view test-data/consensus_result2.fasta @ 0:51fd3136069d draft

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
author bgruening
date Mon, 11 Jun 2018 16:47:50 -0400
parents
children
line wrap: on
line source

>utg000001lr LN:i:46960 RC:i:200 XC:f:1.000000
ATGATTATCATCTACATATCACAACGTGCGTGGAGGCCATCAAACCACGTCAAATAATCAATTATGACGCAGGTATCGTATTAATTGATCTGCATCAACTTAACGTAAAAACAACTTCAGACAATACAAATCAGCGACACTGAATACGGGGCAACCTCATGTCAACGAAGAACAGAACCCGCAGAACAACAACCCGCAACATCCGCTTTTCTAACCAAATGATTGAACAAATTAACATCGCTCTTGAGCAAAGGGGTCGGGAATTTCTCAGCCTGGGTCATTGAAGCCTGCCGTCGGAGACTAACGTCAGAAAGAGAGCATATACATCAATTAAAGTGATGAAGAATGAACATCCCGCGTTCTTCCCTCCGAACAGGACGATATTGTAAATTCACTTAATTACGAGGGCATTGCAGTAATTGAGTTGCAGTTTTACCACTTTCCTGACAGTGACAGACTGCGTGTTGGCTCTGTCACAGACTAAATAGTTTGAATGATTAGCAGTTATGGTGATCAGTCAACCACCAGGGAATAATCCTTCATATTATTATCGTGCTTCACCAACGCTGCCTCAATTGCTCTGAATGCTTCCAGAGACACCTTATGTTCTATACATGCAATTACAACATCAGGGTAACTCATAGAAATGGTGCTATTAAGCATATTTTTACACGAATCAGATCCACGGAGGGATCATCAGCAGATTGTTCTTTATTCATTTTGTCGCTCCATGCGCTTGCTCTTCATCTAGCGGTTAAAATATTACTTCAAATCTTTCTGTATGAAGATTTGAGCACGTTGGCCTTACATACATCTGTCGGTTGTATTTCCCTCCAGAATGCCAGCAGGACCGCACTTTGTTACGCAACCAATACTATTAAGTGAAAACATTCCTAATATTTGACATAAATCATCAACAAAACACAAGGAGGTCAGACCAGATTGAAACGATAAAACGATAATGCAAACTACGCGCCCTCGTATCACATGGAAGGTTTTACCAATGGCTCAGGTTGCCATTTTAAAGAAATATTCGATCAAGTGCGAAAAGATTTAGACTGTGAATTGTTTTATTCTGAACTAAAACGTCACAACGTCTCACATTATATTTACTATCTAGCCACAGATAATATTCACATCGTGTTAGAAAACGATAACACCGTGTTAATAAAAAGGACTTAAAAAGGTTGTAAATGTTAAATTCTCAAGAAACACGCATCTTATAGAAACGTCCTATGATAGGTTGAAATCAAGAGAAATCACATTTCAGCAATACAGGGAAAATCTTGCTAAAGCAGGAGTTTTCCGATGGGGTTACAAATATCCATGAACATAAAGATATTACTATACCTTTGATAATTCATTACTATTTACTGAGAGCATTCAGAACACTACACAAATCTTTCCACGCTAAATCATAACGTCCGGTTTCTTCCGTGTCAGCACCGGGGCGTTGGCATAATGCAATATACGTGTACGCGCTAAACCCTGTGTGCATCGTTTTAATTATTCCCGGACACTCCCGCAGAGAAGTTCCCCGTCAGGGCTGTGGACATAGTTAATCCGGGAATACAATGACGATTCATCGCACCTGACATACATTAATAAATATTAACAATATGAAATTTCAACTCATTGTTTAGGGTTTGTTTAATTTTCTACACATACGATTCTGCGAACTTCAAAGCATCGGGAATAACACCATGAAAAATGCCTACTCGCTACTGCGCTGGCCCTGCTTATTACAGGATGTGCTCAACAGACGTTTACTGTTCAAACAAAACCGGCAGCAGTAGCACCAAAGGAAACCATCACCCATCATTTCTTCGTTTCTGGAATTGGGCAGAAGAAAACTGTCGATGCAGCCAAATTTGTGGCGGCGCAGAAAATGTTGTTAAAACAGAAACCCAGCAAACATTCGTAAATGGATTGCTCGGTTTTATTACTTTAGGCATTTATACTCCGCTGGAAGCGCGTGTATTGCTCACAATAATTGCATGAGTTGCCCATCGATATGGGCAACTCTATCTGCACTGCTCATTAATATACTTCTGGGTTCCTTCCAGTTGTTTTGCATAGTGATCAGCCTCTCTCTGAGGGTGAAATAATCCCGTTCAGCTCTGTCTGCCAGTCGGGGGAGGCTGCATTATCCACGCCGGAGGCGGTGCTTGGCTTCACGCACTGACTGAGACTGCTTTGATGTGCAACCGACGACGACGACCAGCGGCAACATCATCACGCAGAGCAGAGCATTTTCAGCTTTAGCATCAGCTAACTCCTTCGTGTATTTTGCATCGAGAGCAGCAGCAACATCACGCTGACGCATCTGCATGTCAGTAATTGCCGCGTTCGCCAGCTTCAGTTCTCTGGCATTTTGTCGCGCTGGGCTTTGTAGGTAATGGCGTTATCACGGTAATGATTAACAGCCCATGACAGGCAGACGATGATGCAGATAACCAGAGCGGAGATCGCGGTCGCGGTGACTCTGCTCATACATCAATCTCTCTGACCGTTCCGCCCGCTTCTTTGAATTTGCAATCAGGCTGTCAGCCTTATGCTCGAACTGACCAGACCAGCGCCCGGCAGTGAAGCCCAGATATTGCTGCAACGGTCGATTGCCTGACGGATATCACCACGATCAATCATAGGTAAAGCGCCACGCTCCTTAATCTGCTGCAATGCCACAGCGTCCTGACTTTCGGAGAGAAGTCTTTCAGGCCAAGCTGCTTGCGGTAGGCATCCCACCAACGGGAAAGAAGCTGGTAGCGTCCGGCGCCTGTTGATTTGAGTTTTGGGTTTAGCGTGACAAGTTTGCGAGGGATGATCGGAGTAATCAGTAAATAGCTCTCCGCCTACAATGACGTCATAACCATGATTTCTGGTTTTCTGACGTTATCAGTTCCCTCCGACCACGCCAGCATATCGAGGAACGCCTTACGTTGATTATTGATTTCTACCATCTTCTACTCCGGCTTTTTTAGCAGCGAAGCGTTTGATAAGCGAACCAATCGAGTCAGTACCGATGTAGCCGATAAACACGCTCGTTATAAGCGAGATTGCTACTTAGTCCGGCGAAGTCGAGAAGGTCACGAATGAACTAGGCGATAATGGCGCACATCGTTGCGTCGATTACTGTTTTGTAAACGCACCGCCATTATATCTGCCGCGAAGGTACGCCATTGCAAACGCAAGGATTGCCCCGATGCCTTGTTCCTTTGCCGCGAGAATGGCGGCCAACAGGTCATGTTTTCTGGCATCTTCATGTCTTACCCCCAATAAGGGGATTTGCTCTATTTAATTAGGAATAAGGTCGATTACTGATAGAACAAATCCAGGCTACTGTGTTTAGTAATCAGATTTGTTCGTGACCGATATGCACGGGCAAAACGGCAGGAGGAGTGTTAGCGCGACCTCCTGCCACGCGGATTTCACGAAGGTCATGTGTAAAAGGCCGCAGCGTAACTATTACTAATGAATTCAGGACAGACAGTGGCTACGGCTCAGTTTGGGTTGTGCTGTTGCTGGGCGGCGATGACGCCTGTACGCATTTGGTGATCCGGTTCTGCTTCCGGTATTCGCTTAATTCATTCAGCACAACGGAAAGAGCACGACCTGGCTAACCAGGCTCGCCGACTCTTCACGATTATCGACTCAATGCTCTTACCTGTTGTGCAGATATAAAAATCCCGAAACCGTTATGCAGGCTCTAACTATTACCTGCGAACTGTTTCGGGATTGCATTTTGCAGACCTCTGCCTGCGATGGTTGGAGTTCCAGACGATACGTCGAAGTACCAACTAGGCGGAATCGGTAGTAAGCGCCGCCTCTTTCATCTCACTACACAACGAGCGAATTAACCCATCGTTGAGTCAAATTTACCCAATTTTATTCAATAAGTCAATATCATGCCGTTAATATGTTGCCATCCGTGGCAATCATGCTGCTAACGTGTGACCGCATTCAAAATGTTGTCTGCGATTGACTCTTCTTTGTGGCATTGCACCAGAGCGTCATACAGCGGCTTAACAGTGCGTGACCAGGTGGGTTGGGTAAGGTTTGGGATTAGCATCGTCACAGCGCGATATGCTGCGCTTGCTGGCATCCTTGAATAGCCGACGCCTTTGCATCTTCCGCACTCTTTCTCGACAACTCTCCCCCACAGCTCTGTTTGGCAATATCAACCGCACGGCCTGTACCATGGCAATCTCTGCATCTTGCCCCGGCGTCGCGCGGCACTACGGCAATAATCCGCATAAGCGAATGTTGCGAGCACTTGCAGTACCTTTGCCTTAGTATTTCCTTCAAGCTTTGCACACCACGGTATTTCCCCGATACCTTGTGTGCAAATTGCATCAGATAGTTGATAGCCTTTTGTTTGTCGTTCTGGCTGAGTTCGTGCTTACCGCAGAATGCAGCCATACCGAATCCGGCTTGTGATTGCGCCATCCCCATAGCAGCCATCACATCAGTACCGGAAAGAGTCAGAAGCCGTGGCCCGTGGTGAGTCGCTCATCATCGGGCTTTTGGCGAATGAAATTTAGCTACGCTTTCGAGTCTCATGCGCCTTCTCCCTGTACCTGAATCAATGTTAGGTTTCCGCAGAACACTGCGCCGGTATCGATATACATTTGGTTGGCAAACTTGAGTGGTTTCACTGCTGGCGTATGACCAAAGATGAACGTGTCCGCGCCTTTGATTTCTTTCACGATCCCGTTTGTGAGTTGCTGATTCGTTCGCGGTTCCAGATTACCTGCTGATGATGAACTGGCTTTCCAAACTCGTATTCGTCAAAGGGATAATCGGCGTGGCAGATAACATATTTTATCTTTGCTCACCAGTTCGATGATTAACGGAAGTTCATCTGCTTTATGGGCAAGAGCTTTAGCCAGAATTTCTTTGTCGTAATCGAGATTAAAGAACCAGCCACCGCCATTAAGCAGCCAGTGATTAACGTTTCCACGCTCTGATAAGCCATCAATCATCATTTGCTCATGGTTTCCACGTACAGCTCTGAACCAGGGGAATGTGATTAATTCCAGGCATTCAACGTTCTCTGCACCACGATCAACCAAATCGCCCACCGAGATAAGCAGGTCTTTTGTTGTCGAATCCAATCGTATCCAGTTTGTTCATCAGGTTCGTGTAGCATCCGTGCAGATCGCCAACTACCAAATATTTCGGTATTTGCTGCCATCAATTTTTCGTAATAGCGCATCTCTTTCACTCCATCCGCGATGAACCATGAGAACGTCGTTGACGATGGCGTGCATTTTCCCGTCTTTATCATCAACGTATTTTCTGACGTACCGCGACCCATTTCAGTCTGCGTGCTACTTCTGTCTGATTTCCGTATGTTTCAACGAGCATGTCTGGAATGGTTTTACTGAGAACGTCATGCGGCCTCACTTCTGCTATTTCGCAGGTCTTTGAGTTTCTGTTGGTACTCTGCCTTGATCGCCTTGCACTCTTCGATAGTCCAGCGATGGCGGTTATGGTTTGATTCGATTTCGTCTACTGCTTCCTGCCCGATGCGGCTAATCAGTTCGACGCGATACGGAACGAGATTTCCGCTTTGTGCTGGTTGCACACACGCATTGCTTGTGAATATTGCGTTCATTAAATCGGAGTTGAGGTGCCGCAGCAGTTGTCCGGTAATGTCCGGCATCCCACTGAGCAGACGTGAGCGTTCCGCACGAGATACATGGTAAGTCGCGGTCTCTTTCTGATGAAGGCGTTTACGGCTTGTTGGGCTTGTTTAATCCAGTAACTGCGGGGCTTTAAGGCGAGTTTTCGAATCTTAAGTTTATCTTTCTGTTTCTGCTCCTCGTCGTCGTTTCTTCTCTGCTGCTTTTCCCTTTTCGCGTTCTTTACTTCGTCGTTCGAGTGCTATCTTGGTTCCACTCTGGAGAGCACCACCACTGATTAGCGAATGCAGGGTGAAACCATTCCCGGCATTCATCGTTTTACATCGTCTTCGCGCTGGTTTAGCCATCATCTTCTTCCTCGTGCATCGAGCTATTCGGATCGCTCATCAGTTCTGCGCAGCAGTGCTCACACACGTGAACTTCCAGCACATGCAGCTTCTGACCGCAGTTAGCGCACGTTAAAGCTCGCTCGACGCTTTCTTGTTCGTAACTTCGATTTTGGTCAATCACCTTGTTTTCCTCGCACGACGTCTTAGCCACCGGATATCCCACAGGTGAGCCGTGTAGTTGAAGGTTTTACGTCAGATTCTTTTGGGATTGGCTTGGGTTTATTTCTGGTGCGTTTCGTTGGAAGGTATTTGCAGTTTTCGCAGATTATGTCGGTGATACTTCGTCGCTGTCTCGCCACACGTCCTCCTTTCCTGCGGTAGTGGTAACACCCCTGTTGGTGTTCTTTCACACCGGAGACACCATCGATTCCAGTAAGGTTTGATTTGGTCGGAAGCGGTTATCTTCTTTGCATTCACCGCACCGATAACATCGCATCATGCAGCTTCCCTCCCGAAGTCGAAATCAAGCTGCCCTCCAAATATTTCGCATGACTCAGAACAAGAGCCGGTATCGAATCTTTTAGCTCGTACCATGTCCTGATACAGGGCTTGATAATCATTTTCTGAATACATTTTCGCGATACCGTCCAGCGACATTCTTCCTCGGTACATAATCTCCTTTGGCGTTTCCCGATGTCCGTCACGCACATGGGATCCCGTGATGACCTCATTAAAACACGCTGCAATCCCTCCTCATCTTTGCAGGCAAGTCCGATTTTGCGTTGATTTTTAATGCAGAATATGCAGTTACCGAGATGTTCCGGTATTTGCAAATCGAATGGTTGTTGCTTCCACCATGCGAGGAGTATCTTCCTTCTCAAAGTCTGACAGTTCAGCAAGATATCTGATTCCAGGCGTTTTGGCTTTAGCCGCTTCGGTTCATCAGCTCTGATGCCAATCCACGTGGTGTAATTCCCTCGCCCGAAATGGTCATCACAGTATTTGGTGAAGGGAACGAGTTTTAATCTGTCAGTGCAGAACGCGCCGCCGACGTATGGAGTGCCATATTTCTTTACCATATCGATAAATGGCTTCAGAACAGGCATTCGCGTCTGAATATCCTTTGGTTCCCATACCGTATAACCATTTGGCTGTCCAAGCTCCGGGTTGATATCAACCTGCAATACGGTGAGCGGTATATCTCAGAACTTCACAACTTCCCTGACAAACCGATATGTCATTGGATGTTCACAACCTGTATCCATGAAAACGTAATGCACGTCTTTACCTGCCCGTCGCTTTGCTCCATTAGCCAGAGCAAATATGCTGACGTCCTGCCACCGGAGAAACTAACGACATTTATCATGCAGCCCTGTCTCCCCATCTCGCTTTCCACTCCAGAGCCAGTCTCGCTTCGTCTGACCACTTAACGCCACGCTCTGTACCGAATGCCTGTATAAGCTCTAATAGCTCCGCAAATTCGCCTACACGCATCCTGCTGGTTGACTGGCCTTATTACAAAGCCATTCCCGGCAAGGTTAGGAACAACATCCTGCTGCTTTAATGCTGCGGTAAACACACTTCCAGCTTTCTGCATCCAGCCAGCGACCATGCCATTCAACCTGACGGAGACGTCACCTAAGCAGGCCCATAGCTTCCTGTTTTGGTCTAAGCTGCGGTTGCGTTCCTGAATGGTTACTACGATTGGTTTGGTTGGGTCTGGAAGGATTTGCTGTACTGCGTGAATAGCGTTTTGCTGATGTGCTGGAGATCGAATTTCAAAGGTTAGTTTTTCATGACTTCCCTCTCCCCCAAATAAAGGCCTGCGATTACCAGCAGGCTTGTTATTAGCTCAGTAATGTAGATGGTCATCTTTTAACTCCATATACCGCCAATACCCGTTTCATCGCGGCACTCTGGCGACATCTCCTTAAAACCAGGTTCGTGCTCATCTTTCCTTCCCGTTCTTCCCTCAGCAAACCGGTAATACACCGTTCAGACCTTCCTTCGATAACCAGAAGACCTGCCCGTGCCATTTTAGCCGCGGCCTGATTTATGCTGGTTACTGTTGCGCCTGTTAGCGGCAACGTCCGGCGCACAGAAGCTATTATGCGTCCCCAGGTAATGAATAATTGCCTCTTTGCCCGTCATACATTGCTCCTTTCAGTCCGAACTTAGCTTTGATTTCTGCGATCTTCGCCAGAGCCTGTGCACGATTTAGAGGTCTACCGCCCATGACAGGAAGTTGTTTTACTGGTTCAGGGATCGCCTCACCACGGTTAATTCTCGCAGTCATATGGACAAGCTCATCTGCGGCCTTAAGCGTAATTCGCATCAGTAACCGCATTGGCCCGCATGTTCTGACCAGGTGTGGTAACCAGCCAGTAGTGCGCGTTTGATTTCCACGGATAAGACTCCGCATCCGGATACAGGCCTCGCTTCCGGCAATACTCGTAAACCATATCAACCAGCTCGCTGACGTTTGGCAGTCCGGCGGTAACGGATGCTTCTTCCCGGCACCATGCAACAAACTGCCGGGGTGATGGCAGAAATAGTCGATTCTCGAATGATGCTCGACGGGCTACGCGCATTCCTGCGTTAACCTGTTCCATCGTGGTGATCCCGTTTCCCCGAAAAGCCAGAACCCACTGGCGACGGATTTCGGTTCACTTCGTTCTGGTCACGGTTAGCCAGGCTCGCCGGGAAAGTTGCCAGTAACTGGCTGAACACACCGTTGATGATCTGCGCTACCTGCTGTACCTGCGGCTTTCGTCGTACTGTTCCGGCATGTTGTTGGCGATCCGACGCATCTGCTCACGTCAAAGTTAACCATCTGTGCGGCGATGTTTCATAGTATCCACCCCGTAAATCCAGTCTGTGTTTGTCAGGTCGAGTTTTGGTTTGCTGGCTGTCACGCCTGCCTGTTGCTTGTTACGGTTGATTTCGAGTTGGGTCCACTTATCGCGGAGTTTGGCCGGGCCAGCACGTTACCCGACCAGAAGTTGTTCCTGGCATGCCCAGCGGAACAGCACACATGTCGCGGTGGTTACGTCCGTCACGTTCACGCATCAGGCGGATATCGTTAGCCCACCCAGCAAAATTCGGTTTTCTGGCTGATGGTGCTGCGATAGTCTTCACCATGTCAAACATCCACTCTGCGGCGGTCAGGTCTTCTGTTCCCCACTTGCTGCCGCTCTGAATTGCAGCATCCGTTTTGCCACAGAAAGGTCGTTTTCTGGCTGGTCAGGATTCGCCAGAATTCTGACGTGGAATAATCTTTCTTTTCTTTGTATAGTGTCTTTTGTGTCCCTGTTTGAGGGATAGCAATCCCCAATTTGAGGGATGTTTTATCCCTCGTTTAGGGATTTTCCTCGTTTGAGGGATGCACCATTCTGAGATGTTTTATTTGGTACAAACATGCCGCCTTGCTGCTTGATAATATTCATTCTGACGAGTTCTAACTTGGCTTCATTGCACCGTTTGACAGGTAACTTTGTAATCTCGCTAAGTTGAGAATCGGTGATTCTGTCCATTGGTTTATTCCACCCATAGGTTTTACGCAGAATGGCAAGCAGCAGCACTTTAAACTGTCTGCTTGGTCAGATCTGCCCGAATAAGCCTCAAGCAGCAGCATATTTGATAGTCTGGCGTAACCATCATCGAGATCTGCCACATTACGCTCCTGTCCGGCAAATTACCTCTGCCGAAGTTGAGTATTTTGCTGTATTTGTCATAATGACTCCTGTTGATAGATGAGGGTAATAACCTCAGAACTCCATCTGGATTTGTTCAGAACGCTCGGTTGCCGCCGGGCGTTTTATTGGTGAGAATCGCAGCAACTTGTCGCGCCAATCGAGCCATGTCGTCGTCAACGACCCCCATTCAAGAACAGCAAGCAGCATTGAGAACTTTGGAATCCAGTCCCTCTTCCACCTGCTGATCTGCGACTTATCAACGCCCACAGCTTCCCTGTCTTCTCAGTTCCAAGCATTGCGATTTGTTAAGCAACGCACTCGATTCGTAGAGCCTCGTTGCGTTTGTTTGCACGAACCATATGTAAGTATTTCCTTAGATAACAATTGATTGAATGTATGCAAATAAATGCATACCATAGTGTGGTTTAATTTGATGCCCTTTTCAGGGCTGGAATGTGTAGAGCGGGGTTATTTATGCTGTTTTTTGTTACTCGGGAAGGCTTTACTCTTCCGCATAAACGCTTCCATCAGCGTTTATAGTTAAAATCTTTCGGCCTGCATGAATGGCCTTGTTGATCGCGCTTTGATACGCCGAGATCTTTAGCTGTCTTGGTTTGCCCCAAAGCGCATTGCATAATCTTTCAGGGTATGCGTTGTTCCATACAACCTCCTTAGTACATGCAACCATACATGCCATAGTAAAATAGTCAACACGCACGGTGTTAGATATTTATCCCTTGCGGCAGGAGTTAACGTATGAGCACAAAAGAAACCATTAACAAGAGAGCAGCTTGAGGACGCACGTCGCCTTAAAGCAATTTATGAAAGAAAATGAACTTGGCTTATCCCAGGAATCTGTCGCAGACAAGATGGGGATGGGGCAGTCAGGCGTTGGTGCTTTATTTAATGGCATCAATGCATTAAATGCTGTAACGCCGCATTGCTTACAAATTCTCAAAGTTAGCGTTGAAGAATTTAGCCCTTCAATCGCCAGAGAAATCTACGAGATGTATGAAGCGGTTAGTATGCAGCCGTCACTTAGAAGTGAGTATGAGTACCCTGTTTTTCTCATGTTCAGCAGGATGTTCTCACTAAGCTTAGAACCTTTACCAAAGGTGATGCGGAGATGGGTAAGCACACAACAAAGCCAGTGATTCTGCATTCTGGCTTGAGGTTGAAGGTAATTCCATGACCGCACCAACAGGCTCCAAGCCAAGCTTTCCTGACGGAATGTTAATTCTCGTTGACCCTGAGCAGGGCTGTTGAGCCAGGTGATTTCTGCATAGCCAGACTTGGGGGTGATGGAGATTTACCTTCAAGAAACTGATCAGGATAGCGGTCAGGTGTTTTACAACCACTAAACCCACAGTACCCAATGATCCCATGCAATGAGAGTGTTCCGTTGTGCTGGGAAAGTCTCTAGTCAGTGGCCTGAAGAGACGTTTGGCTGATCGGCAAGGTGTTCTGGTCTGGCGCATAGCTGATAACAATTGAGCAAGAATCTTCATCGAATTAGGGAATTTTCACTCTCCCTCAGAACATAACATAGTAAATGGATTGAATTATGAAGAATGGTTTTTATGCGACTTACCGCAGCAAAATAAAGGAAAGATAAGGCTCAATAAACCTGTCTGTTTTCCTTAATTCTCTTGGCTGATCATCACCTGCATGAGTTTGCTCCAATTATTTGTATTCATAAAATCGATGGAAAAACTTTTCTCTTTACCAAACAAATGACAAGAGTCTGGTTCAGAAGATAAATCGCTCTAAAGCTTCAGTTGAAGATAGCAGAACAGCCTCGCAGATGACGAATCATTGGGATTCCCATCTTTTTGTTGAAAGGCGACACCATTGGTTTTGCCAGAACTGTTCGGGCCGACCACATCCGATCTGACAGATTTTAATCGGGAAAGGAATGTCATTAAGCAGTGGAGAGCGCGTTCAGATAGAGCCACTGATGAGGGAATCACCAAAGACGATGTTATGCATATGCATTTCATCGGCCGAACAACGGTGAAGGTAGAAGCCAAGCTACCTGTATTTGGCGATATATTAAAGGTCTTAGGGCAACAGATATTGAAGGGGAGCTTTTGACTCATTGGATATAGTCATTAAGCCAAAATTTAAAGGGATATAAAAGGTTGCCAAGGATATTATTTTAACCCGTCACCTCAATTTTCAGACATTAGCCCTGCGGCAAAAGATGAGGCCGGAGATATTTTAACAGAACATTATCTATCAGAAAAGGCCATCTCTCAGCGCTCTGAACAGTACAATGCTGAGATAGCTGAAGAGATGAGCATAAGATGCTACGCAAGAATGAAAGTGATATACTGGAATGCTTTTAAAGGCAGGTGGGCAAAAGTAAGGATTAATTATCAGGAGTAATTATGCGGAACAGAATCATGCCTGGTGTTTACATAGTAATAATTCCTTACGTTATCGTAAGCATTTGCTATCTCCTTTCCCACTACATTCCTGGTGTTTCTTTTCAGCTCATAGAGATGGTCTTGGGGCGACATTGTCATCATATGCAGGAACCATGATTGCAATCCTGATTGCTGCCTTGACGTTTCTAATCGGAAGCAGAACGCGCCGACTGGCCAAGATTAGAGTATGGGTATATGACATCGGTAGTTATTGTCTATGCCCTTAGTTTTGTTGAGCTTGGAGCTTTGTTTTTCTGCGGGTTATTGCTTCTTTCCAGCATAAGCGGCTACATGATACCCACATCTCCATCGGCATTGCCTCTGCATCGTTCATTCATATGCATCCTTGTTTTCCGACTATAATTTGACAGAGAAAATAAAAGCCTCACCGGCCTCATTCGCCGTATTTCCTTGCCTCACGATCGCCCCCAAAACACATAACCAATTGTATTTATTGAAAATAAATAGATACAACTCACTAAACATAGCAATTCAGATCTCTCACCTACCAAACAATGCCCCCTTGCAAAAATAAATTCATAAACATACAGATAACCATCTTGCGGTGATAAATTATCTCTGGCGGTGTTGACATAAATACCACTGGCGGTGATACTGAGCACATCAGCAGCAGGACGGACTGACCACCATGAAGGTGACGCTCTTAAAATTAAGCCCTGAAGAAGGGCAGCATTCAAAGCAGAAGGCTTTGGGTGTGTGATACGAAACGAAGCATTGGCCGTAATGTGCGATTCCGGATTAGCTGCCAATGTGCATGTAGCTGGAAGCGGGGTTTTCGTTCAGGACTACAACTGCCACACACCCAAAGCGACTGACAGGAGAATCCAGATGGATGCACACAAACACGCCGCCGCGAACGTCGCGCAGAGAAACAGGCTCAATGGAAAGCAGCAAATCCCTGTTGGTTGGGGTAAGCGCAAAACCAGTTAACCGCCTATTCTCGCTGCTGAATCGCAAACCGAAATCACGAGTAGAAAGCGCACTAAATCCGATAGACCTTACAGTGCTGGCTGAATACCACAAACAGATTGAAAGCAACCTGCAACGTATTGAGCGCAAGAATCAGCGCACATGGTACAGCAAGCCTGGCGAACGCGGCATAACATGCAGTGGACGCCAGAAAATTAAGGAAAATCGATTCCTCTTATCTAGTTACTTAGATATTGGCCTTGGCTTTATCTCAATATTATGGATCATAGCTGGCAACTAATTCAGTCCAGTAAATATCCTCAATAGGGAATAATATGCTTTCCATTCCATCGGGAAAAGTTTGTTCAACACACCAAGCTCAATCAACTCACTAATGTATGGGAATTGTTTTGATGTAACCACATACTTCCTGCCTTCATTAAGGGCTGCGCACAAACCATAGATTGCTCTTCTGTAAGGTTTTGAATTACTGATCGCATTTATCGTTTTGCATCTTAATGCGTTTTCTTAGCTTAAATCCCCTTATATCTGGCGCTGGCAATAGCTGATAATCGATGCACATTAATTGCTAGCGAAAATGCAAGAGCAAAGACGACGAACATGCCACATGAGGAATACCGATTCTCATTAACATATTCAGGCCAGTTATCTGGGCTTAAAGCAGAAGTCCACACCAGATAACGATCATATACATGGTTCTCTCCAGAGGTTCATTACTGAACACTCGTCCGAGAATAACGAGTGGATCCATTTCTATACTCATCAAACTGTAGGGGTTGTAATAGTTTATCCGATTTCTCGCTGTAGGGTAACACGAGAACCACGAGAAGCCTGATGTGGTTAAAAGACAGGCACAATCTTTACTACCGCAATCCACTATTTAAGGTGATATATGGAAGAAGAATTTGAAGAGTTCGAAGAGCATCCTCAGGATGTGATGGAACAATACCAGGACTATCCGTATGACTACGACTATTGATAAAATCAATGGTGTGGACAATTCAAGCGATGCAATGGATGCAAGCTGCAATCGGAATGCATGGTTAAGCCTGAAGAAATGTTTCCTGTAATGGAAGATGGGAAATATGTCGATAAATGGGCAATACGAACGACGGCAATGATTGCCAGAGAACTTGGTAAACAGAACAACAAAGCTGCCTGATAGTGGCCTTTATTTTGGCATAAATAACAGAATAAACACTGCACTGTGTATTCATTCCAACGAGTGAATACACGGAGCAATGTCGCTCGTAACTAAACAGGAGCCGACTTGTTCTGATTATTGGAAATCTTCTTTGCCCTCCAGTGTGAGGCGATTTTATCTGTGAGGATATGAACAGATGTCAAACATCAAAATACATCATTGATTACGACTGGAAAGCATCAATAGAAATTGAAATCGACCATGACGTAATGACAGAGGAAAAACTTCACCAGATTAATAATTTCTGGTCAGACTCTGAATACCGACTCAATAAACACGGCTCTGTATTAAATGCTGTATTAATCATGCTGGCGCAACATGCTCTGCTTATAGCAATTTCAAGCGACTTAAATGCATATGGTGTTGTGTGTGGATTCGACTGGAATGATGGAAATGGTCAGGAAGGATGGCCTCCAATGGATGTAGCGAAGGAATAAGAATTACCGATATCGATACATCAGGAATATTTGATTCAGATGATATGACTATCAAGGCCGCCTGAGTGCGGTTTTACCGCATACCAATAACGCTTCACTCGAGGCGTTTTTCGTTATGTATAAATAAGGAGAGCACCATGCAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGCCCTTCCGAATCTTTACTTGAACGAATCACCCGTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAGTCCCAAAGAATGGATCAAACACTTATGGCTATCCAGACTAAATTCACTATCGCCACTTTTATTGGCGATGAAAGATGTTTCGTGAAGCCGTCGACGCTTATAAAATGGATATTAATACTGAAACTGAGATAAGCAAAGCATTCACTAACCCCCTTTCCTGTTTTCCTAATCAGCCCGGCATTTCGCGGGCGATATTTCACAGCTATTTCAGGAGTTCAGCCATGAACGCTTATTACATTCAGGATCGTCTTGAGGCTCAGAGCTGGGCGCGTCTACCAGCAGCTCGCAGCTCCCGTGAAGAGAAAGAGGCAGAACTGGCAGACGACATGAAAAGGCCTGCCCAGCACCTGTTTGAATCGCATCGCTGCATCGATCATTTGCAACGCCACGGGGCCAGCAAAATCCATTACCCGTGCGTTTGATGACGATGTTGAGTTTCAGGAGCGCATGCAGAACACATCCGGTACTGGTTGAAACCATTGCTCACCACCAGGTTGATATTGATTCAGAGGTATAAACGAATGAGTACTGCACTCGCAACGCTGGCTGGGAAGCTGGCTGAACGTCGGCATGGATTCTGTCGACCCACAGGAACTGATCACCACTCTTCGCCAGACGGCATTTAAAGGTGATGCCAGCGATGCGCAGTTCATCGCATTACTGATCGTTGCCAACCAGTACGGCCTTAATCCGTGACGAAAGAAATTTACGCCTTTCCTGATAAGCAGAATGGCATCGTTCCGGTGGTGGGCGTTGATGGCTGGTCCCGCATCATCAATGAAAACCAGCAGTTTGATGGCATGGACTTTGAGCAGGACAATGAATCCTGTACATGCCGGATTTACCGCAAGGACCGTAATCATCCGATCTGCGTTACCGAATGGATGGATGAATGCCGCCGCGAACCATTCAAACTCGCGAAGGCAGAGAAATCACGGGGCCGTGGCAGTCGCATCCCAAACGGATGTTACGTCATAAAGCCATGATTCAGTGTGCCCGTCTGGCCTTCGGATTTGCTGGTATCTCTATGACAAGGATGAAGCCGAGCGCATTGTCGAAAATACTGCATACACTGCAGAACGTCAGCCGGAACGCGACATCACTCCGGTTAACGATGAAACCATGCAGGAGATTAACACTCTGCTGATCGCCCTGGATAAAACATGGGATGACGACTTATTGCCGCTCTGTTCCCAGATATTTCGCCGCGACATTCGTGCATCGTCAGAACTGACACAGGGCCGAAGCAGTAAAAGCTCTTGGATTCCTGAAACAGAAAGCCGCAGAGCAGAAGGGGCAGCATGACACCGGACATTATCCTGCAGCGTACCGGGATCGATGTGAGAGCTGTCGAACAGGGGATGATGCGTGGCACAAATTACGGCTCGGCGTCGTCACATCGCCCGCTTCAGAAGTTCACAACGTGATAGCAAAAACCCGCTCTCGGAAAGAAGTGGCCTGACATGAAAATGTCCTACTTCCACACGCTTGCTTGCTGAGGTTTTGCACCGGTGTGGCTCCGGAAGTTAACGCTAAAGCACTGGCTGGGGAAAACAGTACGAGAACGACGCCAGAACCCTGTTTGAATTCACTTCCGGCGTGAATGTTACTGAATCCCCGATCATCTATCGCGACGAAAGTATGCGTACCGCCTGCTCTCCCGATGGTTTATGCAGTGACGGCAACGGCCTTGAACTGAAATGCCCGTTTACCTCCCGGGATTTCATGAAGTTCCGGCTCGGTGGTTTCGAGGCCATAAAGTCAGCTTACATGGCCCAGGTGCAGTACAGCATGTGGGTGACGCGAAAATGCCTGGTACTTTGCCAACTATGACCCGCGTATGAAGCGTGAAGGCCTGCATTATGTCGTGATTGAGCGGGATGAAAGTACATACATGGAGTTTTGACGAGATCGTGCCGGAGTTCATCGAAAATGGACGAGGCACTGGCTGAAATTGGTTTTGTATTTGGGGAGCAATGGCGATGACGCATCCTCACGATAATATCGGGTAGGCGCAATCACTTTCGTCTACTCCGTTACAAAGCGAGGCTGGGTATTTCCCGGCCTTTCTGTTATCCGAAATCCACTGAAAGCACAGCGGCTGGCTGAGGAGATAAATAATAAACGAGGGGCTGTATGCACAAAGCATCTTCTGTTGAGTTAAGAACGAGTATCTCCAGATGGCACATAGCCTTGCTCAAATTGGAATCAGGTTTGTGCCAATACCAGTAGAGAACAGACGAAGAATTTCATACGTTAGCCGCATCCCTTTCACAAAAGCTGGAAATGATGGTGGCGAAAGCAGAAGCAGATGAGAAACCAGGTATGACAACCACGGAATGCATTTTCTGGCAGCGGGCTTCATATTCTGTGTGCTTATGCTTGCCGACATGGGACTTGTTCAATGACACCTCAGCAGGAAAGCCCCCTTCGCAGCATTGCCCGTCAGGCTAATTCTGAAATCAAAAAAGCCAGACAGCAGTTTCCGGATAAAAACGTCGATGACATTTGCCGTAGCGTACTGAAGAAGCACCGCGAAACGGTAACGCTGATGGGATTCACACCGACTCATTTAAGCCTGGCAATCGGCATGTTAAACGGCGTCTTTAAGGAACGATGAACATGAAAAGCAAATCATCAGGGAGCTACAGGCTCCTTTTATTATTCGCATTCACCTCAAGCGTATTAACCAACAGTTCAGGGATTAATGAAAGATGGCAGACATCATTGATTCAGCATCAGAAATAGAAGAATTACAGCGCAACACAGCAATAAAATTCCCGCCTGAACCACCAGGCTATATCTGCCACTCATTGTTGTCCTGTGTGGCGATCAGATAGATGAACGAAGACGCCTGGTCGTTCAGGGTTGTCGACTTGTGCAAGTTGCCAGGAGGATCTGGAACTTATCAGTAAACAGAGAGGTTCGAAGTGAGCGAAATTAACTCTCAGGCACTGCGTGAAGCGGCAGAGAGCAGGCAATGCATGACGACTGGGGATTTGACGCAGACCTTTCCATGAATTGGTAACACCATCGATTGTGCTGGAACTGCTGGATGAACGGGAAAGAAACCAGCAATACATCAAACGCCGCGACCAGGAGAACGAGGATATTGCGCGCTAACAGTAGGGAAACTGCGTGTTGAGCTTGAACAGCAAATCAAAAACTCAACGAGCAGCGTGAGTATTACGAAGGTGTTATCGGATGGGAGTAAGCGTATTGCTAACTGGAAAGCAACGAAGTCCGTGAAGACGGAAACCAGTTTCTTGTTGTTCGCCATCCTGGGAAGACTCCTGTTATCAAGCACTGCACTGGTACTGGAAGAGTTTCTGCGGCAGTTAATCGAACAAGACCCGTTAGTAACTATCGACATCATTACGCATCGCTATTACGGGGTTGGGGGTCAATGGGTTCAGGATGCAGACTGAGTATCTGCATATGATGTCTGACGCTGGCATTCGCATCAAAAGGAGAGTGAGATCGGTTTGTAAAGATAACGCTTGTGAAATGCTGAATTTCGCGTCGTCTTCACAGCGATGCCAGAGTCTGTAGTGTCAGATGATGACCGTACTCAAACATCGGGTTGAGTATTATCTTACTGTTTCTTTACATAAACATTGCTGATACCGTTTAGCTGAAACGACATACATTGCAAGGAGTTTATAAATGAGTATCAATGAGTTAGAGTCTGAGCAAAAAGATTGGGCGTTATCAATGTTGTGCAGATCCGCTTGTCTTGTCTCCATGCAGACATCACGAAGGTGTTTATGTAGATGAAGGTATAGATATAGAGTCGGCATACAAATATTCCATGAAGGTTTATAAGTCTAATGAAGACAAATCCCCATTCTGCAATGTGCGAGAAATGACTGATACCGTGCAAAATTATTATCACGAGTACGGTGGAAACGATACTTGCCTCTCTGTACAAAACATATATAGATGATTAAACCCAATATTACATAACAATCCTCGCACTCGCGGGGATTTATTTTATCTGAACTCGCTACGGCGGGTTTGTTTATGGAGATGATAAATGCACTTCCGAGTCACAGGAGAATGGAATGGAGAGCCATTCAACAGAGTTATCGAAGCGAGAACATCAACGACTGCTACGACCACTGGATGATATGGGCGCAGATAGCACATGCAGACGTAACCAATATTCGAATTGAAGAACTGAAAGAACACCAAGCCGCCTGATGGCTTTTCTTCTTGCGTAATTGCGGAGACTTTGCGATGTACTTGACACTTCAGGAGTGGAACGCACGCCAGCGACGTCCAAGAAGCCTTGAAACAGTTCGTCGATGGGTTCGGGAATGCAGGATATTCCCACCTCCGGTTAAGGATGGAAGAGAGTATCTGTTCCACGAATCAGCGGTAAAGGTTGACTTAAATCGACCAGTAACAGGTGGCCTTTGAAGAGGATCAGAAATGGGAAGAAGGCGAAGTCATGAGCGCCGGGATTTACCCCTAACCTTTATAAGAAACAATGGATATTACTGCTACAGGGACCCAAGGACGGGTAAAGAGTTTGGATTAGGCAGAGACAGGCGAATCGCAATCACTGAAGCTATACAGGCCAACATTGAGTTATTTTCAGGACACAACACAAGCCTCTGACAGCGAGAATCAACAGTGATAATTCCGTTACGTTACATTCATGGCTTGATCGCTACGAAAAATCCTGGCCAGCAGAGGAATCAAGCAGAAGACACTCATAAATTACATGAGCAAATTAAAGCAATAAGGAGGGGTCTGCCTGATGCTCCATTGAAGACATCACCACAAAGAAATTGCGGCAATGCTCAATGGATACATAGACGAGGGCAAGGCGGCGTCAGCCAAGTTAATCAGATCAACACTGAGCGATGCATTCCGAGAGGCAATAGCTGAAGGCCATAACAACAAACCATGTCGCTGCCACTCGCGCAGCAAATCAGAGGTAAGGAGATCAAGACTTACGGCTGACGAATACCTGAAAATTTATCAAGCAGCAGAATCATCACCATGTTGGCTCAGACTTGCAATGGAACTGGCTGTTGTTACCGGGCAACGAGTTGGTGATTTATGCGAAATGAAGTGGTCTGATATCGTAGATGGATATCTTTATGTCGAGCAGAAGCAAAACAGGCGTAAAATGCCATCCCAACAGCATTGCATATTGATGCTCTCGGAATATCAATGAAGGAAACACTTGATAAATGCAAAGAGATTCTTGGCGGAGAAACCATAATTGCATCTACTCGTCGCGAACCGCTTTCATCCGGCACAGTATCATAGGTCTTTATGCGCGCACGAAAAGCATCAGGTCTTTTCCTTCGAAGGGGATCCGCCTAGCTTTCACGAGTGCGCAGTTTGTCTGCAAGACTCTATGAGAAGCAGATAAGCGATAAGTTTGCTCAACATCTTCTCGGGCATAAGTCGGACACCATGGCATCACAGTATCGTGATGACAGAGGCAGGGAGTGGGACAAATTGAAATCAAATAATGATTTTATTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTTATAATGCCAACTTAGTATAAAAGCTGAACGAGAAACGTAAAATGATATAAATCAATATATTAAATTAGATTTTGCATAAAACAGACTACATAATACTGTAAAACACAACATATGCAGTCACTATGAATCAACTACTTAGATGGTATTAGTGACCTGTAACAGAGCATTAGCGCAAGGTGATTTTGTCTTCTTGCGCCTAATTTTGTCATCAAACCTGTCGCACTCCAGAGAAGCACACAAGCCTCGCAATCCAGTGCAAAGCTTTGTGTGCACCCACTACGACCTGCATAACCAGTAAGAAGATAGCAGTGATGTCAAACGACGCAGCTGACTTCTTTCTTCTTTCACGACTTCCCCACACCCAGCATGCATACCTTTCCTCATAACTGTAGTGAATGTCTGTTATGAGGAGCGGAAGTTAACACTTATGAAAATGGCTACGAAGTCCGTGGCTATCTATCGGCTTATTAGTACTTGAAACGCTTCTTCAGAAGCCTGAAGAGCTAATCGTTCGGCGATACTATATGCATTAATAGACTATATCGTTGGTATAAACAGTGCACCATGCAACATGAATAACAGTGGGTTATGTAAAAGGAAGCAGAAAGCTAAATATGGAAAACTACAATACGATGCCCCGTTAAGTTCAATACTACTAATTTAGATGGAAAACGTATGTAATAGAGAGTAACTTAAAGAGAGATCCTGTGTTGCCGCCAAATAAATTGCGGTTATTTTAATAAAATTAAGGGTTACTATATGTTGGAGTTTAGTGTTATTGAAAGAGGCGGGTATATTCCTGCAGTAGAAAAATAAGGCATTCCTACGAGCAGATGGTTGGAATGACTATTCCTTTGTTACAATGTTTTATCTTACTGTCTTTGATGAGCATGGTGAAAATGCGATATCGGAAATGTTAAAATTGGTTTTGTAGGTCAAAAGAAGAAGTAAGCACTTATTCATTAATAGATAAATTCAGTCAACTCCCTGAAATGTTTTTTCCTTAGGTGAAAGCATTGACTACTATGTTAATCTCAGCAAATTAAGCGATGGTTTAAACATAACCTTCTTAAAGCTATTCAGGATTTAGTAGTATGGCCAAATCGATTAGCCGACATTGAAAATGAAAGCGTCCTTAACACCTCATTACTTAGAGGGGTAACTCTTTCAGAAATTCATGGACAGTTCGCACGTGTTAAATGGTTTGCCAGAATTGTCAGATTTCCATTTTCATTTAATAGAAAAGTGCTCCCGGATTCAGTGATTTAACTAGCCCTTTTGAGGTGACGGTTAATTCTATGCCCAGCACGAACATTCATGCTTTATCGGGCGGAATGGGTGGTAAAACAACAAATTTGAATGGAATGATTGGTGCAATCACCAACCCAGAAAACAATGAATATTTTCTCTGAAAAATAATAGACTTATCGAGTCAAGAATCCCAAAGGGATATTTTTCGATCGCTTGTTTCAGTTTCGTTTAGTGCATTTGATCCTTTACTCCTCTCTAAAGAACAACCTGACCCAGCAAAGGTACACAATACTTTATATTGGACTCAAGAATGCTGCCAGCAATAGTTTAAAATACTAGGCGATCTCCGCTTAGAATTCATTTCAGCATTTATTGGTTGTATGAGTAGATAGAAAGACAACTCTGGCTTGAAGCTATCAAAAACTAAGTAGTGATGAAAACTTTTCAAATATGGAACTCATCAGCCTCATTTCTAAATATGAAGAGTTAAGACGTAATGAACCACAGATTCAAGTGGACGATGATAAATTCACTAAATTGTTTTATGACAATATCCAGAAATATCTGCTTCGAATGAGCTCTGGACATGCAATTGTTTTATTTACTATCACAAGATTAGTAGATGTCGTTGGCGAAAGTCATTAGTTTTATTCGATGAACCAGAGGTTCATCTGCATCCACCTTTGCTCTCTGCTTTTACGAACATTAAGCGACTTACTCGATGCACGCAATGGTGTAGCGCAATAATTGCACTCACTCATTCCCCAGTAGTACTGCAAGAGGTTCCAAATCCTGCATGTGGAAAGTCCTACGTCAAGAGAAGCAATAAATATTATCCGTCCGGATATTGAGACATTCGGTGAGAACTTAGGTGTTTAACTCGTGAGGTGTTTTACTTGAAGTGACAAATTCTGGATACCACCACTTATTATCGCAGTCCGTTGATTCAGAGCTTTCTTATGAAACCATTCTAAAATTATAATGGTCAGATAGGATTAGAAGGTCGAACCGTTTAAAGCGATGATAATGAACAGAGATGAAGGTAAAGTACAATGAAAAACTACCTCTTCCAGCGAGAACTTATAGCGAAATGCTTAATAAATGCTCGGAAGGTATGATGCAGATAAATGTTAGAAATAATTTCATTACTCACTTCCCCACTTTTGCAGAAAGAACAACAATATAGAATATTAAGCTCGACAGGTCAGTTATTTACCTACGACAGGACACCCCTCTTGAGCCTACAACCTTAGTTGGTAATTGACAAAGGTTAAATTAGAAAAGCTTTATGAAAATAATCTCCGAGATAAAACAACCCGCTAGAACATATTACGATGACATGCTTGTTTCATCAGGTGAAAATGTCATTTTGTGTGATATAGACAGACAAAATATAGATCATTTTCTTCCTATTGCACATTATCCTGAATTTTCGGTGATGCCTATTAATTTAGTTCCATCGTGCCGCGACTGCAATATGGGAGAGAAAGGTCAAGTTTTCGCAGTAGATGAGGTACACCAAGCGATTCATCCCTATCGACAAGGACATTTTTCGTGAGCAATGGGTATGCAAATTTCGTTTCCGGAACTCCGGGTGCTATCAGTTTTATGTTGAATGCCCGGCGAACTGGAGGCAGGAAGACAAACACAGAGCTCTTCATCATTTCAAGCTATTAAATATTGCTAACAGGTATCGTTTGGAGGCAGGGAAGCACTTGAGTGAAGTGATTACTCAAAGAAACTCTTTCGTAAAGTTATAAGGAAATATAGTTCAACCGCAACGTTTCAGCAGCTACAGTCAGAATTTATTGAAGCAAATCTGAAACCTATTATAGATTTGAATGACTTCCCCAATTATTGGGAAAGAGTTATGTATCAGTGCCTAGCAAACTCGGAAGATTTTCAGAGGGATCTAGAATATGATGAAAGATAGAAAATTACGACGCTTATCGGAAGTGAACGAATATTTTATGAGGAGGCTGTTTTACAAATCCGGTAGTAACTTGCTAACCAATTCCTAGGCAGGTCATTGGCAACAGTGGCATGCACCGAGAAGGACGTTTGTAATGTCCCTCTCCGGCACAGCAGTCCTAGGGACAGTGGCGTACAGTCATAGATGGTCGGTGGGAGGTGGTACAAATTCTCTCATGCAAAATATGTAAATCGGTAGCAACTGGAAATCATTCAACACCCGCACTATCGGAAGTTCACCAGCCAGCCGCAGCACGTTCCTGCATACGACGTGTCTGCGGCTCTACCATATCTCCTATGAGCAACGTGTTAGCAGAGCCAAGCCACAACTCTAATTTAATACATAATGAATGATAATAATAATATTAAAATTTCCTGTGTAACTAATTTACTATGGTTTCTGATAAGAATCATTGCAAAGATCAAACAACTTGTATTACATTGACAGTTAAGCAGTTAATTTATCCTCTAAATATATCAGCATCTAGCATGCAACCTATCAAAATGGAGAGTTTATGACTAAAACCATGGGAAAGAAGACTTAAAGATTTATCGCACTTGCTCAAATGCTGCATTGATACATATTTTGACCCTGAATTATTTCGCTTGAATTTGAATCAATTCCTCCAAACCGCAAGAACAGTAACATTTATTATTCAAAAACAAAACCAGATTATAGGATATGACATTTGGTAACAATAATGTTATTGAAAATGGAAAATGATCCATTAATGGCTTGGGGCTAAAATTCTCGCAATACGATAGAAAAACAAGGCGATTTAGAAATGTATAGCGAGGCAAAGGCTACTCTTATTTCATCTTACATTGAAGAAAATGACATTGAGTTTATTACAAATGAAAGTATGTTAAACATTGGTATAAAAGTTAGTCAGACTTGCACAAAGAGAAATTACCTTCATATTTAACTGAATCATCTATTATTAAATCAGAAAGACGATGGGTCGCTAATACGCTAAAAGATTACGAATTATTACATGCCTTAGCTATAATCTATGGCAGAATGTATAACTGCTGTAACTCTTGGCATACAAATAAACAATCCAATGGGTGACGATGTGATTTCGCCAACATCATTCGACTCTTTATTTGATGAAGCCAGGAGAATAACTTATTTAAAATTAAAAGATTACTCCATAAGCAAATTGTCCATTTAGCATGATACAATATATGACAATAAAATAATTCCTGAAGATATTAAAGAGCGTCTAAAACTGGTAGATAAGCCTAAAATATCACTTCGACAGAAGAGTTAGTTGACTATACAGCCAAGCTTGCAGAAACGACTTTTAAAGGACGGTTATCACATTCAAACATTAATTTTATGATAAACAATTCCATCCAATTGATTGATTTAATCAATACAACATTTGAAGATCAAGCAGATAAATATATTTTGGCGTTATGCAGCTGACAGAGCCAAAATAACAAATGCCTATGGCTTCATTTGGATATCAGAGCTATGGCTCAGAAAAGCAAGCATCTACTCCAATAAACCAATACATACAATGCCAATTATAGATGAAAGACTTCAGGTAATTGGAATTGATTCAAATAATAATCAAAATGTATTTCATGGAAAATAGTTAGAGAAAACGAAGAAAAACCGACTTTAGAAATATCAACAGCAGACTCAAAACATGACGAAAAACCATATTTCATGCGTTCAGTCTTAAAGCAATTGGCGGTGATGTAAACACTATGAACAATTGAGTCATAGAACTTCCATTATTCTCCTGAAGATAATAATCGCCAAATAAACCAATACTCAGCTTTACAATATACTAACTAACCGCAGAACGTTATTTCATACAACGTTTCTGCGGCATATCACAAACGATTACTCCATAACAGGGACAGCAGGCCACTCAATATCAGGTGCAGTTGATGTATCAACACGGTTCAGCAACACCGATACTTCTTCCAGGCTTCCAGCAACGAGGTTTCTTCCTTCGTTGCAATTTCCAGATCTGCAGCATCCTGAAGCGGCGCAATATGCTCACTGGCTACCTGCATCAGGCTTTTTCTTTCTTCCCTCCCGGATCCGGAACAGTTTTTCTGCTTCGTATCCTTCACCCAGGCTGTGCCGTTCCACTTCTGATATTTCCCTCCCGGCGATAACCAGGTAAATTTTTCGGTAACGGACCGAGTTCAGAAATAAATAACGCGTCGCCGGAAGCCACGTCATAGACGGTTTTACCCCGATGGTCTTCAACGAGATGCCACGATGCCTCATCACTGTTGAAAACAGCCACAAAGCCAGCCGGAATATCTGGCGGTGCAATATCGGTACTGTTTGCAGGCAGACCGGTATGAGGCGGAATATGCGTCACCTTCACCAATAAATTCATTAGTTCCGGCCAGCAGATTATAAATTTATGGTCCGTGGTTGTTCACTCATTCTGAATGCCATTATGCAAGCCTCACAATATAGTTAAATGCAATGTTTTGACGGTGTTTCCGCGTTACCCGCAGCGTTAACGGTGATGGTGTCCGTGTGAACCAATACTGAAAGAATGGGCATGAGCAGCCGATAACAACCGGATGCTGGTGCGCACCAATACCAACTGTATGCGCATGTGCAAGGCAGCACACACGGCTGTACCGGACAATGAGTGACTGTGGCTGCCCTGACTGTCCGTTTTCGATAAATAAGCAATACCTGTGTGCTGGTTCCTTTAACTGTGGATAAACTTCCTGTAATGGTTGCTGTTCCATACTGACTCCAGCCAGAACTGTTCATCCTTAAACCACTTGTGGGCATGAGCACCGCGCGGCCCCTGTTGAACCGCTCAGACTGTGAGCATGAGCCCCCGTGTTATTCGTCGATTTGGTGCCGTAATCGAAACTGCCTGTTGTTTTCGTCCCGTAATCAAACGACGATGTGGTTTTCGTCCCCAAATCCGTACCGGATGCACTGGCACTGTGGGTGTGCGACTTAATTCCATCCTGTTCCTGAGACAATACAGCACGACCGCTGGCGGGTTTCCCCTTGATTGTGCCTCAGCCGCATATCAGGAAGCACACCCGATGGATACGCGACAGCAAGTTTTGGGTAGGCTGATTTGTCAAACGCCTGCCCCTGCATCAGGACGTAGCCAGACGGAACGATATCTGATGGCCACGGGATCGGCGCACCTGCCGGAAAGGCCGAATTCTCACCGGCCCCAAGGTATTCAAGAACATCTGCAACGGAATTTTGCCAGAATATCCCTGCCAACCTGAGTCAGTTCAGTCAGGCTGGCGGCATCATTTCCGCAAATACGGTAATTTATTTTCGCCGTGGGAAGCCCTGCCAGCGCCGTCAGTGTCGCATTCTTCGGTTGTTTACCCGCAAGCGCGTTAGTCATGGTGGTAGCAAAATCTGGATCATTCCCGAGCGCTGCGGCCAGTTCATTCAGCGTATTCAGTGCGTCAGGTGACGCGTCGATAACATCTGCAATCGCGGCCAGTACAAAAGCGGTGTTCGCAATCTGGGTATTGTTTGTTCCCTGAGCGCGGTTGGTGCTGTTGGCGTTCCGGTCAGTGCCGGACTGTCCAGTGGGCTTTTCTGTTCGTTTCATCCATTACCACCTTAACCGCCTTTGGCGTTGCAGCAAGCGTTTCAGACGTGCTGTTGGTTGCACTGCTGAGCTGCACTATCCCTTTCTCGTTGTTGTCCGCATCCTCAAGCGCGACAGCTGAAGCTATATCTTCTGCACGTTTTGCCGAATTTTGCACGTATTGCCGCCGCTTCTGCCGCACTTTTGCTCTGCGATGCTGATACCGCACTTCCCGCAGCCTCCTGTCGCCTTCGTGGATGCCGTTGACGCACTCCCGCCGCCGCTGTTTTGCGTCTGCCGCCGGCAGAGGGCAGGGCGTTCCGCTGCTGTTTCAGATGACCTGGCATTCGTCTCGGACGTTTTGCCGCCCTGGCAGAATTTTCTGCCGCCGTTGCCGAGGAAGCTGCACGACCGGCACTTGATGATGCGTTCGTTTCTGATGATTTTGCTGCCTCTTTGAGGCCACCGCATCTCGTGCTGAAGTGGCGGCCTCGCTCTGACGCTTTCGTGGCCGCGGTGGAGGCAGACGTGGCTGATTGTTGTTGACGCTGCAGCATTCGTTTCTGACGTTTTCGCCGCACCGGCACTGGGCCGCCGCCGCGTTTTGAGAGAACTCTGCGGCTGCGGCACTTTTCCGCTTCAGTGGCCTTTGCTGATGCCCGCTTCTGCGCCGGAGGACGCTTCCTGAGCTGACGATGCAGCCTGTCCGGCGACGTGCTGGCGGCGCGTGCTGAGTCAGTTGCATCAGTCACAAGGGCCGCGACCTGAGCAGCTGATGCACTGGCATCGCCGGCTGATTTCTTCGCGTCTGCCGTACTCTGTGCCACCACGGACGCGTTACGCGCCACCCTCTTCCACCATCAGTTCAAGACGACGCAGCACCTCCGGCCGGGCATCATCCTCCGTCATGGCACAGAGAAAATCATTCAGCGTCCCCGGTTGTGAATCTTCATACACGGTGATGGTCCCGGCGTGCGATGGTGGAAAACCGTCAACCTGCAGGATGACACTGTACTGACCGTACTCCACATCCATGCTGTAACGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCACCACCACCGTGGTGCTGTTACGTCTGGCTTTCAGCTGAATGGTGCAGTTCGTCTGTACCGGTTTTCCTGTGCCGTCTTTCAGGACTCCTGAAATCTTTACTGCCATATTCACCCCACAAAGCCCACCGGTTCCGGCGGGCTGTCATAACACTGTGTTACCTGGCTAATCAGAATTTATAACCGACCCCAACGATGAATCCGTCAGTACGCCAGTCGCCACTGCCGGAGCCTTCATAAGCAATATCAACAACGACGGACGCTGCCGGATTAATCTGTATACCTGCACTCCACGCCACTGAGGTATGCCGCATTGCACTTTCGTCCCTGGCAGTGGTCGTCTCCTTTCATATACCCGGGAGTGATTTCCGTCTTACGGTAATCCATTGTACTGCCGGACCACCGACTGTGAGCCACTCGGCCATGGCGTACGCACTGACCTGCTTACTGATTTGTAAAACCGGTCCGGCCATCACGCTCACATAACGTCCACGCAGGCTCTCATAGTGAAACGTATCCTCCCCGGTCATCACTGTGCTGCTCTTTTCGACGCGGCGAACCCCAGGGAAGCCATCACCCCCACACTGTCCGTCAGCTCATAACGGTACTTCACGTTAATCCCTTTCAGATGACTCACACCGGTATCCCGCCCGACAACGACGGCAATGTACCGGTTTCACTTGAAAATAGCCCACCGTAAACGTACCATGTCACCTTCCGCACGGGCCGGAGATGACTGTCACCGCAAGTGCGGCAAAGACAGCAACGGCAATACACATTACGCATCGTTCACCTCTCACTGTTTATAATAAACGCCCGTTCCCGGACGAACCTCTGTAACACTCAGACCACGCTGATGCCCAGCGCCTGTTTCTTAATCACCATAACCTGCACATCGCTGGCAAACGTATACGGCGGAATATCTGCCGAATGCCGTGGACGTAAGCGTGAACGTCAGGATCACGTTTCCCCGACCCGCTGGCATGTCAACAATACGGGAGAACACCTGTACCGCCTCGTTCGCCGCCGCCATCATAAATCACCGCACCGTTCATCAGTACTTTCAGATAACACATCGAATACGTTGTCCTGCCGCTGACAGTACGCTTACTTCCGAAAACGTCAGCGGAAGCACCACTATCTGGCGATCAAAGGATGGTCATCGGTCACGGTGACAGTACGGGACCTACCTGACGGCCAGTCCACACTGCTTTCACGCTGGCGCGGAAAAGCCGCGCTCGCCGCCTTTACAATGTCCCCGACGATTTTCCGCCCTCAGCGTACCGTTTATCGTACAGTTTTCAGCTATCGTCACATTACTGAGCGTCCGGAGTTCGCATTCACACTGCCACTGATATCCGCATTTTAGCGGTCAGCTTTCCGTCCGGTGTCAGGAAAGGCCGGAGGATTGCCGCCGCTGGTAATGGTGGGGGCCGTCAGGCGCTTCAGGAACACGTCGTTCATGAATATGGTGGTTGCCTGCGCCACAAACATCGGCGTTTCATTCCCGTTTGCCGGGTCAATAAATGCGATACGATTGGCGGCAACCAGAAACTGGCTCAGTTTGCCTTCCTCCGTGTCCTCCATGCTGAGGCCAATACCCGCGACATAATGTTTGCCGTCTTTGGTCTGCTCAATTTGACAGCCCACATGGCATTCCACTTATCACTGGCATCCTTCCACTCTTTCGAAAACTCCTCCAGTCTGCTGGCGTTATCCTCCGTCAGCTCGACTTTTTCCAGCAGCTCCTTGCCGAGATGGGATTCGGTTATCTTGCCTTTGAAAAATCCAGGTAACCTTCCGCATCATCGCTCGCCCGACCGACGGCCTCCACGAATGCCGATTTGCCAACGGTGTTCACACTGCGGATATAAAGTAATAATCATGGCCCGGTTTGATATTGATACTGGCGGCTATCCAGTACAGCGCCGTACCAAGATAACGCGTGCTGGTTTCAACCTGTCTGATATCCGCAATCTGCTTTTCCTAGAGAACCAGAACTCAAACTGTACCGTCGGGTCATAAACGGCAAGATGCGGCGTGGCGGTTATCTGAAAATAGCCCGGCGTCAGCTCAATCCTCGACGGTGCTGCCGGTGCGGCAATCCGGAACGATACCGACGCCGGATCGCCCTGCTGCCCCACGCATTTACCGCCCGGACTGTCAGCCTGTAGTTCCCCAGCGCCAGTTGCGTGAAGCGGTATGTGGTTTCCGTCGTCCGGGCCGTGCTGACCAGCCGCTCACTGCCGTCGTCCGCTGTTACGCCGTCAGACGGAGCAGGAAACTCACGCCCTTCACCACCTTCGGTGTGTCCCATCGCGCCAGCACCTGATATTCCCCGCTGTCTGCAGTGACTTCTGCGGTCAGGTGCTGCACCGCTGGCGGCGTGACACCATTCACCGTGCCACTCTGTTCGCCGTCAAAGTGCGCCCCGTTATCCACGATGGCCTCTTTTCCGGCACATGCTGCACGGCGGTGATGGCATACGTGCCGTCGTCGTTCTCACGGATACTCACGCAGCGGAACAGTCGCGCGCTGGGCAGCGTCGGCAGCTTCAGCTCCCATACGCTGTATTCAGCAACACCGTCAGGAACACGGCTCATTTTACCTTCACGCCGTCGGTGACGGACTGAACCTCCACGCTGACCGGATTGCCACTTCCGTCAACCAGGCTTATCAGCGCGGTACCGGAGGATGGCAGCGTGATTTCACGGTCGAGCGTCAGCGTCCGGGTCGGTGGCTGTTCACCGCCAGCACACGACCACCGGTGCTGATACCGGCATAGTCATCATCGCAGATTTCAATAACATCGCCCGGTACATGGCGAACCCCTTCTGCGCCGACGCTGAAATCCACGGTCTGCGTTTCCAGCAGTTCTGTTTTAATCAGCCACAGCCCGGCGCGGTGTGTGCCTGCCCCGGCTGGTACAGCCAAAGGCATCCATCTTCGTAACATTACGACCGTAACGGGCAATGGCCTGCGTATCTTCAACAAGCTCTGTCGCCGTCTCCCAGCCGTTGTTCGGGTCAATCCAGTTCACCTCAACGGCATTATGGCGGTCCTTCAGGGCGCTGAAGCTGTAGCGGAACGGCGCGCCATCATCCGGCATCACCACATTACTGCGGTTATAGTCCACGTCTTATCCGACGGTCGGTCCTGCACGAACGTCAGCGTCTGCCCGTTCCATACCGGCATACAGCGCAGCATCGCCGAGCAGAAATCGCTGAGCACATCCCACGCCTTACGCTGTGGTCAGGTACGCATTACAGGTGATGCGGCGCGGTGCGTGCCGCCAAAGCCGTCCGGCACTGACTGGTCGCAGTACTGGCCGATGACATACAGCGCCCATTTATCCACATCCGCCGCACCAAGACGTTTCCCCATGCCGTAGCGCGGATGGGTCAGCATATCCCACAGACACCAGGCCATGTTGTTGCTGTATGCCGGTTAAACGTTCCGTCCCAGATACCGCTGTATTGCCGCGTCTGCGGGTTATAGTTCGACGGCACCTGCAGAATACGCCCGCGCAGATGATAATTACGAGCTCACCTGCTGGCTGCCGAACTGCTCCGAGTCCACCTGCACGCCGACCAGTGCCGTGTCGGGTAGCACTGTTTCACATCGATGATTTCAGTGTATGACGACCAGAGCGTTTGTTCTGCAGCTGGTCTGTGGTGCTGTCCGGCGTCATCCTGCGCATCCGGATATTAAACGGGCGCGGCGGCAGGTTACCCATCACACCGAGGCCAGATACTGCAGGTGGTTTGCCTTAATGGTGATGTCTTTTCCGTCGTACCAGCCACCGTTACGTTGTATCTGAACCAGCAGGCGGACTTCCGACGGATTCCTGTCACCCTTTGAGGTGGTTTCCACCAGTGCCTGTACACCGAAGGTAAAGCGCAGACGGTCGATGTTTGCAGACGTTAATGGTGCGGGTGATCGGCGTGTCATATTTCACTTCCGTACCCAGCACCGTCTCCGGAGCCGGAGGATTCAAATCCCTCCGGCGGAGTCTGCTCCTGCTCACCAGCCCGGAACACCACCGTGACAATATGTTGGTATTCCCTCAGTGTCCAGCACCGGCGTACTGTTCAGCAGCACGCTTTTAAGCCATCCAAGGACCTTCAATCGGCCTTCGCTGATGGCATCGATCACACTCAGCAACTGCGTGGACTTCAGGTTGTCCTTCATTCGCGCGGGGGGGTCCCCTTACTGCTTCCTTTACCCATTCCTCACGCTCCATAAATGACAAAACCGCCCGCAGGCGGTTTCACATAAAACATTTTGCATCAGCGACCAATCACCACAACCTGACCACCGTCCCCTTCGTCTGCCGTGCTGATCTCCTGAGAAACCACGCGTGACCCCGCGCGCATTTCCCCGTACAGAACAGGCAGAACATTGCCCTGGGCAACCATGTTATCCAGTGAGGAGAAATAGGTGTTCTGCTTACCGTTATCCGTTGTCTTGTACGGGGAGTTCTGGCTTTCGGTGCCAGCATCTGCGCCACACCACCGAGCACCATACTGGCACCGAGAGAAAACAGGATGCCGGTCATACCACCGGCCCCAATGGCTGCCCCCATGCTGCAAGGGGCTCCGGCGGTAAAGAATGATCCGGCAATGGCGGCAGCCCCCAGGACAATCTGGAATACGCCACCTGACTTGGCCCCGGCGACTCTGGGAACAATATGAATTACAGCGCCATCAGGCAGAGTCTCATGTAACTGCGCCGTTAACCCGGACGTGCTGACGTCCCGCCCGGCAATCCGTACCTGATACCAGCCGTCGCTCAGTTTCTGACGAAACGCCGGGAGCTGTGTGGCCAGTGCCCGGATGGCTTCAGCCCCCGTTTTCACACGAAGGTCGATGCGGCGACCAAATCGTTGTAAATCCCCGTAAAGGCAGATGCGCCATGCCCGGTGACGCCAGAGGGAGTGTGCGTCGCTGCCATTTGTCGGTGTACCTCTCTCGTTTGCTCAGTTGTTCAGGAATATGGTGCAGCAGCCGCCGTCGCCGCAGTAAATTGCGGCGTGATTCGGCACTGATGAACCAAAACAGCACAGCAGCACATCGCCCGGCTGTGCCGTGGACAACGGCACCTGATACAGCCCCGTCGCCTCCAGATTATCCAGATAGAGATTCTGGCCGTTACGCCACCAGTCATCCTCACGATGAAAGTCCGGCATCTCAATCCCGCCAGATGATAAGCATCCCGGAACAGTGTGTAACAGTCCGTCACACCGTGCTCAAAGCGCCGCCCGGTGAGATGCGGCACACAGCGGAACTTATGAATCGTCCCCCGGCAGACCAGCCACCACGGCAAATCACTCTGCACCTGCAGCCGCCGGTCGGCCTCACTCAGCCGAGGCAGACCACCGGGGTGGGCTGGGACCAGCGCCACAATCTCACCCTGCATTTCTGCCTGCAGCCAGTCTTCCGGCGACATACGGAAATACGCCTCCGGCTCACCGGAGATATTCACGCAGGGAAATATTTCCCCCTCCGGCGTGCTTACCACGAAGCCGCACGACTCCGCTGGCGCACATCGCCATGCCGGGCGTGCGGCCAGAAATCGCTGATTCTGTCTTGTCATGGGATTTACTGCGAAAGTTTGTTAATGGAAAGGAAGCCGCCAAAGTTGCCGACGTTATTGCGGAACTTACAAACGCTCAGGCATTTGCTGCATTTATCCTTCGTGATATCGGACGTTGGCTGGTCATATTCATCCGCGACAGCCGGACCGCTATAACCGCACTCGTCACCGCGATAGTCCAGGTGCAGGTGTTGGCCAGCATGATACGTCCTAGAAAAACAGCGCCATCCGTTTCCGTCGGCGTGACAGTACAAAGGAGGCACTCACCGCGCTCAGTTCGCTGCACTGCTCAATGCGCCAGCGGCTGATCACCTCCTGCTCCGGATCGGCGTAACTGTTTCCGTTGACGAAGTTCACCGCATCCAGAAAACGGGCGTAAACCTTACGCCGGACCACCGTTCCGCCGACCAGACTCTGCATATCTTCCGCCATCCCGGTGACCATACCGTACAGGTTAGAAACCGTCAGCGTGGGGCGGGTACTGGTGCCTTTGCCATTCAGTTCAAACCGCTCCCCTGAATGGGATACGGCTGATACTGTCGCCCCTGCCAGGTGACCGGCTCACCTTTTCGTTCTGCTCATTACAGAAAATAACGTTCTCCACCGACCTCTGTCAGGTCGATTTCCAGAGAGCACCACGCTGGCCGACTGCTCCGCACGGGTGCATTCATTCAGTGTTTCCTGCCGGATATCCTGCATCAGTTCACCACCTGTTCAAACTCTGCGCTGAACTCAACACGCAGCATACTGACCGCGACGACCATTTTGCGCAGGTCACCTTTATCTGCCGCCACTCATAAGGCGGCGTCCACAGAAAGGATTTCCAGCCCCGTGCTCTTCCAGAAACGACTCCAGTACCGTGGCCTCCTCACGGGGGACAGAAGGCGTCACGCTGTACGTTTCAGGTTGGCATTCAGCCCGGCAGGCGCTCGCTGAGAATAGCCATCACCAAAGCGCACCTTTCTTACAGAAGGGACCGAAGCCACATCCATACCGGGTTTCACTTTCCAGCGGAAGGTCTTCATCGTCTCTCCGGAACACAGGCCACCATCACGCATCTGTGTCTGAATTTCATCACGGGCACCCTGCGGGCCATGTCATACACCGCCTTCAGAGCAGCCGGCCGGACCTATCTGCCCGTTCGTGCCGTCGTTGTTAATCACCACATGGTTATTCTGCTCAAACGTCCGGACGCCTGCGACCGGCTGTCTGCCATGCTGCCCGGTGTACCGACATAACCGCCGGTGGCATAGCCGCGCATCAGCCGGTAAAGATTCCCCACGCCAATCCGGGGCTGCCTGCCTCCTTCGTGAAGACAAACTCACCACGGTGAACAATCCCCGCTGGCTCATATTTGCCGCCGGTTCCCGTAAATCCTCCGGTTGCAAAATGGAATTTCGCCGCAGCGGCCTGAATGGCTGTACCGCCTGACGCGGATGCGCCGCCACCAACAGCCCCGCCAATGGCGCTGCCGATACTCCCGACAATCCCCACCATTGCCTGCTTAAGCAGAATTTCTGTCATCATGGACAGCACGGAACGGGTGAAGCTGCGCCAGTTCTGCTCACTGCCGTCAGCATCGCCCGCCATATTCTGTGCAATACCATCAAAGGTCTGCGTGGCTGCATTTACCTGCGACATACTGTCCGTGGCGCTCTCTTCCCACTCACTCCAGCCGGACTTCAGGCCTGCCATCCAGTTCCCGCGAAGCTGGTCTTCAGCCCAGGTCTTTTCTGCTCTGACATGACGTTATTCAGCGCCAGCGGATTATCTCGCCATACTGTTCCTTCAGGCGCTGTTCCGTGGCTTCCCGTTCTGCCTGCCGGTCAGTCAGCCCCCGGCTTTTCGCATCAATGGCGGCCCGTTTTGCCCGTTGCTGCTGTGCGAATTTTATCCTGCTGCGCGCCAGCGCGTTCAGGCGCTCCTGATACGTAACCTTGTCGCCAAGTGCAGCCAGCTGGCGTTTGTACTCCAGCGTCTCATCTTTATGCGCCAGCAGGGATTTCTCCTGTGCAAGACAGCTGGCGACGACGTTGCCGCCTCCTCCTCCAGTACCGCGAACTGACTCTCCGCCTTCCACAAATCCCGGCGCTGCTGGCTGATTTTCTCATTTGCTCCGGCATGCTTCTCCAGCGTTTAGAGTTCTGCCTGAAGCGTCAGCAGGGCAGCATGAGCACTGTCTTCCTGACGATCGCCCCGCAGACACCTTCACGCTGGACTGTTTCGGCTTTTCAGCGTCGCTTCATAATCCTTTTCGCCCGCCATCAGCGTGTTGTAATCCGCCTGCAGGATTTTCCCGTCTTTCAGTGCCTTGTTCAGTTTCTTCCTGACGGGCGGTATTTCTCCAGCGGCGTCTGCAGCCGTTCGTAAGCCTTCTGCGCCTCTTCGTATATTTCAGCCGTGACGCTTCGGTATCGCTCTGCTGCTGCGCATTTGTCCTGTTGAGTCTGCTGCTCAGCCTTCTTTCGGGCGGCTTCAAGCGCAAGACGGGCCTTTCACGATCATCCCAGTAACGCGCCCGCTTCATCGTTAACAAAATAATCATCCTTGCGCAGATTCCAGATGTCGTCTGCTTCTTATACGCAGCCTCTGCCTTAATCAGCATCTCCTGCGCGGTATCAGGACGACCAATATCCAGCACCGCATCCCACATGGATTTGAATGCCCGCGCAGTCCTGTCTGCCCAGGTCTCCAGCGTGCCCATGTTCTCTTTCAGGCGGCGGGTCTGGTCATCAAACCCCTTTCGTTGCGGCCTCGTTCGCCGCCTGCAATGCCCCGGCTTCATCGCCGGAACGCTGCAACTGAGCAACATACGCAATCTGCTCCGCCGACACGTTATGGAACTGGCGAGCCATCGCCGTCAGCCCCGACGTCGGGTCTGTGGTCAGCTTCCCGAAGGCTTCAGCGACCTTGTCCACCTCCACGCCGGATGCAGAGGAGAACGCGCCACCACTCTGGCTGATGGACGCAATCTGAGCCTCACCGCTTACCCCCGCCTTAACCAGTGCCTGAGTACTCGCTGGTCTGGTTAAACGTCAGCCCTGCCGCCTGCCCGGCTCTGGACAGGACCAGCATACGATCTGCCGTCAGTCCCGCCTGATTGCCGGAAAGGACCAGCGTTTGTTGAAATCGACGGACAGGGTGAGTTGCCCTGATACCAGGCATACGCCAGCGCACCGGTCGCCACCGCCAGCGAGGCCCCCACCATCGGCAGGGTGATCGCACCGGCAAGCCCCCTGAACATGGGGATCATCCCGCCGAAGGGAGTCCTTCACCTGCCCCCTGTTGCAGCAGGATCAGCCACGGACTTTGCCCGCCCTGCAAGCTGCGTGGCCACGTCGGTGAACTGTGCAGGCAGCATACGCATGGCGGCTTTATACTGCCCGACGGAAATCCCCGCTTTCTGTGCAGCCAGCGCCTGTCGGCTCAGCGACTGTTCAACGACTGCCGCTGTTTTTCGCATCACTTTCCGTACCAGAAAATGACGCCTGACTCTGGCCATCTGCTCGTCAAATCTGGCCGCATCCAGACTCAAATCAACGACCAGATCGCCTACCGGTTCAGCCATACGGACTCCTCCTGCGATCCCTTCTGATACTGTCATCAGCATTACGTCATCCTCCGTCATGTCGCCACATCCGGGGGAAGCGGGGATAACTTCATTCCCGTCCGGGCCAAAGCGGACACCTCCGGCAAGCCCTGCCGCTTTCTGCATCAGCACATCATCTTCAGGCTCTTCGTCAGCCTCGCGCCGGTTCAGCAGACTGAAATCCAGAGGCGGATGCATATATCCGGATCGCTGAAAAAACAGGCTGAGCACGGTGTACGTCAGCCCCCGGAAAGTGCATATCCAGCAGAACATCATGAAAATAATGGGTACTGTAAAGCGGTGCCAGTCGGCATACTCCGTGGATGACATCCCGGCAAGCATGGCACGCCAGTCGGGTCGCCCCATCTCACGCGCCAGTTCAGGGCAAAACTCAGCTCACCGTCGAACACTTTCCCGCAGAAACAGGCTGCTGCGGGCCCGGCGTCCTCTGTCTGTTCAGGGGCATTATTCACCACAAACTCATACATACCAGACAGCCGGTACACCACGTTTTCAGCATGAGAAATTGCCTCCGTGGCCAGGTGGTAAGCACTTCCTGCTCAATCTGTTTAACGGCTTCATTCATGGACGGCATCTGCGTCTTCTGCGGATGGTTATGCCACAGGGACATCGCCCACCAGAAACGCGCCGGTTCTGATGGCGTCTTTCCACAGTAAACTTCCGGTTGCTGTCTGACTCCGCCTGTTCTGCCTGCCGTTTCATCAGGGCGAGATGCTCAATGCGCTGCATGCAGGCTGACAGTTCAGAAAGCGTGACGGTCACCCGTTATGTTCAAATGATTCGGTTTTCAGGAACATCGCTGACTCCGGATTAACTGGCGGTGACGGTAATTTCTGCAACCGCAGCAAACTCACCATTACCGGATACAACCGGAATGTTGACCTTGCCTGCAGCAACGCCGTTCACGGTGATGGTCATACCACTGACGACACGGTGGCTTTTGTTTTATCCGCAGACACCGCACGAAAGCTCTTGTCGGTTACGCCTCCGGCGGCTGGAAGGGCCGGTCGGTCAGCGTGGTGCTCTGCCTTTCACCACCGAGGTGCTGGCAGGCGTCACGGTCATGCCGGTTGTTGCTGTTACCGTGCTGCGATCTTCTGCCATCGACGGACGTCCCACATTGGTGACTTTCACCGTTAGGTGATCACTTCCTTCGCCGTCAGTCGCCTTACCGATACTGCTGACCCAGCCACGGAACACATCGACCGTGCCGTTCGGGAAGCGGATTTATAGGCACGGGTATCGCCTTCATTAAACCACGCCAGCAGCGCCTGCTGCCTGCTGCTCTCCGGGCATCCACGCCAGCGTGAAGCTGGTATCTCCGGCAGATTTCTGCCCCTGCCCGGTCGCAGTCCAGTCTGCATCTTCATCATCGAGATAGCTGTCGTCATAGACTCAGCGTCAGTTCGCCGGGCGTCAGGTCTTTAACTTTGCCCACATTTTCAGTTGCTGAATAAACGCCGGGAATACGACGGTTACCCATTCCCAAGCACGCTGCCGCCACCTTCAGGGATGAACGCTGCCCCTTTACGACGCCTGCATGGCGCGAAAGGACCCGCGCATTACCAGCTTGATTACGAGGCAAATCCCCCGGTTAACTTTGATTCTGACTGCGGATTTGACCGTGGCCTTTTTCATGCCTGGCCCTTCCTTACCAGTTCAGTGTGCGTACCTTTGTCTCACGGGCAACAATGTGACGCCGACTGCGATATCGCGGATGAAGCAACGCGGTTAATGGCCCATTGCGGCGGGCGAGAGAGCACCGCCGTTTTGCTGATACGGCTGAGGATGTCGCAACGGCCTGCTCAAGACTTTATGGCCATACATCCCCTTCTTCAGCGACGGTTAACGGCAGGCGGTACGCCCCGTCCAAGCCAGAGATGACAATTCCCCTCATCATCCGGCGAAACCCGATTACCCAGAAATTTTCCTCACCGATGGTCAGCGTGTCTCCACGCCGCAGCTGCCGCACCTCATCAGTCCGGACAAACAGGGACGGGCTGGAGCCTTCAACGCACGCCTTGTCCGGCATAGCTGATATTTTCAGGGTCATCAAAAACACCACGTATCACTACACGCTGACTGCTCACCGGATGTAATGGTGGCTGACGTTCCCGTTCATGTACCCGCGTATCGTTTCATCGGCGGGGGCAATGGCAGCATCGAACAGGTATCGAAATCAGCCACAGCGCCTCCCGTTATTGCATTCTGGCCGAGCGGAGACGGGCAATCAGTTCATCTTTCGTCATGGACTCCTCCACAGAGAAACATGGCCCCGAAGGGCCATGATTACGCCAGTTGTACGGACACGAACTCATCATCAGTCAGCCAGCAGCATCAGCGGTGCTGACTGAATCATGGTGAAACTCACGCGCCGGATCGCCGGTGGTCACCCAGTTTTTCGGGTAACGGGCAGAGGCGTTAATGCCTTCGCGCTGTGCGTCCGCATCCTGAATGCAGCAGCCAGTAGCGCAGACCGCGTGCCTGAGTGTTCCCCAGCACCATCGTGTTGTCCGGCAGGAAGTTCTTTTGACGCCGTTTTCCACGTACTGTCCGGAATACACGACGATGGCCACATCGCCATACATCCCCTTATAGACACCGCTTTGCCCAGGTCTTCACCGCTGTCTCCAGCTCGGAATTAGAGCCACGACGGGTATCCAGCTTCTCCTTGACGGCTTTGAAGGAACGGAACAGCGCCAGCCTTTCGGATCGAACACGATGATATTCACCACACCGCTGGCGTTCAGCGTAGGCTTCGATATCGTCGGTCGGGTCATACGTGGACTTGTCACGCTTGCTCCACTCCGTGCCGCCGGACTGCGTGATGTTATTCTCCTCACTGCGGCCCATATCCACCTCAACCGGATCGAAGGCTTCACCGGTCATGGTGTATTTGCCCTTAAGCACGGCAGAAACTGCCTGCATCTCTTCGACCTGAGCAATGGCCAGCTCTTCGTCACGCATGTTCTGCATGATGATGCGACGGCGGCGGTAAGCCGGGTCCGCCAGATTCTGCGATCTTTCATCCGGCAGGCGACGCAGGGTCATCTGCGGATTCACTTCATGCTTCGGCTTGACATATCCCGGCGTAAATTCAGGGTGGAGCCGCCACGGGAACGGATAACCTCACCGGAAACAATCGGCGAAACGTACAGCGCCATGTTTACCAGTCCGGAATTTGTGAGAGATAGACTTTCTCGTGGTGAAGGATAGCTCTCACGGAAAAGAGACGCAGAAACAGCGGATCAAACTTAAATTTCTGCTCATTTGCCGCCAGCAGTTGGGCGGTTGTGTACATCGACATAAAATCCCGTAAAAAGCCGCACAGGCGGCCTTTAGTGATGAAGGGTAAAGTTAAACGATGCTGATTGCCGTTCCGGCAAACGCGGTCCGTTTTTTCGTCTCGTCGCTGGCAGCCTCCGGCCAGAGCACATCCTCATAACGGAACGTGCCGGACTTGTAGAACGTCAGCGTGGTGCTGGTCTGGTCAGCAGCAACCGCAAGAATGCCAACGGCAGCACCGTCGGTGGTGCCATCCCACGCAACCAGCTTACGGCTGGAGGTCCAGCATCAGCGGGGTCATTGCAGGCGCTTTCGCACTCAATCCGCCGGGCGCGGTTGCGGGTATGAGCCGGGTCACTGTTGCCCTGCGGCTGGTAATGGGTAAAGGTTTCTTTGCTCGTCATAAACATCCCTTACACTGGTGTGTTCAGCAAATCGTTAACGGATCATCAGATGCCGGGTTGCAGCTGCAGCCAGCGGTGCCGGTGCCCCTGCATCAGACGATCCAGCGCAGTACTGCGCGCCTGTGCACTCTGTGGTGCTGCGGCCAGAATGCGGCGGCCGTTTTCACGGTCATACCGGGGGTTTCTGCCAGCACGCGTGCCTGTTCTTCGCGTCCGTGAGCCTCCTCACAGTTGAGGATCCCCATAATGTAAGCTTTCTGCCGCAACCGCTGCGGTGATCTGCGCGTTCACGTCCGGCTGCGCCGCGCTGGCGTTCGCCCTCCGTCGCTGGCACCACGTCAGTAACGTCAGCCTGCGAAGCAGTGGCTGAAACAGTTGTTGATTGAGTCTCTTTGGTCATTCGCCTCCTGAGAGACGGGATTTACGTGCATCCAGTGCATCACGCATGACGGTGATCGCATCGGTGCTGTTAACAAGTTCATCAGCCAGTCCGGCATCAATGGCCTCCTGACCGCTGTACACTGCAGCCTCGGTATCCAGCACAACCTGCACGGACAGGCCGGTATATGCCGACACCTTCTGCGCAAACATCTGGCGGGTTGCGTCCATCCGGGACTGCAGTGTCTCCCGGACGTCATCCGGAAGATGGCTGTAGGGTTGCCATCCACCTTATGGCTGCCGCTGTAAATCAGCGTGATTTCCACACCCTGTTTCTCCAGCGCAGCACCGTAATTACTGTGAGCCATCATGACGCCGATGGAGCCTGTCCGGGCGGTCTGCGTGACCAGACGCCGGGGAGGCGGCACTGGCAAGCAACTGACCTGCACTGCAGTTCATGTCGTTGGCAAGCGCCCATACCGGGTTTTATGTCACGCACACGGGCGATGATGTCAGCGCAGTCAAATGCCCCGCCACCATCCCGCCGGGCGTGTCCATATCGAGCAGAATGCCGTCCACCATCGGATCGCTGGCAGCCTGTTGCAGACGGGCGATAATGCCGTTGTAACCGGGTCATCCCCGAGTACGGCTGCAGCGCCCGCGTCCGGCTGACCAGCGTGCCGGACATGCAGCACGGCGATGCCGTTCATGACCTGATAACTGCGGCCTGTCGTGTGTCCGTCATCATCACCGGATAATGCCAGCGTCGCGGGTGCCTCCTGGGCAGTCAGGCTGTCGCCGGACACCGCATCCGTCAGGCTGCTGATCCCAAGCTGGCCTGCAAGCGCACAAAGAAAACCCGCGCATAGGCGGGTTCAAGCATCAGCGGCTCATTAAAGGCCATGCTGGCAATATGCGGAGATTACGCAGCTCTGCTGTCACTCTTCTCCTCCTCTGTTGATTGTCGCAGCCCGGATTCAAATGCTGCAGCCGCCCAGGCGGGCGGTTTAAGACCGGCTGCACGGCGCTCCATCGTTTCACGGACCTGCTGGGCAAAATTTCCTGATAGTCGTCACCGCGTTTTGCGCACTCTTTCTCGTAGGTACTCAGTCCGGCTTCTATCAGCATCACCGCTTCCTGAACTTCTTTCAGACCATCGATGGCCATACGACCGGAGCCTATCCAGTCGCAGTTCCCCCAGGCACTGCGGGCTTCCTGAAAACTGAAGCGCGCTTTGAAGGTAACGTCACCACGCGGCGAACGATGGCCTCTTCCAGCCAGCACAGAAACATCTGGCTCGCCTGACGGGATGCGACGAATTTTCGCCGCCCCATAAATGACGCCCACGACTCGTTCGCACTGGCCCGTGCCGTGGAGTAGCTCATCTGGGCGTAATTCCGGGAAAGCTGCTCATACGAGACACCCAGCCCGGCAGCGATATACCGCAGCAGTGACTGCTCAAACACGGAGTAGCCGTTATCCGTATCCTGAGCCGTCTGCAGGTTCAGTGAGAGTACCGGCATCAGGTGCGGTACTTTTGCGCCTCCAGCCGGACCGGCGCTGCTGCGGCGTAATACGCGGCAATTTCACCAATCCAGCCGGTCAGCCTTTCCCGCTGCTCCTGACTGTTCGCGCCCAGAATAAAATCCATCGCTGACTGCGTATCCAGCTCACTCTCAATGGTGGCGGCATACATCGCCTTCACAATGGCGCTCTGCAGCTGCGTGTTTCTGCAGCGTGTCGAGCATCTTCATCTGCTCCATCACGCTGTAAAAACATTTGCACCGCGAGTCTGCCCGTCCTCCACGGTTCAAAACGTGAATGAACGAGGAGGCGCCCGCCGGGTAACTCACGGGGTATCCATGTCCATTTCTGCGGCATCCAGCCAGGATACCCGTCCTCGCTGACGTAATATCCCAGCGCCGCACCGCTGTCATTAATCTGCACACCGGCACGGCAGTTCCGGCTGTCGCCGGTATTGTTCGGGTTGCTGATGCGCTTCGGGCTGACCATCCGGAAGAACTGTGTTTAGAAAAGCCGCGACGAACTGGTATCCCAGGCCTGAACGAACAGTTCACCGTTAAAGGCGTGCATGGCCACACCTTCCCGAATCATCATGGTAAACGTGCGTTTTCGCTCAACGTCAATGCAGCAGCAGTCATCCTCGGCAAACTCTTTCCATGCCGCTTCAACCTCGCGGGAAAGGCACGGGCTTCTTCCTCCCCGATGCCCAGATAGCGCCAGCTTGGGCGATGACTGAGCCGGAAAAGACCCGACGATATGATCCTGATGCAGCTGGATGGCGTTGGCGGCATAGCCGTTATTGCGTACCAGATCGTCTGCGCGGCATTGCCACGGGTAAAGTTGGGCAACAGGGCTGCATCCACACTTTCACTCGGTGGGTTCCACGACCGCAACTGCCCTCCAAATCCGCTGCCACCGCCGCGTGATAACCGGCATATTCGCGCAGCGATGTCATGCCGTCCGGCCCCAGAAGGGTGGGAATGGTGGGCGTTTTCATACATAAATCCTGCAGGTCTCTCCCTGCGTCGCTGTGTCATGCCGGTCTGCACTTCCAGCTCTGCAATATATTTTCAGGTCAGACACGGAAGTGGCCGTAAACTCCACCCTTCGTCCGTCTTTCTGTACTGTTGCCACCCGTTTACCTGTCATCAGGTCATGCAGTGCCGCACGGGCAGCGGCAAGTTCTTCCTGTCGCGTCATTCATCCTCTCCGGATAAGGCACGGCACGGCGTAATCTGCCAGTGTTTTCTTGTTGGTTGCTGCACCATCCTCTTCCTGCAGGCTCGCCAGCAGCGCACTGAGATCCAGCTGCCAGCGGGAAATACTGATGCGCAGCGCCGCCAGCGCATAAACGAAGCAGTCGAGTGCCTCATTGCGTCGCTTTTGCTGTCCACAGTATTTTCCTGCCATCCACCCATTTTCGACCTGCTCTTCAGCAGTCAGCTGCTGCGCTTCGGGTCAGATCAAAATATCCGGGTTATTCGGGAATGAACGGCACCGGGAAGCGGTTCATCCCCTTCCGGCGTCAGTGTGAAGCGGTTATAAATCTGCTCTCTTCGCGGTATCCGTACCGATTTCGGTAAGGTAAACCCCGTTTTGTTTCGCTTACGTGGCATGCTGGCCACCGGCTTTCCGTAGACGGATGCCCCTTTAATGGGGATCACCCGGAACAGCCCATGTTTTTCGAGCGTTCATACACAATGGTCGGGTCAATCCCGCCAGTATCCCAGCAGATACGGGATATCGACATTTCTGCACCATTCGGCGGGTATAGGTTTATTATTGATGGCCTCATCCACGCAGCAGCGTCTGTTCATCGTCGTGGCGGCCCATAATAATCTGCCGGTCAATCAGCCAGCTTTCCTCACCCGGCCCCATCCCCATACGCGCATTTCGTAGCGGTCCAGCTGGGAGTCGATACCGGCGGTCAGGTAAGCCACACGGTCAGGAACGGGCGCTGAATAATGCTCTTCCGCTCTGCCATCACTTCAGCATCCGGACGTTCGCCAATTTTCGCCTCCCACGTCTCACGAGCGTGGTGTTTACGAAGGTTTTACGTTTTCCCGTATCCCTTTCGTTTTCATCCAGTCTTTGACAATCTTGCACCCAGGTGGTGAACGGGCTGTACGCTGTCCAGATGTGAAAGGTCACACTGTCAGGGAGCTCAATCTCTTCACCGGATGACGAAAACCAGAGAATGCCATCACGGGTCCAGATCCCGGTCTTTCGCAGATATAACGGGCATCAGTAAAGTCCAGCTCCTGCTGGCGGATGACGCAGGCATTATGCTCGCAGAGATAAAACACGCTGGAGGGGTCATCCGGCGTCCATTTGAGGCCAAACGGCGTCTCTTTGTCGCCAAATTTAAGATACTGCTCCTCCCCCGCAATGCGGGCAGGCAACATGAAAACGCATAAAATGCGGGGATTCACTGGCTGCACGCTCAATCTGACAGGTGCCTCTCACTTTTGGCGTGGAGCCACGGATGGACTTTGGCCAGACCGAGCCTTCAATACGCTTGTTACCCAGGAACGTCGGAGAGCCTTCCTGTTCAATATCATCATCAAAAGCAGCAAGTTCATCATAACCCGCCACATCCACCGACTTTCACGGTAGTTTTGCCGCTTTACCGCCCAGGCAGCACCAGAAGCCACGCCCATTAGTGAACGCTTCATGGTGAGCGTGTTATCCCGGTGCTTTTGCCATACCACGGGGCCAGCGCCAGCAGCGACGGAATATCACGAATAGTCGGCTCAACGTGGGTTTTCATAAAGTTCTCGGCATCACCATCCGTCGGCAACCAGATAAGGGTGTGCGCTGCTTATGCTCTATAAAGTAGGCATAAACACCCAGCAGCATTTTGGAATAACCGACACGGCAGACTTCACCACATTCACCTCACGGATGTAGTCGCTGCCCATCGCATTCATGATGGCCCGCTGAAAGGGCAGTGTTTCCCAGCGCCCTTCCTGGTATGCGGATTCTTTTCGGGAGATAGTAATTAGCATCCGCCCATTCAACGGCGGTCTGTGGCTCCGGCCTGAACAGGAGCGAAGCCCGGCGCGGACAAAATGCCGCAGCCTGTTAACCTGACTGTTCGATATATTCACTCAGCAACCCCGGTATCAGTTCATCCAGCGCGGCTGCTTTGTTCATGGCTTTGATGATATCCCGTTTCAGGAAATCAACATGTCGGTTTTCCAGTTCCGGAAAACGCCGCTGCACCGACAGGGGAGCCGTCGAGAATACTGGCAATTTCACCTGCGATTGAGCGACAGCACGAAAGTACAGAATGCGGTTTCCACCACTTCAGCGGAGTCTCTGGCATTCTTCAGTTCCTGTGCGTCGGCCGGCGCACGCGTAAGTCGATGGCGTTCGTACTCAATAGTTCCTGGCTGGAGATCTGCCTCGCTGGCTGCTGCCGCAGTTCTTCAACCTCCCGGCGCAGCTTTTCGTTCTCAATTTCAGCATCCCTTCGGCATACCATTTTATGACGGCGCTGCAGAGTCATAAAGCACCTCATTACCCTGCCACCGCCTCGCAGAACGGGCATTCCCTGTTCCTGCCAGTTCTGAATGGTACGGATACTCGCACCGAAAATGTCAGCCAGCTGCTTTTGTTGACTTCCATTGTTCATTCCACGGACAAAACAGAGAAAGGAACGACAGAGGCCAAAAGCTCGCTTTCAGCAGCCCTGTCGTTTCCTTCTTTCAGAGGGTATTTTAAATAAAAACATTAAGTTATGACGAAGAAGAACGGAAACGCCTTAAACCGGAAAATTTTCATAAATAGCGAAAACCC