGGATA
-tig00000001	+	193499	193514	3221ccdb-0395-4983-8a44-e5558664096f	-15.31	-218.05	-202.74	1	3	ACCATCGGGCAGGCCGAGATCGAGAA
-tig00000001	+	193537	193545	3221ccdb-0395-4983-8a44-e5558664096f	-5.65	-164.71	-159.06	1	2	GCTTACGGGTTGCCGCTTC
-tig00000001	+	193559	193574	3221ccdb-0395-4983-8a44-e5558664096f	-9.62	-210.46	-200.84	1	4	CAAGCCGCGTTGCAGCGTTTCGGCCT
-tig00000001	+	193586	193627	3221ccdb-0395-4983-8a44-e5558664096f	-40.33	-295.29	-254.96	1	9	AAAGACGCGCATCCCGTCGCCCTCCAGCGCCGTGCGCAGAAAGCGACGAATA
-tig00000001	+	193658	193658	3221ccdb-0395-4983-8a44-e5558664096f	-4.66	-75.23	-70.56	1	1	CAGAACGTTTG
-tig00000001	+	193720	193720	3221ccdb-0395-4983-8a44-e5558664096f	-3.86	-118.72	-114.87	1	1	TAACACGAAAA
-tig00000001	+	193740	193754	3221ccdb-0395-4983-8a44-e5558664096f	-6.06	-197.88	-191.81	1	4	CCTTCCGGTCGGTTGAACGCGGTAA
-tig00000001	+	193769	193769	3221ccdb-0395-4983-8a44-e5558664096f	-2.32	-108.18	-105.86	1	1	GCCCCCGTACA
-tig00000001	+	193783	193787	3221ccdb-0395-4983-8a44-e5558664096f	-3.82	-122.29	-118.47	1	2	ACTATCGCCCGACAA
-tig00000001	+	193815	193824	3221ccdb-0395-4983-8a44-e5558664096f	-3.96	-139.74	-135.78	1	2	TACCCCGGTACTGCCGACTC
-tig00000001	+	193838	193840	3221ccdb-0395-4983-8a44-e5558664096f	-3.00	-117.44	-114.44	1	2	ATTCCCGCGAGCA
-tig00000001	+	193860	193860	3221ccdb-0395-4983-8a44-e5558664096f	-0.59	-113.87	-113.28	1	1	AATATCGTCTG
-tig00000001	+	193878	193892	3221ccdb-0395-4983-8a44-e5558664096f	1.39	-221.63	-223.02	1	3	CCTGGCGGAAGACCGGGGCCGTTAT
-tig00000001	+	193922	193940	3221ccdb-0395-4983-8a44-e5558664096f	-8.76	-249.85	-241.08	1	3	ATTTTCGCCCTCAACGTGGGCATCGATAC
-tig00000001	+	193952	193965	3221ccdb-0395-4983-8a44-e5558664096f	-22.34	-199.69	-177.34	1	3	AATTTCGGCCTGCGCACCCGCATA
-tig00000001	+	193977	193979	3221ccdb-0395-4983-8a44-e5558664096f	-3.67	-106.96	-103.29	1	2	TTCACCGCGTTCT
-tig00000001	+	194005	194005	3221ccdb-0395-4983-8a44-e5558664096f	-2.79	-134.38	-131.58	1	1	GCACCCGTTCA
-tig00000001	+	194021	194027	3221ccdb-0395-4983-8a44-e5558664096f	0.37	-166.14	-166.50	1	2	TGGCCCGTCAACGTGGA
-tig00000001	+	194043	194043	3221ccdb-0395-4983-8a44-e5558664096f	0.89	-111.53	-112.43	1	1	GTCAGCGGTTC
-tig00000001	+	194070	194082	3221ccdb-0395-4983-8a44-e5558664096f	-16.51	-186.33	-169.82	1	3	ATGGGCGACGATAAACCCGGTTC
-tig00000001	+	194100	194108	3221ccdb-0395-4983-8a44-e5558664096f	-1.20	-149.74	-148.55	1	3	TGCAGCGCGCTGCCGACTA
-tig00000001	+	194124	194124	3221ccdb-0395-4983-8a44-e5558664096f	-2.32	-99.14	-96.82	1	1	TCCAGCGTTAA
-tig00000001	+	194153	194156	3221ccdb-0395-4983-8a44-e5558664096f	-6.16	-105.56	-99.40	1	2	AAAGCCGCCGGACT
-tig00000001	+	194167	194169	3221ccdb-0395-4983-8a44-e5558664096f	-4.32	-91.83	-87.51	1	2	GAATTCGCGCCAT
-tig00000001	+	194197	194197	3221ccdb-0395-4983-8a44-e5558664096f	-12.08	-133.64	-121.55	1	1	CCAGTCGGGTA
-tig00000001	+	194221	194228	3221ccdb-0395-4983-8a44-e5558664096f	-13.77	-158.23	-144.46	1	2	GCTGACGGATCTCGCTGG
-tig00000001	+	194239	194243	3221ccdb-0395-4983-8a44-e5558664096f	-9.29	-147.63	-138.34	1	2	CCTGGCGGGCGTGGG
-tig00000001	+	194258	194258	3221ccdb-0395-4983-8a44-e5558664096f	-0.79	-132.19	-131.39	1	1	TCCTTCGCTTG
-tig00000001	+	194270	194274	3221ccdb-0395-4983-8a44-e5558664096f	-9.64	-189.53	-179.90	1	2	CAGATCGAGCGTTAA
-tig00000001	+	194304	194317	3221ccdb-0395-4983-8a44-e5558664096f	-6.24	-177.27	-171.02	1	4	AGCACCGTAAGCGGCGTGCGTAAA
-tig00000001	+	194328	194337	3221ccdb-0395-4983-8a44-e5558664096f	-15.96	-136.68	-120.71	1	3	TCATGCGAAAGCGCCGCCAG
-tig00000001	+	194348	194353	3221ccdb-0395-4983-8a44-e5558664096f	-10.48	-150.30	-139.82	1	2	CAGGGCGTTGCGGATC
-tig00000001	+	194365	194369	3221ccdb-0395-4983-8a44-e5558664096f	-1.89	-152.14	-150.25	1	2	GTTCACGTTCGCTTG
-tig00000001	+	194380	194382	3221ccdb-0395-4983-8a44-e5558664096f	0.31	-121.81	-122.11	1	2	CCATCCGCGCCTG
-tig00000001	+	194393	194413	3221ccdb-0395-4983-8a44-e5558664096f	-14.81	-265.63	-250.82	1	4	TTCTTCGCTGGCGGTTAGCGTCAGCCGCTCA
-tig00000001	+	194429	194445	3221ccdb-0395-4983-8a44-e5558664096f	-1.46	-198.94	-197.49	1	3	ATTGGCGACTAACAGCGTAAACGTCTC
-tig00000001	+	194458	194458	3221ccdb-0395-4983-8a44-e5558664096f	-3.20	-110.28	-107.09	1	1	GCAGGCGCTGC
-tig00000001	+	194469	194469	3221ccdb-0395-4983-8a44-e5558664096f	-3.87	-149.29	-145.42	1	1	TGTTCCGGGAT
-tig00000001	+	194485	194485	3221ccdb-0395-4983-8a44-e5558664096f	-0.00	-99.04	-99.03	1	1	ACTGGCGCAGA
-tig00000001	+	194496	194496	3221ccdb-0395-4983-8a44-e5558664096f	-2.59	-98.47	-95.89	1	1	TTCCCCGCTCC
-tig00000001	+	194515	194515	3221ccdb-0395-4983-8a44-e5558664096f	-3.10	-105.29	-102.19	1	1	CAGCCCGTAGG
-tig00000001	+	194527	194539	3221ccdb-0395-4983-8a44-e5558664096f	-7.81	-161.08	-153.27	1	3	TTTCTCGCCGCTTTTAGCGGCAA
-tig00000001	+	194554	194587	3221ccdb-0395-4983-8a44-e5558664096f	-28.91	-339.73	-310.82	1	7	TGGTACGGTACACCGGGTAACGTGTCGGTGCCCGCGCCCGCAGG
-tig00000001	+	194617	194638	3221ccdb-0395-4983-8a44-e5558664096f	-23.02	-234.76	-211.74	1	5	CACTGCGCGATGGCATCGTCCCACGGCGTCAT
-tig00000001	+	194650	194650	3221ccdb-0395-4983-8a44-e5558664096f	-0.70	-103.25	-102.55	1	1	CCTTGCGGATG
-tig00000001	+	194662	194662	3221ccdb-0395-4983-8a44-e5558664096f	-7.23	-88.98	-81.76	1	1	GTTAACGGCTG
-tig00000001	+	194676	194685	3221ccdb-0395-4983-8a44-e5558664096f	-9.89	-140.30	-130.41	1	2	TTTACCGTTGTCATCGGGCA
-tig00000001	+	194705	194705	3221ccdb-0395-4983-8a44-e5558664096f	-4.60	-83.41	-78.81	1	1	GACTGCGGGCA
-tig00000001	+	194716	194716	3221ccdb-0395-4983-8a44-e5558664096f	-6.39	-99.16	-92.77	1	1	TGAAACGTGGA
-tig00000001	+	194736	194736	3221ccdb-0395-4983-8a44-e5558664096f	-4.91	-94.38	-89.47	1	1	TTGTTCGCTGG
-tig00000001	+	194748	194773	3221ccdb-0395-4983-8a44-e5558664096f	-9.56	-213.35	-203.78	1	4	GGCAGCGATATCCTGCGGACTGCGGCCCACCGCCAG
-tig00000001	+	194785	194785	3221ccdb-0395-4983-8a44-e5558664096f	-9.67	-129.44	-119.77	1	1	GCTTTCGACAT
-tig00000001	+	194804	194850	3221ccdb-0395-4983-8a44-e5558664096f	-20.37	-337.43	-317.06	1	9	AGTGCCGTGTGCGTTGCTCGCGGTAACGGGCTACCCGCGCCTGATAACGCACGCCAG
-tig00000001	+	194868	194868	3221ccdb-0395-4983-8a44-e5558664096f	-1.82	-89.59	-87.77	1	1	GTTCCCGATCA
-tig00000001	+	194880	194883	3221ccdb-0395-4983-8a44-e5558664096f	-3.60	-101.78	-98.18	1	2	CAGCCCGACGGTTA
-tig00000001	+	194896	194898	3221ccdb-0395-4983-8a44-e5558664096f	-0.08	-121.60	-121.53	1	2	ATCACCGCGAAGG
-tig00000001	+	194928	194949	3221ccdb-0395-4983-8a44-e5558664096f	-24.88	-210.52	-185.64	1	6	AGAGACGGCGAGCGTGCCGCGTGGGGCGATAA
-tig00000001	+	194963	194963	3221ccdb-0395-4983-8a44-e5558664096f	-3.93	-86.30	-82.37	1	1	GAGATCGAAAC
-tig00000001	+	194984	194984	3221ccdb-0395-4983-8a44-e5558664096f	-4.55	-113.59	-109.04	1	1	AATGACGGTGG
-tig00000001	+	195007	195007	3221ccdb-0395-4983-8a44-e5558664096f	-3.80	-98.37	-94.57	1	1	GCCAGCGTCCA
-tig00000001	+	195021	195021	3221ccdb-0395-4983-8a44-e5558664096f	-1.54	-94.64	-93.10	1	1	AATAGCGCCAC
-tig00000001	+	195035	195035	3221ccdb-0395-4983-8a44-e5558664096f	-10.00	-96.81	-86.80	1	1	CACCACGCCAA
-tig00000001	+	195065	195075	3221ccdb-0395-4983-8a44-e5558664096f	2.29	-171.79	-174.08	1	2	GTTGGCGGCATCAAACGCCAT
-tig00000001	+	195110	195134	3221ccdb-0395-4983-8a44-e5558664096f	-29.88	-197.25	-167.37	1	6	GATAACGGCGCATAACGCGGCGGCAACCACGCATC
-tig00000001	+	195154	195154	3221ccdb-0395-4983-8a44-e5558664096f	-8.61	-83.04	-74.43	1	1	GTACACGCCAC
-tig00000001	+	195175	195206	3221ccdb-0395-4983-8a44-e5558664096f	-26.41	-307.57	-281.16	1	7	AAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTG
-tig00000001	+	195222	195224	3221ccdb-0395-4983-8a44-e5558664096f	-3.59	-123.73	-120.14	1	2	TCAAGCGCGACCA
-tig00000001	+	195239	195264	3221ccdb-0395-4983-8a44-e5558664096f	-33.66	-291.62	-257.96	1	6	CTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCA
-tig00000001	+	195275	195313	3221ccdb-0395-4983-8a44-e5558664096f	-45.52	-375.58	-330.05	1	9	GCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAA
-tig00000001	+	195328	195328	3221ccdb-0395-4983-8a44-e5558664096f	-2.66	-103.95	-101.29	1	1	CTTGCCGAGAT
-tig00000001	+	195342	195359	3221ccdb-0395-4983-8a44-e5558664096f	-9.74	-200.33	-190.59	1	3	GTTCACGGGCATAACGCACTACCGCTTT
-tig00000001	+	195371	195371	3221ccdb-0395-4983-8a44-e5558664096f	-2.29	-124.16	-121.87	1	1	TCTTCCGCTGG
-tig00000001	+	195392	195400	3221ccdb-0395-4983-8a44-e5558664096f	-12.31	-126.71	-114.40	1	3	GTTGCCGTCTCCGCGCCCA
-tig00000001	+	195413	195427	3221ccdb-0395-4983-8a44-e5558664096f	-13.79	-166.22	-152.43	1	3	TCCTGCGCCAGACGTAAGGCGCTGA
-tig00000001	+	195441	195460	3221ccdb-0395-4983-8a44-e5558664096f	-3.42	-174.13	-170.70	1	4	TTGCCCGACGTTTTTTCCGGTAAGCGGTGC
-tig00000001	+	195489	195500	3221ccdb-0395-4983-8a44-e5558664096f	-12.08	-179.69	-167.61	1	3	TACACCGCGTGCCAGACGCTAC
-tig00000001	+	195511	195535	3221ccdb-0395-4983-8a44-e5558664096f	-35.35	-266.23	-230.88	1	7	CCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACC
-tig00000001	+	195547	195553	3221ccdb-0395-4983-8a44-e5558664096f	-9.64	-182.38	-172.75	1	2	GTTTTCGCTGCCGGTGT
-tig00000001	+	195565	195565	3221ccdb-0395-4983-8a44-e5558664096f	1.19	-132.62	-133.82	1	1	ATGGCCGATGC
-tig00000001	+	195581	195590	3221ccdb-0395-4983-8a44-e5558664096f	-13.52	-179.02	-165.50	1	5	AGGATCGCGTCGCGCGTGTG
-tig00000001	+	195608	195608	3221ccdb-0395-4983-8a44-e5558664096f	-6.08	-142.96	-136.88	1	1	CTCTTCGCCAG
-tig00000001	+	195621	195630	3221ccdb-0395-4983-8a44-e5558664096f	-17.37	-170.82	-153.44	1	3	TGCCCCGCCAGGCGCGCATT
-tig00000001	+	195646	195663	3221ccdb-0395-4983-8a44-e5558664096f	-20.61	-204.47	-183.86	1	5	ATCAACGCGATCGGCAGTACGGCGCAGT
-tig00000001	+	195676	195685	3221ccdb-0395-4983-8a44-e5558664096f	-14.50	-163.33	-148.83	1	3	CAGTTCGCGCAGGGCGATCA
-tig00000001	+	195702	195702	3221ccdb-0395-4983-8a44-e5558664096f	8.16	-151.97	-160.12	1	1	CTTTGCGGAAA
-tig00000001	+	195720	195735	3221ccdb-0395-4983-8a44-e5558664096f	-14.47	-172.90	-158.42	1	4	AATGGCGCGCTCCGCCTGCCCGGCAA
-tig00000001	+	195764	195781	3221ccdb-0395-4983-8a44-e5558664096f	-7.89	-191.19	-183.31	1	4	TCAGCCGCTGGCGCAGATCGTCCGGGGC
-tig00000001	+	195803	195842	3221ccdb-0395-4983-8a44-e5558664096f	-18.36	-318.20	-299.84	1	8	CACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACC
-tig00000001	+	195855	195864	3221ccdb-0395-4983-8a44-e5558664096f	-17.01	-211.58	-194.57	1	3	AATTCCGGTGACGCCGCTGA
-tig00000001	+	195900	195906	3221ccdb-0395-4983-8a44-e5558664096f	-3.29	-180.57	-177.29	1	2	CTGAACGTTGACGGTAG
-tig00000001	+	195945	195945	3221ccdb-0395-4983-8a44-e5558664096f	-1.28	-110.08	-108.80	1	1	TTCTTCGATAT
-tig00000001	+	195959	195959	3221ccdb-0395-4983-8a44-e5558664096f	1.67	-95.41	-97.08	1	1	GCCAGCGTTTG
-tig00000001	+	195971	195971	3221ccdb-0395-4983-8a44-e5558664096f	-1.43	-107.29	-105.86	1	1	GATGACGGGAA
-tig00000001	+	195982	195982	3221ccdb-0395-4983-8a44-e5558664096f	-4.65	-117.38	-112.73	1	1	CCTGGCGCATT
-tig00000001	+	195994	196002	3221ccdb-0395-4983-8a44-e5558664096f	-12.06	-173.51	-161.45	1	2	CTGTGCGCCAGTTCGTCCA
-tig00000001	+	196018	196044	3221ccdb-0395-4983-8a44-e5558664096f	-47.93	-322.98	-275.04	1	7	ATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGAT
-tig00000001	+	196056	196056	3221ccdb-0395-4983-8a44-e5558664096f	-7.12	-131.15	-124.04	1	1	AAACTCGCTGA
-tig00000001	+	196067	196093	3221ccdb-0395-4983-8a44-e5558664096f	-12.84	-227.17	-214.32	1	5	TATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAG
-tig00000001	+	196122	196125	3221ccdb-0395-4983-8a44-e5558664096f	-7.45	-104.09	-96.64	1	2	CATGGCGGCGGTAT
-tig00000001	+	196136	196140	3221ccdb-0395-4983-8a44-e5558664096f	-1.86	-115.86	-114.00	1	2	CTTTTCGCCCGTGGG
-tig00000001	+	196155	196155	3221ccdb-0395-4983-8a44-e5558664096f	-11.88	-90.86	-78.97	1	1	TACCACGCCAA
-tig00000001	+	196180	196190	3221ccdb-0395-4983-8a44-e5558664096f	-11.16	-155.86	-144.70	1	3	CCTTGCGCCCGCAGTCGCTGG
-tig00000001	+	196210	196210	3221ccdb-0395-4983-8a44-e5558664096f	-4.68	-88.12	-83.44	1	1	AGCATCGCCCA
-tig00000001	+	196224	196227	3221ccdb-0395-4983-8a44-e5558664096f	-6.19	-96.45	-90.26	1	2	CTTCCCGACGCCTG
-tig00000001	+	196242	196242	3221ccdb-0395-4983-8a44-e5558664096f	-4.22	-100.48	-96.26	1	1	GGCACCGAAGA
-tig00000001	+	196264	196274	3221ccdb-0395-4983-8a44-e5558664096f	-8.31	-174.38	-166.08	1	4	TTCCCCGATGCGGCGCGGCAG
-tig00000001	+	196294	196319	3221ccdb-0395-4983-8a44-e5558664096f	-15.53	-254.31	-238.78	1	5	GCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
-tig00000001	+	196342	196342	3221ccdb-0395-4983-8a44-e5558664096f	-2.66	-82.52	-79.86	1	1	TCCAGCGCCAG
-tig00000001	+	196372	196380	3221ccdb-0395-4983-8a44-e5558664096f	-7.53	-120.74	-113.21	1	2	ACAACCGGCTGGCCGATAT
-tig00000001	+	196396	196396	3221ccdb-0395-4983-8a44-e5558664096f	0.51	-133.55	-134.06	1	1	ACCAGCGGTTG
-tig00000001	+	196416	196426	3221ccdb-0395-4983-8a44-e5558664096f	-9.10	-167.53	-158.43	1	2	TTTTGCGATCAGTTGCGTGAG
-tig00000001	+	196440	196440	3221ccdb-0395-4983-8a44-e5558664096f	-4.52	-128.91	-124.39	1	1	TTCAACGCTGA
-tig00000001	+	196451	196466	3221ccdb-0395-4983-8a44-e5558664096f	-22.83	-227.46	-204.62	1	5	GATTACGCGCTTTCGCCACGCGTGGG
-tig00000001	+	196483	196492	3221ccdb-0395-4983-8a44-e5558664096f	-24.81	-205.82	-181.01	1	3	CAGGCCGCCGCTTGCGGGTG
-tig00000001	+	196514	196527	3221ccdb-0395-4983-8a44-e5558664096f	-10.08	-189.37	-179.29	1	3	CAGCCCGCTTGCCGATGCCGTCAC
-tig00000001	+	196542	196576	3221ccdb-0395-4983-8a44-e5558664096f	-23.42	-308.40	-284.98	1	7	TCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAAT
-tig00000001	+	196589	196595	3221ccdb-0395-4983-8a44-e5558664096f	-8.66	-152.52	-143.86	1	3	AGCAACGCGTGCGGCTA
-tig00000001	+	196629	196629	3221ccdb-0395-4983-8a44-e5558664096f	0.96	-91.80	-92.76	1	1	CTGACCGCCAG
-tig00000001	+	196643	196643	3221ccdb-0395-4983-8a44-e5558664096f	-2.58	-93.02	-90.44	1	1	GCTCCCGCCAG
-tig00000001	+	196677	196690	3221ccdb-0395-4983-8a44-e5558664096f	-27.20	-228.73	-201.53	1	4	TCTGCCGTTGCCGACGGGCGACCA
-tig00000001	+	196706	196712	3221ccdb-0395-4983-8a44-e5558664096f	-7.86	-152.14	-144.28	1	2	ATAGCCGTTGCCGGTAA
-tig00000001	+	196727	196749	3221ccdb-0395-4983-8a44-e5558664096f	-24.89	-227.44	-202.55	1	5	CTGCCCGATTAATGCCGAACCGCGCACCGTATC
-tig00000001	+	196762	196770	3221ccdb-0395-4983-8a44-e5558664096f	-4.05	-185.92	-181.87	1	2	CTTCACGAATCAACGAACC
-tig00000001	+	196810	196810	3221ccdb-0395-4983-8a44-e5558664096f	-5.77	-109.86	-104.09	1	1	CAGTACGGTGG
-tig00000001	+	196823	196834	3221ccdb-0395-4983-8a44-e5558664096f	-17.35	-198.01	-180.66	1	3	AGCAGCGGGTAAACGCCGCCAG
-tig00000001	+	196874	196878	3221ccdb-0395-4983-8a44-e5558664096f	-14.68	-118.45	-103.77	1	2	AATGCCGGACGTAAT
-tig00000001	+	196909	196915	3221ccdb-0395-4983-8a44-e5558664096f	-2.35	-138.25	-135.90	1	2	CAGACCGCAAACGGTCA
-tig00000001	+	196945	196952	3221ccdb-0395-4983-8a44-e5558664096f	0.23	-124.87	-125.10	1	2	GATACCGATAAACGGCAC
-tig00000001	+	196975	196975	3221ccdb-0395-4983-8a44-e5558664096f	-3.90	-94.62	-90.72	1	1	CAGACCGTAAA
-tig00000001	+	196992	196995	3221ccdb-0395-4983-8a44-e5558664096f	-6.21	-118.53	-112.32	1	2	AGTTACGGCGCAAC
-tig00000001	+	197011	197018	3221ccdb-0395-4983-8a44-e5558664096f	-4.78	-136.74	-131.96	1	2	AGAAGCGGTAAGCGGTTT
-tig00000001	+	197032	197041	3221ccdb-0395-4983-8a44-e5558664096f	-16.81	-170.71	-153.90	1	2	ACTCACGCCTTTAACGCCAG
-tig00000001	+	197059	197059	3221ccdb-0395-4983-8a44-e5558664096f	-3.56	-108.84	-105.28	1	1	AAAGACGATAA
-tig00000001	+	197071	197071	3221ccdb-0395-4983-8a44-e5558664096f	-16.80	-110.77	-93.97	1	1	CAAGGCGTTGA
-tig00000001	+	197084	197084	3221ccdb-0395-4983-8a44-e5558664096f	-7.03	-104.37	-97.34	1	1	ATCACCGCACT
-tig00000001	+	197098	197108	3221ccdb-0395-4983-8a44-e5558664096f	-17.86	-184.36	-166.50	1	3	GATTGCGGAGTCGGGCGAATG
-tig00000001	+	197132	197132	3221ccdb-0395-4983-8a44-e5558664096f	-4.55	-120.21	-115.67	1	1	TTCAGCGCATT
-tig00000001	+	197144	197168	3221ccdb-0395-4983-8a44-e5558664096f	-24.07	-231.24	-207.16	1	6	AACTGCGGATACGTTGCCGCGAATGCCGCCGGAAT
-tig00000001	+	197179	197197	3221ccdb-0395-4983-8a44-e5558664096f	-10.94	-230.59	-219.65	1	3	AATGGCGAAGTATTTCGCCACATCGTTGG
-tig00000001	+	197222	197229	3221ccdb-0395-4983-8a44-e5558664096f	-14.15	-155.44	-141.28	1	2	GTCAGCGAGCCACGGGTC
-tig00000001	+	197266	197266	3221ccdb-0395-4983-8a44-e5558664096f	-3.24	-96.68	-93.44	1	1	CACCTCGATCA
-tig00000001	+	197279	197279	3221ccdb-0395-4983-8a44-e5558664096f	2.60	-99.18	-101.78	1	1	TTGGTCGGGTT
-tig00000001	+	197290	197296	3221ccdb-0395-4983-8a44-e5558664096f	-3.45	-123.06	-119.61	1	2	AGAGTCGAGATCGACCA
-tig00000001	+	197309	197321	3221ccdb-0395-4983-8a44-e5558664096f	-13.02	-185.09	-172.07	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	+	197332	197350	3221ccdb-0395-4983-8a44-e5558664096f	-14.90	-203.77	-188.88	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	+	197363	197420	3221ccdb-0395-4983-8a44-e5558664096f	-44.13	-448.04	-403.90	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	+	197433	197433	3221ccdb-0395-4983-8a44-e5558664096f	-4.37	-121.01	-116.64	1	1	ACTGACGGATC
-tig00000001	+	197456	197470	3221ccdb-0395-4983-8a44-e5558664096f	-10.68	-190.55	-179.87	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	+	197482	197509	3221ccdb-0395-4983-8a44-e5558664096f	-25.65	-289.18	-263.52	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	+	197520	197530	3221ccdb-0395-4983-8a44-e5558664096f	-11.11	-160.57	-149.46	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	+	197543	197543	3221ccdb-0395-4983-8a44-e5558664096f	-1.49	-103.04	-101.55	1	1	ATCACCGTTTT
-tig00000001	+	197562	197577	3221ccdb-0395-4983-8a44-e5558664096f	-5.95	-152.50	-146.55	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	+	197590	197599	3221ccdb-0395-4983-8a44-e5558664096f	-10.91	-140.76	-129.85	1	2	AATACCGCCTTTGACGATAT
-tig00000001	+	197612	197620	3221ccdb-0395-4983-8a44-e5558664096f	-5.29	-121.94	-116.65	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	+	197631	197631	3221ccdb-0395-4983-8a44-e5558664096f	-1.75	-88.52	-86.77	1	1	GCACACGAGAA
-tig00000001	+	197654	197657	3221ccdb-0395-4983-8a44-e5558664096f	-6.88	-128.43	-121.55	1	2	ACCAGCGGCGTGGC
-tig00000001	+	197670	197672	3221ccdb-0395-4983-8a44-e5558664096f	-8.03	-116.86	-108.82	1	2	CCTGACGCGCAAC
-tig00000001	+	197683	197683	3221ccdb-0395-4983-8a44-e5558664096f	-3.99	-116.55	-112.56	1	1	CTGATCGACTT
-tig00000001	+	197701	197701	3221ccdb-0395-4983-8a44-e5558664096f	-5.71	-140.24	-134.53	1	1	AACATCGGTAG
-tig00000001	+	197719	197719	3221ccdb-0395-4983-8a44-e5558664096f	-1.06	-127.45	-126.39	1	1	ACCACCGTTAG
-tig00000001	+	197736	197749	3221ccdb-0395-4983-8a44-e5558664096f	-11.38	-160.19	-148.81	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	+	197763	197779	3221ccdb-0395-4983-8a44-e5558664096f	-11.97	-231.03	-219.06	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	+	197791	197816	3221ccdb-0395-4983-8a44-e5558664096f	-21.50	-295.62	-274.12	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	+	197837	197837	3221ccdb-0395-4983-8a44-e5558664096f	-4.43	-124.19	-119.76	1	1	TGGAGCGACTG
-tig00000001	+	197848	197856	3221ccdb-0395-4983-8a44-e5558664096f	-24.47	-180.01	-155.54	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	+	197868	197878	3221ccdb-0395-4983-8a44-e5558664096f	-1.96	-192.84	-190.88	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	+	197895	197906	3221ccdb-0395-4983-8a44-e5558664096f	-9.15	-141.13	-131.98	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	+	197921	197921	3221ccdb-0395-4983-8a44-e5558664096f	-3.27	-130.39	-127.13	1	1	GCCAGCGAAGC
-tig00000001	+	197935	197948	3221ccdb-0395-4983-8a44-e5558664096f	-11.00	-193.51	-182.51	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	+	197960	197969	3221ccdb-0395-4983-8a44-e5558664096f	-4.63	-157.46	-152.83	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	+	197982	197999	3221ccdb-0395-4983-8a44-e5558664096f	-10.08	-188.47	-178.39	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	+	198014	198014	3221ccdb-0395-4983-8a44-e5558664096f	1.27	-105.59	-106.86	1	1	GGTGCCGGTTT
-tig00000001	+	198035	198051	3221ccdb-0395-4983-8a44-e5558664096f	-18.13	-191.91	-173.78	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	+	198064	198068	3221ccdb-0395-4983-8a44-e5558664096f	-7.46	-90.24	-82.78	1	2	CTGCACGTCCGCTGG
-tig00000001	+	198087	198089	3221ccdb-0395-4983-8a44-e5558664096f	-1.84	-86.72	-84.87	1	2	ACATTCGCGCCTA
-tig00000001	+	198100	198123	3221ccdb-0395-4983-8a44-e5558664096f	-17.23	-190.97	-173.74	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	+	198137	198137	3221ccdb-0395-4983-8a44-e5558664096f	-2.64	-111.75	-109.12	1	1	CAGGCCGCCAA
-tig00000001	+	198171	198171	3221ccdb-0395-4983-8a44-e5558664096f	-2.99	-80.67	-77.68	1	1	AGCAGCGCCAC
-tig00000001	+	198183	198188	3221ccdb-0395-4983-8a44-e5558664096f	-2.64	-112.71	-110.08	1	2	AGTACCGTTACGCTGA
-tig00000001	+	198203	198233	3221ccdb-0395-4983-8a44-e5558664096f	-8.30	-294.04	-285.74	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	+	198250	198250	3221ccdb-0395-4983-8a44-e5558664096f	-10.17	-130.45	-120.29	1	1	AAAGACGATAG
-tig00000001	+	198289	198313	3221ccdb-0395-4983-8a44-e5558664096f	-31.17	-256.68	-225.51	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	+	198326	198336	3221ccdb-0395-4983-8a44-e5558664096f	-2.56	-143.21	-140.65	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	+	198352	198364	3221ccdb-0395-4983-8a44-e5558664096f	-18.61	-169.05	-150.44	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	+	198399	198415	3221ccdb-0395-4983-8a44-e5558664096f	-13.04	-175.89	-162.85	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	+	198427	198485	3221ccdb-0395-4983-8a44-e5558664096f	-37.49	-377.65	-340.16	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	+	198513	198513	3221ccdb-0395-4983-8a44-e5558664096f	-5.09	-105.32	-100.23	1	1	ACCATCGCAGG
-tig00000001	+	198527	198527	3221ccdb-0395-4983-8a44-e5558664096f	-3.28	-97.06	-93.77	1	1	AATATCGCCAG
-tig00000001	+	198545	198569	3221ccdb-0395-4983-8a44-e5558664096f	-9.85	-196.18	-186.33	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	+	198585	198619	3221ccdb-0395-4983-8a44-e5558664096f	-35.22	-309.20	-273.98	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	+	198660	198670	3221ccdb-0395-4983-8a44-e5558664096f	-14.88	-163.98	-149.11	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	+	198684	198710	3221ccdb-0395-4983-8a44-e5558664096f	-17.41	-263.32	-245.92	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	+	198728	198782	3221ccdb-0395-4983-8a44-e5558664096f	-40.04	-383.19	-343.15	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	+	198812	198821	3221ccdb-0395-4983-8a44-e5558664096f	-4.74	-119.48	-114.74	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	+	198834	198855	3221ccdb-0395-4983-8a44-e5558664096f	-23.89	-246.22	-222.33	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	+	198872	198872	3221ccdb-0395-4983-8a44-e5558664096f	-4.47	-76.72	-72.24	1	1	TTCACCGCTTC
-tig00000001	+	198884	198892	3221ccdb-0395-4983-8a44-e5558664096f	-4.57	-110.29	-105.71	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	+	198907	198914	3221ccdb-0395-4983-8a44-e5558664096f	-12.92	-142.46	-129.55	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	+	198927	198927	3221ccdb-0395-4983-8a44-e5558664096f	-4.67	-89.16	-84.49	1	1	GTTTACGACTC
-tig00000001	+	198972	198987	3221ccdb-0395-4983-8a44-e5558664096f	-17.21	-194.12	-176.91	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	+	199013	199013	3221ccdb-0395-4983-8a44-e5558664096f	-3.15	-97.92	-94.77	1	1	CAGTGCGCCAA
-tig00000001	+	199028	199034	3221ccdb-0395-4983-8a44-e5558664096f	-7.64	-135.67	-128.03	1	2	CAACACGGTGCCGATTA
-tig00000001	+	199056	199088	3221ccdb-0395-4983-8a44-e5558664096f	-19.54	-290.29	-270.75	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	+	199112	199117	3221ccdb-0395-4983-8a44-e5558664096f	-8.21	-194.30	-186.09	1	2	ACCAGCGAACCGGCAA
-tig00000001	+	199133	199133	3221ccdb-0395-4983-8a44-e5558664096f	0.34	-134.44	-134.77	1	1	ATCACCGGGAT
-tig00000001	+	199147	199156	3221ccdb-0395-4983-8a44-e5558664096f	-6.58	-145.41	-138.83	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	+	199172	199172	3221ccdb-0395-4983-8a44-e5558664096f	-6.71	-124.94	-118.24	1	1	CAGAACGCCAG
-tig00000001	+	199193	199193	3221ccdb-0395-4983-8a44-e5558664096f	-7.41	-108.57	-101.16	1	1	CAGAACGGAGA
-tig00000001	+	199204	199228	3221ccdb-0395-4983-8a44-e5558664096f	-14.43	-226.49	-212.06	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	+	199240	199255	3221ccdb-0395-4983-8a44-e5558664096f	-18.10	-186.77	-168.67	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	+	199267	199267	3221ccdb-0395-4983-8a44-e5558664096f	-5.76	-103.00	-97.24	1	1	CACTTCGCTAA
-tig00000001	+	199280	199280	3221ccdb-0395-4983-8a44-e5558664096f	-3.68	-97.77	-94.10	1	1	CCATGCGGGCC
-tig00000001	+	199300	199336	3221ccdb-0395-4983-8a44-e5558664096f	-49.62	-361.88	-312.26	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	+	199352	199355	3221ccdb-0395-4983-8a44-e5558664096f	-2.61	-160.24	-157.63	1	2	ACCAGCGTCGGGGT
-tig00000001	+	199393	199402	3221ccdb-0395-4983-8a44-e5558664096f	-14.57	-141.73	-127.17	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	+	199423	199430	3221ccdb-0395-4983-8a44-e5558664096f	-3.81	-119.44	-115.63	1	2	TATTCCGGTGTACGACCA
-tig00000001	+	199446	199446	3221ccdb-0395-4983-8a44-e5558664096f	2.10	-92.69	-94.79	1	1	CAGCCCGGCAA
-tig00000001	+	199459	199459	3221ccdb-0395-4983-8a44-e5558664096f	-5.15	-100.46	-95.31	1	1	AACACCGCCAG
-tig00000001	+	199485	199485	3221ccdb-0395-4983-8a44-e5558664096f	-0.50	-94.31	-93.80	1	1	CATGCCGTAAA
-tig00000001	+	199500	199509	3221ccdb-0395-4983-8a44-e5558664096f	-3.49	-136.72	-133.23	1	3	AGAACCGACACCGCCGAACA
-tig00000001	+	199543	199543	3221ccdb-0395-4983-8a44-e5558664096f	-14.31	-108.21	-93.91	1	1	CACATCGGCAC
-tig00000001	+	199557	199570	3221ccdb-0395-4983-8a44-e5558664096f	-28.29	-218.92	-190.63	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	+	199582	199593	3221ccdb-0395-4983-8a44-e5558664096f	-22.11	-186.75	-164.64	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	+	199606	199621	3221ccdb-0395-4983-8a44-e5558664096f	-16.81	-176.26	-159.45	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	+	199644	199652	3221ccdb-0395-4983-8a44-e5558664096f	-23.69	-174.12	-150.43	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	+	199687	199687	3221ccdb-0395-4983-8a44-e5558664096f	-2.20	-111.47	-109.27	1	1	CTGTCCGTGCC
-tig00000001	+	199740	199746	3221ccdb-0395-4983-8a44-e5558664096f	-7.91	-110.16	-102.24	1	2	CACCACGCCTACGCAGA
-tig00000001	+	199770	199770	3221ccdb-0395-4983-8a44-e5558664096f	-13.46	-109.08	-95.62	1	1	GACATCGCCCA
-tig00000001	+	199786	199802	3221ccdb-0395-4983-8a44-e5558664096f	-20.07	-182.82	-162.75	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	+	199833	199836	3221ccdb-0395-4983-8a44-e5558664096f	-5.68	-139.85	-134.17	1	2	CACAGCGCCGTTGG
-tig00000001	+	199854	199854	3221ccdb-0395-4983-8a44-e5558664096f	-2.90	-89.79	-86.89	1	1	AAGATCGCCAG
-tig00000001	+	199868	199868	3221ccdb-0395-4983-8a44-e5558664096f	-3.42	-109.14	-105.73	1	1	CTGCACGAAGT
-tig00000001	+	199883	199883	3221ccdb-0395-4983-8a44-e5558664096f	-5.62	-156.50	-150.88	1	1	CAGTGCGGTTG
-tig00000001	+	199899	199908	3221ccdb-0395-4983-8a44-e5558664096f	-9.52	-160.88	-151.36	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	+	199931	199943	3221ccdb-0395-4983-8a44-e5558664096f	-23.33	-180.94	-157.61	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	+	199956	199956	3221ccdb-0395-4983-8a44-e5558664096f	-2.03	-101.94	-99.91	1	1	TTGATCGCTTC
-tig00000001	+	199998	199998	3221ccdb-0395-4983-8a44-e5558664096f	-0.79	-79.98	-79.19	1	1	TGTTGCGCTCC
 tig00000001	+	200009	200009	3221ccdb-0395-4983-8a44-e5558664096f	-6.47	-122.75	-116.27	1	1	TTCAACGGTAT
 tig00000001	+	200046	200046	3221ccdb-0395-4983-8a44-e5558664096f	-1.88	-87.76	-85.88	1	1	TGCAGCGCACC
 tig00000001	+	200081	200081	3221ccdb-0395-4983-8a44-e5558664096f	-4.45	-106.13	-101.68	1	1	AACAACGCCAC
@@ -669,365 +80,6 @@
 tig00000001	+	201922	201930	3221ccdb-0395-4983-8a44-e5558664096f	-7.48	-154.92	-147.44	1	2	GTCACCGGCTGGCCGCACT
 tig00000001	+	201944	201950	3221ccdb-0395-4983-8a44-e5558664096f	-16.64	-170.91	-154.28	1	2	GCAGGCGCTGCCGGAAG
 tig00000001	+	201961	201986	3221ccdb-0395-4983-8a44-e5558664096f	-7.24	-266.73	-259.49	1	4	AACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAA
-tig00000001	+	201998	202007	3221ccdb-0395-4983-8a44-e5558664096f	-3.73	-196.32	-192.59	1	2	CAGTCCGCAGGGGCCGTGGT
-tig00000001	+	202020	202020	3221ccdb-0395-4983-8a44-e5558664096f	-2.18	-129.82	-127.64	1	1	CTGCTCGGCTG
-tig00000001	+	202033	202046	3221ccdb-0395-4983-8a44-e5558664096f	-18.58	-167.22	-148.64	1	3	GTGAGCGGGTGCCGGAAGCGGATG
-tig00000001	+	202064	202081	3221ccdb-0395-4983-8a44-e5558664096f	-36.63	-232.20	-195.56	1	5	GCCTGCGCCGCTGCCGCCGTACCGGGTA
-tig00000001	+	202092	202092	3221ccdb-0395-4983-8a44-e5558664096f	-1.69	-95.93	-94.24	1	1	CTGACCGGGCT
-tig00000001	+	202105	202143	3221ccdb-0395-4983-8a44-e5558664096f	-53.11	-354.77	-301.66	1	8	TGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGA
-tig00000001	+	202155	202198	3221ccdb-0395-4983-8a44-e5558664096f	-44.57	-427.61	-383.04	1	8	TTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTG
-tig00000001	+	202214	202225	3221ccdb-0395-4983-8a44-e5558664096f	-20.42	-214.95	-194.53	1	3	GACCACGCAGGCGCAGCGGGCA
-tig00000001	+	202240	202240	3221ccdb-0395-4983-8a44-e5558664096f	0.56	-79.66	-80.22	1	1	AAGCCCGGCAG
-tig00000001	+	202257	202275	3221ccdb-0395-4983-8a44-e5558664096f	-15.93	-211.71	-195.78	1	5	ATTTCCGGCGGGACGGAACCGTCCGCTTT
-tig00000001	+	202295	202330	3221ccdb-0395-4983-8a44-e5558664096f	-17.74	-319.78	-302.04	1	5	CCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTG
-tig00000001	+	202341	202341	3221ccdb-0395-4983-8a44-e5558664096f	-6.28	-121.70	-115.41	1	1	TCTGCCGTGTG
-tig00000001	+	202352	202370	3221ccdb-0395-4983-8a44-e5558664096f	-12.34	-221.85	-209.51	1	4	GCTGACGCACGACCCGGAATACCCGGAGA
-tig00000001	+	202386	202399	3221ccdb-0395-4983-8a44-e5558664096f	-15.92	-152.08	-136.16	1	4	CCTGCCGCGCCGCTGGTGCGCTAT
-tig00000001	+	202412	202432	3221ccdb-0395-4983-8a44-e5558664096f	-32.23	-253.35	-221.13	1	6	CTGGACGCCCGCGGCGAACTGGCGGCGGTGT
-tig00000001	+	202443	202443	3221ccdb-0395-4983-8a44-e5558664096f	-7.42	-133.95	-126.52	1	1	ATGACCGCAGC
-tig00000001	+	202461	202461	3221ccdb-0395-4983-8a44-e5558664096f	0.88	-105.92	-106.80	1	1	AGGTGCGCAGC
-tig00000001	+	202475	202475	3221ccdb-0395-4983-8a44-e5558664096f	-2.54	-117.74	-115.20	1	1	ACTTACGATGA
-tig00000001	+	202488	202525	3221ccdb-0395-4983-8a44-e5558664096f	0.57	-265.68	-266.25	1	7	AATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAA
-tig00000001	+	202539	202557	3221ccdb-0395-4983-8a44-e5558664096f	-25.80	-208.95	-183.15	1	5	GTTACCGTTACGACAGCGACGGGCGGGTG
-tig00000001	+	202579	202579	3221ccdb-0395-4983-8a44-e5558664096f	-0.11	-102.63	-102.52	1	1	AAACCCGGCAG
-tig00000001	+	202597	202597	3221ccdb-0395-4983-8a44-e5558664096f	-3.21	-130.87	-127.65	1	1	TTACACGTATC
-tig00000001	+	202617	202617	3221ccdb-0395-4983-8a44-e5558664096f	1.00	-92.42	-93.42	1	1	AGGACCGCATC
-tig00000001	+	202631	202631	3221ccdb-0395-4983-8a44-e5558664096f	-2.48	-115.50	-113.02	1	1	ATCACCGACAG
-tig00000001	+	202644	202647	3221ccdb-0395-4983-8a44-e5558664096f	-6.32	-114.35	-108.03	1	2	TGAACCGCCGTGAA
-tig00000001	+	202663	202663	3221ccdb-0395-4983-8a44-e5558664096f	-4.30	-134.32	-130.02	1	1	GCACACGCAGG
-tig00000001	+	202676	202686	3221ccdb-0395-4983-8a44-e5558664096f	-17.37	-199.66	-182.29	1	2	GAAGGCGGGCTGAAGCGGGTG
-tig00000001	+	202705	202722	3221ccdb-0395-4983-8a44-e5558664096f	-9.60	-170.56	-160.96	1	5	GAACACGCGGACGGCAGCGTCACGCAGA
-tig00000001	+	202738	202740	3221ccdb-0395-4983-8a44-e5558664096f	-8.39	-149.45	-141.06	1	2	TTTGACGCGGTGG
-tig00000001	+	202764	202771	3221ccdb-0395-4983-8a44-e5558664096f	-2.74	-129.69	-126.95	1	2	ACAGACGGATGCCGCAGG
-tig00000001	+	202797	202797	3221ccdb-0395-4983-8a44-e5558664096f	-1.17	-120.82	-119.65	1	1	CAGTCCGGATG
-tig00000001	+	202809	202809	3221ccdb-0395-4983-8a44-e5558664096f	-0.97	-130.22	-129.25	1	1	GGTGACGGGCC
-tig00000001	+	202821	202836	3221ccdb-0395-4983-8a44-e5558664096f	-24.47	-190.36	-165.90	1	4	CATCACGCGCATCACCACGCCGGATG
-tig00000001	+	202851	202854	3221ccdb-0395-4983-8a44-e5558664096f	-13.93	-119.57	-105.64	1	2	GGCATCGGCGTTTT
-tig00000001	+	202884	202903	3221ccdb-0395-4983-8a44-e5558664096f	-12.80	-301.43	-288.64	1	3	GTTAACGTCAGCCACCGGGCCTGACGGGCT
-tig00000001	+	202916	202919	3221ccdb-0395-4983-8a44-e5558664096f	-6.06	-176.28	-170.22	1	2	AAATACGCCGGGAA
-tig00000001	+	202940	202940	3221ccdb-0395-4983-8a44-e5558664096f	-2.93	-136.85	-133.93	1	1	GGGGCCGTCTG
-tig00000001	+	202966	202985	3221ccdb-0395-4983-8a44-e5558664096f	-14.14	-274.07	-259.93	1	4	CCTGACGGCGATATCACCCGCTACCGTTAT
-tig00000001	+	203017	203022	3221ccdb-0395-4983-8a44-e5558664096f	-15.94	-160.49	-144.55	1	2	CCCTGCGCAACGGAAG
-tig00000001	+	203035	203042	3221ccdb-0395-4983-8a44-e5558664096f	-3.40	-172.64	-169.24	1	2	GCCACCGGCAGCCGGAAA
-tig00000001	+	203055	203068	3221ccdb-0395-4983-8a44-e5558664096f	-9.66	-205.48	-195.82	1	3	CATGACGTGGAGCCGTTACGGTCA
-tig00000001	+	203098	203098	3221ccdb-0395-4983-8a44-e5558664096f	0.44	-135.04	-135.47	1	1	TGTTCCGGTTA
-tig00000001	+	203111	203111	3221ccdb-0395-4983-8a44-e5558664096f	-2.33	-120.71	-118.38	1	1	TAACCCGCTAT
-tig00000001	+	203126	203126	3221ccdb-0395-4983-8a44-e5558664096f	2.69	-117.71	-120.40	1	1	ATGACCGTTTT
-tig00000001	+	203142	203155	3221ccdb-0395-4983-8a44-e5558664096f	-17.94	-187.52	-169.58	1	4	GGTGACGGCGGTGCACCGCGAGGA
-tig00000001	+	203177	203192	3221ccdb-0395-4983-8a44-e5558664096f	-21.02	-203.92	-182.90	1	4	AGTACCGCGCATACGACAGCCGTGGA
-tig00000001	+	203209	203209	3221ccdb-0395-4983-8a44-e5558664096f	-2.29	-85.82	-83.53	1	1	ATTGCCGTGAA
-tig00000001	+	203220	203220	3221ccdb-0395-4983-8a44-e5558664096f	-0.68	-94.93	-94.25	1	1	AGACACGCAGG
-tig00000001	+	203235	203237	3221ccdb-0395-4983-8a44-e5558664096f	-2.52	-152.57	-150.05	1	2	TGAAACGCGGTAT
-tig00000001	+	203251	203257	3221ccdb-0395-4983-8a44-e5558664096f	-15.29	-149.50	-134.21	1	3	TACAACGCCGCCGGTGA
-tig00000001	+	203272	203272	3221ccdb-0395-4983-8a44-e5558664096f	-0.17	-91.39	-91.23	1	1	ACCACCGTCAT
-tig00000001	+	203283	203287	3221ccdb-0395-4983-8a44-e5558664096f	-4.15	-89.58	-85.44	1	2	TGCCCCGGACGGCAG
-tig00000001	+	203299	203299	3221ccdb-0395-4983-8a44-e5558664096f	-6.43	-116.66	-110.23	1	1	AGAAACGGGAC
-tig00000001	+	203311	203316	3221ccdb-0395-4983-8a44-e5558664096f	-6.63	-126.60	-119.96	1	2	CAGTACGATGCGTGGG
-tig00000001	+	203340	203357	3221ccdb-0395-4983-8a44-e5558664096f	-30.34	-236.04	-205.70	1	4	TACCACGCAGGGCGGTCTGACGCGCAGT
-tig00000001	+	203371	203393	3221ccdb-0395-4983-8a44-e5558664096f	-13.71	-216.88	-203.17	1	4	GAATACGATGCTGCCGGACGGGTCATCCGCCTG
-tig00000001	+	203410	203410	3221ccdb-0395-4983-8a44-e5558664096f	-7.35	-107.74	-100.39	1	1	GAAAACGGCAG
-tig00000001	+	203429	203447	3221ccdb-0395-4983-8a44-e5558664096f	-15.76	-196.21	-180.45	1	4	CCTTCCGTTACGATGTACTCGACCGGCTG
-tig00000001	+	203464	203486	3221ccdb-0395-4983-8a44-e5558664096f	-16.93	-222.98	-206.05	1	4	GAAACCGGCTTTGACGGCCGCACACAGCGTTAT
-tig00000001	+	203497	203506	3221ccdb-0395-4983-8a44-e5558664096f	-9.08	-135.62	-126.54	1	2	CACCACGACCTGACCGGCAA
-tig00000001	+	203519	203524	3221ccdb-0395-4983-8a44-e5558664096f	-2.65	-150.54	-147.89	1	2	TTATCCGCAGCGAGGA
-tig00000001	+	203560	203609	3221ccdb-0395-4983-8a44-e5558664096f	-13.74	-313.48	-299.74	1	8	TATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGG
-tig00000001	+	203623	203629	3221ccdb-0395-4983-8a44-e5558664096f	-3.15	-138.54	-135.38	1	3	TATGACGAACGCGGCTG
-tig00000001	+	203659	203676	3221ccdb-0395-4983-8a44-e5558664096f	-7.42	-176.04	-168.63	1	3	ATCAGCGAAGGGCACCGGGTGACGGTGC
-tig00000001	+	203705	203710	3221ccdb-0395-4983-8a44-e5558664096f	-11.94	-144.51	-132.57	1	2	AAGGCCGCCTCGCCAG
-tig00000001	+	203727	203727	3221ccdb-0395-4983-8a44-e5558664096f	-0.25	-112.99	-112.74	1	1	CCTGACGGTGC
-tig00000001	+	203739	203745	3221ccdb-0395-4983-8a44-e5558664096f	-7.45	-144.21	-136.76	1	2	TCATCCGCAGACGAATG
-tig00000001	+	203781	203788	3221ccdb-0395-4983-8a44-e5558664096f	-11.82	-134.13	-122.31	1	2	ACATGCGTACAACGCACA
-tig00000001	+	203802	203817	3221ccdb-0395-4983-8a44-e5558664096f	-13.43	-185.62	-172.19	1	3	ACTGGCGAACCGCTGTATACCGGACA
-tig00000001	+	203830	203833	3221ccdb-0395-4983-8a44-e5558664096f	-6.68	-134.38	-127.70	1	2	CTGCCCGCCGTGGA
-tig00000001	+	203851	203857	3221ccdb-0395-4983-8a44-e5558664096f	-9.41	-179.29	-169.88	1	2	ACCTACGGCAGCGGCTG
-tig00000001	+	203881	203892	3221ccdb-0395-4983-8a44-e5558664096f	-22.78	-187.53	-164.75	1	3	AAACTCGGCGACACACCGCTGG
-tig00000001	+	203909	203948	3221ccdb-0395-4983-8a44-e5558664096f	-29.67	-303.95	-274.29	1	8	ACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTAT
-tig00000001	+	203965	203965	3221ccdb-0395-4983-8a44-e5558664096f	-0.60	-93.35	-92.75	1	1	ACCACCGCTTA
-tig00000001	+	203980	203980	3221ccdb-0395-4983-8a44-e5558664096f	-6.33	-117.26	-110.93	1	1	CCTGCCGGGCA
-tig00000001	+	204023	204025	3221ccdb-0395-4983-8a44-e5558664096f	-6.83	-109.78	-102.95	1	2	CTGACCGCGATTA
-tig00000001	+	204040	204059	3221ccdb-0395-4983-8a44-e5558664096f	-15.72	-214.04	-198.32	1	4	TGGAACGACAACGGCGAACTCATCCGCATC
-tig00000001	+	204072	204083	3221ccdb-0395-4983-8a44-e5558664096f	-4.68	-170.61	-165.92	1	3	CAGCCCGCGCCAGACCCGGAGT
-tig00000001	+	204106	204106	3221ccdb-0395-4983-8a44-e5558664096f	-5.53	-106.71	-101.18	1	1	ACCACCGGCAG
-tig00000001	+	204118	204121	3221ccdb-0395-4983-8a44-e5558664096f	-1.55	-139.58	-138.03	1	2	CTGACCGGCGTTCA
-tig00000001	+	204133	204138	3221ccdb-0395-4983-8a44-e5558664096f	-0.82	-110.81	-109.99	1	2	ACCACCGCAGCGAATC
-tig00000001	+	204152	204159	3221ccdb-0395-4983-8a44-e5558664096f	-1.67	-137.53	-135.85	1	2	ATATCCGCATCCCGTATA
-tig00000001	+	204174	204174	3221ccdb-0395-4983-8a44-e5558664096f	-0.76	-122.14	-121.38	1	1	AGACCCGGCAG
-tig00000001	+	204185	204198	3221ccdb-0395-4983-8a44-e5558664096f	-2.76	-212.35	-209.58	1	3	GTAACCGCCTGCCCGACCCGGAGC
-tig00000001	+	204210	204217	3221ccdb-0395-4983-8a44-e5558664096f	-6.46	-178.98	-172.51	1	2	GCACCCGGACAGCGCCCT
-tig00000001	+	204234	204258	3221ccdb-0395-4983-8a44-e5558664096f	-9.51	-215.16	-205.65	1	6	GTGGCCGGATAACCGTATCGCCCGTGACGCGCACT
-tig00000001	+	204272	204286	3221ccdb-0395-4983-8a44-e5558664096f	-3.06	-192.80	-189.73	1	3	TTTACCGGTATGACCGTCACGGCAG
-tig00000001	+	204307	204307	3221ccdb-0395-4983-8a44-e5558664096f	-0.86	-103.28	-102.41	1	1	AAAACCGACCT
-tig00000001	+	204318	204318	3221ccdb-0395-4983-8a44-e5558664096f	4.38	-99.92	-104.30	1	1	CATCCCGGAAG
-tig00000001	+	204331	204335	3221ccdb-0395-4983-8a44-e5558664096f	-6.07	-115.41	-109.35	1	2	TTATCCGCACGGATG
-tig00000001	+	204346	204355	3221ccdb-0395-4983-8a44-e5558664096f	-15.04	-168.28	-153.23	1	2	ATGAGCGCACCCACCGGTAC
-tig00000001	+	204366	204366	3221ccdb-0395-4983-8a44-e5558664096f	-2.06	-109.17	-107.10	1	1	CATTACGACAG
-tig00000001	+	204379	204379	3221ccdb-0395-4983-8a44-e5558664096f	-4.18	-119.09	-114.91	1	1	AGCACCGGCTG
-tig00000001	+	204395	204397	3221ccdb-0395-4983-8a44-e5558664096f	-9.45	-115.65	-106.20	1	2	CTACACGCGGACA
-tig00000001	+	204416	204430	3221ccdb-0395-4983-8a44-e5558664096f	-13.62	-211.82	-198.20	1	3	AGAGCCGCTGGTCGAAAGTCGCTAT
-tig00000001	+	204441	204454	3221ccdb-0395-4983-8a44-e5558664096f	-10.86	-215.18	-204.32	1	3	CTTTACGACCCGCTGGGCCGCAGG
-tig00000001	+	204469	204497	3221ccdb-0395-4983-8a44-e5558664096f	-25.95	-327.03	-301.08	1	5	CAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCT
-tig00000001	+	204509	204524	3221ccdb-0395-4983-8a44-e5558664096f	-8.32	-190.08	-181.76	1	3	GATGTCGCTGTCACGGAAACCGCAAG
-tig00000001	+	204540	204596	3221ccdb-0395-4983-8a44-e5558664096f	-38.80	-332.78	-293.99	1	8	TGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTT
-tig00000001	+	204608	204608	3221ccdb-0395-4983-8a44-e5558664096f	1.75	-88.30	-90.05	1	1	TCAGCCGGGGA
-tig00000001	+	204620	204620	3221ccdb-0395-4983-8a44-e5558664096f	-9.25	-105.61	-96.36	1	1	CTTCACGCCAC
-tig00000001	+	204642	204648	3221ccdb-0395-4983-8a44-e5558664096f	-3.96	-159.67	-155.71	1	2	GAAACCGCCACCGGTGA
-tig00000001	-	192815	192815	bdfab7a9-1792-4c9a-9428-261e109cdfae	-4.17	-106.85	-102.67	1	1	AAATACGGTTG
-tig00000001	-	192937	192937	bdfab7a9-1792-4c9a-9428-261e109cdfae	1.75	-104.73	-106.49	1	1	AAAGCCGTATT
-tig00000001	-	192951	192951	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.97	-96.60	-94.62	1	1	TATTACGGCTT
-tig00000001	-	193006	193006	bdfab7a9-1792-4c9a-9428-261e109cdfae	-4.45	-132.02	-127.57	1	1	TAAACCGATAG
-tig00000001	-	193019	193019	bdfab7a9-1792-4c9a-9428-261e109cdfae	-7.76	-125.35	-117.59	1	1	AATACCGGTTT
-tig00000001	-	193039	193049	bdfab7a9-1792-4c9a-9428-261e109cdfae	-10.65	-133.97	-123.32	1	3	AATGGCGTGGGCGGGCGGGAT
-tig00000001	-	193072	193072	bdfab7a9-1792-4c9a-9428-261e109cdfae	-0.56	-103.05	-102.49	1	1	TTTGTCGCAGA
-tig00000001	-	193093	193093	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.08	-90.03	-87.94	1	1	AAATACGCAAA
-tig00000001	-	193112	193118	bdfab7a9-1792-4c9a-9428-261e109cdfae	-0.70	-131.12	-130.42	1	3	GTGTTCGACCGCGTTTG
-tig00000001	-	193149	193149	bdfab7a9-1792-4c9a-9428-261e109cdfae	-5.11	-94.79	-89.68	1	1	GCTGGCGCTGG
-tig00000001	-	193168	193168	bdfab7a9-1792-4c9a-9428-261e109cdfae	-5.50	-114.68	-109.17	1	1	TTTTCCGGCAT
-tig00000001	-	193187	193197	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.39	-153.25	-151.85	1	2	AGCACCGCCAGCAGGCGGAAC
-tig00000001	-	193236	193273	bdfab7a9-1792-4c9a-9428-261e109cdfae	-10.46	-312.53	-302.06	1	7	CACCCCGGTGAATCACGCGGGCGGCTAAATCGACGGTAACATCGGAAA
-tig00000001	-	193289	193300	bdfab7a9-1792-4c9a-9428-261e109cdfae	-16.08	-178.64	-162.56	1	4	ACCAGCGGATCGGGCGCGGTGG
-tig00000001	-	193317	193338	bdfab7a9-1792-4c9a-9428-261e109cdfae	-17.34	-233.25	-215.91	1	6	AGTGGCGGCGTAATGCGACGCGCAGACGGGCC
-tig00000001	-	193351	193351	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.24	-99.00	-97.76	1	1	CAATTCGCCAA
-tig00000001	-	193364	193364	bdfab7a9-1792-4c9a-9428-261e109cdfae	-3.96	-108.12	-104.16	1	1	CCAAACGGCTT
-tig00000001	-	193385	193430	bdfab7a9-1792-4c9a-9428-261e109cdfae	-41.14	-388.70	-347.55	1	9	TCATCCGCTCCGGCATCCAGCGCGGCGATTTTGTCGCTCTTCGCTGCGTGCGGAAA
-tig00000001	-	193446	193454	bdfab7a9-1792-4c9a-9428-261e109cdfae	-13.56	-164.05	-150.49	1	3	ATCACCGGCACCGCGCTCC
-tig00000001	-	193465	193474	bdfab7a9-1792-4c9a-9428-261e109cdfae	-12.94	-183.01	-170.07	1	3	ACTGGCGCAGGTCGCGGATA
-tig00000001	-	193499	193514	bdfab7a9-1792-4c9a-9428-261e109cdfae	-4.94	-286.90	-281.96	1	3	ACCATCGGGCAGGCCGAGATCGAGAA
-tig00000001	-	193537	193545	bdfab7a9-1792-4c9a-9428-261e109cdfae	-8.89	-198.25	-189.36	1	2	GCTTACGGGTTGCCGCTTC
-tig00000001	-	193559	193574	bdfab7a9-1792-4c9a-9428-261e109cdfae	-23.54	-260.43	-236.89	1	4	CAAGCCGCGTTGCAGCGTTTCGGCCT
-tig00000001	-	193586	193627	bdfab7a9-1792-4c9a-9428-261e109cdfae	-36.92	-354.23	-317.31	1	9	AAAGACGCGCATCCCGTCGCCCTCCAGCGCCGTGCGCAGAAAGCGACGAATA
-tig00000001	-	193658	193658	bdfab7a9-1792-4c9a-9428-261e109cdfae	-5.15	-115.08	-109.93	1	1	CAGAACGTTTG
-tig00000001	-	193720	193720	bdfab7a9-1792-4c9a-9428-261e109cdfae	-0.35	-119.03	-118.67	1	1	TAACACGAAAA
-tig00000001	-	193740	193754	bdfab7a9-1792-4c9a-9428-261e109cdfae	-9.44	-194.62	-185.18	1	4	CCTTCCGGTCGGTTGAACGCGGTAA
-tig00000001	-	193769	193769	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.04	-120.86	-118.82	1	1	GCCCCCGTACA
-tig00000001	-	193783	193787	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.44	-177.99	-176.55	1	2	ACTATCGCCCGACAA
-tig00000001	-	193815	193824	bdfab7a9-1792-4c9a-9428-261e109cdfae	-14.65	-196.26	-181.61	1	2	TACCCCGGTACTGCCGACTC
-tig00000001	-	193838	193840	bdfab7a9-1792-4c9a-9428-261e109cdfae	0.72	-129.37	-130.08	1	2	ATTCCCGCGAGCA
-tig00000001	-	193860	193860	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.98	-129.51	-127.53	1	1	AATATCGTCTG
-tig00000001	-	193878	193892	bdfab7a9-1792-4c9a-9428-261e109cdfae	-0.88	-215.18	-214.30	1	3	CCTGGCGGAAGACCGGGGCCGTTAT
-tig00000001	-	193922	193940	bdfab7a9-1792-4c9a-9428-261e109cdfae	-7.41	-182.41	-174.99	1	3	ATTTTCGCCCTCAACGTGGGCATCGATAC
-tig00000001	-	193952	193965	bdfab7a9-1792-4c9a-9428-261e109cdfae	-12.65	-178.03	-165.38	1	3	AATTTCGGCCTGCGCACCCGCATA
-tig00000001	-	193977	193979	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.95	-118.60	-115.66	1	2	TTCACCGCGTTCT
-tig00000001	-	194005	194005	bdfab7a9-1792-4c9a-9428-261e109cdfae	-8.17	-134.90	-126.73	1	1	GCACCCGTTCA
-tig00000001	-	194021	194027	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.64	-169.80	-168.16	1	2	TGGCCCGTCAACGTGGA
-tig00000001	-	194043	194043	bdfab7a9-1792-4c9a-9428-261e109cdfae	0.22	-120.73	-120.95	1	1	GTCAGCGGTTC
-tig00000001	-	194070	194082	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.34	-171.20	-169.86	1	3	ATGGGCGACGATAAACCCGGTTC
-tig00000001	-	194100	194108	bdfab7a9-1792-4c9a-9428-261e109cdfae	-14.15	-150.51	-136.37	1	3	TGCAGCGCGCTGCCGACTA
-tig00000001	-	194124	194124	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.53	-101.54	-99.01	1	1	TCCAGCGTTAA
-tig00000001	-	194153	194156	bdfab7a9-1792-4c9a-9428-261e109cdfae	-7.55	-152.94	-145.39	1	2	AAAGCCGCCGGACT
-tig00000001	-	194167	194169	bdfab7a9-1792-4c9a-9428-261e109cdfae	0.60	-170.84	-171.44	1	2	GAATTCGCGCCAT
-tig00000001	-	194197	194197	bdfab7a9-1792-4c9a-9428-261e109cdfae	0.88	-86.39	-87.26	1	1	CCAGTCGGGTA
-tig00000001	-	194221	194228	bdfab7a9-1792-4c9a-9428-261e109cdfae	3.92	-150.21	-154.13	1	2	GCTGACGGATCTCGCTGG
-tig00000001	-	194239	194243	bdfab7a9-1792-4c9a-9428-261e109cdfae	-6.06	-114.59	-108.54	1	2	CCTGGCGGGCGTGGG
-tig00000001	-	194258	194258	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.78	-83.57	-81.79	1	1	TCCTTCGCTTG
-tig00000001	-	194270	194274	bdfab7a9-1792-4c9a-9428-261e109cdfae	-11.96	-149.22	-137.26	1	2	CAGATCGAGCGTTAA
-tig00000001	-	194304	194317	bdfab7a9-1792-4c9a-9428-261e109cdfae	-12.06	-162.24	-150.18	1	4	AGCACCGTAAGCGGCGTGCGTAAA
-tig00000001	-	194328	194337	bdfab7a9-1792-4c9a-9428-261e109cdfae	-7.33	-125.44	-118.12	1	3	TCATGCGAAAGCGCCGCCAG
-tig00000001	-	194348	194353	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.79	-85.04	-82.25	1	2	CAGGGCGTTGCGGATC
-tig00000001	-	194365	194369	bdfab7a9-1792-4c9a-9428-261e109cdfae	-9.15	-117.29	-108.15	1	2	GTTCACGTTCGCTTG
-tig00000001	-	194380	194382	bdfab7a9-1792-4c9a-9428-261e109cdfae	-15.64	-703.29	-687.65	1	2	CCATCCGCGCCTG
-tig00000001	-	194393	194413	bdfab7a9-1792-4c9a-9428-261e109cdfae	-12.07	-237.17	-225.09	1	4	TTCTTCGCTGGCGGTTAGCGTCAGCCGCTCA
-tig00000001	-	194429	194445	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.35	-169.11	-166.76	1	3	ATTGGCGACTAACAGCGTAAACGTCTC
-tig00000001	-	194458	194458	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.81	-120.74	-118.93	1	1	GCAGGCGCTGC
-tig00000001	-	194469	194469	bdfab7a9-1792-4c9a-9428-261e109cdfae	-0.71	-104.07	-103.36	1	1	TGTTCCGGGAT
-tig00000001	-	194485	194485	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.70	-102.27	-99.57	1	1	ACTGGCGCAGA
-tig00000001	-	194496	194496	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.91	-132.07	-129.16	1	1	TTCCCCGCTCC
-tig00000001	-	194515	194515	bdfab7a9-1792-4c9a-9428-261e109cdfae	-0.68	-110.04	-109.36	1	1	CAGCCCGTAGG
-tig00000001	-	194527	194539	bdfab7a9-1792-4c9a-9428-261e109cdfae	-12.64	-179.04	-166.40	1	3	TTTCTCGCCGCTTTTAGCGGCAA
-tig00000001	-	194554	194587	bdfab7a9-1792-4c9a-9428-261e109cdfae	-7.89	-214.41	-206.52	1	7	TGGTACGGTACACCGGGTAACGTGTCGGTGCCCGCGCCCGCAGG
-tig00000001	-	194617	194638	bdfab7a9-1792-4c9a-9428-261e109cdfae	-20.44	-230.33	-209.89	1	5	CACTGCGCGATGGCATCGTCCCACGGCGTCAT
-tig00000001	-	194650	194650	bdfab7a9-1792-4c9a-9428-261e109cdfae	-0.72	-96.25	-95.54	1	1	CCTTGCGGATG
-tig00000001	-	194662	194662	bdfab7a9-1792-4c9a-9428-261e109cdfae	-5.86	-107.93	-102.08	1	1	GTTAACGGCTG
-tig00000001	-	194676	194685	bdfab7a9-1792-4c9a-9428-261e109cdfae	-3.60	-149.33	-145.74	1	2	TTTACCGTTGTCATCGGGCA
-tig00000001	-	194705	194705	bdfab7a9-1792-4c9a-9428-261e109cdfae	-3.99	-101.83	-97.83	1	1	GACTGCGGGCA
-tig00000001	-	194716	194716	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.06	-110.53	-109.47	1	1	TGAAACGTGGA
-tig00000001	-	194736	194736	bdfab7a9-1792-4c9a-9428-261e109cdfae	-3.09	-91.11	-88.02	1	1	TTGTTCGCTGG
-tig00000001	-	194748	194773	bdfab7a9-1792-4c9a-9428-261e109cdfae	-8.22	-268.57	-260.35	1	4	GGCAGCGATATCCTGCGGACTGCGGCCCACCGCCAG
-tig00000001	-	194785	194785	bdfab7a9-1792-4c9a-9428-261e109cdfae	-0.29	-92.17	-91.88	1	1	GCTTTCGACAT
-tig00000001	-	194804	194850	bdfab7a9-1792-4c9a-9428-261e109cdfae	-29.62	-326.96	-297.33	1	9	AGTGCCGTGTGCGTTGCTCGCGGTAACGGGCTACCCGCGCCTGATAACGCACGCCAG
-tig00000001	-	194868	194868	bdfab7a9-1792-4c9a-9428-261e109cdfae	2.06	-83.65	-85.71	1	1	GTTCCCGATCA
-tig00000001	-	194880	194883	bdfab7a9-1792-4c9a-9428-261e109cdfae	-7.27	-113.42	-106.15	1	2	CAGCCCGACGGTTA
-tig00000001	-	194896	194898	bdfab7a9-1792-4c9a-9428-261e109cdfae	-6.33	-133.67	-127.33	1	2	ATCACCGCGAAGG
-tig00000001	-	194928	194949	bdfab7a9-1792-4c9a-9428-261e109cdfae	-11.16	-223.72	-212.56	1	6	AGAGACGGCGAGCGTGCCGCGTGGGGCGATAA
-tig00000001	-	194963	194963	bdfab7a9-1792-4c9a-9428-261e109cdfae	-5.88	-101.50	-95.62	1	1	GAGATCGAAAC
-tig00000001	-	194984	194984	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.18	-121.25	-119.07	1	1	AATGACGGTGG
-tig00000001	-	195007	195007	bdfab7a9-1792-4c9a-9428-261e109cdfae	-3.47	-134.54	-131.07	1	1	GCCAGCGTCCA
-tig00000001	-	195021	195021	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.65	-97.41	-94.76	1	1	AATAGCGCCAC
-tig00000001	-	195035	195035	bdfab7a9-1792-4c9a-9428-261e109cdfae	-0.93	-107.01	-106.08	1	1	CACCACGCCAA
-tig00000001	-	195065	195075	bdfab7a9-1792-4c9a-9428-261e109cdfae	-4.07	-166.39	-162.32	1	2	GTTGGCGGCATCAAACGCCAT
-tig00000001	-	195110	195134	bdfab7a9-1792-4c9a-9428-261e109cdfae	-20.86	-253.25	-232.39	1	6	GATAACGGCGCATAACGCGGCGGCAACCACGCATC
-tig00000001	-	195154	195154	bdfab7a9-1792-4c9a-9428-261e109cdfae	-0.06	-90.53	-90.47	1	1	GTACACGCCAC
-tig00000001	-	195175	195206	bdfab7a9-1792-4c9a-9428-261e109cdfae	-19.24	-254.95	-235.71	1	7	AAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTG
-tig00000001	-	195222	195224	bdfab7a9-1792-4c9a-9428-261e109cdfae	-5.69	-108.42	-102.73	1	2	TCAAGCGCGACCA
-tig00000001	-	195239	195264	bdfab7a9-1792-4c9a-9428-261e109cdfae	-18.63	-218.32	-199.69	1	6	CTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCA
-tig00000001	-	195275	195313	bdfab7a9-1792-4c9a-9428-261e109cdfae	-22.69	-319.78	-297.09	1	9	GCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAA
-tig00000001	-	195328	195328	bdfab7a9-1792-4c9a-9428-261e109cdfae	1.07	-124.96	-126.03	1	1	CTTGCCGAGAT
-tig00000001	-	195342	195359	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.58	-153.60	-152.03	1	3	GTTCACGGGCATAACGCACTACCGCTTT
-tig00000001	-	195371	195371	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.96	-112.54	-109.58	1	1	TCTTCCGCTGG
-tig00000001	-	195392	195400	bdfab7a9-1792-4c9a-9428-261e109cdfae	-13.97	-171.01	-157.04	1	3	GTTGCCGTCTCCGCGCCCA
-tig00000001	-	195413	195427	bdfab7a9-1792-4c9a-9428-261e109cdfae	-4.27	-186.88	-182.61	1	3	TCCTGCGCCAGACGTAAGGCGCTGA
-tig00000001	-	195441	195460	bdfab7a9-1792-4c9a-9428-261e109cdfae	-4.21	-182.29	-178.08	1	4	TTGCCCGACGTTTTTTCCGGTAAGCGGTGC
-tig00000001	-	195489	195500	bdfab7a9-1792-4c9a-9428-261e109cdfae	-6.45	-156.35	-149.90	1	3	TACACCGCGTGCCAGACGCTAC
-tig00000001	-	195511	195535	bdfab7a9-1792-4c9a-9428-261e109cdfae	-13.54	-285.99	-272.45	1	7	CCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACC
-tig00000001	-	195547	195553	bdfab7a9-1792-4c9a-9428-261e109cdfae	-8.55	-148.59	-140.04	1	2	GTTTTCGCTGCCGGTGT
-tig00000001	-	195565	195565	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.69	-88.60	-85.90	1	1	ATGGCCGATGC
-tig00000001	-	195581	195590	bdfab7a9-1792-4c9a-9428-261e109cdfae	-8.82	-173.83	-165.01	1	5	AGGATCGCGTCGCGCGTGTG
-tig00000001	-	195608	195608	bdfab7a9-1792-4c9a-9428-261e109cdfae	-0.61	-103.36	-102.76	1	1	CTCTTCGCCAG
-tig00000001	-	195621	195630	bdfab7a9-1792-4c9a-9428-261e109cdfae	0.33	-183.05	-183.37	1	3	TGCCCCGCCAGGCGCGCATT
-tig00000001	-	195646	195663	bdfab7a9-1792-4c9a-9428-261e109cdfae	-9.51	-204.75	-195.24	1	5	ATCAACGCGATCGGCAGTACGGCGCAGT
-tig00000001	-	195676	195685	bdfab7a9-1792-4c9a-9428-261e109cdfae	1.37	-132.18	-133.55	1	3	CAGTTCGCGCAGGGCGATCA
-tig00000001	-	195702	195702	bdfab7a9-1792-4c9a-9428-261e109cdfae	-0.35	-94.66	-94.31	1	1	CTTTGCGGAAA
-tig00000001	-	195720	195735	bdfab7a9-1792-4c9a-9428-261e109cdfae	-8.20	-210.65	-202.45	1	4	AATGGCGCGCTCCGCCTGCCCGGCAA
-tig00000001	-	195764	195781	bdfab7a9-1792-4c9a-9428-261e109cdfae	-5.50	-239.25	-233.75	1	4	TCAGCCGCTGGCGCAGATCGTCCGGGGC
-tig00000001	-	195803	195842	bdfab7a9-1792-4c9a-9428-261e109cdfae	-27.73	-357.82	-330.09	1	8	CACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACC
-tig00000001	-	195855	195864	bdfab7a9-1792-4c9a-9428-261e109cdfae	-5.22	-167.08	-161.86	1	3	AATTCCGGTGACGCCGCTGA
-tig00000001	-	195900	195906	bdfab7a9-1792-4c9a-9428-261e109cdfae	-5.29	-121.93	-116.64	1	2	CTGAACGTTGACGGTAG
-tig00000001	-	195945	195945	bdfab7a9-1792-4c9a-9428-261e109cdfae	-3.24	-110.65	-107.41	1	1	TTCTTCGATAT
-tig00000001	-	195959	195959	bdfab7a9-1792-4c9a-9428-261e109cdfae	-6.85	-107.18	-100.32	1	1	GCCAGCGTTTG
-tig00000001	-	195971	195971	bdfab7a9-1792-4c9a-9428-261e109cdfae	-0.92	-104.78	-103.86	1	1	GATGACGGGAA
-tig00000001	-	195982	195982	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.68	-114.38	-112.71	1	1	CCTGGCGCATT
-tig00000001	-	195994	196002	bdfab7a9-1792-4c9a-9428-261e109cdfae	-7.92	-149.90	-141.98	1	2	CTGTGCGCCAGTTCGTCCA
-tig00000001	-	196018	196044	bdfab7a9-1792-4c9a-9428-261e109cdfae	-28.38	-257.02	-228.64	1	7	ATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGAT
-tig00000001	-	196056	196056	bdfab7a9-1792-4c9a-9428-261e109cdfae	2.60	-97.48	-100.07	1	1	AAACTCGCTGA
-tig00000001	-	196067	196093	bdfab7a9-1792-4c9a-9428-261e109cdfae	-18.14	-306.69	-288.55	1	5	TATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAG
-tig00000001	-	196122	196125	bdfab7a9-1792-4c9a-9428-261e109cdfae	-3.83	-141.23	-137.39	1	2	CATGGCGGCGGTAT
-tig00000001	-	196136	196140	bdfab7a9-1792-4c9a-9428-261e109cdfae	-8.73	-125.97	-117.24	1	2	CTTTTCGCCCGTGGG
-tig00000001	-	196155	196155	bdfab7a9-1792-4c9a-9428-261e109cdfae	1.89	-120.48	-122.37	1	1	TACCACGCCAA
-tig00000001	-	196180	196190	bdfab7a9-1792-4c9a-9428-261e109cdfae	-8.85	-144.60	-135.74	1	3	CCTTGCGCCCGCAGTCGCTGG
-tig00000001	-	196210	196210	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.58	-87.40	-85.82	1	1	AGCATCGCCCA
-tig00000001	-	196224	196227	bdfab7a9-1792-4c9a-9428-261e109cdfae	-9.16	-107.32	-98.16	1	2	CTTCCCGACGCCTG
-tig00000001	-	196242	196242	bdfab7a9-1792-4c9a-9428-261e109cdfae	-0.91	-110.14	-109.23	1	1	GGCACCGAAGA
-tig00000001	-	196264	196274	bdfab7a9-1792-4c9a-9428-261e109cdfae	-14.94	-138.14	-123.20	1	4	TTCCCCGATGCGGCGCGGCAG
-tig00000001	-	196294	196319	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.86	-241.47	-238.61	1	5	GCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
-tig00000001	-	196342	196342	bdfab7a9-1792-4c9a-9428-261e109cdfae	1.43	-99.86	-101.29	1	1	TCCAGCGCCAG
-tig00000001	-	196372	196380	bdfab7a9-1792-4c9a-9428-261e109cdfae	-3.85	-149.38	-145.53	1	2	ACAACCGGCTGGCCGATAT
-tig00000001	-	196396	196396	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.74	-102.76	-101.02	1	1	ACCAGCGGTTG
-tig00000001	-	196416	196426	bdfab7a9-1792-4c9a-9428-261e109cdfae	-4.66	-137.57	-132.92	1	2	TTTTGCGATCAGTTGCGTGAG
-tig00000001	-	196440	196440	bdfab7a9-1792-4c9a-9428-261e109cdfae	0.16	-146.52	-146.69	1	1	TTCAACGCTGA
-tig00000001	-	196451	196466	bdfab7a9-1792-4c9a-9428-261e109cdfae	-7.25	-204.57	-197.32	1	5	GATTACGCGCTTTCGCCACGCGTGGG
-tig00000001	-	196483	196492	bdfab7a9-1792-4c9a-9428-261e109cdfae	-5.40	-166.52	-161.12	1	3	CAGGCCGCCGCTTGCGGGTG
-tig00000001	-	196514	196527	bdfab7a9-1792-4c9a-9428-261e109cdfae	-20.18	-210.58	-190.39	1	3	CAGCCCGCTTGCCGATGCCGTCAC
-tig00000001	-	196542	196576	bdfab7a9-1792-4c9a-9428-261e109cdfae	-14.53	-272.79	-258.27	1	7	TCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAAT
-tig00000001	-	196589	196595	bdfab7a9-1792-4c9a-9428-261e109cdfae	-7.76	-136.02	-128.26	1	3	AGCAACGCGTGCGGCTA
-tig00000001	-	196629	196629	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.87	-110.92	-109.05	1	1	CTGACCGCCAG
-tig00000001	-	196643	196643	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.15	-169.57	-168.43	1	1	GCTCCCGCCAG
-tig00000001	-	196677	196690	bdfab7a9-1792-4c9a-9428-261e109cdfae	-4.35	-149.29	-144.94	1	4	TCTGCCGTTGCCGACGGGCGACCA
-tig00000001	-	196706	196712	bdfab7a9-1792-4c9a-9428-261e109cdfae	-4.88	-168.58	-163.70	1	2	ATAGCCGTTGCCGGTAA
-tig00000001	-	196727	196749	bdfab7a9-1792-4c9a-9428-261e109cdfae	-10.16	-269.91	-259.75	1	5	CTGCCCGATTAATGCCGAACCGCGCACCGTATC
-tig00000001	-	196762	196770	bdfab7a9-1792-4c9a-9428-261e109cdfae	-4.51	-166.89	-162.38	1	2	CTTCACGAATCAACGAACC
-tig00000001	-	196810	196810	bdfab7a9-1792-4c9a-9428-261e109cdfae	-0.37	-107.84	-107.47	1	1	CAGTACGGTGG
-tig00000001	-	196823	196834	bdfab7a9-1792-4c9a-9428-261e109cdfae	-4.99	-154.05	-149.06	1	3	AGCAGCGGGTAAACGCCGCCAG
-tig00000001	-	196874	196878	bdfab7a9-1792-4c9a-9428-261e109cdfae	-7.46	-140.84	-133.39	1	2	AATGCCGGACGTAAT
-tig00000001	-	196909	196915	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.24	-141.08	-139.84	1	2	CAGACCGCAAACGGTCA
-tig00000001	-	196945	196952	bdfab7a9-1792-4c9a-9428-261e109cdfae	-4.21	-149.57	-145.36	1	2	GATACCGATAAACGGCAC
-tig00000001	-	196975	196975	bdfab7a9-1792-4c9a-9428-261e109cdfae	-4.00	-122.18	-118.18	1	1	CAGACCGTAAA
-tig00000001	-	196992	196995	bdfab7a9-1792-4c9a-9428-261e109cdfae	-5.79	-138.66	-132.87	1	2	AGTTACGGCGCAAC
-tig00000001	-	197011	197018	bdfab7a9-1792-4c9a-9428-261e109cdfae	-15.63	-135.06	-119.42	1	2	AGAAGCGGTAAGCGGTTT
-tig00000001	-	197032	197041	bdfab7a9-1792-4c9a-9428-261e109cdfae	-9.02	-170.05	-161.02	1	2	ACTCACGCCTTTAACGCCAG
-tig00000001	-	197059	197059	bdfab7a9-1792-4c9a-9428-261e109cdfae	-6.17	-123.63	-117.46	1	1	AAAGACGATAA
-tig00000001	-	197071	197071	bdfab7a9-1792-4c9a-9428-261e109cdfae	-0.97	-88.23	-87.26	1	1	CAAGGCGTTGA
-tig00000001	-	197084	197084	bdfab7a9-1792-4c9a-9428-261e109cdfae	-5.53	-83.54	-78.00	1	1	ATCACCGCACT
-tig00000001	-	197098	197108	bdfab7a9-1792-4c9a-9428-261e109cdfae	-3.19	-132.60	-129.41	1	3	GATTGCGGAGTCGGGCGAATG
-tig00000001	-	197132	197132	bdfab7a9-1792-4c9a-9428-261e109cdfae	2.66	-103.13	-105.79	1	1	TTCAGCGCATT
-tig00000001	-	197144	197168	bdfab7a9-1792-4c9a-9428-261e109cdfae	-8.12	-277.01	-268.89	1	6	AACTGCGGATACGTTGCCGCGAATGCCGCCGGAAT
-tig00000001	-	197179	197197	bdfab7a9-1792-4c9a-9428-261e109cdfae	-5.83	-222.63	-216.80	1	3	AATGGCGAAGTATTTCGCCACATCGTTGG
-tig00000001	-	197222	197229	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.86	-127.74	-125.87	1	2	GTCAGCGAGCCACGGGTC
-tig00000001	-	197266	197266	bdfab7a9-1792-4c9a-9428-261e109cdfae	-4.33	-121.16	-116.83	1	1	CACCTCGATCA
-tig00000001	-	197279	197279	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.93	-102.36	-100.43	1	1	TTGGTCGGGTT
-tig00000001	-	197290	197296	bdfab7a9-1792-4c9a-9428-261e109cdfae	-4.69	-132.72	-128.03	1	2	AGAGTCGAGATCGACCA
-tig00000001	-	197309	197321	bdfab7a9-1792-4c9a-9428-261e109cdfae	-19.21	-230.36	-211.15	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	-	197332	197350	bdfab7a9-1792-4c9a-9428-261e109cdfae	-9.04	-240.48	-231.44	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	-	197363	197420	bdfab7a9-1792-4c9a-9428-261e109cdfae	-20.37	-389.41	-369.04	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	-	197433	197433	bdfab7a9-1792-4c9a-9428-261e109cdfae	0.17	-90.03	-90.20	1	1	ACTGACGGATC
-tig00000001	-	197456	197470	bdfab7a9-1792-4c9a-9428-261e109cdfae	-16.75	-205.10	-188.35	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	-	197482	197509	bdfab7a9-1792-4c9a-9428-261e109cdfae	-26.85	-303.49	-276.64	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	-	197520	197530	bdfab7a9-1792-4c9a-9428-261e109cdfae	-12.12	-151.48	-139.36	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	-	197543	197543	bdfab7a9-1792-4c9a-9428-261e109cdfae	-5.00	-113.79	-108.79	1	1	ATCACCGTTTT
-tig00000001	-	197562	197577	bdfab7a9-1792-4c9a-9428-261e109cdfae	-8.21	-206.36	-198.15	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	-	197590	197599	bdfab7a9-1792-4c9a-9428-261e109cdfae	-5.15	-172.58	-167.43	1	2	AATACCGCCTTTGACGATAT
-tig00000001	-	197612	197620	bdfab7a9-1792-4c9a-9428-261e109cdfae	-6.48	-151.91	-145.43	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	-	197631	197631	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.23	-130.02	-127.79	1	1	GCACACGAGAA
-tig00000001	-	197654	197657	bdfab7a9-1792-4c9a-9428-261e109cdfae	-6.66	-128.37	-121.71	1	2	ACCAGCGGCGTGGC
-tig00000001	-	197670	197672	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.81	-139.67	-137.85	1	2	CCTGACGCGCAAC
-tig00000001	-	197683	197683	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.42	-101.17	-98.75	1	1	CTGATCGACTT
-tig00000001	-	197701	197701	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.93	-108.73	-105.80	1	1	AACATCGGTAG
-tig00000001	-	197719	197719	bdfab7a9-1792-4c9a-9428-261e109cdfae	-4.75	-101.19	-96.44	1	1	ACCACCGTTAG
-tig00000001	-	197736	197749	bdfab7a9-1792-4c9a-9428-261e109cdfae	-9.65	-146.45	-136.80	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	-	197763	197779	bdfab7a9-1792-4c9a-9428-261e109cdfae	-11.38	-176.90	-165.52	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	-	197791	197816	bdfab7a9-1792-4c9a-9428-261e109cdfae	-11.22	-196.23	-185.01	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	-	197837	197837	bdfab7a9-1792-4c9a-9428-261e109cdfae	1.66	-111.60	-113.26	1	1	TGGAGCGACTG
-tig00000001	-	197848	197856	bdfab7a9-1792-4c9a-9428-261e109cdfae	-12.81	-138.87	-126.06	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	-	197868	197878	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.48	-133.89	-131.41	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	-	197895	197906	bdfab7a9-1792-4c9a-9428-261e109cdfae	-14.79	-175.18	-160.39	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	-	197921	197921	bdfab7a9-1792-4c9a-9428-261e109cdfae	0.03	-86.48	-86.51	1	1	GCCAGCGAAGC
-tig00000001	-	197935	197948	bdfab7a9-1792-4c9a-9428-261e109cdfae	-12.69	-175.10	-162.40	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	-	197960	197969	bdfab7a9-1792-4c9a-9428-261e109cdfae	-9.20	-164.12	-154.92	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	-	197982	197999	bdfab7a9-1792-4c9a-9428-261e109cdfae	-10.61	-271.73	-261.12	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	-	198014	198014	bdfab7a9-1792-4c9a-9428-261e109cdfae	-9.79	-143.42	-133.63	1	1	GGTGCCGGTTT
-tig00000001	-	198035	198051	bdfab7a9-1792-4c9a-9428-261e109cdfae	-4.88	-187.26	-182.38	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	-	198064	198068	bdfab7a9-1792-4c9a-9428-261e109cdfae	-3.55	-107.67	-104.13	1	2	CTGCACGTCCGCTGG
-tig00000001	-	198087	198089	bdfab7a9-1792-4c9a-9428-261e109cdfae	-3.03	-94.94	-91.91	1	2	ACATTCGCGCCTA
-tig00000001	-	198100	198123	bdfab7a9-1792-4c9a-9428-261e109cdfae	-10.86	-251.01	-240.15	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	-	198137	198137	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.48	-88.43	-86.95	1	1	CAGGCCGCCAA
-tig00000001	-	198171	198171	bdfab7a9-1792-4c9a-9428-261e109cdfae	0.42	-123.30	-123.71	1	1	AGCAGCGCCAC
-tig00000001	-	198183	198188	bdfab7a9-1792-4c9a-9428-261e109cdfae	-7.90	-171.48	-163.58	1	2	AGTACCGTTACGCTGA
-tig00000001	-	198203	198233	bdfab7a9-1792-4c9a-9428-261e109cdfae	-7.39	-312.32	-304.93	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	-	198250	198250	bdfab7a9-1792-4c9a-9428-261e109cdfae	0.80	-110.42	-111.22	1	1	AAAGACGATAG
-tig00000001	-	198289	198313	bdfab7a9-1792-4c9a-9428-261e109cdfae	-17.02	-249.39	-232.38	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	-	198326	198336	bdfab7a9-1792-4c9a-9428-261e109cdfae	2.83	-144.90	-147.73	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	-	198352	198364	bdfab7a9-1792-4c9a-9428-261e109cdfae	-4.63	-179.87	-175.25	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	-	198399	198415	bdfab7a9-1792-4c9a-9428-261e109cdfae	-15.76	-169.45	-153.70	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	-	198427	198485	bdfab7a9-1792-4c9a-9428-261e109cdfae	-40.46	-427.63	-387.18	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	-	198513	198513	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.08	-127.87	-126.78	1	1	ACCATCGCAGG
-tig00000001	-	198527	198527	bdfab7a9-1792-4c9a-9428-261e109cdfae	0.60	-89.62	-90.22	1	1	AATATCGCCAG
-tig00000001	-	198545	198569	bdfab7a9-1792-4c9a-9428-261e109cdfae	-11.37	-279.86	-268.49	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	-	198585	198619	bdfab7a9-1792-4c9a-9428-261e109cdfae	-5.05	-279.25	-274.20	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	-	198660	198670	bdfab7a9-1792-4c9a-9428-261e109cdfae	-8.28	-151.37	-143.09	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	-	198684	198710	bdfab7a9-1792-4c9a-9428-261e109cdfae	-12.72	-255.84	-243.12	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	-	198728	198782	bdfab7a9-1792-4c9a-9428-261e109cdfae	-23.81	-387.59	-363.77	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	-	198812	198821	bdfab7a9-1792-4c9a-9428-261e109cdfae	-4.16	-177.01	-172.85	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	-	198834	198855	bdfab7a9-1792-4c9a-9428-261e109cdfae	-7.17	-250.23	-243.07	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	-	198872	198872	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.01	-108.07	-106.06	1	1	TTCACCGCTTC
-tig00000001	-	198884	198892	bdfab7a9-1792-4c9a-9428-261e109cdfae	-6.20	-179.71	-173.51	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	-	198907	198914	bdfab7a9-1792-4c9a-9428-261e109cdfae	-8.89	-145.63	-136.74	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	-	198927	198927	bdfab7a9-1792-4c9a-9428-261e109cdfae	-0.83	-104.72	-103.89	1	1	GTTTACGACTC
-tig00000001	-	198972	198987	bdfab7a9-1792-4c9a-9428-261e109cdfae	-7.47	-192.56	-185.09	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	-	199013	199013	bdfab7a9-1792-4c9a-9428-261e109cdfae	0.09	-101.37	-101.46	1	1	CAGTGCGCCAA
-tig00000001	-	199028	199034	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.70	-158.02	-156.32	1	2	CAACACGGTGCCGATTA
-tig00000001	-	199056	199088	bdfab7a9-1792-4c9a-9428-261e109cdfae	-17.32	-263.94	-246.62	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	-	199112	199117	bdfab7a9-1792-4c9a-9428-261e109cdfae	-8.65	-167.02	-158.36	1	2	ACCAGCGAACCGGCAA
-tig00000001	-	199133	199133	bdfab7a9-1792-4c9a-9428-261e109cdfae	-0.83	-84.37	-83.55	1	1	ATCACCGGGAT
-tig00000001	-	199147	199156	bdfab7a9-1792-4c9a-9428-261e109cdfae	-6.93	-146.68	-139.75	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	-	199172	199172	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.08	-110.14	-109.05	1	1	CAGAACGCCAG
-tig00000001	-	199193	199193	bdfab7a9-1792-4c9a-9428-261e109cdfae	0.41	-99.56	-99.97	1	1	CAGAACGGAGA
-tig00000001	-	199204	199228	bdfab7a9-1792-4c9a-9428-261e109cdfae	-8.78	-259.39	-250.61	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	-	199240	199255	bdfab7a9-1792-4c9a-9428-261e109cdfae	-9.46	-200.05	-190.59	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	-	199267	199267	bdfab7a9-1792-4c9a-9428-261e109cdfae	-0.24	-128.91	-128.67	1	1	CACTTCGCTAA
-tig00000001	-	199280	199280	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.30	-91.84	-89.54	1	1	CCATGCGGGCC
-tig00000001	-	199300	199336	bdfab7a9-1792-4c9a-9428-261e109cdfae	-30.31	-319.98	-289.67	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	-	199352	199355	bdfab7a9-1792-4c9a-9428-261e109cdfae	-6.08	-140.03	-133.95	1	2	ACCAGCGTCGGGGT
-tig00000001	-	199393	199402	bdfab7a9-1792-4c9a-9428-261e109cdfae	-12.18	-164.71	-152.53	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	-	199423	199430	bdfab7a9-1792-4c9a-9428-261e109cdfae	-8.86	-159.73	-150.87	1	2	TATTCCGGTGTACGACCA
-tig00000001	-	199446	199446	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.28	-101.54	-100.25	1	1	CAGCCCGGCAA
-tig00000001	-	199459	199459	bdfab7a9-1792-4c9a-9428-261e109cdfae	0.46	-98.35	-98.80	1	1	AACACCGCCAG
-tig00000001	-	199485	199485	bdfab7a9-1792-4c9a-9428-261e109cdfae	0.11	-119.11	-119.22	1	1	CATGCCGTAAA
-tig00000001	-	199500	199509	bdfab7a9-1792-4c9a-9428-261e109cdfae	-5.83	-155.63	-149.79	1	3	AGAACCGACACCGCCGAACA
-tig00000001	-	199543	199543	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.01	-108.04	-106.03	1	1	CACATCGGCAC
-tig00000001	-	199557	199570	bdfab7a9-1792-4c9a-9428-261e109cdfae	-16.82	-198.61	-181.79	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	-	199582	199593	bdfab7a9-1792-4c9a-9428-261e109cdfae	-5.24	-148.94	-143.70	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	-	199606	199621	bdfab7a9-1792-4c9a-9428-261e109cdfae	-20.84	-195.69	-174.85	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	-	199644	199652	bdfab7a9-1792-4c9a-9428-261e109cdfae	-6.47	-198.91	-192.44	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	-	199687	199687	bdfab7a9-1792-4c9a-9428-261e109cdfae	-5.99	-102.01	-96.02	1	1	CTGTCCGTGCC
-tig00000001	-	199740	199746	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.32	-144.37	-142.06	1	2	CACCACGCCTACGCAGA
-tig00000001	-	199770	199770	bdfab7a9-1792-4c9a-9428-261e109cdfae	1.34	-180.29	-181.63	1	1	GACATCGCCCA
-tig00000001	-	199786	199802	bdfab7a9-1792-4c9a-9428-261e109cdfae	-8.35	-227.58	-219.23	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	-	199833	199836	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.47	-114.20	-111.73	1	2	CACAGCGCCGTTGG
-tig00000001	-	199854	199854	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.67	-111.79	-110.12	1	1	AAGATCGCCAG
-tig00000001	-	199868	199868	bdfab7a9-1792-4c9a-9428-261e109cdfae	-4.81	-113.01	-108.20	1	1	CTGCACGAAGT
-tig00000001	-	199883	199883	bdfab7a9-1792-4c9a-9428-261e109cdfae	-4.11	-71.93	-67.82	1	1	CAGTGCGGTTG
-tig00000001	-	199899	199908	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.67	-126.17	-123.50	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	-	199931	199943	bdfab7a9-1792-4c9a-9428-261e109cdfae	-9.38	-156.35	-146.97	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	-	199956	199956	bdfab7a9-1792-4c9a-9428-261e109cdfae	-5.70	-124.86	-119.17	1	1	TTGATCGCTTC
-tig00000001	-	199998	199998	bdfab7a9-1792-4c9a-9428-261e109cdfae	-5.47	-101.38	-95.91	1	1	TGTTGCGCTCC
 tig00000001	-	200009	200009	bdfab7a9-1792-4c9a-9428-261e109cdfae	-2.25	-99.31	-97.06	1	1	TTCAACGGTAT
 tig00000001	-	200046	200046	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.66	-107.76	-106.10	1	1	TGCAGCGCACC
 tig00000001	-	200081	200081	bdfab7a9-1792-4c9a-9428-261e109cdfae	-4.15	-137.48	-133.33	1	1	AACAACGCCAC
@@ -1045,253 +97,6 @@
 tig00000001	-	200400	200400	bdfab7a9-1792-4c9a-9428-261e109cdfae	-1.42	-96.23	-94.81	1	1	AGCACCGCCAG
 tig00000001	-	200423	200423	bdfab7a9-1792-4c9a-9428-261e109cdfae	-8.34	-114.32	-105.97	1	1	CAGGCCGAGAA
 tig00000001	-	200461	200512	bdfab7a9-1792-4c9a-9428-261e109cdfae	-15.84	-389.72	-373.88	1	9	TCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAA
-tig00000001	-	193168	193168	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-6.83	-137.65	-130.82	1	1	TTTTCCGGCAT
-tig00000001	-	193187	193197	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-6.18	-167.43	-161.25	1	2	AGCACCGCCAGCAGGCGGAAC
-tig00000001	-	193236	193273	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-23.77	-307.20	-283.43	1	7	CACCCCGGTGAATCACGCGGGCGGCTAAATCGACGGTAACATCGGAAA
-tig00000001	-	193289	193300	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-20.17	-164.08	-143.91	1	4	ACCAGCGGATCGGGCGCGGTGG
-tig00000001	-	193317	193338	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-19.10	-242.16	-223.07	1	6	AGTGGCGGCGTAATGCGACGCGCAGACGGGCC
-tig00000001	-	193351	193351	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-4.05	-127.18	-123.13	1	1	CAATTCGCCAA
-tig00000001	-	193364	193364	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-3.48	-122.98	-119.50	1	1	CCAAACGGCTT
-tig00000001	-	193385	193430	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-74.46	-441.89	-367.44	1	9	TCATCCGCTCCGGCATCCAGCGCGGCGATTTTGTCGCTCTTCGCTGCGTGCGGAAA
-tig00000001	-	193446	193454	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-15.27	-166.69	-151.43	1	3	ATCACCGGCACCGCGCTCC
-tig00000001	-	193465	193474	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-12.06	-183.03	-170.97	1	3	ACTGGCGCAGGTCGCGGATA
-tig00000001	-	193499	193514	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-18.05	-227.73	-209.68	1	3	ACCATCGGGCAGGCCGAGATCGAGAA
-tig00000001	-	193537	193545	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-14.94	-150.86	-135.92	1	2	GCTTACGGGTTGCCGCTTC
-tig00000001	-	193559	193574	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-29.36	-212.71	-183.36	1	4	CAAGCCGCGTTGCAGCGTTTCGGCCT
-tig00000001	-	193586	193627	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-31.03	-379.39	-348.36	1	9	AAAGACGCGCATCCCGTCGCCCTCCAGCGCCGTGCGCAGAAAGCGACGAATA
-tig00000001	-	193658	193658	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-5.34	-106.41	-101.07	1	1	CAGAACGTTTG
-tig00000001	-	193720	193720	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-9.13	-116.03	-106.90	1	1	TAACACGAAAA
-tig00000001	-	193740	193754	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-25.22	-221.34	-196.13	1	4	CCTTCCGGTCGGTTGAACGCGGTAA
-tig00000001	-	193769	193769	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-1.93	-141.42	-139.49	1	1	GCCCCCGTACA
-tig00000001	-	193783	193787	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-11.45	-188.92	-177.47	1	2	ACTATCGCCCGACAA
-tig00000001	-	193815	193824	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-9.93	-239.17	-229.24	1	2	TACCCCGGTACTGCCGACTC
-tig00000001	-	193838	193840	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-2.99	-138.69	-135.70	1	2	ATTCCCGCGAGCA
-tig00000001	-	193860	193860	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-4.77	-103.82	-99.05	1	1	AATATCGTCTG
-tig00000001	-	193878	193892	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-7.38	-216.93	-209.55	1	3	CCTGGCGGAAGACCGGGGCCGTTAT
-tig00000001	-	193922	193940	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-16.45	-229.13	-212.68	1	3	ATTTTCGCCCTCAACGTGGGCATCGATAC
-tig00000001	-	193952	193965	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-14.22	-213.30	-199.08	1	3	AATTTCGGCCTGCGCACCCGCATA
-tig00000001	-	193977	193979	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-13.31	-121.79	-108.49	1	2	TTCACCGCGTTCT
-tig00000001	-	194005	194005	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-10.89	-144.57	-133.68	1	1	GCACCCGTTCA
-tig00000001	-	194021	194027	1d5ccec9-296a-4afd-ad74-010ebd3732ec	1.48	-150.41	-151.90	1	2	TGGCCCGTCAACGTGGA
-tig00000001	-	194043	194043	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-13.34	-115.74	-102.40	1	1	GTCAGCGGTTC
-tig00000001	-	194070	194082	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-9.80	-201.92	-192.12	1	3	ATGGGCGACGATAAACCCGGTTC
-tig00000001	-	194100	194108	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-5.02	-191.65	-186.63	1	3	TGCAGCGCGCTGCCGACTA
-tig00000001	-	194124	194124	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-11.58	-146.40	-134.82	1	1	TCCAGCGTTAA
-tig00000001	-	194153	194156	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-12.17	-139.70	-127.53	1	2	AAAGCCGCCGGACT
-tig00000001	-	194167	194169	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-8.94	-137.88	-128.93	1	2	GAATTCGCGCCAT
-tig00000001	-	194197	194197	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-2.16	-115.69	-113.53	1	1	CCAGTCGGGTA
-tig00000001	-	194221	194228	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-6.89	-175.02	-168.14	1	2	GCTGACGGATCTCGCTGG
-tig00000001	-	194239	194243	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-19.44	-155.76	-136.32	1	2	CCTGGCGGGCGTGGG
-tig00000001	-	194258	194258	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-3.05	-180.95	-177.90	1	1	TCCTTCGCTTG
-tig00000001	-	194270	194274	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-11.87	-212.56	-200.69	1	2	CAGATCGAGCGTTAA
-tig00000001	-	194304	194317	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-26.92	-195.29	-168.37	1	4	AGCACCGTAAGCGGCGTGCGTAAA
-tig00000001	-	194328	194337	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-17.01	-211.81	-194.80	1	3	TCATGCGAAAGCGCCGCCAG
-tig00000001	-	194348	194353	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-3.13	-190.91	-187.78	1	2	CAGGGCGTTGCGGATC
-tig00000001	-	194365	194369	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-12.43	-136.24	-123.81	1	2	GTTCACGTTCGCTTG
-tig00000001	-	194380	194382	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-5.25	-129.85	-124.60	1	2	CCATCCGCGCCTG
-tig00000001	-	194393	194413	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-33.03	-280.78	-247.75	1	4	TTCTTCGCTGGCGGTTAGCGTCAGCCGCTCA
-tig00000001	-	194429	194445	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-11.99	-208.42	-196.43	1	3	ATTGGCGACTAACAGCGTAAACGTCTC
-tig00000001	-	194458	194458	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-6.16	-125.60	-119.44	1	1	GCAGGCGCTGC
-tig00000001	-	194469	194469	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-1.17	-107.76	-106.59	1	1	TGTTCCGGGAT
-tig00000001	-	194485	194485	1d5ccec9-296a-4afd-ad74-010ebd3732ec	0.63	-125.61	-126.24	1	1	ACTGGCGCAGA
-tig00000001	-	194496	194496	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-2.79	-163.21	-160.43	1	1	TTCCCCGCTCC
-tig00000001	-	194515	194515	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-4.08	-134.64	-130.56	1	1	CAGCCCGTAGG
-tig00000001	-	194527	194539	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-5.13	-177.39	-172.26	1	3	TTTCTCGCCGCTTTTAGCGGCAA
-tig00000001	-	194554	194587	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-37.46	-347.03	-309.57	1	7	TGGTACGGTACACCGGGTAACGTGTCGGTGCCCGCGCCCGCAGG
-tig00000001	-	194617	194638	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-15.70	-283.10	-267.40	1	5	CACTGCGCGATGGCATCGTCCCACGGCGTCAT
-tig00000001	-	194650	194650	1d5ccec9-296a-4afd-ad74-010ebd3732ec	0.02	-109.35	-109.37	1	1	CCTTGCGGATG
-tig00000001	-	194662	194662	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-0.55	-120.91	-120.35	1	1	GTTAACGGCTG
-tig00000001	-	194676	194685	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-0.79	-230.16	-229.37	1	2	TTTACCGTTGTCATCGGGCA
-tig00000001	-	194705	194705	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-2.47	-110.37	-107.90	1	1	GACTGCGGGCA
-tig00000001	-	194716	194716	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-0.35	-118.21	-117.86	1	1	TGAAACGTGGA
-tig00000001	-	194736	194736	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-6.30	-106.10	-99.81	1	1	TTGTTCGCTGG
-tig00000001	-	194748	194773	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-9.53	-262.79	-253.26	1	4	GGCAGCGATATCCTGCGGACTGCGGCCCACCGCCAG
-tig00000001	-	194785	194785	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-7.40	-158.81	-151.42	1	1	GCTTTCGACAT
-tig00000001	-	194804	194850	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-47.16	-447.96	-400.79	1	9	AGTGCCGTGTGCGTTGCTCGCGGTAACGGGCTACCCGCGCCTGATAACGCACGCCAG
-tig00000001	-	194868	194868	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-5.13	-98.38	-93.25	1	1	GTTCCCGATCA
-tig00000001	-	194880	194883	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-4.47	-154.76	-150.28	1	2	CAGCCCGACGGTTA
-tig00000001	-	194896	194898	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-14.06	-161.72	-147.66	1	2	ATCACCGCGAAGG
-tig00000001	-	194928	194949	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-44.37	-254.12	-209.75	1	6	AGAGACGGCGAGCGTGCCGCGTGGGGCGATAA
-tig00000001	-	194963	194963	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-6.65	-107.81	-101.16	1	1	GAGATCGAAAC
-tig00000001	-	194984	194984	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-8.60	-117.22	-108.62	1	1	AATGACGGTGG
-tig00000001	-	195007	195007	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-9.47	-137.52	-128.05	1	1	GCCAGCGTCCA
-tig00000001	-	195021	195021	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-4.74	-125.90	-121.15	1	1	AATAGCGCCAC
-tig00000001	-	195035	195035	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-4.66	-148.41	-143.76	1	1	CACCACGCCAA
-tig00000001	-	195065	195075	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-14.97	-226.14	-211.17	1	2	GTTGGCGGCATCAAACGCCAT
-tig00000001	-	195110	195134	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-24.19	-324.16	-299.97	1	6	GATAACGGCGCATAACGCGGCGGCAACCACGCATC
-tig00000001	-	195154	195154	1d5ccec9-296a-4afd-ad74-010ebd3732ec	0.25	-117.75	-118.00	1	1	GTACACGCCAC
-tig00000001	-	195175	195206	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-21.07	-298.73	-277.66	1	7	AAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTG
-tig00000001	-	195222	195224	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-5.74	-133.39	-127.65	1	2	TCAAGCGCGACCA
-tig00000001	-	195239	195264	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-33.49	-306.20	-272.71	1	6	CTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCA
-tig00000001	-	195275	195313	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-51.39	-345.88	-294.48	1	9	GCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAA
-tig00000001	-	195328	195328	1d5ccec9-296a-4afd-ad74-010ebd3732ec	0.05	-128.81	-128.86	1	1	CTTGCCGAGAT
-tig00000001	-	195342	195359	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-14.18	-237.01	-222.83	1	3	GTTCACGGGCATAACGCACTACCGCTTT
-tig00000001	-	195371	195371	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-1.38	-116.24	-114.85	1	1	TCTTCCGCTGG
-tig00000001	-	195392	195400	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-19.62	-210.89	-191.27	1	3	GTTGCCGTCTCCGCGCCCA
-tig00000001	-	195413	195427	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-0.37	-179.28	-178.91	1	3	TCCTGCGCCAGACGTAAGGCGCTGA
