view test-data/consensus_result3.fasta @ 7:39bed8de8017 draft default tip

"planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit 315fa3071141484b055db128f7d116a774cc5beb"
author bgruening
date Wed, 13 Apr 2022 15:38:59 +0000
parents 4df02149a270
children
line wrap: on
line source

>utg000001l LN:i:48021 RC:i:170 XC:f:1.000000
ACAACGTGCGTGGAGGCCATCAAACCACGTCAAATAATCAATTATGACGCAGGTATCGTATTAATTGATCTGCATCAACTTAACGTAAAAACAACTTCAGACAATACAAATCAGCGACACTGAATACGGGGCAACCTCATGTCAACGAAGAACAGAACCCGCAGAACAACAACCCGCAACATCCGCTTTTCTAACCAAATGATTGAACAAATTAACATCGCTCTTGAGCAAAAGGGTCGGGGAATTCTCAGCCTGGGTCATTGAAGCCTGCCGTCGGAGACTAACGTCAGAAAGAGAGCATATACATCAATTAAAGTGATGAAGAATGAACATCCCGCGTTCTTCCCTCCGAACAGGACGATATTGTAAATTCACTTAATTACGAGGGCATTGCAGTAATTGAGTTGCAGTTTTACCACTTTCCTGACAGTGACAGACTGCGTGTTGGCTCTGTCACAGACTAAATAGTTTGAATGATTAGCAGTTATGGTGATCAGTCAACCACCAGGGAATAATCCTTCATATTATTATCGTGCTTCACCAACGCTGCCTCAATTGCTCTGAATGCTTCCAGAGACACCTTATGTTCTATACATGCAATTACAACATCAGGGTAACTCATAGAAATGGTGCTATTAAGCATATTTTTACACGAATCAGATCCACGGAGGGATCATCAGCAGATTGTTCTTTATTCATTTTGTCGCTCCATGCGCTTGCTCTTCATCTAGCGGTTAAAATATTACTTCAAATCTTTCTGTATGAAGATTTGAGCACGTTGGCCTTACATACATCTGTCGGTTGTATTTCCCTCCAGAATGCCAGCAGGACCGCACTTTGTTACGCAACCAATACTATTAAGTGAAAACATTCCTAATATTTGACATAAATCATCAACAAAACACAAGGAGGTCAGACCAGATTGAAACGATAAAACGATAATGCAAACTACGCGCCCTCGTATCACATGGAAGGTTTTACCAATGGCTCAGGTTGCCATTTTAAAGAAATATTCGATCAAGTGCGAAAAGATTTAGACTGTGAATTGTTTTATTCTGAACTAAACGTCACAACGTCTCACATTATATTTACTATCTAGCCACAGATAATATTCACATCGTGTTAGAAAACGATAACACCGTGTTAATAAAAGGACTTAAAAGGTTGTAAATGTTAAATTCTCAAGAAACACGCATCTTATAGAAACGTCCTATGATAGGTTGAAATCAAGAGAAATCACATTTCAGCAATACAGGGAAAATCTTGCTAAAGCAGGAGTTTTCCGATGGTTACAAATATCCATGAACATAAAGATATTACTATACCTTTGATAATTCATTACTATTTACTGAGAGCATTCAGAACACTACACAAATCTTTCCACGCTAAATCATAACGTCCGGTTTCTTCCGTGTCAGCACCGGGGCGTTGGCATAATGCAATACGTGTACGCGCTAAACCCTGTGTGCATCGTTTTAATTATTCCCGGACACTCCCGCAGAGAAGTTCCCCGTCAGGGCTGTGGACATAGTTAATCCGGGAATACAATGACGATTCATCGCACCTGACATACATTAATAAATATTAACAATATGAAATTTCAACTCATTGTTTAGGGTTTGTTTAATTTTCTACACATACGATTCTGCGAACTTCAAAAAGCATCGGGAATAACACCATGAAAAATGCTACTCGCTACTGCGCTGGCCCTGCTTATTACAGGATGTGCTCAACAGACGTTTACTGTTCAAACAAACCGGCAGCAGCAGTAGCACCAAAGGAAACCATCACCCATCATTTCTTCGTTCGTTTCTGGAATTGGGCAGAAGAAAACTGTCGATGCAGCCAAATTTGTGGCGGCGCAGAAAATGTTGTTAAAACAGAAACCCAGCAAACATTCGTAAATGGATTGCTCGGTTTTATTACTTTAGGCATTTATACTCCGCTGGAAGCGCGTGTATTGCTCACAATAATTGCATGAGTTGCCCATCGATATGGGCAACTCTATCTGCACTGCTCATTTAATACTTCTGGGTTCCTTCCAGTTGTTTTGCATAGTGATCAGCCTCTCTCTGAGGGTGAAATAATCCCGTTCAGCTCTGTCTGCCAGTCGGGGGAGGCTGCATTATCCACGCCGGAGGCGGTGGTGGCTTCACGCACTGACTGACAGACTGCTTTGATGTGCAACCGACGACGACCAGCGGCAACATCATCACGCAGAGCATCATTTTCAGCTTTAGCATCAGCTAACTCCTTCGTGTATTTTGCATCGGAGCGCAGCAACATCACGCTGACGCATCTGCATGTCAGTAATTGCCGCGTTCGCCAGCTTCGATTCAGTTCTCTGGCATTTTGTCGCGCTGGGCTTTGTAGGTAATGGCGTTATCACGGTAATGATTAACAGCCCATGACAGGCAGACGATGATGCAGATAACCAGAGCGGGAGATAATCGCGGTGACTCTGCTCATACATCAATCTCTCTGACCGTTCCGCCCGCTTCTTTGAATTTGCAATCAGGCTGTCAGCCTTATGCTCGAACTGACCAGACCAGCGCCCGGCAGTGAAGCCCAGATATTGCTGCAACGGTCGATTGCCTGACGGATATCACCACGATCAATCATAGGTAAAGCGCCACGCTCCTTAATCTGCTGCAATGCCACAGCGTCCTGACTTTCGGAGAGAAGTCTTTCAGGCCAAGCTGCTTGCGGTAGGCATCCCACCAACGGGAAAGAAGCTGGTAGCGTCCGGCGCCTGTTGATTTGAGTTTTGGGTTTAGCGTGACAAGTTTGCGAGGGATCGGAGTACGCGATAATCAGTAAATAGCTCTCCGCCTACAATGACGTCATAACCATGATTTCTGGTTTTCTGACGTCCGTTATCAGTTCCCTCCGACCACGCCAGCATATCGAGGAACGCCTTACGTTGATTATTGATTTCTACCATCTTCTACTCCGGCTTTTAGCAGCGAAGCGTTTGATAAGCGAACCAATCGAGTCAGTACCGATGTAGCCGATAAACACGCTCGTTATAAGCGAGATTGCTACTTAGTCCGGCGAAGTCGAGAAGGTCACGAATGAACTAGGCGATAATGGCGCACATCGTTGCGTCGATTACTGTTTTGTAAACGCACCGCCATTATATCTGCCGCGAAGGTACGCCATTGCAAACGCAAGGATTGCCCCGATGCCTTGTTCCTTTGCCGCGAGAATGGCGGCCAACAGGTCATGTTTTCTGGCATCTTCATGTCTTACCCCCAATAAGGGGATTTGCTCTATTTAATTAGGAATAAGGTCGATTACTGATAGAACAAATCCAGGCTACTGTGTTTAGTAATCAGATTTGTTCGTGACCGATATGCACGGGCAAAACGGCAGGAGGAGTGTTAGCGCGACCTCCTGCCCGCCCTTTCACGAAGGTCATGTGTAAAAGGCCGCAGCGTAACTATTACTAATGAATTCAGAACAGACAGTGGCTACGGCTCAGTTTGGGTTGTGCTGTTGCTGGGCGGCGATGACGCCTGTACGCATTTGGTGATCCGGTTCTGCTTCCGGTATTCGCTTAATTCATTCAGCACAACGGAAAGAGCACGCACTGGCTAACCAGGCGCCGACTCTTCACGATTATCGACTCAATGCTCTTACCTGTTGTGCAGATATAAAAATCCCGAAACCGTTATGCAGGCTCTAACTATTACCTGCGAACTGTTTCGGGATTGCATTTTGCAGACCTCTGCCTGCGATGGTTGGAGTTCCAGACGATACGTCGAAGTACCAACTAGGCGGAATCGGTAGTAAGCGCCGCCTCTTTCATCTCACTACACAACGAGCGAATTAACCCATCGTTGAGTCAAATTTACCCAATTTTATTCAATAAGTCAATATCATGCCGTTAATATGTTGCCATCCGTGGCAATCATGCTGCTAACGTGTGACCGCATTCAAAATGTTGTCTGCGATTGACTCTTCTTTGTGGCATTGCACCAGAGCGTCATACAGCGGCTTAACAGTGCGTGACCAGGTGGGTTGGGTAAGGTTTGGGATTAGCATCGTCACAGCGCGATATGCTGCGCTTGCTGGCATCCTTGAATAGCCGACGCCTTTGCATCTTCCGCACTCTTTCTCGACAACTCTCCCCCACAGCTCTGTTTGGCAATATCAACCGCACGGCCTGTACCATGGCAATCTCTGCATCTTGCCCCCGGCGTCGTCGCGGCACTACGGCAATAATCCGCATAAGCGAATGTTGCGAGCACTTGCAGTACCTTTGCCTTAGTATTTCCTTCAAGCTTTGCACACCACGGTATTTCCCCGATACCTTGTGTGCAAATTGCATCAGATAGTTGATAGCCTTTTGTTTGTCGTTCTGGCTGAGTTCGTGCTTACCGCAGAATGCAGCCATACCGAATCCGGCTTGTGATTGCGCCATCCCCATAGCAGCCATCACATCAGTACCGGAAAGAGTCAGAAGCCGTGGCCCGTGGTGAGTCGCTCATCATCGGGCTTTTGGCGAATGAAATTTAGCTACGCTTTCGAGTCTCATGCTGCGCCTTCTCCCTGTACCTGAATCAATGTTAGGTTTCCGCAGAACACTGCGCCGGTATCGATATACATTTGGTTGGCAAACTTGAGTGGTTTCACTGCTGGCGTATGACCAAAGATGAACGTGTCCGCGCCTTTGATTTCTTTCACGATCCCGTTTGTGAGTTGCTGATTCGTTCGCGGTTCCAGATTACCTGCTGATGATCAACTGGCTTTCCAAACTCGTATTCGTCAAAGGGATAATCGGCGTGGCAGATAACATATTTTATCTTTGCTCACCAGTTCGATGATTAACGGAAGTTCATCTGCTTTATGGGCAAGAGCTTTAGCCAGAATTTCTTTGTCGTAATCGAGATTAAAGAACCAGCCACCGCCATTAAGCAGCCAGTGATTAACGTTTCCACGCTCTGATAAGCCATCAATCATCATTTGCTCATGGTTTCCACGTACAGCTCTGAACCAGGGGAATGTGATTAATTCCAGGCATTCAACGTTCTCTGCACCACGATCAACCAAATCGCCCACCGAGATAAGCAGGTCTTTTGTTGTCGAATCCAATCGTATCCAGTTTGTTCATCAGGTTCGTGTAGCATCCGTGCAGATCGCCAACTACCAAATATTTCGGTATTTGCTGCCATCAATTTTTCGTAATAGCGCATCTCTTTCACTCCATCCGCGATGAACCATGAGAACGTCGTTGACGATGGCGTGCATTTCCCGTCTTTATCATCAACGTATTTTCTGACGTACCGCGACTACATTTCAGTCTGCGTGCTACTTCTGTCTGATTTCCGTATGTTTCAACGAGCATGTCTGGAATGGTTTTACTGAGAACGTCATGCGGCCTCACTTCTGCTATTTCGCAGGTCTTTGAGTTTCTGTTGGTACTCTGCCTTGATCGCCTTGCACTCTTCGATAGTCCAGCGATGGCGGTTATGGTTTGATTCGATTTCGTCTACTGCTTCCTGCCCGATGCGGCTAATCAGTTCGACGCGATACGGAACGAGATTTCCGCTTTGTGCTGGTTGCACACCACGCATTGCTTGTGAATATTGCGTTCATTAAATCGGAGTTGAGGTGCCGCAGCAGTTGTCCGGTAATGTCCGGCATCCCACTGAGCAGACGTGAGCGTTCCGCAGGAGATACATGGTAAGTCGCGGTCTCTTTCTGATGAAGGCGTTTACGGCTTGTTGGGCTTGTTTAATCCAGTAACTGCGGGGCTTTAAGGCGAGTTTTCGAATCTTAAGTTTATCTTTCTGTTTCTGCTCCTCGTCGTCGTTTCTTCTCTGCTGCTTTTCCGCTTTTCGCGTTCTTTACTTCGTCGTTCGAGTGCTATCTTGGTTCCACTCTGGAGAGCACCACCACTGATTAGCGAATGCAGGGTGAAACCATTCCCGGCATTCATCGTTTTACATCGTCTTCGCGCTGGTTTAGCCATCATCTTCTTCCTCGTGCATCGAGCTATTCGGATCGCTCATCAGTTCTGCGCAGCAGTGCTCACACACGTGAACTTCCAGCACATGCAGCTTCTGACCGCAGTTAGCGCACGTTAAAGCTCGCTCGACGCTTTCTTGTTCGTAACTTCGATTTTGGTCAATCACCTTGTTTTCCTCGCACGACGTCTTAGCCACCGGATATCCCACAGGTGAGCCGTGTAGTTGAAGGTTTTACGTCAGATTCTTTTGGGATTGGCTTGGGTTTATTTCTGGTGCGTTTCGTTGGAAGGTATTTGCAGTTTTCGCAGATTATGTCGGTGATACTTCGTCGCTGTCTCGCCACACGTCCTCCTTTCCTGCGGTAGTGGTAACCCCTGTTGGTGTTCTTTCACACCGGAGACACCATCGATTCCAGTAAGGTTGATTTGGTCGGAAGCGGTTATCTTCTTTGCATTCACCGCACCGATAACATCGCATCATGCAGCTTCCCTCCCGAAGTCGAAATCAAGCTGCCCTCCAAATATTTCGCATGACTCAGAACAAGAGCCGGTATCGAATCTTTTAGCTCGTACCATGTCCTGATACAGGGCTTGATAATCATTTTCTGAATACATTTTCGCGATACCGTCCAGCGACATTCTTCCTCGGTACATAATCTCCTTTGGCGTTTCCCGATGTCCGTCACGCACATGGGATCCCGTGATGACCTCATTAAAACACGCTGCAATCCCTCCTCATCTTTGCAGGCAAGTCCGATTTTGCGTTGATTTTTAATGCAGAATATGCAGTTACCGAGATGTTCCGGTATTTGCAAATCGAATGGTTGTTGCTTCCACCATGCGAGGAGTATCTTCCTTCTCAAAGTCTGACAGTTCAGCAAGATATCTGATTCCAGGCGTTTTGGCTTTAGCCGCTTCGGTTCATCAGCTCTGATGCCAATCCACGTGGTGTAATTCCCTCGCCCGAAATGGTCATCACAGTATTTGGTGAAGGGAACGAGTTTTAATCTGTCAGTGCAGAACGCGCCGCCGACGTATGGAGTGCCATATTTCTTTACCATATCGATAAATGGCTTCAGAACAGGCATTCGCGTCTGAATATCCTTTGGTTCCCATACCGTATAACCATTTGGCTGTCCAAGCTCCGGGTTGATATCAACCTGCAATACGGTGAGCGGTATATCCAGAACTTCACAACTTCCCTGACAAACCGATATGTCATTGGATGTTCACAACCTGTATCCATGAAAACGTAATGCACGTCTTTACCTGCCCGTCGCTTTGCTCCATTAGCCAGAGCAAATATGCTGACGTCCTGCCACCGGAGAAACTAACGACATTTATCATGCAGCCCTGTCTCCCCATCTCGCTTTCCACTCCAGAGCCAGTCTCGCTTCGTCTGACCACTTAACGCCACGCTCTGTACCGAATGCCTGTATAAGCTCTAATAGCTCCCAAATTCGCCTACACGCATCCTGCTGGTTGACTGGCCTTATTACAAAGCCATTCCCGGCAAGGTTAGGAACACACATCCTGCTGCTTTAATGCTGCGGTAACACACACTTCCAGCTTTCTGCATCCAGCCAGCGACCATGCCATTCAACCTGACGAGAGACGTCACCTAAGCAGGCCCATAGCTTCCTGTTTTGGTCTAAGCTGCGGTTGCGTTCCTGAATGGTTACTACGATTGGTTTGGTTGGGTCTGGAAGGATTTGCTGTACTGCGTGAATAGCGTTTTGCTGATGTGCTGGAGATCGAATTTCAAAGGTTAGTTTTTCATGACTTCCCTCTCCCCCAAATAAAGGCCTGCGATTACCAGCAGGCCTGTTATTAGCTCAGTAATGTAGATGGTCATCTTTTAACTCCATATACCGCCAATACCCGTTTCATCGCGGCACTCTGGCGACATCTCCTTAAAACCAGGTTCGTGCTCATCTTTCCTTCCCGTTCTTCCCTGGTAGCAAACCGGTAATACACCGTTCAGACCTTACCTTCGATAACCAGAAGACCTGCCCGTGCCATTTTAGCCGCGGCCTGATTTATGCTGGTTACTGTTGCGCCTGTTAGCGGCAACGTCCGGCGCACAGCACAGGCTATTATGCGTCCCCAGGTAATGAATAATTGCCTCTTTGCCCGTCATACATTGCTCCTTTCAGTCCGAACTTAGCTTTGATTTCTGCGATCTTCGCCAGAGCCTGTGCACGATTTAGAGGTCTACCGCCCATGACAGGAAGTTGTTTTACTGGTTCAGGGATTCGCCTCACCACGGTTAATTCTCGCAGTCATATGGACAAGCTCATCTGCGGCCTTACAGCGTAATCCGCATCAGGCATAGCGCATTGGCCCGCATGTTCTGATACAGGTTGGTAACCAGCCAGTAGTGCGCGTTTGATTTCCACGGATAAGACTCCGCATCCGGATACAGGCCTCGCTTCCGGCAATACTCGTAAACCATATCAACCAGCTCGCTGACGTTTGGCAGTCCGGCGGTAACGGATGCTTCTTCCCGGCACCATGCAACAAACTGCCCGGGTGATGGCAGAAATGGTCGATTCTGGTCGAAATGTCTGCTCGACGGGCTACGCGCATTCCTGCGTTAACCTGTTCCATCGTGGTGATCCCGTTTTCCCCGAAAAGCCAGAACCCACTGGCGACGGATTTCGGTTCACTTCGTTCTGGTCACGGTTAGCCAGGCTCGCCGGGAAAGTTGCCAGTAACTGGCTGAACACACCGTTGATGATCTGCGCTACCTGCTGTACCTGCGGCTTTCGTCGTACTGTTCCGGCATGTTGTTGGCGATCCGACGCATCTGCTCACGTCAAAGTTAACCATCTGTGCGGCGATGTTTCATAGACCCCGTAAATCCAGTCTGTGTTTGTCAGGTCGAGTTTTGGTTTGCTGGCTGTCACGCCTGCCTGTTGCTTGTTACGGTTGATTTCGAGTTGGGTCCACTTATCGCGGGTTTGGCCGGGCCGAGCTCAGCACGTTACCGGACCAGAAGTTGTCCTGGCATGCCCAGCGGAACAGCACACATGTCGCGGTGGTTACGTCCGTCACGTTCACGCATCAGGCGGATATCGTTAGCCCACCCAGCAAAATTCGGTTTTCTGGCTGATGGTGCGATAGTCTTCACCATGTCATGTCAAACACTCTGCGGCGGTCAGTCTTCTGCTGTTCCCCACTTGCTGCCGCTCTGAATTGCAGCATCCATTTTTCACAGAAAGGTCGTTTTCTGGCTGGTCAGGATTCGCCAGAATTCTGACGAATAATCTTTCTTTTCTTTGTATAGTGTCTTTGTGTCCCCTGTTTTGAGGGATAGCAATCCCCAATTTTGAGGGATGTTTTATCCCTCGTTTAGGGATTTTCAGCGTTTGAGGGATGCACCATTCTGAGATGTTTTATTTGGTTACAAACATGCCGCCTTGCTGCTTGATAATATTCATTCTGACGAGTTCTAACTTGGCTTCATTGCACCGTTTGACAGGTAACTTTGTAATCTCGCTACAGTTGAGAATCGGTGATTCTGTCCATTGGTTTATTCCACCCATAGGTTTACGCAGAATGGCAAGCAGCATTTAAACTGTCGCTTGGTCAGATCTGCGCCCGAATAAGCCTCAAGCAGCATATTTGATAGTCTGGCGTAACCATCATCGAGATCTGCCATTACGCTCCTGTCCGGCAAGTTCTCTCTGCCGAAGTTGAGTATTTTGCTGTATTTGTCATAATGACTCCTGTTGATAGATCCAGTAATGACTCAGTAGAACTCCATCTGGATTTGTTCAGAACGCTCGGTTGCCGCCGGGCGTTTATTGGTGTGAGAATCGCAGCAACTTGTCGCGCCAATCGAGCCATGTCGTCGTCAACGACCCCATTCAAGAACAGCAAGCAGCATTGAGAACTTTGGAATCCAGTCCCTCTTCCACCTGCTGATCTGCGACTTATCAACGCCCACAGCTTCCCTGTCTTCTCAGTTCCAAGCATTGCGATTTGTTAAGCAACGCACTCTCGATTCGTAGAGCCTCGTTGCGTTGGCTTTTGCACGAACCATATGTAAGTATTTCCTTAGATAACAATTGATTGAATGTATGCAAATAAATGCATACACCATAGTGTGGTTTAATTTGATGCCCCTTTCAGGGCTGGAATGTGTAAGAGCGGGGTTATTTATGCTGTTGTTTTGTTACTCGGAAGGCTTTACTCTTCCGCATAAACGCTTCCATCAGCGTTTATAGTTAAAAATCTTTCGGCCTGCATGAATGGCCTTGTTGATCGCGCTTTGATACGCCGAGATCTTTAGCTGTCTTGGTTTGCCCAAAGCGCATTGCATAATCTTTCAGGGTATGCGTTGTTCCATACAACCTCCTTAGTACATGCAAGCGTACCGCCAGGTAAAATAGTCAACACGCACGGTGTTAGATATTTATCCTTGCGGTGATAGAGTTAACGTATGAGCACAAAAGAAACCATTAACAAGAGCAGCTTGAGGACGCACGTCGCCTTAAAGCAATTTATGAAAGAAAATGAACTTGGCTTATCCCAGGAATCTGTCGCAGACAAGATGGGGATGGGGCAGTCAGGCGTTGGTGCTTTATTTAATGATGGCATCAATGCATTAAATGCTTATAACGCCGCATTGCTGCTTACAAATTCTCAAATTAGCGTTGAAGAATTTAGCCCTTCAATCGCCAGAGAAATCTACGAGATGTATGAAGCGGTTAGTATGCAGCCGTCACTTAGAAGTGAGTATGAGTAGCTGTTTTTCTCATGTTCAGGCAGGATGTTCTACTAAGCTTAGGACTTTACCAAAGGATGATGAGAGATGGGTAAGCACAACTCAAAAGCCAGTGATTCTGCATCAAGTGCATTCTGGAGGTTGAAGGTAATTCCATGACCGCAGCAACAGGCTCCAACAAGCTTTCCTGACGGAATGTTAATTCTCGTTGACCCTGAGCAGGGCTGTTGAGCCAGCTGATTTCTGCATAGCCAGACTTGGGGGTGATGGATATTTACCTGGTCAAGAAACTGATCAGGATAGCGGTCAGGTGTTTTACAACTAACTAAACCCACAGTACCCAATGATCCCATGCAATGAGTGTTCCGTTGTGGGGAAAGTAAAAGCTAGTCAGTGGCCTGAAGAGACGTTTGGCTGATCGGCAAGGTGTTCTGGTCTGGCGCATAGCTGATAACAATTGAGCAAGAATCTTCATCGAATTAGGGAATTTTCACTCTCCCTCAGAACATAACATAGTAAATGGATTGAATTATGAAGAATGGTTTTTATGCGACTTACGCAGCAAAATAAAGGAAAGATAAGCTCAATAAACCTGTCTGTTTTCCTTAATTCTCCCTGGCTGATAATCACCTGCAGGTTGAGCTCCAATTATTTGTATTCATAAAATCGATGGAAAAACTTTTCTCTTTACCAAACAAATGACAAGAGTCTGGTTCAGAAGATAAATCGCTCTAAAGCTTCAGTTGAAGATAGGGCAGAACAGCCTCGCAGATGACGAATCATTGGGATTCCCATCTTTGTGTTGTTGAAGGCGACACCATTGGTTTTGCCAGAACTGTTCGGGCCGACCACATCCGATCTGACAGATTTTAATCGGGAAAGGAATGTCATTAAGCAGTGGAGAGCGCGTTCAGATAGAGCCACTGATGAGGGGAATCACCAAAGACGATGTTATGCATATGCATTTCATCGGCCGAACAACGGTGAAGGTAGAAGCCAAGCTACCTGTATTTGGCGATATATTAAAGGTCTTAGGGGCAACAGATATTGAAGGGGAGCTTTTGACTCATTGGATATAGTCATTAAGCCAAAATTTAAAGGATATAAAAGGTTGCCAAGGATATTATTTTATACCGTCACCTCAATTTTCAGACATTAGCCTGCGGAAAAGATGAGGCCGGAGATATTTTAACAGAACATTATCTATCAGAAAGGCCATCTCTCAGCCCTCTGAAAAGTCACCAATGCTGAGATAGCTGAAGAGATGAGCTGCATAAGATGCTACGCAAGAATGAAAGTGATATACTGGAATGTTTTTAAAGGCAGGGTGGGCAAAGTTAAGGATTAATTATCAGGAGTAATTATGCGGAACAGAATCATGCCTGGTGTTTACATAGTAATAATTCCTTACGTTATCGTAAGCATTTGCTATCTCCCTTTCCCCTACTACATTCCTGGTGTTTCTTTTCAGCTCATAGAGATGGTCTTGGGGACATTGTCATCATATGCAGGAACCATGATTGCAATGCAATCTGATTGCTGCCTTGACGTTTCTAATCGGAAGCAGAACGCGCCGACTGGCCAAGATTAGAGAGTATGGGTATATGACATCGGTAGTTATTGTCTGCCCTTAGTTTGTTGAGCTTGGAGCTTTGTTTTTCTGCGGGTTATTGCTTCTGTTCCAGCATAAGCGGCTAGCATGATACGCACTATCTCCCATCGGCATTGCCTCTGCATCGTTCATTCATATGCATCCTTGTTTTCCAACTATAATTTGACCAGAACAAGAATCACCCGGCCTCAGCTCGCGGGTTCTTTGCCTCATACGATCGCCCCAAAAACACATAACCAATTGTATTTATTGAAAATAAATAGATACAACTCACTAAACAGCAATTCAGATCTCTCACCTACCAAACAATGCCCCCTTGCAAAATAAATTCATAAACATACAGATAACCATCTTGCGGTGATAATTATCTCTGGCGGTGTTGACATAAATACACTGGCGGTGATACTGAGCACATCAGCAGGACGCCGACTGACCACCATGAAGGTGACGCTCTTAAAATTAAGCCCTGAAGAAGGGCAGCATTCAAAGCAGAAGGCTTTGGGGTGTGATACGAAACGAAGCATTGGCCGTAATGTGCGATTCCGGATTAGCTGCCAAGTGCCTGCGGGGGGTTTTCGTTCAGGACTACAACTGCACACACCACCAAAGGCGACTGACAGGAGAATCCAGATGGATGCACAAAACACGCCGCGAACGTCGCGCAGAGAAACAGGCTCAATGGAAAGCAGCAAATCCCTGTTGGTTGGGGTAAGCGCAAAACCAGTTTAACCGCCTATTCTCTCGCTGAATCGCAAACCGAAATCACGAGTAGAAAGCGCACTAAATCCGATAGACCTTACAGTGCTGGCTGAATACCACAAACAGATTGAAAGCAACCTGCAACGTATTGAGCGCAAGAATCAGCGCACATGGTACAGCAAGCCTGGCGAACGCGGCATAACATGCAGTGGACGCGGAGAAAAAATTAAGGGAAAATCGATTCCTCTTATCTAGTTACTTAGATATTGGCCTTGGCTTTATCTCAATATTATGGATCATAGCTGGCAACTAATTCAGTCCAGTAAATATCCTCAATAGGGAATAATATATGCTTTCCATTCCCATCGGGAAAAGTTTTGTTCAACACACCAAGCTCAATCAACTCACTAATGTATGGGAATTGTTTTGATGTAACCACATATCTTCCTGCCTTCATTAAGGGCTGCGCACAAACCATAGATTGCTCTTCTGTAAGGTTTTGAATTACTGATCGCATTTATCGTTTTGCATCTTAATGCGTTTTCTTAGCTTAAATCGCTTATATCTGGCGCTGGCAATAGCTGATAATCGATGCACATTAATTGCTAGCGAAAATGCAAGAGCAAAGACGAAAACATGCACACATGAGGAATACCGATTCTCATTAACATATTCAGGCCAGTTATCTGGGCTTAAAGCAGAAGTCTAACCCAGATAACGATCATATACATGGTTCTCTCCAGAGGTTCTCATTACTGAACACTCGTCCGAGAATAACGAGTGGATCCATTTCTATACTCATCAAACTGTAGGGGTTGTAATAGTTTATCCGATTTCTCGCTGTAGGGTAACACGAGAACCACGAGCCTGATGTGGTTAAAAGACAGGCACAATCTTTACTACCGCAATCCACTATTTAAGGTGATATGGAAGAAGAATTTGAAGAGTTCGAAGAGCATCCTCAGGATGTGATGGAACAATACCAGGACTATCCGTATGACTACGACTATTGATAAAATCAATGGTGTGGACAATTCAAGCGATGCAATGGATGCAAGCTGCAATCGGAATGCATGGTTAAGCCTGAAGAAATGTTTCCTGTAATGGAAGATGGGAAATATGTCGATAAATGGGCAATACGAACGACGGCAATGATTGCCAGAGAACTTGGTAAACAGAACAACAAAGCTGCCTGATAGTGGCCTTTATTTTGGCATAAATAACAGAATAAACACTGCACTGTGTATTCATTCCAACGAGTGAATACACGATCGCAATGTCGCTCGTAACTAAACAGGAGCCGACTTGTTCTGATTATTGGAAATCTTCTTTGCCCTCCAGTGTGAGGCGATTTTTATCTGTGAGGATATGAACAGATGTCAAACATCAAAATACATCATTGATTACGACTGGAAAGCATCAATAGAAATTGAAATCGACCATGACGTAATGACAGAGGAAAAACTTCACCAGATTAATAATTTCTGGTCAGACTCTGAATACCGACTCAATAAACACGGCTCTGTATTAAATGCTGTATTAATCATGCTGGCGCAACATGCTCTGCTTATAGCAATTTCAAGCGACTTAAATGCATATGGTGTTGTGTGAGTTCGACTGGAATGATGGAAATGGTCAGGAAGGATGGCCTCCAATGGATGTAGCGAAGGAATAAGAATTACCGATATCGATACATCAGGAATATTTGATTCAGATGATATGACTATCAAGGCCGCCTGAGTGCGGTTTTACCGCATACCAATAACGCTTCACTCGAGGCGTTTTTCGTTATGTATAAATAAGGAGCACACCATGCAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGCCCTTCCGAATCTTTACTTGAACGAATCACCCGTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAGTCCCAAAGAATGGATCAAACACTTATGGCTATCCAGACTAAATTCACTATCGCCACTTTTATTGGCGATGAAAGATGTTTCGTGAAGCCGTCGACGCTTATAAAATGGATATTAATACTGAAACTGAGATCAAGCAAAGCATTCACTAACCCCTTTCCTGTTTTCCTAATCAGCCCGGCATTTCGCGGGCGATATTTTCACAGCTATTTCAGGAGTTCAGCCATGAAACGCTTATTACATTCAGGATCGTCTTGAGGCTCAGAGCTGGGCGCGTCACTACCAGCAGCTTCCCGTGAAGAGAAAGAGGCAGAACTGGCAGACGACATGGAAAAGGCCTGCCCCAGCACCTGTTTGAATCGCTATGCATCGATCAGCTTTGCAACGCCACGGGGCCAGCAAAATCCATTACCCGTGCGTTTGATGACGATGTTGAGTTTCAGGAGCGCATGGCAGAACACATCCGGTACATGGTTGAAACCATTGCTCACCACCAGGTTGATATTGATTCAGAGGTATAAACGAATGAGTACTGCACTCGCAACGCCGCTGGCTGGGAAGCTGGCTGAACGTCGGCATGGATTCTGTCGACCCACAGGAACTGATCACCACTCTTCGCCAGACGGCATTTAAAGGTGATGCCAGCGATGCGCAGTTCATCGCATTACTGATCGTTGCCAACCAGTACGGCCTTAATCCGTGGACGAAAGAAATTTACGCCTTTCCTGATAAGCAGAATGGCATCGTTCCGGTGGTGGGCGTTGATGGCTGGTCCCGCATCATCAATGAAAACCAGCAGTTTGATGGCATGGACTTTGAGCAGGACAATGAATCCTGTACATGCCGGATTTACCGCAAGGACCGTAATCATCCGATCTGCGTTACCGAATGGATGGATGAATGCCGCCGCGAACCATTCAAACTCGCGAAGGCAGAGAAGGGACGGGGCCGTGGCAGTCGCATCCCAAACGGATGTTACGTCATAAAGCCATGATTCAGTGTGCCCGTCTGGCCTTCGGATTTGCTGGTATCTATGACAAGGATGAAGCCGAGCGCGCATTGTCGAAAATACTGCATACACTGCAGAACGTCAGCCGGAACGCGACATCACTCCGGTTAACGATGAAACCATGCAGGAGATTAACACTCTGCTGATCGCCCTGGATAAAACATGGGATGACGACTTATTGCCGCTCTGTTCCCAGATATTTCGCCGCGACATTCGTGCATCGTCAGAACTGACACAGGCCGAAGCAGTAAAAGCTCTTGGATTCCTGAAACAGAAAGCCGCAGAGCAGAAGGTGGCAGCATGACACCGGACATTATCCTGCAGCGTACCGGGATCGATGTGAGAGCTGTCGAACAGGGGATGATGCGTGGCACAAATTACGGCTCGGCGTCATCACCGCTTCAGAAGTTCACAACGTGAGCGAAAACCCCGCTCCGGAAAGAAGTGGCCTGACATGAAAATGTCCTACTTCCACACCGCTGCTTGCTGAGGTTATTGCACCGGTGTGGCTCCGGAAGTTAACGCTAAAGCACTGGCCTGGGGAAAACAGTACGAGAACGACGCCAGAACCCTGTTTGAATTCACTTCCGGCGTGAATGTTACTGAATCCCCGATCATCTATCGCGACGAAAGTATGCGTACCGCCTGCTCTCTCCCGATGGTTTATGCAGTGACGGCAACGGCCTTGAACTGAAATGCCCGTTTACCTCCCGGGATTTCATGAAGTTCCGGCTCGGTGGTTTCGAGGCCATAAAGTCAGCTTACATGGCCCAGGTGCAGTACAGCATGTGGGTGACGCGAAAAATGCCTGGTACTTTGCCAACTATGACCCGCGTATGAAGCGTGAAGGCCTGCCTGCATTATGTCGTGATTGAGCGGGGATGAAAAAGTACATGGCGAGTTTTGACGAGATCGTGCCGGAGTTCATCGAAAAATGGACGGAGCACTGGCTGAAATTGGTTTTGTATTTGGGGAGCAATGGCGATGACGCATCCTCACGATAATATCCGGGTAGGCGCAATCACTTTCGTCTACTCCGTATACAAAGCGAGGCTGGGTATTTCCCGGCCTTTCTGTTATCCGAAATCCACTGAAAGCACAGCGGCTGGCTGAGGAGATAAATAATAAACGAGGGGCTGTATGCACAAAGCATCTTCTGTTGAGTTAAGAACGAGTATCCAGATGGCACATAGCCTTGCTCAAATTGGAATCAGGTTTGTGCCAATACCAGTAGAAACAGACGAAGAATTTCATACGTTAGCCGCATCCCTTTCACAAAAGCTGGAAATGATGGTGGCGAAAGCAGAAGCAGATGAGAGAAACCAGGTATGACAACCACGGAATGCATTTTCTGGCAGCGGGCTTCATATTCTGTGTGCTTATGCTTGCCGACATGGGACTTGTTCAATGACACCTCAGCAGGAAACGCCCTTCGCAGCATTGCCCGTCAGGCTAATTCTGAAATCAAAAGCCAGACAGCAGTTTCCGGATAAAACGTCGATGACATTTGCCGTAGCGTACTGAAGAAGCACCGCGAAACGGTAACGGTGATGATGGGATTCACACCGACTCATTTAAGCCTGGCAATCGGCATGTTAAACGGCGTCTTTAAGGAACGATGAACATGAAAAGCAAATCATCAGGGAGCTACAGGCTCCTTTTATTATTCGCATTCACCTCAAGCGTATTAACCAACAGTTCAGGGATTAATGAAAGATGGCAGACATCATTGATTCAGCATCAGAAATAGAAGAATTACAGCGCAACACAGCAATAAAATGCGCCGCCTGAACCACCAGGCTATATCTGCCACTCATTGTTGCTGAGTGTGGCGATCCGATAGATGAACGAAGACGCCTGGTCGTTCAGGGTTGTCGACTTGTGCAAGTGCCAGGAGGATCTGGAACTTATCAGTAAACAGAGAGGTTCGAAGTGAGCGAAATTAACTCTCAGGCACTGCGTGAAGCGGCAGAGCAGGCAATGCATGACGACTGGGGATTTGACGCAGACCTTTCCATGAATTGGTAACACCATCGATTGTGCTGGAACTGCTGATGATGAACGGGAAAGAAACCAGCAATACATCAAACGCCGCGACCAGGAGAACGAGGATATTGCGCTAACAGTAGGGAAACTGCGTGTTGAGCTTGAAACAGCAAATCAAAACTCAACGAGCAGCGTGAGTATTACGAAGGTGTTATCTCGGATGGGAGTAAGCGTATTGCTAAACTGGAAAGCAACGAAGTCCGTGAAGACGGAAACCAGTTTCTTGTTGTTCGCCATCCTGGGAAGACTCCTGTTATCAAGCACTGCACTGACCTGGAAGAGTTTCTGCGGCAGTTAATCGAACAAGACCCGTTAGTAACTATCGACATCATTACGCATCGCTATTACGGGGTTGGAGGTCAATGGGTTCAGGATGCAGCTGAGTATCTGCATATGATGTCTGACGCTGGCATTCGCATCAAAGGAGAGTGAGATCGGTTTTAAAAAAGATAACGCTTGTGAAATGCTGAATTTCGCGTCGTCTTCACAGCGATGCCAGAGTCTGTAGTGTCAGATGATGACCGTACTCAAACATCGGGTTGAGTATTATCTTACTGTTTCTTTACATAAACATTGCTGATACCGTTTACTGCTGAAACGACATACATTGCAAGGAGTTTATAAATGAGTATCAATGAGTTAGAGTCTGAGCAAAAGATTGGGCGTTATCAATGTTGTGCAGATCCTTGTCTTGTCTCCATGCAGACATCACGAAGGTGTTTATGTAGATGAAGGTATAGATATAGAGTCGGCATACAAATATTCCATGAAGGTTTATAAGTCTAATGAAGACAAATCCCCATTCTGCAATGTGCGAGAAATGACTGATACCGTGCAAAATTATTATCACGAGTACGGTGGAAACGATACTTGCCCTCTCTGTACAAAACATATAGATGATTAAACCCAATATTACATAACAATCCTCGCACTCGCGGGGATTTATTTTATCTGAACTCGGACGGCGGGTTTGTTTATGGAGATGATAAATGCACTTCCGAGTCACAGGGAATGGAATGGAGAGCCATTCAACAGAGTTATCGAAGCGGAGAACATCAACGACTGCTACGACCACTGGATGATATGGGCGCAGATAGCACATGGCACGTAACGTAATATTCGAATTGAAGAACTGAAAGAACACCAAAGCCGCCTGATGGCGGTTTTTCTTGCGTGTAATTGCGGAGACTTTGCGATGTACTTGACACTTCAGGAGTGGAACGCACGCCAGCGACGTCCAAGAAGCCTTGAAACAGTTCGTCGATGGGTTCGGGAATGCAGGATATTCCCACCTCCGGTTAAGGATGGAAGAGAGTATCTGTTCCACGAATCAGCGGTAAAGGTTGACTTAAATCGACCAGTAACAGGGCCTTTGAAGAGGATCAGAAATGGGAAGAAGGCGAAGTCATGAGCGCCGGGATTTACCCCTAACCTTTATAAGAAACAATGGATATTACTGCTACAGGGCATCAAGGACGGGTAAAGAGTTTGGATTAGGCAGACAGCGAATCGCAATCACTGAAGCTATACAGGCCAACCAACATTGAGTTATTTTCCAGGACACAACACAAGCCTCTGACAGCGAGAATCAACAGTGATAATTCCGTTACGTTACATTCATGGCTTGATCGCTACGAAAAATCCTGGCCAGCAGAGGAATCAAGCAGAAGACACTCATAAATTACATGAGCAAATTAAAGCAATAAGGAGGGGTCTGCCTGATGCTCCACTTGAAGACATCACACAAAGAAATTGCGGCAATGCTCAATGGATACATAGACGAGGGCAAGGCGGCGTCAGCCAAGTTAATCAGATCAACACTGAGCGATGCATTCCGAGAGGCAATAGCTGAAGGCCATATAACAAACCATGTCGCTGCCACTCGCGCAGCAAATCAGAGGTAAGGAGATCAAGACTTACGGCTGACGAATACCTGAAAATTTATCAAGCAGCAGAATCATCACCATGTTGGCTCAGACTTGCAATGGAACTGGCTGTTGTTACCGGGCAACGAGTTGGTGATTTATGCGAAATGAAGTGGTCTGATATCGTAGATGGATATCTTTATGTCGAGCAAAGCAAAACAGGCGTAAATTGCCATCCCAACAGCATTGCATATTGATGCTCTCGGAATATCAATGAAGGAAACACTTGATAAATGCAAAGAGATTCTTGGCGGAGAAACCATAATTGCATCTACTCGTCGCGAACCGCTTTCATCCGGCACAGTATCACTAGGTATTTATGCGCGCACGAAAAGCATCAGGTCTTTCCTTCGAAGGGATCCGCCTAGCCTTTCACGAGTGCGCAGTTTGTCTGCAAGACTCTATGAGAAGCAGATAAGCGATAAGTTTGCTCAACATCTTTCTCGGGCATAAGTCGGACACCATGGCATCACAGTATCGTGATGACAGAGGCAGGGAGTGGGACAAATTGAAATCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTTATAATGCCAACTTAGTATAAAAGCTGAACGAGAAACGTAAATGATATAAATATCAATATTAAATTAGATTTTGCATAAAACAGACTACATAATACTGTAAAACACAACATATGCAGTCACTATGAATCAACTACTTAGATGGTATTAGTACTATGTAACAGAGCATTAGCGCAAGGTGATTTTGTCTTCTTGCGCCTAATTTGTCATCAAACCTGTCGCACTCCCAGAGAAGCACAAAGCCTCGCAATCCAGTGCAAAGCTTTGTGTGCCACCCACTACGACCTGCATAACCAGTAAGAAGATAGCAGTGATGTCAAACGACGCAGCTGACTTCTTTCTTTCTTTCACGACTTCCCCACACCCAGCATGCATACCTTTCCGCCATAACTGTAGTGAATGTCTGTTGAGCGGACCAGGGAGCGGAAGTTAACACTTATGAAAATGGCTACGAAGTCGTGGCTATCTATCGGCTTATTAGTACTTGAAACGCTTCTTCAGAAGCCTGAAGAGCTAATCGTTCGGCGATACTATATGCATTAATAGACTATATCGTTGGTATAAACAGTGCACCATGCAACATGAATAACAGTGGGTCTGTAAAAGGAAGCAGAAAGCTAAATATGGAAAACTACAATACGATGCCCCGTTAAGTTCAATACTACTAATTTAGATGGAAAACGTATGTAATAGAGAGTAACTTAAAGAGAGATCCTGTGTTGCCGCCAAATAAATTGCGGTTATTTTAATAAAATTAAGGGTTACTATATGTTGGAGTTTAGTGTTATTGAAAGAGGCGGGTATATTCCTGCAGTAGAAAAATAAGGCATTCCTACGAGCAGATGGTTGGAATGACTATTCCTTTGTTACAATGTTTTATCTTACTGTCTTTGATGAGCATGGTGAAAATGCGATATCGGAAATGTTAAAATTGGTTTTGTAGGTCAAAAGAAGAAGTAAGCACTTATTCATTAATAGATAAATTCAGTCAACTCCCTGAAATGTTTTTTCCTTAGGTGAAAGCATTGACTACTATGTTAATCTCAGCAAATTAAGCGATGGTTTAAACATAACCTTCTTAAAGCTATTCAGGATTTAGTAGTATGGCCAAATCGATTAGCCGACATTGAAAATGAAAGCGTCCTTAACACCTCATTACTTAGAGGGGTAACTCTTTCAGAAATTCATGGACAGTTCGCACGTGTTAAATGGTTTGCCAGAATTGTCAGATTTCCATTTTCATTTAATAGAAAAGTGCTCCCGGATTCAGTGATAACTATACCTTTTGAGGTGACGGTTAATTCTATGCCCAGCACGAACATTCATGCTTTATCGGGCGGAATGGGTGGTAAAACAACAATTTTGAATGGAATGATTGGTGCAATCACCAACCCAGAAAACAATGAATATTTTCTCTGAAAATAATAGACTTATCGAGTCAAGAATCCCAAAGGGATATTTTCGATCGCTTGTTTCAGTTTCGTTTAGTGCATTTGATCCTTTACTCCTCCTAAAGAACAACCTGACCCAGCAAAGGTACACAATACTTTTATTGGACTCAAGAATGCTGCCAGCAATAGTTTAAAATACTAGGCGATCTCCGCTTAGAATTCATTTCAGCATTTATTGGTTGTATGAGAGTAGATAGAAAGACAACTCTGGCTTGAAGCTATCAAAAACTAAGTAGTGATGAAAACTTTCAAATATGGAACTCATCAGCCTCATTTCTAAATATGAAGAGTTAAGACGTAATGAACCACAGATTCAAGTGGACGATGATAAATTCACTAAATTGTTTTATGACAATATCCAGAAATATCTGCTTCGAATGAGCTCTGGACATGCAATTGTTTTATTTACTATCACAAGATTAGTAGATGTCGTTGGCGAAAGTCATTAGTTTTATTCGATGAACCAGAGGTTCATCTGCATCACCTTTGCTCTCTGCTTTTACGAACATTAAGCGACTTACTCGATGCACGCAATGGTGTAGCAATAATTGCAACTGCAACTCATTCCCCAGTAGTACTGCAAGAGGTTCCAAATCCTGCATGTGGAAAGTCCTACGTCAAGAGAAGCAATAAATATTATCCGTCCGGATATTGAGACATTCGGTGAGAACTTAGGTGTTTTAACTCGTGAGGTGTTTTACTTGAAGTGACAAATTCTGGATACCACCACTTATTATCGCAGTCCGTTGATTCAGAGCTTTCTTATGAAACCATTCTAAAATTATAATGGTCAGATAGGATTAGAAGGTCGAACCGTTTAAAGCGATGATAATGAACAGAGATGAAGGTAAAGTACAATGAAAAACTACCTCTTCCAGCGAGAACTTATAGCGAAATGCTTAATAAATGCTCGGAAGGTATGATGCAGATAAATGTTAGAAATAATTTCATTACTCACTTCCCCACTTTTTGGCAGAAAGAACAACAATATAGAATATTAAGCTCGACAGTCAGTTATTTACCTACGACAGGACACACCCTCTTGAGCCTACAACCCTAGTTGTAGTTGGTAACCTGACAAAGGTTAAATTAGAAAAGCTTTTATGAAAATAATCTCCGATAAAAACAAACCCGCTAGAACATATTACGATGACATGCTTGTTTCATCAGGTGAAAATGTCATTTTTGTGGTATAGACAGACAAAATATAGATCATTTTCTTCCTATTGCACATTATCCTGAATTTTCGGTGATGCCTATTAATTAGTTCCATTCCATCGTGCCGCGACTGCAATATGGGAGAGAGAAAGGTCAAGTTTTCGCAGTAGATGAGGTACACCAAGCGATTCATCCCTATATCTGACAAGGACATTTTTCGTGAGCAATGGGTATATGCAAATTTCGTTTCCGGAACTCCGGGTGCTATCAGTTTTATGTTGAATGCCCGGCGAACTGGAGGCAGGAAGACAAACACAGAGCTCTTCATCATTTCAAGCTATTAAATATTGCTAACAGGTATCGTTTGGAGGCAGGGAAGCACTTGAGTGAAGTGATTACTCAAAGAAACTCTTTCGTAAAGTTATAAGGAAATATAGTTCAACCGCAACGTTTCAGCTACAGTCAGAATTTATTGAAGCAAATCTGAAACCTATTATAGATTTGAATGACTTCCCCAATTATTGGAAAAGAGTTATGTATCAGTGCCTAGCAAACTCGGAAGATTTTCAGAGGGATCTAGAATATGATGAAAGATAGAAAATTACGACGCTTATCGGAAGTGAACGAATACTTTTTTATGAGGAGGCTGTTTTACAAATCCGGTAGTAACTTGCTAACCAATTCCTAGGCAGGTCATTGGCAACAGTGGCATGCACCGAGAAGGACGTTTGTAATGTCCGTATCCGGCACATAGCAGTCCTAGGGACAGTGGCGTACAGTCATAGATGGTCGGTGGGAGGTGGTACAAATTCTCTCATGCAAAATATGTAAATCGGTAGCAACTGGAAATCATTCAACACCCGCACTATCGGAAGTTCACCAGCCAGCCGCAGCACGTTCCTGCATACGACGTGTCTGCGGCTCTACCATATCTCCTATGAGCAACGTGTTAGCAGAGCCAAGCCACACTCTAATTTAATACATAATGAATGATAATAATAATATTAAATTTCCTGTGTAACTAATTTACTATGGTTTCTGATAAGAATCATTGCAAAGATCAAACAACTTGTATTACATTGACAGTTAAGCAGTTAATTTACCTCTAAATATATCAGCATCTAGCATGCAACCTATCAAAATGGAGAGTTTATGACTAAAACCATGGGAAAGAAGACTTAAAGATTTATCGCACTTGCTCAAATGCTGCATTGATACATATTTTGACCCTGAATTATTTCGCTTGAATTTGAATCAATTCCTCCAAACCGCAAGAACAGTAACATTTATTATTCAAAAACAAAACCAGATTATAGGATATGACATTTGGTATAACAATAATGTTATTGAAAATGGAAAATGATCCATTAATGGCTTGGGCTAAAATTCTCGCAATACGATAGAAAACAAGGCGATTTAGAAATGTATAGCGAGGCAAAGAGGCTACTCTTATTTCATCTTACATTGAAGAAAATGACATTGAGTTTATTACAAATGAAAGTATGTTAAACATTGGTATAAAAGTTAGTCAGACTTGCACAAAAGAAATTACCTTCATATTTAACTGAATCATCTATTATTAAATCAGAAAGACGATGGGTCGCTAATACGCTAAAAGATTACGAATTATTACATGCCTTAGCTATAATCTATGGCAGAATGTATAACTGCTGTAACTCTCTTGGCATACAAATAAACAATCCAATGGGTGACGATGTGATTTCGCCAACATCATTCGACTCTTTATTTGATGAAGCCAGGAGAATAACTTATTTAAAATTAAAGATTACTCCATAAGCAAATTGTCATTTAGCATGATACAATATGACAATAAAATAATTCCTGAAGATATTAAAGAGCGTCTAAAACTGGTAGATAAGCCTAAAATATCACTTCGACAGAAGAGTTAGTTGACTATACAGCCAAGCTTGCAGAAACGACTTTTAAAGGACGGTTATCACATTCAAACATTAATTTTATGATAAACAATTCCATCCAATTGATTTAATCAATACAACATTTGAAGATCAAGCAGATAAATATATTTTGGCGTTATGCAGCTGACAGAGCCAAAATAACAAATGCCTATGGCTTCATTTGGATATCAGAGCTATGGCTCAGAAAAGCAAGCATCTACTCCAATAAACCAATACATACAATGCCAATTATAGATGAAAGACTTCAGGTAATTGGAATTGATTCAAATAATAATCAAAATGTATTTCATGGAAAATAGTTAGAGAAAACGAAGAAAAACCGACTTTAGAAATATCAACAGCAGACTCAAACATGACGAAAAACCATATTTCATGCGTTCAGTCTTAAAGCAATTGGCGGTGATGTAAACACTATGAACAATTGAGTCATAGAACTTCCATTATTCTCCTGAAGATAATAATCGCCAAATAAACCAATACTCAGCTTTACAATATACTAACTAACCGCAGAACGTTATTTCATACAACGTTTCTGCGGCATATCACAAACGATTACTCCATAACAGGGACAGCAGGCCACTCAATATCAGGTGCAGTTGATGTATCAACACGGTTCAGCAACACCGATACTTCTTCCAGGCTTCCAGCAACGAGGTTTCTTCCTTCGTTGCAATTTCCAGATCTGCAGCATCCTGAAGCGGCGCAATATGCTCACTGGCTACCTGCATCAGGCTTTGTTTCTTCCGCCTCCCGGATCCGGAACAGTTTTTCTGCTTCGTATCCTTCACCAGGCTGTGCCGTTGTTCCACTTCTGATATTCCCTCCCGGCGATAACCAGGTAAATTTTCCGGTAACGGACCCGAGTTCAGAAATAAATAACGCGTCGCCGGAAGCCACGTCATAGACGGTTTTACCCCGATGGTCTTCAACGAGATGCCACGATGCCTCATCACTGTTTGAACAGCCACAAAGCCAGCCGGAATATCTGGCGGTGCAATATCGGTACTGTTTGCAGGCAGACCGTATGAGGCGGAAATATGCGTCACCTTCACCAATAAATTCATTAGTTCCGGCCAGCAGATTATAAATTTATGGTCCGTGGTTGTTCACTCATTCTGAATGCCATTATGCAAGCCTCAACAATAGTTAAATGCAATGTTTTGACGGTGTTTTCCGCGTTACCCGCAGCGTTAACGGATGATGTGTCCGTGTGAACCAATACTGAAAGAATGGGCATGAGCACCGATAACAACCGGATGCTGGTGCGCACCAATACCAACTGTATGCATGCATGTGCAGCGGCACTCACGGCTGTACCGGACAATGAGTGACTGTGGCTGCCCTGACTGTCCGTTTTCGATAAATAAGCAATACCTGTGTGCTGGTTCCTTTAACTGTGGATAAACTTCCTGTAATGGTTGCTGTTCCATACTGACTCCAGCCAGAACTGTTCATCCTTAAACCACTTGTGGCATGAGCACCCGCGGCCCCTGTTGAACCGCTCAGACTGTGAGAGCATGAGCCCCCGTGTTATTCGTCGATTTGGTGCCGTAATCGAAACTGCCTGTTGTTTTCGTCCCGTAATCAAACGACGATGTGGTTTTCGTCCCCAAATCCGTACCGGATGCACTGGCACTGTGGGTGTGCGACTTAATTCCATCCTGTTCCTGAGACAATACAGCACGACCGCTGGCGGGTTTCCCCTTGATTGTCCAGCCTCGCATATCAGGAAGCACACCCGATGGATACGCGACAGCAAGTTTTGGGTAGGCTGATTTGTCAAAAACGCCTGCCCTGCATCAGGACGTAGCCAGACGGAACGATATCTGATGGCCACGGGGATCGGCGCACCTGCCGGAAAGGCCGAATTCTCACCGGCCCCAAGGTATTCAAGAACATCTGCAACGGAATTTTGCCAGAATATCCCTGCCAACCTGAGTCAGTTCAGTCAGGCTGGCGGCATCATTTCCGCAAAATACGGTAATTTATTTTCGCCGTGGAAGCCCTGCCAGCGCCGTCAGTGTCGCATTCTTCGGTTGTTTACCCGCAAGCGCGTTAGTCATGGTGGTAGCAAAATCTGGATCATTCCCGAGCGCTGCGGCCAGTTCATTCAGCGTATTCAGTGCGTCAGGTGACGCGTCGATAACATCTGCAATCGCGGCCAGTACAAAGCGGTGTTCGCAATCTGGGTATTGTTTGTTCCCTGAGCGCGTTTGGTGCTGTTGGCGTTCCGGTCAGTGCCGGACTGTCCAGTGGGCTTTTCTGTTCGTTTCATCCATTACCACCTTAACCGCCTTTGGCGTTGCAGCAAGCGTTTCAGACGTGCTGTTGGTTGCACTGCTGAGCTGCACTATCCCTTTCTCGTTGTGTCCGCATCCTCAAGCGCGACAGCTGAAGCTATATCTTCTGCACGTTTTGCCGAATTTTGCACGTATTGCCGCCGCTTCTGCCGCACTTTTGCTCTGCGATGCTGATACCGCACTTCCCGCAGCCTCTGTCGCCTTCGTGGATGCCGTTGACGCACTCCCGCCGCCGCCTGTTTTGCGTCTGCCGCGGCAGGCAGAGGCTCCGTTCCGCTGCTGTTTCAGATGACCTGGCATTCGTCTCGGACGTTTTGCCGCCCTGGCAGAGAATTTTCTGCCGCCGTTGCCGAGGAAGCTGCACGACCGGCACTTGATGATGCGTTCGTTTCTGATGATTTTGCTGCCTCTTTGAGGCCACCGCATCTCGTGCTGAAGTGGCGGCCTCTGACGCTTTCGTGGCCCGGTGGAGGCAGACGTGGCTGGCTGATTGTTGACGCTGCAGCATTCGTTTCTGACGTTTTCGCCGCACCGGCACTGGGCCGCCGCCGCGTTTTTGAGGACTCTGCGGCTGCGGCACTTTTCCGCTTCAGTGGCCTTTGCTGATGCCGCTTCTGCGCCGGAGGACGCTTCCTGAGCTGACGATGCAGCCTGTCCGGCGACGTGCTGCGGCGGCGCGTGCTGAGTCAGTTGCATCAGTCACAAGGGCCGCGACCTGAGCAGCTGATGCACTGGCATCGCCGGCTGATTTCTTCGCGTCTGCCGTACTCTGTGCCACCACGGACGCGTTACGCGCCACCTCTTCCACCATCAGTTCAAGACGACGCAGCACCTCCGGCCGGGCATCATCCTCCGTCATGGCACAGAGAAAATCATTCAGCGTCCCCGGTTGTGAATCTTCATACACGGTGATGGTCCCGGCGTGCGATGGTGGAAAACCGTCAACCTGCAGGATGACACTGTACTGACCGTACTCCACATCCATGCTGTAACGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCACCACCACCGTGGTGCTGTTACGTCTGGCTTTCAGCTGAATGGTGCAGTAGTCTGTACCGGTTTTCCTGTGCCGTCTTTCAGGACTCCTGAAATCTTTACTGCCATATTCACCCCACAAAGCCCACCGGTTCCGGCGGGCTGTCATAACACTGTGTTACCTGGCTAATCAGAATTTATAACCGACCCCAACGATGAATCCGTCAGTACGCCAGTCGCCACTGCCGGAGCCTTCATAAGCAATATCAACAACGACGGACGCTGCCGGATTAATCTGTATACCTGCACTCCACGCCACTGAGGTATGCCGCATTGCACTTTCGTCCCTGGCAGTGGTCGTCTCCTTTCATATACCCGGGAGTGATTTCCGTCTTACGGTAATCCATTGTACTGCCGGACCACCGACTGTGAGCCACTCCGGCCATGGCGTACGCACTGACCTGCTTACTGATTTGTAAAACCGGTCCGGCCATCACGCTCACATAACGTCCACGCAGGCTCTCATAGTGAAACGTATCCTCCCCGGTCATCACTGTGCTGCTCTTTTCGACGCGGCGAACCCCAGGGAAGCCATCGGCCCACACTGTCCGTCAGCTCATAACGGTACTTCACGTTAATCCCTTTCAGATGACTCACACCGGTATCCCCGCCCGACAACGACGGCAATGTACCCGGTTTCACTTGAAAATAGCCCACCGTAAACGTACCATGTCCTTCGCACGGGCCGGAGTGACTGTCACCGCAAGTGCGGCAAAGACAGCAACGGCAATACACATTACGCATCGTTCACCTCTCACTGTTTATAATAAACGCCCGTTCCCGGACGACCTCTGTAACACACTCAGACCACGCTGATGCCCAGCGCCTGTTTCTTAATCACCATAACCTGCACATCGCTGGCAAACGTATACGGCGGAATATCTGCCGAATGCCGTGGACGTAAGCGTGAACGTCAGGATCACGTTTCCCCGACCCGCTGGCAGTCAACAATACGGGAGAACACCTGTACCGCCTCGTTCGCCGCGCCATCATAAATCACCGCACCGTTCATCAGTACTTTCAGATAACATCAACGAATACGTTGTCCTGCCGCTGACAGTACGCTTACTTCCTAGAAACGTCAGCGGAAGCACCACTATCTGGCGATCAAAAGGATGGTCATCGGTCACGGTGACAGTACGGACTGCCTGACGGCCAGTCCACTGCTTTCACGCTGGGGCGGAAAAGCCGCGCTCGCCGCCTTTACAATGTCCCCGACGATTTTCCGCCTCAGCGTACCGTTTATCGTACAGTTTTCAGCTATCGTCACATTACTGAGCGTCCGGAGTTCGCATTCACACTGCCACTGATATCCGCATTTTAGCGGTCAGCTTTCCGTCCGGTGTTAGGAAAGGCCGGAGGATTGCCGCCGCTGGTAATGGTGGGGGCCGTCAGGCGCTTCAGGAACACGTCGTTCATGAATATCTGGTTGCCCTGCGCCACAAACATCGGCGTTTCATTCCCGTTTGCCGGGTCAATAAATGCGATACGATTGGCGGCAACCAGAAACTGGCTCAGTTTGCCTTCCTCCGTGTCCTCCATGCTGAGGCCAATACCCGCGACATAATGTTTGCCGTCTTTGGTCTGCTCAATTTGACAGCCCACATGGCATTCCACTTATCACTGGCATCCTTCCACTCTTTCGAAAACTCCTCCAGTCTGCTGGCGTTATCCTCCGTCAGCTCGACTTTTCCAGCAGCTCCTTGCCGAGATGGGATTCGGTTATCTTGCCTTTGAAAATCCAGGTAACCTTCCGCATCATCGCTCGCCCGACCGACGGCCTCCACGAATGCCGATTTGCCAACGGTGTTCACACTGCGGATATAAAGTAATAATCATGGCCCGGTTTGATATTGATACTGGCGGCTATCCAGTACAGCGCCGTACCAAGATAACGCGTGCTGGTTTCAACCTGTCTGATATCCGCAATCTGCTTTTCCGAGAACCAGAACTCAAACTGTACCGTCGGGTCATAAACGGCAAGATGCGGCGTGGCGGTTATCTGAAAATAGCCCGGCGTCAGCTCAATCCTCGACGGTGCTGCCGGTGCGGCAATCCGGAACGATACCGACGCCGGATCGCCCTGCTGCCCCACGCATTTACCGCCCGGACTGTCAGCCTGTAGTTCCCCAGCGCCAGTTGCGTGAAGCGGTATGTGGTTTCCGTCGTCCGGGCCGTGCTGACCAGCCGCTCACTGCCGTCGTCCGCTGTACACGTCAGACGGAGCAGGAAACTCACGCCCTTCACCACCTTCGGTGTGTCCCATCGCGCCAGCACCTGATATTCCCGCTGTCTGCAGTGACTTCTGCGGTCAGGTGCTGCACCGCTGGCGGCGTGACACCATTCACCGTGCCACTCTGTTCGCCGTCAAAGTGCGCCCCGTTATCCACGATGGCCTCTTTTCCGGCACATGCTGCACGGCGGTGATGGCATACGTGCCGTCGTCGTTCTCACGGATACTCACGCAGCGGAACAGTCGCTGGCGCAGCGCAGCGTCGGCAGCTTCAGCTCCCATACGCTGTATTCAGCAACACCGTCAGGAACACGGCTCATTTTACCTTCACGCCGTCGGTGACGGCTGACTGAACCTCCACGCTGACCGGATTGCCACTTCCGTCAACCAGGCTTATCAGCGCGGGGGAGGAGGATGGCAGCGTGATTTCACGGTCGAGCGTCAGCGTCCGGGTCTGGCTGTTCACCGCCAGCCAGCACACGACCACCGGTGCTGATACCGGCATAGTCATCATCGCAGATTTCAATAACATCGCCCGGTACATGGCGAAGCCCCTTCTGCGCCGACGCTGAAATCCACGGTCTGCGTTTCCAGCAGTTCTGTTTTAATCAGCCACAGCCCGGCGCGGTGTGCCTGCCCCGGCTGGTACAGCCAAAGGCATCCATCTTCGTAACATTACGACCGTAACGGGCAATGGCCTGCGTATCTTCAACAAGCTCTGTCGCCGTCTCCCAGCCGTTGTTCGGGTCAATCCAGTTCACCTCAACGGCATTATGGCGCGGTCCTTCAGGGCGCTGAAGCTGTAGCGGAACGGCGCGCCATCATCCGGCATCACCACATTACTGCGGTTATAGTCCACGTCTTATCCGACGGTCGGTCCTGCACGAACGTCAGCGTGCTGCCCGTTCCATACCGGCATACAGCGCATCGCCGAGCAGAAATCGCTGAGCACATCCCACGCCTTACGCTGTGGTCAGGTACGCATTACAGGTGATGCGGCGCGGCGCTCCGTGCCGCCAAAGCCGTCCGGCACTGACTGGTCGCAGTACTGGCCGATGACATACAGCGCCCATTTATCCACATCCGCCGCACCAAGACGTTTCCCCATGCCGTAGCGCGGATGGGTCAGCATATCCCACAGACACCAGGCCATGTTGTTGCTGTATGCCGGTTAAACGTTCCGTCCCAGATACCGCTGTATTGCCGCGTCTGCGGGTTATAGTTCGACGGCACCTGCAGAATACGCCCGCGCAGATGATAATTACGGCTCACCTGCTGGCTGCCGAACTGCTCCGAGTCCACCTGCACGCCGACCAGTGCCGTGTTCGGGTAGCACTGTTTCACATCGATGATTTCAGTGTATGACGACCAGAGCGTTTTGTTCTGCAGCTGGTCTGTGGTGCTGTCCGGCGTCATCCTGCGCATCCGGATATTAAACGGGCGCGGCGGCAGGTTACCCATCACCACCGAGGCCAGATACTGCAGGTGGTTTTGCCCTTAATGGTGATGTCTTTTCCGTTACCCAGCCACCGTTACGTTGTATCTGAACCAGCAGGCGGACTTCCGACGGATTCCTGTCACCCTTTGAGGTGGTTTCCACCAGTGCCTGTACACCGAAGGTAAAGCGCAGACGGTCGATGTTTGCAGACGTAATGGTGCGGGTGATCGGGCGTCATATTTCACTTCCGTACCCAGCACCGTCTCGGAGCCGGAGGATTCAAATCCCTCCGGCGGAGTCTGCTCCTGCTCACCAGCCCGGAACACCACCGTGACAGGATATGTTGGTATTCCCTCGAGTGTCCAGCACCGGCGTACTGTTCAGCAGCACGCTTTTAAGCCATCCACCGGACCTTCAATCGGCCTTCGCTGATGGCATCGATCACACTCAGCAACTGCGTGGACTTCAGGTTGTCCTTCGCTTCGCGCGGGGGTCCCCTTACTGCTTCCTTTACCCATTCCTCACGCTCCATAAATGACAAAACCGCCCGCAGGCGGTCCGCACATAAAACATTTTGCATCAGCGACCAATCACCACAACCTGACCACCGTCCCTTCGTCTGCCGTGCTGATCTCCTGAGAAACCACGCGTGACCCCACGCGCATTTCCCCGTACAGAACAGGCAGAACATTGCCCTGGGCAACCATGTTATCCAGTGAGGAGAAATAGGTGTTCTGCTTACCGTTATCCGTTGTCTGTACGGGGAGTTCTGGCTTTCGGTGCCAGCATCTGCGCCACACCACCGAGCACCATACTGGCACCGAGAGAAAACAGGATGCCGGTCATACCACCGGCCCCAATGGCTGCCCCCATGCTGCAAGGGGGCTCCGGCGGTAAAGAATGATCCGGCAATGGCGGCAGCCCCCAGGACAATCTGGAATACGCCACCTGACTTGGCCCCGGCGACTCTGGGAACAATATGAATTACAGCGCCATCAGGCAGAGTCTCATGTAACTGCGCCGTTAACCCGGACGTGCTGACGTCCCGCCCGGCAATCCGTACCTGATACCAGCCGTCGCTCAGTTTCTGACGAAACGCCGGGAGCTGTGTGGCCAGTGCCCGGATGGCTTCAGCCCCGTTTTCACACGAAGGTCGATGCGGCGACCAAATCGTTGTAAATCCCCGTAAAGGCAGATGCGCGCCATGCCCGGTGACGCCAGAGGGAGTGTGCGTCGCTGCCATTTGTCGGTTCCTCTCTCGTTTGCTCAGTTGTTCAGGAATATGGTGCAGCAGCTCGCCGTCGCCGCAGTAAATTGCGGCGTGATTCGGCACTGATGAACCAAACAGCACAGCAGCACATCGCCCGGCTGTGCCGCTGACAACGGCACCTGATACAGCCCCGTCGCCTCCAGATTATCCAGATAGAGATTCTGGCCGTTACGCCACCAGTCATCCTCACGATGAAAGTCCGGCATCTCAATCCCGCCAGATGATAAGCATCCCGGAACAGTGTGTAACAGTCCGTCACACCGTGCTCAAAGCGCCGCCCGGTGAGATGCGGCACACAGCGGAACTTATGAATCGTCCCCCGGCAGACCAGCCACCACGGCAAATCACTCTGCACCTGCAGCCGCCGGTCGGCCTCACTCAGCCGAGGCAGACCACGGGGGTGGCTGTGGACAGCGCCACAATCTCACCCTGCATTTCTGCCTGCAGCCAGTCTTCCGGCGACATACGGAAATACGCCTCCGGCTCACCGGAGATATTCACGCAGGGAAATATCTTTCCCCTCCGGCGTGCTTACCACGAAGCCGCACGCACGACTCCGCTGGCGCACATCGCCGGGCGTGCGCCAGAATCGCTGATTCTGTCTTGTCATGGGATTTACTGCGAAAGTTTGTTAATGGGAAAGGAAGCCGCCAAAGTTGCCGACGTTATTGCGGAACTTACAACGCTCAGGCATTTGCTGCATTTATCCTTCGTGATATCGGACGTTGGCTGGTCATATTCATCCGCGACAGCCGGACCGCTATAACCGCACTCGTCACCGCGATAGTCCAGGTGCAGGTGTTGGCCAGCATGATACGTCCGGAAAAACAGCGCCATCCGTTTCCGTCGGCGTGACAGTACAAAGGAGGCACTCACCGCGCTCAGTTCGCTGCACTGCTCAATGCGCCAGCGGCTGATCACCTCCTGCTCCGGATCGGCGTAACTGTTTCCGTTGACGAAGTTCACCGCATCCAGAAAACGGGCGTAAACCTTACGCCGGACCACCGTTCCGCCGACCAGACTCTGCTGCATATCTTCCGCCATCCCGGTGACCATACCGTACAGGTTAGAAACCGTCAGCGTGGGGCGCGGGTACTGGTGCCTTTGCCATTCAGTTCAAAACCGCTCAAACCCTCCCCTGAATGGGATACGGCTGATACTGTCGCCCCTGCCAGGTGACCGGCTCACCTTTTCGTTCTGCTCATTACAGAAAATAACGTTCTCCACCGACCTCTGTCAGGTCGATTTCCGAGAGCACCACGCTGGCCGACTGCTCCGCACGGGTGCATTCATTCAGTGTTTCCTGCCGGATATCCTGCATCAGTTCACCTGTTCAAACTCTGCTGAACTCAACACGCAGCATACTGACCCGCGACGACCATTTTGCGCAGGTCATACCTTTATCTGCCGCCACTCATAAGGCGGCGTCCACAGAAAGGATTTCCAGCCCCGTGCTCTTCCAGAAACGACTCCAGTACCGTGGCCTCCTCACGGGGGACAGAAGGCGTCACGCTGTACGTTTCAGGTTGGCATTCAGCCCGGCAGGCGCTCGCTGAGAATAGCCATCACCAAAGCGCACCTTTCTTACAGAAGGGACCGAAGCCACATCCATACCGGGTTTCACTTTCCAGCGGAAGGTCTTCATCGTCACCTCCCGGAACACAGGCCACCATCACGCATCTGTGTCTGAATTTCATCACGGGCACCCTGCGGGCCATGTCATACACCGCCTTCAGAGCAGCCGGACCTATCTGCCCGTTCGTGCCGTCGTTGTTAATCACCACATGGTTATTCTGCTCAAACGTCCCGGACGCCTGCGACCGGCTGTCTGCCATGCTGCCCGGTGTACCGACATAACCGCCGGTGGCATAGCCGCGCATCAGCCGGTAAGATTCCCCACGCCAATCCGGGCTGGTTGCCTCCTTCGTGAAGACAAACTCACCACGGTGAACAATCCCCGCTGGCTCATATTTGCCGCCGGTTCCCGTAAATCCTCCGGTTGCAAAATGGAATTTCGCCGCAGCGGCCTGAATGGCTGTACCGCCTGACGCGGATGCGCCGCCACCAACAGCCCCGCCAATGGCGCTGCCGATACTCCCGACAATCCCCACCATTGCCTGCTTAAGCAGAATTTCTGTCATCATGGACAGCACGGAACGGGTGAAGCTGCGCCAGTTCTGCTCACTGCCGTCAGCATCGCCCGCCATATTCTGTGCAATACCATCAAAGGTCTGCGTGGCTGCACTTTTACCTGCGACATACTGTCCGTGGCGCTCTCTTCCCACTCACTCCAGCCGGACTTCAGGCCTGCCATCCAGTTCCCGCGAAGCTGGTCTTCAGCCGCCAGGTCTTTTCTGCTCTGACATGACGTTATTCAGCGCCAGCGGATTATCGCCATACTGTTCCTTCAGGCGCTGTTCGTGCTCGTGGCTTCCCGTTCTGCCTGCCGGTCAGTCAGCCCCCGGCTTTTCGCATCAATGGCGGCCCGTTTTGCCCGTTGCTGCTGTGCGAATTTATCCGCCTGCTGCGCCAGCGCGTTCAGGCGCTCCTGATACGTAACCTTGTCGCCAAGTGCAGCCAGCTGGCGTTTGTACTCCAGCGTCTCATCTTTTATGCGCCAGCAGGGATTTCTCCTGTGCAGACAGCTGACGACGGCGACGTTGCGCCGCCTCCTCCAGTACCGCGAACTGACTCTCCGCCTTCCACAAATCCCGGCGCTGCTGGCTGATTTTCTCATTTGCTCCGGCATGCTTCTCCAGCGTTCGGAGTTCTGCCTGAAGCGTCAGCAGGGCAGCATGAGCACTGTCTTCCTGACGATCGCCCGCAGACACCTTCACGCTGGACTGTTTCGGCTTTTCAGCGTCGCTTCATAATCCTTTCGCCGCCGCCATCAGCGTGTTGTAATCCGCCTGCAGGATTTTCCCGTCTTTCAGTGCCTTGTTCAGTTCTTCCTGACGGGCGGTATATTTCTCCAGCGGCGTCTGCAGCCGTTCGTAAGCCTTCTGCGCCTCTTCGTATATTTCAGCCGTGACGCTTCGGTATCGCTCTGCTGCTGCGCATTTGTCCTGTTGAGTCTGCTGCTCAGCCTTCTTTCGGGCGGCTTCAAGCGCAAGACGGGCCTTTCACGATCATCCCAGTAACGCGCCCGCTTCATCGTTAACAAATAATCATCCTTGCGCAGATTCCAGATGTCGTCTGCTTTCTTATACGCAGCCTCTGCCTTAATCAGCATCTCCTGCGCGGTATCAGGACGACCAATATCCAGCACCGCATCCCACATGGATTTGAATGCCGCGCAGTCCTGTCTGCCCAGGTCTCCAGCGTGCCCATGTTCTCTTTCAGGCGGCGGGTCTGGTCATCAAACCCCTTTCGTTGCGGCCTCGTTCGCCGCCTGCAATGCCCCGGCTTCATCGCCGGAACGCTGCAACTGAGCAACATACGCAATCTGCTCCGCCGACACGTTATGGAACTGGCGAGCCATCGCCGTCAGCCCCGACGTCGGGTCTGTGGTCAGCTTCCCGAAGGCTTCAGCGACCTTGTCCACCTCCACGCCGGATGCAGGAGAAACGCGCCACACTCTGGCTGATGGACGCAATCTGAGCCTCACCGCTTACCCCCGCCTTAACCAGTGCGCTGAGTACTCGCTGGTCTGGTTAAACGTCAGCCCTGCCGCCTGCCCGGGCTGGACAGGACCAGCATACGATCTGCCGTCAGTCCCGCCTGATTGCCGGAAAGGACCAGCGTTTGTTGAAATCGGACGGACAGGGTGAGTTGCCCTGATACCAGGCATACGCCAGCGCACCGGTCGCCCACCGCCAGCGAGGCCCCACCATCGGCAGGGTGATCGCACCGGCAAGCCCCCTGAACATGGGGATCATCCCGCCGAAGGAGTCCTTCACCTGCCCCCTGTTGCAGCAGGATCAGCCACGGACTTTGCCCGCCTGCAAGCTGCGTGGCCACGTCGGTGAACTGTGCAGGCAGCATACGCATGGCGGCTTTATACTGCCCGACGGAAATCCCCGCTTTCTGTGCAGCCAGCGCCTGTCGGCTCAGCGACTGTTCAACGACTGCCGCTGTTTTTCGCATCACTTTCCGTACCAGAAAATGACGCCTGACTCTGGCCATCTGCTCGTCAAATCTGGCCGCATCCAGACTCAAATCAACGACCAGATCGCCTACCAAGGGTTCAGCCATACCGGACTCCTCCTGCGATCCCTTCTGATACTGTCATCAGCATTACGTCATCCTCCGTCATGTCGCCACATCCGGGGGAAGCGGGGATAACTTCATTCCCGTCCGGGCCAACGCGGACACCTCCGGCAAGCCCTGCCGCTTTCTGCATCAGCACATCATCTTCAGGCTCTTCGTCAGCCTCGCGCCGGTTCAGCAGACTGAAATCCAGGCGGATGCATATCCGGATCGCTGAAAAACAGGCTGAGCACGGTGTACGTCAGCCGGAAAAGTGCATATCCAGCAGAACATCATGAAAATAATGGGTACTGTAAAGCGGTGCCAGTCGGCATACTCCGTGGATGACATCCCGGCAAGCATGGCACGCCAGTCGGGTCGCCCCATCTCACGCGCAGTTTCAGGGCAAAACTCAGCTCACCGTCGAACACTTTCCCGCAGAAACAGGCTCTGCGGGCCCGGCGTCCTCTGTCTGTTCAGGGGCATTATTCACCACAAACTCATACATACCAGACAGCCGGTACACCACGTTTTCAGCATGAGAAATTGCCTCCGTGGCCAGGTGGTAAGCACTTCCTGCTCAATCTGTTTAACGGCTTCATTCATGGACGGCATCTGCGTCTTCTGCGGATGGTTATGCCACAGGGACATCGCCACCAGAAACGCGCCGGTTCGTGATGGCGTCGTTCCACAGTAAACTTCCGGTTGCTGTCTGACTCCGCCTGTTCTGCCTGCCGTTTCATCAGGGCGAGATGCTCAATGCGCTGCAGGGCTGACAGTTCAGAAAGCGTGACGGTCACCCGTTATGTTCAAATGATTCGGTTTTCAGGAACATCGCTGACTCCGGATTAACTGGCGGTGACGGTAATTTCTGCAACCGCAGCAAACTCACCATTACCGGATACAACCGGAATGTTGACCTTGCCTGCAGCAACGCCGTTCACGGTGATGGTCATACCACTGACGACACGGTGGCTTTTGTTTTATCCGCAGACAAGCACGAAAGCTCTTGTCGGTTACGCCTCCGGCTGGAAGGCCACGGTCAGCGTGGTGCTCTGCCTTTCACCACCGAGGTGCTGGCAGGCGTCACGGTCATGCCGGTTGCCGCTGTTACCGTGCTGCGATCTTCTGCCATCGACGGACGTCCCACATTGGTGACTTTCACCGTGCGGGTGATCACTTCCTTCGCCGTCACTCGCCTTACCGATACTGCTGACCCAGCCACGGAACACATCGACCGTGCCGTTCGGGAAGCGGATTTATAGGCACGGGTATCGCCTTCATTAAACCACGCCAGCAGCGCCTGCTGCCCTGCTCTCCGGGCATCCACGCCAGCGTGAAGCTGGTATCTCCGGCAGATTTCTGCCCCTGCCCGGTCGCAGTCCAGTCTGCATCTTCATCATCGAGATAGCTGTCGTCATAGGACTCAGCGTCAGTTCGCCGGGCGTCAGGTCTTTAACTTTTGCCAGACGCGACCAGTCAACGTCTGAAAGCGGATTCGCGTAAGGGTACCGCTCCCCCGTAAAACCCACAGGGTGGTCCCGGCACCTTTCACCGGCATTGTAGGATTTGGTACAGGCATAGCGTCCTCACATTTCATAGGTAATGACATAAGTCAGATCGGCTGAACTCCACAAGCCCGCATCATCGTCGCGCCGGTAGTAGCTCCTGGCCACCATACTGGTGATCAAATCTGACAGTGCCGGGATATCGCTCATACCGGATAAATCCGGGACTCCATCCACGCATCCAGAGCTCTGAATCCAGCACCTGAGCAGGCAGGAAAACTTCGATATGCAGCTCCGCCTGCCAGGTATCCTGTCCAGCTCTTCGCCGTGTATTCAGCGCCGGTGAGATAAACGGCAACTGCCGGAAAATCCGCCTCCATCAAAACACTCCGGGGCGACCATCAAAACGTCGCCCCGGTGTCATGCTTCTCCAGTGCATCCAGTACGGCTGCACGGAGTTCAGTATGTTTCATCGCTTTATTACCATCCTCAGTTGATGCTGCAGCGCATAGCCCAGCTCTTTCGGAAGACGTTCACGCCGTATCCGCTCAATATCTTTTGTTTAAACGCCGTGGTCAGCGGCAGCGCCATCGGGATTTTCACCACATCAATGGGGTAACGGTTTTTCCCAGCCCACGCTGCATGACATGCCACCGGCCATTTTTCAGTTGCTGAATAAACGCCGGGAATACGACGGTTACCACCAAGCACGCTGCCGCCACCTTTCAGGGATGAACGCTGCCCTTTTACGAAATGCCTGCGGCGCGAAAGGACCCGGCGCATTACCCCAGCTTGATTACGGGCAAATCCCCCGGTTAACTTTGATTCTCTGCCTTGCGGATTTGACCGTGGCCCTTTCAGCCTGGCCCTTCCTTTACCAGTTTCGGCGTACCTTTGTCTCACGGGCAACCTGTGACGCCGACTGCGATATCGCGGATGAAGCAACGAAAGGTTAATGGCCAGTGGTGCGGCACCATGCAGCACCGCGCCGTTTTGCTGATACGGCTGAGGTTTTCAACGGCCTGCTCAAGACTTTATGGCCATACATCCCCTTTCAGCGGCGACGGTTAACGGCAGGCGGTACGCCCCGTCCAAGCCAGAGATGACAACTTCCCTCATCATCCGGCGAAACCCGATCTACCCAGAAATTTTCCTCACCGATGGTCAGCGTGTCTCCACGCCGCAGCTGCCGCACCTCATCAGTCCGGACAAACAGGGACGGGCTGGAGCCTTCAACGCGCACGCCCTGTCCGGCATAGCTGATATTTTCAGGGTCATCAAAACACCACGTATCACCGCACCTGACTGCTCACCGGATGTAATGGTGGCTGACGTTCCCATGTACCCGCGTATCGTTTCATCGGCGCGGGCAATGGGCAGCATCGAACAGGTATCGAAATCAGCCACAGCGCCTCCCGTTATTGCATTCTGGCGGCCGCGCTCTGTCATTTCGGCTGCCACACCGGCAGAGACGAAACGCCGTTCCCGGCAGCACAAATGCCACAGGTTCATCCCGCCGTGGCGTGAAGTGCATCAGTATGCAGCTTCACCAGTGCCACGACCGTGACCAGTTCAGACGTATCCAGAATCACGGTATCCGGCTGCGCTGATCCCACCTCATTTTCATGTCCGGTCAGCACATTTCCCGGCTGAGAGGGGGCTGTGACCGGCAGTTTCATCTCGTGTCATCAAGCTCCTCTTTCAGCTCTGCCACACGGAGCGCCAGTTCTTCTTTCGTCGTCCCCGTCAGGCTGACATCACGGTTCAGTTGTTCACCAGGCGAGCGGAGACGGGCAATCAGTTCATCTTTCGTCATGGACTCCTCCACAGAGAAAGCATGGCCCCGAAGGCCATGATTACGCCAGTTGTACGGACACGAACTCATCAGAGATACAGCCAGCAGCATCAGCGGTGCTGACTGAATCATGGTGAAACTCACGCGCCGGATCGCCGGTGGTCACCCAGTTTTTCGGGTAACGGGCAGAGGCGTTAATGCCTTCGCGCTGTGCGTCCGCATCCTGAATGCAGCCAGCTCATGTAGCGCAGCAGACCGCGTGCCTGAGTGTTCCCCAGCACCATCGGTTGTCCGGCAGGAAGTTCTTTTGACGCCGTTTTCCACGTACTGTCCGGAATACACGACGATGGCCACATCGCCATACATCCCCTTATAGACACCGCTTTGCCCAGGTCTTCACCGCTGTCTCCAGCTCGGAATTAGAGCCACGACGGGTATCCAGCTTCTCCTTGACGGCTTTGAAGGAACGGAACAGCGCCAGCCTTTCGGATCGAACACGATGATATTCACCACACCGCTGGCGTTCAGCGCGTAGGCTTCGATATCGTCGGTCGGGTCATACGTGGACTTGTCACGCTTGCTCCACTCCGTGCCGCCGGACTGCGTGATGTTATTCTCCTCACTGCGGCCCATATCCACCTCAACCGGATCGAAGGCTTCACCGGTCATGGTGTATTTTGCCTTAAGCACGGCAGAAACTGCCTGCATCTCTTCGACCTGAGCAATGGCCAGCTCTTCGTCACGCATGTTCTGCATGATGATGCGACGGCGGCGGTAAGCCGGGTCCGCCAGATTCTGCGATCTTCATCCGGCAGGCGACGCAGGGTCATCTGCGGATTCACTTCATGCTTCGGCTTGACATATCCCGGCGTAAATTCAGGGTGGAGCCGCCACGGGAACGGATAACCTCACCGGAAACAATCGGCGAAACGTACAGCGCCATGGTTTACCAGTCCGGAATTTGTGAGAGATAGACTTTCTCGTGGTGAAGGATAGCTCTCACGGAAAAGGACGCAGAAACAGCGGATCAAACTTAAATTTCTGCTCATTTGCCGCCAGCAGTTGGGCGGTTGTGTACATCGACATAAAATCCCGTAAAAAGCCGCACAGGCGGCCTTTAGTGATGAAGGGTAAAGTTAAACGATGCTGATTGCCGTTCCGGCAAACGCGGTCCGTTTTTTCGTCTCGTCGCTGGCAGCCTCCGGCCAGAGCACATCCTCATAACGGAACGTGCCGGACTTGTAGAACGTCAGCGTGGTGCTGGTCTGGTCAGCAGCAACCGCAAGAATGCCAACGGCAGCACCGTCGGTGGTGCCATCCCACGCAACCAGCTTACGGCTGGAGGGTCCAGCATCAGCGGGGTCATTGCAGGCGCTTTCGCACTCAATCCGCCGGGCGCGGTTGCGGGTATGAGCCGGGTCACTGTTGCCCTGCGGCTGGTAATGGGTAAAGGTTTCTTTGCTCGTCATAAACATCCCTTACACTGTGTGTTCAGCAAATCGTTAACGGGATCAGATGCCGGGTTACCTGCAGCCAGCGGTGCCGGTGCCCCCTGCATCAGACGATCCAGCGCAGTGTACTGCGCCTGTGCACTCTGTGGTGCTGCGGCCAGAATGCGGCGGGCCGTTTTCACGGTCATACCGGGGGTTTCTGCCAGCACGCGTGCCTGTTCTTCGCGTCCGTGAGCCTCCTCACAGTTGAGGGATCCCCATAATGCGCTGTTTTCTGCCGCAACCGCTGCGGTGATCTGCGCGTTCACGTCCGGCTGCGCCGCGCTGGCGTTCTCGCCCTCCGTCGCTGGCACCACGTCAGTAACGTCAGCCTGCGAAGCAGTGGCTGAAACAGTTGTTGATTGAGTCTCTTTGGTCATTCGCCTCCCTGAGAGACGGGATTTACGTGCATCCAGTGCATCACGCATGACGGTGATCGCATCGGTGCTGTTAACAAGTTCATCAGCCAGTCCGGCATCAATGGCCTCCTGACCGCTGTACACTGCAGCCTCGGTATCCAGCACAACCTGCACGGACAGGCCGGTATATGCCGACACCTTCTGCGCAAACATCTGGCGGGTTGCGTCCATCCGGGACTGCAGTGTCTCCCGGACGTCATCCGGAAGATGGCTGTAGGGGTTGCCATCCACCTTATGGCTGCCGCCTGTAAATCAGCGTGATTTCCACACCCTGTTTCTCCAGCGCAGCACCGTAATTACTGTGAGCCATCATGACGCCGATGGAGCCTGTCCGGGCGGTCTGCGTGACCAGACGCCGGGGAGGCGGCACTGGCAAGCAACTGACCTGCACTGCAGTTCATGTCGTTGGCAAGCGCCCATACCCGGTTTTATGTCACGCACACGGGCGATGATGTCAGCGCAGTCAAATGCCCCGCCACCATCCCGCCGGGCGTGTCCATATCGAGCAGAATGCCGTCCACCATCGGATCGCTGGCAGCCTGTTGCAGACGGGCGATAATGCCGTTGTAACCGGTCATCCCCGAGTACGGCTGCAGCGCCCGCGTCCGGCTGACCAGCGTGCCGGACACCGGCAAGCACGGCGATGCCGTTCATGACCTGATAACTGCGCGGCCTGTCGTGTCCGTCATCATCACCGGATAATGCCAGCGTCGCGAGTGCCTCCTGGGCAGTCAGGCTGTCGCCGGACACCGCATCCGTCAGGCTGCTGATCCCAAGCTGGCCTGCAAAGCACAAAGAAAACCCGCGCATAGGCGGGTTCAAGCATCAGCGGCTCATTAAAGGCCATGCTGGCAATATGCGGAGATTACGCAGCTCTGCTGTCACTCTTCTCCTCCTCTGTTGATTGTCGCAGCCCGGATTCAAATGCTGCAGCCGCCCAGGCGGGCGGTTTAAGACCGGCTGCACGGCGCTCCATCGTTTCACGGACCTGCTGGGCAAAATTTCCTGATAGTCGTCACCGCGTTTTGCGCACTCTTTCTCGTAGGTACTCAGTCCGGCTTCTATCAGCATCACCGCTTCCTGAACTTCTTTCAGACCATCGATGGCCATACGACCGGAGCCTATCCAGTCGCAGTTCCCCCAGGCACTGCGGGCTTCCTGAAAACTGAAGCGCGCTTTGAAGGTAACGTCACCACGCGGCGAACGATGGCCTCTTCCAGCCAGCACAGAAACATCTGGCTCGCCTGACGGGATGCGACGAATTTTCGCCGCCCCATAAAATGACGCCCACGACTCGTTCGCACTGGCCCGTGCCGTGGAGTAGCTCATCTGGGCGTAATTCCGGGAAAGCTGCTCATACGAGACACCCAGCCCGGCAGCGATATACCGCAGCAGTGACTGCTCAAACACGGAGTAGCCGTTATCCGTATCCTGAGCCGTCTGCAGGTTCAGTGAGAGTACCGGCATCAGGTGCGGTACTTTTGCGCCTCCAGCCGGACCGGCGCTGCTGCGGCGTAATACGCGGCAATTTCACCAATCCAGCCGGTCAGCCTTTCCCGCTGCTCCTGACTGTTCGCGCCCAGAATAAAATCCATCGCTGACTGCGTATCCAGCTCACTCTCAATGGTGGCGGCATACATCGCCTTCACAATGGCGCTCTGCAGCTGCGTGTTTCTGCAGCGTGTCGAGCATCTTCATCTGCTCCATCACGCTGTAAAAACATTTGCACCGCGAGTCTGCCCGTCCTCCACGGTTCAAAACGTGAATGAACGAGGAGGCGCCCGCCGGGTAACTCACGGGGTATCCATGTCCATTTCTGCGGCATCCAGCCAGGATACCCGTCCTCGCTGACGTAATATCCCCAGCGCCGCACCGCTGTCATTAATCTGCACACCGGCACGGCAGTTCCGGCTGTCGCCGGTATTGTTCGGGTTGCTGATGCGCTTCGGGCTGACCATCCGGAAGAACTGTGTTTAGAAAAGCCGCGACGAACTGGTATCCCAGGCCTGAACGAACAGTTCACCGTTAAAGGCGTGCATGGCCACACCTTCCCGAATCATCATGGTAAACGTGCGTTTTCGCTCAACGTCAATGCAGCAGCAGCAGTCATCCTCGGCAAACTCTTTCCATGCCGCTTCAACCTCGCGGGAAAGGCACGGGCTTCTTCCTCCCCGATGCCCAGATAGCGCCAGCTTGGGCGATGACTGAGCCGGAAAAGACCCGACGATATGATCCTGATGCAGCTGGATGGCGTTGGCGGCATAGCCGTTATTTGCGTACCAGATCGTCTGCGCGGCATTGCCACGGGTAAAGTTGGGCAACAGGGCTGCATCCACACTTTCACTCGGTGGGTTCCACGACCGCAACTGCCCTCCAAATCCGCTGCCACCGCCGCGTGATAACCGGCATATTCGCGGGGCAGCGATGTCATGCCGTCCGGCCCCAGAAGGGTGGGAATGGTGGGCGTTTTCATACATAAATCCTGCAGGTCTCTCCCTGCGTCGCTGTGTCATGCCGGTCTGCACTTCCAGCTCTGCAATATATTTTTCAGGTCAGACACGGAAGTGGCCGTAAACTCCACCCTTCGTCCGTCTTTCTGTACTGTTGCCACCCGTTTACCTGTCATCAGGTCATGCAGTGCCGCACGGGCAGCGGCAAGTTCTTCCTGTCGCGTCATTCATCCTCTCCGGATAAGGCACGGCGTAATCTGCCAGTGTTTTCTTGTTGGTTGCTGCACCATCCTCTTCCTGCAGGCTCGCCAGCAGCGCACTGAGATCCAGCTGCCAGCGGGAAATACTGATGCGCAGCGCCGCCAGCGCATAAACGAAGCAGTCGAGTGCCTCATTGCGTCGCTTTTGCTGTCCACAGTATTTTCCTGCCATCCACCCATTTTCGACCTGCTCTTCAGCAGTCAGCTGCTGCGCTTCGGGTCAGATCAAAATATCCGGGTTATTTCGGGAATGAACGGCACCGGGAAGCGGTTCATCCCCTTCCGGCGTCAGTGTGAAGCGGTTTATAAATCTGCTCTTCGCGGTATCCGTACCGATTTCGGTAAGGTAAACCCCGTTTTGTTTCGCTTACGTGGCATGCTGGCCACCGGCTTTCCGTAGACGGATGCCCCTTTAATGGGGATCACCCGGAACAGCCCATGTTTTCGAGCGTTCATACACAATGGTCGGGTCAATCCCGCCAGTATCCCAGCAGATACGGGATATCGACATTTCTGCACCATTCGGCGGGTATAGGTTTTATTGATGGCCTCATCCACGCAGCAGCGTCTGTTCATCGTCGTGGCGGCCCATAATAATCTGCCGGTCAATCAGCCAGCTTTCCTCACCCGGCCCCCATCCCCATACGCGCATTTCGTAGCGGTCCAGCTGGGAGTCGATACCGGCGGTCAGGTAAGCCACACGGTCAGGAACGGGCGCTGCGCTGAATAATGCTCTTTCCGCTCTGCCATCACTTCAGCATCCGGACGTTCGCCAATTTTCGCCTCCCACGTCTCACGAGCGTGGTGTTTACGAAGGTTTTACGTTTTCCCGTATCCCCTTCGTTTTCATCCAGTCTTTGACAATCTTAAGAGGTGGTGAACGGGCTGTACGCTGTCCAGATGTGAAAGGTCACACTGTCAGTGGCTCAAATCTTTCACCGGATGACGAAAACCAGAGAATGCCATCACGGGTCCAGATCCCGGTCTTTCGCAGAGATAACGGGCATCAGTAAGAGTCCAGCTCCTGCTGGCGGATGACGCAGGCATTATGCTCGCAGAGATAAAACACGCTGGAGGGATCATCAGCGTCCATTTGAGGCCAAACGGCGTCTCTTTGTCGCCAAATTTAAGATACTGCTCCTCCCCCGCAATGCGGGCAGGCAACATGAAAACGCATAAAATGCGGGGATTCACTGGCTGCACGCTCTCAATCTGACAGGTGCCTCTCACTTTGGCGTGGAGCCACGGATGGACTTTACAGACCGAGCCTTCAATACGCTTGTTACCCAGGAACGTCGGAGAGCCTTCCTGTTCAATATCATCATCAAAAGCAGCAAGTTCATCATAACCCGCCACATCCACCGACGACTTTCACGGTAGTTTTGCCGCTTTACCGCCCAGGCAGCACCAGAAGCCACGCCCATTAGTGAACGCTTCATGGTGAGCGTGTTATCCCGGTGCTTTTGCCATACCACGGGGCCAGCGCCAGCAGCGACGGAATATCACGAATAGTCGGCTCAACGTGGGTTTTCATAAAGTTCTCGGCATCACCATCCGTCGGCAACCAGATAAGGGTGTTGCGCTGCTTATGCTCTATAAAGTAGGCATAAACACCCAGCAGCATTTTGGAATAACCGACACGGGCAGACTTCACCACATTCACCTCACGGATGTAGTCGCTGCCATCGCATTCATGATGGCCCGCTGAAAGGGCAGTGTTTCCCAGCGCCCTTCCTGGTATGCGGATTCTTTCGGGAGATAGTAATTAGCATCCGCCCATTCAACGGCGGTCTGTGGCTCCGGCCTGAACAGGAGCGCGAAGCCCGGCGCGGACAAAATGCCGCAGCCTGTTAACCTGACTGTTCGATATATTCACTGAGCAACCCCGGTATCAGTTCATCCAGCGCGGCTGCTTTGTTCATGGCTTTGATGATATCCCGTTTCAGGAAATCAACATGTCGGTTTTCCAGTTCCGGAAAACGCCGCTGCACCGACAGGGGGAGCCGTCGAGAATACTGGCAATTTCACCTGCGATTGACGCGACAGCACGAAAGTACAGAATGCGGTTTCCACCACTTCAGCGGAGTCTGGCATTCTTCAGTTCCTGTGCGTCGGCCTGCGCGCACGCGTAAGTCGATGGCGTTCGTACTCAATAGTTCCTGGCTGGAGATCTGCCTCGCTGGCCTGCCGCAGTTCTTCAACCTCCCGGCGCAGCTTTTCGTTCTCAATTTCAGCATCCCTTCGGCATACCATTTTATGACGGCGGCAGAGTCATAAAGCACCTCATTACCCTGCCACCGCCTCGCAGAACGGGCATCCCTGTTCCTGCCAGTTCTGAATGGTACGGATACTCGCACCGAAAATGTCAGCCAGCTGCTTTTGTTGACTTCCATTGTTCATTCCACGGACAAAACAGAGAAAGGAACGACAGAGGCCAAAGCTCGCTTTCATAGACCCTGTCGTTTCCTTCTTTCAGAGGGTATTTTAAATAAAAACATTAAGTTATGACGAAGAAGAACGGAAACGCCTTAAACCGGAAAATTTTCA