view test-data/consensus_result3.fasta @ 1:4df02149a270 draft

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit da382e2ab73f0bb19ed85d74a338c47a43a0973a
author bgruening
date Thu, 19 Jul 2018 07:43:14 -0400
parents
children
line wrap: on
line source

>utg000001l LN:i:48021 RC:i:170 XC:f:1.000000
ACAACGTGCGTGGAGGCCATCAAACCACGTCAAATAATCAATTATGACGCAGGTATCGTATTAATTGATCTGCATCAACTTAACGTAAAAACAACTTCAGACAATACAAATCAGCGACACTGAATACGGGGCAACCTCATGTCAACGAAGAACAGAACCCGCAGAACAACAACCCGCAACATCCGCTTTTCTAACCAAATGATTGAACAAATTAACATCGCTCTTGAGCAAAAGGGTCGGGGAATTCTCAGCCTGGGTCATTGAAGCCTGCCGTCGGAGACTAACGTCAGAAAGAGAGCATATACATCAATTAAAGTGATGAAGAATGAACATCCCGCGTTCTTCCCTCCGAACAGGACGATATTGTAAATTCACTTAATTACGAGGGCATTGCAGTAATTGAGTTGCAGTTTTACCACTTTCCTGACAGTGACAGACTGCGTGTTGGCTCTGTCACAGACTAAATAGTTTGAATGATTAGCAGTTATGGTGATCAGTCAACCACCAGGGAATAATCCTTCATATTATTATCGTGCTTCACCAACGCTGCCTCAATTGCTCTGAATGCTTCCAGAGACACCTTATGTTCTATACATGCAATTACAACATCAGGGTAACTCATAGAAATGGTGCTATTAAGCATATTTTTACACGAATCAGATCCACGGAGGGATCATCAGCAGATTGTTCTTTATTCATTTTGTCGCTCCATGCGCTTGCTCTTCATCTAGCGGTTAAAATATTACTTCAAATCTTTCTGTATGAAGATTTGAGCACGTTGGCCTTACATACATCTGTCGGTTGTATTTCCCTCCAGAATGCCAGCAGGACCGCACTTTGTTACGCAACCAATACTATTAAGTGAAAACATTCCTAATATTTGACATAAATCATCAACAAAACACAAGGAGGTCAGACCAGATTGAAACGATAAAACGATAATGCAAACTACGCGCCCTCGTATCACATGGAAGGTTTTACCAATGGCTCAGGTTGCCATTTTAAAGAAATATTCGATCAAGTGCGAAAAGATTTAGACTGTGAATTGTTTTATTCTGAACTAAACGTCACAACGTCTCACATTATATTTACTATCTAGCCACAGATAATATTCACATCGTGTTAGAAAACGATAACACCGTGTTAATAAAAGGACTTAAAAGGTTGTAAATGTTAAATTCTCAAGAAACACGCATCTTATAGAAACGTCCTATGATAGGTTGAAATCAAGAGAAATCACATTTCAGCAATACAGGGAAAATCTTGCTAAAGCAGGAGTTTTCCGATGGTTACAAATATCCATGAACATAAAGATATTACTATACCTTTGATAATTCATTACTATTTACTGAGAGCATTCAGAACACTACACAAATCTTTCCACGCTAAATCATAACGTCCGGTTTCTTCCGTGTCAGCACCGGGGCGTTGGCATAATGCAATACGTGTACGCGCTAAACCCTGTGTGCATCGTTTTAATTATTCCCGGACACTCCCGCAGAGAAGTTCCCCGTCAGGGCTGTGGACATAGTTAATCCGGGAATACAATGACGATTCATCGCACCTGACATACATTAATAAATATTAACAATATGAAATTTCAACTCATTGTTTAGGGTTTGTTTAATTTTCTACACATACGATTCTGCGAACTTCAAAAAGCATCGGGAATAACACCATGAAAAATGCTACTCGCTACTGCGCTGGCCCTGCTTATTACAGGATGTGCTCAACAGACGTTTACTGTTCAAACAAACCGGCAGCAGCAGTAGCACCAAAGGAAACCATCACCCATCATTTCTTCGTTCGTTTCTGGAATTGGGCAGAAGAAAACTGTCGATGCAGCCAAATTTGTGGCGGCGCAGAAAATGTTGTTAAAACAGAAACCCAGCAAACATTCGTAAATGGATTGCTCGGTTTTATTACTTTAGGCATTTATACTCCGCTGGAAGCGCGTGTATTGCTCACAATAATTGCATGAGTTGCCCATCGATATGGGCAACTCTATCTGCACTGCTCATTTAATACTTCTGGGTTCCTTCCAGTTGTTTTGCATAGTGATCAGCCTCTCTCTGAGGGTGAAATAATCCCGTTCAGCTCTGTCTGCCAGTCGGGGGAGGCTGCATTATCCACGCCGGAGGCGGTGGTGGCTTCACGCACTGACTGACAGACTGCTTTGATGTGCAACCGACGACGACCAGCGGCAACATCATCACGCAGAGCATCATTTTCAGCTTTAGCATCAGCTAACTCCTTCGTGTATTTTGCATCGGAGCGCAGCAACATCACGCTGACGCATCTGCATGTCAGTAATTGCCGCGTTCGCCAGCTTCGATTCAGTTCTCTGGCATTTTGTCGCGCTGGGCTTTGTAGGTAATGGCGTTATCACGGTAATGATTAACAGCCCATGACAGGCAGACGATGATGCAGATAACCAGAGCGGGAGATAATCGCGGTGACTCTGCTCATACATCAATCTCTCTGACCGTTCCGCCCGCTTCTTTGAATTTGCAATCAGGCTGTCAGCCTTATGCTCGAACTGACCAGACCAGCGCCCGGCAGTGAAGCCCAGATATTGCTGCAACGGTCGATTGCCTGACGGATATCACCACGATCAATCATAGGTAAAGCGCCACGCTCCTTAATCTGCTGCAATGCCACAGCGTCCTGACTTTCGGAGAGAAGTCTTTCAGGCCAAGCTGCTTGCGGTAGGCATCCCACCAACGGGAAAGAAGCTGGTAGCGTCCGGCGCCTGTTGATTTGAGTTTTGGGTTTAGCGTGACAAGTTTGCGAGGGATCGGAGTACGCGATAATCAGTAAATAGCTCTCCGCCTACAATGACGTCATAACCATGATTTCTGGTTTTCTGACGTCCGTTATCAGTTCCCTCCGACCACGCCAGCATATCGAGGAACGCCTTACGTTGATTATTGATTTCTACCATCTTCTACTCCGGCTTTTAGCAGCGAAGCGTTTGATAAGCGAACCAATCGAGTCAGTACCGATGTAGCCGATAAACACGCTCGTTATAAGCGAGATTGCTACTTAGTCCGGCGAAGTCGAGAAGGTCACGAATGAACTAGGCGATAATGGCGCACATCGTTGCGTCGATTACTGTTTTGTAAACGCACCGCCATTATATCTGCCGCGAAGGTACGCCATTGCAAACGCAAGGATTGCCCCGATGCCTTGTTCCTTTGCCGCGAGAATGGCGGCCAACAGGTCATGTTTTCTGGCATCTTCATGTCTTACCCCCAATAAGGGGATTTGCTCTATTTAATTAGGAATAAGGTCGATTACTGATAGAACAAATCCAGGCTACTGTGTTTAGTAATCAGATTTGTTCGTGACCGATATGCACGGGCAAAACGGCAGGAGGAGTGTTAGCGCGACCTCCTGCCCGCCCTTTCACGAAGGTCATGTGTAAAAGGCCGCAGCGTAACTATTACTAATGAATTCAGAACAGACAGTGGCTACGGCTCAGTTTGGGTTGTGCTGTTGCTGGGCGGCGATGACGCCTGTACGCATTTGGTGATCCGGTTCTGCTTCCGGTATTCGCTTAATTCATTCAGCACAACGGAAAGAGCACGCACTGGCTAACCAGGCGCCGACTCTTCACGATTATCGACTCAATGCTCTTACCTGTTGTGCAGATATAAAAATCCCGAAACCGTTATGCAGGCTCTAACTATTACCTGCGAACTGTTTCGGGATTGCATTTTGCAGACCTCTGCCTGCGATGGTTGGAGTTCCAGACGATACGTCGAAGTACCAACTAGGCGGAATCGGTAGTAAGCGCCGCCTCTTTCATCTCACTACACAACGAGCGAATTAACCCATCGTTGAGTCAAATTTACCCAATTTTATTCAATAAGTCAATATCATGCCGTTAATATGTTGCCATCCGTGGCAATCATGCTGCTAACGTGTGACCGCATTCAAAATGTTGTCTGCGATTGACTCTTCTTTGTGGCATTGCACCAGAGCGTCATACAGCGGCTTAACAGTGCGTGACCAGGTGGGTTGGGTAAGGTTTGGGATTAGCATCGTCACAGCGCGATATGCTGCGCTTGCTGGCATCCTTGAATAGCCGACGCCTTTGCATCTTCCGCACTCTTTCTCGACAACTCTCCCCCACAGCTCTGTTTGGCAATATCAACCGCACGGCCTGTACCATGGCAATCTCTGCATCTTGCCCCCGGCGTCGTCGCGGCACTACGGCAATAATCCGCATAAGCGAATGTTGCGAGCACTTGCAGTACCTTTGCCTTAGTATTTCCTTCAAGCTTTGCACACCACGGTATTTCCCCGATACCTTGTGTGCAAATTGCATCAGATAGTTGATAGCCTTTTGTTTGTCGTTCTGGCTGAGTTCGTGCTTACCGCAGAATGCAGCCATACCGAATCCGGCTTGTGATTGCGCCATCCCCATAGCAGCCATCACATCAGTACCGGAAAGAGTCAGAAGCCGTGGCCCGTGGTGAGTCGCTCATCATCGGGCTTTTGGCGAATGAAATTTAGCTACGCTTTCGAGTCTCATGCTGCGCCTTCTCCCTGTACCTGAATCAATGTTAGGTTTCCGCAGAACACTGCGCCGGTATCGATATACATTTGGTTGGCAAACTTGAGTGGTTTCACTGCTGGCGTATGACCAAAGATGAACGTGTCCGCGCCTTTGATTTCTTTCACGATCCCGTTTGTGAGTTGCTGATTCGTTCGCGGTTCCAGATTACCTGCTGATGATCAACTGGCTTTCCAAACTCGTATTCGTCAAAGGGATAATCGGCGTGGCAGATAACATATTTTATCTTTGCTCACCAGTTCGATGATTAACGGAAGTTCATCTGCTTTATGGGCAAGAGCTTTAGCCAGAATTTCTTTGTCGTAATCGAGATTAAAGAACCAGCCACCGCCATTAAGCAGCCAGTGATTAACGTTTCCACGCTCTGATAAGCCATCAATCATCATTTGCTCATGGTTTCCACGTACAGCTCTGAACCAGGGGAATGTGATTAATTCCAGGCATTCAACGTTCTCTGCACCACGATCAACCAAATCGCCCACCGAGATAAGCAGGTCTTTTGTTGTCGAATCCAATCGTATCCAGTTTGTTCATCAGGTTCGTGTAGCATCCGTGCAGATCGCCAACTACCAAATATTTCGGTATTTGCTGCCATCAATTTTTCGTAATAGCGCATCTCTTTCACTCCATCCGCGATGAACCATGAGAACGTCGTTGACGATGGCGTGCATTTCCCGTCTTTATCATCAACGTATTTTCTGACGTACCGCGACTACATTTCAGTCTGCGTGCTACTTCTGTCTGATTTCCGTATGTTTCAACGAGCATGTCTGGAATGGTTTTACTGAGAACGTCATGCGGCCTCACTTCTGCTATTTCGCAGGTCTTTGAGTTTCTGTTGGTACTCTGCCTTGATCGCCTTGCACTCTTCGATAGTCCAGCGATGGCGGTTATGGTTTGATTCGATTTCGTCTACTGCTTCCTGCCCGATGCGGCTAATCAGTTCGACGCGATACGGAACGAGATTTCCGCTTTGTGCTGGTTGCACACCACGCATTGCTTGTGAATATTGCGTTCATTAAATCGGAGTTGAGGTGCCGCAGCAGTTGTCCGGTAATGTCCGGCATCCCACTGAGCAGACGTGAGCGTTCCGCAGGAGATACATGGTAAGTCGCGGTCTCTTTCTGATGAAGGCGTTTACGGCTTGTTGGGCTTGTTTAATCCAGTAACTGCGGGGCTTTAAGGCGAGTTTTCGAATCTTAAGTTTATCTTTCTGTTTCTGCTCCTCGTCGTCGTTTCTTCTCTGCTGCTTTTCCGCTTTTCGCGTTCTTTACTTCGTCGTTCGAGTGCTATCTTGGTTCCACTCTGGAGAGCACCACCACTGATTAGCGAATGCAGGGTGAAACCATTCCCGGCATTCATCGTTTTACATCGTCTTCGCGCTGGTTTAGCCATCATCTTCTTCCTCGTGCATCGAGCTATTCGGATCGCTCATCAGTTCTGCGCAGCAGTGCTCACACACGTGAACTTCCAGCACATGCAGCTTCTGACCGCAGTTAGCGCACGTTAAAGCTCGCTCGACGCTTTCTTGTTCGTAACTTCGATTTTGGTCAATCACCTTGTTTTCCTCGCACGACGTCTTAGCCACCGGATATCCCACAGGTGAGCCGTGTAGTTGAAGGTTTTACGTCAGATTCTTTTGGGATTGGCTTGGGTTTATTTCTGGTGCGTTTCGTTGGAAGGTATTTGCAGTTTTCGCAGATTATGTCGGTGATACTTCGTCGCTGTCTCGCCACACGTCCTCCTTTCCTGCGGTAGTGGTAACCCCTGTTGGTGTTCTTTCACACCGGAGACACCATCGATTCCAGTAAGGTTGATTTGGTCGGAAGCGGTTATCTTCTTTGCATTCACCGCACCGATAACATCGCATCATGCAGCTTCCCTCCCGAAGTCGAAATCAAGCTGCCCTCCAAATATTTCGCATGACTCAGAACAAGAGCCGGTATCGAATCTTTTAGCTCGTACCATGTCCTGATACAGGGCTTGATAATCATTTTCTGAATACATTTTCGCGATACCGTCCAGCGACATTCTTCCTCGGTACATAATCTCCTTTGGCGTTTCCCGATGTCCGTCACGCACATGGGATCCCGTGATGACCTCATTAAAACACGCTGCAATCCCTCCTCATCTTTGCAGGCAAGTCCGATTTTGCGTTGATTTTTAATGCAGAATATGCAGTTACCGAGATGTTCCGGTATTTGCAAATCGAATGGTTGTTGCTTCCACCATGCGAGGAGTATCTTCCTTCTCAAAGTCTGACAGTTCAGCAAGATATCTGATTCCAGGCGTTTTGGCTTTAGCCGCTTCGGTTCATCAGCTCTGATGCCAATCCACGTGGTGTAATTCCCTCGCCCGAAATGGTCATCACAGTATTTGGTGAAGGGAACGAGTTTTAATCTGTCAGTGCAGAACGCGCCGCCGACGTATGGAGTGCCATATTTCTTTACCATATCGATAAATGGCTTCAGAACAGGCATTCGCGTCTGAATATCCTTTGGTTCCCATACCGTATAACCATTTGGCTGTCCAAGCTCCGGGTTGATATCAACCTGCAATACGGTGAGCGGTATATCCAGAACTTCACAACTTCCCTGACAAACCGATATGTCATTGGATGTTCACAACCTGTATCCATGAAAACGTAATGCACGTCTTTACCTGCCCGTCGCTTTGCTCCATTAGCCAGAGCAAATATGCTGACGTCCTGCCACCGGAGAAACTAACGACATTTATCATGCAGCCCTGTCTCCCCATCTCGCTTTCCACTCCAGAGCCAGTCTCGCTTCGTCTGACCACTTAACGCCACGCTCTGTACCGAATGCCTGTATAAGCTCTAATAGCTCCCAAATTCGCCTACACGCATCCTGCTGGTTGACTGGCCTTATTACAAAGCCATTCCCGGCAAGGTTAGGAACACACATCCTGCTGCTTTAATGCTGCGGTAACACACACTTCCAGCTTTCTGCATCCAGCCAGCGACCATGCCATTCAACCTGACGAGAGACGTCACCTAAGCAGGCCCATAGCTTCCTGTTTTGGTCTAAGCTGCGGTTGCGTTCCTGAATGGTTACTACGATTGGTTTGGTTGGGTCTGGAAGGATTTGCTGTACTGCGTGAATAGCGTTTTGCTGATGTGCTGGAGATCGAATTTCAAAGGTTAGTTTTTCATGACTTCCCTCTCCCCCAAATAAAGGCCTGCGATTACCAGCAGGCCTGTTATTAGCTCAGTAATGTAGATGGTCATCTTTTAACTCCATATACCGCCAATACCCGTTTCATCGCGGCACTCTGGCGACATCTCCTTAAAACCAGGTTCGTGCTCATCTTTCCTTCCCGTTCTTCCCTGGTAGCAAACCGGTAATACACCGTTCAGACCTTACCTTCGATAACCAGAAGACCTGCCCGTGCCATTTTAGCCGCGGCCTGATTTATGCTGGTTACTGTTGCGCCTGTTAGCGGCAACGTCCGGCGCACAGCACAGGCTATTATGCGTCCCCAGGTAATGAATAATTGCCTCTTTGCCCGTCATACATTGCTCCTTTCAGTCCGAACTTAGCTTTGATTTCTGCGATCTTCGCCAGAGCCTGTGCACGATTTAGAGGTCTACCGCCCATGACAGGAAGTTGTTTTACTGGTTCAGGGATTCGCCTCACCACGGTTAATTCTCGCAGTCATATGGACAAGCTCATCTGCGGCCTTACAGCGTAATCCGCATCAGGCATAGCGCATTGGCCCGCATGTTCTGATACAGGTTGGTAACCAGCCAGTAGTGCGCGTTTGATTTCCACGGATAAGACTCCGCATCCGGATACAGGCCTCGCTTCCGGCAATACTCGTAAACCATATCAACCAGCTCGCTGACGTTTGGCAGTCCGGCGGTAACGGATGCTTCTTCCCGGCACCATGCAACAAACTGCCCGGGTGATGGCAGAAATGGTCGATTCTGGTCGAAATGTCTGCTCGACGGGCTACGCGCATTCCTGCGTTAACCTGTTCCATCGTGGTGATCCCGTTTTCCCCGAAAAGCCAGAACCCACTGGCGACGGATTTCGGTTCACTTCGTTCTGGTCACGGTTAGCCAGGCTCGCCGGGAAAGTTGCCAGTAACTGGCTGAACACACCGTTGATGATCTGCGCTACCTGCTGTACCTGCGGCTTTCGTCGTACTGTTCCGGCATGTTGTTGGCGATCCGACGCATCTGCTCACGTCAAAGTTAACCATCTGTGCGGCGATGTTTCATAGACCCCGTAAATCCAGTCTGTGTTTGTCAGGTCGAGTTTTGGTTTGCTGGCTGTCACGCCTGCCTGTTGCTTGTTACGGTTGATTTCGAGTTGGGTCCACTTATCGCGGGTTTGGCCGGGCCGAGCTCAGCACGTTACCGGACCAGAAGTTGTCCTGGCATGCCCAGCGGAACAGCACACATGTCGCGGTGGTTACGTCCGTCACGTTCACGCATCAGGCGGATATCGTTAGCCCACCCAGCAAAATTCGGTTTTCTGGCTGATGGTGCGATAGTCTTCACCATGTCATGTCAAACACTCTGCGGCGGTCAGTCTTCTGCTGTTCCCCACTTGCTGCCGCTCTGAATTGCAGCATCCATTTTTCACAGAAAGGTCGTTTTCTGGCTGGTCAGGATTCGCCAGAATTCTGACGAATAATCTTTCTTTTCTTTGTATAGTGTCTTTGTGTCCCCTGTTTTGAGGGATAGCAATCCCCAATTTTGAGGGATGTTTTATCCCTCGTTTAGGGATTTTCAGCGTTTGAGGGATGCACCATTCTGAGATGTTTTATTTGGTTACAAACATGCCGCCTTGCTGCTTGATAATATTCATTCTGACGAGTTCTAACTTGGCTTCATTGCACCGTTTGACAGGTAACTTTGTAATCTCGCTACAGTTGAGAATCGGTGATTCTGTCCATTGGTTTATTCCACCCATAGGTTTACGCAGAATGGCAAGCAGCATTTAAACTGTCGCTTGGTCAGATCTGCGCCCGAATAAGCCTCAAGCAGCATATTTGATAGTCTGGCGTAACCATCATCGAGATCTGCCATTACGCTCCTGTCCGGCAAGTTCTCTCTGCCGAAGTTGAGTATTTTGCTGTATTTGTCATAATGACTCCTGTTGATAGATCCAGTAATGACTCAGTAGAACTCCATCTGGATTTGTTCAGAACGCTCGGTTGCCGCCGGGCGTTTATTGGTGTGAGAATCGCAGCAACTTGTCGCGCCAATCGAGCCATGTCGTCGTCAACGACCCCATTCAAGAACAGCAAGCAGCATTGAGAACTTTGGAATCCAGTCCCTCTTCCACCTGCTGATCTGCGACTTATCAACGCCCACAGCTTCCCTGTCTTCTCAGTTCCAAGCATTGCGATTTGTTAAGCAACGCACTCTCGATTCGTAGAGCCTCGTTGCGTTGGCTTTTGCACGAACCATATGTAAGTATTTCCTTAGATAACAATTGATTGAATGTATGCAAATAAATGCATACACCATAGTGTGGTTTAATTTGATGCCCCTTTCAGGGCTGGAATGTGTAAGAGCGGGGTTATTTATGCTGTTGTTTTGTTACTCGGAAGGCTTTACTCTTCCGCATAAACGCTTCCATCAGCGTTTATAGTTAAAAATCTTTCGGCCTGCATGAATGGCCTTGTTGATCGCGCTTTGATACGCCGAGATCTTTAGCTGTCTTGGTTTGCCCAAAGCGCATTGCATAATCTTTCAGGGTATGCGTTGTTCCATACAACCTCCTTAGTACATGCAAGCGTACCGCCAGGTAAAATAGTCAACACGCACGGTGTTAGATATTTATCCTTGCGGTGATAGAGTTAACGTATGAGCACAAAAGAAACCATTAACAAGAGCAGCTTGAGGACGCACGTCGCCTTAAAGCAATTTATGAAAGAAAATGAACTTGGCTTATCCCAGGAATCTGTCGCAGACAAGATGGGGATGGGGCAGTCAGGCGTTGGTGCTTTATTTAATGATGGCATCAATGCATTAAATGCTTATAACGCCGCATTGCTGCTTACAAATTCTCAAATTAGCGTTGAAGAATTTAGCCCTTCAATCGCCAGAGAAATCTACGAGATGTATGAAGCGGTTAGTATGCAGCCGTCACTTAGAAGTGAGTATGAGTAGCTGTTTTTCTCATGTTCAGGCAGGATGTTCTACTAAGCTTAGGACTTTACCAAAGGATGATGAGAGATGGGTAAGCACAACTCAAAAGCCAGTGATTCTGCATCAAGTGCATTCTGGAGGTTGAAGGTAATTCCATGACCGCAGCAACAGGCTCCAACAAGCTTTCCTGACGGAATGTTAATTCTCGTTGACCCTGAGCAGGGCTGTTGAGCCAGCTGATTTCTGCATAGCCAGACTTGGGGGTGATGGATATTTACCTGGTCAAGAAACTGATCAGGATAGCGGTCAGGTGTTTTACAACTAACTAAACCCACAGTACCCAATGATCCCATGCAATGAGTGTTCCGTTGTGGGGAAAGTAAAAGCTAGTCAGTGGCCTGAAGAGACGTTTGGCTGATCGGCAAGGTGTTCTGGTCTGGCGCATAGCTGATAACAATTGAGCAAGAATCTTCATCGAATTAGGGAATTTTCACTCTCCCTCAGAACATAACATAGTAAATGGATTGAATTATGAAGAATGGTTTTTATGCGACTTACGCAGCAAAATAAAGGAAAGATAAGCTCAATAAACCTGTCTGTTTTCCTTAATTCTCCCTGGCTGATAATCACCTGCAGGTTGAGCTCCAATTATTTGTATTCATAAAATCGATGGAAAAACTTTTCTCTTTACCAAACAAATGACAAGAGTCTGGTTCAGAAGATAAATCGCTCTAAAGCTTCAGTTGAAGATAGGGCAGAACAGCCTCGCAGATGACGAATCATTGGGATTCCCATCTTTGTGTTGTTGAAGGCGACACCATTGGTTTTGCCAGAACTGTTCGGGCCGACCACATCCGATCTGACAGATTTTAATCGGGAAAGGAATGTCATTAAGCAGTGGAGAGCGCGTTCAGATAGAGCCACTGATGAGGGGAATCACCAAAGACGATGTTATGCATATGCATTTCATCGGCCGAACAACGGTGAAGGTAGAAGCCAAGCTACCTGTATTTGGCGATATATTAAAGGTCTTAGGGGCAACAGATATTGAAGGGGAGCTTTTGACTCATTGGATATAGTCATTAAGCCAAAATTTAAAGGATATAAAAGGTTGCCAAGGATATTATTTTATACCGTCACCTCAATTTTCAGACATTAGCCTGCGGAAAAGATGAGGCCGGAGATATTTTAACAGAACATTATCTATCAGAAAGGCCATCTCTCAGCCCTCTGAAAAGTCACCAATGCTGAGATAGCTGAAGAGATGAGCTGCATAAGATGCTACGCAAGAATGAAAGTGATATACTGGAATGTTTTTAAAGGCAGGGTGGGCAAAGTTAAGGATTAATTATCAGGAGTAATTATGCGGAACAGAATCATGCCTGGTGTTTACATAGTAATAATTCCTTACGTTATCGTAAGCATTTGCTATCTCCCTTTCCCCTACTACATTCCTGGTGTTTCTTTTCAGCTCATAGAGATGGTCTTGGGGACATTGTCATCATATGCAGGAACCATGATTGCAATGCAATCTGATTGCTGCCTTGACGTTTCTAATCGGAAGCAGAACGCGCCGACTGGCCAAGATTAGAGAGTATGGGTATATGACATCGGTAGTTATTGTCTGCCCTTAGTTTGTTGAGCTTGGAGCTTTGTTTTTCTGCGGGTTATTGCTTCTGTTCCAGCATAAGCGGCTAGCATGATACGCACTATCTCCCATCGGCATTGCCTCTGCATCGTTCATTCATATGCATCCTTGTTTTCCAACTATAATTTGACCAGAACAAGAATCACCCGGCCTCAGCTCGCGGGTTCTTTGCCTCATACGATCGCCCCAAAAACACATAACCAATTGTATTTATTGAAAATAAATAGATACAACTCACTAAACAGCAATTCAGATCTCTCACCTACCAAACAATGCCCCCTTGCAAAATAAATTCATAAACATACAGATAACCATCTTGCGGTGATAATTATCTCTGGCGGTGTTGACATAAATACACTGGCGGTGATACTGAGCACATCAGCAGGACGCCGACTGACCACCATGAAGGTGACGCTCTTAAAATTAAGCCCTGAAGAAGGGCAGCATTCAAAGCAGAAGGCTTTGGGGTGTGATACGAAACGAAGCATTGGCCGTAATGTGCGATTCCGGATTAGCTGCCAAGTGCCTGCGGGGGGTTTTCGTTCAGGACTACAACTGCACACACCACCAAAGGCGACTGACAGGAGAATCCAGATGGATGCACAAAACACGCCGCGAACGTCGCGCAGAGAAACAGGCTCAATGGAAAGCAGCAAATCCCTGTTGGTTGGGGTAAGCGCAAAACCAGTTTAACCGCCTATTCTCTCGCTGAATCGCAAACCGAAATCACGAGTAGAAAGCGCACTAAATCCGATAGACCTTACAGTGCTGGCTGAATACCACAAACAGATTGAAAGCAACCTGCAACGTATTGAGCGCAAGAATCAGCGCACATGGTACAGCAAGCCTGGCGAACGCGGCATAACATGCAGTGGACGCGGAGAAAAAATTAAGGGAAAATCGATTCCTCTTATCTAGTTACTTAGATATTGGCCTTGGCTTTATCTCAATATTATGGATCATAGCTGGCAACTAATTCAGTCCAGTAAATATCCTCAATAGGGAATAATATATGCTTTCCATTCCCATCGGGAAAAGTTTTGTTCAACACACCAAGCTCAATCAACTCACTAATGTATGGGAATTGTTTTGATGTAACCACATATCTTCCTGCCTTCATTAAGGGCTGCGCACAAACCATAGATTGCTCTTCTGTAAGGTTTTGAATTACTGATCGCATTTATCGTTTTGCATCTTAATGCGTTTTCTTAGCTTAAATCGCTTATATCTGGCGCTGGCAATAGCTGATAATCGATGCACATTAATTGCTAGCGAAAATGCAAGAGCAAAGACGAAAACATGCACACATGAGGAATACCGATTCTCATTAACATATTCAGGCCAGTTATCTGGGCTTAAAGCAGAAGTCTAACCCAGATAACGATCATATACATGGTTCTCTCCAGAGGTTCTCATTACTGAACACTCGTCCGAGAATAACGAGTGGATCCATTTCTATACTCATCAAACTGTAGGGGTTGTAATAGTTTATCCGATTTCTCGCTGTAGGGTAACACGAGAACCACGAGCCTGATGTGGTTAAAAGACAGGCACAATCTTTACTACCGCAATCCACTATTTAAGGTGATATGGAAGAAGAATTTGAAGAGTTCGAAGAGCATCCTCAGGATGTGATGGAACAATACCAGGACTATCCGTATGACTACGACTATTGATAAAATCAATGGTGTGGACAATTCAAGCGATGCAATGGATGCAAGCTGCAATCGGAATGCATGGTTAAGCCTGAAGAAATGTTTCCTGTAATGGAAGATGGGAAATATGTCGATAAATGGGCAATACGAACGACGGCAATGATTGCCAGAGAACTTGGTAAACAGAACAACAAAGCTGCCTGATAGTGGCCTTTATTTTGGCATAAATAACAGAATAAACACTGCACTGTGTATTCATTCCAACGAGTGAATACACGATCGCAATGTCGCTCGTAACTAAACAGGAGCCGACTTGTTCTGATTATTGGAAATCTTCTTTGCCCTCCAGTGTGAGGCGATTTTTATCTGTGAGGATATGAACAGATGTCAAACATCAAAATACATCATTGATTACGACTGGAAAGCATCAATAGAAATTGAAATCGACCATGACGTAATGACAGAGGAAAAACTTCACCAGATTAATAATTTCTGGTCAGACTCTGAATACCGACTCAATAAACACGGCTCTGTATTAAATGCTGTATTAATCATGCTGGCGCAACATGCTCTGCTTATAGCAATTTCAAGCGACTTAAATGCATATGGTGTTGTGTGAGTTCGACTGGAATGATGGAAATGGTCAGGAAGGATGGCCTCCAATGGATGTAGCGAAGGAATAAGAATTACCGATATCGATACATCAGGAATATTTGATTCAGATGATATGACTATCAAGGCCGCCTGAGTGCGGTTTTACCGCATACCAATAACGCTTCACTCGAGGCGTTTTTCGTTATGTATAAATAAGGAGCACACCATGCAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGCCCTTCCGAATCTTTACTTGAACGAATCACCCGTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAGTCCCAAAGAATGGATCAAACACTTATGGCTATCCAGACTAAATTCACTATCGCCACTTTTATTGGCGATGAAAGATGTTTCGTGAAGCCGTCGACGCTTATAAAATGGATATTAATACTGAAACTGAGATCAAGCAAAGCATTCACTAACCCCTTTCCTGTTTTCCTAATCAGCCCGGCATTTCGCGGGCGATATTTTCACAGCTATTTCAGGAGTTCAGCCATGAAACGCTTATTACATTCAGGATCGTCTTGAGGCTCAGAGCTGGGCGCGTCACTACCAGCAGCTTCCCGTGAAGAGAAAGAGGCAGAACTGGCAGACGACATGGAAAAGGCCTGCCCCAGCACCTGTTTGAATCGCTATGCATCGATCAGCTTTGCAACGCCACGGGGCCAGCAAAATCCATTACCCGTGCGTTTGATGACGATGTTGAGTTTCAGGAGCGCATGGCAGAACACATCCGGTACATGGTTGAAACCATTGCTCACCACCAGGTTGATATTGATTCAGAGGTATAAACGAATGAGTACTGCACTCGCAACGCCGCTGGCTGGGAAGCTGGCTGAACGTCGGCATGGATTCTGTCGACCCACAGGAACTGATCACCACTCTTCGCCAGACGGCATTTAAAGGTGATGCCAGCGATGCGCAGTTCATCGCATTACTGATCGTTGCCAACCAGTACGGCCTTAATCCGTGGACGAAAGAAATTTACGCCTTTCCTGATAAGCAGAATGGCATCGTTCCGGTGGTGGGCGTTGATGGCTGGTCCCGCATCATCAATGAAAACCAGCAGTTTGATGGCATGGACTTTGAGCAGGACAATGAATCCTGTACATGCCGGATTTACCGCAAGGACCGTAATCATCCGATCTGCGTTACCGAATGGATGGATGAATGCCGCCGCGAACCATTCAAACTCGCGAAGGCAGAGAAGGGACGGGGCCGTGGCAGTCGCATCCCAAACGGATGTTACGTCATAAAGCCATGATTCAGTGTGCCCGTCTGGCCTTCGGATTTGCTGGTATCTATGACAAGGATGAAGCCGAGCGCGCATTGTCGAAAATACTGCATACACTGCAGAACGTCAGCCGGAACGCGACATCACTCCGGTTAACGATGAAACCATGCAGGAGATTAACACTCTGCTGATCGCCCTGGATAAAACATGGGATGACGACTTATTGCCGCTCTGTTCCCAGATATTTCGCCGCGACATTCGTGCATCGTCAGAACTGACACAGGCCGAAGCAGTAAAAGCTCTTGGATTCCTGAAACAGAAAGCCGCAGAGCAGAAGGTGGCAGCATGACACCGGACATTATCCTGCAGCGTACCGGGATCGATGTGAGAGCTGTCGAACAGGGGATGATGCGTGGCACAAATTACGGCTCGGCGTCATCACCGCTTCAGAAGTTCACAACGTGAGCGAAAACCCCGCTCCGGAAAGAAGTGGCCTGACATGAAAATGTCCTACTTCCACACCGCTGCTTGCTGAGGTTATTGCACCGGTGTGGCTCCGGAAGTTAACGCTAAAGCACTGGCCTGGGGAAAACAGTACGAGAACGACGCCAGAACCCTGTTTGAATTCACTTCCGGCGTGAATGTTACTGAATCCCCGATCATCTATCGCGACGAAAGTATGCGTACCGCCTGCTCTCTCCCGATGGTTTATGCAGTGACGGCAACGGCCTTGAACTGAAATGCCCGTTTACCTCCCGGGATTTCATGAAGTTCCGGCTCGGTGGTTTCGAGGCCATAAAGTCAGCTTACATGGCCCAGGTGCAGTACAGCATGTGGGTGACGCGAAAAATGCCTGGTACTTTGCCAACTATGACCCGCGTATGAAGCGTGAAGGCCTGCCTGCATTATGTCGTGATTGAGCGGGGATGAAAAAGTACATGGCGAGTTTTGACGAGATCGTGCCGGAGTTCATCGAAAAATGGACGGAGCACTGGCTGAAATTGGTTTTGTATTTGGGGAGCAATGGCGATGACGCATCCTCACGATAATATCCGGGTAGGCGCAATCACTTTCGTCTACTCCGTATACAAAGCGAGGCTGGGTATTTCCCGGCCTTTCTGTTATCCGAAATCCACTGAAAGCACAGCGGCTGGCTGAGGAGATAAATAATAAACGAGGGGCTGTATGCACAAAGCATCTTCTGTTGAGTTAAGAACGAGTATCCAGATGGCACATAGCCTTGCTCAAATTGGAATCAGGTTTGTGCCAATACCAGTAGAAACAGACGAAGAATTTCATACGTTAGCCGCATCCCTTTCACAAAAGCTGGAAATGATGGTGGCGAAAGCAGAAGCAGATGAGAGAAACCAGGTATGACAACCACGGAATGCATTTTCTGGCAGCGGGCTTCATATTCTGTGTGCTTATGCTTGCCGACATGGGACTTGTTCAATGACACCTCAGCAGGAAACGCCCTTCGCAGCATTGCCCGTCAGGCTAATTCTGAAATCAAAAGCCAGACAGCAGTTTCCGGATAAAACGTCGATGACATTTGCCGTAGCGTACTGAAGAAGCACCGCGAAACGGTAACGGTGATGATGGGATTCACACCGACTCATTTAAGCCTGGCAATCGGCATGTTAAACGGCGTCTTTAAGGAACGATGAACATGAAAAGCAAATCATCAGGGAGCTACAGGCTCCTTTTATTATTCGCATTCACCTCAAGCGTATTAACCAACAGTTCAGGGATTAATGAAAGATGGCAGACATCATTGATTCAGCATCAGAAATAGAAGAATTACAGCGCAACACAGCAATAAAATGCGCCGCCTGAACCACCAGGCTATATCTGCCACTCATTGTTGCTGAGTGTGGCGATCCGATAGATGAACGAAGACGCCTGGTCGTTCAGGGTTGTCGACTTGTGCAAGTGCCAGGAGGATCTGGAACTTATCAGTAAACAGAGAGGTTCGAAGTGAGCGAAATTAACTCTCAGGCACTGCGTGAAGCGGCAGAGCAGGCAATGCATGACGACTGGGGATTTGACGCAGACCTTTCCATGAATTGGTAACACCATCGATTGTGCTGGAACTGCTGATGATGAACGGGAAAGAAACCAGCAATACATCAAACGCCGCGACCAGGAGAACGAGGATATTGCGCTAACAGTAGGGAAACTGCGTGTTGAGCTTGAAACAGCAAATCAAAACTCAACGAGCAGCGTGAGTATTACGAAGGTGTTATCTCGGATGGGAGTAAGCGTATTGCTAAACTGGAAAGCAACGAAGTCCGTGAAGACGGAAACCAGTTTCTTGTTGTTCGCCATCCTGGGAAGACTCCTGTTATCAAGCACTGCACTGACCTGGAAGAGTTTCTGCGGCAGTTAATCGAACAAGACCCGTTAGTAACTATCGACATCATTACGCATCGCTATTACGGGGTTGGAGGTCAATGGGTTCAGGATGCAGCTGAGTATCTGCATATGATGTCTGACGCTGGCATTCGCATCAAAGGAGAGTGAGATCGGTTTTAAAAAAGATAACGCTTGTGAAATGCTGAATTTCGCGTCGTCTTCACAGCGATGCCAGAGTCTGTAGTGTCAGATGATGACCGTACTCAAACATCGGGTTGAGTATTATCTTACTGTTTCTTTACATAAACATTGCTGATACCGTTTACTGCTGAAACGACATACATTGCAAGGAGTTTATAAATGAGTATCAATGAGTTAGAGTCTGAGCAAAAGATTGGGCGTTATCAATGTTGTGCAGATCCTTGTCTTGTCTCCATGCAGACATCACGAAGGTGTTTATGTAGATGAAGGTATAGATATAGAGTCGGCATACAAATATTCCATGAAGGTTTATAAGTCTAATGAAGACAAATCCCCATTCTGCAATGTGCGAGAAATGACTGATACCGTGCAAAATTATTATCACGAGTACGGTGGAAACGATACTTGCCCTCTCTGTACAAAACATATAGATGATTAAACCCAATATTACATAACAATCCTCGCACTCGCGGGGATTTATTTTATCTGAACTCGGACGGCGGGTTTGTTTATGGAGATGATAAATGCACTTCCGAGTCACAGGGAATGGAATGGAGAGCCATTCAACAGAGTTATCGAAGCGGAGAACATCAACGACTGCTACGACCACTGGATGATATGGGCGCAGATAGCACATGGCACGTAACGTAATATTCGAATTGAAGAACTGAAAGAACACCAAAGCCGCCTGATGGCGGTTTTTCTTGCGTGTAATTGCGGAGACTTTGCGATGTACTTGACACTTCAGGAGTGGAACGCACGCCAGCGACGTCCAAGAAGCCTTGAAACAGTTCGTCGATGGGTTCGGGAATGCAGGATATTCCCACCTCCGGTTAAGGATGGAAGAGAGTATCTGTTCCACGAATCAGCGGTAAAGGTTGACTTAAATCGACCAGTAACAGGGCCTTTGAAGAGGATCAGAAATGGGAAGAAGGCGAAGTCATGAGCGCCGGGATTTACCCCTAACCTTTATAAGAAACAATGGATATTACTGCTACAGGGCATCAAGGACGGGTAAAGAGTTTGGATTAGGCAGACAGCGAATCGCAATCACTGAAGCTATACAGGCCAACCAACATTGAGTTATTTTCCAGGACACAACACAAGCCTCTGACAGCGAGAATCAACAGTGATAATTCCGTTACGTTACATTCATGGCTTGATCGCTACGAAAAATCCTGGCCAGCAGAGGAATCAAGCAGAAGACACTCATAAATTACATGAGCAAATTAAAGCAATAAGGAGGGGTCTGCCTGATGCTCCACTTGAAGACATCACACAAAGAAATTGCGGCAATGCTCAATGGATACATAGACGAGGGCAAGGCGGCGTCAGCCAAGTTAATCAGATCAACACTGAGCGATGCATTCCGAGAGGCAATAGCTGAAGGCCATATAACAAACCATGTCGCTGCCACTCGCGCAGCAAATCAGAGGTAAGGAGATCAAGACTTACGGCTGACGAATACCTGAAAATTTATCAAGCAGCAGAATCATCACCATGTTGGCTCAGACTTGCAATGGAACTGGCTGTTGTTACCGGGCAACGAGTTGGTGATTTATGCGAAATGAAGTGGTCTGATATCGTAGATGGATATCTTTATGTCGAGCAAAGCAAAACAGGCGTAAATTGCCATCCCAACAGCATTGCATATTGATGCTCTCGGAATATCAATGAAGGAAACACTTGATAAATGCAAAGAGATTCTTGGCGGAGAAACCATAATTGCATCTACTCGTCGCGAACCGCTTTCATCCGGCACAGTATCACTAGGTATTTATGCGCGCACGAAAAGCATCAGGTCTTTCCTTCGAAGGGATCCGCCTAGCCTTTCACGAGTGCGCAGTTTGTCTGCAAGACTCTATGAGAAGCAGATAAGCGATAAGTTTGCTCAACATCTTTCTCGGGCATAAGTCGGACACCATGGCATCACAGTATCGTGATGACAGAGGCAGGGAGTGGGACAAATTGAAATCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTTATAATGCCAACTTAGTATAAAAGCTGAACGAGAAACGTAAATGATATAAATATCAATATTAAATTAGATTTTGCATAAAACAGACTACATAATACTGTAAAACACAACATATGCAGTCACTATGAATCAACTACTTAGATGGTATTAGTACTATGTAACAGAGCATTAGCGCAAGGTGATTTTGTCTTCTTGCGCCTAATTTGTCATCAAACCTGTCGCACTCCCAGAGAAGCACAAAGCCTCGCAATCCAGTGCAAAGCTTTGTGTGCCACCCACTACGACCTGCATAACCAGTAAGAAGATAGCAGTGATGTCAAACGACGCAGCTGACTTCTTTCTTTCTTTCACGACTTCCCCACACCCAGCATGCATACCTTTCCGCCATAACTGTAGTGAATGTCTGTTGAGCGGACCAGGGAGCGGAAGTTAACACTTATGAAAATGGCTACGAAGTCGTGGCTATCTATCGGCTTATTAGTACTTGAAACGCTTCTTCAGAAGCCTGAAGAGCTAATCGTTCGGCGATACTATATGCATTAATAGACTATATCGTTGGTATAAACAGTGCACCATGCAACATGAATAACAGTGGGTCTGTAAAAGGAAGCAGAAAGCTAAATATGGAAAACTACAATACGATGCCCCGTTAAGTTCAATACTACTAATTTAGATGGAAAACGTATGTAATAGAGAGTAACTTAAAGAGAGATCCTGTGTTGCCGCCAAATAAATTGCGGTTATTTTAATAAAATTAAGGGTTACTATATGTTGGAGTTTAGTGTTATTGAAAGAGGCGGGTATATTCCTGCAGTAGAAAAATAAGGCATTCCTACGAGCAGATGGTTGGAATGACTATTCCTTTGTTACAATGTTTTATCTTACTGTCTTTGATGAGCATGGTGAAAATGCGATATCGGAAATGTTAAAATTGGTTTTGTAGGTCAAAAGAAGAAGTAAGCACTTATTCATTAATAGATAAATTCAGTCAACTCCCTGAAATGTTTTTTCCTTAGGTGAAAGCATTGACTACTATGTTAATCTCAGCAAATTAAGCGATGGTTTAAACATAACCTTCTTAAAGCTATTCAGGATTTAGTAGTATGGCCAAATCGATTAGCCGACATTGAAAATGAAAGCGTCCTTAACACCTCATTACTTAGAGGGGTAACTCTTTCAGAAATTCATGGACAGTTCGCACGTGTTAAATGGTTTGCCAGAATTGTCAGATTTCCATTTTCATTTAATAGAAAAGTGCTCCCGGATTCAGTGATAACTATACCTTTTGAGGTGACGGTTAATTCTATGCCCAGCACGAACATTCATGCTTTATCGGGCGGAATGGGTGGTAAAACAACAATTTTGAATGGAATGATTGGTGCAATCACCAACCCAGAAAACAATGAATATTTTCTCTGAAAATAATAGACTTATCGAGTCAAGAATCCCAAAGGGATATTTTCGATCGCTTGTTTCAGTTTCGTTTAGTGCATTTGATCCTTTACTCCTCCTAAAGAACAACCTGACCCAGCAAAGGTACACAATACTTTTATTGGACTCAAGAATGCTGCCAGCAATAGTTTAAAATACTAGGCGATCTCCGCTTAGAATTCATTTCAGCATTTATTGGTTGTATGAGAGTAGATAGAAAGACAACTCTGGCTTGAAGCTATCAAAAACTAAGTAGTGATGAAAACTTTCAAATATGGAACTCATCAGCCTCATTTCTAAATATGAAGAGTTAAGACGTAATGAACCACAGATTCAAGTGGACGATGATAAATTCACTAAATTGTTTTATGACAATATCCAGAAATATCTGCTTCGAATGAGCTCTGGACATGCAATTGTTTTATTTACTATCACAAGATTAGTAGATGTCGTTGGCGAAAGTCATTAGTTTTATTCGATGAACCAGAGGTTCATCTGCATCACCTTTGCTCTCTGCTTTTACGAACATTAAGCGACTTACTCGATGCACGCAATGGTGTAGCAATAATTGCAACTGCAACTCATTCCCCAGTAGTACTGCAAGAGGTTCCAAATCCTGCATGTGGAAAGTCCTACGTCAAGAGAAGCAATAAATATTATCCGTCCGGATATTGAGACATTCGGTGAGAACTTAGGTGTTTTAACTCGTGAGGTGTTTTACTTGAAGTGACAAATTCTGGATACCACCACTTATTATCGCAGTCCGTTGATTCAGAGCTTTCTTATGAAACCATTCTAAAATTATAATGGTCAGATAGGATTAGAAGGTCGAACCGTTTAAAGCGATGATAATGAACAGAGATGAAGGTAAAGTACAATGAAAAACTACCTCTTCCAGCGAGAACTTATAGCGAAATGCTTAATAAATGCTCGGAAGGTATGATGCAGATAAATGTTAGAAATAATTTCATTACTCACTTCCCCACTTTTTGGCAGAAAGAACAACAATATAGAATATTAAGCTCGACAGTCAGTTATTTACCTACGACAGGACACACCCTCTTGAGCCTACAACCCTAGTTGTAGTTGGTAACCTGACAAAGGTTAAATTAGAAAAGCTTTTATGAAAATAATCTCCGATAAAAACAAACCCGCTAGAACATATTACGATGACATGCTTGTTTCATCAGGTGAAAATGTCATTTTTGTGGTATAGACAGACAAAATATAGATCATTTTCTTCCTATTGCACATTATCCTGAATTTTCGGTGATGCCTATTAATTAGTTCCATTCCATCGTGCCGCGACTGCAATATGGGAGAGAGAAAGGTCAAGTTTTCGCAGTAGATGAGGTACACCAAGCGATTCATCCCTATATCTGACAAGGACATTTTTCGTGAGCAATGGGTATATGCAAATTTCGTTTCCGGAACTCCGGGTGCTATCAGTTTTATGTTGAATGCCCGGCGAACTGGAGGCAGGAAGACAAACACAGAGCTCTTCATCATTTCAAGCTATTAAATATTGCTAACAGGTATCGTTTGGAGGCAGGGAAGCACTTGAGTGAAGTGATTACTCAAAGAAACTCTTTCGTAAAGTTATAAGGAAATATAGTTCAACCGCAACGTTTCAGCTACAGTCAGAATTTATTGAAGCAAATCTGAAACCTATTATAGATTTGAATGACTTCCCCAATTATTGGAAAAGAGTTATGTATCAGTGCCTAGCAAACTCGGAAGATTTTCAGAGGGATCTAGAATATGATGAAAGATAGAAAATTACGACGCTTATCGGAAGTGAACGAATACTTTTTTATGAGGAGGCTGTTTTACAAATCCGGTAGTAACTTGCTAACCAATTCCTAGGCAGGTCATTGGCAACAGTGGCATGCACCGAGAAGGACGTTTGTAATGTCCGTATCCGGCACATAGCAGTCCTAGGGACAGTGGCGTACAGTCATAGATGGTCGGTGGGAGGTGGTACAAATTCTCTCATGCAAAATATGTAAATCGGTAGCAACTGGAAATCATTCAACACCCGCACTATCGGAAGTTCACCAGCCAGCCGCAGCACGTTCCTGCATACGACGTGTCTGCGGCTCTACCATATCTCCTATGAGCAACGTGTTAGCAGAGCCAAGCCACACTCTAATTTAATACATAATGAATGATAATAATAATATTAAATTTCCTGTGTAACTAATTTACTATGGTTTCTGATAAGAATCATTGCAAAGATCAAACAACTTGTATTACATTGACAGTTAAGCAGTTAATTTACCTCTAAATATATCAGCATCTAGCATGCAACCTATCAAAATGGAGAGTTTATGACTAAAACCATGGGAAAGAAGACTTAAAGATTTATCGCACTTGCTCAAATGCTGCATTGATACATATTTTGACCCTGAATTATTTCGCTTGAATTTGAATCAATTCCTCCAAACCGCAAGAACAGTAACATTTATTATTCAAAAACAAAACCAGATTATAGGATATGACATTTGGTATAACAATAATGTTATTGAAAATGGAAAATGATCCATTAATGGCTTGGGCTAAAATTCTCGCAATACGATAGAAAACAAGGCGATTTAGAAATGTATAGCGAGGCAAAGAGGCTACTCTTATTTCATCTTACATTGAAGAAAATGACATTGAGTTTATTACAAATGAAAGTATGTTAAACATTGGTATAAAAGTTAGTCAGACTTGCACAAAAGAAATTACCTTCATATTTAACTGAATCATCTATTATTAAATCAGAAAGACGATGGGTCGCTAATACGCTAAAAGATTACGAATTATTACATGCCTTAGCTATAATCTATGGCAGAATGTATAACTGCTGTAACTCTCTTGGCATACAAATAAACAATCCAATGGGTGACGATGTGATTTCGCCAACATCATTCGACTCTTTATTTGATGAAGCCAGGAGAATAACTTATTTAAAATTAAAGATTACTCCATAAGCAAATTGTCATTTAGCATGATACAATATGACAATAAAATAATTCCTGAAGATATTAAAGAGCGTCTAAAACTGGTAGATAAGCCTAAAATATCACTTCGACAGAAGAGTTAGTTGACTATACAGCCAAGCTTGCAGAAACGACTTTTAAAGGACGGTTATCACATTCAAACATTAATTTTATGATAAACAATTCCATCCAATTGATTTAATCAATACAACATTTGAAGATCAAGCAGATAAATATATTTTGGCGTTATGCAGCTGACAGAGCCAAAATAACAAATGCCTATGGCTTCATTTGGATATCAGAGCTATGGCTCAGAAAAGCAAGCATCTACTCCAATAAACCAATACATACAATGCCAATTATAGATGAAAGACTTCAGGTAATTGGAATTGATTCAAATAATAATCAAAATGTATTTCATGGAAAATAGTTAGAGAAAACGAAGAAAAACCGACTTTAGAAATATCAACAGCAGACTCAAACATGACGAAAAACCATATTTCATGCGTTCAGTCTTAAAGCAATTGGCGGTGATGTAAACACTATGAACAATTGAGTCATAGAACTTCCATTATTCTCCTGAAGATAATAATCGCCAAATAAACCAATACTCAGCTTTACAATATACTAACTAACCGCAGAACGTTATTTCATACAACGTTTCTGCGGCATATCACAAACGATTACTCCATAACAGGGACAGCAGGCCACTCAATATCAGGTGCAGTTGATGTATCAACACGGTTCAGCAACACCGATACTTCTTCCAGGCTTCCAGCAACGAGGTTTCTTCCTTCGTTGCAATTTCCAGATCTGCAGCATCCTGAAGCGGCGCAATATGCTCACTGGCTACCTGCATCAGGCTTTGTTTCTTCCGCCTCCCGGATCCGGAACAGTTTTTCTGCTTCGTATCCTTCACCAGGCTGTGCCGTTGTTCCACTTCTGATATTCCCTCCCGGCGATAACCAGGTAAATTTTCCGGTAACGGACCCGAGTTCAGAAATAAATAACGCGTCGCCGGAAGCCACGTCATAGACGGTTTTACCCCGATGGTCTTCAACGAGATGCCACGATGCCTCATCACTGTTTGAACAGCCACAAAGCCAGCCGGAATATCTGGCGGTGCAATATCGGTACTGTTTGCAGGCAGACCGTATGAGGCGGAAATATGCGTCACCTTCACCAATAAATTCATTAGTTCCGGCCAGCAGATTATAAATTTATGGTCCGTGGTTGTTCACTCATTCTGAATGCCATTATGCAAGCCTCAACAATAGTTAAATGCAATGTTTTGACGGTGTTTTCCGCGTTACCCGCAGCGTTAACGGATGATGTGTCCGTGTGAACCAATACTGAAAGAATGGGCATGAGCACCGATAACAACCGGATGCTGGTGCGCACCAATACCAACTGTATGCATGCATGTGCAGCGGCACTCACGGCTGTACCGGACAATGAGTGACTGTGGCTGCCCTGACTGTCCGTTTTCGATAAATAAGCAATACCTGTGTGCTGGTTCCTTTAACTGTGGATAAACTTCCTGTAATGGTTGCTGTTCCATACTGACTCCAGCCAGAACTGTTCATCCTTAAACCACTTGTGGCATGAGCACCCGCGGCCCCTGTTGAACCGCTCAGACTGTGAGAGCATGAGCCCCCGTGTTATTCGTCGATTTGGTGCCGTAATCGAAACTGCCTGTTGTTTTCGTCCCGTAATCAAACGACGATGTGGTTTTCGTCCCCAAATCCGTACCGGATGCACTGGCACTGTGGGTGTGCGACTTAATTCCATCCTGTTCCTGAGACAATACAGCACGACCGCTGGCGGGTTTCCCCTTGATTGTCCAGCCTCGCATATCAGGAAGCACACCCGATGGATACGCGACAGCAAGTTTTGGGTAGGCTGATTTGTCAAAAACGCCTGCCCTGCATCAGGACGTAGCCAGACGGAACGATATCTGATGGCCACGGGGATCGGCGCACCTGCCGGAAAGGCCGAATTCTCACCGGCCCCAAGGTATTCAAGAACATCTGCAACGGAATTTTGCCAGAATATCCCTGCCAACCTGAGTCAGTTCAGTCAGGCTGGCGGCATCATTTCCGCAAAATACGGTAATTTATTTTCGCCGTGGAAGCCCTGCCAGCGCCGTCAGTGTCGCATTCTTCGGTTGTTTACCCGCAAGCGCGTTAGTCATGGTGGTAGCAAAATCTGGATCATTCCCGAGCGCTGCGGCCAGTTCATTCAGCGTATTCAGTGCGTCAGGTGACGCGTCGATAACATCTGCAATCGCGGCCAGTACAAAGCGGTGTTCGCAATCTGGGTATTGTTTGTTCCCTGAGCGCGTTTGGTGCTGTTGGCGTTCCGGTCAGTGCCGGACTGTCCAGTGGGCTTTTCTGTTCGTTTCATCCATTACCACCTTAACCGCCTTTGGCGTTGCAGCAAGCGTTTCAGACGTGCTGTTGGTTGCACTGCTGAGCTGCACTATCCCTTTCTCGTTGTGTCCGCATCCTCAAGCGCGACAGCTGAAGCTATATCTTCTGCACGTTTTGCCGAATTTTGCACGTATTGCCGCCGCTTCTGCCGCACTTTTGCTCTGCGATGCTGATACCGCACTTCCCGCAGCCTCTGTCGCCTTCGTGGATGCCGTTGACGCACTCCCGCCGCCGCCTGTTTTGCGTCTGCCGCGGCAGGCAGAGGCTCCGTTCCGCTGCTGTTTCAGATGACCTGGCATTCGTCTCGGACGTTTTGCCGCCCTGGCAGAGAATTTTCTGCCGCCGTTGCCGAGGAAGCTGCACGACCGGCACTTGATGATGCGTTCGTTTCTGATGATTTTGCTGCCTCTTTGAGGCCACCGCATCTCGTGCTGAAGTGGCGGCCTCTGACGCTTTCGTGGCCCGGTGGAGGCAGACGTGGCTGGCTGATTGTTGACGCTGCAGCATTCGTTTCTGACGTTTTCGCCGCACCGGCACTGGGCCGCCGCCGCGTTTTTGAGGACTCTGCGGCTGCGGCACTTTTCCGCTTCAGTGGCCTTTGCTGATGCCGCTTCTGCGCCGGAGGACGCTTCCTGAGCTGACGATGCAGCCTGTCCGGCGACGTGCTGCGGCGGCGCGTGCTGAGTCAGTTGCATCAGTCACAAGGGCCGCGACCTGAGCAGCTGATGCACTGGCATCGCCGGCTGATTTCTTCGCGTCTGCCGTACTCTGTGCCACCACGGACGCGTTACGCGCCACCTCTTCCACCATCAGTTCAAGACGACGCAGCACCTCCGGCCGGGCATCATCCTCCGTCATGGCACAGAGAAAATCATTCAGCGTCCCCGGTTGTGAATCTTCATACACGGTGATGGTCCCGGCGTGCGATGGTGGAAAACCGTCAACCTGCAGGATGACACTGTACTGACCGTACTCCACATCCATGCTGTAACGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCACCACCACCGTGGTGCTGTTACGTCTGGCTTTCAGCTGAATGGTGCAGTAGTCTGTACCGGTTTTCCTGTGCCGTCTTTCAGGACTCCTGAAATCTTTACTGCCATATTCACCCCACAAAGCCCACCGGTTCCGGCGGGCTGTCATAACACTGTGTTACCTGGCTAATCAGAATTTATAACCGACCCCAACGATGAATCCGTCAGTACGCCAGTCGCCACTGCCGGAGCCTTCATAAGCAATATCAACAACGACGGACGCTGCCGGATTAATCTGTATACCTGCACTCCACGCCACTGAGGTATGCCGCATTGCACTTTCGTCCCTGGCAGTGGTCGTCTCCTTTCATATACCCGGGAGTGATTTCCGTCTTACGGTAATCCATTGTACTGCCGGACCACCGACTGTGAGCCACTCCGGCCATGGCGTACGCACTGACCTGCTTACTGATTTGTAAAACCGGTCCGGCCATCACGCTCACATAACGTCCACGCAGGCTCTCATAGTGAAACGTATCCTCCCCGGTCATCACTGTGCTGCTCTTTTCGACGCGGCGAACCCCAGGGAAGCCATCGGCCCACACTGTCCGTCAGCTCATAACGGTACTTCACGTTAATCCCTTTCAGATGACTCACACCGGTATCCCCGCCCGACAACGACGGCAATGTACCCGGTTTCACTTGAAAATAGCCCACCGTAAACGTACCATGTCCTTCGCACGGGCCGGAGTGACTGTCACCGCAAGTGCGGCAAAGACAGCAACGGCAATACACATTACGCATCGTTCACCTCTCACTGTTTATAATAAACGCCCGTTCCCGGACGACCTCTGTAACACACTCAGACCACGCTGATGCCCAGCGCCTGTTTCTTAATCACCATAACCTGCACATCGCTGGCAAACGTATACGGCGGAATATCTGCCGAATGCCGTGGACGTAAGCGTGAACGTCAGGATCACGTTTCCCCGACCCGCTGGCAGTCAACAATACGGGAGAACACCTGTACCGCCTCGTTCGCCGCGCCATCATAAATCACCGCACCGTTCATCAGTACTTTCAGATAACATCAACGAATACGTTGTCCTGCCGCTGACAGTACGCTTACTTCCTAGAAACGTCAGCGGAAGCACCACTATCTGGCGATCAAAAGGATGGTCATCGGTCACGGTGACAGTACGGACTGCCTGACGGCCAGTCCACTGCTTTCACGCTGGGGCGGAAAAGCCGCGCTCGCCGCCTTTACAATGTCCCCGACGATTTTCCGCCTCAGCGTACCGTTTATCGTACAGTTTTCAGCTATCGTCACATTACTGAGCGTCCGGAGTTCGCATTCACACTGCCACTGATATCCGCATTTTAGCGGTCAGCTTTCCGTCCGGTGTTAGGAAAGGCCGGAGGATTGCCGCCGCTGGTAATGGTGGGGGCCGTCAGGCGCTTCAGGAACACGTCGTTCATGAATATCTGGTTGCCCTGCGCCACAAACATCGGCGTTTCATTCCCGTTTGCCGGGTCAATAAATGCGATACGATTGGCGGCAACCAGAAACTGGCTCAGTTTGCCTTCCTCCGTGTCCTCCATGCTGAGGCCAATACCCGCGACATAATGTTTGCCGTCTTTGGTCTGCTCAATTTGACAGCCCACATGGCATTCCACTTATCACTGGCATCCTTCCACTCTTTCGAAAACTCCTCCAGTCTGCTGGCGTTATCCTCCGTCAGCTCGACTTTTCCAGCAGCTCCTTGCCGAGATGGGATTCGGTTATCTTGCCTTTGAAAATCCAGGTAACCTTCCGCATCATCGCTCGCCCGACCGACGGCCTCCACGAATGCCGATTTGCCAACGGTGTTCACACTGCGGATATAAAGTAATAATCATGGCCCGGTTTGATATTGATACTGGCGGCTATCCAGTACAGCGCCGTACCAAGATAACGCGTGCTGGTTTCAACCTGTCTGATATCCGCAATCTGCTTTTCCGAGAACCAGAACTCAAACTGTACCGTCGGGTCATAAACGGCAAGATGCGGCGTGGCGGTTATCTGAAAATAGCCCGGCGTCAGCTCAATCCTCGACGGTGCTGCCGGTGCGGCAATCCGGAACGATACCGACGCCGGATCGCCCTGCTGCCCCACGCATTTACCGCCCGGACTGTCAGCCTGTAGTTCCCCAGCGCCAGTTGCGTGAAGCGGTATGTGGTTTCCGTCGTCCGGGCCGTGCTGACCAGCCGCTCACTGCCGTCGTCCGCTGTACACGTCAGACGGAGCAGGAAACTCACGCCCTTCACCACCTTCGGTGTGTCCCATCGCGCCAGCACCTGATATTCCCGCTGTCTGCAGTGACTTCTGCGGTCAGGTGCTGCACCGCTGGCGGCGTGACACCATTCACCGTGCCACTCTGTTCGCCGTCAAAGTGCGCCCCGTTATCCACGATGGCCTCTTTTCCGGCACATGCTGCACGGCGGTGATGGCATACGTGCCGTCGTCGTTCTCACGGATACTCACGCAGCGGAACAGTCGCTGGCGCAGCGCAGCGTCGGCAGCTTCAGCTCCCATACGCTGTATTCAGCAACACCGTCAGGAACACGGCTCATTTTACCTTCACGCCGTCGGTGACGGCTGACTGAACCTCCACGCTGACCGGATTGCCACTTCCGTCAACCAGGCTTATCAGCGCGGGGGAGGAGGATGGCAGCGTGATTTCACGGTCGAGCGTCAGCGTCCGGGTCTGGCTGTTCACCGCCAGCCAGCACACGACCACCGGTGCTGATACCGGCATAGTCATCATCGCAGATTTCAATAACATCGCCCGGTACATGGCGAAGCCCCTTCTGCGCCGACGCTGAAATCCACGGTCTGCGTTTCCAGCAGTTCTGTTTTAATCAGCCACAGCCCGGCGCGGTGTGCCTGCCCCGGCTGGTACAGCCAAAGGCATCCATCTTCGTAACATTACGACCGTAACGGGCAATGGCCTGCGTATCTTCAACAAGCTCTGTCGCCGTCTCCCAGCCGTTGTTCGGGTCAATCCAGTTCACCTCAACGGCATTATGGCGCGGTCCTTCAGGGCGCTGAAGCTGTAGCGGAACGGCGCGCCATCATCCGGCATCACCACATTACTGCGGTTATAGTCCACGTCTTATCCGACGGTCGGTCCTGCACGAACGTCAGCGTGCTGCCCGTTCCATACCGGCATACAGCGCATCGCCGAGCAGAAATCGCTGAGCACATCCCACGCCTTACGCTGTGGTCAGGTACGCATTACAGGTGATGCGGCGCGGCGCTCCGTGCCGCCAAAGCCGTCCGGCACTGACTGGTCGCAGTACTGGCCGATGACATACAGCGCCCATTTATCCACATCCGCCGCACCAAGACGTTTCCCCATGCCGTAGCGCGGATGGGTCAGCATATCCCACAGACACCAGGCCATGTTGTTGCTGTATGCCGGTTAAACGTTCCGTCCCAGATACCGCTGTATTGCCGCGTCTGCGGGTTATAGTTCGACGGCACCTGCAGAATACGCCCGCGCAGATGATAATTACGGCTCACCTGCTGGCTGCCGAACTGCTCCGAGTCCACCTGCACGCCGACCAGTGCCGTGTTCGGGTAGCACTGTTTCACATCGATGATTTCAGTGTATGACGACCAGAGCGTTTTGTTCTGCAGCTGGTCTGTGGTGCTGTCCGGCGTCATCCTGCGCATCCGGATATTAAACGGGCGCGGCGGCAGGTTACCCATCACCACCGAGGCCAGATACTGCAGGTGGTTTTGCCCTTAATGGTGATGTCTTTTCCGTTACCCAGCCACCGTTACGTTGTATCTGAACCAGCAGGCGGACTTCCGACGGATTCCTGTCACCCTTTGAGGTGGTTTCCACCAGTGCCTGTACACCGAAGGTAAAGCGCAGACGGTCGATGTTTGCAGACGTAATGGTGCGGGTGATCGGGCGTCATATTTCACTTCCGTACCCAGCACCGTCTCGGAGCCGGAGGATTCAAATCCCTCCGGCGGAGTCTGCTCCTGCTCACCAGCCCGGAACACCACCGTGACAGGATATGTTGGTATTCCCTCGAGTGTCCAGCACCGGCGTACTGTTCAGCAGCACGCTTTTAAGCCATCCACCGGACCTTCAATCGGCCTTCGCTGATGGCATCGATCACACTCAGCAACTGCGTGGACTTCAGGTTGTCCTTCGCTTCGCGCGGGGGTCCCCTTACTGCTTCCTTTACCCATTCCTCACGCTCCATAAATGACAAAACCGCCCGCAGGCGGTCCGCACATAAAACATTTTGCATCAGCGACCAATCACCACAACCTGACCACCGTCCCTTCGTCTGCCGTGCTGATCTCCTGAGAAACCACGCGTGACCCCACGCGCATTTCCCCGTACAGAACAGGCAGAACATTGCCCTGGGCAACCATGTTATCCAGTGAGGAGAAATAGGTGTTCTGCTTACCGTTATCCGTTGTCTGTACGGGGAGTTCTGGCTTTCGGTGCCAGCATCTGCGCCACACCACCGAGCACCATACTGGCACCGAGAGAAAACAGGATGCCGGTCATACCACCGGCCCCAATGGCTGCCCCCATGCTGCAAGGGGGCTCCGGCGGTAAAGAATGATCCGGCAATGGCGGCAGCCCCCAGGACAATCTGGAATACGCCACCTGACTTGGCCCCGGCGACTCTGGGAACAATATGAATTACAGCGCCATCAGGCAGAGTCTCATGTAACTGCGCCGTTAACCCGGACGTGCTGACGTCCCGCCCGGCAATCCGTACCTGATACCAGCCGTCGCTCAGTTTCTGACGAAACGCCGGGAGCTGTGTGGCCAGTGCCCGGATGGCTTCAGCCCCGTTTTCACACGAAGGTCGATGCGGCGACCAAATCGTTGTAAATCCCCGTAAAGGCAGATGCGCGCCATGCCCGGTGACGCCAGAGGGAGTGTGCGTCGCTGCCATTTGTCGGTTCCTCTCTCGTTTGCTCAGTTGTTCAGGAATATGGTGCAGCAGCTCGCCGTCGCCGCAGTAAATTGCGGCGTGATTCGGCACTGATGAACCAAACAGCACAGCAGCACATCGCCCGGCTGTGCCGCTGACAACGGCACCTGATACAGCCCCGTCGCCTCCAGATTATCCAGATAGAGATTCTGGCCGTTACGCCACCAGTCATCCTCACGATGAAAGTCCGGCATCTCAATCCCGCCAGATGATAAGCATCCCGGAACAGTGTGTAACAGTCCGTCACACCGTGCTCAAAGCGCCGCCCGGTGAGATGCGGCACACAGCGGAACTTATGAATCGTCCCCCGGCAGACCAGCCACCACGGCAAATCACTCTGCACCTGCAGCCGCCGGTCGGCCTCACTCAGCCGAGGCAGACCACGGGGGTGGCTGTGGACAGCGCCACAATCTCACCCTGCATTTCTGCCTGCAGCCAGTCTTCCGGCGACATACGGAAATACGCCTCCGGCTCACCGGAGATATTCACGCAGGGAAATATCTTTCCCCTCCGGCGTGCTTACCACGAAGCCGCACGCACGACTCCGCTGGCGCACATCGCCGGGCGTGCGCCAGAATCGCTGATTCTGTCTTGTCATGGGATTTACTGCGAAAGTTTGTTAATGGGAAAGGAAGCCGCCAAAGTTGCCGACGTTATTGCGGAACTTACAACGCTCAGGCATTTGCTGCATTTATCCTTCGTGATATCGGACGTTGGCTGGTCATATTCATCCGCGACAGCCGGACCGCTATAACCGCACTCGTCACCGCGATAGTCCAGGTGCAGGTGTTGGCCAGCATGATACGTCCGGAAAAACAGCGCCATCCGTTTCCGTCGGCGTGACAGTACAAAGGAGGCACTCACCGCGCTCAGTTCGCTGCACTGCTCAATGCGCCAGCGGCTGATCACCTCCTGCTCCGGATCGGCGTAACTGTTTCCGTTGACGAAGTTCACCGCATCCAGAAAACGGGCGTAAACCTTACGCCGGACCACCGTTCCGCCGACCAGACTCTGCTGCATATCTTCCGCCATCCCGGTGACCATACCGTACAGGTTAGAAACCGTCAGCGTGGGGCGCGGGTACTGGTGCCTTTGCCATTCAGTTCAAAACCGCTCAAACCCTCCCCTGAATGGGATACGGCTGATACTGTCGCCCCTGCCAGGTGACCGGCTCACCTTTTCGTTCTGCTCATTACAGAAAATAACGTTCTCCACCGACCTCTGTCAGGTCGATTTCCGAGAGCACCACGCTGGCCGACTGCTCCGCACGGGTGCATTCATTCAGTGTTTCCTGCCGGATATCCTGCATCAGTTCACCTGTTCAAACTCTGCTGAACTCAACACGCAGCATACTGACCCGCGACGACCATTTTGCGCAGGTCATACCTTTATCTGCCGCCACTCATAAGGCGGCGTCCACAGAAAGGATTTCCAGCCCCGTGCTCTTCCAGAAACGACTCCAGTACCGTGGCCTCCTCACGGGGGACAGAAGGCGTCACGCTGTACGTTTCAGGTTGGCATTCAGCCCGGCAGGCGCTCGCTGAGAATAGCCATCACCAAAGCGCACCTTTCTTACAGAAGGGACCGAAGCCACATCCATACCGGGTTTCACTTTCCAGCGGAAGGTCTTCATCGTCACCTCCCGGAACACAGGCCACCATCACGCATCTGTGTCTGAATTTCATCACGGGCACCCTGCGGGCCATGTCATACACCGCCTTCAGAGCAGCCGGACCTATCTGCCCGTTCGTGCCGTCGTTGTTAATCACCACATGGTTATTCTGCTCAAACGTCCCGGACGCCTGCGACCGGCTGTCTGCCATGCTGCCCGGTGTACCGACATAACCGCCGGTGGCATAGCCGCGCATCAGCCGGTAAGATTCCCCACGCCAATCCGGGCTGGTTGCCTCCTTCGTGAAGACAAACTCACCACGGTGAACAATCCCCGCTGGCTCATATTTGCCGCCGGTTCCCGTAAATCCTCCGGTTGCAAAATGGAATTTCGCCGCAGCGGCCTGAATGGCTGTACCGCCTGACGCGGATGCGCCGCCACCAACAGCCCCGCCAATGGCGCTGCCGATACTCCCGACAATCCCCACCATTGCCTGCTTAAGCAGAATTTCTGTCATCATGGACAGCACGGAACGGGTGAAGCTGCGCCAGTTCTGCTCACTGCCGTCAGCATCGCCCGCCATATTCTGTGCAATACCATCAAAGGTCTGCGTGGCTGCACTTTTACCTGCGACATACTGTCCGTGGCGCTCTCTTCCCACTCACTCCAGCCGGACTTCAGGCCTGCCATCCAGTTCCCGCGAAGCTGGTCTTCAGCCGCCAGGTCTTTTCTGCTCTGACATGACGTTATTCAGCGCCAGCGGATTATCGCCATACTGTTCCTTCAGGCGCTGTTCGTGCTCGTGGCTTCCCGTTCTGCCTGCCGGTCAGTCAGCCCCCGGCTTTTCGCATCAATGGCGGCCCGTTTTGCCCGTTGCTGCTGTGCGAATTTATCCGCCTGCTGCGCCAGCGCGTTCAGGCGCTCCTGATACGTAACCTTGTCGCCAAGTGCAGCCAGCTGGCGTTTGTACTCCAGCGTCTCATCTTTTATGCGCCAGCAGGGATTTCTCCTGTGCAGACAGCTGACGACGGCGACGTTGCGCCGCCTCCTCCAGTACCGCGAACTGACTCTCCGCCTTCCACAAATCCCGGCGCTGCTGGCTGATTTTCTCATTTGCTCCGGCATGCTTCTCCAGCGTTCGGAGTTCTGCCTGAAGCGTCAGCAGGGCAGCATGAGCACTGTCTTCCTGACGATCGCCCGCAGACACCTTCACGCTGGACTGTTTCGGCTTTTCAGCGTCGCTTCATAATCCTTTCGCCGCCGCCATCAGCGTGTTGTAATCCGCCTGCAGGATTTTCCCGTCTTTCAGTGCCTTGTTCAGTTCTTCCTGACGGGCGGTATATTTCTCCAGCGGCGTCTGCAGCCGTTCGTAAGCCTTCTGCGCCTCTTCGTATATTTCAGCCGTGACGCTTCGGTATCGCTCTGCTGCTGCGCATTTGTCCTGTTGAGTCTGCTGCTCAGCCTTCTTTCGGGCGGCTTCAAGCGCAAGACGGGCCTTTCACGATCATCCCAGTAACGCGCCCGCTTCATCGTTAACAAATAATCATCCTTGCGCAGATTCCAGATGTCGTCTGCTTTCTTATACGCAGCCTCTGCCTTAATCAGCATCTCCTGCGCGGTATCAGGACGACCAATATCCAGCACCGCATCCCACATGGATTTGAATGCCGCGCAGTCCTGTCTGCCCAGGTCTCCAGCGTGCCCATGTTCTCTTTCAGGCGGCGGGTCTGGTCATCAAACCCCTTTCGTTGCGGCCTCGTTCGCCGCCTGCAATGCCCCGGCTTCATCGCCGGAACGCTGCAACTGAGCAACATACGCAATCTGCTCCGCCGACACGTTATGGAACTGGCGAGCCATCGCCGTCAGCCCCGACGTCGGGTCTGTGGTCAGCTTCCCGAAGGCTTCAGCGACCTTGTCCACCTCCACGCCGGATGCAGGAGAAACGCGCCACACTCTGGCTGATGGACGCAATCTGAGCCTCACCGCTTACCCCCGCCTTAACCAGTGCGCTGAGTACTCGCTGGTCTGGTTAAACGTCAGCCCTGCCGCCTGCCCGGGCTGGACAGGACCAGCATACGATCTGCCGTCAGTCCCGCCTGATTGCCGGAAAGGACCAGCGTTTGTTGAAATCGGACGGACAGGGTGAGTTGCCCTGATACCAGGCATACGCCAGCGCACCGGTCGCCCACCGCCAGCGAGGCCCCACCATCGGCAGGGTGATCGCACCGGCAAGCCCCCTGAACATGGGGATCATCCCGCCGAAGGAGTCCTTCACCTGCCCCCTGTTGCAGCAGGATCAGCCACGGACTTTGCCCGCCTGCAAGCTGCGTGGCCACGTCGGTGAACTGTGCAGGCAGCATACGCATGGCGGCTTTATACTGCCCGACGGAAATCCCCGCTTTCTGTGCAGCCAGCGCCTGTCGGCTCAGCGACTGTTCAACGACTGCCGCTGTTTTTCGCATCACTTTCCGTACCAGAAAATGACGCCTGACTCTGGCCATCTGCTCGTCAAATCTGGCCGCATCCAGACTCAAATCAACGACCAGATCGCCTACCAAGGGTTCAGCCATACCGGACTCCTCCTGCGATCCCTTCTGATACTGTCATCAGCATTACGTCATCCTCCGTCATGTCGCCACATCCGGGGGAAGCGGGGATAACTTCATTCCCGTCCGGGCCAACGCGGACACCTCCGGCAAGCCCTGCCGCTTTCTGCATCAGCACATCATCTTCAGGCTCTTCGTCAGCCTCGCGCCGGTTCAGCAGACTGAAATCCAGGCGGATGCATATCCGGATCGCTGAAAAACAGGCTGAGCACGGTGTACGTCAGCCGGAAAAGTGCATATCCAGCAGAACATCATGAAAATAATGGGTACTGTAAAGCGGTGCCAGTCGGCATACTCCGTGGATGACATCCCGGCAAGCATGGCACGCCAGTCGGGTCGCCCCATCTCACGCGCAGTTTCAGGGCAAAACTCAGCTCACCGTCGAACACTTTCCCGCAGAAACAGGCTCTGCGGGCCCGGCGTCCTCTGTCTGTTCAGGGGCATTATTCACCACAAACTCATACATACCAGACAGCCGGTACACCACGTTTTCAGCATGAGAAATTGCCTCCGTGGCCAGGTGGTAAGCACTTCCTGCTCAATCTGTTTAACGGCTTCATTCATGGACGGCATCTGCGTCTTCTGCGGATGGTTATGCCACAGGGACATCGCCACCAGAAACGCGCCGGTTCGTGATGGCGTCGTTCCACAGTAAACTTCCGGTTGCTGTCTGACTCCGCCTGTTCTGCCTGCCGTTTCATCAGGGCGAGATGCTCAATGCGCTGCAGGGCTGACAGTTCAGAAAGCGTGACGGTCACCCGTTATGTTCAAATGATTCGGTTTTCAGGAACATCGCTGACTCCGGATTAACTGGCGGTGACGGTAATTTCTGCAACCGCAGCAAACTCACCATTACCGGATACAACCGGAATGTTGACCTTGCCTGCAGCAACGCCGTTCACGGTGATGGTCATACCACTGACGACACGGTGGCTTTTGTTTTATCCGCAGACAAGCACGAAAGCTCTTGTCGGTTACGCCTCCGGCTGGAAGGCCACGGTCAGCGTGGTGCTCTGCCTTTCACCACCGAGGTGCTGGCAGGCGTCACGGTCATGCCGGTTGCCGCTGTTACCGTGCTGCGATCTTCTGCCATCGACGGACGTCCCACATTGGTGACTTTCACCGTGCGGGTGATCACTTCCTTCGCCGTCACTCGCCTTACCGATACTGCTGACCCAGCCACGGAACACATCGACCGTGCCGTTCGGGAAGCGGATTTATAGGCACGGGTATCGCCTTCATTAAACCACGCCAGCAGCGCCTGCTGCCCTGCTCTCCGGGCATCCACGCCAGCGTGAAGCTGGTATCTCCGGCAGATTTCTGCCCCTGCCCGGTCGCAGTCCAGTCTGCATCTTCATCATCGAGATAGCTGTCGTCATAGGACTCAGCGTCAGTTCGCCGGGCGTCAGGTCTTTAACTTTTGCCAGACGCGACCAGTCAACGTCTGAAAGCGGATTCGCGTAAGGGTACCGCTCCCCCGTAAAACCCACAGGGTGGTCCCGGCACCTTTCACCGGCATTGTAGGATTTGGTACAGGCATAGCGTCCTCACATTTCATAGGTAATGACATAAGTCAGATCGGCTGAACTCCACAAGCCCGCATCATCGTCGCGCCGGTAGTAGCTCCTGGCCACCATACTGGTGATCAAATCTGACAGTGCCGGGATATCGCTCATACCGGATAAATCCGGGACTCCATCCACGCATCCAGAGCTCTGAATCCAGCACCTGAGCAGGCAGGAAAACTTCGATATGCAGCTCCGCCTGCCAGGTATCCTGTCCAGCTCTTCGCCGTGTATTCAGCGCCGGTGAGATAAACGGCAACTGCCGGAAAATCCGCCTCCATCAAAACACTCCGGGGCGACCATCAAAACGTCGCCCCGGTGTCATGCTTCTCCAGTGCATCCAGTACGGCTGCACGGAGTTCAGTATGTTTCATCGCTTTATTACCATCCTCAGTTGATGCTGCAGCGCATAGCCCAGCTCTTTCGGAAGACGTTCACGCCGTATCCGCTCAATATCTTTTGTTTAAACGCCGTGGTCAGCGGCAGCGCCATCGGGATTTTCACCACATCAATGGGGTAACGGTTTTTCCCAGCCCACGCTGCATGACATGCCACCGGCCATTTTTCAGTTGCTGAATAAACGCCGGGAATACGACGGTTACCACCAAGCACGCTGCCGCCACCTTTCAGGGATGAACGCTGCCCTTTTACGAAATGCCTGCGGCGCGAAAGGACCCGGCGCATTACCCCAGCTTGATTACGGGCAAATCCCCCGGTTAACTTTGATTCTCTGCCTTGCGGATTTGACCGTGGCCCTTTCAGCCTGGCCCTTCCTTTACCAGTTTCGGCGTACCTTTGTCTCACGGGCAACCTGTGACGCCGACTGCGATATCGCGGATGAAGCAACGAAAGGTTAATGGCCAGTGGTGCGGCACCATGCAGCACCGCGCCGTTTTGCTGATACGGCTGAGGTTTTCAACGGCCTGCTCAAGACTTTATGGCCATACATCCCCTTTCAGCGGCGACGGTTAACGGCAGGCGGTACGCCCCGTCCAAGCCAGAGATGACAACTTCCCTCATCATCCGGCGAAACCCGATCTACCCAGAAATTTTCCTCACCGATGGTCAGCGTGTCTCCACGCCGCAGCTGCCGCACCTCATCAGTCCGGACAAACAGGGACGGGCTGGAGCCTTCAACGCGCACGCCCTGTCCGGCATAGCTGATATTTTCAGGGTCATCAAAACACCACGTATCACCGCACCTGACTGCTCACCGGATGTAATGGTGGCTGACGTTCCCATGTACCCGCGTATCGTTTCATCGGCGCGGGCAATGGGCAGCATCGAACAGGTATCGAAATCAGCCACAGCGCCTCCCGTTATTGCATTCTGGCGGCCGCGCTCTGTCATTTCGGCTGCCACACCGGCAGAGACGAAACGCCGTTCCCGGCAGCACAAATGCCACAGGTTCATCCCGCCGTGGCGTGAAGTGCATCAGTATGCAGCTTCACCAGTGCCACGACCGTGACCAGTTCAGACGTATCCAGAATCACGGTATCCGGCTGCGCTGATCCCACCTCATTTTCATGTCCGGTCAGCACATTTCCCGGCTGAGAGGGGGCTGTGACCGGCAGTTTCATCTCGTGTCATCAAGCTCCTCTTTCAGCTCTGCCACACGGAGCGCCAGTTCTTCTTTCGTCGTCCCCGTCAGGCTGACATCACGGTTCAGTTGTTCACCAGGCGAGCGGAGACGGGCAATCAGTTCATCTTTCGTCATGGACTCCTCCACAGAGAAAGCATGGCCCCGAAGGCCATGATTACGCCAGTTGTACGGACACGAACTCATCAGAGATACAGCCAGCAGCATCAGCGGTGCTGACTGAATCATGGTGAAACTCACGCGCCGGATCGCCGGTGGTCACCCAGTTTTTCGGGTAACGGGCAGAGGCGTTAATGCCTTCGCGCTGTGCGTCCGCATCCTGAATGCAGCCAGCTCATGTAGCGCAGCAGACCGCGTGCCTGAGTGTTCCCCAGCACCATCGGTTGTCCGGCAGGAAGTTCTTTTGACGCCGTTTTCCACGTACTGTCCGGAATACACGACGATGGCCACATCGCCATACATCCCCTTATAGACACCGCTTTGCCCAGGTCTTCACCGCTGTCTCCAGCTCGGAATTAGAGCCACGACGGGTATCCAGCTTCTCCTTGACGGCTTTGAAGGAACGGAACAGCGCCAGCCTTTCGGATCGAACACGATGATATTCACCACACCGCTGGCGTTCAGCGCGTAGGCTTCGATATCGTCGGTCGGGTCATACGTGGACTTGTCACGCTTGCTCCACTCCGTGCCGCCGGACTGCGTGATGTTATTCTCCTCACTGCGGCCCATATCCACCTCAACCGGATCGAAGGCTTCACCGGTCATGGTGTATTTTGCCTTAAGCACGGCAGAAACTGCCTGCATCTCTTCGACCTGAGCAATGGCCAGCTCTTCGTCACGCATGTTCTGCATGATGATGCGACGGCGGCGGTAAGCCGGGTCCGCCAGATTCTGCGATCTTCATCCGGCAGGCGACGCAGGGTCATCTGCGGATTCACTTCATGCTTCGGCTTGACATATCCCGGCGTAAATTCAGGGTGGAGCCGCCACGGGAACGGATAACCTCACCGGAAACAATCGGCGAAACGTACAGCGCCATGGTTTACCAGTCCGGAATTTGTGAGAGATAGACTTTCTCGTGGTGAAGGATAGCTCTCACGGAAAAGGACGCAGAAACAGCGGATCAAACTTAAATTTCTGCTCATTTGCCGCCAGCAGTTGGGCGGTTGTGTACATCGACATAAAATCCCGTAAAAAGCCGCACAGGCGGCCTTTAGTGATGAAGGGTAAAGTTAAACGATGCTGATTGCCGTTCCGGCAAACGCGGTCCGTTTTTTCGTCTCGTCGCTGGCAGCCTCCGGCCAGAGCACATCCTCATAACGGAACGTGCCGGACTTGTAGAACGTCAGCGTGGTGCTGGTCTGGTCAGCAGCAACCGCAAGAATGCCAACGGCAGCACCGTCGGTGGTGCCATCCCACGCAACCAGCTTACGGCTGGAGGGTCCAGCATCAGCGGGGTCATTGCAGGCGCTTTCGCACTCAATCCGCCGGGCGCGGTTGCGGGTATGAGCCGGGTCACTGTTGCCCTGCGGCTGGTAATGGGTAAAGGTTTCTTTGCTCGTCATAAACATCCCTTACACTGTGTGTTCAGCAAATCGTTAACGGGATCAGATGCCGGGTTACCTGCAGCCAGCGGTGCCGGTGCCCCCTGCATCAGACGATCCAGCGCAGTGTACTGCGCCTGTGCACTCTGTGGTGCTGCGGCCAGAATGCGGCGGGCCGTTTTCACGGTCATACCGGGGGTTTCTGCCAGCACGCGTGCCTGTTCTTCGCGTCCGTGAGCCTCCTCACAGTTGAGGGATCCCCATAATGCGCTGTTTTCTGCCGCAACCGCTGCGGTGATCTGCGCGTTCACGTCCGGCTGCGCCGCGCTGGCGTTCTCGCCCTCCGTCGCTGGCACCACGTCAGTAACGTCAGCCTGCGAAGCAGTGGCTGAAACAGTTGTTGATTGAGTCTCTTTGGTCATTCGCCTCCCTGAGAGACGGGATTTACGTGCATCCAGTGCATCACGCATGACGGTGATCGCATCGGTGCTGTTAACAAGTTCATCAGCCAGTCCGGCATCAATGGCCTCCTGACCGCTGTACACTGCAGCCTCGGTATCCAGCACAACCTGCACGGACAGGCCGGTATATGCCGACACCTTCTGCGCAAACATCTGGCGGGTTGCGTCCATCCGGGACTGCAGTGTCTCCCGGACGTCATCCGGAAGATGGCTGTAGGGGTTGCCATCCACCTTATGGCTGCCGCCTGTAAATCAGCGTGATTTCCACACCCTGTTTCTCCAGCGCAGCACCGTAATTACTGTGAGCCATCATGACGCCGATGGAGCCTGTCCGGGCGGTCTGCGTGACCAGACGCCGGGGAGGCGGCACTGGCAAGCAACTGACCTGCACTGCAGTTCATGTCGTTGGCAAGCGCCCATACCCGGTTTTATGTCACGCACACGGGCGATGATGTCAGCGCAGTCAAATGCCCCGCCACCATCCCGCCGGGCGTGTCCATATCGAGCAGAATGCCGTCCACCATCGGATCGCTGGCAGCCTGTTGCAGACGGGCGATAATGCCGTTGTAACCGGTCATCCCCGAGTACGGCTGCAGCGCCCGCGTCCGGCTGACCAGCGTGCCGGACACCGGCAAGCACGGCGATGCCGTTCATGACCTGATAACTGCGCGGCCTGTCGTGTCCGTCATCATCACCGGATAATGCCAGCGTCGCGAGTGCCTCCTGGGCAGTCAGGCTGTCGCCGGACACCGCATCCGTCAGGCTGCTGATCCCAAGCTGGCCTGCAAAGCACAAAGAAAACCCGCGCATAGGCGGGTTCAAGCATCAGCGGCTCATTAAAGGCCATGCTGGCAATATGCGGAGATTACGCAGCTCTGCTGTCACTCTTCTCCTCCTCTGTTGATTGTCGCAGCCCGGATTCAAATGCTGCAGCCGCCCAGGCGGGCGGTTTAAGACCGGCTGCACGGCGCTCCATCGTTTCACGGACCTGCTGGGCAAAATTTCCTGATAGTCGTCACCGCGTTTTGCGCACTCTTTCTCGTAGGTACTCAGTCCGGCTTCTATCAGCATCACCGCTTCCTGAACTTCTTTCAGACCATCGATGGCCATACGACCGGAGCCTATCCAGTCGCAGTTCCCCCAGGCACTGCGGGCTTCCTGAAAACTGAAGCGCGCTTTGAAGGTAACGTCACCACGCGGCGAACGATGGCCTCTTCCAGCCAGCACAGAAACATCTGGCTCGCCTGACGGGATGCGACGAATTTTCGCCGCCCCATAAAATGACGCCCACGACTCGTTCGCACTGGCCCGTGCCGTGGAGTAGCTCATCTGGGCGTAATTCCGGGAAAGCTGCTCATACGAGACACCCAGCCCGGCAGCGATATACCGCAGCAGTGACTGCTCAAACACGGAGTAGCCGTTATCCGTATCCTGAGCCGTCTGCAGGTTCAGTGAGAGTACCGGCATCAGGTGCGGTACTTTTGCGCCTCCAGCCGGACCGGCGCTGCTGCGGCGTAATACGCGGCAATTTCACCAATCCAGCCGGTCAGCCTTTCCCGCTGCTCCTGACTGTTCGCGCCCAGAATAAAATCCATCGCTGACTGCGTATCCAGCTCACTCTCAATGGTGGCGGCATACATCGCCTTCACAATGGCGCTCTGCAGCTGCGTGTTTCTGCAGCGTGTCGAGCATCTTCATCTGCTCCATCACGCTGTAAAAACATTTGCACCGCGAGTCTGCCCGTCCTCCACGGTTCAAAACGTGAATGAACGAGGAGGCGCCCGCCGGGTAACTCACGGGGTATCCATGTCCATTTCTGCGGCATCCAGCCAGGATACCCGTCCTCGCTGACGTAATATCCCCAGCGCCGCACCGCTGTCATTAATCTGCACACCGGCACGGCAGTTCCGGCTGTCGCCGGTATTGTTCGGGTTGCTGATGCGCTTCGGGCTGACCATCCGGAAGAACTGTGTTTAGAAAAGCCGCGACGAACTGGTATCCCAGGCCTGAACGAACAGTTCACCGTTAAAGGCGTGCATGGCCACACCTTCCCGAATCATCATGGTAAACGTGCGTTTTCGCTCAACGTCAATGCAGCAGCAGCAGTCATCCTCGGCAAACTCTTTCCATGCCGCTTCAACCTCGCGGGAAAGGCACGGGCTTCTTCCTCCCCGATGCCCAGATAGCGCCAGCTTGGGCGATGACTGAGCCGGAAAAGACCCGACGATATGATCCTGATGCAGCTGGATGGCGTTGGCGGCATAGCCGTTATTTGCGTACCAGATCGTCTGCGCGGCATTGCCACGGGTAAAGTTGGGCAACAGGGCTGCATCCACACTTTCACTCGGTGGGTTCCACGACCGCAACTGCCCTCCAAATCCGCTGCCACCGCCGCGTGATAACCGGCATATTCGCGGGGCAGCGATGTCATGCCGTCCGGCCCCAGAAGGGTGGGAATGGTGGGCGTTTTCATACATAAATCCTGCAGGTCTCTCCCTGCGTCGCTGTGTCATGCCGGTCTGCACTTCCAGCTCTGCAATATATTTTTCAGGTCAGACACGGAAGTGGCCGTAAACTCCACCCTTCGTCCGTCTTTCTGTACTGTTGCCACCCGTTTACCTGTCATCAGGTCATGCAGTGCCGCACGGGCAGCGGCAAGTTCTTCCTGTCGCGTCATTCATCCTCTCCGGATAAGGCACGGCGTAATCTGCCAGTGTTTTCTTGTTGGTTGCTGCACCATCCTCTTCCTGCAGGCTCGCCAGCAGCGCACTGAGATCCAGCTGCCAGCGGGAAATACTGATGCGCAGCGCCGCCAGCGCATAAACGAAGCAGTCGAGTGCCTCATTGCGTCGCTTTTGCTGTCCACAGTATTTTCCTGCCATCCACCCATTTTCGACCTGCTCTTCAGCAGTCAGCTGCTGCGCTTCGGGTCAGATCAAAATATCCGGGTTATTTCGGGAATGAACGGCACCGGGAAGCGGTTCATCCCCTTCCGGCGTCAGTGTGAAGCGGTTTATAAATCTGCTCTTCGCGGTATCCGTACCGATTTCGGTAAGGTAAACCCCGTTTTGTTTCGCTTACGTGGCATGCTGGCCACCGGCTTTCCGTAGACGGATGCCCCTTTAATGGGGATCACCCGGAACAGCCCATGTTTTCGAGCGTTCATACACAATGGTCGGGTCAATCCCGCCAGTATCCCAGCAGATACGGGATATCGACATTTCTGCACCATTCGGCGGGTATAGGTTTTATTGATGGCCTCATCCACGCAGCAGCGTCTGTTCATCGTCGTGGCGGCCCATAATAATCTGCCGGTCAATCAGCCAGCTTTCCTCACCCGGCCCCCATCCCCATACGCGCATTTCGTAGCGGTCCAGCTGGGAGTCGATACCGGCGGTCAGGTAAGCCACACGGTCAGGAACGGGCGCTGCGCTGAATAATGCTCTTTCCGCTCTGCCATCACTTCAGCATCCGGACGTTCGCCAATTTTCGCCTCCCACGTCTCACGAGCGTGGTGTTTACGAAGGTTTTACGTTTTCCCGTATCCCCTTCGTTTTCATCCAGTCTTTGACAATCTTAAGAGGTGGTGAACGGGCTGTACGCTGTCCAGATGTGAAAGGTCACACTGTCAGTGGCTCAAATCTTTCACCGGATGACGAAAACCAGAGAATGCCATCACGGGTCCAGATCCCGGTCTTTCGCAGAGATAACGGGCATCAGTAAGAGTCCAGCTCCTGCTGGCGGATGACGCAGGCATTATGCTCGCAGAGATAAAACACGCTGGAGGGATCATCAGCGTCCATTTGAGGCCAAACGGCGTCTCTTTGTCGCCAAATTTAAGATACTGCTCCTCCCCCGCAATGCGGGCAGGCAACATGAAAACGCATAAAATGCGGGGATTCACTGGCTGCACGCTCTCAATCTGACAGGTGCCTCTCACTTTGGCGTGGAGCCACGGATGGACTTTACAGACCGAGCCTTCAATACGCTTGTTACCCAGGAACGTCGGAGAGCCTTCCTGTTCAATATCATCATCAAAAGCAGCAAGTTCATCATAACCCGCCACATCCACCGACGACTTTCACGGTAGTTTTGCCGCTTTACCGCCCAGGCAGCACCAGAAGCCACGCCCATTAGTGAACGCTTCATGGTGAGCGTGTTATCCCGGTGCTTTTGCCATACCACGGGGCCAGCGCCAGCAGCGACGGAATATCACGAATAGTCGGCTCAACGTGGGTTTTCATAAAGTTCTCGGCATCACCATCCGTCGGCAACCAGATAAGGGTGTTGCGCTGCTTATGCTCTATAAAGTAGGCATAAACACCCAGCAGCATTTTGGAATAACCGACACGGGCAGACTTCACCACATTCACCTCACGGATGTAGTCGCTGCCATCGCATTCATGATGGCCCGCTGAAAGGGCAGTGTTTCCCAGCGCCCTTCCTGGTATGCGGATTCTTTCGGGAGATAGTAATTAGCATCCGCCCATTCAACGGCGGTCTGTGGCTCCGGCCTGAACAGGAGCGCGAAGCCCGGCGCGGACAAAATGCCGCAGCCTGTTAACCTGACTGTTCGATATATTCACTGAGCAACCCCGGTATCAGTTCATCCAGCGCGGCTGCTTTGTTCATGGCTTTGATGATATCCCGTTTCAGGAAATCAACATGTCGGTTTTCCAGTTCCGGAAAACGCCGCTGCACCGACAGGGGGAGCCGTCGAGAATACTGGCAATTTCACCTGCGATTGACGCGACAGCACGAAAGTACAGAATGCGGTTTCCACCACTTCAGCGGAGTCTGGCATTCTTCAGTTCCTGTGCGTCGGCCTGCGCGCACGCGTAAGTCGATGGCGTTCGTACTCAATAGTTCCTGGCTGGAGATCTGCCTCGCTGGCCTGCCGCAGTTCTTCAACCTCCCGGCGCAGCTTTTCGTTCTCAATTTCAGCATCCCTTCGGCATACCATTTTATGACGGCGGCAGAGTCATAAAGCACCTCATTACCCTGCCACCGCCTCGCAGAACGGGCATCCCTGTTCCTGCCAGTTCTGAATGGTACGGATACTCGCACCGAAAATGTCAGCCAGCTGCTTTTGTTGACTTCCATTGTTCATTCCACGGACAAAACAGAGAAAGGAACGACAGAGGCCAAAGCTCGCTTTCATAGACCCTGTCGTTTCCTTCTTTCAGAGGGTATTTTAAATAAAAACATTAAGTTATGACGAAGAAGAACGGAAACGCCTTAAACCGGAAAATTTTCA