-tig00000001	-	195441	195460	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-10.36	-164.43	-154.07	1	4	TTGCCCGACGTTTTTTCCGGTAAGCGGTGC
-tig00000001	-	195489	195500	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-6.38	-221.67	-215.29	1	3	TACACCGCGTGCCAGACGCTAC
-tig00000001	-	195511	195535	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-26.67	-296.73	-270.06	1	7	CCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACC
-tig00000001	-	195547	195553	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-12.89	-130.92	-118.03	1	2	GTTTTCGCTGCCGGTGT
-tig00000001	-	195565	195565	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-5.85	-134.16	-128.31	1	1	ATGGCCGATGC
-tig00000001	-	195581	195590	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-7.15	-180.95	-173.80	1	5	AGGATCGCGTCGCGCGTGTG
-tig00000001	-	195608	195608	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-1.24	-151.02	-149.78	1	1	CTCTTCGCCAG
-tig00000001	-	195621	195630	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-14.39	-222.88	-208.49	1	3	TGCCCCGCCAGGCGCGCATT
-tig00000001	-	195646	195663	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-3.23	-233.44	-230.21	1	5	ATCAACGCGATCGGCAGTACGGCGCAGT
-tig00000001	-	195676	195685	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-12.47	-185.96	-173.49	1	3	CAGTTCGCGCAGGGCGATCA
-tig00000001	-	195702	195702	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-4.13	-116.11	-111.98	1	1	CTTTGCGGAAA
-tig00000001	-	195720	195735	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-17.70	-313.14	-295.44	1	4	AATGGCGCGCTCCGCCTGCCCGGCAA
-tig00000001	-	195764	195781	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-22.07	-267.87	-245.81	1	4	TCAGCCGCTGGCGCAGATCGTCCGGGGC
-tig00000001	-	195803	195842	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-42.59	-469.01	-426.42	1	8	CACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACC
-tig00000001	-	195855	195864	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-12.35	-206.87	-194.52	1	3	AATTCCGGTGACGCCGCTGA
-tig00000001	-	195900	195906	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-13.27	-143.68	-130.41	1	2	CTGAACGTTGACGGTAG
-tig00000001	-	195945	195945	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-7.00	-116.01	-109.02	1	1	TTCTTCGATAT
-tig00000001	-	195959	195959	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-14.88	-126.03	-111.15	1	1	GCCAGCGTTTG
-tig00000001	-	195971	195971	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-3.92	-95.78	-91.87	1	1	GATGACGGGAA
-tig00000001	-	195982	195982	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-6.69	-106.81	-100.11	1	1	CCTGGCGCATT
-tig00000001	-	195994	196002	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-19.74	-184.35	-164.61	1	2	CTGTGCGCCAGTTCGTCCA
-tig00000001	-	196018	196044	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-42.53	-273.12	-230.59	1	7	ATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGAT
-tig00000001	-	196056	196056	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-3.08	-127.32	-124.24	1	1	AAACTCGCTGA
-tig00000001	-	196067	196093	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-50.88	-325.50	-274.62	1	5	TATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAG
-tig00000001	-	196122	196125	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-14.48	-133.15	-118.67	1	2	CATGGCGGCGGTAT
-tig00000001	-	196136	196140	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-12.72	-131.39	-118.66	1	2	CTTTTCGCCCGTGGG
-tig00000001	-	196155	196155	1d5ccec9-296a-4afd-ad74-010ebd3732ec	0.68	-96.31	-96.99	1	1	TACCACGCCAA
-tig00000001	-	196180	196190	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-21.85	-227.83	-205.98	1	3	CCTTGCGCCCGCAGTCGCTGG
-tig00000001	-	196210	196210	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-17.22	-147.97	-130.76	1	1	AGCATCGCCCA
-tig00000001	-	196224	196227	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-16.25	-162.80	-146.55	1	2	CTTCCCGACGCCTG
-tig00000001	-	196242	196242	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-0.02	-132.28	-132.26	1	1	GGCACCGAAGA
-tig00000001	-	196264	196274	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-10.12	-195.57	-185.45	1	4	TTCCCCGATGCGGCGCGGCAG
-tig00000001	-	196294	196319	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-17.77	-260.16	-242.39	1	5	GCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
-tig00000001	-	196342	196342	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-3.92	-101.61	-97.69	1	1	TCCAGCGCCAG
-tig00000001	-	196372	196380	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-0.53	-196.55	-196.01	1	2	ACAACCGGCTGGCCGATAT
-tig00000001	-	196396	196396	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-4.87	-130.69	-125.82	1	1	ACCAGCGGTTG
-tig00000001	-	196416	196426	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-28.33	-262.86	-234.52	1	2	TTTTGCGATCAGTTGCGTGAG
-tig00000001	-	196440	196440	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-2.63	-111.16	-108.54	1	1	TTCAACGCTGA
-tig00000001	-	196451	196466	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-11.39	-216.36	-204.97	1	5	GATTACGCGCTTTCGCCACGCGTGGG
-tig00000001	-	196483	196492	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-20.82	-210.28	-189.46	1	3	CAGGCCGCCGCTTGCGGGTG
-tig00000001	-	196514	196527	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-13.46	-246.20	-232.74	1	3	CAGCCCGCTTGCCGATGCCGTCAC
-tig00000001	-	196542	196576	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-36.06	-389.85	-353.79	1	7	TCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAAT
-tig00000001	-	196589	196595	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-5.92	-188.17	-182.26	1	3	AGCAACGCGTGCGGCTA
-tig00000001	-	196629	196629	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-2.95	-120.39	-117.44	1	1	CTGACCGCCAG
-tig00000001	-	196643	196643	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-5.98	-132.85	-126.87	1	1	GCTCCCGCCAG
-tig00000001	-	196677	196690	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-10.77	-176.62	-165.85	1	4	TCTGCCGTTGCCGACGGGCGACCA
-tig00000001	-	196706	196712	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-8.09	-136.57	-128.48	1	2	ATAGCCGTTGCCGGTAA
-tig00000001	-	196727	196749	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-37.53	-301.91	-264.38	1	5	CTGCCCGATTAATGCCGAACCGCGCACCGTATC
-tig00000001	-	196762	196770	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-7.48	-164.60	-157.12	1	2	CTTCACGAATCAACGAACC
-tig00000001	-	196810	196810	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-1.42	-123.54	-122.12	1	1	CAGTACGGTGG
-tig00000001	-	196823	196834	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-12.77	-211.82	-199.06	1	3	AGCAGCGGGTAAACGCCGCCAG
-tig00000001	-	196874	196878	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-8.03	-113.13	-105.10	1	2	AATGCCGGACGTAAT
-tig00000001	-	196909	196915	1d5ccec9-296a-4afd-ad74-010ebd3732ec	2.38	-169.93	-172.31	1	2	CAGACCGCAAACGGTCA
-tig00000001	-	196945	196952	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-1.86	-154.21	-152.36	1	2	GATACCGATAAACGGCAC
-tig00000001	-	196975	196975	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-2.55	-115.67	-113.12	1	1	CAGACCGTAAA
-tig00000001	-	196992	196995	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-9.01	-142.68	-133.67	1	2	AGTTACGGCGCAAC
-tig00000001	-	197011	197018	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-8.57	-170.77	-162.20	1	2	AGAAGCGGTAAGCGGTTT
-tig00000001	-	197032	197041	1d5ccec9-296a-4afd-ad74-010ebd3732ec	0.83	-180.63	-181.46	1	2	ACTCACGCCTTTAACGCCAG
-tig00000001	-	197059	197059	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-5.51	-159.83	-154.33	1	1	AAAGACGATAA
-tig00000001	-	197071	197071	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-3.24	-90.71	-87.47	1	1	CAAGGCGTTGA
-tig00000001	-	197084	197084	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-5.92	-135.43	-129.51	1	1	ATCACCGCACT
-tig00000001	-	197098	197108	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-6.05	-226.05	-220.00	1	3	GATTGCGGAGTCGGGCGAATG
-tig00000001	-	197132	197132	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-1.17	-149.00	-147.84	1	1	TTCAGCGCATT
-tig00000001	-	197144	197168	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-31.35	-273.98	-242.63	1	6	AACTGCGGATACGTTGCCGCGAATGCCGCCGGAAT
-tig00000001	-	197179	197197	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-12.20	-190.49	-178.29	1	3	AATGGCGAAGTATTTCGCCACATCGTTGG
-tig00000001	-	197222	197229	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-15.28	-182.72	-167.44	1	2	GTCAGCGAGCCACGGGTC
-tig00000001	-	197266	197266	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-1.04	-116.54	-115.50	1	1	CACCTCGATCA
-tig00000001	-	197279	197279	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-1.77	-109.92	-108.15	1	1	TTGGTCGGGTT
-tig00000001	-	197290	197296	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-15.63	-235.67	-220.04	1	2	AGAGTCGAGATCGACCA
-tig00000001	-	197309	197321	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-34.99	-301.39	-266.40	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	-	197332	197350	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-26.70	-264.33	-237.63	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	-	197363	197420	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-53.79	-524.46	-470.66	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	-	197433	197433	1d5ccec9-296a-4afd-ad74-010ebd3732ec	0.99	-168.05	-169.04	1	1	ACTGACGGATC
-tig00000001	-	197456	197470	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-30.77	-195.38	-164.61	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	-	197482	197509	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-38.16	-263.55	-225.39	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	-	197520	197530	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-15.13	-156.69	-141.56	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	-	197543	197543	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-6.63	-103.57	-96.94	1	1	ATCACCGTTTT
-tig00000001	-	197562	197577	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-21.15	-214.19	-193.04	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	-	197590	197599	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-9.11	-216.46	-207.34	1	2	AATACCGCCTTTGACGATAT
-tig00000001	-	197612	197620	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-18.47	-212.86	-194.39	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	-	197631	197631	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-5.68	-148.40	-142.72	1	1	GCACACGAGAA
-tig00000001	-	197654	197657	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-13.40	-175.38	-161.98	1	2	ACCAGCGGCGTGGC
-tig00000001	-	197670	197672	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-3.15	-155.50	-152.35	1	2	CCTGACGCGCAAC
-tig00000001	-	197683	197683	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-12.09	-156.00	-143.91	1	1	CTGATCGACTT
-tig00000001	-	197701	197701	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-1.06	-97.25	-96.19	1	1	AACATCGGTAG
-tig00000001	-	197719	197719	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-4.03	-94.92	-90.89	1	1	ACCACCGTTAG
-tig00000001	-	197736	197749	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-8.92	-208.74	-199.82	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	-	197763	197779	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-12.34	-211.02	-198.68	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	-	197791	197816	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-27.40	-254.91	-227.51	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	-	197837	197837	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-11.35	-144.45	-133.10	1	1	TGGAGCGACTG
-tig00000001	-	197848	197856	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-22.80	-208.58	-185.78	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	-	197868	197878	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-14.72	-181.08	-166.36	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	-	197895	197906	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-18.39	-214.15	-195.76	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	-	197921	197921	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-7.10	-126.41	-119.30	1	1	GCCAGCGAAGC
-tig00000001	-	197935	197948	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-22.18	-209.80	-187.62	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	-	197960	197969	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-15.33	-165.74	-150.42	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	-	197982	197999	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-29.85	-231.27	-201.42	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	-	198014	198014	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-8.88	-125.53	-116.65	1	1	GGTGCCGGTTT
-tig00000001	-	198035	198051	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-16.23	-210.24	-194.01	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	-	198064	198068	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-10.24	-163.67	-153.44	1	2	CTGCACGTCCGCTGG
-tig00000001	-	198087	198089	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-11.10	-130.12	-119.03	1	2	ACATTCGCGCCTA
-tig00000001	-	198100	198123	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-16.94	-259.34	-242.40	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	-	198137	198137	1d5ccec9-296a-4afd-ad74-010ebd3732ec	1.20	-123.19	-124.38	1	1	CAGGCCGCCAA
-tig00000001	-	198171	198171	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-2.16	-120.89	-118.73	1	1	AGCAGCGCCAC
-tig00000001	-	198183	198188	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-10.27	-167.08	-156.82	1	2	AGTACCGTTACGCTGA
-tig00000001	-	198203	198233	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-20.22	-311.53	-291.31	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	-	198250	198250	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-5.37	-122.26	-116.88	1	1	AAAGACGATAG
-tig00000001	-	198289	198313	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-27.56	-307.96	-280.40	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	-	198326	198336	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-15.22	-267.04	-251.82	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	-	198352	198364	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-13.28	-203.96	-190.68	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	-	198399	198415	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-18.06	-223.72	-205.66	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	-	198427	198485	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-50.92	-510.03	-459.11	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	-	198513	198513	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-4.08	-131.16	-127.08	1	1	ACCATCGCAGG
-tig00000001	-	198527	198527	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-0.89	-116.74	-115.85	1	1	AATATCGCCAG
-tig00000001	-	198545	198569	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-23.95	-267.20	-243.25	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	-	198585	198619	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-32.18	-351.56	-319.38	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	-	198660	198670	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-13.88	-235.73	-221.85	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	-	198684	198710	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-16.43	-302.87	-286.43	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	-	198728	198782	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-34.86	-481.41	-446.55	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	-	198812	198821	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-11.30	-226.97	-215.67	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	-	198834	198855	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-17.04	-302.90	-285.87	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	-	198872	198872	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-1.57	-135.26	-133.69	1	1	TTCACCGCTTC
-tig00000001	-	198884	198892	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-11.21	-180.64	-169.43	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	-	198907	198914	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-10.40	-293.18	-282.78	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	-	198927	198927	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-2.44	-143.01	-140.57	1	1	GTTTACGACTC
-tig00000001	-	198972	198987	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-10.26	-198.14	-187.88	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	-	199013	199013	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-5.15	-133.88	-128.72	1	1	CAGTGCGCCAA
-tig00000001	-	199028	199034	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-6.27	-210.59	-204.32	1	2	CAACACGGTGCCGATTA
-tig00000001	-	199056	199088	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-33.99	-321.43	-287.43	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	-	199112	199117	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-9.72	-144.65	-134.94	1	2	ACCAGCGAACCGGCAA
-tig00000001	-	199133	199133	1d5ccec9-296a-4afd-ad74-010ebd3732ec	1.06	-88.99	-90.05	1	1	ATCACCGGGAT
-tig00000001	-	199147	199156	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-15.18	-200.29	-185.12	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	-	199172	199172	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-6.82	-97.80	-90.97	1	1	CAGAACGCCAG
-tig00000001	-	199193	199193	1d5ccec9-296a-4afd-ad74-010ebd3732ec	0.22	-137.33	-137.55	1	1	CAGAACGGAGA
-tig00000001	-	199204	199228	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-25.25	-259.59	-234.34	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	-	199240	199255	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-27.84	-200.67	-172.83	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	-	199267	199267	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-1.59	-108.26	-106.67	1	1	CACTTCGCTAA
-tig00000001	-	199280	199280	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-0.26	-108.51	-108.24	1	1	CCATGCGGGCC
-tig00000001	-	199300	199336	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-34.02	-380.23	-346.21	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	-	199352	199355	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-10.41	-178.03	-167.62	1	2	ACCAGCGTCGGGGT
-tig00000001	-	199393	199402	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-8.97	-170.84	-161.87	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	-	199423	199430	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-7.03	-155.59	-148.56	1	2	TATTCCGGTGTACGACCA
-tig00000001	-	199446	199446	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-6.61	-157.05	-150.44	1	1	CAGCCCGGCAA
-tig00000001	-	199459	199459	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-3.77	-125.55	-121.78	1	1	AACACCGCCAG
-tig00000001	-	199485	199485	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-3.52	-104.36	-100.84	1	1	CATGCCGTAAA
-tig00000001	-	199500	199509	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-14.57	-250.43	-235.87	1	3	AGAACCGACACCGCCGAACA
-tig00000001	-	199543	199543	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-4.38	-133.75	-129.37	1	1	CACATCGGCAC
-tig00000001	-	199557	199570	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-16.99	-218.74	-201.75	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	-	199582	199593	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-21.59	-204.26	-182.66	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	-	199606	199621	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-26.49	-246.97	-220.48	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	-	199644	199652	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-18.33	-222.37	-204.04	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	-	199687	199687	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-3.60	-103.83	-100.23	1	1	CTGTCCGTGCC
-tig00000001	-	199740	199746	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-10.11	-209.90	-199.79	1	2	CACCACGCCTACGCAGA
-tig00000001	-	199770	199770	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-12.70	-122.05	-109.35	1	1	GACATCGCCCA
-tig00000001	-	199786	199802	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-28.85	-275.53	-246.67	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	-	199833	199836	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-10.66	-128.33	-117.68	1	2	CACAGCGCCGTTGG
-tig00000001	-	199854	199854	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-2.69	-120.36	-117.67	1	1	AAGATCGCCAG
-tig00000001	-	199868	199868	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-4.42	-103.96	-99.54	1	1	CTGCACGAAGT
-tig00000001	-	199883	199883	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-1.21	-111.00	-109.79	1	1	CAGTGCGGTTG
-tig00000001	-	199899	199908	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-8.07	-147.99	-139.92	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	-	199931	199943	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-23.00	-210.89	-187.90	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	-	199956	199956	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-7.29	-108.36	-101.07	1	1	TTGATCGCTTC
-tig00000001	-	199998	199998	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-12.39	-127.55	-115.16	1	1	TGTTGCGCTCC
 tig00000001	-	200009	200009	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-3.76	-133.64	-129.88	1	1	TTCAACGGTAT
 tig00000001	-	200046	200046	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-5.68	-140.43	-134.75	1	1	TGCAGCGCACC
 tig00000001	-	200081	200081	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-1.99	-119.84	-117.85	1	1	AACAACGCCAC
@@ -1302,488 +107,11 @@
 tig00000001	-	200224	200233	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-10.24	-168.70	-158.46	1	2	TGCACCGTTAAGCCCGCCAT
 tig00000001	-	200257	200257	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-3.29	-123.48	-120.18	1	1	CTCAACGTGGT
 tig00000001	-	200268	200268	1d5ccec9-296a-4afd-ad74-010ebd3732ec	-1.52	-97.68	-96.16	1	1	TTCACCGCTAT
-tig00000001	-	193289	193300	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-16.69	-145.43	-128.75	1	4	ACCAGCGGATCGGGCGCGGTGG
-tig00000001	-	193317	193338	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-17.35	-257.10	-239.75	1	6	AGTGGCGGCGTAATGCGACGCGCAGACGGGCC
-tig00000001	-	193351	193351	6a470b8f-d316-4d8c-b93f-ea7bd154775d	0.98	-123.71	-124.69	1	1	CAATTCGCCAA
-tig00000001	-	193364	193364	6a470b8f-d316-4d8c-b93f-ea7bd154775d	0.28	-120.40	-120.68	1	1	CCAAACGGCTT
-tig00000001	-	193385	193430	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-64.07	-381.02	-316.96	1	9	TCATCCGCTCCGGCATCCAGCGCGGCGATTTTGTCGCTCTTCGCTGCGTGCGGAAA
-tig00000001	-	193446	193454	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-2.69	-165.06	-162.37	1	3	ATCACCGGCACCGCGCTCC
-tig00000001	-	193465	193474	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-11.89	-168.56	-156.67	1	3	ACTGGCGCAGGTCGCGGATA
-tig00000001	-	193499	193514	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-12.07	-229.89	-217.82	1	3	ACCATCGGGCAGGCCGAGATCGAGAA
-tig00000001	-	193537	193545	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-8.78	-134.90	-126.12	1	2	GCTTACGGGTTGCCGCTTC
-tig00000001	-	193559	193574	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-14.60	-186.29	-171.69	1	4	CAAGCCGCGTTGCAGCGTTTCGGCCT
-tig00000001	-	193586	193627	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-31.62	-364.75	-333.13	1	9	AAAGACGCGCATCCCGTCGCCCTCCAGCGCCGTGCGCAGAAAGCGACGAATA
-tig00000001	-	193658	193658	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-4.51	-138.96	-134.45	1	1	CAGAACGTTTG
-tig00000001	-	193720	193720	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-2.00	-111.45	-109.45	1	1	TAACACGAAAA
-tig00000001	-	193740	193754	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-8.30	-169.52	-161.23	1	4	CCTTCCGGTCGGTTGAACGCGGTAA
-tig00000001	-	193769	193769	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-3.87	-95.32	-91.45	1	1	GCCCCCGTACA
-tig00000001	-	193783	193787	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-12.27	-180.06	-167.78	1	2	ACTATCGCCCGACAA
-tig00000001	-	193815	193824	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-8.73	-192.37	-183.64	1	2	TACCCCGGTACTGCCGACTC
-tig00000001	-	193838	193840	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-5.86	-122.89	-117.03	1	2	ATTCCCGCGAGCA
-tig00000001	-	193860	193860	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-13.49	-133.22	-119.73	1	1	AATATCGTCTG
-tig00000001	-	193878	193892	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-7.52	-160.70	-153.19	1	3	CCTGGCGGAAGACCGGGGCCGTTAT
-tig00000001	-	193922	193940	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-22.29	-201.94	-179.65	1	3	ATTTTCGCCCTCAACGTGGGCATCGATAC
-tig00000001	-	193952	193965	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-11.37	-175.76	-164.39	1	3	AATTTCGGCCTGCGCACCCGCATA
-tig00000001	-	193977	193979	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-2.79	-132.52	-129.72	1	2	TTCACCGCGTTCT
-tig00000001	-	194005	194005	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-4.78	-82.09	-77.31	1	1	GCACCCGTTCA
-tig00000001	-	194021	194027	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-7.61	-125.71	-118.10	1	2	TGGCCCGTCAACGTGGA
-tig00000001	-	194043	194043	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-1.50	-113.45	-111.95	1	1	GTCAGCGGTTC
-tig00000001	-	194070	194082	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-2.14	-167.12	-164.98	1	3	ATGGGCGACGATAAACCCGGTTC
-tig00000001	-	194100	194108	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-18.47	-171.22	-152.75	1	3	TGCAGCGCGCTGCCGACTA
-tig00000001	-	194124	194124	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-8.50	-109.10	-100.60	1	1	TCCAGCGTTAA
-tig00000001	-	194153	194156	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-5.48	-155.35	-149.87	1	2	AAAGCCGCCGGACT
-tig00000001	-	194167	194169	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-5.62	-165.71	-160.09	1	2	GAATTCGCGCCAT
-tig00000001	-	194197	194197	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-2.97	-99.66	-96.68	1	1	CCAGTCGGGTA
-tig00000001	-	194221	194228	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-1.58	-147.03	-145.45	1	2	GCTGACGGATCTCGCTGG
-tig00000001	-	194239	194243	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-8.90	-123.06	-114.16	1	2	CCTGGCGGGCGTGGG
-tig00000001	-	194258	194258	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-2.54	-125.65	-123.11	1	1	TCCTTCGCTTG
-tig00000001	-	194270	194274	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-11.61	-170.28	-158.68	1	2	CAGATCGAGCGTTAA
-tig00000001	-	194304	194317	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-26.38	-197.62	-171.24	1	4	AGCACCGTAAGCGGCGTGCGTAAA
-tig00000001	-	194328	194337	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-20.53	-194.47	-173.94	1	3	TCATGCGAAAGCGCCGCCAG
-tig00000001	-	194348	194353	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-7.62	-142.25	-134.64	1	2	CAGGGCGTTGCGGATC
-tig00000001	-	194365	194369	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-13.43	-142.68	-129.25	1	2	GTTCACGTTCGCTTG
-tig00000001	-	194380	194382	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-2.98	-117.23	-114.25	1	2	CCATCCGCGCCTG
-tig00000001	-	194393	194413	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-27.48	-249.63	-222.15	1	4	TTCTTCGCTGGCGGTTAGCGTCAGCCGCTCA
-tig00000001	-	194429	194445	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-7.77	-255.11	-247.34	1	3	ATTGGCGACTAACAGCGTAAACGTCTC
-tig00000001	-	194458	194458	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-11.22	-163.04	-151.82	1	1	GCAGGCGCTGC
-tig00000001	-	194469	194469	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-1.65	-115.69	-114.04	1	1	TGTTCCGGGAT
-tig00000001	-	194485	194485	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-1.72	-104.88	-103.16	1	1	ACTGGCGCAGA
-tig00000001	-	194496	194496	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-4.38	-98.38	-93.99	1	1	TTCCCCGCTCC
-tig00000001	-	194515	194515	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-1.00	-142.29	-141.28	1	1	CAGCCCGTAGG
-tig00000001	-	194527	194539	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-9.49	-176.92	-167.43	1	3	TTTCTCGCCGCTTTTAGCGGCAA
-tig00000001	-	194554	194587	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-32.83	-319.91	-287.08	1	7	TGGTACGGTACACCGGGTAACGTGTCGGTGCCCGCGCCCGCAGG
-tig00000001	-	194617	194638	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-34.48	-284.30	-249.81	1	5	CACTGCGCGATGGCATCGTCCCACGGCGTCAT
-tig00000001	-	194650	194650	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-1.05	-80.59	-79.54	1	1	CCTTGCGGATG
-tig00000001	-	194662	194662	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-2.26	-76.47	-74.21	1	1	GTTAACGGCTG
-tig00000001	-	194676	194685	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-5.17	-163.58	-158.41	1	2	TTTACCGTTGTCATCGGGCA
-tig00000001	-	194705	194705	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-7.79	-118.80	-111.01	1	1	GACTGCGGGCA
-tig00000001	-	194716	194716	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-0.53	-106.07	-105.53	1	1	TGAAACGTGGA
-tig00000001	-	194736	194736	6a470b8f-d316-4d8c-b93f-ea7bd154775d	0.52	-97.20	-97.72	1	1	TTGTTCGCTGG
-tig00000001	-	194748	194773	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-20.23	-245.35	-225.12	1	4	GGCAGCGATATCCTGCGGACTGCGGCCCACCGCCAG
-tig00000001	-	194785	194785	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-8.13	-119.32	-111.19	1	1	GCTTTCGACAT
-tig00000001	-	194804	194850	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-37.24	-342.18	-304.94	1	9	AGTGCCGTGTGCGTTGCTCGCGGTAACGGGCTACCCGCGCCTGATAACGCACGCCAG
-tig00000001	-	194868	194868	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-1.19	-102.79	-101.61	1	1	GTTCCCGATCA
-tig00000001	-	194880	194883	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-13.48	-154.69	-141.21	1	2	CAGCCCGACGGTTA
-tig00000001	-	194896	194898	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-10.50	-127.07	-116.57	1	2	ATCACCGCGAAGG
-tig00000001	-	194928	194949	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-19.15	-194.84	-175.69	1	6	AGAGACGGCGAGCGTGCCGCGTGGGGCGATAA
-tig00000001	-	194963	194963	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-6.00	-104.89	-98.89	1	1	GAGATCGAAAC
-tig00000001	-	194984	194984	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-2.22	-97.96	-95.74	1	1	AATGACGGTGG
-tig00000001	-	195007	195007	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-3.41	-114.39	-110.98	1	1	GCCAGCGTCCA
-tig00000001	-	195021	195021	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-2.15	-107.28	-105.12	1	1	AATAGCGCCAC
-tig00000001	-	195035	195035	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-6.22	-146.86	-140.64	1	1	CACCACGCCAA
-tig00000001	-	195065	195075	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-8.35	-167.63	-159.28	1	2	GTTGGCGGCATCAAACGCCAT
-tig00000001	-	195110	195134	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-23.48	-238.23	-214.75	1	6	GATAACGGCGCATAACGCGGCGGCAACCACGCATC
-tig00000001	-	195154	195154	6a470b8f-d316-4d8c-b93f-ea7bd154775d	3.68	-124.35	-128.04	1	1	GTACACGCCAC
-tig00000001	-	195175	195206	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-18.13	-248.42	-230.30	1	7	AAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTG
-tig00000001	-	195222	195224	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-1.56	-99.30	-97.74	1	2	TCAAGCGCGACCA
-tig00000001	-	195239	195264	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-34.61	-273.30	-238.69	1	6	CTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCA
-tig00000001	-	195275	195313	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-47.30	-346.31	-299.01	1	9	GCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAA
-tig00000001	-	195328	195328	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-2.88	-116.86	-113.98	1	1	CTTGCCGAGAT
-tig00000001	-	195342	195359	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-9.56	-221.25	-211.69	1	3	GTTCACGGGCATAACGCACTACCGCTTT
-tig00000001	-	195371	195371	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-2.21	-167.93	-165.72	1	1	TCTTCCGCTGG
-tig00000001	-	195392	195400	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-10.28	-139.98	-129.70	1	3	GTTGCCGTCTCCGCGCCCA
-tig00000001	-	195413	195427	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-13.82	-161.04	-147.22	1	3	TCCTGCGCCAGACGTAAGGCGCTGA
-tig00000001	-	195441	195460	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-21.73	-208.11	-186.38	1	4	TTGCCCGACGTTTTTTCCGGTAAGCGGTGC
-tig00000001	-	195489	195500	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-14.70	-195.11	-180.42	1	3	TACACCGCGTGCCAGACGCTAC
-tig00000001	-	195511	195535	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-19.04	-248.67	-229.63	1	7	CCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACC
-tig00000001	-	195547	195553	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-11.50	-135.42	-123.92	1	2	GTTTTCGCTGCCGGTGT
-tig00000001	-	195565	195565	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-3.28	-96.29	-93.01	1	1	ATGGCCGATGC
-tig00000001	-	195581	195590	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-10.70	-163.23	-152.53	1	5	AGGATCGCGTCGCGCGTGTG
-tig00000001	-	195608	195608	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-9.70	-188.46	-178.76	1	1	CTCTTCGCCAG
-tig00000001	-	195621	195630	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-14.02	-215.52	-201.50	1	3	TGCCCCGCCAGGCGCGCATT
-tig00000001	-	195646	195663	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-8.56	-178.74	-170.18	1	5	ATCAACGCGATCGGCAGTACGGCGCAGT
-tig00000001	-	195676	195685	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-1.58	-148.45	-146.87	1	3	CAGTTCGCGCAGGGCGATCA
-tig00000001	-	195702	195702	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-1.30	-110.20	-108.90	1	1	CTTTGCGGAAA
-tig00000001	-	195720	195735	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-17.13	-188.23	-171.10	1	4	AATGGCGCGCTCCGCCTGCCCGGCAA
-tig00000001	-	195764	195781	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-4.95	-220.34	-215.38	1	4	TCAGCCGCTGGCGCAGATCGTCCGGGGC
-tig00000001	-	195803	195842	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-24.14	-355.54	-331.40	1	8	CACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACC
-tig00000001	-	195855	195864	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-14.83	-174.90	-160.06	1	3	AATTCCGGTGACGCCGCTGA
-tig00000001	-	195900	195906	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-2.20	-140.79	-138.59	1	2	CTGAACGTTGACGGTAG
-tig00000001	-	195945	195945	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-3.76	-144.75	-140.99	1	1	TTCTTCGATAT
-tig00000001	-	195959	195959	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-13.61	-107.39	-93.78	1	1	GCCAGCGTTTG
-tig00000001	-	195971	195971	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-4.46	-87.55	-83.09	1	1	GATGACGGGAA
-tig00000001	-	195982	195982	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-3.53	-104.44	-100.90	1	1	CCTGGCGCATT
-tig00000001	-	195994	196002	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-8.87	-170.39	-161.52	1	2	CTGTGCGCCAGTTCGTCCA
-tig00000001	-	196018	196044	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-32.76	-286.93	-254.18	1	7	ATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGAT
-tig00000001	-	196056	196056	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-2.96	-112.41	-109.45	1	1	AAACTCGCTGA
-tig00000001	-	196067	196093	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-31.60	-304.77	-273.17	1	5	TATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAG
-tig00000001	-	196122	196125	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-15.90	-137.97	-122.07	1	2	CATGGCGGCGGTAT
-tig00000001	-	196136	196140	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-2.58	-104.96	-102.38	1	2	CTTTTCGCCCGTGGG
-tig00000001	-	196155	196155	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-8.48	-108.54	-100.06	1	1	TACCACGCCAA
-tig00000001	-	196180	196190	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-13.85	-203.03	-189.18	1	3	CCTTGCGCCCGCAGTCGCTGG
-tig00000001	-	196210	196210	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-10.67	-116.21	-105.54	1	1	AGCATCGCCCA
-tig00000001	-	196224	196227	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-15.73	-153.44	-137.71	1	2	CTTCCCGACGCCTG
-tig00000001	-	196242	196242	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-6.09	-122.00	-115.91	1	1	GGCACCGAAGA
-tig00000001	-	196264	196274	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-23.90	-193.81	-169.91	1	4	TTCCCCGATGCGGCGCGGCAG
-tig00000001	-	196294	196319	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-11.39	-233.07	-221.68	1	5	GCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
-tig00000001	-	196342	196342	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-1.15	-92.05	-90.89	1	1	TCCAGCGCCAG
-tig00000001	-	196372	196380	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-7.14	-142.99	-135.85	1	2	ACAACCGGCTGGCCGATAT
-tig00000001	-	196396	196396	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-7.26	-110.03	-102.77	1	1	ACCAGCGGTTG
-tig00000001	-	196416	196426	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-4.21	-167.69	-163.48	1	2	TTTTGCGATCAGTTGCGTGAG
-tig00000001	-	196440	196440	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-1.03	-109.49	-108.46	1	1	TTCAACGCTGA
-tig00000001	-	196451	196466	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-17.16	-192.02	-174.86	1	5	GATTACGCGCTTTCGCCACGCGTGGG
-tig00000001	-	196483	196492	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-10.11	-162.42	-152.31	1	3	CAGGCCGCCGCTTGCGGGTG
-tig00000001	-	196514	196527	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-25.67	-172.56	-146.89	1	3	CAGCCCGCTTGCCGATGCCGTCAC
-tig00000001	-	196542	196576	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-18.56	-327.84	-309.29	1	7	TCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAAT
-tig00000001	-	196589	196595	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-14.44	-167.06	-152.62	1	3	AGCAACGCGTGCGGCTA
-tig00000001	-	196629	196629	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-0.93	-130.89	-129.97	1	1	CTGACCGCCAG
-tig00000001	-	196643	196643	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-1.89	-134.48	-132.58	1	1	GCTCCCGCCAG
-tig00000001	-	196677	196690	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-19.64	-182.76	-163.12	1	4	TCTGCCGTTGCCGACGGGCGACCA
-tig00000001	-	196706	196712	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-13.85	-172.47	-158.62	1	2	ATAGCCGTTGCCGGTAA
-tig00000001	-	196727	196749	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-33.97	-241.60	-207.63	1	5	CTGCCCGATTAATGCCGAACCGCGCACCGTATC
-tig00000001	-	196762	196770	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-8.97	-154.31	-145.35	1	2	CTTCACGAATCAACGAACC
-tig00000001	-	196810	196810	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-6.21	-116.63	-110.41	1	1	CAGTACGGTGG
-tig00000001	-	196823	196834	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-10.24	-134.90	-124.66	1	3	AGCAGCGGGTAAACGCCGCCAG
-tig00000001	-	196874	196878	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-7.52	-131.07	-123.55	1	2	AATGCCGGACGTAAT
-tig00000001	-	196909	196915	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-2.82	-138.85	-136.03	1	2	CAGACCGCAAACGGTCA
-tig00000001	-	196945	196952	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-13.54	-147.30	-133.76	1	2	GATACCGATAAACGGCAC
-tig00000001	-	196975	196975	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-5.19	-102.29	-97.11	1	1	CAGACCGTAAA
-tig00000001	-	196992	196995	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-7.18	-121.01	-113.84	1	2	AGTTACGGCGCAAC
-tig00000001	-	197011	197018	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-11.28	-125.33	-114.05	1	2	AGAAGCGGTAAGCGGTTT
-tig00000001	-	197032	197041	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-10.61	-146.28	-135.66	1	2	ACTCACGCCTTTAACGCCAG
-tig00000001	-	197059	197059	6a470b8f-d316-4d8c-b93f-ea7bd154775d	0.52	-119.59	-120.11	1	1	AAAGACGATAA
-tig00000001	-	197071	197071	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-8.72	-127.07	-118.34	1	1	CAAGGCGTTGA
-tig00000001	-	197084	197084	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-6.45	-109.46	-103.01	1	1	ATCACCGCACT
-tig00000001	-	197098	197108	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-3.82	-186.96	-183.14	1	3	GATTGCGGAGTCGGGCGAATG
-tig00000001	-	197132	197132	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-7.23	-123.24	-116.01	1	1	TTCAGCGCATT
-tig00000001	-	197144	197168	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-21.06	-257.63	-236.57	1	6	AACTGCGGATACGTTGCCGCGAATGCCGCCGGAAT
-tig00000001	-	197179	197197	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-8.12	-197.43	-189.30	1	3	AATGGCGAAGTATTTCGCCACATCGTTGG
-tig00000001	-	197222	197229	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-9.39	-160.19	-150.79	1	2	GTCAGCGAGCCACGGGTC
-tig00000001	-	197266	197266	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-5.45	-132.45	-127.00	1	1	CACCTCGATCA
-tig00000001	-	197279	197279	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-4.63	-103.80	-99.17	1	1	TTGGTCGGGTT
-tig00000001	-	197290	197296	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-2.18	-126.90	-124.72	1	2	AGAGTCGAGATCGACCA
-tig00000001	-	197309	197321	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-31.56	-197.63	-166.06	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	-	197332	197350	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-6.25	-194.52	-188.28	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	-	197363	197420	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-41.94	-451.55	-409.60	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	-	197433	197433	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-2.71	-104.68	-101.97	1	1	ACTGACGGATC
-tig00000001	-	197456	197470	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-15.45	-205.77	-190.32	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	-	197482	197509	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-26.62	-277.20	-250.58	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	-	197520	197530	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-10.40	-144.25	-133.85	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	-	197543	197543	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-1.26	-102.21	-100.95	1	1	ATCACCGTTTT
-tig00000001	-	197562	197577	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-18.45	-180.40	-161.95	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	-	197590	197599	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-15.61	-124.63	-109.01	1	2	AATACCGCCTTTGACGATAT
-tig00000001	-	197612	197620	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-7.26	-147.27	-140.02	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	-	197631	197631	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-6.12	-183.43	-177.30	1	1	GCACACGAGAA
-tig00000001	-	197654	197657	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-13.93	-117.23	-103.29	1	2	ACCAGCGGCGTGGC
-tig00000001	-	197670	197672	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-3.95	-129.09	-125.14	1	2	CCTGACGCGCAAC
-tig00000001	-	197683	197683	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-2.67	-97.25	-94.58	1	1	CTGATCGACTT
-tig00000001	-	197701	197701	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-0.78	-141.95	-141.17	1	1	AACATCGGTAG
-tig00000001	-	197719	197719	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-1.61	-134.51	-132.90	1	1	ACCACCGTTAG
-tig00000001	-	197736	197749	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-19.98	-183.78	-163.80	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	-	197763	197779	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-12.11	-214.78	-202.66	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	-	197791	197816	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-31.30	-273.08	-241.78	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	-	197837	197837	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-8.89	-113.05	-104.16	1	1	TGGAGCGACTG
-tig00000001	-	197848	197856	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-17.32	-152.49	-135.17	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	-	197868	197878	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-12.41	-160.35	-147.94	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	-	197895	197906	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-15.74	-215.58	-199.84	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	-	197921	197921	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-8.10	-118.95	-110.84	1	1	GCCAGCGAAGC
-tig00000001	-	197935	197948	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-28.23	-181.14	-152.92	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	-	197960	197969	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-14.87	-143.90	-129.03	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	-	197982	197999	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-20.21	-224.52	-204.31	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	-	198014	198014	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-4.40	-131.67	-127.28	1	1	GGTGCCGGTTT
-tig00000001	-	198035	198051	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-15.78	-184.35	-168.57	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	-	198064	198068	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-11.66	-144.08	-132.43	1	2	CTGCACGTCCGCTGG
-tig00000001	-	198087	198089	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-5.76	-176.19	-170.43	1	2	ACATTCGCGCCTA
-tig00000001	-	198100	198123	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-37.22	-337.90	-300.68	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	-	198137	198137	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-2.06	-113.39	-111.33	1	1	CAGGCCGCCAA
-tig00000001	-	198171	198171	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-1.53	-97.05	-95.52	1	1	AGCAGCGCCAC
-tig00000001	-	198183	198188	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-6.79	-120.30	-113.51	1	2	AGTACCGTTACGCTGA
-tig00000001	-	198203	198233	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-36.47	-249.85	-213.38	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	-	198250	198250	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-3.86	-137.53	-133.67	1	1	AAAGACGATAG
-tig00000001	-	198289	198313	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-42.53	-219.62	-177.08	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	-	198326	198336	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-26.71	-211.53	-184.82	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	-	198352	198364	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-16.23	-216.03	-199.79	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	-	198399	198415	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-17.43	-162.88	-145.45	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	-	198427	198485	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-40.66	-489.23	-448.57	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	-	198513	198513	6a470b8f-d316-4d8c-b93f-ea7bd154775d	0.28	-100.96	-101.24	1	1	ACCATCGCAGG
-tig00000001	-	198527	198527	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-0.61	-68.11	-67.50	1	1	AATATCGCCAG
-tig00000001	-	198545	198569	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-14.21	-252.39	-238.18	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	-	198585	198619	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-24.66	-356.85	-332.20	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	-	198660	198670	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-10.58	-155.85	-145.26	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	-	198684	198710	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-23.52	-291.30	-267.78	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	-	198728	198782	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-35.11	-409.50	-374.39	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	-	198812	198821	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-9.52	-194.07	-184.55	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	-	198834	198855	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-22.77	-205.19	-182.41	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	-	198872	198872	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-0.97	-91.34	-90.37	1	1	TTCACCGCTTC
-tig00000001	-	198884	198892	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-10.38	-167.60	-157.21	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	-	198907	198914	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-12.03	-136.12	-124.09	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	-	198927	198927	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-3.87	-96.12	-92.25	1	1	GTTTACGACTC
-tig00000001	-	198972	198987	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-5.34	-173.45	-168.11	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	-	199013	199013	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-1.87	-94.86	-93.00	1	1	CAGTGCGCCAA
-tig00000001	-	199028	199034	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-9.64	-170.19	-160.55	1	2	CAACACGGTGCCGATTA
-tig00000001	-	199056	199088	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-26.75	-267.27	-240.52	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	-	199112	199117	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-1.10	-136.99	-135.89	1	2	ACCAGCGAACCGGCAA
-tig00000001	-	199133	199133	6a470b8f-d316-4d8c-b93f-ea7bd154775d	0.45	-85.62	-86.07	1	1	ATCACCGGGAT
-tig00000001	-	199147	199156	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-14.97	-158.29	-143.32	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	-	199172	199172	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-0.60	-96.83	-96.23	1	1	CAGAACGCCAG
-tig00000001	-	199193	199193	6a470b8f-d316-4d8c-b93f-ea7bd154775d	0.40	-107.49	-107.88	1	1	CAGAACGGAGA
-tig00000001	-	199204	199228	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-14.54	-205.59	-191.05	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	-	199240	199255	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-20.72	-194.42	-173.71	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	-	199267	199267	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-4.00	-89.82	-85.82	1	1	CACTTCGCTAA
-tig00000001	-	199280	199280	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-1.94	-109.04	-107.10	1	1	CCATGCGGGCC
-tig00000001	-	199300	199336	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-26.96	-293.21	-266.25	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	-	199352	199355	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-10.92	-156.43	-145.51	1	2	ACCAGCGTCGGGGT
-tig00000001	-	199393	199402	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-7.27	-186.50	-179.23	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	-	199423	199430	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-8.95	-142.82	-133.87	1	2	TATTCCGGTGTACGACCA
-tig00000001	-	199446	199446	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-3.77	-114.13	-110.36	1	1	CAGCCCGGCAA
-tig00000001	-	199459	199459	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-1.04	-105.20	-104.16	1	1	AACACCGCCAG
-tig00000001	-	199485	199485	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-1.00	-118.21	-117.20	1	1	CATGCCGTAAA
-tig00000001	-	199500	199509	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-9.16	-199.65	-190.49	1	3	AGAACCGACACCGCCGAACA
-tig00000001	-	199543	199543	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-2.15	-151.12	-148.97	1	1	CACATCGGCAC
-tig00000001	-	199557	199570	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-12.08	-163.04	-150.96	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	-	199582	199593	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-7.74	-140.37	-132.63	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	-	199606	199621	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-30.87	-210.59	-179.72	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	-	199644	199652	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-5.41	-183.64	-178.23	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	-	199687	199687	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-1.55	-108.60	-107.05	1	1	CTGTCCGTGCC
-tig00000001	-	199740	199746	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-5.09	-154.20	-149.11	1	2	CACCACGCCTACGCAGA
-tig00000001	-	199770	199770	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-12.55	-132.19	-119.64	1	1	GACATCGCCCA
-tig00000001	-	199786	199802	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-30.02	-230.41	-200.39	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	-	199833	199836	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-9.50	-107.27	-97.78	1	2	CACAGCGCCGTTGG
-tig00000001	-	199854	199854	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-2.06	-122.18	-120.12	1	1	AAGATCGCCAG
-tig00000001	-	199868	199868	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-3.90	-122.34	-118.44	1	1	CTGCACGAAGT
-tig00000001	-	199883	199883	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-3.20	-86.16	-82.95	1	1	CAGTGCGGTTG
-tig00000001	-	199899	199908	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-11.90	-136.14	-124.24	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	-	199931	199943	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-13.54	-195.06	-181.52	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	-	199956	199956	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-2.66	-143.62	-140.96	1	1	TTGATCGCTTC
-tig00000001	-	199998	199998	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-7.13	-124.30	-117.17	1	1	TGTTGCGCTCC
 tig00000001	-	200009	200009	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-0.05	-138.26	-138.21	1	1	TTCAACGGTAT
 tig00000001	-	200046	200046	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-3.95	-106.49	-102.54	1	1	TGCAGCGCACC
 tig00000001	-	200081	200081	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-1.67	-115.15	-113.48	1	1	AACAACGCCAC
 tig00000001	-	200105	200122	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-20.08	-218.45	-198.37	1	3	CATAACGTGATGCGTAGCAGATCGACCC
 tig00000001	-	200137	200141	6a470b8f-d316-4d8c-b93f-ea7bd154775d	-11.64	-179.38	-167.74	1	2	ATTCCCGAGCGTGCT
-tig00000001	-	193658	193658	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-4.71	-107.62	-102.91	1	1	CAGAACGTTTG
-tig00000001	-	193720	193720	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-9.08	-101.89	-92.81	1	1	TAACACGAAAA
-tig00000001	-	193740	193754	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-8.92	-204.78	-195.86	1	4	CCTTCCGGTCGGTTGAACGCGGTAA
-tig00000001	-	193769	193769	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-3.95	-118.22	-114.27	1	1	GCCCCCGTACA
-tig00000001	-	193783	193787	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-12.18	-166.60	-154.42	1	2	ACTATCGCCCGACAA
-tig00000001	-	193815	193824	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-27.27	-223.25	-195.98	1	2	TACCCCGGTACTGCCGACTC
-tig00000001	-	193838	193840	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-10.29	-145.84	-135.55	1	2	ATTCCCGCGAGCA
-tig00000001	-	193860	193860	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-4.22	-98.08	-93.86	1	1	AATATCGTCTG
-tig00000001	-	193878	193892	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-9.68	-187.15	-177.48	1	3	CCTGGCGGAAGACCGGGGCCGTTAT
-tig00000001	-	193922	193940	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-11.55	-200.54	-188.99	1	3	ATTTTCGCCCTCAACGTGGGCATCGATAC
-tig00000001	-	193952	193965	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-6.07	-185.06	-178.98	1	3	AATTTCGGCCTGCGCACCCGCATA
-tig00000001	-	193977	193979	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-0.70	-124.92	-124.22	1	2	TTCACCGCGTTCT
-tig00000001	-	194005	194005	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-4.69	-112.35	-107.66	1	1	GCACCCGTTCA
-tig00000001	-	194021	194027	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-1.73	-118.27	-116.54	1	2	TGGCCCGTCAACGTGGA
-tig00000001	-	194043	194043	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-2.76	-84.95	-82.19	1	1	GTCAGCGGTTC
-tig00000001	-	194070	194082	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-6.49	-150.66	-144.17	1	3	ATGGGCGACGATAAACCCGGTTC
-tig00000001	-	194100	194108	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-13.09	-129.33	-116.24	1	3	TGCAGCGCGCTGCCGACTA
-tig00000001	-	194124	194124	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-4.81	-114.72	-109.91	1	1	TCCAGCGTTAA
-tig00000001	-	194153	194156	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-9.52	-156.08	-146.56	1	2	AAAGCCGCCGGACT
-tig00000001	-	194167	194169	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-3.52	-121.43	-117.91	1	2	GAATTCGCGCCAT
-tig00000001	-	194197	194197	f58173f7-dbfb-4c47-92c1-0124626bf4c2	2.08	-106.75	-108.83	1	1	CCAGTCGGGTA
-tig00000001	-	194221	194228	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-5.80	-158.33	-152.53	1	2	GCTGACGGATCTCGCTGG
-tig00000001	-	194239	194243	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-3.62	-128.83	-125.21	1	2	CCTGGCGGGCGTGGG
-tig00000001	-	194258	194258	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-7.97	-113.90	-105.93	1	1	TCCTTCGCTTG
-tig00000001	-	194270	194274	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-16.96	-137.86	-120.90	1	2	CAGATCGAGCGTTAA
-tig00000001	-	194304	194317	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-18.40	-202.13	-183.73	1	4	AGCACCGTAAGCGGCGTGCGTAAA
-tig00000001	-	194328	194337	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-18.27	-159.85	-141.58	1	3	TCATGCGAAAGCGCCGCCAG
-tig00000001	-	194348	194353	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-11.58	-125.53	-113.95	1	2	CAGGGCGTTGCGGATC
-tig00000001	-	194365	194369	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-12.67	-209.81	-197.14	1	2	GTTCACGTTCGCTTG
-tig00000001	-	194380	194382	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-9.09	-241.80	-232.71	1	2	CCATCCGCGCCTG
-tig00000001	-	194393	194413	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-23.70	-243.71	-220.01	1	4	TTCTTCGCTGGCGGTTAGCGTCAGCCGCTCA
-tig00000001	-	194429	194445	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-18.47	-219.04	-200.58	1	3	ATTGGCGACTAACAGCGTAAACGTCTC
-tig00000001	-	194458	194458	f58173f7-dbfb-4c47-92c1-0124626bf4c2	0.23	-110.37	-110.60	1	1	GCAGGCGCTGC
-tig00000001	-	194469	194469	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-1.24	-96.42	-95.18	1	1	TGTTCCGGGAT
-tig00000001	-	194485	194485	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-1.04	-106.12	-105.08	1	1	ACTGGCGCAGA
-tig00000001	-	194496	194496	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-4.45	-134.06	-129.61	1	1	TTCCCCGCTCC
-tig00000001	-	194515	194515	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-3.81	-122.28	-118.46	1	1	CAGCCCGTAGG
-tig00000001	-	194527	194539	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-9.41	-162.07	-152.67	1	3	TTTCTCGCCGCTTTTAGCGGCAA
-tig00000001	-	194554	194587	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-27.91	-269.32	-241.41	1	7	TGGTACGGTACACCGGGTAACGTGTCGGTGCCCGCGCCCGCAGG
-tig00000001	-	194617	194638	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-22.87	-242.64	-219.77	1	5	CACTGCGCGATGGCATCGTCCCACGGCGTCAT
-tig00000001	-	194650	194650	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-3.81	-95.11	-91.30	1	1	CCTTGCGGATG
-tig00000001	-	194662	194662	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-4.08	-106.77	-102.70	1	1	GTTAACGGCTG
-tig00000001	-	194676	194685	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-7.33	-172.03	-164.70	1	2	TTTACCGTTGTCATCGGGCA
-tig00000001	-	194705	194705	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-5.28	-113.83	-108.55	1	1	GACTGCGGGCA
-tig00000001	-	194716	194716	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-0.01	-113.94	-113.94	1	1	TGAAACGTGGA
-tig00000001	-	194736	194736	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-5.54	-93.63	-88.09	1	1	TTGTTCGCTGG
-tig00000001	-	194748	194773	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-25.38	-277.63	-252.24	1	4	GGCAGCGATATCCTGCGGACTGCGGCCCACCGCCAG
-tig00000001	-	194785	194785	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-8.34	-111.53	-103.19	1	1	GCTTTCGACAT
-tig00000001	-	194804	194850	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-26.57	-338.67	-312.10	1	9	AGTGCCGTGTGCGTTGCTCGCGGTAACGGGCTACCCGCGCCTGATAACGCACGCCAG
-tig00000001	-	194868	194868	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-6.66	-129.52	-122.86	1	1	GTTCCCGATCA
-tig00000001	-	194880	194883	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-2.14	-146.98	-144.84	1	2	CAGCCCGACGGTTA
-tig00000001	-	194896	194898	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-7.89	-121.92	-114.03	1	2	ATCACCGCGAAGG
-tig00000001	-	194928	194949	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-24.13	-259.19	-235.06	1	6	AGAGACGGCGAGCGTGCCGCGTGGGGCGATAA
-tig00000001	-	194963	194963	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-4.36	-94.54	-90.19	1	1	GAGATCGAAAC
-tig00000001	-	194984	194984	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-3.52	-105.41	-101.89	1	1	AATGACGGTGG
-tig00000001	-	195007	195007	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-3.06	-111.95	-108.88	1	1	GCCAGCGTCCA
-tig00000001	-	195021	195021	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-4.07	-118.76	-114.69	1	1	AATAGCGCCAC
-tig00000001	-	195035	195035	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-3.77	-129.86	-126.09	1	1	CACCACGCCAA
-tig00000001	-	195065	195075	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-8.75	-149.85	-141.10	1	2	GTTGGCGGCATCAAACGCCAT
-tig00000001	-	195110	195134	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-16.93	-213.29	-196.37	1	6	GATAACGGCGCATAACGCGGCGGCAACCACGCATC
-tig00000001	-	195154	195154	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-0.73	-107.82	-107.09	1	1	GTACACGCCAC
-tig00000001	-	195175	195206	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-15.77	-241.31	-225.53	1	7	AAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTG
-tig00000001	-	195222	195224	f58173f7-dbfb-4c47-92c1-0124626bf4c2	4.50	-82.66	-87.16	1	2	TCAAGCGCGACCA
-tig00000001	-	195239	195264	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-14.56	-220.52	-205.96	1	6	CTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCA
-tig00000001	-	195275	195313	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-28.23	-280.61	-252.38	1	9	GCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAA
-tig00000001	-	195328	195328	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-6.51	-125.20	-118.69	1	1	CTTGCCGAGAT
-tig00000001	-	195342	195359	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-2.06	-211.02	-208.97	1	3	GTTCACGGGCATAACGCACTACCGCTTT
-tig00000001	-	195371	195371	f58173f7-dbfb-4c47-92c1-0124626bf4c2	2.91	-123.53	-126.44	1	1	TCTTCCGCTGG
-tig00000001	-	195392	195400	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-18.35	-157.20	-138.85	1	3	GTTGCCGTCTCCGCGCCCA
-tig00000001	-	195413	195427	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-3.56	-221.51	-217.96	1	3	TCCTGCGCCAGACGTAAGGCGCTGA
-tig00000001	-	195441	195460	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-14.84	-193.75	-178.92	1	4	TTGCCCGACGTTTTTTCCGGTAAGCGGTGC
-tig00000001	-	195489	195500	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-15.66	-198.09	-182.42	1	3	TACACCGCGTGCCAGACGCTAC
-tig00000001	-	195511	195535	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-16.37	-270.59	-254.22	1	7	CCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACC
-tig00000001	-	195547	195553	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-10.78	-194.86	-184.09	1	2	GTTTTCGCTGCCGGTGT
-tig00000001	-	195565	195565	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-8.00	-124.75	-116.76	1	1	ATGGCCGATGC
-tig00000001	-	195581	195590	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-19.27	-178.24	-158.96	1	5	AGGATCGCGTCGCGCGTGTG
-tig00000001	-	195608	195608	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-3.67	-99.39	-95.72	1	1	CTCTTCGCCAG
-tig00000001	-	195621	195630	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-6.52	-174.85	-168.33	1	3	TGCCCCGCCAGGCGCGCATT
-tig00000001	-	195646	195663	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-14.48	-176.80	-162.33	1	5	ATCAACGCGATCGGCAGTACGGCGCAGT
-tig00000001	-	195676	195685	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-1.07	-168.30	-167.23	1	3	CAGTTCGCGCAGGGCGATCA
-tig00000001	-	195702	195702	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-1.16	-125.28	-124.12	1	1	CTTTGCGGAAA
-tig00000001	-	195720	195735	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-25.82	-292.24	-266.42	1	4	AATGGCGCGCTCCGCCTGCCCGGCAA
-tig00000001	-	195764	195781	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-11.70	-323.40	-311.69	1	4	TCAGCCGCTGGCGCAGATCGTCCGGGGC
-tig00000001	-	195803	195842	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-44.51	-383.71	-339.21	1	8	CACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACC
-tig00000001	-	195855	195864	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-10.95	-151.68	-140.74	1	3	AATTCCGGTGACGCCGCTGA
-tig00000001	-	195900	195906	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-5.97	-192.87	-186.90	1	2	CTGAACGTTGACGGTAG
-tig00000001	-	195945	195945	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-1.94	-103.54	-101.60	1	1	TTCTTCGATAT
-tig00000001	-	195959	195959	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-3.92	-124.93	-121.01	1	1	GCCAGCGTTTG
-tig00000001	-	195971	195971	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-0.88	-104.48	-103.60	1	1	GATGACGGGAA
-tig00000001	-	195982	195982	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-0.65	-121.14	-120.49	1	1	CCTGGCGCATT
-tig00000001	-	195994	196002	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-1.23	-149.96	-148.73	1	2	CTGTGCGCCAGTTCGTCCA
-tig00000001	-	196018	196044	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-28.10	-246.15	-218.05	1	7	ATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGAT
-tig00000001	-	196056	196056	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-2.68	-138.35	-135.67	1	1	AAACTCGCTGA
-tig00000001	-	196067	196093	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-41.85	-257.56	-215.70	1	5	TATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAG
-tig00000001	-	196122	196125	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-14.25	-115.99	-101.74	1	2	CATGGCGGCGGTAT
-tig00000001	-	196136	196140	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-6.51	-126.04	-119.53	1	2	CTTTTCGCCCGTGGG
-tig00000001	-	196155	196155	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-0.90	-151.78	-150.87	1	1	TACCACGCCAA
-tig00000001	-	196180	196190	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-12.35	-146.42	-134.07	1	3	CCTTGCGCCCGCAGTCGCTGG
-tig00000001	-	196210	196210	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-7.44	-102.60	-95.16	1	1	AGCATCGCCCA
-tig00000001	-	196224	196227	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-10.07	-124.23	-114.16	1	2	CTTCCCGACGCCTG
-tig00000001	-	196242	196242	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-6.71	-124.74	-118.04	1	1	GGCACCGAAGA
-tig00000001	-	196264	196274	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-23.55	-184.43	-160.88	1	4	TTCCCCGATGCGGCGCGGCAG
-tig00000001	-	196294	196319	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-11.30	-238.25	-226.95	1	5	GCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
-tig00000001	-	196342	196342	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-0.81	-99.77	-98.96	1	1	TCCAGCGCCAG
-tig00000001	-	196372	196380	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-5.42	-166.90	-161.47	1	2	ACAACCGGCTGGCCGATAT
-tig00000001	-	196396	196396	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-2.38	-145.01	-142.63	1	1	ACCAGCGGTTG
-tig00000001	-	196416	196426	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-8.55	-157.86	-149.32	1	2	TTTTGCGATCAGTTGCGTGAG
-tig00000001	-	196440	196440	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-1.09	-103.27	-102.19	1	1	TTCAACGCTGA
-tig00000001	-	196451	196466	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-8.82	-206.99	-198.17	1	5	GATTACGCGCTTTCGCCACGCGTGGG
-tig00000001	-	196483	196492	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-11.95	-156.84	-144.89	1	3	CAGGCCGCCGCTTGCGGGTG
-tig00000001	-	196514	196527	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-23.23	-191.22	-167.99	1	3	CAGCCCGCTTGCCGATGCCGTCAC
-tig00000001	-	196542	196576	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-8.85	-277.88	-269.02	1	7	TCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAAT
-tig00000001	-	196589	196595	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-8.99	-148.09	-139.11	1	3	AGCAACGCGTGCGGCTA
-tig00000001	-	196629	196629	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-3.08	-110.86	-107.78	1	1	CTGACCGCCAG
-tig00000001	-	196643	196643	f58173f7-dbfb-4c47-92c1-0124626bf4c2	1.17	-94.36	-95.53	1	1	GCTCCCGCCAG
-tig00000001	-	196677	196690	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-16.37	-220.76	-204.39	1	4	TCTGCCGTTGCCGACGGGCGACCA
-tig00000001	-	196706	196712	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-2.85	-141.65	-138.80	1	2	ATAGCCGTTGCCGGTAA
-tig00000001	-	196727	196749	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-26.68	-266.73	-240.05	1	5	CTGCCCGATTAATGCCGAACCGCGCACCGTATC
-tig00000001	-	196762	196770	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-2.50	-148.18	-145.68	1	2	CTTCACGAATCAACGAACC
-tig00000001	-	196810	196810	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-2.28	-129.48	-127.20	1	1	CAGTACGGTGG
-tig00000001	-	196823	196834	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-6.19	-164.01	-157.82	1	3	AGCAGCGGGTAAACGCCGCCAG
-tig00000001	-	196874	196878	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-9.62	-104.04	-94.42	1	2	AATGCCGGACGTAAT
-tig00000001	-	196909	196915	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-1.54	-153.46	-151.93	1	2	CAGACCGCAAACGGTCA
-tig00000001	-	196945	196952	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-1.04	-137.91	-136.87	1	2	GATACCGATAAACGGCAC
-tig00000001	-	196975	196975	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-6.78	-147.34	-140.56	1	1	CAGACCGTAAA
-tig00000001	-	196992	196995	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-8.49	-145.55	-137.07	1	2	AGTTACGGCGCAAC
-tig00000001	-	197011	197018	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-11.26	-156.12	-144.87	1	2	AGAAGCGGTAAGCGGTTT
-tig00000001	-	197032	197041	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-8.50	-159.50	-151.00	1	2	ACTCACGCCTTTAACGCCAG
-tig00000001	-	197059	197059	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-2.67	-141.00	-138.33	1	1	AAAGACGATAA
-tig00000001	-	197071	197071	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-5.34	-94.41	-89.07	1	1	CAAGGCGTTGA
-tig00000001	-	197084	197084	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-5.72	-96.01	-90.29	1	1	ATCACCGCACT
-tig00000001	-	197098	197108	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-10.45	-206.24	-195.79	1	3	GATTGCGGAGTCGGGCGAATG
-tig00000001	-	197132	197132	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-2.47	-115.69	-113.22	1	1	TTCAGCGCATT
-tig00000001	-	197144	197168	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-35.37	-277.38	-242.00	1	6	AACTGCGGATACGTTGCCGCGAATGCCGCCGGAAT
-tig00000001	-	197179	197197	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-15.49	-220.87	-205.38	1	3	AATGGCGAAGTATTTCGCCACATCGTTGG
-tig00000001	-	197222	197229	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-3.28	-117.18	-113.90	1	2	GTCAGCGAGCCACGGGTC
-tig00000001	-	197266	197266	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-0.42	-141.89	-141.48	1	1	CACCTCGATCA
-tig00000001	-	197279	197279	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-4.72	-113.95	-109.22	1	1	TTGGTCGGGTT
-tig00000001	-	197290	197296	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-2.82	-153.78	-150.96	1	2	AGAGTCGAGATCGACCA
-tig00000001	-	197309	197321	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-32.42	-173.65	-141.23	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	-	197332	197350	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-12.07	-260.91	-248.84	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	-	197363	197420	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-37.72	-447.69	-409.97	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	-	197433	197433	f58173f7-dbfb-4c47-92c1-0124626bf4c2	2.02	-123.26	-125.28	1	1	ACTGACGGATC
-tig00000001	-	197456	197470	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-18.71	-185.29	-166.58	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	-	197482	197509	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-21.88	-288.26	-266.38	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	-	197520	197530	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-3.86	-161.72	-157.86	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	-	197543	197543	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-13.92	-119.30	-105.38	1	1	ATCACCGTTTT
-tig00000001	-	197562	197577	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-21.60	-240.83	-219.23	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	-	197590	197599	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-8.69	-184.79	-176.10	1	2	AATACCGCCTTTGACGATAT
-tig00000001	-	197612	197620	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-6.69	-151.06	-144.36	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	-	197631	197631	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-2.98	-126.46	-123.48	1	1	GCACACGAGAA
-tig00000001	-	197654	197657	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-7.31	-123.66	-116.35	1	2	ACCAGCGGCGTGGC
-tig00000001	-	197670	197672	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-4.96	-170.58	-165.61	1	2	CCTGACGCGCAAC
-tig00000001	-	197683	197683	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-12.46	-121.02	-108.56	1	1	CTGATCGACTT
-tig00000001	-	197701	197701	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-4.87	-106.89	-102.02	1	1	AACATCGGTAG
-tig00000001	-	197719	197719	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-8.35	-125.51	-117.16	1	1	ACCACCGTTAG
-tig00000001	-	197736	197749	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-20.33	-235.07	-214.74	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	-	197763	197779	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-13.87	-194.27	-180.40	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	-	197791	197816	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-24.55	-227.82	-203.26	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	-	197837	197837	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-1.41	-126.25	-124.84	1	1	TGGAGCGACTG
-tig00000001	-	197848	197856	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-15.73	-178.73	-162.99	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	-	197868	197878	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-8.51	-143.23	-134.72	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	-	197895	197906	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-18.29	-186.15	-167.86	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	-	197921	197921	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-13.96	-146.21	-132.25	1	1	GCCAGCGAAGC
-tig00000001	-	197935	197948	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-11.35	-210.33	-198.98	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	-	197960	197969	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-15.38	-179.70	-164.32	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	-	197982	197999	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-17.68	-249.40	-231.72	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	-	198014	198014	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-7.74	-117.80	-110.07	1	1	GGTGCCGGTTT
-tig00000001	-	198035	198051	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-17.72	-236.72	-219.00	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	-	198064	198068	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-1.31	-181.06	-179.74	1	2	CTGCACGTCCGCTGG
-tig00000001	-	198087	198089	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-2.67	-155.43	-152.76	1	2	ACATTCGCGCCTA
-tig00000001	-	198100	198123	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-17.56	-301.29	-283.73	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	-	198137	198137	f58173f7-dbfb-4c47-92c1-0124626bf4c2	1.23	-110.15	-111.38	1	1	CAGGCCGCCAA
-tig00000001	-	198171	198171	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-1.37	-115.58	-114.21	1	1	AGCAGCGCCAC
-tig00000001	-	198183	198188	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-5.46	-149.37	-143.91	1	2	AGTACCGTTACGCTGA
-tig00000001	-	198203	198233	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-25.30	-323.00	-297.70	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	-	198250	198250	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-2.26	-135.06	-132.80	1	1	AAAGACGATAG
-tig00000001	-	198289	198313	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-28.89	-236.33	-207.43	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	-	198326	198336	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-12.68	-155.48	-142.80	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	-	198352	198364	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-7.78	-167.37	-159.59	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	-	198399	198415	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-15.19	-202.07	-186.88	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	-	198427	198485	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-20.18	-434.05	-413.87	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	-	198513	198513	f58173f7-dbfb-4c47-92c1-0124626bf4c2	10.34	-150.14	-160.48	1	1	ACCATCGCAGG
-tig00000001	-	198527	198527	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-0.99	-133.37	-132.39	1	1	AATATCGCCAG
-tig00000001	-	198545	198569	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-25.43	-286.93	-261.50	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	-	198585	198619	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-26.88	-282.89	-256.01	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	-	198660	198670	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-12.09	-149.10	-137.01	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	-	198684	198710	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-23.69	-283.66	-259.97	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	-	198728	198782	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-27.29	-445.79	-418.50	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	-	198812	198821	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-0.59	-177.56	-176.97	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	-	198834	198855	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-15.90	-241.96	-226.06	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	-	198872	198872	f58173f7-dbfb-4c47-92c1-0124626bf4c2	1.18	-122.87	-124.05	1	1	TTCACCGCTTC
-tig00000001	-	198884	198892	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-11.03	-215.46	-204.43	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	-	198907	198914	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-8.62	-162.72	-154.10	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	-	198927	198927	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-2.46	-106.34	-103.88	1	1	GTTTACGACTC
-tig00000001	-	198972	198987	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-5.74	-195.50	-189.76	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	-	199013	199013	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-1.45	-136.15	-134.70	1	1	CAGTGCGCCAA
-tig00000001	-	199028	199034	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-4.11	-194.93	-190.82	1	2	CAACACGGTGCCGATTA
-tig00000001	-	199056	199088	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-11.77	-267.30	-255.53	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	-	199112	199117	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-9.74	-111.26	-101.51	1	2	ACCAGCGAACCGGCAA
-tig00000001	-	199133	199133	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-2.44	-110.68	-108.24	1	1	ATCACCGGGAT
-tig00000001	-	199147	199156	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-18.57	-190.80	-172.23	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	-	199172	199172	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-5.29	-100.89	-95.60	1	1	CAGAACGCCAG
-tig00000001	-	199193	199193	f58173f7-dbfb-4c47-92c1-0124626bf4c2	0.48	-101.05	-101.53	1	1	CAGAACGGAGA
