changeset 0:51fd3136069d draft

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit f6dd7c41a45584b478b8af48df5294e3c39f5203
author bgruening
date Mon, 11 Jun 2018 16:47:50 -0400
parents
children 4df02149a270
files macros.xml racon.xml test-data/consensus_result2.fasta test-data/sample_layout.fasta test-data/sample_overlaps.sam test-data/sample_reads.fasta
diffstat 6 files changed, 828 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Mon Jun 11 16:47:50 2018 -0400
@@ -0,0 +1,14 @@
+<macros>
+    <xml name="requirements">
+        <requirements>
+        <requirement type="package" version="1.3.1">racon</requirement>
+            <yield/>
+        </requirements>
+    </xml>
+    <xml name="citations">
+        <citations>
+            <citation type="doi">10.1101/gr.214270.116</citation>
+            <yield />
+        </citations>
+    </xml>
+</macros>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/racon.xml	Mon Jun 11 16:47:50 2018 -0400
@@ -0,0 +1,81 @@
+<tool id="racon" name="Racon" version="1.3.1">
+    <description>Consensus module for raw de novo DNA assembly of long uncorrected reads.</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements" />
+    <version_command>racon --version</version_command>
+    <command detect_errors="exit_code"><![CDATA[
+        ln -s '$reads' reads.${reads.ext} && 
+        ln -s '$overlaps' overlaps.${overlaps.ext} && 
+        ln -s '$corrected_reads' corrected_reads.${corrected_reads.ext} && 
+
+        racon 
+            reads.${reads.ext}  
+            overlaps.${overlaps.ext}  
+            corrected_reads.${corrected_reads.ext}
+            -t \${GALAXY_SLOTS:-4} 
+            $u
+            $f
+            -w $w
+            -q $q
+            -e $e
+            -m $m
+            -x $x
+            -g $g
+            > racon_polished_consensus.fa  
+    ]]></command>
+    <inputs>
+        <param type="data" name="reads" format="fasta,fasta.gz,fastq,fastq.gz" label="Sequences"/>
+        <param type="data" name="overlaps" format="sam" label="Overlaps"/>
+        <param type="data" name="corrected_reads" format="fasta,fasta.gz,fastq,fastq.gz" label="Target sequences"/>
+
+        <param argument="-u" type="boolean" truevalue="-u" falsevalue="" label="output unpolished target sequences" />
+        <param argument="-f" type="boolean" truevalue="-f" falsevalue="" label="perform fragment correction instead of contig polishing" />
+        <param argument="-w" type="integer" value="500" label="Size of window on which POA is performed" />
+        <param argument="-q" type="float" value="10.0" label="Threshold for average base quality of windows used in poa" />
+        <param argument="-e" type="float" value="0.3" label="Maximum allowed error rate used for filtering overlaps" />
+        <param argument="-m" type="integer" value="5" label="Score for matching bases" />
+        <param argument="-x" type="integer" value="-4" label="Score for mismatching bases" />
+        <param argument="-g" type="integer" value="-8" max="0" label="Gap penalty" />        
+        
+    </inputs>
+    <outputs>
+        <data name="consensus" format="fasta" from_work_dir="racon_polished_consensus.fa" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="reads" ftype="fasta" value="sample_reads.fasta"/>
+            <param name="overlaps" ftype="sam" value="sample_overlaps.sam"/>
+            <param name="corrected_reads" ftype="fasta" value="sample_layout.fasta"/>
+            <param name="u" value="true"/>
+            <param name="f" value="true"/>
+            <param name="w" value="800"/>
+            <param name="e" value="0.2"/>
+            <output name="consensus" ftype="fasta" file="consensus_result2.fasta"/>
+        </test>
+    </tests>
+    <help><![CDATA[
+
+**What it does**
+
+Consensus module for raw de novo DNA assembly of long uncorrected reads.
+
+Racon is intended as a standalone consensus module to correct raw contigs generated by rapid assembly methods
+which do not include a consensus step. The goal of Racon is to generate genomic consensus which is of similar
+or better quality compared to the output generated by assembly methods which employ both error correction
+and consensus steps, while providing a speedup of several times compared to those methods.
+It supports data produced by both Pacific Biosciences and Oxford Nanopore Technologies.
+
+Racon can be used as a polishing tool after the assembly with either Illumina data or data
+produced by third generation of sequencing. The type of data inputed is automatically detected.
+
+Racon takes as input only three files: contigs in FASTA/FASTQ format, reads in FASTA/FASTQ
+format and overlaps/alignments between the reads and the contigs in SAM format. Output is a set of polished contigs in FASTA format printed to stdout.
+
+Racon can also be used as a read error-correction tool. In this scenario, the SAM file needs
+to contain pairwise overlaps between reads including dual overlaps.
+
+    ]]></help>
+    <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/consensus_result2.fasta	Mon Jun 11 16:47:50 2018 -0400
@@ -0,0 +1,2 @@
+>utg000001lr LN:i:46960 RC:i:200 XC:f:1.000000
+ATGATTATCATCTACATATCACAACGTGCGTGGAGGCCATCAAACCACGTCAAATAATCAATTATGACGCAGGTATCGTATTAATTGATCTGCATCAACTTAACGTAAAAACAACTTCAGACAATACAAATCAGCGACACTGAATACGGGGCAACCTCATGTCAACGAAGAACAGAACCCGCAGAACAACAACCCGCAACATCCGCTTTTCTAACCAAATGATTGAACAAATTAACATCGCTCTTGAGCAAAGGGGTCGGGAATTTCTCAGCCTGGGTCATTGAAGCCTGCCGTCGGAGACTAACGTCAGAAAGAGAGCATATACATCAATTAAAGTGATGAAGAATGAACATCCCGCGTTCTTCCCTCCGAACAGGACGATATTGTAAATTCACTTAATTACGAGGGCATTGCAGTAATTGAGTTGCAGTTTTACCACTTTCCTGACAGTGACAGACTGCGTGTTGGCTCTGTCACAGACTAAATAGTTTGAATGATTAGCAGTTATGGTGATCAGTCAACCACCAGGGAATAATCCTTCATATTATTATCGTGCTTCACCAACGCTGCCTCAATTGCTCTGAATGCTTCCAGAGACACCTTATGTTCTATACATGCAATTACAACATCAGGGTAACTCATAGAAATGGTGCTATTAAGCATATTTTTACACGAATCAGATCCACGGAGGGATCATCAGCAGATTGTTCTTTATTCATTTTGTCGCTCCATGCGCTTGCTCTTCATCTAGCGGTTAAAATATTACTTCAAATCTTTCTGTATGAAGATTTGAGCACGTTGGCCTTACATACATCTGTCGGTTGTATTTCCCTCCAGAATGCCAGCAGGACCGCACTTTGTTACGCAACCAATACTATTAAGTGAAAACATTCCTAATATTTGACATAAATCATCAACAAAACACAAGGAGGTCAGACCAGATTGAAACGATAAAACGATAATGCAAACTACGCGCCCTCGTATCACATGGAAGGTTTTACCAATGGCTCAGGTTGCCATTTTAAAGAAATATTCGATCAAGTGCGAAAAGATTTAGACTGTGAATTGTTTTATTCTGAACTAAAACGTCACAACGTCTCACATTATATTTACTATCTAGCCACAGATAATATTCACATCGTGTTAGAAAACGATAACACCGTGTTAATAAAAAGGACTTAAAAAGGTTGTAAATGTTAAATTCTCAAGAAACACGCATCTTATAGAAACGTCCTATGATAGGTTGAAATCAAGAGAAATCACATTTCAGCAATACAGGGAAAATCTTGCTAAAGCAGGAGTTTTCCGATGGGGTTACAAATATCCATGAACATAAAGATATTACTATACCTTTGATAATTCATTACTATTTACTGAGAGCATTCAGAACACTACACAAATCTTTCCACGCTAAATCATAACGTCCGGTTTCTTCCGTGTCAGCACCGGGGCGTTGGCATAATGCAATATACGTGTACGCGCTAAACCCTGTGTGCATCGTTTTAATTATTCCCGGACACTCCCGCAGAGAAGTTCCCCGTCAGGGCTGTGGACATAGTTAATCCGGGAATACAATGACGATTCATCGCACCTGACATACATTAATAAATATTAACAATATGAAATTTCAACTCATTGTTTAGGGTTTGTTTAATTTTCTACACATACGATTCTGCGAACTTCAAAGCATCGGGAATAACACCATGAAAAATGCCTACTCGCTACTGCGCTGGCCCTGCTTATTACAGGATGTGCTCAACAGACGTTTACTGTTCAAACAAAACCGGCAGCAGTAGCACCAAAGGAAACCATCACCCATCATTTCTTCGTTTCTGGAATTGGGCAGAAGAAAACTGTCGATGCAGCCAAATTTGTGGCGGCGCAGAAAATGTTGTTAAAACAGAAACCCAGCAAACATTCGTAAATGGATTGCTCGGTTTTATTACTTTAGGCATTTATACTCCGCTGGAAGCGCGTGTATTGCTCACAATAATTGCATGAGTTGCCCATCGATATGGGCAACTCTATCTGCACTGCTCATTAATATACTTCTGGGTTCCTTCCAGTTGTTTTGCATAGTGATCAGCCTCTCTCTGAGGGTGAAATAATCCCGTTCAGCTCTGTCTGCCAGTCGGGGGAGGCTGCATTATCCACGCCGGAGGCGGTGCTTGGCTTCACGCACTGACTGAGACTGCTTTGATGTGCAACCGACGACGACGACCAGCGGCAACATCATCACGCAGAGCAGAGCATTTTCAGCTTTAGCATCAGCTAACTCCTTCGTGTATTTTGCATCGAGAGCAGCAGCAACATCACGCTGACGCATCTGCATGTCAGTAATTGCCGCGTTCGCCAGCTTCAGTTCTCTGGCATTTTGTCGCGCTGGGCTTTGTAGGTAATGGCGTTATCACGGTAATGATTAACAGCCCATGACAGGCAGACGATGATGCAGATAACCAGAGCGGAGATCGCGGTCGCGGTGACTCTGCTCATACATCAATCTCTCTGACCGTTCCGCCCGCTTCTTTGAATTTGCAATCAGGCTGTCAGCCTTATGCTCGAACTGACCAGACCAGCGCCCGGCAGTGAAGCCCAGATATTGCTGCAACGGTCGATTGCCTGACGGATATCACCACGATCAATCATAGGTAAAGCGCCACGCTCCTTAATCTGCTGCAATGCCACAGCGTCCTGACTTTCGGAGAGAAGTCTTTCAGGCCAAGCTGCTTGCGGTAGGCATCCCACCAACGGGAAAGAAGCTGGTAGCGTCCGGCGCCTGTTGATTTGAGTTTTGGGTTTAGCGTGACAAGTTTGCGAGGGATGATCGGAGTAATCAGTAAATAGCTCTCCGCCTACAATGACGTCATAACCATGATTTCTGGTTTTCTGACGTTATCAGTTCCCTCCGACCACGCCAGCATATCGAGGAACGCCTTACGTTGATTATTGATTTCTACCATCTTCTACTCCGGCTTTTTTAGCAGCGAAGCGTTTGATAAGCGAACCAATCGAGTCAGTACCGATGTAGCCGATAAACACGCTCGTTATAAGCGAGATTGCTACTTAGTCCGGCGAAGTCGAGAAGGTCACGAATGAACTAGGCGATAATGGCGCACATCGTTGCGTCGATTACTGTTTTGTAAACGCACCGCCATTATATCTGCCGCGAAGGTACGCCATTGCAAACGCAAGGATTGCCCCGATGCCTTGTTCCTTTGCCGCGAGAATGGCGGCCAACAGGTCATGTTTTCTGGCATCTTCATGTCTTACCCCCAATAAGGGGATTTGCTCTATTTAATTAGGAATAAGGTCGATTACTGATAGAACAAATCCAGGCTACTGTGTTTAGTAATCAGATTTGTTCGTGACCGATATGCACGGGCAAAACGGCAGGAGGAGTGTTAGCGCGACCTCCTGCCACGCGGATTTCACGAAGGTCATGTGTAAAAGGCCGCAGCGTAACTATTACTAATGAATTCAGGACAGACAGTGGCTACGGCTCAGTTTGGGTTGTGCTGTTGCTGGGCGGCGATGACGCCTGTACGCATTTGGTGATCCGGTTCTGCTTCCGGTATTCGCTTAATTCATTCAGCACAACGGAAAGAGCACGACCTGGCTAACCAGGCTCGCCGACTCTTCACGATTATCGACTCAATGCTCTTACCTGTTGTGCAGATATAAAAATCCCGAAACCGTTATGCAGGCTCTAACTATTACCTGCGAACTGTTTCGGGATTGCATTTTGCAGACCTCTGCCTGCGATGGTTGGAGTTCCAGACGATACGTCGAAGTACCAACTAGGCGGAATCGGTAGTAAGCGCCGCCTCTTTCATCTCACTACACAACGAGCGAATTAACCCATCGTTGAGTCAAATTTACCCAATTTTATTCAATAAGTCAATATCATGCCGTTAATATGTTGCCATCCGTGGCAATCATGCTGCTAACGTGTGACCGCATTCAAAATGTTGTCTGCGATTGACTCTTCTTTGTGGCATTGCACCAGAGCGTCATACAGCGGCTTAACAGTGCGTGACCAGGTGGGTTGGGTAAGGTTTGGGATTAGCATCGTCACAGCGCGATATGCTGCGCTTGCTGGCATCCTTGAATAGCCGACGCCTTTGCATCTTCCGCACTCTTTCTCGACAACTCTCCCCCACAGCTCTGTTTGGCAATATCAACCGCACGGCCTGTACCATGGCAATCTCTGCATCTTGCCCCGGCGTCGCGCGGCACTACGGCAATAATCCGCATAAGCGAATGTTGCGAGCACTTGCAGTACCTTTGCCTTAGTATTTCCTTCAAGCTTTGCACACCACGGTATTTCCCCGATACCTTGTGTGCAAATTGCATCAGATAGTTGATAGCCTTTTGTTTGTCGTTCTGGCTGAGTTCGTGCTTACCGCAGAATGCAGCCATACCGAATCCGGCTTGTGATTGCGCCATCCCCATAGCAGCCATCACATCAGTACCGGAAAGAGTCAGAAGCCGTGGCCCGTGGTGAGTCGCTCATCATCGGGCTTTTGGCGAATGAAATTTAGCTACGCTTTCGAGTCTCATGCGCCTTCTCCCTGTACCTGAATCAATGTTAGGTTTCCGCAGAACACTGCGCCGGTATCGATATACATTTGGTTGGCAAACTTGAGTGGTTTCACTGCTGGCGTATGACCAAAGATGAACGTGTCCGCGCCTTTGATTTCTTTCACGATCCCGTTTGTGAGTTGCTGATTCGTTCGCGGTTCCAGATTACCTGCTGATGATGAACTGGCTTTCCAAACTCGTATTCGTCAAAGGGATAATCGGCGTGGCAGATAACATATTTTATCTTTGCTCACCAGTTCGATGATTAACGGAAGTTCATCTGCTTTATGGGCAAGAGCTTTAGCCAGAATTTCTTTGTCGTAATCGAGATTAAAGAACCAGCCACCGCCATTAAGCAGCCAGTGATTAACGTTTCCACGCTCTGATAAGCCATCAATCATCATTTGCTCATGGTTTCCACGTACAGCTCTGAACCAGGGGAATGTGATTAATTCCAGGCATTCAACGTTCTCTGCACCACGATCAACCAAATCGCCCACCGAGATAAGCAGGTCTTTTGTTGTCGAATCCAATCGTATCCAGTTTGTTCATCAGGTTCGTGTAGCATCCGTGCAGATCGCCAACTACCAAATATTTCGGTATTTGCTGCCATCAATTTTTCGTAATAGCGCATCTCTTTCACTCCATCCGCGATGAACCATGAGAACGTCGTTGACGATGGCGTGCATTTTCCCGTCTTTATCATCAACGTATTTTCTGACGTACCGCGACCCATTTCAGTCTGCGTGCTACTTCTGTCTGATTTCCGTATGTTTCAACGAGCATGTCTGGAATGGTTTTACTGAGAACGTCATGCGGCCTCACTTCTGCTATTTCGCAGGTCTTTGAGTTTCTGTTGGTACTCTGCCTTGATCGCCTTGCACTCTTCGATAGTCCAGCGATGGCGGTTATGGTTTGATTCGATTTCGTCTACTGCTTCCTGCCCGATGCGGCTAATCAGTTCGACGCGATACGGAACGAGATTTCCGCTTTGTGCTGGTTGCACACACGCATTGCTTGTGAATATTGCGTTCATTAAATCGGAGTTGAGGTGCCGCAGCAGTTGTCCGGTAATGTCCGGCATCCCACTGAGCAGACGTGAGCGTTCCGCACGAGATACATGGTAAGTCGCGGTCTCTTTCTGATGAAGGCGTTTACGGCTTGTTGGGCTTGTTTAATCCAGTAACTGCGGGGCTTTAAGGCGAGTTTTCGAATCTTAAGTTTATCTTTCTGTTTCTGCTCCTCGTCGTCGTTTCTTCTCTGCTGCTTTTCCCTTTTCGCGTTCTTTACTTCGTCGTTCGAGTGCTATCTTGGTTCCACTCTGGAGAGCACCACCACTGATTAGCGAATGCAGGGTGAAACCATTCCCGGCATTCATCGTTTTACATCGTCTTCGCGCTGGTTTAGCCATCATCTTCTTCCTCGTGCATCGAGCTATTCGGATCGCTCATCAGTTCTGCGCAGCAGTGCTCACACACGTGAACTTCCAGCACATGCAGCTTCTGACCGCAGTTAGCGCACGTTAAAGCTCGCTCGACGCTTTCTTGTTCGTAACTTCGATTTTGGTCAATCACCTTGTTTTCCTCGCACGACGTCTTAGCCACCGGATATCCCACAGGTGAGCCGTGTAGTTGAAGGTTTTACGTCAGATTCTTTTGGGATTGGCTTGGGTTTATTTCTGGTGCGTTTCGTTGGAAGGTATTTGCAGTTTTCGCAGATTATGTCGGTGATACTTCGTCGCTGTCTCGCCACACGTCCTCCTTTCCTGCGGTAGTGGTAACACCCCTGTTGGTGTTCTTTCACACCGGAGACACCATCGATTCCAGTAAGGTTTGATTTGGTCGGAAGCGGTTATCTTCTTTGCATTCACCGCACCGATAACATCGCATCATGCAGCTTCCCTCCCGAAGTCGAAATCAAGCTGCCCTCCAAATATTTCGCATGACTCAGAACAAGAGCCGGTATCGAATCTTTTAGCTCGTACCATGTCCTGATACAGGGCTTGATAATCATTTTCTGAATACATTTTCGCGATACCGTCCAGCGACATTCTTCCTCGGTACATAATCTCCTTTGGCGTTTCCCGATGTCCGTCACGCACATGGGATCCCGTGATGACCTCATTAAAACACGCTGCAATCCCTCCTCATCTTTGCAGGCAAGTCCGATTTTGCGTTGATTTTTAATGCAGAATATGCAGTTACCGAGATGTTCCGGTATTTGCAAATCGAATGGTTGTTGCTTCCACCATGCGAGGAGTATCTTCCTTCTCAAAGTCTGACAGTTCAGCAAGATATCTGATTCCAGGCGTTTTGGCTTTAGCCGCTTCGGTTCATCAGCTCTGATGCCAATCCACGTGGTGTAATTCCCTCGCCCGAAATGGTCATCACAGTATTTGGTGAAGGGAACGAGTTTTAATCTGTCAGTGCAGAACGCGCCGCCGACGTATGGAGTGCCATATTTCTTTACCATATCGATAAATGGCTTCAGAACAGGCATTCGCGTCTGAATATCCTTTGGTTCCCATACCGTATAACCATTTGGCTGTCCAAGCTCCGGGTTGATATCAACCTGCAATACGGTGAGCGGTATATCTCAGAACTTCACAACTTCCCTGACAAACCGATATGTCATTGGATGTTCACAACCTGTATCCATGAAAACGTAATGCACGTCTTTACCTGCCCGTCGCTTTGCTCCATTAGCCAGAGCAAATATGCTGACGTCCTGCCACCGGAGAAACTAACGACATTTATCATGCAGCCCTGTCTCCCCATCTCGCTTTCCACTCCAGAGCCAGTCTCGCTTCGTCTGACCACTTAACGCCACGCTCTGTACCGAATGCCTGTATAAGCTCTAATAGCTCCGCAAATTCGCCTACACGCATCCTGCTGGTTGACTGGCCTTATTACAAAGCCATTCCCGGCAAGGTTAGGAACAACATCCTGCTGCTTTAATGCTGCGGTAAACACACTTCCAGCTTTCTGCATCCAGCCAGCGACCATGCCATTCAACCTGACGGAGACGTCACCTAAGCAGGCCCATAGCTTCCTGTTTTGGTCTAAGCTGCGGTTGCGTTCCTGAATGGTTACTACGATTGGTTTGGTTGGGTCTGGAAGGATTTGCTGTACTGCGTGAATAGCGTTTTGCTGATGTGCTGGAGATCGAATTTCAAAGGTTAGTTTTTCATGACTTCCCTCTCCCCCAAATAAAGGCCTGCGATTACCAGCAGGCTTGTTATTAGCTCAGTAATGTAGATGGTCATCTTTTAACTCCATATACCGCCAATACCCGTTTCATCGCGGCACTCTGGCGACATCTCCTTAAAACCAGGTTCGTGCTCATCTTTCCTTCCCGTTCTTCCCTCAGCAAACCGGTAATACACCGTTCAGACCTTCCTTCGATAACCAGAAGACCTGCCCGTGCCATTTTAGCCGCGGCCTGATTTATGCTGGTTACTGTTGCGCCTGTTAGCGGCAACGTCCGGCGCACAGAAGCTATTATGCGTCCCCAGGTAATGAATAATTGCCTCTTTGCCCGTCATACATTGCTCCTTTCAGTCCGAACTTAGCTTTGATTTCTGCGATCTTCGCCAGAGCCTGTGCACGATTTAGAGGTCTACCGCCCATGACAGGAAGTTGTTTTACTGGTTCAGGGATCGCCTCACCACGGTTAATTCTCGCAGTCATATGGACAAGCTCATCTGCGGCCTTAAGCGTAATTCGCATCAGTAACCGCATTGGCCCGCATGTTCTGACCAGGTGTGGTAACCAGCCAGTAGTGCGCGTTTGATTTCCACGGATAAGACTCCGCATCCGGATACAGGCCTCGCTTCCGGCAATACTCGTAAACCATATCAACCAGCTCGCTGACGTTTGGCAGTCCGGCGGTAACGGATGCTTCTTCCCGGCACCATGCAACAAACTGCCGGGGTGATGGCAGAAATAGTCGATTCTCGAATGATGCTCGACGGGCTACGCGCATTCCTGCGTTAACCTGTTCCATCGTGGTGATCCCGTTTCCCCGAAAAGCCAGAACCCACTGGCGACGGATTTCGGTTCACTTCGTTCTGGTCACGGTTAGCCAGGCTCGCCGGGAAAGTTGCCAGTAACTGGCTGAACACACCGTTGATGATCTGCGCTACCTGCTGTACCTGCGGCTTTCGTCGTACTGTTCCGGCATGTTGTTGGCGATCCGACGCATCTGCTCACGTCAAAGTTAACCATCTGTGCGGCGATGTTTCATAGTATCCACCCCGTAAATCCAGTCTGTGTTTGTCAGGTCGAGTTTTGGTTTGCTGGCTGTCACGCCTGCCTGTTGCTTGTTACGGTTGATTTCGAGTTGGGTCCACTTATCGCGGAGTTTGGCCGGGCCAGCACGTTACCCGACCAGAAGTTGTTCCTGGCATGCCCAGCGGAACAGCACACATGTCGCGGTGGTTACGTCCGTCACGTTCACGCATCAGGCGGATATCGTTAGCCCACCCAGCAAAATTCGGTTTTCTGGCTGATGGTGCTGCGATAGTCTTCACCATGTCAAACATCCACTCTGCGGCGGTCAGGTCTTCTGTTCCCCACTTGCTGCCGCTCTGAATTGCAGCATCCGTTTTGCCACAGAAAGGTCGTTTTCTGGCTGGTCAGGATTCGCCAGAATTCTGACGTGGAATAATCTTTCTTTTCTTTGTATAGTGTCTTTTGTGTCCCTGTTTGAGGGATAGCAATCCCCAATTTGAGGGATGTTTTATCCCTCGTTTAGGGATTTTCCTCGTTTGAGGGATGCACCATTCTGAGATGTTTTATTTGGTACAAACATGCCGCCTTGCTGCTTGATAATATTCATTCTGACGAGTTCTAACTTGGCTTCATTGCACCGTTTGACAGGTAACTTTGTAATCTCGCTAAGTTGAGAATCGGTGATTCTGTCCATTGGTTTATTCCACCCATAGGTTTTACGCAGAATGGCAAGCAGCAGCACTTTAAACTGTCTGCTTGGTCAGATCTGCCCGAATAAGCCTCAAGCAGCAGCATATTTGATAGTCTGGCGTAACCATCATCGAGATCTGCCACATTACGCTCCTGTCCGGCAAATTACCTCTGCCGAAGTTGAGTATTTTGCTGTATTTGTCATAATGACTCCTGTTGATAGATGAGGGTAATAACCTCAGAACTCCATCTGGATTTGTTCAGAACGCTCGGTTGCCGCCGGGCGTTTTATTGGTGAGAATCGCAGCAACTTGTCGCGCCAATCGAGCCATGTCGTCGTCAACGACCCCCATTCAAGAACAGCAAGCAGCATTGAGAACTTTGGAATCCAGTCCCTCTTCCACCTGCTGATCTGCGACTTATCAACGCCCACAGCTTCCCTGTCTTCTCAGTTCCAAGCATTGCGATTTGTTAAGCAACGCACTCGATTCGTAGAGCCTCGTTGCGTTTGTTTGCACGAACCATATGTAAGTATTTCCTTAGATAACAATTGATTGAATGTATGCAAATAAATGCATACCATAGTGTGGTTTAATTTGATGCCCTTTTCAGGGCTGGAATGTGTAGAGCGGGGTTATTTATGCTGTTTTTTGTTACTCGGGAAGGCTTTACTCTTCCGCATAAACGCTTCCATCAGCGTTTATAGTTAAAATCTTTCGGCCTGCATGAATGGCCTTGTTGATCGCGCTTTGATACGCCGAGATCTTTAGCTGTCTTGGTTTGCCCCAAAGCGCATTGCATAATCTTTCAGGGTATGCGTTGTTCCATACAACCTCCTTAGTACATGCAACCATACATGCCATAGTAAAATAGTCAACACGCACGGTGTTAGATATTTATCCCTTGCGGCAGGAGTTAACGTATGAGCACAAAAGAAACCATTAACAAGAGAGCAGCTTGAGGACGCACGTCGCCTTAAAGCAATTTATGAAAGAAAATGAACTTGGCTTATCCCAGGAATCTGTCGCAGACAAGATGGGGATGGGGCAGTCAGGCGTTGGTGCTTTATTTAATGGCATCAATGCATTAAATGCTGTAACGCCGCATTGCTTACAAATTCTCAAAGTTAGCGTTGAAGAATTTAGCCCTTCAATCGCCAGAGAAATCTACGAGATGTATGAAGCGGTTAGTATGCAGCCGTCACTTAGAAGTGAGTATGAGTACCCTGTTTTTCTCATGTTCAGCAGGATGTTCTCACTAAGCTTAGAACCTTTACCAAAGGTGATGCGGAGATGGGTAAGCACACAACAAAGCCAGTGATTCTGCATTCTGGCTTGAGGTTGAAGGTAATTCCATGACCGCACCAACAGGCTCCAAGCCAAGCTTTCCTGACGGAATGTTAATTCTCGTTGACCCTGAGCAGGGCTGTTGAGCCAGGTGATTTCTGCATAGCCAGACTTGGGGGTGATGGAGATTTACCTTCAAGAAACTGATCAGGATAGCGGTCAGGTGTTTTACAACCACTAAACCCACAGTACCCAATGATCCCATGCAATGAGAGTGTTCCGTTGTGCTGGGAAAGTCTCTAGTCAGTGGCCTGAAGAGACGTTTGGCTGATCGGCAAGGTGTTCTGGTCTGGCGCATAGCTGATAACAATTGAGCAAGAATCTTCATCGAATTAGGGAATTTTCACTCTCCCTCAGAACATAACATAGTAAATGGATTGAATTATGAAGAATGGTTTTTATGCGACTTACCGCAGCAAAATAAAGGAAAGATAAGGCTCAATAAACCTGTCTGTTTTCCTTAATTCTCTTGGCTGATCATCACCTGCATGAGTTTGCTCCAATTATTTGTATTCATAAAATCGATGGAAAAACTTTTCTCTTTACCAAACAAATGACAAGAGTCTGGTTCAGAAGATAAATCGCTCTAAAGCTTCAGTTGAAGATAGCAGAACAGCCTCGCAGATGACGAATCATTGGGATTCCCATCTTTTTGTTGAAAGGCGACACCATTGGTTTTGCCAGAACTGTTCGGGCCGACCACATCCGATCTGACAGATTTTAATCGGGAAAGGAATGTCATTAAGCAGTGGAGAGCGCGTTCAGATAGAGCCACTGATGAGGGAATCACCAAAGACGATGTTATGCATATGCATTTCATCGGCCGAACAACGGTGAAGGTAGAAGCCAAGCTACCTGTATTTGGCGATATATTAAAGGTCTTAGGGCAACAGATATTGAAGGGGAGCTTTTGACTCATTGGATATAGTCATTAAGCCAAAATTTAAAGGGATATAAAAGGTTGCCAAGGATATTATTTTAACCCGTCACCTCAATTTTCAGACATTAGCCCTGCGGCAAAAGATGAGGCCGGAGATATTTTAACAGAACATTATCTATCAGAAAAGGCCATCTCTCAGCGCTCTGAACAGTACAATGCTGAGATAGCTGAAGAGATGAGCATAAGATGCTACGCAAGAATGAAAGTGATATACTGGAATGCTTTTAAAGGCAGGTGGGCAAAAGTAAGGATTAATTATCAGGAGTAATTATGCGGAACAGAATCATGCCTGGTGTTTACATAGTAATAATTCCTTACGTTATCGTAAGCATTTGCTATCTCCTTTCCCACTACATTCCTGGTGTTTCTTTTCAGCTCATAGAGATGGTCTTGGGGCGACATTGTCATCATATGCAGGAACCATGATTGCAATCCTGATTGCTGCCTTGACGTTTCTAATCGGAAGCAGAACGCGCCGACTGGCCAAGATTAGAGTATGGGTATATGACATCGGTAGTTATTGTCTATGCCCTTAGTTTTGTTGAGCTTGGAGCTTTGTTTTTCTGCGGGTTATTGCTTCTTTCCAGCATAAGCGGCTACATGATACCCACATCTCCATCGGCATTGCCTCTGCATCGTTCATTCATATGCATCCTTGTTTTCCGACTATAATTTGACAGAGAAAATAAAAGCCTCACCGGCCTCATTCGCCGTATTTCCTTGCCTCACGATCGCCCCCAAAACACATAACCAATTGTATTTATTGAAAATAAATAGATACAACTCACTAAACATAGCAATTCAGATCTCTCACCTACCAAACAATGCCCCCTTGCAAAAATAAATTCATAAACATACAGATAACCATCTTGCGGTGATAAATTATCTCTGGCGGTGTTGACATAAATACCACTGGCGGTGATACTGAGCACATCAGCAGCAGGACGGACTGACCACCATGAAGGTGACGCTCTTAAAATTAAGCCCTGAAGAAGGGCAGCATTCAAAGCAGAAGGCTTTGGGTGTGTGATACGAAACGAAGCATTGGCCGTAATGTGCGATTCCGGATTAGCTGCCAATGTGCATGTAGCTGGAAGCGGGGTTTTCGTTCAGGACTACAACTGCCACACACCCAAAGCGACTGACAGGAGAATCCAGATGGATGCACACAAACACGCCGCCGCGAACGTCGCGCAGAGAAACAGGCTCAATGGAAAGCAGCAAATCCCTGTTGGTTGGGGTAAGCGCAAAACCAGTTAACCGCCTATTCTCGCTGCTGAATCGCAAACCGAAATCACGAGTAGAAAGCGCACTAAATCCGATAGACCTTACAGTGCTGGCTGAATACCACAAACAGATTGAAAGCAACCTGCAACGTATTGAGCGCAAGAATCAGCGCACATGGTACAGCAAGCCTGGCGAACGCGGCATAACATGCAGTGGACGCCAGAAAATTAAGGAAAATCGATTCCTCTTATCTAGTTACTTAGATATTGGCCTTGGCTTTATCTCAATATTATGGATCATAGCTGGCAACTAATTCAGTCCAGTAAATATCCTCAATAGGGAATAATATGCTTTCCATTCCATCGGGAAAAGTTTGTTCAACACACCAAGCTCAATCAACTCACTAATGTATGGGAATTGTTTTGATGTAACCACATACTTCCTGCCTTCATTAAGGGCTGCGCACAAACCATAGATTGCTCTTCTGTAAGGTTTTGAATTACTGATCGCATTTATCGTTTTGCATCTTAATGCGTTTTCTTAGCTTAAATCCCCTTATATCTGGCGCTGGCAATAGCTGATAATCGATGCACATTAATTGCTAGCGAAAATGCAAGAGCAAAGACGACGAACATGCCACATGAGGAATACCGATTCTCATTAACATATTCAGGCCAGTTATCTGGGCTTAAAGCAGAAGTCCACACCAGATAACGATCATATACATGGTTCTCTCCAGAGGTTCATTACTGAACACTCGTCCGAGAATAACGAGTGGATCCATTTCTATACTCATCAAACTGTAGGGGTTGTAATAGTTTATCCGATTTCTCGCTGTAGGGTAACACGAGAACCACGAGAAGCCTGATGTGGTTAAAAGACAGGCACAATCTTTACTACCGCAATCCACTATTTAAGGTGATATATGGAAGAAGAATTTGAAGAGTTCGAAGAGCATCCTCAGGATGTGATGGAACAATACCAGGACTATCCGTATGACTACGACTATTGATAAAATCAATGGTGTGGACAATTCAAGCGATGCAATGGATGCAAGCTGCAATCGGAATGCATGGTTAAGCCTGAAGAAATGTTTCCTGTAATGGAAGATGGGAAATATGTCGATAAATGGGCAATACGAACGACGGCAATGATTGCCAGAGAACTTGGTAAACAGAACAACAAAGCTGCCTGATAGTGGCCTTTATTTTGGCATAAATAACAGAATAAACACTGCACTGTGTATTCATTCCAACGAGTGAATACACGGAGCAATGTCGCTCGTAACTAAACAGGAGCCGACTTGTTCTGATTATTGGAAATCTTCTTTGCCCTCCAGTGTGAGGCGATTTTATCTGTGAGGATATGAACAGATGTCAAACATCAAAATACATCATTGATTACGACTGGAAAGCATCAATAGAAATTGAAATCGACCATGACGTAATGACAGAGGAAAAACTTCACCAGATTAATAATTTCTGGTCAGACTCTGAATACCGACTCAATAAACACGGCTCTGTATTAAATGCTGTATTAATCATGCTGGCGCAACATGCTCTGCTTATAGCAATTTCAAGCGACTTAAATGCATATGGTGTTGTGTGTGGATTCGACTGGAATGATGGAAATGGTCAGGAAGGATGGCCTCCAATGGATGTAGCGAAGGAATAAGAATTACCGATATCGATACATCAGGAATATTTGATTCAGATGATATGACTATCAAGGCCGCCTGAGTGCGGTTTTACCGCATACCAATAACGCTTCACTCGAGGCGTTTTTCGTTATGTATAAATAAGGAGAGCACCATGCAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGCCCTTCCGAATCTTTACTTGAACGAATCACCCGTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAGTCCCAAAGAATGGATCAAACACTTATGGCTATCCAGACTAAATTCACTATCGCCACTTTTATTGGCGATGAAAGATGTTTCGTGAAGCCGTCGACGCTTATAAAATGGATATTAATACTGAAACTGAGATAAGCAAAGCATTCACTAACCCCCTTTCCTGTTTTCCTAATCAGCCCGGCATTTCGCGGGCGATATTTCACAGCTATTTCAGGAGTTCAGCCATGAACGCTTATTACATTCAGGATCGTCTTGAGGCTCAGAGCTGGGCGCGTCTACCAGCAGCTCGCAGCTCCCGTGAAGAGAAAGAGGCAGAACTGGCAGACGACATGAAAAGGCCTGCCCAGCACCTGTTTGAATCGCATCGCTGCATCGATCATTTGCAACGCCACGGGGCCAGCAAAATCCATTACCCGTGCGTTTGATGACGATGTTGAGTTTCAGGAGCGCATGCAGAACACATCCGGTACTGGTTGAAACCATTGCTCACCACCAGGTTGATATTGATTCAGAGGTATAAACGAATGAGTACTGCACTCGCAACGCTGGCTGGGAAGCTGGCTGAACGTCGGCATGGATTCTGTCGACCCACAGGAACTGATCACCACTCTTCGCCAGACGGCATTTAAAGGTGATGCCAGCGATGCGCAGTTCATCGCATTACTGATCGTTGCCAACCAGTACGGCCTTAATCCGTGACGAAAGAAATTTACGCCTTTCCTGATAAGCAGAATGGCATCGTTCCGGTGGTGGGCGTTGATGGCTGGTCCCGCATCATCAATGAAAACCAGCAGTTTGATGGCATGGACTTTGAGCAGGACAATGAATCCTGTACATGCCGGATTTACCGCAAGGACCGTAATCATCCGATCTGCGTTACCGAATGGATGGATGAATGCCGCCGCGAACCATTCAAACTCGCGAAGGCAGAGAAATCACGGGGCCGTGGCAGTCGCATCCCAAACGGATGTTACGTCATAAAGCCATGATTCAGTGTGCCCGTCTGGCCTTCGGATTTGCTGGTATCTCTATGACAAGGATGAAGCCGAGCGCATTGTCGAAAATACTGCATACACTGCAGAACGTCAGCCGGAACGCGACATCACTCCGGTTAACGATGAAACCATGCAGGAGATTAACACTCTGCTGATCGCCCTGGATAAAACATGGGATGACGACTTATTGCCGCTCTGTTCCCAGATATTTCGCCGCGACATTCGTGCATCGTCAGAACTGACACAGGGCCGAAGCAGTAAAAGCTCTTGGATTCCTGAAACAGAAAGCCGCAGAGCAGAAGGGGCAGCATGACACCGGACATTATCCTGCAGCGTACCGGGATCGATGTGAGAGCTGTCGAACAGGGGATGATGCGTGGCACAAATTACGGCTCGGCGTCGTCACATCGCCCGCTTCAGAAGTTCACAACGTGATAGCAAAAACCCGCTCTCGGAAAGAAGTGGCCTGACATGAAAATGTCCTACTTCCACACGCTTGCTTGCTGAGGTTTTGCACCGGTGTGGCTCCGGAAGTTAACGCTAAAGCACTGGCTGGGGAAAACAGTACGAGAACGACGCCAGAACCCTGTTTGAATTCACTTCCGGCGTGAATGTTACTGAATCCCCGATCATCTATCGCGACGAAAGTATGCGTACCGCCTGCTCTCCCGATGGTTTATGCAGTGACGGCAACGGCCTTGAACTGAAATGCCCGTTTACCTCCCGGGATTTCATGAAGTTCCGGCTCGGTGGTTTCGAGGCCATAAAGTCAGCTTACATGGCCCAGGTGCAGTACAGCATGTGGGTGACGCGAAAATGCCTGGTACTTTGCCAACTATGACCCGCGTATGAAGCGTGAAGGCCTGCATTATGTCGTGATTGAGCGGGATGAAAGTACATACATGGAGTTTTGACGAGATCGTGCCGGAGTTCATCGAAAATGGACGAGGCACTGGCTGAAATTGGTTTTGTATTTGGGGAGCAATGGCGATGACGCATCCTCACGATAATATCGGGTAGGCGCAATCACTTTCGTCTACTCCGTTACAAAGCGAGGCTGGGTATTTCCCGGCCTTTCTGTTATCCGAAATCCACTGAAAGCACAGCGGCTGGCTGAGGAGATAAATAATAAACGAGGGGCTGTATGCACAAAGCATCTTCTGTTGAGTTAAGAACGAGTATCTCCAGATGGCACATAGCCTTGCTCAAATTGGAATCAGGTTTGTGCCAATACCAGTAGAGAACAGACGAAGAATTTCATACGTTAGCCGCATCCCTTTCACAAAAGCTGGAAATGATGGTGGCGAAAGCAGAAGCAGATGAGAAACCAGGTATGACAACCACGGAATGCATTTTCTGGCAGCGGGCTTCATATTCTGTGTGCTTATGCTTGCCGACATGGGACTTGTTCAATGACACCTCAGCAGGAAAGCCCCCTTCGCAGCATTGCCCGTCAGGCTAATTCTGAAATCAAAAAAGCCAGACAGCAGTTTCCGGATAAAAACGTCGATGACATTTGCCGTAGCGTACTGAAGAAGCACCGCGAAACGGTAACGCTGATGGGATTCACACCGACTCATTTAAGCCTGGCAATCGGCATGTTAAACGGCGTCTTTAAGGAACGATGAACATGAAAAGCAAATCATCAGGGAGCTACAGGCTCCTTTTATTATTCGCATTCACCTCAAGCGTATTAACCAACAGTTCAGGGATTAATGAAAGATGGCAGACATCATTGATTCAGCATCAGAAATAGAAGAATTACAGCGCAACACAGCAATAAAATTCCCGCCTGAACCACCAGGCTATATCTGCCACTCATTGTTGTCCTGTGTGGCGATCAGATAGATGAACGAAGACGCCTGGTCGTTCAGGGTTGTCGACTTGTGCAAGTTGCCAGGAGGATCTGGAACTTATCAGTAAACAGAGAGGTTCGAAGTGAGCGAAATTAACTCTCAGGCACTGCGTGAAGCGGCAGAGAGCAGGCAATGCATGACGACTGGGGATTTGACGCAGACCTTTCCATGAATTGGTAACACCATCGATTGTGCTGGAACTGCTGGATGAACGGGAAAGAAACCAGCAATACATCAAACGCCGCGACCAGGAGAACGAGGATATTGCGCGCTAACAGTAGGGAAACTGCGTGTTGAGCTTGAACAGCAAATCAAAAACTCAACGAGCAGCGTGAGTATTACGAAGGTGTTATCGGATGGGAGTAAGCGTATTGCTAACTGGAAAGCAACGAAGTCCGTGAAGACGGAAACCAGTTTCTTGTTGTTCGCCATCCTGGGAAGACTCCTGTTATCAAGCACTGCACTGGTACTGGAAGAGTTTCTGCGGCAGTTAATCGAACAAGACCCGTTAGTAACTATCGACATCATTACGCATCGCTATTACGGGGTTGGGGGTCAATGGGTTCAGGATGCAGACTGAGTATCTGCATATGATGTCTGACGCTGGCATTCGCATCAAAAGGAGAGTGAGATCGGTTTGTAAAGATAACGCTTGTGAAATGCTGAATTTCGCGTCGTCTTCACAGCGATGCCAGAGTCTGTAGTGTCAGATGATGACCGTACTCAAACATCGGGTTGAGTATTATCTTACTGTTTCTTTACATAAACATTGCTGATACCGTTTAGCTGAAACGACATACATTGCAAGGAGTTTATAAATGAGTATCAATGAGTTAGAGTCTGAGCAAAAAGATTGGGCGTTATCAATGTTGTGCAGATCCGCTTGTCTTGTCTCCATGCAGACATCACGAAGGTGTTTATGTAGATGAAGGTATAGATATAGAGTCGGCATACAAATATTCCATGAAGGTTTATAAGTCTAATGAAGACAAATCCCCATTCTGCAATGTGCGAGAAATGACTGATACCGTGCAAAATTATTATCACGAGTACGGTGGAAACGATACTTGCCTCTCTGTACAAAACATATATAGATGATTAAACCCAATATTACATAACAATCCTCGCACTCGCGGGGATTTATTTTATCTGAACTCGCTACGGCGGGTTTGTTTATGGAGATGATAAATGCACTTCCGAGTCACAGGAGAATGGAATGGAGAGCCATTCAACAGAGTTATCGAAGCGAGAACATCAACGACTGCTACGACCACTGGATGATATGGGCGCAGATAGCACATGCAGACGTAACCAATATTCGAATTGAAGAACTGAAAGAACACCAAGCCGCCTGATGGCTTTTCTTCTTGCGTAATTGCGGAGACTTTGCGATGTACTTGACACTTCAGGAGTGGAACGCACGCCAGCGACGTCCAAGAAGCCTTGAAACAGTTCGTCGATGGGTTCGGGAATGCAGGATATTCCCACCTCCGGTTAAGGATGGAAGAGAGTATCTGTTCCACGAATCAGCGGTAAAGGTTGACTTAAATCGACCAGTAACAGGTGGCCTTTGAAGAGGATCAGAAATGGGAAGAAGGCGAAGTCATGAGCGCCGGGATTTACCCCTAACCTTTATAAGAAACAATGGATATTACTGCTACAGGGACCCAAGGACGGGTAAAGAGTTTGGATTAGGCAGAGACAGGCGAATCGCAATCACTGAAGCTATACAGGCCAACATTGAGTTATTTTCAGGACACAACACAAGCCTCTGACAGCGAGAATCAACAGTGATAATTCCGTTACGTTACATTCATGGCTTGATCGCTACGAAAAATCCTGGCCAGCAGAGGAATCAAGCAGAAGACACTCATAAATTACATGAGCAAATTAAAGCAATAAGGAGGGGTCTGCCTGATGCTCCATTGAAGACATCACCACAAAGAAATTGCGGCAATGCTCAATGGATACATAGACGAGGGCAAGGCGGCGTCAGCCAAGTTAATCAGATCAACACTGAGCGATGCATTCCGAGAGGCAATAGCTGAAGGCCATAACAACAAACCATGTCGCTGCCACTCGCGCAGCAAATCAGAGGTAAGGAGATCAAGACTTACGGCTGACGAATACCTGAAAATTTATCAAGCAGCAGAATCATCACCATGTTGGCTCAGACTTGCAATGGAACTGGCTGTTGTTACCGGGCAACGAGTTGGTGATTTATGCGAAATGAAGTGGTCTGATATCGTAGATGGATATCTTTATGTCGAGCAGAAGCAAAACAGGCGTAAAATGCCATCCCAACAGCATTGCATATTGATGCTCTCGGAATATCAATGAAGGAAACACTTGATAAATGCAAAGAGATTCTTGGCGGAGAAACCATAATTGCATCTACTCGTCGCGAACCGCTTTCATCCGGCACAGTATCATAGGTCTTTATGCGCGCACGAAAAGCATCAGGTCTTTTCCTTCGAAGGGGATCCGCCTAGCTTTCACGAGTGCGCAGTTTGTCTGCAAGACTCTATGAGAAGCAGATAAGCGATAAGTTTGCTCAACATCTTCTCGGGCATAAGTCGGACACCATGGCATCACAGTATCGTGATGACAGAGGCAGGGAGTGGGACAAATTGAAATCAAATAATGATTTTATTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTTATAATGCCAACTTAGTATAAAAGCTGAACGAGAAACGTAAAATGATATAAATCAATATATTAAATTAGATTTTGCATAAAACAGACTACATAATACTGTAAAACACAACATATGCAGTCACTATGAATCAACTACTTAGATGGTATTAGTGACCTGTAACAGAGCATTAGCGCAAGGTGATTTTGTCTTCTTGCGCCTAATTTTGTCATCAAACCTGTCGCACTCCAGAGAAGCACACAAGCCTCGCAATCCAGTGCAAAGCTTTGTGTGCACCCACTACGACCTGCATAACCAGTAAGAAGATAGCAGTGATGTCAAACGACGCAGCTGACTTCTTTCTTCTTTCACGACTTCCCCACACCCAGCATGCATACCTTTCCTCATAACTGTAGTGAATGTCTGTTATGAGGAGCGGAAGTTAACACTTATGAAAATGGCTACGAAGTCCGTGGCTATCTATCGGCTTATTAGTACTTGAAACGCTTCTTCAGAAGCCTGAAGAGCTAATCGTTCGGCGATACTATATGCATTAATAGACTATATCGTTGGTATAAACAGTGCACCATGCAACATGAATAACAGTGGGTTATGTAAAAGGAAGCAGAAAGCTAAATATGGAAAACTACAATACGATGCCCCGTTAAGTTCAATACTACTAATTTAGATGGAAAACGTATGTAATAGAGAGTAACTTAAAGAGAGATCCTGTGTTGCCGCCAAATAAATTGCGGTTATTTTAATAAAATTAAGGGTTACTATATGTTGGAGTTTAGTGTTATTGAAAGAGGCGGGTATATTCCTGCAGTAGAAAAATAAGGCATTCCTACGAGCAGATGGTTGGAATGACTATTCCTTTGTTACAATGTTTTATCTTACTGTCTTTGATGAGCATGGTGAAAATGCGATATCGGAAATGTTAAAATTGGTTTTGTAGGTCAAAAGAAGAAGTAAGCACTTATTCATTAATAGATAAATTCAGTCAACTCCCTGAAATGTTTTTTCCTTAGGTGAAAGCATTGACTACTATGTTAATCTCAGCAAATTAAGCGATGGTTTAAACATAACCTTCTTAAAGCTATTCAGGATTTAGTAGTATGGCCAAATCGATTAGCCGACATTGAAAATGAAAGCGTCCTTAACACCTCATTACTTAGAGGGGTAACTCTTTCAGAAATTCATGGACAGTTCGCACGTGTTAAATGGTTTGCCAGAATTGTCAGATTTCCATTTTCATTTAATAGAAAAGTGCTCCCGGATTCAGTGATTTAACTAGCCCTTTTGAGGTGACGGTTAATTCTATGCCCAGCACGAACATTCATGCTTTATCGGGCGGAATGGGTGGTAAAACAACAAATTTGAATGGAATGATTGGTGCAATCACCAACCCAGAAAACAATGAATATTTTCTCTGAAAAATAATAGACTTATCGAGTCAAGAATCCCAAAGGGATATTTTTCGATCGCTTGTTTCAGTTTCGTTTAGTGCATTTGATCCTTTACTCCTCTCTAAAGAACAACCTGACCCAGCAAAGGTACACAATACTTTATATTGGACTCAAGAATGCTGCCAGCAATAGTTTAAAATACTAGGCGATCTCCGCTTAGAATTCATTTCAGCATTTATTGGTTGTATGAGTAGATAGAAAGACAACTCTGGCTTGAAGCTATCAAAAACTAAGTAGTGATGAAAACTTTTCAAATATGGAACTCATCAGCCTCATTTCTAAATATGAAGAGTTAAGACGTAATGAACCACAGATTCAAGTGGACGATGATAAATTCACTAAATTGTTTTATGACAATATCCAGAAATATCTGCTTCGAATGAGCTCTGGACATGCAATTGTTTTATTTACTATCACAAGATTAGTAGATGTCGTTGGCGAAAGTCATTAGTTTTATTCGATGAACCAGAGGTTCATCTGCATCCACCTTTGCTCTCTGCTTTTACGAACATTAAGCGACTTACTCGATGCACGCAATGGTGTAGCGCAATAATTGCACTCACTCATTCCCCAGTAGTACTGCAAGAGGTTCCAAATCCTGCATGTGGAAAGTCCTACGTCAAGAGAAGCAATAAATATTATCCGTCCGGATATTGAGACATTCGGTGAGAACTTAGGTGTTTAACTCGTGAGGTGTTTTACTTGAAGTGACAAATTCTGGATACCACCACTTATTATCGCAGTCCGTTGATTCAGAGCTTTCTTATGAAACCATTCTAAAATTATAATGGTCAGATAGGATTAGAAGGTCGAACCGTTTAAAGCGATGATAATGAACAGAGATGAAGGTAAAGTACAATGAAAAACTACCTCTTCCAGCGAGAACTTATAGCGAAATGCTTAATAAATGCTCGGAAGGTATGATGCAGATAAATGTTAGAAATAATTTCATTACTCACTTCCCCACTTTTGCAGAAAGAACAACAATATAGAATATTAAGCTCGACAGGTCAGTTATTTACCTACGACAGGACACCCCTCTTGAGCCTACAACCTTAGTTGGTAATTGACAAAGGTTAAATTAGAAAAGCTTTATGAAAATAATCTCCGAGATAAAACAACCCGCTAGAACATATTACGATGACATGCTTGTTTCATCAGGTGAAAATGTCATTTTGTGTGATATAGACAGACAAAATATAGATCATTTTCTTCCTATTGCACATTATCCTGAATTTTCGGTGATGCCTATTAATTTAGTTCCATCGTGCCGCGACTGCAATATGGGAGAGAAAGGTCAAGTTTTCGCAGTAGATGAGGTACACCAAGCGATTCATCCCTATCGACAAGGACATTTTTCGTGAGCAATGGGTATGCAAATTTCGTTTCCGGAACTCCGGGTGCTATCAGTTTTATGTTGAATGCCCGGCGAACTGGAGGCAGGAAGACAAACACAGAGCTCTTCATCATTTCAAGCTATTAAATATTGCTAACAGGTATCGTTTGGAGGCAGGGAAGCACTTGAGTGAAGTGATTACTCAAAGAAACTCTTTCGTAAAGTTATAAGGAAATATAGTTCAACCGCAACGTTTCAGCAGCTACAGTCAGAATTTATTGAAGCAAATCTGAAACCTATTATAGATTTGAATGACTTCCCCAATTATTGGGAAAGAGTTATGTATCAGTGCCTAGCAAACTCGGAAGATTTTCAGAGGGATCTAGAATATGATGAAAGATAGAAAATTACGACGCTTATCGGAAGTGAACGAATATTTTATGAGGAGGCTGTTTTACAAATCCGGTAGTAACTTGCTAACCAATTCCTAGGCAGGTCATTGGCAACAGTGGCATGCACCGAGAAGGACGTTTGTAATGTCCCTCTCCGGCACAGCAGTCCTAGGGACAGTGGCGTACAGTCATAGATGGTCGGTGGGAGGTGGTACAAATTCTCTCATGCAAAATATGTAAATCGGTAGCAACTGGAAATCATTCAACACCCGCACTATCGGAAGTTCACCAGCCAGCCGCAGCACGTTCCTGCATACGACGTGTCTGCGGCTCTACCATATCTCCTATGAGCAACGTGTTAGCAGAGCCAAGCCACAACTCTAATTTAATACATAATGAATGATAATAATAATATTAAAATTTCCTGTGTAACTAATTTACTATGGTTTCTGATAAGAATCATTGCAAAGATCAAACAACTTGTATTACATTGACAGTTAAGCAGTTAATTTATCCTCTAAATATATCAGCATCTAGCATGCAACCTATCAAAATGGAGAGTTTATGACTAAAACCATGGGAAAGAAGACTTAAAGATTTATCGCACTTGCTCAAATGCTGCATTGATACATATTTTGACCCTGAATTATTTCGCTTGAATTTGAATCAATTCCTCCAAACCGCAAGAACAGTAACATTTATTATTCAAAAACAAAACCAGATTATAGGATATGACATTTGGTAACAATAATGTTATTGAAAATGGAAAATGATCCATTAATGGCTTGGGGCTAAAATTCTCGCAATACGATAGAAAAACAAGGCGATTTAGAAATGTATAGCGAGGCAAAGGCTACTCTTATTTCATCTTACATTGAAGAAAATGACATTGAGTTTATTACAAATGAAAGTATGTTAAACATTGGTATAAAAGTTAGTCAGACTTGCACAAAGAGAAATTACCTTCATATTTAACTGAATCATCTATTATTAAATCAGAAAGACGATGGGTCGCTAATACGCTAAAAGATTACGAATTATTACATGCCTTAGCTATAATCTATGGCAGAATGTATAACTGCTGTAACTCTTGGCATACAAATAAACAATCCAATGGGTGACGATGTGATTTCGCCAACATCATTCGACTCTTTATTTGATGAAGCCAGGAGAATAACTTATTTAAAATTAAAAGATTACTCCATAAGCAAATTGTCCATTTAGCATGATACAATATATGACAATAAAATAATTCCTGAAGATATTAAAGAGCGTCTAAAACTGGTAGATAAGCCTAAAATATCACTTCGACAGAAGAGTTAGTTGACTATACAGCCAAGCTTGCAGAAACGACTTTTAAAGGACGGTTATCACATTCAAACATTAATTTTATGATAAACAATTCCATCCAATTGATTGATTTAATCAATACAACATTTGAAGATCAAGCAGATAAATATATTTTGGCGTTATGCAGCTGACAGAGCCAAAATAACAAATGCCTATGGCTTCATTTGGATATCAGAGCTATGGCTCAGAAAAGCAAGCATCTACTCCAATAAACCAATACATACAATGCCAATTATAGATGAAAGACTTCAGGTAATTGGAATTGATTCAAATAATAATCAAAATGTATTTCATGGAAAATAGTTAGAGAAAACGAAGAAAAACCGACTTTAGAAATATCAACAGCAGACTCAAAACATGACGAAAAACCATATTTCATGCGTTCAGTCTTAAAGCAATTGGCGGTGATGTAAACACTATGAACAATTGAGTCATAGAACTTCCATTATTCTCCTGAAGATAATAATCGCCAAATAAACCAATACTCAGCTTTACAATATACTAACTAACCGCAGAACGTTATTTCATACAACGTTTCTGCGGCATATCACAAACGATTACTCCATAACAGGGACAGCAGGCCACTCAATATCAGGTGCAGTTGATGTATCAACACGGTTCAGCAACACCGATACTTCTTCCAGGCTTCCAGCAACGAGGTTTCTTCCTTCGTTGCAATTTCCAGATCTGCAGCATCCTGAAGCGGCGCAATATGCTCACTGGCTACCTGCATCAGGCTTTTTCTTTCTTCCCTCCCGGATCCGGAACAGTTTTTCTGCTTCGTATCCTTCACCCAGGCTGTGCCGTTCCACTTCTGATATTTCCCTCCCGGCGATAACCAGGTAAATTTTTCGGTAACGGACCGAGTTCAGAAATAAATAACGCGTCGCCGGAAGCCACGTCATAGACGGTTTTACCCCGATGGTCTTCAACGAGATGCCACGATGCCTCATCACTGTTGAAAACAGCCACAAAGCCAGCCGGAATATCTGGCGGTGCAATATCGGTACTGTTTGCAGGCAGACCGGTATGAGGCGGAATATGCGTCACCTTCACCAATAAATTCATTAGTTCCGGCCAGCAGATTATAAATTTATGGTCCGTGGTTGTTCACTCATTCTGAATGCCATTATGCAAGCCTCACAATATAGTTAAATGCAATGTTTTGACGGTGTTTCCGCGTTACCCGCAGCGTTAACGGTGATGGTGTCCGTGTGAACCAATACTGAAAGAATGGGCATGAGCAGCCGATAACAACCGGATGCTGGTGCGCACCAATACCAACTGTATGCGCATGTGCAAGGCAGCACACACGGCTGTACCGGACAATGAGTGACTGTGGCTGCCCTGACTGTCCGTTTTCGATAAATAAGCAATACCTGTGTGCTGGTTCCTTTAACTGTGGATAAACTTCCTGTAATGGTTGCTGTTCCATACTGACTCCAGCCAGAACTGTTCATCCTTAAACCACTTGTGGGCATGAGCACCGCGCGGCCCCTGTTGAACCGCTCAGACTGTGAGCATGAGCCCCCGTGTTATTCGTCGATTTGGTGCCGTAATCGAAACTGCCTGTTGTTTTCGTCCCGTAATCAAACGACGATGTGGTTTTCGTCCCCAAATCCGTACCGGATGCACTGGCACTGTGGGTGTGCGACTTAATTCCATCCTGTTCCTGAGACAATACAGCACGACCGCTGGCGGGTTTCCCCTTGATTGTGCCTCAGCCGCATATCAGGAAGCACACCCGATGGATACGCGACAGCAAGTTTTGGGTAGGCTGATTTGTCAAACGCCTGCCCCTGCATCAGGACGTAGCCAGACGGAACGATATCTGATGGCCACGGGATCGGCGCACCTGCCGGAAAGGCCGAATTCTCACCGGCCCCAAGGTATTCAAGAACATCTGCAACGGAATTTTGCCAGAATATCCCTGCCAACCTGAGTCAGTTCAGTCAGGCTGGCGGCATCATTTCCGCAAATACGGTAATTTATTTTCGCCGTGGGAAGCCCTGCCAGCGCCGTCAGTGTCGCATTCTTCGGTTGTTTACCCGCAAGCGCGTTAGTCATGGTGGTAGCAAAATCTGGATCATTCCCGAGCGCTGCGGCCAGTTCATTCAGCGTATTCAGTGCGTCAGGTGACGCGTCGATAACATCTGCAATCGCGGCCAGTACAAAAGCGGTGTTCGCAATCTGGGTATTGTTTGTTCCCTGAGCGCGGTTGGTGCTGTTGGCGTTCCGGTCAGTGCCGGACTGTCCAGTGGGCTTTTCTGTTCGTTTCATCCATTACCACCTTAACCGCCTTTGGCGTTGCAGCAAGCGTTTCAGACGTGCTGTTGGTTGCACTGCTGAGCTGCACTATCCCTTTCTCGTTGTTGTCCGCATCCTCAAGCGCGACAGCTGAAGCTATATCTTCTGCACGTTTTGCCGAATTTTGCACGTATTGCCGCCGCTTCTGCCGCACTTTTGCTCTGCGATGCTGATACCGCACTTCCCGCAGCCTCCTGTCGCCTTCGTGGATGCCGTTGACGCACTCCCGCCGCCGCTGTTTTGCGTCTGCCGCCGGCAGAGGGCAGGGCGTTCCGCTGCTGTTTCAGATGACCTGGCATTCGTCTCGGACGTTTTGCCGCCCTGGCAGAATTTTCTGCCGCCGTTGCCGAGGAAGCTGCACGACCGGCACTTGATGATGCGTTCGTTTCTGATGATTTTGCTGCCTCTTTGAGGCCACCGCATCTCGTGCTGAAGTGGCGGCCTCGCTCTGACGCTTTCGTGGCCGCGGTGGAGGCAGACGTGGCTGATTGTTGTTGACGCTGCAGCATTCGTTTCTGACGTTTTCGCCGCACCGGCACTGGGCCGCCGCCGCGTTTTGAGAGAACTCTGCGGCTGCGGCACTTTTCCGCTTCAGTGGCCTTTGCTGATGCCCGCTTCTGCGCCGGAGGACGCTTCCTGAGCTGACGATGCAGCCTGTCCGGCGACGTGCTGGCGGCGCGTGCTGAGTCAGTTGCATCAGTCACAAGGGCCGCGACCTGAGCAGCTGATGCACTGGCATCGCCGGCTGATTTCTTCGCGTCTGCCGTACTCTGTGCCACCACGGACGCGTTACGCGCCACCCTCTTCCACCATCAGTTCAAGACGACGCAGCACCTCCGGCCGGGCATCATCCTCCGTCATGGCACAGAGAAAATCATTCAGCGTCCCCGGTTGTGAATCTTCATACACGGTGATGGTCCCGGCGTGCGATGGTGGAAAACCGTCAACCTGCAGGATGACACTGTACTGACCGTACTCCACATCCATGCTGTAACGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCACCACCACCGTGGTGCTGTTACGTCTGGCTTTCAGCTGAATGGTGCAGTTCGTCTGTACCGGTTTTCCTGTGCCGTCTTTCAGGACTCCTGAAATCTTTACTGCCATATTCACCCCACAAAGCCCACCGGTTCCGGCGGGCTGTCATAACACTGTGTTACCTGGCTAATCAGAATTTATAACCGACCCCAACGATGAATCCGTCAGTACGCCAGTCGCCACTGCCGGAGCCTTCATAAGCAATATCAACAACGACGGACGCTGCCGGATTAATCTGTATACCTGCACTCCACGCCACTGAGGTATGCCGCATTGCACTTTCGTCCCTGGCAGTGGTCGTCTCCTTTCATATACCCGGGAGTGATTTCCGTCTTACGGTAATCCATTGTACTGCCGGACCACCGACTGTGAGCCACTCGGCCATGGCGTACGCACTGACCTGCTTACTGATTTGTAAAACCGGTCCGGCCATCACGCTCACATAACGTCCACGCAGGCTCTCATAGTGAAACGTATCCTCCCCGGTCATCACTGTGCTGCTCTTTTCGACGCGGCGAACCCCAGGGAAGCCATCACCCCCACACTGTCCGTCAGCTCATAACGGTACTTCACGTTAATCCCTTTCAGATGACTCACACCGGTATCCCGCCCGACAACGACGGCAATGTACCGGTTTCACTTGAAAATAGCCCACCGTAAACGTACCATGTCACCTTCCGCACGGGCCGGAGATGACTGTCACCGCAAGTGCGGCAAAGACAGCAACGGCAATACACATTACGCATCGTTCACCTCTCACTGTTTATAATAAACGCCCGTTCCCGGACGAACCTCTGTAACACTCAGACCACGCTGATGCCCAGCGCCTGTTTCTTAATCACCATAACCTGCACATCGCTGGCAAACGTATACGGCGGAATATCTGCCGAATGCCGTGGACGTAAGCGTGAACGTCAGGATCACGTTTCCCCGACCCGCTGGCATGTCAACAATACGGGAGAACACCTGTACCGCCTCGTTCGCCGCCGCCATCATAAATCACCGCACCGTTCATCAGTACTTTCAGATAACACATCGAATACGTTGTCCTGCCGCTGACAGTACGCTTACTTCCGAAAACGTCAGCGGAAGCACCACTATCTGGCGATCAAAGGATGGTCATCGGTCACGGTGACAGTACGGGACCTACCTGACGGCCAGTCCACACTGCTTTCACGCTGGCGCGGAAAAGCCGCGCTCGCCGCCTTTACAATGTCCCCGACGATTTTCCGCCCTCAGCGTACCGTTTATCGTACAGTTTTCAGCTATCGTCACATTACTGAGCGTCCGGAGTTCGCATTCACACTGCCACTGATATCCGCATTTTAGCGGTCAGCTTTCCGTCCGGTGTCAGGAAAGGCCGGAGGATTGCCGCCGCTGGTAATGGTGGGGGCCGTCAGGCGCTTCAGGAACACGTCGTTCATGAATATGGTGGTTGCCTGCGCCACAAACATCGGCGTTTCATTCCCGTTTGCCGGGTCAATAAATGCGATACGATTGGCGGCAACCAGAAACTGGCTCAGTTTGCCTTCCTCCGTGTCCTCCATGCTGAGGCCAATACCCGCGACATAATGTTTGCCGTCTTTGGTCTGCTCAATTTGACAGCCCACATGGCATTCCACTTATCACTGGCATCCTTCCACTCTTTCGAAAACTCCTCCAGTCTGCTGGCGTTATCCTCCGTCAGCTCGACTTTTTCCAGCAGCTCCTTGCCGAGATGGGATTCGGTTATCTTGCCTTTGAAAAATCCAGGTAACCTTCCGCATCATCGCTCGCCCGACCGACGGCCTCCACGAATGCCGATTTGCCAACGGTGTTCACACTGCGGATATAAAGTAATAATCATGGCCCGGTTTGATATTGATACTGGCGGCTATCCAGTACAGCGCCGTACCAAGATAACGCGTGCTGGTTTCAACCTGTCTGATATCCGCAATCTGCTTTTCCTAGAGAACCAGAACTCAAACTGTACCGTCGGGTCATAAACGGCAAGATGCGGCGTGGCGGTTATCTGAAAATAGCCCGGCGTCAGCTCAATCCTCGACGGTGCTGCCGGTGCGGCAATCCGGAACGATACCGACGCCGGATCGCCCTGCTGCCCCACGCATTTACCGCCCGGACTGTCAGCCTGTAGTTCCCCAGCGCCAGTTGCGTGAAGCGGTATGTGGTTTCCGTCGTCCGGGCCGTGCTGACCAGCCGCTCACTGCCGTCGTCCGCTGTTACGCCGTCAGACGGAGCAGGAAACTCACGCCCTTCACCACCTTCGGTGTGTCCCATCGCGCCAGCACCTGATATTCCCCGCTGTCTGCAGTGACTTCTGCGGTCAGGTGCTGCACCGCTGGCGGCGTGACACCATTCACCGTGCCACTCTGTTCGCCGTCAAAGTGCGCCCCGTTATCCACGATGGCCTCTTTTCCGGCACATGCTGCACGGCGGTGATGGCATACGTGCCGTCGTCGTTCTCACGGATACTCACGCAGCGGAACAGTCGCGCGCTGGGCAGCGTCGGCAGCTTCAGCTCCCATACGCTGTATTCAGCAACACCGTCAGGAACACGGCTCATTTTACCTTCACGCCGTCGGTGACGGACTGAACCTCCACGCTGACCGGATTGCCACTTCCGTCAACCAGGCTTATCAGCGCGGTACCGGAGGATGGCAGCGTGATTTCACGGTCGAGCGTCAGCGTCCGGGTCGGTGGCTGTTCACCGCCAGCACACGACCACCGGTGCTGATACCGGCATAGTCATCATCGCAGATTTCAATAACATCGCCCGGTACATGGCGAACCCCTTCTGCGCCGACGCTGAAATCCACGGTCTGCGTTTCCAGCAGTTCTGTTTTAATCAGCCACAGCCCGGCGCGGTGTGTGCCTGCCCCGGCTGGTACAGCCAAAGGCATCCATCTTCGTAACATTACGACCGTAACGGGCAATGGCCTGCGTATCTTCAACAAGCTCTGTCGCCGTCTCCCAGCCGTTGTTCGGGTCAATCCAGTTCACCTCAACGGCATTATGGCGGTCCTTCAGGGCGCTGAAGCTGTAGCGGAACGGCGCGCCATCATCCGGCATCACCACATTACTGCGGTTATAGTCCACGTCTTATCCGACGGTCGGTCCTGCACGAACGTCAGCGTCTGCCCGTTCCATACCGGCATACAGCGCAGCATCGCCGAGCAGAAATCGCTGAGCACATCCCACGCCTTACGCTGTGGTCAGGTACGCATTACAGGTGATGCGGCGCGGTGCGTGCCGCCAAAGCCGTCCGGCACTGACTGGTCGCAGTACTGGCCGATGACATACAGCGCCCATTTATCCACATCCGCCGCACCAAGACGTTTCCCCATGCCGTAGCGCGGATGGGTCAGCATATCCCACAGACACCAGGCCATGTTGTTGCTGTATGCCGGTTAAACGTTCCGTCCCAGATACCGCTGTATTGCCGCGTCTGCGGGTTATAGTTCGACGGCACCTGCAGAATACGCCCGCGCAGATGATAATTACGAGCTCACCTGCTGGCTGCCGAACTGCTCCGAGTCCACCTGCACGCCGACCAGTGCCGTGTCGGGTAGCACTGTTTCACATCGATGATTTCAGTGTATGACGACCAGAGCGTTTGTTCTGCAGCTGGTCTGTGGTGCTGTCCGGCGTCATCCTGCGCATCCGGATATTAAACGGGCGCGGCGGCAGGTTACCCATCACACCGAGGCCAGATACTGCAGGTGGTTTGCCTTAATGGTGATGTCTTTTCCGTCGTACCAGCCACCGTTACGTTGTATCTGAACCAGCAGGCGGACTTCCGACGGATTCCTGTCACCCTTTGAGGTGGTTTCCACCAGTGCCTGTACACCGAAGGTAAAGCGCAGACGGTCGATGTTTGCAGACGTTAATGGTGCGGGTGATCGGCGTGTCATATTTCACTTCCGTACCCAGCACCGTCTCCGGAGCCGGAGGATTCAAATCCCTCCGGCGGAGTCTGCTCCTGCTCACCAGCCCGGAACACCACCGTGACAATATGTTGGTATTCCCTCAGTGTCCAGCACCGGCGTACTGTTCAGCAGCACGCTTTTAAGCCATCCAAGGACCTTCAATCGGCCTTCGCTGATGGCATCGATCACACTCAGCAACTGCGTGGACTTCAGGTTGTCCTTCATTCGCGCGGGGGGGTCCCCTTACTGCTTCCTTTACCCATTCCTCACGCTCCATAAATGACAAAACCGCCCGCAGGCGGTTTCACATAAAACATTTTGCATCAGCGACCAATCACCACAACCTGACCACCGTCCCCTTCGTCTGCCGTGCTGATCTCCTGAGAAACCACGCGTGACCCCGCGCGCATTTCCCCGTACAGAACAGGCAGAACATTGCCCTGGGCAACCATGTTATCCAGTGAGGAGAAATAGGTGTTCTGCTTACCGTTATCCGTTGTCTTGTACGGGGAGTTCTGGCTTTCGGTGCCAGCATCTGCGCCACACCACCGAGCACCATACTGGCACCGAGAGAAAACAGGATGCCGGTCATACCACCGGCCCCAATGGCTGCCCCCATGCTGCAAGGGGCTCCGGCGGTAAAGAATGATCCGGCAATGGCGGCAGCCCCCAGGACAATCTGGAATACGCCACCTGACTTGGCCCCGGCGACTCTGGGAACAATATGAATTACAGCGCCATCAGGCAGAGTCTCATGTAACTGCGCCGTTAACCCGGACGTGCTGACGTCCCGCCCGGCAATCCGTACCTGATACCAGCCGTCGCTCAGTTTCTGACGAAACGCCGGGAGCTGTGTGGCCAGTGCCCGGATGGCTTCAGCCCCCGTTTTCACACGAAGGTCGATGCGGCGACCAAATCGTTGTAAATCCCCGTAAAGGCAGATGCGCCATGCCCGGTGACGCCAGAGGGAGTGTGCGTCGCTGCCATTTGTCGGTGTACCTCTCTCGTTTGCTCAGTTGTTCAGGAATATGGTGCAGCAGCCGCCGTCGCCGCAGTAAATTGCGGCGTGATTCGGCACTGATGAACCAAAACAGCACAGCAGCACATCGCCCGGCTGTGCCGTGGACAACGGCACCTGATACAGCCCCGTCGCCTCCAGATTATCCAGATAGAGATTCTGGCCGTTACGCCACCAGTCATCCTCACGATGAAAGTCCGGCATCTCAATCCCGCCAGATGATAAGCATCCCGGAACAGTGTGTAACAGTCCGTCACACCGTGCTCAAAGCGCCGCCCGGTGAGATGCGGCACACAGCGGAACTTATGAATCGTCCCCCGGCAGACCAGCCACCACGGCAAATCACTCTGCACCTGCAGCCGCCGGTCGGCCTCACTCAGCCGAGGCAGACCACCGGGGTGGGCTGGGACCAGCGCCACAATCTCACCCTGCATTTCTGCCTGCAGCCAGTCTTCCGGCGACATACGGAAATACGCCTCCGGCTCACCGGAGATATTCACGCAGGGAAATATTTCCCCCTCCGGCGTGCTTACCACGAAGCCGCACGACTCCGCTGGCGCACATCGCCATGCCGGGCGTGCGGCCAGAAATCGCTGATTCTGTCTTGTCATGGGATTTACTGCGAAAGTTTGTTAATGGAAAGGAAGCCGCCAAAGTTGCCGACGTTATTGCGGAACTTACAAACGCTCAGGCATTTGCTGCATTTATCCTTCGTGATATCGGACGTTGGCTGGTCATATTCATCCGCGACAGCCGGACCGCTATAACCGCACTCGTCACCGCGATAGTCCAGGTGCAGGTGTTGGCCAGCATGATACGTCCTAGAAAAACAGCGCCATCCGTTTCCGTCGGCGTGACAGTACAAAGGAGGCACTCACCGCGCTCAGTTCGCTGCACTGCTCAATGCGCCAGCGGCTGATCACCTCCTGCTCCGGATCGGCGTAACTGTTTCCGTTGACGAAGTTCACCGCATCCAGAAAACGGGCGTAAACCTTACGCCGGACCACCGTTCCGCCGACCAGACTCTGCATATCTTCCGCCATCCCGGTGACCATACCGTACAGGTTAGAAACCGTCAGCGTGGGGCGGGTACTGGTGCCTTTGCCATTCAGTTCAAACCGCTCCCCTGAATGGGATACGGCTGATACTGTCGCCCCTGCCAGGTGACCGGCTCACCTTTTCGTTCTGCTCATTACAGAAAATAACGTTCTCCACCGACCTCTGTCAGGTCGATTTCCAGAGAGCACCACGCTGGCCGACTGCTCCGCACGGGTGCATTCATTCAGTGTTTCCTGCCGGATATCCTGCATCAGTTCACCACCTGTTCAAACTCTGCGCTGAACTCAACACGCAGCATACTGACCGCGACGACCATTTTGCGCAGGTCACCTTTATCTGCCGCCACTCATAAGGCGGCGTCCACAGAAAGGATTTCCAGCCCCGTGCTCTTCCAGAAACGACTCCAGTACCGTGGCCTCCTCACGGGGGACAGAAGGCGTCACGCTGTACGTTTCAGGTTGGCATTCAGCCCGGCAGGCGCTCGCTGAGAATAGCCATCACCAAAGCGCACCTTTCTTACAGAAGGGACCGAAGCCACATCCATACCGGGTTTCACTTTCCAGCGGAAGGTCTTCATCGTCTCTCCGGAACACAGGCCACCATCACGCATCTGTGTCTGAATTTCATCACGGGCACCCTGCGGGCCATGTCATACACCGCCTTCAGAGCAGCCGGCCGGACCTATCTGCCCGTTCGTGCCGTCGTTGTTAATCACCACATGGTTATTCTGCTCAAACGTCCGGACGCCTGCGACCGGCTGTCTGCCATGCTGCCCGGTGTACCGACATAACCGCCGGTGGCATAGCCGCGCATCAGCCGGTAAAGATTCCCCACGCCAATCCGGGGCTGCCTGCCTCCTTCGTGAAGACAAACTCACCACGGTGAACAATCCCCGCTGGCTCATATTTGCCGCCGGTTCCCGTAAATCCTCCGGTTGCAAAATGGAATTTCGCCGCAGCGGCCTGAATGGCTGTACCGCCTGACGCGGATGCGCCGCCACCAACAGCCCCGCCAATGGCGCTGCCGATACTCCCGACAATCCCCACCATTGCCTGCTTAAGCAGAATTTCTGTCATCATGGACAGCACGGAACGGGTGAAGCTGCGCCAGTTCTGCTCACTGCCGTCAGCATCGCCCGCCATATTCTGTGCAATACCATCAAAGGTCTGCGTGGCTGCATTTACCTGCGACATACTGTCCGTGGCGCTCTCTTCCCACTCACTCCAGCCGGACTTCAGGCCTGCCATCCAGTTCCCGCGAAGCTGGTCTTCAGCCCAGGTCTTTTCTGCTCTGACATGACGTTATTCAGCGCCAGCGGATTATCTCGCCATACTGTTCCTTCAGGCGCTGTTCCGTGGCTTCCCGTTCTGCCTGCCGGTCAGTCAGCCCCCGGCTTTTCGCATCAATGGCGGCCCGTTTTGCCCGTTGCTGCTGTGCGAATTTTATCCTGCTGCGCGCCAGCGCGTTCAGGCGCTCCTGATACGTAACCTTGTCGCCAAGTGCAGCCAGCTGGCGTTTGTACTCCAGCGTCTCATCTTTATGCGCCAGCAGGGATTTCTCCTGTGCAAGACAGCTGGCGACGACGTTGCCGCCTCCTCCTCCAGTACCGCGAACTGACTCTCCGCCTTCCACAAATCCCGGCGCTGCTGGCTGATTTTCTCATTTGCTCCGGCATGCTTCTCCAGCGTTTAGAGTTCTGCCTGAAGCGTCAGCAGGGCAGCATGAGCACTGTCTTCCTGACGATCGCCCCGCAGACACCTTCACGCTGGACTGTTTCGGCTTTTCAGCGTCGCTTCATAATCCTTTTCGCCCGCCATCAGCGTGTTGTAATCCGCCTGCAGGATTTTCCCGTCTTTCAGTGCCTTGTTCAGTTTCTTCCTGACGGGCGGTATTTCTCCAGCGGCGTCTGCAGCCGTTCGTAAGCCTTCTGCGCCTCTTCGTATATTTCAGCCGTGACGCTTCGGTATCGCTCTGCTGCTGCGCATTTGTCCTGTTGAGTCTGCTGCTCAGCCTTCTTTCGGGCGGCTTCAAGCGCAAGACGGGCCTTTCACGATCATCCCAGTAACGCGCCCGCTTCATCGTTAACAAAATAATCATCCTTGCGCAGATTCCAGATGTCGTCTGCTTCTTATACGCAGCCTCTGCCTTAATCAGCATCTCCTGCGCGGTATCAGGACGACCAATATCCAGCACCGCATCCCACATGGATTTGAATGCCCGCGCAGTCCTGTCTGCCCAGGTCTCCAGCGTGCCCATGTTCTCTTTCAGGCGGCGGGTCTGGTCATCAAACCCCTTTCGTTGCGGCCTCGTTCGCCGCCTGCAATGCCCCGGCTTCATCGCCGGAACGCTGCAACTGAGCAACATACGCAATCTGCTCCGCCGACACGTTATGGAACTGGCGAGCCATCGCCGTCAGCCCCGACGTCGGGTCTGTGGTCAGCTTCCCGAAGGCTTCAGCGACCTTGTCCACCTCCACGCCGGATGCAGAGGAGAACGCGCCACCACTCTGGCTGATGGACGCAATCTGAGCCTCACCGCTTACCCCCGCCTTAACCAGTGCCTGAGTACTCGCTGGTCTGGTTAAACGTCAGCCCTGCCGCCTGCCCGGCTCTGGACAGGACCAGCATACGATCTGCCGTCAGTCCCGCCTGATTGCCGGAAAGGACCAGCGTTTGTTGAAATCGACGGACAGGGTGAGTTGCCCTGATACCAGGCATACGCCAGCGCACCGGTCGCCACCGCCAGCGAGGCCCCCACCATCGGCAGGGTGATCGCACCGGCAAGCCCCCTGAACATGGGGATCATCCCGCCGAAGGGAGTCCTTCACCTGCCCCCTGTTGCAGCAGGATCAGCCACGGACTTTGCCCGCCCTGCAAGCTGCGTGGCCACGTCGGTGAACTGTGCAGGCAGCATACGCATGGCGGCTTTATACTGCCCGACGGAAATCCCCGCTTTCTGTGCAGCCAGCGCCTGTCGGCTCAGCGACTGTTCAACGACTGCCGCTGTTTTTCGCATCACTTTCCGTACCAGAAAATGACGCCTGACTCTGGCCATCTGCTCGTCAAATCTGGCCGCATCCAGACTCAAATCAACGACCAGATCGCCTACCGGTTCAGCCATACGGACTCCTCCTGCGATCCCTTCTGATACTGTCATCAGCATTACGTCATCCTCCGTCATGTCGCCACATCCGGGGGAAGCGGGGATAACTTCATTCCCGTCCGGGCCAAAGCGGACACCTCCGGCAAGCCCTGCCGCTTTCTGCATCAGCACATCATCTTCAGGCTCTTCGTCAGCCTCGCGCCGGTTCAGCAGACTGAAATCCAGAGGCGGATGCATATATCCGGATCGCTGAAAAAACAGGCTGAGCACGGTGTACGTCAGCCCCCGGAAAGTGCATATCCAGCAGAACATCATGAAAATAATGGGTACTGTAAAGCGGTGCCAGTCGGCATACTCCGTGGATGACATCCCGGCAAGCATGGCACGCCAGTCGGGTCGCCCCATCTCACGCGCCAGTTCAGGGCAAAACTCAGCTCACCGTCGAACACTTTCCCGCAGAAACAGGCTGCTGCGGGCCCGGCGTCCTCTGTCTGTTCAGGGGCATTATTCACCACAAACTCATACATACCAGACAGCCGGTACACCACGTTTTCAGCATGAGAAATTGCCTCCGTGGCCAGGTGGTAAGCACTTCCTGCTCAATCTGTTTAACGGCTTCATTCATGGACGGCATCTGCGTCTTCTGCGGATGGTTATGCCACAGGGACATCGCCCACCAGAAACGCGCCGGTTCTGATGGCGTCTTTCCACAGTAAACTTCCGGTTGCTGTCTGACTCCGCCTGTTCTGCCTGCCGTTTCATCAGGGCGAGATGCTCAATGCGCTGCATGCAGGCTGACAGTTCAGAAAGCGTGACGGTCACCCGTTATGTTCAAATGATTCGGTTTTCAGGAACATCGCTGACTCCGGATTAACTGGCGGTGACGGTAATTTCTGCAACCGCAGCAAACTCACCATTACCGGATACAACCGGAATGTTGACCTTGCCTGCAGCAACGCCGTTCACGGTGATGGTCATACCACTGACGACACGGTGGCTTTTGTTTTATCCGCAGACACCGCACGAAAGCTCTTGTCGGTTACGCCTCCGGCGGCTGGAAGGGCCGGTCGGTCAGCGTGGTGCTCTGCCTTTCACCACCGAGGTGCTGGCAGGCGTCACGGTCATGCCGGTTGTTGCTGTTACCGTGCTGCGATCTTCTGCCATCGACGGACGTCCCACATTGGTGACTTTCACCGTTAGGTGATCACTTCCTTCGCCGTCAGTCGCCTTACCGATACTGCTGACCCAGCCACGGAACACATCGACCGTGCCGTTCGGGAAGCGGATTTATAGGCACGGGTATCGCCTTCATTAAACCACGCCAGCAGCGCCTGCTGCCTGCTGCTCTCCGGGCATCCACGCCAGCGTGAAGCTGGTATCTCCGGCAGATTTCTGCCCCTGCCCGGTCGCAGTCCAGTCTGCATCTTCATCATCGAGATAGCTGTCGTCATAGACTCAGCGTCAGTTCGCCGGGCGTCAGGTCTTTAACTTTGCCCACATTTTCAGTTGCTGAATAAACGCCGGGAATACGACGGTTACCCATTCCCAAGCACGCTGCCGCCACCTTCAGGGATGAACGCTGCCCCTTTACGACGCCTGCATGGCGCGAAAGGACCCGCGCATTACCAGCTTGATTACGAGGCAAATCCCCCGGTTAACTTTGATTCTGACTGCGGATTTGACCGTGGCCTTTTTCATGCCTGGCCCTTCCTTACCAGTTCAGTGTGCGTACCTTTGTCTCACGGGCAACAATGTGACGCCGACTGCGATATCGCGGATGAAGCAACGCGGTTAATGGCCCATTGCGGCGGGCGAGAGAGCACCGCCGTTTTGCTGATACGGCTGAGGATGTCGCAACGGCCTGCTCAAGACTTTATGGCCATACATCCCCTTCTTCAGCGACGGTTAACGGCAGGCGGTACGCCCCGTCCAAGCCAGAGATGACAATTCCCCTCATCATCCGGCGAAACCCGATTACCCAGAAATTTTCCTCACCGATGGTCAGCGTGTCTCCACGCCGCAGCTGCCGCACCTCATCAGTCCGGACAAACAGGGACGGGCTGGAGCCTTCAACGCACGCCTTGTCCGGCATAGCTGATATTTTCAGGGTCATCAAAAACACCACGTATCACTACACGCTGACTGCTCACCGGATGTAATGGTGGCTGACGTTCCCGTTCATGTACCCGCGTATCGTTTCATCGGCGGGGGCAATGGCAGCATCGAACAGGTATCGAAATCAGCCACAGCGCCTCCCGTTATTGCATTCTGGCCGAGCGGAGACGGGCAATCAGTTCATCTTTCGTCATGGACTCCTCCACAGAGAAACATGGCCCCGAAGGGCCATGATTACGCCAGTTGTACGGACACGAACTCATCATCAGTCAGCCAGCAGCATCAGCGGTGCTGACTGAATCATGGTGAAACTCACGCGCCGGATCGCCGGTGGTCACCCAGTTTTTCGGGTAACGGGCAGAGGCGTTAATGCCTTCGCGCTGTGCGTCCGCATCCTGAATGCAGCAGCCAGTAGCGCAGACCGCGTGCCTGAGTGTTCCCCAGCACCATCGTGTTGTCCGGCAGGAAGTTCTTTTGACGCCGTTTTCCACGTACTGTCCGGAATACACGACGATGGCCACATCGCCATACATCCCCTTATAGACACCGCTTTGCCCAGGTCTTCACCGCTGTCTCCAGCTCGGAATTAGAGCCACGACGGGTATCCAGCTTCTCCTTGACGGCTTTGAAGGAACGGAACAGCGCCAGCCTTTCGGATCGAACACGATGATATTCACCACACCGCTGGCGTTCAGCGTAGGCTTCGATATCGTCGGTCGGGTCATACGTGGACTTGTCACGCTTGCTCCACTCCGTGCCGCCGGACTGCGTGATGTTATTCTCCTCACTGCGGCCCATATCCACCTCAACCGGATCGAAGGCTTCACCGGTCATGGTGTATTTGCCCTTAAGCACGGCAGAAACTGCCTGCATCTCTTCGACCTGAGCAATGGCCAGCTCTTCGTCACGCATGTTCTGCATGATGATGCGACGGCGGCGGTAAGCCGGGTCCGCCAGATTCTGCGATCTTTCATCCGGCAGGCGACGCAGGGTCATCTGCGGATTCACTTCATGCTTCGGCTTGACATATCCCGGCGTAAATTCAGGGTGGAGCCGCCACGGGAACGGATAACCTCACCGGAAACAATCGGCGAAACGTACAGCGCCATGTTTACCAGTCCGGAATTTGTGAGAGATAGACTTTCTCGTGGTGAAGGATAGCTCTCACGGAAAAGAGACGCAGAAACAGCGGATCAAACTTAAATTTCTGCTCATTTGCCGCCAGCAGTTGGGCGGTTGTGTACATCGACATAAAATCCCGTAAAAAGCCGCACAGGCGGCCTTTAGTGATGAAGGGTAAAGTTAAACGATGCTGATTGCCGTTCCGGCAAACGCGGTCCGTTTTTTCGTCTCGTCGCTGGCAGCCTCCGGCCAGAGCACATCCTCATAACGGAACGTGCCGGACTTGTAGAACGTCAGCGTGGTGCTGGTCTGGTCAGCAGCAACCGCAAGAATGCCAACGGCAGCACCGTCGGTGGTGCCATCCCACGCAACCAGCTTACGGCTGGAGGTCCAGCATCAGCGGGGTCATTGCAGGCGCTTTCGCACTCAATCCGCCGGGCGCGGTTGCGGGTATGAGCCGGGTCACTGTTGCCCTGCGGCTGGTAATGGGTAAAGGTTTCTTTGCTCGTCATAAACATCCCTTACACTGGTGTGTTCAGCAAATCGTTAACGGATCATCAGATGCCGGGTTGCAGCTGCAGCCAGCGGTGCCGGTGCCCCTGCATCAGACGATCCAGCGCAGTACTGCGCGCCTGTGCACTCTGTGGTGCTGCGGCCAGAATGCGGCGGCCGTTTTCACGGTCATACCGGGGGTTTCTGCCAGCACGCGTGCCTGTTCTTCGCGTCCGTGAGCCTCCTCACAGTTGAGGATCCCCATAATGTAAGCTTTCTGCCGCAACCGCTGCGGTGATCTGCGCGTTCACGTCCGGCTGCGCCGCGCTGGCGTTCGCCCTCCGTCGCTGGCACCACGTCAGTAACGTCAGCCTGCGAAGCAGTGGCTGAAACAGTTGTTGATTGAGTCTCTTTGGTCATTCGCCTCCTGAGAGACGGGATTTACGTGCATCCAGTGCATCACGCATGACGGTGATCGCATCGGTGCTGTTAACAAGTTCATCAGCCAGTCCGGCATCAATGGCCTCCTGACCGCTGTACACTGCAGCCTCGGTATCCAGCACAACCTGCACGGACAGGCCGGTATATGCCGACACCTTCTGCGCAAACATCTGGCGGGTTGCGTCCATCCGGGACTGCAGTGTCTCCCGGACGTCATCCGGAAGATGGCTGTAGGGTTGCCATCCACCTTATGGCTGCCGCTGTAAATCAGCGTGATTTCCACACCCTGTTTCTCCAGCGCAGCACCGTAATTACTGTGAGCCATCATGACGCCGATGGAGCCTGTCCGGGCGGTCTGCGTGACCAGACGCCGGGGAGGCGGCACTGGCAAGCAACTGACCTGCACTGCAGTTCATGTCGTTGGCAAGCGCCCATACCGGGTTTTATGTCACGCACACGGGCGATGATGTCAGCGCAGTCAAATGCCCCGCCACCATCCCGCCGGGCGTGTCCATATCGAGCAGAATGCCGTCCACCATCGGATCGCTGGCAGCCTGTTGCAGACGGGCGATAATGCCGTTGTAACCGGGTCATCCCCGAGTACGGCTGCAGCGCCCGCGTCCGGCTGACCAGCGTGCCGGACATGCAGCACGGCGATGCCGTTCATGACCTGATAACTGCGGCCTGTCGTGTGTCCGTCATCATCACCGGATAATGCCAGCGTCGCGGGTGCCTCCTGGGCAGTCAGGCTGTCGCCGGACACCGCATCCGTCAGGCTGCTGATCCCAAGCTGGCCTGCAAGCGCACAAAGAAAACCCGCGCATAGGCGGGTTCAAGCATCAGCGGCTCATTAAAGGCCATGCTGGCAATATGCGGAGATTACGCAGCTCTGCTGTCACTCTTCTCCTCCTCTGTTGATTGTCGCAGCCCGGATTCAAATGCTGCAGCCGCCCAGGCGGGCGGTTTAAGACCGGCTGCACGGCGCTCCATCGTTTCACGGACCTGCTGGGCAAAATTTCCTGATAGTCGTCACCGCGTTTTGCGCACTCTTTCTCGTAGGTACTCAGTCCGGCTTCTATCAGCATCACCGCTTCCTGAACTTCTTTCAGACCATCGATGGCCATACGACCGGAGCCTATCCAGTCGCAGTTCCCCCAGGCACTGCGGGCTTCCTGAAAACTGAAGCGCGCTTTGAAGGTAACGTCACCACGCGGCGAACGATGGCCTCTTCCAGCCAGCACAGAAACATCTGGCTCGCCTGACGGGATGCGACGAATTTTCGCCGCCCCATAAATGACGCCCACGACTCGTTCGCACTGGCCCGTGCCGTGGAGTAGCTCATCTGGGCGTAATTCCGGGAAAGCTGCTCATACGAGACACCCAGCCCGGCAGCGATATACCGCAGCAGTGACTGCTCAAACACGGAGTAGCCGTTATCCGTATCCTGAGCCGTCTGCAGGTTCAGTGAGAGTACCGGCATCAGGTGCGGTACTTTTGCGCCTCCAGCCGGACCGGCGCTGCTGCGGCGTAATACGCGGCAATTTCACCAATCCAGCCGGTCAGCCTTTCCCGCTGCTCCTGACTGTTCGCGCCCAGAATAAAATCCATCGCTGACTGCGTATCCAGCTCACTCTCAATGGTGGCGGCATACATCGCCTTCACAATGGCGCTCTGCAGCTGCGTGTTTCTGCAGCGTGTCGAGCATCTTCATCTGCTCCATCACGCTGTAAAAACATTTGCACCGCGAGTCTGCCCGTCCTCCACGGTTCAAAACGTGAATGAACGAGGAGGCGCCCGCCGGGTAACTCACGGGGTATCCATGTCCATTTCTGCGGCATCCAGCCAGGATACCCGTCCTCGCTGACGTAATATCCCAGCGCCGCACCGCTGTCATTAATCTGCACACCGGCACGGCAGTTCCGGCTGTCGCCGGTATTGTTCGGGTTGCTGATGCGCTTCGGGCTGACCATCCGGAAGAACTGTGTTTAGAAAAGCCGCGACGAACTGGTATCCCAGGCCTGAACGAACAGTTCACCGTTAAAGGCGTGCATGGCCACACCTTCCCGAATCATCATGGTAAACGTGCGTTTTCGCTCAACGTCAATGCAGCAGCAGTCATCCTCGGCAAACTCTTTCCATGCCGCTTCAACCTCGCGGGAAAGGCACGGGCTTCTTCCTCCCCGATGCCCAGATAGCGCCAGCTTGGGCGATGACTGAGCCGGAAAAGACCCGACGATATGATCCTGATGCAGCTGGATGGCGTTGGCGGCATAGCCGTTATTGCGTACCAGATCGTCTGCGCGGCATTGCCACGGGTAAAGTTGGGCAACAGGGCTGCATCCACACTTTCACTCGGTGGGTTCCACGACCGCAACTGCCCTCCAAATCCGCTGCCACCGCCGCGTGATAACCGGCATATTCGCGCAGCGATGTCATGCCGTCCGGCCCCAGAAGGGTGGGAATGGTGGGCGTTTTCATACATAAATCCTGCAGGTCTCTCCCTGCGTCGCTGTGTCATGCCGGTCTGCACTTCCAGCTCTGCAATATATTTTCAGGTCAGACACGGAAGTGGCCGTAAACTCCACCCTTCGTCCGTCTTTCTGTACTGTTGCCACCCGTTTACCTGTCATCAGGTCATGCAGTGCCGCACGGGCAGCGGCAAGTTCTTCCTGTCGCGTCATTCATCCTCTCCGGATAAGGCACGGCACGGCGTAATCTGCCAGTGTTTTCTTGTTGGTTGCTGCACCATCCTCTTCCTGCAGGCTCGCCAGCAGCGCACTGAGATCCAGCTGCCAGCGGGAAATACTGATGCGCAGCGCCGCCAGCGCATAAACGAAGCAGTCGAGTGCCTCATTGCGTCGCTTTTGCTGTCCACAGTATTTTCCTGCCATCCACCCATTTTCGACCTGCTCTTCAGCAGTCAGCTGCTGCGCTTCGGGTCAGATCAAAATATCCGGGTTATTCGGGAATGAACGGCACCGGGAAGCGGTTCATCCCCTTCCGGCGTCAGTGTGAAGCGGTTATAAATCTGCTCTCTTCGCGGTATCCGTACCGATTTCGGTAAGGTAAACCCCGTTTTGTTTCGCTTACGTGGCATGCTGGCCACCGGCTTTCCGTAGACGGATGCCCCTTTAATGGGGATCACCCGGAACAGCCCATGTTTTTCGAGCGTTCATACACAATGGTCGGGTCAATCCCGCCAGTATCCCAGCAGATACGGGATATCGACATTTCTGCACCATTCGGCGGGTATAGGTTTATTATTGATGGCCTCATCCACGCAGCAGCGTCTGTTCATCGTCGTGGCGGCCCATAATAATCTGCCGGTCAATCAGCCAGCTTTCCTCACCCGGCCCCATCCCCATACGCGCATTTCGTAGCGGTCCAGCTGGGAGTCGATACCGGCGGTCAGGTAAGCCACACGGTCAGGAACGGGCGCTGAATAATGCTCTTCCGCTCTGCCATCACTTCAGCATCCGGACGTTCGCCAATTTTCGCCTCCCACGTCTCACGAGCGTGGTGTTTACGAAGGTTTTACGTTTTCCCGTATCCCTTTCGTTTTCATCCAGTCTTTGACAATCTTGCACCCAGGTGGTGAACGGGCTGTACGCTGTCCAGATGTGAAAGGTCACACTGTCAGGGAGCTCAATCTCTTCACCGGATGACGAAAACCAGAGAATGCCATCACGGGTCCAGATCCCGGTCTTTCGCAGATATAACGGGCATCAGTAAAGTCCAGCTCCTGCTGGCGGATGACGCAGGCATTATGCTCGCAGAGATAAAACACGCTGGAGGGGTCATCCGGCGTCCATTTGAGGCCAAACGGCGTCTCTTTGTCGCCAAATTTAAGATACTGCTCCTCCCCCGCAATGCGGGCAGGCAACATGAAAACGCATAAAATGCGGGGATTCACTGGCTGCACGCTCAATCTGACAGGTGCCTCTCACTTTTGGCGTGGAGCCACGGATGGACTTTGGCCAGACCGAGCCTTCAATACGCTTGTTACCCAGGAACGTCGGAGAGCCTTCCTGTTCAATATCATCATCAAAAGCAGCAAGTTCATCATAACCCGCCACATCCACCGACTTTCACGGTAGTTTTGCCGCTTTACCGCCCAGGCAGCACCAGAAGCCACGCCCATTAGTGAACGCTTCATGGTGAGCGTGTTATCCCGGTGCTTTTGCCATACCACGGGGCCAGCGCCAGCAGCGACGGAATATCACGAATAGTCGGCTCAACGTGGGTTTTCATAAAGTTCTCGGCATCACCATCCGTCGGCAACCAGATAAGGGTGTGCGCTGCTTATGCTCTATAAAGTAGGCATAAACACCCAGCAGCATTTTGGAATAACCGACACGGCAGACTTCACCACATTCACCTCACGGATGTAGTCGCTGCCCATCGCATTCATGATGGCCCGCTGAAAGGGCAGTGTTTCCCAGCGCCCTTCCTGGTATGCGGATTCTTTTCGGGAGATAGTAATTAGCATCCGCCCATTCAACGGCGGTCTGTGGCTCCGGCCTGAACAGGAGCGAAGCCCGGCGCGGACAAAATGCCGCAGCCTGTTAACCTGACTGTTCGATATATTCACTCAGCAACCCCGGTATCAGTTCATCCAGCGCGGCTGCTTTGTTCATGGCTTTGATGATATCCCGTTTCAGGAAATCAACATGTCGGTTTTCCAGTTCCGGAAAACGCCGCTGCACCGACAGGGGAGCCGTCGAGAATACTGGCAATTTCACCTGCGATTGAGCGACAGCACGAAAGTACAGAATGCGGTTTCCACCACTTCAGCGGAGTCTCTGGCATTCTTCAGTTCCTGTGCGTCGGCCGGCGCACGCGTAAGTCGATGGCGTTCGTACTCAATAGTTCCTGGCTGGAGATCTGCCTCGCTGGCTGCTGCCGCAGTTCTTCAACCTCCCGGCGCAGCTTTTCGTTCTCAATTTCAGCATCCCTTCGGCATACCATTTTATGACGGCGCTGCAGAGTCATAAAGCACCTCATTACCCTGCCACCGCCTCGCAGAACGGGCATTCCCTGTTCCTGCCAGTTCTGAATGGTACGGATACTCGCACCGAAAATGTCAGCCAGCTGCTTTTGTTGACTTCCATTGTTCATTCCACGGACAAAACAGAGAAAGGAACGACAGAGGCCAAAAGCTCGCTTTCAGCAGCCCTGTCGTTTCCTTCTTTCAGAGGGTATTTTAAATAAAAACATTAAGTTATGACGAAGAAGAACGGAAACGCCTTAAACCGGAAAATTTTCATAAATAGCGAAAACCC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sample_layout.fasta	Mon Jun 11 16:47:50 2018 -0400
@@ -0,0 +1,2 @@
+>utg000001l
+AAAGTGATAATGATTATGATTATCATCTACATATCTACAACGTGCGTGGAGGCCATCAAACCACGTCAAATAATCAATTATGACGCAGGTATCGTATTAATTGATCTGCATCAACTTAACGGTTCAAAACAACTTCAGACAATACAAAGGTCAGCACTGAATACGGGGCAACCTCATGTCAACGAAGAAACCAAAGAACCCGCAGAACAACAACCCGGACCCGCTTTTCCAACCAAATGATTGAACAAATTAACATCGCTGAGCAAAGGGAGTCGGGAATTCTCAGCCTGGGTCATTGAAGCCTGCTGGAGACTAACGTCAGAAAAGAGAGCATATACATCAATTAAAGTGATGAAGAATGAACATCCCGCGTTCTTCCCTCGAGAACAGGACGGTATGTAACCCCACTTAAGTCCCGAAGTCGCAGGAGTGAAGCATCTGAGTTGCAGTTACCACTTTCCTGACAGTGACTTGCGTGTGTGTTGGCTGGTGTCACAGACTAAATAGTTTGAATGATTAGCAGTTATGGTGATCAGTCAACCACTAGGAATAATCCTTCATATTATTATCGTGCTTCACCAACGCTTCCACTTCCTCGCATCCTTCCCCTACACCTTGCTGTTCTACATGCAATTACAACATCAGGGTAACTCATAGAAATGGGTGCTATTAAGCATATTTACACGAATCAGATCACGGAGGAGTAAATCAGCAGATTGTTCTTTATTCATTTTGTCGCTCATGCGCGCTTGCTCTTCATCTAGCGGTTAAAATATTACTTCAAATCTCTTTCTGTATGAAGATTTGAGCACGTTGGCCTTAAGCCATCTGTCGGTTTAGCGTTGTATTTCCCTCCAGAATGCCAGCAGGACGCAATTTTGTTACGCAACCAATACTATTAAGTGAAAACATTCCTAATATTGACATAAATCATCAACAAACACAGGAATAAGACAGATTGAACGATAAAAACGATAATGCAAACTACGTGCCTGCAGTACAGGGGAAGTACCAGCATGGAGCCGAGAGATGCCATTTAAAGAAATATTCCAATCAAGTGCGAAGGATTTAGACTGTGAATTGTTTTTATTCTGAACTAAACGTCACAACGTTCACATTATATTTGTTATCTAGCCCAGACTACTGTCGCCTTCGTGCCACGCTACAGCCGCGTGTTATAACCCGCCAATCTTAAAAAGGTTGTAAATGTTAATTCTCAAGAAACACGCATTATAAGAAACGTCCTATGATAGATTGAAATCAAGAGAAATCACATTTCAGCAATAAGGGAAAAATCTTAAAGCAGGAGTTTTCCGATCGGTTACAAATATCCATGAACATAAAGATATTACTATACCTTTGATAATTCATTACTATTTACTGAGAGCATTCAGAACACTACACAAATCTTTCCACGAAGCTCATAACGTTGCTACGCTTCTTCCGTGCGTGTCAGCACCGGGGCGTTGGCATCAATGCAATACCGTGTACGCGCTAAACCCTGTGTGTGCATCGGTCCTCAATTATTTACGCCGGACACTCCCCGCAGAGAATTCCCGTCAGGGCTGTGGACATAGTTAATCCGGGATCACGACCGATTGCCGCACCGAGAATACAGCAGTAAATATTAAATATGAAATTTCAACTCATTGTTTATAGGGTTTATTAATTTTCTACACATACGATTCTGCGAACTTCAAAAAGCATCGGGAATAACACCATGAAAAATGCCTCGGGCCTCCGCCCCTGCTTATTGGATGTGCTCAACAGACGTTTACTGTTCAAACAAAAGCAGCAGTAGCACCAAGGAAACCATCACCATCATTTCTTCTTTCGTTTCTGGAATTGGGCAGAAGAAAACTGTCGTGATGCAGCCAAATTTGTGGCGGCGCAGAAAATGTTGTCAAACAGAAACCCAGCAAACATTCAAATGGAATTGCTCGGTTTTATTACTTTAGCATTTATACTCATGGAAGCGCGTGTGTATTGCTCAATAATTGCATTCATGCATTACAGTCCGATATGGGCAACTCTATCTGCACTGCTCAGGATATATTTCTGGGTTCCTTCCAGTTGTTTAGCAGTGATGATCAGCCTCTCTCTGAGGGTGAAATAATCCCGTTTAAGCTCCGTCTGCCAGTCGGGGGAGGCTGCATTATCCACGGAGGCGGTGGTGGCTGCATTCACGCAGCACGACCCCGTGGAGTGGCAAATGAGCACGACGAGAAGAGCTTAACATCATCACGCAGAGCATCCTTCAGCTTAGCATCAGCCTACTAACTAATTCGTGCCTTTCCCATTTCGGGCTGCCGGCGATAATACAGCCCGCTGACGCATCTGCAGTGTCAGTAATTGCCGCGTTCTCAGCTTCGTTTTCTCTGAGAGCATTTTGTCGCGCTCCGTTGTAGGCATGGCGTTATCACGGTAATGATTAACAGCCCATGAATAAGCAGACGATGAGGATGCAGATAACCAGAGCGGAGATACTAATCGCGGTGACTGCTCATACGTAATCTCTGACCGTTCTCACGCTTCTTGAATTTGCAATCAGGCTGTCAGCCTTATGCTGAACTGACCAGACAGGGGACGGCAGTGAAGCCCCAGATATGCTGCAACGGTCGATTGCCTGACGGATATCACCACAGATCAATCATAGGTAAAGCGCCACGCGGGCTTAATCTTGCTGCATGCCACAGCGTCTGACTTTCGGAGAGAAGTCTTTTCAGCCAAGCTGCTTGCGGGTAGGCATCCCACCAACGGAAAGAAGCTGGCTCAGTCGGCGCCTGTTGATTTGAGTTTTGGGTTTAGCGTGACATTTTGCTCCTGCAGGGAAGCTCCCAGCAGCGCACACCGCCTCCGAGACACAATAGTCCATAACCATGATTTCTGGTTGGTAGTCGTTATCAGTTCCCTCCGACCACGTCAGCATATCGAGGAACGCCTACGTTGATTATTGATTTCTACCATCTTCTACTCCGGCTTTACAACGGCAGCGAAGCGTTTGATAAGCGAACCAATTCGAGTCAGTACCGATGTAGCCGATAAACACGCTCGTTATAAGCCGAGATTGCTACTTAGAGTCCGTGAAGTCGAGAAGTACAGGAGAATGAACTAGCGGCGATAATGGCGCGCGCACATCGTTGCGGTTCGTCGATTACTGTTTTGTAAACGCACCGGGTTTATATCTGCCTCGAAGGTACGCCATTGCAAACGCATTAAAGCAATGCCTTGTTCCGGCTCCTTTGCCGCGAGAAGCGGCCAACAGGTCATGTTTTTCTCGGCATCTTCATGTCTTACCCCAATAAAGGGATTTGCTCTATTTAATTAGGAATAAGTGATTACTGACGCTAAACAAATCCAGGCTGTGTTTATAATCAGATTTGTTCGTGACCGATATGCACGGGCAAAACGGAGATTTGTCCCCTGGCTCCTGCCTCGCCCGCTTCACGAAGGTCATCCCGAGGGAAGGAGCCCGTACACGTCCCAGCATGAATCCCAGAGAAGACAGTGGCTACGGCTCAGTTTGGGTTGTGCTGTTGCCTGGCGGCGATGACGCCTGATGGATTTGTGATCCGGTTCTGCTTCGGTATTCACTCACGGTGATTCACACAACGCGGAAAGAGCAGATCTGGCTAACCAGGCTCGACTCTTCACGATTATCGACTCAATGCTTATTACCTGTTTGTACCACTACAAAAACCCCGAAATCCATTCATGCAGGCTCACTATTACCTGCGAACTGTTTTCGGGATTGCATTTGCAGACCTCTCTGCCATGCGATGGTTGGAGTTCCAGACGATACGTCGAAGTGACCAACTAGGCGGAATCGGTAGTAAGGCCCCCTCTTTTCATCTCACCCACAACGAGCGAATTAACCCATCGTTGAGTCAAATTTACCCAATTTATTCAATAAGTCAATATCATGCCGTTAATATGTTGCCATCCGTGGCAATCATGCTGCTAACGTGACCGCATTCAACTGTGTCGGCTTCTCTCTTCGTTGGGATGCCTCGCCAGAGCTTCATACAGCGAGGGACATGGGGTAACAGGTGGGTTGGGTAAGGTTTTGGGATCGCGGGCGGAACCACGGCGATCCGTCCCCGCGAAGCCTGAATGCATGAAGAGTGCTGACGCCTTTGCATCTTCCGACTCCCTTCTACGACAACTCTCCCCCACAGCTCTGTTTGGCAATATCAACCGCACGGCCTGTACCATGGCAATCTTGCATCTTGCCCCCGGCGTCGTCGCGGCACTACGGCAATAATCCGCATAAGCGAATGTTGCGGCTAATTTGCAGTACTTTGCCTTAGTATTCCTTCAAGCGGTTGCCACCACGGTATTTCCCATCCATTGTGCAAATGCATCAGATAGTTGATATAGCCTTTGTCGTCGTATCCATGAGTTCGTGCTTACCGCAGAATGCAGCCATACCGAATCCATGCTTGATCATTGCGTATCCCCATAGCAGCCATCACATCAGTACCGGAAAGAGTCAGAAGCACGTGGCCCGTGGTGAGTGGTCGCTCATCATCGGGAGCTTTTGGCGAATGAAATTTATTACCACGCTTTCGAGTCGCCTGCCTTCTCCCTGTACCTGCGATCGATGTGCCTTCCCCGCAGAACACTGCGCCGGTATCGATATACATTTGGTTGGCAAACTTGAGTGGTTTCACTGCTGGCGTATGACCAAAGATGAACGTGTCCCTAGCTTTGATTCTTTCACGATCCCGTTTTGTGAGTTGCTGATTCGCATTAGAGTTCGCGCAACCCCACAGCTGAGGCAGGATAACCGCTTTCCAAACTCGTATTCGTCAAAGGATAATCGGGGCAGATAACATATTTATCTTTGCTCACCAGTTCGATGATTAACGGAAGTTCATCTGCTTTATGGGCAAGAGCTTTAGCCAGAATTTCTTTGTCGTAATTCGATTAAAGAACCAGCCCGCCATTAAGCAGCCAGTGATTAACGTTTCCACGCTCTGATAAGCCATCAATCATCATTTGCTCATGCACTTCCACGTACAGCTCTGAACCAGGGAATGTGATTAATTCCAGGCATTCAACGTTCTGCACCACGATCAACCAAATCGCCACGAGATAAGCAGGTCTTTTTGTTGTCGAATCCAATCGTATCGCGTGTCGGCGCCTTCATCCATTCGGTTCGTGCCAGTACGCCAACTACCAAATATTTCGGTATTTGCTGCCATCAATTTTCGTAATAGCGCCAATCTCTTTCACTCCTCCATCCGCGATGACGATGAGGAACGTCGTTGACGATGGCGTGCATTTTCCCGTCTTTATCATCAACGTATTTTTCTGACGGTCACCGCGACCCATTTCAGTCGGGCGTATGCCTTTACGCTTGCGTGGTTGAGCGCAACGAGCGTTTTTACTGAGAACGTCATGCGGCCTCACTTCTTATTTACTCGGTTATTTGAGTTTCTGTTTATACTCTGCCTTGATCGCCTTTGCACTCTTCGGAGTGGCGATGGCGGTTATGGTTTTGATTCGATTTTCGTCTACTGCTGCCTTCCTGCCCGATGCGGCTAATCAGTTCGACGCGATACGCGGAACGAGGATTTCCGCTTTGTGCTGGTTGCACACGCATTGCTTGTGAATATTGCGTCTCATTAATCGGAGTTGAGCTGCAGCAGTTATTCCGGTAATGTCGGCATCCCACTGAGCAGACGTAGTGAGCTTCAGGGCACGAGATACATGGTAAGTCGCTTCTCTTCTGCCTGACTCGGCGCGTGTACGGCTTGTTGGCTGTGTTTAATCCAGTAACTGATCGGGGCTTTAAGGCGAGTTTTCGAGTAATCTTAAGTTTATCTTCTGTTTATTCTTAGCTCCTTATACGTCGTCGTTTCTTCTGGACCCTGCTTTTCCGCTTTCGCGTTCTTTACCTTCGTCGTTCGATGCTATCTTGGTTCCACTCTGGAGAGCACCACCACTGATTAGCGAATGCAGAGGTGAAACCATTCCCGGCATTCATGTAGTTTTACATCGTCTTCGCGCTGGTTTAGCCCATCATCTTCTTCCTCGTGCATCGAGGCCTTCAATCGGGCTCATCAGTTCTGCGCAGCAGTGCTCACACGTGAACTTCCACGCCTGCAACATTCTTACGCAGTGCCCACGTTAAAGCTCGGTCGACGCTTTCTTGTTCGTAACTTCGATTTTGGTCAATCACCTTGTTTTCCTCGCACGACGTTAGCCTAGATATCCCACAGCTGAGCCGTGTAGTTGAAGGTTTTACGTCAGATTCTTTTGGGGGTGGGTTAATTTCTGCGTTTCGTTGGAAGGTTTGCGATTTCGCAGATTATGTCGTAACCTTCGTTAGATTTACCACGTTAACGGTTCCTTAGAACATCCTCTAGATTGTTGGTTCTTTCACACCGAGACCCATCGATTCCGTAAGGATTGATTTGGTCGGAAACGCGGTTATCTTCTTTGCATTCACGCACCGATAACATCGCATCATGCAGCTTCCCTCGCATGTGCTGAAATCAACATGCCCTCCTCCAAATATTTCGCATGACTCAGAACAAGAGCCGGTATTGAATCTTTTAGCTCGTACCATGTCCTGAACAGGGCTGTACATAATCATTTTCTGAATACATTTCGCGATACCGTCCAGCGAAGACATTCTTCCTCGTATAAGCTAATCTCCTTTGGCGTTTCCCGATGTCCGTCACGCACATGGGATCCCGTGAGTACTCATTAAAAACACGCTGCAATCTAACTCCTCATCTTTGCAGGCAAGTCGAATTTTTGCGTTGATTTTTAATGCAGAATATGCAGTTACCGAGATGTTCCGGTGTTGCAAATCGAAATGGTTGTTGCTTCCACCATGCAGGAGTATCTTCCTTCTCAAAGTCTGACAGTTCAGCTCAAAGATATCTGATTCCAGGCTTAGTTGGCTTGCTGACGCTTCGGTTCATCGCTCTGATCGATCAGATTAGTGATTCCTACGAAATGGTCATCACAGTATTTGGTGAAGGGAACGAATTTTAATCTGTCAGTGCAGAACCGCGCCGCCGACGTATGAATCAGATTTCAATTACCATATCGATAACTCGTCAGAACAGGGCAATCCTCGTCTGAATATCCTTTGGTTCCCATACCGTATAACCATTTGGCTGTCAAACAATGCTCCGGCCTGCGATACGGTAAGTACTGGTGAACGAAGAGGGAGGGGCTCCAGAACTTCACAACTTCCCTGACAAACCGATATGTTAGCTTGGATGTTCACAACCGTATCCATGAAAACGTAATGCACGTCTTTACCTGCCCGTCGCTTTTAGCTCCATTAGCCAGAGCGATATGCTTTTAACATGCTAAGAGAAACTAACACATTTATCATGCAGCCCTGTCTCCCCATCTCGCTTTCCACTGTACCAGCCAGTCTCGTCGTCTGACCACTTAACGCCACTCTCTTAGCGATTGCCTGTATAAGGTAGCTCTAATAGCTCCGCAAATTCGCGCCGCATCACTCCTGCATGGTTGACTGGCCTTACTAAGATAACGCGCTTCCCGGCAAGGTTAGGAACAACATCCTGCTGCTTTAATGCCATGCGGTAAACACACTTCCAGCTTTCTGCATCCAGCCAGCGACCTGCCATTCAACCTGACGCAGAGACGTCACCTAAGCAGGCCCAGCTAACCTGTTTTGGTCTAAGCTGCGGTTGCGTTCCTGAATGGTTACTACACGATTGGTTTGGTTGAGTCTGAAGGGATTTGCTGTACTGCGTGAATAGCGTTTTGCTGATGTGCTGCGATCGAATTTCAAAGAGTTAGTTTTTCATGACTTCCCTCTCCCCCAATAAAGGCCTGCGTACCAGCAGTAGATTTATTATTAGCTCAGTAATGTAATGGTCATCTTTTAACTCCATATACCGCCAATACCGTTCATCGCGGCACTCTGGCGACATCCCACTCCATGTCGTTAACATCTTTCCTTCCCGTCTTCTAGACCAAACCGGCTGCTCCACCGTTCCTAATATGCTTCGATCAGACCGACCTGCCCGTGCCATTTTGACTCACTCTGCTGATTATGCATGGTTACTGTTTGCACCCTGTTGGCGCGGCAACGTCGAGGCGCACGAGGCACAGACTGCTATGCGTTGGCCAGGTAATGAATAATTGCCTCTTTGCCCGTCAGCCCATTGCTGGCTTTCAGTTAGAACTGCTACGTCTCTTTTATCGAATGTCACGCAGGGTAGTGTCCGCGTGCCAGTGACGACAGATGACAGGAGTTGATTTGGTTCAGGGAGTACGCCTCACCACGGTTAATTCTCGCAGTCATATGGACAAGCTCATCTGCGGCCTGCGGCGTAATTCGCATCAGTAAGCGCATTGGCCCGCATGTTTGATGACCAGGTTGGTACAGCCATGAGTGCGCGTTTGATTTCCGCTCCATCGCATCCGGATACGAGGCCTCGCTTCCGGCAATACTCGTAAAACCATATCAACCAGCTCGCTGACGTTTGGCAGTCCGGCGGTAACGGATGCTGCTTCCCGGCGCCATGCAATCAAACTGCCGGATGATGGCAGAAATAGTCGATTCTGCCCCGACGAATGAAGCACGACGGGCTACCGCGCATTCCTGCGTTAACCTGTTCCATCGTGACCGTGGCTTTCCCAAAAGCCAGAATGCCACTGGCATAGCGTGCTTTCACTTCGTTTGGTCACGTTAGCCGCACCGACGGGGGAAAGTTGCCAGTACTGGCTGAACACACCGTTGATGATCTGCGCTACCTGCTGTACTGCGGCTTTTCGTTATCGTACTGTTCCGGCATGTTGTTGGCGATCCGACGCATCTGCTCACACGTCAAGTTAACCATCTGTGCCGGGGTGTTTTCACGTACACCCCGTAAATCCGTCTGTGTTTGTCAGGTCGAGTTTGGTTTGCCTGGCTGTCACGCTGCCTGTTCATGTTACGGTCCTTTCGAGAGTTGGGTCCACTTATCGCGGAGTTTGGCCGGGCCTACCGACACGTTACCGGACCAGAAATTTGGCTGGCATGCCCAGCGGAACAGCACACATGTCGCGTATGCGTCACGTTCACGCATCAGGCGATATCGTTTAGCCCACCCATACAAATTCGGTTCTCTTATCGCTCTGCGCTCGGTCTTCGCTGTCGGCTCCGCTCTGCGGCGGTCAGTCTTCCTGTTTACCATTGCTTACATCGATCCGAAGCATCCGTTCAACCTCCGACGGAAGGTCGTTTTCTGGCTCGTGCCGCATTCGCCAGAATTCCTTAACGGGAATAAATCTTTCTTTTCTTTGTAATAGTGTCTCGTTGTGTCCGCAATGGGAGAAGGCCGCAGGTTTGAACCGCGGTTTTATCCTCGTCGGGATTTTCAGCGTTTGAGGGATGCACCCATTCTGGCGCTTTTTATTTGGTTACGACCCTGCCGCCTTGCTGCTTGATAATATTCATTCTGACGAGTTCTAACTTGTAGTCATTGCCGTTTGACAGGTAACTTTGTAATCTCGCTACAGTTGAGAATCGGTGATTCGTCCATTGGTTTATTCCCAGCTGTCACAGTAGCAAGCAGCACTACTTCCTTAAACTGTCGCTTGGTCAGATCTGCCCGAATAAGCCTCTACCACCAGCATATTTACTCAGTCTGAGTAACCATCGAGATCTGCCACATTACTCCTGTCCAACAGGTCTCTATGCCGAAGTTGAGTATTTTGCTTATTTGTCATAAGCCGAGACTCGAAGCGGGAGGGAACTCCATTCTCCGGTTCCGGCCGCTTGCCCGGGCGTTGATTAGTGAGAATCGCAGCAAATGTCGCGCGCCAATCGAGCCATGTCGTCGTCACGTACCGCATTCAAGAACAGCAAGCAGCATTGAGAACTTTGGAATCCAGTCCCTCTTCCACCCTGCTCAATGCGACTTATCAACGCCACAGCTTCCTGTCTTCCCCGTTCCAAGCATGCGATTTGTTAAGCAACGCACTCTGGATTCGTAGAGCCTCGTTGCGTTGTTGCACGAACCATATGTAATATTTCCAAAATAACAATTGATTGAATCTTACAAATAAATGCAGCCCAGGCTTGGTTTAATTTGATGCCCTTTCAGGCTGGAATCATAGGGGTTATTTATGCTGTTGTTTTGTAGAAGCGAGCGTCCGCCTCCGCATAAACGCTTCCATCAGCGTTTATAGTCAAAAATCTTTCGGCCTGCATGAATGGCCTTGTTTAATCGCCATTTGATACGCCGAGATCTTTAGCTGTCTTGGTTTGCTCCGATATTCTCGTATTTCCGGATGCGTTGTTCAGACAATACTGCTCCTGCGTACCGCCAGGTAAATAGTCAACACGCACGGTGTTAGATATTTATCCTTGCGGTGGAGTTACTGACTTGAGCACAAAGAAACCATTAACAACAGAGCAGCTTAATCGCACGTCGCCTTAAAGCAATTTATGAAAGAAAAGTGAAGTGGGCTTATCCAGGAATCTTCGCGCCGAGGGAGCAGTTCTGCTTTATTTAATGGCATCAATGCAGTTAATCAAATTAGCCCGCATCTTGCTTACAAATTCTCAAAGTTAGCGTTGACGAATTAGCGGTTAGTATGCAGCCGTCACTTAGAAGTGAGGGTAGCGTACCTTTCTACTGTTCAGGCAGGATGTTCATCTAAGCTGTGACTTTACCAAAGGCTTGCGAGAGATGGGTAAGCACACGACCAAAAGGCCGATCGGGTCAATGCTTTCTGGCGAGTTGAAGGATTGCAGGACCGGCCAGTAACAGCTTCAAGCGTACACCCTTTCCTGACGCTAGAATGTAATTCTCGTCACTGAGCAGGGCTGTTGAGCCAGGCTTCGCATAGCCAGACTTGGGGGTGATGGTTTTTACCCAGTCAAGAAACTGATCAGGATAGCGGTCCTGTTTTACAACTAACCTAAACCCACGTACCCAATGATCCATGCAATGAGTGTTCCAGGCGGGAAAGAGGAATGGGAGTGGCCTGAAGAGACGTTTGCTGATCGGACTGTTCTGGTCTGGCGCATAGTTGATAACAATTGAGCACAATTCATCGAATTAGGAATTTTCACTCCTCCGAGAACATAAAGTAAATGGATTGAATTATGAAGAATGGTTTATGCGACTTACGCAGCAAAATAAAGGAAAGATACAGCTGATAAACCTGTCTGTTTTCCTGCATTCTGCTGGCTCATCATCACCTGCGAGTTGGCTGCATTATTGTATATTCATAAAATCGATGGAAAAACTTTTCTCTTTACCAAACAAATAAAGAGTGGTTTAGTATAATTCTAACTATTCAGTTGAAGATAGCAGAACAGCCTCGCATGACGAATCATTGGGATTCCCATCTTTGTTGAAGGGCGACACCATTGGTTTTGCCAGAACTGTTCGGCCGACCATCGATCTGACCATTTAATCGGGAAAGGAAGTGGTTTAAGCAGTGGAGAGCGCGTTCAGATAGCGTCCACTAGATGAGGCGTCAACCGTCCAAAGACGATGTTGGATATGCATTTCATCGGCCGAACAACGGTGAGCGACTAAGCTAGCTTGGTTTGGCGTATATTAAAGGTCTTAGCGTAACAGATATTAAATGAAGGGAGCTTTGACTCATTGGATAGTCATTAAGCCAAAATTTAAAGGGATAAAAGGTTGCCAAGGATATTATTTATACCGTCAGCTCGATCGACATTAGCCTGCGGCAAAGATGAGGCTGGAGTCTTTTAACAGAACAGTCTATCAAAGCTGACCTAAGGGGACCCTTAGCCCATCGCCTAGTGCGAACCATGGGAGCGCTGAAGAGGCGCATCTCATTAGCAAGAATGAAACCAGCTCATACTGGAATGGCTTTAAAGCAGGGCAAAGTAAGGATTAATTATATGGAGTAATTATGCCGCGAGAACGAGAATCATGCGGTGTTTACATAGTAATAATTCCTCATCGTTATCGTAAGCATTCATGGCCTTTCCTCCATTCCTCTGTTTCTTTTCAGGCTAGTCATGGTCTTGGGGCGAGTACTTATCATATGCAGGAATAGATGCAATTCTGATTGCTGCCTTGACGTTTAATGGGAAGCAGAACGCGCGACCAGAATTAGGATATAACCCTGTAGTCTTGTCTATTAATTTGTCAGCTTGGCGCTTCTGCCAATCTTTAGTCTTCAGCTAGCGGGTAGCATGGCTCTAGTCTCGGGCGGCTTGCCTCTTGCTCCTGCGTTCATTCAAGTGCATCGTTGGACCTTTTACGATATCTACGGTACCCTCAAACTGTTGCCGGACCATCGCACCCCAAAACACATAACCAATTGTATTTATTGAAAGTAAATAGATACAACTCACTAAACAGCAATTCAGATCTCTCACCTACCAAACATGCCCCCTTGCAAAATAATTCATAAACATACACAGATAACCATCTTGCGGTACAATTATCTGGCGGTGTTGACATAAATACCGGTGATACTGAGCAAGAGCAGGACGGACTGACTACCATGAAGGTGACGCTCTTAAAATTAAGCCCTGAAGAAGGGCAGCATTCAAAAAGCAGAAGGCGTCCTGTGTGATACGAAACGAAGCATTGGCCGTACCGGATTAGCTGCCAATGTCGAGGACCCCGGGGGTTTTCGTTGCTAACTACAACTGCCACACACCACAATAGGACTGACAGGCGAATCCAGATGGATGCACAAAAGCCCGCCGCCTAAGAACGTCGCGCAGGGAAACAGGCTCAAGCATCGTGAAGAAAGCAGCAAATCCCTGTTGTATTCGGCGTAAGCGCAAAACCAGTTAACCACCGCCTATTCTCGCTGCAAATTCGCAACTGAAATCACGATATGAAAGCGCACGCACTAAATCGATAGACCTTACAGTGCTGGCTGAATACCACAAACAGATTGAAGCAACCTGCAACGTATTGGAGCGCAAGAATCAGCGCACATGGTACAGCAAGCCTGGCGAACGCAGCAATAACATGCAGTGGACGCAGAAAATCTAATGTTAATAAGGGAAAATCGATTCCTCTTATCTAGTTACTTAGATATTGGCCTTGGCTTTATCTCAATATTATACGCATTACTATCTGGCAACTAATTCAGTTAGAGTAAATATCCTCAATAGGGAATAATATGCCGCTTTCCATTCCATCGGGAAAAGTTTTGTTCAACACACCAAGCACTCAATCGACCTACTAATGTATGGGAATTGTTTTGATGTAACCACATACTTCCTGCCTTCATTAAGGGCTGCGCACAAAACCATAGATTGCTCTTCTGTAAGGTTTTGAATTACTGATCGCATTTATCGCGTTTTTGCATCTTAATGCGTGCGTTTTCTTAGCTTAAATGACGGTCTATCTGGCGCTGGCAATAGCTGATAATCGATGCACATTAATTGCTAGCGAAAATGCAAGCAAGACGAAAACATGCCACCACATGAGGAATACCGATTCTCATTATAACATATTCAGGCCAGTTATCTGGCTTAAAGCAAGTTAATACCAATAAGATCATATACATGGTTCTCTCCAGAGGTTCTCATTACTGAACGCTCGTCCTACAGAATAACGAGTGGATCCATTTCTATACTCATATCAACTGTAGGGGTTGTAATAGTTTATCCGATTTCTGCTCGCTGTAGGGTAACACGAGAACGAGCCTGATGTGGTTAAAAGACAGGCACAATCTTTACTACCGCAATCCACTATTTAAGGTGATATATGGTCAAAGAAAGAATTTGAAGAGTTCGAAGAGCATCCTACAGGATGTGATGGAACATACCAGGACTATCCGTATGACTACGACTATTAACTAAATCAATGGTGTGGACAATTCAAGCGATGCAATGGATGCAAGCTGCAATCGGAATGCATGGTTAAGCTGAAGAAGATGTTTCCTGTAATGGAAGATGGGAAATATGTCGATAAATGGGCAATACGAACGACGGCAATGATTGCCAGAGAACTTGGTAAACAGAACAACAAAGCTGCCTGATAGTGGCCTTTATTTTTGTAGCATAAATAACAGAATAAACACTGCACTGTGTATTCATTCCAACGAGTGAATACACGATGCAATGTCGCACTCGTAACTAAACAGGAGCTAAATGTTCTGATTATTGGAAATCTTCTTTGCCCTCCAGTGTGAGGGCAGTTTTATCTGTGAGGATATGAACAGATGTCAAACATCAAAATACATCATTACGTACGACTGGAAAGCATCAATAGAAATTGGACGAAATCGACCATGACTTAATGACAGAGGAAAAACTTCACCAGATTAATAATTTCTTCAGTAGACTCTGAATACCGACTCAATAAACACGGCTCTGTATTAAATGCGCTGTATTAATCATGCTGGCGCAACATGCTCTCAGTAGCAATTTCAAGCGACTTAAATGCATATGGTGTTGTGTGTGGATTCGACTGGAATGATGTGAATGGAAAACCTTTAGTCAGGAAGGATGGCCTCCAATGGATGTAGCGAAGGAATAAGAATTACCGATATCGATACATCAGGAATTACTTTCTTTGATTCAAGATGATATGACTATCAAGGCCGCCCTGAGTGCGGTTTTACGCATACCAATAACGCCTTCACTCGAGGCGTTTTCGTTATGTATAAATAAGGAGCACACCCATGCAATATGCCATTGCAGGGTGGATCGTCGCTGGCTGCCTTCCGAATCTTCTACTTGAACGAATCACCCGTAAATTACGTGACGGATGGAACGCCTTATCGACAACTACTTAGATCACGGCCAGGAGTCCCAAAGAATGATGGATCAAACACTTATGGCTATCCAGACTAAATTCACTATCGCCACTTTTATTGGCGATGAAAGATGTTTCGTGAAGCCGTCGACGCTTATAAATGGATATTAATACTGAAATATCGAGCAGATTACAACAAAGCATTCACTAACCCCCTTTCCTGTTTCCTAATCAGCCCGGCATTTCGCGGGCGATGATTTCACAGCTATTTCAGGAGATTCAGCCATGAACGGTGCCATTCAGGATCGTCTTGAGGCTCAGAGCTGGGCGCGTCAGCAGCAGCTCGCATTCATGGTGCAAAGAGAAAGAGGCAGAACTGGCAGGACGACTGAAAAGGCCGCCTGCCCCAGGCTACCTGTTGAATGCTATGCATCGATCATTTGCAACGCCACGCGCCGGAGCAAAAGAACCATTACCCGTGCGTTTGATGACGGGCCGGATGTTGAGTTTCAGGAGGAGCGCCGCATGGCGAACGGAACATCCATCCTGGTCGAAACCATTGCTCACCACCAGGTTGATATTATTGATTCAGAGGTATCAAACGAATGGCTGACTGCATACCGCAACGCCCTGGCTGGGAAGCTGGCTGAACGTGCATGGATTCTGTCGACCCACGAAGGAACTGATCATCACCACTCTTCGCCAGACGCATTTAAAGGTGATGCCAGCGATGCGCATTTCATCTTCGCATTACTGATCGTTGCCAACCAGTACGGCCTTAATCCCTAAGGTCAACGAAAGAAATTACTACGCCTTTCCTGATACCGGAAGAATGGCATCGTTCCGGTGGCGTTGATGGCTGGTCCCGCATCAGGTTAATGAAAACCAGCAGTTTGATGGACGCATGGACTTTGAGCAAGGACAATGAATCCTGTACATGCCGGATTTGGTCACCGCAAGGACCGTAATCATCCAGATCTGCGTTACCGAATGGATGGGATGAATGCCGCCGCGAACCCATTCAAACTCGCGCCGAAGGCAGAGAAATCACGCTGTGCAGTCGCATCCCAAACGCTCCATTGTTGTTACGTCATAAAGCCATGATTCAGTGTGCCCGTCTGGCCTTCGATTTGCTGGTATATCTATGACAAGGATGAAGCCGAGCGCCGCATTGTCGAAAATACTGCATACACTGCATGAACGTCAGCCTGAACGCGACATCACTCCGGTTAACGATGATGAAACCATGCAGGAGATTAACACTCTGCTGATCTGCCTCCGGATAAAACATGGGATGACGACTTATTGCCGCCGCTCTGTTCCCCAGATATTTCGCCGCCCGACATTCGAATGTGACGTTGCACATGACAGGCACGAGCAGTAAAAGCGCCTGATCGCTTCCTGAAACAGAAAGCCGCAGAGCAGAAGGTGGCAGCAGCATGACACCGGACATTATCCTGCAGCGTACCGGGATCGATGTGGAGCCCTGTCGAACAGGGATGATGCGTCGAACAAATTACGGCTCGGCGTCACTCCACGCCCGCTTCGAAGTCCACAACGTGGCACCCGAAAACCCCGACTCAGAAAGAAGTGGCCTGACATGGAACAACTTTAACCTTCCACACCGCTGCCGTTGCTGAGGTTTTGCACCGGTGTGGCTCTGAAGTTAACGCTAAAGCAACTCGTCCGGGGAAAACAGTACGCAGAACGACGCCAAAGCCTGTTTGACGATTCACTTCTAGCGTGAATGTTACTGAATCCCCAATCATCTATCGCCGCGACGCAAACTACTGCGTACCGCCTGCTCTCCCGATGGTTGGCTTATGCATGACGCAACGGCCTGAATCGAACTGAAATGCCCGTTTACCTCCCGCCTGGATTTCATGAAGTTCTATCAGGCTCGGTGGTTTCGGGTGGGTCAGAGACAAAGTCAGCTGGATGATAGCCCCTGACCCAGGTGCAGTACAGCGGGCATGTGACTCGACGCGAAAAAGATCGCCTGGTGATTTGCCAACTAACCTGACGTGCGTATGAAATCCAAATGCGTGAAGGCCTGCACGCATTATGTCGTTATTGAGCGCTACCCTGAACGAAAAAGTACATGGGGGTTTTGACGACGAGATTGATCGTGCCGGAGTTCATCGAAAAATGGAAGGGATCGAGCATGAAATTGGTTTTTGTATTTGGGGGAGCATCGATGACGCATCCTCACCACGCACCTCGGCCTAAGTAGGCCGCAATCACCTTTCACGTCTACTCCTAGTCGTATACAAAGCGAGGCTGGGTATTTCCCGGCCTTTCTGTTATCCGAAATCCACTGAAGCACTAAGCACTGGCTCGGAGGGTAGATAATCAATAAACGCTGTTATCTCATGCAACAAAGCATCTTCTGTTGAGTTAAGAACGAGTATCGGCCAGATGGCACACTCATGCTCAAATTGGAATCAGGTTTGTGCCCAATATGAAAGAGAACCGCAACGACCCTCCAGGATTTTAGCCGTTATAGCCGCATCCGTTCACAAAGGCTGGAAAACCGATGGTGCGAAAGGCAGAAGCAGATGAGAAACCAGGATATGACAACCACGGAATGCATTTTCTGGCAGCGGGCTTCATATTCTGTGTGCTTATGCTTGCCGACATGGGACTTGTTTAATGACACCTCATGCAGGAAAGCCCTCGATTCACAGCATTGCCGTCAGGCTAATTCTGAAATCAAAAGCCAGACATAGCAAGTTTCCGGATAAAACGTCGATGACATTTGCCGTAGCGGGTCGATACTGAAGAAGCACCGCGAAACGGTAACGCCCTGATGGGATTCACACACGACTCGATTTAAGCCACTAATGCAATCGGCAGCCTGTTAAACGATGTCTTTAAGGAACGATGAACATGAAAAGCAAAATCATCAGGGAGCAGCTCCTTTTATTATTCGCATTCACCTCAAGCGGCGTATTAACCAACAGTTCAGGGATTAATGAAAGATGGCAGACATCATTGATTCAGCATCAGAAATAGTACGGAATTACGGACGCAACACAGCACTAAAACAGCAATAAAATTCGCCTCCCTGTTTGACATACCAGGCTTGATGGGTCCTGTTGGCTAGCGACCCGGCTCATGAACCAAATAAACAAAGAAGACGCGCGAGCTGTTATTATGTCTAGTTTGACTGTGCAAGTCTCAGGCTAATTGGGACGTTATCAACAGTAGCTCCGACGCTGGCAAAGGCCGGCCGCACTCGCCGCGATCTCGGGCAAGCCGACAGCAGCCACTGATGACAGACTGTGATTAAACTAATCTGCGGTCCCAACGGCCAACATACGCAGCGCCGGACGCTTGTTAAGTCAGAACGGGAAAGAAACCAGCAAGATATCAACGGTAATCAGGAGAACGGTCCAGATATCGGGAAGTAATATCTAGCTAGAAAACTGCGTGCGTAGGCTAGAACAGGCAAAGTAAATTGAACTATACGGAGGTTTGACAGCTTTGGGCATTGTATAAGCGATGGGACCTGGAAAGGCAAATGACTAGAAGACCGACCATGCCTCGTAGCTGGAGTTCTTAAATCTTGTTGTTCGCCATCCTGAGGAAGACTCCTGTTGACTCAATGCACTGGTACCGGGAAGAGTTCCGGCAGTTAATCGAACAAGACCCGTTAACTATCGACTATTACGCATCGCTATTACGATTGGCAATCGTAATGGCCTCTTCTTCCCTGCGACTTCCTATCTGCATATGATGTCGAAGGAAGCGTGCTCCGCATTCATTAAGGAGTGAGATCGGTTTATACCAAAGATAACGCTTGTAAAATGCTGGACGATTTCGCGTCGTCTTCACAGCGATCCCAGTACTGTAGTGTCAGATGATGACGTACTCAACATCGCTATTGACGTATCTTACTGTTTCTTTACATAAACATTGCTGATACCGTTTAGCTGAAACGACCATTGCAAGGATTTATAAATGAGCATCGATGAGTCGGAGGAAAACGATTCTCCGTAGTCAAGTTAGAGTCGCTTCCTGCAACTACGAATGTTATGTAGATGAAGGTATAGATAGAGTCGCTACAAATATTCAATAAAGTTTATAAGTCGGACTAAATCCCCATTCTGCAATGTGCCAAAATGACTGATACGTGCCACGTGGTGACTCAGAATACGTGGGAACGATACTTGCCTCTGTACAAACATAGATGATTAAACCCAAGAGAAGAAGACTCCGGGATTAGATTTCTCCCACTCCCTCCGGGTTTGTTTATGGAGGTGATAACTTAAGTTCCGTACAGGAATGGAATGGAGCCATTCAACATTATGTACGAGGAGAAACATAGAATCAATGCTACTACACTGGATGATATGGCGCAGATAGCACATGCAAGACGTACGATATTCGATTGACAGAACTGAAGAACCAAGCTGCCTGATGGCTTTCTTGCGTAATCTCGGAGACTTGCGATGTATTGACATTTCAGAGTGGAACGCACGCCAGGCATCACCGTCCAAGAAGCCTTGAAACGTTCGTCGAGCGGTCGGAAGCGGCAGGAGCTCTTCCCACCCGCGTTACAGGATGGAAGAGAGATATCTGTTCCGGATTAAAGAGCGTTAACATTATCACTTAAATAGCACAGTAACAAGGTGGCCTTTGACACCAAGAGTGAAATGGGAAGAAGGCGAAGTCATGAGCGCCGGGAATCATTTACCCCCTAACCTTTAAGAAAACTTAGTAAGAGGCCACCATCACAGAATTGGGGTAAACCAGGCTACGGCAGTTACACAGCTAATGGGACACCCATGCAAGGGCCAGGTCAACATTGAGTCTTTCCAGACAACACAGCCTCTGACAGCGAATAAACAGTGATAATTCGCGTAGTTACGCTTCATGGCTGGGTCCGTCACCAACATTCTGGCCAGCAGAGGAAGTAAGCAGAAGCACACTCATAATTACGAGCAAATTAAAGCAATAAGGAGGGCTTCTTAGTGCTGTATTGCACATACCAAAGAAATTGCGGCAATGCCAAGCAGAGCACGCGCAAGGCGGCCGTACAGTTAATAAGTAAATGGCTGCGGTCTAAGCGCGAGGCAATAGCGCTACCGACCTATCAGTAAATGTCGTGCCTACTCGGCGCAAGTAGGTAAGGAGATACAAGATTACCTATGACGAAACTATGGCAAAATTATCAAGCAGCAGAATATACCATGTTGGCTAGACTTGCAATGGAGAACTGGCTGTTGTTCCGGGAAGGAGTCCTGATTTATGCGAAATGAAGTGGTATGTATCGTAGAGCGCGCATATGTCTGTTAAGCAAAGCAAACAGGCGTAAATGCCAGCCTCAACATTGCCCAGTGTCTCTGCGTATAAGGAATATTACATGAAGGAAACCTTGATAAATGCAAGAGTGTATCCGGCGGAACCATAATGCCATACTCTTTACCAGCCCCTTTCAACTGCTTGCTAGGCACATAGTTAATAGGTCTGCGCACGAAAGCTAGTCTTCTTCCACGACGGCATTAGCCTTTCACGAGTGCGCAGTTGTCTGCAAGACTCTATGAGAATACAGATAGGCCATAAGTGCCTACACTTCTCGGGCATAAGTCTTAACACCATGGCAACTACAGTATCGTGATAGAAGAGGCAGGAGGTGAGCAAATTGGAAATACATACGGCTTTGTTGTACTGATAGTGACCTATTCGTTGCACAAATTGACGGCTAATGCAGTTCTATTACTGTACGGCTAACTATGAACGAGAAACGTAAATGGTAACAATAGATATGTACTTAGATTTTAAGAGCCTCCACTACATACTGTAAAACACAACATATGCAGTCGGTACTATGAAGTACTATTATCTGTCTTACTGTAAATATAGAGCGGATTAGCCAAGGGCTTTGTGTTCTTGCGGTCATCAAACCTGTCGCACTCCAGAGAAGCAGCACCCGCACAAACGCCTAGATCCAGTGCAAAGCCTTGTCTCATATCACGACTGCATAACCAGTAAGAATAGCAGTGATGTCAAACGACGCAGCTGACTTCTTTCTTCCACGACTTCCCCACACCAGCATGCATACCTTCGATAATCGTCGATCTTTGGGTGGCCTAGGAGCGGAAGTAATACTAGAAAATGGCTACGAAGTCGTGGCTATCTATCGTATTAGTACTTGAAACGGTTCTTCAGAACCCTGAAGTCGCTAATCGTTCGGCGATACTATATATGCATTAAGCACTATATCGTTGGTATGACTAAACAGTGCACCATGCACATGAATAACAGTGCGGTCTGTAAAAGGAAGCAGAAAGCTAAATATGGAAAACTAATACGATGCCGTTAAGTTCAATACTACTAATTTAGATGGAACTAGCTTGTAATAGAGAGAGTAACTTAAAGAGAGATCCTGTGTTGCCGCCAAATAAATTGCGGTTATTTAATAAAATTAAGGGATTACTATATGTTGGAGTTTAGTTATTGAAAGAGGCGGGTATATTCCTGCGTTCAGTAGAAAAATAAGGCATTCCTACGAGCACGGTTGGAATGACTATTCCTTTGTTACAATGTTTTATCTTACTGTCTTTGATGGGGCTACGGCGAAAATGCGATATCGGAAATGTTAAAATTGGTTTTGTCATCAAAAGAAGAATACGGGCACTTATTCATTAATAGATAAAATTCAGTCAGACTCCCTGAAATGTTTTTCCCTTAGGTGAAAAGCATTGACTATTATGTTACATCTCAGCAAATTAAGCGATGGTTTAACATAACCTTCTTAAAGCTATTCAGGATTTAGTAGTATGGCCAAATCGATTAGAGCCGACATTGAAATGAAAGCGGTCCTTAACACCTCATTACTTAGAGGGGTAACTCTGTCGGAAATTCATGGACAGTTCGCACGTGTTAAATGGTTTGCCAGAATATTGTCCACCATTCACCTTTCATTTAATAGAAAAAGTGTGCCGGATTCAATGATTTAACTAGTTTGAGGTAGACGGTTAATTCTATGCCAGGCACGAACATTCATGCTTTATTATCGGCGGCGGAATGGGTGTGGTAAAACAACAATCATTTGAATGGAAGCTTGATCCGGTGCAATCACCACCCAGAAAACAATGAATATTTTCTCTGAAAGTATAATAGACTTATCGAGTCAAGAATCCCAAAGGGATATTTTCGGATCGCTTGTTTCAGTTCGTTTAGTGCATTTGATCCTTTACTCCTCCTAAAGAACATGGATAGGCAAAAGCTACACAACCTTTATATTATCAACTCAAGAATGCTGCGTCAGCAATAGTTTTAAAAGTACTAGGCGATCTCCGCTTAGAATTCATCTTCAGCATTTAATATTGTATGAGCGGCTATACGAGGACAAGACAACTCTGGCTTGAAGCTATCAAAACTAAGTAGTGATGAACTTTTCAAATATGCTGCACGCATCAGCCTCATTTCTAAAGTGAAGAGTAAGACGTAATGAACCACCAAGATTCAAAGTGGACGACGATGATAAATTCACTAAATGTGTCTGACAATATGAGAAATATTGGTTCGAATGAGCTCTGGGACATGCAATTGTTTAGGCTACTTTACAAGATTAGTAGATGTCGTTGGCGAAAGTCAACATGCTTTGTATTCGATGAACCAGAGGTATTCATCTGCACATTTCACCTTTGCTCTCTGCTTTGACGAACATTAAGCGACTTTATCCTCATGCACGCAATGGTGTAGCGCATAATTGCAGCACTCATTCCCCCAGTAAATTGCAACTCATTCCCCAGTAGTACTGCAAGAGGTTCCAAAATCCTGCATGTGGCAAATCCTACGTCGCGAGATAAACTTATCCGTTAGATGCACGGTCGGTATTAGGTGTTTATACGTGAGGTTTTACCTTGAAGTGACAAATTCTGGATACTACCACCCCTTATTATCGCAGTCCGTTGATTCGAGCTTTCTTATGAAACCATTCTAAAAATTAGATGGTCGATAGGATTAGAAGGTCGAACCGTTTTAAAAGGGTGAAGTAATAATGAACAGAGAGATGAAGGTAAAGTACAATGAAAAACTATTCTTCCAGCGAGAAGTGTAGCGAGAAATGCTAATAAATTGATTAGAAGAGTATGATGCAGATAAATGTTCAGAAATAATTTCATTACTCACTTCCCCACTTTTGCCAAGCAAAAGAACAATATAGAATATTAAGCTGGACAGAGTCGATTATTACACCCGCCTTACGCTACACCCTATCGTACATCTAAAGGTTAATTAGAAAATTTATGAAATAATACTCCCAAAACACTAGCTAAACATATTACATCATGCTTGTTCATCAGGTAAATGTCATTTGGTATAGACAAAATAGATCATTTTCTTCCTATTGCACATTATCCTGAAATTTTCGGTAATGGGTTTAAGGTTCATCGTGCCGGACTGAAAATCGGCTAAACCGTCACCGGCCTGAGATAAGCGATCATTCATGACAATAAAGTTTTTCGTGAGTAATGGCTAATTTCGTTTCCAACTCTATCAGTTTTATGTTGAATGCCCGGCGAATGGAGGCAGAGACAAACACAGCTCTTCATCATTTCAAGCTGTAAAATATTAGGTAAAGGTATCGTTTGCGAGGCAGGGAACCAAATCAATGAATGACCGACGAAACTATTTTAAATTACTAAGGAAACACTTCCTCGTAAAGAGCGTTCAATGCAAAAGCCGATTACAGAATTTATTTATTGAAGCAAATCTGAAACCTATTATAGATTTGAAGTACTTCCCCAATTATTGGAAATTATGTATGCGTGAAGCCGAACCATTTTTCCAGTAAGGGGATAACCATAGAAGTATCATAAAGTGACTAGAATGAACGAATATTTATATGAGGAGGCTGTTTTACAAATCCTTAGTACTTGCTAACCAATCCTAGGCAGTCATTGGCAAGCGCATCGCAGTAGAGAAGGACGTTACCGTAATGTCCCAACCAGCAGTCTCTAAAGTGGAGTCAGTCAACAGTCATAGATGGTCGGTAGCGAGTATACAATTCTCGCTGCAAAAGTAAATCGGGTAGCAATGGGAATCATTCAATAGCTACACGATGGAAGTTGCCAGCCAGCCGCACCGTTCCACGACGTGTCTTAGGCCGCGACTCCGGGGTGTTAGCAACTATAAGAGCCAACTAATTTAATACATAATGAAACTATAATAAGTATTAAATTTCCTTGTAACTAAGTCCTATGGTTCTGGTAAGAATCATTGCAGATCAAAACAACTTGTATTACATTGACAGTTAAGCAGTCACTTTACCTCTAAATATACTACCGGGACGCATGCAATAGTAAATGGAGATTTATCACGTAAATAGAAGAAGACTTAAAGTTTATCGCACTGTAAATGCTGCGCTTACATATTTATCCTAGAATTATTTCGCTTGAATTTGGATCATTCCCAATCCGCACGAACAGTGACATTTATTATTCAAAACAAAACGAGATTATAGAGGTGACATTTGGTATATAATAATGTGGTCCAAAATGGAAAATGATCCATTAATGGCTTGGTAAAATTCTCGCAATACGATAGAAAACAATAGAGCATTTAGAAAGCCCGGCTAGAGGCTAAACTATCTTCATGTACATTGAAGAAAGTAACATTGAGTTGGTCAAGTGAAATATGTTAACATTGGTAAAATTAGTCAGACTTGCACAGAATTACCAACTGAATCATCTATTATTAAATCAGAAAGACGATGGGTCGCTAATACGCTAAATACAGTACGAATTATTACATGCCTTAGCTAATCTATGGCAGAATGTATAACTGCTGTAACTCTTGGCATACAAAAATAAATTCCAATGGTGACGATGTGATTCGCCAACATCATTCGACCCTTTATTTGATGAAGCCAGGAATAACTTATTAAAATTAAAGATCATAAGCAAATTGTCAGTCCACTAGCATGATAAGGTAATAAAATAATTCCTGAAGATATTAAAGAGTCTAAAACTGTAGATAAGCCTAACAGTACCTAGAATTAAAGTACCTACTACGGATAGAGCAGCTTGCAGAAACGACTTTAAAGCTAAATTTATCTACATTCAAACATTAATTTATGATAACAATTCATCAACCTTTAATCTAATAACAACATTTGAATAAGCAAGATAAATATATTTGGCGTTGCCATGACGAGCCAAAATAAATGCCTATGGCTTCATTTTGGATATCAGAGCTGGCTCAGAAAGCAAGCATCTACTCAATAACCAATAAGACCGGTAAGTACGGTTGAAAAACTTTCAGGTAATTGGAATTGATTCAACAGATAATCAAATGTATTTCATGGAAAATAGTTAGAGAAACGAAGAAAGGTACTTTAGAAGATATCAACAGCAGACTCAAACATGACGAAAACCATATTCATGCGTTCAGTGGGAAGCAAATGGCGGTTTGAATAGCTGAACAATTGAGTCATAGAAACTTCCATTATTCTTCTCCCTGAAGATAATAATCCAAATAAACCAATACTCAGCTTTACAATATAGACTAACTTCACGAACGTTACTTCATACAACGTTTCTGCGGCATATCACAAACATTACTCCATAACAGGGACAGCAGGCACTCAATATCTAAGTCGTCAGTTGATGGAAACAGTTCAGCAACACCGATTCGGTTCAGGCTTCGAGCAACGAGTTTCTTCCTTCGTTGCGATTCAGAGTGCAGCATCCTGAAGCGCGGACTATGCTCACTGGCTACCTGCATCAGGCTTTTTGTTTCCCCTCCCGATTAGAACAGTTTTTATCGTTCCTGTTATCCGAGGTATTCCATTGCTTCCACATTGATTCCCTCCCGGGGGCTATAACCAAATAGGGTTCCGTAACGACTGAGATTCAGAAAATAAACGACGCGTGCCGGAAGCCACGTCAGGACGGTTTTGACGCGATGGTCTTCATGAGATGCCACGATGCCTCATCACTGTTTAAACAGCCACAAAAGCCAGCCGGAATATCTGCGGTGCGACCGTATGCGAGGCAAACAGGATGGCAGGCGAATATGCATTTATAATCACTAAAGCGTGCTTAGTCCTAAACAATTATAATTTGGTCCTTCTTTCACTCGATCCAATAAATCATTAGAGCCTCGATAAGATTAATGCAATGTTTTATAGTGTTTCCGCGTTACCCGCAGCGTTAACGGTGGTGTCCGTGTGAACCAATACTGAAAGAATGGGCATGAGCACGATAACAACCAAAGTGCTGGTGCGCACCAATACCAACTTATGTGCGCATGTGCAGTCTTAGTCAAGCACGAGCTAAACAAGTACCCTGAGTGAACTGTGGCTGCCTGACTGTCCGTTCCATCAAAGGCAGCAATACGCTGTGTTATTCCTTTAACTGTGATAAATCTTCCTGTAATGGTTACTGTTCCATACTGACTCCAGCCAGAACTGTTCATCCTTAAACCACTTGTCGGCATGAGCACCGCGGCTCGCTGTTGAACCGACTCAGACTGTAGACTAAGTGAGCCCCCGTGTTATTCGTCGATTTGGTGCCGTAATCGAATACTGCCTGTTGTTTTCGTCCCCGTAATCGACTCACATTGGTTTCGTCCCCAAATTACGATTGGCTTGCGCTCAGACAATTATGTGCGACTTAATTCGGCATCCTCTTTTAGACCATAAACCACCAGCCCTATCATTTCTAGATCGTCTAGCGCATATCAGGAGCACACCCGATGGATACGCGACAGCAAGTTGTAGCTAATACTTTGTCAAACGCCCGCCTGCCCTGCGAGCCATCGCCAGACGGAACGAAACTATCTGATGACGGGGTTAGCGCAGCTTAGAAAGGCCGAATTCTCACATCGCACTTCAGAACATCTGCAACGGAATTTTTCAGAAATATCCCTGCCAACCTGGATCAGTTCAGTCAGGCTGGCGGCATCCATTTCCGAGGCAAATACGGTAATTATTTTCGCCGTGATGAAGCCCTGCCATAAGCGTCGCGTGGGGCGCGGCATTCCGGTTGTTGACTAGGCCCGTTAGTCATGACTAAATGGATCATTCCCATGCGGCCATTTCATTCAGCGTATTCAGTGCGTCAGGTGACGCGTCGAACATCTGCAATCGCGGCCAGTCAAGCATGTTCGAGTATCTGGGTTAAACGCTACGGTTGGTGCTGTCTTGGCGTTCCCACTTTAGTGCATATGTCAGTGGGCTTTTCTGTTCGTTTCATCCATTACCATTGACCGCTTTGGCGTTGCAGCAGCGTTTCAGACGTGCTGTTGGTCCATGCACTCTGCTATCCTATTTCTCGTTGCCCATTAACTCGCGACAGCTGAAAAGCTATCTTCTGCACGTTTGCCGAATTTTGCACGTATTGCCGCCGCTTCTGCAGCGCACTTTTGCTCTGCGAGAGCTTGATACCGCACTTCCTTATGAGCCGCAGCCTACTGTCGCCTTCGTGGATGCCGTTGACGCACTCCCTAATTTTGCGCGTGCCGCGGCAGGAGCTCCGTTCGCTGCTGTTTCAGATGACCTGGCATTCGTCTCTGAACGTTTTTGCCCCTGGCAGAATTTCTGCCGCCGTTGCCGAGGAACGCTGCACGACCGGCACTGATGATGCGTTCGTTTCTGACTGATTTTGCTGCTCTTTGAGCAGGCCGCATCTCGTCTCGTGCTGAAGTGGCGCTCATCGGATTTCGTGAACCCGGTGGCGAGAGGCAGACGTGGCGGCTGATGTTGTGACGGTGGCAGCATTCGGTTTCTGACGTTTTAGCACTAGCACTGACCCCCGTTGAGACTCTGCGGCTGCGGCACTTTTCCCCTTCAGTGGCCTTTGCTCTGCCGGTCCTACGCGGCTTCCTGGCTAGCTGACGGATGCAGCCTGTCCGGCGTGCAGACGTGCTGGCGGCGCGTGCTGAGTCAGTTGCATCAGTTACAAGGGCCGCGACCTGAGCAGCTGATGCACGACTGGCATCGCTCGGCTCATTTCGTCGCGTCTGCCGTACTCTGTGCCACCACGGACGCGTTACGCGCCACCTCTTCGTACATCAGTTCAAGACGACGCAGCACCTCCGGCCGGGCATCAGTTCCGGACCGTCATGGCACAGAGGAAATCAGTCCAGCGTCCCGGTTGTGAATCTTCTTCATACACGGTGATGGTCCCGTGCGATGATGGGCGGAAACCGTCGACCTGCAGGATGACACTGTACTGACCGTACTCCACATCCATGCTGTAACGCCCGGCCATTTTCATCCGGATTCTGAGCCACCGTGTTCACCACCACCGTGGTGCTGTTACGTCTGGCTTTCAGCTGAATGGTGCAGTCGGAGTACCGGTTTTTCCTGTGCGTCTTCTCAGGACTCCTGAAATCTTTACTTCATATTCTTACCCCACAAAGCCCACCGTTCCATGCGGCTGTCATAACGGGTTACCTGGCTAATCAGAATTTATAACCGACCCCAACGATGAAATCCGTCAGTACGCCAGTCGCCACTGCCTTCGGAGCCTTCATAAGCAATATCGACAACGACGGACGCTGCCGGATTAATCTGTACCTGCACTCCCACGCCACTGAGGTATGCCGCATTGCACTTTCGTCCCTGAGTTAGGTCGTCCCTTCATACCCGGGAGTGATTTCGTCTGTACGGTAATCCATTGTACTGCCGGACCACCGACTGTGTGAGCCATCGGCCATGGCGTACGCACTGACCTGCTTACTGATTTGTTAAACCGTTTGGAGTACGCTCAACGTCCACGCAGGCTCTCATAGAACGTATCCTCCTAGTGTCATCACTGTGCTGCTCTTTTCGACGCGGCAAATGGAGGGAAGCCATCAGCGCCAAAGTGTCCGTCAGCTCATAACGGTATTCACGTTAATCCCTTCAGATGACTCACACCGGTATCCCCGCAGGACAAAGACGCAATGTACCCGTTTCACTTGAAAATAGCCCACGTAAACGTACCATGTCAGGTCGCGCACGGGCCGGAGTGACTGTCTACGCAAGTGCGGCAAAGACAGGACGGCAATACACATTACGCATCGTTCACCTCACTGTTTATAATAAACGCCCGTTCCCGGACGGAACCTGTAACTAGACCAACGCTGATTACCGCCAGGCCTGTTCTTAATCACCAAGACCTGCACATCGCTGAAACGTATACGGCGACGAATATCTGCCGAATGCCGTGGACGCTTCGGCAAGTGCGTCGGCTCATTCTTCCTGGGGGCTCTCGCCGGCTTCGGGATACGGGAGAACACCTGTACCGCCTCAGTTCGCCGCCATCATAAAGTACCGCACCGTTCATCAGTACTTTTAGATAACATCGAATCGTTGTCCTGCCGCTGACAGTACGCCCTTACTTCTAGAAACGTAGGAGCGACGCACCACTATCTGGCGATCAAAGGATGGTCATCAGTCACGGTGACAGTACGGACTATCTAACGGCCGTACACTGCTTTCACGCTTGGGGCGGAAAAGCCGCGCTCGCCGCCTTTACACTTTAGAGACGATTTTCTGGAATGGAATGTCACGGAGGAGGGAATATGGAGCTATCGTCACATTACTGATAGTCCGGAGTTCGCATTCAACTCTGCCAACCTGATATCCGCATTTAGGGAGCTTGCGAGTGGGAGTCGAGAAACTTATCGCGGAAGGAATACGAGGCCGCTGTGACTCCGAGCGTCAGGCGATGCTTCAGGAATACCACGTCGTTCATGGCATCTGGTTTCACCTGCGCCACAACATCGGCGTTTCATTCATTCCCGTCCGCCGGTTAATAAATGCGATACGATTGGATGACTCTAGGCACAGAAACTGGAGGTTTGCCTTCCTCCGTCGGGTTGCTCTTAGGCACCATATCTAGACATAATGTTTGCCGTCTTTGGTCTTGCTCAATTTGACAGCCACATGGCAGCATTCACTTATCACTGGCATGCTTCCACTCTTTCCGAAAACTCCTCCAGTCTGCTGGGCGTTATCCTCATCAGCTCGACTTTTCCAGCAGCTCCTGCCGAGATGGGATTCGGTTATCTTGCCTTTGAAAATCCATAGGTAATTTCCGCATCATCGCTCGCCCGACCGACGGCTCGACGGAATGCCCGTGCCAACGGTGTTCACATGCGGATATAAAGTAATAATCATGGCCCGGTTTGATATTGATACTGGCGGCTCAGTACAGCGCCGTCACCAAGATAACGCCGTGTGCTGGTTTCAACCTGTCTGTGATAGCAATTGGTTTTTCCGAGAGACGAACTCAAACTTATCACGTCGGGTCATAACGGCAAGATGCGGCGTGGGCGGTTATCTGAAATAGCCCGGCGTCAGCTCAATCCTGGACGGTGCTGCCGCGAGGCGGCAACCCGGGAACGATAAGCAGGAAGCCGCACTTCGAGCCTGCCCCACGCATTTACCGCAGCAATGTCAGCCTGTAGTTCCAGCGCCCCAGTTGCGTGAATGGCGCGGTATTATCGGTTTCGTCGTCCGGGCGTGCTGACCAGCCGCTCACTGCCGTCGTCCGCTGTACAGCGTCAGACGGAGCAGGAAACTCACGCCCTTCACCACCTTCGGTGTAGCCATCGCGCCAGCACCTGATTCCCGCTGTCTGCAGTGACTTCTGCGGTCAGGTGCTGCACCGCTGGCGGCGCGTGACACCATTCACCGTGCCACTCTGTTCGCCGTCAAAATAGCGCCCCGTTATCACGATGGCCTCTTTGCCGGCACATGCTGCACGGCTGTATTGGCATACGTGCGTCGTCGTTCTCACGGACCAGCAGCATGAACGTCTCGGGCGCTAGTCCTATGCAGCTTCTTCAGCTCCCATACGCTGTATTCAGCAACCGTCAGGAACACGGCTCATTTACCTTCACGCCGTCGGTAGACTGAAGAACCTCCACGCTGACCGGATTGCCACTTCACGTCAACCAGGCTTATCAGCGCGGTACCGGATGGCACGTGATTTCACGTAGAGCGTCAGCGTCCGGGCCGGGTGGCTGTTCCCGCCAGCTAATCACGGTGCTGATACGGCATAGTAGTGATGACCCGCAGATTTCGATCAACACATCGCCCGGTAAGGCGGGGTGAACGCTGCCTGCGCCGACGCTGAAAAGCCACGGTCTGCGTTTCCAGCAGTTCTGTTTAGCATCAGCCACAGCCCGGCGCGGGTGTGCCTGCCCCGGCTGGTACAGCCAAAGGCATCATCTTCGTAACATTACGACGTAACGGGCAATGGCCTGCGGAATGGAAGCTCTGTCGCGTCGCCGTCGCCAGCCCGTTGTTCGGAGTACAATGCGTTCACCTCAACGGCATTATGGCGTCGGTCCTTCAGGAGGGGCAAATGTCCCGGGGCCTGATGAACGGCGGCCTTACCATCCGGCATCACCACATTACTGCGGTTATAGGTCCACGTCTTATCCGACGGTCGGTCCTGCACGAACGTCAGCGTCTGCCCGAGGTCCAGCCATGCATCAGCATCGCTAAGAAATCGCTGAGCACATCCACGCCTTACGCTGTGGTCAGGTACGCATTACAGGTGATGCGCGCTGATAGCGTGCCGACCGTCATTCGGCGACTGACTGGTCGCAGTACTGGCCGATGACATACACCACCATTTATCCTAATGGCCTACATAAGACTATTTCCCCATGCCGTAGCGGATGGGTTCAAGTACCCTAAGACACCAGGCCATGTTGTTGCTGTATGCCGGTTTAACGTTCGTCCGAATACCGCTGTATGCCGCGTCGTCTTGCGGATTATAGTTTGACGGCACCTGCCCAGAATACGCCCGCGCAGATGATAATTACGGAGGTCCTGCTGATGGCTTCGAACTGCTCCGAGTTACGGCGCACGCCGAAGTGCCGTGTTCGCCGCAATTTACGCATCGATGATTCAGGCCCTCATGGACCACAGAGCGTTTTGTTCTGCAGCTTATTGGTGCTGGTAAGCGTCGGTACGCCTGCGCATCCGGATATTAAAACGGGTGCGCGGCGGCATGTACCCATACTCCTAGCTAAGATACTGCGAGGCGGTTTTACCGCCCTTATTATGTGATGTCTTTTCTTGCCGTACCAGCCACTAGGTTCATTCGTTGGATCTGAACCAGCAGGCGAGACTTCCAGACGGATTCCTGATCACCCTTTGAGGTGGTTTCCACCAGTGCCTGTCACACGAGGGTAAGCGCACGGTCGATGTTTGCAGATCGTTCAATGGTGCGGGTAGATCGGCGTGTTACTTCACTTCCGTACCCAGCACCGTCTCGAGCCGGAGGATTCAAATCCCTCGGCGGAGGTCTGCTCCTGCTCACCAGCCCGGAACACCAAGCGTGACTAGATATGTTGGTATTCCCTCGATGTGCCGGGGCTCCGGCCGGATCCTCTTCCGCTACGCTTTAAGCAAGTAGGACCTTCAATCGGCCCTTCGCCTGATGGCATCGATCACATGGGAGCAACTGCGTGCGACTTCAGGTTGTCCTTCATTCGCTAGGCGGGTCCCCTTACTGCTTCCTTTACCCATTCCTCACGCTCCATAAATGACAAAACCGCCGCAGCGTTGCACAATAAATTTGCATCAGCGACCAATCACACAACCTGACCGCGTCCCCTTCGTCTGCCGTGCTGATCTCCTGAGAAACCACGCGATTGACGGCGCGCATTCCCGTACAGAACAGGCAGAACATTGGGCCTGGGCAACCATGTTATCCAGTGAGAGAAGTAGGTTTTATCGTGAGCATTTATCCGTTGTCTTATACCGGGGGTTGCGGTTTGTAGCTGCCAGCATCTGCGCCACCCACCGAGCACCATACTGGCACCGAGAGAAAGAGGATCGCCGTCATACCACGGCCCCAATGGCTGCCGCCGATGCTGCAAGGGCTCCGGCGCGGTAAAGAATGATTAGGATGAGGCAGCCGCAAGACAATCGGAATACGCCATAGTGACTGTGCCCCGGCGACCTGGGGGACAAATATGAATTACAGCGCCATCAGGCAGAGTCTCAGATGTAACTGCGCGTTGGGCCCAGACTTCACTGACGTTATCGCCGCGGCATGCGTACCTGATACCAGCTTCTGACGAAACGCCGGAGCTGTGGCCAGTGCATTCACATGTGCTTCAGCCGCGTTTGCTCACGAAGGTCGATGCGGCAACAAATCGTTGTAAATCCCCGTAAAGGCAGATGCGCGCCATGCCCGGTGACTCAGGGAGTGTGTGCGTGCGCCATTGTCGGTGTACCTCTCGTTTGCTCAGTTGTTCAGGGAATATGGTGCAGCACTCGCCTTCCCCGAGCATCTCCGGCATTCTGCATGCAGGCAATGAACAGGCCAGCAGCACATGCCCGGCTGTGCCCTGACAACGATGATACAGCCCCGTCGCCTCCATAATTATCCCATAGAGATTCTGTATGATTCTAAGAGTCATCCTCACCGATGAAAGTCCGGCATCTCAATCCCACAGATGATAAGCATCCCGGAACAGTGTGTAACAGTCCGTCACACCGTGCTCAAAGCGCCACGCCGTGAGATGCGGCACATAGAACTTATGAATCCTTTTGCCCCGGCAGACCAGCCACCACGGCAAATCACTCTGCATGCAGCCGCCGGTCGGCCTCACTCAGCCGACGAGACCACCGGGGCTCGTGACTGCGCCACAATCTCACCCTGCATTTCTGCCTGCAGCCAGTCTTCCGGCGACTAGAATACAGACTGGACACCTCCCGGCTCACCGGAGATATTCACGCAAGGGAAATATTTCCCCCTCCGGCGTGCTTACCACGAACTCGCACGACTCCTAGCGCGACTGTGTCATGGGATTTTACGGTTCGAAAGTTTGTTAATGGGAAGGAAGCCGCCAAATCATGCGACGTTATGCTAGAACTTAAACTGAGCAGGCATTCTATGCAGATTTATCCTTCGTATTAGGACTATCGTTGAGCTGGTCAATTCATCCGACAGCCGGACCGCTATAACTCATGATCTTCTACAGTGCGATAGAGAGGCTTAAGGAGGGCATAAGTTACCCGGAAAAACTAGCCACACGGCTAGTTTCGTCGAGTCGGCACGATAAAGGAGCTGAACGCACTAATGCTAGTCGCTGCACTGTGATAGTGCACCCCTCAGGCTGATCACCCCTGCTCCGATCGTGAGCGTAACTTTGTTTCTACCACGTAACCCAAGTTCACCGATCAGAAAACGGGCGTTAAACCTTGACCCCCAACACCGTTTCTTGGTTCAGACATACAATCTTGCATATCTTTAGATACCCCGGTAGACAACAGTCCAATTATAGAAACCGTAGACCGTGCGCTTCACTGCTGCCTTTGCCATTCAGTCGACCATCAAACTTCCGCGGTTCTCATAATGGGTCTGTTCCCCCTGCCCCTGACCTCGGCTCACCTTTTTCGGTTCATGCTCATTACAGAAATAACGTTGCTCCACCGACCTGTCGTCATCGATTTCCCAGCACAGACTGACTCGAGGGCGCACGCGCTGGATTCATTCAGTGTTTCCTTGCCGGATATCCTGCATCAGTTCACCTGTTCAACTCTGCTGAATCCAACACGCAGCATACTGACCCTAGACGACCATTTGCTACGTATACCTTTATCTGTTAGCCACTCATAAGGCTGAGTCACAGAAAGAGTTTCCAGCCCCGTGCTCTTCCAGAAACGATCGTATACCGGTGGCCTCCCTCACGGCGACAGAAAGCGTCACGCTGTACGTTCCACTTACGGCATTCAGCCCGTGGCAGGCGCTCGCTGAGAATCTAAGTACCAAAGCACCTTCTTGTCAGAAGGGACCGAAGCATCATAGGTTCGTATTCATTCCCAGCGGAAGGTCTTCATTATAGTCACCGCGCGATGAACAGGCCATACCACAGATCTGTGTCTGAATTTCATCACGGGGATCATGCCGGGCCATGTCATACACCGCGTCGCTAAGAGCAGCCGGACTATCTGCCCGTTCGTGCGTCGTTGGTTAATACATGGTCTTGCTCAAACGTCCGGACGCCTTCGCGAGGTGACGGCTGTCTGCCATGCTGCCCGGTGTACCGACTAAAGCCGGGTGGCATAGCCTAGCATCAGCGGACATTCCCCACGCCAATCCGGGGCTGGTTGCCCCCTTCGTGAAGACAAACTCACCGGTGAACAATCCCCGCTGGCTCATATTTACGCCGGTTTATCGCGTAATCCTCCGGTTGCAAAACCTAGAATTTGGCCCTAGAAGCGGCCTGAATGGCTGTACTTCGCCTGACGGGATTATGCTAGCCAACAGCCCCAATGGCGCTGCCGATACTCCCGACAATCCCCACCATTGCCTGCTTAAGCAGAATTTCTGTCATCATGGACAGCACGAGAACGGGTGAAGCTGCGCCATTTCTTAGCACCACTGCCGGTTCAGCATCTCCCGCTTACTGCGATGGCGCACAGTATCAAATTGGGGCTGCATTTACCTGCACATACTGTCCGTGGCGCTCTCTTCCCACTCACTCCAGCCGACTTCAGCTCGTCATCCAGTTCCCGCGAAGCTGGTCTTCAGCCCAGGTCTTTTCTGCTGACATGACGTTATTCAGCTAGCGGATTATCTCATACTGTTCCTTCAGGCGCTGTCGTAATTGTGGCTTCCCGTTCGCTGCCGGTCAGTTCAGCCCCGGCCTTTTCCATCAATAGCGGCCCGTTTTATCGCCCGTCGCTGCTATGTGCGAATTTTATCTATGCTTAGCCAGCACGCGTTCAGGCGCTCCGTCAGTACTTGTCGCACCTGCAGCCAGCTGGCGTTTGTACTCCGGGCGTCTCATCTTTATGCCTCAGCAGGAATTTCTCCTGTGCAGACAGCTGACAGCTGGCGACGTTGCCGCCTCCTCCAGTACCGCGACTGACTCTCCGCCTTCCACAAATCCCGGCGCTGCCTGATTTGCCATTTGCTCCGGCATGCTTCTCCAGCGTCCGATGCGCCTGAAGGCGTGCAGGGCAGCATGAGCACTGTCTTCCTGACGATCGCCCGCAAGACATCTTCACACGCTGGACTGTTTCGGCTTTTTCGCCGTGCTTCATAATCCTTTTCGCCTCATCACCGTGTTGTAATCCTCATGCACCAATTTCCCTTTTCCTTCCTCTTTCGCGTTTCTTCCTGACCTCTGCGTATTTTCTCCATAAGGGGTGCAGCAGGGTCGGCCACCCTGCCTGCGCTGCGATATTTCAGCCGTACGTTCGGTATCGCTCTGCTGCTTGGCATTTGTCCTGTTGAGTCTGCTGTTCAGCCTTCTTTCGGGCGGCTTCTAAGCGCAAGACGGGCCTTTCACGATCATCCCAGTAACGCGCCCGCTTCATGATTCCAAATAATCATCCTTGGCAGATTCCAGATGTCGTCTGCTTGGTAACCTCGCAGCCTCTGCTTAATCAGCATCTCCTGCTAGGTATCAGGACTAAGTCCAGCACCGCATCCCACCTAGATTTGGATGCCCGCGCAGTCCTGTCTGCCCAGGTCTCCATGTCCATGTTCTCCTTTCAGGCGGCGGGTCTGGTCATCAAACCCCTTTCGTTGCGCTCGTTCGCCGCCCTGCAATGCCCCGGCTATTCATCGCCGGAACGCTGCAACTCAGCAACATACGGATCTGCTCGACACGTTGGAACGCGGCTCATCGCCGTTAAGCCCGACGTCGGGTCTGTGGTCAGCTTCCCCGAAGGCTTCAGCGACCTTGTCCACCTCCACGCCGGATGCAGGAGGACGCGCCCCACTCTGGCTGATGGACTCAATCTGAGCCTCACCGCTTACCCCCGCCTTAACCAGTGCGCTGAGTGACTCGCTGTGTTTGCTTGGTTAAACGTAGTGCCCCGCCTGCCCGGCTGGGACAGAGACAGCATACGATCTGCCGTCAGTCCCCGCCTGATTGCTCGGAAACGACAGCGTTTGTTGAAATCGGACAGGATGAGTTGCCTGATACCAGGCATACGCCAGCACGCACCGGTCGCCCACATGCCAGCGAGGCCCCCACCATCGGCAGGGGTGATCGCACCGGCAAGCCCCCTGAACATGGGGTGGATCCCGCCGAAGGAAGTATTTTCACCTGCCCCCTGTTGCAGCAGGATCAGCCACGACTTGCCCGCCTGCTGCAAGCTGCCGTGGCCACGTCGGTGAACTGTGCAGGCAGCATACGCATGGCTGCGGTATAATCGCCCGACGGAAATCCCCGCTTTCTGTGCAGCCAGCGCCTGTCGGCTCAGCGACTGTTCAACGACTGCCGCTTTTCTTTCCATCACTTTCCGTACCAGAAAATGACGCCTGACTCTAGCCATCTGCTCGTCCAAATCTGGCCTAAGGGATCCGCACTCAAATCAACGACCAGATCGCCTCAATGGTTCAGCCGCTACGGACTCCTCCTGCGATCCCTTCTGATATGTCATACTCAGCATTACGTCCATCCTCCGTCATGTCGCCACATCCGGGAAGCGGATAACTTCATTCCCGTCCGGGCCAACGCGGACACCTCCGGCAAGCCCTGCCGCCGCTTTCTGCACTCAGTAAGCTTCTTCAGGCTCTTCCGTCAGCCTCTCCCGCGCCGGTTCAGCAGACTGAAATCCAGCGGATGCATATCCGGATCGCTGAAAAACGGCTGAGCACGGTGTACGTCAGCCGGAAAAGGTCCGGATATCCCACAGAACATCATGAAATAATGGGTACTGTAAACCGCTGCCAGTCGGCATACTCGTGGATGACATCCCGGCAAGCATGGCACGCCAGTCGGGTCGCCCCATCTCACGCGCGTTTCAGGGCAAAACTCAGCTCACCGTCGAACACTTTCCCGCAGAACAGGCTCCGGGCCACCGGCGTCCTCTGTCTGTTCAGGGGCATTATTCACTACAAACTCATACATACCAGACAGCCGGTACACCACGTTTTCAGCATGAGAAATTGCCTCCGTGGCCAGGCTCAAGCACTTCCTGCTCAATCTGTTTAACGGCTTCATTCATGGACGGCATCTGCGTCTTCTGCGATGGTTATGCCACAGGAATTCACCAGAAACGCGCCGGTTCTGATGGCGTCTTCTCCACAGTAAACTTCCGGTTGCTGTCTGACTCCGCCTGTTCTGCCTGCCGTTTCATCAGCGAGATGCTCAATGCCTATGCAGGCTGACAGTTCAGAAGGCGTGACGGTCACGGTCTGTTCAAATGATTCGGGTTTTCAGGAACATCGCTGACTCTGGATTAACTGGCGGTGACGGTAATTTCTGGATGCAACCGCAGCAAACTCACCATTACCGGATACAACCGGAATGTTGACTGCTGCCTGCAGCAGCAACGCCGTTCACGGTGATGGTCATACCACTGACCGACGGTGGCTTTGTTTTATCCGCAGACACCGCACGAAAGCTTGTCGGTTACGACCCCGCGGGGCTGGAAGGGTTCACGAGTCGTGCTCTGCCCTTCACCGAGGTGCTGGCAAGGCGTCACGGTCATGCCGGTCCGCCCTCATGTTACCGTGCTGCTGCATGCGGTCTGCCATCGACGGACGTTCCCACATTGGTGACTTTCACGTGCGTTGATCCTTCCTTTCATTCATTACATACTGCTGACCCAGCCACGGAACACATCGACCGTGCCGTTCGGGAAGCGATTTATAGGCACGGGTATCGCCTTCATTAAATCACGCCAGCAGCGCCTGCTGCCCTGCTCCTGGCATCCACGCCAGCGTGAAGCTCGATATCTCCGGCAGATTTCTGCCCTGCCCGGTCGCAGTCCAGTCTGCATCTTCATCATCGAGATAGCTGTCGGTCTATAGAGCAACCGTCAGGTTTTCGCCGGCGTCAGGTCTTTAACTTTTAAGAACAGGGTCAACGTTGAACGAACATTAATTCCGCGTAGGACGATAAGGCCGGGTAGGACAGTAACTATATCTACACAGTCTAAGGCGCACGTAGAGCATTGTAGATTTGACCAGGCTAGCAAGTCCTCAGTCAACTAACAGACAGTCATCACGGAGTGAACTCCACGGATGCACGATAGTCGCGCCGGTAGTACTAGAGCCTAAGATAACGGTACATCAACATGCCCTGAATTATACGGGATACCGCTCAATGTAAGACTCTAGACCGCATCGAACTGAGATCCATTGAACTACAAGTTCATAAGGCAAGGAAAACATTCGATATGCATAGTCGGCTCGGCAGAGACCCTGTCCAGTAGCTGTCGCCCGTCTGTCAGGCCGGTTGAGGATAAACGGCAACATGCCCGGAAAATGGCTGATCAAAAACGGGAGAAGAACAGTCGGCTAGGTATCGTTCTACTAATTGTCAGACTTAGTTTGGACGTAATGCCGTTGGTGGTGAGCCATTCATATCATTGTTCGATCTAGTGTTAGTTACCATTAGCCAGTTGGGTCGTTGAGCATAGCATATGATATGGCGTCGGAAAAAGTTCACGCTAGTTATCAAGATAAGTGAGTTGAACGCCGTGGTCAGCAGCAATAGCCACTTAGGATTTGGATAATACACGGGGTAACGGTTTATGCCATCAAAAGGGTGCAATGACACTGCCAAGGCTCATTTTCCGTTTGCTGAATAAACGGCCCGGGAAACGACGGGTCACAAGGACGCTGCCGCCACCCGTCCACGAATGAACCGATGCGCTTTACACTCAAATGCATGGTGAGGAATAAACACCTAGAATTACCAGAGGCTTGATTAAGGCAAATCGCCCGGTTAACTGATTGGGTTCATGCGGATTTGACCGTGATGTCAGCTGGCCATTCCTACTGTTACCGATTTCCTACAGTTTCTATACTTTGTCTCACGGAGATACAATGTGACGGCCGACTGCGATATCGCGGGGCAGCAACGAAAGCGTAGATAATTAGGAGCGGGCGCAAGGAGCACCCCAGTTTTAGTGATTACGGCTGATTTAAACGGCCATGCGCTCAAGACTTTATAGGCCAACCCCATGTCAGCGAGAAGGGTTAACGGGGGCAATTACACCGCGTCCAAGCCAGAGATGACAATTCCCTAGATAGATGTCGGCGAAACCAGGATTACCAGAGAAAAGTGTCCCCAAGTGGTTCAGCAGTGTCTCCACGAGGTCGAGCATATACGCCCGCATCGATCAGTTAAAAACAAAAGAACGGGGCTGGAGCTTCAACAGGGACTTCCGCCGGCGACCTAGCAATGATAATATTTGTGATTAGATAAACACCTAAGATCATCTACAGCTGACTTAGTCACGGATAGTAATGGTGAGTGACGTTCCCATCATGTACCGGGGTATCTGATTTCAACCTGAGGGGGCAAATAGCAAGGATCGAAACAGGTATCGAACAGCAGCATAGGGCCGGTTATTAGAGTCTGACAGCGCCATTACTGTCGTCAAGCTGCGGCCGCCCAATGAAGAGACGAAACACCGTCACCGGGGCATAAAATGCTGCCACGATTCATCGCCGTGGCGTGAATATGCATCAGTATTGCAGTTCACAGTGCCACAGGTTGACCGTCAAAGATAGACGTACGAGAATCACGGTATTTACGCTGCGTGATCCCCACTCATTCATATTTAAGTCACAGTCGCCATGAGAGGGGTAGTGACCCGGCAGTCTCACGTGTCATCAATATAGGCCTCTTTCCTATGGTAGGCCACGAGGATAGGAGCGTTCGTCTTCCAGTCGAGGTTCATAACAGACCTAAGCCAGTCAGTTTAGCCAGATGAGCGGAGACGGCAATCAGTTCATCTTTCGTCAGCACTCCTCCACAGAGAAAGCATGGCCCCGACAGGCTTACGCCAGTTGTACGGGACGAACTCATCAGCCAGCCAGCAGCATCAGCGGTGCTGACTGAATCATGGTGAAGACTCACGCGCCGGATCGCCGGTGGTCACCAGTTTTTCGGGTAACGGGCAGAGGCGTTAATGCCTTCGCGCTGTGCGTCCGCATCCTGAAGCATGCAGCCAGCTTAGCAGACCGCGTGCCTGAGGGCTTCCAGCACCATCGGTTGTTGCCTGTCGGCAGGAAGTTCTTTTGACGCCGTTTTCCACGTACTGTCGGGAATACACGAACGATGGCCCACATCGCCATCATCCCTTATAGGACACCGCTTTGCCCAGTATCTTCACCGCTGTCTCCAGCTCGGAATTAGAGCCACGACGTATCCAGCTTTCTCCTTGACGGCTTTGAAGGAGAACGGAACCTCAGCGCTTCGGATCGAACACGATGATATTTCACCACACCGCTGGCGTTCAGCGTAGGCTTCGATATCGTGCTTCATACGTGGACTTGTCACGCTTGCATCATCGTGCTCGCCGGACTGCGTGATGTTATTCTCCTCACTGCGGCCCATATCCACCTGGACCGGATCGAAGGGCTTCACGGTTCATGGTGGCTTTCCTTAAGCACGGCAGAGGAAACTGCCTGCATCTCTTCGACCTGAGCAATGGCCAGCTCTTCGTCACGCATGTTCTGCATGATGATGCGACGCGGCGGTAAGCCGGGTCCGCCAGATTCTTCTGCCGATCTTCATCCACCGGGGGCGACGCATTACTTGCGGATTCATTCAATTGGTTCGTGAGCTTGACATATCCGGCGGTTAACATTCCGCCTATGGAGCCGCCACGGGAACGGATAACCTCACCGGAAACAATCGGCGAAACGTACAGCACGGTGGTTTACCAGTCCGGAATTTGTGAGAGATAGACTTTCCGTGGTGAAGGATAGCTCTCACGGAAAAGGACGCAGAAACCACAGCGGATCAAACTTAAATTTCTGCTCATTTGCCGCCAGCAGTTGGGCGGTTGGTGTACATCGACATAAAAATCCTTTAAAGCCGCACAGGCGGCCTTCTTTAGTGATGAAGGGTAAAGATTAAACGATGCTGATTGCCGTTCCGATTAACGCGGTCCGTTTTTGCGTATCGTCGCTGGCAGCCTCGAGCCAGAGCACATCCTCATAACGGAACGTGCCGGACTTAGAACGTCAGCGTGGTGCTGGTCTGGTACTAGCAACCGCAGAATGCCAACGGGCAGCACCGTCGGTGGTGCCATCCACGCAACCAGCTCACGGCTGGAGGTAGAGGCATTAGTCAGATGTTTGCAGGCGCTTCGCACTCAATCCGCCGGGCTGCGGTTGCAATCATGAGCCGGGTCACTGTTGCCCTGCGGCTGGTAATGGTAAAGGTTTCTTTGCTGGTTCAACATCCCTTACACTGGTGTGTTCAGCAAATCGTTAACGGATCAGATAGATGCCGGGTTACCTGCAGCCATGCTGCCCCTGCATCAGACGATTGAGCGCAGTACTGCGCGCCTGTGCACTGTGGTGCTGCGGCCAGAATGCGGCGGCTGTTTTCACGGTCATACCGGGGGTTTCTGCCCAGCACGCGTGCCGGTCTTCGCGTCCGTGAGCCTCCTCACAGTTGAGGAGATCCCATAATGCGCTCTTTCTTGCCGCAACCGCTGCGGTGATCTGCGTTCACGTCCGGCTGCGCCGCCCCGGCTTCGCCCTCCGTCGCTGGCACCACGTCAGTGGACGTCAGCCTGCGAAGCAGTGGCTGAAACAGTTGTTGATTGAGTCTCTTTGGTCATTCGCCTCCCTGAGAGACGGATTACGTGCATCCAGTGCATCACGCATGACGGTGATCGCATCGCTGCTGTTAACAAGTTCATCATGAGCCAGTCCGGCTCAGATCAATGGCCTCCTGACCGCTGTACTGCAGCCTCGGTATCCAGCACAAGGCCTGCACGGACAGGCCGGTATATGCCGACACCTTCTGCTGCAACATCTGGCGGGTTGCGTCCATCGGACTGCAGATGTCTCCCGGACGTCATCCAGAAGATGGCTGTAGGGATGCCATCGACCTTATGGCTGCCGCCTGTAAATCCGTGATTTCCACATGTTTCTCCAGCGCAGCACCGTAATTATTGTGAGCCATCATGACGCCGATGCAGCCTGTCCGGGCGGTCTGCGGTCACAGACGCCGGGAGGCGGCACTGGCAAGCAACTGACCTGCACTGCAGTCGGCTGTCGTTGGCAAGCGCCCATACCGGGTTTTAATCGACGCACACGGGCGATGATGTCAGCGCATTCAGGAATGCCCCGCCATCCCGCCGGCGTGTCCATATCGAGCAGAATGCCGTTGCACCCATCGCATTCGCTGGCAGCCTGTTGCAGACGGGCGATAATGCCTAGTTTGACCGGTCATCCCCGAGTACGCTCAATGCGCCCGCGTCCGGCTGACCAGCGTGCCGGACATGGCCAAGCACGGCGATGCCGTTCATGACCTGATAACTGCGGCCTGTCGGTGGTCGTCATCATACCGCCGGATAATGCCGCCAGCGAGCGTCGCGGATGCCTCCTGGGCAGTCAGCAGTGTCGCCGGACACCGCATCGTCAGGCTGCTGATCCCCAAGCTGGCCTGCAAGCGCACAACGAAACCCGTGCATAGGCGGGTTCAAGCATCATATGGCTGATGAACCTACATGCTGTGGCAATATGCGGAGATTACGCAGCTCTGCTGTCACTCTTCCTCCTGTTGATTGTCTGCACAGCCCGGATTCAAATGCTGCAGCCGCCCAGGCTGGCGGTTTAAGACCGGCTTGCACGGCGCTCCATCGTTTCACGGGACCTGCTGGGCAAAAATTTCCTGATAGTCGTCACCGCGTTTTTGCCAATCCTTCTCGTAGTATCCAGTCCGGCTTCTATCAGCATCACCGCTTCCTGAACTTCTTTCAGACCCTTCATTACATACGACCGGAGCCTATCCAGTCGCAGTTCCCCCAGGCACTGCGGCTTCCTGAAAACTGAAGCGCGCTTTGAAGGACGTCACGCGGCTGACGATGGCCTCTTCCAGCCAGCACAGAAACATGGCTCGCCTGACGCATGCGACGAATTTTGGCCGCCCCATAAATGACTCACGACTCGTTCGCACTGGCCCGTGCCGTGGAGGAGCTCATCTGGGCGTAATTCCGGGAAAGCTGCTCATACGAGACACCCAGCCCGGGCATGCGATATACCGCAGCAGTGACTGCTCAAACACGGAGTAGCCGTTATCCGTATCCTGAGCCGTCTGCAGGTTCAGGTCATCTAGCATCAGGTGCGGTACTTTGCGCCTCCAGCCGGACCGGCGCTGCGATGCGTAATACGGCAATTTCACTCAATCCAGCCGGTCAGCCTTTCCCGCCTGCTCCTGACTGTTCGCGCCCAGAATAAAATCCATCGCTGACTGCGTATCCAGCTCACTCTAATGGTGGCGGCATACATCGCCTTCAATGGCGCTCTGCAGCTGCGTGTTTCTGCCCGTGGTTGCTGAGCATCTTCATCATCTGCTCCATCACGCTGTAAAACATTTGCACCGCGAGTCTGCCCGTCCTCCACGGGGTTCAAACGTGAATGAACGCTGGAGGCGCGCCCTAGTATAACTCACGGGGTATCCATGTCCATTTCTGCGCATCCAGCCAGGATACCCGTCCTCGCTGACGTAATATCCCCAGCGCCGCACCGCTGTCATTAATCTGCACAAGGCACGGCAGTCCCGGCTGTCGCCGGTATTGTTCCTGATGCTGATGCGGTCATGCGTGACCATCCGCCAGAACTGTGTCCGGAAAAGCCGGAGACGAACTGGTATCCCAGGCCTGAACGAACAGTTCACCGTTAAAGGCGTGCAAGGCCACACTTCCCGAATCATCATGGTAAACGTGCGTTAAAACGCTCAACGTCAATGCAGCAGAGCAGTCATCCTCGGCAAACTCTTTCCATGCCGCTTCAACCCGGAAAGCACGGGCTTCTTCCTCCCGATGCCAGATAGCGCCAGCTGCTTGGGCATGACTGAGCCGGAAAAGACCCGACGATGATCCTGATGCAGCTGGATGGCGTTATTGGCGGCATCGTTATTGGGCCAGATCGTCTGCGCCGGCATTGCCACGGGTAAAGTTGGGCAACACAGGGCTGCATCCACTTTCACTCGGTGGGTTCCACGACCGCAACTGCCCTCCAAATCCGCTGCCACCCCGGGTCAACCGGGATATTCATCGATGTCATGCCGTCCGGCCCCAAAGCGGGGAATGGTGGGCGTTTTCATACATAAATCCTGCAGGTCTCCCTGCGTCGCTGTGTCATGCCCCGGTCTGCACTTCCAGCTCTGCAATATGTTTCCAGTACCACGGAAGTGGCCGTCGACTCCACCTTCGTCCGTCTTCTGTACTGTTGCCACCCCGTTTACCTGTCATCAGGTCATGCAGTGCCGCACGGGCAGCGGCAAGTCTTCCTGTCGCGTCATTCATCCTCTCTGGATAAGGCACGGCGTAATCTTGCCAGTGTTTTCTGTGCTTGGTTGCTGGACCCCTTCCTGCAGGCTCGCCAGCAGCGCACTGAGATCCAGCTGCCAGCGGAAATACTGGGTGATGCGCAGCGCCGCCAGCGCATAAACGAAGCAGTCGAGTGCCTCATTGCGTCGCTTTGCTGTCCCACAGTATTTTCCTGCCATCCACCCATTTTTCGACCTGCTCTTCAGCGCAGTCAGCTGCTGCGCTTCGGGTCAGATCAAAATATCCGGGTTATTCGGAAGTGAACGGCACCGGGAAGCGGTTCATCCCCTTCGGGCGTCAGTGTGAAGCCGGTTATATAAATCTGCTCCTTCGCGGTATCCGTACCGATTTCGGTAAGGTAAACCCCGTTTTGTGCTTCGCTTAATGGCGGATGCTGATTCACCGGCTTTCCGGTAGACGCGGGTTGCCCCTTAGCATGGGGATCACCCGGAACAGCCCAGCTTTTCCGGGCGAGTTCATACACAATGGTCCTGGTCAGTCAATCCCGCCAGTATCCCCAGCGCAGGATACGGGATATCGACCTTCTGCTGCACCATTCGGCCGGGTATAGGTATTTTATTGATGGCCTCATCCACGCAGCAGCGTCTGTTCATGGTTTAGTGGCGGCCCATACGTAATAATCTGCCGGTCAATCAGCCGAGCTGTTCCTCTACCAGCCCCGGTACCGCCATACGCATTTCGGGCTGTCCAGCTGGGAGTCGATACCGGCGGTCAGGTACAGCCAATCGTCACGGAAACGGGCGCTGAAGACGAATAATGCTTCCGCCTTGCCATCATTTCAGCATCCGGACGTTCGCCAATTTTCTCCTCCCACGTACCTGACTACGAGCGTGGTGTTTACGAAGGTTTTACGGTTTTCCCCGTATCCCTTCCACTTCATCCAGTCTTTGACAATCTTAAGAGGTGAGGAACGGGCTGTACGCTGTCCAGATGTGAAAGGTCACACTGTCAGGGCGTCCAATCTGTTCACGGATGACGAAAACCAGAGAATGCCATCACGGGTCCAATCCCGGTCTTTCGCAGATATAACGGGCATCAGTACACTGAAGTCCAGTGCTCCTGCTGGCGGATGACGCAGGCATTATGCTCGCAGAGATAAACACGCTGGAGGCGATTCATCCGTCATTTGAGGCCAAACGGCGTCTCTTTGTCCGCCTAAATTTAAGATACTGCTCTCCCCCGCAATGCGAGCAGGGCAACATGAAAACGCATAAAATGCCGGGATTTCACTGGCTGCACTCAATCTGACAGGTGCCTCTCACTTTGGCGTGGAGCCACGGATGGACTTTACAGACCGAGCCTTCAATACGCTTGTTACCCAGGAACGTCGGAGAGCCTTCCTGTTCAATATCATCATCAAAAGCAGCAAGTTCATCATAACCCGCCATCCACCGCTAATCTTCACGCTTAGTTTTGCCGCTTTACCGCCCAGGCAGCCCAGAAGCCACGCCCATTAGTGAACGCTTCATGGGCCGTGTTATCCCGTGCTTTTGCCATACCACGGGGCCAGCGCCAGCAGCGACGGAATATCACGAATAGTCTATCCAACGTGGGTTTTCATAAAGTTCTCGGCATCACCATCCGTCGGCAACCAGATACCGGTGTTGCGCTGCTTATGCTCTATAAAGTAGGCATAAACACCCAGCAGCATTTTGTAGAATAACCGACACGGCAGACTTCACCACATTCACCTCACGGATGTGGTACCTGCTGCCATCGCATTCATGATGGCCCGCCTGAAAGGCAGTGTTTCCCCAGCGCCCTTCCTGGTATGCGGATTCTTTCGGGAGAGATAGTAATTAGCATCCGCCCATTCAAACGGCGGTTCTGTGGCTCCGGCCTGAACAGGTGGGAAGCCCGGCGCGGACAAATGCCGCAGCCTGTTAACCTGACTGTTCGGTTATATTCTGACTGATGAGCAACCCCGGTATCAGTTCATGCAGCGCGGCTGCTTTGTTTGTCATGGCTTTGATGATATTTCCCGTTTCAGGAAATCAACATGTCGGTTTTCCAGTTCCGGAACGCCGCACCGACGGAGAGCCGTCGAGAATACTGAATTCACCTGCGACGTGTGACAGGCACGAAAGTACGAATGCGGTTTCCACCACTTCAGCGGAGTCTGGCATTCTTCAGGTTCCTGTGCGTCGGCCGGGCACGCGAGTTAGATGGCGTTCGTACTCAATAGTTCCCTGGCGTTCGCGATTCTGCCTCGCTGTGCCTGCTTGCCGCAGTTCTTCAACCTCCCGGCGCAGCTTTTCGTTCCAATTTCAGCATCCCTTCGATACCATTTTACTGACGCTGCAGAGTCATAAAGCACCTCATTACCCTGCCACCGCCTCGCAAGAACGGCATCCCTGTTCCTGCCCAGTTCTGAATGGCGGTAACGGGATACTCGCACCGAAAATGTCGAGCCATAGCTGCTTTGTCTTGACTTCCATTGTTCATTCCACGGACAAACAGGAAAGGAACGACAGAGGCCACAAACCCGCTTTCAGCTACCCTGTCGTTTCCTTCTTTCAGAGGGGTATTTGTAAAGTAAAAACATTAAGTTATGACGAAGAAGAACGGAAACGCCTTAACCGGAAAATTTTCAAATAGCGAAAACCCGC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sample_overlaps.sam	Mon Jun 11 16:47:50 2018 -0400