-tig00000001	-	199204	199228	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-22.18	-205.62	-183.44	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	-	199240	199255	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-25.62	-193.15	-167.53	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	-	199267	199267	f58173f7-dbfb-4c47-92c1-0124626bf4c2	1.52	-107.14	-108.66	1	1	CACTTCGCTAA
-tig00000001	-	199280	199280	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-2.39	-103.53	-101.15	1	1	CCATGCGGGCC
-tig00000001	-	199300	199336	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-47.64	-355.65	-308.01	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	-	199352	199355	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-8.36	-143.03	-134.66	1	2	ACCAGCGTCGGGGT
-tig00000001	-	199393	199402	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-10.07	-159.77	-149.71	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	-	199423	199430	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-5.26	-134.00	-128.74	1	2	TATTCCGGTGTACGACCA
-tig00000001	-	199446	199446	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-1.05	-106.92	-105.87	1	1	CAGCCCGGCAA
-tig00000001	-	199459	199459	f58173f7-dbfb-4c47-92c1-0124626bf4c2	0.12	-128.52	-128.64	1	1	AACACCGCCAG
-tig00000001	-	199485	199485	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-1.60	-133.47	-131.87	1	1	CATGCCGTAAA
-tig00000001	-	199500	199509	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-13.24	-187.18	-173.94	1	3	AGAACCGACACCGCCGAACA
-tig00000001	-	199543	199543	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-5.98	-142.87	-136.89	1	1	CACATCGGCAC
-tig00000001	-	199557	199570	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-15.68	-245.74	-230.06	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	-	199582	199593	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-11.71	-156.61	-144.89	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	-	199606	199621	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-17.03	-199.36	-182.33	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	-	199644	199652	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-22.40	-186.40	-164.00	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	-	199687	199687	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-5.67	-97.68	-92.01	1	1	CTGTCCGTGCC
-tig00000001	-	199740	199746	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-9.47	-133.77	-124.30	1	2	CACCACGCCTACGCAGA
-tig00000001	-	199770	199770	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-8.25	-103.01	-94.76	1	1	GACATCGCCCA
-tig00000001	-	199786	199802	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-42.27	-269.14	-226.87	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	-	199833	199836	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-14.30	-135.24	-120.95	1	2	CACAGCGCCGTTGG
-tig00000001	-	199854	199854	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-3.03	-98.98	-95.95	1	1	AAGATCGCCAG
-tig00000001	-	199868	199868	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-0.90	-119.52	-118.62	1	1	CTGCACGAAGT
-tig00000001	-	199883	199883	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-6.56	-110.53	-103.98	1	1	CAGTGCGGTTG
-tig00000001	-	199899	199908	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-8.65	-147.18	-138.53	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	-	199931	199943	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-13.03	-165.43	-152.40	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	-	199956	199956	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-4.52	-115.69	-111.17	1	1	TTGATCGCTTC
-tig00000001	-	199998	199998	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-11.74	-137.99	-126.25	1	1	TGTTGCGCTCC
 tig00000001	-	200009	200009	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-9.16	-140.53	-131.37	1	1	TTCAACGGTAT
 tig00000001	-	200046	200046	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-4.25	-76.96	-72.71	1	1	TGCAGCGCACC
 tig00000001	-	200081	200081	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-1.43	-122.22	-120.79	1	1	AACAACGCCAC
@@ -1812,207 +140,6 @@
 tig00000001	-	200784	200788	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-16.32	-136.50	-120.18	1	2	ATCTGCGGGCGGGGT
 tig00000001	-	200914	200914	f58173f7-dbfb-4c47-92c1-0124626bf4c2	-0.55	-95.05	-94.50	1	1	GTGGTCGGATG
 tig00000001	-	200942	200942	f58173f7-dbfb-4c47-92c1-0124626bf4c2	3.36	-138.34	-141.70	1	1	AAAGGCGGTAC
-tig00000001	-	194458	194458	7f343574-f2bc-4388-91b9-84b99e39256a	0.05	-111.08	-111.14	1	1	GCAGGCGCTGC
-tig00000001	-	194469	194469	7f343574-f2bc-4388-91b9-84b99e39256a	-1.06	-91.84	-90.78	1	1	TGTTCCGGGAT
-tig00000001	-	194485	194485	7f343574-f2bc-4388-91b9-84b99e39256a	-0.73	-140.15	-139.42	1	1	ACTGGCGCAGA
-tig00000001	-	194496	194496	7f343574-f2bc-4388-91b9-84b99e39256a	0.68	-130.78	-131.45	1	1	TTCCCCGCTCC
-tig00000001	-	194515	194515	7f343574-f2bc-4388-91b9-84b99e39256a	-0.91	-103.11	-102.20	1	1	CAGCCCGTAGG
-tig00000001	-	194527	194539	7f343574-f2bc-4388-91b9-84b99e39256a	-0.48	-150.51	-150.03	1	3	TTTCTCGCCGCTTTTAGCGGCAA
-tig00000001	-	194554	194587	7f343574-f2bc-4388-91b9-84b99e39256a	-16.61	-317.86	-301.25	1	7	TGGTACGGTACACCGGGTAACGTGTCGGTGCCCGCGCCCGCAGG
-tig00000001	-	194617	194638	7f343574-f2bc-4388-91b9-84b99e39256a	-8.92	-243.78	-234.86	1	5	CACTGCGCGATGGCATCGTCCCACGGCGTCAT
-tig00000001	-	194650	194650	7f343574-f2bc-4388-91b9-84b99e39256a	-0.47	-110.66	-110.19	1	1	CCTTGCGGATG
-tig00000001	-	194662	194662	7f343574-f2bc-4388-91b9-84b99e39256a	-2.34	-106.19	-103.85	1	1	GTTAACGGCTG
-tig00000001	-	194676	194685	7f343574-f2bc-4388-91b9-84b99e39256a	-1.05	-152.40	-151.35	1	2	TTTACCGTTGTCATCGGGCA
-tig00000001	-	194705	194705	7f343574-f2bc-4388-91b9-84b99e39256a	-3.85	-108.43	-104.58	1	1	GACTGCGGGCA
-tig00000001	-	194716	194716	7f343574-f2bc-4388-91b9-84b99e39256a	-1.66	-116.89	-115.23	1	1	TGAAACGTGGA
-tig00000001	-	194736	194736	7f343574-f2bc-4388-91b9-84b99e39256a	-2.64	-83.70	-81.05	1	1	TTGTTCGCTGG
-tig00000001	-	194748	194773	7f343574-f2bc-4388-91b9-84b99e39256a	-9.97	-233.49	-223.53	1	4	GGCAGCGATATCCTGCGGACTGCGGCCCACCGCCAG
-tig00000001	-	194785	194785	7f343574-f2bc-4388-91b9-84b99e39256a	-3.96	-115.65	-111.69	1	1	GCTTTCGACAT
-tig00000001	-	194804	194850	7f343574-f2bc-4388-91b9-84b99e39256a	-28.06	-344.45	-316.39	1	9	AGTGCCGTGTGCGTTGCTCGCGGTAACGGGCTACCCGCGCCTGATAACGCACGCCAG
-tig00000001	-	194868	194868	7f343574-f2bc-4388-91b9-84b99e39256a	-4.13	-116.02	-111.89	1	1	GTTCCCGATCA
-tig00000001	-	194880	194883	7f343574-f2bc-4388-91b9-84b99e39256a	-2.31	-161.45	-159.14	1	2	CAGCCCGACGGTTA
-tig00000001	-	194896	194898	7f343574-f2bc-4388-91b9-84b99e39256a	-7.72	-124.04	-116.33	1	2	ATCACCGCGAAGG
-tig00000001	-	194928	194949	7f343574-f2bc-4388-91b9-84b99e39256a	-22.24	-233.02	-210.78	1	6	AGAGACGGCGAGCGTGCCGCGTGGGGCGATAA
-tig00000001	-	194963	194963	7f343574-f2bc-4388-91b9-84b99e39256a	-2.29	-95.27	-92.98	1	1	GAGATCGAAAC
-tig00000001	-	194984	194984	7f343574-f2bc-4388-91b9-84b99e39256a	-3.00	-84.64	-81.65	1	1	AATGACGGTGG
-tig00000001	-	195007	195007	7f343574-f2bc-4388-91b9-84b99e39256a	-4.93	-139.30	-134.37	1	1	GCCAGCGTCCA
-tig00000001	-	195021	195021	7f343574-f2bc-4388-91b9-84b99e39256a	-1.14	-104.76	-103.62	1	1	AATAGCGCCAC
-tig00000001	-	195035	195035	7f343574-f2bc-4388-91b9-84b99e39256a	-2.03	-130.82	-128.79	1	1	CACCACGCCAA
-tig00000001	-	195065	195075	7f343574-f2bc-4388-91b9-84b99e39256a	-12.88	-192.73	-179.85	1	2	GTTGGCGGCATCAAACGCCAT
-tig00000001	-	195110	195134	7f343574-f2bc-4388-91b9-84b99e39256a	-22.86	-235.86	-213.00	1	6	GATAACGGCGCATAACGCGGCGGCAACCACGCATC
-tig00000001	-	195154	195154	7f343574-f2bc-4388-91b9-84b99e39256a	0.72	-126.41	-127.12	1	1	GTACACGCCAC
-tig00000001	-	195175	195206	7f343574-f2bc-4388-91b9-84b99e39256a	-10.96	-224.69	-213.72	1	7	AAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTG
-tig00000001	-	195222	195224	7f343574-f2bc-4388-91b9-84b99e39256a	-4.39	-147.00	-142.62	1	2	TCAAGCGCGACCA
-tig00000001	-	195239	195264	7f343574-f2bc-4388-91b9-84b99e39256a	-17.48	-328.99	-311.51	1	6	CTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCA
-tig00000001	-	195275	195313	7f343574-f2bc-4388-91b9-84b99e39256a	-31.72	-392.10	-360.38	1	9	GCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAA
-tig00000001	-	195328	195328	7f343574-f2bc-4388-91b9-84b99e39256a	-1.23	-94.37	-93.13	1	1	CTTGCCGAGAT
-tig00000001	-	195342	195359	7f343574-f2bc-4388-91b9-84b99e39256a	-5.28	-174.45	-169.17	1	3	GTTCACGGGCATAACGCACTACCGCTTT
-tig00000001	-	195371	195371	7f343574-f2bc-4388-91b9-84b99e39256a	0.33	-95.44	-95.77	1	1	TCTTCCGCTGG
-tig00000001	-	195392	195400	7f343574-f2bc-4388-91b9-84b99e39256a	-10.62	-208.21	-197.59	1	3	GTTGCCGTCTCCGCGCCCA
-tig00000001	-	195413	195427	7f343574-f2bc-4388-91b9-84b99e39256a	-8.49	-229.79	-221.30	1	3	TCCTGCGCCAGACGTAAGGCGCTGA
-tig00000001	-	195441	195460	7f343574-f2bc-4388-91b9-84b99e39256a	-10.44	-222.39	-211.95	1	4	TTGCCCGACGTTTTTTCCGGTAAGCGGTGC
-tig00000001	-	195489	195500	7f343574-f2bc-4388-91b9-84b99e39256a	-1.28	-248.08	-246.79	1	3	TACACCGCGTGCCAGACGCTAC
-tig00000001	-	195511	195535	7f343574-f2bc-4388-91b9-84b99e39256a	-21.09	-223.38	-202.29	1	7	CCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACC
-tig00000001	-	195547	195553	7f343574-f2bc-4388-91b9-84b99e39256a	-1.86	-101.29	-99.43	1	2	GTTTTCGCTGCCGGTGT
-tig00000001	-	195565	195565	7f343574-f2bc-4388-91b9-84b99e39256a	-4.70	-90.28	-85.59	1	1	ATGGCCGATGC
-tig00000001	-	195581	195590	7f343574-f2bc-4388-91b9-84b99e39256a	-8.10	-158.14	-150.04	1	5	AGGATCGCGTCGCGCGTGTG
-tig00000001	-	195608	195608	7f343574-f2bc-4388-91b9-84b99e39256a	1.98	-94.95	-96.94	1	1	CTCTTCGCCAG
-tig00000001	-	195621	195630	7f343574-f2bc-4388-91b9-84b99e39256a	-4.52	-151.31	-146.79	1	3	TGCCCCGCCAGGCGCGCATT
-tig00000001	-	195646	195663	7f343574-f2bc-4388-91b9-84b99e39256a	-12.40	-199.49	-187.09	1	5	ATCAACGCGATCGGCAGTACGGCGCAGT
-tig00000001	-	195676	195685	7f343574-f2bc-4388-91b9-84b99e39256a	-5.95	-183.57	-177.62	1	3	CAGTTCGCGCAGGGCGATCA
-tig00000001	-	195702	195702	7f343574-f2bc-4388-91b9-84b99e39256a	-1.52	-118.02	-116.50	1	1	CTTTGCGGAAA
-tig00000001	-	195720	195735	7f343574-f2bc-4388-91b9-84b99e39256a	-8.28	-193.20	-184.92	1	4	AATGGCGCGCTCCGCCTGCCCGGCAA
-tig00000001	-	195764	195781	7f343574-f2bc-4388-91b9-84b99e39256a	-12.29	-192.32	-180.02	1	4	TCAGCCGCTGGCGCAGATCGTCCGGGGC
-tig00000001	-	195803	195842	7f343574-f2bc-4388-91b9-84b99e39256a	-31.81	-369.97	-338.16	1	8	CACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACC
-tig00000001	-	195855	195864	7f343574-f2bc-4388-91b9-84b99e39256a	-7.10	-148.53	-141.43	1	3	AATTCCGGTGACGCCGCTGA
-tig00000001	-	195900	195906	7f343574-f2bc-4388-91b9-84b99e39256a	0.15	-120.73	-120.88	1	2	CTGAACGTTGACGGTAG
-tig00000001	-	195945	195945	7f343574-f2bc-4388-91b9-84b99e39256a	-1.49	-203.42	-201.93	1	1	TTCTTCGATAT
-tig00000001	-	195959	195959	7f343574-f2bc-4388-91b9-84b99e39256a	-6.40	-131.02	-124.63	1	1	GCCAGCGTTTG
-tig00000001	-	195971	195971	7f343574-f2bc-4388-91b9-84b99e39256a	-1.65	-80.95	-79.30	1	1	GATGACGGGAA
-tig00000001	-	195982	195982	7f343574-f2bc-4388-91b9-84b99e39256a	-9.28	-127.79	-118.51	1	1	CCTGGCGCATT
-tig00000001	-	195994	196002	7f343574-f2bc-4388-91b9-84b99e39256a	-0.10	-150.63	-150.53	1	2	CTGTGCGCCAGTTCGTCCA
-tig00000001	-	196018	196044	7f343574-f2bc-4388-91b9-84b99e39256a	-20.31	-214.44	-194.13	1	7	ATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGAT
-tig00000001	-	196056	196056	7f343574-f2bc-4388-91b9-84b99e39256a	0.07	-119.81	-119.88	1	1	AAACTCGCTGA
-tig00000001	-	196067	196093	7f343574-f2bc-4388-91b9-84b99e39256a	-25.27	-350.61	-325.34	1	5	TATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAG
-tig00000001	-	196122	196125	7f343574-f2bc-4388-91b9-84b99e39256a	-8.51	-168.11	-159.60	1	2	CATGGCGGCGGTAT
-tig00000001	-	196136	196140	7f343574-f2bc-4388-91b9-84b99e39256a	-10.16	-136.24	-126.09	1	2	CTTTTCGCCCGTGGG
-tig00000001	-	196155	196155	7f343574-f2bc-4388-91b9-84b99e39256a	-7.02	-118.27	-111.25	1	1	TACCACGCCAA
-tig00000001	-	196180	196190	7f343574-f2bc-4388-91b9-84b99e39256a	-9.82	-171.59	-161.76	1	3	CCTTGCGCCCGCAGTCGCTGG
-tig00000001	-	196210	196210	7f343574-f2bc-4388-91b9-84b99e39256a	-0.00	-103.84	-103.84	1	1	AGCATCGCCCA
-tig00000001	-	196224	196227	7f343574-f2bc-4388-91b9-84b99e39256a	-2.55	-159.29	-156.74	1	2	CTTCCCGACGCCTG
-tig00000001	-	196242	196242	7f343574-f2bc-4388-91b9-84b99e39256a	-8.43	-116.17	-107.73	1	1	GGCACCGAAGA
-tig00000001	-	196264	196274	7f343574-f2bc-4388-91b9-84b99e39256a	-13.31	-152.30	-138.99	1	4	TTCCCCGATGCGGCGCGGCAG
-tig00000001	-	196294	196319	7f343574-f2bc-4388-91b9-84b99e39256a	-3.32	-212.59	-209.26	1	5	GCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
-tig00000001	-	196342	196342	7f343574-f2bc-4388-91b9-84b99e39256a	-6.37	-117.26	-110.88	1	1	TCCAGCGCCAG
-tig00000001	-	196372	196380	7f343574-f2bc-4388-91b9-84b99e39256a	-9.17	-158.94	-149.77	1	2	ACAACCGGCTGGCCGATAT
-tig00000001	-	196396	196396	7f343574-f2bc-4388-91b9-84b99e39256a	-2.73	-104.27	-101.54	1	1	ACCAGCGGTTG
-tig00000001	-	196416	196426	7f343574-f2bc-4388-91b9-84b99e39256a	-3.19	-132.93	-129.73	1	2	TTTTGCGATCAGTTGCGTGAG
-tig00000001	-	196440	196440	7f343574-f2bc-4388-91b9-84b99e39256a	-0.78	-77.38	-76.60	1	1	TTCAACGCTGA
-tig00000001	-	196451	196466	7f343574-f2bc-4388-91b9-84b99e39256a	-11.17	-181.60	-170.43	1	5	GATTACGCGCTTTCGCCACGCGTGGG
-tig00000001	-	196483	196492	7f343574-f2bc-4388-91b9-84b99e39256a	-15.59	-180.90	-165.31	1	3	CAGGCCGCCGCTTGCGGGTG
-tig00000001	-	196514	196527	7f343574-f2bc-4388-91b9-84b99e39256a	-4.10	-173.51	-169.41	1	3	CAGCCCGCTTGCCGATGCCGTCAC
-tig00000001	-	196542	196576	7f343574-f2bc-4388-91b9-84b99e39256a	-13.39	-309.48	-296.09	1	7	TCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAAT
-tig00000001	-	196589	196595	7f343574-f2bc-4388-91b9-84b99e39256a	-8.99	-154.25	-145.26	1	3	AGCAACGCGTGCGGCTA
-tig00000001	-	196629	196629	7f343574-f2bc-4388-91b9-84b99e39256a	-0.35	-125.52	-125.17	1	1	CTGACCGCCAG
-tig00000001	-	196643	196643	7f343574-f2bc-4388-91b9-84b99e39256a	-0.64	-126.19	-125.55	1	1	GCTCCCGCCAG
-tig00000001	-	196677	196690	7f343574-f2bc-4388-91b9-84b99e39256a	-4.83	-204.42	-199.58	1	4	TCTGCCGTTGCCGACGGGCGACCA
-tig00000001	-	196706	196712	7f343574-f2bc-4388-91b9-84b99e39256a	-1.29	-126.43	-125.14	1	2	ATAGCCGTTGCCGGTAA
-tig00000001	-	196727	196749	7f343574-f2bc-4388-91b9-84b99e39256a	-12.94	-252.96	-240.02	1	5	CTGCCCGATTAATGCCGAACCGCGCACCGTATC
-tig00000001	-	196762	196770	7f343574-f2bc-4388-91b9-84b99e39256a	2.43	-149.46	-151.89	1	2	CTTCACGAATCAACGAACC
-tig00000001	-	196810	196810	7f343574-f2bc-4388-91b9-84b99e39256a	-1.00	-116.61	-115.61	1	1	CAGTACGGTGG
-tig00000001	-	196823	196834	7f343574-f2bc-4388-91b9-84b99e39256a	-7.66	-155.47	-147.81	1	3	AGCAGCGGGTAAACGCCGCCAG
-tig00000001	-	196874	196878	7f343574-f2bc-4388-91b9-84b99e39256a	-5.17	-124.26	-119.09	1	2	AATGCCGGACGTAAT
-tig00000001	-	196909	196915	7f343574-f2bc-4388-91b9-84b99e39256a	0.17	-159.97	-160.14	1	2	CAGACCGCAAACGGTCA
-tig00000001	-	196945	196952	7f343574-f2bc-4388-91b9-84b99e39256a	-2.73	-132.33	-129.60	1	2	GATACCGATAAACGGCAC
-tig00000001	-	196975	196975	7f343574-f2bc-4388-91b9-84b99e39256a	-1.63	-130.54	-128.91	1	1	CAGACCGTAAA
-tig00000001	-	196992	196995	7f343574-f2bc-4388-91b9-84b99e39256a	-8.27	-135.50	-127.22	1	2	AGTTACGGCGCAAC
-tig00000001	-	197011	197018	7f343574-f2bc-4388-91b9-84b99e39256a	-6.60	-168.75	-162.14	1	2	AGAAGCGGTAAGCGGTTT
-tig00000001	-	197032	197041	7f343574-f2bc-4388-91b9-84b99e39256a	-4.28	-198.44	-194.16	1	2	ACTCACGCCTTTAACGCCAG
-tig00000001	-	197059	197059	7f343574-f2bc-4388-91b9-84b99e39256a	0.65	-101.47	-102.12	1	1	AAAGACGATAA
-tig00000001	-	197071	197071	7f343574-f2bc-4388-91b9-84b99e39256a	-3.37	-117.50	-114.13	1	1	CAAGGCGTTGA
-tig00000001	-	197084	197084	7f343574-f2bc-4388-91b9-84b99e39256a	-0.41	-114.51	-114.11	1	1	ATCACCGCACT
-tig00000001	-	197098	197108	7f343574-f2bc-4388-91b9-84b99e39256a	-3.22	-139.97	-136.75	1	3	GATTGCGGAGTCGGGCGAATG
-tig00000001	-	197132	197132	7f343574-f2bc-4388-91b9-84b99e39256a	-2.24	-117.77	-115.53	1	1	TTCAGCGCATT
-tig00000001	-	197144	197168	7f343574-f2bc-4388-91b9-84b99e39256a	-16.62	-263.69	-247.07	1	6	AACTGCGGATACGTTGCCGCGAATGCCGCCGGAAT
-tig00000001	-	197179	197197	7f343574-f2bc-4388-91b9-84b99e39256a	-13.66	-222.38	-208.71	1	3	AATGGCGAAGTATTTCGCCACATCGTTGG
-tig00000001	-	197222	197229	7f343574-f2bc-4388-91b9-84b99e39256a	-1.19	-145.20	-144.01	1	2	GTCAGCGAGCCACGGGTC
-tig00000001	-	197266	197266	7f343574-f2bc-4388-91b9-84b99e39256a	-1.54	-149.91	-148.38	1	1	CACCTCGATCA
-tig00000001	-	197279	197279	7f343574-f2bc-4388-91b9-84b99e39256a	-3.30	-116.64	-113.35	1	1	TTGGTCGGGTT
-tig00000001	-	197290	197296	7f343574-f2bc-4388-91b9-84b99e39256a	0.62	-124.81	-125.43	1	2	AGAGTCGAGATCGACCA
-tig00000001	-	197309	197321	7f343574-f2bc-4388-91b9-84b99e39256a	-16.48	-177.78	-161.30	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	-	197332	197350	7f343574-f2bc-4388-91b9-84b99e39256a	-4.12	-274.73	-270.61	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	-	197363	197420	7f343574-f2bc-4388-91b9-84b99e39256a	-30.46	-530.97	-500.52	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	-	197433	197433	7f343574-f2bc-4388-91b9-84b99e39256a	-2.34	-128.83	-126.49	1	1	ACTGACGGATC
-tig00000001	-	197456	197470	7f343574-f2bc-4388-91b9-84b99e39256a	-12.89	-183.35	-170.47	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	-	197482	197509	7f343574-f2bc-4388-91b9-84b99e39256a	-32.28	-286.66	-254.38	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	-	197520	197530	7f343574-f2bc-4388-91b9-84b99e39256a	-7.26	-182.01	-174.74	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	-	197543	197543	7f343574-f2bc-4388-91b9-84b99e39256a	-4.63	-111.26	-106.63	1	1	ATCACCGTTTT
-tig00000001	-	197562	197577	7f343574-f2bc-4388-91b9-84b99e39256a	-21.86	-186.67	-164.80	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	-	197590	197599	7f343574-f2bc-4388-91b9-84b99e39256a	-16.75	-210.07	-193.32	1	2	AATACCGCCTTTGACGATAT
-tig00000001	-	197612	197620	7f343574-f2bc-4388-91b9-84b99e39256a	-9.14	-189.63	-180.50	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	-	197631	197631	7f343574-f2bc-4388-91b9-84b99e39256a	-4.20	-148.08	-143.87	1	1	GCACACGAGAA
-tig00000001	-	197654	197657	7f343574-f2bc-4388-91b9-84b99e39256a	-8.69	-124.79	-116.10	1	2	ACCAGCGGCGTGGC
-tig00000001	-	197670	197672	7f343574-f2bc-4388-91b9-84b99e39256a	-6.69	-164.79	-158.10	1	2	CCTGACGCGCAAC
-tig00000001	-	197683	197683	7f343574-f2bc-4388-91b9-84b99e39256a	-6.95	-186.60	-179.65	1	1	CTGATCGACTT
-tig00000001	-	197701	197701	7f343574-f2bc-4388-91b9-84b99e39256a	-1.49	-109.05	-107.55	1	1	AACATCGGTAG
-tig00000001	-	197719	197719	7f343574-f2bc-4388-91b9-84b99e39256a	-0.37	-110.44	-110.07	1	1	ACCACCGTTAG
-tig00000001	-	197736	197749	7f343574-f2bc-4388-91b9-84b99e39256a	-3.36	-190.81	-187.44	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	-	197763	197779	7f343574-f2bc-4388-91b9-84b99e39256a	-1.91	-195.48	-193.57	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	-	197791	197816	7f343574-f2bc-4388-91b9-84b99e39256a	-10.71	-228.75	-218.04	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	-	197837	197837	7f343574-f2bc-4388-91b9-84b99e39256a	-1.17	-99.26	-98.09	1	1	TGGAGCGACTG
-tig00000001	-	197848	197856	7f343574-f2bc-4388-91b9-84b99e39256a	-11.44	-179.67	-168.23	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	-	197868	197878	7f343574-f2bc-4388-91b9-84b99e39256a	-8.12	-166.08	-157.96	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	-	197895	197906	7f343574-f2bc-4388-91b9-84b99e39256a	-12.73	-180.61	-167.88	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	-	197921	197921	7f343574-f2bc-4388-91b9-84b99e39256a	-3.83	-124.29	-120.45	1	1	GCCAGCGAAGC
-tig00000001	-	197935	197948	7f343574-f2bc-4388-91b9-84b99e39256a	-20.90	-248.53	-227.63	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	-	197960	197969	7f343574-f2bc-4388-91b9-84b99e39256a	-22.81	-156.19	-133.38	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	-	197982	197999	7f343574-f2bc-4388-91b9-84b99e39256a	-8.72	-176.23	-167.51	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	-	198014	198014	7f343574-f2bc-4388-91b9-84b99e39256a	-5.36	-96.87	-91.52	1	1	GGTGCCGGTTT
-tig00000001	-	198035	198051	7f343574-f2bc-4388-91b9-84b99e39256a	-8.86	-188.77	-179.91	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	-	198064	198068	7f343574-f2bc-4388-91b9-84b99e39256a	-4.75	-108.19	-103.44	1	2	CTGCACGTCCGCTGG
-tig00000001	-	198087	198089	7f343574-f2bc-4388-91b9-84b99e39256a	-2.46	-142.41	-139.94	1	2	ACATTCGCGCCTA
-tig00000001	-	198100	198123	7f343574-f2bc-4388-91b9-84b99e39256a	-20.73	-297.37	-276.64	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	-	198137	198137	7f343574-f2bc-4388-91b9-84b99e39256a	0.57	-96.59	-97.15	1	1	CAGGCCGCCAA
-tig00000001	-	198171	198171	7f343574-f2bc-4388-91b9-84b99e39256a	-0.77	-116.87	-116.09	1	1	AGCAGCGCCAC
-tig00000001	-	198183	198188	7f343574-f2bc-4388-91b9-84b99e39256a	-7.89	-158.17	-150.27	1	2	AGTACCGTTACGCTGA
-tig00000001	-	198203	198233	7f343574-f2bc-4388-91b9-84b99e39256a	-18.07	-260.99	-242.92	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	-	198250	198250	7f343574-f2bc-4388-91b9-84b99e39256a	3.58	-120.11	-123.69	1	1	AAAGACGATAG
-tig00000001	-	198289	198313	7f343574-f2bc-4388-91b9-84b99e39256a	-30.28	-247.21	-216.93	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	-	198326	198336	7f343574-f2bc-4388-91b9-84b99e39256a	-2.04	-186.28	-184.24	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	-	198352	198364	7f343574-f2bc-4388-91b9-84b99e39256a	-5.24	-188.77	-183.53	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	-	198399	198415	7f343574-f2bc-4388-91b9-84b99e39256a	-7.40	-225.43	-218.03	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	-	198427	198485	7f343574-f2bc-4388-91b9-84b99e39256a	-35.95	-434.65	-398.70	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	-	198513	198513	7f343574-f2bc-4388-91b9-84b99e39256a	0.88	-92.08	-92.96	1	1	ACCATCGCAGG
-tig00000001	-	198527	198527	7f343574-f2bc-4388-91b9-84b99e39256a	1.89	-90.70	-92.59	1	1	AATATCGCCAG
-tig00000001	-	198545	198569	7f343574-f2bc-4388-91b9-84b99e39256a	-7.94	-257.62	-249.68	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	-	198585	198619	7f343574-f2bc-4388-91b9-84b99e39256a	-15.00	-243.49	-228.49	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	-	198660	198670	7f343574-f2bc-4388-91b9-84b99e39256a	-6.79	-162.58	-155.79	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	-	198684	198710	7f343574-f2bc-4388-91b9-84b99e39256a	-17.74	-287.40	-269.66	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	-	198728	198782	7f343574-f2bc-4388-91b9-84b99e39256a	-24.37	-409.15	-384.78	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	-	198812	198821	7f343574-f2bc-4388-91b9-84b99e39256a	-3.78	-160.93	-157.15	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	-	198834	198855	7f343574-f2bc-4388-91b9-84b99e39256a	-14.51	-205.75	-191.24	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	-	198872	198872	7f343574-f2bc-4388-91b9-84b99e39256a	-0.32	-98.27	-97.95	1	1	TTCACCGCTTC
-tig00000001	-	198884	198892	7f343574-f2bc-4388-91b9-84b99e39256a	-12.83	-178.77	-165.93	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	-	198907	198914	7f343574-f2bc-4388-91b9-84b99e39256a	-3.24	-153.50	-150.25	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	-	198927	198927	7f343574-f2bc-4388-91b9-84b99e39256a	-2.03	-115.85	-113.82	1	1	GTTTACGACTC
-tig00000001	-	198972	198987	7f343574-f2bc-4388-91b9-84b99e39256a	-4.22	-183.22	-179.00	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	-	199013	199013	7f343574-f2bc-4388-91b9-84b99e39256a	-2.60	-96.31	-93.70	1	1	CAGTGCGCCAA
-tig00000001	-	199028	199034	7f343574-f2bc-4388-91b9-84b99e39256a	-3.03	-183.56	-180.53	1	2	CAACACGGTGCCGATTA
-tig00000001	-	199056	199088	7f343574-f2bc-4388-91b9-84b99e39256a	-17.81	-280.68	-262.87	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	-	199112	199117	7f343574-f2bc-4388-91b9-84b99e39256a	-4.46	-152.13	-147.67	1	2	ACCAGCGAACCGGCAA
-tig00000001	-	199133	199133	7f343574-f2bc-4388-91b9-84b99e39256a	-3.91	-129.03	-125.12	1	1	ATCACCGGGAT
-tig00000001	-	199147	199156	7f343574-f2bc-4388-91b9-84b99e39256a	-4.94	-156.08	-151.14	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	-	199172	199172	7f343574-f2bc-4388-91b9-84b99e39256a	-1.97	-96.62	-94.65	1	1	CAGAACGCCAG
-tig00000001	-	199193	199193	7f343574-f2bc-4388-91b9-84b99e39256a	0.12	-109.76	-109.89	1	1	CAGAACGGAGA
-tig00000001	-	199204	199228	7f343574-f2bc-4388-91b9-84b99e39256a	-13.57	-192.23	-178.66	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	-	199240	199255	7f343574-f2bc-4388-91b9-84b99e39256a	-14.07	-193.67	-179.60	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	-	199267	199267	7f343574-f2bc-4388-91b9-84b99e39256a	-1.81	-108.04	-106.23	1	1	CACTTCGCTAA
-tig00000001	-	199280	199280	7f343574-f2bc-4388-91b9-84b99e39256a	-1.42	-100.48	-99.05	1	1	CCATGCGGGCC
-tig00000001	-	199300	199336	7f343574-f2bc-4388-91b9-84b99e39256a	-16.17	-360.48	-344.31	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	-	199352	199355	7f343574-f2bc-4388-91b9-84b99e39256a	-3.77	-133.43	-129.65	1	2	ACCAGCGTCGGGGT
-tig00000001	-	199393	199402	7f343574-f2bc-4388-91b9-84b99e39256a	-12.46	-139.35	-126.89	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	-	199423	199430	7f343574-f2bc-4388-91b9-84b99e39256a	-1.29	-148.05	-146.75	1	2	TATTCCGGTGTACGACCA
-tig00000001	-	199446	199446	7f343574-f2bc-4388-91b9-84b99e39256a	-2.82	-115.76	-112.94	1	1	CAGCCCGGCAA
-tig00000001	-	199459	199459	7f343574-f2bc-4388-91b9-84b99e39256a	-1.30	-150.97	-149.67	1	1	AACACCGCCAG
-tig00000001	-	199485	199485	7f343574-f2bc-4388-91b9-84b99e39256a	-1.27	-101.84	-100.56	1	1	CATGCCGTAAA
-tig00000001	-	199500	199509	7f343574-f2bc-4388-91b9-84b99e39256a	-1.81	-178.44	-176.63	1	3	AGAACCGACACCGCCGAACA
-tig00000001	-	199543	199543	7f343574-f2bc-4388-91b9-84b99e39256a	-1.54	-137.77	-136.23	1	1	CACATCGGCAC
-tig00000001	-	199557	199570	7f343574-f2bc-4388-91b9-84b99e39256a	-11.72	-179.23	-167.51	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	-	199582	199593	7f343574-f2bc-4388-91b9-84b99e39256a	-6.93	-159.08	-152.14	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	-	199606	199621	7f343574-f2bc-4388-91b9-84b99e39256a	-10.63	-169.56	-158.93	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	-	199644	199652	7f343574-f2bc-4388-91b9-84b99e39256a	-10.35	-159.80	-149.44	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	-	199687	199687	7f343574-f2bc-4388-91b9-84b99e39256a	-7.59	-126.11	-118.52	1	1	CTGTCCGTGCC
-tig00000001	-	199740	199746	7f343574-f2bc-4388-91b9-84b99e39256a	-1.82	-171.80	-169.98	1	2	CACCACGCCTACGCAGA
-tig00000001	-	199770	199770	7f343574-f2bc-4388-91b9-84b99e39256a	-7.08	-122.14	-115.06	1	1	GACATCGCCCA
-tig00000001	-	199786	199802	7f343574-f2bc-4388-91b9-84b99e39256a	-26.58	-181.31	-154.73	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	-	199833	199836	7f343574-f2bc-4388-91b9-84b99e39256a	-4.33	-115.14	-110.81	1	2	CACAGCGCCGTTGG
-tig00000001	-	199854	199854	7f343574-f2bc-4388-91b9-84b99e39256a	0.12	-103.03	-103.15	1	1	AAGATCGCCAG
-tig00000001	-	199868	199868	7f343574-f2bc-4388-91b9-84b99e39256a	-4.00	-83.55	-79.55	1	1	CTGCACGAAGT
-tig00000001	-	199883	199883	7f343574-f2bc-4388-91b9-84b99e39256a	-4.80	-93.87	-89.07	1	1	CAGTGCGGTTG
-tig00000001	-	199899	199908	7f343574-f2bc-4388-91b9-84b99e39256a	-0.93	-151.94	-151.01	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	-	199931	199943	7f343574-f2bc-4388-91b9-84b99e39256a	-5.94	-194.91	-188.97	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	-	199956	199956	7f343574-f2bc-4388-91b9-84b99e39256a	-1.52	-98.89	-97.37	1	1	TTGATCGCTTC
-tig00000001	-	199998	199998	7f343574-f2bc-4388-91b9-84b99e39256a	-1.24	-109.30	-108.05	1	1	TGTTGCGCTCC
 tig00000001	-	200009	200009	7f343574-f2bc-4388-91b9-84b99e39256a	-0.90	-165.84	-164.94	1	1	TTCAACGGTAT
 tig00000001	-	200046	200046	7f343574-f2bc-4388-91b9-84b99e39256a	-3.42	-115.09	-111.68	1	1	TGCAGCGCACC
 tig00000001	-	200081	200081	7f343574-f2bc-4388-91b9-84b99e39256a	-1.65	-143.63	-141.98	1	1	AACAACGCCAC
@@ -2048,191 +175,6 @@
 tig00000001	-	201252	201270	7f343574-f2bc-4388-91b9-84b99e39256a	-8.36	-216.83	-208.47	1	4	AAAACCGCCAGCGGAAACGCTGGCGGTTT
 tig00000001	-	201313	201313	7f343574-f2bc-4388-91b9-84b99e39256a	-1.95	-108.89	-106.94	1	1	GACATCGTTAT
 tig00000001	-	201325	201325	7f343574-f2bc-4388-91b9-84b99e39256a	-3.50	-110.82	-107.32	1	1	CCAATCGAAAC
-tig00000001	-	194804	194850	380cc868-0f9e-478b-b1df-70cbe6602339	-47.33	-440.37	-393.04	1	9	AGTGCCGTGTGCGTTGCTCGCGGTAACGGGCTACCCGCGCCTGATAACGCACGCCAG
-tig00000001	-	194868	194868	380cc868-0f9e-478b-b1df-70cbe6602339	-0.11	-113.73	-113.63	1	1	GTTCCCGATCA
-tig00000001	-	194880	194883	380cc868-0f9e-478b-b1df-70cbe6602339	-3.59	-154.23	-150.64	1	2	CAGCCCGACGGTTA
-tig00000001	-	194896	194898	380cc868-0f9e-478b-b1df-70cbe6602339	-2.39	-128.07	-125.68	1	2	ATCACCGCGAAGG
-tig00000001	-	194928	194949	380cc868-0f9e-478b-b1df-70cbe6602339	-16.98	-240.45	-223.47	1	6	AGAGACGGCGAGCGTGCCGCGTGGGGCGATAA
-tig00000001	-	194963	194963	380cc868-0f9e-478b-b1df-70cbe6602339	-5.80	-104.73	-98.93	1	1	GAGATCGAAAC
-tig00000001	-	194984	194984	380cc868-0f9e-478b-b1df-70cbe6602339	-1.05	-98.41	-97.36	1	1	AATGACGGTGG
-tig00000001	-	195007	195007	380cc868-0f9e-478b-b1df-70cbe6602339	-10.86	-122.96	-112.10	1	1	GCCAGCGTCCA
-tig00000001	-	195021	195021	380cc868-0f9e-478b-b1df-70cbe6602339	2.74	-137.53	-140.27	1	1	AATAGCGCCAC
-tig00000001	-	195035	195035	380cc868-0f9e-478b-b1df-70cbe6602339	-4.46	-159.48	-155.02	1	1	CACCACGCCAA
-tig00000001	-	195065	195075	380cc868-0f9e-478b-b1df-70cbe6602339	-5.65	-138.45	-132.80	1	2	GTTGGCGGCATCAAACGCCAT
-tig00000001	-	195110	195134	380cc868-0f9e-478b-b1df-70cbe6602339	-18.10	-254.76	-236.65	1	6	GATAACGGCGCATAACGCGGCGGCAACCACGCATC
-tig00000001	-	195154	195154	380cc868-0f9e-478b-b1df-70cbe6602339	3.14	-120.23	-123.37	1	1	GTACACGCCAC
-tig00000001	-	195175	195206	380cc868-0f9e-478b-b1df-70cbe6602339	-15.86	-279.85	-263.99	1	7	AAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTG
-tig00000001	-	195222	195224	380cc868-0f9e-478b-b1df-70cbe6602339	0.32	-131.83	-132.15	1	2	TCAAGCGCGACCA
-tig00000001	-	195239	195264	380cc868-0f9e-478b-b1df-70cbe6602339	-24.62	-319.79	-295.17	1	6	CTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCA
-tig00000001	-	195275	195313	380cc868-0f9e-478b-b1df-70cbe6602339	-44.73	-322.61	-277.88	1	9	GCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAA
-tig00000001	-	195328	195328	380cc868-0f9e-478b-b1df-70cbe6602339	-6.69	-101.19	-94.50	1	1	CTTGCCGAGAT
-tig00000001	-	195342	195359	380cc868-0f9e-478b-b1df-70cbe6602339	-6.17	-160.38	-154.21	1	3	GTTCACGGGCATAACGCACTACCGCTTT
-tig00000001	-	195371	195371	380cc868-0f9e-478b-b1df-70cbe6602339	-1.25	-117.22	-115.97	1	1	TCTTCCGCTGG
-tig00000001	-	195392	195400	380cc868-0f9e-478b-b1df-70cbe6602339	-17.80	-157.46	-139.66	1	3	GTTGCCGTCTCCGCGCCCA
-tig00000001	-	195413	195427	380cc868-0f9e-478b-b1df-70cbe6602339	-4.88	-173.50	-168.63	1	3	TCCTGCGCCAGACGTAAGGCGCTGA
-tig00000001	-	195441	195460	380cc868-0f9e-478b-b1df-70cbe6602339	-9.48	-199.03	-189.55	1	4	TTGCCCGACGTTTTTTCCGGTAAGCGGTGC
-tig00000001	-	195489	195500	380cc868-0f9e-478b-b1df-70cbe6602339	-8.89	-205.06	-196.17	1	3	TACACCGCGTGCCAGACGCTAC
-tig00000001	-	195511	195535	380cc868-0f9e-478b-b1df-70cbe6602339	-19.94	-270.82	-250.88	1	7	CCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACC
-tig00000001	-	195547	195553	380cc868-0f9e-478b-b1df-70cbe6602339	-17.95	-166.51	-148.56	1	2	GTTTTCGCTGCCGGTGT
-tig00000001	-	195565	195565	380cc868-0f9e-478b-b1df-70cbe6602339	-4.21	-127.96	-123.76	1	1	ATGGCCGATGC
-tig00000001	-	195581	195590	380cc868-0f9e-478b-b1df-70cbe6602339	-13.52	-202.08	-188.56	1	5	AGGATCGCGTCGCGCGTGTG
-tig00000001	-	195608	195608	380cc868-0f9e-478b-b1df-70cbe6602339	-3.68	-129.18	-125.50	1	1	CTCTTCGCCAG
-tig00000001	-	195621	195630	380cc868-0f9e-478b-b1df-70cbe6602339	-11.39	-185.45	-174.06	1	3	TGCCCCGCCAGGCGCGCATT
-tig00000001	-	195646	195663	380cc868-0f9e-478b-b1df-70cbe6602339	-31.36	-251.57	-220.20	1	5	ATCAACGCGATCGGCAGTACGGCGCAGT
-tig00000001	-	195676	195685	380cc868-0f9e-478b-b1df-70cbe6602339	-9.76	-128.44	-118.68	1	3	CAGTTCGCGCAGGGCGATCA
-tig00000001	-	195702	195702	380cc868-0f9e-478b-b1df-70cbe6602339	-4.23	-138.16	-133.93	1	1	CTTTGCGGAAA
-tig00000001	-	195720	195735	380cc868-0f9e-478b-b1df-70cbe6602339	-31.64	-213.96	-182.32	1	4	AATGGCGCGCTCCGCCTGCCCGGCAA
-tig00000001	-	195764	195781	380cc868-0f9e-478b-b1df-70cbe6602339	-14.35	-199.28	-184.93	1	4	TCAGCCGCTGGCGCAGATCGTCCGGGGC
-tig00000001	-	195803	195842	380cc868-0f9e-478b-b1df-70cbe6602339	-24.59	-425.49	-400.91	1	8	CACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACC
-tig00000001	-	195855	195864	380cc868-0f9e-478b-b1df-70cbe6602339	-14.68	-179.18	-164.50	1	3	AATTCCGGTGACGCCGCTGA
-tig00000001	-	195900	195906	380cc868-0f9e-478b-b1df-70cbe6602339	-9.84	-163.40	-153.56	1	2	CTGAACGTTGACGGTAG
-tig00000001	-	195945	195945	380cc868-0f9e-478b-b1df-70cbe6602339	-2.83	-124.28	-121.45	1	1	TTCTTCGATAT
-tig00000001	-	195959	195959	380cc868-0f9e-478b-b1df-70cbe6602339	-9.25	-122.86	-113.61	1	1	GCCAGCGTTTG
-tig00000001	-	195971	195971	380cc868-0f9e-478b-b1df-70cbe6602339	-0.68	-119.77	-119.09	1	1	GATGACGGGAA
-tig00000001	-	195982	195982	380cc868-0f9e-478b-b1df-70cbe6602339	-5.84	-132.95	-127.11	1	1	CCTGGCGCATT
-tig00000001	-	195994	196002	380cc868-0f9e-478b-b1df-70cbe6602339	-2.42	-207.58	-205.16	1	2	CTGTGCGCCAGTTCGTCCA
-tig00000001	-	196018	196044	380cc868-0f9e-478b-b1df-70cbe6602339	-26.14	-297.02	-270.88	1	7	ATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGAT
-tig00000001	-	196056	196056	380cc868-0f9e-478b-b1df-70cbe6602339	-1.70	-114.71	-113.00	1	1	AAACTCGCTGA
-tig00000001	-	196067	196093	380cc868-0f9e-478b-b1df-70cbe6602339	-19.93	-284.13	-264.20	1	5	TATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAG
-tig00000001	-	196122	196125	380cc868-0f9e-478b-b1df-70cbe6602339	-16.60	-130.34	-113.73	1	2	CATGGCGGCGGTAT
-tig00000001	-	196136	196140	380cc868-0f9e-478b-b1df-70cbe6602339	-9.99	-164.09	-154.10	1	2	CTTTTCGCCCGTGGG
-tig00000001	-	196155	196155	380cc868-0f9e-478b-b1df-70cbe6602339	-2.82	-112.92	-110.10	1	1	TACCACGCCAA
-tig00000001	-	196180	196190	380cc868-0f9e-478b-b1df-70cbe6602339	-18.00	-133.49	-115.49	1	3	CCTTGCGCCCGCAGTCGCTGG
-tig00000001	-	196210	196210	380cc868-0f9e-478b-b1df-70cbe6602339	-7.02	-122.85	-115.83	1	1	AGCATCGCCCA
-tig00000001	-	196224	196227	380cc868-0f9e-478b-b1df-70cbe6602339	-4.76	-134.80	-130.04	1	2	CTTCCCGACGCCTG
-tig00000001	-	196242	196242	380cc868-0f9e-478b-b1df-70cbe6602339	0.59	-116.97	-117.56	1	1	GGCACCGAAGA
-tig00000001	-	196264	196274	380cc868-0f9e-478b-b1df-70cbe6602339	-20.59	-259.12	-238.53	1	4	TTCCCCGATGCGGCGCGGCAG
-tig00000001	-	196294	196319	380cc868-0f9e-478b-b1df-70cbe6602339	-19.19	-297.95	-278.76	1	5	GCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
-tig00000001	-	196342	196342	380cc868-0f9e-478b-b1df-70cbe6602339	-6.56	-115.44	-108.88	1	1	TCCAGCGCCAG
-tig00000001	-	196372	196380	380cc868-0f9e-478b-b1df-70cbe6602339	-10.20	-159.83	-149.63	1	2	ACAACCGGCTGGCCGATAT
-tig00000001	-	196396	196396	380cc868-0f9e-478b-b1df-70cbe6602339	-5.83	-118.44	-112.61	1	1	ACCAGCGGTTG
-tig00000001	-	196416	196426	380cc868-0f9e-478b-b1df-70cbe6602339	-10.15	-143.10	-132.95	1	2	TTTTGCGATCAGTTGCGTGAG
-tig00000001	-	196440	196440	380cc868-0f9e-478b-b1df-70cbe6602339	-0.04	-93.21	-93.17	1	1	TTCAACGCTGA
-tig00000001	-	196451	196466	380cc868-0f9e-478b-b1df-70cbe6602339	-7.94	-190.07	-182.13	1	5	GATTACGCGCTTTCGCCACGCGTGGG
-tig00000001	-	196483	196492	380cc868-0f9e-478b-b1df-70cbe6602339	-10.60	-207.98	-197.38	1	3	CAGGCCGCCGCTTGCGGGTG
-tig00000001	-	196514	196527	380cc868-0f9e-478b-b1df-70cbe6602339	-7.34	-166.19	-158.85	1	3	CAGCCCGCTTGCCGATGCCGTCAC
-tig00000001	-	196542	196576	380cc868-0f9e-478b-b1df-70cbe6602339	-22.62	-326.02	-303.40	1	7	TCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAAT
-tig00000001	-	196589	196595	380cc868-0f9e-478b-b1df-70cbe6602339	-11.24	-149.23	-137.99	1	3	AGCAACGCGTGCGGCTA
-tig00000001	-	196629	196629	380cc868-0f9e-478b-b1df-70cbe6602339	-0.40	-105.84	-105.45	1	1	CTGACCGCCAG
-tig00000001	-	196643	196643	380cc868-0f9e-478b-b1df-70cbe6602339	-4.57	-119.22	-114.65	1	1	GCTCCCGCCAG
-tig00000001	-	196677	196690	380cc868-0f9e-478b-b1df-70cbe6602339	-10.56	-174.39	-163.82	1	4	TCTGCCGTTGCCGACGGGCGACCA
-tig00000001	-	196706	196712	380cc868-0f9e-478b-b1df-70cbe6602339	-16.11	-154.39	-138.28	1	2	ATAGCCGTTGCCGGTAA
-tig00000001	-	196727	196749	380cc868-0f9e-478b-b1df-70cbe6602339	-32.51	-300.09	-267.58	1	5	CTGCCCGATTAATGCCGAACCGCGCACCGTATC
-tig00000001	-	196762	196770	380cc868-0f9e-478b-b1df-70cbe6602339	-10.38	-231.93	-221.55	1	2	CTTCACGAATCAACGAACC
-tig00000001	-	196810	196810	380cc868-0f9e-478b-b1df-70cbe6602339	-2.16	-121.37	-119.21	1	1	CAGTACGGTGG
-tig00000001	-	196823	196834	380cc868-0f9e-478b-b1df-70cbe6602339	-4.25	-157.14	-152.89	1	3	AGCAGCGGGTAAACGCCGCCAG
-tig00000001	-	196874	196878	380cc868-0f9e-478b-b1df-70cbe6602339	-12.52	-132.46	-119.95	1	2	AATGCCGGACGTAAT
-tig00000001	-	196909	196915	380cc868-0f9e-478b-b1df-70cbe6602339	0.23	-164.83	-165.06	1	2	CAGACCGCAAACGGTCA
-tig00000001	-	196945	196952	380cc868-0f9e-478b-b1df-70cbe6602339	-5.33	-216.71	-211.37	1	2	GATACCGATAAACGGCAC
-tig00000001	-	196975	196975	380cc868-0f9e-478b-b1df-70cbe6602339	-5.98	-118.78	-112.80	1	1	CAGACCGTAAA
-tig00000001	-	196992	196995	380cc868-0f9e-478b-b1df-70cbe6602339	-6.57	-94.12	-87.55	1	2	AGTTACGGCGCAAC
-tig00000001	-	197011	197018	380cc868-0f9e-478b-b1df-70cbe6602339	-9.70	-124.07	-114.37	1	2	AGAAGCGGTAAGCGGTTT
-tig00000001	-	197032	197041	380cc868-0f9e-478b-b1df-70cbe6602339	-1.55	-161.85	-160.29	1	2	ACTCACGCCTTTAACGCCAG
-tig00000001	-	197059	197059	380cc868-0f9e-478b-b1df-70cbe6602339	-0.37	-110.95	-110.57	1	1	AAAGACGATAA
-tig00000001	-	197071	197071	380cc868-0f9e-478b-b1df-70cbe6602339	-3.93	-129.27	-125.34	1	1	CAAGGCGTTGA
-tig00000001	-	197084	197084	380cc868-0f9e-478b-b1df-70cbe6602339	-1.87	-119.15	-117.28	1	1	ATCACCGCACT
-tig00000001	-	197098	197108	380cc868-0f9e-478b-b1df-70cbe6602339	-3.68	-153.76	-150.08	1	3	GATTGCGGAGTCGGGCGAATG
-tig00000001	-	197132	197132	380cc868-0f9e-478b-b1df-70cbe6602339	-0.16	-122.42	-122.27	1	1	TTCAGCGCATT
-tig00000001	-	197144	197168	380cc868-0f9e-478b-b1df-70cbe6602339	-10.89	-260.07	-249.18	1	6	AACTGCGGATACGTTGCCGCGAATGCCGCCGGAAT
-tig00000001	-	197179	197197	380cc868-0f9e-478b-b1df-70cbe6602339	-6.17	-208.54	-202.37	1	3	AATGGCGAAGTATTTCGCCACATCGTTGG
-tig00000001	-	197222	197229	380cc868-0f9e-478b-b1df-70cbe6602339	-7.82	-147.75	-139.92	1	2	GTCAGCGAGCCACGGGTC
-tig00000001	-	197266	197266	380cc868-0f9e-478b-b1df-70cbe6602339	-0.29	-166.38	-166.09	1	1	CACCTCGATCA
-tig00000001	-	197279	197279	380cc868-0f9e-478b-b1df-70cbe6602339	-5.01	-128.97	-123.96	1	1	TTGGTCGGGTT
-tig00000001	-	197290	197296	380cc868-0f9e-478b-b1df-70cbe6602339	-0.21	-159.59	-159.39	1	2	AGAGTCGAGATCGACCA
-tig00000001	-	197309	197321	380cc868-0f9e-478b-b1df-70cbe6602339	-26.42	-197.47	-171.05	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	-	197332	197350	380cc868-0f9e-478b-b1df-70cbe6602339	-9.61	-199.30	-189.69	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	-	197363	197420	380cc868-0f9e-478b-b1df-70cbe6602339	-29.05	-495.56	-466.51	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	-	197433	197433	380cc868-0f9e-478b-b1df-70cbe6602339	-0.27	-151.80	-151.52	1	1	ACTGACGGATC
-tig00000001	-	197456	197470	380cc868-0f9e-478b-b1df-70cbe6602339	-12.56	-178.08	-165.52	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	-	197482	197509	380cc868-0f9e-478b-b1df-70cbe6602339	-20.99	-256.07	-235.09	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	-	197520	197530	380cc868-0f9e-478b-b1df-70cbe6602339	-2.96	-180.71	-177.75	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	-	197543	197543	380cc868-0f9e-478b-b1df-70cbe6602339	0.75	-100.85	-101.60	1	1	ATCACCGTTTT
-tig00000001	-	197562	197577	380cc868-0f9e-478b-b1df-70cbe6602339	-10.38	-173.31	-162.93	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	-	197590	197599	380cc868-0f9e-478b-b1df-70cbe6602339	-15.60	-199.37	-183.78	1	2	AATACCGCCTTTGACGATAT
-tig00000001	-	197612	197620	380cc868-0f9e-478b-b1df-70cbe6602339	-10.10	-200.57	-190.48	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	-	197631	197631	380cc868-0f9e-478b-b1df-70cbe6602339	-3.53	-162.90	-159.37	1	1	GCACACGAGAA
-tig00000001	-	197654	197657	380cc868-0f9e-478b-b1df-70cbe6602339	-9.76	-144.47	-134.72	1	2	ACCAGCGGCGTGGC
-tig00000001	-	197670	197672	380cc868-0f9e-478b-b1df-70cbe6602339	-4.90	-112.60	-107.69	1	2	CCTGACGCGCAAC
-tig00000001	-	197683	197683	380cc868-0f9e-478b-b1df-70cbe6602339	-6.58	-125.99	-119.42	1	1	CTGATCGACTT
-tig00000001	-	197701	197701	380cc868-0f9e-478b-b1df-70cbe6602339	-1.08	-92.82	-91.74	1	1	AACATCGGTAG
-tig00000001	-	197719	197719	380cc868-0f9e-478b-b1df-70cbe6602339	-5.91	-114.61	-108.70	1	1	ACCACCGTTAG
-tig00000001	-	197736	197749	380cc868-0f9e-478b-b1df-70cbe6602339	-7.66	-156.99	-149.33	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	-	197763	197779	380cc868-0f9e-478b-b1df-70cbe6602339	-9.90	-239.95	-230.05	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	-	197791	197816	380cc868-0f9e-478b-b1df-70cbe6602339	-23.13	-304.62	-281.49	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	-	197837	197837	380cc868-0f9e-478b-b1df-70cbe6602339	4.45	-86.36	-90.81	1	1	TGGAGCGACTG
-tig00000001	-	197848	197856	380cc868-0f9e-478b-b1df-70cbe6602339	-17.99	-159.39	-141.40	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	-	197868	197878	380cc868-0f9e-478b-b1df-70cbe6602339	-7.81	-164.45	-156.64	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	-	197895	197906	380cc868-0f9e-478b-b1df-70cbe6602339	-16.96	-205.65	-188.70	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	-	197921	197921	380cc868-0f9e-478b-b1df-70cbe6602339	-5.38	-138.64	-133.26	1	1	GCCAGCGAAGC
-tig00000001	-	197935	197948	380cc868-0f9e-478b-b1df-70cbe6602339	-10.44	-180.58	-170.14	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	-	197960	197969	380cc868-0f9e-478b-b1df-70cbe6602339	-9.68	-154.12	-144.44	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	-	197982	197999	380cc868-0f9e-478b-b1df-70cbe6602339	-9.18	-197.24	-188.06	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	-	198014	198014	380cc868-0f9e-478b-b1df-70cbe6602339	-11.99	-110.36	-98.36	1	1	GGTGCCGGTTT
-tig00000001	-	198035	198051	380cc868-0f9e-478b-b1df-70cbe6602339	-14.19	-239.44	-225.25	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	-	198064	198068	380cc868-0f9e-478b-b1df-70cbe6602339	-9.25	-198.77	-189.53	1	2	CTGCACGTCCGCTGG
-tig00000001	-	198087	198089	380cc868-0f9e-478b-b1df-70cbe6602339	-5.86	-163.77	-157.91	1	2	ACATTCGCGCCTA
-tig00000001	-	198100	198123	380cc868-0f9e-478b-b1df-70cbe6602339	-10.67	-266.22	-255.55	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	-	198137	198137	380cc868-0f9e-478b-b1df-70cbe6602339	-0.79	-111.21	-110.42	1	1	CAGGCCGCCAA
-tig00000001	-	198171	198171	380cc868-0f9e-478b-b1df-70cbe6602339	0.16	-99.99	-100.15	1	1	AGCAGCGCCAC
-tig00000001	-	198183	198188	380cc868-0f9e-478b-b1df-70cbe6602339	-1.08	-135.84	-134.76	1	2	AGTACCGTTACGCTGA
-tig00000001	-	198203	198233	380cc868-0f9e-478b-b1df-70cbe6602339	-25.54	-297.44	-271.90	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	-	198250	198250	380cc868-0f9e-478b-b1df-70cbe6602339	0.00	-105.36	-105.37	1	1	AAAGACGATAG
-tig00000001	-	198289	198313	380cc868-0f9e-478b-b1df-70cbe6602339	-32.44	-283.98	-251.54	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	-	198326	198336	380cc868-0f9e-478b-b1df-70cbe6602339	3.02	-187.04	-190.06	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	-	198352	198364	380cc868-0f9e-478b-b1df-70cbe6602339	-10.65	-143.70	-133.06	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	-	198399	198415	380cc868-0f9e-478b-b1df-70cbe6602339	-9.54	-170.33	-160.79	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	-	198427	198485	380cc868-0f9e-478b-b1df-70cbe6602339	-34.30	-454.02	-419.72	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	-	198513	198513	380cc868-0f9e-478b-b1df-70cbe6602339	3.73	-135.22	-138.95	1	1	ACCATCGCAGG
-tig00000001	-	198527	198527	380cc868-0f9e-478b-b1df-70cbe6602339	0.07	-113.41	-113.48	1	1	AATATCGCCAG
-tig00000001	-	198545	198569	380cc868-0f9e-478b-b1df-70cbe6602339	-16.09	-223.03	-206.95	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	-	198585	198619	380cc868-0f9e-478b-b1df-70cbe6602339	-16.58	-274.17	-257.59	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	-	198660	198670	380cc868-0f9e-478b-b1df-70cbe6602339	-7.10	-141.63	-134.53	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	-	198684	198710	380cc868-0f9e-478b-b1df-70cbe6602339	-11.34	-231.58	-220.23	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	-	198728	198782	380cc868-0f9e-478b-b1df-70cbe6602339	-23.16	-432.64	-409.48	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	-	198812	198821	380cc868-0f9e-478b-b1df-70cbe6602339	-7.61	-133.32	-125.71	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	-	198834	198855	380cc868-0f9e-478b-b1df-70cbe6602339	-12.31	-225.80	-213.49	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	-	198872	198872	380cc868-0f9e-478b-b1df-70cbe6602339	-2.29	-110.04	-107.75	1	1	TTCACCGCTTC
-tig00000001	-	198884	198892	380cc868-0f9e-478b-b1df-70cbe6602339	-7.01	-159.68	-152.67	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	-	198907	198914	380cc868-0f9e-478b-b1df-70cbe6602339	-8.29	-152.12	-143.83	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	-	198927	198927	380cc868-0f9e-478b-b1df-70cbe6602339	-9.26	-131.94	-122.67	1	1	GTTTACGACTC
-tig00000001	-	198972	198987	380cc868-0f9e-478b-b1df-70cbe6602339	-16.40	-241.01	-224.61	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	-	199013	199013	380cc868-0f9e-478b-b1df-70cbe6602339	0.04	-103.56	-103.60	1	1	CAGTGCGCCAA
-tig00000001	-	199028	199034	380cc868-0f9e-478b-b1df-70cbe6602339	-6.52	-129.44	-122.92	1	2	CAACACGGTGCCGATTA
-tig00000001	-	199056	199088	380cc868-0f9e-478b-b1df-70cbe6602339	-15.40	-257.83	-242.42	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	-	199112	199117	380cc868-0f9e-478b-b1df-70cbe6602339	-10.32	-153.46	-143.14	1	2	ACCAGCGAACCGGCAA
-tig00000001	-	199133	199133	380cc868-0f9e-478b-b1df-70cbe6602339	-7.57	-131.09	-123.52	1	1	ATCACCGGGAT
-tig00000001	-	199147	199156	380cc868-0f9e-478b-b1df-70cbe6602339	-10.67	-169.73	-159.06	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	-	199172	199172	380cc868-0f9e-478b-b1df-70cbe6602339	-5.60	-102.68	-97.08	1	1	CAGAACGCCAG
-tig00000001	-	199193	199193	380cc868-0f9e-478b-b1df-70cbe6602339	0.11	-107.49	-107.60	1	1	CAGAACGGAGA
-tig00000001	-	199204	199228	380cc868-0f9e-478b-b1df-70cbe6602339	-20.62	-278.98	-258.36	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	-	199240	199255	380cc868-0f9e-478b-b1df-70cbe6602339	-24.56	-239.50	-214.94	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	-	199267	199267	380cc868-0f9e-478b-b1df-70cbe6602339	0.13	-140.64	-140.76	1	1	CACTTCGCTAA
-tig00000001	-	199280	199280	380cc868-0f9e-478b-b1df-70cbe6602339	-3.96	-136.43	-132.47	1	1	CCATGCGGGCC
-tig00000001	-	199300	199336	380cc868-0f9e-478b-b1df-70cbe6602339	-37.17	-316.35	-279.18	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	-	199352	199355	380cc868-0f9e-478b-b1df-70cbe6602339	-9.10	-152.63	-143.53	1	2	ACCAGCGTCGGGGT
-tig00000001	-	199393	199402	380cc868-0f9e-478b-b1df-70cbe6602339	-20.70	-186.28	-165.57	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	-	199423	199430	380cc868-0f9e-478b-b1df-70cbe6602339	-10.50	-122.16	-111.66	1	2	TATTCCGGTGTACGACCA
-tig00000001	-	199446	199446	380cc868-0f9e-478b-b1df-70cbe6602339	-11.73	-120.48	-108.75	1	1	CAGCCCGGCAA
-tig00000001	-	199459	199459	380cc868-0f9e-478b-b1df-70cbe6602339	-0.80	-99.56	-98.76	1	1	AACACCGCCAG
-tig00000001	-	199485	199485	380cc868-0f9e-478b-b1df-70cbe6602339	-2.97	-112.13	-109.16	1	1	CATGCCGTAAA
-tig00000001	-	199500	199509	380cc868-0f9e-478b-b1df-70cbe6602339	-9.15	-166.37	-157.22	1	3	AGAACCGACACCGCCGAACA
-tig00000001	-	199543	199543	380cc868-0f9e-478b-b1df-70cbe6602339	-5.88	-135.88	-130.00	1	1	CACATCGGCAC
-tig00000001	-	199557	199570	380cc868-0f9e-478b-b1df-70cbe6602339	-4.47	-192.51	-188.04	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	-	199582	199593	380cc868-0f9e-478b-b1df-70cbe6602339	-3.71	-240.19	-236.49	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	-	199606	199621	380cc868-0f9e-478b-b1df-70cbe6602339	-10.06	-232.51	-222.45	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	-	199644	199652	380cc868-0f9e-478b-b1df-70cbe6602339	-6.17	-150.53	-144.36	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	-	199687	199687	380cc868-0f9e-478b-b1df-70cbe6602339	-2.51	-106.24	-103.72	1	1	CTGTCCGTGCC
-tig00000001	-	199740	199746	380cc868-0f9e-478b-b1df-70cbe6602339	-13.69	-175.58	-161.89	1	2	CACCACGCCTACGCAGA
-tig00000001	-	199770	199770	380cc868-0f9e-478b-b1df-70cbe6602339	-8.73	-129.92	-121.19	1	1	GACATCGCCCA
-tig00000001	-	199786	199802	380cc868-0f9e-478b-b1df-70cbe6602339	-16.96	-176.33	-159.37	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	-	199833	199836	380cc868-0f9e-478b-b1df-70cbe6602339	-10.89	-107.56	-96.67	1	2	CACAGCGCCGTTGG
-tig00000001	-	199854	199854	380cc868-0f9e-478b-b1df-70cbe6602339	3.93	-146.68	-150.61	1	1	AAGATCGCCAG
-tig00000001	-	199868	199868	380cc868-0f9e-478b-b1df-70cbe6602339	-1.99	-151.76	-149.77	1	1	CTGCACGAAGT
-tig00000001	-	199883	199883	380cc868-0f9e-478b-b1df-70cbe6602339	-2.79	-91.87	-89.08	1	1	CAGTGCGGTTG
-tig00000001	-	199899	199908	380cc868-0f9e-478b-b1df-70cbe6602339	-13.00	-166.11	-153.12	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	-	199931	199943	380cc868-0f9e-478b-b1df-70cbe6602339	-12.78	-165.44	-152.66	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	-	199956	199956	380cc868-0f9e-478b-b1df-70cbe6602339	-1.60	-128.49	-126.89	1	1	TTGATCGCTTC
-tig00000001	-	199998	199998	380cc868-0f9e-478b-b1df-70cbe6602339	0.82	-102.36	-103.18	1	1	TGTTGCGCTCC
 tig00000001	-	200009	200009	380cc868-0f9e-478b-b1df-70cbe6602339	-1.10	-125.24	-124.13	1	1	TTCAACGGTAT
 tig00000001	-	200046	200046	380cc868-0f9e-478b-b1df-70cbe6602339	-4.64	-126.88	-122.24	1	1	TGCAGCGCACC
 tig00000001	-	200081	200081	380cc868-0f9e-478b-b1df-70cbe6602339	0.56	-122.34	-122.90	1	1	AACAACGCCAC
@@ -2288,200 +230,6 @@
 tig00000001	-	201922	201930	380cc868-0f9e-478b-b1df-70cbe6602339	0.61	-122.83	-123.43	1	2	GTCACCGGCTGGCCGCACT
 tig00000001	-	201944	201950	380cc868-0f9e-478b-b1df-70cbe6602339	-5.67	-126.74	-121.07	1	2	GCAGGCGCTGCCGGAAG
 tig00000001	-	201961	201986	380cc868-0f9e-478b-b1df-70cbe6602339	-9.58	-237.97	-228.39	1	4	AACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAA
-tig00000001	-	201998	202007	380cc868-0f9e-478b-b1df-70cbe6602339	-7.87	-132.80	-124.92	1	2	CAGTCCGCAGGGGCCGTGGT
-tig00000001	-	202020	202020	380cc868-0f9e-478b-b1df-70cbe6602339	-0.45	-102.63	-102.18	1	1	CTGCTCGGCTG
-tig00000001	-	202033	202046	380cc868-0f9e-478b-b1df-70cbe6602339	-4.11	-160.36	-156.26	1	3	GTGAGCGGGTGCCGGAAGCGGATG
-tig00000001	-	202064	202081	380cc868-0f9e-478b-b1df-70cbe6602339	-20.36	-242.91	-222.55	1	5	GCCTGCGCCGCTGCCGCCGTACCGGGTA
-tig00000001	-	202092	202092	380cc868-0f9e-478b-b1df-70cbe6602339	-0.19	-123.94	-123.75	1	1	CTGACCGGGCT
-tig00000001	-	202105	202143	380cc868-0f9e-478b-b1df-70cbe6602339	-22.88	-275.50	-252.62	1	8	TGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGA
-tig00000001	-	202155	202198	380cc868-0f9e-478b-b1df-70cbe6602339	-16.19	-360.26	-344.08	1	8	TTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTG
-tig00000001	-	202214	202225	380cc868-0f9e-478b-b1df-70cbe6602339	-16.32	-210.83	-194.51	1	3	GACCACGCAGGCGCAGCGGGCA
-tig00000001	-	202240	202240	380cc868-0f9e-478b-b1df-70cbe6602339	-1.73	-109.86	-108.13	1	1	AAGCCCGGCAG
-tig00000001	-	202257	202275	380cc868-0f9e-478b-b1df-70cbe6602339	-11.95	-231.80	-219.86	1	5	ATTTCCGGCGGGACGGAACCGTCCGCTTT
-tig00000001	+	194868	194868	44b26523-eaf0-4f28-87ad-4cca044fabc8	-0.83	-103.94	-103.11	1	1	GTTCCCGATCA
-tig00000001	+	194880	194883	44b26523-eaf0-4f28-87ad-4cca044fabc8	-8.91	-146.94	-138.03	1	2	CAGCCCGACGGTTA
-tig00000001	+	194896	194898	44b26523-eaf0-4f28-87ad-4cca044fabc8	-8.99	-164.04	-155.04	1	2	ATCACCGCGAAGG
-tig00000001	+	194928	194949	44b26523-eaf0-4f28-87ad-4cca044fabc8	-41.23	-277.79	-236.56	1	6	AGAGACGGCGAGCGTGCCGCGTGGGGCGATAA
-tig00000001	+	194963	194963	44b26523-eaf0-4f28-87ad-4cca044fabc8	-2.90	-102.94	-100.04	1	1	GAGATCGAAAC
-tig00000001	+	194984	194984	44b26523-eaf0-4f28-87ad-4cca044fabc8	-3.44	-110.38	-106.94	1	1	AATGACGGTGG
-tig00000001	+	195007	195007	44b26523-eaf0-4f28-87ad-4cca044fabc8	-0.18	-94.64	-94.46	1	1	GCCAGCGTCCA
-tig00000001	+	195021	195021	44b26523-eaf0-4f28-87ad-4cca044fabc8	-2.66	-90.66	-87.99	1	1	AATAGCGCCAC
-tig00000001	+	195035	195035	44b26523-eaf0-4f28-87ad-4cca044fabc8	-8.41	-100.26	-91.85	1	1	CACCACGCCAA
-tig00000001	+	195065	195075	44b26523-eaf0-4f28-87ad-4cca044fabc8	-6.38	-168.77	-162.39	1	2	GTTGGCGGCATCAAACGCCAT
-tig00000001	+	195110	195134	44b26523-eaf0-4f28-87ad-4cca044fabc8	-31.69	-271.77	-240.08	1	6	GATAACGGCGCATAACGCGGCGGCAACCACGCATC
-tig00000001	+	195154	195154	44b26523-eaf0-4f28-87ad-4cca044fabc8	-3.77	-109.65	-105.89	1	1	GTACACGCCAC
-tig00000001	+	195175	195206	44b26523-eaf0-4f28-87ad-4cca044fabc8	-29.52	-284.26	-254.74	1	7	AAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTG
-tig00000001	+	195222	195224	44b26523-eaf0-4f28-87ad-4cca044fabc8	-4.33	-130.78	-126.45	1	2	TCAAGCGCGACCA
-tig00000001	+	195239	195264	44b26523-eaf0-4f28-87ad-4cca044fabc8	-48.37	-314.47	-266.10	1	6	CTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCA
-tig00000001	+	195275	195313	44b26523-eaf0-4f28-87ad-4cca044fabc8	-21.53	-307.27	-285.74	1	9	GCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAA
-tig00000001	+	195328	195328	44b26523-eaf0-4f28-87ad-4cca044fabc8	-4.66	-108.39	-103.73	1	1	CTTGCCGAGAT
-tig00000001	+	195342	195359	44b26523-eaf0-4f28-87ad-4cca044fabc8	-23.92	-190.34	-166.42	1	3	GTTCACGGGCATAACGCACTACCGCTTT
-tig00000001	+	195371	195371	44b26523-eaf0-4f28-87ad-4cca044fabc8	-2.30	-99.80	-97.50	1	1	TCTTCCGCTGG
-tig00000001	+	195392	195400	44b26523-eaf0-4f28-87ad-4cca044fabc8	-13.58	-146.14	-132.56	1	3	GTTGCCGTCTCCGCGCCCA
-tig00000001	+	195413	195427	44b26523-eaf0-4f28-87ad-4cca044fabc8	-17.52	-201.69	-184.17	1	3	TCCTGCGCCAGACGTAAGGCGCTGA
-tig00000001	+	195441	195460	44b26523-eaf0-4f28-87ad-4cca044fabc8	-6.18	-245.96	-239.78	1	4	TTGCCCGACGTTTTTTCCGGTAAGCGGTGC
-tig00000001	+	195489	195500	44b26523-eaf0-4f28-87ad-4cca044fabc8	-10.44	-186.79	-176.35	1	3	TACACCGCGTGCCAGACGCTAC
-tig00000001	+	195511	195535	44b26523-eaf0-4f28-87ad-4cca044fabc8	-36.75	-293.20	-256.44	1	7	CCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACC
-tig00000001	+	195547	195553	44b26523-eaf0-4f28-87ad-4cca044fabc8	-9.54	-159.38	-149.84	1	2	GTTTTCGCTGCCGGTGT
-tig00000001	+	195565	195565	44b26523-eaf0-4f28-87ad-4cca044fabc8	0.55	-126.72	-127.27	1	1	ATGGCCGATGC
-tig00000001	+	195581	195590	44b26523-eaf0-4f28-87ad-4cca044fabc8	-4.96	-151.73	-146.77	1	5	AGGATCGCGTCGCGCGTGTG
-tig00000001	+	195608	195608	44b26523-eaf0-4f28-87ad-4cca044fabc8	3.87	-82.67	-86.54	1	1	CTCTTCGCCAG
-tig00000001	+	195621	195630	44b26523-eaf0-4f28-87ad-4cca044fabc8	-10.18	-195.37	-185.19	1	3	TGCCCCGCCAGGCGCGCATT
-tig00000001	+	195646	195663	44b26523-eaf0-4f28-87ad-4cca044fabc8	-18.90	-192.90	-174.00	1	5	ATCAACGCGATCGGCAGTACGGCGCAGT
-tig00000001	+	195676	195685	44b26523-eaf0-4f28-87ad-4cca044fabc8	-12.03	-144.80	-132.77	1	3	CAGTTCGCGCAGGGCGATCA
-tig00000001	+	195702	195702	44b26523-eaf0-4f28-87ad-4cca044fabc8	4.29	-101.40	-105.69	1	1	CTTTGCGGAAA
-tig00000001	+	195720	195735	44b26523-eaf0-4f28-87ad-4cca044fabc8	-14.62	-175.88	-161.25	1	4	AATGGCGCGCTCCGCCTGCCCGGCAA
-tig00000001	+	195764	195781	44b26523-eaf0-4f28-87ad-4cca044fabc8	-14.16	-182.52	-168.36	1	4	TCAGCCGCTGGCGCAGATCGTCCGGGGC
-tig00000001	+	195803	195842	44b26523-eaf0-4f28-87ad-4cca044fabc8	-27.50	-371.49	-343.99	1	8	CACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACC
-tig00000001	+	195855	195864	44b26523-eaf0-4f28-87ad-4cca044fabc8	-9.96	-152.64	-142.68	1	3	AATTCCGGTGACGCCGCTGA
-tig00000001	+	195900	195906	44b26523-eaf0-4f28-87ad-4cca044fabc8	-15.53	-142.74	-127.21	1	2	CTGAACGTTGACGGTAG
-tig00000001	+	195945	195945	44b26523-eaf0-4f28-87ad-4cca044fabc8	-3.74	-181.92	-178.18	1	1	TTCTTCGATAT
-tig00000001	+	195959	195959	44b26523-eaf0-4f28-87ad-4cca044fabc8	-1.07	-106.82	-105.75	1	1	GCCAGCGTTTG
-tig00000001	+	195971	195971	44b26523-eaf0-4f28-87ad-4cca044fabc8	-0.82	-110.89	-110.06	1	1	GATGACGGGAA
-tig00000001	+	195982	195982	44b26523-eaf0-4f28-87ad-4cca044fabc8	-6.32	-121.13	-114.82	1	1	CCTGGCGCATT
-tig00000001	+	195994	196002	44b26523-eaf0-4f28-87ad-4cca044fabc8	-12.13	-151.27	-139.14	1	2	CTGTGCGCCAGTTCGTCCA
-tig00000001	+	196018	196044	44b26523-eaf0-4f28-87ad-4cca044fabc8	-53.76	-295.67	-241.91	1	7	ATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGAT
-tig00000001	+	196056	196056	44b26523-eaf0-4f28-87ad-4cca044fabc8	-5.84	-105.40	-99.55	1	1	AAACTCGCTGA
-tig00000001	+	196067	196093	44b26523-eaf0-4f28-87ad-4cca044fabc8	-34.96	-268.26	-233.30	1	5	TATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAG
-tig00000001	+	196122	196125	44b26523-eaf0-4f28-87ad-4cca044fabc8	-9.06	-131.34	-122.29	1	2	CATGGCGGCGGTAT
-tig00000001	+	196136	196140	44b26523-eaf0-4f28-87ad-4cca044fabc8	-5.80	-138.37	-132.57	1	2	CTTTTCGCCCGTGGG
-tig00000001	+	196155	196155	44b26523-eaf0-4f28-87ad-4cca044fabc8	-10.40	-82.21	-71.81	1	1	TACCACGCCAA
-tig00000001	+	196180	196190	44b26523-eaf0-4f28-87ad-4cca044fabc8	-11.99	-158.15	-146.16	1	3	CCTTGCGCCCGCAGTCGCTGG
-tig00000001	+	196210	196210	44b26523-eaf0-4f28-87ad-4cca044fabc8	-4.90	-84.68	-79.77	1	1	AGCATCGCCCA
-tig00000001	+	196224	196227	44b26523-eaf0-4f28-87ad-4cca044fabc8	-9.20	-98.93	-89.73	1	2	CTTCCCGACGCCTG
-tig00000001	+	196242	196242	44b26523-eaf0-4f28-87ad-4cca044fabc8	-1.81	-90.95	-89.14	1	1	GGCACCGAAGA
-tig00000001	+	196264	196274	44b26523-eaf0-4f28-87ad-4cca044fabc8	-13.01	-171.63	-158.61	1	4	TTCCCCGATGCGGCGCGGCAG
-tig00000001	+	196294	196319	44b26523-eaf0-4f28-87ad-4cca044fabc8	-27.81	-269.93	-242.13	1	5	GCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
-tig00000001	+	196342	196342	44b26523-eaf0-4f28-87ad-4cca044fabc8	-0.41	-125.02	-124.62	1	1	TCCAGCGCCAG
-tig00000001	+	196372	196380	44b26523-eaf0-4f28-87ad-4cca044fabc8	-0.28	-139.00	-138.72	1	2	ACAACCGGCTGGCCGATAT
-tig00000001	+	196396	196396	44b26523-eaf0-4f28-87ad-4cca044fabc8	-3.56	-135.09	-131.53	1	1	ACCAGCGGTTG
-tig00000001	+	196416	196426	44b26523-eaf0-4f28-87ad-4cca044fabc8	-5.55	-136.82	-131.27	1	2	TTTTGCGATCAGTTGCGTGAG
-tig00000001	+	196440	196440	44b26523-eaf0-4f28-87ad-4cca044fabc8	-2.13	-77.78	-75.64	1	1	TTCAACGCTGA
-tig00000001	+	196451	196466	44b26523-eaf0-4f28-87ad-4cca044fabc8	-28.33	-210.32	-181.99	1	5	GATTACGCGCTTTCGCCACGCGTGGG
-tig00000001	+	196483	196492	44b26523-eaf0-4f28-87ad-4cca044fabc8	-15.84	-166.63	-150.78	1	3	CAGGCCGCCGCTTGCGGGTG
-tig00000001	+	196514	196527	44b26523-eaf0-4f28-87ad-4cca044fabc8	-2.30	-169.37	-167.07	1	3	CAGCCCGCTTGCCGATGCCGTCAC
-tig00000001	+	196542	196576	44b26523-eaf0-4f28-87ad-4cca044fabc8	-20.42	-270.63	-250.21	1	7	TCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAAT
-tig00000001	+	196589	196595	44b26523-eaf0-4f28-87ad-4cca044fabc8	-5.62	-128.39	-122.77	1	3	AGCAACGCGTGCGGCTA
-tig00000001	+	196629	196629	44b26523-eaf0-4f28-87ad-4cca044fabc8	2.21	-71.76	-73.97	1	1	CTGACCGCCAG
-tig00000001	+	196643	196643	44b26523-eaf0-4f28-87ad-4cca044fabc8	-0.01	-113.69	-113.68	1	1	GCTCCCGCCAG
-tig00000001	+	196677	196690	44b26523-eaf0-4f28-87ad-4cca044fabc8	-14.78	-199.88	-185.10	1	4	TCTGCCGTTGCCGACGGGCGACCA
-tig00000001	+	196706	196712	44b26523-eaf0-4f28-87ad-4cca044fabc8	-11.80	-156.80	-144.99	1	2	ATAGCCGTTGCCGGTAA
-tig00000001	+	196727	196749	44b26523-eaf0-4f28-87ad-4cca044fabc8	-12.94	-212.95	-200.01	1	5	CTGCCCGATTAATGCCGAACCGCGCACCGTATC
-tig00000001	+	196762	196770	44b26523-eaf0-4f28-87ad-4cca044fabc8	-8.52	-143.66	-135.15	1	2	CTTCACGAATCAACGAACC
-tig00000001	+	196810	196810	44b26523-eaf0-4f28-87ad-4cca044fabc8	-4.42	-159.15	-154.73	1	1	CAGTACGGTGG
-tig00000001	+	196823	196834	44b26523-eaf0-4f28-87ad-4cca044fabc8	-25.85	-225.93	-200.08	1	3	AGCAGCGGGTAAACGCCGCCAG
-tig00000001	+	196874	196878	44b26523-eaf0-4f28-87ad-4cca044fabc8	-5.10	-201.92	-196.82	1	2	AATGCCGGACGTAAT
-tig00000001	+	196909	196915	44b26523-eaf0-4f28-87ad-4cca044fabc8	-7.99	-124.51	-116.52	1	2	CAGACCGCAAACGGTCA
-tig00000001	+	196945	196952	44b26523-eaf0-4f28-87ad-4cca044fabc8	-4.43	-119.08	-114.65	1	2	GATACCGATAAACGGCAC
-tig00000001	+	196975	196975	44b26523-eaf0-4f28-87ad-4cca044fabc8	-7.57	-105.96	-98.39	1	1	CAGACCGTAAA
-tig00000001	+	196992	196995	44b26523-eaf0-4f28-87ad-4cca044fabc8	-12.78	-143.97	-131.20	1	2	AGTTACGGCGCAAC
-tig00000001	+	197011	197018	44b26523-eaf0-4f28-87ad-4cca044fabc8	-5.94	-131.24	-125.31	1	2	AGAAGCGGTAAGCGGTTT
-tig00000001	+	197032	197041	44b26523-eaf0-4f28-87ad-4cca044fabc8	-13.46	-188.46	-175.00	1	2	ACTCACGCCTTTAACGCCAG
-tig00000001	+	197059	197059	44b26523-eaf0-4f28-87ad-4cca044fabc8	-0.61	-128.29	-127.67	1	1	AAAGACGATAA
-tig00000001	+	197071	197071	44b26523-eaf0-4f28-87ad-4cca044fabc8	-18.52	-126.20	-107.69	1	1	CAAGGCGTTGA
-tig00000001	+	197084	197084	44b26523-eaf0-4f28-87ad-4cca044fabc8	-7.35	-120.15	-112.80	1	1	ATCACCGCACT
-tig00000001	+	197098	197108	44b26523-eaf0-4f28-87ad-4cca044fabc8	-27.21	-196.09	-168.88	1	3	GATTGCGGAGTCGGGCGAATG
-tig00000001	+	197132	197132	44b26523-eaf0-4f28-87ad-4cca044fabc8	-5.80	-112.65	-106.84	1	1	TTCAGCGCATT
-tig00000001	+	197144	197168	44b26523-eaf0-4f28-87ad-4cca044fabc8	-29.41	-266.75	-237.34	1	6	AACTGCGGATACGTTGCCGCGAATGCCGCCGGAAT
-tig00000001	+	197179	197197	44b26523-eaf0-4f28-87ad-4cca044fabc8	-8.46	-177.84	-169.39	1	3	AATGGCGAAGTATTTCGCCACATCGTTGG
-tig00000001	+	197222	197229	44b26523-eaf0-4f28-87ad-4cca044fabc8	-5.16	-159.33	-154.17	1	2	GTCAGCGAGCCACGGGTC
-tig00000001	+	197266	197266	44b26523-eaf0-4f28-87ad-4cca044fabc8	-5.38	-117.29	-111.91	1	1	CACCTCGATCA
-tig00000001	+	197279	197279	44b26523-eaf0-4f28-87ad-4cca044fabc8	-3.97	-112.84	-108.88	1	1	TTGGTCGGGTT
-tig00000001	+	197290	197296	44b26523-eaf0-4f28-87ad-4cca044fabc8	-13.16	-137.85	-124.69	1	2	AGAGTCGAGATCGACCA
-tig00000001	+	197309	197321	44b26523-eaf0-4f28-87ad-4cca044fabc8	-16.19	-157.75	-141.56	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	+	197332	197350	44b26523-eaf0-4f28-87ad-4cca044fabc8	-14.73	-195.17	-180.44	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	+	197363	197420	44b26523-eaf0-4f28-87ad-4cca044fabc8	-45.97	-400.14	-354.17	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	+	197433	197433	44b26523-eaf0-4f28-87ad-4cca044fabc8	-1.42	-144.51	-143.10	1	1	ACTGACGGATC
-tig00000001	+	197456	197470	44b26523-eaf0-4f28-87ad-4cca044fabc8	-18.88	-164.97	-146.10	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	+	197482	197509	44b26523-eaf0-4f28-87ad-4cca044fabc8	-21.14	-259.22	-238.07	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	+	197520	197530	44b26523-eaf0-4f28-87ad-4cca044fabc8	-13.54	-173.71	-160.17	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	+	197543	197543	44b26523-eaf0-4f28-87ad-4cca044fabc8	-4.67	-117.40	-112.73	1	1	ATCACCGTTTT
-tig00000001	+	197562	197577	44b26523-eaf0-4f28-87ad-4cca044fabc8	-18.57	-210.45	-191.88	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	+	197590	197599	44b26523-eaf0-4f28-87ad-4cca044fabc8	-7.08	-155.32	-148.24	1	2	AATACCGCCTTTGACGATAT
-tig00000001	+	197612	197620	44b26523-eaf0-4f28-87ad-4cca044fabc8	-13.20	-123.45	-110.25	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	+	197631	197631	44b26523-eaf0-4f28-87ad-4cca044fabc8	-6.75	-110.43	-103.68	1	1	GCACACGAGAA
-tig00000001	+	197654	197657	44b26523-eaf0-4f28-87ad-4cca044fabc8	-2.37	-147.00	-144.63	1	2	ACCAGCGGCGTGGC
-tig00000001	+	197670	197672	44b26523-eaf0-4f28-87ad-4cca044fabc8	-14.99	-138.01	-123.02	1	2	CCTGACGCGCAAC
-tig00000001	+	197683	197683	44b26523-eaf0-4f28-87ad-4cca044fabc8	-5.17	-130.89	-125.73	1	1	CTGATCGACTT
-tig00000001	+	197701	197701	44b26523-eaf0-4f28-87ad-4cca044fabc8	-9.06	-133.17	-124.11	1	1	AACATCGGTAG
-tig00000001	+	197719	197719	44b26523-eaf0-4f28-87ad-4cca044fabc8	-2.35	-109.53	-107.18	1	1	ACCACCGTTAG
-tig00000001	+	197736	197749	44b26523-eaf0-4f28-87ad-4cca044fabc8	-13.02	-170.57	-157.55	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	+	197763	197779	44b26523-eaf0-4f28-87ad-4cca044fabc8	-14.45	-230.97	-216.52	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	+	197791	197816	44b26523-eaf0-4f28-87ad-4cca044fabc8	-17.12	-256.09	-238.97	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	+	197837	197837	44b26523-eaf0-4f28-87ad-4cca044fabc8	0.18	-98.56	-98.74	1	1	TGGAGCGACTG
-tig00000001	+	197848	197856	44b26523-eaf0-4f28-87ad-4cca044fabc8	-40.19	-270.49	-230.29	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	+	197868	197878	44b26523-eaf0-4f28-87ad-4cca044fabc8	-9.36	-120.59	-111.23	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	+	197895	197906	44b26523-eaf0-4f28-87ad-4cca044fabc8	-7.05	-173.71	-166.66	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	+	197921	197921	44b26523-eaf0-4f28-87ad-4cca044fabc8	-9.25	-145.65	-136.40	1	1	GCCAGCGAAGC
-tig00000001	+	197935	197948	44b26523-eaf0-4f28-87ad-4cca044fabc8	-10.23	-180.49	-170.26	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	+	197960	197969	44b26523-eaf0-4f28-87ad-4cca044fabc8	-17.85	-164.17	-146.31	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	+	197982	197999	44b26523-eaf0-4f28-87ad-4cca044fabc8	-9.56	-198.01	-188.45	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	+	198014	198014	44b26523-eaf0-4f28-87ad-4cca044fabc8	-4.62	-131.69	-127.07	1	1	GGTGCCGGTTT
-tig00000001	+	198035	198051	44b26523-eaf0-4f28-87ad-4cca044fabc8	-4.73	-145.31	-140.58	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	+	198064	198068	44b26523-eaf0-4f28-87ad-4cca044fabc8	-7.75	-113.44	-105.70	1	2	CTGCACGTCCGCTGG
-tig00000001	+	198087	198089	44b26523-eaf0-4f28-87ad-4cca044fabc8	-6.27	-102.84	-96.56	1	2	ACATTCGCGCCTA
-tig00000001	+	198100	198123	44b26523-eaf0-4f28-87ad-4cca044fabc8	-11.49	-257.38	-245.89	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	+	198137	198137	44b26523-eaf0-4f28-87ad-4cca044fabc8	-5.27	-132.72	-127.45	1	1	CAGGCCGCCAA
-tig00000001	+	198171	198171	44b26523-eaf0-4f28-87ad-4cca044fabc8	-6.28	-118.91	-112.64	1	1	AGCAGCGCCAC
-tig00000001	+	198183	198188	44b26523-eaf0-4f28-87ad-4cca044fabc8	-5.87	-127.43	-121.57	1	2	AGTACCGTTACGCTGA
-tig00000001	+	198203	198233	44b26523-eaf0-4f28-87ad-4cca044fabc8	-29.73	-319.51	-289.77	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	+	198250	198250	44b26523-eaf0-4f28-87ad-4cca044fabc8	-0.88	-98.75	-97.87	1	1	AAAGACGATAG
-tig00000001	+	198289	198313	44b26523-eaf0-4f28-87ad-4cca044fabc8	-34.27	-258.98	-224.70	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	+	198326	198336	44b26523-eaf0-4f28-87ad-4cca044fabc8	-10.12	-156.15	-146.03	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	+	198352	198364	44b26523-eaf0-4f28-87ad-4cca044fabc8	-7.24	-157.27	-150.03	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	+	198399	198415	44b26523-eaf0-4f28-87ad-4cca044fabc8	-36.07	-234.39	-198.32	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	+	198427	198485	44b26523-eaf0-4f28-87ad-4cca044fabc8	-46.08	-467.91	-421.83	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	+	198513	198513	44b26523-eaf0-4f28-87ad-4cca044fabc8	-2.59	-81.71	-79.12	1	1	ACCATCGCAGG
-tig00000001	+	198527	198527	44b26523-eaf0-4f28-87ad-4cca044fabc8	-0.61	-117.06	-116.45	1	1	AATATCGCCAG
-tig00000001	+	198545	198569	44b26523-eaf0-4f28-87ad-4cca044fabc8	-20.81	-236.58	-215.77	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	+	198585	198619	44b26523-eaf0-4f28-87ad-4cca044fabc8	-36.70	-310.26	-273.56	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	+	198660	198670	44b26523-eaf0-4f28-87ad-4cca044fabc8	-10.89	-154.16	-143.27	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	+	198684	198710	44b26523-eaf0-4f28-87ad-4cca044fabc8	-37.92	-314.98	-277.07	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	+	198728	198782	44b26523-eaf0-4f28-87ad-4cca044fabc8	-49.68	-450.26	-400.57	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	+	198812	198821	44b26523-eaf0-4f28-87ad-4cca044fabc8	-20.34	-179.72	-159.38	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	+	198834	198855	44b26523-eaf0-4f28-87ad-4cca044fabc8	-16.16	-233.80	-217.64	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	+	198872	198872	44b26523-eaf0-4f28-87ad-4cca044fabc8	-9.70	-98.19	-88.48	1	1	TTCACCGCTTC
-tig00000001	+	198884	198892	44b26523-eaf0-4f28-87ad-4cca044fabc8	-12.35	-130.36	-118.01	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	+	198907	198914	44b26523-eaf0-4f28-87ad-4cca044fabc8	-10.72	-150.60	-139.88	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	+	198927	198927	44b26523-eaf0-4f28-87ad-4cca044fabc8	-4.92	-112.10	-107.18	1	1	GTTTACGACTC
-tig00000001	+	198972	198987	44b26523-eaf0-4f28-87ad-4cca044fabc8	-20.42	-219.70	-199.28	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	+	199013	199013	44b26523-eaf0-4f28-87ad-4cca044fabc8	-4.65	-111.77	-107.12	1	1	CAGTGCGCCAA
-tig00000001	+	199028	199034	44b26523-eaf0-4f28-87ad-4cca044fabc8	-4.02	-140.39	-136.37	1	2	CAACACGGTGCCGATTA
-tig00000001	+	199056	199088	44b26523-eaf0-4f28-87ad-4cca044fabc8	-27.91	-289.91	-262.00	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	+	199112	199117	44b26523-eaf0-4f28-87ad-4cca044fabc8	-3.48	-142.39	-138.91	1	2	ACCAGCGAACCGGCAA
-tig00000001	+	199133	199133	44b26523-eaf0-4f28-87ad-4cca044fabc8	-0.68	-193.80	-193.13	1	1	ATCACCGGGAT
-tig00000001	+	199147	199156	44b26523-eaf0-4f28-87ad-4cca044fabc8	-9.66	-216.95	-207.29	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	+	199172	199172	44b26523-eaf0-4f28-87ad-4cca044fabc8	-8.25	-138.10	-129.85	1	1	CAGAACGCCAG
-tig00000001	+	199193	199193	44b26523-eaf0-4f28-87ad-4cca044fabc8	-9.88	-102.15	-92.28	1	1	CAGAACGGAGA
-tig00000001	+	199204	199228	44b26523-eaf0-4f28-87ad-4cca044fabc8	-11.44	-228.57	-217.13	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	+	199240	199255	44b26523-eaf0-4f28-87ad-4cca044fabc8	-20.58	-186.99	-166.42	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	+	199267	199267	44b26523-eaf0-4f28-87ad-4cca044fabc8	1.71	-116.23	-117.94	1	1	CACTTCGCTAA
-tig00000001	+	199280	199280	44b26523-eaf0-4f28-87ad-4cca044fabc8	-5.27	-133.34	-128.07	1	1	CCATGCGGGCC
-tig00000001	+	199300	199336	44b26523-eaf0-4f28-87ad-4cca044fabc8	-36.42	-356.76	-320.34	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	+	199352	199355	44b26523-eaf0-4f28-87ad-4cca044fabc8	-9.18	-135.12	-125.93	1	2	ACCAGCGTCGGGGT
-tig00000001	+	199393	199402	44b26523-eaf0-4f28-87ad-4cca044fabc8	-14.85	-170.55	-155.71	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	+	199423	199430	44b26523-eaf0-4f28-87ad-4cca044fabc8	-9.58	-162.39	-152.81	1	2	TATTCCGGTGTACGACCA
-tig00000001	+	199446	199446	44b26523-eaf0-4f28-87ad-4cca044fabc8	-0.72	-101.03	-100.31	1	1	CAGCCCGGCAA
-tig00000001	+	199459	199459	44b26523-eaf0-4f28-87ad-4cca044fabc8	-10.68	-101.64	-90.95	1	1	AACACCGCCAG
-tig00000001	+	199485	199485	44b26523-eaf0-4f28-87ad-4cca044fabc8	-4.94	-114.95	-110.01	1	1	CATGCCGTAAA
-tig00000001	+	199500	199509	44b26523-eaf0-4f28-87ad-4cca044fabc8	-10.96	-128.19	-117.24	1	3	AGAACCGACACCGCCGAACA
-tig00000001	+	199543	199543	44b26523-eaf0-4f28-87ad-4cca044fabc8	-10.78	-113.78	-102.99	1	1	CACATCGGCAC
-tig00000001	+	199557	199570	44b26523-eaf0-4f28-87ad-4cca044fabc8	-14.39	-145.24	-130.85	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	+	199582	199593	44b26523-eaf0-4f28-87ad-4cca044fabc8	-10.14	-145.90	-135.76	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	+	199606	199621	44b26523-eaf0-4f28-87ad-4cca044fabc8	-16.72	-198.34	-181.62	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	+	199644	199652	44b26523-eaf0-4f28-87ad-4cca044fabc8	-19.15	-160.63	-141.48	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	+	199687	199687	44b26523-eaf0-4f28-87ad-4cca044fabc8	1.94	-106.61	-108.55	1	1	CTGTCCGTGCC
-tig00000001	+	199740	199746	44b26523-eaf0-4f28-87ad-4cca044fabc8	-10.63	-134.70	-124.08	1	2	CACCACGCCTACGCAGA
-tig00000001	+	199770	199770	44b26523-eaf0-4f28-87ad-4cca044fabc8	-4.17	-116.51	-112.35	1	1	GACATCGCCCA
-tig00000001	+	199786	199802	44b26523-eaf0-4f28-87ad-4cca044fabc8	-21.87	-213.44	-191.56	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	+	199833	199836	44b26523-eaf0-4f28-87ad-4cca044fabc8	-2.65	-114.14	-111.49	1	2	CACAGCGCCGTTGG
-tig00000001	+	199854	199854	44b26523-eaf0-4f28-87ad-4cca044fabc8	-1.15	-152.05	-150.90	1	1	AAGATCGCCAG
-tig00000001	+	199868	199868	44b26523-eaf0-4f28-87ad-4cca044fabc8	-4.58	-109.93	-105.35	1	1	CTGCACGAAGT
-tig00000001	+	199883	199883	44b26523-eaf0-4f28-87ad-4cca044fabc8	0.48	-157.64	-158.12	1	1	CAGTGCGGTTG
-tig00000001	+	199899	199908	44b26523-eaf0-4f28-87ad-4cca044fabc8	-17.48	-189.12	-171.64	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	+	199931	199943	44b26523-eaf0-4f28-87ad-4cca044fabc8	-16.03	-183.10	-167.07	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	+	199956	199956	44b26523-eaf0-4f28-87ad-4cca044fabc8	-1.38	-101.93	-100.55	1	1	TTGATCGCTTC
-tig00000001	+	199998	199998	44b26523-eaf0-4f28-87ad-4cca044fabc8	-0.87	-109.43	-108.56	1	1	TGTTGCGCTCC
 tig00000001	+	200009	200009	44b26523-eaf0-4f28-87ad-4cca044fabc8	-7.06	-110.96	-103.90	1	1	TTCAACGGTAT
 tig00000001	+	200046	200046	44b26523-eaf0-4f28-87ad-4cca044fabc8	-7.55	-104.67	-97.12	1	1	TGCAGCGCACC
 tig00000001	+	200081	200081	44b26523-eaf0-4f28-87ad-4cca044fabc8	-12.20	-111.19	-98.99	1	1	AACAACGCCAC
@@ -2504,182 +252,6 @@
 tig00000001	+	200591	200596	44b26523-eaf0-4f28-87ad-4cca044fabc8	-10.20	-158.71	-148.51	1	2	AAAAACGTGGCGATCA
 tig00000001	+	200615	200615	44b26523-eaf0-4f28-87ad-4cca044fabc8	-1.50	-91.22	-89.72	1	1	CCTTGCGCAGC
 tig00000001	+	200629	200635	44b26523-eaf0-4f28-87ad-4cca044fabc8	-12.81	-133.02	-120.21	1	2	CAGAACGCCTCCGCATT
-tig00000001	-	195035	195035	c2ba4328-d217-4343-a959-874cf5addce4	-1.85	-159.65	-157.80	1	1	CACCACGCCAA
-tig00000001	-	195065	195075	c2ba4328-d217-4343-a959-874cf5addce4	-8.22	-173.00	-164.78	1	2	GTTGGCGGCATCAAACGCCAT
-tig00000001	-	195110	195134	c2ba4328-d217-4343-a959-874cf5addce4	-27.38	-240.55	-213.18	1	6	GATAACGGCGCATAACGCGGCGGCAACCACGCATC
-tig00000001	-	195154	195154	c2ba4328-d217-4343-a959-874cf5addce4	-0.02	-158.48	-158.46	1	1	GTACACGCCAC
-tig00000001	-	195175	195206	c2ba4328-d217-4343-a959-874cf5addce4	-15.99	-254.94	-238.95	1	7	AAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTG
-tig00000001	-	195222	195224	c2ba4328-d217-4343-a959-874cf5addce4	-10.72	-120.53	-109.81	1	2	TCAAGCGCGACCA
-tig00000001	-	195239	195264	c2ba4328-d217-4343-a959-874cf5addce4	-36.54	-244.06	-207.52	1	6	CTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCA
-tig00000001	-	195275	195313	c2ba4328-d217-4343-a959-874cf5addce4	-54.06	-346.93	-292.86	1	9	GCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAA
-tig00000001	-	195328	195328	c2ba4328-d217-4343-a959-874cf5addce4	-8.80	-99.40	-90.60	1	1	CTTGCCGAGAT
-tig00000001	-	195342	195359	c2ba4328-d217-4343-a959-874cf5addce4	-10.25	-189.77	-179.52	1	3	GTTCACGGGCATAACGCACTACCGCTTT
-tig00000001	-	195371	195371	c2ba4328-d217-4343-a959-874cf5addce4	-10.47	-141.66	-131.19	1	1	TCTTCCGCTGG
-tig00000001	-	195392	195400	c2ba4328-d217-4343-a959-874cf5addce4	-12.35	-161.18	-148.83	1	3	GTTGCCGTCTCCGCGCCCA
-tig00000001	-	195413	195427	c2ba4328-d217-4343-a959-874cf5addce4	-7.11	-202.85	-195.74	1	3	TCCTGCGCCAGACGTAAGGCGCTGA
-tig00000001	-	195441	195460	c2ba4328-d217-4343-a959-874cf5addce4	-11.60	-194.28	-182.67	1	4	TTGCCCGACGTTTTTTCCGGTAAGCGGTGC
-tig00000001	-	195489	195500	c2ba4328-d217-4343-a959-874cf5addce4	-11.02	-154.95	-143.92	1	3	TACACCGCGTGCCAGACGCTAC
-tig00000001	-	195511	195535	c2ba4328-d217-4343-a959-874cf5addce4	-5.18	-334.92	-329.74	1	7	CCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACC
-tig00000001	-	195547	195553	c2ba4328-d217-4343-a959-874cf5addce4	-4.38	-138.54	-134.16	1	2	GTTTTCGCTGCCGGTGT
-tig00000001	-	195565	195565	c2ba4328-d217-4343-a959-874cf5addce4	-5.86	-87.03	-81.17	1	1	ATGGCCGATGC
-tig00000001	-	195581	195590	c2ba4328-d217-4343-a959-874cf5addce4	-17.02	-187.85	-170.83	1	5	AGGATCGCGTCGCGCGTGTG
-tig00000001	-	195608	195608	c2ba4328-d217-4343-a959-874cf5addce4	-5.36	-158.42	-153.05	1	1	CTCTTCGCCAG
-tig00000001	-	195621	195630	c2ba4328-d217-4343-a959-874cf5addce4	-1.47	-175.96	-174.49	1	3	TGCCCCGCCAGGCGCGCATT
-tig00000001	-	195646	195663	c2ba4328-d217-4343-a959-874cf5addce4	-14.23	-226.13	-211.90	1	5	ATCAACGCGATCGGCAGTACGGCGCAGT
-tig00000001	-	195676	195685	c2ba4328-d217-4343-a959-874cf5addce4	0.19	-192.45	-192.64	1	3	CAGTTCGCGCAGGGCGATCA
-tig00000001	-	195702	195702	c2ba4328-d217-4343-a959-874cf5addce4	1.69	-151.23	-152.93	1	1	CTTTGCGGAAA
-tig00000001	-	195720	195735	c2ba4328-d217-4343-a959-874cf5addce4	-11.00	-225.57	-214.57	1	4	AATGGCGCGCTCCGCCTGCCCGGCAA
-tig00000001	-	195764	195781	c2ba4328-d217-4343-a959-874cf5addce4	-3.34	-193.99	-190.65	1	4	TCAGCCGCTGGCGCAGATCGTCCGGGGC
-tig00000001	-	195803	195842	c2ba4328-d217-4343-a959-874cf5addce4	-37.57	-401.26	-363.68	1	8	CACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACC
-tig00000001	-	195855	195864	c2ba4328-d217-4343-a959-874cf5addce4	-12.73	-180.50	-167.77	1	3	AATTCCGGTGACGCCGCTGA
-tig00000001	-	195900	195906	c2ba4328-d217-4343-a959-874cf5addce4	-1.39	-104.75	-103.36	1	2	CTGAACGTTGACGGTAG
-tig00000001	-	195945	195945	c2ba4328-d217-4343-a959-874cf5addce4	-1.11	-131.39	-130.29	1	1	TTCTTCGATAT
-tig00000001	-	195959	195959	c2ba4328-d217-4343-a959-874cf5addce4	-5.18	-120.64	-115.45	1	1	GCCAGCGTTTG
-tig00000001	-	195971	195971	c2ba4328-d217-4343-a959-874cf5addce4	-3.37	-84.82	-81.44	1	1	GATGACGGGAA
-tig00000001	-	195982	195982	c2ba4328-d217-4343-a959-874cf5addce4	-2.96	-98.13	-95.17	1	1	CCTGGCGCATT
-tig00000001	-	195994	196002	c2ba4328-d217-4343-a959-874cf5addce4	-6.83	-157.81	-150.98	1	2	CTGTGCGCCAGTTCGTCCA
-tig00000001	-	196018	196044	c2ba4328-d217-4343-a959-874cf5addce4	-28.05	-221.08	-193.03	1	7	ATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGAT
-tig00000001	-	196056	196056	c2ba4328-d217-4343-a959-874cf5addce4	-2.89	-73.92	-71.03	1	1	AAACTCGCTGA
-tig00000001	-	196067	196093	c2ba4328-d217-4343-a959-874cf5addce4	-50.78	-258.52	-207.73	1	5	TATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAG
-tig00000001	-	196122	196125	c2ba4328-d217-4343-a959-874cf5addce4	-13.50	-114.13	-100.63	1	2	CATGGCGGCGGTAT
-tig00000001	-	196136	196140	c2ba4328-d217-4343-a959-874cf5addce4	-5.52	-137.47	-131.96	1	2	CTTTTCGCCCGTGGG
-tig00000001	-	196155	196155	c2ba4328-d217-4343-a959-874cf5addce4	-0.46	-152.26	-151.80	1	1	TACCACGCCAA
-tig00000001	-	196180	196190	c2ba4328-d217-4343-a959-874cf5addce4	-8.04	-219.94	-211.90	1	3	CCTTGCGCCCGCAGTCGCTGG
-tig00000001	-	196210	196210	c2ba4328-d217-4343-a959-874cf5addce4	-11.13	-152.20	-141.07	1	1	AGCATCGCCCA
-tig00000001	-	196224	196227	c2ba4328-d217-4343-a959-874cf5addce4	-17.36	-133.97	-116.61	1	2	CTTCCCGACGCCTG
-tig00000001	-	196242	196242	c2ba4328-d217-4343-a959-874cf5addce4	-5.58	-105.54	-99.97	1	1	GGCACCGAAGA
-tig00000001	-	196264	196274	c2ba4328-d217-4343-a959-874cf5addce4	-29.40	-231.22	-201.82	1	4	TTCCCCGATGCGGCGCGGCAG
-tig00000001	-	196294	196319	c2ba4328-d217-4343-a959-874cf5addce4	-2.15	-223.52	-221.37	1	5	GCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
-tig00000001	-	196342	196342	c2ba4328-d217-4343-a959-874cf5addce4	-2.68	-120.70	-118.02	1	1	TCCAGCGCCAG
-tig00000001	-	196372	196380	c2ba4328-d217-4343-a959-874cf5addce4	-10.68	-149.91	-139.23	1	2	ACAACCGGCTGGCCGATAT
-tig00000001	-	196396	196396	c2ba4328-d217-4343-a959-874cf5addce4	0.21	-109.36	-109.57	1	1	ACCAGCGGTTG
-tig00000001	-	196416	196426	c2ba4328-d217-4343-a959-874cf5addce4	-0.28	-162.75	-162.47	1	2	TTTTGCGATCAGTTGCGTGAG
-tig00000001	-	196440	196440	c2ba4328-d217-4343-a959-874cf5addce4	0.03	-108.73	-108.76	1	1	TTCAACGCTGA
-tig00000001	-	196451	196466	c2ba4328-d217-4343-a959-874cf5addce4	-11.25	-195.90	-184.65	1	5	GATTACGCGCTTTCGCCACGCGTGGG
-tig00000001	-	196483	196492	c2ba4328-d217-4343-a959-874cf5addce4	-19.47	-169.32	-149.85	1	3	CAGGCCGCCGCTTGCGGGTG
-tig00000001	-	196514	196527	c2ba4328-d217-4343-a959-874cf5addce4	-3.11	-169.88	-166.77	1	3	CAGCCCGCTTGCCGATGCCGTCAC
-tig00000001	-	196542	196576	c2ba4328-d217-4343-a959-874cf5addce4	1.29	-326.45	-327.75	1	7	TCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAAT
-tig00000001	-	196589	196595	c2ba4328-d217-4343-a959-874cf5addce4	-9.84	-157.00	-147.16	1	3	AGCAACGCGTGCGGCTA
-tig00000001	-	196629	196629	c2ba4328-d217-4343-a959-874cf5addce4	0.75	-131.83	-132.58	1	1	CTGACCGCCAG
-tig00000001	-	196643	196643	c2ba4328-d217-4343-a959-874cf5addce4	-1.36	-98.87	-97.51	1	1	GCTCCCGCCAG
-tig00000001	-	196677	196690	c2ba4328-d217-4343-a959-874cf5addce4	0.22	-156.03	-156.25	1	4	TCTGCCGTTGCCGACGGGCGACCA
-tig00000001	-	196706	196712	c2ba4328-d217-4343-a959-874cf5addce4	-8.79	-153.79	-145.01	1	2	ATAGCCGTTGCCGGTAA
-tig00000001	-	196727	196749	c2ba4328-d217-4343-a959-874cf5addce4	-23.20	-207.15	-183.96	1	5	CTGCCCGATTAATGCCGAACCGCGCACCGTATC
-tig00000001	-	196762	196770	c2ba4328-d217-4343-a959-874cf5addce4	-6.93	-153.41	-146.48	1	2	CTTCACGAATCAACGAACC
-tig00000001	-	196810	196810	c2ba4328-d217-4343-a959-874cf5addce4	-13.76	-132.68	-118.93	1	1	CAGTACGGTGG
-tig00000001	-	196823	196834	c2ba4328-d217-4343-a959-874cf5addce4	-12.62	-185.49	-172.88	1	3	AGCAGCGGGTAAACGCCGCCAG
-tig00000001	-	196874	196878	c2ba4328-d217-4343-a959-874cf5addce4	-4.02	-123.00	-118.98	1	2	AATGCCGGACGTAAT
-tig00000001	-	196909	196915	c2ba4328-d217-4343-a959-874cf5addce4	5.36	-167.51	-172.87	1	2	CAGACCGCAAACGGTCA
-tig00000001	-	196945	196952	c2ba4328-d217-4343-a959-874cf5addce4	-1.97	-150.88	-148.91	1	2	GATACCGATAAACGGCAC
-tig00000001	-	196975	196975	c2ba4328-d217-4343-a959-874cf5addce4	-4.89	-139.68	-134.79	1	1	CAGACCGTAAA
-tig00000001	-	196992	196995	c2ba4328-d217-4343-a959-874cf5addce4	-13.50	-148.71	-135.21	1	2	AGTTACGGCGCAAC
-tig00000001	-	197011	197018	c2ba4328-d217-4343-a959-874cf5addce4	-18.58	-143.87	-125.30	1	2	AGAAGCGGTAAGCGGTTT
-tig00000001	-	197032	197041	c2ba4328-d217-4343-a959-874cf5addce4	-4.72	-167.45	-162.73	1	2	ACTCACGCCTTTAACGCCAG
-tig00000001	-	197059	197059	c2ba4328-d217-4343-a959-874cf5addce4	-5.47	-129.52	-124.05	1	1	AAAGACGATAA
-tig00000001	-	197071	197071	c2ba4328-d217-4343-a959-874cf5addce4	-4.11	-112.61	-108.50	1	1	CAAGGCGTTGA
-tig00000001	-	197084	197084	c2ba4328-d217-4343-a959-874cf5addce4	-7.14	-108.56	-101.43	1	1	ATCACCGCACT
-tig00000001	-	197098	197108	c2ba4328-d217-4343-a959-874cf5addce4	-16.55	-155.64	-139.08	1	3	GATTGCGGAGTCGGGCGAATG
-tig00000001	-	197132	197132	c2ba4328-d217-4343-a959-874cf5addce4	-4.18	-111.90	-107.72	1	1	TTCAGCGCATT
-tig00000001	-	197144	197168	c2ba4328-d217-4343-a959-874cf5addce4	-23.39	-263.60	-240.21	1	6	AACTGCGGATACGTTGCCGCGAATGCCGCCGGAAT
-tig00000001	-	197179	197197	c2ba4328-d217-4343-a959-874cf5addce4	-23.23	-233.34	-210.11	1	3	AATGGCGAAGTATTTCGCCACATCGTTGG
-tig00000001	-	197222	197229	c2ba4328-d217-4343-a959-874cf5addce4	-13.65	-143.24	-129.58	1	2	GTCAGCGAGCCACGGGTC
-tig00000001	-	197266	197266	c2ba4328-d217-4343-a959-874cf5addce4	-3.52	-117.35	-113.84	1	1	CACCTCGATCA
-tig00000001	-	197279	197279	c2ba4328-d217-4343-a959-874cf5addce4	-4.37	-125.35	-120.98	1	1	TTGGTCGGGTT
-tig00000001	-	197290	197296	c2ba4328-d217-4343-a959-874cf5addce4	-7.98	-134.89	-126.90	1	2	AGAGTCGAGATCGACCA
-tig00000001	-	197309	197321	c2ba4328-d217-4343-a959-874cf5addce4	-15.65	-183.06	-167.41	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	-	197332	197350	c2ba4328-d217-4343-a959-874cf5addce4	-16.07	-231.69	-215.62	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	-	197363	197420	c2ba4328-d217-4343-a959-874cf5addce4	-46.50	-436.94	-390.44	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	-	197433	197433	c2ba4328-d217-4343-a959-874cf5addce4	-3.47	-121.56	-118.08	1	1	ACTGACGGATC
-tig00000001	-	197456	197470	c2ba4328-d217-4343-a959-874cf5addce4	-33.41	-228.94	-195.53	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	-	197482	197509	c2ba4328-d217-4343-a959-874cf5addce4	-36.80	-290.31	-253.51	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	-	197520	197530	c2ba4328-d217-4343-a959-874cf5addce4	-11.02	-176.70	-165.68	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	-	197543	197543	c2ba4328-d217-4343-a959-874cf5addce4	-1.83	-91.15	-89.32	1	1	ATCACCGTTTT
-tig00000001	-	197562	197577	c2ba4328-d217-4343-a959-874cf5addce4	-24.53	-214.00	-189.47	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	-	197590	197599	c2ba4328-d217-4343-a959-874cf5addce4	-11.65	-164.03	-152.38	1	2	AATACCGCCTTTGACGATAT
-tig00000001	-	197612	197620	c2ba4328-d217-4343-a959-874cf5addce4	-1.76	-144.48	-142.72	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	-	197631	197631	c2ba4328-d217-4343-a959-874cf5addce4	5.00	-132.56	-137.56	1	1	GCACACGAGAA
-tig00000001	-	197654	197657	c2ba4328-d217-4343-a959-874cf5addce4	-13.81	-140.27	-126.46	1	2	ACCAGCGGCGTGGC
-tig00000001	-	197670	197672	c2ba4328-d217-4343-a959-874cf5addce4	-7.58	-130.54	-122.96	1	2	CCTGACGCGCAAC
-tig00000001	-	197683	197683	c2ba4328-d217-4343-a959-874cf5addce4	-9.75	-111.35	-101.59	1	1	CTGATCGACTT
-tig00000001	-	197701	197701	c2ba4328-d217-4343-a959-874cf5addce4	0.34	-88.98	-89.32	1	1	AACATCGGTAG
-tig00000001	-	197719	197719	c2ba4328-d217-4343-a959-874cf5addce4	-8.34	-123.59	-115.25	1	1	ACCACCGTTAG
-tig00000001	-	197736	197749	c2ba4328-d217-4343-a959-874cf5addce4	-2.60	-182.88	-180.28	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	-	197763	197779	c2ba4328-d217-4343-a959-874cf5addce4	-14.43	-219.62	-205.19	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	-	197791	197816	c2ba4328-d217-4343-a959-874cf5addce4	1.95	-303.74	-305.69	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	-	197837	197837	c2ba4328-d217-4343-a959-874cf5addce4	-6.33	-110.63	-104.30	1	1	TGGAGCGACTG
-tig00000001	-	197848	197856	c2ba4328-d217-4343-a959-874cf5addce4	-11.16	-140.70	-129.54	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	-	197868	197878	c2ba4328-d217-4343-a959-874cf5addce4	-11.20	-148.66	-137.46	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	-	197895	197906	c2ba4328-d217-4343-a959-874cf5addce4	-10.43	-139.06	-128.62	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	-	197921	197921	c2ba4328-d217-4343-a959-874cf5addce4	-6.03	-93.38	-87.35	1	1	GCCAGCGAAGC
-tig00000001	-	197935	197948	c2ba4328-d217-4343-a959-874cf5addce4	-15.77	-230.84	-215.07	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	-	197960	197969	c2ba4328-d217-4343-a959-874cf5addce4	-26.74	-173.07	-146.33	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	-	197982	197999	c2ba4328-d217-4343-a959-874cf5addce4	-18.91	-206.40	-187.49	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	-	198014	198014	c2ba4328-d217-4343-a959-874cf5addce4	-6.44	-98.93	-92.50	1	1	GGTGCCGGTTT
-tig00000001	-	198035	198051	c2ba4328-d217-4343-a959-874cf5addce4	-4.11	-197.28	-193.18	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	-	198064	198068	c2ba4328-d217-4343-a959-874cf5addce4	-3.17	-163.52	-160.35	1	2	CTGCACGTCCGCTGG
-tig00000001	-	198087	198089	c2ba4328-d217-4343-a959-874cf5addce4	-1.33	-142.59	-141.26	1	2	ACATTCGCGCCTA
-tig00000001	-	198100	198123	c2ba4328-d217-4343-a959-874cf5addce4	-34.52	-304.32	-269.81	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	-	198137	198137	c2ba4328-d217-4343-a959-874cf5addce4	2.63	-126.43	-129.05	1	1	CAGGCCGCCAA
-tig00000001	-	198171	198171	c2ba4328-d217-4343-a959-874cf5addce4	0.59	-97.88	-98.47	1	1	AGCAGCGCCAC
-tig00000001	-	198183	198188	c2ba4328-d217-4343-a959-874cf5addce4	-6.94	-115.24	-108.30	1	2	AGTACCGTTACGCTGA
-tig00000001	-	198203	198233	c2ba4328-d217-4343-a959-874cf5addce4	-18.32	-322.39	-304.08	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	-	198250	198250	c2ba4328-d217-4343-a959-874cf5addce4	-0.90	-151.28	-150.37	1	1	AAAGACGATAG
-tig00000001	-	198289	198313	c2ba4328-d217-4343-a959-874cf5addce4	-34.00	-258.50	-224.50	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	-	198326	198336	c2ba4328-d217-4343-a959-874cf5addce4	-2.12	-211.96	-209.83	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	-	198352	198364	c2ba4328-d217-4343-a959-874cf5addce4	-2.27	-160.26	-157.99	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	-	198399	198415	c2ba4328-d217-4343-a959-874cf5addce4	-17.85	-208.92	-191.08	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	-	198427	198485	c2ba4328-d217-4343-a959-874cf5addce4	-32.47	-385.71	-353.24	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	-	198513	198513	c2ba4328-d217-4343-a959-874cf5addce4	-1.72	-98.22	-96.51	1	1	ACCATCGCAGG
-tig00000001	-	198527	198527	c2ba4328-d217-4343-a959-874cf5addce4	-0.57	-112.63	-112.06	1	1	AATATCGCCAG
-tig00000001	-	198545	198569	c2ba4328-d217-4343-a959-874cf5addce4	-20.37	-214.93	-194.55	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	-	198585	198619	c2ba4328-d217-4343-a959-874cf5addce4	-15.70	-274.49	-258.79	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	-	198660	198670	c2ba4328-d217-4343-a959-874cf5addce4	-2.21	-149.55	-147.34	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	-	198684	198710	c2ba4328-d217-4343-a959-874cf5addce4	-28.10	-303.80	-275.69	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	-	198728	198782	c2ba4328-d217-4343-a959-874cf5addce4	-37.25	-388.97	-351.72	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	-	198812	198821	c2ba4328-d217-4343-a959-874cf5addce4	-7.80	-149.55	-141.75	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	-	198834	198855	c2ba4328-d217-4343-a959-874cf5addce4	-31.82	-269.05	-237.23	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	-	198872	198872	c2ba4328-d217-4343-a959-874cf5addce4	-0.54	-106.58	-106.05	1	1	TTCACCGCTTC
-tig00000001	-	198884	198892	c2ba4328-d217-4343-a959-874cf5addce4	-6.77	-155.26	-148.49	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	-	198907	198914	c2ba4328-d217-4343-a959-874cf5addce4	4.93	-116.08	-121.01	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	-	198927	198927	c2ba4328-d217-4343-a959-874cf5addce4	-2.28	-115.09	-112.80	1	1	GTTTACGACTC
-tig00000001	-	198972	198987	c2ba4328-d217-4343-a959-874cf5addce4	-4.31	-168.96	-164.65	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	-	199013	199013	c2ba4328-d217-4343-a959-874cf5addce4	1.72	-84.20	-85.92	1	1	CAGTGCGCCAA
-tig00000001	-	199028	199034	c2ba4328-d217-4343-a959-874cf5addce4	-8.61	-174.76	-166.15	1	2	CAACACGGTGCCGATTA
-tig00000001	-	199056	199088	c2ba4328-d217-4343-a959-874cf5addce4	-22.49	-293.31	-270.82	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	-	199112	199117	c2ba4328-d217-4343-a959-874cf5addce4	-10.08	-142.19	-132.11	1	2	ACCAGCGAACCGGCAA
-tig00000001	-	199133	199133	c2ba4328-d217-4343-a959-874cf5addce4	-3.11	-102.98	-99.87	1	1	ATCACCGGGAT
-tig00000001	-	199147	199156	c2ba4328-d217-4343-a959-874cf5addce4	-23.86	-215.00	-191.15	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	-	199172	199172	c2ba4328-d217-4343-a959-874cf5addce4	-1.71	-121.23	-119.52	1	1	CAGAACGCCAG
-tig00000001	-	199193	199193	c2ba4328-d217-4343-a959-874cf5addce4	0.52	-102.33	-102.85	1	1	CAGAACGGAGA
-tig00000001	-	199204	199228	c2ba4328-d217-4343-a959-874cf5addce4	-15.36	-204.39	-189.03	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	-	199240	199255	c2ba4328-d217-4343-a959-874cf5addce4	-25.48	-183.91	-158.43	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	-	199267	199267	c2ba4328-d217-4343-a959-874cf5addce4	-3.19	-92.76	-89.57	1	1	CACTTCGCTAA
-tig00000001	-	199280	199280	c2ba4328-d217-4343-a959-874cf5addce4	-2.62	-99.14	-96.52	1	1	CCATGCGGGCC
-tig00000001	-	199300	199336	c2ba4328-d217-4343-a959-874cf5addce4	-39.47	-312.76	-273.30	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	-	199352	199355	c2ba4328-d217-4343-a959-874cf5addce4	-2.92	-101.98	-99.06	1	2	ACCAGCGTCGGGGT
-tig00000001	-	199393	199402	c2ba4328-d217-4343-a959-874cf5addce4	-25.93	-170.09	-144.16	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	-	199423	199430	c2ba4328-d217-4343-a959-874cf5addce4	-14.13	-159.64	-145.51	1	2	TATTCCGGTGTACGACCA
-tig00000001	-	199446	199446	c2ba4328-d217-4343-a959-874cf5addce4	-8.84	-174.30	-165.47	1	1	CAGCCCGGCAA
-tig00000001	-	199459	199459	c2ba4328-d217-4343-a959-874cf5addce4	-2.01	-151.54	-149.53	1	1	AACACCGCCAG
-tig00000001	-	199485	199485	c2ba4328-d217-4343-a959-874cf5addce4	2.44	-97.78	-100.21	1	1	CATGCCGTAAA
-tig00000001	-	199500	199509	c2ba4328-d217-4343-a959-874cf5addce4	-14.63	-156.71	-142.08	1	3	AGAACCGACACCGCCGAACA
-tig00000001	-	199543	199543	c2ba4328-d217-4343-a959-874cf5addce4	-2.64	-142.31	-139.68	1	1	CACATCGGCAC
-tig00000001	-	199557	199570	c2ba4328-d217-4343-a959-874cf5addce4	-16.47	-230.88	-214.41	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	-	199582	199593	c2ba4328-d217-4343-a959-874cf5addce4	-19.73	-193.30	-173.56	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	-	199606	199621	c2ba4328-d217-4343-a959-874cf5addce4	-15.20	-236.28	-221.08	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	-	199644	199652	c2ba4328-d217-4343-a959-874cf5addce4	-28.22	-197.21	-168.99	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	-	199687	199687	c2ba4328-d217-4343-a959-874cf5addce4	-6.15	-126.89	-120.73	1	1	CTGTCCGTGCC
-tig00000001	-	199740	199746	c2ba4328-d217-4343-a959-874cf5addce4	-11.45	-175.37	-163.91	1	2	CACCACGCCTACGCAGA
-tig00000001	-	199770	199770	c2ba4328-d217-4343-a959-874cf5addce4	-3.86	-137.92	-134.06	1	1	GACATCGCCCA
-tig00000001	-	199786	199802	c2ba4328-d217-4343-a959-874cf5addce4	-21.59	-235.83	-214.25	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	-	199833	199836	c2ba4328-d217-4343-a959-874cf5addce4	-9.10	-126.84	-117.73	1	2	CACAGCGCCGTTGG
-tig00000001	-	199854	199854	c2ba4328-d217-4343-a959-874cf5addce4	-1.08	-85.00	-83.92	1	1	AAGATCGCCAG
-tig00000001	-	199868	199868	c2ba4328-d217-4343-a959-874cf5addce4	-7.31	-110.22	-102.92	1	1	CTGCACGAAGT
-tig00000001	-	199883	199883	c2ba4328-d217-4343-a959-874cf5addce4	-5.32	-118.24	-112.92	1	1	CAGTGCGGTTG
-tig00000001	-	199899	199908	c2ba4328-d217-4343-a959-874cf5addce4	-0.42	-142.68	-142.27	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	-	199931	199943	c2ba4328-d217-4343-a959-874cf5addce4	-15.87	-207.05	-191.18	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	-	199956	199956	c2ba4328-d217-4343-a959-874cf5addce4	-4.07	-114.57	-110.50	1	1	TTGATCGCTTC
-tig00000001	-	199998	199998	c2ba4328-d217-4343-a959-874cf5addce4	-5.98	-113.17	-107.20	1	1	TGTTGCGCTCC
 tig00000001	-	200009	200009	c2ba4328-d217-4343-a959-874cf5addce4	-1.13	-128.47	-127.34	1	1	TTCAACGGTAT
 tig00000001	-	200046	200046	c2ba4328-d217-4343-a959-874cf5addce4	-4.58	-111.39	-106.80	1	1	TGCAGCGCACC
 tig00000001	-	200081	200081	c2ba4328-d217-4343-a959-874cf5addce4	0.65	-84.47	-85.12	1	1	AACAACGCCAC
@@ -2735,184 +307,6 @@
 tig00000001	-	201922	201930	c2ba4328-d217-4343-a959-874cf5addce4	-4.74	-153.32	-148.58	1	2	GTCACCGGCTGGCCGCACT
 tig00000001	-	201944	201950	c2ba4328-d217-4343-a959-874cf5addce4	-5.01	-138.89	-133.88	1	2	GCAGGCGCTGCCGGAAG
 tig00000001	-	201961	201986	c2ba4328-d217-4343-a959-874cf5addce4	-8.66	-273.63	-264.97	1	4	AACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAA
-tig00000001	-	201998	202007	c2ba4328-d217-4343-a959-874cf5addce4	-1.44	-144.80	-143.36	1	2	CAGTCCGCAGGGGCCGTGGT
-tig00000001	-	202020	202020	c2ba4328-d217-4343-a959-874cf5addce4	2.68	-102.95	-105.62	1	1	CTGCTCGGCTG
-tig00000001	-	202033	202046	c2ba4328-d217-4343-a959-874cf5addce4	-2.73	-179.19	-176.45	1	3	GTGAGCGGGTGCCGGAAGCGGATG
-tig00000001	-	202064	202081	c2ba4328-d217-4343-a959-874cf5addce4	-21.70	-229.41	-207.70	1	5	GCCTGCGCCGCTGCCGCCGTACCGGGTA
-tig00000001	-	202092	202092	c2ba4328-d217-4343-a959-874cf5addce4	0.79	-123.97	-124.76	1	1	CTGACCGGGCT
-tig00000001	-	202105	202143	c2ba4328-d217-4343-a959-874cf5addce4	-34.13	-270.90	-236.77	1	8	TGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGA
-tig00000001	-	195175	195206	77635ef8-3824-401c-8442-7fdec33235a8	-12.71	-291.96	-279.25	1	7	AAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTG
-tig00000001	-	195222	195224	77635ef8-3824-401c-8442-7fdec33235a8	-3.07	-95.49	-92.42	1	2	TCAAGCGCGACCA
-tig00000001	-	195239	195264	77635ef8-3824-401c-8442-7fdec33235a8	-7.80	-191.50	-183.71	1	6	CTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCA
-tig00000001	-	195275	195313	77635ef8-3824-401c-8442-7fdec33235a8	-14.57	-280.81	-266.24	1	9	GCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAA
-tig00000001	-	195328	195328	77635ef8-3824-401c-8442-7fdec33235a8	-2.81	-125.88	-123.06	1	1	CTTGCCGAGAT
-tig00000001	-	195342	195359	77635ef8-3824-401c-8442-7fdec33235a8	-4.22	-157.17	-152.95	1	3	GTTCACGGGCATAACGCACTACCGCTTT
-tig00000001	-	195371	195371	77635ef8-3824-401c-8442-7fdec33235a8	-0.16	-73.79	-73.63	1	1	TCTTCCGCTGG
-tig00000001	-	195392	195400	77635ef8-3824-401c-8442-7fdec33235a8	-1.51	-140.44	-138.93	1	3	GTTGCCGTCTCCGCGCCCA
-tig00000001	-	195413	195427	77635ef8-3824-401c-8442-7fdec33235a8	-5.75	-166.99	-161.24	1	3	TCCTGCGCCAGACGTAAGGCGCTGA
-tig00000001	-	195441	195460	77635ef8-3824-401c-8442-7fdec33235a8	-7.30	-178.54	-171.24	1	4	TTGCCCGACGTTTTTTCCGGTAAGCGGTGC
-tig00000001	-	195489	195500	77635ef8-3824-401c-8442-7fdec33235a8	-6.79	-132.49	-125.69	1	3	TACACCGCGTGCCAGACGCTAC
-tig00000001	-	195511	195535	77635ef8-3824-401c-8442-7fdec33235a8	-11.91	-223.05	-211.14	1	7	CCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACC
-tig00000001	-	195547	195553	77635ef8-3824-401c-8442-7fdec33235a8	-5.48	-117.36	-111.88	1	2	GTTTTCGCTGCCGGTGT
-tig00000001	-	195565	195565	77635ef8-3824-401c-8442-7fdec33235a8	-0.95	-87.78	-86.83	1	1	ATGGCCGATGC
-tig00000001	-	195581	195590	77635ef8-3824-401c-8442-7fdec33235a8	-5.35	-148.42	-143.07	1	5	AGGATCGCGTCGCGCGTGTG
-tig00000001	-	195608	195608	77635ef8-3824-401c-8442-7fdec33235a8	-1.41	-126.01	-124.60	1	1	CTCTTCGCCAG
-tig00000001	-	195621	195630	77635ef8-3824-401c-8442-7fdec33235a8	-9.59	-180.05	-170.46	1	3	TGCCCCGCCAGGCGCGCATT
-tig00000001	-	195646	195663	77635ef8-3824-401c-8442-7fdec33235a8	-7.88	-179.18	-171.30	1	5	ATCAACGCGATCGGCAGTACGGCGCAGT
-tig00000001	-	195676	195685	77635ef8-3824-401c-8442-7fdec33235a8	-1.93	-257.48	-255.55	1	3	CAGTTCGCGCAGGGCGATCA
-tig00000001	-	195702	195702	77635ef8-3824-401c-8442-7fdec33235a8	-1.19	-116.25	-115.06	1	1	CTTTGCGGAAA
-tig00000001	-	195720	195735	77635ef8-3824-401c-8442-7fdec33235a8	-3.27	-149.86	-146.59	1	4	AATGGCGCGCTCCGCCTGCCCGGCAA
-tig00000001	-	195764	195781	77635ef8-3824-401c-8442-7fdec33235a8	-4.69	-151.12	-146.44	1	4	TCAGCCGCTGGCGCAGATCGTCCGGGGC
-tig00000001	-	195803	195842	77635ef8-3824-401c-8442-7fdec33235a8	-6.62	-302.21	-295.60	1	8	CACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACC
-tig00000001	-	195855	195864	77635ef8-3824-401c-8442-7fdec33235a8	2.38	-145.92	-148.29	1	3	AATTCCGGTGACGCCGCTGA
-tig00000001	-	195900	195906	77635ef8-3824-401c-8442-7fdec33235a8	-3.13	-133.95	-130.82	1	2	CTGAACGTTGACGGTAG
-tig00000001	-	195945	195945	77635ef8-3824-401c-8442-7fdec33235a8	-2.54	-90.79	-88.25	1	1	TTCTTCGATAT
-tig00000001	-	195959	195959	77635ef8-3824-401c-8442-7fdec33235a8	-2.17	-107.09	-104.93	1	1	GCCAGCGTTTG
-tig00000001	-	195971	195971	77635ef8-3824-401c-8442-7fdec33235a8	0.24	-115.85	-116.10	1	1	GATGACGGGAA
-tig00000001	-	195982	195982	77635ef8-3824-401c-8442-7fdec33235a8	0.24	-97.87	-98.10	1	1	CCTGGCGCATT
-tig00000001	-	195994	196002	77635ef8-3824-401c-8442-7fdec33235a8	0.87	-132.38	-133.25	1	2	CTGTGCGCCAGTTCGTCCA
-tig00000001	-	196018	196044	77635ef8-3824-401c-8442-7fdec33235a8	-11.73	-224.19	-212.46	1	7	ATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGAT
-tig00000001	-	196056	196056	77635ef8-3824-401c-8442-7fdec33235a8	-0.58	-109.46	-108.88	1	1	AAACTCGCTGA
-tig00000001	-	196067	196093	77635ef8-3824-401c-8442-7fdec33235a8	-13.90	-218.49	-204.59	1	5	TATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAG
-tig00000001	-	196122	196125	77635ef8-3824-401c-8442-7fdec33235a8	-8.19	-144.66	-136.47	1	2	CATGGCGGCGGTAT
-tig00000001	-	196136	196140	77635ef8-3824-401c-8442-7fdec33235a8	-1.17	-158.60	-157.44	1	2	CTTTTCGCCCGTGGG
-tig00000001	-	196155	196155	77635ef8-3824-401c-8442-7fdec33235a8	-2.43	-146.36	-143.93	1	1	TACCACGCCAA
-tig00000001	-	196180	196190	77635ef8-3824-401c-8442-7fdec33235a8	-3.48	-121.48	-118.00	1	3	CCTTGCGCCCGCAGTCGCTGG
-tig00000001	-	196210	196210	77635ef8-3824-401c-8442-7fdec33235a8	0.14	-88.08	-88.22	1	1	AGCATCGCCCA
-tig00000001	-	196224	196227	77635ef8-3824-401c-8442-7fdec33235a8	-3.21	-110.57	-107.36	1	2	CTTCCCGACGCCTG
-tig00000001	-	196242	196242	77635ef8-3824-401c-8442-7fdec33235a8	-0.23	-111.37	-111.14	1	1	GGCACCGAAGA
-tig00000001	-	196264	196274	77635ef8-3824-401c-8442-7fdec33235a8	-4.69	-104.67	-99.98	1	4	TTCCCCGATGCGGCGCGGCAG
-tig00000001	-	196294	196319	77635ef8-3824-401c-8442-7fdec33235a8	-7.53	-246.83	-239.30	1	5	GCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
-tig00000001	-	196342	196342	77635ef8-3824-401c-8442-7fdec33235a8	-1.11	-111.47	-110.36	1	1	TCCAGCGCCAG
-tig00000001	-	196372	196380	77635ef8-3824-401c-8442-7fdec33235a8	0.35	-124.75	-125.10	1	2	ACAACCGGCTGGCCGATAT
-tig00000001	-	196396	196396	77635ef8-3824-401c-8442-7fdec33235a8	-2.85	-79.47	-76.62	1	1	ACCAGCGGTTG
-tig00000001	-	196416	196426	77635ef8-3824-401c-8442-7fdec33235a8	-3.82	-144.93	-141.11	1	2	TTTTGCGATCAGTTGCGTGAG
-tig00000001	-	196440	196440	77635ef8-3824-401c-8442-7fdec33235a8	-0.56	-112.59	-112.04	1	1	TTCAACGCTGA
-tig00000001	-	196451	196466	77635ef8-3824-401c-8442-7fdec33235a8	-5.62	-152.88	-147.26	1	5	GATTACGCGCTTTCGCCACGCGTGGG
-tig00000001	-	196483	196492	77635ef8-3824-401c-8442-7fdec33235a8	-11.00	-147.18	-136.18	1	3	CAGGCCGCCGCTTGCGGGTG
-tig00000001	-	196514	196527	77635ef8-3824-401c-8442-7fdec33235a8	-1.27	-151.27	-150.01	1	3	CAGCCCGCTTGCCGATGCCGTCAC
-tig00000001	-	196542	196576	77635ef8-3824-401c-8442-7fdec33235a8	-13.59	-275.73	-262.14	1	7	TCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAAT
-tig00000001	-	196589	196595	77635ef8-3824-401c-8442-7fdec33235a8	-3.72	-132.75	-129.03	1	3	AGCAACGCGTGCGGCTA
-tig00000001	-	196629	196629	77635ef8-3824-401c-8442-7fdec33235a8	0.43	-104.88	-105.31	1	1	CTGACCGCCAG
-tig00000001	-	196643	196643	77635ef8-3824-401c-8442-7fdec33235a8	-1.29	-104.72	-103.43	1	1	GCTCCCGCCAG
-tig00000001	-	196677	196690	77635ef8-3824-401c-8442-7fdec33235a8	1.05	-141.93	-142.98	1	4	TCTGCCGTTGCCGACGGGCGACCA
-tig00000001	-	196706	196712	77635ef8-3824-401c-8442-7fdec33235a8	-2.88	-153.94	-151.07	1	2	ATAGCCGTTGCCGGTAA
-tig00000001	-	196727	196749	77635ef8-3824-401c-8442-7fdec33235a8	-15.31	-260.03	-244.72	1	5	CTGCCCGATTAATGCCGAACCGCGCACCGTATC
-tig00000001	-	196762	196770	77635ef8-3824-401c-8442-7fdec33235a8	0.04	-135.75	-135.80	1	2	CTTCACGAATCAACGAACC
-tig00000001	-	196810	196810	77635ef8-3824-401c-8442-7fdec33235a8	-4.50	-112.76	-108.25	1	1	CAGTACGGTGG
-tig00000001	-	196823	196834	77635ef8-3824-401c-8442-7fdec33235a8	-2.75	-144.60	-141.86	1	3	AGCAGCGGGTAAACGCCGCCAG
-tig00000001	-	196874	196878	77635ef8-3824-401c-8442-7fdec33235a8	-1.42	-93.30	-91.89	1	2	AATGCCGGACGTAAT
-tig00000001	-	196909	196915	77635ef8-3824-401c-8442-7fdec33235a8	-4.27	-147.14	-142.87	1	2	CAGACCGCAAACGGTCA
-tig00000001	-	196945	196952	77635ef8-3824-401c-8442-7fdec33235a8	-4.90	-133.88	-128.98	1	2	GATACCGATAAACGGCAC
-tig00000001	-	196975	196975	77635ef8-3824-401c-8442-7fdec33235a8	-2.58	-112.11	-109.53	1	1	CAGACCGTAAA
-tig00000001	-	196992	196995	77635ef8-3824-401c-8442-7fdec33235a8	-4.11	-117.10	-112.99	1	2	AGTTACGGCGCAAC
-tig00000001	-	197011	197018	77635ef8-3824-401c-8442-7fdec33235a8	-2.51	-133.93	-131.42	1	2	AGAAGCGGTAAGCGGTTT
-tig00000001	-	197032	197041	77635ef8-3824-401c-8442-7fdec33235a8	0.60	-119.92	-120.52	1	2	ACTCACGCCTTTAACGCCAG
-tig00000001	-	197059	197059	77635ef8-3824-401c-8442-7fdec33235a8	-1.38	-132.69	-131.31	1	1	AAAGACGATAA
-tig00000001	-	197071	197071	77635ef8-3824-401c-8442-7fdec33235a8	-1.75	-102.88	-101.14	1	1	CAAGGCGTTGA
-tig00000001	-	197084	197084	77635ef8-3824-401c-8442-7fdec33235a8	-0.20	-86.16	-85.96	1	1	ATCACCGCACT
-tig00000001	-	197098	197108	77635ef8-3824-401c-8442-7fdec33235a8	0.52	-135.49	-136.01	1	3	GATTGCGGAGTCGGGCGAATG
-tig00000001	-	197132	197132	77635ef8-3824-401c-8442-7fdec33235a8	-1.85	-100.18	-98.33	1	1	TTCAGCGCATT
-tig00000001	-	197144	197168	77635ef8-3824-401c-8442-7fdec33235a8	-11.29	-262.58	-251.29	1	6	AACTGCGGATACGTTGCCGCGAATGCCGCCGGAAT
-tig00000001	-	197179	197197	77635ef8-3824-401c-8442-7fdec33235a8	-5.26	-202.39	-197.13	1	3	AATGGCGAAGTATTTCGCCACATCGTTGG
-tig00000001	-	197222	197229	77635ef8-3824-401c-8442-7fdec33235a8	-6.63	-149.09	-142.46	1	2	GTCAGCGAGCCACGGGTC
-tig00000001	-	197266	197266	77635ef8-3824-401c-8442-7fdec33235a8	-1.73	-100.68	-98.95	1	1	CACCTCGATCA
-tig00000001	-	197279	197279	77635ef8-3824-401c-8442-7fdec33235a8	-2.31	-120.88	-118.57	1	1	TTGGTCGGGTT
-tig00000001	-	197290	197296	77635ef8-3824-401c-8442-7fdec33235a8	-1.48	-122.08	-120.59	1	2	AGAGTCGAGATCGACCA
-tig00000001	-	197309	197321	77635ef8-3824-401c-8442-7fdec33235a8	-11.35	-205.28	-193.93	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	-	197332	197350	77635ef8-3824-401c-8442-7fdec33235a8	-6.40	-201.04	-194.64	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	-	197363	197420	77635ef8-3824-401c-8442-7fdec33235a8	-13.45	-387.46	-374.00	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	-	197433	197433	77635ef8-3824-401c-8442-7fdec33235a8	-0.51	-100.99	-100.47	1	1	ACTGACGGATC
-tig00000001	-	197456	197470	77635ef8-3824-401c-8442-7fdec33235a8	-9.56	-159.77	-150.21	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	-	197482	197509	77635ef8-3824-401c-8442-7fdec33235a8	-14.44	-215.78	-201.34	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	-	197520	197530	77635ef8-3824-401c-8442-7fdec33235a8	-1.35	-128.84	-127.49	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	-	197543	197543	77635ef8-3824-401c-8442-7fdec33235a8	-2.84	-88.92	-86.08	1	1	ATCACCGTTTT
-tig00000001	-	197562	197577	77635ef8-3824-401c-8442-7fdec33235a8	-5.11	-166.71	-161.60	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	-	197590	197599	77635ef8-3824-401c-8442-7fdec33235a8	-2.01	-135.81	-133.80	1	2	AATACCGCCTTTGACGATAT
-tig00000001	-	197612	197620	77635ef8-3824-401c-8442-7fdec33235a8	-6.07	-175.04	-168.97	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	-	197631	197631	77635ef8-3824-401c-8442-7fdec33235a8	-4.78	-143.85	-139.06	1	1	GCACACGAGAA
-tig00000001	-	197654	197657	77635ef8-3824-401c-8442-7fdec33235a8	-9.04	-97.84	-88.80	1	2	ACCAGCGGCGTGGC
-tig00000001	-	197670	197672	77635ef8-3824-401c-8442-7fdec33235a8	-3.42	-123.82	-120.40	1	2	CCTGACGCGCAAC
-tig00000001	-	197683	197683	77635ef8-3824-401c-8442-7fdec33235a8	-1.26	-100.32	-99.07	1	1	CTGATCGACTT
-tig00000001	-	197701	197701	77635ef8-3824-401c-8442-7fdec33235a8	-3.33	-84.97	-81.64	1	1	AACATCGGTAG
-tig00000001	-	197719	197719	77635ef8-3824-401c-8442-7fdec33235a8	1.63	-102.41	-104.04	1	1	ACCACCGTTAG
-tig00000001	-	197736	197749	77635ef8-3824-401c-8442-7fdec33235a8	-5.44	-195.68	-190.24	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	-	197763	197779	77635ef8-3824-401c-8442-7fdec33235a8	-4.15	-164.29	-160.14	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	-	197791	197816	77635ef8-3824-401c-8442-7fdec33235a8	-8.79	-173.72	-164.93	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	-	197837	197837	77635ef8-3824-401c-8442-7fdec33235a8	-3.12	-158.69	-155.56	1	1	TGGAGCGACTG
-tig00000001	-	197848	197856	77635ef8-3824-401c-8442-7fdec33235a8	-3.01	-131.07	-128.07	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	-	197868	197878	77635ef8-3824-401c-8442-7fdec33235a8	-7.41	-182.67	-175.26	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	-	197895	197906	77635ef8-3824-401c-8442-7fdec33235a8	-13.74	-144.34	-130.59	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	-	197921	197921	77635ef8-3824-401c-8442-7fdec33235a8	-2.52	-140.12	-137.60	1	1	GCCAGCGAAGC
-tig00000001	-	197935	197948	77635ef8-3824-401c-8442-7fdec33235a8	-6.80	-186.74	-179.94	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	-	197960	197969	77635ef8-3824-401c-8442-7fdec33235a8	-3.56	-151.15	-147.59	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	-	197982	197999	77635ef8-3824-401c-8442-7fdec33235a8	1.66	-188.68	-190.33	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	-	198014	198014	77635ef8-3824-401c-8442-7fdec33235a8	-3.16	-104.80	-101.64	1	1	GGTGCCGGTTT
-tig00000001	-	198035	198051	77635ef8-3824-401c-8442-7fdec33235a8	0.41	-226.00	-226.41	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	-	198064	198068	77635ef8-3824-401c-8442-7fdec33235a8	-0.05	-173.74	-173.69	1	2	CTGCACGTCCGCTGG
-tig00000001	-	198087	198089	77635ef8-3824-401c-8442-7fdec33235a8	-0.39	-115.60	-115.21	1	2	ACATTCGCGCCTA
-tig00000001	-	198100	198123	77635ef8-3824-401c-8442-7fdec33235a8	-3.16	-294.89	-291.73	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	-	198137	198137	77635ef8-3824-401c-8442-7fdec33235a8	1.38	-106.71	-108.09	1	1	CAGGCCGCCAA
-tig00000001	-	198171	198171	77635ef8-3824-401c-8442-7fdec33235a8	0.23	-137.53	-137.76	1	1	AGCAGCGCCAC
-tig00000001	-	198183	198188	77635ef8-3824-401c-8442-7fdec33235a8	-3.18	-153.27	-150.09	1	2	AGTACCGTTACGCTGA
-tig00000001	-	198203	198233	77635ef8-3824-401c-8442-7fdec33235a8	-5.74	-261.02	-255.28	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	-	198250	198250	77635ef8-3824-401c-8442-7fdec33235a8	-0.83	-108.16	-107.34	1	1	AAAGACGATAG
-tig00000001	-	198289	198313	77635ef8-3824-401c-8442-7fdec33235a8	-9.73	-182.82	-173.09	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	-	198326	198336	77635ef8-3824-401c-8442-7fdec33235a8	-4.76	-173.28	-168.52	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	-	198352	198364	77635ef8-3824-401c-8442-7fdec33235a8	-3.42	-203.38	-199.96	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	-	198399	198415	77635ef8-3824-401c-8442-7fdec33235a8	-10.25	-211.12	-200.88	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	-	198427	198485	77635ef8-3824-401c-8442-7fdec33235a8	-17.18	-348.95	-331.77	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	-	198513	198513	77635ef8-3824-401c-8442-7fdec33235a8	6.31	-79.52	-85.83	1	1	ACCATCGCAGG
-tig00000001	-	198527	198527	77635ef8-3824-401c-8442-7fdec33235a8	1.70	-79.15	-80.85	1	1	AATATCGCCAG
-tig00000001	-	198545	198569	77635ef8-3824-401c-8442-7fdec33235a8	-1.61	-189.59	-187.98	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	-	198585	198619	77635ef8-3824-401c-8442-7fdec33235a8	-11.91	-293.16	-281.24	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	-	198660	198670	77635ef8-3824-401c-8442-7fdec33235a8	-5.04	-146.39	-141.35	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	-	198684	198710	77635ef8-3824-401c-8442-7fdec33235a8	-17.30	-246.04	-228.74	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	-	198728	198782	77635ef8-3824-401c-8442-7fdec33235a8	-9.25	-414.60	-405.35	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	-	198812	198821	77635ef8-3824-401c-8442-7fdec33235a8	0.55	-155.18	-155.73	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	-	198834	198855	77635ef8-3824-401c-8442-7fdec33235a8	-24.77	-267.23	-242.46	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	-	198872	198872	77635ef8-3824-401c-8442-7fdec33235a8	-1.27	-106.90	-105.63	1	1	TTCACCGCTTC
-tig00000001	-	198884	198892	77635ef8-3824-401c-8442-7fdec33235a8	-5.17	-232.47	-227.30	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	-	198907	198914	77635ef8-3824-401c-8442-7fdec33235a8	1.27	-170.17	-171.44	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	-	198927	198927	77635ef8-3824-401c-8442-7fdec33235a8	-1.13	-136.54	-135.41	1	1	GTTTACGACTC
-tig00000001	-	198972	198987	77635ef8-3824-401c-8442-7fdec33235a8	-3.87	-207.54	-203.67	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	-	199013	199013	77635ef8-3824-401c-8442-7fdec33235a8	1.68	-121.35	-123.02	1	1	CAGTGCGCCAA
-tig00000001	-	199028	199034	77635ef8-3824-401c-8442-7fdec33235a8	-8.91	-146.74	-137.83	1	2	CAACACGGTGCCGATTA
-tig00000001	-	199056	199088	77635ef8-3824-401c-8442-7fdec33235a8	-18.95	-250.46	-231.51	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	-	199112	199117	77635ef8-3824-401c-8442-7fdec33235a8	-3.65	-133.98	-130.33	1	2	ACCAGCGAACCGGCAA
-tig00000001	-	199133	199133	77635ef8-3824-401c-8442-7fdec33235a8	1.73	-138.55	-140.28	1	1	ATCACCGGGAT
-tig00000001	-	199147	199156	77635ef8-3824-401c-8442-7fdec33235a8	-3.95	-184.65	-180.71	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	-	199172	199172	77635ef8-3824-401c-8442-7fdec33235a8	-1.40	-90.76	-89.36	1	1	CAGAACGCCAG
-tig00000001	-	199193	199193	77635ef8-3824-401c-8442-7fdec33235a8	0.43	-104.67	-105.10	1	1	CAGAACGGAGA
-tig00000001	-	199204	199228	77635ef8-3824-401c-8442-7fdec33235a8	-12.37	-201.72	-189.35	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	-	199240	199255	77635ef8-3824-401c-8442-7fdec33235a8	-14.33	-166.98	-152.66	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	-	199267	199267	77635ef8-3824-401c-8442-7fdec33235a8	-1.49	-98.84	-97.35	1	1	CACTTCGCTAA
-tig00000001	-	199280	199280	77635ef8-3824-401c-8442-7fdec33235a8	-1.91	-115.72	-113.81	1	1	CCATGCGGGCC
-tig00000001	-	199300	199336	77635ef8-3824-401c-8442-7fdec33235a8	-13.80	-302.57	-288.77	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	-	199352	199355	77635ef8-3824-401c-8442-7fdec33235a8	-3.68	-106.74	-103.06	1	2	ACCAGCGTCGGGGT
-tig00000001	-	199393	199402	77635ef8-3824-401c-8442-7fdec33235a8	-7.42	-193.41	-185.99	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	-	199423	199430	77635ef8-3824-401c-8442-7fdec33235a8	0.06	-121.09	-121.14	1	2	TATTCCGGTGTACGACCA
-tig00000001	-	199446	199446	77635ef8-3824-401c-8442-7fdec33235a8	0.58	-99.77	-100.35	1	1	CAGCCCGGCAA
-tig00000001	-	199459	199459	77635ef8-3824-401c-8442-7fdec33235a8	-0.14	-111.45	-111.31	1	1	AACACCGCCAG
-tig00000001	-	199485	199485	77635ef8-3824-401c-8442-7fdec33235a8	-0.86	-84.08	-83.22	1	1	CATGCCGTAAA
-tig00000001	-	199500	199509	77635ef8-3824-401c-8442-7fdec33235a8	-1.32	-152.47	-151.15	1	3	AGAACCGACACCGCCGAACA
-tig00000001	-	199543	199543	77635ef8-3824-401c-8442-7fdec33235a8	-2.44	-100.34	-97.90	1	1	CACATCGGCAC
-tig00000001	-	199557	199570	77635ef8-3824-401c-8442-7fdec33235a8	-0.43	-167.36	-166.92	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	-	199582	199593	77635ef8-3824-401c-8442-7fdec33235a8	-6.66	-158.65	-151.99	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	-	199606	199621	77635ef8-3824-401c-8442-7fdec33235a8	-5.62	-168.16	-162.55	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	-	199644	199652	77635ef8-3824-401c-8442-7fdec33235a8	-2.58	-169.47	-166.88	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	-	199687	199687	77635ef8-3824-401c-8442-7fdec33235a8	-3.23	-121.67	-118.44	1	1	CTGTCCGTGCC
-tig00000001	-	199740	199746	77635ef8-3824-401c-8442-7fdec33235a8	-3.90	-149.51	-145.61	1	2	CACCACGCCTACGCAGA
-tig00000001	-	199770	199770	77635ef8-3824-401c-8442-7fdec33235a8	-4.90	-121.47	-116.57	1	1	GACATCGCCCA
-tig00000001	-	199786	199802	77635ef8-3824-401c-8442-7fdec33235a8	-7.44	-235.91	-228.47	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	-	199833	199836	77635ef8-3824-401c-8442-7fdec33235a8	-1.59	-120.77	-119.18	1	2	CACAGCGCCGTTGG
-tig00000001	-	199854	199854	77635ef8-3824-401c-8442-7fdec33235a8	0.08	-126.17	-126.25	1	1	AAGATCGCCAG
-tig00000001	-	199868	199868	77635ef8-3824-401c-8442-7fdec33235a8	-1.48	-116.05	-114.57	1	1	CTGCACGAAGT
-tig00000001	-	199883	199883	77635ef8-3824-401c-8442-7fdec33235a8	-0.26	-102.25	-102.00	1	1	CAGTGCGGTTG
-tig00000001	-	199899	199908	77635ef8-3824-401c-8442-7fdec33235a8	1.38	-151.04	-152.41	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	-	199931	199943	77635ef8-3824-401c-8442-7fdec33235a8	-7.81	-176.40	-168.60	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	-	199956	199956	77635ef8-3824-401c-8442-7fdec33235a8	-1.34	-116.35	-115.01	1	1	TTGATCGCTTC
-tig00000001	-	199998	199998	77635ef8-3824-401c-8442-7fdec33235a8	-5.71	-99.98	-94.27	1	1	TGTTGCGCTCC
 tig00000001	-	200009	200009	77635ef8-3824-401c-8442-7fdec33235a8	0.81	-95.14	-95.95	1	1	TTCAACGGTAT
 tig00000001	-	200046	200046	77635ef8-3824-401c-8442-7fdec33235a8	-2.65	-94.10	-91.45	1	1	TGCAGCGCACC
 tig00000001	-	200081	200081	77635ef8-3824-401c-8442-7fdec33235a8	-0.43	-189.42	-189.00	1	1	AACAACGCCAC
@@ -2968,238 +362,6 @@
 tig00000001	-	201922	201930	77635ef8-3824-401c-8442-7fdec33235a8	-5.07	-131.20	-126.12	1	2	GTCACCGGCTGGCCGCACT
 tig00000001	-	201944	201950	77635ef8-3824-401c-8442-7fdec33235a8	-1.79	-127.05	-125.25	1	2	GCAGGCGCTGCCGGAAG
 tig00000001	-	201961	201986	77635ef8-3824-401c-8442-7fdec33235a8	-0.17	-232.58	-232.41	1	4	AACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAA
-tig00000001	-	201998	202007	77635ef8-3824-401c-8442-7fdec33235a8	-2.74	-132.32	-129.59	1	2	CAGTCCGCAGGGGCCGTGGT
-tig00000001	-	202020	202020	77635ef8-3824-401c-8442-7fdec33235a8	-1.57	-96.46	-94.89	1	1	CTGCTCGGCTG
-tig00000001	-	202033	202046	77635ef8-3824-401c-8442-7fdec33235a8	-6.09	-142.86	-136.76	1	3	GTGAGCGGGTGCCGGAAGCGGATG
-tig00000001	-	202064	202081	77635ef8-3824-401c-8442-7fdec33235a8	-13.01	-186.40	-173.39	1	5	GCCTGCGCCGCTGCCGCCGTACCGGGTA
-tig00000001	-	202092	202092	77635ef8-3824-401c-8442-7fdec33235a8	0.39	-121.84	-122.23	1	1	CTGACCGGGCT
-tig00000001	-	202105	202143	77635ef8-3824-401c-8442-7fdec33235a8	-15.55	-322.10	-306.55	1	8	TGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGA
-tig00000001	-	202155	202198	77635ef8-3824-401c-8442-7fdec33235a8	-3.75	-290.02	-286.27	1	8	TTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTG
-tig00000001	-	202214	202225	77635ef8-3824-401c-8442-7fdec33235a8	-5.30	-127.55	-122.26	1	3	GACCACGCAGGCGCAGCGGGCA
-tig00000001	-	202240	202240	77635ef8-3824-401c-8442-7fdec33235a8	1.01	-119.52	-120.53	1	1	AAGCCCGGCAG
-tig00000001	-	202257	202275	77635ef8-3824-401c-8442-7fdec33235a8	-7.76	-172.23	-164.47	1	5	ATTTCCGGCGGGACGGAACCGTCCGCTTT
-tig00000001	-	202295	202330	77635ef8-3824-401c-8442-7fdec33235a8	-10.69	-271.95	-261.26	1	5	CCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTG
-tig00000001	-	202341	202341	77635ef8-3824-401c-8442-7fdec33235a8	-2.38	-97.92	-95.53	1	1	TCTGCCGTGTG
-tig00000001	-	202352	202370	77635ef8-3824-401c-8442-7fdec33235a8	-3.31	-224.39	-221.07	1	4	GCTGACGCACGACCCGGAATACCCGGAGA
-tig00000001	-	202386	202399	77635ef8-3824-401c-8442-7fdec33235a8	-8.63	-153.30	-144.67	1	4	CCTGCCGCGCCGCTGGTGCGCTAT
-tig00000001	-	202412	202432	77635ef8-3824-401c-8442-7fdec33235a8	-14.56	-209.38	-194.81	1	6	CTGGACGCCCGCGGCGAACTGGCGGCGGTGT
-tig00000001	-	202443	202443	77635ef8-3824-401c-8442-7fdec33235a8	-0.72	-113.67	-112.95	1	1	ATGACCGCAGC
-tig00000001	-	202461	202461	77635ef8-3824-401c-8442-7fdec33235a8	-1.12	-110.39	-109.27	1	1	AGGTGCGCAGC
-tig00000001	-	202475	202475	77635ef8-3824-401c-8442-7fdec33235a8	-0.39	-98.74	-98.36	1	1	ACTTACGATGA
-tig00000001	-	202488	202525	77635ef8-3824-401c-8442-7fdec33235a8	-3.29	-299.46	-296.17	1	7	AATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAA
-tig00000001	-	202539	202557	77635ef8-3824-401c-8442-7fdec33235a8	-11.32	-245.24	-233.91	1	5	GTTACCGTTACGACAGCGACGGGCGGGTG
-tig00000001	-	202579	202579	77635ef8-3824-401c-8442-7fdec33235a8	-2.15	-101.43	-99.28	1	1	AAACCCGGCAG
-tig00000001	-	202597	202597	77635ef8-3824-401c-8442-7fdec33235a8	-3.13	-121.35	-118.23	1	1	TTACACGTATC
-tig00000001	-	202617	202617	77635ef8-3824-401c-8442-7fdec33235a8	-0.66	-114.50	-113.84	1	1	AGGACCGCATC
-tig00000001	-	202631	202631	77635ef8-3824-401c-8442-7fdec33235a8	0.32	-114.77	-115.08	1	1	ATCACCGACAG
-tig00000001	-	202644	202647	77635ef8-3824-401c-8442-7fdec33235a8	-5.01	-112.23	-107.22	1	2	TGAACCGCCGTGAA
-tig00000001	-	202663	202663	77635ef8-3824-401c-8442-7fdec33235a8	-3.17	-92.79	-89.61	1	1	GCACACGCAGG
-tig00000001	-	202676	202686	77635ef8-3824-401c-8442-7fdec33235a8	-1.81	-150.30	-148.49	1	2	GAAGGCGGGCTGAAGCGGGTG
-tig00000001	-	202705	202722	77635ef8-3824-401c-8442-7fdec33235a8	-6.91	-171.81	-164.90	1	5	GAACACGCGGACGGCAGCGTCACGCAGA
-tig00000001	-	202738	202740	77635ef8-3824-401c-8442-7fdec33235a8	-0.23	-130.78	-130.55	1	2	TTTGACGCGGTGG
-tig00000001	-	202764	202771	77635ef8-3824-401c-8442-7fdec33235a8	-3.76	-116.22	-112.46	1	2	ACAGACGGATGCCGCAGG
-tig00000001	-	202797	202797	77635ef8-3824-401c-8442-7fdec33235a8	-0.77	-91.29	-90.52	1	1	CAGTCCGGATG
-tig00000001	-	202809	202809	77635ef8-3824-401c-8442-7fdec33235a8	-1.35	-95.96	-94.61	1	1	GGTGACGGGCC
-tig00000001	-	202821	202836	77635ef8-3824-401c-8442-7fdec33235a8	-4.23	-233.60	-229.37	1	4	CATCACGCGCATCACCACGCCGGATG
-tig00000001	-	202851	202854	77635ef8-3824-401c-8442-7fdec33235a8	-1.06	-106.47	-105.40	1	2	GGCATCGGCGTTTT
-tig00000001	-	202884	202903	77635ef8-3824-401c-8442-7fdec33235a8	-1.16	-197.18	-196.02	1	3	GTTAACGTCAGCCACCGGGCCTGACGGGCT
-tig00000001	-	202916	202919	77635ef8-3824-401c-8442-7fdec33235a8	-6.82	-119.82	-113.00	1	2	AAATACGCCGGGAA
-tig00000001	-	202940	202940	77635ef8-3824-401c-8442-7fdec33235a8	-3.96	-100.15	-96.19	1	1	GGGGCCGTCTG
-tig00000001	-	202966	202985	77635ef8-3824-401c-8442-7fdec33235a8	1.26	-186.01	-187.27	1	4	CCTGACGGCGATATCACCCGCTACCGTTAT
-tig00000001	-	203017	203022	77635ef8-3824-401c-8442-7fdec33235a8	-1.42	-129.96	-128.54	1	2	CCCTGCGCAACGGAAG
-tig00000001	-	203035	203042	77635ef8-3824-401c-8442-7fdec33235a8	-5.65	-118.95	-113.30	1	2	GCCACCGGCAGCCGGAAA
-tig00000001	-	203055	203068	77635ef8-3824-401c-8442-7fdec33235a8	-2.98	-137.08	-134.10	1	3	CATGACGTGGAGCCGTTACGGTCA
-tig00000001	-	203098	203098	77635ef8-3824-401c-8442-7fdec33235a8	-0.32	-81.10	-80.78	1	1	TGTTCCGGTTA
-tig00000001	-	203111	203111	77635ef8-3824-401c-8442-7fdec33235a8	-1.20	-95.07	-93.87	1	1	TAACCCGCTAT
-tig00000001	-	203126	203126	77635ef8-3824-401c-8442-7fdec33235a8	-5.69	-96.58	-90.89	1	1	ATGACCGTTTT
-tig00000001	-	203142	203155	77635ef8-3824-401c-8442-7fdec33235a8	-1.94	-133.97	-132.03	1	4	GGTGACGGCGGTGCACCGCGAGGA
-tig00000001	-	203177	203192	77635ef8-3824-401c-8442-7fdec33235a8	-2.06	-140.16	-138.09	1	4	AGTACCGCGCATACGACAGCCGTGGA
-tig00000001	-	203209	203209	77635ef8-3824-401c-8442-7fdec33235a8	-1.82	-100.26	-98.44	1	1	ATTGCCGTGAA
-tig00000001	-	203220	203220	77635ef8-3824-401c-8442-7fdec33235a8	-0.55	-80.66	-80.12	1	1	AGACACGCAGG
-tig00000001	-	203235	203237	77635ef8-3824-401c-8442-7fdec33235a8	-1.96	-102.75	-100.79	1	2	TGAAACGCGGTAT
-tig00000001	-	203251	203257	77635ef8-3824-401c-8442-7fdec33235a8	-5.43	-138.02	-132.59	1	3	TACAACGCCGCCGGTGA
-tig00000001	-	203272	203272	77635ef8-3824-401c-8442-7fdec33235a8	1.83	-114.18	-116.01	1	1	ACCACCGTCAT
-tig00000001	-	203283	203287	77635ef8-3824-401c-8442-7fdec33235a8	2.79	-111.50	-114.28	1	2	TGCCCCGGACGGCAG
-tig00000001	-	203299	203299	77635ef8-3824-401c-8442-7fdec33235a8	0.31	-95.01	-95.32	1	1	AGAAACGGGAC
-tig00000001	-	203311	203316	77635ef8-3824-401c-8442-7fdec33235a8	-0.99	-117.12	-116.13	1	2	CAGTACGATGCGTGGG
-tig00000001	-	203340	203357	77635ef8-3824-401c-8442-7fdec33235a8	-8.07	-199.16	-191.09	1	4	TACCACGCAGGGCGGTCTGACGCGCAGT
-tig00000001	-	203371	203393	77635ef8-3824-401c-8442-7fdec33235a8	-0.40	-208.65	-208.26	1	4	GAATACGATGCTGCCGGACGGGTCATCCGCCTG
-tig00000001	-	203410	203410	77635ef8-3824-401c-8442-7fdec33235a8	0.87	-86.32	-87.19	1	1	GAAAACGGCAG
-tig00000001	-	203429	203447	77635ef8-3824-401c-8442-7fdec33235a8	-9.15	-216.91	-207.76	1	4	CCTTCCGTTACGATGTACTCGACCGGCTG
-tig00000001	-	203464	203486	77635ef8-3824-401c-8442-7fdec33235a8	-8.09	-203.26	-195.17	1	4	GAAACCGGCTTTGACGGCCGCACACAGCGTTAT
-tig00000001	-	203497	203506	77635ef8-3824-401c-8442-7fdec33235a8	-0.06	-146.71	-146.65	1	2	CACCACGACCTGACCGGCAA
-tig00000001	-	203519	203524	77635ef8-3824-401c-8442-7fdec33235a8	-4.99	-150.76	-145.76	1	2	TTATCCGCAGCGAGGA
-tig00000001	+	195222	195224	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-4.27	-103.35	-99.09	1	2	TCAAGCGCGACCA
-tig00000001	+	195239	195264	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-26.48	-314.03	-287.54	1	6	CTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCA
-tig00000001	+	195275	195313	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-35.36	-352.37	-317.00	1	9	GCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAA
-tig00000001	+	195328	195328	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	0.59	-108.39	-108.98	1	1	CTTGCCGAGAT
-tig00000001	+	195342	195359	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-21.65	-205.12	-183.47	1	3	GTTCACGGGCATAACGCACTACCGCTTT
-tig00000001	+	195371	195371	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-2.06	-89.95	-87.89	1	1	TCTTCCGCTGG
-tig00000001	+	195392	195400	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-5.52	-140.74	-135.22	1	3	GTTGCCGTCTCCGCGCCCA
-tig00000001	+	195413	195427	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-30.28	-253.16	-222.88	1	3	TCCTGCGCCAGACGTAAGGCGCTGA
-tig00000001	+	195441	195460	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-13.18	-210.86	-197.68	1	4	TTGCCCGACGTTTTTTCCGGTAAGCGGTGC
-tig00000001	+	195489	195500	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-12.00	-174.62	-162.62	1	3	TACACCGCGTGCCAGACGCTAC
-tig00000001	+	195511	195535	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-34.27	-244.00	-209.73	1	7	CCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACC
-tig00000001	+	195547	195553	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-10.92	-168.63	-157.72	1	2	GTTTTCGCTGCCGGTGT
-tig00000001	+	195565	195565	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-0.32	-144.72	-144.40	1	1	ATGGCCGATGC
-tig00000001	+	195581	195590	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-9.24	-147.70	-138.47	1	5	AGGATCGCGTCGCGCGTGTG
-tig00000001	+	195608	195608	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-0.02	-79.56	-79.54	1	1	CTCTTCGCCAG
-tig00000001	+	195621	195630	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-11.81	-131.21	-119.40	1	3	TGCCCCGCCAGGCGCGCATT
-tig00000001	+	195646	195663	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-16.40	-203.49	-187.09	1	5	ATCAACGCGATCGGCAGTACGGCGCAGT
-tig00000001	+	195676	195685	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-13.71	-164.88	-151.17	1	3	CAGTTCGCGCAGGGCGATCA
-tig00000001	+	195702	195702	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-1.61	-86.47	-84.86	1	1	CTTTGCGGAAA
-tig00000001	+	195720	195735	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-17.39	-211.68	-194.29	1	4	AATGGCGCGCTCCGCCTGCCCGGCAA
-tig00000001	+	195764	195781	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-14.76	-219.64	-204.87	1	4	TCAGCCGCTGGCGCAGATCGTCCGGGGC
-tig00000001	+	195803	195842	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-15.19	-332.25	-317.06	1	8	CACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACC
-tig00000001	+	195855	195864	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-15.21	-148.72	-133.50	1	3	AATTCCGGTGACGCCGCTGA
-tig00000001	+	195900	195906	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-11.73	-131.23	-119.50	1	2	CTGAACGTTGACGGTAG
-tig00000001	+	195945	195945	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-2.48	-95.74	-93.27	1	1	TTCTTCGATAT
-tig00000001	+	195959	195959	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-1.31	-123.69	-122.38	1	1	GCCAGCGTTTG
-tig00000001	+	195971	195971	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-1.80	-117.97	-116.18	1	1	GATGACGGGAA
-tig00000001	+	195982	195982	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-3.81	-103.47	-99.66	1	1	CCTGGCGCATT
-tig00000001	+	195994	196002	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-5.65	-168.79	-163.14	1	2	CTGTGCGCCAGTTCGTCCA
-tig00000001	+	196018	196044	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-44.83	-315.23	-270.40	1	7	ATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGAT
-tig00000001	+	196056	196056	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-8.31	-120.60	-112.29	1	1	AAACTCGCTGA
-tig00000001	+	196067	196093	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-23.71	-230.04	-206.33	1	5	TATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAG
-tig00000001	+	196122	196125	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-7.70	-144.68	-136.98	1	2	CATGGCGGCGGTAT
-tig00000001	+	196136	196140	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-6.00	-139.45	-133.45	1	2	CTTTTCGCCCGTGGG
-tig00000001	+	196155	196155	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-12.43	-104.83	-92.41	1	1	TACCACGCCAA
-tig00000001	+	196180	196190	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-22.04	-192.64	-170.60	1	3	CCTTGCGCCCGCAGTCGCTGG
-tig00000001	+	196210	196210	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-7.23	-109.80	-102.57	1	1	AGCATCGCCCA
-tig00000001	+	196224	196227	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-7.34	-130.65	-123.31	1	2	CTTCCCGACGCCTG
-tig00000001	+	196242	196242	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	4.43	-75.87	-80.30	1	1	GGCACCGAAGA
-tig00000001	+	196264	196274	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-11.99	-155.97	-143.98	1	4	TTCCCCGATGCGGCGCGGCAG
-tig00000001	+	196294	196319	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-34.44	-246.17	-211.73	1	5	GCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
-tig00000001	+	196342	196342	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-5.97	-125.29	-119.32	1	1	TCCAGCGCCAG
-tig00000001	+	196372	196380	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-7.80	-162.61	-154.81	1	2	ACAACCGGCTGGCCGATAT
-tig00000001	+	196396	196396	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	0.75	-112.41	-113.16	1	1	ACCAGCGGTTG
-tig00000001	+	196416	196426	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	1.53	-163.80	-165.33	1	2	TTTTGCGATCAGTTGCGTGAG
-tig00000001	+	196440	196440	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-1.48	-140.74	-139.26	1	1	TTCAACGCTGA
-tig00000001	+	196451	196466	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-29.11	-238.55	-209.44	1	5	GATTACGCGCTTTCGCCACGCGTGGG
-tig00000001	+	196483	196492	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-20.00	-158.62	-138.61	1	3	CAGGCCGCCGCTTGCGGGTG
-tig00000001	+	196514	196527	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-12.92	-154.12	-141.20	1	3	CAGCCCGCTTGCCGATGCCGTCAC
-tig00000001	+	196542	196576	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-36.39	-331.93	-295.54	1	7	TCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAAT
-tig00000001	+	196589	196595	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-13.84	-165.73	-151.89	1	3	AGCAACGCGTGCGGCTA
-tig00000001	+	196629	196629	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-5.92	-127.61	-121.69	1	1	CTGACCGCCAG
-tig00000001	+	196643	196643	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-0.18	-189.95	-189.77	1	1	GCTCCCGCCAG
-tig00000001	+	196677	196690	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-21.51	-212.86	-191.35	1	4	TCTGCCGTTGCCGACGGGCGACCA
-tig00000001	+	196706	196712	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-6.66	-126.48	-119.82	1	2	ATAGCCGTTGCCGGTAA
-tig00000001	+	196727	196749	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-24.68	-228.58	-203.89	1	5	CTGCCCGATTAATGCCGAACCGCGCACCGTATC
-tig00000001	+	196762	196770	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-6.11	-134.46	-128.35	1	2	CTTCACGAATCAACGAACC
-tig00000001	+	196810	196810	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-3.47	-100.88	-97.41	1	1	CAGTACGGTGG
-tig00000001	+	196823	196834	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-17.90	-146.78	-128.89	1	3	AGCAGCGGGTAAACGCCGCCAG
-tig00000001	+	196874	196878	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-5.39	-142.55	-137.15	1	2	AATGCCGGACGTAAT
-tig00000001	+	196909	196915	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-11.19	-147.11	-135.92	1	2	CAGACCGCAAACGGTCA
-tig00000001	+	196945	196952	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-2.00	-132.68	-130.68	1	2	GATACCGATAAACGGCAC
-tig00000001	+	196975	196975	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-1.14	-94.96	-93.81	1	1	CAGACCGTAAA
-tig00000001	+	196992	196995	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-6.40	-118.85	-112.45	1	2	AGTTACGGCGCAAC
-tig00000001	+	197011	197018	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-9.15	-133.14	-124.00	1	2	AGAAGCGGTAAGCGGTTT
-tig00000001	+	197032	197041	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-10.63	-166.94	-156.31	1	2	ACTCACGCCTTTAACGCCAG
-tig00000001	+	197059	197059	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-1.55	-120.66	-119.12	1	1	AAAGACGATAA
-tig00000001	+	197071	197071	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-12.32	-123.64	-111.32	1	1	CAAGGCGTTGA
-tig00000001	+	197084	197084	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-6.95	-111.03	-104.08	1	1	ATCACCGCACT
-tig00000001	+	197098	197108	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-26.20	-157.11	-130.90	1	3	GATTGCGGAGTCGGGCGAATG
-tig00000001	+	197132	197132	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-5.78	-95.57	-89.79	1	1	TTCAGCGCATT
-tig00000001	+	197144	197168	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-53.30	-276.16	-222.86	1	6	AACTGCGGATACGTTGCCGCGAATGCCGCCGGAAT
-tig00000001	+	197179	197197	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-13.00	-216.10	-203.10	1	3	AATGGCGAAGTATTTCGCCACATCGTTGG
-tig00000001	+	197222	197229	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-9.24	-166.50	-157.26	1	2	GTCAGCGAGCCACGGGTC
-tig00000001	+	197266	197266	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-7.26	-108.89	-101.63	1	1	CACCTCGATCA
-tig00000001	+	197279	197279	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-5.63	-106.24	-100.61	1	1	TTGGTCGGGTT
-tig00000001	+	197290	197296	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-3.97	-112.85	-108.88	1	2	AGAGTCGAGATCGACCA
-tig00000001	+	197309	197321	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-6.66	-158.20	-151.53	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	+	197332	197350	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-13.63	-220.07	-206.45	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	+	197363	197420	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-32.39	-420.88	-388.49	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	+	197433	197433	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-0.83	-120.25	-119.42	1	1	ACTGACGGATC
-tig00000001	+	197456	197470	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-11.06	-159.60	-148.54	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	+	197482	197509	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-29.46	-231.67	-202.21	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	+	197520	197530	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-12.60	-148.44	-135.83	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	+	197543	197543	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-2.75	-89.49	-86.74	1	1	ATCACCGTTTT
-tig00000001	+	197562	197577	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-18.57	-180.15	-161.58	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	+	197590	197599	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-3.30	-161.87	-158.58	1	2	AATACCGCCTTTGACGATAT
-tig00000001	+	197612	197620	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-6.77	-116.39	-109.62	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	+	197631	197631	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-4.76	-93.47	-88.71	1	1	GCACACGAGAA
-tig00000001	+	197654	197657	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-4.46	-151.13	-146.67	1	2	ACCAGCGGCGTGGC
-tig00000001	+	197670	197672	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-9.82	-123.43	-113.60	1	2	CCTGACGCGCAAC
-tig00000001	+	197683	197683	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-10.73	-115.56	-104.84	1	1	CTGATCGACTT
-tig00000001	+	197701	197701	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-10.45	-106.31	-95.86	1	1	AACATCGGTAG
-tig00000001	+	197719	197719	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-4.78	-102.90	-98.12	1	1	ACCACCGTTAG
-tig00000001	+	197736	197749	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-5.88	-185.88	-180.00	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	+	197763	197779	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-12.23	-192.43	-180.20	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	+	197791	197816	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-20.84	-261.83	-241.00	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	+	197837	197837	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-9.21	-263.67	-254.46	1	1	TGGAGCGACTG
-tig00000001	+	197848	197856	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-9.21	-328.12	-318.91	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	+	197868	197878	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-6.43	-178.09	-171.66	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	+	197895	197906	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-2.50	-190.70	-188.20	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	+	197921	197921	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-5.51	-127.78	-122.27	1	1	GCCAGCGAAGC
-tig00000001	+	197935	197948	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-9.17	-229.85	-220.68	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	+	197960	197969	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-19.39	-187.50	-168.11	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	+	197982	197999	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-8.24	-220.77	-212.53	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	+	198014	198014	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-0.26	-107.85	-107.59	1	1	GGTGCCGGTTT
-tig00000001	+	198035	198051	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-19.07	-194.02	-174.95	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	+	198064	198068	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-7.76	-104.49	-96.74	1	2	CTGCACGTCCGCTGG
-tig00000001	+	198087	198089	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-8.48	-123.76	-115.28	1	2	ACATTCGCGCCTA
-tig00000001	+	198100	198123	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-12.33	-191.47	-179.14	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	+	198137	198137	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	0.30	-120.31	-120.61	1	1	CAGGCCGCCAA
-tig00000001	+	198171	198171	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-2.91	-101.74	-98.83	1	1	AGCAGCGCCAC
-tig00000001	+	198183	198188	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-7.43	-124.06	-116.63	1	2	AGTACCGTTACGCTGA
-tig00000001	+	198203	198233	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-16.14	-269.45	-253.31	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	+	198250	198250	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-5.46	-111.24	-105.78	1	1	AAAGACGATAG
-tig00000001	+	198289	198313	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-18.11	-226.22	-208.11	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	+	198326	198336	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-4.98	-155.73	-150.75	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	+	198352	198364	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-16.58	-193.60	-177.02	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	+	198399	198415	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-25.79	-209.20	-183.40	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	+	198427	198485	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-54.33	-390.78	-336.45	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	+	198513	198513	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-2.68	-178.68	-176.01	1	1	ACCATCGCAGG
-tig00000001	+	198527	198527	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-0.65	-120.83	-120.18	1	1	AATATCGCCAG
-tig00000001	+	198545	198569	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-0.76	-210.26	-209.51	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	+	198585	198619	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-40.65	-307.98	-267.33	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	+	198660	198670	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-14.48	-130.07	-115.60	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	+	198684	198710	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-28.26	-239.44	-211.18	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	+	198728	198782	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-33.98	-535.64	-501.66	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	+	198812	198821	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-10.17	-128.20	-118.03	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	+	198834	198855	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-20.80	-227.72	-206.92	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	+	198872	198872	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-8.28	-98.02	-89.74	1	1	TTCACCGCTTC
-tig00000001	+	198884	198892	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-6.63	-163.11	-156.48	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	+	198907	198914	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-3.02	-151.29	-148.27	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	+	198927	198927	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-4.28	-93.77	-89.49	1	1	GTTTACGACTC
-tig00000001	+	198972	198987	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-20.66	-218.23	-197.57	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	+	199013	199013	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-1.44	-93.21	-91.78	1	1	CAGTGCGCCAA
-tig00000001	+	199028	199034	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-6.71	-118.53	-111.82	1	2	CAACACGGTGCCGATTA
-tig00000001	+	199056	199088	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-19.65	-259.95	-240.29	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	+	199112	199117	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	0.66	-105.72	-106.38	1	2	ACCAGCGAACCGGCAA
-tig00000001	+	199133	199133	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-2.07	-122.31	-120.25	1	1	ATCACCGGGAT
-tig00000001	+	199147	199156	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-9.71	-131.57	-121.86	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	+	199172	199172	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-5.78	-106.42	-100.64	1	1	CAGAACGCCAG
-tig00000001	+	199193	199193	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-9.80	-129.22	-119.41	1	1	CAGAACGGAGA
-tig00000001	+	199204	199228	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-12.71	-272.72	-260.00	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	+	199240	199255	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-14.76	-190.55	-175.79	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	+	199267	199267	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-3.31	-126.04	-122.73	1	1	CACTTCGCTAA
-tig00000001	+	199280	199280	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-5.42	-153.43	-148.01	1	1	CCATGCGGGCC
-tig00000001	+	199300	199336	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-42.12	-372.28	-330.16	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	+	199352	199355	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-4.93	-125.81	-120.88	1	2	ACCAGCGTCGGGGT
-tig00000001	+	199393	199402	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-7.37	-184.83	-177.46	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	+	199423	199430	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-0.99	-127.81	-126.82	1	2	TATTCCGGTGTACGACCA
-tig00000001	+	199446	199446	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-1.79	-107.46	-105.67	1	1	CAGCCCGGCAA
-tig00000001	+	199459	199459	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-4.72	-98.98	-94.26	1	1	AACACCGCCAG
-tig00000001	+	199485	199485	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-0.95	-123.82	-122.87	1	1	CATGCCGTAAA
-tig00000001	+	199500	199509	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-1.26	-172.11	-170.84	1	3	AGAACCGACACCGCCGAACA
-tig00000001	+	199543	199543	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-4.96	-126.05	-121.09	1	1	CACATCGGCAC
-tig00000001	+	199557	199570	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-12.48	-202.98	-190.50	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	+	199582	199593	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-8.75	-157.97	-149.22	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	+	199606	199621	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-12.15	-169.21	-157.06	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	+	199644	199652	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-9.80	-134.16	-124.36	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	+	199687	199687	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-0.54	-119.28	-118.74	1	1	CTGTCCGTGCC
-tig00000001	+	199740	199746	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-11.92	-133.27	-121.36	1	2	CACCACGCCTACGCAGA
-tig00000001	+	199770	199770	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-3.40	-102.35	-98.95	1	1	GACATCGCCCA
-tig00000001	+	199786	199802	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-11.94	-178.82	-166.89	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	+	199833	199836	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-6.05	-94.20	-88.15	1	2	CACAGCGCCGTTGG
-tig00000001	+	199854	199854	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-7.22	-117.77	-110.56	1	1	AAGATCGCCAG
-tig00000001	+	199868	199868	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-5.32	-140.78	-135.46	1	1	CTGCACGAAGT
-tig00000001	+	199883	199883	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-12.13	-125.56	-113.43	1	1	CAGTGCGGTTG
-tig00000001	+	199899	199908	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-18.93	-186.76	-167.83	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	+	199931	199943	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-15.95	-162.90	-146.95	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	+	199956	199956	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-4.83	-94.64	-89.80	1	1	TTGATCGCTTC
-tig00000001	+	199998	199998	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-4.64	-80.50	-75.86	1	1	TGTTGCGCTCC
 tig00000001	+	200009	200009	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-4.26	-112.22	-107.96	1	1	TTCAACGGTAT
 tig00000001	+	200046	200046	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-10.76	-97.43	-86.67	1	1	TGCAGCGCACC
 tig00000001	+	200081	200081	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-2.64	-99.10	-96.46	1	1	AACAACGCCAC
@@ -3209,177 +371,6 @@
 tig00000001	+	200188	200202	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-22.07	-229.08	-207.01	1	3	ATCACCGCAATCCCGCTGGCGGCAG
 tig00000001	+	200224	200233	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-6.73	-151.16	-144.42	1	2	TGCACCGTTAAGCCCGCCAT
 tig00000001	+	200257	200257	2c468ad4-194a-4af0-93d4-3fcbe17a9be7	-7.78	-102.40	-94.62	1	1	CTCAACGTGGT
-tig00000001	+	195222	195224	9388888e-4344-4e51-a44c-54c3b3c62b8b	-7.47	-122.16	-114.69	1	2	TCAAGCGCGACCA
-tig00000001	+	195239	195264	9388888e-4344-4e51-a44c-54c3b3c62b8b	-33.51	-264.24	-230.73	1	6	CTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCA
-tig00000001	+	195275	195313	9388888e-4344-4e51-a44c-54c3b3c62b8b	-17.99	-279.04	-261.05	1	9	GCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAA
-tig00000001	+	195328	195328	9388888e-4344-4e51-a44c-54c3b3c62b8b	-4.80	-111.68	-106.88	1	1	CTTGCCGAGAT
-tig00000001	+	195342	195359	9388888e-4344-4e51-a44c-54c3b3c62b8b	-11.48	-198.18	-186.69	1	3	GTTCACGGGCATAACGCACTACCGCTTT
-tig00000001	+	195371	195371	9388888e-4344-4e51-a44c-54c3b3c62b8b	0.78	-94.78	-95.56	1	1	TCTTCCGCTGG
-tig00000001	+	195392	195400	9388888e-4344-4e51-a44c-54c3b3c62b8b	-11.55	-188.26	-176.71	1	3	GTTGCCGTCTCCGCGCCCA
-tig00000001	+	195413	195427	9388888e-4344-4e51-a44c-54c3b3c62b8b	-10.71	-149.53	-138.82	1	3	TCCTGCGCCAGACGTAAGGCGCTGA
-tig00000001	+	195441	195460	9388888e-4344-4e51-a44c-54c3b3c62b8b	-10.68	-219.48	-208.80	1	4	TTGCCCGACGTTTTTTCCGGTAAGCGGTGC
-tig00000001	+	195489	195500	9388888e-4344-4e51-a44c-54c3b3c62b8b	-15.72	-180.21	-164.49	1	3	TACACCGCGTGCCAGACGCTAC
-tig00000001	+	195511	195535	9388888e-4344-4e51-a44c-54c3b3c62b8b	-23.61	-245.71	-222.10	1	7	CCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACC
-tig00000001	+	195547	195553	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.23	-129.22	-125.99	1	2	GTTTTCGCTGCCGGTGT
-tig00000001	+	195565	195565	9388888e-4344-4e51-a44c-54c3b3c62b8b	0.26	-122.94	-123.20	1	1	ATGGCCGATGC
-tig00000001	+	195581	195590	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.92	-158.64	-154.72	1	5	AGGATCGCGTCGCGCGTGTG
-tig00000001	+	195608	195608	9388888e-4344-4e51-a44c-54c3b3c62b8b	0.56	-107.68	-108.25	1	1	CTCTTCGCCAG
-tig00000001	+	195621	195630	9388888e-4344-4e51-a44c-54c3b3c62b8b	-13.37	-167.87	-154.50	1	3	TGCCCCGCCAGGCGCGCATT
-tig00000001	+	195646	195663	9388888e-4344-4e51-a44c-54c3b3c62b8b	-20.56	-244.05	-223.49	1	5	ATCAACGCGATCGGCAGTACGGCGCAGT
-tig00000001	+	195676	195685	9388888e-4344-4e51-a44c-54c3b3c62b8b	-14.51	-195.54	-181.03	1	3	CAGTTCGCGCAGGGCGATCA
-tig00000001	+	195702	195702	9388888e-4344-4e51-a44c-54c3b3c62b8b	-0.88	-104.14	-103.25	1	1	CTTTGCGGAAA
-tig00000001	+	195720	195735	9388888e-4344-4e51-a44c-54c3b3c62b8b	-7.37	-182.34	-174.97	1	4	AATGGCGCGCTCCGCCTGCCCGGCAA
-tig00000001	+	195764	195781	9388888e-4344-4e51-a44c-54c3b3c62b8b	-6.18	-171.56	-165.38	1	4	TCAGCCGCTGGCGCAGATCGTCCGGGGC
-tig00000001	+	195803	195842	9388888e-4344-4e51-a44c-54c3b3c62b8b	-18.92	-362.07	-343.15	1	8	CACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACC
-tig00000001	+	195855	195864	9388888e-4344-4e51-a44c-54c3b3c62b8b	-5.50	-153.13	-147.64	1	3	AATTCCGGTGACGCCGCTGA
-tig00000001	+	195900	195906	9388888e-4344-4e51-a44c-54c3b3c62b8b	-4.51	-122.41	-117.90	1	2	CTGAACGTTGACGGTAG
-tig00000001	+	195945	195945	9388888e-4344-4e51-a44c-54c3b3c62b8b	-2.20	-93.69	-91.49	1	1	TTCTTCGATAT
-tig00000001	+	195959	195959	9388888e-4344-4e51-a44c-54c3b3c62b8b	2.71	-97.33	-100.04	1	1	GCCAGCGTTTG
-tig00000001	+	195971	195971	9388888e-4344-4e51-a44c-54c3b3c62b8b	-2.42	-98.03	-95.61	1	1	GATGACGGGAA
-tig00000001	+	195982	195982	9388888e-4344-4e51-a44c-54c3b3c62b8b	-4.17	-76.71	-72.54	1	1	CCTGGCGCATT
-tig00000001	+	195994	196002	9388888e-4344-4e51-a44c-54c3b3c62b8b	-5.32	-146.32	-141.01	1	2	CTGTGCGCCAGTTCGTCCA
-tig00000001	+	196018	196044	9388888e-4344-4e51-a44c-54c3b3c62b8b	-32.05	-309.01	-276.97	1	7	ATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGAT
-tig00000001	+	196056	196056	9388888e-4344-4e51-a44c-54c3b3c62b8b	-1.46	-92.77	-91.30	1	1	AAACTCGCTGA
-tig00000001	+	196067	196093	9388888e-4344-4e51-a44c-54c3b3c62b8b	-19.91	-293.86	-273.95	1	5	TATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAG
-tig00000001	+	196122	196125	9388888e-4344-4e51-a44c-54c3b3c62b8b	-7.61	-137.42	-129.81	1	2	CATGGCGGCGGTAT
-tig00000001	+	196136	196140	9388888e-4344-4e51-a44c-54c3b3c62b8b	-7.58	-131.86	-124.29	1	2	CTTTTCGCCCGTGGG
-tig00000001	+	196155	196155	9388888e-4344-4e51-a44c-54c3b3c62b8b	-6.26	-68.69	-62.43	1	1	TACCACGCCAA
-tig00000001	+	196180	196190	9388888e-4344-4e51-a44c-54c3b3c62b8b	-16.00	-152.84	-136.84	1	3	CCTTGCGCCCGCAGTCGCTGG
-tig00000001	+	196210	196210	9388888e-4344-4e51-a44c-54c3b3c62b8b	-0.01	-76.71	-76.70	1	1	AGCATCGCCCA
-tig00000001	+	196224	196227	9388888e-4344-4e51-a44c-54c3b3c62b8b	0.91	-95.10	-96.01	1	2	CTTCCCGACGCCTG
-tig00000001	+	196242	196242	9388888e-4344-4e51-a44c-54c3b3c62b8b	-4.81	-106.28	-101.47	1	1	GGCACCGAAGA
-tig00000001	+	196264	196274	9388888e-4344-4e51-a44c-54c3b3c62b8b	-6.64	-142.83	-136.20	1	4	TTCCCCGATGCGGCGCGGCAG
-tig00000001	+	196294	196319	9388888e-4344-4e51-a44c-54c3b3c62b8b	-26.37	-243.05	-216.68	1	5	GCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
-tig00000001	+	196342	196342	9388888e-4344-4e51-a44c-54c3b3c62b8b	-0.36	-80.40	-80.04	1	1	TCCAGCGCCAG
-tig00000001	+	196372	196380	9388888e-4344-4e51-a44c-54c3b3c62b8b	-1.56	-135.29	-133.73	1	2	ACAACCGGCTGGCCGATAT
-tig00000001	+	196396	196396	9388888e-4344-4e51-a44c-54c3b3c62b8b	0.79	-116.22	-117.01	1	1	ACCAGCGGTTG
-tig00000001	+	196416	196426	9388888e-4344-4e51-a44c-54c3b3c62b8b	-0.60	-146.04	-145.44	1	2	TTTTGCGATCAGTTGCGTGAG
-tig00000001	+	196440	196440	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.48	-86.03	-82.55	1	1	TTCAACGCTGA
-tig00000001	+	196451	196466	9388888e-4344-4e51-a44c-54c3b3c62b8b	-14.52	-214.05	-199.52	1	5	GATTACGCGCTTTCGCCACGCGTGGG
-tig00000001	+	196483	196492	9388888e-4344-4e51-a44c-54c3b3c62b8b	-16.13	-216.77	-200.64	1	3	CAGGCCGCCGCTTGCGGGTG
-tig00000001	+	196514	196527	9388888e-4344-4e51-a44c-54c3b3c62b8b	-7.16	-168.57	-161.40	1	3	CAGCCCGCTTGCCGATGCCGTCAC
-tig00000001	+	196542	196576	9388888e-4344-4e51-a44c-54c3b3c62b8b	-11.91	-255.13	-243.23	1	7	TCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAAT
-tig00000001	+	196589	196595	9388888e-4344-4e51-a44c-54c3b3c62b8b	-5.82	-132.68	-126.85	1	3	AGCAACGCGTGCGGCTA
-tig00000001	+	196629	196629	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.06	-99.27	-96.21	1	1	CTGACCGCCAG
-tig00000001	+	196643	196643	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.61	-84.27	-80.66	1	1	GCTCCCGCCAG
-tig00000001	+	196677	196690	9388888e-4344-4e51-a44c-54c3b3c62b8b	-12.17	-200.32	-188.16	1	4	TCTGCCGTTGCCGACGGGCGACCA
-tig00000001	+	196706	196712	9388888e-4344-4e51-a44c-54c3b3c62b8b	1.51	-126.03	-127.54	1	2	ATAGCCGTTGCCGGTAA
-tig00000001	+	196727	196749	9388888e-4344-4e51-a44c-54c3b3c62b8b	-10.34	-201.99	-191.65	1	5	CTGCCCGATTAATGCCGAACCGCGCACCGTATC
-tig00000001	+	196762	196770	9388888e-4344-4e51-a44c-54c3b3c62b8b	-2.32	-133.77	-131.46	1	2	CTTCACGAATCAACGAACC
-tig00000001	+	196810	196810	9388888e-4344-4e51-a44c-54c3b3c62b8b	-4.33	-107.79	-103.46	1	1	CAGTACGGTGG
-tig00000001	+	196823	196834	9388888e-4344-4e51-a44c-54c3b3c62b8b	-10.53	-148.48	-137.95	1	3	AGCAGCGGGTAAACGCCGCCAG
-tig00000001	+	196874	196878	9388888e-4344-4e51-a44c-54c3b3c62b8b	-2.95	-106.42	-103.47	1	2	AATGCCGGACGTAAT
-tig00000001	+	196909	196915	9388888e-4344-4e51-a44c-54c3b3c62b8b	-2.02	-164.15	-162.13	1	2	CAGACCGCAAACGGTCA
-tig00000001	+	196945	196952	9388888e-4344-4e51-a44c-54c3b3c62b8b	-2.60	-132.87	-130.28	1	2	GATACCGATAAACGGCAC
-tig00000001	+	196975	196975	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.10	-86.65	-83.55	1	1	CAGACCGTAAA
-tig00000001	+	196992	196995	9388888e-4344-4e51-a44c-54c3b3c62b8b	-11.12	-118.07	-106.95	1	2	AGTTACGGCGCAAC
-tig00000001	+	197011	197018	9388888e-4344-4e51-a44c-54c3b3c62b8b	-7.32	-118.79	-111.47	1	2	AGAAGCGGTAAGCGGTTT
-tig00000001	+	197032	197041	9388888e-4344-4e51-a44c-54c3b3c62b8b	-8.73	-131.73	-123.00	1	2	ACTCACGCCTTTAACGCCAG
-tig00000001	+	197059	197059	9388888e-4344-4e51-a44c-54c3b3c62b8b	-4.87	-117.80	-112.93	1	1	AAAGACGATAA
-tig00000001	+	197071	197071	9388888e-4344-4e51-a44c-54c3b3c62b8b	-10.24	-113.85	-103.61	1	1	CAAGGCGTTGA
-tig00000001	+	197084	197084	9388888e-4344-4e51-a44c-54c3b3c62b8b	-5.96	-125.49	-119.53	1	1	ATCACCGCACT
-tig00000001	+	197098	197108	9388888e-4344-4e51-a44c-54c3b3c62b8b	-9.94	-145.82	-135.88	1	3	GATTGCGGAGTCGGGCGAATG
-tig00000001	+	197132	197132	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.26	-99.95	-96.69	1	1	TTCAGCGCATT
-tig00000001	+	197144	197168	9388888e-4344-4e51-a44c-54c3b3c62b8b	-20.32	-204.43	-184.11	1	6	AACTGCGGATACGTTGCCGCGAATGCCGCCGGAAT
-tig00000001	+	197179	197197	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.73	-188.69	-184.96	1	3	AATGGCGAAGTATTTCGCCACATCGTTGG
-tig00000001	+	197222	197229	9388888e-4344-4e51-a44c-54c3b3c62b8b	-7.13	-143.02	-135.89	1	2	GTCAGCGAGCCACGGGTC
-tig00000001	+	197266	197266	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.73	-146.82	-143.08	1	1	CACCTCGATCA
-tig00000001	+	197279	197279	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.82	-150.07	-146.26	1	1	TTGGTCGGGTT
-tig00000001	+	197290	197296	9388888e-4344-4e51-a44c-54c3b3c62b8b	-12.28	-159.54	-147.25	1	2	AGAGTCGAGATCGACCA
-tig00000001	+	197309	197321	9388888e-4344-4e51-a44c-54c3b3c62b8b	-11.77	-186.98	-175.22	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	+	197332	197350	9388888e-4344-4e51-a44c-54c3b3c62b8b	-5.92	-195.82	-189.90	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	+	197363	197420	9388888e-4344-4e51-a44c-54c3b3c62b8b	-15.68	-367.23	-351.54	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	+	197433	197433	9388888e-4344-4e51-a44c-54c3b3c62b8b	-2.49	-117.30	-114.81	1	1	ACTGACGGATC
-tig00000001	+	197456	197470	9388888e-4344-4e51-a44c-54c3b3c62b8b	-10.17	-180.23	-170.07	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	+	197482	197509	9388888e-4344-4e51-a44c-54c3b3c62b8b	-16.30	-278.26	-261.96	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	+	197520	197530	9388888e-4344-4e51-a44c-54c3b3c62b8b	-13.89	-176.47	-162.58	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	+	197543	197543	9388888e-4344-4e51-a44c-54c3b3c62b8b	1.54	-122.23	-123.77	1	1	ATCACCGTTTT
-tig00000001	+	197562	197577	9388888e-4344-4e51-a44c-54c3b3c62b8b	-10.52	-172.69	-162.17	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	+	197590	197599	9388888e-4344-4e51-a44c-54c3b3c62b8b	-10.53	-164.23	-153.70	1	2	AATACCGCCTTTGACGATAT
-tig00000001	+	197612	197620	9388888e-4344-4e51-a44c-54c3b3c62b8b	-1.31	-130.74	-129.43	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	+	197631	197631	9388888e-4344-4e51-a44c-54c3b3c62b8b	-5.38	-101.00	-95.62	1	1	GCACACGAGAA
-tig00000001	+	197654	197657	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.35	-110.77	-107.42	1	2	ACCAGCGGCGTGGC
-tig00000001	+	197670	197672	9388888e-4344-4e51-a44c-54c3b3c62b8b	-8.98	-107.56	-98.58	1	2	CCTGACGCGCAAC
-tig00000001	+	197683	197683	9388888e-4344-4e51-a44c-54c3b3c62b8b	-7.10	-90.91	-83.81	1	1	CTGATCGACTT
-tig00000001	+	197701	197701	9388888e-4344-4e51-a44c-54c3b3c62b8b	-7.34	-120.95	-113.61	1	1	AACATCGGTAG
-tig00000001	+	197719	197719	9388888e-4344-4e51-a44c-54c3b3c62b8b	-1.15	-91.39	-90.24	1	1	ACCACCGTTAG
-tig00000001	+	197736	197749	9388888e-4344-4e51-a44c-54c3b3c62b8b	-5.65	-153.00	-147.35	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	+	197763	197779	9388888e-4344-4e51-a44c-54c3b3c62b8b	-11.11	-209.78	-198.66	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	+	197791	197816	9388888e-4344-4e51-a44c-54c3b3c62b8b	-9.46	-198.89	-189.44	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	+	197837	197837	9388888e-4344-4e51-a44c-54c3b3c62b8b	-0.70	-86.40	-85.70	1	1	TGGAGCGACTG
-tig00000001	+	197848	197856	9388888e-4344-4e51-a44c-54c3b3c62b8b	-1.37	-131.84	-130.47	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	+	197868	197878	9388888e-4344-4e51-a44c-54c3b3c62b8b	-6.29	-146.01	-139.72	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	+	197895	197906	9388888e-4344-4e51-a44c-54c3b3c62b8b	-10.12	-165.58	-155.46	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	+	197921	197921	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.04	-112.77	-109.73	1	1	GCCAGCGAAGC
-tig00000001	+	197935	197948	9388888e-4344-4e51-a44c-54c3b3c62b8b	-14.16	-186.08	-171.92	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	+	197960	197969	9388888e-4344-4e51-a44c-54c3b3c62b8b	-7.72	-128.32	-120.60	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	+	197982	197999	9388888e-4344-4e51-a44c-54c3b3c62b8b	-14.53	-192.36	-177.84	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	+	198014	198014	9388888e-4344-4e51-a44c-54c3b3c62b8b	-6.21	-116.64	-110.43	1	1	GGTGCCGGTTT
-tig00000001	+	198035	198051	9388888e-4344-4e51-a44c-54c3b3c62b8b	-15.19	-191.87	-176.68	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	+	198064	198068	9388888e-4344-4e51-a44c-54c3b3c62b8b	-1.78	-110.89	-109.11	1	2	CTGCACGTCCGCTGG
-tig00000001	+	198087	198089	9388888e-4344-4e51-a44c-54c3b3c62b8b	-6.21	-103.49	-97.28	1	2	ACATTCGCGCCTA
-tig00000001	+	198100	198123	9388888e-4344-4e51-a44c-54c3b3c62b8b	-12.89	-211.54	-198.65	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	+	198137	198137	9388888e-4344-4e51-a44c-54c3b3c62b8b	-1.31	-95.36	-94.05	1	1	CAGGCCGCCAA
-tig00000001	+	198171	198171	9388888e-4344-4e51-a44c-54c3b3c62b8b	-4.25	-99.52	-95.28	1	1	AGCAGCGCCAC
-tig00000001	+	198183	198188	9388888e-4344-4e51-a44c-54c3b3c62b8b	-2.73	-125.40	-122.67	1	2	AGTACCGTTACGCTGA
-tig00000001	+	198203	198233	9388888e-4344-4e51-a44c-54c3b3c62b8b	-7.52	-262.22	-254.70	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	+	198250	198250	9388888e-4344-4e51-a44c-54c3b3c62b8b	-0.99	-117.68	-116.69	1	1	AAAGACGATAG
-tig00000001	+	198289	198313	9388888e-4344-4e51-a44c-54c3b3c62b8b	-31.03	-257.54	-226.50	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	+	198326	198336	9388888e-4344-4e51-a44c-54c3b3c62b8b	-1.88	-155.44	-153.56	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	+	198352	198364	9388888e-4344-4e51-a44c-54c3b3c62b8b	-16.32	-189.54	-173.22	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	+	198399	198415	9388888e-4344-4e51-a44c-54c3b3c62b8b	-29.01	-223.16	-194.15	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	+	198427	198485	9388888e-4344-4e51-a44c-54c3b3c62b8b	-41.00	-408.33	-367.33	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	+	198513	198513	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.04	-111.15	-108.11	1	1	ACCATCGCAGG
-tig00000001	+	198527	198527	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.34	-89.26	-85.92	1	1	AATATCGCCAG
-tig00000001	+	198545	198569	9388888e-4344-4e51-a44c-54c3b3c62b8b	-12.24	-242.79	-230.55	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	+	198585	198619	9388888e-4344-4e51-a44c-54c3b3c62b8b	-6.19	-244.64	-238.45	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	+	198660	198670	9388888e-4344-4e51-a44c-54c3b3c62b8b	-7.72	-160.68	-152.96	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	+	198684	198710	9388888e-4344-4e51-a44c-54c3b3c62b8b	-10.68	-257.07	-246.39	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	+	198728	198782	9388888e-4344-4e51-a44c-54c3b3c62b8b	-24.53	-365.10	-340.57	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	+	198812	198821	9388888e-4344-4e51-a44c-54c3b3c62b8b	-7.43	-153.28	-145.85	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	+	198834	198855	9388888e-4344-4e51-a44c-54c3b3c62b8b	-15.56	-257.20	-241.65	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	+	198872	198872	9388888e-4344-4e51-a44c-54c3b3c62b8b	-6.02	-101.15	-95.12	1	1	TTCACCGCTTC
-tig00000001	+	198884	198892	9388888e-4344-4e51-a44c-54c3b3c62b8b	3.87	-156.94	-160.81	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	+	198907	198914	9388888e-4344-4e51-a44c-54c3b3c62b8b	-1.58	-173.64	-172.06	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	+	198927	198927	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.96	-104.19	-100.23	1	1	GTTTACGACTC
-tig00000001	+	198972	198987	9388888e-4344-4e51-a44c-54c3b3c62b8b	-9.31	-193.46	-184.15	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	+	199013	199013	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.34	-96.48	-93.14	1	1	CAGTGCGCCAA