@@ -0,0 +1,257 @@
+@PG	ID:minimap2	PN:minimap2	VN:2.1.1-r369-dirty	CL:minimap2 -Qax map-ont sample_layout.fasta sample_reads.fastq
+@SQ	SN:utg000001l	LN:47564
+1	0	utg000001l	29076	60	28S21M1D12M1D15M1I16M3D3M2I10M1D2M3D7M2I2M4I4M1I21M1D6M1D15M2I27M1I15M1D23M1I5M1I2M7I7M3D1M2D5M1I6M6D4M1D9M1I4M2D4M1I1M1I4M1I38M5I2M3D10M1D9M1D3M1I7M5D29M1D2M3I8M4I4M1D2M6D10M4I1M1D16M3D2M6I5M2D2M1I5M4D28M1D13M1D9M2D5M2I8M1I3M3I21M1D4M1D7M2D4M2D9M4I4M1D30M2I3M1I5M2D3M1D10M1I7M2D7M1I12M1D2M1D14M1I6M1D5M1D3M3I7M1D5M1I3M1D3M1D8M2D7M1I24M1D6M3I14M1D13M3D13M2I6M2D5M3I16M1D5M2I11M1I2M1D1M1D4M1D3M1D2M1I18M1D12M1D40M1D6M1D2M2D5M1I6M3D3M1D6M2I1M1D7M2D3M3D11M2I3M1I18M2I6M2D4M1D8M4D6M1D3M1D5M1I9M2I37M1I3M1D1M1D3M2D4M2I25M1I10M1D1M2I18M2I5M1I6M1D6M1D18M2I2M1D1M2D1M1D6M1D6M1I36M1D2M1D9M1I33M1I18M1I17M2I2M1I2M1I5M1D5M1I2M3I3M2I1M2I5M1D2M2D3M1D2M1D4M7I19M1D8M2I20M1I10M1D9M1D3M1D2M1I31M1D8M2I3M2D5M1D6M2I1M1I10M1I7M3I2M1D20M3D20M1I2M2I4M1I4M2I7M1I17M1I15M2D1M1D21M1D20M2I3M1D8M1D3M2D15M1I5M2I5M1D7M1I10M3D32M1I20M2I20M38S	*	0	0	AGGTAGCCTGTTTTATGAGTGGGGATTACAAAGGATGGTCATCGGTCACGTGACAGTACGGGTACCTGACGGCCGTCACACTGCTTTCACGCTGGCTAGGAAAAGCCGGCCCGCCTTTGTAGGGCCAATGTCCCCGACGATTTTCCGCCCTCAGCGTACCGTTTATCGTACAGTTTCAGCTATCGTCACATTACTGAGCGTCCCGGGGTTCGCATTCACACTGCCACACTGATATCCGCATTTTAGCGGTCATTTCAGTTTGCTGTGTCAGGGAAAGCGGAGGATTGCGCAGGCCTGTAGTAAGCGTGAGCGTCAGGCGGTGCTTCAGGAACACTTCTTCGTTCGCTGAATATCTGGTTGCCCTGCGCCAAACGACCGGCGTTCATTCCCGTTTGCCGTATAATAAATGCATCCCACGATTGGCGGCATGATCCAGAAACTGGGCTCAGTTTGCCTTCCTCCGTGTCCTCCATGCTCAGCGGACCCGCGACATAATGTTTGCCGTCTTTATTCTGCTCAATTTGACGACGCCCGGGCATTCACACTTATCGACTGGCGGCATCCTTCCACTCTGTTCGAAACCCTCCAGTGCTTAGTTATCCTCCGTCATAGCCGGACTTTTCCAGCAGCTCCTGCCGAGGTATGAGGATTGCTTCTTGCCTTTGGAAAATCGAGGTAACCTTCCGCATCATGCCGCCCGACCGACGGCCTCCACGAATGCCGATTTGCCAACGTGTTCCACTGCGAGATAAACATAATCGCTGGCCCGGTTTGATATTGATACTGCGGCTATCCAGTACAGCGCCGTACCAAGATAACGCGTGCTGGTTTCAATGGCTGTCTGATATCCGCAATCTGCTTTTCAGGGGACCAGAACTCAAACTGTACCGTCCGTATAAACGGCAAGATGCGGCGTGGCGGTTATCTGAAGACCCCGGCGTCAGCTCAATCCTCGACGGTGCTGCAGCAATCAGAACGGAATACCATAAGGACCCGCTTAATCGCGCGCCCGCATTTACCGCCCGGTGACTGTCGACCTGTAGTTCCCCAGCGCCAGTGCGTGAAGCGGTATGTGGTTTCCGTCGTCCGCTGCCGTGCTGACCAGCCGCTCACTGCCGTCGTCGTCCGTTACGGTCACGGCCAGCAGGAAACTCACGCCGGTCCCTAGGCTTCGGTGTGTCCCATCGCGCCAGCACCTGATATTCCATGTTGTAGCAGTACTTCTGCGGTCAGGTGCAGTGAGGGGCGGGCGGGATCACCATTCACCGTGCCACTCTGTTCGCCGTTACACTGCACCCGTTATCCACGATGGCCTCTTTTCCGGCACATGCTGCACGCGGGGCGATGGCATACGTGCCGTCGTCGTTCTCACGGATACTCACGCAGCGGAACAGTCACCTCTGGCTGGCGCAGCGAGCGGTTCGGCAAGCTTCAGCTCCCATACGGTGGGTCAGCAACACCGTCAGGAACACGGCTCACTTTACCTTCAGCCGTCGGTGACGACTGAACCTCCACGCTGACCGGATTGCCATTTCCGTCAACCCGAGGGATGACGGGGTCAAGGAGGATGGCAGCGTGATTCAATCCGTCGAGCGTCAGCGTCCGGTATTGGCTGTTCACACAGGCACACGACCACCGGTTAACTGATACCGGCATCATAGTCATCATGGCGCAGATTTCAATAACATCGCCCGGTACCATGGGGCAACGGATTCTGCGCCGACGGTATGAAATCCACGTCCGTTTCCAGCAGTTCTTGTTTTAATCATAGCCACATGCCCGGCGCGGTGCCTGCCCCGGCTGGTACAGCCAAAGGCATCCATCTTCGTAACATTACGACCTGTAACGGGCAATGGCCTGCGTATCTTCAACAAGCTCTGTCGCCGTCTCGAGTAGATAC	*	tp:A:P	cm:i:20	s1:i:190	s2:i:0	NM:i:485	ms:i:968	AS:i:968	nn:i:0
+2	0	utg000001l	26590	60	49S4M1I21M1D7M2D3M1I25M1I12M2I7M1D6M4D3M1I3M1D3M2I11M1D4M2I12M8I1M2I5M2I8M2I4M1I1M4I27M1I19M2I5M3I17M1I1M2I11M1I1M2D8M11I5M1D15M2D10M2D9M3I1M1I3M1D3M1I6M1I26M2I7M1I15M1I23M3D6M6I9M1I12M1I2M1I3M2I16M2D4M2I13M1I9M1D30M2I16M1D3M1D14M8D15M1D7M1D12M1I7M9I2M2D7M1I15M6I2M1D32M1I6M1D5M1D7M1I1M1I32M1D10M1I6M1I21M1D8M1D2M1I4M2I9M2D3M5D11M3I5M1D10M3I7M2D3M1D2M1D3M1D11M3D10M3I2M1I3M3I2M2I11M1D7M2I7M3I12M1I4M1I4M4I5M3I38M5I3M7I7M3D4M2I11M3D26M4D7M2I11M1D1M1D14M2I9M3I24M3D11M1D41M2I12M1I23M4I3M1D15M2I2M1D9M2D3M1I2M2D15M1I6M2D8M1I12M3D7M2D13M3I9M6D5M1I16M4I46M4D11M2I6M1I10M2I21M1I28M1I2M1I6M3D1M1D11M2I5M1D3M1D19M1I8M2D6M1D10M1I5M1D3M1I12M3I6M2I37M1D6M1I38M3I15M1I24M2I10M1D28M1D11M2I3M2D7M6I5M1I17M1I5M1D11M2I22M2D9M1D1M1D8M3I3M2I8M2D1M2D18M1I6M2I9M5I23M6I15M1D13M1I13M1I23M2D4M2D15M2D7M1I11M1I20M2D3M1D5M1D10M1I6M1D10M1D14M1I16M1I4M1D2M1I5M1D9M1D28M1I9M2I8M2I11M3I8M1I26M1D4M2I5M2I3M1I5M1D5M3I4M1I5M3D5M1I12M1I10M2I8M2I14M2D14M5I6M1D3M1D7M2D3M2I4M1I13M1D6M1D8M2D2M1I29M1D14M2I3M2D30M2I4M1D4M1I6M1I14M2I2M2D9M2I3M1I7M1I1M1I45M1I2M1D7M2I3M1I3M1D14M2I16M2D13M3I2M1D8M1I9M1I21M1D6M1D15M1I27M2I15M1D9M2D12M1I5M1I2M2I7M2D2M1D5M1I4M4D3M2D1M1D14M4I10M2I15M3D10M3D14M4I11M1D9M1D11M4D11M2I3M2D24M6D1M2D4M2I9M3I2M1D16M3D2M2I3M1I1M1I7M1D5M1I21M1I8M1D7M1I12M2D2M2D5M2I4M1I4M1I21M1D6M3I10M1D4M1D11M6I3M1D8M1I15M1I31M1I8M2D6M1I30M1I6M1D5M1D20M1I2M1I10M1D12M1D26M3I14M1D4M2D7M3D25M4I18M3D2M2I11M1I2M1D1M1D3M1I8M1I7M1I11M2I13M2I39M1D14M1D30M1D3M1I16M1I3M1I3M1I15M3I6M2D13M4D3M4D13M1I5M1I5M1D1M1D6M5I1M4I1M1D4M3I13M1D1M1D21M1D5M1I3M2I4M4D12M1D19M2I18M1D16M3I9M1I6M2D21M2D19M1D12M1I35M2I4M1I7M1D2M2I2M1I17M2I2M1I2M1I5M1D5M1I5M1D4M1D5M2I1M1I11M1D6M1D3M1D15M2I5M2I15M1I20M1I4M2I3M3I18M2I12M2D27M2I1M5I8M1I4M3I7M1I13M1D1M2D4M2I4M2I9M3I4M6I2M2I3M1D6M1I9M1I15M4D3M1I3M1D6M2D1M1D10M1I4M1I3M5D3M1I4M1D5M4I46M2D17M2I3M5I10M1I25M1I19M1I23M2I5M4I11M2D4M1D2M1D4M1D11M1D2M1D6M1I11M2I11M3D11M2D10M2D7M2D1M2D8M1I3M2D22M1D25M3I8M2I19M1I9M2D6M4I10M1D3M1I3M1I3M2I35M1I28M2D3M1D8M9I6M3D4M1D34M4I5M1D9M1I11M1I1M1I4M1D11M1I5M2I9M1D5M2I12M1I13M1D9M1I13M1I7M1I11M1I5M3D6M2D7M1I16M1D10M1D3M1D7M3D24M1I16M1I3M2D1M1I9M2I12M1I8M1I14M1I5M1I1M3D1M1D2M1D6M1D5M1D13M5I4M1I8M6I8M3I8M2D9M2D28M1D8M2I7M4I9M1D3M1I4M5D2M1D5M2D2M1I12M4D4M1I1M1I8M2D4M1D1M2D22M2D7M1D12M1D33M1I7M2D2M1I6M1I18M1D3M2D17M1I36M1I5M1I6M1D10M1I7M1D3M1I2M3I10M1I4M1I20M1D1M3I14M1I10M1D2M2D9M2D1M1D15M4I1M1I6M2I6M2I3M1D10M1D6M1D18M1I1M2D13M1D6M1I5M4D3M1I6M3D5M3I53M1I5M1I2M1I7M1D5M4I6M4I5M2I21M1I4M1D8M1I5M3D9M1I3M6I2M1I5M2D16M1I27M1I5M1D21M1I14M1D2M1D5M2D12M1D4M1D8M1D6M2I6M2D15M1I37M1D3M1I9M1I17M1D2M1D10M3I7M2D19M2I2M2I7M1I13M1I10M2D2M3I18M1I2M1D6M1D33M2D11M1I4M1D19M1D7M1D4M1I19M10I15M1I5M2I11M2I2M1D3M1D1M3D7M1I8M2D19M1I17M1D27M1I2M1I4M1D1M1D2M1I3M2D8M1D3M2I2M4I6M2I28M1D16M3I1M1D11M1I2M2I3M1D6M3I3M1I5M1I2M1D3M1D22M1I15M1I7M1I1M2I22M1D8M1I14M4I22M1D26M1I4M2I6M3I30M2D10M1I16M1D11M1D1M2I18M1D37M2I15M1I2M2D9M1I4M1I8M3I2M1I3M3I6M1I6M2D28M1I16M4D6M1I3M2D6M1D24M1D29M2D6M1D1M2I10M2I6M37I5M1D10M1D5M2D35M1I1M2D2M1I8M1I4M1I8M1I15M3D5M1I13M1I2M1I5M4D5M1I1M2D6M1I5M1D1M2I9M5I15M2D6M1D2M2D8M1I2M3I3M1D8M2I3M7I6M2D11M1D7M1I1M2D1M2D4M1I4M1I4M1D15M3I13M1D1M1D1M2D11M1I3M1D1M1D3M1D6M1D11M1I8M1I5M3D7M2D6M2D7M1I1M1I13M1I2M1I13M1D6M1D8M2I4M1I7M3D1M2D4M1I5M2D2M1D23M1D2M1I2M1I11M1D6M1I11M3I10M1I1M1I3M3I15M6D5M4I7M8I4M4I6M1I2M3D5M1I16M2D9M1D5M1D4M1D10M3I12M1D14M1D4M2I10M3I4M1I9M1D6M3I6M1D22M1D24M2I7M1I7M1I2M1I23M1I8M1D10M2I2M2I2M1D12M1D5M1D15M1I10M1D7M1I22M5I9M1D7M1D6M1I34M2D11M3D20M2I3M2D1M1I6M2I12M1I4M1I1M1I10M3I3M1I3M1I4M1I7M2I1M1D6M1D12M3D5M1I6M1D13M2D4M1I2M1I1M2I22M1D13M2D7M1D3M1D4M1D30M1I4M1I7M1D6M1I3M3I3M4I2M1D5M1D5M1I10M2D4M4D28M1I5M1I3M1I4M1D19M1I3M4I1M2I9M2D9M2D11M1I23M1I10M2D12M1D11M3D6M1I10M1D7M2D13M2D22M2D9M1I4M2I6M1I11M2I29M1D48M1D4M1D20M2D12M1I12M2I2M1I4M1D3M3D1M1D2M1D12M2I1M1I2M1I1M1I7M4I4M1D4M1I9M1I8M2D11M1I1M1I3M1I6M1I8M2I2M1D30M8S	*	0	0	ATCTTGATAGAGATTTCTAGGGGTATGCGTTAATGATCAGAAGCTCCCAATCAGGTTCAGTCAGGCTGGCGGCATCATTTCCGGCAAAATACGGTAATTATTTTCGCCGTGTAGAAAGCCCTGCCACATAGGCTAGAGTCGCAAGCTTCTTCGGTTGTTTACCCGCAAGCGTTAGTCATGGTGGTGGTAGCCAAAATCTGGATCATTCTCCCGAGCGCTGCGGCCAGTTCATTCAGCGTATTCAGTTGCGTCAGGTGACGCGTCGATAACATCTGCTGCAATCGCGGCCAGTACAAAAGCGGTTTCGCAATCTGGGTTTGTTTGTTCCTTGACATCCGGTTGGTGCTGTTGGCGTTCCGGTCAGTGCCGGACTGTTGAGGTTGGCTTTTTCTGTTCGTTTCATCCATTACCACCTTAACCGCCTTTGGCGTTGCAGCAAGCGTTTCAGACGTGCTGTTGGTTGCACTGCTGAGCTGCTATCCGGATTTCTCGTTGTCCGCATCCTCAAGCGCGACAGCTGAAGCTATATCTTCTGCACGTTTTGCCGAATTTGCACGTATTGCCGCCGCTTCTGCCGCGCTCGCATTTGCTCTGCGATGCTGATACCGCACTTCCCGCAGCCTCCCTTCCCTTCGTGATGCCGTTGACGGCACTCCCCGCCGCCGCTGTTTGCGTCGTGCCCCGGCAGGATGAGGGGCGCGTTCCATGCTGTTTCAGATGACCTGGCATTGCGTCTCGGACGTTTTGCCTCACTGGCAGAATTTCTGCCGCCGTTGCCGAGGAAGCTGCACGACTCGGCACTTGATGATGCGTTCGTTTCTGATGATTTTGTGCCTCTTGTTGTACCGGGCATCTCGTGCTGAAGGAGTGGGGGCCTCTGACGCTTTCGTGGCCATGCGGAGGCAGAATTGGCTGATCTTTTAGTCGACTTTGGCTTAGCAGCATTCGTTTCTGTAACGTTTTCGCCGCACCGGCACTGGGCCGCCCGCGTTTTGAGAGAACTCTGCGGCTGCGGCACTTTTCCGCTTCAGTGGCCTTGCTGATGCCGCCTCTTCTGCCGCTACGGGCAGCTTCCTGAGCTGACGGATGCAGCCTGTCCGGCGGACGTGCTGTGGCGGCGCGTCGGGTCAGTTGCATCAGAGTCACAAGCTAGGCCGCGACCTGAGCAGCTGATGCACTGGCATCGCCGGCTGATTTCTTCGCGTCTGCCGTACTCTGTGCCACCACGAAGACGCGTTACGCTGGGAGCTCTTCCACCATGAGTTCGACGAAGCGACGCAGCACCTCCATGGATGGCATCATCCTCGCGTCATGGCACACAGAGAAACCTTCAGCGTCCCCGGTTGTGAATCTTCATACGGTGATGGTCCCGGCGTGCGATGGAAAACCCGTCAACCTGCAGGATATCTGACACTGTACTGACCGTACTCCACATCCATGCTGTAACGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTTGCCCCACCACCGTGGTGCTGTTAATGTCTGGCTTTCAGCTGAATGGTGCAGTTCTTGACTAGTTTTCCTGTGCCTATCTTTCAGACTCCTGAAATCTTTACTGCCATATTCACCGCAAAAGCCCACCGGTTCCGGCGGGCTGTCATAACACTGTGTTACGCCTGGCTAATCAGAATTTATAACCGACCCCAACGATGAATCCGTTTAGATCGCCAGTCGCCACTGCCGGCCCAGCCTTCATAGACAGCAAGATAATGAACGGACGGACGCTGCCGGATTAATCTGTATACCTGCACTCCACGCCAACCAGGTATGCCGCATTGCATTTCGTCCCTGGCAGTGGTCGTCTCTTATCTTTCAATACCCGGGAGTGATTTCCGTCTTACGGTAATGCGGCTTGTACTGCCGGATAAGCGACTGTGAGCCACTCCATGGCTGAGAAGCCGCACTGATTTACTGATTTGTAAAACCGGTCCGGCCATCACGCCCTAACTAACGTCCACGCAGGCTCTCATAGTGAAGAAACGTATCCTCCCCGGTCATCACTGTGCTTGCTCTTTTCGACGGTGGGGACCCCAGGGAAGCCATCCCCCACTGTCCGTCAGCTCAACGGTACTTCACGTTAATGCCTTTCAGATGACTCACATCTATCCCGCCGACAACGACGGCAATGATCGGTTTCATTGAAAATAGCCCACCGTAAACGTACCATGTCCACGCGTCGCACGGCCGGAGTACTGTCACCGCAAGTGCGGCAAAGACAGCAACGGCAATACACACATTACTCGCATCGTTCACCTCCTCACTGTTTTATAATAAACGCCCGTTCCCGGACGACCCTCTGTAACACTCAGACCACGCTTTCGTTTCACAGCGCCTGTTTCTTAATCACCTAAGACCTGCACGCATCGCTGGCAAACGTATACGGCGGAATATCTGCCGAATGCGTTGCCGTGACCTTAAGCGTGAACGTCAGGATCACGTTTCCCCGAACCATGCATGTCAACAATACGGGAGAACACCTGTACCGCCTCGTTCGCCGCCATGAGCTAATCACGCACCGTTCATCAGTACTTTCAGATAACACATGAATACGTTGTCCCTGCCGCTGACAGCTTACCCTTATTTCACTATGAAACGTCAGGGAACGAAGCACCACTATCTGGCGATCAAAGGATGGTCATCGGTCTACGTGACAGGTTCCTAGATAGCTGACGGCCGTCAACCCTGCTTTCACGCTGGCCGGAAAAGCCCTAGCCGCCCCGCTCTTTACAATGTCCCCGACGATTTTCCGCCCTCAGCGTACCGTTTATCGTACAGTTCAGCTATCGTCACATTACTGAGCGTCCCCGGAGTTCGCATTCACACTGCCACTGATATCCGCATTTTAGCGGTCAGCTTTCGTAGCGTCCGTGTTAGGAAAGGCCACCGAGGATTGCCGCCGTAATGGTGGGGCCGTCAGGCGCTTCAGGAACACGTCGTTCATAGTGAATATCTGGTTGCCCTGCGCCAAACATCGGCGTTTCATTCCCGTTGCCGGGTCAATAAATGCGATACGATTGGCGGCAACCAGAAACTGGCTGAGTTTGCCTTCCTCCGTGTCCTCCATGCTGAGGCCAATACCCGAGACATAATGTTTGCCGTCCTTTGGTCTGCTCAATTTTGACAGCCACGGGCATTCCCACTGTATCAACTGGCATCCTTCCACTCTTTCGAAAACTCCTCCTCCAGTTGCTGGCGTTATCCTCCGTTACATAGCTCGACTTTTTCCAGCAGCTCCTTGCCGAGATGGGATTCGGTTATCTTGCCTTTGGAAAATCCAGGTAACCTTCCGCATCATCGCTCGCCCGACCGACGGCCTCCACGAATGCCGATTCAACGGTGTTCACACTGCCGGATATAAATAATAATCATGGCCGGTTTGATATTGATACTGGCGGCTATCCAGTACAGCGCCGTACCAATAACGCGTGCTGGTTTCAACCTGTCTGATATCCGCAGCAATCTGCTTTCCCGAACCAGAACTCAAACTGTACCGTCCGGGTCATAAACGGCACAGATGCGGCGTGGGGGCGGTTATCTGGAAAATAGCCCGGCGTCAGCTCAATCCTCGACGGTGCTGCCCCTTGCGGCAATCCGGAACCATGATACCGACGCCGTACGCCCTGCTGCCCCCACGCATTTACCGCCCGTCAACTGTCAGCCTGTAGTTCCCCCAGCGCCAGTTGCGTGAAGCGTATCTTATGCGTCTTTCAGCGCCGTCGACCAGTAATTCATGGCCTCAAGCCTGCCGTCGTCCGTTACCACGTCAGACGGAGCAGGAACTCGACGGTCCCTCACCGTCCTTGTCCCATCGCGCCAGCAGCTGATATTCCCGCTGTCTGCAGTACTTCTGCGGTCAGGTGAGGCTGCAGCGCCGGGCGGCGTGACACCATTCACCGTGCCTCTGTTCGCCGTCAAAGTGCGCCCCGTTATCCACGATGGCCTCTTTTCCGGCACATGCTGCACGGCGGTGAAGATGGCATCGTCTGCCGTCGTCGTTCTCACGGATACTCACGCAGCGGAACAGTCGCAGCGTAGGCAGCGTCGGCAGCTTCTCAGCTCCAGGGCCGTATTCAGCAACACCGTTGAAGGAACACGGCTCATTTTACCTTCACGCCGTCGGTGAGACGGTGACTCTGACCCTCCACGCTGACCCTAGATTGCCACTTCGTCAACCAGGCTTATCAGCGCGGTACATCGGAGAGGATGGCAGCGTGAGCATTTCACGGTCGAGCGTCAGCTAGGCTTCGGGTCTGGCTGTTCTCACCCCATGGATCAAGGCTACCGCGTGTGCTGATACCGGCATAGTCATCATCGCAAGATTCAATAACATCGCCCGCTTAATGGCGAAGCCCTTCTGCGCCGGCCGACGCTGAAATCCCACGGTCTGCGTTTCCAGCAGTTCTGTTTAATCAGCCACAGCCCGGCCGGTGTTCTTGGTGCGCCTGCCCCCGGCTGGTACAGCCAAAGGCATCCATCTTCGTAACATTACGACCGTAACGGGCAATGGCCTGCGTATCTTCGACAACAGCTCTGTCGCCGTCTCCCAGCCGTTGTTCGGGTCAATCCAGTTCACCTCAAACCGGCATTATGGCGGTCCTTCAGGGCGCTGAAGCTGTAGCGGAACGGCGCGCCATCATCCGGCATCACCACATTATGCGGTTATAGGTCCACGTCTTATCCCACGACGGTCCTGTTGCTGCACGAACGTCAGTCGTATGCCCGTTCCATACCGGCATACAGCGCAGGCGCCGAGCAGAAATCGCTGAGCACATCCACGCCTTACGCTCTGTGTCAGGTGAGCATTACAGGTGATGCGCGGCTCCGTGCAGCCAAAGCAAACCGTCCGGCACTGACTGGTCGCAGTACTGGCCGATGACATACAGCGCCCAGCTTTATCCCACATCCGCAGCATCACAGACGTTTCCCCATGCCCGTAGCGCGGATGGGTCAGGCATATCCACAGACACCCAGGCCATGTTGTGCTGTATGCCCGGTTAAACGTTCCGTCCCAGATCTCGCTGTATTGCCGCGTCTTGGATTATAAGTCGGACGGCACCTGGCAGAATACGCCGGCAGATGATTACGGCTCACCTGCGGCTGGCTGCCGAACTGCTCCGAGTCCACCTGCACGCCGACCAGTGCCGTGTTCGGGAGCACTGTTTCACATCGATGATTTCAGTGTATGACGACCAGCGTTTGTTCTGCAGCACTGGTCGTGTGGTGCTGTCCGGCGTCATCCTTTACGGTGCGCGTGCATCCGTACTTAAACGGGCGCTATGCGGCGTGTACCAGGCTCCACCACCGAGGCCAGATACTGCAGGTAGGTCGCCTTAATGGTGATGTCTTTTCCGTCACCCAGCCACCGTTACGTTGTATCTAAACCAGCAGGCGACTTCCGACGGATTCCTGTCACCCTTTGAGGTGGTTTCCACCAGTGCCTGTACACCCGACTAAAGCGCGACGGTCGATGTTTGCAGACGTAATGGTGCGGGTACTGCGGGCGTCATATTTCACTTCCGTACCCAGCACCGTCTCGGAGCCGGGAGGATCAAATCCCTCCGGCGGAGTCGTGGGACTCCTGCTCACCCAGCCCCGGAACACCAAGGGTGACACCGGATATGTTGGTATTCCCCTCAGTGTCCAGCACCGGCGTACTGTTCAGCAACGGACCCTTTTAAGCCCATCCACCGGACTTCAATCGGCCTTCGCTGATGGCATCGATCACACTCAGCAACTGCGTGGACTTCAAGGTTTTCGCTTCGCGCGGGGTATCCCCTTACTGCTTCCTTTACCCATTCCTCACGCTCCATAAATGACAAAACCGCCCGCAGGCGGTTGCGCATAAAACATTTTGCATCCCTCATCTAGACCAATCACACAACCTGACCACCGTCCCTTCGTCCTGCCCCGATTTCCGTGACGACTGGAGATCCACGATTACCCTAGCGCATTTCCCGTACAGAACAGGCAGAACATTGCGGCCTGGCAACCATGTTATCCAGTGAGGAGAAATAGGTGTTGCTTACCGTATCCGTTGTCTGTACGGGGGTTCCCTTTCGGTGCCTCAGCATCTGCGCCACACCACCGAGCACCATACTGGCACCGAGAGAAAGAGCATGCCGGTCATACCACCGGCTCCAATGGGTGCCCCATGCTGCAAGGGTGGCTCCGGCGGTAAAGAATGATCCGGCAATGGGCGGCAGCCCCCAGGACAATCTGGAATACGCCAGCCCTGACTTGGCCCCGGCGACTCTGGGAACAATATGAATTACAGCGCCATCAGGCAGAGTCTCATGTAACTGCGCCGTTAACCCGGACGTGCCTGACGTCCCGCCCGGCAATCCGTACCTGATACCAGCCGTCGCTCAGTTCTGACGAAACGCCGGGAGCTGTGTGGCCAGTGCCCATCAAGCTTCAGCCCCCGTTTTCACGAAGGTCGATGCGGCGACCAAATCGTTGTAAATCCCGTAAAGGCAGATGCGCGCCATGCCGCGAATGATAGAGGAGTGTGCGTCGCTGCAGGATTTGTCGTCGCTTACCTCTCGTTTGCTCAGTTGTTCAGGAATATGGTGCAGCATAGCCGCCGTCGCCGCAGTAAATTGCGGCGTGATTCCGGCACTGATGAACCAACAGCACAGCAGCACATCGCCCGGCTGTGCCGTGGACAACGCACCTGATACAGCCCCGTCGCCTCCAGATTATCCAGATAGAGATTCTCTGGCCGTTACGCCACCAGTCATCCTCACGATGAAAGTCCGGCATCTCAATCCCGCCAGATATGATAAGCAGCATCCCGGAACAGTGTGTGACAGTCCGTCACCGTGCTCAAAAGCGCCGCCCGGTGGATGCGGCACAAGGGAACTTATGAATCGTCCTCCCCGGCAGACCAGCCACCACGGCAAATCACTCTGCACCTGCAGCCGCCGGTCGAGCCACTCAGCCAGAGGCAGACCACCCGGGGTGGCTGGTCGAGACCAGCGCCAATCTCATCCTGCATTTCTGCCTGCAGCCCAGTCTTCCGGCGACATACGGAAATACGCCTCCGGCTCACCGGAGATATTCACGCAGGGAAATATTTCCGCTCCCGGCGTGAGTCACGAATGACGCACGACTCCGCTGGCGCACATCGCCGGGCGTGCGGCCAGAATCATGATTCTGTCGTCTTGTCATGGGATTTACTGCGAAAGTTTGTTAATGGAAAGGAAACCGCCAAAGTTGCCGACGTTATTGCTAAGAACTTACAACCGCTCAGGCATTTGCTGCATTTATCCTTCGTGATATCGGACGTTGTATGGTCATATTCACGGTGACAGCCGAAGACGACCGCTATACCGCACTCGTCACCGCGATAGTAGTCCAGGTGCAGGTGTTGGCCAGCATGATACGTCCCGGAAAAACAGCGCCATCCGTTTCCGTCGGCGTGACAGTACAAAGGAGGCACTCACCGCGCTCAGTTCGCTGCACTGCTCAATGCGCCAGCGGCTGATCACCTCCTGCTCCGGATCGGCGTAACTGTTTCCGTTGTATAGACGAAGTTCACCGCATCCAGAGAACGGGCGTAAACCTAATCGCCGGACCACCCGTTCCGCCGACCAGACTCTGCATATCTTCCGCCATCCCGGTGACCATACCGTACAGGTTAGAAACCCGTCAAGCGTGGGGCGCGTGATTAGCCTGGGTCCTTTGCCATTCAGTTCAAAACCGCTCCCGCGTAGAATGGGATACGGCTGATATATACTGTCGCCCCCTGCCAGGGACCGGCTCAGCTTTTCGTTCTGCTCATTACCCGATAAATAACGTTCTCCACCGACCTCTGTCAGGTCGATTTCCCGAGAGCACCACGCTGGCCGACTGCTCCGCACGGGTGCATTCATTCAGTGTTTCCTGCCGGATATCCTGCATCAGTTCACGCCTGTTCAAACTCTGCCTACAACTCAACACGCAGCATACTGACCCCGGGACATAATAGGGTTCACAGGTCACCTTTATCTGCCGCCCTCATAAGGCGGCGTCCACAGAAAGATTTCCAGCCCCCGTGCTCTTCCAGAAACGACCCACTCCAGTACCGTGGCCTCCTCACGGGGGACAGAAGGCGTCACGCTGTACGTTCAGGTTGGCATTCAGCCGGCAGGCGCTCGCTGAGAATAGCCATCACCAAAGCGCACCCTTTCGTACAGAGACGGGACCGAAGCCACATCCATAAGGTATCTCATTTGCTTTCCATGGAAGGTCTTCATCGTCCACCTCCGGAGAACAGGCCACCATCACGCAATCTGTGTCTGAATTTCATCACGGCATCCTTGCGGTAAGTCAACACGCGCCTTCAGAGCAGCCGTACTATCTGCCCGTTCCGTGCCGTCGTTGTTAATCACATGCTGGTTATTCTGCTCAACGTCCCGGACGCCTGCGACCGGCTGTCTGCCATGCTGCCCGGTGTACCCAACATAACCGCCGGTGGCATAGCGCCGCATCAAGCCGGTGAAGAAATTCCCCGCCAATCCGGCTCGTTGCCTCCCTTCGTGAAGACAAACTCACCACGTGAACAATCCGCTGGCTCGTTTGCCGCCGGTTCCCGTAAATCCTCCGGTCCAAAATGGAATTTCGCCCGCAGCGGCCTGAATGGCTGTACCGCCTGACGCGGATGCGCCGCTCAGACCACAGCCCGCCAATGGCGCTGCCGATACTCCCGACAATCCCACCATTGCCTGCTTAAGCAGAATTTCTGTCATCATGGACAGCACGGAACGGTGAAGCTGCGCCAGTTCTGCTGCACTGCCGTCTACAGCATCGCCGCCAGATTCTGTGCAATACCATCAAAGGTCTGCGTGGCTGCACCTTTTTACTGCGACATACTGTCCCGTGGCGCTCTTCCCACTGCTATTCCCAGCCGGACTTCAGGCCTGCCATCCAGTTCCCGCGAAGCTGGTCTTCAAGTCGTTA	*	tp:A:P	cm:i:149	s1:i:1466	s2:i:0	NM:i:2202	ms:i:5494	AS:i:5511	nn:i:0
+3	0	utg000001l	18263	60	366S719M1I3M1I19M1I1M1I4M3D9M2D2M2D30M1D6M2D3M1D1M3D6M2I9M1I5M1D6M2I6M1I23M1D2M2D5M1D5M1I10M1I6M1D4M1I18M4D6M1D8M2D2M1I5M1I5M3D10M2D4M5D7M1I1M2D2M1D5M1I2M2D8M3D10M2D15M1D10M2I1M1I5M1D9M4D9M7D5M2I4M4D3M1D6M1D1M1D7M2D2M4D5M1D30M3I2M2I8M1D3M3D8M1D3M2D5M1D1M1D3M1I1M2I13M2I11M2D14M1D2M1I11M1I4M1D3M2D9M1D7M2D16M1D10M1I6M1D18M5D1M1D5M3D7M1D2M1I3M2D5M3D4M2I11M2I4M1I12M1D1M1D1M1D6M1D1M1D17M2I1M1D5M1I3M2I1M3I5M1D3M1I10M1D3M1D7M1I1M1I8M2I4M6I1M2I12M1I5M1D3M2D10M9D4M1I9M3D8M3I12M6D2M8D4M6D23M1I14M1I12M2D20M1I7M2D2M2I1M1I7M4I13M1I3M1I9M3D10M1D4M2D9M1I1M2I9M2I5M1I3M1I16M1I1M1I4M1D1M6D9M1D11M1I6M6I9M5D2M1D4M2I4M2D16M2D6M5D11M9D3M2D5M4I13M3I3M1I1M1I4M2D4M1I10M2I21M1I23M1D25M1I17M2D13M1D9M1D1M3D10M2D12M1D5M1I15M4D21M1I7M1D2M2D1M1D3M1D1M1D6M1D12M2D1M1D6M1I23M2I5M1D11M3I1M2I11M1D2M1D7M1D14M4D4M1D7M1D1M2I7M3D6M2D2M1D5M1D2M1D3M2I5M1D5M1I4M2D9M7I29M9D7M1D27M2I5M1D4M1I13M1I5M1D2M2I2M3I7M4D6M2D2M2I3M3I3M1I4M1I5M1I6M1D10M1D5M3I5M2I3M2I4M3I4M1D2M3I5M2D2M1I3M3D5M1D4M1I10M4D3M2D21M2I36M2D10M3D19M2I2M2I4M1I4M1D3M1D3M4D17M1I15M1I6M5D7M3D5M2I23M2I13M3D9M1D6M3D3M1D2M1D5M1D3M1I1M1I13M1D3M1D2M1D43M2D2M1D28M3D3M2D8M4D29M2I27M1D13M1I1M2D8M5D15M4D3M9D6M2I5M1D2M2D2M1I7M2D4M3D18M1D11M1D3M1D12M3D4M1I4M3D5M2D3M1I3M1I2M1I4M1I2M1D2M1D3M2D12M1I8M1D34M1D12M2D10M2I11M1D10M3I19M1I5M1D3M2D6M10D6M5D2M3D3M3D2M5D7M2I4M2D10M1D2M4D4M6D12M3I2M2I9M2I7M1D15M3D3M5D11M6D15M1D5M1I4M2I3M1D6M1I10M2D2M3D1M1D3M2I3M2I9M3I3M1I12M1D11M2D79M1I10M2D3M1D5M2D2M3D11M1D12M3D16M2D9M1D11M3D9M1D4M1I13M1I9M1I13M2D3M4D2M1D4M5D10M2D12M1D11M1D6M5D3M1D3M1D7M3I10M2D1M1D5M2I14M1D3M2D6M1D4M1D10M1D9M3D1M1D1M1D7M4D10M1I16M5D7M3D3M2D14M1D10M1D1M1D8M1I7M1D1M1D3M1D13M2D4M1D8M2D8M3D1M2D9M2D2M1I3M1I6M1D2M3D3M1D4M2I7M1I12M4D3M22D28M1D10M1D14M2D3M1I3M1D10M5I5M1I9M5I8M2I9M1I3M1D7M1D2M1D9M2D8M2D3M2D13M1D15M1D3M2I10M1I2M2D3M2D12M2D6M1I7M2I18M1D7M2D6M3D1M1D11M4D19M1D1M2D4M1I5M1I5M2D5M1I7M2D7M1I7M1D2M1D5M2D5M2D10M3D2M1D7M1D7M1D1M1D4M2D8M3D3M3D6M4I4M3I5M1I16M1D13M1I3M3D2M1D2M2D13M2D25M1D6M1D3M3I7M1I5M2D2M1I3M1I6M2I20M1I8M1I7M1I1M2I6M2I4M1D4M1D6M1D18M1D6M1D10M1I4M2D6M3D2M2D3M6I3M3I3M1I8M2D4M7I1M1I2M3I9M2I12M2I5M1D14M1D7M3I14M2I3M8I32M1I3M5I6M2I6M1I17M3I5M1D12M1D5M1I21M2D2M8D13M2I1M2I8M2I1M1I6M1D7M4D6M5D5M2D6M3D3M1I5M1D4M4D19M1D16M1I24M5I1M1I8M1D3M1I9M1D6M2D2M5D12M4I4M1D1M1D2M3I6M2I3M4I20M4D20M2D3M1I7M1I2M2I2M1I5M8D7M1D7M2I19M2I2M2D1M2D7M3I7M3D4M4D3M2D4M1I18M1D3M2D3M1D4M1I7M1D7M1I1M1I13M1D3M1D13M1I25M3I7M4I7M1D12M5D3M2D2M1D10M1D6M2D6M2I4M1I16M2D1M1I7M1D4M1I11M2D5M1I6M3D23M2D6M1D32M3I22M1D8M2I3M1D9M1I8M1D1M1D11M1D1M2D4M1I8M1I2M1I2M1I1M1I12M2I3M1I7M1D3M1D24M5I1M1D5M2I2M1D5M1D29M2I1M2I11M9D6M1D30M3I6M2D7M1I9M1D2M2D3M3D6M4D4M1D7M5D2M1I2M1D7M3D1M1I3M1D27M4I8M1I6M1D19M1I18M2I2M1I7M9I12M3D17M1D2M1D3M2D3M1I4M1D4M4D11M1D7M1I4M2D28M2D4M4D13M2D1M1D4M1I52M2I18M1I6M5I7M1D10M4D5M2I12M1D8M1D4M1I1M1I4M2D9M1D12M3D4M1D10M1I1M2D5M5D2M2D2M2D2M1D3M2D9M1D6M5D17M1D10M2D5M2D4M1I3M1I3M2I9M1D3M1D5M1I6M2I2M1I4M1D11M2I5M1I6M2I1M1D4M1D9M2I12M1I5M2D4M2D5M1D6M3D1M1D19M1I12M3I1M3I8M2D4M2D4M2D4M2I4M3D24M2D10M3D8M1D1M1D10M3I2M1D6M1I2M2D17M1I4M1D9M1D4M1I9M4I12M1D6M2D2M1I2M1I4M1D12M1D6M1D6M1I9M4D15M2I21M1D9M2D6M1D4M1I5M2D8M1D5M3D5M1I4M1D2M1D10M1D5M3D3M4D1M1D16M2D5M1I9M3I10M1D2M1D3M2I4M2D5M2I14M1I12M1I9M2I4M1I7M3I28M1I2M2D14M3D13M1D15M1I3M3I7M1D2M1I7M1D3M3D1M1D8M1I6M2I6M3D21M1I5M1D3M1D3M2D9M3D3M1I3M2I6M3I5M6I7M1I10M1D15M2I28M2I5M5D18M2I20M1D5M1I2M4I1M1I6M2D7M2I7M4I2M4I4M2I6M4D12M2D2M3I7M2D3M8D7M1D4M2D10M1I1M2I29M5D5M1I5M1I1M2D6M1D2M2I13M1D16M2I2M1I7M1D1M2D3M2I5M2D9M1I9M3D3M1I3M1D5M1I2M2D3M1D1M3D19M2D7M1D13M1D22M1I6M1D3M1D2M2D14M2I19M2D3M1D2M1D25M1D20M3I5M2I1M1D4M1I2M1D5M1D5M1D4M1D1M1D8M2D2M1D2M3D1M6D2M8D25M1D10M1D13M183S	*	0	0	GTTGCTTGTGCAGGTTACAGGATCCGATCTGCTCGATCCTGAAGAATTTGCCGAGCCCGAGTGGACTCGCACTGCCGTGAGGCATCGAAGGCAGTGCAAGTATCGGAAGCGGAAGCATTTCACGCGTGACGGATCCGGATTGAATGGGTAATCGAAACGCATTCCATCGAATGGCGCACACTCGACCCCGCGAACTTCCACTCGGACAGCACCAGAAGCGAAATGCACCTCACGTAGGAAGCGTATCCTGTCAACGTGGGACGCCTTAAAATGAACTAAATCGACTGATCCACGCGAGGTCTAATGGAACGTTCGGATCTTGTTACGCCTGACCGGAAGCCGAATGAAAGGCGCGAATGGACCATTTCTTGTTGTTCGCCATCCTGAGGAAGACTCCTGTTGACTCAATGCACTGGTACCGGGAAGAGTTCCGGCAGTTAATCGAACAAGACCCGTTAACTATCGACTATTACGCATCGCTATTACGATTGGCAATCGTAATGGCCTCTTCTTCCCTGCGACTTCCTATCTGCATATGATGTCGAAGGAAGCGTGCTCCGCATTCATTAAGGAGTGAGATCGGTTTATACCAAAGATAACGCTTGTAAAATGCTGGACGATTTCGCGTCGTCTTCACAGCGATCCCAGTACTGTAGTGTCAGATGATGACGTACTCAACATCGCTATTGACGTATCTTACTGTTTCTTTACATAAACATTGCTGATACCGTTTAGCTGAAACGACCATTGCAAGGATTTATAAATGAGCATCGATGAGTCGGAGGAAAACGATTCTCCGTAGTCAAGTTAGAGTCGCTTCCTGCAACTACGAATGTTATGTAGATGAAGGTATAGATAGAGTCGCTACAAATATTCAATAAAGTTTATAAGTCGGACTAAATCCCCATTCTGCAATGTGCCAAAATGACTGATACGTGCCACGTGGTGACTCAGAATACGTGGGAACGATACTTGCCTCTGTACAAACATAGATGATTAAACCCAAGAGAAGAAGACTCCGGGATTAGATTTCTCCCACTCCCTCCGGGTTTGTTTATGGAGATGATAAATGCACTTCCGTACAGAGAAGTGGAACCGAGCCATTCAACGAGTTATCGAATAGAAGTAACGACTGATAATAGACGGGTCGATATGGCCAGGTAACAGGACGTAACCAATATTCGAATTGAAGAACTCAAAAGAATACAAGCCGCCTGATGGCTTTGGTCGGGCACGCGACTTTGCGATGTACTTGACATTCAGGAGTGGAACGCACGCCAGCGACGTCAAGAAGCTGCCATCGCTTCCTTCCTTCCGAATGCATATTCCCTACGGTTACGAGTCGAAGAGTATCTGTTCCACGAATCAGCGGTAAATTATCAAGTGGACACTCGACAGTAACAGGGCGTCGAAGTCACGAACGGAAGTGAAGCTTAGCTCGGATTTACCTCTAATTTATAAGAACAATGGATCATGGTTCGCTACATGATCAAGACGGGTAAAGAGTTTGGATTAGCATAAAGCGAATCGCAATCACTGAAGCTATACAGGCCAACATTAGTTATTTTCAGACAAACAAGCCTGACAGCGAGAATCAAATACTTCGCTTCCTTCGCTTCATGGCCTTGATCGCTACGAAAATCCTGACGGGAAGGAAGAAGACTAGTTAAATAGCAGGACTTAAAGCAAGCTAGGCGATGCCTGATCATCGACTTGAAGACCAAAGGAATTGCGCTGAATGCTCAATGGATACATAGACGAGGCAAGGCGGCGTCAGCCAAGTCAATCAAATACGGCTAGGCCGGATCGGTCCAAGAGCTGAAGCATAACAACAAACCATGTGCCTGCCTACGAGCAAATCAGAGGTAAGGAGATTTCGAAGAAAATTTATCAAGCATAAGAATCATCAGATGTTGGCTCAGACTTGCAATGGAACTGGCTGTTGTCACGGGCAACGAGTTGGTACTTTATGCAGAAGAAATGAAGTGGTCCTGATATCGTAGATGGATATGTCGTCACAAAGCAAAGCTTAGGCGTAAAATTGCCATGCCAACAGCATTGCATATTGATGCTCTCGGAATATCAATGAAGGAAACACTTGATGTCGTCAAAGGGAAGATCGGCTAAGAAATAATTGGATACGCTTCGTGCCGAACCGCTTCCAGTATCGGGTTTTATGCGGACGAAAACGGATCAGGTCTTTCCTTCGAAGGGATTCTAGCTTTTCACGGTTGCGCAGTTTGTCTGCAAGACTCTATGAGAAGCAGATAAGCGATAAGTTTATAAACATTCTCGGGCATAAGTCTAGACCATGGCATCACAGTATCGGGCAGAGGAAGGGTGGACAAATTGAAATCAAATAATACTTTATTTGACGGTGACCTGTTCGTTGCAACAAATTACCAATCGTTTTATAATCCCCTGCTCCTGAACGGAGAAACGTAAATGATATAAATATCAATATTAAATCGATTTGCATAAAACAGACTACATAATACTGTAAACACAACATATGCGATCTATGAATCAACTATTAGTATTAGTACTGTGACAGTTAATAGGAAGGTACTTTATTCTTGCTCAATTTTGTCATCAAACCTGTCGCACTCCAGAGAAGCACAAAGCCCCAATCCAGTGCCGACCTTTGTGTGCCACCTACGACCTGCATAACCAGTAAAGAAAGACCATTCGTACTGTCGATGCCTGGGACGTATTCTTTTCGTTGAATAAACTTCTAAGACAAGATTAACGGTACTTTCTCGCCATAACTGTAGTGAATGTCGTTATAGGCGGAGCGAAGTTAACACTTGACGCGGAAGGATTAGCTATCTATCGCTTATTAGTACTTGAAACGCTTCTTCAGAAGCCTGAAGGCTAATCGTTTGATGGGGTCTATGCATTAATAGACCACTGACCTGTTGTATAAACAGTGCACCATGCAACATGAATAACAGTGTGGGTCTAGGAAGCAAGCTCCCACTCTTCCGAACTAATACGATGCCCCGTTAAGTTCAATACTAATTTGATGGAAGCCGAAGAGGAGCATATAACTTAAAGAGGATCTTGTTGCCGCCAAATAAATTGCGGTCGTTTAATAAAATTAAGCGTATATATGTTGGGATTTAGTTATTGAAATAGGGTATTCCTGCAGTAGAAAAATAAGGCATTCCTACGAGCAGATGGTCCGAATGACTATTCCTTTGTCAAATGTTTTATCTTGAGTTGTTAACGACCGTGAAATGGCTCGAAATTGCCGTACTTCCAGAAGGAAGCACGACTTATTCATTAATAGATAAATTCAGTCAACTCCTGAAATGTTTCCTTGACGTAAGCAGGCTTATATACTGTTGACTCAAGGGTCTAGCGATGACTTTAACAGACCTTCTTAAAGCTATTCAGGATTTAGTAGTATGTAAAATCGATTAGCCAATAGTCCAAAATGAAAGCGTCCTTAACAAGTCGCCAGCTCTTCGAGGCGTCAACTCGTCAAAATCCGAAGGAATTTAGTGTCGACGTCATTGCTCGCACGTATAAAGGGGTTCGATGCTTCCTTCCTCCTCCTTTCGGACCTTGCGTGCACTGCTAAGCGCAATTCATGCTTTGACGGCCGATTCTATTGGGACTAACGGAACATCGTTGCGAGTGGAAGTGCGTGGACAATTTAACGACGCAATAGATCGACACTGAATATTTCTCTGAAAATAATAGACTTATCGAGTCAAGAATCCCAAAGGAAGATCTGGAGATTGCTTGTTTCAGTTCGTTTAGTGCATTTGATCCTTTTACTCCTCAAACTCATCTCGAAAGGTACAATACTTTATATTGACTCAAGAATGCTGCCAGCAATAGTTTAAAATCACCCGATCTCCCTTACGAATTCGGGTTTACGGATTTATTGGTTGTATGAGTAGATAGAAAGACTGGCTTGAATAGTAAAACGGATAGTGATGAACTTTCAACAGTCGAGAAGCCACTTCATTTCTAATAACAGGATCAGACGTAATGAACACAGATTCAAGTGACGATGACGCACGTTGACAGGTCTAACTCAGAAATATCTGCTTCGAATGGCCTCCTTCCGATTTCCTGTTATACAAGATCGTAGATGTGTCGTGAAAGGTCATTAGTTTTATTCAGTGAACCAGGTTTGATATGCAGTCCACTTCTCTGCTTACGGAATCACTAATGTTACCGCCGATGCACGCCAATGGTGTAGCAATAATTGCGACTCATTCCCCAGTAGTACTGAAGAGATTCCAAATCCTGCATGTGAAAGTCCACGTCAAGAGAAGCAATAAATATTATCCGTCCCACTTGAGACATTCGGTGAGAACTTAGTTTTTAACTGTAGTCTTCTTTTATTCCATCGCCGTGCTTCCTCACTTATTATCGCACCCGAGCCGATCGGAGGCTCTTGAAACCATTCTAAATTATAATGGTCATGATAGGATTAGAAGGTCGACCGTTTAAAGCGATGATAATGAACAGATGAAGGTAAAGTACAAGTAACGTCCGCGCTCCAGAGAACTTATAGCGAAATGCTTAATAAATGCTCGAACTATTGCAGATAAATCGAAATAATTCATTATACTTCTAGGTTTAAGAAGAACGACAAACACAGTAGAAGGAGGCAGCCCGACATATTGCCTCTAACACATCGTAGCCACGTGTTGGTACGTAACAGTTAATTAGAAAAGCTTTGAATAATCTCGAGATAAAACAATTAGAACACACTATTACGAATGATGGTGTTTCATCAGGTAAAATGTCATTTTGGTAGTAAAGACAAGCTATAATCATTTCTTCTATTGCACATTATCCTGAATTTTGGTGATGCCTATTAATTTATCCCACTCGAGGGGAAGCCAATATGGAGAAAGTCAAGTTTTCCTCGCACTCCTGGCCTCCAAGCAATGGTTCGTATGACATCAACATTTTCGTAGCAATGGGTGCAAATTTCGTTTCTAGAACCCTGGTGCTCTATCAGTTTTATGTTGAATGCCCGGCGAACTGGAGCTAAGGCAGGAAGACAACACAGAGCTCTTCATCATTTCTTCGACTATTAAATATTGCTAACAGGTATCGTTTATAAGGAAGGACTGAGTGATCTACGGAATGAACTCTTTCGTAAAATTATAAGGAATAGGTCGACCGCATTTCCCCTCGCGTCAGAATTTATTGAAGCAAATCTGAACCTATTATAGATTTACAATGACTTCCCCAATTATTGGAAGAAAGAGTTATGTATCGTGGGACTCGAAGATTTTCAGGGATTAGAATATGATGAAGACAGAGAAAATTACGACGGCTTGGAAGGAACGAATTTTTATGGGGGCTGTTTTACAAATCCGGTGACTTGCTCAATTCCAAATCCCCTTCGCTTCCCATTCCACGGCAGAGAAGGACGTTTGACTTGTCCTATGGGCAAGCATTTAGGACAGTGGATCAGTCATAGATGGTCGTAGAGATACAAATTCTCATGCAAATATGTAAATCGGTGAGACTGAAATCATTCACTGAACAGCACTATCGAAGTTCACAGCCCGAAGCTGCAGAAGCTGGGCCCCATATCTCCTATGACCGGCTGTTAGCACTACAAGCCAACTCTAATTTTGATACATAATGAATGATAATAATATTAAAACTTCCTTGACTAATTTACTATTCTGATAAGAATCATTGCACGTAAATAAATGTATTACATTGACAGTTAAGCAGTTGATTTATCACCTCTAAATATATCAGCATCAGCATGCAACGTAGACTTAGAGAGTTTATGACTAACGGAAGAAGCAATGATTTATCTCGACGTGCTCAAATGCTGCATTGATACGACGTTGACCTGAATTATTTCGCTTGAATTTGAATGTTGACTTCTCGGAACCGCAGAACAGTAACATTTATTATTCAAAACAAACCAGTCGCGCTTCTCGTTGGTAACAATAATGTTATTGAAAATGGAAAATGATTGACCGTGACGCTTGGCTAAAATTCTTCTACAGAGGAAGCGATCTAGACGAGCAAAGGCTCTTATTTCATGTACATTGAAGAAAATGACATTAGTCGATTTATTACAAATGAATATGTTAACATTGGTAACAGTTAGTCAGACTTGCACAAAGAAATTACCTTCATATTTAACTGAATCATCTATTAAATCAGAAAGACATCGTATAGATACCTAAAGTACCCCGTATCCCTGCTCCTATAATCTATGGCAGAATGTATAACTGCTGACTCCGAACGGAAGGAATCAATGGGTGACGATGTGATTCGCCAACATCATTCGACTCTTTATTTGATGAAGCCAGGAGAATAACTTATTTAAATTAAAAGATTACTCCATAAGCACGTGTCATTTAGCACGTAATATGACAATAAATAATTCTGACATGAGACCAGCGTCTAAACTGTAGATACTAAAATACTTCGACAGAAGTCTGGAGGCATAGGAGATAGACTTTTACGGTTGCCTCCATTCAACATTAATTTGATAAATTCCATCCAATTGATTTAATCAATACAACAATTTGAAGATCAAGCAGATAAATATACTTTTGGAGGTTGCAGCTGACAGCCAAAATACAAATGCCTATGGCCTTCATTCGATCAGGCTGACGAGGCAAGCATCTACTCAATAAACCAATGATACATACAATGCCAATTAGATGAAGCCCAGAAGGAAGAATTGATTCAAATAATAATCAAATATTCCTCCGATAATTCGGAACGAAGAAAAACCGACTTTACGAATATCAACAGCAGACCCTGAACTGACGAAAACATATTTCATGCGTCCTGTTAGTCTAAAGCATTGGCTTATGTAACACTGAACAATCGATCATAGAACTTCTCATTATTCTCCTGAAGATAATAATCGCCAAATAAACCAATACTGAGCTTACAATATACTAACTAACGGAAAGGCTGCCGAGACGTTGCGGCCATAGAAATGATTACTCATAAGGAAGCACCGACGACCTAAGGTCCGATTCCTGTAACTGACCATTCAGCACCCGATATTCTTCTGCAGCTTCCAGCAACGAGGTTTCTTCCTTCTGTTGCAATTCCCAGATCTGCAGCATGATCCTGAAGCCTCAAATATGCTCACTGGCCTCTGCATCAGGCCTTACTCTCCGGCAGATCGAACAGTTTTTCTGCTTCTATCCTGCTTCACGAGCGATCCGTTCCACTTCTGGGTCTAACTCCCGGCTATAACCATAGAATTTTCTAGTAAAACGCGTCAGGACTTCTATCGCTACTTCCGATCGAAGCTTAAGACATGTCATAGACGCTTTTACCCGATGGTCTTCAACGGAGATCCTAAGATCCCTCATCACTGTTAGGAAACTTAAATCCAGTCGGAATAAGTCTCTTTTGAAGTCGGATGCAGGCAGAAGCCGCTAGTATGAGGCGAAACTATGCGTCACCTTCACAATAAATTCATTAGTTCATAGATCTACTTTATTTATATTGTTCACTCATTCTAATCCATTATGCAAGCCTCAATAGGTTAAATCGAATGTTTTACTTCCACCGTTGACGCGGCTTGCTCCTGCTGTGTCCTTTGAACCAATACTGAAGAAGGAATCGGAAGCCAAGGGTCAACCGTAGATGTGGGTGCCTAGATACGACTGTATGCCTGAAGTGTAAGGCAGCCACGCTGTACCGGACAATGGCTGACTGTGGCTGCCTGACTGTCCGTTTCGATAAAGCCAATACTGTGTGCTCCATTCCTTTAACTGTGATAACTTCTTAATGGTTGCTGTTCCATACTGACTCAGCCAGAACTGTTCATCCTGAATAGACGTCCTTGATCGAACGGCGCCCGGCCCTGTTGGAGATCCCTCCGCGTGTTATTCGTCGATTTGGTGCGTAATCGAAACTGCCTGTCGTTGCCGTAATCAAACGACGGCTTGGTTCTTTAATGCCCAAATCGATCCTAATGCGACGCGCGTGGTGTGCGACCTGTAATTCCATCCTGTTACAACCACATGAAATGGCTCAATTCCCTTAATTTAAGCCTCGCATATTAGAAGCACAGTAGGATACGCGACAGCAAGTTGGGCTCAACGTGTCC	*	tp:A:P	cm:i:180	s1:i:1139	s2:i:0	NM:i:2534	ms:i:1952	AS:i:1908	nn:i:0
+4	16	utg000001l	40457	60	4300S11M7D17M2D4M1I3M1D11M1D3M1I2M4D17M1I25M1D1M1D14M3D9M1I1M2D3M1D20M2D9M2I2M2I12M3I13M1D6M1D4M3I3M1D9M1I2M2D10M6I7M1D5M1D7M2D6M2I2M1D4M1D6M2I7M1I17M1I20M3I3M2I2M1I7M1D9M1D4M1D6M2D5M1I2M2D3M2I1M1I4M3I1M1I4M2I9M3D6M2D16M2D1M1I3M1D4M6I8M1D13M2I1M5I2M2I9M1D4M1D2M1I1M2I6M1D21M2D14M3D21M1D6M1I7M1I3M3I37M1I1M2D7M1D16M2I31M2I28M3D16M5I12M2D4M2D3M1I13M2D7M1D1M1D2M1D10M3I4M2D3M1D29M1I4M2D4M1D3M1D5M1I2M1I7M1I8M3D15M2D9M1I12M1D3M1I1M1I5M1I6M2D15M1D14M2D1M1D9M1D6M2I19M1D22M1D8M3D3M1I3M1I1M2I13M4D14M2D12M2I3M1D3M4D14M1D11M1I3M2I9M1D6M1D3M1D1M3I4M1I1M2D17M1I9M1D5M1I1M2I3M2I3M2I2M4I11M1I12M1I13M2I11M2D6M1I11M1D3M1D3M2D3M5D5M2I1M1D3M1I2M1D5M1I2M1I9M1D9M1I18M1I3M2D2M1D1M1D1M2D3M2I3M1I23M1I6M1D5M1D9M1I5M1I5M1I3M1I4M1I3M1D20M2D5M2I23M3I2M1I12M5I3M1I2M1D9M2I10M1I7M1I2M2I21M2I9M1D12M1D1M2I9M2D12M2D6M3I8M1D4M1I18M2D6M4I15M1D7M1I1M1I9M4I2M1I4M5I4M3D2M1I12M2I2M2I6M1I5M1I5M2D2M1I3M1I13M2I8M1I2M1I56M1I9M1I3M1I8M4I3M1I42M1D8M3D12M4D25M1I8M1D14M1D12M3D4M2D6M1D2M1D13M2I5M2D1M1I14M2I9M1D35M1I26M2I9M2I11M1I12M2D23M1I19M1D3M3I8M2I7M1I3M1D18M1I11M8I12M2I2M2I3M1I2M2D9M2D9M1D11M3I7M2D22M1I4M2D3M2I3M2I8M1I29M1D3M2D2M2D11M1I4M1D2M1D7M5I4M1D12M2D3M1I5M1D5M1D9M1I3M4I5M1I21M2I36M1I3M1D14M2I11M2I10M3D12M9D23M3D2M1D2M1I6M1D4M1D2M1D8M2D7M1D19M1D20M3D8M1D5M1I2M1D18M2D20M1I7M4I12M1D4M1D3M1D9M3I10M1I6M3I2M4I15M4D17M1D9M1I14M2D12M2D18M1D8M4D14M1D2M2I2M1I1M1I23M1D30M1I32M1D13M3I22M1I1M1I4M2I6M1D3M1I33M3D3M1D13M1I23M3D12M1I7M2I6M2D5M1I2M1I6M1I7M1D1M2D13M1D28M3D6M3D6M4I1M3I2M2I7M3D9M1D18M1I11M1I12M3I4M1D9M1D12M1D5M2I11M2I9M2D8M2I4M1D5M1D9M1I6M3D17M1D6M3D10M1D15M3I2M1I2M1D18M2I1M2I5M2I2M1D2M1I9M2I8M1I2M2I19M5D6M2D5M4I5M1I5M1I4M1D5M1I12M1I6M1I20M1I3M1D20M4D9M5I8M1I4M2D6M1D1M1D5M1D29M3D3M1D8M3D4M1I11M2I19M1I10M3I3M2I9M6D2M2I5M2I1M1D12M1I7M1D12M1D1M2D1M1D4M2I2M2I9M1D12M2D42M1I1M2D33M4D7M3I11M4D4M1D2M4I7M2D11M4I13M1I3M3I1M3I3M1D14M1D6M1I7M2D4M3D8M1I7M2I6M1D6M4I2M3I5M1I4M1I20M3D10M3I6M2I11M1I12M6I8M1D17M3D39M4I7M2I9M2I9M4I6M1I7M2I1M1I9M3I14M2D6M1I2M2D10M1D4M1D23M2I4M1I1M2I5M2D4M1I8M1I10M2D2M1I14M1I10M1I4M2D2M10D7M1I26M1I9M1I1M2I3M3I5M3I5M2I5M2I5M1I1M3I10M1D6M1I9M2D4M2I49M1I4M1I4M1I7M1I12M4I2M1I3M1I31M1I8M4D11M2I7M2D8M4I2M5I2M1I10M3D2M1I5M1D6M1I1M1I21M2D2M2D1M3D10M3D7M1I8M2I10M1D3M1D17M2D7M1I5M4I2M1I3M1D4M1D6M1D15M1D15M1D6M3D8M4I15M3I7M1D3M3D6M3I12M3D10M3D7M1I6M1D6M2D1M1D6M1I2M2D11M2D10M2D8M3D1M1I9M3D6M1D10M1D8M1I2M1I12M2I3M4D6M1D5M1D10M1I3M1D1M1D5M2D10M3D11M1I12M1D2M3I8M1I14M2D13M4D7M1D7M1D15M1I5M1D1M2D6M3D10M2I7M1D4M2I19M1D8M2I5M1D5M2D1M1I4M1D2M1D4M3D3M4D12M1I5M2I3M1I1M2D2M1I14M2I15M2D4M2D5M2D5M4D8M1D4M1I12M1D5M1D37M1D5M7I3M1D1M1D13M3D2M2D10M4D9M1D3M1D1M1D11M1I13M1D18M1I2M1I28M2I6M4D2M1D6M1D2M2D3M1I14M3I1M1I12M1D1M1D2M2D11M3D5M1I2M2D27M2D7M1D4M1D15M4D13M1D3M1D15M4D6M2D3M1D6M2I6M1I4M1D12M1D6M1D37M1D10M1D4M2D5M5I8M2I5M1D4M2I3M1D9M1D3M1D12M1D8M1I1M2D2M2D2M1D6M1I4M1I6M1D5M1I3M4I2M1D5M2I6M1I4M2D6M1D3M1D4M2D3M1I2M3I28M1I16M1I1M3D6M1D7M1I18M1I4M1I3M3D5M1D3M2I22M1D3M1D11M1D5M2D5M2D16M3I11M1D4M2D12M1D1M1D13M3I3M1I6M3D13M1I10M2D1M1D16M4I9M1I18M1D23M1I11M1I9M1D5M1I3M1I4M4I5M2I10M2I8M1I3M4D16M1D3M6D7M1D3M2I3M3I3M1D20M3D4M3D3M4D4M6D4M3D3M1D4M2I14M1D13M1D2M1I10M1I18M1D21M3I8M1I21M2I4M2I18M1D12M1I9M3D3M2D5M2I2M5I15M2D2M1I16M2D8M2I2M3D3M1I3M1D17M1I6M2D6M1D10M4D4M1I3M2D3M2D2M2I2M1I4M2D2M3D35M2I8M5I3M1D4M1I2M2I3M1I25M1I15M1I9M3I5M1D2M1D4M3D4M2D2M3I10M3D22M2D8M1I5M2D33M4I12M1D3M2D6M1I4M1D8M1D6M1I8M2I7M3D13M2D12M1D27M1I16M1I4M1I6M46S	*	0	0	TAAACGTATTCTGCTTCTTATACGAGACCTCTGCCTTAATCAGCATCTCCTGCGCGGTATCAGGACGGACCAATATCCAGCACCGCACCCCACATGGATTTGAATGCCCGTACCCTGTCTGCCCAGTAGCCCGTCCTAGTTTTCTTATTCACGGCGGCGGAGGTCTTATCATCAAATGCTTCGCGTTGCGGCCGCCGCCTGCAATGCCCCGGCTTCATCGCCGGAACGGACTCAGACATACGGATCTGCTGGCTAAATTATGGAAACTGCGGCTAGTACTGCCCGTCGACGTCGGGTCTGTCAGCTTCCCGAAGGAGTACGTAAGGCTACTGCTTGTCCTACGCCGGATGCAGGAGAGAAGGACGCGCCACTCGGCTGATGGACGCAATCATGAGCCTCAATGCTAGCTCGCTCCGTCCCCGACCAGGTGCGGCGCTATCACTGGCTTGGTTAAACTACTGCCTTGCTGCCTGCCCGGCTCTGGACAGGACCAGCATACGGATCTTGCCGTCCGTCAGTCGCTGATTGCCAGAAAGGACAGCGTTTGTTGAAATCTAGCACGAATTGATGAGTTGCCCTGATACCAGCGGATGCCAGCGCAACGGTCCCCACCGCCATGAGGCGCCAGGATACATGGCAGGGTGATTCACGCAATGGCACCGCGGAAATAATGGGATTCATCGAAGGGAGTCCTTAGCGTACCTGTGCCCCTGTTGCAGCAGGATTACGACGGACTTTGCCCGCCTTGCAAGCTTGCGGTCAAGTTCAGTAACTTACGGATACGCACTGGCGGTATTTATACTGTACCGACGGAAATCGCCCCGTTTCTGTGCAGCAGCCGGCCTGTTACTCGGGCTAATTCATCAAACGACTGTAGCGGCTTTTTCGATCATTTCTTACAGAAAATGACGCCTGACTCTCTACATCTTAGTCGTCAACCTGAGCAGTAGAGACTCAAATACGACGAAGATCGGCCCAAGGTTCATTAGATACCGACTCCTCGGCGATCCCGGTACCCATGATATTTAAGCATTAGTCATATCGTGATGTTCACAAGTGCGGAAGCGGATATTCATTCCGTGAGGGCACGGCACTAGCCGGCAAGCCGGGCCGCCGCTTTCTGCATCAGCACATCATTCAGGCTCTTCGTCACTCCGCGCTTCATGCTAAGACTGAATCCATGATCGGGATCATGTAATCGCTGAAAATAAGGCTGAGGGGACGGTGTACGTCAGCCGGAAAATTGTAAGTCCAGCAGAACATCAGCATGAAATAATGGGTACTGTAAAGCCTGCCAGTAGGCGCATACTCGTGGATGACATGACCCTGAAGGCAGGCACGCCAGTTGGGTCGCCCCATCTCACGCGTTTCAGGGCAAACCCCAGCTGACGTCGAACATTCGCCCCGCAAGAACAGGCTCTGCGGGCCCGGGGCGTCGGACTGTCTGTCCGAGGGATTATTCACCAAACTCATACATACCAGACAGCCGCTCCACGTTTTCATCATGAGAAAATTGCCTCTGTAGGCCGTACAATAACTAATTTCCTGCTCAATCTCTGTTTAACGGCTTCATTCATGGACGGCATCGGTGCGTCTTCTTGCGATGGTTATGCCACGAGGGAATAAGGTCGCCAGAACGCGCCGGTCTGATGGCGTCCTCCACAGTAAACTTCCGGTTGCTGTTTGACTCCGCCTGTTCTGCCTGCCGTTTCATCAGCGATGCTCAATGCACCGTCAGGACAGTCGACCGTGACGGTACCGTTATGTTCAAATGATTCGGTTTTGGAGGAACATCGTGACTCCCGGATTAACTCGTGGTGACGGCGTAATTTCTGCGGACCGCAGCAAACTCACCATTACCGTAAGATACAAACCGGAATTGACCTGCCTGCAGCAACGCCGTTCACGGTGATGGTGAGTATACTGACGACAGCGGTGGCTTTTGTTCACAGACAGCGCACGAAAGCTCTGTCCTGGTTTACGCCTCCGGCTGGAAGCGACCTACATTTAGTGGTGCTCTGCCTTTCACCGCTGCAGGCGTCACGGTCATCCTGTTGCCGGCTTTACCGTGCTGCGATCTTGCCATCGACGGACGTCCACAGTTTTGTCAATCGTTCACCGTGCGGGCATCATCTCCTTGGTCGCCGTCAACGGCTTACGATACTGCTGACCCAGCCACGGAACACAATACGGACCGTGCGATGCGTCGAAGCGGATTTATCTAACGACGCGCCATATCGCCTTCCATTAAACCGCCAGCATGCCTGCTTCCGCTGCTGGCGGGGCATCGACGAGCGTGGCGACTCTTATCTCGGCAGATTTCTTGCCCTGCCCCAGTTACCGTCCAGTCTGCACTTTTCATCATCGGCGATAGCTGTCATAGGACCGGCTGTCAGGTTCGCCGGGCGTCAGGTCTTTAACTTTCAGACCGACCAGTCAACGTCTGAAAGCGACTCGCGTGACGGTACGCTCCCCTTATAAACCCACGCTGGTCCCGGCACCTTCCTCACGGCATTGGGGGATTTGGTACAGGCAGCTAGCGCGTACGCCGCTTCATAGGTCACCCAAGGTTACGATCGGCTGAAACTCAAGCCCGATCATCGTCGCGCCGGGTACGCCTCTAGATACTGATCAGAGTAAATCTGACAGTGCCGGATATCGCTGATAAGGGATAAATCCGGGACTCCATCCAAAGAATGGCAGCTCTGAATCCGGCGCATATGAGCAGGCAGGAAATGCGATATGCAGCTCCGCCTCATGACCCTGTCCAGCTCTTCACCCTTTAAGTGCCGCCGGTGAGATAACGGGGACTGCTGCCGGAAATCCGCTGTATGCCAAACCTCCGCGGTAATATTCAACGTGCCGCGTCGGTGTCGTATCCTTCTTCGAGTGCAGGTACGGCTGCACGGAGTTCAGAGGTTTCATCGCTTCCTTACCGGAGCGTTGATGATGCTGCAGCATAGGGAGCTCGTGGAAGACGTTCATACGCCGTATTACCCTGATGATCTTTTGTTTAAACGCCGTCGTGATGCCAAGCGATCGGATTTCACCACAGGACTTCGGTGACTCGATAGCTTTCCCAGCCACGCTGCATGACATGCCACCCATCATTTTTCAGTTGCTGAATACGACCAAACGGGAATAAGGGTTATACCACAAGCACGGTGCCGCCACCTTCAGGATGAACGCTGCGCAGGTTTACTAACTCTTCGGCGCGAAAGGACAACCCGCATCTCAGCTTTACTACGGGCAAATCCCCCGGTTAACTTTGATTCTGGCCTGCGCGGATTTGACGTGGCCCTTTGAGCCTCTTCCTTTACCAGTTCCGTCCTGTCTCACGGGCAACCTGTGACGCCGACTTCGTCATCTCCGGATGAAGCAACGCGGTTAATGGCCAGTTACTGCGGACTGCAGAGCGACGCCGTCGGGCATCGGCTGAGGAGTTCAACGGCCTGCGTAAGACTTTATGGTCACACTCCCCCTTCAGGCGACGGTTAACGGGCAGGGCAATCGTCCAAGCGAATATACGACAACTTCCGCCATCATCCGGCCAACCCGATAATTACCCAGAGAAATTTTCCCACCGATGGTCATGTCGGGTTCACGCCCGATAAGCTGCCGCACCTCATCAGTCCGGACAACAACAGGAAATGCGATGGAGCCTTCAACGCGCACGCCTTATGTCCGGCATAGCTGATATTTCAGTTAGGTCAACGACCGTATCACCTAAGCTGACTGCTGCGACCGGATGTAATGGCTGACGTTCCCAGTACCCGCGCCATCGTTTCATCGGCGGGCAATGGCAGCATTACGAACAGGCTATCGAAATCAGCCACAGGCCTCCCCGTATTCTTGCATTCTGGCCAGGCCGCGCTCTGTCAGTCTGTTCGGTCACACCGGCAGAGACACGAAACCGTCCCGGCAGCACAAATGCCACCATTCATCCGTGAATGTAAGAGCTTATGCAGCTTCACCAGTGCCACGACCGTGACCAGTCGACGTATCCAGAATCACGCTCAGCGGCTCCTCTGATCCCACCTCATTTGTTTACTGTCCATTCAGCACATTTCCCCTTGAGGGTATTTATGACCGGCAGTTTCATCCGTGTCATCACACTCTGGTTCTTACTCACACGGAGCGGTTCTTCTCCTTTCGTCCCGTCAGGCTGACATCACGGTTCAGTCCCAGGCTCGGAGACGGGCAATCAGTTCATTCGTGATGATCGCTGGCCACAGAGAAACACTCTAGCAAAGGATGATTACGAGTTGTAAGGACCAACAGCGATCATAGAGCATGATGTCAGCAGCATCATGACTGAATCATGGTGAACTCAACGGCCGGATCGCCGTGAGTAGATTTTCGAGTAACGGTGCAGAGGCGTTAATGCCTTCGCGCTTAGTCCGCATCCTGAATGCAGCCATGTAGGGACCGCGTGCCTGAGTGATCAGTTCCATTCCGGAGCAGATGCGTGTTGCCGGCAGGAAGTTCTTTGACTCGTCAGTTTCACGTACTGTTCGAATACACGACGAGATACGATCGCGATAAGCCATCCCCTTAGCTAAAGACGCTTTGGGACGAGTGATCTTCTACGCTGTCTCTGAGCTCGGAATTAGAGCCACGAAGACGGGTAATCCAGCTTCTCCTTGTGACTTGAAGGAACGAGACTCCAACGCGCCCATGTCCGCAATCGAACACGATATTACGCCACGGCTGGCGTAGGCGGGGCCTACCATGCGATATGTCCATCGTCGGTCAGTCACTAATCCTTGTCACGGTGCTCGACCCCGTGCCGCCGGACTGCGTGATGTTATTCCTCACTGCGGCCATGGACCTGGACCGGATCGAAGGCTTCAAGGGTTCTATGTATTTGGCCTTGCCTAAGCACGACGGCAGAAACTGCCTGCGATCTTCGACTGAGCAATGGCTAGCCTTCTTCGTCACGCATGTTCTGCATCATGATGCTAGAACCGGCGGTAAGCCGGGTCCGCCAGATTCTGCGGATCCTCATGTAAGCGACGGAAGGCGTCATCTTGGGGGATTCATTCATGCTTCGGGCTGACATATCCCGGGGCGTAAATTCAGGAGGTGGAGCCGCCACGGGAACGCCACACTCACGGAACAATTCATGCGAAACCGTACAGCGCCATTTACCAGTCCCAGTTGAGACGCGATAGACTTTCGTCGCGTGAAGGGATAGCTCACGGAAAAGAACCGGAAACAGCACCGTAAACTTAAATTCTGCGGCCATTTGCCGCCAGCAGTTAGCGGCTTTAGTACATCGACATAAAATGCTAGGACCGTCTAACAGGCGGCCTTCCTGATGAAGGGTAAACTAAACGATGCCGTCATGCCCGGCAAACGCGGTCGTTTTTCTGTGCTCGTGTCCCTGGCGCCTCGGCCGCCTAGCATCCCTAATATAAGACCGGGTCAAGACTTAAACGTGCTAAGCAAGTGACGTCGAGGCGCGTCTGGTCAGCAGCAACCGCAAGAATGCCAACGGAAGGGGCACCGTCTGCTGCTAAGCCACGCAAGAGGCAGCTTAGAGCTGATTCAGCAGGTCGTATTGCAGGCGGTCGCACTCAAATCCGCCGGGGTGCGGTCTGCTCTACGGTTATCTACTGTTGCCCTGCGGCTGGTACTCGGTAAAGCTTCTTGCTCGTTCCAACACTCGGTAAACAACTGTGTGGTTCAGCAAATCGTTAACGGCAGGTTAAGATGCCGGGTTACCTGCAGCCAGCGTGCCGGCCCCTGCATGACGACAGTACACTCCACGCATAGTACTGCGCTGCCTGTGCCACTCTGTGGTGCTGCGGCGAGAATGCGCGGCGGCTATTTCACGGTCAAGCCCGGGGGTTTGCCCAGCACGCGCCTGTTCACTTCGCGTCGTGAAGCCTCCCTACAGTTGAGGATCCCCATAATAATGCGCTGTTTCTGCCGCAGACCCGCTGCGGTACTTGTCTCTTAGCAGCGTCGTTCCGGCTGCGCCCAGCGGTGCGGCGTTCTCGCCTCCCGCCTGAGCACCACGTCATTCAGGACGTCATGCTCGGTGAAGCAGTGGCTGAAACAGTCGGTGATTGAGTCTCTTTGGGTATTCGCCTCCTGTGGGAGACGGGATTTACGTGCGGTAAGCTCAGTGCATCACGCATGACGGTGATCGCATCGGTGCTGTTAACAGTTCATCAGCCAGTCCGGCATCAATGGCCTCCTGACCGCTGTACATGCAGCCTGCTATCGAGCACAAGCCTGCACGGACCCGGTATGCCACCCTTCTGCTCCAAACCATCTCTTAGTTGCGTCCATCCGGGACTGCAGTGTCTCCCCGACGTCATCCGGAAGATGGCTGTAGGCGATGCCGTCCACCTTATGGCGGCCGCCGCTGTAAATCAGCGTGATTTCCACCCTGTTTCTCCAGCAGCACCGTAATTACTGTGAGCTCATCATGACGCCGATGGAGGTGGGAGCCGGGCGCTGTCTGCGTGACCAGACGCCGGGAGGCGGCAACGGGCAAGCAGGAGCAGGACTGACCTGCACTATGCACAGTTCATGTCGTTGAGGGGCACAGCCGGGTTTTATCTGTCTACGCACTGGCGATGATGTCAGCGCAGTTCAAATCCGCCGAGCGCGGTCAGCGCCGGCGTGTCCATATCGAGCAGAATGCGTCAGATCGGATCCGACTCGAGCTGTTGCGATCAAGACGGCGATAATGCCGTTGTAACCGTCATCTCGAGTACGGCTGCGGCAGCGCCGCCCGCGTCCGGCTGACCAGGTCGTGCCGGACACCGGCACCGACGGCGATGCCGTTCAGTGACTGATAACTGCGGCTACTGTCCTTGGTAGCGTCATCATACCGGATAATGCCCGTCGCGAGTGCCTCCTAACCAGGCGTCGTCGCCGACACGATCGTCAGTGCTGATCCCAAGCTGGCCTGCAAGCAAGAAATAAACCTAGGAATAGGGTTCAACATCACTAGGCTCATCGACGGTCATGGTGGCAATATGCGGAGATTATTACAGCTGGTAGTTCTGGTTCTCTCCTCTGTGCTTGTCTACGGCGCAGCCCGCAACTCACGGAATTCTTCCTGCAGCCGCCCAGGCGGTTTAAGACCGGCTGCACGGCGCCTCCATCGTTTCACGACCTGCTGGGCAAATTTCCTGATAGTGGTACCGGGGTCCTAGACTTCTCGTGTCCATACTCAGTTCAGCTTCTATCAGCCGGACGCTTCCTGAACTTCTTTCAGACCATCGATGGCCATACGACCGGAGCCTAATCAGTCGCAGTTCCCCAGGCAATGCACGGGCTTCCTGAAAACTGAAGCGCTGAATTTACAAAGTAGTCTACACAGCGAACGATGGCCTCTTCCAGCAAGAACATCTGGCTCGCCTGACTGGATGCGACGAATTTTGGCCGCCTAGATAAATCACGGACTCGTCATCCCACGACTGATGTCCGTGGTAGGTGGTATGGGCGTAATTCCGGAAAGCTCGTCATACGAGACACCCAGCAGCATGTATACCCCCGGACTCAAGGCAGTGACTCAAACACGAGTAGCCGTTATCCGTATTCCTGAGCCGTATTGCAGGTTGAGTGAGTTACCGGCATCAGTGCGGTACTTTTGCCTCCCCAGCCGGACCCGGGCCCTGCGGCGTAATACGCGGCACTTCCTCAATCCAGGCCCGTCCTTCCCGGGCGGCTCCGACTGTCCCCCAGAATAAATCCATCGCTGACGGGTGACGATCCAGCTCACTCTCATGATGAATGGCGTATCTAGCATCGCCTTCACAATGGCGCCTAGGTGCAGCTGCGTGTTTCTGGAATGCAGCGTGCGGCTTTATTCATCTTACTCATCACCGCTGTAAAACATTTTGCACCCGCGAGTCTGCCCGTCCTCGCACGGGTTCAAACGTGAATGAACGAGGCGCGCGCCCGCCGGGACTCAACTCGGGGTTCATGTCATTTCTGCGGATCCAGCCAGGATACCCGTCGTGACGTAACCCCTACCGCCCGACCTAGATGTCATTAATCTGCACACCGGCACGGCACTTGTCCGCCGGCTGTCATTCTGTTCTGCGATGCTGATGCGCTTCGGGCTGACCATCCGACGCGTCTTACCATAGAAAAGCCGCGACGAACTGGTCCCAGGCCTGAACGAACAGTTCACCGTTAAAGCGGTGCATGAGACATTCCCCGAATCATCATGGTAAACGTGCGGTCGCTCAACGTCGTCAATGCAGGCAGCATATTTCATGGGGACTCTTTCCATGCTTGCCGCTTCAACCTCGGCGAACGGAAGACGGGCTTCTTCCTCCAATGCCCAGATAGCCAGCTTGGGCGATGACTGATAGATGGAAAGACAAGGCCATAGAATATTAATGCCTGATGCAGCTGGATGGCGTTGGCGGCATAGCCGTTATTATGCGGTAGATCGGTCTGCGCGGGCATGTCAATTGCCACGGTAAAGTTGGCGGACAGGCTGCAGCATCCTTCACCCCTTACGATTCACGACCGCAAACCACTCCCCCGCCCAAATCCTAGCTGCCACCGCCGCCGTGTATAACCGGCTGCATATTCTACGGGGCCGTCATGCCGTCGATCCAGAATGGGAATGGTGGCGTTTCACATAAAAATCCTGCAGGTTGCTCCTCGGTGCGTCTGTATTCATGCCGCCGGTCTGCATCGCTGCCTTGCAATATATTTTGCGGTAGATACAAACTAGACGGTTAGTCATTCAACTGTACCTTTGCCTATAGCGTTTGATTCATATATTCATTAGTAGGTTAGATGCAGAGTGCTCAAAGCGCATGAAGGGCAAGTTCTTCCTGTCGTCAGATTCATCCTGGCTGGATAAGGCACGGCGTAATCTGCCCACTATTTCTTGTTACTATTGTATGCACCATCCTCTTCCTGCAGAGCGGCCTCGGAGAGCAGGACACTGAGATCCAGCTGCCAGCGGGAAATACTGATGCGCACCTAGGCGCCAGCATAAACATGAGACCGTCAGTTAGTCGGGTGCAGTTGCGGGCTTTAGTCTAGCACACGGTCTTTCCTTGATAGTTTTTCGACCTCTGCATGAGCAGTCATAGCTGCTGCGTGCCGTCAGATCAAAATATCGGTTATTCCGGAACCATATAGAAGGCAGGGGAACGGTTTAAGCCCTTCGGCGTCAGTGTGAAGCGGTTAAAATCTGCTCTGTCCTTCGCGGTATCCGTAGTACCGATTCAAGGTAAATAACCCCGTTTTGTTCGCTTAATGGATGCTGGACGCAGGGCTTCGTAAACTACGCTGCCCTTTAATGGGGATCACGGACCAGATGTTTTTCCGGAGGTCCACACAATAGCTTGGTCACGTACAATCCCGCCAGGTTGTAGAGCAGATACGGATATCGACACTTTCTTAAGTTCCGGCGGTCGGTTTATTAGTTGATGGCCCCACCTGTACGCAGCACCCGTCTGTTCATCGTGGTGGCGGCCCATAATAATGGTCGATAACCACCCAGGCTTTCTCCTCAGGCCCCATCGCCATACAGGGATTTCGTCTCAGTCCAGCTGGGAGTCGATACAGCGGTCATAGATAAGCCACGGTCAGGAACGGCTATGAATAATGCTGTCCTCTGCTTAGATACCTGTCAGCATCCGATAACGTTCGCTAATTTTCCTCACGTCTCACAGCGTACTTTTATAGAAGGTTTTACGTTTTCCCGTATCCCCTTCGTTTCATCCAGTCTTTGACAATCTAAGAGCCCTATGGTAGAACGGGCTGTACGTAGATGTGAAAATAATGTCAGGCTCAATCTCTTCAGCGGATGACGAAAACAGAGAATGCCATCACGGAGTACGCGTGCCAGTCTTTCTAAGATATAACGGCGGCAACCATAAAGTCAGCTCCCTGCTGAAGGGTGGGCAGAGAAGGCATTATCCGGAGATAAACACGGCGGTCGTGATCCGTCATTTGAGCCAAAACGGCGTCTTTGTCGCCAAATTTAAGATACTGCCCCAGCAATGCGGCAGGCAACATGAAATGGACCTGCGGATTCACTGAGGGTCCAACACGTATGACACCTGCTCTCATTATGCGTGGAGCCACGGATGGACTTTACAGACCGAGCTTCAATACGGTGTCCCAGAGGAAGAACGTCGTCCAGAGCTTCGGCTGTCAAGAGTAGATAAAAGCAGCAAGTCATCATATAAGATCACCTCACACTGATTCACCTTGGATTTAGAGTGCGGTTGCTACGGCGCCAGAGATCAAAGGACGCATGTACTTATGAACGCTTCATGGTGAGTGTTATCCCGGTGCTTTTGCCAGACCTAGGCCAGGCCAGCAGGCGACGGAATATCACGAACCAGTGGTAAAAGTCGTCATTTCATAAAGATTGGGGCATCACATCGTCGGCAAGCGATACATGTTGCTGCGTAGGCTCTATAACAAAGTAGGGATAACAGAGCAGCACTTTTGAATAACCGACGCATGGGCAATAATTCACATTCACCTGACCGGATGTAGTCGCTGCGATCCCATTCAACTCTGATGGCCCATCTTGAAAGGCAGTGTTTCCCGGAGCCCTTCCTGGTATGCGTGATTCTTTCGGAGATAGATAGGATTAGGCATTCTGTATACGGATCAACAAAAGGCGTAGATCTGCGAGCTTCAGAACCTATTAGAACCCTTTAAATCTGTTCAGCGACCTTTAACGGGGCTCTACCATTATCAGGTTAACCTTAGATGAGCGGCCGGCTGCTTTATGTTCATGGCTTTGATATGATATCCCGTTCTCAGGAAATCAACATGTCGTTTTCCAGTTCGAAAACGCCGGTGCATAGACAGGCCAGGAGTCGAGAATACTGGCAATTTGGGCTTGCGATCCGCGACAGCACGAAAGTACAGAATGCGGTCACCTTCAATGCATATAGGGGTCTGGCATTCTAGAGTTCCTGTGCGTAGTCGGCACGCGTAAGGGTCGGCTTCGTACTCAATAGTTCTCTTGGCTGGAGATCTGCCTCGCCCTGTATTCGCTTCACTCTCAATCGCCCTACCTTTCGTTCTAATTTCAGCATCCCTTCGGCATACCATTTGTGCTTATGACGGCGGGGCAAGAGTCATAACACCCCTCATTACCCTTGCCACCGCCACTCACAGAACGGCATTCTCCCTTTCTGCGTTCAACCGTGACTGTACCATACTCGCACCGAAAATGTTCACTCAGCTGCCTTTGTTGACTTCCATTGTTCATTCCACGGACAAACAGAGAAGAAAGGAACGACGAGCTCAAAGCTCGTTTCAGCTCACTGTCCTTTTCCTGGTCATTCAGGGTATTTGGCAAATAAACATTAAGTCTGACGAAGAAGAACGGAAACGCCTTAAACCGGAAAATTTTCATAACAGGCGAAACACGAGTGCCTCAAAGCAGGATTAGACGCCGCACTACGAAGTAAGC	*	tp:A:P	cm:i:67	s1:i:660	s2:i:0	zd:i:2	NM:i:2041	ms:i:3030	AS:i:3030	nn:i:0	SA:Z:utg000001l,36050,-,27S2397M35D9007S,60,650;
+4	2064	utg000001l	36050	60	27H6M1I28M4I7M1I39M3D12M1D6M1D15M1I4M1I7M2I28M1I2M5D5M1D16M2D15M2D1M2D6M2D15M2I11M1I3M1I9M1I1M1I1M1I4M6D13M3D8M1D8M4I5M1I5M2I5M3D3M2D16M1I4M2I10M1D17M1I14M3I8M1I9M1I5M2D6M1D6M5D12M1D7M3I14M1I7M1D2M1I8M1I4M1I11M1I4M1D8M1D26M2I4M2I1M1I10M1I11M1I4M2D5M2D10M1D5M1D5M1D9M2I2M1I4M1D4M1D7M3I10M3D8M2I12M5D14M4I1M1D5M1I21M1D4M1I3M1I10M2D7M1I3M3D7M1I5M1D4M1D3M1D2M4D7M1I2M3D4M4I20M2I5M1D11M1D4M2I5M4I2M1I4M1D1M3D7M1I7M3I7M3D9M1D3M1D4M1D29M2I1M1D5M2D6M1I2M3D2M1I3M3D1M1D8M2D5M1I13M1D22M1D10M2I3M3I6M1D1M2D2M3D7M1D2M1D3M1D2M1D8M2D5M2I3M1D11M2D6M1D10M2D1M2D3M1D2M1D2M2I28M1D6M2D4M1I11M1D5M4D2M1D6M3D4M1I2M2I6M1D6M1I1M2I1M1I4M1D5M3D12M1I8M2I24M2D1M1D19M3I25M1D10M2I19M2I11M1D28M2D26M1D9M1D2M2I6M1I11M2I15M1I12M1I4M2D9M2D25M3D20M1I13M1I4M2D10M4I11M2I32M2I9M1I17M1I1M1I5M4I7M1D10M1D12M2D61M2D12M1I4M1D3M3D5M1D2M1D2M2D49M1D5M1I21M2I10M1I1M2D1M2D24M3I5M1I8M2D5M2D6M3D28M1I2M1D6M1D3M3I10M1D4M3D21M1I4M2I2M1I10M4D11M3I4M1I23M5D3M1D2M1D15M1D5M1D7M1D1M1D12M1D1M1D2M1D1M2D1M1D16M2D5M2I7M2I6M1I14M1I5M2I1M2I6M5I4M1I26M1I2M1I1M1I14M1I6M1I7M3I3M1D5M3I9M1I7M1D1M1D8M1D11M1I5M2I13M2D9M1I3M1D6M1D11M1I7M1I22M1I11M1I12M5D3M1I14M2D6M1I20M9007H	*	0	0	CCTCTGCCTTAATCAGCATCTCCTGCGCGGTATCAGGACGGACCAATATCCAGCACCGCACCCCACATGGATTTGAATGCCCGTACCCTGTCTGCCCAGTAGCCCGTCCTAGTTTTCTTATTCACGGCGGCGGAGGTCTTATCATCAAATGCTTCGCGTTGCGGCCGCCGCCTGCAATGCCCCGGCTTCATCGCCGGAACGGACTCAGACATACGGATCTGCTGGCTAAATTATGGAAACTGCGGCTAGTACTGCCCGTCGACGTCGGGTCTGTCAGCTTCCCGAAGGAGTACGTAAGGCTACTGCTTGTCCTACGCCGGATGCAGGAGAGAAGGACGCGCCACTCGGCTGATGGACGCAATCATGAGCCTCAATGCTAGCTCGCTCCGTCCCCGACCAGGTGCGGCGCTATCACTGGCTTGGTTAAACTACTGCCTTGCTGCCTGCCCGGCTCTGGACAGGACCAGCATACGGATCTTGCCGTCCGTCAGTCGCTGATTGCCAGAAAGGACAGCGTTTGTTGAAATCTAGCACGAATTGATGAGTTGCCCTGATACCAGCGGATGCCAGCGCAACGGTCCCCACCGCCATGAGGCGCCAGGATACATGGCAGGGTGATTCACGCAATGGCACCGCGGAAATAATGGGATTCATCGAAGGGAGTCCTTAGCGTACCTGTGCCCCTGTTGCAGCAGGATTACGACGGACTTTGCCCGCCTTGCAAGCTTGCGGTCAAGTTCAGTAACTTACGGATACGCACTGGCGGTATTTATACTGTACCGACGGAAATCGCCCCGTTTCTGTGCAGCAGCCGGCCTGTTACTCGGGCTAATTCATCAAACGACTGTAGCGGCTTTTTCGATCATTTCTTACAGAAAATGACGCCTGACTCTCTACATCTTAGTCGTCAACCTGAGCAGTAGAGACTCAAATACGACGAAGATCGGCCCAAGGTTCATTAGATACCGACTCCTCGGCGATCCCGGTACCCATGATATTTAAGCATTAGTCATATCGTGATGTTCACAAGTGCGGAAGCGGATATTCATTCCGTGAGGGCACGGCACTAGCCGGCAAGCCGGGCCGCCGCTTTCTGCATCAGCACATCATTCAGGCTCTTCGTCACTCCGCGCTTCATGCTAAGACTGAATCCATGATCGGGATCATGTAATCGCTGAAAATAAGGCTGAGGGGACGGTGTACGTCAGCCGGAAAATTGTAAGTCCAGCAGAACATCAGCATGAAATAATGGGTACTGTAAAGCCTGCCAGTAGGCGCATACTCGTGGATGACATGACCCTGAAGGCAGGCACGCCAGTTGGGTCGCCCCATCTCACGCGTTTCAGGGCAAACCCCAGCTGACGTCGAACATTCGCCCCGCAAGAACAGGCTCTGCGGGCCCGGGGCGTCGGACTGTCTGTCCGAGGGATTATTCACCAAACTCATACATACCAGACAGCCGCTCCACGTTTTCATCATGAGAAAATTGCCTCTGTAGGCCGTACAATAACTAATTTCCTGCTCAATCTCTGTTTAACGGCTTCATTCATGGACGGCATCGGTGCGTCTTCTTGCGATGGTTATGCCACGAGGGAATAAGGTCGCCAGAACGCGCCGGTCTGATGGCGTCCTCCACAGTAAACTTCCGGTTGCTGTTTGACTCCGCCTGTTCTGCCTGCCGTTTCATCAGCGATGCTCAATGCACCGTCAGGACAGTCGACCGTGACGGTACCGTTATGTTCAAATGATTCGGTTTTGGAGGAACATCGTGACTCCCGGATTAACTCGTGGTGACGGCGTAATTTCTGCGGACCGCAGCAAACTCACCATTACCGTAAGATACAAACCGGAATTGACCTGCCTGCAGCAACGCCGTTCACGGTGATGGTGAGTATACTGACGACAGCGGTGGCTTTTGTTCACAGACAGCGCACGAAAGCTCTGTCCTGGTTTACGCCTCCGGCTGGAAGCGACCTACATTTAGTGGTGCTCTGCCTTTCACCGCTGCAGGCGTCACGGTCATCCTGTTGCCGGCTTTACCGTGCTGCGATCTTGCCATCGACGGACGTCCACAGTTTTGTCAATCGTTCACCGTGCGGGCATCATCTCCTTGGTCGCCGTCAACGGCTTACGATACTGCTGACCCAGCCACGGAACACAATACGGACCGTGCGATGCGTCGAAGCGGATTTATCTAACGACGCGCCATATCGCCTTCCATTAAACCGCCAGCATGCCTGCTTCCGCTGCTGGCGGGGCATCGACGAGCGTGGCGACTCTTATCTCGGCAGATTTCTTGCCCTGCCCCAGTTACCGTCCAGTCTGCACTTTTCATCATCGGCGATAGCTGTCATAGGACCGGCTGTCAGGTTCGCCGGGCGTCAGGTCTTTAACTTT	*	tp:A:P	cm:i:23	s1:i:227	s2:i:0	zd:i:1	NM:i:650	ms:i:1208	AS:i:1208	nn:i:0	SA:Z:utg000001l,40457,-,4300S7085M17D46S,60,2041;
+5	0	utg000001l	1	60	62S9M6D20M1D11M1I20M2D13M1I29M1I1M1I9M2D7M1D4M2I13M2D4M3I25M3D7M2D1M2D4M1I32M1I10M1I19M3I2M1D5M2D4M1I6M1I27M2I1M1I4M4D8M1I4M1I48M2I7M1D14M1I15M1D5M1D2M2D2M3D15M1D5M2I12M2I10M3I9M3D5M1D18M1I24M3D10M1D22M1I2M1D21M1I5M1D10M1I10M1D6M1I37M1D16M2I5M1I11M2I5M3I4M1D1M1D30M1D3M1I3M2D17M1I7M1D14M3D35M1I8M1D2M3D2M3D30M1I3M1D45M1I22M5I6M1I6M1I7M1I30M2I11M1D6M4I5M2D3M2D6M1D10M4I1M2I10M1D12M2I3M1I6M4I12M2D7M1D5M1I14M1I6M1I8M1I10M1I4M1D6M2D8M8I7M1I3M2D1M1D6M1I4M6D2M2I7M4D2M3I9M1I20M1I3M1D32M1D18M1I11M1I5M3I3M1D20M1I36M2I21M1D10M3I23M2I17M2D11M2D9M1I2M4D4M5I5M1D9M1D5M1I12M2D5M1I6M1D2M2D9M2D11M1D11M1I5M2I1M1I1M1I2M1I17M4I13M3I2M1D5M1D1M2I6M3D19M2I30M4I27M1I11M2D31M2I4M3D2M1I5M3I10M3I35M5I5M2D3M5I28M4D15M1D17M3D41M1D17M1I1M2I6M1D7M1D9M1I5M1I12M2I22M1I12M3I1M2D3M3D3M1D1M1D2M2I5M1I5M1D5M1D14M2I1M1D3M1I10M2I7M1I10M1D37M1D17M1D22M3I12M4D3M1D8M2I1M1D2M1I2M2D9M1D2M2I9M2I9M2I1M1D2M2D8M2D11M1I7M1I11M6D16M4D4M1I18M5D5M1I11M1D9M1D10M1D5M2D4M3I1M1D4M3D3M1D11M1I10M1I14M1D19M1I2M4I13M3D24M1I26M1I7M1I7M1I10M1I5M1I13M3I15M1I12M1I3M1I15M1D7M1D19M4I17M1D23M1I3M3D7M1D18M1I5M1I5M2D8M1D15M2I4M1D18M1I19M1I13M1D28M5D7M1D4M1I5M4I3M7I12M5D2M1D5M2D2M1I30M3I2M2I4M1D32M1I6M1D6M1D27M5D2M1D7M1I17M1D4M1D14M1D21M7I3M4I7M1D10M1D22M1I13M2D10M4D13M5D42M1D1M2I7M2I12M1I3M4I18M6D10M2I5M1I8M2I10M1D6M1D17M1I23M1I15M1I2M1I9M3D2M1I12M5I5M1I4M1I10M1I5M1I5M1I10M1D8M4I6M1I9M1D6M1I4M3D4M1I14M3D3M1I6M1I3M2I4M1I2M1I2M2I6M2D6M1D7M1I3M1D1M1D31M1D4M3I8M6I6M1I14M1I12M1I11M5D7M4I5M2D12M2D13M1I2M3I38M1D11M1I1M1I19M1D7M1I3M2I12M2D2M1D2M1I31M1D14M1D4M1D17M2D14M1D7M1I3M1I8M3I7M1D2M2I18M1D16M1D8M1I12M1D3M2D5M3I10M2I10M2I4M1I17M2I11M2I29M2D4M2I4M2I20M4I3M1I18M1D7M1D7M1I4M1D7M1D12M3D4M3D10M1I6M1I3M2D2M1I21M1D6M1D10M2D14M2I4M1I3M1I2M1D10M1D17M1I9M1D6M3D12M7I18M1I13M1I2M2D7M1D13M4I2M1I11M1D21M2I14M1I8M3I7M2D6M1I4M1I7M1D2M3I1M1D16M3D10M1D10M1D6M1D8M1I8M1D8M1I2M1D17M1I9M1D7M3D5M3D15M2I9M1I14M2D22M1I3M1D5M1I3M1I4M1D9M2I1M1D3M2D10M1D21M1I8M1I48M3I3M3D12M2I13M1I22M1D5M3D9M2D41M1I10M3I13M1I21M1I20M7I26M3I11M3D4M1D2M3I15M2I17M12I1M3I11M2D18M2I15M1I4M1D24M1I31M2I18M1I6M3I3M1I15M1D31M4D1M2D5M3I1M3I10M1D3M2D2M3I8M2D12M2I32M2D10M3D13M1D2M1D3M4I3M1I48M1D13M1D3M3I15M1D4M2D3M2I3M3I4M1I7M1I4M4D9M2I2M10I14M3I13M1I5M2I5M1D55M1I4M3I28M1D14M3D30M1I7M3D6M1D6M16S	*	0	0	AGTCGCTGTTATACTAAATCACCAGTCTCAGTTCCGTACTAGGCGCAGCCCGGACCCACTTTAAAGTGATAATGATTATCATCTACATATCACAACGTGCGTGGGAGGCCATCAAACCACGTCATAATCAATTATGAACGCAGGTATCGTATTAATTGATCTGCATGCTAACTTAACGTAAAAACACTTCACAGACAATACAAATCAGCGACACTGAATACGGGGCAACCTCATGTCGAAGAACAGAACCCCGATAAACAACAAGCAACATCCGCTTTTCCTAACCAAATGATTTGAACAAATTAACATCGCTCTTGGCAAAAAGTCCGGGAATTTCTCAGCCTGGGTCATTGAAGCCTGCCGTCGGAGACGTCAGACAGAGCCGAGCATATACATCAATTAAAGTGATGAAGAATGAACATCCCGCGTTCCTTTCCCTCCGAACAGGACGATATTGTAAATTCACTTAATTACGAGGCATTGCAGTAATTGAGTGCAGTTTTACCACTTTCCAACCACAGTGACAGACTGCGTGTGAGGCTCTGTCACAGACTAAATAGCGTTGAATGATTAGCAGTTATGGTGAGTCAACCACAGGAATAATCCTTCATATTATTGATTTCCTTCACCAACGCTGCCTCATTGCTGAATGCTTCCAGAGACACCTTATGTTCGTACATGCAATTACAACATCAGGGTAACTCATAGAAATGGTGCTATTAAGCATATTTTTACGCCGAATCAGATCGCACGGCTTATGATCATCAGCAGATTGTTCTTTGTTCGTTTTGTGCTCCATGCGCTTGCTCTTCATCTGAGCGGTTAAATATTACTTCAATCTTTCTGTATGAAGATTTGAGCACGTTGGCCTTACATACATCTTCCTGTTGTATTTCCCTCCAGAATGCCAGCAGGACCGCACTTTGTTACGCAACCAATACTATTAAGTGAAAACATTCCTAATATTTGACATAAATCATCAACAAACAAGGTAGAGGAGGTCAGACCAGATTGAAACGATAAAAACGATAATGCAAACTACGCGCCCCTTATCTACATGGAAGGTTTTACCAATGGCTCAGGTTGCCATTTTAAAACGAAGAAATATTCGATCAAGTGCGAAAAGAGATTTAGACTGACTGTGAATTGTTTATTCGAACTAAAACGTCACAACGTCTCACATCTATTTATGACTATCTAGCCACAGATAATATTCATCGTGTTGTTAGAAAACGATAACACCGTGTTAATAAAAGGACTTAAATTGACGTAAATGTTAAATTCTCAAGAAACACGCATGTATAGAAACGTCCTATGATAGGTCGAAATCAAGAGAATCGCATTTCAGCAATACCGGGGAAAATCTTTAAAGATGCAGAGTTTTCCGATGAGTTATACAATATCCATGAACATAAAGATATTACTATACCTTTGTAATAATTCATTACTATTTACTGGAGCATTCAGAACAACACTACACAAATCTTTCCACGCTAAAATCATAACGTTGCTGTTCCTTCCGTGTCTAAGCATCCCGTTGTCCCGGCATAATGCAATACGTGTGACGCGCTAAACCGTGTGCAGCATCGTTTAATTATTCTTCCAAAGCTCCCGCAGAGAAGTTCCCCGGCTACATAGGCTCTTAAGCTAGTTAATCAATCCGGGAATACAATGACGATTCATCGCAGCTCTACATTAATAAATATTAACAATATGAAATTTCAACTCATTGTTTAGGGGTTTTGTTTAATAATTTTCTACACATACGATTCCTGCGAACTTCAAAGCATCGGGAATAACACCATGAAAAATGCTACTCGCTACTGCCTGGCCTGCTTATTACAGGATGTGCTCAACAGACGTTTACTGTTCAAACAAACCGATAGCAGGTACCTACCCACCAAAGGAACCATCACCATCATTTCTTCGTTTCTGGAATTGGCAGAAGAAAACTGTCATGCAGCCAAATTTGTGGCGGCGCAGAAAATGTTGTTAAACGAAGCCCAGCAAACATTGCGTAAATGGATTGCTCATTTTATTACCTTTAGGCATTTATACTCCGCTGGAAGCGCGTGTGTATTGCTCCAATAATTGCATGAGTTGCCCATCGATATATGAGGTAATCTATTGCACTGCTCATTAAGTTATCTTCTGGGTTCCTCTTCCAGTTTGTTTTGCATAGTGATCAGCCTCTCTCTGAGGGTGAAATAATCCCGTTCAGCGGGGTCTGCCATTTGGGGAGGGTGCATTATCCACGCCGGAGGCGGTGGTGCTTCACGCACTGACTGACCGCAGACTGCTTTGATGTGCAACCGACGACCACCGGCAACATCATCGCAGAGCATCATTTCAGCTTTAGCATCAGCACTCCTTCGTGTATTTTTGCATGGCAGGCAGCAAGCATACGCTGAACGCATCTGCATGTCAGTAATGCCGCGTTCCCGCTGATTCAGTTCTGGCATTTGTCGCGCTGGCTTTGTAGGTAATGGCGTTATCACGTAATGATTAACAGCCCATAGAACCGACAGGCAGACGATGATGCAGATAACCAGAGCGGAGATAAGTAATCGCGGTAACTGCTCATACATCAATCTCTCGACCGTTCCGCCCGCTTCTTTGAATTTTGCAATCAAGCGTATGTCAGCCTTATGCTCGAACTGAGATGACCAGCGCCCCGGCAGTGAAGCCCAGATTGCTGCAACGGTCGATTGCCTGACTGACGGATATCACCACGATCAATCATAGGTAAAGCGCCATCTCCTTAATCTGCTGCCGGCCACAGCGTCCTGACTTTTCGGAGAAGTCTTTCGGCCAAGCTGCAGCTGCGGTAGGCATCCCACCAACGGGAAAGAAGCTGGTAGCGTCCAGCGCCTGTTGATTGGGGTTTGGGTTTAGCGTGACAAGTTTGCAGGGGGTTACGGAGTAATCAGTAAATTAGGCTCTCCGCCTACCAATACCTTTAACCATGATTTCTGGTTTTCTGACGTTAAGGTCCAAGTTCCTCCGACCACGCCAGCATATCGAGGAACGCCTTACGTTATTATTATTTCTACCATCTTCTACTCCGGCTTTTGAGCGAAGCCGTTTGATAAGCGAACCGGGCAGTCAGTACCGATGAGCCGATAAACACGCTCGTTACCCAAGGTAATACTACCGAGATGCTACTTAGTTAAGCGAAGTCGAGAAGGTCACGAAGGATGAACTAGGCGATAATGGCGCACATCGTTGCGTCGATTAATGTTTTGTAAACGCACCGCCATTATATCTGCCCGGGAAGGTAAGCCCCATTGCAAACCGCAAGGATTTCCGCGATGCCTTGTTCCTTTGCCGCACGAGATGGCGGCCAACACAGGTCATGTTTTCTGGCATCTTCACGTCTTACCCCCAATAAGGGGATTTGCTCTACGTCAATTAGGAATAAGGTCGATTACTGATAGAACAAATCCAGGCTACACTGTGTTTTAGTAATCAGATTGTGTTCTGTGACAGGATATGCACGGCAAAACGGCAGGAGATGTTAGCGCATACTCGTCGCCTCCGCTTTCACGAAGGTCATGTGTAAAAGGCCGCAACCGTAACTACTATTACTAATGAATTCAGAGACAGAATGGCTACGGCTCAGTTTGGGTTGTGCTGTTGCTGGTTTAGGCGATGAATGACACGCTTGGAAGCATTTATGATCCCGGTTCTGCTTCCGGTATTCGCTTAATTCAAGAGCACAACGGAAAGAGCAGCTGGCTAACCAGGCCTCGCCGACTCTTCACGATTATCGACTCAATGCTCCTTACCTGTTGTGCAGATATCGACAAATCCCGAAACCCGTTATGCAGGCCTCTAACTATTACCTGCACGTATTTCGGGATTGGAATTCAAGACCTCTCTGCCTGCGATGGTTGGAGTCCAACGATACGTCGAAGTAAGACTAGGCGGAATCGTAGTAAGGGCGCCGCTCTTTTCTTCATCTACTACCACAACGAGTGAATTAACCATCGTTGAGTCAAATTACCCAATTTTATTCAATGATCAATCATGCCGCCGTTAATAACTGTTGCCATCCGCGTGAATAATCATGCTGCCAACGTGTGACCGCATTCACAAATGTCTGCGATTGACTCTTCTTTGTGGCATTGCACCAGAGAGCGTCATACAGCGGCGGCTTAACAGTGCGTGACCAGGTGGGTTGGTAAGGTTTGGGATTAGCATCGTCACAGCGCGATATGCTGCGCTTGCATGCGGCGAAGTACTTGAACGCCTTTGCATCTTCGCACTCTTTCTGGACAACTCTCCCACAGCTCTGTTTGTGGCAAATGATAAATGCACGGCTGTACCATGGCAATCTCTGCATCTTGCCCCGGCGTCGCGGCACTGAGCAGCACGGCAATAATCCGCATAGAGCGAATGTTGCGAGCAGGTGCATCCTTTGCCTTAGAGACTATTTCCTTCAAGCTTTGCCACCACGGTATTTCCCCGATACCTTGTGCAAATTGCATCAGATAATAGTTGATAGCCTTTTGTTTGTCGTTCTGGCTGAGTTCGTGCTTACCGAATGCAGCCGACCGAATCCGGCTTGTGATTGCGCCGTCCCCAAGCAGCCACTCCATCAGTAAGGGAAAGAGGTCAGAAGCCGTGGCCGGTGAGTCGCTCATCATCGGGCGTGGTTTTGTATGAATGAAATTTAGCTACGCTTTCGAGTCTCATGCGCCTTCCCTAGTATCCTGAATCAATGTTAGGTTCCGCAGAACATGCACGCTTATCGATATACATGTTGGTTGGCCAAACTTGAGTGGTTTCACTGCTGGCGTATGACCAAAGATGAACGTGTTGGCGCCTTTATTTCTTTCGCACGATCCCGTTTGTGTGAGTTGCTGATTCGTTCTAAGTTCCAGATTTACCTTAGTGATGATCAACGCTTTCCAAACTCGTATTCGTCAAAGGGATAATCGGCGTGGCAGATAACATATTTTATCTTTGCTCACCAGTTCACATGATTAACGGAAGTTCTTAAGAGTACTGCTTTATGGGCAAGAGCTTTAGCCAGAAGAATTTCTTTGTAATCGAGGATTAAAGAACCAGCCACCGCCATTAAGCAGCCACGTATTGAAGCTGCACTGATTATCGTTCAAGATATGATAAGCCATCACAATCATCATTTGCTGCCTGGTTTCCACGTACAGCTCTGAACCAGGGGAATGTGATTAATTCCCGGCATTCAACGTTCTCTGCACCACGATCAACCAAAATCGCCCCCACCGAGATAAGCAGGTCTTTTGTTGTCAAATCCAATCGTATCCAGTTTGTTCATAAGCTGTCATTTGGCACTGCGTTAAATGCCAACCCAAATATTTCGTAGTATTTGCTGCCATCAATTTTCGTAATAGCGCATCTCTTTCACTCCATCCGCGATACATGAACCAGGTAACGTCGTTGACGATGGCGTGCATTTCCGCGTCTTTATCATCAACGTATTTTCCGACTGGCCCGTACCCAGCCACTTCAGTCTGCGTGCTACTTCTGTCTGATTTCCGTATGTTTCAACGAGCATGTTCTGGAATGGTTTTACTGAGAACGTCTTCATGCGGCCTCACCTTCTGCTATTTCGCAGGTCTTTGAGTTTCTGTTGGTACTCTGCCTTGATCGCCTGTGCACTCTTCGATAGTCTCAGCGATGGCGGTTATGGTTTGAATTCGATTTCGTCTACTGCTTCCCTGCCCGATGCGGCTAATCAGTTCGACGGCGATACGAACGAGATTTCATTTTGTGCCTGTGCG	*	tp:A:P	cm:i:127	s1:i:1139	s2:i:0	NM:i:1320	ms:i:4118	AS:i:4118	nn:i:0
+6	4	*	0	0	*	*	0	0	CATCTTGTGCTGTTTGGCCTGGCTCAACCGCGGTATTTGGCCTTGTCGTCCATTCCGTTAAGTTCCGTTCTTGTTAATCTACTCTGTTTGACCACCCCTCGAAAGAAGCTAAACGAATTATGAAAGGCTGTTGGTCGTTCCTTGCTTTCTTTGATCGGACCGAACAATCGACAGAACAAAACATCATTTTAAAGTTGGGCGTATCCGTACCAGTCAGAACGATGAACAGGGAATTACCGTTTAGCGTAATTAGATAACCGGTGTCTCTGTCACGTGCCCGAGGTACAAACCGGTGCTGAAAAAGTACGGATTGGTACGAAAGCCTGGGGGTAGGACGGAGTCTAAGAGTGTAAGATGCCAGCATGAACCTTACGGACTCATTAAGGCGCGCCCTATCGACGAAAAACAGGACCGAATACGGTACCAGCCCGAAATTACTTTGGTTCGTCTGTCCACGGCAGGTGAACTTACAGAGTGTGACCTACATCCCGTCGTCAAGCTTTTTCGCGCGGACGCGACCCGACAGGGTGGTCTTCCTGAAACGGGCCACCATAAAGCCAGGAACAAATAATAACTATCGATTAATGGTACTGGCTAGGCGTCACAGTTGACCAGATGGTAAATTTGTAAGCGTGACGCTCGTTTTAATGAGAGCCCAAGACCGCCGTTTAACTGCCTGATACGTCAATATTACCCCGAAACCAACCCAAGGACGCCTGGGAAACGGCCGTCCCATGCTACATAAACCGTATGGCATAAGCCACAGCGACCCCTTAGTAATGCCCCTTATCCAAAGTCCGCTCGTTATGTCGAGCTTGGTGTTTATTACCGTACGAACACCGAGCGAGCACGCGTGACTGTTGAGCCAACTTGTGACCACTGTGAGAGCATTCTATTGATCTGAGCGTGCTTATGATGGGGTTGGCCCAAAGGACTAGAGAACCCAGGCACGTTTTAAGTAATCGTCTCTTTGGTGCGGCGCCGGGCCAAAGGCGGTGGGGGTCAAATTATGTGTAAAGTCTCTATATGGTGTTTTATGACTTAGCCGAGGAGGACTGAAGAGCACGTCCTTCGGTACCAAGGATGTAATGCTCGTTATCCCAAGGTTCGACTCATTGACCCATCAAGGCTAGATTGAGAGTGCTTAATTCATAGAATGATATCCCCGCTTTTATCGTTAATGTCACTTGGGGGTCAGGCAGCAGTGGATCTCTAACAAAGACGAGTTCCCCGACTCTGAACTTAGCCGACGAGGCGTGTTTCTCCAGATCGCTCACTTAGTATATGATACCCACCGGGGACTGATCCACTTAGATTTAGAAGACCGGGACTTAGACTGGCTGATCCCTTTGGGTTTCGTACCATTGCCCGTACTGACAGTGGGATCTAAGTTCGCGACCTTAAAGGTCAAGCGCGTTCAGATATTAGATTCCACGGGTTGAAACCGAAAGGGGACCGACCGAGAAATCCAACGTGAAACCGACGCCGACCCGTGACGTACCGGCGATGAACGTCTAAGTATCTTAAAATAAGGCTAAGTGCACCGTTCCGACTCGGTCGTACCTGACCCCGGTTGACGCCCATATGGAACCGCTATCAATCTCATGAGCCCATCGGAGGAAGGTGTCTGATGACCGGATCGTTCGATCACACGACCATGAACAACCTTCCTTGATTATACAAACGGGACCCGACGGACCCCCAAGAAAGACTGTCGAGGTTGGGTACCCATGTGACTCCTTAGATGACCTGAAGCCGTGTGACGCTTAAACAGCGGTATGTTCGATCCCCAGTCGAGCAACTCGATTGTCTGAAGCGACCGGTACATAAGTACATCACGAACAAAACGGGTTAGTACCGAACTGAATTCGACCCCACGAAAGATTATAAAATCCCCTAATGACGACAGGACTGGGGTTGACCCCGTCCGTTCATTACGAAGACCCGATATGTTTGACCCAGCATAATATGACGCTGAAGTCAGAACGTATGGCAGAACACTTCTGGACAGCACGACAAGTAGAAGGCTCTTGGGTCCTGGTGGCTGAATGTTTACAGATGAGCTCGATTCTGTATCAGGTGGCCTCGGGCGGATATGTCAGACCAGCGAAGACAATAAATTGTACGATTTAACTGGCCGCGCCACTCGGCCCAGCCCGACGTGACATGACAAATTCGGCCCTGCACTCTGACCGCAGTACGGCTGACCGACGGGAAACATTAAGAAGACGACCTAATGTAGGGTTTGCTGGCTTAATTTAAATACTAAGAGCTGTACGACCATTGCACATACGGCAGGGACGAGCTATCGCTTTGGTTGAACCACACAGTCCCCGATCTGGGCTCTGACGACATTAGTGACAGTCCGGCATCGGTGTAAGGGTTGCGGGAGTTGCGTCTTAGTTAACCACGAGTAAAGCGTATTATCACTCGCGTGTCTAAAGCGTACCCCAATGCATCCCAACGATCGTGAAGGTAAATACGTAGCCCCCACAAAACCATTACTCCAAGTAATATGTGCGTGTTGCGCTCGAGGTCAGCAGCTGGGCCTGGTACTGGCTAAATACCGGCGCGCTCGCGTCCAATTAGATGGGAAAGTTTTACGATGACTATCTGATTGACGTTGAAACGAAGGGCTAAGAGGTTCGGAACTGTCATGAAGCTTACGGTGGACGCTGTTACCGTGGGTCCGTCGGCCCGGGTGGCACAGTTCTGCTGGGTTCGAATAGAGTTTAATTAACACCGAGGACATACGACGCAGCCCATGGCATGACATAGGGAGCTGACGTCCGGTTGTCAGATCTAACTGGCCCGGTTACCGTGGGCTCTTGGAGCACCCTGAACTGGCTGACGATACGAGACTCTACTTACCGCATGATTGAAGTAGAACCTACCGTTCCTTAAGATTTTGAGTTGTGAATAGCGTTCACCATTTGAGTATTTCTAAGATTACCACAGAGCCGGTAGCCTAGGAACCAGCATTAGAAGAGGACTAGAGCCGGTGTAAAAGGCCGTATTACCCCCGATCATCCCTCTGGCCCAGTCAAAGGACTGATTGGGTTCTAAGGATTACGGCACCACGGCTAGTACCCACGTACTGGGTGGGTCAGATTGAGGGTCCCCCGCTCCGCGTCCCGCAGCTGACTGAAGAGCAGCCGTACCCACGACTTAAGTGAACTAGATATGGGGCGTAAGGCTGGGCGGTAGGACAACCTTAAGCCGGTTTTGAGTCAGTAGAGCCTGCTGTAGGGACTTGTCTATTGTAGCTCATGTCCCAGATCAGGGGTAAACCCCGGGCCGTAGCGTTGAAGCACCCGATCTGCTTCGTGACGTGACGTGTAGTCAGGCCCCGTGGGTCGCCATGAGTCGAGCGAGGCCCAATGTTTTAATGTTATCTGAGAAGCTAACGTTCACGACTTAAATTAGATCCACTAAATCCTTTCCAAGGGACGCCGGTCAGCTGGCAGAGCCTGGGACCCCGTTCTTATCACATGAACTGTTGACAAGGAATTTATACAGACATAAGTTATCTATCCCCGTACCTGTGAGCATGCTTCCGCCCGGGTCTTGACCCGCATGTTAGCAGGCGGTCTCCTTTAGGCATGAGCGTTCGGGACCATTTAAGCCGACGATGGGCTCTGAAGGACTTTGGGTTGACCGACCCCGTAAGGCTCCCGCGAGCAGGTTGACGGACAAGACTGACCCATAGAGTATTGAACGACATCCCTCGTCCGGCCTGATCTTATACGACGCGTTATTTACTTACATCGATGACTGCTAAACGATGAGTGCATGAGCCACTCATGATGCGGCCAGCGGACGTAAGTGGCGTATGTAAATCACCCCTTCCGATGGCGCGAGTTGACGCGGTAGACATACAGCCCGTCCCCTTTAGTAAGACAACTCGTCATGTAGCGTGAACCCGACCTAATTTACTATATGGCCGGTTTTAAGCCTGTAGCCGCGTTAAGCAGACTGATCGGACATCCATCGTGGTAGGTCGTAATAGACAAGTAATGCTGGGCCGTCTGTAGACTTAGTCTAAAGCATTTGGATCCACAGCCCATTGTATGTAATCACAGCCCCTAACTATTCGGATTACGATTTATCCACGTCACCCGGATATCGTCCCCATGAAGCGGCTAAGAACCGATACATGATGATTATATCTGAGACTTATGCATTTAACAGGCGATGTCAGGCCTGTTGCACGGGCGCTAAATGTGAAGACTCAAGCAAGCTATTTGGCTGACCGTGCTGAAGGGACCCCGTCCATGTTGAATGACCATCACAGACGCGCCCGACTTTTACTAAGTGTCACTGACTGGCGTATATTTACGTTAGAACGTTGTTATGGCACGGACGTAAGAAGGATTAGAGCGTCAGAAACAGATCAGTGATATGTTGGGGCCCGAATTAGTCGCCGAGCATGACGTGACGACTTAGGTAGATGAAACCCGGGAGGACCGGAAACCTAAGGCATCGCGGACGTTCAATAATATTACCAACAGTAGTTGATATGTCACAACGGGGCGCCCCACTAGCCCTACCGGGCTGACCCCAACTGAGCCAGGCTTTTGACCCAAGAGGCGAGCCCGGTACCGTATAATGTCGGAACACTCTACGGCCCGGCGACGATAAAGATTATCACATACCCAGTTATCGGTAAAGATGACCCGTGATGACTAAAGCTTCCGCGAGTGCATGAAGTCGCCGTAATATGACCGTTATATGCACTCAGCACCGCTGGCTATCGTAATACCACGAGCCATCGTAATCCGTTGTCGGAATTATAACTAAGAGCGAATTGAGGGGTGTTCTACCGGCCGGCTGTTACGCAGTACCTACGAACTAGGACGCGGTCCCGGACCGTAAGAGCCATAAGATGGCGTACGTACGGCCACTAATAGACCCCGCCTATCTGACGGCAGGCCTTGGACTGACTTTCGTGACTGTAAGAAGGCTTTAAGTTGGCATTAGTCTCGTCCTGGTTATCTCGATACACCGCCACACTTAATTCTGACGCGTCAAACGTTCCCTTCTCAATGTTATGAGCTGAGCCGGGGGTACGCCTCGAGCCCGAAGCGGCCCGTTTTACCTAACTACGGCACCTAACGTTTATCACTTGCCCGCTCCCGATAGTTCCGTATTCACCTTTATTGCTTACCGAGCCCCAGCTGGCTCCTCAACAGGATTAAAGTTTGGTTCATAGGTTTGATTATACCGTCAAGTCCGGCAGGTAACAAGTTGACCGCGATCGACTCCCGATGCGATGACTTAGAGCCAATACTGTTACTTTCTAGGAACTTGTTCATTAGACAGTACCGTTTACGAATTAACCATCACGCCTACTTTGACGGGTCGGCCGGGTACGTACCACTCGCGTAGTCTACCTGAAGTGCGCGTCCCCAAAGTAGATACAGTAATCGGGCCACTCCGTCGGGCCTACCTACTGCTGAGACATGAAAGATCGCCAAACCTAGTTGTAAGCGGTTGGCCGGGCTTCTATCTATTCGTAGCGGCCTCCGAAGTACGTGAACGTCAAAGAATCCGTCCGTAACAACCGATGCGCGGACCCAGACGGAGGGATTAGTCGGAGTACTAGCACGAACACAGTCCTAAGTACTTAACGAGCGGCCGCTACGACTCGAACACCCTATACTCGAGGTCTACATGATTTAGTCAGACCTGGTTCGTTGATCCAGCCGGTCCGCGGACTTACGAACTGGTGTAACAGGTCGAGCGGCCTTGCGCTATCAGAGTTACGAAGAACTGTAATCACTTAGTCCTTGCGAACGATCCTGACCGGGAGGGTCCGGACGTCAATGAACAGAAGACTTATCAGAGCGGCCTAAGTTTGACATAGGTAGTAGGTCCAAATGGTTGAATTGCCGTCGTTACGACATCCCCCATGAACCCTGGACTTAATTCGAAAGCTTGCGATCATAGCAGATGTATAACTATGTATTATGAACTGGTACCGGTTCTTTAACTGTGAAGGTGATATCGATGACATGCATCAAGTTCTGGTTGAATTCTAATGGCGCCTCGACGTAGCGTCTCGCGCTCCTACTGACTAACATTGATGTTGACCTGACAACGCGGAGAGCTGGCGCCATTGTACGAGCCCGCTGGTACTCCGCAACCGAGCTGACCGCCACGTCCAAGAGGGAACTAGGCGATCATCACAGCGATAGGATGAGGGGAGCGGTGGGTTGACGTGGACAGTTATGATGGATCAGGCGGTGGATTGAAGTCGAGCATCCGTGGGCTTGGATTCGATTTCCTTAGTAGGCTGTACAGAGGCGGCGGCCAACCGAATAGGTGGAATTCGGAGATCGGCTCTACCGTATGATGGCGTGGAATATGAGTCGTGTCTTAACTCGAGCGACTCGAGGGACGTGAGGCGGGATCGGGGTTCGAGCGATAGAGTCAAAGAGGTCTAAGCTGACTGGATGAGAGAAACGCGATGGGCAGCAGGCATGAGTAACGGAGGTTATAGCCGGCCCGGTTACTAGGCATGCTGGGTGGAGCACAGCTGCATGCGTTGAATTGGATTGGATTCGATTGAATTGATCAGGATTGAATTGAATGGATTCGAGTACAGACAGAGAATGGCGATTACCCGGCATTTACACCATCCGGTAATGCCTCGTGTGCTTTACTAGGTGGGATCCGGCAGGCCGTCCTGAAGACGGCAGGGGCCTCCTTCTTGGCCCGTCGTATCTTTTATGAGACTAAAATTTTGCCCCTACGCTATCATGTGGCTGTAAACGGTTACCAGGCGTTTGGGCAATCAAACCCCGATGGCTGTCGCTCCGATCGTTAACGCAAACCATCATGATACGTGCGGACTTATGACACTCTAGCTAGCTGATAAGGACTCAGCCAATAACCGTTGAACAGATTGACCTGAGGAGGGACCCCGAATGGGACTATTTTGACTTCGCGACTTTTTACCGGCCTGTTTAGTGCGTGCTCGTTTGGCCCCCATCATAGCTCCGATGCACGGGTGGGCCAAATGGGCCAATACGGGACTATCGGCCGTGCTTGATATCGATCGCCGTGCCGCTACTTGAGCGTACGTGAGAGTCTCGAGTGGCTCATACCCCATCGTCCGTGTATCCCCAGGTCTGTACGGGATGACCCCATCATGATATTAGTGATGATCGGTTCTACGATTGGTGATGGTCGGTGGGACTCGTAGTTAGATGTGTAACTGTCGCACGTCCGGCAGATCGTACAATCCGTAATGTCGTCACCGGGGTATTGGCGGTACCCGATCACGATTTGCTGGATCCAACGCTGTGTATGTAAATTGGTAAGATTTTACGCACCGTGACGGAACCGCCTCTGACGACATAGTGCTGTCGACATATTAAGACTCGACGGCGACTGGTAAGCCACAATCGAATGAGAGACCTTACGGGGGTGCGATGCCCGCTCATTGGTAAGAGCTAGCGCGGGTAATGAAGTAGTTGACCCCTGAGGTAACCGCTTCGCCGACGTACAACGGGTCGTCGCGGCCTCCGTCTGGTTTCATTACTTGCTAAGTGGGGTTCACGGCGTGACGGACTAGAGATCACCGAACGGTGTACGTACCAATGTGGACCGTCCGTCCGTAAGATACGCTAAGTACTAGAACATAGACCGTAAGGACCGTGACGCTTACAGCTATAATCTTCGGGCCAAAGGCCATAATACTATGCTTCGAGCCGATGGACGCACATTTGCGTGCTTGTCTTAGGCCAAACAAAGGATTTAGTCCTATTGGCTAACGATTATGAACTAGGTTCTTACATAAACAGTCGGATTCGGTAACTTAGTTGATCGTTTACTAAACCCGTACACGAGTTAACCCGGGGTCATAGTGTTCCTCAACGAAGTAGGAATGTTATACGCGCCGTGACCGTACCCTTTAACGGTGATAGCTCCTTACATCTACATCGCTCGATGAAACGCTAAGTAAGAACAGGTCAGACAGACCGGATTTGACTTAGACACGGCCATACGACCCTGTCTTGGGCTGTGCGCTGTGTAACACCAACCCTAAGAAGACCCATATCCGTTATCAACCGGCCGTTAAACAGTACTCCACCATTGACCCGCCTTACCACCTTTACCGTATCAAGCGCCTTGTCGAAACCTGTGGACTTGTAGGTTGTGACTCAGTAGGCGACCAAGCCCGACTAAAGTCACGAACGTTCTTACGGCAATGTTCTAGACTTATGACGTGTTTAGCGTGCTCTGAATCCTCTGATGCGGGCAGCTCCTTCCTGATGTACGACTGTCTACCCCGATGGGCCTACTCACGGTTGAATGAACTGTTCGACTGTTTATCGTCCAGTATGGTGGCGTTTAAAGCTGTTCCATAATTAGGACTGTGAGGTTCGGTTATCTGGTTAAGCCGGGTGGCCCCGCTGAACGCGCTCTTTATATTACGACAGGATACAGGTATCTTACATAAATGTTACGTCTTACCGTAGGGCTCCGTGCCCGGATCCGCGAACTTAATAGCTCCCGCTCTACTTATGCTATAATGATTAGGGTGAAGAGAGTTAATTGGACTGCAGCGGTTGAGATCTATTTCCTTTGAATTAGGGCCCATTGCGGCCAGGGCCTAGATCGCTCGTCACCGTTATTACACGTATCAGAGGGAGATAGTTTGAGTCCTCTGGCTAAACCGGGACCTACGAAAAAGTCGATTTAGGACCTTGGCCGACAGTAGCTGGCGTTTAACAGACATCCTAGATGTGAGGTGAGAGTCCAATTGATACGTATGCATGAACAGAGCACTCGAACCCTAACTAAGTCTGCAGGGTACAATATCCGCGGTTCCGGGTTGACAGTTCGGGCCATGACCAATGGTGGGCCTATCAGGTCTGTGAGCCCGTTAGATGATCGTACCGGGCCCCTGAGGTGGCGTGGCTACGACTTCGTCCGGGCTCCGGGCAGAGTAAACCAATCTTATTTCGTTGAAACAAACGAGGGCGGCCGTAATACGTTTAGCAACCCGCACGTCAGACCACGCCTGGTCGCTCGACTGGGTAAGGCTTAACCTGAAGTTAGTTAATAGCCGACTTGGGGTTAGGGGTACATCGTAGTACTAGGTCAGCCTACTTCTAGGCTCCCGCATGGGGCGGACATTTAGGCCCTGGGTGAAGCGACAGACCTGACGCGTTCGGACGTCTGAGCCCACGGCCTAAGTACGTGGTTGGCGTGCTAGTTTAAGCCTGGCTCAACCGGATTAAGTGAACGCTACCTAAACGAAGGCGAGGTTGACCCAACCCGCCTATCAAAGAGAACAGCGACTGCCACTCGATAACAGACGCTCCGTAAGTCAAACCATGTGATACGTCTGGTTGGGCGTCTATCGCCACGAGTATATCCAGCAGGTAAGTTGTAAGAAGCAGACAACGACATGGAATCTATAAGGTTATGTTGTGACGATGAACCTAGTGATTTCGTACTTCACGCGACTTACCGTCTCTTGAATAGCCCGAAGACTGCAGCATAACGACAGACAAAACTAATAAGAGGGTACCGAAGGGTACCGAGTAACAGACTCGAAGAGCTAAGAAGAGCTTGACCGGCCTTACGAGCTGAGAAGACCCTACCGATTAAAGACCGAACAAGCACTGAATGTAAACAATCGATAGTACAAGAACGTATGATGGCGGTACCATAGGCCTGAAGCTAGAAAGCCGAACAGTCCGACTGCCCTGTTAATCTTAAGCAACAAAGTCTAGTATGTAGCATCCTCTAACTTATGTCAGACGCGACCCGTAACAGCATAATCAAAGCCAAACGATAAGCCGGATTGTGCGGCCGTGAGTTTAGATTGGAGGTATAGGCTAAATTAGCCTGTTATCGAAAGAGAATCCGCCGTATACCAAGAGACGCTGCTACACAACCTTATGACATCCTACAAGTCCGTACCAGGGACACTATGGGGACGGCGCGCTAAGCAGGCGATTGACAGCATAAACGGTAAAAACGGGCCCGTATCGAGCGTAATGAACAGAGCCAGGACGACAGCCCAAGACGGCACCATTAAGGACATCTAAAGACCTGGGGTAACCCCGTCGAATGTTTAGATAAGAAAAGACCTGGGCTGAAGACTTACGCCTACATATGAATACCCGGTGGATAGATGGTGACCAGCACGAACATTATTGTCTAAGTAAAAGTTGAGCCCACGATACGCTTTATTGACAGAATATCTGGGCTCCTTGACTTACATGATAAGACTCTACGATCACCGTTCCCGCCGTGGTCCGACCACAATGGTGTAAGCATACATCGTGATGGGGTCAGGCAGATGGGCTAGCCGGGCGTCATTTTATCACTATGAACAGTTGAGGCCGTGCGACGGTTGAGCAACCGCCTATCGATTACACGGTGTTACAACAGCCTTTACCATTAGATGGGCACTGGCGGGGTTTTAGCTAATTGATTTACCAAAGAGCGACCCGGCGTGTAATTGAAATTGGCTGTGGGTCCGTTATTACACCGGGCCTTTCTTTAAATTCGGATAAGGTGTAAGACAGAGCCCGTCTATAAGCGTCTACCGTACGTTCCAAGACACCTGTGTATTAACACGACGAACCGAACGATCAGAGCCGGGCTCTGTATCTTAGCCTGAGTTGACATGACAGGATTAGCATTGGCGTGAAGCCCAATACTTATCCGTTCTCCAGGCTGTAGGGCTACGTTCAATAGCGTGAACCGAATTATGTTCGTTTGGGTCTTAGAAATCCTTTGACTTCGCTAGACTTGAGTCTATCCATAGGCATTAATTACGTTATTTACCGGAATCGGAAACCACCGTGACCGTTTGGCCCCTCCGGCGGCGTAATGGATTAGCGTCTGGTCTTAAAGACCTGTGGAGCGAAAGTGGGACGCCTGGTCGTCTTTAGATCAATGTGACCTGTAAAATGTCCGTTCTAGAGTTTGGGCGGTATGGTCAAGAGGACAGGTAACAGTAT	*
+7	16	utg000001l	41574	60	4666S11M2D3M1D6M1I1M2D6M3I11M1I4M1D3M4D5M2D3M2I6M1I11M1D23M1I6M1D14M1D5M5I9M2D8M6D5M2I2M1D3M1D4M1D2M1D4M1D3M2D2M3D3M3D8M1D39M1I5M2D5M2D4M1D2M3D4M1D5M1I17M3D8M3D17M5D1M5D4M1I6M1D1M1D4M1D9M1D1M2D5M4D23M2D14M1D10M1D11M1D13M1D9M1D14M1D3M1I9M1I24M1I5M2D6M2D22M2I2M4D20M1I4M2D1M1D4M3D4M2D1M1D7M1I7M4D7M3D8M1D1M2D2M2D1M3D6M1D6M1I5M1D11M1D4M1D1M2D12M1I10M2D4M1D19M1D1M1D10M5D1M1D2M2D12M1I6M5D6M2D13M2D1M1D6M5D10M1D10M2D13M2D8M1D4M1D22M5D3M1I9M1D2M2I7M1D1M1D3M1D4M1D4M2I5M1D7M3I7M1D2M2D7M1I15M2D1M1D7M1D4M12D10M2D2M3D2M2D6M1D5M4D1M2D7M3D3M2D8M2D4M2I2M1D7M4D2M1D5M2D7M4D4M5D12M4I4M1I4M1I1M1I7M1I1M2I8M1D30M6D24M1D2M1D9M1I7M1I2M1D5M2D2M1D1M1D4M1D5M1I9M1I3M2D9M3D16M2D1M1D8M2D10M3D19M1D5M1I14M2D1M1D7M7D11M1D5M1I2M1D10M2D1M1D5M1D7M1D2M1I6M3D6M2D6M1I3M1D11M1D9M2D6M1D3M1I5M1D7M1D21M2D34M3I4M1D5M1I10M1D2M3D3M3D4M3I5M1I10M1I7M2D5M3D2M1I2M3D1M3D8M3D11M1D3M1D5M1D3M2D6M1D3M2I5M1I21M1D8M1D1M3D2M2D2M2D7M5D1M2D1M2D4M1D4M1I12M3D1M1I2M1D2M1D2M3D24M2D13M1I18M2D18M3D5M1I7M1D8M5D2M1D2M1D4M2I29M3D4M1I12M1I19M1D4M1I14M1D2M3D13M2D4M1D8M1I6M10D7M1I7M1D7M1D7M1D5M1D17M1I5M1I2M2D10M2I4M1D5M1I9M1I9M1I5M1D10M1D6M6D15M1D7M1D9M3D7M4D4M3I18M1D8M8D13M3D3M7D2M1D8M2D2M5D6M2D2M1D8M1D4M2D15M2D4M1D3M1D5M2I3M6D3M1D1M1D5M1D8M1I3M1D22M2D5M1I14M3D7M3D2M2D18M1D15M1I38M1D6M1D4M1I2M2D17M1D12M2D4M2I16M2D20M1D7M4D7M1D4M1I3M1D6M1D21M1D3M1D8M1D9M7D2M2D2M1D23M1D10M3D4M1D17M1D3M3D2M2D5M2D6M2D11M1D6M2I7M1D14M1D10M2D8M3D14M3D6M1D6M2I5M1D19M1I9M8D1M3D5M3D2M3D3M1D6M5D11M1D8M3D5M1D3M1D3M3D3M1D2M1D6M7D10M1D4M2D5M4D3M3D10M1I5M1D5M3D1M1D5M1D5M1I8M1I9M1D26M3D21M2D6M1D6M1D3M2D13M1D4M2D9M3D18M1D16M1I4M4D16M1I16M3D3M2D6M1I20M2D5M2I21M1D5M1D6M1D23M1D18M1D1M1D28M4D6M1D3M1D3M1D10M4D10M1D2M1D21M2D11M1I8M5D19M4D1M2D5M2D6M1D5M3D2M1I13M1I1M1I11M1D7M1D10M2D3M1D1M1D9M5D5M2D2M3D2M1I3M1I3M3D4M2D15M2I4M2D2M3D6M4D3M1D5M2D4M5D2M2D7M2D4M3D4M2D1M1D6M3D12M2D25M1D4M1D6M3D7M1D6M11D7M2I8M1I6M10D6M1D6M3D14M2D7M3D18M1D6M1I1M1I3M1I3M1D2M1D6M2D4M1D6M3D1M2D11M2D5M1D5M1D4M5D4M1D10M1D2M1D12M1D4M1D2M1D3M1D14M4D4M1D4M1I1M2D3M2D4M1D5M3D2M1D2M4D12M5D3M1D3M4I4M2I18M4D10M1D6M3D2M1I2M2D13M6I2M1I3M1I26M44D7M1I3M2I4M1I2M1D6M4D10M1I5M1D6M5I2M2I1M4I9M2D5M2D11M2I3M1I8M1D2M1D6M1D7M2D16M5D2M1D1M1D4M1I1M4D6M1I8M1D10M3I11M1D6M1I22M1D8M1D16M1D4M2D4M4D6M2D15M1D3M1I10M2D12M3D4M1D15M1D1M2I8M1I4M1D18M2D2M2D15M1D16M3D39M2D2M2D16M1D3M2D2M1D4M2D1M3D4M3D4M1D1M3D12M1I6M2I4M2D2M1D10M2D4M1I3M1D14M1I11M2I9M2D8M1D7M1D2M2D5M1D26M2D1M5D5M1D1M2D3M1I2M1D6M3D3M1D12M1D13M1D1M2I16M3D4M1D2M5D14M2D11M1I1M2D4M1D6M2D8M1D3M3D9M1I3M1D18M1I1M2D2M1D15M4D3M3D5M3D17M3D6M1D6M2D12M1D6M1D11M680S	*	0	0	TTAAATAACAAACTGTAGATGTGTGTGGTCTGCTTCTTACCGCTCTCTTACTTACTTCTCATAGCAAGCAGGAAGGCACCGAAGAATCCCACATGGTTGGAATGCCCGCGGTCTGTCTTGCCCAGTACCCTCGTCGCTGTTCTCTTTCAGGCGGCGGTCTGGTCGTAATCTCCCTTCGTGCGGCCTCGTTCGCCCTGCCTGCCCCGGCTTCATCTCTAGAACTAGATGCACTTACAATGAGTACCCAATCTGCCCCCACGTTATGGATCGGCTCATCGCCGTTCGACCTAGTCGGGTGTGGTCCTTCCTAAGGCTTCAGCGTATTGTCTACTCACGCCGGGTGCAGGAGCACTCTCATGATGGGGGTGGCTCCTCCTTTCCCCTAGCTCCCTTGCTGAGTACTCGGTCTGCTAACGTAGCCCTGCTGCCTGCCCGGGACTCACAGCCACCATCTGCCGTACGTCGCCTGATGCCGGAAGCACAGCGTTTGTTGCAATGGATTGATGCTCTCCGGCTAGCGCACCCTTCACCGCTCGCCCGGAGGCGCGGAGCGCCCCAAGGAGGTCCTGCCCCATGTTGCAGCGGATAGCCCTCAACTTCTACGGCCTCTGCCGTGACTACGTCAATGAGTCTGTGCTCGCCTCCGGGATTACTTACAGCTACGGCATGCCCCCTTCATTCTGTGCGACCCCTGGCTAACTTCCCTCATGATGTTCGGCCTGTAGATTCGATATTCAAATCCCGCTATCTCGCGCCCTCTCTTAGCCTCGTGACTTGAACCAATCGCGCCTCGCGTATAGCCTCCTCAGTACAACAATTCAGCCCCTCCGGGTGGCTCGCTGCGGTACCTTCTCTTCATGGTACTCATTAATCAACGTCATGTCATCGGAAGCGCTTCTCTTCCTTCCCCTTCCGGCCATAGCCGAGCACTCGCCTTGGGTTTCTTAATGGGCTAATTTCATCCTGTCAAGCGACCTTCGTGGTTCTCCTCGCAGCGGTTTCGCCTGAAATCCGGGGCTGCCTTGAGCTGTACCGTAAGCCTGATGGCATAGCCACCTGGAGGCAAAGGTGCGCGAGGATTGGAAGGAGGAAAGCCTGTAAAGTGCCGTCAGCAACAGTGCAAGTAATGGGGGCAGCAACTGCCGCCTTTACTATCGCCGATCGCGCCCGTTCACCGCGACCCCTATAGTTCCGCCTTCGCCGCATCGGCTGCTCCATGCGTCCGTCAACTGTCTTTCCATTATTGACACCTCTCATAAATAGCTCCTCGGCCGGTCGCTCGCCTTTTAAGGCTATTACAGCCGTCAATGTGATACCACTATTCTTACTTATAAATCTCTTTTATAGCTTTAGTTCAGCGACTCCTGCCGTCGTACTTGCCTAATCGTCGCCCCCGACGAGATATCGCCTCGGAGCGTCGCCATTCTGACCATTCTTCGCTTCTTTGCGCTTGCCTTCTTATGACCGCCTATTGTTGTTACTTAAGTCTATACGCGCTTAAGTGCTATCAGAGGACATGACGTCCAGACCACGTATAGAGAAACCCACGGCGCAGAATGAGAGGAACATGACTTAGACCAATCAGTGACATGTAATTTTGAACTAAGCAACTACCATTACCGTAATACAACCGGAATGTTGACCTTGCTGCAGCAACTAGAGTCACGGTGATAGTCATACCACTGACCGACGGTGGCTTTGTTTGATGGACACGCACGAAATATTGTCGGTTACTATGGTAGAGCTGGAAGGTCAACTAAGGTGCTCTGCCCTTCACATGAGCTGAAGGCGTCACGGTCATGCCGGTTGCCTGTCATAGTTGTGATCTTGTAAGTGACGTAAAGTAATTGGTACGTGCAGGCGGTACTTCCTTCTAGGTCACATGCTTACGATACTGCTGACCCACTGAACACAGCGAAGGAGTCGGGAATTACATAGCACGGTACTTCCTGCCTCCGCTCGCTCCTGCCTTCTCGGCATCCAGCGTGAAGTGGTATCTCAGCACTTTGGTCCCTGCCCGATGTCTAAGTCCAGTCTGCATCTTCATCATCGAGATAAGGTAGTCACAATAGAGCGTCAGTTCTAAGCGTCAGGTCTTTAACTTTAAGACGCGACCAGTCAACGTTGAACAGTGATTCACGTAAGGTCGCCTCAGTAAACCACAGGTCCGGCACTTTTACTAGCATTGTAGGATTTGACAGTAAGGCGACCGTAATACTTTCATATAATAAGTCAATTCGGCTGAACTCAACCTACGATGTCGTCCCAGAGCTTAGTACTACATACACTATATGATCAAATCTACGTGACATAGGGATATCGATAAGGATAATCTAATCCATCACGATCATATCTGAATCTAATAGCAGCAGGAAAGCGCGGAGAGGCAGGTGCAGGTTTCTATAGTTGTATTTACAGCCGGTGAGATAAACGGCAACTTCATAGAAAGTGGGCTCCACCAAACATCTATAAGGTCAAAAATTCCTGCTTCCTGCGGCTCCTGCACGAGTGCACGTATTCAGCTCATTGCTTACCATCTAAGTTGATGCTGCATAGATAGCCATATTTAGAAGACGTTCACGTATCCTTAATATTTGTTTAACGTGGTCGGAGCAGTAAGGATAGGGGATTCACACACATCATGGGTAACGAGTTTTCTACATACACGCTGCATGACATCTTAAGGATAGGTTTTTCAGTGAATAACTCAGGGAATACAGAATCACCAAGCACGCTGCCATAGTTAAGGAACGCTGCCTTTACGCTGCGACGCGTCTGAGGAGGAAATAACAGGGGCATTACCAGCTTTACAGGCAAATCCCCGGTTAACTTTGATTCTACTTAGATTTGACCGTGGCCTTCATAGCCTTCCTTGGCATACGCAGCGATAGCACGAGGCACCGAAGGGAATGGTACCGGTGAAGCAACGGGTTTAATAATTTAAGCGTAAGAGCACCGTTACTGAGGTACGGAGGCGATTTTCAACGGGTGAGTAAGACTTCTCTCTCCTTCTCGCTTCCTCGGCACGGTGACCTCAGAGTCACACCGTCATAAGATGACTTCAGATGTAGCTCAGCAAACATTACCCAGAAATTTTCGGAGCAGATGGTCAGTGTCTCACGCTTAAGTGCCGCATACCTAAACAAAATCAGTAAAAGGCTGGAGTGCAACGGGGCACGCTGTCAGCATAGCTGATATTTTCCAGGTCATCAAACACGTCTACAGACTAATATGACGAGCAGGATGTAATGGCTGTAGTTCCCATACCCGGTATCGTTTCATACTCAGGGTGAATGAGCATCGAACAGTACCCAAACCACTACAGGCCTCCCCGTTATTGCCTTCATCCGATATGTCCGTCATGGGCTGCCACACCGGCAGAGACGAAACGCCGTCGGCAGTACACAATTCACATCACCACGTGAGTGCAAGTGATGTAAGTATGCAGCATGAGAAGAAGGAGGAAGTCAGAAGTATCCCAGAATCACGGTATCCATGCTAGCATCTAAGGCCCGTTTACTTTAAGTCACACTTCCCCGTCAGGCTGTCTGACGGCTTCCTCCTTCTCTCGGCCTCTTCTCGGCCACACGAGCGCCATTCTTCTTTCGTCCGTCAGGCTGACATCACGTTCGGTCGATGTCATAGAGCGGAGACGGCGTAAATCATGATGTCGTCATGGATCCTCCACAGAAATAGCTAACGGTTACGAGTTGTACGACGCATACATAGATAGAGCAGCATCAGGCTGCTGACTGAATCATGGTAAACACGGATCAGTGGTTCGCCGGAGTCATAGCTGAGAAAGCGATTATTAAGTCACGCTTGCTGTCCCGATCCTGAATGCAGTCATAGGTAGCGACAATCAACCTGTCGCTGAGCTCTCATACGTGTTTGTCTACGGAAGTTCTTTACCGTTTCACGTACTGTTAGGAATAACTAAAGATGGCCATCTGGTAATAAGCCCTTATAGACACCGTCGCAGTCGCATAGGCGCAGCTCGAAGCGAGTAAGACGCCTATATCTAGTCTCTTGACGGCTTTGGAATAGAACGGAACATGTCAGGTCAGCTCAATTTGACACTACATGGCGTCGCCCCTTCTCGCGTTCGATGGTGTCGGTCGGTATACGTAAATGTCACCAATTGCTCTATACGTGCTCAGGACTGCGTATTACTATGCGCACTTAGCCATCACTAACGGATCGAAGGCTTCACGGTCATGTAGTATTGCCCTTAATAAAGCAGAAATGCCTGCATCTGTCGACTGAGCAAGGCCAGCTCGTAATTCTGCATGAGTCGGTCCATGAGAAGTGACAGGTACAGATTCTGCCAATGTCCTCATGCAGGGCGACGATGATGCCGTGGTTCATGCTTCATGATGGGCTAAATATCTAAGCGTAATTCAGGTGGAGCTCACAGGGAACGATAACTACGGAAACACGGGCGAAACATACAGGTTTACCAGTCAGAGGCAACGGAGAGAAGCGCGGGCGAGGAAGGTATCACGGAAAAGGACGTAAGAAACAGTAAGATCAACTTAGTCCTGCCGGTTAAGAGCGTGGCGGTTGTGGTACTAACATTCAAAAGGGCTGAAAATTCCTTGCGCTCGTAGCGGTCCTGCCGTTCAGCAAACGGTACCTACGTTTTGGTCGTCGCTGAGCACGGCCCAGCACATCCTCAACGAACGTAGGGACTTGTCAGAACGTAAGCGGTAGGCTTGGTAAGCATAACCGCAAGAATGCCAACGGCAGAGACGTCGGTGGTGCCATCCCACGCATCAGCTTACGGCTGAGGTCCATCAGCGTCATTTAAGAAGTGCCCTGATCCACCTATCGAGGGTCCTTATCAGCCGTATACTGTTGCCCTTAGGCTGGTAATGGTAAAGGTTTCTTTGCCTGATAACTTGATAACTGTGTCAGCTAAATCGTAGACCGATCACCATCCCGTACCTGCAGCCGTAGTGGGACGCAAGGAGGAATAAGCGCGCATTAATATCTGTCTTAAGAATGCGGCGGCCGTTCACGGTCATACCGGGGTTTCTGCCAGCACGCGTCCTGTTGTCGCGTCGTGAGCCTCTCACAGTTGAGCATTCGCCATAATGCGGCTGTTTCCTTCTGCTCCTGCTTCTCGTGAGGCGTTCGTCCGGCTGCGTCACCAAAGCAGTTCACCGTCTAAGGCTAAAAGTCCAATAGTTATGCGGGGTCGCTGGAGACCGTAATTGATCTTTGGTACGTAGATAGCAGATTAACGTGATCTCCTGCATACGCTCGGTGGTACAATACAGTGATATTTAAGTCGGCATAAGTCGCTGCGGTAGACCTATAGTACATGTACTGCGGCTCTAAGTGTACAATATGCACGGACAGCTTATATTACGTTGTGCGCAACATCTGATATTGCGTCCGTAAATGCAGTGTCGCCGGACGTCATCCGGAAGATGAGGTGATGCCATCACTTATTATCGTCCGCTGTAATCAGGGTCATTCCACACCCTGTTTCTCAGCAGTACACGTAATTACGGAGAGAGAGGAAGCGATGGAGGAATGCTCTACCGGGAGCGGCGACCAACTCTGCTTCAGTCATGTCACGTGGCAAGCAACAGGACTAATCTACAGTTTATGTTAGCAAGGGCATGTCAGCGTAATGCCCTCGTGCCTTCCCACGGCTTGTCCATGTAGAGCAGAATGCCGTCATTAAGATCGCTGGCAGCCTGTTTAAAGGGAGATCGTTGTCTCAGTCGACGTACCCCAGTACGGCTGCATGCAGCCCGTCCAGCTCACCGTGCCGGACAAGCAGCACGGCTGCCGTTCATCTGATAACTTAGGCCTGTCGTGGTCCGTCATCATACAGCGTAATGCCAGCGTCGCTTAGCCTCGCTGGCAGTCAGCTTCGCCGACACCGATACGTCAGGCTGATCTAAACATGGCTGCAGGCACAAACGCAACCTAGATAGCGAGGTTCATCATTAAGGGCTCATTAAAGGCCATGCTGGCAATATGCGGAGATTACTAAGCTCTGATGTCTATATTCTCCTCTCTGTTGATTGATCAGGAATAAATCAAAGTGCTGCAGCCGGAATAGGAGCAGAAGGAGGCACGGCGCATTGTTTCACGGACTTATGGCAAATTTCTGATATAGTACTTTACTAGGTTTTTGCGCCTCTTCTCCTGCCTCTCTTCTAAAGCTTCTGAGACAACCATCTGATGTCTTCAGACCGTAAGCTATCCAGTCTAAGTCCCCAAGCACTGCGGGCTTCCTGAAAACTGAAGCGCTTTGAAGGTAATCAGAATGAACGATGGCTCTTCCATAAGAACATCTGGCTCGCCTGACGCATGCGACGAATTTTCACCTAGATAAAGTACTCCAATACTGGGTCGGACTGGCCGTCGTCGTGGAGTAGGTATGGCGTAATTCCGGAAGCGGTAAGCCAGAGACATCATGAGCATCTACCAAGCAGTACTGCTCAACACGAGTAGCCGTTATCGGTGGGCCTCTACGTCTGCAGGTATTCAGTGATACAGGCATCATGCTGCGGTACCTTTGGCCTCCAGCCGACCGGGGTGCGTAATACGGCATTTGACCAATCCAGCTCAGCGTCGCCCTATGCTCCTCTGTGTTCTAGCCAGAAGACGCAGAGGGAGGAAGCGAGCAGGAGGTACCTTCACGGCTATGCACTTCCCTTCTTCCATAAGTCGGATATGTCATGGAATAATAGCTGTAAACATTTAGCACTAGAGTCTGCCCGTCTGACACGGTTCAAAACGTGAATGAACGGAGGCGCCGGGTAACTCACGGGGTATCATGTCACTTTCTGCGGCATCCAGCCAGGATACCCGTCCTCTATGACGTAATATCCCAGCACGCTACATGTCATTAACTTAGACATGCACGGCAGTCGTCTATGTTGTCATTATTGTTTAGTGCTGATGCGGTCGGGCTGACCATCAGAACTTGTCACGGAAAGCCGCGACGAACTGGTATCCCAGGCTGACGAACAGTCATAATTAGCGGTACAGTCGCCGAATCATCATGGTAACGTGCGTTTCACCAACGTCAATGCAGCAGTCAATAGGGCACTCTTCATGCCGCTTCACTGGGGAAAAGCACGGCTTCTTCCTCCCATGCCAGATAGCCAGCGGGAGTATGACGGAGCTAAAGACCGACGATATGATCTGATGCAGCTGGATGGCGTTTATTGGAGAGGCCACGGAGGGGCATCGGAAGAAATTGTCAACTCGCTGCTCCCTTCTCCTGCTTCCCAACTGCCCTCAAACGCTGCTCTCATGCTGGACTATTCTAGATAGCGGTCGGCCGTCAGACAGTGGGAATGGTGGCGTTTTCATACATAAATCCTGCAGTACCCGGGTCGCTGTGTCATGCCGGTCGCACTTCAGCGGCAATATATTTTAGTCACGCATATAGTCAACTCTAAGTGCGTCGTCTTCTGTACTGTTAGCCAGGTTACCTGTCATCAGTATCATGCAGTGCTGAAGCATGAAAGTTCTTCTTCTAGCGTCATTCACTCTCCGCGGATAAGGCACGGCGTAATCTGCCATGTTCTTGTTTATTGATGCTAATACTCTTCTGCAGGCTCGCCAGCAGGACTGAGATCCAGCTGCCAGCGGAAATACTGATGCCAGGCCTCAGCGCATAAAGCAGTCGATGCTCATTGGGTCGCTTTTATGTCACAGTATTTTGCCTGCCATCATAAGTCGACCTGCTGTTGGTCAGGAGGCGAGCGGAGAATGAATGGAGGCGAGAGTTATTTAGAATGAACGGACCGGGAAGCTTCTCGCTTCGGGGTGCGGCTTCCTAGTGATGCTGTCACGGTATCGGTAAGTCAATCATGGTAGCGTTTGTTTCGTGGGATGCTCTAAGCTTCGTAGACGGTTTAGCCGTAATGGGGATAGTCTCGAACAGCCCAGTTTTAGAGCGTCATACAAGTGGTAATCCCGGCCCAGTGGCTTCCATCGGATATGACATTCTGCACCATTCGGCGGTATAGTTTTATTGATGGCCTCATCACGCATGATAGTCGTTGTCATCGTCGTGAGGCCATAATAATCTGCTTCAAGAGCCAGCTTCTACGGCCCCCATCCCCATACGGATTTGGTCGTCAGAGGGAGTCGATACCGTCAGTACTACAAGTCAGGAAAGCCTATGAATAATGCTCTTTCATGGTTAATACTTCAGCATGTAAAAGTTCATTTTCGCCTCCACGTTGTACCGAGCGTGGTGTTAGGAAGAACCGAGAGGCATGAAGGAGCTCCCCGTATGCCGGCTGGAGTGCCATGTCACAATGTGATCACTATGTCAACGGCTGCAATGGTCGCTTCGCCCCTTCTCCGCTCCAAACAGAGAATGCCAGATCTACCAGTACGTCCGGTCTTCTAAGATAACGGCGATCAGTAAATCAGTAGTGCTGGCCGGATGACTAAGCATTATTAGGCTGGCAGATAAAACACAGCCGGAGGGTACTCAGGCGTCATTGAGGCCAACGGCGTCTCTTTGTCGCCAATTACACTGCTCCTCAGCAATGCGGCACAGGCAACATGAACGCATAAATTAGGATTAACTGGCTGCAATAGTAAGTGACACTATGCTCTCACTTTGTCGTGGATAGATGGACTTTACAGACGAGCCTTCAATACGCTTACCCAGGAACGTCGGAGAGCCTTCCTGTTCAATATCAGTAAAGCAGCAAGTCCATATACCTAATACTAATGACCGAATGGAGGCTTATACCGCAGCCAGAGGAATAAGGGACTCAGTTATCAACGCTTCATGGTGCCGTGTTATCTAAGGTGCTTTACATACCAAGGGCCATGAGCAGGACGGAATATCGCTGCTCCTCTATTCCTTCTCTAGTCTCCGGCATCATCGTCGGCAACCAATAAGGGTGTTGCCTATGCTTATGCTCTATAACGGCTACCAACAGCATTTAGGAATAACCGACTATAAGCTGTACGATTCACCCACTGTATTACCTTGCCCCATCGCATTCATGATGAGCGCTGAAAGGCAGTATTCAGCCTTCGTATGCGGATTTCTTCGGAGATATAATTAAGTGGCCCATTCAACAGCGTTCTGTGGCTGCTATGAACATGAGCGACCCGGCGGACAACTTAGAGGCCCTTTATACTTAACTTCATCTGTCACTGATACCAAGTGTATCATTCAGCCGTCCGGCGCTGCTTTGTTGTTGGCTTTGATGAGCGGAATGGGAAGAATAGAGTGGAGCGGGTATTGACGCCGTGCACCGACCTAGAGCCGTCGAGAATACTGGCAATTTACCTGCGATCCAGCACAGCACGAAAGTACAGAATGCTTCCTATTCAAGAATCTGATGTCGTTTGTAATGTGGGTCATGCGCTTAGTCGGCGTTCCTTCTCCTCCTCTTCTGAGACTCGCAGCCTGATAGGGTCGTCTTCACTCTAAGCGCCTCATCTTCGTTCACTTCATCATCCCTTTCTGATACCATTTTTATGACGACCGGTGCAGAGTCATAACCACTACGCTTACCTGCCACCGCTCGCAACGGCATTCCTGTTCTGGTCGGATCTGATCAGATACTCACGAAATGTCAGCTCATGCTTTTGTTGACTTTCCATTGTTCGGTTTCACGGACAAACAGAAAGGAAATAAGAGCTAAAGGCCTTCATAGTGGTTCCTTCTTTCCAGGTATTTAAATAACATTAAGTATGACGAAGAAGAACGCAACGGTGAGGAAGCGCAATACCGCTACAATTATAAAATTAGAGCCCTCAGAGACCCG	*	tp:A:P	cm:i:27	s1:i:177	s2:i:0	NM:i:1735	ms:i:538	AS:i:430	nn:i:0
+8	0	utg000001l	20836	60	22S9M2I57M2D11M2I2M1D15M4D17M1I15M1D3M1D3M1I24M2I8M2I9M2I24M3I21M2D31M1D20M1I6M1D10M1D20M2I7M1D13M1I7M4D6M1D22M2I7M3I46M2D6M1I17M1D8M1D27M1I2M2D21M1D11M1D3M1D13M2D9M1D11M3D7M1D25M1I5M1I7M1I6M1I34M2D13M1I3M1D4M1D10M3I2M1I4M6D39M2I13M3D4M2D5M1D2M1D4M1I25M1I17M3I15M1D33M2I4M3D6M2D12M3D7M1D4M1D13M3D4M1D13M1I6M1D12M1I8M1I4M2D4M1I12M1I26M1D15M1I13M1I6M1I22M3I1M1D8M2I11M2I10M2D18M2D46M1D13M1I6M3I12M4D2M1D14M1I11M1I17M2I7M1I8M2D14M1I10M1I8M1I18M1I3M1D4M1D5M3D21M1I2M1I21M1D17M2D23M1I23M1D13M1D1M1D3M1D18M2D10M4D3M2D32M1D3M2D3M1I15M4D2M2D3M22D39M1D33M5I5M1I7M6I4M2I6M2I9M1I3M1D2M1D6M3I6M2I6M1D11M1D18M6D4M1D15M1I23M2D6M1I7M1I13M1D12M2D15M1I1M1I6M2D23M1D7M1I7M7I3M1D6M1D4M7I9M1I7M1D10M1D20M1D11M2I12M1D5M1D5M2D35M1D10M13I6M1D6M1I1M2I8M4I2M2I8M3I1M1D7M1I10M2I6M1I7M1D4M3I6M2I8M1I10M1I2M2I8M1I10M3I6M1I4M3I3M3I3M5I7M1I8M1D25M1D9M2I8M1I4M3I4M1I10M1I5M1I11M1I8M6I1M1I3M2I8M5I6M1I6M2I2M1I25M4I2M6I8M4I6M3I4M7I29M2I10M2I10M2I12M1D18M1D5M1I29M2I4M1I4M1I3M1I15M2I4M1I3M1D1M1D5M2I7M2I1M1D5M4D2M1I4M2I1M1D9M1D1M2D5M4D65M1I9M7I4M1I11M2D3M2D1M1D5M4D6M1D6M1I4M7I1M2I3M3I2M3I3M1I19M1I11M1I14M1I13M1I3M5I1M1D7M2I7M2I6M2D4M2D6M3D3M3D9M7I2M2D7M1D4M3I1M1I8M6D12M1I4M1D7M1I2M1I2M1I2M1I7M1D8M4I7M1D8M1I16M1D9M1I7M1I14M1I1M1I6M7I8M3D7M3I3M4I4M4D10M4I12M9I20M2D1M1I7M1D3M2I1M1I9M1I9M2I2M1D6M1I15M1D3M3I5M1D40M1I1M1I11M7I5M2I9M1D5M2D17M1D3M4I2M1I16M1I10M1I2M1I1M1I13M1I1M1I7M2I1M1I4M1D25M2I4M2I10M1D18M1I19M3D4M3I13M1I16M3I37M1D19M2D2M1D2M1I8M9I8M1I12M1I3M1D19M1D15M1I9M1I6M1I13M2I16M2I2M1I7M9I46M1D1M1D4M2D27M2I5M3D23M2I30M2I1M1D9M1I39M1I10M1I14M5I16M1D1M4D10M4I1M1I6M1D13M2D8M1I2M2I24M4I2M3I4M2D4M1I2M2D3M2I1M1D3M1D3M1D3M1D1M2I19M1I7M1D10M1D15M1I8M1I7M1I3M1I3M2I9M1D3M1D11M2I2M1I4M1D11M1I8M2I3M2I1M1D4M1I3M2I7M3I17M1D15M2I2M1I2M1D3M1I16M1I4M1I8M1I4M2I15M1D5M1D10M1I13M2I10M1I15M1I13M1I11M3I2M1D22M1I15M1I9M1I14M2I5M1I10M6I2M3I5M3I2M1I1M1I19M1D15M4D15M2I21M1D10M2I13M1D39M1I14M1I11M1I11M1D4M1D1M1D11M2I4M2I4M1I2M4I6M3I3M1I9M1I15M1I15M1D9M1I21M1I36M3I4M1I6M1I3M1I1M1I20M1I1M1I3M2I3M1I4M6D6M2I8M1I2M2I15M2D6M1I2M1I10M1I12M1D5M1D7M1D1M3I6M1I8M4I8M1I10M5I2M1D12M1I5M2I24M2I11M1D5M2I14M1I3M1I4M7I1M1I9M1D14M2D4M1I6M4I1M1I5M1D11M3D3M1I4M1I3M2I6M1I7M2I2M1I6M1I1M2I18M2D7M1I1M2I5M2I5M1I15M4I38M2I15M2I4M1I21M2I7M1I7M1D2M1I22M1I2M2D12M2D2M5D6M1I3M6I4M4I4M6D5M2D5M2D7M1I5M1D10M1I11M1D1M1D5M1I22M1D16M2I6M1I4M1I16M2I12M1I29M1D13M1D10M1D5M2D3M1D6M1D20M1I6M1D3M1D18M7I17M5I3M1I20M1I5M1D7M2D4M1I3M2I27M2I26M2I4M3I6M6I6M1I12M4I29M2I6M1D2M2I15M1D7M1I6M4I1M1D20M3D3M1D5M3I17M1I6M1D13M2D2M4I2M4I4M3I22M1I4M1D36M3D13M3D13M1I3M1I10M1I2M2D10M3D7M1I1M1I3M4D2M1D6M2I11M3I2M1I4M1I9M3I8M2I11M3I2M4I33M3I14M1I1M2I21M4I4M1I7M1I1M3I4M1I3M2I4M2D2M1I6M1I10M2D10M3I2M1D5M1D2M1D16M1I23M2I7M1I13M2I2M3I23M3D6M1I2M2I3M2I2M4I14M1I2M3I3M2D4M2I5M6I24M1I9M1I7M1I20M2D18M1D3M1D14M8D9M1D26M1I7M8I2M1D17M1I14M1I5M1I3M1D24M1D9M4I37M1D19M3I18M1D11M1I6M1D2M1D4M2D2M1D18M3I9M2I1M1D9M1D4M2I29M4I9M2D10M1D9M2I8M7I17M4I6M2I21M1D19M3I15M4I2M3I7M3D7M1D17M5D18M3I7M1D12M2D24M1I4M3D11M1D10M1I21M2I11M7I3M1I7M1I2M4I1M2I9M2D1M1I9M1D18M1D11M2D3M2D23M1I5M2D3M1I6M2D4M2D21M2I1M1I14M2D22M1I45M4D11M2I6M1I59M1I2M2D4M1D3M2D8M3I6M2D12M1I11M1I8M2D6M1D10M1I5M1D3M1I6M1D2M2I3M4I13M4I10M2D17M1I26M1D3M3D10M3D19M2I18M1I28M1I13M1D11M2I3M2D7M1I2M1I3M2I17M3I5M1D27M1I2M2I4M2D9M2I1M1I13M1I31M1I6M2I9M4I14M2D7M3I15M1D35M2I3M1D9M1I1M2D19M1D4M3I6M1I6M1I8M1I17M1D10M1D10M1I3M4I2M1D6M2I20M1I21M3I46M4I14M2I1M1I7M4I4M2D5M1I3M1I13M1D12M1D4M2I7M1D4M1I2M1I1M1I4M1I3M4D3M1D6M1I12M1D17M2I9M2D3M2D14M1I11M2D5M2D3M2I1M1I3M1I33M1I10M3I19M1D6M2I4M1I11M3I5M1D12M1D9M2I6M4I9M1I15M1D12M1D1M2I6M2I2M1I4M1D22M1I11M1I9M2D1M1I12M3I12M1I18M3D3M3I17M1I12M1I17M8I14M5D2M4D15M2I29M1D6M4D13M1I5M1I2M2I7M1D16M3D26M4I10M2I8M3D10M3D11M2I2M1I12M1D10M1I18M2D11M1I24M6D1M2D4M2I7M1D20M3D2M2I3M1I1M1I7M1D14M1I4M1D15M1D15M1I7M3D5M1I29M1D7M1D13M1D11M1I9M1I3M1I13M2I2M1I39M2D8M1I28M1I6M1D5M1D3M3I17M1I3M1I13M2I5M1D1M2D8M6I7M3D2M1I7M3I6M1I8M1D13M3D4M1I9M12S	*	0	0	ATTGGGTGCTTGGTGTTAACCTTATCTATCGCTTATTAGTACTTGAAACGGTTCTTCAGAACCCTGAAGTCGCTAATCGTTCGGCGATACTATATGCATTAATAGACTATATCGTTGGTATAAACAGTGCACCATGCAACATGAATAACAGTGGGTTATCCAAAGGAAGCAGAAAGCTAAATATGGGGAAAACTACAATACGATGCCCCGTTAAGTTCAATACTACTAATTTTGTAGATGGAAAACGTATGTAATAGAGAGTAACTTAAAGAGAGATCCTGTGTTGAGCCAAATAAATTGCGGTTATTTTAATAAATTAAGGGTTACTATATGTTGGAGTTTAGTGTTATTGAAGAGGCGGGTATAATTCCTGCAGTAGAAAATAAGGCATTCCTACGAGCAGATGGTTGCACGAATGACTATTCCTTTGTTACAATGTTTTATCTTACTGTCTTTGATGGCTGCATGTGAAAATGCGATATCGAAATGTTAAATTGGTTTTGTAGTCAAAAGAAGAAGTAAGCACTTATTCATTAATAGATAAATTCAGTCAACTCCTGAAATGTTTTCCTTAGGTGAAAGCATTGACTATGTTAATCTCAGCAAATTAAGCGATGGTTTAAACATAAACCTTCTTTAAAGCCTATTCAGGATTTAGTAGTATGGCCAAATCGATTAGCCGACATTGAAGATGAAGCGTCCTTAACATCGCCGTCATGAGGGGTAACTCTTTCAGAAATTCATGGACAGTTCGCACGTGTGTTAAATGGTTCAGAATTGTCAGATTCCACTTTTCATTTAATAGAAAGGATGCTCCCGGATTCAGTGATTATATAACTACGTTGAGGTGACGGTTAATTCTATGCCCAGCACGAACATTCATGTGCTTTATCGGGCGGAATGGGTGTAAAACACGACCGTTGAATGGAATGATTGGTGCAATCACCAACCCAGAAATAATGAATAGTTTTCTCTGGAAAATAAGTAGACTTATCGAGGTCAAGAATCCCAAAGGGATATTTTCGATCGCTTGTTTCAGTTTCGTTTAGTGCATTTTAATGCTTTTACTCCTCCTAAAGAACAACCTGATACCCAGCAAAGGTACACAATACTTTTATATTGGACTCAAGAATGCTGCCAGCAATAGTTTAAAGGGTACTAGGCGATCTCCGGTTAGAATTCATTTCAGCATTTATTGGTTGTATGGTGAGAGTAGATAGAAAGACAACTCTGGCTTTGAAGCTATCAAAAACTAAGTAGTGATGAAAACTTTTCCAAATATGGAACTCATCAGCCTCCATTTCTAAATATGAAGAGTTAAGACGTAATGAACCACACCAATTCAAGTGGACGATGATAAATTCACTAAATTGTTTTATGACAATATCCGAAATATGCTTCGAATGAGCTCTGACATGCAATTGTTTTATTTACTATCACAAGATTAGTAGATGTCGTTGTGAAAGTCATTAGTTTTATTCGATGAACCAGAGGTTCATCTGCATCATTTGCTCTCTGCTTTTACGAACATTAAGCGACTTACTCGATGCACGCAATGGTGGCAATAATTGCAACTCATTCCCCAGTAGTACTGCAAGAGGTTCCAAATCCTGCATGTGGAAGGTCCTACGTCAAGAGAAGCAATAAATATTATCCGTCCGGGTTATTGAGACATTCGGTGAGAACTTAGTTTTGTAACTCGTGAGGTGTTTTACTTGAAGTGACAATTCTGGATACCACCACTTATGCAGTCCGTTGATTCAGAGCTTTCTTATGAAACCATTCTAAATTATAATGGTCAGATAGGATTAGAAGTCGAACCGTTTAAAGCGATACCTCATCAGATGAACAGAGATGAAGGTAAAGTACAATGAAAACTACCTCTTCCGCGCGGGAGCAGAACTTAGCTAAGAGAGAGAAATGCTTAATAAATGCTCGGAAGGTATGATGCAGATAAATGTTAGAAATAATTTCGCATTACTCACTTCCCACTTTGCAGAAGAACAACAATATAGAATATTAAGCTCGACAGGTCAGTTATTTACCTACGACAGGACACCCTCTTACAGCCCTACAACCTTAGTAGTTGGTAAGTGGACAAAGGTTAAATTAGAAAAGCTTTATGAAAATAATCTCCAGATAAAACAAACCCGCTAGAACATATTACGATGACATGCTTGTTTCATCAGGTGAAAAATGTCCATTTTGTGGTGATATAGAACAGACAAATATAGATCATTTCTTCCTATTGCACATTATCCTGAATTTTCGGCTTACTGCCTATTAATTTAGTTCCATCGTGCCGCGACTGCAATATGGGAGAGAAAGGTCAAGTTTTCGCAGTAGATGAGGTACACCAAGCGATTCATCCCTATCGACAAGGACATTTTTCGTGAGCAATGTCGGGTATATCCAAATTTCACGGGTTTCCTAGAACTCCGGCTGCTATCAGTTTTATGTTGAATGCCCGGCGACTCTGGAGGCAGGAAGACAAACACAGAGCTCTTCATCATTCAAGCTATTAAATATTGCTAACAGGTATCGTTTTAGAGGCAGGAAAGCACACTTGAAGTGAAGTGATCAAAGGAAACTCTTTCGTAAAGTTATAGGAAATATAGTTCAACCGCAACGTTTCAGCAGCTACAGTCACCAGAATTTATTGAAGCAAATCTGAAACCTATTATAGATTTGAATGACTTCCCCAATTATTGGAAAGAGTCGTATCAGTGCCTAGCAAAACTCGAAAGATTTTCAGAGGGATGTAGAATATGATGAAAGAGAAAATTACGACGCTTATCGGAAGTGAACGAATACTTTTATGAGGGAGGCTGTTTGTACAAATCGGTAGTAACTTGCTAACCAATTCCGGCGGTGGCAGCCAGAGTGGCAACAGTGCAGCAGGCGAAGGTTGTAATGTCCGCTCCGGCACAGCAGTTCTAGGGACAGTGGCGTACAGTCATAGATACGTCGTGGGGAGGTGGTCACAAATTCTCATGCAAAATACTGTAAATCGGTAGCAACTGGAAATCATTCAACACCGCACTATCGGAAGTTCACCAGCCAGCCGCAGCACGTTCCTGCAAGTACGACGTGTAGTCCGGCTCTAATATCTCCTATGAGCAACGTGTTAGCAGAGCCAAGCCACAACTCTAATTTAATACATAATGAATGATAATAATATAATAAAATTTCCTGTGTAACTAATTGTTTATGGTTTCTGATAAGAATCATGCAAAAGATCAAACAACTTGTATTACATTGACAGTTAAGCAGTTAATTTATCACCCTAACTATATCAGCATCTAGCATGCAACGCATCGACAAAATGGAGTTTTATGACTAAAACCATGGGAAGAAGACTTAAAGATTTATCGCACTTGCTCAAATGCTGCACTTGATAATATTTTGACTCCTGAATTATTTCGCTTGAATTTGAATCTAATTCCTCCAAACCGCAGAACAGTAACATTTATTATTTAAAAACAAAACCAGATTGAGGATATGACATTTGGTATGACAATAATGTTATTGAAGCAAATGGAAAATGATCCATTAATGGCTTGGCTAAATTCCGCAATACGATAGAAAACAAGGCGATTTAGAAATGTATAGTAGCGAGGCAAAAAGGCTACTCTTATTTCATGTACATTGAAGAAATGACATTGAGTTATTACAAATGAAAGTATGTTAAACATTGGTAAAAAGTTAGTCAGACTTGCACAAAGAAATTACCTTCATATTTAACTGAATCATCTATTATTAAATCAGAAAGACGATGGGTCGCTAATCCTAAAGATTACGAATTATTACATGCCTTAGCTATAATCGGCAGAATGTATAACTGCTGTAACTCTCTTGGCATACAAATAAACAATCCAATGGACTACGATGTGATTTCGCCAACATCATTCGACTCTTTATTTGATGAAGCCAGAGAATAACTTATTTAAAATTAAAGATCACTCCATAAGCAAATTGTCATTAGCATGATACAATATGACAATAAATAATTCCTGAATATTAAAGGAGCGTCTAAAACTGTAGATAAGCCTAAATATCATTGGGACAGAAGTTAGTTGACTATACAATGTCACAAGCTTTAAGAAACGACTTTTAAAGGACGGTTATCACATTCAAACATTAATTTTATGATAAACAATTCCATCCAATTGATTTAATCAATACAACATTTGAAGATCAAGCAGATAAATATATTTTGGCGTTATGCAGCTGACAGAGCCCCAAAATAACAAATGCCTATGGCTTCATTTGGATATCAGAGCTATGAGCCAGAAAAGCAAGCATCTACTCCAATAAACCAATACATACAATGCCAATTATAGATGAAGACTTCAGGTAATGTGGAATTGATTCAATAAAGATAATCAAAATGTATTTCATGGAAAAATAGTTAGAGAAAACGAAGAAAAACCGACTTTAGAAAACATCAACAGCATAACTCAAACATGACGAAAAACCATATTTCATGCGTTCAGTTCTTAAAGGCAATTGGCGAACCTTGTGGCTTAAACACTATGAATGAACAATTGAGTCATAGAACTTCCATTATTCTCCTGAAGATAATAATCGCCAAATAAACCAATACTCAGCTTACAATATACTAACTAACCGCATGACGTTATTTCATACAACGTTTCTGCGGCAGCTCACAAACGATTACTCCATAACATAGGACAGCAGGCCACTCAATATCAGGTGCAGTTGATGTATCAACACGGTTCGAGCCCCCAATACCGTCGACTTCCTTCCAGGGCTTCCAGCAACGAGGTTTCTTCCTTCGTTTGATTCAGATCTGCAGCATCCTGAAGCGGGGCAATATGCTCACTGGCTACCTGCATCAGGCTTTTTGTTTCTTCCGCCTCCCGGATCTCGGAACAGTTTTTCTGCTTCCGTGGTTCCTTCACGAGCGTTGCCGTTCCACTTCTGATATTCCCTCCCATGAGATAACCGAACACACTTTTCCGGTAACGACTGAGTTCAGAAATAAAGATAACGCGTCGCCGGAAGCAACCCACGTCATAGACGGTTTTACCCCGAGCGATGGTCTTCAACGAGACATGCCACGATGCCTCATCACTGTTGGAAAACAGCCACAAAGCCGCAGCCGGAATATCTGGCGCTTGCAATATCGGTACTGTTTGCAGGCAGACGGTATGAGGCGGAATATATGCGTCACCTTCACCAATAAATTCATTAGTTCCGGCCAGCATATTATAAATTTATGGTCCGTGGTTGTTCACTCATTCGAATGCCATTATGCAAGCCTCACAATATAGTTAAATGCAATGTGGAGTTGACGGTGTTTCCGCGTTACCCGCAGCGTTAACGGTGATGTGTCCGTGTGAACCGGGATACCTGAAAGAATGGGCATGAGCACCCGATAACAAACCGGATGCCTGGTGCGCACCAATACCAACTGTATGCGCATGTGCACTAAGCACTGAGGGGCGACTTATGGGACAATGAGTACTGTCTCGGTGAACTGTCGTTCGATAATAAAGCAGGCATCTTGTGCTGCTTCCTTTAACTGTGATAAACTTCCTGTAATGGTTAGCCTGTTCTCATACCTGACTCCAGCCAGAAATCTGTTCATCCTTAAAACCACTTGTGGGCATGAGCACCGCGGCCCCTGTTGAACCGCTCAGACTGTGAGCATGATCCGCGGTTATTCGTCGATTTGGTGCTCGTAATGAAACTGCCTGTTGTTTTCCTTTTTATGCGGCGTAATCAAACCACGCCGGCTTAGTTTTCGTCCCCCAAATCCGTACCGGATGCACTGGCACCTTGGGTGTGCGACTTAATTCAGCATCCTGTTCCTGAGACAATACAGCACGAACGCTGGCGGGTTTCCCCTTGATGTCCAGCCTCGAGGCGCATATCAGGAGGAAGCACACCCGATGAATACGCGACAGCAAGTTTTGTAGTAGGCTGATTTGTCAAACGCCGCCTGCCCCTGCATCAGGACTTAGCCAGACGGAACGATATTGATGACCACGGGATCGGCGCACCTGCCGAGACCCGAATTCTCACCGGCCCCAAGGTATTCATAAGAACATCTGCAACGGAATTTTGCCAGAATATCCCTGCCAACCTGAGTCAGTTCAGTCAGGCTGGCATGAATTTCCGCGACCGCGGTAATTTATTTTTCGCCGTGGAAAGCCCTGCCAGCGCCGTCAGTGTCGCATTCTTCGGTTGTTTACCCGCAGGGCCGCGTTAGTCATGGTGGCTAAATCTGGATCATTCCCGGCAGCGCTGCGGCCAGTTCATTCAGCGTATTCAGTGCGTCGATAGGTGACGCGTCGATACTCATCTGCAATCGCGGCCAGTCAACAAAGCGGTGTTCGCATCGGTATGATGTTTGTTGCGGCTCCGCTTTGGTGCTGTTGGCGTTCCGGTCATGCCGGCTACGTCGATGGGCTTTCTCTGTTCGTTTCATCCATTACCACCTTAACCGCCTTTGGCGTTGCATCGCACAAGCGTTCAAGACGTGCTGTTGGTTGCACTGCTGAGCTGCATGAGGCTTCTTTCTCGTTGTCCTCGCATCCTCAAGCGACAGGCATAGCTATGAAGCTATCTTCTGCACGTTTTGCCGAATTTTTGCACCGTATTGCCGCCGCTTCTGCCGCACTTTTGCTCTGCGATGCTGATACCGCACTTCCCGCAGCCTCTGTCGCCTTCGTGGATGCCGTTGACGGCACTCCCGCCGCCGCTGTTTTGCGTCTTACGAGCGAGGGAACTCCGTTCCGCTGCCTGTTCAGATGACCTGGCATTCGTCTCGCACGTTGTGCCGCGCCGCTGGCAGAATTTCTGCCGCCGTTGCCGAGGAAGCTGCACGACCGGCACTTACCGTAATGCGTTCGTTTCTGATGATTTTGCTGCCTCTTTTGAGGCCACGCATCTCGTGCTGAAGTGGCGGCGCGCTTGACGCTTTCGTGACCCAAGGCGGTAGGAGGCAGACGTGGCGGCTGATCTTATTTGTGACGGGCAGCATTCGTTTCTGACGTGTTTTCGCGCACCGGACGCGCTCTGAGCCGCGCGTTTTTAGAACCTCTGCGGCTGCGGCACTTTTCGCTTCAGTGGCCCTTGCTGTGATGCCGCTTCTGCGCCGGAGGACCCTTCCTGAGCTGACGATGCAGCCTGTCCGGCGACGTGCTGGCGGCGCGTCGGGCTTACTAGTTGCATCAGTCAAGGGCCGCGACCTGAGCAGCTGAATGCACTGGCATCGCCGGCTGATTTCCTTCGCGTCTGCCGTACTCTGATTGCCACCACGGCTGTTGAAGGACGACACGACGGCTACTTCACCTCTCCACCATCAGTTCAGACGACGCCTCATCTCCATCGGGCATCATCCTCCGTCATGGCACAGAGAAAATCAAGTGCCGTCCCCGGTCGAAATCTTCATACACGGTACTGTTAGCGGCGTGCGATGGTGGAAAAACCGTCAACCTGCAGGATAGAACCTGTACTGACCGTACTCCACATCCATGCTGTAACGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCACCACCACCGTGGTGCTGTTACGTCTGGCTTTCAGCTGAATGGTGCAGTTCTGTACGGTTTCCTGTGCAGCGTCTTCAGGACTCCTGAAAATCTTTACTGCCATATTCACCCCAAAAGCCCACCGGTTCCGGCGGGCTGTATTCAACCACTGTGTTACCTGGCTAAGCAATCAGAATTTAACCGACCCCAACGATGGCGATCCGTCAGTACGCCAGTCGCCATGCCGGAGCCTTCAGCAATATCAACAACGACGCTGACGCTGCCGGATTAATCGTATACCTGCGGCATCACGCCACTGAGGTAACGCCGCATTGCATTTCGTCCCTGGCAGTGGTCGTCTCCTTTCATATACCCGGGAGTGATTTCCGCGTCTTACGGTAATCCATTGTACTGCCGGACCTACAGCGACTGTGAGCCACCTCCGGCCATGGCGTACCGCACTGACCTGCTTACTGATTTGTAAAACCGGTCCGGCCATCACGCTCACATAACGTCCACGCAGGCTCATAGTGAAACGTATCCTCCCCGGTCATCACTGTGCTGCTCTTTTCGACGCGGCGAATCCCCAGGAAGCCATGCCCCCACACTGTCCGTCAGCCATAACGACGGTATTTCACGTTTAATCCCTTTCAGATGACTCACATCGTATCCCCGCCGACAACGACGGCACCGGATTACCCGGTTTTCACTTGAAAATAGCCCACCGTAAACGTACCATGTCCGCTTTCCGCGCACGGGCTCGAGTGACTGTCACCGCAAGTGCGGCAAAGACAGCAACGAAGGCAATACACAGGTCTACGCATCTAGCGTTTCTCACCTGTTTTATAATAAACGCCGTTCCCGGACGAACCTCTGTAACACACTCAGACCGCTGGATGCCCGCCTGTTTCTTAATCACCAGACCTGCACATCGCTGGCAAACGTAAAGCGGAATATCTGCCGAATTGCCGTTAACGTAAGCGTGAACTGTCAGGATCACGTTTCCCCGACCCGCTGGCAGGCGTCAACAATACGGGAGAAGAACACCTGTACCGCCTCGTTCGCCGCGCCGCTCATAAATCACACCCGCACGTTCATCAGTATTTCAGATAACACATCGAACAAACCGTTGTCCCTGCCGCTGACAGTCTACCTTACTTCAGCGAAACGTCTACTGAGGAAGCACCACTATCTGGCGATCAAAAGGATGGTCTATCGGTCACTAGACAGTACGGGCAGATACCTGACGGCCAGTCCACTGCTTTCACGCTGGCTAGGGGAAAGCCGCGCTCACGCGCCTTTACAATGTCCCCGACGATTTTCCGCCCTCAGCGTACCGTTTATCACAGTTTTCAGCTATCGTCGTACATTACTGAGCGTCCGGGGTTCGCATTCACACTGCCTGATATCCGCATTTTAGCGGTCAGCTTTCCGTTGCTGTTAAGGGAAGGGCCGGAGGATTGCCACGCCGCTGGTAATGGGTTGGGGGCCGTCAGGCGCTTCAGGAACACGTCGTTCAGCTGAATATCTGGTTGCCCTGCGCCACAAACATCGGCGTTTCATTCCCCCGTTTGCCGGGTCAATAAATGCGATACGATTGGCGGCAACCAGAAACGGCCGTTGCCCTTCCTCCGTGTCCTCCATGCTGAGGCCAATACCCGGACATAAATGTTGCCGTCTTTGGTCTGCTCAATTTGACAGCCCACATGGCATTCCACTTATCACTGGCATCCTTCCACTCTTTCGAATTCCCTCCAGTCTGCTGGCGTTATCCTCCGTCAGCTCGGTCTTTTTCCAGCATATTCCCTTGCCGAGATGGGATTCGGTTATCTTGCCTTTGGAAATCCAGGTAATTCTCCGCATCATCGCTCGCCCGACCGACGGCCTCCACGAATGCCGATTTGCCAACGGTGTTCACACTGCGGGATATAAAGTAAGCTAATCTCACGCTTTTGGGTCGATATAGCTGGGCGGCTATCCAGTACAAGCGCCGTACCAAGATAACGCGTGCTTGGTTTCAATCCGTTAAGTTT	*	tp:A:P	cm:i:162	s1:i:1507	s2:i:0	NM:i:2303	ms:i:6250	AS:i:6252	nn:i:0
+9	0	utg000001l	1	60	56S9M6D20M1D34M3I18M2I1M1D17M3I14M2D25M2D5M1I3M1I1M1I2M1I1M1I2M3D22M1I10M6D9M4D6M1D9M1I8M3I4M1D16M1I3M1I3M2D10M1D6M3I5M1I1M2I14M1I4M2D8M1D59M1D14M1I19M3D2M2D1M2D6M1I11M1D5M1I18M1I3M2D16M1D35M2D18M3D39M3I11M1I5M2I2M1I13M1D6M2I15M1D2M1D1M1D16M1D19M3I2M2I5M1I6M1I4M1I38M1D3M1I3M2D8M2I25M1D7M3D28M1D4M1I12M3D1M4D9M3D17M1I3M1D7M4I12M2D3M4I5M1D22M1D10M1I6M1I4M1I1M1I5M1I5M2I2M1I17M1I16M1I8M1D6M3I5M2D3M2D6M1D7M2I27M1I18M1I17M1D1M3I13M1I4M1I20M1I4M1D19M1D1M2D6M4I7M1I8M3D1M1D3M1D17M1I15M1D16M1D13M1D7M1I5M1D8M1I1M1I6M1I4M2D4M1I13M1D12M2D1M1D17M2D6M6D25M2D15M2D15M3I5M1D10M4D8M4D20M3I15M1D12M1I7M3D11M2D9M2D1M1D9M1D7M1D3M1I9M1D12M1D13M1I1M1I4M1D5M1D1M2I6M1I2M1D19M2I16M2I8M2D8M1I29M1I5M2D11M1D18M3I25M3I21M2I3M1D3M1I7M2I7M1I2M1I1M1I3M1I15M1I10M4D33M2D2M1I10M2I2M1I11M1D7M1I3M1I14M2I11M2I6M1D11M1I11M1I7M1I15M2D10M2I12M3I1M2D3M3D3M1D1M1D12M1D1M2I19M1D3M1D28M3D13M1I2M2D8M1I7M1I4M4I3M2D7M1D7M3I2M2I4M4I11M2D10M2D6M1D1M1D7M4D13M1D2M2D3M1D8M1D5M1I2M2D3M1I1M1I4M2D4M1D1M2D12M5I5M2D14M1I1M1I3M1D10M2I14M1I10M3D5M5D12M4I4M2D2M1D4M1D2M5I3M1I5M2I5M1I3M3D5M1I8M1D1M2D20M1I19M2I4M1D4M3I4M1D1M1D2M1I21M1D4M3D7M2I1M2I16M1I2M2I22M1I33M1I12M2I11M3I15M1D6M3I3M1I1M2I2M1I10M1I6M1I9M1D7M3I6M5I2M3I11M1I9M1D6M1I12M1I20M1D5M3I1M2I13M1D25M3I6M1D5M1I30M1D7M2D3M1I1M2I1M1D4M1I6M2D6M4I3M1I4M1I8M1I8M1D3M1I1M1I2M1D2M1D3M2I3M1D8M2I5M3I1M1I2M1I3M3I3M1I11M1I3M2I1M2I24M5I12M1I28M2D2M2D27M2D13M3I9M1I2M1I8M2I2M1D2M2D19M2D6M1I9M1D4M2I2M1D13M2D8M3D5M2I4M1D1M2I5M5D19M4I30M1D16M6I3M1D14M6D10M1I6M2I17M1D6M1D9M2D1M1D4M1I38M1I2M1I3M1I5M1I3M2D7M2I6M3I8M1D2M1I39M1I1M1I2M1I5M4D1M1I2M4I7M2D6M3I15M3D9M4I1M1I6M2I10M2D8M3D1M1D17M1D1M1D38M4I2M2I23M1I11M5D7M1I5M2D8M1I3M3D3M1I1M3D8M3I28M1D9M1D4M1D5M2D6M2I10M2I14M2I14M3I4M1D13M1I9M2D7M1D37M2D3M1D28M1I10M1D35M1D17M1I16M1I13M2I4M1I4M1D4M4I6M1D7M3I3M1D5M3I1M1I7M1D7M2I2M1D6M1D5M1I2M3D4M2D13M1D3M3I13M2I8M2D4M1I4M2I7M1I4M1D7M1D11M1D2M2I1M2I2M2I23M1D25M1D7M1D7M4D12M3I4M2I4M1I1M1I2M1I29M1I17M2I14M4I2M2I17M1I3M2I9M1I2M2D9M1I9M2I6M3I22M1D9M1I2M1I4M1I5M1D3M2I22M1I11M1D2M3I1M1D4M1I10M3D11M1I3M2I8M1I2M1I6M1D8M1I29M1I5M2I6M1I6M1D4M3I1M2D12M1D13M2D2M1D19M1I2M1I17M4I1M1D18M1D9M2I1M1D6M4D5M1D13M2D17M1I47M4D6M1I4M1I12M1D18M8D15M2I9M1D5M1I3M2I13M1I12M2I1M1I7M2I3M3I4M1I9M1I7M4D10M6I7M1I17M2I12M1D1M1D17M1I8M1D2M2I15M5I7M1I6M1I55M1D12M3I2M2D3M1D9M1I1M1I10M1D17M1D17M3I6M1I15M2D16M5I8M1D7M5D8M2I4M1I2M4I1M1I4M1D8M4I5M2D10M1I3M2I6M11I9M1I13M1D2M1D10M2D15M1I7M1D4M1I13M4I28M1I8M2I8M1D12M1I8M1D5M1D9M4I2M1I6M1I4M2D3M1D7M2I2M9I6M2I4M1D16M1D4M2I5M1D34M1I8M1D9M1I3M1I4M2I19M3I3M1D5M1D12M4D35M1I3M1D8M1D16M2D4M1I2M1I11M1I14M1D5M1I9M3I5M1I16M3I7M1I16M1D6M1D5M1I3M2I1M1I6M2D17M1I5M1I5M1D4M3D2M1D11M1I3M1I6M1D18M2D3M1I14M3D27M3D4M2D6M4D16M3D1M1I9M1D10M2I7M2D12M1I14M2I17M1D2M1D14M2D24M2D25M1I5M1D12M2I15M2D2M2D6M3I17M1I3M1I4M1I3M1D14M1I10M1D6M1I3M2I3M4I4M3I8M3I5M3I18M1D9M1D33M2I3M3D1M1I33M1I11M2I7M1I4M3I2M2I4M1I3M1I5M3I5M3I12M2I5M1I6M1I12M1I2M1I9M3I6M1I8M2I1M1D9M4I3M1I7M7D13M1I10M1I4M1I7M1I10M1I12M2D22M1I4M1I2M1I7M1I7M2I11M1I4M1D4M1D1M1D23M5I1M1I16M1I1M1I26M1I7M1D2M1D7M1I8M1D1M1D13M1I9M2I13M2I5M3D13M1I5M3D51M1D7M3I2M1I11M1D4M3D14M1I1M1I7M1I3M3D9M1D19M2I7M1D23M1I12M1I12M1D3M1D13M2I17M2D10M1I11M3D8M1I3M2I16M1I8M2I6M1D2M5I4M1I2M2I5M2I16M4I5M1I19M2I3M3I3M1D4M1D1M1D5M1I4M2I3M3I10M1I4M2I8M1D5M3D10M2I4M1D5M1D3M1D52M3D3M1D15M1I2M3I1M2I4M1D16M2I13M2I15M5I20M1D22M4I40M2D17M3I7M3D9M1D6M4I6M1I8M1D33M3D2M1I11M2I17M1D9M1I15M5D26M1D5M4D17M2D6M3D16M1I34M2D8M2I35M1I21M1D4M3D11M1I5M2I22M1D8M176S	*	0	0	TTGCTCGCGTATACACGGTATGGCCTGTCCAATCTTAATACGAGAAAGGACCCGTCAAAGTGATAATGATTATCATCTACATATCACAACGTGCGTGGAGGCCATCAAACCACGTCAAAGCGTAATCAATTATGACGCAGTAGATCGTATTAATTGATCTGCGGCATCAACTTAACGTAAAACCAACTTCAGACAATACAAATCAGCGACTAGCAACTAACGCGACCTCATGTCAACGAAGAACACGTAAGAACAACAGCAACATCCGCTTTCTAACCAAAATGATTGACGAACAATTAACATCGCTGGGTCAACAGGGTCGGGAATTTCGGCCTCATGAGTACGTATTGAAGCCTGCCGTTCGAAGCGTCAGAAAGAGAGCATATACATCAATTAAAGTGATGAAGAATGAACATCCCGCGTTCTTCCCTCCGAACAGGACGATATTGTAAATTCACTTAATTACAGGGCATTGCAAGTAATTGAGTGCAGTTTACCACTTTCCTGACAGATGAAGACTGCGTGTTGGCTCTGTCACAGACTAAATAGTTTGAATGATTAGCAGTTGGTGATCAGTCAACCACGAATAATCCTTCATATTATTATCGTGCTTCACCAACGCTGCCTCAAATTGCTCTGAATCGTCTCTCTCAGAGACATTATGTTCTATACATGCAATTACAAATAGGTAACTCATAGAAATGGTGCTATTAAGCATATTTTCAACTAACGAAGTCAGATCCACGCGAGGATCATCTGAGCAGATTGTTCTTTATTCATTTTGTGCTCCATGCGCTTGCTGTCCTCATCTAGCGGTTAAAATATTATTCAAATTTTCTGTATGAAGATTTGAGCACGTTGGCTTACATACATCTGTCGTTTGTATTTCCCAGAATGCCAGCAGGACCGCACTTTGTTACGTACGCAACCAATGATGCCCTGACTAAAACATTCCTAATATTGACATAATCATCAACAAAACACAAGGAGAGTCAGACCAGATCGTGAAACGATAAAAACGATAATTGCAAATGACGCGCCTCGTATCACATGGAAGGTTTACCAATGGCTCAGGTTGCCAGCGTCCACGAAATTTGCCGATCAAGTGCGAAAAGATTTAGACTGTGAACTTGTTTTTATTCTAAACACCGACCGTCACAACGTCTCACAATGCTATTTACTATCTAGCCACAGATAATATTCACATCGTGTTAGAAAGCCAACACCGTGTTAATAAAGGGACTTAAAAGGTTGTAAATGTTAAATTCTCAAGAAACAGCATCTGCCCAAACGTCTATGATAGGTTGAATCACGAAGTGACGCACTTCGACCCAATACAGGGAAGTGGTTAAAGCAGGAGTTTCCGATGAGTCAATATCCATGAACATAAATATTACGTTGATAATTCATTACTATTTACTGAGCATTCAGAACACCACAAATCTTTCGACCCTAAATCCATAACGTCGGTTTCTTCCGTGTCAGCACCGGGGCGTTGGCGGCATAAGTGCAATACGTGTACGCGCTAAAACCCTTGTGCATCGTTTTAATTATTCCCGGACACTCCCGCAGGAAGTTCCCGTCAGGCTGTGGACATGTTAATCCGGAATACAATGACGATTCATCGCACCTGACATACATTAATAAATATTAACAATATGAAATTTCAACCGCCATTGTTTAGGGTTTGTTTAATTTTCTACACATACAATTCTGCGATGGTTCAAAGCATCGGGAGAAAGCCATGAAAAATGTGAGCTCGCTACTGCTGGCCTGCTTATTACAGGATGTGCTCAACAGACGTTTGAACTTTCAAAACAAACCGGCAGCACATCAGGCATCAAAGGAAACCATCACCCATCATTTCTTCGTTTCTGGAATTGGGCAGAAGAAAACTGTCGACTGCAGCCAAAATTTGTGTGGCGGCACGAAAGTGTTTGTTAAAACAGAAACCCAGAGCAAACATTCGTAAATGGATTGCTCGGTTGTTTTAATTTTAGGCATTTACTCCGCTTGGAAGCGCGTGTATTGCTCACAATAATTGCATGAGTTGCCCATCGATATGGGCAATGGGTACTTGGACTGCTCATTAATATTCTGGGTTCCTTCCAGTTGTTTTGCAGTGATCAGCCTCTCGGCCGGATGAACGGAATCCGCGTTCTACTAATCCGTGTCCCGTCGAACGGAAGAAGCAACGGTGCATTATCCGCATTCGCTTCGACGATGACGCAGACTGCTTTGGGTGCATGGGACAACGGACGACGCAACGACTCATCGCAAATCCCGACGCTTTCGACAGCTTGACGACTCCCTCATCTACGTTATTTTGCATCGAACGGAATCCCAACGGGTAGAACGGGATGACTGCACTGTCAGCTCCTAATCCCGTTTCCAAGAAGCGTGCCTCCTTTCTCCTGGCATTCTCATCCCGTGTTGTAGTAATGGCGTTATCAATGATGATGATTAACAGCCAGCATGGTAAGGGGCAGCATCTAAGCTGCAGATAACCAGAGCGAGATAATCGCATGTAGTCAATGCTCATACATCAATCTCTCTGACCGTTCGCCCGCTTCTTTGAATTTGCAATCAGGCTGTCAGCCTTATGCTCGAAATGACCATAACCAGCGCCCGGCAGTAGTGAAGCCCATTATTGCTGCATGAACAGCTGTCCAATTGCCTGAACTGATCATGACGCCAATCAATCATAATAGGTAGAAGAATCTAGCTCCAAGCGCTCCTTAATCTGCTGCAATGCCACAGCGTCCTGACTTTTCCAGAGAAGTCTTTCAACGGACCCAAGCTGCTTGCGGTAGGCATCCCACCAACGGGAAGAAATAAATGGGCCGTCCGGCGCCTGTTGATTTAGGGTTTGGGTTTATGTATCATTGACAGTCTGCGAGGTAATCGGAGTAATCAGAGGCAGCTCAGCCTCCCGCTACAAATGACGTCAAACTAGATATTTCTGGTTTTCGTCTGACGTCCGTCAGTATCCATTTCCCTCCGGACGACGAACGCCAGCATATCGCGGAACGCCTTGATCAGTTTGATTATTACATTTCTACCATCTTCTACTCCGGCTTTTAGCAGCGAAGCGTTTGATAAGCGAACGATCGAGTCAGTATCTAAGATGTAGCCGGACTAAACACGGCCTGTCAAGACGAGATTGCTACTTAGTCCGCTGAAGTCGAAGGTCAACGCAGCACGAACTAGGCGATAACCCGCTAGCACTCCCGTTGCGTCGATTACTGTTTTGTAATAGAACGCACATGCTCATTATTGGACGCGAATGACCCCATTGCAAACGCGCAAGGATTCCCCGATGCCTTGTTCCTTTGTTGTAGAGAATGGCGGCCAACAGGTCATGTTTTCTGGCATCTTCGGTTACCCCCAATAAGGGGATTTGCTCTATTTAATTAGGAATAAGGTCGATCTACTGAACGGAACAAAGGTCGAGGCTACTGTGTTTTAGATCAGATTTGTTCGTGACCGATATGCACGGGCAAAACGGCAGGAGGTTGTTAGGCGACCTCCTGCGGCCAGGGTTTTCACGAAGGTCATGTGTAAAGGCCGCAGGGCCGTCAACTATTACTAATGAATTCAAAGACAGTGGCTACGGCCGTTTGGGTTGTGCTGTTGCTCGGCGGCGATGACGCCTGTTCAATAGGGAGATTTGAGTCATTTCTGCTTCCGGTATTCGCTTAATTCAGCACAACGGAAAGAGGCACTGAGACCAGGCTCGCCGACTCTTCACGATTATCGACTCAATGCTCTTACCTGTTGTGCAGTTAAAACGGGTCGAAAACCCGTTTTATGCAGGCTCTAACTATTACCTGCGAAGTACTGTTTCGGGATTGCATTTTGCAGACCTCTGCCTGCGATGGTTGGAGTTCCAGACGATACGTCGAAGTAAGACAGGCGGAATCGGTAGTAAGCGCCCCTCTATTTCATCTCACTACAACGAGCGAATTAACCCATCGTTGAGTCAAATTACCCAATTTATTCAAGTAAGTCAATATCATGCTAGTTAATATGTTGTTCGATGGAGTGCAATCATTCATGCGCTAACGTGTTGACGCATCGGTAAAAATGTTGCGATTAACTTCTTTGTGGCATTGCACCAGCGTCATACAGCCGGCTTAACAGTGCGTGACAGAGGTGGCTCGTACACGTGGTTTGGGATTAGCATCGTCACAGCGCGATGCTCTGCTGCCTTGTGCTGGCGGCATCCTTGAATAGCCCGACGCCTTTGCATCTTCCCACTCTTTCTAGACAACTCCCACAGCTCTGTGTTTTGACGAAAGTGATGTAACCGCACGGCCTGTACCATGGCAATCTCTGCATCTTGCGCGCGGCGAGGCGTCGCGGCACTGAGCACTAGGCAATAATCCGCATAAGGCGTAAATGTTGCGAGCACTTGCAATCACTTTGCCTTGTAGTATTTCTCCTTCAAGCTTTTGCCACCACGTGTTCCCCGATACCTTGTGTGCATTGGGCATCAGATAGTTGATATAGCCTTTTGTTGTCGTTCTGGCTGAGTTTCGTGCTTACAGAATGCAACGCATGGAGGCAGTCGCACGGCTTGTACTTGCGCCATCCCCATAGCATCCATCACATCAGTACTAGGAAAGAGAGTCAAGAAGCCGTGTAAGCGTGGTCAGTCGCACTCATCATCGGGCTTTGTAGAATGAAGTTCATCTAGCTACGGTTTTCAGTCTCAGTGCGCCTTCTCCCTGTACCTGAATCAATGTTAGGTTCCCGAACATGCGCCGGTATCGATACATTTGGTTGGCAAGACTTGAGTGGTTTCACTGCTGGCGTATGACCAAAGATGAACGTGTCCCTTTGATTTCTGTTCACGATCCCGTTTGTGAGTTGCTGATTCGTTCGCGGTTCCAGATTGACCTGCTGATGATCAACTGGGCTTTCCAAACTGCGTATTCGTCAATTAGGGATAATCACGGCGTGGCAGGATAACATATTTTATCTTAACGAGTTCACTCTAGATGATTGGACGGAAGTTCATCTGCTATTTATGGGCAAGGTCTAGCCAGAATTTCTTCTGTCGTAATCGAGATTAAAGAACCAGCCGCCACCGCCATGTAAGCATGCCAGTGATTAACGTTTCCACGCTCTGATAAGCCATCAATCATCATTTGCTCATGGTTTCCACGTACAATAGCTGACCAGGGAAGTCGTGATTAATTCAGGCATTCAACGTTCTCTGCACGATCAACCAAATGCTCCCCACCGAGATAAGCAGGTCTTTGTTGTCGAATCCAGCACGATCGTATCCGCGTTGTTCATCGAACTTCGTGTAGCATCCGTGCAGATCGCGGCGCGACTCGTATATTTCATGTAAATTTGCGGGTCATTGTATGCCATCAATTTTTCGTAATAGCCCATCTCTTTCACCTCCATCCGCGATGAACCATGAGAACGGTCGTTAACAATGTCCATCGTGCATTTTCCCGTCTTTATCATCAACCGTATTTTCGTATGAATGCACCGCGACTAAGTTTCAGTCTGCGTTGCCTTCACTTCTCCTTTCCGTATGTTTCGAACGAGCATGTCTGGAATGGTTTTACTATGAGACGTCATGCGGCCTCATTCTGCTATTTCGCAGGTCTTTGAGTTTCTGTTGGTGATATGCCTGTGATCGCCTTGCACTCTGTCGATAGTCCAGCGATGGCGGTTATGGTTTGATTGTTCGATTTCGTCTACTGCTTCCTGCCCGATGCTACTAATCAGTTCGACGCGAGTACCGGAACGAGATTTCCGCTTTGTGCCTTGCCACCACGCATTGCTGCGTGAATATTGCGTTCATTAAATCGGAGTCGATGATCATGCAGCAGTTATTCTGTAAGTAATGTCCGGCATCCCACTGAGCGACGTACAAGCGTTCTAATCCGCACGATACATGGTAAGTCGCGGTCTCTTTCTGATGAAGGCGTTTACGGCATTGTTTGGCTTGTTTAATCCAGTGACTGCGGCTGCTTTAAGGCGAGTCGCGTAATCTTAAGTTTATCTTTCGTTTCTGCTCCTCGTCGTCGTTTCTTCTCTGCTGCTTTTCGCTTTCGCGCTTTCTTTATTCGTCGTTCGAGTGCTATCTTGGTTCCACACTCTGGAGAGCACCACATGATTAGCGAATGCAGGTGAAACCATTCCCGGCATTCATCGTTTTACATCGTCTTCGCGCTGGTTTTAGCCATCATCTTCTTCTCCTCGTGCATCGAGCTATTCGGATCGCTCATCAGTTCTGCGCGACCGATCGACGCCACGTGAACTTCCAGCACATGCAGCTTCTGACCGCGAAGTCCTAGCGCAGGACGTTAAAGCTGCTCGCTCGCCGACGCTTTCTTGTTCTGACTTCGATTTAGTTAATCACCTTGTTTTCCTCGCACGACGTCTTATAAGGGGTCCCACAGGTGAGCCGTGTAGTTGAAGGTTTTTACGTCAGTAATTCTTTGTGGGATTGGCTTGGGTTTATATTTCTGGTGCGTTTCTTCGTTGGAAGGTATTTGCAGTTTTCTACAGATTATGTCGGTGATACTTCGTCGCTGTCTTCTCACACGTCCTCCTTTTCCTGCGGTGGTAACACCCTGTTGGTTCTTTCAATAACGAGACAAGATCCGATTCCAGTAAGGAGTGTACTTGGTCGGAAGCGGTTATCTTCTTTGCATTCACCGCAGCCAGACGACACCCGCATCAGATGCAGCTTCCTCCCGAAGTCGAAATCAAGCTGCCCTCGACAAAGAGCGACTCTTTCGCATGACTGATGAAATACCAGCCGGTATCGAATCTTTTATAATTATACAGTCCTGATACGAGGCTTGATAATCATTTTCGTGAATACATTGTTCGCGATACCGTCCCCAGCGACATTCTTCCTCGGTACATAATCTCCTTTGGCGTTTCCCGATGTCCGTCACGCACATGGGATGCCGTGATATACATGCCTACGGAACCCGTTGGATCCTCCTCATCTTTGCGACTACAAGTCCGATTTGCGTTGGGTTTAATGCAGAATATGCATATTTACCAGATGTTCCGGTATTGCAAATCGCGAATGGTTGTTGCCGTCGCCCATGCGGATATCTTCCTTCTCATAAAGTCTGACAGTTCAGCACAGATATCTTGATTCCAGGCGTTGGCTTCGTTAGGCCGCTTCGGTTCATCAGCTCTGATGCCAATCAATCCACGTGGTGGACCTCCCTCGCCGAAATGGTCATCACAGAGAGTATGTTGGTGAAGGGAACGAGTTCCTTAATGATCGTCATCGGAATGCGCAATCCTAAGCCGACGTATGGAGTGCCATATTTCTTTACAGTGAGACCTGGCTTCGATCAGGCATTCGCGTCTGAATATCCTTTGGTTCCCATACCGTATAACCATTTGGCTGTCCAAGCTCTAGGTTGATATCACTGAGCTGCAATACCGGTGAGCGTATATCCAAAGGGGCTAGAGCGAACTTCACAACTTCCCCCGCCTGACAAACCGATATGTCACTTGGATGTTCACATGGCTATCTTGGCCGGCGGACGTAATGCACGTCTTTACCTGCCCGTCGCTTTGCTCCATTAGCCAGAGCATAAATATGCTGACGTCCTTGAGCAGGGGACTAACGACATTTATATGCAGCCCTGTCTCCCCATCTCGTGTTCCACTCCGAGCCAGTCTCGCTTCGTCTGACCACTTAACTCACGCTCTGTACCGAATGCCTGTACAGCTCTAATAGCTGCGCAAATTCACACGCATCCTTAGTGGTTGACCGCTTACTACAAAGCCATTCCCGGCCAAGGTCAGGAACAACATCCTGCTGCTTTAATGCTGCGGTAAACACACACTTCGAGCTTTCTGCATCCAGCCAGCGACCATGCCATTCAACCTGACGGAGAAGGTCTAAGCAGGCCATAGCTTCTTCCTGTTTTGGTCTAAGCTGCATTGCGTTTCGGACATCATAGACTGATGAGTGGTTACCTAGAAAGGATTTGATTCGTGTAATTAGTAGGGAGGAGTGTCGGTACTGACGATCCAACATCAGTTTTGTATAGACCTTCTTGCCTGGGATCGAATGTTCGGATAGTTAATGTTTGTTAGGTGACTTTATACCTATCTACGCCGATA	*	tp:A:P	cm:i:136	s1:i:1176	s2:i:0	NM:i:2029	ms:i:4396	AS:i:4396	nn:i:0
+10	16	utg000001l	29357	60	866S8M3D8M1D3M1D7M2I7M2I4M1I7M1D10M1I9M3D1M2D16M1I18M4I6M4D7M3D9M3I2M2D10M1D3M3D2M2I3M3I1M1I7M1I1M2D3M1I29M1D13M1I1M1I8M3D7M1D11M1D2M4D2M1I6M1D12M2I1M3D12M1D5M2D1M3I5M1I9M2I4M2I7M1I5M2I25M1I8M1D11M1I2M4I6M1D3M1D9M3D15M1D17M1I11M3D30M2I8M3I18M5D5M3D6M1I20M1I5M1I7M5I3M1D6M2D9M1I2M1D1M1D11M1I3M1I18M6D23M1D3M2I1M1I2M1D4M1I9M1D1M1D21M2D1M1D10M2D3M1D6M4I8M1I7M1I27M2D13M4D2M1D4M1I2M5D5M1D5M2I1M1I4M2D23M1I7M1I3M1D1M1D24M3D12M1I5M1D19M2I6M4I3M1I41M2D4M3D8M3D1M1D23M2D10M1I52M2D10M4I6M2D13M1I5M2I3M1D5M3D5M3D8M1D15M1I13M1I5M1I6M1D19M2I7M5D3M1I5M1I7M1I11M1I3M2D8M2I3M1D8M3I8M1D8M1D5M3D17M2D17M1I3M5I9M1I8M1I8M1D6M2D2M2I2M1I8M2D2M2D4M2D7M2D8M2D7M1I4M7D3M1D35M2D9M1D7M4D30M2I4M1I19M1I6M1D14M1I4M5I5M1D15M5D2M1D3M1D7M1D2M1D4M1I10M1I14M3D10M1D5M1I5M1D1M2D7M5D11M2D3M4I2M4I2M1I5M4D10M1D5M1I1M1I4M4I10M1D6M1I5M1D9M2I6M1D7M2D1M1D8M2D2M1D3M7D7M1D9M1D2M2D3M3I3M3I2M2I3M1D2M1D18M8I13M2I7M1I6M2D2M1I7M1D1M1D1M1D2M2D15M3I1M1I7M1I20M1I9M1I5M1D19M1I10M2I1M1D2M1I40M1I6M1I7M1I5M1D5M1I7M2D3M1D5M2D19M2D40M3D5M1I8M1D1M2I1M1I6M1I2M2D1M1I5M1I2M2D5M2D1M1I5M1D2M6D1M1D8M4I11M1D5M1D3M2I4M1D3M1I6M2I8M8D4M3D4M1I3M1I9M1D1M1D6M1D11M1D7M4D1M1D2M1D5M3D3M1I2M2D4M1I11M1I5M3D1M1D5M2D2M1I8M1D5M3D5M2I3M3D7M1D1M1D4M3D2M1D12M1D1M1D7M1D12M1D3M2D6M3D19M1I11M1I6M2I6M1D3M1D6M1I3M1D3M1D5M1D1M1D3M1D13M3I29M1I12M1D3M1D4M1I6M1D3M3I10M1D5M1D9M4D6M1D1M2I14M2D2M2D1M3D5M3I9M2D2M1I12M3I13M1D1M3I13M1I9M1D6M2D9M1D1M2D13M1D18M1I6M3D3M3I3M1D18M1D5M1I9M1D10M1D6M1I5M1I2M1I7M1D5M1I17M1I19M1D17M1D15M2D2M1D1M2D3M2I11M2I7M1D5M1I11M2D19M1D7M1D8M3D3M1D2M2D3M1D3M9D5M4D9M4I5M2I2M1D8M1I4M3I1M1I5M1I4M3I24M1D8M1D3M1I9M1I14M1D2M2I5M1I4M1I2M1I4M1I1M3D8M1D7M3I2M1D5M1D11M1D8M2I3M2I8M1D7M1D12M1I2M2D4M1D16M2I18M2D8M2D5M1I12M1D7M1D7M1D11M1D11M12I15M1I8M5D3M1D6M2I3M1D15M2D8M1I3M1D10M2I8M1D5M1D8M1D10M1I3M3I6M1D5M1I4M1I3M2D8M1I2M1I4M1I4M1I8M2I18M1D3M1D16M1D5M2I1M2I3M1I3M1I12M3I8M1I2M1D3M2D3M5I15M1I1M2D12M2I6M2I3M1D6M1D9M1D6M1D8M1I11M4D4M4D5M2I2M1I4M2I43M1D9M2D10M1D14M2I11M1D11M4I6M1I7M1I8M2D7M3D24M1D6M3I31M1D12M1I34M1D4M1D2M2I5M1D2M4D4M2D4M1D4M3D5M4I12M1D15M1D9M2I9M1D4M1I6M3I1M1I7M2I5M7I1M1D2M1I4M3I5M3I1M1I2M12I13M1D5M2D3M5D27M1I1M2D2M1I20M1I3M1I1M2D9M3D5M1I6M1D6M5D2M1D3M3I5M1D8M1I15M3I7M3D4M1D1M2D3M2D1M1I3M2D19M1I4M3I4M2D5M2I16M6D10M1I4M1D15M2I5M1D2M4D3M2D13M1I3M1D1M1D3M1D6M1D11M1I2M1I6M1I7M5D2M1D8M5D2M1I4M2I4M1D7M1I2M1I8M1D16M6D9M3D3M1D8M2D2M1D15M2D6M1D4M3I8M1I7M1D6M1I2M2D8M2D22M6D6M2I4M2I15M2I3M1I3M1D15M3D9M2D4M1D4M1D22M1D1M1D3M1D8M1D4M2I7M1I7M1I9M1D1M1D3M3I30M1D16M2I3M1D11M1I35M2D1M1D9M2I2M1D1M1D10M8D3M1D6M2I4M1I1M1I12M1I2M1D7M1D9M1D4M6D2M2D3M2D1M1D4M1D2M1D7M2D4M1D6M1I2M1D31M1D1M1D19M2I3M2D7M2I10M1D10M1D3M2I2M3I3M1I4M3I2M1I6M2D1M1D10M1D3M1D3M1I5M1D5M2D5M2D10M1I30M1D9M1D5M3D14M3D20M1D9M1D7M1D6M3I6M4I4M1D9M1D10M4D1M3D9M3D12M2D8M1I3M1I4M1D12M1D5M1D2M1I3M3I12M3D4M2D23M4D7M1I8M1I6M3I2M3I2M2I10M1I8M3D2M1D15M1D5M2D1M1I7M2D3M2D22M2D2M1I8M4D3M4I3M1D9M2I8M1D3M1D5M1I36M3I14M1I10M1D14M2I3M4D4M2D1M3D9M1D17M2I3M3D1M1D2M1D12M2I1M1I2M1I1M1I16M1I11M2D27M1I54M3I20M1I8M4D5M2D11M1D6M1D21M1D3M2I5M1D1M2D3M1D2M4D1M4D12M4I2M1I7M5D12M2D8M1D6M1D13M2I17M1I1M1I13M1I8M1D10M1D7M1D12M1D17M1I5M3I6M4D1M1D1M3D16M2I7M1D13M1I14M1D17M5I3M3I9M1I8M1D21M3I2M5I10M1D3M1I2M6I1M1I38M1D9M2D30M1I13M50S	*	0	0	AAACAGAACGTACCTGATCCGTCTATACTACGTATTGACGTACTTCACGTTAATGCCTGTATACGACTCAATGGTATCCCGCCCGACAGACGGGACAATGTCAGGGTTTCACTTGAAATAGCCCATCAACCATCATGTTACTATGCCTAACGGGCCGGGATGACTGTACCGCAATGCGGGCACACGTAAAAGCGCAACCACACGTCTACCGCATGGTTCAGTTCTGGATGTTTGTAATCAACGCCCGTTTCTAGGACATATAACTAGGTAACATCTACTAACTATGTTTCACCCCTCCTCCTGTTCTTATCTAGCTCTCCTACTCCTCGCCATCGTGGTCTCGGCCCTTCTCTTCTGCCCAACTTGATACGGCGCGAAAGCCAGCAGATCACAGGCTTCCCGAGAACGCGCTGCAGGTAACATACGGGGAAACACCTGTACCGCCTCCTGGGTCTAGCCCATAACGGACCATAAAGTAACTAACTATTTACGTATCTGTTTAGATAACATCGAACCTTTGCTTGTAGTAATCACGCTTATCTATCAACGTTACTAAATATAATTCACTACCTAGAATCAAAAACCGATATGCCCATCTTATCAATCTAGTACGATCGTATACCTGACTATACAGTTACACCGCCTGATCGTTTAGGCCCGGAAGCTCGAGGCCGCCTTTACAATGTCCCGACCATTTTTCCGCCCTCAGCGTGATCCGTTTATCGTACAGTTTTCAGCTCGTAGACATTACTGAGCGTCCGGAGTCGCATTCACACTGCCACTGATATCCGCATTTTAGAGGGTACTATAGCTTCGTCCGTTAAGGGTTGGAAAGGCCGGAGGATTGCCGCTGGTAATGGTGGGGCCGTCAGGCGCTTCAGGAGACACGTCGTCTTCATAGAATATCATGGTTGCCCTGCTGCACAAACATCGGCTTTCATTCCCGTTTGCCGGGTCAATAAATGCGATACCGCAGATTGGCGCAACGAGAAACGGGCTAAGTTGCCTTCCTCGTGTCCTCCCCATGCTGAGGCTAATACCCGCGACATAATGTTTGCCGTCTTTGGTCTGCTCAATTTGACGACCCCACATGGCATTCATTATCACTGACTGCAGATCCTTCGAAAATTCCTCTTCCAGCCGGGAGGTCCCTCCGGGAGTGCAGGCGCTTCCAGAGCAATGCCCCGGAAGGAGGCATGGGATTCGGTTATCTTGCCTTTGAAAAATCCAGGGTCTCTTCCTGCCCTGATGAGCCTCCCCGCCTCATTCGCCCGCATTCCCTTCAAACGGTGTTTACACTGCGGATATAAAATAATCATGGCCCGGTTTGATATTGATACCATGGCGGCTATCCAGTACAGCTAAGTCACCAACGCGTGCTGAGTCGTGACTTGAGTCTGATATCCAATCTGCTTTTAGGGAACCAGAGACTCTCAAACTGTACCGTCGGGTCATAAACGGGCAAGATGCGGCGTGAGTCTGAAATAGCCCGGCGTCAGCTAGTGACTCTGACGCCTAGTGCCGGTGCGGCAATCCGGAACCGATACCGACGCCGGATCGCCCTGCTCTGCCCACGCATTTTACCGCCCGGACTGTCAGCCTGTAGTTCCAGCGCCAGTTGCGTGAAGCGTATGTATTCGTGTCCGTTGAGCGTAGACCAGCCGCTCACTGCCGTCGATCCGCTGTTACGGTCAGACGGAGCAGGAAACTCACGGTCCCCACCTTCGGGTGTCCCATCGCGCCAGCACCTGATATTCCCCGGTGTTGGTCTGCAGTGACTTCTGCGGTCAGGTGCTGCACCGCTGGCGGCGTAACATTCATTCAAGCTGTTCCCCGTCAAAGTAGCCCCGTTATCCACGATGGCCTCTTTTCTAGCACATGCTGCACGGCGGTGATGGCATACGTGCCGTCGTTCACGGATACTGACGCGGCCGGAACGTCCTCGGCAGCGTGGGCGGCAGCTTCAGCTCCATACGCTGTATTCAAGACACCGTCAGGAAACACGGGCTCATTACCTTCACGCCGTCGGTAAAGGCTGACTCGCACTCAGGAATGGCAGTCGCATTTCGAGGAACCAGGCGAGTACGGAGGGGAGATGGAGGATGTAAGCGATGCACGAGCGTCAGCGTCCGGGGTCTGGCTGTTTCAGCCAAGCCAGGACAATCACGGATGCTGATACCGGCATAGCGTCCTCCTTCGCCAGGCTTCTCCTCAGCCAGTTCCCTGGCTTCGCTTCTCTGCCTGAAATCCACGGTCTGCGTTTCCAGCAGTCCTGTTTAATCAGCCACGGCAGGCGTGTGCCTGCCCCGGCTGGTACAGCCTAAGAAGCATCCATCTTCGTAACATTACGACCGTAACGGCAATGGCCTGCGTGAGTCTTCAACAAGTGTGTCGCGTCTACGAGCCGTGTTCGGGTCAATCGAGTTCACCTCCAACGGCATTATGGCGGTCCTTCATAGGGCGTGAAGCTGTAGCGAACGGTGGCCACCCTAGATAAGGCCGGGGGTAGGTTACTGCTTTATCACGGTCCTCGCACGTCTTATCGACGGTTAGGTCTGCCCGTAGTCCTCAGATCTTACAGTCGACCCGCTCATAAGAAACGCCGAGCAATACGGGACCTGGGCAGCCGCGTGTCAGGTACGCATTACAGCTAGTATTGTGGTCGGCGCTGCCAAAGCTTAGGGGACTCAATTCAGCATACGTCGGTGCTCTGGTCTAAGTATGACATCACACGCCCATTTATCCACATCCGCCTAGATCAAGACGTTTCTCCATGCCGTAGCGCGATCGGTACAGCATATCCCACAGACACCAGGCCATGTTGTTGCTGTATGCCGGTTTAAACGTTCCGTCCCAGATACCCTGTATTGCCGCGGTCTGCGGTATAGTTTGACGGCACCTGCAGAATACGCCCGCGCAGATGATAATTACGGCTCACCTGCTGGCTGCCGAACTGTAGCGCGCGTTGACCTGCACGACCAGTGCTAGGTCGCGAGGATCGATGCAGGAGGCATGCCCCATAGCCAGGAAGAAGTATCTATTACCGGCAGCTCTCGGCTTCCGGCTCCTCCTGCCTTGGGACTTCCCTCGGGGTGCGGCTTACCATACGAGGCAGATAACTGCGAGGTGAGTTTTGCCTTAATGGTGATGTCTTTCTAGTACTACAGCTACGTTATCGTATTGAACCAGCAGGGCAATTCCGACGGATTCCTGTCACTTTGAGGTTTCCACCAGTGCCTGTACACCCGAAGGTAAAGCGCAGACGTTCATGTTGCAGAATCTGCATCGTCGGTGATCGGCGTGTCACCTCTTCACTTCCGTACCCAGCACCGTCTCCACGTCTAAGGATTCAATCCTCAGGCGGAGTCTGATGCTCCTGCTACCAGCCGGAACACCGTGACACGGATATGTTGGTATTCTAGCCGGTCCAGCACCGGCGATTACTGTCATGATAGGACGCTTTAAGCCATCCAAGGACCTTCAATCGGGCCCTTCGCTGATGATCCAGTACTCAGCAACTTCGTGGACTTCAGGTTGTCCTTCGCTTCGCGCGTTCGCTCCCTTACTGCTTCCTTTACCATTCCCTCACGCTCATAAACTACAAACCGCCCGCAGGCGGTTTCACATAAACAGTGCATCAGCGACCAAGTACCACAAGCTGACACCGTCCCTTCGTCTGCCGTGCGATCTCCTGAGAAACCGGTGACCCCACGCGCATTTCCCCGTACGAACACGGCAGAACATTGCCGGGGCAACCATGTTATCAGTGAGGAAATAGGTATGTTCATTATTATAGGGTTACGGGCCATTTGTTCTGTGCCCGGATTCAGTCCCTGTCACACCACTTAAGAGCACCATACTGGCACCGAGAGAACAGGATGCCGGTCATACCACCGGCCCCAATGGCTCCTTTCCGAGTTCTCGCGGAGGAGAGGAGCGGGAAGAATGCGGAGAGGAGAGTTCGCCGCGGACAATCTTGGAAGATACGCCACCTGACTTGGCCCGGCGACTCTGGGAACATATGAATTACAGCAGGCCATCAGGCAGAGTCTCATGTAACTGCGTTACGACCCGGACGTGCTGACGTCCCGCCCGGCAATCGTACTGATACCAGCCGGGTTCGCTAATTCTGACGAAACGCCGGGAGCTGTGTGATGCCCGGATGGCTTCAGCCCCGTTTTCACGAAGCATCATGCGGCGACCAAAAGCCTTTAAATGCCGTAAAGCAGATGCGCTGCCCCGATGCCCGTGACGCCAGAGGAGTGTGCGTCGCTGCCATTTGTCCGGTGTACCTCTCTCGTTTGCTCAGTTGTCAGGAATATGCTGCAGCATCGCCGTTGGTCCGCAGTAGTAAATGCGGCGTGATTCGGCACTGATGATGAACCAAACAGCACAGCAGGATCGCCCGGCTGTGCCGCCTGACGGCACCTGATAAGACCCGTCTCTCCAGATTATCCAGATAGAGATTCTGATAGAGTTACAGTCCTGACATAGATGAAAGTCCGGCATCTCAATGCCCCAGATGATAAGCAGCCGGAACAGTGTAACAGTCGTCACACGGTGCTCCCAAAGCGCCGCCCGGGTGATGCGGCTGGCACACGAGAACTGTCTGAATCGTCGCTCAAGACCAGCCACCACGGCAAATCAACTGCACCTTGCAGCCGCCGGTCGGCCTCACTCAGCAGGCAGACCACCGGGGTGTCCTAACAGCGCCACAATCTCACCCTGCATTTCGCCTCAAGGAGAGCTGCGAGGAAGCAGGGAAATAAGCCCCGCGGAGGATGGAGATATTCACGCAGGGAAATATCTTTCCCCCTCGGCGGTGCTTCGGATCGCCGAAGCCTCGCCTCCTGGAGAGCTCCCCTTCGCGTGCCGGATCTCGGCTTCTTCTGTGTCATGGGATTTACTGCTTTGTTAATGGAAAGGAAGCCGCCAAAGTTGCCGACGTTATGCCAAAATGTACAACATCCAGGCATTTGCTGCATTTATCTTCGTGATATCGACGTTGGCTGGTCATATTCATCCGACAGCCGTAGGACCTCAACTAATCCGTACCGCGATAGATCAGCTTAAGTGTTGTCAGCATGATACGTCCGGAAAACATAGCCATCGTTTCGTCGGCGTGGAATAGTAAAGGAGGACTCAAGCGTGAGTCGCTGCACTGCTCAATGCGCCAGCGGCTGATCACCTCCTTGCTCCAAATCGTGAATCTGTTTCCGTTGACGACGAATTTACCGCATCCAGAAAACGGCGTTAACGATCGACTACCGTTCCGCTAACCAGACTCTGCATATCTTCTCATCCCGGTGACATATACCGTACAGGTTAGAGAAGCGTCAGCGTGCGGTACTGGTGCCTTTGCCATTCAGTTCAAACCGCTCCTAGCGAATGGGATACGGCTGATACTGTCGCCCCGCCAGTGACGGCTCACCTTTCGTTCTGCTCATTACAGAAAAGACGTTCGCATGACCTCTGTCAGGTCGATTTGCCCAGCACCACGCTGGCCAGGACTGCTCAAACGGTGCATTCATTCAGTGTTTCCTGCCGGATATCCTGCATTTCACCCACCTGTTCAAACTCTGCTGAACTCAACACGCAGCATACTGACCCGCGACCATTTTAGCAGTATAGCTTTGCCCGCAGAGCAGGCGTGGAGGTACAGAAATGAATTCCAGAGAGCGCTCTCCAATTATCGTGGCTCCTCTCGGATAAGAGGGATCGGCTTCTCTTTCCAGGTTTGGCATTCAGCCCTGAAGGCGCTCGCTGAGAATAGCCATACCAAAGCGCACCTTCTTACAGAAGGGACGAACAGCCACATCCATACCGGGTTTCGTACTTTCCAGCAGAGGCTTCCATTAGGTCAGCGGGGAACAGGCCACCATCACGCATCTGTGTCTGAATTTCATCACGGCACCCTGCGGGCGTACTACTACGCCTTCAGAGCAGCCGGACTATCTTACGTTCGTCGTCGTTGTTAATACCACATGGTTATTCTTATCAAACGTTTGACGCCTTAGACGGCTGTCCATGCTGCCCGGTACCGACATAACCGCCGGTGGCATAGCCGGGATAGTCGGTAAAGATTCCCCACGGTACGGCTGGTTGCCTCCTTCGTGAAGACTCACCACGTGAACACATCCCCTGAGCCTATGTAGCTCATATTTGCCGCCGGTTCCCAAATCCTCCGGTTTAAAATGGGAATTTCCCGCAGCGGCCTGAATGGCTGTACCGCCCCGACGGATGCGCCCCACCAACAGCCCGCCAATGGCCTGCGATACCTCCAGACATGCCCCACCATTGCCTGCTTATTAAGACCGATTTCTGTCATCATGGGACAGCACGGAACGGGTGAAGCTTAGGGTTCTGTACTGCCGGTCAGCATCGCCCCCATATTCTGTGCAATACCATCAAAGGTCTGCGTGGCTGCATTTACCTGCGACATACTGTCCGGCGCTCTCTTCCCACTCACTCCAGCCGGACTTCAGGCCTTGGTTCAGTTCCCGCGAAGCTGGTCTTCAGCCCAGGTCTTTTCTGCTGCTGACATGACGTTATTCTCGCCCTCGATCGCCCTCTTCCTTCGGCGCTTCCTTCTCGCGGCTTCCCGGTGCTTCGCCTGCTTCGCGTAAGAGCATTAGGGACCGAGCGCGTTGCCCGTTGCTGCTGTGCGAATTTATCCTGCTGCGCCCGCTGAGCCGTTCAGGCGCTCCTGATACGTACTTGTCGCCAAGTGCATCAGCTGGCGTTGTACTCATGCGTCTCATTTTATGCGCCAGCAGGAGAGTTCTCTTCCTTTAAGACAGCTGGCGACGTTTAGCCGCCTCTCCCGGATCTAGAACTGACTCTCCGTCTCCACAAATCCCGGCGCTCTTATGCTGGCTGATTTTCTCATTTGCTCGGCATGCTTCTCGAGCGTTCGTGGAGTTCTTGGGCCTGAAGCGATGATTCAACGAGGGCAGCATGAGCACTGTCTTCCTGACGATCGCCCGCAGACACCTTCACGCTGGACTGTTTCGGCTTTTTCAGCGTCGCTTCATAATCCTGTCGCCCTAGTCCCACGTGTGTCTTAATCCTGCGCTTAACAAGCATAGAG	*	tp:A:P	cm:i:71	s1:i:638	s2:i:0	NM:i:1933	ms:i:2004	AS:i:2004	nn:i:0
+11	0	utg000001l	40352	60	2106S10M1I6M1I8M1I9M1I12M2D22M2I3M1I2M2D3M2D3M1D13M2I18M3D7M1D6M6I2M1D4M1I4M1D19M1D4M1I9M1D17M1I1M2I3M1I31M1I5M1I7M3I9M1D14M1D2M2I8M3I13M3D24M1D26M1D20M1I3M1I17M1D11M1D4M1D32M2I9M1D23M1D8M2I1M1I34M2D18M1D15M1I3M4I5M3I3M1D20M1I1M1I4M2D17M3I31M2D2M5I5M1I4M1D10M1D13M1I14M3D29M1I3M1I6M2D6M1D5M1I3M2D6M1I16M3I12M1I13M1D1M1D3M2D5M3D4M1I10M3I15M1I12M1D4M2D8M1I6M2D2M2D6M2D3M1D4M2D6M1I14M1I17M1D5M1I1M3I9M7D4M1I11M1I13M2I5M1D5M2I6M2D21M3D10M1D41M2D2M1D11M1D7M2I13M1I11M3D17M1D23M3I21M1D20M1I3M1D35M2I20M1D7M1I12M1I5M1D4M1D5M1I7M1D6M3I4M3D2M1I4M1D6M1I4M1D1M1D7M1D10M8D3M1D4M1D7M1D8M6I3M4I5M4I3M1I6M2I8M2I2M2D13M5D3M4D10M1D5M1I10M5I4M1I1M4D6M1I4M2I4M2I2M1D8M6I2M6I4M2D3M6I5M3D12M4I3M3I2M1I27M3I10M1I2M1D3M2I24M1I5M3D14M2D19M2I6M1I24M1I2M1D7M2D3M1I10M1I10M1D10M1I14M3I1M1I14M2I5M1I15M1I2M1I1M1I68M1I25M1I7M1I58M3D11M2D3M1I13M1I6M3I29M2D38M1D2M1I7M1D13M2I4M2I8M1D8M1I50M2D6M5I4M2D1M1D8M1D1M2I44M2D7M1D7M3I10M1D5M3D3M1I30M2I1M1D7M1I28M1D7M1I3M1D26M2I5M2D12M1D6M5I24M1D2M1D4M1D8M1D24M1I10M3D3M1I21M1I3M1I2M2D5M2D26M1I4M2D34M1I23M1D15M7D21M2D2M1I3M1I2M2D18M1I15M1D10M1D4M4I8M1I4M1I24M1I6M1D9M5D2M1D6M1I11M2I11M2I22M2I12M1D2M1D12M1D4M1I9M1D11M3D12M1I20M1I2M1D9M1D3M1D22M2I4M1D6M1I14M1I48M2I5M2I5M1I4M2I7M1I5M1I8M1D22M1I5M1I4M1D6M1I16M2I4M2I1M1I13M1I9M3I4M2I7M1D9M4I10M1I30M1I2M1D7M1D3M1I6M2D2M1D9M1I36M2D21M1I3M1D26M1D20M3I11M1D4M1I11M3I13M3I2M3I9M1I5M1D5M4I2M1D4M1D10M2D6M1I7M1I7M1D15M1I30M1D8M1I1M2I9M1D26M2D19M6I5M2D14M3D6M1I4M5D1M1D8M3D9M2I15M1I2M5I6M1I6M1D5M1D11M1D18M1I13M2I4M1I13M1D22M1I16M2D14M2D4M1D33M1I28M1I13M1I8M1I3M2D5M1I2M1I6M5D5M1D12M1D15M1I4M1I13M1I11M1I18M1I18M1I13M3D21M1D34M1I4M2I6M4I3M3I21M4I2M1I5M1D7M3D8M1I19M1I8M2I1M1D2M2D15M1I5M3I2M2I4M1I4M2I11M2I1M2I17M2I1M1I23M2D13M2I45M5I10M1I6M2I13M5I13M1I7M2I1M4D1M1I22M1I3M1I6M1I4M1I7M2D16M2I5M2D14M2I29M2I8M2D6M2I1M1I14M1I7M2I6M3D12M3I10M2I2M1I6M3D4M1D7M1I5M1I6M1D4M1I16M1D11M1I9M3I16M3D14M2I2M1D7M2I1M1I4M1D7M1D6M2I1M1D3M2I11M1I10M3D2M2D4M2I27M2I15M1I5M1I5M1I2M1I1M1I9M1I19M1D8M2I10M2D7M1D12M2D4M1D3M1D17M2I4M1D20M1I3M1I25M1D7M3D29M1D19M1D5M2D4M1I4M1I5M2D6M1D6M2I8M1D8M3D7M1I3M2D10M2D12M2D10M2D6M2I10M1D6M2I18M1D4M2D3M1D5M1D13M1D1M1D24M3D8M2D12M2I19M2D13M4D4M1I13M4I3M3I4M1D4M1D6M1D30M1I12M1I6M1I5M1I15M1I2M3D11M3D5M5D3M1D7M2I12M1I3M1I42M2D5M2D27M1D5M2D14M1I20M1D9M1D2M1I2M2D17M1D4M1D9M1I35M1I12M1I7M1I4M1I10M4I1M2I3M1I29M4D3M3I2M2D16M1I22M1D1M2D7M3I7M1D2M1D7M4I1M4I28M1D4M1D20M2I16M1D12M1I12M1D19M2I3M4I1M1I17M1D11M1I3M1D13M1I2M2I45M1D13M3D21M1I2M2I1M1I11M5I7M2D3M1D6M1D24M1D4M2I14M2I21M2D5M1I2M3I4M1I14M1D18M1I2M1I32M2I42M1D11M2D32M1D15M2D11M1D17M3I4M1D6M2I10M1I4M2D22M1D3M1I13M1D33M3D26M1I9M2D21M1D3M1I1M3I30M1I1M1I15M1D9M2D2M3D18M1I1M1I18M1D4M3D17M2D8M1I8M1D8M1I8M1D6M1I7M3I14M1I15M2I2M1I5M1I1M1I3M1D3M1I1M1I6M1D12M1I12M2D8M1I5M1D11M1I1M2D15M2I2M2I10M2I2M1D14M2I11M1D6M2D16M2D3M3D27M2I6M1D8M1I17M3I1M1D11M1D3M2D6M1D15M1D19M1D6M1I4M1I12M1D12M2D1M1D28M1D4M2D9M1D12M1D9M1I10M138S	*	0	0	AGTAGTGTTGCTGGGCTAACCTTGCCGTTCGGGAAGCGGATTTATGAAACGGTATCGCGCTTCACATTAAACCACGCCAGCAGCGCCTGCGATTCCCTGCTCTCCGGGCATCCACGCCAGCGTGAAGCCTCGGGTCGCGGCAGATTTCTGCCCCTGCCCGGTGGCAGTCCAGTCTGCAACCTTCATCATGAGATAGCTGTCGTCATAGGACTCAGCGGTCAGTTCGCCGGGCGTCAGGTCTTTAACTTTTGCCAGACCCGACCAGTCAACGTCTGAAAGCATTCGCGTAGATTACCGCTCCCGGTAAACCCACAGCCTGTTGAGGCACCTTTCACGGCATTGTAGGATTTGGTACAGGCAGCGTCCTCCACATTTCATAGGCATCGACATAAGTCAGATCGGCTGAACTCCACAAGCCCGCATCATCGTCGCGCCGGTAGTCATAGCCGGGTGGCCACCATACTGGTGATCAAATTGGTAGACAGTGCCTGGATATCGCTCATCACATCTGGATAAATCCGACTCCATTCATCCACGCATCCAGCTCTGAATCCGGCACCTGAGCGGCAGGAAAACTTCGATATGCAGCTCCGCCTGCCAGGATGCCCTGTCCAGCTCTTCGCCCGTGTATTCAGCCCACCGGTGAGAGATAAACGGCATGGACTTGCCGCTGAAAATCCGCCTCAAGTAAAAACAGCGGGGCGACCATCAAAAACGTCGCCCCCGGGCTGTTAATGCTTCTCCAGTGCATCCAGAGTACGGCTGCACGGAGTCCAGTATGTTTCATCGCTTTATCCGGTCCTCAGTTTGATGCTGCAGGCATAGCCCAGCTGATTGGAAGACGTTCTAATCGCCTATCCAATGACTTTGTTTAAACGCCGTGGTTAGCACAGCGCCATCGGGATTTTCACCACAACCTATCATATTTTGGGGTAAAAGCCACGCTGCCAACCCTTAAGCACATCCGCATGTTTCAGTTGCTGAATAAACGCGCCGGGAAGTACAGCGACGGTTACCCACCACAAGCACGCTGCCGCCACCTTTCAGGGATGAACGGGCTCGTGCTTTTACGACGCCGCTCGGCGCGAAAGATGACGCGCATTACCCAGCTTGATTACGGGCAAATCCCCCGGTTAACTTTGATTCTGCCTGTGGATTTGACCGTGGCTTTCATAGCCTGGCCTGTCTTTCCTTTACCAGTTTCCGGCGTACCTTTGTCTCCACGGGCAACCTGTGACGCCGACTGCGGGATATCGCGGATGAAGCAACGCGGTTAATGGCCATTGCGGCGGCACCAGGCACCGCGTTTCGCTGATACGGCTGAGGTTTTCAACGGACCCGCCTGCTCAAGACCTTTTGGTACATACATCCCCCTTTCAGCGGACGGTTAACGGCAGGCTATCACACGCGTCTAGGTAAGGATGACAACTCCATCATCTAGGTGAAACCCGATCTACCCAGAAATTTTCCTCACCGATGGTCACTCATCGTGTGCCGCCACGCAGCTGCCGCTCTAATGCATCAGTCCGGACAAACAGGACGGGCTGGAGGGCTATTCAACGCGCACGCTGTCCGGCATAGTAGTATTTTCAGGTATATCATCAAAACACCACGTATCGCCGCACCTGACTGCTCACCGGATGTAATGGTGGCTGACGTTCCATGTACCCGCGTATCGTTTCATCGGCGCGGGCAAGTGGGCAGCATCGAACAGGTTATCGAAATCAGCCACAGCGCCTCCCGTTATTGCATTCTGACAGGCCGCGCTCTGTCATTTCGGCTGCCACACCGGCAGAGACGGAAACGCGTTCCCGGCAGCACAAATGCCACAGGTTCATCCCGCGTGGCGTGAAGTGCATCAGTGCAGCTTCACCAGTGCCACGTCAATCCAAGTTCAGACGTATCCAGAATCACCACGGTATCCGGCTGCGCTGATCCCACAGCGGTTTCCATGTCCGTCAGCACATTTCCCCCGGCTGAGGGGGTGTTAACCGGCAATTTCATCCGTGTCATCAAGCTCCCTCTCTCTTTCAGGTGCCACACGCCCCGGTTTTTACTTCTTTCGTCCCTAGAGTCAGGCTCAACTAACTAGTTCAGTGTTTATACGAGCGGAGACGGGCAATCCAGTTCATGATTTCGTCATGGACTCCTCCACAGAAACAATGGCCCCGAAGGGCCATGATCGAGTTACTAACGAACTCATCAGAGTCAGCCAGCAGCATCAGTGCTTATGAATCGACTAAATCTGACGGACCCTGCGCCGGATCGCCGGTGTCACCCAGTTTTTAGCCAACGGGCACAAGCAGTTTTAGATGCCTTCGCGCTGTGCGTCCGCATCCTGAATGCAGGCCGGCCGGGGTGTGCGCAGACGCGTGCCTGAGTGTTCCCCAGCATCAAGATGGCGTGTTGTCCGGCAGGAAGTTCTTTTGACCCCGTTTCCACGTACTGTCCGGAATACACGACGATGGGCCACATCGCCATACATCCCCTTATAGGACACCGCTTGCCAGGTCTTTCACGCTGTCTCCAGCTCGGAATTAGAGCCACGACGGGTATCCAGCTTCTCCTTGACGGCTTTGAAGGAAACGGAACAGCGCCAGCCTTTCGGATCGAACACGATGATATTGCGCCACCGCTGGCGTTCAGAGCGGCTTCGATATCGTCGGTCGGGTCATACGGCGTGACTTGTCACGCTTGCTCCACTCCGTGCGCCTAAATGCGTGATGTTATTATTCTCCTCACTGCGTAACGGGTCCACCTACCTTAACGGATCCGAAGGCTTCACGGTCATGGTGTATTTGCCTTAAGCACGGCAGAAACTGCCTGCATCTCTTCGACCTGAGCAAATAGGCCAGCTGCGTACGCAGTGTTGCAGGCTTGATGCGACGCGGCGGTAGTAAGCCGGGTCGGGCCAGATTCTGCGTGATTCATCCGGCAGGCGACGCAGGGTCATCTGCGGATTCACTTCGCCTGCTTCTGAGTGGCATATCCCGGCGTAATTCAGGATGAGCCCACGGAGAACGGATAACCTCAAGCGGAAACAATCGGCGAACGTGATCTCAGCTAGGTCAGTCCCGGAATTTGTAGAGAGATAGACTTTCTCCGTGTGAAGGGGATAGCTCACGGAAAAGGAAGCAGAAACAGCGGATCAACTTAAATTTCTGCTCATTTGCCGCCAGCAGTTGGGCGGTCTTACATCGACATAAAATCCCGTAAAAAGCCGGACAAGGCGGCCTTCAGTGATGAAGGGTAAAGTTAAACGATGCTGATTGCCGTTCCGGCGACAAACGCGGTCCGTTTTTCGTCTCGTCGCTGGCAGCCTCCGATCAGAGCACATCCTCATAACGGAACGTGCTCAACTTGTAGAACGTCAGCGTGGTAGTGTCTGGTCAGCAGCAACCGCAAGAATCGAAAGGCAGGGATTATGGTGGTATGGCCAACGGCAAGAGCCCGTCGGTGAGTGAGGGCATAGGTCGCAGCGCTGGCACTGACCCGCCCATCGGGGGCGTACTGCGGCATGTTCGCACTCAGATTAGCCGCCGGGCTGAGGATTTGCGTATAACAGTATCCTGTTAGGTCCAACATGGGACCCCTGTTGGTCTAGATCCTAGCATGAACGCCTACGTGCCGCGAGCCGTCTCGGGGACCCCTCTGCCGTAGCTGCAGCCAGCGGTGCCGGTGCCCCCTGCATCAGACGATCCAGCGCAGTGTCACTGCGCGCCGTGGCACTCTGTGATGCTGCGGCCAGAATGCGAGTGGCTTTCACGGTCATACGGGGTTTCTTGCCAGCACGATCGTGCCTGTTCTTCGCGTCCGTGAGCCTCCTACAAGTTGAGGATCCCCATAATGCGGCTGTTTCTTACGCAACCGCTTGCGGTGATCTGCGCGTTCTCACGTCCGGCTGCTAGCCGCGCTCGCGTTCTCGCTCGCGCTGGGCTGGCACCACGTCAGTAGACGTCAGCCTGCGAAGCAGTGGCTGAAACAGTTGTTGATTGAGTCTCTGTTGGTCATTCGCCCTCCTGAGAGACGGGATTACGGTGCATCCAGTGCATCACGCATGACGGTGATCGCATCGGTGCTGTTAACAAGTTCATCAGCCAGTCCGGCAGCATCAATGGCCTCCGTAAATGGGTGTGTACTGCAGCCTCGGTATCCAGCACAACCTGCACGGACAGAGCGGTATATGCCGACACCTTCTGCGCAAACATCTGCGGGTTGCGTCCGTATCGATAAATGCAGTGTCTCCCAGGACGTCATCCGGAAGATGGCTGTAGGGTTGCCATCCACCTTATGGCTGCCCTGTAATCATAATCTATTTCCACTGCGTTTCTCCAGCGCAGCACCGTAATTACTGTGAGCCATCATGACGGATGGAGCTGTCCGTCCGGCGGTCTGCGTGACCCCTCCGGAGGCGGCACTGGCAAGCAACTGACTTAAGACTGCAGTTCATTTACCGTTGGCAAGCGCCCATACCGGTTTTATGTCACGCACACGGGCGATGATGTCAGCGCAGAGTCAAATGCCCCGCCACCGGCCTAAATCGCGTGTCCATATCGAGCAGAATGCGTCCACCATCGGATCGCTGGCAGCCTGTTGCAGACGGTGCGATAATGCGTTGTAACCGGTCATCCCCGAGTACGGCTGCAGCGCCCGTCCGGCTGACGAGCGTGCCGGACACCGGCAGCACGGCGATGCCGTTCATGACCTGATAACTGCGGGCCTGTCGGTGTCCGTCAGTATCCATCGGATAATGCCAGCGTCGCGAGTGCCTCCTGGAGATCAGGCTGTCGCCGGACACCGCATCCGTCAGGCTGCTGATCCCAAGCTGGCTGCAAGAAAGCGCACAAAAGAAAACCCGCGCATAGGCGGGTTCAAGGCATCAGCGGCTCATTAAAGCGGTTGGCAATATGCGGGGAGATTACGCATAGCTCTGCTGTCACTTCTCCTCCTCTGTTGATTGTCGCGAGCCCAGATTCAATGCCTGCAGCCGCGAGGCGGGCGTCAGACCGGCTTAAAACGGCGCTCCATCGTTTCGACTGACCTGCTGGCAAAATTTCCTGATAGTCGTCACTACGCGTTTTGCGCACTCTTTCTCGTAGGTACTCAGTCTAGCTTCTATCAGCATCACCGCTTCCTGAATCTCCGTCGGAGACCATCGCCAGCCACGAAGCCGGCACGGAGCCCTATCGATCGCAGTTCCCCCAGGCACTGCGGGCTTCCCTGAAACTGAAAGCGCGCGTTGAAGGTAACGTTACGACGCGGCGAACGATTGGCCTCTTCAGCCAGAACGAGCACGAAACATCGTGCCCTCGCCTGACGGGATGCGACGAATTTTCGCCGCCCCATAAACTGCCCACGATAGTTTCGCAAGCCGTGCTGTCGGAGTAGCTCATCTGGGCGTAATTCCGGGAAAGCTGCGTACGAGACACCCAGCCCGGCGGACCGATATACCGCAGCAGTGACTGCTCAACACGGAGTAGCCGTTATCTTACGTATCCTGAGCGTCTTGCAGGTTCAGTGAGTCACCCGGCATCACAAGATTATGCGGTACTTTTGCCCTCCCATGAGCTGACGGCGCTGCGGCGTAACTGAAGCAGGTTTCACCAATCCAGCCGGTCATGCTTTTCCCGCCTGCTCCTGACTGTTCTAGCCAGAATAGAGCAATCCATCGGGACTGCGTATCCAGCTCACTCTCATTGGTGGCATACACCGCCTTAGATCACAATGGCTCTGCAGCTGCGTTCTGCAGCGTCAAGCATCTTCATCTGCTCCCCATCACGCTGTAAACACAGCGGATTTGCTATAGAGGTCTGCCGTCCTCCACGGGTTCAAAATAGGCAGACCCGAACGAGGCTCCTGCCCGCCGGGTAACTCACGGGTATTCAGGTTCCTTTCTGCGGCATCCAGCCAGGATACGTCCTCGCTGACGGTATCCCATAGCCGCGACGCTGTCATTAATCTGCACACCGGCACGGCATTTCCGGCTGTCGCCGGTGGTTGTTTCGGGTGCCTGATGCGCTTCGAGTGAACTCATCCGACCGTCCCTGAAACGCCGCGACGGACTGGTATCCCCAGGGCCTGAACGAACGAGTTCACCGTTGCTATGAATTCGACTCGACTTCTTCCCGAATCATCATGCTTAAACGTGCGTTTCGCTCAACGTCAATGCAGCAAGCAGTCATCCTCGGCAAACTCTTTCCATGCCGCTTTCATGACGCGGGCGAAAATAGGCACGGGCTTCTTCCTCCGCATTACTGCCCATAAGCTCCAGCTTGGGCGATGACTGAGCCGGAAAAGACCCCGACAAACTATTAATGCGGGTGGGTGCCCGTTGCGATGCGGGCTCGCACCCCGTTATTGCGTACTAGAGATCGTCCCGGGCGGATCAATTGCCACGGGTAAAGTTGGGCAACAGGGCTGCATCCACACTTTCACTCGGTGGGTTCCACGACCGCAACTGCCCTCCAAATCTTGAGCCCTGCCGCCACCGTGTGATAACCGGCATATTCGGCGCAGCGATGTTAGGTCGGTCCGTAGAGAAGGGTGGAATGGTGGGCGTTTGCCACTACGGACAGTCGCTGCAGGTCCCTGCGTCGGTGTGCCTCATGCCGGTCTGCACTTCCTCAGCTCTGCATTACTTTTCAGGTCAGACGCCGAAATGGCTGGGCTAACGCCCCTTCGTGCGTCTTTCTGTATCCTGTTGCCCCGTTTACCTATCGTCATCAGGTTGCACTGCAGTGCACGGCAGCGTGCAAGTTCTTCCGTCGCCGTCATTCATCCTCTCCGATAAGGCACGGGCGTAATCTTATTGCCAGTGTTTTCTGTTGGTTGCTGCACCATCCTCCTTCAATGAGAGCCCAGCAGGCACTGGCAATCTAGAGCTGCCAGCGGGAAATAATGCACGCATCCCGCCGCCAGCGCATAAACGAAGCAGTTGTGAGTCTCGCCTTGCAGTTGCTTTTGCGTGCTAGCCACAGTATTTTTCCTGCCATCCACCCATTTTCGACCTCTGCTCTTCAGCAGTCATTAGTGCGCTTCGTCAATCAACTATCCGGGTTATTCGGGGAATGAAACGCACCGGGAAGCGGTTTCAATCCCCTTCCGGCGTCAGTGTGAAGCGGTTATAATCTGCTCTTTCGCGGTATCCGTACCGATTCGGTAAGGTAAACCCCGTTTGTTTCGCCTTACGTGGCATGCTGGCCACCAAGGCCTTCCGTAGACGCTTACCCCTTTAATGGGGATTACTGAACAGCCCATGTTTCGAGCGTTCATACACACAATGGTATGCTCATAATCAATCCCGCCAGTATCCCAGCAGATACGGATATCGACATTTCTGCACCATTCCGGCGGGTATAGGTTTATTAACCCTCATCCACGCACAGCAGCGTCTGTTCATCGTCGTGGCGGCCCATAATCAATCTGCCGGTCAACTTATCCGGAGCCAGCTTTCCTCACCATCCCCCATCCCCCGACGCGCATTTCGTAGCGGTCCAGCTGGGGAGTGGGATACCCGGGAGTCAAGCACGAGAGAGACGCGGAGGGCGGACAGTAATGCTCTTCCGCTCTGCTAATACTATTCAGCATCCGGACGTTCGCCAATTTTCGCCTCCCACGTCTCACCGAGCGTGGTGTTTACGAAGGTTTTACGTTTTCCGTATCCCTTTCAGTTTCATCCAGTCTTTGACAACTGCACCCGGACTGCGTGCCGTACACTGTCCCATGCAAAGGTCACCACTGTCAGGTGGCTCAATCTCTTCACCGCTGACGAAAAACCAGAGAATTGCCATCGACGGTATCAGATCCCAGAGGTTGTCTTTTCGCAGATATAACGGGCATCAGTACACGTCACTCAGCTCCTGCTGGCGGATCTACGCAGGCATTATGCTCGCAGGAAACACGGCCCTGGAGGGATCATCCGGCGTTGGAGCATTTGAGGCCAAACGGCGTCTCTTTGTCGCCAAATTTAAGATACTGCTCTCCTCCCCGCAATGCGGGCAGGCAACATGAAAGCCGCATAAAATGCGGGTACGCATTCGTAGCACGCTCGTGAATATCTGACAGGTGCCTCTACTTTTGTGAGTTAGAACGGATGGACTTAGAGCCAAACCGAGCCTTCAATACGCTTGTCACCCAGGAACGTCGGAGAGCTTCCTGTTCAATATCATCAAAAGCAGCAAGTTCTATACCTATAACCCGCCACATCCTCCACCGACTTTCACGGTAGTTTTGCCGCTTTACCGCCCAGCAGGAGCAAGAAGTGAGGCAGCCAGGCGTGAAAGCCCCATGGCGTGTGTAGCCACCCGGTGCTTTTGCCATACACGGGGCCAGCGCCAGCAAGAGGACGGAATATCACGAATAGTCGGCTCAACGTGCGGGTTTTCATAAAGTTCTCGGCATCACCATCCGTCGGGGACCCACTCGGGTGTCCCTGCTTATGCTCTATAAAGTAGGCATAAACCCCAGCAGCATTTTGGAATAACCGACGGGCAGACTTCACCACATTCTTCACTCACGGTGATCCGGTGCGTTGCCCATCGCATTCATGATGGCCCGCTGAAAAGGCAGTGTTTCCAAGCGCCCTTCCTGGTATGCGGATTCTTTCGGAGATAGTAATTAGCATCCGCCCATTGCCAACGGCGTCTGTGGCTCCGTGGTGAACAGTGAGCACGAAGCCCGGCGCGGACAAATGCCGCAGCCTAGTTTAACCTGACTGTTCGATATATTCACTCAGCAACCCCGGTATCACGTTTCATCCTAAGCGGCTGCTTGTTCATGGCTTTGATGATATCCCGTTTCCAGGAAATGACATGTCGGGTTTTCCGTTTAGAAAACGCCGGTGCACCGACAGGGAGCCCGTCGAGAATACTGGCAATTTCACGCTTGCACGATCCCGACAGCACGAAAGTACAGAATGCGGTTTCCCACTTCAGGCGTACCTGGCATTCTGTGCTTCCTGTGCCTCGTCGCTGCGTGCACGCGTAAGTCGATGGCGTTCATTGATCCAATAGTTCCTGGCTGGAGATTCTGCCTCGGTGGCCTGCCGCAGTTCTTCAACCTCCAGGGCCGCAGCTTTCGTTCTCAATTTCAGCATCCCTTATGCATACCATTTTATGAATGCAGGTCATAAAGCACCTCTCAGCTTGGATTTGCCTCGACGAACGGGCATTCCCTGTTCCTGCCAGTTCTGAATCGTGACTAGATACTCGCACCGAAAATGTCAGCCAGCTGCTTTTGTTGATTTGCATGTTCATTCTAAAGGACAAAACGACGCCAGTAAAATGCTGGATGTTCCTTCCGGGCCTATACTAAATAAACATTAAGTTATGAAGCAAAGAAGAACGCGAAAGCCGGTAAACCGGAAAATTTTCATAAATAGCAAACGCCGCGAGGTCGCCGCCACGA	*	tp:A:P	cm:i:136	s1:i:1291	s2:i:0	zd:i:2	NM:i:1635	ms:i:5086	AS:i:5086	nn:i:0	SA:Z:utg000001l,38255,+,18S228M4I9155S,27,38;
+11	2048	utg000001l	38255	27	18H19M1I7M1D5M1D8M1I3M2I26M2I7M2I26M1I4M1D4M1D14M1I26M1I11M1D12M1D3M1D3M1I2M1I11M3D6M1I21M9155H	*	0	0	ACCTTGCCGTTCGGGAAGCGGATTTATGAAACGGTATCGCGCTTCACATTAAACCACGCCAGCAGCGCCTGCGATTCCCTGCTCTCCGGGCATCCACGCCAGCGTGAAGCCTCGGGTCGCGGCAGATTTCTGCCCCTGCCCGGTGGCAGTCCAGTCTGCAACCTTCATCATGAGATAGCTGTCGTCATAGGACTCAGCGGTCAGTTCGCCGGGCGTCAGGTCTTTAACTTTT	*	tp:A:P	cm:i:6	s1:i:57	s2:i:0	zd:i:1	NM:i:38	ms:i:228	AS:i:228	nn:i:0	SA:Z:utg000001l,40352,+,2106S7061M100I138S,60,1635;
+12	4	*	0	0	*	*	0	0	CGTGAGTGGTTAACAGCGCCTTAGTGCCCTGCTGCGTAGCTAACAAGGCTGCAGCCTGCTCTTATCTCTCCGGCAGATTTCCAAATGCCAGCGTGAAGCGCGGTTCTCTTAGCAAGATTTCTGGCGCCGGCAGTCTGCATCTTCATCATGAGATAGCTGTCGTCATAGATCAGCCGTCAGTTCGCCGGGCGTCAGGTCTTTGATTACTTTTGCCAGACGCGACCAGTCAACGTGAAAGCGACTTCGCGTAAGGGTCACCGCTCCTAGTCAAACCGCACTGTTATCGAGCAGCTTTCACGGCATTAGGATTTGGTACCACAGGCAGCGTTCACATTTCATAGGTAATGACATAAGTCAGATCGGCTGGAAGTACCTAAGCCCGCATCATCGTCGCGCCGTAGTCATAGCCGCTGGCCACCATACTGGTGATCAAATCGTGACAGGGTCGGGATATCATTCATCACAACATGATCCGGGACTCCCATCCACGCATCCAGCTCTGAATCCTAAGCGGCCGGACGGCAGGAAAACTTCGATATGCAGCTCCGCCTGCCATATTATCATGTCCAGCTCTTCACCGTGTATTCCAGCGCCGGTGAAGATAAACGGCAACTGCCGCAAATCCGCCTCATCAAAGCCTCGGCGACCATCAAAACGTCGCGGTGTGCTATTGCTTCTCCAGTGCATCCAGTACGGCTGCACCGTTGCGTTATGTTTCATCGGATTTATTACCATCCTCAGTTGATGCCTGCAGCACAGCCCAGCTCTTTCGAAGACGTTCACGCCGTATCCGCTCAATATTTTGTTTAAACGCCGTGGTCAGCGGCAGCGCCATCGGGATAGTGCATTCACCACATCAATCGGTAACGGCTTTTTCCCATTACACGCTGCATGACATGCCACCGGCCTTTTCAGTTGCTGAATGGTAACGCGCCGGGGAATACGACGGTTACCCACCACAAGCACGCTGCCGCCTTTCAGGGATGAACGCTGCCCCTTTTACGACGCCTGCCTGAGGCGAAGGACAACCCGCGCATTACCCAGCTTGATTAAAGCGATAAATCCCCCGGTTAATTGATTCTGGCCTGCGGATTTTGACCGTGAGGCTTTTCAGCTCGCCTGGCCTTTCCTTTACCAGTTCCGGCGTGTTGTCTCACGGCAACCTGTGACGCAGGACTGGGAGATATCGCGGATGAAGCAACGCGGTTAGTATCCATTGCGGCGGCACCAGGCACCCCCGTTTTCGCTGATACGGCTGCTATTTCAACGGCCTGCTCAAGACCTTTTATGGCCATACATCCCCCGCCGTTTCAGCGGCACCGTTATAACTGAGCGGGATACGCCCCCATTTAAGACCCGCCAGATGACGACAACTTCCCGCTCATCATCCGGCTCGAAGTCATGGCGATCTACAGAAATTTTCCTCACCATGATGGTCGGCTCTAATGTTGTACCAGCTAGGATTAGAGCTACATCAGTCCAATAAAACAAAGTAGAACCGTAGGGATAGGCCTTCAACACGAAGCTTTATGAGCAGCATAGTATGTTCAGGTACTTAAAAACAAGTACGTTCTTGTTT	*
+13	0	utg000001l	28356	60	29S9M1D503M1D5M3I10M1I40M1I22M1D6M2I10M1I33M2I9M1I10M1I14M2D11M1D5M1I3M1I9M4D2M1I10M1I28M2I3M1I3M1I7M1I4M1I3M1I12M1I5M3D3M1D10M1I1M3D14M1I8M1I13M2I1M1I5M1I3M1I4M1D3M4D14M2I21M1I10M1I3M1D5M2D12M1I7M2I7M1D9M2I7M3D3M1D10M5D7M1D1M2D1M2D6M1D4M1D3M1I3M1D21M1I12M1D5M1I5M1I3M2I2M1I6M4D10M1I23M1I7M6D1M2D4M1D27M3D2M2I3M1I1M1I7M1D8M2I26M1D7M1I8M4I7M3D5M1I6M1I30M1I15M1D27M1D8M2D2M1D29M1I9M2D1M1D24M1I8M1I6M1D5M2D2M3I13M2I24M3I5M2D25M3I16M1D11M3D19M2D5M3I5M1I10M3D5M1I10M1I2M1D1M1D29M1D10M1D4M1I2M1I4M2I7M2D22M1D5M2I5M1D12M3I1M1I6M2D4M1D3M3D1M1D19M1I11M1I10M2I21M4D6M1D3M1D5M1I10M3I1M1I9M7I10M1D16M1D2M1D16M1D8M5D15M1I2M2I18M2I4M2I33M1I1M1I9M5D19M1D3M1D18M1D63M1I17M2I2M1I2M1D1M1D4M1I4M1I3M1I5M1I3M1D2M1D9M3D10M2I6M3I8M1I4M2I13M1D9M4I2M2I5M1D5M2D9M2D5M1D22M2D13M1I1M2I5M1D2M1D3M1I10M1I9M1I2M1I22M3D9M1I5M3I3M3I9M1D1M1D5M1I16M4D12M2D1M1D13M3D4M1I3M1D5M1D5M1I1M2D10M2D31M2D6M1I3M2I3M3D4M3D35M2I17M1I13M2I10M5I1M1D14M2D4M1D2M1D4M1D8M2D4M4I6M1D4M1I8M1D9M1D1M1D17M2D2M9D1M1D5M1I8M1I3M1I3M2I30M1D1M1D2M1D19M1D39M2I5M1I2M2I13M3I2M2I2M2I6M2I4M1I17M2I25M1I5M2D6M2I5M2I5M3D4M1D14M3I20M1I12M5I12M1D8M1I10M1I6M3I5M1D50M2I6M1I7M1I11M1I9M4D18M1D7M2D20M1D11M2I16M1I7M2I6M1I6M2D1M1I9M5I4M1D7M2I10M1D13M3D5M1D3M2I8M1D1M1D16M2I3M1I7M1D2M2D6M2D2M1D8M1I1M2D7M1I6M3D9M5I4M1I7M1I19M1D1M1D9M3D7M2D2M1I11M2D2M1D3M1I10M3D3M1D1M2D9M1D1M1D4M2I6M2D7M1D12M1D3M1D29M1I3M1D7M1I5M1D18M1D3M2D8M2D2M1D4M1D6M2I2M1I15M2I9M2I5M1I8M2D12M1I5M2D8M1D1M1D19M2D6M1D1M3I24M3D11M4D11M2I3M4I9M8I1M1I7M1D4M1I6M1D4M1D1M1D17M2D1M1I14M1D18M1I9M2D4M1I57M1I2M1I7M1D5M3I18M2D7M1D3M1I5M1D27M1I12M2D12M1I9M2I23M1D20M1D24M2I16M1D1M1D15M1D11M4I8M3I3M1I17M1D10M1I22M1I13M1I4M1D13M3I7M2D12M7I7M2I4M2I9M2D18M1D7M1D12M1I11M1I4M1I6M1D1M2D8M3I10M2D4M1I6M1D4M1D10M1I2M1D7M1I7M1D4M1I19M13I15M1I9M2I4M1D3M2D7M1D9M1D9M1D14M2I24M1I6M4D22M3I15M3I6M1I5M5I3M1I2M1I24M1D16M1I13M9I1M5I2M1I3M1I7M2D3M1D5M2D3M2D10M5I8M1I13M2I9M2I1M2I22M1D8M1I13M4I4M3D17M2I20M1I17M1D12M2D18M1D7M4I13M2I17M1I13M3D7M3I49M1D13M1D2M2I11M4I1M1I6M1I9M1I7M1I22M1D13M4D4M3D3M3I13M2I19M1D10M1I8M3I1M1I11M2I21M1D3M57I6M3I6M6I1M1I3M1D7M1D7M1D6M2I8M5I12M1I1M2D2M1I8M1I3M2D7M1I5M1D1M2I8M3D5M1I12M3I9M1D7M1I4M1I5M1I7M2I10M1I2M1I8M1I4M2D9M1I3M1D2M1D3M2I5M1D1M2I1M2I6M2I1M3I4M2D5M2I8M2D2M3I7M2D1M2D4M1I4M1I4M1D15M6D8M7I3M1I2M2I11M1I1M1I2M1D1M1D5M4D13M1I4M1D6M2D2M1D7M2D6M5D13M2I5M1I2M1I2M1I11M1D8M1D1M2D14M3D1M1D6M3D3M1I3M2I23M1D2M1I2M1I8M2D20M1D5M1D6M1I4M3D6M3D10M4I11M4D6M4I10M5I3M1I2M3I2M2I5M2D5M1D3M2D4M1D4M1D14M2I8M1D5M1D3M1I6M1I1M2D10M1I5M1I2M11I9M5D6M1D9M2I36M3I13M2I2M1D1M1D6M2I1M1I9M3I4M1D9M2D7M2D6M2I12M6I8M1D1M4D8M1I11M3I7M1I22M1I10M2I7M1D6M1I26M1I5M1I3M2D9M1I25M2I3M2D1M1D5M2I10M1D6M4I4M1D5M1I3M1I4M2I2M3D2M1D4M1I19M2D6M1I6M1D2M1D11M2I11M2D8M3I20M3D2M2I5M1I10M2D3M1I10M2D2M1I17M1I6M2D6M7I6M1I8M1I6M1I8M2D1M1D4M4D4M2I24M1D2M1D4M3I1M2I6M1I1M2D19M3I10M3I9M2D4M1I7M1I2M3I6M1I8M3I2M1D3M2I11M1D11M1D11M3D1M1D6M1I18M2D1M1D10M3D12M4I7M2D2M2D14M6I15M3I78M1D10M1I1M1I12M2I2M3D14M2D12M2D5M1D4M1D12M4I1M2I10M5I2M1I1M1I5M2D27M2I1M1D10M1I8M2I2M1D11M1D18M5I9M1D6M1I18M2I16M1D21M2I2M4D2M1D12M1I2M2I28M1I6M2I7M4D3M3D12M2D8M2D5M1D5M2D2M1I6M2I13M1I4M4I1M1I4M2I16M1I10M1D9M1D6M3I10M1I26M3D1M3D17M7I7M4I13M1I18M1D7M1I9M3I2M2I7M1I15M1D7M1I2M1I4M1I3M1I3M1I7M1D4M2I50M2D12M1D6M1D10M1I17M5I7M5D13M1D14M1I1M1I4M1I5M1I3M1I3M1D2M1D11M2D4M1I3M1D8M1D6M2I6M1D5M1D8M1D6M3I18M1I3M3I1M1I24M3I7M1D3M1D8M1D4M2I18M2I2M1D12M3I16M2I9M1I7M1I8M3I2M2I17M3I28M1I1M3D11M1I25M1I1M3I2M1D6M1I34M2D26M3I2M1D5M1D7M1I2M4I10M2D18M2D5M5I1M1I11M3I8M1D7M2D9M1I26M1I5M4I2M1D8M2I6M5I3M1I2M1D9M3I2M3I1M1D15M1D10M1D9M1I21M1I7M1I2M1I4M1D5M1D1M3I9M1D53M1D6M1D9M5D1M1D11M1I2M3I2M2D7M1D6M1D6M1D2M1I14M1I3M1I5M2D8M1I4M1D5M2I4M1I5M2I11M1I10M1D5M1I19M2D1M1D8M1I3M1D5M1D7M2D2M1D13M2D16M1D3M2I13M3D5M2I10M1D3M1D6M2D39M3D10M1D7M1D2M1D15M1I27M1D7M1D10M1I6M1D1M1D14M5I8M1I9M4I13M1I8M1I27M1D18M1I5M2D9M4D6M1I1M1I26M2D3M3I3M2D3M1D31M1I5M3D12M1D8M1I2M1I3M1I2M1D5M1I2M1I1M4I3M1I2M2I16M1I11M1I1M1I3M1I7M3D17M2D9M6I7M2I16M1I11M4D10M3D17M8I12M5I7M3I7M1I11M2D4M2I5M1D7M1I5M2D10M1D3M2D4M1I16M1I23M1I10M1D7M1I6M1I11M8I12M2I8M1D11M1D12M1D13M1I7M1I6M1I3M3I5M2D25M1D22M1D22M2I34M1D1M2I21M1D2M4I34M1I4M1I9M2I13M2I1M1D3M1D13M2I2M3I2M2D6M1D12M1I6M1I9M1D1M1D2M1I16M1I4M2I1M2I5M1I16M1I1M2D4M1I29M3I21M7S	*	0	0	AGTCACGAGCCCATTGACTGGTCGACCACTGAGCCATCTCCGTACCGTACGCACTGACCTGCTTACTGATTTGTTAAACCGTTTGGAGTACGCTCAACGTCCACGCAGGCTCTCATAGAACGTATCCTCCTAGTGTCATCACTGTGCTGCTCTTTTCGACGCGGCAAATGGAGGGAAGCCATCAGCGCCAAAGTGTCCGTCAGCTCATAACGGTATTCACGTTAATCCCTTCAGATGACTCACACCGGTATCCCCGCAGGACAAAGACGCAATGTACCCGTTTCACTTGAAAATAGCCCACGTAAACGTACCATGTCAGGTCGCGCACGGGCCGGAGTGACTGTCTACGCAAGTGCGGCAAAGACAGGACGGCAATACACATTACGCATCGTTCACCTCACTGTTTATAATAAACGCCCGTTCCCGGACGGAACCTGTAACTAGACCAACGCTGATTACCGCCAGGCCTGTTCTTAATCACCAAGACCTGCACATCGCTGAAACGTATACGGCGACGAATATCTGCCGAATGCCGTGGACGTACGGCGTCAAACCATTCAGGATCACGTTTCCCCGACCCGCTGGCAGGGTCAACAATACGGGGAGAACACCTGTACCGCCTCGTTCGCCGCGCCATCAAATAAGTACCGCACCGTTCATCAGTACTTTCAGATAACACATCGAATGGGTTTACTTGTACGCTGACAGTACGCGTACTTCTAGAACGTCAGGAAGAGACAGATAGTCTGGCGATCAAAAGGATGGTCATCGGTCACGGTGACGGGCGACTGGATCAGTCGACGCGGTACGTTACACTGCCTCCAACGCTGGCGCAAAGCCTCAGGCCGCCTTTACAATGTCCCCGACGGATTTTCCGCCCTCAGCGTACGCTTATCGTACAGTTTTCAGCTATCGTCACACATTACTGAGCGTCCCGCGATTCGCATTCACAATTGCCACTGATATCCGCATTTTAGCGTCAGCTTTCCGTCCGTGTTAAGGGAAAGGCCGGGAGGATTGCCGCTGGTGAGCGTACGCCTGTCATAGGAGGAAGCCGTCGTTCATGAATATCTGGTTGCCCTGCGGCCACAAACAAATACGGCGTTTCATTCCCGTTTTGCTCATTAATAAATGCGATACCGATTGGCGGCAACCAACGCTCAGTTTGCCTTCCTGCGTGTCCTCCATGCTGAGGCCAAGATCTAGAGACATAATGTTTGCCGTCTTTGGTCTGCTCAATTTTGACAGCCAACCACATGGCATTCCACTTAGTCACTGGCATCCTTCCACTCTTTTAGAAAACCTCCTCCAGTCTGCTGGCGTTATCCGCGTCAGCTCGACTTTTCAGATGCTTGCTAGATGGCATTCGGTTATCTTGCCTTTGAAAAATCCATGACCTTCCGCATCATCGCTCGCCCGAATAGACGGCCTCCACGAATGCGATTTGCCAACGGTGTTTACACCTGCGGATATAAAGTAATAATCAGCATGGATGTTTGATATTGATACTGGCGGCTATCCAGTACACCTAGATTACAAGATAACGCGTGCTGGTTTCAACCTGTCTGATATCCGCAATCTGCTTTTCCCAAACGCAACTCAAACTGTACCGTCGGGTCATAACGGCAAGATGCGGCGTGGCGGTTATCGAAACTACTCACATGGAGTCATAGATCCTCGACGGTGCTGCCGGTGCCAAGGCAATCGAGAACGATACCGACGCCGGATCGCCTTGCTGCCCCACGCATTTACCGCCCGGACTGTCATGCTCGTAGTTCCCCAGCGCCAGAGTTGCGTGAAGCGGTATGTGGTTTCCGTCGTCCGGTATGAGGGGCCCACGTTAGTACAGCCGGACATGCCGTCGTCGGGTGTTACGTCAGACGGAGCAGGAACTCACGGGCCACCTTCGGTGTGTGTCCCATCGCGCCAGCACCTGATATTCCGCCGCTGTCTGCAGTGACTTCTGCGGTCAGGTGCGTCGCACCGCTGGCGTGACACCATTCACCGTTCATCTGTTCGCCGTCAAAGTGCGCCCCGTTATCACGATGGCCTCTTTTCCGGCACATGCTGCACGGCGGTGATGGCATACGTGCCGTCGTCGTTCTCACGGATACTCACGCATGGAACAGTCGCCGGGCCGCAGCGTCGGCAGCTTCAGCTTCATAATACGAGCCTGTATTCAAGCAACACCGTCAGGAACAGGCTCATTTGATCACTAGTTTAGACGTATAGACTGAACCCTCACGCTGACCGGATTGCCACTTCGTCAACCAGGGTATGGGTAAGGCGTACCCGGGCAGCACCGTGATTTCGACGGTCGAGCGTCAGCGTCCGGGTCTGGCTGTTCACCGCCAAGAGCACACAACCACCGGTGATACCGGCATAGTCATCATGGCAGATTTCAATAACATCGCCCGGTACGGGCGTGACGCTTCTGCTGAACGCTGAAATCACGGTCTGCGTTTCCAGCAGTTCGTTTTAATCAGCGCACTAAGCGCGCTGTGCCTGCCCCGGCTGGTACAGCCAAAGGCATCATCTCTTCGTAACATTACGACCGTGACGGGCAATGGGGTCTGCGTATCTTCAACAAGCTCTGTCGCCGTCTCCCAGCCGTTGTTTAGTCGCGACCGAGGTTCTACCTCAACGCATTATGGGCGGTCCTTCAGGCGCTGAAGCTGCTCGAATGGCGCGCCATCAGGTGATGCGGCATCACCACATTACTGCGGTTAAGTCACGTCTTATCCGACGGTCGTTATGCACGAACGTCAGCGTCTGCCCGCGTTCCATACACCGGCATACAGCGCATCGCCGAGCAGGCATGACGAACTCAGCCGACATCCCACGCCTTACGCTGTGTAGTCAGGTACGCATTACAGGTGATGCGGCGCTCCCCGTCCGCCAAAGCCGTCCGGCACGCACTGGTCTCACACGTACTGGCCGATGACATACAGCGCCCATTTATCTAGAACTACCGCCGCACCAAGACGACGTTCCCCATGCCCGTGGCCCCGGATGGTACGCATATCCCACGACACCAGGCCATGTTGTTGCTGTATGCCGGTTTAAAACGTTCCGTCCCAGATACCGCTGTATTGCCGCGTCTGCGGGTTATAGTTCGACGCACCTGCAGAATACGCCCGCGCAGATATAATTACTAAACGGCTCACCTGCTGGCTGCCGAAATGAGCTCCGCATTGACCTGCACGCCGACCACGAGTGCGTGTTCGGGTAGCACGTTCACATCGATGATTGCCGTATGACGACCACAGGGTTTTGTTCTGCAGCTGGTCTGTGGTGCTGTCCGTAGACCCTTAGCAGTGGATATTCCAAACGGCGCGGCGGCTGACCAGGTTACCCATCACACCGAGGCCAGATACTGGGGTGGTTTTGCCCTTAATGGTGATGTCTTTTTCCGTTACGAGACCCGTTACGTTGTATCGACCAAGGCAGGCGACTTCCGACGGATTCCTGTCACCTTTGAGGTGGTTTCCACCAGTGCCTGTACACCGAAGGTAAAGCGACGGTCGATGTTTGCAGACGTAATGGTGCGTGATCGCGTGTCATAGTTTCATTTCCGTACCCACAGCAGCGTCCCTCCAGGATGGAGGTCGACCCCAACGCGCGTATATGCTCCGTAGCCAGCCCGGAACACCACGTGACACCGGATATGTTGGTATTCCCTCGATGTTAAGCACCGGCTACTGTTCAGCAGGACAGGGGTTTTAAGCCAGGTATAATAGCAGGACTTCGAATCGGCCTTGCTGATGGCATCGATTACGCTCAGCAACTGCGTGGACTTCAGGTTGTCCTTCGCTTCCCTAGGGGTCCCCCTTACTGCTTCCTTTACCCATTCCTCACGCTCCATAAATGACAAAGCGCCCGCAGGCGGTTCCACATAAACATTTTGCATCAGCGACCAATTACAAGCGACTCACGTCCCTTCGTCTGCCGTGCTGATCTCCGGCGGAAACCACGCGTACCCACGCGCATTTCGAGTGCTAAGAACAGGCAGAACACTTGCCCTGGCAACCATGTTATCCAGTGGAGAAATAGGTGTTCTGCTTACCAGCGTTATCCGTTGTCTTAATGGGGAGTCCGGCTTTCGGTGCCAGCCCGAACCTGCGCCTACACACCACCGAGCACCATACTGCACCGAGAGAAAACAGGATGCCCGTCATACCACCGGCCCCAATCGCTTGCCCCCATGCTGCAAGGGTGGCTCCGGCGGTAAAGAATGGACGTGGAACGGGCAATGAGCGGCAGCCCCCATAATCTGAATACGCCACCTGACTTAGCCCGGCGACTCATGGGAACAATATATGGAATTAAGCCATCAGGCCGCATAGTCTCATGTGGACTGCCGTTGACTCGAACTGTCCTGACGTCTGCCGCCCGGCAATCCGTACCTGATACCAGCCGTCCTGCTCAGTTTCTGACGCAACGCCGGGAGCTGTGTAGCCATGCCCGGATGGCTTCAGCCCGTTTGCACCGAAGGTCGATGCGGAGGACCAAATCGTTGTAAATCCCCGCTGAAGGTGCACTCCATGCCCCGTGACGCCAGAGGGAGTGTGTGCGTCGGGTGCCATTTGTCGGGTAGGTAGTCACCTCTCGTTTGCTCAGTTGTTCAGGAATATGGTGCAGCAGCTCGCCGTCGCCGCAGTAAATAATTGGGGCGATCGTCCGGCACTGATGAACCAAACAGGCCAGCACTACAGCACATCGCCCGGCTGTGCCGTCCGACAACGGCACCTGATACAGCCCCGTCGCCTCCAGATTATCCAGATAGAGATTCTGGCGTTACGCCACCAGTCATCTTAACCACGATGAAAGTCCGGCATCTCAAATGCGCCAGGTACTCACATCCCGGAACAGTGTAACAGTTAGTCACACGTGCTCGACTAAAGCGCCGCGCCCGGTGAGATGCGGCACACAGGAACTTATGAATCGTCCCCCGCTGGCAGACCAGCCACCACGGCAAATCATGGTACATGCAGCCGCCGGTCGGCTCACTCAGCCGAGAGCGACCACCGGGGTGGCCTTTGCGACCAGCGCCACAAATCTCAGCCCTGCATTTCTGCCTGCAGCCGTCTTCCGGCGACATACCTGAAATACGCCTCCGAGCTATCACCGGAGATATTCACGCAGGGAAATATCTTTCTCCTAGGCGCGGCGTGCTTATGCCACGAAGCCGCACGACTCCTCCGCTGGGCGCACATCGCTAAATCGGCGTGCTAGGAGAGAGAGAAATCTGCCCATGATTTCGTCTGTCTTGTCATTCTTAAGAGGATTTACTGTAGAAAGTTGTTAATATGGAAAGGAAATGAAGCCGCCAAAGTTGCCGACGTTATTGCGAACTTACAACCGGCTCAGGCATTTGCTGCATTTATCCTTCGTGATATTAGGACGTTGTGGCCGCTCAGTCATATTCATCCGCGACAGCCGGAACTCGCTATAACCGCACTCGTCGCCGACTCGTAGTTAGAGGTGGTGCACGGTGTCGCCAGCATGATACGTCTAGAAAATAAGCGCCAATCCGTTTCCGTCGGCGTGACAGTACAAAGGAGGCACTATTCCACCGCGCTCAGGTTCGCTGCACTGCTCGAATGCGCCAGGCTGATCACCTCCTGGCAAATTGGGGTAACTGTTTCCGTTGACGAAGTTCACACCGCATCCAGGAAAACGGGCGTAAACCTTACGGACCACCGTTCCGCCAGACCAACTCTGCGGCATATCTTCCGCCATCCCGGTGACCATACCGTACAGGTCGAAACCGTTCGGCGTGGGGTCCTGGTGTCCTTCATTCAGAGTTTCAAAATGGCCTCCCCGGGTGAATGGATACGGCTGATACCGTGGTCCTCGCGTGCCAGGTGACCGGGTAGCTTTCGTTCTGCTCATTACAGAAAGATAACGTTCTCCACGACCCTGTCAGGTCGATTTCCAGAGCACCACGGCGCCGGCCGAATGCCTCCGCACGGGTGCATTCGAATTGAATGTTTCCTGATCGGATATCCTGCATCAGTTCACCACCTGTTCAACTGCCTCAAATACGGACGCCCGCATCAATATACGCAGCTGGAATAATTTTGCGCAGGTCACTTTATCTGCCGCCATAAGCCACCGGCGGCGTCCACAGAGAAAGGCATTTCCAGCCCCCGTGCTCTTTGCGAAACGACTCCAGTACGGATGTGGCCTCCTCACGGGGGACGAAAACCGTCACGCCGTACGTTTTCAGGTTGGCATTCAGCCCCAACGCAGGCGCTCGCTGAGAATAGCCATCTAAAGCGCACTTTCTTACAGAAGGGTGGGACGAAGCCATCCATACCGGGTTTCACTTTCCAGCGCAAAGTCTTCCATCGTCCACCTCCGGGAACAGGCCACCCATCACGCATCTGTCTTAACGGATTCCTGACGGGCACTGTGCGCATCAGGTCCATACACCGCCGCTTCAGAGCATCGACCTATCTGCCCGTTCGTGCCGTCGTGTCTATCACCACGACCTGGTTATTGCTCAAAACGTCCCGGACGCTGCGACCGGCCCTGTCTTCCATGCTGCCCGGTGTAAGCTAACGGACCGCCGGGCTCACGGCCGCGCATCAGCCGTAAAGATTCCCCACGCCGCCAATCCGGCTCGGTTGCCTCCTAGCTTCGTCGAAGACAAATGACCACCACGGTGAACAATCCCGCTGGCTCTATTGCCGCCGTTCCCGTAAATCCTCCGGTTGCAAAATGAACTTCGCCGCAGCGGCCTGAATCGATGGCAGCTGGTTGACGCGCTGACCCCGCTGCCGCCCAACAGCCCCGCCAATGGCGCTGCCAATACTCCCGACAATCCCCACCATTGCCTGCTTAAGCAGAATTTCTGTCATCATGGACAGGACGGAACGGGTGAGACGCTGCGCCGTTTTGCTCACTGCCGCCGGTTGCATCGCCGGGTCTGTGTTGCAATACCATCAAAGGTCTGCTGTGGCTGCACCGTCTTGTGACATGCATACTGTCCGTGGCGCTCTCTTCCTAAGCCACTCCAGCCGGACTTCAGGCCTGCCATCGAGTTCCGCGAAGCTGGTCTTCACGGCCGCCCAGGTCTTTCTGCCTGACATGACGTTATTCAGCGCCAGCGGATTATCGCCACCGTTCCTTCAGGCGCTGTTCCGTGGCCTTCCCGTTCTGCATTAACGGTTACTCGTGCCCCCGGCTTTTCGCATCGACCCATCGGCTTTGCCCGTTGCTGCTGTGCGAATTCTCATGCTGCGCTCCACCGGAGTTCAGGCGGTGCCCTGATACGATTAACCTTATGCCAAGTGCAGCCCAGCTGGCGTTGTACTCCAGCGTCTCATCATCTTTATGGCGCCAGCAGGGATTTCTCCTGTGCAAGACAGCTGGCGACGTTGGTGGCCACCGCCTCTACGCCCCAGTACCGCGAACTGACTCTCCGCCTTCCCAAATCCAGGGCGCTGCTGGCTCCGATTTTCTCATTTGCTCCGGCATCGTCTCCGCGCCGTCTAGAGTTCTGCCTGAAGCGTCAGCAGGGCAGCATGAGACCTGTCTTCCTGACGTACGCCCGGCAGACACCTTCACGCTGGACTGTTCGGCTTTTCAGCGTCGCTTCATAATCCTTTTCCGCCGGCCTCATTGTTGTAATCCGCTGCAGGATTTTCCCGTCTTTCAGTGCCGTATGTTCAGTTCTTCCTGACGGGCGGTATTTCTCCAGCGGCGTCTGCAGCCGTTCGTAAGCCTTCTGCGCCTCTTCGGTATTTCAGCCGTGACGGTCTATCGGTATCGCTCTGCTGCTGCGCATCTTTTGTCCGTTTGCTTGCTTATAGGGCCTTCTTTCGGGCGGCTCGTCAAGCGCAAGACGAACCGCTTTTCACGATCATCCCCCAGTAACGGCGCCCGCCTTCATCATCGTTAACAAAATAATCATCCTTGCTAGCAGATTCCAGATGTCGTCTGCTTCTTATACGCAGCCTCTGCCTTAATCAGCATCTCCTGCGCGGTACTAACCAGACCAATATCCAGCACCGCATCCCACATGGATTTGAATGCCAGCAGTCCTGTCTGCCCAGGTCTCCAGCGTGCCATGTCTCTTTCTCGAGTAGGCGGCCGGTGGTCATCAAACCCTTTTATGCGAGCCTCGTCGTTCGCCCCCTGCCTGCAATCCCCGGCTTCATCGCCGGGAACGCTGCAACTGAGCAACATACGCAATCTTATGGCCGACACGTTATGGAACTGGTGGCGAGCCATTGCCGTCACTACCTACGCGACGTCGGGTCTTAGTCAGCTTCCCGAAGGCTTTCAGCGACCTTGTCCACCTCGGACCCCGCCACTGCAGAGGAGAAACGCGCCACTGGGCTGATGGACGCAATCTGAGCCTCACGCCTTACCCCCGCCTTAACCAGTGCCTGAGTACTGGCTGTCTGGTTAAACGTCAGCCCTGCCGCCTGCCGGCTGGACAGGACCAGCATACGATCTGCCCGTTCAGTCCGCCTGATTTGCCGGAAAGAGGACCAGCGTTTTTGTTGAAGTGCATAAAGGGTCGTTGCCCTGATACCAGGCATACGCGACGCACCGAGTCCCCACCGCCAGCGGCCCCACCATCGGCGCATGATCGCACCGGCAGCATCCCCTGAACATGGGGATCATCCGCCGAAGGAGTCCTTCATGCCCCCTGTTGCAGCAGGATCAGACCCGACTTTGCCGCCTGCAAGCTGCGTGACCCGCGGTGAACTGTGCAGTGCAGCATACGCATGGCGGCTTTATACTGCCCGACGAAATCCCCGCCTTTCTTCAGCCGGACACTGTCATCCCGGCTCAGCCGACTGTTCAACGAACGACTGCCCATGTGTTTTTCGCATCACTTTCCGTACCAGAAAATGACGCTGACTCTGGCCATCTGCTTCGTCAATCTGGCCGCATCCAGAGACTCAAATCAACGACCAGATCGCCTACGCCCGTTGTCATACGGACTCCTCCTGCGATCCCTTCTGATACTGTCATCAGCATTACGTCATCCTCCAGTCCATAGTGCCACGATACAAGGCGGCGACCGGGGGATAACTTCATTCCCCGTCCGGGCGCTAACTCCGGACAGCGGCAAGCCCTGCCGCTTTTCTGCATATCACCTAATTAACATCATCTTCAGGCTCTCTTCGTCATCCTCGCGCCGGTTCAGACTGAAATCCAGGGATGAGGATGATGCATATCCGGCGAAGATCGCTGACGAAAAACAGGCTGAGCACGGTACCATTCAGCGGAAAATGCACCATATCCAGCAAACCATGAAAATAATGGGTACTGTAAAAGCGGTGCCAGTCGGCATACTCCGTGCATCACTCCCGGCAAAGCATCGGCACGCCAGTTGTTAGGACGGGTCGCCCCAACTCTCACGCCCATTCAGGGCAAACTCAGCTCACGTTGAACACTTTCCCCGAAGAAACAGGCCTCCTGCGGGCCCGGCGTCCTCTGTCTGTTCAGGGGACTGTTCACCACAAAGCCATACGACCAGACAGCCGGTACACCACGGGCTTTCAGCATGAGAAATTGCCTCCGTGGCCAGGTGGTAAGCATTTCCTGCTCAATCTTTACAGTAACGGCTTCATTCATGGACGGCATCTGCGTCTTCCTGCGGATGGTTATGCGCCACAGGGACCCCTACAGAACGCGCCGGTTCTTTGTCCATCGTCTTGCCACAGTAAACGTTGCGGTTTGCTGTCTATCACGCCTGTTCTGCTTACGCGTTCATCGCATCAGGCGAGATGCTCAATGCGCTGCAGGGCTGACAGTTCAGAAAGCGTGACGGTCACACCGTTATGTTCAACGGATTCGGTCGTTTG	*	tp:A:P	cm:i:208	s1:i:1626	s2:i:0	NM:i:2586	ms:i:5218	AS:i:5255	nn:i:0
+14	4	*	0	0	*	*	0	0	GGCTTTATGTTACGTTATACTAGGTCACCGAACCTGTCGGTCGCCAAAGATAGCAGTCGGGCTCCTCGCATCTATTAACTAACCAACTAGGTACAGATAATTCGTTGGCAGCGACTGTACCGACCTTCATGGCGTAGATTACTCCCAGGTAACTAGCTGTAATTATTGATGCGGCCTAACTTATGCCTAGCTGTCATAATACAAACAGATCAAGGCTACTGATACAGGCGAGCCGTGGACGAGGGACCGTAGCGCGAGCTACCGAGCATAACCACGTTTAAATGAGCCCATACCTGTGAGCGTAGCTCTAGTGTAAGGGCCAGGGTTAAGGAATTTTACCGGCAATAATAGTGCGTCCAAACATTGAAGATTGGTCACTGTCATTTGGCAATAGCTCCGTCGAGGGTAAAAGGCACATCAGATCAATTAACAAGTACTGGCCGATACATCCTACCGTTTGTCCTCAGCGAGCCGCTCATGGTCTAAATTAGACTAGCCTTCGAGGGCATTGCGGGTAAGCTTGAGTTGCAAAGGCTTTTACCCCTTTTAAAGTACGCTGTAACAAATCGATGTCGGTATTCTAAGCGAGCCAGTTCAGTGATCGAGTTGATCGATCCTGGGCCGCAGGGAGCTTACTGTCATATCTTATGTAACCCAATTTATTTCTATCGAAAGCCGGTTCACTAATACTTGTCTATGAGATCGTCTGGCACTGGTTACGTCCTCCCATCCGGGACCCAACAGAAGTATTCTATTGCGCCACCTCATGTTTTGGCCTCGAGTCGCGGTGGGGCAAGGGATATGTCCCAGATTGATTTCTTTGGTCGGTTTTCTCTGCTGTGCTCTCATTCATCCTAGCGTGCCTCTTACTTGCCGTATTTCATCTGTGAGGTTTAGGCCGTTACCGTATTACACCATCTGTCGGTTATTTCGCCTCGCAGAATCTAGGCACTCCGCTTTGTTGGGTCGCATGAGATGATGGATAAATGAGGACGGTGTCCGCTCTTTATAATCGATAGCCACTCGCACTACAAAGAGAAGTCAAATATAGAAAGTCGGCGGGCTACCCGGCTGCTATACGACAACGATCACAAATGGAAAGGTCTAAACCGGCCAAAATTGCCCACGTCCAGAAATAGTGAGTGGCTGCGAGACCGGATTCTTCCTATTAGCGTGTTTATTTAACTCGTACAAGCGTCTAAATATTCGTCTACATTAGTCACTTTAGACTAAAGCTTATCAGCCAAAGCTCTTCAGCCATCATGTCAGCAAGCCCGATAACGGACAAGCCTGTTTGTCAGGGTCTTAAAGTGTAATGTTCGTAGCTATTCTAAGGAGCCCATCTTACAGGCGCAACGTCCTGGCGTAAATTACCGTAGGAAGTACACGTCACAGCGAGTACTAGGGAGATCTGTGCCTAGCGAGGAATTTTCTACAATGGATCCATATCGATAATACCTATCCTCCTTTGGCTCGTGTTATTCGATCACTTTGGATGTTGGCCGTAACACAATCTTTCTACACGTAAAACGTTAGGTCTGTTTAGTTGGGGCCCGATGTTGCAGGATAAGCTTGGGCGATACGTTACCACCGCCATCCCTGTGTTAAACGTTTAATGCTTCCCAAACTAGAGGGATTTAAGGCGTCACAGGGGGTGCTAATTAATCGGGAGGTCTAATGAGTTAACCAAGTACACCGCATCGCCTCTATCCCTGGCAGTTTCGGTTGATATCTGCGGTCAATGTTGTTTAATTTTAGGGATAGCGTCGTTGCGCGGTCAGGCATGCTTAAGGAGATAACGAGCAAGTGGCTACCGCTAGCTGTAGGTACATGCCTTATTACAGGGTGTTATACGGCACAACGTTACTGTCAAACCATCTCATACCGAGCAGGCTTAGCACCAAGGAAGACCATCGCGGTACGTCTTCAATAGTTTCTTAACCATTGAGCAGGGGACTGTCGACTATGCAGGCCGTATTTGTACCGCTCTAGGCACAACTTTGTTGATAATATTGGCCCCATCCCAGCAATAAATGTCTATCAAGTCACCGTCGTGCCTGTCCTCATACCATTTATAGTGGAAGGCCAGTCTGTGTAAAGAAGCACCGTGTCTAATAATTGGTAGGGCTCCAACTCGGCAGCCTTAATGCATCCTTAACAATAACTTTGGTGTTATTTCGATTGTTTTAAGGTAATGATCGATAACTGGATGGCGCGGCTGCCCGTTCGGGGTCCGTGAGCAGGAAGCTGCATTGGTGCGCCAAGGGATAGCGGTTCGGTCAGCAAAGCTCTAAGTGGTAGCTAAAGACTTAGTTCTATCGGTGTCTGCCATGAGAGCCACTATACAGCGGCATAATCACTCGCAGGCGGGGTGATTTCACTTTATAGATGGCTATACTTCGTGTATGTTTGCTAAGTGGGGCCAACTAGTCTGGGCATCTGCTGTCGCTGGGTTTAAGCCATTTCCTAAGATGATTTAGGGCGTCTCTCCAGTTCTAAGCCGTTGTAATACATGGCAGATTTACTCCATGGGTACCTACTATAGCGTAAAGGCAATAGATGGAGACTGGTAACCGGATACCGAGCTAGTACGATAAGTGGCTCTAGCCGTAAGTAAAGAGCGTACTCTATCTCGTTCCTAATTCTTTGCAATTTTGAGTACACTCGATTCGGCCTGCTCTGTAACAGTGACAATACAGGCTAAATAACAGTGAAACGATGTGCTTCTGTCACTGGCTTCGCACTTGTTAAAGTACCTGGACTGTAGCGATCGGTGGCCTAAGCCGGCTAAGGATACACTGTAATGTATAGTCGAGGGCCTAAGCGTCCTGTATTTCAGGCAAGGCAGCGGTTCTTTCAAAGGTCCTTAGTTCGAAGGGCATCCAAGCGGATAGCGGCAAGAAGCTGGCTCGTCCGGCACGGTCGTTACAGTTTGGGTTGTAATTAGCGTGCGGATACCAGAGGGAGGACCGTAAGGGATAATCGGTAACTAAACACCTACATCGTCTAACCAATTTCTGGTTTTGCAACGTTCGGTTAGCGGTTCTATAGCAATAGCGCCAGCATATCGAAGCCTGCCGTTGATTACTTGTGATATTCTACATCATTCGCTCCAACAAGTTCGAGCGAAGCGTTGATAAGCAATGAGTGAGAGTCAGGTTGTATAGAATGTGTAGCGATAGCCACCGTCGCGGGGCGCCAAGGCTAAGAGAATTAATTAAATCCAACCGAGTCGAGGAGGGTCTGGGGCGCGAATGAGACCAGGCAAGGGACTACTGGGGCCCTGGAGCTACGTCTGCTTCAGTCGGCTCGGCTTTGCTCCGCACCACGATCATCTGCCTCGTAAGCCAAGTAGCTAGCGAGAGTGTGCGACTCGAATTGGTGCTCCGAGTCCTGTTTAGTTGTTGTAGCGGCACCGATGAAGCGGGACAGGCGCGGTGCTGTTTCTGGCTAGCAACTTCGGTTCTTACCCGCGACCACGCATTTGTCATGAGTTTAGTGCGGAGGCTCGGTAATTACTGGCTCGCCACCAACACATGCCGAGCGGGTGTTGCTCGATCGGATTTGGTTCTGATCAAGCGATATGCGGGCAGGCAAGGGGAATGTTAGGCAGCCCGGTGCAGGCGTCACAGGGGCCTGCTGTGTAAGCGCATATCGTGCTCTATCCTAATGAATTTCGGATAGCGTACCGACACTACACTAGCCGTTAATGTCCTGTTGTTAATGGGGCATGGCCCTGCGTCGGGATTTGGTACATTTTGTAATCGTCCTGTCATTAGATGTCAAAATGAGAAAGAAAAGAGACCAACCTGAGGGGCATACTAGATATTTACCTAGAGAACCCTGAGTTAGTATTACGTTGTTAGAAACAGATCACAGATAGTTATGCCAACTATATAAGGGCATTATTAGGTCAGAATATTAAAGTTGCAGTGTTAAATATGCCTGCGATACAGTTGGAATTTAGAGGCACCGATACGTCAGAACTCTCAAGGACAGGGATCGGTAGTAAGGACATATTTCAGTACACCAACGACGAGATTAAACAGAACGTTAGTTAGGTTATAACAGTTTTATTTAGGTAAGTCATAACCACTGCCGTTAGGTATGTTACAAACCGTGAAGGTTAAGTCATTAATTACACGAGATGTCAAGTGGTCCGATTAGTATATTTGGTTGTGAGAAGTCCACCACCGAGTAGTTCCAAGTATAGAGAGGTAACAGTCCGTACAGGTAATTAAATTTGGGATGAGAGCTTTGGCTAGAAAGTACACTTAGTCAACTCCGGCGATGACATTACAAACACATAGGTTTGCTATGTCAGAAGGTACTTTTAGTGTAAAGGTAACTACAGAGACATCTGATATGTTTTGGCGAAAGTACATACAGGGTATAGAATATTACATGGCAGATGTACTTAAGTTACACAAGGCGTTAGACCGACAGGTAAGGAGGACAATCCATAAAGCGATGTTGGAGCACATAGTCCAGTACACTTTACATCGTACCGTTCTATTTACAACAGTCTAAATGGTTCCTCAATACTTGTGTTAAGTTGGGCGATTAAGATAAGTTGTAACGATTTTGTTATACCAATAGTTCGTAATTTACTTACCCATTGCAGCCATGGAAGGAGTCGATAAATTGTAATTTGTAAAGTGACAGGCGAACTAAGTCACCAACCATGATGACAGGGAAGGCAGTCGGAGTCAATAATTAAAATTTGGCCAATCGGGCAATAGGTACAGGCCGTTGGCGATGGGGTCATAAGCTGTTCGATTAGATACACCAACATTGTAACCTAAAGTATTGTGATAGACAGTGTAAAGTATTTAAATTTAGAGAAAACCATAGAGATGTAATATAGATTGGGATTGGCTAGTGGTATTAGAAGTTTTCCTGCTGGCCGTATAGATGGCTGTCCTAATCGGGGTTGTAATTTCGCCGAGTCCCGTTAGTTAGTCGTTGGCGTCCCAATCGTAAATACTGATCAATAGGCTTTAAACGATCTTCGTTAGGATAACGTAGATGAGTCAAATATAATTTTTATGTTAATAGAAGTTTCCAATATATGATAACTGAACTATTTCGTAATTAAAGTCAAGATTATAAGGGATGTTAAACAACCTTTAACGCAAAATTTTAACTAAGAGAGTTTTATTTGGTGTAGAAGGTAACAAGAGTACAAAAGGGATAAACACAACGAGGACAGTGGTACATGGTAACTATTAGTAACGTTTTTACATGGTGACAAAGCCTATCTAACCTTTATAGCACTATAATATTTTAGGTCAATAGCGAGAAGTTAGTCAATTCAAAAATACCATTGCTCAACGTTCTCTGCCTCGATCGGCCGTATACGAGCTAGCGGTGTTTTGTCCAATTACAGTCGTAAAGTACAAAGTTTAAACTAAAATAGTTGAGTCAAATAATTCAAAGGGTCAACAAACACAAGTATTTCGGACTTGCTTAAGATGAGTTTTAAGTAACTAAGTAACGTTGATAGAACCACGAGATAGTCCGGGCGACGTCAGTTTAGATGAGGTCCAAGGTTTCAACCGTCTTTATCACTCTTTTATCACGTACCAAAGCATTTCAAGGTTAATTCGGCGTCAAGTCTCTTTCAATTAATACTGTTTCGATAGCGAGCACGTTGATGGCAGGAATGGTTTATACCCAAAGCTCGTCTAATCAGTAATAATTTGGTCCTTTCAT	*
+15	0	utg000001l	43287	60	11S13M1I5M1I13M2I10M1D17M2I15M1I44M1D13M1I3M1I6M1I13M1D9M2I14M2I32M1I12M1I6M2I9M2D17M1I40M1I1M2D11M4I23M3D7M3I5M1D2M3D34M1D7M2D25M3I19M2I1M1I4M1I9M1I7M1I1M1I3M2D7M2D7M1I1M3I12M1D45M1D42M1I7M1I16M1I24M1D10M5D15M2D13M1D1M2I2M1I6M1I12M1I6M1I6M1D7M2D18M2D9M3I7M1D1M2I4M1I2M2I4M3D4M2I12M1I20M1D4M1D5M1D9M3I2M1D21M1I1M1I5M1D6M2I22M1I2M1I2M1I17M1I7M1D5M2I5M3D3M1D5M2D9M1D21M1I13M2I32M2I22M1I4M3D20M2D6M1D25M1D8M3I1M1I5M1I5M3I10M1D9M1D10M3D7M1I4M2I10M2I13M2I12M4I13M3D9M1I11M2I14M1D3M2I8M3D5M1D5M2D49M1D11M1I6M1D4M3D2M2I9M2I3M4I3M1I5M3I5M1D5M1I7M1I5M1I18M2I2M1I5M1I25M4D6M2D5M1D18M2I30M1D4M3I15M1I16M1D55M1D3M1I10M3I21M5I7M3D6M1D6M1I10M1D2M1I3M3I2M1I22M1D5M3I8M1D11M3I4M1D33M1I35M1D6M2I21M1D18M3D6M1D1M2I11M2I28M2I6M2I1M2I30M1D15M1D6M3D34M1I16M1D5M2I9M2D2M1I5M1I4M4I16M1D6M3D9M1I3M2D8M1D27M2D4M1I2M2D10M3D16M1I4M1D4M2D3M1D19M1D1M1D11M2I2M1D6M1D3M2D9M2D31M2D7M1D5M1D20M2I12M1D7M1I1M1I11M1D2M1D13M1D3M1D29M1D5M1I4M2I8M2I2M1D10M6D9M3I37M2D2M2I15M2D2M2D1M1D4M2D22M1D5M1D10M3I31M2I5M3D33M1D27M1I1M2I37M1I3M2D10M1I15M2I8M1D6M2D1M1D5M1D1M1D24M4I10M4I17M2I5M3I3M1I28M1D4M1D7M2D8M2I19M1D18M1D11M1D9M6I5M2I1M1D3M1D5M1D4M2D4M1D6M1D46M2I1M1I14M1I32M3I37M1D9M1D1M2I18M2D4M3D1M1D16M2I3M3I12M8I3M1D2M1D6M1I4M1I10M1D12M4I15M2I33M498S	*	0	0	CTATCTGTTTAACCTCGGTTTTGCGCACTCTTTTCTCGTAGTATGATGAGTCCGTCTCTATCAGCAGTACCGCGTTTCCTGAACTTCTTTCCAGACCATCGATGGCCAACGACCGCAGCCTATCCAGTCGCAGTTCCCCAGGCACTGCGGGCATTCCTGAAAAACTGAAGCGCTTTTGAAGGTAACGTCACACGGCGGAAATGATGGCCTCTTCGAGCCAGCACAGAAACATGGGCTCGCCTGACGGGATGCGAGACGAATTTGCCGCCCCATAAATGACGCCACGACTCGTTCGCACTGGCCCGTGCCGTGGAGTAGCTCGATGGGCGTAATTCCGGCCGGGAAAGCTGCTCATACGAGACGAGCCCGTGGGGCAGCATACCGCAGCAGTGACTGCTCAAACACGGAGTAGCGTTATCTAATCTGAGCCGTCTGCAGGTTCAGTGAGTCACCCGGCATCAGGTGCTGGTGTACTTTTGCGCCTCCCAGCCGCGTAACCACTGCGGCATCATCAGCGCGGCAATTTCACCAATCCAGCCGGTCAGCCTTTCTTTGCTGCTCCTGACTGTTCGCGCCAGAATAAAATCCATCGCTGACTGCGTATCCAGCTCACTCTCAATGGTGACCGGCATACATCGCCTACCAATGGCGCTCTGCAGCTGCGTGTTCTGCATGTCGGAGCATCTTCATCGTGCTCCATCACGTAGGTAAAAAGATTTTGCACCGCGAGGTCTGCAGTGTCCCCACGGGTCCAACGTGAATGAAAGCGAGGCGCGCCCGCCGGGTAACGACGCAACTTGGGGCCATGAGTCCATTTCTGCGGCATCCAGCCAGGATATCCGCGTCCTGACTGATATCCCACGCACGCCGCACCGCTGTCATTAGTACGTGCACCGGCACGGGGCAGTTCCGGCTGTCGCCGGTAATATGTTTCGGGTTGCTGATGCGCTTCGGGCTGACCATATCCGGAATGTTTAGAAAAGCCGCGACGAACTGGTATCCCAGGTGCTGAACGAACAGAATTCACCGTTAAAGGCGTGCATGGCCACCTTTCGTCCGAATCATCATGGTAAACGTGCCGTTTCGCTCAACGTCAATGCAGCAGCAGTATCCTCGGCAAACTCTTTCCATGCCCTTCAACCTCGCGGGAAAGGCACGTGAGGCTTCCTCCCCCGATGCCGATAGCGCCAGCTTGGGAGATGACACTGAGCCCGCAAAAAGACCCGACGATATGATCCTGATGGGTCCAGCTGGATGGCGTTGGCGGCACCCGTTATTGCGTACCAGATCGTCTGCGCGGAACATTGCCAATAAATTGGGATAGAAGGCTGCATCGGATTTCACTCGGTGGGTTCCACGACCGCAACTGCCTCCAAATCCTGCTGCCCGCCTCTTAACCGGGATGGTTTGGCGCATACAATGTATTCATGCGTCCGGGCCCCAGAAGGGTGGGAATGGTGGGCGTTTTGGGAGTACATAAAATCCTGCAGGTCTCCCTGCGTCGGTCATGCCGGTTGCACTTCCAGCTCTGCAATATATGTTTCAGGTCAGACGGAAGTGGCCGTAACTCGGCCACCTTCGTCCGTCTTTCTGTACTGTTGCCACCCGTTTACCTGTCATCAGGTCATGCAGTGCCGCACGGGCAGCGGCAAGTCTTCCGTCTTCGTCAGTCAGGGTACCCTCTGGATAAGGCACGGGCGTACGTAATCCCAGTGTTCCTGTTGGTTCGTCGTGACACCATCCTCTTCCTGCAGGCTCGCCAGCAGGCACTATCGAGATCCAATGCCAGCGGAGAGAATATCACTGATGCGCAGCGCCGCCAGCGCATAAACGAAAGCAGTCGAGTGCCTCATTGCGTCGCTTTGCTGTCCACAGTATATTTTCCTGCCATCCACCCATTTTCGACCTGCTCTTCACAGTCACTATGCTGCGCTTCGGGGGTCAGATCAAAATATCCGGGTTATTCGGGGAAGTAGGCTGACGGCACCGGGAAGCGGTTCATCCCCTTCGGCGTCAGTGTGAAGCGGTTACAATCTGCTCTTTCGCGGTATCCGTACCGATTTCGGGTAAGGTAATGGGCGTTTGTTCGTTTTGCTTTGTTCACACTGCTGTACGACGCACCGGCTTTCCGTAGACGGATGCCCCTTTAATGGGGATACCAGGGACGGCCCATGTTTTTCGAGCGTTCGCTACAATGGTCCTCAGTCAATCCCGCCATGTATCCCAGCAGATACGGGATATCGACATTTCTGCACCATTCTAGGCGGGTAAGGTTTTATTAACCCTCATCCACGCAGCAGCGTCTGTTCATCGTCGTGGCGCTCACCATAATAATCTGCCGGTCACGTTCGATGGAGCTTTCCTCTCACCCGGCCCCCATCCCCATACGCATTTCGTCGTTAAGCTGGGAGTCGATACCGGCGGTCAGTACAGGCCACGCCCGTCACCAGGAACGGGCGCTGAATAATGCTCTTTCCGCTCTGCCATCACTTCAGCATCCGGACGTTCTCATGATTTCGCCTCCCACGTCTCACGAGTGGTGTTGACGAAGGTTTTACGTTTTCCCGTATCCCCTTTTCGTTTTCATCCAGTCTTTGACAATCTGCACCCAGGTGAACGGGCTGTACGCTGTCCAGATGCGGAAAGTACACTGTCAGATAGCTCAATCTCTTCAGCATGGATGACGAAAACCAGAGAATGCCATCACGGGTCTAAGTCCGTCTTTCGCACCAGATAACGGGCATCATAGTAAAGTTATTCCTCTCATCGGTGGATGACGCAGGCATTATGCTCTAGCGCAGAGATAAGATAACACGCTGGAGGGGATAATCATCCGGCGTCCATTTGAGGCCAAACGGCGTCTCTTTGTCGCCAAATTTAATACTGCTCCCTCCCCCGCAATGCGGGCAGGCAACATGAAAACGCATAAATGCGGGGATTCACTGGCCTATCATGGACCGTAATTGACAGTGCCTCATTTGGCTGGAGCCACGGATGGACTTTACAGACCGAGCCTTCAATACGCTTGTCGTCACCCAGGAACGTCGCGAGAGCCTTCCTGTTCAATATCATCATCAAAACAGGCAGCAAGTTCATCATAACCCGCCTGACGCAGCGACTTTCACGCCTGCTTTTTGCCGCTTTACCGCCGGCACGAAGCCACGCCGTGTATCGGGCCCAACGCTTCATGGCTGTAGTAGCCTGTATCCCGGTGCTTTTTGCCATACACGGGGCCAGCTAGGGAGAGCAGCGACGGAAGATATCACGAATAGTCGGCTCAACGTGGGTTTTCGGGGTCCAAAACAGCTCCATCCATTAAGCGAATACCCTCCGCCTTGCTCGTAGTCATACAACGGACGAGGCTCTACGAGGCAAAAGAGGTCTTTGGAAAATAACGCTGAAGACGTGAACGACGAGGGTGTCGACGAACATGTAGTCGGTGCCCTATACTTCCTTCATGGGTCTAGGTGGCGGACCGAACATGTTCAACGAGACAAAAGTCAAGTGGTGAATTCATTTTCGCTGGAGGAGCTCATACGATTAGCGACTTAAGGAACAGCGACTTCATGATAGCGTCTTAGGCGGACTAGTACATCCCTCGAATAGGGGCTAGATCCGCAACCTGTTAATAAACTGTTCGACGTGGTTTGTCGAAAGGCCAAAACGAAACCCGCGGTGGCGTTGATGACAGGACGGCTGATTTGTTCGTAGCAGATTCTCTTACGTATTAAACGCGTTTGAGGAAGTAAAACGGTACTGATTTCCGATTTTCGTGCGCAACGCAGGCCGA	*	tp:A:P	cm:i:99	s1:i:885	s2:i:0	NM:i:668	ms:i:2802	AS:i:2802	nn:i:0
+16	0	utg000001l	23539	60	150S9M1I1M1I9M1I11M1I9M1I3M2D13M1I8M1I10M3I8M1D4M2D12M3D8M1I2M1I14M2D2M1D3M2D4M1I1M1I24M1D2M1I2M1I9M1D8M4I2M1I8M2I2M2D16M3D9M1I7M1I8M3I2M1I4M1D6M7I18M1I3M3I4M3I3M7I23M2I4M1I16M2I10M1D13M1I9M1I9M2I7M1D11M2I5M1D6M2D1M1D20M1D8M3I4M2I1M1D7M1D1M2D5M2I1M2I3M1I3M1I7M3I2M2I4M1I14M3I2M1I5M1I11M1I10M1I2M1I1M1I9M4I7M4I10M1D25M1I4M2I7M2I3M1D4M1D1M1D33M1I16M1D15M1D29M3I1M1D6M1D13M1I6M2D2M1D2M1I8M6I8M1D7M3D1M1I3M1D4M3I21M1D12M1D4M3I7M1I9M1I4M1I16M3I2M1I7M5I1M3I43M1I2M4D4M1D1M1D25M2I35M4I16M2I9M1I6M1D2M5I3M1I27M4I7M2I5M3I5M2I19M5I7M2D9M4D10M4I1M2I6M1D10M2I3M4I10M1I2M1I10M1I16M1I2M1I7M1I12M2I3M4D7M2I16M3D2M5I13M1D3M2I14M2D11M1I4M1I2M4D6M1I2M3I3M2I11M1D7M1I16M4I1M1I3M2I14M1I6M1D4M2D2M2D2M2D6M2I8M2I2M1I2M1D3M1I16M1I4M1I8M1I4M2I7M1I3M2D9M1D37M1I11M1D12M1I4M3I21M1I20M2I8M1I7M1I14M1I17M2I1M1I26M1D15M4D6M2I10M1I18M2D11M2I11M1D12M2D19M1D6M1I24M1D16M4D10M3I1M2I4M2I6M2D6M8I4M2D19M1I15M1D5M1I4M2I15M3I18M1I24M3I10M1I3M1I22M1I1M1I6M3D2M1I6M3I4M2I8M1I2M2I3M1I7M2D12M2I1M1I2M4D14M1I2M1I6M1D7M1D1M2I6M1I2M1I1M2I2M3I2M1I2M1I7M1I25M1I20M2I20M2D5M2D5M2I6M1I6M9I2M2I5M1D3M2I14M1D14M1D25M1I3M2I6M1I9M2I7M1I3M2I12M2D5M2I5M1I1M2I5M2I5M1I2M1D15M1I1M1I5M1I29M5I8M1D13M1D6M1D13M1D6M1I3M2D7M1D2M1I5M2I9M1I6M1I10M2D4M1I3M1D3M1D2M1D1M2D8M4I10M1D10M1I12M2I6M2D2M1D16M1I14M1D7M2D20M1D4M1I34M1D17M1D1M1D5M2I8M1I5M1D2M1D12M1D1M1D14M4I21M3I5M1D3M1D13M1D16M1I2M1I3M4I14M2D7M1I8M2D6M1I1M2I16M2D9M3D17M2I5M2I1M2I5M3I5M3I5M1I13M1I8M2D6M1I15M1D9M1I2M1I8M4D12M1D1M2I3M1I1M2I15M2D4M1I31M2I18M4I4M2I13M1I17M2I2M3I1M2D2M1I9M1I3M3D9M2I1M1D1M2I15M4D2M1I11M1I7M2I8M1D9M1D3M1D4M1D1M1D6M2D9M2I3M2I7M3I5M2D10M5I9M1I10M1I1M4I1M2I26M1D1M1D7M3I2M3I6M1D4M2I1M2I7M2D4M2D2M3I3M2D2M1D3M1I5M1D7M1I6M1I1M1I2M1I4M9I2M1I9M6I1M3I7M4I13M1D1M1D6M1I4M2I5M1D4M1D12M2D3M1D3M3I7M2I3M1I7M1D6M1D7M1D7M1I1M6I4M1D4M1D5M1D11M4D3M2I18M4I8M1D10M2I3M5D3M3D3M8D3M2I1M1I3M2D9M1D10M1I2M1D4M2D3M1D12M2D1M1D5M1D19M1I6M1I4M5I3M1I4M4I3M7I11M4I8M5D2M1D3M1I10M1D13M7I7M2D35M1I10M1D10M9I6M1I16M2D3M1D1M1D5M2D8M2I13M3D4M2D1M2D5M2I7M1D5M3I8M2D8M1D1M1D8M3I4M1I1M2I5M4D4M1D23M1I6M1I6M1D3M2I16M4D3M2D13M4D9M1I2M2I8M2I9M2I12M1I3M5I5M1D6M2I5M1D7M5D26M2I9M1I6M5D10M4I13M4D1M1D3M4D6M2D5M1I6M1D21M1D27M1I2M1I18M1D1M1D5M2D2M3I5M2D3M2D2M1I5M5I2M2D8M3D19M2D4M3D14M1D9M1D3M3I1M3I4M2D12M1D1M1D3M1I6M3D3M1D6M2D23M5I3M1I4M3D6M2D1M3I6M1D1M1D4M4I2M1I4M1D7M2D1M1D5M1D11M3D6M3I3M1D8M1I11M1D10M1I6M1D11M1D3M7I13M1I3M2D8M4D2M1D5M2D4M1I10M1I8M4D1M1D3M3I12M2D3M2I11M1D10M2I3M1D8M2D3M4I5M1D4M2D3M1D8M1D4M2I7M3I15M2D4M1I5M1I10M2D12M1I18M6D4M5I10M2I20M8D10M3D2M1D3M1D22M1I7M5D1M1D5M1D5M6I10M1D5M2I1M1I2M2I2M2I7M1I2M1D8M1D2M3I3M4I5M1D4M1I40M6I6M2D11M2D1M1D4M1D7M3I4M2I2M1I7M2D7M1I1M2I10M1I3M1I7M1D3M2D5M1I10M1I1M2D6M2D8M2I4M2I8M1I19M1D6M1I1M1I6M2D9M1I9M1D3M1D8M2I4M1I16M2D3M1D14M1I2M4D9M1I9M2I7M2I6M1D9M3D5M1D2M2D1M1D4M3I3M4I2M1I1M1I8M2I6M1D8M5I1M2I10M2I11M4D13M1D13M136S	*	0	0	CGTCCTGTGAGGCATCGACTTGTCATAGATTTGAATAACTTCCCCAATTATTAGAAAGAGTTATTATCAGGTGCCCAGCAACTCGAAGATTTTCAGAGGGATCTAGAATATGGGTCGAACATACGCAAATTACGACGCTTACCGCGGAAGTGAACGAATGATTTTATATGAGGGAGGCTGTTTGGCCAAATCCGGTAACTTGCTATCCAATTCCTAGGCAAGTCATTGGCATGAATCGCATGCAGGCGAAGGACGTTGTAATGTCTCCTAACCAGCAGTTCCTAGGGACAGTGCGTACAGTCATACATCGTCGGTGGAGGTGGTCACAATTCTCATGCAAAAATATGTAAAATCGGGCCTAACTGGAAATCATTCAACCGCACTATCGGAAGTTCACCAGCCATGCGCTCGCACGTTCCTGCAAGTACGACGTGTCTGCGGCGGCCCATATCTCCTATGAGCAGCAACGTGTTAGCAGCCAGCCAAGCCAACTCTAATTTTAATACATAATGAATGATAATAATAATATTAAATTTCCTGTGTAACTAATTTACTATGGGTTTCTGATAGAATCATTGCAAAGATCAAACAATTATTACATTGACAGTTAAGCGTTAATTTATCACCTGACAAATATATCAGCATCCTAGCATTTCTAATCGTACCCAACTTAGAGGTTTTAGTACCAAACCCATGGGAAGAAAGACTTAAAGATTTATCGCACTTGCTCAAATGCTGCAATTGAATACAGATGTTTTTACCCTGAATTATTTCGCTTGAATTTGAATCAATTCCTCCAAACCTGGCAGAACGAACATTTATTATTCAAAAACAAACCAGATTGTAGGATATGACATTTGGTAACAATAATGTTATCCAAATGGAAAATGATCCATTAATGGCTTGGGCCTAAATTCCGCAATACGATAGAAAAACAAGGCGATTTAGAAATGTATAGCGAGGCAAAGGCTCTTATTTCATCTTGGCCGTCGAAGAAAATGACATGCGTTGGTCAATGAAGAGATATGTTAAACATTGGTCAAAAGTTAGTCAGACTTGCACAAAAGAAATTACCTTCATATTTACTGAATCATCTATTATTAAATCAGAAAGACGATGGGTCGCTACATTAAAAAGATCGAATTATTACATGCCTTAGCTATAATCTATGGCAGAATGTATAACTGCTGTAACTCTCTTGTGAAATAAAATAATAAACAATCCAATGCGTGACGTGGCCCTTGATTTCGCCAACATCATTCGACTCTTTATTTGTCTGATGAAACGCCAGGGAGAATAACACTTATTTAAATTAAAGATTACTCCATAAGCATTGTCATTTAGCATGATACAATACTGACAATAAATAATTCCGTTGAAATGAGATATTAAAGGATGTCCCTAACTGGTAGATAAGCCCAAAATATCACTTCGACAGAAGAGTCGGTTGACTATACAGCCAAGCTTGCAGAAACTACAACGTCCACCGACGGTTATCACAGCTTCAAACATTAATTTGATAACAATTCCATCTAATGATGTCAAGGCCAAGCCAACAGTCGAAGATCAAGCATAAATATATTTGGCGGCGTTATGCAGCCTGACAGGCCAAAGACAAATCCGAGCCATTGGGTCAATCAGAGCTATGAGCCAGAAAAGCAAGCATCTACTCCAATAAACCAATACATACATCCCAATGTTACATGAAAGACTTCAGGTAATGCGAATTGATTCAAATAATAATCAAATGGTATTTCATGGAAATAGTTAGAGAAAACTATGAAGAAAGGCGATTTAGAAGACTATCAACAGCAGACTCAAACGAACTACGAACAACCATACTTCATGCGTTCAGTCTTAAAGCAATTGGCGGTGATGTAAACACCTGAACAATTGAGTCATAGAACTTCCATTATTCTCCTGAACCAATAATAATCACAAATAAACCAATACTCATTTACAATATACTAACTAACCGCAGAACGTTATTTCACAACGTTTCTGCGGCAGAAACAAACCATTACTCCATAACAGGGACAGCAGCGCTCAATATCGATGCAGTTGATGGTGAATCAACACGGTTCAGGCACCGCATCTGATATTCTTCCGGCTTCCAGCAACGAGGTTTCTTCCTTCGTTCGATTCCATAATCTGCAGCATCCTGAAACGGAGCGCAATATGCTCACTGGGCTACCTGCATCAGGCTTTTTGTTTCTTCCCCTCCCGGATCCGGAACAGTTTTCTGCATTCCTAGATTATCCTTCACCCCAGGGTTGCCGTTCCACTTCTGATATTCCCCTCCCCGGCGATAACCAGGACATTTCCGTAACGACTGAAGCGTTCAGAAATAAAGTAACGCGTCGCGCATGGATAAACGCGCACGTCATAGACGGTTTTACCCCGATGATCTTCAACGAGATGCCACGATGCCTCATATCAATGTTGAAACAGCGCCAAGCCCCGGACCGCATCTGGCGCTGTATGCATATCGGTACTGTTGCAGGCGGCAGACCGTATCCCGGGGAATATGCGTCACCTTCACCAATAATTCATTAGTTCCGGCCAGCATATTATAATTTATGGTCCTGTGTTGTTCACTCATTGCTGAATGCCATTATGCAAGCCTCACAATATAGTTAGTGCAATGTTTTGACGGGTGTTTTCCGCGTTACCCGCAGCGTTAACGGTGATGGTGTGTTAGTTGAACCAATACTGAAGAATGGCATGAGCACGAGACGACTCGATGCTGATCGACATCAAGATAACCCCTCTATCTGCCGCATGTGCACTCACGGCGGCCGGACACTAGTGGGGACAATGAGTGACTGTGGCTGCCCTGACTGTCCGTTTTCGATAAGCACTAATACCCTGTGCTCATTCCTTTAACTTAATAAATTCCTGTAATGGTTAGTGCTCATACCTGACTCCAGCCAGAACTGTTCATCCTTAAACCATTGTGGGCATGAGCACCCGCTCGCCCTGTTGAACCCGGCCATCTGTAGGCTGATAGCCCCCGTGTTATTCGATCGTCGATTTGATGCTGTAATACCCAAATCTGCTGTTGTTTTCGTCCCGTAATCAAACGACGATGTGGTCATTTTCGTCCCCAAATCGATTGGCCATGCACTGGCACTGTGGGTGTGCGACTTAATTCCATCCTGTTCCCCACAACCCAAGAGCGACGAATGGCGGGTTTCCCGTGGATGTCCGCCTCAGCGCAAGCCAGGAAGCACACCATCCATCACGCGACAGCAAGTTTGGGTAGTAGCTGATGTCAAACGCCTGCCCTGCATCGCCGACTTAGCCAGACCGAATGGGTAGTATGGTAAGGGTGTAAGCGCACCGTAGAAGGTAGCCGAATTTACTAAACGCGGATAGGTGCCAATAGATATGCATACAGAATTTTGCCCAAACTTAAAGTGTAGATAGCGTGAGATTTGAGTCAGCAGTGAGGCGTCAACCATTTCGCAAAATACGGTAATTTATTTTTACTAGGTTAGAAACCCTGCATAGCGCCGTCAGTCAGCATTCTTCGGCTTTGTTTACCGCAAGGCGTTAGTCATGGTGGGTCAAAGTGTAATCATTCCCGAGCGCTGCGCGGCCAGTTCATTCAGCGTATTCAGGGTCACGTCTCAACCTCGCGTCAACAGCTGACTGCAATCGGCGTATACAAATTACTGAGCACGGGGTTGTTTCGCATGACTTGTTCTTGTCGAGGGCCGCGGTCTTACGTACGTTTGCGTTCCATGTCAATTGAGTGGGTTCCATTGAGGTTGATTTCTTTCGTTCATCCATTACTAGCCGTAACTAGGTCTTATTCGAAGGAGGTTTCAAGGTCCTTTGGTCCGACCCTCCTGCAGCTGTAAACATTTTACGTTGTTAGGATACCATAGAGCTGGGCATTCCGCTATCTTTAAAGGTTTGCCCCGTGCTATCTTTACGTGCCACACTTTTATATGCGATACGCTCATCGCCAAGCTTCTGAGGATCCTCTGTCGCATTCGTGGATGCGCGTTAATGGCATCCCCCGCGCCTAGGCTGTTGGCTGTCTTGCGCGAGCCTGAAGAGGCGGGCGTCGACTGCTGTTTCGATTTAATGGTATATGAAGGTCGTCTCAGCGTTTTTAAAGGTTCGAGAGTTTCTGCTAAATTCTGCCGAGGAAGCTGCACGACAGGCTCTATCGGCACTTGATGATGCGTTCGTTTGATACTTTTAATCGTTGCGAGCGGGGCGAATGGATTTGAAGCATGGCACTAGCTGTAAATTTCGTGGGCGGTTGGGAGGCAGAAAGTGTGAGTAAGGCTTTGTACCTATGCAGCATTCGTGTTCTGTACGTTTCGCGCACGGCGTAATGGGCGCGTTTGAGTGCCTCGGGCTATTTTTACATTGGCTGTAATAGTCCTGATGCGGTCGTAGGGGCAGCTTCCTGAGCTGTAGAAGCTGCGGTCGACCATCCGTCCGGCGACGTGCTGGCGGCGCGTGCTGAGTCAGAGTTGCATCAAGTCTCCCGCCACTAGAGATAGGAGCTGATGCATGCATCGGATTTTCGTTCGCGTTAGGGTACTCTGTGCCACCGCCTCGCGTTACGCGCTCCTTCTGGGCCCAATACAGTTTAAGACGAAACCGACTAAGCGTATGGCATGATGGTAGAGTTTAACCAACACAGAGATCATTCCAGCGTTAGAGTTGAATCTTCATACACGGTATGGTCCCGGCGTCCATCTTGATATGAAAACCGTCACTGCCAGGATAATTACTGATTATCCCACATCCATGCTGTAACGGACAGCCGCGGCTTTCATGTAAGATTCTATCACTAGGGGTTGTTACCACTAGGGCGCGTATGGTCTAGTCAGTTAGGGCACGTACAGTGCGTTGTACTAGTTTTCATGTGCCGTCTTTCAGATATCCTAAACGGGCTGTATTTACTTAAAACTTCGCGCCACACCGCGTTAAGCGGGCTGTCAGACATGTGTTAGTAAGGGTCAGAATTTATACAATTACCCAACGATGAATGCGTCAGATTACCGAGTCGCCTGCCATCCTTCGAGCTGAGAGTAATACAACTAAACGAAGCTAGCCCTTACTAGATTAGTGTAATCTGAAACAAACAAGGGTGAGGTATGCTGGCATTGCACTTTCGTCCTAGGCGTATTGGTCCTTTCATATACCCGGGAGTGATTTCGTTAATAGATCGTGAGGTCACTTAATACGGGAGTCAGCGCTCCATGGGACTGAATGCTAAGTAGTACTGATTTGTAGACTGCGGTCCTTAAGGTCTACAGCCAACGTCCCGAGTAAGGATAGCGCTGTAGCAACGTATCCTCCCCATGTCATCACTGTGCTGCTCTTTTCGCACCCAACGCGGACCCCAGGGAACTAAGGCCATAGGTTTGGCATCGTTGAGCTCAACGGTACTGGTCACGTTATTGCCCTTTCAGATACTCACCGCCAATCGCCGCTAACAAAGGCAATGTACTCCCGGTTTTCGCTTGGCGACTAGCCCACGTAAACTATTATAGTTTAGGTCGCACGGGCTCGAATATACGTCAGGCAAGTCGGCGGACAAGAACATGAATGTAACAAGTACGCATCGTTCTACCTGTTTATAGACAGAAGCCCGCGTTCCCAGGGACAGACCTGGCACCCCAAGCATACCCAAGCCTTAGAGCGCCCTGTTCTTGTAATCACAAGATATAAGTGGCACACATGGCTGGCAAACGTATAAGCGAATATCTGCCGATGCGTTGGACGCGTGACGATTCGGTAGAATGTAATAAGTTCCTAGGATAGGCTGGCCGTCAATACCGGAGAACATGTACCCTGAGTTCGCCTAGGCAGGATAGACTAGTTATCACGAGCGTTCATCAGTACTTTTACAATAACAATAC	*	tp:A:P	cm:i:41	s1:i:388	s2:i:0	NM:i:1865	ms:i:1312	AS:i:858	nn:i:0
+17	0	utg000001l	10787	60	379S5M1I12M1I7M1D7M2D2M1I4M2I4M1I2M2D3M1I15M1D10M2D10M1I4M1I2M2I10M3I13M1D3M3D7M1I3M2I9M1I12M3I7M5I1M1I2M1I9M1I2M1I7M1D16M3D6M1I3M3I10M2D26M1I2M2I12M3I4M1D22M2I1M1I19M1I11M2I2M1I3M1I5M1I14M1I9M2I1M1D3M1I15M1I10M2I4M1I5M4I14M1D10M1I6M1D9M1D9M4I7M1D21M5I5M2I8M4I2M1D3M3I68M5I3M1D19M2I6M1I3M1I3M1I7M2I3M1I9M1I2M1I7M1I10M1D2M2D6M4I3M1D12M4I2M1D9M1D1M1D9M3I3M2D16M2I5M1I5M2I3M3I5M3D13M1D4M2I3M1I9M2I7M2I4M1I6M2D4M1I17M1D1M2D43M1D5M1I23M1D7M2D5M3I8M1D2M1I1M1I4M3I13M1D4M1I15M2I8M5D2M3D4M4D14M1I2M3I7M3D3M1I5M1D8M4I2M1I9M2I2M1I12M1D5M1D9M2D2M1I6M1I5M1I5M1D20M2D5M3D3M1D4M1D10M1D5M2I20M1D7M1I9M2I1M1I2M2D6M5I10M1I14M1I2M1I17M1I5M1D1M2D13M3I2M1D2M1I8M1D2M5I17M4I18M1I3M4I2M3I5M1I4M1I6M1D7M2D10M3I2M3I3M3I12M10I6M4I4M1I3M1I9M6I2M1I1M1I13M4I6M1D11M1I7M1D2M2D3M1D9M3I13M4I5M4I11M5I2M3I3M3D5M2I3M7I1M1I13M2D19M1D10M1D5M2D4M1I5M1D3M3D2M1D25M1D5M1I10M2D5M1I16M1D5M1I6M1D4M1I1M1I2M1D5M2I8M1D4M1I11M3I2M3I2M1I1M1I9M1I1M1I4M2I5M1D2M2D17M4I4M1I6M3D4M5D2M2D4M1I1M1I6M2D5M1D8M5I7M1D3M2I2M4I9M3D2M1I1M1I4M3I1M3I4M5I13M10I9M5I11M1I4M2I2M2D21M2I2M2I2M2D7M1D23M4D6M4D11M2I16M6D2M2D21M2D2M4D20M2D9M2I5M1I3M2D7M1I5M1D8M1I2M1D4M6D9M1I32M1D3M1D5M1I5M1I17M1D24M1D20M1D18M1I6M3D3M5D17M1I3M1D22M3D25M1D22M1D9M1D21M1D12M1I13M1D18M2D10M2D18M1D17M1I5M1I23M1D26M1D15M2I9M1I2M1I1M1I18M6D10M1D3M2D2M1I22M1D16M1D20M2I3M1I12M1I5M1D24M2D12M4D9M3I8M2I8M1D3M1I4M1I30M3D3M1I14M8D23M1I3M4D20M1D6M1D6M5D1M1D3M1I15M4I1M1I7M2D5M2D15M1D5M2D21M2D6M3D3M1D36M1D1M1D7M1I21M1I1M2D63M1D15M1I8M1D8M1D42M3D14M3I32M1D16M1D5M2D21M1D5M2D19M3I4M1D6M1I5M2I4M2D12M3I6M1I9M1D22M1D6M1D1M1D19M2D8M2I18M3D8M2D28M4D32M2D19M1D1M2I2M3D4M1D9M1I18M1D14M4D24M1I2M2D22M1I7M6I7M1D3M1D13M1D6M3D7M5D29M1D11M1D28M1D2M5D8M1D16M1D4M1I3M4D9M3I1M1I3M4I5M1D4M1D3M1D14M2D12M1D5M1D5M3D14M3I30M1I3M1I5M2I15M2D5M1I9M1D2M1D7M1D12M2D6M1D4M2D17M3D25M1D12M1D1M2D5M1I11M5I2M1I28M1D23M5D3M2D1M2D2M1D41M1D16M1D22M1D13M2I3M1I38M1I3M1D2M1D12M3D3M2I9M1D16M3D2M1D5M1I4M3D5M1D4M1D2M1D1M1D3M1I6M1I21M2D1M1D8M2D6M2D10M4D15M3I5M1D6M4D6M5D7M2I4M3D6M3I5M1D29M3D17M1D12M1D11M2D5M1I2M2D6M2I14M2I7M1I7M1D2M1I4M2D6M1D1M4D1M1D17M1I21M3I13M3D42M3D2M1D3M1D9M2D16M3D21M3I7M1I18M2D15M1D3M3D3M1D5M1D2M2D4M2I4M1D2M1D7M2I6M1I2M1I12M3I3M2I2M5I4M1I13M1I4M3D2M1I15M2D2M2D4M1D2M1D14M1I1M1I17M3D4M2I3M1D2M1D18M7D27M2I10M4D5M2I6M1I5M1I2M4I3M2D20M1D5M1D25M1D11M1D1M1D15M1D6M1D1M1D1M1D10M2I18M2D11M1I7M20S	*	0	0	AATGTTTAACCTGTGCTTTATTTAATGGCGGGTGTAATAATGCATTAATCTTAAGTTAACGCGGTTGTTACTTGCTGCATTGCCAAATTCTCAAAGTTAGCGTGCAAGAATTTAGCCCTTCAATCGCCAGGGAAATCGCAAGGGAGATGTATGTGAAGCGGTTAGTATGCAGCCGTCATTAGAAGTGAGTATACGACCCTGTTTTCTCATGTTCGCTCGGCAGGGATGTTCTCGCCGACCTTACGAACCTTTACCACTTGGAGAGAGATGGGTAAGCACAACCAAAGCCCAGTGATTCTGCAATAAGAAGGCAGTGGAGTTGAAGGTAGATCCATGACCGCACCGGATGAGGCGGCTCCATCCCATGCTTTCCTCGAATGAATGTTAATTCTCGTTACCTGAGCAGGCTGTTGCTCAGGTATTTCTGCAGCTCAGACTTGGAGGTGAGCGATTTACCTTCAAGAAACTTGATGCAGGGGATAGCGGTTTAGGTGTTGGCCAACCACAACCCACAGTACCCCCAATGATCCCATGCAATGAGAGTTGTTTAATCGTTGTGCTGGGAAAGTGCGAGATAGAAGGCCCTGAAGAGACGTTTGACCGTGGCAGGTGTTCTGGTCGCACATAGTCAACAACAATTGAGCACGAATCTTCATCGAATTAGGGGGAATTTCACTCCCCTCAGAACATAACGACGTAAATGGATTGAATTATGAAAGAATGGTTTTGATCGAGTACTTACCGCAGCATAATAAAGGGAAAGATAAGCGCTCAATAAACCTGTCTGTGTTCCCTTAATTCTCTGCCTGGCCTGATAATCATCATGTGCAGGTTGCTCCAATTATTTGTATTCATAAATCGATGGGAAGAAAAACTTTCTCTTTACCAAACAAATACTGACAAGAGTCTGGTTCAGAAGATAAATCGCTCTAAAGCTTCAGTTGAAAGTATAAGAACAGCCTCGCAGGACGAATCATTGGGATTCCCATCTTTGTTGTTGCGAAGGCGACACCATTAGTTTTGGATCAGAACCTGTTTCGGGCCGACCACATCCGATCTGACAGATTTTAATCGGGGAAAGGAATGTCATGCCTCGAGTGCGAGCGCGTTCTGCGAGTGGAGTACATGATGAGGGGAACTCACGCCCAAAGACGATGTTATGCATAATGCATGTTTAAACATCGAAACGGCCGTGAGGACTAGAAGCCAAGCTACGTATTTGGCGGCGATACTTAAAGATTAGGGGCAACAGATATTGAAGGGGAGCTTTGACTCATTGGATAGTCATTAAGCCAAAATTTAAAGGATATAAAGGTTGCCAAGGATATTATTTTACCGTCCTCAATTTTCAGCACTGCTCGTGAGTAAGAAAAGATGAAGCGGAGATATTTTAACAGAACATTATCTATCAGAAAGGCCATCTCTCAGCGCTCTGAAAATCTGAATGCTGAGCCTGAAGAGATGAGCGGCATAAGATGCTACGCAAGAATGAAAGTGATATACTGGAAGCTTTTAAAGGCAGGTGGTAATTAGGATTAATTATCAGGAGATAGTGCGGAACAGAATCATGCCTGTTGGTCGATAGTAATAATTCCTTACGTTATCTGATAGCATTTGCTATCCTTTCCCCTACTACATTCCTGGTGTTTCTTTTCAGCTCATAGAGATGGTCTTGGGGACATGTCATCATATGCAGGAACCATGATTGCAATGCGATCCTCTTCCTGCCTGCTCGTTTCTCCGATCGGAAGCAGAACGCGCCGACTGGCCATTAGAGTATGGGTATATGACATCTAGTTATTTATTACGCCTGCGTTGTTTTGAGCTTGGAGCTTGCTTTGTTTTCTGCGGGTTATTGCTTCTTTTCATCATGAAGGGCATAAGCGGCTCACATGATACGCGCTATCGCCATCGGCATTGCCTCTGCATCGTTCATTCCATATATGCATCCTTGTTTCCAACTATAATTTACCAGAACAAGAATAACCCGGCCTCAGCTACGCGGGTTTCTTTGCCTCACGATCTCCCCAAAACACATAACCATTGTATTTATGCAAACATCGGGTAAGCCTAATAGCAATTCAGATCTCTCACCTACAAACAATGCCCCCTTAAAATAAATTCATAAACATACAATATACATCATCTGCGTGATAAATTATCTCTGGCGGGTTGTACATAAATACCACTGGCGCTGTAGTACTGAGCACATCAGCATATGACGAGACCACCATGAAGGTGACTATCGATGCGTAAAAAGCAGGGGCGACGAAGTCAAAGCGAAGGCTTTGCAGCATGTGTAAACCCGCATCAACCGAAGCGGTCTCGTAGTGCGTTGGGAATCACTTACATGTCGATGCTTAATCTTATCAAGCAGCTGGATGCGGGGGTTTTCCGTTCAGCACTACAACTGCCACACACCACCAAACCTAACTGACAGAGAATCCAGATGGATGCACAAACGCCGCGAACGTCGCACCGACAGAAACAGGCTCAATGGGAAGCAGCAAATCCCTGTTGTTGTGAGCGCAAAACCAGTTTAACCGCCTATTCTCTCGCCTGAATGCGCAAACCGAATCACGAGTAGAAAGCACTAAATCCGATAGACCTTACAGTGCTGGCTGAATACCACATCGATTGAAAGCAGACTTGCAACGTATTGGACGCAAGAATCAGCGCACATGGTACCCAAGCCTGGCGAACGCGGCATAACATGCAGTGACCTCGAGAGAAAATTAAGGGAAAATCGATTCTCTCTATCTAGTTACTTAGATATTAGTGGCTTTATCTCAATATTATATGGATGCTAGCTGGCAACTAATTCAGTCCAGTAAACTCCTCAATAGGGAATAATATATGCTTTCCATTCCCATCGGGAAAAGTTTGTTCAACACACCAAGCTCAATCAACAATCATTGATGGGAATTGTTTGATGTAACCACATATCTTCCGTGCCTTCAATCACGGCTGCGCACAAACCATAGATTGCTCTTCTGTAAGGTTTGAATTACTGATCTAGCATTTATCAGCAGCATTTTGCATCTTAATGCGTTCTTAGCTTAATCGCTTATATCTGGCGCTGGCAATAGTAATAATCGATGCACATGATTGCTAGCGAAAATGCAAGAGCAAAGACGAAAACAGTGCCACACATGAGGAATACCGATTCTCATTAACATATTCAGGTTATCTGGGGTCGTAAAGCAGAAGTCCATCGAGATAACGATCATATACATGGTTCTCTCCAGAGATGCTTACCTGAACACTCGTCCAACCAGTGGATGCATTTCTATACATCAAACTGTAGGGGTTGTAATAGTTATCCATTTCTCGTAGGGGTGACACGAGAACCACTGAAGCCTGATGGTTACGACAGGCACAATCTTCCTCGCGATTCCCTCCTTCGGGTGATATGGAAGAAGAATTTGAAGGGGTCGAAGAGCATCCCTCAGTATTATGGAACAATACCAGGACTATCCGTATGAGCCGACTATTGATAAAATCAATGGTGTGGACAATTCAAGCGATGCAATGGATGCAAGCTGCAATCGAATGCATGGTTAAGCCTGAAGAAATGTTTCCGTAATGGAAGATGGGAAATATGTCGATAAATGGGCAATACGAACGGCAAACCTTGCCCTCAGAGAACTTAGTAAACCAAACAACAAAGCTGCTGATAGTGGCCTTTACGTTGGCGGTAATAACACGATAAACATGCACTGTATTCATTCCAACGAGTAGCGACTCACGTTCGAGATCATTCGCTCGTAACTAAACATCAGGAGCCGACCTGTTTGATTATTGGAAATCTTCTTTGCCTCCATTGAGGCGATTTTTATCTGTGGATATGAACACAGATGTCAAACATCAAACATCATTGATCGACTGGAAAGCATCAATAGAAATTGAAATCGACCATGACGTAATGACAGAGGAAAATTCACCAGATTAATAATTTTGGTCAGACCTGAATACCTAACTCAATAAACACGGCTGGTATTAAATGAACTTAATCATGCTGGCACAGCCTGCTGGTGTAGCAATTTCAAGCGACTTAATATGCATATCCCTCTGGTGTTTCTTGGATTCGACTGGAGGATGATGGAAATGGTCGGAAAGGATGGCCTCCAATGGATGAGCGAAGGAATAGAATTACCGATATCGATACATCAGGAATATTTGATTCAGATGATATGACTATCAGGCTCGCAGTGGGATTAGGTCTACCCGAGCAGATAATACGCTTCACTCGAGGCGTTCGTTATGTATAATAAGAGCACCATGCAAACTGCCGGGCTTGCAGGGTCGAGGTTTGCTGGCTGCCTTCCCGCAATCTTATTTACTTGAACGAATCCCGTGTAATTACGTACGATGGAAGCCTTATCGACATACTTAATCAGCCAGGAGTCCCCACGAATGGATCAAACACTTATGGCTATCCGAGCGGAGTCGCAGCCGCATTTTATTGGCGCACTTATCGAAAGATGTTTCGTGAAGCCGTCGACGCTGTAAATGGATATTAATACTGAAGTGGTAAGCAAAGCATTCACTAACCCCCTTTCCTGTTTCCTAATCAGCCGGCATTTCGCGGGCAGGTTTTGCCAGCTATTTCAGGGATTCAGCCATGAACACGTATGCCATTCAGGATGGTCTTGAGGCTCAGAGCTGAGCGTCATAGAGCAGCTCGCATTGGAATCGAAAGAGAAGGGGCAGAACTGGCACACTAAGAAAGGCCTGCCCAGCACTGTTTGAATCGCTATGCATCGATGCTTTGCAGCACGGGCCAGCAAAATCCATTACCCGTTAGATTTCGCGCCCGCGTATTTGCGTGCCGGAGCATGACCAGAACACATCCGGTACACTGTTGAAACCATTGCTCACCACCAGGTTGATATTGATTCAGAGGTATAAACGAATGAGTACTGCACTCGGACTCCGCTCGGGGAGCTGCTGGCTGAACGTCGGCATGGATTTCTGTCACTCCACAGGAACGTACCACTATTCGCCAGACGGCATTTAAAGGTGATGCCAGCGGTGCTGCGCAGTTCATCGCATTGATGATCGTTGCCAACCAGTACGGCCTTAATCCGTGTGACAAAGAAATTTACGCCTTTCCTGATAGCAGAATGGCATCGTTCCGGTGGCGGCGTTGAATGGCTGGTCCCGCATCATCAATGAAAACCAGCGTTTGGCGCATGATTGATTCCAACAAATGAATTAGCTGTACCACTTACAGATTTAGTAATCAGGCCACGGGGGAAGGGACCTTAATCATCCCAGTGCCGTGGCGCAAACCATCAAATGCGCGCGAGACCGTTCAGATACCCATGAAGGAGGCAGTATCGGACGTGGCAGTCGCATCCCAAACGGATGTTACGTCATAAAGCCATGATTCAGTGTGTGCCCGTCCTTCCGGATTTGCCTGGTCATGGTGACCTGACAAGGATGAAGCCGAGCTCGCATGTCGAAAATACTGCATACACTGCAGAACGTCAGCCGACCCGACATCACTCCGTCTACAGTGAAACCATGCACAGGAGATTAACACTCTGGACTTACCTCCGGGATAAACAGCACTGGATACAGTTTAG	*	tp:A:P	cm:i:80	s1:i:720	s2:i:0	NM:i:1394	ms:i:2896	AS:i:2896	nn:i:0
+18	4	*	0	0	*	*	0	0	GCTTCCGTTGCGGCTTATGTCTATTCAGGTGCTTGTCACTATTGGGGTTTTAGTTTGAAAAGAGCCGTTTTACCGTTCTTCTTGGTCAGACTTAATGTTTATTTACGTAACCGCGGAAAGAAGCTAAAAGTACTATGAAGGCTATTTTGGTATGTCGTTTCTTCCTTTGTTAGTGACCCAACAATGGCATTGGACAAACAACATGCGTTTCTTCCTTCCGGGTATCTATTATCAGAAGGCAGGAAGGATCGCCGTTTATCGTCCGTAGCATCCAAGGTAATGAGGTACTCTGCCGGTCACTGTAGCCGAAGGGATTGAAGTGAACACGAAGGTGCCGGGGTCAGTGAAGAAGGGCAAGCTAGGATCTCCATAAACCGAGCTTACATGACAGCCATCAATATTACGCGTGCAGGCCGACCCAAGCACAGAATGAAGAATGCCAGACGGGCCGAATGTAGAAGGCATCGATTCCTTCCCACTTCATTGGAAGGGGAAGCTCCTTGTCGGTGCCGTCCACGCTGAAAACCACATGTTGATTCCTGAAACGGATGATAAAGCTGACAAAGCAGCCCCATGAACCTGATACATTGGTATCAGACCATGAATATAACAGTCGATCTAAGTCCGCTGCGGCTTTTGCTCATCATTCAGTACTGTTCCTGAGCCACATAAACCGTTGAATGAGCTGCTAATCTATCTCCGAAAGAATCACGATAGAAGGCTGAGGAATTCCTTCGGAAGCGACCTACCGTGGATAGATGTGGTAAATTAACAGTGTCGCTTTATGTTCCCAAATGCTCTGTTGCTATTTATAAGCAGCGCACCCTATCGTATGCCGACGTATTAGGTAGCCAGCCAACGTCGAACCCACGTTTACCACTGGTTTATTCCGTCGCTTAGCCATGGCCCGTACCAAAGCACCGGATAACAACCTCATGAAGCTAATCTTTTCTAGTGGGTCTCCTTTCTCGGAAGAGCCGTGATGTTGACATGCTGGGTATCATTGAACAGTGAATCGCTGCTGACGTCTCCTGGGTACAAGGCGAAAATAGTTCTGATCAAAGCATCTTCCACGTCAAAAGGTCTAATAGTCAGATCAGGGCGCATCAGTCAATCCACTACGTTCAGGCTGCCCGCACTTTTAGCGTTTACTGTCATGTAAAGTTAGACAAATACCCTATTTGTAAAGGGACGCTTTGATACCACTACCGCATCTCCAGAAGCTCTGCCCTATTAGTCATCTAAGCAAGGCAATATTTACTCATTTATCTTAGACCAACTAGATTGGATTATCGCATTCTCTGTTTTCGTCATGTAGACAGTACTGAGCCTGACATAGATCTTTTAGATGGACATGTACAGCCGTTTAGACTAAGTCTATACAACCCACCGAACACGAAGCGTCATTAAACGTCACTGTAACACGCTCGGTACGTGGGGAGGAAAGTGGGAAGTCGTCATGGAATGATGGCAGTAGAATAAGTCAGCCGTTGATTCTCCGTCTCCGGTACCGGTACAACGCTCCCAGCTCCCGAACCGCATGAACGGCGTAGATCGGCCGGGAAGCTGGACTGATCCACATCGAGTCGTCTGACACCACGAAAGCTGAGCCTTGGTACGTTAGATAATAATAGCCGCCGAATGGCTAAGAAGTATTCTATCGCTGATTGATACGACCAGGAAGAGATTGTATGAACTAGCCGAACATGGGTTTAGAGCTGCGAATGCTAAAGGGACCGTCTACGAAAGCCGTGAAGCACCGGCATTAATGAACAAGCTTCTCCGTCTCCACAGTACTTGGTAACCGCCATAAGATTTATACGCTTCACTGACGCCGAAGGGATGAACGCTTCCGGTACGTCTATTCCGCAAACAAGACTTTATTATTAGAAGCTTACGCAGCATGACTGGAAGAGCATACCAACCGGGGCATAAATACTGTGGACATAAAGCGAACTAAGCTACTGAACCTTCGTTGCTGAGCGTGCATCAGTATTCCGCTGGCACTTATCTCATTGCTTAGTGCCTTACTTCCGAGCCTTCCGGAAGCATTGCTGAGATGAAGCACGGAATAACCAATCTAATTCATGCCGGAGCCATCTAAGCAGTATTGAGAAGGAAGTAACCTAGCGAACAGATACACGAAGGACGAATGAGTTACTATTCGATTAACTAAATATATTGCAAGCATAGCGAATCAACCGTAAGGACACAGGACCGTAAGGATTTGATGGAAGCCATTCCCCTTTGGACTAAGGACATGGACATACGCTTATATACGATTAGCATCTAAGTCTAGTAAGAGTGGGCTTTAATCCTTCGATTGCTTCCATGGAAGTCGCCAATTTACCGTGTAATCGACTACGGATGGCAATAACGATGCTCAGACGCCATCCAGCTGCCGATGATATCTTCCTGTGTTTTTCAGGCTCAGTCACTCCAAGCTCAAGGGTGGGCATCTGGGAAGAAGCCGTGCCTTCCGTTTAAATGTCGATGGAAAGAGTTCTAAGTACTTACTGCATTGACGTTGTAATGGAAACGAATTACAGGCATGTACGTACCGCCTTTACGTGAACTTGTTCGTTCATAGCGGTAAGTTCTTCCTCGGTTCCTTAGACACAGTTCCCTGTACGAGCGATCAGCATCAGCAGGACAATAAGCGGACAGCTTAAATTTGGTGCCGTGACATTAAGGAATGAGATATAATGGGTCACGGGTATGCTCCTGAGTGCTAAGAATGGACATCATCAGGTCCGTGTCTCCATCAGCCGTTTCACCAGTACGAATGAGTCCGGACGGGCATGGCTTGCAAATGTTTACCTATTAAGATGAAGACATACTCCGCTCCCTTGAGAGCGCATGCAAGGCCTTGAAGGCGTATCCGCCCATTGAGTATGGTACTAAGTCATAGTGGCTTCTGTCTTAGAACAGATGAGTCCACGAGGCGAAAGTACGGCGTGACGTAGAATTGCCGTATTACGCCGCAATACGGAGGCTTAGAAGTAAAGACTTACACTGATCGACCTGTGAGAGCTCAATGACTACCACCGTCATAACCTATTCTTACGGTCCAAGTATGATACGGTATTGAGCCGGCTTCTCCTTCCCCTTTTAGAATTACGCCAGGTACTCCACTAAACGATCAGTCTGAATCTATGGTATTTATGGCTACAAAATTCTTGCATGCGTCACATAGGAGAGCCAGGCCTGGCGCTGTTCGGACAGTCTATTCTATTCACGGTCGATTTCGGAAGGCCAGTCGGAGTGAGTAAACGGTCTGAACTGCCTCGTGACCCCACGCGATTTGTCGGAGTGTATTCTTACCGATGAGGAAAGACCTGACAGGGTCTAAACTAGATGGCTAGACTATATCTACGAAATTTTACTAAACGGGCTGCTTCGTTCCGTAGTGAACGATGGGAATGATGACCTATGAAGCCCGGGCCGCAGCATTTGAATCCGCTGGACAATCAACAGACAGAGAAGAGTACTAAGCTGTAATGCTTACCGCATATTGCCAGCATCCTTTAATGAGCCTGATGCTGACACGCTATCAGGGGTTCTTTGTGCTTGCATCAGCTTACGATCAGCAGCCTTACGATGCGTGGACAGCCTGACTGCCCAGGAGGATAGCGCACGCTGGCATTATCCGAGAAGTGACGGTACACCAACAGTCGGAAGGCAGTTCTCCAGCTCCTTCCTTAGCCCTACGGCCGGTCAGCGGAACGGTCTGACGTTTATTTGATAGTATTG	*
+19	4	*	0	0	*	*	0	0	TGTGGGTTGTATGAATCCTAATGTCTGCCTGTTTCCCGCCGCATCTTTTATTTTAATTAGACAAAGAGACGGGTAGGGTGTGCAAACCGCACGCTGAGTATCCTCAGGGGGAGGCTTACATCTTCGTAGTAATGCCCTCGTAGCTGAGCAAGTAATCATTATTAGCCGACTTTACTAGTCCCCAGCCGTTGCTTGAACAATCTAGAATTCTACAACAGCGGTATGGCATTCTTGGTCTGCGTCAGGCGACCATCGAGCTATGTAACAGGCCACATGATGTACATAGGGACGGACATGTGTACTGCCGTGTACCTGTAGGGTCTTACAAAGATCCATTGCACGAACGTCACATTTAGAATTTTCAAACCTGGGACCAAGGCCGCTGGTAACTAGAGCGAAATGGCTAAACATAGGCCATCCCGCCTTGACATGTGTTATCTTTAATAAGGAGGAAACCAGCATTGTTGGTCGCCAGCTCTTGACAGGGTAGGCTTAACGCCGTCCTAGATTCCGTTGAGCACGTAGACTGTGCGTATGCGGTACCTGGCCGCTAAAAGGCTTTGTTGCTTCTTATTAACCGCTAATACGAGGCACCTGTTTTAAGAACGATGAAAGAACTGATCGGCCTCGGCCAGGCTATATCAAACACGAGCCGGACATGTGTCTTAAATGTTGATATGTTTGCTTTCGCATACATATCGTGCGCATTACGTTAACCATTAGTTCGACAGCTGCCGAAACACCGCGCGTCATGGCTCATCCACCTAACGGTGCACTGTCGATCGAAATGGTGGCCAGGTTCTCACGTAAGCGACAACGGATTCTTACGATGTTCACTAAAATGGTCACTACACCTTAGAAATATTTCAGATTATAACATCTGGCTCTCACACTAACGCCGCACGTTTTTGTTGCAAAGCCTTCCTTGGTGCTGTTGAGTTCCCGAATACGTACGATGAATCCAAGGACTTAAGCCACTAAGCGACGCTGTAACAAAGTAAGAGGCCAAAACATGCGCTGGTTTTACATTAAAACCTGTAAATTTAACATTTTAATTTAACAGCCAGCCGGATCGCGTTATTCTCGTTTGGGTCGGCGGCTCCCACCATATTTCCCCGCTAGTCATGTCGGTTTGCGACCTGTTTAGCGGGTGCTGTACTAACACCCAGAGGGCCTAACAAGAAAACATTGGCAGATGTTTGCCAGCGTAGTGGTTAAGCAATGGACTAGAATTTGACGACTTTCCTTTAGGTGCCCCTACACGCCCGTTGTATAGAACAGCGAAATCCATGTAACAGAGCAGTTAAACAACTTAACGACTAGGCCGGACCACCACGATTAGCATATTTCTGTCTACATGGAAAGTCCGCAGAGCGGCGTGACTTTCTAAGACGCTTTTAAGCACATGACGATATGTCAATCTGATTTAATATGAGGTGAATCTCACTTCACCCCTCTGCGTACGGACTTTAAGGCCTAACTTGTCCTTTGAATAGTCGCCGCTGAGTAAGTGGTGATTGATTGTTATAGCAGTCCTCGGCCTGGCAAACCCAAGGAGGAAAGGGTTTAGCACCCTGAGGCTTTTGCCATACACGGCCTTAGCTAGACATCGCTTTGGGTTCTTTAAAGATCTGGTACCTGCAAGAAGCCGGATCCCCGCCACGCGTTACGAGTCGGATGAGCATATCCTAGTGTGCCGGCGCTACTGCCCAAGCCTTAGTTGGCTCGATGGCGACCGGGTGTTTATTAGAAGTTTGACGCCGTGCCTTTCTGTGTATGACGGCAGGAAATATCGTCGTCATCAACGCTGTTCGTACGGACCATGAGCAAACCAGCACGAGCGCCAGCTACTGCGACGACAAAGAAAGGCCAGCAATCGCCGTCTAACGCCGAACTGGCTCCAGTGATGGCTTACACCATGCTGCGGCCCTGCGTACACAGCGGGCCAGGATGGATCCAAAGGCAAGTACCAGCAAGTGAAGCCACAGATCTGACTAGAAACCGCCCTGTATGTGGCCCAACGATAGCATACTGAAGGCGCTGGAGTCAGCTAAGGTGGCTGAAGAGGACTCGTATCCTGGCCTAGTTTACCGCTCGCAGACAATGCAACCTGTTGATAGGGGCGGTCCGTGGTGGCCTCCGTTAGCGTTTAATTATTATCAGAATAGGCTAAAAGGGCACTGTGGTGCAAATGGGCCGTACAGGTCGGTTACGACAGTTCGCCGCAAGTCGCAACATTAAGCGACGCAAGTGGGTTTGTAGTGACAGCGATGAGGCGGGTCCCGCCAGATGAGTCTTACACTAAGTACTAGAGGGATGTACTTGTGCTTCGCTGTAGAAGTCAGGTTACCGTAAACGTTGACACGTGTTAGGGATATGGTGGAGCTACTCAGTCCGCTAAACAATTGCTGCTCATTGATGCCCGTGATGGGCTGGGCTAGGCAAAGCTACAGCACCTAGAGCGCGACTCACTAAACCTGTACACTAACGGCTATGATAATAGTCAACGAGCCGCGTCTCATACGAGGTATCGCGCTCGCGCTATTTATGCTCGGGCTCGTCTTCGGCTAGTCATCTCCCGCAAACCATCCCGACTCATTATCACCCCCACGTAACGCGATGTGCTAGAACGAGTGTGTATACCATTTAGTCTAGCGTTGAAAGGCGCACCCTACACTAGAGGTTAAGGAGTGCGGCGCGTCGGCTGATGACTGAAATCGTTAGCGCGGCCAGCCACCGCCGGGGTAAACCAGCTGCCTCCACGACCTGTCTGGGCTAGCCTGAAGCCCGCAGGCCTGGAGCACGGGACTGGATAGTGTTTATTAGCCAGCCAGCGGAAAGAATATTATAAAGGCGTGTTCTTGATAGACTTAAACGAGTCTGTCCACTCAGACGAAATATAGCAAACGGGTGGAGAACGTCATAGCAGGAAAACTGTCCTCAGGCAGAGCGGCAACGATGAGTCGGCCGCGCAGCCGCTATCGGACGACGCCGCCTGCGTGCACGGAGCCCTGACTTTGGTGTCTTGTCGCGTTAACAAGCAAAGTTGTTATGGAAGAGGAACACTAAGGTCGCGACTTCTTGCCGCATATCGCCAGCATGGCCTTAAGGCCGCTAGTTGCCTGAACCTTGTCTGTGGGTCTGCTCCCTCTGTTGTACGTACCCGGGTTGTCATCCCAGCTACCAAACTCACTCTAGAGCTTTAGCGATAAAGTCCCGACATGCCAGGTGTGCCACTGCGACCCTTAACGTTGTAGAGCCGACGGACACGATGATTCCGTCACGTACGGCAGTCAGGCCAGGAACGGCACTCGCCTAGCGTTGCTGCTATGCTCAATGCCGCTGATCGACCTTAACCGCGCTTATGATACTGTTTAGTTTGTAGAAGCCAAATTTAGCGCAGGTGCCGAGGCAAACAGGCTCTGCTTACACCCATCGGCACCGTTTGGCCCTGATAGCACTCTTACTGTCCTAGATGGCTGTGACGACCGTACGTGAGCGAACCGTTTTCCACGTGCCGGTGAATAACGGCTGGTGTCTAAATAATTTTAAACCATGCACAGGCATCAGTCGCTTCAGCCTTCCATCGCTGTCACGCTGCCCGACTCTCATCTAACAGCTTTTCGTTCTTACTCATGTAGCATATAATTTTACACGACTACTGTCCGCGTGGCCTTTCCAAAACAGCGCTGACGAAATAATCACAGCACTTAGATTAGTCAAGCGCCGGCAATGTTTCCTGCCACTTAATCATCGATTTTCTGATAGACATATGTCCGCTCTGCCAACATCTCACCAGCCTGACTGACCCGACATCCATGTTTGCCACATGACGTCTGATTACAGCGCTAGCCCTAGGCCGGACGAGCGGCGCAGTTTAGTAGCCCGATTTACGTATGTCCCAGCCTAACTCCAGGAGTAACATGCTCTATAAAGAGCAGAAGGCTTCTACAATGTAGTTTCAGGTTGGCATTCATGGACCTGAACGACCCCTGGAGCGAGCGACATAGACCAAAGAGACCTCAATGACAAAGCACCGTTTATCCCAGCCCCAACCATCGCTCGGATGTCGACGTCCGACGCAGGTGCTCATTTAACGCCGCGAGAACGCCAGCGCGCTGACGCCGAACTGACTTTACATTTCACTGACGCTGGCAGACATTGTTGCATTATGGGGATTCGACACGCTAGTCCAGCATCATCAACTGTGACAGAAAGTTTATTCACACGCGTGCTTTTAACGTGTTAACTGACGCCTGGTTGGATTCTGCTCACAATACGTTGGCCAACATGTCGGAGCACCTGTCGTACGCTTAGTGCCCGGTGTACAGCCTAACCTAGTGGGCTGCAGCGACTAGATAGGGTCGCCGTAACGATTTAGCCACGAACATAGTAACGTGATAGTCTATTAAAACTAGTAAATAAAACCTAATGAGCCACTATTTACGTAAAGTTTGATTAGGTTGTACCGGACTTAGCCCGTGTACGCTGGGAAATCTTTCGCAGCAACCATCTAGTGGCCTATCGGACCCGCCCACCAACATAGCCCACCCGCATGGATACAGGACGACGTGCTTCAGTATGGCCCGACATTCTCCGCATTGCTGTGACTAAGAAGTTGACTGTCACTATGACAGCACAGTCGGACTCAGCCGTCCACCCCGTTGGTATAGGTCGGTTAGACGAGACGCTAAAAACTTTGACTTGCTATCGCCAACCTGTAATATTATAATGGCTAATTTTATTGGTTATTGACGTTGCGTGCGCTCTTTAATTAGACTGTCGTCGGAGCGACTAACGCGCCCCAACTCTTTAGCTAAAGCTAAACAGCAGTCCCAACCTGTGGCTCGCGCTTCTTTCTTAGCGTATAGTATTCTTTCACACGCCAACAGTGCTGGCACAAAGCTTCTTTTAACTGTCCAACAGGTTTAGGTGTACGTCTCGCGTTGCTTACGTGTCTCGTGTATAGCCTCCGCGGCTTTCCCATCGTAAATACCGGTCTAGTTTTGATCGACGATTTGAAGTGATCCACAGTATCTGCCCTGCCTGCCGCCGACAAGTTCGGCAGATAAATTAGCCAACCTTGTCCTCTAATGCAGCCCCTCATACCCATGTTTAACTTAAACACTTTGTTAACCAAATATGGTTTGCTTTGACCACCGCAGGCAGTTTCTCGTGTGCCAGCTAAATACAGCAAGCTTTAGTTCGTCGGGATAGCGGCTTAGATCTATCATGAGGTAATCAACATCACGGAGTCTTGAATTATCTTACCCAATTATGACCACGTCACAAGTACGAGCACCTGACTGACGTTTCGACTCATTGTCTGACAGCCATGTAGTTGACAGGTTGGCCGCATTCGAACCGATTGCGCTCCAGCTGTCCGGCCGCCAACGAGGTACAGGTACGTCGGATGTCTGTCCTATCTAATCGCCGAGACACTTCTAGAACATCTGTTTCAACGTGCGATTTTAAGTCGTTAGGTTGGCCTATCCTTTTACCGCCAACATAATTTGGACCCTTACAAAAAGAATTTCCCGTCTTTCACAACAATTGATGTTCCGTTCTTTAAACGTACTATCAGTGAATTTTACTCCAGCAGCGGTGCGCAGCCGTTTGGGACTGACACTTTAATCGACTGATTCGATTCACGGACTCTTTCAGCTCATTGAAAATTCGGGTAATACGTAGTCATCTAGGGTTTTGTCACTGTTCAGTGTACTGGACGTAACTCGTCTGTTTCGGGCCGCTGTTAAGCGCATAATCATTTGTCGATACATCGAGCACTCAGCCCTGTCATCGTCCCCTCGTAGTACTGTTAACGAAAGATGAACTGATTGCCATGTCTTGCCTTTCTGCTCGCGACAACTTGACGTATAGGAGCGCTGACCTGTAAAATGTAAAAGACAGACTTAAAGACGCGCGTGGGTCTAAAATAGTTGAGTGTGACACGTATTTACAATTGACGCACGACGATTCGCTGTTACTTTCAGACAGCCTTGGTCGGTCGTAAAAAGGACGCTGACTAATTGTCGAAATGTTTGATAATAGTTCTCACTAAGTTCAATGCGCGGATACGTCTGACACGCGCGGCATATCAAGCACTATAGGGCAATGTGACATCGTCGCACCACACGTTACTCGATATGCAGATCCATCACTTCGACCCAATGGTCTGAATTGTGGTCACCTGTCGCGACGCTTCTAAAACGTGTTTCCTCGCGCCCCTAGATCAGGAAAGGACAGAGCGCCTGATAACAAGACTTAAATAACGCAGAGGTGCTCTACTACATTGTATACGCGCTATCTCGATGCCTCCGACTCTCATGTGGTTAAACGTCAAGCGGGGTAAGATCTAGAACGATAGGCCACTACAGCGGAGGATGTAGGGTCAAGTGCTAGGTGGTTACGCAAAACAAGAGCTTTTGTTTGCGACTTAAAGCCGTAGTGCTGTGTTGAATGAGCCGCTTATGGCCGAGGCGACGGCCGGTTAGCCAGCCGCCAGGCCAAAGTAGGACCATCGTTAAAAACCCGCGGGGCACTCGGACCTGGCATGATGGCTAGAGCGGGAAATTATGTCACTGCCCCTGTTGGACGCGCTGTAGCCACTTTGCTCGCTGCTATAACGCTGCTGTGAACGGTTCATGAGTGGTCAAAAGAGCGAGCAGGCTCAGAAACCGAGCGTCTATCACTTACGGACGCGAAATGCGCCTTTCTTGCTACGCCTAATTTAGCTACGACTGTTCGGCCTATGTGCCTGTTCGCGATACTTTCGTACCCGCTAATACCTCATCTGGTAAATAACGTTAATCCCATGAGTGGAAAATCGGCCAACTAAAACCTACAGCGTCGAACAGCCACTACAAACATCGATTACATTTGATAATCAAATAACTCTGTCAGCCGTAAGCACTTGGGTTAACATGTCCTGTTAGCGCGCTCCTAGGCGATAGGCAAACTGATTGTCCCAGTCCCTGAAAGGGCGGGACGGCAGCGCCAGGCGGACCTATGCCTATTTCCATCGTAGGCTAGATGTAACTTTGAAAAATCTGTTCGTCCTACTACAGCGTCCGCGGACGACTCCAGTGGATGAGCGGGTGAAAATGTATCGTGCTGAGGATCACGGCTAACAAAAGAGCGCTGTACAGTCCGCTAGAAAGTGCCTCTTAAAAGAGCGGCTATGGGTGCAGATAGACCCTGGTATCTAGATCACGTGATGAAATACCGCACGGGTCGCTGACATCGTACTTAATGGCACGAAGCAGACGCGGGCACGAGTGCTCGCGCTTATAGGCTCTAGCGATTTCTAGGCATATCTCAGCTCTCCATTCCGACCTCTTTTTAAAGAGACCTATAAATATTAAAGGACAGGGAGTGCAGGCGTCTGATATTTGAATATTTCCTGCCGCTTATTGTCGCTGGATCAGCCATAGCACCTAGTCACGCTGTTTACAGGCTGGCGATGCTATACGTGTAAAGGGTACGCGGGTCATACTTAGCCTATGATCATCTTTTGACTCAGTCGTGTTGTGCTCAGCCGAGGATATTAGGATTGTCCATGGTGTGAGCACAAACACGCGAGACGCGCCGTCAAATGGTGATTGTCCGAACATGTCTCGTTAAAGTTCTGTCTGATAGCCACTGTTTGTACGTAGCTGATTCTAACCTCAGCAGATGACTATTGACACGGCTGCTAGGGCAAACCAGTCACAGGCACGCAGCGTGAACTGACGTGAGCCTAACAGGCTTTGGTTCATGATTAGTTTTCGCAGACTCAATAACCGGATTGTAATCTGGCTGACGGTAAGACGTTGTTCTGCATGCCGCGACGCTACTCACCCTTGGCCCATCTCATGAGTGTTGACCTTGTAATGCAGGGCGCTCTAGTTTACGACCTTATATTAGCCTAGTAAAAATCCGTTGTTTATCCCGAACGCGCACGAGCTCATAGGGCTATTGTCGGTTACGTACATAGATGGGGATAGCGCTAAATTAGACTAATTAATATGCTTTT	*
+20	16	utg000001l	21868	60	11S39M3I12M3D5M1I12M1I10M1I19M2D9M1D7M1D1M1D1M1D2M1I9M1D10M4I16M1I13M3D2M1D2M1I3M1D7M2D17M2I5M2I11M2I3M1D18M2I18M1I5M2I4M1I18M2D6M1D5M3D21M1I5M2I10M1I8M1D15M3D16M3D6M2I1M1I35M1D1M1D4M2D16M2D10M3D23M1I12M1D2M1D3M2D3M1I13M1D2M1D4M1I9M2D7M3D6M1I6M1D3M1I1M2D6M7D14M6D3M1D15M2I8M5I5M1I5M1D3M2I5M6I11M4I1M1I5M1D4M1D2M3I6M4I5M2D29M1D16M1D9M1I12M1I10M3I7M1I9M1I11M1I5M1I19M1D3M2D9M2D23M1D7M2I15M1I7M2D7M1I7M1D10M1D20M1D33M2I3M1D5M1I30M1D3M1I7M14I11M3I11M4I2M1I5M1D4M3I17M4I1M1I12M1D4M5I6M1I8M1I10M1I2M2I8M2I7M1I3M2I14M3I2M5I27M2D14M2D4M1D9M1I4M3I1M2I3M1I10M1I5M1I13M1D5M4I12M10I6M1I6M4I2M1I25M1I4M5I6M1D1M2I4M2I3M5I18M2I7M1D5M1I9M2I4M1D7M2D10M5I17M1D5M1I12M1D14M8I2M1I17M1D8M2I4M2I3M1D10M5D7M1D4M2D3M3I9M2I1M1D3M1D10M3D56M4I18M2I1M2I3M1I1M5I6M1D3M2D1M1D5M3D1M1D5M1D6M1I4M8I1M2I3M3I2M3I3M1I11M2I2M1D8M1I17M2I4M1D13M1I3M2D4M1I10M2I2M1I5M1D3M1D14M3D8M2I2M2I3M1I8M1D2M2D2M1D2M4I8M1I15M1I9M1I6M1D16M4I2M1I7M3D4M1I16M3I2M1D7M1I21M2I7M5I16M4I4M1I2M1I3M3I3M4I8M1D2M4D5M8I3M2I15M3I4M1I2M2D7M1D4M1I9M1I12M12I6M1I19M2I5M1D27M1I7M1I5M3I9M1D3M1D8M1I1M2I8M2I2M1D1M2I4M1I5M1I8M1D6M7I1M1I8M1I6M2I10M1I2M1I1M1I9M1D3M1D4M3I3M1I31M1I4M2I4M2D3M1I42M1I8M5I1M1D12M2I2M1I3M1D15M2I4M1D8M1I6M2I3M1I2M1I23M2D2M1D2M1I8M6I10M2I3M2D5M1I3M1D7M3I1M1I11M1D15M2I1M1I8M1I6M1I8M2I21M3I2M1I7M13I19M4I12M2D19M3D2M1I10M1I15M2I15M1I16M2I9M1D31M1I25M1I14M2I18M3I6M5I7M1D4M4D5M1I11M4I1M1I25M2I10M1I7M1I14M56S	*	0	0	CGATTGCTTAGTGTTTCGTTTCGTTTAGTGCATTTGATCCTTTACTCCTCGCGCAACAGAACATGACCCAGCAAGGTACACAATACTTTATATTGGCCAACTTAAGAATGCTGCCAGCAATAGTTTAAAATCAGCGCGATCTCCATTAGAATTCGGCTTTCATCAGCATTTATTGGTTGTATGAGAGGTAGATAGAAAGACAACTGGCTTGAAGCTATCACCAAACTACAAGTAGTGATGAAAACTTTCAAATATGGGGAACGCCCATCAGCCTCATTTCTAACAATGAGCAGAGTTAAGACGTAATGAACCACAGATTCAAGTGGACGATGATAAATTCATTAAATTGTTTTGGTGACAATATCCAGAAATATGCTTCGAATGAGCTGGACATGCAATTGTTTTTATTTAATCACAAGATTAGTAGATGTCGTTGGCGAAAGTCATTAGTTTGTTCGATGAACCAGAGGTTCATCTGCATCCACCTTTGCTCTTCATTTTGATAGAACATTAAGCACTTACTCGATGCACGCAATGGGTGGGCAATAATTGCAACTCATTCCAGTAGTACTGCACTGCTACCCATTCAAATGGTTGCATGCTGTGGAAAGTCTCACGGGTCAAGAGAAGCAATAAATATTATCGTACTCGATCATTGAGAACATTCGGTGAGAACTTAGGGTTTTAACTCGTGAGGGCTGTTTTGGTGAAGTGACAAATTCTGGATACCACCACTATTATTATCGCAGTCGTTGATTCAGAGCTTTCTTATGGAAACCATTCGTGTAAAATTATACATGGTCAGATAGGATTAGTAAAGTACGAACCGTTTTAAAAGCATCCGATAATGAACAGAGATGAAGGTAAAGTACAATGAAAACTACCCTCTTCCAGCGAGAACTTATAGCGAAATGCTTAATAAATGCTCGGAAGGTATGATGCAGATAAATGTTAGAAATAATTTCATTACTCACTTCCCCACTTTTTGGGCAGAAAGAACAACAATATAGAATATTAAGCTCGACAGGTCAGTTTATTTACCCAAGGACAGGACACCCCTCTTGAGAGCCTACAACCTTAGTATTGGTAACCTGACAAAGGTAAATTAGAAAAGCTTTATTATGAAATAATCTCCGAGATAAAAACAACCCGCTAGAACATATTACGATGACATGCTTGGCTTCATCAGGGTGAAAATGTCATTTTGTGTGATAGGACAGACAAAATAGATCATTTTCTTCCTATCACATTATCCTGAATTTCGTGATGCCTATTAATTTGCCATTCCATCATGCCGCGACTGCAATATGGGAGAAAGGTCAAGTTTCTTCATTAGATGAGGTACACCAAGCGATTCATCCCTATATCGACAAGGACATTTTTCGTGAGCAATGGGCTATGCAAATTTCTACTTCCGGAACCCCGGGCTATCAGTTTTATGTTGCTTACGCCCGTGAACTGGAGGCAGGAAGACAACAGAGCTTCATCATTCTTCATCAAGCTATTAAATATTGCTAACAGGTATCGTTTGGAGGCAGGGAAGCACTTGAGTGAAGTCGATTACTCACGGAAGAACTCTTTCGTAAAAGTTATAAGGAAATATAGTCAAACCGCAACGTTTCAGCAGCTACAGTCAGAATTTATTGGAAGCAAATCTGAAACCTATTATAGATTTGAATGACTTCCCCAATTATTGGAAAAGAGTTATGTATCAGTGCCGCCTAGCAAACTCGGAAGATTTTTCAGAGGGATCTAGAATATGATGAAAGATAGAAATTACGACGCTTATCGGAAGTGAACGAATATCCTTTATGAGGAGGGCTGTTTTACAAATCCGGGTAGACTTGCCAACCAATTCCGGCAGGTCATTGGCAACAGTGGCATGCACCGAGAAGGACGTTGTAATGTCGTCCGGCACATAGCAGTCCTAGGGACAAAATCTGGCGTACAGTCATAGATGGTTCGTGAGCGTGGTACAAATTCTCGATGCAAAAAGCTGTAAAATCGGGCAACTGGAAATCATTCAACACCCGCGCACTATCGGAAGTCGCCAGCCACCCGCATGACGTTCCTGCATACGACGTGTCTGCGGCTCTACCAGTACTTCCTATGAGCAACGTGTTAGCGCAGAGCCACACTCACAACTCTAATTTAATACATAAGCATGATAAGTAATAATATTAAAATTTCCTGTGTAACTAGATCTACCATTTACCTCTCTGGTTTCTGATAAGAATCATTGCAAAGATCAAACAACTTGTATTACATTGACAGTCACAGCAGTCGACTTTATCACCTCTAAAATATATCAGCATCTAGCATGCAACCTATCAAAATGGGAGAGTTTATGACTAAAAACCATGCGGAAAGAAGACTTTAAAGATTTTATCGCACTTGCTCAAATGCTGCATTGATAAGGTTTGACCCTGAAATTATTTCGCTTGAATTTGAATCAATTCCTCCAACGCAAGGAACAGTAACATTTATTATTCAAAAACAAACCAGATTATAGGATATGACGGTTTATTGGTATAACATACAACCGTATTGAAAATGGAAAAGGTGATCATTAATGCGTTTGGGCTAAGAACTTCTCGCAATACGATAGAAAACAAGGCGATTTAGAAATGTATAGCGAGGCAAATGAGTACTCTTATTTCATCTTACATCATTGAAGAAATGACATTGAGTTTATTACAAACTGAAAGTATGTTAAACATTGGTATAAAAGTCGTCAGACTTGCACAAAAGAAATTACCTTTCATATTATTTAACTGGATCATCTATTATTGACGACATCAGAAAGAATGGGTCGCTAATACGCTAACGATTACGAATTGCCGACTTGCCTTAGCTATAATCTATGGCAGAATTGTATAACTGCTGTAACTCTCTTGGGACCAAATAAACATTCCAATGCTGACGATGTGATTTCGCCAACATCATTCGACTCTTTACTTTGATGAAGCCAGGAGAATAACTTATTTAAATTATAAAAGATTACTCCATAAGCAATTGTCCATTTAGCATGATACAATATGACAATAAAATAATTCCTGAAGATACTTTAAAGAGTCGTCGAACTGGTAGATAAGCCTAAAATATCGTCACCGCGGAATTGACGTTAGTTGACTATACAGCCAGGTTAACACCCAT	*	tp:A:P	cm:i:34	s1:i:331	s2:i:0	NM:i:866	ms:i:1358	AS:i:1358	nn:i:0