-tig00000001	+	199028	199034	9388888e-4344-4e51-a44c-54c3b3c62b8b	-0.98	-103.72	-102.74	1	2	CAACACGGTGCCGATTA
-tig00000001	+	199056	199088	9388888e-4344-4e51-a44c-54c3b3c62b8b	-11.18	-336.31	-325.13	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	+	199112	199117	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.05	-104.14	-101.09	1	2	ACCAGCGAACCGGCAA
-tig00000001	+	199133	199133	9388888e-4344-4e51-a44c-54c3b3c62b8b	-0.89	-93.77	-92.88	1	1	ATCACCGGGAT
-tig00000001	+	199147	199156	9388888e-4344-4e51-a44c-54c3b3c62b8b	1.07	-160.13	-161.20	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	+	199172	199172	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.30	-108.29	-104.99	1	1	CAGAACGCCAG
-tig00000001	+	199193	199193	9388888e-4344-4e51-a44c-54c3b3c62b8b	-7.44	-120.87	-113.43	1	1	CAGAACGGAGA
-tig00000001	+	199204	199228	9388888e-4344-4e51-a44c-54c3b3c62b8b	-12.59	-204.21	-191.61	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	+	199240	199255	9388888e-4344-4e51-a44c-54c3b3c62b8b	-11.67	-149.99	-138.32	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	+	199267	199267	9388888e-4344-4e51-a44c-54c3b3c62b8b	-4.98	-98.58	-93.61	1	1	CACTTCGCTAA
-tig00000001	+	199280	199280	9388888e-4344-4e51-a44c-54c3b3c62b8b	-5.32	-108.10	-102.78	1	1	CCATGCGGGCC
-tig00000001	+	199300	199336	9388888e-4344-4e51-a44c-54c3b3c62b8b	-24.84	-276.74	-251.90	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	+	199352	199355	9388888e-4344-4e51-a44c-54c3b3c62b8b	-7.99	-126.90	-118.91	1	2	ACCAGCGTCGGGGT
-tig00000001	+	199393	199402	9388888e-4344-4e51-a44c-54c3b3c62b8b	-10.08	-161.70	-151.61	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	+	199423	199430	9388888e-4344-4e51-a44c-54c3b3c62b8b	-5.06	-140.48	-135.42	1	2	TATTCCGGTGTACGACCA
-tig00000001	+	199446	199446	9388888e-4344-4e51-a44c-54c3b3c62b8b	-0.90	-76.73	-75.83	1	1	CAGCCCGGCAA
-tig00000001	+	199459	199459	9388888e-4344-4e51-a44c-54c3b3c62b8b	1.55	-89.16	-90.71	1	1	AACACCGCCAG
-tig00000001	+	199485	199485	9388888e-4344-4e51-a44c-54c3b3c62b8b	1.50	-86.41	-87.92	1	1	CATGCCGTAAA
-tig00000001	+	199500	199509	9388888e-4344-4e51-a44c-54c3b3c62b8b	-11.99	-159.67	-147.68	1	3	AGAACCGACACCGCCGAACA
-tig00000001	+	199543	199543	9388888e-4344-4e51-a44c-54c3b3c62b8b	-4.33	-98.12	-93.79	1	1	CACATCGGCAC
-tig00000001	+	199557	199570	9388888e-4344-4e51-a44c-54c3b3c62b8b	-12.24	-132.94	-120.70	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	+	199582	199593	9388888e-4344-4e51-a44c-54c3b3c62b8b	-4.10	-110.38	-106.27	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	+	199606	199621	9388888e-4344-4e51-a44c-54c3b3c62b8b	-2.11	-160.83	-158.72	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	+	199644	199652	9388888e-4344-4e51-a44c-54c3b3c62b8b	-16.86	-170.71	-153.85	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	+	199687	199687	9388888e-4344-4e51-a44c-54c3b3c62b8b	-0.54	-126.36	-125.82	1	1	CTGTCCGTGCC
-tig00000001	+	199740	199746	9388888e-4344-4e51-a44c-54c3b3c62b8b	-8.56	-142.88	-134.32	1	2	CACCACGCCTACGCAGA
-tig00000001	+	199770	199770	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.22	-69.44	-66.22	1	1	GACATCGCCCA
-tig00000001	+	199786	199802	9388888e-4344-4e51-a44c-54c3b3c62b8b	-10.46	-188.04	-177.58	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	+	199833	199836	9388888e-4344-4e51-a44c-54c3b3c62b8b	-4.18	-95.54	-91.36	1	2	CACAGCGCCGTTGG
-tig00000001	+	199854	199854	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.98	-108.42	-104.44	1	1	AAGATCGCCAG
-tig00000001	+	199868	199868	9388888e-4344-4e51-a44c-54c3b3c62b8b	2.27	-129.65	-131.91	1	1	CTGCACGAAGT
-tig00000001	+	199883	199883	9388888e-4344-4e51-a44c-54c3b3c62b8b	0.32	-105.65	-105.97	1	1	CAGTGCGGTTG
-tig00000001	+	199899	199908	9388888e-4344-4e51-a44c-54c3b3c62b8b	-6.48	-144.40	-137.92	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	+	199931	199943	9388888e-4344-4e51-a44c-54c3b3c62b8b	-10.45	-156.22	-145.77	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	+	199956	199956	9388888e-4344-4e51-a44c-54c3b3c62b8b	-0.18	-89.16	-88.98	1	1	TTGATCGCTTC
-tig00000001	+	199998	199998	9388888e-4344-4e51-a44c-54c3b3c62b8b	-5.48	-136.07	-130.59	1	1	TGTTGCGCTCC
 tig00000001	+	200009	200009	9388888e-4344-4e51-a44c-54c3b3c62b8b	-7.66	-135.97	-128.32	1	1	TTCAACGGTAT
 tig00000001	+	200046	200046	9388888e-4344-4e51-a44c-54c3b3c62b8b	-2.74	-77.70	-74.96	1	1	TGCAGCGCACC
 tig00000001	+	200081	200081	9388888e-4344-4e51-a44c-54c3b3c62b8b	-6.57	-135.44	-128.87	1	1	AACAACGCCAC
@@ -3435,228 +426,6 @@
 tig00000001	+	201922	201930	9388888e-4344-4e51-a44c-54c3b3c62b8b	-5.00	-130.63	-125.63	1	2	GTCACCGGCTGGCCGCACT
 tig00000001	+	201944	201950	9388888e-4344-4e51-a44c-54c3b3c62b8b	-11.86	-125.10	-113.24	1	2	GCAGGCGCTGCCGGAAG
 tig00000001	+	201961	201986	9388888e-4344-4e51-a44c-54c3b3c62b8b	-5.18	-257.94	-252.77	1	4	AACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAA
-tig00000001	+	201998	202007	9388888e-4344-4e51-a44c-54c3b3c62b8b	0.61	-163.45	-164.05	1	2	CAGTCCGCAGGGGCCGTGGT
-tig00000001	+	202020	202020	9388888e-4344-4e51-a44c-54c3b3c62b8b	1.03	-80.07	-81.10	1	1	CTGCTCGGCTG
-tig00000001	+	202033	202046	9388888e-4344-4e51-a44c-54c3b3c62b8b	-22.55	-210.74	-188.19	1	3	GTGAGCGGGTGCCGGAAGCGGATG
-tig00000001	+	202064	202081	9388888e-4344-4e51-a44c-54c3b3c62b8b	-23.20	-240.87	-217.67	1	5	GCCTGCGCCGCTGCCGCCGTACCGGGTA
-tig00000001	+	202092	202092	9388888e-4344-4e51-a44c-54c3b3c62b8b	0.38	-107.56	-107.94	1	1	CTGACCGGGCT
-tig00000001	+	202105	202143	9388888e-4344-4e51-a44c-54c3b3c62b8b	-23.85	-314.01	-290.16	1	8	TGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGA
-tig00000001	+	202155	202198	9388888e-4344-4e51-a44c-54c3b3c62b8b	-47.09	-392.79	-345.70	1	8	TTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTG
-tig00000001	+	202214	202225	9388888e-4344-4e51-a44c-54c3b3c62b8b	-18.54	-206.93	-188.39	1	3	GACCACGCAGGCGCAGCGGGCA
-tig00000001	+	202240	202240	9388888e-4344-4e51-a44c-54c3b3c62b8b	-2.84	-97.68	-94.84	1	1	AAGCCCGGCAG
-tig00000001	+	202257	202275	9388888e-4344-4e51-a44c-54c3b3c62b8b	-17.97	-196.89	-178.93	1	5	ATTTCCGGCGGGACGGAACCGTCCGCTTT
-tig00000001	+	202295	202330	9388888e-4344-4e51-a44c-54c3b3c62b8b	-2.95	-273.37	-270.43	1	5	CCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTG
-tig00000001	+	202341	202341	9388888e-4344-4e51-a44c-54c3b3c62b8b	-4.27	-119.02	-114.75	1	1	TCTGCCGTGTG
-tig00000001	+	202352	202370	9388888e-4344-4e51-a44c-54c3b3c62b8b	-5.33	-166.70	-161.37	1	4	GCTGACGCACGACCCGGAATACCCGGAGA
-tig00000001	+	202386	202399	9388888e-4344-4e51-a44c-54c3b3c62b8b	-26.45	-187.78	-161.33	1	4	CCTGCCGCGCCGCTGGTGCGCTAT
-tig00000001	+	202412	202432	9388888e-4344-4e51-a44c-54c3b3c62b8b	-31.14	-235.19	-204.05	1	6	CTGGACGCCCGCGGCGAACTGGCGGCGGTGT
-tig00000001	+	202443	202443	9388888e-4344-4e51-a44c-54c3b3c62b8b	-2.64	-100.26	-97.61	1	1	ATGACCGCAGC
-tig00000001	+	202461	202461	9388888e-4344-4e51-a44c-54c3b3c62b8b	-0.61	-107.81	-107.21	1	1	AGGTGCGCAGC
-tig00000001	+	202475	202475	9388888e-4344-4e51-a44c-54c3b3c62b8b	-2.43	-124.60	-122.18	1	1	ACTTACGATGA
-tig00000001	+	202488	202525	9388888e-4344-4e51-a44c-54c3b3c62b8b	-5.71	-338.28	-332.58	1	7	AATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAA
-tig00000001	+	202539	202557	9388888e-4344-4e51-a44c-54c3b3c62b8b	-5.34	-226.77	-221.43	1	5	GTTACCGTTACGACAGCGACGGGCGGGTG
-tig00000001	+	202579	202579	9388888e-4344-4e51-a44c-54c3b3c62b8b	-2.77	-83.99	-81.22	1	1	AAACCCGGCAG
-tig00000001	+	202597	202597	9388888e-4344-4e51-a44c-54c3b3c62b8b	-1.86	-97.71	-95.85	1	1	TTACACGTATC
-tig00000001	+	202617	202617	9388888e-4344-4e51-a44c-54c3b3c62b8b	-1.28	-100.78	-99.50	1	1	AGGACCGCATC
-tig00000001	+	202631	202631	9388888e-4344-4e51-a44c-54c3b3c62b8b	0.23	-87.88	-88.11	1	1	ATCACCGACAG
-tig00000001	+	202644	202647	9388888e-4344-4e51-a44c-54c3b3c62b8b	-10.29	-163.01	-152.71	1	2	TGAACCGCCGTGAA
-tig00000001	+	202663	202663	9388888e-4344-4e51-a44c-54c3b3c62b8b	-1.41	-80.08	-78.67	1	1	GCACACGCAGG
-tig00000001	+	202676	202686	9388888e-4344-4e51-a44c-54c3b3c62b8b	-6.13	-165.82	-159.69	1	2	GAAGGCGGGCTGAAGCGGGTG
-tig00000001	+	202705	202722	9388888e-4344-4e51-a44c-54c3b3c62b8b	-1.83	-175.81	-173.98	1	5	GAACACGCGGACGGCAGCGTCACGCAGA
-tig00000001	+	202738	202740	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.72	-129.99	-126.27	1	2	TTTGACGCGGTGG
-tig00000001	+	202764	202771	9388888e-4344-4e51-a44c-54c3b3c62b8b	-5.90	-160.40	-154.49	1	2	ACAGACGGATGCCGCAGG
-tig00000001	+	202797	202797	9388888e-4344-4e51-a44c-54c3b3c62b8b	-1.19	-105.82	-104.63	1	1	CAGTCCGGATG
-tig00000001	+	202809	202809	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.99	-106.80	-102.81	1	1	GGTGACGGGCC
-tig00000001	+	202821	202836	9388888e-4344-4e51-a44c-54c3b3c62b8b	-17.97	-189.81	-171.84	1	4	CATCACGCGCATCACCACGCCGGATG
-tig00000001	+	202851	202854	9388888e-4344-4e51-a44c-54c3b3c62b8b	-7.02	-91.13	-84.11	1	2	GGCATCGGCGTTTT
-tig00000001	+	202884	202903	9388888e-4344-4e51-a44c-54c3b3c62b8b	-10.67	-219.28	-208.60	1	3	GTTAACGTCAGCCACCGGGCCTGACGGGCT
-tig00000001	+	202916	202919	9388888e-4344-4e51-a44c-54c3b3c62b8b	-11.85	-121.39	-109.54	1	2	AAATACGCCGGGAA
-tig00000001	+	202940	202940	9388888e-4344-4e51-a44c-54c3b3c62b8b	0.52	-95.18	-95.70	1	1	GGGGCCGTCTG
-tig00000001	+	202966	202985	9388888e-4344-4e51-a44c-54c3b3c62b8b	-20.21	-209.43	-189.22	1	4	CCTGACGGCGATATCACCCGCTACCGTTAT
-tig00000001	+	203017	203022	9388888e-4344-4e51-a44c-54c3b3c62b8b	-13.03	-151.74	-138.71	1	2	CCCTGCGCAACGGAAG
-tig00000001	+	203035	203042	9388888e-4344-4e51-a44c-54c3b3c62b8b	2.03	-141.67	-143.70	1	2	GCCACCGGCAGCCGGAAA
-tig00000001	+	203055	203068	9388888e-4344-4e51-a44c-54c3b3c62b8b	-8.13	-210.34	-202.20	1	3	CATGACGTGGAGCCGTTACGGTCA
-tig00000001	+	203098	203098	9388888e-4344-4e51-a44c-54c3b3c62b8b	1.93	-105.93	-107.86	1	1	TGTTCCGGTTA
-tig00000001	+	203111	203111	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.27	-87.51	-84.24	1	1	TAACCCGCTAT
-tig00000001	+	203126	203126	9388888e-4344-4e51-a44c-54c3b3c62b8b	-0.59	-109.42	-108.82	1	1	ATGACCGTTTT
-tig00000001	+	203142	203155	9388888e-4344-4e51-a44c-54c3b3c62b8b	-8.26	-192.93	-184.67	1	4	GGTGACGGCGGTGCACCGCGAGGA
-tig00000001	+	203177	203192	9388888e-4344-4e51-a44c-54c3b3c62b8b	-7.99	-161.87	-153.88	1	4	AGTACCGCGCATACGACAGCCGTGGA
-tig00000001	+	203209	203209	9388888e-4344-4e51-a44c-54c3b3c62b8b	-0.19	-147.57	-147.37	1	1	ATTGCCGTGAA
-tig00000001	+	203220	203220	9388888e-4344-4e51-a44c-54c3b3c62b8b	-4.74	-197.33	-192.59	1	1	AGACACGCAGG
-tig00000001	+	203235	203237	9388888e-4344-4e51-a44c-54c3b3c62b8b	2.19	-132.77	-134.96	1	2	TGAAACGCGGTAT
-tig00000001	+	203251	203257	9388888e-4344-4e51-a44c-54c3b3c62b8b	-14.77	-163.38	-148.61	1	3	TACAACGCCGCCGGTGA
-tig00000001	+	203272	203272	9388888e-4344-4e51-a44c-54c3b3c62b8b	-0.77	-127.55	-126.79	1	1	ACCACCGTCAT
-tig00000001	+	203283	203287	9388888e-4344-4e51-a44c-54c3b3c62b8b	-6.97	-149.17	-142.20	1	2	TGCCCCGGACGGCAG
-tig00000001	+	203299	203299	9388888e-4344-4e51-a44c-54c3b3c62b8b	-3.88	-101.85	-97.97	1	1	AGAAACGGGAC
-tig00000001	+	203311	203316	9388888e-4344-4e51-a44c-54c3b3c62b8b	-4.02	-144.00	-139.99	1	2	CAGTACGATGCGTGGG
-tig00000001	+	195328	195328	eaa48d4e-1945-4011-8bae-ded748af1fca	0.74	-86.33	-87.07	1	1	CTTGCCGAGAT
-tig00000001	+	195342	195359	eaa48d4e-1945-4011-8bae-ded748af1fca	-13.05	-172.99	-159.94	1	3	GTTCACGGGCATAACGCACTACCGCTTT
-tig00000001	+	195371	195371	eaa48d4e-1945-4011-8bae-ded748af1fca	-4.38	-114.04	-109.66	1	1	TCTTCCGCTGG
-tig00000001	+	195392	195400	eaa48d4e-1945-4011-8bae-ded748af1fca	-7.10	-129.46	-122.36	1	3	GTTGCCGTCTCCGCGCCCA
-tig00000001	+	195413	195427	eaa48d4e-1945-4011-8bae-ded748af1fca	-11.40	-193.88	-182.48	1	3	TCCTGCGCCAGACGTAAGGCGCTGA
-tig00000001	+	195441	195460	eaa48d4e-1945-4011-8bae-ded748af1fca	-6.85	-177.40	-170.55	1	4	TTGCCCGACGTTTTTTCCGGTAAGCGGTGC
-tig00000001	+	195489	195500	eaa48d4e-1945-4011-8bae-ded748af1fca	-0.19	-163.80	-163.61	1	3	TACACCGCGTGCCAGACGCTAC
-tig00000001	+	195511	195535	eaa48d4e-1945-4011-8bae-ded748af1fca	-30.06	-328.84	-298.78	1	7	CCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACC
-tig00000001	+	195547	195553	eaa48d4e-1945-4011-8bae-ded748af1fca	-13.43	-151.37	-137.94	1	2	GTTTTCGCTGCCGGTGT
-tig00000001	+	195565	195565	eaa48d4e-1945-4011-8bae-ded748af1fca	0.82	-94.35	-95.17	1	1	ATGGCCGATGC
-tig00000001	+	195581	195590	eaa48d4e-1945-4011-8bae-ded748af1fca	-10.25	-164.59	-154.34	1	5	AGGATCGCGTCGCGCGTGTG
-tig00000001	+	195608	195608	eaa48d4e-1945-4011-8bae-ded748af1fca	-4.26	-117.89	-113.63	1	1	CTCTTCGCCAG
-tig00000001	+	195621	195630	eaa48d4e-1945-4011-8bae-ded748af1fca	-8.38	-149.40	-141.02	1	3	TGCCCCGCCAGGCGCGCATT
-tig00000001	+	195646	195663	eaa48d4e-1945-4011-8bae-ded748af1fca	-23.66	-210.27	-186.60	1	5	ATCAACGCGATCGGCAGTACGGCGCAGT
-tig00000001	+	195676	195685	eaa48d4e-1945-4011-8bae-ded748af1fca	-14.68	-174.91	-160.23	1	3	CAGTTCGCGCAGGGCGATCA
-tig00000001	+	195702	195702	eaa48d4e-1945-4011-8bae-ded748af1fca	3.85	-96.50	-100.36	1	1	CTTTGCGGAAA
-tig00000001	+	195720	195735	eaa48d4e-1945-4011-8bae-ded748af1fca	-13.27	-163.67	-150.39	1	4	AATGGCGCGCTCCGCCTGCCCGGCAA
-tig00000001	+	195764	195781	eaa48d4e-1945-4011-8bae-ded748af1fca	-9.60	-186.86	-177.26	1	4	TCAGCCGCTGGCGCAGATCGTCCGGGGC
-tig00000001	+	195803	195842	eaa48d4e-1945-4011-8bae-ded748af1fca	-24.69	-309.96	-285.27	1	8	CACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACC
-tig00000001	+	195855	195864	eaa48d4e-1945-4011-8bae-ded748af1fca	-14.67	-142.08	-127.41	1	3	AATTCCGGTGACGCCGCTGA
-tig00000001	+	195900	195906	eaa48d4e-1945-4011-8bae-ded748af1fca	-12.25	-159.71	-147.46	1	2	CTGAACGTTGACGGTAG
-tig00000001	+	195945	195945	eaa48d4e-1945-4011-8bae-ded748af1fca	-4.98	-100.50	-95.53	1	1	TTCTTCGATAT
-tig00000001	+	195959	195959	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.76	-118.97	-116.21	1	1	GCCAGCGTTTG
-tig00000001	+	195971	195971	eaa48d4e-1945-4011-8bae-ded748af1fca	-3.82	-93.55	-89.73	1	1	GATGACGGGAA
-tig00000001	+	195982	195982	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.00	-97.76	-95.76	1	1	CCTGGCGCATT
-tig00000001	+	195994	196002	eaa48d4e-1945-4011-8bae-ded748af1fca	-7.35	-156.59	-149.24	1	2	CTGTGCGCCAGTTCGTCCA
-tig00000001	+	196018	196044	eaa48d4e-1945-4011-8bae-ded748af1fca	-19.80	-290.03	-270.23	1	7	ATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGAT
-tig00000001	+	196056	196056	eaa48d4e-1945-4011-8bae-ded748af1fca	-3.06	-85.18	-82.12	1	1	AAACTCGCTGA
-tig00000001	+	196067	196093	eaa48d4e-1945-4011-8bae-ded748af1fca	-21.22	-234.13	-212.91	1	5	TATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAG
-tig00000001	+	196122	196125	eaa48d4e-1945-4011-8bae-ded748af1fca	-9.58	-129.79	-120.21	1	2	CATGGCGGCGGTAT
-tig00000001	+	196136	196140	eaa48d4e-1945-4011-8bae-ded748af1fca	-3.47	-103.00	-99.54	1	2	CTTTTCGCCCGTGGG
-tig00000001	+	196155	196155	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.51	-86.42	-83.92	1	1	TACCACGCCAA
-tig00000001	+	196180	196190	eaa48d4e-1945-4011-8bae-ded748af1fca	-15.32	-176.28	-160.96	1	3	CCTTGCGCCCGCAGTCGCTGG
-tig00000001	+	196210	196210	eaa48d4e-1945-4011-8bae-ded748af1fca	-9.72	-142.24	-132.52	1	1	AGCATCGCCCA
-tig00000001	+	196224	196227	eaa48d4e-1945-4011-8bae-ded748af1fca	1.84	-76.08	-77.92	1	2	CTTCCCGACGCCTG
-tig00000001	+	196242	196242	eaa48d4e-1945-4011-8bae-ded748af1fca	-4.33	-129.49	-125.16	1	1	GGCACCGAAGA
-tig00000001	+	196264	196274	eaa48d4e-1945-4011-8bae-ded748af1fca	-19.83	-166.95	-147.12	1	4	TTCCCCGATGCGGCGCGGCAG
-tig00000001	+	196294	196319	eaa48d4e-1945-4011-8bae-ded748af1fca	-11.50	-225.47	-213.97	1	5	GCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
-tig00000001	+	196342	196342	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.05	-130.41	-128.36	1	1	TCCAGCGCCAG
-tig00000001	+	196372	196380	eaa48d4e-1945-4011-8bae-ded748af1fca	-4.11	-145.43	-141.32	1	2	ACAACCGGCTGGCCGATAT
-tig00000001	+	196396	196396	eaa48d4e-1945-4011-8bae-ded748af1fca	-0.52	-96.47	-95.94	1	1	ACCAGCGGTTG
-tig00000001	+	196416	196426	eaa48d4e-1945-4011-8bae-ded748af1fca	-7.06	-171.98	-164.91	1	2	TTTTGCGATCAGTTGCGTGAG
-tig00000001	+	196440	196440	eaa48d4e-1945-4011-8bae-ded748af1fca	-5.18	-96.20	-91.02	1	1	TTCAACGCTGA
-tig00000001	+	196451	196466	eaa48d4e-1945-4011-8bae-ded748af1fca	-22.84	-213.34	-190.50	1	5	GATTACGCGCTTTCGCCACGCGTGGG
-tig00000001	+	196483	196492	eaa48d4e-1945-4011-8bae-ded748af1fca	-16.82	-149.02	-132.21	1	3	CAGGCCGCCGCTTGCGGGTG
-tig00000001	+	196514	196527	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.66	-180.84	-178.18	1	3	CAGCCCGCTTGCCGATGCCGTCAC
-tig00000001	+	196542	196576	eaa48d4e-1945-4011-8bae-ded748af1fca	-18.59	-291.33	-272.73	1	7	TCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAAT
-tig00000001	+	196589	196595	eaa48d4e-1945-4011-8bae-ded748af1fca	-6.20	-134.01	-127.82	1	3	AGCAACGCGTGCGGCTA
-tig00000001	+	196629	196629	eaa48d4e-1945-4011-8bae-ded748af1fca	-6.19	-117.08	-110.88	1	1	CTGACCGCCAG
-tig00000001	+	196643	196643	eaa48d4e-1945-4011-8bae-ded748af1fca	-4.31	-78.45	-74.14	1	1	GCTCCCGCCAG
-tig00000001	+	196677	196690	eaa48d4e-1945-4011-8bae-ded748af1fca	-9.99	-190.15	-180.16	1	4	TCTGCCGTTGCCGACGGGCGACCA
-tig00000001	+	196706	196712	eaa48d4e-1945-4011-8bae-ded748af1fca	0.78	-113.17	-113.95	1	2	ATAGCCGTTGCCGGTAA
-tig00000001	+	196727	196749	eaa48d4e-1945-4011-8bae-ded748af1fca	-15.32	-162.16	-146.84	1	5	CTGCCCGATTAATGCCGAACCGCGCACCGTATC
-tig00000001	+	196762	196770	eaa48d4e-1945-4011-8bae-ded748af1fca	-1.15	-132.14	-130.99	1	2	CTTCACGAATCAACGAACC
-tig00000001	+	196810	196810	eaa48d4e-1945-4011-8bae-ded748af1fca	-8.24	-138.53	-130.29	1	1	CAGTACGGTGG
-tig00000001	+	196823	196834	eaa48d4e-1945-4011-8bae-ded748af1fca	-3.79	-144.74	-140.95	1	3	AGCAGCGGGTAAACGCCGCCAG
-tig00000001	+	196874	196878	eaa48d4e-1945-4011-8bae-ded748af1fca	-6.92	-116.19	-109.26	1	2	AATGCCGGACGTAAT
-tig00000001	+	196909	196915	eaa48d4e-1945-4011-8bae-ded748af1fca	0.71	-143.84	-144.55	1	2	CAGACCGCAAACGGTCA
-tig00000001	+	196945	196952	eaa48d4e-1945-4011-8bae-ded748af1fca	-4.88	-145.71	-140.83	1	2	GATACCGATAAACGGCAC
-tig00000001	+	196975	196975	eaa48d4e-1945-4011-8bae-ded748af1fca	-1.96	-92.26	-90.30	1	1	CAGACCGTAAA
-tig00000001	+	196992	196995	eaa48d4e-1945-4011-8bae-ded748af1fca	-10.50	-148.45	-137.95	1	2	AGTTACGGCGCAAC
-tig00000001	+	197011	197018	eaa48d4e-1945-4011-8bae-ded748af1fca	-8.84	-132.30	-123.46	1	2	AGAAGCGGTAAGCGGTTT
-tig00000001	+	197032	197041	eaa48d4e-1945-4011-8bae-ded748af1fca	-6.14	-172.95	-166.82	1	2	ACTCACGCCTTTAACGCCAG
-tig00000001	+	197059	197059	eaa48d4e-1945-4011-8bae-ded748af1fca	-1.86	-116.13	-114.27	1	1	AAAGACGATAA
-tig00000001	+	197071	197071	eaa48d4e-1945-4011-8bae-ded748af1fca	-8.90	-122.66	-113.76	1	1	CAAGGCGTTGA
-tig00000001	+	197084	197084	eaa48d4e-1945-4011-8bae-ded748af1fca	-0.03	-116.62	-116.59	1	1	ATCACCGCACT
-tig00000001	+	197098	197108	eaa48d4e-1945-4011-8bae-ded748af1fca	-24.42	-207.15	-182.72	1	3	GATTGCGGAGTCGGGCGAATG
-tig00000001	+	197132	197132	eaa48d4e-1945-4011-8bae-ded748af1fca	-0.84	-111.38	-110.53	1	1	TTCAGCGCATT
-tig00000001	+	197144	197168	eaa48d4e-1945-4011-8bae-ded748af1fca	-16.68	-246.26	-229.58	1	6	AACTGCGGATACGTTGCCGCGAATGCCGCCGGAAT
-tig00000001	+	197179	197197	eaa48d4e-1945-4011-8bae-ded748af1fca	-15.54	-215.74	-200.20	1	3	AATGGCGAAGTATTTCGCCACATCGTTGG
-tig00000001	+	197222	197229	eaa48d4e-1945-4011-8bae-ded748af1fca	-6.54	-160.29	-153.74	1	2	GTCAGCGAGCCACGGGTC
-tig00000001	+	197266	197266	eaa48d4e-1945-4011-8bae-ded748af1fca	-6.79	-121.25	-114.46	1	1	CACCTCGATCA
-tig00000001	+	197279	197279	eaa48d4e-1945-4011-8bae-ded748af1fca	-4.35	-120.37	-116.02	1	1	TTGGTCGGGTT
-tig00000001	+	197290	197296	eaa48d4e-1945-4011-8bae-ded748af1fca	-10.08	-132.19	-122.11	1	2	AGAGTCGAGATCGACCA
-tig00000001	+	197309	197321	eaa48d4e-1945-4011-8bae-ded748af1fca	-12.73	-191.33	-178.61	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	+	197332	197350	eaa48d4e-1945-4011-8bae-ded748af1fca	-15.18	-191.01	-175.83	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	+	197363	197420	eaa48d4e-1945-4011-8bae-ded748af1fca	-36.11	-449.62	-413.52	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	+	197433	197433	eaa48d4e-1945-4011-8bae-ded748af1fca	-3.74	-133.95	-130.21	1	1	ACTGACGGATC
-tig00000001	+	197456	197470	eaa48d4e-1945-4011-8bae-ded748af1fca	-16.57	-232.01	-215.44	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	+	197482	197509	eaa48d4e-1945-4011-8bae-ded748af1fca	-25.44	-223.30	-197.86	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	+	197520	197530	eaa48d4e-1945-4011-8bae-ded748af1fca	-19.43	-163.17	-143.74	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	+	197543	197543	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.37	-121.81	-119.45	1	1	ATCACCGTTTT
-tig00000001	+	197562	197577	eaa48d4e-1945-4011-8bae-ded748af1fca	-13.04	-179.00	-165.95	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	+	197590	197599	eaa48d4e-1945-4011-8bae-ded748af1fca	-4.34	-160.18	-155.84	1	2	AATACCGCCTTTGACGATAT
-tig00000001	+	197612	197620	eaa48d4e-1945-4011-8bae-ded748af1fca	-10.57	-151.04	-140.47	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	+	197631	197631	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.29	-88.88	-86.59	1	1	GCACACGAGAA
-tig00000001	+	197654	197657	eaa48d4e-1945-4011-8bae-ded748af1fca	-7.04	-163.64	-156.59	1	2	ACCAGCGGCGTGGC
-tig00000001	+	197670	197672	eaa48d4e-1945-4011-8bae-ded748af1fca	-15.25	-117.65	-102.40	1	2	CCTGACGCGCAAC
-tig00000001	+	197683	197683	eaa48d4e-1945-4011-8bae-ded748af1fca	1.40	-118.09	-119.49	1	1	CTGATCGACTT
-tig00000001	+	197701	197701	eaa48d4e-1945-4011-8bae-ded748af1fca	-5.69	-153.87	-148.18	1	1	AACATCGGTAG
-tig00000001	+	197719	197719	eaa48d4e-1945-4011-8bae-ded748af1fca	-3.46	-102.45	-98.99	1	1	ACCACCGTTAG
-tig00000001	+	197736	197749	eaa48d4e-1945-4011-8bae-ded748af1fca	-15.74	-163.72	-147.99	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	+	197763	197779	eaa48d4e-1945-4011-8bae-ded748af1fca	-7.51	-245.00	-237.49	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	+	197791	197816	eaa48d4e-1945-4011-8bae-ded748af1fca	-13.70	-255.26	-241.57	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	+	197837	197837	eaa48d4e-1945-4011-8bae-ded748af1fca	-6.33	-110.38	-104.04	1	1	TGGAGCGACTG
-tig00000001	+	197848	197856	eaa48d4e-1945-4011-8bae-ded748af1fca	-13.79	-165.96	-152.16	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	+	197868	197878	eaa48d4e-1945-4011-8bae-ded748af1fca	-3.26	-160.74	-157.48	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	+	197895	197906	eaa48d4e-1945-4011-8bae-ded748af1fca	-7.61	-161.23	-153.62	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	+	197921	197921	eaa48d4e-1945-4011-8bae-ded748af1fca	-3.96	-111.98	-108.02	1	1	GCCAGCGAAGC
-tig00000001	+	197935	197948	eaa48d4e-1945-4011-8bae-ded748af1fca	-6.47	-194.49	-188.01	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	+	197960	197969	eaa48d4e-1945-4011-8bae-ded748af1fca	-12.78	-162.60	-149.83	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	+	197982	197999	eaa48d4e-1945-4011-8bae-ded748af1fca	-10.21	-282.71	-272.49	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	+	198014	198014	eaa48d4e-1945-4011-8bae-ded748af1fca	-5.39	-135.14	-129.75	1	1	GGTGCCGGTTT
-tig00000001	+	198035	198051	eaa48d4e-1945-4011-8bae-ded748af1fca	-13.29	-222.22	-208.94	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	+	198064	198068	eaa48d4e-1945-4011-8bae-ded748af1fca	-11.26	-143.50	-132.24	1	2	CTGCACGTCCGCTGG
-tig00000001	+	198087	198089	eaa48d4e-1945-4011-8bae-ded748af1fca	-3.44	-103.68	-100.24	1	2	ACATTCGCGCCTA
-tig00000001	+	198100	198123	eaa48d4e-1945-4011-8bae-ded748af1fca	-8.84	-295.04	-286.20	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	+	198137	198137	eaa48d4e-1945-4011-8bae-ded748af1fca	0.42	-127.73	-128.15	1	1	CAGGCCGCCAA
-tig00000001	+	198171	198171	eaa48d4e-1945-4011-8bae-ded748af1fca	-1.30	-129.89	-128.59	1	1	AGCAGCGCCAC
-tig00000001	+	198183	198188	eaa48d4e-1945-4011-8bae-ded748af1fca	-5.19	-151.86	-146.67	1	2	AGTACCGTTACGCTGA
-tig00000001	+	198203	198233	eaa48d4e-1945-4011-8bae-ded748af1fca	-16.49	-266.91	-250.42	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	+	198250	198250	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.89	-75.98	-73.10	1	1	AAAGACGATAG
-tig00000001	+	198289	198313	eaa48d4e-1945-4011-8bae-ded748af1fca	-22.79	-279.17	-256.38	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	+	198326	198336	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.74	-172.31	-169.57	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	+	198352	198364	eaa48d4e-1945-4011-8bae-ded748af1fca	-11.74	-176.13	-164.39	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	+	198399	198415	eaa48d4e-1945-4011-8bae-ded748af1fca	-22.16	-200.30	-178.15	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	+	198427	198485	eaa48d4e-1945-4011-8bae-ded748af1fca	-33.42	-369.57	-336.15	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	+	198513	198513	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.35	-117.42	-115.08	1	1	ACCATCGCAGG
-tig00000001	+	198527	198527	eaa48d4e-1945-4011-8bae-ded748af1fca	-0.90	-117.28	-116.38	1	1	AATATCGCCAG
-tig00000001	+	198545	198569	eaa48d4e-1945-4011-8bae-ded748af1fca	-22.07	-262.77	-240.71	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	+	198585	198619	eaa48d4e-1945-4011-8bae-ded748af1fca	-35.82	-313.61	-277.79	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	+	198660	198670	eaa48d4e-1945-4011-8bae-ded748af1fca	-8.26	-160.82	-152.56	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	+	198684	198710	eaa48d4e-1945-4011-8bae-ded748af1fca	-17.17	-274.37	-257.20	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	+	198728	198782	eaa48d4e-1945-4011-8bae-ded748af1fca	-20.92	-369.31	-348.39	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	+	198812	198821	eaa48d4e-1945-4011-8bae-ded748af1fca	-7.77	-159.56	-151.79	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	+	198834	198855	eaa48d4e-1945-4011-8bae-ded748af1fca	-16.42	-218.08	-201.66	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	+	198872	198872	eaa48d4e-1945-4011-8bae-ded748af1fca	-3.95	-111.19	-107.24	1	1	TTCACCGCTTC
-tig00000001	+	198884	198892	eaa48d4e-1945-4011-8bae-ded748af1fca	-11.96	-195.21	-183.25	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	+	198907	198914	eaa48d4e-1945-4011-8bae-ded748af1fca	-4.01	-141.17	-137.16	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	+	198927	198927	eaa48d4e-1945-4011-8bae-ded748af1fca	-1.14	-95.82	-94.68	1	1	GTTTACGACTC
-tig00000001	+	198972	198987	eaa48d4e-1945-4011-8bae-ded748af1fca	-10.81	-191.46	-180.66	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	+	199013	199013	eaa48d4e-1945-4011-8bae-ded748af1fca	-0.73	-111.11	-110.38	1	1	CAGTGCGCCAA
-tig00000001	+	199028	199034	eaa48d4e-1945-4011-8bae-ded748af1fca	-7.36	-173.72	-166.35	1	2	CAACACGGTGCCGATTA
-tig00000001	+	199056	199088	eaa48d4e-1945-4011-8bae-ded748af1fca	-28.28	-316.42	-288.14	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	+	199112	199117	eaa48d4e-1945-4011-8bae-ded748af1fca	-0.05	-154.11	-154.06	1	2	ACCAGCGAACCGGCAA
-tig00000001	+	199133	199133	eaa48d4e-1945-4011-8bae-ded748af1fca	0.66	-125.19	-125.85	1	1	ATCACCGGGAT
-tig00000001	+	199147	199156	eaa48d4e-1945-4011-8bae-ded748af1fca	-4.22	-123.41	-119.19	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	+	199172	199172	eaa48d4e-1945-4011-8bae-ded748af1fca	-1.04	-105.38	-104.34	1	1	CAGAACGCCAG
-tig00000001	+	199193	199193	eaa48d4e-1945-4011-8bae-ded748af1fca	-4.26	-124.16	-119.90	1	1	CAGAACGGAGA
-tig00000001	+	199204	199228	eaa48d4e-1945-4011-8bae-ded748af1fca	-20.73	-289.64	-268.92	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	+	199240	199255	eaa48d4e-1945-4011-8bae-ded748af1fca	-11.06	-170.32	-159.25	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	+	199267	199267	eaa48d4e-1945-4011-8bae-ded748af1fca	-6.39	-104.48	-98.09	1	1	CACTTCGCTAA
-tig00000001	+	199280	199280	eaa48d4e-1945-4011-8bae-ded748af1fca	-4.23	-130.15	-125.92	1	1	CCATGCGGGCC
-tig00000001	+	199300	199336	eaa48d4e-1945-4011-8bae-ded748af1fca	-45.48	-342.58	-297.09	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	+	199352	199355	eaa48d4e-1945-4011-8bae-ded748af1fca	-6.83	-111.77	-104.94	1	2	ACCAGCGTCGGGGT
-tig00000001	+	199393	199402	eaa48d4e-1945-4011-8bae-ded748af1fca	-15.05	-173.33	-158.28	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	+	199423	199430	eaa48d4e-1945-4011-8bae-ded748af1fca	-5.28	-162.97	-157.68	1	2	TATTCCGGTGTACGACCA
-tig00000001	+	199446	199446	eaa48d4e-1945-4011-8bae-ded748af1fca	-3.91	-137.64	-133.72	1	1	CAGCCCGGCAA
-tig00000001	+	199459	199459	eaa48d4e-1945-4011-8bae-ded748af1fca	-10.10	-121.95	-111.85	1	1	AACACCGCCAG
-tig00000001	+	199485	199485	eaa48d4e-1945-4011-8bae-ded748af1fca	1.26	-94.06	-95.31	1	1	CATGCCGTAAA
-tig00000001	+	199500	199509	eaa48d4e-1945-4011-8bae-ded748af1fca	-12.32	-141.73	-129.42	1	3	AGAACCGACACCGCCGAACA
-tig00000001	+	199543	199543	eaa48d4e-1945-4011-8bae-ded748af1fca	-14.31	-119.56	-105.25	1	1	CACATCGGCAC
-tig00000001	+	199557	199570	eaa48d4e-1945-4011-8bae-ded748af1fca	-18.79	-193.43	-174.63	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	+	199582	199593	eaa48d4e-1945-4011-8bae-ded748af1fca	-14.01	-150.52	-136.51	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	+	199606	199621	eaa48d4e-1945-4011-8bae-ded748af1fca	-8.65	-166.25	-157.60	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	+	199644	199652	eaa48d4e-1945-4011-8bae-ded748af1fca	-26.78	-182.14	-155.37	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	+	199687	199687	eaa48d4e-1945-4011-8bae-ded748af1fca	-0.43	-106.78	-106.34	1	1	CTGTCCGTGCC
-tig00000001	+	199740	199746	eaa48d4e-1945-4011-8bae-ded748af1fca	-11.98	-165.48	-153.49	1	2	CACCACGCCTACGCAGA
-tig00000001	+	199770	199770	eaa48d4e-1945-4011-8bae-ded748af1fca	-4.81	-91.42	-86.60	1	1	GACATCGCCCA
-tig00000001	+	199786	199802	eaa48d4e-1945-4011-8bae-ded748af1fca	-9.04	-213.40	-204.36	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	+	199833	199836	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.59	-121.19	-118.59	1	2	CACAGCGCCGTTGG
-tig00000001	+	199854	199854	eaa48d4e-1945-4011-8bae-ded748af1fca	-1.71	-112.03	-110.32	1	1	AAGATCGCCAG
-tig00000001	+	199868	199868	eaa48d4e-1945-4011-8bae-ded748af1fca	-6.34	-144.44	-138.10	1	1	CTGCACGAAGT
-tig00000001	+	199883	199883	eaa48d4e-1945-4011-8bae-ded748af1fca	-5.39	-181.94	-176.55	1	1	CAGTGCGGTTG
-tig00000001	+	199899	199908	eaa48d4e-1945-4011-8bae-ded748af1fca	-15.57	-180.21	-164.65	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	+	199931	199943	eaa48d4e-1945-4011-8bae-ded748af1fca	-16.01	-164.41	-148.40	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	+	199956	199956	eaa48d4e-1945-4011-8bae-ded748af1fca	-0.16	-85.37	-85.21	1	1	TTGATCGCTTC
-tig00000001	+	199998	199998	eaa48d4e-1945-4011-8bae-ded748af1fca	-4.85	-130.02	-125.17	1	1	TGTTGCGCTCC
 tig00000001	+	200009	200009	eaa48d4e-1945-4011-8bae-ded748af1fca	-7.11	-98.69	-91.58	1	1	TTCAACGGTAT
 tig00000001	+	200046	200046	eaa48d4e-1945-4011-8bae-ded748af1fca	-6.69	-110.51	-103.82	1	1	TGCAGCGCACC
 tig00000001	+	200081	200081	eaa48d4e-1945-4011-8bae-ded748af1fca	-4.37	-127.44	-123.08	1	1	AACAACGCCAC
@@ -3711,298 +480,6 @@
 tig00000001	+	201922	201930	eaa48d4e-1945-4011-8bae-ded748af1fca	-9.12	-167.27	-158.15	1	2	GTCACCGGCTGGCCGCACT
 tig00000001	+	201944	201950	eaa48d4e-1945-4011-8bae-ded748af1fca	-18.65	-133.91	-115.25	1	2	GCAGGCGCTGCCGGAAG
 tig00000001	+	201961	201986	eaa48d4e-1945-4011-8bae-ded748af1fca	-17.02	-244.42	-227.39	1	4	AACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAA
-tig00000001	+	201998	202007	eaa48d4e-1945-4011-8bae-ded748af1fca	-0.67	-190.77	-190.10	1	2	CAGTCCGCAGGGGCCGTGGT
-tig00000001	+	202020	202020	eaa48d4e-1945-4011-8bae-ded748af1fca	-10.98	-128.86	-117.88	1	1	CTGCTCGGCTG
-tig00000001	+	202033	202046	eaa48d4e-1945-4011-8bae-ded748af1fca	-17.91	-167.75	-149.83	1	3	GTGAGCGGGTGCCGGAAGCGGATG
-tig00000001	+	202064	202081	eaa48d4e-1945-4011-8bae-ded748af1fca	-40.52	-232.26	-191.74	1	5	GCCTGCGCCGCTGCCGCCGTACCGGGTA
-tig00000001	+	202092	202092	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.76	-112.07	-109.31	1	1	CTGACCGGGCT
-tig00000001	+	202105	202143	eaa48d4e-1945-4011-8bae-ded748af1fca	-47.95	-329.36	-281.40	1	8	TGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGA
-tig00000001	+	202155	202198	eaa48d4e-1945-4011-8bae-ded748af1fca	-47.93	-390.04	-342.12	1	8	TTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTG
-tig00000001	+	202214	202225	eaa48d4e-1945-4011-8bae-ded748af1fca	-11.50	-192.65	-181.16	1	3	GACCACGCAGGCGCAGCGGGCA
-tig00000001	+	202240	202240	eaa48d4e-1945-4011-8bae-ded748af1fca	-3.30	-94.15	-90.86	1	1	AAGCCCGGCAG
-tig00000001	+	202257	202275	eaa48d4e-1945-4011-8bae-ded748af1fca	-13.18	-203.70	-190.52	1	5	ATTTCCGGCGGGACGGAACCGTCCGCTTT
-tig00000001	+	202295	202330	eaa48d4e-1945-4011-8bae-ded748af1fca	-12.89	-347.67	-334.78	1	5	CCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTG
-tig00000001	+	202341	202341	eaa48d4e-1945-4011-8bae-ded748af1fca	-7.64	-135.69	-128.05	1	1	TCTGCCGTGTG
-tig00000001	+	202352	202370	eaa48d4e-1945-4011-8bae-ded748af1fca	-15.77	-193.42	-177.65	1	4	GCTGACGCACGACCCGGAATACCCGGAGA
-tig00000001	+	202386	202399	eaa48d4e-1945-4011-8bae-ded748af1fca	-17.81	-235.89	-218.08	1	4	CCTGCCGCGCCGCTGGTGCGCTAT
-tig00000001	+	202412	202432	eaa48d4e-1945-4011-8bae-ded748af1fca	-14.43	-237.99	-223.56	1	6	CTGGACGCCCGCGGCGAACTGGCGGCGGTGT
-tig00000001	+	202443	202443	eaa48d4e-1945-4011-8bae-ded748af1fca	-0.77	-113.38	-112.61	1	1	ATGACCGCAGC
-tig00000001	+	202461	202461	eaa48d4e-1945-4011-8bae-ded748af1fca	-5.14	-120.52	-115.38	1	1	AGGTGCGCAGC
-tig00000001	+	202475	202475	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.30	-100.75	-98.46	1	1	ACTTACGATGA
-tig00000001	+	202488	202525	eaa48d4e-1945-4011-8bae-ded748af1fca	-3.78	-300.48	-296.70	1	7	AATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAA
-tig00000001	+	202539	202557	eaa48d4e-1945-4011-8bae-ded748af1fca	-26.78	-193.86	-167.08	1	5	GTTACCGTTACGACAGCGACGGGCGGGTG
-tig00000001	+	202579	202579	eaa48d4e-1945-4011-8bae-ded748af1fca	-4.46	-124.67	-120.21	1	1	AAACCCGGCAG
-tig00000001	+	202597	202597	eaa48d4e-1945-4011-8bae-ded748af1fca	-5.81	-93.66	-87.85	1	1	TTACACGTATC
-tig00000001	+	202617	202617	eaa48d4e-1945-4011-8bae-ded748af1fca	0.48	-88.72	-89.20	1	1	AGGACCGCATC
-tig00000001	+	202631	202631	eaa48d4e-1945-4011-8bae-ded748af1fca	-0.44	-90.55	-90.10	1	1	ATCACCGACAG
-tig00000001	+	202644	202647	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.99	-133.55	-130.56	1	2	TGAACCGCCGTGAA
-tig00000001	+	202663	202663	eaa48d4e-1945-4011-8bae-ded748af1fca	-8.17	-151.12	-142.95	1	1	GCACACGCAGG
-tig00000001	+	202676	202686	eaa48d4e-1945-4011-8bae-ded748af1fca	-23.65	-206.73	-183.08	1	2	GAAGGCGGGCTGAAGCGGGTG
-tig00000001	+	202705	202722	eaa48d4e-1945-4011-8bae-ded748af1fca	-9.50	-186.37	-176.88	1	5	GAACACGCGGACGGCAGCGTCACGCAGA
-tig00000001	+	202738	202740	eaa48d4e-1945-4011-8bae-ded748af1fca	-4.83	-142.26	-137.43	1	2	TTTGACGCGGTGG
-tig00000001	+	202764	202771	eaa48d4e-1945-4011-8bae-ded748af1fca	-9.84	-167.56	-157.72	1	2	ACAGACGGATGCCGCAGG
-tig00000001	+	202797	202797	eaa48d4e-1945-4011-8bae-ded748af1fca	1.92	-105.09	-107.01	1	1	CAGTCCGGATG
-tig00000001	+	202809	202809	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.33	-99.19	-96.86	1	1	GGTGACGGGCC
-tig00000001	+	202821	202836	eaa48d4e-1945-4011-8bae-ded748af1fca	-31.82	-246.80	-214.98	1	4	CATCACGCGCATCACCACGCCGGATG
-tig00000001	+	202851	202854	eaa48d4e-1945-4011-8bae-ded748af1fca	-11.00	-125.31	-114.31	1	2	GGCATCGGCGTTTT
-tig00000001	+	202884	202903	eaa48d4e-1945-4011-8bae-ded748af1fca	-15.72	-229.35	-213.62	1	3	GTTAACGTCAGCCACCGGGCCTGACGGGCT
-tig00000001	+	202916	202919	eaa48d4e-1945-4011-8bae-ded748af1fca	-7.82	-111.74	-103.93	1	2	AAATACGCCGGGAA
-tig00000001	+	202940	202940	eaa48d4e-1945-4011-8bae-ded748af1fca	0.32	-84.67	-84.98	1	1	GGGGCCGTCTG
-tig00000001	+	202966	202985	eaa48d4e-1945-4011-8bae-ded748af1fca	-6.35	-195.26	-188.92	1	4	CCTGACGGCGATATCACCCGCTACCGTTAT
-tig00000001	+	203017	203022	eaa48d4e-1945-4011-8bae-ded748af1fca	-5.54	-140.95	-135.41	1	2	CCCTGCGCAACGGAAG
-tig00000001	+	203035	203042	eaa48d4e-1945-4011-8bae-ded748af1fca	0.51	-139.08	-139.59	1	2	GCCACCGGCAGCCGGAAA
-tig00000001	+	203055	203068	eaa48d4e-1945-4011-8bae-ded748af1fca	-9.44	-163.06	-153.61	1	3	CATGACGTGGAGCCGTTACGGTCA
-tig00000001	+	203098	203098	eaa48d4e-1945-4011-8bae-ded748af1fca	-3.52	-103.01	-99.49	1	1	TGTTCCGGTTA
-tig00000001	+	203111	203111	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.38	-110.28	-107.90	1	1	TAACCCGCTAT
-tig00000001	+	203126	203126	eaa48d4e-1945-4011-8bae-ded748af1fca	-0.35	-115.41	-115.06	1	1	ATGACCGTTTT
-tig00000001	+	203142	203155	eaa48d4e-1945-4011-8bae-ded748af1fca	-9.80	-140.12	-130.33	1	4	GGTGACGGCGGTGCACCGCGAGGA
-tig00000001	+	203177	203192	eaa48d4e-1945-4011-8bae-ded748af1fca	0.21	-170.38	-170.59	1	4	AGTACCGCGCATACGACAGCCGTGGA
-tig00000001	+	203209	203209	eaa48d4e-1945-4011-8bae-ded748af1fca	1.59	-125.05	-126.64	1	1	ATTGCCGTGAA
-tig00000001	+	203220	203220	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.11	-122.35	-120.24	1	1	AGACACGCAGG
-tig00000001	+	203235	203237	eaa48d4e-1945-4011-8bae-ded748af1fca	-3.70	-120.72	-117.02	1	2	TGAAACGCGGTAT
-tig00000001	+	203251	203257	eaa48d4e-1945-4011-8bae-ded748af1fca	-10.22	-207.65	-197.43	1	3	TACAACGCCGCCGGTGA
-tig00000001	+	203272	203272	eaa48d4e-1945-4011-8bae-ded748af1fca	-7.81	-118.15	-110.34	1	1	ACCACCGTCAT
-tig00000001	+	203283	203287	eaa48d4e-1945-4011-8bae-ded748af1fca	-5.27	-130.72	-125.45	1	2	TGCCCCGGACGGCAG
-tig00000001	+	203299	203299	eaa48d4e-1945-4011-8bae-ded748af1fca	-3.96	-167.13	-163.17	1	1	AGAAACGGGAC
-tig00000001	+	203311	203316	eaa48d4e-1945-4011-8bae-ded748af1fca	-20.49	-179.73	-159.24	1	2	CAGTACGATGCGTGGG
-tig00000001	+	203340	203357	eaa48d4e-1945-4011-8bae-ded748af1fca	-28.30	-230.00	-201.70	1	4	TACCACGCAGGGCGGTCTGACGCGCAGT
-tig00000001	+	203371	203393	eaa48d4e-1945-4011-8bae-ded748af1fca	-20.92	-259.26	-238.33	1	4	GAATACGATGCTGCCGGACGGGTCATCCGCCTG
-tig00000001	+	203410	203410	eaa48d4e-1945-4011-8bae-ded748af1fca	-13.30	-104.89	-91.59	1	1	GAAAACGGCAG
-tig00000001	+	203429	203447	eaa48d4e-1945-4011-8bae-ded748af1fca	-4.08	-205.00	-200.92	1	4	CCTTCCGTTACGATGTACTCGACCGGCTG
-tig00000001	+	203464	203486	eaa48d4e-1945-4011-8bae-ded748af1fca	-20.64	-269.63	-248.99	1	4	GAAACCGGCTTTGACGGCCGCACACAGCGTTAT
-tig00000001	+	203497	203506	eaa48d4e-1945-4011-8bae-ded748af1fca	-3.27	-155.76	-152.49	1	2	CACCACGACCTGACCGGCAA
-tig00000001	+	203519	203524	eaa48d4e-1945-4011-8bae-ded748af1fca	-3.59	-126.09	-122.50	1	2	TTATCCGCAGCGAGGA
-tig00000001	+	203560	203609	eaa48d4e-1945-4011-8bae-ded748af1fca	-33.32	-409.29	-375.97	1	8	TATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGG
-tig00000001	+	203623	203629	eaa48d4e-1945-4011-8bae-ded748af1fca	-8.07	-156.82	-148.75	1	3	TATGACGAACGCGGCTG
-tig00000001	+	203659	203676	eaa48d4e-1945-4011-8bae-ded748af1fca	-8.25	-189.93	-181.68	1	3	ATCAGCGAAGGGCACCGGGTGACGGTGC
-tig00000001	+	203705	203710	eaa48d4e-1945-4011-8bae-ded748af1fca	-4.41	-130.25	-125.83	1	2	AAGGCCGCCTCGCCAG
-tig00000001	+	203727	203727	eaa48d4e-1945-4011-8bae-ded748af1fca	-11.07	-147.38	-136.31	1	1	CCTGACGGTGC
-tig00000001	+	203739	203745	eaa48d4e-1945-4011-8bae-ded748af1fca	-8.06	-162.65	-154.58	1	2	TCATCCGCAGACGAATG
-tig00000001	+	203781	203788	eaa48d4e-1945-4011-8bae-ded748af1fca	-13.83	-168.27	-154.44	1	2	ACATGCGTACAACGCACA
-tig00000001	+	203802	203817	eaa48d4e-1945-4011-8bae-ded748af1fca	-14.05	-218.04	-203.99	1	3	ACTGGCGAACCGCTGTATACCGGACA
-tig00000001	+	203830	203833	eaa48d4e-1945-4011-8bae-ded748af1fca	-13.14	-186.42	-173.28	1	2	CTGCCCGCCGTGGA
-tig00000001	+	203851	203857	eaa48d4e-1945-4011-8bae-ded748af1fca	-6.72	-136.74	-130.02	1	2	ACCTACGGCAGCGGCTG
-tig00000001	+	203881	203892	eaa48d4e-1945-4011-8bae-ded748af1fca	-18.68	-172.33	-153.65	1	3	AAACTCGGCGACACACCGCTGG
-tig00000001	+	203909	203948	eaa48d4e-1945-4011-8bae-ded748af1fca	-31.38	-305.69	-274.31	1	8	ACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTAT
-tig00000001	+	203965	203965	eaa48d4e-1945-4011-8bae-ded748af1fca	-9.85	-103.37	-93.52	1	1	ACCACCGCTTA
-tig00000001	+	203980	203980	eaa48d4e-1945-4011-8bae-ded748af1fca	-9.04	-136.81	-127.77	1	1	CCTGCCGGGCA
-tig00000001	+	204023	204025	eaa48d4e-1945-4011-8bae-ded748af1fca	-5.78	-134.04	-128.26	1	2	CTGACCGCGATTA
-tig00000001	+	204040	204059	eaa48d4e-1945-4011-8bae-ded748af1fca	-24.99	-238.22	-213.23	1	4	TGGAACGACAACGGCGAACTCATCCGCATC
-tig00000001	+	204072	204083	eaa48d4e-1945-4011-8bae-ded748af1fca	-10.87	-145.87	-134.99	1	3	CAGCCCGCGCCAGACCCGGAGT
-tig00000001	+	204106	204106	eaa48d4e-1945-4011-8bae-ded748af1fca	-6.89	-141.44	-134.55	1	1	ACCACCGGCAG
-tig00000001	+	204118	204121	eaa48d4e-1945-4011-8bae-ded748af1fca	-4.89	-108.64	-103.75	1	2	CTGACCGGCGTTCA
-tig00000001	+	204133	204138	eaa48d4e-1945-4011-8bae-ded748af1fca	-7.58	-111.78	-104.19	1	2	ACCACCGCAGCGAATC
-tig00000001	+	204152	204159	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.73	-127.46	-124.73	1	2	ATATCCGCATCCCGTATA
-tig00000001	+	204174	204174	eaa48d4e-1945-4011-8bae-ded748af1fca	-3.94	-94.60	-90.66	1	1	AGACCCGGCAG
-tig00000001	+	204185	204198	eaa48d4e-1945-4011-8bae-ded748af1fca	-5.25	-170.03	-164.78	1	3	GTAACCGCCTGCCCGACCCGGAGC
-tig00000001	+	204210	204217	eaa48d4e-1945-4011-8bae-ded748af1fca	-10.31	-135.93	-125.62	1	2	GCACCCGGACAGCGCCCT
-tig00000001	+	204234	204258	eaa48d4e-1945-4011-8bae-ded748af1fca	-16.34	-275.19	-258.85	1	6	GTGGCCGGATAACCGTATCGCCCGTGACGCGCACT
-tig00000001	+	204272	204286	eaa48d4e-1945-4011-8bae-ded748af1fca	-15.55	-196.09	-180.54	1	3	TTTACCGGTATGACCGTCACGGCAG
-tig00000001	+	204307	204307	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.86	-127.49	-124.63	1	1	AAAACCGACCT
-tig00000001	+	204318	204318	eaa48d4e-1945-4011-8bae-ded748af1fca	-1.67	-128.32	-126.65	1	1	CATCCCGGAAG
-tig00000001	+	204331	204335	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.22	-115.08	-112.85	1	2	TTATCCGCACGGATG
-tig00000001	+	204346	204355	eaa48d4e-1945-4011-8bae-ded748af1fca	-12.92	-164.80	-151.88	1	2	ATGAGCGCACCCACCGGTAC
-tig00000001	+	204366	204366	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.85	-103.28	-100.43	1	1	CATTACGACAG
-tig00000001	+	204379	204379	eaa48d4e-1945-4011-8bae-ded748af1fca	-8.09	-107.79	-99.69	1	1	AGCACCGGCTG
-tig00000001	+	204395	204397	eaa48d4e-1945-4011-8bae-ded748af1fca	-1.57	-123.29	-121.72	1	2	CTACACGCGGACA
-tig00000001	+	204416	204430	eaa48d4e-1945-4011-8bae-ded748af1fca	-10.39	-154.13	-143.74	1	3	AGAGCCGCTGGTCGAAAGTCGCTAT
-tig00000001	+	204441	204454	eaa48d4e-1945-4011-8bae-ded748af1fca	-10.71	-182.73	-172.03	1	3	CTTTACGACCCGCTGGGCCGCAGG
-tig00000001	+	204469	204497	eaa48d4e-1945-4011-8bae-ded748af1fca	-18.37	-309.00	-290.64	1	5	CAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCT
-tig00000001	+	204509	204524	eaa48d4e-1945-4011-8bae-ded748af1fca	-16.14	-211.25	-195.11	1	3	GATGTCGCTGTCACGGAAACCGCAAG
-tig00000001	+	204540	204596	eaa48d4e-1945-4011-8bae-ded748af1fca	-41.08	-479.69	-438.61	1	8	TGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTT
-tig00000001	+	204608	204608	eaa48d4e-1945-4011-8bae-ded748af1fca	-1.67	-100.16	-98.50	1	1	TCAGCCGGGGA
-tig00000001	+	204620	204620	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.40	-81.98	-79.58	1	1	CTTCACGCCAC
-tig00000001	+	204642	204648	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.50	-146.47	-143.97	1	2	GAAACCGCCACCGGTGA
-tig00000001	+	204659	204683	eaa48d4e-1945-4011-8bae-ded748af1fca	-14.47	-203.62	-189.14	1	5	GCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATA
-tig00000001	+	204702	204714	eaa48d4e-1945-4011-8bae-ded748af1fca	5.33	-234.18	-239.52	1	3	CAGTCCGGTGGCGAAGACGGTGG
-tig00000001	+	204734	204737	eaa48d4e-1945-4011-8bae-ded748af1fca	-10.91	-148.18	-137.27	1	2	GTTCCCGCCGGTGC
-tig00000001	+	204756	204760	eaa48d4e-1945-4011-8bae-ded748af1fca	-3.01	-178.00	-174.99	1	2	ATGCTCGACCGGCTG
-tig00000001	+	204787	204787	eaa48d4e-1945-4011-8bae-ded748af1fca	-1.22	-113.82	-112.61	1	1	CTGACCGGGTG
-tig00000001	+	204805	204808	eaa48d4e-1945-4011-8bae-ded748af1fca	-14.50	-120.37	-105.88	1	2	AAAGCCGCCGCTGG
-tig00000001	+	204821	204839	eaa48d4e-1945-4011-8bae-ded748af1fca	-17.72	-196.80	-179.08	1	4	GGCATCGTGCGGCCTGACGGTGGCGCAGA
-tig00000001	+	204863	204880	eaa48d4e-1945-4011-8bae-ded748af1fca	-11.71	-201.77	-190.06	1	5	GGACCCGGTATACACGCCGGCGCGAAAA
-tig00000001	+	204903	204920	eaa48d4e-1945-4011-8bae-ded748af1fca	-10.74	-178.56	-167.82	1	4	CACTGCGACCATCGCGGCCTGCCGCTGG
-tig00000001	+	204938	204938	eaa48d4e-1945-4011-8bae-ded748af1fca	-0.77	-127.79	-127.02	1	1	CAGCACGGAAG
-tig00000001	+	204953	204969	eaa48d4e-1945-4011-8bae-ded748af1fca	-11.45	-183.84	-172.38	1	3	AACAGCGTGGTACGCAGAATACGATGA
-tig00000001	+	205004	205004	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.86	-90.86	-88.01	1	1	GAACCCGCATC
-tig00000001	+	205027	205034	eaa48d4e-1945-4011-8bae-ded748af1fca	-6.51	-132.58	-126.07	1	2	TTATCCGCCTGCCGGGGC
-tig00000001	+	205059	205059	eaa48d4e-1945-4011-8bae-ded748af1fca	-4.08	-103.00	-98.92	1	1	GAGTCCGGCCT
-tig00000001	+	205075	205081	eaa48d4e-1945-4011-8bae-ded748af1fca	-7.63	-122.15	-114.52	1	2	ACAACCGCCACCGCTAT
-tig00000001	+	205094	205094	eaa48d4e-1945-4011-8bae-ded748af1fca	-0.32	-97.01	-96.69	1	1	TGACCCGCTGC
-tig00000001	+	205105	205105	eaa48d4e-1945-4011-8bae-ded748af1fca	-6.65	-103.04	-96.39	1	1	AGGGGCGATAT
-tig00000001	+	205124	205124	eaa48d4e-1945-4011-8bae-ded748af1fca	0.55	-144.17	-144.72	1	1	GGATCCGATTG
-tig00000001	+	205161	205170	eaa48d4e-1945-4011-8bae-ded748af1fca	-4.43	-170.93	-166.51	1	2	GTATCCGTTGAATCCGATCT
-tig00000001	+	205237	205237	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.78	-119.96	-117.19	1	1	ATGGGCGGAAC
-tig00000001	+	205255	205255	eaa48d4e-1945-4011-8bae-ded748af1fca	-0.84	-115.63	-114.80	1	1	AGAAGCGGTCC
-tig00000001	+	205277	205277	eaa48d4e-1945-4011-8bae-ded748af1fca	-0.08	-90.66	-90.58	1	1	GAATCCGTTCT
-tig00000001	+	205344	205344	eaa48d4e-1945-4011-8bae-ded748af1fca	-2.65	-95.47	-92.82	1	1	ACCAACGGGGA
-tig00000001	-	195342	195359	44442ba9-9951-4bac-90ab-2acc8d1c4015	1.79	-179.22	-181.01	1	3	GTTCACGGGCATAACGCACTACCGCTTT
-tig00000001	-	195371	195371	44442ba9-9951-4bac-90ab-2acc8d1c4015	0.45	-162.87	-163.32	1	1	TCTTCCGCTGG
-tig00000001	-	195392	195400	44442ba9-9951-4bac-90ab-2acc8d1c4015	-9.77	-164.13	-154.37	1	3	GTTGCCGTCTCCGCGCCCA
-tig00000001	-	195413	195427	44442ba9-9951-4bac-90ab-2acc8d1c4015	-5.77	-179.50	-173.73	1	3	TCCTGCGCCAGACGTAAGGCGCTGA
-tig00000001	-	195441	195460	44442ba9-9951-4bac-90ab-2acc8d1c4015	-3.94	-214.24	-210.30	1	4	TTGCCCGACGTTTTTTCCGGTAAGCGGTGC
-tig00000001	-	195489	195500	44442ba9-9951-4bac-90ab-2acc8d1c4015	-8.82	-208.98	-200.16	1	3	TACACCGCGTGCCAGACGCTAC
-tig00000001	-	195511	195535	44442ba9-9951-4bac-90ab-2acc8d1c4015	2.70	-296.49	-299.19	1	7	CCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACC
-tig00000001	-	195547	195553	44442ba9-9951-4bac-90ab-2acc8d1c4015	-6.16	-125.08	-118.92	1	2	GTTTTCGCTGCCGGTGT
-tig00000001	-	195565	195565	44442ba9-9951-4bac-90ab-2acc8d1c4015	-0.08	-127.73	-127.65	1	1	ATGGCCGATGC
-tig00000001	-	195581	195590	44442ba9-9951-4bac-90ab-2acc8d1c4015	-16.50	-204.08	-187.59	1	5	AGGATCGCGTCGCGCGTGTG
-tig00000001	-	195608	195608	44442ba9-9951-4bac-90ab-2acc8d1c4015	-4.68	-148.93	-144.25	1	1	CTCTTCGCCAG
-tig00000001	-	195621	195630	44442ba9-9951-4bac-90ab-2acc8d1c4015	-8.30	-169.42	-161.12	1	3	TGCCCCGCCAGGCGCGCATT
-tig00000001	-	195646	195663	44442ba9-9951-4bac-90ab-2acc8d1c4015	-8.26	-221.05	-212.79	1	5	ATCAACGCGATCGGCAGTACGGCGCAGT
-tig00000001	-	195676	195685	44442ba9-9951-4bac-90ab-2acc8d1c4015	-8.00	-187.66	-179.66	1	3	CAGTTCGCGCAGGGCGATCA
-tig00000001	-	195702	195702	44442ba9-9951-4bac-90ab-2acc8d1c4015	0.60	-97.74	-98.34	1	1	CTTTGCGGAAA
-tig00000001	-	195720	195735	44442ba9-9951-4bac-90ab-2acc8d1c4015	-16.99	-238.55	-221.56	1	4	AATGGCGCGCTCCGCCTGCCCGGCAA
-tig00000001	-	195764	195781	44442ba9-9951-4bac-90ab-2acc8d1c4015	-8.31	-202.23	-193.92	1	4	TCAGCCGCTGGCGCAGATCGTCCGGGGC
-tig00000001	-	195803	195842	44442ba9-9951-4bac-90ab-2acc8d1c4015	-37.29	-424.60	-387.31	1	8	CACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACC
-tig00000001	-	195855	195864	44442ba9-9951-4bac-90ab-2acc8d1c4015	0.30	-207.97	-208.27	1	3	AATTCCGGTGACGCCGCTGA
-tig00000001	-	195900	195906	44442ba9-9951-4bac-90ab-2acc8d1c4015	-6.88	-146.43	-139.56	1	2	CTGAACGTTGACGGTAG
-tig00000001	-	195945	195945	44442ba9-9951-4bac-90ab-2acc8d1c4015	-4.59	-132.92	-128.33	1	1	TTCTTCGATAT
-tig00000001	-	195959	195959	44442ba9-9951-4bac-90ab-2acc8d1c4015	-6.00	-101.96	-95.97	1	1	GCCAGCGTTTG
-tig00000001	-	195971	195971	44442ba9-9951-4bac-90ab-2acc8d1c4015	-1.63	-109.12	-107.50	1	1	GATGACGGGAA
-tig00000001	-	195982	195982	44442ba9-9951-4bac-90ab-2acc8d1c4015	-0.98	-102.06	-101.08	1	1	CCTGGCGCATT
-tig00000001	-	195994	196002	44442ba9-9951-4bac-90ab-2acc8d1c4015	-2.22	-140.02	-137.81	1	2	CTGTGCGCCAGTTCGTCCA
-tig00000001	-	196018	196044	44442ba9-9951-4bac-90ab-2acc8d1c4015	-6.06	-225.51	-219.45	1	7	ATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGAT
-tig00000001	-	196056	196056	44442ba9-9951-4bac-90ab-2acc8d1c4015	-2.46	-107.48	-105.01	1	1	AAACTCGCTGA
-tig00000001	-	196067	196093	44442ba9-9951-4bac-90ab-2acc8d1c4015	-22.40	-282.92	-260.53	1	5	TATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAG
-tig00000001	-	196122	196125	44442ba9-9951-4bac-90ab-2acc8d1c4015	-5.65	-159.10	-153.45	1	2	CATGGCGGCGGTAT
-tig00000001	-	196136	196140	44442ba9-9951-4bac-90ab-2acc8d1c4015	-0.23	-153.89	-153.65	1	2	CTTTTCGCCCGTGGG
-tig00000001	-	196155	196155	44442ba9-9951-4bac-90ab-2acc8d1c4015	-0.29	-200.45	-200.17	1	1	TACCACGCCAA
-tig00000001	-	196180	196190	44442ba9-9951-4bac-90ab-2acc8d1c4015	-8.83	-225.50	-216.67	1	3	CCTTGCGCCCGCAGTCGCTGG
-tig00000001	-	196210	196210	44442ba9-9951-4bac-90ab-2acc8d1c4015	-4.29	-97.69	-93.40	1	1	AGCATCGCCCA
-tig00000001	-	196224	196227	44442ba9-9951-4bac-90ab-2acc8d1c4015	-6.11	-126.17	-120.06	1	2	CTTCCCGACGCCTG
-tig00000001	-	196242	196242	44442ba9-9951-4bac-90ab-2acc8d1c4015	0.22	-111.09	-111.32	1	1	GGCACCGAAGA
-tig00000001	-	196264	196274	44442ba9-9951-4bac-90ab-2acc8d1c4015	-11.29	-136.56	-125.27	1	4	TTCCCCGATGCGGCGCGGCAG
-tig00000001	-	196294	196319	44442ba9-9951-4bac-90ab-2acc8d1c4015	-1.54	-210.83	-209.29	1	5	GCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
-tig00000001	-	196342	196342	44442ba9-9951-4bac-90ab-2acc8d1c4015	-4.67	-105.09	-100.42	1	1	TCCAGCGCCAG
-tig00000001	-	196372	196380	44442ba9-9951-4bac-90ab-2acc8d1c4015	-6.18	-159.13	-152.95	1	2	ACAACCGGCTGGCCGATAT
-tig00000001	-	196396	196396	44442ba9-9951-4bac-90ab-2acc8d1c4015	-7.00	-127.88	-120.88	1	1	ACCAGCGGTTG
-tig00000001	-	196416	196426	44442ba9-9951-4bac-90ab-2acc8d1c4015	-7.07	-139.36	-132.29	1	2	TTTTGCGATCAGTTGCGTGAG
-tig00000001	-	196440	196440	44442ba9-9951-4bac-90ab-2acc8d1c4015	-2.45	-126.64	-124.20	1	1	TTCAACGCTGA
-tig00000001	-	196451	196466	44442ba9-9951-4bac-90ab-2acc8d1c4015	-10.22	-212.43	-202.21	1	5	GATTACGCGCTTTCGCCACGCGTGGG
-tig00000001	-	196483	196492	44442ba9-9951-4bac-90ab-2acc8d1c4015	-6.29	-154.70	-148.40	1	3	CAGGCCGCCGCTTGCGGGTG
-tig00000001	-	196514	196527	44442ba9-9951-4bac-90ab-2acc8d1c4015	-11.39	-232.23	-220.83	1	3	CAGCCCGCTTGCCGATGCCGTCAC
-tig00000001	-	196542	196576	44442ba9-9951-4bac-90ab-2acc8d1c4015	-21.81	-322.56	-300.74	1	7	TCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAAT
-tig00000001	-	196589	196595	44442ba9-9951-4bac-90ab-2acc8d1c4015	-11.38	-225.10	-213.72	1	3	AGCAACGCGTGCGGCTA
-tig00000001	-	196629	196629	44442ba9-9951-4bac-90ab-2acc8d1c4015	0.91	-111.84	-112.75	1	1	CTGACCGCCAG
-tig00000001	-	196643	196643	44442ba9-9951-4bac-90ab-2acc8d1c4015	1.56	-135.27	-136.83	1	1	GCTCCCGCCAG
-tig00000001	-	196677	196690	44442ba9-9951-4bac-90ab-2acc8d1c4015	-12.56	-191.00	-178.44	1	4	TCTGCCGTTGCCGACGGGCGACCA
-tig00000001	-	196706	196712	44442ba9-9951-4bac-90ab-2acc8d1c4015	-1.24	-150.68	-149.44	1	2	ATAGCCGTTGCCGGTAA
-tig00000001	-	196727	196749	44442ba9-9951-4bac-90ab-2acc8d1c4015	-25.64	-273.49	-247.84	1	5	CTGCCCGATTAATGCCGAACCGCGCACCGTATC
-tig00000001	-	196762	196770	44442ba9-9951-4bac-90ab-2acc8d1c4015	0.99	-191.59	-192.58	1	2	CTTCACGAATCAACGAACC
-tig00000001	-	196810	196810	44442ba9-9951-4bac-90ab-2acc8d1c4015	-4.21	-136.10	-131.88	1	1	CAGTACGGTGG
-tig00000001	-	196823	196834	44442ba9-9951-4bac-90ab-2acc8d1c4015	-6.40	-176.32	-169.91	1	3	AGCAGCGGGTAAACGCCGCCAG
-tig00000001	-	196874	196878	44442ba9-9951-4bac-90ab-2acc8d1c4015	-6.10	-153.54	-147.43	1	2	AATGCCGGACGTAAT
-tig00000001	-	196909	196915	44442ba9-9951-4bac-90ab-2acc8d1c4015	1.06	-150.74	-151.80	1	2	CAGACCGCAAACGGTCA
-tig00000001	-	196945	196952	44442ba9-9951-4bac-90ab-2acc8d1c4015	0.56	-174.92	-175.48	1	2	GATACCGATAAACGGCAC
-tig00000001	-	196975	196975	44442ba9-9951-4bac-90ab-2acc8d1c4015	-2.71	-147.50	-144.79	1	1	CAGACCGTAAA
-tig00000001	-	196992	196995	44442ba9-9951-4bac-90ab-2acc8d1c4015	-2.21	-145.28	-143.07	1	2	AGTTACGGCGCAAC
-tig00000001	-	197011	197018	44442ba9-9951-4bac-90ab-2acc8d1c4015	-6.95	-136.47	-129.52	1	2	AGAAGCGGTAAGCGGTTT
-tig00000001	-	197032	197041	44442ba9-9951-4bac-90ab-2acc8d1c4015	-1.24	-131.57	-130.33	1	2	ACTCACGCCTTTAACGCCAG
-tig00000001	-	197059	197059	44442ba9-9951-4bac-90ab-2acc8d1c4015	1.22	-105.97	-107.19	1	1	AAAGACGATAA
-tig00000001	-	197071	197071	44442ba9-9951-4bac-90ab-2acc8d1c4015	-3.72	-86.82	-83.10	1	1	CAAGGCGTTGA
-tig00000001	-	197084	197084	44442ba9-9951-4bac-90ab-2acc8d1c4015	-3.38	-114.90	-111.52	1	1	ATCACCGCACT
-tig00000001	-	197098	197108	44442ba9-9951-4bac-90ab-2acc8d1c4015	-3.03	-113.48	-110.46	1	3	GATTGCGGAGTCGGGCGAATG
-tig00000001	-	197132	197132	44442ba9-9951-4bac-90ab-2acc8d1c4015	-3.06	-92.44	-89.38	1	1	TTCAGCGCATT
-tig00000001	-	197144	197168	44442ba9-9951-4bac-90ab-2acc8d1c4015	-30.92	-277.68	-246.75	1	6	AACTGCGGATACGTTGCCGCGAATGCCGCCGGAAT
-tig00000001	-	197179	197197	44442ba9-9951-4bac-90ab-2acc8d1c4015	-11.25	-245.68	-234.42	1	3	AATGGCGAAGTATTTCGCCACATCGTTGG
-tig00000001	-	197222	197229	44442ba9-9951-4bac-90ab-2acc8d1c4015	-4.24	-163.36	-159.12	1	2	GTCAGCGAGCCACGGGTC
-tig00000001	-	197266	197266	44442ba9-9951-4bac-90ab-2acc8d1c4015	-2.55	-181.18	-178.63	1	1	CACCTCGATCA
-tig00000001	-	197279	197279	44442ba9-9951-4bac-90ab-2acc8d1c4015	2.29	-99.17	-101.46	1	1	TTGGTCGGGTT
-tig00000001	-	197290	197296	44442ba9-9951-4bac-90ab-2acc8d1c4015	0.10	-146.90	-147.00	1	2	AGAGTCGAGATCGACCA
-tig00000001	-	197309	197321	44442ba9-9951-4bac-90ab-2acc8d1c4015	-13.22	-207.84	-194.62	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	-	197332	197350	44442ba9-9951-4bac-90ab-2acc8d1c4015	-0.58	-177.35	-176.77	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	-	197363	197420	44442ba9-9951-4bac-90ab-2acc8d1c4015	-22.64	-444.43	-421.79	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	-	197433	197433	44442ba9-9951-4bac-90ab-2acc8d1c4015	3.46	-126.80	-130.27	1	1	ACTGACGGATC
-tig00000001	-	197456	197470	44442ba9-9951-4bac-90ab-2acc8d1c4015	-11.60	-195.32	-183.72	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	-	197482	197509	44442ba9-9951-4bac-90ab-2acc8d1c4015	-26.80	-291.56	-264.76	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	-	197520	197530	44442ba9-9951-4bac-90ab-2acc8d1c4015	-2.85	-172.19	-169.34	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	-	197543	197543	44442ba9-9951-4bac-90ab-2acc8d1c4015	-4.28	-135.20	-130.92	1	1	ATCACCGTTTT
-tig00000001	-	197562	197577	44442ba9-9951-4bac-90ab-2acc8d1c4015	-6.38	-186.47	-180.09	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	-	197590	197599	44442ba9-9951-4bac-90ab-2acc8d1c4015	-15.33	-261.66	-246.32	1	2	AATACCGCCTTTGACGATAT
-tig00000001	-	197612	197620	44442ba9-9951-4bac-90ab-2acc8d1c4015	1.35	-243.25	-244.60	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	-	197631	197631	44442ba9-9951-4bac-90ab-2acc8d1c4015	-0.67	-188.86	-188.19	1	1	GCACACGAGAA
-tig00000001	-	197654	197657	44442ba9-9951-4bac-90ab-2acc8d1c4015	-10.33	-258.77	-248.43	1	2	ACCAGCGGCGTGGC
-tig00000001	-	197670	197672	44442ba9-9951-4bac-90ab-2acc8d1c4015	-2.05	-140.62	-138.57	1	2	CCTGACGCGCAAC
-tig00000001	-	197683	197683	44442ba9-9951-4bac-90ab-2acc8d1c4015	-2.70	-134.71	-132.01	1	1	CTGATCGACTT
-tig00000001	-	197701	197701	44442ba9-9951-4bac-90ab-2acc8d1c4015	-3.94	-172.60	-168.66	1	1	AACATCGGTAG
-tig00000001	-	197719	197719	44442ba9-9951-4bac-90ab-2acc8d1c4015	-5.23	-131.55	-126.32	1	1	ACCACCGTTAG
-tig00000001	-	197736	197749	44442ba9-9951-4bac-90ab-2acc8d1c4015	-2.92	-223.35	-220.44	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	-	197763	197779	44442ba9-9951-4bac-90ab-2acc8d1c4015	5.96	-204.69	-210.65	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	-	197791	197816	44442ba9-9951-4bac-90ab-2acc8d1c4015	-8.22	-229.02	-220.79	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	-	197837	197837	44442ba9-9951-4bac-90ab-2acc8d1c4015	-0.55	-136.10	-135.55	1	1	TGGAGCGACTG
-tig00000001	-	197848	197856	44442ba9-9951-4bac-90ab-2acc8d1c4015	-8.54	-189.99	-181.45	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	-	197868	197878	44442ba9-9951-4bac-90ab-2acc8d1c4015	-8.66	-162.10	-153.44	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	-	197895	197906	44442ba9-9951-4bac-90ab-2acc8d1c4015	-16.21	-245.41	-229.20	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	-	197921	197921	44442ba9-9951-4bac-90ab-2acc8d1c4015	-2.41	-176.48	-174.07	1	1	GCCAGCGAAGC
-tig00000001	-	197935	197948	44442ba9-9951-4bac-90ab-2acc8d1c4015	-8.77	-217.75	-208.97	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	-	197960	197969	44442ba9-9951-4bac-90ab-2acc8d1c4015	-3.65	-163.30	-159.65	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	-	197982	197999	44442ba9-9951-4bac-90ab-2acc8d1c4015	-8.64	-236.94	-228.30	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	-	198014	198014	44442ba9-9951-4bac-90ab-2acc8d1c4015	-0.94	-107.78	-106.85	1	1	GGTGCCGGTTT
-tig00000001	-	198035	198051	44442ba9-9951-4bac-90ab-2acc8d1c4015	0.28	-226.80	-227.08	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	-	198064	198068	44442ba9-9951-4bac-90ab-2acc8d1c4015	0.44	-168.98	-169.41	1	2	CTGCACGTCCGCTGG
-tig00000001	-	198087	198089	44442ba9-9951-4bac-90ab-2acc8d1c4015	-4.95	-147.10	-142.15	1	2	ACATTCGCGCCTA
-tig00000001	-	198100	198123	44442ba9-9951-4bac-90ab-2acc8d1c4015	-14.80	-316.09	-301.29	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	-	198137	198137	44442ba9-9951-4bac-90ab-2acc8d1c4015	1.46	-98.83	-100.29	1	1	CAGGCCGCCAA
-tig00000001	-	198171	198171	44442ba9-9951-4bac-90ab-2acc8d1c4015	-0.07	-109.11	-109.04	1	1	AGCAGCGCCAC
-tig00000001	-	198183	198188	44442ba9-9951-4bac-90ab-2acc8d1c4015	-5.73	-145.35	-139.62	1	2	AGTACCGTTACGCTGA
-tig00000001	-	198203	198233	44442ba9-9951-4bac-90ab-2acc8d1c4015	-22.61	-380.84	-358.23	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	-	198250	198250	44442ba9-9951-4bac-90ab-2acc8d1c4015	2.58	-123.37	-125.95	1	1	AAAGACGATAG
-tig00000001	-	198289	198313	44442ba9-9951-4bac-90ab-2acc8d1c4015	-7.58	-311.44	-303.87	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	-	198326	198336	44442ba9-9951-4bac-90ab-2acc8d1c4015	-9.19	-220.81	-211.62	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	-	198352	198364	44442ba9-9951-4bac-90ab-2acc8d1c4015	-10.65	-238.10	-227.45	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	-	198399	198415	44442ba9-9951-4bac-90ab-2acc8d1c4015	-5.85	-215.18	-209.33	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	-	198427	198485	44442ba9-9951-4bac-90ab-2acc8d1c4015	-28.03	-491.37	-463.33	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	-	198513	198513	44442ba9-9951-4bac-90ab-2acc8d1c4015	1.09	-112.77	-113.87	1	1	ACCATCGCAGG
-tig00000001	-	198527	198527	44442ba9-9951-4bac-90ab-2acc8d1c4015	-2.42	-163.93	-161.51	1	1	AATATCGCCAG
-tig00000001	-	198545	198569	44442ba9-9951-4bac-90ab-2acc8d1c4015	-17.07	-302.62	-285.54	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	-	198585	198619	44442ba9-9951-4bac-90ab-2acc8d1c4015	-10.49	-346.80	-336.32	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	-	198660	198670	44442ba9-9951-4bac-90ab-2acc8d1c4015	-4.59	-142.61	-138.02	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	-	198684	198710	44442ba9-9951-4bac-90ab-2acc8d1c4015	-30.23	-319.69	-289.47	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	-	198728	198782	44442ba9-9951-4bac-90ab-2acc8d1c4015	-6.98	-501.11	-494.13	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	-	198812	198821	44442ba9-9951-4bac-90ab-2acc8d1c4015	-7.81	-197.62	-189.81	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	-	198834	198855	44442ba9-9951-4bac-90ab-2acc8d1c4015	-19.35	-246.71	-227.36	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	-	198872	198872	44442ba9-9951-4bac-90ab-2acc8d1c4015	0.65	-107.12	-107.77	1	1	TTCACCGCTTC
-tig00000001	-	198884	198892	44442ba9-9951-4bac-90ab-2acc8d1c4015	-3.20	-160.08	-156.88	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	-	198907	198914	44442ba9-9951-4bac-90ab-2acc8d1c4015	-1.49	-152.17	-150.68	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	-	198927	198927	44442ba9-9951-4bac-90ab-2acc8d1c4015	1.91	-102.29	-104.20	1	1	GTTTACGACTC
-tig00000001	-	198972	198987	44442ba9-9951-4bac-90ab-2acc8d1c4015	-3.94	-217.48	-213.55	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	-	199013	199013	44442ba9-9951-4bac-90ab-2acc8d1c4015	-7.65	-97.88	-90.22	1	1	CAGTGCGCCAA
-tig00000001	-	199028	199034	44442ba9-9951-4bac-90ab-2acc8d1c4015	-9.44	-182.14	-172.69	1	2	CAACACGGTGCCGATTA
-tig00000001	-	199056	199088	44442ba9-9951-4bac-90ab-2acc8d1c4015	-16.09	-263.73	-247.64	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	-	199112	199117	44442ba9-9951-4bac-90ab-2acc8d1c4015	-5.95	-131.75	-125.80	1	2	ACCAGCGAACCGGCAA
-tig00000001	-	199133	199133	44442ba9-9951-4bac-90ab-2acc8d1c4015	0.99	-96.88	-97.87	1	1	ATCACCGGGAT
-tig00000001	-	199147	199156	44442ba9-9951-4bac-90ab-2acc8d1c4015	-10.92	-163.42	-152.50	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	-	199172	199172	44442ba9-9951-4bac-90ab-2acc8d1c4015	-3.05	-114.23	-111.18	1	1	CAGAACGCCAG
-tig00000001	-	199193	199193	44442ba9-9951-4bac-90ab-2acc8d1c4015	-0.09	-99.60	-99.51	1	1	CAGAACGGAGA
-tig00000001	-	199204	199228	44442ba9-9951-4bac-90ab-2acc8d1c4015	-12.26	-238.01	-225.75	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	-	199240	199255	44442ba9-9951-4bac-90ab-2acc8d1c4015	-14.89	-182.74	-167.85	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	-	199267	199267	44442ba9-9951-4bac-90ab-2acc8d1c4015	-0.18	-133.12	-132.94	1	1	CACTTCGCTAA
-tig00000001	-	199280	199280	44442ba9-9951-4bac-90ab-2acc8d1c4015	-3.39	-138.57	-135.18	1	1	CCATGCGGGCC
-tig00000001	-	199300	199336	44442ba9-9951-4bac-90ab-2acc8d1c4015	-30.59	-362.46	-331.87	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	-	199352	199355	44442ba9-9951-4bac-90ab-2acc8d1c4015	-5.86	-107.97	-102.11	1	2	ACCAGCGTCGGGGT
-tig00000001	-	199393	199402	44442ba9-9951-4bac-90ab-2acc8d1c4015	-5.94	-217.73	-211.79	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	-	199423	199430	44442ba9-9951-4bac-90ab-2acc8d1c4015	-12.22	-154.94	-142.71	1	2	TATTCCGGTGTACGACCA
-tig00000001	-	199446	199446	44442ba9-9951-4bac-90ab-2acc8d1c4015	4.52	-82.08	-86.61	1	1	CAGCCCGGCAA
-tig00000001	-	199459	199459	44442ba9-9951-4bac-90ab-2acc8d1c4015	0.31	-172.07	-172.38	1	1	AACACCGCCAG
-tig00000001	-	199485	199485	44442ba9-9951-4bac-90ab-2acc8d1c4015	-0.32	-113.29	-112.97	1	1	CATGCCGTAAA
-tig00000001	-	199500	199509	44442ba9-9951-4bac-90ab-2acc8d1c4015	-8.43	-178.94	-170.50	1	3	AGAACCGACACCGCCGAACA
-tig00000001	-	199543	199543	44442ba9-9951-4bac-90ab-2acc8d1c4015	0.29	-161.45	-161.74	1	1	CACATCGGCAC
-tig00000001	-	199557	199570	44442ba9-9951-4bac-90ab-2acc8d1c4015	-9.97	-170.01	-160.05	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	-	199582	199593	44442ba9-9951-4bac-90ab-2acc8d1c4015	-7.01	-162.15	-155.14	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	-	199606	199621	44442ba9-9951-4bac-90ab-2acc8d1c4015	-6.65	-206.69	-200.04	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	-	199644	199652	44442ba9-9951-4bac-90ab-2acc8d1c4015	-6.09	-167.05	-160.95	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	-	199687	199687	44442ba9-9951-4bac-90ab-2acc8d1c4015	-3.08	-128.27	-125.19	1	1	CTGTCCGTGCC
-tig00000001	-	199740	199746	44442ba9-9951-4bac-90ab-2acc8d1c4015	-4.94	-169.26	-164.32	1	2	CACCACGCCTACGCAGA
-tig00000001	-	199770	199770	44442ba9-9951-4bac-90ab-2acc8d1c4015	-4.19	-127.76	-123.57	1	1	GACATCGCCCA
-tig00000001	-	199786	199802	44442ba9-9951-4bac-90ab-2acc8d1c4015	-8.91	-218.42	-209.50	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	-	199833	199836	44442ba9-9951-4bac-90ab-2acc8d1c4015	-7.78	-120.07	-112.29	1	2	CACAGCGCCGTTGG
-tig00000001	-	199854	199854	44442ba9-9951-4bac-90ab-2acc8d1c4015	0.28	-91.07	-91.34	1	1	AAGATCGCCAG
-tig00000001	-	199868	199868	44442ba9-9951-4bac-90ab-2acc8d1c4015	-5.26	-106.45	-101.19	1	1	CTGCACGAAGT
-tig00000001	-	199883	199883	44442ba9-9951-4bac-90ab-2acc8d1c4015	-3.81	-77.77	-73.96	1	1	CAGTGCGGTTG
-tig00000001	-	199899	199908	44442ba9-9951-4bac-90ab-2acc8d1c4015	-2.21	-166.14	-163.92	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	-	199931	199943	44442ba9-9951-4bac-90ab-2acc8d1c4015	-1.98	-148.82	-146.84	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	-	199956	199956	44442ba9-9951-4bac-90ab-2acc8d1c4015	-4.06	-95.21	-91.16	1	1	TTGATCGCTTC
-tig00000001	-	199998	199998	44442ba9-9951-4bac-90ab-2acc8d1c4015	-7.82	-124.81	-116.98	1	1	TGTTGCGCTCC
 tig00000001	-	200009	200009	44442ba9-9951-4bac-90ab-2acc8d1c4015	-2.53	-141.98	-139.45	1	1	TTCAACGGTAT
 tig00000001	-	200046	200046	44442ba9-9951-4bac-90ab-2acc8d1c4015	-2.63	-100.71	-98.08	1	1	TGCAGCGCACC
 tig00000001	-	200081	200081	44442ba9-9951-4bac-90ab-2acc8d1c4015	-1.72	-116.29	-114.58	1	1	AACAACGCCAC
@@ -4058,203 +535,6 @@
 tig00000001	-	201922	201930	44442ba9-9951-4bac-90ab-2acc8d1c4015	-9.83	-177.60	-167.77	1	2	GTCACCGGCTGGCCGCACT
 tig00000001	-	201944	201950	44442ba9-9951-4bac-90ab-2acc8d1c4015	-1.79	-170.01	-168.22	1	2	GCAGGCGCTGCCGGAAG
 tig00000001	-	201961	201986	44442ba9-9951-4bac-90ab-2acc8d1c4015	-2.33	-248.08	-245.75	1	4	AACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAA
-tig00000001	-	201998	202007	44442ba9-9951-4bac-90ab-2acc8d1c4015	-3.54	-136.54	-133.00	1	2	CAGTCCGCAGGGGCCGTGGT
-tig00000001	-	202020	202020	44442ba9-9951-4bac-90ab-2acc8d1c4015	-2.66	-112.85	-110.19	1	1	CTGCTCGGCTG
-tig00000001	-	202033	202046	44442ba9-9951-4bac-90ab-2acc8d1c4015	-5.23	-142.18	-136.95	1	3	GTGAGCGGGTGCCGGAAGCGGATG
-tig00000001	-	202064	202081	44442ba9-9951-4bac-90ab-2acc8d1c4015	-17.81	-221.47	-203.66	1	5	GCCTGCGCCGCTGCCGCCGTACCGGGTA
-tig00000001	-	202092	202092	44442ba9-9951-4bac-90ab-2acc8d1c4015	-0.92	-131.82	-130.90	1	1	CTGACCGGGCT
-tig00000001	-	202105	202143	44442ba9-9951-4bac-90ab-2acc8d1c4015	-25.18	-320.09	-294.92	1	8	TGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGA
-tig00000001	-	202155	202198	44442ba9-9951-4bac-90ab-2acc8d1c4015	-11.77	-355.60	-343.83	1	8	TTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTG
-tig00000001	-	202214	202225	44442ba9-9951-4bac-90ab-2acc8d1c4015	-1.58	-149.24	-147.66	1	3	GACCACGCAGGCGCAGCGGGCA
-tig00000001	-	202240	202240	44442ba9-9951-4bac-90ab-2acc8d1c4015	-0.88	-179.14	-178.26	1	1	AAGCCCGGCAG
-tig00000001	-	202257	202275	44442ba9-9951-4bac-90ab-2acc8d1c4015	-17.60	-220.59	-202.99	1	5	ATTTCCGGCGGGACGGAACCGTCCGCTTT
-tig00000001	-	202295	202330	44442ba9-9951-4bac-90ab-2acc8d1c4015	-9.70	-319.81	-310.11	1	5	CCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTG
-tig00000001	-	202341	202341	44442ba9-9951-4bac-90ab-2acc8d1c4015	-4.54	-109.06	-104.52	1	1	TCTGCCGTGTG
-tig00000001	-	202352	202370	44442ba9-9951-4bac-90ab-2acc8d1c4015	-3.30	-232.92	-229.62	1	4	GCTGACGCACGACCCGGAATACCCGGAGA
-tig00000001	-	202386	202399	44442ba9-9951-4bac-90ab-2acc8d1c4015	-7.06	-155.08	-148.02	1	4	CCTGCCGCGCCGCTGGTGCGCTAT
-tig00000001	-	202412	202432	44442ba9-9951-4bac-90ab-2acc8d1c4015	-13.05	-227.23	-214.18	1	6	CTGGACGCCCGCGGCGAACTGGCGGCGGTGT
-tig00000001	-	202443	202443	44442ba9-9951-4bac-90ab-2acc8d1c4015	-1.77	-116.59	-114.82	1	1	ATGACCGCAGC
-tig00000001	-	202461	202461	44442ba9-9951-4bac-90ab-2acc8d1c4015	-1.99	-117.82	-115.83	1	1	AGGTGCGCAGC
-tig00000001	-	202475	202475	44442ba9-9951-4bac-90ab-2acc8d1c4015	-5.04	-167.76	-162.72	1	1	ACTTACGATGA
-tig00000001	-	202488	202525	44442ba9-9951-4bac-90ab-2acc8d1c4015	-6.34	-330.38	-324.04	1	7	AATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAA
-tig00000001	-	202539	202557	44442ba9-9951-4bac-90ab-2acc8d1c4015	-4.07	-213.06	-208.99	1	5	GTTACCGTTACGACAGCGACGGGCGGGTG
-tig00000001	-	202579	202579	44442ba9-9951-4bac-90ab-2acc8d1c4015	-3.11	-88.56	-85.45	1	1	AAACCCGGCAG
-tig00000001	-	202597	202597	44442ba9-9951-4bac-90ab-2acc8d1c4015	0.82	-105.93	-106.75	1	1	TTACACGTATC
-tig00000001	-	202617	202617	44442ba9-9951-4bac-90ab-2acc8d1c4015	0.30	-116.99	-117.29	1	1	AGGACCGCATC
-tig00000001	-	202631	202631	44442ba9-9951-4bac-90ab-2acc8d1c4015	0.14	-109.14	-109.29	1	1	ATCACCGACAG
-tig00000001	-	202644	202647	44442ba9-9951-4bac-90ab-2acc8d1c4015	-5.00	-185.38	-180.37	1	2	TGAACCGCCGTGAA
-tig00000001	-	202663	202663	44442ba9-9951-4bac-90ab-2acc8d1c4015	-4.21	-127.21	-122.99	1	1	GCACACGCAGG
-tig00000001	-	202676	202686	44442ba9-9951-4bac-90ab-2acc8d1c4015	-10.87	-171.90	-161.03	1	2	GAAGGCGGGCTGAAGCGGGTG
-tig00000001	-	202705	202722	44442ba9-9951-4bac-90ab-2acc8d1c4015	-5.30	-170.98	-165.68	1	5	GAACACGCGGACGGCAGCGTCACGCAGA
-tig00000001	-	202738	202740	44442ba9-9951-4bac-90ab-2acc8d1c4015	0.21	-86.09	-86.30	1	2	TTTGACGCGGTGG
-tig00000001	-	202764	202771	44442ba9-9951-4bac-90ab-2acc8d1c4015	-5.27	-135.82	-130.55	1	2	ACAGACGGATGCCGCAGG
-tig00000001	-	202797	202797	44442ba9-9951-4bac-90ab-2acc8d1c4015	0.37	-91.89	-92.26	1	1	CAGTCCGGATG
-tig00000001	-	202809	202809	44442ba9-9951-4bac-90ab-2acc8d1c4015	1.60	-79.24	-80.84	1	1	GGTGACGGGCC
-tig00000001	-	202821	202836	44442ba9-9951-4bac-90ab-2acc8d1c4015	-9.08	-186.74	-177.65	1	4	CATCACGCGCATCACCACGCCGGATG
-tig00000001	-	202851	202854	44442ba9-9951-4bac-90ab-2acc8d1c4015	-9.97	-110.39	-100.42	1	2	GGCATCGGCGTTTT
-tig00000001	-	202884	202903	44442ba9-9951-4bac-90ab-2acc8d1c4015	-5.20	-288.46	-283.26	1	3	GTTAACGTCAGCCACCGGGCCTGACGGGCT
-tig00000001	-	202916	202919	44442ba9-9951-4bac-90ab-2acc8d1c4015	-9.46	-166.62	-157.16	1	2	AAATACGCCGGGAA
-tig00000001	-	202940	202940	44442ba9-9951-4bac-90ab-2acc8d1c4015	-1.62	-141.98	-140.36	1	1	GGGGCCGTCTG
-tig00000001	-	202966	202985	44442ba9-9951-4bac-90ab-2acc8d1c4015	-13.21	-300.02	-286.82	1	4	CCTGACGGCGATATCACCCGCTACCGTTAT
-tig00000001	-	195565	195565	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-7.69	-100.97	-93.29	1	1	ATGGCCGATGC
-tig00000001	-	195581	195590	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-14.16	-145.74	-131.58	1	5	AGGATCGCGTCGCGCGTGTG
-tig00000001	-	195608	195608	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-4.13	-164.11	-159.99	1	1	CTCTTCGCCAG
-tig00000001	-	195621	195630	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-5.06	-211.26	-206.20	1	3	TGCCCCGCCAGGCGCGCATT
-tig00000001	-	195646	195663	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-11.83	-217.74	-205.92	1	5	ATCAACGCGATCGGCAGTACGGCGCAGT
-tig00000001	-	195676	195685	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-12.80	-142.24	-129.44	1	3	CAGTTCGCGCAGGGCGATCA
-tig00000001	-	195702	195702	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-3.17	-95.10	-91.93	1	1	CTTTGCGGAAA
-tig00000001	-	195720	195735	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-27.10	-200.79	-173.69	1	4	AATGGCGCGCTCCGCCTGCCCGGCAA
-tig00000001	-	195764	195781	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-11.05	-227.90	-216.85	1	4	TCAGCCGCTGGCGCAGATCGTCCGGGGC
-tig00000001	-	195803	195842	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-33.73	-341.11	-307.38	1	8	CACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACC
-tig00000001	-	195855	195864	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-6.25	-164.76	-158.51	1	3	AATTCCGGTGACGCCGCTGA
-tig00000001	-	195900	195906	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-5.46	-165.12	-159.66	1	2	CTGAACGTTGACGGTAG
-tig00000001	-	195945	195945	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-4.11	-139.32	-135.21	1	1	TTCTTCGATAT
-tig00000001	-	195959	195959	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-7.09	-104.05	-96.96	1	1	GCCAGCGTTTG
-tig00000001	-	195971	195971	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-4.21	-115.78	-111.57	1	1	GATGACGGGAA
-tig00000001	-	195982	195982	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-5.85	-113.72	-107.87	1	1	CCTGGCGCATT
-tig00000001	-	195994	196002	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-10.14	-144.78	-134.64	1	2	CTGTGCGCCAGTTCGTCCA
-tig00000001	-	196018	196044	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-44.64	-264.36	-219.73	1	7	ATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGAT
-tig00000001	-	196056	196056	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-4.37	-112.49	-108.12	1	1	AAACTCGCTGA
-tig00000001	-	196067	196093	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-34.74	-309.08	-274.34	1	5	TATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAG
-tig00000001	-	196122	196125	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-15.63	-156.71	-141.08	1	2	CATGGCGGCGGTAT
-tig00000001	-	196136	196140	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-10.65	-141.39	-130.74	1	2	CTTTTCGCCCGTGGG
-tig00000001	-	196155	196155	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-5.82	-116.49	-110.68	1	1	TACCACGCCAA
-tig00000001	-	196180	196190	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-10.21	-182.27	-172.06	1	3	CCTTGCGCCCGCAGTCGCTGG
-tig00000001	-	196210	196210	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-3.86	-131.12	-127.26	1	1	AGCATCGCCCA
-tig00000001	-	196224	196227	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-11.05	-143.48	-132.43	1	2	CTTCCCGACGCCTG
-tig00000001	-	196242	196242	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-9.09	-113.87	-104.78	1	1	GGCACCGAAGA
-tig00000001	-	196264	196274	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-17.66	-169.96	-152.30	1	4	TTCCCCGATGCGGCGCGGCAG
-tig00000001	-	196294	196319	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-14.00	-1701.26	-1687.26	1	5	GCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
-tig00000001	-	196342	196342	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-3.66	-131.57	-127.92	1	1	TCCAGCGCCAG
-tig00000001	-	196372	196380	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-4.99	-172.11	-167.12	1	2	ACAACCGGCTGGCCGATAT
-tig00000001	-	196396	196396	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-3.35	-145.40	-142.05	1	1	ACCAGCGGTTG
-tig00000001	-	196416	196426	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-18.32	-204.65	-186.33	1	2	TTTTGCGATCAGTTGCGTGAG
-tig00000001	-	196440	196440	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-1.71	-119.97	-118.27	1	1	TTCAACGCTGA
-tig00000001	-	196451	196466	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-16.37	-211.38	-195.01	1	5	GATTACGCGCTTTCGCCACGCGTGGG
-tig00000001	-	196483	196492	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-15.07	-185.60	-170.53	1	3	CAGGCCGCCGCTTGCGGGTG
-tig00000001	-	196514	196527	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-17.93	-198.55	-180.62	1	3	CAGCCCGCTTGCCGATGCCGTCAC
-tig00000001	-	196542	196576	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-16.09	-312.24	-296.15	1	7	TCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAAT
-tig00000001	-	196589	196595	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-6.44	-145.29	-138.86	1	3	AGCAACGCGTGCGGCTA
-tig00000001	-	196629	196629	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	0.15	-120.14	-120.29	1	1	CTGACCGCCAG
-tig00000001	-	196643	196643	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-4.40	-112.59	-108.19	1	1	GCTCCCGCCAG
-tig00000001	-	196677	196690	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-16.49	-164.54	-148.05	1	4	TCTGCCGTTGCCGACGGGCGACCA
-tig00000001	-	196706	196712	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-16.97	-155.63	-138.66	1	2	ATAGCCGTTGCCGGTAA
-tig00000001	-	196727	196749	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-14.06	-246.45	-232.39	1	5	CTGCCCGATTAATGCCGAACCGCGCACCGTATC
-tig00000001	-	196762	196770	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-0.41	-191.40	-191.00	1	2	CTTCACGAATCAACGAACC
-tig00000001	-	196810	196810	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-8.20	-117.28	-109.08	1	1	CAGTACGGTGG
-tig00000001	-	196823	196834	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-6.30	-171.71	-165.41	1	3	AGCAGCGGGTAAACGCCGCCAG
-tig00000001	-	196874	196878	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-2.96	-131.21	-128.25	1	2	AATGCCGGACGTAAT
-tig00000001	-	196909	196915	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-1.21	-158.58	-157.37	1	2	CAGACCGCAAACGGTCA
-tig00000001	-	196945	196952	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-11.18	-173.61	-162.42	1	2	GATACCGATAAACGGCAC
-tig00000001	-	196975	196975	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-4.13	-108.15	-104.02	1	1	CAGACCGTAAA
-tig00000001	-	196992	196995	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-16.93	-145.77	-128.84	1	2	AGTTACGGCGCAAC
-tig00000001	-	197011	197018	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-9.18	-106.28	-97.10	1	2	AGAAGCGGTAAGCGGTTT
-tig00000001	-	197032	197041	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-5.75	-154.70	-148.95	1	2	ACTCACGCCTTTAACGCCAG
-tig00000001	-	197059	197059	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	1.16	-121.12	-122.27	1	1	AAAGACGATAA
-tig00000001	-	197071	197071	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-7.25	-113.79	-106.54	1	1	CAAGGCGTTGA
-tig00000001	-	197084	197084	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-4.34	-102.53	-98.19	1	1	ATCACCGCACT
-tig00000001	-	197098	197108	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-6.38	-144.77	-138.39	1	3	GATTGCGGAGTCGGGCGAATG
-tig00000001	-	197132	197132	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-7.81	-123.00	-115.19	1	1	TTCAGCGCATT
-tig00000001	-	197144	197168	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-21.31	-260.60	-239.29	1	6	AACTGCGGATACGTTGCCGCGAATGCCGCCGGAAT
-tig00000001	-	197179	197197	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-9.94	-155.83	-145.88	1	3	AATGGCGAAGTATTTCGCCACATCGTTGG
-tig00000001	-	197222	197229	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-8.21	-138.65	-130.44	1	2	GTCAGCGAGCCACGGGTC
-tig00000001	-	197266	197266	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-2.69	-140.97	-138.28	1	1	CACCTCGATCA
-tig00000001	-	197279	197279	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-0.75	-125.42	-124.66	1	1	TTGGTCGGGTT
-tig00000001	-	197290	197296	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-7.20	-144.10	-136.90	1	2	AGAGTCGAGATCGACCA
-tig00000001	-	197309	197321	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-27.49	-188.77	-161.28	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	-	197332	197350	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-11.73	-254.67	-242.94	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	-	197363	197420	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-39.33	-427.48	-388.15	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	-	197433	197433	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-1.81	-152.74	-150.93	1	1	ACTGACGGATC
-tig00000001	-	197456	197470	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-24.57	-184.73	-160.16	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	-	197482	197509	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-29.01	-289.51	-260.50	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	-	197520	197530	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-10.75	-171.52	-160.77	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	-	197543	197543	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-5.61	-111.64	-106.02	1	1	ATCACCGTTTT
-tig00000001	-	197562	197577	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-19.37	-224.70	-205.33	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	-	197590	197599	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-12.13	-189.57	-177.44	1	2	AATACCGCCTTTGACGATAT
-tig00000001	-	197612	197620	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-15.22	-146.55	-131.34	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	-	197631	197631	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-3.66	-108.60	-104.94	1	1	GCACACGAGAA
-tig00000001	-	197654	197657	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-9.68	-142.46	-132.79	1	2	ACCAGCGGCGTGGC
-tig00000001	-	197670	197672	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-2.61	-115.30	-112.68	1	2	CCTGACGCGCAAC
-tig00000001	-	197683	197683	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-7.58	-123.11	-115.52	1	1	CTGATCGACTT
-tig00000001	-	197701	197701	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-0.26	-83.19	-82.93	1	1	AACATCGGTAG
-tig00000001	-	197719	197719	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-6.86	-113.84	-106.98	1	1	ACCACCGTTAG
-tig00000001	-	197736	197749	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-8.48	-192.70	-184.22	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	-	197763	197779	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-10.15	-172.83	-162.67	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	-	197791	197816	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-23.97	-290.17	-266.20	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	-	197837	197837	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-3.28	-109.07	-105.79	1	1	TGGAGCGACTG
-tig00000001	-	197848	197856	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-9.83	-142.53	-132.70	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	-	197868	197878	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-4.89	-157.56	-152.67	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	-	197895	197906	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-16.49	-183.51	-167.02	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	-	197921	197921	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-11.69	-152.97	-141.28	1	1	GCCAGCGAAGC
-tig00000001	-	197935	197948	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-15.17	-211.54	-196.38	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	-	197960	197969	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-20.09	-161.16	-141.07	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	-	197982	197999	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-20.20	-226.42	-206.22	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	-	198014	198014	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-5.51	-104.51	-99.00	1	1	GGTGCCGGTTT
-tig00000001	-	198035	198051	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-16.42	-200.99	-184.57	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	-	198064	198068	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-4.67	-152.84	-148.16	1	2	CTGCACGTCCGCTGG
-tig00000001	-	198087	198089	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-6.46	-132.14	-125.68	1	2	ACATTCGCGCCTA
-tig00000001	-	198100	198123	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-20.44	-277.41	-256.97	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	-	198137	198137	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-0.60	-115.98	-115.38	1	1	CAGGCCGCCAA
-tig00000001	-	198171	198171	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-1.69	-148.34	-146.65	1	1	AGCAGCGCCAC
-tig00000001	-	198183	198188	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-9.78	-169.00	-159.22	1	2	AGTACCGTTACGCTGA
-tig00000001	-	198203	198233	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-12.22	-298.70	-286.47	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	-	198250	198250	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-2.06	-121.09	-119.03	1	1	AAAGACGATAG
-tig00000001	-	198289	198313	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-39.09	-263.99	-224.90	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	-	198326	198336	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-6.02	-174.34	-168.32	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	-	198352	198364	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-6.54	-166.29	-159.75	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	-	198399	198415	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-24.63	-232.81	-208.19	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	-	198427	198485	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-36.50	-455.63	-419.14	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	-	198513	198513	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-1.17	-121.40	-120.23	1	1	ACCATCGCAGG
-tig00000001	-	198527	198527	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-2.60	-115.78	-113.18	1	1	AATATCGCCAG
-tig00000001	-	198545	198569	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-20.84	-281.12	-260.28	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	-	198585	198619	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-14.31	-337.59	-323.28	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	-	198660	198670	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-12.94	-183.52	-170.59	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	-	198684	198710	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-22.22	-281.25	-259.03	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	-	198728	198782	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-32.27	-435.54	-403.27	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	-	198812	198821	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	0.85	-187.25	-188.10	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	-	198834	198855	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-23.77	-214.98	-191.21	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	-	198872	198872	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-3.96	-86.82	-82.86	1	1	TTCACCGCTTC
-tig00000001	-	198884	198892	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-4.85	-160.15	-155.30	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	-	198907	198914	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-5.04	-119.49	-114.45	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	-	198927	198927	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	0.60	-100.28	-100.88	1	1	GTTTACGACTC
-tig00000001	-	198972	198987	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-9.66	-237.33	-227.67	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	-	199013	199013	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-2.56	-105.47	-102.91	1	1	CAGTGCGCCAA
-tig00000001	-	199028	199034	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-10.88	-173.80	-162.92	1	2	CAACACGGTGCCGATTA
-tig00000001	-	199056	199088	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-14.06	-306.08	-292.02	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	-	199112	199117	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-7.14	-176.65	-169.51	1	2	ACCAGCGAACCGGCAA
-tig00000001	-	199133	199133	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-1.16	-136.64	-135.48	1	1	ATCACCGGGAT
-tig00000001	-	199147	199156	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-17.78	-178.68	-160.90	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	-	199172	199172	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	0.12	-87.24	-87.36	1	1	CAGAACGCCAG
-tig00000001	-	199193	199193	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-0.02	-86.72	-86.70	1	1	CAGAACGGAGA
-tig00000001	-	199204	199228	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-17.05	-245.45	-228.40	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	-	199240	199255	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-14.91	-184.78	-169.86	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	-	199267	199267	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-1.11	-128.89	-127.78	1	1	CACTTCGCTAA
-tig00000001	-	199280	199280	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-3.70	-123.06	-119.35	1	1	CCATGCGGGCC
-tig00000001	-	199300	199336	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-34.13	-315.15	-281.02	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	-	199352	199355	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-9.18	-142.27	-133.08	1	2	ACCAGCGTCGGGGT
-tig00000001	-	199393	199402	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-8.61	-119.63	-111.02	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	-	199423	199430	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	2.43	-131.41	-133.83	1	2	TATTCCGGTGTACGACCA
-tig00000001	-	199446	199446	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-3.45	-97.42	-93.97	1	1	CAGCCCGGCAA
-tig00000001	-	199459	199459	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-1.53	-118.81	-117.28	1	1	AACACCGCCAG
-tig00000001	-	199485	199485	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-3.96	-146.90	-142.94	1	1	CATGCCGTAAA
-tig00000001	-	199500	199509	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-8.57	-164.69	-156.12	1	3	AGAACCGACACCGCCGAACA
-tig00000001	-	199543	199543	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-3.06	-117.18	-114.12	1	1	CACATCGGCAC
-tig00000001	-	199557	199570	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-17.24	-183.89	-166.66	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	-	199582	199593	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-11.65	-163.47	-151.82	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	-	199606	199621	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-11.94	-180.21	-168.27	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	-	199644	199652	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-11.27	-123.62	-112.35	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	-	199687	199687	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-3.73	-127.94	-124.21	1	1	CTGTCCGTGCC
-tig00000001	-	199740	199746	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-11.55	-231.55	-220.00	1	2	CACCACGCCTACGCAGA
-tig00000001	-	199770	199770	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-9.02	-120.22	-111.20	1	1	GACATCGCCCA
-tig00000001	-	199786	199802	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-28.20	-215.14	-186.94	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	-	199833	199836	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-7.75	-114.20	-106.45	1	2	CACAGCGCCGTTGG
-tig00000001	-	199854	199854	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-1.51	-98.58	-97.07	1	1	AAGATCGCCAG
-tig00000001	-	199868	199868	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-3.85	-138.07	-134.22	1	1	CTGCACGAAGT
-tig00000001	-	199883	199883	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-10.17	-98.27	-88.10	1	1	CAGTGCGGTTG
-tig00000001	-	199899	199908	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-13.75	-160.84	-147.08	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	-	199931	199943	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-8.73	-184.32	-175.59	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	-	199956	199956	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-3.31	-92.91	-89.59	1	1	TTGATCGCTTC
-tig00000001	-	199998	199998	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-8.19	-95.31	-87.12	1	1	TGTTGCGCTCC
 tig00000001	-	200009	200009	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-1.04	-121.29	-120.25	1	1	TTCAACGGTAT
 tig00000001	-	200046	200046	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-5.82	-129.49	-123.67	1	1	TGCAGCGCACC
 tig00000001	-	200081	200081	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-0.04	-90.11	-90.07	1	1	AACAACGCCAC
@@ -4281,162 +561,6 @@
 tig00000001	-	200742	200742	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	1.85	-106.73	-108.58	1	1	GATACCGGAAG
 tig00000001	-	200773	200773	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-1.55	-109.08	-107.53	1	1	GATTTCGCAAA
 tig00000001	-	200784	200788	bec0a1f3-2776-4ace-b372-0a76a9cbed6b	-14.08	-154.19	-140.10	1	2	ATCTGCGGGCGGGGT
-tig00000001	+	195621	195630	38f657d9-0701-44bb-8c13-d9446f8fe441	-11.83	-154.58	-142.75	1	3	TGCCCCGCCAGGCGCGCATT
-tig00000001	+	195646	195663	38f657d9-0701-44bb-8c13-d9446f8fe441	-28.09	-239.16	-211.06	1	5	ATCAACGCGATCGGCAGTACGGCGCAGT
-tig00000001	+	195676	195685	38f657d9-0701-44bb-8c13-d9446f8fe441	-6.67	-160.64	-153.96	1	3	CAGTTCGCGCAGGGCGATCA
-tig00000001	+	195702	195702	38f657d9-0701-44bb-8c13-d9446f8fe441	2.44	-151.20	-153.63	1	1	CTTTGCGGAAA
-tig00000001	+	195720	195735	38f657d9-0701-44bb-8c13-d9446f8fe441	-10.13	-155.86	-145.73	1	4	AATGGCGCGCTCCGCCTGCCCGGCAA
-tig00000001	+	195764	195781	38f657d9-0701-44bb-8c13-d9446f8fe441	-10.30	-190.44	-180.14	1	4	TCAGCCGCTGGCGCAGATCGTCCGGGGC
-tig00000001	+	195803	195842	38f657d9-0701-44bb-8c13-d9446f8fe441	-21.60	-308.80	-287.20	1	8	CACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACC
-tig00000001	+	195855	195864	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.75	-156.20	-148.45	1	3	AATTCCGGTGACGCCGCTGA
-tig00000001	+	195900	195906	38f657d9-0701-44bb-8c13-d9446f8fe441	-5.73	-142.73	-137.00	1	2	CTGAACGTTGACGGTAG
-tig00000001	+	195945	195945	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.82	-102.98	-95.16	1	1	TTCTTCGATAT
-tig00000001	+	195959	195959	38f657d9-0701-44bb-8c13-d9446f8fe441	1.27	-103.34	-104.61	1	1	GCCAGCGTTTG
-tig00000001	+	195971	195971	38f657d9-0701-44bb-8c13-d9446f8fe441	-0.25	-96.83	-96.58	1	1	GATGACGGGAA
-tig00000001	+	195982	195982	38f657d9-0701-44bb-8c13-d9446f8fe441	-6.89	-94.24	-87.35	1	1	CCTGGCGCATT
-tig00000001	+	195994	196002	38f657d9-0701-44bb-8c13-d9446f8fe441	-2.31	-138.23	-135.92	1	2	CTGTGCGCCAGTTCGTCCA
-tig00000001	+	196018	196044	38f657d9-0701-44bb-8c13-d9446f8fe441	-34.01	-292.73	-258.72	1	7	ATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGAT
-tig00000001	+	196056	196056	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.97	-109.55	-101.58	1	1	AAACTCGCTGA
-tig00000001	+	196067	196093	38f657d9-0701-44bb-8c13-d9446f8fe441	-8.96	-201.25	-192.29	1	5	TATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAG
-tig00000001	+	196122	196125	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.12	-118.79	-111.67	1	2	CATGGCGGCGGTAT
-tig00000001	+	196136	196140	38f657d9-0701-44bb-8c13-d9446f8fe441	-10.22	-125.77	-115.55	1	2	CTTTTCGCCCGTGGG
-tig00000001	+	196155	196155	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.83	-99.21	-91.38	1	1	TACCACGCCAA
-tig00000001	+	196180	196190	38f657d9-0701-44bb-8c13-d9446f8fe441	-8.51	-151.62	-143.11	1	3	CCTTGCGCCCGCAGTCGCTGG
-tig00000001	+	196210	196210	38f657d9-0701-44bb-8c13-d9446f8fe441	-11.15	-108.61	-97.47	1	1	AGCATCGCCCA
-tig00000001	+	196224	196227	38f657d9-0701-44bb-8c13-d9446f8fe441	-5.16	-98.35	-93.19	1	2	CTTCCCGACGCCTG
-tig00000001	+	196242	196242	38f657d9-0701-44bb-8c13-d9446f8fe441	-0.67	-74.39	-73.72	1	1	GGCACCGAAGA
-tig00000001	+	196264	196274	38f657d9-0701-44bb-8c13-d9446f8fe441	-14.75	-164.00	-149.25	1	4	TTCCCCGATGCGGCGCGGCAG
-tig00000001	+	196294	196319	38f657d9-0701-44bb-8c13-d9446f8fe441	-26.01	-243.05	-217.04	1	5	GCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
-tig00000001	+	196342	196342	38f657d9-0701-44bb-8c13-d9446f8fe441	0.57	-89.52	-90.08	1	1	TCCAGCGCCAG
-tig00000001	+	196372	196380	38f657d9-0701-44bb-8c13-d9446f8fe441	1.85	-144.97	-146.82	1	2	ACAACCGGCTGGCCGATAT
-tig00000001	+	196396	196396	38f657d9-0701-44bb-8c13-d9446f8fe441	-2.50	-84.48	-81.98	1	1	ACCAGCGGTTG
-tig00000001	+	196416	196426	38f657d9-0701-44bb-8c13-d9446f8fe441	-0.96	-168.58	-167.62	1	2	TTTTGCGATCAGTTGCGTGAG
-tig00000001	+	196440	196440	38f657d9-0701-44bb-8c13-d9446f8fe441	-0.01	-94.07	-94.06	1	1	TTCAACGCTGA
-tig00000001	+	196451	196466	38f657d9-0701-44bb-8c13-d9446f8fe441	-18.70	-207.53	-188.83	1	5	GATTACGCGCTTTCGCCACGCGTGGG
-tig00000001	+	196483	196492	38f657d9-0701-44bb-8c13-d9446f8fe441	-24.43	-219.68	-195.25	1	3	CAGGCCGCCGCTTGCGGGTG
-tig00000001	+	196514	196527	38f657d9-0701-44bb-8c13-d9446f8fe441	-2.99	-135.50	-132.51	1	3	CAGCCCGCTTGCCGATGCCGTCAC
-tig00000001	+	196542	196576	38f657d9-0701-44bb-8c13-d9446f8fe441	-9.72	-244.20	-234.48	1	7	TCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAAT
-tig00000001	+	196589	196595	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.34	-143.49	-136.15	1	3	AGCAACGCGTGCGGCTA
-tig00000001	+	196629	196629	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.45	-92.46	-89.01	1	1	CTGACCGCCAG
-tig00000001	+	196643	196643	38f657d9-0701-44bb-8c13-d9446f8fe441	-4.63	-137.82	-133.19	1	1	GCTCCCGCCAG
-tig00000001	+	196677	196690	38f657d9-0701-44bb-8c13-d9446f8fe441	-6.28	-204.79	-198.51	1	4	TCTGCCGTTGCCGACGGGCGACCA
-tig00000001	+	196706	196712	38f657d9-0701-44bb-8c13-d9446f8fe441	-2.46	-136.40	-133.94	1	2	ATAGCCGTTGCCGGTAA
-tig00000001	+	196727	196749	38f657d9-0701-44bb-8c13-d9446f8fe441	-5.77	-202.35	-196.58	1	5	CTGCCCGATTAATGCCGAACCGCGCACCGTATC
-tig00000001	+	196762	196770	38f657d9-0701-44bb-8c13-d9446f8fe441	-2.25	-159.34	-157.09	1	2	CTTCACGAATCAACGAACC
-tig00000001	+	196810	196810	38f657d9-0701-44bb-8c13-d9446f8fe441	-5.38	-121.41	-116.02	1	1	CAGTACGGTGG
-tig00000001	+	196823	196834	38f657d9-0701-44bb-8c13-d9446f8fe441	-11.33	-167.05	-155.72	1	3	AGCAGCGGGTAAACGCCGCCAG
-tig00000001	+	196874	196878	38f657d9-0701-44bb-8c13-d9446f8fe441	-1.96	-145.60	-143.63	1	2	AATGCCGGACGTAAT
-tig00000001	+	196909	196915	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.12	-191.62	-184.50	1	2	CAGACCGCAAACGGTCA
-tig00000001	+	196945	196952	38f657d9-0701-44bb-8c13-d9446f8fe441	-0.84	-159.46	-158.62	1	2	GATACCGATAAACGGCAC
-tig00000001	+	196975	196975	38f657d9-0701-44bb-8c13-d9446f8fe441	-5.49	-90.83	-85.34	1	1	CAGACCGTAAA
-tig00000001	+	196992	196995	38f657d9-0701-44bb-8c13-d9446f8fe441	-5.41	-100.97	-95.56	1	2	AGTTACGGCGCAAC
-tig00000001	+	197011	197018	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.20	-207.28	-200.09	1	2	AGAAGCGGTAAGCGGTTT
-tig00000001	+	197032	197041	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.11	-156.11	-153.00	1	2	ACTCACGCCTTTAACGCCAG
-tig00000001	+	197059	197059	38f657d9-0701-44bb-8c13-d9446f8fe441	-2.39	-118.88	-116.48	1	1	AAAGACGATAA
-tig00000001	+	197071	197071	38f657d9-0701-44bb-8c13-d9446f8fe441	-10.75	-99.57	-88.82	1	1	CAAGGCGTTGA
-tig00000001	+	197084	197084	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.96	-108.45	-104.50	1	1	ATCACCGCACT
-tig00000001	+	197098	197108	38f657d9-0701-44bb-8c13-d9446f8fe441	-15.10	-166.44	-151.33	1	3	GATTGCGGAGTCGGGCGAATG
-tig00000001	+	197132	197132	38f657d9-0701-44bb-8c13-d9446f8fe441	-5.54	-104.20	-98.66	1	1	TTCAGCGCATT
-tig00000001	+	197144	197168	38f657d9-0701-44bb-8c13-d9446f8fe441	-26.73	-210.28	-183.55	1	6	AACTGCGGATACGTTGCCGCGAATGCCGCCGGAAT
-tig00000001	+	197179	197197	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.17	-207.82	-200.65	1	3	AATGGCGAAGTATTTCGCCACATCGTTGG
-tig00000001	+	197222	197229	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.04	-151.63	-144.58	1	2	GTCAGCGAGCCACGGGTC
-tig00000001	+	197266	197266	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.36	-92.52	-89.16	1	1	CACCTCGATCA
-tig00000001	+	197279	197279	38f657d9-0701-44bb-8c13-d9446f8fe441	0.31	-97.90	-98.21	1	1	TTGGTCGGGTT
-tig00000001	+	197290	197296	38f657d9-0701-44bb-8c13-d9446f8fe441	-8.13	-124.46	-116.33	1	2	AGAGTCGAGATCGACCA
-tig00000001	+	197309	197321	38f657d9-0701-44bb-8c13-d9446f8fe441	-4.44	-166.60	-162.17	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	+	197332	197350	38f657d9-0701-44bb-8c13-d9446f8fe441	-5.40	-221.50	-216.10	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	+	197363	197420	38f657d9-0701-44bb-8c13-d9446f8fe441	-23.04	-400.47	-377.42	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	+	197433	197433	38f657d9-0701-44bb-8c13-d9446f8fe441	-6.36	-103.38	-97.02	1	1	ACTGACGGATC
-tig00000001	+	197456	197470	38f657d9-0701-44bb-8c13-d9446f8fe441	-13.76	-160.22	-146.46	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	+	197482	197509	38f657d9-0701-44bb-8c13-d9446f8fe441	-4.78	-262.68	-257.90	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	+	197520	197530	38f657d9-0701-44bb-8c13-d9446f8fe441	-9.74	-151.10	-141.36	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	+	197543	197543	38f657d9-0701-44bb-8c13-d9446f8fe441	0.89	-93.80	-94.70	1	1	ATCACCGTTTT
-tig00000001	+	197562	197577	38f657d9-0701-44bb-8c13-d9446f8fe441	-6.91	-189.52	-182.61	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	+	197590	197599	38f657d9-0701-44bb-8c13-d9446f8fe441	0.36	-157.24	-157.60	1	2	AATACCGCCTTTGACGATAT
-tig00000001	+	197612	197620	38f657d9-0701-44bb-8c13-d9446f8fe441	-2.12	-133.70	-131.57	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	+	197631	197631	38f657d9-0701-44bb-8c13-d9446f8fe441	-2.36	-79.90	-77.54	1	1	GCACACGAGAA
-tig00000001	+	197654	197657	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.36	-104.92	-101.56	1	2	ACCAGCGGCGTGGC
-tig00000001	+	197670	197672	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.47	-109.92	-102.45	1	2	CCTGACGCGCAAC
-tig00000001	+	197683	197683	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.53	-113.32	-109.79	1	1	CTGATCGACTT
-tig00000001	+	197701	197701	38f657d9-0701-44bb-8c13-d9446f8fe441	-8.92	-124.53	-115.61	1	1	AACATCGGTAG
-tig00000001	+	197719	197719	38f657d9-0701-44bb-8c13-d9446f8fe441	-5.06	-157.18	-152.12	1	1	ACCACCGTTAG
-tig00000001	+	197736	197749	38f657d9-0701-44bb-8c13-d9446f8fe441	-6.37	-204.99	-198.63	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	+	197763	197779	38f657d9-0701-44bb-8c13-d9446f8fe441	-5.93	-191.70	-185.77	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	+	197791	197816	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.35	-241.98	-234.63	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	+	197837	197837	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.54	-148.72	-145.18	1	1	TGGAGCGACTG
-tig00000001	+	197848	197856	38f657d9-0701-44bb-8c13-d9446f8fe441	-10.34	-178.70	-168.36	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	+	197868	197878	38f657d9-0701-44bb-8c13-d9446f8fe441	-13.81	-172.53	-158.72	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	+	197895	197906	38f657d9-0701-44bb-8c13-d9446f8fe441	-6.43	-136.85	-130.43	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	+	197921	197921	38f657d9-0701-44bb-8c13-d9446f8fe441	-5.68	-127.32	-121.64	1	1	GCCAGCGAAGC
-tig00000001	+	197935	197948	38f657d9-0701-44bb-8c13-d9446f8fe441	-9.31	-196.00	-186.69	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	+	197960	197969	38f657d9-0701-44bb-8c13-d9446f8fe441	-22.80	-186.01	-163.21	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	+	197982	197999	38f657d9-0701-44bb-8c13-d9446f8fe441	-5.68	-173.67	-168.00	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	+	198014	198014	38f657d9-0701-44bb-8c13-d9446f8fe441	0.65	-109.13	-109.78	1	1	GGTGCCGGTTT
-tig00000001	+	198035	198051	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.63	-242.62	-234.99	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	+	198064	198068	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.59	-139.29	-131.69	1	2	CTGCACGTCCGCTGG
-tig00000001	+	198087	198089	38f657d9-0701-44bb-8c13-d9446f8fe441	-12.96	-125.73	-112.77	1	2	ACATTCGCGCCTA
-tig00000001	+	198100	198123	38f657d9-0701-44bb-8c13-d9446f8fe441	-10.49	-201.61	-191.12	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	+	198137	198137	38f657d9-0701-44bb-8c13-d9446f8fe441	-2.98	-105.29	-102.31	1	1	CAGGCCGCCAA
-tig00000001	+	198171	198171	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.79	-100.34	-96.55	1	1	AGCAGCGCCAC
-tig00000001	+	198183	198188	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.72	-116.24	-112.51	1	2	AGTACCGTTACGCTGA
-tig00000001	+	198203	198233	38f657d9-0701-44bb-8c13-d9446f8fe441	-13.40	-238.56	-225.16	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	+	198250	198250	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.36	-105.36	-102.01	1	1	AAAGACGATAG
-tig00000001	+	198289	198313	38f657d9-0701-44bb-8c13-d9446f8fe441	-32.03	-316.45	-284.42	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	+	198326	198336	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.80	-158.08	-154.28	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	+	198352	198364	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.06	-125.76	-118.70	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	+	198399	198415	38f657d9-0701-44bb-8c13-d9446f8fe441	-14.77	-206.92	-192.15	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	+	198427	198485	38f657d9-0701-44bb-8c13-d9446f8fe441	-44.38	-438.70	-394.32	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	+	198513	198513	38f657d9-0701-44bb-8c13-d9446f8fe441	-4.35	-136.48	-132.13	1	1	ACCATCGCAGG
-tig00000001	+	198527	198527	38f657d9-0701-44bb-8c13-d9446f8fe441	-1.79	-105.08	-103.29	1	1	AATATCGCCAG
-tig00000001	+	198545	198569	38f657d9-0701-44bb-8c13-d9446f8fe441	-9.07	-231.71	-222.63	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	+	198585	198619	38f657d9-0701-44bb-8c13-d9446f8fe441	-9.64	-279.57	-269.93	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	+	198660	198670	38f657d9-0701-44bb-8c13-d9446f8fe441	-4.18	-164.52	-160.34	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	+	198684	198710	38f657d9-0701-44bb-8c13-d9446f8fe441	-19.89	-296.48	-276.59	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	+	198728	198782	38f657d9-0701-44bb-8c13-d9446f8fe441	-30.79	-413.59	-382.80	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	+	198812	198821	38f657d9-0701-44bb-8c13-d9446f8fe441	-11.83	-156.38	-144.55	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	+	198834	198855	38f657d9-0701-44bb-8c13-d9446f8fe441	-15.49	-228.99	-213.50	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	+	198872	198872	38f657d9-0701-44bb-8c13-d9446f8fe441	-2.04	-84.82	-82.79	1	1	TTCACCGCTTC
-tig00000001	+	198884	198892	38f657d9-0701-44bb-8c13-d9446f8fe441	1.69	-167.37	-169.06	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	+	198907	198914	38f657d9-0701-44bb-8c13-d9446f8fe441	4.62	-143.08	-147.70	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	+	198927	198927	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.46	-100.14	-96.68	1	1	GTTTACGACTC
-tig00000001	+	198972	198987	38f657d9-0701-44bb-8c13-d9446f8fe441	-2.71	-212.95	-210.25	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	+	199013	199013	38f657d9-0701-44bb-8c13-d9446f8fe441	-2.03	-92.04	-90.01	1	1	CAGTGCGCCAA
-tig00000001	+	199028	199034	38f657d9-0701-44bb-8c13-d9446f8fe441	-5.41	-148.35	-142.94	1	2	CAACACGGTGCCGATTA
-tig00000001	+	199056	199088	38f657d9-0701-44bb-8c13-d9446f8fe441	-13.24	-273.51	-260.27	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	+	199112	199117	38f657d9-0701-44bb-8c13-d9446f8fe441	0.89	-122.37	-123.25	1	2	ACCAGCGAACCGGCAA
-tig00000001	+	199133	199133	38f657d9-0701-44bb-8c13-d9446f8fe441	-0.48	-119.13	-118.65	1	1	ATCACCGGGAT
-tig00000001	+	199147	199156	38f657d9-0701-44bb-8c13-d9446f8fe441	-4.11	-121.01	-116.89	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	+	199172	199172	38f657d9-0701-44bb-8c13-d9446f8fe441	-6.80	-83.27	-76.47	1	1	CAGAACGCCAG
-tig00000001	+	199193	199193	38f657d9-0701-44bb-8c13-d9446f8fe441	-8.27	-112.90	-104.62	1	1	CAGAACGGAGA
-tig00000001	+	199204	199228	38f657d9-0701-44bb-8c13-d9446f8fe441	-4.15	-241.06	-236.90	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	+	199240	199255	38f657d9-0701-44bb-8c13-d9446f8fe441	-21.18	-187.89	-166.71	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	+	199267	199267	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.15	-115.74	-112.59	1	1	CACTTCGCTAA
-tig00000001	+	199280	199280	38f657d9-0701-44bb-8c13-d9446f8fe441	-0.39	-104.41	-104.02	1	1	CCATGCGGGCC
-tig00000001	+	199300	199336	38f657d9-0701-44bb-8c13-d9446f8fe441	-41.82	-320.01	-278.19	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	+	199352	199355	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.47	-105.73	-98.26	1	2	ACCAGCGTCGGGGT
-tig00000001	+	199393	199402	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.97	-194.32	-190.35	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	+	199423	199430	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.78	-123.36	-119.58	1	2	TATTCCGGTGTACGACCA
-tig00000001	+	199446	199446	38f657d9-0701-44bb-8c13-d9446f8fe441	-0.86	-106.75	-105.88	1	1	CAGCCCGGCAA
-tig00000001	+	199459	199459	38f657d9-0701-44bb-8c13-d9446f8fe441	-0.29	-108.97	-108.67	1	1	AACACCGCCAG
-tig00000001	+	199485	199485	38f657d9-0701-44bb-8c13-d9446f8fe441	-1.10	-103.44	-102.34	1	1	CATGCCGTAAA
-tig00000001	+	199500	199509	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.27	-141.41	-134.14	1	3	AGAACCGACACCGCCGAACA
-tig00000001	+	199543	199543	38f657d9-0701-44bb-8c13-d9446f8fe441	-8.57	-121.18	-112.62	1	1	CACATCGGCAC
-tig00000001	+	199557	199570	38f657d9-0701-44bb-8c13-d9446f8fe441	-4.62	-173.67	-169.05	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	+	199582	199593	38f657d9-0701-44bb-8c13-d9446f8fe441	-10.02	-169.20	-159.19	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	+	199606	199621	38f657d9-0701-44bb-8c13-d9446f8fe441	-15.94	-181.03	-165.08	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	+	199644	199652	38f657d9-0701-44bb-8c13-d9446f8fe441	-15.48	-234.91	-219.43	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	+	199687	199687	38f657d9-0701-44bb-8c13-d9446f8fe441	-1.17	-102.28	-101.10	1	1	CTGTCCGTGCC
-tig00000001	+	199740	199746	38f657d9-0701-44bb-8c13-d9446f8fe441	-6.73	-134.76	-128.03	1	2	CACCACGCCTACGCAGA
-tig00000001	+	199770	199770	38f657d9-0701-44bb-8c13-d9446f8fe441	-2.15	-105.92	-103.78	1	1	GACATCGCCCA
-tig00000001	+	199786	199802	38f657d9-0701-44bb-8c13-d9446f8fe441	-9.21	-155.54	-146.33	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	+	199833	199836	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.73	-138.45	-130.72	1	2	CACAGCGCCGTTGG
-tig00000001	+	199854	199854	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.28	-117.76	-110.48	1	1	AAGATCGCCAG
-tig00000001	+	199868	199868	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.03	-112.69	-109.67	1	1	CTGCACGAAGT
-tig00000001	+	199883	199883	38f657d9-0701-44bb-8c13-d9446f8fe441	0.39	-127.46	-127.85	1	1	CAGTGCGGTTG
-tig00000001	+	199899	199908	38f657d9-0701-44bb-8c13-d9446f8fe441	-9.46	-137.09	-127.62	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	+	199931	199943	38f657d9-0701-44bb-8c13-d9446f8fe441	-16.48	-202.84	-186.36	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	+	199956	199956	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.40	-153.36	-145.95	1	1	TTGATCGCTTC
-tig00000001	+	199998	199998	38f657d9-0701-44bb-8c13-d9446f8fe441	-1.34	-132.17	-130.84	1	1	TGTTGCGCTCC
 tig00000001	+	200009	200009	38f657d9-0701-44bb-8c13-d9446f8fe441	-4.50	-128.91	-124.41	1	1	TTCAACGGTAT
 tig00000001	+	200046	200046	38f657d9-0701-44bb-8c13-d9446f8fe441	-0.56	-93.10	-92.54	1	1	TGCAGCGCACC
 tig00000001	+	200081	200081	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.70	-131.39	-123.69	1	1	AACAACGCCAC
@@ -4492,243 +616,6 @@
 tig00000001	+	201922	201930	38f657d9-0701-44bb-8c13-d9446f8fe441	-11.74	-144.81	-133.07	1	2	GTCACCGGCTGGCCGCACT
 tig00000001	+	201944	201950	38f657d9-0701-44bb-8c13-d9446f8fe441	-6.70	-112.14	-105.44	1	2	GCAGGCGCTGCCGGAAG
 tig00000001	+	201961	201986	38f657d9-0701-44bb-8c13-d9446f8fe441	-6.88	-248.38	-241.50	1	4	AACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAA
-tig00000001	+	201998	202007	38f657d9-0701-44bb-8c13-d9446f8fe441	-11.23	-215.35	-204.12	1	2	CAGTCCGCAGGGGCCGTGGT
-tig00000001	+	202020	202020	38f657d9-0701-44bb-8c13-d9446f8fe441	-2.40	-104.59	-102.19	1	1	CTGCTCGGCTG
-tig00000001	+	202033	202046	38f657d9-0701-44bb-8c13-d9446f8fe441	-9.18	-175.38	-166.19	1	3	GTGAGCGGGTGCCGGAAGCGGATG
-tig00000001	+	202064	202081	38f657d9-0701-44bb-8c13-d9446f8fe441	-34.99	-212.27	-177.28	1	5	GCCTGCGCCGCTGCCGCCGTACCGGGTA
-tig00000001	+	202092	202092	38f657d9-0701-44bb-8c13-d9446f8fe441	1.36	-91.32	-92.68	1	1	CTGACCGGGCT
-tig00000001	+	202105	202143	38f657d9-0701-44bb-8c13-d9446f8fe441	-38.48	-333.12	-294.64	1	8	TGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGA
-tig00000001	+	202155	202198	38f657d9-0701-44bb-8c13-d9446f8fe441	-27.45	-370.78	-343.32	1	8	TTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTG
-tig00000001	+	202214	202225	38f657d9-0701-44bb-8c13-d9446f8fe441	-18.87	-175.79	-156.92	1	3	GACCACGCAGGCGCAGCGGGCA
-tig00000001	+	202240	202240	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.86	-99.71	-95.85	1	1	AAGCCCGGCAG
-tig00000001	+	202257	202275	38f657d9-0701-44bb-8c13-d9446f8fe441	-16.12	-194.96	-178.85	1	5	ATTTCCGGCGGGACGGAACCGTCCGCTTT
-tig00000001	+	202295	202330	38f657d9-0701-44bb-8c13-d9446f8fe441	-6.56	-308.99	-302.43	1	5	CCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTG
-tig00000001	+	202341	202341	38f657d9-0701-44bb-8c13-d9446f8fe441	-1.59	-103.05	-101.46	1	1	TCTGCCGTGTG
-tig00000001	+	202352	202370	38f657d9-0701-44bb-8c13-d9446f8fe441	-8.79	-194.99	-186.19	1	4	GCTGACGCACGACCCGGAATACCCGGAGA
-tig00000001	+	202386	202399	38f657d9-0701-44bb-8c13-d9446f8fe441	-17.79	-195.92	-178.13	1	4	CCTGCCGCGCCGCTGGTGCGCTAT
-tig00000001	+	202412	202432	38f657d9-0701-44bb-8c13-d9446f8fe441	-35.48	-264.73	-229.25	1	6	CTGGACGCCCGCGGCGAACTGGCGGCGGTGT
-tig00000001	+	202443	202443	38f657d9-0701-44bb-8c13-d9446f8fe441	0.18	-141.75	-141.93	1	1	ATGACCGCAGC
-tig00000001	+	202461	202461	38f657d9-0701-44bb-8c13-d9446f8fe441	-1.91	-124.25	-122.34	1	1	AGGTGCGCAGC
-tig00000001	+	202475	202475	38f657d9-0701-44bb-8c13-d9446f8fe441	-2.72	-112.31	-109.59	1	1	ACTTACGATGA
-tig00000001	+	202488	202525	38f657d9-0701-44bb-8c13-d9446f8fe441	-13.85	-319.93	-306.07	1	7	AATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAA
-tig00000001	+	202539	202557	38f657d9-0701-44bb-8c13-d9446f8fe441	-20.19	-192.45	-172.25	1	5	GTTACCGTTACGACAGCGACGGGCGGGTG
-tig00000001	+	202579	202579	38f657d9-0701-44bb-8c13-d9446f8fe441	-0.34	-98.50	-98.17	1	1	AAACCCGGCAG
-tig00000001	+	202597	202597	38f657d9-0701-44bb-8c13-d9446f8fe441	-6.09	-98.42	-92.33	1	1	TTACACGTATC
-tig00000001	+	202617	202617	38f657d9-0701-44bb-8c13-d9446f8fe441	1.00	-79.82	-80.82	1	1	AGGACCGCATC
-tig00000001	+	202631	202631	38f657d9-0701-44bb-8c13-d9446f8fe441	1.19	-84.09	-85.28	1	1	ATCACCGACAG
-tig00000001	+	202644	202647	38f657d9-0701-44bb-8c13-d9446f8fe441	-1.42	-102.39	-100.96	1	2	TGAACCGCCGTGAA
-tig00000001	+	202663	202663	38f657d9-0701-44bb-8c13-d9446f8fe441	-6.72	-88.71	-81.99	1	1	GCACACGCAGG
-tig00000001	+	202676	202686	38f657d9-0701-44bb-8c13-d9446f8fe441	-11.88	-179.04	-167.16	1	2	GAAGGCGGGCTGAAGCGGGTG
-tig00000001	+	202705	202722	38f657d9-0701-44bb-8c13-d9446f8fe441	-8.85	-200.78	-191.93	1	5	GAACACGCGGACGGCAGCGTCACGCAGA
-tig00000001	+	202738	202740	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.23	-163.09	-159.86	1	2	TTTGACGCGGTGG
-tig00000001	+	202764	202771	38f657d9-0701-44bb-8c13-d9446f8fe441	-11.78	-136.41	-124.62	1	2	ACAGACGGATGCCGCAGG
-tig00000001	+	202797	202797	38f657d9-0701-44bb-8c13-d9446f8fe441	-0.83	-124.21	-123.38	1	1	CAGTCCGGATG
-tig00000001	+	202809	202809	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.33	-99.93	-96.59	1	1	GGTGACGGGCC
-tig00000001	+	202821	202836	38f657d9-0701-44bb-8c13-d9446f8fe441	-10.76	-191.96	-181.20	1	4	CATCACGCGCATCACCACGCCGGATG
-tig00000001	+	202851	202854	38f657d9-0701-44bb-8c13-d9446f8fe441	-10.18	-138.77	-128.58	1	2	GGCATCGGCGTTTT
-tig00000001	+	202884	202903	38f657d9-0701-44bb-8c13-d9446f8fe441	-20.89	-187.07	-166.17	1	3	GTTAACGTCAGCCACCGGGCCTGACGGGCT
-tig00000001	+	202916	202919	38f657d9-0701-44bb-8c13-d9446f8fe441	2.53	-131.54	-134.07	1	2	AAATACGCCGGGAA
-tig00000001	+	202940	202940	38f657d9-0701-44bb-8c13-d9446f8fe441	-5.14	-114.31	-109.17	1	1	GGGGCCGTCTG
-tig00000001	+	202966	202985	38f657d9-0701-44bb-8c13-d9446f8fe441	-15.57	-195.38	-179.81	1	4	CCTGACGGCGATATCACCCGCTACCGTTAT
-tig00000001	+	203017	203022	38f657d9-0701-44bb-8c13-d9446f8fe441	-15.23	-111.05	-95.82	1	2	CCCTGCGCAACGGAAG
-tig00000001	+	203035	203042	38f657d9-0701-44bb-8c13-d9446f8fe441	-6.28	-109.07	-102.79	1	2	GCCACCGGCAGCCGGAAA
-tig00000001	+	203055	203068	38f657d9-0701-44bb-8c13-d9446f8fe441	-6.62	-166.37	-159.75	1	3	CATGACGTGGAGCCGTTACGGTCA
-tig00000001	+	203098	203098	38f657d9-0701-44bb-8c13-d9446f8fe441	-1.12	-113.40	-112.27	1	1	TGTTCCGGTTA
-tig00000001	+	203111	203111	38f657d9-0701-44bb-8c13-d9446f8fe441	-5.26	-105.90	-100.65	1	1	TAACCCGCTAT
-tig00000001	+	203126	203126	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.50	-95.53	-92.04	1	1	ATGACCGTTTT
-tig00000001	+	203142	203155	38f657d9-0701-44bb-8c13-d9446f8fe441	-8.29	-148.07	-139.79	1	4	GGTGACGGCGGTGCACCGCGAGGA
-tig00000001	+	203177	203192	38f657d9-0701-44bb-8c13-d9446f8fe441	-13.57	-167.01	-153.44	1	4	AGTACCGCGCATACGACAGCCGTGGA
-tig00000001	+	203209	203209	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.05	-86.92	-83.87	1	1	ATTGCCGTGAA
-tig00000001	+	203220	203220	38f657d9-0701-44bb-8c13-d9446f8fe441	-2.32	-90.88	-88.56	1	1	AGACACGCAGG
-tig00000001	+	203235	203237	38f657d9-0701-44bb-8c13-d9446f8fe441	-9.20	-116.31	-107.12	1	2	TGAAACGCGGTAT
-tig00000001	+	203251	203257	38f657d9-0701-44bb-8c13-d9446f8fe441	-8.80	-134.20	-125.40	1	3	TACAACGCCGCCGGTGA
-tig00000001	+	203272	203272	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.83	-96.46	-88.63	1	1	ACCACCGTCAT
-tig00000001	+	203283	203287	38f657d9-0701-44bb-8c13-d9446f8fe441	0.26	-100.91	-101.17	1	2	TGCCCCGGACGGCAG
-tig00000001	+	203299	203299	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.16	-122.00	-118.84	1	1	AGAAACGGGAC
-tig00000001	+	203311	203316	38f657d9-0701-44bb-8c13-d9446f8fe441	-11.83	-192.51	-180.69	1	2	CAGTACGATGCGTGGG
-tig00000001	+	203340	203357	38f657d9-0701-44bb-8c13-d9446f8fe441	-23.17	-210.14	-186.97	1	4	TACCACGCAGGGCGGTCTGACGCGCAGT
-tig00000001	+	203371	203393	38f657d9-0701-44bb-8c13-d9446f8fe441	-16.81	-213.07	-196.26	1	4	GAATACGATGCTGCCGGACGGGTCATCCGCCTG
-tig00000001	+	203410	203410	38f657d9-0701-44bb-8c13-d9446f8fe441	-9.33	-109.88	-100.56	1	1	GAAAACGGCAG
-tig00000001	+	203429	203447	38f657d9-0701-44bb-8c13-d9446f8fe441	-8.54	-173.70	-165.16	1	4	CCTTCCGTTACGATGTACTCGACCGGCTG
-tig00000001	+	203464	203486	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.08	-179.95	-172.87	1	4	GAAACCGGCTTTGACGGCCGCACACAGCGTTAT
-tig00000001	+	203497	203506	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.40	-107.04	-103.64	1	2	CACCACGACCTGACCGGCAA
-tig00000001	+	203519	203524	38f657d9-0701-44bb-8c13-d9446f8fe441	0.99	-114.99	-115.98	1	2	TTATCCGCAGCGAGGA
-tig00000001	+	203560	203609	38f657d9-0701-44bb-8c13-d9446f8fe441	-35.07	-338.79	-303.72	1	8	TATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGG
-tig00000001	+	203623	203629	38f657d9-0701-44bb-8c13-d9446f8fe441	-5.20	-115.19	-109.99	1	3	TATGACGAACGCGGCTG
-tig00000001	+	203659	203676	38f657d9-0701-44bb-8c13-d9446f8fe441	-4.21	-171.33	-167.12	1	3	ATCAGCGAAGGGCACCGGGTGACGGTGC
-tig00000001	+	203705	203710	38f657d9-0701-44bb-8c13-d9446f8fe441	-9.83	-131.41	-121.57	1	2	AAGGCCGCCTCGCCAG
-tig00000001	+	203727	203727	38f657d9-0701-44bb-8c13-d9446f8fe441	-3.89	-90.48	-86.59	1	1	CCTGACGGTGC
-tig00000001	+	203739	203745	38f657d9-0701-44bb-8c13-d9446f8fe441	-6.92	-124.93	-118.02	1	2	TCATCCGCAGACGAATG
-tig00000001	+	203781	203788	38f657d9-0701-44bb-8c13-d9446f8fe441	-6.43	-126.32	-119.89	1	2	ACATGCGTACAACGCACA
-tig00000001	+	203802	203817	38f657d9-0701-44bb-8c13-d9446f8fe441	-7.82	-168.68	-160.85	1	3	ACTGGCGAACCGCTGTATACCGGACA
-tig00000001	+	203830	203833	38f657d9-0701-44bb-8c13-d9446f8fe441	-9.02	-146.63	-137.60	1	2	CTGCCCGCCGTGGA
-tig00000001	+	203851	203857	38f657d9-0701-44bb-8c13-d9446f8fe441	-8.03	-146.87	-138.84	1	2	ACCTACGGCAGCGGCTG
-tig00000001	+	203881	203892	38f657d9-0701-44bb-8c13-d9446f8fe441	-14.63	-148.74	-134.11	1	3	AAACTCGGCGACACACCGCTGG
-tig00000001	+	203909	203948	38f657d9-0701-44bb-8c13-d9446f8fe441	-32.83	-269.01	-236.18	1	8	ACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTAT
-tig00000001	+	203965	203965	38f657d9-0701-44bb-8c13-d9446f8fe441	-6.51	-105.74	-99.23	1	1	ACCACCGCTTA
-tig00000001	+	203980	203980	38f657d9-0701-44bb-8c13-d9446f8fe441	1.53	-82.48	-84.00	1	1	CCTGCCGGGCA
-tig00000001	+	204023	204025	38f657d9-0701-44bb-8c13-d9446f8fe441	-14.66	-131.89	-117.23	1	2	CTGACCGCGATTA
-tig00000001	+	204040	204059	38f657d9-0701-44bb-8c13-d9446f8fe441	-23.33	-214.85	-191.53	1	4	TGGAACGACAACGGCGAACTCATCCGCATC
-tig00000001	+	204072	204083	38f657d9-0701-44bb-8c13-d9446f8fe441	-18.50	-178.31	-159.81	1	3	CAGCCCGCGCCAGACCCGGAGT
-tig00000001	+	204106	204106	38f657d9-0701-44bb-8c13-d9446f8fe441	-1.76	-84.90	-83.14	1	1	ACCACCGGCAG
-tig00000001	+	204118	204121	38f657d9-0701-44bb-8c13-d9446f8fe441	-9.95	-130.86	-120.91	1	2	CTGACCGGCGTTCA
-tig00000001	+	204133	204138	38f657d9-0701-44bb-8c13-d9446f8fe441	-10.33	-157.39	-147.06	1	2	ACCACCGCAGCGAATC
-tig00000001	+	204152	204159	38f657d9-0701-44bb-8c13-d9446f8fe441	-1.72	-108.26	-106.54	1	2	ATATCCGCATCCCGTATA
-tig00000001	+	195646	195663	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-12.63	-238.60	-225.97	1	5	ATCAACGCGATCGGCAGTACGGCGCAGT
-tig00000001	+	195676	195685	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-20.70	-182.05	-161.35	1	3	CAGTTCGCGCAGGGCGATCA
-tig00000001	+	195702	195702	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	0.81	-109.97	-110.78	1	1	CTTTGCGGAAA
-tig00000001	+	195720	195735	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	1.03	-163.34	-164.38	1	4	AATGGCGCGCTCCGCCTGCCCGGCAA
-tig00000001	+	195764	195781	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-2.88	-177.38	-174.50	1	4	TCAGCCGCTGGCGCAGATCGTCCGGGGC
-tig00000001	+	195803	195842	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-33.77	-321.32	-287.55	1	8	CACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACC
-tig00000001	+	195855	195864	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-14.03	-142.86	-128.82	1	3	AATTCCGGTGACGCCGCTGA
-tig00000001	+	195900	195906	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-3.68	-104.78	-101.11	1	2	CTGAACGTTGACGGTAG
-tig00000001	+	195945	195945	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-5.66	-142.25	-136.59	1	1	TTCTTCGATAT
-tig00000001	+	195959	195959	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	4.98	-118.10	-123.09	1	1	GCCAGCGTTTG
-tig00000001	+	195971	195971	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-5.55	-125.78	-120.23	1	1	GATGACGGGAA
-tig00000001	+	195982	195982	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-20.90	-126.40	-105.51	1	1	CCTGGCGCATT
-tig00000001	+	195994	196002	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-10.71	-139.05	-128.34	1	2	CTGTGCGCCAGTTCGTCCA
-tig00000001	+	196018	196044	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-34.71	-304.03	-269.32	1	7	ATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGAT
-tig00000001	+	196056	196056	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-10.65	-137.06	-126.40	1	1	AAACTCGCTGA
-tig00000001	+	196067	196093	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-5.62	-226.36	-220.74	1	5	TATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAG
-tig00000001	+	196122	196125	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-1.52	-150.76	-149.24	1	2	CATGGCGGCGGTAT
-tig00000001	+	196136	196140	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-6.70	-132.72	-126.01	1	2	CTTTTCGCCCGTGGG
-tig00000001	+	196155	196155	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-8.57	-107.22	-98.65	1	1	TACCACGCCAA
-tig00000001	+	196180	196190	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-14.28	-165.34	-151.06	1	3	CCTTGCGCCCGCAGTCGCTGG
-tig00000001	+	196210	196210	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-2.97	-101.98	-99.01	1	1	AGCATCGCCCA
-tig00000001	+	196224	196227	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-3.61	-101.19	-97.58	1	2	CTTCCCGACGCCTG
-tig00000001	+	196242	196242	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	1.37	-84.00	-85.38	1	1	GGCACCGAAGA
-tig00000001	+	196264	196274	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-6.51	-155.45	-148.94	1	4	TTCCCCGATGCGGCGCGGCAG
-tig00000001	+	196294	196319	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-14.83	-282.96	-268.13	1	5	GCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
-tig00000001	+	196342	196342	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-1.63	-108.84	-107.22	1	1	TCCAGCGCCAG
-tig00000001	+	196372	196380	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-2.55	-189.33	-186.78	1	2	ACAACCGGCTGGCCGATAT
-tig00000001	+	196396	196396	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	2.88	-144.82	-147.70	1	1	ACCAGCGGTTG
-tig00000001	+	196416	196426	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-4.70	-143.14	-138.44	1	2	TTTTGCGATCAGTTGCGTGAG
-tig00000001	+	196440	196440	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-7.52	-98.44	-90.92	1	1	TTCAACGCTGA
-tig00000001	+	196451	196466	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-18.72	-182.84	-164.12	1	5	GATTACGCGCTTTCGCCACGCGTGGG
-tig00000001	+	196483	196492	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-15.96	-156.28	-140.32	1	3	CAGGCCGCCGCTTGCGGGTG
-tig00000001	+	196514	196527	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-0.50	-146.57	-146.07	1	3	CAGCCCGCTTGCCGATGCCGTCAC
-tig00000001	+	196542	196576	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-16.93	-290.13	-273.20	1	7	TCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAAT
-tig00000001	+	196589	196595	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-8.12	-137.12	-129.00	1	3	AGCAACGCGTGCGGCTA
-tig00000001	+	196629	196629	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-0.12	-117.68	-117.56	1	1	CTGACCGCCAG
-tig00000001	+	196643	196643	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-5.75	-113.95	-108.19	1	1	GCTCCCGCCAG
-tig00000001	+	196677	196690	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-7.75	-164.40	-156.65	1	4	TCTGCCGTTGCCGACGGGCGACCA
-tig00000001	+	196706	196712	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-12.56	-144.50	-131.94	1	2	ATAGCCGTTGCCGGTAA
-tig00000001	+	196727	196749	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-20.99	-229.79	-208.80	1	5	CTGCCCGATTAATGCCGAACCGCGCACCGTATC
-tig00000001	+	196762	196770	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-6.57	-139.22	-132.65	1	2	CTTCACGAATCAACGAACC
-tig00000001	+	196810	196810	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-5.90	-102.33	-96.43	1	1	CAGTACGGTGG
-tig00000001	+	196823	196834	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-14.40	-146.19	-131.79	1	3	AGCAGCGGGTAAACGCCGCCAG
-tig00000001	+	196874	196878	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-6.71	-117.51	-110.80	1	2	AATGCCGGACGTAAT
-tig00000001	+	196909	196915	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-5.04	-119.74	-114.70	1	2	CAGACCGCAAACGGTCA
-tig00000001	+	196945	196952	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-6.61	-157.99	-151.38	1	2	GATACCGATAAACGGCAC
-tig00000001	+	196975	196975	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	1.34	-91.92	-93.26	1	1	CAGACCGTAAA
-tig00000001	+	196992	196995	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-5.02	-121.43	-116.41	1	2	AGTTACGGCGCAAC
-tig00000001	+	197011	197018	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-7.61	-127.59	-119.98	1	2	AGAAGCGGTAAGCGGTTT
-tig00000001	+	197032	197041	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-7.91	-182.63	-174.72	1	2	ACTCACGCCTTTAACGCCAG
-tig00000001	+	197059	197059	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-20.96	-145.21	-124.25	1	1	AAAGACGATAA
-tig00000001	+	197071	197071	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-13.79	-124.29	-110.49	1	1	CAAGGCGTTGA
-tig00000001	+	197084	197084	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-14.74	-139.40	-124.66	1	1	ATCACCGCACT
-tig00000001	+	197098	197108	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-19.49	-164.93	-145.44	1	3	GATTGCGGAGTCGGGCGAATG
-tig00000001	+	197132	197132	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-6.32	-122.27	-115.95	1	1	TTCAGCGCATT
-tig00000001	+	197144	197168	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-31.01	-269.02	-238.01	1	6	AACTGCGGATACGTTGCCGCGAATGCCGCCGGAAT
-tig00000001	+	197179	197197	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-15.83	-203.67	-187.84	1	3	AATGGCGAAGTATTTCGCCACATCGTTGG
-tig00000001	+	197222	197229	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-3.26	-122.80	-119.54	1	2	GTCAGCGAGCCACGGGTC
-tig00000001	+	197266	197266	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-14.56	-107.95	-93.39	1	1	CACCTCGATCA
-tig00000001	+	197279	197279	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-5.50	-117.03	-111.53	1	1	TTGGTCGGGTT
-tig00000001	+	197290	197296	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-3.49	-147.82	-144.32	1	2	AGAGTCGAGATCGACCA
-tig00000001	+	197309	197321	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-10.97	-199.31	-188.34	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	+	197332	197350	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-15.94	-197.19	-181.25	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	+	197363	197420	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-26.20	-405.22	-379.01	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	+	197433	197433	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	0.96	-155.14	-156.09	1	1	ACTGACGGATC
-tig00000001	+	197456	197470	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-12.06	-198.05	-185.99	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	+	197482	197509	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-12.37	-276.86	-264.49	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	+	197520	197530	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-11.60	-171.37	-159.77	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	+	197543	197543	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	1.65	-111.22	-112.87	1	1	ATCACCGTTTT
-tig00000001	+	197562	197577	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-14.11	-198.94	-184.84	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	+	197590	197599	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-3.76	-140.66	-136.90	1	2	AATACCGCCTTTGACGATAT
-tig00000001	+	197612	197620	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-9.04	-116.61	-107.57	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	+	197631	197631	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-1.91	-78.87	-76.97	1	1	GCACACGAGAA
-tig00000001	+	197654	197657	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	1.63	-143.38	-145.01	1	2	ACCAGCGGCGTGGC
-tig00000001	+	197670	197672	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-10.94	-124.76	-113.82	1	2	CCTGACGCGCAAC
-tig00000001	+	197683	197683	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-2.52	-108.28	-105.76	1	1	CTGATCGACTT
-tig00000001	+	197701	197701	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-6.30	-127.19	-120.89	1	1	AACATCGGTAG
-tig00000001	+	197719	197719	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	0.63	-120.80	-121.44	1	1	ACCACCGTTAG
-tig00000001	+	197736	197749	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-22.27	-192.98	-170.71	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	+	197763	197779	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-15.77	-191.88	-176.10	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	+	197791	197816	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-15.33	-244.86	-229.54	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	+	197837	197837	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-1.40	-106.28	-104.88	1	1	TGGAGCGACTG
-tig00000001	+	197848	197856	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-20.50	-186.31	-165.81	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	+	197868	197878	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-6.64	-161.35	-154.71	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	+	197895	197906	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-2.75	-128.34	-125.59	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	+	197921	197921	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-3.13	-102.75	-99.62	1	1	GCCAGCGAAGC
-tig00000001	+	197935	197948	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-7.37	-184.83	-177.46	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	+	197960	197969	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-11.69	-173.71	-162.02	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	+	197982	197999	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-22.54	-238.10	-215.56	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	+	198014	198014	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-5.01	-117.37	-112.36	1	1	GGTGCCGGTTT
-tig00000001	+	198035	198051	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-11.33	-172.08	-160.75	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	+	198064	198068	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-7.24	-113.95	-106.71	1	2	CTGCACGTCCGCTGG
-tig00000001	+	198087	198089	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-9.68	-101.30	-91.62	1	2	ACATTCGCGCCTA
-tig00000001	+	198100	198123	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-19.13	-223.74	-204.61	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	+	198137	198137	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-1.20	-116.19	-114.98	1	1	CAGGCCGCCAA
-tig00000001	+	198171	198171	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-3.45	-133.44	-129.99	1	1	AGCAGCGCCAC
-tig00000001	+	198183	198188	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-3.15	-110.19	-107.04	1	2	AGTACCGTTACGCTGA
-tig00000001	+	198203	198233	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-5.30	-262.61	-257.30	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	+	198250	198250	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-6.75	-125.53	-118.78	1	1	AAAGACGATAG
-tig00000001	+	198289	198313	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-21.54	-235.95	-214.42	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	+	198326	198336	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-7.06	-164.00	-156.94	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	+	198352	198364	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-13.04	-155.71	-142.67	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	+	198399	198415	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-26.29	-225.05	-198.76	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	+	198427	198485	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-47.85	-455.08	-407.23	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	+	198513	198513	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-6.56	-106.14	-99.58	1	1	ACCATCGCAGG
-tig00000001	+	198527	198527	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-4.83	-100.30	-95.47	1	1	AATATCGCCAG
-tig00000001	+	198545	198569	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-13.25	-321.26	-308.01	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	+	198585	198619	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-32.49	-285.30	-252.80	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	+	198660	198670	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-2.12	-176.14	-174.02	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	+	198684	198710	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-25.42	-230.30	-204.89	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	+	198728	198782	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-55.02	-449.27	-394.25	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	+	198812	198821	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-5.73	-169.59	-163.86	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	+	198834	198855	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-25.06	-242.22	-217.16	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	+	198872	198872	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	0.61	-119.41	-120.03	1	1	TTCACCGCTTC
-tig00000001	+	198884	198892	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-3.06	-174.83	-171.78	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	+	198907	198914	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-12.09	-176.63	-164.55	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	+	198927	198927	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-2.41	-99.73	-97.31	1	1	GTTTACGACTC
-tig00000001	+	198972	198987	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-12.58	-202.32	-189.74	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	+	199013	199013	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-3.76	-109.31	-105.55	1	1	CAGTGCGCCAA
-tig00000001	+	199028	199034	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-4.56	-132.17	-127.61	1	2	CAACACGGTGCCGATTA
-tig00000001	+	199056	199088	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-12.11	-287.13	-275.02	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	+	199112	199117	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-4.50	-119.45	-114.95	1	2	ACCAGCGAACCGGCAA
-tig00000001	+	199133	199133	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-3.04	-90.47	-87.42	1	1	ATCACCGGGAT
-tig00000001	+	199147	199156	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-5.36	-131.04	-125.68	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	+	199172	199172	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-6.01	-134.67	-128.66	1	1	CAGAACGCCAG
-tig00000001	+	199193	199193	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-9.78	-108.60	-98.82	1	1	CAGAACGGAGA
-tig00000001	+	199204	199228	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-12.66	-290.97	-278.31	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	+	199240	199255	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-15.91	-211.70	-195.79	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	+	199267	199267	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-9.59	-106.61	-97.02	1	1	CACTTCGCTAA
-tig00000001	+	199280	199280	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-5.44	-123.40	-117.95	1	1	CCATGCGGGCC
-tig00000001	+	199300	199336	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-39.80	-304.22	-264.42	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	+	199352	199355	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-6.70	-138.78	-132.07	1	2	ACCAGCGTCGGGGT
-tig00000001	+	199393	199402	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-4.67	-175.47	-170.80	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	+	199423	199430	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-1.76	-136.91	-135.15	1	2	TATTCCGGTGTACGACCA
-tig00000001	+	199446	199446	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	0.40	-87.04	-87.44	1	1	CAGCCCGGCAA
-tig00000001	+	199459	199459	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-8.83	-92.08	-83.25	1	1	AACACCGCCAG
-tig00000001	+	199485	199485	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-0.27	-90.67	-90.40	1	1	CATGCCGTAAA
-tig00000001	+	199500	199509	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-14.05	-134.88	-120.83	1	3	AGAACCGACACCGCCGAACA
-tig00000001	+	199543	199543	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-1.52	-89.67	-88.15	1	1	CACATCGGCAC
-tig00000001	+	199557	199570	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-18.13	-159.58	-141.45	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	+	199582	199593	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-10.31	-145.34	-135.03	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	+	199606	199621	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-7.10	-176.90	-169.80	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	+	199644	199652	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-16.67	-157.90	-141.23	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	+	199687	199687	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-1.64	-103.65	-102.01	1	1	CTGTCCGTGCC
-tig00000001	+	199740	199746	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-5.70	-175.46	-169.76	1	2	CACCACGCCTACGCAGA
-tig00000001	+	199770	199770	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-3.68	-91.11	-87.43	1	1	GACATCGCCCA
-tig00000001	+	199786	199802	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-14.31	-184.81	-170.49	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	+	199833	199836	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-2.81	-114.26	-111.46	1	2	CACAGCGCCGTTGG
-tig00000001	+	199854	199854	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-2.35	-113.60	-111.25	1	1	AAGATCGCCAG
-tig00000001	+	199868	199868	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-3.15	-122.46	-119.31	1	1	CTGCACGAAGT
-tig00000001	+	199883	199883	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-5.77	-118.64	-112.87	1	1	CAGTGCGGTTG
-tig00000001	+	199899	199908	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-16.31	-216.73	-200.43	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	+	199931	199943	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-16.20	-162.68	-146.48	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	+	199956	199956	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-5.80	-93.70	-87.90	1	1	TTGATCGCTTC
-tig00000001	+	199998	199998	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-6.95	-135.84	-128.89	1	1	TGTTGCGCTCC
 tig00000001	+	200009	200009	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-7.41	-138.07	-130.67	1	1	TTCAACGGTAT
 tig00000001	+	200046	200046	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-7.34	-93.26	-85.91	1	1	TGCAGCGCACC
 tig00000001	+	200081	200081	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-3.56	-133.19	-129.64	1	1	AACAACGCCAC
@@ -4784,159 +671,6 @@
 tig00000001	+	201922	201930	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-12.93	-136.77	-123.84	1	2	GTCACCGGCTGGCCGCACT
 tig00000001	+	201944	201950	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-8.33	-133.60	-125.27	1	2	GCAGGCGCTGCCGGAAG
 tig00000001	+	201961	201986	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-8.36	-268.72	-260.36	1	4	AACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAA
-tig00000001	+	201998	202007	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-6.41	-190.40	-183.99	1	2	CAGTCCGCAGGGGCCGTGGT
-tig00000001	+	202020	202020	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-14.23	-163.05	-148.82	1	1	CTGCTCGGCTG
-tig00000001	+	202033	202046	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-25.16	-226.14	-200.98	1	3	GTGAGCGGGTGCCGGAAGCGGATG
-tig00000001	+	202064	202081	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-32.19	-228.55	-196.35	1	5	GCCTGCGCCGCTGCCGCCGTACCGGGTA
-tig00000001	+	202092	202092	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-4.68	-143.12	-138.44	1	1	CTGACCGGGCT
-tig00000001	+	202105	202143	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-50.07	-342.73	-292.66	1	8	TGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGA
-tig00000001	+	202155	202198	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-41.07	-350.02	-308.95	1	8	TTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTG
-tig00000001	+	202214	202225	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-11.13	-206.41	-195.28	1	3	GACCACGCAGGCGCAGCGGGCA
-tig00000001	+	202240	202240	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	1.04	-113.06	-114.10	1	1	AAGCCCGGCAG
-tig00000001	+	202257	202275	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-24.26	-221.79	-197.52	1	5	ATTTCCGGCGGGACGGAACCGTCCGCTTT
-tig00000001	+	202295	202330	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-8.39	-286.70	-278.31	1	5	CCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTG
-tig00000001	+	202341	202341	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-0.69	-113.46	-112.77	1	1	TCTGCCGTGTG
-tig00000001	+	202352	202370	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-17.89	-218.44	-200.54	1	4	GCTGACGCACGACCCGGAATACCCGGAGA
-tig00000001	+	202386	202399	c39789a3-7c1c-4b1e-bc6d-dc0df49e969c	-23.34	-201.76	-178.42	1	4	CCTGCCGCGCCGCTGGTGCGCTAT
-tig00000001	+	196122	196125	1896c369-b7d0-4e98-aa23-830f7a9f001f	-3.48	-146.49	-143.01	1	2	CATGGCGGCGGTAT
-tig00000001	+	196136	196140	1896c369-b7d0-4e98-aa23-830f7a9f001f	-3.51	-141.31	-137.80	1	2	CTTTTCGCCCGTGGG
-tig00000001	+	196155	196155	1896c369-b7d0-4e98-aa23-830f7a9f001f	-6.21	-168.02	-161.81	1	1	TACCACGCCAA
-tig00000001	+	196180	196190	1896c369-b7d0-4e98-aa23-830f7a9f001f	-12.29	-182.71	-170.42	1	3	CCTTGCGCCCGCAGTCGCTGG
-tig00000001	+	196210	196210	1896c369-b7d0-4e98-aa23-830f7a9f001f	-2.94	-136.47	-133.53	1	1	AGCATCGCCCA
-tig00000001	+	196224	196227	1896c369-b7d0-4e98-aa23-830f7a9f001f	-3.96	-116.70	-112.74	1	2	CTTCCCGACGCCTG
-tig00000001	+	196242	196242	1896c369-b7d0-4e98-aa23-830f7a9f001f	-9.86	-118.46	-108.60	1	1	GGCACCGAAGA
-tig00000001	+	196264	196274	1896c369-b7d0-4e98-aa23-830f7a9f001f	-12.28	-244.91	-232.63	1	4	TTCCCCGATGCGGCGCGGCAG
-tig00000001	+	196294	196319	1896c369-b7d0-4e98-aa23-830f7a9f001f	-12.48	-317.06	-304.58	1	5	GCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
-tig00000001	+	196342	196342	1896c369-b7d0-4e98-aa23-830f7a9f001f	-2.59	-92.95	-90.36	1	1	TCCAGCGCCAG
-tig00000001	+	196372	196380	1896c369-b7d0-4e98-aa23-830f7a9f001f	-3.94	-172.50	-168.56	1	2	ACAACCGGCTGGCCGATAT
-tig00000001	+	196396	196396	1896c369-b7d0-4e98-aa23-830f7a9f001f	-1.89	-112.72	-110.84	1	1	ACCAGCGGTTG
-tig00000001	+	196416	196426	1896c369-b7d0-4e98-aa23-830f7a9f001f	0.93	-210.49	-211.43	1	2	TTTTGCGATCAGTTGCGTGAG
-tig00000001	+	196440	196440	1896c369-b7d0-4e98-aa23-830f7a9f001f	0.17	-104.85	-105.02	1	1	TTCAACGCTGA
-tig00000001	+	196451	196466	1896c369-b7d0-4e98-aa23-830f7a9f001f	-15.57	-219.41	-203.85	1	5	GATTACGCGCTTTCGCCACGCGTGGG
-tig00000001	+	196483	196492	1896c369-b7d0-4e98-aa23-830f7a9f001f	-15.72	-181.32	-165.60	1	3	CAGGCCGCCGCTTGCGGGTG
-tig00000001	+	196514	196527	1896c369-b7d0-4e98-aa23-830f7a9f001f	-5.76	-203.37	-197.61	1	3	CAGCCCGCTTGCCGATGCCGTCAC
-tig00000001	+	196542	196576	1896c369-b7d0-4e98-aa23-830f7a9f001f	-28.33	-322.99	-294.66	1	7	TCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAAT
-tig00000001	+	196589	196595	1896c369-b7d0-4e98-aa23-830f7a9f001f	-4.83	-159.51	-154.68	1	3	AGCAACGCGTGCGGCTA
-tig00000001	+	196629	196629	1896c369-b7d0-4e98-aa23-830f7a9f001f	-5.14	-150.84	-145.70	1	1	CTGACCGCCAG
-tig00000001	+	196643	196643	1896c369-b7d0-4e98-aa23-830f7a9f001f	-4.33	-124.92	-120.60	1	1	GCTCCCGCCAG
-tig00000001	+	196677	196690	1896c369-b7d0-4e98-aa23-830f7a9f001f	-11.84	-182.04	-170.21	1	4	TCTGCCGTTGCCGACGGGCGACCA
-tig00000001	+	196706	196712	1896c369-b7d0-4e98-aa23-830f7a9f001f	0.12	-180.76	-180.87	1	2	ATAGCCGTTGCCGGTAA
-tig00000001	+	196727	196749	1896c369-b7d0-4e98-aa23-830f7a9f001f	-21.18	-241.37	-220.19	1	5	CTGCCCGATTAATGCCGAACCGCGCACCGTATC
-tig00000001	+	196762	196770	1896c369-b7d0-4e98-aa23-830f7a9f001f	-1.77	-163.57	-161.80	1	2	CTTCACGAATCAACGAACC
-tig00000001	+	196810	196810	1896c369-b7d0-4e98-aa23-830f7a9f001f	-7.39	-148.03	-140.64	1	1	CAGTACGGTGG
-tig00000001	+	196823	196834	1896c369-b7d0-4e98-aa23-830f7a9f001f	-10.67	-161.55	-150.88	1	3	AGCAGCGGGTAAACGCCGCCAG
-tig00000001	+	196874	196878	1896c369-b7d0-4e98-aa23-830f7a9f001f	-9.28	-159.35	-150.07	1	2	AATGCCGGACGTAAT
-tig00000001	+	196909	196915	1896c369-b7d0-4e98-aa23-830f7a9f001f	-0.33	-168.50	-168.17	1	2	CAGACCGCAAACGGTCA
-tig00000001	+	196945	196952	1896c369-b7d0-4e98-aa23-830f7a9f001f	1.61	-144.88	-146.49	1	2	GATACCGATAAACGGCAC
-tig00000001	+	196975	196975	1896c369-b7d0-4e98-aa23-830f7a9f001f	-3.36	-103.25	-99.89	1	1	CAGACCGTAAA
-tig00000001	+	196992	196995	1896c369-b7d0-4e98-aa23-830f7a9f001f	-8.60	-168.11	-159.51	1	2	AGTTACGGCGCAAC
-tig00000001	+	197011	197018	1896c369-b7d0-4e98-aa23-830f7a9f001f	-3.97	-199.66	-195.69	1	2	AGAAGCGGTAAGCGGTTT
-tig00000001	+	197032	197041	1896c369-b7d0-4e98-aa23-830f7a9f001f	-6.34	-190.25	-183.91	1	2	ACTCACGCCTTTAACGCCAG
-tig00000001	+	197059	197059	1896c369-b7d0-4e98-aa23-830f7a9f001f	-4.86	-135.11	-130.25	1	1	AAAGACGATAA
-tig00000001	+	197071	197071	1896c369-b7d0-4e98-aa23-830f7a9f001f	-8.14	-124.59	-116.45	1	1	CAAGGCGTTGA
-tig00000001	+	197084	197084	1896c369-b7d0-4e98-aa23-830f7a9f001f	-5.66	-129.93	-124.27	1	1	ATCACCGCACT
-tig00000001	+	197098	197108	1896c369-b7d0-4e98-aa23-830f7a9f001f	-2.77	-169.86	-167.09	1	3	GATTGCGGAGTCGGGCGAATG
-tig00000001	+	197132	197132	1896c369-b7d0-4e98-aa23-830f7a9f001f	-1.78	-106.21	-104.44	1	1	TTCAGCGCATT
-tig00000001	+	197144	197168	1896c369-b7d0-4e98-aa23-830f7a9f001f	-10.71	-226.71	-216.00	1	6	AACTGCGGATACGTTGCCGCGAATGCCGCCGGAAT
-tig00000001	+	197179	197197	1896c369-b7d0-4e98-aa23-830f7a9f001f	-9.68	-220.52	-210.84	1	3	AATGGCGAAGTATTTCGCCACATCGTTGG
-tig00000001	+	197222	197229	1896c369-b7d0-4e98-aa23-830f7a9f001f	-4.38	-187.68	-183.30	1	2	GTCAGCGAGCCACGGGTC
-tig00000001	+	197266	197266	1896c369-b7d0-4e98-aa23-830f7a9f001f	-5.25	-153.88	-148.63	1	1	CACCTCGATCA
-tig00000001	+	197279	197279	1896c369-b7d0-4e98-aa23-830f7a9f001f	4.21	-169.65	-173.86	1	1	TTGGTCGGGTT
-tig00000001	+	197290	197296	1896c369-b7d0-4e98-aa23-830f7a9f001f	-11.41	-158.72	-147.31	1	2	AGAGTCGAGATCGACCA
-tig00000001	+	197309	197321	1896c369-b7d0-4e98-aa23-830f7a9f001f	-6.42	-178.56	-172.14	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	+	197332	197350	1896c369-b7d0-4e98-aa23-830f7a9f001f	-13.42	-269.65	-256.23	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	+	197363	197420	1896c369-b7d0-4e98-aa23-830f7a9f001f	-29.86	-508.70	-478.84	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	+	197433	197433	1896c369-b7d0-4e98-aa23-830f7a9f001f	-1.24	-98.77	-97.53	1	1	ACTGACGGATC
-tig00000001	+	197456	197470	1896c369-b7d0-4e98-aa23-830f7a9f001f	-15.56	-227.96	-212.40	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	+	197482	197509	1896c369-b7d0-4e98-aa23-830f7a9f001f	-12.19	-292.74	-280.55	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	+	197520	197530	1896c369-b7d0-4e98-aa23-830f7a9f001f	-6.97	-162.40	-155.43	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	+	197543	197543	1896c369-b7d0-4e98-aa23-830f7a9f001f	-2.08	-112.40	-110.33	1	1	ATCACCGTTTT
-tig00000001	+	197562	197577	1896c369-b7d0-4e98-aa23-830f7a9f001f	-7.57	-233.20	-225.63	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	+	197590	197599	1896c369-b7d0-4e98-aa23-830f7a9f001f	-3.95	-175.37	-171.42	1	2	AATACCGCCTTTGACGATAT
-tig00000001	+	197612	197620	1896c369-b7d0-4e98-aa23-830f7a9f001f	-5.50	-115.52	-110.02	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	+	197631	197631	1896c369-b7d0-4e98-aa23-830f7a9f001f	-3.23	-109.41	-106.18	1	1	GCACACGAGAA
-tig00000001	+	197654	197657	1896c369-b7d0-4e98-aa23-830f7a9f001f	-5.13	-123.37	-118.23	1	2	ACCAGCGGCGTGGC
-tig00000001	+	197670	197672	1896c369-b7d0-4e98-aa23-830f7a9f001f	-6.29	-113.35	-107.06	1	2	CCTGACGCGCAAC
-tig00000001	+	197683	197683	1896c369-b7d0-4e98-aa23-830f7a9f001f	-5.10	-120.16	-115.06	1	1	CTGATCGACTT
-tig00000001	+	197701	197701	1896c369-b7d0-4e98-aa23-830f7a9f001f	-4.12	-115.91	-111.80	1	1	AACATCGGTAG
-tig00000001	+	197719	197719	1896c369-b7d0-4e98-aa23-830f7a9f001f	-1.00	-115.88	-114.88	1	1	ACCACCGTTAG
-tig00000001	+	197736	197749	1896c369-b7d0-4e98-aa23-830f7a9f001f	-14.92	-249.43	-234.50	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	+	197763	197779	1896c369-b7d0-4e98-aa23-830f7a9f001f	-7.32	-206.95	-199.63	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	+	197791	197816	1896c369-b7d0-4e98-aa23-830f7a9f001f	-12.41	-261.79	-249.38	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	+	197837	197837	1896c369-b7d0-4e98-aa23-830f7a9f001f	-1.14	-146.95	-145.80	1	1	TGGAGCGACTG
-tig00000001	+	197848	197856	1896c369-b7d0-4e98-aa23-830f7a9f001f	-3.82	-183.77	-179.95	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	+	197868	197878	1896c369-b7d0-4e98-aa23-830f7a9f001f	-5.06	-168.21	-163.15	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	+	197895	197906	1896c369-b7d0-4e98-aa23-830f7a9f001f	-1.89	-196.96	-195.07	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	+	197921	197921	1896c369-b7d0-4e98-aa23-830f7a9f001f	-2.37	-185.83	-183.46	1	1	GCCAGCGAAGC
-tig00000001	+	197935	197948	1896c369-b7d0-4e98-aa23-830f7a9f001f	-5.92	-211.34	-205.42	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	+	197960	197969	1896c369-b7d0-4e98-aa23-830f7a9f001f	-4.16	-212.60	-208.44	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	+	197982	197999	1896c369-b7d0-4e98-aa23-830f7a9f001f	-11.57	-241.45	-229.88	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	+	198014	198014	1896c369-b7d0-4e98-aa23-830f7a9f001f	-4.92	-149.82	-144.90	1	1	GGTGCCGGTTT
-tig00000001	+	198035	198051	1896c369-b7d0-4e98-aa23-830f7a9f001f	8.39	-157.82	-166.21	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	+	198064	198068	1896c369-b7d0-4e98-aa23-830f7a9f001f	-6.48	-125.44	-118.97	1	2	CTGCACGTCCGCTGG
-tig00000001	+	198087	198089	1896c369-b7d0-4e98-aa23-830f7a9f001f	-3.53	-116.34	-112.82	1	2	ACATTCGCGCCTA
-tig00000001	+	198100	198123	1896c369-b7d0-4e98-aa23-830f7a9f001f	-11.17	-229.90	-218.73	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	+	198137	198137	1896c369-b7d0-4e98-aa23-830f7a9f001f	-5.34	-100.17	-94.83	1	1	CAGGCCGCCAA
-tig00000001	+	198171	198171	1896c369-b7d0-4e98-aa23-830f7a9f001f	-2.91	-116.22	-113.31	1	1	AGCAGCGCCAC
-tig00000001	+	198183	198188	1896c369-b7d0-4e98-aa23-830f7a9f001f	-1.01	-142.75	-141.74	1	2	AGTACCGTTACGCTGA
-tig00000001	+	198203	198233	1896c369-b7d0-4e98-aa23-830f7a9f001f	-5.61	-268.37	-262.77	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	+	198250	198250	1896c369-b7d0-4e98-aa23-830f7a9f001f	-12.70	-148.10	-135.40	1	1	AAAGACGATAG
-tig00000001	+	198289	198313	1896c369-b7d0-4e98-aa23-830f7a9f001f	-20.12	-271.05	-250.93	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	+	198326	198336	1896c369-b7d0-4e98-aa23-830f7a9f001f	-0.89	-171.46	-170.57	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	+	198352	198364	1896c369-b7d0-4e98-aa23-830f7a9f001f	-19.71	-209.44	-189.73	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	+	198399	198415	1896c369-b7d0-4e98-aa23-830f7a9f001f	-15.25	-200.50	-185.25	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	+	198427	198485	1896c369-b7d0-4e98-aa23-830f7a9f001f	-40.69	-483.84	-443.15	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	+	198513	198513	1896c369-b7d0-4e98-aa23-830f7a9f001f	-6.86	-123.46	-116.60	1	1	ACCATCGCAGG
-tig00000001	+	198527	198527	1896c369-b7d0-4e98-aa23-830f7a9f001f	-5.10	-106.50	-101.41	1	1	AATATCGCCAG
-tig00000001	+	198545	198569	1896c369-b7d0-4e98-aa23-830f7a9f001f	-10.66	-276.52	-265.86	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	+	198585	198619	1896c369-b7d0-4e98-aa23-830f7a9f001f	-13.27	-343.86	-330.59	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	+	198660	198670	1896c369-b7d0-4e98-aa23-830f7a9f001f	-11.48	-191.29	-179.81	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	+	198684	198710	1896c369-b7d0-4e98-aa23-830f7a9f001f	-13.23	-253.90	-240.67	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	+	198728	198782	1896c369-b7d0-4e98-aa23-830f7a9f001f	-31.32	-456.19	-424.87	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	+	198812	198821	1896c369-b7d0-4e98-aa23-830f7a9f001f	-8.22	-162.86	-154.63	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	+	198834	198855	1896c369-b7d0-4e98-aa23-830f7a9f001f	-14.54	-292.59	-278.05	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	+	198872	198872	1896c369-b7d0-4e98-aa23-830f7a9f001f	1.41	-118.16	-119.57	1	1	TTCACCGCTTC
-tig00000001	+	198884	198892	1896c369-b7d0-4e98-aa23-830f7a9f001f	0.49	-183.36	-183.85	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	+	198907	198914	1896c369-b7d0-4e98-aa23-830f7a9f001f	-1.96	-160.60	-158.64	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	+	198927	198927	1896c369-b7d0-4e98-aa23-830f7a9f001f	-1.32	-101.98	-100.66	1	1	GTTTACGACTC
-tig00000001	+	198972	198987	1896c369-b7d0-4e98-aa23-830f7a9f001f	-10.65	-243.39	-232.75	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	+	199013	199013	1896c369-b7d0-4e98-aa23-830f7a9f001f	-0.45	-120.23	-119.78	1	1	CAGTGCGCCAA
-tig00000001	+	199028	199034	1896c369-b7d0-4e98-aa23-830f7a9f001f	-2.47	-145.26	-142.79	1	2	CAACACGGTGCCGATTA
-tig00000001	+	199056	199088	1896c369-b7d0-4e98-aa23-830f7a9f001f	-2.71	-300.59	-297.89	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	+	199112	199117	1896c369-b7d0-4e98-aa23-830f7a9f001f	6.18	-124.67	-130.85	1	2	ACCAGCGAACCGGCAA
-tig00000001	+	199133	199133	1896c369-b7d0-4e98-aa23-830f7a9f001f	0.45	-118.04	-118.49	1	1	ATCACCGGGAT
-tig00000001	+	199147	199156	1896c369-b7d0-4e98-aa23-830f7a9f001f	1.50	-168.26	-169.76	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	+	199172	199172	1896c369-b7d0-4e98-aa23-830f7a9f001f	1.60	-104.23	-105.83	1	1	CAGAACGCCAG
-tig00000001	+	199193	199193	1896c369-b7d0-4e98-aa23-830f7a9f001f	-1.44	-102.57	-101.13	1	1	CAGAACGGAGA
-tig00000001	+	199204	199228	1896c369-b7d0-4e98-aa23-830f7a9f001f	-3.51	-214.66	-211.16	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	+	199240	199255	1896c369-b7d0-4e98-aa23-830f7a9f001f	-14.40	-208.17	-193.77	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	+	199267	199267	1896c369-b7d0-4e98-aa23-830f7a9f001f	-1.17	-134.88	-133.71	1	1	CACTTCGCTAA
-tig00000001	+	199280	199280	1896c369-b7d0-4e98-aa23-830f7a9f001f	-1.40	-136.30	-134.90	1	1	CCATGCGGGCC
-tig00000001	+	199300	199336	1896c369-b7d0-4e98-aa23-830f7a9f001f	-21.50	-344.25	-322.76	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	+	199352	199355	1896c369-b7d0-4e98-aa23-830f7a9f001f	-2.58	-142.34	-139.76	1	2	ACCAGCGTCGGGGT
-tig00000001	+	199393	199402	1896c369-b7d0-4e98-aa23-830f7a9f001f	-4.19	-227.57	-223.37	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	+	199423	199430	1896c369-b7d0-4e98-aa23-830f7a9f001f	-6.20	-160.69	-154.49	1	2	TATTCCGGTGTACGACCA
-tig00000001	+	199446	199446	1896c369-b7d0-4e98-aa23-830f7a9f001f	-2.68	-102.89	-100.21	1	1	CAGCCCGGCAA
-tig00000001	+	199459	199459	1896c369-b7d0-4e98-aa23-830f7a9f001f	-0.84	-89.51	-88.67	1	1	AACACCGCCAG
-tig00000001	+	199485	199485	1896c369-b7d0-4e98-aa23-830f7a9f001f	0.92	-131.89	-132.81	1	1	CATGCCGTAAA
-tig00000001	+	199500	199509	1896c369-b7d0-4e98-aa23-830f7a9f001f	-3.48	-132.32	-128.84	1	3	AGAACCGACACCGCCGAACA
-tig00000001	+	199543	199543	1896c369-b7d0-4e98-aa23-830f7a9f001f	2.13	-121.43	-123.55	1	1	CACATCGGCAC
-tig00000001	+	199557	199570	1896c369-b7d0-4e98-aa23-830f7a9f001f	-3.23	-225.72	-222.50	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	+	199582	199593	1896c369-b7d0-4e98-aa23-830f7a9f001f	-10.72	-189.70	-178.98	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	+	199606	199621	1896c369-b7d0-4e98-aa23-830f7a9f001f	-13.77	-228.91	-215.15	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	+	199644	199652	1896c369-b7d0-4e98-aa23-830f7a9f001f	-4.54	-126.51	-121.96	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	+	199687	199687	1896c369-b7d0-4e98-aa23-830f7a9f001f	0.56	-141.25	-141.81	1	1	CTGTCCGTGCC
-tig00000001	+	199740	199746	1896c369-b7d0-4e98-aa23-830f7a9f001f	-9.39	-132.86	-123.47	1	2	CACCACGCCTACGCAGA
-tig00000001	+	199770	199770	1896c369-b7d0-4e98-aa23-830f7a9f001f	0.46	-113.41	-113.86	1	1	GACATCGCCCA
-tig00000001	+	199786	199802	1896c369-b7d0-4e98-aa23-830f7a9f001f	0.54	-189.17	-189.71	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	+	199833	199836	1896c369-b7d0-4e98-aa23-830f7a9f001f	1.33	-148.58	-149.91	1	2	CACAGCGCCGTTGG
-tig00000001	+	199854	199854	1896c369-b7d0-4e98-aa23-830f7a9f001f	-2.58	-101.96	-99.38	1	1	AAGATCGCCAG
-tig00000001	+	199868	199868	1896c369-b7d0-4e98-aa23-830f7a9f001f	-3.02	-115.06	-112.04	1	1	CTGCACGAAGT
-tig00000001	+	199883	199883	1896c369-b7d0-4e98-aa23-830f7a9f001f	-2.85	-131.19	-128.34	1	1	CAGTGCGGTTG
-tig00000001	+	199899	199908	1896c369-b7d0-4e98-aa23-830f7a9f001f	-7.21	-148.67	-141.45	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	+	199931	199943	1896c369-b7d0-4e98-aa23-830f7a9f001f	-7.80	-183.95	-176.15	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	+	199956	199956	1896c369-b7d0-4e98-aa23-830f7a9f001f	-1.87	-107.88	-106.02	1	1	TTGATCGCTTC
-tig00000001	+	199998	199998	1896c369-b7d0-4e98-aa23-830f7a9f001f	-2.10	-110.38	-108.28	1	1	TGTTGCGCTCC
 tig00000001	+	200009	200009	1896c369-b7d0-4e98-aa23-830f7a9f001f	1.91	-113.63	-115.54	1	1	TTCAACGGTAT
 tig00000001	+	200046	200046	1896c369-b7d0-4e98-aa23-830f7a9f001f	-0.46	-106.20	-105.75	1	1	TGCAGCGCACC
 tig00000001	+	200081	200081	1896c369-b7d0-4e98-aa23-830f7a9f001f	-7.16	-97.76	-90.59	1	1	AACAACGCCAC
@@ -4971,145 +705,6 @@
 tig00000001	+	201124	201130	1896c369-b7d0-4e98-aa23-830f7a9f001f	-10.73	-154.64	-143.92	1	3	AAGACCGCGCCCGCTTT
 tig00000001	+	201151	201179	1896c369-b7d0-4e98-aa23-830f7a9f001f	-6.41	-295.73	-289.32	1	5	TGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGT
 tig00000001	+	201198	201198	1896c369-b7d0-4e98-aa23-830f7a9f001f	-0.99	-93.96	-92.97	1	1	CAGGCCGAAAA
-tig00000001	-	196122	196125	756abc44-d69f-46e2-8464-2f309b147a27	-19.53	-112.21	-92.69	1	2	CATGGCGGCGGTAT
-tig00000001	-	196136	196140	756abc44-d69f-46e2-8464-2f309b147a27	-7.53	-129.68	-122.16	1	2	CTTTTCGCCCGTGGG
-tig00000001	-	196155	196155	756abc44-d69f-46e2-8464-2f309b147a27	-4.91	-125.91	-121.00	1	1	TACCACGCCAA
-tig00000001	-	196180	196190	756abc44-d69f-46e2-8464-2f309b147a27	-2.27	-213.81	-211.55	1	3	CCTTGCGCCCGCAGTCGCTGG
-tig00000001	-	196210	196210	756abc44-d69f-46e2-8464-2f309b147a27	-9.15	-137.85	-128.70	1	1	AGCATCGCCCA
-tig00000001	-	196224	196227	756abc44-d69f-46e2-8464-2f309b147a27	-12.85	-151.56	-138.72	1	2	CTTCCCGACGCCTG
-tig00000001	-	196242	196242	756abc44-d69f-46e2-8464-2f309b147a27	-9.24	-122.83	-113.59	1	1	GGCACCGAAGA
-tig00000001	-	196264	196274	756abc44-d69f-46e2-8464-2f309b147a27	-28.12	-201.22	-173.10	1	4	TTCCCCGATGCGGCGCGGCAG
-tig00000001	-	196294	196319	756abc44-d69f-46e2-8464-2f309b147a27	-6.01	-230.79	-224.78	1	5	GCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
-tig00000001	-	196342	196342	756abc44-d69f-46e2-8464-2f309b147a27	-0.40	-108.88	-108.48	1	1	TCCAGCGCCAG
-tig00000001	-	196372	196380	756abc44-d69f-46e2-8464-2f309b147a27	-13.88	-156.68	-142.80	1	2	ACAACCGGCTGGCCGATAT
-tig00000001	-	196396	196396	756abc44-d69f-46e2-8464-2f309b147a27	-3.68	-102.24	-98.56	1	1	ACCAGCGGTTG
-tig00000001	-	196416	196426	756abc44-d69f-46e2-8464-2f309b147a27	-8.01	-148.59	-140.58	1	2	TTTTGCGATCAGTTGCGTGAG
-tig00000001	-	196440	196440	756abc44-d69f-46e2-8464-2f309b147a27	-2.25	-90.37	-88.12	1	1	TTCAACGCTGA
-tig00000001	-	196451	196466	756abc44-d69f-46e2-8464-2f309b147a27	-10.26	-158.17	-147.91	1	5	GATTACGCGCTTTCGCCACGCGTGGG
-tig00000001	-	196483	196492	756abc44-d69f-46e2-8464-2f309b147a27	-17.85	-171.51	-153.66	1	3	CAGGCCGCCGCTTGCGGGTG
-tig00000001	-	196514	196527	756abc44-d69f-46e2-8464-2f309b147a27	-25.74	-198.64	-172.91	1	3	CAGCCCGCTTGCCGATGCCGTCAC