+21	4	*	0	0	*	*	0	0	TTCGATGGACGGAGTCTATTAGATTCAACTAAGGCGGAAGCGTACGTCGACTTATTATTCGTCACGGCTGCCAACGATTGTAACATTGATCGTCCACAGAGACATCCAACTTCTAACATGCATTACGCAGGACATCTAGACCGACGAGATGGTACTATGCGGCAATGTTTTGGCCCGAATCGATTAAGGGATGGACCCAATTGTTCTTTACGTCGGTTCAATGAACGGTTTGATATTTAAACGATTCGCTACTGTACTTCGAATCTTTCTGTACAGTCCGGTCTCGTGTACAGCCAACTGTTAATTTGACTTTAGACGCGATCACAGCACCCATTTGTTACCGCATGAATAAGCTTAGATGGAGCTCGGTCGCCTGTTACGACTCCAACTCGACAGGGACCCGGGATGCCAACGCGATTGGAGCCAAGCCACCCATGAAACTCCACGCAAGCACTTAACAATAGGGAGATTTGAATGAGTAAGTGCCGTTAGAAGCTCTTCGATCGGGTCCCAAGAGGGGAAGGAATTTCTAACTTGGATTGTTGGTCAGTACGGACCGTCACAACGTCTAAATCGTTATAACTCGGATAGAAAGCCTGTTAACGGATATTCGCAAGCCAACGAGTTGGTAGCCACGTAAAGATCAAATGTTACACTTCAGCCGAGCCCGGTGTACGAGACCTGTTTGACACCTGACTAATGCGATCGAAGTACGGGTTCCGGATCCCGGAAGTTATTGCCAAGCGAATTTTCGATGAGTACATGACGATCGCTGTGATAACGGTTTGACTAATTAAATCGGCTTCGGCCATGCAAGCCCGCCAACTCGTCCGCCCTAATCGACTTTCCGTTGCCTTCGGGACGATTCTGAATAAATGCGATACGCAATTGGCGACGACAATAAATGTGTTAAATTTCTAAATTCTCCAAGCCTCGGCCCGCGGAATTCTCACGATTTCCACTAGTCGCCGCCGTGACTTGGCCGGGAACCGATGACTGCTCCCGAGCCAGCTAGTCTAGCTGCTCGGACTATCCTACATCCTCCGATTCACGGATTTCAAGTTGCCGCTTTGTTTCACTTTTTCTACAGGCTTCTGCAGTGGTCTTTAAGGGACGGAAGCCCATGCACTTAGGCTACTCGCTACTGCCGGCCTCGGTAATCTGCCCGCTGTGGCTCCGGGTTGGGTTGCACAGCCATGAAGCGATTAGATCGCATACGAGAGGACGGGAACCGGGCCCATCATTTCTGACTTCGTTTCTGGGATTGTTGGCGCGGAAGGACTTCAGATTGCCTAGATTTGGCTCGAAGGGTCGACTAAGTCGCAGCGACTCTCAGCCTTCTGATCGCACTCCATTGCTCGGTTTGCGTGACGTCGCATTTAACTCCGGGCAATCCCGTTGTGTATTGCTCGCGCCTGCAATCGATTGCCGGGCCAACCTGAATGATAGTGAAGGTAGCCTGCTCTCGACCGTCTATTTATTCCGATTGTTGCGAACTCCTTAAGGCTCTACTCGGAGCGTCGCGTTTCCTACTTGCCAGTCGACGAAGTGCGGGCTGACCCTAAAGAAGCAATCGGTAGGTTTGCCCGATGGTATAAAGACTGCGTTGATCTTGAGCGCTAGCCGACGAGAAGCTCAACGCGAGCAACATTTCATAGTCCCTGGACGGCCGTTGCAATTATTTGCCAAACGCACCCCGGGGACATCCTCGGGCAAGTGCCGTGTCACGGTGATTGCGCGTTTAACGATTCAGTTCAACTCCCGTTGTCACAGCCAGATTGACATCGATTTATCGACGGTAACCCTTATACGCCTACACCCCTGACGCCGGCAGCCGGCCTGCATGGGCAAGGCGAGCCTGATCGCATGACCTGCTCGGACTCGGATCTACTTAGTTCCGCCTTCTTTGTGGATTCCGATCGCTAATTCTAAGCTGCTCCAAGCCCGGTACCCACGGCCAGACGCGACGGCGATGCAGCTCGCGACTGTGCTGCAACGGTTGGGTTCGTACTTTAGATCGCCTGGCCGGAATCGGATCGACAACAGCATACGGGCATCCTGCAATCAAGCGTCCTGACTTTCCACAGAAACTGTTCAACGTAAAGCACGCTCATAGTCAACGGTGAAACCAAAGCCAACGGAAGAGACGACCACGTCCAAGGTTTGGGTTTGAATTCATTTACGATGCCCATTTGAAGAGGTGGAAGCTGCAGTACGGACGCTAGATCCCGTCATAAACGACCTTTTGACTGTTCTGACGTTGCTTTAACTAAGTTTTAACAGGCCAGCAGATATACCAAGAATAGTCATTTGACGTACGTGACATTTCGCTGTTAACTAAGCGTCTAGACGAAGCGTTGATAAGGCAATCAATCGATCAAACCCCATTACCGATAACGCTCGTTGAGCGAAGGTTAAACGGGTCATGAACGATCCAGGTCCCCGAATGAACGGCTGACGACGCAACTCCCACGCCGCTTTTAAGTCGAAGAATGCAAACGATGTTTTGACGAAGCCCCAATCTGGTCGCCCCAAGGGTAGCCCGGTTAAATGACGAGAAGTCCACGAAGATCAAATCGTCCTTTACAGAATGGCGAGCCGGCAGGTCATGTTTCTCCATGTCAGTACCCCGAAGGCCAGGGATTTGGACGGCCTTTAGATCGTAAGAGACCCATTGAACATTGGACTACAGACGGATCCAGCAGCCATCATGTTAGATCGAGGTTGTTTATTATACGCGGATACTTAAGTCAAGCATAGACGACGAAGATTGTTAATCCCAAACGGTGAAGTTCACGCAAATCCTGTGGCTCCACAGCACAGTTCAATAACTATTATAAAACCATTCGATTGATAACGCCCCATAGTACCGCTCACGCTGATTTGGACTTGTCGTTGAAGGATACATAAGTGTGAAGCAACGCATTTACTGTACTGCACGTCCTTTAGGTCGTCACGCTGCTTCAGCTAAGTGGAAGCAAGAGCAACCCAACAGGCAACACAAATATTCAGAGATTACCAACCACAATGCTGTACCGATTTACAAACTAATCACGCGAAACCGTTGCTAGATAGACACATAAACATTACTGCCGAACTGTTTCGAGTTGGAAGTTTGCAAACGGATATACTGCCTGCAGTGGTTCGAATTCAGACATCGTCAGGGACTCACGACGAGAATCGGGCTAAGCTTCATCGAAACACAGGTAACGGTAAAGAATGCTGACACATGAACGTTTAAGTCAAGGTTACCCGATTTTACGTCAATAAGTTGAACGAACTGACCCTGCCGGGTTACTGTTACATCGTGAGTGAACATAGTTGACCCCATTCAGGTGGTCCGATTGACCTCCTTCCGTTGTGAAGTTACAGACGAAAGGACATGACGCACAGTGACCACGTGGATTGACGAACGATTCGGACATGTCAGCGGTTAGCAAGGACGTCCCACGATATTAATCGTGGGATACGTATTCGAAACTAACAGACTACGTTGTGAACTTCCCGCCAAACGTCCACGCTAACTCCATACGCCGGACTTTTCTGAACGGGTACTAACGACGGACTTGACGCTGGCGATCTCTGTAAATGTTACACGAAGCAGTTACTCCAGCGACGCCAAAGGCGAGACTAATGCCGCATAGAGTGTTACAGGAAGCCATTCCGTAACCTTTACAAACCAAATATTTCCTTTTCAACAACGTTGTAGATCTGTTCACGAAGCCCGTTGTTAAGAGTCGATCCCAATAGTTGAAGCCACGTTGTTGGTTAACCCAAACGATCCGTTATCCCCGATGCAGACGGAGTCAGAACGGTTAATCGTCGTTGTAAGCCGCATCACGCACCAGAACGATACCAGCCGTCAACGGAGACGAATCGAGAAACACAATTACCTCCATTATCCGTACATCACGTTGTATGAATGGATCGCGTCATAGCGTTTCCGATCTCATTGAACGGTTAACAGTGGACGATTATTACATGTTAGAACGTCCCCAGCCAACCACCGTATCGATATACGTCTTTGGCATATCGCTACTGTTAATAACGTGACCATCTGGCCGACCTGAGTAATTTGCCCCACGGTTGATTCTTTCACGATCCCGTTTGTACCGTGATTTGGTTCTAAGTTCCGACGATTAACGGTGGACTCCTATCATACGTCCAATAATGGTCGTCGACGATAATCGAACGATGCAAGACGAACACCACTTTTATCTTTACGCGTCAATCGACTGACGAAGTCAACCTTTGGCGACGGTTTAACGAGAGTTCATGTTGGACTTACGCGACGAAATCAGAAGCACAAGTTAGAACAGTACTTAACGTTTCCGCTGAACCTAGATAGATCAACGGTTAACATGGTCCGTGGCTATATAATTCCCAAGGAAGTGATCAATTCGAAGGTCAACGTCTCTGCCAACGGATCCTGCGGATCGCCCCCGACTAGCAAGTCTTTGTTTCGAATGCGCCGGGTATCCCGATTTGTCATCGATCCTTTATTGACGCATCGTGAAGGGTTCCCGCCAACGCCCGGATATTTCCTGGCTCCTTGCATGTGATGCAGCCATTTTCTGACTAGCATGACTTTCCTCCATCTCACGCCCAACCGTAAAGCGGACGGTCTCTTATCCTACATCGCGTGCTTTCCACCGTTGCTGACGTAGGTATTTTCTGTAATGCTCCGCAGCTCGCATTTGAGTCCGTGCCTTCTTTATAATTTCTATTGGTTCAACGAGCGGGTCTCCGAAGTTTACTGATCGAGTTCGAACGGACCTCACCTTCTGCACTTTCGCATGTTCAAATTTCTGTTCTGACTGCTTATCTAGATGTAAGCTTCGCACAGAGCTGCTAGATGAGTCGACTTCTGGTGATTCAAGATTCCTGTCTCTACTGCTTCCTTACCGCAATCGATGCGTCAGGCGAACGCCAGACCCGTTTCCGTTTGATTCGACGCCCGCGGTCGGTTGGCTCTGTGCGTTCCTTAGATCGACCGAATCCATTATGAATCGTCGAAGGGTTGTGTTTAAGTAAATTGTCCCTCGAGTCGCGCTCGAGACTTCTAGTTTAGAAACTTAGATCCTAGTCGCACGTCTCTTTCTGATGCAGGCGTTAAGGGTTGGGGGTTTGATCCGATCTGACTTAGGGCGTTGCCACGCGATTTTCCGAATGTTTAGATTTGGTCTGTTTTAACGGATTCGTCGTTCTTCTCATGTAAATCGTCCTCGGTTTGGATTTATTCTTTCCGCTGCCTATCTTGGTTTGCTTCGACTGGCGGACGCGCCACTGATTAGAATGTTCCGAAGGGCGGGACCATTCCGATCGGCACATTCCCGTTTTGTACTCATGGTTTGACGCTGATTTACGCTCCTGTCTTTTTAACGTGCCTCCGACATTTTCAGGTACGGCTGAGTCCGGACGGAATGCTCGCCGTGAGCATCTTCCGGACATGCCAGCGATCGTCGTACGCGTTACGGATTGAGCTCGACGGTTTCTGTTCCTGACTTCAGGTTCTTCATCTGCTCCTCGTCCAAATGCTTGGTACTCTACCTGACATCGTATTTCGTTCTACTGATACTAGCTGGGTGGCATGAGGCACGACTTCTTTACAGCATCCCCGGCTCCGTGTAGTTGAAGGGTTTCGGTTCGCTTCGTCCCATTGACATTGGACTTTATTTTAACTGCGTTTCTACGTTGGCAATCTATTTGCGGATTCGCATTAACTTGCTTAACGTCGTCTAATGTTACCGTTAGCCTTTCCTGCCGTGATGCACCGGATTTCTTCCGTTCTACACGAGGCGCGATCATCGATTCCGTAAAGGGTCTCTTCATTCGAAGCATTTGCTTCCTGTTACGCTTCGCCATCGCACTAGGACGCGCTCCCCCAGGACCCTGCACTTCCCTCAGAATGCGCGATTAGTCGCTAGCTGCCTCCAACTATTCCATGACTCCGACCGCTGACTGGATCTGTTCGGGTCGCGGTGCCTCCGCAGGGCGTACTGAATCGATTTTCTACGCTCCATTCCCATCCGTTTCAGCGCCTGTCGGTTCCTCGCTGTATAAGCGTACCGTCTCGTTTTCTTATCGAATGTCCACGTCACCCGGCCCGTGAATTAATACCCTGCGCTCTAAATGCGATCCTGACCCTGTTTGCGACCCATTCGAGTTTTGCGTTGGTATTTTGATGCAGACTGCGATCCCCAAGTTTAAATTATTTGCGGAGTGGCATCGAATTGCGTCACATGCGAGGGGATATTCCTTTCTAGTCTGGCCGTCAGGCCAACTCTGTCCGGGGTCCTCCGTCGCTCATTCACTCGTTTAGACACTCTGCAATCCGTGATCATTCACGACGAGATGGTTACAATTATTCTCAGGCAGTAGGGATTCCGTAATGGTCCGTGAACGCGCCCCTATCTGGGGTTGCCAATTTTATTTGATCCGACCCTAACCGTCAAAGCGGGACGCATTCACGTCCAAGTACCTTTCTTTAGCACCCGTACTCGAGTTGGCATTCCCACCCCAATCTATCGAGGCGTAGATCACGCCGTATTGGGTTGGGACGCTCCGAGAACTTCACGGACTGTCCTATCTAGACCCCAACTTTAATCCTGTTCCCGCTCGTATCCCTGAAATGGTACTGCATTTGTTACCTTACGGATTCTCCATTTGCTCTCGATTGCTCGCAGAGCGGATATGCGGTACGTCCTGCACGCATGAGCGCTTCCCTGCAACGCTGTCTCTAGAAACCGTCCGCTCCGAACGGGACAGTTCTCGCATTTGAATCGTTAACCCTGACCCCTGGTTGGCTTGCTCCAACATGATCTCATAGCCAACTATACGCGATATTCCGCGCATTAATCGTGTAAATCTAAAGCCAAGACCCGTCTAGACCGGGACGTACGAGACATAAACCTTGACGGTTAATCGTGCACTTAGATCGTACGTAGCCGCACTTCCCACTCGTCCGGCCAATGCGACCTGCGACTTCGACCTGTAGCACCGTGCCCGGATCGCCGACTTCCTGTTTGGTCTAAACCCGTCGTGCACTGAGCGGCGAATCGTGTAGCCGCGGTAGTTTGGTTGATGGAGTCCTGTACGTGCGTGAGACCGTTTAGTATGTGGTAAGAGAATGCTCGCATTTCTAAATTAATTTCTACTTTAACGCCAAAGCCACGCTCCGAACCGGGACGGTGATCCTCGATAGGTTAGGTTGGGTTGGCCGACCTAGACCCGTTTCATGGATAAACTGGCATCGGTCTAATGGCGAGTCGTCAACTTTTAATTTCACGTTCGTCTCGGCCAATATGCGGTAGCGCGTCCCCGCACTCTTAACCTTCGACCCGATAATGTCCACATTGCCGTCGGCCCAACCGTGCTTAAACTTGCTTCCAACTGTTAGGGATGATTTCGCAGCACGAAGCCAAAGTACTGCTCCGTCCCGACATGGCGCTCGGGTGCTATTTGCCACGTCCTACGGCTTGCTCGTTCGTAAAGTCCCAATGACAGTTGACTTTTGCGAATGTCAACGCCAGCCTGTTCCCATTGGTTCTTGAAGCAATTAGCCGCTGACGGAATTGTGTTTTACTAATAA	*
+22	0	utg000001l	24223	60	215S10M2I22M1I6M2D2M1D2M1I3M2I5M6I8M1I12M1I3M1D5M1I14M1I1M4I10M1I14M1I6M1I13M1I16M3I2M1I7M10I54M1D22M1I4M3I20M1I40M1I6M1I7M1I13M1I24M3I12M1I8M1I6M5I18M4D10M4I1M1I8M1I24M2I4M1D6M2D1M1D9M1D4M1I1M1I2M6I4M3I2M2D3M3D1M1I3M4D7M2I16M2I7M1D10M1D30M1I3M1I3M2I9M1D3M1D11M2I2M1I4M1D7M1I2M1I10M2I3M2I1M1D4M1I10M3I23M2D13M2I23M1I8M1I4M2I21M1D33M1I28M1I8M4I15M1D27M1I9M1I14M6I17M2I1M1I26M1D15M4D15M2I32M2I44M1I1M2D5M4I1M1I15M1I7M2I3M1I11M1D4M1D1M1D7M1I4M2I4M5I11M1I4M3I3M2D2M1I15M1I2M1I21M3I9M2I12M1D3M1I2M2I27M1D8M8I8M1I18M5I3M1I4M1D3M1D6M1I6M3D1M1D8M1I2M2I10M3D11M3I2M1D8M2I5M1I7M1D12M2I2M1I8M1I3M1I7M1D16M1I13M1I40M1D10M1D8M1I9M3I5M4I3M1D11M1I3M2D28M3D3M1I5M1D4M3I1M1I2M1I7M10I3M1I7M1D8M1D4M2D5M2I5M1I1M2I6M1D6M1I2M1I20M2I12M1I9M1I7M5I16M2I1M1D4M1D17M4I9M2D4M1I7M1I6M1I10M3D2M1I22M3D3M1D7M1D13M1D10M1I12M2I6M1D1M3I2M1D3M2I7M1D1M2I4M1I16M1I5M2D60M2I5M1D5M1I2M2I10M1D13M1D10M1I2M1D1M2D12M3I20M1D10M1D11M2D4M1I18M1I19M2D4M2D2M1I7M2D6M1I1M2I16M2D9M2I18M1I3M1I5M2I4M3I13M5I8M2I3M1I2M1I7M1D2M1I14M3I13M4I3M2I14M1I2M3D6M4I1M1D20M3D2M2D5M3I8M4I1M1I8M2I20M2D2M3I2M3I4M1I3M3I19M1I21M1D25M3I15M1I11M1I27M3D7M1D7M3D6M2I11M4I17M4I6M2I5M4I7M5I1M2I5M1I41M2I23M2I4M1I7M1I1M2D7M4I9M1I1M3I13M1D1M2I7M1D3M1D6M1D7M1I34M1I7M1I15M1I23M3D6M6I3M2I6M1D9M1I2M1I5M2I12M1D11M1I5M1I6M1I21M1I1M2D12M2D18M1D3M1D15M7D4M1I5M1I3M1D30M5I2M1D25M1I1M1I5M1I21M3I8M2D8M1D6M1I5M2I6M1I7M2D14M1D16M1I19M1D1M1D3M1D7M1I8M1I5M2D3M1D5M1I2M1D1M1D6M1D4M3I5M1D1M1D9M5D7M1D20M1I12M1D9M1D19M2I11M1I2M1I3M4I3M1I6M2I37M1I5M4I3M1I6M5I1M1D8M3D7M1D14M2D1M1D10M1I23M1I4M2D8M1D17M1I7M3D11M1D4M3I1M2D33M1D17M2D16M1D11M5I7M1D11M2D3M3D4M2I19M1D8M1I12M3D11M1D10M3I12M3D31M3D21M2I12M4D11M2I6M1I44M5I15M1I2M2D8M1D10M1I6M1D2M2I8M3I13M1I8M2D7M1I15M1D3M1I5M2I7M3I17M1D14M1D10M1D15M2D11M3D8M4I44M2I10M1D12M2D26M2I3M2D12M2I18M2D1M1D14M3I1M1D3M1I4M1D6M1I4M2D9M1I1M1I5M1I13M3I20M1I12M2I10M3I6M3I13M3D19M2I27M3D2M1I4M1I20M1D21M1I14M1I12M1D5M1I12M1I3M1D13M3I35M1I6M1D6M1D21M3I1M1I18M6I2M2I9M2I19M1D7M1I15M1I12M2D2M1I7M1D4M1I3M1I7M2D2M1D4M1I5M1I10M2D3M2I15M2I14M2D5M2D4M1I3M1I7M1I4M2D5M2D3M2I4M1I13M3D14M3I1M1I2M1I10M1D25M1I12M1D7M1I23M2I9M1I11M2D10M3I2M1I12M1D5M1I18M2D8M1I8M1I5M1I16M3D4M4I11M1I2M2I10M1I6M2D4M1I11M1D17M1I10M1I11M1I7M1D4M3I1M2I9M2I2M2D10M1I29M1D7M2D1M1D7M3I5M1I10M2I5M3I3M1D4M2D2M1D4M2D1M1D12M2D5M1I5M4I2M1D12M1I3M3D10M1D1M1D12M1D15M1D6M1D11M4D16M1I24M6D1M2D4M2I10M4I2M2D14M3D2M6I4M4D8M1I14M1D15M1D7M4I8M1I8M2D13M1I1M1I2M1D9M1I8M1D21M1D11M1I27M1I32M1I7M2D3M2D8M5I2M1I6M1I15M1I6M1D5M1D3M3I17M1I8M2I30M3D11M3I14M1D5M4I7M1D11M4I11M2D5M3I55M1D11M1D46M2I6M1D1M1D7M1I5M1I9M2D1M1D37M1I21M2I6M2D14M3D4M3D5M1I24M1I21M2D8M1D4M1D4M4I5M2D4M3I9M3D12M1D1M3I18M2I3M1I49M1I14M1I5M1D15M1I7M1D12M1I38M1I2M2I11M1I11M1D5M1I2M1I2M1I5M2D4M1I11M1D2M1D9M3D28M4I16M1I4M1I20M1D6M1I12M1D1M1D16M1D8M3I9M1I11M3I8M1I10M3I8M1I3M1I6M2I3M1I10M3I5M1I7M7I7M1I11M1I5M3D7M1I2M1D14M1D3M1I13M1I1M1I2M2I10M1I3M2D8M1D1M2I4M1D35M2D15M3I6M1I9M1I20M1I5M1I19M1I20M1D6M3I1M1I11M2D4M1D2M1D4M1D11M1D2M1I19M1D12M3D1M1D6M2D5M2I6M4D4M2D1M2D8M1I10M1I28M1D2M1D38M1I1M1I2M1I6M2D6M1I5M1I4M1I2M2I7M4I29M1I4M1D6M1D29M2I8M1I7M3D4M1D2M1I4M1D2M2I25M1I15M4I2M2I7M1D6M1D12M2I2M1D3M1I7M1D3M5I1M1D2M1I10M1D29M1I6M1I7M1I6M1I11M2D4M1D12M1D4M1D8M2D5M1D11M1I2M1D4M6I5M2D2M3D2M2D8M1I10M1I1M1I5M1I2M1I5M1D7M2I6M1I6M2I8M1I14M1I5M1I1M3D1M1D2M1D6M1D17M3D2M4D7M2D4M1D3M2D4M3I3M1I5M3I4M2I8M1D5M4I11M1I4M4I8M1D5M4I19M4D7M2D2M1I14M1I3M4D8M2I5M2D3M2D21M1D7M1D12M1D3M2D28M1D3M1I2M1I5M1I28M2D9M2I4M1D3M1D6M2I31M1D9M1I10M1I4M1D3M3D6M1D5M1D5M1I8M2D8M1D4M1I4M1I14M1I3M1D2M2D9M2D1M1D11M2I5M2I9M1D1M2I4M1I1M1I9M2I1M4D3M1D18M1I1M2D13M1D18M1I6M3D5M3I58M1I3M2I6M1D5M3I20M1I3M2I5M1D4M3I4M4D23M1D13M2D2M1D9M1D5M4I1M1I18M3D24M1I5M6I10M2D4M1D9M2D3M1D6M6I2M4I11M5D2M1D10M2D5M1I32M2I5M1D3M1I9M1I17M1D17M3I3M2D19M2I2M1I31M1D20M1I2M1D6M1D18M1D1M2I13M2D11M1I4M1I20M1D12M1I19M2I1M3I2M2I9M2I3M1D3M1I5M4I14M1D2M1D7M1I8M1D12M1I8M1I13M1D9M1I7M1D15M1D7M3I5M2D8M1I2M1I4M1I11M1I5M1I18M1D10M4I6M1D3M1I9M1I16M2D5M1D4M3I6M7I4M1I2M1I15M1I6M1I3M1I9M1I3M1I2M4I16M1D8M1I17M1D2M3I3M2D12M2D2M1I18M1I10M1I48M2D2M1D6M1I30M12S	*	0	0	GCCTTAATCTCATCGCACTTGATTCCCAACTGCTGCACTTGATACAAGGATTTTGACTCTGAATTATTTCGGACTTGAATTTGGATCAATTCCTCCTAAACGCAAGAACCTAATAACAGTTTTATTGTGTATCCTTCAAAAACAAACCATAATAGGATGGACCTTCGTAGACAATCAATTCACTTGAAAAATCGAAAAACTGATTCGTACAGTTCAATGGCTTGGGCTAAAATTCTCGCAATACGATAGAAAAACAAGGCGATTTGTAGAATCGTATAGCGAGGCAAACAGGCTACTCTTATTTCATCTTACATTGAAGAAATGACATTATCATTGAGTTTAGTCAAATGAAAGTATGTTAAACATTGGTAAAAGTTAGTCAGACTTGCACAAAAGAAATTACCTGTCATATTTAACTGAATCATCTATTATTAAATCAGAAAGACGATGGGTCGCTAATACGCTAAAAGATTACGAATTATTACATGCCTTTAGCTACTAATCTATGGCAGAAGGGAGTAACTGCTGTAACTCTTGGCATACAAATAAACAATCCAATGGGTGACGGATGGCATTTCGCCAACATCATTTCGACTCTTTATTTGATGAAGCCAGGAGGAATAATGTACTTTAAATTAAAAGATTACTCCATAAGCAAATTGTCATTTAGCATGATACAATATGACAATAAGAATAATTCCTGAAGATATTAAAGAGCGTCTAAACTGGTAAGCCTAAAATATCACTTCGGACAGAAGAGTTAGTTGACTATACAGCCAAGCTTGCAGAAACGACTTTTTAAAGGACGGTTATCACATTCAAACATTAATTTATGATAACAATTCCATCCAATTGATTTAATCAATACAACATTTGAAGATCAAGCAGATAAACTACTTTTTGGCGTTATGCAGCTGACAGAGCCAAAATAACAAATGCCTATGGCTTCATTTTCGATCAGAGCTGGCTGACAGAAAGCAAGCATCTACTCAATAAACCAATACATACAATGCCAATTATAGATGAAAGACTTCAGGTAATTGGAATTGATTCAAATAATAATCAAAATGTATTTCATGGAAAATAGTTAGAGAAAACGAAGAGACAAACCGACTTTAGAAATATCAACAGCAGACTCAAACATGACGAAAAACCATATTTCATGCGTTCAGTCTTAAAAGGCCGCAATTGGCGGTGATGTAAACACATGAACAATTGAGTCATAGAACTTCCATTATTCTCCTGAAGATAATAATCGCCAAATAAACCAATACTCAGCTTTACAATATATCAACTAACCGCAGGACCGTTATTTCATACAACGTTTCTGCGGCATCAAGAAAGGCCCGATTACTCCATAACAGCGGACATCCAAGGCCACTCAATATCAGGTGCAGTTTACTGTATCAACACGACGGTTCAGCAACACCCGATACTTCTTCCAGGCTTCCAGCAACGGAGGTTTCTTCCTTCGTTGCAATTTCCCAATCTGCATCACATCCTGAAGCCGGCACCATATGCTCACTGGCTACCTGCATCAGGCTTTTGTTTCCTTCTTCCCCCTCCCGGATTAGAACAGTTTTTCTGCTTCCGTATCCTTCACCCAGGCTGTGCCGTTCCACTTCTGATATTCCCTCCCGGCGATAACCAGGTAAAATTTTCCCTGTAACGGACCGAGTTCAGAAAATAAATACGGACGCGTGCCCGCGAAGCCAATCACGACGGTTTTTACCCCGATGGTCTTCAACGAGATGCCACGATGCCTCATCACTGTTGAAACAGCCACAAAGCCAGCCGAATATCTGGCGGTGCAATATCGGTACTGTTGCAGGCAGACCGGTATGAGGCGAATATGCGTCATTCACCAATAAATTCATTAGTTTAAGCCAGCAGATTATAAATTTTATGGCTTTAGGTGGTTGTTCACTCATTCTGAATGCCATTATGCAAGCCTCACAATAGTTAAATGCAATGTTTGACGGTTTTATTCCGCGTTACCTCACGGGGTTAAACGGTGATGGTGTGTCCGTGTGAACCATCAACTGAAGAATCGGCATGAGCACAAGCGATAACAAATGGATGCTCGTATCCCACGTAATACCAACTGCTGCGCATGTGCAGCGGCACTCAACGGCTGTACCGGACAATGAGTGACTGTGGCTGCCCTGACTGTCCGTTTTCGATATTTAATCAATGAAGTACCTTTGTGCTGGTTCCTTTAACTGTGGATAACTTCCTGTAATGGTTGCTGTTCCATACTGACTCCAGCCAGAACTGTTCATCCTTAACTTAAGCCTGTGTAATCGAACGCCCCGCGGCCCCTGTTGAACCGCTCAGACTGTGAGCACTGAGCCCCCGTGTTGTTATTCGTCGATTTGGTGCGTAATCGAAACTGCCTGTTGTTCGTTATCCGTAATCAAACGACGATGGTTTTCGTCCCCAAATCGATCCATTGCACTGGCACTGTGGGTGTGCGACTTAATTCCATCCTGTTCCTGAGACAATACAGCACGACGCCGCTGGCGGGTTTCCCCTTGATTGTCCAGCCTCACGCATATCGAAGGAAGACCCACCCATCGAATACGCGACAGCAAGAAGTTTTGGGTGAGCGGGACGATTTGTTAAAAGCCCTGCCCCTGCATCAGGACGTAGCCAGACGGAACGATATGATGGCCACGGGATTCTCAACGCGCACCTGCCGGAAAGGCCGAATTCTCACCGGCCCAAGGTTTCAAGAAAGACATCTGCAACGGAATTTTGCCACGAATATCCCTGCCAACCGGCGTACTTCAGTCAGGCTGGCGGCGGAATCGATGTCCTCCGCAAAATACGGTAATTTATTTTCGCCGTGCGCAAACCCTGCCAGCGTCGGAGTGTCGCATTCTTCGGTTGTTGACGCCGCAAGCGCGTTAGTCATGGTGTAGCAAATCTGGATTACCCATTCCCGAGCTAGCTGCGGCCCATTTCATTCAGTGGTTCCAGTGCGTCAGGTGACGCGTCGATAACATCTGCAATCGCGCTCAGTCAAAAGCGGTGTTCGCAATCTGGGTATTTTGTTCCCTGAGCGCGGTTGGTGCTGTTGGCGGCGTTCCATTCAATCGACTGTCCAGTGGGCTTTTCTGTTCGTTTCATCCATTACCACTTAACCGCCTTTGGCGTTGCAGCAAGCGTTTCAGACGTGCTGTTGGTTGCACTGCTGAGCTGCACTATCCCTTTCTCGTGTGTCCCATCCTCAAGCGCGACACTATGAAGCTAGTAGTCGTGCACGTTTTGCCGAATTTTGCACGTATATTGCCGCTTCTGCCGCACTTTTGCTCTGCGATGCTGATACCGCACTTCCCCGCAAGCCTGGCTTTGCCTTCGTGGATGCCGTTGACGCACTCCCGCCGCTGTTTTGCGTCTGCCGCGGCAGAGGCGTAGGGTTCCGCTGCTGTTTCAGATGACCTGGCGGCATTCGTCGGGACGTTTTGCTCGCTGGCGCAGAATTTTCTGCTAGTCCCCGCCGAAGCTGCACGACCGGCACTTGATGATGCGTTCGTTTCTATCATTTGCTGCCTCTTTGAGGCAGGGGACTCGTGCTGGATGAATGGCGTGGGTGACGCTTTCGTGGGATGTGGAGGCAGACGTGGCGGCTGATTGTTGTGACGCTGCAGCATTCGTTTCTGACGTTTTCACACGGCGGCACTGGCCGCCGCGTTTGCTGAGGACTCTGCGCGGCTGCGGCACTTTTCGGTTTCAGTGGCCTTTGCTGATGCCCATTCGTGCCTACGGAGGACGCTTCCTGAGCTGACGATGCAGCCTGTCCCTGAAGGCGTGCCTGGCGGCGCGTGCTGAGTCAGTCTCCAAGTCACAAAGCCGCGACCTGAGCAGCCTGATGCACTGTAATCGCCGGCGGGTTTTCTTCGCGTTTGCCGTACTCTGTGCCACCACGACGCGTTACGCGCCACCTTCCACCATCAGTTCGGACGACGCCGAATGACCCCTCCATCGGGCATCATCCTCGTTACGTGGCACAGAGAAAATCATTCAGCGTCCCCGGTTGTGAATCTTCATACACGTGATGGTCCCGGCGTGCGATGGTGGAAAACCGTCAACCTGCAGGATCGTATTGTAACCGTACTCCACATCCATGCTTGGTAACGCCCGGCTTCATCCGCATTCTCTGAGCCCACCGTGTTCACCACCACCGTGGTGCTGTTACGTCTGGCTTTCATAGTAGCTGAATGGTGCAGTTCTGTACCGGTTTTCCTGTGCCGTCTTTCAGAGGACTCCTAATGAAATCTTTACTGCCATATTCACCCCACAAAAGCCCACGGTTCCGGCGGGCTGGTTCAACACTGTGTGTTACCTGGCTAATCGAATTTATAAATGACCCAACGATGAATCCGTCAGTACGCGTCGCCACTGCCGGAGCCTTCAGTCATAAGCAATATCAACAACGACGGACGCTGCCGGATTAATCTGTATACCTGCACTCCACGCCACTCATATGCCGCATTGCACTTTCGTCCCTGGCAGTGGTCGTCTCTTCATATACCGGGGAGTGATTTCCGTACGGTAATCCATGCATTACATGCCAAATACGCGACTGTGAGCCACTCCGGCCGCTGGCGTACGCACTAATGACCTGCTTACTGATTTGTAAAAACCGGTCGGCCATCACGCTCAAGGACGTCCCGGACGCAGCCTGTGAAACGTATCCTCCCCGGTTCATATCACTGTGCTGCTCTTTTCGACGCGGATCCCAGTGGAAGCCATCGGCCCCCACGGTCCGTCAGCTCATAACGGTACTTCACGTTAATCCCTTTCAGATGACTCCACCGCGTATCCCGCCAGCGACACGACGCAATGTATAGGATGTTTCACTTGAAAATAGCCACCGTAAACGTACTCATGTCCCTTTCCACGGGCTCGAGTGACTGTCTGTCACCGCAAGTGCGGCAAAGACCCTAAAAGAAGCCGGCAATACACACATTACGCATCGTTCACTCACTGTTTTATAATAAACGCCGCGTTCCCGGACGACTCTGTAACACACGCAAGCCCTGATGCCCAGCGCCTGTTTCTTAATCAGAGTAACCTGCACATCGCTGGCAAACGTATACGGCGGAATATGCCGGAACTGCGTTGTGACGTAAGCGTGAACGTCAGGATCACGTTTCCCCGAACCCGCTGGCAGTTGTCAACAATACGGGGAACACCTGTACCGCCTCGTTTCACGCGCCATCATAAATCACGCACCCGTTCATCAGTACTTTCAGATAACACATCGAATACGTTGTCCTGCCTGACAGTACGGTGCTGATTCCTCCTCGAACGTCAGCGGAGAAGCATAAGTATGGCGATCAAAAGCATGTATTATACGGTCACGGTGACAGTGACTCCAGACCTGACGGCCGGTCCACACTGCTTTGGACGCTGGCCTAGAAAAGCCGCCTCGCCGCCTTTACAATGTCCCCGACGATTTTTCCGCCCTCAGAGCGTACCGTTTATCGTACAGTTTTCATAGGTATCGTCTACATTACTGAGCGTTGAGGGGTCGCATTCACACTGCACTGATATCTACCGCATTTTAGCGGTCATTTCCGTCCTGTTAAGGAAAACAGGCCGGAGGATTGCTGCACGCTGGTAATGGTGGGGCCGTTACGGCGCTTCAGGAAACACGTCGTTCATGAATATGGTGGCTCCGCGCCAAACATCGGCGTTTCATTCCCGTTTGCCGGGTCAATAAATGCGATACGATTGGCGGCAACCAGAAACTGGGCTCAGTTGCCTTCCTCCGTGTCCTCCATGCTGGCGCCATCACGGCGACATAATGTTGCCGTCTTTGGTCTGCTCAAGGCTTTTGACAGCCCACATTGGCATTCACTTATCGATCTGCATCCTTCTCACTCTTTCGAAAACTCCTCCAGTCTGCTGGCGTTATCCTCCGTCAGCTCGACTTTTCCAGCAGCTCCTTGCCGAGATGGGATTCGGTTATCTTGCCTTTGAAAAATCCAGGACTTCCGCCGAGGATCCATCGCATCGCCCGACCGACGGCCTCCACGAATGCCGATTTGCCAACGGTGTTCACACTGCGGATAACGACAGTAATAATCATGGCCCGGTTTGATATTACTGGCGGCTATCCAGTACAGCGCCGTACCAATAAGGGTAACGCGTGCCCTGGTTTCATTCAACCTGTCTGATATCCGCAATCTGCTTTTCCGAGACCAGAACTCAAACTCGTACCGTCGGGTCATAAACGCAGATGCGGCGTGGCGGTTATCTGAAATAGCCAACCGTCAGCTCAATCCTCGACGGTGCTCTGCCGGTGCGGCAGATCTGCGGAACGATACCGACGCCGCACTGCCCTGCTGCCCCACGCATTTACCGCCCGGACTGTCAGCCTGTAGTTCCCCAGCGCCAGTTGCGTGAATGCGGTATCGTATTCCGTCGGGCTGCCGTGCTGACTCAGCCGCTCACTGCCGTCGTCTTAGATAGGTCAACGGTTTAAGCTGAACTGGAAACGCCCTTCACCTTCGGTGTGTCTCCATGGCGCCAGCACCTGATATTCCCCGCTGTCTGCAGTGACTTCTGCGGTCAGGTGCTGCACCGCCGCGGGCGGCGTGACACCATTCAAGCGTCCACTCTGTTCGCCGTTCAAAGTGCGCCCCGTTATCCACGATGGCCTCTTTTCCGGCACATGCTGCACGGCGGTGATGATGGCATACGTGCCGTCGTCGTTCGACGGTACTCACGCAGCGAACAGTCGCTGGCGCAGCGTCGGCAGCTTCAGCTCCCATACGCTGTATTCAGCATAACACCGTCAGGAACACGGACTCATTTTACCTTCACGCCGTCGGTGACGGACTGAACCTCCACGTAACGGATTGCCACTTCCGTCAACCGAGAGGCTTATCGGGGGCGGTACCGGAGGATGGCAGCGTGATTTCACCCCGCTGAACGGTCGAGCGTCATAGGCGTCGGGTCTCTAATGTTCACCGCCAGCAGCACACGAACCACCGGTGCTGATACCGGCATAGTCATCGAACACAGATTTCAATAACAACATCGCCCGGTACATGGCACTCGCTTTACTGCTCAACGCCGCTGGCTGAAATCCACGGTCTGCGTTTCCAGCAGTTCTGTTTAATCAGCCACAGCCCGCTCCCGCGGTGTGCGCCTGCCCCCGGCTGGTACAGCCAAAGGGCATCCATCTTCGTAACATTACGACCGTAACGGGCAATGGCCTGCGTATGGTCAACAGCTCTGTCGCCGTCTCCCAGCCGTTGTTCGGGTCACGTGGAGTTCACCTCAACGCATTATGGCGTTTTTCAGGGCGCTGAAGCGTTAGCGGAACGGCGCGCCATCGTATAGCGGCATCACCACATTACTGCGGTTATAGTCACGTCTTATCCGACGGTCGGTCCTGCACGAACGTCAGTCAGTGCCGCCCGTTCCATACGATGGCATACAGCGCATCGCCGAGCACGAAATCGCTGAGCACATCCACGCCTTAACTCGTGGTCCGTACGCATTACAGGTGATGCGCGCTGATCCAGTCCGCCAAAGCGTCCGGCACGTAACGGTCTCACAGTACTGGCCGATGACATACAGCGCCCATTTATCTTACCACATCCAGCGCACTAAGACGTTTCCCCATTCAGCGGGCTGGATGGGTCAGTGGCATATCCCACAGACACAGGCCATGTTGTTGCTGTATGCCGGTTTAAACGTTCCGTCCCAGATACCGCCTGTATGTCCCCGTCTGCGGGTTAGCGTTGAAGCACCTGCAGAAACGCCCGCTCACGAGATACTGACTATTACAGCTTGCTGGCTGCCGAACTGCTGCTCCAGTCCACCTGCGACGCCGACCAGTGCCGGTGTTCGGGTAGCACTGTTTCACATCGATGATTTCAGTGTATGACGACCATCGTTTTGTTCTGCATAAGCTGGTCCGTGGTGCTTCAGGCGTCATCCTTAGGATGGTTTGAAACTCTGCTTAGGGGGCGGCAGGTTACCAGAGGATACACCACCGAGGCCAGATACTGCGAGGTGGTTTGCCCTTAATGGTGATGTCTTTCCTATACCCAGCCACGTTACGTAGTTTGTATCTGAACCAGCAGGCGGACTTCCGACGGATTCCTGTCACTTTGAGGTGGTTTCCACCAGTGCCTGTACAGCGAAAGGTAAAGGGGACGGTCGATGTTTGCACTTCGTAATGGTGCGGAGGTAATCGCGTGTCATATTTCACTTCCGTACCCAGCACCGTCTCCATCGGAGGATCCCAAATCCCTCCGGCCAGTGCTCCGCTCACAGCCAGGGAACACACCGTGACACATGGTTTATGGTATTCCCCTGAGTGTCCAGCACCGGCGTACTGTTCAGCAGCACGCTGTTTAAGCCATCAAGCATCTCTTCAATCGTAGTCGCTGATGGCATCGATCACACTCAGCAACTGCGTGGACTTCAGGTTGTCCTTCGCTTCGCGCGGGGTATGCCGGTACTGCTTCCTTTACCCATTCCTCACGCTCCATAAATGACAAAACCGCAGCAGGCGGTTTCCACATAAACATTTTGCATCAGCGACCAATCACCACGTAACATACCGTTTGGTCTCGTCTGCCGTGCTGATCTCCTGGAAACCGCGTGATACGCGCGCATTTCGAATTGCCAAGAACAGGCAGAACATTGCTGGGCAACCATGTTATCCAGTGAGGAGAACAGGGCGTAGTTCTTAGTTACCGTTATCCAGTTTATACGGAATTCGTCATGGGCTTTCGGTGCGCCAGCATCTGCCACACCACCGAGCACCATACTGGCACCGAGAGAAAGCCAGGATGCCGGTCATACCACCGGCCCCAATCGCTGCCCCCATGCTGCAAGCGCTGAGCCGGCGGTAAAGAATGATCCGGCAATGGCGGCAGCCCCAGGACAATCTGAATACGCCACCTGACTTAGCCCCGGCGACTCTGGGAACAATATGAATTACAGCGCCTGCCAGGCAGAGTCTCATGTGACTGCGCCGTTATGATCGAGACGTGCCTGACGTCCCGCCGCGGCAATCCGTACCTGATACCAGCCGTCGCTCAGTTTCGAAACTAAACGAGCCTGTGATGCGCCAGTGCCCGCACTGGCTTCAGCCCCCGTTTCACACGAAGGTCGGTTCCGGCGACCAAATCGTTGTAATCCCCGTCAAAGGCACTGCGCGCCATGCCCGTGACTCCAGAGGGAGTGTGCGTCGCTGCCATTTGTCGGCTTATCCTCTCCGTTTGCTCAGTTGTTCAGGAAACTGGTGCCGGCAGCATCGCCCGTCGCCGCAGTAATTGCGGCGTACCGTGCGGCACTGATGAACCAAAACGAGGCACATGAAGCACATGCCCGGCCTGTGCTCGTCGACAACGATACATCACCTGGATACGCGTCGCCTCCAGATTATCCAGATAGAGATTCTGTCCGTTACGCTAAGTCATCCTCACATCGAAAGTCCGGCATCTCAATTCCCGCCCATCTACACGCATCCCGGAACAGTGTGTAACAGTCCGTCACACCGTGCTCGACGCACGCCGGTGAGATGCGGCACAGCGAACTTATGAATCGTCCCCCACGTT	*	tp:A:P	cm:i:160	s1:i:1526	s2:i:0	NM:i:2342	ms:i:5422	AS:i:5422	nn:i:0
+23	16	utg000001l	33462	60	265S2039M1D8M1D1M2D1M1D7M1I4M2D7M1I7M3D10M1D14M5I9M1I17M1I4M1D4M1D1M1D2M1D10M1D4M2I5M2I3M1I10M2I16M1I2M1I4M1D5M2D2M2D12M1D6M1D10M1I16M1D4M3I20M1I5M4D6M4I6M1I11M1D2M1D6M2I5M2D4M1D2M1D6M4D5M4I6M1D5M1D8M1D6M3I18M1I16M1I17M2I11M1I5M1I10M1D3M1D9M1D2M2D7M1D4M1D15M1I10M2I12M2I58M1I2M1I5M1I4M1I9M1I3M1I13M2I3M1I41M1I7M1D11M1I8M1D3M1D11M1D6M1D12M2D20M1D16M2D35M1I5M3I11M2I6M1I9M3D9M2I31M3D7M2D5M2I1M2I4M1D7M1I6M2I5M1I13M1I15M1I6M1D21M1D10M1D6M1D2M3D3M1D18M1I2M2I2M2D15M2I31M3D11M1D9M1I3M1D2M1I16M1I10M1I28M3D4M1D4M1D11M1D14M4D8M2I40M1D15M5D9M1D9M1I9M2D3M2D6M2I4M1I12M1D10M1I11M1I1M1I20M2D16M1D6M1I17M2I3M1I28M1D4M1I26M1D2M1D6M1D1M2D1M2D10M3I1M1I2M3I4M1D2M2D8M1D3M1I38M2I7M4I9M1I1M1I12M3D5M1D10M4D30M2I18M3D3M1I11M2D7M1I5M1I9M5D11M1D1M2D22M4D53M3I2M4D5M2I3M2D9M1D7M1I1M2I7M1I3M5D1M1D28M3D2M1D7M2I5M2D2M1D16M3I4M2I1M1D17M1D14M2I10M1D12M1I9M1D4M2D5M1I14M2D24M2D7M3D9M1D19M3D30M1I5M1I4M2I1M1D23M2I8M5I13M1D9M4D15M1D2M1I2M1I2M2I10M3D4M1I1M1I1M1I10M2D3M1I1M2D5M1D49M2I16M1I1M2D4M3I29M1I19M1D23M1I6M2I9M5I16M2D17M1D7M1D15M1I6M1I8M1D12M1D18M1D2M2D4M1D22M4D1M1D1M2D11M3I11M1D6M2D9M5I3M4I5M3D20M1I6M1I9M2I2M1I9M2D3M1D3M3D16M1D1M1D2M1D1M1D8M1I10M1D15M1D4M1I3M1I17M2I6M4I4M2I14M1I11M1I7M2D15M4I31M2D1M1D20M1I5M1D25M1D4M1D16M1I8M1D3M1I11M1I7M1I20M1D3M1D4M5I11M5D26M3I1M1I1M3I5M2D12M2D3M3D4M3D3M5D7M2I3M7D8M1D6M3I12M1D6M2I11M1I6M2I1M1D5M1I4M2D3M3I1M3I3M3I2M1D2M1D12M1I2M2D3M1D11M2D7M5I14M1I3M1I15M1D4M3D5M1D2M3D4M2I5M1I15M1I1M2I2M1I3M6I5M2I4M1D6M2D2M1D6M3D4M4I17M1D8M1D10M2D36M2D5M1I3M3D1M1I3M1D4M5D10M2D4M1D4M2I4M1I8M6I4M1I2M2I1M5I6M1D21M1I2M2I4M1D3M3D10M4D3M1I2M8D3M3D4M1I2M4D9M2D6M1D5M3D8M1D3M1D4M1I3M3D5M1D38M3I5M3D15M1I1M2I11M6D5M2D2M1I5M1D6M2D2M1D12M2D11M1D1M1D3M1D5M1I3M1I6M1D2M1D15M1D7M1I20M1I5M3D3M1D4M1D7M1D5M1I6M2D3M1D9M1I7M2D4M1D13M3D29M2I5M1I3M2D1M1D11M5I2M1D4M1D3M2D14M1D5M1D5M5D1M2D2M1D16M1D1M3D3M2I6M1D8M1I10M1I2M4I8M4D3M2D6M2D2M3I1M6I7M2I2M2D1M1D18M1D9M3I11M1D1M2D12M1D7M1I2M5I5M1D5M4D11M1I4M1D5M1D5M4I6M2D4M2D2M1I3M4I2M1D3M1D3M1D3M1D13M3D4M1D3M1D9M3I4M1D4M4D16M1D5M3D1M2D1M1D8M1I6M2I7M2D6M1D9M1I6M2I2M1D6M2D1M1I5M1D1M2D4M2D6M3D9M3D7M1D3M1I4M1D3M1D2M2I6M2D1M1I8M1D21M2D9M1I7M1D1M1D7M2D1M1D6M1D7M2I7M1D13M1D25M1I3M3I5M2I4M4D7M5D12M1I3M2I1M1I11M1D11M2I7M4D7M1D19M1D11M1D5M1I12M1D2M3D8M1I5M1I7M1I15M3D4M1D3M4I1M1I11M1I14M2I4M7I2M1D2M2I8M2I1M1I3M1D3M1D12M2I14M3D8M2D1M1D10M1D4M3D4M2I8M5I2M5I11M2I8M2D2M3D5M2D5M1D4M1D20M1D15M2I29M5I19M1I9M2I9M4I13M2I3M1D3M1I12M1I7M2D27M1I34M1I8M1I19M3D7M1I2M1I1M2D2M2I8M1D2M1D8M1D4M3I4M1D14M3D13M1D8M3D5M2I1M1I9M2I11M1D7M1D10M2I2M1I6M3I5M1D12M1D4M1D41M2I8M1D4M1D9M1D6M2D9M2I1M1I5M1D27M1D4M4D9M2I19M1I3M5I8M1D11M1D4M1D3M3I7M2D39M1I7M1D14M1I9M1D13M2I37M1I7M1I17M1I11M1I18M1I25M3D5M1D10M3D4M1I4M1D8M2I5M1D6M1I4M2D7M3D4M1I6M1I6M1D16M1D28M1D7M1D34M1I11M2D13M1I1M1I28M1I9M3D16M1D23M1I13M1D45M1D20M1D14M1D10M1I1M2D52M1I1M2I23M2I30M1D4M2I2M1I4M3I15M1I33M1I16M1D6M2D7M1I8M2I6M1D1M1D11M2I11M3I5M1D6M1D3M1D44M2I1M1D42M1D1M1D12M1I13M1D2M1I3M4I9M1D10M3I3M1I3M2I5M1I11M2I8M2I4M1I7M5I10M1D17M1D10M1D5M2I1M2I19M1D9M1I15M1D14M2I32M1I14M1D16M1D13M2D15M1I56M1D2M1D9M2I4M1I18M1I11M1I33M3D7M1D4M8D3M2I4M2I3M1I1M2I2M1I5M1I6M1D1M1D12M2D3M2D6M2I10M1I13M1I22M1D6M2I2M1D4M2I9M1D19M1D1M2D21M1D4M1I5M1I4M4I2M1D16M3I8M1D29M1D2M1I19M2I16M1D3M1D7M4I12M1D28M1I2M2D34M1D9M1D22M2D4M1I9M1D23M2D8M2D2M1D4M1D3M1D24M1I11M2D3M1I5M1I5M1I11M1I3M1I2M2D33M1I5M1D25M2D15M1D5M3I10M3D9M3D6M2D6M7D8M4I6M1I2M2D18M3I4M2I1M1I28M2D10M1I11M1D2M2D12M80S	*	0	0	ATAAGCAGGTCAATCCGAGAAAACAGGACTTACAAACACTCTTCCTCCTCACGCTCCACTCCGACCGAACCCCCTGAATCCTTACGCCTTGACTGAATGATAGTTGATCTGCTGCACTCATAGTTGATCTTCTAACATACGCTAAATACGCCTAGCCGTACCGTATTCACCCCGGGGAACTTTCCCCTCTCGCTCATTGATCGCCCCGCAACCGACTCCGCTGGCACATCGCCGGGCGGTGCGCCAGAATCTAGTGATTTGGTGTCTGTGTCATGGGATTTTACGGTTCGAAAGTTTGTTAATGGGAAGGAAGCCGCCAAATCATGCGACGTTATGCTAGAACTTAAACTGAGCAGGCATTCTATGCAGATTTATCCTTCGTATTAGGACTATCGTTGAGCTGGTCAATTCATCCGACAGCCGGACCGCTATAACTCATGATCTTCTACAGTGCGATAGAGAGGCTTAAGGAGGGCATAAGTTACCCGGAAAAACTAGCCACACGGCTAGTTTCGTCGAGTCGGCACGATAAAGGAGCTGAACGCACTAATGCTAGTCGCTGCACTGTGATAGTGCACCCCTCAGGCTGATCACCCCTGCTCCGATCGTGAGCGTAACTTTGTTTCTACCACGTAACCCAAGTTCACCGATCAGAAAACGGGCGTTAAACCTTGACCCCCAACACCGTTTCTTGGTTCAGACATACAATCTTGCATATCTTTAGATACCCCGGTAGACAACAGTCCAATTATAGAAACCGTAGACCGTGCGCTTCACTGCTGCCTTTGCCATTCAGTCGACCATCAAACTTCCGCGGTTCTCATAATGGGTCTGTTCCCCCTGCCCCTGACCTCGGCTCACCTTTTTCGGTTCATGCTCATTACAGAAATAACGTTGCTCCACCGACCTGTCGTCATCGATTTCCCAGCACAGACTGACTCGAGGGCGCACGCGCTGGATTCATTCAGTGTTTCCTTGCCGGATATCCTGCATCAGTTCACCTGTTCAACTCTGCTGAATCCAACACGCAGCATACTGACCCTAGACGACCATTTGCTACGTATACCTTTATCTGTTAGCCACTCATAAGGCTGAGTCACAGAAAGAGTTTCCAGCCCCGTGCTCTTCCAGAAACGATCGTATACCGGTGGCCTCCCTCACGGCGACAGAAAGCGTCACGCTGTACGTTCCACTTACGGCATTCAGCCCGTGGCAGGCGCTCGCTGAGAATCTAAGTACCAAAGCACCTTCTTGTCAGAAGGGACCGAAGCATCATAGGTTCGTATTCATTCCCAGCGGAAGGTCTTCATTATAGTCACCGCGCGATGAACAGGCCATACCACAGATCTGTGTCTGAATTTCATCACGGGGATCATGCCGGGCCATGTCATACACCGCGTCGCTAAGAGCAGCCGGACTATCTGCCCGTTCGTGCGTCGTTGGTTAATACATGGTCTTGCTCAAACGTCCGGACGCCTTCGCGAGGTGACGGCTGTCTGCCATGCTGCCCGGTGTACCGACTAAAGCCGGGTGGCATAGCCTAGCATCAGCGGACATTCCCCACGCCAATCCGGGGCTGGTTGCCCCCTTCGTGAAGACAAACTCACCGGTGAACAATCCCCGCTGGCTCATATTTACGCCGGTTTATCGCGTAATCCTCCGGTTGCAAAACCTAGAATTTGGCCCTAGAAGCGGCCTGAATGGCTGTACTTCGCCTGACGGGATTATGCTAGCCAACAGCCCCAATGGCGCTGCCGATACTCCCGACAATCCCCACCATTGCCTGCTTAAGCAGAATTTCTGTCATCATGGACAGCACGAGAACGGGTGAAGCTGCGCCATTTCTTAGCACCACTGCCGGTTCAGCATCTCCCGCTTACTGCGATGGCGCACAGTATCAAATTGGGGCTGCATTTACCTGCACATACTGTCCGTGGCGCTCTCTTCCCACTCACTCCAGCCGACTTCAGCTCGTCATCCAGTTCCCGCGAAGCTGGTCTTCAGCCCAGGTCTTTTCTGCTGACATGACGTTATTCAGCTAGCGGATTATCTCATACTGTTCCTTCAGGCGCTGTCGTAATTGTGGCTTCCCGTTCGCTGCCGGTCAGTTCAGCCCCGGCCTTTTCCATCAATAGCGGCCCGTTTTATCGCCCGTCGCTGCTATGTGCGAATTTTATCTATGCTTAGCCAGCACGCGTTCAGGCGCTCCGTCAGTACTTGTCGCACCTGCAGCCAGCTGGCGTTTGTACTCCGGGCGTCTCATCTTTATGCCTCAGCAGGAATTTCTCCTGTGCAGACAGCTGAAGGTTGCGCTCGGCCTCGATCCCACCGCGAACTGACTCGCCTTCCTCAATCCCGGCGCTGCCATGGCTGATTTTCTCATTTGGTCCGGCATGCAGTCTCAGCTCGTTTGCCGGAATCGTCAGCAGGATGCAGGGAAGAGAACTATGTCTTCCTGACGATCTTCACCGCAGACATTCACGCTGGACTGTTCGGCTTTTCAGCGTCGCTTCATAATCCTTTTTCCTAGCCATCAGCGTGTCGTAATGGTGCAGGCATTTCCCCGTCTTTTCAGTGCCTTGTTCAGTTCTTCTGCTGACGGGCTATTTCTCAGCGGCGTCTGCAGCCGTTCGTAAGCCTTCTGCGCCTCTTCGGTATTTCAGCCGTGACGGTCTGTATAAGTCGTGCTGCTGCGCATTTGTGCCCTGTTGAGTCTTGCTGCATCAGCCTTCTTCGGCGGCTTCAAGCAAGACGGCCTTCACGATCATCCCATGTAACGCGCCCGCGCTTCATCGTTAACAAAATAATCATCCTTAGCAGATTCCAGATGTCGTCTGCTTCTTACTCACGCAGCCTCTTGCCTTAATTAAGTAACCCCCTGCCTAGGGTATCAGGACGACCAATATCAGCACCGCATCCCACATGGATTTGAATGCCCGTGCAGTCTATGTCTGCCAGGTCTCCAGCGTCCATGTCTCTTTCAGGCGGGGGTCTGTACTCAAACCCTTCGTTGCGCTCGTTCGCCGCCGGCAATGCCCCGGCTTCATCGCCGGAACGCTGCAACTGAGCAACATACGCAATCTGTAGCCAGACACGTTATGGAACTGGGGCTCATCGTTCAGCCGTCAAAGCTGGGTATGTGGTCAGCTTCCAGGAATTCAGCGGTTGTGACTATACCCCACGCCGGGTTGCAGAGGAGAAACGCGCTCAGGTACTGGCTGATGGACGCGGATCTGGCCTCACCGCTTACCCCCGCCTAACCAGTGCCTGAGTACATGGTGTGCTTGGTTAAACGTCAGCCTGCCGCCTGCCCGGCTGCTGGACAGAGACAGCATACGATCTGCCGTCAGTCGCCTGATTGCCGGAAAGGACCAGGTCGTGTTGAAATCGGACATTGATGAGTTGCCCTGATACCAGGCATACGCCAGCAGGCAGTCGCCACCGCCAGCGAGGCCCTAAGATGAGCATGATTGCAAGGCTGCAAGCCCCCTGAACATGGGGATCATCCCGCCGAAGGAGTCTGTCGATGTGCGATGCAGGAGCCCAGCAAGCAATTTGCCCCTTGCAAGCTCTGCGTGTGGCCACGTCGTGAACTGTGCCAGGCAGCAGATCAGCATGGCGGCTTTATAATCGCAACGGAAATCCCCGCTTCTGTCGCAGCCAGCGCCTGTCGATGATAGAGCGACTGTTCAACGACTGCCGCTGTTTTTCTAATGACCTTCCGTACCAGAAAATGACCCGACTCTGATGCTCGTCCAGTGATATCAACTGGCTCGAATCAGACTCCAAATCAACGACCAGATCTCGACCCCGTTTCAGCCCCTCCCCGGGCTCTGACCTCCTGCGTACTTCCTCCTCGTACGTACCAGCATTACGTCCTCGGTGATGTCGCCACATCCGGGAAGCGGGGATAACTTCATTCCCGTTGCTCAAAGCGGACATCCGGCAGAACCCTTGCCGCCGCGCATTCAGCAACCTTCAGGCTCTTCCGTCAGCCTCGCGCCGGTTCAGCAGACTGAAATCCAGCGGATGCATATCCGGATCGCTGAAAGCTAATGAGCTAACGGTACGTCAGCGGAAAATGCTGTACGGAGGATAAACATCATGAAATAATGGGTACTGTAAAATCCAGTCGATCCATACGGGATGACATCCGGGCACGGAGCAGCTGCACGCCAGTCGGGTCGCCCATCTCACGCGCCAGTTTCAGGGCAAACTCAGTTAAGCCGTCGAACCTTTCTAAGAAACAGGCTGCGGGCCCGGCGTCCTCTGTCTGTTCAGGGATTATTCACAAACTCAGCATACCAGACAGCCGGTACACGTTTTCAGCATGAGAAATTGCCTCCGTAGGTCAGGGCTAGCAGCACTTCGTGCTCAATCTGTTTAGAAAGGAATGGAGGAATTCATGCACGGATATGCGTCGGGATGGTTATGCCAAGCGACATCGCCACCAGAAAGCCGAGATGTCTGATGGCGTTCGTACAGTAACTTCCGGTTGCTGTCTGACTCCGCCTGTTCTGCCTGCCGTTTCATCAGGGCGAGATGCTCAATGCGCTGCAGGGGGCTGACAGTTCAGAAAGCGTGACGGTCACCGTTATGTTCAAATGATTCGGTTTTCAGGAAAGCCGCTGACTCCCGGATCGGGACTGGCGGTGGAGTGACGGTAATTTCTGCGGGACCGCAGCACGCTACCATTACGGATACAACCGGAATTGTTGACCTCTTGCCGCTGCAGCAACGCGTTCACGGTGATGGTCAACCTGACGACGGTGGCTTTTGTTTATCCAAGGACGAAAGCTCTGTGTCCATTACGCCTCCCGGCTGGAAGGCCACGGTCGGGTCATGCGTGCTGTGCCTTTCACCAAGGGTGCTATGCAGGGCGATTCGAGTGCCATGAGTCGCGAGGGGCCAGTGCCGCGATCTTCTTTAAGTAGACGGACGTCCCACATTGGTGACTTCACCGTAGGGTAAGTACTTCCTTTCGCCGTCACGCCTTACCGATATTGCTGACTCAGGCCACGGAACATCACCGACTAGCGTTCGGGAAGCGGCGGATTTATAGCGACGAGTATCGCCTTCATTAACCCCCAGCAGCGCCTGCTGCCGCTGCTGGGGCATCGACTCAGGCGTGAAGCTGGTACCCGGGCAGATTTCTGCCCCTGCCCGTCAGCAGTCCAGTCTTGCATCTGTCATCATCGAGATAGCTGTCGTCATAGGACTCAGCTTCCGTCACCGGAGGCGTCAGGTCTTTAACTTTTGCCAGACGCGACCAGTCAACGTTGAAAGCGATTCGTGCTAAGGTACCGCTCCCCCTTATCCAACCCACAGGGTCCGGGCACCTTCACGGCATTGTAGGATTTGGTACAGGCATAGCGTCGGACATTTCATAGGTAATGACATAAAGTCAATCGGCTGAACTCCACAAGCCCGCAATCATCGTAGCGCCGGTGAGTCGCTCGTGGCCACCATACTGATCAAATCTGACCATAGTGCCGGGATATCGCTCATACCGGATAAATCCGGGACTCCATCGACGCATCACGAGCTCTGAAAATCCGTCACACTCATAAGGCAGGAAAACTTCGATATGCAGTAGGCCTGCCAGGTACTCGGTCCAGCTGCCTTCGAGTCTCTTCCTCGGTGAGACCTCGATATTCGGAAATCCGCCTCCATCAAAACTCCGTAGGGCGACCGTCATCAAAAACGTCGCCCCGGTGTCATGCTTCATAGCATTGCGGTAGATTAGGCTGCACGGAGTTCAGTATGTTTCATCGCTTTATTACCGGCCAGTTGATGCTGCAGCGCATAGCCAGCTCTTCGGAAGACGTTCACGGTATCCATCAATAGCTTTTGTTTAAACGCCGTGGTCGATTGGAGAGAACGCGGATTGAGCAGTAATGGGGACGTTTTCCCCAGCCACGCTGCAGTAAATCCAAGTGGTACATTTTCGTTGCTGAATAAACGGCCGGGAATACGACGAGTACCACGCACGCTTGCCGCCCTTCAGGATGAACGCTGCCCCTTTACTAAATGCTTGCGAAAGGACAACCCGCGCATTACCAGCTTGATTACGGGCAATCCCCCGGTTAACTTTGATTCTGGCTGCGGATTTGAAGGGGCCTTATTCATGGCCCTTCCTCCTTTACCAGTTCGGCGTACTTTGTCTCACGGGCAACCTGTGACGCCGACTGCCAATATCGCGTGGATGTGAAGCAACGCGGTTAATGGCCCATTGCTCGCGGGCGATCAGGCACCGCCGTTTTGCTGATACGGCTGAGGTTTTCAACGGCCTGCTCAAGACTTTTATGATACACTTGGTCCCCTTCAGCACGGCTAACGGCAGGCGGTACGCGAGGATTTCGAAGAGAGGAGCAAGACCTTCCTCATCATCCGGCGAAACCCGTACCCAGAAATTTTCCTCACCGATGGTCCGTGTCTCCACGCCGCAAGCTGCCGCACCGCATCAGTCCGGACAACAGGGACGGGCTGGAGCCTTCAACGCACGCCTTGTCCGGCATAGCTGTCCAGGGTCATCAAAACACCACGTATCACTAAGCCCTGACTGCTCATGGATGTAATGGTGGCTGACGTTCCCCATGTACCGAGCGTATCGTTTCATCGGCGGGCAATGGCAGCAGCATCGAACAGGTATCGAAATCAGCACTGTCCCCGTTATTGCAGTTCTGGGGCCAGGCCGCCCTGTCATTTCGGCTGCCCACACGGCAGAGACACGGAACGCGTCTCCCGGCAGCACAAATGCCACGGTCATGAGCGTGGCGTGAAGTGCATCAGTATGCAGCTTCACAGTGCCAAGGACCGTGACCAGTTCAGACGTATCCAGAAGTACGGTATCCCTCGTCCTAGCATCCCACCTCATTTCATGTCCATGTCCTACAGCACATTTTCCCGGCTGAGAGGCTGTCTATCACCGGCAGTTTCATCCGTGTCATCAAGCTCCTCTTTCAGCTATGCCACACGAGTGCCAGTTCTTCTCTTCGTCCCCGTCGGTCGAGGCTGACATCACGGGTTCAGTGTCTATCAGTGAGCGGAGACGGCAATCAGTCATCTTTCGTCAACCGACTCCTCGACAGAGAAACAATGGCCCCGAAGGGCCATGATTACGCCAGTTGTACCGACACGAACTCTCATCACCGATACAGCCAGCAGCATTGTAGGGTGGCTGACTGAATCAATGGTGAACTCACGGGGTGGATCGCCGGTGGTCACCCAGTTTTTCGGGTAACGGGCAGAGGCGTTAATGCCCTTCGCGCCTGTGCGTCGGCATCCTGAATGCAGCTCATGTAGCGCAGACAGGTTCGGCGTGTTCCCCAAGCAGATGGCTTGTTGTCCGGCAGGAAATTCTTTAACGCTTTCCTAATTATACGGTCCTCAGAATACACGACGATGGCCACATCGCCAGATACCTCCCCCTTTATAGACACCGCTTTGCCAGGTCTTTACCGCTGTCTCCAGCTCGGAATTAGAGCCAAGACGGATATCCAGCTTCTATTGACGGCTTGAAGGAACGGAACAGCGCCAGCCTTTCGATCGAACACGATGATATGTCACACATGGAGTTCAGCGCGTCCGTCTCGATATCGTCGGTCGGGGTCATACGTGACTTGTCACGGTGCTCACACTCGTGCTCAGGACTGCGTGATGTTATTCTCCTCACTGCGGCCCATATTCTACCTAACCGGATCGAAGGCGTTGGACGGTCATGGTGTATTTGCCCTTAAGCACGGCATCAGAAACTGCCTGCATCTCTTCAGACCTGATGATACAGCATGGTCTTCAGTCACGCATTTATCTGCATGATGATGCGACGGCGGCGGTAAGCCGCTATCGTCAGATTCTGCGATCTTCATCCGGCAGGCACGCATTAGTATTGCGATTCACTTCATGCTTCGGCTTATAAATACCCCGGCGTAAATATTCAGGGTAGGAGCCGCCACGGGAACGGATAACCTCACGGAAACATCGGCGAAACGTACAGGCCAGCGGTTTACCAGTCCCGGAATTTGTGCGATAGACTTTCTCGGTGGTGAAGGATAGCTCTCACGGAAAAGAGACGCAGAAACAGCGGATCAAACTTAATTTCTGCTCATTTGCCCTGAGTTAGTTGGGCGGTTGTGTACACGGACATAAAATCCCGTAAAAGCCGCACAGGCGGCCTTTTTAGATATGAAGGGTAAAGTTAAACGATGCTGATGCCGTTCAGCAAACGCGGTCCGTTTTCTCGTCTCGTCGCTGGCAGCCTCCGGCCAGAGCACATGCGTCTCAGACTAGAACGTGCCGGACTTGTAGAACGTCAGCGTGGTGCTGGTCTGGGTCAGCATGACGCGCACAGGAATGCCAACCGGCAGGCACCGTCGGTGGTGCCATCCACGCAACCAGCTGCCGGGCTGGAGGTCCAGCAGTACCGGGGTCATGCAGGCGTGCTGAGATCGATCCGCCGGCGGAGGCGGTTGCGCCGGTCTGAGCCGGTACTGTTGCCCTGCGGCTGGTACTGGGCAAGGTTTCTTTGCTCGTCATAACATCCCTTACACTGGTGTGTTCAGCAAATCGTTAACGGATAACAGATGCCGGGTTTACCTGCAGCCAGCGTGCCCTTCCCTGCATCGAACATCCAGCCTCGCGTGTCGCCGGCTGCGCCTGTGCACTCTGTGGTGGCCTGCGGGAGAGAATTAGATGCGGCGGCGTTTTCACGGTCATACCGGGGTTTCTGCCAGCTAACGCGCGTGCCTGTCTTCGCGTCGTGAGCCTCCCTCACAGTTGAGGATTCCCATAATGCGCTGTATTTCTGTACGCAACCGCTGCGGTGATCTGCGGGTCACGTCCGGCTTGCCGCGCTGGCTTCGCCTCCGTCGAGGGGCAGATCAGTAAAGGTTGAGCCTGCGAAGCAGTGGCTGAAACAGTTGTTGATTGAGTCTCTTTGGTCATTCGCTCCTGAGAGACGCGGATTTACGTGCATCCAGTGCAGTCACGCATGACGGGTGATCGCATCGGTGCTGTTAACAAGTTCATCAGCCAGTCGGCATGCTGCCTGACCTAGCCACTCACTGATCCTGCGCTCGGTATCCAGCAACCTGCACGCGGACAGGCCGGGTATATGCCGACGTTGTTCTGCTGCAACATCTGGCGGATGCGAGTCATCTAAGACTGCAGTGTCTCCCGGACGTCATCCGGATGGCTGTAGGGATGCCATCACTTATATGGCCTGCTTCACGCTGTAAATGGTTCATTTCCTCCACATGTTCTCCAGCGCAGCACCGTAATTACTGTGGCTCATCATGACGCCGATGGAGGCCCTGTCCCGGCGGTCTTGGAACAGACGTGGGCTCGGAGGCGGACTGGCAAGCAACTGACCTGCACTGCAGTTCATGTCGTTGGCAAGCGCCCATACCGCGTTTTAGTGACGCACACGGCGATGATGTCAGCGCAGTCAAATGCCCCCGCCATCCGCCGGCGTGTCCATATCGAGCAATGCCGTCAAGATGGATCGCTGGCAGCCTGTTGCAGACGGCGCGATAATGCCGTTGTAACCATGTCACTCCCCGAGTACGGCTGCAGCGCCCGCGTCCGGCTGACCAGCGTGCCGGACACCGGGCAGCACGGCGATGCCGTTCATGACCTTAACTGCCGGCTGTCGTGGTCTACGTCATCATACCGGATAATGCCAGCTCGTCGCTCCTGGGCCAACAGTCAGGCTGTCGCCGGACACCGCATCGCCGTCCTACCGTTGCTGATCCCACATCATGAGTGCAAGCACAAAGAATACCCGTGCATAGCGTTCAAGCATCAGCGGTTCATTAAAGCTTGATGGAGGGGAAGTCGCGACTAATGCATGCTTCAGCTGCCTCCTCTAGCTTACAACACCCAAC	*	tp:A:P	cm:i:482	s1:i:3109	s2:i:0	NM:i:2061	ms:i:7752	AS:i:7752	nn:i:0
+24	0	utg000001l	35424	60	851S23M4I3M1I8M1I12M4D8M1D8M1I7M1D7M4D2M2D6M1I4M1D11M5D3M1I4M2I4M6D1M1D5M7D13M1I3M2D26M1I1M5I2M3I2M3I6M1D2M3D2M1I27M1D4M1D2M1D2M2D4M4D2M1D5M1D14M1I19M2I4M1I19M2D6M10D6M5D6M2I8M2D1M1D7M1I2M2I2M1D7M3D4M2I7M1D6M3I3M1I5M2D7M3D12M4I5M2I7M1D1M1D19M1D5M5D6M4D4M5D3M6I7M1D3M1D22M6D6M3D10M1D4M1D10M1I2M2D14M1D1M1D1M1D9M4D30M2D8M2I2M1D3M4D16M1D3M2D7M1I3M1I7M1I3M2D6M1D2M1D16M1D6M3D9M2I10M2D8M1I10M4D10M3D5M3D3M2D3M1D7M1I3M2D1M2D6M1I8M1D7M1D12M2I1M5I4M1I9M8I7M1I5M1I5M1D6M2D4M5I7M1D6M1D1M2D1M1I5M1I2M1I5M3I2M1D8M2D2M8D7M3D6M1D6M3D6M3I8M2D4M1D4M6D3M1D3M3D2M3D3M1D7M2I11M7D2M3D8M1D4M1D1M1D5M2D3M1D2M1D10M2D10M1I8M2I2M2D12M1D5M3D4M1I4M2D4M4D7M3D5M2I11M1D6M1D6M1D4M2D20M2D5M2D5M5D1M1D9M1D4M3D7M1D3M1I6M1I1M2D8M1D3M4D1M1D3M1D2M2D8M1D8M4D1M2D1M1D5M2D12M2D2M1D18M1D11M1D1M1D5M1D5M2D3M6D4M1D1M1D2M2D7M1D6M1I7M4D8M1D5M1D4M3I11M1D7M3I12M2I2M1D16M2D9M7D3M2D2M1D7M1I5M2D8M1I4M2I4M2D4M1I2M2I15M1I3M2D2M1D4M1D8M1D5M2D2M14D1M1D2M1D1M2D17M1D10M1D7M3D8M2D12M1D4M1D5M1D4M2I5M1I3M2I2M2D7M5D4M1D3M12D18M1D5M1I1M1I10M2I10M1D3M2I3M2I5M3I13M1I4M1I3M1I5M3D2M2D6M1D3M1D8M1I3M1D6M1D18M2D4M2D1M1D1M3D6M1D10M1D13M1D8M1D14M1D5M3D7M4D2M2D16M4D14M1D9M4D1M1D2M2D3M4D27M1I4M1I5M2D20M2D4M4D15M1D11M1I17M2I3M3D25M1D5M1I2M4D5M1I12M1D8M2D5M1I3M1I4M1I3M1D8M1I1M1I18M1I3M3I7M1D3M1D5M1D9M2D2M1I18M1I2M5D4M2D1M1D2M2D7M1D23M1D8M1D6M1D3M1D32M4D8M5I18M6D7M5D1M1D3M2D5M3D8M1D11M1D37M1D5M2D12M4I13M3D10M1D5M3D13M3D8M2I6M1I6M1D16M2D2M1D3M1D5M4I11M4D1M1D6M1I19M3D5M2D1M1D10M1D3M2I1M1D7M1I14M3I3M1D45M1I8M8D2M3D11M1D1M1D4M1D3M1D9M2D2M1D4M1D14M2I11M1I17M1D7M1D6M2I6M2I4M1D3M1I1M1I7M1D4M5D6M1D3M1D5M1D3M1I2M1I5M3D26M1169S	*	0	0	AAGGTCGTTGATAGGGAAGGCCTTCTTACAAGTGAAGCAAGTACATATTTAACGTTTAAAGCAGCGATCATCACGTCCTCCCATGAAGAGCCGGCGCCATCACGCCGATATTGTACGCATTTTCATGACGGGCAGCCTGGTTAGTACAAGCCTTGGAAGCAGCTGACGTATTGCCCGTTCGTTCACGTTGTTAATCATAAGCTGGTTATTCTGTGCTCAATACGTCCCTAACGCCTGCGACCGGCTGTCCATGCTGCACCCGGTGTGGCAGGAATGAGACCCGCATCACCTAAGTAGCCGTCACCAATCACGGCCTGTGCTCATTCCGATAAGCCAACAGTGAACAATCCCCTGAGCCATATTTACGTTACCGACGGTGGAAGCCTTTGCTTTACAAATGGAATTTCTACCGCGAGCGTAAGCCGTAATCGACTCATGCCACAACAACGCGCCAATGGCTGCCGATACTCCCGACAATCCCACCATTCGATGGAAGGAATTCTACATGGACAGCAATGAACGAAGCTGCGCCGTCGTATGCTCACTGCCGTCAGCATCACGCCTTGCAATACCATCAAAGGTCTCGTGGCTCATTTACCTTGAGACATAAGGGATCCGCTCTTCCCACTCACTCGCGACTTCCTCCTGCCGTATGCCCGTCCCAGCCATTATTTCTTATGACATGACGTTATTCAGCGCCAGCCGTACCATTTCCCAGATGTTCATGTAGCTTCCCGTCTATCCGTCGGTCAGCCCCGGCTTTCGCATCATCGATACCGTTTTGCCCCGTTATGCTGTGCGAATTTATTCGCGACGAGCCACAGGGCCTTTCGATACGGTAATGTCTCAAGTGCAGCCAGCTGGCGTTTGTACTTATGACGCAGCGTCTCGATATTTACTCCTAGGCATTTACGTATTCGAGTAAGCGACTTTTACTGCTGCTATGCGCAGAAGCCCGCTCGTCGGGCCCTTACCCGGTAATTTCTCATTTAACTGGCATGCTTCTCCAGCGTCCCGTTCGTCGATTACTAACGAATGAGTCGTCACAGGCATGAGCACTGTCTTCCTGACGATCGCCGCAGCATTCACTAACTGTTCGGCTTTTTCACGCGTGCTTCATAATCCTTTTCACGCCGCCATCAGCGTGTTGTAATCGACGCATTTTCCCTTTCGGAAGTTTCTTTAACTCCGACGCTTATTTCTCCAGCGTTATGCAGCCGTTCGTAAGCCTTCCCTCTTCGGTATATTTCAGCCGTGACTACGTGCTCCGCCTGTATGCTGCTTAGGATTTGTCTATTTGCAGTCCTTGGGAGGAACCGGCTTCAAGGCAAGACGGGCCTTTCACGATCGTAACGCCGCTTCATGTTACAACAATCATCTCTGCAGATTCCAGGTGCTTTCTTTATACGCAACCTCTGCTTAATCAGCATCTCCTGCCGTATCAGACGATAAACCACCCGATTGGACCACATGAATTCAGCGTCGCAGTCTCTGTGCCCAGTGGCAGTTTGAGGTTCTCTTTCAGGCGGGTCTTGGGTAATTAAATCTTTCGTCTGCTGGCATTTCCCTGCAATCCGTCTCAGCCGAACGGTCGGATGCGATAGGACGCCTCGCGCGACCGTATGACAGCGTTGACCATCTCAGGCTCCGTGACGGTCGGTAGCCCCAGCTTCGTCGACTTGGTCATTCCGGATGAGGAAGGATCAGCATATGTCCAACGCGCCATTGCGCGAATCTAAGCTACTCTTCAAGGCTCAATATCCTCAGTACCGCTTACCCGCTTAGCGTGAACCTGGTCTGGTGCTCCTTCAGCGTCGGACAGACTGGACGGATAGTACATTGCCGTCAGTCCGCCTGATTACCACGGAAGGACCAGCGTTTGTTGAATCGAGAATTGAGACCTCCAGGCAGCCCGCTCAGGCACCGGTTCTCACCGCCAGGCGGCCCACCATCGGCAGGTCTAAGCATCTAAGCGACATGGGATCATCCCTAAGGAGTGCTCTTCTATGCAGCATTTGAGATTGACGACTTGCCGCCTGCATCCGTGTAAGTCGGTGTAGTCAGGCAGCATACGCATCGAGCTTTATACTGCCAACGAAATCCGGTGCGCAGCCTTTCTATGAGCCGACTGTCGACTGCCCTTATTTTCGCGCATCACTTTCCTATTATACACAAATGACGCCTGTAACCTAGGTACGTGCTGGTAAATCTCGCATCCATCAAATCAAAGGAAGATCGCCGTCAAACACGTAGCCTGCGGTACTGATTCCTCCTGTTGACCGCTGTACGTCATCTAAGTTTATTCCACATCCGGGAAGCGGGGACTTCATTCCGTCCGTAAAGCGGACCTCCGGCAAGCCTGCACTGTTCCGATGCACATCATCGTGCCTCTTTATTCGTCGCCGGTTCAGCAGACTGAATCCGATACAGATGCATGCAGCTGAATTGGGAGGAAAGTACGGCTAATAAGCACGGCTTACCGTCAAACACGCAAGTGCATATCTAAGAACATCTATGAATAATGGTACTGTAAAGCGGTGCGTTGAAGCCGATCCATCACGGCAGCATGGCACGCCGTCGGGTCTCCCATCTCACGCGTTTTCGCATACCCTCCGTCTAACCATTTACGAACATGCGCTGAGAACAGTCGTTTCTTCCCAATCTTCACAAACGACTCATACATAGGAAGTTCAGCGTACAGAAATTATGCCGCATGAAACTCCGTGGCCATGGTAAGCACTTCCTGGCTCAATCTGTTTAACGTCGCTTTCATGGACGGCATCTGCGTCTTCTTAATGAGTCCACAGGGTATAAGCCAGAACGCCCCTTCCGTATGTTCATGCTTTGCACAGTCATAACTTCCGGTTGCTGTCTCCACTGTTTAGCGTTTCGCCTGAGGTTCAGCCGTACATGCCGTACGCCGTTGTCAACAGCGACCGTGACGTCACGTTATGTTCAAATGATTCGGTTTTCAGAACATGGTACTCCGGATTAACTGGCGGTGACGGTAATTTCTGCAACCGTTGCCCAGCAAACTCACCATTACCAACCCGTACTTGCCTGCAGCAACCCGTTCACGGTATGGTCATACCACTGACCGACACTGCTTTTGTTTTATCGCAGACCGCACGAAGGCCTCCTTGTCGGTTACGCCTCCGGCCTGAAGGCATTAATTATGGTCCTTTCACCACCAGGTAGCTGGCAGGCGTCACGGTCATGTGACGCTTCAGGGCTGTTACCGTGCGACGCGGATCTTCTTACGAACGACGTTACATTTACTTTCAAGTCGTACTATTCGTCGCCGTCACGCCTTACCCGATATGCTGGCCGAGCCACTGAACACATCGACCGTGCCGTTCGGGAAGCGGATTTAAATACATTCATTAAACCGACTCATGCCTGCTGCTCTCCGGCATCCACGCCAGCCCGTGAAGCTGGTATATCTCCGGCAGATTTTATCCTGCCATTCCAGCCGTCCGCAGTTGCGATTCTTCGTAGCGGCTGTCGTCATAGACAAGCCGGTCAGTTCACGGGCGTCAGGTCTTTAACTTTGAGACGGGACCAGACAGTCGGAATCCTTTAACCAATTGGGCCGTAAGGTCACCGACTCGGTATAAACCACATTTACATTTCACCGGCATTAGAATTGGTACAGGCACCGTTTAGCATTTCATAGGTAGACATAAGTCAGTTATAAACCCCACAAGCCCGCATTCATGCCCCGGTATAGCCTGATGGCCCCATACTGGTGAATAGAAATTGACAGGCTTAGATATCACCGATATCGGTACAACCATCCACGCATCCAGCTGAATCCGGCACCTGAGCAGGCAGGAAAACTTCGGATATTAAGCTGCCAACTGCATGTCCTATTTAGAAGCTCTTCAGCGTTTCAAGCATTAGTCAAAGGCAAATCGCCTCATCAAAACAAGCGGGTAGACGTCACCAAAAGTCTTGCTGTCATTGCTCCAGTGCATCCAGTACTATCGACCGTTCAGTATGTTCATCGGTTATTACCCGATTGCACCATAGAGCTCTTCCGGAAGACGTTCCGCCGTATCCGCTCAATATTTGTTAACGGGTCACGGCACCGCCATCGGGAGTCCTACATCAATGGGTAACGATGTCTCCATGACACGCTGCATGATGCTACGGCCATTTTTCAGGTCGATAAACGGCCGTAGAATACGACGGTTACCACCAACGCCTGCCCGCCGCTTTCAGGGATGAACGCTGCCTTTGACGCCTTAGGCGAAGGACCCGCATTACCCAGCTTGATTACCGACTCCGTACCGCATTTACTTTGATTCTTAGCTTGGATAGGACCGTGCTTTATTTTTGTAATCTCCACTTTCGGACTCCACTGCATTTTAGTTGACGCCGTCCAGAAATGGTTATCATGAAGCAACGTATACATTGAATATCTAAACCAGGCAGGCTGTTCAACGTATGGCCACATTAGAGCATAAGCCGTTTTCATGAGTATAATCCGTTAACGGCCCGTAGCTGGCTATTTGGAGATAGACATCTCCGGTTTCACGAGCGACGGTTACTCCAAGCATGCCCGTCCAAGCCGGCTCCTGTCGAAGCCGCATGATGGCTCAAGCATGCCGATCACAATGTTCTACGGGAGGTCGGACCTGTCTCACGCGTGGTCGGACGGTTTAGAGCTACAACATTTCACTCATGTCAAGCATAGACTTTTCAGGCGTATAGTAGCG	*	tp:A:P	cm:i:30	s1:i:250	s2:i:0	NM:i:1079	ms:i:328	AS:i:58	nn:i:0
+25	0	utg000001l	20209	60	297S6M1I4M1I19M1I2M1I7M4D16M2I15M4D5M2D4M1D9M1D3M6I18M2D5M2I4M1I7M2D3M1I4M1I15M1I21M1I9M4D3M1D12M3D11M9I1M2I5M3I23M2I18M5I11M1D2M1D5M3I7M3D12M3D8M1D1M2I4M1I6M1I4M3I10M1I7M2D24M6I3M2I25M5D7M6D2M8D17M6I12M1I13M2I3M1D23M2I32M1I16M1I2M2I4M3I4M1D2M3I3M1I15M5I4M1I8M1I1M1I2M1D1M2I9M2I6M4I14M1I4M3D30M1D12M5D3M2I13M2I2M1D5M3D17M1I2M1I5M1I4M1I14M1D1M1D4M3I3M1I20M4I11M2I6M3I2M3I46M2D18M5I8M3D11M2D10M1I6M1D5M1D6M3D12M1D5M2D3M1I10M2D1M1D8M5D5M5D6M1I3M2D6M2I64M1D30M1D19M1I2M2D4M1I5M3I9M1D2M1D10M2D11M2I7M1D9M1D11M3D7M3D2M1D33M4D1M1I2M2I11M2D2M1I11M2I6M2D21M1D56M2I24M2D9M2D4M1D19M3I6M4I9M2I1M1I9M1D10M1D29M1I8M3D6M2D8M1D5M1I14M2D3M1I8M3D5M1I13M1I6M1D14M3D4M2D11M1D1M3I2M2I10M1I3M1I12M1D5M3D2M2I3M1D6M1I7M1I7M1I10M4D2M2D9M3I12M1I9M2I10M2D18M2D6M1I28M3I2M3I1M2D5M1I2M1D13M1I13M3D2M4D1M2D42M2I6M2I9M2D11M3I21M1I18M2D8M2D1M1D13M1I11M1I2M2I13M4I3M1D5M1I5M1D11M1D4M1D19M1I23M1D13M1D1M2D2M1D17M2D3M1I4M1D1M2D15M1I9M2I3M1I11M2I3M1D3M2D3M1I19M4D3M22D29M1D9M1D14M2D3M1I2M1I2M1I8M1I2M2I5M1D8M4I1M1D1M1D13M4I13M4I8M1I3M1I2M1I21M3D19M1I13M1I2M1D28M1I7M1I20M1I10M3D9M1D7M2D27M2I4M1D16M1D4M2D5M1I2M1I7M1D2M1D7M1D6M1I14M1D35M2D5M1I24M1I6M1D9M5I3M1I10M4I2M4I5M2I5M1D4M1D2M4I2M1I1M1I8M4I7M1I7M1I8M2I4M3I6M2I8M1I10M1I2M2I10M2I6M1I8M1I2M1I7M8I8M3I6M3I28M1D17M1I4M2I4M1I10M1I3M1I2M1I11M1I8M8I1M1I3M2I6M4I1M2I7M1I4M2I2M5I2M1I16M1D13M3I1M1D4M1I5M2I4M7I12M3I2M7I1M3I4M2I20M2I10M2I31M1D5M2I8M1D3M1D11M1I2M2D5M1I22M2I6M5D5M4D4M1D5M3D1M3D1M3D4M4D5M1I18M3D12M1I2M1I35M3I13M6I4M1I4M1D2M1D8M3D13M1I2M1I3M1I5M3I5M3I3M3I2M3I3M1I18M1I3M2I18M2D3M1I9M1D11M1I4M1I7M2I20M1I3M1I3M3D10M3I1M1I14M2I1M1I8M6D9M1D3M1I11M4I3M1D1M1D12M1D12M3D30M1I7M1I14M1I1M1I6M5I12M3I3M1I4M4I2M1I4M4D10M1I3M2I1M1I8M9I20M2I10M1D13M1I2M1I5M1I9M3I2M1I19M2I5M1D6M1D5M1D10M1I3M1D2M1D4M1D10M1D11M2I26M2I8M1D3M3I4M2D12M5I5M2I5M1I2M1I1M1I12M2I21M1I5M1I18M2I2M1I8M1D38M1D4M1I13M1D25M2I18M4D6M1D13M1I6M2D2M1D2M1I10M3D2M2I2M1D9M2I3M1I2M4I5M1I30M4I3M1D5M1I6M1I21M1I1M4I2M8I3M1I7M3I2M1I14M1D18M1D2M2D4M1D5M1I2M2I7M1D2M2I3M1I2M1D6M6I2M1I10M1I17M2D11M1I16M1I13M2D1M1D2M1I1M1I2M2I2M1D1M2I35M1D3M2I6M1I18M5I8M3D7M4D10M4I1M1I9M3I19M1I8M1D8M1D12M2D10M2I4M1D2M4I5M2I2M1D7M1I32M3D16M1I8M4I7M1I3M1I3M2I9M1D3M1D11M2I2M1I4M1D19M2I3M2I1M1D6M1I5M2I6M2I2M1D3M2I11M3D1M1I9M2I2M1I2M1D6M3I3M4I6M1D4M2I3M1I8M3I3M3I5M1I6M3D6M2D24M2D2M1D20M1I9M1I4M1D10M3I2M1D4M2I38M2I4M1I31M1I1M1I2M2I4M1D2M2I17M1D6M2I5M3D9M2D13M2D24M2I2M1D2M1D7M1D14M3I22M1D4M1I17M3D2M3D9M2D4M1I3M2D6M2I3M2I20M3I3M2D2M1I2M1I32M1I4M2I2M4I2M1I11M2I6M3I10M2D25M1I3M1I4M1I8M1D12M4I6M1I4M1D3M2D5M1I11M1I9M1D3M1I7M3D10M3D3M1I6M1I5M1I3M1D14M3D2M1D4M1I3M2I13M2D6M2I1M3I6M2I14M1I4M1D16M1I5M1I11M1D16M3I4M3I6M7I1M1I9M1D11M1I3M1I1M2D37M1I3M2I6M1I9M2I6M1I1M2I15M2D5M2I5M1I1M2I9M1D25M5I4M1D6M3D12M4I10M1D20M1D15M2I9M1D4M1D14M2D2M1I6M2D10M6I1M6I2M1I2M3I15M3I4M2D6M3D1M1D4M1D4M2D4M1D1M1D11M3D7M2D9M1I14M1D4M2D4M1I3M1D10M2D21M4D22M1D2M1D2M1D4M1I7M1I14M1D10M1D5M2D11M1I7M2D2M1I15M1I4M3D16M1D16M1I18M1D4M2D4M2D5M1D4M1D6M2I13M2D9M2I18M1D7M1I3M2I10M2I2M1I13M1I3M1I1M2I16M2I2M1D8M2I3M1I6M2D8M5D7M1I6M1I5M3I16M3D3M1I7M3D2M2D14M2D13M2D2M3I1M4I5M1I23M2I3M1D12M1I32M1D8M1I1M3D25M2D4M1D6M3D6M1D4M4D2M1D6M3I10M2I1M1I17M5I1M1I5M2I12M1I1M4I36M4I9M1I1M1I22M1I1M3I4M1I7M1I1M2D7M5I6M1D2M1I11M1I2M2D8M1D3M2D6M1I4M1I4M1I1M1I6M1D25M2I7M1I8M1D6M1I23M3D6M3I3M6I8M1I10M3I2M1I3M2I1M1D2M1D11M2D4M2I13M1I12M3I4M3D10M1I7M2D1M1D10M1D5M1I2M2D16M7D18M5I8M1D12M3I5M8I10M1D5M1D8M4I4M3I4M1I8M1D3M4D3M7D8M2I13M3I22M1I11M1D5M2I1M1I11M2I20M1D11M1I2M1I7M2I4M1D4M5D12M1D5M2I3M3I13M1D32M1I12M1D9M1D10M1D4M2I4M1D14M2I20M2D15M2I1M2I8M2I18M1I10M1D1M2D3M1D7M1D9M5D28M1I32M1I8M3D8M1I4M2I1M1D24M1I2M1I12M4I1M3I10M1I8M1I5M1I1M2D19M3I4M2D2M2D4M1I6M2D4M2D12M1I4M1I23M2D4M3D13M2I9M5I10M5I28M2I5M1D6M1D13M1I1M1I5M1D11M4D11M2I6M1I32M2I5M6I7M3I15M1I12M1D8M1D7M2I4M1D19M1I8M2D1M1I13M1D3M1D3M1D7M1I1M2I5M2D4M2D11M2D7M1D4M1I7M1D1M1D2M1D8M1I6M1D13M3D3M2I35M3D10M1I9M1D1M3D11M1I27M2I3M2D21M1D2M2D6M3D3M1D17M2I1M1I7M2I4M2D9M1I2M3I1M1I3M1D11M2D8M3D14M1I6M2I10M3I12M1I10M3I15M1D26M1D8M1I11M1I8M3D5M2I20M5S	*	0	0	AGTAGGCAACGAGTTGGTGATTTATGCGAAATGAAATGGTCTGACTTATGCTATCATATCTTTATGTCCAAAGAGCAAAACAAGCATCGGCAAATTGCCATCCCAACAGCATTGCATATTGATGCTCTCGGAATATCAATGAAGGAACCACTTGATAAATGCAAAGAGATTCTTGGCCAAGAAACCATAATGCATCTACTCGTCGGCGAACCGCTTTCTGCGGCACAGTATCAAGGTATTTATGCGCGCACGAAAAGCATCAGGTCTTTCCTTCGAACCAGGGATCTGGTGGTAGAGCTTTCACCGAGTTGCGCAGTTGTCTGCAAGACCTGCTAGGAGCAAATAAGCGATAATTTAACATAATATTCCCTGAGGTCGACAGATGGCATCACATCGATGGTATTGACATATCACAGGGGAGGGATGGGACAAATTGAATCAAATAATGATTTTATTTTACGTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTTATAATGCCAACTTAGATCAAAAGCTGAACGCGGCGAAACGTAAATGATATAAATATCAATATTAAATTAGATTTTGCATAAACAGACTACATAATACTGTCGTAAAACACATATGCAGTCACTATGAATCAACTACTTAGATGGTATTAATACTGTCCGTAACAGAGCATTAGCGACTGATTTTGTCGTCTTGCCTAAGCGTTGTCATCAAACCTGTCACACTCCAGAAGCACTCACCCAGTGCAAAGCTTTGTTGTGTGCGGCTAAGACGACCTGCATAACCAGTAGAAGATAGCAGTGATGTCAAACGACGCAGAGCTGACTTCTTTCTTTCACGACTTCCCCACACCCAGCATGCCGACCTTCCGCCATAACTGTAGTGAATGTCTGTTGGTCGACCAGGGAGCCCGGCGGAAATTAACAGCGTAACCAAATGGCTACCCGAAGTCCGCCGTGGCTATCTATCGGTATTACGTGAAACGCTTCTTCAGAAGCCTGAAGAGCTAATCGTTCTACCATCTATATGCATTAATAGACTGTGATGTTCTGTATAAACATGTCCCACCGCTGCAACATGAATAACAATCGTCTATCTTACAAAGGAAGCAGAAAGCTAAAGCAGAACGGAAAACTACAATACGGTTATTCCCCCGTTAAGTTCAATACTACTAATTTAGATGGAAAACGTATGTAATAGAGAGTAACTTAAAGAGAGATTAGATCCTGTGCCGCCAACTAGTGCGGTTATTTTAATAAATTAGAGATTATATGTTGGAGTTAGTGTGCATAGAGGCGGACTTCATGCGTAGAAAGGCAGGTCACGAGCAGATGGTCCGAATGACTATTCATTTGTTACAATGTTTTATCTTACTGTCTTTGATGAGCACATGGCTAAATGCGATATCGGAAATGTTAAAATTGGTTTGCCTGCAAAAGAAGAAGTAAGCACCTTATTGCTCATTAATAATAAATTCAGTCATTCCCTTAAAACTGTTTTTCCTTAGGTGAAAGCATTGACTATGTTAGTACCAAATGCTGCGATGGTTTGATAAAAGCTTCTGCCTCGGGTCAGGGTTTTACGTATGGCCAAATGTGGATTAGCCGACATGCAAATGAAAGCGTCCTTAACAGCTCATTACTTAGAGGGGTAACTCTTTCAGAAATTCATGGACAGTTCGCGCACGTGTTAAATGGTTTGCCAGGATTGTTGATTTCGCTTTCATTTAATAGAAAAATTAGTATGGCTCCCGGATTCAGTATTGATTTGACCCTTTGAGGTGACGGTTAATTCTATGCCCAGCACGAACACTTCATGCTTTATCGGGCCGAATGGTGTAGGTGAAACAACAATTTTAGAATGGAATGATCTTGAGGCAATCACCAACCCAGAAACAATGAATATTTCTGAGAATAATAGATAGGTACGTGGAGTCAAGAAATGCCCAAAGGGATATTTCGCGTACATTTTCAGTTTCGTTTGAATGCCTGTTATTCCTTTCTTAACCAACAAGCTGGATCACCAAACAGGTACCCAATACTTTTATATTGGACTCAAGAATGCTGCCAGCAAGCCGTTGTTAAATCACTAGGGGATCTCCGGGACTGCCTAATTCGATTTCAGCATTTATTGGTTGTATGAGAGGTAGAAGACGCCTCTGGCTTGAAGCTATCAAAACTAAGTAGTGATGAAAACTTTTGTCAAATATGGAACTCATCAGCTCCCTCATTTCTAAAGTAACCAGTTAAGACGTAATGAACCACAGATTCAATGACGATGATAAAATAATTCACTAAATTGTTTGAGTGACAATATCCGCGAGAATATCTGCTTGAATGAGCTCTGGACTGCAATTGTTTTATTTACTATCACAAGATTAGTAGATGTCGTTGTGAAAGTCATTAGTTTATTCGATGAACCAGAGATTGGGTCGCATCCCACCTGTCCTCCTCTGCTTTTCTACGGAACATTAAGCGAGACTTACTCGATGCACGCAATGGTGTAGCAATAATTGCAATCCATTCCCCAGTAGTACTGCAGAGGTTCCAAATCCTGCATGTGAAAGTCGCTCACGTTAAGAAGCAATAAAGTATGCGTCCCCTGTGAAGCTTCGGTAGAACTTAGGTGTTTATAATTGCGTGAGGTGTTTGACTATTGAAGTGACAAATTCTGGATACCACCACTTATTATCGCAAGTCCGTTGATTCAGACGTTCTTATGAAACCATTCTAAAGATTATAATGGTCAGATAGGATTAGAAGGTCGAACCCGTTTTAAAGCGATGTAAACTGAACAGAGATGAAGGTAAAGTACAATGAAAAACACTATCTTCCAGCGAGAACTTAGCGAAGTCGCTTAATAAATGCTGGAAGGTATGATTGCAGATAAATGTTAGAAATAATTTCATTACTCACTTCCCCACTTTTGCAGAAAGAACAACAATATAGAATATTAAGCTCGGACAGGTCAGTTATTTACCTACGACAGGACATAATCGCGGAGCCTACAAGGCGTAGGTAATTGACCTGACAAGGTTAAAAGGGTCGAAAGCTTTATGAAAATAATAATCTCCGATAAAAACAAACCCGCTAGAACATATTACGATGACATGCTTGTTTCCATCAGTGAAAATGTCCATTTTTGTAGTGACATCTAGACAAAAATATAGATCAACATTTTCTTCCTATTGCACATTATCCTGAATTTTCGGTGATGCCTATTAATTAGTTCCATCGTGCCGCGACGTGCAATATGGGAGAGAAAGGTCATAAGTTTTCGCAGTAGATGAGGTACATCTAAGCGATTCATCCTCCCTATATCGACAAGGACATTTTTCTTAGCAATGGGTATGCATTCGTTTTCCGGAACTCCGGGTGCTATCAGTTTTACTTTGCGCGTTATCAGTGAAACCGCCCGGCGACTGGAGGCAGGAAGACAAACACAGAGCTCTTCATCATTTCAAGCTATTAAATATTGTTAAACAGGTATCGTTGGAGGCAGGGAAGGCTTGAAGTGAATGATCTAAGAAACTATTTCGTAAATTGGGAAGCCTGTCAACCGCAACGTTTCCCTGAGTCGATTTATTGAAAATCTGAAACCGTAGCTAGAGATTTGAATGACTTCCCCAATTATTGGAAAGAGTTATGTATCAGTGCCTAGCAAACTCGAAGATTTTCCAGGGGCATTAGAATATGATAGTGAAGATAGAAAATTGCCGACGCTTATCGGAAGTGAACGCATCGTTATATGCACGAAAGGCTGTTTTACAAATCCGGTGACTTGCTAACGATTCTAGGCAAATCGCTTGGCATGAGTGAAATGAGGAAGAGGAGCGCCTGTTGTAATGTCCCTGGATACGCGCCGGCGTTAGGACAGTGGCGTACAGTCATAATGAGTCCTTGGCAACATGGTAAAATTCTGGCTGCAACGTAGATCGGGCACTGGAAATCATTCAACACCGGCACTATCGGAAGTTCACCAGCCAGCCGCAGCACGTTCCTGCATACGACGTGTCTTGCGGGGTCAGCACCATATCTCCTATGAGCAACGTGTTGAGCGAGCCAAGCCACAACTCTAATTTAATACATAATGAATGATAATAATAATATTAAATTTCCTGTGTTGACTCAATTACTATATGGGTTTCTGATAAGAATCATTGCGGAGATCGACCTATTGTATCCATTAACACGTTAGAGTCCTTTAACACTAATATATCAGCTTAGCATGCATGCTATCAAAAATCGAGAGTTTTATGACTAAACCATGGGAAGACACAATGGCACATTTATCACGCACTTGCTCAAATGCTGCATTGATACATATTTTGTATAGGCGTACTTTCGCCTTGAATTTGAATCATTCCTCCAAAACCGCAGAACAGTAACATTTATTATTCAAAACAAAACCAGATTACGAGTCTGACATTTGGTAACAAGCATGTTATTGAAAATGGAAAAGATGATCCATTAATGGCTTAAATTCCGCAATACGATAGAAAAACAAGGCGATTTAGAAAGGGTACTGAGGCAAAAGGCTACTCTTATTTCATCTTACATTGAAGAAAATGACATTGAGTTTATTATACAATGAAAGTATGTTAAACATTGGTAAAATTAGTCAGTATGTGCTAAGAAGAGTGCAACAACATTCATATTTAACTGAATCAACCGTATGTAATCAGAGATAGAGGTCTTAGTGACAAACGGAATCAGGGTAGCGATTAATCAGAAGACGATGGGTCGGCATAATCTATGGCAGAATGTAACTGCTGTACTCTCTTGGCATACAAATAAACAATCCGAATTACTGTATAAGTACTTTCGCCAACATCATTCGACTCTTTATTTGATGAAGCAGGAGAATAATCTACTTTAAATTAAAGATTATTCCATAGGCAGGTCATTTAGCATGATACAATATGACAATAAAGCGGCAATTCCTGAAGGACTTAGGAGCGTCTAAAGGGTATTAAGCCTGACAAAATATCATTCGACAGACAGAGTTAGTTGACTATACAGCCAGCTTGCAGAAACGACTTTTTACGGACGGTTGACATTCAAACATTAATTTTATGATAAACAACAATTCCATCCAATTGATTTAATCAATACAACATTTGAAGATCAAGCAGATAAATATATTTTGAGTTATGCAGCTGACAAGGCCAAATAACAAATCTGCTAGCTGGCTTCATTTACAATCAGAGCTATGAGCCAGAAAGACGCAAAAGAGCATCACTCTGCCTCAACCAATACATACAATGCCAATGAGGTACTCATAATTAAAGGCACTTGGAATTGATTCAAGGCATCAAATGTATTTCATGGAAAAATAGTTGAGAGAACGAAGAAAAACCGACTTTGTAGAAAATATCAACAGCATACTCAAACAGTACGAAAACAGCATATTTCATGCGTTCAGTCTTAAAGGATTGGCGGTATATGTAAACACTACGAACAATTGAGTCATAGAACTTCGTCATTATTCTCCCTGGATAACATTACTAAAACCAATACTCAGCTTTACAATAACTAACAACCGCAGAACGTTATTTCATACGACAACGTTTCTGCGGCATGACAAAACGATTACTCCATAACAGGGGCCACTCAATATGAGATGGAGTTGACTTAGCCCCACGGTTCAGGCACTACGATATTTCTTCCAGGGCTTCCAGCAACGAGGTTCTTCCTTCGTTGCAGTTTGGCACTCCGATCTGCAGCATCCTATGAAGCACGGCGCAATATGCACTGGCTACCTGCATCAGGCTTTTGTTTCTTCCGCCTCCGGATCGAACAGTTTTCTGCTTCCGTATCCTTCACGAGGCTGTGCCGTTCCATTTCTGAGTATTCCCCTCCCGGCGATAACCCAGCCTTTCCGGTAACGGACGAAATTAAGAGCCTCGCCCGATTCTACGGAAGCCCGGTCGACGGTCATAAGTTCCCGAATGATGGTCTTCATGAAGGTCCACGATGCCTCATCACCTGTTGAAAACAGCCACAAAGCCAGCCGGAATATGCTCTGAGTCCGTGCAATATCGGTACTGTTTGCAGGCAGACCGGTATGAGGGCGAATATGCGTCTACCTTCACCAATAATTCATTAGTTCCGGCCAGCAGATTATAATTTATGGTCCGTGGTTGTTCACTCATTTCTGAATGCCATTATGCAAGCCTCAATAGTTAAATGCAATGTTTGACGGTGTTGGAATTCCCGTTACCAGCGTTAACGGCTTATGGTGTTAGTTGAACCAATACTGAAAGAATGGCATGAGCACGATAGGCCAACCGGATGCTGTGAGCACCAATACACGGTATCTGCATGTGCAGCGGCACTCGAAGGCTGTACCGGACAATGGCGAGGTATGTGACATGCCCTTAACTTCGCCCTGCGTCGTTTCGATAGGCAGCTCCTGTGTGCTCATTCCTTTAACTTGCTGGCTGTCCGTAATGGTTAATTCCGACCTGACTCCAGCCATGTTCATCCTTAAACCGCTTGTGGATAGCACCCGCGCCATCGCTGTTGAACCGCTCAGACTGTGAGCATGATGCCCAGTCGTCGTTCCGCATTTGGTGCCGTAATGTGAATGCCTGTTGTTTTCGTCCCGTAATCAAACGACGATGTATTTCGTCCCCAGATCCGTGACACGGTAGGCACTGTGGCTGCGACTTAATTCCATCCTGTTCCTGAGACAATACAGCACGACCCTGGCTATTCCCCTTGATTGTCCCTCCGGGCATATCAGGAAGCGACGCAGTGGCTGGAGAAGCCGGAAGCAAGTTTGGTAGGCTGATTGTCTCAACGCCTGCGCCTGCGAAGCCATATTAGCCAGACGGAACGATATGGTGATAAGGATCGCACCGTAGAAGCCGAATTCTCACCGGCCCAAGGACTTCAAGAACATCTGCAACGGAATTTTTGCCAGAATATCCCTGCCTAACCTGAGTCAGTTCAGTCAGGCTGGCGGCATCATTTCCGCAAAATACGGTAATTATTTTCGCCGTGGAAGCCTGCCAGCGTCAGTGTCGCATTCTGTCAGTTGTTGAGCCGCAAGCGCGTTAGTCATGGTGGTAGCAAAATCTGGATCATTCCCGAGCGCTGCGGCCATTTCATTCAGCGTATTCAGTGCGTCAGGTTTTTGACGCGTCAGTAACATCTGCAATCGCGGCCAGTACAAAAAGCGGTGTTCGCAATCTGGGTTTGTTTAGACCTCCCATTTGGTCCATGTTGGCGTTCCATTCGGGTCGGACTGTCGATGTGGGCTTTCTGTTCGTTTCATCCATTACCATCTTAACAGCCTTTGGCGTGCAGCAAGCGTTTCAGACGTGCTGTTGGTTGCACTTGGCTGATGGCACTATCCCACTTTCTCGTTGTGTCCGCATCCTACCGCGACAGCTGAAGCTATATCTTCTGCACGTTTTGCCGAATTTAAATGTAAGTCCCACCGCCTTCTGCCCTATTTTACTTACGATTAATGATCTCGCACTTCCCCGCAGCCCTCTGTCTCCGCGGGTTCGTTGAGGAATGGACGCATCGCGCCCCGCCGCTGTTGTTTTGCGTTGCCCGGCAAGAGTAGGCGCGGTCGTTCCCCTGCTGTTCGACTCTACTCTGGGAAGGAGGCAGCCCTGCCTGGCAGAATTTCTGCCGCCGCTTCAGGAGGAAGCTGCTAATGGAAGGGCACTTGGATGATGCGTTCGTTTCTGATGATTTTGCTGCCTCCTTTGAGGCCAAGCGCATCTCGTGCTGAATGGCGGCCTCTGAAGGGGCTTTCGTGGCCCGGTGTCAAGAGGCAGACGTGGCGGCTGATTGTTGTGACGCTGCAGCATTCGTTTCTGACGTTTAGCGCACAGCACTGGCTAGAGTTTTGAGGAACTGCACCTGCGGGGTTTCCTTTTCAGTAAGTTGCTGATGCCTTCTGGCGCGCCTAGAAGGCCTTCCTAGCTGGACGATGCAGCTGTCCGGCGACGTGCTGGCGGCGCGTGCTGGATCAGTTTGCATCAGTTACAAGGGCCGCGACCTGAGCATACGAATGCACTGGCATGCCCTGACGCTGATTTCTTCGCGTCTGCCGTATCTACTGTGCCACGACCGTTGAATGAATCGGAGCAGCGCCACCTTCCTCAGCATCAGTTCAAGACGACGCATAAGCATCGCTGAAACATCCTCCAAGGTCATGTAACCATACAGAAATGGATTCAGCGTCCCGGTTGAATCTTCATACACGGGCTTATGGTCCAGCGGCGTCAGTTGAATACTTAGTGGGAAACCGTCAACCTGCAGGACGGTAATCTTAATGACGATCTCCACATCGCGCTGCTTAACGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCACCACCACCGTGGTAGTGTTAGGCTTCTTTATACCGTTTGCCCTACCTGAATGGTTAAGTTCTGTGTACTAGTTTTCCTGCCGTCTTTCCTCAGATTCCTGAAATCTTTACTGCCATATTCAGCCGCACAAAACGCGCGTCCGGCAGATCGATTCATAGTGTCCTGGCCTATCCATTTATACAGTACAACAAGTGAATCCGTCTAGTACGGAGTCGCCACTGCCGGCCAGCCTTCATAAGCAATATCAACAACGACGGACGGTAGATTAATCTGGTACCTGCATACGCTAAGTAGACTATGCCGCATTGCACTTTCGTCCCTGGCAGTGGTCGTGCTTTCATACCCGGGGTTTCCGTTACGTAATGCGATGTACTGCTTCATGATCACTAGGACTGTGAGCCACTCTGAGAGCCTGGCGTACGGAGACCTGCTTGATTTGTAAAACCGGTCCGGCCATCACGCTCACAGACGTCCACGCAGCGCTCTCATAGTGAAACGTATCCTCCGCGGTCATCACTGTGCTGCTCTTTTCTACCGGCGAATCCCAGGGAAGCCGACCGACGCACTGTTAGCGTCAGCTCATAACGGTATATTGG	*	tp:A:P	cm:i:87	s1:i:826	s2:i:0	NM:i:2618	ms:i:2900	AS:i:2878	nn:i:0
+26	0	utg000001l	30793	60	7S16M1D4M2D10M3I1M1I9M3D28M3I4M1I13M4I6M1I23M5I1M1D14M2D4M1D2M1D4M1D11M1D2M1D4M3I23M5D10M2D10M2D9M1D1M1D8M1I3M2D14M1D3M1D7M1D6M1D2M1D17M1I23M2D4M3D13M1I1M1I3M2I6M1I3M2I42M1I1M3I14M1D3M1D14M2D2M3I7M3I3M1D26M2D4M1I3M2I4M1I6M4I4M5I2M1I4M1D4M2I1M1I2M1I8M2I14M3I7M2I20M1D26M1I6M1I18M2I3M5D9M2D13M5I13M2I12M5D7M1I12M3D5M1I17M2D2M1D9M2I13M2D2M4D2M3D2M3D10M3I2M1I3M1I2M2I8M3I18M4D4M1D5M2I4M1I2M1I3M2D2M4I18M1D6M2D13M1I7M1D10M2I9M1D6M1D4M4D5M2D2M1I12M4D4M2I4M3D2M1D2M1I3M1D1M2D16M1I1M2I1M1I4M1I9M1D12M1D3M1D6M1D3M1I3M1I4M1I12M1I17M2I10M1D9M3D13M1D26M1I20M3I6M1I6M1I4M1I7M1D9M1I9M1I13M1I6M2I25M1I3M1D2M2D8M1D4M1D10M2I4M1I1M1I7M6I2M1I2M1D3M1D9M5D3M1D10M2I8M1I1M2D13M1I4M1D4M3D7M1D4M4I4M2D4M1D14M1I39M3I4M1D2M2I5M1D5M4I18M1I17M2D5M2I34M1D3M1I15M2D5M4I6M2D6M2D21M1D2M1I7M2I9M1D2M1D19M1D12M1I1M1I7M1D21M1D18M5I9M1D9M1D3M2I9M1I17M1D12M1I8M2D19M2I16M3D15M1D6M1D12M1I2M2D5M1D33M2D11M1I4M1D7M1I4M1D7M1D3M1D3M1D4M1I2M3I4M1I4M1D8M11I4M1D4M3D3M1I8M5D3M1D9M1D7M1I10M1D19M1I12M1D22M3I3M2I2M3D5M3I14M2I3M2I2M1D7M1I1M1I8M1D23M1D13M2I3M1I13M1I2M3I3M1D6M3I8M1I2M2I1M3I6M2D32M2I3M1I5M2I1M2I8M1D5M1D7M1D8M2I8M4I4M5I2M1D6M2D2M2I1M2I10M1D26M2I23M2I17M2D17M2D2M2D18M1I18M4D3M1D4M1D2M2D2M1D5M2I1M1I11M2I4M3D21M2I3M1D14M1D1M1D3M1I7M2I3M10I2M1D36M2I7M5D1M1D1M2D6M1D34M2I28M1I13M1I6M32I2M2I3M2I15M4I3M2D6M1D26M1I1M2D2M1I8M2I3M2D7M1I2M1I3M1I10M3D5M1I13M1I2M1I5M4D5M1D7M1D7M2I14M2D1M1I3M1I4M2D6M1D2M2D8M1I5M1D6M4I7M2D5M3I2M1I8M2D8M2D1M2D8M1D8M1I3M1I7M6D5M1I6M1I2M1I9M1D3M2I2M1I5M1D6M1D19M1I5M3D6M3D2M1D4M1D7M2D12M1I2M1I14M2D6M1D5M5I4M1D7M3D1M2D5M3D2M1I28M1D3M1I8M2D12M1I2M2D3M2I4M1I1M2I3M5I6M1D14M6D5M2D4M1I16M1I1M4I3M8I11M1I6M2D4M1D4M1D5M1D4M1D2M3I13M3I1M1D5M1D5M1D8M1D4M2I9M1I5M1I2M1I8M5D6M1D2M1D1M3I22M2I2M1D26M1I6M2I10M2D16M1I1M2D8M1I5M1I6M1D11M2D20M1I10M1D29M2I9M1D7M1D6M2I4M1I9M1I8M1D12M2D12M2D4M1D15M2I3M2D1M1I13M1D4M1I15M2I3M1I4M2I2M3D2M1D4M1I8M1I4M1D6M3D6M1D5M1D14M1I3M1D7M1D3M1I5M1D14M2I4M1D22M3D11M2I3M1D15M2I8M1D6M4I6M4I2M1D11M1I10M2D4M4D8M1D1M1D8M1D9M2I4M1I3M1I13M3I4M2D7M1I3M1I2M1I9M1I8M2D19M2I2M1I13M1I3M3I15M2I18M3D8M2I8M1D7M2D9M1I3M3D15M5D6M1D6M1I4M2I7M1D9M4I29M1D10M1D36M2D25M2D6M2D4M2D5M4D7M1D2M1I2M1D2M2D1M1I7M1D5M4D2M1D3M3D2M3D6M2D2M3D2M1D5M6D3M1D9M1D4M1D6M1D15M3D3M2D5M2I3M1D8M1I20M1D17M1I18M3D1M1D2M10D9M1I6M1I7M1D4M1I18M2D3M1D14M2I4M1D4M2D3M3D3M2D3M1D8M1D6M1D1M1D10M1I6M2I5M4D5M3D2M1D1M1D7M3D19M2D3M4D3M2D3M2D4M1I16M1D1M2D3M2D1M1D8M3I14M1D24M1D14M3I1M1I8M1I11M7I16M1I5M1I3M1I7M1D4M2I33M1D6M1D4M1D2M2I27M2I3M2I4M1D7M2I3M1I5M2I10M1I1M1I13M1D1M1D30M1D14M2D4M1I4M1I10M1I5M2I6M1D11M2I2M1D4M1D20M1I3M1I18M4I4M1I3M1I16M2D23M1D3M1D13M2I1M1D17M1D9M2I12M2I10M1I7M1I29M2D1M1I11M1I14M1I18M5I8M1I3M1I26M2D5M1I21M3I12M1D24M1D3M1D13M5I7M1D3M1D16M2D13M1I6M1D3M1D6M1D4M1I8M2I8M2I6M2I3M1I2M1D3M3I10M1I26M1D12M2D1M2D3M1I8M2I8M1D6M2I4M1I6M1D17M2I14M1D3M2I6M2D17M1D6M1D2M5D4M3D1M1D16M1I23M1D23M1D12M1I4M1I12M1I17M2D7M11I1M1I9M1I5M3D5M2D11M1D4M1D3M2I7M4I16M1D4M1D1M1D12M2D19M1I11M1D3M1D10M2D5M1I8M4I14M1I10M2D1M2D6M1D8M1I7M1I24M1I14M1D1M1D21M2D11M1I17M1D21M3D15M1I8M2D2M1D23M1D11M4D33M1D20M3D21M1I5M3D4M2I8M1D23M1I9M2I4M1D20M1D19M3D2M1D3M1I5M3I7M1D6M1I17M1D9M4D11M1I16M6I17M6I5M1I7M1I22M1I7M2D2M2D22M1D15M1I12M1I9M1D19M1D3M2I39M1I2M2D25M1D6M3D8M3I7M2D10M1I6M1D10M1I1M2I12M1I23M1I28M1D4M1D1M4D3M1I8M1D5M2I9M1D9M2I7M1I12M1D8M2D1M1D14M1I3M1I2M2I7M1D14M2I16M1D69M1I2M2I3M4I11M3D4M1D12M2I11M2I2M1I15M1I13M2I8M2D12M1D13M2D11M2I13M2D1M1D7M2I11M2D13M1I5M1I5M1D4M1D2M1D4M1I5M1D9M2D7M1D14M2D7M18S	*	0	0	CTTAGTCCGTTTCCAGCAGTTCTTTTAATCAGCCACATACGCCCCGGCGCGGTGCCTGCCCCGGCTGGTACAGCCAAAGGCAGCATCCATCTTCGTAGCAATAGTTACGACCGTAACGGGCAATGGCCTGCGTATCTTCAACAAGCTCTGTCGCCGTCTCCCAGCCGTTGTTCGGGTCAATCCGGCGTTAGCCTCAACGGCATTATGAGTCCTTCAGGGCGCTGAAGCTGTAGCCTAGAACGGCGCGCCATCATCCGGCATCACACTAACTGCGTTATAGTCACGTCTTATCCGACGGTTTAGTCCTGCACGAACGTCAGCGTGCCGTTCCATACCGGCGACTCAGCGCATCGCCGAGCAGAAATCGCTGAGCACATCCACGCCTTACGCTGTGGTCAGGTGACCGCGCATTACAGGTGAGCGGCTCGTCGCGTCCCCCAAAGCCGTTCTAGGGCACTGACTGGTCGCAGTACTGGCCCATCATACCACAGCACCGCTTTATTATGCGTATGCACATCCGCCGCATCAACAGAACCGTTTCCTCCCATGCCGTAGCGCCTGATGGGTCGGCATATCCCACAAGACACCAGCCATGTTGTTGCTGTATGCCGGTTTAAACGTTCCGTTCAGATACCGCTGTACTTGCCGTCTTGAGTTATAGTTCGACGAGCTAGCACCTGCAGAGAAGATACGCCCGCGCATCATTAGCGGCTCACCTGCTGGCTGCCGAACTGCTCCCCGTTGGACCCGCCGACCAGTGCCGTGTTCGGCTAATTGTTTCAAGCCGACCTTCAGTGTTGACGACCGACCAGCGTTTTGTCCTGCAGCTGGTCTGGTGGTAGCTGTCCGGCGTCATCCTGCGCATTAGAAGCTTAAACGGGCGCGGCGGCAGGTTACCCATCACCGCCCCAATAGATGATGCAGGTGGTTTACATTAATGGTGATGTCTTTTCCGTTCACCAACAGCGTTACGTTGTATCTGAACCATGTACAAGGCGGCGACTTCCGACGGCTTCCTGTCACCTTTGGCTAGGTATTCCTACCAGTGCCTGTACACCCGACTTAAAGCGCAGACGGTCGATGTTGCAGACCCAATGGTGCGGGTGATCGGCGTCATATTTCACTTCCGTACCCCAGCACCGTCTGGAGCCGCTCGAGGATGCCAAATCCCCTCCGGCGGAGTCTGCTCCGTGCTCACCATACGCGGAACATCACACCGTGACACTGGATATGTTGATATTCCCTCGAGTGTCCAGCACCGGCGTACCTGTTCAGCAGCACGTCGTTTAAGCCATCTAAATGTCGACTTCAATCGTCGCTGATGGCATACCGATCACACTCAGCAACTGCGTGACAACTCAGGTCCTTCGTCGCTTTCTAGGGGTCCCTTACTGCTTCCTTTTACCCATTCCTCACGCTCCATAAATGACAAAACCGCCCAAGCAGGTCCTACACATAAAACATTTTGCATCAGCGACCAATAGATACACCCTAAGCTCGCCGTTCGCGTCTGCCGTGCTGATCTCCTGAGAAACCACGCGTGGTACCGCACGCATTTCCACAGAATTGACAAGCAACATTGCCTGGGCAACCATGTTATGCGTATAGAGAAGCGTAGGTTCTGCTTACCCGTTATCCGTTGTCTGTACGGGGAGTCTGGCTGCTTTCGCTGCCAGCATCTGCGCCACCACCGAGCACCATACTGTACAAGCAGCCAGAAAACAGGATGCCCGGTCATACCACCGGCCCCAATGGGTGCCCCCATGCTGCAAGGGGCTCCGGCGGTAAAGAATGATTAAGCAATGAGGCAGCCCCCAGATCGGAATACGCCCTGTGACTTGGCGCGGCGACTCTGGCACGATATGAATTACAGCGCCATCAGGCAGAGTCTCATGTAACTGCGCCGTTAACCCGGAACGTGCTGACGTCTGCCCGGCAATCGAGCGTGACATATACCAGCCGTCGCTCAGTTTCTACGAGCCGGGAGCTGTGTGAGTCGCATGGATTGAGCCCCCGTTTTCCACGAAGGTCGATGCGGCATACAAATCGTTGTAATCCCCGTAAAGGCAGATGCGCCTCGCTTCACCGGTACCGCCAGAGGGAGTGTGCGTGGACGGTGCCATGTCGTCGGTCTCCTCTCGTTTGCTCAGTTGTTCAGGAATATGGTGCAGCGCAGCTCGCCGTCGCCGCAGGTAAATTGCGGCGTGATTCGGCACTGACCGTAAACCAAAACAGCACAGCAGCACATCGCCGGCTGTGCCCGGTGATCAACGGCACCTGATACAGCCCGTGCCTCCAGATTATCCGAGATAGAGAATGCTTCTGGCCCGTTGAATCAGCTACCGTCATCCTCACGATGAAAGTCCGGCATCTCAATCCCCGCCAGATGATAAGCATCCCGGAACATATTGTGTAACAGTCCGTCACCGTGCTCAAAGCGCCGGTGAGATGCGGCACAGGGCAACTTATGAATCGTTGGGGGCGAGCGCCCCGGCAGGACTTAAAGCTGCACCTGCAGCCGGTCGGCCTCACTCAGCCAGGGCAGACCACCGGGTATGGACTTGCATCAATCAAGCACCCCCTGTCCACCCTGCATTTCTGCCTGCAGCCAGTCTTCCGGCGACACTAGAAATACGCCTCCGGCTCACCGGAGATATTCACGCAGGGAAAATATCTTTCCCCCTCCGGCGTGCTTACTACGAAGCTCGCACGACTCCATGGCGCACATCGCCGGGCGTGCGCCAAGAATCGCGCATGATTCTGTCTGTCATGGGATTTTATAACCCGCGAAAGTTGTTAATGGAAAGGAAGCCGCCAAAGTTGCCGACGTTACTTGCGATCTTACAACCCGCTCCAGGCATTTGCTGCATTTATCCTTCGTGATATCGGACGTTGGCTGGTCATTCATCCGCGACAGCCGCACTGAGTAACCGCACTCGTCACCGCGATAGTCTAGGTGCAGGTGTTAGAGCATGATACCGTCCTAGAAAAGCGCCATCCGTTTCCGTCGGCCGTGACAGATCAAAGGAGGCACTCACCGCTCAGTTCGCTGCACGCGGCCTCAATGCGCCAGCGGCTGATCATAGCCGCTCCGGATCGGCGTAATGGTCTCGTTGTACGAAGTTCACCGCATCCAGAAAACGGGCGTAACCTTACGCCGTAGACCACCCGTTCCGCCGACCAGACCCTGCATATCTTCCGCCATCCCGGTACCATACCGTACAGGTCGAAACCGTCAGCGTGGGCGCGTCGTCATGAAGCTGGTGCTTTGCCATTCAGTTCAAAACCGACTGCTCCCTGAATGGGATACGGCTGATACTATCTTCGCCCTGCCAGGTGACCGGCCAGCTTTTCGTTCTGTAACTCATTACAGAAAAGCTACGTTCTCCACGACCTCTGTCAGGTCGATTTCCACAGCAGCACGGCCGACTGCGCACCGTAGAGCATTCATTCAGTGTTTCCTTGGATCGATATCCTGCATCAGTTCACCTGTTCAAACTCTGCGCTGAACTCAACGCAGCATACTGACCGCGACGACCATTTTGCGCAGGTACCCTTTATCTGCCCCACTCATAAGGCGGCGTCCACAGAAGGATTTCCAGCCCCGTGCTCTTCCAGAAACGAACTCCAGTACCGTGGCCTCCTCACCGGGGGAACAGAAGGCATTTACGCTCACGTTCAGGTTGGCATTCAGCCCGGCACCGAGCCCTGAGAATAGCCATCACCAAAGCACCTTTCGTACAGAAGGGACCGAAGCTCATCCATACCGGGTTTCACTTTCCAGCACGAAGTCTTCATCGTCCTCCGGATGAACTAGCCATCACCCTAATCTTGTCCTGAATTCATCACGGGCATCCCTTGCGGGCCATGTCATACACCGCCTTCAGAGCAGCCCACGATATCTGCCCGTTCTTCAGCGTCGTTGTTAATCACCACATGGTTATTCTGCTCAAACGTGGCGGACGCCTGCGACCGGCTGTTCCATGCTGCCGGTGTACCTCGACATAACCGCCGGTAGGCATCGAAGGCGCATCAGCCGGTACGATTCCCCACGGCCAATCCGGCTCGTTGCCTCCTTCGTCCGACAAACAAACTCACCACGTATAGAACAATCCCCGCTGTAGCTCATATTTGCGCCGGTTCCCGTAAATTCCTCCGGTCCAAAATGGAAGTCGCGCCGCAGCGGCCTGAATGAGATCGCTGACGCGGATGCGCCGCCACCAACAGCCCCCGCCAATGGCGCTGCCGATACTCCCGACAATCCCACCATTGCTGCTTAAGCAGAATTTCTGTCATCATGGACAGCACGAACGGGTGAAGCTGCCTCAGTTCTGCTCAAGCCGTCAGCCGCGCTTCTAGCATCATCAAAGTTCTAAGGTCCTAGAAGATTGGTGTGCTCCATCATTCCAGCGACTCCGCTGCCATGTGATTCCCGACCGTCTTACCTGCCAGCTCTGTTAGTGCTGGAAGGACCATATCATTCAGCGCCCTACCATCATACGATTCCTTCAGGTTCCATCCCGTTGCGCCGCATGGTCAGTCAGCCCCCGGTGCTTTCGACCAAGCGCCCGTTCAGGCGCTTGAGTGCTGATGGAATTACTCAGGTTGCCAGCCAGTGCGGCCGACGGCGTGCCAATATCGCAGCGTTGCTGGTCGTATTCCCAGCAGGGGATTTCTCCAGATTTATTCCTAGGCAGACATCGAGCGGACGTTGCGCACGCCTCCTCCAGTACGCGACTGACTCTCCGCTTTCCACAATCCCGGCGCTGCTGGCTTGATTTTCTCATTTGCTCCGTAAGCGTGCTTGCTTCTCCAGCGTTTAGAGTTCTGCCTGAAGCGTCAGCAGGGCAGCATGAGCACTGTCTTCCTGACGATGCCCGCAGACTCCGTTCACGCTCTTAACTGTTTCGGCTTTTCATAGGTCGGTCTTCATAAGATCGCTTTTCACGCCTCATCAGCTCGTGTTGTAATGCCTGCAGGATTTTCCGTTTCAGTGCCTTGTTCCAGTTCTTCCTGACGGGCGGTATATTTCTCCACAGCGGCGTCTGCAGCCGTTCGTAAACGTGCGCCTCTCTTCGGTATTTCAGCCGTGACGCTTCGGTATCGCTCTGCTGGGTCCTTGAGCATTTTGTCCTGTTGAGTCCTGCTCAGCCTTCTTTCGGGCGGTTCAAGCGCAAGACGGTAGGTTTCACGATCATCCCATAACGCGCCCGCGCTTCATCGTTAACAAAATAATCGTTCCTTGCGCAGATTCCAGATGTCGTCTGCTTTCTTATACGCAGCCTCTGCCTTAATCAGCATCTCCCTGCGCGGTATCAGGACGACCACAAGTGGAGGCACCCGCATCCCACATGGATTTGAATGCCCGCAGTTCCTGTCTGCCCAGATCTCCAGCGTGCCCATGTTCTCTTTCAGGCGGCGGGTCTGGTCGTAAATGCTTTCGTTGCGCGCTCCTCGTTCCCGCCTGCAATGCCCCGGCTTCATCGCCGGAATCTCGGCACTAGCTACCACGCAATCTGCTCCCGACACGTTATGGAACTGGCGAGCCATTGCCGCCGTCAAGCCCCGACGTCGGGTCTGTGGTCAGCTTCCCGAAGGCTTCCCATATGTCCACCTATCCACGCCGATGCACCAGAGAAACGCGCCCACTCTGGCTGATGGGTACGCAATGTGGGACCACTACGCTTACCCGCCTTAACCAGTGCCTGAGTACGGGTCTGGTTAAACGTCACGCGGCCGCCTGCCCGGCTGGGACAGACCAGCATACGATCTGCCGTCAGTCCCGCCTGATTGCCACGCGACAGGACTGAGTTTTGTTGAAATCGGACATTGAGTTAGATAGGCTCCGCCCTGATACCGATGCAGCCAGCGCACCGGTCGCCACCGCCACAGCGAGGTGAGCGCCCACCATCGGCAGGGTACGCACCGGCAAGCCCTGAACATGGGGATGATGCGCGCCGAAGGAGTCCTTCACCTGCCCTGCGTGCAGCACCATTGATCAGCCACGACTTTGCCCGCCTTAAGCTGCGTGGCCACCGTCGGTGGATCTTTACAGGCAGCATACGCATCGGCGGCTTTATACTGCCGACGGAAATCCCGGTTTTCTGCAGCCAGCGCCCTGTCGACTCAGCGACGTTCAACGACTGCCGCTTTTCGCATCATTTTGCGTACCCATAAAAACCCTGACTCTGGCCATCTGCTCGTCAAATCTGTCCGCATCCAGACCCAAATCAACGACCAGATCGCCTAAGCGTTCAGCCATGACGGACTCCTGCGATGCCTTCTGATACTGTCATCAGGACAGTACGTCATCCTCCGTCATGTTGCCACATGGCGGGAAGCGGGGATACTTCATTCCCGTTCGGGCCACGGCGACAACAGAGGCGACTCCGTACGCTTTCTTCTGCATCAGCACATCATCTTCAGGCTCTTCGTCAGCCTCGCGCCGGTTCAAGCAGACTGAAATCCAGGGTAGGCAGATGCATATCTGGATCAGGGTCGCTGGAAAAACAGGCTGAGCACGGTGTACGTCAGCCCGGAAAGTGCATATCCAGCAGAACATCATGAATAATGGGTACTGTAAAAGCGGTGCCAGGTCGGCATATCGATCCTGACATCCCGGCAGCGAACGACCCGCCAGTCGGGTCGCCCCATCGCACGCCAGTTTCCAGCAAAACTCAGCTCACCGTTGAACATTTCCCGAACAGGCTGGTGCGGGCCCGGCGTCCTGATTTATTTCCGGGGCAGTGGTCCTCACCACAACTCTCATACAGATAAGACAGCCGGTTCCACCACGTTTTCAGCATGATTAAACGATCCTAGGTATTAAGCATTCCTTAACTCCGTATTTTAACGGCGATCCATTCGTTGCACGGCATCGCGTCTTCCATGGTTATGCCACAGGGACATCGCCACCAGAACGCGCCGGTTCTTCGATGGCGTCTTCCGCAAGTAAACTTCCGGTTGCTGTTTGACTCCGCCTGTTCTGCCTGCCGTTTCATCAGGGCGATGCTCAATGCGCTGCATGAGTTTAGGTGGACAGAGAAGCGTGACGGTCACCCGTTATGTTCAATAACTGATTTCGGTTTTCAGGGAACATCGCTGACTCTCTAGATGCTGGCGGTGACGTAATTTCTGCATAAACGCAGCAAACACTCACCATTACCAACCATGGAAGAATGTTGACTTGCTTTAAGCAACGAGCTCACGTTCCGGTATGTCACTGACAGGACTCACGGGCGTTGTTTATCCGCAGACAGCACGAAGGCCTCTTATTTGATAGA	*	tp:A:P	cm:i:80	s1:i:779	s2:i:0	NM:i:2029	ms:i:3386	AS:i:3398	nn:i:0
+27	16	utg000001l	30267	37	994S6M2I2M1D11M1I15M1I6M2I14M1I3M7D7M1I2M2I5M1I15M1D9M2I2M1D8M1D6M2D2M4I26M3I5M3D21M5I3M1D5M1I11M1D1M2I5M1D5M3D25M1D4M1I5M1I12M1I16M1I5M1D6M1I4M1D2M1D6M1D1M2D7M2I6M7I10M1D6M2D1M1D2M1D5M1I9M2D2M1D7M1I2M6I7M2D6M1I5M2D8M1I3M1D2M2D3M1D4M3I3M1D5M1I11M4D4M2I6M1D11M1D2M1I5M2I2M1I6M5D5M1I2M2D5M3I3M1D5M1D12M1I2M1I17M1I12M1I7M4I1M1I5M2I5M1D14M3D2M1D10M1I7M2I9M1D2M1I2M2D21M2I4M1D4M1I12M12D6M2D2M2D5M1I2M3D19M3I6M5D7M2D2M5D2M1I4M2D3M2D1M1D4M4D5M1D7M4D12M1I5M1D2M1D6M1I9M1D6M1D8M2I2M3I2M2I3M2I4M1I4M1I2M1D6M1D9M2D4M4I4M1I18M3D7M1I2M1D2M1D5M1D3M5I1M1I17M4D5M3I6M1I7M3D3M1I20M1595S	*	0	0	ATAAACAGAACGTTTCAATCTCACTGATATCTCGCAGCAGGTCCGTCTAGTTTCGCCGTCCGTCAGCCAGAAAAGCCGGAGTGATTAGCCGCTGAGTGGGGTAAGCCGTTCGAAGCTTCGTCGTCAGGGCATCAAAAGTCGTTCATGAATATCTCATTCACCTGCGCTACAACACTCGGCGTTTCGATTCGCGTTTGCCGGTATAATAAAATGCATCCCCATTAACGGCGAGCAACCAAAACTGGCTCGTGCTTCATTTCCTCTAGTCCTCCATCCCTGAGGCGTACCCAGCATTAGACAGATGTTTGCCGTCTTTATTGTAACTAAAGATTTGCCTCGGCATGAATTCGCTACGTATCACTTAGCATCCTTCTGTCACTCTTTCGAAACTCCGACGCTTGCTGGCGTTATCGGCTCACGGTCGACTCGACTTTTCCTACCATCCTGCCGAGATGGGATTCGAGTCTTGCCTTTGAAAAATCCAGGTAACGTCGCATCACCCGGATTGACAGACGGCCTCCACGAATTGCGATTTGCTAACTTAGTGTTACCCACTGTGACCAAAGTAAAGATCAGGCCGTGACCCGTTTATTGGTGAGGGTACATATCCGTACCAAGATAACGCGTCGTCGGTACTGTACGAGGAGCGCAATCTGCTTTTCTACAACAGAACTCAAACTGGTACCGTCGGTATAAACATCGAAGATGCGGCTTGAAAGTGGCTTCTAGGTCTAATCCTCTCACCGGCGTCGCTCTCAAAATCTAATTGAGAACGTCAAGTGAACGGCAATCGCCCCGCGCCAATACCGCATTACCGCCCGTGGCAAAGGGAGTCCCCCATATTCATACTCGTAGACTTTTATACGAGCCAGTTGCGTAGGTTCAGGCTTATGACATTGATTTCAGTCGTCCGTGAGATAGACGTCCGTCACGTCAAGTTGAACGGTCAGCCCTGGAAGTAAGTTGGGTGACATTCATGTTACGATAGGCTCATATTCCCCGGCGTCTGCAGTGATCTTCTGCGGTCAGGTGGCTGCAAGCCTTAGGCGACTAGATGAGGCCGTGACCTAAGTTTAGTTCGCCGTCAAAGTGCGCCCCGTCCTACACGATGGCTCTTTCGTAAAGCGCCTGCTGCACGGCGGTGATGGCACTTTACGTTCGTCGTTCTCACGGTACAGCCCACGAGCGGAACAGTCGCTGGCGCAGCGTCCTGGCAGCTTCAGCTCCCATACGCTGTATTCACAACACGTCAGGGAACACGGCTCGGTTTACCTTCACGCCGTTTAGTGACGGACTGAACTCACGGTAGAATTGCTACACTTCCCGCCGTCCGTCAACCAGCGTATGGCGTACCGGGATGGCCCGATCCGCGTCAGCATTCCAGCGTCAGTCCGGAGCTTGGGCTGTTCACCGCATTACACGACTGTGTGATACCGGCATAGTCGGTCCATCGCAGATTGGGTCAACAATGCTCACATGGATAAGGCGAAAGCCTTTGGGAATCCGCTATGAAATCCACGGTCTTGCCGTTTCCAGCAGTTCTGTTTTGGGATCAGCTCACAGCCGTAGCTGGCGCCTCGTTGGGCTGCCACAGCCGCATCAAAGGCATCCATCTTCGGGTAACAATAGACCGACGGGCAATGGCCTGGTGAGTCCTCAACTTTAGTCGCGTCGCCGTGTTCGGTAATCCAGTCCTCAACGGAATTATGGCGGTTTTGGTCGAAGCGGAACGATGGCGCTAGGCGTATCACAGGCATACATTACTGCGGTTTATAGTCACGTCTTTATCAGACGTTGCTTTGCACGACGACGATGTCGCAGGTAGTCGTTCCACGGTTCGACTAAGCAGCCATCGCCAGCTACAGAAATCGCTGACCTAATCGCCTAATCGTGAGTCAGTAGAGATCTGCATTACAGGTGATGCGGGTAGCGCCGTGCCAAAGCGTCCGGCCAACTGACTGGTCGCAGTACGGGTCATACGGTGATAAGCCGGCTAGACCTGTTTAACCGTTGCCCGCGTCGACCGGAGTTCAATCATCCACAACACAGGCCAGCTGTTGTTGCTGTATGTGCCGGTTTAACGTTCGTAGAGGTCACAGCCCTGTATTGCTCGTTATCGAGCGTCATTGCTGGCCCGTTGGACGCCACTCGCAAGATGCATCCTAAGGATTACGTGTAGAGCTGCTGGCTGCCGAACGGCGTACCTAGTCCATGTTCGACTCACCCGTTTCCTATGACTAGATTTCAGATTATTAGCCATAGATTCGTTTATAAACTAATTATTATCCACTTTATCGTAGGCGTCGGTGCTCTGCTATCTCATACGTCGTAATTAAACGGCGGGCTTAGGCAGGTACCCATCACCGAGGCCATACTGCGTGAGGTTTTTGGGCCCTCCGTGATAGTACTGTAGTTACGTTAGTCCTCAACAGTTGTATTTTGACTCGTAGGACGGATTCCTTTAAGGCGTGCTGGTTTCTCACCAGTCCTACAGCTCGTCGTCCGACGATTAGTACAAAGTAGGCCAAGACGTCGATGTTGCAGACGTAATGGTGTGAGACTCGTGAGTTCGTCACTTCCGTACCAGCCGTTGACCTAGCCGGATTCAAATCCTTAGGCTCTCATGCGTATTACTTAAACAATACGCTACACGGATAGGGTCTCCTGTTGACTTTAGAGTCAACCGCCGGATACGTTTACCAAATGTCGGAGCCGATGATGATAAGGGACTTCAATCGCTTCGGTGATGTAGCACCTGTAATACAGTACTAGCCAGGACTGCGGTCAGACTTCGAGTCGTGCCGCGTGCGGGGTTCGCGTGGATCGTTCCCATTCGTACGCGTCCATAAAGGACCGCTTAAGGGATGCACCAAACATACCGCATTCAGACCAAATAGGCCAATCTAGAATACGTCGCGTCGCTTCGATCAATTCCTGAAACCACGTCGGGGGCGATCGTTGACGGATTCCCAATAACGGAACGATTGAAAGACGATTGCCTTAGAAGATAGGTCGTTAGAATTACCCCAGTCCGTTGTTTATGTACGCCGGGGAGTGCGGGTCGCATTGCGCGATACGAGTACCACCACGGCACTGAGAACAGGATGCTCGACAGAAGCGAGGAATCGCGTTGCGCCGCAACGGGCATCTAGGTCAAAGAATGCATGCAATGAGTACGATGGCGATTAGGATGAATTTCAATCGAACTCCAGGCACCGCGGTACTGGAGTAAGATGAAGCGGGCAGCTGGCATAAGTAGAGTGCCGTAACCTAGTCCGAAGAAGTCTAATTATGCTACCGGCAATCCGTAGTCAGGGGCCATTTAGAGTCCCCTGACGAACGCGTTCGTACCCGGCGGTTTGGGAGCCATCCCATTCAGGGTCGCATTCAACCATAGGAGCGTCACGAATCGGGCTTGTAAAGCGCGTAAATGCGGGCAGATCCGTCATGCCCGTGACGCAGTTGAGTCGGGGAAGTGCTGCCAGTTGGGTGCGTACCCTCTCATTCAGTTCAGGAACTATGGTGCAGCAGCCGCGAGTCATAAACACCAATGGAGACGATGGATG	*	tp:A:P	cm:i:6	s1:i:64	s2:i:0	NM:i:349	ms:i:152	AS:i:110	nn:i:0
+28	0	utg000001l	22440	60	55S450M1D8M8D7M1D4M3I14M3I1M1D6M6I3M10I2M5I6M2I1M1I13M3I6M6I6M2D7M1D4M1I8M2D4M2D2M2D5M4I1M4I6M3I6M5I7M2I28M1I27M2I1M3I4M1I10M1I5M1I11M1I8M6I1M1I3M2I9M1I7M2I12M1I1M1I3M3D7M1D5M3I15M3I3M3I1M1I7M1D20M6D5M1D21M1I19M1D5M1I12M1D2M1I4M1D7M2I10M1I3M5I1M2I3M1D10M2I4M3I1M1I3M1D13M5D3M2I1M1I4M1I4M1I6M3D3M2D1M1D1M1D7M1I7M1D3M1D33M5I15M4I12M6I1M1I4M1I4M1D6M2D1M4D7M4D6M1D6M1I4M9I1M2I3M3I2M3I3M1I10M2I14M2D13M1I5M1I21M3I4M1D9M1D2M1I5M1D1M1D12M2D14M5I7M1D4M4D2M2I28M2I2M1D4M1D2M1D7M1D7M3I3M1I5M1D28M1D12M1D13M1I1M1I6M5I5M1D3M1I3M1I4M1I1M1I4M3I4M3I3M4I13M4D6M2I4M1I16M2I10M1D2M2I11M1I9M1I10M2I14M4I4M2I5M1D39M3I13M1D1M2D5M1I1M2I10M3I2M5I1M1I8M2I8M1D4M4I3M2I9M4D1M2I10M1I2M1I13M2I9M2I5M1D25M1I4M3I22M1I7M2I3M1I19M1I16M1D80M1I9M1I1M3I6M2D2M1D11M4I12M1I23M2I9M1I6M1I23M1I7M5I1M1I7M7I28M1I26M1D27M2I20M1I11M2I12M1I8M2D9M1D5M1D3M1I13M3I12M1I14M2I4M1D17M1I1M1I1M2I16M1I2M4D10M6I7M5I24M3I12M1I12M1I13M1I7M1I5M1I14M2D9M1I3M1D4M2D2M2D9M1D15M1I5M1I10M1I3M1I3M2I9M1D3M2D11M4I5M1D11M2I8M2I3M2I1M1D4M1D2M2I7M3I17M1D11M4D5M3I3M1I16M1I4M1I8M1I4M3I15M1D5M1D33M1I28M1I11M3I2M1D9M1D4M1D9M1D4M1I1M1I16M1I14M1D14M1I1M1I8M1D21M1I14M4D15M2I32M2I11M1D14M3I3M1I6M7D1M1D4M1D4M1I25M1I11M1D4M1D1M1D11M2I4M2I12M2D1M1D2M1D5M2D11M1I2M1D37M1I20M2D3M1I12M3I3M1I6M3I8M3D1M1D1M3D5M5I7M1I4M1D10M4D7M2I8M1I2M2I10M3D21M1I1M1I2M3I5M3I3M1I2M3I6M2D12M2I5M1I4M1D9M2D23M2I23M1I5M1I15M1D2M2I5M2D6M1I7M7I1M1I9M1D8M1I3M1I3M2D3M1D1M1D6M1D5M2D4M1D13M1I3M2I15M2I6M1I1M2I13M4D6M3I10M2I5M1I18M1I6M1I11M1D14M1I1M1I10M1D12M3I4M1I7M1D6M4I9M1I4M4I6M5D5M2D8M5D6M4D3M4D3M3D5M2I8M1D7M6I6M1D10M1I10M2I15M1I10M3I2M1I4M1I20M1D38M1D1M2D16M3I3M1D4M3I3M1I4M1D1M1D8M1I13M1D10M1I2M1D1M4D37M2I9M1I14M1D13M1D7M1I14M3I3M2I3M4I4M1I8M9D15M2D9M2I6M3D17M2I4M3I10M2I10M1D15M2I19M3I2M1I1M1I5M3D5M5D1M1D8M3I2M1D24M3D9M4I11M1I3M1I18M4D5M5I2M2I4M1I17M2I6M2I3M1D28M1I7M1I12M1D6M3D25M2D11M3D3M1D3M1D2M2I6M4D4M2I8M1D2M4D4M4I9M3I6M2I13M4I7M1D43M1I14M2I8M1D6M1I3M1I15M1D4M1I9M2D5M1D4M2D9M3I1M1D23M1D14M2I7M1I15M1I23M3D6M1I2M2I3M2I2M2I3M3I11M6I2M1I3M2I1M1I8M3D1M2D8M1D4M4D1M1D10M1D6M1I13M1I7M2D5M2I11M1I2M1I4M1D15M7D9M1I42M2D7M2I15M2I35M1D5M1D6M2I11M1I9M1I14M1D16M1I8M2I13M1D3M1D7M1I3M1I6M2I2M2D5M5D12M2I6M2I2M1I3M1D10M1D8M4D9M2D2M1D6M2I12M1D24M2I5M1D7M6I5M1I8M1D7M1I2M2I5M1I6M1D34M5I1M2I8M3D7M1D23M2D3M2D2M2I1M1D6M1I6M2I17M1D6M4D3M1I2M2I3M4I9M1D1M1D10M1D25M1I1M2D10M3D14M1I2M1I1M1I18M4D2M2D4M6D13M2D3M1I2M2D8M1I6M1D7M1D8M1I6M2D4M3D23M1I4M4I3M3I27M8D4M1I4M6D8M2D9M1I6M4D11M2I6M1I35M1D10M1I11M1D2M2I6M3D8M1I1M1I5M2D27M1I8M2D7M1I8M1I7M2D1M1D12M3I17M1I26M1D32M2D34M1I1M3D11M4I16M1I35M2I10M1I18M1D5M1I5M1D15M1D1M1D2M1D4M2D7M3D1M1D5M4I2M2I1M1I3M1I9M1D2M2D25M1I6M5I14M1I17M3I1M1I15M1D6M3D2M1D1M1D17M2D17M1D56M3D7M1D11M3D3M1D9M1I21M1I17M1D3M2D11M4D3M1D17M3I5M1I2M2D14M2I14M2I15M1I5M1D12M1D4M2I7M1I3M1D3M1I1M1I7M3D4M2I7M1I12M2I1M1I7M1I10M2I8M5D2M1D7M1D17M2D5M2D3M2I4M1I16M4D2M1D7M2I1M1I2M1I7M2D7M1D6M2D4M1D14M2I37M1I7M1I8M1I4M1D2M3D8M2D2M2I1M1I3M1D8M1I1M1I3M3D39M2I5M1I7M1I3M2D12M1I12M2D4M2D6M1D6M4I4M1D1M1D11M2I3M4D9M2I7M4D9M2I6M1D6M3I2M5I2M1I20M2I12M1D3M3D6M2D17M1I2M2I5M3I1M1I3M1I2M3I4M2I7M3I7M3D2M2D7M4I11M6D5M1D4M7D2M1D4M3D13M1I12M1D8M1D12M4D16M1I8M1I16M2I4M2D10M4I4M3D2M2D6M6D6M1D2M5D2M2D6M1I29M1D7M1I15M3D5M1I46M1D4M2D10M1I27M1I9M2I23M2I7M2D6M1I30M1I6M1D5M1D3M3I8M4D5M1I25M1D4M3I22M3I14M1D13M3D11M1I8M2D5M3I15M1D3M1D2M1I11M1I2M1D1M1D4M1D3M1D2M1I6M1D12M1I1M1I5M2D4M1I30M1D9M1D1M1D11M1D7M2I12M1I6M4D1M1D3M1D38M1D4M1I6M3I8M4D6M1D3M1D5M1I11M1I11M3D20M4D2M1I23M5D2M3D22M1I9M1D12M2D5M3D10M1D13M2D10M1I1M1I4M1I4M1D15M1D10M1D3M1I9M1I15M1D35M1I17M2I2M1I2M1I5M2D4M1I3M5I1M1D6M1D2M1D17M4D10M4D5M1I2M1I4M1D3M4D4M2I12M3D11M1D1M2D6M1D6M4I1M1I8M3I8M1D9M3D19M1D2M1D3M2I18M1I9M196S	*	0	0	TGTTGCCTCCATGCGCAGCGACTTACTCGATGCCGCACGCAATGGTGGGCAGCATAATTGCAACTCATTCCCCAGTAGTACTGCAAGAGGTTCCAAAATCCTGCATGTGGCAAATCCTACGTCGCGAGATAAACTTATCCGTTAGATGCACGGTCGGTATTAGGTGTTTATACGTGAGGTTTTACCTTGAAGTGACAAATTCTGGATACTACCACCCCTTATTATCGCAGTCCGTTGATTCGAGCTTTCTTATGAAACCATTCTAAAAATTAGATGGTCGATAGGATTAGAAGGTCGAACCGTTTTAAAAGGGTGAAGTAATAATGAACAGAGAGATGAAGGTAAAGTACAATGAAAAACTATTCTTCCAGCGAGAAGTGTAGCGAGAAATGCTAATAAATTGATTAGAAGAGTATGATGCAGATAAATGTTCAGAAATAATTTCATTACTCACTTCCCCACTTTTGCCAAGCAAAAGAACAATATAGAATATTAAGCTCGACAGGTCAGTTAGCTTTACCGACAGGACACTATCCTCCATGGACAAAGGTAGTTGATAAAGTGAAAAGGTTAGGTGAGAAAAGCTGTTATGAAAATATAGATCTACGAGTCGACAAACCCGCTAGGCTATTGCCATCATGTGTTTCGTAAAAAGCTGAGGGTCATTTTGTGGTATATAGAAGACAAAATATAGATCATTTTCTTCCTATTGCACATTGATCCTGAAATTTTCGGTGATGCTATTATCATTCGATTCCATCGTGCCGCGACTGCAATATGGGAGAGAAAAGTCAAGTTTTCGCAGTAGATGAGGTACACCAAACCGATTCATCCCTATCATAAGTTCGTGATAGCGGGTGCAAATTTCGTTTCCGGAAACGGGTGCTATCAGTTTATGTTGAATGCCCGGCGGGCAGGAAAGACAGAGCTCTTCATCAGTTTCAAGCTATTAAATATTGCTAACAGGTATCGTTTGGAGGGCAGGAAGCACTATTGAGTGAAGTGATTACTCAACGAGAAACTCTTTCGTAAAAGGTCTACCAGGAAGTAGTTCAAACCGCAACGTTTCATAGGCTACCGTCGAATTTAGCATACAGAGCAATCTGAAACCTATTATAGATTTGAATGACTTCTGGTACGCAATTATTGGAAAAGAGTTATGTATCAGTATTCTAGCAAACTCGAAGATTTTCAGGGGATGTAGAATATGATGAAAGATAGAAAATTACGACGCTTATCGGAAGTGAACGAATACTTTTATATGAGGAGGGCTTTCCAAATCCGGTAGTAACTTGCTAACCAATGTCAGGCGAAAATCGTGGCATACCAGTGGCATCCGGAGGACGTTTGTAATGTCCTAACCGGCACAGCAGTTCTAGGACAGTGAGTCAAGAGTCATAGATCGTCGGTGGAGGACTTAGATTCTCATGCAAAAACATTAAAATCGGTAGCACTGGAAATCATTCAACACATAACCTAGGATATTCGAGCCAGCCGCAGCACGTTCCTGCATACGACTGTCCTTGCGGCTCTACCATATCTCCTATGAGCAACGTGTTAGCAGCCAAGCCAACTCTAATTTTAATACATAATGAATGATAATAATAATATCTTAAATTTCCTGTGTAACTAATTTACTATGGTTCTCTGATAAGAATCAGCGCCTGCAAAGATCAAACAACTTGTATTACATTGACAGTTAAGCAGTTAATTTATCACCTCTAAATATATCAGCATCTAGCATGCAGTAAGGGTCAAAAATAATGGAGAGTTTTATGACTAAACCATTAGGAAAGAAGACTGCCTTTATCGCACTTGCTCAATGCTGCATTGATACATATTTTGATCCTGAATTATTTCGCTTGAATTTGAATCAATTCCCTCCAACCCGCAAGAACAGTAACATTTTATTATGTTCAAAAACAAAACCAGATTATAGGATATGACATTTGGTAACAATAATGTTATTGAAAATGGAAAATGATCCATTAATGGCTTGGCTAAATTCTCGCAATACGATAGAAAACTTCAAGGCGATTTAGAAATGTATAGCGGCGAGCAAAGCTCTCTTATTTCCTGTACATTGGCGGAAAATGACATTGAGTTTATTACAAATGAAAGTATGTTAAACATTGGTAAAGTTAGTCAGACTTTGCACACAAAGGAAATTACCTTCATTTAACTGAATCATCTATTATTAAATCAGAAGCGACGATGGGTCGCTAATACGCTAAAAGATTACGAATTATTACATGCCTTAGCTATAATCTATGGCAGAATGTATAAACTGCTGTAACTCTCTTGGCATACGATAAACAATCCAATGGTACGCTTGATTTCGCCAACAACATGGTTCGACTCTTTACTTTGATGAAGCCGGGAGAATACTTATTTAAATTAAAGTACTCCCATAAGCAAATTGTCATGTTAGCATGATACAATATACGGACTCGACCAAATTAATTCCTGAAGATATTAAATATTAGTCTACGACTGGTAGATAAGCCTAAATATCACTTCGACAGAAGAGTTAGTTGACTACTCAGCCAGCCTTGCGGAACAAGCGTTAGGACGTTATCACATTCAAACATTAATTTTATAGTAAACAATTCCATCCAATTGATTTAATCAATGAACATTTGAAGATCTAAGCAGATAAATATATTTTTGGCGTTATGCAGCTGACAGCCCCAAAATAACAAATGCCTATGGCTTCATTTGGATATCATGGCTTACCAGAAAAGCAAGCATCTACTCCAATAAACCAATACATACAATTGCCAATTATAGATGAAGACTTCAGGTAATTGGAATTGATTCAAATAATAATCAAAATGTATTTCATGGAAAATAGTTAGAGAAAACGAAGAAAAACCGACTTTAGAAATATATCAGCATATCAAGACCCTGACGAAAACCATATTTCATGCGTTCAGTTAAAGCAATTGGCGTGATGTAAACACTGAACAATTGAGTCATAGAACTCTTCCATTATTCTCCTGAAGATAATAATCGCCAAATAAACCAATACTCAGCTTTACAATATACTAACTAACCGCAGAACGTTATTTCATGGGGCATACGTTTAAACAAAACGATTACTCCATAACAGGGACAGCAGGCCACTCAATATCAGGTGCAGTTGATGTATCAACACGGTTCAGCAACGCATCGTGCACGTCGAGCAACAGATTTCTTCCTTCGTTGCGTCCCAATCTGCAGCATCTAGCAACAGCGCAATATGCTTCCTCCAGCCTGCATCAAGCCATTTTGTTCTTTAAGCCAATCCCTGAGTTTTCTGCTTCTCGTATCCTTCGCCCCAGGCTGTTGCCGTTCCACTTCTGATATTCCCTCCCGGCAAAAACAGAACCCTTTTCTCAGTATAAACGAGTCCCGCAGCCTACTACGAATTCTCGAAGCTGGAGCCATGAACCCGGTCAGCTAGTTTACCGCGATGGTCTTCAACGGAGATGCCACGATGCCTCATCACCTGTTGAAAACAGCCACAAAACCGGAGCCGATATCTGGCGGTGCAATATCGGTACTGTTTGCAGGCAGACTCGGTATGAGGGATATGCGTCATTCGCAACGATTCATTAGTTCCGGCCAGCAATTATAATTTATGGTCCGTGGTTGTTCACTCGGTTGAATCCCGCTGCAAGCCTCACAATATAGTTAAATGCAATGTTTTGACGGTGTTTTCCGCGTTAACGCAGCGTGCTCGTGATGGTGTTAATTGAACCAATACTACCCAAAGGGATGGGAGCCGCCCTAAGGATAACACTCCAGATCAACTGCCGCGCATCGCAACTGCGCACCGATTGCACGGCGGCTAGGCTGTACCCGGACAATGAGTGACTGTGGCTGCCCTGACTGTCAGCGTTCGCTCATATACGAGCAATACTCGTGTGCTGTTGCTTCCTTTAACTGTGATAAACTTCCTGTAATGGTTGCTGTTTGCTACTGACTCCAGCCGCTGTTCATCCTTAAACTTGTACTGTCTTAATCTATGACCCTCGTCTCCCCTGTTGAACCGCTCAGACTGTGAGCTGAGCCCCCGTGTTATTCGTCGATTTGGTGCCGTAATGGGGACTCTTGTGCTGTTGTTTTCGTCCCGTAATCAAATAGGGTGGTTTTCGTCCCCAAATCCGTACCGGATGCACTGGCACTGTGCTCTGTGCGACTTAATTCCATCCTGTTCCTGAGACAAACCGCTAAGGCTGGCGGGTTTCCCCTTGATTGTCCATAGGGCATCTAGGAGCACATAGCATCCGGATACGCGACAGCAAGTTTTGGTGAGGCTGATTTGTGTCGACTACAAATCACGGGCTATCGCCAGACGGAACGATATCTGATGGCCAACGGGATCGGCAGGACGGTGCCGAAGGTCGAATTCAGCGGCCCCCAAGGTTCAAGAACATCTGCAACGGAATATTTTTGCCAGAATATCCGTGCCAACCTGAGTCAGTTCAGGTCAGGCGTGCATGAATCGATTCCCAAAATACGGTAATTATTTTCGCCGTGGAAAGCCTGCCAGCACGGTTAATGTCGATTCTTCAGTTGTTACCCCGGGGTTTAGTCATGGTAACAAAATCTGGATGCTTCCCAGCGCTGCGGCCGTTGATTCAGCGTATTCAGTGCGTCAGGTGACGCGTCGATAATGGTGAAATCGCAACCCGCGTACAGCGGTTCGCGGTGATGTTGTTTAGACTCCCGGTTTCTTGCTGTTGGCTTCCGGTCAGTGCCGGACTTCCAATCGGCTTTTCTGTTCGTTCATCCATTACCACCTTAACCGCCTTTGGCGTTGCAGCAAGCGTTTCAGACGTGCTGTTGGTTGCACTGCTGAGCTGCATGACCTCCCCTTTCTCGTTGTTGTGTCCGCATCCTCAAGCCGCGGGTAATGGTTCTTAGTTTGCCGAATTTGCACCGTATTGCCGCCGCCTTCTGCCGCACCTTTTTGCTCTGCACATTAGCTGATACCGCACTTCCCCGCAGCCTGTCTATAAGCTTCGTGGATGCCGTTGACGAGCCCGCCGCTGTTGCGTGCCCAGCGGCAGAGGCTCCGGCTTCGCTGCTGTTTCAGATGACCTGGCATTCGTCTCGGACGTTTTGCCGCCCTGGCAGAATTTTCTGCCGCCCGTTGCCGAGGAAGCTGCACGACCGGCACTTGATGATGCACGTTCGTTTCTGATGATTTGCTGCCTCTTTTGAGGCCACCGCATCTCGTGCTGAAGTGTGGCGGCCTGGATGGATTTCGTGGCCCGGTGGAGGCAGACGGTGCTTACGTGTTGTGACGGTGCAGCATTCGGTTTCTGACGATTTCGCGCACGGCACTGGTGGCCGCCCCGCGTTTGGATATGCGGACTGCGCGGCGGCTATTCGCTTCAGTGGCCTTTGCTGTGCCGCTTCTGCGCCGGAGGACGCTTCCTGAGCTGACGATGCAGCCTGTCCGGCGGGTCGGTGGGAACGCGCGTCGGTGGGCTTGAGTTGCATCAGTCACGGGGCCCCTAGAAGGCATAGTGGTGATGCAGCTCGCATCGCCGGCTGATTTCTTCGCGTCTGCCGTGACTGTGCCACCGACGCGTTACGCTCAGAGCGCTCTTCCACCATCAGTTCCGGCAGCGGCCATGAAACATCCTCGCGTCATGGCCACAGAGAAGCCATTCAGCGTCCCCGGTTGAATCTTCATACACGGTGATGGTCCCGGCGCGTCAGATACCCATGTAGGAAAACCGTCAACCTGCAGGGTACGTGACCCACATCCGGTATCACGACGCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCACCACCACCGTGGTGCTGGTCAGTTGGCTTTCAGCCTGAATGGTGCGTTGCTCTGTGGCTTTTCGCATGTGCCGTTACACGACTCCTGAAATCTTTACTGCCATATTCACCCCACAAAAGCCAAGCGGTTCCGGGCTGTCATAACACTGTGTTACCTGGCTAATCTAGAATTTATAACCGACCCCAACGATGAATCCGTCAGTACGCCAGTCGCCACTGCCGCCAGCCTTCAGCAGCAATATCAACAACGACGGACGCATGGATTAATCTGTATATACCTGCACTCTGACGCCCACTGAGGTATGCCGCATTGCATTTTCGTCCCTGGCAGTGTGGTCGTTCCTTTCATACCCGGGAGGATTTCCGTCTTACCGTAATCCATTGATGCGTAAGCGACTTAGCCACCACTCCAGCGCCGCTGGCGTACTAGACCTGCTTACTGATTTGTAAAACCGGTCCGGCCATCACTACACATAACGTCCCACGCAGGCTCTCATAAGTGAAACGTATCCTCCCCGGTCATCGTCACTCTTTTCGACGAAGCATCCAGGGAAGCCATCACCCCACACTGTCCGTCAGCTCATAACGGTATTCACGTTAGTAAGTTCGGACGACTCGGGGTATCCCGCCCGACAACGAATGTACCCGGTTTCACTTGAAGGTAGCCCACCGTAAACGTACCCTGTCCGTCGCACGGGCCGGACGTCACCGCAAGTGCGGCAAGAAAGAGCAACGGCAATACACATAGTACGCATCGTTCACCTCTCACTGTTTATAATAAAACGCCGTTCCCGGACGAACCTCTGTAACACAGCCAGACCGCTGATCGCCCGACGCCTGTTTCTTAATCACCGGATAAACCTGCCACATCGCTGGCAAACGTATGAGAATATCCCCGAATGCCGTGGACGTAAGCGTGAACGTCAGGATCACGTTTCCCCGACCGCTGGCAGTGTCAACAATACGAGAACACTGTACCCTCGTTCGCCATGAACAGCTAAATCACCGCACCGTTCATCAGTACTTTCAGATAACGATGAAATACGTTGTCCATGCCCTAGTAAATCTAGTCATTCACGAGCGTCACGGAAGGCACCACTATCTGGCGATCAAAGGATGGTCATCGGTCAAACCGTAGACAGGACCTGTATATGACGGCCAGTCCACTGCTTTCGCTGGCCGGAAAGCCAATAGCGCCCCGCCTTTACAAGCTTGACGATGTTCCCTCGTTTCCTCACATACCGTACCGTTATCGTACAGTTTGCCTCATCGTCACATTACTGAGCGTCCCCGGAGTTCGCATCACTGCCACTGGTATCCGCATTTAGCGGTCAGCTTTCCGTCCATGTTAAGGAAAGGCCGGGATGCCGCTTATGGGTAATACTGTGGGGGCCGATTTGAGCGCGGGTCGGAACACGTCGTTCATGAATATCTGGTTGCCCTGCGCCGAACATCGGCGTTTCATTCCCGTTTGCCGGGTCAATAGAATGCGATACGATTGGGCATGAATAGAGACCGTGCTTAACAGTTGACTGGCCGGTGAGACAATACCCGCGACATAATGTTTGCCGTCTTTGGTCTGCTCAATTTTGACAGCCACATGGCATTCCACTTATCACTGGCATCCTTCCACTCTTTCTGGAAACTCCTCCAGTTGCTGAGTTATCCTCCGTCAGCTCGACTTTTCCAGCAGCTCCTTGCCGAGATGGGGGATTCGGTTATCTTGCCTTTGGAAAAATCCAGGTAACCTTCCGCATCATCGCTCGCCCGACCGACGGCCTCCACGAATGCCGATTTGCCAACGTCACACTGCGGATATAAAGTAATAATCATGGCCGGCCATTTGATATTGATACTGGCGGCTATCCAGTACAGCGCCGTACCAAGATAACGCGTGCTGGTTTCAAACCTGTCTGATATCCGCAATCTGCTTTTCCAGAACAGAACTCAAACTGTACCGTCCGTATAAACGGCAGATGCGGCGTGTGTGAGGTCCTGAAAATAGCCCGGCGTCAGCTCAATCCTCGACGTGCTGCCGGTGCGGCAATCCGGAACCATCTAAGCCGGATGCTCTCCCTGCTGCCCGCGCATTTACCGCCGGACTGTCAGCCTGTAGTTCCCCGCATAGAGTTGCTGCGTGAAGCGGTATGTGGTTTCCGTCGTCCGGGCCGTGCTGACCAGCTCACTGCCGTCGTCCGTTAGCCGTCATAACGATAAGGAAACTCATTCACGGTCGGTGTCCCAACCGCGCCCATAAGCTCTTCGCCATGTCCAGTGGGTGCGGTCAATCATGCGCCACTCCATGAGTTAGCAAGGATTTCACGTGCCTATATGTTCACGTCAAAGTGCGCCCCCGTTATCCACGATGGCCTCTTTCCGGCACATGCTGCACGGCGGTGATGGCATACGTGCCGTCGTCGTTCTCACGGATACTCACGCAGCGGACAGTCAACAGTGGGCGCAGCGTCGGCAGCTTCATAACCATACGGTGCAGCATACGCGTCGGAGCCTAACATTTTACTTCACGTCGGTAGACGGGACCTCACGCTCCACGAACCGGATTGCCGCCACTTCCGTCAACCATTATCAGCGCAGTACTGGAGGATGAAAGATTTCACGGTGAGCGTGCGGCGTCCGTGGCTGTTCGCCCGCGCCAGCCCATTGATACCGGCATAGTCATCATCGCATAGATTTTCAATAACATCTCGTAACACCCTATTAATGGAACGCTGATCCTGGGGCCTCCTGCAGCTTGGTAAGCTTCAAAGTGCATGTTCGGGTTTCTTTCCTTACGACCCCTAACGGCAGGCTAAGTTACGTAGAGACAATATCA	*	tp:A:P	cm:i:170	s1:i:1381	s2:i:0	NM:i:2360	ms:i:3906	AS:i:3906	nn:i:0
+29	16	utg000001l	40813	60	5S6M2D9M3I1M1D5M1I4M2D18M1I3M1D12M2D3M2D16M4D2M1I6M1I25M1D2M2I4M1D15M1D3M2D11M2D3M1D2M1D2M1D12M1D10M1D13M1I2M1I12M3D10M1I3M1D3M1D7M1I5M2D2M1I2M1I3M3D30M2D14M2D3M2D5M8D1M2D6M2D13M1I4M1I1M2D3M2I7M1I4M2D11M1D15M2D10M3D6M1D7M1I10M2D6M1I6M2D6M1D9M2D4M2D2M1I21M4D23M2D11M2I10M3D37M1I1M2D13M1D3M1D18M3I5M6D8M4D5M1I12M1D4M1D9M2I3M1I5M3I2M1I14M1I8M3D3M1D4M2D3M2D1M2D3M1D1M1D7M1I5M2D16M2D3M1I10M1I10M2I8M1I3M1I6M1I3M1I11M1D5M1I7M3D8M1I25M1I3M1D2M5D5M5D6M2D12M2D5M1D3M1D41M1D25M1D5M1I4M10D7M3I18M1I3M1D1M1D5M1I1M2D3M3D13M1D6M1D2M1I7M3D12M1I3M5D6M4D13M1D8M3D15M1D12M3D10M1I11M1D11M3D5M2D2M1D16M1I1M1I1M1I4M2I1M1D31M2D10M2D5M1I13M1D6M1D9M1D23M3I23M3D11M1D2M1D10M1I3M1I64M5D2M3D6M1D5M1D7M1I13M3D4M1D3M1D1M1D39M1I1M2D6M1D7M5D7M1D1M2D12M1D2M3D14M5D4M1D3M2D8M5D6M2D4M1D10M2I15M1D7M2D26M1I37M2D3M1D10M4D1M2D7M4D15M2D17M2D3M2D13M4D19M6D2M1D10M3I38M2D2M1D8M1D22M1D12M2D18M2D4M1I3M1I2M2D3M1I9M2I6M2D3M2D6M1D3M2D1M1D8M1I4M1D9M1D15M1D3M1D6M2D7M1D14M7D7M1D4M2I16M1I2M2D8M2D8M1I15M1D9M1I1M2D9M7D12M3D14M3D10M3I2M1D2M3D7M4D7M2D1M1D14M1I12M2I6M2D3M1D26M4D6M1D3M2D5M1D6M1D7M1D1M4D8M1I16M2D25M1D7M1D15M1I1M1I1M1I8M2970S	*	0	0	GTGGCTTGAAGGAACGGAACAGGCCCGCGCCTTCATCGAATACGATGATATTGTCACAAGGCGTCGGCTCAGTGGGCTTCGATATCGTCGGTACGTAGGACTTGTCACGCTTGCTCCACTGTCTAGTGCCAAATGCGTGATGTTATATTCACTGCGGGCTATCACTGACAGGATCGAAGGCTTCACGGTCATGGTGTATTTGCCTTTAAGCACGGCAGAAACTTCTTCGCACTCGAGACCTAGTGGAGGACCGAGCTCGTCACGCATGTTCTGCATGATGATGCGACGGCGGTAAGCCGGCCGAGATTGCTTCATACGGCAGGCGACGAGATTGATGCGGGGATTCACTTCATGCTTCGTGAGTCGACATATCCGGCGTAAATTTCAGAGGGAGTGCCACGAGGAATTCATATTCGCCGGGCAACTAGTAGAACGTACAGCGGTTTATACCAGTCCGGAATTTGTGAGAGACCTTCCGTGGTGAAGGATAGCTCACGGAAAAATGCACGCAGAAACAGCGGATCAAACTTAAATTTCTGCTCATTTGCCGCGCCAGTTGGGCGGTTGTGAGATAGACATAAAAACCCCGATTTCAACAGGCGGCTTTAGGTGATGAAGGGTAACATAAACGATGGCCCGCATGGCAAACGCATGCGGGCGAGGCGAGCGCGTCTCGTTCGTCTGACTCATCAGAGCAACATCCATAACGGAACGTGCCAATGTAGAACGTCAGGCGTGGTGCTGGGGTCTGGTGCCTCAGCATCGCGCAAGAATGCCAACGGCAGAGACCGTCGGTGCCATCCCACGCAACCAGCTGCCGGCTGTAGAGTAAGAGCCATTGCAGGCTTCGCACTCACGGCCGGCGCGGTTGCGGGTATGAGCCGGGTCACTGTTGCCCTGCGGCTGTAATGGTAAAGGTTTCTTTGCTCGTCAACGCTCCTGTATTCGGGAGCAAATCGTTAACGGATCCAGTCATTCTCGTTTGCAGCCATGCTGCCCTGCTCTAGACGATCCGCAGTACTGCAGCGGCACTGGCTGAGGCGGGAAGCGGAGGCTTTCACGGTCATACCGGGGTTTCTGCCCACGCGTGCCTGTTCTTCGCGTCGTGAGCCTCCGATTTGGGCTTCCATAATGCGCTGCGTCTTCTGCTCCGCAACCGCTGCGGTGATCTGCGTTCAAGTGGCTGCGCCGCTGGCGTTCTCGCCCCGTCCCGGCACACGTCAATAACGTCAGCCTGTGAAGCAGTGGAGTATGAAACAGTTGTTGATTGAGTCTTCGTCATTCGCTCCTGAGAGACGGGATTTACCTAGATCCAGTGCATCACGCATCTCGGCTTCCGCATCGGTGCTGTTAACAAGTTCATGATAGGGTTCAATCAAGGCCTCCTTGACCGCTGTACTGCCTGGTTCAGCACAACGTATGCACGGACAGGCCGGTATATGCCGACGAGTCGGCGCAACATGAGATGCTACGGGACTGCAGTGGCCGGACGTCATCCATGGGGTCGATGCCACTTACGTGCCCCCGTAAATCAGCGTGATTTCCACATGTTCTCCAGCAGCACCGTAATTACTGTGAGCCATCCATGACGCCGATGGAGCCTGTCCGGGCACGCTTCGATTAGCACCGGGAAGAGGCAAGCGACCTGCACTGCAGTTCAGTCGTTGGCAAGCGGATCGCCTTTTAATCGACACGGGCGATGATGTCAGCAGAATGCCCCGCCACCATCCCGCCGGCGTGTCCATATCGAGCAGAATGCCGTCACCATCGGATCGCTGGCAGCCTGTTGCAGACGGCGATAATGCCGTTGGATCAATGTACCCCGTACGGCTGCAGCGTGGCGCAGCCTAGAGTGAAGCGCCCTAATGCAGCACGGCTCCTGCGTTCATGACTGATAACTGCGGGCGTCGTAGTCCGTCATAAGCCGGATAATGCCAGCGTCGGGCTGGGCCTCCTGGGCAGTCAGGCTGTCGCCGCACCGCATCCGTCAGGCTGCTGATCCCAAGCTGAGTGCAAGCGCAACCCGCGGATAGGGTTCAAGCATCAGGCTCATTAAAGGCCACCTGCGACTGCGGAGTCGCTGCCATGTCGTATAGTTCTCCTCCTGTGTTGAGTCCCGCAGCACGGATTCAAATGCTGCTGCCAGGCGGCTTTAAAGCGGCTGCACGGGATGGCTTCGACAGGACCTGCTGGGCAAATTTCCTGATAGTCGTCACCGCGTTTTGCCGTACTTCTCGTAGTAGTACTCAGTCCGGATGCGGAGCATTAAGAGACTTATCCCGAACTGCCTACAGCTCGGAGCTTGATGACCGATCCGATGCTGGCTTCATATGCATATCTCCAGCATTTGGGGTTCCCCGGCTCGAAACAGCCGGCGCTGAATAGAATGCAGGAGAATTCTAGAAAGGTCGCCTCGTCGCCTTACCAAATTCAAGTCAGAAACATGGCTCGTCGACGTGAGATGCTCAGACGAACCTGAGCGCCAGCTACAGCGTAATCGACTGCCTACCGCAAGCCCCGTCGTACTCGTCGATGTCGTGAGCATTCTAAAATGCTTTGGAGTAGGATAGAGACCATGCAGGGATGCAGTTAACCTAAGCAGTAGGATCGAAACCGGCCAGTCCCGAGCCACTCCTGATGTCGCAGGAGTCAGGGCACAGCTGCGTATCTTCAGCTTAAACTCTATGGGCGGATACGGCACTTCAGCTTGAGATGCTTCAGTGCGTCTTCGGGCCACTTACCCTTGCCCTAGCTTTGCTCCGAACGGCCGTGGAATAAATTCATCGTGAATGAACCGCGAGCGATAACCCTGGTGCATCCTGTCACATTTCTGCTGCATCGAGCCGCATCGCGTCTCGCATGGTAGGTCTAATAGCCTTGCCCACGGTTCAACATTCGGCCCTGCACCGGCGTCCAGGTCGGTTGTCCTAATTGCTCTTAATTCGGACTCTAATCCCTATGTGCAGGCCGGAGACGAACTGGTACCATAGAGGAGTCGCGGATGGTCCACAGTCTCGACGGATATTCCCGAATTCAACGGTCGCGTTTAATTCCTGCACCGTAAACGTACGGCTCTTCAGCTGCTTTAGACCCGGAGCCCGGGCGGTCAACCCCGATGGCCGGAGGCACCATTGAGAACTCTGCGGCCGGAAAAGCCGGACGAACATCGTGATGCTGAGTTGGCTGAACAGCCACGTTATTAAGCCCGTCGTCGGATGCCACACCTTCTGAGGCTGCATCATTCAACGGTGGGTTCGGCCCAACGTCAATCATGCGTCAACTAATGCAGTTCCGGCGAATCGCTGCCCGTCGGCTCCACGCGCGGTGGAACGGCTTTCCGCTGGCCCCTCTATCCTGCGTTCCCCGGATGCCAGATAGCTGAGTCTGGCGTCAGCATGCTTTTCGTACACAGAGATCTCAAAGTGATATACGCGTTTAGATCGTCTTCTGTATTGTCGACCCAGTTCTAGTCATCAGACTGCGTCCGCGGCGGCAAGTCTTCAATTCAGTTAAATCATGTGTAACAGGCTCGACCCGTACGTCTTGCCCGGTGTTGTATTCTTGGACCGGACTGCCTCTTCAAATCCGTCGCATGCCCCTATGATAAGACTTACGGGTGTAATGGAGTGCCAGCGGCTTCAGTGATCGACTTAGTTATTTATTCACAAAATCTTTTTATGCATCGCTTTCCTGGTGCTGTCAGCGGTCTAACATGCTGCGCCGTCGGCAAGAGGCATCCTTGGAAGCAACGGAAGCTTCATCATTCAGGTTGAAAGGTTAAAACCTGTATGTCGCGGTCGCTCCAGATTCATGCCATACCGTTTGTTCATTAGGTGATGCTCAGTCACCTTCACGTCGCTTTAACGCTTACGCGCAACCATTTCGGAACATGGTGGGTACTGTACCTAGGATAAGGCGAATAGGGCAACCTTCGGTTAGATTTCCGGCGGGCCTTTTACTTGATCTCCGCAAGGTCTCAGGCAGCACTGAGATCGTCTTCATCGTAGTGGCGGCCAGAAATATTCATTCGTGCTCACGTCGCTCTCAGTGCAGAATTAAAGCAGTCGAGCTGGGAATCCATCGGGCTTCCTGCCCGGGAGCAAGTAGAGATACTTATTTCCTGGTTCATCTGGATTCAGCGGTCTAAGTCAAGTTTTTCGCTCGTCTCGCTAATTAATCCAAAAGTTGAAAGTTTCCTTCGTTCGGGGTTACTTAGAAGTGAACCTGAATCTAAATGTCCAGATGTGATCCTGTCAGGACCGGGTAAATCTTCGCCGGAGCAGGTACGAATGCGGTAAGGTCAAAGGGAGTGGCTTCGGCCGATAGGGCATGCTGTGCAGGCCTGCCTGATGACGGATGCTGCGCGACCTGGAGATTAAACGAAGCGTTAGAGTGGCGAGCCAATAGGTTCTGTTAATCAAGCCTTATACCTCAGTGCATGAGACGGGATATGACATATGCGGCATACCCGCGCCTGTAGATGAGTGTCTGATGATAATCTACTTAAGCCATTTGTAGGTGAGACGATCCGCTTTACACGAGCTACTACTCCTCAGCTTCATACGGATTACCCACAGATCGTGTCGCATACTTCTATGTTTATCTATGGGAGCAGCGAGATAGATTACAACCCACTAAACCTAGCTGACATAATTTGCTCCTGGTATTTTGTAGCCTTCCCTACTAGCCCACCTTAAAACGTTATCTCGGTCAATTTTGCCTCCACCTACACTACTAGGCTAAAGGATACCATGATTACTCTCGTATTCTATTCGGTTTGGACTAGTCTATTCAGTCCCGACAATCTGATAGTAGAACGGGCTATCTACCATACCATAACCCCATTAGAAATTTACAGGGTATAGCTCAACGTGACTAAGTTAACTACAATATTACCTTAAGACTCCAGTTAACTCTATACACCCTTATTTTCTTAAGAATCTGATCAAAGTCCATGTTCGTAGGCGACTGGTCTAATACCTAGTCTGTAAGAGATAAACACGCTGGTATGTATCATCTATACTTATTGACTGTCTCTTGTGTCCTGTTAACACTAATACTAATGTGCCGGTTATCCCTCCTGGTTGCACTCTTTACTGTAACATTTAACGCATAAAACCTGTTATTCGCTTCGGTGGGACTATCCAATCGACGCTCCCTTCACATAGGGAGCATTATAATGTACGTGGACTACTACCAAAACCAATCAAATTTGACGCAAGTCG	*	tp:A:P	cm:i:35	s1:i:284	s2:i:0	NM:i:657	ms:i:1212	AS:i:1212	nn:i:0
+30	0	utg000001l	9015	60	166S12M1D1544M38I6M3D24M4D1M1I2M1I5M1I13M1D9M2I3M1D7M2I1M1D2M1I7M1D8M3D5M8D2M1D7M14D14M2I10M2I3M7D2M3D1M1D2M4D6M1D5M2I13M4D5M1I10M3I3M1I22M1D7M3D4M3D13M6D3M3D2M1D4M1I7M2D11M4I6M3I3M1I5M3D7M5D13M2I1M3I3M1I6M1D4M1I6M2I4M2D14M1I9M1I11M4I10M2D24M1I4M2I5M2I6M2I11M1D7M1I1M2I9M3I2M1D6M1D4M2D14M6I8M1I3M4I2M4I11M1I13M1D11M1D16M1D2M3I2M1D9M2D8M2D1M2D2M2D6M3I6M1D1M3I7M2I6M4D8M3D2M1I7M1I1M1I5M2I8M4I2M1D3M3I20M1I2M2D4M1I1M2D6M2I26M3I8M1D7M1I5M1D8M1D5M1D16M1I3M5I1M1D2M2I11M1D6M1D1M1D2M2I24M1D5M3D1M1D5M1I6M2D19M2I18M1I1M1I13M5I6M1D19M1D8M1D6M1I13M4D14M1D6M1I3M1I1M1I1M1I23M1I3M4D2M2D1M2D4M5D19M3I2M1I23M1D5M1I12M4D2M1D1M1D3M4D4M2I11M1I13M1I1M1I8M2D3M1I3M1I4M1I10M2I6M3D3M3I12M3D2M1D1M1D11M2D4M3I2M2D4M1D4M1I13M1I3M2I11M3D3M1D4M1D9M1I7M1I2M1I18M1D8M3D2M1D3M1I1M1I1M1I7M2I3M1D14M1I1M4I5M2D18M5D2M1I5M2D6M3I15M1I11M2D3M3D1M2D8M1D7M1I4M5I17M1I7M1I12M8I5M2D5M1D6M1D2M2I2M1D5M2I1M1D3M2I2M1I3M2D4M2I8M1I19M2I7M1D2M2D3M1D22M6I3M1I2M2I9M5I2M5I2M2I3M3D4M2D5M2D7M6I1M1I4M1D30M1I18M1D2M3D3M1D3M3D1M3D18M1I10M1D22M1D2M3D6M3D4M2D20M2I9M1D4M3D4M1I5M2D24M3I10M1D4M3I2M1I5M4D2M2D13M1I4M1D7M4D29M9I19M1D5M4D34M7D5M1D8M6D2M1D6M1D14M4D17M4D3M2D4M1D6M2I5M2D7M7D9M1I3M1I4M3D8M3D16M1I3M3I3M2I4M1I14M1I2M1D5M4D10M1I42M1I19M1D2M2D35M1D3M2I5M1D12M2D1M1I8M3D1M2D2M2D4M3D6M1I6M2D11M1D1M3D1M3D8M2I25M2D4M3I23M1D13M2D7M3D2M2I10M1I5M1D6M1D4M1D6M1D7M2D7M1I2M3D1M1I4M5D4M3D1M1I46M4D6M1I9M3D1M1D3M1D10M2I8M1I7M4D9M2I3M4D20M2D4M1D15M2D2M1I16M1I6M2D3M2D9M1I3M1I3M1I3M2D6M3D12M1D5M1D2M1D3M2D33M2I7M1D4M1I4M1I4M1I1M1I11M3I3M1D16M1I2M1I12M4D1M1D5M1D13M1I15M1D4M1D8M2D15M36D11M1D2M5I29M1I15M4D13M1I20M1D10M2D1M4D2M1D12M2D2M3D21M2D8M1I4M1D18M2I10M1D15M1I9M1I21M1I35M1D13M2I6M5D36M1D5M2D15M1I6M1D9M3D7M7D2M4D8M5D1M5D1M3D10M3D5M3D2M3D17M2D15M1D3M3D10M1D3M3D2M1D2M2I9M6D7M1D1M1D1M1D5M1I3M1I6M1D10M4D36M1D18M2I2M3D28M2I3M1D2M1I9M2D12M1I8M1D42M3D11M2D7M5I27M1I11M4I7M2D5M4D2M9D4M3D2M4D8M2I9M8D1M4D4M2D7M3D1M4D6M1D2M1D10M1I15M1D4M1I3M1D16M1D3M1D5M1I6M3D20M3D1M1D2M2D2M1D15M1I6M1D2M1I13M1D16M1D7M2I13M2D6M1D5M2D2M1D5M7D2M1D38M7D3M1D13M3D12M1I7M1I6M1I24M3D1M1D2M1D4M2D3M1I7M1D3M1D1M4D35M1D5M1D1M1D5M1I3M2D10M1D17M2I1M1I15M2I23M2I2M1I1M1I10M7D3M2D23M1D6M1I7M3D10M1D2M1D7M1I11M2D10M3D2M3D6M3D8M5D1M1D4M1I4M1D32M6D8M1I1M1I3M3D2M1I6M1I8M1D12M1D8M3D5M1I7M1D20M1D5M2D8M5D2M1D1M1D17M1I10M1D6M1I4M2D12M1D5M4D7M1I11M1D24M4D2M4D1M3D9M1D7M3D9M6D1M4D9M3D16M2D22M1I10M3D3M1D5M6D8M2D2M1D10M3D4M1D10M1D19M1I4M1I7M2D1M1D5M1I4M3D13M1D10M3I4M1D13M1D5M1D6M1D6M7D11M4I1M3I11M1I10M1D7M4D1M4D13M2D2M1D1M1D10M1D3M1D7M2I5M2I16M2D1M9D16M1D3M3I19M1D11M1D1M1D2M1D19M3D14M1I6M3D8M3I5M1D1M1D2M2D4M1D6M1D15M3D11M1D12M2I4M2D9M2D8M2D1M1D8M2D4M2D13M2D34M2D8M1D30M2D7M1D5M2D10M1D3M1D1M1D5M1D2M3I6M3I2M4D9M1D1M1D6M2D4M1I20M2D9M1D3M1I1M1I8M1D3M7D4M4D4M2D8M4D1M1D2M1D5M1D15M1D6M3I19M2D22M1D11M1I7M1D4M2D20M1I25M4D11M1D7M2I21M4D6M2D11M3D1M2D16M2D5M822S	*	0	0	CCAGTCCTTGTTCGCTTGGCCTAATTCACGTTAAATACGATGTCGCTGCGATGAATATGGAGTAATGGAAGCGCGTAATGCTTCTATAGCAGAGGATTTGTTCAGTAAGCGAGCGCGCGCTTCAATAGATTGCCGGCTCAGAAGTATACCGCACAGAAGCTTTGTCCTGGCATGCCCATAGAACAGCACACATGTCGCGTATGCGTCACGTTCACGCATCAGGCGATATCGTTTAGCCCACCCATACAAATTCGGTTCTCTTATCGCTCTGCGCTCGGTCTTCGCTGTCGGCTCCGCTCTGCGGCGGTCAGTCTTCCTGTTTACCATTGCTTACATCGATCCGAAGCATCCGTTCAACCTCCGACGGAAGGTCGTTTTCTGGCTCGTGCCGCATTCGCCAGAATTCCTTAACGGGAATAAATCTTTCTTTTCTTTGTAATAGTGTCTCGTTGTGTCCGCAATGGGAGAAGGCCGCAGGTTTGAACCGCGGTTTTATCCTCGTCGGGATTTTCAGCGTTTGAGGGATGCACCCATTCTGGCGCTTTTTATTTGGTTACGACCCTGCCGCCTTGCTGCTTGATAATATTCATTCTGACGAGTTCTAACTTGTAGTCATTGCCGTTTGACAGGTAACTTTGTAATCTCGCTACAGTTGAGAATCGGTGATTCGTCCATTGGTTTATTCCCAGCTGTCACAGTAGCAAGCAGCACTACTTCCTTAAACTGTCGCTTGGTCAGATCTGCCCGAATAAGCCTCTACCACCAGCATATTTACTCAGTCTGAGTAACCATCGAGATCTGCCACATTACTCCTGTCCAACAGGTCTCTATGCCGAAGTTGAGTATTTTGCTTATTTGTCATAAGCCGAGACTCGAAGCGGGAGGGAACTCCATTCTCCGGTTCCGGCCGCTTGCCCGGGCGTTGATTAGTGAGAATCGCAGCAAATGTCGCGCGCCAATCGAGCCATGTCGTCGTCACGTACCGCATTCAAGAACAGCAAGCAGCATTGAGAACTTTGGAATCCAGTCCCTCTTCCACCCTGCTCAATGCGACTTATCAACGCCACAGCTTCCTGTCTTCCCCGTTCCAAGCATGCGATTTGTTAAGCAACGCACTCTGGATTCGTAGAGCCTCGTTGCGTTGTTGCACGAACCATATGTAATATTTCCAAAATAACAATTGATTGAATCTTACAAATAAATGCAGCCCAGGCTTGGTTTAATTTGATGCCCTTTCAGGCTGGAATCATAGGGGTTATTTATGCTGTTGTTTTGTAGAAGCGAGCGTCCGCCTCCGCATAAACGCTTCCATCAGCGTTTATAGTCAAAAATCTTTCGGCCTGCATGAATGGCCTTGTTTAATCGCCATTTGATACGCCGAGATCTTTAGCTGTCTTGGTTTGCTCCGATATTCTCGTATTTCCGGATGCGTTGTTCAGACAATACTGCTCCTGCGTACCGCCAGGTAAATAGTCAACACGCACGGTGTTAGATATTTATCCTTGCGGTGGAGTTACTGACTTGAGCACAAAGAAACCATTAACAACAGAGCAGCTTAATCGCACGTCGCCTTAAAGCAATTTATGAAAGAAAAGTGAAGTGGGCTTATCCAGGAATCTTCGCGCCGAGGGAGCAGTTCTGCTTTATTTAATGGCATCAATGCAGTTAATCAAATTAGCCCGCATCTTGCTTACAAATTCTCAAAGTTAGCGTTGACGAATTTAGCCTTCAATCGCCAGAGAAACCTACGAGATGTATGAAGCGGTTATGCAGCCGTCATGTAGAAATGAACTCTGAACCTTTTCTCATGTTCAGCAGGATGTTCTCACTAAGCTTAGGACCTTTACCACTGATTGGAGATACCGCTCAACAGTGCATTCTGGCTTGAGTTGAAGGTAATTCGATACTACAACGCACCAAACATTTCATGACGAATGTTAATTCTCGTTGACCCTTGAGCAGGGCTGTTGAGCCAGGTGAGTATCGGAGAAGGAGATCCTTCAGAGACCTGGGTGAGGAGCGGTCAGGTGGTGTTTACATCCGCTCGATCTCCCGGGTATTCTCCATGCAAGGTCGAGAGTTGTTCCGTTGTGGAAAGTCATCAGTCAGTGGCCTGAAGGAGACGTTTGGCTGATCCGGCAAGGTGTTCTGGTCGAGCATAGCTGATAACAATTGAGCAAGAATCTTCATCACGAATTAGAGGAACCGTCATCAACCGCATCAAACATGAACCCGTTACCGATCAACCGACGAATGGTTTGAACCGAACCGACTGTACCGAAGCACTAAGGAAAATAAACGGAACCAAGCATCAATAAACCTGTTGTCTTCCTTAATTCTCTTACGGTGATAATCATGCATGTTCCAATGGGAGCGGAGCCAACCGAGAAGGAGGTGGAAATTTCTGGTCAGAACAAATGACAAGAGTCTGGTTCAGAAGATAAATCGCTCTAAAGCTTCAGTTGAATATTAAGAAGCCCTCGCAGATGACGAATCATTGGGATTCCCATCTTTGTTGTTGAAGGCGACACCCATTGTCCTGCCGAACTTTCGCTCCTCCATCCAGTCTCCTTCGCCGTGTTTAATCGGGAAGGAATGTCATTAAGCAGTGGAGAGCGCGTTCAGTAAGGATAGGTGGAGGGGAACTCACCAAAGACGATGTTATGCATATGCATTTCATCGAGACTGAACAACGGTGAAGGTAGAGACAAGCTACCTGTATTTGGCGATATTAAAGTCTTAGGGGCAACAGATATTGAAGGCAGCTTTGCTCATTACGACTCATGTCATTAAGCCACTGTCAGAAGGAGATGGGAAGGATGTATACCGTCACCTCAATTTTCAGACATTAGCCTTGGGCAAAGATGGACAGAAAGTATTTTAGCCATGATGGTGATACAAAAGGCCATCTCTCAGCGCCTCTGAACAAGGTCACCAATGCTGAGACGGGCAAGAGATGAGCATATTGGCCGCAAGAATGAAAGTATACTGGAATGTTTAGGCAAAGTGAAAGTTAAGGATTAATTACTATCAGGAGTAATTATGCGGAACAGAATCATGCCTGTGTTAGACCACGGTAATAATTCCTTACGTTATCGGCTTCGACTCCGCCTTTTCCCTCATTCCTGTGTTTCGTCGCATTTCAATAGAGATGGTCTTGGGGACATTGTCATGCAGGGAGAGTGGAAGCAATCCGTGATTGCTTCCGACTTCGGAAGCGAACGCGCCGACCGTGGCAGTATGGGTATATGACATCGGTAGTTATTGTCTCTTAGGTCCGTTATTTGAGCTTGAGCTTTGTTCCGTATTGCTGTCTGTTCCAGAGGGACGATAATATAAGCTCCCATCGCCATCACCCATTGCCTCTGCATCGTTCATTCATATGCATCCTTGTTTTCAGACTATAATTTACCATAAGAACACAAGAATAACCGGCCTCACCGTCCTGTCCCTCTAGAGTCGCCCCCAAAACACATAACCAATTGTATTTATTGGAAAATAAATAGATACAATCAGAAGCTAACTCACGCCTACCAAACAATGCCCCCTTAAAAATAATTCATAAACATACAAGACCATCCGGTAATTATCTGGCGGTGTTATCCTATCACAACCATGATGGGCCATCAAGGACGCACTGACCACCATGAAGGTACTAACCCACTTCCATCGCTATCGCGCGACGCAGCATTCAAACGAGCGTTGGGGGTGTGATACGAAACGAAGCATTGGCCGTAAGTGCGATTCCGGATTAGCTGCCAATGTGCGTAGGGGGTTTTCGTTCAGGACTACAACTGCCACATAAGGACGACTGACGGAGAATGCCGTAAGCCGCCCGCGAACGTCGCGCAGAGAAGCTAGCACGATAATGGAAAGGGAAGGCAATCCGGCGAGAAGGGGCACCAGTTAACCGCCTATTCTCTCTAGCATTGAATGAGCGCAAACCGAAATCACGAGTAGAAAGCGCACTAAATCCGATAGTAGTCAGGGTGCTGGCTGAATACCACAAACAGATTGAAAGCAACCTGCAACGTATTGAGCAAGAATCAGCGCACATAGATCAGCAAGCCTGGCAACGGGCGGCATAACATGCAGTACCTCAGAAATTGAATAGAAAATGCCATTCCGTATCTAGGTCGGTGGCCTTAGGGCTTTATCTCAATATTATATGGATCTATAGCCCAGCGACTAATTCAGTCCCAGTAATATCCTCAATAGAAGCCTCCTTCCTTTCCCTTCCCATCGGAAAATTCTTTCTACTAATAAGCTCAATCAGAAGCTAAGGGAGCTTTTGATGTAACCACATACTTCCTGCCTTCAATCAAATCAGCCCGCCCCTGGCCGTGATATTTAGGTTTGAATTACCTTAATCGCACTTTATCGTTTGCATCTTGTAATGCGTTTTCTTAGCTTAAATCGCTTATATCCCGCTGGCAAGCCTGATAATCGATGCACGCTTAGTCTAGAAAATGCAGAGCAAAGCACGAACATGCCACATGAGGAAGCCGATCCATTAACATATTCAGGCCAGTTATCTGGCTTAAAGCAGAAGTCCAACCAGATAACGATCTACTCTCCATATTTAAACTCCCCGAGAATGTCATTACCTGGAACACTCGTCCGATAGCAGTGAGTCGATTTCCTCTACTCGTAGGTATGTAGGATTGTAACTTTATCCGATTTCTAGTTAAAAGAAGATACTACACAATCTTTACTACCGCAATCCACCGTGTTAAGGTGATATATGAAGAAAGAATTTGAAAGAGTTCGAAGAGCATCCTCAGGATGTGAGTACAGATCTATCCGTGACGCCTCTGCTCTAGATCGCTTCTTGATAGATTCAGCGATGCAATGGATGCAATAGCTGCAATCGAATGCATGGTTAAGCCTGAAGAAGCCTGTTTCCTGTAATGGAAGATGGGGAAATATGTCGATAAATGGGCAATACGAACGACGCAATGATTGCCAAGGCGTACAAACAGAACAACAAAGCTGCCTGATAGTGGCCTTTATTTTGGCATAAATAACAGAACTAAACATGCACTGTGTGATTCCGAACGATGGAGGCTGAAGAAGAAGACGTGATTGGAAATCTTCTTTGCTCGATTACAAAGGCGATTCTGTACCGACTGAGTGGCTCGACCGGCCTTGAATCTCGACTCCGAGTAGCATGATAGAAATTGAAATCGACCATGACTTAATGACAGAGGAAAAACGTGCCAGATTAATAATTTCTGGTCAGACTCTGAATACCGACTCAATAAACTCTAGGCCTGGTATTAAATGCTGTATTAATCGATGCTGGCTAACATGCTCTGCTTAGCAATTTCAAGCGACTTAAATGCATATGTTGTGTGAGTTCGACTCCTTCGGAATGGGCTGCAGTGATGTCGGTTCGAACCGGCCGTATCGCGGGGCTCCGGGATCGGAATCGCGCTCCATCGCAGGAACTAGAAGAATATCGCCCCGCTCGATTAAGTTTTACCGCATACAGACTACGCTTCAACTAAGCCCGTTTCGTCCTTATAATAAGGGAGCACCATGCAATATGCCATTGCATGAGTGTTCGCTGCCTTCCGCGATCTTTACCTTGAACGAATCACCGTAAATTACGTGACGATGGAAACCGCCTTATCGACATACTTAATTACACGGAGTTAGATGGATCAAACACTTATGGCTATCCAGACTAAATTCACACTTTATTGGCGATGGAACTTTCGTGAGAGCCGTCGGACGGTGTCAAAATGGATATTAATACTGAAACTGAGATCAAGCAAAGGATCATCCCTTTCCTGTTTCCTAATCAGCCCGGCATTTCGCGGAGAGTGGCAGGAGAATTCAGGAGTTCAGCCACGACCGGTGGTCTAATTCAGGATCGTCTTGTGAGGCTCAGAGCCTGGCGCGTCGTAGACGAGCAGCTCCCGTGAAGAGAAAGAGGCAGAACTGGCAGACGACATGGAAAGGCCTGCCCCAGCACCTGTTCGATCGCACTTCCGCTCCGTTGCGCTCCCCTCAATCGATCGCGTTGCGTTGCTCCTCGCCCGCTTGTTGAGTTTCAGGAGCGCATGGCAGAAACACAATCGGTACATGGTTGAACCATTGCTCATACCAGGTTAGTACTTTACGCCAGGTATAAAACGAATGAGTACTGCACCGCAACGGTGGAAGCTGGCTGAACGTCGCATGGATTCGTCTACTCCACAGGAACTGATCACGCGATGGCCAGAAGGCATTTAAAGTGATGCCAGCGATGCGCAGTTCACGAATCGTTTACATCAGTACCTTAATCCTGAAAGAAATTACGCCTTTCCTGATAAGCAGAATGGCATCGTTCCGGTGGGCGTTGATGAGTCCGAATAATGAAATACAGTTTGATGGCATGATTTTGAGCAGGTAAATGAATCCTGTACGGTGCGCCCACTTTACCTCGAAGGGTAATCGTATAGAATGCGTTACCCCGGAATCATCCAACCAATGCGCCGGATGGCTTCAAACGAAGGCAGAGGAGAAGGGAATGGGGCCGTGGCAGTCGCATCCAAACGATGTTACGTCATAACCTACTCAGAGTGCAGCTGGAATGGGGGATCCGTGCTGGTATCGCTATCGCCGCTCCCTCCATCGCGATGCGACTCCTGCATACACTGCAGAACGTCAGCCGACCGACATCACTCCGGTTAACGATGAAACCATGCAGGGAGATCACTCTGCTGGTGATCGCTGGATAAACATGGATGACGACTTATTGCCGCTCTGTTCCCAGATATTTCGTGCCGCGACATTCGTGCATCGTCCATGACAGACGAAACGAACCCAACTTGGATTCCTGAAACAGAAAGCCGCAGAGCAGAAGGGCAGCAGGTGACACCGGACATTATCCTGCAGCGTACCGATGGCTTGGAGCTGTCGAACAGGAGTGCGTGAGGGACAAATCCCTATCGGCGTCATCACGCCATTCAGAAGTTCACAACGTGATAGCAAAACCCCGCTCGAGGAAAGAAGGGCGGAAGGTACTTCCACATCCTTGCTTGGGTTTGCACCCCTTGGCTCCGGGGAAGTTAACGCTAAAGCATGGCCTGGGGAAAACAGTACGCGAACGACGCCAGAACCCTGTTGAATTCACTTCCGGCGTGAATGTTTACTGAATCCCCGATCATCTATCGAATAGAAAGTATGCGTACCGCGCCTGCTCTCCCGATGGTTGATGAATCGCAACGGCTTTAAATGAAATGCGCGTTCCTCCGCTTCGGCGTCGCCTCGACATTATTGGTTTTCGAGAGGCCATAAAGTCATTAGTAAGTAGCCAGGTGCAGTACAGCATGTGGGTATACGCGATAAACGCTGGTATTTGCCAACTATACAGTGGGCTCAGTGCAAGGCATTATGCAGTAGGCGGCTAAGAGAGGAGGAAACGGAGCAGTGTTGACGATCGTGCCGAGTCATTAACGAAGGTAGACAGGCAAAACGGGCGGTTAGTTTGTATTTTGGGGAGCCAATGGCGATACGATCTAATAATATCAGCCCCGGGTGGTACCACCTTTCGTCTATCTAGTTATTCAAAACTATAGAGGCTGGGTCCAGACCTTCTTTATCCGCAGAGTTACGGCGGACACGGAGCAAATAATAGTGAGGAGAGATAAATAAGAAATAGTAGAGGTATGCACACCATCTTCTTTGAGTTGATAGAACCAGATATCGATGGCTAATAGTGTAGTAAAATTGGAATGCCTGTTACATCTATGAGAGCAGAGTAGAAACAAAGAAGTTCGACTCGTCCTCGCGGGTACACGTCGAGAAGAAACCAGGAGAGAGAAGAGAATAAGATGAGAAGTTAGTAATAGAATCGTGGCATTTTCTTTAAGACGGGCTTTCATATTCTGTGTGGTCGGTGCCAACATGTAACACGTTTACATCACCTACAGGAAAGCCCTTCTGACCCAGCATGTGCCGTCAGGTAAGGGCACCAACTAAGAAGGAAGAAGTTCCCTAAGATAAAAACGTCAGTGACATTTGCCGTAGATTATATCGAAGCACCCAAACGGTAAAATATCCCATTCATAAAGTT	*	tp:A:P	cm:i:345	s1:i:2153	s2:i:0	NM:i:1987	ms:i:4308	AS:i:4342	nn:i:0
+31	4	*	0	0	*	*	0	0	AGGGTCGTTCTAATCTGTTAGATGACCAGATCTTAAGGATAGAGACTGTGGGTATTGCTGGCTAAGGGTGTAGATAGTTTGTAGGGCTGGGCGTCAGGCAGTCCCACCGTGCAACAGATGGTATGAGTGGAAATTTAACGCGGTTATTGAAGGACCGGTAAATAGAGCGGCCCATAGGCGTATCTGTACTGTGTGTTTAGTTCGCATTGACTTTTACCAAAGAGCCAGCGTACGTGGGGATTGTACCGGTAGCGGTAGCTAGAGGTTACTGTCGGTGCCACAATCAGATAAGCATAAGGGTAAGAAGGGTCGCAGGCCGTTGGCCAAGACAGAATATGTATGAACCACGACGAGCACGAACGCGTAGAATAAGTCCGTAGCCCTGAATTTACTCCACATGACCTAAGGGGTCGCATCCGGTTGAAGCCCAATACATTGTATCGTTTGGCCGGCGTGACCTGAAGACGGCCTGGAATCGAACCGGTACTGTATGCGTCCGTACTGGTGGCCCAATCGTGTGTATGGTACAGAGCCCCGTGCGGGCGGTAATGAACTACAACGGAATTAAAGGTGACGTCGTCCCCGGTAGGGGTAGAGTCCTAATCGTTCTTTCGCGGGACAGACTGAATCGTTGACTTGTGACGAGCTGTAGGCTGGTAAAGGCCAATGTAAAGGGAGCTTTAGATGTCATTATGTGGTAGGTAGCTACTATTTTGACTTTCCGACGATTTATAAGCGCAGTAACAATGAACTGAAGAGCACTGGATATAGGCATTAGGCTTCGGTAAAGTACTGGAATAAGCTGGCGTACGTCGGATTGTTGACTGAAAGCGGGCCCGTTAAGCGGGTAAGGCGTGACATAGATGTACCCATTCAGGGGCTTTTGACGACCGTAAAGTAAAGAGTCCACTAAGATTACGTCCTACGTGCACCGTCGTCTACACACGCGGCCATGGGTATTTAAAGTTAGATAGTCTGTTGAACGGCCGTGATAGCCCCGATTTGTATCGTGGGAATTGGTCAACGAACAGGATTAAGGATTAGAGGATATCCCGCTCTAGATCGATTTAAGGGACCTGCCCCATTAGTCCTACGGCCGTGACGATTTACGCGGAACGCCAGGCTGACTATTTTTACAACATCACTTACGATTGGTACGAGTGGGTAGCCGTACCGTGGCTTTTAGCGTTAGATTGAGTAACAGATGATAACCAGGCCACGTGCACCATCACAAAGCCTGCCGTAGCTCGTTACGTCCAAGACAAATTAAAATTAGGCATTTCGAGTACAAATTAAGGTCAAACCCATGAAACAGACAGAAAAGTTTTATGACTAAGGGGTAGATGTCGCTTATTTCGTAGGGCTTACACGACAGGGGCGGACTTTGCCCTGTGAACGATCGGCCGGCGTATTCGATGGTCCTAAAGAACTGAGCAGAAAGCAGGTGATGTGACTGTTCGAGGCCGAATTGGTGTAGCCCGGTACTTAATGGGCCAGCCGGCCAACTATGCGATCAGATATTTGGGTGTGACTTTACCATCAAGAGTCCACCGTCCACTGGTGTCCCCTGAATCGGACGTCCACAATCGCGTAATGTCCGCGAGGTTTCGATGATACCGTAATACGGATGGGCTCACTTCTAAACGTGATAATCGGGTATGTAACCGTATAACCAGCACCATCTTGAGGTGCTTCGACAAGCGGTGGGGTGGTCCTTTTTGGTCCTGGCCCATTTATGAAACCACGCGGATTTACTGACATGAGTCGAATGACAGTATCGGACGGGTCGATAAAACGAGAGTTAGAAGGACAAATGGATAGCCACGAACACACTCCGTACCGGCATCTAAGCCATCCTTCCGCCGGCTTGCACGATTTAGCCGGCAATCCACCTGCGGCTGAACGGGCTAAACCATCGGAATGGCACTTCCGGGGTAGACTTGGCAGTTAAAATGCGTCATGAGGGTCCGTGTATCGAGCCGATTGTGCCGGGGACTATCTATCATGACCGTTGAACGTTCACCGATCGCCCGGCCGCGTCGAGGTGTAAAGTTCGGAGAGATGTTACACCTCGGTTACGATGAGTCGTGTAGCGCAGCCAGTGCTAAGTTCGAAGGCTCGGAGCATTACTCGGTTGGGCCCGGCTGAACCGTTCTCGTCGGATCATGGTGCTCGTGGTTAGCGTAACTCCAAAGCCAGACCCCATGAGACAGACAACCGTACGGTAAGAACACCTTTCTACGGACAGGTGTTGCCCAAGCATGTTCTGCACCGTTCTGTCGGGGTAATGCTTACGCTTTTATAAGAATGATACGCCCGGGCACGGTATGTCCGTTGTGTATCCGTCCTGGTAAAGGTGTTCTGTGACGCCGGGCGTGCTTTATAGAATGGGGTAACTGAAGAGGGTACCGTAAGAAGCCGAAGGGACCGACAATCTACGATTTATAGCTTGGATGAGGCTAAAGCCGATCTAAATCGATCTGGTGCGAGGATTATCTATGAACCCGTCTTAACCCTAGACACCAAATATCCCAATGGCGTCTCCGGTTTCGCGTACTGTATACGCAGCCGCTTTACGTACCCCGGTGGGTAAATCCTGTACGCCGGACCCACAGGACTACGATACCCACCAGTCCGGCTTTAAACAGGACCGTCTTAGTCTAGATCGTGGCAACATAGTGACCGCGGCTAGAAGTACCGGTAATTGAATTAGGGTAACTGTCAGACCGAACCGGTCTGGCACGAAAAGACAAGAGTACCAAAACAGGCCATTACTGTAGCGTATGGTAATTACCACCGTCCTGGCGTAAGCCCGTACCGACGCCCGCATGAAGACACATAAGACAAAACGTCTGCTAGCTACAATCGAAGTCCGAGCGAACGTTAGATTCGAACTCACGACGCGTTCGGGCAGGGGTGACGCCACTTACCATACTGGCCGTAAGGTCTGCCGGCTTACGTCAGGGTACGTAGACCTAAGACTACAACAGGCGGGGTCTGGACCGGACGTCCTAACCGGTAATAAAAGACAGGGATGGGTGTCTGTGTAGCTGTGGACCCATCGATCTAACGCGGAATCTTCGCACTTATGGATAAATCTTGCTTAGGATTACAACCGATTGCGTTGACAGAGTAATGACGTGTAGGGACCGGAGCCTAATGGGTCGGTACCCGACATCCATTGATGTCCGCCATTTTATCTATGGAGAATGGTCCGGCCGACGTGACCGGGCACGCGGCGTCGTGCACCGACGACCGTCGGATAAGATCCTACTAGAATGATGATGGGTTAGCGATGAGCGTCCAGCGGTCTAGACAGGCCGACGCCGACGGCCGTTGCTGTAGGTGAATGGGATACGACAACGAGCTCTAACGGACACCATTGTTAGATACGATAGATTGCAGGGTACGTCTACTGTTTGAAGACTGCTTGGGTCGCACCCGGCCACGAACACGATGTGATATTGAGGCCGAACAGACCTGGAACGACGCCGAGGGTATAATTATGCTTTGCACCGGTGGGCTAGACGTGGGGTCGATCGATGTGAATGGTAACTGGTCCGGTGTAGGGTTGACGTTATGACATGCTGACCTGACGAACTGACGCGAATACTACTCCTCGGAAGGGGCCACTCGGTGAACCTAAATCCACTCTACAGTCTAGTAGTTACCTAATGACCGTGGGCAGTCAAACCGTCAGTTCGATCCCCGGACGGGTGCTGAATAACATGTTCGTAAGTCGGCACTTAAGCACCCTGATCACGCCCTGGCTGGGGAGAACCACGACGTTTAAACCGTATGGCCATTAAAGGACGGTACATCTAAAAGTCAGCTGTGCACGCGAGCCAATTGACCGTAAAGTTGAATGGGAGAAGCGTAATCCCGCCTTTGTCACTAGAACCACCACAGTACGATTAAAGGGGAAGGGGCGCGGCCGTAAACTGACAGATGTATTAAGCGTGGGTCGGGCGCGTCGACGTGACAGGCACGTAAGCGTACATGGTCGGATACCAGAATGACTCCACGACGCGGAACAAGTCACGCTGACTAAACGCAACGGCCGTGCGTCAAACTAATTACGAAGTTCGGGTAAAGGGTAGCGTTCGCGTACACCGGGCCACCCGTCGATACTGGTACCCCGTAAGCTGGTTCGACGACTACCGGGAGCTAAAATCCAAGGCGTTACCCAGCCGTGGCGTTGACTTTAACGTCCAACAGAGGGCTGGTCCCTAAATACCAGCCGATTGTAAATAAAAGAATTTATCGTCACGCTGATCACCACAGTCCGAGCCATAGAATCCGGGTATTATTAGTTATGGTACCCATTGACACCGTGTAAGCATTGGTTACAGCCGTCGGTCGGGCTTATCTAATATCGAGCGGATTGACGACGTCAGGGCAGCGATTAGAAAGGCCAATAACGTATAGAATCAATACACGGGGCTAGTGGAAAGAGGATTTTACGAGTAAGTGGATGAATGAGTTGGGTGCCAAATCGGCCCAACAAAGACGTCAAAATGTTAGGGTCCTTACCTGAGACTAGAAGCGAATAAACGCCCATTTCTGGTCCGCCAATGGATCTACCGTTGACCGTAAACGGGGGACTAGACGATGTTTTACGGGCAGCAGGTGCGCGACAGTTGAGGTATGACGAATCCCGGCTCGTAAAACCTGAGCCAGTAATTTTAAACCCCGGCCGGAAACTCACGGAGAATAATGAATGAATTACTGCCAAATAGGAGTAAGGGCGTAACTTAGGACCTGGACGTTAATGGCAGCCGTGACACTCTAAAGCCAAACGTACTAGTGTAAAAAGGCTCCAACATGGTTTAAGGCCCCACGACAGATCGAATTATCGATCCGTGATGGGATCCGTACCGTGACCGGGTGCTGACGTTGTACCGAGTATATGTGGTCTAATTTAAAGTAAGGATTAGTCATAGTAAGGCACGTATTGATGTGTTTGACACGGTTGACGCGTGAGTCTTTATTAGCTCTTATGGCTGAGGACCGTCTAAGTGTCCCGGTTCGGAGTGAACCCACCACTTGCCTGGGGAAAGCGTATCTGACGTCCGCATGCGTGCCGCAACCGTCACTCCATATTTCAGCCATTGGCCGTTGGATGTCAGGTTATGTGAGAACAGGCCTGGTAAGGTTAGGTGTGTCCCGAGGTCCACCGTTGACGCGGGGGTCAAAACAGTAGTTAGTGAACTACCTACTGATCTAATTTTATTGTGCCGACTTAAAGATCGATCGCTGAATACCGTCAGCACTTAATCGTTGACCGCGGTCCTTTGAGTGAACGCGTAAATTACGTGCGTCGTCAGCGGTCGTACTGAGTACGTACCGTACCGGTCTCTGAATGAACATTGGCTGGTCCCTGGGTTTACGATTACAGAACAGGGGTTGACTCGGCGGGTTTCAAGCTATCGTGGGTTCTCTTAACGGGTGGCCGGCCGTTGACCGATGAAGTAAGATCCATTCCTGCGCATCACATCACCGTGCTTGTGTGTTACAGTCCGATGCCATTACACATCGGATAGAATACCGGATCTAAAGCCCCGGGTCGAACCGGGTACCACGATTGGCTTACGATCAAGTGAGAAGCTTGGTCAGGTAAGTCCGTGATTCTTATTACCCTCGTGGGTATGTAAAGATTGAAGCGTTTAGTACGTTGCGTACTGTACGAGCCCATTTGGCCTCGCCCCGGTAACTGATGAGTTGTAAACAAGTGACAGGTCGCATTACCGACGCGCGAGCGTCAGGTACTGACAGTTTGAGGCCTGACACGGAAGAGGGAAGGGTACAGGAATCGCAGTCTGACCAGAATGAATAAGCGGGCGTGAATAGTGTAGGTACCCGGTCGAACCGGCGTACTGATGATCTACGTTTCCGCAGGGTACGGTAGCCCCATTGGATTACCGGACATAACTGTTGACGTTAATTAAAACCGGGGTACGAACCGGGAGGACTTATGATCACTTTATGGTCCGAGCCTTAACGCGTCCGTGGCGAGTCGAGGACGAGCCCGCGAAACAGAGGACGACGGAACCATCCTAATTCATTAAGTACCCCAGTCGATGCCCTGTGTATCATGACGTACCATAACTACCGCACATACGAGCCGGACAGCGTCTAAGCTGAGTAGGTTGGGCCCGGAGATTAAGCCAGTAAAGGCACTGAAGGCACGAGCTAAGGCCGATCTACAAACGGCCGATGCCCCGCGGTAAAACTATAGAACGAATTTGTCAAGTTGTCAAACAAGAGATCCAAGGATGGTGCTAACCGGGATGAAGGGTCTACTCACCGAACCCGGGTACGGCTAGCGTAAAGAGGTAGTACCAAAGAGAAACGAAGCAGAGAGATGAGCAGCGAGCGACCTCCGTAAATTCGTCGATTAAAAAGGGCCCATTGGTAAAACGAGCGTACGAAGCCGATGGAAGTCACTGACGCTACAGCGCCTCGACTTAGAATGAAAGGGCGGCGGGCTCGTACGTAAGCATACGAAGGACCCACCGTCGGGATGCGTCGAGCAGCATTGGGCATAAAGCTTAGATACGGTGAGATCGTAAAAGTCCAAAACGACGTCAGATATTGCCTGCTGTGGCTTAGGACACAAAGGAAGGGGACGTCATAACCACGATGCTGAACGAGCGCTAATTCCACCTTACCAGGCTTTTGAACTTAAACCCGACCGAACAAAACGATTAAGTAAACAGCCCACGCACGCGAACGCCAACAGAACGAGGGAACACCAGATCGACACCGGATTCTACGATTGCCATATGTTGTATCGACGAATCCGTAAATACGACTACTGACGAGCTCGGGACTGTACCATTTACCACAGATGTAACGCCTTAAACACGCAGCAGAAATCGGTGACATCGAACGTCTAAGGGGGCCTGCCCGGTCTAAATAAAGCTCCTCTATGACTTACGATCCCACGCTGATCTGACCGCACGATCCGTTGCCGTATTTCTCAATCGTCTAATCATGACCTCGATCTAGAATTAGTGGGTTCAGATTAGCGTCCGATCGGGAGGGAGGCGGAAGGAACTTAAGGTGACGCATTTTAGGACAAACCTACCCAAAATGTATCTTTACCATCCGCTCGTGTTAGTATCGAAGCACAACCAAGGGCCGAAAGCAGGGGCGGTCCTTGATGTCCACGACGAGCCGGCCGTACGGCCGCATTTAAGTCATCCGTGCACCGGTTTGGCGCTCACGAATAATTGGTTTCTTGCCATCGCACGAAACAGTTTTAGATTACGAATAAAGGCACGACACCGCGGCTCATCTACAGAATGCCGTTTGAAAGCTCTAATGTCGGACAGCGCTTAAGCATCTTTACATGACAGTTCTGTATACGTACCATTGACATAAAGAGACGAAGTGGGCACAGGATTTGACGAAATTTACGAGGCCGAAAACCGTACCGGGTACAGGCCCGATTAACAGATTTAAAGTCCGGTGCTCTTAGTTGAACCGGGTACTTATCTGTCACCCATCGCGTTGTATCGGTCGCTTACCATTGGTCGATGTGGTCCAATTAGCACCATACGCGTTAACGGTACGTAACACCTAAACAGGGTTAGAATTAGTCGTCTGATAATCGTACATAGACCGTCGAACAATGGACAGTAAAGGGGTTACCCTTGATGACTAAGGACTAGCGTGACTTAGATGGATATTCTGAGCTACCGTTTCTTAACCTACGATTACGATATCCCCGACTGTCGCGGAAATGGTTGTGTATTTCTAAGCTGACCACCACTGGGTAACGTGGGGGCTGAACTAGCCCCGTGACCGTGGTCGAACGGCCGTTGATTGGTTCGGCCGTTCGTTACAACAGATTGACGACATTTACCCCTAATGAGGGGGATGAATAAAACTTAGAGCCACCAGGGTTAGGAACAAATGCCGGCCGCAGGAGAGCTATCGATGTAGCCGATGATAGATTACCACTGTGAAAGTGAATGACAAGTGACAGAAACGCTTTGGGTAAAGCAATGGATTTACTCGTGTCTGACTAGCCAACTATCGTATGTTGGATGTCTGAGCTTAATTTTGTGTATCCCCGAACCTATTTGACGACGGTTCCTTTGAGTTGTTGTAATCTTAGGTAGTATCGTTGGTTTAGTATCTTGAGAGAAGACTGGATTTATGACCATTGTGCTTGTTTTAGTAAGAAGGTCAGAAGCGGGTAACGACGACTACTTTCGTGCTGTTCTAGTCTCGTCTGTTCTAAAGTCGGTTCTTGGGTTTTGACGTTGCCGACATCGCTTTTATTTGATCAAGTCCATTAAAGGTTCTACTTAAGTGTATGTAAGTTCTGAGCCTGGTTGGTTTGCTGGCCTATGGTACCAAAGCATATAAGGGTGAGCGGAGTCTTTGACTTTAATACGCCAACTATTTGGCTGTATCTTACAACTTTGCCGGCCTTAAAGTTTACGCCGAATGTAAATGTTCTATGTACTGTAACCGTTGTAATTCCGATCGTTTAGGTAACCGTCTAATGCTGAAGGTCGTCCCTGACTGTTGATACCATTTTTAGACTTTACTTGAGTACTTTTGGTTTATATCCGTATAGACCCATTATCTAGTACTTGCTTTACGATTGTAATATGCTGAGATAAGAGTCGACTGTTAGGGATACCCGAGCTGCCCGCGTATGTTCTTTACAGAGTACATGAGTCACATTTAAGGTACACCGGCTATCACCTTAAGTT	*
+32	16	utg000001l	20505	60	98S19M3D8M1D1M2I4M1I6M1I6M5I5M3D7M2D2M2D1M1I6M3I12M1I3M5I25M1D1M2D6M3D7M1D4M2I1M1D8M3I3M1I13M5I7M1I11M1I6M2I41M3I7M1D5M1D16M4I6M2I13M1I4M1I10M1D10M1I2M1I5M3I27M3I6M2I6M1D12M1D3M2I2M2D7M1I1M2D2M4I4M2I8M2D7M1D3M2I2M1D15M4D17M1I12M1I43M2I9M2I46M1D15M1D29M2I19M1D9M1I2M3I2M1I2M1D6M6I4M3D24M4D6M1D22M2I53M1D4M1D36M1D5M1D1M2I12M1I2M1D22M1D11M1D2M1D21M1D3M1D13M2D6M1D22M1I15M1I26M1I14M2D21M1D18M1D20M1I13M3I2M1I5M4I2M4I17M1D1M3D7M1D22M1D17M1I13M1D4M1I4M2I11M2I9M1D24M1D6M3D4M2D7M1I9M2D3M1I8M3D4M1D10M1I1M2D1M2D8M1D19M2D4M1D4M1D4M1I2M1I12M1D30M3I20M1I20M3I1M1D19M2I19M1I11M2D9M1D7M1D2M2D1M1I11M1D9M1I3M2I4M5I12M2I2M1D4M1I6M3D2M1I11M2D10M3I3M3D17M2I3M1D17M3D17M2I8M1I9M2I4M2D3M2D6M1D9M1D20M1D7M4I1M2D5M4I7M1I18M2I16M5I6M2D27M1I12M1D4M1D17M2D10M3D24M1D3M1D2M2D2M2I11M1I3M1D11M1D1M2D6M18D2M4D5M1D59M1I8M5I5M1I4M4I4M4I2M6I5M3I2M1I3M2D8M2D31M1D9M3D5M3D24M1I23M1D7M1I7M1I14M1I12M2D6M3D1M1D13M1D8M1I30M1I10M1I4M2D7M4I8M1I10M1D18M1D2M1D15M1D1M1D4M2I11M2D2M1D1M1D29M2D4M1D8M10I6M2I3M1I6M2I7M2I5M1D4M4I7M2I10M2I5M1I9M1I5M10I1M1I9M2D13M2I8M1I20M3I3M3I3M3I7M2I57M5I3M1I2M1I3M2I16M1I13M6I1M1I3M2I8M5I6M1I4M4I1M1I29M7I14M2I5M7I7M1D8M2I14M1I9M2I11M3I3M1D25M2D5M1I12M3D22M1I2M3I2M1I13M2I8M1D7M2I10M2D2M1I2M1I6M1D3M4I14M4I5M3D22M1D28M2I9M5I4M2I10M6I4M1I11M2D3M2D7M3D1M1D5M1D6M1I4M11I1M2I3M3I2M3I3M1I13M1D8M1I5M1D8M1I3M2I5M1I6M1D7M4I1M1I9M1D2M2I2M1I4M2I2M1I8M1D14M3D8M3I2M2I3M1I8M1D3M2I4M2D3M1I5M1D24M1I2M1I4M1I7M1D8M3I5M3I6M1D5M1I6M1I7M2I12M1I6M2I5M1I10M1I1M1I6M5I12M1I4M1I1M1I4M3I4M4D10M1I4M2I8M7I23M1I7M1D4M1I8M1D3M1I6M3I9M1D18M2I5M1D20M1I1M1I2M1I15M3I10M1D3M1D1M2D5M1I1M2I8M2I13M1I12M4I4M2I14M3I1M1I9M1I2M1I1M1I9M1I12M1I5M1D10M1I9M2I2M2I1M1I8M1I3M2D8M1D4M2I13M1I1M1I4M1D13M1I16M1D1M1D24M2I19M3I1M1I7M2I20M2D2M1D10M6I8M1I8M3D1M1I3M1D5M1I30M2I1M1I3M1I5M1I6M1I13M5I16M3I2M1I5M1D9M8I2M1I3M1D5M4I12M2D7M2I14M1D26M1D46M2I2M1D5M1D6M1D10M1I27M1I12M2I18M1I5M6I13M4D5M1I11M4I1M1I6M1D24M1D1M1D10M4I2M5I3M1I4M1I1M2I7M2D13M2D6M2D3M4D23M4D6M1D16M2I8M1I7M1I3M1I3M2I9M1D3M1D11M2I2M1I4M1D9M2I10M2I3M2I1M1D4M1I10M3I32M1D5M1D35M7I8M2D10M1D18M3I15M1I14M1I5M1I9M1I8M2I15M1D23M1I8M5I13M1D14M3I2M1D5M1I3M1I2M3I2M2D18M1D15M4D16M1I5M1D8M1I2M3I4M1I9M2I6M3I7M1D27M2I8M1I6M1I6M1D18M1I11M2D3M1D1M1D5M3I3M1D2M2I5M2D4M2I2M2I2M4I2M1I2M2I3M2D2M1I8M1D8M1I3M4I18M4I5M3I15M1D36M1I5M2I16M4I1M1I8M4I5M1I15M1I6M3D1M1D8M1I5M1I7M2D12M3I11M2I6M3I6M1D5M1D14M4I8M1I1M2I8M2D7M2D8M2I3M1I3M1I9M2I15M1I3M1D8M1D3M1D28M3I5M4I3M1D8M1D5M2D4M1I7M4I17M1I3M1I3M2I4M1I3M1I6M1I7M2I2M1I6M4I5M2I4M1I2M1I3M1I9M2I2M4D7M3I2M2D3M2I1M1I13M1I6M1I6M1I5M1D15M4I2M2I6M2D14M1D9M1D6M21S	*	0	0	AATCAACCTCTATAAAGCTGAACGAGAAACGTAAAACGATATAAATATCAATATATTAAAATTGCGACCTTGGCGCGCATAAAAAGAAGCATAAGTTCAAACACAACATATGCAGTCACTATGAATCAACTACTTAGATGGTATTAGTGACCTGTAACAGAGCATGCCCTAGGCATGATTTGTCTTCTGTGCTAATTTGTCATCAAACCTGTCGCACTCCAGGTCAGAAGCACAAAGCCTGCAATCCAGTGCGACAACAATGTTGTGTCGTGCCCCACTACGACCTGCATAACCAGGTAAGAAGATAGCAGTGATGTCAAACGACGCAGCTGACTTCTTTCTTTCTGGACGACTTCCCACCCAGCATGCGACCCTTTCTGCCATAACTTAGTGAATGTCTGTTATGAGCGAGGGAGCGAATTAACACTTATGAAAAACCGGGGTACGAAGTCGTGGCTATCTATCGGCTTATTAGATTACTTGAACGCTTCTTCATTCTTCCAAGGCGCGTTCGGTGGTTCCTGGCGCTCCTCTCTGCTTAATAGACTATATCGTTGGTATAAACAGTGCACCATGCAACATGAATAACATGTGGGTTATCCAAAAGGAAGCAGAAAGCTAAATCTGGAAAACTACAATACGATGCCCCGTTAAGTTCAATACTACTAATTTAGATGGAAAACGTATGTAATACCAGAGTAACTTAAAAGAGATCCTGTGTTGCCGCCAAATAAATTGCGCGGTCCTTTAATAAAATTACCGAATACAGAGCCTAGTGGGGAGTGGCGGGTGAGCTGAAAGAGGCGGGTATATTCCTGCAGTAGAAAATAAGGCATTCCTACGAGCAGATGGTTGGAATGACTATTCCTTTGTTACAATGTTTTATCTTACTGTCTTTGATGAGCATGGTGAAAATGCGATATCGGAAATGTTAAAATTGGTTTGTAGGTCAAAAGAAGAAGTAAGGCACTTATTCATTAATAGATAAATTCAGTCAACCCCTGAAATGGTTTTTCCTTAGTGAAAGCATTGACTACTGTTAATCTCAGCAAATTAAGCGATGGTTTTAACATAACCTTCATTAAAGCTATTCAGGATTTAATAGTAGTGGCCAAATCGATTAGCCGACATTGAAATGAAAGCGTCCTTAACACCTCATTAGTCCAGGGGTAACTCTTCCGCGCACTTCCTGGGCCCTGGTTTCGCGGGGACTCCTTTCTTTAATGGTTTGCCGCTTGTCCGCTTTCCATTTTCATTTAATAGAAAAGTGCTCCGGATTCTAGTGATTTGACTATATGTAGGTCCAAACGGTTAATTCTCTATGCCAGCACGAACATTCATGCTTTATCCTGGCGACATCGGTGGTAACAACAACAATTTTGGAATCGAATGATTGGTGCAATCTAATAGAACACAGGCACCTTGCCCCTGAAAATAAGGACTATCGGAGGTAAGGAATCCCAACGGATATTTTCTAATCGCTTGTTTCAGTTCGTCGTTTAGTGCATTTGATCCTTTTACTCCTCCTAACGAACAACCTGATCAGCAAAAGGTACACAATACTTTTATATTCTTGACACGCAGAATGCTGCCAGCAATAGTTTAAAATAAGGGCGATCTTCGTTAGCGTTCGACCGTTTCATCGGTGCGTTTAATGTTCGGTTGAGTCGAGTAGATAGAAAAGACAACTGGCTTGAAGTGGCTAAAACTAAGTAGTGATGAAAACTTTCAAATATGTGGAACTCAGCCTCATTTCTAAATTATGAAGAGTTAAGACGTAGCATGACACAGATTCAAGTGGACGTGATGATAAATTCACTAAATTGTTTTATGTGCTATGACAGGGAAATATCTGCTTCGAATGAGCCTTGGTGGACATGCAATTGTTTTATTAAGTCTATCACAAGATTAGTAGATGTCGTTGGCGAAAAGTCATCGTGTTTGGTTCGATGAACCAGAGGTTCATATGCATCCACCTTTGCTCTCTGCCTTTACAGCTTGCCTGGCTCCTGCCTCCATCCCGCAATCCTTCGCATACCAATTGGACTCATTCCCCAGTAGTACTGCAAGAGGTTCCAAATGCCTGCATGTGGAAAGTGTCACGGTCAAGAGAAGCAATAAATATTATCATTCCGGCTCTTGAGTGCAGATGAGACATCGGAGAACTTGGCCTACACGGGCGAGTGGCCCGTGGAATGACAATTCTGGATACCACTTATTATCGCAGTCCGTTGATTCAGAGCTTTCTTATGAAACCATTCTAAAATTATAATGGTCAGATAGGATTAGAAGAGTAGAACCGTTTAAAGCGATGATAATGAACAGGAGATGAAGGGTAAAGTACAATGAAAAGCCCTCTTTCCATGCGAGAACTGCTACCGAAATGCTGCTTAATAAATCTGCTCGGAAGGTATGATGCAGATAAATGTCGAAATAATTTCATTATACTTCGCCCCACTTTGGAACGAACAACAATATAGAATATTAAGCTCGACAGTCATTATTACCTACGACAGGACACACCTCTTGAGCCTACGCACCTTAGTTGGTAACCTTAACAAAGGTTTAAATTAGAAAAGCTTTATAGAAATAATATCTCCCTACGAGATAAACAAACACGAGGAACATATTACGTGACATGCTTGTTTCATCATGAAAATGTCATTTTGTGGTGATATGACAGACAAAATATAGATCATTTTCTTCCTATTGGACATTATCCTGGAATTTCCCTTCGCGGCTCCCAGTCTCCCTTCCATTCGCCTGCGGAAATGCAAGTCGGGAGAGAAGGTCAAGTTTTCGCAGTAGATGAGGTACACCAAGCGATTCATCCTATACCTGACAAGGACATTTTTCGTGAGCAATGGGTATATGCAAATTTCGTTTCGAGAACTCCGGGTGCTATCAGTTTATGTTGCGAATGCCCGGCGAACTGGAGGCAGGAAGACAAACACAGAGGCTTTCATCATTTCAAGCTATTAAATATGCCAACAGGTATCGTTTGGGCAGGGAAGCACTTGAGTGAAGTGATTACTCAAAGAAACTCTTCGTAAAATTATAAGGAAATATAGTTCAACAACCGCAACGTTTATCCGGGCAGCTGCAGGCTACAGTCAGAAATTTATTGAAGCAAATCTGAAACTATTATAGATTTGAATGACTTCCCCAATCTTATTGGAAAAGAGATTACCAGTATCAGTGCCTAGCAAACTCGGAAGATTTTCAGAGGAGATCTAGAATATGATGAAAGATAGAAATTATTACGACGCTTATCGGAAGTGAACGAATACTTTATGAGGAGGGCTGTTTACAAAGTACGGGTAGTAACTTGCCACGAATTCCGCGCGAGGCAGTATACGGCGCAACGGCGGCAGCGCACCGAGAAGGACGTTGTAATGTCGCTCCGGCACATAGCAGTCCTAGGACCTAGTACCGTCACAGTCATAGATGGTCGGTGTGGAGGTGGTACAAATTCTCATGCAAAATATGTAAAATCTCGGCTGCCATCGCGACTCCCTTCCACCTCGCCATACTATCGGAAGTCCCACCATGCCAGCCGCAGCACGTTCCTGCATACGACGTGTATTGCGGCTCTACCATATCTCCTATGAGCAACGTGTAGCAGAGCCAAGCCAACTCTAATTTAATACATAATGAAGCTAATAATAATATTAAAATTTCCTGTCAACTAACATTTACTATGGTCTGATAAGAATCATTGCAAAGATCAAACAACTTGTATTACATTGTACCACGTTAAGCAGTTAATTTTATACCTCTAAAATATCAGCATCTAGCATGCAACCTATCAAATGGAGAGTTTATGACTCAAAACCATGGGAAAGAAGACTTAAAGATTTATTATCGCACTTGCTCAAATGCTGCATCATACATATTTGACCCTGAATTACTTCGGTTTGAAGTGCTGAAGTAGCATCCCGCAACGCAAGAAAGAGCAACATTTATTATTCGACAAACAAACCAGATTATAGGATATGACATTTGGTAACATAATGTTATTGAAAATGGAAAAGCTGATCCATTAATGGCTTGGGGCTAAAAATTCTATCGCAATACGATAGAAAGTAAGGCGTTTAGAAATGTATAGCGAGGCAAAGAGCCTCTTATTTCATCTTACATTGAAGAAAATGACATTGAGTTTATTACAAAGATGAAAGTATGTTAAACATTGGTATAACACAGTTAGTCAGACTTGCACAAAAGAAATTACTTCTTTATGGGGTTGCCACTCTTCCTTGCGCGTATCCGCACTAATCCTTCTTTCTAATACGCTAAAAGATTACGAATTATTACATGCCTTAGTAATCTATGGCAGAATGTATAACTGCTGTAACTCTTGGCATACAAACCAACAATTCAATGGGTAGACTTGATTTCTACAACATCATTCGACTCTTTATTGGGATGAAGCCAGGAGAATAACTTATTTAAATTAAAAGATTACTCTCATAAGCAAATTGTCCATTTAGCATGATACAATATGACAATAAATAATTCCTGAAGATATTAAAGGCTAGACGCGTCATCAGGCGCAAAAGAGCCATGCGACAGAAGAGGAGTCAATTATACTCCATAAGCTTGCAGAAACGACTTTACGGACGGGTTACATTCAAACATTAATTTTTATGATAAACAATTCCATCCAATTGATTTAATCAATACAACATTTGAAGATCAAGCAGATAAATATGTTTTTGGCGTTATGCAGCTGACAGAGCCAAAATAACAAATGCCTATGGCTTCATTTGGGATATCATAGTGGCTAGAAAGCAAGCATCTATTCAATAACCACAAATACCATACAATGCCAATTAGATGAAAGACTTCAGGTAATTGGAATTGAGCATTCAAATAATAATCAAAATGTATTTCATGAGAAAAGTAGGTACAGAAAACGACGCTAAACCGACTTTAGAAATATCAACAGCAGACTCAAACATGGATGTACACCCTTCCCTCTTCCTGCGTCGGTCTGCCTCAATTCATGCGGTGATGTAACACTATGAACAATTGAGTCATAGAACTTCCATTATTCTCCTGAAGATAATAATCTCAAATAACCAATATCTATCCAGCTTTTACAATAGCCCGACTAACAACCGCAGAACGTTATTTCATACAACGTTTCTGCCGGGCATATCTACAAACGATTACTGATAACAGGGACAGCAGGCCAGCCAATATCAGTGCAGTTACCCATCATCAACAGCAGCCGAATGCAGAAGCCGGAGCTTCTTCCAGGCTTCAGCAACGAGGTTCATCTCTTCCTTCGTTGCAATTGTTCCAGTGATCTGCAGCATCCTGAAGGCGCAATATGCTCACTGGCTACCTGCATCAGGCTTTGTTCTTCCTCCGCTTCCGCACAGATCTCATCAGTTTTTCTGCTTCGTGTACTCTTCACCCAGGCTGTGCCGTTCCACTTCTACTTCCCCTCCCGGGCGATAACCAGGTAAAATTTTTGCGGGTAACGATAACCGAGTTCAGAAATAAATAACGCGTCGCTGCCGGAATGACCCACGTCAACGGTTTACCCGATGATGGCTTTCAACGAGATGCCACACGATGCCTCATCACCTGTTGAACAGCACAAAGCCAGCCGGAATCTGTGCAATGCAATATCGGTACTGTTGCAGGCAGACGTATGAGGCGGAATATGCCGTCACCTTTCACCAATAAATTCGATGCCACTAGTTCCGTCAGCAGATTATAAATTTATGGTCCGTGGTTGTTCCTCCCTTCTGATGCCCCTTACTGCCAAGCCTCGCCCATGCTCGTAAATGCAATGTTTTGACGGTGTTTTCCGCCGTTACCGCAGCGTTAACGGGTGATGGTGTGTCCGTGAACCAATACTGAAGAATGGGATGAGCGGAAGACTTAAGGTTAAACGA	*	tp:A:P	cm:i:84	s1:i:763	s2:i:0	NM:i:1643	ms:i:2342	AS:i:2342	nn:i:0
+33	16	utg000001l	40362	60	1927S17M2I4M1I1M2I2M1D10M2D4M2D5M1D5M1D4M5I8M2I6M1I6M1I11M3I3M5I4M1D8M1I21M1D3M1D16M1D2M1D5M1D11M3D8M3I7M2I11M1D10M1D10M3D8M2I4M1I2M2D6M1I12M1D3M1I4M2I4M1D3M1D7M3D29M1I22M2I12M1I2M1I3M2D2M1D8M2I2M1D17M1D23M1D10M1I2M1D3M1I9M1D11M2D3M2I5M2D9M2I1M1I6M2I9M2I4M1I9M1D9M1D8M1D3M2I20M4I1M2I5M1D18M7I14M2I10M1D10M1D5M1D6M6I24M2I6M1I7M1I8M2D5M1I2M1I9M1D2M1I6M2D3M1D5M1D4M1I13M3I11M2I23M3I2M2I5M3I5M2I8M2I22M2I13M1I27M1I4M2D7M3D11M2I6M2D16M1I28M1I24M1I4M2I25M2I14M1D15M2D12M4I9M3D5M1I14M1D16M1D16M1D5M1I16M3I8M6D7M3D7M1I14M2D13M1I3M1D17M2I8M2D9M1I8M1D35M1I6M1I1M1I9M1D1M2I10M1D3M1I5M4I1M1I3M2I7M2I1M1I8M1D13M2I4M1D6M5I21M2D6M1D6M3I4M5D9M1I12M1I10M1D8M1D2M1D35M1I21M2I5M2I32M1I8M3D7M1I4M1D3M1I9M4I10M2I18M1I9M1I2M1D8M2I12M2D4M1I14M2I4M1I14M4D9M1D3M3I21M1I3M1D5M1D9M2D6M5I10M1D4M1D14M4I9M2I15M1I7M1I15M1D7M2D10M3D4M1I22M1D13M1I20M1I7M2D10M2I16M1I11M1I10M1D2M1D4M2I7M3I4M1I2M1I11M7D3M2D5M2D1M1D4M1I7M2I2M2I3M1I2M1I18M1I1M2I1M1I7M1D7M1D8M4I1M1I14M1D2M1I20M4I3M4I1M1D9M2D15M1D21M1D4M1I2M1I5M2D7M3D2M1D20M2I3M4I10M3D5M1D8M1I2M2D3M3I1M1I3M1I10M1D10M1I2M2I6M1I3M1D8M1I5M2I35M2D16M1D6M2I21M1D15M1I7M2D7M6I8M2I5M5I1M1I8M1D18M2D10M1D22M1D12M2D3M1I10M1D3M3I7M1I3M3I30M1D5M1D4M2D36M1D5M1D5M7I9M4D17M5D2M3D11M1D8M1I2M2D23M1I3M1I8M1I7M1I6M1I5M1D3M1D1M3I10M1I4M2I2M1D15M2D18M1D4M1D18M1I4M2D16M4I3M1I4M1I8M4I1M1D11M1D2M2I21M1D17M1D3M1I5M1I4M2I5M11I5M3D30M2I4M1I1M1I16M3I5M1I3M1D9M1D3M2I17M1D15M3I3M1D4M1D4M2D1M1I5M1I16M6I16M6I15M3I5M3I8M1D9M3I9M3I7M2I29M2I15M5I25M6I4M3I9M2I5M1I4M1I3M2D14M1I5M1D2M3D4M1I7M1I20M1I2M4I4M1D5M5I3M1I41M1D8M2D21M1D6M1I1M2I1M1I13M1D15M5I8M2I2M1I4M1I4M2D3M1I4M3I1M1I4M2I8M1D2M1I10M1I10M1I4M2I16M1I6M4I5M2D12M2I17M7I4M1D2M1D8M3D4M1D6M1I8M1I2M2I5M1I6M1D12M2D3M4D4M3D9M1I24M2I5M1D3M1I8M4I5M2D8M4I13M1D5M1I7M2I3M2D5M4I4M1D12M1D9M1I16M2D28M1D16M2I4M1I4M1D11M2I31M2I1M1I6M1I7M1D10M3D19M1I38M1D1M2I12M2I3M1D6M1D10M5I1M1D8M1I19M2I15M2D13M1I9M1D21M2I16M1D19M3D1M2D8M1I3M2I23M2I6M2D6M1I11M3D20M2I34M1D4M1I2M1I6M1D9M1I11M2D8M1I12M2I4M1D2M1D7M6I3M2I9M1D8M3D6M6I13M1D4M1I3M3D17M1D19M4D2M2I12M1I9M4D3M2I13M9I8M2D3M2D1M2D17M1D7M2D10M1I6M3I1M2I10M1I22M1D4M1I4M1I6M1I12M1I6M2I28M1D8M6I5M1D5M2D6M1I4M1I1M2I5M1I7M3I14M1D6M1I4M1D9M1I10M5I5M1I7M2D2M1I10M2I69M2D31M3I11M2I9M2D8M1I17M1I6M2I30M1I7M1D11M1I2M4D3M1D9M1I6M3I8M1D31M1D6M1D15M1D9M2I5M1D6M3D9M1D6M1D7M2D12M1I8M1D3M2D4M2D4M2D4M3I6M1D4M4I7M2I4M1D8M1D2M1I1M2D5M3I10M1I5M2D9M3D2M1D13M1I1M2I15M2I16M1D21M4D24M1I5M1D8M6I8M1I9M1D1M1D14M3D2M1I6M1D1M1D14M1D3M1D5M1I7M1D2M1D7M1D2M6D7M2I8M1I9M1I2M1I23M1D8M1D3M2D2M2D4M1D3M1D4M2D12M1D5M1D5M1D7M3I5M1D12M5I15M2I1M2I9M2I3M1D4M1D3M1D1M2I3M1I12M1D16M1D1M1D5M1D4M1D9M1D20M2I5M1I2M1I15M1D3M1D15M5D7M2D19M1I11M8I7M1I16M1I6M3I1M1I5M3I10M1D20M1D4M1D7M1I1M1I8M1D7M1D7M1D3M1D9M2D9M2I5M2D5M1I3M1D1M1D6M1D2M3D3M1I1M1I12M5I8M2D19M3I10M1D12M1I3M1I4M4I11M2I9M1D20M2I8M2I9M1D11M2D3M1I2M2D2M1D9M1D5M2D1M2D8M2D2M1D10M2I6M5I8M4I11M3D2M1I15M1I10M2I13M2D1M1I2M3I14M4I19M2I1M1D4M3I14M2D3M3I2M1I9M2I16M3I1M1I37M1I15M2I14M1D11M2D7M1D2M1D5M2D6M1I1M1I4M1D13M1D9M1I6M1D17M1D14M1D11M2D10M3I3M1D13M1D6M1D4M1I19M1I1M1I6M3D4M3I7M1I10M3D2M2I3M1I12M1D8M1D4M774S	*	0	0	AAACATAAAAGAACAGCGACCTTCAGACGTCTGAGACCAGTCAACGTCCGAATCCGACGCTCTACACATCTACCGCTCTTATAAACCCACAGCGGTCCCGGCACCTTCTTCACGCGGCATTGTAGGATTTGACCATGAAGGCGGCGTTGGCACCACCGCCAGTAGCGTAAGCACAGCACCATGATCAGATCGGCTGAACTCCACAAGCCCGGGAATCATCGTCTGCGCCGGTAGTCATAGCCGCGGGCACCATACTGGTGATCAAATCTGTAACAGTGCCGGGATACCCTACCAATGGATAAAGTGGGGCTGACCTCATCCCACGCATCCAGGCGCGCACGTGGAGCACCTGATGCAGCCTGAAGGAAGACCTTCGAGCTCTGCCAGCGCCTGCGGGTCTCCCTGTCCGGCTCTTCGCCTAGTCCTTTCTGTCCCTACCCCGCCGGTGAGATAAACGGCAACTGCCGGAAAAGTGGGCTCCAACATAAAAGAACCTCTAGCTAAGATATAAAAACGTCGCCCATTGTCTCATGCTTCTCCAGTGCATCCAGTACGGCTGCACGGAGTTCAGTATGTTTCATCGCTGTTACTCTACCCGATTGATGCTGCCATCCACGCTATACGCTGGCTCTTCGACAGACGTTCACGCCGTTTATCAAGCTTTGTGTTTAAACGCCGTGGTCAGCGGACGCCATCGGGATTTACCACAATAATGGGGTAACGGTTTTCCCATACACGCTGCATGACATGCCTAAGCGGCCATTTTCAGTTGCTGAACCAACGCGCCGGGAATACGACGGTTACCTACACAGCACGGTGCCGCCATTTGGTAGCGGATGAAAACGCTGCCTTTTACGTAAATGCTCCGCGAGGGGGAAGGACACCCCGCGCATTACCCAGCTTGATTACGGCAAAGTCGCCGGTTAACTTTGATTCATGCGGATTTGACGTGGCCCTTTCATAGGCCCCCTTCCTTACCAGTTCGGCGTACCTTTGTCGCACGGGCGGACCTGTGACGCACTGCGATATCGCGGATGAAAGCAGAACGCGGTTAATAGGGTTGCGCGGACGATACAGAGCAGGCACCGCCGTTTTGGTGAGCCACTCGTCGGGCGCTTTTCTCAATCCTGCTCATACTTTTGGGCTAAGCCATTTCCCTCAGCGACGGTTAACGGCAGGCGTAATCAGCCCCGTCCAATGCCAGAGATGACAACTTCCATACCTGTAAACACGATCCCAGGTTACCAGAAATTTTCCTCACGATGGTCAGCGTGTCTCACGCCGCAGCTGCCGCACCTCATGAGTCAGCCGGACAAACACAGGGACGGGCTTGGAGCTTCAACGCACGCCCATATGTCCGCGGCATAGCTCACCTGCGTTGTCATCAAACAGATTACCACCGTACCTGAAGCCTACCGGCCCCGGATTATGGTGGCTGACTCCATGACGTCCGCGGTACCGCGCGGTATCGTTTCATCGGCGCGGCAATGGCGGCAGCAGATAAGATACAGCAGAAATTATCGAAATGAGCCACAGCGCCTCCCGTTATTGCATTTCTCTCTACAGGCCGCGCTCTGTCAGTCGGCTGCCACACCGGCAGAGACGAAACCGTTACTCCCGGCAGCACAATGCCAAGGTTCATCCCGCGTGGCGTGAATGCATCCAGGTATGCAGCTGTTATTCACCAGTGCCACGACCGTGACCAGTCAGACGTATCAGAATAGAATCATCCGGCTCCTATTACGGGGTTGGGACCTTCATGTCCGGTCCATTTAACATGCCTGTGAGGCCGATGTCTTATGACGGCGGGTCATCTACGCGTGTCATCAAGCTCCTCTTTCAGGGCCCCTCACACGGGAGCGGGGCTTTCTTCCTTTCTTTTACGTCGGCACGGATGCTCCCCGTTCAGTTGTTTCCCGGCGGCACGGGCAATCAGTTCATCTTTCTCGTACTTAGACTCCTGCACAGAACATGGCCTGAAGGCCATGATTACGCCAGCGTTGTACCAGGACAGAACTCATCAGATACCATACTTACTACAGCATCAGGCGGTGCTGACTGAATCATGGGCAACTCACGCGCCGGATCCCTTGGTACCATATTTTCCAACTGTCATGAGAGGCGGTTTAATGCCTTCCTATGTGCGTCGCATCCTGAATGCAGCCTAAGCTCCAAGACCGCCGTGCCTGAGTGTTCTGAGCATACTACGGTGTTGTCCGGCAGGAAATTCTTTTGACGACGCGTTCTTACGTACTGTCTAGAATACACGTTGACGATGGCCCATCACTCGGTACCGCTTAGCTAGACACCGCTTTGCCCAGGTCTTCACCGCTGTCTCGAGCTCCAAATCGAGCACAGACGGTATCCAGCTTCTCCTTGACCTTTATGAAGGAACGGAACAGCGCCCGCGCTCTTCGGATCTTGAACAACCATCATATTCACCACACGCTGGCGTCAGCGCGTGGGCTTCGATATCGTGTGGTCGGGTCATCGTGGACTTGTCACCATTAATAATAGCCGTATCGGCCTCAGGCTGGACTGCTGATGTTATTTCCTCCTGCCGATTTCACCCAGCTGTACCTCAACCGGATCGGCAAGAACGTTAACGGCTTCCTCTTCTTGCTCTGCCAGCACGGAGAAGTAAAGTCGCATCCTTCAGACCTGAGCAAGGGGAGCCAGCTCTTCGTGTAACGCATGTTCTGCATGATGAGCGTGCACGGCGCGACGGCGGTGTAAGCCGCTGGTCCGCCAGAGCATTCTGCGGTAATCTTCATCATCCAGCAGGCGACGAGTTCAGTGCGGATTCACTTCATGCTTCGGCTTGACATATCCCCGGCGTAAATTTCAGGGTACGAGGGCCGCCACGGGAACGGATAACCTCACTAAGAAACAATCGGCGAAACGTACATGCGCCATGTCATTTACCAGTCCGGAATTTGTGAGAGAGATAGACTTTCGTGGTGAAGGATAGCTCACGGAAAAGAAGAGAAGCAGAAACAGCAAGATCAAACTTAAATTCTGCTCATTTGCCGCAGCAGTTGGGCGGTTGTGTAGGATAGACATAAAAATCTAGCTAAAAAGAGGCAACCTTTAGTCCATGAAGGATAAAGTAAACGATGCTTACATGCGTTCCGGCAAACGAGGCTTCCGTTTTCGTCTCGTCTCCTGGCAGCTCCGGCCAGAGCACATCCTCATAACGGAACGTGCTCAAAGTGTGTGAACGTTACTAGTGGTGCTGGCTGTGTACTTGACAGGCAGGACCGCAGGAATATGCCAACGGCAGCACCGTCGCTGTCGGCCGGCGGGAACACTTAACCAGGCCAGGGCCGGGTCCAGCATCAGGGGTCATTGCAGGCGATTTCGCACTCAAGTGCGCCGGGCGCGGTTGCGTATGAGCTTCATAATATTTTCGATGCGGCTGGTAATGGGTAAAGGTTTCTTTGCTCGTCATAAACAAATCCCTTACACTGGTGTGTTCAGCAAATCGTTAAAAGGATCTAGATGCTCTAGTACTATGCAGCCAGCGGTGCTGCCCCTGCGCATCAGACGATCCAGCGCCAGTATTGCTGCTCTGTGCACTCTGTGGTGCTGCTCAGAAATGCGGCTGAGGTCGCTTCGACCCAGATTCTAAGTATGCCTCGACGAATCGTGCCTGTCTTCGCGTCCGTCCAGCTCCTACAGTTGAGGATCCCCGGGTGTCATACGCTGTTCTGCCGCAACCGCTGCGGTCGGTGATCTGCGCGTTCACGTCCCTCATGCGCCGAGCGCGTTCTCGCGCTCGTCGCTCTACACGTCAGACGTTAAGCCTGCGAAGCAGTGGCTGAACAGTTGTTGATCCGAGTCTCTTTGGTCATTCGCCCTCCCTGAGACGGATTTGACGTGCATCCAGTGCAGTCACGCATGACTGGTGATCTCACGGGCTTATTTAACAGCCAGTTGTATTAATGTGGCAGCAGCGCTGCCCTGAAGTGCTGGATAATATGCCATGGCTCCCCATCGAGCACACATCGAGACAGTAGGACAGGCTGTATATTAACGAACGACATGTTATGCGCAAACATCTGGCGGGTTGCGTCGTGGCCTAAGGCGACTTCACATCTCCAGGACGTCATCAGAAGATGGCTGTAGCGATGCATCACACCCTTACCTTCGGGTACGCTGTGGGTTCCACTCGTACTTCCTGTTCCAGCACAGCGTAATCCTGTGACGCTCAGAGTAGACGGTAGATGGAGCTGTCCTAGCTGGCTTCTGCGTGACCAGACGCCGGGGAGCAGAGGCACTGGCAAGCAACTGACCTGCACTGCATTCATGTCGTTGGCAAGCGCCATACAATGGGTTTTTAGTGTCCCACACGGCGATGATGTCAGCAGAGGTCAAATGCCCTGAGAACACCAGCCGGTGCCGTGAGAGTCGTGTCCAATCAACTAGAGTGCCGTTAAGTATCGGATCGCTGGCAGCCTGTTGCAGACGGCGATAATGCCGTTGTAACCGGTTACGCTTACCAATACGGCTGCGCAGCGCGCCCGCGTCCGGCTAACCAGCTTGCTAACCGGCAGCACGGCGATGCCGTTCATGACCTGATAACTGCGGCTGTCGTGGTCTACCACCGTCATCATCTAGATAATGCCGTCAGGTGGCCGCCTCCTGGCAGTCAGGCTGTCGCTGGACAATGCATCGTCAGGGCGTGCCGATCGTACGAGCGCGTCGTGGCAAGGCAAGGGAATAAACCCGCGGCATCTAGCGTTTTCAAGCATCATGGCTCATTAAAGGCCAGGTGGGCAATATGCGGTACTTACCGCATATGCTGTCACTCTTCTCCTCTCTCTGTCGGCTTGTCCCGATTATGGCCCGGATCGGACATGCTGCATAGGGCCAGGCGGCGGTTTAAGACCGGCTGCAACGGCGGCTCAACATCGTGATGGATCATTTTCAGACCTGCTGGGCAAAAATTTCCTGATAGTCGTGTCAGCGCGCGTTTTAGGTACTCTAGCCTCTCCGTCCATACGGTCGGTACTTCTATCAGCATCACCCTTCCTGAACTTCTTTGGTCAATACTCATCGATAAGAACCGGAGCCTATCCAGGTGTTTTAAGAGTTCCCCCATGAGATAAGACTGCGGCTTCATGCGAAAAACCAGCGAAGCGCTTTTGAAGGTAAACGTCACACCAGGGCGAACAGGTTGGCCTCTTCCAGCCAGCACAGAAACATCTGGCTCGCCTGACGCTCTGGATGCGACGAATTTTCGCCGCCCCATACTGACAAATCACGGCCCACGATCCTCATGTCGCAACTCATTTGCCGTGGAGTAAGGTATAGCGATAATTCCGGGGAAAGCTGCTCATACGAGAACATAGAGCCGCCCGTACAAGGCGATACCAGATATGGCAGCAGTGACTGCTCAAACACGGAGTAGCGTTATCCATCCTCGGCCGTCTGCAGGTTACGTGAGTACCATGGCATCAGCTGCTTACTTTGTGCCTCCCCATGAGCGTAACATCGTGCCCTTGCGGCGATCATCGCACCGGCATAATTTCTCCAGGTCCATAGGGTTCAGCCTTTCAGCGCTGCTGCTCCTGACTGTTCTGCGCCCAACGAGAATAATTCATCGCTGACACTGCGTATCCAGCTCATCGCTCCCTCTCTCCAGCGACCCTCCCTTCATATCTCGCTCCTGCGCGGCTTCCGTGTTCTGCCCGTAGGCTATCTTCATCTGCTGAGATCACGCTGTAAAACATTTGCAAGCGGCGGTCTTATACGTCGGCACTCTAAGTTTCAAAAACACGTGAATGAACGAGGAGCGCCCGCCGGGTAATAACACGGTCACGGGTATCCATGTCACTTCTGCGGCATCCAGCCAGGATACGTCCTCGCTGACGTAATATCCCCAGCGCTAACTGATGTCATTAATATCTGGCACCGGCACGGCAGTTTTGGGGCTGTCGCCGGTATTGTTCCTTAGGCCATCGATGCGCTTCGGGCTGACCATCCGGAACTGTGTCCGGAAAAGCTTAGAGACGAACTGGTATCCCAGGCCTGAACGAACAGTTAGGATGTTAAAGGCGCATGCGGGCCAAGTCGCCGAAGGAGCTACCCTACTCAAACGTGCGTTTTGGGGCTAACAACGTCAATGCAGCAGCAGTCATCCTCATGCAAACTCTTCCATGCCGCTTCAACGCGGGAAAAGCACGGGCTTCTTCTACCGCGCCCAGATAGCGGGCTTGGGCGATGACACTGAGCCGGAACAGACCCGACGATATGATCGGTGCAGGCTGGATGGCGTTGGCGGCATCGTTATTGCGTACCAGATCGTGTCCGCGGGCATTGCCACGGGTAAATTGGCTCTATAACAGGCTGCATCACACTTTCACCCTTGATTCCAACGCAAACAACTTGGACCCCAATCCGCGTAAATTGCTTCATGCTGGGGGATCGGGTTTATCGCGCCGGCTTTACTGCCGTCGGCGACCGGTGGGAATGGTGGGCGTTTCATACATAAATCCTGCCTTGCCGGGCGTCGCTCTTGTCGTTCGTCGATGCAATTCCAGCTCTAATCATGCTGCAATATTTAATCTCAGAAGTGGCCGTAACTCCATTCGTGCGTCTTTCTATCACATCCTGTTACCTCACCCGTTTACCTGTCATCATATCGGCACCCGCTAGCACGCTGAAGCGGCAAGTTGTTCCTATGTCGCGTCATTCATCCTCTCCGGATAAGCACGGGGCAGAACAAATCTGCCAGCTTTCTTGTGTCTGTTGGTCCGCACGAGACCCCCTGCCGGCAGGAGGCCAGGCAGGGATCGAGATTAGAGCTGCCCGGCAATCGGAAAATACTCTCGATGCGCAGCGAGCCGCCAGCGCATAAACGAAGCAGTCGAGTGCCTCATTGGGTCGCTTTGCTGTCACACAGGTCCTTCCTCATCCACCCATTTTTCGACCTGCCTTTCAGCCAAGCAGTCAGCTGCTCTGCGCTTCGTCAGATCAAAAATATCCGGGTTATTGCGGAAGAATGAACGGCACCGGGAAGCGGTTAGTACCCTGTCGGGTGGAGTGTGAAGCGCGTATAATCTGCTCTGTTCGCCGGGGTATCTGATCGATTTCGGTAAGGTAAACCCCGTTTTGTTTTCGCTAATCGTGGATGCTGTCCACCGGCCTTTTCCGTAGACGGATGCTTCTAGCATGGGATCACGGAACAGCCCATGTTTTTCCAGCGTTCACACTGCTGCCCCTGGTAGTCCGTTAATCCCGCCCCAGGTCGCCTGGCTAATACGCGCGGATATCGACATTTCTTACACCATTCCGGCATATCTATTTATGGCTTGATGGCCTCATCTACACGCAGCAGCGTCTGTCATGGTTTAGTGGCGGCCGATAATAATCTGCCGGTCAATCAGCCGGAGCTTTCCTCGAGCCGAGCCATCCCCAGGTTGATCCTCGCATTTCGAGCTGAGTATGCGATGATAAGTGGGTTCAATAAGCCACACGGTCAGGAACGGGCCTGAATAATCCTCTTCCGCTCTGCCCATCTATCTTCAGCATGTAGACGTTCGCTAAGTTCGCCTCCATAGGTCACGGCTTTGTTTACGAAGGTTTACGTTTTCCCTTATCTGCCCTTCGTTTCGGCCGGACCGTTGTTTGACAATCTTAGCACCCAGGTGGTGCTAACTGATTACCAATTTATCAGATGTGAAAATCACACTGTCAGGGCTCAATCGTACCGGATGACGAAACCAGAGAATGCCATCACAATTGTCAGAGATCCCGGCTTTTCACCATCAACGGGCATCAGTAAAGTCCAGCTCCTGCTGGCGGATGACGGCAGGCATTATGCTCGCGCGCTCGCATGATAAAAACACGCTGGCTGGAGAGAGTATCATCCGGCGTCATTTGAGCCAAACGGCGTCTCTTTGTCGCCAAATTTACACCATCCTTCCTCGCCCTAATGCGGCAGGCAACATGAACGCAGCACTTCTGCGCATTCTTATCCTGCATCCTGTATCCTGTACCTCTCTTCGTACCGTGGCGGAGCCACGGATGGACTTTGGGATATAACGAGCTTCAATACGGTGTGTCTACCAGAGGAGGAACGTTGTAGAGAGCCTTCGGTTCAATATTACTACCAAACAAACAGCAGGAAATCATCACACCCCACAGCCCGACTTCTCACGCTTATTTTGGTTACCGCCTGAGCCCAGGAGCACCACGCCTAAGCCATTGGTGAACGAACGCTCTATCCAGTGTTATCCGCTGCTCTTTGCCATACCACACGGGGCCAGCGATGCGATAGAGACGGTATAACTGGTACGAATAGTGGAGCCAACGGCTGGTTGGCTTCATAAAGTTCTCTATAAGCAGCCATCCGTCAGGGCAACCAGATAAGGGGCTTCTTTGCTATGCTTATGCTCTATAAAGCTGAGACCAACACCCCAGCAGCATTTGGCTTTGAATAACCGACAGGCGGTATTCAAGATTCACTATGGATCGTACTCATGCTCCATCGCATTCATATGGCCCGCGGTGAAAGCAGTGTTTCCCATGCGCGTTCCTGGTATGCGATTCTTTCGGGAGATAGCAACCCTTACACTCGCCCATTCAACGGCTTTCTTGTGAGAACGGCCTGAACATGAGCGGGACCGGCACCCCGGACAAAATGCCGCATGGTTTATACCTGACTGTTCGATATATTTGACCACCACCATACCATTATCGATAGTTTCAATCCAGCGCGTCAGTGAGTCCTTTGTTCGGCGCGCGTGTAGCCTCGCGCCTATCGCTGTTCCAGGAAATCAACATGTCCTGGTTTTCCAGTTCCGCCCAAACGCCGGCGCCTCAGGAGGCTCGAGAATACATGAGTTCTGGTATAGTCCAGGATCAGAGCTCCGCAATCTGCCACTGCCATTTTGGTAAAGTTAACGAACAGTACCAATTCGGTCTTCCACGTACCGGTCGTCATCCGGCATTCGCGCCATTCCCCTGTCGGCTCGTTCAATTGGGTCCTGATGGGGTTCTGATTAACCCATTCTTAGCTCCACTCTGCCCCTTTCTGTTCCACTCTCAATGAGGGCGGCCTAAGCTTCGTTCTCAATTTCAGATCCCCTTCTAAGCATACCATTTATGCTGACCGCGCAGAGTCATAAGCACCTCATTACCCTTGCTACACTAGATCGGCATTAACCTGTTTAATCCCCCGTTTTCTGATATCTGACTAGCCACGGCTCGCACCGAAATGTCACTCATTGCCTTTGTTGACTTCCATTGTTCATTCATTGTGACGGACAAAACAGAGAAAGGAACCAACTACCAGTCAAAAGCTCGGTTTCAGCCACCTGTCGTTTGCCCTTTCTGTCTCAGAGGGTATTTTAAATAAAAGGCTGCAGTCTGACGAAGAAGAACCTAAACGCCTTAAACCGGAAAATCTTCATAAATAGCGAAATAGCGCGTATGCCGCCAGTAAACACCCAACC	*	tp:A:P	cm:i:76	s1:i:694	s2:i:0	NM:i:1930	ms:i:2654	AS:i:2654	nn:i:0
+34	0	utg000001l	11088	60	406S19M1I14M1D1M1D5M2D7M1I5M1D4M1I17M1I1M3I3M2D4M2D9M1D1M2D18M2I5M2I2M1D7M1D14M1I23M1I1M1I5M2I4M1I4M1D5M3I5M6D8M2I14M3D32M4D2M1D4M1D19M1D5M2D1M1D9M3I1M1I1M1I2M1I21M1D2M2I9M4I8M1D5M1I2M1D9M2D1M2D13M2D5M11D5M4D3M1I5M2I1M1I12M1D3M2I4M1I10M1I2M2I4M1D9M2D4M1I7M2D7M6D5M1I10M1I3M2I14M2D27M3D4M1I5M1I1M2D3M2D17M1D3M2D8M4D3M1D15M1D10M5I2M2I3M2I1M2I8M1D6M2D2M3D6M4D2M6D2M1D3M3I5M1D3M1D1M1D2M2D14M3D2M1D1M1D9M2D1M1D4M6D6M1D1M1D4M2D5M1D1M1D11M3D11M2D2M1D3M3I6M2D18M1I8M4D5M2I1M1I13M1I7M1I3M1I7M3I8M1D1M1D2M1D9M5D8M2I2M1I7M2I2M1D2M1I27M2I8M1I6M1I3M1I9M1I6M1I4M7I4M1I5M1I7M3I3M1I10M1D8M1D3M1D5M2I2M1I2M4D5M4I3M1I1M2I6M2D5M3D3M4D20M1D6M2I19M5D7M1I2M2I4M1I6M3I21M1I2M1I5M2I8M1I10M2D3M1I12M4I9M1D7M3D2M1D1M1D3M1D3M2D5M1D3M2I5M7D3M5D6M2I10M2D8M4D8M1I5M1I4M2D13M2D7M1I25M3I4M4D6M6D5M2D5M2D5M3I3M1I2M2I12M4D7M2D3M2I6M1D2M1D14M2D6M3I3M3I1M1I5M1I7M1I2M1D5M1D4M1D9M1D18M3D10M1D21M2I1M2I2M1D5M6D2M1D5M9D20M6D1M3D7M1D11M1I2M2D2M1D8M1D8M2I5M2D7M2D6M2D1M3D22M1D9M1D1M2D6M1I6M2D28M3I6M1I19M2D2M1D2M1D2M1D4M4D5M2D15M1D9M1D6M1D2M1I15M11D1M1D7M1D2M1I2M2D5M2D10M1D4M3D3M2D8M3D3M1I4M2D4M2D1M2D9M1D1M3I8M1D9M2D2M1D5M5D5M1D10M1I10M1D8M1D7M3D9M1D8M7D3M1D9M4D7M3D6M1I8M8D7M2I5M3I18M4I2M3D24M3D3M4D11M3D2M1I6M1I8M3D2M1D2M1D9M1I5M1D8M1D5M5D6M1I4M2I2M1I4M7I4M2D4M3D11M3D21M5D5M1D11M1I6M1D4M1I6M2I7M1D3M1D4M1I10M3D9M1D3M2D3M1D1M1D6M2D6M2D1M2D12M1I4M1I23M1D26M2D5M5D3M2D3M1D16M1D2M10D1M1D4M1D5M3D11M1D5M4D2M2D2M1D2M6D2M2D12M1D6M1D5M1D3M1D5M1D1M1D12M2D6M1D3M3D2M2D1M2D9M1D4M2I3M2D9M1I19M1D11M2D2M2D1M3D7M3I8M3D6M1D10M2D26M2D4M1D2M5D1M1D6M2D29M1D4M3D9M2D4M2D59M2D2M1I3M1D1M2D3M1D15M3D4M2D5M2I22M1I6M2D6M1I13M2D20M2D12M1I7M1D4M1D12M2D4M11D6M2D1M1D4M1I3M1D7M6D5M2D2M1D6M3D1M2D3M1D7M1I1M1I2M1D3M3D4M1I1M2D2M1D2M1D8M3D1M1D36M1D14M1D16M3617S	*	0	0	CTTCTATGCGGTCTGGCATGTAATTGAATGAGAGACAATTTCCACGGTATCTAAGCACTAGGATAACCGAATAGAGGGTTTCCTATCGCGCATGTTAATTATAGTTGCCGGCATATGTTGACAGACTATTTGTATTAAAGCCATATTGGCTGGGTTGACTATTCCATGAAGGCAAATATCCAATCAAGAGCTCCGACGAGGTTAAAGTAATTCTGGCTAGCCGGCCCCATCTAAGATAATGCCATGAGATAGCAAGAATTTTAATGGTTTGTAGGAAAGTGCTCCAATCCATCCAGCAAGGTTGGCTCTTAGCGGGTTTTTGACGTCACCCTAAGGTACGGCCAACACATTGAGCAAGAATCTTCATCGATTTGGGGAAGTCACTCCGAGTAAAGCCGCTCACTCCATTGAATTATGAAGAATGGTTTTATGCGACTTACCGCATAAAAGGAAGACATAAGCTCAATAAACCTGTCTGTTTATGGGTCTATCCCTGACTCGTAGCCTGCACGTGAGCTCCAACTTATTTGGTTATTCATAAATCGATGGAAAAGACTTTTCTCTTTACCAAACAAATGACAAGAGTCTGGTCCCAGACAATCGCTCTAAAGTCGATGCCATATCAGGACAGCCCAAGACGAATCATTGGGATTCCCATCTTTGTTGGGACACATTGGTTTAATCAGAACTTTCGGGCCACCGCTCCCGTAGCACAGATTTAATCGGGAAAGGAAGTGTCATTAAGCATTATTGGGAGAGAGGGTCATGAGGTGACAACGGAGGAGTCGGCCGCTAAGTCTGCCATCCGGTCATGAAACAACGGTGAGGACCAGAAGCCAAGCTACGTATTGCGGCGATATTAAAGATTAGGGGCAACATATCCAGGAGCTTTTGAGTCATCAGGCTATAATCATGAAGCCAATTTAAAAGCAGTAAAGGTTGCCAAGAGTACTTTATGAGTCCTCAATTTTCATTAGCCGTGAAAGATGAGGATATTTTAACAGAACATTAACCAAAGGCGCTCTCGGACAACAATAAGTATATCTTAGCACTTAGTACAGGCTATATAAGAGCGACTTGCCCAAGAATGAAAGTATACTGGAAGTTTAGGCAAATAGCAAATTAAGGCATTATTATGAGACATCCAGGCTGCCTTAGTGTTGATAGTAATAATTCCTTACTAGTTGGCCCATTTGCTATCTCCTTTCCCCTCATTCCTGGTGTTTTCTTTGCATAACGCGATATGTCTTGGGGACATGTCATGTAGTGCAGGACCATGATTGCAATCCTGATTGCTGCCTTGACGTTTCTAATCGAAGAGCAGAGCCGACGCCTCCCGCCATTAGAGAGAGGTGGGCTGACATCGGTAATTATTGTCCTCTCCTTAGTTTGTTGCTATGCCTTTGTTAGTATGCTTCTTCCCATAGCATAAAGCGGGGCCTGATACGCACTCCTAACCAATCCCTCTGCATCGTCCTTCATATGCATCCTTGTTTCCAACTAGCTTTACCGAGACAGACCTGAAGCCGACGCCTCGCCATTCTTCACCATCCGCGACACCATAACCAATTATGTTATTATGAGGACAACAATAGATACACTCGCTCACATTAAATCTCACTAATCTAAACCTAATCATAGTCATAAACATACAGATAAGTAACGGTGATAATCTATCGCTGTGTAGACATACACTGGCTAGTACTGACTATGAGCACGATAGAACGCTGACATGAAGCTCTAACTTGCCCTGTCGAACGACCAGGGCAGCATTCAGCAGCACTTTGGCTGTGGACCGAAACGAAGCATGCCGTAAGTGCGATTGCATTAGACTTACAAGTGCTTGGCAGCGGGGTTTTCTGGTTCACTACAACTGCCCACCACGCTACACTGACACGAGAAGCCAGATACGTAGAGCACACGCGACTGCGCAGAGAAACAGGCTCAATGAAAGCATAAATCCCTGTCTGTTGGGGGACGGCAAAACCGTAGTTACACCGCCTTCTCGGATGCGCAATGGAAATCACGATAGAAAGCGCAGCTAAATCCGATAGCTTACAGTGCTGGCTGAATACCACAAACATGAGATTGAAAGCAACCTGCAACGTATTAGGCCGATCAAGATGACAGCAAGGCTGGCGACACAGCAAGCCTTGAGATGCACCCGGCAAATCAGGAAAATGAGGTACTTAAAATTACTTAATATCCTGCTTTATCAGACTTATGGATCGCTGGCAACAGGCATTCAATTCTTTAAATAATAATAGAAGCTCTGCTTTCCACTTCCATCGGGAAAGTTGTTTGGACATAAGCTCTCATCCACCTTATGGCATTGTTTGTAACCTATGTCAATCACTTCCTGCACAATCAAAATACCCAGCTATTGCTCTTCTGACACTATTTTGAATTACTGATCGCATTTATGTTCATCTTAATGCCGATTTTCTGTACCTTAAACCTTATCTGGCGCCTGGCATAGCTGACATCGCATTAAGCTGCTTTAGGCGACTGCGCCAAATAAGCACGAAAACATGCCACATGAGGAATACCGATCCATCGCTATTCAGGCCAGGTTATCGGCTGTAAAGCAGAAGTCCAACCATAACGATCATAGACGTTCTCTCCGAGTCTATGCTGAGCTCGTTAGAATAACGAGTACAATGCCATTTCTATAGCCATCAAAACTTAGCGGTTGTAATAGGTTGACCGATTTAATCAAGAGCCGATAAAGAGACTTATTGAGCACATCTTTACCGCAATGCCTATTGTTAATAGAGAATTTACCGATTCGAACGCATCTAACGCTTATGGAACAGACCCACTATCGTACCCTACTGACTAATCGGACTTGTAAACAATTTCGGACGATGCAATGGATCAAGCTGCAATGAGGATTAAGTGCCTGAAGAACTTTCCGTAATGGAAGGGGAAATATGTTAATAAATGGGCAGTGAACACTATTGCCAGAAGTGGGCAAACAGAACAACAAAGCTGCTGATGGCCTTTATTTGGCATAAATAACAGAATAAACACTGCACTGTGTATTCATTCCAACGAGTGAATACACGTTAAGTGTGCTCTATCTAAACAGGGGCCTGTTGATTGGTTTGGAAATCTTCTTTGCCCTCTGAGTGTGGTAAGAATTTATCTTAGAGTCTGAACAGATGTCGACCGTAAATACATCATTGATGTAAGGTGGAAGCATCAATAGAGTGCAATGATATGATCAGGGAAAAACAGATCTATTTCTGGTCCTGACTATCACGCTCAAACTAGCCTTATGTAATCGTATTAATCATGCTGACGCAACATGCTCTGCTTAGCATTTCAAGCGACTTAATGCATATGGTGTTGAATTCTGTGAATGATGGAAATGGTCAGGACAGTATCTAGCCATCCTTAGCGAAGGAATAAGGGGTTACCGATACATCTCACTAGGAGGCTCTTGGTCGTAAAATAAGTATGATACCAGCACGCTATTAAATTTCTCCGCTGGGGCCTCGCTTCACTCGAGGCCCGAATTTCGTCCTTATAAATAGGATGAAGCCTAAATTAGATGTCTGCTGGCTGCTTTTATTCCAAATTTACTGTAGCCGATACGTAATCATGATGCCTATTAGCTTATGAAATAAGGTCTGGCTAAATGGTAAAGCGGAATTACAAGATGGATCTATACTAAACCTCATTCTCCCACTCTAGGTTAGCTCCACTTTGCCTGTATCCAGCTCCGATGTTCTGCCTCGTCCTACCTGCCCTGACAGAACTTAAACTGAGACTGGCAGAACCCTCAGCATTGTCTAACCGCCTTTCATCTAATGTTTTAAAATGGACGGGGCAATTGTTCTAGTATGAGCACGAGGTATTTGCCCTAAGGTCGAATTTGCTATAAGTAGGCTTATTACATTGCCAGTGGTTACAAAACCGACTGCACGTGCTCGCTAAAGCCCGTGCAGAGAAGGGAGCCAGAACGAGCATAGGCAGGACGGACAGATCGCATAGACTTTCGATCGCTATGCCACTAGTACCTTTAAGGACGAACACAGCGCCTATAAGTGCACTTACCGCATTCGTTCTGGCGGCTCGGATGTTGCGTGCTCGAAGCAACCATACGATACAGATCAGTCCATGAAATTAGCTAAGTGGGTCCATAAGCCGACTCCGATGAGTGGTAATAGGACTCAATGGATAGGCAGCTCATGATCGGCTGGTTAAACGTCATGTCACTCCACAGGAATATGCCCCTGGTCACCAAGGCGATTTACAGACTTAGAGCGTAAGCAAGTTCACTCCCATTAAATGGTTTACATCAGAATCGCTCATGCTATCCAGTCTGGCGCGCGTTACTAGGTTTGTAATAACCAGAGTGGCATCGTTTAGTGAATTTATGAGTCATTGCCGAATATAGGGCAAACCGACAGTTGGAGTAATTGTCAGCAAAATGAGTCTATCCTTACAGGTTGATTATGGTCCACGCGGGCCAACATCGTAATACGATTAGTTGGCCGGTGCTGCTGAGTGCGCATACATTCGACCCGGGGCGAAGGGAAGATCATTACCAAATTATGGCATCCGAAAACAAATGTCAGGTCATAATAGGACCGTCACATTACAGTGTCTCGTCGAGTTGTAGTATCTATGACAGGGTGGAGCCGAAGTAGCGGTTGGGCAAGGTACAGCTGCGGGTCAGCCCATGAGACATCTAAATTACCATGAATAATCGAGGGATGTAACACTTAATCTTACAGCCTGAAATAGCTATCTTGCCCACTGGCGGGATCGGCGACTGTTCGCACTGCGGCGTGCTAACCGTCAAACTTAGCACCAAGCGGCCCTCTTGGGTTGAAGATAAGCAGGCCAAACCAATGAGAGCGCTGGCTAGCACTTATCCTTAGATTATAGAGCTTAATGCCTCTTCCAACGCTGAAGCATATTAATTATGGGCTACGAAAATTAAAGCTGGGCTTGCTGGCGCTTCCATGTCGCTATTGAAAACCGATAAAGGCAGAAATTAATCTATGAGAGTGTCGCGTCGGGGCATGTGCTCAATGTTGCCGGCTGTGGCTGGAGCGTGGCTACTAAGCGCTCATGGAGAGCTAATCACAGAGCTAGAGCGTAAATGTTTTCAAGATCCTCACCTTTAATAGTGGATGTCACTATGAGTATTATGAGTTAAACTACAGCGGGCTAGTATGTAATTATAAGGTGCTCGATATGTTATTAAACGAGCTACGTTACATGGCAATGCGCGTTGTATAGGGGTCAACCGAGTCAAGCCGTATTTCAAGAGAGCGGGGATAGTCGGCTCGGTATAAAGTAGGGGTATGGCGGCGGCGTAAAGCATGTGATGACAGCAGGGGCGACGGTATTAAATATTTAAAATAGTAGGGTGGCAACAATTAAGGCCGGTAAATGGTCGGTCATTGGGACAAGAGCGCGTGCAAAGTCCTAACCAGAGTTAGGGATGGTTAAAGAATTGAAGATGAGAGCTGGCGCCCGACTCCCTGAGCAATTAAAGTTTGTGGTCGGGGCACCAATACAGTGGCGATAACATATAGTATGCATAAGGTAACGCGCATACCTTTCGTCTACCGTGCCATAGCGGCTGGAAAGCCTTTAGTATTTGGCAGTGGCGCACCACAGCGGCTGAATAGGAAGCCTCCGGACCGACCCGCGCTGTAGAGCGTATTCTGTTTAATTAAATGAGATATGCGAGAGCAAAGCTTTAATAGGTTGAAGTCAATTCGACCGTGAACCGCAACCGAGCAGCCAGGGGTTCTAACGTTAGCCCTTAAGGTTCTAGAAAAGGCGAGTCAACCGAAAGCGAGCAAGATGAGGCAACCAAATACTATAGAGTGCGTCTGGCTCGCATGAGCTTCATGTCATGTGTATGGTTACATAGTAGATGTTTAATATAGGCGATAACATAGGTCCGGATAAAGTCACCGTCCACCCACGTGGCGTACCGACATAGCATAAAAGTTCTCAGCCTCTAGCTCTTTAATATAGCTGTTGCTAGTGGGTTGGCGCAACATAGAGTATGAACTGACACAATGGATTCAGCGGTGATAGGCTTTAGGCTGGCATGATCACATGTTAGCCGTTATTGTAAGGGGTAAACATAGGCTAAGCGAGGACTTAAGCCGCATAGGCATGGGACTGAATGTTATTGACATTGCCCATTACTAAGCTATCTGCTCAAGCCGTCAAGGATACTGCAAGGGCATACAGCTTAACTTATTAAACCGTAACCAATAGAGGATCGACAGATAGCACGACGCTAGGTTAGGTAAATGGCCAGGGTAACTTATTAGATAAAATTGTAGGTGTGAAAGTTAGACCAAAAGTGAACGCAAGCTACATGGTCGTTTAAAGAGTGTGTCCTATTGTTAAGTGTAGGGAGAATGGCTGTAAAGTAACCGATTTGGCAAGTAAAACGCATATCCTGGAGGTGATTCCGGGCTCAGCAGCGGGGTTGGGCACTATGGGGATTTGACAGAGACCTTTCCATGAGTATTAGCCTAAGCCAGTTATTGGGCTGTAGTAGATAGTAGGGAGAGGTGGCCATCAGGTAGGCCGCTACCGGAGTACCAGGGTTGCTATAGGTAATGAGAAATGTTTTAATGTGGCATCGAGCGGGCGCTCAGCAGCGAGGTCGGGCTAGAGTAGGAAGGTTGTAACAGGTCGAGGCCTAGCGTTATTGTGAGTAGGCGGCAACGCAGTTAATATTGCCAAGGGGTACGTACCGTTATTGTTGTTTAGTAAAGTACTGGAGCTCCTGTTGACAGCTAGGTCCATGGGGGCGCGCGTCTGCCAGTGCCTATCCATACATAATAGCGTTAATATAGTAGACTATGTACGCAACTATGCTAAGGATGCGTGATAGTGATGATAACATTCGATGGCATGGTGACAACTTATTAGAGACGTAATGTCTACTACTATAAATGAGGCTTTGTGTGTCAACAGGTAAT	*	tp:A:P	cm:i:18	s1:i:141	s2:i:0	NM:i:1150	ms:i:374	AS:i:198	nn:i:0
+35	16	utg000001l	24388	60	12S15M3I4M2I14M1I2M1D3M2I10M1D4M1D26M1D23M1I8M1I10M1D9M1I8M1I6M1D6M1I4M1D4M2I7M3I7M1I2M1D13M2I10M2I8M2I6M5I7M2D6M2D4M2D4M1D1M3D3M1D7M2I7M3I6M1I6M1I1M2I4M1D7M1I9M1I7M1I2M1I7M1I8M2D2M2D4M2I10M2D12M1I7M1D8M1D1M2D35M1D13M2I10M1D9M1D2M2I11M1D3M3I4M2D3M1I3M3I2M1I29M3D5M2I8M1I18M7I9M2D1M1D6M2D4M2D1M1D11M1D35M1D18M3D7M1I15M1D34M2I5M2I9M5I1M3I2M5I3M2I8M1I5M2I1M1I4M3I2M2D5M1D12M1D11M3D7M1D1M1D10M2I21M1D6M2I15M1D8M1D32M1I36M2D3M1D1M1D11M2I4M2I11M1I4M3I3M2D2M1I8M1D8M1I17M1D3M2I4M2I15M2D5M2D7M7I4M2D1M1I9M2I7M2D11M3I3M2I10M4I10M5D1M1D6M1I6M3D1M1D8M1I2M2I10M3D11M3I2M1D7M2I6M2I7M2D2M1D3M2I14M1I17M1I11M2I13M1I15M2I5M1I1M2I2M1D4M4D2M1I21M3I4M4I3M2I3M2I4M1D7M1D15M1D4M1I10M4I2M5I4M2I9M1D6M1I2M3D5M1D7M2I2M1I7M2I10M1D4M2D5M2I5M1I1M2I5M2I5M1I27M1D8M2I3M2I7M4I4M1I1M1I6M1D5M1I5M3D4M1D17M1I14M1D24M1I2M2D6M1I6M4D2M1I10M1D5M2D11M1D2M1D10M1I6M1I6M2I6M1D3M1D6M2D24M1I5M2D21M1D6M2D2M1D11M2I10M1D10M2D2M1D8M1D4M1D13M1D10M1D5M2D4M1D36M1D13M3I9M2D9M1I7M5I6M1D9M1D2M2I13M1D6M1I1M3I6M1D9M2D9M2I6M4D6M2I2M2I1M1I2M1I5M2I4M1I9M2I3M1D11M1I2M2D23M2I4M2I3M1I5M3D9M4D12M1D5M1D3M3I6M3I9M3I8M1D6M2D3M2I4M4D15M5I4M2I4M1D4M1I6M2D6M1D5M4I6M1D11M2I13M2D13M1D4M1D7M3D13M1I3M1I6M1D4M2D13M1D10M1D4M1D8M2I11M4D3M1I1M2I9M5I6M2I12M1I1M4I27M1I17M3I1M1I1M2I18M4I9M2D5M2I1M2I4M1D2M2I4M3D5M7I11M1D6M1D6M1D3M3I7M1D4M1I4M3D2M1I25M2I2M2I20M1I8M1D14M1I8M2I1M3I3M2I6M3D2M1D6M1I7M1I3M3I17M3I13M1I9M1D24M3I11M2I6M1D4M2I4M5D11M7D3M1I10M8D4M1I14M2I9M4I4M1I3M4I7M1D3M1I32M1D7M2D15M2I16M3D9M2D4M2I5M2D5M1D7M2I7M1I16M2I7M1I7M1I3M1I15M1I2M2I2M1I8M4D2M1D4M4D6M1I14M1D14M5I3M1I10M3I12M1D12M4I3M4I16M3I3M5I4M1I12M1D3M4I7M1D19M1I6M3I6M2I2M5I3M1D6M3D7M1D17M5D7M1I5M2D20M2I16M4I5M1I14M2D2M1D8M1D7M1I8M3D17M2I20M2D21M1D14M1D5M1D7M2D3M3D15M1D7M1D21M4D9M1D2M1D5M2I7M1I3M1I5M2D12M1I17M1D37M4D5M1D5M2I11M2D11M1I12M4I15M1D1M2I6M1I18M1D10M1I4M2I2M1D3M2D6M2I1M1I5M2D4M3I1M1I9M4D6M10I22M1D2M1D3M6D10M3D5M2I2M1I23M1I10M1D8M1D5M1I3M4D3M2D3M1D5M1D30M1I10M1D6M2I6M1D16M1D10M2I3M2D15M1I15M2D1M1D2M2D2M1D3M1I8M1D1M2D1M1D4M1D12M1D8M1I6M2I8M9I11M1D3M1D9M5I12M1I3M1I1M2I5M1D14M1I6M2I9M1D2M1D4M1D6M2D15M1I19M1D1M2D20M5I2M2I1M1I7M1I5M1I9M1I15M2I24M1I11M1I5M1I5M1D6M1D10M4I15M2I8M1I1M1I21M1I6M9I9M1I51M346S	*	0	0	CGTCTCATATTTAACTGAATCATCTATTACTATTACAAACCAGAAAGACGTATCGTACCGCTAATACGTAAAAGATTACGAATTATTACATGCCTTAGTAATCTATGGCAGAATGTATAACTTGCTGTAACCTCTTGGCATCACAACTAACAATCCAATGGGTGACATGTAAGTTCGCAACATATCATTCTTAGGTAATTCTATCGATGAAGCCAGGAGAATAACTTATGTTAAAATTAAAAAGATTACTCCATAAGCACTATCTTTAAGCAGAGGAAGAGAAGCCAATTCCGAGCGAAGAGTAGGAAGAGCGAATTAAAACTGGTAGATAAGCCCTAAAATATCACTTCGACAGAAGAGTGTTATGATTATACAGCAGTGCAGAAACGACTTTTAAAGGACGGTTACCATTCAAACATTAATTTATGATAACATTCCAGCCACTTGGATTTAATAATACAACATTTGATCAGCCAGTACGCCTCTCTTTGGGTTTGGGCGAAAGTAGCGGACATAACAAAATGCCTATGGCTTCATTTGGGATAGAGCTATGGCTGAGAAAAGCAAGCATCTACTCAACCAAACATAACCAATGCCATTATAAGTAAAAGATTTCAGTAATTGGAATTGATTCAAATAATAATCAAATGTATTCATGGAAAATAGTTAGAACGAAGAAAAGCGACTTTAGAAATATCAACAGCAGACTCAAACATGACGAAAAACAAGTGTTCGGTTGCGTTCATGGCGGTCTTGATTTCGGACCTGCATTTGAGCGGTGATGTAAACACTATGAACATTGAGTCATAGAACTTCCATTATTCTCCCGACATAATAATCGCCAAATAAACCAATACTCAGCTTACAATGTATTAACTAACCGCAGAACGTTATTCATACAACGTTTCTGCGGCATATCACAAACGATTACTCCAACACTAGGACAGCAGGCCATCAATATCAGTGCAGTTGATGTATCAACACGGTTCAGCAACACCCGATACTTCTTCCAGGCTTCAGCAACGAGGTTTCTTCCTTCGTTGCATTTCCAGACCCTGCAGCAGGCGGAAGCGGAAGGCGCAAGAGGGGATGGAGGCTGCAGGAATGTCGTTTCTTCCCCTCCCAGGGATCCGGGACCAGTTCTGCTTCATCCTTCACCCAGGCTGTGCCGTTCCACTTCTGATATTCCCTCCCGGCGATAACCAGGTAAAATTTTCTACAAAACATAACCGAGTCGAAATAATAAATAACGCGTCGCCGGAAGCCACGTCAGTGACGGTTTGTACCCCCGATGGTCTTCAACGAGATGCCACGTTTCCCCTCTAGCTCCTGTGCGACCCTCCCATCCCTGCCGGAATCTTCTCTGAGTGCATGGTACGTGATGTTTGCAGGCAGACGGTATGGAGGCGGAATATGCGTCCTCTTCACCAATAAATTCATTAGTGGGGTTTAAGTAAGCATTATAAATTTATGGTCGTGGTTGTTCACTCATTCTGAATGCCATTATGCAAGCCTCACAATAGAGTTAAATGCAATGTTTGACGGTATTTCTCGTTACCGCCGATCAGAATTTAACAACGTGATGGTGTCGTCTCGAACCACTGAAGAATGGGCATGAGCACCGATAACAACCGGATGCTGGTGCGCACCAATACCAACTGTATGCGCAGTGTGCATAGGGCACTCACGGCTTAAGGGACAATGATGACTGTGGCTGCCCTGACATGTCCGTTTTCGATAAATAAGCAACCCTGTGCTGGTCCTTTAACTGTGGATAACTTCCTGTAATGGTTGCTGTTCATACTCTCAGCCAGAACTTCATTCATCCTTAACCACTTGTGCTGAGCACCCGGCCCCTGTTGAACCGCTCAGACTGTGAGCATGAGCCCCGTGTTATTCGTGGATTTGGTGCCGTAATCGAAACTGCCTGTTGTTCGGTGCGAGCCCAATAGAAACGACGATGGCCCCATTGCGTGCGAAATTAGAGCAGGGGATGAGATCGGCACTGTGGGCTGTGCATGTAATTCCATCCTGTTCCTGAGACAACCACAGCAACGACCGCTGGCGGGTTTCCTTGATTGTCCCTACGCATATCAGGAAGCACCCGATGGATACGCGACAGCAATATTTGGGTAGGCTGATTTGTCCAACGCCTGCGCTGCATCCACGCTGGTAGACGCACGAGCGCGGCTGGTATCGGATTCGGGGAGCATGCCGGAAGGCCCGAATTCTACGGCCCCAAGGAGCCTTCAAGAACATGCAACGAATTAGGGTTTCAGAATATCCCTGCCTCAACCTGAGTCAGCGTTAAGGCTGGCGCATCATTTGCGCAAATACGGTAATTTATTTTTCGCGTGGAAGCCCTGCCATAGCGTTCAGTATTCATGCATTCTTCGGTTGTTTACCCCTGATTTAGTCATGGTGGTAGCAAATCTGGATCATTCCCGAGCGCTGCGGCCAGTTCATTCAGCGTATTCGGTTGGGTCAGTAGACGCGTTAGCTGATAACATCTGCAATACCGGCGTATCACAAAAGCGGTCGCAATCGTATTGTTTGTTCCCTAGGGAGCGCGGTTGGTGCTTGTTGGGGTCACCTTCCGTAGCGGACTGTCCAGTCTCATTCTGTTCGTTTCATCCATTACCACCTTAACACCGCTTTGGCGTTGCAGCAAGCGTTTCGACGTGCTGTTGGTGCTATGCACGGTGAGCTGCACTATCCCTTCGTTGTCCCGGTACTCTAAGCGCGACAGCTCTGAAGCCTATATCTTCTGCACGTTTTGCCGAATTTGCACGTATTGCCGCCGCTTCTTACGAATGGCACCTGGAGGCGCGCGATGGAGCACCGCACTGCCCCGTCTGCCTTCTGGAGGCATCCCAGTGACGCAGCCGCCCTGTTGCCGTCTGCCGCTCCGGTGCCGCGCATATAGCCCCGTTGGCTGCTGTTTCAGATGACCTGCATTCGTCTGGACGTAGTTGCCGCCCTGGCAGGGTTCCTTCCGTTGCCGGAATCCCCTGCGACCCCTCCCATCTGATGCGTTTCTTTCCTTCCTCCTGCTTCGCTGCCTCTTTGCGGCTAGCCCGCATCTCGCCTTCGAGTGGCTAACGTCTAGCGTCGTGACGCCCCCTATCGTGAGCAGAACTTGAGGCCCTGATGATTGTTGTGACGCATGAGGCAGCATTCGTTTCTGACGTTCCGCTTAACCGGCACCACGACTGGCCCTCGCCGCGTTTTTGAGGACTCTGCGGCTCGGTGCTCACTTTTCCCTTCAATGGCCTTTGCTGATGCCGCCCTTCTTAGCCGGAGGACGGTTCCTGAGCTGACGATGCAGCCTGTCCGGCGACGTGCTTGGCGGCGTGCTGAGTCAGTTGCATACCAGTTATAAGATACACGTTGGGCCTGGAGCAGCTGATGCAACGGCATCGCCGGCTGATTTTCTTCGCTGCCGTACTCTGTGCCAGACTACAGACGCGTTACGCGCCCTCTTCCACCATCAGTTCTAACGACGCAGCAGCTCGGCCGGCATCATCCTCGTCATGGCACAGAGAAATCATTCAGCGTCCCGGTTGTGAATTTCATACACGTATAGTTGGCGGTGCGGGTCGATGGGAAAACCGTCAACCCTGCAGGATGACATTGATTGACCGTACTCCACATCCATGCTGTAACGCCCGGCTTCATCGGATTCTCTGAGCCACCGTTCACCACCACCCGTGGTAGTGTCCTATAATTCTGGCTTTCACTATGAATGTATTAAGTTTCTGTACCGGTTTTCCTGTGCCGTCGGTTACAATTCCTAGGCAAATCTACTCGGTAGAGAGCGTTCACAAAAGAATCTCCGGCGCATTGATCCCCCTCGCTGTATTCGCTGGCTAATCATTTAACTATAACGACCCAGACGATGAACTGCGTTAAGTACGCCGCCGGTACGCCTTACGGTTCAAGGACATGACAACGACGGACGCTGCCGGATTAATCTGTTACCTGCACTCCACGCCACACTGAGTATGCCGCATTGCACTTCGTGCCTGGCAGTGGTCGTCTCTTCATATACCGGGAGTGATTTCCGTGGAATCCCAATCCATCGACCCCGAATGCATGACGGTAGGCTCATGGCCGGTACGGACCCGACCTCATGACCTGCTTATGATTGACAAACTCAGTCGGTAGATGTACGGCTACATAACGTCACGCAGGCCGCCAGTGAAACGTGTATCCTCCAGGTCACTCTGTTGCTCTTTCTAACGCGGGCGACCCCAGGGAAGCCACCCCCACACTGTTAGGGAGCTTCAAGCAACTAAACGGTACTTCACGGTCAATCCCTTTCAGATGACTCACACCCCAGTATCCCCGCAGGACAACGACGGCAATGTACCCGGTTTCTACTTGAAATAGCCACGTAAACGGTAGTACCATGTCACCCCCTTCGGACGGAGAGCGGAGTGACTGTCAACGCAAGGTGCGGCGGTGGAGCCAAAGACAGCAACGGCAATACACATTACGCATCGTTCACCTGGATGTTTATAATCAACGCCACCGTCGCTCGAACTGACTGTAAGCCCAACACTCACCAATCCTTACGGTAGCTGGGCATATTAGGCCTCCAGCGCCTGGGCTCCAAGAGAGACCCGCACATCGCTCAGGGAAACTTAGTACGGCCGAACTTCCGTTTCTCCTCGATTCGGCTTCGGCATCGTCGGGAGCCTTTCCCCTACCGCTTCTGGCATGTCAACATCGGAGAACACCTGTACATGCGTTCGCCGCTCAGCCATAATAAGCAGCACCGTTCATACCATCAGTACTTTCAGATAACACAGCCATCGTGCCTTGACATAGTAAATTACGCTTACTTCCGCGAAACGTCAGCGGAAGCAGGTTAAC	*	tp:A:P	cm:i:37	s1:i:399	s2:i:0	NM:i:1388	ms:i:1358	AS:i:1358	nn:i:0
+36	4	*	0	0	*	*	0	0	CGTCGAAAACCTTCGAGACCCAACACATGTAGTTTCGAGCAGCCTCGGTTCTACGAGACTAGACTATTTTACTGTCAAAGCGTCCTTATAGCTGGAAGTACAACGCCGCGAAATGACAGGTGTTAAAGTCCGTCGACCCGCGGTGGCTCCCATGCCTGGGTCGAGGGGCGGAATGAAAGATCATTCGACGGTCAAAGCGTCAAACATTCCATTATGGCTTGACATTTTCGCCCCAGCGGAGCCCATTGCTGATACCGGCATAAATCGTAAACGCAGGAAAAGAGTTTGACGCTGCTCGCCCGTATGGGTGGCGGCCACGTACAGGCCCTAGCTGGGCATGCAGCGCCGTCATATGTAAAATCGTTTCAGAAAGGGATGTTCTTTTAATCAAAAATGAGAACGAAAGTGTTGCCGGTGCCGCGGCTGATGAACTAAAAGGAATGGGATGGTCAGTCGTATAGTCACACTCCTGACGTACCATGAAAACCGTAATCTTATTCAACAGGTAAACGGTACTGTCACGGTTCTTGGCGCAACGGTTTCAAAACTTACGTGAAGTTAACATAAAACGGCGAAGTTAACCGGCCTCAGAGATTCCTTCAGGCACGGGCGTATAGGAAACGCACTCATCGGCGTATCGCGTAGGGTGTGATGCGGTCAATCCACCGTCAAACCCCTACGTCATTCTATGCGCCGAACGTCGACCGTCCCGTTCCCCCTGGGGCAACGCGCCCCATCGCCAAGGGCTTCGAAGTGGACTCGGACAAACCCACATTAGCTGTTGATCTTCCTGAACGCGATCAGGTGATGCTAAGCGATGAAACGTCCACAAATAGACCGTCCGGCTATGGTCACCCGTAACGGCCGATACATGGGGCCGCTTTATTACGACAATGACAAAGAGCGACGTTTCAAAACAGTCCCTATCTACGGAATACGTATGCGGCGCATATCCCGCCTCTAGGCCTGTTGTTTGCTGTAATCGTTGCTATCGTTCCGTCCCGACTCAATCTTGCCGGTCCACAGAATGCCGTTGAAGCGGCTTATGCAGGATGACGCCTAGAAATAGCCGTACCCCTCCTGCTGAAATCGAAGTGCTCCGCAGTCATGACGGGCCCCGCGACCCCGTGCCCGTGTTCAGCCCTAACTGCGTTTAGGACCCAATGATTTGCCGTGTAACCTAGGCACGTTCTTTCATGCAGCTGGTTATTCTGTGAAATGCTCGTCGGGGCTTCATTATCCCGTATCAGGATAGTACGACGGCAGCAAAAGCGGCTCGGTTGCGAACCGGATGGTGATGCCCCAAACAGCGCTGAAACAGGACTATTATCAGACTGGTTCTAGATCACTCCGTCTCTTGCTTTTCCGTCGCATAGGCGTCGTGAGGTTTATCTACAAACATCAAGCGGAGCAATTCCAGCGTCATGTCAGCTGTTGAATATGGTTCCTACGATTTAGTGTGGTCTGGCCCCCGGGGCGGAGCTTCAAATGTTGCAACGTAATGAAAGTCGTGAGTATTAGCGGGTCGATGAACTTTCATGCCTTTACGTACCCGAACGAGCACGTCTTATCTGCGAAGTCTCCGCGGAACAAGGCGTCAGCTTACACGGCCGGCCGGCCAAAGTCCACTCCGTAGCCCAACGCCAAAGCTCACTAGGGTTGACGCCATGTTGGTTCATAGAATCTTCCCTCAAGCCGCGTACTGTTCGGCAGCGCTTCCAACTCTCACGGATCGGGGGTATGTCACCGTATTAACCTTCGTGACAAATAACTCCAGGTCGGCGCCAAATCGCACGGACGACGCTGTAAGATCCTGGTTCAGGTCTTCTGCGAGCATGCCTTCACCCGCCAGCACCTACTCACGACGGTGGGTTCATTTACCCGGTTCTATAGACCCGCGAAAGACTCCACGGACCACGCGATGGCATTTCGCGCCATATGCGTCCATCGGGACCCACGATTACGCCAACCTGACAGTTAGATTCATTCTGCCGTTAATCTAGTGGAAACCGCACTGATTACCGCCACCATGCGTTCAGATTAGCCAAAGACTGAACGAACGGATTACATGGGAAACAGGTTTATCCAAACAGTGCGGAGAAACACCAACTTTTATCCTGTGAGACGCGGTTCCGTTTGTTAACGGGGAGTTCGTCGACGTCATCCGGTTTCGCTTGACATAGGATGATGCATCATAGGAACAGCATACTGGCACCAGGGAAACTCAGTGCCATTCGACCGCTCTAGGGTCTAGTCGCCGCATGCTTAGATGGCTCCAAGGATTCCCAGGTGGAATCCATCGAATGCGCGGCTGGGGCGGATGCGGTCTGGAGGTATAGAACATGACTTGGCCCCATGAAAGCCCGGGCAGTACGCTCTGGAGTGCGCCACGACGATGAAAGAACGTGGCCTTACTCTTGCGCCTAGGTTTATGACCCAATAACAGCTTTGCCTGACGTCCCCGGCATTGAAAGTGCTGATACCCGGCTACGTCGCTCGGATTTCACTGGCTCTGACGGATACTAAGGAGCTGTGTATGAACGGGTCTGAAACAACTTAGCTTTGCGAGCCCGCGATTTCGCCGAGATGTTACGGACTGCGGCAACGCTGCGTTGTAGTCACGATCGAAAATGCCGGGGCCAGCATGCCACGGTACCCCAAAAAGAACGGGAGTGTTGTGCATTTGAAAGCTGCGGATTCATGTGATACGTTTTGTGAACAGTTTACAGAGATGAAATGGTTATTCGATTGAATCGCTTCCGCGACCGTGGTCAGTCCAACAATGCTTCCGGCACTGATGGGTAGGGTTCCAGCGACGACCAGCCACATCAGCTCAATCGAATTACGCTTGAACCTAGCCTCACGCATCAGACGCGGTAGCTAACAGATTATCCAGATAGAGATTTAAAAGTTCGCTAGTCATCTCACCGAAAACCAGGTTCTAGCAACCAATCCCACAAAACAGCGACATCCCAATAGCGTTGATTGGCGTCGGACCGCCGTTAGCCGCCCGTCGCGCCCCGGGCGCTGCGCATCAGGGAGGGTCTCCTTAGCGATCGTCCCACGGCGCCAGGGGTTGCTGGCGCTCAGCCACCGACGAGGATGGTGGACCAAACCAACACTGCGACGATTACTCTACTTCGAGGGCTAGCCGGAGAGGCGATAGAGCACTGACGGGTCAACAGCGACGACAAATCTAGCCGCTGCCATGTTCTGCCTGCAACAGTCTGCAGCTAACCTAGAAATGACAGCTCAAACGGGGCAAATATTCACAGAAAGGAACTGTCGTAAAATGAATGAGTTTAGTCGACGACGAAGCCATACGGGGTGGCGCCCTGAAAAAGAGCCCTGCATTCAGTCGGAAGGAGTGGGACTTTAACTTCTTGTCAACATGACGCATGTTAACCTGCAGATGTTGATTTATGGAGGGAAACGCCACAGATGCCACTGTCTCTTGCGCTCGAACTGCCATCTAAACAGGCATTTGACGGTGCGTATCCTTCGTGAATATGCTGGTTATCAATTGTAGGCATGATTTGGGTACGCACCTGGCTGGAATAGCCAGACCGTCTGAACCCGTGGGATGCACTCTTTGGCCCGCCCAAGTGGCCTTTTAGAAAGGCCGCCATCCGTTTCCGTCTGGACGATCTCTAGTACGGAAGAGAATAACGGCCCTCCCGCCCAAACGCGTTTACCTGCACTGACGACCATATTGTCGCTAGAGAGCGGCTCCTTATAGGCTTAACTCCAAGTCGGCTGGCTCTTTCCGTTGATCGAAATTCTATAGAAAACCAAGAAGAAGCCATGCGTAAACCTGCCTAGAGCTAACCGTCCACATGAACACTACTGCGTCGACCGCTGCTCGCATCTAACTAGTCGAAAATTAGAATACCGTCAGCAGTTGATTCGCACGTCAACAAACGGTGCTTTGCCATGTCAAATTCCATCCATCTAGCAAACCGGTGAACGGGCTGATGGTTGAGGCTTCAGATAGATCGGCTCGCTTTTCGTTCGGCCTTTCTTACAGGACAACAGTTCTCCACCCGACCTCTGTTCGAATGTACGCAATTTCGAAAGACCATCCGCTGACAGCGAACTGCTCCGCGCCGTGTGCAGATTAATTCGACATGCCGTGCAGCTGTTCGGTTAAGAGTATCCTTGAATAGAAATTCACGCCCTGTTCATAATACCTGCCCTCAACTCAACGGAGGACCTCAATACCCGTATACCCCGGGCCCCTTTCAGCCATTGACTATTTAATCGTAGGGTAGAACAGCGCATGGATTGCGAGGCGGTTCAAATGCCCCGTTGGACTGTCCAGGTCGCTATCAGTATTAAAGATGCTCATGAGCTAGGCGCTCGAAGGCTTCGACATGTGATTTCGATCTCGCATTCAACACGCATGAAGGCGCTCGCTGCATATAGCCACCCTAGCACCTATCGTTGCTTGGCCAGATGAGGTCCGAGCTGGCCAATGAACGGGTTTTACGTCAGGCATAGTCTTCAATACCGTTCTCTATAGCGCGAACAGTCAGGAGCTAAGGGGAATGACGGCTCCACGATCTGTCTAACAAATTTCGCCGGGCACTACGCCGCTTGCATGAGGTCGTGGGCTAGCGCAAAGGTCAGCATGATAGGGTATCGCCTGACTGCCCGTTCGAATTTGCCGGTCAACGCGTTGTTAATCGAGGGGACGTGTTATTCTGCTCATCGTCCCACTACATGCTGGGGCTGTCATGCAGATGCTGCCCGGTTGGCTAGCTCCGCCGGTAGGCAGCTCCCCGCGATGAATAGATGCCCAGTTGAGGCTAATCCAACAACTTCAAAAGCCTGTTACGTGCGGACAAACGAGCGCTTAGGGCGTACACCATGGCTCGCTGTCTGAAATTGCGCCGTGCCAATGCTTGATAGCGGTCCATAATGGGATTCTTTGTCTTGTTGTGCCTAGAAGGCTATGAATACCCTGTACCCTGACAGATGCGCCGACGAGCTAGCCCGCCAAATGGCGCTTGCCAGTACTCCCATAAATGCCCGCCATTGCCTGCTTAGGTGGAACTTTCAACTTCTGGATAGGTTATCCTGAGCGCCAGTGGGGTCTGATGAGTAGCCTTAAAAGAAGTTCATTAAACTAGCGATGCTAGTGTCAGCAATAGCACGACGTGGTCCATCGCTAAAGTCTGTGAAATTAGTCTGCAAAACTTTTATAACCAAGACGTTAGTTGACAAAACTCTTCAGCAGAGCTGGCGAACGACTTCGATGGGTCCCCGTCCGCATGGTCGTTGGAAGCGCCCATTATTTCTGCGCTATGGACTCCACGTGACGTGCGTTGCCAAAGCAACAGTGATTATCCCAACGTTCAACTTCAGGCACTGTTCGGTAATTGCCTTCCAACCAGTCCTGCCGTCAGTTCACGAGGCGTTCACGAGCTTAGATGGCGGCCGTTGCCTGAAGTTTGCTGCTGTGCGAGTTCCCTGTGCGGCCTGCTGCAGCCAGCCCGGGACGCGTTCAAAGGCACGGTAAATACGTAATGATGTCACCTCGATCCAGACAAAACGATTTGTGGAGCCCGTCTCGCCCCATCTTTGACTGCCCATGAGGGATTCCCTGTGCGACAGCTGGCATAGTTATTCCTTAGAGCCGCCGACTAACAGTACGCATGTACTCTAAGGTCCAGGTCACCGAAACGCACTGCCTGGCTGATGGTTTGTTGTCAACCCCGCTTTGGACGCGGCTTAGTCGCACCGTTAGAGTTGCGTACCAACTGTTACAACGGCATCGTTCGGCAGGCAGCACTGGGACACTGTCTCATTTGATCTAGGGTTTGGCGGACGTGACGGCACTCTGTTCATATGGAATTTTCAGCGTCGGTCAGCCTGTCTCGTCGACAGCGCTAAGACCCTCGTGTTGTAGTGCCTGCACAGGTTTTCCGATTCTTTTCGTGTTGTTCAAATTTAAAATGTTCAGTTCTTCTATCGCCAACGAACCATTAACTTTCTCTGCACCGTCTTGCAGTACCATGCTGCCGCCGGCCGTTCTTAACTCCTTCGTCCTATAGTCCCTGGTCAATAATTAACCCTTCATCTGACATGATCTCACTTGCTGGCCAGGTTTGTCCTGTTACAGTCTAATTAACGGTGGCCTTCTTTCGGTGAAACAGCCTTTGAATCACGGCGCAGCACCGTTTACGGTTACATCTAAGTAGCACATTCATCGTTGACTAGATAATCATCCTTGCAGGTCCAAATGTCGTCCTTTCTTATACGCAACCTCTTACGCTTAATCGACGCAATCTCACCATCTATCGCGGTATCAAGCTGGGACCATTGAGCGTAGCGCATCCCTAGATACATTTACAGTGCCGCGCGTCTCACCGTTGCAGTGCCCACATGTACCGAGCGTTAGCCATGTCTACTTTCAGACGCGATGAACTTGTGATCAACATGAGGACTTAACGGTTTCGTTGCACTCACCGTTTCGCTAGATGCAATCCACCCCAGCTTCAACCCCGGGCGGCTCACGACAGCCCCGATCTGCTCCGCCACCGTTATCGAATGACCAACAGGTAAGCGATCAACAACCGAGCTTCGACGCTTATGTACCACTTCAATTCGCAAGGCTTCAAAGGCTACTTGTCTAGCCGCCGACGTGCCAGGAGGACGCCAGGCTAAAACTGCCGCTGATGGCGCACCCGACGTGAACGGCCCCTACATTACACCGCGCATCTGAAGTTGCGCTCAATGGACCATGGTCTGGTTAATAGCTTCAGCCAATCCACAAATCGGGTAGAGGTGAGCCAAACAGCAACGCGTGACGAATTCACGTCTAACGGGCCTGATTGCAGAAAGACCATCGCGTTTGTTGAAATCTGAACGGATGCTTGGATCCCTGATACCCCATCGCAGCCAGCACCACAGCGAGTGCCGCACAAGGCGCATGACCAACAAGTCGCGTAGCAAGCCTGATGCAGCGGCGAGCAGCCACAGCGCTGGCTCCAAGCTGACGTAACCCGCCAAGTGGGATGCCGTTAACGATTTGCTGAACACAGTCGATTGATGTTTATGACGAGCAAAGAATCAACAGCTAGATATTTGCCGCTTAAGCTGACAGTGATTAGGGCTTGGATCAGTATTTGAAGGCAGCGGCCCCAACCGGCTGTTAACGAGTGCGCGACGAAATCCCCATTTCTTGCAAGGCACCCCGCTGTCGATGCTGAGCAAATATTTCGCTCAGCCGTACATGTTTGGGGATCCCTTCCATTACCCAAGGTAAATGAACCTGGCCTTATGCTATCGTCAATCTCGCGTGGCACTCCATGCTGCTCAACGACCATGATCACGGCGTCGACCAGCCAATAGCGTAACACTGCGTACCGTCGTGATCTCTGTCGTCCTAGCGGCTTGGCTTGCTCCTCCGTCATGTCAGAAACCGTGAGAAGCAAAACGAACTTCGGGTCGCGTTTACAAACGCAGGGCAAGAGCGCATAGCCGAGCGACCTGCGCTTTCGATGAGCACATCATGTTAAAGGGTTCGTCGGCGCGCGCCGTCGGCGTACGCGACTGTGGCGCTGATGAGCAACAAATGCCATAACCGCGTGGGTGGCAAATGAGCAGTATGAACATGTACGTCGACCGCCGGAGGGCTTCGCGCTGCCTCCCCTGAGCGAGAGCTCGGTGGCGATAATTGGGTCAAAGCAAGTCGAGTTCGGCAACTCCGTCAACGGTAAACCAAGCGAGCGGCGCTGACCCATCGCTTGATTAGATCTCTAGAGTGCTCCTAGGCTGGTTTCCGGCAAAACAAAACCTACGCTTCGGATATGCTTTTAAGAAGCCGACATGATCGAATTAACGCATGCGGTTTAATACGTGTCTGTTCCACGCATTATGCCTGCCGCGGGATGAACACCGCATACCGCGGCACCCGGCCCTTACCGCCGCTTTCAGCATCCGAGTTAAGCCATGGCCAAACTCGTGCTGACGAAGGTCGTTTGCTCAGTTGAATTCATACTCGGCATCTGCAGTCTTCTGCGATGGTTATGCAGGGACAAATACAGAGCGAAGGGGACCGCGCTCGCATTTCATCGTCGTCACTGATGGATGATGTCAGAATAAAGAACCCAACTTCACGGTCCTTTAACCCTAGTTTTAGGTCTAGACCGTTCATGACAAGGCAGATGATAATTAGATCAGACAGTGAAGTTCAACGTCATCGGACCGGACGCGTGACATTCTGTCATAGGCGTTATGTTCAACCTTCGGTTTTCAGGAGTACGCTGGTACTGAAAGGTCCTGGCGCTGTAGCCCAAGTGAGTTTTATTTCGGTGCAACCGCCGGCTAATAGGACAGTGCCGGATACATCAGAATGTTGACCTGTCATGCATCCCGGCTTTCGATGTAAACCTTGAACAGACCTGGCTAAATGGCTTTTGATTTTATTAGCCCGACGCCCGCACCGAAGGCGACCTCATCATTGTCATTCAATCCTGAACTAAGCACGTGGAAAACGCCAAAAGAACTTCCCCTCGTATTAAACACGATGCCTTGTTCGCGCCCGAACATCCTGGCACGGCGTCGCCTTCAGTGCGGATTTAAGTCCGTTATGCATTGGTCCATCGGACGTCTAAGCACTTTGGTGACTTTCACGTTTAAATCGCGTGCCTTCACCGTTACTGAAAAAGACTGCGTCACAGTACTTAGTACAATCCTAGCGATACCGATACATAGTTCAGTTCCAGGAGAAGCAATGCTGTTTAGCGCCGCTATCACGGAGAGGGTTCGGTGTAAACCGCGGACAAGGCGCCCTCTGCTGCCATTGGCTCTCCGTGGGAGGATGGCTGACGAACAGTTGAAAGCTGGTACTGCCAGGCAATTCTGCCCTGCTGCCCAAACACGTCGCGAACCGTTTGTCCATGTCTTGAAACTTCGTAAACGAATAACTAACTGTCGTCTAGGCTCAGCATTCCGTTTAGAACAGGTCCGACTTGGATTTGACTTTGCCTGAAGACGAACGCAGTCCAACGACTTCTCCAGCGGGTCATGACAGTGCCCTATCCCTGGCCGTCCCAAAACCGCCGCTGTTAACGGACATGAAAGCTCGTTTAGCATCCCAAGTCCCACATGTTGGTACAGCAGCGTCCACATTTCTAGATAAGCTGACGGGACGGTTCAGGTTACTGAGCATACCACGGCCGCATCGGTGACGTCGCATAAGTACTGTCACTCATCAAACCGCCCACGTACTGGCCATTAACCTGTGGTACGGTTGTGCCTATGCCGGGAACGCTCATCGCCTCCTGTCGATGGGGGTCGCCGCTGTGTGGATACCGTTGAACCAACGAGACAGTAGGCCGGGGAGCATATTCAAACCTGCAATAACGCCCCTGCCAGGTGGCTTAGGCTGATTTCGATAACCTTCACCGCGTTTGCTGCGTATTCACTAGCGCCATTGAAACGATCGCGGGTATACATGGGAACGAGGTTGCCGCAGGTCACACGCTACATGCTCCACTCATAGAGCGACCATCAGCTCGTCACTACAGTCGTGGTCGTCGGATCGTCACCGTGAAACCAGGCCTCGTCCGACAGGCGTGCTTCCGTTGAATGTTTCATCATTTAATCACATGTAGCGGTTACTTAGTCCGGACGCCCATAGCCGCGACCTTTCGAGGCGTTCTACAAATCGCTATGAACGGTTTGTTGCTTAAACACGTGGTTCTTCTAGAGCACTGCGCCATCGGATTTCAGACGATGGACTATCTATCCCTTTTCCCAGCCGCTGCAAACTCTATGCAGCGTACCGCTTTGCCGTTACAACGGCCTCCCGCTGAAATGGCGACATTGTTGTATACATAAAAGCTTAGGCTAATGTTCAGGATGAAAATAGCCGCTTTACGTTTGAACGGCGCTGCCTGGCGCTGGCCGCAATCCTCAGCAGCTTGATCCCTGAAGTCGCCGCGGTTGCTGTTTGTTGACGTTGGTGGGGTACAGATGTTCG	*
+37	16	utg000001l	17216	60	2958S4M1D8M2D6M1D26M5D9M2D12M2D11M5D4M5D10M1D9M1I3M1D9M2I8M1D8M4D5M2D5M1I4M1I8M1D2M3I19M1D2M2D4M2D12M4D2M1D7M3D1M2D4M6D10M2I8M5I11M3D5M1I8M3D6M1D1M1D6M2D2M2D11M3D29M4D7M1I1M2I5M3I14M2D12M2I6M1D2M2D4M1I11M4D1M1D2M2D6M2I3M1D22M3D4M3D5M1D1M2D1M1D3M3D10M9D14M1D5M6D7M1D2M1D15M4I10M1I15M12D8M5D11M4D3M1I1M1I3M1I6M3D2M1I9M1I6M1D8M1I2M1D2M4D2M2D4M2D4M1I16M1D5M1I4M1D19M1I5M1D4M1I6M1D5M1I4M3D4M2I3M1I3M3I5M1I7M1D2M2D4M1I7M6D7M1D10M3D2M1I15M2D7M3D3M3D2M1I3M2D12M2I12M2D7M1I6M1D5M1D4M3D8M1D3M3D1M1D11M1D5M1D12M3D8M2I3M1I2M3D4M1D10M2D4M2I6M8D2M1D10M2I1M1I1M1I7M1D12M1D6M3D1M1D5M1I2M1I3M1I5M5I8M2D15M1D4M3I11M1I1M1I6M1D12M1I5M4D8M6D3M2D3M1D2M1D3M3I15M1D2M8D1M1D2M4D2M1D3M5D2M2I17M2D23M4D7M1D2M1I13M1I8M1D3M2D20M2I1M1I7M1D6M1D1M3I14M1D6M1D18M2I8M1I4M4D8M1D7M1D14M2D3M3I10M3D20M1I3M8I8M7I7M2I16M1I2M1I7M1D2M1I3M1D9M5D7M2D3M3D8M6I14M1I1M3D12M1I7M4D4M1D3M1I6M1I13M2I3M1D6M1I5M1D26M3I6M1I6M1D3M2I4M1D6M4I4M4D29M1I14M2I8M5D17M2D4M2I10M1I2M5I2M2D13M2D9M4I3M1I2M1D1M1D7M2D7M1I5M1D7M1I6M1I5M1D12M3I3M1I7M2D8M1I4M2D4M1I29M7D19M1D9M1I6M1I4M2D8M3D7M2I3M1D4M1D9M5D5M1I5M1I2M4D6M1D8M2D8M2D4M1D1M1D4M1D13M4D5M1D6M4D11M1D2M2I6M2D5M1D5M2I9M5D12M2D9M2D2M1D4M2D8M1D3M3I1M1D3M1I4M2D5M2D9M2I3M3D2M1D22M2I17M2D1M1D16M1I1M1I10M1I1M2D6M1D14M1D11M3D8M2D16M1D8M1I6M2I30M2D1M1I5M1D4M2I21M1D5M1I3M1I6M5D1M1D2M1D8M2I4M1I2M1I3M1D4M1I3M1D6M3D2M5D9M2D3M3D2M2I11M2I6M1I4M1D13M1I18M1I14M1I2M1D3M3D9M3D8M1I10M2D14M2D15M1I11M3D11M1D14M1I2M1D7M1D1M1D8M7I4M4D14M2D4M1I4M1I29M1D4M2D5M1D11M1I15M3D5M1I6M2D5M3D9M3D2M2D1M1I10M1D7M1I7M1I2M1D4M1D6M4I1M1D5M1D10M2D4M1I9M1I3M1I10M1D2M1D5M1I15M2D7M1D2M6D2M1I5M2I4M1D8M1I10M6D12M1D3M1D9M1D2M1I7M1I4M1I4M1D7M4I6M1D11M4D5M3D3M1D5M3I2M2I14M2D16M2D2M1I3M1D6M3I2M4I7M1I8M4D3M2D4M2I2M1I2M4I2M1D4M1D1M1D12M4D7M1D4M2I5M4I5M4I5M6D17M1D1M1D3M1D3M1I6M1I5M4I4M2I1M3I5M2I2M2I1M4I13M1D3M1D22M2I8M2D3M3D4M1D6M2D1M3D16M3D4M1D4M1I7M2D1M1D9M4D7M1D6M1D2M2D12M1I10M1D6M1D10M1I6M1I1M1I7M2D2M1I3M4D2M4D14M2D4M1I8M2D1M1D20M3I8M1D3M1D4M3D4M1D1M1D7M1I1M3D2M2D20M1I8M2D5M3I12M5D14M2D6M2I3M1I3M1D1M3I5M3I9M3I3M2D4M2D2M1I3M1I18M2I5M2D8M1D8M1I10M2D1M1D1M2D2M1D2M1D22M2I6M7D2M6D8M2D13M2D7M2D10M3D16M1D4M1D8M1I1M4D7M3D17M2I16M1I24M2D2M1D6M2I6M2D2M2D29M3I3M12D7M2D2M3D8M1D6M1I2M1D8M1I5M1I6M2D8M4D5M1D3M1D11M2D8M1D14M2D6M1I7M1D3M1I3M1I3M2D3M2D3M4D3M1D6M1D13M2D7M3I14M1D5M3D7M4D12M3D1M1D3M1I22M2I10M2I1M2I9M2D5M1D2M1D4M2I4M1D15M3D1M1D7M1I4M2D6M3I7M3D4M1I8M1I2M2I31M6D27M3D6M3I1M1D4M2D4M2D11M1D11M4D1M2D9M7D3M2D6M5I4M1D9M1D6M8D3M2I2M1D7M5D9M1I6M2I2M2D9M1I2M1D11M1D7M1D22M3D16M2D9M1D11M2D8M3D7M3I5M1D7M6D1M1D5M1I3M1I8M4D2M1D9M3D5M1D27M1D9M4D9M2D4M1D8M3I1M1D23M5D6M3D3M2D2M2D17M1D4M6I10M1D7M1I3M1I6M1D1M2I6M1D17M1D4M2D8M4D18M3D11M2D6M1I4M2I5M2D3M1D5M2D7M5I10M1D10M7D3M11D4M1I10M1I2M1D1M4D5M1I5M17D6M4D4M2D4M1D5M1D5M1D5M2D15M3I1M1D12M1I13M3I4M4I2M1I3M2D2M2I9M1I5M1I5M1D2M3I12M1D8M3D20M5D3M8D1M3D5M1D3M1D18M1D7M1D6M1I12M2I2M3D10M1I5M1I5M2D10M1D2M1D20M1D9M1I8M1D8M1D9M1I9M3D8M5D8M1D9M1D7M2I5M1I2M1I26M6D25M3D7M1I4M1I2M4I7M1I2M1I4M1D5M1D5M1D1M1D9M1I10M2I11M1I6M1I3M1I5M2I4M3D10M1I4M3I6M1I9M1I1M1I14M3I2M4I5M2I8M2D16M1D1M2I8M1D9M2I8M3I14M1I1M2D6M1I8M6I4M11I5M2I6M1D5M4D3M1D7M1I30M4I11M2I4M1D8M3I9M3I13M1I9M1D5M1I25M3D7M1D5M2D3M1I6M2D2M1D16M2I3M1D5M1I13M2I4M1I18M1D3M2D6M1I4M3D1M1D2M4D3M2D1M1D4M4D21M2D10M1D11M1D15M554S	*	0	0	GACCTGATTTCCTTCCTCCGGTAAAACTGCCCCCGGTCTATACGTGTTGTGGTACTACGGTGACCATAGAGGAACACCCAAAATACATCATTGATAGACTGAACGAAATTTACAAGCATAGAAAGTAGCTGATTATGAAATCGAAGGTTGACGGATTTGAACAGAGAACGGTACTAAGGATTGCTTCGAGTGCTCCCGACCATACGTATGACTCGACTTAACACGGCTTCGAGAGCAAGAATGGAGCGATCATGCTCGAGGACATGCTGCTAGCAATCGAACCTGGTTAGGTAATGAGACGCATGTTCTATGTACCGACGCGGAAGGAGCGGCTGGTTGCTGACTATGAAAATACGCCGCTCGGACTATCATTAGGCTGTAACGAATAAATTAAATAATTACGTACTTTATTTTGATAATGACAGAAGCACTCATCAGGTAATGACTTATCTTCTTGATCGCTTCTACTCAATAATAACGGCTTCACTCGAGGGGCTTCTATTAGTATAAAGCATCCCTGTCTGTATCCGCAATCTTCACTCATGTCGCTTTTATCCTTGGCTCCTTATTCGACCGGCCCGAAAAGAAATAAACGAAGGAGGCGGTAGACAAAGTGCTTACGTGACGTAGTACCCGGAACTCTTCTAGAGTGACAGTAATTTAACTGTCAGGTACTGATAAACCGGATAACACTTATGCCTGTGGTAGTGATGAGACCCTTCCTGCTTCCCAGTCGGCGGGTAGTGAAATATTGTGATTCGGGCTATAGAATGATGGAACCATTACGGAGGACGGTACTAATACTGAACTGACCAAGGAGCAAAGGGATTCACTAATCGCTCCCTTCCGCATTGACGGCAGAATGCGGTGACATACATACCTCGGACTCACAGGCGTTGTTCGTATCCTCAGGAGAGCCCTGCCATTTCCATTCACGTGGCGGTGTCGGCGAGGCGTAGTGTAGTATGGAGAGAGCCGCGCTTAGCTACTATTAAGCTTCAGCGGAGTAAAGAGAAATAGTCTAAACTGATTAACGACTAGTTACTCAGTTGATGAAAAGCTGTTCACTCGTCATGGGTCGAATCGCCCTCGCTTAATGATTACAGGAGGCGCGACGAATTTCCGTCTTCTCGGGTTTACGGGCAAACCGTTCACCTGGTACGTGATGACGACGGAGCTTATCCTTCAGTGTTACAGGCTAGGCGTCGCCCGGCGTCAAGAACAAGAAGCATGAGCACTGATGAAAAACCATTGCTCCCCCGGCTGTCCATCGGTGAGCGTACGGTGATTCCAGTAAAAACGGAATCGGTACTTGCAATCCTCCCCATCCGTTCGGGAAGCTGGCGGAACGGTGGGACTGATTCGGGGCTTACAGGATTAAAAGCCCGATCATTGGTCAGGAAGCCACGGAAGGAGGATGCCATGATGGTGCTGATACGATGCTTTCGCATCAGGGTGACTCTATCTGTCAACCACGCTCGATTCCTGATGCGATGAATCATTCATCGCCGGGTGCCCTCTTTAGATACAGTACTAAATGCTTAATCCGCGGAGCTTTAGCCGTGGGCTAGAGTGGCTCGTTCATCCATTGATGGTTGACCGATGAAAAACCGAGCAGCGTTGATGGCAGCGACTTTGACTAAAATGAATCCTGTACGTGCCGGATTCCCCGCGCTTCTAATCATCGATCTGCGGAGCCAGGAAGGGGAATCGAAGCCGCCGCTTAGAACCATTCAAACTCAGAAGGCAGAGAAATCACGGGCTTTACATCCAACGGTTTACGTCATAAATGATTGAGTGTGCCCGTCTGGCCTTCGTCACGCTTCTATCTATGACATGAAGCTACCTAATCTAGTCGAAAATACTGCAGGACTGCAGAACGTACTGAACGCGACATGACCCCTTCCGGGCTTCGATGCAGGAGATTAACACCTCTGCTGATCCTGGATAAAACATGGGATGACGCTAATGCCGCCGCTCTGTTCCCCACTTCGCCGCCAGAGACATTCGTGCATCGTAGAACTGACAACCGAAGCATCAACATGTCGGATTCCTGAACGACGGCCTCACACCCGCTGACCCAACCGGACATCTTGCAGTACCCCACGGAGCCGCGGAGGTGGAAGGAGGGATGATGCGGCAAATTACGGCTCATGCGTCAGTACCGCTTCGACAGTTGGACTGATAGCATACAAAGCCGGAGAGTGGCCTCCCTTCCCATTCCTTCCTACACCCTGCTTGCTGAGGATTGCGACCGGTGTGGCTCGGAAGTTAACGCTAAAGGACTGATGGGGAACAGTACGAGAACGACGCCAGAACCCCTGTTTGAATTCACTCGGCGTGAATTACTGAATGCGTAATCATCTATCGCGACGAAATGATGCGTGTAATGCTCCCCCATGGATTTATGCATGAAGCAACGGCTGAACTGAAATCCAAGGGAGCTCCCGCGATCGCCCGAAATACGCGGCTTCCCTGATGGTTTCGAGGTAAAGTCAGCTTACATGGAGGTGCAGATTAAGCGGGTGACTGGCTACGAAAATGCTCCTTCTGTTGCCAATACTATACCCGGTGAATCATGGACAGTGAGGTAGGTGTCACGTGAGTGGATGAAAGTACGGCGAGGCTTTGACGAGATCGTGCCGGAGTTCATCGAAATGGACGAGGCACTGGCTGAAATTGGTTTGTATTTGGGGGTGAGCAATCGGTGTATAGGTAATGACGCATCCTATTCTTCTATAGGATCGAAGGAGTTTCTAGATCGTTCAGTTACAAAGGCTGTACTCCCTACCCTCTCATGAAATGATCGAATAACTGTAGCCGGCTGTATCAAATAACCAAACGTGTTGGCTTTAACTACATCTTACCTATCAAAAACGTATTGGATGTAACTTTGGTAAAATCGACGGTTTTGGTACAGGAAGACGAAGAATTTCATACTACGTTAGCTTACCCCTTCAAAGCTGGAAATGATGGGCGAAAAGCAGAAGCAGATGAGAAACTATGACAACCGGAATGCATTTTGGCTCTCGGCAGTCCCTTCTGCTTCCCTCATGGAGACTGTTCAAGGAAATACCTCAGCAGGAAATCGGTGCAGCGATTGCCCGTCAGGTAGGCATTCTGAAATCAAAAGCCAACAGCATTTCCGGATAAACGTGACATTCAGCGTACTGATCAACGGCACCGCGAGAGTAAACGGTAACGGGAAGCGGATTCACGGATTCATTAAGCCTGGCAATCGGCATGTTAAACGGGGTCTTTAAGGAACGATGAGAACAGCGACGAAAACGGAATCAGGGAGCAGCTTCTTATTATTCGCACATTCACTAGCGACCGTATTAACCGTCGGATTACGATGAAGATGGCAGACATCATTGATTCATCAATAGAGATTGCCGCTCCTCACAGCAATAAAAATGCCTCTAACATACAGCTATATCTGTATTGATGTTTGAGTGGCGTACTAGTTACATGAACGAAGACGCTTGGTCGTAGGGTTGTCGACTTGTGCACTGCCGGAGGATCTGGAACTTATCAACGAGAGGAATGGAAGGAGCGAATTAACTCTCAGGCACTGCGTGAAGCCCGCAGCAGGCAATGCATGACGACTGGGGATTGACGAGACCTTTCCATGAATTGGTAACCATCGATTCTTATGGAACTGCTGGATGAACGGGAAGAAACCAGGACCATCAACGGTAGCCAATGACGGAGACGAGGATATTGCCTGGCTTCTGGAACTTCCGTGTTGGGTGAGAACAGCAAATCCAAACTCAACGAGTACCGTATTACGAATGTTATCGGATGGGAGTAAGGGCTTAAACTGAGAAAGCAACGAAGTCGTGAAGACGGAACCAGTTGTTCAGGTCTCACCCTGGGAAGACTCCTGTCACGCGACTGGAGAGCAGCGGAAGTTCTTAGTGCGGGGTTAATCGAACAAGATCGTTAGTAACTATCGACATCATTACGATCGCTGTTACGCGTTGGGGTAATGGGTTCAGGATGCAGGCTATCTGCTTCTGCTTCCTGGCTTCGGCCAGTGAGATCGGTTTGTAAAAGATAACGCTTGTGAAATGCTGAATTCGGTCCGTCTTCACAGCGCTTCAGAGTCTGCTGTCAGATGATGACGTACTGACAAACATCGGGTTGAGTATTATCTTACTGTTTCCTACATAACATTGCTGATACCGTTTGTAGCTGAATACGATGCAAGGATTATAAAGGGTATCAATGATTGAGTCTGTAAAAGATTAGGATATAAGAAGGAAGCGCATTCTTGTCTAGCTGCGACTAGACATCACGAATGTTTTATGTAGATGAAGCTCATGATATAGATCTGATCAAATATTCGGCTTCTCTCCTGCCTCCAGGGTGCCATTCTGCAATGTAGAAATGACTGATACCGTGCAAATTATCACGAGTACGGTGGAAACGATACTGTTGCTCTGTGACAAAACAGCTCATCAAACCCAATATCATAAATCGGCACCGGGGATTTATTGTTATCGACTCTGTACCTCATTGTTTATGGAGATGATAAATGCACTTCGAGTACAGGAATGGAAGATGGAGCCGCGGTACGGAACAGGAGGCATGGAGAACCAACGACTGTCAGACCACTGGATGAACTCCCTGCTCGGGCTCTCTATCTCACATAATATTCGAATTGAAGAACTGAAAGAACACCATCGCCTGATGATTTGTATCTCTGCGTAATCGGAGACTTTGCCGTACTTGACGCTTCAGGCTTGAACGGACGCCAGCGACGAGGAAGCCTTGAAAGTTCGTCGATGGGTTCGGGAATGCATGAGTTCCCACCTCCGGTTAAGGATGGAAATATCTTATTCACGAATCAGGTAAAGGTTGACTTAAAGCAATAACAGGTGGCCTTTGAAGGAGGAAATGGAAGGCGAAGTATCCGGGTGCGGAATACCGAGGCTCCGTAACAGGGAACTTCTTCCTGCCTGCCAAGGACGGGTAAAGAGTTTGTACGGGCATAAACCGAATCGCAATCACTGAAGCTATAAGCCAACATTGAGTTATTTTCAACACAACACGGTAAACCGAGAATCAACATGATGATAATTCGTCAGTTACATTCATGGCTTGATCGCTACGAAAATGGCCAGCAGGAATCAAGCAGAAGACACTCATAAATTACATGAGCAAATTAAAGGACCATTGATGCCTGATGCTCCTGATTGAAGACATCACAAAGAAATTGCGGACCGCTCAATGCAGAGGAAGCTTCCTTCCTCGGCTTCGATCGTATGATGCCGCGTAGAGGCAATAGCTGAAGCATAACACAAACCATGTCGCTGCCACTCGGAGCAAATCAGGTAAGGAGATTCAAGACTTACGGCTGACGAATACCTGAAATTATCAAGCAGAATCATACCAGCTTATCCACATGCAATGGAACTGGCTGTTGTTACCGGCAACGAGTGGTTTATGCGAATGAAGTGGTCTGATACGTATAGGGTAGATGTACTTTGGCTGTCAAAGCAAAACGGCAAATCGGTACGGCGAAGCATCGCAGAGCGATGCTGCGGAACCGTCTGATTGAAGGAAACATTTGATAAATGGAAGGTCTCGTGGCGGGGATACCATGCGCTCCCTCCGTCCCGACGCTTCATCCGGCACAGTATCAAGGGTCTCTTAGGCACGACGATCGTCTTTCCTTCGAAGCCAGTCACGCCTTTCACGCTCGCAGTTTGTCTGCAAGACTCTGAGAATCACCGATAAGTTTGCCAAACATCTCCGGGCAGATGGACGATGGCATCACATATCGTGATGACAGAGGCATGGAGTGGGACAAAGTGAAATCAAATAATAATGATTTGACTGATGACTGTTCAGCGCATGGAACAACCCTACCCAATGCAATGCTTTTTGATTCCCTTCCCCATATGCCTGAACGACGAGACGGAGTAAATACGGACTACGGCTGACTTGTAAAAACAGACTTACATACGTAAACAACACTTAGATCATTTTAAAGCAACTACTTAGTACTGTTACGGCTACATGTAAACTACTGCATTAGCGTAGACTATTAGAACCTTATCTCCGGGCCCCACGCTTTGTGTCATTAAATTTGTTGCATTCAGCTGGGAAGGAAGCACAACGGCGCAATCGAAGGCTTTGTAGATACGACCTGCATACGTAAGAAGATGATGTCAACGACTATGACTTCTTTCTCTTCACGGATTCCTACAGAGCATGCATCACCCTCTGCCTTCTCGGAGTCTGTTAGGAGCGGAATTAACTATGAAAATGGAGAAGTGGGGGCTATCTATCGGCTTATTAGTATTGAACGCTTCGACGCTGACAGCATCGTTTGGCGATACTATATGCTGCATTACAATAGACTATCGTTGGTATAACGATGCACCATGCATGAACCGAAGGAGGAACCGGCCAGAGGTAAAACGATAAAGGAAATAGAATGCTTTAAAAGTTACAAGATACGCCCTATTTACATGGATTAATCTTAGATGGAAACGTATCACAGAGTGACTTAAAGAGAGACTTCCTATCCATTCCTGTTTTAATAAAATTACGCTTACTATGTTGGAGCGGGCTTGAAAGAGGCGGTACTTCCTGCAGGTAGAAAAACGCATTCCTACGAGCAGATGGTTGGAATGACTACTTCCTTTGTTACAATGTTTTATCTGTTCTTTGGTAAGGGGACTGAAAATGCGATATCGGAAATGTTAAATTACCTGGAGGAAGAACCACTAATTATTCATCAGTAAAAATCAATTCATAACTCCGAAATGTTCCTTAGTGAAAGCATTGACTCATGTTAATCTCAGCAAATCATGATGGTTTTAACAAACACTTCCTTAGCTTCCTTCTGGTAGGCCAAATCGATTAGCTAACATTATTGAAATGAAAGCGTCGTGACCTCATTAGAGGGGTAATTCGAGAAATTCATGGACAGTTCGCACGTGTGTTAAATGACGCATTTGCCAGAATTGTCAGATTTCCACCTTCATTTAATAGAAATTATCGGATTTCAGGCGCAGCGACCCGATGCTATGACGGTTAGATTCTCTATGCCCAGCACGAACATTCATGCTTTATCGGCGGAATGGGTGTGGTAAAACAACAATTTGATCTAGGAATTCACTGTGCAATCAGACCGAGAAAAGCATTTTCCCATACCCCTTCTGCAATCGGTGGAGAATCTACAGTCGCTCACGCTTGTTTCGTTTCGCCGGATTAATGCCTTTATTCTCTCTAAAGAACCTGACCAGCAAAGCTACAATACTTTTATATTGACTCAAGAATGCTGCCAGCAATAGTTTAAAATCACCGAGATCTCTTAGAATGCTTCATTTCAGGAACGCATCGAGCCGGAGATAGAAAGACAACTGATTGAGTAAATAGAACTAAGTAGTGATGAACTTTCAAATAGAACTCCTCTCTCCTTCTAAATATGGAAGAGTAAGACGTAATGAACCAATTCAAGGAACCGATAAATTCACTAAATTGTCATTTTATGACAATACGGAAATATGCGGTTTCGAAGCCAGCTCTGGACATGCAATCGTTTATTTATCACAAGATCGATGTCGTTGGCGAAAATGATGCTTAGTTGGGTCTAACGTCACCGATTACTTGCATGTCAGGCCCCCTTTAAACTTGATTTGACGAGCCATGTAACGCAATGGCTGAATAATCTGCAGAATCGCGATTCCAGAGCACGCAAGGATTCAAATCCTGCATGTGGATTCCTTCCTCCTTCGCCGAAGCAATATTATCGTCCGGATATTGAGACATTCGGTGAGAACTTAGGCTGTTTTAACTCGTGAGGCTTTACTTGAAGTAAATTCTGGATACTGAGAGCTTACGATTCAGCTTCTTATGAAACCATTCTAAAATTAATGGTCAGATAGGATTAGATCAGGAAGCGTTTTAAAAAGCGCTGATGATACGGAAAGGAGATGAAGGTAAAGTACAAGGCAAACTACCCCTTCCACGAGAACTTATCTAGAAGGGGCGCAGACGCTCGGAATGATGCAATAAATGTTAGAAATAAGATTTCGGTGTACTCACTTCCCCACTTTTCCGGAGCTCAATATAGAATATTAAGCTGGACATAGATTACCTACGACAGAGACACCTTGGCTGGTAATCGTTGGTAACTGACGATTAAATTAGAAAAGCTTTATGAAATACATTCTCTAGATAAACAATCTAGAACATATTACGATGACGGTGCTTGTTTCAACAGGCTAAAATGTCATTTTGTGTCATTAAAAGACACGAAAAGGATTACTCCTCCCGTCGCAAGGTGATCCTGAATTTTCTGCTTGATGCCTTAATTTAGTTCCATCGTAGGGAATGCAATATGGGAGAGAAATAAGTTTTCTTCTTCCCTTAGCTCCGGCTCGGGCGTCATCCACTGACATTAACATTTTTCGTGAGGACTTGTTATGCAATTTCGTTTCTAGAACCCCTGCGTGCCGTTATCTTGCGTGACGCCCGGTGAACTGGAGGCAGGACAACACAGAGCTCTTCATCATTTCAAGCTAAATATTGCTAACTATTCGTTTGAGCAGGGAAGCACTTGAGCATGATTACTCAACGGAACTCTTCGTAAAGAGTAGGAACGAGGAAGGTCTCAAAGGGACGTTTCACCGTCAGAATTTATTGAAGCAAATCTGAACTATTATAGATTGAATGACTTCCTAATTATTGGAAAAGGTTCCTTCTCCATTCGGGAAGGCGGTTGAGGGATCTAGAATAGGTGATAAAAGATAGAAATTACGACGATTATCGGAAGGAACGAAGTAGCTTTATAGAGGCTTTTACAAATCCGGTGACTTGCCTAACCAATTCCTAGCAGAGTAGGTACCTTGGGGTGAACAGGCGCACCGGATTTGACGGTTAACGGTAAGCTGAGCTCCACGTCTACGGGGGACAGTGTACAGTCACGAGGAGCGGCTCCGCGGAGGAGACCTCGGCAAATATGAGTAAATCGCTAACGCGTAAAACCCATTCAACGCACTCCCTTCTTCCGCTCAGCCAAGCACGTTCTGCCACCGTCGTGTCTGCGGGGCCCCACTTCCGAGGGACTTAGCAGAGCCCAACCGACTCTAATTTAGCTCACCACATAATGAATGATAATAATAATATTAAACTTCCTCTGTAATTTACACTGGTTGTTATGACCCCATCGGAGACGATGGACCAAAATCTGTATTACATTGACAGTTAAGCAGTACTTTACTCAGCTTTGGGAAGAGGAGCAAAGTT	*	tp:A:P	cm:i:28	s1:i:194	s2:i:0	NM:i:2292	ms:i:328	AS:i:-106	nn:i:0
+38	16	utg000001l	1	60	63S12M2I6M4D7M3D1M1I2M1D15M2I22M1I35M5I13M2D1M1D23M2D2M2I2M1I10M1D24M2D2M2I5M1D18M1I3M2I4M2D4M1I29M1I15M1I9M2I23M1I1M1I25M2D48M1D11M3I18M1D8M2I10M2D1M2D2M1D10M2I12M1I10M1D15M3D4M1D51M1I36M1I4M2I2M1I17M1D11M1D6M2I37M1D32M1I8M5D15M2I8M1D9M1I3M4D5M5I24M1I3M1I6M1D36M2I12M4D2M3D9M2D2M1D2M1I12M2I3M1D16M1D3M2I25M5I13M1I5M1I5M1D6M1D3M1I13M1D10M4I15M2D5M1I2M1I7M4I5M2D9M3D11M2I10M1D9M1D1M3I10M1D3M1D8M1I19M2I6M2I2M1D7M1D2M4I14M1I4M1D15M4I9M1D1M1D9M1I4M1D6M2D3M1D26M1I10M2I4M1D17M1I3M1I7M2I13M1I11M1I4M2D6M2I8M2D7M1D15M1I10M1I51M3D6M3D3M1D9M3I2M2D9M5D1M1D3M1D2M2D28M1D10M3D23M2D29M1D10M2I3M1I12M1D6M1D17M4I2M1D5M1D1M2I6M1I2M1D18M5I7M1D17M2D19M2D21M1D13M2I11M1D9M1I5M2I6M3I11M3I9M2I26M2I15M1I11M1D1M1D9M4D12M1I7M1D1M1D7M1D1M2I3M1D2M1D24M1D8M1I8M1I9M2D3M1I3M2I6M1D34M2I10M2D20M3D7M3I1M1D3M2I2M2I20M1I4M1I9M1D29M3I1M2I3M1D3M1D4M3D9M1I10M2I5M1D6M1D16M3I6M2I4M1I7M5I9M5I4M2D12M1I4M1I2M3D2M1D1M1D3M2I6M2I3M1I5M2I11M1D10M1D11M2I8M1I10M4D12M3D3M4D4M1D8M2D4M6I1M2I29M2I16M4I5M1I3M1I1M2D7M3D5M4I2M1I8M3D4M1D3M1I10M2I20M2D2M5D4M1I3M2D26M3D14M5I8M2D4M1I10M1I10M1D6M3I26M1I12M2I4M1I23M1I12M1I11M3I5M1D1M1D1M1D3M1D13M1I2M3I3M1I8M1D9M1D6M1I11M1D11M2I4M2I4M1D6M2I3M1D10M1D9M1I10M2I11M1I5M3D16M4I2M1D17M1I7M4D1M1D9M1D4M4I20M1D5M1D3M1I17M3I7M1I1M1I2M1I13M1I1M1I1M1I5M2I12M2I3M1I13M1D14M2D2M2I6M1D3M1D12M1D13M5I1M1I7M1D6M1D34M1I26M1I1M1I4M2D5M1I10M3D5M1I7M1D4M3D4M4I4M1D11M5D24M1I34M3I8M6I23M5D2M4D6M1I4M1D3M1D2M2D11M1D17M1I31M1I8M2I9M1I3M2D8M1I3M2D9M1I14M2I5M1D8M2I2M1I9M3I4M1I6M1D8M3I3M1D3M1D6M1I7M1I7M1D9M2D4M8I4M1D2M4I1M2I5M2D5M1D2M3I4M1I2M1I11M1D8M1I13M2I24M1I8M1I12M1I22M2D3M2I1M1D4M2D11M3D21M1I22M1D11M1I4M1I3M1I21M2I13M2I19M1I13M1I9M2D7M1D39M2D14M1D5M1I5M3I10M1D2M3D25M1I38M1D47M3I9M1I5M1I4M2I1M1I16M1I5M5I15M1I8M1D1M2I7M1I4M1I4M1I6M1I10M1D7M1I4M2I4M1D10M1I14M1I19M2D6M1I12M6I4M1I3M1D6M1D28M1I22M1D13M1I2M2I14M3D43M1I2M2D11M3I10M1I7M1I8M1D16M1I17M1I3M2D10M2D10M1I4M1I3M1D2M5I1M1D4M2I22M1I3M2D9M2D2M1I3M1D8M1I7M3I39M1D2M4D2M1D6M3D16M1D5M3D16M1I6M1I13M2I7M1I11M1D8M1I4M2I2M1D7M1I35M1D43M1D1M2D7M3D6M5I4M3D24M7D7M4I2M1I15M1D3M2I5M1I26M1I10M3I17M1D5M3D1M1I35M2D8M1D12M1I9M2D5M5I14M2I1M1I18M1I57M4I11M1D7M2I17M1D2M1D5M1I1M1I9M11I1M1I19M2I16M2D10M1I22M5D6M4I1M1I5M1I2M4I5M1D21M1I8M1I29M2D5M1D4M3D14M1I6M1D5M3I7M3I5M3D9M1I12M2I6M1I3M1D9M1D2M1D8M2I6M3I4M3I5M1D2M5I8M3I2M1I7M1I4M1I2M3D8M2I2M9I32M3I5M2D25M2D14M1D8M1I17M3D5M3I4M2I7M1D12M4D19M1I18M2D8M1D2M1D14M1I7M3I25M1D7M2I2M1I1M2I4M1I3M1I12M3I2M1I17M1D4M1D8M3D6M2D8M1D6M1D1M1D9M2I4M1D4M2D4M1D21M1I3M2D18M2D17M1I6M3D4M1I9M3D5M3D4M2D5M1D3M1D18M3D9M1I3M1I14M1D4M3I9M1I14M1I6M1D7M1D16M3I4M1D4M1D5M2I15M2D3M1D26M1D26M1D2M2I4M1I4M2D9M1I4M3I5M1I8M1I16M1I12M3I11M3I1M2D22M1D9M1I8M2I5M2I21M1D11M1D2M3I9M3D5M1I9M2D3M2D1M1I12M4I11M3I2M2I12M3I4M1D12M6I5M1I18M1I2M1I9M3I1M1D1M1D20M2I1M4I3M4I4M2D4M1D2M2D11M2D8M1D11M1I22M4I4M1D55M1I4M1D1M1D1M1D11M3D29M1I1M1I27M1I12M1I8M1D1M1D21M1I17M1I2M3D13M4I5M3D13M1I23M1D1M2D11M1I7M1I17M3D3M1D24M1D7M2I38M1D4M1I35M1I4M1D5M3I6M2I1M1D17M2D8M2D8M1D2M2D2M2I5M2I2M1I4M2D13M1I8M1D1M1D3M1D2M1I2M1I3M3I3M1I3M2I51M2I8M1D5M2D9M1I4M2I27M2I3M3I1M1I6M1D3M1D16M1I23M1I6M1I7M3D3M1D10M2D3M1I1M1I6M1D3M2D2M3D1M2D7M3D3M1D13M2I22M2I2M1D10M2I4M2I12M1D44M3I6M1D1M3D19M2I12M1I14M1I2M2I4M1I10M1D11M3D2M2I11M2I22M1I5M1I17M4D25M1D1M2I7M1D6M1D16M1I2M3D22M1I4M1I18M3I3M1D11M3D18M2I1M2I9M1I5M1I12M1I6M1D6M1I16M2I4M1D15M1I3M1I4M1I1M1I23M1I66M1I17M1D10M1I22M1I11M5I5M1I4M2D3M1I6M2D4M2D8M3I7M1D23M1D4M1I6M3D6M1I5M1I6M8I2M1I2M2D3M4I13M1I9M1I4M2I2M1I2M2D8M1D13M1I4M2I2M1D6M1D4M3I3M4I19M1I5M1I8M2D5M1I15M3D6M2D10M1I3M1I3M7D8M2I10M1D11M2I5M1I14M316S	*	0	0	GACCGAACATAACAGAACTTATAGTCCCCGCCCCAATCGTCGAGATCACGGAAAGAGACCCGTAAAGTGATAATGGCCTTATGTCATCTAAGTCACAACGTGCGTGGAGGTGCCATTCAACCACGTCAAATAATTCAATTATGACGCAGGTATCGTATTAATTGATCTGCTGAACATCAACTTAACGTAAAACAACTTCAGACAATACAAATCATAGAGACTGAATACGGGCAACCTCATGTCAACGAAGAACAGTCAGCACGGCAGAACAACAACCCGCAACATCCGCTTCCTAACCAAATGATTGAACAAATTAACATCCCTTGAGCAAAAAGGGTCGGGGAATTCTCGCTGCCTCCGTCATTGAAGCCTGCGTCGGAGACTAACGTCAGAAAAGTACGCATACATCAATTAAAATGATGAAGAATGAACATCCCGCGTTCTTCCCTCCGAACAGGACGATATTATGTAAATTCACTTAATTACGAGGGATTGCTGCAGTAATTGGGTTGCAGTTTTACCACTTTCCGTGACAGTGACAGACTGCGTGTTGGCTGTCCGGACTAAATAGTTTGAATGATTAGCAGTTATGGTGATCAGTCAACCACCAGGGAATAATCCTTCATATTATTATCGCTTTTCATAAATCCCTGCTCTCAATTGCTCGAATGCTTCCAGAGACATTATGTTCTATACATGCAATTACAACATCAGGGTAACTCATAGAAATGGTGCTATTAAGCATATTTACACGCACGAGATCCACGGAGGATCAGCAGATTATTCGTTTTATTCATTTGTCGCTCCATGCTTGTCAGTCTCTTCATCTAGCGGTTAAAATATGTACTTTCAAAATCTTTCTGTATGAAGATTTGAGCACGTTGGCCTTACCATACATCTGTCGAGTCTGTTTCCCCGACATCCCAGCATAAACCGCACTTTGTTTGGCAAGCATACCCTATTAAGTGAAAACATTCCTAATATGGTCTTGACATAAATAAGCCAACAAAACAAGGAGTAGACCAGATTGAACGATAAAACGATAAAGCTTGCAAACTACGCGCCCCGTATCACATGGAAGGTTTTACCAATGGAGCCGTATGCCATTTACGACGAAATATTCAAGTACGTCTTAGAAAGATTTAACTTGAATTGTGTTTCATCGTGAACTAAACGGTTCACAACTCGTCTCATTTAGTCCTTTACTATCTAGCCACAGATAATATTCACATCGTGTTAGAAACGATAACCGCGTGTTAATAAAAGCGACTTAAAAGGTTGTAAATGTTAAATCTCAAGGAAACACGCATCTTATAGAAACGTCCTATGATAGGATGTGAAATCTGCAGAGAAATCACACCTTCAGCAATACAGGGAAATCTGCCAAAGCAGGTTTTCCATCGGTTACAAATATCCCATGAACATAAAAGATATTACTATACCTTTGATAATTCATTACTATTTACTGAGAGCATTCATACTAAGACTTTCCACGCGCAATCATAACGTCCATTTGCGCGTGTCAGCACCGGGGCGTTGGCATAGTGCAATACGTACGCGCTAAACCCTGTCCGGGTTGGCCCTTAATTGTTATCCCGGGACACTCCCGCAGAGAATATTCCCCGTCAGGGCTAGGGCACGTTAATCCGGGAATACAAGTGACGATTCATCGCACCTGACATACATTAATAAATATTACTACAAATATGAATTTCAACTCATTGTTTAGGTTTTGTTCACTTTCTACATACCATTCTGCGAACTTCAAAAGCATCGGGAAGATAACACCATGAAAATGCCTACTCGCTACTGCGCTGGCCCTGCTTATTACAGGATGTGCTGCCAACAGACGTTTACTGTTCAAACAAACCGGCAGCAGTAGCACCAAAGGAAACCATACATCATTTCTTCGTTTCTGGAGAACCCGCGATAAATCGCAACGGAGCAGCCAAATTTGTGGCGGCGCAGAAATGTTGTTCAAACAGCAACCCCAGCACAGCTCGTAAATGGATTGCTCGGTTTTATTACTTTAGCATTTATACTCCGCTGGAAGCGCGTGTATTGCTCAATAATTGCCATGAATCGCTCAGCTTCATCGATATGGGCAACTCTATCTGGCACTTGCTCATTAATACTTCTGGGTTCCTTCCAGTTGTTTTGTGCCATAGTACGTCAGCTCTCTGAGCGGTGAAATAATGTACCGTCCAGCGGGTCTGCCAGTCGGGAATAGATGCGTTGCATTTATTCACGCGCCGGAGGCGGCCGCATGGTCTCCATTCACGCTAGTATCGCCTGAGTCTAGCAACGGTGAAGAACCAGACCAGCGGCGTCAACATCATACGCAGAGCATCACCTTCAGCTTTAGCATCAGCTAACTCCTTCGCTTATTTTGGCTTCCCGATCCAGGCAGCAGACATCACGCTGACGCATCTGCAATGTCATAGTAATTGCCGCGTTCGCCGCCAGCATTCAGTTCTATGGCATTTGTCTTCGTCGCGTTTTGTGACTATGGCGTTATCACACGGTAATGATTAACAGCCTGGCAGCTCGGATGATGCAGATAACCAGAGCGGAGATAATCGCGGTGACTCTGCCGCTCATACAATCGCCTGACCGTTCCGCCCGCTTCCGAATTTGCTGCAATCAGGCTGTCAGCCTTATGCTCGAACTGACCATAACCAGGCGCCCGGCAGTGAAGCCCCAGATATTGCTGCAACCGTAAGTCTGCCTAAAAGCGGGTTACACGATCAATCATAGGCTACGCAAGAAGCCACGCTCCTTAATCTGCTGCAATGCCACAGCGCTGACTTTCGGTTCGCGTTGAGTATTTCAGGGCCTCCTGCATGCGGTAGGCATCCCCACCAACGGAGAAATAACCCGTGATGAGGCGCCTGTTGATTTGTTTCAGTTTGGGTTTAGCGTGACAAGTTTGCGAGGTGATCTGGAGTAATCAGTAAATAGCTCTCCCCAGCATGACGTGCCATAACCATGATTTCTCTCATTTTCTGACGTCCGTTATCAGTTCCTCATGCCGACTACACGCCAGCATATCTCGCCGGAACGGTTACGTGATTATTGATTGCCCGGCTCTTCGCTCGGCTTTGTGACCCAGCGAAGCGTTGTCCGTCGATAAGCAACCAATCGAGTCAGTACCGATGTAGCCGATAAACACGCTGGGTTATACACCGAGATTGCTACTTAGTACGGCCGAAGTCCGAGAAGTACCGAATAGAACTAGGGAGATGGCCTCCGCGGCACATCGTTGCGTCGATTACTGTTTTGTAAACCCGACCGCCATTATATCTGCCGCGAAGGTACGCCATTGCCGCAAACGCAACCGGATTGCCCCGATGCCTTGTTCCTGTTCGAGAATGCGGTAAAGCCTGTTTTTCTGGCATCTTCATGTCTTACCCCCAATAAGGGGATTTGCTCTATTTAATTAGGGAATAAGTATGATTACTGAACGAAACAAATGCTACTGTGTTTAGTAATCAGATTTGTTTCCGTGACGATATGCCAACGGGGCAAAACGCTGGCGCAGGAGTGAGGGGCTAGACCTCCTGCCAGCTTTCACGACAGAGAATCCGATCAAAAGCCTATCGCAGCGTAACTGTTGTTTACTAATGAACCATTCAGAGGACAGACAGTGGCTCAGCTGAGAGCTGGTTGGTGCTGAGTTGCTGGGCGGCGATGACGCCTGTACGCATTTGGTGATCCGGTTCGTGCTTCTAGATGCGTTCACGATTTCCTAACAACGGAAAGAGCACTGGCTAACCAGGCTCGACTCTTTCACGATTATCGACTCAATGCTCTTACCTGTTGTGCAGTCAGATATAGAATCCCCGAAATGCAGGTTCATGCAGGCTCTAACCATTACCTGCGAACTGTGTTTCGGGATTGCATTTTGCAGACCTCTGCCTGCGATGGTTGGAGTTCCAGACGATACGTCGAAGTGACCCTAGCCAGAATCGGAGTAATGTCCCGCTCCGCCCTTCACTTCACAACGAGCGAATTAACCCATCGTTTGAGTCAAATTTACCCAATTTATTCAATAAGTCACTACTTGCCGTTAATATGTTGCCATCCGTGGCAATCATGCTGCTAACGTGCTAACCGCACTCAAAATGTTGTCTTGCGATTGACTCTTCCTTGTGGCGGCGCACCCTCGCCAGAGCGTCGATACAGCGGCTTAACAGGTGCGTGACCAGGGTGGGTTTGGGTAAGGTTTGGGATTAGCATCGTCGATCCACCGCAGACCTGATGCTGCGCTTGCTGGCATCCTTGAATAGCCGACTGCCTTTGCATCTTGGCTCTCCGCACTCTTTCTCGACAACTCTCCCCCACAGCTCTGTTTGTGCAATATCAACCGCACGGCCTGACCATGGCAATCTCTGCACATCTTGCCCCCGGCGTCGCGGCACTACGGCAATAATCCGCATAAGCGAATGTTGCGAGCACTTGCAGTACTATTTTGCCTGCGCTCTTCCTGTCAAGCGGTGCCACCACGGTATTTCCCCGTACCTTGTGCAAATTGCCAGATAGTTGATAGCCTTTGTTTGTCCGTTCTGGGGCTGAGATTTCGTGCTTACCGCAGAATGCAGGCCACCGAATCCGCGTTGTGATTGCGCCATCCCCCAGATAGCAGCCATCACATCAGTACCGGAAAGAGTCAGAATCCGACTAGTGAGTCGCTCATCATCGCGGCTTTAGAATGAAATTTATAAGCCACGCTTTTCGAGTCTCATGCGCCTTCTCCCCTGTACCTGAATCAATGTTGCCGGTTTCCGCAGAAACACTGCGCCCGGGCCGCGTTACATTTGGTTGGCAACTTGAGTGGTTTCACTGCTGGCGAGCGACCAAAGATGAACGGCCTTGATATTCTTCCGGATCACCCCGTTTTGTGAGTTGCTGATTCGGTTCGCGGTTCCAGATCTACCTGCTGATGATGTAATAACTGGCTTTCCAAACTCGTATTCGTCAAAGGGATAATCGGCGTGGCAGATAACATATTTACTTTGAGCCAGTTCGATGATTAACGGAAGTTCATCTGCTTTAGGCAAGAGTTTAGCCAGAATCTTCTTTGTCAATCCGGCCAGATTAAAGAACCAGGCCACCGCCATTAAGCAGCCAGTTGATTAACGTTTCCACGCTCTGATAAGCCGGTAATCATCATTTGCTCATGGGTTTCCACGTACGTACAGCTCGAACCAGGCGGAATGTGATTAATTCCGGATTCATAGGGTTCCGCATTCCAACGATCCTCACGATCAACCAAATCGCCAGACGAGATAAGCAGGTCTTTGTTGTCGAAATCCAATCGTATCCAGTTTTGTTCATCAGCTCTATTCGTGTAGCATCGTGCAGATCGCCAACTACCAAATATTTTCGGTATTTTGCTGCCATCAATTTTCGTAATAGCGCATCTCTTCACTCCATCCGCGATGAACCATGGAAACGGTGTCGTTGTGAACGATGTGCATTTTCCCCGTCTTTATCATATCAACGGTATTTTCTGACGTACCGCGACTAAGATGTCGCCAGTCTGCGTGCTACTTTCTGTCTGTAGCTCGATTTCCGTATGTTCGACAACGAGCATGTCTGGAATGGTTTTACTGAGAACGTCATGCGGCCTCACTTCTTGCTATTTTCGCAGCTTTGAGTTTCTGTTGGTACTGCCTTGATCGCCTTGCATTCGATAGTTGTAGATATGGCTATCGCCATTGTCCAATTCGATTTCGTCTACTGCTTCCTGCCCGATGCGGCTAAATCAGTTCGACGCGATACGGAACGAGATTCCGCTTTGTGCTCGGTTGCACACCACGCATTGCTTGTGAATATTGCGTTCATTAAATTCAGTCGAGTCTGAGGCCGCAGCAGTTGTCATCACCGGTAATGTCGGCATCCACGAGCAGACGTGAGCCGTGGGACCCATACTCTAAGTCGCCATTCTTTCTCTGATGAAGGCGTTTACGGCTTGTTGGGCTGTTTAATCCAGTAACTGCGGGGCTTTAAGGCGAGTTTTTCGAATCTTTAAGTTTATCTGTTTCTGCTCCTCTCGTCGTCGTTTCTTCTTGCTGCTTTTCTCGCTTTTCGCGTTCTTTACTTCGTTGTGGTTCGAGTGCTATCTTGGTTCTAACTCTCAGAGCACAGGTTCGATTAGCGACCGATGCGAGGGCAACCACATTCCCGGCATTCATCGTTTACATCGTCTTCGCGCTGGTTTAGCCATCATCTTCTTCCTCGTGCATCGAGCTATTTCTAATCGCTCATCAGTTTCTTGGGCGCATGCAGTGCTACACACGTGAACTTCCAGCACATGCAGCTTCGCTCCACCGCAGTTTAGCACGTTAAAGCTCGCTCGACGCTTCTTGTTCGGTAACTTCATGATTTTGTGGTCAATCACCTTGTTTTCCCGCACGACGGTGCTCACCGGATATCCAGCTCGTGCTGGGTTTGGCATTTTACGTCAGATGCATTCTTTTGGGATTGGCTTGGGTTTATTTCTGGTGCGTTCGTTGGAAGGGCTCATTTTGCAGTTTTCGCAGATTATGTCGGTGATACTTCGTCGCTGTCTCACACGTCCTCCTTTCCCTTGCGGTAGTGGTAACACTGTCAGTTGGTTCTTTCACGGAGACCATCGATTCCAGTAAGGTCCGATTTGGATGTAAATGGAGGCGTCCTGGTCCTTGCATTAACGCACCGATAACATCGCATCATGCAGCTTTCCTCCCGAAGTCGAATCAAGCTGCCCTCCAAATATTTCGCATGACTGAGAACACAGGAGCCGGTATCGAATCTTTTAGCTCGTGACCATGTCCTGATACAGGGCTTGATAATGCCCTTCTGAATACATTTTCGCGATACCGTCCATGCGACATTCTTCCTCGCTGGTACATAATCTCCTTTGGCCGTTTCCCGATGTCCGTCACGCAAGCATCCCGTGATGACCTCACTTTAAAACACGCTGCAAATCCCTCCACTTTGCAGGCAAGTCGCATTTTCCGATTTGATTTTTAATGCAGAATATGCAGTTACCGAGATGTTCGGTATTTGCAAATCCGAATGGTTGTTGCTTCCACCATGCGAGGATATGTTGCTCCTTCGGTAAAGTCTGACAGTTCAGCAAGGATATGATTCCAGCAGTCTTGGCGTTTAGCCGGTTTCGGTTCATCAGCTCTGATGCCAATGTACGTGGTAATTCCCTGCCCGAAATGGTCATCACAGTATTTGGTGAAGGGAACGAGTTTTAATCTGTCACCTTGCAGAACGCGCTCGACGTATGGAGTGCCATATTTCTGTCACCATATCGATAAATGGCGTTGCCGAGAACAGGCATTCGCGTCTGAATATCCCTTTGGTTCCCATACCGTATAACCCATTTGGGATGTCCAAGCTCCGGGTTGATGACCTGCAATACGTCAGTGGTATCTCAGAACTTCACAACTCTTCCCTGACAAACCGATATGTCCCATTTGGATGTTCCCACATGGCTGTATCCATGAAACGTAATGCACGTCTTTACCTGCCCGTCGCCCTTTGCTCCATCCATACCCAAATATGCTGACGTCCTGCCACCGGAGAAACTAACGACATTTACCATGCATGCAGCCTGTTCTCCCCATCCGCTTTCCACTCCAGAGCCAGTCTCGCTTCGTCCGACCACTTAACGCCACGTAGCTGTACCGAATGCCTGTATAAGCTCTAATAGCTCCGCAAATTCGCCTACACGGCATCCTGCTGGTTGACTCGAGGTACCTACAAAGCCATTCCCGGCAAGGTATAGGAAACAACATCTTGCTGGGTGGCTGAGACCCGCGGTAACATTTCCAGCTTTCTGCCAAGCTCCAGCTAGAAGACCATGCCATTCAACCTTGACGCCAGACGATCACCTAAGCAGGCCCATAGCTTCCTGTTTTGGTCTACAGCTTGCGTGTTTGCGTTCCTGAATGGTTACTACGAGTACTGGTTTGGTTGGGTCTGGAAGGATTTAGTGTACTGCGTGAATAGCGTTTTGCTGATGTGCTGGAGATCGAATTTCAAAGGTTAGTTTTTCCATGACTTCCCTCTCCCCAAATCAAAGGCCTGCGGCGATTACCAGGCAGGCTGTTATTAGGCTGTAATGTATAGATGGTCACTTTTAACTCCATAAGCCCCCAACCCGTTTCATCGTACTCGAGGAGAACATTCTATGGGAACAGCTATGGGGTTCGTGCTCATCTTCGCTTTCCCGTTCTTCCCTCAGCAAACCGGTAATACACCGTTCACGAACTTACCTTCGTCAGATAACCAGAAGACCTGCCCGTGCCATTTTAGCCGCGGCCCTGATTTATGCCCTGGTTACTGTTTGCCTGTTAGCGGCAACGTTCGTAGGGGCACAGAAGCTATTATGCGTCCCCAGGTAAGCGGCATCAATTGCCTCTTTGCACGCCCGTCATCATGCTCCTTCAGTCCGAACGGCTTTGATTTCTGCTGCGATCTTCGCCAGAGCCCTGTGCACGATTTAGATACCGCCCATGACAGGAAGTTGTTTGATAACTGGTTCAGGGCAATTCGCCGAGACACGGCCGATCCCATTAGAGTCATGGACAAGCTCTCATCATCATCTTCGCGGCGCCTATTACGGCCTAATTCTTGATCAGTAAGCTCCAATCAGCCCGCATGTTCTGATACGGTTGGTAACCAGCCAGTTAGTGAGGTTAACACCCAAGCAGACGCCGCAATATCATGAGCACCCAACACC	*	tp:A:P	cm:i:169	s1:i:1550	s2:i:0	NM:i:2053	ms:i:5250	AS:i:5250	nn:i:0
+39	4	*	0	0	*	*	0	0	ATTAATTTAATTCTCAACCTTAATATTGTAACATTGCTGCAGGCTGTATCCATATCCTGCAGGCGACGGTTGCGTCCGAGCATTGCGGCTGTTGTGCTTCGTCGACTCGAATGCGACGCTGATTGATAATCTGTAGCCCAGAAAGGATCATGTAAGAGATCGCAGACGGGCTCGAACTGTCACAGGTCGCCCACTCCGGCCGACATTGGGTGAAGCTATGACTTAATGTTGTGTTTTACGATGACTTAATTGTTGCCTAATCTAGGTCAATATGCTGTCTATGCTTTTACGTTATCTCGTTTAAGTTAACACAATTGAAATGACGCCCATGCATCCGTCAGAATTTGTTGAGCTCCATACGTACTATCAATTCATATACCTATCATATTATTCTTCGTTGTCCCGACTCCTATTACTGGTCCTCAGCTGTGTATTACCACTGTAGTTTAAAATACTGCCGAAAGTGTTGGACCGACTGACCCTTATGCTTCTACGGAGTTATGTCCAGACAGGCCGTCCTCGATAGGATTGCATAATCCAGCAAATGCGTCGTGGAGGAAGATAGTGGATCGCATTTTCTGCCCGCGCCTCTCGGACGGTACTGTGCGCTCTCGCAGGCCGTCCAAAGGGTAATGAATTAACTGTTTACCTAAAGCCGATCTATGTTGGCGTAAATTATCGCTATCGTTGACGAATCCTTAATGATTTAAGAGCGGCCTCCGTGAAGATTAATGTTGCAATGAGATTCATGGAAATGTTTGCTTCAACAGACATAAGATAAATCATACCAACTCAACGGTGAAGTTCGCAGCGTAGCATTAATTCTAATAACATAGAATGTTTAAGAATTAAATTAAGCTATCCTAACATATCTGATTTACTGCTTACTTACCTATTTCCACGACTTGGTGTCAGCCTTAAATTATTAATGTAGCTCGTGTTATTAGTGGCCGCTCCGGCGCTAAGGTATTCATTGCCTGTTGTCTCTGGAATCCACCACTTGCCCTTAACAGGATGCATCTAACCAACTGTTGATCTGACTAACGCGAGCGCGAAGAGAAATGAGGAGTGGCTAAGCTGAGTCATAAGTTGAAAGTTTATTTCTTGGTGTCCTTCAGATGGTAGGCTGAGGCAAACTATAAGTGTAAGTTAATTTATAGTGTAATTATGGAGTGTCTTTAGTACTATTTAATACTTAGTAAGAGTTTACAAACCATCCAACAGGGAGTAAATCAACGGAGTATATCGGAAGTCTATCACTCTTTCGTCCTTCGCTGTCAGTAAGTGTTTGTTAGCGACGGCCTATGTTGGTCGCTGTACACGTTGTCAAACCTTGCGTACCTGTCTCTGCCGCGTGAGATAGTTGGCCGTTTAAATCCTTGTAATGGCTGTAAATATCTACAATGTGTTTTACTGTAACATTAGAGAGCTGTGGCGGCTGGGTAAAGTCGTCCGCTTTTACTTACGTTATTCAAGGCCTATTTTGGACTTGCTTTAGGTCAGGTCGCGCTGGTTGGTCCAATAATATGACTGTCCATCCGTAAGCCAAAGTAGGAAGCTGTGAGTGGCATGTCCACAGATACAACCATAAGTGTTTCAAGCAGTCTTACTGGTTACCTGGCGTGCGTTCGACATACAAGCAATGTCGACCCCCGTTCGCAGATGTAGAAAGTGCCCGCAAAGAAAGCCCAAGCGAGCTTAGTGTTGGTCAAAGTCGTCGTAGTTGAGTATTGATCCTTTGTACATGTGCTATGGGCGCTACTATACTGAGTGGTTATGAGTCGGTCATGTTCTCCGTGGCACTCTACTGTTGAGTATTCCATACCGGTTCGCTTTGCTGTGTATAGAGATCCATTGCTGACTCCCTAGCCAGCTGACAGAGATACGAGTTCGGACCTAATAGTGGCCCGCCGAGTACAAGGAGTGTGTTAATACTATTAATTAAATGAATGACTATAATGTTGTACCGGAGGTAGTATGGGCTTTCTTAAACAATCCCACTATTAGCTATGATATTTGCTAATGGATCCTTTCCGCGCACTTGCAGCAACTGGAAGTCGTCTTGCTATCAAAACGTCATGGAGGGCTCTGTTGACCCTATATGGACGGTGTCATACCACGGCCGTGATGCTTGCGGGCAGCGCTCAAATGAGTTGGTAAGGCCTTAACACCAATATTGTTAACGGGTAAAACAAGTCATGGCCTCTACATTTATCTAACACTTGCCAATATTCGTTTTCCTCGACTCGGTGGCATCGTCTCTCTCGGCATGGCGTGCCAGCTCTAGCAACGATGTTGCACTGCTAGTCGTCTATCTGAGCCAAGCTCTGGCGACCCTGTGCAGCGCTAGCAGCGATTTGAGCGGTTTCGCCAGACAATTTATGTGTTTACCAAAACCACAATCGTCCTATATGAGGTGTTATCCTGCCATGCCGACCAGGGTTGTCGATAGGTAGATGCGAGACTGGTAAGTAAGTGGGAAGCGTATGAGCATTGTAACTAGAGCCGATGACAGGGTGAGTGATGATGTCAGCCTGGATCTAACATATTGTCAGGTCTACTGCCACAAGAGACTTAATTTAAATCACAATTAGGATGTAATCATAGCTAGAGAATCTTTGGCAGAGTATGAGGCTATAGAAGAGATATATGTTAGTTAACAAAATTGAGTTGTAATGTTCACAGGTTGAATGACAAGTCACATCGAGACTACGTCTATGACACCACGTGCTCATTTCAATGTTATTTTGCTGTGTCCCTAACAACGCAGTTCCACTGTTAGCGACTGTACTGAGGTGACATTGCTCAACAGTTGATGATGTGAATAGTTCATTTCTTGGCCGTTCCTTAAGAGCGTCAGCGATAGTGAGTAGTACCGAGTGGCAAGGGAAAGCTCGAGTTGAGGCCGAGATCTGGTTGCTGCGACTTGCCACTGTGTAATCATTCACCAGTGCTAACAGAGTTAATGTTGCTCGTCAGATGAATATGTTGGATAATAAGGTCCGAGTTAACTATCGAGTGCACAAGTCAGGACAGGCTCCCAGCATTCTTCGTTCGCTCTGCGCTTACCTAGGCTATAGACCAGTACGAGCCTGATGGTTCGGGAGCGCATTTTATTAATGTTACATGTAGATTTATTTAGTTTTATTACTGCTGGATCGGACTATGTTCTGCCAACTTTCAGTTGATCGGACTTTCTTGCTCCCTTGCTAGCTGGATTAAGCTCGAGCTATCATCAATGATTTGTAGTTTGGACTGTCCGTCATCGTTGATACAAGCGTTTAACGGTGGCGTGGCACGTAATGCAGTCATTGAATCCCACATCAGCGTTGGCTGTTTGTCGTAACAGCAATTAGTCGTCAATACACATATAGGCGAGGCCAGTGTCATCTAGGTTTAGTGGGGATATGCTGTCTCGTTGTACTCTTTCCGATGCTGGCCCATCCGTGGAAGATCAGTGCAAGAGTTTAGTGGCCAAGCGGACTTGCTTACATACATTGGCGACCCAGCGACAACAAGATATGAGGCCCGGGCCGAGTGCAGTGCTTCTGGTTGTCACACCTGATTTTCGCCTTATGAATTGCTTTTACGACAGGTTAGTTCGGTGTTTCTTAAGAGATACGACAACGTATGAAGTGTTATTGAATTTATGTTTTATAGTGGAATGCATAAACTCTACTTCCATTTACGACAGCGACAGGTCTTCATGGGGCCGTAGGTTAATAGCTGGACGCAAGTGCTTTGTGCATACGACACATAATTCTTATTTATGACATCAGCCAGCCAAACTTGCTTTCAGTACTAGTGCCACCCAGCGGAGATGGCGCTCGCTTGTATACAAGAGAGCTCATAGGCGCAAACCTTGCACCGAGAAGTATGAATGCATCCGTGCGTTCGGCCCCTGTGTGCGCCAGATGGCGCTCCCGCTTTCGGGGTCCTCGTCCCTTCCAACCGTAACAGCGCCATCCTGTCAGGCTATAGGGGCTATCTTATGTCTGATAGTACCGGATACACATAAAATATCCAACGGTTGAATGTCAGACAGAATTAAATTGGCGATAGTGGGAGGAGTCGTTGTTACGGATGTTAGCCAGAACAACTTATTCAGGCTGTAAGCTGACGTGTTATATTAGACGAAGCGGATGACTAGCCGTAAAGCGAGCCAGAGTGTCAGGCGATCTAGGAGATAAACATTGGATAGGAGTCTTCAGTGTTTAGGCGTTGTTAAAGGTCTAAGTCGGAGCCATAAGCATACGGGAGAGCAGCAGTCACAGAGCTGTTAGTCGCAGGTAATACGTAGGCGATTTAAACATAGTCGACAGGAGTGAATTCAGCGGCGACTGTCATCAGGTCGTCCGTTCGTCGTCAATTGATAAATGTTTGTTAAGATAGATTAAGTTAGCGTTGGGTCAGAGAGCCACCGGTTACAAACTGAGGACCAGAAGCAGAAGTATTAGGAGTCGAGAGGGCTTTCGCTTTATAGGTCAAGTCTTCCCATAGATGTTGTAAAGCCCTGATTGTACATATTGGGAGACGAACAAGTGATAGAGACGGTATTTGTCGGCCCATTAGTCATCCTAAGTGTTCATAAACTGGATGAATTAGAGTCACTTGAGAGCTATGTTAAGTGTCAATGATCACGGTCTATATCAACATGTTTATGTTTCAGGAATCCATTTGATGCTTATGAGTATGTCGGTTTCGTAGGGTGCGCATCCTTCGCGGCGCGAACCAATGTAGTAGGAGGGAGGGGGAGCGAGTGATGATCAACGCGATGTTGCGTACGCGAGGAAACAAGATGTTAATACATGCTATGGTTCGTAGTTATGAGAGTGATATTGCGAGTTTAAGCTATCGTTCTGCAGTCTTATGCAAACTGGTTTTCAGGGTGCACGGCCTTTGATCATGTTAACAACTAGGCTCTTAGAGCCAGACATGAAAGGCGTAAATGGCATTGACTATGGAGCTACGTAAAATTTTAGGATGCGCACTGCACAACGTGATTTCTCTGCAGCTGTCACGATTTAGCATCGTCGCGGGGCATTGCTCCCATCCGGTCAAACGCAGATCCAACCTTAATGTCCTTGCGTAATTAAGTAAGTACCGCGGTCATGTCCTTAACAAAGTCAGTGCCATCAACTGCTGGTTTCATTACTCCTGCCTAGCTGAGACCTAACGCCACCAGAGCATGCCATTTATTAGTATCAGGAAAGGCGTAGATGTCTTTCGTTAGAACGTAGGCTGATCCTGGTTAATGAGGCATGATCAGGCCTTACGAGATGAGATGGCTAACCTGGGAGCGATAGCTTTAAGTATTGAATTCTGGCGGTGATATTACAATTCCGTATGCTGTAGGCGTTAAAATCAAAGAGTGGGCTAAAGTTTCAGCCAGAGCTTCCCATAGAGCGTTGCGGGTCGAGTAGCCACTTCGTCGTTTATATGGCTACCAATGCTGGTATAATATCTTAGGGGTGCTGGTTTTAACCATTAGCGTATGTTCTGTGCCGGGCATCTAGCAACATCTGGGGTCATGGAGACCGAAGCTAAGCTGGCATTTTAGGCCCGTGGCGTCGTCGAAGACCATCCATCCGAGGCGATTTAAAACAGGTGGGGGCCTTTTTGCCATGTCGTCTGTGAGTTCATGTGCTCTTTCCTTCGCGCTGGCGACCGTAGTAGTGGCTAAGGGAGGAGCTGGATAACAAGCCAATTAGGCATCAACAGCTAC	*
+40	16	utg000001l	20436	60	9485S14M1I14M2I7M2I10M3I1M1I11M1D2M1D7M1D19M3D8M1D1M2I5M3I3M1D7M5I5M3D7M2D26M6I9M2D15M8D1M3D7M1D6M2I13M3D6M1D8M1I11M1I6M2I5M1I44M3I1M1I10M2D4M2D3M2D10M1D10M1I1M4D10M1I8M1I5M1I12M1I15M3I3M1I2M1D2M1D27M1D20M2D11M2I2M1D2M2D7M1D4M1D1M2D6M1D20M1D23M1D4M2D22M2I22M2I23M2D15M1D40M4I7M2D2M2I3M2D14M2D6M1D12M5D6M4D14M1D6M2D6M2I59M3D16M2I9M1D25M1I4M2D32M2D13M6D7M3D19M2D10M4D4M2I33M1D26M2D21M1D5M1I21M2I35M2I20M2D5M3D28M1I3M2I3M1D4M1D2M2D8M2D3M2D3M1D19M1D18M2D6M5D9M8D1M1D6M2D11M3D4M4D3M2D6M1D7M5D1M7D8M3D9M4D18M1D20M1D6M2D9M2D3M2D4M2D7M1I2M2I26M4D4M3D21M2D5M6D6M1D1M1D1M1D3M1D1M1D5M1D6M3D6M2D1M2D6M1I4M1D5M4D4M1D1M2I12M2D33M2I3M1D11M2D8M1D1M1D13M1I8M1I11M2I7M2D8M2D2M3D21M1I2M1I20M1D18M1D12M1I5M1D6M1I14M1D23M1D2M2I2M1I2M1D11M2D3M1D8M1D5M3D1M1D33M1D5M2D6M3I13M1D1M28D14M2D6M1I17M1D15M85S	*	0	0	ACATCTCAACGCATCAGCTCAACGGTATTGACTTTGACCTTCCAAAACCGGCCTCAAATGCAGCAGCATCGAATCCCCGCCAGGATGGTTGAATCTACCCCTCATTAGTACGCGTGAAACTGGCGGGTCCAGACTGTCCACGCTGACGTTAATGCCAGTAAGTCCCGCATCGCGCCAGCTCGCTACATCGCGTTCCAGACGGTAACCATTGGTTGTGACGCAATCTGGCTTATACGTCGTTTTCCCGCACAGCGGCGATGATATCGGGCAAAGTCGCGCGATAAAGACGGCTCCCTCTCATCTGTACCGCCTCATATTCGGCGAAGGCGCGGATTCAACTGCCCGTGACCCCAAGAAGCCGGTCTCCGGCATTTCTCCTCCTAGCCTGCCCCCTACTTTATTGACTTTAACGAAATACACATCGGTAATCGCAGGCAAGTAAACTACGCGGCAAATGCATCAGTCATAGTTGTGAAGCCAGCATCATCTCCATACGGAGGCGAAGTCATTTCTTCCGCCCTGGCGCAATCTTACGAGCATTGTCCACGGACGATCGTATCACGTATGCAGAGGAGGATGTTTAGCGTCTCATTAGTAAATGGTACTACCATTTGATCCACACCTTCGCTCTGTAATCATGTATAGCTACGTACGGCGGTCGTAAGACTAGAAATGGCGTTTTACTTTGATACATCATCAGGGAGGCAGAGCGTGCATCGTCCTTTAGATAGAAGAAATAGTTTGTATCCTCAATATTGGCAGGTAATTGCTTCCCCGCAATTTGGGCGATGTAGGCGGATAATTACTCCAGGAATCTATATTTAAATCGTACGCTGGCTGATCTTGATCGTCGTCCGGCGGAGGCAGGGAAGGGAATCCCTTCCCTTCTCGCGAGGCTCTGCGGGTCGAATTCGAGGAGCGCCACCGATAATGCGAGCGCACGGGGCGTATTCGCCGTTCAGAAGGCGCATTGCCTGGGAGCTCTTAACTGCCTCAAACCAAGCTGATAACGCAACGAGCGTCGCCTCCGCGATGTTTGAAGCCCGTTTTTGGTGGCAATGGCGAAGCTTCCCGGTCATAATCTCGGAAACTTGATGTTAAAGCGCTGGGGATCACCTTAGCGTGCTGTAGCCTCTGGAAGCCATCAATTTAATTCGTAATCTGTAGCTGAAAGTGGATACGCATTTGATTCCAATGTTAAGAGCATCCTGTTGATCTGATGGCGATTGACGTACTAGCAGTGAAGTTTACGGGGAGATAGCAGTTAACTACGCCGATTCAAGAGTTATTGTTAACGCCCTAGTGTATACCCGCAACGCGTATCGAGATTTCACGCTATCAATGAAGCATCTCATCATCTGTTCTGAGCAGTTTTTATACAGCCTGATGCCAATCTGCTGCTGAATTACGAACCGCCCATGGATCGATCGGGACGCACTTGGATGGTTGAGTCTCCATGCGCGTGCCTTCGGCTAATTGAAGCTGGAAAGCAAGCTGGCAATTATGGAGCAGTATGTTGGTAAAAGGTTTGATGCGAGTCGTCGGCCAAAAGTGGATGTCTGGGTGAAAGAGCATTGTGATCCAGTGTACCGCCACTATATCGGAGCGATGACGGTTGTTACATACGCGCTGGAAAAGGCGTTACAGGCTTTAGGTTACGGAAATCCGAAGGAAATTCCGTTTCCGAAGACAAAGGCGGAGGCTTATGCCGGATGCGCGAACTGCAGTGGAGCGCTACAACGCGCAAACCTCAGAGTGATATGCGGAGAAATGTAGGCTGGACCGTAGCAGAGCGTCGAGTTTTCCGTTTGTCATCAGTCTTCTTTCGCTCCGCTGTTACGATGCCGCGATAAACAGCTCACGCAGTGATGCAACTGGTCACGTAAGAATTTGCTGCCGCTTCTTCGAACTCCAGTTCTGCCCGTTGCATCATCAACCCTTCCAGCTCATGCTTCTGCTGCGATACGCTTCTGCGGGAGCGTCTCATACGGCACATTATCCGGGGCTCAAATCGGTGGATTTTCCTCTGCCGTGCCTTTGGTTTGGCAATGTTCTGCCCAGCGCCAGGATATCGACCACTTTCTTGTTCAAGCCTTGCGGCGTAATCCCCTATTCCTCGTTGTACTTCTGCTGTTTCCACGGCGACGTTTCATCGCCAATCGCTTTCGCCAGGAGCGTGATCGATATCGCCGTAGAGAATCCCTTTACCGTTAACGTCAGCTACGTGCCGCACGACCAATGGTTGGACGAACCATGGAACGCAGTTCGACGCTCCCTACCGTCGAGGATTCACTAACCTCTACGAGATCCGCGCAGTAAGTTGATCCCTACCAGCACGTCGAACTCACCAGACGCAAGTCGCGGATAATCCCATAAGTTCGACGTGTCGATATCTGAGCAAGATAACGCACGCGCTCGCCATGTTCTTCGAGATATTCGGTAAGATTTCCACTCATCCGCTTGGTCCTGACCAGAGATCTCATGCCTCTTCCACTCATTCCACGAGTTTTCATCACCGCTGCAGGCCGCACTTCTACGGGTCAAGCAATCCGGTTGGACGCACCTGAAGGCGAATCGAAGCATCCCCGGATTTGCGAGCGGTACGAGTGCGTCGCGAAACTAGATGGTTGCGGCGCTAATGCTTCGAACTCTTCAACTTAAGGGACGGTTATCCAGCTGATGGCAGGCGAAGGGCCATTCTACCAGTGTCTCTTACGCCTAGCCCGTACCGCGATACATGCCGCCAATTGTGGAATGGTGACGTGAGATTCATTGACGACCAGCAGCCATTCAAGCAGGCGATCAACATCAGGCGTCGGTGGCGCCGAGTCAGCAGACGGAGAGGAAGGGGTAGTTTTCAATCCCCCGAACAGTAGCCGCCAGCCAGAGTCTCCAAACTGCGTACGCTGGGATACTCACGCTGCTCTTCAGCAGTTTTGTTGTTTTCCAACAGCACTTCGTCTGGCGGCCAGCTCTTCTTTGACCCTCCATCGCCTGAGATCCTCGCGGTTTGCGTTCCTTCGGCTGGGTAAAACGGAATAGTGGAACAATCTGCCCGGTCAGCGGGTCAAATAACGACAATCGTTCCACTTCCTCGTCAAACAGTTCCACGCGAAGTGCATCGATTTGATCGTTGGGACATATCTATACCTGGCCACGAACGCTGAAATCACGCTGGAATGAGCATCATTACGAGCGTATTGCAGCTCTCAGTCGGGAATCGCGCTGATCGATAATCATACCGACCGTGAGATGGAGCATCAGTCTTGATATAATCAGGACTGCCAGACCATAAATCGCGGAAAGACGCCACCAAATACGCCGCTCCAGCAATGCCGCTTTAAAACGCATTGCTCAATATGTTCCGTTAACCGAGGCATCTTTCTCAATGAAAGCTGGAACTTGGGGAGTAAGGCTTCCAGGCGAGCGGGAGGAACGAAAGATGCACCGCGAATTTCCCAAGGAGAACTTCCCTTCCCCCTCGGGGCCGCCAGCGTTTTGTTGGGCGCAAGTACCATGGTTGGGCGCTGAATAAGCAATGACATTGGCAATGGTGAAGGTTTTCCCGGTGAGCCAGTCACGCCACAGTAACGTCTGCTAGGGGCCGTATCTTCCAGCCCCTTCGAGACGTCGAATTCCCGGAGCGATCGCCAGAAGGTTTAAACCGGAATTCAGTTTGAACGGTTGTTCATGAGGTCTGACGTTGGTGGTAAGCTCAATTATCGTCGTATTTAAGCGTCGCCAACACGCTACTCAAAAGTTCTGATACCATAATTGCAGCGGTAACTCCGTCAATCATGAGCACGTACTTAGGGTTAAACTCCACCGGTCCCCAACGGACGGGCTTTTTAACATTTGTCACGATGAGTGATGACAGTTTTATGAGGCAAGAGATGCCTGTCAGTGACTGCCATTGCATTTATCTAACCAGTTAAAATAAAAGATATTCTTTGAGCCGTCTTTAACGCCAATTCGCGTGCAAGCCGCGGTACTCGTCGCTTGCCGCGGCTTTCTATACTCTAATACACCGGGTTATCCACAGGAATAGTGGATAACTGTCTCCAGCCTATTCCCCCGCCGCCTGGGCAATTCCCACATTCGCTTAACTGTCTGACGAATTTATTGATTATCTAGTGAATTTGGCACGGTTAAATGCAGTCAATCGTCGAAGACGCATCTCGCTGCAGTGTAACCAAATACAGAATGGCTACAACAAGGCAAGGTTTATGTACTTTCCTTCATGCCGCATTTTCTGGATTTTCCTGCACTGTTACGAGGACTGAATCTCCCAGCAGGCGCGGAGAATCTGGCGAGCGCGAGTCATCCAGGGCTAATCTCCCGCTTAGAAGATTCGTTCGCCCACGACCCGCCAGTATCAGTCACCCGGCGTGTTGTATTACCTGTGCAGTCAACATCGCGTGATTAATACAGCCGAGTTTCACAGACCACCCAGTATCACCGGCAGTTCCTCTTGTTACCAATCTGCAAAGGTGAAATGTCAGAAAGCGGCGTGCTCAACAGCCGCCAGCACCTTCCACTAACACCCAGTCAGCCTGTTACAGTGCGTAATCGGCTTGCCCTGGCTTCCTCCTTCCTGGTGCGCTGATGATGTGCGGCGAAGTGGGTTCTGCGGAATGTAAGGATTTACTGTTGCGTAATCCAGCTTGCAGGCTTCAGCATCGTGCTGTAACGCCAGCGTCGCTTGCGTAAACCTTCCGGGGTCTTCGCTGCCAGAGGGAACCGGTTTATAACCTGGTCCCCCGCTCGTTGCGGTTGTAAAAGGCACAACGGTGACAGTTTTCCTAATTTGCGGAGCGCTTGTAGACAAAATAAAGGAGGCTCACGTTAATCGCCAAAAGATGATACCATAGATACCTGCCTTGCTTCCTCAGGCCACAGTTGCAATCGCTGCAACTGTGAACGCGTTAATATTTCTAGGTCGCGCCCTTCATGAAGATGCGGCACCGATGCCTTTCAGCGAACGCATCGCACTGAGCGCATCATCAACAAGGGTCGCTGAATATGATGTTGATAATGCACGCCATCCAGTGACGGCTCGATTGCCAGCGGTAAAAGGGCACCGTGCATGTGGACGCTGGATGCCCCCTCTGTACTCCATGCAGTTCGGGTAACGATCCCTGCACCGATCAGCGTGGTAACGGGACCACGCGTCTCGGCGCACCAGGGAGCTCGCGCGACCCCGTAAGAAAGAGCCCGCACCACATGCACTGCGGATGCGCCTCATGCAGATCGAACGTCGCAGTCGCTAACGGCAGGATTCACCATCTCCCGCCAGATAATGGTCTTGCGGCATCCTCTAGCGTTGAACAGCATTGGGGCGGCGAGAGATCTAAGGCCGTCACCTGCGTGTTGACGTTCCCGCCAGTGGCGGCTCATCCAGCCGTCCCAACCCCGTCAGTACGTGCTGTATATTACGCTGTGGAAGCATTGCCAGTAAGGGTCAGCAGATAATATGGCGCTTAGATCTGCATGTTGCTCATAGTGTCGGCTGCCCGACCAATGCCGCTCGCAATGGCCTCGTTTATTAACCTCATTTGCCATGCAGCACCTCCAGCAACGGGTCGATATCCTGCAATTCGTTTGTGCAGCGTCCTGTTAAGTGCAGTCGCGCAGTACCAGGGGTACGGTTGGCGGGCGAATCGCCGTGACCCAGCAGCCTTGCTGACGCAGTTTTTCTGCCAGTTTGTAACGCACGGCTGTTATCAACACGGCTCGATCGGCGCTGCATGAATTAAAGCGGTAAACGGCAAATCCTGTACTGTAACGAACGGGGGATAGCCTCGCGTGCCATATCTAGTGCCCACTTCGAAGGACCGCCAGCGACGGACTAATTGCGCCTGAGCGGCGGCATACTGATAAGTGCTGTAACGCAGATAATCCGCCACCGTACTGGAGCAAAGCAAGCGCTGCCCCGCTGACGCCAAATCCCTTTGCAGCCGAGAAAGTCCATTACCAATTGGGAGGCCGCAGGAGTAAGGCCCCGCCGCGCCCCCTGCCTCCCCGATAACGCCCGTCCGTTCCATCGACCATCAACCAGCCATTGTGCTGTTGCGTTACCTGCTGGGATTTCCGCTTCATTTTAATCAGCCGCCGCCTGAAACACGCCTTCTGTCACCATTTGCTGCCTAGACAGGGGAAGCAAGCAATCGCTAAAGCTATGGCCATACTTCTGCGCCAATTCCTGCAAGCTGCGACGGGCTTAAACGGCAGCTTCCAGCACATGAGGACTGGCTAAGCCGGTCGGCAGCAAGTCACGGTCCCCCTTCGCTTCATCATCGCGGACTGAGACTCTGCCTGATTAGCGGCGAACCAGAGATAAACAGCAGTGCCCGGAATAGCCATCCATCCGGCTCTTCTTCCAGTGCCTGATGACCACGCTATAACCGCTGACTTATGGAGCCGCCCCCACCCTCTAATGCCAAATTGCTCCGCCCCCTGCTGCCAGGCACGGATAATTTGCGGATGATGGCTTAAAGCAAATAATCGTCATGGAAAAGTTCAGATACGGTGATAGCCACCATAGCTCGTTCCGGTGCACCGTAAGATAACGGCCGACGCAGGCATCGGCAACGCCTAGCGCATCGAGCGCCGCGTTGTTCTCCCTGCCAGCTCGTCATGCTGCTCTGATCACTGTCGGTGTTGTTCGTATACCATGCCGCTAACGAGATGTTAAGAGATTCCCTGGTTCCTTATCTTCCTTCCAGATGTCGGGAACAGTCACGAACGTTAGGCTTTGCTGGGATTCGGCGAGAGATACGAGTTTGCACGTGAAATTCAGCCTGCCATAAAGCACATCGCCTGAGTCTGTTCGTTCATCTGCATCGCGTCCGGCAGAAAGGCGACGTAAGAGGATTGGATACGATGATTTGTGGGAAGCGCAATGGTGCGGTCAAATCAAAGGCATTGACGATGGTAGTCGGCCAACCCGCTCGTGCCTTTCATCTCACTAATGTTTAGCACGCTCCTGTCTGATTATCTCAGTTGCAGCAATAATCCGGCGCGATCTTTACCGTTTCAGCAGCCCACAATGCCGCTAAGAACATAACCGATCCGCATCGCGCACCCTTTCCAAGCGTATCGAGGCGTTCCTGATAAGTGCGTGGGCGATGATGTCGCCGTAAAACTCCGGCTAAGAGATGTCACGGTGTTGGTTGTAAACGTACCACCGGCGTTCGCGCCTTCTATTTCCTTCAACGGAGGGTCACGCCTCCAGCCGTCACGCTTTACCCTGCACCATTTGTTCCAGGTACGGCATATCGCGTTCGTGGGATTCTTCCACGCCTAGGCCCATAAAGGCGCTGATTCATTTGCCGCGTTTTCGCCCCTGACTCTAATCAGCACCTGTTCAACTTCCATCAACCGCTTCTATTCCAGCCTACCGGTTTTGTTGGGCAGTATTTGCAATCTTCCCGGACACTCGAGCGCACTGACAGGACTAGCCGATTTGTAATACAGCTCAACGTTAATCTGAATGCTAGTGGGCGATGCAGCATGCTGGCTTCAACAGCACTCAGCAACGGTTTTTCAAATAATTCTGTGACTTGCAAGGTGTCCAGCGGTGAGCCGGGCTTCTCCAAACGTGTTTGTTGTTAATTCGGGTGACTTGTAACCTAAATCTTTCAAGTTTTGGTTTACAAGTGATTATGACAACGGACGATCTTGCGTTTGACCAACTCATATCTGATACCCATACATCCATGACCTCCCTCTGCCGGTTTATCCTTGGTGAGCGCTGAAGGTTGCGAGCTGATTTTTGACGGCACGCCTCAGTTGACGGTATGTCGTCCTGGTGGGCGGCGATTACACGGCTAATCACCGCACAAGCTTAATGCGGCGATGAAGTCGCAAACAATGATATCCAAGTCTGCAAGTCGTTTGGCGGTATCAGCCCGGGCGCCAGCCGGTATTGAGCTGTGCCGCAAACTGTTGAAAGCCCCGCAACCGCTCGTTTTGGCTTGGGGCCACGGTTCCGTAGCGTGGAAGTGGCGATGAAATGGCGTTGCAATACGGCAAGCCAAAGCGAAGCGCGCCAGCGTTTTCTGACCCTTCCGCAATGGTTATTCTAGATATTACAACGGTTGGCGGGATAGGGATAACGCATGCACAGTCTGTGGAAAGGCTATGTGCCAGAAAACCTGTTCTAAATGCATGGATGGCGAATGGGATGAGCGCGATATGGTGGGCTTCGCCCGCCTGATGGCGGCGCATCGTCATGAAATCGCGGCGATTGATCGATTACCGGATGCGCTTACATGGAATCGGGAGCAACGAAGTGCACCTGTACTGAAGTATCGATTGCCGACGAGATCTCACTGTAACATGAGTGGATTTAGAACTCTGCCTAGTTGAACACCCTGCAGAAATTGGTGCACAGTCGCCTCGGTAAAGCCTAAAGGGGGCAAGTACTTGCCTTACACTCAGAAACGCGGTGATGGTCGTAGCCGGGAAACCACCCAACTGTTTAAATGTTGGTTGGGTGAGCGCAGCGACTTATGGGCAATTGCTTTTGTTGGTAGCGCCTAAAATTCAGCCTGTGATCGGCGAATTGGGGATCGGCAGCAACAGGGGTGACCCGAAGGCAGAATGCGGAGACCCTGCGCTGTACCGTGAGTCTCGTTGAACGGTTGCCTGATGCGGCCTCTTTATGGGCGATCGGGGCCAGGGGCGGCTGAACTAAGTGCTGAATTTTCTAGCTTATGCAAATGCGTGAACAGGGGCTGCATCTGTTGGCAAACCCCACAGCTTAGATATGCCCCGCCGTGAGGTCGTACTCTCCCGGCAACAGTTGCAGCGTCTGACCGCAGCGGTTAACACCGCGGTACAGGATGAAACATTTGCCAATAACGAGAAGTCCGCGTGCGAGGGTCTGGCTACACTTTTGGCAACAAGAAAGGAGGGTTCATGAAACTAGATAGTAACGATTTGCGCGATGGCGGCTATTACGACGCGTCGTCCGTCTTTAACGGCATCTCATACGATGTGATAATATCCACTGCATCTGTGCTACGTACTTCCTGCGAGGAACGAAAGTTTTGTTGTCCACCTGCATACGACCGGGACGCGCCAACGCGGCTCGGCTGGGGCACTGGGTGTTGAGTAGACTATTACCCCGATATGCGTATACCGCAAGGTTTGGCTCTGGTCTGTAGCAATGCGACGGCGTTGCCGGACGCGTATCGACTTTGGTAAACCGGGTACGATGGCGCATCCGCGCCGAAAGGCGATGACGGACGCATACGCCATTTTACCGTTTAATTCCCGGATATAGAACGTAGGTGATGTCGATGAATAGGTGCCAGGCGCGATGGCTCGGGATTAACCAGCCATGCGTTCCGGCAGCGCCTGATTACTGGGAGGAGGCGATAATCATCTCTGCCACGATGGCGTGCAATGCCATCTCACTTAACGTATTAAACAACTTTATTTGTCTTTACTTTCCCGTTTGGCTCATACGTCATAAAAGCTGAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATTAGATTTGCATAAAAAGACTACATAATACTGTAAACACAACATATGCAGTCACTATGAATCAACTATGCGGATGGTATTAGTGACCTGTAACAGAGCATTAGCAATGATTTTTGTCTTCTTGCCTAATTTGTCATCAACTGTCGCACTCCAGAAGCACAAAGCCTCGCAATCTAGTGCAATGTGCCACCACTACGACCTGCATAACCAGGTAAGAAGATAGCAAGTGATGTCAAACGACGCAGCTGACTTCTTTCTTTCACGACTTCTATCTCGCCTCCAGCGCTTCTTATATTCGAAGTCTGTTGATGAGGGAGCGGAAGTTAACACTATGAAAAGCGGCTACGAAGTCCGTGGCTATCTATCGGCTTATCTATATTGAAACGCTTCTTCAGAAGCCTGAAGAGCTAATCGTTTGGCGATACTATATGCATTAATAGACTATCGTTGTATAAAAGAGGCACCATGGACAGCAAGTACGTGGGTTATCCAAAAGGAAGCAGAAGCAATATGGAAAACTAATACGATGCCCCGTTAAGTTCAATACTACTAATTTTTAGATGGAAAACGTATGTAATAGAGAGTAACTTAAAAGAGATCCTGTGTTGCCGCCAAATAAATTGCGGTTATTTAGGCGGCAGAATAGCAGGAGGTGGAGGCTGGAGGCGCGAGGAAAGAGGCGGTTCCTGCAGTAGAAAAATAAGCATTCACGAGCAGATGGTTGGAATGACTATTCCTTTGTTACAATGTTTTATCTTACTGTCTTTGATGAGCATGTGAAAATGCGATATCCTAGAAATGTTAAATTGGTTTTGTAGTCAAAAGAAGAAATAAGCACTTATTCATTAATAGATAAAATTCAGTCACTCCCTGAAATGCCTTCCGAAAGCATTGACTACTATGTCATCTCAGCAAAGCATGATGGTTTAACATAACCTTCTTAAAGCTATTCAGCTTTAGTAGTATGGCCAAATCGATTAGCCGACATTGAAATGAAAGCGTCGTGTAACACCTCATTACTTAGAGGCTGGTAACTCTTTCAGAAATTCATGGACAGTTCGCACGTGTGTTAAATGGTTTGCCAGAATTGTCCATTCCACTTTCATTTAATAGAAAGTGCTGTACGCCGATTAACTATACCTTTTGCTGACGGTTAATTCTATGCCAGCACGAACATTCATGCTTTTATCGTAAATGGGTAAACAATTTTGAATGGAATGATTTCTAACTAATAGAAAGGCCCTGAAATAGTAAGCCGAGTCAAGAATCCCAAAGGATATCTTCGGATCGCTTGTTCCGTGCTTCCTGCCTGCCTTCTCTTCCATACGAACAACCTGACCCAGCAAAAGGTACACTTTTTATTGACTCAAGAATGCTGCCAGCATTAAAATCAGGGTTTGCCTTTGACGGTTTGTTTAATGAGCGATGAGTATAGATAGAAAAAGACAACTGGCTTGAAGCTATCAAAACTAAGTAGTGATGAAAACTTTCAAATATGGAACCCATATTTCATTTCTAAATATGAAGAGTTAAGACGTAATGAGAACCACAGATTCAATGGACGATGATAAATTCACTAAATTGTTTTATGACACTCCCAGAAATCTGCTTCGAATGAGCTCTGGACATGCAATTGGTTTATTTACTATCACAAGATTAGTAATGTCGTTGGCGAAAGTCATTATCTAGTTCGTGTCGATGAACCAGGATCCACCTCACGTACTTTGCTCTCTGCTTTTACGAACATTAAGCGACTTATCCATGCACGCCGCAATGGTGAAGGACCTGCAACTCATTCCAGTATATACTGCAAGAGGTTCCAAATCCTGCATGTGGAAAGTGTAACGGTCGGAGCAGCACTCCTCTTACGTCGCCTTGCGACATTCGTGAGAACTAGGCGAGCGATGGACGACCCGCATCT	*	tp:A:P	cm:i:42	s1:i:347	s2:i:0	NM:i:537	ms:i:1130	AS:i:1138	nn:i:0
+41	16	utg000001l	27001	60	387S10M2D4M2I7M1D5M1I13M1D6M2I16M2D4M2D12M1D5M1D9M1D7M5D9M1I12M1D6M2D16M4I2M1I3M3I9M1D2M3D5M1I3M3I2M1I2M2I27M1D1M1D6M1D7M1I11M1I14M1D3M2D6M1I6M2D23M1I8M2I8M1D1M5D2M1D4M1D10M1D14M5I2M5I5M1I1M3D14M4D20M1I12M1D3M1I7M2I1M1D4M2D2M2D5M1D11M6I5M2I4M1I4M1I1M2D15M2I9M1I12M1I6M1I3M3I5M1D3M1I6M3D7M1D9M2I10M1D1M1D29M1I4M1I3M2I6M8D2M2I16M3D11M1D11M1D1M1D2M1D1M1D3M2D40M2D4M2I16M1I4M2D1M1D13M2D3M3D23M1D20M3D10M2I11M2I14M2D13M1I10M2D9M3D2M2I20M1D1M1D5M4D7M1D3M3I4M1D2M1I7M3D1M2D10M1D2M1D4M2I20M1D4M3I2M1I2M4D6M1D10M1I5M2D31M1I3M3D3M3D5M1D10M2I7M1I3M4I7M2D9M1D1M1D8M4I2M1I14M1D4M2I10M1D13M3D5M1D47M2D5M1D12M3D11M9I4M2I5M1D6M2I2M2I2M1D2M1D2M2I5M2I8M1D19M1D7M1D4M4D6M2D17M6D6M2D2M1D8M1D3M3D6M3D4M1D4M1D4M1I1M1I2M1I1M2I5M2D5M1D8M1D4M1D8M1D5M1D16M1I1M3I7M7D8M2D7M1I10M1D10M2D4M2D1M1I13M4I5M1I12M2I2M3D18M1I7M1I1M2I16M4I1M1D5M4D11M1I1M2I7M1I1M1I5M3D2M3D2M2D5M2D6M2I5M2D7M3I29M1I8M3D17M2I5M1D8M1I1M1I3M1I5M1D8M4D5M1I5M1I12M1D9M1D3M1D4M1I3M1D9M2D25M1D8M3D4M1I14M1I7M6D3M1I1M1I2M1D28M3D2M1I3M2I11M1D3M2I7M2D2M1I19M1I5M1D2M2D4M2D5M2I2M1D2M1I2M1D5M1I15M2D26M1I8M6D4M1D1M1D2M1D3M1I5M1I6M5I1M1I9M2D6M1D7M4D5M1D5M1I2M1I5M1D4M3D2M1I4M5D10M2D1M1D2M1D6M1I4M2I2M2I3M2D13M1D3M4D4M1D2M3I2M1D11M1D5M2D1M1D5M2D10M1I7M1I2M2I5M1D1M4D7M2I6M5D12M2D9M3I1M2I2M1D7M1I9M2D10M3D13M1I12M1D10M1I12M2D17M1I7M1I11M1I6M4D1M1D7M2I8M1D12M2D2M2D6M2I3M1I1M1I6M2D2M2D3M2D18M4D2M1D3M1I7M7D3M6D15M1D18M1D2M1D21M1D3M3D2M1I5M1D21M1I5M1D22M1D10M2D7M2I3M1I14M3D9M1I6M1D25M1D9M2I35M1D4M5I4M3I9M1D16M1D6M1I2M2D8M3D3M5D13M4I6M1D2M2I11M1I2M1D1M1D3M1I5M1I3M1I10M1I5M1D2M1D37M1D3M2I12M4D5M4I4M1D9M3I1M1I6M2D4M1D2M3D2M1I4M1I9M1D8M1I19M7I6M1D15M5D4M1D3M1D5M1I11M1I31M1D4M1D2M3D1M2D24M1I16M1D1M2I18M2I3M1I9M1I12M1I3M3D5M1I11M1D6M1D2M2D8M1I8M2I21M2D11M1I1M2D2M1I19M3I13M1I2M1I12M2D5M1D12M1I3M1D7M2D1M1D10M2I4M1I42M1D1M2I8M2D7M1I16M1D6M1I7M2I5M3I6M1I7M2D4M1D28M3I8M1I5M1I1M3I5M1I8M1I5M2I3M3D2M2I12M3D1M2I3M1D4M1D4M5I1M2I1M1I2M1D5M1I10M1I5M3D13M2D1M1D6M1D6M3I4M6D5M2D8M1I5M1D1M1D10M1D11M2I2M2D5M1I4M2D4M2I20M3D1M2D13M1D1M1D8M1I4M1D15M3I3M1I22M1D8M5D14M1D4M2I6M2D4M3D24M3D5M1I15M2I4M4D4M1I2M5D1M2D2M1D13M2D6M1D19M1D16M3D12M2I16M3D4M2D3M1I4M2D10M2I10M1I5M1D8M2D8M1I1M1I18M5D5M4D10M4I4M4D5M1I9M3I28M1D9M1I5M1I4M1I6M1I4M1D9M1I2M1D13M1D3M2I1M1D2M1I10M1D3M1I12M1D15M6D3M5D2M1D3M1I11M1D8M2D1M1D5M1I12M2D13M1I17M2D8M3D5M1I6M1D4M5D15M2I12M2I24M7D5M3I5M1I22M2I3M1I4M2I2M1I10M1D4M2D3M5D5M1I6M1I5M6I15M3I3M1D5M2D6M1D21M1D11M1D1M4I6M2I14M1I1M1I4M2D2M4D4M2D6M1D4M1D11M1D6M2D9M1I3M1D3M1I8M1D21M1I3M1I1M1I14M1D5M1I3M1I1M1I7M1D4M3I5M2D6M3D2M1I10M2D22M1I3M2I2M2D3M1D20M1D9M1D19M2D8M1D1M3I12M3I6M3D3M5D5M2I3M1D4M1I11M1D8M4I8M1D20M1D5M1I3M4I4M2I5M1D1M2D13M1D28M1D19M1D27M2D7M1I5M1I2M1I7M1D5M4I9M2D10M1D16M2I14M4I24M2D4M4I6M1D5M2D7M1D2M2I10M1D27M1I7M1I8M1D2M2I5M2D3M3D26M4D18M2I1M1D4M1I10M1I1M3D3M1D10M1I5M1D3M2I8M3D15M1D2M1D8M1I2M2I7M2D11M1I8M4I2M1I7M1I4M1D3M1D7M1I7M2I16M1D7M3D3M1D2M2I4M1I2M2I4M1I2M2D3M1D5M1D7M1D3M1D3M5D4M3D1M4D3M1D6M1D5M5I6M3I2M1I2M1I2M2I2M1D5M3I9M6I2M1I6M2D5M1I17M2D7M1D20M2I19M1D4M1I17M1I8M2D6M1I26M1I4M1I4M1I34M1D16M1I5M117S	*	0	0	GTATCTAGAGTGTGCCACCCTCGGTACTCAGTCGATCAGTCACGGCAATGAGGCGAGTCGGTGGTAGCAAAATCTGGATTGGTTTCCCGTGGAGGGCGCTGCGCCAGTTCATTCATTTGTTACCAAGCGCCGTTAGTGCGTCAGGTGACGCGTCGATAACATCTGCAATTCAGTTACAAAGCGGTTGCAATCTGGGTTTGTTTGTTCCCCTGAGCGCGGTTGGTGCTGTGGCCGGTTCCGTCATGCAGTTAGGACGTAGAGCGCGTAGCGCGTACTGGTTTCACCGTATTACCAGCAATGCCCTGGCCGCAGCACCGGTTGGGCACGTCGAGAGGCGGTTTAGACGTGAGCTGCACTATCCCCTTTCTCGTTGTAGGGACTCCGCATGCGACAGCTGAAGCTATATCTGCGCACGTTTTGCCGAATTTTTACGTATCTTGCCGCCGCTTCTGCCGCAATTGCTCTGCGATGCTTACACCGCACTCCTTATTCACCCTTCGTGCTGCCTTCGTGTTCCCTGACGCCATCCCTGCTTCCCTTCTGCCCTCCTTCCCGCGCAGCTCGCGTCGGTCAGCCTTGCTGTTTCAGATGACCTGGCATTCGTTGGGACGTTTTGCCGCCTGGCAGAATCTTCTGCCGCCGTTGCGAACCGTTCGTTCAATGATTTGATGATGCGTTCGGGCCGGGGTTGATACTTTGCTGCCGCGGCCTACCGCATCTGGGCGGAAGTGGCGGCCGCCTAAAGCCGTCGCGTCGTGGTCCGCGTGGAAGCAGACGTGGCGGCTGATTGTTGTGACGCTGCAGGCATTCGACGTTCTCGCTAGCCCGGCACTAACTGTTCGCCGCGTTTTGAGGACTGCCGGCTGCTGCAATTTTGTCGCCTTCAGGTGGCCTTTGCTGATGCCGCTTCGATCAACGGACATTCCTGAGCTGACGATGCAGCCTATGTCCGGCGTCGACGGGCGGCCGGCGCGCGCGCAGTCAGTATGCAGTCAATGTTGTAGATTACTGAGCAGCTGATGCACTGGCATCGCCGGCTGATTTCTGCTTGCTCATTGGCGCCACCACGGACGCGTTACGCGCTACCTCTTCACATACCATGGCAAGACGATTCAAGGATGGGCCGGGCATCATCCTCGTCATGGCACAGAGAAAATCATTCAGCACCCCGGTTGTGAATCTTCATACAATTGGTGATGGTCATCCGTGCGATGGTGGGAAAACCGTCAACTATGCAGGATGACTGTACTGGTTCACTCCACATCCATGCTGTAAGCCGGCTTCATCCGATTCCTCTGGCTCACCGCGAGCCACCGTGGGCGTGAGTCGTCTGGCTTTCAGCTGAATGTGCTTAAGTTCTACCGGTTTTCCTGTGCCGTCTTCAGGACTCCTGAAATCTTTACTGCCGCCTCGATACACGCCTACGCTGCCTGCGGGGCTGTCAATACTCTATGTGCTCTGGCTAGTACATTTACACTCTACGCTACCCCAACGATGAATCGTCGTCAGTACGGGGTCGCCACTGCCGGAGCTTCATAAGCAATATCAACAACGACGGACGCTGCCGGATTAATTGGTCTGCATTCCACGGTACTGTATGCTGCATCGACCCGCGCGCAGGCTGTCTCGCTGCCAGGATTGGCGATTGCCTGATCCAAGCCAGCGCGATTCATTAAATACGTAATCCTTATCAGGTCCCTACCGGGGAAGCAATTGACTTGCTTGACCTGTCAACGTGTACCGGTGGTTACAGCCTACATAACGTACGCAGCTCTCATGAACCATCCTCCAGGGTACTACCGTGCTGCTCTATGGGTTCTTTGTGACGTGACCGTCAGTCGGTACGGTGCCGTCAGCCCAACGACCTCACGTTAATCCTAGGCTCCATAATGATTCACACATCGTCCTCCCGGTTCAACGACGGCAATGTCAGGTCGGTTTCATTTGAAATCTTAAGGCCAAACGTACCATAGTATCTGGACTGTCCCACCCGTCGGCCCGCAAGGATGGGGAAGACAGCCAAACGGCAATACACATTACGCATCGTTCACTCTCACTGTTAATCAACGCCCGTTCCCGCGGACGAACCTCTGACACTCAGACCACGCTGATGCCAGCGCCTGTTTCTTAATTACCAGACCTGCAAGCCTTACAACCATACGGCGGAATATATGCCGAATGCCGTGGACGTACGCGAACGTCAGGATCACGATGCCTACAGAGCTGGCATGTCAAATACGGGGAAATACCTGTACCGCCTCTCAGCCTAGCCATCATAGACACGACGCACAGGAGCCAGTATTTTCAGATAACACTGGCACGGTCCCTGCTTAGAAGATAACCTTGTACTTCTAGAAACGTCAGCAAAGCACCACTATCTGGCGATCAAAAGGATGAGTCCGTACACGTACGTCACGATAAAACCTTAAAGCCAGGATTGCCTCACGCCCCGGAAAGCTTGTTGCTCCAGCAAGCGCTGACGGTTTCCGCTGAGCGTACACGTTTATCGTACAGTTTTCAGCTAGGTTTACGAGTCTACCCGGAGTTCGACGCATTGCCACTGATATCCGCCATTTAGCGGTCAGCTTCGGCTGTCCAGGGAAAGGCCGGAGGATTGCCGCCCCTCAAGCATGGTGGGGGCCGTCAGGCGGTTTCAGGAACACGTCGTTCATGAATATCTGGTTGCCCTGCGCCACAAACATCGGCGTTATTCATTCCCGTTTGCCGGGTCAATAAAATGCGATACGGATTGGCCGGGGCAACCAGAAACTCAGGTTTAGCTTTCTCGTGTCCTCCATGCTGAGGCCATCGACATAATGTTTGCCGTCGTTTGACTAAACTCACGCATTCGATTATCACGGCATCCTTCGACTCTTTCGAAACTCCTCCAGTCTGCTGAGGTTCTGTGTTACTCGACTTTTCCAGCAGCTCCTTGCCGGATGGGATTCGGTTATCTTGCCTTGAAAATCCAGGACCTTCTTCTCGCATCATCGCTGGGACCGACGGCCTCCACGAATGCCCGTGCCAACGGTGTTCACTGCGGATATAAAAAGTAATAATCATGGCCCGGTTCCATATTGATACGGCGGAGTAGCTCCAGAGTACAGCGCGAGACGCAGTCAATGCGGGTGCCTCTTCACCCCTGGCATCTGGTAATTCGCCCCCAGAACCAGAACTCAAACTGTACCGTCCGTATACATAAACGGCAAGAGTCCGGGTGGCGGTTATCGAAAATAGCCCGGCGTCAGCTCAATCCGGACCCTATGCTGCCGCTGGCAATTGAGCCAGAACGATACCGACGCTGGATCGCCTAGTGCTGCCCCCACGCATTACTTCACGGACTGTCAGCTCGTAGTTCGTTCCACCAGCGCCCAGTTGCGTGAATGGTATGTGGTTTCCGTCGTCCGGGCCGTGCTGACCAGCCGCTCACTGCCGTCGTCCATGTCATGACGGAGCAGGAAACTCACGGTGTCTCATCACCTTCGGTGTGTCCCATCGCGCCAGCACCTGATATTCCCCGCTGTCTTGCAGTGACTTCTTGCCATGTCGCTGCAGCGCTGTGGCGATCACCATTCTACCGTGTCGGCCGCTACTCGCTATAGAATTAGCCCCGTTATCTAATCGGCCTCTTTGCGGACAAGTGCCGCTGCACGGCGGTGATGTGGCATACGTGCCGTCGTCCGACGTACGACTCACTTAAACCCGCCTGCTAGCAGCGTGATGGCGCAGCTTCAGCTGCGATAAGCTCCATTCAGCACATGTATTTAAACACGTGTTGGAGCCTTCACGCCGTCGGTGACGGACTGAACCTCACCACGATTATGACCGGGATTGCCTTCCGTCAACCAGGCTTATCAGCGCGGTACCGGAGGATGGCAGCGTAAGTCGGTTCACGGTCGAGCGTTTAGCTAGTCGCTTAGTCTGGCTGTTGATTCACTAACACGACCACGACTAGCGATACATGCATGATAGATGATGCATACACTTCAATAACATCGCCGGTACTTAGCCAACCCCCTTTGCCTGACGCGAAATCCACGGCTTCATGCCTAAGGCTTCTGTTTTAATCAGCGCCACAGCCCGGCGCGGCTGCCCCCGGCTGGTACGCGAATGCATTCATTTCGTAACATTACGAAAGGGTAAACGGGCAATGGCCTGCGTCCTCAACATCTGTCGCCGTCTCCAGCCGTCATAGTCGGTACGAGTTCACCTCAACGGCATTATGGCGGTCTATTCAGGGCGCTCAATTATGTAGGCTCTAGCGCCGTAATAGTCGATCACCGATTACTGCGGTTATAAATCACGTCTTATCCGACGAGCCCTGCACGACGACGTCAGCGTCTGCCCGTCCCCACCGCAGGCATCGCGAGCAGAAATCGCTCGAGCAAGCAATGCTAGGATGTCGCGGGAGCCACGCAGAGCAGCCGCGTAGCGTGCCGCCAAACCGTCGGCGGACTGACTGTACCTCGCAGTACTGGCCGATGACATACAGCCCATTTATCACACATCCGCCGCACTCACAGACGCTTCCCCAGTGCGTAGCGGATGGGTCAGCATATCCCACAGACACAGAGCGATGTTGTCGGGTATGCCCCATTAAACCCCCAGATAAGCCGGGTCTGCTGCGGTCCGTTCCGACGGCACCTGCAGAATACGCCCGTAGCAGATGATAATTACGGCTCATGCTGGCTGCCGAACGGTCTATCATGCACGCCGACCAGTGCCGTGTTCGGGTAGCACGGTTCGCATCGATGATTTCATGTATGACGACCAGAGCGTTTTGTTCTGCAGCTGGTCTGTGGTGGGCGTTCTAAGCGTGGTACCTTAGGGTACAGTAGGAACGGTCCCTGGGGCGCGGCGGCATGCAGTACCATACCACGCCGGAGGCTTCGGCGCGGCTCTGCGCGCTGGTTTGGGGGTCCTGGCTCTTGTCTTTCCGTCACCCAGACCTCACGTTGGTTTGACCAGCAGGCGGACTTCTACGGATTCACTGTCAGCCCTTTGAGTGGTTTCCACCAGTGCCTGTACACTACCGAAAGTAAAGGCAGGACGTATGATGTTGCAGACATTATCCAATGGCGGATTCTTTCATATTCCCATTTCCGTACCCAGCACCGTCGCCGTTAGGGAGCTTCAAATCCTCCGGCGGAGTCTGCTCCGCTCACCAGCCCGGAACACACCGTGACACCGGATATGTTGGGAGCCTCCCCTTGTTGCTCAACGGCGTACTGTTCATCAGCACGCTTTACGGTATCAACTAGACCTTCAATCGGCCCTTCGCTGATCGGCTCTAATTGTAACCACTCAGCAACTTCGTGGACTTCAGGTTGTCCTTCATTCGCGCGGGGGATGCCTTACTGCTTCCTTACCCATTCCTCACGCTCCATAAATGAAGACCGCCCGCAGGCGGTTTCACATAAAACATTTTGCATCAGACCAATCACCAACCTGACACCGTCCGGTCTTCGTCTGCCGTGATGGCTGATCTCCTGAGAAACCACGCGTGACCCCACGCGCGGTTCCTACATAAAGTCGAAGAACATTGCCCTGGGCAACCATGTTATCCAGTGAGGAGAAATCATGGTTTACGTATGTGCTTAGTCGTCTGAGATCGGTGGTCTCGGCTGGTGCCAGGAATTGGGGCGTAATACGAGAGTACGATGAGCAAGCGAGAAAGAAGGATGCCGAGTCATACCGCTCGAATGGCTGCCCCATGCTGCACCGCTGGCTCCGGCGGTAAAGAACCGGTACGGTGCAATGGCGGCAGCCCGCCTAAATCGCATATCGGCCCTCTACATCCTGTATCTCGCGACATCGAAAGGATATGGAGCATGACCAGTCTCAGGGGACTCTAGAGCAGAGTGGACTCCCTGCGTTAAAGCCCCGCCGGTTCGTGCAATAGGCTACCTTTCGATACCAGCCCTCAGTTCCGGACGACGCCGGGAGCTGTGCGCGTTGCCCGGATGGCTTCAGCCCCGTTTTCTCAATCGACGGTCGAGGCGACCACTGTCGGTTGTAAATCCCCGTAACAGGCAGATGCGCCATTGCCCGGTGACTCAGAGGGAGTGTGCTATGCTGCCATTTGTTGTAGTCTCTCTCGTTTGCTCAGTTGTTCAGGAATATGGTGCAGCAGCTCGCGTCCGCCGCAGTAAATTGTGGATTCGGCACTGATGAACCAAACAGCACACACAGCAGCACATTTCCCCGGCTGTGCCTCAACAACGGGGGACCCTCCATTAAGCTACAAACAGGGAC	*	tp:A:P	cm:i:47	s1:i:548	s2:i:0	NM:i:1934	ms:i:1116	AS:i:1108	nn:i:0
+42	4	*	0	0	*	*	0	0	GTTGGTATTGCAGCGTCTGCTTGGGTTTATGGCATTGTGACATGAATAGCAATACGCTTCAGGAGTCCTCAAAGCAGGAAGCCAAGTCAGAACTCCCAACCATTCAGCTGGCGCACTCCCACCGCCGCAGTGCCGAATGGCTAGAATGCGACGCGACGCTCCGGCGTACATGATCGTACCGATGACGGTTTAATCTAATCTGCACCTTGACGGAACGTGGTACTCCCACTGTTTGCACGCCCGGAATACGCCTAGACGGGACTAGGAATGGCTAGAAGTGGAGATCCGCTCTCATGAACTTATTTTACTGTTACAATCCCACGGGGGCTGCGTGACCGCTTACTGCGTCTTGAACTTAGAGGGGTGGCACGCCGTGACCGTCCGTTAATCGAACGCCCGTAAGGATCCTCGGAAGGAGGACGATGCGATGCAGCCAGTCCGATAGCTGCGCATGCCGCATCTCACGCACTCTGCTGGTAACTGGACCATTGCAACTCAACGCCTCGCCAGCGGCATCAACGCGCCACGACGGATTTAACCGCCAAAGCTCCACACGGAATGCATCATTCTAAACGCCGGGAGCTCCGGTTCTAAAATAGAACGAAACCCGACGCTCCCACTGAAAATCCCAGCCAATGCTCCCAACCGCGGCACTCACGAGTTGCCGGTGCCTCGAGAATGGAAAGCCCGTACGGTGCGGCTTAAAAGCTATCAAGTTAAACACCCGATAAACGAAAGCGTCCAAGCCGGGTTTAGAGCGCGGGTGCATTATCCCTGAAAGGGAGCAAGAAAAGTCTCCACTTAGAAACGATGAAGGAAATGCCTGAACGTGACGGTTTATTCATTCCTCACGAAGCGGCAAAATTCATCCCTAGCACCGGGGACCGTCCCAACGCACGAGGACATAGAGTGCCATGTGGTACGCATCGCATTCTCCAGGCAGATGCCGCATCCAAACCTCGAAAGCCACCAGGCTCCCAGTGCGTCACTGAATTATAAAAAGAAGGCAGCTGAAGGACAATGAAGCTGGAAATGCACTGCTCCAAACGCCAACGCGATTAGATCCAACGGAAGAGAAACTGCATCTACGTGCACTAAATTCGAACGTGCACGCAGGACTTAGCTTCAGCTGTCTAAACCCACGTGCCAACGCGAAGGGATGGTGCAGCTCCACCATGAAGGCCCGTCTGACGGACTCAAAGTCCTGCCGGCCCGCTTCTATTCCGAAACTTTAAGTATGATGGAGCGAACGCTGAGAAAGCCAACCACGTTAGAAACGACCCCAACATCGACGGGCTCACGGGAAGCTCCTAACGACAGGTACCCCAAAATGATTGCAGGGACCTCAAATCATTTGACCCGATTGCCTTTGACGATCCTGTAGCGCACTTCAGAATCTCTACGCTGAGATGAACTGGCCGCAGCGACTCCAGGAGCAGCCCCGGGCAGTTTTGCCTGACCTCGCTCCTCACTCCCGACATTCATCCTCCCCAGGGATCCACGGCGACGATGTAGCTCCATGAAAGCGTTCTAAGCGACTCAATCTAATCTTTGCCCGCATCGAATGCTAAAGCCCGTAAGGCGCGAAGCACAAAATTGACTGCGGGATCCAACTGAAGGACGAATTCACGTTGCAATGTTCTTACGCACATCTCATTGGGGTCGCATTCACGGCTCATGGACGTTTCATTCGAGCAACGATGCCCGTGCCCGCGTGGCCGCATCACGGACTCCAATTACGCGATGTAAAGGCAACGGTTTAATCGATGCAGGATCGTTTGGCTTACAGCCCGGATATTGTCCATGTCCTACGTATCCACTCATCCACTCTTACTTCTAACGTAACGTATCGATCCGGGTAAATCTAAAGGAAATCTCAAGCACTAAGTCGTTTCATGTATTCTTAAGGAAGAAACGCATTAGATCTAAAGCCCACGATCTAAAGCGTGGAATTGACGCATATCCCGCATTTGGGGTCGCCAAATACCGCACGCCATCGCCCGTCGTTTGATCTAAGGCCGCAAGCTAAGCCAATACGGGATTTCGATTACGGCTGAGAAGCGAATCGAGAATCCTATAGAGCCATCCTGACGCCGTGACTCAACGGTTCATGGGACGTTACAAACCCTAAATGGTTATGCCCTGCCGCATGGAACGGTTCTTGGCATGGGCGTACGTAACGAATGCCGGATGCACGCGTCTCACTCCCAGGTTACGCCCACTAAAAAGGGATCTCAGCACGACTTGCCTTATTTAACGCCGAAGGACGGTTGCTGAATGCAGCCAAATCCACGGCTTGTTTGCCGGTGCGGCTTAGATCGATGGCGATGCAAGAAAGCACGTTGTAATGCCCGCTACTAGGAGCGTACGGTTATTACTAGCTTAGCCGCCTTGCCGCTTCTTTCAGTGACCTTGACAGCCCGCTCCGTTGTACTCACGCATGCCTGACGAACGCATTAAAGGCCTTGCGGTCTATCCGGTGCTATATCCTGGCACGTCGATGGCTCCCTGGCTGGACTAAGGCTCCACTAAATTTACGTATCTGACGGACTCCTACATCGAATTTATTGGGCTCGAAAGCGGCTGGTTTCTACGCCCGCCTCATGGCCATTCAGACATGCACGGCCGTACCCGGGTGCTCGTATTGCAAAGCCCAAATATTTACCGGACAGCCTGACCTGTTGTAACGTGTTCAGACGATCTGAGGCAACGTGAGAAACTAACAGCCGTTTCCAAAGCCTGCTTAGATACACGATCTCCATTTTGTCCTCTGACGTGACATTCCATGAGGACGAGTTTATTTATTTCAACGGTACGTCCGTTGTACCCACGCGACTTTGACACTGGTCTCCCATGCAAGGAAGCCGAAATGGAGAAATGGAGCCGCAGCCGGTCGCGACCTGTTTAAGAGTTATCAAGAGGATGCAGAGAAGCACGCATCTAATGCGGATCGGCTCTACAGCACGTGGCCCTGGTCTCCGTAGATGCGCATTAGTGCATGTGGGGAGTGCATTGGAAGTATGACAGTTTTGGAAGCTGGAGAAATGACGGGTCTTGCCTCCACTTAATTAAACTAAGCCTCTTAATGCAATCCTTAGTTTTGCCTGTTACTCCCAAACTTAATCGTTTGACTGATATGCCCGATAACAGCTTTTAGGAGAACGTTCTGTAATGCGGTCCTGCTGGTCTAACGGTACTTATTGGTTGTATTTGCTCCAACGATTGCCCAACGTATTCAGGGATGATAATGGAGAAGTTCTGACCTGTTCCACTGTTGTATAAACCTCCCGAACCCCGTTAAGCCTATCTAAGCAACTGACTTTTCACGTCACTAATTGTTTACGGATCGTATCCTGTTGGACAGTAACTGTCACGGGACGAGCATTTTATGTCGTTTCTCCCTCCTTTTTCCAACCGTACCCCTTACCGGCTTGGATCCATTCCATTGTCTACTGAAGTCTTTCATCTGAACACTTGGCTTGTAAATTGGTTATGCGTGCTTGACGTGCTTTCCATCTCATCTAATGATATGATCTAAAATGGGATCCCTAAATAGGCAGCCGGGAATGGTGACCGCTGGTTTGTAACATGACTTCCTGGTAATGGTGCGACTCGCCTAACTTCTCTGCGTATTAGACTTCCAAATGTTGTATTGGTTAATCGATTTGGCCCACTGCGATTCTTATCTAAATTCGATGTTTGGATCTAAGGATTCGTCTCACACGGGTTCTGCACGGACTTATCTCGTACGCCTGGACTTCGAACTTTTGTGCTCCATCTCACGGAAAAATTTTATCGACTTTATATTCCGACAGCAGGAATTATTTCCTCTCCCTTCCCAACGTATCTAGTTAATCACCTGTCATTATGAACGTATTTTAATTTAACAGAGTCCTGTCTCCGCCTGGCTTCATCGACTGCACCAACTCACAGTGCAGCCGGGTACGCGAAGTGCCCACTCCACCTGTTGCAAACCCCATTACAATTCTTTGATGCACGCGAATTGACTCCCAGTCTCATTCAACTTCAATTAACGGACGCATGTACCGTTAATTAACGTAGCAGGCAGTGACACGACCCGGGTTCTTTCTATTTGTAACGCTGACGTCGGTCGATTAAACTACTTAGCAGCTTTCTTTGTGCCGGTCTACTGGTTTACCAATGTTTACTTTCGTCACCGACTTGTCACGTCTGTCAATGTAATGACGAGCCGACCTTTAGCCCTCGTCACGGTACGCTTGTTTCTATCTGTGCCGAATTTTAACTAACGGAAAGAGATGCATCCTTGACTATTTTCTCATTTCCACTCGTATTCTAAGTGTTCATATCCTCTATCCGTTGTTCCGTAACGGGTCTGGATTTGCCACGGTTCAGGAATTGACGGGCACGCAGTTCGACGCAACGGAATTCAGATTGAGACGTAGATGCATTTACCAAATGCAAGCGTAACAAATCTTTAAGTCGCATTCAACTTTCTAAGATAGTTTGACGTACGCCTCCATTTTGACCTACGTGCCATTAATGGACTCCTGGTTCCTGGGATGCGCAGTCTGACTGCTTAAGGTATTCAATGTAACCTAGATTGTTCTGTGCAATGATTTATCGAAACCCTCATGATTAAATTCTAAGGCAGTTCTAACTTGACTGCTTCATGCACTAGGTTAAGAAATTGCCCGTTATCGTATCGACAGTTTGCCTCACCAAATAATGAGGACGGAGCATCGACGCCACGTCTGATCCCAGGAACTGGTTCCTGCCAAAGAGGACCCGGCTGGTGCTGCTTCCGACCTTGCGATTCAGTATGGGTTCCGAAGCACGCTTTAACGCCAATTCTACTTTTATCAAATCCGCATTTGACTAACCTCCAGCACGACTAGATGGTATGCTCCTGTTTACGCAACTGCTTACGAACTAAACCGAATCTGATTTAACGATGCCGTAAGCTCCTGACTTCCGGATACTACTTAGGGCATTGATCGGTTAGGATGCCTCCCACCTTTGTAGCTAACCTCCTACACGCTCCTACAGCCAACTTCGTTTAGAAGGATTAAGCTTCCAACTGTCACCTCTTAATTAACGCAACGGAGCCGCAGCGAGGAAGCAACTCGACTTTTGCGTAAATTAACAGGAAATCGACTTCAAAGGCTTGACACTCGACTTTTAGAATTGCTTCACGCAACCATCTGTAATCATGACGTGCCTTTGGATTAACGTCCTTATTTACCGCAATTTTCTTTTCGACCTGACGGTCGACTAGGTCTATTTAACCGTACCGCTCCATCTCACGTATAGAAGTGATCTCACCTTACGAAATACTGCCGAGACTGTTGTATTTTAATCGACCCGATTCCCCGGGCGGTTCAACTAAGCACACCTCCCACCCGCGTGCTCCACGCAACGCAACAGTTAAGAACTAGAATAGAAAATGTCTGGTTGCAAGGTACCCCGGTAACGGATCCTATTATCCCCCGCTCCTTAGAACTTAACTCTTTTAACCAGCGACTGTGCAGTCTAGAGCACGATCCGATCTACTAGAAGCACGCGCATCTCTAAGGTTTCAGGACCTATGCGATAGGAAGGCGAACTCGTACTTTTGTCTTTACTATCGCCTCCTTTTAGACTGCATCCGCTCCAGGTTCTATGATCGAAGTGTTTAAAGGATTATGTTTCCTTTTGCTTCTTAAACTACTTTGTCCGTGACGCTCCAACTACGGTTAGATGCCAAATCTTTTGGATACTTTATAACTCTTCCGACATTAACTTCTAAGTATTTGTTTAAATTATCGCAGGGTGACTAATGAAGAATTATTTCTATTTAACTGCATCGCTCTCTGATTCCGAGCGGTCTCATTAGGGCCCGGTCGACTAGTCTCACTGGGGGACCATGTAGTTATTTGATAACATTCCTTTCATTAACCTTTTACACGGATAAGTTTGACGCAACATAACATTTAAAATGCTATCTAATCGTTTGTAGGCCATCGTCATAAGGGGACGATCATACGACTGCAGATGGTACGATTCCGTCAAACTAACTACGATCCCTCTAGTTCTCACGAGTGCTCCAGGTACATACCTCACCTGGGTAACTTTATTGTAATTATGTAGTATAGACGTACGTGAATCTCCGAAAAGGCATTTTAGAGTAGTTAGAGTGCTCTGGGGAATGAACGGGC	*
+43	4	*	0	0	*	*	0	0	CTACCGCGGACGTCATCTGCCTTATGCCATGGACGCGCCGGCGCAGCATGGCAGATCGAGCCAGCGTTGAGAGTCTATGCCAACAGGTGCGGAGAAGTGCAGAGGGATAGGGGTACGATCAGCATTAAGTCAGTACAGGGCAGCTCTAATCGCTGCTAATGGCATGGTAGCAAGCTATCCCCTGTGCTGACCTGGTGGCATGCGCGCAAGAAGTCAATGGCATAATTGACCATTAAGTCGCGTCTAATCCATGAAAATACCGCAATATACTTGAATAAATTAGTTACAACTAAACTATTGGGTTGGCACTCTCAGGCTAAATACCGTGCTCACGATTATTCGTGATCCACTCTTAAATCCAACAGCGCTCTAAGAGAGTGCCAACTGCAATCGAACAGAGTCGCAGGTAATTAGGTGCCTGGAAGCTTGCAGTCTAAACATAGAGCTAAGTCAGTAATGGTGAAGAGTGTGGGCACCTTGATTAGCGCGTACTTTTAGTCTTGGATGTAAGCGAATACGAAAGCAGAACTAAGTAACAGGGCTGCCGGCATTGACAAGAGCACGGAGCGAGCTACGCTCAGTGTATTTAGCGTGATACTATTAATCGTGCGTGAATCGCTCTACTATAGCTATCGTAGCACTCCTTGCTCTTAAGAGCGAGCAGGAACAAAGGCCTATGTAAATTTTGCTTGGATAGGTTGGCTACAATCGCCTCGCTTGTTTCTACAGTAACTTATTCCAAATCGCTCGATGGCGTATTAGAAGCCAACAGTACAGCTCTATGGTCCCGCTTCTGAAGGAATAAGAACGGGTACGGGCCTTTGCAAGCGTAGGTCGGGACTATAATCGTTGGGCTACAACTATCGAAGCACTTGAGCCATCTCTAGATTGCTCACGGTATCTTCTCGTACAAGCCGATAGGATAGCACTTAGGTGACTCGAATGGTCTATGGCCTCGATCTAGATGGCGCTAGAAACCGCGACCCAGCGAAGCCTATAGACAGCGTTAGAAAGGCAACGTAATAGCGTATTAGGAATCAACGTACGAGTGAATACATATTAAATTACTTATCGAAGGTTGGGTGACCCTGATTATCTCCTATAAGTGTGCCCTCCTAACCCAATGTAAAAAGGCACAACTAAATTGTCACGCCTTCTCGATGAGCGCAGCAGGTCCCTGAAAGTCTCTCGAAAAGTCACTAATGGCGTGGTGCAGCATTAGAAGGTAAGTTGATAGCGTATGTAACCGTTAGGCGATACGTTGCGATAGTCTAACATGAAGCACTAATATCTGGTGCTCATTGTCTAGGGACCACGATGATAATGCGGTCGAAAGAGGCGCGCTTGCGCATGTAATGGATCGCCGAACGTATAGCTAATATGTATGAGCTGGTTGCTCATGGGCTCGATGTCGGTACCATCACCGTACTGATCAGCTAAAGCCAAAATCAGAAACGAAGGACCGGGCATGATGAAGCTCATCGTCAGCGTATGTTGCTCCATGCAAAACACGAAGTTAGCTTACGACAGCGAGCTGCTATCATGGATCGGCTGTCGTCGGTTGAACCAAAGCAATTATTGCTTACATTCTGCCGACGGACATGCCTGCAGCCCCGACCAAGGGCTAAGGCTAGGGGTCGCGGCCAGATACTATCAGGGACACTGGAAGAAGCGATAGTCTGACGATACAGCCATCCCCTCCATGAAGGCAGTGTAATGTAAGGAGGCTACACACGCTTCCAGCGATAAATGCTAATAAACTGAAGCGAGATCGCATGTTTGGGTCTGTCTAGTTGGCGCGGTTGTAAACATTTGCCCGCTGCCAAGGCAGACTTTAAAGTTGCTCCTGCCAATTTCAGAACACTTTATGTAGAGCCTCCACAGCGAGCCGAGGCCTAACAGATTTAATCTTTAAGAGCATGAGGCATCGTGCAGTTAGAGTACCCAGTGCCTGGTAGAGCCAGCCATCCGTCCCTTAAGTTCAATGTCTATCTATGTAACTTAAACTCGAACATGGTTTGCTTACTTGCTATGGATGACATTACGGCCATCCGAGGGCTTACTATCGACGGGCAACCGTCTCAGGAGCTGCGGATAACCACCGAACCAATTAGATACATCTGATCGATGGGCCTCGCCAATCCGCGGAACCGACGTACGGCTTGGCTTAGAAAAGAGACATTATGTCTCAATCGCCCAATAGTAAAGCTAACGATAGGCCTCAACTTTATTTAGTACCGCTACGAAAATTCCTTAAGTTTTCTTCTAGTATGCTAGGACTTTATCCTTCCTCTACATCAAGGGCACTTTCTAGATAATCTTTCTTAGAAATTAACATGTCTAAGCTTTGTGTACGTGTAGTCTCTAATAATCGTCTAAATGGAGCTCTGTAGATAGATAATGGCTAATTACTTTGGGTCCAAATAAACATTCACAGTCTAATGGTCCGGCACTATCCAACTGTCTTCGTACAAAGCGGACAATCGCTCTGTCAGTGGGTACTCTCCAATGGGTTGTCTGCATGAGGCTCAATGGTTTTACCTTCCTAGTGTATAGTGTTTACTTTACTTGCTATGGCAGTGTCTATACTTATTGGGCAACAATCCTGGCTCTCTTAAGGCGAAGTTAGGAGCCAACTAAATAAGCGCTATTGAATATTAAAGTTAGCAACGTCGGTACAGGACAGCAAGCGCAGGCACAAAACGAATAAAGAACAATCTAGCTCCACCGTGACGGTATTCGTGACATATGATCTAAGTCATAGCGTCTCTAGCTTGTAATCAAACCACATAGTGTCTCTGGAAGCAATCCAGGATGAGGCGGATTTGTGGAAGCGACAGATAGGCAGTACTTCCGGATATGACTACATATCAAGCCTTCAAGCCTTGGCGTGACAGACAGCGCAGTTATCCTATTGATAGAAATAGGTAACCCACTCAATTACTGCGGTAGGTAATAAGTGAGTAAGTCCTATCGTGCTGTCCTAGAAGACGGAGGTTAGTCTGCCTACTTTATGCTCTTTGACATTAGTCGCGCAGTGCTACAAAGAGCCGAGTACAACTACTTTGAGCCGGCTAGTACGTGTTCCATCAGTCGTATAGGAAGGCTGAACGTAGTGCCGGGTCGATTGTTTGCTGTCATTCTCGTACATCCGCGTATCCTATTAGCTTGTATGTCTGAATGTTAGCTCTTAGTGGATAGATATCAGCATACATCAATTAATACTTATCGTGTAATATTATTTGAACTAGCCCAATTATACGTATACGGTTGTAATGGTTTAAGTGCCATCCCTCCGTTGGTATCGTATTGACTTG	*
+44	0	utg000001l	32981	60	568S18M1I8M1I5M1I2M1I7M2I1M2I5M1I1M5I1M1I7M1D7M1D8M1I17M2D2M1D14M1D3M1I23M2I17M2D21M2D14M3I24M3I1M1D15M4D5M3I2M1I25M6I10M4D19M2I3M1D12M1D5M3D6M2I23M2I4M1D16M4D6M1I3M2D6M1D24M1D9M2I12M1I9M1D18M4I2M1I5M1D1M29I2M1D9M2I1M1D5M2D4M2D42M2I2M2I3M1I2M1I2M3D3M1D18M4D1M1D7M3I8M4D5M1D17M1D16M1I2M2I14M1D14M1D3M2I2M3I6M1I3M6I1M1I5M1I7M3I6M4D2M1D3M1I7M1D10M1D13M1I2M1I7M3D1M1D2M1I10M1D1M1D3M3D9M3I9M2D8M1D3M1D2M1D8M1I2M2I1M1D10M6D9M1I16M1D8M1D3M1I1M4I6M1I7M3D1M2D4M1I5M2D2M1D23M4D5M1I3M1I15M1I2M2D3M3I6M5I15M2D6M6D5M2D5M3D6M1I6M9I4M1D10M1I6M2D8M2D5M1D9M1D10M2I7M1D5M1D9M1I1M2D9M3D1M1I5M1I2M1D3M1D11M1I6M3I13M3I5M1D23M1I8M1I16M2D16M1I3M1D7M1I15M1D7M1D23M1I8M1D29M1I2M2I5M2D8M1D5M2I5M2I6M4D2M1I14M3D2M1I13M2D7M1I2M3D7M2D3M2D4M7I7M1I5M1D15M3I1M3I3M1I4M2I2M3D2M1D4M1I13M3D3M3D6M1D5M1D2M1D10M1I16M1D13M1D27M3I2M1D5M4D10M1I7M1D6M1D1M3D5M1D6M4I6M4I2M1D21M2D4M4D9M1I10M1I8M1I4M2I5M1I4M1D6M2D4M2D29M2D19M1I14M2I11M1D7M2I10M1I8M3D6M1I9M1I3M2D4M2D3M1I9M3D22M2D12M2I4M3I4M1D9M2I20M1D47M1D9M1D16M1D8M2D2M1D10M1D17M4I3M3D2M5D2M1D6M6I2M1I2M1I1M1I4M1D2M4I2M1I1M1I2M1I4M1D16M2D21M2I8M2I2M2I23M1D16M1D23M1D2M5I1M1I4M2I7M1I8M2I9M2D5M2I3M2I6M2D4M1I18M1D10M4D3M3I20M3D1M1D10M2D5M2D1M1D6M2I13M2D12M2D6M1D3M2I1M2I5M1I19M1D9M1D46M2D8M4D6M4I11M3D10M1I8M1D17M2I7M1I7M1I15M1I13M1D3M1I10M1D4M2I17M1D10M1I7M1D10M2D2M2D12M1D6M1D10M1I11M1I8M2D12M3I5M1D3M1D14M1I1M1I4M1I11M1D2M1D3M1D9M2I1M1D4M1D19M1I1M1I1M2I8M3I3M1D8M3D13M2D4M3D11M2I18M1I37M5I11M2D3M3D6M1I52M2I25M2D3M1I9M1I18M1I8M4D5M1I2M4I5M3I2M6I25M1D3M1D25M1I12M1D3M2I9M3I9M4D16M1D11M1D8M1D1M2I4M1I2M2D3M1I2M2D28M1I4M1I1M1I2M2I10M3I5M1D4M2I9M1D4M2D24M1D9M1I3M2I16M1D3M3I8M1I7M1I12M1D10M3I19M3I6M1D17M1I4M1D6M3D3M1D18M1I2M3I2M2D14M2D12M1I2M1I16M1D13M1D7M1I2M1I5M1I6M1I19M1I2M1I11M2I2M1D4M3D3M1D8M1D9M2D9M1I2M3I11M2D10M1I14M1I8M3D3M1D8M3I3M1D3M1D6M2D28M1I2M1I9M3D10M1D4M1I5M1I27M3I12M1D14M1D3M1D5M1D48M1D5M1D4M1I14M2I4M2I12M1D20M2D3M4D2M4D25M4I8M1D12M1D7M2D4M3D7M2I7M1I13M1D7M1D24M1I1M1I6M1D26M1I9M4I9M5D1M2D2M1D11M1D6M1I14M1D2M1D9M4D33M1D3M2I4M1D3M1D3M1I7M1I24M3I6M2D6M1D6M1I12M1I33M1D3M5I1M1D5M1D2M4I4M1D16M2I4M3I8M3I9M1D1M5D23M1D20M1I8M4I1M1I11M1D5M1D16M1D7M2D14M1D6M1D6M1I9M2I31M1D1M1D28M2D9M1D22M1I7M1I10M1I2M2I7M1D9M2D2M1I4M1I14M2I20M1D32M2I16M1I7M3I4M3I6M3I6M1I15M1I19M1I1M2D6M1I15M3I32M1I3M3D1M1D6M1D6M2I7M1D7M1I9M1I3M2D6M1D8M1I33M2I8M1I9M4D17M2I13M1D6M2D10M3I5M1D23M1I3M3D4M1D7M1I7M1I7M1D13M2I4M1D2M1I2M1D1M1D2M1D20M1D12M1D8M2D5M1I10M1I4M5I4M2I4M2I10M1I6M2I5M3D7M2D2M2D6M2I6M2D4M2I1M1I3M1D32M1D8M1I5M1D28M1D21M1I18M3I1M6I31M1D7M1I13M3D6M1I7M1D17M719S	*	0	0	TGTTGCGCCGCTAGGGCGGCGGATACCTCTGAGCGGCGGAGAGCCGGTGAGGTTTAATAGCGCGCTCCCCAAGTAACTGAGTACACCAGTAGTCCATCGGGCAAGCGGTAGAAACATTAAGCAGGTCAACCGGCGGCCCCAATCTGGAATCGCGCTATCTGCACCCGGCGACTCTGGGGGTCAAACTGACGATTATAAAGGGCCATCGGGGTTAACAATGTAAATACGGGTTTGACTGAGGGGTAATTCGACAATACGTTAGAAGCAATCCGTGGGTACAGCCGTCTAATAAGAGTTCATCACCGAGACTAGGGCACCTTACGCACGTGCCGATGGCTTCAGCCCCCGTTGGACACGAAATCCGGGTTGAGGCGGCCTGCGTTGGCTTACCGATCAGGCAATGACAGGCCGGGCGTGACACAAAAGAATGTGCGTCATTGGTAATCCGGATTTACCGGTTCATGTACCGTATAGCTTTTGCTCGAGTTAGTGTTCGGAGGCTCTGAGTCCAGCAAACAGCGTGCAGCAGCCGCAGTAAATGCGGCGTACTTCGGCACTGTATGAACCAAACAGCACAGCAGCACATCGCCCGGCTGGTGCCGGTGGACAACGGCACCTGATAGCGAGAGATGCCCCGTGCCTCCAGATTGTCCAGATAGAGATTCTGGCTGTCAAGAGTCATCCTCACGACTGAAAGTCCGGCATCTCAATCCCCGCCAGATGATAAGCATCCGAACAGTGTGTAACAGTTAGTCACCGTGCTCAAAGCGCCGCCACGGGGTTACATGCGGCACAGGGTGAACTTATGAATCGTCCCCGATTCCAAGACCAGCCACCACGGCAAATCACTGGCCACCTGCATACAGCGGTCGGCCTCATGCAGCCAGGGCAGACCACCGGGGTCGGGGGACCAGCCAATCTCACCCTGCATTTCTGCCTGTGCATCAGTCTTCCGGCGACATACGGAAATACGCCTCCGGCTCACCGGAGATATTCACGCAGGGAAATATCTTTCTCCCTCCGTGCGTGCTTACACGAAGCCGCACGACTCTCCGCTCAGCACATGCCGGGCGTGCGGATAGAATCAATTCTTCTTGTCATGGGGCATTTACTGCGACTTTGTTAATGGAAAGGAAGCCACAAAGTCCCACGACGTTAGTTGTCCCACGATACAACGCTCAGGCATTGCCTGCATTCCTTCGTGATATCCGGACGTTGGCTGGTCACTTCATCCGCAGCTATACCTGAATAGACGGCCAAAACCGTCTACGAGCCGTACAAATGTGAATAGTTACAGAGCAATACCAACCACGTTACTCCGGAAAGGCCACTAGACGCTCCGTTTAGCGTGACATCAGTAAAAGGAGGAGTAATAGCACTACAGTTCGCTGCACTTAAACATCCCACAGCCGGCTGATCAGCTGCTCCAACTGGGGTGACTGTTCCGTTGTAGCACGAAGTTCACCGGACCGGAAAACGGGCGTAGACCTTACCGCTGAGCTAACAGACGTTCCGCCGACCAGACTCTGCATATCTTCCGCCATCCCGGTAATAGATCCGGATTATAGAAACCGTCAGCGTGGGGCGCGTACTGGCTCTGGTGCTGTTGCTTGAGTTCAAAACCGCTCCCCTGAATGGGACCGGCTGATCTGTCGCCCTGCCAGGTGACCGGCTCACTTTTCGTTCTTACTAGTACAGAAAAGCAACGTTCTCCACGACCTGTCAGGTCGATTTCGTCAGAGCACCACCGCCGGCCGACTGCTCCGACCGTATCATTCGATGCGATTTCCTGCCGGATATCCTGCATCAGTTCGCCCTGTTCAAACTCTGCTGAACTCAACGCAGCATACTGACCGCGAACGACCATTTTGCAGCGTATAGCTTATCTGCCGCCACTCATCAGGCAGCGTCATCAGAAGGATTTCCAGCCCCGTGCTCTTTGCGAAACCACTCCAGTATAATTGGCCTCCTCACCCGGAGTAACAGAATCTACGATTTACGTTGCTAGTGGCATTCAGCCCGGCAGGCAGCCTGAGAATAAACCATCAGATGAGGCACCTTTCTTACAGAAGGGACCCAACCCGCCACATCCATACCGGGTTTCACTTTCCATAGAAAGTTCATCGTCCTCCGGAGAACAGGCCACCATCACGCATCTGTGTTGAATTTCATCACGGCACCCTTGCGGGCCATGTCAGACGCCCACGGTTGCAGCAGCTACATCTATCTGCCGTTCTTCGTTGTTAATCACCACATGGTTATTCTGCTCAAACGTCCCGACGCCTGCGACCGGCTGTCGTAAGATGCTGCCCCGGTGTGATAGGCACTAACCGCCGGTGGCAGGCGCATCAGCCGTCAATTCCCACGCCAATCCGGCTGGTTGCCTCCTTCGTGGAAGACAAACTCACCACGGTGAACAATCCCGCTGTAGCTCATATTTGCCGCCGGTTCCCGTAAATCCTCCGTCTTAAAATGGAAACTTCGCCGCAGCGGCCTGAATGGCTGTACCGCCTGACGGGACGAGATGCCGCCACCAACAGCCGGCCAATGGCGCTGCTGATACTCCGACAATCCCCACCATTGCCTGCTTAAGCAGAATTTCTGTCATCATGACAGCACGGAACGGGTGAAGCTGCCCCGTTCTGCTCACTGCCGGTCAGCATCGCCCGCCTATATTCTGTGCATATCAACCGCTCGTCTGCGTGGCTCAAGTGTTGTGACACTGCTATACTGTCCGTGGCGCTCTTCCCGCTCACTCCAGCCCGGACTTCAGGCCTGCCGTAAGCGAGTTCCCCCGAAGCTGTCTTCAGCCCAGGTCTTTCTTATGACATGACGTTATTCGCCCACATCAGCGCTAATTATCGCCATACTGATTTCCTTCAGGCTGTTCCGTGGCCTCGTCTACTCCGTTGCCTGCCGGTCAGTCAGCCCCGGTTCGGGCATCAATGGCGGCCCGTTTTGCCGTTGCTGCTGTGCATTTATCCGCCTGCTGCGCCAGCGCGTTCAGGCGCCTTGATACCGTGATGTCGCCAAGTGCAGCCAGCTGGCGTTGTACTCCAGCGTCTCATCTTTATGCCAGAGCAGGGATTTCTCCTGTCAAGACATGGCAGCTACGTTGCGCCCCGCCTCCTCCACCGTGACGGAACTCTCCGCTTCCACAAATCCCGGCCTGCTGGCTCTATTTTCTCATTTGCTCCGGCATGGCTTCTCCAGCGTAGAGTTCTGCTGAAGCGTCAGCAGGGCAGCATGAGCATGTCTTCCTGTACGTACGCCGCAAGACATTCACGCTGGACTGTTCGGCTTTTCAGCGTCGCTTCAGGATCGCTTTTCGCCATCAGCGTGTTGTGGTAATCGCTGCAGGATTTTCCCGTCTTTCAGTGCCTTGTTCAGTTCTCCTGACCTGACGCGTTACTCGCGCTAGGGCGTGCGACGCTCCCGTTCGTAAGCCTTCTGCCTCTTCGGTATTTCAATTATAGGTGACCCTGGCTGCTGCTTGGCATTTTTGGCTGTTGAGTCTTATGCTCAGCCTTCTTTCGGGCGCCCGACGTGTTAGGCGCATCGATTTCACCGATCATCCCAGTAACGCGCCCGCTTCATCGTAACAAATAATCATCCTTGCCCAAGATTCCAGATGTCGTCTGCCTGTTCTTACGCAGCCTCTTACATCATCAGCATCTCCGGGCTAAGTGAACTGAATGTGGTCAATATGCTGATTAACCGCATCCCACATGGATTTGAATGCCGGCAGTCCTGTCTGCCCAGGTCTCCAGCGTGCCGGTTCTCTTCATCAGGCGGCCTTGGTTGTAGTAAACCGCTTTCGTTGCCTCGTTCGCCGCCTGCAGTCAAGCCGAGCTTCTATCCGGAACGCTGCAACTGAGCAACATACGCAATCATCGCCGCCGACACGTTATCCAAACTGGCCATGATAGCCGTCAGCGACGTCGGGTCTGTGGTCACCTTCCCGAAGGCATTCATAGCATACTTGTCCGCCCAACGCCGCCGGATCGCACGCGAGAAACGCGCCACCTGGCTGATGGACGACGCAATCTGAGCCTCACTCACGCTTATCCCGCCTTAACCAGTGCCGCTCGTAACCTGGTCGGTCTGGTTAAACGTCAGCCCTGCCGCCTGCCCGGCTCCCTAAAACAGCAATCACGATCTGCCGTCAGTCCCGCCTGATTGCCGGGGACAGACCAGCGTTTTGTTGGAAATCGGACAGGGTTAGTCAGCCCTGATACCAGCCGCTAGGGCAGGATCCGTGCCCACTAGAGCCAAGCCTCCGCGCGCCATCGGCAGGTGACCGCACCCGGCAAGCCGCCTCTAACATGGAGACCCGCCGAGACAGGAGTCCTTCATGCGCCCTGTTGCAGCAGGATCAGCCACGGATATTGCCCGCCTGCAAGCTGCGTGATCCGCTGTTAGTGAAATGTGCAGGCAGCATACGCATCATGGCGGCTGTTACCTGCCCGACGGAATCCCGCTTCTGTGCAGCCAGCGCCTGTCGGCTCAGCGACTGTTAAACGACTGCCCTGTTTTTCGCATCACTTTCCGTACCCCAGCAAAAATGACGCGTACTCTGGCCATCTGCTCGTCAATCCGCATGCAGACCCAAATCAACGACCATTCCGATCGCCTACCGGTTCAGCCATACTGACATCCGATTCCGGTTCTGATAATGTCATCATCAGGTCACGTCATCCTCCGTCATGTTGCCACATCGCTGGGAAGGCATATATTCATTCCCGTCCGGGCCACACGGCGACAACATCCTCCGGCATCGGGCTTTCTGCATCAGCACATCATCTTCAGACTTTCGTCAGCCTCGCGCCGGTTCAGCAGACTGAAATCCAGCGGATCATGCATGCGATGCTGGAAAAACAGGCTGAGCACGGTGTACGTCAGCCCCGGGCAAATGCGGACTCTCAGCAGAACATCATGAAAATAATGGGTACTGTAAAGCGGTGCCAGTCGGATATGAGTCCATGGTGAGCAACATCCGGCAAGCATGGCACCGGTTATTTGTTAGCTCCTTACCGCATCTAGTTTCAGGGCAAAACTCAGCTCACGTCGAACATTTTCCCCAAGAAACAGGCTGGTGCGCGGGCCATTAGGTTCTTTTCTACTCAGGGGCATGTTCACCAAACTCATACATACAGACATCGGTACCACCACGTTCACGCAGCATGAGAAATTGCCTCCGTGTAGAGGTAAGCACTTCCTGCTCAATCTGTTTAACGTTCATTCATGACGGCAAGTGCGTCTTCTGCGCATGGTTATTGCCACAGGACATCGCCACCAGAACGCGCCGTCATGATACCCGTCTTCCACACCAAGTAAACTTCCGGTTGCTGTTGACTCCGCCTGTTCTGCCTGCCGTTTCATCAGGGCGGGTTGCTCAATGCGCTGCGCACAGGGCTAAATACAGTTCGTCAGAACCGCGTGACGGTCACGCGTTGGTTCAACTGATTCGGAGTTCAGGAAACATCTAGTACTCTCCAGGACGGACTGGCGGTGACGGTAATTTCTGCATCGCAGAGCAAAACACCAAGTCACATGTACAACCTAGAATGTTGTACTTGCTTGTGCAGCAACCCCCGTTCAAAGTGATGGTCATACCACTGACCGACACGGTGGCTTTTGTTTGACAGACAAGGCACCGAAGCTCTTGTCGGTTACGCCTCCCGGCTCGAAGGCACGGTCAGCGTGGTGCTCTTCCTTTCACGGCAGGTGGCAGGCGTCTACGGTCAGCGCCGGTTGCCTAGCTGTTACTCCGTCTAGCGATCGTGCTCACATCGACGGACGTCCCACATTGGTACTTTCACCCGTTAGATCATTCCTAGTCACCGCCGTCACCTTACCGATACTGCTGACCCCAGCCGCCCGGACATCGAATAGTTCGGTGGAAGCTTTACCTGAGGAAGGGTATCGCCTTCATTAAACCACGCCAGCACGCCTGATCGCGCTCGCCGGGCATCCACGCCAGCGTGAAGCTGGTATCTCCGGCAGATTTCTGCCCCTGCCCATTCGAGGTCTCTCAATATGAGTCTGCATCTTCATCATCGAGATAGCTGTCGTCTATAGGACTCAGCGTCAGTTCGCCGGGCGTCAGTCTTTGACTTTTCAGACGCGACCAGTCGGGACGTCTGAAAGCGGATTCGCGTAGCGATTACGCTGACGCTCCTAACCGCACAGGGTGGTCCCGGCAGCTGATTCTAATGTGTAGGATTTGGTACACAGGCATAGCGTCCTCACATTCATAATAATGACATAAGTCAGATCGGCTGAACTCCACAAGCCGCATCATCGTTGCGCCGTAGTCAGCTCGCTGGCACACCATACTGGTGATCAATCTGACAGTCGGGATATCGCTCATCACGATAAATCCGGACTCATCAAACCGCATCCAGCTCTGAATCCGGCACTGAGCAGGCAGGAAAACTTCGATATGCAGCTCCGCCTAGAGGTACCCGCTGTCCACTCTTCGCCCGTGTATTCAGCGCCCGGTAGGAGATAAACATCGCAACTGCCGCAAATCCGCCTCATACAACAGCGGGTACCAAAAACCTTTAGCGGTGTTAGGTGCTTCTGAGTGCATGCGAGTTACGGCTGAACGGAGTTCAGTATGTTTCATCGCTTTACCATCCTCGAGTTGATGCTGCACCTACCCAGCCTCTTTCGGAAGACGTTCACGCCGTATCCCTTAATATTTTGTTAAACGCCGTGTTACCTACCAGCGCCATCTCCAGCAGTTCACATCAATGGGGTAACGCTTTTCCCAGCCACACGTGCAGGTGACATGCCACCGGCCATTTTCAGTTAGTAACAAACACACGTTTGGTTATGT	*	tp:A:P	cm:i:62	s1:i:631	s2:i:0	NM:i:1572	ms:i:2448	AS:i:2457	nn:i:0
+45	0	utg000001l	24882	60	41S7M1D16M2D2M1I23M1I8M1I4M4D4M2D2M1I2M1I6M2D4M2D5M1D14M1D21M1D6M1I5M1D14M1I4M1I2M1D5M1D14M3D1M2D1M2D30M1D10M2I1M1I6M1D15M2D2M1D13M7D8M1D5M2I2M5D4M3D4M2I14M1I7M2D17M2D4M3I5M5D1M1D3M1D18M4D3M2I5M2I2M1D8M2D3M1D1M1D11M2I4M2I7M4D4M5I3M2D10M2D7M1I15M1D5M1I4M1I17M1I21M2D13M1I17M4I1M1D2M2D5M2I2M1D4M1I3M1I2M3D7M1I6M3D1M1D3M2D5M2I4M3D3M3D6M1D2M2I5M3D13M1D6M1D5M1I4M3D10M2D7M1D1M1D4M3D4M1I4M1D1M1D18M2I16M1D12M1D19M1I5M1D3M9I8M3I12M1I3M2D1M1D4M2I6M1D10M1I5M3D3M1I4M1I11M1I2M2I5M2I6M1I1M2I18M1I4M1I7M4D5M1I2M1D23M2D1M1D5M2I16M2I43M2D5M1I4M3D1M1D1M1D20M1I2M2D15M2D1M2D7M2D3M2I5M1I12M2D8M2I20M1D3M1D5M1D2M1D4M1D12M2D9M3D13M2D1M4D3M1D5M4I2M4D6M1D3M1I4M2D1M1I7M1I3M6D1M1D23M5D13M1D12M1I18M3I13M2D4M1D26M1D3M1I3M1D7M1D11M1I5M1D7M2D6M1I5M1D1M2I10M1D10M2I6M4I6M2I7M5I10M1I2M5D6M3D9M1I2M2D10M1D11M1D7M2D9M1D1M1D14M1I4M1D2M1D12M1D6M3D6M2D1M3I16M1D6M1D19M2I4M1I9M2D2M2D11M1D9M2D7M4D2M1D5M5D1M7D2M3D5M2I3M2D9M3I4M1D4M1D4M2D5M1D6M3D4M1D1M1D8M3D6M2I8M1D19M2D2M2I4M1I14M3I8M1I9M3D6M1I5M2D9M2I24M3I4M1I6M2D8M3I10M1I1M3I4M2I10M1I9M2I3M1D7M1I15M1D16M1D10M1I5M1I7M1D11M1D4M1D4M2D1M1I6M3D4M2I2M3I4M2I3M1I11M1I3M1I2M1I3M2I11M2D22M1D6M1D9M3D2M3D8M5D3M7D10M5D13M5D2M2D7M1D2M1D3M2D8M1D17M9I1M1D5M2D7M2I9M1I8M1I3M2D2M2I6M1D2M1D4M2I2M1D9M1D1M1D3M1D5M2D7M1I7M1I5M1I4M2I10M1D15M2D6M1I14M1D3M1D7M1I7M3D7M4D2M1I17M1I4M1D4M1I1M3I4M1D1M2D1M4D5M2I1M1D19M1D4M1D4M1D2M1D10M2D36M1I8M1D34M5D5M6D6M2D2M3D1M3D5M1D6M1I1M1I5M6I7M1D2M3D11M2D2M2I2M1D6M2D2M1D4M1D7M3D3M1D8M3I1M2D4M2D10M1D1M1D17M1I26M1D30M1D18M1D4M2I4M5D3M2D14M3D7M1D8M1I6M2D4M3D7M2D8M1I12M1I6M1I5M6D3M1D9M1I33M1D11M4D11M2I6M1I22M1D2M1D10M1D10M3I5M1I9M2D7M2D8M1I8M1D3M1D6M3D3M2I1M1I8M1D4M6D10M2D7M1D3M1I5M1D1M1D25M1D9M1I2M1I10M1D29M2D7M6D7M1D7M1I13M3D2M1D4M3D5M2I1M1D8M2I4M3D2M1D2M2D3M2I13M5I4M1D4M2D1M1I10M3I6M2I11M2I15M2D3M1D1M2D3M3D6M2D5M5D1M1D2M2D2M3D12M5D4M2I1M1D6M2D12M3I4M5I1M1I2M1I85M2I2M1D9M1D7M4D11M1I14M1I14M4D4M1I6M1D11M1D3M1D5M1I6M1D3M2D9M1I11M3D5M1I4M1I8M1D22M4D2M2I4M1D7M2D15M1D3M1D4M1D2M2D4M1I2M1I2M1D4M1D8M1I4M1D4M2I7M1D3M2I7M1D4M3D36M3I2M2D10M2D1M2D16M1D7M1D4M1I3M3D7M2I6M2D1M1I19M3D9M2D2M1D17M1D17M2D1M1I29M2I9M1I12M2I11M1D6M1I4M1I9M2D6M3D9M1I18M1D9M1D12M1D4M3D1M1D8M4D5M2I4M6D1M4D3M1D7M1I8M3I6M1I20M1D5M1I1M3D7M3D7M1I17M3D3M2D2M3I3M1D9M3D6M2D12M1I7M2I7M2D8M1D6M2I4M5D8M2D6M1I9M2D1M1D6M3I2M1D2M1D2M2D3M3I4M3D12M1I8M2D2M1D10M1I10M1D7M3D5M1D27M5I5M4D1M1D3M1D2M2D5M3I1M1D5M1D18M1D1M3D3M1D24M1I10M1D17M1I5M2D1M2D3M1I29M1D2M2D7M1D6M1D2M1D11M1I15M1I17M1I2M1D1M1D6M1D8M19D9M1D3M2I2M1D2M1I3M1D7M1I4M2D8M1D1M1D3M3I4M1I4M2D8M2D22M1D4M1D21M1D3M1I4M2I6M1D4M2D3M3D16M2D5M2D5M3I5M1I6M3D5M1D2M2I11M1I2M1D1M1D4M1D3M1D2M1I18M3D2M1I2M1I1M2I1M1I10M2D8M1D13M1D9M1I2M4D7M3D7M2D1M1D6M1D2M4D1M1D4M2I4M2I21M1I5M3D2M1I5M1I6M2D4M1D9M6D3M1D3M1D19M2D3M2D9M2I1M2I2M1D4M1D8M1D15M6D4M1D2M2D4M1I4M2D2M2D4M2D2M2D12M2I1M1D12M1D4M1D2M1D3M1D16M3I11M1D7M1D5M2I26M4D1M1D9M1I14M2D2M2D4M1I14M1I8M1I6M2D13M1I3M1I2M1I5M1D4M1D5M1I1M2I5M1D4M4D3M5D5M2I2M1I7M3D9M1D7M1D5M6D19M1I5M1I3M4D4M1I24M1D15M2I4M1I7M2I10M1I3M1D5M1D1M5D5M1D5M1I3M2I10M1D10M1D1M1D5M1I4M2D6M2I14M4D3M1I7M1D9M2D4M1I4M1I11M3D3M1D6M2D9M2D17M4D5M1D4M2I6M3D4M6D1M1D29M3I8M2D8M1D19M2D10M2I5M3I5M5D26M1D2M1D4M3I2M1I5M3D16M2D16M2D2M9D1M1D3M1D1M1D4M1I3M2D1M3D11M1D6M5I5M1D3M1D4M1D4M1I14M1D18M2D4M1I7M2D6M1D11M3D3M6D16M1D5M5I8M1D2M1D4M1D9M1D2M3I6M1D3M4D4M2I3M1I7M3D4M1I3M1I4M4D19M2D20M1I4M1I2M1I6M1D1M2D9M1D14M1D2M1D8M1I4M3D6M1D6M2D1M3D2M1D7M1I6M1I13M1I5M1I6M1I6M1D4M10D6M4D1M1D23M1D6M6D3M1I7M6D3M2D9M2D4M2I7M2I15M2D4M3I13M2D5M7D7M1D6M1D6M1I8M1I4M1D5M2D8M3D1M1D3M1D5M3D7M1D7M3D8M1D1M1D27M1D9M4D3M2D4M1I2M1I3M2D13M3D8M2D4M1D1M2D5M2D15M2D19M2D19M1D2M1D4M1D2M1D2M1D12M2I4M2I18M1D3M2D15M1D1M2D5M2I27M1I6M3D3M1D4M3I7M4D3M1D3M2D1M1D3M2D3M1I11M1D1M2I5M3D5M1I19M1D4M5D12M1I8M1D3M1D7M1I12M5I4M1D5M1I1M4D3M1D10M2I7M1D15M2D6M2I2M1I10M1I2M3D4M1I25M1D10M2D13M1D11M1I2M1I11M1I23M1D1M1D6M1I6M1D15M2D6M1I6M1D7M4D14M3I5M1D19M3D3M2I19M1D1M1D4M1D5M1I1M2I6M7D9M1D1M1D6M4I7M2I7M2D42M4D4M1D9M1I1M2D8M3D3M1I4M1I3M1I5M1D3M1I4M1I4M5D3M1D6M2D7M1I1M2D5M1I12M4D17M5D1M1D12M1I36M1D7M1I2M1I3M2D2M1D2M1D3M4D5M1D6M2D3M2D2M1D4M2D3M1I16M1I7M4I1M2I11M2D4M6I1M2D5M1I4M1D26M1D8M1I19M1D3M1D8M1D6M3D8M2I2M1D5M1I7M1D9M1I1M3I7M1D1M2D2M1D3M3I1M1D20M2D15M1D11M2D4M4I1M1I8M1I3M1D3M1D1M2D8M1I10M2I6M1I10M4D1M4D18M1D2M8D10M3I9M5I4M3D16M1D10M1D15M1D1M1D14M2D10M2D9M2D19M1I1M1I4M3I8M2I5M1D3M1D2M1D10M4D10M1D3M3D7M1D5M1D4M1I12M1D14M2D3M1I13M2I8M1D15M2D14M1D19M4D6M1I3M2D6M1D14M2D8M1D4M1D5M1I10M1I11M127S	*	0	0	GTCGTCTAGTTATGCAGCTGACAGACCAAAGACAAATCCAGGGCTTCATTTGGATATCAGAGCTATACGAAAAGCAAGCATCTACTCAATAAACCAATACATACAATTGGATTAGATGAATTCATACGTGAATTGATTCAATAATAATCAAATGTATTTCATGGAAATAGATGAGAAAACGAAGAAAAATGAATTCTATTGCTTCCGCGGTATCCTCCGGAAGAAGAGATGGGAGCGTTCAGTCTAAAGGATTGGCGGTGATGTAAACACTGAACAAGTCAGTCAGAACTTCCATTATTCTGAAGATATAATCGCCAACCACTCAGAGCTTTACAATATACTACTAACCGCATACGTTATTTCATGACGCTCTTTTTAAGCCAACGATTACTCCATAACACATTAAACGATCATCAATATCAGTGCAGTTACTGTATCAACACGGTTCAGCCCGAATGATTTCTTCAGGCTTCCCAACGAGGTTTCTTCCTTCGTTCGATTCCAGATCTGCAGCATCCTGAAGCGGCGCAATATGCTCACTGGCTATGCATCAGGCTTTGTTTCTTCCGCTCCGGATCCCCTGAAGTTTGCTTCCGTATCCGTGCCCCAGGCTGTGCCGTTCCATTGGTATTCCCCGGCGATACGATAAATTTTCCGTAACGACCCGGTTAGAAAGATAATCGCTTCCCGCGGCTCGCGCACTTCGCAGGCAGCTCGAGAAGAGACGGGAAGGGTTGCGCCATCACTGTTGAATAGCCACAAAGCCAGCCGGAATATCTGGCGGTCGAATATTAGATCTGTTTGCAATGAGGCAGACCGGTATGAGTGAAGATATGCGTCACCTTCAGATAAATTCATTAGTTCCTTAAGATTGTACCAAATTTATGGTCCGTGGTTGTTCACTCATTTGAATGCCATGCAATGGACAATACAGTTAAATCAATGTTTGACGGTGTTCCGTTACCCCCGCAGCGTTGACGGTATGGTGTCCGTGTGAACCAATACTGAAAGAATGGGCAGCCGCACCAACACTCCATCGGTGCGCACCAATACCAACTGTATGCGCATGTGCAGGCACCGGCACGCTTGTACCATAGGACAATGAGTACTGTAGCCTTGAATGACTGTCATTTCGATAAATAAGCATCGCTTCCTCTTCTATTCTGTGATAATTCCTGTAATGGTCCCAACCGAGAAGCTCCAGAAGGTCTCATTGTGACCCAGCTTACAGCACCGCGGCCCCCTGTTGAATGAGACCCTGGTCACATGAGCCCCCGGAGTTATTCGTCGATTTGATCGGGTCGTAATCGAACTGCTGTTGTTTCATTTAGCGTAATCAACGACGATTATTTCGTCCCAAAACCCGTACCGGATGCACTGGCACTGTGGGTCTAGACTTAATTCACATCCTGTTCCTGAGACAATACATAAAGTAAATGAGGGCGTCGCCGTGATTGTCCCTCTACAGATCAGGAAGCACCCGATCGTACGCGACAGCAGTTTTATAGTAGATTTAAACGCCTGCCTGCATCAGGACGGTAGCCAGACGAACGATATCTGGCCCCCGTGATTAGCACTGCTAGAAAGCCGAATTCGCCGGCCCCAATATTCAAGAACATCTTAGAATTTGCCAGAATATCCTTAAACCTGAGTCAGTTTCTTCCGGAAGGAATACGGAAGAGATTATTTCACGTCGAAGCCTGCCAGCGCCGTTAGTCGCATTCTTCGGTTGTTACCCGGCATTTTAGTCATGTAGCACTGTGATCATTCCCCGGCTTAGTCGGTTTAGATTCAGCGTCATTGCCGTCATGACGCGTCATAAATATCTTGGATCGCGGCCAGTCAAAAAGCGGTGTTCGCATCTGGGTTGTTGTTCCCTGAGCCCGGTCCTGTTGTTGGCGTTTGCGGTCATGCATTCAGGGACGTCAGTGAGTGGGCTTTCTGTTCGTTTCATCATTACCATTAAACCGCCTTTGGCTTGCAGCAGCGTTCAACGTTAGTTTATTGCATCCTGAGCTGCATTATCCCCCTTTCTCGTTTGTCCGCATCCTCAAGCGCGACCTATGAAGCTATCTTCTGCACGTTGCCGATTTTGCACTTGCCACTTCCGCCTCTTCCAGAAGGCAGAAGTTCCAGGAAGCCTCTTCGGTCGTGGAGCCGTTGACGCACTCCCCGCCGCCCGTATTTTGCTTGCCCGGCGGAAGGAGGCTCCGTTCCGCCTTAGTTTCAATACCTTAGGATTCGTCTCGACGTTTTGCCTGGCATGAATTTCTTGCCGCCCGTCATGCCGAGGAAGCTGCACGACCGGCAGGTGATCGCGTTCGTTTCTGATGATTTGCTGCCTCTTTGAGGCCACCGATCTCGTGCTGAAGTGGCGGCGCTCGGTACGCTTTCTATTGGCTTGGAGGCAGACGTCCAAGCTGTCTTTGACCTGCAGCATTCGTTCTGACGTTTCGCCAGCGGCACTGAGCCCGTTTTACAACTCTGCGATGCGGCAATTTTTCTATTCATTAGCCTTTGCTGATCCGCTTCCGCCCGGGTCGACCTCGCTCCGGGTTGAACGTGCAGCGTGGAGGGGAATTGGAAGCGGCTGTCGCTAGAGAGCCTCCGAGCTCCTTTCGGCTCCTGGCATCGCCGATGATTTCTTCGCGTCGTCCCGTACTCTGTTACGCCCCCGACGGTCACGGGGCGCCTATTCCACCATCAGTTCAGACGACGCAGCACCTCCATCGATGGCATCCTCCGTCATGGCACAGAAATCATTCAGCGTCCCCCGTTGAATCTTCATACGATCATCTTTGCAGTTCGAGTGGTGGAGCGTACGATTTCATCATCCACATCGTACTGACCGTACTCCACATCCATGCTTAACGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCACCACCACGGTGTATGTTACGTCGGCTTTCATCATATGAATCGGTGCATTCTGTACCGTTTTCCTGTTACGTCTTTCAGACTCCAATGGCGGTTACTGCTAATCCACAAAGGCCGGTTCCGGCGGGCTGCTAACTTGTTACCTGGCTAATCAGAATTATAACCGAACTCCCAACGATGAATCCGTCAGTACGCCGGGAGCCGGAGCCGGGAGGCAGGAAGAAGACGACGGTCGGATCCTTCCTTATCTCCTGCGTATAGAGCGCATCACTCTTGGCAGGTCGAGCTTTCGTCTATATCCCGGTTATACTTCCTTTTACGGTAACCGCTAGAGTAATTTCAGGTCAATACGTGAATCGTGAGCCCCAGCGTATGTACGCACGTAAGCGCTGATTACCATAGTCGTAACCTTGTGAAGGGCTCCGATTTACATCTAACGACGTCGCAGGCTCGGGTGAAACGTATCCTCCCCGGGTCATCACTGTGCTGCTCTTTTCGACGCGGCGAACCGAGGGAAGCCCAATAGCCCCACATGTCCGTTCATAACGGTACTTCACGTTAATCCCTTTCAGATGACTCACGTATCCCCCGCCGACAACGACGGATTACCCATTTTCATTGAATAGCCCACCGTAAACGTACGTTAGCTTCGTCGCACGGGCTGCTTCTCCGTCGCCGCAAATCAAGAAGAAGGAAGGATACAGAAGCCCTATGTTTCGTACTCTAGTAGATAACGCCGTTCCCGGGACGACCCTCTGTAACACATGCCAATACGGTTGCCCGCCCTGTTCTTAATCACCATAACCTGCACATCATGGCAAACGTATACCCGAATATCTGCCGAATCCGTGTAACTTAAGGGTACGTCAAGGATCACGTTCCCCATGACCCGTGCAGTAACAATACGAAATAGCTGTACCGCCTCGTTCAGCGCCATCATAATCACCGCACCGTTCATCAGTACTTTCAGATAACACATCGAATACGTTGTCCTGCCGTGCTGACATGACACGTTAGCCTCATAGAAACGTCAGCGAAGCACTATCTTATCGATCAAAGGATGGTATGGGTCACGTGACAGTACGGGTATAGGTCGAACCGTTCATACCCCAAGCGCTCTCACCCGCCTTCCATTCCCTGTCCCCGACGATTTTCCGGAAGGAATAGCGAAGGAAGTATGGCAGCTATGGTCACGTAACTAGCGTTAGAGTCGCATTCACTGCCACTGATATCCGCATTTTAGCGTCAGGTTCCGTCGGTGTTAGAAAGGCCTAGAGAGATTGCCGCCGGCTGGTAATGGCGTCACATAGGAGCCAGTTAGAATACGTCGTTCATGAATATCTGGTCCCTGCGCCACAAACATCGGCGTTCATTCCCCGTTGCCGTATAATAAATGCGATACGATTGGCGGCGATGAAGCAAGACTGGCTCAGTTTGCTTCCTCCGTCTCCATGCCGGCTGATACCGAGACATAATGTTTGCCTTTATTTGGTCTGCTCAATTTGACAGCCAAGATGAATTCCACTTATCACTGGCATCCTTCCACTCTTTCGAACTCCTCAGTCTATGGCGTTATCCTCCGTCAGCTCGACTTTCCCCTTCCTCTCCTTCCGCAGTGAATTCGTTATCTTTAATTTTCGATCCAATGCTTCGCCGAATGAATGGAGAAGGAAGCCGATTTGCCAAACGGTTCACTTAGATATAAAGTAATAATCATGGCCGGTTGATATTGATACTGGCGGCTGGTGAGAGGTCGCCGTACCAATACCGCGTGCTGGTTTCACTGTCTGATATCCGCAATCTGCTTTCTAGAACCAGAACTCAAACTGTACCGTCCGTATAAACGGCATAATCCGGCGTCGTGTATGAAGTCCGATATAGAGCCGTCACTCAATCCTCGACGTGCTGCCGTCGGGCAATCGAACGATGACTAAGCGTGAGCTGCTGCGTACCACGCATTTACCGCCGTAACTGTCATGATCGTTCCCAGCGCCAGTCCGTGAATGTATGTGGTTTCGTCGTCCATCCGTTGAACCCGCTAAGCCTATGCTTCTTCGCTGTTGGCTTCCTCCGGAGTCTCCGCTTCGATCATTGTGTCCCAAGCCAGCACCGATATTCCCGCTGTCGCAGGATTCCCGGGGAGAAGAGGGAGAGGAGCTGCAGGCCGTGACACATTCGTACCGTGCCACTCTGTTCGCCGTCAAACCCCCGTTATCCACGATGGCCTCTTCCTACATTGATGCACGGCGGTGAATGGCATCACGTGCCGTCGTTCTCACGATACTCACGCAGCGGAAGTCGCTGACGGCGCCGTCGCATTCAGGCCTCCCCATACGTATTCAGCACCGTCAGAACAATTTTACGTCACGCCGTCGTGACGACCTGACCTCCCACGCTGACCGGATTGCCACTTCCGTCAACCAGGCTTAGCTAAGTCGGGGTAAGGAGGATGGCAGCGTACTTCCGCTTCGCTTCGCGGCTTCCAGTTGGCGTTCAAGGCACGACCACCGGTTGGTACCGGGCATAGTCATCATCGCAAGATTTCATCAATAAAGCCCATGTACATGGGCGTTGACTGCTCCGCACTATGAAATCACGGTCTGCGTTCCCGTTCTTTTAATGTATCAACAGGAGAAGCGCCTGGAGGGAAGGGTACAGCCAACGAATGCATCCATCGTGAAGTAGTACGTAACGGGCAAACCTGCCGTATCTTCAACACGCTCTGTCGCCGTCTCCCATCCGTTGTTCGGGTCAATCCAGCAGTTCAAAACGGCATTGAGGCGAGTGCTTCAGGCGCTGAAGCTGTAACGAGCGCCGATCCGGGATACTACAATGCGTTACTTGGTATAGTCCTAAGTCTTATCCGACGTCATTTATGCACGACCGAACGTTATGCCCGTTCTAACAGGCATAAGCGCATGCCTAAGCAGTTCCCTCCTAATTCTCCGCCGTATAGATCTAACTACAGTCCCTATCCGGCTCCGTCCGCCAAAGCGTCCGGCGGACTTTACCGCAGTACTCGATCATGACACAGCGCCATTTATGCACATCCGCCGCAGCACGAGCTTTCCCCATCCGCTCCCAATGGGTCAGCATGCTCAAGACAGGCCTGTTGTCATCCGGTTTAAACGTTCCGTCCCAATACCGCCTGTATTGCCGCTGAGGTCTGCGTGACGGTCCGAGAAGAAAGAAGCCCTTAAGTGATTATCCATGCTGATGAAGCTCCGAGTCGCCCTGCACCCCATGGATTGCCGTGTTCGGCTACTGTTCAAGTAAGTATTTCAGTGGACCAAGAGCGTTTGTTCCTGCAGGTATATTCTGCTTCCGCTTCATCCGCGTAGGATATTAAACGGGGCGGCGGCTTACCCAGGCCGATCGATCAGATACTGCAGGTGGTTTGGCTATTAATGGTGGTCTTTTCGTCACCCAGCCACCGTTACGTTGTATGAACCAGCAGGCGACTTCAGGACGGATTCCTTTACCCTTTGAGGTGGTTTCACAGTCCGTACCCGAAGGTAAAGGCGCATACGTTAGATGTTTGCAGACGTAATGGTGCTGGTATACCGTGTCATATTTCACTTCCGTACCCAGCACCGTCGTCCATCAGGGTCACGGAATCCCTAGAGTCCCCTTGAGCCAGCCCGGAAAGGAGAAGAACAAGGATATGTTGGTATTCCCTCATGTGTTTAAAGCCGGCGTACTGTTCGCACGCTTTCAAGCCATCCGGACTTTGCCTTAACCGTGTCGCTGATGGCATCACGATCACTCCTCGATATTCCGTGACTTCCTCGCCTTGTCCTTCGATCTAGCGGGGGTCCCCTTACTGCTTCCTTTACCATTCCTCACTCCATAAATGACAAATCGACGCAGGCGGTTGCATAAAACATTTTACATCAGCGACCAATCACCACATGATCACCGTCGCTTCGTCTGCCGTTGATCTCCCTGAGAACCACGTGACTCCACGCATTTCCCCCGTCAGAACAGGCAGAACATTGCTGCTGGCAACCATGTTATCCAGTAAGAATAGGTCTGCTTACCGTTATCCGTTTGTATACGACGCGAGAGTTATGGGGTTTCGGTGCCATCTTGAGCGCCACCAAGCTACCAGCATACAGGCAGAGAACAGGATCAGGTCATACCGCCTCCAAGTGGCCTGCCCCGCATGCGTCCATCCGAGAAGAAGAAAGCAGGGATGGAGGCAGCCCCAAATTAGAATACGCCTTATTGGCCCGGCGACTCTGGAACTCCAATATGAATTACAGCGCCATCAGGCAAGTCTCATGACTTTCTCGGTTCCAGATTCACTCCTTCCCACAATCCCGTACGTGATACCAGCCGTCTGAGTTTCTTGAAACGAACGATGTGTATTATGAGGGCGCTTCGATGAGCTTCAGCCCCGTTGGATTACCAGGTCAATTGCTACGATAAATCGTTGTAATCCCGTAAAGCAGATCCCCCTGCAGCCGTGACGGCTAGGATGTGTGCGTCGATCCGCCATTTGTTACTATCCTCGTTTGCTCAGTTGTTCAGAATATGGTGCAGCATAGCCGTCGCCGCATAAACCTTGCGGCGTCACTCGTCGCACTGAACCAAAACAGCAAGGCACATCGCCGAGCTGTTAGGAAGAAGCGGCCAAGTGCTTATCTCAGACCCCAGATTCTGGCCGTTACGCCACCAGTCATCCTCACGATGAAAGTCGGCATCTCAATCCCCGATGATAAGCATCCGAACAGTGTGACAGTCCGTCACCGTGCTCAAAGCGCCATCAGCCGGTCTCGGCTTCCAGGCGCCAGGCTGTGAATCGTCCCCGGCAGACAGCCACGGCAATCATCGGCCCTGCAGCCGCCGTGAGGCTCACTCATGAGGGGGACCACCGGGTAGGTCGTGAAGCACCACAATCTCACTGCATTTCTGCCTTAATCAGTCTTCCGGCGACATACGGAAATACGCCTCCGGCTCACCGGAGATTCACGCAGGGAATATCTTTCGCCTCCGGGCGTGCTTACACCGAAGCCCCTCAACTAAAACGCGCTGACACGCCGTGCAGGAGAAGGGTCGATTCGTCTGTCATGGGATTTACTGGAAATATAGAGAAGGAAGGAAACGTTCCAACTTTAAGTTTAGTTATAGTCT	*	tp:A:P	cm:i:35	s1:i:301	s2:i:0	NM:i:2893	ms:i:740	AS:i:684	nn:i:0
+46	16	utg000001l	17739	60	604S522M25D12M3I15M1D5M9I4M1D7M2I4M2D18M1I3M6I15M1D4M1D3M1D3M2D2M1I7M1I2M6D10M1I2M1I8M1I6M3I17M2I7M3I5M1I3M2D1M1I16M1I8M2I11M1I1M2D7M4D7M1I3M3I4M2I7M1D7M3I2M1D7M4D8M1I7M2I6M1I5M1I2M1D7M1I37M2D19M2I11M3I6M2I2M2I1M1I13M1I3M3I3M1I1M1I5M3I9M2D7M3I1M1D4M1D2M2I8M3I4M3D8M1D12M1I2M1I14M1I4M3I1M1I4M2I5M4I1M2I3M1D12M1I7M1D4M1I12M1I4M1D11M1D8M2D23M3D1M1D2M1I17M1I2M1I4M6I1M1I4M1I19M1D5M2I17M3D7M1I4M6I4M2I8M3D4M6I18M1D2M1I3M3I8M7D3M2D6M3I12M2D14M1D3M1I1M2I20M1D7M1I4M2D2M2I4M2I10M2I4M5I8M5D5M1I21M1I16M1D11M1D25M1I6M1I4M2D7M2D9M1I9M11D2M1D10M5D19M3D7M1D1M1D8M3D1M4D2M1I2M1D3M3D3M1D1M1D18M2D1M1D6M3I3M6I6M3D9M1D7M4D9M1D2M6D1M1D13M9D2M1D5M2D6M2D5M2D3M3D2M1D6M1I20M1I1M1I3M2I6M1D3M1I3M1D3M1I1M2D8M3I11M1D1M3D6M4D1M1D10M1D3M1I2M2D24M1I7M1D8M1I6M2I4M2I20M1I1M1I16M6I6M2I11M1D8M1I3M5I9M1D2M2I6M1I3M2D6M3I10M1I4M1D7M1I2M1D5M3I4M1D8M1I2M1D4M2D10M2I5M3D10M2I7M1D6M1D3M4D5M3D11M1D28M1D11M1D1M1D4M1D4M3D7M1D17M1I5M1D15M2I13M6D15M2I4M1I2M2D14M1D6M1I32M2D4M8D18M1D4M1D4M2I6M2I2M2I6M7I14M1I1M2I2M2D5M2I11M2D5M2I1M2I6M4I2M1I3M1I4M1D2M1D2M2D3M2D24M3I11M1D9M2I7M5D2M2D9M1D2M2D6M1I2M1D3M1D4M3D11M1D7M1I6M2I12M2I2M1I3M1D4M1D4M1I7M1D6M4I2M2I5M1D3M2D2M1D3M1D2M1D6M7D3M1I7M3I9M4I1M1D2M1D5M1D3M1I5M4I3M1D9M4I7M3I10M1I18M5D3M1D2M1I6M1I3M4I3M1I5M4I10M3D4M1D13M2D2M2I4M1D1M2I4M4I11M1D9M1I2M2I2M1D3M1D2M2I1M1I3M2I5M4I1M1I14M7I9M1D4M4D13M1D12M1D3M2D1M2D3M2D5M1I7M1I2M1I4M2D1M1D2M1I10M3D3M3D6M1I7M5I6M1I5M1I9M3I8M1I2M1D9M1I6M2I4M3D2M2D3M2D5M1I2M1D6M2I8M1I18M1D6M2D11M3D9M2I1M1I4M1I12M3D4M1I15M1I4M1I5M1D4M2D2M2D6M1I11M1I5M4D5M2D2M1I9M1D18M1D5M1D12M2D6M2D21M2I1M1D21M1D11M1I5M4D2M1D19M1D26M1D5M1I10M2D1M4D1M8D3M1D20M9D9M1D8M2D8M1D7M1D3M1D3M3I7M2I15M2D10M2D3M1I3M1I8M2D5M4D7M1D7M3D3M2I3M1I12M2I4M1I4M3I8M3D30M2D3M1D9M1D1M2I6M2I6M4D15M1D13M2I24M1I1M2D13M2I1M1D9M2D4M1D8M1I8M2I4M1I5M1I10M1D15M1I1M1I8M10D1M1D3M1I3M1I5M3I24M6I4M6D1M1D5M4D6M3I2M2I18M1D3M1I14M1I8M3D1M1D4M3I4M1I9M1D32M2D1M2D6M3D7M4D5M2D12M3D4M1D11M1D7M1D15M2D7M2D14M1I3M1D1M3D11M1I9M1D11M1I3M1D3M3D7M1D11M4D12M1D5M1I7M2D12M1I4M1I2M1I7M1D6M1I4M2D12M2D13M5D12M2I3M2D1M2D4M2I6M2D14M1D2M3I3M1D7M2D14M1I9M3D7M2I15M2D1M1D4M2D8M3D2M2I4M1D4M1D16M2D9M1D5M3D22M1D6M2I2M1D4M4I22M2D14M1I2M1D3M1D4M2D27M6D10M1I6M1I12M2D9M2D6M3I18M1D12M5892S	*	0	0	AGATATCCGCTTAGCTCGTCCAAATGGAAGGAGCGAGCATCTTAGATATAGAAAGACGACAGAATTTCATACGTTTGAGGCATGGGTGGTTCCAACAGCTGGAAAGTTGGGCTTAGAAATAAGAATCAGATGTACAAACCAGGCTACTTAACTGAACTTCACCTTCTGACCGGCTTCGAGGCTATCGCTGGCTTATTTGGCTAGAATCAATTTAGACGGTCGAAGCAATTTTGTTGGCAGCAAAACTCCGCTCGCACCGACTCGCAAGAGCGATCAGGCTTAATTCGAATAAAGCCAAGTACTTCTGTTACAGAAAATGTGGAGCACATGCTATCGAGGCGGAGATCGAAGAGAAGCACAGCATCGTGGTTAAGAACGGTAAAGGGGCCGCGACTCGACTAGATTCTACGATTGACGCTCGTCGGAATCGGCAGGCTAACGGGGCAGGCGCATAACGATGAACAGCGAAGAAACCGATGACAAACTCAGGGAGTATCATGTCTGCGCTTGTTCCACTCAGCAGGAGGGATAACACGTGTCCGTACGCATGAAATTTAGTAATGCAAGGTTTGACTGATCAGAAAGTGACAATAAAGTCATTTAGTAACACAGCAATAAAATTCGCCTCCCTGTTTGACATACCAGGCTTGATGGGTCCTGTTGGCTAGCGACCCGGCTCATGAACCAAATAAACAAAGAAGACGCGCGAGCTGTTATTATGTCTAGTTTGACTGTGCAAGTCTCAGGCTAATTGGGACGTTATCAACAGTAGCTCCGACGCTGGCAAAGGCCGGCCGCACTCGCCGCGATCTCGGGCAAGCCGACAGCAGCCACTGATGACAGACTGTGATTAAACTAATCTGCGGTCCCAACGGCCAACATACGCAGCGCCGGACGCTTGTTAAGTCAGAACGGGAAAGAAACCAGCAAGATATCAACGGTAATCAGGAGAACGGTCCAGATATCGGGAAGTAATATCTAGCTAGAAAACTGCGTGCGTAGGCTAGAACAGGCAAAGTAAATTGAACTATACGGAGGTTTGACAGCTTTGGGCATTGTATAAGCGATGGGACCTGGAAAGGCAAATGACTAGAAGACCGACCATGCCTCGTAGCTGGAGTTCTTAAAGATTCCTGGTGAGGACCCAAGGTACTGGACCGGCGATCTTACGAAGGTTGCTGACCAGTACGGAATAAGCGGTGTTAGACTGGAGGCAAGTAATACTACGCAAGCTCTAGATGCGGAGCGGAGATTTCTGCAGTGTAGAACAGGCTACTCTCCATCGTACGCGGCCTCAATTAGCCCGTGCGCGATCGCATATCAACAGGAGTGAGATCGTTTGTATAAAAAGGAGATAACGCTTAGAAATGCTGAATTCGCCGTCTCCTTCGGTTCACAGGCTGCCAGAGGTCTGTAGTGATGATGACCGTACTCCAAACATCGGATATCTGTTTATATGTACTGTTTCTTTACATAAACCTTGCTGATACCGTTTATGAAACCACCATTGCAAGGGAATTTATAAATGGTCAGTAACCTGAGTTAGAGTCTGAGCAAATACGCGTATTACATCTGTAGCAGTCCTGTTTGTCGCTCGGTATGCACGGTACGAAGGGCTTTATCATGAAGGCTAGATAGAGTCGGCATACAAATATTCGATGAAAGAGTTATTATACAAGTCTAATGAAGACAAATCCCCATTCGCGCAATGGCGAGAAATGACTCATACCGTGCAAATTATCACGAGTGTACGGAAACGATACTTGCTTGGGGACCTAGGCTCATTAGACCCAATATTACATAAATGCTCGCACTCGCGGGATTCCGTTTATCTGAACCCTAAGCGGGTTTGTTTATGGAGCTAGCTGTCAGACGGATTTCCGAGTACAGGAGAATGACGCGGGAGCCATTCAACAGTATTATCGAAGCGGAGAAACCAACGACTAGACCACTGGATGATAGCGCCGATACTACAGCACAGGGACGTAAGATATTCGAATCAAGAACTGAAAGACAGGAGCTCCGCCTGATGGCTTTTTCTGGATTTGCGTAAGAGACTTTGCGATGTACTGACACTTCAGGAGTGGAACGCACGACGCCAGCGACGTCACGAAGCCTTGAAACACTTGTCGATGCCACCGGGAATGCAGGATATTCCCACTCCGGTTTACGAATATCTGTTCTAACGACAGGTAAAGTGATTGACGTACCAATAACATTTATGTACGAGGAATGGGAAGAAGGCGAAGAGAGCTCGTACGGGCACTAGAAACAAGCCACTCACTTTAAGCCAAGGACGGGTAAAGAGTTTGGATTAGGCAGAGACAGGATCGCACTGAAGCTCACAGGCCAACATTGAGTATTTGCTCAGACACAACAAGCGCTCAACTATAATCAACAGGAGTAATAATTCCGTTACGAGGATGCCTGCTCATGCCGTACTGATGAAAATGGGTACTAACGCAGAAGACACTCATAAATTACATGAGCCGAAATTAAAGCAATAAGGAGGCGAATTCTGCCTGATGGATGGACGACGCACAAGGAACAAAGAAATGCGGCAAGTGCTGACTCATACAGAGACGAGGGCAATTGCCTATACTCAAGTTAATCAGATCAACACTGAGCGTGATGCATTCCGAGCAATAGCTGCACCGCTACTAACAACCATGTCCCTGCGATGCTTACAAATAGTAAGGGATGACTAAGGAAGAAGCTTTGAAAAATTATCAAGCAGCAGAATAGAGTTGTTGGCTAATGGCACGGACTGTCTTTGGTGATGTGACGAGTATGTGATTATGCGAAATGAAGGCTGGTTGGTATGGTCACTTATGTCTGTTAACAGCACAAAAACAGGCGTAAATTCAGCCAACAGCATTGCATATTACTTGTGCCACTAATGAATTAAAACATTGATAAATGCAAAGAGATTCTTGGCGGAGGACATCATAATTGCATCAGCCTTACTCGTCGCGCGAAGCGTTTGACCAGTACGAGCGGCACGAACGTATTTATACTATCAGGAGCTGGCCGCGCGCCGCCTCGAACGACGGCAAGTGCCTACTTTCACGAGTCCCATTTGTTGCTGCAAGATGACTCCTGAAGCAGATGATGGTAACATGGGCATAAGTCGGACACCGATGGCATCAATACGGTATCGGAGGAATACAGAGCAGCGACTAGACAAATTGAAAGGTTAAATAATAGCATGTGACTGTTTATACCGTTGCTTAACAAATTGATAATCGCAATGCGTTGGTAATGCCAACTTAGGTATAAAAAGCAGTGAACGGCGAGAAACGTAAAATGATAAATATCAATATTAATCGTCATGCAGCAAAACACAGACTAAGATAATACTGTAAACAAATATGCAGTCATTTAGCTGAATCAACTATGGCTTAGATGTGATCTGTAAATACTATCCACGGTTCGATGCCCGCAGGGACATCATTTGTCTTCTTGCGCTAATTTGTCATCAAACTGTCTTAAGTGAAGCACAACGGCGCCAAGCCGCTAGCAAATGTCTTGTACTACATAAGATCTGCATAACCAAGACCAGTGGATGTCACTATCAACGACTGAAGCATGACTTCTTCGCGCCTCCTCAGATTCCCCACACCCAGCATCTGCACTGTTCCGCCAGACTGTAGTAGGGGCCCAGGGAGCGGAATAAAGTGTAAAAATGTAGAAAGTCGTTATCTATCGGCTGCTTAGGTACTTGAAACGCTTCGAGACGCCTGAAGAAGTCTAATTCATTGGCGACTATATGCCATTAATGACTGTTATCGTATGTAGAACGATGCATACGGACATGAATAACAGGCCGTTGTCAAAGGAAGGAAAGCAACCCGGAAAACTAATACGATTAGAGTTAAGTTCAATACTACTAATTAGATGGAACGTATCTATCACCCAGTAACTTAAAGAGCATTCTGTGTTGCCGCCAAATAAATTCTATTGCTTTAATAAATGATGTAGCGGTTGGCTATAGAAAGTAGTGCTTCTGCAGTAGAAATAATGATTTCGATAGATGGTTGTTGGAAGCTGACTATTCCTTTGTCAAGACTTTATTACCTGTTCTTTGATGATTAGAAAATGGGTATCGATGGACTATAAATTAGATGTGGCTCTTACAAAGACAGAAGGATGTCACTGTCTGTTTAAGGTGTAGACGCGAGAGATCCCTGAAAGCCTTATTCTTCCTTAGAAAGCATTGACTATTTACTTCATCCAAGGACCGATTGACCTCTATATGAACACAGATTGCGGAAGCTATCGTAGGATCTAGCTATGTCAAATCTAATTGGAGGTCTAACCATTGAAAATGAAAGCGTCCTTAACACCTCAGTGTACTTAGATTCGAGAACAGCCAGCTTAAACAGTTCGCACGTGTTAAATGTACCTCGTTTAATTGTCATTGATTTCCATTTTCATTTAATAGAAAAATGTCCCCGGATTCAGTGATTTTAACTATACGTCCCTGACGGGTCGATTCCTGCCACCAAAGAACATTCATGCTTTAGTCTCCTTAAATCCTGGTAAACAAATTTGAATGGAATGATTGGTGCAATCACACCCAGAAACAATGAATATTTTCTGAAAATAATAGACTTATCGGAGCAATCCCAAAGGCCATATTTTCGATCGCTTGTTCTCATGCCCGTGCATTGATCCTTTATTCTAACAAACAGCATACGGCTAAATAGGTAATATTTGCTGTCTACTCGATTCAGACTGCCTGCCAGCAATAGTTTAAAGTACTCAGCGCGGTTTGCCTTCTAATCCCATTGCTAATATTATGAGCGCTTATAGATATAGAAAGACAACTGGCTTGAAGCTAGCCAAAATTACGTGATGAAAACTTTTCAAATATGGAAGCCAGCCTCACTGGGAAGGAAGTTAAGACGTAATGGACTCAAGATTCAAGTGGACGATGATAAATTCACTAAATTGTCTGTAACATATTAGCGAGAAATAGTGCTTCGAATGAGCTGGGACATGCAATCTGTTACCTATCACAAGATTAGTAGATGTCGTTGGCGAACAGGTTTTACTATTCAGTCCAACAGGAGCTTCATCTGCATGTCAGGACCTTTGCTCTCTGCTTTACGAACATTAAGGCAGCCTGTTTAACGCACACGGGCTGACCACGCACTCATTCCAGTACTGCAAGGTTCAAAAGACGCCCGGAACCTGATTAAGAGAAGCAAGCTTATGTGCGTATTGGATCCTGTCAAGAAACTGGCCTTATCCGTGATAATTCCGGTGAGCTGTGCTATTGAAAGTGACAAATTCTGGATACCACTATCATCGCAGGTCGTTGATCGTTACCTTCTTATGAACCGCGAAATTTACGGTCACTAGATCTAACAGTAGGACCGTTCAAAGCGATGATAATGACAGAGAAGGTAAAGTACAATGAACACGCTCTCCTCAGCGACGTGTCGAAATGCTCTAATAAATGCTCGAAGGGTATGATGCAGATAAATGTTAGAAATAATTTCAGTAGGTACTTCCCCACTTTTGCAGAACAAAGAGGAACTAAGCTGACGACAGAGTAGCTACAGACAGTATAATTAACACTTCTACGGCAACTTAGTAGTTGGTACTGAAAGGTTAAATTAGAAGAAAAGTGTCGAAATAATCTCCGAGATAAAACAACCTGAACATACCATAGACTGCTTGTTTCATCATCAAAAGGGTTGGCGGTTTTAACCAACAAAAATATTATACGTTTTCTTCTATTGCAAGTGTAACCTGCGGAGTTTCCTTAATTTAGTTCCTCATCGTGCTTTGTCACGCCTCGCAAGTGGGAGAGAAAGTACATTTTCGCAGAGCCATGGCGATACACCAAGCGATCGTTCCCTATAAGTGACACGGGACATTTTTCGTGAGCAGCAATGGCTATGCAAATTGCCCCTAGAATCGGCCTGCTATCTAGTATGTTGAATGCCCGGCGAACTGGAGGCAGGAAGACAACACAGCTCTTCATCTCAATGTTAAACAGTGCTAACAGGTATCGGCTTGTTTGGAGGCAGGGAAGCACTTGAGTGAAGTGATTACTGTAAAGAATATTTCTTTCGTAACAGTAAGGACGTTCGGTTCAAATGCACCAGCCCAATGTCAGAACTTATTGAAGCAAATCTGAATCTATTATACGTGGCATGACTTCCCAAGCTTATTGGACGAGTGTATTTGCCTAGGCAAACTCGGAAGATTTCCAGTCGATCTAGAATCATGAAAGATAGAAAATTACGACGCTGTCTATCGGAAGTAAGAACGAAGTCTATGCGCGAGCTTACTTACAAAGTGCTAGTAACTTGCCTAACCAATTCCTAGCAGTAATCATTGGCAACAGGCATGCAGCGAGAAGGACGTTTGTAATGTTCACGATCGGCACAGCGGTAATAAGTCAGCAGGCCTGTGGCGTAGAGGGCCAAATCGTGTGGCTCATGTGCACAAAATAGGTAAAATCGCTAATCGGAAATCATTCAACAGCACTATCGGAAGTTCATGCCGCCAGCTAGCAGCACGTCTCTGCATCATCAGACAGCTGTCTGGGTCTCTATAAATTTATGATATGATACACGAGACTGGCATCGACTAATAATAATATTAAAAATTTCCTGTGACTAATCTATATGTTTCGATAAGAATGATGCACAAAGATCAAACAACTTGTATAGAAAGTGACATTACTAAATTGATAGACTTAGTCCATCTTAAACCATATTTGTACTGATGGCAATTATTTCAAAATGGAGTCGTTAACTAAACCAGCGGAAAGAAGACCTGACCACCCTTTATCTGCACTAGACCAGGACGGAACGTTTGGTCCATCTACCTGAATGTTGCCTTGACCTGAAGTACACTCCGGGAAGCAAGAACAGTACCAACATTATTATCAACAAAACCAGATTAGATAGCGACACTTGGTAACACCGAGGCTAGAAAAACAGCGAAATGATCCAGGAGGAGCTAATGGCTTGTTATGTTAAAATCCTGCAAGATAGAACATGTCAGCGAAAGGAGGCGTAAAGCTATCGCCTCATTGAAGAAAGGATTTATTACAAATGAAAGCTGTTAAACATTGGTATAAAAATCGTAGACTTGCACAAAGAAATTACCTTCGGTTATTAACTGAATCATTAGCTTATTAAATGAGAAAGACGATGGGATCCGCTAATACCTAATAAAAGATTACGAATTATTACATGCCTTAGCTATAATCTATGGCAGAATGTATAACTGCTGTAACTGCTCGAAATACAAAATAAACTCAAGTGCGACGATGTGATTTCAACATCATTCGACTCTTGGTGAAGCCAGGAGAAGATAATTAAAATTAAAGATAATTACTCACTAAGCAAATTGTTGCTTTAGCGGTTTGATGATACAATATGACAATAAAATAATTCGAAGTATTAAAGAGGGTCTAAACTCGGTAGATAAGCCTAAAATATACTCGGACAGAAGAGTAGTGACTATACGAGACCTAAGAACGATTGCGGAATAACGAGTAATGCAAACATCTGATTGGCTAATTCATCAATTGATTAAGGATAAGATTTGAAGATTAAGATAAATATATTTTGGCGTTGCTCGCATGACACCAGCCAAATAACAAATGCCTATGGCTTCATTTGATAGAGTGGCTCAGAAAAGGACTCATTACTCCAATAAACCAATACATACAATGCCAATTATAGATGAAAGACGACTTCAGGTAATCGACCTGATTCAAATAATAATCAAATGTATTTCATGGAACAACGTAGAGAACGAAGAAAATGACCTAGAAATATACTCAACAGGACTCAAAACATGACGAAAAACCATATTTCGTTCGGCTAGTCTCAAAGCAATCGCGGTGATGTAAACACTATGAACATTGAGTCATAGAACTTCCATTATTCCCTGAAGATAATCGCCAACAGACATAATACCAGCTGACCAGCTTTACACATACTATAACACTAACCGCAGAACGTTATTTCAACCCAACGTTTCTTACAGAGCATACAAACGATAGCCGCCAACAGGGACAGCAGGCTCGATTACTTACAGCTTGAGAGTATCAACTAAGCTTCAAACATAGCGATACTTCTTCCAGCGCTTCCAGCACGCGAGGATTTCTTCCTTCGTTGCAATTCCCATCTGCACTCCGAAGGGCGCAAATAGCCCTCACTGGCTATGCATCAGCTTTGTTTCTTCGCCTCCTAGACCCCTACATCCAAAGAGCTTTTCTGCTGCTTCGGCTTCATCCTCGTCCCAGGCTGTCGCGTTCCACTTCTACTCCCCCGGCGCGGTGACCAGGCACGCTTTCGGCGACGTAAATGGTTCAGAAAATAAATAACGCGTCGGACCACAGTTATAGACCGCGATGTGCCCCTTACTGTTGCAAACGAGCCCCTAATCACGATGCGCCGTCAGTACTGAGTGAAATATCTACAACGTATTTGCCGGAAGAGTCTGGCGCACAATATCGTACCCTGTTTCACGTAAATGAGCCCTGACCTCGTTTGATAATTCCATCGGTGCCATAAGATTATAAATTTATTGGTTGTTCACTCATTCTGAATGCCATTATGCACAGCCTCACAATAGTTAAATGCATGCAATGGCTTTGACCGGGCTTCTGTCCGCACCGTAACGGTGATGTGGTGTGTCCCTGTTGAACCAATACTGAAAGAATGGGCATGCTACAAGGGCCGATAACAACTGATTCAGGCTTAATAACGGTGCCCGGGGTACTGATGACTCGGCGCCTGTACCGGACGTGACGCCTGCTCCGACTGTCGTTTCGATAAATAAGCAAGTTGTGTCCTGGTTGTTCATTCTAACTGTGGATAAACTTCCTCCTGTAATGGTTCGATTGGAGTACTGTTCACGCCGGAGAACTGTTCATCCTTAACCACCGGCAGCTCACGCGCTCGCCTGTTGAACGCTGACTGGGCTAAGCTCGAGTTGCGTTGGGGCGATTTGTTCGTCCGTAATCGGCAAAATCGCCTGTCTATTCGGTGGTAAGCCAACGACGTCCCTGATGCGGCGCCTGAATCGAGACTTGTAATGTTGCACTGTAATTCACGATCGGCTGTCCATGGCTAAGCGCACCGCCCGCTTCCTTGTCTGAGACACAAGCAGCAAGAAGTTGGTGCTTCCCTCCGCGCTTCCTCCCTTACGGTGCTGCACTACTAAAGCACAGTAGCCCCGGATACGCGAGACAGCAAGTCTGGGCCGCAGGGAACGAACTCGCCTCTTTAAGGAGGACTATAACGGACGAGCACCTTCGGCTGAGCTCTCAGAATTCAGAATCTCTACTTAGATCGACGAAATGAATTCGTAAGGTCGGATTTATTTCCTAAACATTTGCAACGGATTATCGCCAGAAGTTCCTTCCCTCAAGTCCTGGTATGGCTACTGTTGGCGGTGCATCATCTTCGGCAAAGATTCAGGATTAGTCGGTCGTGAACGGTTTCATTCATGCGTCATAGCATCCTGCGAGTCGTTGTTACCCAGCCGAGGCCCTAACATGCTTATCATCTGTGTCCGTCGTAACAATTGGGATTAATTCCCGTCTCGCGGTTTCTGATACGGCTGTTTACTCTTCATGTCCTTACGGTGACCTAGCTTAACAGAACGTTGCAAGTGCGTTACAAAGACTTCTGAATGTGTTCGCAATTGCTATTGGGCTAGCTTCCCCGTTGGTGCCCTTATCGGGGCCGCGGATGGCAAGCCTATCTATCTTCTTAGTTGCCGGTTCATTAATTAACTGCATCCTGAGCCCTCGCTGGTTCACCGCTAGACTTAGCCTTTAATCGCTGCTCAGCATTACTCCCCGCCTGTTTGCATTCAATGTGACAGCTGAAGGCTGCACGTCCGCCCTCAACCTGGACGATGCCCCGCTCGAGTCTGCCGCACCCCCGCGGAGCCTGATAAGCACTCCCACTTGCGTGCCTTTCTTTCGCTCATCCCGTTATTCCATTCCGAGCGCCGCACTCGCTTAGCTCTGCTCGCTTCGAGGCAGTATCTCGCTTCGCTCTTGTTCCTACCGATTGTGCATTCTATCGGACGGGATAGCCCCGCGTTTTGCTGGCAGGTAACGGGGCTGCGAGGCATTGCACGAAGGCACTGTTTACTCGGTTCGCGAATCTCGGCTTTGGACTTGCTTGCGCTTCGTGCTACTCACCTCCTGTCGCAGAAGCATCGTGCTGACGCTTGCGGCTGCGGTGAGGCAGAACGTGCGCTGTCCACGGTCCAGGGGAGACTGAGCGCAGCACTGGAGCCTGGCGAAGCCTTCGCTGCCCCGTACTGTGCCTCCACCACTGTCCAGCCTCGGCCGGGGTACATCCTCGTTCGGGGATCTGCGCCGCTTGGCCTTCGCGTCCCCTTGCTGCCTTCTTGGTCGAGGAACCGCTTCCGAGTGAATGATGGACTGTATCGTAGCGGACGCTGCGGCGCGCTCTTTAGCGCGCGGCGGCGTTACTTGTCAACGGTTATTGATAAGGACCTATCGCGACTTTAAGCCTATTCTCTCTCCACGATATTCTGATTTCGCCGGCTCCGGGCCTCTCTCTTGTTACTGGCGCCTGTACCAATTAACCGACCGGGAGGTACGGTCAGTGCCCCCACAGTAGGGTAAGAAGCTTCGACGACCGATTACCTCGGCTTAGACTATCTGTATACGCTCCGATATGCACAGAGAAAGGATGCCTTCCGTTCAACCCTCCAGACTTGGTGGTCCTTACCTTTACCCTATACCGGGAACAGGTGTCCAAGTTCGCAGGTTACATGACAATCGAGTATTAAATGTATCTCAAGCCATGCCTGAATCCCACTGTGATGCCCTGTAATAAGTGCGGGTCGGTACGGCCCACCACTGTCCTAGCGGCTACCTGGCTCTCAGCGAACCCTACTTGGTACGGTTGGCTTCCTGAGGCTCTCCAGAGATCTCGAAATCTATTCACGCTCTAGACTGACTACCGGCTGAAGACACTCTAGCTGGCTAATAT	*	tp:A:P	cm:i:108	s1:i:685	s2:i:0	zd:i:1	NM:i:1551	ms:i:1050	AS:i:915	nn:i:0	SA:Z:utg000001l,24335,-,7073S1572M60I2310S,27,566;
+46	2064	utg000001l	24335	27	7073H15M1I8M2I10M1D10M2I2M1I7M10I11M1D2M2I24M1I1M1I9M1D3M2I30M2I33M1I10M1D10M1D19M2D17M5D36M7I3M1I12M3D9M6I6M4I1M1I16M2D4M1D9M2I4M1D5M2I16M1I9M1I15M4D3M1I3M1D4M2D3M1D5M2D2M3D6M2D4M3I2M1D10M1I5M2D4M3D10M3D5M1D17M1D16M1I11M3I4M2I9M2I23M2D3M3D4M1D8M1I11M1D4M1I4M1I8M1I4M2I21M2I10M1D42M1D8M1D15M1D4M1I6M1I7M2D5M1I10M1I11M2D1M1D5M4I3M1I7M1D9M2I1M1I4M3I2M2D5M1D12M1D12M5D14M1D6M5I4M1I4M1I2M1I2M1D10M3I1M1I3M1I12M1D13M1D1M2I9M1I3M1I1M1I4M3D10M2I4M2D15M2D12M5D3M1I4M1I4M2I3M2I2M1I4M2D3M2I5M3I3M2D2M1I3M1I10M1I5M2I24M1I5M1D1M1D3M1D8M1I5M1D1M2I11M2D7M1D5M1I13M1I3M3I3M5I13M1I1M1I1M1I3M2I2M1D9M3D5M5I4M1I15M2D3M1D25M2D5M1I3M2I23M2D4M2D4M6D1M2D3M1I4M1I7M1I1M8I4M1I1M2I5M6I2M2D6M2I3M1I9M1I13M1D4M1D2M3I9M1I3M2D5M1D2M5I4M3I2M3I1M1D6M5D3M2D4M2I1M1D4M1D5M1I5M1D7M1D4M5D5M2D6M1I12M1D8M1D4M2D5M2I5M1I1M3I6M1D6M1I3M5I8M2I16M3D1M2D8M1D8M7I9M1I27M2310H	*	0	0	CAAATGAAAGCTGTTAAACATTGGTATAAAAATCGTAGACTTGCACAAAGAAATTACCTTCGGTTATTAACTGAATCATTAGCTTATTAAATGAGAAAGACGATGGGATCCGCTAATACCTAATAAAAGATTACGAATTATTACATGCCTTAGCTATAATCTATGGCAGAATGTATAACTGCTGTAACTGCTCGAAATACAAAATAAACTCAAGTGCGACGATGTGATTTCAACATCATTCGACTCTTGGTGAAGCCAGGAGAAGATAATTAAAATTAAAGATAATTACTCACTAAGCAAATTGTTGCTTTAGCGGTTTGATGATACAATATGACAATAAAATAATTCGAAGTATTAAAGAGGGTCTAAACTCGGTAGATAAGCCTAAAATATACTCGGACAGAAGAGTAGTGACTATACGAGACCTAAGAACGATTGCGGAATAACGAGTAATGCAAACATCTGATTGGCTAATTCATCAATTGATTAAGGATAAGATTTGAAGATTAAGATAAATATATTTTGGCGTTGCTCGCATGACACCAGCCAAATAACAAATGCCTATGGCTTCATTTGATAGAGTGGCTCAGAAAAGGACTCATTACTCCAATAAACCAATACATACAATGCCAATTATAGATGAAAGACGACTTCAGGTAATCGACCTGATTCAAATAATAATCAAATGTATTTCATGGAACAACGTAGAGAACGAAGAAAATGACCTAGAAATATACTCAACAGGACTCAAAACATGACGAAAAACCATATTTCGTTCGGCTAGTCTCAAAGCAATCGCGGTGATGTAAACACTATGAACATTGAGTCATAGAACTTCCATTATTCCCTGAAGATAATCGCCAACAGACATAATACCAGCTGACCAGCTTTACACATACTATAACACTAACCGCAGAACGTTATTTCAACCCAACGTTTCTTACAGAGCATACAAACGATAGCCGCCAACAGGGACAGCAGGCTCGATTACTTACAGCTTGAGAGTATCAACTAAGCTTCAAACATAGCGATACTTCTTCCAGCGCTTCCAGCACGCGAGGATTTCTTCCTTCGTTGCAATTCCCATCTGCACTCCGAAGGGCGCAAATAGCCCTCACTGGCTATGCATCAGCTTTGTTTCTTCGCCTCCTAGACCCCTACATCCAAAGAGCTTTTCTGCTGCTTCGGCTTCATCCTCGTCCCAGGCTGTCGCGTTCCACTTCTACTCCCCCGGCGCGGTGACCAGGCACGCTTTCGGCGACGTAAATGGTTCAGAAAATAAATAACGCGTCGGACCACAGTTATAGACCGCGATGTGCCCCTTACTGTTGCAAACGAGCCCCTAATCACGATGCGCCGTCAGTACTGAGTGAAATATCTACAACGTATTTGCCGGAAGAGTCTGGCGCACAATATCGTACCCTGTTTCACGTAAATGAGCCCTGACCTCGTTTGATAATTCCATCGGTGCCATAAGATTATAAATTTATTGGTTGTTCACTCATTCTGAATGCCATTATGCACAGCCTCACAATAGTTAAATGCATGCAATGGCTTTGACCGGGCTTCTGTCCGCACCGTAACGGTGATGTGGTGTGTCCCTGTTGAACCAATACTGAAAGAATGGGCATG	*	tp:A:P	cm:i:9	s1:i:57	s2:i:0	zd:i:2	NM:i:566	ms:i:368	AS:i:156	nn:i:0	SA:Z:utg000001l,17739,-,604S4519M121D5892S,60,1551;
+47	16	utg000001l	25544	60	96S4M1I12M1D5M1D15M1I16M1I10M1D14M1I9M1I7M1I1M1I2M1I10M1I9M3D17M1D7M6I2M2I21M1I3M2D4M1I2M2I6M1D8M1I3M4I4M1I13M2I6M1I5M1I4M2I7M2I7M1I2M3D3M3D4M2I5M2I1M2I2M1I10M1D2M2I5M1D7M2I11M1D5M1D5M1I10M6I26M2I1M1I17M3D10M4I3M1I11M4I10M1I2M2D12M2D1M2D11M1D3M6D5M2I1M2I6M1D10M1I12M2I6M1D3M1D10M1D5M2I16M1I6M1D17M1I36M2I7M2D3M1D11M1I1M1I19M1D10M1D5M2D4M2D12M2I23M1D6M2I12M2D15M1I2M1I3M1I6M1D6M1D4M1I13M1I11M3I14M2D5M3I4M2I26M2I4M3I4M3I6M3I3M2I11M1I7M4I8M1D1M1D13M3I3M1I5M3D16M3D6M4I1M1D20M3D9M3I17M5I18M1I2M2D2M6I2M1I4M1I14M1D8M1I3M1D5M1I18M2I7M1I2M1I12M1D5M3D15M1I14M2D11M3D6M1D3M2D5M2D5M3I8M4I1M1D3M2I15M5I6M2I17M2I2M1I2M2I16M5I5M1I13M1I4M2I22M1I3M4I1M1D7M2I1M5I4M1D2M2I8M3I2M1I7M1D16M1D12M3I1M1D4M1I32M1I13M1D10M1I12M1I11M3D6M6I3M2I9M3D6M3I2M1I3M2I12M1D9M2I5M1I1M1I7M1I9M1D18M1I8M2D5M1D12M1D3M1D15M2D4M1D4M6D19M2I14M9I2M1D10M1I9M2I7M2I1M1I2M1D3M1D3M2D13M1D7M4I3M1D6M1D6M2I11M1D4M2I35M2I21M2I12M1I6M4I5M1D12M1D5M2D3M1D5M2I2M2I13M2D4M1D6M1D6M3D11M4I22M1D8M1I5M2I5M1I9M1I1M2I6M4I18M1D10M2I10M1D5M1I2M1I11M3I5M2I8M3D7M1D18M4D5M8I6M1I23M3I9M1I7M2I17M2D13M1D57M1I7M2D1M1I11M3D12M1D13M2D3M2D2M1I25M3I9M3D6M3D22M3I12M3D42M1D17M2I7M4D11M2I37M1I5M1D3M2I19M1I8M1D3M1D10M1I5M1I5M2D18M1I8M2D1M1D9M1I9M1D5M1I12M3I4M1I2M2D35M1D28M3D60M3I2M1D35M1D4M2I3M2D29M1I5M1D15M1D9M1D7M2D43M2D9M2I2M3I6M3I1M1I5M1D4M1I8M1D8M1D16M1D18M1I5M1I6M2I5M1I21M2D15M2D7M2I17M2D28M3D3M1I11M1I14M3D4M1I10M2D2M1D4M4I3M1D36M1D7M1I16M4I13M2I16M1I17M1D4M2I5M2I3M1I3M1I6M1I5M2D2M1D4M1I5M1I8M1D8M3I13M2I5M1D8M2D3M3I15M2I7M2D5M2D3M2I4M1I16M4D10M1I1M1I31M1I1M1I4M6I34M2I22M1D3M1D17M2D7M1I10M2D4M1I15M2I7M1I6M1I21M1I6M2I14M1I2M1I16M1I7M1I26M1D18M4I10M1I3M1I4M1D3M4D25M3I3M2D16M2D5M1D14M2I5M1I2M2I7M2D2M1I13M3D3M1D3M1D6M2D15M2I6M2I7M3D11M2D4M1I9M1I10M2I2M1I10M1D11M4D11M2I3M2D3M3I2M2I12M1D9M3D3M2D1M1D3M1D5M1I1M1I18M3D2M2I3M1I1M1I7M1D5M1I13M1I13M2D4M3I1M1I15M1I4M3D5M1I29M1D21M1D12M2I11M1I28M3I6M1I4M1D8M1I7M2D6M1I7M1I13M1I10M1I9M3I3M1D3M3I7M2I7M4I3M1I12M1D6M2I1M1I15M3I17M3I14M1D13M3D19M2D5M3I21M2D3M1D2M1I4M1I5M9I11M1I7M2I11M1D12M1I13M1I13M1D4M1I1M2I8M1D13M1D8M5D4M2I6M2D6M2I42M3I4M2D13M1I5M1D3M1I3M1D1M1D5M4I4M1I6M2I1M1I9M2I20M1D10M1D4M1I20M1D14M4I1M1I4M1D3M1D2M1D13M4I4M2D9M1D17M2I9M2I6M1D25M2D42M1I9M1I2M1I29M2D7M3I1M1D7M6I12M2I3M2I3M4I6M1D2M1D8M1I5M2D7M4I4M5I14M2I20M2I6M1I15M1D5M1I27M1I4M1D3M1D7M2D10M1I5M3I5M1I6M2I8M1I5M2D5M2I22M4I7M4I18M1I5M3D9M1D7M1D6M2D1M1D13M3D12M7I8M1I9M1D13M3I1M2I8M1I9M1I4M2D10M3D7M1I5M1I30M1I19M1I23M8D3M1D2M4I2M1I24M2D3M1D6M1I8M1I14M3D17M2D5M5D3M3D1M1D18M1I26M1I2M2D1M1D22M1D4M1I1M4I19M2D6M1I3M1I6M1I8M1I3M2I10M2I8M1I33M3I1M2D9M2D3M1D8M4I1M1I5M1D22M1I19M1I6M1I15M1I3M1D11M2D10M2I9M1D3M2I1M1D2M1I2M4I8M1I30M1I6M1I7M1I6M6I11M2D3M1D5M3D8M1I11M2D13M1D26M3D5M1I12M1D6M2D1M1I9M2I12M2I8M1I14M1I12M1D4M2D22M2I3M1I41M1D7M3D5M1D4M8I8M1I7M1I24M3D1M1D5M2D2M1I3M1D7M2D2M1D9M1D2M1D6M2D25M1D7M1D18M2I5M1I3M1I4M1I9M2I7M1D5M1I14M1I4M2D1M1I8M1I30M2I10M1D4M1D31M1I5M2I4M2D30M4D6M1D1M3I6M3I8M1I5M1D1M1D5M2D9M2D1M1D11M2I5M1I6M1I4M1I1M1I1M1I14M1D6M1D9M1I9M1D15M1D8M2D8M1I6M3D5M2I2M3I40M3I4M1D6M1I5M2I2M1I8M1I4M1I21M1I12M1I44M2D3M2I11M2I8M4I16M1D27M2I17M1I1M1I3M1D10M2D10M3I4M1I10M1D11M2I10M2D17M1I3M1D5M2I10M1D4M2I6M2D30M5D6M9I10M1I13M1I3M2D12M1I19M1D11M1D8M1D13M1D2M1D17M2D5M2I4M1I6M1D9M1I1M2I9M3D6M1D13M1I4M6I1M1I19M1I5M2I12M2D7M2I16M2D19M1I36M4D14M1I3M1I3M2I3M2I6M1I2M1I4M1I12M2I11M2I1M1D8M3D10M4I5M1I6M1I7M1I2M3I3M1D6M3I6M4I2M2D9M5I15M1I3M1I10M1I3M1I9M2I1M4I22M1D8M1I13M5I4M3D16M1D10M1D15M4I24M2D10M1D7M1D14M2I23M3I13M3D6M2I4M1D10M2I3M1D15M2I15M2D2M1I8M1I2M1D1M1D13M23S	*	0	0	GAATATTACATACTTCTGTTTCCGTATCCTTCACCCAGGCTGTGCCGTTCCACTTCTCTCATATTCCCTCCATGCACGCTGACCAGGTAAAAGCTTTTCCGGTAACGACCGAGTTCAGAAATAAATAACGCGTCGCTCAAAGCCACGTCATAGACGGTTTTACCCGATGGTCTTCAACGAGATGCTTAAGATGACGCTCCATCACTGTTGAAAACAGCCAAAGCCAGCCGGAATATGGCGGTGCAATATCGGTACTGTTTGCAGGGCAGACCGGTATGAGGCGGAATATATGCTTCACCTTCCACAGAATAAATTCATGCACGGTCCGGCCAGCAGATTATAAATTTATGGTCGTGGTTATTCACCTTCCAAATGCCATTACTGCAAGCCCTCCAATAGTTAGAATGCATGTTTTTGACGGTGTTTTCCGTTACCGCACGCGTTAACGGAGGTGATGGTGTCCGTGATAACCAATACTGAAGGACGAATGGGCATGAGCAGGACGAGCTGAGCTGATGCATGGTGCACGCCGCCTGATACCAACTGTATGCGCATGTGCACCGGCATCCACGGCTGTACCGACAATGAGTGACTGTGGCTGCCCTGACTGTCCGTTTTCGATAAATAAGCAATACCTGTGCCTGGTTCCTTTAACTGTGGATAAACTTCCTGTAATGGTTGCTTGTTCCATACTGACTCCAGCCAGAACTGTTCATCCTGCTTAACCATGTGGCATGAGCACGCAGAGGGGCCCTGTTGAACCGCTCAGACTGTGAGCATGAGCCCGTGTTATTCGTGTCGATTTGGTGCCGTAATCGAAACTGCCTGTGTTGTTTTCGTCCGTAATCAAACGACGATGTGGTTTTCGTCCCAAATCCGTACCGGAATGCACTGAAGATCACTGTGGGGTGCGACTTAATTCCATCCTGATGTTCCTGAGACAATACAGCACGACCGCTGGCGGGTTTCCCCTTGATTATTGTCCATTAGCTCGCATATCAGGAAGCACACTACGCAGATGGAAGCGACAGCAAGTTTTGGTAGGCTGATTTGTTAGACGCCTGCCCCTGCATCAGGACGTAGCCAGACGGAACGATACCTGATGGCCACGGGATCGGCGCACCTGCCGGAAGAAAGGCCGAATTCTCTACCGGCCCCACAGCTTCAAGAACATCTGCAACGAATTTTTGCAGAATATCCCCTGCCAACCTGAGTCAGCGTGGCGTCCACGGCTGGCGGCATCATTTAGGCAAATACGGTAATTTATTTTCGCCGTGGAAAGCCTGCCAGCGTCAGTGTCGCAATTCTGTCGGTTGTTACCCGCAAGCGGCGCGTTAGTCATGGTGGTAGCAAATCTGGATCATTCCCGAGCGCTGCGTAGGGTTCATTCAGCGTATTCAATCCAGTGCCGTTAGGTGACGCGGTCGATAACATCTGCAATCGCGGCCAGTACAAAACCGGTGTTCGTAACCCGGGTATTGTTTGTTCCCCTGAGCATTTGGTTGTGCTTTGTTGGCGTTCCGGGTCAGTGCCGGACTGTCCAGTGGGCTTTTCTGTTCGTTTCATCCATTACACCTTAACCGGTCTCCGTTGCAGCAAGCGTTTCAGACGGTGCTGTTGGTTGCACTGCTGAGCTGCACTATCCCCTTCGTTGTGTCCGCATCCTCAAGCGCGACACTATGAAGCTATATCTGTCCTGCACGTTTTGCCGAATCCGCACGTATTGCCGCCGGATTCTGCCGCACTTTGCTCTGCGATGCTGATACCGCACTTCCCGGACCGCCTGTCGCCTTCGTGGATGCCGCGTTGACGCACTCCCCGCCGCCGCTGTTTTCCGTGATGCCGCGGCAGAGGCGCTGACGCGTCGGGCTTTCAGATGACCTGCATTCGCTATTCTTGGACGTTTTGCCGCCCTGGCAGAATTCTGCGCCGCCGTTGCCGAGGAATCCTGCACGACCGGCACTGTGATGATGCGTTCGTTTCTCATCCTGATTTTGCTGCCTCTTTTGTAGAGCACCCGCATCTCGTGCATGGAATGGCGGCCTGGTAACGGGCTTCGTACCCGCGGTGGAGGCAGTGGCGGCTGATAATTGTTGTGACGCTGCAAGCATTCGTTTCTGACCGTTTCGCCGCACCGGGCACTGTAGGCCGCCGCGTTTTGGGACTCTGCGGCTGCGCAATTTTTCTGGTTTCAGTGGCTTTGCCTGATGCCGCTTCTGCGCCGCGACGCTTCCTGAGCTGACGATGCAGCCTGTCCGGCGGACGTGCTCTGAAGCTGGCGGGGGCGTGCTGAGTCAGTTGCATCACCAGTCACAAGGGGCCGCGAGACCTGAGCAGCTGATGCGACTGGCATCGCCGGCTGATTTCTTCGCGTCTGCCGTACTCTGTGCCACCACGGACGCGTTACGCGCCACCCTCTTCACCATCAGTTCAAGACGCAGCACCTCATCCGGGCATCATCCTCTAGTCATGGCACAGAGAAAATCATTCATATAGCGTCCCCGTGAATCTTCATACACGGTGATGGTCCCGGCGTGCGATGGTGGAAAACCGTCAACCTGCAGGATGACACTGTACTGACCGTACTCACATCCATGCTGTAACGTGCCCGGCTTCATCCGGATTCTCTGAGCCACCGTGTTCACCACCACCGTGTAGCTGTTAACGTCAACAAATTCAGCTGAATGGTGCAGTTCTGTGTACGGTTTTCCTGTGCCGTCTGTTACAATTCCTGAAATCTTTACTGCCATATTCACCCACAACGACGGACGGTTCAGGCGGGCTGTCATAACACTGTGTCTATGGCTAATCAGAATTTATAACCGACCCCAACGATGAATCCGTTGGTACGCCAGTCGCCACTGCCGGAGCCTTCATAAGCAATATCAACAACGACGGACGCTGCCGGATTAATCTGTACCTGCATTGCTCCACGCCACTGAGGTATGCTGCATTGCACTTTCGTGCTGGCAGTGGTCGTCCCTTCATATACGGGAGTGATTTCCGTCTTACGGTAATCCATTGACTGCCGGACACCGACTGTGAGCCATCGGCCATGGCATCCGCACTGACCTGCTTACTGATCCTAAACCGGGTCGGTTACAGCGCTCACGCTAACGTTACACGCAGCTCTCATGAACGTATCCTCCCAGGTCATCACTGTGCTGCTCTTTTTCTAACGCGGCGCAAACCCCAGCGGAGCCATGATAGCCACTGTCCGTCAGCTCAACGGTATCTTCACGTTAATCCCTTCATGACTCACACCGGTATCCCCGCAGCACGACGGCAATGTACCCGGTTTCACTTGAACACCCACCGTAAACGTAATTTAGTACCTTCCGCACGGGCCGGAGTGACTGTCACCGCAAGTGCGGCACGACAGCAACGGCAATACACATTACGGACGCATCGTTCACCTCTCACTGTTTATAATAGAACGCCCGTTCCCGGACGAACCTCTGTAACACTCAGACCCAAAGAATGATGCCCAGCGCCTGTTTCTTAATACCATAACCTGCTGCACATCGCTGGCAAACGGTACGGCGGAATATTATCTGCCGAATGCCGTGTGGACGTAAGCGTGAACGTCAGGATCACGTTTCCCCGACCCGCTGGCATGTCAACATACGGGAGAACACCTGTACCGCCTCGACGTTCTCTCGAGCGGCCATCATAAATCACCGCACCGTTCATCAGTAGACCTTCAGATAACATCTAAACGTGTCTGCCGCTGACAGTACGCTTACTTCCGCGAAACGTCAGCGGAAGCACCACTATCTGAGGCGATCAAAAGCAGTGGTCATCGGTCACGGTGACAGGTACGGGTAATACCTGACGGCCAGTCACACTGCCTTCACGCTGTGCGGCGCGGAAAGCCGCGCTCGCCGCCTTTACATGTCCCGACGATTTTCTGCCCTCACTAGATCGTTTATCGTACAGTTTTCAGCTATCGTCACATTACTGAGCGTAGGGGAGTTCGCATTCAACTGCCACTTGATATCCGCATTTTTAGCGGTCAGCTTTCGTCCGGTGTCAGGAAAAGCCGGAGGATTGCCGCCGCTGGTAATGGTGGGGCTAGTCAGGCGCTTCAGGAATCACGTTCGTTCATGAATATCTGGTTGCTCGCCCTGCGCCAAACATCGGCGTTTCATTCCCGTTGCCGGGTCGCTAAGATAAATGCGGGAGATTGGCTGCAACCAGAACTGAGCAGTTTTGCCTTCCTCGGTGTCCTCCATGCTGAGGCCAATACCCGCGACATAATGATTTGCCGTCTTTGCTTGGTCCGTCAATTTGACAGCCAGCATGGCATTCCACTTATCACTGGCATCCTTCCACTCTTTCGAAAACTCCTCCAGTCTGCTGGCGTTATCCTCCGTTCAGCTCGACTTTTTCCAGCAGCTCCTGCTTAGATGGGATTCTTCGGTCTATCTGCCTTTGAAAAATCCAGGTAACCTTCCACGATGATCGCCTGCCAGGAAGGACGGCCTCCACGAAATCATGCCGATTTGCCAACGGGGTGTTCGTCTACACTGCGGATATAAATAATAAGCTGCTAGGCCCGGTTTGATATTATTGATACTGGCGGCTATCCAGTACAGCGCCGTATCAAGATAACGCGTGCTGGTTTCAACCTGTCTGATATCCGCAATCTGCTTTTCCAAAAGAAACCAGAACTGTAACACCGCTGTACCGTCGGGTCATAAACGGCAAGAGATGCGGCGTGGCGGTTATCTGAAAATAGCCCGGCGTTCAGCTCAATCCTGACGCGCCTGCTTAAGGATGCGGCAATCCGGAACGATGGAAACGCCGGATCGCCCTGCTGCCCCACGCATTTACGCCCGGACTGTCAGCCTGTAATTCCCCAAGCGCCAGTTGCGTGAAGCGGCGGGTGACTTGGTTTCCGCCGTCAGTCCGGCCGCCGTGCTGACCTCAGCCGCTCACTGCCGTAGTCGCTGTACAGGTCAGGACGGAGCAGGAAACTCACGCCTTCACCACCTTCCTTTGATTGTGCCTCCGTAAGCACCTGAACTGTTGCCTGTCTGCATGACTTCTGCGGTCGGGCCTGCTGCACCATGAGGGCGCGCGTGACACCATTCACCGTGCCACTGTTCGCCGTACACGTCTAGCCCCGTTATCACGATGGCCTCTTTTCCCTGCGACGATGCTGCACGGCGGTGATGGCATACGTGCCGTCGTTGGACCACGTACTGAACGCAGCGGAAAGGAGGCGTGCCTCCGCTGGGCGCAGCGTCGGCAGGGTGCCAGCTCCGTATAATACTTGTCGTCGTATTCAGCAACACCGTCAGGAACACGGCTCAGCTTTACCGGTCGATCCGTCGGTAACGGACTGAACCTCCACGCTGACCGGATTGCCACCTTCCGTAACCAGGGAGTAGCGCGCGTACCGGAGGATGAGCACGTGCGATTTCACGGTCCAGTCAGTTCATCGGGTCCTGGTGGCTGTTCACCACCGCCAGCACACGACTACCGCTGCTGATACCGGCATAGTGATCATCGCAGATTCAATAACATCGCCCGGTACATGGCGAAAGCCCTTCTGTGCTCACGCCCGACGCTGAAATCCACGGTCTTGCGTCCGTTTCCATGCAGTTCTGTTTTAATCAGCCACACGGCACGCTGTGTCGCCTGCCCCGGCTGGTACAGCCAAAGGCATCCATCTTCGTAACATTACGACCGTAACGGGCAATGGCCTGCGTATCTTCAACAGCTGTCGCCGTCTCCCATACGTTATTCAGTCAATCCAGTTCACCTCCAACGGCATTATGGCGGTCCTTCAGGCGCTGAATGTAGCAGAACGGCGAGATGGACATGGCGGCATCACCACATTACTGCGGTTATTATCACGTCTTATCCGACGGTCGGTCTGCGACGCCCGAACGTCAGCGTCTGCCCGTTCCATACCGCTGCATACAGCATCGCCGAGCAGAAATCGCTGAGAGCACATCCCACGCCTTACGCTGTGGTCAGGTACGCATTACCCTATGATGCGCGGCTCCGTGCCGCCAAAGCCGTCGTCGAACATGGACTGGTCGCAGTTACTGGCCGATGACATACAGCGCCCATTTTATCACAATGGCCGCACCAAGACGGTTTCCATGCCGTAGCGCGGATGGGTCAGCATATCCACAGCCAAGACACCCAGGCCATGTTGTTGCTGTATGCCGGTTTAAACGTTCCGTCCCAGATACCGCCGGGTCTGTATGCCGCCGTATGCGTATAGTTTCGACGGCACCTGCAGAATACGCCCGGCAGATGATAATTACGGCTCACCTGCTGGCTGCCGAACTGCTCCAGTCACCTGCACGCCGACCAGTGCCGTGTTCGGGTAGCACTGTTTCACATCGATGATTTCAGTGGCTGACGACCAGAGCGTTTTGTTCTGCAGCTGGTCTGTGGTGCTTTCCGGCGTCGTGATTCCTGCGCATCCGGATATTAAACGGGGCGGCGCATGAGGAGTAGTACCCATCACTACGAGGCGCAGATACTGCGAGGTGGTTTTGCCTTAATGGTGTTTCTTTTTCCGTACCAGGATAGGGTTACGTTGTATCTGAACCAGCAGGCGGACTTCCGACGGATTCCTATTTAACGGATTTGTAGGCTAGTATTCCTACAGTATGCCTGTACGCGAAGGGTAAAGGCACGAGCCGGCTTTGCAGACTGATTCAATGGTGGCGGTAGATCGGCGTGTCATATTTCACTTCGTACCAGCACCGTCTCGAACGAGGGGATTCAAATCCCCTCTAGGCGGGTCTGCTCCTGCTTACCAGCCCGGAACACCGTGACACCGGATATGGCTTTGGTATTCCCCTCAGTGTCAGCACCGGCGTACTGTTCAGCAGCACGCGTTTAAGCCATGCTCACGGACTTTCAATCGGCCTTCGCTGATGGCATTAGATCACAGCCAGCAACTCCGTGGACTTCAGTGTCCTTCGCTTCGCGCGGGGCTCTTAGCCTTACTGCTTCCTTTACCCATTCCTCACGCTCCATAAAACCTAACAAACCGCCCGCAAGGCGGTTTCACATAAAACATTTGCATCAGCGACCAATCACCACAACCTGACCACCGTCCCCTTCGTCTGCCGTGCTGATCTCCTGAGAAACCACGCGTGACCCCACGCGCATTTCCCCGTACAGAAGGAACAGGCAGAACATTGCCCTGGGCAACCATGTTATCCAGTGAGGGAGAAATAGGTGTTCTCTGCTTACCGTTATCCGGTCTTACCCCAATGGGGAGTTCTGGCTTTCGGTGCCAGCATATCTGCGCCACACCGAGCACCATACTGATCACGAGAAGGAAACAGGATGCCGCTTCATACCGGCCCCAATGGCTGCCGGGGTCGCTGCAACCGGCGGCATTAGAACGGTAACGAAGCGATCCGGAAGCGTTCACGGAGGACAATCTGGAATACGCCCACCTGACTTGGAGCGGCGACTCCGGGAACATATGAATTACGCTCATCAGGCAGAGTCTCATGTATGACTGCCCCGTTAACCCGGACGTGCTGACGGACGTCTCAGGGCAATCGTATATCGATAGCGTCGCTCAGTTTCTGACGAAACGCCGGGAGCTGTGTGGCCAGTGCCCGGATGGCTGCTTCAGCCCCGTTTTCACGAAGGTCGATGCGGCGACCAAATCGTTGTAAATCCCCGTAAAGGCAGATGCGATGCCCGGTGACGCGAGGAGAGCTTGTCAGCGCGTCGCTGCCATTTGTCGGTGTACCTCTCTCGTTTGCCGTTGTTGTTCGAATATGGTGGTCACAGCAGCTCGCCGGTCGCCGCAGTTAAATTGCGGCGTGATTCTGGGGACACGGGTCATGAACCAAACAGCACAGCAGCAGCATCGCCCGGCTGTGGCCGCTGACAACGGCACCTGTGATACAGCCCCGTCGCCTCCAGATTATCCAGATAGAGATTCTGGCCGTTACGCCACCAGTCATCCTCACGATGAAGGTCGGCATCTCAATCCCCGCGCCAGATGATAAGCATCCCGGAACAGTGTAACAGTCGTCACACGTGCTCAAAGCGCCGCCCGCGGTGAGATGCGGCACACAGCGGAACTTATGAATCGTCCCCAGCGGCGACCGACGACTACACGCAAATCACTCTGCACCTGCAGCCGCCGGTCGCTCCACTCAGCGCGCAGACCACCGGGGCCTGTGGACCAGCGCCAAGGGTCG	*	tp:A:P	cm:i:102	s1:i:1059	s2:i:0	NM:i:2073	ms:i:4506	AS:i:4506	nn:i:0
+48	0	utg000001l	22017	60	15S13M4I10M5D3M1D2M1I24M1I5M1I17M2I13M3D25M1I8M1I18M2D6M1D4M4D14M2D6M1D5M4I8M1I9M1I17M1D26M1D20M1D13M1D1M1D3M1D17M2D11M3D6M1D31M1D3M2D3M1I17M2D11M2D11M26D8M1D9M1D21M1I10M1I2M2I6M2I8M5I2M2I2M1D1M1D10M5I1M1I5M1D6M5I6M1I7M2D19M3D32M1D3M6I22M3I5M1D6M1I27M2D7M2D3M2I3M3I8M1I31M1I22M2D7M1I7M1D9M4I2M1D19M1D2M1I10M1I16M1D13M1I30M1D10M8I2M3I2M1I4M4I3M1I11M4I2M2I8M3I1M1D7M1I9M1I7M1I7M1D4M3I6M2I2M1D5M1I7M1I3M1I2M2I8M1I10M3I6M1I4M3I4M1I2M4I7M2I34M1D17M1I3M3I5M1I10M1I5M1I13M1D5M6I1M1I3M2I8M5I6M1I8M3I26M7I15M2I4M7I21M1D12M1D4M2I10M2I19M1I12M3D3M1I8M1D3M1D10M2I2M1I12M1I2M3I16M2I4M1I3M1D4M2I3M1I7M2I1M1D5M4D2M1I4M2D2M3D3M2I1M1D3M1D13M3D19M2D32M3I13M7I2M2I5M3D6M1D8M2I5M2I3M1I7M1I11M2I3M4I2M3I3M1I5M3I8M1D5M1I3M2I11M1I6M1I3M1D14M1I9M1I4M2I7M3D2M1I8M1I12M3D9M3I2M2D12M2I1M1I8M1I3M5D4M3D7M3I2M1D7M1I3M1D7M1D7M1I1M1I2M1I5M1D4M1I11M3I9M3I2M2I4M4D7M1I14M1I1M1I6M5I16M1I1M1I4M3I4M4D10M1I3M1I9M9I4M1I11M2I5M2I10M1D13M1I23M2I11M1I3M1I5M1D40M4I8M1D3M1D8M1I1M2I10M3I2M2I9M1I8M1D3M4I4M1I14M1I9M4I3M1I13M2I14M1D10M1D14M1I4M2I12M1D13M1I25M1I17M1I13M1D14M1I17M1I22M1I21M5D2M3I10M5I4M1I8M1I34M1I5M1I6M1I13M1I16M2I2M1I6M5I1M3I14M1I8M1I3M1D2M4I1M2I1M1I3M1D5M2D3M1I2M3D26M1D6M2I4M1I1M2D24M2I14M1I6M2D6M1I6M1I19M1I4M3I6M1I17M2I10M1I14M5I4M2I14M4D10M4I1M1I21M3D8M1I4M1I17M3I5M1I4M2I1M1D4M3I2M2D3M2I1M1D3M1D8M4D16M2I7M1D7M3D16M1I8M1I7M1I3M1I3M2I9M1D3M1D11M2I2M5I4M1D11M2I8M2I3M1I2M1I5M3I9M3I17M1D15M2I2M1I2M1D19M1I4M1I8M1I4M2I9M2D10M1D61M1I8M2I15M1D27M5I9M1I8M1I6M1I17M1I5M2I3M3I1M2I19M1I15M4D36M1D8M1I2M1D10M1D24M2D10M1D4M1I8M2I6M1D10M1I11M1D4M1D1M1D11M2I4M2I8M2D5M3I3M2D2M1I38M2I4M1I4M3I13M1I33M1D6M2I4M1I6M1I3M1I21M1D1M1D4M5I5M1I9M2I7M3D1M1D13M4D6M4D4M5I4M1I5M1I7M1D21M1I12M1I3M2D23M2I30M1I11M1D19M1I7M7I1M1I9M1D11M1I4M1D4M1I14M1D11M2I8M6I3M2I6M1I2M5I3M1I3M1I1M1I6M1I1M2I18M2D7M1I1M2I10M1I25M3D7M1I1M1I13M1D3M7I9M1D9M1I3M1D21M1D34M1I7M1I10M1D1M2D1M1I6M3D1M1D3M1I8M1I10M1D8M1I2M1I6M1D11M1D3M1D17M2I1M2I20M2D61M1I3M1D10M1I7M1D13M1D10M1D5M2D12M1I17M1D11M1D4M1D30M1I5M6I14M3I3M2I17M5D7M1D9M1D10M2I21M1I5M3I1M1I3M2I9M4I2M2D12M2I2M3D25M3I3M1I16M5D12M4I1M1D20M3D2M2D5M3I2M1D7M1D6M2I13M2I7M2D2M4I2M3I26M1I4M1D76M1D5M1D6M1I6M3D7M1I3M2I5M3D6M2I11M3I8M1D8M5I1M1I5M2I12M1I1M4I13M1I5M1I28M2I19M1D2M2I1M1I4M1D6M1I1M2D9M6I16M1D4M1D4M4I6M2D12M1I4M1I3M1D3M1D18M5I7M2I7M1I2M1I6M1D6M1I9M1I14M3D4M5I2M3I6M4I3M1D11M3I2M1I3M2I16M2D4M2I13M1I16M1I23M2I3M1D13M1D3M1D13M9D24M1I17M5I4M2D4M2D12M1I7M1I5M1I19M2D12M1D5M1D6M2I11M1I9M2I3M4D7M1D15M2I4M2I11M1D10M1D7M1I3M1I6M2I2M2D5M1D11M2I6M1I1M1I4M1D8M3I4M1I12M2I1M1D14M1I5M1I25M1D15M2I2M4I6M5I5M1D7M8I3M2I7M1D14M1D15M6I3M1D6M1I4M1I14M3D15M1D7M2D13M1D11M1I1M1I20M1I10M3I1M1D15M3D11M1D41M1I14M7I8M2D2M3I18M1D7M1I9M2I3M1D5M3D14M1D18M1I7M2I5M3D21M2I13M1I11M4I3M1I5M1D4M2D14M1I3M3I23M1I4M4D11M2I6M1I9M2I27M1D22M3I2M2D19M1I9M3I21M1I8M2D3M1I3M1D10M1I5M1D8M1I7M1D42M1D29M5D7M2I8M5D27M1I30M2I23M1D1M1D2M1D12M4I16M1I3M1D15M2D9M1I9M3D11M1I9M1D1M1D30M1I6M2I5M1I9M1D11M1I3M1I18M1D9M1D38M1I7M2D14M1D9M1I14M1I15M1D12M1D10M1I11M1I6M1I15M1I12M1D3M1I2M1I3M2D22M1D6M6I2M1I13M1I10M3I3M1D36M2I9M3I6M3I3M1D6M1I5M1D8M2D2M1D4M1I5M1I8M1I4M1D16M1I15M2D15M2I6M1I3M2I8M2D3M2I4M1I29M2D2M1I29M1D3M2I13M1I4M2I14M2I2M1D12M2I9M1I4M2I7M2I13M1D11M6I7M1I5M1D22M1I29M1I4M1D4M2I11M1I16M3D11M2D21M3I3M1I3M1D6M10D5M2D13M1I1M1I3M5I22M1I20M1I1M3D2M1D12M1I5M1I2M2I7M1D12M3I4M5D15M1I3M2D4M4I14M1I4M3D10M3D13M1I12M1D4M1I16M5D16M1I6M4I5M2I13M6D1M2D4M2I7M2D4M2I15M28S	*	0	0	TCATCGTCTCTCACTTTCAGCATTTGATGGTCGTTGTATGAGATAGATAGAAAAGACAACTCTGGCTTGAAGCCTATCAAAAACTAAGTAGTGATGAAAACTTTCCAAATATGAACTCATCAGCCTCATTTCCAAATATGAAGAGTTAAGACGTAATGAACCACAGATTCAAGTGACGATGATAAATTCTAAATTGTTTGGTGGACAATATCCAGAAATATCTGCTTCGAATGAGCTCTGGACATGCAATTGTTTTATTTACTATCAAGATTAGTAGATGTCGTTGTGAAAGTCATTAGTTTTATTCGATGAACCAGAGATTCATCTGCATCCACCTTGCTCTCTGCTTTTACGAACATTAAGCGACTTACTCGATGCACGCAATGGTGTAGCATAATTGCAACTCATTCCCCAGTACTGCAGAGGTTCCAAATCCTGCATGTGGAAAGTCTCTACGTCAAGAAGCAATAAACTATTATCCGTCCGGATATTGAGACATTCGGTACAACTTGTAGGTTTTATATGACTCGTGGGTGTTTTACTGAAGTGACAAATTCTGGATACCACCACTTATTATCGCAGTCCGTTGATTCAGCATAACATTTCTTATGAAACCATTCTAAAGGCTATTAATGGTCAGATAGGATGCGAAGGTCGAACCGTTTTAAGGGCGGTATGATACCGGCGAACAGTAGAGATGAAAGTAAAGTACAATGAAAAACTACCTCTTCCAGAAGGGCGAGTAGCGAAATGCTTAATAAATGCTCGGAAAGCTGATATGATGCAGATAAATGTTAGAAAATAATTTCGCTTACTCACTTCCCCATTTTGCCCGGAAAGAACAACAATATAGAATATTAAGCTCGACAGGTCAGTTATTTACCTACGACAGGACACCGCCCCTCTTGAGCCTACAACCTTAGTAGTTGGTAAGTGGACAAAGGTTAAATTAGAAAGCTTTATGAAAATAATCTCCAGATAAAACAAACCGCTAGAACATATATCCGATGACATGCTTGTTTCATCAGGTGAAAAATGTCCATTTTGTGGTGATGGACAGACAAAATATAGATCATTTTCTTCCTATTGCACATTATCCTGAATTTTCGGTGATGCCTATTAATTAGATTCCATCGTGCCGCGACTGCAATATGGGAGAAAAGTCAAGTTTTCGCAGTAGATGAGGTACACCAAGCGATTCATCCATATCGACAAGGACATTTTTCGTGAGCAATGGGTATATGCAAATTTCGTTTCCGGAACTCCGGGTGCTATCAGTTTTATGTTGAATGCCGGCGACTCGAGCAGGAAGACAAACACAGAGCTCTTCATCATTTCAAGCCTATTAAATATTTAACAGGTATCGTTGGAGGCAGGGAAGACGCACTTGAGTGAAGTGATTATCAAAGAAACTCTTTCGTAAAGTTATAAGGAGAATATAGTTCAACCGCAACGTTTCAGCAGCTACAGTCAGAATTTATTGAAACCAAATCTGAAACCTATTACATTTGAATGACTTCCCCAATTATTGGAAAGAGTTATGTATCAGTGCCCAGCAAACTGCCGAATTTTTCAGGGATGTAGAATATGACCGATGAAAGATAGAGAAAAGTACGACGCCTTATCGGAAGTGAACGATGAATATTTTATGAGGGAGCGGCTGTTTTACAAAATCCGGTATACTTGCTAACCAATTCCTAGGCAGGTCACCTTGGCAACAGTGGCAGCAGGCGAAGGACGTTGTGCTGTTCGGGCACAGCAGTCCCTAGGACAGTGGCGTACAGAGTCGATGGTCCTTGGAGGTGGTCACAAATTCTCATGCAAATATGTAAAATCGGTAGGCACTGGAAATGAGCCTTCAACACCCGCATTACAGGAAGTTCACCAGCCAGCCGCAGCACGTTCCTGCATACGACGTGTCTGCGGCTCTACCATATCTCCTATGAGCAACGTCTGCAGAGCCAAGCCACAACTCTAATTTTAATACATAATATGAATGATAATAATAATATTAAATTTCCTGTGTAACCAATTTATATGGTTCTGACATAAGAATCATGTGCAAGATCAAACAACTTGTATTACATTGACAGTTAAGCAGTTAATTTATCACCCTCTAAAATATATCAGCATCTAGCATGCAGTAAGGGTCAAAATGGAGAGTTTATGACTAAAACCATGGAAAGAAGACTTAAAGATTTATCGCACTTGCTGATAAATGCTGCATTGATACATATTTGACCTGAATTATTTCATTGAATTTGAATCGATTCCTCCAAACCGCAAGACAGTAACATTTACTTATTCAAAACAAAACCAGATTATAGGATATGACATTTGGTATAACAATAATGTTATTGAAATGGAAAATGAATCCATTAATGGCTTGGCTAAAATTCTCGCAATACGATAGAAAAACAAGGCAGATTTTAGAAGGTATATAGAGGCAAGGCGGAGCTCTTATTCATCTTACATTGAAGAAAATGACATTGAGTTTATTACGATGAAAGTATGTTAAACATTGGTAAAAGTTAGTCAGACTTGCACAAAGAAATTACTTCATCTTTAACTGAATCATCTACTTATTAAATTCAAATTGTATTGTATGTGGGTCTACATCTAAAAAGATTACGAATTATTACATGCTTAGCTATAATGCTGGCAGAAATTATAACTGCTGTAACTCTCTTGGCATACAATAAACAATCCAATGGGTGACGGATGTGATTCGCCAACATCGATTCGATGATCGTCTTATTTGATGAAGCCAGGAGAATAACTTACTTTAAATTAAAGATTACTCCATAGCAGCAAATTGTCATTTAGCATGATACAATATGACAATAAAGCGATTCCTGAAAGTACCCATGTTTAAAAACTGTAGATAATCCCAAAAACAGGTTCGACAGAAGAGTTAGTTGACTATACTGCCAAGCTTGCAGAAACGACTTTTTAAAGGACGGTTGACATTCAAACATTAATTTTATGATAAACAATTCCATCCAATTGATTTAATCAATACAACATTTGAAGATCAGCCAAGCAGATAAATATATTTTTGGCGTTATGCATAGTGACGAGCAGCCAAAATAACAAATGCCTATGGCTTCATTTGGATATCAGAGCTATGAGCCAGAAAGCAAGCATCTACTCCAATAAACCAATACATACAATGCCAATTAGATGAAAGACTTCAGGTAATTGGAATTGATTCAAATAATAATCAAATGTATTTCCAGGCAAATAGTTAGAGAAAACGAAGAAAAAGCGACTTTAGAAATATCAACAGCAGACTCAAACATGACGGAGCAAAAACCATATTTCATGCGTTTCAGTCTTAAAGCAATTGGCGGTGATGTATGTAGACACTATGAACAATTGAGTCATATAGAACTTCCATTATTCTCCTGAAGATAATAATCTAAATAAACCAATACTCAGCTTACAATACTAACTAACCGCAGAACGTTATTTCATACAACGTTTCCGGCATACCAAAACGATTACTCCATATAACAGGACAGCAGGCCACTCAATATCAGGTGCAGTTGATGTATCAACACGGTTCAGCAACCGATACTTCTTCCAGGCTTCCAGCAACGAGTTTCTTCCTTCGTTGCGATTCCCAGATCTGCATAAGCATCCTGAAGCGGCGCAATATGCTCACTGGCTACCTGCATCAGGCTTTTGTTCTTCCGCCTCCCGGATCTCGAACACGTTTTCTGCTTCCGTATCCTTCACCAGGCTGTGCCGTTCCACTTCCATATTCCCTCCCGAGATAACCAGGGACATTTTCCGGTAACGGACCGAGTTCAGAAAATAAATAACGCGTCGCCGGAAGCCACGGTCGACGGTTTTACCCCGATGGTCTTTGAATGAGATGCCACGATGCCTCATCATTGTTGAAAACAGCCACAAAGCCAGCCGGAATATCTGGCGGTGCAATATCGGTACTGTTTGCAGGCAGACCGGTATGGAGGCAGAATATGCAGTCGTCTCAGAAGAGCAAATGCCAAGTGGGGTTCCGGCCAGCAGATTTCCGTTTCAATGTATGGTCCGTGGTTGTTCACTCATTCGAATGCCATTATGCAAGCCTCAATATAGTTAAATGCAATGTTTTGACGGGTCGCGGGAGCTCCGCAGCGTTAACATGAATCTATGTGTCCGTGCAACCAATACCTGAAGAATGGGCATGAGCAGCATACATACAATGTATCGGTGCGCACCAATACCAACTGTATGCGCAGCATGTGCAGCACCTCAAGGGCTGTACCGGGTAACAATGAGTGACTGTGGCATGCCCTGACGTGCTTTCCATAAAGCAGCAATACCCTGTGTGCTCGTTTCCTTTAACTGTGATAAATTCCTGTAATGGTTGCTGTTCCATACTGACTCCAGCCAGAACTGTTCATCCTTAAACCACTGTGTGGCATGAGCACCCGCGGCCCCTGTTGAACCGCTCAGACTGTGAGCATGAGCCCCCGTGTTTATTCGTCGATTTGATCCGTAATCGAAACTGCTGTTGTTTTCCTTTCCGTAATCAAACGACGAATGGTCTGCTTTTCGTCCCCAAATCCGTACCGGATGCACTGGCACTGTGGGTGTGCACTTAATTCACATCCTGTTCCTGAGACAATACAGCAAGAACCGCTGGCGGGACTTTCCCTTGATTGTGTCCCTCGCATATCAGGAAGGCCCCGATGGATACGCGACAGCAAGTTTTGGTAGGCCGATAAGTTGTCAACGCCTGCCCTGCATCAGGACGTAGCCATACGGAACGATATGATGGCCACGGGATCGGCACCTGCCGGAAAGGCCGAAGCTTCTCACCGGCCCCAAGGCTTCAGAACATCTGCAACGGAATTTTGCCAGAATATCCCTGCCAACCTGAGTCAGTTCAGTCAGGCTGGCGGCATCCATTTCCGAACAAAATACGGTAATTATTTTCACGTGTGCATCGACTGCCAGCGCCGTCGTCAGTGTCGCATTCTTCGGTTGTTTACCCGCAAGCGCGTAGTCATGGTGGTAGCAAAATCTGGATCATTCCCGAGCGCTGCGGCCAGTTCACTTCAGCCGTATTCAGTGCGTCAGGTGACGCGTCGATAACATCTGCAATCGCGGCCGTTACAAAGCGGTTCGCAATCTGGGTTTGTTTGTTTCCCTGAGCGCGGTCTGTTTGGCAGTCGTTCCGGTCAGTGCCGACTGTCGAGTGGCTTTCTGTTCGTTTCATCCCATTAATTACCACCTTAACCGCCTGTTGGCGTGCAGCAAGCGTTTCACGACGTGCTGTTGGTTGCAACCTGCTGAGCTGCAACTGCTCCCTTTCTCGTTGTGTCCGCATCCTCAAGCGCGACAGCTGAAGCTATATCTTCTGCACGTTTTGCCGAATTTTGCACCGTATTGCCTCAGCTTCTGCAGCCAGCATTTTGCTCTGCGATGCTGATACCGCACTTCCGCAGCCTCCTGTCTCCTTCGTGTCATGCCGTTGACGCACTCCCGCCCCTGTTTGCGTGCCGCGGCAAGGAGGTGCGGTTCCCCTGCTGTTTCAGATGACGGCATTCGTCTCGGACGTTTTGCCGCCCTGGCAGAATTTTCTGCCGTCCCGCTAGGAAGCTGCACGACCGGCACTCTGATGTGATGCGTTCGTTCTGATTGATTTGCTGCCTCTTTTGAGGCCACCGCACGCATCTCGTGCTCTGAAGATCTGCGGCCTCTGACGCTTTCGGTGGCCGCGGTGCTGGAGAGGCAGACGTGTGGAGCATACTGTTGTGACGACTGCAGCATTCGTTTCTGACGTTGCAAGGCCCCTACGAGCGGGATAGTGAGCGCGTTGCACAGGGGAGTAACTCTGCGATGAGGCACTTTTCGGTTCAGTGGCCTTTAGTGATGCCGGCCGTGTCCGGAGGACGCTTCCTGAGCTGAACGATGCAGCTGTTAGATGGGGACGTGCTGAGGCGCGTCCGTACAGTCAGTTGCATCAGTCACAAAGGGCCGCGGGTACTGAGCAGCTGATGCACTGGCATCGCCGGCTGATTTCAGCGCGTCTGCCGTACTCTGTGCCACCACGTAACGCGTTACGCGCGAGAGGGCGCCTCTTTACACCATGAGTTCAAGACGACGACTAAGTGCCGGCAGGGGTAATAGCTCAGCGTCATGGCACAAGAAAGTGGATTCAGCGTCCCCAGTTGAGTGAATCTTCATACACGGTGATGAGCGGCCGTGCGGTGGTGTGATGGAAATAGCATTTAGTAAGTGAGGAACACTGTACTGACCTATAGATCTCCACATCCATGCTGTAACGCCGCGGCTTCATCCGGATTCTCTGAGCCCGCCGTGTTCTCATCACCACCGTGGTGCTGTTACGTCGGCTTTCAGCTGAATGGTGCAGTTTTCTGTACCAGTTTTTCCTGTGCCGTCTTTTCTTGAGGACTCCTGAAATCTTTACTGCCATATTCACCACCAAAAGCCCACCGGTTCCGGCGTCAGTTCAACACTGTTACCTGGCTAATCAGAATTTATAACCGACCCCAACGATGAATCCGTCAGTACTCCAGTCGCCACTGCCAGCCTTCAGATAAGCAAACAACGACGGACGGTGCCGGATTAATCGTATACCTGCACTCCACCGCCACTGAGGTATCCGCCGCATTGCACTTTCGTCCCTGGCAGTGGTCCTTTCAGCGCTACCCGGGAGTGATTTCCGTTGTACGGTAATCCATTACTGCCGGAACAAGCGACGTGAGCCATCGAGCCATGGCGATCACCAACCTGCTTACTGATTTGGTAAACCGGTCCGGCCATCACGGCCCAACGTCACGCAGGCTCGACAGTGAAACGTATCCTCCCCGGTCATCACTTGCTGCTCTTTTCGACGCGGCGACTCCCAGGAAGCCATGTACCCCCACTGTCCGTCATATAGACCGGTACTTCACGTTAATCCCTTTCAGATGACTCACACGGTATCCCCGCCGACAACGACGGCAATGTACCCGGTTTCATATTGAAAATAGCCCACCGTAAACGTACCCGTCCACCGTCGCACGGGCCGGAGTGACTGTCACGCAACATACCGTGGCGGCAAAGACAGCAACGGCAATAAGGCGCGTACGCATCGTTCCTCTCACTGTTTATATAAAACACCACCGTTCCCGGCTGACGTAGTGACCGCCACTCAGACCACGCTGATGCCCAGCGCCTGTTTCTTAATACACCAGACCTGCACATCGCTGGCAACGTATACGGCGGAATATCTGCCGAATGCGCCGTGTAACGTGCCTAAGCGTGAACGTCAGGATCACGTTTCCCGCGACCGCTGGCAGGTCAACAATACGGGAGAACACCTGTACCGCCTCGTTCGCGCCGCCAGCACATAAGTACACCGCACCGTTCATGCCATCCTTTCAGATAACACATCGAATACGATAGGTCCTGCCACGCTGACAGTACGCTTTACTTCAACGGCGCGAAACGTCAGCCGGAAGCAGCACTATCTGGCGATCAAAAGGATGGTCATCGGTCACGGTGACAGTCACGGGTATGAATGACGGCCGTCACACTGCTTTCACGCTGGCGCTAAAGCCGCTCGCCGCCTTTACAATGTCCCCGACTACATTTTCCCTCAGCGTACCGTTTATCGTGAGTTCAACTATCGTCACATTACTGAGCGTCCCGGAGTTCGCATTCACCTCATTAGTGATATCCGCATTTTAGCGGTCAGCTTTCCGTCCGTGTCCATAGGAAAGGCCGGAGGATTGCGCCGGGCTGGTAATGGGTGGGGCCGTCAAGGCGCTTCAGGAACACGTCGTTCATGAATATCTGGTTGCCCTGCCGCCAAAACATCGGCGTTCATTCCCGTTTGCCGGGTCAACCGCTAGGTTGGCGATACGATTGGCGGCAACCAGAAACGCGGCCGTTGCCTTCCTCCGTGTCCTCCATGCTGCTGACGTTCTGGTTC	*	tp:A:P	cm:i:96	s1:i:939	s2:i:0	NM:i:2099	ms:i:4104	AS:i:4100	nn:i:0
+49	16	utg000001l	46993	60	1182S18M2I2M1I21M5I3M1I23M2I26M2I17M2I7M1I3M1I2M2I3M3I1M1D23M1D6M2D6M1D12M1D5M3D18M1I20M1I14M1I5M2I13M1D4M2I28M1I5M1I8M1D6M1I4M1I14M1I15M1I2M2I3M1D10M1I17M1D10M1D18M1I11M1I6M1I36M1D14M1I9M3I1M1D8M1D4M1D1M1D18M3D18M1I15M2I14M32S	*	0	0	GGATGACGAAAATAGAATGCCAGGACTGTCAGTACATCCCGTATCTGCATACGAACTGGTAAGAGTGACCCAAATAGATTACTCCTCGGCTCCGAGATAGTAAATCGTCCCTAATATTAGCGGTGCTGGATACGTTAACCAAAACACGGTGCGTCGTAGAGCATTAGTCCATTTAGCAAACGCTGGGGCTTTGTAAATCTACAGATCACGTACCGCCTTCCCCGGGAGCAATTCTATACATGTCAAAATACGAACGCATTAAACCCTTCTAGGTCCGTCATTCGAATAACCCCTGTTTGGTCTGACCCGAGCCCAATCCGACAGCTGGGTGCATGCGGGGGTGAGATCCACTGACATCCGGGGAAAAGCTATGTTGCAAGCTCAGAGCAAACGATGGAGGCGCTCCTCTTAGTCCAAACCAGTATTTGTTCAAAAATGGCAGCTGGATCTCAGAGATCCGGATGAGACTGAAGCCTGCAATCTAGGAGAGGATGGTGCTAGACCCTCGCCCGACTCATGCAGATTACACGTTAAATGGTCAAGAGCCCATCTATGAAAGCCGCCCGGAGGGTATTGCCTTAGCGTGCCACGGGGCCATGCATGACTCGTGACGCAACAGCATCAATATGGAGGGCTGAATCCCGCAGCCACCTCCAGGACAATACCCGTGTAATAATTACAGTTTATCTTAACCATAAGCCTCTTGCAGCTGGAGGTGCCTCAGCAATGAGGCATAACAGAGGAGCTGCAGGATTTTATCTGAATAACCGACGACACGGTCTAAACCACTTCCACCACTGGAGCTGTAAAACGGTACGCGCTCTGCTGCCATTGCATCCCAAGCATCCGGATTTATGAAAGGCAGGTCCGAGCGGTCATCTTCCATGGGCTCCGCGAATGATCCCGGGTATTAATGTGCAGCCCTGTTACCGAACGACCTGGTCGCGTGTGAATGCCGCGGACAGGCTTATGACGCGACTACCGGCGTGGGACAAATTTCAGCCCGTAGCCAATACGTGCAACCGGGATTGGGTCGTCATATCCGTCCATCGAGCAAGCCGTGATGACGCCGGCTGGCCTGGGTGGGCATCGCTCGAGGGGAAGGAGCCCCGTTAGTTTCAGGAATCCAACAGGCGCTGGATGGAAAGAGTTGCCTAGAACTGCTTGCTGCACGTGACAGGGGAGCCGTCGAGAATACTGGCAATTTCAGCTGCGATCCGCGACAGCTTAACCACCGAAAGTACGAATGCGGTTTCCACTCCACTTCAGGGGTCTCTGGCATTCTTCCCACCGTCCTGTTAGTTGATAAATGGCAACGCCGTAAGTCGATGATGGCGTTCGTACTCAATAGTTCCTGGCTGGAGATCTTCATCGCTGGCCTGGTCGCAGTTCTTCAACCTCCCCGGCGCAGCTTTTCGTTCTCAATTTCAGCATCCTGTTCGGCATACCATTTTGGTAAGCAGGGCAGAGTCATAAAGCACCTCATTACCCTTGCCACCCGCCTCGATAAACGGGCATTCCGTGTTCCTGCCGCAGTTCTGAGTGACGTGTGGTACGGATACTCACGACGCAAAATGTCCAGCCGAGCTGCTTTTGTTGACTTCCATTGTTCGGTTCCACGGACAAAACAGAGAAAGGAACGACAGAGGCCAAAAGCTCGCTTTCAGCACCCTGTCGTTTCCTTTCTGTGCGTCCAGGGTATTTTAAATAAAACATTAAGTTATGACGAAGAACGGAAACGCCTTAAACCGGAAAATTTTCATAAATAGCGAAAACCTGTAGTCGCCCCCAGGTCTATGAGAGCATAAG	*	tp:A:P	cm:i:13	s1:i:125	s2:i:0	NM:i:118	ms:i:474	AS:i:474	nn:i:0
+50	4	*	0	0	*	*	0	0	ACTATTTAAGCACTGGCATTAAAGCAGCAGGATGCTACTCGATCGGGCGGCCGGGACGCTCGGTGTACGTCGATATAAGAAAGTCAGATCGAGCACTCGGCGCTAGCGTAACCTCGTATATATGTCATAAGCATTCGTACACAGTCGGCGGCCGTTAATAGTAGAAGGAAGGAGAAGACGGCCGGTTAAATCGTCGGGTACTCGCATCATAAAGGCTAGTTTCTAGCGGCGCAGGACCCACTCACGTTGAGCCCTTTCAGCAGGGAGCAACGTGAACGGGACCGTCAACGTGCCCATTATTGCCCGGATACATGAGCCATAAACAGTACGACAGTTCACTACATGGAAGTTGTAGACAGTTCTAATAAGGTGCCTTAACGCTTATTCTGTTTATGAGTCGCCTTTGGTCGGGTGAGCATCTGTGGATTTGTGCGGATGGTTATGCTAGAGGTGACAGCGCCAGGCATCGAGGCTTCCGTATGGGTGGGGTCAAGGGTACGCTCTTCGATTTACTTCTCCGAAAGTTAACGGAACCGAAGTCCGTAGGAAGGCCGTAGTGCCTGCGGCTCTCCGCCCGTTGAAGGAAATCGAAGTCAACAAAAGGAGCCCCGTTAACTTTCGCTGGCGTTACGGTTCAGAAGCCCTGAAACTAAATCCATCATGGCTGAGGACGGTACGCTTAGCTGATTCTGCATCGCCGATACAAACAGCGGTCTCAGATCAAACGGAGTTTGAAATTGAAATGAAAGCTCGCGTTCTACTAAAAATGCGCATCTGGTCATGGCTCCCATAAACCGTTGTACGAACGCCAGCAGGACGCTCTTTAACGGTCGACGGCTCTAACAGAACTAACCGAGTAGAGATTGTTGAATAGCGTGAAACTTGGATCGGTTTCTAGCGCGGATTGGACCGAGGAATCGCCAGTGGGATTCGAAGGGGCTCCTTTGATCCGTCCTGCGTGACGTCGGACGGACCTACTTCCGACGATTGGTACGTAAATGTTTAACACGGTGCGCTGGTTAACGGGTTCTATTCGCTAGGTCCTCGACTTATCGCGGACCTTAGTCTGGCGCTGAATAGCCGCGGGATCAGGGCTCGTCCCGTTCGGAGCATTCTACTCACCCAGGCCGCTGATAACCTCAGGTCCTTAACCCCCGACGCCACCTATTAGTCGCCTTAACCGGGCATCACTAAGCGTTGGGAACACTGGTGGCCCGGCGAGTTTAAGGGCAATTCGCGGTCCGTCAATGGATTATGCATCTAGGCGAAGGGGCACGATGCCCGTATCCTCACAAAGCCGCTTCAGCTCGTCCTACCGTAAGCATTTAACATTATTCTCTTTGCCGAACGCATGGATTGGGTAAAAGCGTCTGAAATGAGTTGACGAGTGTAGACTAATCGGCCGCCTTGCTCGCTGCCCCTTATCGACGACGCACTCTTTAAGACTGTTTACCACGGCGATGCCCGATTTGGTGGGGCCTCGTCTGGCCCTTTCTATAGGTAACGGCAAAAACATTACGTGGACGACCCGCGGAGCCCTAGAGTAGGTTTACGACATGCTGCCTATGAGTGATGAACAGGTAACCTGCCTGACGATCGGGAGACAAGCCAGGAAGGCCGCATTGTAAAGCTCAGGCGTGGCTAGAACTCAAAATGATCTAAGCAGACGAGCGCAGGAGGTGTCAATCCCTTAATAGCTCGGCTGCCATGATCCCCGGTTCGACTTCTATATCACAGTTTGACCTGTCATAAGGCGGTGATTCCCTTCGACGCGACGCTCCGCATAATCCAGGTCGCCGGGGATGCCTGGGTACTGAGCACCTATACTGAGCAAGGCGACTAGACCTTCACCGGTCTTGTGTCCGCGTGAAATGGGTCACGATCCATCCGCATCCTCACTGCTAAGCCCCGTCACGTATATGTTCATCATTTATTGACAGGTGATTGACTAGCGGAATTTGATTAGTCCAGCCAGATAGCCTACACCCAAAGACTTTCAGGACGAAAGCGTGATTCAGAAACGAGAAGCGCGGATATGTTTCTTAGTACTAGTCGTCAACGCTAAACAGCGATCGACAGGTTTTCACGATGAAAATATCACGTACTGGCTTGTTTTCGAAGCGCTTGAAGCCCCATTGACTCCATAGAACCGGAATTTTCGTGCTCCGTACGGGTAGAGCACGGGGAGTGAAAAGCTGTTACCCCTAAGCACGTGCTACAGCTGTTCTAAAGGATGAACGGTGCCCCTTTACGCTAGATGGATAAGACAGCTCGAGCGAATTGTCTACGAACCTACTCTGCTCTCTCTTTCGCCCACGTAAGCAAAGTCAGCCCGAACTTTAACTTTAGTTCTGTATCTCGGTTTAAATTTTGACCGTTGATTTCAAAGCCTGACCTACTTTCATTTGGGATTACGAAAGAAACCGCGGTTTGTTGGACATGAAACTCGTGACTACAGGTGGTGAAATATCAGCATAATGAGGCAACCGCTTCACATGACGCTTGCACGGCTAATGAATGCTCCCCGGAGCGATTCGAGCCACATTTCGATTGATTGAATGAATGAAAGCTGAGATTTCAAGCTCAAGCCTTAACAGATAGTTTTTAAACCGCCTACGGACTAAAACACGGTTCTTTAAAGCAAAAGCAATGGACCCGTCTACGCGAGGCATGCCGCCCGTTGCGGCCGCGCTCCTGTCTACCTCGCGGATCACTACGGGTCGGGCACCTGACCCCATTACCCCCGGCTGTTTTATCGCAGTGACAGTTACGCGAGAAGCAACGAAGAAACACGGTCGCGCAATAAGCCCGCGCTGGACTGAATGGAGACAGGTCGACCCGCCCTTCATCGGCGCTCGGACTGGACTGATTTTACGACAGTAAACGGGGCACTCAAGAATGACGGACGAAGTGAGCTCACCATCAGATTAGTATCTCGTGACGTTCGAAAAGTACCCGCAGTCTGACGTTCATCTAAAGTGGCAGTGAAGACCCAACCGTACCGTAGACCTAAGGCAGCGCTCCGTTGAAATCCCATTCTATCGCGACGCTAAACTGTCACCTTTCAATCGCTCGCGGCACGGAGTACGCGCGTTCTAAGCGGCAGCGGCTAAGAGCTGCGCCAAGGGTTCTAATGGATACGCATGGAGCTCGGAAGGGGCTATGCAATGCCCGTGCAACAGCCACGGACGTGGCTTTCACGGACGGGTCTCGAGTCTCTAAGTACGTAAGGTCACGGCTTTCATGTCCTGTCATAGAGCTTTCACTCCAAGCTGGCGCTTTAGCATCGGGGAGGAAGCCCGTGCTTTTCCTTGAGGTTGACTCAATGAAATATTTCGAGTAACTGCCTAGGCTTCTTTCACGTCCGACCGTTGAGCTCCAAACGGACCCATTTCCATTGATTTCGGAGCGATAGAGACCCGGTTTCTGGATTTCGACTCTTTCATTTACCTGGATACTGGCTCGCGCCGGAGACAATACGCGGGTAATCCATTTACGGACGCATCAGGCAACGAAGAAGAAGGCACGCGAAACTCTACTGGCTTAAGGATATCAATGACCGTAGGGGCCGGGTTAACTACATGCGTGACGCGGTTTTCAGGTATGGATGGCAGAACCCGACGCCACCCGTCTATTGGATCCGGGGCCTTGCTTCCGCGATCGATGCAACGAGCTGACAACCCGAGGAACCGTTAACCTGTTCCAAATCGTGTTGAGCAGGAGGTTTGGTTTTACAGTTCGATCTCTTCCGCATGACGCCTCGCGACGAAATCCAAGCCGCATCAGTGGGATCGACATTTAGGATGTATGTTCACAGTCCCAGCTCGAATGCAGATAGCGCAGAGTACTTATAACGCTTTACATAGGATCCTCGGCGCGGCTAAACAGTTCAGGTTACAATAGGGCGTAAACTGTTGACACATGGCGTTCGACCCTGCTAGCTGAACAAACTCGTCATTCCTTAGCCGTTGGACTCATTCACCTTGCTCACCGGCTCGCGTTATCGACAAAGTATTAAGTCTGATCGTCTGTCACTGCAAGCCGACCTCACAACCGTACGAGACGATCGATTAACTGTATGTCTGCTGTAGAGCATCACGCTGCGAGTAGTTTCTTCCTCCTGAGCATCTCCCTGAACTACTGTCACGGAGGTCCTGAAGGGCAGACGGGCACCCGGGCTGACGGTTGGCCCCGGTGGTTTATGCGGTGTGCTGACGCGTCGCAGGCGGGGCACCGTATTATCCTTGGCGCTCTATCGTGAAGGTCGTCATCGTTTAGATGCTTCGGCGTGACTAGTATCCCAAACCGTAATTCAGAGGTCGCCCGTAACGGATGCCGCGGGAACTGGTGACGGGGATAGTTACTGAGAGGACCTTACAGCGCGGTTTAGGCTTTGACGAATTTACCAAAGCGCTATTCTAATTCTTGGAAGGGAGCTCACGAGAAAGAGGCAAACAGCGGTGACGACTGTTACTGAAAGTTGCTCAGCAGTACCCGAACGTTTGGGATTTGCCGGCCCACCGCCGCTTGAATCGCCCGCTCGTAGCCCCACAGGCGAATAGGGCTTCATGACAATGAGACATAGTAAAGTCGACTAATATCGCGATTAATTGCCGTTCGCATATAGAGTTCTCATTTCATTTAATCGTCGCTGGCATAGCCGGCCGGGGCCCCGCAATCGGCTCATGGTTTCCTAGCCTGCCAGCCTTCAAGCGTTACGTGGACGGGACTCTCGTATTCTCTCATTCAGCGAGCGATCGGAGACGGATTGTTGGCTACTGAAGCAAGACCACCGTCACTTACAGTCATAGATGAACGCATCGCGACTTAGCCGCCGGGGTGTCCGACGCTCTCACGGATCGTGGTGGTGCACCCATTTCTAAGAGAATGGAGAGAAAGGCGAATTCATTATGAGGTAGCCAATCATGTTGCCATGCGACTAGGACTCGTAGGAAGCACTTTCTTTGCTCGTCACTCAACTCATGTGGCTAACTGTTCGGCGGATCGTCGACCGGCATCACGATTTCCCGATCCTTCGCAGCCGGACGCTGCCGCCTGCCAACGAAGGGACTGCGATCTACACGTTACAGAGCGCGATCCTGATGCCTCATTCCCCTCTCCTTGATTGCTGCGGCCAAGAGAACGGACTTCACCGAACCGTCCCATTCATGGCCGGCTCACAGGATTTTAGGGCCCGCCGTCCCTTAGAAAAGTTTCGTTGAAATTCACCGTCCTACGTGGACCTACCGGTTAAGGGATCCGCATAATCCTAAGCGTATTTCCGAGATAGAAATGGGAGACTCTGCACGTTCACGGACCTTCCATCCCCCTCTCCCGTTCTGGACGACCGTCGTACTCTGGACGAGCTTCGACTGAGCTTCAC	*