-tig00000001	-	196542	196576	756abc44-d69f-46e2-8464-2f309b147a27	-19.70	-328.77	-309.07	1	7	TCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAAT
-tig00000001	-	196589	196595	756abc44-d69f-46e2-8464-2f309b147a27	-6.87	-147.74	-140.88	1	3	AGCAACGCGTGCGGCTA
-tig00000001	-	196629	196629	756abc44-d69f-46e2-8464-2f309b147a27	-1.88	-108.59	-106.72	1	1	CTGACCGCCAG
-tig00000001	-	196643	196643	756abc44-d69f-46e2-8464-2f309b147a27	0.07	-119.59	-119.67	1	1	GCTCCCGCCAG
-tig00000001	-	196677	196690	756abc44-d69f-46e2-8464-2f309b147a27	-20.18	-176.91	-156.72	1	4	TCTGCCGTTGCCGACGGGCGACCA
-tig00000001	-	196706	196712	756abc44-d69f-46e2-8464-2f309b147a27	-12.86	-141.97	-129.11	1	2	ATAGCCGTTGCCGGTAA
-tig00000001	-	196727	196749	756abc44-d69f-46e2-8464-2f309b147a27	-26.18	-239.81	-213.63	1	5	CTGCCCGATTAATGCCGAACCGCGCACCGTATC
-tig00000001	-	196762	196770	756abc44-d69f-46e2-8464-2f309b147a27	-11.34	-158.84	-147.50	1	2	CTTCACGAATCAACGAACC
-tig00000001	-	196810	196810	756abc44-d69f-46e2-8464-2f309b147a27	-4.02	-131.74	-127.72	1	1	CAGTACGGTGG
-tig00000001	-	196823	196834	756abc44-d69f-46e2-8464-2f309b147a27	-9.31	-208.08	-198.78	1	3	AGCAGCGGGTAAACGCCGCCAG
-tig00000001	-	196874	196878	756abc44-d69f-46e2-8464-2f309b147a27	-10.34	-126.18	-115.84	1	2	AATGCCGGACGTAAT
-tig00000001	-	196909	196915	756abc44-d69f-46e2-8464-2f309b147a27	-3.07	-105.31	-102.25	1	2	CAGACCGCAAACGGTCA
-tig00000001	-	196945	196952	756abc44-d69f-46e2-8464-2f309b147a27	-5.84	-150.11	-144.27	1	2	GATACCGATAAACGGCAC
-tig00000001	-	196975	196975	756abc44-d69f-46e2-8464-2f309b147a27	-3.01	-89.96	-86.95	1	1	CAGACCGTAAA
-tig00000001	-	196992	196995	756abc44-d69f-46e2-8464-2f309b147a27	-6.71	-107.98	-101.27	1	2	AGTTACGGCGCAAC
-tig00000001	-	197011	197018	756abc44-d69f-46e2-8464-2f309b147a27	-14.96	-132.77	-117.80	1	2	AGAAGCGGTAAGCGGTTT
-tig00000001	-	197032	197041	756abc44-d69f-46e2-8464-2f309b147a27	-6.30	-148.52	-142.22	1	2	ACTCACGCCTTTAACGCCAG
-tig00000001	-	197059	197059	756abc44-d69f-46e2-8464-2f309b147a27	3.65	-103.36	-107.01	1	1	AAAGACGATAA
-tig00000001	-	197071	197071	756abc44-d69f-46e2-8464-2f309b147a27	-6.83	-108.40	-101.56	1	1	CAAGGCGTTGA
-tig00000001	-	197084	197084	756abc44-d69f-46e2-8464-2f309b147a27	-5.78	-86.23	-80.45	1	1	ATCACCGCACT
-tig00000001	-	197098	197108	756abc44-d69f-46e2-8464-2f309b147a27	-5.57	-133.66	-128.09	1	3	GATTGCGGAGTCGGGCGAATG
-tig00000001	-	197132	197132	756abc44-d69f-46e2-8464-2f309b147a27	-5.55	-103.10	-97.54	1	1	TTCAGCGCATT
-tig00000001	-	197144	197168	756abc44-d69f-46e2-8464-2f309b147a27	-15.86	-253.56	-237.70	1	6	AACTGCGGATACGTTGCCGCGAATGCCGCCGGAAT
-tig00000001	-	197179	197197	756abc44-d69f-46e2-8464-2f309b147a27	-16.62	-208.94	-192.31	1	3	AATGGCGAAGTATTTCGCCACATCGTTGG
-tig00000001	-	197222	197229	756abc44-d69f-46e2-8464-2f309b147a27	-6.03	-114.50	-108.47	1	2	GTCAGCGAGCCACGGGTC
-tig00000001	-	197266	197266	756abc44-d69f-46e2-8464-2f309b147a27	-5.26	-116.12	-110.86	1	1	CACCTCGATCA
-tig00000001	-	197279	197279	756abc44-d69f-46e2-8464-2f309b147a27	-3.73	-125.59	-121.87	1	1	TTGGTCGGGTT
-tig00000001	-	197290	197296	756abc44-d69f-46e2-8464-2f309b147a27	-11.88	-160.05	-148.17	1	2	AGAGTCGAGATCGACCA
-tig00000001	-	197309	197321	756abc44-d69f-46e2-8464-2f309b147a27	-32.59	-194.22	-161.63	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	-	197332	197350	756abc44-d69f-46e2-8464-2f309b147a27	-11.82	-190.88	-179.06	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	-	197363	197420	756abc44-d69f-46e2-8464-2f309b147a27	-44.84	-446.09	-401.25	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	-	197433	197433	756abc44-d69f-46e2-8464-2f309b147a27	-2.47	-103.22	-100.75	1	1	ACTGACGGATC
-tig00000001	-	197456	197470	756abc44-d69f-46e2-8464-2f309b147a27	-24.28	-165.62	-141.34	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	-	197482	197509	756abc44-d69f-46e2-8464-2f309b147a27	-19.34	-224.91	-205.58	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	-	197520	197530	756abc44-d69f-46e2-8464-2f309b147a27	-10.91	-189.65	-178.74	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	-	197543	197543	756abc44-d69f-46e2-8464-2f309b147a27	-4.41	-112.12	-107.71	1	1	ATCACCGTTTT
-tig00000001	-	197562	197577	756abc44-d69f-46e2-8464-2f309b147a27	-19.49	-182.18	-162.69	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	-	197590	197599	756abc44-d69f-46e2-8464-2f309b147a27	-6.15	-169.84	-163.68	1	2	AATACCGCCTTTGACGATAT
-tig00000001	-	197612	197620	756abc44-d69f-46e2-8464-2f309b147a27	-13.03	-162.90	-149.87	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	-	197631	197631	756abc44-d69f-46e2-8464-2f309b147a27	-0.55	-118.17	-117.62	1	1	GCACACGAGAA
-tig00000001	-	197654	197657	756abc44-d69f-46e2-8464-2f309b147a27	-16.25	-128.55	-112.30	1	2	ACCAGCGGCGTGGC
-tig00000001	-	197670	197672	756abc44-d69f-46e2-8464-2f309b147a27	-4.13	-114.31	-110.18	1	2	CCTGACGCGCAAC
-tig00000001	-	197683	197683	756abc44-d69f-46e2-8464-2f309b147a27	-13.02	-112.39	-99.37	1	1	CTGATCGACTT
-tig00000001	-	197701	197701	756abc44-d69f-46e2-8464-2f309b147a27	-2.54	-99.77	-97.23	1	1	AACATCGGTAG
-tig00000001	-	197719	197719	756abc44-d69f-46e2-8464-2f309b147a27	-11.65	-128.44	-116.79	1	1	ACCACCGTTAG
-tig00000001	-	197736	197749	756abc44-d69f-46e2-8464-2f309b147a27	-9.94	-158.69	-148.75	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	-	197763	197779	756abc44-d69f-46e2-8464-2f309b147a27	-7.74	-188.29	-180.55	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	-	197791	197816	756abc44-d69f-46e2-8464-2f309b147a27	-27.18	-248.65	-221.47	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	-	197837	197837	756abc44-d69f-46e2-8464-2f309b147a27	-2.16	-129.82	-127.66	1	1	TGGAGCGACTG
-tig00000001	-	197848	197856	756abc44-d69f-46e2-8464-2f309b147a27	-29.27	-191.33	-162.06	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	-	197868	197878	756abc44-d69f-46e2-8464-2f309b147a27	-9.45	-171.78	-162.33	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	-	197895	197906	756abc44-d69f-46e2-8464-2f309b147a27	-26.83	-202.03	-175.20	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	-	197921	197921	756abc44-d69f-46e2-8464-2f309b147a27	-9.91	-125.89	-115.97	1	1	GCCAGCGAAGC
-tig00000001	-	197935	197948	756abc44-d69f-46e2-8464-2f309b147a27	-17.23	-214.59	-197.36	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	-	197960	197969	756abc44-d69f-46e2-8464-2f309b147a27	-20.67	-160.60	-139.93	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	-	197982	197999	756abc44-d69f-46e2-8464-2f309b147a27	-25.55	-218.53	-192.97	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	-	198014	198014	756abc44-d69f-46e2-8464-2f309b147a27	-6.06	-111.60	-105.55	1	1	GGTGCCGGTTT
-tig00000001	-	198035	198051	756abc44-d69f-46e2-8464-2f309b147a27	-12.01	-193.58	-181.57	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	-	198064	198068	756abc44-d69f-46e2-8464-2f309b147a27	-3.45	-119.37	-115.92	1	2	CTGCACGTCCGCTGG
-tig00000001	-	198087	198089	756abc44-d69f-46e2-8464-2f309b147a27	-7.67	-128.51	-120.84	1	2	ACATTCGCGCCTA
-tig00000001	-	198100	198123	756abc44-d69f-46e2-8464-2f309b147a27	-27.07	-265.60	-238.53	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	-	198137	198137	756abc44-d69f-46e2-8464-2f309b147a27	0.21	-115.07	-115.29	1	1	CAGGCCGCCAA
-tig00000001	-	198171	198171	756abc44-d69f-46e2-8464-2f309b147a27	-1.50	-102.93	-101.42	1	1	AGCAGCGCCAC
-tig00000001	-	198183	198188	756abc44-d69f-46e2-8464-2f309b147a27	-6.56	-128.83	-122.27	1	2	AGTACCGTTACGCTGA
-tig00000001	-	198203	198233	756abc44-d69f-46e2-8464-2f309b147a27	-11.43	-300.25	-288.82	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	-	198250	198250	756abc44-d69f-46e2-8464-2f309b147a27	-4.61	-112.79	-108.18	1	1	AAAGACGATAG
-tig00000001	-	198289	198313	756abc44-d69f-46e2-8464-2f309b147a27	-41.87	-252.87	-211.00	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	-	198326	198336	756abc44-d69f-46e2-8464-2f309b147a27	-4.34	-172.34	-168.00	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	-	198352	198364	756abc44-d69f-46e2-8464-2f309b147a27	-6.82	-143.21	-136.39	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	-	198399	198415	756abc44-d69f-46e2-8464-2f309b147a27	-16.07	-197.66	-181.59	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	-	198427	198485	756abc44-d69f-46e2-8464-2f309b147a27	-32.38	-386.68	-354.30	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	-	198513	198513	756abc44-d69f-46e2-8464-2f309b147a27	-1.37	-111.61	-110.23	1	1	ACCATCGCAGG
-tig00000001	-	198527	198527	756abc44-d69f-46e2-8464-2f309b147a27	0.42	-115.09	-115.51	1	1	AATATCGCCAG
-tig00000001	-	198545	198569	756abc44-d69f-46e2-8464-2f309b147a27	-6.22	-248.08	-241.86	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	-	198585	198619	756abc44-d69f-46e2-8464-2f309b147a27	-24.71	-293.31	-268.60	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	-	198660	198670	756abc44-d69f-46e2-8464-2f309b147a27	-7.35	-150.03	-142.68	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	-	198684	198710	756abc44-d69f-46e2-8464-2f309b147a27	-25.35	-259.31	-233.96	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	-	198728	198782	756abc44-d69f-46e2-8464-2f309b147a27	-36.22	-382.67	-346.45	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	-	198812	198821	756abc44-d69f-46e2-8464-2f309b147a27	-4.03	-149.56	-145.53	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	-	198834	198855	756abc44-d69f-46e2-8464-2f309b147a27	-22.99	-286.14	-263.15	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	-	198872	198872	756abc44-d69f-46e2-8464-2f309b147a27	-3.42	-103.81	-100.39	1	1	TTCACCGCTTC
-tig00000001	-	198884	198892	756abc44-d69f-46e2-8464-2f309b147a27	-8.38	-128.55	-120.18	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	-	198907	198914	756abc44-d69f-46e2-8464-2f309b147a27	-1.42	-146.44	-145.02	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	-	198927	198927	756abc44-d69f-46e2-8464-2f309b147a27	-0.33	-103.59	-103.27	1	1	GTTTACGACTC
-tig00000001	-	198972	198987	756abc44-d69f-46e2-8464-2f309b147a27	-6.77	-221.15	-214.38	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	-	199013	199013	756abc44-d69f-46e2-8464-2f309b147a27	-1.18	-105.07	-103.89	1	1	CAGTGCGCCAA
-tig00000001	-	199028	199034	756abc44-d69f-46e2-8464-2f309b147a27	-4.02	-138.16	-134.14	1	2	CAACACGGTGCCGATTA
-tig00000001	-	199056	199088	756abc44-d69f-46e2-8464-2f309b147a27	-20.68	-247.05	-226.37	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	-	199112	199117	756abc44-d69f-46e2-8464-2f309b147a27	-4.08	-125.36	-121.28	1	2	ACCAGCGAACCGGCAA
-tig00000001	-	199133	199133	756abc44-d69f-46e2-8464-2f309b147a27	-1.02	-99.25	-98.23	1	1	ATCACCGGGAT
-tig00000001	-	199147	199156	756abc44-d69f-46e2-8464-2f309b147a27	-16.54	-184.38	-167.84	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	-	199172	199172	756abc44-d69f-46e2-8464-2f309b147a27	-4.83	-122.15	-117.33	1	1	CAGAACGCCAG
-tig00000001	-	199193	199193	756abc44-d69f-46e2-8464-2f309b147a27	0.11	-83.76	-83.87	1	1	CAGAACGGAGA
-tig00000001	-	199204	199228	756abc44-d69f-46e2-8464-2f309b147a27	-20.14	-253.74	-233.61	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	-	199240	199255	756abc44-d69f-46e2-8464-2f309b147a27	-19.96	-215.63	-195.67	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	-	199267	199267	756abc44-d69f-46e2-8464-2f309b147a27	-2.08	-124.94	-122.86	1	1	CACTTCGCTAA
-tig00000001	-	199280	199280	756abc44-d69f-46e2-8464-2f309b147a27	-1.73	-107.67	-105.93	1	1	CCATGCGGGCC
-tig00000001	-	199300	199336	756abc44-d69f-46e2-8464-2f309b147a27	-23.12	-279.51	-256.40	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	-	199352	199355	756abc44-d69f-46e2-8464-2f309b147a27	-12.71	-148.35	-135.64	1	2	ACCAGCGTCGGGGT
-tig00000001	-	199393	199402	756abc44-d69f-46e2-8464-2f309b147a27	-14.64	-168.78	-154.14	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	-	199423	199430	756abc44-d69f-46e2-8464-2f309b147a27	-9.87	-120.02	-110.15	1	2	TATTCCGGTGTACGACCA
-tig00000001	-	199446	199446	756abc44-d69f-46e2-8464-2f309b147a27	-9.02	-99.30	-90.28	1	1	CAGCCCGGCAA
-tig00000001	-	199459	199459	756abc44-d69f-46e2-8464-2f309b147a27	-2.43	-103.62	-101.19	1	1	AACACCGCCAG
-tig00000001	-	199485	199485	756abc44-d69f-46e2-8464-2f309b147a27	-3.39	-124.13	-120.74	1	1	CATGCCGTAAA
-tig00000001	-	199500	199509	756abc44-d69f-46e2-8464-2f309b147a27	-13.26	-208.29	-195.03	1	3	AGAACCGACACCGCCGAACA
-tig00000001	-	199543	199543	756abc44-d69f-46e2-8464-2f309b147a27	-4.84	-97.01	-92.18	1	1	CACATCGGCAC
-tig00000001	-	199557	199570	756abc44-d69f-46e2-8464-2f309b147a27	-24.43	-180.55	-156.12	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	-	199582	199593	756abc44-d69f-46e2-8464-2f309b147a27	-16.03	-145.03	-129.01	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	-	199606	199621	756abc44-d69f-46e2-8464-2f309b147a27	-20.62	-174.55	-153.92	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	-	199644	199652	756abc44-d69f-46e2-8464-2f309b147a27	-10.41	-132.62	-122.21	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	-	199687	199687	756abc44-d69f-46e2-8464-2f309b147a27	-2.17	-112.26	-110.09	1	1	CTGTCCGTGCC
-tig00000001	-	199740	199746	756abc44-d69f-46e2-8464-2f309b147a27	-2.57	-176.51	-173.93	1	2	CACCACGCCTACGCAGA
-tig00000001	-	199770	199770	756abc44-d69f-46e2-8464-2f309b147a27	-8.16	-143.83	-135.67	1	1	GACATCGCCCA
-tig00000001	-	199786	199802	756abc44-d69f-46e2-8464-2f309b147a27	-22.41	-190.30	-167.90	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	-	199833	199836	756abc44-d69f-46e2-8464-2f309b147a27	-4.71	-108.45	-103.75	1	2	CACAGCGCCGTTGG
-tig00000001	-	199854	199854	756abc44-d69f-46e2-8464-2f309b147a27	1.01	-104.58	-105.59	1	1	AAGATCGCCAG
-tig00000001	-	199868	199868	756abc44-d69f-46e2-8464-2f309b147a27	-0.19	-114.32	-114.13	1	1	CTGCACGAAGT
-tig00000001	-	199883	199883	756abc44-d69f-46e2-8464-2f309b147a27	-5.84	-113.93	-108.09	1	1	CAGTGCGGTTG
-tig00000001	-	199899	199908	756abc44-d69f-46e2-8464-2f309b147a27	-3.24	-158.89	-155.65	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	-	199931	199943	756abc44-d69f-46e2-8464-2f309b147a27	-14.40	-125.09	-110.69	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	-	199956	199956	756abc44-d69f-46e2-8464-2f309b147a27	-1.00	-89.02	-88.02	1	1	TTGATCGCTTC
-tig00000001	-	199998	199998	756abc44-d69f-46e2-8464-2f309b147a27	-10.27	-107.48	-97.22	1	1	TGTTGCGCTCC
 tig00000001	-	200009	200009	756abc44-d69f-46e2-8464-2f309b147a27	-2.56	-109.48	-106.92	1	1	TTCAACGGTAT
 tig00000001	-	200046	200046	756abc44-d69f-46e2-8464-2f309b147a27	-4.04	-93.72	-89.69	1	1	TGCAGCGCACC
 tig00000001	-	200081	200081	756abc44-d69f-46e2-8464-2f309b147a27	-0.03	-112.90	-112.86	1	1	AACAACGCCAC
@@ -5120,134 +715,6 @@
 tig00000001	-	200224	200233	756abc44-d69f-46e2-8464-2f309b147a27	-4.41	-125.73	-121.33	1	2	TGCACCGTTAAGCCCGCCAT
 tig00000001	-	200257	200257	756abc44-d69f-46e2-8464-2f309b147a27	-7.04	-100.72	-93.68	1	1	CTCAACGTGGT
 tig00000001	-	200268	200268	756abc44-d69f-46e2-8464-2f309b147a27	-0.26	-95.55	-95.29	1	1	TTCACCGCTAT
-tig00000001	+	196396	196396	3048e786-5b3d-4587-b5d0-714b40192268	-1.85	-94.61	-92.76	1	1	ACCAGCGGTTG
-tig00000001	+	196416	196426	3048e786-5b3d-4587-b5d0-714b40192268	-7.63	-129.45	-121.82	1	2	TTTTGCGATCAGTTGCGTGAG
-tig00000001	+	196440	196440	3048e786-5b3d-4587-b5d0-714b40192268	-8.49	-109.15	-100.65	1	1	TTCAACGCTGA
-tig00000001	+	196451	196466	3048e786-5b3d-4587-b5d0-714b40192268	-18.47	-172.24	-153.77	1	5	GATTACGCGCTTTCGCCACGCGTGGG
-tig00000001	+	196483	196492	3048e786-5b3d-4587-b5d0-714b40192268	-20.71	-164.55	-143.84	1	3	CAGGCCGCCGCTTGCGGGTG
-tig00000001	+	196514	196527	3048e786-5b3d-4587-b5d0-714b40192268	-4.51	-143.21	-138.70	1	3	CAGCCCGCTTGCCGATGCCGTCAC
-tig00000001	+	196542	196576	3048e786-5b3d-4587-b5d0-714b40192268	-24.96	-337.23	-312.27	1	7	TCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAAT
-tig00000001	+	196589	196595	3048e786-5b3d-4587-b5d0-714b40192268	-6.99	-111.35	-104.36	1	3	AGCAACGCGTGCGGCTA
-tig00000001	+	196629	196629	3048e786-5b3d-4587-b5d0-714b40192268	3.55	-90.41	-93.95	1	1	CTGACCGCCAG
-tig00000001	+	196643	196643	3048e786-5b3d-4587-b5d0-714b40192268	-5.29	-101.30	-96.01	1	1	GCTCCCGCCAG
-tig00000001	+	196677	196690	3048e786-5b3d-4587-b5d0-714b40192268	-13.18	-201.18	-188.00	1	4	TCTGCCGTTGCCGACGGGCGACCA
-tig00000001	+	196706	196712	3048e786-5b3d-4587-b5d0-714b40192268	-1.99	-95.33	-93.34	1	2	ATAGCCGTTGCCGGTAA
-tig00000001	+	196727	196749	3048e786-5b3d-4587-b5d0-714b40192268	-10.51	-164.34	-153.83	1	5	CTGCCCGATTAATGCCGAACCGCGCACCGTATC
-tig00000001	+	196762	196770	3048e786-5b3d-4587-b5d0-714b40192268	-4.76	-144.93	-140.17	1	2	CTTCACGAATCAACGAACC
-tig00000001	+	196810	196810	3048e786-5b3d-4587-b5d0-714b40192268	-4.76	-139.74	-134.98	1	1	CAGTACGGTGG
-tig00000001	+	196823	196834	3048e786-5b3d-4587-b5d0-714b40192268	-16.28	-189.80	-173.51	1	3	AGCAGCGGGTAAACGCCGCCAG
-tig00000001	+	196874	196878	3048e786-5b3d-4587-b5d0-714b40192268	-0.45	-112.91	-112.46	1	2	AATGCCGGACGTAAT
-tig00000001	+	196909	196915	3048e786-5b3d-4587-b5d0-714b40192268	4.85	-108.84	-113.68	1	2	CAGACCGCAAACGGTCA
-tig00000001	+	196945	196952	3048e786-5b3d-4587-b5d0-714b40192268	0.55	-118.56	-119.11	1	2	GATACCGATAAACGGCAC
-tig00000001	+	196975	196975	3048e786-5b3d-4587-b5d0-714b40192268	0.13	-86.22	-86.35	1	1	CAGACCGTAAA
-tig00000001	+	196992	196995	3048e786-5b3d-4587-b5d0-714b40192268	-8.40	-122.31	-113.91	1	2	AGTTACGGCGCAAC
-tig00000001	+	197011	197018	3048e786-5b3d-4587-b5d0-714b40192268	0.99	-122.37	-123.37	1	2	AGAAGCGGTAAGCGGTTT
-tig00000001	+	197032	197041	3048e786-5b3d-4587-b5d0-714b40192268	-5.23	-182.62	-177.39	1	2	ACTCACGCCTTTAACGCCAG
-tig00000001	+	197059	197059	3048e786-5b3d-4587-b5d0-714b40192268	-9.75	-146.55	-136.80	1	1	AAAGACGATAA
-tig00000001	+	197071	197071	3048e786-5b3d-4587-b5d0-714b40192268	-9.94	-92.25	-82.31	1	1	CAAGGCGTTGA
-tig00000001	+	197084	197084	3048e786-5b3d-4587-b5d0-714b40192268	-1.86	-78.43	-76.57	1	1	ATCACCGCACT
-tig00000001	+	197098	197108	3048e786-5b3d-4587-b5d0-714b40192268	-16.15	-139.47	-123.32	1	3	GATTGCGGAGTCGGGCGAATG
-tig00000001	+	197132	197132	3048e786-5b3d-4587-b5d0-714b40192268	-2.45	-85.86	-83.41	1	1	TTCAGCGCATT
-tig00000001	+	197144	197168	3048e786-5b3d-4587-b5d0-714b40192268	-25.48	-214.21	-188.73	1	6	AACTGCGGATACGTTGCCGCGAATGCCGCCGGAAT
-tig00000001	+	197179	197197	3048e786-5b3d-4587-b5d0-714b40192268	-10.38	-168.93	-158.56	1	3	AATGGCGAAGTATTTCGCCACATCGTTGG
-tig00000001	+	197222	197229	3048e786-5b3d-4587-b5d0-714b40192268	-4.58	-133.02	-128.44	1	2	GTCAGCGAGCCACGGGTC
-tig00000001	+	197266	197266	3048e786-5b3d-4587-b5d0-714b40192268	-2.72	-99.01	-96.30	1	1	CACCTCGATCA
-tig00000001	+	197279	197279	3048e786-5b3d-4587-b5d0-714b40192268	-0.38	-109.15	-108.77	1	1	TTGGTCGGGTT
-tig00000001	+	197290	197296	3048e786-5b3d-4587-b5d0-714b40192268	-8.08	-182.52	-174.44	1	2	AGAGTCGAGATCGACCA
-tig00000001	+	197309	197321	3048e786-5b3d-4587-b5d0-714b40192268	-10.76	-171.50	-160.74	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	+	197332	197350	3048e786-5b3d-4587-b5d0-714b40192268	-6.97	-179.90	-172.93	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	+	197363	197420	3048e786-5b3d-4587-b5d0-714b40192268	-26.86	-335.93	-309.07	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	+	197433	197433	3048e786-5b3d-4587-b5d0-714b40192268	-0.81	-93.69	-92.89	1	1	ACTGACGGATC
-tig00000001	+	197456	197470	3048e786-5b3d-4587-b5d0-714b40192268	-6.85	-152.66	-145.80	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	+	197482	197509	3048e786-5b3d-4587-b5d0-714b40192268	-7.57	-205.63	-198.06	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	+	197520	197530	3048e786-5b3d-4587-b5d0-714b40192268	-6.71	-146.96	-140.25	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	+	197543	197543	3048e786-5b3d-4587-b5d0-714b40192268	-4.10	-88.00	-83.90	1	1	ATCACCGTTTT
-tig00000001	+	197562	197577	3048e786-5b3d-4587-b5d0-714b40192268	-12.17	-166.86	-154.69	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	+	197590	197599	3048e786-5b3d-4587-b5d0-714b40192268	-4.61	-138.81	-134.20	1	2	AATACCGCCTTTGACGATAT
-tig00000001	+	197612	197620	3048e786-5b3d-4587-b5d0-714b40192268	-1.48	-138.30	-136.81	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	+	197631	197631	3048e786-5b3d-4587-b5d0-714b40192268	-0.71	-100.30	-99.59	1	1	GCACACGAGAA
-tig00000001	+	197654	197657	3048e786-5b3d-4587-b5d0-714b40192268	-6.41	-154.51	-148.10	1	2	ACCAGCGGCGTGGC
-tig00000001	+	197670	197672	3048e786-5b3d-4587-b5d0-714b40192268	-6.44	-141.98	-135.54	1	2	CCTGACGCGCAAC
-tig00000001	+	197683	197683	3048e786-5b3d-4587-b5d0-714b40192268	0.41	-103.66	-104.08	1	1	CTGATCGACTT
-tig00000001	+	197701	197701	3048e786-5b3d-4587-b5d0-714b40192268	-0.46	-120.57	-120.12	1	1	AACATCGGTAG
-tig00000001	+	197719	197719	3048e786-5b3d-4587-b5d0-714b40192268	-3.03	-93.89	-90.86	1	1	ACCACCGTTAG
-tig00000001	+	197736	197749	3048e786-5b3d-4587-b5d0-714b40192268	-11.50	-200.46	-188.95	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	+	197763	197779	3048e786-5b3d-4587-b5d0-714b40192268	-12.63	-158.19	-145.57	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	+	197791	197816	3048e786-5b3d-4587-b5d0-714b40192268	-12.25	-250.15	-237.90	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	+	197837	197837	3048e786-5b3d-4587-b5d0-714b40192268	-5.63	-100.76	-95.13	1	1	TGGAGCGACTG
-tig00000001	+	197848	197856	3048e786-5b3d-4587-b5d0-714b40192268	-9.19	-171.44	-162.25	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	+	197868	197878	3048e786-5b3d-4587-b5d0-714b40192268	-7.43	-169.92	-162.49	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	+	197895	197906	3048e786-5b3d-4587-b5d0-714b40192268	-10.03	-145.28	-135.25	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	+	197921	197921	3048e786-5b3d-4587-b5d0-714b40192268	-3.18	-84.75	-81.57	1	1	GCCAGCGAAGC
-tig00000001	+	197935	197948	3048e786-5b3d-4587-b5d0-714b40192268	-9.70	-174.36	-164.67	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	+	197960	197969	3048e786-5b3d-4587-b5d0-714b40192268	-9.13	-139.77	-130.64	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	+	197982	197999	3048e786-5b3d-4587-b5d0-714b40192268	-8.95	-173.45	-164.50	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	+	198014	198014	3048e786-5b3d-4587-b5d0-714b40192268	-1.42	-112.58	-111.16	1	1	GGTGCCGGTTT
-tig00000001	+	198035	198051	3048e786-5b3d-4587-b5d0-714b40192268	-9.23	-184.60	-175.37	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	+	198064	198068	3048e786-5b3d-4587-b5d0-714b40192268	-2.82	-135.30	-132.48	1	2	CTGCACGTCCGCTGG
-tig00000001	+	198087	198089	3048e786-5b3d-4587-b5d0-714b40192268	-7.87	-95.24	-87.38	1	2	ACATTCGCGCCTA
-tig00000001	+	198100	198123	3048e786-5b3d-4587-b5d0-714b40192268	-21.94	-247.11	-225.16	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	+	198137	198137	3048e786-5b3d-4587-b5d0-714b40192268	-1.53	-115.52	-113.99	1	1	CAGGCCGCCAA
-tig00000001	+	198171	198171	3048e786-5b3d-4587-b5d0-714b40192268	0.49	-96.87	-97.36	1	1	AGCAGCGCCAC
-tig00000001	+	198183	198188	3048e786-5b3d-4587-b5d0-714b40192268	-3.40	-100.41	-97.01	1	2	AGTACCGTTACGCTGA
-tig00000001	+	198203	198233	3048e786-5b3d-4587-b5d0-714b40192268	-13.82	-213.08	-199.25	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	+	198250	198250	3048e786-5b3d-4587-b5d0-714b40192268	-2.93	-113.26	-110.33	1	1	AAAGACGATAG
-tig00000001	+	198289	198313	3048e786-5b3d-4587-b5d0-714b40192268	-26.74	-254.96	-228.22	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	+	198326	198336	3048e786-5b3d-4587-b5d0-714b40192268	1.33	-139.05	-140.38	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	+	198352	198364	3048e786-5b3d-4587-b5d0-714b40192268	-17.61	-164.86	-147.25	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	+	198399	198415	3048e786-5b3d-4587-b5d0-714b40192268	-21.09	-196.23	-175.14	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	+	198427	198485	3048e786-5b3d-4587-b5d0-714b40192268	-42.47	-394.32	-351.85	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	+	198513	198513	3048e786-5b3d-4587-b5d0-714b40192268	-4.07	-126.79	-122.72	1	1	ACCATCGCAGG
-tig00000001	+	198527	198527	3048e786-5b3d-4587-b5d0-714b40192268	-7.87	-120.07	-112.20	1	1	AATATCGCCAG
-tig00000001	+	198545	198569	3048e786-5b3d-4587-b5d0-714b40192268	-27.54	-243.94	-216.40	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	+	198585	198619	3048e786-5b3d-4587-b5d0-714b40192268	-24.39	-300.29	-275.90	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	+	198660	198670	3048e786-5b3d-4587-b5d0-714b40192268	-10.27	-139.34	-129.07	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	+	198684	198710	3048e786-5b3d-4587-b5d0-714b40192268	-16.53	-199.86	-183.32	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	+	198728	198782	3048e786-5b3d-4587-b5d0-714b40192268	-48.76	-415.58	-366.82	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	+	198812	198821	3048e786-5b3d-4587-b5d0-714b40192268	-4.33	-167.44	-163.12	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	+	198834	198855	3048e786-5b3d-4587-b5d0-714b40192268	-19.19	-232.69	-213.50	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	+	198872	198872	3048e786-5b3d-4587-b5d0-714b40192268	-1.30	-95.76	-94.45	1	1	TTCACCGCTTC
-tig00000001	+	198884	198892	3048e786-5b3d-4587-b5d0-714b40192268	-6.81	-183.29	-176.48	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	+	198907	198914	3048e786-5b3d-4587-b5d0-714b40192268	-11.15	-165.01	-153.86	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	+	198927	198927	3048e786-5b3d-4587-b5d0-714b40192268	-1.94	-89.18	-87.24	1	1	GTTTACGACTC
-tig00000001	+	198972	198987	3048e786-5b3d-4587-b5d0-714b40192268	-10.74	-392.21	-381.47	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	+	199013	199013	3048e786-5b3d-4587-b5d0-714b40192268	-3.36	-120.77	-117.41	1	1	CAGTGCGCCAA
-tig00000001	+	199028	199034	3048e786-5b3d-4587-b5d0-714b40192268	-10.66	-187.23	-176.57	1	2	CAACACGGTGCCGATTA
-tig00000001	+	199056	199088	3048e786-5b3d-4587-b5d0-714b40192268	-17.77	-279.07	-261.31	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	+	199112	199117	3048e786-5b3d-4587-b5d0-714b40192268	-8.14	-146.02	-137.88	1	2	ACCAGCGAACCGGCAA
-tig00000001	+	199133	199133	3048e786-5b3d-4587-b5d0-714b40192268	-4.72	-128.00	-123.29	1	1	ATCACCGGGAT
-tig00000001	+	199147	199156	3048e786-5b3d-4587-b5d0-714b40192268	-3.45	-152.01	-148.56	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	+	199172	199172	3048e786-5b3d-4587-b5d0-714b40192268	-3.19	-96.19	-93.00	1	1	CAGAACGCCAG
-tig00000001	+	199193	199193	3048e786-5b3d-4587-b5d0-714b40192268	-4.75	-98.51	-93.76	1	1	CAGAACGGAGA
-tig00000001	+	199204	199228	3048e786-5b3d-4587-b5d0-714b40192268	-15.67	-266.02	-250.36	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	+	199240	199255	3048e786-5b3d-4587-b5d0-714b40192268	-0.36	-129.52	-129.16	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	+	199267	199267	3048e786-5b3d-4587-b5d0-714b40192268	-8.94	-124.38	-115.44	1	1	CACTTCGCTAA
-tig00000001	+	199280	199280	3048e786-5b3d-4587-b5d0-714b40192268	-5.40	-85.66	-80.26	1	1	CCATGCGGGCC
-tig00000001	+	199300	199336	3048e786-5b3d-4587-b5d0-714b40192268	-36.00	-335.50	-299.50	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	+	199352	199355	3048e786-5b3d-4587-b5d0-714b40192268	-3.37	-103.31	-99.94	1	2	ACCAGCGTCGGGGT
-tig00000001	+	199393	199402	3048e786-5b3d-4587-b5d0-714b40192268	-7.37	-136.48	-129.11	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	+	199423	199430	3048e786-5b3d-4587-b5d0-714b40192268	-4.82	-145.08	-140.27	1	2	TATTCCGGTGTACGACCA
-tig00000001	+	199446	199446	3048e786-5b3d-4587-b5d0-714b40192268	-3.92	-105.06	-101.14	1	1	CAGCCCGGCAA
-tig00000001	+	199459	199459	3048e786-5b3d-4587-b5d0-714b40192268	-9.09	-134.28	-125.19	1	1	AACACCGCCAG
-tig00000001	+	199485	199485	3048e786-5b3d-4587-b5d0-714b40192268	-3.44	-84.21	-80.78	1	1	CATGCCGTAAA
-tig00000001	+	199500	199509	3048e786-5b3d-4587-b5d0-714b40192268	-12.84	-128.88	-116.04	1	3	AGAACCGACACCGCCGAACA
-tig00000001	+	199543	199543	3048e786-5b3d-4587-b5d0-714b40192268	-2.09	-81.55	-79.46	1	1	CACATCGGCAC
-tig00000001	+	199557	199570	3048e786-5b3d-4587-b5d0-714b40192268	-5.38	-139.45	-134.07	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	+	199582	199593	3048e786-5b3d-4587-b5d0-714b40192268	-11.17	-165.37	-154.21	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	+	199606	199621	3048e786-5b3d-4587-b5d0-714b40192268	-8.64	-196.28	-187.64	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	+	199644	199652	3048e786-5b3d-4587-b5d0-714b40192268	-13.67	-152.29	-138.62	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	+	199687	199687	3048e786-5b3d-4587-b5d0-714b40192268	-1.32	-117.30	-115.99	1	1	CTGTCCGTGCC
-tig00000001	+	199740	199746	3048e786-5b3d-4587-b5d0-714b40192268	-10.88	-124.66	-113.77	1	2	CACCACGCCTACGCAGA
-tig00000001	+	199770	199770	3048e786-5b3d-4587-b5d0-714b40192268	-1.07	-94.71	-93.65	1	1	GACATCGCCCA
-tig00000001	+	199786	199802	3048e786-5b3d-4587-b5d0-714b40192268	-6.96	-163.15	-156.19	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	+	199833	199836	3048e786-5b3d-4587-b5d0-714b40192268	-4.83	-96.42	-91.59	1	2	CACAGCGCCGTTGG
-tig00000001	+	199854	199854	3048e786-5b3d-4587-b5d0-714b40192268	-7.18	-94.07	-86.90	1	1	AAGATCGCCAG
-tig00000001	+	199868	199868	3048e786-5b3d-4587-b5d0-714b40192268	-4.97	-95.93	-90.96	1	1	CTGCACGAAGT
-tig00000001	+	199883	199883	3048e786-5b3d-4587-b5d0-714b40192268	-2.24	-107.31	-105.07	1	1	CAGTGCGGTTG
-tig00000001	+	199899	199908	3048e786-5b3d-4587-b5d0-714b40192268	-7.62	-144.96	-137.34	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	+	199931	199943	3048e786-5b3d-4587-b5d0-714b40192268	-3.31	-156.65	-153.34	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	+	199956	199956	3048e786-5b3d-4587-b5d0-714b40192268	-1.49	-94.49	-93.00	1	1	TTGATCGCTTC
-tig00000001	+	199998	199998	3048e786-5b3d-4587-b5d0-714b40192268	-4.68	-102.61	-97.93	1	1	TGTTGCGCTCC
 tig00000001	+	200009	200009	3048e786-5b3d-4587-b5d0-714b40192268	-4.84	-91.21	-86.37	1	1	TTCAACGGTAT
 tig00000001	+	200046	200046	3048e786-5b3d-4587-b5d0-714b40192268	-6.51	-90.43	-83.92	1	1	TGCAGCGCACC
 tig00000001	+	200081	200081	3048e786-5b3d-4587-b5d0-714b40192268	-12.20	-93.76	-81.56	1	1	AACAACGCCAC
@@ -5303,166 +770,6 @@
 tig00000001	+	201922	201930	3048e786-5b3d-4587-b5d0-714b40192268	-2.49	-113.45	-110.96	1	2	GTCACCGGCTGGCCGCACT
 tig00000001	+	201944	201950	3048e786-5b3d-4587-b5d0-714b40192268	-12.09	-121.89	-109.81	1	2	GCAGGCGCTGCCGGAAG
 tig00000001	+	201961	201986	3048e786-5b3d-4587-b5d0-714b40192268	-11.82	-251.10	-239.28	1	4	AACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAA
-tig00000001	+	201998	202007	3048e786-5b3d-4587-b5d0-714b40192268	-1.20	-192.82	-191.62	1	2	CAGTCCGCAGGGGCCGTGGT
-tig00000001	+	202020	202020	3048e786-5b3d-4587-b5d0-714b40192268	-8.25	-132.22	-123.97	1	1	CTGCTCGGCTG
-tig00000001	+	202033	202046	3048e786-5b3d-4587-b5d0-714b40192268	-4.83	-188.55	-183.72	1	3	GTGAGCGGGTGCCGGAAGCGGATG
-tig00000001	+	202064	202081	3048e786-5b3d-4587-b5d0-714b40192268	-23.63	-243.42	-219.79	1	5	GCCTGCGCCGCTGCCGCCGTACCGGGTA
-tig00000001	+	202092	202092	3048e786-5b3d-4587-b5d0-714b40192268	-10.65	-127.21	-116.56	1	1	CTGACCGGGCT
-tig00000001	+	202105	202143	3048e786-5b3d-4587-b5d0-714b40192268	-27.50	-285.43	-257.93	1	8	TGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGA
-tig00000001	+	202155	202198	3048e786-5b3d-4587-b5d0-714b40192268	-30.68	-360.83	-330.15	1	8	TTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTG
-tig00000001	+	202214	202225	3048e786-5b3d-4587-b5d0-714b40192268	-15.25	-170.90	-155.65	1	3	GACCACGCAGGCGCAGCGGGCA
-tig00000001	+	202240	202240	3048e786-5b3d-4587-b5d0-714b40192268	-1.58	-83.62	-82.05	1	1	AAGCCCGGCAG
-tig00000001	+	202257	202275	3048e786-5b3d-4587-b5d0-714b40192268	-13.15	-201.21	-188.06	1	5	ATTTCCGGCGGGACGGAACCGTCCGCTTT
-tig00000001	+	202295	202330	3048e786-5b3d-4587-b5d0-714b40192268	0.99	-283.22	-284.21	1	5	CCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTG
-tig00000001	+	202341	202341	3048e786-5b3d-4587-b5d0-714b40192268	-3.98	-146.97	-142.98	1	1	TCTGCCGTGTG
-tig00000001	+	202352	202370	3048e786-5b3d-4587-b5d0-714b40192268	-12.59	-229.65	-217.05	1	4	GCTGACGCACGACCCGGAATACCCGGAGA
-tig00000001	+	202386	202399	3048e786-5b3d-4587-b5d0-714b40192268	-29.94	-221.11	-191.17	1	4	CCTGCCGCGCCGCTGGTGCGCTAT
-tig00000001	+	202412	202432	3048e786-5b3d-4587-b5d0-714b40192268	-13.55	-227.51	-213.96	1	6	CTGGACGCCCGCGGCGAACTGGCGGCGGTGT
-tig00000001	+	202443	202443	3048e786-5b3d-4587-b5d0-714b40192268	-3.58	-93.45	-89.88	1	1	ATGACCGCAGC
-tig00000001	+	202461	202461	3048e786-5b3d-4587-b5d0-714b40192268	-4.29	-104.69	-100.40	1	1	AGGTGCGCAGC
-tig00000001	+	202475	202475	3048e786-5b3d-4587-b5d0-714b40192268	0.08	-67.22	-67.30	1	1	ACTTACGATGA
-tig00000001	+	202488	202525	3048e786-5b3d-4587-b5d0-714b40192268	-17.45	-311.50	-294.05	1	7	AATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAA
-tig00000001	+	202539	202557	3048e786-5b3d-4587-b5d0-714b40192268	-23.88	-195.65	-171.77	1	5	GTTACCGTTACGACAGCGACGGGCGGGTG
-tig00000001	+	202579	202579	3048e786-5b3d-4587-b5d0-714b40192268	-3.34	-140.94	-137.60	1	1	AAACCCGGCAG
-tig00000001	+	202597	202597	3048e786-5b3d-4587-b5d0-714b40192268	-0.83	-106.20	-105.37	1	1	TTACACGTATC
-tig00000001	+	202617	202617	3048e786-5b3d-4587-b5d0-714b40192268	-3.99	-82.84	-78.85	1	1	AGGACCGCATC
-tig00000001	+	202631	202631	3048e786-5b3d-4587-b5d0-714b40192268	-1.95	-99.82	-97.87	1	1	ATCACCGACAG
-tig00000001	+	202644	202647	3048e786-5b3d-4587-b5d0-714b40192268	-8.21	-111.02	-102.81	1	2	TGAACCGCCGTGAA
-tig00000001	+	202663	202663	3048e786-5b3d-4587-b5d0-714b40192268	-6.13	-121.27	-115.14	1	1	GCACACGCAGG
-tig00000001	+	202676	202686	3048e786-5b3d-4587-b5d0-714b40192268	-14.04	-159.59	-145.55	1	2	GAAGGCGGGCTGAAGCGGGTG
-tig00000001	+	202705	202722	3048e786-5b3d-4587-b5d0-714b40192268	-1.23	-236.96	-235.74	1	5	GAACACGCGGACGGCAGCGTCACGCAGA
-tig00000001	+	202738	202740	3048e786-5b3d-4587-b5d0-714b40192268	2.52	-164.29	-166.81	1	2	TTTGACGCGGTGG
-tig00000001	+	202764	202771	3048e786-5b3d-4587-b5d0-714b40192268	-1.06	-151.95	-150.88	1	2	ACAGACGGATGCCGCAGG
-tig00000001	+	202797	202797	3048e786-5b3d-4587-b5d0-714b40192268	-1.75	-88.96	-87.21	1	1	CAGTCCGGATG
-tig00000001	+	202809	202809	3048e786-5b3d-4587-b5d0-714b40192268	-3.23	-91.55	-88.32	1	1	GGTGACGGGCC
-tig00000001	+	202821	202836	3048e786-5b3d-4587-b5d0-714b40192268	-18.70	-232.90	-214.20	1	4	CATCACGCGCATCACCACGCCGGATG
-tig00000001	+	202851	202854	3048e786-5b3d-4587-b5d0-714b40192268	-3.96	-134.06	-130.09	1	2	GGCATCGGCGTTTT
-tig00000001	+	202884	202903	3048e786-5b3d-4587-b5d0-714b40192268	-6.56	-194.57	-188.01	1	3	GTTAACGTCAGCCACCGGGCCTGACGGGCT
-tig00000001	+	202916	202919	3048e786-5b3d-4587-b5d0-714b40192268	-5.13	-155.72	-150.59	1	2	AAATACGCCGGGAA
-tig00000001	+	202940	202940	3048e786-5b3d-4587-b5d0-714b40192268	1.12	-92.88	-94.00	1	1	GGGGCCGTCTG
-tig00000001	+	196514	196527	c1709263-8322-4cbd-86de-5f40eb0457c1	-5.06	-146.01	-140.95	1	3	CAGCCCGCTTGCCGATGCCGTCAC
-tig00000001	+	196542	196576	c1709263-8322-4cbd-86de-5f40eb0457c1	-6.95	-284.03	-277.09	1	7	TCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAAT
-tig00000001	+	196589	196595	c1709263-8322-4cbd-86de-5f40eb0457c1	-9.88	-135.92	-126.04	1	3	AGCAACGCGTGCGGCTA
-tig00000001	+	196629	196629	c1709263-8322-4cbd-86de-5f40eb0457c1	-1.78	-109.11	-107.33	1	1	CTGACCGCCAG
-tig00000001	+	196643	196643	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.00	-123.25	-123.25	1	1	GCTCCCGCCAG
-tig00000001	+	196677	196690	c1709263-8322-4cbd-86de-5f40eb0457c1	-5.44	-161.81	-156.37	1	4	TCTGCCGTTGCCGACGGGCGACCA
-tig00000001	+	196706	196712	c1709263-8322-4cbd-86de-5f40eb0457c1	-1.01	-117.20	-116.19	1	2	ATAGCCGTTGCCGGTAA
-tig00000001	+	196727	196749	c1709263-8322-4cbd-86de-5f40eb0457c1	-17.83	-205.73	-187.91	1	5	CTGCCCGATTAATGCCGAACCGCGCACCGTATC
-tig00000001	+	196762	196770	c1709263-8322-4cbd-86de-5f40eb0457c1	-7.50	-160.97	-153.47	1	2	CTTCACGAATCAACGAACC
-tig00000001	+	196810	196810	c1709263-8322-4cbd-86de-5f40eb0457c1	-9.49	-140.73	-131.23	1	1	CAGTACGGTGG
-tig00000001	+	196823	196834	c1709263-8322-4cbd-86de-5f40eb0457c1	-9.99	-159.84	-149.85	1	3	AGCAGCGGGTAAACGCCGCCAG
-tig00000001	+	196874	196878	c1709263-8322-4cbd-86de-5f40eb0457c1	-5.13	-126.21	-121.08	1	2	AATGCCGGACGTAAT
-tig00000001	+	196909	196915	c1709263-8322-4cbd-86de-5f40eb0457c1	-4.39	-138.62	-134.22	1	2	CAGACCGCAAACGGTCA
-tig00000001	+	196945	196952	c1709263-8322-4cbd-86de-5f40eb0457c1	0.42	-178.88	-179.30	1	2	GATACCGATAAACGGCAC
-tig00000001	+	196975	196975	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.42	-90.65	-90.23	1	1	CAGACCGTAAA
-tig00000001	+	196992	196995	c1709263-8322-4cbd-86de-5f40eb0457c1	-4.64	-108.23	-103.59	1	2	AGTTACGGCGCAAC
-tig00000001	+	197011	197018	c1709263-8322-4cbd-86de-5f40eb0457c1	3.92	-152.12	-156.04	1	2	AGAAGCGGTAAGCGGTTT
-tig00000001	+	197032	197041	c1709263-8322-4cbd-86de-5f40eb0457c1	-6.83	-183.47	-176.65	1	2	ACTCACGCCTTTAACGCCAG
-tig00000001	+	197059	197059	c1709263-8322-4cbd-86de-5f40eb0457c1	3.18	-137.91	-141.08	1	1	AAAGACGATAA
-tig00000001	+	197071	197071	c1709263-8322-4cbd-86de-5f40eb0457c1	-7.53	-114.89	-107.37	1	1	CAAGGCGTTGA
-tig00000001	+	197084	197084	c1709263-8322-4cbd-86de-5f40eb0457c1	-7.46	-144.26	-136.80	1	1	ATCACCGCACT
-tig00000001	+	197098	197108	c1709263-8322-4cbd-86de-5f40eb0457c1	-9.67	-190.65	-180.98	1	3	GATTGCGGAGTCGGGCGAATG
-tig00000001	+	197132	197132	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.11	-126.64	-123.53	1	1	TTCAGCGCATT
-tig00000001	+	197144	197168	c1709263-8322-4cbd-86de-5f40eb0457c1	-29.46	-274.70	-245.23	1	6	AACTGCGGATACGTTGCCGCGAATGCCGCCGGAAT
-tig00000001	+	197179	197197	c1709263-8322-4cbd-86de-5f40eb0457c1	-24.77	-237.46	-212.69	1	3	AATGGCGAAGTATTTCGCCACATCGTTGG
-tig00000001	+	197222	197229	c1709263-8322-4cbd-86de-5f40eb0457c1	-6.87	-159.49	-152.62	1	2	GTCAGCGAGCCACGGGTC
-tig00000001	+	197266	197266	c1709263-8322-4cbd-86de-5f40eb0457c1	-5.50	-134.40	-128.90	1	1	CACCTCGATCA
-tig00000001	+	197279	197279	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.66	-131.82	-131.16	1	1	TTGGTCGGGTT
-tig00000001	+	197290	197296	c1709263-8322-4cbd-86de-5f40eb0457c1	1.15	-138.25	-139.40	1	2	AGAGTCGAGATCGACCA
-tig00000001	+	197309	197321	c1709263-8322-4cbd-86de-5f40eb0457c1	-8.12	-192.03	-183.91	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	+	197332	197350	c1709263-8322-4cbd-86de-5f40eb0457c1	-14.91	-230.90	-215.99	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	+	197363	197420	c1709263-8322-4cbd-86de-5f40eb0457c1	-26.99	-485.55	-458.56	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	+	197433	197433	c1709263-8322-4cbd-86de-5f40eb0457c1	-5.72	-98.24	-92.52	1	1	ACTGACGGATC
-tig00000001	+	197456	197470	c1709263-8322-4cbd-86de-5f40eb0457c1	-17.38	-208.01	-190.62	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	+	197482	197509	c1709263-8322-4cbd-86de-5f40eb0457c1	-21.68	-270.93	-249.24	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	+	197520	197530	c1709263-8322-4cbd-86de-5f40eb0457c1	-13.56	-145.60	-132.04	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	+	197543	197543	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.83	-103.02	-100.19	1	1	ATCACCGTTTT
-tig00000001	+	197562	197577	c1709263-8322-4cbd-86de-5f40eb0457c1	-10.74	-176.38	-165.64	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	+	197590	197599	c1709263-8322-4cbd-86de-5f40eb0457c1	-8.98	-148.11	-139.13	1	2	AATACCGCCTTTGACGATAT
-tig00000001	+	197612	197620	c1709263-8322-4cbd-86de-5f40eb0457c1	-7.86	-140.67	-132.81	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	+	197631	197631	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.88	-87.95	-84.07	1	1	GCACACGAGAA
-tig00000001	+	197654	197657	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.36	-138.83	-136.47	1	2	ACCAGCGGCGTGGC
-tig00000001	+	197670	197672	c1709263-8322-4cbd-86de-5f40eb0457c1	-11.78	-129.44	-117.66	1	2	CCTGACGCGCAAC
-tig00000001	+	197683	197683	c1709263-8322-4cbd-86de-5f40eb0457c1	-8.95	-119.71	-110.76	1	1	CTGATCGACTT
-tig00000001	+	197701	197701	c1709263-8322-4cbd-86de-5f40eb0457c1	-4.50	-98.69	-94.19	1	1	AACATCGGTAG
-tig00000001	+	197719	197719	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.40	-90.36	-87.95	1	1	ACCACCGTTAG
-tig00000001	+	197736	197749	c1709263-8322-4cbd-86de-5f40eb0457c1	-6.57	-187.65	-181.08	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	+	197763	197779	c1709263-8322-4cbd-86de-5f40eb0457c1	-14.07	-243.62	-229.55	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	+	197791	197816	c1709263-8322-4cbd-86de-5f40eb0457c1	-5.80	-252.48	-246.68	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	+	197837	197837	c1709263-8322-4cbd-86de-5f40eb0457c1	-7.00	-89.02	-82.02	1	1	TGGAGCGACTG
-tig00000001	+	197848	197856	c1709263-8322-4cbd-86de-5f40eb0457c1	-12.09	-142.89	-130.80	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	+	197868	197878	c1709263-8322-4cbd-86de-5f40eb0457c1	-14.08	-175.12	-161.04	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	+	197895	197906	c1709263-8322-4cbd-86de-5f40eb0457c1	-6.27	-164.23	-157.96	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	+	197921	197921	c1709263-8322-4cbd-86de-5f40eb0457c1	-11.01	-145.48	-134.46	1	1	GCCAGCGAAGC
-tig00000001	+	197935	197948	c1709263-8322-4cbd-86de-5f40eb0457c1	-9.18	-195.52	-186.34	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	+	197960	197969	c1709263-8322-4cbd-86de-5f40eb0457c1	-8.14	-159.84	-151.70	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	+	197982	197999	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.61	-230.71	-227.10	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	+	198014	198014	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.40	-102.97	-102.58	1	1	GGTGCCGGTTT
-tig00000001	+	198035	198051	c1709263-8322-4cbd-86de-5f40eb0457c1	-13.95	-215.32	-201.36	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	+	198064	198068	c1709263-8322-4cbd-86de-5f40eb0457c1	-6.72	-109.13	-102.41	1	2	CTGCACGTCCGCTGG
-tig00000001	+	198087	198089	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.41	-93.12	-89.71	1	2	ACATTCGCGCCTA
-tig00000001	+	198100	198123	c1709263-8322-4cbd-86de-5f40eb0457c1	-19.01	-266.32	-247.32	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	+	198137	198137	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.76	-115.78	-112.02	1	1	CAGGCCGCCAA
-tig00000001	+	198171	198171	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.25	-86.67	-84.42	1	1	AGCAGCGCCAC
-tig00000001	+	198183	198188	c1709263-8322-4cbd-86de-5f40eb0457c1	-4.11	-107.48	-103.38	1	2	AGTACCGTTACGCTGA
-tig00000001	+	198203	198233	c1709263-8322-4cbd-86de-5f40eb0457c1	-9.76	-233.57	-223.81	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	+	198250	198250	c1709263-8322-4cbd-86de-5f40eb0457c1	-5.21	-98.16	-92.96	1	1	AAAGACGATAG
-tig00000001	+	198289	198313	c1709263-8322-4cbd-86de-5f40eb0457c1	-12.61	-214.69	-202.08	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	+	198326	198336	c1709263-8322-4cbd-86de-5f40eb0457c1	-8.23	-141.02	-132.79	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	+	198352	198364	c1709263-8322-4cbd-86de-5f40eb0457c1	-14.97	-140.24	-125.27	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	+	198399	198415	c1709263-8322-4cbd-86de-5f40eb0457c1	-11.74	-173.19	-161.45	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	+	198427	198485	c1709263-8322-4cbd-86de-5f40eb0457c1	-38.51	-415.07	-376.56	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	+	198513	198513	c1709263-8322-4cbd-86de-5f40eb0457c1	0.52	-116.49	-117.01	1	1	ACCATCGCAGG
-tig00000001	+	198527	198527	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.98	-110.04	-107.06	1	1	AATATCGCCAG
-tig00000001	+	198545	198569	c1709263-8322-4cbd-86de-5f40eb0457c1	-6.61	-228.11	-221.50	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	+	198585	198619	c1709263-8322-4cbd-86de-5f40eb0457c1	-18.63	-240.59	-221.96	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	+	198660	198670	c1709263-8322-4cbd-86de-5f40eb0457c1	-12.44	-147.58	-135.14	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	+	198684	198710	c1709263-8322-4cbd-86de-5f40eb0457c1	-15.55	-252.84	-237.29	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	+	198728	198782	c1709263-8322-4cbd-86de-5f40eb0457c1	-27.63	-357.00	-329.37	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	+	198812	198821	c1709263-8322-4cbd-86de-5f40eb0457c1	-5.39	-162.95	-157.56	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	+	198834	198855	c1709263-8322-4cbd-86de-5f40eb0457c1	-18.29	-219.03	-200.74	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	+	198872	198872	c1709263-8322-4cbd-86de-5f40eb0457c1	-6.20	-92.14	-85.94	1	1	TTCACCGCTTC
-tig00000001	+	198884	198892	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.52	-120.00	-119.47	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	+	198907	198914	c1709263-8322-4cbd-86de-5f40eb0457c1	1.47	-133.22	-134.69	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	+	198927	198927	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.63	-102.83	-102.20	1	1	GTTTACGACTC
-tig00000001	+	198972	198987	c1709263-8322-4cbd-86de-5f40eb0457c1	-13.01	-217.01	-204.00	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	+	199013	199013	c1709263-8322-4cbd-86de-5f40eb0457c1	-7.15	-99.60	-92.45	1	1	CAGTGCGCCAA
-tig00000001	+	199028	199034	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.01	-148.74	-145.73	1	2	CAACACGGTGCCGATTA
-tig00000001	+	199056	199088	c1709263-8322-4cbd-86de-5f40eb0457c1	-22.96	-380.60	-357.65	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	+	199112	199117	c1709263-8322-4cbd-86de-5f40eb0457c1	-4.54	-148.93	-144.40	1	2	ACCAGCGAACCGGCAA
-tig00000001	+	199133	199133	c1709263-8322-4cbd-86de-5f40eb0457c1	-9.59	-134.99	-125.40	1	1	ATCACCGGGAT
-tig00000001	+	199147	199156	c1709263-8322-4cbd-86de-5f40eb0457c1	-6.55	-142.87	-136.32	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	+	199172	199172	c1709263-8322-4cbd-86de-5f40eb0457c1	-9.50	-116.36	-106.86	1	1	CAGAACGCCAG
-tig00000001	+	199193	199193	c1709263-8322-4cbd-86de-5f40eb0457c1	-5.90	-114.65	-108.75	1	1	CAGAACGGAGA
-tig00000001	+	199204	199228	c1709263-8322-4cbd-86de-5f40eb0457c1	-15.04	-246.34	-231.30	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	+	199240	199255	c1709263-8322-4cbd-86de-5f40eb0457c1	-15.19	-175.36	-160.18	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	+	199267	199267	c1709263-8322-4cbd-86de-5f40eb0457c1	-4.76	-124.95	-120.19	1	1	CACTTCGCTAA
-tig00000001	+	199280	199280	c1709263-8322-4cbd-86de-5f40eb0457c1	0.58	-98.67	-99.25	1	1	CCATGCGGGCC
-tig00000001	+	199300	199336	c1709263-8322-4cbd-86de-5f40eb0457c1	-36.20	-328.13	-291.93	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	+	199352	199355	c1709263-8322-4cbd-86de-5f40eb0457c1	-4.01	-110.68	-106.67	1	2	ACCAGCGTCGGGGT
-tig00000001	+	199393	199402	c1709263-8322-4cbd-86de-5f40eb0457c1	-8.94	-155.58	-146.64	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	+	199423	199430	c1709263-8322-4cbd-86de-5f40eb0457c1	-6.16	-126.48	-120.33	1	2	TATTCCGGTGTACGACCA
-tig00000001	+	199446	199446	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.40	-129.58	-129.18	1	1	CAGCCCGGCAA
-tig00000001	+	199459	199459	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.73	-120.61	-117.88	1	1	AACACCGCCAG
-tig00000001	+	199485	199485	c1709263-8322-4cbd-86de-5f40eb0457c1	-4.54	-106.29	-101.75	1	1	CATGCCGTAAA
-tig00000001	+	199500	199509	c1709263-8322-4cbd-86de-5f40eb0457c1	-15.07	-203.52	-188.45	1	3	AGAACCGACACCGCCGAACA
-tig00000001	+	199543	199543	c1709263-8322-4cbd-86de-5f40eb0457c1	1.13	-114.40	-115.53	1	1	CACATCGGCAC
-tig00000001	+	199557	199570	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.55	-214.55	-212.00	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	+	199582	199593	c1709263-8322-4cbd-86de-5f40eb0457c1	-10.63	-175.81	-165.18	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	+	199606	199621	c1709263-8322-4cbd-86de-5f40eb0457c1	-20.39	-204.96	-184.57	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	+	199644	199652	c1709263-8322-4cbd-86de-5f40eb0457c1	-18.63	-171.31	-152.68	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	+	199687	199687	c1709263-8322-4cbd-86de-5f40eb0457c1	-1.00	-79.60	-78.60	1	1	CTGTCCGTGCC
-tig00000001	+	199740	199746	c1709263-8322-4cbd-86de-5f40eb0457c1	-15.52	-195.32	-179.80	1	2	CACCACGCCTACGCAGA
-tig00000001	+	199770	199770	c1709263-8322-4cbd-86de-5f40eb0457c1	-4.27	-110.64	-106.37	1	1	GACATCGCCCA
-tig00000001	+	199786	199802	c1709263-8322-4cbd-86de-5f40eb0457c1	-16.77	-242.02	-225.25	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	+	199833	199836	c1709263-8322-4cbd-86de-5f40eb0457c1	-4.50	-149.10	-144.60	1	2	CACAGCGCCGTTGG
-tig00000001	+	199854	199854	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.48	-112.49	-110.01	1	1	AAGATCGCCAG
-tig00000001	+	199868	199868	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.17	-129.05	-125.88	1	1	CTGCACGAAGT
-tig00000001	+	199883	199883	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.09	-139.94	-137.85	1	1	CAGTGCGGTTG
-tig00000001	+	199899	199908	c1709263-8322-4cbd-86de-5f40eb0457c1	-16.90	-171.11	-154.22	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	+	199931	199943	c1709263-8322-4cbd-86de-5f40eb0457c1	-17.90	-192.45	-174.56	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	+	199956	199956	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.49	-139.88	-137.39	1	1	TTGATCGCTTC
-tig00000001	+	199998	199998	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.79	-124.59	-120.80	1	1	TGTTGCGCTCC
 tig00000001	+	200009	200009	c1709263-8322-4cbd-86de-5f40eb0457c1	-6.17	-115.50	-109.33	1	1	TTCAACGGTAT
 tig00000001	+	200046	200046	c1709263-8322-4cbd-86de-5f40eb0457c1	-11.71	-129.61	-117.90	1	1	TGCAGCGCACC
 tig00000001	+	200081	200081	c1709263-8322-4cbd-86de-5f40eb0457c1	-15.57	-152.57	-137.01	1	1	AACAACGCCAC
@@ -5518,316 +825,6 @@
 tig00000001	+	201922	201930	c1709263-8322-4cbd-86de-5f40eb0457c1	-6.36	-138.35	-131.99	1	2	GTCACCGGCTGGCCGCACT
 tig00000001	+	201944	201950	c1709263-8322-4cbd-86de-5f40eb0457c1	-13.56	-138.04	-124.48	1	2	GCAGGCGCTGCCGGAAG
 tig00000001	+	201961	201986	c1709263-8322-4cbd-86de-5f40eb0457c1	-9.18	-249.72	-240.54	1	4	AACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAA
-tig00000001	+	201998	202007	c1709263-8322-4cbd-86de-5f40eb0457c1	-8.74	-162.92	-154.17	1	2	CAGTCCGCAGGGGCCGTGGT
-tig00000001	+	202020	202020	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.67	-131.44	-127.77	1	1	CTGCTCGGCTG
-tig00000001	+	202033	202046	c1709263-8322-4cbd-86de-5f40eb0457c1	-20.23	-200.57	-180.35	1	3	GTGAGCGGGTGCCGGAAGCGGATG
-tig00000001	+	202064	202081	c1709263-8322-4cbd-86de-5f40eb0457c1	-26.61	-214.58	-187.97	1	5	GCCTGCGCCGCTGCCGCCGTACCGGGTA
-tig00000001	+	202092	202092	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.22	-99.33	-97.11	1	1	CTGACCGGGCT
-tig00000001	+	202105	202143	c1709263-8322-4cbd-86de-5f40eb0457c1	-39.17	-328.12	-288.95	1	8	TGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGA
-tig00000001	+	202155	202198	c1709263-8322-4cbd-86de-5f40eb0457c1	-47.27	-390.77	-343.51	1	8	TTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTG
-tig00000001	+	202214	202225	c1709263-8322-4cbd-86de-5f40eb0457c1	-11.40	-141.67	-130.27	1	3	GACCACGCAGGCGCAGCGGGCA
-tig00000001	+	202240	202240	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.63	-107.54	-106.91	1	1	AAGCCCGGCAG
-tig00000001	+	202257	202275	c1709263-8322-4cbd-86de-5f40eb0457c1	-12.38	-198.67	-186.28	1	5	ATTTCCGGCGGGACGGAACCGTCCGCTTT
-tig00000001	+	202295	202330	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.57	-273.56	-272.99	1	5	CCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTG
-tig00000001	+	202341	202341	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.87	-129.22	-126.35	1	1	TCTGCCGTGTG
-tig00000001	+	202352	202370	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.69	-204.39	-201.70	1	4	GCTGACGCACGACCCGGAATACCCGGAGA
-tig00000001	+	202386	202399	c1709263-8322-4cbd-86de-5f40eb0457c1	-20.71	-182.67	-161.96	1	4	CCTGCCGCGCCGCTGGTGCGCTAT
-tig00000001	+	202412	202432	c1709263-8322-4cbd-86de-5f40eb0457c1	-13.85	-209.98	-196.12	1	6	CTGGACGCCCGCGGCGAACTGGCGGCGGTGT
-tig00000001	+	202443	202443	c1709263-8322-4cbd-86de-5f40eb0457c1	-5.33	-106.29	-100.96	1	1	ATGACCGCAGC
-tig00000001	+	202461	202461	c1709263-8322-4cbd-86de-5f40eb0457c1	-4.44	-111.54	-107.10	1	1	AGGTGCGCAGC
-tig00000001	+	202475	202475	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.04	-116.47	-116.44	1	1	ACTTACGATGA
-tig00000001	+	202488	202525	c1709263-8322-4cbd-86de-5f40eb0457c1	-16.29	-314.24	-297.95	1	7	AATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAA
-tig00000001	+	202539	202557	c1709263-8322-4cbd-86de-5f40eb0457c1	-15.97	-249.46	-233.50	1	5	GTTACCGTTACGACAGCGACGGGCGGGTG
-tig00000001	+	202579	202579	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.98	-82.03	-81.06	1	1	AAACCCGGCAG
-tig00000001	+	202597	202597	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.65	-128.92	-125.27	1	1	TTACACGTATC
-tig00000001	+	202617	202617	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.66	-92.42	-91.75	1	1	AGGACCGCATC
-tig00000001	+	202631	202631	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.19	-107.79	-107.60	1	1	ATCACCGACAG
-tig00000001	+	202644	202647	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.49	-105.44	-102.95	1	2	TGAACCGCCGTGAA
-tig00000001	+	202663	202663	c1709263-8322-4cbd-86de-5f40eb0457c1	-1.67	-104.61	-102.94	1	1	GCACACGCAGG
-tig00000001	+	202676	202686	c1709263-8322-4cbd-86de-5f40eb0457c1	-9.52	-242.54	-233.02	1	2	GAAGGCGGGCTGAAGCGGGTG
-tig00000001	+	202705	202722	c1709263-8322-4cbd-86de-5f40eb0457c1	-16.37	-243.93	-227.56	1	5	GAACACGCGGACGGCAGCGTCACGCAGA
-tig00000001	+	202738	202740	c1709263-8322-4cbd-86de-5f40eb0457c1	3.54	-170.55	-174.09	1	2	TTTGACGCGGTGG
-tig00000001	+	202764	202771	c1709263-8322-4cbd-86de-5f40eb0457c1	-11.21	-133.92	-122.71	1	2	ACAGACGGATGCCGCAGG
-tig00000001	+	202797	202797	c1709263-8322-4cbd-86de-5f40eb0457c1	5.32	-156.12	-161.45	1	1	CAGTCCGGATG
-tig00000001	+	202809	202809	c1709263-8322-4cbd-86de-5f40eb0457c1	-4.64	-111.33	-106.69	1	1	GGTGACGGGCC
-tig00000001	+	202821	202836	c1709263-8322-4cbd-86de-5f40eb0457c1	-14.08	-179.47	-165.39	1	4	CATCACGCGCATCACCACGCCGGATG
-tig00000001	+	202851	202854	c1709263-8322-4cbd-86de-5f40eb0457c1	-7.79	-115.03	-107.24	1	2	GGCATCGGCGTTTT
-tig00000001	+	202884	202903	c1709263-8322-4cbd-86de-5f40eb0457c1	-20.32	-218.33	-198.01	1	3	GTTAACGTCAGCCACCGGGCCTGACGGGCT
-tig00000001	+	202916	202919	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.49	-139.74	-139.24	1	2	AAATACGCCGGGAA
-tig00000001	+	202940	202940	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.40	-93.07	-92.67	1	1	GGGGCCGTCTG
-tig00000001	+	202966	202985	c1709263-8322-4cbd-86de-5f40eb0457c1	-13.61	-188.08	-174.46	1	4	CCTGACGGCGATATCACCCGCTACCGTTAT
-tig00000001	+	203017	203022	c1709263-8322-4cbd-86de-5f40eb0457c1	-10.61	-119.08	-108.46	1	2	CCCTGCGCAACGGAAG
-tig00000001	+	203035	203042	c1709263-8322-4cbd-86de-5f40eb0457c1	0.02	-148.39	-148.41	1	2	GCCACCGGCAGCCGGAAA
-tig00000001	+	203055	203068	c1709263-8322-4cbd-86de-5f40eb0457c1	-6.14	-222.72	-216.58	1	3	CATGACGTGGAGCCGTTACGGTCA
-tig00000001	+	203098	203098	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.13	-107.35	-105.22	1	1	TGTTCCGGTTA
-tig00000001	+	203111	203111	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.64	-90.72	-88.09	1	1	TAACCCGCTAT
-tig00000001	+	203126	203126	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.37	-96.86	-96.49	1	1	ATGACCGTTTT
-tig00000001	+	203142	203155	c1709263-8322-4cbd-86de-5f40eb0457c1	-6.41	-201.10	-194.69	1	4	GGTGACGGCGGTGCACCGCGAGGA
-tig00000001	+	203177	203192	c1709263-8322-4cbd-86de-5f40eb0457c1	-18.37	-229.06	-210.70	1	4	AGTACCGCGCATACGACAGCCGTGGA
-tig00000001	+	203209	203209	c1709263-8322-4cbd-86de-5f40eb0457c1	1.83	-113.94	-115.77	1	1	ATTGCCGTGAA
-tig00000001	+	203220	203220	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.92	-98.07	-97.15	1	1	AGACACGCAGG
-tig00000001	+	203235	203237	c1709263-8322-4cbd-86de-5f40eb0457c1	-6.85	-124.54	-117.69	1	2	TGAAACGCGGTAT
-tig00000001	+	203251	203257	c1709263-8322-4cbd-86de-5f40eb0457c1	-15.62	-146.64	-131.01	1	3	TACAACGCCGCCGGTGA
-tig00000001	+	203272	203272	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.39	-119.55	-117.16	1	1	ACCACCGTCAT
-tig00000001	+	203283	203287	c1709263-8322-4cbd-86de-5f40eb0457c1	-4.20	-136.03	-131.83	1	2	TGCCCCGGACGGCAG
-tig00000001	+	203299	203299	c1709263-8322-4cbd-86de-5f40eb0457c1	-10.87	-136.83	-125.96	1	1	AGAAACGGGAC
-tig00000001	+	203311	203316	c1709263-8322-4cbd-86de-5f40eb0457c1	-9.29	-144.16	-134.87	1	2	CAGTACGATGCGTGGG
-tig00000001	+	203340	203357	c1709263-8322-4cbd-86de-5f40eb0457c1	-21.32	-211.81	-190.49	1	4	TACCACGCAGGGCGGTCTGACGCGCAGT
-tig00000001	+	203371	203393	c1709263-8322-4cbd-86de-5f40eb0457c1	-12.52	-260.40	-247.88	1	4	GAATACGATGCTGCCGGACGGGTCATCCGCCTG
-tig00000001	+	203410	203410	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.48	-85.53	-83.05	1	1	GAAAACGGCAG
-tig00000001	+	203429	203447	c1709263-8322-4cbd-86de-5f40eb0457c1	-17.83	-182.83	-165.00	1	4	CCTTCCGTTACGATGTACTCGACCGGCTG
-tig00000001	+	203464	203486	c1709263-8322-4cbd-86de-5f40eb0457c1	-10.06	-209.03	-198.97	1	4	GAAACCGGCTTTGACGGCCGCACACAGCGTTAT
-tig00000001	+	203497	203506	c1709263-8322-4cbd-86de-5f40eb0457c1	-7.35	-143.32	-135.97	1	2	CACCACGACCTGACCGGCAA
-tig00000001	+	203519	203524	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.31	-162.53	-162.22	1	2	TTATCCGCAGCGAGGA
-tig00000001	+	203560	203609	c1709263-8322-4cbd-86de-5f40eb0457c1	-23.39	-402.28	-378.90	1	8	TATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGG
-tig00000001	+	203623	203629	c1709263-8322-4cbd-86de-5f40eb0457c1	-7.02	-137.51	-130.49	1	3	TATGACGAACGCGGCTG
-tig00000001	+	203659	203676	c1709263-8322-4cbd-86de-5f40eb0457c1	-6.76	-209.32	-202.56	1	3	ATCAGCGAAGGGCACCGGGTGACGGTGC
-tig00000001	+	203705	203710	c1709263-8322-4cbd-86de-5f40eb0457c1	-7.63	-157.64	-150.01	1	2	AAGGCCGCCTCGCCAG
-tig00000001	+	203727	203727	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.88	-109.50	-106.63	1	1	CCTGACGGTGC
-tig00000001	+	203739	203745	c1709263-8322-4cbd-86de-5f40eb0457c1	-12.43	-130.14	-117.71	1	2	TCATCCGCAGACGAATG
-tig00000001	+	203781	203788	c1709263-8322-4cbd-86de-5f40eb0457c1	-14.01	-150.39	-136.37	1	2	ACATGCGTACAACGCACA
-tig00000001	+	203802	203817	c1709263-8322-4cbd-86de-5f40eb0457c1	-12.83	-182.59	-169.76	1	3	ACTGGCGAACCGCTGTATACCGGACA
-tig00000001	+	203830	203833	c1709263-8322-4cbd-86de-5f40eb0457c1	-6.48	-114.58	-108.11	1	2	CTGCCCGCCGTGGA
-tig00000001	+	203851	203857	c1709263-8322-4cbd-86de-5f40eb0457c1	-5.08	-133.68	-128.60	1	2	ACCTACGGCAGCGGCTG
-tig00000001	+	203881	203892	c1709263-8322-4cbd-86de-5f40eb0457c1	-12.88	-178.94	-166.06	1	3	AAACTCGGCGACACACCGCTGG
-tig00000001	+	203909	203948	c1709263-8322-4cbd-86de-5f40eb0457c1	-20.21	-306.32	-286.11	1	8	ACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTAT
-tig00000001	+	203965	203965	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.07	-114.82	-111.75	1	1	ACCACCGCTTA
-tig00000001	+	203980	203980	c1709263-8322-4cbd-86de-5f40eb0457c1	-4.11	-93.48	-89.37	1	1	CCTGCCGGGCA
-tig00000001	+	204023	204025	c1709263-8322-4cbd-86de-5f40eb0457c1	-9.31	-132.07	-122.76	1	2	CTGACCGCGATTA
-tig00000001	+	204040	204059	c1709263-8322-4cbd-86de-5f40eb0457c1	-8.83	-192.11	-183.28	1	4	TGGAACGACAACGGCGAACTCATCCGCATC
-tig00000001	+	204072	204083	c1709263-8322-4cbd-86de-5f40eb0457c1	-6.15	-144.93	-138.78	1	3	CAGCCCGCGCCAGACCCGGAGT
-tig00000001	+	204106	204106	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.95	-103.09	-100.14	1	1	ACCACCGGCAG
-tig00000001	+	204118	204121	c1709263-8322-4cbd-86de-5f40eb0457c1	-7.19	-123.56	-116.37	1	2	CTGACCGGCGTTCA
-tig00000001	+	204133	204138	c1709263-8322-4cbd-86de-5f40eb0457c1	-1.31	-116.21	-114.89	1	2	ACCACCGCAGCGAATC
-tig00000001	+	204152	204159	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.09	-125.66	-122.57	1	2	ATATCCGCATCCCGTATA
-tig00000001	+	204174	204174	c1709263-8322-4cbd-86de-5f40eb0457c1	1.59	-103.30	-104.89	1	1	AGACCCGGCAG
-tig00000001	+	204185	204198	c1709263-8322-4cbd-86de-5f40eb0457c1	-8.59	-143.11	-134.51	1	3	GTAACCGCCTGCCCGACCCGGAGC
-tig00000001	+	204210	204217	c1709263-8322-4cbd-86de-5f40eb0457c1	-5.95	-118.69	-112.74	1	2	GCACCCGGACAGCGCCCT
-tig00000001	+	204234	204258	c1709263-8322-4cbd-86de-5f40eb0457c1	-21.75	-232.75	-211.00	1	6	GTGGCCGGATAACCGTATCGCCCGTGACGCGCACT
-tig00000001	+	204272	204286	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.19	-142.78	-140.59	1	3	TTTACCGGTATGACCGTCACGGCAG
-tig00000001	+	204307	204307	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.94	-124.31	-120.36	1	1	AAAACCGACCT
-tig00000001	+	204318	204318	c1709263-8322-4cbd-86de-5f40eb0457c1	-1.28	-119.83	-118.55	1	1	CATCCCGGAAG
-tig00000001	+	204331	204335	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.43	-115.07	-111.64	1	2	TTATCCGCACGGATG
-tig00000001	+	204346	204355	c1709263-8322-4cbd-86de-5f40eb0457c1	-12.30	-160.57	-148.27	1	2	ATGAGCGCACCCACCGGTAC
-tig00000001	+	204366	204366	c1709263-8322-4cbd-86de-5f40eb0457c1	3.21	-97.29	-100.50	1	1	CATTACGACAG
-tig00000001	+	204379	204379	c1709263-8322-4cbd-86de-5f40eb0457c1	-9.17	-108.76	-99.60	1	1	AGCACCGGCTG
-tig00000001	+	204395	204397	c1709263-8322-4cbd-86de-5f40eb0457c1	-5.23	-127.99	-122.76	1	2	CTACACGCGGACA
-tig00000001	+	204416	204430	c1709263-8322-4cbd-86de-5f40eb0457c1	-7.90	-148.37	-140.47	1	3	AGAGCCGCTGGTCGAAAGTCGCTAT
-tig00000001	+	204441	204454	c1709263-8322-4cbd-86de-5f40eb0457c1	-7.04	-188.44	-181.40	1	3	CTTTACGACCCGCTGGGCCGCAGG
-tig00000001	+	204469	204497	c1709263-8322-4cbd-86de-5f40eb0457c1	-24.37	-332.00	-307.62	1	5	CAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCT
-tig00000001	+	204509	204524	c1709263-8322-4cbd-86de-5f40eb0457c1	-4.01	-203.27	-199.26	1	3	GATGTCGCTGTCACGGAAACCGCAAG
-tig00000001	+	204540	204596	c1709263-8322-4cbd-86de-5f40eb0457c1	-34.85	-361.41	-326.57	1	8	TGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTT
-tig00000001	+	204608	204608	c1709263-8322-4cbd-86de-5f40eb0457c1	1.21	-67.91	-69.12	1	1	TCAGCCGGGGA
-tig00000001	+	204620	204620	c1709263-8322-4cbd-86de-5f40eb0457c1	-4.64	-215.86	-211.22	1	1	CTTCACGCCAC
-tig00000001	+	204642	204648	c1709263-8322-4cbd-86de-5f40eb0457c1	-1.61	-121.22	-119.61	1	2	GAAACCGCCACCGGTGA
-tig00000001	+	204659	204683	c1709263-8322-4cbd-86de-5f40eb0457c1	-11.97	-235.31	-223.34	1	5	GCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATA
-tig00000001	+	204702	204714	c1709263-8322-4cbd-86de-5f40eb0457c1	-1.01	-130.42	-129.41	1	3	CAGTCCGGTGGCGAAGACGGTGG
-tig00000001	+	204734	204737	c1709263-8322-4cbd-86de-5f40eb0457c1	-7.13	-118.55	-111.42	1	2	GTTCCCGCCGGTGC
-tig00000001	+	204756	204760	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.24	-107.52	-105.27	1	2	ATGCTCGACCGGCTG
-tig00000001	+	204787	204787	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.04	-113.32	-113.28	1	1	CTGACCGGGTG
-tig00000001	+	204805	204808	c1709263-8322-4cbd-86de-5f40eb0457c1	-8.99	-106.69	-97.69	1	2	AAAGCCGCCGCTGG
-tig00000001	+	204821	204839	c1709263-8322-4cbd-86de-5f40eb0457c1	-15.74	-294.06	-278.31	1	4	GGCATCGTGCGGCCTGACGGTGGCGCAGA
-tig00000001	+	204863	204880	c1709263-8322-4cbd-86de-5f40eb0457c1	-5.06	-195.92	-190.86	1	5	GGACCCGGTATACACGCCGGCGCGAAAA
-tig00000001	+	204903	204920	c1709263-8322-4cbd-86de-5f40eb0457c1	-8.56	-210.41	-201.85	1	4	CACTGCGACCATCGCGGCCTGCCGCTGG
-tig00000001	+	204938	204938	c1709263-8322-4cbd-86de-5f40eb0457c1	-4.81	-116.65	-111.85	1	1	CAGCACGGAAG
-tig00000001	+	204953	204969	c1709263-8322-4cbd-86de-5f40eb0457c1	-11.12	-171.42	-160.31	1	3	AACAGCGTGGTACGCAGAATACGATGA
-tig00000001	+	205004	205004	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.06	-108.30	-105.24	1	1	GAACCCGCATC
-tig00000001	+	205027	205034	c1709263-8322-4cbd-86de-5f40eb0457c1	-1.69	-137.75	-136.07	1	2	TTATCCGCCTGCCGGGGC
-tig00000001	+	205059	205059	c1709263-8322-4cbd-86de-5f40eb0457c1	-1.74	-89.04	-87.29	1	1	GAGTCCGGCCT
-tig00000001	+	205075	205081	c1709263-8322-4cbd-86de-5f40eb0457c1	-11.70	-126.31	-114.60	1	2	ACAACCGCCACCGCTAT
-tig00000001	+	205094	205094	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.42	-80.65	-77.23	1	1	TGACCCGCTGC
-tig00000001	+	205105	205105	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.15	-112.27	-112.12	1	1	AGGGGCGATAT
-tig00000001	+	205124	205124	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.30	-143.33	-143.02	1	1	GGATCCGATTG
-tig00000001	+	205161	205170	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.32	-138.18	-137.86	1	2	GTATCCGTTGAATCCGATCT
-tig00000001	+	205237	205237	c1709263-8322-4cbd-86de-5f40eb0457c1	-1.53	-112.78	-111.25	1	1	ATGGGCGGAAC
-tig00000001	+	205255	205255	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.56	-101.85	-99.29	1	1	AGAAGCGGTCC
-tig00000001	+	205277	205277	c1709263-8322-4cbd-86de-5f40eb0457c1	-1.45	-104.57	-103.12	1	1	GAATCCGTTCT
-tig00000001	+	205344	205344	c1709263-8322-4cbd-86de-5f40eb0457c1	4.03	-112.16	-116.19	1	1	ACCAACGGGGA
-tig00000001	+	205415	205415	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.99	-95.64	-92.65	1	1	CTGGCCGTTGT
-tig00000001	+	205426	205435	c1709263-8322-4cbd-86de-5f40eb0457c1	-7.45	-150.87	-143.42	1	2	GACCTCGTTGAAACCGATAA
-tig00000001	+	205487	205489	c1709263-8322-4cbd-86de-5f40eb0457c1	-7.48	-160.74	-153.26	1	2	AAGGCCGCGTTAT
-tig00000001	+	205595	205595	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.84	-222.54	-218.70	1	1	TGCTCCGGAAA
-tig00000001	+	205611	205611	c1709263-8322-4cbd-86de-5f40eb0457c1	-4.05	-124.15	-120.10	1	1	TTGGACGTTTT
-tig00000001	+	205634	205634	c1709263-8322-4cbd-86de-5f40eb0457c1	4.06	-100.27	-104.33	1	1	TTCACCGGAGT
-tig00000001	+	205691	205691	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.87	-103.70	-100.82	1	1	TTTATCGCTTT
-tig00000001	+	205744	205744	c1709263-8322-4cbd-86de-5f40eb0457c1	0.85	-111.26	-112.11	1	1	CCACTCGTGAT
-tig00000001	+	205755	205755	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.66	-98.35	-97.69	1	1	GTGAGCGAGTT
-tig00000001	+	205863	205863	c1709263-8322-4cbd-86de-5f40eb0457c1	0.00	-68.74	-68.74	1	1	ATTGGCGTAAG
-tig00000001	+	205892	205892	c1709263-8322-4cbd-86de-5f40eb0457c1	-4.81	-113.07	-108.26	1	1	TATGGCGATAA
-tig00000001	+	205954	205954	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.28	-89.32	-87.04	1	1	GTAAGCGCATT
-tig00000001	+	206021	206021	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.75	-101.00	-100.24	1	1	TATCCCGTATG
-tig00000001	+	206036	206036	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.43	-96.36	-95.93	1	1	AGACCCGGCAG
-tig00000001	+	206047	206060	c1709263-8322-4cbd-86de-5f40eb0457c1	-8.74	-203.79	-195.05	1	3	GTAACCGCCTGCCCGACCCGGAGC
-tig00000001	+	206072	206072	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.72	-121.91	-121.19	1	1	GCACCCGGACA
-tig00000001	+	206096	206120	c1709263-8322-4cbd-86de-5f40eb0457c1	-21.89	-305.26	-283.36	1	6	GTGGCCGGATAACCGTATCGCCCGTGACGCGCACT
-tig00000001	+	206134	206148	c1709263-8322-4cbd-86de-5f40eb0457c1	-10.50	-175.98	-165.48	1	3	TTTACCGGTATGACCGTCACGGCAG
-tig00000001	+	206159	206169	c1709263-8322-4cbd-86de-5f40eb0457c1	-1.92	-156.86	-154.94	1	2	GCTGACGGAGAAAACCGACCT
-tig00000001	+	206180	206180	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.39	-115.34	-114.95	1	1	CATCCCGGAAG
-tig00000001	+	206193	206197	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.28	-115.99	-113.71	1	2	TTATCCGCACGGATG
-tig00000001	+	206208	206217	c1709263-8322-4cbd-86de-5f40eb0457c1	-10.35	-163.48	-153.13	1	2	ATGAGCGCACCCACCGGTAC
-tig00000001	+	206228	206228	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.41	-116.51	-116.10	1	1	CATTACGACAG
-tig00000001	+	206241	206241	c1709263-8322-4cbd-86de-5f40eb0457c1	-4.23	-121.13	-116.91	1	1	AGCACCGGCTG
-tig00000001	+	206257	206259	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.80	-97.79	-94.99	1	2	CTACACGCGGACA
-tig00000001	+	206278	206292	c1709263-8322-4cbd-86de-5f40eb0457c1	-16.70	-206.06	-189.36	1	3	AGAGCCGCTGGTCGAAAGCCGCTAT
-tig00000001	+	206303	206316	c1709263-8322-4cbd-86de-5f40eb0457c1	-7.82	-183.95	-176.14	1	3	CTTTACGACCCGCTGGGCCGCAGG
-tig00000001	+	206331	206359	c1709263-8322-4cbd-86de-5f40eb0457c1	-27.29	-358.07	-330.78	1	5	CAAAACGGGTGTGGCGACGTGAACGGGACCTGACGGGCT
-tig00000001	+	206371	206386	c1709263-8322-4cbd-86de-5f40eb0457c1	-10.86	-204.04	-193.18	1	3	GATGTCGCTGTCACGGAAACCGCAAG
-tig00000001	+	206402	206458	c1709263-8322-4cbd-86de-5f40eb0457c1	-22.31	-371.75	-349.44	1	8	TGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTT
-tig00000001	+	206470	206470	c1709263-8322-4cbd-86de-5f40eb0457c1	0.57	-113.66	-114.22	1	1	TCAGCCGGGGA
-tig00000001	+	206482	206482	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.76	-107.66	-103.90	1	1	CTTCACGCCAC
-tig00000001	+	206504	206510	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.05	-150.71	-147.65	1	2	GAAACCGCCACCGGTGA
-tig00000001	+	206521	206545	c1709263-8322-4cbd-86de-5f40eb0457c1	-8.75	-182.17	-173.42	1	5	GCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATA
-tig00000001	+	206564	206576	c1709263-8322-4cbd-86de-5f40eb0457c1	-16.75	-166.27	-149.52	1	4	CAGTCCGGCGGCGAAGACGGTGG
-tig00000001	+	206596	206599	c1709263-8322-4cbd-86de-5f40eb0457c1	-7.92	-135.96	-128.04	1	2	GTTCCCGCCGGTGC
-tig00000001	+	206618	206622	c1709263-8322-4cbd-86de-5f40eb0457c1	0.35	-142.74	-143.10	1	2	ATGCTCGACCGGCTG
-tig00000001	+	206649	206649	c1709263-8322-4cbd-86de-5f40eb0457c1	-1.04	-115.30	-114.26	1	1	CTGACCGGGTG
-tig00000001	+	206667	206670	c1709263-8322-4cbd-86de-5f40eb0457c1	-11.67	-100.00	-88.33	1	2	AAAGCCGCCGCTGG
-tig00000001	+	206683	206695	c1709263-8322-4cbd-86de-5f40eb0457c1	-16.25	-172.03	-155.77	1	3	GGCATCGTGCGGCCTGACGGTGG
-tig00000001	+	206725	206742	c1709263-8322-4cbd-86de-5f40eb0457c1	-19.86	-255.67	-235.81	1	5	GGACCCGGTGTACACGCCGGCGCGAAAA
-tig00000001	+	206765	206788	c1709263-8322-4cbd-86de-5f40eb0457c1	-22.78	-258.39	-235.60	1	5	CACTGCGACCATCGCGGCCTGCCGCTGGCGCTTG
-tig00000001	+	206800	206800	c1709263-8322-4cbd-86de-5f40eb0457c1	-5.43	-130.16	-124.72	1	1	CAGCACGGAAG
-tig00000001	+	206822	206831	c1709263-8322-4cbd-86de-5f40eb0457c1	-5.31	-146.98	-141.68	1	2	TGGTGCGCAGAATACGATGA
-tig00000001	+	206866	206866	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.35	-102.03	-98.67	1	1	GAACCCGCATC
-tig00000001	+	206889	206896	c1709263-8322-4cbd-86de-5f40eb0457c1	-5.23	-127.88	-122.65	1	2	TTATCCGCCTGCCGGGGC
-tig00000001	+	206921	206921	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.49	-79.58	-79.09	1	1	GAGTCCGGCCT
-tig00000001	+	206937	206943	c1709263-8322-4cbd-86de-5f40eb0457c1	-6.52	-143.52	-137.00	1	2	ACAACCGCCACCGCTAT
-tig00000001	+	206956	206956	c1709263-8322-4cbd-86de-5f40eb0457c1	-9.09	-110.26	-101.17	1	1	TGACCCGCTGC
-tig00000001	+	206986	206986	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.97	-113.11	-112.14	1	1	GGATCCGATTG
-tig00000001	+	207023	207032	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.14	-125.66	-122.52	1	2	GTATCCGCTGAATCCGGTTC
-tig00000001	+	207090	207090	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.50	-125.45	-124.95	1	1	AATGGCGGATA
-tig00000001	+	207101	207101	c1709263-8322-4cbd-86de-5f40eb0457c1	3.32	-135.01	-138.33	1	1	TGGAGCGAGAC
-tig00000001	+	207116	207126	c1709263-8322-4cbd-86de-5f40eb0457c1	-13.33	-142.46	-129.13	1	3	CAAACCGCCTACGCCCGATCC
-tig00000001	+	207143	207152	c1709263-8322-4cbd-86de-5f40eb0457c1	-4.46	-178.70	-174.24	1	2	ATTGCCGGACATAGCGAAAC
-tig00000001	+	207197	207197	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.03	-89.03	-86.00	1	1	TAGTGCGCCTA
-tig00000001	+	207240	207240	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.63	-75.85	-75.22	1	1	CCTTACGACTA
-tig00000001	+	207290	207290	c1709263-8322-4cbd-86de-5f40eb0457c1	-7.13	-99.51	-92.38	1	1	TTGTACGCCAC
-tig00000001	+	207432	207432	c1709263-8322-4cbd-86de-5f40eb0457c1	1.49	-137.41	-138.90	1	1	AAACCCGATGG
-tig00000001	+	207500	207500	c1709263-8322-4cbd-86de-5f40eb0457c1	-6.74	-108.90	-102.16	1	1	AACATCGAGAG
-tig00000001	+	207578	207578	c1709263-8322-4cbd-86de-5f40eb0457c1	-4.11	-116.62	-112.51	1	1	GATTGCGAAAT
-tig00000001	+	207617	207617	c1709263-8322-4cbd-86de-5f40eb0457c1	-4.44	-96.29	-91.85	1	1	ATTTTCGCTAA
-tig00000001	+	207637	207639	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.76	-136.23	-132.47	1	2	TTTTCCGCGTTTC
-tig00000001	+	207694	207694	c1709263-8322-4cbd-86de-5f40eb0457c1	-8.35	-101.14	-92.79	1	1	GACATCGGTGA
-tig00000001	+	207753	207758	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.57	-162.12	-158.55	1	2	CCAAGCGGGGCGAGAC
-tig00000001	+	207772	207787	c1709263-8322-4cbd-86de-5f40eb0457c1	-7.02	-179.42	-172.40	1	4	TAATTCGCGTCGGGTCACTACGCCTT
-tig00000001	+	207818	207818	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.19	-113.14	-112.95	1	1	AGGAACGTTGC
-tig00000001	+	207850	207867	c1709263-8322-4cbd-86de-5f40eb0457c1	-17.34	-222.06	-204.72	1	5	AAAAACGGCGTTTCTCGGCGATCGGTTT
-tig00000001	+	207889	207889	c1709263-8322-4cbd-86de-5f40eb0457c1	-3.65	-118.15	-114.50	1	1	AAGAGCGGGTA
-tig00000001	+	207991	207991	c1709263-8322-4cbd-86de-5f40eb0457c1	-1.62	-97.01	-95.39	1	1	ATGCTCGAATG
-tig00000001	+	208010	208010	c1709263-8322-4cbd-86de-5f40eb0457c1	-0.48	-99.85	-99.37	1	1	TCTCCCGAACA
-tig00000001	+	208028	208028	c1709263-8322-4cbd-86de-5f40eb0457c1	-2.02	-92.23	-90.21	1	1	TCTTACGAATG
-tig00000001	+	208062	208062	c1709263-8322-4cbd-86de-5f40eb0457c1	-1.90	-117.75	-115.85	1	1	TAATTCGTAGT
-tig00000001	-	196874	196878	237f1f8e-b267-437b-b8d0-464a8f838fc0	-2.44	-104.13	-101.69	1	2	AATGCCGGACGTAAT
-tig00000001	-	196909	196915	237f1f8e-b267-437b-b8d0-464a8f838fc0	-4.21	-121.95	-117.74	1	2	CAGACCGCAAACGGTCA
-tig00000001	-	196945	196952	237f1f8e-b267-437b-b8d0-464a8f838fc0	-4.41	-147.55	-143.13	1	2	GATACCGATAAACGGCAC
-tig00000001	-	196975	196975	237f1f8e-b267-437b-b8d0-464a8f838fc0	-2.94	-143.86	-140.92	1	1	CAGACCGTAAA
-tig00000001	-	196992	196995	237f1f8e-b267-437b-b8d0-464a8f838fc0	-10.49	-173.92	-163.43	1	2	AGTTACGGCGCAAC
-tig00000001	-	197011	197018	237f1f8e-b267-437b-b8d0-464a8f838fc0	-11.51	-141.32	-129.82	1	2	AGAAGCGGTAAGCGGTTT
-tig00000001	-	197032	197041	237f1f8e-b267-437b-b8d0-464a8f838fc0	-2.19	-132.65	-130.46	1	2	ACTCACGCCTTTAACGCCAG
-tig00000001	-	197059	197059	237f1f8e-b267-437b-b8d0-464a8f838fc0	-2.60	-116.17	-113.57	1	1	AAAGACGATAA
-tig00000001	-	197071	197071	237f1f8e-b267-437b-b8d0-464a8f838fc0	-4.00	-89.40	-85.40	1	1	CAAGGCGTTGA
-tig00000001	-	197084	197084	237f1f8e-b267-437b-b8d0-464a8f838fc0	-6.02	-140.58	-134.56	1	1	ATCACCGCACT
-tig00000001	-	197098	197108	237f1f8e-b267-437b-b8d0-464a8f838fc0	-8.94	-184.73	-175.79	1	3	GATTGCGGAGTCGGGCGAATG
-tig00000001	-	197132	197132	237f1f8e-b267-437b-b8d0-464a8f838fc0	-5.52	-129.66	-124.15	1	1	TTCAGCGCATT
-tig00000001	-	197144	197168	237f1f8e-b267-437b-b8d0-464a8f838fc0	-26.63	-304.83	-278.20	1	6	AACTGCGGATACGTTGCCGCGAATGCCGCCGGAAT
-tig00000001	-	197179	197197	237f1f8e-b267-437b-b8d0-464a8f838fc0	-14.26	-250.09	-235.83	1	3	AATGGCGAAGTATTTCGCCACATCGTTGG
-tig00000001	-	197222	197229	237f1f8e-b267-437b-b8d0-464a8f838fc0	-6.09	-160.01	-153.93	1	2	GTCAGCGAGCCACGGGTC
-tig00000001	-	197266	197266	237f1f8e-b267-437b-b8d0-464a8f838fc0	-1.00	-113.01	-112.01	1	1	CACCTCGATCA
-tig00000001	-	197279	197279	237f1f8e-b267-437b-b8d0-464a8f838fc0	-0.56	-105.02	-104.47	1	1	TTGGTCGGGTT
-tig00000001	-	197290	197296	237f1f8e-b267-437b-b8d0-464a8f838fc0	0.41	-165.42	-165.82	1	2	AGAGTCGAGATCGACCA
-tig00000001	-	197309	197321	237f1f8e-b267-437b-b8d0-464a8f838fc0	-22.51	-283.48	-260.97	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	-	197332	197350	237f1f8e-b267-437b-b8d0-464a8f838fc0	-2.75	-253.57	-250.82	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	-	197363	197420	237f1f8e-b267-437b-b8d0-464a8f838fc0	-30.12	-524.62	-494.50	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	-	197433	197433	237f1f8e-b267-437b-b8d0-464a8f838fc0	3.15	-172.74	-175.89	1	1	ACTGACGGATC
-tig00000001	-	197456	197470	237f1f8e-b267-437b-b8d0-464a8f838fc0	-14.99	-197.38	-182.39	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	-	197482	197509	237f1f8e-b267-437b-b8d0-464a8f838fc0	-21.50	-246.31	-224.81	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	-	197520	197530	237f1f8e-b267-437b-b8d0-464a8f838fc0	0.37	-284.88	-285.25	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	-	197543	197543	237f1f8e-b267-437b-b8d0-464a8f838fc0	-4.82	-126.84	-122.02	1	1	ATCACCGTTTT
-tig00000001	-	197562	197577	237f1f8e-b267-437b-b8d0-464a8f838fc0	-10.01	-202.68	-192.67	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	-	197590	197599	237f1f8e-b267-437b-b8d0-464a8f838fc0	-9.66	-186.03	-176.38	1	2	AATACCGCCTTTGACGATAT
-tig00000001	-	197612	197620	237f1f8e-b267-437b-b8d0-464a8f838fc0	-9.56	-169.75	-160.19	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	-	197631	197631	237f1f8e-b267-437b-b8d0-464a8f838fc0	0.40	-146.53	-146.93	1	1	GCACACGAGAA
-tig00000001	-	197654	197657	237f1f8e-b267-437b-b8d0-464a8f838fc0	-12.47	-106.37	-93.89	1	2	ACCAGCGGCGTGGC
-tig00000001	-	197670	197672	237f1f8e-b267-437b-b8d0-464a8f838fc0	-2.46	-121.24	-118.78	1	2	CCTGACGCGCAAC
-tig00000001	-	197683	197683	237f1f8e-b267-437b-b8d0-464a8f838fc0	-5.02	-101.21	-96.19	1	1	CTGATCGACTT
-tig00000001	-	197701	197701	237f1f8e-b267-437b-b8d0-464a8f838fc0	-4.06	-92.27	-88.21	1	1	AACATCGGTAG
-tig00000001	-	197719	197719	237f1f8e-b267-437b-b8d0-464a8f838fc0	-1.71	-133.50	-131.79	1	1	ACCACCGTTAG
-tig00000001	-	197736	197749	237f1f8e-b267-437b-b8d0-464a8f838fc0	-4.94	-217.54	-212.59	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	-	197763	197779	237f1f8e-b267-437b-b8d0-464a8f838fc0	-5.94	-186.77	-180.83	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	-	197791	197816	237f1f8e-b267-437b-b8d0-464a8f838fc0	-14.44	-252.09	-237.65	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	-	197837	197837	237f1f8e-b267-437b-b8d0-464a8f838fc0	-4.67	-101.88	-97.21	1	1	TGGAGCGACTG
-tig00000001	-	197848	197856	237f1f8e-b267-437b-b8d0-464a8f838fc0	-13.91	-167.91	-154.00	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	-	197868	197878	237f1f8e-b267-437b-b8d0-464a8f838fc0	-7.98	-166.83	-158.85	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	-	197895	197906	237f1f8e-b267-437b-b8d0-464a8f838fc0	-21.13	-192.50	-171.38	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	-	197921	197921	237f1f8e-b267-437b-b8d0-464a8f838fc0	-0.74	-100.62	-99.87	1	1	GCCAGCGAAGC
-tig00000001	-	197935	197948	237f1f8e-b267-437b-b8d0-464a8f838fc0	-10.21	-198.06	-187.85	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	-	197960	197969	237f1f8e-b267-437b-b8d0-464a8f838fc0	-5.15	-176.34	-171.19	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	-	197982	197999	237f1f8e-b267-437b-b8d0-464a8f838fc0	-8.15	-179.72	-171.57	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	-	198014	198014	237f1f8e-b267-437b-b8d0-464a8f838fc0	-0.29	-98.23	-97.93	1	1	GGTGCCGGTTT
-tig00000001	-	198035	198051	237f1f8e-b267-437b-b8d0-464a8f838fc0	-2.96	-201.68	-198.72	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	-	198064	198068	237f1f8e-b267-437b-b8d0-464a8f838fc0	-6.51	-196.35	-189.84	1	2	CTGCACGTCCGCTGG
-tig00000001	-	198087	198089	237f1f8e-b267-437b-b8d0-464a8f838fc0	0.67	-127.34	-128.02	1	2	ACATTCGCGCCTA
-tig00000001	-	198100	198123	237f1f8e-b267-437b-b8d0-464a8f838fc0	-16.35	-297.48	-281.14	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	-	198137	198137	237f1f8e-b267-437b-b8d0-464a8f838fc0	0.23	-111.56	-111.78	1	1	CAGGCCGCCAA
-tig00000001	-	198171	198171	237f1f8e-b267-437b-b8d0-464a8f838fc0	-1.36	-96.58	-95.22	1	1	AGCAGCGCCAC
-tig00000001	-	198183	198188	237f1f8e-b267-437b-b8d0-464a8f838fc0	-2.53	-127.92	-125.38	1	2	AGTACCGTTACGCTGA
-tig00000001	-	198203	198233	237f1f8e-b267-437b-b8d0-464a8f838fc0	-7.29	-252.26	-244.97	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	-	198250	198250	237f1f8e-b267-437b-b8d0-464a8f838fc0	-5.68	-129.86	-124.18	1	1	AAAGACGATAG
-tig00000001	-	198289	198313	237f1f8e-b267-437b-b8d0-464a8f838fc0	-23.04	-238.67	-215.63	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	-	198326	198336	237f1f8e-b267-437b-b8d0-464a8f838fc0	-5.33	-154.69	-149.36	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	-	198352	198364	237f1f8e-b267-437b-b8d0-464a8f838fc0	-9.92	-166.48	-156.56	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	-	198399	198415	237f1f8e-b267-437b-b8d0-464a8f838fc0	-16.06	-210.22	-194.16	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	-	198427	198485	237f1f8e-b267-437b-b8d0-464a8f838fc0	-25.27	-467.22	-441.94	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	-	198513	198513	237f1f8e-b267-437b-b8d0-464a8f838fc0	3.16	-103.00	-106.16	1	1	ACCATCGCAGG
-tig00000001	-	198527	198527	237f1f8e-b267-437b-b8d0-464a8f838fc0	-0.26	-88.17	-87.92	1	1	AATATCGCCAG
-tig00000001	-	198545	198569	237f1f8e-b267-437b-b8d0-464a8f838fc0	-12.65	-270.89	-258.24	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	-	198585	198619	237f1f8e-b267-437b-b8d0-464a8f838fc0	-3.99	-331.32	-327.33	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	-	198660	198670	237f1f8e-b267-437b-b8d0-464a8f838fc0	-10.75	-158.51	-147.76	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	-	198684	198710	237f1f8e-b267-437b-b8d0-464a8f838fc0	-23.62	-276.97	-253.35	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	-	198728	198782	237f1f8e-b267-437b-b8d0-464a8f838fc0	-17.01	-414.62	-397.61	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	-	198812	198821	237f1f8e-b267-437b-b8d0-464a8f838fc0	-9.05	-202.38	-193.33	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	-	198834	198855	237f1f8e-b267-437b-b8d0-464a8f838fc0	-25.60	-258.04	-232.44	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	-	198872	198872	237f1f8e-b267-437b-b8d0-464a8f838fc0	-3.71	-131.93	-128.22	1	1	TTCACCGCTTC