+51	16	utg000001l	10572	60	222S2008M7I11M1I6M1D6M4D11M3D19M1I2M2D2M1D27M1I2M1I13M4D27M6D2M2D13M1I8M1D3M2D1M1D6M4D8M3D13M1I5M2D2M1D4M1I22M4D10M1I12M1D16M2D11M1I19M1D8M1I7M1D12M1I8M2D10M1D19M8D3M5D25M2D2M1I2M1D11M3D11M1D8M2D6M1D21M1D8M3D20M4D5M1I7M1D16M2D8M2D7M1D14M1I14M2I8M1I3M2D33M2D2M1I14M2I1M3D16M2I9M3D17M5D21M1I33M2D6M1D8M1D7M2I3M1I6M2D6M3D37M1D3M2I4M1I5M1I10M1D3M1I3M1D4M4I4M1I5M1D3M1D4M1I10M3I4M2D20M2D7M2I4M1D5M1D6M2D6M4D6M1D1M2I17M1D5M4D5M2I5M3D15M2D1M1D3M1D5M8D3M1I3M1D3M2D6M1D12M1I1M2D2M2D6M3D3M1D12M1D12M1D20M1I12M1D4M1I12M6D10M2D31M4I25M1I8M1D40M1I24M1D52M1D5M2D32M1D35M2D19M1D34M6D3M7D11M1D11M2I5M1D6M1D6M2D6M1I2M1I11M1I15M4D6M1D5M3D10M5I21M2I4M1D4M1I2M3D45M6D45M1D40M6D7M5D20M1I36M6D8M1D2M6D7M3D7M5D1M1D4M1D12M2I1M2I1M1D7M1D1M1D9M1D5M1D8M1I9M1D4M1D11M3D8M1D13M1I6M5I12M1I12M2D38M1I12M3D8M1D10M4D1M1D12M3D23M1D6M3D8M2D10M1D25M1I5M3I9M1D8M1D5M3D1M3D5M2D22M3D6M1I4M1D1M2I15M2D5M1D1M2D21M1D18M3I9M1I4M1D10M5D11M1D6M5D4M1D4M3D2M1D3M1I16M1D6M1I1M1I6M3D5M1D9M2D1M1D3M5I3M1I1M1I8M3I18M2D4M2D5M3D8M1D16M6D8M2I10M7D3M1D3M6D28M3D11M3D16M2D12M1D6M1I1M2D7M2D24M4I16M1D4M2D5M1D10M1I2M3D10M1I17M3I3M1D6M1I40M3I1M1D10M1D3M3D11M3D6M1D9M2D16M2D4M1I5M2I16M1D4M3D2M1D4M3D5M1D6M3D15M1D24M1I6M4D4M2D4M1D11M1D16M1I3M1I2M1I4M1I18M1I9M1D3M3I10M1I7M2D6M1D17M7D19M3D19M2D3M1D1M2D4M1D7M3D5M1I13M3D10M1I11M1I9M1D6M1I2M2D2M4I24M3D29M1D6M1D4M2D19M2I3M3D4M1I12M1D16M2D9M2D2M1I2M1I1M1I3M1I5M1D2M2I6M1D2M1I9M3D4M2D8M2I2M1I24M2D2M1D1M1D21M1I25M1I3M2D22M1D1M2D1M1D15M3D2M1D2M3D22M2D1M1D7M1D29M4D10M3I7M4D3M2D9M2D8M2D6M1D4M1D5M4I2M2D4M1I4M1D14M1D17M1I7M1D4M2D5M1D2M3D22M3D1M1I2M1D13M1D6M1D26M7D3M2D3M1I10M3D1M1D26M3D16M3D1M1D5M1D8M10D15M6D2M3D7M2I13M4D10M1D9M3D2M1D20M3D1M1D3M1D4M1D4M3D1M5D15M6D15M6D6M2D9M1D13M7D24M2I5M2D4M1D1M1D2M1D5M1D5M4D4M2D8M3D3M4I5M3D3M2D3M2I8M5D1M1D3M2D1M1D3M1D1M1D4M2D9M5D3M1D13M3D13M1D9M1D7M1I2M1D4M1D2M1I6M1I7M2D4M2D11M1I4M5I5M6D4M1D8M2D10M1D8M1D3M1D1M1D22M1D13M1D14M1D4M1D5M2D4M6D14M2D28M3D7M1I7M3D20M1D6M2D4M1D7M1D15M4D5M1I8M2I4M1I34M1D13M3D12M1I9M2D16M3D3M2D3M1D7M2D1M1I28M6D18M5I6M1D3M5D9M2D10M1D7M3D2M2D11M3D43M5D9M2I3M1D7M2I18M3D16M1D2M2D43M2D3M1I2M1D7M2D7M11D13M1I9M1D2M2I6M1I4M2I9M1D7M1D3M3D4M6D2M2D2M2D9M3D8M1D3M5D2M1I10M1D5M1I20M1I6M1D5M4I5M1D2M1I8M1D2M1I2M1I3M7D11M1D5M1I4M1D6M2I13M1I5M2I8M2I1M1I8M1I4M3D4M2I1M2I24M1I2M1I7M6D7M1D5M3I18M2I1M1I4M1D2M2D7M4D12M1D5M1D2M2D6M1D12M2I4M1I4M1D5M1D12M3D3M1D5M2D6M5I6M1I6M3D7M3D4M1I7M1D8M1D10M2D4M2I2M1I9M2I2M3D5M2D3M3D7M1D14M5I1M1D6M1I9M1D12M2I6M1D18M2I4M1D2M1D3M1I1M1I11M2D6M9D4M1I10M5D3M1D2M1D3M4I18M3D6M1D2M4D5M5I2M1D4M2I18M2D15M1I8M1D2M2D4M2D21M2I4M1D5M1I3M1I1M2D6M2D2M4D9M1I1M2D8M1I6M1D10M1D31M2I6M1D6M1I4M1I22M1I2M2I8M1I12M1I3M4I9M4I3M1I4M1I2M1I1M1I7M2I15M1D14M1I10M1I2M2I11M1I2M4D3M1D17M1I1M2I6M1I6M1I2M1D1M1D8M5D3M1D3M1I6M1I17M5I10M1I12M1D6M5I9M4I1M1I4M1I1M1I6M1D4M2I13M2I30M1D4M1I2M1I17M1I10M3I4M3D7M1D5M1D10M1D2M1D4M1D9M4I14M3D1M2D3M1D2M2I9M1I5M1D7M1I4M2I18M3I12M2D18M1I11M1I15M9D21M1I9M1I2M1D3M1I4M2D7M2D4M1D7M1D4M1D3M3I9M3D10M2D15M1D4M1I21M1D3M1D8M2D28M1D6M2D6M4D5M3D4M1I4M1I8M1I3M3I2M4I3M5I5M1D4M2D2M1D4M2D7M3D5M4I1M2I6M2D5M1I10M2I4M2D2M1D21M1I9M3I21M3I19M1D3M1I5M1D9M1I11M1D17M1I18M2I8M1I6M2I4M1I23M3I3M3I7M1D10M1I3M2I15M1I4M1I3M1I1M3I7M3D2M2D9M2I2M1D9M1I4M3I2M1I9M1D3M1D9M1D1M3D3M1D3M3I2M1I5M2D2M2I6M1I4M1D5M1I2M1I6M1I1M1I11M1D5M1I17M3D1M1D24M2I1M2I6M2I8M1D9M1D14M1I5M1I2M1I6M5I19M1D7M1I6M1D2M3D5M1I3M1D8M1I15M3I1M1I11M1D3M3I12M1I1M1I4M1D1M7D8M1D13M1I2M9I12M3D1M1D12M1D25M1D8M3D8M1I2M1D2M2I2M2D4M1D3M1D10M2I2M2I5M1I6M2D11M6I20M2D18M1D16M2I3M1I5M1I6M1D6M1I7M4D9M3I14M1D2M1I11M1I4M1D3M2I4M1I5M1I11M2I6M1D22M1I8M1I3M1I8M1D2M2D8M1D12M6I13M1I4M1I10M1I5M1D11M3I1M1I11M1D2M1D56M1I1M1I9M6I2M1D5M5D2M2D17M10I4M1I27M1D2M1D8M3D5M1I4M1I15M5I4M1I2M1D5M1I4M2D11M2I38M1I1M2I14M3D9M1D2M2I4M1I11M4I6M1D16M1I9M1I2M1I4M2I28M3I5M1I7M1D8M2D15M1D4M1I14M2I18M2D11M4D17M1I10M1D3M1D36M2I3M1D16M1I6M3D17M2D3M2D2M1D13M1D5M1D40M3I9M3D6M2D15M4D12M1I11M4D2M1D26M2I10M1I13M1I2M2D5M1D14M1I12M3D3M1D21M1D5M1D9M2D8M2D2M2D11M1I1M1I5M5D10M2D24M1D3M1D22M1D76M2D19M1I1M1I9M2D15M1D10M1D25M2I21M3D6M2D26M1I23M2D9M1D16M1I4M1I18M2D4M3D11M2D10M1D5M1I10M2D1M2D17M2D22M2D11M4D1M1D4M3D2M1D7M1D5M1D5M2D3M1D11M2I1M1D6M1D16M1D3M1D15M1I4M2I3M1I4M4I6M1D3M3D5M1D4M1D16M2D2M1I7M1D8M1I27M2D13M2I13M3D2M1D2M2D2M3D3M3D5M1D13M1I5M1D8M2I3M1D11M2D14M1I8M2I4M1D12M1D10M2D6M1D4M4D32M3I12M1D9M1D3M3D8M1I11M6D15M1D7M1I1M3D6M1D5M1I1M2D8M1D2M2I3M2D4M2D11M4D8M1D5M1I6M1D16M1D5M2D20M1D10M30S	*	0	0	TAAGTAACGAACGACGCATACCCTCGAATCAAGGAGCGTCACCTTAACCCAGGTTGAAAGAAAAACCATATGTACCCTTAACCGGAAATGGTTACCCTCATGGGATTCGCATTCAGGCGTTAATGCTTTATTTACCCTGAAGTAAATGCATCCTTGACTACCCTGAATTGCAATCAAATTCTAATCGTTGCATTTACGCTTCCTTACGAGAATCTAGAGTGAAGCGGTTAGTATGCAGCCGTCACTTAGAAGTGAGGGTAGCGTACCTTTCTACTGTTCAGGCAGGATGTTCATCTAAGCTGTGACTTTACCAAAGGCTTGCGAGAGATGGGTAAGCACACGACCAAAAGGCCGATCGGGTCAATGCTTTCTGGCGAGTTGAAGGATTGCAGGACCGGCCAGTAACAGCTTCAAGCGTACACCCTTTCCTGACGCTAGAATGTAATTCTCGTCACTGAGCAGGGCTGTTGAGCCAGGCTTCGCATAGCCAGACTTGGGGGTGATGGTTTTTACCCAGTCAAGAAACTGATCAGGATAGCGGTCCTGTTTTACAACTAACCTAAACCCACGTACCCAATGATCCATGCAATGAGTGTTCCAGGCGGGAAAGAGGAATGGGAGTGGCCTGAAGAGACGTTTGCTGATCGGACTGTTCTGGTCTGGCGCATAGTTGATAACAATTGAGCACAATTCATCGAATTAGGAATTTTCACTCCTCCGAGAACATAAAGTAAATGGATTGAATTATGAAGAATGGTTTATGCGACTTACGCAGCAAAATAAAGGAAAGATACAGCTGATAAACCTGTCTGTTTTCCTGCATTCTGCTGGCTCATCATCACCTGCGAGTTGGCTGCATTATTGTATATTCATAAAATCGATGGAAAAACTTTTCTCTTTACCAAACAAATAAAGAGTGGTTTAGTATAATTCTAACTATTCAGTTGAAGATAGCAGAACAGCCTCGCATGACGAATCATTGGGATTCCCATCTTTGTTGAAGGGCGACACCATTGGTTTTGCCAGAACTGTTCGGCCGACCATCGATCTGACCATTTAATCGGGAAAGGAAGTGGTTTAAGCAGTGGAGAGCGCGTTCAGATAGCGTCCACTAGATGAGGCGTCAACCGTCCAAAGACGATGTTGGATATGCATTTCATCGGCCGAACAACGGTGAGCGACTAAGCTAGCTTGGTTTGGCGTATATTAAAGGTCTTAGCGTAACAGATATTAAATGAAGGGAGCTTTGACTCATTGGATAGTCATTAAGCCAAAATTTAAAGGGATAAAAGGTTGCCAAGGATATTATTTATACCGTCAGCTCGATCGACATTAGCCTGCGGCAAAGATGAGGCTGGAGTCTTTTAACAGAACAGTCTATCAAAGCTGACCTAAGGGGACCCTTAGCCCATCGCCTAGTGCGAACCATGGGAGCGCTGAAGAGGCGCATCTCATTAGCAAGAATGAAACCAGCTCATACTGGAATGGCTTTAAAGCAGGGCAAAGTAAGGATTAATTATATGGAGTAATTATGCCGCGAGAACGAGAATCATGCGGTGTTTACATAGTAATAATTCCTCATCGTTATCGTAAGCATTCATGGCCTTTCCTCCATTCCTCTGTTTCTTTTCAGGCTAGTCATGGTCTTGGGGCGAGTACTTATCATATGCAGGAATAGATGCAATTCTGATTGCTGCCTTGACGTTTAATGGGAAGCAGAACGCGCGACCAGAATTAGGATATAACCCTGTAGTCTTGTCTATTAATTTGTCAGCTTGGCGCTTCTGCCAATCTTTAGTCTTCAGCTAGCGGGTAGCATGGCTCTAGTCTCGGGCGGCTTGCCTCTTGCTCCTGCGTTCATTCAAGTGCATCGTTGGACCTTTTACGATATCTACGGTACCCTCAAACTGTTGCCGGACCATCGCACCCCAAAACACATAACCAATTGTATTTATTGAAAGTAAATAGATACAACTCACTAAACAGCAATTCAGATCTCTCACCTACCAAACATGCCCCCTTGCAAAATAATTCATAAACATACACAGATAACCATCTTGCGGTACAATTATCTGGCGGTGTTGACATAAATACCGGTGATACTGAGCAAGAGCAGGACGGACTGACTACCATGAAGGTGACGCTCTTAAAATTAAGCCCTGAAGAAGGGCAGCATTCAAAAAGCAGAAGGCGTCCTGTGTGATACGAAACGAAGCATTGGCCGTACCTGCATTCCAATTAGCTGCCACCTTACGGGATTCGGTTTTCAGGGACTACAACTGCCACACACCGACTAGACTGACAGGAGAATCCAGATGGATGCTACGACAAACACGCCTCGAACGTCGCGCAGAGAAACAGGCTCAATGGAAAGCAGCAAATCCCCTGTTGGTTGGTAAGCAACCAGTTGACCGCCTATTCTCCGCTGAATCGCAAACCGAAATCACGGTTAGAAAGCGCACTAAATCCGATGGGACTTAAGTGCTGGCTGAATACCAAACAGATTGAAAGCAACCTGCAACGTATTGAGCGCAAGGAATTAGGCACATGGTACAGGCAAGCCTTGAACGCGGCATAACATGCAGTGGACGCAAATTAAGGGAAAATCGATTCCTCTTATCGTGTATGCCATATTGGTGGCTTTATCTAATATTATGGATCATAGCTGGCAACTAATTCAGGTCAGTAAATCTTAAGTGGGAATAATATGCTTCCATTTCCATCGGAAAAGTTTTGTTCAACACCAAGCTCAATCAACTCAGGATGTATGGGGAATTGTTTGGAGCTACAACCACCATTTCCTGCCTTCATTAAGGGCTGCGCACAAAACCAGCATTGCTCTTCTGTATCATTTGAATTACTGATCGCACATTTATCGTTTTGCATCTTAATGCGTTTCTTAGCTTAAATCCCGGTAATATCTGGCGCTGGCAAGGCCTGATAATCGATGCATTAATGCTCGCGAAATGCAAGAGCAAAGACGAACATGCTACATGAGGAATACCGATTCGTATCTTAACATATTCGGCCTCAGTCTATCTGGGCTTAAAGCAGTCTAACCCACGTCATAACGATCAGTAATGGTTTCTCTCCTGCCCAGGTTCATTACTGAACACTCGTCCGAGAATACCCCGATCGCTCATTTCTACTCAGACTGTGCCCCATTGTAATAGTTTATTGATTCTCGCTGTGTAGAACACGAGAACCATCGTCTGTTAACACTAATTGTTACCGCATGTACTATTTACATGATATGGAAGAAGAATTTGAAGGTTCGAAGAGCAGCGGCCGGATGTGATGGAACAATACTAGAAGTACGGTCATGACTAAGCCTTAAATCAATGGTGGACAATTCAAGCGATGCAATGGATGCAAGCTCGCTGCAATCGGATTGCAGCGTTAAGCCTGAAGAAATGTTTCCTGTAATGGAAGATGGGAAATATGTTGATAAATCTGGCAATACGAACGACGGCAATGATGCCAGAGAACTTGGTAAACAGAACAACAAAGCTGCCTGATAGTGGCCTTTATTTTGGCATAAATAACAGAACAGACACTGCACTGTGTTTCATTCCAACGAGTGAATACACGGAGCAATGTCGCTCGTAACTAAACAGGAGCACTTGTTCTGACTATTGGAAATTGCCTTTAGCCTTGATTTATCTGCGAGATATGAACAGTCATGTCAACATCAAATACCCTTACGGTGATGACTGGAAAGGCATCAATAGAAAGTGAAATCAGCATTAAATGTAAGCCGACAGGAAAAACTTCATACGGTCACGGTAATTCTGTCAGACTCTGAAGCCCGACTCAATAAAAATCTATCTGTATTAAATGCTTAATCTCGCTGGCGCAACATGCTCTGCTTAGCAATTTCAAGCGATTAAATGCATATGGTGTTGTGTGTGAGTTCGACTGGAATGATGGAAATGGTTAGGAAGGATGGCCTCACGATGGCTGTAGCGAAGGAATAAGAATTACCGATGTATCAGGAATATTGATTCATGATATTAAGGCTACATGAGTGCCTGCCGTTTACGCTCCAATAACGCTTCATCGCGTCGTTTTTCGTTAGTATAATAAGGAGCACCATGCGACTGCCATTGCAGGCGTCGCTTCGTGCGTTGCTGGCTGCCCTTCCGGATCTTACTTGAACGAATCACCCGTTAATTACGTGACGGAGGGAAACGCCTTATCGACTACTTAATGTCAGCCATCCAAAGAAGCATTCAAACACTTATGGCCGACTTGATAAATTTATCGGTATTTATTGGCGTGAAAGATGTTTCGTGAAGCCGACGCACGGTCGCTAGTAACGGTATTAATATGAAACTAGATCAGCAAAGCATTCACTAACCCCTCCGGTCTTCCACGATCAGCCCGGCATTTCGGGCACTTTCACAGCTATTTCAGGAGTTCAGCCATGAACGGTCCTTACATTCAGGATTCGTGTGAGGGTTAGGGCGCTACAGAGCAGCTTCACGTGAGGAAGAAAGGCAGAACTGGCAGACGACATGGAAAAGGCCTGCCCAGACTATTTGAGCGCAATCGCCTATGCATGTACGGTCCGGTGCAACGCCACGCCAGCAAATCCATTACCGTGCGTTTGATGACGATGTTGATGGCTTCAGGAGGCAGGCAACATCTTACATGGTTGAAACCATTGCTCACCAGGTTGATATTGATTCAGAGGTAAAACGAATGAGTACTGCACTCGCAACGCTGGCTGGGAAGCTGGCTGAACGTGTCGGCATGGATTCTGTCGACTACAGGAATTATGATCACTCATTCGCCAGACGGCATTTAAAGCTTACACGAACAGGTTGCGTCGGTTCATCCTCGCATTACTGATCGTTGCCAACCAGTACGCTCGCTTAATCCGTAGGACGAAAGAAATTACGCCTTCCTGATAAGCAGAATGGCATCGTCATTGGGCGTCCTGATGACTAGGACGGCTGAGCAGCAAAGCAGTTGATGGCATGGACTTTGAGCAGGACAATGAATGCTGTACATGCCTAGATTTACCGACGAAGTGATCATCCGATCTTCGTTACCGAACCGGTATCGGTACTGAATGCCGCCGCGAACCGGTTTCAAACCCCTAACCCTAAGTAACGACTAGTCGCAGTCATTCGCATCCCAAACGGATGTTACGTCATAAAGCCATTCAGTGTGCCGGTTCGGTTCATGCTTTAGAGCGTCAACCTACGAAGCCGAGCGCATTGTCGAAAAATACTGCAGTACACTGCAGAACGTCCACTCAGGGAACGCGACATCACTCCGGTTAACGATGAAACCATGCAGGAGATTAACACTCTATGATCGCCTGCATAAAACATGGGATGACGTGACTTGCTTGCCGCTCTGTTCCCAGATATTTCGCCGCGACATTCGTGCTGCATCGTCAGAACTGACACAGGCCGAAGCAGTGAATCCTTGGATTCCTATGCGAACAGAAAGCCGCAGAGCAGAAGGGACCGCATGACACCGGACATTATCCCTGCAGCGTACCGGGATCGATGTGCGAGCTGTCGAACAGGGATGATGCGTGCAATTACGGCTCGGGGCTCACCGCTTCAAAGTTCACAACGTGAGCGCAAACACGATCCCGGAAGAAATGGCCTGACATGAACTTTTACCCATTTCTACATGCTTGCTGAGGTTGCACCGGTGGCTGGAATCAACGGAGGCAAGCAAACTGGCCTGGGGAAATATACGAGGAACGACGCCAGAACCCTGTTGAATTCATTGCGTGAATGTTACTGAATCCCCCGATTAGCTTCGCGACGAAAGTATGCGTACCGCCTGCTCTCCCGATGGTTGCGACTGCAACGGCCTTGAACTGAAATGCCCGTTTACCTCCCGGGATTTCATGAAGTTCCGGCTCGTGGTTTCGAGGCTAAATCAGCTTACATGGCCGTCATATGCAGTACAGCATGTGGGTGACGCGAAAATGCCTGGTACTTTGCCAACTATACGGGGTCGAACCGTGAAGGCTTGCACTGTCGTGATTGAGCGGGGATGAAAGTACATGGCGTTTTGACGAGATCGTGCCGGAGTTCATCGAAAATGACGGAGGCTGGCTGAAATGGTTTATTGGGGAGCAATGGCGTACGCATCAACGATAATATCGGGAGGGACTACTTTCGTCTACTCCGTTACAAAGCGTCGCGTATTCCCCGTCCTTCTGTTATCGAAATCACATGAACAGCAAACCGGCTGGCTGAGGAGATAAATAATAAAACGAGGGGCTGTATGCACAAAGCATTCTGTTGAGTAAGAACGCTACTCCAGATGGCACTTTGTCGCTCAATTGGAATCAGGTTGTGCCAAACCAGTAGAAACAGACGAAGAATTTCATACGTTAGCCGCATCCCTTCACAAAAGCTGGAATGATGGTGGCGAAAGGAAGCAGATGAGAAACCAGGTATGACTCTCGAATGCAGTTCTGGCAGCGGGCTATTCATGTGTGCTGGTGTGCCTTGCTAACATGGGACTTGTTCAATGACACCTCAGCAGGAAACGCCTTTCACAGCATTGCCCGTCAGGCATTCTGAAAGTAAAAGGACAGCAGTTTCCATTAAAACGTCGATGACATTTGCCGTAGCGTACTGAAGAATCACCGCGTTACTAAACGGATCGATGGGATTCACATGACTCATTTAAGCTGGCAATCGGCATGTTAAACGGCGTATTTACGAAACGATGAACATGAAAAGCAAACAGGAATCAGGGCTAATTTATCCTGTTCGCATTCACCTCAAGCGTATTAACCAACAGTCGGATTAATGAAAGATGGCAGACATCATTGATTCAGCATCAGAAAGTGACGAATTACAGGCAACACAGCAATAAAATGCCGCCTCCCGTCCCCGGCACTATCTTGGGCCTGATGTTGCTGTGGGCGATCGATAGATGAACGAAGACGCCGATAGTTCAGGGTTGTCGACTTGTGCAAGTGCCAGGAGGATCTGGAACTTATCAGTAAACAGAGATTTCGAAGTGAGCGAAATTAACTCTCAGGCACTGCGTGAAACCGGCAGAGCAGGCAATGCATGACGTTGACTGGGGCATTTTGACGAGACCTTTCCAGCTGAATTGGTAACAGATGCCATGCTGGAACTGCTGGATGAACGGGAAGAAACCACCAGCAATACATCAACGCCGCGAATAGGAACGCTATTGCGGACAGTGGCTCAGAGGAAATTCGTGTTGAGGTCCTTGAAACAGCAAATCAAATCAACGAGCAGATTGAGTATTACGAAGGGCTTATCTCTAGATGGGAGTAAGCGGTTTAGACTGGAAAGCGACGAAGTCGTGAAGACGGGAAACCAGTTTCTTGATTCATCCTGGGAAGACTCCTGTTATCAAGCTTAATCGGACTGGGATGGGAATGTTTCTGCGGCAGTAATCGAACAAGACCCGTCCTGACCTGACATCATTACGCATCGATTACGCGTACGCGGTCACTTCAGGATGCAGGGCTATCTGCATATGATGTCTGACGCTGGCATTCGGCCCAAAAGGAGAGTGAGATCGGTTTGTAAAAGATAACGCTTGTGAAAATGCTGAATTTCGTCGTCTTCACAGGGCTGCCAGAGTATGTAGATGTGCATGATGGTAACATTCCTCAGGCTTATCTTTACTGTTCTTCACATAACATTGCTGATACCGTTTAGCTGAAACGACATCATTGCACCATTATCTACAATGAGTATCAATGAGTTAGAGTGAGCAAAAGATTGGGGCGTTATCAATGTTGTGCAGATCCGCTTGTCTCCATGCAGACATCACGAAGGCTTTATGTAGATGAAGGATAGATAGAGTGGCATACAAATATTCCATGATTAAGTCTATGAAGACAAATCCCCATTCTGCAAGTCGGTGCGAGAAATGATCTACCGTGCAATTATCACGAGTACGGTGGAAACGATACTTGCCCTCTCTCTGTACAACATATAGATGATTAACCCAATATTACATAACAATTCCGCACTCGCGGGGATTTATTTATCTCTGAATCGCTAATCTAGTTTGTTTATGGAGATGATAAATGCATTCCGGTCACAGGAATGGAAGCGAGCCCATTCAACAGAGTTATCGAAGCGAACATCAACGACTGCACATACGGATGATATGGGCGGCGCAGATAGCACCGACTAACCAATATTCGAATTGAAGAACTGAAAGAACACCAAGCCGCCTGATGGCGTTTTTCTTGCGTAATCGGAGACTTGCGATGTACTTGACATTTCAGGAGTGGAACGCACGCCCGACTAAGAAGCCTTGAAACAGTTCGTCGATGCTTCGGGAATGCAGGATATTCCACTCGGTTAAGGAGCATGGAAGAGTATCTGTTCCACGAATCAGCGGTAAAGGAGTGACTTAAATCGACCAGTAACAGGGCCCTTTGACCAGGATCGAAATGGGAAGAAGGCGAATCATGAGCCGGGATTTACCTAGACCTGTTAAGAAACAATGGATAAGTCGTACTGCTACAGGGACCCAAGGACGGGTAAAGGCTTTGGATTAGGCAGAGACATGAGAATCGCAATCACCTGAAGCTACAGGCCAACATTGAGTTATTTCCAGGACACAACACAGCCTCTGACAGCGAGAAATCAACAGTGATAATTCGTTACGTTACATTCATGGCGTCGATCTCTCAGAAAATCCTGGCCAGCAGGAGGAATCAAGCAGAATCAGACACTCATAAATTACATGAGCAAAATTAAAGCAATAAGGAGGGGTGAGTCTGCCTGATGCTCACTGCACATCACCAAAAAGAAATTGCGGCATGTGCTCAATGAATAAGAGAAGCGTCGACCGTGGTCGGTACTAAGATCAACACTGAGCTGCATTCGAGGGGAGGCAAACTATGAAGGCCATAACAAACCATGTCGCTGCCACTCGCGCAGCAAATCAGGGTAAGGAGATCAAGACTTACGGCTGACGAATCTGAAAATTATCAAGCAGCAGAAGATAGTCATCATGTTGGGGCTGGACTGCAATGGAAACTGGCTGTTGTTACCGGGCAACGGAGTCAGTTGGTGATTTATGCGAAATGAATGGTCTGATATCGTGATGCATGACGCTGTTATGTTAAAGCAAACAGGCGGATTAAAATCTCATCCCAACAGCATTGCATATTGATGCTCTCGAATATCAATGAAGGAAACATGTGGGACCGCAAATAGATGCACCATTCCGGAGAAACCTAATTGCAGCCTCGTCGCGAACCGCTTCATCCGGCAAGGTATCAAGGCTTTATGCCGGCACGAAAGCATTAGCGTCTTCCTTCGAAGGGGATCCGCCCCGCACCTTCACGAGTGCGCAGTTGTGCACTGCGCTCTGAGAAGCAGATAAGCGATAAGTTTGCTCAACATCTTCTCGGCATACAGTCGGACATGGCAGCAGATACAGTATCGTGCTGACAGAGGCAGGAGTGGGACAAAGAGTGTGAAATCAAATAATGATTTATTTTGTCTGATAGTGACCTGTTCGTTGCAACAAATTGTACGACCCAATGCGTTGTCACTGCCAACTTAGTATAAAAGGGAACGAGAAACGTAAAATAGGTATAAATATAATATTAATTAGATTTGCATAAACAGACTACATAATACTGTAAAACACAACATATGCAGTCATTAGAATCAATTACTTAGATGGGTATTAGCATGTAACTATCCCTCAAGGCGCACATGATTTGTGTTCTTGCGCTTACGATTTGTCATTCAAACCTGTCGCACTCCAGAGAAGCACAACGCTGGACTTAGTCTCCAATTGCAAAGCTTTGTGTGCCCTCACTACAGGACCTGCAACCAGTAAGAAGATAGCAGTGATGTCAAACGACGCAGCTGACTTCCTTCTGTCGCCACGACTTCCCCACAGCATGCAACCTCTTCTCATAACTGTAGGTGAATGTCTGTTGGCTGAGGAGCGGAAAGTTACACTTATGAAAACATGGCTACGAAGTCGTGGCTATCTATCGGCTTATTAGGTACTTGAACGCTTCCAGAACGCGGAGGGCCTAATTAGTTCGGCGATACTATATATATGCATTAATGACTATCGTTGGTATAAACAGTGCACCATGCAACATGAATAAAGTCCTTATCCAAAAGGAAGCAGAAAGCTAAATATGGAACTATCAATACGATGCCGTTAAGGTTCAATACTAATTTAGATGGAAAACGTATCTACTCAGTAATTAAAAGAGATCCTGTGTTGCCGCCAAATAAATTGCGGTTATTTAGGCATAAAATTACATTACTATGTCGGAGTTTAGTGAAAGAGGCGGTATATATTCCTGCATAGAAAAATAAGGCATTCCTACGAGCAGATGGTTGGAACTAACTATTCCTTTAGTCAATGTTTATTGGCCTGTCTTTTGATGAGCATGTGAAATGCGATATCGGAAATGTTAAATTGTATCGTGAGAAAGAAGTAAGCACTTATTCGACTTAATAAATTCAGTCACTCCCTGAAATGGTTTTTCCTTAGTGAAAGCATTGACTATGTTAGTACTCTCAGCAAATTAAGCGATGGTTTAACATAACCTTCTTAAAGCTATTCAGGATTTAGTAGTATGGCCAAATCGATTAGCCGACATTGAAATGAAATGTCAGTCCTTAACCTCATTACTTAGAGGGTAACTCTTCAGAAATTCATGAAAAGTTCGCACGTGTGTTAAATGGTTTGCCAGAATGTGGATTTCTCATTTCATTTAAGCGAAAATGCTGCTCCGGATTCAGTGATTTAACGTTTTAGCTGACGGTTAATTCTATGCCCAGAGCACGAACATTCATGCTTTTATCGGCGGAATCGGTGGTAAAACACAGTGCATTCGAATGATTGGTGCGTCGCAATCAACCCAGAAAACAATGAATATTTTCTGAAAATATGCGTAAGGGAGGATCCAAAGGATATTCGATCGCTTGTTCGTAGTTCGTTAGTGCATTTGATTCTTATTCTCCTAAAGAACACTTGACCCAGAGCAAAATGAAGCTAATATTTATTGGTAACCGCAGAATGCTGCCAGGCAATAGTTTAAATGATACAGGGAGATCTCCGCTTAGAATTCATTCAGCATTTATTTGGTTGTATGAGAGGTAGAACACACTGGCTGAACCTATCAAACAGGAATAGTGATGAAAACTTTCAAATATGGAACTCATCAGCCTCCATTTCTACTAAATATGGATCAGACGGATGAACCACAGATTCAAGTGACGATGATAAATTCACTAAAATTGTTTTATAAAGATATCAGAAATATGCTTCGAAGGGTGGGACATGGCAATTGTTTATTTATAAGATTAGTAATGTCGTCTGAAAATTACTTAGTTGGATTCATGGGAAGGAGCTTCATCTGCATCAGCTCTCTCGCTTGCTTTACGAACATTAAGCGACTTATCCATGCACGCAATGGTGTAGCAATAATTGCAACATTATAAACACCCAAGCACGCATCGGAA	*	tp:A:P	cm:i:507	s1:i:3132	s2:i:0	NM:i:2759	ms:i:8300	AS:i:8300	nn:i:0
+52	16	utg000001l	11385	60	4S6M2I3M1I8M1D2M4I17M1D1M1D2M2I30M1D5M1D7M1D1M2D4M1D14M2I33M2I1M1I3M2I21M1I9M1D4M2D1M1I16M1D1M2D6M1I10M3I3M2I22M7I6M1I1M1I6M4I1M1I17M1D2M2I12M3I2M1I13M1I5M3I9M2I5M1I5M3I10M1D1M1D6M3D13M1I14M1I11M2I1M1I19M4I5M4I14M2I11M1D11M2D2M3I4M2I3M3I17M1I5M1I5M1I9M1D11M1D5M1I3M2I17M2I9M1D16M2I1M1D8M5I1M1I10M2I7M1D6M1I22M4I1M2I3M1D14M4I2M1D2M1I27M2I19M1I3M4I9M7I2M1I14M1I10M4I1M3I6M1I8M2I3M1I7M3D3M5I3M2I1M2I4M2I2M7I2M1I1M1I8M1D4M4I6M1D23M2I1M1I3M3I14M1I8M6I1M4I2M3I2M2I3M4I8M2I15M9I3M2I4M2I2M3I8M2D11M3D4M3I6M10I5M1I29M2I11M2D15M1I8M2I8M6I6M2I23M1D6M1I1M1I6M2I23M5I15M4I2M1I9M1I2M2I14M1D18M1I23M2D12M1I3M6I14M3I17M9I3M3I13M2I4M1D7M2D4M2D6M1D3M2I20M1I3M1I13M1D10M5I4M2I7M2D8M3I2M1D3M1I3M3I2M4I8M1D11M6D2M2D13M2I8M1D3M1D16M3I11M2D5M2I8M2D2M1D4M1I5M1I9M1I2M1D3M3D1M2D22M1D3M2I11M3D14M2I4M2D11M1D14M2D7M3I6M1D14M1D7M2I2M1I13M2I5M8D3M2D2M1D9M5I13M2I46M2I2M1D19M1D31M3D11M3I23M6I11M1I11M1I21M5I2M2I3M1I2M2I25M1D10M1D9M1I5M1I12M1D18M4I7M3D37M1D10M2I43M1D9M2I3M1I6M1D7M3D25M2D17M1I6M1I11M1I5M1I6M1I4M1I15M2I13M2D11M1I9M4D4M1I3M1I2M1I2M1I4M1I16M1I1M2D25M1D6M3D12M1I4M1I1M2D4M4I2M1I23M2I37M2D6M3D3M1D29M1D17M1I4M2D25M1I1M2I16M1D4M1I6M1I40M2D2M2I2M1I5M1D38M3I18M2I7M1I46M1I8M1D5M2D21M1D4M5I10M1I21M1I3M1D7M2D18M1I7M1I37M2I7M1D29M3I12M1I37M4D28M1D9M1D9M1I7M2I2M3D8M1I10M3I27M1I17M1D3M2D7M1I5M4I42M2D2M1I11M6D7M5D6M1I10M1D11M1I42M1D2M5D8M1D23M1D16M1I30M1I5M1I22M1I2M1I20M1D19M1I13M1D4M1I1M2I24M5I1M3I2M1D5M1I7M2I8M2D2M1D3M1D4M2D17M3D58M1D35M1I19M3D1M1D2M1D9M1I1M1I32M1I6M1D17M1I2M2D5M1D9M2I5M1D4M1D1M2I8M3I17M1D6M1D1M1D15M3I6M1I11M5D1M2D23M1D6M1I1M4I6M3D5M1D4M1D2M1D5M2I6M1I1M1I14M2I13M1I5M2D6M2D14M1I11M6D18M6D8M1I4M3D1M1D5M1I1M1I21M1D6M1I5M3D9M2D6M1D12M1D6M1I1M2D6M1I1M2I7M1I13M1I27M2D6M1I5M2I54M3D30M2D2M3I8M2D2M3D6M2I1M1I5M2D4M1D5M3I6M2D19M3I7M1I21M2D17M1D5M2D1M1I16M1D11M3I23M1D16M1D1M1D2M1D21M1D18M1I15M3D18M3I5M1I6M1I5M1I7M3D2M1D11M1I5M1I8M2I2M1I17M1I4M1I12M3D22M3D25M1D4M1D10M2I19M1D6M3D20M3I5M1D2M1I8M1D3M1D22M3I7M3D15M1D2M1D9M2D9M2D8M1I5M1D5M3I3M1D2M1I6M1I4M2D43M3D48M4D10M1I17M4I19M1D1M1D3M1D8M1I20M2D9M1D2M1I8M1I1M1I12M1D3M1D2M3I6M1D10M1D4M2D9M1D11M1I6M1D10M1D8M4I3M2I4M3I16M1D5M1D5M4I8M1I7M1I1M2I5M3I3M1D9M2I6M6I4M1I5M1I9M3D7M1D6M1D4M1I12M1D9M4D7M5I4M3I5M1I4M1I9M2D11M1I3M1I7M1D38M3D5M4D7M4I5M6D2M2D5M2D14M4D7M1D2M1D5M2I4M3D2M1D20M3D15M8D11M2D29M5D2M1D7M1I17M7D6M1D7M2I6M2D10M1I1M1I7M1D5M1D3M1D10M1D7M1I2M2I1M1I2M1I13M2D3M4I4M1D3M5D5M1D13M2D10M2D2M2D10M1D9M1D10M1D24M2D5M1D9M2D3M2D15M1I3M3I7M4I5M1D5M1I17M3I11M1I3M3D10M3I1M1D7M2I12M1I1M1I7M1D9M1I4M1D5M2D4M6D14M2D9M2I20M2D7M1I6M1D23M1D20M1I21M1I6M1D22M1I10M1I22M1I3M3D5M1I1M1I6M4I11M2I6M1D11M1D3M2D3M1D6M1I5M1D17M5I9M6D18M1I11M2D16M1D15M2D2M2D8M1I40M1D5M1D45M1D1M2D6M2I61M1D12M1D15M10D7M1I2M1I4M5D23M1I2M1I3M1I4M1I4M3D4M4D5M1D4M1I17M3D15M1D5M1I9M3I1M1I10M1I6M1D5M4I5M1I11M1D2M4D1M1D4M1I13M1D5M1I4M1D6M1I13M1I5M1D4M1I4M1I5M2D6M2I6M2I3M1I3M2I7M1D2M4I4M1D6M1I3M3I4M1D3M3D26M5I4M2I1M2I4M1D9M1I1M4D9M2D6M1D4M3D11M2D4M1I3M2I6M1D16M12I2M1I13M4D6M1D6M1I6M1I4M2I10M1D4M2I5M2I1M1D9M2D1M8D3M3D4M6D12M1D4M1I17M2I4M1D3M4I7M2D11M1I3M2I25M3I11M1I1M1I19M3D8M5I6M3D4M1D7M1D1M1D21M3D10M1I6M1D3M2D4M1I7M1I4M2I3M2I2M1I3M6D9M1I8M1D2M2D12M1I3M4I14M1D12M1I8M1I7M1I7M1D6M1D1M3I21M1D16M1I15M3I11M1I28M3I2M2I20M1I3M4I3M8I3M2I1M1I2M1I3M1I4M1I2M1I1M1I5M2I2M1I29M1D14M1I11M7I4M2I3M1D4M1D6M1D11M1I1M1I11M1I5M1D10M1D3M1I6M1I7M3I10M2I8M1I21M5I9M5I1M1I4M1I3M2I4M1D11M2I7M3I4M1I25M1D4M2I2M1I2M1I12M4I13M3I14M1D5M1D15M1I13M1I5M4I8M1D12M2I9M1I5M1D7M1I4M2I18M4I8M1I2M1I2M2I10M1I10M1I11M1I13M4D2M1D8M1D12M3I4M1I9M1I6M1I4M2D7M2D1M1I8M2I3M1D3M2D12M3D10M2D8M1D6M1D25M1D13M4D4M1D1M2I5M1I30M5D15M2I7M143S	*	0	0	CCGTGCCGACTACATCCGATCTGACAGATTTTTAATCGGGAAAGGAATGTCATTAAGCAGTGGAGAGCGCGTCCAGATAGAGCCACTGATGAGGGAACCACCAAAGACGATGTTATGCATATGCATTTCATCGATAGAACAACGGTGAAGGTAGAAGCCAAGCTACCTGTATTTGGCGATATATTAAAGTCTGCCCCAACAGATATTGAAGGGGAGCTTTTGACTCATTGCTGGATATAGTCATTAAGCCAAAATTAAACATCGTAAGAGAGTAAAAAGGCTGCTGTGCCAAGGATATTATTTTAACCCGTCACCTCGATTTTCAGACATTAGCCTGCGGGCAAAAGAGATGAGGCGATGGAGATATTTCTGTAACAGAACATTATCTATTACGAAAGGCCATCTCTCAGCGCCTCGAACAAGTACTAATGCTGATGAGATAGCTGAAGAGGTTTTGGCATATTGCTGCTACGCAAGAAGGTGAAAAGTGATATACTGGAATGTTCCGTAAAAGGCAGGTGGGCAAAGTCAGGATTAGATTATCACGGAGGTAATTATGCGGAACAAAGAAATCATTGCCTGGTGTTGATAAGGTAATAGAATTCCTTACGTTATCGTAAGCATTTGCTCTCCTTTTCCGCCACTACATTCCTGGGTGTTTCTTTCAGCCCCAGAGATGGTCTTGGGGCGACATTGTCTACCATCATATGCAGGAAGCCATGATTGCAATCCTGATTGCTTCATTGACGTTTCTAATCGGAAGCAGAACGCGCCGACTGGCCAAGATTAGAGTATGGGTATATGACATCGTAGTTATTGTCTATGCCCTGCGCGTTTGTTGAGCTTGGAGCGTCTTTTGCTCTGCGGGTTATTGCTTCTTTCCATGAACGGGCATAAGCGGCTACATGATACCCACTATCGCCATCGGCCACGTTCTTGCTGCCTCTGCATCGTTCATTCATATGCCATCCTTGTTTTCCGTCCAACTAGCTAATTTGACCACCAGAACAATAACGAAGCCTCATAGGGTTTATTCTGTATTGCCTCGCCTCACGATCGCCCCAAAACACACCAAGGACTGGACCCGGAGTGGTTTATGCGAAAATAAATAGATACAACTCACTAAACATAGCAATTCAGATCTCACCTACCAAACAATGCCGCCGGCTGCAAAAACCACGTGCTTCATATAAACATACACAGATAACCATCTGCGGTGATAAATTATCTCTGGCGGTGTTGACATAAATACCCTGGCGGTGATACTGAGCACATCAGCAGCAGGACGCGACTCTGACCACCATGAAGTGACGCTCTTAAAATTACAGCCCTGAAGAAGGGCAGCATTCAAAGCAGAAGGCAGGCTTTGGGGTGTGTGATACGAAACCACGAAGCATTGGCCGTAATGTGAATTCCGTTCGATTAGCTGCCAATCTTTCAGTACGCGGCGTCCGTTCAAGGACTACAACTGCCACACACCATTAACTGCGACTGACAGGGAATGGAGATGGTAGGGATTCGCACAAACACGCCGCGTTCTTGACCCGTTCTCTAGGGAGCAGAGAACAGGCTCAATGGAAAGCAGCAAATCCCCCTGTTGGTTGGGGTAAGCGCAAAACCGGCAGTTGACCGCCCTATTCTCTCGCTGAATCGCAAACCGAAAATCACGAGTAGAAGCGCACTAAATCGATAGACCTTAAGTTAGTGGGCTGAATACAAACAGATTGAAAGGCAATGCAACGTATTGAGCGCAAGAATCAGCACATGGGCGTACAGAAGCCTGGCGAACGATTAAGAAGACGATGCAGTGGACGCTAAGAAATTACAGGAAAATCGTAAGAATTCCTCTTATCTAGAGTTACTTAGATATTGGCCTTGGCTTTATCTCAATATTATATGGATCATATAGCTGGCAACTAATTCAGTCCAGTAAATATCCTCAATAGGGAATAATATGCTTTCCATTCCATCATCGGGAAAAAGTTTGTTCTACGCTCCAACACCAAGCTCGTCAATAACCCTCACTAATGTATGGGAATTGTTTACTTATGATATGATAAGACTACATATTTCCTGCCTTCATTAAGGCTGCGCACAAACCATAGAATTTCATCTTCTGTAAGGTTTGAATTACTGATCTCAGGATTTTATCGTTTTGCATCTTAATTAATGCGTTTTCTTAGCTTAAATCCCTTATATCTTTGGCGCTGGCAATAGCTGATAATCGATGCACATTAATTGCTAGAAAAATGCAAGAGCAAAGACGAAACATGCCACATGAGGAATACCGATTCTCATTAACATATTCAGGCCAGTTTATCTGGGCTTAAAGCAGAATTACAACCCAGATAACGATCATATACATCGTCATCTCTCCAGAGGTTCATTACTGAACCACTCGTCCGAATCAACGGAGGTCAGATCCCATTTCGTCACTCATCAAACTGTAGGGGTTGTAATAGTTTATCGATTTCTCGCTGTAGGGATAACTAAGAACCACCGAAGCCTGATGTGGTTAAAAGACAGGAGCACAATCTTTACTACCGCAATCCACTATTTAAGGTGATATGGAAGAAGAATTTGAAGAGTTCGAAGAGCATCCTCAGGATGTGATGGAACAGTAGCGACTATCCGTATGACTACGACTATTGATGATAAAATTAATGGTGTGACACGTGCAAGGCGATGCAATGGATGCAAGCTGCAATCGGAATGCATGGTTGCCGTGAAAGAAATGTTTCCTGTAATGGAAGATGGGAAATATGTCGATAAATTATGGGCAATACGAACGACGGGGCAATGAATTGCCAGAGAACTTGGTAAACAGAACAACAAAGCTGCCTGATAGTGGGCCTTTATTTTGGCATAAATAACAGAATAAACATGCACATCTCTTTGTATTCGATTCCAACGAGTGAATACACGCACGAATGTCGCTCGTAACTAAACAGGAGCCGACTTGTTTCTGATTATTGGAAATCTTCTTTGCCCTCCAGTGTGTAAGCGGAGTTTATCTGTGAGGATATGAACAGATGTCAAACAACATCAAAATACCATCATTGATTACGACTGGAAGGCATCAATAGAAATTGAAATCGACCATGACGTAATGACAGAGGAAAACTTCACAGATTAATCAATTTCTGGTCAGACTCTGAAATACCGACTCAACAATAAACACGGCTCTGTATTAAATGCTGTCGTATTAATCATGCTGAGACATGCTGCTCTGCTTATAGGATCGTTAAGCGACTTAAATGCATATGGTGTTGTGTGCGTTCCGACTGGAATGATGGAAATGGTCACGGAAGGATGGCTCGAATGGATGGTAGCGAAGGAATAAGAATTACCGATATCGATACATCAGGAATATTTGATTCAGATGATATGATTATCAAGGCCGCCTGAGTGCGGTTTTACCGCATACCAATAACGGATTCACTCGAGGCGTTTTTCATTTATGTATAAATAAGGAGCACGACACCATGCAATATGCCATTGCAGGTGGCCTGTTGCTGGCTGCCCTTCCGAATCTTTACTGTACGAACGAATCACCCGTAAATTACGTAAATGGTCTACGATGGAAACGCCTTATATCGACATATTAATCAGCCAGGAGTCCCAAAGAATGGATCAAACACTTATGGCTATCCAGACTAAATTCACTATCGCCACTTTTATTGGAGTGAAAGATGTTTCGTGAAGCCGTCGACGCTTATAACATGGATATTAATACTGAAACTGAGATTATAAGCAAAAGCATTCACTAACCCCCTTTCCTGTTTCCTGAATCAGCCGGCATTTCGCGGGCGTATTTTCAAGGGAGTTCGGAGGAGTTCACTACATGAACGCTTATTACATTCAGGATCGTTTGAGGTAGAGCTGGGCGCGTCACTACCAGCAAGCTCGCGTTCGAAGAGAAAGAGGCAGAACTGGCAGACGACATGGCCGAAAAGGCCTGCCGAGCACCTGTTTTGAATCGCCTCTGCATCGATCACCTTTGCAACGCCACGGGGCCAGCAAAATCCATTACCCGTGCCGTTTGATGACGATGTTGAGTTTCAGGAGCGCATGGCAGAACAATCCAGTACATGGTTGAAACCATTGCTCACACCAGAGTTGATATTGATCCAGGTATAAACGAATGAGTACTGCACTCGCAACAGCCCCCTGGCTTCGGAAGCTGGCTGGAACGTGCATGGATTCTGTCGACCCACAGGAACTTTACCCTATGATCACTCTTCGCCAGACGCATTTAAAGGTGATGCCAGCGATGCGCAGTTCATCGCATTACTGATCGTTGCCAACCAGTACGCTCGGTAATCCGTGGACGAAATTGCAAATTTACGCTTTCCCTCTGATAAGCAGAATGGCATCGTTCCGGTGGTGGCGTTTGATGGCTGGTCCCGCATCATCAATGAAAACCAGCAGTTGATATGGCATGGACTTTGAGCAGGACAATGAATCCTCCTGTACATGCCGGATTTGAGCCCGCAAGGACGGTAATACCGATCTGCGTTACCGAATGGATGGATGAATGCCGCCGCGAGAACCATTCAAACTCGCGAAGGCAGGGAAATCACGGGGCCGTGGCAGTCGGAATCAGAAAACGGATGTTGAGCCGTCCATAACAGCCATTAAGTTCCATTGTCCCCGTCTGGCGCTTCGGATTTGCTGGTACTATGACAAGGATGAAGCCGAGCGCATTGTCGAAAATACTGCATACATGCAGAACGTCAGCCGCCGAACGCGACATCACTCCGTTAACGATGAAACCATGCAGGAGATGCATAACATCGTCCTGATCGCCCTGGATAAAACATGGGATGAAGCTAACTTATTGCCGCTCTGTTCCCCCAATTTCGCCGCGACATTCGTGCATCGTCAGAACTGACACAGGGCCGAAGCAGTCTAAAGCCTCTTGGATTCCTGAAACAGAAAGCCGCAGAGCAGAAGGTGGCAGCATGACAAGGGACATTATCCTGCAGCGTACCGGGATCGATGCGGTTGTCGAACAGGGGATGATGCGTGGCACAAGAAAATTACGGCTCGGCGTCATCACCGTGCTTCAGAAGTTCACAACGTATTAGCAAAACCCCGCTCCGGAAAGAGAGGTGGCCTGACATGAAAATGTCCCTCACTTCCACACCCTGCTTGCTGAGGTTTGCACCGGTGGCGGCTGGAAGTTAACCTGGAGCAAGGCACTGGCATCGGGCGGGGAAAACAGTACGAGTACACGCCTCAGAACCCCTGTTTTGGCGCAGTTTAACTGATTCAGCGTGAATCCATCACTTTGAACGAATCCCCCAGATCATCTATCGCGACGAAAGTATGCGTTACCGCCTGCTCGCCGATGGTTTATGCAAGGTCTAACGCAGCAACGGGCCTTGAACGGGAGAAATGCCCGTCGGAGCCTCCCGCGGGATTTCATGAAGTTCCGTTCGATTAGGTCGTTTCGAGGCCATAAAGTCCACCAGCTTACACGGCCAGGTGCAGTACAGCATGTGGTGACGCATGAAAATGCCTGGTACTTTGCCAACTATGACCCGCGTATGAAGCGTGAAGGCCCCTGCATTATGTCGTGATTGAGCGGGAGCCGAAAAGTACCATGGCGGTTTTGACGAGATCGTCCGGAGTCGTCATCGAAGTGGACGGAGCACTGGGCTGAAATGGTTTTGTATTTGGGGAGCAATGGCGGAGTAAAGCATCCTGAACGATAATATCCGGGTAGGCGCAATCCACTTTCGTCTACTCCGTTATACAAAGCCGGCTGGGTTTTCCCGGCCTTCTGTTATCCGAAATCCACTGAAAGTAACAGGGGCTCAGGAGATAATTAATAAACGGCTTAGGAGAGCTGAAGTATGCACAAAGGCATCTTCTGTTGAGTTATCAAGAACGAGTATTCGAGATGGCACATAGCCTTGCTCATAAATTGGAATTATGAGTTGGCGCCAATACCAGTAGAAACAGACGAAGAATTTCATACGTTAGCCGCATCCCCGTCGCCAAAAGCTGGAAATGATGGTGGCGAAAGCAGAAGCAGATGAGAAACCAGGTATGACAACCACGGAATGCATTTTTCTGGCAGCGGGCTTCATAATTCTGGTGCTTATGCTTGCCGACATGGAGACTTGTTCACGTGACACCTCAGGCAGGAAAACGCCTTGCACGACCCCTTGCTGCCCGTCAGGCTAAGATTCTGAATCAAAAGCCGACAGCAGTTTCTCGGATAAACGTCGATGACATTTGCCTCGCCGTAGCGTACTGAAGAAGCACCGCGTGAACGGTAACGCTGATGGGATTCACACCGACTCATTTTAAGCCTGGCAATCGTACAGCATGTTAAACGGCGTCTTTAAGGAACGATGAACATGAAAGCAAATCATCAGGGAGCAGCTCCTTTTATTATTCGCATTCACCTCAACCGTATTACAACCAACAGTTCAGGGATTAATGAAAGATGGCAGACATCATTGATTCAGCATCAGAAATAGAAGGAATTACAGCGCAACACAGCAATAAAAATTCTGCACGCCTGAACCACCAGGCTATATCTGCCACTCATTAGTCTGAGTGTGGCGATCCGATAGATGAACGAAGACGCCTGTGTCGTTCAGGGTTGTCGACTTGTGCAAGTTGCCACCAGGAGGATCTGGAACTTATCAGTAAACAGAGAGATTCGAAGTGAGCCGAAATTAACTCTCAGGCACTGCGTGAAGCGGCAGAGCAGGCAATGCATGACGACTGGGGATTTATAAAGCAGACCTTTCCATGAATTGGTAACACCATCGATTACTGCTCGAACTGCTGGATGATAGTAACGGGAAAGAAACCAGCAATACATCAGCCAAACGCCGCATAATAGGAGAACGAGGATATTGCGCTAACAGTAGGGAAACTGCGTGTTGAGCTTGAGAACAGCAAATCAAACTCAACGAGCAGCGTCCGTATTACGAAGGTGTTATCTCGGATGGGAGTAAGCGTATTGCTAAACTGGAAAGCAACGAAGTCCGTGAAGACGGAAACCAGTTTCTTGTTGTTCGCATCTCTGGGGAAGACTCCTGTTATCACCAAGCACTGCACTGATCTGGAAGAGTTTCTGCGGCAGTTAATCGAACAAGACCCGTTAGTAACTATCGACATCATTACGCATCGCTATTACGGGGTCCCGGGTTATAATGGGTTCAGGATGCATACGTATCTGCATATGATGTCTGACGCTGGCATTCGCATCAAAGGAAATGAGACTGTGATTTTGAATCACCAACGCTTGTGAAAATGCTGAATTTCGCGTCGTGCTTCTCCCACAGCGATGCCAGAGTGTAGTGTCATAATGATGACCGTACTCAAACATCGGGTTGAGTATTATCTTACTGTTTCTTTACATAACATTGCTGATACCGTTTTACCTGAAACGACATACATTGCACGGAGTTTATAAATGAGTATCAATGAGTTAGAGTCTGAGCAAAAGATTGGGCGTTATCAATGTTGTGCAGATCCTGCTTGTCTTGTCTCTCCATGCAGACATCACGAAGGTGTTTATGTAGATGAAGGTATAGATAGAGTCGTGGATAAATTCCATGAAGGTTTATAAGTCTAATGTCGAAGACAAATCCCATTTGCAATGTGCCTAGAAATGACTCATCACGTGCAAATTATTATCACGAGTACGGTGGAAACAGCGATACTTGCCTCTCTGTACAAAACATAGATGATTAAACCCAATATTACATAACAATCCTCGCACTCGCGGGAGATTTATTTATCTGAACCTGGATCAGGCGGGTTTTGTTTATGGAGATGATAAATGCATTCCGAGTCACTAGGAATGGAATGGAGAGAGCGATTCAACAGAGTTATCGAAGCGGAGAACATGAACGACTGCTACGACCACTGGATGATATGGGCGCAGTGAGATAGGATTGGCAGACGTAACCAATATTCGAATTGAAGAACTGAAAGAACACCAAGCCGCCTGATGGCGGTTTTTCTTGCAGTCAAGTTTTCAGAGACTTTGCGATGTACTTGACACTTCAGGAGTGGAACGCACGGAGCAACGTCACGAAGCCTTGAGCAAACATTTCGTCGATGGGTTCGGGAATGCAGGATAATTCCCACCTCCGGTTAGGATGGAAGAGTATCTGTTCCACGAATCACGGTAAAGGTTGACTTAAATCGACCAGTAACAGGTGGCCTTTGAAGGATCAGAAATGGGGAAGAAGGCGAAGTCATGAGCGCCGGGATTGTCCCCTAACCTTTATAAGAAACAATGGATATTACTGGGATGATGTAATTACAAGGGACCCAAAGGCGTTTGGATTAGGCAGAGACAGGCGAATCGCAATCACTGAAGGCCATTACAACATTGAGTTATCTTTCCATAAACACAAACATCACGTGCGAAGGTTAT	*	tp:A:P	cm:i:174	s1:i:1531	s2:i:0	NM:i:2150	ms:i:4832	AS:i:4832	nn:i:0
+53	0	utg000001l	42161	60	20S20M1D13M1I2M1I4M1D1M1D1M1D10M2D1M1D3M1D9M5I3M1I11M1I5M1I1M1I13M1D2M1D1M1D6M1D6M1I14M3D12M4D24M1I10M1D12M3D11M2I4M2D13M3D1M1D3M1D2M1I17M2I16M1D2M1I8M5I9M1D10M1D10M2D2M1I11M3D10M2I1M1I13M3I18M1I13M1D23M2I2M1I12M2D2M1I3M1D24M1D6M1D9M1I5M1I2M2D24M1D7M1I9M1D4M1I4M4D1M1D1M2D9M4I20M1I32M1D9M1I10M1D13M1I11M2D5M2I9M2D8M1I3M1I2M2D5M2D9M6I17M1D3M2D4M3D5M1I10M1I12M1I8M1I6M1I9M2D14M7D12M1D15M1I2M2D18M1I15M1D10M1D9M1I36M2D4M1I5M1I5M2D5M2D5M1I2M1I11M2D14M3I7M1I12M1D1M1D4M1I1M2D48M1D17M1D5M1D3M1D5M1D3M1D26M2D5M1I14M1I28M1D8M2D2M1I18M4D9M2I33M1I20M1D2M2D7M2I6M1I4M1I36M1I3M1D8M1I33M2I36M1I8M4D12M1D13M1I14M1D4M1D6M1D1M1D23M1D2M1D38M3I17M1I1M1I13M1I22M2D9M1I7M5I6M2D4M1I16M2D28M1D30M4I3M1D17M2D1M6D2M1D9M1I4M1I12M1I6M4D2M1D6M3D12M1D1M1D2M1I7M2I11M1D25M2I2M2I6M2I1M1D6M4D9M2I6M3D29M4I16M1D9M1I9M1I3M1D14M1I19M1I15M1D18M3I3M2D4M1D12M1D10M3D5M1D3M1D6M1I3M1I9M4D7M1I1M1I46M3I4M1I12M1D10M3D6M1D13M2D16M1D10M1D3M2D9M2I3M1I18M1I7M1I5M1D7M3D5M1I3M1I14M1I12M2I8M1D12M2I6M3I5M4D12M2I10M2D1M1D8M2D18M2D16M1I8M1D22M1D5M1D16M2I4M1D12M4I21M2D10M1I7M2D26M2D9M1D11M2D5M1I5M1D10M1I7M1D3M4I4M1D1M1D7M2I2M1I10M1D3M1I12M1I34M1I7M1I16M3I9M1I17M2I5M2D16M1I8M1I9M1D5M1D2M1D7M1I6M3I2M1I11M1D9M2D5M1I24M1D1M1D8M1D1M1D5M1D41M1I8M1D23M1D3M1D8M1I12M1D6M2D6M1D12M1I30M1D5M1D7M2D6M1I21M1D4M2D9M2D6M1I25M2D4M1D10M1D5M2D2M4D22M1D9M6D8M2D2M1D7M1D4M1D8M1I11M1D1M1D3M1I4M1D11M5D2M1D3M1D10M1D9M2D15M1I7M2I9M1I4M2D7M4D5M2I4M3D25M2D2M1I14M2D2M7D10M1D5M2I5M1D18M3D9M1I9M1I2M2D24M1I8M1I1M1I1M1I5M2D5M1D2M2D4M2D3M6D9M2I34M2D20M2D2M2D1M1D4M2I25M2D3M1D7M1I29M3I11M4D25M1D70M1I9M1I5M1I3M2D16M5D8M5D5M3D30M1I7M2I4M1D6M3I3M2I3M3I30M1D4M1D9M2I27M1D9M2D8M1I5M1D6M3I1M1I3M1I8M1D4M2D4M4D9M1I17M1D3M1D7M7I18M1I21M1D16M1I12M1D26M4I6M1D2M2D10M2D17M2D13M2I6M1I2M1I11M1I12M3I2M1I36M1I4M3I10M1D5M1D1M1D37M1D13M2I21M1D3M1D24M1I7M1I15M2D17M1D1M1D2M2I26M1D5M2D19M3D6M1I11M1D4M2D17M1I5M1D10M3D13M1I1M2D5M1D7M1I33M6D21M3D2M1I11M2D6M1I1M1I3M3D38M1I4M3D17M2D5M1I11M2I25M2I5M1I15M1I5M2D8M2I6M1D5M1I2M2D6M1D12M1I17M1I5M1D5M2I13M3I1M1D12M2D2M3I3M1I7M2I1M1I2M1I2M1D9M3I2M3I1M2D15M2D6M3D10M3D4M3D37M1I19M2I7M5D4M1I30M1I14M1D5M1I10M1I4M1I6M1D8M3D4M1I3M3D3M1D4M1D17M2I2M1D7M2D10M1D12M1D3M1I6M2D4M1I11M1D18M1I2M4D4M1D4M4I3M1I7M1D8M1D2M4D20M2I14M1I6M1I14M35S	*	0	0	GAGTGCTGTTATACCGAGTAACGTCAGCCTGCGAAGCAGTGCTGAAACAGTTGATTGGATTATTCTTTAGTCACCCTCCTGAGAGACACGTCGGTATTACGTGCATGCGATTAGACATCACGCATGACGTACGCATCATGCTGTTTAACAAGTTCATCAGCCAGTCCGGCATCAATGGCCTCCTGACCGCTGTACCTGCAGCCTCGTATCCAGCACACCTGCACGGACATAGGCTTATATGCCGACATTGCGCAAACATCTGGCGGGTTGCTAGGCCTTGAGACTGCAGTGTTATGCAGGGGCCTACGTCATCCGGAGATGGCTTAGCATTGCCCGTAGCTGCTGGCTGCCTGTGCATGCCTCGTGATTTCCACACCCTGTTTCTCCAGCGCAGCACCCGTAATTACTGTAGCCATCATGACGCCGATGGAGCTGTTAGTCCGGGCGGTCCGTGACCAGACGCCGGGAGGCGGCACTGGCAGCAACGTACTGCACTTGCAGTTCATGTCGTTGGCAAGCGCCCATACCGGTTTTATGTCACCGCAAGGGAGCGAGCCGTATTAAGAGATGAATGCCCCAGGAGCCCGCCGGGCGTGTCCATATCGAGCAGAATGCCCGTCCACCATCGGATCTCGCTGGCAGCTTTAGCAGACGGTGCGATAATGCCGTTTGTAACCGGTCATCCGAGTACGGCTGCAGCGCCCGTCCGGCTCTAATGGGTAAGCGTGCCGGACAGGCAGCACGATGCCCGTTCATGATACTGATAACTGCGGGCCTGTCTCGTGGTCCGTCATCATCACGGGATAATGCCAGCGTCGCGGGTCCTCCTGGGCAGTCAGGCTGTCGCCGGACACCGCATCCGTCAGGCTGCTGATCCCAAGCTGGGTGCAATCGACAAAAGAAAACCCGCGCAAGGGCGGGTTCAGGCATCAGGGCCTCATCAAAGCCATGCTGGCACCTCCTGCGGGGAGTGCCGCTCTGCCTTCCTTCCTCTTCTCTACTGTTGATTTAGCAGCCCCGGATTCAAATGCTGCAGCCGCCCAGGCGGGCAGTCCAAGACCGGCTGCACGGCGCTCCATCGTTCACGGACTGCTGGCAAAATTTCCTGATAGTCGTCACCGCGTTTGCGCACTCTTTCTCGTAGGTACTCAGTCCGGCTTCTATCAGCATCACGCTTCCTACGTTCTTTCAGACCATCGATGACGACCGGCCAGCCTATCCAGTCGCAGTTCCCGCAGGCACTGCGGGCTTCCTGAAAACTGAAGCCGTTGAAGGTAACGTCACCACGAGCGAACGATGGCCTCTTCCAGCCAGCACAGAAACATCGGCCGCCTGACGGGATGCTACGAATTTTCGCCGCCCCATAAAGTACGCCCACGACTCGTTCGCACTGGCCCGTGCCGTGGAGGTAGCTCATCCTTAATTCCGGGAAGCTGCTCATACGGAGACACCCAGCCCGGCAGCGATAACGCAGCAGTGACTGCTCAAACACGATAGCCGTTATCCGTATCCTGAGCCGTCTGCAGGTTCAGTGAGTCATCGAGCATCACGTAGTCTCTATTTTGCGCTATCGAGCCGGACCGGCGCTGCGGCGTAATACAGGCAATTCGAGATCCCGCTACATTCCTCTCGTCCTTTCCCCTGCTCCTGACTGTTCGCCTACAGAATAAATCCATCAGTGACTGCGTATCCAGCTCACGCGCTCACTGGGGGCGGCATAGAGATGCGCAGGGCAAGCTGGCAGGGTTCTGCAGCGTGGAGGCATCTTCATCTGCTCCACCGTCCGTAAAACACATTTGCACCCGCGTCTGCCCGTCCTCCACGGGTTCCTCCAAAACGTACGATGAACGAGGCGCGCCGCCGGGTACTCACGGGGTATCCATGTCCATTTCTGCGGCAGCATCCAGCCAGGATAGCGTCGTTGACGGCCGTAACTATCCCAGCGCCGCACCTAATGTCATTAATCTGCACACCGGCACGGCAGTTCCGCTGTCGCCGGTATTGTTCGGCCTTGCTCTGCCTTCGGGCTGACCATCCGGAACTTGTCGGAAAGCGCACGAAGGCGAGTATCCCGATGGCCTGAACGAACAGTTCACCGTTAAAGGCGTGCAGGGCCACCCTTTCGCCCGAAATCATCATGGTAACGTGCGTTTTGCTCACGTCAATGCAGCAGCAGTCATCCTCGGCGACTCTTTCCTGCCTTCATCGCGGGGATAGGCACGGGCTTCTTCCTCCCCGATGCCCAGACGCGCCAGCTTGAGGCGATGACTGAGCCGCATAAAGACCCGACGATATGATGCTCTGCAGCTGGATGAGGCGTTGGCATTGGAGCGTTATTGCGTACCAGATCGTCCCGGGCATTCACGGGTAAAGTTGGGCAACAGGGCTGCATCCACATTTCACTCGTGGGTTCCACGACCGCAACTGCCTCCAATCCGCTGCCGCCTCTAGGATAACCGGCATATTCGCGCAGCGATGTCATGCCGTCCGGCCGAAGGGGGTGAATGGTGAGTTTTCATACATAAATCCGGCAGGTCCCTGCGTGCTGTGTCATGCCGGTCCGGCATTCCAGCTCTGGCAATATTTTGAGGTCAGACACGGAATGGTGGGCCGTAAACCCACCCTTCGTCCGTCTTTCTGTACTGTTGCCACCCCGTTTACCTGTCAGCAAGGTCATGGCAGTGCCGCACGGGCAGGAGCGGCAAGTTCTTCCTGTCGCGTCATGCTCATCCTCTGGATAAGGCATGAATGTAATCGTGGCCAGTGTTTCTTGTTGGTTGCCTGCACCATCCTCTTCCTGCAGGACGCCAGCAGCACTGGCGATCCAGCTGCCAGGGGAACTATGCTGATGCCGCGCCCCAGCGCATAGACGAAGCAGTTGAGTGCCTCATTGCGTCGCTTTTGCTGTCCACAGTATTTTCCTGCCATCCACCATTTTCGACTCTGCTCTTCAGCAAGTCATGCTGCCTTCGCTTCAGATTAAAAATATCCGGGTTATTCGGGAATGAACGCACCGGAAGCGTCATCCATCTTCCGGCGTCAGTGTGAAGCGGTTATAAATCTTATTTCTGGGGTATCCGTACCGATTTCGGTAATAAACCCGTTTTATTTTCGTACGATTAATTAGTAAGGGGCTTTCAGTAGACGACCCTTTAATGGGATGACAGGACAGCCCATGTTTTTCTAAGGGTTGGATAACAATGGTCCTGTAATCCGACAGTATCTCGGAGCAATACGGGTAAGTGACATTTCTGCAACGCACCATTCCGGCGGTATAGTTTATCCTTATCTCATGCACGCAGCAGCGTCTGTTCGGCCGTCGTGGAGCCCCACTCTGGCTGGCGTGAGATGCGAGTCTTCCGCCGCAGGCCCCATCCCCATACCGCATTTCGATGGTCCAGCTGGGAGTCGATACCGGCTGTTAAGGTGAGCGCGCCACGTCAGGACGGGCTGAATAATGCTGTTCCGCTCTGCCATCACTTCAGCATCCGGACGTTCCAATTTTCGCCTCCCACGTCTCACGAACCCGTGGTGTTTACGAAGGTTTTACGTTTCCCGTATCCCCTTTCGTTTCATCCAGTCTTTGACAATGCACCCAGGTGGTGACGGGCTGTACGCTGTCCAGATGTGAAGGTCACTATGTCAGGTGGCTCAATCTCTTCACCGATGACGAAAACCAGAGAATGCCATCACGGGTCTAGATCCCGGTCTTTTCGACAGATAACGGGCATCAGTAAAGTCCAGCTGCTGGATGACGCAGGCATTATGCTCGCAGAGATAAAACACGGCCAGGGGTTATCAGTGAGTTCCGAGGAGATTTGAGGCCAAACGGCGTCTCTTTGTCGCCAAATTTAAGATATACTGCTCCCTCCCGCAATGCGGGCAGGCAACATGAACGCATACAAATGCGGGATGCCTCGCACCGGGCGGCCTCACCGATGCGCCCCATTTTTGGCGTGGAGCCACGATGATTTGACCACGGCCAGACCGAGCCTTCGACATCGCTTGTCACCCAGGAACGTCGAGAGCCTTCCTGTTCTAATATCATCATCAAAGCAGCAAGTTCATCATAACCCGCGCCACATCCACGACTTTTCACGTAGTTTTTGCTCGTTACCCCAGGCATAAGAGTGAAGCCGACGGTTAAGTAGTGAAACGCTTCATGGTGAGCTCGTGTTATCCGGTGCTTTTGCCATACCACGGGGCCATGCGCCGACATAAGGGACGAATACCGAATAGTCGGCTCAACGTGGGTTTTCATAAAGTTCTGGCATCACCATCCCTGTCGGCAACCAGATAAGGGTGTGCCTGCTTATGCTCTATAAAGTAGGCAATAAACACCCCAGCAGCATTTTGGAATAACCGACACGGTAATTAGCTCAAGATTCACCTCACGGATGTAGTGCTGCCCATCGCATGCCTGATGGCCCTGAAGGGGCAGTGTTTCCCAGCCCTTCCTGGTATGCGTGCTTCCTCGGGGTAGGCTATTAGCATCCAGGATGCGACGGGGCGATCTGGAGCAGCGGAGGCAACAGGAGCGAAGCCGGACAAATGCCGCAGCCTGTCCATGACTGTTCCGATATTCATAGCCTCAGCAACCCCGGTATCAGTTCATCCAGCGCGGCTGCTGTTGTTCATGGCTTTGATGATATCCCGAGTTCAGGAAATGATAACATGTCCGTTTTCCAGTTCCGGAAAACGCTTGCACCGACAGGGAGCCCGTCGAATACTGGCATTTCACTGCGTACGCGACAGCACGAAAGTACAGAATGCGGTTTCCACCACCTTCATGGAGTCTCTGGCATTCTTCGCTAGTTCCTGTGCGTGCTTGCGGCGCACGCGTAAGGTCTAATGGCGTTCCGGGTTGGACAATAGTTTCCTGGCTGGAGATGCCTCGCTGCTGCCCGCAGTTCTTCACTCTCCCGGCGCAGCTTTTCGTTCTTAATTTCAGCATCCTTTCGGCATACCGTTGACGGCAGCAGAGTCATAAAGCAGGCCATTACCCTTGCCACCGCCTCGCAGAACGGGCATTCCTGTTTCCTTGCCGATTCTGAATGGTATACGCACCGCAGGAAAGTAGGGAGCCATACAGTGCTTTGTTGACTTCCATGTTCATTCCACGACAAAACAGAAGGAAACGACAGAGGTAAAAGCTCGCTTTCAGCATAGTCGTTCCGTGATTCGTCCCAGAGGGTATTTTAACAAACATTAAGTTATGACGGAAAGAAGAACGGAAATCGCCTTAAACCGGAAAATTTTTACACCTATAGCAAACAGGAGGTCGCCACCGTTTA	*	tp:A:P	cm:i:88	s1:i:857	s2:i:0	NM:i:1221	ms:i:3794	AS:i:3794	nn:i:0
+54	4	*	0	0	*	*	0	0	ACATTTTTCCGATAGACCGGTATACGGTAATTTGGCACGCTACACTTACCATGATACAATGTGAAAGAGCCTTCCATGTAAACGCTGACAGGTCATTTGACAGCACGATAGTCGTTTAAGACAATGAAGAGCGTAGTGATGCTAGGTAAACCACGTTAGGTCGGGCCGGTCGATTTACGTCAGGTCCTTACCTTAGACGTCCCGCTTGACTTTACGTGATGCGAGATCGTTCAAGGCTTTACTCTGAGGTATCAGGTCTTATCATCACGCCACGACATGAATGGCCTGAAGGTATAGGTGAAAGGTATCGGCCTGTTAATCAGATGAGTGCGCGGTGCATGTCATCACGAGTGACTGTCGTCCTAAGATCTAGCGTCCGTTCCTGCGTCATGTACTGTCAGCCGGCGTCAGTATTTAGAACCAAGATTTAAATTATAATTAGATTTGGTAATCCGTAATTTTACTACCGTCACCATTTGTACATAAGTTAGCATTTCATAAGACATAAGTCAGATCTATGAACTCCACAAGCCCATCATGTCGCCCGGTATGCCTATCATACTTATAAATTGACATATTAGATATTATAACTGATAAATCCATCGATCACTAAGCCTATGAATCCTACTGAGCAGGCAGACACGTATGCAGCTCGCCTGCCATCGTGCTCTTCGGTGTATTCAGCGCCGTCAGACTAACGCAACCCAAAGTGGATAAATAGAGCTCAGCATCATAGACGTCGCACGGTTAGTCGTGCCGTGAGTACCATCGAGAGCTCTTTCAGCATGTCACTTACTATTTGTTAGTACGTGTCTGAAGGCCATCCAAGTTAGCACGCCCTATCAGCTACTTCCACCCTGCATATCACCGGCCAGTCGTTGAATAACCCAGGGAGAATACGGTTACCACCAAGCACGGTTCAGGGTACTGCTGTTACGACGGCTAAAGACAATCTAATATCCAGGCTTACTAAGTGTAATGCTTAAGTAATTTTGACCGTGGCTCGTCATAACCGTCCTTTGGGGTCCTATTATTTGACGGCATGTACTCAGACTGCGATACCCTAGATGAAGCAACCATTTACATTTAGGCATAAGGCCGTTGTCGATGAGCTGATTTTTAATATGGCCACTGTCTCACCCCTTACGTTACGGCATAGATCCAAGCAGTGACATTCCAGCCGCTCTGTTAAAAATAGCGATGGATCTCCCCATGTTTAGCCATCTTCCACTTTAAGCGCCCAGTAAAAAGACGTCCAGCTCACCGACGGGCTTAAGTCCTATAGTTCATATAATTTCCACTTATAGACGAGAGCCATGTACCGTATCGTTCTCACCCCTGCGTAAGGATATCGAACAGTTGAATCAGCCACAGCGCTCCAGTTATTGCATTCTAGCCTATAGTCATTTCTAGCGGCAGGGATACGAACCGAGCAGCACAATGCCAAGTTACTCATCCGTGAAGTGCATCAGTATGCATATGCAGCATTGCCACGACGGTACGTTCAGACGTATCAGAATCACGTAGTATCTGAGCTGATCCCAGCGTTGCCGTGCTGTCTAAGTCCCTATGAGGTGTCCAACTTAGTAAGTTCATCCGTCATCTAGCTCTTTCAAGCCCTTTCAGTTCTTTGGTCTCGTCCATGACATCACGTTCAGTCCAGAGCGGACGGCAATCAGTTCTGTTACTTAACTCCACAGAAACAAGCCCACCATGATTCCACGAATTAACCATACAGGTCAGCCAGCAGCATCAGGTCTACTTCCACGTGATATAGCTAGTACATGGTCCAGTTTGGACCGCTGAAGCCGTTATGTAAGACCGGTGCGTTCTAAGGTTAGCTTAAGGACATCCTACCGACGGTCGGGATCGAGATTTAGAGTGACAGTACGATAGCCATCATCCCTTAGACATGTTAGGGTCTTTCAATGTCTCCACCGATCGACGGGTATGCTATTCTCTGACTGAGTTGAAGGAACGGTGAAAGAGCTGTCGATCCAACACGGTATTCACAAGCTAGTTCGCCGTAGGCTTCGATACCGTAGTCGTATACGTAATGTCACGGTGCTCATCCGTGCCGACTCGTGATTATTCTACTTAGGCCATCCTCATGAAGGTCTCAAGGTATGGTATTTAGTAAGCACGCCCAACTGCCTGCATCTGTCACCTTAAGTATTAGTCACGCATGTTGCATCATTAAGGCGAACGTAGATGCCGGTTGCCATTCTTAAGGCAGGCATTCCAATATCCGTCAACGGTATATCGATCACACGGAACTAGATAAGGCCAATAGAAACAATCCAAACTGTAAGCTAAGTTGCCGTAGAATTTGTAGAGCGACGTTACCTTGCATAGAAAACCACGCAGAATAGCAAACTAAGTCGATATGCTGCCGAGAGTGAATAAAACCCTAAAGCTCATTAGTGATGAAGGTAAAGTTAAACTATTAATTGGTCCTAAACGCGTCCGTTTTCTTCTCGTCCTTAAGCGCCTGAGACTCTATAACGAACTTCATAGTACTTTATAAATTATGTCTGTCAGCATCGCAGAATCAACGAGCACCTTTATTAGTCAGGGATGGATCATAGCAGGTGTCCAGCAGCAGCGTATGCAGGCGTGCACTCAATCGCCGGGCCGTCGTATGAGCTTATTGAGCTGGGTAATTTTATACTTCTATAGTAAAATGTGTTTCCGGCTTCCCATAGGTAGGATCATTAGCCCGATCCTGCTCATGATACGACGGATCGGGCGCCGTGGCACTTATGTGAGACAGGCGGCTTAGTTGCATTATAAGCGTGTTCTGCCAGCACGTGCCTGTTCTTCAGCGTCCTTGCTCCACATTAGTCTAGACTGATACTGTCCGCGGCAGTCAAATGCTAGTTCCCGTCAAGCTGCGCTCCGTTTCTCCCGTCCTACATACCAGCGTGAACGGTCGAGAAGTTAGATAGAGCGTTGGGCCACGTTGATTAATCCATCACGCATGACGTACGGACGGTGTTAAAGTTGAGCCGTTAGCATCAAGCTCTGACGTACTTAAGGGCTGCTACAATATGACTAACAGATATGCCGACCTTCTGAGGACATCTAGTCGTCCATCCGGGACTTGGCCCTTCCGATCACTTAGTTAAATAGCTATGACCGGTGCCCTTATGGTAAATCATTCCACGCTGTTTACAAGAAGCCGTAGTGTGACTAATAACCATCTACGTGCATGCGTTGATCAAGGGAGGCAGGCAACCGGGTATGGCTTTATTTACATAAAGCGTTGATCCCCCAGCAGAATGGTGTCAAGGTCGACTGCTAAGGCTCACGCTGTTAATCACGCTTACGGTCTCATCATGTAGACCATGTCTGTGAGACATGAAGTGATCAGTCTCAGTACCCAATGGGGCTAGCGGTCAGTAAGGGTTAAGCCCGTAGGCGATGCGGTCATATAGTCGAGATCATCGATAGCCGTAAGCCAATAGTCATGGCAATTAAATAACTGAGGCGGCCACTAGGGTTCAATAAGCTCTTCCATAAAGCTGGCGATATGCGGGAGATTACGCATATTATTCTCTTCTCTGTTGATCTCATCTAAGTAAATGCATCATAGAGACCGTGCACTACTGCTGAGCATCGATCGTTCTAAAACCTCCAGGTCAATGTGTTAGCATTCCACGACCTTTCTGTTACTTAAGCCTTAATTTGTTCCTAACGAACCCTATAGGACTATACGTACCGGTGAACTAAGGGCCTGCGTTCAGGCATACAGCTGTCGACGTCACGACCAACGCTTGGTAATTGGCACCACCACGGCCTGACGGCCCGGCCCAGTCAGCCCAACCCCTATCGTCAATAGATTGCTTAAGCTGGATATTCAAGGAAGGTCAACCAGCCCATAGAGCGGCCCCAGCAGATGGTATAGGCCCATAGTCGAGATAGCTGCGATGACTGAGTAATCCAATTTCACCAATCAGCCGTCTACCTTTGCCCTGCTCTGACGTTGGCCAGAATAATCCATCGACCCTATCCAGCCTCAATGTAAGCCTACAATCTAAGCCTCTGCACTACTGCCTGTTCCAGCTTCAAACTTTAAAATACCGACCTGTAGCCCTCGCATTTAAAAGTGAACCACGTTAGCTTACTATAATCACGTCATGGAGGCCCTCCGGGCATGTCCATTCCATGATCTTAAGGCACGATACCCGTCGCCGTATGTATTCCACATGTGCTCGGTAGTAAGTTGCTTAAAGTCTTTAAATTATTAGGAACCAACTATCCATGTTAGAGGACGAAATATCGACTATAAAGTGAGCCGTCACGTCCCTGAATCATCATAGCTTCCAGTAAACGTGCTGTCTAACGTCAAGCAGCAGCAGTATCCTCTAAACTCTTTCCATTCATTCAACGGGAAAGCACGGCTTGCTCCCCTTACATCAGCCAGGTGGGCGAGATTTGAGGCACCCACGTTGATCCGATCGTTAGCAGGCTTTAATAGAGCGTACCAGCCCTAGGACTCACGTCAATATTAATTTAAGCCAATATAGCACTGTCAGCACGTACCCACTTCAAACGATGCTGCTTCCGTCCAATGGCATTGGCATAGTTGAGCGCCTATCCAATCGTGAATGTCCTAGTCGTACATACTGCCTCTTGTCATGCCCATGCTTAATAGGTCACGATTTTCTCTTCCCGTTGGGTTCAGGCATTGAGCAATCTAAGCTAAGTTCTTCCTGTCGCTTGCTGCTCTATAAGCACGGTATTATGGTCGCGTTGTTCTCACATCTCTTCTGCAGCTGGCCCTACTGAGATGGCTATCATAGAAGTGATGCGCGCCGCCGGCATAAACGAAGTCATATTAGCTGTCATTGCTGTTAGTGTCCAATATTTCCTTACATCCACCATTTTCGACCTTATGCTAAGTCATGCTGCTTCGTCAGATCAAATCCGTATTCGAAGTACTGAGCGAGATTTAGATGATCGTTGCTTAAAGTAATGGCCGTTCTTAGTCATCCACCATTTAGTAAGTAATCAGGATGGCCGACCTAATGTTCCCGTCGATAAGCTTTGGTACGTAAGTGAGCAGGTACGATGACAGCCCGTCTGCCGTCAGACAATAGTTCTATAAGCCCAGCCACGTTAGACATTTGGCATCATGCCTTTATGAGCTATTTAGCATCACGCATTCCCCAGCCGGATTCATCCGGTCTATGGAGTCAAGGCGTCATACTACACGTCAGAACGGTAGAATACGTAGGGTCGATATTAAGCAGTACCATGGTCAATTTTTAATACTAAGTCCACAGACCGTCTGTTACATGTTGAGTTCTCATTACAGTTAATAGTCGACCCAGACTGAGTACTATGTCAGATACGTATAGTCAATGGTCACGATACGAAAACAGAGATGCTCACGTATCAGATCCCGGTTTACCAAAGCCCATACAGCTGCTTAAGCTGACTCAGTACAGGCATACGAGATACTTTAGTTGATACTTATGGTAAAAGCGTCCCAACCAATATAAGCTGCGGATTCCTGCGCCTCCTTCCCTATCACGTTTACGTAAGGCTCTGTTGGCCACCCAGCTTCATCGTACCCAGTACTAGAGCTGCGTCAATAAGTAAAGCATAAGTCATACTCACATCCACCGACTTTCACTGTTATAGTCGCCGCTAAGCCATTGAAGCCACGTTATAACGTGCTTAGCCGGTGTTGCTATCACTACGCTAGCGCCGACGACAGTAGAAGGTCGGACGTCGTCATAAAGTTCTCTAAGTACCATCCTTTAAGATAATAGTCCCGTATGCTATAAAGTAAGACCCCAGCAGGCATTTTAGAATAACCACGGCAGACTTCACATGCCTCACCATTATGCTGCCCATCGCAATCATTATCATGAAAGCGATGTTTCCCGCCTCTGGTGCTTCTTTGGAGAGATATTAGCATCCGCCTTCAACGGCGTTGGTAGCGTATGAACAGTGAGCGAAGCCGGCTAAAGTCGACATGTAAGTACTGTTCGAGATATGGTTGTTCAACCTTTATCATCAGTTCGGGGAGCCTTCCTTTCCCTTCCAGCGTAAAAGCCGCATACCGTTCAGAATACTGGCAGGTTCGTACCGACACCCAATACAATTAGTTCCACCACTTCGCCGTATGACGGCATTCTTGAGTTCTATGCTTGAGCACGTAAGTCTAGTTCTATTAATAGTTCCTGGGCTGTAAGCTGGCCGGTTGCTCGCAGCCCACTTTCGTCAATTTCAGCATCCCTTTGGCATACAGTTATGACGGGATATAAGGCCTATCCTTGCCACCGCTCGGCGATTAATTCCCGTTCTGAGTGTAATGTACGACTCGCACCAAAGTGTCACAGCTGCTTTTGGTACGGTTCATTCACGACAAAACAGAATAGAAAGACATAGTAAAGCTTATGCAGTCTGTCCAGTATTTTAACAACATTAAGTTGGAAGAAGACAGACGAAACCTTATAAATAGAAAATTTATAAATAGAAGACCGATGGCTAGTTCTTGTATTTT	*
+55	16	utg000001l	30	60	79S5M2I10M3I5806M1D3M1D6M1I15M2I10M1D15M1D28M1I4M2D13M2I7M2D6M2D5M1I19M2D10M3I20M1D33M3D4M3D3M1I35M1I10M1D5M3I1M1I6M2I9M1D29M1D5M1D6M1D34M6I14M1I15M3D15M1D8M2I7M8I2M4I9M2I6M2I10M1D1M1D4M1I2M1I9M1I2M1I9M4I1M1D7M2I5M2I1M1D9M4I3M1I9M5D7M1I16M1I11M1I6M1D15M2D22M1I14M2I7M1D9M1I4M1D4M1D1M1D13M3D10M1D35M1D17M1D12M1D1M1D21M1I16M6D13M1I3M1D21M7I4M1I2M2I9M2D2M1D2M1D11M1I6M2D1M4D13M2D4M3I3M2D6M1D3M2D2M3I3M3D10M2D30M1D6M1I11M1D11M1I12M1D4M4I2M2I3M2D1M1D7M1D7M1D6M1I6M1D5M1I10M1I5M2D4M1I2M2I1M1I8M1I8M1I8M2I8M1I9M1I3M3I27M1D8M1D20M1I1M1I7M2D9M1I4M2I8M1D18M1I3M2I7M1D3M1D36M2I2M2D2M1D9M1D5M1D6M1I9M2I1M1I6M1D3M1D12M7D23M3I6M2D7M1I1M1I15M1D3M1I3M1I7M2D8M2I4M3I5M4D10M6D2M1D2M2D9M1D3M1D16M2I11M1I34M2D6M3D2M2I11M2I11M1D15M1I4M3I10M3D2M1I8M4D5M1D1M1D5M3D15M3D4M1D6M1D19M2I14M1I6M2D16M2D8M2D20M3I13M1I15M1I2M1I10M1I2M1I9M2D8M1I3M1D8M1I14M1I12M2D1M1D48M3I3M1D16M1I17M1D18M1D3M1D9M3184S	*	0	0	AGATCAAAGAACGTGTAGCCTGTCCGTAATCTAGCGCATTTCACACGAGACCCGCGTAATGGGCTCCGGCTTAGCGCTCCATATTACTACAACGTGCGTCGTGGAGGCCATCAAACCACGTCAAATAATCAATTATGACGCAGGTATCGTATTAATTGATCTGCATCAACTTAACGGTTCAAAACAACTTCAGACAATACAAAGGTCAGCACTGAATACGGGGCAACCTCATGTCAACGAAGAAACCAAAGAACCCGCAGAACAACAACCCGGACCCGCTTTTCCAACCAAATGATTGAACAAATTAACATCGCTGAGCAAAGGGAGTCGGGAATTCTCAGCCTGGGTCATTGAAGCCTGCTGGAGACTAACGTCAGAAAAGAGAGCATATACATCAATTAAAGTGATGAAGAATGAACATCCCGCGTTCTTCCCTCGAGAACAGGACGGTATGTAACCCCACTTAAGTCCCGAAGTCGCAGGAGTGAAGCATCTGAGTTGCAGTTACCACTTTCCTGACAGTGACTTGCGTGTGTGTTGGCTGGTGTCACAGACTAAATAGTTTGAATGATTAGCAGTTATGGTGATCAGTCAACCACTAGGAATAATCCTTCATATTATTATCGTGCTTCACCAACGCTTCCACTTCCTCGCATCCTTCCCCTACACCTTGCTGTTCTACATGCAATTACAACATCAGGGTAACTCATAGAAATGGGTGCTATTAAGCATATTTACACGAATCAGATCACGGAGGAGTAAATCAGCAGATTGTTCTTTATTCATTTTGTCGCTCATGCGCGCTTGCTCTTCATCTAGCGGTTAAAATATTACTTCAAATCTCTTTCTGTATGAAGATTTGAGCACGTTGGCCTTAAGCCATCTGTCGGTTTAGCGTTGTATTTCCCTCCAGAATGCCAGCAGGACGCAATTTTGTTACGCAACCAATACTATTAAGTGAAAACATTCCTAATATTGACATAAATCATCAACAAACACAGGAATAAGACAGATTGAACGATAAAAACGATAATGCAAACTACGTGCCTGCAGTACAGGGGAAGTACCAGCATGGAGCCGAGAGATGCCATTTAAAGAAATATTCCAATCAAGTGCGAAGGATTTAGACTGTGAATTGTTTTTATTCTGAACTAAACGTCACAACGTTCACATTATATTTGTTATCTAGCCCAGACTACTGTCGCCTTCGTGCCACGCTACAGCCGCGTGTTATAACCCGCCAATCTTAAAAAGGTTGTAAATGTTAATTCTCAAGAAACACGCATTATAAGAAACGTCCTATGATAGATTGAAATCAAGAGAAATCACATTTCAGCAATAAGGGAAAAATCTTAAAGCAGGAGTTTTCCGATCGGTTACAAATATCCATGAACATAAAGATATTACTATACCTTTGATAATTCATTACTATTTACTGAGAGCATTCAGAACACTACACAAATCTTTCCACGAAGCTCATAACGTTGCTACGCTTCTTCCGTGCGTGTCAGCACCGGGGCGTTGGCATCAATGCAATACCGTGTACGCGCTAAACCCTGTGTGTGCATCGGTCCTCAATTATTTACGCCGGACACTCCCCGCAGAGAATTCCCGTCAGGGCTGTGGACATAGTTAATCCGGGATCACGACCGATTGCCGCACCGAGAATACAGCAGTAAATATTAAATATGAAATTTCAACTCATTGTTTATAGGGTTTATTAATTTTCTACACATACGATTCTGCGAACTTCAAAAAGCATCGGGAATAACACCATGAAAAATGCCTCGGGCCTCCGCCCCTGCTTATTGGATGTGCTCAACAGACGTTTACTGTTCAAACAAAAGCAGCAGTAGCACCAAGGAAACCATCACCATCATTTCTTCTTTCGTTTCTGGAATTGGGCAGAAGAAAACTGTCGTGATGCAGCCAAATTTGTGGCGGCGCAGAAAATGTTGTCAAACAGAAACCCAGCAAACATTCAAATGGAATTGCTCGGTTTTATTACTTTAGCATTTATACTCATGGAAGCGCGTGTGTATTGCTCAATAATTGCATTCATGCATTACAGTCCGATATGGGCAACTCTATCTGCACTGCTCAGGATATATTTCTGGGTTCCTTCCAGTTGTTTAGCAGTGATGATCAGCCTCTCTCTGAGGGTGAAATAATCCCGTTTAAGCTCCGTCTGCCAGTCGGGGGAGGCTGCATTATCCACGGAGGCGGTGGTGGCTGCATTCACGCAGCACGACCCCGTGGAGTGGCAAATGAGCACGACGAGAAGAGCTTAACATCATCACGCAGAGCATCCTTCAGCTTAGCATCAGCCTACTAACTAATTCGTGCCTTTCCCATTTCGGGCTGCCGGCGATAATACAGCCCGCTGACGCATCTGCAGTGTCAGTAATTGCCGCGTTCTCAGCTTCGTTTTCTCTGAGAGCATTTTGTCGCGCTCCGTTGTAGGCATGGCGTTATCACGGTAATGATTAACAGCCCATGAATAAGCAGACGATGAGGATGCAGATAACCAGAGCGGAGATACTAATCGCGGTGACTGCTCATACGTAATCTCTGACCGTTCTCACGCTTCTTGAATTTGCAATCAGGCTGTCAGCCTTATGCTGAACTGACCAGACAGGGGACGGCAGTGAAGCCCCAGATATGCTGCAACGGTCGATTGCCTGACGGATATCACCACAGATCAATCATAGGTAAAGCGCCACGCGGGCTTAATCTTGCTGCATGCCACAGCGTCTGACTTTCGGAGAGAAGTCTTTTCAGCCAAGCTGCTTGCGGGTAGGCATCCCACCAACGGAAAGAAGCTGGCTCAGTCGGCGCCTGTTGATTTGAGTTTTGGGTTTAGCGTGACATTTTGCTCCTGCAGGGAAGCTCCCAGCAGCGCACACCGCCTCCGAGACACAATAGTCCATAACCATGATTTCTGGTTGGTAGTCGTTATCAGTTCCCTCCGACCACGTCAGCATATCGAGGAACGCCTACGTTGATTATTGATTTCTACCATCTTCTACTCCGGCTTTACAACGGCAGCGAAGCGTTTGATAAGCGAACCAATTCGAGTCAGTACCGATGTAGCCGATAAACACGCTCGTTATAAGCCGAGATTGCTACTTAGAGTCCGTGAAGTCGAGAAGTACAGGAGAATGAACTAGCGGCGATAATGGCGCGCGCACATCGTTGCGGTTCGTCGATTACTGTTTTGTAAACGCACCGGGTTTATATCTGCCTCGAAGGTACGCCATTGCAAACGCATTAAAGCAATGCCTTGTTCCGGCTCCTTTGCCGCGAGAAGCGGCCAACAGGTCATGTTTTTCTCGGCATCTTCATGTCTTACCCCAATAAAGGGATTTGCTCTATTTAATTAGGAATAAGTGATTACTGACGCTAAACAAATCCAGGCTGTGTTTATAATCAGATTTGTTCGTGACCGATATGCACGGGCAAAACGGAGATTTGTCCCCTGGCTCCTGCCTCGCCCGCTTCACGAAGGTCATCCCGAGGGAAGGAGCCCGTACACGTCCCAGCATGAATCCCAGAGAAGACAGTGGCTACGGCTCAGTTTGGGTTGTGCTGTTGCCTGGCGGCGATGACGCCTGATGGATTTGTGATCCGGTTCTGCTTCGGTATTCACTCACGGTGATTCACACAACGCGGAAAGAGCAGATCTGGCTAACCAGGCTCGACTCTTCACGATTATCGACTCAATGCTTATTACCTGTTTGTACCACTACAAAAACCCCGAAATCCATTCATGCAGGCTCACTATTACCTGCGAACTGTTTTCGGGATTGCATTTGCAGACCTCTCTGCCATGCGATGGTTGGAGTTCCAGACGATACGTCGAAGTGACCAACTAGGCGGAATCGGTAGTAAGGCCCCCTCTTTTCATCTCACCCACAACGAGCGAATTAACCCATCGTTGAGTCAAATTTACCCAATTTATTCAATAAGTCAATATCATGCCGTTAATATGTTGCCATCCGTGGCAATCATGCTGCTAACGTGACCGCATTCAACTGTGTCGGCTTCTCTCTTCGTTGGGATGCCTCGCCAGAGCTTCATACAGCGAGGGACATGGGGTAACAGGTGGGTTGGGTAAGGTTTTGGGATCGCGGGCGGAACCACGGCGATCCGTCCCCGCGAAGCCTGAATGCATGAAGAGTGCTGACGCCTTTGCATCTTCCGACTCCCTTCTACGACAACTCTCCCCCACAGCTCTGTTTGGCAATATCAACCGCACGGCCTGTACCATGGCAATCTTGCATCTTGCCCCCGGCGTCGTCGCGGCACTACGGCAATAATCCGCATAAGCGAATGTTGCGGCTAATTTGCAGTACTTTGCCTTAGTATTCCTTCAAGCGGTTGCCACCACGGTATTTCCCATCCATTGTGCAAATGCATCAGATAGTTGATATAGCCTTTGTCGTCGTATCCATGAGTTCGTGCTTACCGCAGAATGCAGCCATACCGAATCCATGCTTGATCATTGCGTATCCCCATAGCAGCCATCACATCAGTACCGGAAAGAGTCAGAAGCACGTGGCCCGTGGTGAGTGGTCGCTCATCATCGGGAGCTTTTGGCGAATGAAATTTATTACCACGCTTTCGAGTCGCCTGCCTTCTCCCTGTACCTGCGATCGATGTGCCTTCCCCGCAGAACACTGCGCCGGTATCGATATACATTTGGTTGGCAAACTTGAGTGGTTTCACTGCTGGCGTATGACCAAAGATGAACGTGTCCCTAGCTTTGATTCTTTCACGATCCCGTTTTGTGAGTTGCTGATTCGCATTAGAGTTCGCGCAACCCCACAGCTGAGGCAGGATAACCGCTTTCCAAACTCGTATTCGTCAAAGGATAATCGGGGCAGATAACATATTTATCTTTGCTCACCAGTTCGATGATTAACGGAAGTTCATCTGCTTTATGGGCAAGAGCTTTAGCCAGAATTTCTTTGTCGTAATTCGATTAAAGAACCAGCCCGCCATTAAGCAGCCAGTGATTAACGTTTCCACGCTCTGATAAGCCATCAATCATCATTTGCTCATGCACTTCCACGTACAGCTCTGAACCAGGGAATGTGATTAATTCCAGGCATTCAACGTTCTGCACCACGATCAACCAAATCGCCACGAGATAAGCAGGTCTTTTTGTTGTCGAATCCAATCGTATCGCGTGTCGGCGCCTTCATCCATTCGGTTCGTGCCAGTACGCCAACTACCAAATATTTCGGTATTTGCTGCCATCAATTTTCGTAATAGCGCCAATCTCTTTCACTCCTCCATCCGCGATGACGATGAGGAACGTCGTTGACGATGGCGTGCATTTTCCCGTCTTTATCATCAACGTATTTTTCTGACGGTCACCGCGACCCATTTCAGTCGGGCGTATGCCTTTACGCTTGCGTGGTTGAGCGCAACGAGCGTTTTTACTGAGAACGTCATGCGGCCTCACTTCTTATTTACTCGGTTATTTGAGTTTCTGTTTATACTCTGCCTTGATCGCCTTTGCACTCTTCGGAGTGGCGATGGCGGTTATGGTTTTGATTCGATTTTCGTCTACTGCTGCCTTCCTGCCCGATGCGGCTAATCAGTTCGACGCGATACGCGGAACGAGGATTTCCGCTTTGTGCTGGTTGCACACGCATTGCTTGTGAATATTGCGTCTCATTAATCGGAGTTGAGCTGCAGCAGTTATTCCGGTAATGTCGGCATCCCACTGAGCAGACGTAGTGAGCTTCAGGGCACGAGATACATGGTAAGTCGCTTCTCTTCTGCCTGACTCGGCGCGTGTACGGCTTGTTGGCTGTGTTTAATCCAGTAACTGATCGGGGCTTTAAGGCGAGTTTTCGAGTAATCTTAAGTTTATCTTCTGTTTATTCTTAGCTCCTCTCGTAGTCCGTTTCTTCTCTCTCTGCTGCTTTTCCCTTTCGCGTTCTTTACTTCGTCGTTCAGTGCTATCTTGGTTCCAACTCGAGAGCACCACTAGCCTGATTAGAATGCATGTGAAAACCATTCCCGGCATTCATCGTTTTACATCGTCGTCTTCGCGCTGGTTTAGCCATCATCTTCTTCCTCGTGCATCGAGAGGGTCCGGGATCGAATTGGGCGGCGCAGTGCTCACACGTGAACTTCCAGCACATGCAGCTTCTTCGAACCGCAGTTAGCGCACGTTAAGCTCGCTCGACGCTTTCTTGTTCGTAATTCGATTTGGTAATCACCTTGTTTTCCTCGCACGACGTCGGCTTATCACCGGATATCCCACAGGTAGAGCCGTGTAGTCCATTTTACGTCAGATTCTTTGGGGGATTGGCTTACGGGATTTATTCTCTTCTGCGTTCCTCGTTGATGGCGGTTTGCAGTCGCCAGGATTATGTCGGTGATACTTCGTCGCCTGTCTCGCCACACGTCCTCCTTTTCCTGCGGTGGTAACACCCCCTGTTGGTGTCCTTCACACGGAGACACCATCGATTCCAGTAAGGTTGATTTGGTCGGAAGCGGTTATCTTCTTTGCATTCACCGGACCGATAACATTGCGAAGCAGCAGCTTCCTCCCGAAGTCGAAATCAAGCTGCCCTCCAAATATTCGCATGACTCAGAACAAGAGCCGGTATCGAATCTTTAGCTGGTACCATGTCTATACAGGGCTTGATAATCATTTTCTGAATACATTTTCGCGATACCGTCCGACATTCTTCCTCGGTACAGTCACGCTCCCGTGGCTTTAGAGTGATCCCGGAGCTGATTGTTACAATGCAACCTCTAATGCCCTCTACGCCCTGCAATCCCTCCAGCTCCTTTGCGGCTTCCCCGATTTGCGTTGATTTAATGCAGAATATGCAGTTACCGAGATGTCCGGTATTTGCAAATCGAATGGTTGTTGCCTTCGACCATGCGGAGCTGTTAAGTCTCGCTCGGATCTGACATTCAGCGCCAGAGTATCTGGTTTCCAGGCGTGAGTCCTTAGCCTTAGCCGCTTCGGGTTCATCAGCTCTGATGCCAATCCGACTTAGTAATTCCCTCGCCCGAAATGGTCATCACAGTATTTGGTGAGGGAACGAGTTTAATCTGTCAGTGCAGCAGAACGCGCTCGACGTATGGAGTGCCATATTTCTTTACCATATCGATAAATGGGTGCCAGAACAGGCATTCGCGTCTGAATATCCTTTGGTTCCCATACCGTAACTACAGTGGGGGTCCCCAAGCTCCGCGGTTGATATCAACCTGCAATACGGTGAGCGTATATCCCCAGAACTTCACAACTTCCCAGGCGACAACGTAATGCTGTACCTGTCACGTTCAATCTAGTCATCCATGAACGTAATGGGAACCGAGGATTTGCCCGTCGCCTCAAGCGAGAGCACAGTCGTGAAAGTGCGCACCGAGAAACTAACGACATTTATCATGCAGCCCTGTCTCCCCATCTCGCTCCACTCCAGAGCCAGTCTCGCTTCGCTTGACCATTAACGCCACGCTCTGTACCGAGGAATGCCTGTAGCCTCGCTCTCCTCCCAATTCCCCCATCGTTCCTGCCTTGCTGGCCTATTACCACAAAGCCATTCAGCCGGCAAGGTTAGGAAACAACCCTGCTGCTTTAATGCTGCGGTAAACACTTCCAGCTTCTTGCATGAGCCAGCGAGCGACCATGCCATTCAACCTGACCGCCAGGAAGGTCTACACACATGAGGAAGTTTACTCCGTTTGGTCTCAAGCTGCGGTTGCGTTTCGTGAATGGTCATACGATTGGTTTGGTTGGTTCTGGAAGGATTTGCTGTACTGCGTGAATCGTAGTTTTTGCTGATGTGCTGGAGATCGAATTTCAAAGGTTAGTTTTTCATGACTTCCTTCCCCAAATCAAATGCTTGTGATTACTACGGTCCTATTCTAGCTACCCCATCCAAATAATTCACCGCCAATCATTCATTCACGCGACATTCCTAAACCATGGCGCTCATCTCCTTCTTATTCTCCTGCTTAACGGTAATACAACCGTTGCAGCTGTTCTTCGATAACCGACAGACCCGCCCGCTCGCTCTCCCCTCGGTTCTCCCGGCGGCCGCCTGTTAGGCGGCAAAGGATATGGTGGCATGCACAGACCCAGGTTCGTAGCGTTAGTAAGCATCTTTCCCCCTTTCAGGGTACCGCTGCTTGGTCGAACTAGCTCGAATTTCTGCGATCTGCCAGCCGGCGCACGATTTACCGGTTGACATGAACTATTACGGGTCGTTAGACCCCGCAGACTGGTTAATTCATTTATATGGACATTGATAATTTGCCTGATTAGTAATCCTGTACGTTAATGCATTTTACCGCATAGTCCTAAGCTTCCAGCCAGAGGCGCTATTAACTGCGTCACGATAAGACTGGCAATGGATAATTAGCCTGCTCCGGCACTCAACGAGAGTAACCAGCTCGCGTTGAATGATCTTAAGTCCTAGGTAGACTGTATCCTTCTTATGCGTGATTCATGCAATCAAACTTTCCGGCATCTTTGTCCGATGGCAGAAATGTATGCTCCGCCGACGCGTACTGTTTCCTTATATCGCTTCATGCGGCGGCTTCTGTTTTCCCCGAAATTGTAGACGATTGTGTTAAATCCCACTTTCGTTCATCTGTGTTTGTCACGAGTCGAGTTATTTGCTCTTAGAAATGTTTCATTCACACGGTGAACAAGTGATTTGCGCTTGTTGTGCCTTTGGGCATTTCAGGGACCCGTTGTGATTAACGCATTATGGCGACCTAAGAATTGATAACCATCTTAGGGCTTTTCATAGACCCGTTGTAAAGGCCGCGAGAGTGTCAGGTCGTATATCTGGATGCCGGCTCAAGGCCCCGCCTGTCCCCGGTAATCGTTTAATTTCGAGCCGTCACTATCGCGGCCAGGCCGCGAGCTTAACGTTACTAAGAAGTCCTGGACTTCAGTTGGACAGCACAAGCTCTTGGCGGTATATTATACAGTCTTCACGGACCATGTCACTCTACTAAATTCGATATGCGGCGATGCTTGGTTTTCAGGTGGATTCTTCGGTTAGTCGCTGTCCCCACTTGCTGCCGCTCTGAATTGCAGCATCTCATTCACCACAGAAAGGTGGTCTCTCAGTCCAGGATTCGCCAGAATTCGGACGAATAATCTTTCTTTCTTTGTAATAGTCTTTGTCCCCTGTTTTGAGGGATAGCAATCCCCGATTTGGCGGAGTGTATCCATCTACCCCTAGTTTGGGGAATTTCCTCGTTTGAGGGATGCATTCACTCTGAGATGTTTTATTTGGGTCCAAACATGCCGCCTTGCTTAATCGGCTCTTCATTCTGACGAGTTCTAACTTGGCTTCATTGCACCGGTTGACATAACTTTGATCTCAGCAGTTGAGAATCGGTGATTCTGTCATTGGTTTATTCCACCCATAGGTTTACGCAGAACCGTCAAGCAGCATTTGAACTGTCGCTTGGTCAGATCTGCGCCCGAATAAGCCTCAAGCAGCATATTTGATAGCTATTGGCGTGACCATCATCGAGATCTGCCGGTCGCTCCTCTTCCTGGGATAGGTTCTCCTGCCGACAAGTTTGAGTATTTGCTGTATTTGTCAGTAATGACTCCTGTTGATAGATCCAGTAATGACCCGGAACTCCATCTGGATTTGTTCAGGACGAACGGTTGCCGCCGGGCGTGTCTTGTCTGTAGGATCGCTAGACGGACTTGTCGCGCCAATCGAGCCATGTCGTCAACGTCACGCCCCATTCAAGAACAGCAAGCAGCATTTGAGAACTTTAGAATCCAGTCCCTCTTCCACCTGCTGATCTGCCGACTTATCAACGCCCACAGCTTCCGCTCTTCTCAGTTCCAAGCATTGCGATTTTGTTGATTCAACGGTCGCATCTCACGCGGTCCGGCCGGAGCGCGTTTGAGTATTGTGAAGAAAGATATGTAAGTATTTCCTTAGATAACAATTGATTGAATGTATGCAAATAAATGCATACACCATAGTGTGGTTTAATTTGATGCCTCAGCGTTTAAGGGGGAGTAAGAGCGGGTTATTTATGCTGTTTTTGTTACTCGGAGAAGGGCTATCTTCCCTCCTCCAAGTCGTAACGGGGCTCCATCAGCGTTTATAGTTAAAACGTGCGGTTCATTCACTTCTGCGTGGCTTCTTGGATAGTGTTTCGTCTCGCGTGATACTATAGATCTTTAGCTGTCTTGGTTTTACGCCAAAGCGCATTGCATAATCTTTCAGGGTCTGCGTTGTTCCATAACAACCTCCTTAGTACATGCAAGCATTATCACCGCCATGAGGTAAATAGTCAACACGCACGGTGTTAGATACCTTTATCCCTTGCGGTGATAGATTTAACGTATGAGCACAAAAGAAACCATTAACAAGAGCAGCTTGAGGACGCACGTCGCCTTAACAAGCAATTTATGAAGGAAAAACCCGACTTGGCTTATCCCAGGAATTGTCGCAGACAAGATGGGGATGGGGCATTCAGGCGTTGGTGCTTTATTTAATGATCGGCATGAATGCACTGATAAAGCCGCCGAGGAATTATCGCATCTACAAATTCTCAAATCAGTGTTGAAGAATTTAGCCCTTCAATCGCCAGAGAAATCTACGAGATGTATGAAGCGGTTAGTATGCAGCCGTCACTTAGAACAGGTGAGTATTAATACGCTGTTTTTCTCATGTTCAGCAGGATGTCTCACCTAAGCTTAGAACCTTTACGACCACGCTCTTCGGCTGCGGAGAGATGATAAGCACTACAGACAACGCGTCGCTTCTGCATTCTGGGCTTGAGGTTGAAGGTAATTCCATCATCGCACCAACAGGCTCCAAGCCAAGCTTTCCTGACGGAATGTTAACTCTGTAGTTGACCCTGAGCAGGCTGTTGAGCCCAGGACCTTCTGCATAGCCAGACTTGGGGGTGATGAGTTTACCTTCAAGAAATGATCAGGATAGCGGTTCAAAACGTTTTATTACAACCACTAAACCCACAGTACCCAATGATTGCATGCAATGAGAGGTTAACACCCAAGCAGACGCCGCACA	*	tp:A:P	cm:i:1139	s1:i:6169	s2:i:0	zd:i:1	NM:i:533	ms:i:12626	AS:i:12626	nn:i:0	SA:Z:utg000001l,10329,-,10317S614M95I28S,32,231;
+55	2064	utg000001l	10329	32	10317H16M2I5M1I10M3I6M3D2M1I1M1I7M1I16M2D12M2I15M2I20M4I1M3D11M1I14M1I3M2I2M2I4M4I3M7I3M1I14M4I12M2I1M1I6M5I1M2I5M2D7M5D14M1D16M39I29M3I5M4I4M1I2M1I2M2D14M1D9M1I15M2I8M1I6M7I3M1I7M1D9M1I2M1I3M3D4M1D2M1D7M2D8M1I3M2I2M1I8M2I12M2D8M1I9M3D15M3D5M1I6M2I4M3I9M1D10M1I5M2I4M1I24M1I1M2D6M2D9M1D16M6I6M1I9M2D10M1I11M1I13M28H	*	0	0	CGCACGGTGTTAGATACCTTTATCCCTTGCGGTGATAGATTTAACGTATGAGCACAAAAGAAACCATTAACAAGAGCAGCTTGAGGACGCACGTCGCCTTAACAAGCAATTTATGAAGGAAAAACCCGACTTGGCTTATCCCAGGAATTGTCGCAGACAAGATGGGGATGGGGCATTCAGGCGTTGGTGCTTTATTTAATGATCGGCATGAATGCACTGATAAAGCCGCCGAGGAATTATCGCATCTACAAATTCTCAAATCAGTGTTGAAGAATTTAGCCCTTCAATCGCCAGAGAAATCTACGAGATGTATGAAGCGGTTAGTATGCAGCCGTCACTTAGAACAGGTGAGTATTAATACGCTGTTTTTCTCATGTTCAGCAGGATGTCTCACCTAAGCTTAGAACCTTTACGACCACGCTCTTCGGCTGCGGAGAGATGATAAGCACTACAGACAACGCGTCGCTTCTGCATTCTGGGCTTGAGGTTGAAGGTAATTCCATCATCGCACCAACAGGCTCCAAGCCAAGCTTTCCTGACGGAATGTTAACTCTGTAGTTGACCCTGAGCAGGCTGTTGAGCCCAGGACCTTCTGCATAGCCAGACTTGGGGGTGATGAGTTTACCTTCAAGAAATGATCAGGATAGCGGTTCAAAACGTTTTATTACAACCACTAAACCCACAGTACCCAATGATTGCATGCAATGAG	*	tp:A:P	cm:i:11	s1:i:60	s2:i:0	zd:i:2	NM:i:231	ms:i:200	AS:i:219	nn:i:0	SA:Z:utg000001l,30,-,79S7791M1D3184S,60,533;
+56	16	utg000001l	36327	60	364S11M2I6M5I15M3D15M2I2M3I5M1D3M1I9M2I10M1D12M2D5M1I2M3D8M1I2M3D10M1D2M1D6M3D7M2D4M1I9M1I1M2D4M2I9M1D7M1I2M3D21M1I8M4D4M1D2M1I5M2D5M1I14M3D11M3I6M1I15M2D4M1D3M2I5M5D27M5D1M3D10M2I5M1I10M2I1M1D15M2D12M3I13M1D1M1D5M2D3M1I3M1I6M4D11M1D5M1D2M1D6M1I1M1I4M1D3M1D16M2D13M1I6M1I6M1I10M2I5M1D2M1D15M3I19M1I8M3D11M1I22M2D6M1D3M2D4M2D8M2D1M2D8M1D3M1D11M1I10M1I2M2D6M2D8M4I4M2I1M1D19M1I5M3D12M1D3M1I15M1I7M1I7M2I18M1D10M1D5M2I4M4I6M2I5M3D8M1I5M1D6M1I12M2D12M3D7M2D6M2D14M1D12M1I3M2D7M1I1M1I6M1D1M1D3M2D8M4I8M2D14M1D1M1D7M2D16M1I21M1D5M3I27M2I10M3I4M1I5M1D1M3D10M1I13M1D1M1D6M4I2M1D9M2D3M2D1M1D11M1I6M2D7M1I7M2D1M1D7M4D12M1D13M3D9M1I1M2D3M1D7M1D2M1D8M1D30M1I4M2I17M1I1M1I1M3I3M4D1M1D11M1I8M1I6M4I1M1I4M1D9M2I4M1D13M1I7M1D6M1I14M3D6M1I30M1D4M1D7M1I11M1I13M1D2M2I6M1D7M1I1M1I6M1D15M1D1M1D3M1D2M1I15M6I5M2I2M1I6M4D16M3I18M2D20M3D9M1D10M1I11M3I1M1I13M3D19M1D10M6I2M1I7M1I7M1I16M2I1M1D7M4I5M1D9M1I3M2D4M1D1M2I5M2D2M1I6M1I11M1D4M4D19M1D1M1D9M3I10M2D10M1D24M1D4M1I4M7I4M2I15M1D12M1I5M1I1M1I16M2D3M7I1M1D14M3I7M4I15M2I9M1I8M2I3M1I3M1D3M1I3M2D10M1D7M1I9M2I3M1D18M1D9M3D20M1D3M1D16M3D13M1D13M1914S	*	0	0	CCTGGATTAAGAACTTTTAAGATCTTCACGAACTGTATGGCTGCGTATCCAGCAGAAATAATCCAGCTGAGGTGTACCTCTTTAGCAGATCCTCCGCAGTTAGTCTGCTCGTACCCTGCGTAAGAGGTTTCCGGCGGGGGTATCAGGACGACGGATCAGATCTAATGGATTTAAATGCCACTCATTTAGCTGGAGGCCTTCAGCGTTTGCCTAGTGTGCCGCGGTACTAGATGCAACATTTATGCAGCGCTTGTGAGCCTCTGTTGGACCGCCTGTTTCACATGCTTAAACGAGGCATTCCAAAGTTACGGACTGTTCTGGTGACAAGTAGCAACGGGTACCCCGTCAGCCGCGACGTCGCCACCTGTGGTCAGCTATTCCCCGACGGGAAGGCTTCACGGACGTCAAGCTACCCGCCAAGGCTTACGCAGAGAAACGCGCCCAGTACTGTGAGTATGGACGCAATCAGCCTGTACTTACCCCTCGTAACCAGTGCCTATAGACCTGTGCTCTTGAGTTAAACGTCAGCCCTGCTCCTGCCCGCTCTAACCAACAGCATACGATCTGCCGTCATGTCCCCACTTGCCGCAAAACCAGCGTTTTGTTGAAATCGGGTGTGAATTACTATCTCTTAGCCAGGCATACGCCAGCGCAAGGCTTCACCGCCAGCGAGGCCCCCACTAATGGCAGGTACCGGCAAGCGAACCCTAAAACATGGGGGATGACCCCGCCAAATTATACTTTAGCTTGAGTGCCCCTGTTGCAGAGATCACACGGACTTTGCCCGCTGCAAGCTGCGTGGCAGTCCGTAGCAACTTGCGGCAGCATACGCATGGGGGCTTTATTCACTAAGACGAGAAATCTCCCGCTTTCTTGGTTCACCTCGCCTAGCTGTTGATAGGCGACTGTTCAACGACTGCTGGCTTTTCACATCACTTTCGGGTACCAAAAGGTGACGCCTGACTGGCCGCTTAGTAAATTTAGTGGCATGAGACTAAATCAACGACTGAGTACGCCTACAGCGTCACTATACAGCGTAACTCTACCCTGCGATCCCTTCTGATACTGTCATCAGCATTACGTCATCCCTGCGTCATGTCCCACACATCCGGGGAAGCGGGGATAACTTCATTCCCGTTGAGCCAACGGGACACCCCTCTAAGCGGCAAACGCCCTGCCGCTTTCCTGCATCAGCACATCATCTTCAGGCTTGCGTCAGCCCCCACGCGTTGAGGACTGAAATCCAGCGATGCATATTCGAGATCTGAAAATAGAGGCCGGACGGTACGTCATACTACTAGAAAGTGCGCATATCCCAAAACATGAAAATAATGGGTACTGTAAAAGCGGTGCCAGTCGGCATATCGAGTCCAACTAGACCCCGGCAAGCATGGCACGCGTCAGCCGGGTCTCTACCCGCATCTAGGGTTTCAGGCCCAAAACTCAGCTACGTCGAAATGACCTTTCCCGCAACGTGCGGGCGGCCAGGCGTCCTGTCTGTTTTAAGGATGGTCACAACTCATACATACAGACAGCCGGTACACGTTTGCTAATGGAAATTGCTCGTGGCCAGCGTAAGCACTTCCTGCTCAATCTGTTTAACCGTCATTTCATTCATGGACGGCAGTACAATTGCTTGCGATGGTTACCGCCACAGCGACATCGCCGAGCCAGAACGCGCCGTCGTACCCCGGTGTCCGCTCCCACAGTAACTTCTAAGTTGGTGTCTCACGCCTGTTTATCCTTGCCGTTTCATGAGCGAGATGCTAATGCGGTGCAGGGCTGACAGTTCCAGAAAGCGTGACGTCACACCGTTGTTCAACAGTGATTCGGTTTTCAGAGACCTGTGATCGCGGATTAACTGGCGGGCCTGTTGACGTAGTCAATTTCTGCAACCGCAGCAAACTAGTCACCATGACCTGAGCCACGGAATGTTGACCTTTGCCTGCAGCAACGCGTTCACCGTATATTGTCATACATACGATTAAAGGACCCTTTTGTTTTATCCCAAGACAAGCACGAAAGGGGCCTCTGTGTCGGTCTACGCCCTCCCCGGCCTTGGAAGGCCGTCACGTGGTCATCGTGGCGGCCTTTGCGCAGGTCTATGGCAGCAGTCACGAGTCATGCCGGTTGCCTGTTACCGTGCTGCGAGATCTTCTGGTATTAGTGACGGACGTCCACATTGGTATTTTAGATTTAGGTACTACTTCCTTCACGTCACCGACGCTTACCGATACTGCTGACCCAGTACGGAACACATACGACCTGTTGAGGTTCGGGAAGCGTCACGGCGGCTGACACTGTCAATGCTTGCTTCATTAATCAAACCACGCCAGCAGGCCGCCTGCTGCCCCTGCTCTAATGAGGACTAGAGCGCGTGAAGCTGGTATCTGGCGGCAGATTCTTCGCCGTGCCCGGTCGAAGTCAGTCTGCATGGTCATCGAGATAGCTGTCGTCATAGGACCACCGTCAGTTCGCCGGCGTCAGTCTTTAACTTTTGCCACAACGAGACCAGTCAACGTCTGAAAGCGGATTTCGGCTACAACTTACGGATACGCTCCGTAAAGTCACCACAGGGTGTCCCGGCACCTTTCACGGGCGAAGTCGGCGAGGATTTGGTACAGGCAGCGTCCTCACATTTCACTCATAGGTACCATAATCCGTACAACCCTCTCCACGGCCCGCATCATCGTCTGTCGCGCCTTAGTCCATAGCCGCTGGCCACCATACTGGTACTGAATCTGACAGTGCCGGGATACGCTCATACGGATAAATCCGGGCAAACCGCATCGACTCACGTGTAGCGACAAACTCGGCTAAGTGGAGCAGCAGGAAAACTTCGATATGCAGAGCCTAGGTGCCATATCGCTAGTCCGCTCTTCGCCGTGTATTCAGGGTCGAGGCGAGATAAACGCGACTGTAGGAAAATCGCGCCATACAACAGGGCAATAAGTCAAACGTCGCCCCGGTGTTAAGGTGCTTCTTCTAATTAAGTGGAGTACGGCTGCACGCGTCCGTATGTTTCATCGCTATTTATTACCATCCTCAGTTGTAATGGTGCAGCATAGCCCAGCTCTGTTCGGAAGACGTTCACTAGATCTTAGATAATATTTTGTTTAAACGCCGTGGTCACAGCACCGCCATCGGATTTTCACCACGACTCGGGTCAACGGTTTTCTCAGCAACGAGGACCAATGGCCCGGCCATTTTCAGTTGCTGAATAAACGCGCCGGGGAATACGACGGTTACCCACCACAGCACATGCCGCCACCTTTCAGCGAGTAATGAACGCTGCGCTCGTAAGGCCGCACGCGCTCCCGCGGCGAAAGTGGACCCGGCAATCCCCGTCTACTTTGATTACGGGAGACTCGTGCCTGTTTTGACCTGATCTTATCGTCAACCTGACCTTTCGTGCTTCCTTTACAGTTCCGGCGTACCTTTGTCTCACGGCAGTAATCTGTGACGGATCTTGCGTTTGCGATAGCAAGTGAAGCAACGCGGTTAATGGCCATTGCGGCCCAGCACCGGGAGCGCGTTTTAGTGATACGGCTGAGGTTTTCGGAACTATCGTAAGACCTTTTGGCCATACATGCGTCGGTCGACGGACGGTTACGGCAGCGATCGCCCCGTCCAACTCAGAGATGACAACTTCCCCATCATCTAGCGAACCCGATCCCAGAAATTTCCTCACCCATCTTGCCCACTTCGACGCATTGACGCACTAAGCCAGTCCGGACAACAGGGACGGGAGGGTATGCAACGCCCGCACGCTGTCCGGCATAGCTGGTATTTTCAGGTATAGTAAAAGATACGCCCACTACGTAACTGCTCACGGATGTAATGGTGGCTGACGTTCCTACGTACCCGCGTATCGTTTCATCGGCGCGGGCAATGGCAGCATCGAACAGGTCTGAAGAAATCAGCCACCTCCCGTTATTGCATTCTGGCCAGCGCTCTGTCATTTCGGCTGCCACACGGCAGAGACGAAACGCCGTTCCCGTAAGCACAAAGTTCGATACGATTAATGCGGTGGTGAATGCATCAGTATGCAGCTTCGCTACAGTGCCACGACCGTGACCGTTACATATCCAGAATCACGGTATCCGGCTGCGGTAGGTCCCACCTCATTTTCCATGTCCGTCAGCACATTTTCCCGTAGGGCCAGGTCTTTGAACCGGCAGTTTCATCCGTGTCACTAAGCCTCCGCCTTTCGATAATCGGAGCGCCAGTTCTTCTGTCTTTCGTTACCGTCGACATCACGGACCTACGTCCGTTGTTAGAGCGGAGACGGGCATAAGTGAATCACGTTGTCATCTTTCGTCACTTAATCCTCTACACAGAAATACACGGCCCGACGAGTCTAATTGACGCCGTAAATACGACGCCAGGTACTACAGAGACCAGAATCGTGAA	*	tp:A:P	cm:i:8	s1:i:101	s2:i:0	NM:i:656	ms:i:670	AS:i:670	nn:i:0
+57	0	utg000001l	43578	60	80S9M1D11M1D12M1I1M1I9M2D6M1D4M1D2M3D4M4I6M1D7M1I16M1I1M1I22M2I3M1I3M2D3M1D18M1D8M2D4M1I6M1D6M4D3M1I1M3D6M2I12M1D10M1D4M1I4M3D3M1D58M1I3M1D24M2I8M2D10M3D7M1I5M3I2M2I2M1I2M1D7M3D15M1I21M1D1M1D2M1D2M1D8M2I3M1D6M1I14M3D10M2I6M3D16M1I13M1I11M1D2M1D6M1I5M1D7M2D5M1I3M1D6M1D20M1I21M3D5M2I6M2D19M1D8M5D8M1D11M1D15M1I4M1I34M4I8M1D1M2D13M1D2M1D5M2I5M2D3M1I18M2D4M3D22M2D16M1I16M1D19M3D8M1I17M1D1M2D7M1D14M3I8M3D8M2I12M3I27M1D14M2D13M2I11M1D22M2D8M2D9M1I19M2I4M1D1M2I3M3I1M1I6M1I10M1I5M1I14M2D16M25S	*	0	0	GGTAGTGTTATGATAGCGCCTGCAGCGTTTAATGCGCCGCGACGCATGGCCCACAACCGTTCACGGACTGAATTCGATTTAGCTCATCTGGCGTAATTCCGGAAAGCTGCTCTAGTACGAGACACAGCCCGGCAGCATACTGGACGCAGCGATACTGACTAATATAGAGACTGGACACGTTATCCGTATCCTGAGCCGTCCCTGTCAGTGAGTCACCCGGCATCAGGTGGGTACTTTGCCTCCCAGCCAAGCGGGCGTAGTAATACGCGGCAATTTCACCAATCCAGCCGTCATGGGTCCGCTGCTCCTATCTGTTCCCACCGAGAATAAAATGCATCGCTGACTGCGTATCCAGCTCACCTCAATGGTGGCGGCATACATCGCCTTCACAATGGCGCTGCAGCTGCTTTCTGCAGCGTGTCCGTCAGGACTAGCATCTTCATCTGCTCCATCACCGATCAAACACATTTGCACCGGGTTGCCGTCCTCTACACGGGTTCAAAACGTGAATGAACGGAGGCGCGCCGCCGGGTACTAATGGGGTATCCAGTGTCATTTTCTGCGGCATCCAGCCAGAGCCCGTCCCTAGTGACGTAATCCCATAGGCCGGACGCTGTCATTAATCTGCACACCGGCACGGCAGTTCCGGCTGTCGGTATGTTGTTCAATTGTGATGCCTTCGGGCTGACCATCGAACTTTGCCCGCAGGGCCGCGACGAACTGGTATCCCCATAGCCTGAACGAACAGTTCACCGTTAAAGGCGTGCCCGTAAGGCTTCCCCCGAATCATCATCTAACGTGCGCGTTTTCGGCTCAACGTCAATGCAGCAGCAATCCTCGGCAAACTATTTTAATCATTGCTCGCGGGAAAGGCACGGGCTTCTTCCTCCGATGCCAGATAGCGCCAGCTTGGGCGATGACTGAGCCGGAAAAACGAGGGTATATTAGTGCAGCTCTAGGATGGCGTTGGCATCCGAGCGTTATTGCGATACCAGATCGTCTGCGCGGGCATTGCCACGATAAAGTTGGGCAACAGGGCTGCATCCACACTTTCACTCGTGGGTTCCACGACCGCAACTGCTGGAAATGCTGCCACCGCCGTGATAACCGGCATATTCGCAGCACTTGTAGACGGTGCGGTTCCAGCCCCAGAAGGGTGGGAATGGTGGGCGTTCATACAGATATCCTTGCCTTGGCTGCGTGATCCGTTGTC	*	tp:A:P	cm:i:20	s1:i:159	s2:i:0	NM:i:275	ms:i:700	AS:i:700	nn:i:0
+58	16	utg000001l	44385	60	2513S13M2I2M1I7M1I15M1I13M2D4M3D8M1I21M2D8M2D6M1D8M5I4M1I7M5D6M1I9M2D2M1I4M1I2M1I12M1D8M1I4M1D2M6D11M1D4M1D5M1D4M1D2M1D2M2I13M1D6M3I12M2D9M6D1M2D2M3I6M4I9M3D7M1D5M3D6M1D13M3D4M1D2M1D21M2D13M1D16M2I3M1I10M2D4M2D5M3D6M6D18M1I1M3D10M3D24M2D8M2D2M1D8M1I10M10D6M1I9M1D5M1D2M2D4M1D2M1D13M3I2M1I5M1D7M2D3M1I3M2D20M1I6M3I4M4D4M2D3M2D7M2D19M1I25M2D6M1D4M5D6M1D3M1D5M1D6M1D5M2D13M2D11M1D2M1D9M5D11M2D14M1D6M2D9M6D11M4D11M2D1M1D1M1D6M1I3M3D2M1D3M3D3M1I10M3D2M1D14M4D5M1I12M5D2M1D2M3D4M1D7M2D8M1D8M1D1M2D3M1I10M2D6M5D2M2D6M2D6M10D3M8D3M1D3M3I9M1D6M4D1M1D11M2D3M5D2M1D19M1I7M1D5M1D8M2D8M6D8M2D1M1D13M7D1M1D5M1D15M4D1M1D2M1D7M2I2M1D19M4D10M1D3M2D5M3D10M5D4M3D1M2D8M1I4M2D5M2D9M2D3M3D16M2D2M4D6M2D1M2D10M2D4M1D6M2D6M2I1M1D2M1D5M1D12M4D4M1D10M4D5M1D8M1I2M2I19M3D3M2D2M5D12M1I15M2D7M3D3M1D3M2D14M1D1M1D8M1D10M5D7M1D2M2D3M1D2M1D15M2D4M1I3M1D6M5D4M2I8M1I3M1D1M1D2M2I8M4D1M1D16M4D9M1I2M2I3M1D4M3D16M1D25M2D3M1D6M2D5M4I2M1D9M1D14M3D23M2I3M1D4M1D10M1D4M1I4M2D3M2D17M10D16M1D2M1D7M3D3M2I8M3D1M1D7M1D10M4D11M2D2M2D19M1D13M2D1M1D1M1D3M1D3M5D7M4D9M5D5M1D10M1D5M1I1M2D5M1D9M1D12M1D9M1D3M2D11M5D1M2D4M2D5M1D7M10D1M6D17M2D5M1I6M1D10M3D20M1D2M2D1M1D26M2D5M3D10M3D3M3D17M1D8M5D7M2D4M1I8M1D8M1D9M2D10M1D3M3D3M2I5M1I2M1I11M1D14M1I8M519S	*	0	0	GAACTGTATTTGTATCTACTTTACGGAGTTGGCGATGTATAAGTGACATAAAATCCTATAAATTAAATCTAGCTAGCGTATAGAAGGTAAATATAAACGACCCTACGCTTACAAACGGTAGCTTACCTTCCGCTCGCTTTGGTTTCATTCTCTTCTATGCCATAACATGGACTAAACCCTGTCTAACTTGGTAAACGTAGACCTTGTATGTGGTTACCAAACCGCAGAATCCCAACGGCAGGACTAGCCCTTCACTTAGAACCGCACCTTAACGGCTGGAGGCTATTACGCTACTCGACTTGAGGCGCCTTCCCTCCTCCTCCGCTCAGGTTGATGGTACTTACTGCTTTGTAGGTAATGGTAAATAGTTTGTTGGTAACTTCTATAGACTGTTATAAAATGTATTCCCGATCATATCCTGTATATGCAGCCGTCCCTTAGCAGAACCGAGAGCGCAGTACCGCGCCTTACACCCTGTCGCTGGTGTACCCCTTATCAGGCCTTCCACGTATAAGGGGTTTGGCCGACATTCTTTCCCCGTTCGGTCCTACCCTTCTTAGCATCTCGTTCCTAGATCCTGTCCGCTCTCAAATGCTCGTGATCTAGGGTCGTCCGGCTGCCTGGTGCGGCTTCGCCTTCTATGTAAGATCATGACGGTTAGCGAAGCATGTAGAAACATATGATTTATTGGTGGTATCGTCCCCTGAGACGCGATTACTTAATCAGTGCATAATTGCATGACGGTAATGGATCGGTAATAACAAGATTACGGTTACTCTCACGATTAGGAAGCCCTACACGCCCCGCCACTTGTATAATCTCAACTAAACCATATATTAGTATGCTAACATCTTAAAAGTGGGCCGGGTACTCAAATGCATTCATTAAACGATGCAGATGTTGTAGGTTACGATGGTAGCGCTGCCGCTGTAAAATCTATAGATTCGGACCTATCCTGCCTTACCGTAAGAGCCTGTTGATAGAACTCATTACTTACTTACTCTATCATGCGAAGACTGTCGGCCCGATCTCTTCCCTCCTGCAGGCCGGCAGGCCATCTTACGGCTTTAATTAACTGTCAGGAATAGCAGAGGAATGGGCTGTCACCATTAGCTGGTTGCCTAGATGTAGAATGCGTCGGTCAATACGGACCCTGCCGCTTCGGACGGTGATAATGGGGTAGTAAAGGTTGAGATCTATGCATGCCCGTTTGACTGATCACCGTATCCAGCTCACGCTAGATTCAATCGGGCTGAGGGGTCCGGGGGCCTCCGCAGACTTCGGTTAGCTGGCTCTTCGTAAGTCTCAACTTGGATTTATACCTTATCCAGCTTCACGGTCGACTATGGCTTAAATCTAACAAACCCGTGGGCCCTTACTTAAGTAAGAGCCAGGAACCCCATGGCGCAATCCTATACGATGATGGCTGGAGGTCACTCTCCTGTTATCTGATTGATTGACCGGATCGTAAATCCTTCAAGCCGCCAGCGGCTTTAAGACCTCATGCACGGTTAGCTCACCTGGTTTGACGCCAACCCGGGCAAAATCCTCCTTATTATTACCGCTTTGTACCCTGGTGTTTATACGGCCGGTTACTATTACCGGCTCCCGTGACAACGGTGCTCGTAGTCAAATACGGCCTGATAAAGCGCCGTAGGCTCCAGTCCGCATTCAGCCGCACCGACTGGGCTTCCGAATCGAAGCGAGGAATAGAAAGGTGTCAGATAATTAGAACGATGGCTCCAGTAGATGATATGTCACCTCGCCGAAGCCACTGGACATGACCTGCTCGCGAGTCACCTAATGACGCAATGACTTCATGGACCCTTTGCCGTGGAGTAGGTCTCTAGTAATTCGGGGAAATAGCCACGAGAGACACGATCTAGGCACCCTGATACCGCACTAATGACTCTCAACACGGAGCTTTATGAGTGGCTCCTTTGGCTATTGCATGATGGCTTACTAGGAAGAGCGATTTGTGGCCTCAGACCCTCTCAATGCGACCATCTAACTCTACATAACTCATGTTTAAGCCTTCTGTTCGCTCTTGACGCCTAGAATAAATCCACTCTAACCGTGTACTATAGTATCTCAAGGCCTCTAATTGCCTCACGCGCTCTGCAATGGGTTTCTGCATGAGCACCTTGTCAGCTGTTCATAATGTAAAACACTTAAAGCCCAGTCCGCTTGTGTCACGGTTCAACGTGAAGGACCGGTGCCTTCCGGCTGCCAACGCAGCCGAGGCTAGTACTGCGTTTCTGCGCATCCAGCCAGGATACCTTCTATGGACTGACTCCCAGCCTAACTTGGTGTATTACACCTCGACCTTCAACGGCCAATGTGTCTATGCTGGCTTACTTCATGATGGTATCGGTGTTGACCATAGGGACGGGTAAACGATGGTAAACCAACGGTTCTACCTTTAAACGAACAGCCACGAGACTTTTTAACTTACTCCCCGAATCACTCGGTAAACGTTCTAACGTCAATGGAGGAAGGCAGGAAGTTCGTAAATGCCGCTTCAACCTCCGGGAAAGCAACGGGCTTCTTCCTCTCCGATGCCAGATAGCCAGCTTGGGCGATGACTGAGCCGGAAAAGACCAGGACCATTAATGCGATGGATGAGTGCGCGTCTAATAGCCGTTATCCGGTACAGAGTACTGCTGCGCGGCATTGCCACGGTAAAGTCTGCGAAGCTGCATCCACTTCATCGGTGCTTCAGAAGCTGCAACTGCCCTCAAATCCTGCGCCGCCAAGCCGTTGACCGGCCGGGCATGTCAGGCTTGTTGTCCGTCAAAGCGGGAATGGGCGTTTCATACATAAATGCAGTACCCTGCGTCGCTGTGTCATGCCGGTCTGCACTTCAGCTGGGCAATATGTCCGTCAGAGAAGCACGAGTGAATCGGCACCTGTCTTCTGTACTGTTGCCTACGTTTATTTGTCAGGTCATCAAGTGCTGCACGGGGCAGCAAGTTCTGTCGCGTTCATTCCTCCAGGCGCATGCGTAATCTGCCATGTTCTTGTTGGTTGCTGCACCATCCTCTTTCGCAGGCTTCATGCAGCACTGAGATCCAGCTGCCAGGCGGAAAGCATACTGATGCAGCCGCCAGCATAAACGAAGCAGTCGATGTGCCTCATTGCGTCCCTTTTATGTCACAGTTTTTCATCCACCATTTTCAAGTGCATTCAGCAGTCAGCTGCTGCTTCGGGTCAATAAAAGTTCCCTTCCGGACTGCCCAACCGGGAAGCGTTCATCCTTCCGGCGTGAAGCCGGTTAAATCTGCTCTGGTTGTCACGTGATTCAAGAGCAAAGCGAGTGGCTTCACTTAATGGTGCTGCAGCCTCCGTCATTAACGGATCCCTTTAACCGCGATACCAGCAAACGATGTTTTTCAGGGATTTCCAGCTCCTTTAGTCGTAGCAGATACGACGGGATATGACATTTCAAGATTCGGCGGTTATTTATTGATGGCGCCAACCTAAGCAGCGTGTCGTTCATCGTCGTGGCGACGTAATACGCCGGTCAATCAGGTCTTCACCCGGCCCGGTACCTCGATTTCGGTAGCGTCCAGCTGGGAGTCGATACGGTCAGGTAAGCACGGTTGAAACGGGCATCCTTTCCTCGGTCCTTCATCATCCTCATTCACGGCCAATTTTCTCGACCCGTGACTAAGTGGTGTCTAAAGGTTTACGTTTCCCATCTACGCTTCGTTTCATCCAGTGACACCTTAAGAGGGAACGGCTGTACGGCGATGGCTGAAAGAGATAGGTCCTGAGCTAATCGCTTCACCGGATGACGAAAACCAGAATGCCACGGTAATCCCGTCCCTTCCGATATAACGGCATCAGTAAAGTCCATGCCTATGCGGATGACGCAGGCTCTGCCTCCCGCGAACGCTATGGAGGCGTAGTACCTAGTCAGCTGCAACGGCGTCTCTTTGTCTCAATTTACAGTTCTATGCTCCCCGCAATGCGGGCAGGCAACATGAACTGGCATAAAATGCGGATTCACTCAGCACGAGCTAATCTGACAGTGCCTGTTGATTTGTGGAGCCACGGATGGACTTTACTAAGACGAGCTTCAATACGGTGTCTAGCGGAGGAGGAACGGTTTCCTGTCATCAAAAGCAGCAATTGTCATGAGACTAATACACCGACTTCACGGTAGTTTTGCTTACCGCCCAGTGCAGAAGCCACGCCCATTAGAAACGCTTCATGGCTTTACCCTTTGCCAACGGGGCCATGCAGGACGGAATATAAGAAGTTTTATCAACGTGGGTTTCATAAAGTTTAGGCATCACATGTCGGCAACCACTGTTGCTGCGATGCTCGCACCCAGCAGCATTTTGGAAGAGACCGACGGGCAGACTTCACATTCACCTCACGGATGTGTCGCTGCCATCGCATTCATGATGGCCCGTGAAAAGAATTTGCCCGCTCCTGGTATGCGGATTCGTCGGGAGCTAATTAACCCGGCCCATTCAACGGCGGTCTGTGGCTGGCCTGAACAGTGAGCGACCGGCAGCGGGACAAATGCCCGTCCTGTTAACTTCGACTGTTCTGATAGAGCTTCATCCAGCAAGCGGCTTTCTTCATGGCTTTATGATGTACTAGTTCGGAATCAACATGTCGGAGCCTCGGAGCGTCGTGCGGAAACGCTGCAGCACTATCTAGAGTGAGAAGTTCACTTCAGCGGCGATCCAACCGTCGTTTAACTTGAAAGTAGTACAGAATCGGCATTCCAGTACCACTCGTTTTACTTGCTGGATCCCCGTCCGTCATCCTCCCTGAGCGAACTTCGTCACCATTTATAGTAAGCAGCTTTACAGCACAGAGTACCCTGAGCTGTAATGCCTCAGCACTGCATTTGACTCATGTCTATTACGTCTGATGGACCTAGTGCCATAATGCTTTAGTTGTCCTTGTCGATCAAGGAAGGCTAGAGAATAATACGCACTACCCTTTCGACTTTGGTTCTAAACGTAATTCCGCTCTTTACTTGACGACTAATTTGACGAAAGAGGAGCCACCTGGAGGACTTCCACTACCGACCCCGTGGACATTAAACAGAGATCAAGAT	*	tp:A:P	cm:i:15	s1:i:99	s2:i:0	NM:i:774	ms:i:548	AS:i:548	nn:i:0
+59	0	utg000001l	25214	60	22S10M1D33M2D8M3I11M1I2M1I4M1I7M1D3M3D7M2D2M1I11M2I3M1I12M1D2M2I4M2D2M1I17M1I13M1D7M2I14M1I1M1I1M1I5M1I12M1D8M1D21M2I19M4I12M2D16M2D2M1D20M3D11M3I2M1D8M1I19M2I5M4D18M2D2M1I25M1I12M1D1M2I10M1D6M1I9M1D11M1I8M1I7M7I1M1I9M1D5M2I9M2D12M3I1M2I6M1I4M1D4M2D4M1I5M1D7M2I7M4I2M1I10M1I7M1D4M2D5M2I5M1I1M2I12M1I12M1D12M1D5M3D11M3I4M2I21M1D2M1D5M2D7M2D3M4D7M1I1M3D4M1I3M1I13M2D3M3I13M5D8M3D3M2D10M2I1M2I5M2D6M1I2M2D4M1I8M1I6M1D3M1D16M1D20M3D14M2D11M1I32M2D3M1D15M3D13M1D12M1D1M2D1M1D4M1D29M1D4M3D3M1D7M1D15M6I10M2I9M4D5M1D9M3D8M3I9M5I14M3I1M1I5M4D13M1D8M1D3M6I2M2I6M1D6M2I11M1I9M1D2M1D9M3I3M1I4M2I10M4D5M1D5M3D10M2I7M2I4M6D4M1D5M1D8M5D8M1I6M3D9M3D1M2D26M1D10M1D2M1D46M3D13M1I15M2D2M2D4M2D2M2D6M1I8M3D6M2I4M2D2M1D2M2I18M4I1M2I4M1D2M2D5M2I7M3I33M1D8M2I6M1D15M2I1M1I4M1D6M1I1M2D6M2I11M2I4M2D6M2D10M2D9M4I1M1D11M4D2M1D5M1D28M1I17M1D17M2I2M1D2M1D5M1I1M1I14M3I2M1I2M3I4M1D12M2D17M1D8M1D6M1I23M1D16M1I5M2D8M1D3M8D9M1D13M1D5M1I41M4I7M1I4M2I1M1D27M1D1M1D3M3D3M2D10M1I23M3I3M1D7M2D4M3I5M1I3M2I6M1D6M1D3M1D22M2I3M5D18M4I2M2I22M1I3M1D5M3I9M1D1M2I4M9I1M2I5M1D3M2D1M1D3M1I5M1D7M2D5M3D10M1I6M1I4M6I4M1D8M2D16M1D5M1D8M1I4M2D7M1I3M5I7M3D4M3D7M2D5M6D1M2D8M1D29M2I5M1D24M3D11M1D19M289S	*	0	0	CAGTGCTTGGGTGTTAATAGCCACTAACCGCAGAACGTTATTTCATACAACGTTTCTGCGGCAGAGCAAACCTACCGACGCGATCACTAGAGGACAAGCAGGCCTCATCTAAGGTGCAGTTGATGTATCAACTAATTCAGCAACAGGATATTCTTCCAGGCTTCCAGCAACGAGGTTTCTTCCTTCGTGCGATTCCCAATCTGCAGCATCTCGTCGAACCGGCGCAATATGGTAATGGCTACTGCATCAGGCTTTTTGTTTCTTCCCTCCCAATGCCGACAGTAGCGTTGCTTCGCTCCTTCGCCGAAGAGGTCCCGTTCCACTTCTATTCCCTCCCAGCGATAACCAGGTAAAATTTTCCGGTAACGACTGGGGTTGAGAACAAATAACGCGTGGCCGAAGCCACCATAGACGGTTTTACCCCGATGGTCTTCAACGAGATGCCACACTTGCCTCATCATGTTGAGGACAGCCACAAAGCCAGCCGCGAATATCTGGCGGTGCAATATCGGTACTGTTTGCAGGCAATAACCGTATGAGGCAAATATGCGTTACCTTCATACACCATAAAATTCATTAGTTTAGATAAGATTATAAATTTTTATGGTCGTGGTGTTCACTCATTCTGAATGCCATTATGCAAGCCTCACTACGTGTAAATGCAATGTTGACGGTGTTTAGGGTCCGCAGCGTTAACGACGGTATGGTGTCCGTGTGAACCAACATGAAGAAGGCAGTAACGCACCCAACACTGGATGCTGTCCCAATACCAATATCCCACGAGCATGTGCAAGCTAAGCAGCCACCCGTACCGACAATGAGTACTGTGTGCCCTGAACTGTCCGTTTGGATAAAGCAGCAATACCGTGTGGCTTCCTTTAACTGTGATAATTCCTGTAATGGTTGGTTCCATACTCTACTCCAGCCAGAACTGTTGCTCCTTAAACCATGTGGCGTGAGCACCGAGCCCTGTTAGTCCGCTCAGACTGTAGCATGAGCCCCGTGTTATTCGTCGATTTATCGATGTACCGACTCCTGTTGTTTCGTCCCCGTAATCAACGACGACCCGCCTGCTGTTTTCGTTAACTCGATCGGATGCTCAAACCGGCACTGTGTGATTAAGGACTTAATCCGACTCGATTCCTCAGACAATACAGCAAAGAACTAGATGGCGGGTTCCCTTGATGTCCAGCCCGCATATCAGGAAGCACACCCATGATACGGGAAGCCCGACAAGTTTTATAGCTAATTGTCAACGCCCTGCCCTGCATCAGGTATAACGCCAACGAACCACCGATGACTCGAGCAGAGTCCGAGACGAATGCCCGTACTTCAAGACATCTGCAACGGAATTTTCAGAAACTCCTGCCAACCTGAGTCAGTTCAGTCAGGCTGGCGGCATCCATTTCCCCAAATACGGTAATTTATTTTCGCCGTGAAACCGGATGCGCCGCCGTCAGTCGCATTCTTCGGTTTACCGCAAGCGCGTTAGTCATGAGCGTCGGTAAAGGCATTCATCGAGCCGCTCGCCAGTTCATTCAGCGTATTCAGTGCGTCAGGTACGCGTCGATAACATCGCAATCGCGGCCAGTTACAAAGCGGTGCGCAATCTGGGTGTTGTTCCCTAGGCCGTCTGCTGTTGGCGTTCCGGTCAGTGCCGGGACTGTCAGTAGGTCGTTCGTTCATCCATTATTAAAGCCCCGTGTAGCAGTTGCAGCAAGGGTTCAACGTCCTGTTGATGCATTAGCCTTAATAGTACCCCTTTCTCGTTGTGTCCGCAACCTCAAGCGCGACAGCTGACGGTATCTTCTGCACGTTGCCGAATTTGCACCGTATTGCCGCCGCTTCTGCAGCCAAGCGTCCTCTGCGATGTAATATACCGCATTCCCGCAGCCTCTGTCGCCTTCGTGATGCTCGTTGACGCACTCCCGCCTGTTTTGCGTGCCGCGGCAGGAGGAGTCCCCGTTCCGCTTAGTGTTTCAGATGACCTGGCATTCGTCTCGACGTTGCCTGGCAGAATTTTCTGCAGCCGTTGCCGAGGAAAACCGCCCTCAACGCACGAATGACGTATGACCGTTCGTTCTCATCATTTGCTGCTATGCGTGTTGGCCAAGCATCTCGTGCTGAAGTGGCGGCCTCTGACAGCGCCCTTCGTGGCCGCGGTAGGCAGAGGAACCGGATGAGGGAAGCTGCAGCAACGCATCTGTTGGCCTGCACGAATTGCTTTCTCGTTTCAAGGGCACTGGGCCCCGCGTTTTTAAAGGGATATGCGACAAGCACTTTTCCGCTTAGTGGCTTTGCTCATGCCTTCTGCGCCGGAGAACCTTCCTGAGCTGGCTGCACTGTCGGACGTGCTTAAGCGCGTGCTGAGTCAGTTGCGGCCGTCATACAAGGCCGCGACCTGAGCAGCTGATGCACTGGCATCGCCGGCTGATTTCTTCGCGTCCATCCGTGGTCAATACTGTTACAAATGTATACTGAGGAGGCGCGCGTCAAGAACAGTTTAAGACCGCCCCAGGGTACCATCACCGGGCAAGTAAACTTATAGTTTAGTGAGAAGTACCATTGTACACCGTTATAGAGTCTGAGTATTGAACTAGTATTTAAGCAGTCCAAGTGGCAGTAACCAGACCGTAAGTATCGAACCTGTACTGACGTACTCGAGTACGGTGTATCACCCATAGTCGATACAGATTTATAGCCTAATTGTCATGAGGGATTATTACATGTTATTC	*	tp:A:P	cm:i:20	s1:i:190	s2:i:0	NM:i:786	ms:i:630	AS:i:630	nn:i:0
+60	0	utg000001l	19497	60	3747S15M3I2M1I6M4I3M1I5M1I14M1D16M1I2M3I9M1D8M1I6M1D32M2I8M3D12M2I19M1I6M1I12M1D5M2I19M1D7M1I3M1I9M2I11M1D3M1I1M2I1M1I10M1I1M1I2M1I3M1I2M2I7M6D4M2D6M1I4M1D3M3I2M1I4M2I17M1I6M2I6M3I4M1D4M3I3M1D3M1I7M1I5M2D15M2I11M1D4M1I1M1I6M1I7M1I3M4I11M1D2M1D11M1I5M1I8M1I23M2D11M3D6M2D3M1D5M4I6M7I16M2I5M1D3M3I6M3D1M1D8M1D3M2D9M1D11M1I11M1I6M3D4M2I5M3I13M2I13M2D7M3D5M2D1M1D7M2D9M1I1M2I7M1I7M2I5M2I6M2D10M4I12M1D11M2D15M1D16M2I3M1I1M1I4M1I17M2D5M2D7M1D13M1D2M1I3M1I7M1D11M1D5M1I12M2I4M1D21M6I2M1D6M4I7M2D12M2I6M1D17M1D5M1I8M1I6M1D4M1D2M1D8M3I1M2I11M1D2M1D27M3D8M1D1M2I4M1I7M1D4M1D2M3D1M1D4M1D13M1D5M1I4M2D12M2I1M1I1M2I9M5I6M1D6M10D4M1D6M2I5M4I10M2I6M1I2M1D4M1I3M1I17M7I5M1I21M1I25M1I3M1D11M3D5M1I1M1I3M1D3M2D4M1I7M3D1M1D3M1D5M1I6M1I2M1I12M3I5M1I15M3I8M1D9M1D5M1I2M1D9M1D16M6D7M2I4M2I2M1D15M4D17M1I15M1D5M1I1M5D20M1I3M4I6M1I9M1I7M1D2M1D6M1D9M1D20M6D16M2D5M1I7M1I5M1I9M1I6M1D10M2D2M1D29M2D13M4D9M1I7M1D12M2I14M2I14M2I25M1D4M1D5M1D18M2I4M1D10M2I15M2D2M2D11M1I10M1D11M1D18M1D9M1D11M3D7M1D21M1I4M1I33M2I8M2D9M2D21M1D14M2I4M1D3M1I1M1I5M1D30M1D6M2I8M1I6M1D4M2D9M2I2M1D14M1D7M1I5M2I8M1D56M3D6M2D3M1I23M3D13M9I7M4D1M2D10M2D25M2D19M1D9M437S	*	0	0	GTGGGGTGACTTTGGACGAAATGAAGTCTACTTCTTAATCCCCCTTTCCTCCCCATACGTAATCGTACGATGCGTCACGAGTCAACTGATAACTGAAACCGATGCGATGCTACGCGAAATGACCCTTCTTTGCCTATGAAGGGCAGGGATCACGCTGATTGAGGTCAGCCCGATTATTCCAATATAATGTTGGATTAAATGAACCAAATGAATGCCCGTCTGGCTTCGATTTAATCGAAGCTTAAGAGCCCGCAAGCGAGAAGTATCCGAAATAATCGACCCTGCGGATATTCACTCGACCGCGACATCGACCCCGTTACGGATGGCATGCAACTGCATGCAGGGAATCACTCCAACTCTTGACGGCTCACGACCCTTGGAAGCCCCTATCATTCAAACTGGTTCCCGCACTGTTCGACGCCCGGGTTCTTTAAACGTGCAACCTCGAACTACCTGAACGGCACAGGATGCGAACTCGACTTGATTTAGCATGAGATAAGCAAGGCGCTCCGGCACTCCTCGGATCGATTATCCTGCAACATTCTACGGGGTCAGTAAACTTGAATCCGAACATGTCAAACGGGGTCTGCACGTGGCACGATCGACGTACTGAACTTCCTTCCCCTTCCGCATGTTGTCGCTATCAATGCTCCAAATACCCGCCAACCGGAGAGGCGAAATCGGGCCCTGAAGAAGTGTTCCACTTCCGCCCCTGCTTTACATTTGCACCGGTGGCTGGAATTAAGCCCATAAAGCACTGGCTGGGGGAAATATACGATCGAGAGAAAGCAAATGCAATTCATGCTCGTACATTTGGACGGGTTCGGCAATCCGCGATCGTAAACTCCCAATGCCGCGACTCTTAATCCCCGCCTGCTCTCCCAATGGTTTATGCGTCTGAAGCAAATCGAATGAATGCCCGTTTACCTCCGGATTTCATGAAGTTCAAGCTCCGTATTTCCAGGCCATAAAGTCAGCTTCAAGTGAGCCAGGTGCATGGTGATCCACAGCGGCTTGGGTGACTGAAAAATCCCCTAGTATTTGCCAAGCTGACGCCCCTATTGAAGCGTGAAGGCCTGCATTATGTCGTGATCATGAGCGGATGAAAAGGTAGATGGCGGTGTTTGACGAGATCGTGCCTAGTTCGAGACATCTACCCACCCAAAACTGAAGCTGACGTGAAATCGTTGTATTTGGCGATAATGGCGATGAATACCTCGGACGTACGACGCTCCCCAATCCTTTCGTCTCTCCTTCCTTCATCGTCAAGAAGGGGCCTAGGTCCCCGAGCATTTTCTTTATCCAGAAATCCACTGAAAGCACAGCGGCTGGCTGAGGAGATAATCAATAAACGAGGGCTGTATGCACAAAGCATCTTCTGTTGAGTTAAGAACGAGTATCCAGATGGGACACCTTGCTCAGGTGGAATCAGGTTGTTGAACTAGGAGCGCCACCAGTAGAAACAGACGGAACTTTCAACCGTTAGCCGCATCCTTTCACAAAGCTGGAAATGATGGGCGGGTGAAAGCAAGTACAGGGAAACCAGGTATCAACCACGGAATGCATTTGGCAGCGGGCTTCGACTTCTGGTTGTGCTTATGCTGCCGACTCAAATGTCGATGTAATCATCGATGGAATGAAAGCCCTTCTGAAGCATTGCCCGTCAGGCTAATTCTGAAATCAAAGGCACCCAGTTTCTAAACAGCAACCCGGACCCCATGTACCGACCGATTAACGAAGCACCGCGTAAACGGTAACGGTGGATTCACCACCGACTCCACTTTAAGCTGGATCGGCATGTTAAACGGCGTCTTTAAGGAATGCCATCGCCTACTCCGGCTATCCATCAGGAGTACAGGCTCCTTTATTATTCGCATTGCCCTCAAGCGTATTAACAGACAGTTCAGGAGGATTAATGATGAAGGTACGGCAGCACTCCATTGATTCAGCATCAGAAATAGAGAATTAAAGGCACTGACACAGCGACTAAATGCGCCCTCCTAAACCCAACGATAGCTATCTTGGTTCTTAAGGCTTGTTGAGTGAGATCCGATAGATGAAATGAAGACGCTGTCGTTCAGGGTGTCGACTTGTGTGCAAGTGCCAGGAGGATCTGAATTATCAGTAAACATAGAGAGGTTTGAATAGTCATAGGAAGTCGACTCTACGGACGCGACTTGGATCCAAGCATGAATGCATGACGGGAAGCGGAGACCGAAGCCCGACCTCGAATTACTTGGTAACACCATCGATTGTGCTCAGAACTGCTCATGGGGAGATGAACGGAATAAACAGGCACACGGACGCCGCGACCAGGAGAACGGAAGGGGTTGCGCTATAAACCGTCGGAAAATGCGTGTTGATAGCTTGAATGAAAGACGCAAATCGAGCTCCCATCCCCTTCTTCTCATCGGGCTAATGCGCGAAGTGTTATCCGGGTAGAAGCCGTATTGCTCTGAAGCAACGAAGTCCGTGAAGACGGAAACCAGTTTCTTGTTGTTCGCCATCCTGAAGATCTCCTGTTATCAAGCACTGCACTGACCGAAGAGTTTCTTAAGCAGTTAATCGAACAGACCCGTTGTTAGGTGACTATCGACATCATTACGCATCATTACGGGGTTGGGGGTCATAATGGGTAATTCAGGATGCAGTGAGGTATCTGCGATATGATGTCTGACGCTGGCAATTCGCATCAAAGGAGAGTGAGATCGGTTTATAAAGAAGGAGCGGAGGAAGCGTGCACCGTCGTCTTCACAGCGATGCCAGAGTCTTAGTCCATCAACCGTTCAAACATCGGGTCGGTATTATCTTACTGTTTCTTTACATAAACATTGCTGATACCGTTTACGGCGCTCCAACGACATTGCAAGGAGTTTATAAATGAGTATCAATGAGTTAGAGTTGAGCAAAAGATTGGGCGTTATCAATGTTGTGCAGATCCCTTGTCTTCTCCTGCTATGCTCCAGGTTTCTTCCTGCTCCCATAGTAGATAGAGTCGGCATACAAATATTCCATGAAGGTTTATAAGTCTAATGAAGACAAATCCCCATTCTGCAATGTGCGAGAAATGACTGATACGTGCAAATGCTTATCGAACTCACCGGTGGAAGTCAGTATGCCCTCTCTGTACAAACATATTAATGACGTAATACGAAGACATCCCCGCAACCGCGGGCAGGGAGTGGCTTGAGCTGAACCCTGACTAGCGGGTTTTGTTTATGGAGATGATAAATGCACTTCTTCCAGTCACAGGCGAATGCGAATGGGAGAACGGTTCAACAGAGTTATCGAATAACGGAGGACATCAACGGGACTGCTACGACCACTGGGCTCTGGGCGCACTGATAGCACATGCAATGACTAATATTCGAATTTGAAGAACTGAAAGAGAACACCAAAGCCGCCTGGTGATGGCCGTCCTCCTGCGTGTAATTGGAGACTTTGCGATGTACTTAACCTTCAGGGAATGAACGCACGAGCGACGTCCAACCGAGCCTTGAAACAGTTCGTCGATGGGTTCGGAATGCAGCAGTTCCATCCGGTTAAGGATGGAAGAGAACTTTCCCCAGGCTTCCTGATTCTCTTCCTGCACTGAATAACGATAGCTTTGAAGAGGATCGAAATGGGAAGAAGGGGAAGAGAGAAGGAGCGAGAAGGCAGGAGGAAATCGATTACTGTGATGAGCATCAAGGACGGGCAAGGTTGGATCTAGCAGACATGAATCCAATCATGGCAACGCTCTAGTAACAGGCCAACATTGAGTTATCTTTTCCATGACGACAAACACAAGCCTCTGACAGCGAGAATCATTGATAATTCCGTTACGTAGTTACATTCATGGCCTTGATCGCTACGAAAATCCTGGCCAGCAGAGGAATTAGGACCAGAAGACTCATAATTACATGAGCAAATTAAAGCAATAAGGGAGGGTCTGCCTGATGCTCATTGAAGACATCACAAAGAAATTGCGCAATGCTCAATGGATACGACGAGGGCAAGGCGGCGTCAGCCAAGTCAATCAGATCAACATGAGCGATGCATTCCGAGAGTAGCACCTATGAAGGCCATAACAAAGAAGAGCGCATCCCGATCCCAGCGAGCAAATCAGAGGTACGACCCAATCAATGTCGACCGTATGAATGCCCTCCCAGACTTCTCTCCCGGGGCCAATCACTCCCCTCCTTTCCTCAGACTACCTTGCAATCGAAATGGCTGTTGTTACCGGGCAACGAGTCGGTGATTTATGCGAAATGAAGTGGTCTATCGTAGATGGATATCTTTATGTCGTCAAAGCACTCCTGAAACAGGCGTAAATGCCTCATCCCAACAGCATTGCGATTACTGCTCTCGAATATCAATGAAGGAAACACTTGATAAATGAGAAGAGATTCGTGGCGGAGAAACCATAATTGCATCTACTCGTCTGAAGCCTTTCAGCTTGAGCACATATCACAGGTCATGAGGGGACGAAAATCTAAGGTCTTTCCTTCGAAGGGGATCCGCCCACCTTTCACGAGTCGCAGTTGTTTAAGACTCTATGAGAAGCAGATAAGCGATAAGTTTGCTCAAACATCTTCTCGGGCATAAGTCGACGCTGGCATCACAGTATCGTGATGACAGAGGGAAGGAGTGGACAAATTGAAATCAAATAATGATTTTATTTGACTGATAGTGACCTGTTCCTTCCGTCGGCCATCTTCCTCGCCGCCTTCCTTTTATAATGCACTGTAGTATAAAGCTGAACGAGAACGTAAAATGATATAAACTAATATTAATCCATTTGCATAAAACAGACTACATAATACTGTTAAACACAACATATGCAGTCACTATGAATCAACTACTTAGATGGTGATGAATAGGCGCAGAAGCCGAGGCTTATCTGCTGGCGGAGATCTTAGATGACTTGTCGCCCAATACTCCAAGAAGCCAAAGCCTCGCAATCCAGGTTGTGCCATGACATTTGTGTGCACCCACCGACCTGCATAACCAGTAAGAGAGAGACATACCAAGTGATGTCGACCAACGCAACGTAACTTCTTTCTTTCACGACTTCCCGCGCCCATAAATCATTTCTAGTGAATGTCTGTTATGAGCGGAGAGGGAAGTTAACACTTATGAAAATGGCTACAGGGAAGTCCGTGGCTATCTATCGGCTTATTAGTATTGAAACCGTCTTCGAGACGCTGGAGAGCTAATCGTTCGAGGTATATGCAGATTAATAGACTATATCGTTGGTATAAACAGTGCACCATGCAACATGAATAACAGTGGGTCTCGGCTTCCAGGCCCCTCTCTTTCCGAGCTCCCACAAGATACGATGCGCGTTACGGCAGGCGAGAAGCTGGAGGAAAACGTATGTAATAGAGACTTAAAGAGAGATCCTGTTGAGCGCCAACATAAAGTCGCGGTTATTTTAATAAATTAAGCGTATATATGTTGGAGTTTAGTTATTGAAAGAGGGGTATATTCCTGCAGTAGAAAGCACCAGGATTCCTACGAGCAGATGGTTTAAATGACGTTGCTCCTTTGTTACGTAATGTTTTATCTTACTGTCTTTGATGAGCATGGCTAAATGCGATATCGGAAATTTGTTAAATTGGTTTGCTTAGATAAAGAGAAGTAAGCACTTATTCTATTAATAGATAAATTCAGTCAACTCCCTGAAATGTTTTTCCTTAGGTGAAAGCATTGACTATGTTAATCTAAGCAAATTAAGCGATGTATTTAAACATAACCTTCTTAAAGCTATTCAGGGAGCAGGCGAGGAGGGAGATCGATTAGCCGACATTGAAATGAAAGCGTCCTTAACACCTCGGTTTATAATGTAGGGGCACTCTTTCAGAAATTCGCTCCCCGTTCGCCTTCTTCCCTCTCCTTCTTCGAGGTCTTCTTCGATTTCCACTTTCATTTAATAGAAAAGTGCTCCCGAAGATTCAGTACTTATTTAGCCTCCGTTGAACGGTTAATTCTATGCCCAGCACGAACATTCATGCTTTATCGGGCACGCATCCTTGTCGGGCCACAACAATTTGAATCGAAGAGGCATCCTCTTGATCGATCACAACCCAAAACAATGAATATTTTCTCTGAAAATAATAGACTTATCGAGTCAGAATCCCACGAAGCTCACAGTGTTTTGCCTGCCCTTTCTAGCCCGATGGGAGAAGCGCGAAGGGATGCCTCTCTCTGAATAAACACCCTAAGGCTCAAACAGCACGTAATACTTTATTGTAATGGAATCCTGCCAGCAATAGTTTAAATCAGGCGATCCCCTGCTCGAATTCATTTCAGCATTTATTGGTTGTATGAGTAAGCCGAAAAGACTCGTGGAAGCTATCGACGGACGATAGTAAACCGACTGTTCAGCTGATGAGGGGACTCATCAGCCCCTTCCTAAATATGAAGAGGATCAAGACGTAATGAACCGAGCAGATTCAATGACGATGATACAACGCCCGACTTGTTTTATGACACTGAGAAATCTGCTTCGAGTCTGAACTACCTGCATTGTTTTTATTTACTTATCAAGATTAGTCATCTTCTCATCTTCTTCTCGA	*	tp:A:P	cm:i:15	s1:i:156	s2:i:0	zd:i:2	NM:i:749	ms:i:602	AS:i:558	nn:i:0	SA:Z:utg000001l,16994,+,1293S698M51D4569S,60,226;
+60	2048	utg000001l	16994	60	1293H5M1D6M1I11M1I6M2D3M1I7M2D4M2D15M4I5M6D4M1D34M3D13M1D7M1D19M3D2M1I4M2D4M1I4M4I5M1I3M6D3M2I10M2D20M1D8M2D6M1D2M4I4M1D2M2D7M1D11M1D3M2D17M3D22M2I11M1D7M4I3M1I3M2D2M2D4M2D2M2D2M1I2M1I12M1I2M3D3M1D7M1I28M3D2M4D8M4D3M5I20M1D1M1D1M4D4M2D15M1I11M4D1M1D1M1D7M1I3M1D8M1I7M6D2M1D8M3D22M3D3M1D4M1I5M5I2M2D3M1I5M1D4M2I2M1I5M1D23M3D21M2I10M2I3M2I7M1I27M1D1M2D6M2D6M3I7M1I6M4569H	*	0	0	TTTCTTTATCCAGAAATCCACTGAAAGCACAGCGGCTGGCTGAGGAGATAATCAATAAACGAGGGCTGTATGCACAAAGCATCTTCTGTTGAGTTAAGAACGAGTATCCAGATGGGACACCTTGCTCAGGTGGAATCAGGTTGTTGAACTAGGAGCGCCACCAGTAGAAACAGACGGAACTTTCAACCGTTAGCCGCATCCTTTCACAAAGCTGGAAATGATGGGCGGGTGAAAGCAAGTACAGGGAAACCAGGTATCAACCACGGAATGCATTTGGCAGCGGGCTTCGACTTCTGGTTGTGCTTATGCTGCCGACTCAAATGTCGATGTAATCATCGATGGAATGAAAGCCCTTCTGAAGCATTGCCCGTCAGGCTAATTCTGAAATCAAAGGCACCCAGTTTCTAAACAGCAACCCGGACCCCATGTACCGACCGATTAACGAAGCACCGCGTAAACGGTAACGGTGGATTCACCACCGACTCCACTTTAAGCTGGATCGGCATGTTAAACGGCGTCTTTAAGGAATGCCATCGCCTACTCCGGCTATCCATCAGGAGTACAGGCTCCTTTATTATTCGCATTGCCCTCAAGCGTATTAACAGACAGTTCAGGAGGATTAATGATGAAGGTACGGCAGCACTCCATTGATTCAGCATCAGAAATAGAGAATTAAAGGCACTGACACAGCGACTAAA	*	tp:A:P	cm:i:14	s1:i:146	s2:i:0	zd:i:1	NM:i:226	ms:i:268	AS:i:268	nn:i:0	SA:Z:utg000001l,19497,+,3747S2350M26I437S,60,749;
+61	16	utg000001l	30718	60	8S11M2D1M1D12M3I6M6D7M1I4M1D20M2I19M1D18M1I8M1D10M2D22M1I20M1I2M2D2M1D3M1D12M8D2M2D7M2I11M1D9M3D2M1D6M1I32M4D2M2D3M3D3M11D22M2D3M4I19M3D30M2I9M2D9M2D13M1I2M1I8M1I3M2I18M1I11M1I7M2I26M1I4M3D1M1I7M2I6M3D4M1D2M1I21M1D12M1D12M1I2M2D2M1D1M2I2M1I6M2D8M2I7M2I9M1D3M2I1M1D2M1I14M2I32M1I7M1I5M1D2M1D2M1I9M4D5M1D20M2D39M2D24M1I2M2D1M1I9M2I12M2I8M1I14M1I5M4D1M1D3M2I3M2D7M2D3M1D8M4D4M1D2M1D8M1I3M2D2M4I6M1D9M2D7M4D7M1D11M5D1M2I25M2D1M2D4M2D2M1I12M5D12M2D4M1D1M2D18M1I5M1D7M2I13M1D21M1I12M1I3M1D7M1I6M2I10M1D7M1D1M1D2M1D6M2D4M1D11M2I52M1I6M1D16M1I2M2D9M4D6M1D1M3I11M1I1M1I3M1I4M1D1M1D6M4D4M2D15M1D6M3I5M3D1M1I1M1I14M1D6M1D2M1D15M2D33M1I33M1I3M3D2M1I1M2I7M1D10M1D6M1I5M1I3M2I7M1I4M1I9M3I12M1I5M1D6M1I14M1I36M1D9M2I3M1I2M3I2M1D16M2D7M1D5M2D4M1D6M1I21M1D15M1D12M1I9M2D20M1I16M1D20M1D4M2I8M1I17M1D12M1I8M2D11M4I13M2D4M1D10M1I6M3D11M1D1M1D11M2D6M3D10M2I9M1D10M2D11M1I4M5I2M4I4M1D8M3D7M1D4M2D4M1D3M3D4M9I1M1I36M2D7M1D10M1D58M2D17M1I13M1I2M1D1M2D4M1I5M2I1M1I11M1I10M5I4M1I2M3D15M1D12M1I2M2I3M1D14M1I2M1D12M1D6M5I7M1I6M2I7M1I9M2I1M4I5M1D4M1I8M3I4M1D9M2I12M5I4M3D43M1I51M1I1M2I22M1I8M3I5M2D8M4D14M3D20M2I1M3I31M1D7M1I6M2I4M3I8M1D4M1D14M3I21M8D2M1I4M1I3M2D11M4D3M2D6M1D2M1D11M2I10M7I7M1I1M2I14M4I4M7I2M1I2M6I1M1I1M4I2M3I3M1I2M2I3M3I5M1I5M1D5M2D3M1I23M2D7M1I1M2D2M1I8M1I3M1D8M1I3M1D11M3D5M1I13M1I2M1I5M4D5M1D8M1I7M2I3M2I14M1D6M1I1M2D8M2D8M4I4M2I2M4I3M1I6M2D6M3D10M2D3M3D4M2D8M1I11M1I12M1I10M1D20M1I9M4D8M1D10M1I7M5D11M5D18M1I2M1I3M1D9M1D8M1D28M1D5M6D10M3D1M1I7M1I2M1I3M2I10M1D10M1D12M1D22M6D5M1I7M1I11M3I19M1I5M3D16M2D1M1D13M1I10M1D14M1D4M2I4M1I6M2I4M1I11M1I5M1D5M1D22M1D12M2I6M1I4M3I4M2I5M1I6M2I42M2I2M1D1M1D15M1D16M3D3M1I7M3I2M1D7M1D21M1D1M1D3M1D9M3I4M1D3M3I6M1D4M1I10M1D9M1I3M2D24M1I2M2I8M2I3M2D1M1I5M3I11M1I1M3D13M3I3M1I4M2I2M3D2M1D4M1I19M2D6M1I6M1D2M2D10M1I31M1I3M1I1M2I5M1D14M1D1M1D5M3D16M1D6M2I8M1I7M1D6M6I6M5I2M1D21M2D3M4D2M1I13M3I19M1I3M1I4M1D14M3I3M4I4M1I3M3I12M3D10M1D20M1D7M1I17M1I5M3I7M1I9M2D6M2I17M3D12M7D18M2D10M4D3M5I3M1D9M3I11M2D13M1D18M1I12M2D9M4I10M1D7M1D1M1D15M2D2M1D10M1D17M1D3M2D7M1D3M3I6M4I3M1I8M1I7M2I1M1D19M1D15M1I5M1I7M1I3M1D14M1D4M1I9M1I5M3I6M1D5M1D9M1I3M1I2M11I4M2D6M4I8M1I18M2I3M1I4M2D16M2I2M2I9M1D3M1I2M2D27M1D4M4D8M1D8M2D6M1D3M2I7M2I2M1I8M1D6M4I20M1I2M5I9M1D2M3I1M1I13M1D17M1D4M1I27M2D1M2D2M4D5M2I21M1I4M1D2M3I9M1I8M1I9M6I2M1I9M1I8M1I13M1D3M1I2M1I5M1I3M2I7M1D6M1I1M1I5M2I3M1I22M4I7M3D7M2D10M3D6M2I10M1D15M2I5M1I5M1I1M1I24M2I4M2I3M1I5M1I11M3D22M1I21M1D14M1D6M3I4M1I1M1I13M1I3M2I15M1I10M1I5M1D39M1D3M1D8M2I4M1D8M2D1M1I14M2I12M2I17M1I16M4I16M1I11M1I13M1I21M2I3M2D6M1D12M7I11M2I19M2I9M3I2M1D21M1D16M1D13M4I3M1I8M1D16M2D35M1I9M2I8M3I5M1I3M1I2M1D87M1I6M2D3M2D6M1D2M1I7M3I19M1D7M1I16M1I5M1D5M1D2M3D1M1D11M2D1M2D6M1I9M2I32M3D11M1D9M1I2M1I15M1D12M1I2M1I22M2D12M1I4M1D3M3D7M1I4M1D3M1D6M1I3M1I13M2D6M4I28M1D3M1I1M2I20M1I14M1I11M3D40M1I70M1I34M1I11M1I4M2I7M1I10M1D14M2I11M2D6M1I7M1D25M2I2M4D7M2I1M1I12M1I14M2I5M1I5M3D28M1I17M3I55M4D7M1D6M1I17M1D9M4D20M1D33M1I32M1D2M2D12M1I10M1I24M3I11M1D3M1I6M2D5M4I17M2D19M3I6M2I6M1D3M1D12M1D20M1I7M1I6M3D8M8I14M1I26M2I20M2I1M1D30M15S	*	0	0	TATCATCTCAGATTTCAATAACATCGCCCGGTCGCATGGCGACCCTTCTCTGCCCGACGGTGAAATCTAAAGGCTTCTGCGTTTCCAGCAGTTCGTTTTGAACCATCAACCGACCCGGCGCTGTGTGCCTGCCGGCTGGTACAGCCAAAGGCATTCATCTTCGTAACATTACGACCGACGGCATGGCCTGCGTATCTCACGTCTAGCGGTCTCCAGCCGTTGTTCGTCAATCCAGTTCACCTCAACGGCATTATGGCGTCGGCGCTGAAGCTGTAGGAACGGGGGCGCCATCATCCCATGAAGTACCACATTACTGCGGTTAGTCCACGTCTTATCCGACGGTCGGTCCTGCAGACGAACGTCCGTCTTACCGTTCCATACCGGCAATACAGCATCGCCGAGCAGAAATCGCTGAGCACATCCCACGCCTTACAGCTGTGGTATCAGGTACGCATTACAGCTGATGCGCGGCGGGCCGTGCCGCCAACGTCCGGCACATGACTGGTCGCAGTACTGGCCATGACATACAGCCCATTTATCAGACATCCACGCACCAAGACGTTCCCCACCTGCCGTAGCGCGGATGGGTCAGCATATCCCACAGACACCAGGCGCCATGTTGTTGCTGTATGCCGGTTTAACGTTCCGTCCGAGATACCCTTATTGCCGCGTCTGCGGTTATAGTTCGACGGCACCTGCAGAATACGCCCGCGCAGATGATAATTACGGCTCACCTGGTCGGCTGCCGACTGCTCCGAGTTGACCTGCACGCCGACCAGTGCCGTGTTCGGGTAGCACTGTTTCACATCGATGATTTCAGTATGACGACCAGAGGGTCGTATGCAGCTGGTCTGTGGGCGTCCGGCGTCATCCTGCGATCCGGATAGGAACGGGCGGCGGATGAGTCCATAAGGGCCGAGATACTGCGAGGTGGTTTTAGCTTAATGGTGATGTCTTTTCGTACCAGCCACCGTTACGTTGTATCTGAACCACCAAGGCGGACTTCCCTAGACGCATTCCCGTCACCCTTTGAGGTGGTTTCCGGTCAGTGCCTGTACACCGAAGGTAAAGCGCAGACGGTCGATGTTGCAGACTTAATGGTGGCTGATCGGCGTGTCATATTTCACTTCCGTACCCAGCAAGGGTGGGAGCCGGAGGATTCAAATCCCTCGGGCGGAGTCTGCTCCTGCTCGCTCACCGGAACACCGTGACACCGGATATGTTGGTGACTTCGCCTCAGTGCCGTAAGCGCGTACTGTTCAGCACCCCTAGATTAGCTCACGGACCTTCAATCGGCCTTCGCTATCGCATCGATCACACCAGCAACTCCTTAGGACTTCAGGTTGTCCTTCGCTTCGCTGTATGGGGCTCCTTACTGCTTCCTTTGACCTCGCGGTCACGCTCATAAATGACAAACCGCCCGCAGGCGGTTTTCACATAAAACATTTGCATCATGAGCGACCAATCACCACAACTGACCACCGTCCCCTTCGTCTTGCCGTGCTGATCTCCTGAGAAACCACGCGGTATACGCACGCATTTCCCCGGTGCCACGAACAGGCAGAACATTGCCTTAGAAGCATTATCAGTGAGGAGAAATAGGTGTTCTGCTTACCGTTATCCGTTGTCTGTACGGGGAATCTGGGGTCGGGTGGCCAGCATCTGCGCCACACCACCGAGCACCATACGGCACCGAGAGAAACAGGATGCCGCTTCATACCACCGGTTAGAATGGCTGCCCCCATGCTGCAAGGGGCTCCGGCGGTAAAGAAACCTTGAATGGCGTAAGAGCCCCAGAAGATCTGGAATACATGGTTAATGGCGCGGCGACCTGGAACACTGAATTACAGGGCGCCATCAGCAGAGTCTCATGTAACTGCGCCGTTAACCCGGACGTGCTCGTCTCCACCGTAATCCCACCCTGATAGATAAGGTCGTCGCTCAGTTTCTGACGAAACGCCTGAGCTGTGGCCCGTGCCCGGATGGCTTCAGCCGGCTTTCACACGAAGGTCGATGCGAGACCAAATCGTTGTAAATCCCCGTAAAGGCAGATGCGCCATGCCCGGTGACGCCAGGGAGTGCGTCGCTGCCATTTGTCCTGTCTATACCTCTCGGTTTGCTCAGCTAGTTTGTGTCGAATATGGTGCAGCATCGCCGTCGCCGCAGTAAATTGCGTGATTCGGCACTGATGAACCAAACAGCCAGCAACCAAGGACATCGCCTAGCCCTGTGCCGCTGACAACGGCACCTGTGATAAGCCAGCGTCGCCAAGCCCAGATTATCCCAGATAGAGATTCTGGCCGTTACGCCACCAGTCATGGACCCCATTGAAAGTCCGGCATCTCAATCCCGCCAGATGAGCAGCATCCCGGAACAGTGTGTAACAGTCCGTCACACCGTGCTGCATAAAGCGCCGCCCGGTGAGATGCGGGCACACAGCGGAACTGGAATCGTCGCCGGCAGACCAGCCACGGCAAATCACTCTGCACCTGCAGCAGCCGCCGGTCGGCCTCACTCAGCCAGCGGACCACCGGGGGCTGGCGTGTAAACAGCGGCCAATTCACCCTGCATTTCTCTTGCCTGCAGCCAGTCTTCCGGATCACGGAAATACGCCTCCGGGCCGGATGGTACCAAGGGAAATATGTTTCCCCCTCGACGGGTCGGCGTGTCGGTTACCACGAAGCCGGAACCACGCGCTGGCACATCGCCGGGCGTGCACAGAATCGCTGATTCTGTCTTGTCACTGGGATTTACTGCGGAAAGTTTGTCAATGGAAAGGAACGCCAAAGTTGCCGACGTTATTGCGGAACTTACAACGCTCAGGCATTTGCTGCATTTATCCTTCGTGATATCGGACGTTGGCTGGTCATATTCATCTACGAGGAAGCCGGACCGCTAACCGCACTCCGTGTACCGCGATAGGTCCAGTGCAGCGTCTTTACAGCATGATACGTCCGGAAAAGCGCCCTGCGTTTCGTCGGCGTGGACAGGTACAAAGGAGCAGCACCGCGCTCAGTTGGTCGCTGCAACCTGCTCAATGCGCCCGGATAGTCTCGCTGCTCCGGATCGTGAATTATGTTTCCGTTGACGAAGTTTACCGCATCCAGAAACGGGCGTAAACCTTACGCCGGACACCGTTCCGCCGACCAGACTGCCAATATCTTTCGCGCCATGTAGGATTAAGCCCGTACAGGTTAGAAACCGTCACCGTGCGCGTACTGGTGCCTTTGCCATTCAGTTCAAACCCTCCCCTGAATGGGATAAGCCTGATACTGTCGCCCCTGCCAGGTGACGGCTCACCTTTTTCGTATGCTCATTACAGAAAATAACGTTCTCCACCGACCTCTGTCAGGTCGATTTTCCCAGAGCACCACGCTGGCTCTTATGGGCACGGGTGCATTCATTCAGTGTTTCCTGCCGGATATCCTGTGCATCTAGTTTACCACCTGTGTTCAAACTCTGCGCTGAACTCAACACGCAGCATACTGACCCGCGACGACCATTTTAGCAGTATACCTTTATCTGCCGCCACTCATAAGGCGTCTACAGAAAGGTGATTTCCAGCCCGTGCTCTTCCAGAAACGACTCTCCAGTACCCTTATCCCAACCTAGGCGACGAAAGGCGTCACGCTTAATTTTCAGCTTGGCATTCAGCCATCGGCAGGCGCTGCGTCCGGAGAATAGCCATCACCAAAGCAGCACCTTCTTAGGAAGGGACCGAAGCCACATCCATACCGGGTTTCACTTTCCAGCGGAAGGTCTTCCATCGTCCACCTCCGGAACAGGCCACCATCACGCATCTGTGTCTGAATTTCATCACGCGGGCACCCCTTGCGGTACATGTCATAATGCCTTCAGAGCAGCCGGACTTACGCCAGCGTTCGTGCCGTCGTTGTCAATCACCACACATGGATTATTCTGCTCAAACGTCCGGACGCCTGCGGACCGGCTGTCTGCCATGCTGCTGCCCGGTGTACCGACATAACCGCCGGTGGCATAGCCTAGAGGCAAGAGCCAGCCGGTAAAGATTCCCCACGGTACGGCTCTCATGCCTCCTTCGTGAAGACAACTCACACGGTGAACAATCCCCGCTTGGCTATCCATATTTGCCCCCGGTTCCCCTTTAAATCCTCCGGTTGCAAATGGAATTTCGCCCGGCCTGAATGGCTGTACCGCCTGACGGATGCGCCCCCACCAACAGCCCCGCCAATGGCGCTTGATACTCCCGACATCCCCACCATTGCCTGCATTAAGCAGAATTTGTCATGTTAAGCGGACAGGACGGAACGGGGAGCTGCGCCAGTTCTGCTCACTGCCGGTCAGCATCTCCGCCATATTCTTGTGCAAGTACCATCAAAGGTCTTGCGTGATGCACTGTCTCTTAGACATACTGTCCGTGGCGCTGCTTCCCACTCTATCGGAGCCGGACTTCATGGTGCCATCCAGTTCCCTGAACCCTGGTCTTCCAGCCTCACAGGTCTTTCTTTGACATGACCGTCTACTGCCGTGCTTTTCATACCGGCCTCATTATCTCGTTACTGTTCCTTCAGGCGCCCTGTTCCTTTGTGGCTTCCCGTTCTTGCCTTGCCGGTCATTCTAGCCGGCCTTTCTAATCAATGGCGGCCCGTTTACCGTTGCTTTATGTGCATTTTACTATCTGCCTTGCTCCTAGAGCGCGTCAGGCCTTAGCTCCTTACGTACTTGTCTCTACAAGTGCCGCATCCACTATGGCGCGTTTGTACTCCAGCGTCTCATCTTTATGCTCATTAAGGGATTTCTCCTGTCGATAAAGCTCCTACGTTGCGCCGCCTCCTCCAGTACCGCGAACTGCTTGACTCCGCCTTCCCACAAATCCCCGGCGCTGTGATGGCTCTGATTTTCTCATTTGCTGCCTTAATGCTTCTCAGCCGTTCGGAGTTCTTGCCTGAACCGTACTACAGGCATCCCACTGAGCACCGTCTTCCTGACGATTCGCCGCCCGCACACCTTCACGCTGGACTTCAGCGGTCGGTCGTCGGCTTCATAATCCTTTCGCCGCCGCCATCGACCCGTGTTGTAATCTGCCTGCGGCAGGATTTTCCCCGTCTTCAGTGCCTTGTTCATTCTTTCCGTAAACGGCGTATATTTCTCCGGAGCGTCTGCAGCCGTTCGGTAAGCCTTCTGCGCCTCTTCAGTATACTTCAGCCGTGACGGAGTCGGTATCGCTCTGCCTGCTGCGCATTTTGTCTGTTGAGTCTGCTGCTCAGCCTTCTTTCGGGCGGCTTCAAGGCAGGACGTAGTCCTTCACGATTGCTCAGTAACGCGCCCGCGCTTCATCGTTAACAAAATAATCATCCTTGCGCAGATTCCAGATGTCGTCGGTCTGCCTTCTTGCATACGCAGCCTCTGCCTTAATCAGCATCGCCCTGCGCGGTATCAGGACGACCAATAAAACCCACGGGACCTAGAATTCACATTTGAATGCCATAGGGCAGTCCTGTCTGCCCAGAGGTCTCCAGCGTGCCATGTTCTTTCTTCAGGCGGGGGTCTGGTCATCAAACCCTTTCGTTGCGGCCTCTCAGTTCGCCGCCTGCAATGCGCCGGCTTCATCGCCGGAACGCTGCAACTGAGCAACATACGCAATCTTATCCAGACACGTTATCGAAACTGCGAGCCATCGCCGTCAGCCCCGACGTCGGGTCTGTGGTCAGCTTCCAGGAAGGCTTCAGCGACCTTGTCCACCTCCACGCCGGATGCAGGAGCAACGCGCCACTGGCTATCGGACGCACTGATCTGAGCCTCACCGCTTACCCCGCCGGTAACCAGTGCGCTGAGGTAACCCCTGGTCTGGTTAAACGTTCCCTCCATGCCCGGCTGCGGGACAGGGACAGCATACGATCTGCCGTCAGTCGCTCGATTGCCGGAAAGGACCAGGCGTTTGTTGAAATCGACAGGGTCGGTATGCCCTGATACCAGGCATACGCCAGCGCACCGGTCCCGCCACTGCCGAGGCCTCACAGATGTAAGGCGCTACATCGCACCGGCACCGCATGAACGAACATGGGGATCATACCCCCGGAAGAATCTGTCCTTCACCTGCCCCCTGTTGCAGGCAGGATCAGCCACGGACTTTGCCGCCTGCAAGCTGCGGCGGCCAAGTCGGTGAACTGTGCAGGCATGCATACGCATGGCGGCTTTATAATCGCAGGACGGAAATCCCCGCTTTCTGTGCAGCCAGCGCCTGTCGGCTTCAGCGACTGTTCAACGACTGCCGCTTTTCTTTCACATCACTTTCCGGTACAGAAGAAAACCGACGCCTGATCTAGCCATCTGCTCGCGTCTAAATCTCTTGAGCGCATCAGACTCAAATCAACGACCAGATCGCCTAGCATTCAGCCTAGACCCCGGACTCCTCCCTGCGATCCCTTCGATGATACTGTCATCAGCATTACGTCCATCCTCCGTCATGTCCGCCACATCGGGGAAGCGGGGGATAACTTCATTCCCGTCCGGCTCAAAGCGGACACCTCCGGCAAGCCCTGCCGCTTCTGCATCAGCACATCATCTTCAGGCTCTTCGTCAGCCTCGCGCCGGTTCAGCAGACTGAATCCAGCAGATGCATATCCGGATCGCTGAAAATACGGCTGAGCACGGTGTACGTCAGCAGGAAAAGTGCATATCCAGCAGGAACATCATGAAAATAATGGGTACTGTAAACCGCTGCCGCCAGTCGGCAACTCCGTGGAACATCCTAACCGGCAAGCATGGCACGGGTCGGGTCGCCCCATCTCACGACGCGCCGGTTTCAGGCAAACTCAGCTCACGTCGAACACTTTCCCGCAGAAACAGGCTTGCGGGCCGGCGTCATCTAGCTCTCTGTCTGTTCAGCGGGCATTATTCACCACAAACTCATACAGATACCAGACAGCCGGTACACTTCCGTTTTCAGCATGAGAAATTGCCTCCGTGGGAGTTAAACACCACA	*	tp:A:P	cm:i:105	s1:i:1033	s2:i:0	NM:i:1837	ms:i:3778	AS:i:3778	nn:i:0
+62	16	utg000001l	18937	60	1315S4M1D11M1D3M1D23M3I29M2I3M1D5M1D5M1D3M1D3M2I8M1I10M2I3M1D4M2D11M1D7M2I14M1D4M1I14M1D7M1D10M2I7M1I7M1I15M1I2M2I1M1I3M1I4M1I11M2I8M8D14M1I4M2D5M1D3M2D7M1D3M2D17M1D4M1I1M1I9M2D9M2D30M1D4M1D6M4D10M1I4M1I3M3D13M1I1M1I2M1D5M5D6M4D9M2D3M1I3M1I7M8I3M3I5M1I2M1I2M3I3M1D5M1I14M1I1M2I6M1D9M1I3M1D4M1D5M8D1M2D3M1I4M2I11M1D1M3D8M1I6M1I11M1I2M1I18M1I5M2I4M1D10M2I6M1D2M2D13M1I14M1I5M2I4M1D14M2I28M4I4M1D5M1I2M1D10M1I19M1I3M1I6M1D3M4D4M1D2M2I4M1I7M1I9M1D3M1D3M1D2M1I4M3I5M2I6M3I2M3I6M1D2M2D1M1D2M2D2M2I6M1I4M1D2M1D6M4I4M1I4M1D7M1D5M1I4M1I2M2I11M3D1M2D5M1I2M3D10M1I6M1D6M2D11M2D6M5D9M1I28M1I4M1D11M3D16M1D1M1D4M1I8M2D8M2I1M1D14M1D7M5D2M2D5M1D10M1I18M1D13M3I2M2I5M2D2M1D4M2I4M4I4M3I12M6D5M3D7M2D2M1I3M4I5M1I10M1I3M2I4M2I9M2D4M2D2M2I11M2D16M3D2M1I25M1I6M1D5M2D2M1D5M4D3M1D9M1D13M1D2M1I25M1I3M1I10M2I7M1I2M1D6M1D15M1D6M4D3M1D6M3I2M2I7M1I3M1D12M2D8M2I14M1I2M1I16M2I1M2I7M1I2M1I3M2D7M1D19M3D15M2I26M2D2M2D5M2I13M4I6M4I13M2D8M1D9M3D16M1I17M1I2M4I6M2I9M1I7M1D4M1I2M1D7M4I38M2D15M1D3M1D8M1D4M3I2M1D17M1D6M2I37M2I12M1I6M1D12M7I2M2D11M1D2M2D4M1D1M2D11M2D4M1D7M2D2M2D2M1D3M1I6M2I4M1I2M1I16M1D17M1I13M1I3M1D16M2I6M2D7M1D2M1I15M2D1M2D2M1D4M1D15M2D9M1D24M1I8M1D15M2D13M1D2M2D5M2D4M1I13M4D28M1D14M1D5M2D6M1D3M1D10M1I2M3I22M1I6M2I5M1D20M2I3M2D1M1D9M1I2M2D16M2I1M1D3M1D11M1D22M3D3M1D21M1D4M1D3M1D16M1I4M2I1M1I4M1I12M1D14M6D3M1I2M1I5M2D11M1I10M1D15M5D10M1I16M2I2M2I17M1I3M1I4M1D8M2D8M1I9M1D18M1I5M3D8M1I5M2D2M1D3M3D6M2I15M1D3M1D14M3D17M3D6M4D5M1D13M3D4M2D10M1D12M2D5M1D12M2D12M1D1M2D3M1D11M1D10M1D40M1D9M2D3M1I5M1I4M1D5M1D14M4D7M2I7M1I4M2D12M2D6M2D11M2I2M3D7M1I4M1D10M1I18M4D10M2D12M2D10M1D6M2D3M1D5M6D3M1I7M1I2M2I18M1I4M1I3M3I3M1D1M1D5M4D10M2D2M3D9M1D11M1I12M1D11M1I9M1D3M3D4M3I14M4D13M3D4M1D14M7D1M2D3M1D5M2D1M2D2M7D10M2I12M2D2M1I5M1D5M3D5M2D9M2D1M2D2M1I2M1I3M1D3M1I8M1D4M1D3M1D15M1D1M1D14M1D8M1D1M1D5M1I7M2D15M1D11M1I4M1I2M2I10M1D3M1I7M2I9M4I1M1I10M1D2M3I24M1D11M2D1M1D5M4D10M1D5M3I4M1I2M1I7M2D4M2I4M1I3M1I5M3I4M1I7M3D23M2D4M1I7M5D23M1I13M2I2M4D14M1D6M1D5M1I8M1D2M1D7M1D1M2D15M1D2M1D22M2D3M1D6M2D2M1D10M3I22M1I1M2D2M1D4M3I2M1D5M1I1M1I6M1I2M2D6M7I5M1D5M1I14M1I15M1D5M2I10M2D6M1I9M1I6M1I5M2I4M8I1M3I2M1I3M1I7M1I4M6I3M1D6M2I7M3I7M4D3M1D9M1D7M1D7M2I7M1I1M2I2M1I10M1I5M1I1M4I12M3I3M3I4M3D18M1I2M1I1M1I1M1I4M1I2M1I20M7I3M2I7M2I5M1I4M1I2M3I14M1I4M1D6M1I4M4D3M1D40M2D6M1D11M1I6M1D17M1I2M3I2M1I8M1D1M1D18M7D10M3D5M1I5M4D5M2I1M1I7M2I22M2D1M1D2M2D3M1D14M3D14M1I2M2I10M1D8M1D17M1D5M1D7M1D10M4I5M1I6M1I7M1D8M1D2M1D6M2I4M1I1M1I17M2D5M2D1M1D11M2I2M1I5M1I6M2D5M2I5M3D12M1I4M5I1M1I5M1D1M3D5M1I6M1D1M2D4M1I3M5D2M1D5M3D8M2I5M1D8M3I7M2D29M1I3M2I6M1D5M4I10M2I7M2I9M1I2M1I1M3D5M3D13M1D4M1I1M3I3M4I6M1D2M4I17M2D1M1I7M1D1M1D10M1D11M1I5M1D6M1I2M1I3M1I9M2I6M2I8M2D38M1D20M2I2M1I1M2D8M1D8M1D4M2I2M4I1M1I3M1I9M2I3M1I9M1I2M1I1M1I17M3I1M1I8M1D22M2I2M2I2M1I15M2I4M1D7M4I8M2D15M2I14M1D4M1I12M3D7M1D7M1D2M1D2M2I9M2I7M1D8M4D6M1D5M1D2M1I12M1I13M2I4M3D5M1I23M1I7M1I9M1I6M1I20M1D1M2D5M2I2M1I7M8I14M1I9M1D21M1D2M1D4M2D18M1I4M1D4M2I17M2D6M1I21M1I8M1D5M1I14M2D10M1I10M1I15M2I10M2D14M1I2M3I4M3I6M1D3M3D13M2I7M3I14M1D9M4I4M1D6M2D16M5I1M2I1M1D6M3D1M1D5M1D3M4D2M2I6M1D9M1D2M3I17M3D13M2I12M1D6M1I3M3D10M1I12M2I6M2D9M1D8M4I3M1I3M1I3M1I8M1I3M2I16M2D6M4D9M1D2M1I16M1I16M2I1M2I6M6D7M1D5M1D4M1D14M1D31M1I8M1D3M1D4M2I1M1D2M1D6M1D27M1I1M3I8M1I13M2I7M1D7M3D8M6I1M2I5M1D12M1D15M4D22M4D5M1D9M32S	*	0	0	CTAAACTGATGGCTATCACTACTCCAGGCCGCACGTCCGCATGGAGCACCAAAGAGCCATTTCTTTCACAGGTTCAACAATCATTAACATCAGTCGGATGCCTGCAGGATGAAAGCTTGAAGTCACAGCAGAATTACAGCACAGCAAGGACATGCCGCCTGAACCACCATGAGGCTGTATTCATTGTTGCTGTGGCGTGGATGCAGAGCGAACGAATCGCCGCTGTCGTATGCACTGTGCATTGCCAGGAGGATCTTAACTAGTGAACACAGGAGGTTCGAAATGAGTCGAAATTAACTCTTCAGGCACTGCGGCAGCGGCAGAGCAGGCAATGCATGACTAACTGCGCATTTGACGCATTTTCCATGAATCGCCAACATGCATTGTGCTGGAACTGCTGGATGAACTCGGAAAGGAACTATGCATACATTCAAACAGCCGCGACCAGGAAATCCAGGATATTTGCCTAACAGTGGAAATACTTCCTATGGTCTTGAAACAGGACAAATCAAACTCAACGAGCAGCGTGAGTATTACGAACATGTTATCTCAGGGGTGGGAGTAAGCATGCCTAACTGGAAAGCAACGATCCGGCAAGGAATAGTTTCTTGTTCGCCATCCCTGGAAGACTCCAGTGTCACTAATCTGCACTGACTCGCAAAGAGTTTTCTGCGCAGTTAATGCTAAACAGTCATGGGCCTAACCAGCTTGACGAGGATACCAGTGCACCTGGGGTCGCGATGGGTGATTTCAGGATGCAGGCGTACCTCTCACTCATGTCTGACGCTGGCATCGCATCAAAGGAGGTGCATTCAGTTTTGCAACAAGATAACGCTTGAAATGCCGGCAATTCTGCGTCCTTCACAGCCGTATGCCAGAGTATCTGCTGTCGATGATGACCTCATCGAACATGGGTTGTGAGTTTATGGTCTGTTTCCCACTAAACATTGCGTCGATACTAGTTTAGTGAAACGGACATAAGTGCCAAGGAGTTAGTACAACCTATGTGATTAGAATCTGATTACTAGTTAACAAAGTATTGCCGATCCGACTTGTCTTGTGTCTCCATGCACATCACGAAGACTATTTATGTGCCCCATGAGAGCCAGTCAGGCATACAATATTCCATGAAGATGTAAGTCTAATGAAGACAAAGTCGCCCATTCTGCAATGTGCCAGAAATGAACTACCGCAAAATTATGCTCACCCGAATGGGCGGAAACGATACTCTTGCCTCTCTTACAACAGTAGATGATTAAATGACCAGCTCACTAACATCCTGCACTCGCGGGGATTCTTTATCTGAATCGCGCTACCCTCGGTTTTGTTTTGGGATGATAAATGCACTTCCGAGCACCTAGAATGGAATGGAGCCATTCAACATTATGGCAACCGGAGAACATCAACGACCTGCTACGACCACTGGATGAGCTCTGCGCATAGCACATGCAGACGTAACCAATATTCAATTGAAGAATCGAAAGAACTAAGCGCCTGATGCTTTCTTGCGTGTAATTTGCGGAGACTTTGCGGTCTCATGACTATGCTGTCAGGAGTAGAAACGCACGCCTCAGGAAGCAGAACCCTTGAAACAGTTCCGGGCTTCATGCGACGCATATTCCTAAGCGCGTTAAGGAGTGGGAAGAGAGCTCTGTTCCACGAATCAGGGTAAAGGTTGACTCTTAAATGGACCCAACAGGCCTTTGACGAGGATAGAAAATGGGAAGAAGTGTCGACTCAGCCGGGATTTACCTCAACTGTTATAAGAAACATGGATTACTGGGTACTACAGCAGCACGCCCAAACGGCCGCATTGGATTAGAGGAACATGAATCGCAATGTACTAGCACTGGTAAGAGGCCAAAGCTCGGCATTATTTGCCGACCAACACAAGCCTCTGACAGGCGGAATCAACAGTGATAATTCCACGTTAAGGTCCATTCATGGCACTTGATCGACGAAAATCCTGGCCCAGCAGAGGAAGTCAAGCAAGGAAGACACTCATAATTACATGAGCAAAGTAGCACACTCAGGAGCGCGTATGCCTGATGCTGATATGCACATACCAAAAGAATGTGCAGCAATGCTCAATGGATAGACGAGGCACATCGCAGCAGTCAAGTACGTAAATGCTCAGCTGATGCATTCCGAGGCGCAATAGGTGCAAGGCTAACACACAAACCATGTCGCTGCCACCTGCGCAGCAAAGTGAGATAGGAGATCAAGACTTACGATGGCTGACGGATCTGAAATTGATGCAGCAGAATCATACCAGGTGGCGACTTGCAATGGCACTGTGTCCAGGGCAACGAGTGGGCATTTATGCGAAATGAAGCTTGTGGTATGGTGGATGGATATGTCTGTTAACAGGCAAAACAGGCAATTGCCATTGGACAGCATTGCATATTACTCTTAGAATATGGATGAAGGAAAACATTGATAAATGCAAAGCATTTCTTGAGAAAGAGGAGCATTGCATAGCCTGTGCGGTAACGTGAAGCAGCTTTCATCATAAGAGAGTATCAGGGCTTTATGCGGCACGAAAACAAAGCATCTTTCCTTCGACTAGAATGCCTCTTTCACGAGTGCAGTTGTCTGCAAGATACTGTGCAGGCAGATAAGCAGTCGCTGTCCAACATTCTCGCTAAGTGGACATGGCATCACAGTATCGTGATGACAGAGGCAGGGAATGGGACAATTGAACAGTAAAATAAAGCTGATTGTTTTGACGGTAGTACCTGTTCTATGCACAATTGATAAGCATTTGGACTGCCTCACTGCCACGCTAACGTCGAAAGCAACGTAAAAATGATATAAATATCACTATTAAATGTCATTTTGCAGGACAACATACCGACTATACTGTAAACACAACATATGCAGTCACTATGAAGTACTATGCCATCTGTATTAGGCTACTCGCACAGCATGCCCACCCTGATTTGTCTTCATTTTTCCGGGGCATTATCAAACCCTTCACGCCAGGAGGCTAAAGCACAACGGGCGCAATGCCAGTGCAAACAATTGTGCTTCCGCCCAGCCGACGACTGCACTATACAGAAGATATGCAGTGATGTCTGTCAAACGACGCAGCTGACCTCCTTCTTTCACGACTTCCACACCCGGATGCAGCCGCCATAATGTAGTGAATTTATGTTAGCCTAGGAGGGAAGTTAAATCAGGGCAAATGGCTACGAAGTCGTGGCTATCTATGCCTTATTAGTATTGTGCAACGCCCTTCGGATCGTAGGGACCAGGGCACTCATGTAGTGTTTTCAATGGATAGGATATATCGGGTGCTATAACATTTAGCACTCATTAAAGATGCAGCACAGGCGGGTTGTAAAAGGAAGGCAGAAAGCTAAACTCTGAAAACTAATACGATGCCCCGTCATTCAATATAGCATTTTTACATGGAAAATTACTCACATAGTAACTTAAAGAGATTCTTGTTGCCGCCAAATAAATTGCCATGTCTTTAATAAATTAAGCCATTACTATGTTGGAGTTTGTCCGAAAGGCGGGGTATATTCCTGCAGTAGAAAAAGAGCGCATTCCCAGCAGATGGTTGGAATGACCTTCCTGTTACATGTTTATGTGACTTGTTTTCTTTGATGAGGCATGGGTGAACACTGCGAAATATCGAAATGTTAAAATTGTATTTAGGGCCAAAGAAGAAGTAAGCACTTATTCATTAAGCTGATAAATTCAGTCAACTCCCTAAAATCTGTTTTCCTGTGAAAGCATTGACTACTATGTTAATCTAGCAATTAAGCGATGGTTTAAACAAGTCAACCTTTCTTAAAGCTATCGGGATTTAGTAGCAATATGCCATTAGCCGACATTGAAAATGAAAGCGTCCTTAACACTTGATGGTGGGCCACACTCTTTCAGAAATTCCTATTAAGACATTTCGCACTAGTCTAACATGGTTGCCAGAATTGTCCATTCTTCCATCTTCATTTAATAGAAAATGCTGGGCATTCATCGCATTTATATTTGTGCACTGGGTCGATTCCCTGCCGACCGAACATTCATGCTTTATCGGCCTAGGAATGGTGGTAAACAACATTTGAATGGAATGATTATGCAATCACAAGCAGAAAACGGCATCTTTCTCTGAAAATAATAGACTTACGTCGGAATGCCAAAGCAGTTTTTCCATCGCTTGTTCGCCTTCTATTCATGCATTTGATCCTTTATCCTCCTAACACTATCGACCAGGACACGTACAATACTTTTATTGGACTCGTAAGAATGCCTGCCAGCAATAGTTTAAAGTAGGGCGATCTCCATGCGAATTCATTCATAGCATTTATTGGTTGTATGAGAGTAGATAGAAAAGACAACTGGCTTGAAGCTCAAAACTAATAGTGAAACTTGCACTGACTCGCATAGATGGCCTCCCTTCTAACATGACAGAGTTAACATGACTATGAATAAGATTCAATGGACGATGATAATTCACTAAATTGTTTATGACAACTCAGAAATATATGCTTCGAAGGGTGGGACAACATGCATTTTCTTTACTATACAAGATTAGAGTCGTCTGCGAAAGGTTGGGTCGGCCTTCATTTGCAAGTAGTTCATCGATTCATCTGCCTGCCCTTTACGACTTAATTTGACAGCGCTTGCCTGAATCGACCATGCGCAGGCCTGACGCTATAATTGCAACTCATTCCCAGTAGATGCAAGGAGATTCAAATCCTGCATGTGGAAAGTGTACGTAAGAGAAGCAATAATATTATCGTGCAGATGCAGACATTCGGTGGCGACTGCGCTGTTTTAACTCGTGCTGTTTTTGTATGCAATGACAATTCTGGATAAGAGCCTTATCGCAGTCGTTGAGCATTCAGAGGCCTTCTTGAAATATCAGTTCGTAAAAATGATTATAATAGTCAGCATTAGAAGGTGGAACCGTTTAAAGCGATGCAGCTGAACAGAGGTATGAAGGTAAATGTACAATGAAAAAGCCTTTCCAGCGTCAACTTAGCGAACATGCCGCATAAATGCCGGAAGGTGATGCAGATAAATGTCGAAATAATTTCATTACTCATTTCCATTTTACAGAAAAGAACAACACCATAGCATATTAAGCTGGACAGTACGTTATAGCTAACAGGACACTTGCGCCTGCTGTAATTGGGCTGGTAATAGACAACATTAATTAGAACGCTTTATGCGACCATCTCCCATAAAACACGAGGAACATGATTTGATGACTGCTTGCTTCATGCCAGGCTATGTCTTCAAAACATGATATTTTGTGTATCATTAAAGAAAAATACCCATCAGTCGGTTCGCCCGCAAGTATCCTGAATTTTCGTATTGGGCGCTTAAGTGCCTTCCATCGTGCCGCGACTGCACTGTATATCAGAGAAAAATAAGTTTTCACCCAGTGTCAAGCACTCATCTCGAGTCGGCACATGACATCTTTTCGTGAGCAATGGGTATATGCTGCAATTTCGAATCTCCGGACTGCTGCCGTTATTTTGCTGTTAGGATCGCAGCGGAATTCATGACAGACAGAGCTCTTCATCATTTCAAGCTATTAAATATGCCAAAGTATGGGTCCCGGAGGCAGGAAGCACTTGAGTGAAGTGATTACTCAAAGAAATCCTCAAAGTAGTAAGGAAGTAGTATAAATTCAACCGCAACGTTTTCAGCAGCAGTCAGAATTATTGAAGCAAATCTGAACATTAGCTTGAATGACTTCCACGCTTGGAAAGGAGTGGTTATGCCGGCACTGGAAGATTTTCCAGGGATCGAATATGATGAAAGATAGAAAATTACCGCTTAGAAGTGAAAGCAATACTTTATGAGGAGCGCTTTACTCAAAGTGCCTGCTGACTTGCCGACTTCCTGAGTCATTGGCAACAGTGGCATGCACACTAGAAGCCGACGTCTCACTGTCGCACATGATTGGGGACAGTCCAGTGGCAGTCAGCCAGTGCCTGTGCTAGGTACACAATCTTCTCATGCAAAATATGTAAATCGTAGCAACGGAAATCATTCAACACCCGCACCTACCTGGAAGTGCCAGCCTGCCAGCCGCAGGCACTTCCATACGACGTATGCTCTCCGAGCCAGTCTCTGAGCACTAGTGCCCAGCCCAAGCCAATATCGCATTTGGACCATAATGAATGATAATAATGTAAATTTCCTGTGGCTAATTGGATATGTTCTGAGTGCCGCAATCATTGCAAAGAGCATCAAACATCTTATTACATTGACAGTCATGCAGTTAATTTACCTCGGAAAAAGTAGCATCTAGCATGCATCATCAAAATGGAGGTTATGACTAAAACTATGGGGAAAGAAAGACTTAAAGAGTCTTATCGCACTTGCTCAAATGCTGCATTGATATCCGACTTTTGGCTGAATTATTTCGCTTGAAGTCGGCAATGCCACTTCTAAACTCGCAAGAAAACATGACATTTATATATTATTCCACAAAACCAGATTAGCCGGATATGACATATGTATAACAATAATGTTGAAAATGGAAATGATCATAGCATGGGTTGGGCTAAAACTTCGCAATAAGGAAAAACAGGCGATTTAGAAAGCCGAGGCAATAGGCTATCGCCTTTCATCTTACATTGAAGAAAATGACATTGCATTTATTACAAATGAAAGTATGTTAAACATTAGTAACATAGGTTAATGCACAAAGAAATTACCTTCATATTAACTGAATCATGTAGGTAGTAAATAGAAAGACGCTCGGTCGCTAAGCCTAAAGATTACGAATTATTACACTGCCTAGCTATAATCTATGGCAGAATGTAACTGCCTGTAACTCTTGGCAGCCAAATAAACAATTCAATGCCTGACGATGTGATTTCAACATGATGCCGACTCTTTGGTCTGATGCAGCCAGGAGAATAACTTAAACTTTAAAAACCATTACTCAGCATGCAAATGTGGTTTAGCATGATAAGTAGCAATAAGACAATAATTCTAGAAGTATTAGGGACGTTGTCTAAACTGGGCCAGCCTAAAAGTATAGTTCGACAGAATTGACCTATACAGCCACTAGCTGCAGAAACACCATTTTAAAGGACGCGTTATCATTCAAACATGAGCATTTATGATAACATTCATCCAATTGATTTAATCAATAACATTTGAAGATACGCCATAAATCTTTTGGCGTGTCCTGCAGATGGACAGAGCCAAACATAACAATGCCTATGGCTTCATTGGATGAGCTAGCTAGAAAAGCAAGGATAGCCTCCAATAAAGCATCATACATCTTGCCAAGTGAAAGATTTCATTAATGGAATTGATTCAAACATAAGTAAATGGCTTTCATGGAAATGAGTGCAAAGGAAGAAAAAGCCGACGTAGAAATATCAACAGCAGACTCAAACATGACGCAGGCAAACTATATTTCATGCGTTCAGTCTTGGACGGATTGGCTTGAGTAGTAAACACTATGAACATTGAGTCAGCGAACTTCCATTATTCTCCTGAACATAATACGCCAAATAAATACCAGCTTTACGGCCCTTAATATACAGGCTATAGAAAACAGGC	*	tp:A:P	cm:i:26	s1:i:240	s2:i:0	NM:i:2155	ms:i:602	AS:i:514	nn:i:0