-tig00000001	-	198884	198892	237f1f8e-b267-437b-b8d0-464a8f838fc0	-0.98	-131.94	-130.96	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	-	198907	198914	237f1f8e-b267-437b-b8d0-464a8f838fc0	-3.41	-125.25	-121.83	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	-	198927	198927	237f1f8e-b267-437b-b8d0-464a8f838fc0	-1.45	-103.50	-102.06	1	1	GTTTACGACTC
-tig00000001	-	198972	198987	237f1f8e-b267-437b-b8d0-464a8f838fc0	-5.19	-172.67	-167.48	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	-	199013	199013	237f1f8e-b267-437b-b8d0-464a8f838fc0	-2.15	-108.16	-106.01	1	1	CAGTGCGCCAA
-tig00000001	-	199028	199034	237f1f8e-b267-437b-b8d0-464a8f838fc0	-5.82	-164.02	-158.20	1	2	CAACACGGTGCCGATTA
-tig00000001	-	199056	199088	237f1f8e-b267-437b-b8d0-464a8f838fc0	-24.77	-307.65	-282.88	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	-	199112	199117	237f1f8e-b267-437b-b8d0-464a8f838fc0	-7.70	-156.86	-149.17	1	2	ACCAGCGAACCGGCAA
-tig00000001	-	199133	199133	237f1f8e-b267-437b-b8d0-464a8f838fc0	-2.71	-110.38	-107.67	1	1	ATCACCGGGAT
-tig00000001	-	199147	199156	237f1f8e-b267-437b-b8d0-464a8f838fc0	-10.13	-167.73	-157.60	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	-	199172	199172	237f1f8e-b267-437b-b8d0-464a8f838fc0	-2.41	-112.26	-109.85	1	1	CAGAACGCCAG
-tig00000001	-	199193	199193	237f1f8e-b267-437b-b8d0-464a8f838fc0	1.05	-81.53	-82.57	1	1	CAGAACGGAGA
-tig00000001	-	199204	199228	237f1f8e-b267-437b-b8d0-464a8f838fc0	-2.26	-232.27	-230.01	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	-	199240	199255	237f1f8e-b267-437b-b8d0-464a8f838fc0	-14.18	-230.97	-216.78	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	-	199267	199267	237f1f8e-b267-437b-b8d0-464a8f838fc0	1.50	-107.54	-109.05	1	1	CACTTCGCTAA
-tig00000001	-	199280	199280	237f1f8e-b267-437b-b8d0-464a8f838fc0	-3.39	-104.42	-101.04	1	1	CCATGCGGGCC
-tig00000001	-	199300	199336	237f1f8e-b267-437b-b8d0-464a8f838fc0	-12.68	-343.64	-330.96	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	-	199352	199355	237f1f8e-b267-437b-b8d0-464a8f838fc0	-4.11	-159.31	-155.20	1	2	ACCAGCGTCGGGGT
-tig00000001	-	199393	199402	237f1f8e-b267-437b-b8d0-464a8f838fc0	-5.29	-154.01	-148.72	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	-	199423	199430	237f1f8e-b267-437b-b8d0-464a8f838fc0	0.34	-183.26	-183.60	1	2	TATTCCGGTGTACGACCA
-tig00000001	-	199446	199446	237f1f8e-b267-437b-b8d0-464a8f838fc0	-5.00	-123.30	-118.30	1	1	CAGCCCGGCAA
-tig00000001	-	199459	199459	237f1f8e-b267-437b-b8d0-464a8f838fc0	-0.00	-102.66	-102.66	1	1	AACACCGCCAG
-tig00000001	-	199485	199485	237f1f8e-b267-437b-b8d0-464a8f838fc0	-1.52	-107.99	-106.46	1	1	CATGCCGTAAA
-tig00000001	-	199500	199509	237f1f8e-b267-437b-b8d0-464a8f838fc0	-3.05	-174.34	-171.29	1	3	AGAACCGACACCGCCGAACA
-tig00000001	-	199543	199543	237f1f8e-b267-437b-b8d0-464a8f838fc0	-0.78	-114.85	-114.07	1	1	CACATCGGCAC
-tig00000001	-	199557	199570	237f1f8e-b267-437b-b8d0-464a8f838fc0	-10.57	-202.71	-192.14	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	-	199582	199593	237f1f8e-b267-437b-b8d0-464a8f838fc0	-6.20	-157.26	-151.06	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	-	199606	199621	237f1f8e-b267-437b-b8d0-464a8f838fc0	-22.46	-241.74	-219.28	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	-	199644	199652	237f1f8e-b267-437b-b8d0-464a8f838fc0	-13.57	-187.08	-173.51	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	-	199687	199687	237f1f8e-b267-437b-b8d0-464a8f838fc0	-3.10	-95.87	-92.76	1	1	CTGTCCGTGCC
-tig00000001	-	199740	199746	237f1f8e-b267-437b-b8d0-464a8f838fc0	-1.83	-145.49	-143.66	1	2	CACCACGCCTACGCAGA
-tig00000001	-	199770	199770	237f1f8e-b267-437b-b8d0-464a8f838fc0	-2.96	-104.50	-101.54	1	1	GACATCGCCCA
-tig00000001	-	199786	199802	237f1f8e-b267-437b-b8d0-464a8f838fc0	-21.42	-222.30	-200.88	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	-	199833	199836	237f1f8e-b267-437b-b8d0-464a8f838fc0	-2.39	-109.80	-107.41	1	2	CACAGCGCCGTTGG
-tig00000001	-	199854	199854	237f1f8e-b267-437b-b8d0-464a8f838fc0	0.53	-105.45	-105.99	1	1	AAGATCGCCAG
-tig00000001	-	199868	199868	237f1f8e-b267-437b-b8d0-464a8f838fc0	-6.30	-113.21	-106.90	1	1	CTGCACGAAGT
-tig00000001	-	199883	199883	237f1f8e-b267-437b-b8d0-464a8f838fc0	-0.51	-94.36	-93.85	1	1	CAGTGCGGTTG
-tig00000001	-	199899	199908	237f1f8e-b267-437b-b8d0-464a8f838fc0	-6.61	-138.00	-131.39	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	-	199931	199943	237f1f8e-b267-437b-b8d0-464a8f838fc0	-11.65	-162.98	-151.33	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	-	199956	199956	237f1f8e-b267-437b-b8d0-464a8f838fc0	-3.61	-130.56	-126.95	1	1	TTGATCGCTTC
-tig00000001	-	199998	199998	237f1f8e-b267-437b-b8d0-464a8f838fc0	-6.63	-123.73	-117.09	1	1	TGTTGCGCTCC
 tig00000001	-	200009	200009	237f1f8e-b267-437b-b8d0-464a8f838fc0	-3.83	-129.09	-125.26	1	1	TTCAACGGTAT
 tig00000001	-	200046	200046	237f1f8e-b267-437b-b8d0-464a8f838fc0	-4.79	-98.68	-93.88	1	1	TGCAGCGCACC
 tig00000001	-	200081	200081	237f1f8e-b267-437b-b8d0-464a8f838fc0	-5.46	-119.69	-114.23	1	1	AACAACGCCAC
@@ -5875,201 +872,11 @@
 tig00000001	-	201689	201689	237f1f8e-b267-437b-b8d0-464a8f838fc0	-6.03	-161.30	-155.27	1	1	TCTCCCGCACC
 tig00000001	-	201707	201725	237f1f8e-b267-437b-b8d0-464a8f838fc0	-26.14	-372.56	-346.41	1	5	GTTACCGGACAAAACGCCCGCGCCGGTGG
 tig00000001	-	201738	201744	237f1f8e-b267-437b-b8d0-464a8f838fc0	-7.12	-192.27	-185.15	1	2	AGCCTCGGCCCCGGCTG
-tig00000001	+	197266	197266	d7bbdb5c-225f-4910-a264-6444e1ace544	-13.96	-121.57	-107.62	1	1	CACCTCGATCA
-tig00000001	+	197279	197279	d7bbdb5c-225f-4910-a264-6444e1ace544	3.66	-140.16	-143.81	1	1	TTGGTCGGGTT
-tig00000001	+	197290	197296	d7bbdb5c-225f-4910-a264-6444e1ace544	-15.49	-172.85	-157.36	1	2	AGAGTCGAGATCGACCA
-tig00000001	+	197309	197321	d7bbdb5c-225f-4910-a264-6444e1ace544	-3.98	-181.83	-177.85	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	+	197332	197350	d7bbdb5c-225f-4910-a264-6444e1ace544	-20.29	-244.71	-224.43	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	+	197363	197420	d7bbdb5c-225f-4910-a264-6444e1ace544	-43.86	-441.83	-397.97	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	+	197433	197433	d7bbdb5c-225f-4910-a264-6444e1ace544	-5.88	-106.34	-100.46	1	1	ACTGACGGATC
-tig00000001	+	197456	197470	d7bbdb5c-225f-4910-a264-6444e1ace544	-6.82	-161.84	-155.01	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	+	197482	197509	d7bbdb5c-225f-4910-a264-6444e1ace544	-20.09	-277.50	-257.40	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	+	197520	197530	d7bbdb5c-225f-4910-a264-6444e1ace544	-4.10	-154.97	-150.87	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	+	197543	197543	d7bbdb5c-225f-4910-a264-6444e1ace544	-2.10	-105.74	-103.64	1	1	ATCACCGTTTT
-tig00000001	+	197562	197577	d7bbdb5c-225f-4910-a264-6444e1ace544	-9.14	-201.17	-192.03	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	+	197590	197599	d7bbdb5c-225f-4910-a264-6444e1ace544	-4.55	-162.57	-158.01	1	2	AATACCGCCTTTGACGATAT
-tig00000001	+	197612	197620	d7bbdb5c-225f-4910-a264-6444e1ace544	-14.44	-175.55	-161.11	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	+	197631	197631	d7bbdb5c-225f-4910-a264-6444e1ace544	-1.98	-83.81	-81.83	1	1	GCACACGAGAA
-tig00000001	+	197654	197657	d7bbdb5c-225f-4910-a264-6444e1ace544	-8.52	-156.70	-148.18	1	2	ACCAGCGGCGTGGC
-tig00000001	+	197670	197672	d7bbdb5c-225f-4910-a264-6444e1ace544	-11.58	-106.87	-95.29	1	2	CCTGACGCGCAAC
-tig00000001	+	197683	197683	d7bbdb5c-225f-4910-a264-6444e1ace544	-3.20	-100.67	-97.47	1	1	CTGATCGACTT
-tig00000001	+	197701	197701	d7bbdb5c-225f-4910-a264-6444e1ace544	-7.34	-117.59	-110.25	1	1	AACATCGGTAG
-tig00000001	+	197719	197719	d7bbdb5c-225f-4910-a264-6444e1ace544	1.32	-101.26	-102.59	1	1	ACCACCGTTAG
-tig00000001	+	197736	197749	d7bbdb5c-225f-4910-a264-6444e1ace544	-23.83	-207.73	-183.90	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	+	197763	197779	d7bbdb5c-225f-4910-a264-6444e1ace544	-11.13	-202.17	-191.04	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	+	197791	197816	d7bbdb5c-225f-4910-a264-6444e1ace544	-20.68	-279.77	-259.09	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	+	197837	197837	d7bbdb5c-225f-4910-a264-6444e1ace544	-4.25	-108.46	-104.21	1	1	TGGAGCGACTG
-tig00000001	+	197848	197856	d7bbdb5c-225f-4910-a264-6444e1ace544	-19.41	-169.31	-149.89	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	+	197868	197878	d7bbdb5c-225f-4910-a264-6444e1ace544	-11.94	-180.69	-168.75	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	+	197895	197906	d7bbdb5c-225f-4910-a264-6444e1ace544	-12.43	-177.35	-164.91	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	+	197921	197921	d7bbdb5c-225f-4910-a264-6444e1ace544	-10.66	-142.87	-132.20	1	1	GCCAGCGAAGC
-tig00000001	+	197935	197948	d7bbdb5c-225f-4910-a264-6444e1ace544	-17.32	-255.30	-237.98	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	+	197960	197969	d7bbdb5c-225f-4910-a264-6444e1ace544	-14.03	-163.99	-149.97	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	+	197982	197999	d7bbdb5c-225f-4910-a264-6444e1ace544	1.88	-203.51	-205.39	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	+	198014	198014	d7bbdb5c-225f-4910-a264-6444e1ace544	-4.80	-110.88	-106.09	1	1	GGTGCCGGTTT
-tig00000001	+	198035	198051	d7bbdb5c-225f-4910-a264-6444e1ace544	-28.58	-207.61	-179.03	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	+	198064	198068	d7bbdb5c-225f-4910-a264-6444e1ace544	-15.34	-161.29	-145.95	1	2	CTGCACGTCCGCTGG
-tig00000001	+	198087	198089	d7bbdb5c-225f-4910-a264-6444e1ace544	-11.95	-105.02	-93.06	1	2	ACATTCGCGCCTA
-tig00000001	+	198100	198123	d7bbdb5c-225f-4910-a264-6444e1ace544	-7.56	-214.96	-207.40	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	+	198137	198137	d7bbdb5c-225f-4910-a264-6444e1ace544	-5.17	-98.38	-93.21	1	1	CAGGCCGCCAA
-tig00000001	+	198171	198171	d7bbdb5c-225f-4910-a264-6444e1ace544	-1.66	-129.80	-128.14	1	1	AGCAGCGCCAC
-tig00000001	+	198183	198188	d7bbdb5c-225f-4910-a264-6444e1ace544	-5.28	-118.66	-113.38	1	2	AGTACCGTTACGCTGA
-tig00000001	+	198203	198233	d7bbdb5c-225f-4910-a264-6444e1ace544	-19.71	-270.02	-250.32	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	+	198250	198250	d7bbdb5c-225f-4910-a264-6444e1ace544	-2.71	-110.79	-108.08	1	1	AAAGACGATAG
-tig00000001	+	198289	198313	d7bbdb5c-225f-4910-a264-6444e1ace544	-16.98	-253.36	-236.38	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	+	198326	198336	d7bbdb5c-225f-4910-a264-6444e1ace544	-9.28	-153.71	-144.43	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	+	198352	198364	d7bbdb5c-225f-4910-a264-6444e1ace544	-14.25	-165.30	-151.05	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	+	198399	198415	d7bbdb5c-225f-4910-a264-6444e1ace544	-24.17	-227.36	-203.19	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	+	198427	198485	d7bbdb5c-225f-4910-a264-6444e1ace544	-63.91	-499.93	-436.02	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	+	198513	198513	d7bbdb5c-225f-4910-a264-6444e1ace544	-7.13	-104.49	-97.36	1	1	ACCATCGCAGG
-tig00000001	+	198527	198527	d7bbdb5c-225f-4910-a264-6444e1ace544	-9.43	-97.18	-87.76	1	1	AATATCGCCAG
-tig00000001	+	198545	198569	d7bbdb5c-225f-4910-a264-6444e1ace544	-7.92	-218.92	-211.00	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	+	198585	198619	d7bbdb5c-225f-4910-a264-6444e1ace544	-38.54	-297.86	-259.31	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	+	198660	198670	d7bbdb5c-225f-4910-a264-6444e1ace544	-14.51	-170.62	-156.11	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	+	198684	198710	d7bbdb5c-225f-4910-a264-6444e1ace544	-18.61	-215.84	-197.23	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	+	198728	198782	d7bbdb5c-225f-4910-a264-6444e1ace544	-47.58	-408.46	-360.87	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	+	198812	198821	d7bbdb5c-225f-4910-a264-6444e1ace544	-14.87	-161.44	-146.57	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	+	198834	198855	d7bbdb5c-225f-4910-a264-6444e1ace544	-20.03	-219.04	-199.02	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	+	198872	198872	d7bbdb5c-225f-4910-a264-6444e1ace544	-4.25	-109.88	-105.63	1	1	TTCACCGCTTC
-tig00000001	+	198884	198892	d7bbdb5c-225f-4910-a264-6444e1ace544	2.93	-148.04	-150.97	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	+	198907	198914	d7bbdb5c-225f-4910-a264-6444e1ace544	-8.42	-153.18	-144.77	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	+	198927	198927	d7bbdb5c-225f-4910-a264-6444e1ace544	-0.62	-99.77	-99.15	1	1	GTTTACGACTC
-tig00000001	+	198972	198987	d7bbdb5c-225f-4910-a264-6444e1ace544	-10.12	-216.13	-206.01	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	+	199013	199013	d7bbdb5c-225f-4910-a264-6444e1ace544	-6.79	-116.21	-109.42	1	1	CAGTGCGCCAA
-tig00000001	+	199028	199034	d7bbdb5c-225f-4910-a264-6444e1ace544	-6.00	-132.24	-126.25	1	2	CAACACGGTGCCGATTA
-tig00000001	+	199056	199088	d7bbdb5c-225f-4910-a264-6444e1ace544	-24.87	-307.84	-282.97	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	+	199112	199117	d7bbdb5c-225f-4910-a264-6444e1ace544	-9.62	-158.55	-148.93	1	2	ACCAGCGAACCGGCAA
-tig00000001	+	199133	199133	d7bbdb5c-225f-4910-a264-6444e1ace544	-3.55	-104.50	-100.95	1	1	ATCACCGGGAT
-tig00000001	+	199147	199156	d7bbdb5c-225f-4910-a264-6444e1ace544	-11.04	-176.24	-165.20	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	+	199172	199172	d7bbdb5c-225f-4910-a264-6444e1ace544	-4.48	-102.04	-97.56	1	1	CAGAACGCCAG
-tig00000001	+	199193	199193	d7bbdb5c-225f-4910-a264-6444e1ace544	-5.31	-107.98	-102.67	1	1	CAGAACGGAGA
-tig00000001	+	199204	199228	d7bbdb5c-225f-4910-a264-6444e1ace544	-12.15	-237.08	-224.94	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	+	199240	199255	d7bbdb5c-225f-4910-a264-6444e1ace544	-4.37	-170.76	-166.39	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	+	199267	199267	d7bbdb5c-225f-4910-a264-6444e1ace544	-12.15	-143.29	-131.14	1	1	CACTTCGCTAA
-tig00000001	+	199280	199280	d7bbdb5c-225f-4910-a264-6444e1ace544	-12.26	-120.68	-108.42	1	1	CCATGCGGGCC
-tig00000001	+	199300	199336	d7bbdb5c-225f-4910-a264-6444e1ace544	-30.10	-310.29	-280.19	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	+	199352	199355	d7bbdb5c-225f-4910-a264-6444e1ace544	-9.00	-113.23	-104.23	1	2	ACCAGCGTCGGGGT
-tig00000001	+	199393	199402	d7bbdb5c-225f-4910-a264-6444e1ace544	-13.49	-168.34	-154.85	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	+	199423	199430	d7bbdb5c-225f-4910-a264-6444e1ace544	-5.32	-137.94	-132.63	1	2	TATTCCGGTGTACGACCA
-tig00000001	+	199446	199446	d7bbdb5c-225f-4910-a264-6444e1ace544	0.63	-95.79	-96.42	1	1	CAGCCCGGCAA
-tig00000001	+	199459	199459	d7bbdb5c-225f-4910-a264-6444e1ace544	-4.68	-80.53	-75.85	1	1	AACACCGCCAG
-tig00000001	+	199485	199485	d7bbdb5c-225f-4910-a264-6444e1ace544	-2.75	-101.80	-99.05	1	1	CATGCCGTAAA
-tig00000001	+	199500	199509	d7bbdb5c-225f-4910-a264-6444e1ace544	-19.51	-161.24	-141.73	1	3	AGAACCGACACCGCCGAACA
-tig00000001	+	199543	199543	d7bbdb5c-225f-4910-a264-6444e1ace544	-11.70	-111.65	-99.95	1	1	CACATCGGCAC
-tig00000001	+	199557	199570	d7bbdb5c-225f-4910-a264-6444e1ace544	-15.08	-162.06	-146.98	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	+	199582	199593	d7bbdb5c-225f-4910-a264-6444e1ace544	-10.04	-186.26	-176.23	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	+	199606	199621	d7bbdb5c-225f-4910-a264-6444e1ace544	-15.87	-198.45	-182.58	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	+	199644	199652	d7bbdb5c-225f-4910-a264-6444e1ace544	-21.83	-164.11	-142.29	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	+	199687	199687	d7bbdb5c-225f-4910-a264-6444e1ace544	-2.60	-108.52	-105.93	1	1	CTGTCCGTGCC
-tig00000001	+	199740	199746	d7bbdb5c-225f-4910-a264-6444e1ace544	-8.80	-143.27	-134.47	1	2	CACCACGCCTACGCAGA
-tig00000001	+	199770	199770	d7bbdb5c-225f-4910-a264-6444e1ace544	-6.16	-106.45	-100.29	1	1	GACATCGCCCA
-tig00000001	+	199786	199802	d7bbdb5c-225f-4910-a264-6444e1ace544	-8.48	-198.64	-190.16	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	+	199833	199836	d7bbdb5c-225f-4910-a264-6444e1ace544	-8.10	-103.70	-95.60	1	2	CACAGCGCCGTTGG
-tig00000001	+	199854	199854	d7bbdb5c-225f-4910-a264-6444e1ace544	-16.08	-153.07	-136.99	1	1	AAGATCGCCAG
-tig00000001	+	199868	199868	d7bbdb5c-225f-4910-a264-6444e1ace544	-3.18	-121.27	-118.09	1	1	CTGCACGAAGT
-tig00000001	+	199883	199883	d7bbdb5c-225f-4910-a264-6444e1ace544	-7.77	-113.38	-105.61	1	1	CAGTGCGGTTG
-tig00000001	+	199899	199908	d7bbdb5c-225f-4910-a264-6444e1ace544	-8.26	-112.21	-103.95	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	+	199931	199943	d7bbdb5c-225f-4910-a264-6444e1ace544	-18.08	-177.11	-159.03	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	+	199956	199956	d7bbdb5c-225f-4910-a264-6444e1ace544	-0.13	-99.59	-99.46	1	1	TTGATCGCTTC
-tig00000001	+	199998	199998	d7bbdb5c-225f-4910-a264-6444e1ace544	-4.95	-139.32	-134.38	1	1	TGTTGCGCTCC
 tig00000001	+	200009	200009	d7bbdb5c-225f-4910-a264-6444e1ace544	-10.57	-135.24	-124.67	1	1	TTCAACGGTAT
 tig00000001	+	200046	200046	d7bbdb5c-225f-4910-a264-6444e1ace544	-8.19	-115.17	-106.98	1	1	TGCAGCGCACC
 tig00000001	+	200081	200081	d7bbdb5c-225f-4910-a264-6444e1ace544	-5.86	-108.91	-103.05	1	1	AACAACGCCAC
 tig00000001	+	200105	200122	d7bbdb5c-225f-4910-a264-6444e1ace544	-20.87	-217.32	-196.45	1	3	CATAACGTGATGCGTAGCAGATCGACCC
 tig00000001	+	200137	200141	d7bbdb5c-225f-4910-a264-6444e1ace544	-4.81	-136.75	-131.94	1	2	ATTCCCGAGCGTGCT
-tig00000001	+	197309	197321	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-11.40	-206.09	-194.69	1	3	TTGCCCGCCTCTTTCGCCGCCTG
-tig00000001	+	197332	197350	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-11.10	-187.27	-176.17	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	+	197363	197420	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-28.30	-420.57	-392.27	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	+	197433	197433	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	0.11	-115.27	-115.39	1	1	ACTGACGGATC
-tig00000001	+	197456	197470	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-9.13	-190.92	-181.78	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	+	197482	197509	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-13.12	-257.19	-244.07	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	+	197520	197530	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-4.52	-160.97	-156.45	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	+	197543	197543	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.83	-91.51	-88.68	1	1	ATCACCGTTTT
-tig00000001	+	197562	197577	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-4.86	-194.68	-189.82	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	+	197590	197599	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.67	-138.99	-136.32	1	2	AATACCGCCTTTGACGATAT
-tig00000001	+	197612	197620	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-4.61	-143.85	-139.25	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	+	197631	197631	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-3.75	-116.68	-112.93	1	1	GCACACGAGAA
-tig00000001	+	197654	197657	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-4.10	-130.06	-125.96	1	2	ACCAGCGGCGTGGC
-tig00000001	+	197670	197672	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-13.38	-151.32	-137.94	1	2	CCTGACGCGCAAC
-tig00000001	+	197683	197683	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-4.66	-110.30	-105.64	1	1	CTGATCGACTT
-tig00000001	+	197701	197701	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.31	-109.04	-108.72	1	1	AACATCGGTAG
-tig00000001	+	197719	197719	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-1.49	-109.27	-107.78	1	1	ACCACCGTTAG
-tig00000001	+	197736	197749	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-3.62	-187.86	-184.25	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	+	197763	197779	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-1.05	-209.95	-208.90	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	+	197791	197816	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-6.28	-272.19	-265.91	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	+	197837	197837	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-6.85	-129.49	-122.64	1	1	TGGAGCGACTG
-tig00000001	+	197848	197856	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-10.34	-187.76	-177.42	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	+	197868	197878	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-3.29	-182.67	-179.38	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	+	197895	197906	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-3.56	-195.63	-192.07	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	+	197921	197921	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	0.54	-99.59	-100.14	1	1	GCCAGCGAAGC
-tig00000001	+	197935	197948	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-8.49	-186.96	-178.47	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	+	197960	197969	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-4.94	-156.76	-151.82	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	+	197982	197999	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-7.62	-233.26	-225.65	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	+	198014	198014	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	2.43	-98.65	-101.08	1	1	GGTGCCGGTTT
-tig00000001	+	198035	198051	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-6.78	-199.45	-192.67	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	+	198064	198068	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-4.38	-123.31	-118.93	1	2	CTGCACGTCCGCTGG
-tig00000001	+	198087	198089	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-4.21	-102.10	-97.88	1	2	ACATTCGCGCCTA
-tig00000001	+	198100	198123	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-10.69	-234.83	-224.14	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	+	198137	198137	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.82	-107.01	-106.19	1	1	CAGGCCGCCAA
-tig00000001	+	198171	198171	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.43	-125.07	-122.64	1	1	AGCAGCGCCAC
-tig00000001	+	198183	198188	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	0.18	-130.56	-130.74	1	2	AGTACCGTTACGCTGA
-tig00000001	+	198203	198233	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-7.93	-252.77	-244.85	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	+	198250	198250	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-4.10	-130.71	-126.62	1	1	AAAGACGATAG
-tig00000001	+	198289	198313	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-11.74	-235.88	-224.13	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	+	198326	198336	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	1.90	-163.03	-164.93	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	+	198352	198364	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-5.62	-179.39	-173.77	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	+	198399	198415	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-15.84	-226.67	-210.83	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	+	198427	198485	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-19.11	-429.81	-410.70	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	+	198513	198513	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.19	-112.47	-110.28	1	1	ACCATCGCAGG
-tig00000001	+	198527	198527	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	1.89	-113.79	-115.67	1	1	AATATCGCCAG
-tig00000001	+	198545	198569	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-15.35	-266.25	-250.91	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	+	198585	198619	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-16.37	-278.11	-261.74	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	+	198660	198670	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-8.60	-145.74	-137.14	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	+	198684	198710	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-8.36	-224.18	-215.82	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	+	198728	198782	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-19.97	-407.87	-387.90	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	+	198812	198821	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-8.89	-166.60	-157.71	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	+	198834	198855	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-6.10	-186.33	-180.24	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	+	198872	198872	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-3.91	-111.09	-107.18	1	1	TTCACCGCTTC
-tig00000001	+	198884	198892	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-1.69	-178.51	-176.81	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	+	198907	198914	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.12	-203.31	-201.18	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	+	198927	198927	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-1.85	-93.14	-91.29	1	1	GTTTACGACTC
-tig00000001	+	198972	198987	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-4.87	-315.42	-310.56	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	+	199013	199013	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.39	-147.52	-147.12	1	1	CAGTGCGCCAA
-tig00000001	+	199028	199034	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-1.49	-159.54	-158.06	1	2	CAACACGGTGCCGATTA
-tig00000001	+	199056	199088	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.71	-196.20	-193.49	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	+	199133	199133	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	2.27	-147.78	-150.05	1	1	ATCACCGGGAT
-tig00000001	+	199147	199156	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.05	-189.99	-189.94	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	+	199172	199172	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.24	-178.39	-178.15	1	1	CAGAACGCCAG
-tig00000001	+	199193	199193	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.03	-217.01	-216.98	1	1	CAGAACGGAGA
-tig00000001	+	199204	199228	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-1.04	-387.32	-386.28	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	+	199240	199255	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-14.54	-615.54	-600.99	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	+	199267	199267	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.41	-161.98	-161.57	1	1	CACTTCGCTAA
-tig00000001	+	199280	199280	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.38	-153.58	-151.20	1	1	CCATGCGGGCC
-tig00000001	+	199300	199336	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-18.52	-487.00	-468.47	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	+	199352	199355	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-3.18	-221.25	-218.07	1	2	ACCAGCGTCGGGGT
-tig00000001	+	199393	199402	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-6.51	-259.34	-252.83	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	+	199423	199430	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.90	-186.11	-185.20	1	2	TATTCCGGTGTACGACCA
-tig00000001	+	199446	199446	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	1.25	-260.69	-261.94	1	1	CAGCCCGGCAA
-tig00000001	+	199459	199459	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-4.32	-242.26	-237.94	1	1	AACACCGCCAG
-tig00000001	+	199485	199485	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.86	-148.79	-147.93	1	1	CATGCCGTAAA
-tig00000001	+	199500	199509	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-14.45	-184.49	-170.04	1	3	AGAACCGACACCGCCGAACA
-tig00000001	+	199543	199543	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-3.04	-187.24	-184.20	1	1	CACATCGGCAC
-tig00000001	+	199557	199570	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-6.95	-252.72	-245.77	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	+	199582	199593	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-12.33	-239.44	-227.11	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	+	199606	199621	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-10.89	-265.36	-254.47	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	+	199644	199652	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-11.79	-221.62	-209.83	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	+	199687	199687	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.07	-139.11	-139.04	1	1	CTGTCCGTGCC
-tig00000001	+	199740	199746	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-6.03	-159.30	-153.28	1	2	CACCACGCCTACGCAGA
-tig00000001	+	199770	199770	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.63	-118.35	-117.72	1	1	GACATCGCCCA
-tig00000001	+	199786	199802	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-12.98	-211.98	-199.00	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	+	199833	199836	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.67	-146.37	-143.70	1	2	CACAGCGCCGTTGG
-tig00000001	+	199854	199854	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.65	-84.52	-83.87	1	1	AAGATCGCCAG
-tig00000001	+	199868	199868	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-5.13	-145.08	-139.95	1	1	CTGCACGAAGT
-tig00000001	+	199883	199883	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-4.08	-96.30	-92.21	1	1	CAGTGCGGTTG
-tig00000001	+	199899	199908	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-7.60	-138.57	-130.97	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	+	199931	199943	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-9.30	-189.10	-179.81	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	+	199956	199956	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-7.47	-129.02	-121.54	1	1	TTGATCGCTTC
-tig00000001	+	199998	199998	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.90	-117.05	-114.15	1	1	TGTTGCGCTCC
 tig00000001	+	200009	200009	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-1.55	-127.87	-126.32	1	1	TTCAACGGTAT
 tig00000001	+	200046	200046	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-1.87	-102.29	-100.42	1	1	TGCAGCGCACC
 tig00000001	+	200081	200081	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-6.75	-119.53	-112.77	1	1	AACAACGCCAC
@@ -6125,227 +932,6 @@
 tig00000001	+	201922	201930	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-6.10	-146.53	-140.43	1	2	GTCACCGGCTGGCCGCACT
 tig00000001	+	201944	201950	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-7.79	-137.15	-129.36	1	2	GCAGGCGCTGCCGGAAG
 tig00000001	+	201961	201986	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-6.14	-262.35	-256.21	1	4	AACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAA
-tig00000001	+	201998	202007	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	2.16	-185.33	-187.49	1	2	CAGTCCGCAGGGGCCGTGGT
-tig00000001	+	202020	202020	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-6.22	-159.87	-153.65	1	1	CTGCTCGGCTG
-tig00000001	+	202033	202046	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-3.69	-158.74	-155.05	1	3	GTGAGCGGGTGCCGGAAGCGGATG
-tig00000001	+	202064	202081	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-17.20	-220.47	-203.27	1	5	GCCTGCGCCGCTGCCGCCGTACCGGGTA
-tig00000001	+	202092	202092	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	0.61	-105.55	-106.16	1	1	CTGACCGGGCT
-tig00000001	+	202105	202143	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-18.83	-291.73	-272.90	1	8	TGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGA
-tig00000001	+	202155	202198	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-18.95	-353.69	-334.75	1	8	TTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTG
-tig00000001	+	202214	202225	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-5.59	-160.93	-155.35	1	3	GACCACGCAGGCGCAGCGGGCA
-tig00000001	+	202240	202240	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-4.25	-100.51	-96.26	1	1	AAGCCCGGCAG
-tig00000001	+	202257	202275	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-9.73	-188.00	-178.27	1	5	ATTTCCGGCGGGACGGAACCGTCCGCTTT
-tig00000001	+	202295	202330	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-11.34	-370.01	-358.67	1	5	CCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTG
-tig00000001	+	202341	202341	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	0.85	-116.59	-117.44	1	1	TCTGCCGTGTG
-tig00000001	+	202352	202370	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-12.67	-182.71	-170.04	1	4	GCTGACGCACGACCCGGAATACCCGGAGA
-tig00000001	+	202386	202399	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-9.26	-164.18	-154.92	1	4	CCTGCCGCGCCGCTGGTGCGCTAT
-tig00000001	+	202412	202432	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-16.06	-238.91	-222.85	1	6	CTGGACGCCCGCGGCGAACTGGCGGCGGTGT
-tig00000001	+	202443	202443	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	1.40	-118.99	-120.38	1	1	ATGACCGCAGC
-tig00000001	+	202461	202461	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.32	-109.51	-107.19	1	1	AGGTGCGCAGC
-tig00000001	+	202475	202475	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-3.54	-122.76	-119.22	1	1	ACTTACGATGA
-tig00000001	+	202488	202525	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-5.43	-300.10	-294.67	1	7	AATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAA
-tig00000001	+	202539	202557	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-13.40	-202.27	-188.88	1	5	GTTACCGTTACGACAGCGACGGGCGGGTG
-tig00000001	+	202579	202579	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	1.02	-107.91	-108.92	1	1	AAACCCGGCAG
-tig00000001	+	202597	202597	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.72	-139.19	-136.47	1	1	TTACACGTATC
-tig00000001	+	202617	202617	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-4.38	-111.53	-107.15	1	1	AGGACCGCATC
-tig00000001	+	202631	202631	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	0.63	-107.93	-108.56	1	1	ATCACCGACAG
-tig00000001	+	202644	202647	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-4.53	-117.35	-112.82	1	2	TGAACCGCCGTGAA
-tig00000001	+	202663	202663	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-4.15	-104.18	-100.03	1	1	GCACACGCAGG
-tig00000001	+	202676	202686	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.76	-169.22	-166.46	1	2	GAAGGCGGGCTGAAGCGGGTG
-tig00000001	+	202705	202722	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.04	-185.32	-183.27	1	5	GAACACGCGGACGGCAGCGTCACGCAGA
-tig00000001	+	202738	202740	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.63	-133.01	-130.38	1	2	TTTGACGCGGTGG
-tig00000001	+	202764	202771	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-1.75	-127.25	-125.50	1	2	ACAGACGGATGCCGCAGG
-tig00000001	+	202797	202797	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.16	-109.79	-109.64	1	1	CAGTCCGGATG
-tig00000001	+	202809	202809	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.59	-135.48	-134.89	1	1	GGTGACGGGCC
-tig00000001	+	202821	202836	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-10.42	-245.18	-234.76	1	4	CATCACGCGCATCACCACGCCGGATG
-tig00000001	+	202851	202854	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-7.75	-133.32	-125.58	1	2	GGCATCGGCGTTTT
-tig00000001	+	202884	202903	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	0.09	-221.58	-221.67	1	3	GTTAACGTCAGCCACCGGGCCTGACGGGCT
-tig00000001	+	202916	202919	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-4.11	-159.31	-155.21	1	2	AAATACGCCGGGAA
-tig00000001	+	202940	202940	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	0.21	-86.02	-86.23	1	1	GGGGCCGTCTG
-tig00000001	+	202966	202985	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	2.96	-222.41	-225.37	1	4	CCTGACGGCGATATCACCCGCTACCGTTAT
-tig00000001	+	203017	203022	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-10.44	-120.50	-110.06	1	2	CCCTGCGCAACGGAAG
-tig00000001	+	203035	203042	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-1.50	-133.47	-131.97	1	2	GCCACCGGCAGCCGGAAA
-tig00000001	+	203055	203068	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.62	-181.51	-178.89	1	3	CATGACGTGGAGCCGTTACGGTCA
-tig00000001	+	203098	203098	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	2.24	-137.09	-139.32	1	1	TGTTCCGGTTA
-tig00000001	+	203111	203111	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-3.11	-108.32	-105.21	1	1	TAACCCGCTAT
-tig00000001	+	203126	203126	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.53	-109.36	-108.83	1	1	ATGACCGTTTT
-tig00000001	+	203142	203155	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-15.86	-187.21	-171.34	1	4	GGTGACGGCGGTGCACCGCGAGGA
-tig00000001	+	203177	203192	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-4.41	-197.17	-192.76	1	4	AGTACCGCGCATACGACAGCCGTGGA
-tig00000001	+	203209	203209	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.38	-96.08	-95.69	1	1	ATTGCCGTGAA
-tig00000001	+	203220	203220	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-5.59	-130.26	-124.68	1	1	AGACACGCAGG
-tig00000001	+	203235	203237	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.02	-110.74	-110.72	1	2	TGAAACGCGGTAT
-tig00000001	+	203251	203257	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-11.94	-144.32	-132.38	1	3	TACAACGCCGCCGGTGA
-tig00000001	+	203272	203272	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-3.94	-126.56	-122.62	1	1	ACCACCGTCAT
-tig00000001	+	203283	203287	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.22	-124.52	-124.29	1	2	TGCCCCGGACGGCAG
-tig00000001	+	203299	203299	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-6.69	-111.21	-104.52	1	1	AGAAACGGGAC
-tig00000001	+	203311	203316	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-3.32	-142.46	-139.14	1	2	CAGTACGATGCGTGGG
-tig00000001	+	203340	203357	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-24.10	-215.27	-191.17	1	4	TACCACGCAGGGCGGTCTGACGCGCAGT
-tig00000001	+	203371	203393	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-8.90	-220.90	-211.99	1	4	GAATACGATGCTGCCGGACGGGTCATCCGCCTG
-tig00000001	+	203410	203410	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-5.38	-103.96	-98.58	1	1	GAAAACGGCAG
-tig00000001	+	203429	203447	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-13.33	-208.98	-195.66	1	4	CCTTCCGTTACGATGTACTCGACCGGCTG
-tig00000001	+	203464	203486	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-3.37	-231.80	-228.43	1	4	GAAACCGGCTTTGACGGCCGCACACAGCGTTAT
-tig00000001	+	203497	203506	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-3.15	-180.90	-177.75	1	2	CACCACGACCTGACCGGCAA
-tig00000001	+	203519	203524	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	0.09	-134.62	-134.71	1	2	TTATCCGCAGCGAGGA
-tig00000001	+	203560	203609	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-25.53	-396.69	-371.16	1	8	TATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGG
-tig00000001	+	203623	203629	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	0.36	-134.59	-134.95	1	3	TATGACGAACGCGGCTG
-tig00000001	+	203659	203676	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-5.91	-195.29	-189.38	1	3	ATCAGCGAAGGGCACCGGGTGACGGTGC
-tig00000001	+	203705	203710	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	0.40	-172.04	-172.44	1	2	AAGGCCGCCTCGCCAG
-tig00000001	+	203727	203727	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.90	-113.81	-112.90	1	1	CCTGACGGTGC
-tig00000001	+	203739	203745	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-6.40	-126.34	-119.94	1	2	TCATCCGCAGACGAATG
-tig00000001	+	203781	203788	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-3.57	-178.44	-174.88	1	2	ACATGCGTACAACGCACA
-tig00000001	+	203802	203817	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-7.82	-203.80	-195.98	1	3	ACTGGCGAACCGCTGTATACCGGACA
-tig00000001	+	203830	203833	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.31	-151.71	-149.40	1	2	CTGCCCGCCGTGGA
-tig00000001	+	203851	203857	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.27	-152.15	-149.88	1	2	ACCTACGGCAGCGGCTG
-tig00000001	+	203881	203892	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-1.56	-202.05	-200.49	1	3	AAACTCGGCGACACACCGCTGG
-tig00000001	+	203909	203948	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-25.46	-283.94	-258.48	1	8	ACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTAT
-tig00000001	+	203965	203965	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-3.30	-105.92	-102.62	1	1	ACCACCGCTTA
-tig00000001	+	203980	203980	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.79	-126.83	-124.04	1	1	CCTGCCGGGCA
-tig00000001	+	204023	204025	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-1.28	-152.99	-151.71	1	2	CTGACCGCGATTA
-tig00000001	+	204040	204059	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-13.50	-223.51	-210.01	1	4	TGGAACGACAACGGCGAACTCATCCGCATC
-tig00000001	+	204072	204083	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-9.37	-160.75	-151.38	1	3	CAGCCCGCGCCAGACCCGGAGT
-tig00000001	+	204106	204106	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.69	-118.38	-115.69	1	1	ACCACCGGCAG
-tig00000001	+	204118	204121	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-8.08	-114.30	-106.22	1	2	CTGACCGGCGTTCA
-tig00000001	+	204133	204138	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-7.13	-124.23	-117.10	1	2	ACCACCGCAGCGAATC
-tig00000001	+	204152	204159	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-4.39	-156.45	-152.07	1	2	ATATCCGCATCCCGTATA
-tig00000001	+	204174	204174	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.04	-129.65	-129.61	1	1	AGACCCGGCAG
-tig00000001	+	204185	204198	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-3.04	-185.18	-182.15	1	3	GTAACCGCCTGCCCGACCCGGAGC
-tig00000001	+	204210	204217	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-4.36	-153.10	-148.74	1	2	GCACCCGGACAGCGCCCT
-tig00000001	+	204234	204258	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-17.19	-234.93	-217.74	1	6	GTGGCCGGATAACCGTATCGCCCGTGACGCGCACT
-tig00000001	+	204272	204286	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-6.74	-159.73	-152.99	1	3	TTTACCGGTATGACCGTCACGGCAG
-tig00000001	+	204307	204307	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.24	-121.75	-121.51	1	1	AAAACCGACCT
-tig00000001	+	204318	204318	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	1.62	-131.59	-133.21	1	1	CATCCCGGAAG
-tig00000001	+	204331	204335	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.30	-146.79	-144.50	1	2	TTATCCGCACGGATG
-tig00000001	+	204346	204355	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-10.00	-166.37	-156.37	1	2	ATGAGCGCACCCACCGGTAC
-tig00000001	+	204366	204366	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.17	-129.70	-129.54	1	1	CATTACGACAG
-tig00000001	+	204379	204379	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-5.18	-118.73	-113.55	1	1	AGCACCGGCTG
-tig00000001	+	204395	204397	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.13	-144.91	-144.78	1	2	CTACACGCGGACA
-tig00000001	+	204416	204430	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-5.61	-192.09	-186.48	1	3	AGAGCCGCTGGTCGAAAGTCGCTAT
-tig00000001	+	204441	204454	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-13.50	-253.27	-239.77	1	3	CTTTACGACCCGCTGGGCCGCAGG
-tig00000001	+	204469	204497	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-10.20	-263.23	-253.03	1	5	CAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCT
-tig00000001	+	204509	204524	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-11.96	-218.65	-206.69	1	3	GATGTCGCTGTCACGGAAACCGCAAG
-tig00000001	+	204540	204596	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-33.12	-402.67	-369.55	1	8	TGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTT
-tig00000001	+	204608	204608	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.59	-91.66	-91.07	1	1	TCAGCCGGGGA
-tig00000001	+	204620	204620	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-6.14	-133.51	-127.37	1	1	CTTCACGCCAC
-tig00000001	+	204642	204648	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.01	-113.68	-111.67	1	2	GAAACCGCCACCGGTGA
-tig00000001	+	204659	204683	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-6.98	-200.87	-193.89	1	5	GCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATA
-tig00000001	+	204702	204714	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-1.89	-173.10	-171.21	1	3	CAGTCCGGTGGCGAAGACGGTGG
-tig00000001	+	204734	204737	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-7.65	-112.69	-105.04	1	2	GTTCCCGCCGGTGC
-tig00000001	+	204756	204760	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-1.63	-127.82	-126.19	1	2	ATGCTCGACCGGCTG
-tig00000001	+	204787	204787	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	3.44	-101.49	-104.92	1	1	CTGACCGGGTG
-tig00000001	+	204805	204808	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-1.51	-106.66	-105.15	1	2	AAAGCCGCCGCTGG
-tig00000001	+	204821	204839	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-5.74	-243.01	-237.28	1	4	GGCATCGTGCGGCCTGACGGTGGCGCAGA
-tig00000001	+	204863	204880	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-4.10	-316.85	-312.76	1	5	GGACCCGGTATACACGCCGGCGCGAAAA
-tig00000001	+	204903	204920	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-7.97	-1205.60	-1197.63	1	4	CACTGCGACCATCGCGGCCTGCCGCTGG
-tig00000001	+	204938	204938	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.95	-142.24	-139.30	1	1	CAGCACGGAAG
-tig00000001	+	204953	204969	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-10.23	-232.24	-222.01	1	3	AACAGCGTGGTACGCAGAATACGATGA
-tig00000001	+	205004	205004	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-1.41	-101.80	-100.39	1	1	GAACCCGCATC
-tig00000001	+	205027	205034	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-1.77	-189.46	-187.69	1	2	TTATCCGCCTGCCGGGGC
-tig00000001	+	205059	205059	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-1.52	-103.93	-102.41	1	1	GAGTCCGGCCT
-tig00000001	+	205075	205081	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-9.22	-142.61	-133.39	1	2	ACAACCGCCACCGCTAT
-tig00000001	+	205094	205094	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.28	-100.10	-97.82	1	1	TGACCCGCTGC
-tig00000001	+	205105	205105	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-3.43	-153.67	-150.24	1	1	AGGGGCGATAT
-tig00000001	+	205124	205124	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.59	-150.36	-149.77	1	1	GGATCCGATTG
-tig00000001	+	205161	205170	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	1.60	-150.02	-151.62	1	2	GTATCCGTTGAATCCGATCT
-tig00000001	+	205237	205237	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-1.86	-118.79	-116.93	1	1	ATGGGCGGAAC
-tig00000001	+	205255	205255	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	0.32	-152.67	-152.99	1	1	AGAAGCGGTCC
-tig00000001	+	205277	205277	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.28	-105.43	-105.15	1	1	GAATCCGTTCT
-tig00000001	+	205344	205344	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-1.29	-87.42	-86.13	1	1	ACCAACGGGGA
-tig00000001	+	205415	205415	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-0.02	-121.02	-121.01	1	1	CTGGCCGTTGT
-tig00000001	+	205426	205435	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-1.61	-182.42	-180.82	1	2	GACCTCGTTGAAACCGATAA
-tig00000001	+	205487	205489	70a6e1ac-2b52-46e4-83ac-0a49cdc637d4	-2.45	-113.90	-111.45	1	2	AAGGCCGCGTTAT
-tig00000001	+	197332	197350	88b1797f-3a41-442f-bab4-cdfedf7ec597	-21.38	-202.03	-180.65	1	4	GGTGCCGGAGTTCATCGCCACCGCGACAT
-tig00000001	+	197363	197420	88b1797f-3a41-442f-bab4-cdfedf7ec597	-43.30	-398.65	-355.35	1	10	GCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTG
-tig00000001	+	197433	197433	88b1797f-3a41-442f-bab4-cdfedf7ec597	-3.85	-113.69	-109.84	1	1	ACTGACGGATC
-tig00000001	+	197456	197470	88b1797f-3a41-442f-bab4-cdfedf7ec597	-18.13	-158.27	-140.14	1	4	GCCTCCGGTGTCGCTTCGGCGAGAA
-tig00000001	+	197482	197509	88b1797f-3a41-442f-bab4-cdfedf7ec597	-13.68	-249.32	-235.64	1	6	ATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAG
-tig00000001	+	197520	197530	88b1797f-3a41-442f-bab4-cdfedf7ec597	-13.77	-186.66	-172.89	1	3	TCAGACGGTTATCGCCGGTAA
-tig00000001	+	197543	197543	88b1797f-3a41-442f-bab4-cdfedf7ec597	-5.19	-110.58	-105.39	1	1	ATCACCGTTTT
-tig00000001	+	197562	197577	88b1797f-3a41-442f-bab4-cdfedf7ec597	-11.61	-184.99	-173.38	1	3	TTTTGCGCAGCTGGGCGAAGCGCTCT
-tig00000001	+	197590	197599	88b1797f-3a41-442f-bab4-cdfedf7ec597	-11.13	-143.53	-132.39	1	2	AATACCGCCTTTGACGATAT
-tig00000001	+	197612	197620	88b1797f-3a41-442f-bab4-cdfedf7ec597	-8.50	-110.51	-102.02	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	+	197631	197631	88b1797f-3a41-442f-bab4-cdfedf7ec597	-1.14	-104.72	-103.58	1	1	GCACACGAGAA
-tig00000001	+	197654	197657	88b1797f-3a41-442f-bab4-cdfedf7ec597	-9.97	-141.63	-131.66	1	2	ACCAGCGGCGTGGC
-tig00000001	+	197670	197672	88b1797f-3a41-442f-bab4-cdfedf7ec597	-13.16	-125.66	-112.50	1	2	CCTGACGCGCAAC
-tig00000001	+	197683	197683	88b1797f-3a41-442f-bab4-cdfedf7ec597	-3.14	-89.91	-86.76	1	1	CTGATCGACTT
-tig00000001	+	197701	197701	88b1797f-3a41-442f-bab4-cdfedf7ec597	-14.66	-125.43	-110.77	1	1	AACATCGGTAG
-tig00000001	+	197719	197719	88b1797f-3a41-442f-bab4-cdfedf7ec597	-2.50	-125.55	-123.06	1	1	ACCACCGTTAG
-tig00000001	+	197736	197749	88b1797f-3a41-442f-bab4-cdfedf7ec597	-6.79	-140.37	-133.57	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	+	197763	197779	88b1797f-3a41-442f-bab4-cdfedf7ec597	-3.91	-152.68	-148.77	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	+	197791	197816	88b1797f-3a41-442f-bab4-cdfedf7ec597	-15.89	-246.84	-230.95	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	+	197837	197837	88b1797f-3a41-442f-bab4-cdfedf7ec597	-8.41	-102.89	-94.47	1	1	TGGAGCGACTG
-tig00000001	+	197848	197856	88b1797f-3a41-442f-bab4-cdfedf7ec597	-12.99	-160.19	-147.20	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	+	197868	197878	88b1797f-3a41-442f-bab4-cdfedf7ec597	-7.47	-165.29	-157.82	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	+	197895	197906	88b1797f-3a41-442f-bab4-cdfedf7ec597	-13.18	-128.22	-115.03	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	+	197921	197921	88b1797f-3a41-442f-bab4-cdfedf7ec597	-5.56	-93.57	-88.01	1	1	GCCAGCGAAGC
-tig00000001	+	197935	197948	88b1797f-3a41-442f-bab4-cdfedf7ec597	-7.82	-211.07	-203.24	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	+	197960	197969	88b1797f-3a41-442f-bab4-cdfedf7ec597	-14.64	-140.80	-126.16	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	+	197982	197999	88b1797f-3a41-442f-bab4-cdfedf7ec597	-9.45	-183.21	-173.76	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	+	198014	198014	88b1797f-3a41-442f-bab4-cdfedf7ec597	-0.14	-96.84	-96.70	1	1	GGTGCCGGTTT
-tig00000001	+	198035	198051	88b1797f-3a41-442f-bab4-cdfedf7ec597	-11.85	-160.25	-148.40	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	+	198064	198068	88b1797f-3a41-442f-bab4-cdfedf7ec597	-4.15	-127.37	-123.22	1	2	CTGCACGTCCGCTGG
-tig00000001	+	198087	198089	88b1797f-3a41-442f-bab4-cdfedf7ec597	-9.00	-99.68	-90.68	1	2	ACATTCGCGCCTA
-tig00000001	+	198100	198123	88b1797f-3a41-442f-bab4-cdfedf7ec597	-18.05	-224.37	-206.32	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	+	198137	198137	88b1797f-3a41-442f-bab4-cdfedf7ec597	1.24	-101.83	-103.07	1	1	CAGGCCGCCAA
-tig00000001	+	198171	198171	88b1797f-3a41-442f-bab4-cdfedf7ec597	-3.13	-105.60	-102.47	1	1	AGCAGCGCCAC
-tig00000001	+	198183	198188	88b1797f-3a41-442f-bab4-cdfedf7ec597	-6.64	-138.66	-132.02	1	2	AGTACCGTTACGCTGA
-tig00000001	+	198203	198233	88b1797f-3a41-442f-bab4-cdfedf7ec597	-5.91	-229.72	-223.80	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	+	198250	198250	88b1797f-3a41-442f-bab4-cdfedf7ec597	-14.34	-125.64	-111.31	1	1	AAAGACGATAG
-tig00000001	+	198289	198313	88b1797f-3a41-442f-bab4-cdfedf7ec597	-24.98	-246.96	-221.98	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	+	198326	198336	88b1797f-3a41-442f-bab4-cdfedf7ec597	-4.38	-146.70	-142.32	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	+	198352	198364	88b1797f-3a41-442f-bab4-cdfedf7ec597	-18.22	-168.27	-150.06	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	+	198399	198415	88b1797f-3a41-442f-bab4-cdfedf7ec597	-28.76	-206.76	-178.01	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	+	198427	198485	88b1797f-3a41-442f-bab4-cdfedf7ec597	-49.12	-433.54	-384.42	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	+	198513	198513	88b1797f-3a41-442f-bab4-cdfedf7ec597	-3.54	-120.53	-116.99	1	1	ACCATCGCAGG
-tig00000001	+	198527	198527	88b1797f-3a41-442f-bab4-cdfedf7ec597	-6.12	-117.13	-111.01	1	1	AATATCGCCAG
-tig00000001	+	198545	198569	88b1797f-3a41-442f-bab4-cdfedf7ec597	-23.98	-230.59	-206.61	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	+	198585	198619	88b1797f-3a41-442f-bab4-cdfedf7ec597	-23.09	-260.47	-237.38	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	+	198660	198670	88b1797f-3a41-442f-bab4-cdfedf7ec597	-10.64	-166.06	-155.42	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	+	198684	198710	88b1797f-3a41-442f-bab4-cdfedf7ec597	-14.67	-196.18	-181.51	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	+	198728	198782	88b1797f-3a41-442f-bab4-cdfedf7ec597	-25.19	-378.32	-353.13	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	+	198812	198821	88b1797f-3a41-442f-bab4-cdfedf7ec597	-0.25	-143.08	-142.82	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	+	198834	198855	88b1797f-3a41-442f-bab4-cdfedf7ec597	-11.40	-223.42	-212.02	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	+	198872	198872	88b1797f-3a41-442f-bab4-cdfedf7ec597	-2.98	-110.60	-107.62	1	1	TTCACCGCTTC
-tig00000001	+	198884	198892	88b1797f-3a41-442f-bab4-cdfedf7ec597	-3.25	-157.09	-153.84	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	+	198907	198914	88b1797f-3a41-442f-bab4-cdfedf7ec597	-3.52	-155.88	-152.37	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	+	198927	198927	88b1797f-3a41-442f-bab4-cdfedf7ec597	1.42	-94.58	-96.00	1	1	GTTTACGACTC
-tig00000001	+	198972	198987	88b1797f-3a41-442f-bab4-cdfedf7ec597	-12.31	-204.89	-192.58	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	+	199013	199013	88b1797f-3a41-442f-bab4-cdfedf7ec597	-2.83	-96.90	-94.07	1	1	CAGTGCGCCAA
-tig00000001	+	199028	199034	88b1797f-3a41-442f-bab4-cdfedf7ec597	-5.73	-125.99	-120.25	1	2	CAACACGGTGCCGATTA
-tig00000001	+	199056	199088	88b1797f-3a41-442f-bab4-cdfedf7ec597	-14.15	-270.93	-256.78	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	+	199112	199117	88b1797f-3a41-442f-bab4-cdfedf7ec597	-5.98	-126.20	-120.23	1	2	ACCAGCGAACCGGCAA
-tig00000001	+	199133	199133	88b1797f-3a41-442f-bab4-cdfedf7ec597	-0.69	-90.54	-89.85	1	1	ATCACCGGGAT
-tig00000001	+	199147	199156	88b1797f-3a41-442f-bab4-cdfedf7ec597	-10.59	-148.60	-138.01	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	+	199172	199172	88b1797f-3a41-442f-bab4-cdfedf7ec597	-4.38	-109.15	-104.77	1	1	CAGAACGCCAG
-tig00000001	+	199193	199193	88b1797f-3a41-442f-bab4-cdfedf7ec597	-7.65	-89.29	-81.64	1	1	CAGAACGGAGA
-tig00000001	+	199204	199228	88b1797f-3a41-442f-bab4-cdfedf7ec597	-14.44	-205.54	-191.11	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	+	199240	199255	88b1797f-3a41-442f-bab4-cdfedf7ec597	-15.60	-162.32	-146.71	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	+	199267	199267	88b1797f-3a41-442f-bab4-cdfedf7ec597	-7.55	-108.49	-100.95	1	1	CACTTCGCTAA
-tig00000001	+	199280	199280	88b1797f-3a41-442f-bab4-cdfedf7ec597	-4.17	-115.71	-111.54	1	1	CCATGCGGGCC
-tig00000001	+	199300	199336	88b1797f-3a41-442f-bab4-cdfedf7ec597	-34.00	-295.11	-261.11	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	+	199352	199355	88b1797f-3a41-442f-bab4-cdfedf7ec597	-6.69	-127.28	-120.59	1	2	ACCAGCGTCGGGGT
-tig00000001	+	199393	199402	88b1797f-3a41-442f-bab4-cdfedf7ec597	-16.03	-187.26	-171.23	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	+	199423	199430	88b1797f-3a41-442f-bab4-cdfedf7ec597	-6.83	-132.56	-125.74	1	2	TATTCCGGTGTACGACCA
-tig00000001	+	199446	199446	88b1797f-3a41-442f-bab4-cdfedf7ec597	-0.12	-97.61	-97.49	1	1	CAGCCCGGCAA
-tig00000001	+	199459	199459	88b1797f-3a41-442f-bab4-cdfedf7ec597	-7.84	-163.31	-155.46	1	1	AACACCGCCAG
-tig00000001	+	199485	199485	88b1797f-3a41-442f-bab4-cdfedf7ec597	-8.45	-116.12	-107.67	1	1	CATGCCGTAAA
-tig00000001	+	199500	199509	88b1797f-3a41-442f-bab4-cdfedf7ec597	0.24	-132.35	-132.59	1	3	AGAACCGACACCGCCGAACA
-tig00000001	+	199543	199543	88b1797f-3a41-442f-bab4-cdfedf7ec597	-3.20	-91.16	-87.96	1	1	CACATCGGCAC
-tig00000001	+	199557	199570	88b1797f-3a41-442f-bab4-cdfedf7ec597	-12.82	-160.74	-147.92	1	3	GCCACCGAGAGCGGTAAACGAATC
-tig00000001	+	199582	199593	88b1797f-3a41-442f-bab4-cdfedf7ec597	-16.49	-143.36	-126.87	1	3	TGCATCGCAATCACCGCGCCAC
-tig00000001	+	199606	199621	88b1797f-3a41-442f-bab4-cdfedf7ec597	-10.37	-186.00	-175.63	1	5	GAAGCCGCCGTCGTCACGACCGCAAA
-tig00000001	+	199644	199652	88b1797f-3a41-442f-bab4-cdfedf7ec597	-15.56	-147.31	-131.75	1	3	CAGCACGCCGAAACGGCTC
-tig00000001	+	199687	199687	88b1797f-3a41-442f-bab4-cdfedf7ec597	-2.87	-110.58	-107.72	1	1	CTGTCCGTGCC
-tig00000001	+	199740	199746	88b1797f-3a41-442f-bab4-cdfedf7ec597	-15.96	-170.14	-154.19	1	2	CACCACGCCTACGCAGA
-tig00000001	+	199770	199770	88b1797f-3a41-442f-bab4-cdfedf7ec597	-2.04	-85.35	-83.31	1	1	GACATCGCCCA
-tig00000001	+	199786	199802	88b1797f-3a41-442f-bab4-cdfedf7ec597	-23.10	-209.20	-186.11	1	4	ACATGCGCCCCTGGCGGCGATCGCCCA
-tig00000001	+	199833	199836	88b1797f-3a41-442f-bab4-cdfedf7ec597	-1.37	-97.29	-95.92	1	2	CACAGCGCCGTTGG
-tig00000001	+	199854	199854	88b1797f-3a41-442f-bab4-cdfedf7ec597	-4.44	-138.17	-133.73	1	1	AAGATCGCCAG
-tig00000001	+	199868	199868	88b1797f-3a41-442f-bab4-cdfedf7ec597	-4.57	-127.64	-123.06	1	1	CTGCACGAAGT
-tig00000001	+	199883	199883	88b1797f-3a41-442f-bab4-cdfedf7ec597	-2.84	-124.98	-122.14	1	1	CAGTGCGGTTG
-tig00000001	+	199899	199908	88b1797f-3a41-442f-bab4-cdfedf7ec597	-17.28	-147.68	-130.40	1	3	TCAAACGGATGCGACGAGTT
-tig00000001	+	199931	199943	88b1797f-3a41-442f-bab4-cdfedf7ec597	-5.74	-147.78	-142.05	1	3	GCCACCGCCGTTAGTACCGAGCA
-tig00000001	+	199956	199956	88b1797f-3a41-442f-bab4-cdfedf7ec597	-7.87	-99.43	-91.56	1	1	TTGATCGCTTC
-tig00000001	+	199998	199998	88b1797f-3a41-442f-bab4-cdfedf7ec597	-5.15	-93.88	-88.73	1	1	TGTTGCGCTCC
 tig00000001	+	200009	200009	88b1797f-3a41-442f-bab4-cdfedf7ec597	-1.23	-117.16	-115.93	1	1	TTCAACGGTAT
 tig00000001	+	200046	200046	88b1797f-3a41-442f-bab4-cdfedf7ec597	-0.10	-104.28	-104.18	1	1	TGCAGCGCACC
 tig00000001	+	200081	200081	88b1797f-3a41-442f-bab4-cdfedf7ec597	-8.86	-96.70	-87.84	1	1	AACAACGCCAC
@@ -6401,225 +987,6 @@
 tig00000001	+	201922	201930	88b1797f-3a41-442f-bab4-cdfedf7ec597	-11.80	-155.94	-144.15	1	2	GTCACCGGCTGGCCGCACT
 tig00000001	+	201944	201950	88b1797f-3a41-442f-bab4-cdfedf7ec597	-14.70	-132.62	-117.92	1	2	GCAGGCGCTGCCGGAAG
 tig00000001	+	201961	201986	88b1797f-3a41-442f-bab4-cdfedf7ec597	-16.46	-274.36	-257.91	1	4	AACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAA
-tig00000001	+	201998	202007	88b1797f-3a41-442f-bab4-cdfedf7ec597	-4.15	-156.25	-152.10	1	2	CAGTCCGCAGGGGCCGTGGT
-tig00000001	+	202020	202020	88b1797f-3a41-442f-bab4-cdfedf7ec597	-4.25	-127.74	-123.49	1	1	CTGCTCGGCTG
-tig00000001	+	202033	202046	88b1797f-3a41-442f-bab4-cdfedf7ec597	-23.59	-243.28	-219.69	1	3	GTGAGCGGGTGCCGGAAGCGGATG
-tig00000001	+	202064	202081	88b1797f-3a41-442f-bab4-cdfedf7ec597	-28.91	-223.43	-194.52	1	5	GCCTGCGCCGCTGCCGCCGTACCGGGTA
-tig00000001	+	202092	202092	88b1797f-3a41-442f-bab4-cdfedf7ec597	-3.50	-99.49	-96.00	1	1	CTGACCGGGCT
-tig00000001	+	202105	202143	88b1797f-3a41-442f-bab4-cdfedf7ec597	-41.98	-310.59	-268.62	1	8	TGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGA
-tig00000001	+	202155	202198	88b1797f-3a41-442f-bab4-cdfedf7ec597	-31.08	-429.33	-398.25	1	8	TTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTG
-tig00000001	+	202214	202225	88b1797f-3a41-442f-bab4-cdfedf7ec597	-14.84	-191.94	-177.10	1	3	GACCACGCAGGCGCAGCGGGCA
-tig00000001	+	202240	202240	88b1797f-3a41-442f-bab4-cdfedf7ec597	-2.13	-110.23	-108.09	1	1	AAGCCCGGCAG
-tig00000001	+	202257	202275	88b1797f-3a41-442f-bab4-cdfedf7ec597	-28.42	-255.58	-227.16	1	5	ATTTCCGGCGGGACGGAACCGTCCGCTTT
-tig00000001	+	202295	202330	88b1797f-3a41-442f-bab4-cdfedf7ec597	-15.34	-296.10	-280.76	1	5	CCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTG
-tig00000001	+	202341	202341	88b1797f-3a41-442f-bab4-cdfedf7ec597	-1.15	-89.58	-88.43	1	1	TCTGCCGTGTG
-tig00000001	+	202352	202370	88b1797f-3a41-442f-bab4-cdfedf7ec597	-17.53	-184.46	-166.93	1	4	GCTGACGCACGACCCGGAATACCCGGAGA
-tig00000001	+	202386	202399	88b1797f-3a41-442f-bab4-cdfedf7ec597	-26.16	-182.33	-156.17	1	4	CCTGCCGCGCCGCTGGTGCGCTAT
-tig00000001	+	202412	202432	88b1797f-3a41-442f-bab4-cdfedf7ec597	-26.63	-218.49	-191.86	1	6	CTGGACGCCCGCGGCGAACTGGCGGCGGTGT
-tig00000001	+	202443	202443	88b1797f-3a41-442f-bab4-cdfedf7ec597	-4.33	-101.36	-97.03	1	1	ATGACCGCAGC
-tig00000001	+	202461	202461	88b1797f-3a41-442f-bab4-cdfedf7ec597	-7.47	-107.00	-99.53	1	1	AGGTGCGCAGC
-tig00000001	+	202475	202475	88b1797f-3a41-442f-bab4-cdfedf7ec597	-6.11	-108.69	-102.59	1	1	ACTTACGATGA
-tig00000001	+	202488	202525	88b1797f-3a41-442f-bab4-cdfedf7ec597	-16.87	-288.29	-271.42	1	7	AATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAA
-tig00000001	+	202539	202557	88b1797f-3a41-442f-bab4-cdfedf7ec597	-23.98	-235.02	-211.04	1	5	GTTACCGTTACGACAGCGACGGGCGGGTG
-tig00000001	+	202579	202579	88b1797f-3a41-442f-bab4-cdfedf7ec597	-0.73	-88.30	-87.58	1	1	AAACCCGGCAG
-tig00000001	+	202597	202597	88b1797f-3a41-442f-bab4-cdfedf7ec597	-5.55	-131.23	-125.68	1	1	TTACACGTATC
-tig00000001	+	202617	202617	88b1797f-3a41-442f-bab4-cdfedf7ec597	-4.92	-103.92	-99.00	1	1	AGGACCGCATC
-tig00000001	+	202631	202631	88b1797f-3a41-442f-bab4-cdfedf7ec597	-2.54	-119.38	-116.84	1	1	ATCACCGACAG
-tig00000001	+	202644	202647	88b1797f-3a41-442f-bab4-cdfedf7ec597	-2.28	-98.84	-96.56	1	2	TGAACCGCCGTGAA
-tig00000001	+	202663	202663	88b1797f-3a41-442f-bab4-cdfedf7ec597	-8.18	-109.28	-101.11	1	1	GCACACGCAGG
-tig00000001	+	202676	202686	88b1797f-3a41-442f-bab4-cdfedf7ec597	-1.17	-133.59	-132.42	1	2	GAAGGCGGGCTGAAGCGGGTG
-tig00000001	+	202705	202722	88b1797f-3a41-442f-bab4-cdfedf7ec597	-11.72	-180.49	-168.77	1	5	GAACACGCGGACGGCAGCGTCACGCAGA
-tig00000001	+	202738	202740	88b1797f-3a41-442f-bab4-cdfedf7ec597	-3.05	-132.66	-129.61	1	2	TTTGACGCGGTGG
-tig00000001	+	202764	202771	88b1797f-3a41-442f-bab4-cdfedf7ec597	-0.50	-119.83	-119.32	1	2	ACAGACGGATGCCGCAGG
-tig00000001	+	202797	202797	88b1797f-3a41-442f-bab4-cdfedf7ec597	0.95	-115.73	-116.68	1	1	CAGTCCGGATG
-tig00000001	+	202809	202809	88b1797f-3a41-442f-bab4-cdfedf7ec597	-3.32	-85.01	-81.69	1	1	GGTGACGGGCC
-tig00000001	+	202821	202836	88b1797f-3a41-442f-bab4-cdfedf7ec597	-32.25	-227.45	-195.20	1	4	CATCACGCGCATCACCACGCCGGATG
-tig00000001	+	202851	202854	88b1797f-3a41-442f-bab4-cdfedf7ec597	-9.52	-105.01	-95.49	1	2	GGCATCGGCGTTTT
-tig00000001	+	202884	202903	88b1797f-3a41-442f-bab4-cdfedf7ec597	-0.76	-182.88	-182.12	1	3	GTTAACGTCAGCCACCGGGCCTGACGGGCT
-tig00000001	+	202916	202919	88b1797f-3a41-442f-bab4-cdfedf7ec597	-4.76	-117.18	-112.41	1	2	AAATACGCCGGGAA
-tig00000001	+	202940	202940	88b1797f-3a41-442f-bab4-cdfedf7ec597	-0.47	-85.44	-84.97	1	1	GGGGCCGTCTG
-tig00000001	+	202966	202985	88b1797f-3a41-442f-bab4-cdfedf7ec597	-12.92	-204.14	-191.22	1	4	CCTGACGGCGATATCACCCGCTACCGTTAT
-tig00000001	+	203017	203022	88b1797f-3a41-442f-bab4-cdfedf7ec597	-12.96	-147.97	-135.01	1	2	CCCTGCGCAACGGAAG
-tig00000001	+	203035	203042	88b1797f-3a41-442f-bab4-cdfedf7ec597	-4.43	-116.89	-112.46	1	2	GCCACCGGCAGCCGGAAA
-tig00000001	+	203055	203068	88b1797f-3a41-442f-bab4-cdfedf7ec597	-10.95	-173.48	-162.53	1	3	CATGACGTGGAGCCGTTACGGTCA
-tig00000001	+	203098	203098	88b1797f-3a41-442f-bab4-cdfedf7ec597	2.53	-105.23	-107.75	1	1	TGTTCCGGTTA
-tig00000001	+	203111	203111	88b1797f-3a41-442f-bab4-cdfedf7ec597	-6.99	-117.10	-110.11	1	1	TAACCCGCTAT
-tig00000001	+	203126	203126	88b1797f-3a41-442f-bab4-cdfedf7ec597	-1.91	-101.94	-100.03	1	1	ATGACCGTTTT
-tig00000001	+	203142	203155	88b1797f-3a41-442f-bab4-cdfedf7ec597	-9.23	-175.98	-166.75	1	4	GGTGACGGCGGTGCACCGCGAGGA
-tig00000001	+	203177	203192	88b1797f-3a41-442f-bab4-cdfedf7ec597	-11.26	-207.36	-196.10	1	4	AGTACCGCGCATACGACAGCCGTGGA
-tig00000001	+	203209	203209	88b1797f-3a41-442f-bab4-cdfedf7ec597	-0.06	-96.81	-96.75	1	1	ATTGCCGTGAA
-tig00000001	+	203220	203220	88b1797f-3a41-442f-bab4-cdfedf7ec597	-2.34	-136.19	-133.85	1	1	AGACACGCAGG
-tig00000001	+	203235	203237	88b1797f-3a41-442f-bab4-cdfedf7ec597	-0.23	-134.39	-134.16	1	2	TGAAACGCGGTAT
-tig00000001	+	203251	203257	88b1797f-3a41-442f-bab4-cdfedf7ec597	-20.35	-135.64	-115.29	1	3	TACAACGCCGCCGGTGA
-tig00000001	+	203272	203272	88b1797f-3a41-442f-bab4-cdfedf7ec597	-3.22	-123.34	-120.12	1	1	ACCACCGTCAT
-tig00000001	+	203283	203287	88b1797f-3a41-442f-bab4-cdfedf7ec597	-6.39	-140.06	-133.67	1	2	TGCCCCGGACGGCAG
-tig00000001	+	203299	203299	88b1797f-3a41-442f-bab4-cdfedf7ec597	-0.98	-97.10	-96.11	1	1	AGAAACGGGAC
-tig00000001	+	203311	203316	88b1797f-3a41-442f-bab4-cdfedf7ec597	-7.05	-119.66	-112.61	1	2	CAGTACGATGCGTGGG
-tig00000001	+	203340	203357	88b1797f-3a41-442f-bab4-cdfedf7ec597	-30.17	-244.96	-214.79	1	4	TACCACGCAGGGCGGTCTGACGCGCAGT
-tig00000001	+	203371	203393	88b1797f-3a41-442f-bab4-cdfedf7ec597	-12.71	-235.26	-222.55	1	4	GAATACGATGCTGCCGGACGGGTCATCCGCCTG
-tig00000001	+	203410	203410	88b1797f-3a41-442f-bab4-cdfedf7ec597	-5.73	-97.45	-91.72	1	1	GAAAACGGCAG
-tig00000001	+	203429	203447	88b1797f-3a41-442f-bab4-cdfedf7ec597	-10.63	-183.60	-172.97	1	4	CCTTCCGTTACGATGTACTCGACCGGCTG
-tig00000001	+	203464	203486	88b1797f-3a41-442f-bab4-cdfedf7ec597	-19.71	-221.25	-201.54	1	4	GAAACCGGCTTTGACGGCCGCACACAGCGTTAT
-tig00000001	+	203497	203506	88b1797f-3a41-442f-bab4-cdfedf7ec597	-3.92	-174.62	-170.70	1	2	CACCACGACCTGACCGGCAA
-tig00000001	+	203519	203524	88b1797f-3a41-442f-bab4-cdfedf7ec597	-4.49	-120.79	-116.30	1	2	TTATCCGCAGCGAGGA
-tig00000001	+	203560	203609	88b1797f-3a41-442f-bab4-cdfedf7ec597	-16.62	-363.00	-346.38	1	8	TATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGG
-tig00000001	+	203623	203629	88b1797f-3a41-442f-bab4-cdfedf7ec597	-12.93	-147.13	-134.20	1	3	TATGACGAACGCGGCTG
-tig00000001	+	203659	203676	88b1797f-3a41-442f-bab4-cdfedf7ec597	-5.20	-215.78	-210.57	1	3	ATCAGCGAAGGGCACCGGGTGACGGTGC
-tig00000001	+	203705	203710	88b1797f-3a41-442f-bab4-cdfedf7ec597	-16.35	-197.03	-180.68	1	2	AAGGCCGCCTCGCCAG
-tig00000001	+	203727	203727	88b1797f-3a41-442f-bab4-cdfedf7ec597	-1.65	-97.79	-96.14	1	1	CCTGACGGTGC
-tig00000001	+	203739	203745	88b1797f-3a41-442f-bab4-cdfedf7ec597	-10.11	-104.84	-94.74	1	2	TCATCCGCAGACGAATG
-tig00000001	+	203781	203788	88b1797f-3a41-442f-bab4-cdfedf7ec597	-13.05	-152.38	-139.32	1	2	ACATGCGTACAACGCACA
-tig00000001	+	203802	203817	88b1797f-3a41-442f-bab4-cdfedf7ec597	-9.72	-213.29	-203.57	1	3	ACTGGCGAACCGCTGTATACCGGACA
-tig00000001	+	203830	203833	88b1797f-3a41-442f-bab4-cdfedf7ec597	-9.10	-118.11	-109.01	1	2	CTGCCCGCCGTGGA
-tig00000001	+	203851	203857	88b1797f-3a41-442f-bab4-cdfedf7ec597	-12.25	-157.07	-144.83	1	2	ACCTACGGCAGCGGCTG
-tig00000001	+	203881	203892	88b1797f-3a41-442f-bab4-cdfedf7ec597	-16.74	-160.14	-143.40	1	3	AAACTCGGCGACACACCGCTGG
-tig00000001	+	203909	203948	88b1797f-3a41-442f-bab4-cdfedf7ec597	-34.20	-303.06	-268.86	1	8	ACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTAT
-tig00000001	+	203965	203965	88b1797f-3a41-442f-bab4-cdfedf7ec597	-2.46	-92.78	-90.32	1	1	ACCACCGCTTA
-tig00000001	+	203980	203980	88b1797f-3a41-442f-bab4-cdfedf7ec597	-4.54	-102.24	-97.70	1	1	CCTGCCGGGCA
-tig00000001	+	204023	204025	88b1797f-3a41-442f-bab4-cdfedf7ec597	-4.00	-119.56	-115.55	1	2	CTGACCGCGATTA
-tig00000001	+	204040	204059	88b1797f-3a41-442f-bab4-cdfedf7ec597	-15.79	-179.76	-163.97	1	4	TGGAACGACAACGGCGAACTCATCCGCATC
-tig00000001	+	204072	204083	88b1797f-3a41-442f-bab4-cdfedf7ec597	-9.87	-156.34	-146.46	1	3	CAGCCCGCGCCAGACCCGGAGT
-tig00000001	+	204106	204106	88b1797f-3a41-442f-bab4-cdfedf7ec597	-5.10	-81.58	-76.48	1	1	ACCACCGGCAG
-tig00000001	+	204118	204121	88b1797f-3a41-442f-bab4-cdfedf7ec597	-9.29	-125.10	-115.82	1	2	CTGACCGGCGTTCA
-tig00000001	+	204133	204138	88b1797f-3a41-442f-bab4-cdfedf7ec597	-6.36	-125.10	-118.74	1	2	ACCACCGCAGCGAATC
-tig00000001	+	204152	204159	88b1797f-3a41-442f-bab4-cdfedf7ec597	-3.03	-147.68	-144.65	1	2	ATATCCGCATCCCGTATA
-tig00000001	+	204174	204174	88b1797f-3a41-442f-bab4-cdfedf7ec597	-1.06	-83.99	-82.92	1	1	AGACCCGGCAG
-tig00000001	+	204185	204198	88b1797f-3a41-442f-bab4-cdfedf7ec597	-0.73	-139.87	-139.14	1	3	GTAACCGCCTGCCCGACCCGGAGC
-tig00000001	+	204210	204217	88b1797f-3a41-442f-bab4-cdfedf7ec597	-2.89	-116.70	-113.81	1	2	GCACCCGGACAGCGCCCT
-tig00000001	+	204234	204258	88b1797f-3a41-442f-bab4-cdfedf7ec597	-9.59	-264.77	-255.17	1	6	GTGGCCGGATAACCGTATCGCCCGTGACGCGCACT
-tig00000001	+	204272	204286	88b1797f-3a41-442f-bab4-cdfedf7ec597	-8.94	-187.89	-178.95	1	3	TTTACCGGTATGACCGTCACGGCAG
-tig00000001	+	204307	204307	88b1797f-3a41-442f-bab4-cdfedf7ec597	-0.55	-84.13	-83.58	1	1	AAAACCGACCT
-tig00000001	+	204318	204318	88b1797f-3a41-442f-bab4-cdfedf7ec597	0.98	-80.00	-80.98	1	1	CATCCCGGAAG
-tig00000001	+	204331	204335	88b1797f-3a41-442f-bab4-cdfedf7ec597	-4.03	-172.19	-168.16	1	2	TTATCCGCACGGATG
-tig00000001	+	204346	204355	88b1797f-3a41-442f-bab4-cdfedf7ec597	-14.84	-147.51	-132.67	1	2	ATGAGCGCACCCACCGGTAC
-tig00000001	+	204366	204366	88b1797f-3a41-442f-bab4-cdfedf7ec597	-0.37	-91.45	-91.09	1	1	CATTACGACAG
-tig00000001	+	204379	204379	88b1797f-3a41-442f-bab4-cdfedf7ec597	-2.76	-104.51	-101.75	1	1	AGCACCGGCTG
-tig00000001	+	204395	204397	88b1797f-3a41-442f-bab4-cdfedf7ec597	-8.05	-123.03	-114.98	1	2	CTACACGCGGACA
-tig00000001	+	204416	204430	88b1797f-3a41-442f-bab4-cdfedf7ec597	-13.98	-186.35	-172.37	1	3	AGAGCCGCTGGTCGAAAGTCGCTAT
-tig00000001	+	204441	204454	88b1797f-3a41-442f-bab4-cdfedf7ec597	-10.46	-177.77	-167.31	1	3	CTTTACGACCCGCTGGGCCGCAGG
-tig00000001	+	204469	204497	88b1797f-3a41-442f-bab4-cdfedf7ec597	-13.99	-252.77	-238.77	1	5	CAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCT
-tig00000001	+	204509	204524	88b1797f-3a41-442f-bab4-cdfedf7ec597	-15.95	-175.38	-159.43	1	3	GATGTCGCTGTCACGGAAACCGCAAG
-tig00000001	+	204540	204596	88b1797f-3a41-442f-bab4-cdfedf7ec597	-49.88	-441.39	-391.50	1	8	TGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTT
-tig00000001	+	204608	204608	88b1797f-3a41-442f-bab4-cdfedf7ec597	-1.10	-125.35	-124.25	1	1	TCAGCCGGGGA
-tig00000001	+	204620	204620	88b1797f-3a41-442f-bab4-cdfedf7ec597	-6.25	-120.39	-114.14	1	1	CTTCACGCCAC
-tig00000001	+	204642	204648	88b1797f-3a41-442f-bab4-cdfedf7ec597	-9.64	-191.89	-182.26	1	2	GAAACCGCCACCGGTGA
-tig00000001	+	204659	204683	88b1797f-3a41-442f-bab4-cdfedf7ec597	-15.70	-256.06	-240.36	1	5	GCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATA
-tig00000001	+	204702	204714	88b1797f-3a41-442f-bab4-cdfedf7ec597	-9.95	-179.33	-169.38	1	3	CAGTCCGGTGGCGAAGACGGTGG
-tig00000001	+	204734	204737	88b1797f-3a41-442f-bab4-cdfedf7ec597	-13.74	-152.13	-138.39	1	2	GTTCCCGCCGGTGC
-tig00000001	+	204756	204760	88b1797f-3a41-442f-bab4-cdfedf7ec597	-4.76	-95.92	-91.16	1	2	ATGCTCGACCGGCTG
-tig00000001	+	204787	204787	88b1797f-3a41-442f-bab4-cdfedf7ec597	-5.98	-140.40	-134.42	1	1	CTGACCGGGTG
-tig00000001	+	204805	204808	88b1797f-3a41-442f-bab4-cdfedf7ec597	-15.06	-191.15	-176.09	1	2	AAAGCCGCCGCTGG
-tig00000001	+	204821	204839	88b1797f-3a41-442f-bab4-cdfedf7ec597	-11.33	-275.58	-264.25	1	4	GGCATCGTGCGGCCTGACGGTGGCGCAGA
-tig00000001	+	204863	204880	88b1797f-3a41-442f-bab4-cdfedf7ec597	-19.20	-195.74	-176.55	1	5	GGACCCGGTATACACGCCGGCGCGAAAA
-tig00000001	+	204903	204920	88b1797f-3a41-442f-bab4-cdfedf7ec597	-12.83	-206.66	-193.83	1	4	CACTGCGACCATCGCGGCCTGCCGCTGG
-tig00000001	+	204938	204938	88b1797f-3a41-442f-bab4-cdfedf7ec597	-2.76	-121.34	-118.58	1	1	CAGCACGGAAG
-tig00000001	+	204953	204969	88b1797f-3a41-442f-bab4-cdfedf7ec597	-13.14	-181.30	-168.15	1	3	AACAGCGTGGTACGCAGAATACGATGA
-tig00000001	+	205004	205004	88b1797f-3a41-442f-bab4-cdfedf7ec597	-3.16	-107.16	-103.99	1	1	GAACCCGCATC
-tig00000001	+	205027	205034	88b1797f-3a41-442f-bab4-cdfedf7ec597	-4.53	-168.17	-163.64	1	2	TTATCCGCCTGCCGGGGC
-tig00000001	+	205059	205059	88b1797f-3a41-442f-bab4-cdfedf7ec597	-1.23	-109.36	-108.13	1	1	GAGTCCGGCCT
-tig00000001	+	205075	205081	88b1797f-3a41-442f-bab4-cdfedf7ec597	-21.68	-169.32	-147.64	1	2	ACAACCGCCACCGCTAT
-tig00000001	+	205094	205094	88b1797f-3a41-442f-bab4-cdfedf7ec597	-3.13	-86.20	-83.07	1	1	TGACCCGCTGC
-tig00000001	+	205105	205105	88b1797f-3a41-442f-bab4-cdfedf7ec597	-0.62	-86.22	-85.60	1	1	AGGGGCGATAT
-tig00000001	+	205124	205124	88b1797f-3a41-442f-bab4-cdfedf7ec597	1.98	-141.99	-143.96	1	1	GGATCCGATTG
-tig00000001	+	205161	205170	88b1797f-3a41-442f-bab4-cdfedf7ec597	0.89	-148.30	-149.19	1	2	GTATCCGTTGAATCCGATCT
-tig00000001	+	205237	205237	88b1797f-3a41-442f-bab4-cdfedf7ec597	-6.77	-112.55	-105.78	1	1	ATGGGCGGAAC
-tig00000001	+	205255	205255	88b1797f-3a41-442f-bab4-cdfedf7ec597	-1.34	-107.36	-106.02	1	1	AGAAGCGGTCC
-tig00000001	+	205277	205277	88b1797f-3a41-442f-bab4-cdfedf7ec597	-0.61	-103.50	-102.89	1	1	GAATCCGTTCT
-tig00000001	+	205344	205344	88b1797f-3a41-442f-bab4-cdfedf7ec597	-1.76	-107.94	-106.18	1	1	ACCAACGGGGA
-tig00000001	+	205415	205415	88b1797f-3a41-442f-bab4-cdfedf7ec597	0.14	-116.41	-116.55	1	1	CTGGCCGTTGT
-tig00000001	+	205426	205435	88b1797f-3a41-442f-bab4-cdfedf7ec597	-16.18	-159.69	-143.52	1	2	GACCTCGTTGAAACCGATAA
-tig00000001	+	205487	205489	88b1797f-3a41-442f-bab4-cdfedf7ec597	-0.77	-119.22	-118.45	1	2	AAGGCCGCGTTAT
-tig00000001	+	205595	205595	88b1797f-3a41-442f-bab4-cdfedf7ec597	-2.31	-95.69	-93.39	1	1	TGCTCCGGAAA
-tig00000001	+	205611	205611	88b1797f-3a41-442f-bab4-cdfedf7ec597	5.94	-136.07	-142.01	1	1	TTGGACGTTTT
-tig00000001	+	205634	205634	88b1797f-3a41-442f-bab4-cdfedf7ec597	0.35	-107.63	-107.98	1	1	TTCACCGGAGT
-tig00000001	+	205691	205691	88b1797f-3a41-442f-bab4-cdfedf7ec597	0.85	-91.18	-92.04	1	1	TTTATCGCTTT
-tig00000001	+	205744	205744	88b1797f-3a41-442f-bab4-cdfedf7ec597	-0.62	-121.29	-120.66	1	1	CCACTCGTGAT
-tig00000001	+	205755	205755	88b1797f-3a41-442f-bab4-cdfedf7ec597	-5.14	-112.54	-107.40	1	1	GTGAGCGAGTT
-tig00000001	-	197590	197599	29fcf315-e502-472c-8e1f-80e65e5b4972	-11.12	-192.99	-181.87	1	2	AATACCGCCTTTGACGATAT
-tig00000001	-	197612	197620	29fcf315-e502-472c-8e1f-80e65e5b4972	-9.09	-151.29	-142.20	1	2	TTCAGCGCAATAACGCCCA
-tig00000001	-	197631	197631	29fcf315-e502-472c-8e1f-80e65e5b4972	-3.43	-111.44	-108.01	1	1	GCACACGAGAA
-tig00000001	-	197654	197657	29fcf315-e502-472c-8e1f-80e65e5b4972	-17.48	-227.95	-210.47	1	2	ACCAGCGGCGTGGC
-tig00000001	-	197670	197672	29fcf315-e502-472c-8e1f-80e65e5b4972	-4.16	-109.39	-105.23	1	2	CCTGACGCGCAAC
-tig00000001	-	197683	197683	29fcf315-e502-472c-8e1f-80e65e5b4972	-6.35	-106.23	-99.88	1	1	CTGATCGACTT
-tig00000001	-	197701	197701	29fcf315-e502-472c-8e1f-80e65e5b4972	2.62	-87.72	-90.33	1	1	AACATCGGTAG
-tig00000001	-	197719	197719	29fcf315-e502-472c-8e1f-80e65e5b4972	-3.94	-90.54	-86.61	1	1	ACCACCGTTAG
-tig00000001	-	197736	197749	29fcf315-e502-472c-8e1f-80e65e5b4972	-17.38	-182.77	-165.39	1	3	CATGGCGACGAATGGCATCGACAG
-tig00000001	-	197763	197779	29fcf315-e502-472c-8e1f-80e65e5b4972	-22.81	-223.90	-201.08	1	3	CTTTACGGATCATGCGGTTGTCGATGT
-tig00000001	-	197791	197816	29fcf315-e502-472c-8e1f-80e65e5b4972	-31.33	-272.60	-241.27	1	4	GATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-tig00000001	-	197837	197837	29fcf315-e502-472c-8e1f-80e65e5b4972	-2.88	-89.16	-86.28	1	1	TGGAGCGACTG
-tig00000001	-	197848	197856	29fcf315-e502-472c-8e1f-80e65e5b4972	-13.94	-156.17	-142.24	1	4	CACATCGCGCTCGCGCAGG
-tig00000001	-	197868	197878	29fcf315-e502-472c-8e1f-80e65e5b4972	-11.45	-166.67	-155.22	1	2	TAAAACGCTGCTTGGCGAGGA
-tig00000001	-	197895	197906	29fcf315-e502-472c-8e1f-80e65e5b4972	-17.38	-165.31	-147.93	1	3	TACTGCGGCCTTCCGGCGTTTC
-tig00000001	-	197921	197921	29fcf315-e502-472c-8e1f-80e65e5b4972	-3.18	-121.88	-118.70	1	1	GCCAGCGAAGC
-tig00000001	-	197935	197948	29fcf315-e502-472c-8e1f-80e65e5b4972	-22.66	-185.94	-163.28	1	3	TTGTGCGGCGTCAGCCAGCGTTTT
-tig00000001	-	197960	197969	29fcf315-e502-472c-8e1f-80e65e5b4972	-12.93	-175.72	-162.78	1	3	ATCCACGCCCTGCGCGGGGA
-tig00000001	-	197982	197999	29fcf315-e502-472c-8e1f-80e65e5b4972	-27.66	-208.60	-180.94	1	4	AACTCCGACGCCTGACGGTTACCGAGTG
-tig00000001	-	198014	198014	29fcf315-e502-472c-8e1f-80e65e5b4972	-11.14	-110.64	-99.50	1	1	GGTGCCGGTTT
-tig00000001	-	198035	198051	29fcf315-e502-472c-8e1f-80e65e5b4972	-19.72	-222.64	-202.91	1	3	CAGAACGTCAACGTCACCTGCCGCTTC
-tig00000001	-	198064	198068	29fcf315-e502-472c-8e1f-80e65e5b4972	-0.45	-164.31	-163.86	1	2	CTGCACGTCCGCTGG
-tig00000001	-	198087	198089	29fcf315-e502-472c-8e1f-80e65e5b4972	-5.58	-135.82	-130.25	1	2	ACATTCGCGCCTA
-tig00000001	-	198100	198123	29fcf315-e502-472c-8e1f-80e65e5b4972	-47.82	-298.57	-250.75	1	6	GCATCCGGCTCATCCCGGCGACGCCGATCGCTGA
-tig00000001	-	198137	198137	29fcf315-e502-472c-8e1f-80e65e5b4972	0.55	-121.62	-122.17	1	1	CAGGCCGCCAA
-tig00000001	-	198171	198171	29fcf315-e502-472c-8e1f-80e65e5b4972	-0.52	-86.34	-85.83	1	1	AGCAGCGCCAC
-tig00000001	-	198183	198188	29fcf315-e502-472c-8e1f-80e65e5b4972	-7.74	-154.70	-146.95	1	2	AGTACCGTTACGCTGA
-tig00000001	-	198203	198233	29fcf315-e502-472c-8e1f-80e65e5b4972	-32.05	-283.41	-251.36	1	6	ATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTG
-tig00000001	-	198250	198250	29fcf315-e502-472c-8e1f-80e65e5b4972	-3.65	-92.63	-88.98	1	1	AAAGACGATAG
-tig00000001	-	198289	198313	29fcf315-e502-472c-8e1f-80e65e5b4972	-47.51	-276.48	-228.97	1	6	AATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTT
-tig00000001	-	198326	198336	29fcf315-e502-472c-8e1f-80e65e5b4972	-1.32	-188.36	-187.04	1	3	ACCATCGCGATCATCCGATCC
-tig00000001	-	198352	198364	29fcf315-e502-472c-8e1f-80e65e5b4972	-11.08	-174.66	-163.57	1	3	TGTCTCGCCGGGGTTAACGCTAC
-tig00000001	-	198399	198415	29fcf315-e502-472c-8e1f-80e65e5b4972	-18.82	-153.43	-134.61	1	5	GAATACGCGTGCCGCCGGTGACGGAGG
-tig00000001	-	198427	198485	29fcf315-e502-472c-8e1f-80e65e5b4972	-35.78	-340.81	-305.02	1	10	AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGC
-tig00000001	-	198513	198513	29fcf315-e502-472c-8e1f-80e65e5b4972	-2.73	-87.56	-84.83	1	1	ACCATCGCAGG
-tig00000001	-	198527	198527	29fcf315-e502-472c-8e1f-80e65e5b4972	-2.13	-81.32	-79.19	1	1	AATATCGCCAG
-tig00000001	-	198545	198569	29fcf315-e502-472c-8e1f-80e65e5b4972	-29.98	-269.41	-239.43	1	4	CAGTACGATATCGCCTTTACGAAGTTGGTCGGCAG
-tig00000001	-	198585	198619	29fcf315-e502-472c-8e1f-80e65e5b4972	-19.54	-305.52	-285.98	1	6	TTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCA
-tig00000001	-	198660	198670	29fcf315-e502-472c-8e1f-80e65e5b4972	-18.85	-202.96	-184.10	1	2	GCCTGCGCTTTACTGCGGCCT
-tig00000001	-	198684	198710	29fcf315-e502-472c-8e1f-80e65e5b4972	-28.68	-244.18	-215.50	1	5	GCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGA
-tig00000001	-	198728	198782	29fcf315-e502-472c-8e1f-80e65e5b4972	-30.49	-347.39	-316.91	1	9	CCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGC
-tig00000001	-	198812	198821	29fcf315-e502-472c-8e1f-80e65e5b4972	-15.48	-142.48	-127.00	1	2	ACTGCCGATCCAGACGATAA
-tig00000001	-	198834	198855	29fcf315-e502-472c-8e1f-80e65e5b4972	-36.11	-248.63	-212.52	1	4	ATCACCGGATTGCGCCATTGCGCCTGCGGGTT
-tig00000001	-	198872	198872	29fcf315-e502-472c-8e1f-80e65e5b4972	-2.29	-109.76	-107.47	1	1	TTCACCGCTTC
-tig00000001	-	198884	198892	29fcf315-e502-472c-8e1f-80e65e5b4972	-13.87	-147.25	-133.38	1	2	TTCAGCGCCTGAACGACAA
-tig00000001	-	198907	198914	29fcf315-e502-472c-8e1f-80e65e5b4972	-6.33	-159.19	-152.85	1	2	TGGTTCGAATAGCGCCAG
-tig00000001	-	198927	198927	29fcf315-e502-472c-8e1f-80e65e5b4972	-5.28	-187.33	-182.04	1	1	GTTTACGACTC
-tig00000001	-	198972	198987	29fcf315-e502-472c-8e1f-80e65e5b4972	-9.24	-194.67	-185.43	1	3	TATTCCGCCACCGGACCAAGCGCCAG
-tig00000001	-	199013	199013	29fcf315-e502-472c-8e1f-80e65e5b4972	-1.63	-84.30	-82.67	1	1	CAGTGCGCCAA
-tig00000001	-	199028	199034	29fcf315-e502-472c-8e1f-80e65e5b4972	-13.03	-144.31	-131.28	1	2	CAACACGGTGCCGATTA
-tig00000001	-	199056	199088	29fcf315-e502-472c-8e1f-80e65e5b4972	-35.77	-340.91	-305.14	1	6	AACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTT
-tig00000001	-	199112	199117	29fcf315-e502-472c-8e1f-80e65e5b4972	-14.57	-117.45	-102.88	1	2	ACCAGCGAACCGGCAA
-tig00000001	-	199133	199133	29fcf315-e502-472c-8e1f-80e65e5b4972	-0.13	-84.29	-84.16	1	1	ATCACCGGGAT
-tig00000001	-	199147	199156	29fcf315-e502-472c-8e1f-80e65e5b4972	-19.21	-201.60	-182.39	1	3	CACCCCGAAGCGACCGACAA
-tig00000001	-	199172	199172	29fcf315-e502-472c-8e1f-80e65e5b4972	-8.89	-98.41	-89.52	1	1	CAGAACGCCAG
-tig00000001	-	199193	199193	29fcf315-e502-472c-8e1f-80e65e5b4972	0.83	-103.08	-103.92	1	1	CAGAACGGAGA
-tig00000001	-	199204	199228	29fcf315-e502-472c-8e1f-80e65e5b4972	-26.31	-208.60	-182.30	1	4	GTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGT
-tig00000001	-	199240	199255	29fcf315-e502-472c-8e1f-80e65e5b4972	-26.45	-243.83	-217.38	1	4	GTTAGCGGCGGATGACACGGCGTACA
-tig00000001	-	199267	199267	29fcf315-e502-472c-8e1f-80e65e5b4972	-0.64	-153.29	-152.64	1	1	CACTTCGCTAA
-tig00000001	-	199280	199280	29fcf315-e502-472c-8e1f-80e65e5b4972	-3.27	-109.52	-106.24	1	1	CCATGCGGGCC
-tig00000001	-	199300	199336	29fcf315-e502-472c-8e1f-80e65e5b4972	-30.69	-305.89	-275.20	1	9	CATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCA
-tig00000001	-	199352	199355	29fcf315-e502-472c-8e1f-80e65e5b4972	-13.86	-136.47	-122.61	1	2	ACCAGCGTCGGGGT
-tig00000001	-	199393	199402	29fcf315-e502-472c-8e1f-80e65e5b4972	-11.64	-186.80	-175.16	1	4	CATCTCGCGTACGTCGATTT
-tig00000001	-	199423	199430	29fcf315-e502-472c-8e1f-80e65e5b4972	-5.14	-135.31	-130.17	1	2	TATTCCGGTGTACGACCA
-tig00000001	-	199446	199446	29fcf315-e502-472c-8e1f-80e65e5b4972	-0.22	-98.41	-98.19	1	1	CAGCCCGGCAA
-tig00000001	-	199459	199459	29fcf315-e502-472c-8e1f-80e65e5