+63	16	utg000001l	32648	60	245S16M2D15M1D7M2D11M2I5M2I7M1I19M2I1M3I2M4I2M1I1M1I9M1I13M1D3M3D9M1I13M2D19M1I17M1I16M2D19M3I5M2D8M1I2M2I9M3I7M2I22M1D19M1I2M1I1M2I3M1I4M1I2M2I2M1D7M3I8M1I2M1D6M1I18M1D3M3I2M2I3M1D12M3I3M2I8M1D6M1D5M2D7M3I16M1I36M1D11M2I23M1D1M1D14M2D10M1D4M3I6M2D2M3I9M2I19M3D17M3D11M1D1M2D5M2I9M4I19M1D1M1D19M4I31M3I22M6D2M1D3M1D12M2I30M1I1M2D10M2I5M1I15M6I3M5I1M1I2M1I2M10I2M1I2M3I3M1I2M2I1M3I12M2D4M2D27M2D11M1I6M2I5M1D8M1I3M1D8M1I3M3D5M1I9M2I3M3D4M1I1M1I7M6I1M2I6M1I3M2D3M4I3M2D9M1D4M2I5M1D1M1D11M2D8M1D3M3I7M1I1M1I3M3I4M2D5M2I10M3D5M4D10M1I19M7D11M1I2M1I11M5D9M1D6M2I4M1D10M1I5M3D2M1I5M2D6M5D5M1D7M1D4M1I2M1I14M2I4M2D7M3D10M3D1M1D2M1D3M1I4M1I4M1D10M2I1M1D3M2D6M1D2M1I2M1I10M5I1M1D3M1D7M2I3M1I9M1D12M2I1M1D8M6D5M3D4M3D6M1I6M1I1M4I3M3I1M1I10M1I5M3D8M2D6M2D3M1D2M2I7M2I2M3I2M1I24M1I1M2D4M1D5M3I6M1D3M1D4M5D8M1D13M3D14M1I13M6I3M3I4M1D3M1I7M2I5M1I12M5D6M2I22M2D5M1D2M1D13M1D2M3D2M1I26M1I8M1D5M1I12M1I5M1D32M1I5M1I3M2D13M1I21M2I3M2D1M1I6M2I23M1D3M3I3M1I4M3D3M1I6M2I11M1I2M9D2M1D10M2I2M1D10M1I11M2D13M1I14M1D13M2D9M2I15M1I7M2I6M1D20M7I6M1I3M1D7M1I2M2D10M4D46M1D16M33S	*	0	0	CGTTATTACGTTGTCTGTACGGGAGTTCTGAGTCGGTAGAGCTACATCTGCTCACACCACGCAGCACCATACTGACAGCGAGAGAAACATGCCATTCAGCCTGCCCAATGTGATCACGGCTGCTGCGGTTGCACGCTGGGGTAAGCATGCTCGATACATTCTCGGCTGGCTCTGCGAGCCAGATGCCGTACTGGAATACACCTGACTTGGCCGGCGACTCTAGGAAAGTCGAAGAGTACAGGCCACATAAGGCAGAGTCTCATGTAACTCTGCCCTAGCCCCGTTAACTAACGTGCTGACGTCCCGCGGCAATCGGTACCTGATACCAGCCGTCGCTCAGTTTGTACCGAAACGCCGGGAGCTGTGGCCATGCCGGATGAGCGGTCAGCCCCGTTTTCACGAAGGTCGATGCGGCGACCAAATCGTTGTAAATCCCCCGTAAAGGCAGATGCGCCATGCCCGGTGACGCCAGAGGGAGTGTGCGTCGCTTGCCATTGTCTATGGTGTACCTCTCTCGTTTGCTCAGTTGTTCAGGAATATGGTGCATCGCTCAGCTCGGTTCGGCCGCAGTCCAATTAGGCGTGATTCGGCACTGATGCAACCAAACAGCACAGCAGCACTGCGCACCGAGGCGCTCGCTGACAACGGCGACCTGATACAGCCCGTCCCTCCAAGGATCTGTAGATAGAGATTCTGTAGTTACGCCACCAGTCATCCTCGCCGGCGCACTTTCGGATCTCGATCCCCGCCAGATGATAAGCATCCCGGAACGGTGTAACAGTCCGTCACCGTGCTCAAGCAAAGGCTCGGTTTGGCGATGCGGCACACATAGAACTTATGAATCGTCCCCCGGCAGACCAGCCACGGCAAATACTGCACCTGCAGCCGCCCAGCGGTCGGCCTCACTCAGCCAGGCATCACGGGGGTGAGTGGGCAACAGCGCCAATACCTCACCCTGCATTTCTGCTTACTGCAGCCAGTCTTCCGGCGACACCACGGAAATAAGCCGCTGCTTACCGGAGATATTCACGGCAGGAAAATCAGCCGGCTTCGGTGCGGGCCTTACCACGAAGCCGGACATACACTGAGGGCACATCGCCGGGCGTGCTAAGAATCGCTGATTCTGTTGTGTCATGGGATTACTTAGAAAGTTTGTTAATGGAAAGGAAGGTCTGACCATGCCGACGTTATATGCGGAACTTACAACGCTCAGGCGATTTGCTGCATTTATCGTGCTCGTGGGTATCTCACGTGCTCCCTGGGTGCTGCCTCTTCGGTGAGCACAGCTAGACGCTGGATAACCTAATAGGGTACCGCGATAGGAGGTAGCTGCAGTGTTGGCCAGCATGATACGTCCGGAAAAGCCCTCATCGTTTCGTCGGCGTGGACAGTACAAAGGAGCACTACAGCTCAGTTCGCTGCACTGCTGCATGGCCAGGCTAAGAGCCGCCGGCTCCGGATCGGCTGTAACTGTTTCCGTGACGAAGTTACCGCATCCAGAAAACGGGCGTAGTAAATTGACGCTCGCCGTTTCGACGACTATCCGACTCTGCATATCTTCCTCATCCCGGTGACCATACCGTACAGTAGAGCTTAGAACCGTAATCACAGGCGCGCGTACTGGTGCCTTTAAGTATTCAGTTCAAACCGCTCCCCTGAATGGGATACGGCTGATATGTCCCCCTGCCAGCTAACGGCTCACTTTTCGTCAGCCGGCCTTACCAAGTCAAACATAACGGTTCTCAAGTAACCTGTCAGGTCGCTTCCTGAGAGCACCACGGCTGCGCCCGCCTGCATTCCTTCATTTCCATCCCTGCTCTTCCTGCTTAAGTCGCCCGTCAGTGCCCGACACGCCCTGCGAGGAATACTAACACGCAGCGACTATGGAGACGACCATTTTTAAAGTATATTTATTGCCGCCACTCATAAGCGTCCACAGAAAGGATTTCCAGCCCCGTGCGTCCTTCAGAACGACTCCAGTACCGGTGGGCCTCCTAAGGGGGACAGAAAGCGTCACGCTGTACGTTTTCAGGTTGGCATTCAGCCCGCCGGCAGGCGCTCGCTGAGAATAGCCATCACCAAAGCGCAGCTTCTTGATATAAGGAAGCAAGCCACATCCATACCGCCATTCACTTTCCCAGCGAATAGATGTCATCGTGCCGGAGAACAGGCCACCATCACGCATCTGTCTGAAATGAATTCAACGGGAGCGTGCGGGCCATGTCATACCGCCCCGGTTTCAGAGCAGCCGGACCTATCTGATCCCGTTTTGCGGCGCGAGTAGATCCAGCCGCGCTTGTTTCTGCCACTCGTGCCAAGCCTGCTCTGACGGCTGTCTGCCATGCTGCCCGGTGTACCGACATAACCCTAGTGCATAGCCGGGCATCATATAGTGCGGTAAAGCATTCCCACGGTTACTAC	*	tp:A:P	cm:i:13	s1:i:155	s2:i:0	NM:i:728	ms:i:392	AS:i:324	nn:i:0
+64	16	utg000001l	14281	60	9S21M1D20M2D30M1I1M1I2M2D8M2I3M1I6M5D3M1D16M2D16M1D5M11D19M1I7M1I10M1I23M2I1M1D7M1D2M5D8M1D23M1D16M1I5M2D1M3D4M1D14M1D39M2I12M1D4M1D10M2I12M1D2M1D1M1D5M2I7M1I4M2D3M3I14M1I15M2D6M1D4M2D12M1I5M3D18M1I4M2D1M1D4M1I17M1I14M1I22M1D8M1I13M1I8M3D1M1D2M1D4M2D3M1I16M1I11M1I5M1I5M1D1M1D5M1I14M1D1M1D19M1D18M2D2M4D4M4I2M1D7M8I2M1I14M3I9M1I4M3D1M2D4M2D18M5D7M1I7M3D10M1D8M1I19M4I1M1D10M4I8M2D6M2D8M1D7M1D8M6D18M6D17M1D4M1D2M2D2M1D18M2D6M3D14M2D10M2I11M1I1M2D33M4I13M1I8M3D9M6D12M1D20M3I9M1D1M1D4M3D27M1I2M2D11M2D2M3D6M1I6M2D6M1D9M1D5M1D13M1I4M1I6M3I10M1D8M2D6M2D9M1D6M3D6M3I5M2I8M3D4M1I7M1I8M2D3M1D5M1I3M3D9M1D3M2D14M1D11M2I15M1D11M6D22M2I12M2D4M7D12M1D25M2D1M1D4M2I3M1I7M1D1M1D5M2D16M1D1M1D24M1D1M1D4M1D8M2I3M5I13M2I12M3D25M2D9M1D3M1D6M1I12M3D8M3D7M1D3M1D8M1D7M2D9M2D8M3I5M1D2M2I6M1D2M1I4M1D12M3D31M2D1M1I4M2D7M1D1M2D4M3I22M1I8M1I3M3D2M1I19M1D1M1D7M3I7M2I5M3D3M2I12M1I5M2D3M2D1M1D3M3D10M1D3M1D7M1D2M1I13M3I5M1I4M2D9M1D4M2D9M2D9M1D25M1D5M1D9M1I6M1D16M1D3M2I6M1D6M1D3M2D1M1D16M1D13M3D10M3I1M3I7M2D12M1D8M4D7M1I4M1I10M3D1M1D14M1I12M3D3M1D12M3D1M1D4M4I11M3D5M4D12M3D1M1D1M1D2M7D29M1D11M1I1M2D3M1I5M1D10M1D19M8D12M4D21M7D1M1D8M1D1M2I8M2D8M4D1M1D3M1D5M2I12M2D7M2I5M1D5M1D9M1D10M1D7M1I1M1I3M2D1M1D8M1I4M5I1M1I3M4I7M5D4M2D12M3D3M1D4M1D5M1D1M4D4M1D12M1I27M1D6M6D11M2I6M2D3M5D7M2I8M3D4M1D5M1I3M2D23M3I4M1D11M3I1M1D7M1D19M1D9M1I4M1D5M2D4M6D14M2D11M1I2M1I7M1D8M2D4M1I3M1I6M1D12M2I11M1D1M1D17M1I7M1D5M1D12M2D15M1I8M4I30M1D3M1D2M1D7M1D4M1I12M1I21M2D4M1I1M2D17M1D16M1D3M3D11M1D4M3D4M4D4M2I3M1I8M3D19M5D6M2I4M2I6M3I32M1D11M2D7M3I2M1I3M1I26M3D39M2D18M3I11M2D1M1D3M11D7M3D9M1D12M3D16M2D5M4I2M1I6M1I1M1I11M4D2M5D8M3D7M3D4M1D14M1D5M1I9M2I1M1D9M1I6M1D5M4I5M1D10M1D2M1I2M1I3M7D12M1D1M1D2M1I4M1D3M1D15M1I5M1D4M1I16M4D3M2I3M1I3M2I7M1D2M1D1M2I7M1D2M3D8M1I1M3I6M1I8M1D10M1I13M1I8M1I1M4D7M1I10M1D4M2D4M2I2M1D12M2D2M1D20M1D1M1D3M1I7M2I12M1D6M1I6M2I1M1I5M1D7M1D4M2I16M2D1M8D3M3D4M6D20M1D14M1D1M1D4M4I7M2D9M1I7M1I11M1I6M2D4M3I9M2I3M1I18M2I11M2D5M3D4M1D21M2D8M4D7M1I2M1I6M1D3M2D3M2I11M3I23M1D8M1D2M2D38M4D8M1I7M1I7M2D5M1D6M2D6M3I2M2I5M1D32M3I8M2I3M1I22M6I11M1D19M3I4M2I2M1I3M2I3M2I3M2I5M2I5M1I1M1I13M2D14M2D16M1D1M2I9M4I1M2I3M1D36M1I15M1D3M1I6M1I17M2I8M3I4M2I17M3I9M2I1M1I4M1I1M1I6M1D8M1I9M1I1M2I8M1I18M1I4M1I3M3I3M1I4M2I23M3I4M1I3M1I2M1D10M2D21M1I8M1D9M3I6M1D2M2D3M2I9M1I18M3I6M3I21M1I2M2D8M1I10M1I11M1I11M1I6M1I3M2D2M1D27M1D1M3D7M1I4M1D4M2D1M1D7M1I9M3I14M1D9M2I1M1D20M1D9M2I4M2I14M2D6M1D1M1D7M1I5M1D28M4D19M3I5M1I3M3I5M5I5M3D6M1D4M2D11M4I11M2D5M1I10M1I10M1I1M1I6M2I4M5D11M2I2M1I7M1I6M1D6M1I10M1I9M1D2M1I2M1I5M1D14M1D15M3D13M1I9M1D8M1I6M2I25M1D3M4D3M2I2M1I13M1I22M2D6M3I9M1D2M2I7M7I1M4I3M2I7M2I12M1I10M2I1M1I6M3D7M2D7M1D7M1I4M1D3M2I10M1I9M1D4M2D2M1I14M1I2M1D3M2D4M1I17M1I2M1I3M1I2M1D6M1I12M2D9M1D5M1I5M1I7M1I26M1D1M1D1M1D3M1D12M1D5M2I1M1D18M1I11M1D3M3I12M3D4M3D1M1D11M1D19M1I5M2I3M3D4M2I5M3I8M1I17M1D4M1D4M6D3M2D6M1I2M2D3M1D6M6I2M2I5M1I5M1I1M5I1M1I5M1I14M2D5M3I10M1D5M4I17M2D3M1D13M2I3M2I3M1I5M1I13M1I2M2D16M1D10M2I3M1D2M1I11M2I5M1I6M1D5M1I26M1D1M3I18M2D35M9I1M2I20M3I2M2D13M2I8M3I8M1D3M1D2M1D27M3D2M1D5M1D1M2I4M1I6M1I6M5I5M3D5M3D7M1I5M1I2M1I18M1I2M5I1M2I5M1I6M1I10M9D27M1D4M1D4M1D2M1D4M1I17M2I19M1I5M2D7M4I4M2I4M5I4M1I22M7I5M1D4M3I13M1I4M1I3M2D3M1I8M1I5M1I2M1I17M1I15M4I20M1D15M1D6M1I14M2D11M2I2M1D12M7I5M1D6M1I3M1D16M5D5M2D20M2I2M1I10M2I2M1D10M1I13M1I7M2I23M5D10M1I8M1D29M2I1M1D11M5D37M1D12M4D29M2I20M1I12M1D17M1D4M1I1M1I2M1D19M1D8M1D29M2D21M1D11M1D6M2I12M1D5M1D3M1D9M1I12M1D17M1D4M1D3M2I5M3D4M2I11M1I25M4D4M1I29M3I3M2I3M1I5M5D9M2I5M1D6M3D2M1D28M2D5M1D2M1D4M2I21M3D22M2D1M1D7M1D7M2I18M1I13M2D4M3D11M2D8M2D2M1D3M2D11M3D4M1D13M1I30M3D25M1D5M1D5M2D3M1D6M1D8M1I27M1D13M2I17M1D3M2D6M4D18M2D4M1I13M1D1M1D1M1D6M1D6M3D11M2I5M1D5M2I10M1D7M4D2M1D7M2D16M1D16M2I3M1D11M2D24M1I8M1I18M2D6M1D4M1D7M2D3M3D18M1D5M2I9M1I17M1D8M1D8M2D7M4I28M1I3M4D7M3I5M1D12M2D10M4D3M2D12M2I20M1D3M2D3M1I19M42S	*	0	0	GCTGGTGTCGACTCTGAATACCGACTCAATAACACGGCTCTGTATTAAATGCTGTATTAATCATGCTGGCGCAACATGCTGCTTCTGCCAATTCCTGAGTGCGACTGCCATGGTGTTGTGTGAGTTCAAATGGAATGATGGAACGGTCAGGAAGGATGGCCTCCAAATGGATGGTAGCGAAGGAAATAAGAATTACCGATATCGATAAGCTCAGGAATATTTGATTCAGATGATATGACTATCAAGGCCGCCTGAGTGCGGTTTTACCGCATCAACGCTTCACTCGAGGCGTTTCGTTATGTATAAATAAGGAGGACGACGATGCAATATGCGCCATTGCAGGGGCCTGTTGCTGGCTTCGCCCTTCGACGCTCATGGAAACCGAAGGAGGCCGAATGCATACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAGTCCCAAAAGAATGGATCAAACACTTATGAGGTACGACTCAAATTCACTATCGCCACTTTTTATTGGCGATGAAAAGATGTTTCGTGAAGCCGTCACCATTATAAAATGGATATTAACCACTGAAACTGAGATCAAGCAAAGCATTCACTAACTCCCCCTTCCTGTTTTCCTTAATCGACGGCGGTTTCGCGGGCGATATTCACAGCTACTTCAGGAGTTCAGCCATGAACGCTGCTTATCGCCCTTCTGCCGCTTCTCGTTCCATGCGCTCCTCCCGTCACTACCAGCAGCTTCGCCCGTGAAGAGAAAGAGGCAGAACGGACGACATCGAAAGGCCTGCCCCAGCACCCTGTTTGAATTCGGTGCATCGATTGAGCTTTGCAACGCCGCTCACGGGCCAGCAAAATCCATTACCGTGCGTTGATGACGATGTTGAGTTTCAGGAGCGCAGGGAAAGCAGTGCTACACCGTGAAACGAATGGCGAGAACGGTTGATATTGATTCAGAGGTCAAACGAATGAGGTTCTCTGCACTTGCAACGCCGGGTATGGGAAGCTGGCTGAACGTGTCGGCATGGATTCGGTACGACCCACGGAACTGATCACTCTTCGCCAACGGATTTAAAGCTGATGCCATGAGGGTTCCGATTCATCGCATTACTGATCGTTGCGACCCAGTAACCCTTAATCCGTGGACGAAAGGAAATTTACGCCTTCCTGATAAGCTAAATGGCATCGTTCGTGGTGGGCGTTGGAGATGGCTGGTCCGCATCATCAATGAACCAGCAGTTGATGGCATCGTAAATTTTACGACCAATGATGAGTTCCTATCTCCTGCCGCTTCTCCCACGCGACCTTAATATCGATCTGCGTTACCGGTGACCGGGATGAGAATGCCGCCGCGAACCATTCAAACTGAAGGCAGAGAAATCACGGGGTTGGCAGTCGCATCCAACGGATATTACGTCACAACCCATGATTCAGTGTGCCCGTCGCTTCGAGATCTCGCTCGACCCTAACAAGGATGAAGCCGACCCGCATTGTCCAAAATACTGCATAATGCAGAACGTCATGGCCCGGAACGAACGCGACATCATACTCCGGTTAACGATGAAACCATGCAGGAGATTAACACTGCTGATCGCCCTGGATAAAAACATGGGATGACTTATTGCCGCTCGTTCCCAGATATTCGCCGCGACATTCGTGCATCGTCCATGAACTGACACAGGCCGAAGCATTAAAGCTCTTGGATTCCTGAAACAGAAAGCCGCAGAGCAGAATAGGCATGCATGAAGGACGCTATTATCATGCAGCGTACCGGGATTAGATGTGAGAGTGTTCGAACAGGGATGATGCGTGCCCAGTTACCACCCCTCGGGGCGTTCCGTACCTCGGATTCGCCAGTCCTATGCAGCAAACCCCGCTCGAAAGAATGAGCCTGACATGAAATGTCCTCTCATAATTCCACACCCTGCTTGCTGAGGTTGCACCGGGTGGCTCCGGAATTAACGCTAAAGCACTCGCTGGGGAAACAGAGCAGGAGAACGAAGCCAGACTTGAGTCTGAAATTCATGCGGTGAATGTTACTGAATCCCAGTAATCTATCGCGAAGGAAGGTATCCCTTATGCACCGCCTGCTCTCCGATGGTTTATGCAGTGACGGCAACGGCCTTGAACTGAAATGCCCGGTTTACCTCCCGGGATTCATGAAGTTCCGGCTTCGGCGGTGGTTTCGAGGCCATAAAGTCAGCTTAAGCCCAGCTGCAGTACACAGCGCATGTGGGTGACGCGAAAAATGCGCTCTGGTATCTGTTTACAAGCTGACCCGCGTATGAAGCGTGAAGGCCTGCATTATGTCGTGATTGAGCGGATGAAAAATCCACATGGCGTTTGACGAATCACGTGCTTCGGAGTTCATCGAAATGGACGAGGCACTGGCTGAAATTGGTTTTGTATTTGGGGAGCGACTCGGCGCATCCTACTCCGGTGTATCGCTGATATCTCGGGTCGCGCATTGACCTTCGTTACTCGAGTGCAGACGAGGATGGGGAGCTTCCCGAATCTTCTGTTATCCGAAATGACTGAAAGCACCGGCTGGCTGAGGAGAAATAAACGAGGGGTGGTATGCACAAAGGCATTCTGTTGAGTTAAGAACGAGTATTCTCCGCAGATGGCACATAGCCTTGCTCAATTGGAATCAGGTTTGTGCCAATACCAGTAGAAACAGACGAAGAATTTCATACGTTAGCCGCATCCTGTCTCACAAAGCTGGAAATGATGGGTGGCGAAAGCAGAAGCAGATGAGAGAAACCAGGTTGACAACCACGGAATGCGATTTTCTGAAGCGGCTTCATATTCTGTGCTTATGCTTGCTAAAGATGGTACAGACTTGTTCAATGACACCTCATGCAGGAAACGCCGTGCACCGATTGCCCGTCAGGCTAATTTCTGAAATCAAAAGCCAGACAGCATATTCCGGATAAAACGTCGTAACATTTGCCGTAGCGATTAGTGGAGAAGACCGAATGCGCCGAATGAACGGGATTTCGCCTCTCCATTCCAGCCTGGAGTTCCTGCTTCGCCTGGCCCTAAACGGCGTCTTTAAGGAACGATGAACATGAAAGCAAAATCCACGGAGCTACAGGCTCCCCTTTATTATTCGCATTCACCTCAAGCGTATTAACCAACAGTTCAGGGATTAATGAAAGATGGCACATCATTGATTCAGCATCACCAGAAATAGAAGATTACAGCGCAACAGCAATAAAGGCCCCTCCTATGAACCACCCGGCTATCTGCCACTCATTGTTGAGTGTGGCGATCCGATAGATGAACGAAGACGGTGCGTCGTTCAGGGTTGTCGACTTGTGCAAGTTGCCAGGAGGATCTGGAACTTATCAGTAAACAGAGGTTCGAAGTGAGCGAAATTAACTCTGAGCACTGCGTGAAGCGGCAGCAGGCAATGCATGACGACTGGGGATTTGACGCACCTTCCATGAATTGGTAACACCATCGATTGTGCCGGCGGAAACGGCGAGGGGAACGGAGAAAGGAAGAGCAATACATTCAACGCCGCTCACGGAGAACGAGGATATTGCGGCGCTAACAGTAGGGAAGTAATTCCTGCATTGGAGATAAGCCACTTCAACGGAGCAGCGTGAGTATTACGAATGTTATCGGATGGGAGTAAGCGGTATTGGGACTGGAAAGCAACGAAGTCGTGAAGACGGAAACCAGTTTCTTGTTGTTCGCCATCCTGGGAAGACTCCTGTTATCAAGCACTGCACTGACCTGGAGGAATTTGCGTGCAGTTAATCGAAATAAGGCGTTAGTAACTATCGACACTCATTACGCATCGCTATTACGGGTTTGGAGGTCAATGGGTTCAGGATGCAGCTGAGTATCTGCATGATGTCTTACCCTGGCATTCGCATCAAAGGAGAGTGAGATTGTACTTTTGTATAAAAGATAACGCTTGAAAATGCTGAATTTCGCGTCGTCTTCACAGCGATGCCAGGTCTGTGGTGATGATGACCGTACTCAAACATCGGTTGAGTAGCTCTCTATCGCCTGCTTACAGAACATTGCTGATACCGTTTAGCTGAAACGACATACATTGCAAGGGGAGTTTATAAAACCGTATCAATGAGTTAGAATCTGAGCAAAAGATTGGGCGTTATCTACTTCCCAGTGCTTCTTCTTCTCCGGTGCCTGACTACGCGCTTCGTTTATGTAGATGAATAGATATAGAGTGGATAAATATTCGATGAATCATTATAAGTCTAATGAAGACAAATCCCCATTCTGCAATGTGCGGAAATGACTGATACCGTGCAAAATTATTATCACGAGTACGGTGGAAACGATACTTGCCTCTCTGTACACAAAACATATAGATGATTAAACCCAATTACATAACAATCGCACTCGCGGGGATTTATTTATCTGAACTCGCTACGGCGGTTTTGTTTTATGGAGATGATAAATGGACGCTTCGAGAGTCACAGGAGAATGGAATGGAGCCATTCAACAGAGTTATCGAAGCGGGAAGAACATAACGAATGGCAGAAGATCGGAGCGATATGGGCAGATAGCAAAAGATGCAGGTAACCAATATTCGAATTGAAAGAACTGAAGAACACCCAAGCCTATGGGTGCGGTTTTTCTTGCGTGGATCGGAGACTTTGCGATGTACTTGACACTTCAGGAGTGGAACTCGACGCCATGGCGACGTCCACGAAGCCTTGAACAGTTCGTCATTCGGAATTCCGAGGATATCCCGCTCCCCCTTCCTCTAGGATGGAAGAGAGTATCTGTTCGACGAGGAATCAGTCCTAACGGTTGACTTAAATCTAGCTGACAGTAACAGGGCGTTTTGAAGAGGATTAGAAATCGAAGAAGGCGACATTACGGCCGCCGGGATTTACCCCCTAACCTTTATATAGAAACAATGGATATTACTGCTACAGGGGATCAAGGACGGGTAAAGGAGATTGGATTAGGCAGAGACAGGCGAATCGCATTACTGAAGCATACGGGCCAACGGTCGGAGGCCTGCCGAAGAAGAACACAAGCCTCGACAGCGGAATCAACAGTTGATAATTCCGTTACGTTACATTCATGGCTTGATCGCTACGAAAATCCTCAGCAGAGGAATTAAAGCAGAAGACACTCATAAATTACATGAGCAAATTAAAGCAATAAGGAGGGGTCTGCCTTGATACGGCGCTCACCGCACGCAATTGCATTAAGTACAAAGAACAAACCGCGCAAGGGGCACCGTACATAAGCCGGATCTTTAGTATGATTAATAATAACAGCGATGCATTCCGCCATTGCGGAATACTCCTGATATAAATGATGTCGCTGCCACTCGCGGAGCAAATCAGGATAGGAATACGACTTACGGCTGACGAATACCTGAAAATTTATCAAGCAGCAGAATCATCACCTATTTGGCTCAGACTTGCAATGGAACTGGCTTTGTTACCGGGCAACGAGTATGTGATTTATGCGAAATGAAGGCCTAGACGTGGGGATGGATATTCTGTCCTATCAAAGCAAACAGGCGTAAAATTTCATCCCAACAGCATTGCATATTGATGCTCGGAATATCACTGAAGGAAACCTTGATAAAGTGCAAAGGAGATTCTTGGCGGAGAAACCATAATTGCATTACTCGTCGCGACCGCTTCATCCGGCACAGTATCAAGGGCTTTATGCGCTAGCACGAAAAGCATCGCCCAGGTCTTCCTTCAGCGAATCCACGCCTACCTTCACGCTTGGATGTTTTATGTCTGCAAGACTCTATGAAGCAGATAAGCGATACAAGTTTGCTCAACATCTTCTCGGGCATACAGTGGACACGATGGCATCACAGTATCGTGCGATGACAGAGGCAGGGGGAGTGGGACAAATTGAAATCAAATAATGATTTATTTGACTGATAGTACCTCCTGTTCCTTCGATAAGTACTCCCAATGCACTTCTGTATCTATATTCCTAACTTAGTATAAAAGCTGAACGAGAAACGTAAAAGGCCATAAAGAGCCACCCACGGGCAGCTTTGCATAAAAGACGGATAATACTGTAAAACACAACATATGCAGTCACCTGAATCAACTACTTAGATGGTATTAGTGACCTGTAACAGAGATTAGCGCAAGGTACTTTTGTCTTCTTGCCCTAATTCTTTTAAGCAACGTGGTCGCATCCCCAGAGAAGCACAAATGCCTGGATTCAGTGCAAAGGGTGCCCACTACGACCTGCATAACCAGTAAGAAGATAGCAGTGATGTCAAACGAAAGCATGACTTCTTCTTTTCTTTTCCACGGTACGACCTCCCCCACATCAGGATGCATACGGGTCCCCCTCATAACTGTAGTGAATGTCTGTTATGAGCCGGATAAGGAAGTCAACACTTATGAAAATGGCTACGAAGTCCGTGGCTATCTATCGGGCTTATTAGTATTTGAAACGGTTTCCAGAAGCCTGAAGAGCTAATTGGTTCGGCGATACTATATGCATTAATAGACTATCTCGGTGTAAGCCCGCATGCGGAGCGAATCGCCACTCGCATGATTTTCGGTGTAAAAGGAAGCAGAAAGCTGTAGAATATGGAAACTACAATACGATGCGCGTTAAGTTCAATCACTACTACCGTTTAGATGGAAAACGTATGTAACCAGTAACTTAAAAGAGAGTCCTGTGTTGCCGCCAAATAAATTGCGGTCCTTTTAATAAAATCATTACTATATGTTGGAGTTTAGTGCTTGAAAGAGGCGGTATATTCCTGCAGTAGAAAAATAAGGCATTCCTACGAGCAGATGGTTGGAATGACTATTCCTTTTGTTACAATGTTTATCTTACTGTCTTTACGGTGAGCATGGTGAAAATGCGATATCGAAATGTTAAATTGGTTTTGTAGTACAAAGAAGAATAAGCACTTATTCATTAATAGATAAATTCATTCAACCCCCGGCGAAATGTTTTTCCTTAGTGAAAGCATTGAACTACTATGTTAATCTCAGCAAATTAAGCATCGTCAGGACAGATTATGCGGAAGCGATGCGAGGATTTAGTAGTATGGCCAAATCGGTGCTCGACATTGAAATGAAAGGCGTCCTTAACATTGCCTGCCCTCGGCTTCCTAACTCTTCTTCCGCGTTCAACGTTCGCACGTGTTAAATGGTTTGCCAGAATTGTCAGATTTCCACCTTTCATTTAATAGAAAAGTGCCGGATTCAGTGATTTAACGTTGAGGTGACGGGTCCAATTCTATGCCCGGCACGAAACATTCATGCTTTTATCGGCGGAATGGGTGGTAAATAAATTTTGAATCGAATGATTGGTGCAATCACCAACCCAGAATAAAATGAATATTTTCTCTGAAATAATAGACTTATCCAGTACAGAATCGACAGGATATTCAATCGCCGGTTCGGTTTCGTTTAGTGCATTTGATCCTTTACTCTCTTAAAGAACACCTGACCCAGCAAAAGGTAATACTTTATTGGACTCACGAATGCTGCCAGCAAATAGTTTTAAAATCAGGGGAAGCCGCGAACGGAGCATGCCCGCATTAATTGGTTGTATGAGGTAGATAGAAAGACAACTGGCTTGAAGCTATCAAACTAAGTAGTGATGAAAACTTTCAAATATGGAACTCATCAGCCTCATTTCTAAATATGAAGAGTTAAGACGTAATGAACCACAGATTCAAGTGACGCTGGGTTTCCCTTGGTTTCTCTGATATATCCTACAAATATCTGCTTCGAATGAGCTCTGGACATGCATTGTTTATTACTATCACCACAAGATTAGTAGATGTCGTTGGCGAAAGGTCTGATTAGGGTTATTCATGAACCAGAGGTTCATCTGCATCATTTGCTCTCTGCCTTTTGACGAACATTAAGCGACTTACTCGATGCACGCAATCGTGTAGCAATAATGCAACCACTTAGGTTAAACAGACCCACCCCAAGGTG	*	tp:A:P	cm:i:86	s1:i:864	s2:i:0	NM:i:2430	ms:i:2796	AS:i:2796	nn:i:0
+65	4	*	0	0	*	*	0	0	TCTTGACTTGACGGGTCCAAACGGATGCACGTGGCTGCATTAGACCATTATTGGTCGTTTTAATACCGCAGGAAGGTGTAAATTCAAGGCAGGAACGGAACTGCCGATGGAAAGCGACATCTGGAATGCACCGGGATGACGACTTGACGTTGGATGGGATAAGGGGGTCGAAGCACGTCATGAGCGGAACTGATCTGGTCCGACAGTTCTTGCCGCTTGAATGGAGAGCTCAACGACAGAGGCAGTAAAGCTGCAGCGACGGCCGGCCCGGATGCAAGAAGCAGCGGCATCTCCGAAGCCGTCTAACGGGCAGCTCCTCCCCATGAAGCACAGAAGGCTTCGCACCGAACGGGCGGGGCGCTGGAGCAGCCTCCGTGACCGCCGTCGGAAGAGTAATAACGGAAGGGCACTACTCAGGGCTCGCCGGGGGAGGTTGGCTGCATGAAGGGTTATAAGCCCCGACCTGGTGAAGCGGCGAGCCGCGGTCGCATGAGGCCCTGGAGACCCCCGGCCCGTTGACAGCGTAGTGCAAGGTGTCTGCCACGGGCAGAATCGTCAGGAGCTAATTAACGACTTAATCGACGTAATGGGTTCAGGCGAACGAGCTGAAGTTCGAAGCAAATCGAGCAGGTATCAGGCAGAAAATCAAACAGATGCGGGGCCGGCGCGTGTTGTGACGAGATGAAGAATCCGTTGACGAAATCTGGAGGGGACGCGGCTTCTACCCCCGGACTGTGCGCCGGAAGAATCTCATGCCTGCACCGACGCCAATGAAACGATACTCGACCCCGAGCTGGCTGCTATTGGCTTAGCCCGCGGATCGTATCGGAAGCACGGCTGGAAAGGTGAAGGCGCGAGCGGCAGATAGTTCGCAAAAAGCAGCAGCCGGGCCAGCTCATGCGCTAGGATCGCAGGTCGAAGGTACGCCGGCAATACTCTGAGCAGGCGGAATGGGAAATGAATCCCGCCTGGAGGGATACGTATGGCGCCGAATAGTCGGGCTGGATAACGTCATGTCGCGGCCACAGCAGACGACTGGAGCCCTGGTGCGGCTACCCCGGAGCATTCAGCCCGTAGGAATTAACGGATGGCACCTGAAGGTCCGGCTGGAATGGATGGAAGAGCAGCGCCCGGCTGAACTGTATGTCGCGATAGATCCCGGTCGCGATCCTTTGGACTTGCCTACGAAACTGGCAGCGATGCTGATCCGGCAGTGATCAGCATGGCGCAGCTTCACCGAAGCCGTTCTCCGTTAGGTTCTCGACTCATGACGACGAAATGTCGTCCTGCCTGAGACGAGATGCTTACGCATTGTCGTCACGCATCGCGGGCCCCGGCCTTATCAGGCTGGTCTGCGAGCACGTACGCCACGTCGACCCGAAGTCATAGAATTCAGCAAATGAGTCCGGCGGTTCTGCAATAATTTTGCACCTGACCAAATCCATGAATCAGAATAAAGCAGCGACTCTGAGCACGCCGGGGATCTTGTGATTTCACCGTGTGGAAGTTGTCTTCCGCGGGAAGAATATCCGGCACTTGGCGTGGGGGAATCTTTATCCGGACATGATGCATGAAAGGGCTACTGCGTGCGCTCCGGCGGTCTCCGTTCGTAGCCCGGTGCAGCTAGAGCCGGCTGGCAGCTAGCCGGATCAATCAGTCGCGGCGGCGCGTCCGCCTCGTTGAAGCGAACTACAATGTGATCTGAGCCTGAGGCATGGGATCGAGACTCTTAAAGTGCCGGCTGCTCTGAGAAGCCGCGATAATGCGTGACGCTGGCCAGGGTGCCCGTGATGAGGGTTCGAGACGCCGCTGCGTGGGTCTGGACTTTCCGCAATGACGCTCTGCAATATATTCCGGGCGACGGGCAAACCCAGTACCCGACAAATCTTGACGTCGGTTACATTCGTAGGATGCTTTGGCATCGCACTTCTCAGCGGACGGATTAAATCGATCGATGCCTGCATGGATCGCGACTCGTTGAAGGGTCCTACTGGATTTCCCGTCATGCCCGAATCCGGGAAGCACTAGATAACGATCGTTTATACGCGCGCCTAGAGCGCTGGAAGCCATTACTCTATTTCTGGTTGGGGCCGCCGTATGGCTCTCAGCCATTCTACCGCTCTACTGCCGCTATCGTTCCCGGGTCGACTGATTCGTTCCCTTGAGTCTTCGATTTAGGCAAGCCAGAATTCCTTGAACAAAGGTGAACCATGATTGCAGGGATATCCCCCGGCAGGAAGCCTGGATGGGGTGAATCTTGGAGACTCGAGTTCAGAGCACGTTCAACGAAGCGTGATTATGGGCGGGAATCACTCTCCCCGCAAAGGTCCTTGGAACGCTTCCTTTTTATCTATGAACCGGGCAAGGACTAAGTCACTGGCAGAGCAAGGCGACACTAGAATATCGACGCCGTATCCGCTTTACGCCCCGAAAGCGGTTTGAATGAAAGGCAGCGGTGCACCGCTAAATCCTCGTCGACGTACGCTTATTGCTCTACGCTAGAACCAGGATATGCGGATCTTGCTCGAGGGTGCAGGATTCCCGGAGCGATGAATCGTGTACGCGTTTACCGAAGTGCAAATGAACCGTTGCCGTCAACCATCAAAGCGAAGGAAGCGTTTAGCCGATTAGAGCACGAACTAGCCTGACGAAAGAAGTCAGCAGTGCGAGCGATCGCATCCAGTGCACTCGTTATCCTGTCTCACGCCGACGGAACATCAATACTTGCAGACAAATTTTCAGAGCTCGTGAAACCTGCCTGACTCGAGCTGCAGCATATGCTGACGCATCTCAGTGCAGTTAGCATTTAAGGCTGTTCTAGGGCGTATGCATGACTCTGACCTAAGCAGACGGTTCGATATCGACGACGAGGCAGCAACAGCCTGCAGGCTAGGTGCGGCTTTGTAGGTTCTAAGGATAGCTTTACTGAAATTTGAGGGGTTCCTTTCCAACTTATGAGTATTTTAGAGTTAATCCCAATACCCCGACTAGGAATCAGCGTACCAGGGGCATTGCCCCAGTACAAGTCGTGCATTCGTGGGCCGGAGGAGGGAGATGTCTCTACGGGGTGCGTTGAGGTATGAACCAACGGAGCAGTTTCACTAGTTATGTCACCACGAATAGTGGATCAAGGAGAAGGTGCAGATTGGGGGTTGGCTAGTCAGCGAGGGTCACCCCCATGCGTGGTGCAACAGATCGATGGCTAGGTAAAGCATCGGGCAGGTTGAAAATGGTTGTAGATTATAATCAGGCTAAGATTCAAGTTCTCATGTTGTCAAGGATACCATGCAGCCTTTTATTTGGAGCACATTGTAGCTATGTTGAAACAAATGTTTGAAATGAACCTTATATCTCAGGCGGTGAGATTAGAGTATTTCGAGTAGTTAGAACTGTGAGTATAGCCGATCATCCGTATACGCAAGCGCGACGGCTGTAAAATCAGATTTTACGGCTAAAGAGGATTAGAAAGGCATGATGTGATGCTGTCCTGTATTTCGTCACCTGAGTTACGATCAAGGCCATAGAGGTTAGTCAGAATAGAAGTAGCTGGAAGGGCATAGTCGGTAGCACGGACCCTGGTTTACGGCTCTGGAGCGGAATACGAAGAGGTAGCGACGGATGGCGAGCACTAAGTAAAATATACAGGGTAACTGGCGTCACAGTGAAGTGAACAGGAAGCGATCTAGATTTGAGGCATTTACATCGGATTTGACTGTCACCCATCAATAGTCGATTGAGGTAACTACGGGGACGAGCCCGCCTTAGTGAGGCATAACCGACAGGACATCTACTAGGCGTTTCGTCAGGATGGGGCATAGATCTAGATGACCGCTAAGATTGAACCGGCGTCAGCAGGAGTTTAGATCGTGACTACCGCTATTAAGGGCACGAGTTAGTACCGCTGAAGGGTAAGTACTTGCTGAACCGTATCTAGTATGGTCCGGTAATGTTTAACCAGAGTCGCCATAAGGTCAGGTAACGGGTATTCAAGAGATTGTCCTCCATAGATCACATTGTCTAGATGCTTTTATTAAAGAAGCTAAGTCCATGAGACGAGTAGATTTTACGTAAAAGGTCAGGCATCCTGTTTCTCGAATCACCGTATACGTCATCAATCTTGTACAACAGCAAATGTAATAAGCGATACCGACTAGAAGTATAGCGCCATTATTATACATAAACGCTGGAATACCGTAAGCGACCTATCGCTTTCTCTACTATACATGACATGGTTCACAAAGGAGATGTTTAATTTTAACTGGTCGGGGGAAGGATGCGAAATTAGAGTACTACCGATTGATTCTCAGGAGATCGGCTAGGCACCCCAAAGAGATGGTCAAATTGTAATTGGTCGCTCTTGGGGTATGTTTTATGTAACCATCAATAGATAGATATTAGATCCGGCACTACGTTGTGCGTTGGGAAACCATCGATGCGGGAATATTACCAAGGTAGGGGAAGCGATAGAGGGGAGACCTAGACAGAAGCGAGGACGATACATCGGGCGGTGGCCCCAGTTAACCGTATCCGTGACAAATAGCGAGGCGTGAGGATTAGATCATGGCTGCTGCTAGGCGTTAGTACGGCTGGATACGCTAGTCAGTATAGTAGGGGAGGCATCACAAGCCACATCCATGTTGTCTAGGTCTGTTTAGAGTCAAATGAGCGGAGCATCCGCCTAGAGGGGATTTGGGATCGCGGCGGGCTATAAGTTAGGCTCGCAGTGAAATAGCCCTATTAACGCCAGGCGATGCGTCGTGAGATAAACCGTCTGCCGCCTTTACTGTCCTGTACGGGGAGACGTATTGGGGATACAACAGCGGGAGTCCTCCTAGGAATCCAGTTTAGGAGTCGGTAATATTTGCCCTATGGATAACTATCGTAAGCCTATCTACTCTGACCCTAGAAAAGCGCTATACTAGTGGGTAGGCGCTCCTATAGGATCTGCTATCTGGCCTCGTATCGTAATGGGTAGCTGCTAAACACGCGTTTAATACAAGGTGCGCGCCGGTACTACGAAGCGGCTACGGACCAATAATCGAGCCGGCCAACCGTGGTCTATACATGGGATTAATACCATGCGAAGTGGGGTTAGATAGGATATAAGAGACGTGGGGGTCCAGGTAAGACCGTCGGCGAGAGCCAGCAAGACCGTAGGTGGGTATGCTAAGTGAGTGGATTGGTCGCGGATCACCGTCAACATGATAGAGAAAGGCAAACAGGGGGTATGACACTTGAAGGGGTACGTCCACTGCGGCAACCCAGCCTGATAGGTGTCTTAATTGGAAATGTATTGAAGCCGATACAAGCCCGCTGGAGATTCACCGTTAATGCCGGCTTCCGGATGTGGGTCGCGCTGGCCGCGGTGTCAACCTTAGAGTGGTTCGAGCGTCGGTGCTAGGCTTTGGCGAGCACAGCCGCATCACTGGGTGTAGGTGGGGTTGTATAACTTATAAGGAACAATCAAGCGCGTCAGCGGTGTGCTCAGCGATTTTATCGCTGAGTGGCCTGTATGCCATTACTGGCGTATAGCCTCACCTCGTAGCAGCTAATCGTTCGTGCGAGCACTCGTCGGTAAGGTCCTCCTCCTAAGGCGACCGTGGTACTTAAGATACTTAGCGAGCGCCGTTTAAGGCCGAAAGTCTAGCGCCCTGGATAGGGTAGCCAGCGTCCAGCGTTAATAGAGGTAAAACATTACCTCGCAGCCTATAGTGGGAAGGCAGGCACATCAAGCTACGGTGATTGTTGCGGTAAGAGGCCATGTGCCCGTTACGTCATCAATGTTAGCCGAGGTAGCGTAAGTTGGGCTGGTCCAGCCACCGGGAGCAATCAGAAGGGGGCCATCGATT	*
+66	16	utg000001l	23684	60	182S24M1I2M1I4M1I7M1D8M3I7M1D8M1I8M1I18M1I7M1I11M3I14M3D15M5I4M4I4M1I3M1D1M2D16M2I12M6D3M1D9M2D8M1D13M2I24M2I5M2D32M3I5M1I10M1D3M1D1M2D5M1I1M2I8M2I2M1D1M2I9M1I8M1D3M4I4M2I8M2D2M4I3M3I9M1D11M1I2M3D4M2I21M1D20M2D4M1D3M2I2M1D5M1D10M1I14M2D18M3D23M2D3M1D14M3I5M2D25M1D5M4I16M8D6M5D3M3D17M2D1M1D11M3D8M3D5M2D8M1D3M1I17M2I1M1I5M1D1M2I3M1I6M1D12M2I11M4D6M1D5M1D13M1D3M1D5M1I30M2D6M2D6M1I8M1I13M1I23M1I3M3D10M1I18M2I6M2D11M2D6M1I21M2D6M1I16M1D2M1D6M2D4M3D12M4I7M1I4M3D1M1I3M4D7M2I3M1D19M1D10M1D26M1D4M2D5M7I7M1D3M1D12M3I2M1I3M2D1M1D2M3D13M3I2M1D2M1D4M3I2M3I6M3D3M1I16M2D13M1D2M1I9M2D9M1I8M1I4M2I21M1D4M1D17M1D2M1D16M1I9M2I3M2I5M3D2M1D2M2D7M2I1M1I14M3I7M1D1M1D9M2D3M1I1M4I4M2I7M1D24M1I5M1D9M4D3M1D2M1D3M2D11M8D18M1D24M2D4M1I2M2D2M3I4M2I38M1I20M1I5M1I3M1D7M1D4M1D1M1D7M1D7M1I11M1I4M3I3M1I4M1I5M1I7M1I5M1I15M1I5M1I1M1I7M1D13M1I21M2D12M2I9M1I4M4I3M2D4M4D12M5I13M1I11M1I6M6D8M2D10M2I16M2D4M4I3M1D8M1I10M1D5M1I8M2D12M2D1M1I7M1I6M1I7M1I8M4I40M3I4M1I2M2I7M5I2M1I4M4I3M1D5M2I9M2D7M3I3M1D6M4I2M1I8M1I1M1I9M2I3M3D8M1D2M5I2M2I6M7I13M6D4M2I12M1D6M1I2M1I17M2I1M1D9M1I2M1D6M5D3M1I2M2D33M3I6M1D2M3I2M1I5M1I1M2D5M1D4M1D3M1D5M2D3M7D6M6D1M4D2M2D9M3D3M1D1M1D8M3D2M3D4M1I15M2D2M3I3M1D17M2I1M2I5M1D15M1D6M1D9M2D34M2D5M2D2M1I4M1I3M3I2M1I3M1I9M1D10M2D10M1I2M1D1M3D1M1D3M1D11M1I5M1D3M6I1M1I5M1I10M1D8M1D2M3D3M1I13M3D2M2I2M1I3M1I14M2D7M1D7M2D6M1I1M2I6M1D9M2D3M3I6M2I5M1D3M2D2M1I13M2I4M3I13M3I11M1I6M1D24M125S	*	0	0	CATGATGAAAGATAGAAAATTACGACGCTTATCGGAAGTGAACGAATAGCTTTATGGAGGGCTGTTTACAAAATCCGTAGACCTTCAACCAATTCCTAAGTAGATGGCATAACAGCGCATGCACCGAGACACGTTTGTACTGTCCTCGATCGCTGCGCCTCCAGTCCCCCGCCGATCTGCGTACAGTCATAGATGGTCGGGTGGGAGGTGGTACAAATTCTCATGCAAAATATGTAAATCGGTAGCAACTGGAAATCTCTTCAACACCCGCACTATCGGAAGTTCACCAGCCAGCCGCAGCACCATTCCTGCAGTCCTATGTCGCGGCTCATTTCCGTTAAAGATCGTTGATTACAAGCCACAACTGGCATTTAATACATACTTACCCACTAAAATTTCCTGTGACTAATTACTATATGGTTCTGATAAGAATCATTGCAAAGATCAACAACTTGTATTACATTGACAGTTAAGCAGTTGACATTTATACCTCTAAAATATCAGCATCTAGCATGCAACCTATCAAAATGGGGAGTTTATGACTAAAACCATGGGAAAGAAGACAAGCGGAATACGAGATGGCACCCCAACGCTGCAGCGATAAGTGTACGGCGGAATTATTTCGCTGAATTTGAAGGATCCCCAACGCAGAAGTTATAACATTATTATTCACAAACAAAACCAGATTAGATATGACATTTGGTAAATAATGTTATTGAAAATGGAAAGCTCATTAATGGCTTGGGCTTACGACTGCCAGCTCTTTAATATTCGCTCGGGATTCTTCTCAAAAGGTCGGGTCGCTATCTTACGAAGAAAGTGACATTCATGTTAACTGAAAGTAAACATTATAAAGTTAGACCGCAAAAGAAATGTCTTCAGAGCACGCATCAGGTGAGCTAAATAGAAAGACGATGCCGGTACATTATAAAATACGTTTGACTGCTACATGCCTAGTAATCTTATGGCAGAATGTATAACTGCTGTAACTCTGCATACAAATAACATTGCAATGGGTGACGATGTGATTTCGCCAACATGATTCGACTGTTGTATATGAAGCCGGAGAATAACTTATTAAAATTAAAAAGATTACTCAGATCGACCCCATTTAGCAGGATAAGAGGATCAAAACTCCTTGAAGATACTAAAGAGCTAGACGGGGTACTAACAGTACTTCGACAGAATTATTAGTTGACTATACAGCCAAGCTGCAGAAACGACTTTAAAGGACGGTTATCACATTCAAACATTGACCTATGTCAACATTCCAAGCTAATTGATTTAATCAATACAACATTTGAAGATTACAGCGTACTCTTCGGCGTCGGGTCCTGCGAGACTCCGCTAAGATAGCCTTATGGCTTCATTTGGGATCAGAGCTGGCTAGAAAAGCAAGCCTATTCAATAAACCAATACATACAATGCCAATTATAGATGAAAGACCTCAGTAATTAGAATTGATTCACGATAATAAAATGTATTCTCATGGAAAGGGTACCATTAGAAGAAAAGCTAACCAGTGAGAAAAGAGCACGCACAGCAGCGAAACAGGAAAAGAGCTGCCATGCATTGGAGGTGCAGCAGGAACTAATTGGCGGTGATGTAAACTAAACACGTATGAATTCCATTATTCGAAGATAATAATTCGAATAACCAATACTCAGCTTTACAATATACTATACCAAATGGAAAGCGTTATTTCATACAACGTTTCTGCGGCATATCACAAACGATTACTCCATAACAGGGACAGGCAGGCCACCAATATCAGGTGCAGTTGAGCCGACAGGTTCAGCAACACCCGATACTTCTTCTTCCAGGCTTTCCAGCGCACGAGGTTTCTTCCTTCGTTCGCAATCTCCAGATTGGGCATCCTGAAGCGGCGCAATATGCTCACTGGCTATGCATCAGGCTTTGTTTCTTTCCTCCTCGCTTCCGTCGATTTCTTTCCTTCCCCTTCTCTTCACCCAGGCTGTGCCGTTCCATTCTACTCCCTCCCCGGCGATAACAGTAAACATTTTCCCGTAGACTAAACGAGTTCAGAAACTTAAAAGACGTTACCAGGAATCAATAAGGACGGTTTACCCCGATGAGTCTTCAACGAGATATCGACCATTAGCGCCTGATCTATATTGAAACAGACGCCAAACCCATCAGGAATATTATCATGAACAGTGCGAGGTAACAGGTACTTTTACAGGCACCAAATCGATGAGCGGAACATTATCTCTTAAGTCTAGATAAATAAGACGCTTCATTAATGTCACCAAGTAAAGTGTTTTACTGGTCCGTGAGTGTTCATTCACTCGAAGATGCCATGCAAGCCTCACAATAGTTAAATGCAATGTTTGACGGGCTTTTCCGCGTCTACGGGAGACGCGTTTAGCTTAGGGACGCATACTGAAAGACCGGGAATGCTGAGCAGAAGCCAGACAACTCACTGCGGCGGCAGAAGAAGCCGCATGCTCGCTCGTTCTCCATCTCTGTTTCTGCTGCCCTGACTGTCCGTTCTCGGTAAATAAGCAATACCCTGTGTGCTGGTTTCCTTAACTGTGCTAACTTTCCTGACTCATTGCTTCCATACTGACTCCAGCCAGAACTGTTCATCCTAACCATGCGCGGACTTGTAGAGGCACCCGCGCGTCCTGTTGAACCCTTAGACTGTGAGCGGAGCCCCGTGTGCTGTCGTCATTCTTTGATCGGTGCTCGTAATCGAAACTGCCTGTGTCGTTTCCCGTAATCAAACGAATGTGGTTTTCGTGCCCAAATCCATCGGATGCACTGGCACTGTGGGTGTGCACTGCATTCCATCCCCCTGTTCCTGAGACATACGCACGACCTCTGGCGGGTTTCCCCTTGATTATTCAGCCTCGCATATCAGGAAGCACACCGATGGATACGCGACAGCAAGTTTTGGGTAGGCTGATTTTGATCAACGCCTCCTGCACCTAACGGTGAGACGGAACGATATGGCCTGTACGGGATCGGCACCTGCCGGAAAGGCCGAATTCTACATGCCTCACGAGCGACGCCGAATT	*	tp:A:P	cm:i:18	s1:i:150	s2:i:0	NM:i:967	ms:i:404	AS:i:222	nn:i:0
+67	0	utg000001l	30270	60	37S15M1I22M1I3M1I3M2D3M1D42M1D12M1I8M1D25M6I3M1D1M1D12M2D8M6I7M3I1M1I2M1D1M1D8M6I9M1I2M2D3M3D11M2D10M1D8M2I6M2I39M2I7M1I22M3I8M1D8M1I3M1D5M1I10M1I1M3I8M1I11M1I11M1I9M2I14M1I3M2I7M1I4M1I11M1I14M1I2M2D7M1D6M2D1M1D8M2I5M3D9M1I4M1D9M1I20M2D9M1D3M1D6M2D20M1I5M1I10M2D5M2I1M1I7M1I5M1I13M2I6M1I21M1I4M5I14M2D4M1D2M1D4M1D11M1D2M1D6M1I16M1I9M1D22M2D7M2D1M2D8M1I3M2D4M1D7M1I5M1I5M2I3M3I23M2I10M1I21M3I5M2D6M4I10M1D6M1I3M2I10M1D7M1I16M3I26M4I1M4I2M1I3M1D4M2D3M1I7M3D4M1D3M1I5M4I7M4I4M3D5M1I4M4I3M3I17M2D4M1I2M1I3M1I3M1D17M5I8M3I2M1I20M1I2M2D5M1D4M1I3M1I2M1I7M1I5M2I6M3I1M1D11M1I9M4D26M2D29M1D2M1D9M2D4M1I5M1D1M2I2M1D6M2D2M5I3M1D7M2I12M2I22M1I6M3D5M2I3M2D7M1D10M2I5M6I2M3I17M3D1M1D19M1D6M2D4M1D15M1I20M1D3M1I7M2D2M1D5M2D2M1I8M1D5M3D2M1I2M1I8M2D4M1D1M2D10M3I13M1D7M1D3M1D8M1D3M2D2M1I26M1I3M1D6M3I2M1I5M1I17M3D2M1I33M2D20M3I2M1D19M1I5M2D11M1D2M1D1M1D14M1D8M1D1M2I21M1I3M1D2M2D9M2D1M1D16M2I9M1D1M3I1M1I4M1I1M2I9M1D6M1D8M1I10M1I1M2D13M1D9M3I2M1I4M2D6M1I5M1D3M2I21M2I10M1I19M3I13M1I8M1I6M2I16M1I12M1I4M1D15M2D13M4D2M1D6M2I1M1I11M1I25M1I22M1D13M6I12M1D26M1I10M1D6M1D15M1I23M2I5M2I9M1D3M1I6M1D2M1D14M1I16M3I7M2D19M2I2M2I8M2I3M1I9M1I11M1D3M1D4M1D11M1I2M1D6M1D34M4I1M3I3M3D20M2D7M1D12M1I11M1D7M8I15M1I5M2I12M4I2M3D4M1D28M3I2M1I7M1I12M1D5M2I11M1I13M1D16M1I8M7I3M1I4M1I9M1I2M1I5M5I48M1I2M2I3M1D6M1D8M1D6M3I6M2I4M1I2M1I9M1I13M1I2M1I7M2I24M1D7M1I3M1D9M5I4M1D18M1D26M1I43M1D4M4I16M1I21M1D2M2I7M1I13M2D2M1I19M1I7M1I10M1D10M2D5M2I3M1D12M3I2M1I5M2I12M1D40M2I4M5D1M1D2M2D20M2D7M3D9M1I6M1I7M2I33M1D2M31I3M1I4M5I5M1I1M1I9M1D16M1I21M1I8M1I4M2D3M1I3M1I15M3D5M1I13M5D2M1D3M3I5M1D8M1I7M2I12M2D6M1I4M2D6M1D2M2D8M2I4M1I2M3D3M1D7M2I8M3I2M1D5M1D9M2D1M2D7M1I4M3I16M2D15M2I13M1I3M1D1M1D3M1D6M1D8M1I3M1I8M1I5M3D7M2D6M5D18M1I2M1I14M2D6M1D5M2I1M1D2M1D5M2I13M1D1M1D1M3D25M1D2M1I2M1I11M1D10M1I15M1I6M1D13M2D1M4D5M2D5M3D6M1I6M1I1M4I11M1I7M1D2M3I7M1I3M2D4M1D4M1D12M1I10M1D15M1I1M2D12M2I3M1I9M1D6M3I6M1D12M1I10M1D6M1D10M3I9M3I5M1I26M3I6M2I13M2I5M2I5M3D9M4D19M1I23M1I2M2I7M1D7M1I13M2D2M1D6M2I12M2I9M1D4M1I5M1I3M2D12M2D17M1I14M1I6M1I5M1D11M3I5M1I3M1I4M2I2M3D2M1D4M1I20M1D11M3D2M2D10M2D9M1D27M1D18M1D4M4D28M5I9M3I1M1D4M4I6M4I2M1D11M1D9M2D4M4D7M1D22M1D5M1I6M1I3M2I8M2D7M1I3M2I2M4I3M1D13M2D5M2D9M1I3M1I14M2I11M1D4M2I3M1I4M1I14M3D6M1I17M4D10M1I2M2D8M2I2M3I3M2I9M2D9M1I2M3D4M1I6M1I5M3I3M3I75M2D12M1I8M1I5M2D2M1D9M2D5M1I3M1D5M3D7M2I5M1I11M1I1M1I2M1I12M1I5M1I17M2D13M2I8M1I8M2I2M1D30M3I16M2I17M1I3M2D2M3I8M1I24M2D1M1D17M2I1M2I8M2I3M1D7M1I3M1D6M1I12M2I8M1D2M1D11M2D8M2D5M2I11M1D1M2D13M2I4M1I6M2I7M1I29M1D11M1I31M12D11M4I21M1I19M3I14M4I9M1I31M5I2M4I1M4I10M1D6M4I32M1I3M1I3M1D5M1I4M2D30M1I7M3I13M4I37M1I1M1I4M1I11M1D2M1D11M2D7M1D8M1D6M2I8M2I5M3I8M1D6M3I5M3I13M1I2M4I3M1I6M1I6M3I11M1I16M1I11M2I18M1D16M1I25M1I2M1I11M2I1M1I16M1I8M2D19M2D1M1I11M1I13M1D15M3I6M1I10M1I35M1I3M2D4M1D7M3I12M1D6M1D20M3I1M4D10M2I6M1I5M1D16M2D35M1I8M4I8M2I6M1I5M1D4M1I35M2D5M1I15M1D1M2D1M1I3M1D2M3D7M2I5M1I14M3I8M1D3M2I25M3D20M1D9M5D1M1D11M1I2M3I4M1I2M1I3M1D8M1I7M1D2M1I25M1I1M2I1M1D8M1D6M1D2M1I22M2I3M1I7M1I24M1I2M1D1M2D3M1D3M3I4M1D1M3D21M1D35M1I16M1D2M1D2M1I35M1I3M1I7M1D2M2D9M1D5M2D1M1D8M2I3M1D16M1I5M1D5M1I5M1D1M1D7M1I13M1D10M1I2M2I23M1D15M1D4M1I12M2I2M1D7M1I28M1D8M5D1M1D30M1D2M1D8M2I4M1D3M1I22M1I6M1I5M3D12M1D32M2I25M1D3M1I3M2I1M1D3M1I1M1I3M2I9M3D13M1D6M1I17M1D9M4D25M5I4M1I27M3I10M2I14M1I5M2D2M2D22M1I34M1I4M1D3M1D14M1D4M2D3M3I39M2D4M1I5M1D23M5I13M2D2M1D58M1D2M1D23M1D9M1I4M2I2M2D1M1D25M1I1M2D13M2I20M1I7M3I4M2D15M2I1M1I23M2D11M3I39M1D10M1I13M1I1M2D6M4I3M2I7M6I17M1I19M1D9M4I5M1D10M4I15M1D11M4D15M2I12M1D9M1D9M1I2M2D5M3D8M1I12M1D1M2I16M2I1M1D19M3I8M1D10M5I6M1D6M2D5M1D12M1D5M2I1M2I11M1D4M3I8M2I1M1D5M1D6M2I11M720S	*	0	0	CTGGTGTCCCATCGCATAGGGCTCCCTGATATTCTTCCCCGCTGTCTGCAGTCAACTTCTGCGGTCAGGTGCTGCAACCAGCTTAGGCGTGACACCATTCACCGTGCCACTCTGTTCACCGTCAAAGTGCGCCCCGTTATCCACGATGGCTCTTTTCCGGCACATGCTGCACGGGGTGATCTGATGGCATACGTGCCGTCCTTCAATCGTTCACGGATATCTCACGCATGAACAGTTGAGTATGGGGCAGCGTCGGCAGCTTCATGCTCCCATACCTGTATTCATAACAACAGCGATAGGAACACGGCTCATTTACCTTCACGCCGTCGGTACGGACCGAATGAACCTCCACGCTGACCGGATTGCCGCCACTTCCGTCAACCGAGGGTATCAAGCGCGGTACTCGGAGGATGGCAGCGTGATTTCACGGTCGAGCGTCAGGCGTCCGGGATTCGTTTGGCTGTTCACCGGAGCACCAAGACCACCGGTGCTGATACCGGCATAGTCATCATTGCAGCAGATTCAATAACATCGCCAGCGGTACATGGCGAAGCCCTTCTGCGCCGCACGCTGAAATCGCACGGTCTGTTTCCAGCGTTTATTTAATCAGCCACAGCCCGGCGCGCGGTGTCGCCTGCGCCGAGGTATGCTACCTAAAGGGCATCCATCTTCGTAACAGGTCACGACCGTAACGGGCAATGGCCTGCGTGTATCTTCAACAAGCTCTGTCGCCGTCTCCCAGCCGTTGTTCGGGTCAATCCAGTTCACCTCAACAGCAGTAACCGCATAGTCCTTCAGAAGAGGCTGAAGCTGTAGCGGAACGGCGCGCCATCACCGGCATCCATCAGCATCAGGGTGGTCCGGTTATAGGTCCACGTCTTATCTAGGACGGTCGGTTGGTGCACGAACGTCAGCGTCTGATGCCCGTTCCATACCGGCATACAGCGCATCGCCGAGCAGAAGTGGATAGCACATCCCACGCCTTACGCTGTGTAGGTCATGATGGGATTACAGGTGATGCCTAGGCTTCCGTCTGCAGCGCCAAAGCGTCCGGCACTGGTCGGCCCAGTGGCAGTGATTACTCGATGTAGATAGCGACAGCGCTTCCATTTATCCACATCCGAGCACCAATGACGTTTCCCCATGCCGTAGCCGCCCGGAGGTGATCTTACACATATCCCACAACACCAGCGCTGTTGTGCTCTTATTGAGCGGTTTAAACGTTCTCGTCCCCAGATACCGCTGTATTGCCGCGTCTGCGGGTTATAGTTCGACGGCACCTGCAGAATACGCCCGCGCAGATGATAATTACGAGCCCTGCTGGGCTGCCGAATGAGCCCGAGTCGCTCATGCGACGCCGACCAGTGCCGTGTTCGGGTAGCACTGTTCACATCGATGATTTCAGGTTATGACGACCAGAGCGTTTGTTCTGCATAACTTTCAGTCATCTGTGGTGCTGTCCGGCGTCATCCTGCGCATCCGGATATTAAACGGGCGCTAGGCAGGTTACCATCACCACGAGGCCAGATACTGCAGGTAGGTTTTCGCCTTAATGGTGATGTCTTTCTCGTTACCCAGCCACCGTTACGTTGTATCTGACGAACCAGCAGGCGGACTTCCGACGATTCCTGTCATTGTTGAGCTGGTTTCCACCAGTGCCTGTACACCGAAAGACATAGAGCGCAACGGTCGATGTTTGCAGGTATCAATGGTGCGGGTAGATCGGCGTCATATTTCATCCGTACCCAGCACCGTCTCGCTGACCGGAGGATTCAAATCCCTCCGGCGGTTATGCTCCTCTACAGCCCGGAACAGCACCGTGACACGGATATGTTGGTATTCCCTCGAGTGTCCAGCACCGGCGTACTGTTCCGCAGCGCTGTTTAAGCCATCCAACGCACTCTTTTCAATCGGCCTTCGCTGATGGCAACCGATCACACTCAGCAACTGCGTGGACTTCAGGTGTTTAGTGCCCTTCGCCTCCGGGGTATCCCCTTACTGCTTCCTTTACCACCATTCCTCACCCCTCCATAAATGACAAAATGGCCGCAGCAGAGTTCGCATAAAACATTTTGCACATCAGCGACCAATCACCACAACCTGACCACCGTCCCTTCGTCTGCCGTTGATCTCCTGAGAACCGATCGGTACCCACGCGCATTCCCCGTACAGAACAGGCATGACATTGTGCCCTGGGCAACCATGTTATGCGTACGAGAAATAGGTATCCGTTTTCTGCTTACCGTTATCCGTTGTCTGTGACCGGGGAGTTCTGGCTTTCGGTGCAGCATCTGCGCCACACCACCGAGCACCATACTGGCACCAGGAGAGGAAAACAGGATGCCGGTCATACAGACCCCAATGGCTGCCCGCGGATGCTGCAAGGGTGGCTCCGGCGGTGAAGAATGATCCGGCAATACTAGGCAGCGACGCGAGGACAATCTGGAATACGCCACGTAATGGCCCCGGCGACTCTGGGAACAATATGAATTACAGCGCCATCAGGCAGAGTCTCATGCCGCTCATGCAGCCCGTTAACGCGGGACTGCTGACGTCCCGCCGTACCAATCCGTACCTGTACCAGCCGTGCCGTTTCTGACGAAACGCCGGGAGCTGTGTGGCCGTTGCCCGGATGATGGCTTCAGCCCCGTTTTCACACGAAGGTCTTACATTGCGGCATACAAATCGTTGTAATCCAGGCGTAAAGGCAGGATGCGCGCCATGCCGGAACCCCAGGGAGATGTGTGCGGTGTGCATGCTGCCATTTGTCGGTGTTATCCTCTCTGGCCGTTTGCTCAGTTGTTCAGGGAAACTGGTGCAGCAGCAGCCGTCGACGCAGTAAATTGCGGCTAATGCGTCCGGCACTGATGAACCAAAGCACATGCAGCACATCGCCCGGCTGTGCCGGTGGACAACGGCATGATACAGCCCCGTCGCCTCCATATTATCCAGATGAGATTCTGGCCGTTACGTGCCACCAGTCATCCTCACGATGAAAGTCCGGCATCTCAATCCCGCCAGATGATAAGCATCCCGGAACAGTGTGTAACAGTCCGTCACCCGTGCCAGCTCAAAGCGCCGCTCGAGTCAGATGCGGCACAGCGGATTGGCTGATTCGATCGTCCCCCGGCACTCAGCCACCACGGCAAATCACCTCTGCACTGCAGCCGCCGTCGGCCTCACAGCCAGGGCAGACCACCGGGGTGAGTGCGTGAACCAGCGCCACAATTCACCCTGCATTTCTGCCTGCAGCCAGTCTTCCGGCGACTGGGGAAATGCCCCTCCAGGCTCACCGGAGATGCCCGGGGAAATATCTTCCCCTCTCCGGCGAGTGCTTACCACGAAGCCGCACGACTCCGGGCGCACATCGCCGGGCGTGCGGCTGTAGACTGATTCGTGTAGTCACTAGCTGGAAGTCTTAATGGGTGAAAAGTTGTTAATGGAAAAGGAACCCGCCAAAGTTTGCCGACGTTATTGCTAACTTTACAACCGCTCAGGCATTTGCTGCATTTATCCTTCGTGATATCGACGTTGGCTGGTCATATTCATCCGCGACAGCCGGACTTATAACCGCACTCGTCACCGCGATAGTCCGAGTGCAGGTGGTTTAAGAGATACCCTTTAGAAAACAGCCATCCGTTTCCGTCGGCGTGGACAGTACAATAAAGGAGGCACTCACAAGGGCTCGAGTTCATGCACTGCTCAATGCGCCAGCGGCTGATCGACCTCCTGCTCCGGATCGGCGTAACTGTTTCCGTTGACGAAGTTCACCGCATCCAGAAAACGGGCGTAACCTTACGCCGTCACCCGTTCCCCCAGGACCAGACTCCTTGCATATCTTCCGCCATCCCGGTGACCATACCGTACAGGTTAGAAACCGTCAGTCCTAATCCTGGACCTGGTGCTTTGCCATTCAGGTCAAAACCGCTCCCCTGAATGGGATACGGCTGATACTGGTCGCCCGTGCCAGGTAAGCCCTACCTTTCGTTCTGCTCATTACAGAAAATAACGTTCTCCACCGACCTGTCAGGTCGATTTCCCAGGGCACCACGCTGGCCGACTGCTCCGGACGGGTGCATTCATTGGAGTGTTTCCTGCCGGTATCCTGCATGTAGAGTTCATCAGGTGTTCAAACTCTGCTGAACTCAACACGCAGCAAGCTACTTAACCCCGGGACGACCATTTTTGCAGCAGGTCATTTATCTGCCGCTCATAAGGCGGCGTCCACAGAAAGGATTTCCAGCCCCGTTGTACTCTTCCGAAACGACTCCAGTACCGGTGCTCCTCACCGGGGGACAGAAAGCCCGTCACGCTTACGTTTTCAGGTTGGCATTCAGCCCGGCAGGCGCTCGCTGAGAAACCTCATCACCAAGCGCACCTTTCTTACAGAAGGGACGGGTGAAGCCATCCATACCGGGTTTCACTTTCCATAGGAAGGTCTTCAGCTAGGAGCCGGACACTCCCCATCATCTATCTTGTCTGAATTTCATCACGGGCACCTTGCGGGCCATGTCATACGCCCTTCAGAGCAGCCGGACTATCTGCCCGTTCGTGCTCAGCGTCGTTGTCTGTAATCACCACATGGTTATTCTGCTCAAACGTTGAACGCCTGCGACCGGCTGATGCCATGCTGCCCGGTGTACCACCAACCGCCGGTGGGCAGCATAGCCGCATCAGCCGGTAACAAAGATTCCCACGCCAATCCGGCTGTGCTGCCTTCCGTGGAAGACAAACTCACCACGGTGAACAATCCCGATCTGAGCTCGCTATTGCCGCCGGTTCCCGTAAATCCTCTGGCTTTAAAGGCATTTCGCGCCGCAGCGGCCACTGAGGAACGTAGCCGTACCGCCTGACGCGGATGCGCCGCCAGACAGCCCGCCCTAAAACCCCGCTGCCGATACTCCCGACAATCCCCACCATTGCCTGCTTAAGCAGAATTTCTGTCATCATGGACAGCACGAACGGGTGAAGCCTGCACCAGTTTCTGCTCACTGCCGTCAGCGATCGCCGCCAGATATTCTGTGCAATACCATCAAAGTCTGCGTGATGGTTTTAGCCTGCGACATACTGTCCGTGGCGCTCTTCCCACTGAAGCTCCAGCCGGACTTCAGGCCTGCTATCCAGTTCCCGCGAAGCTGGTCTTCAGCCGCCCAGGTCTTTTCTGCTCTGACATGACGTTATTCTAGCGCCATGGATTATCGCCATACTGTTCCTTCAGGCGCTGTTCTCGTGGCTTCCCGTTCTTGCCCTGCCGGTCACAGTCAGCCCGCAGCTTTTCGCATCAATGGCGGAAGCCGTTTTGCCCCGTTGCTGCTGTGCGAATTATCCGCCTGCTGCGCCGCGCGTTCAGGCGCGGGCTGATACGTAACCTTGTCGCCAAGTGCAGCCAGCTGGCGTTTGTATTCCAGCGTCTCATCTTTTATGCGCCAGCAGGGATTTCTCCTGTGCACCGGCGACGTTATGCGCCGCCTCCTCCAGTACCGCGAACGTACTCAGCGCGTCGCAGATCAAATCGCGGCGCTGCTGGCCTGATTTCCCCATTTGCTCCGGCATGCTTCTCCAGCGTCGTCCGCGTGATACTCTTACGCCTGAAGCGTGCAGCTAGGGCAGCATGAGCGCTGTCTTCCTGACGATCTGCCTCGCAGACAGCCTTCACGCTGGACTGTTTCGGCTTTTTCAGCGTCGGTTCATATAAATCCTTTTCGCCGCCGCCATCAGCGTGTTGTAATCCGCCTGCAGGATTTTCCCGTCTTTCAGTGCCTTGTTCAGTTCTTCCTGACGGGCTTATTTCTCCAGCGGCGTCTGCAGCGGCCGTTCGTAAGGTGCTCTTCTGCGCCTCTTCGGGTATATTTCAGCCGTGACGAAGGTTACGGTATCCGCTCTGTAGCTGCTGCGCATTTTGTCCTGTTGAGTCTTGCTGCTCAGCCTCTTCTTTCGGGCGGCTTCAAGCGCAAGACGGGCCTTTTCACGATCATGCGAGTAACGCGCGCCGGTTTCATCGTTAACAAAAATAATCATCCTTGCGCAGATGCGATGTCGTCTGCTTTCTTATACGCAGCCTCTGCCTTAATCAGCATCCCTGCGCGGTATCAGCACGACCAATATCCAGCACCGGCATCCCACATGGATTTGAATGCCATGGCAGTCTTCGTCCCCAGTCTCCAGCGTGCCCATGTTCTCTTTCAGCGGCGGCCTTGGTCATCAATGGATTTCGTTGCGGCCTCGTTCCTCCGCCTGCAATGCCCCGGCTTCATCGCCGGAAGGCTGCAACTGAGCAAGCTACGCAATCTGCTCCGCCGACGCGTTATGGAACTGGAGCCATCGGCTGTCAGCCCCGACGTCGGGTCTGTGGTCAGCTTCCGAACGGTCCCAGCGACCTTTAGGCTCACGGATGCAGAGGAGAAACGCGCCACACTCTGGTGGCTGATGACCGGCAATCTGAGCCTCACCGCTTACCCCCTTAACCAGTGCGCTGAGTACTCGCTGTCTGGTTAAACGTCAGCCCTGCCGCCTGCCGCCCGGCTCTGGACAGGACCAGCATACGATCTGCCGTCAGTCCCTCATGGTGATTGCCGGAAAGACCAGCGTTTGTTGAAATGGGACACCGTACAGTGTTGCCCTGATACCAGGCATACGCCATAAGCGAGGTGCCAAGCACAGGCTAGGGCCCCACCATCGGCAGGGTGATCGCACCGGCAAGCCGACAGAACATGGGGATGCATCCCGCCGAAGGAGATCCTTCACCTGCCCCGTGTTGCAGCAGGATCAGCCACGGACTTTGCCCGCTTGCAAGCTGCGTGGATTCGGTGAAGACTTGCAGGCAGCATACGCAATGGCGGGGTCCTACTGCCGACGGAAAATCCCCGCTTTGGTGCAGCCACGCCAGCCTGTCGGCTCAGCAACTGTTCACGACTGCCGCTGTTTTTCGCATCATTTTCTGATTATAGAAAATTAACGCCTGACTCTGGCCATCTGCTCGTCAAATCTGAGCATCCAGACTCAAATCAACGACCAGATCGCTACCGGTTCCTAGCCATACCGGACTCCTCCTGCGATCCCTTGCTGATACTGTCATCAGCATTACGTCATCCTCCGTCATGTCGCCACATCCGGGAAGCGGGGATAACTTCATTCCCGTCCGGGCCACGACGGCTAACCATGCTGAAGCAAGCCCTGCCGCTTTCTGCATCAGCACATCATCTTCAGGCTCTTCGTCAGCCTCGCGCCGGTTCAGCAGACTGAAATCCTCCTCAGCTGGATGCATATCCGGATCGCTGAAAAACACAGGCTGAGCACAAATTGTACGTCAGCCAGGGAAGTGCATATCCAGCAGAACATCATGAAAATAATGGGTACTGTAAAGCGGTGCCATTGAGCAATACCGTCATGACATCCCGGCAGCAGCAACGCGCCAGTCGGGTCGCCCCATCGCACGCCAGTTTCAGGGCAACTCCAGCTACCGTCGAACACTTTCCCGCAGAAAGGTAGAGGACCCTGGCCCGTGTCCTCTGTCTGTTCAGGGGCATTATTCACCACAAACTCATACATACCAGACAGCCGTCACCACGTTTTCAGCATGAGAAATGCCTCCGTGGGCCGTAGTAAGCACTTCCTGCTCAATCTGTTTATAGCTTCATTCAGCGTAACGGCATCTGCGTCTTCTGCGGATGGTTTGGATGCTAGGACATCGCCAGATCAGAAACGCCGGTTCTGATGGCGTCTTCAACAGTAAACGTCTTCCGGTTGCTGTCTTAACCCGCCTGTTCTGCCTGCCGTTCATCAGGGCAGATGCTCAATGCGCTGCAGGTAGAGTGACACAGTTCGGCCAGAGAAAGCGTGACGGTCACCCGTTGGTTCAAATGATTCGGTTTTCAGGAGTGAACACGCTGACTCTCTCCGGATTAACTGGCGGTACGGTAATTTCTGCAACCGCAGCAAACGCTCACCATTACCGATACAACCGAATGTTGACCTTGCCTGCAGCAACGGCCGTTCACGGTATCTAGTCATACCACTGACGACACGGTGGCTTTTGTTTATCTAGCGCAGACAAGCACGAAAGGGCCTCTTGTCGTTACGCCCTCCGGCTGGAAAGGCCACGTCAGCGTGGTGCTCTGCCTTCACCACCGAGGGCTCTGGCAGGCGTGGCACGGTCATGCAGATTACAGCCGTATTCACGTTAAGGTTGAATGCTTTGCGTGATCAGCATCGACTAAAGTTTCTACAAGTTATGACTTTCACCGTTAGTATATCCACTTCCATGACGGTTCACACATGCGCCAGAGATACCGTAAGGTACCCATCTAAGGAACACGAGGACCTGTTTACCGTTCTGGAAGGTAACGTTGACCACCAGGTGAACCAACTGTTCACGCTTAAGACCACGCCAGCATAGGTGCTGCTTACCCTGCTCATACCGGGCAATCACGCCATAGCGTGAAGCTGATATGCCTAAGCAAATTTCTGCATGCCATTACCAGCACAGCCATTCAAAGTCTGCATCACGTATTCCATGATACAGACTGATCGTCACCCCTCCATTCAGTTCAAGATGTGAAAGAGTCAAAATCTGTCTATTTTGCCAACGAGACCAGTCACTAAATGTCAACCATGCAGATTTCATCCTCCAGTGACAACCAATAGCCACTCCGTGACAAACCCACAGAGCACTGTCTAAGCACCTTTCAGACCTTCCGAAGTTAACAGTTATCTAAGCAGCAAGGCCGTCAACTTAACACATTTCAACAGACTGATGACGACAATCCATCAATCCCTCCACTCCGCCTCCCCATCTATGGTTCCACCACCATGCTTCCTATAGATGCCTCACATACTGATCGGTGATTAAAAATTTAAAACAGTTCGTGCCAATAGTTTGT	*	tp:A:P	cm:i:117	s1:i:1079	s2:i:0	NM:i:2090	ms:i:4450	AS:i:4461	nn:i:0
+68	16	utg000001l	35103	60	11S6M1I10M1I7M3I2M1D6M1D15M1D5M1I11M1I11M3I5M2I2M1D17M7I2M1I3M1D11M1I8M3I11M2I8M1D10M2D7M6I7M2I1M1I3M1D13M6I1M2I5M1I6M1D10M1D6M1I7M1D13M2D11M1D10M1D22M1D7M3I4M1D3M6I5M1I9M2I28M1D22M1I5M1D6M1D10M4D4M1D13M7I8M2I11M1I8M1D8M1I18M4I6M3I20M1I13M4I2M1I3M1I6M1I6M2I12M2I10M1I10M1I6M1D4M3D3M3D15M1D4M2I10M2I9M2I4M2I9M1D23M1I3M1D9M1I2M3I7M2I6M1I13M1D17M3D5M5I6M1D6M2D13M5I5M3I7M1D3M1D2M2D2M2I4M1D3M1D10M1I3M1I6M1D15M1I4M3I4M3I5M1I6M4I5M1D3M1D8M2I11M1D18M2I9M1I3M1I20M4I5M1I9M8I3M2I8M1I1M3D2M1D2M1I6M1I11M2D6M2I2M1I2M2D4M3I6M1I8M1I26M2D6M1D12M5I7M5I4M1I1M2I22M1I14M1D7M1I4M3I2M6I6M2D5M2D7M2I2M3I4M2D3M1I2M1I6M2I7M2I17M1I9M1I7M3I11M6I6M2I3M1D13M1D16M1D9M1I10M5I6M4D5M1I9M1D4M1D2M3I2M1D27M3I3M3I4M2D5M3D14M3I9M1D1M4D6M3D4M1I9M1I2M4I25M1D7M3I1M1D15M1D11M1I8M2I2M2I3M1I2M1D5M1I8M1D5M1I5M2I2M2I3M1I1M1I7M2I3M1D3M3I4M1D4M1I2M1D8M1I11M2I11M2D2M1I12M1I1M1I1M2I11M1D9M2D2M3I6M1I2M2I10M1D4M1I19M2I13M2D4M1D2M2I4M1D4M6I23M1D21M3I2M2I17M1D38M2I4M2I7M2I9M1I10M1D6M3D1M1I16M2D16M2I1M1D3M1I11M1D8M1I2M5D11M1I11M3I5M1D3M2D13M1D3M1I12M4I16M1I4M3D20M1I7M1I21M1D5M6I6M3I9M17I6M1D8M3D9M3D13M2D5M1I9M1I2M3D5M1I5M4I1M3I2M1I4M1I4M1D9M1I4M2D7M2I19M1I5M3I15M1D10M2I3M2I6M1I3M1I8M1D8M1I7M1I10M1D6M4I10M2I12M3I3M1D3M1I1M1I4M2I1M1I11M3D15M1I10M3I18M1I14M1I4M3I6M1I6M1D25M1D54M1I8M1D15M1D9M2D3M1D3M2I6M1I5M2I4M1I3M1I11M1I14M3I5M1I1M1I3M1I3M1I1M1I7M3I15M3I7M2I10M1I3M1I18M1D5M1I2M1D17M2I7M1I23M1D16M1D7M1I29M1I12M121S	*	0	0	ACAGTCTGCGTGGCTGCAATTTACCTGCGACATAATTTAGTAGTGGCCTCTCTTCCCACTCATCGAGCCCGACTTCAGCATTGCGATACAGGTTTTCCCCGGCAAGCTGGTCTTCAGCCCGAGCCTTAGAGTCTTTCTTATGACGCTGACGTTGGGCTCCAGCCGGCCAGGATTATCGGTACTGTTCTCGTGCGCGCCACCTGTCGTTGAGATTCAGCTTCCCGTTCTGTTCTGCCCTGCCGGGTCAGTCAGCCCCGGCTTTTCGCATCAATCCGGCCCGTTTTAGCCCGTTGCTGTATGTGCGAATTTATCGCTGCTGCGCCGTCGCCGTTCAGCTAGTGCCTGTAATGATCAGTAACCTGTCGCCAATATGCAGCCAGCTGGCGTTTGTACTCCAGCGTCTCATCTTTATGCGCCAGGCAGGATTTCTCTGTCCCTACGACACTGGCGACGTTGCGCCTACTCGTCTCCTCCCCAGATCTCCGAACTGACTCCCGCCTGCGTACAAATCCCGGCGCTGCTAGGCTGATTTTCTCCCACTTTATCCGGCATGCGGTCTCGGCCGTTCATGGGAGTTCTGCCTGACAGGCGTCAGCAGGGAAGCATGAGAGCACTGTCTTTCCTGACGATTCACCCTAAGTCTCACGCTGGACTGTTTGGGTAGGGGTCGACGTCGGCTTCGTAATTTCCTAGCCTCGCCGCTCGCTAAGTTGTAGTGTACATGCTAGCATTTACATTCTTCCGCCTTACTTGTTTTCGTCGTTCATTTCTGACGCTGATTATTTTCTCCAGGGGCGTCTTGCAGCCGTTCGTAAGCTGGCTGCGCGCCTCTTCGAGTATATTTCGACTATTGACGGTTCGGATGGTGCTTATGCGATTTGTCTGTTGAGTCTGCTGCATCATAGGCTTCGGTCTTTCCTGGCGCTGAGTTTCAAGGCAAGACGGTGGCCTTTCACGTCATCCCAGTAACGCGCCCGCGCTTTAAGCGTTAACAAATAATCATCCTTAGCACTCCAATTCACCGATGTCGTCGGTTATTCTGCGCTTCTTATACGAGACCTCTGCCTTAATCAGCAACCTGCCTTATGGCCAGGACGACCAATATCCAGCAGATGTACCCCACATGGATTTGAATGCCCTAAGTCTGTCTGCCCAGTCCTTCTCTCCATAGCGTGTCGCTGTTGTTCTCTTTTCAGCAGGCGGAGTCTGGTCATCAAACCCTTTCGGTTGGGTCGAGCTCACTCGTTTCGCCGCAATGCTTCCTAGCGGCTTCAATGAGCCGGAAAACGCTGCACAACTGAGCAACATACGCAATCTGCTCAGACAGGTCTGTGGAACATGGCGAGGTATCATCGCCCCGTCAGCCCGACGTCGGTCTGTGGTCAGCTTCCCGAAGGCTTTCAGTGACCCTATATTGTCCCCACGAGCGGATGCAGAGGCGAAACGCTCACTTAGTATGATGGACGCAATCTGGCTAGCATGCTCAGATTATCGCCTTAGGCAATATAGCCCTGAGTACTGGGTCCTGAGTCAAACGTCAGCCGCTGCCTCCATTGCCCGGCTGGGACAGGACAGGACGGTCGATCTGCCGTCAGTCCCGCCTGATTAGGAAGGAAATACAATACTAGTTTTGTTTGAAATCGACAGCGGTTACGGTCATGCGCTTGTCACCTAATGATAGGGAGCCGTACAGCCCAGTCCCGCCGCATGCCAGGCCTAGCGCGCCAATACGGCAGCGATCAGTACGGGCACCGGCAAGCCCCTGAACGGCTCGGCGCATTCATCCGCCGAAGGAGTACCCTTCACCTGCCCCCTGTTTGGCTGCAGCATGAGAATATTAAGCACCCTGGGTTGCCTGCAAGCTGCCGTGGCCACGTCGTGAACTGTGCAGGCAGCAGACCTCGACCATGGCGGCTTTATACTGCCCGACGGAAATCCCCGCTTTCTGTGCAGCCAGCGCCTATGTCCATGAACCGTCCCACTGTTCTAACGACTGCCCTGTCCCGCAGTACTTTCCGTACCAAAATGACGCCTGACTGACCGCTCATCTGCTCGTCAAATCTGAGCGCATCCAGACTCCAAATCAACGACTGCCTTACGCCAGTCGGTCCGTCATACCGGACTCCTCCTCGTCGCGATCCCTTCTGATACTGTCGTCAGCATTACGTCCATCCTGGCGTCATAGTCCTAAGAAGCGGGAAGCGGGAACTTAGTCGTCATTCATACAAGCTGGGACTGACCTCTGTATCTACCAAAGGGACACCTGCAAGCCCTGCCGCTTTCTGCAGAGCACATCATCTTCGAGCTTCCGGTCGGTACTCGTACTCCTCCTCGAGCGGTTCAGCAAGCCAAATCCAGCGCGGATGCATATCCTAATCTGACGAATGAAAACAGCTGAGCACGTGTACGTCACTACCTAGCAAAATAGTGCCAGCTATCCAAGGAACCGTCATGAAAATAATGGGACTGTACGGGGACAAATGCCGGAGTCGGCATACTATACGTGATAGTACGTGGCACCGGCACTCATATGCGAGCCGCTTCGTAGCGATAGCAATTAGCGAGTTTCAGGGCAAACAGCCAGCTCACCGTCCGAACACCACTTTCCCCGGAAACAGGCTGCGGCCCGCCGGCGTTCCTGTCTGTTCAGGGGGATTATTCACCAACAACTCATACAGTCCAGACAGCCGGTAAGATCACGTTTCAGCATGAGAAATCCCTCCGTACAGCTGGTAAGCACCTTCCTGTGCTCCAAGTCTGTTTAAAGCGTTTCATTCATCTAACGCGGTACTCCTGCCGTGCGGTCTGCGTCAATGGTTATGCCACAGCGAGACATCACGCCAGAAACGCGGCCGGGTTCTGATGGCGTCTTCCAATACGTAACTTCCGGTTGCTGTCTATGACCCCTGTCCGTTCTGCCTGCCGTTTCATATCGAGATGCTCAATGCTATGCAGGGCTGACAGTTCAGAAAGCGTGACGATCACCGTTATGTTCAACGGCTTCAATTCGGAAGCTCGTATAAAAGATTGGATATGCATGTGGTACAGTAATTCTGCGGCGGGCTAAACTTATAATTGCCTCCCGCAAGCGACCACAAGAAATATTCATAAAGGACTA	*	tp:A:P	cm:i:18	s1:i:185	s2:i:0	NM:i:904	ms:i:810	AS:i:810	nn:i:0
+69	0	utg000001l	20706	60	6775S26M1I18M1D3M1D12M2I6M1I7M5I5M5D3M1D5M1D6M2D12M1I2M4I7M1I15M2D2M1I9M1D3M1D9M1I10M1D14M1D5M2D11M2I2M1D5M2I6M1D4M4I10M13D12M1D20M3D16M2I9M1I31M1I3M1I2M3D16M2D7M1D4M1I10M1I6M2D3M1D8M4I8M3I5M3D3M5D10M1D17M1D13M4D6M1D23M1D1M2I7M1I13M1I27M1D2M5D3M3I9M1D3M1I5M2D6M1D16M2D6M1D7M2D5M1I1M1I3M1D8M1D11M1D10M3D5M1D9M2D10M3D7M1D6M1D20M1D3M2D19M1I12M1D8M4I5M2I2M1D9M1I10M1D16M2I8M1D6M3D12M2D7M2D9M1D8M1D5M2D8M2D3M1I21M2D20M1D2M2D9M1D3M1D12M2I3M1D17M3D6M2D14M4D8M3D13M3I4M7D1M2D6M1I6M1D14M3D3M2D2M2D30M2D10M1D3M2D10M1I7M1I10M2D11M1D2M1D7M2I1M1D7M1D12M1I6M3D6M1D1M1D11M2D2M1D8M3D13M1I4M1I4M3D1M3D14M3D13M4D2M1D2M1D15M1I1M3D9M1D14M1D16M2D11M1D12M1I8M1I18M4D9M4D7M1D7M3D4M3I1M1I8M1D4M3I9M1I17M1D16M4D5M1I1M1I30M3D15M1D1M2D16M2D9M8D5M1D3M1D14M1I2M2D2M4D16M4I10M1I8M2I13M3D3M5D3M9D6M11D4M4D2M1D5M2D8M1I8M1D4M2I10M2I1M1I5M3I2M2I1M4I5M2I3M1I7M1I6M3I2M2I11M2D1M2D5M5D2M2D2M1I3M2I3M2D28M1D20M3I7M2I1M1I3M2I5M1I9M1D20M3D7M1D9M2D15M1D15M2D5M2D3M4D4M1D4M1D5M1I6M4D5M1I8M1D15M1D29M1I7M1D2M1D5M1D2M1D17M2D1M1D2M2I10M1I3M5I8M1I1M2D6M4D6M3I3M4I2M1I16M1I9M1I16M2I2M1I3M2D2M1I9M1I8M2D6M2I2M2I6M3I6M1I4M1I7M3I19M3D11M2D1M1D7M2D8M1I3M4I15M1I5M1I5M5I17M1I2M3I5M1D13M3I7M3I4M2D15M5I10M1D4M3I4M7I16M1I14M1I2M2I5M3I2M1I14M1D4M5I3M1D6M1D17M1I5M3I6M2D14M3I14M1I4M1I10M2I7M1D1M1D5M1I3M1D8M2I4M1I4M1I4M2D6M2D1M1D3M1D4M4D12M1D5M1I6M2D23M2I5M2I4M1I3M3I14M1I3M1I4M1D6M5I5M1D18M1D8M2I3M1D2M2D3M1I10M2I9M1D19M1I9M4D8M3D3M1I5M1I4M1I5M2D2M1D2M1I6M2D12M2D5M2D10M1D5M1D1M2D1M2D4M2D19M2I2M1D10M3D2M1D7M1I1M1I7M1D26M1D4M1I6M2I3M2I15M1I1M2I6M5I5M1D2M2D12M3I2M5D1M1D8M2I4M4I5M6I3M2I4M1I16M2D1M1I7M1D8M3I3M2I7M1D4M3I11M3D2M1I11M2I5M1D36M1I11M1I4M1D9M1D16M1D6M2D4M1D6M7I7M1D1M2D14M1I2M1I1M1I6M2I2M3D7M1I8M1D25M1I4M1I4M1D7M1D4M1I4M2D5M1D3M1D4M1D4M1D5M1I4M1I10M5D8M1D4M1I8M1D3M2I15M1I1M2D3M2I1M3D4M1D1M1D5M1D5M2D3M2D3M1D12M1I5M3I8M1D2M5I2M1I3M1D16M1D35M3I27M4I3M7I3M2D12M2I1M5D14M1I4M2D3M1I2M4D9M4D11M5D5M1I3M1I8M1I27M1D21M2D3M2D6M1D6M1D27M2I4M1D6M1D3M1I14M5I12M3D3M3D11M2D2M3I6M2D12M1D8M2I8M3D2M2I13M1I2M1I7M1I8M3D2M2I4M8D2M1D5M2D14M2D9M1D14M2I9M1I7M1I3M1I3M2I9M1D3M4D9M1D7M1I2M1D5M1D13M2I4M1D15M3I1M2D8M1D20M1I2M1D5M1D16M1I6M1I3M5I2M3D11M1D5M1D5M3D1M1D7M1D15M1D13M2D7M1I1M2D13M3I2M1D6M8D9M1D1M1D8M1I14M2D10M944S	*	0	0	ACGTCCTTTGGGTGTTTAACTATCTAGTTACTTAGATATTAGTCCGTCTCAATATTATGGATGCTAGCTGAAGCACGATTCAGTCCCGTAGACTCCAAGGGAAGACAGTCGTCCCTTCCATCGAAAAGTTTGTTCACACCACAGCTCAATGATCACCAATGTATGGGAATTGTTTTTATGATACTACATTCCTGCTTCATTAAGTGGCACAAACCATAATTGCTCTTCTTGGACAGCTGCACTTTACGCTTAATGGCCAGCATTTATCGTTTCCATCTTAAACTGCGCGTCCTGCTGGCATTATGATAAGCACATGACGAGCCTCTTAGCGGAATGCGCTCGGTGCCGCAGGTCCAGCAAAGAGACTGAAAGATGCCACACATGAGGATTACCGATTCTCATGACATATTCAGTTACCGGCCGAAGTCTAATGAGATAACGATCATATACATGGTTCTCCAGAGGTTCATTACTGAACACTCGTTAGAATAACGATCAGTGCGGTTCGGTTTCTACTCATCAAACTTACGGTTGTAATAGTTCTTAATTTCTCGGCTGTAGGGGTCACGAGAACGGAAGGCTCGCTGGTCTTCCAAGACGCTCAATGGTCACCGCAATCCACTTTTAAGGTGATATGGAAGAATTTGAAGAGTCCGGAATATCACCCGCGCCGTGATATGGAACAATACCAGACTTAGTACCCACTATTAATCAAGTGGACAATTCAAGGGATGAAGCATGCCTGCAATCGGAATGCATGGTTACTGAGAAATGTTCCTGTAATGGAAAGATGGGGAAATAGTTAGATAAATGGGCAGTACGAACGACGATGATTGCCACCGTAAACAGAACAACAAATCTATCTCCTGTTATTTTTGCAGCATACGAATAAACACTGCACTGTGCTTCCAACGAGTACATCACGGAGCAATGTCGCTCGTAACTAAACAGGCCTAACTTGTCCTTGATCGGAATCTTCTTCCTACGATCAGGGCGATTTATCTGCGACCGAACAGATGTCAAAACATCAAATAAGTTGATTACGACCGAAGCAGCATGATAGAATTATGAAATCGACATACGTAATGACAGAGAGACTTCCATAATTACATTTCTGGTCACTCTGAATAGCACTCATACTGGCTGTATTAAAGCTATTAATCAGTGCCTCCGCAAGAGCCTGCTGGTAGCATTTCAAGCGACTTAATGCATATGTTATGAGTTCGGGACTGGAATGATGGAATACTTTAAGAAAGGGAATAGACCCGCTCCATGAGCGAAGCCAGGAATAGAATTACCGGGCTGGCCAACCGGCCAGGAATATTTGATTCAGATGAGCTCACTATCAAGCTCGCGCCTGAGTGCGTTTTGATCGCAGCCGACACCCTTCACTCGCAGGCGTTTTCGTTATGTATAATAAGGAGCACATGCATATGCGCTTGCAGGCTGTCCTGGCTTATGCCCTTCCACGCGGGGTCTTTGAACTAACAATCACCGTAAGTGGCGTGACGCTGGAAGCCTTATCGACATACTTAATCAGGGAGTCTCAAAGAATGGATCAAACACTTATGGCTATCCAGGCCAATTCATCGCCATTTATTGGCGATGAAAGTGTTTCGTGAAGCCGTCGGACCTTATAAAAATCAGTGATATACTGAAGTGAGTACGGCAGGATCGCCGGTCTATTTCCGTGCCTCCAGCATTTCGCGGTGAATTTTCACAGCTATTTCAGGAGTTCAGCCATAATCCCCTTCGCGGTGCTTCTTAAGCGGACTGAGTCGCCCATAAGCTCATGCGAAGAGAATATGAAGCGGCAGACATGTGACGCCCCAGCACCTGTCGTTGAATCCTGCATCGATCATTTGCAACGCCACGCTAAATCCATTACCCGTGCGTTTGGCCCGACGGTGTTTCAGTTTGCCCGCATGGCAGAACAATTACATGCTGTCCATGGAAATTAAGCCAGGTCTATCCTTTACGAGGTAAACGGCAACCGATACTGCACTCGCAACGCTGGCTGGAAGCTGGCTGAACGTCGCATCCATTCTTTGGGCCCGCATGACAACTTCTAAGCGTCCTATTCAGACGCTTTAAAGGCTTTCACCATGCGTAATCATAGCAGTGTAGGCCTTAATCCGGTTGCCCAAGCAGTTACGTTCCTCCACTCAGAAGTGGCATCGTTCGTTCCGGTGAATTGAATCTCTGGCTGGTGGGCCGAGCTCGGCAATGAAGAGCAGTTTGTAGCATGACGTTGGACAATGAATCCTATCGATCCCGGATTTGCCCGCAGGACCGTAATCATCCGATCTGCGTGCCGAGTGAACCTCCTGAATGCCGCGAACGCTTCAAACTCGAAGGCAGGGAAATCGCGCCGTGGATCCGCATCCCAAACGCTTTACGTCACCCCGGCCTCCTTCGAGTGGCGTCGCCTTCGATTGCTGGTATCTATGACAGGATGAAGCCAGCGCATTGTCCATCACTGCAGCCACTGCAGAACGTCAGCCGAATGGCACTCTACAGTTGACGATGAAACCATGCAGGATACTAACACTCTGCTATCTCCGCTAAAGAGCCCGTACGACGTACTTGCCGCTCTTTCCATCTTTCGCCGCGACATTCGTGCAGCGTCAGAACTGACGATGGACGCAACAGTAATTGCTTCCTGAAACAGAATGAGCCCAGCACAGAAGGTAGCAGCATGACAGCTAAATTATCCTGCAGCGATGGGGGATGGCCGGTGAGGTCGAACAGGGATGGTCCCTGCCAATCGCCTCGAGGTTGCGCCTCATACTAGCGTCAACGCCTTCGCAGTCGCCGTGAAAGCCAACCGGAAGACCTGAAATGTCTATTCCAACGCCGCTGTGAGCAGTGCGCCCCTTGACTATCGAATCTCCCACCCACTGAGCCTGGGGGAAACAGTACGCGACGACGCCAGAACCCTGTTTCGATTCACTTCCGGCGTGAATGTTACTGAATCCCCGATCATGGACGCGACGAAGGTGCGTGACGCCTGCTCCCATGGTTTATCGATGAAAATCGGACGCGTGCCCGTTTGACTCCGAATCCGGTTTCATGAAGTTCGATCGCTCGGTGGTTTCCCGTAAAGTCAGCTTACATGGCCCCTGGCAGTATCGCCGCTGTGACTGTAGAAAATGCCTGGTTTTGCCAACTATACGCGTATGAAGCGTGAAGGCCTGCATTATGTCGGGCCGGAGGCGACATGAGATTTTGTAGGTCCCCAATCGTGCCGGAGTTGCCATCACCGAAGCTGACGCACGGCATGCTGAAATTGGTTTGTATTTGGGGAGCAATGGCAAACGCATCCTCAACTATCTAGGCCGCAATCACTTTCGTGCTCCGTTCGAGGAGCCTTTCCGCTCGTCTTTGACTCCCGGATCTCAAGTAGCGGCGCGCTAGGTAATAAGAATAAGCTAGGGTCTGCACGCATCTTCTTTGAGTTAGAACGAGTATGAGATGGCACTTGCTCAATTGGAATCAGGTTACGAGGCGCGCGCGCGCGCAGTAGAAACGACGAATTTCGACCTTCACCGCTCCTTTCACACTGGAATATGGCTCGAGCGAAGCAGATGAGAAACGATATGACATGGCCAGTGCGTCCTGGCAGCGCTTCGGGTCGTTCTTGCATGATCATCGGATTGTTCATAATACCGCTAGGAAGCCCTTCTGCACGCTTTGCCGTCAGGCGCTTCTGCAATGAAAAAGCCAGACACCGTTTCCGGATAAAAACCTTTAGACCCATTTGCCGTGAGAAGCACTCGCATCTAAACAGGCGTCACGGACCCGGTTAAGCCACTGACGCGATCAGCAATTCCTCACTGACGGGACGGCGTCTTTGAAACGATGGCACAGTGTAATAATCAGGGGAGCGATAGCCTTTTATTATTCGCATTCACCCTCATCCTTGTATGACCAACAGTTCAGGGATCATGAAAGCAGAAGATGCTTGATTCAGCAACGAAAGCGACCGAATCGCAACACCCAAGTCAATCTCCGGACGAGCACTGGCTTCCCACTCATGTTGTAGATGGCGTGAATAATGAACGCGCCTGTACTGTTCCATTTCCGTGTTGATGTGCAAATTTACCGGAGGAAGTAGCGAAGTGGCTGAGCCGATGTCAGAAATAAGGCAATTCGAGTAGCGCGGATGCGGCACTCAGGGCAATGCAGTAGACCGATGGGAGCGAAGTTGACGCAGACCTTTCGGATAGCGAATAGCGGCCATTGAATGCTGGGTCGAAACGGAAAGCAACCAGCATCAGCCAACGCGACCCTAGAAGCGAGTATTGCCTACATCTGGCGGAATGCGTGTCTCCTGCATCAGATCAAACTCTAAATGGCCCAGCAGCGTGAGTACTACGAAGGTGTCTCGCTGGGAGGCCTCGATGGTCCTAACTGGAGGAAGCACCGAATAGCTGAATGAAGAGTTCCTGTTGTTCGCCATCCTGGAAGACTCCTGTTATCACGCCTGCTATACTGGAAGTTTCTGCGGCAGTCCGGATCGGAAGTACCTAGCCGTTACTCGAGCCTCACTCCACTCGGGCCCGGCTCTATGACGCGCTCCGAGCAGTGGGGCGATGGCCTGGATGGATCCGGGCATGACTCATCAATAATGAGAGCTTAGCCTGGCAATCCGCGGCCAACCGCCTGCCCGCATCTCGATCGATTTTGCCACTCGTGGATGCCTGAGGCGCGTCGCGTCTTCACGGCTGCCAAGTCTCAGGTGGTGCGCTCGCGTGGATAAAACATTAGTGGTCGTTTGTCGGACCGGTTAATACATTCGCAAGCTACCTTGCGGGATTTACCGGGCTATCAATGAGTCTTAGAGTCTAGCAAAGATTGGGCGTCTCATGTGGATCCTTGTCCCCTGCAGACAGCCGAAGGTGTTTATGTAGATGAGGGCCTCATACGATCCGACAGGTATGTCTACATGAAGATTCTAGTCGCCTGCGATAAAGGTCACGGATTCTGCAAGTTGAGAAGCTTAACCGTTGAAGGGTCTCTTGGCCAAACAGTGGAACGAGCTGTGCTAACCGTAAGCTATCATAACCCAATATCCCTCGTACTAGCCGGGGCTTCTGACTCGTCTGGGGTCTAGGCGCTGTTTGACCGCAGCCTCCATTAATGACCGTGCAGTACTAGGCATCGAGACCAGCACGAATTCTTCCACGATCTGCGAGCAGAGTAGCCGGCGGGAGCAGCACCGGATAGCTGGGACCGGGCACTGACCAATTCGAATGAATCCAGAAGCACAGCAGCCGCCTGGCCGTTGGTCGATTACTTGCGGGTTGCGATGGTACCTTCAGGGATACGAAGCCCGCACCATTCCGGAAGCTGCGGCAGCCGTTCGTCGATGGGTTGAATCGGGAATGCAGGATCCGCCTCCGGTTACTGAAGTAGAGGAGGGTCTTTCACGATTGAGCTAAGTAGATTACTGTAATCGACTAGTAGCAACGTTGCGCGGCCGAATGGGGATGAAGGCAGATCACACCTACGGCATTTACCACTGATTCGCAGCGGACCAATGTAGTATCGACGCGGCGCGACGGCCGATTTACGGGCTCGAGCTAAGGATCGCAATCGCCTGAAGGCCTGGCCAAGCTTTGAGTCGTACTTTTCCAGCACAACACCAAGCCTGGACCCCGGCGTAACTCAGTGGTATAGATTCCTACGTTGATTCCGCTGCCTGATCTGCTGACGAAAATCCTGGCTAGGAATCCCTCATAACATAATGCTACAAGCTACAATTAAGCAATAGGATGTGGGTGGTCGCTCTTCCCTGACTACTATCTCACCAAGGGATCGAGACTGCCTGGTCATATGGAAGCGCCTAGCAGGCGGCTTCACCATGCTATCAGATACCTCCGCTGCATTCCGGCGGCACTGAGCAAGCGCTACTAAGATACAATTGCTGCCTCCGCAGCAAATCCGAGCGGGATGGCTATGCTATAATCACCGATAGAACTATCCAATTACAGCACAGAATCATCACCATGTTGGCCTCAACTTGCGGACTGGGTTGTTACCGTGAAGCGAGTCTATTTATGCAGATGAAATTAACTGTAGTTGATACGTATGTTATGTCAGCAAAAAGAAAACGAGGTCAAATTGCCATCCGAAGGCAGTGCATATTACTGCTCTAGAATATCAATGAAGGAACATTACTGAATGCAAAGAGATTCTTAGAACCATAATGCAACCGTTCGAAGCCCTTTCCATCCGACAGTATCAGCTACTACGTTATGCCGCACGAAAAGCATCAAGGTCTTCCTTCCGGAATCCCCCACCTTCACGAATTACGCGTTGTCTGCACTGGAGCGAAGCAAGATAAGGGATAAGTTGAGCTGTCTCGGGCATAAGTCGACACTACTAAGCATCACAGTATTATACAGAAGAGGCAAGGGAGTGACAAATTGAAATCAAATAATACTTTATTTTACGTATAGATGTTCGTCATGCACGATAATTGACCAGCGAGTGCTTTTATAATGCCATCCGTATAAAATAGGCTGAGAAACGTAAAGTAAATAATAGATATTAAATTAGATTTTAATAAAAATACCAACATAATACTGTAAACACAACATATGCATTACATATGAATTGACTATTAGATGGTATTATACTGTAACACAGCATTATAAGCAATATATTTTGCCCCTTTGTCACTATTAAAACCTGTCGCACTCCAGAAAGCACTCGCAATCAGTGCACCTTTCACGGCCCCTACTGCCATAGACCATCGCATAAGAAGTAGTGTCAAACGACGCAGCTGACTTCTTTCCTTTCACGACTTCCCCACCCATAAGCATACCTTTCCCATAACTCTACCAAATTGTCTTTACCCGGAGGGAAGTTAATATAAACCGAGCTCCATACGAAGTTAGATGCTATCTATCATGTAGTACGTGAACGATCTTCCGCAGCCCTGAAGCACTAATCGTTTGGGGTACTATATGCATTAATAGACTATACATCGTTGTATAAACGATTAAACAGTGAATAACAGTGGGTCTGCTCAAGGAAGCAGACTAAATATGGAAAACTACAATACGATGCCCGTTGAGTTCAATACACCGATTTTACATGGAAACGTATGTAATAGAGAGGATAGTAAAGAAGATGCCTGTGTTACTCGCCAACAATGCGGTTATTATTTTAAGAAACTAATTAGATTATGTTGGAGTTAGTGAGTGTCTGTGGGCGCATATTCCTGCAGTAGAAAATAAGGCATTCCTACGAGCAGATGGTGGAAGTCACGCTTCATTTCTTTACAATGTTTTATCTTACTGTCTTTATTACCATGGTAGAAATCGAGTATCGAATGTTAAATTGGTTTTATAGTAAAGAAACAACAGACCTACTGTCATGATAGATAAATTCAGTCAACTCCCTGAATTTTTCCTTAGGTGAAGCATTGACGGTGTTAATCTCATAAATTAAGCGATGGTTTAAACACTCTTTAAAGCTATTCAGGCATTTGATAGTATGTAAAATCGTAAGATTATGGACCGACATTGAAAATGAAAGCGTCCTTAACAGCGCTTGGTATGTCTAGGGTAATTTCGAGGATCCGGACAGTGCACGTGTTAATGGTTTACAGAATTGTCGATTTCCACTTTTCATTTAACAGAAAATTAGCCGGATTCAGTGATTTACGTTTGAGGTGACGTTAATTCTATGCCCCAGCACGAACATTCATGCTTTATCGGGCGGAATTGGTGTAAACAACAATTTGAATGGAAGTAACTTGGATCACCAAGCCAGAAATAATGAATATTTCTAAATAATAGACTTATCGAGTCACCAATCCCAAGGATATTTTCGATCATGTTTCAGTTTCGTTTGATTAAGTCTGCTTTTACTCCTCTAAGAACACCTGACCAGCAAAGGTACACAATACTTTATATCAATAAGAAACCTGCCATAATAGTTAGATTACTAGCAGTACCTGCCCCGTCGGTTTCAGCATTTATTGGTTGAGAGTAGATAGAAGACAACCGTGAGGAAGCTATCAAACTAAGTAATGAAAACTTTCCTGATATGGAACTCATCAGCGCATTTCTAAATATGAAGAGTTAAGACGTAATGAACCACATTCAAAGTGACTAAGTAAATTCAAATCGAGTTGTTTGACATATCCAGCGAAATATCTGCTTCGAATGAGCTCTGGACATGCAATTGTTTTATTTATGACAAGATTAGTAGGTCTTATTTGCGAAAGTCAGGCTGTTAACTCGTACCAGATTTATGCATCCACTTTTAACTCTGTTTACGAACATTAAGGGTACTACATGCACGCAATGGTGCGACTATTAAATAATTTGACGCAATCTCACTCTGCCAGATTTAAAGTACTCAAATGATCTGAAGTCCTACCGTCAAGAAGCAGCACTTATCCGTCCTAAGTTGAGACATTCATGTGGGCGGAGAACTTAGGTGTTTTATAACTCGGTTGCTGTTTGACTACTGATCGAGTACGTTACCGCCTTATTATCGCAGTCCGTTGATGCGCCTTTCTTATGAAACCATTCTCGTGACACTGGTGTGACTTAGTCACATAGGATTGAAAGTTGAACCGTTTTAAAGCGAGGTATAATGAACAGAGATGAAGGTAAATACAATGAAAAACTACTTCCCCATGTACTAGAATGCTTAATAAATTAGCCCGAATATATGCAGATAAATGTTAGAAATAATTTCATTACTCACTTCCCCACTTTTTGGCAGAACAGACACATAGAATATTAAGCTAAGTCAGTTATTTATCTACGACAGACACACCTCTGCTACAATAGTAGGTAATTGACCTGACAATTAAATTAGAAAGCTTTATGAAGATAATGCGAGATAAACAAACTTAGAACACTTACTACGAACATGGTTTCATCATAGTAGAAAATTTAGTTTTTGTGGTGATAGACAGACAAATAGATCATTTTCTTCCTGCACATTATCGAATTTTCTGATGCCTATTACTTTAGTCCCATCGTGCCGCGACTGCAATATGAGAAAGGTCAGAGTGTTACCGAGCCAACCAAGCCAGCGATCATCCCCTATGACAAGCCCACATTTTCGTCAGCAATGGGTATGCAAATTTCGTTCCTAGAACTCCGGGTGCTATCAGTTTTATGTTAGAATGCCCGGCGAACTGCAGAGGCAAGAGAAGACAAACACATATTTAACGGTTTCATTCAAGGGTCTAATGTTGTCTAACAGGTATGGTCGTTTGAAGCAAGGAAGCACTTGAGGAATGAAGTACTTAACAGAAACTCTTTCGTAAATTATAGGAATAGATTTATGGTAGAAAGCAACGTTTCAGCACTACAGTCAGAATTTATTGAAGCAATCTAGAAACCTTATAGATTTGAATGACTTCCCCGGCATTACCTTGGCAAAGAGTTATGTATCAGTCACAACTCGAAGATTTTCAGGATCTAGAATATGATGAAGATAGAAAATTACGACTAGTACGAAGTGAACGAATACTTTTATACGAGAGGCTGTTTTACAAATCCGGTAGTACATAGCGGTCCGCATGTAATCCGGCGTAGAGTCCATGAAGAGGCTCGTTGACGTTGGCCTGCAGCAGTCCTAAATACCGTACAGTCATAGATGGTCGGTGGAGGTGTATACAATCCTGCAAATATGTAAATCGGTAGCAACTGGAATCGATCGACAGCCCACTGATACACGAGTTCTACCAGCCAGCCGCAGCTACGTTCCTGCATACGACTGTTAGGGCTCCACATATCTATAGCAACTTTATAGCGCAGAGCCAGCCACAACTCTAATTTTAATACATAATGAATGATAATAATATTACATCAGTGCAACTTGTAATAGGATTTACTATGGTTCTACAGAATCATTGCAAAGATCAAACAACTTGTATTACATTGACAGTTAAGCAGTTACTTTTACCTCTAATATATCAGCATGGAGCATGCACTATCAAATGAGAGTTGACTAAAAACCATGGGGAAGGAGCAACCATTATCGCACTTGCTCAAATGCATTGATACATATTTTACCCTGAATTATTTCGCTTGAATTTGAATCAATTCGCCAACCGCAAGACAGTTGACTTGGTCTCAAACAAACAGATTGACAGTATTTGACATTTATAAGAAGAGGTTTTAAAATGAAGGACTGATCCATTAATGAGTGGCCTATTCCCAATAGATAGAACTAGGCATTTAGAATGAATCGGTGTATAGCGGCAAGGGCCTCTTATTTCATGTACATTGAAGAAGATACCTTGAGTTGGTCAAATGAAGTATGTTAAATCCACGTATAAAGTGAGTCAGACTTGCACGACGAGATCGTCATATTTAACTGAATCATGGCTTAAATCAGACACATCTATCTCGGCCCGCAAGATTACGAATTATTCTTTACGGTAAATCTAAGTACTGAGAGTATAACTGCTGTAACTCTTACAGCCAAATAAACAATCCAAGCGGAAGTGGTCGCCATAACATTCGACTCTTTATTTGATGAAACGCCAGAATAATTATTTAAAATTAAAGATTACTCCATAAGCAAATTAGTTTAGCATGATAGTGACAATAAAGATTCCTGAAGACTTAAAGAGCGTCTAAAATAGGGCTACCCCTAACATATCACTTCGACAGAAGAGTTAGTCTACCACTTGCATACGACTTTAAAGGACGTTATCACATTCAAACATTAGCATCGTTGGTAAACAATTCCATCCAATTACTTTAATCAATACATTTGAAGATCAAGCATAATGTTTTGGCGTTGGCAGCTGACAGCCAAAAGCACTGCGAGCTGGCTTCATTTGGATATCAGGCCTGGCTACAAAAGCAGCATCTACTCAATAATCCAATACAGATAATGCCAATTATAGATGAAGACTTCAGACCGAATTATTCAACTAATAATCAAGGTATTTCATGAAGCCGTGTAGAAACGAAGAAAAACCGACTTTACAGCAGTAGCCAAACATGAACTAAAACCATATTTCCGTTCAGTCTTAAAAGGATTACAGTGGGTGTAAACACCTGAACAATTGAGTACACCATCTTCCCGCACTGCTTCCAATAATACCACAGCCTTGGATATTAAAGTCAAACTCGCTCGCAGAATTCTTTCAGACGAGCGTGCGGCTCCAAACGATTACTCCATAACAAGGGACAGCCGTATCAAGGTGCCAGTTATGTATCAACGGTTCAGCCCGATACTGTCTCCTTCCCACCGTTCCCAACGATTCTTCCTTCGATTCGATTCCAGATCTGCATCATCCAACCACTCCTTCCACATGGAGTGGCCTGGCTATGCATCAGGCTTTTGTTTCTTCCGCCTCCGGATCGAACAGTTTTCTGCATTCGTTATTCCTCATCAGTGTTGCGTTCCTTCTATTCCCTCCCGGGGATAACCCATAAATTTTCCGTAACGACTGAGTTCAGAAATAATAACGCGTCTGAGAAGCGGTCACTAGTTTTACCCCGGCTTGTCAACGCGGTACGCGCCATGCCTAACAGCCAACCTGTGCGGCCCACAATAGAGCCGCAGTATCTACTGAGTGCTGCATATAGTAAGTACTGTTTGCGGCGGCCCTTATGAGGCGGAATATGCGTCACCTTCACCAATAAATCATGATGCCTGGCCACCAGCAGATTACACTTTTATGGTCGTGGTTGTTCACCCCTTCTGAATGCCATTATGCACTCATAGTTAAATGCATGTTTTACGTTTAGGGTCGCAGCGTGACGGTATGGTGTCCGTGATTGACTAATTAAGGTAATACTGAGCACGATGATGGGGTCTAGCGCCGCAGCGGATGGCCGGCTTAGTGTAGGCGCTAGCTAAGCTCCAACTGCTGAAGGTCCCATAAGGTCTCTGGGCGCGCTCCGTAACTGTGATAATCCTGTGTAATGTCCGTTTCCAGCCTGACCGCCTCAGAACTCGTACTTTGA	*	tp:A:P	cm:i:25	s1:i:171	s2:i:0	zd:i:2	NM:i:1437	ms:i:936	AS:i:936	nn:i:0	SA:Z:utg000001l,13123,+,111S3864M715D7988S,60,1577;
+69	2048	utg000001l	13123	60	111H11M2D6M1D6M3D7M1I2M2D6M1D4M1D34M3D6M1D10M3D2M1D4M1D8M1D11M1D1M2D2M9D6M1D3M1I4M1D3M1D6M2I4M1I5M5D7M2D8M1I2M1D2M1I3M3D2M3D10M2D6M5D13M4I8M8I2M3I3M5I4M3I16M1D22M3D10M5D6M1D5M4D2M1D4M1I4M1I1M2D5M1I15M2D11M2D18M2D1M2D9M3I3M2I11M2D7M1I1M2D4M1D2M1D13M2I3M4D6M1D1M1D7M1I4M2D10M2I5M1I16M2D10M2D1M1D13M1D9M2D6M7D17M1I11M1I5M1I3M3D7M1I6M1D4M5D6M2D8M5D6M4D19M1D2M1D6M3D22M2D3M1D4M1D3M1D12M1I5M1I36M3D9M5D2M2D25M8D3M1I15M5D2M1D19M4D1M1D15M1D15M2D16M1D5M1I7M2D7M1D9M3D5M1D1M1D8M1D13M4D13M1I19M4D8M2D8M2I4M1D4M2D10M1D3M1D14M3D6M2D3M3D3M1I2M1I6M2D3M1D13M1D4M1D2M2D2M1D3M2D10M3D2M2D9M1I17M1I2M1D6M1D14M1D8M3D10M2I2M4D13M1D4M5D1M1D5M3D7M2I6M1D10M1D5M4I6M1D9M2I8M1D2M2I8M1D2M5D8M1D24M1I16M1I4M1D5M1D3M1D10M1I19M1D11M4D5M1D17M5D3M1D5M3I2M1I6M5I7M1D1M2I3M2D3M1D5M1D16M1D7M1D12M2D6M1D4M2D1M3D13M3D29M1D6M3D7M2D17M1D17M1I3M1D5M2I4M2I1M1I3M4D10M3D3M5D6M2D5M8D7M1D8M2D2M2D2M2I14M4D3M2I20M1D9M1D2M3D8M1I14M3D4M1D3M1I5M2D1M2D7M6D3M3D9M1D9M2D1M1D4M1D9M9D1M1D6M1D2M1D4M3I9M2D26M9D3M1D19M7D9M2D9M2D5M1D9M1I4M2D2M1D9M1D3M3I4M2D3M4D1M2D1M1I6M2D8M2D3M1D5M3D5M2I7M1D6M1I1M2D7M2D6M1D17M1I18M2I5M2D15M1D5M3D7M1D7M2D7M1D7M4D11M9D2M9D3M1D11M4D3M1D12M3D4M3D5M1D4M1I6M2D5M4I10M1D7M5I8M2I4M1D14M3D10M1D1M2D1M1D4M1D6M6D30M2D1M1D4M1D16M1D8M1D21M3D11M1D8M5D43M9D22M1I4M1D1M2D4M2D8M1D7M2D10M1D11M1D2M3D9M3D3M1I15M1D11M1D5M1D1M1D2M1D10M3D35M1D2M4D4M1D6M1I1M1I4M3D1M1D8M1I2M3D8M1D4M4D11M2D9M2D8M1I5M1D4M1I7M1I7M10D19M2I4M1D13M3D14M1D36M4D20M1D1M2D5M2D7M5I3M2I3M6I1M1I7M3D9M1D3M2D10M3D4M8D6M5D9M7D4M3D5M1D2M4D7M1D4M2I1M3D9M1D7M1I3M2D6M3D7M1I21M1D1M1D9M1I10M2D39M4D12M2D2M2D15M2D5M1D5M4D9M4D2M7D8M1D1M1D15M1D3M3I2M1D2M1D17M2D17M11D10M1D2M1D11M8D10M1D3M1D10M3D4M3D2M1D7M2D11M3D1M1D2M2D9M8D12M4D11M7D1M1D1M4D5M1I3M7D4M1D9M1I9M3D14M2I3M3I4M2I13M3D2M1D9M2D9M1D8M3D3M4I11M6D1M7D18M1D4M2D2M2D6M1I1M2D3M7D2M1D5M6D5M2D12M1I8M3D6M3D1M1D3M3D13M1D4M1D6M2D9M3D3M1D2M3D9M1D7M1D11M2D1M2D6M2D4M2D5M1D15M4I7M3D7M1I4M2D8M7D13M1D2M1D4M1D10M4D6M4D10M3D2M1D16M3D9M2I4M2D1M2D3M2D11M2D5M7D8M3D5M1I3M1I7M1D5M2I4M3D5M1D1M2D3M1D6M1I2M2D5M1D15M1D11M1I13M3D1M1D11M1I10M1D2M2I9M14D2M1D8M1I3M2D3M2D3M7D11M3D7M1D24M2I4M2I4M3I12M2D9M5D17M1I6M3I2M2D20M1I4M1D9M1D18M1D8M4D4M1I17M7988H	*	0	0	TCCCTTCCATCGAAAAGTTTGTTCACACCACAGCTCAATGATCACCAATGTATGGGAATTGTTTTTATGATACTACATTCCTGCTTCATTAAGTGGCACAAACCATAATTGCTCTTCTTGGACAGCTGCACTTTACGCTTAATGGCCAGCATTTATCGTTTCCATCTTAAACTGCGCGTCCTGCTGGCATTATGATAAGCACATGACGAGCCTCTTAGCGGAATGCGCTCGGTGCCGCAGGTCCAGCAAAGAGACTGAAAGATGCCACACATGAGGATTACCGATTCTCATGACATATTCAGTTACCGGCCGAAGTCTAATGAGATAACGATCATATACATGGTTCTCCAGAGGTTCATTACTGAACACTCGTTAGAATAACGATCAGTGCGGTTCGGTTTCTACTCATCAAACTTACGGTTGTAATAGTTCTTAATTTCTCGGCTGTAGGGGTCACGAGAACGGAAGGCTCGCTGGTCTTCCAAGACGCTCAATGGTCACCGCAATCCACTTTTAAGGTGATATGGAAGAATTTGAAGAGTCCGGAATATCACCCGCGCCGTGATATGGAACAATACCAGACTTAGTACCCACTATTAATCAAGTGGACAATTCAAGGGATGAAGCATGCCTGCAATCGGAATGCATGGTTACTGAGAAATGTTCCTGTAATGGAAAGATGGGGAAATAGTTAGATAAATGGGCAGTACGAACGACGATGATTGCCACCGTAAACAGAACAACAAATCTATCTCCTGTTATTTTTGCAGCATACGAATAAACACTGCACTGTGCTTCCAACGAGTACATCACGGAGCAATGTCGCTCGTAACTAAACAGGCCTAACTTGTCCTTGATCGGAATCTTCTTCCTACGATCAGGGCGATTTATCTGCGACCGAACAGATGTCAAAACATCAAATAAGTTGATTACGACCGAAGCAGCATGATAGAATTATGAAATCGACATACGTAATGACAGAGAGACTTCCATAATTACATTTCTGGTCACTCTGAATAGCACTCATACTGGCTGTATTAAAGCTATTAATCAGTGCCTCCGCAAGAGCCTGCTGGTAGCATTTCAAGCGACTTAATGCATATGTTATGAGTTCGGGACTGGAATGATGGAATACTTTAAGAAAGGGAATAGACCCGCTCCATGAGCGAAGCCAGGAATAGAATTACCGGGCTGGCCAACCGGCCAGGAATATTTGATTCAGATGAGCTCACTATCAAGCTCGCGCCTGAGTGCGTTTTGATCGCAGCCGACACCCTTCACTCGCAGGCGTTTTCGTTATGTATAATAAGGAGCACATGCATATGCGCTTGCAGGCTGTCCTGGCTTATGCCCTTCCACGCGGGGTCTTTGAACTAACAATCACCGTAAGTGGCGTGACGCTGGAAGCCTTATCGACATACTTAATCAGGGAGTCTCAAAGAATGGATCAAACACTTATGGCTATCCAGGCCAATTCATCGCCATTTATTGGCGATGAAAGTGTTTCGTGAAGCCGTCGGACCTTATAAAAATCAGTGATATACTGAAGTGAGTACGGCAGGATCGCCGGTCTATTTCCGTGCCTCCAGCATTTCGCGGTGAATTTTCACAGCTATTTCAGGAGTTCAGCCATAATCCCCTTCGCGGTGCTTCTTAAGCGGACTGAGTCGCCCATAAGCTCATGCGAAGAGAATATGAAGCGGCAGACATGTGACGCCCCAGCACCTGTCGTTGAATCCTGCATCGATCATTTGCAACGCCACGCTAAATCCATTACCCGTGCGTTTGGCCCGACGGTGTTTCAGTTTGCCCGCATGGCAGAACAATTACATGCTGTCCATGGAAATTAAGCCAGGTCTATCCTTTACGAGGTAAACGGCAACCGATACTGCACTCGCAACGCTGGCTGGAAGCTGGCTGAACGTCGCATCCATTCTTTGGGCCCGCATGACAACTTCTAAGCGTCCTATTCAGACGCTTTAAAGGCTTTCACCATGCGTAATCATAGCAGTGTAGGCCTTAATCCGGTTGCCCAAGCAGTTACGTTCCTCCACTCAGAAGTGGCATCGTTCGTTCCGGTGAATTGAATCTCTGGCTGGTGGGCCGAGCTCGGCAATGAAGAGCAGTTTGTAGCATGACGTTGGACAATGAATCCTATCGATCCCGGATTTGCCCGCAGGACCGTAATCATCCGATCTGCGTGCCGAGTGAACCTCCTGAATGCCGCGAACGCTTCAAACTCGAAGGCAGGGAAATCGCGCCGTGGATCCGCATCCCAAACGCTTTACGTCACCCCGGCCTCCTTCGAGTGGCGTCGCCTTCGATTGCTGGTATCTATGACAGGATGAAGCCAGCGCATTGTCCATCACTGCAGCCACTGCAGAACGTCAGCCGAATGGCACTCTACAGTTGACGATGAAACCATGCAGGATACTAACACTCTGCTATCTCCGCTAAAGAGCCCGTACGACGTACTTGCCGCTCTTTCCATCTTTCGCCGCGACATTCGTGCAGCGTCAGAACTGACGATGGACGCAACAGTAATTGCTTCCTGAAACAGAATGAGCCCAGCACAGAAGGTAGCAGCATGACAGCTAAATTATCCTGCAGCGATGGGGGATGGCCGGTGAGGTCGAACAGGGATGGTCCCTGCCAATCGCCTCGAGGTTGCGCCTCATACTAGCGTCAACGCCTTCGCAGTCGCCGTGAAAGCCAACCGGAAGACCTGAAATGTCTATTCCAACGCCGCTGTGAGCAGTGCGCCCCTTGACTATCGAATCTCCCACCCACTGAGCCTGGGGGAAACAGTACGCGACGACGCCAGAACCCTGTTTCGATTCACTTCCGGCGTGAATGTTACTGAATCCCCGATCATGGACGCGACGAAGGTGCGTGACGCCTGCTCCCATGGTTTATCGATGAAAATCGGACGCGTGCCCGTTTGACTCCGAATCCGGTTTCATGAAGTTCGATCGCTCGGTGGTTTCCCGTAAAGTCAGCTTACATGGCCCCTGGCAGTATCGCCGCTGTGACTGTAGAAAATGCCTGGTTTTGCCAACTATACGCGTATGAAGCGTGAAGGCCTGCATTATGTCGGGCCGGAGGCGACATGAGATTTTGTAGGTCCCCAATCGTGCCGGAGTTGCCATCACCGAAGCTGACGCACGGCATGCTGAAATTGGTTTGTATTTGGGGAGCAATGGCAAACGCATCCTCAACTATCTAGGCCGCAATCACTTTCGTGCTCCGTTCGAGGAGCCTTTCCGCTCGTCTTTGACTCCCGGATCTCAAGTAGCGGCGCGCTAGGTAATAAGAATAAGCTAGGGTCTGCACGCATCTTCTTTGAGTTAGAACGAGTATGAGATGGCACTTGCTCAATTGGAATCAGGTTACGAGGCGCGCGCGCGCGCAGTAGAAACGACGAATTTCGACCTTCACCGCTCCTTTCACACTGGAATATGGCTCGAGCGAAGCAGATGAGAAACGATATGACATGGCCAGTGCGTCCTGGCAGCGCTTCGGGTCGTTCTTGCATGATCATCGGATTGTTCATAATACCGCTAGGAAGCCCTTCTGCACGCTTTGCCGTCAGGCGCTTCTGCAATGAAAAAGCCAGACACCGTTTCCGGATAAAAACCTTTAGACCCATTTGCCGTGAGAAGCACTCGCATCTAAACAGGCGTCACGGACCCGGTTAAGCCACTGACGCGATCAGCAATTCCTCACTGACGGGACGGCGTCTTTGAAACGATGGCACAGTGTAATAATCAGGGGAGCGATAGCCTTTTATTATTCGCATTCACCCTCATCCTTGTATGACCAACAGTTCAGGGATCATGAAAGCAGAAGATGCTTGATTCAGCA	*	tp:A:P	cm:i:22	s1:i:150	s2:i:0	zd:i:1	NM:i:1577	ms:i:562	AS:i:368	nn:i:0	SA:Z:utg000001l,20706,+,6775S4244M152D944S,60,1437;
+70	0	utg000001l	24064	60	76S12M2I9M2I5M1D25M1I4M2I10M1D21M1D18M1I17M1I25M3I28M1D13M1I6M2D2M1D2M1I8M6I8M3I7M3D2M3D5M1I5M3I2M1I7M2I2M1D2M1D8M1D11M1I6M1I8M2I5M2I1M2I13M1I4M1I7M8I9M2I39M1D4M2D27M2I16M1I17M1D5M1I1M3I22M2D8M1I33M2I6M2I4M1D5M1I11M3I3M5I18M4D10M7I1M1I9M2I2M1I21M2I4M1D5M3D13M1I2M1I7M1I8M3D4M2I2M1D8M2I16M2I7M1D10M1D15M3I8M1I7M1I3M1I3M2I9M1D3M1D10M1I3M1I4M1D20M10I3M1I4M1D6M3I9M1D28M2D7M8I14M1I4M1I8M1I4M2I12M1D2M1D5M1D46M2I15M1I13M2I1M4I2M2D4M2I2M1I5M4D2M1I3M1D1M1D10M1I9M1I19M2I12M2I1M1I6M1D2M2I26M4D6M1D15M2I32M2I11M1D5M1I25M2D4M1D4M1I14M3I1M1I4M2I6M1I11M1D4M1D1M1D11M2I4M2I22M4I17M1I13M1D4M5I1M1I6M1I5M1I1M1I8M1I46M2I2M1I7M1I4M1I8M3I1M6I10M2I1M1D8M5D7M3I8M1I2M3I3M1I11M4D6M1I5M1I11M1I29M1D1M2I7M2D5M1I9M2D1M1I13M2I29M4I11M1D19M1I7M7I1M1I9M1D21M2I1M1I8M4I2M5I4M2I6M4D2M2D7M2D4M1I9M3I6M1I1M2I10M1D4M2D5M2I5M1I1M2I5M2I5M1I18M1I17M3I16M2I42M3I4M1D9M1D2M1I7M1D14M1I2M2D13M5D10M1D3M6D5M1I3M4I5M2I3M1D8M1I8M1I2M1I7M3D1M1I2M1I2M1D6M3I2M2I2M3I8M1D14M1D13M1I23M1I29M1I11M1I7M1D13M1D10M1D5M2D27M3I2M1D11M1D27M4I4M1D3M1D4M1I14M3I3M2I3M2D2M1D6M2D6M1I1M2I2M3I14M2D3M1I6M2I26M3I4M2I6M5I18M1I2M2D8M2I19M4I3M1I5M4D15M3D6M2I11M2D8M2D2M1I2M2D5M2I17M1I8M1D15M1D5M1I2M1I2M4I1M4I2M1I19M1D18M2D9M1D3M2D2M3I6M5I11M3D7M4I3M1I1M2D7M3I25M1D1M1D8M3D6M2I11M3I17M4I1M1I1M1I4M2I12M1I1M2I33M1I13M2I22M4I1M1I4M1I7M1I1M2D6M8I2M3I6M3D12M2D8M1D15M1I3M1I8M1D4M2D4M1D14M2I15M1D7M2I22M3D6M6I3M2I4M3I14M1I2M1I3M2I16M2D17M1I9M1D6M1I20M2D5M1D12M1D3M1D15M1D7M4D7M1D3M1D5M2I3M1I4M2I9M1D4M1I2M2D5M5I25M1I33M1D5M2D5M2I28M2D4M1D16M1I21M1D11M1I9M2I2M2D10M8D10M5I3M1I3M4I10M2D3M1D3M4D20M1I12M1D3M2I21M3I20M5I2M1I30M2I1M1I14M1I15M4I2M3I7M3D7M1D17M2D44M1D5M3I4M1I18M1D1M3D8M1D35M1I6M3D10M3D8M1I11M5I14M5D16M3D4M1I5M4D5M1I4M1I6M2D9M2D4M3D14M1D7M3I5M1D7M1I7M1D61M4D11M2I6M1I11M1I5M2D14M1I27M1I2M2D8M1D10M1I6M1D3M1D19M1I8M2D3M1I3M1D4M2D4M1I12M1D2M1I6M1I14M3I18M1D10M1D14M1D5M1D3M1D7M2D7M3D7M3D20M1I11M1I9M1I28M1D11M2I3M2D7M1I22M1I5M1D7M1I3M3I12M1D6M6D8M1D6M2D1M1I10M5I2M3I6M1D3M2I2M1D11M1I6M2I9M4I9M1I29M1D37M4I14M1I13M2D1M1D4M2D7M1I17M1D13M1D4M1D5M1D10M1I11M1I6M1D5M1I4M1I10M3I12M1D4M1D9M4I28M3I7M1I14M2I3M2I5M1I37M6I4M1I4M2I5M4I3M1I5M1D12M1I2M2D5M1I9M1D2M1I19M2I14M2D18M2I6M4I6M2D2M3D4M1I15M4I4M4D4M1I5M2D6M1I2M1I2M3I18M2D7M2D3M1I6M2D2M2I26M2I9M1I6M1I17M8I4M1D6M3I9M2D5M2I21M3I23M1I2M1D3M2I4M1D2M1D10M1I6M1I3M1I24M1D19M1I21M2D3M2I2M1D11M3I28M1I3M2I15M1D9M2D7M1I10M1I2M2I7M1I17M5D16M1I4M2I4M1I10M1I8M1D1M1D10M3D13M1I10M2I2M1D9M1D11M4D16M1I15M1I12M2I2M1D1M2D3M1D3M1D8M7I16M3D2M6I3M1D7M3I3M1I6M1D3M7D2M1D6M1I6M1D7M4D25M1D2M1D4M1I18M1D13M1I17M1I18M2I9M1I2M1I16M1D13M2I7M2D4M1I15M2I10M1D6M1I13M2I1M1I9M1D9M1I41M3D8M3I11M1I3M1I13M1D4M1D13M1D3M2D5M3I17M1D3M2I1M1I4M1D6M1I2M1D1M1D4M1D3M1D2M1I18M1D12M2I40M1D1M1D21M1I9M1I4M1D3M3D1M1D3M1I16M1I21M2I6M2D13M4D7M1I1M1I2M1I8M2I4M5I3M1I7M2D2M2D22M1D2M1D1M1D5M1D29M1D10M1D1M2I10M2D6M2I16M1D24M2D7M2D8M1I34M1D13M3I20M2I1M1I28M4I29M1I4M1I5M2I1M1I3M1I2M2D3M3D5M3D28M2I26M2I14M1D3M1D1M2D16M2I13M1D19M1I6M2I5M4I7M1I3M1I8M3D6M1I10M1I2M2I4M2I4M1I5M1I7M2D5M5I11M1I15M4D13M1D5M1D5M2D1M1D9M1D3M3I8M1D1M1D9M1D8M1D35M1D11M1D10M1I25M1I15M1D3M1I23M2I5M1I11M1D1M1D6M1I5M1D11M1D2M1D3M1I8M1D11M2I1M1I2M1I9M1I7M2D10M2D7M2D1M2D8M1I5M1D39M1D1M1D34M1D6M2D6M4I10M1D6M1I3M2I7M1I2M2D16M4I25M4I10M1I3M2D10M4I1M1I5M3D4M1D12M3I4M1D5M2D4M1D5M2I1M4I1M1D13M3I5M4I3M1D31M1I7M2D3M1D4M4D2M1I3M3D20M1I6M1I3M1I4M3I12M2D3M2D12M2D4M3D6M2I9M1D16M1I4M1I7M1D16M1I16M1I3M2D1M1I9M2I12M1I8M1I14M1I5M1I1M3D1M1D3M2I3M2D7M1D14M2I3M1I17M3D1M1D12M8I8M4I4M4D11M2I9M1I5M1D9M2I5M1D6M1D4M2D2M3D6M1I14M3D2M1I2M1I8M2D4M1D1M2D11M1I11M2D7M1D12M1D33M1I3M2I14M2I18M1D3M2D16M5D3M2I8M1I10M1I4M3D1M1D1M2D4M1D4M1I11M2I2M2D8M5I7M1I2M1D1M1D15M1D8M1D1M3I8M1D5M1I13M2D3M1I2M4I13M1I3M2I9M4I9M2D13M4I5M2I4M2D6M3I3M1D6M1I1M2D4M1I9M1D22M1D3M1D36M2D25M16S	*	0	0	CCCATTTTCTTTTAGTGCTCTTGCGCCGTGCTTACTGGTTTATCTCGAGATATGCCGCGTTATCGCGCACTTGCTCAAATGCTGCATTGATACATATTTTGACCCTGAATTATTTCGCTTGAATTTGAATCAATTCCTCCAAACCGCAGAACAGTAACATTTATTATTCAAACAAAACCAGATTATAGGATATGACATTTGGTATAACAATAATGTTATTGAAAATGGAAAATGATGATCCATTAATGGCTTGGCTAAATTCCGCAATACGATAGAAAAACAAGGCGATTTAGAAATGTATAGCGAGGCAAAGAGAGGCGCCCTGAGTGCACCCGATAGGAAGAAGCAGAAGTGGAGTTATTAAATGAAAGTATGTTAAACATTGGTATAAAAGTTAGTAGTCAGACTTGCAAAAGAAATTAGCTTCAGTTTAACTGAATCATATCTATTATTAAATCAGAAAGACGATGGGTCGCTAATACCTAAAGATTACGAATTATTACATGCCTTAGCTATAATCTATGGCAGAATCGTATAACTGCTGTAACTGTGGCGACCGTATTAAGATGCGTTCCAATCATCGCCTTGATTTCGCCAACATCATTCGACTCTTTATTTGATGATGAAACAGGAGAATACTTATTTAAAATTAAATTCCATTACTCCATAAGCAAATTGTCATTTAGCATGATACAATATTATGACAATAAATGATGAATTCCTGAAAATATTAAAGAGCGTCTAAACTGATAAGCCTAAAATATCACTTCGACAGAAGAGTTAGTTGACTATACAGCCAAGCTTGCAGAAACGACTTTTTAAAGGACGGTTATCACATTCAATCATTAATCTTTTATGATAAACAATTCCATCCAATTGATTTAATCAATACAACATTTGAAATCAAGCAGATAAATATATTTGGCGGTGGGAGCAGAGGCCGAAGAGAGCCAAAGAAACAAATGCGAGGGGTCCCATTTGGATATCAGAGCTATGAGAAAATACCGCAGCAAGCATCTACTCCAATAAACCAATACATACAATGCCCATTATAGTGAAGACTTCAGGTAATTGGAATTGATTCAAATAATAATCAAATGTATTTCATGGGGAAAATAGTTAGAGAAAACGCAGGCAGGGCTCGGCACTAGATTCGCATATCGCTAGATAAACATGACGAAAAACCATATTTCATGCGTTCAGTCTTAAAGGCAATTGGCGGTGATGTAAACACTACGAACACGTGAGTCATAGAACTTTCCAGGTTCTCCTGAAGATAATAATCGCCAAATAAACCAATACTCAGCTTTACAATATACTAACTAACCGCAGAACGTTTATTTCATACAACGTTTCTGCGGCATCAAAACGATTACTCCATAACAATTGTAGACCAAGCAGGCCACTCAATATCAGGTGCAGTTGATGTATCAACACGGTTCAGCAACACCGATACTCTTCTTCCAGGCTTCCAGCAACGAGGTTTCTTCCTTCGTGCGTTGGCACTCCAGATCTGCATGACCTCCGGACACGGCGCAATATGCTCACTGGCTACCTGCATCAGGCTTTTTGTTTCTTCCGCCCCCGAGATCGAAAGAGTGTGCCTGGCCGGTGGCGAGCCTCCGTCGCCGAGCCGTTGCCGTTTCCACTTCTGCTTATTCCCCTCCCGGGGTAACCATCCTAGATTTTCCGTAACGGACCGGGGTTCAGAAATAAAATAACGCGTCTACAGAAGCCGTCATAGACGGTTTACCCCGATGGTCTTCTAACGAGATGCCACGATGCCTCATCACTGTTAACGAAAACAGCCACAAAGCCAGCCGGAATATATCGCGGTGCAATATCGGTACTGTTTGCAGGCAGACCGTATGAGAGGCGGAATATATGCGTCACCTTCACCAATAAATTCATTAGTTCAGGCCAGCAGATTATAATTTTATGGTCCGTGGTTGTTCACTCATTCTGAATGCCATTATGCAAGCCTCACAATATAGTTAAATGCAATGTTTTGACGGTGTTTTCCCGTTACCTCCCGCAGCGTTAACGGTATGGTGTCCGTGTGAACCAATACTGAAAGAATGGGCATGAGCACACCGATACGACTGGATGCCTGGTGCCACCAATACCAACTGTATGCGCATGTGCAGGGCACTCACGGCTGTACCGCTGGACAAATGAGTACTTAGCTGCCTTGACTGTCACGTTTCGCTCGCGCGAGGAGACGCATCTCAGTGCCGTGCTTCCCTAACGGGCGTAAACTTCCTGTAATGGTTTGCTGTTCCATACTGACTCCAGCCCAGAACTGTTCATCCTTAAACCATGTGTGTGGCATGAGCACCCGCGGCCCCTGTTGAACCGCTCAGACTGTGAGCATGAGCCCCCGTGTTATTCGTCGATTTGTCCGTACGTAATTGAAACTGCCTGTTGTTTTCGTCCCCGTAATCAAACGACGACTTGGTTTTCGTCCCCAAATCCGTACCGGATGCTGCACTGGCACTGTGGGTGCGGTGCGACTTAATTCCATCCCTGTTCCTGAGACAATACAGCACGACCGCTGGCGGGTTTTCCCTTGATTGTCCCCTCTAGCGCATATCAGGAAGCACCCGATGGGGATACGCGACAGCAAGTTTTGGGTAGGCTGATTGTCAAACGCCTGCCCCTGCATCAGGTGACGCCTCAGAACGACGTATGATGCCACGGGATCGGCGCACCTGCCGGAAGGTGAATTCAGCCATCGGCTCCGAGTAATTGCCAATGATACTGCAACGGAATTTTTCAGAATATCCCTGCCAACCTGTCAGTTCAGGAGTGGAAGCGGCAGAAGGAAGAGTGCCGAAAAGAAGGATCGTACAATCTTAGAATCTCTTTCGAACTCCTTCACTGGGCGCCGTCAGTCGCATTCTTCGGTTGTTTACCCGCAAGCGCGTTAGTCATGGTGTAGCATAAATCTGGATCATTCCCGAGCTGCGGCCAGTTCATTCAGCGTATTCAGTGCGTCAAGGTGACGCGTCGATAACATCTGCAATCGCGGCCAGTGATACAAAGCGGTGTTCGCAATCTGGTATTGTTTGTTCCTGAGCGCGGTTGGTGCTGTTGGCGTTCCGGGTCAGTGCCGACTGTCCAGTGGGCTTTCTTCGTTCATCCATTACCACCTTAACCGCTTTGGCGTGCAGCAAGGCGTTTCAGACGTGCTGTTGGTTGCACTGCTGAGCTGCACTATCCGCCCCTTTCTCGTTGTCCGCATCCTCAAGCGCGACAGCTGAAGCTATATCTTGCACGTTTTGCCGAATTTGCACCGTATTGCCGCCGCTTCTGCCGCACTTTGCTCTGCGATGCTGATACCGAGCTTCCCACGAGCTCCTCCTTCGCTCCGGCTGGAATGCAGCGCCGAAGCCGCCGCTGTTTGCGTCTCGCGAGCAGAGGGAGGTGGGGCGTTCCGCTGCTGTTTCAGATGACCTGGCATTCGTCTCGCACGTTTGCCGCCCTGGCAGAATTTCTGCCGCCGTTGCCGGAAGCTGCACGACCGGCACTTGATGATGCGTTCGTTTCTGATGATTTTGCTGCCTCTTTGAGGCCACCGCATCTCGTGAAGTGGCGGCGGCCTCTAACGGGTGGCTTTCGTGGCCGTGGAGGCAGACGTGGCGGCTGATTGTTGTGACGCTGCATCGCATTCGGTTTCTGACGTTTTCGCCGCACCGGCACTGGCCGCCGGAGTTTTGGGGACTCTGCGGCTGCGGCACTTTTCCGCTCGTGCCGTGGCCTTTGCTGATGCCGCTTCTGCGCCGGAGGACCCTTCCTGAGCTGACGATGCAGCCTGTCCGGCGCGGACGTGCTGGCGGCGCGTGCTGGCTTAGTTGCATCAGTCACGGGGCCATCGGGTACCTGAGCAGCTGATGCAGGGCATCGCCGGCTGATTTCTTCGCGTCTGCCGTACTCTGTGCCTACGACGGCGTTACGCGCCTTTGCGCGAGACGAATGCCCCGGAACCCGACGCAGCAGGCAGCGACTCGATTCTCCGTTCATGAGGGGCAAATGAAATGCCGTCCCCGTTGAATCTTCATACACGGTATGGTCCCGGCGTGCATCTTGGAGTGGAAACGTCATACTGCAGGATGACACTGTACTGACCGTACTCCACATCCATGCTGTAACGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCTACCACCCGTGGTGCTGTTACCGTCGGCCTTTCAGCTGAATGGTGGAGTTCTGTACCGGTTTTCCTGTGCCGTCTTTCAGACTCCTGAAATCTTTACTGCCATATTCGCCAGCAAAAGCACCGGTTCCGTGGAGCGTCCACCACTGTGTTACCTGGCTAATGATCAGAATTTATAACCGACCCAACGATGAATCCGTCCGTACGCAGTCTCATGCCGCCAGCCTTCAGCAATAACAACGACGGACGCTGCCGGCATTAATCTGTATACTGCACTCTCCACGCCACTGAGGTATGCCGCATTGCATTTCGTCCCTGGCAGTGGTCGTCTCTTTCGGCCCGGGGAGTGATTTCCGTCTTACGGTAGATCGGGCATTGTACTGCCGACCACTGAAAGCCTCCTCCGCGCGAACGCGCAGGGATGCGCGCCGGCGACCATGTTTGTAAAACCGGTCCGGCCATCACGCTCACATAACGTCCACGGCAGGCTCAGGTGAAACGTATCCTCCCCGGTCATCACTGTGCTGCTCGTTTCGACGCGGCGAAGCGAACCAGGGAAGCCAACGGCCCCCACACTGTCCCGTTCAACGGTACTTCACGTTAATCCCTTCGATGACTCACACCGTATCCCGCCGACAACGACGGCAATGTACCCGGTTTCATTGAAGACTACGCCACCGTAAACGACGTACCATGTCCTTCCGCACGGGCCGCGCGGAGTAACTGTCACCGCAAGTGCGGCAAAGAAGACAGCAACGGCAATACACAAGTCACTCACATCCGTTCCTCTCACTGTTTATAATAAACGCCCGTTCCCGTCCCACGAGGTGAACCTCTGTAACACACTCAGACCACGCTGATGCCCAGCGCCCTATTTCTTAGTACGCCATAACTGCGCATCGCTGGCAAACGTATACGGCGGAATATCTGCCGAATGCCGTGTGGACGTAAGCGTCGAACGTCAGGATCACGTTTCCCGAACTGAGGCGCCTGGCGTGGATACAGGCGATGCGATCGCGATTCCTTCCTCCTCCCCGAGCGAGCAAGCCAAGCACCGTTCATCAGTACTTTCAGATAACACATCGAATACGTTGTCCCTGCCTATGACAGTGCTTGATTCAGGCCTCCTCCGGGTAGAAACGTCAGCGGAAAGCAGCACTATCTGGCGATCAATAAAGGATGGTCATCGGTCACGGTAGAAGTCCACGGGTCCTGACGGCCAGTCCACATGCTTTTCACGCCTGGCTAGGAAAAGCCCGCTCGCCGCCTTTACAATGTCCCCGACGATTTTCCGCCCTCATCCGTACCGTTTATCGTACAGTTTTCAGCTATCGTCACATTACTCATCCGTCCCCGGAGTTCGCATTCACACTGCCACTGATATCCCGGTTTTAGCGGTCAGCTTTCAGCGTCCCTGTTAGGAAAGGCCGGAGGATTGCCATCGCCTAGTAGATGGGTGGGGGCCGTCAGGCAGCTTCAGGAACACGTCGTTCATGAATATCTGGTTGCTCCCTGCGCCAAACATCGGCGTTTCATTCCCGTTTGCCGGGTCAATAAATGCGATTACGATTGGCGGCAACCGACCAGAACTGTAGACGCTCAGTTTGCCTTCCTCCGTGTCCTCCATGCCTCCGGCGCTCCCGCTACCTGACTTCCGTCTGTTGGTCTGTACGAACCCCAAGAGGGATGCGATAGCCTACAAGGCAATCCTTCCACTCTGTTCGAAGCTCCTCCAGTGTTGCTTGGCGTTATCCTCCGTCAGCTCGACTTTTCCATAGCAGCTCCTTGCCCTAGATGGGATTCAGTCTCTTGCCTTTGGAAAAATCCAGGTGACCTTCCGCATCATCTAGCCCGACCGACGACGGCCTCCACGGAATGCAGCAATTGCCAACGTGTTCACACTGCGGATATAAAGTAATAATCATGGCCCGGTTTGATATTGATGGCGGCTATCCAGTACAGCGCTAGTCCATCAAGATAACGCGTGCCTGGTTTCAACCGTCTGATATCCGCAATCTGCTTTTCCTAAGAACCAGAACCAAACTGTACCGTCCGTATAAACGGCAAGATGCGGCGTGGCGGTTATCTGGAAAATAGCCCGGCGTCAGCTCAATCCTCGACGGTGCTGCCGGTGCGGCAATCCGGAACCGATACCGACGGATGTACGCCTTGCTGCCCCCACGCATTTACCGCCCGGACTGTCAGCCTGTAGTTCCCCAGCGCCAGTTGCGTGAAGCGGTATGTGATGCGTTGTAGAATCGTACCAGCCGAGGATTGCACTCGGCGCGGGGCCGTCGTCCACGTCGCGTCGCCTCAGCATTCCGCTCACGCCCTTCGCCCCTTCGGTGTGTCCCATCGCCCCCTCATGATATTCCCGCTGTCTGCATGACTTCTGCGGTCAGGTGCTGCAGCTGGCGGCGTGACACCCATTCACCGTGCCACTCTGTTCGCCGTCAAAGTGCGCCCCGTTATCTAGATTATGGCCTCTTTTCCGGCTAATCCTGCTGCACGGCGGTGATGGCATCCGTTAGAGCGTCGTCGTTCTCACGATACTGACGCATAGAACAGTCGCATGAGGCAGCGTCGGCAGCTTCAGCTCCCATACGCTGTATTCAGCAACACCGTCAGGAACACGGCTCATTTACCTTTTCACGCCGTCGGTGACGGACCCTCCACGCTGACCGCGGATTGCCACTTGCGTCAACCAGGCTTATCACGCCCGGTATACCGGAGAGATGGCAGCGTACACTTCACGACGGTCCAGCGTCGGGAGCGTCGGGTCTGGCTTGTTCACCGCCAGAAGCACGACCCGGTGCTGATACCGGCATAGTCATCATCGCAGATTTCAATAACACGCGCCGAATACCGGGGAACCCCGATGCCTCCCGAAGCTGAAATCCACGTCTGCGTTTCCAGCAGTTCTTTCTGCCATCCGCCCAGCCCGGCGCGGTGTGCCTGCCCCCGGCTGGTACAGCCAAGGGCATCCATCTTCGTAACAGTCGACCGTAACGGGCAATGGCCTGCGTATCTTCAACAGCTCTGTCTCTGCCGTCTCCCAGCCGTTGTTCGGGTCAACCGAGTTCACTCAACGAAATGGTAATAGGCGGCTTTATCTTCAGGGCGCTGAAGCTGTAGCGGAACGGCGCGCCATCAATGAGGCATCACCACATTACTTGAGTTATAGGTCCACTTTATCCGACGGTCGGTCCTGCACGAACGTCAGTGGTGCCCGTTCCATACCGGCATACAGCGCATCGCCGAGCAGAAATCAGCCCCACATCCACGCCTTACTGACGCTGTGGTCAGGTGAGCATTACAGGTGGGTGATGCGCGGCTCCCCGTCCCGCCAAAGCCGTCCGGCACTGACTGGTCGGCCCAATCTATCAGGAATACATGCGGGGCCCATTTATCCCAAGCTTAGCCGCCGCACCAAGACGTTCTCCCCATGCCGTAGCGGATGGAGTGGAAGCCCAAGAAGAGACTTATTGAGGTATGCCGGTTTAAACGTTCCGTCCCGACAGATACCGCTGTATTGCCGTCTTGAGGGTCAGTAGGGCACGCCTGCGCCGATACGCCGCCGGAGGTGGGTAGGTTGCCGGCTCTAGCTGCTGGCTGCCGAACTGCAGCGAGTCCACCTGCACGCCGACCAGTGCCGTGTTCGGTAGCACTGTTCTACATCGATGATTTCAGTGTATGACGACCAGAGCGTTTGTTCTGCAGCTGGTCTGTGGTGCTGTCCGGCGTCATCCTGCGCATCCTTGGAGCAGGATATTAAGCCAAACGCGCGGCGGCAGGTCTACCCATCACACCAGGCCAGATGCTCTGCAGGTGGTTGAGCTGTAATGGTGATGTCTTTTCTCGTTACCCAGCCACCGTTACGTTGTATCTGAAACCAGCAGGCGACTTCCGACGGATTCCTGTCACCCTTTGAGGTGGTTTCCACCAGTGCCTGTACACCGACCATAGAAGGGGCAGACGGTCGATGTTTGCAGACGTAATGGTGCGGGTGAATTGTCATATTTCACATGCCGAGCCCGAGAATTAGCCGAGGAATGCGATTCCCGATCCGCAGGGCTTTATTGCTCCTAGCCCCAGCCCGGAACACCACCGTGACACCGGATATGTTGTATTCCCCTCAGTGTCCCAGCATCCATTCGGCTCTTTCCTCATGCAGCGCGCCGTTGCACTCATCCAAGCGACCTTCAATCGTAGTGCGCTGATGGCGGTGGCACAATCACCACACTCAGCTAACTGCGTGGACTTCAGCTTGTCCTTCATTCCTAGCGGGGTCCCTTACTGCTTCCTTTACCCATTCCTCACTCCATAAATGACAAAACCGCCGCATAGCGGTTTGGTTTAT	*	tp:A:P	cm:i:119	s1:i:1131	s2:i:0	NM:i:2370	ms:i:3658	AS:i:3658	nn:i:0
+71	0	utg000001l	27909	60	25S4M1I7M4D11M2I6M1I18M4I4M1D13M1D12M1I10M1I2M1I7M1I3M3D8M1I6M1D14M1I9M1I8M2D4M2D5M2D4M1I5M1D3M1I7M1D4M2I22M3D18M1D19M6D1M1D32M2I24M2I10M1D10M1D3M2D24M2I3M2D4M6I14M1I6M1I5M1I5M1D24M2D2M2D4M3D3M3I4M1I7M2D5M1I3M1D33M2I9M3I38M1D30M1I5M2I8M1I25M1D5M1D6M1I15M4I8M1I2M1I2M2I9M1D16M1I3M2I14M1D14M1I34M1I4M1D25M2I2M1D12M1I4M1D22M1I23M1D9M2I3M1I5M1D5M1D11M2D2M1D16M1I14M4I3M1I11M2D17M336S	*	0	0	TTTGATGGCGTCCTTACCTTATGTTTAACTGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCACCACCACAATCCGTAAGCTGTTACGTCGGCTTTCAGCTGAAATGGTGCAGTTCTGTAGTACTCAGTTCCTGTGCCGTCTTTCAGGACTCCTGAACATCTTTACTGCCATATTCACCCCAAAGCACCGGTTCCGGCGGGCTGTCTAGCCTGTGTTACCTGGCTAATCAGAATTAACCGATCCCAACGATGAATCCGTCCGTACGCCAGTTCCTTCCATGCCTTCATAAGCAATATGGACAACAGGACGGACGCTGCCGGATTAATCTGTATACCTGCACTCCACGCCACTAGGTGCCGCATTGCACTTTCGTCCCTGGCAGTGGTCGCGTTAGTCCTTTCATACCCGGGGAGTGGATTTCCGTCTTACGGTAATCGGATGTACTGCCGGCAGACTTGACTCGCTAGCCGGCCAGTGAATCACCAGACCTGCTTACTGATTTGTAAAACCGGTCGGCCATCACGCTCAATAACGTCCACGCAGGCTCAGGTGAAACGTATCCTCCCCGGTCATCACTGTGCTGCTCTTTTCGACGGGGTGAAATCCCCAGGGAACCCCATCATCCCCACACTGTCCGTCACTCATACGGTACTTCACGTTAATCCCTTTCGTCAGATGACCTACACTCACCGGTATCCCGCCCGACAACGACGGCAAGATGGCCCGGTTTCATTGAAAGTAGCCCACCGTAAACGTACCATGTCCCTTTCCGCACGGGCTGAGAGTACTGTCACCGCAAGTGCGGCAAAGAAGCAAACGGCAATACACCAATCGCATCGTTCCTCTCACTGTTTGGTAATAAACGCCGTTTCCCGGACGAACCTGTAACACTCAGACCACGCTCTTACCCTCCGCTTTCTTAATGCCCCAGATAATGCACATCGCTGACGCAAACCGTATACGGCGGAATATCTGCCGAATGCGTTCATTAGGGCACGTGGCAGCGAACGTCATTCAGCTACAGGATCACTAGCCGTTTCCCGCGACCCGCTGGCAGCGTGAGCACAATACGGGGGAGAACAGCTGTACCGCCTCGTTCGCGCCGGAGCCTCATAAATCACAGCGCACCGTTCATCAGTACTTTCAGATAACACATGAATACGTTGCTTACGACAGTAAATCGCTGTGATTCCTCTACCGAATATTCTAGCGGAAATATTATTAGCAGTCAAAGGATGGTCATCGGTTATCAAGTGACAGTTAAGGGTATAGTACGGCCAGTTAAGTGGGTCGGTTCAAGACATAGCCGTTCTTGTTGA	*	tp:A:P	cm:i:11	s1:i:109	s2:i:0	NM:i:213	ms:i:714	AS:i:714	nn:i:0
+72	16	utg000001l	6139	60	133S10M1I5M1D3M2D4M1I7M5I27M1D10M2I5M1D12M1I3M3D20M2D1M1D6M1D6M3I2M2I12M3I17M4I5M1I14M1I2M7I3M4D2M2I2M1I2M1I6M4D4M2I1M1D7M3I5M4I4M1D5M1D1M1D5M1D6M3D9M1I11M1I6M1D15M2D13M2I9M1I5M1I12M1D4M3I2M1D5M2I5M1D4M1D1M1D13M3D10M1I6M1D3M1I13M1D12M1D5M3I2M1D2M2I6M4D2M2I8M1D1M1D6M1I18M1D2M2D11M2D2M1D1M1D14M3D10M1I4M1D11M1D17M1D6M1I9M2D11M1D3M3D1M1D5M1D17M2D11M2D30M1D6M1I8M1I3M1D15M2I8M1I4M1D12M1D6M1D5M2D4M1D1M1D8M1D6M2D2M3D2M3D1M2D11M1I8M1I8M2I13M2I4M3I3M3I6M3D9M1D1M2I16M2D21M3D5M2D4M2D4M5I28M2I10M2D2M1D2M2D21M2D4M1D2M2D4M1I6M3I12M3I4M1D23M15D1M5D18M1D15M1D1M1D2M2D9M2D5M1I9M1D15M5D16M1D10M1D6M1I7M3D4M2I4M1D10M3D16M2I14M1I5M1I4M2I3M3D4M3D6M3I27M1I23M7D10M3D7M2D10M1D17M3D8M2I27M3I16M2D35M3D5M3I5M1I12M2D5M3I2M3D12M2I4M1D5M1D19M1D5M1I15M1I34M1D22M2D22M5I2M1D18M1D10M1I14M2I9M2D3M1I6M2D4M3D7M1I6M2D1M2D7M1I1M2D9M1I3M2D23M1D3M3I13M2I7M1D10M1I4M2I2M1I2M2D3M2D3M2I2M2I14M2D2M1D10M1I10M7D15M2I4M1I2M1I6M2I10M1D4M1D10M1I3M3D5M1D8M1D2M2D1M1D2M1D8M1I3M2D34M2D8M1D9M1I9M2D1M1D10M1I2M1D9M4D2M1I5M1I7M3I12M2I8M1I8M2I11M1D9M1D12M3D20M1D11M6I1M1I7M2I7M4D16M2I8M1D2M2D3M1I5M2I5M3D5M1I13M8I1M1I3M3D13M1D1M2D4M3I5M3I1M2D4M2D2M2D62M1I11M1D25M1I3M1D1M1D4M7D4M13D2M2D10M3D6M1D10M1I4M2I4M3D3M1D13M1D9M3D4M2I6M1D4M1D7M2I1M1I2M2D5M1D1M2D5M2I15M1I9M2D31M1I5M4D4M3D6M1I9M1I16M1I12M2D8M2D19M1D5M2I5M1I11M1I1M1I11M2D10M1I9M1D5M3I7M1I4M3I5M1I3M1I7M2I7M2D23M2D24M1D5M2D17M1D3M2D20M5I2M3I19M6D5M2D13M3I7M1D5M2I7M3D3M2I3M1D9M5I4M1I11M2D13M1D3M1I6M3D12M1I4M5I7M5I5M4D4M3D13M2I7M4D2M2D11M2D4M2D4M1D15M2D3M3D5M1D4M3I3M2D4M1D3M2I4M1D6M1D5M4D7M1I9M6I14M1I13M1D7M1D9M1D5M1D7M1I2M3I7M1I15M2I5M1I9M3I19M2I20M2D15M1D7M1D5M1I4M3D9M2I4M1D3M1I4M2I4M1D7M1I4M2D3M3I10M1I6M1I9M2D7M1D3M4D2M2D6M1I6M1D12M3I25M3I8M3D1M1D11M1I4M1I3M1D18M4D6M5I2M1I5M5I10M2I9M5I12M6I4M1I1M1I5M1I14M3I41M1I35M1D7M1D11M1I10M1I4M2D9M1I6M1D10M1D19M1I10M6I2M2I3M1D8M1I7M1D15M1I3M1I3M3D13M1I7M1I20M4I9M1D11M1I27M1I8M2I6M1I3M2D13M7I5M1I2M4I4M3D4M2I2M1D23M1I4M1I16M4D19M1D28M3I20M3I2M1I2M1D3M1I12M3I10M1I7M2I4M2I9M8I9M1I1M2D10M1D5M2D2M1D11M1I12M1D3M3D4M1D1M2D22M1D6M1I3M1D8M2I3M1D6M1D14M2D6M2I8M1I10M1I4M2I3M2I2M1I4M5I3M1I4M8I11M2I25M1I4M1I5M2D5M2I11M1I7M2D9M1I5M37I26M1D8M3D4M5I5M3I1M1D10M1I17M2I1M1D16M2I3M2D15M7D4M2D4M4D2M1D5M3I3M5I5M1D7M4I13M2D14M4D2M1D1M1D12M3D5M1I10M3I11M1I5M3I8M2I1M1I4M1I3M1D20M5D5M1D3M3I6M3D8M2I19M1I9M1I5M1I10M1I2M1I9M9I9M2I9M3I30M3I41M3I7M1I4M2I12M1I9M4I1M1D7M1D1M1D6M3I8M2I1M1I19M2I6M2I10M1D1M1D6M1I25M1I13M2I1M6I5M1D5M1I4M2I9M1D4M2I1M1D9M3I3M2D12M1I11M1D1M3I6M4D11M1I6M2I7M2I6M3I5M1I1M2D13M1I1M2I2M1I4M1D1M1D6M2I10M3D8M1I5M3I3M1D4M1D19M3I10M5I5M2D1M1I13M1I2M1I17M1D1M1D2M2I4M2I2M1D3M2I1M1D14M2I5M2D3M1D9M2D2M1D3M2D11M2I16M2I3M1I8M3D4M1D4M3D3M3I3M1I3M2I7M1I22M1D6M4D4M1D8M1D9M2I26M1I24M1I5M1I2M2I1M1I10M3I2M1I10M1D1M1D3M1I30M1I3M1D4M3I3M1I12M4D18M1I3M6D16M1I1M1I8M1D15M2D2M1D13M2D3M1I6M2I8M1I10M4I1M2I4M1D3M1D2M3I7M5D4M1D10M1D14M1I11M1D14M2I1M2I7M6I6M1D3M3I6M4D7M1D13M6D7M1D15M2I2M1D2M1I23M2I4M2I2M1I17M1I3M5I10M1I2M7I13M1I9M5I8M1I12M8I7M5D6M2I7M4I3M4I3M1I2M1D3M2D2M2I9M3I6M1I7M1D3M1D3M1D22M4D4M3I5M2I8M8I1M1I2M2I1M1I4M6I1M1I3M1D11M1I4M1D24M1D28M7D11M1D4M1I3M1D2M5D6M2I3M2I22M3D17M1I13M1D25M1I3M1D5M1D1M2I13M1D20M1D22M1D6M2D43M1I4M3I1M1D4M3I1M2I14M5D17M1D1M2I11M2D10M1D14M1D17M4D7M2D9M3I16M3D1M1I4M3D2M2D16M1D4M2D20M3D1M3D3M6D13M1D4M1I14M1I1M1I7M4D6M1D18M1D13M2D26M1D4M2I8M1I7M1D10M1D6M1D10M1D3M1D17M2D6M10D5M2D5M1D13M2D11M2I2M1I2M3D25M4D20M37S	*	0	0	CCTAATGGCCTTCTGTCGTACTAGTGCTCTTCCCTCGTTCGGGTTCGGATCGTGCTCAGATCATCCCTCAAGCAGTCGAGGCCCAATTAGCGACATCTTCCAGCACATGCAGCTTCTCGAAGGGTCTAAAGCTAAGCTCGGCCGGACGCTTCGTTCGGTAACTTTACGCCGATTTTGGTCAATCACCTTGTTTTCCCGCACGACGTCGTCACCGGATATGCCACAGGCTCAGTGTAGTTGAAGGTTTGATAGATTCTTTGGGATTGGCTTGGGTTTATTTCTGGTGCGTTTCGTTGGAAAGTATATTTGCAGTTTTCGCAGATTAGTGGCCAGGCTCGCTGCTCAGTGCAGATTACGTCCTCCTTTTCCTGCTTAGTGGTAACACCCCTGTTGGTGTTCTTCACGGAGACACCATCGATTCCAGTAAGGTTGATTTGGTCGGAAGCGGTTATCTTCTGGTTGCCTTCACCGCGCTAGATACCTTCGCTCGTCGGGCGCTTCCTCCCCGAAGTCGAAATCAAGCTGCCCTCCAAATATTTTCACCGACCTCAGAACAAGAGCGGTATCGAATCTTTAGTCCCTGTCCACCATGGAATACAGGGCTTGATAATGGGTCTTCTGAATACATTTTCTAAGGTCCGTCAGCTTCTTCCTGGTACATAATCTCTTTGTGGCTTTCCCGATGTCGTCACGCACATGGGATGCGTGATGACCTCATTAAACACGCTGCATCCCCTCACCTTGCAGGCAAGTCGATTTTGCGTTGATTTAATGCAGAATATGCAGTTACCGAGATGTCCGGTATTTGCAAATTCGAATGGTTGTTGCTTCGGCACCATGCGAGGATATCTTCCTTCTAACATCGACAGCGGCCAGGAGCTCGCTTCCGCGTCGCGGCCGCTTCGGGTTCATCAGCTCTGATGCCAATCCACGTGGTGGGATTCCGCCTCGCCCGAAATCATCACAGAGCTTTGGCGACAGGAACGGTTTAATCTGTCATTGCAGAACGCCGGAGGTGAAGCTGCTCATATTTCTATCACCATATCCATAAATGGCTTCAGAACAGCATTCGTCTGAATATCCTTCACTTCATACGTGACTCAGTTGTGAGTTAGCATCCTAGGTTGATAGACCTGCAATACGGTGAGCGCTATCCAGAACTTCACAACTTCCTGACAAACCGATAGTATTGGATGTTCAACCTGTATCCATGAAACGTAATGCACGTCCTGCCCGTCGCTTTTGCTCCATTAGGAGAGCAAATATGCTGACGTCTGCCACCGGAACTACGATTATGTGGGCGCCTCCTGTCTCCCCATCTTCGCTCCTCCATACTCCAGGTCTCGCCTTCGTCTGACCACTTAACGCCACGCTCTGTACCGAATGCCTGTATAAGCTGGACCTCACCAACTCGCTGTCACGCATGCTGCTCAACTGGCGTTACCACAAAGCCAGAATCCCCTGAAGGTTAGGAACAACATGAGCCTGCTGCTTTAATGCTGCGCTCAACACACTTCCAGCTTTCTGCATCCAGCCGACCAGATGCCATTTCAACCTGACGGAGACAAAGTCTAAGCAGGCCCATAGCTTCCTGTTTGGTCTAAGCTGCCATTCGGTCTCGGAATGGTTACTACGATTATTGGTTTGGTTGGGTCTGGAAGGATTTGCTCACTGCGTGAATAGCGTTTTGCCTCTGCGGGGCTTCCATTCCCACGCTTAGGTTAGTTTTTCATGACTTCCTCTCCCCCAAATAAAGGCCTGCGATTACCAGCAGGCTGTTATTAGGCTTAATGTAGATGGTCCTTAATTCTCATACCGCCATCTAATTCGGAGCTGCGATCTGGCCACTCCTTAAAAACCAGTTCGTGCTGATGTCTTCCTTCCCGTTCTTCCCTCAGCAACGGTAATAAGGTTCGCCAGACCTTACCTTCGATAAGGAAAGACCTGCATTTAGATGCGATCCGCGCTCGATTTATGCTGCTGGTTACTGTTGCGCCTGTTAGCTGAGACGTCCGGCGCACAGAAGCTATTATGCCGTGCCAGGTAATGAATAATTGCCTCTTTGCCCGTCATAATTGCTCCTTTCAGTCGATAACGGCCTTTGATTTCTGCGATCTTCCCCTATGTGCCTCGCATGCTTTCGGCGCTTACCGCCATGACAGGAAGTTGTTTACTGGTTCAGGCATTCGCCTCACACGGTTAATTCCAGTCATATGGACAAGCTTAATGCCACCTGCCCTCATGTCCGTAATCCCCGCATCACCGCATTGGCCCGCAGCTTTCTGATACGTTGTGGTAACCAGCCAGTGCTCCGGTTGATTTCCACGGATAAGACTCCGCATCCGGATACACTTCGGTGCTTCTAACCAGTTCAAAACCATATCAACCAGCTCGCTGACGTTTGGCAGTCCGGCGGTAACGGATGCTTCTTCCCGATCACCATGCAACAAATTGCCCGCTGATGGCAGAAATGAGTGTACTCGAAGCCAGCGCATTCCGATGATTGTTCCATCGGTGATCCCGTTTTCCGAAAGCCAGAACCCACTGGCGCATTCGGTTTCCTTCTTTCCTCCAATCGAGTCGAGTCGGATGGGAAAGTTGCCAGTAACTGGAGGAACACCGTTGATGATCTGCGCTACCTGCTGTACCTGCGTTCGTGGTACTTGTTCCGGCAATGTTGTTGGCGATCCAAACGCATCTGCTCACGTAAATAACCATCTGTGCTATTGTTTTTCATAAGGATCACCCCGTAAAGTACAGTCTGTGTTTAAGGTCGAGTTTTGGTTTGCTGGCTATTGTCACGCCTGCCTTCTGTTGCTTAGTTACGGGTTGATTTCGAGTTGGGTCCACTTATCGCGGATTGGCCGGGAGAGCCAGCACGTTACGGACGAAGTTGTTCTGGCATGCCAGGAACAGCACACATGTCGCGGTGGTTACAGTCGGTCACGTTCACGCACCTATCGGAGCTGCCCCGAAGCGCCACTTCCTTCTGGCTGATGGTGCTTGATAGTCTTCACCACCATGTCAAACATCGACCTTGCGGTCAGTCTTCTGCTTCACCGCCTATGCCGCTGCTGAATTGCAGCATCCGGTTTGTTCACAGAAAGGTCGTTTTCTCAGGCCCGTCACGCCAGAATTCTGACGAATAATCTTTCTTTTCTTTAATGTCTGTTGCCCTGTTTTAGGGATAGCATCCCCAATTTGGAGGTTTATGTTCTAGTTTTAGGCGGGATTTTCCTCGTTTTGAGGGATGCACCATTCTGAGATGTTTGTTGGTAGAACCTCTCCAGCTGCCTATGCTGCTTGATAAGAGCCTCATCTTTGACGAGTTCTTCTAACTTGGCTTCATTGCACCGTTTGACAGGTAACTTTGATCTCGCTTAAGATGGTTTCTGGCTTCTGTCCGGTTTATTCAGTCAGTGTACTCATCGCAGAACCGGCAACTAACCGATTTGAACTGTCTGCTTGGTTAAGATCTGTGCATGACCTCAAGCATAGTGTGATAGTCTGGCGAACCATCATCGAGATCTGCCACATTACGCTTGGAGTGGAATACCCGCGCCGAAGTTTGAGGTATTTGGTGGTTTGTCATAATGACTCCTGTTGATAGATGCTACCGATCTAACTCTGGATGATATGGATTTGTTCAGAACGCTCGGTCATGCCGCTTGGCGTTTTCTTGGTGCGAATCCTCGCAGCAACTGTGTTGCGCCAATCGAGCCATGTCGTCGTCAACGACCCCCATTCAAGAACAGCAAGCAGCATTGAGACTTTGGATCCCGTTTCTCCTTCCTGCCTGGATCTGCGACTTACCCAACGCACAGCTTCCGTCTTCTCAGTTCCAAGCATTGCGATTTGTCTACCATACCAGCACGCATGCGGGGAATCCAGGGTCTCGTTGCGTTTGTTTGGAACCATATGTAAGTATTTCCTTAGATAACAATTGATTGAATGAGGAATGCAAATAATGCAGACCATAGTGTGGTTTGACCTTAAGCCTTTAGAGGGCTGGAATGTAAGAGCGGGCTTTATGCTGTTGTTTGTCTTTTTGTTACTCGGAAGGCTTTACCCTTCCGCATCAACGCTTCCACCATGCCTATCGTAGTTAAAACCCTGCCTTAATGAATGGCCTTGTTGATCGCGCTTTGATACGCCGAGATCTTTATTAGCTGTCTTGGTTTGCCCAAGCGCATTGCATAATCTTTCAGGGATATGCGTTGTTCCATACAACCTCCTTAGTACATGCGAAGGCTCTTACCCCCTGAGACTCGGCCACCCCACTGTCGATATTTATCCCTTGCGATAGATTAACGTAACAAAGAAACCATTAACAAGAGGAAGCTGTAACGAAGTTCTTGCCTGAAGCATTTATGAAAGAAATGAACTTGGGGCTTATCCCAGGAATCTGTCACCGGACAAGATGGGATGGGTGGATGTTCGGCGTTGGTGCTTTATTAACTATGGCATCAATGCATTAAACCTGCTGTAACGCCGCATTGCTGCCAAAAATTCTCAAAAGTTAGTTGAAGAATTTAGCCCTTCAATCGCCAGAGAAATCTACGAGATGTATGAAGGGTTAGTATGCAGCCGTCACTTAGAATGAGTGGATACCCCTGTTTTCTCTCATGTTCAGGCAGGGATGTTCTACTAAGCTTAGGACCTTACCAACGGGTGATGCGAGATGGGTAAGCACAAAGTGATTCTTGCTTCGTTCCTGCTTGGAGGTTGAAGACTACATTCCATGACCGCACCAACAGCTCCATAAGCATTCCCAACGGAATGTTAATTCTCGTTGACCCTGAGCAGGCGATGTTGATGAGCCAGCTGATTTCTGCAGGCCAGACTTGGGGGCGATGTACCCGTCGGTAAGAAAAGCAGGATTAAGTCGTACTGTTTTACACCATATACTAAACCCCACAGTACCCAAGGTATCCCATGGACTTGAGAGGTAGAGTGTTCCGTTGTGGGGAAATTATACGCTAGTCAGTGGCCTGAAGAGACGTTTGATGATGATCGGCATGTTCTGGTATGGCGCATAGCTGATAACAATCATTGAGCAAGAATCTTCATCGAATTAGGGAATTTGCTGGTATCGCCCGGACATAACATAGTAAATGTCGCATTGAATTATGAAGAATGGTTTTTATGCTCAACTTACTCGAGACTACGCGCAAGGCTACCTCGGCCGTACTTGGTCTGTTTTCCTGTCCTGATTAATTCTCTTGCTTCATGAGATGAGCTGGACTACTGCTCCGTAAGGCTTGTATTCATAAAATGTGATGGAAAAATGGAATTCTCCCAAACAATGACAAGAGTTGGGTTCAGAAGATAATCGCTCAAAGCTTCAGTTGAAGATGAGGGCAAGAAACCCCGCAGATGACGAACCCGCATGCCAGATGTGGCTTGCGAAGGCGACACCATTGGTTTGGTAAGCAGAACTGTTTATCTCGGCATCAAGCGATCTGACAGATTTTAATCGGGAAAGGAATGTCATTAAGGGCGTGTTGGAGAGCGTTCAGATAGAGCGTACTGATGAGGAGGACATAAAGACGATGTTATGCATATGCATTTCATGGCGGTCAGAACAATTCGGACTCTACGGGCTCTCGCCTGTGATGATATATTAAAGGTGCCGGCGTAAAGATATTGAAGGCGGTTTACTCATTGGATATAGTCATTAAGGCCAAATTAAAAGGATATAAAAAGATGCCAAGGATATTATTTTATCACGTCGGTCACCTCAATTTTCAGACATTAGCCGGGCAAAAGATGAGGCCGGAGATATTTAACAGAACTACTTATCAGAAAAGGCTCATCTCATGCCTCTGAACATAGATAAGATGCTGAGATAGCTGAAGAGAGCCGCATATCGGAGCAAGAAGGAAAAGTGATACTGGAATGTTTAAAAGCAGTGGGCAAAGTTAAGGATTGACAGGTCGTATAGGATAATCATTATGCGAACAGAATCATGCCTGTTTACATAGTACATAATTCCTTACGTTATCGTAAGCACTTGCTCCTTGCGGTTATCATTCCCTAGGCTTCCTCTCTTTTCTTCTAGACCAGGTGCTAAGATAATCATATGCAGGACGATGATTGCAATCCTGATTGCTGCCTTGAATAGTTTCTACACCTGCAGCAGAACGCGCCGACGTGGCCAAGATTAGAGAGTATGGGTATAATGGGGTAGTTATTGTCTATGCCCTTAGTTTGTTGAGCTTGGAGCCTTTGTTTTTCTGCCTTAGTCTGTTCCACTGCCCAGCATAAGGGCTACATCTACCCACTATCGCCCATCGGCATTGCCTCTGCACTCGTTCATTCATATGCAGCCCTGTTTTCCAACTATACATGTAAGGAGAAAGAATCACGGCGCTCAGCCGCGATTCTTTGCCTCACGATTCGCCCCAAAAACACATAACCAATTGTATTATTGAAAATAAATAGATACAACTCACCGATTTTCATCCCCAGCCTCCTGCCACAGCTTCCGCAAATAAATTCATAAACATACGATAACCATCTTGCGGTGATAATTATCTGGCGTGTTGACATAAATACTGGCCACCCTTGACATCACTAAGGACGCACTGACACCATGAAGGTGACGCTCTTAAATTAAGCCCTGAAGAAGGACGCATTCAAAGCAGAAGGCTTGGGGTGTGATACGAAACGAAGCATTGGCCTGTACGTGCGATTCTAATCGTTGCCAATGCCAATCGGGGGTTTTCGGTTCAGGACTACAACTGCCACACCACCAACGACTGACAGGAGATCCAGATGGATGCAGACACGCCGGAGGAACGTCCCCGCGCAGAGAAACAGGAGAGCATGGAAAGCAGCAAATCCCGTGGCTGAGCGGGATCGCCACACCTCACTTCTCTCGGCGAATCGCAAACCGAAATCACGAGTGACGAAAGCGCACTAATCGATAGACCTTACAGGTCGGCTGAATACCAAACAGATTGAAAGGACCTGCAACGCTTGATGAGCGCAAGGAACCAGGCACATGGTAAGCAAGCTGGCGAACGGGCATAACATGCAGTGGACGGAAAATTAAGGAAATCATTCCTCTTATCTTTACTTAGATATCTTAGGTCGCTTTATCTCAATATTATATGGATAGCTGGCAACTAATTCAGTCATTATTAAACACCAAGCAGACGCCGCAATATCACTA	*	tp:A:P	cm:i:68	s1:i:596	s2:i:0	NM:i:2322	ms:i:1656	AS:i:1673	nn:i:0
+73	4	*	0	0	*	*	0	0	TAGGTCGCTGAGTGCGATCCCGTTCAAGGCAATAGAATTTACGTTTTCGTCTCGTTCTAACTCCGAGCTCGGCGCACCGTGCCAGAGCACATCCTCAACGAACGTGCCGGACTTGTAGAACGTCAGCGTGGTGCTGTCTGGTCAGCAAGGCATCGCAAGAATTATCGGACGGCAGCACCCGTCGGTGTACTAAGCACGCAACCAGCTTACGGCTGGAGGTGTCCAGCATCAGCGTATATTGCAGGCGCTTTCACTGAAGCGCCGTACCGCCGTAGGGTCAGGGTTTGCGTAAATGATGGTAAAGCGGTACTGTTAAATGCGACGGTACCTATCGGTTTGGTTTGCTCGTCGCCTCGTAAATTACTCATGGATGTTCGGCGGATCGTCTCCCAACCCTATTGGATTATAATGCGAGCGGTTAAAGTTAGGCCCGGGTGAGGCTCCCTACAGTCGAGCGCGTACTGCGCTAGGTTGGCACTCTGTGGTACTGCGGCCGATCCGGCTCGTTGCCCCGGTCGGCCGGGGTTCGTAAGAGCACGCGCGTCAAGGTTTCGTGAAGTTATGTGCTCCTCCGCGTTGGGATCCCCATAATCCGGCTGTTCTGCCGCGGCCAATGCATGACGTATCCACGTTCGTCGACTCAGGTCCTAGATGATTTCCTAACCCGTCAGCCTGGCGCCGTCAACATGACGTCAACATGCAGTAGCAAGTCGGGGCCAAACCATTGTCGTACTTGCCGTGACTTTGGTCATGTCGCCTAACGGTCGAGACGCGTTAGGGTTGCGGCAATTAGCATCGCATGGCTTGGTCGCATCAATTAGTTTAACAGGGTTAAACAGCCGTTAGACTCAATGACTAGCCCTGACATGTACTATGCGACTATAATGGTACAGCACGGGTCGATGTAAGAGACAGCCTACGGCCGTATATTATTAAGACGGGTTTGACTGCGCGACCGGACTGAGATTGCGTCTGAGTAAAGGCTGGCGACTTTACGAGCCTTTGATCTAGAAGATCTAATCACCGATTGCTAATCGACATTAACGGTGCACGGTCCACTGCAGCGTACTTTCAGCGTTTCTCCACGCAACGACGGTAATTAGTGCCTGGCCGCATCGACTCCGATGGAGCTTCTAATGAAGCGGTCCGTACAGGCCGGGGAGCGCGGGGTAAGCATGGAGGCGGTAACCTTGACGACGTGAAGTTCATGTCGTTGGCTAGCGCCCTGGCTTTTATTCCTAGGTGGAAATGGTCGAAACCGAAGTTAAAATCCACCCGCCGACGCTATCGCTAGATGAGATTCAAAGCCCGGCCGACGGAATGCATTTCTATGAATGAGTACAACCCAGCCTGTTGCAACGGGCAGATAAATGCCGTTTGACGCTGTTGAATGACCCCAGATCGACGAATGCACGCGTCCAATGACCAAGCCCGTTAAGACGAACGGCGAAGGCAACGGAGAGGTCCGACGACGTTCAAATGATAACTCTGAATGAAACGGTCTGTCCTTCATCGACTCCAAACGGGTCACGGCGTCACGGAATGAAAACGTGAAGTCCAACGGAACTGTCACGACGGACGAAAGAATGACGCTTCCATGAATCCCGACGCTCATCCAAGCTGAAGCAGGAACGCTAAGCTACTGATTCAGGCATCAACGGACCATTACATACAAATCGAAATGAAAACTGCAATGCCGAAGCAAACGGTGGACTGATTCACTGTTGAATTGTCGCGGCAACGCACTTCAGGTGCGTGAGAGCGCGGCGGGCGGTCCAACATGCGCTAGGACCGTTCACGACCTTATGAAGGTTTAGTAACGTCTGTTCTCCCGTTTGCACGGCGTTTGGGTTAGACCATTTAAGCACGTCTATCGGCTCGCCTTTGACGGTTCTGTTCGCTATAAATCTAAACTAAGAGCCGACTATCCAGTCGCGTCCCTAGAAGGCACTGCGACCCTTCATGAAGCCAGGCCATTTTGAGCCTCGTCTCTAGAGACCGGCAACGCGTAAACATTTTAGTAGCGAGCCAGCACGCGGCCTTATGATATGAACATGACGCTGCATAGAATTTTCGACATAAGCCCGCAAGCTCGTTCTAGACCCGTTTCGGGTTGGGATCGGATGGGCTATCGGTTTCACGGGGAAGACTAGCCTGGAGGCCCATGGATGCGGGGTATACCCGCAAGCGACTTAACTGGTAGCGCACGGACGAGCGTCAGTTCGGTTAGTCGTTCGGGCTGCATGCGTCCCCATGAGTAAGGTCGGTGACTTTATTAAGCCCGAGCGCGAACTATCGGACATGCGGCGTAATGGAGCGATTCGCGGTCGGGCTCGATTCATTTCAGTCTGACATGACTTTCTGACCTAGAACCGTACATCGCTTATCGATATGCGCTCGATAATGAGCAACTCATCAAAGTTAAAATGGATATGCACGTAAATTTCGTCGTGAAAGATCCGTGCGATACCGTTAGGACATCTGTAAACAGGTATCGACTACCCCATTTGAACACGATCTGCCCGTTAGCCTATTCTCGACCTTGAGGCTGGAGGCACACCGCCCGACTCCAGGACGTGAAATCTGTCATTTCTAGATGCGATGGAGACGAGGATGACGCGTCAAGTAGTGCTATCCAAGACAGCACGTCGGTCCGTATCAAAAGAGCCTGAAGTTCGGACGGTTCTAGGTCTTTCGCCGGGTCCTGATTAAAGTTCGAACGCTGACATGCGTATGTGTCCCCAGCTAAAGCAGGCTGATCTGAAAGCCTACTGGATAGGGTTTAACGCGTCAGCGTGAACTCGACTATTTGTTACGAAATCACGTAAACTTGCTTTCAATAGACCTTTAATTGAAGGCGTCTCCGAGTGGTTTCCGTAAAGATACCCGACGAAGCAGGATTCCAGGAATAGACGGCGAGAAGCAGGAAGAGGGAACAGGAAGCCTAACGCATAGATATTAATCGAGCTGGCGTTGGCGGCACTCCCCGTCCTGTGCAGTGCAAGTGC	*
+74	0	utg000001l	21787	60	87S9M1D19M2D4M1I2M1D1M1D5M1I13M1I7M8D3M2D10M4I1M1I18M1I1M1I8M1I4M1I12M3D5M2I10M1I12M1D8M2D8M2D4M3D2M2D5M1I5M4D4M1I15M1D13M5D2M1D7M1I1M1I2M3I3M1D10M2I14M1D2M1I30M3I1M3I9M1I2M2I5M1D10M1D4M2D5M2I3M1D2M1D3M2I20M2D1M2D3M1D1M1D2M3D6M2I13M2I7M1I4M1I3M1I9M1I1M1I7M1D4M1I6M2I6M4D2M1D5M1I3M3I2M2I1M1D16M3D4M1I7M1I3M1I7M1I4M1I6M2D4M1D6M1D1M2D17M2I11M1I6M1I7M2D3M1I5M1I10M24D12M1I15M1I10M2I3M2I9M1I9M3D3M2D7M1D4M2I8M1I2M1I5M2I7M2D4M4I2M1I3M1I6M5I4M2I4M1D37M1D4M3D14M1I7M1D12M1I1M1I12M1D7M1I7M2I10M2I20M3D4M2D11M2D39M1D14M3D5M1I7M1D2M1D8M2D6M1D11M1D33M3D6M1I20M1I4M2D3M1I9M4I2M3I5M3I1M2I5M1I6M1I3M2D22M2I2M1I1M1I11M1D6M1D3M1I3M1I5M3I7M1I9M1D20M3I10M3I6M4I7M2I7M1I12M1I7M2D3M1I2M2D2M4D11M1I4M3I4M1I9M2I19M1D5M5I3M2D3M1I4M8I6M1I6M4D1M2D5M3I8M1I11M4I12M2I5M2I2M1I1M2I28M2D4M2I17M1I25M1D5M1I5M2D3M2I5M1D3M1D24M2I11M2I4M1I3M1D5M1D8M2I1M1D5M4D6M2D2M3D3M4D5M2I17M1D14M2D16M2D17M1I1M1I4M1I5M3I4M1I3M2D9M7D14M1D3M2D5M1I6M1D9M4D10M3I6M1I9M4I2M2I3M5D7M2I7M9I3M1I3M1D10M2I1M1I6M1D2M2D13M2I1M1D22M1D4M2D1M1D8M2D4M4D2M1D6M2I6M1D5M1D23M1D25M1D1M4D9M1I2M1I7M1I6M1D6M1I2M1I8M3D6M1D2M1D4M2I9M2D2M1I5M1D5M3I8M1I4M4D6M1D6M2D4M1I7M3D36M2I5M2D5M2D1M1D6M1D26M2I8M1I6M2D2M1D8M1I2M1D1M2I13M2D6M2D8M1D5M3I5M1D1M1D3M1D9M2D5M3D6M1D3M1D25M2I4M2I9M3D5M6D8M2I15M1D6M1D13M1D11M2I1M3I9M1I5M1I25M2D18M1I1M3D2M1D2M1I10M2D6M2I8M4I9M1D8M1D22M2I44M3I2M1I7M5I1M2I35M4D3M2D2M1D7M1D1M2D1M1I4M1I9M1I7M2D2M1I13M1D1M2D14M1D5M1D19M4I7M1I1M1I5M1I12M3I27M1I9M1I3M1D11M5I9M2I1M2I4M2D1M2D13M4I1M1I6M1D13M2D8M1I2M3I2M1D2M7D7M3D5M6D17M2I2M1D3M1I6M1D5M2D14M3D8M1D17M2D11M1I4M4I1M2I5M1I5M3I13M3D6M1D6M4D9M2I3M2I1M1D4M1D6M2I20M1D17M1I2M1D1M1D21M1I8M1I1M1I12M2D4M1D5M1D11M1D3M1D11M1D3M2D16M4D2M1I17M3I2M1D6M1I3M1D11M2D4M1I10M1I9M1I13M3I2M2I13M2I3M2I1M1I2M3I4M1D8M1I11M1D15M3I7M4D6M2D2M2D2M3D3M4D5M1D8M3D9M1D9M1D13M2D3M1D6M1I2M1D4M1I14M1I4M1I7M5D5M3D1M2D2M2D10M2I4M2I6M3D6M3I3M2D19M1I21M1I4M1I16M2I4M1I33M1I8M1I8M1I1M2I6M1D5M2I2M2I1M1I3M1I4M1D3M1D2M1D3M4D7M2I4M3D2M1I5M1I11M5D3M4I4M3D5M1I5M2I7M1D7M3D3M1D5M1D8M2I9M1I25M1I14M2I1M3I12M1D10M3D10M1D8M1I7M2I1M1I6M4I3M1D1M1D9M1I3M2D9M2D1M1D7M5I2M1I12M1I5M2D15M4I4M2I3M2I10M1D4M2D5M2I5M1I1M1I3M1I4M1I6M1I2M1I41M1D3M1I4M1D7M1I1M1I1M1I3M4I4M1I4M2D6M4D4M5I13M1D7M1D3M1I5M2D2M1D8M1I3M1D8M2D1M5D18M2D10M1I2M1D7M1D2M1I4M1D1M1D3M3I4M3D4M1I5M1D4M3D2M1I25M1D15M2D7M1D10M1I22M1I8M1D3M2D2M1D1M1D12M1D10M2I9M2D17M1I1M5D5M4D7M4I7M2D4M1D7M3I5M1I1M3D4M1I2M1D5M1D1M1D2M1D14M1D4M1I5M1D7M2D6M1I13M1I4M2D9M2I10M9I9M5I4M1D5M1I2M5D11M1I2M1D13M1D2M1I5M1D11M1I11M2D2M1I3M2D18M4I1M1D20M3D9M3I9M2D19M1D5M1I2M1I24M3I11M1D5M1D25M1I13M1D7M3D6M1I5M1I9M2D6M2D4M1I6M3D7M1I5M3D2M1D6M2I10M2I16M3I2M2I2M1D3M2I12M1I1M2I34M2D5M1I5M2I5M5I17M1I1M2I4M1I8M4I7M1I3M2I8M1I1M3I14M1I8M2I1M3I5M3I7M4D22M2I21M1I16M1I14M1I9M3D5M3I3M3I6M1D8M1I3M2I2M1I3M2I1M2I2M1D8M2D2M1D9M2D7M1I9M1D16M2D3M6D2M1D16M1D3M1D7M1I2M2I2M1D3M4D7M1D2M6D1M1D26M4I13M2I6M1D4M2I13M4I15M1D1M2D9M2D15M2I11M1I9M4I14M1D14M3I4M1D16M2D6M2I14M6D4M5D18M2I3M4I13M2D4M1I6M1D13M4I4M3D4M3D1M5D5M2D14M1I3M2D3M1D10M1I2M1I4M3I20M1D24M1I6M3D5M2I3M5I7M3D7M1D17M5D12M2D36M1D1M2D14M3D11M1D13M1I4M1I4M1I3M7I2M1D15M13D2M7D6M1D2M3D3M2I7M1D2M2I6M1D9M9D16M1D3M2I7M3D13M1I2M3D16M2I1M1D3M2I15M1I4M2I7M1D1M2D28M1D2M1D15M1D5M2D2M2I2M1D8M2I6M1I10M1D3M1D49M1D1M1D2M3D10M1I6M1D15M4I5M1D4M1I4M6D5M1I6M2D9M1D3M2I4M1D2M5D10M2I5M3I2M1D6M4D2M4D7M1D11M1D21M2D2M1I9M3D6M1I4M1I7M1I7M3D10M1I2M2I1M1D3M1D9M3D15M3I18M2I7M1I22M1I3M1D17M1D4M1D6M3I8M1D4M2D1M1D3M1I1M2D16M1D11M1D3M1D7M1I10M1D2M2I5M2I11M1I7M2I3M3D2M2I6M2D4M1D2M1D3M1I16M1I5M1I13M2I6M1D4M2D24M1I14M1I3M2D8M3D5M1I7M1D10M1I11M2I1M1D15M2D9M1D2M1D10M2I2M1I12M3D20M2D10M1D14M2I7M5D19M1D12M1D11M3D2M1I8M3D3M1I3M2I19M2D3M3I13M3D7M2D5M1D3M1I2M4I5M1D2M1D3M1I6M2D5M1D7M2D4M5D5M5D8M2D2M5D2M3D7M2I7M3I2M1D14M1D7M1I8M4I18M1I5M2I9M1I1M1I1M2I22M2D4M1D3M1D4M2I4M5D7M2I3M1D2M3I36M1D3M4I15M1I2M2D3M1D11M1D8M1D8M2I1M1D16M3I16M634S	*	0	0	GATTGCGGCCTCCGTCTCTTGATATCTCGTCTCTCACTCTATCTCAACCGCCTCGGAGGTTTCCAATCCCGAATGATTGCAGTCAAGCCAGAAGACCTGAATATTTTCTCTGAAAATAACTAATTATCGGAGTCACGAATCCGGAAACGGGGAGAGTGTTTCACGCCGCTTCGTTGCTTGGATTTGACTGCTTTTACTCCCTCTCTAAAGGACCTGACTCATCAAAGGTACACGTACCTTTTTATTGGACCGCAACTGCTGCCGGCAGGTAAAGGGTCCCTATCCTCCGCCCCGAATGCCCTGCCCGATTTAGTTTCGCGGTCGTATGTTACAGTAAAGGACCGCGCTCTGGCTTGAACTCGTAAAAACGCGGCACTTATGAGGTGTTCGACTGACCTTAGAATACATCGGACTTCACCCCATTTCTCCGTATACTCCATGCGATTCCGAAGAAGCAGTACTCCAACTAACGTATTTGACTCGAACTGTTTATGACTAAATCGGAGGAAAGTATATCCTTCGAACTCGGCCTCTGGACGATGCAAGCGTGTTTTATTTACGTAGCCAATGCTGTAGATGTCGTTGGCGGACATTGATGTTATCGTTATTCGACTGAACCCAGAGATTCTCTGCAATCGCCTTTGCTCTCTGCCTTTTGACGAACACTTAAGCGGACTGTACTCGATGCACCGAACTGGTGCCCCGACTAATTCTGCAATCCATTCCCCGAGTCGACCTGCACAATGGAGATTCCACAAATCCTGCTGGAAGCGGAATGGAAGGAGATAATGCGTTAACGACTTGAGACACGTTACGTATGGATATTAGACATCGTTTCCTTCTCGTGAGGTTTTTACTTGAAGTGACAAATTCTGGATACACCACTTATTATCGCAGTCCCGTTGATCCAGCTTTCTTGACCGAAACCCTTCTAAAATTATAATGGTCATGATAGGATTAGCGAAGGTCGAACCGTTTTAAAGCGATGATAATGAACAGAGATGAAGGTAAAGTACAATGAAAAACTTACCTTCGATGAGAACCGTAGCGAATGCTTAATAAATGCTCGCAGACCGATGGGAAGAAGGTTAGAAATAATTTCATTACTCACTTCCCCATTTTTAAGAAAGAACAACAATATAGAATATTAGACCTCCATGCGTTGATTTGACATAAGGACACTTACGGCCCCTCTATGCTGATAATTTGGTAGTACTGACGGTTAAATTTGACGAAAAGCTTTGAATAATCTCGAGATAAACAAACCCGGCGACGATAGATCAAACCTGCTGTTTCATCAGGTAGAAAATGTCATTTTGTGGTATATAAAGACAAAAGATAGATCTATTTTCTTCCTACTTGCAGAAGCTCTAACGGTGATGCCTATTAATTTAGTTCCATCGTGCCTAGAACGCAATATGGGAGAAAGGTCAAGTTTTCGCAGTAGATGAGTAGCCAAGCGATTCCTTCCTAAAGACCCTTTTCTTAGAGCAATGGGTATGCAATTTCGTTTCCGGAACTCCGTAGTGGCTTTTTGGTGTTGAATGCCCGGCGAACGGGCAGCGAGACAAACACAGAGCTGTCATCATTTCAAGCTATTAAATATTGCTAACAGGTAGTTCATCCGAGCAGGAAGCACTTGAGTGAAGGAGCGAAGGGAACCTCTTTCGTAAAGTTATAAGGAATAGTTCAACCGCAACGTTCAGCAGCTACAGTCAGACGATTTATTGAAGCAATCTGAAACCTATTAGATTTGAATGACTTCTAATTATTGGAAAAGAGTCGTATCGCGTGAGCAAACGCGACTTCTTTCCGCATCGCCCGCGAATATGACGGCCGGCCAAATTGACGACGGTATGAGGGGTAGGCTGCTTTTACAAAGAAGGCGACTTTTGCCAAGTACAATCCTGTGCCGATTAGAGCATCATTGGCAACGGTGGCATCCAAGCGAAGGACGTTTGATTTAATGAGGCACATAGCAGTCCTAATAAATCAGTACAGAGCGTTCGATGTAGAGGTACAAATTCTATTTAAATATGTAAATCGGTAGGACTGGAAATCATTCAACAGTGGGGCAGGTCTGACGAGCCAGGCAGCACGTTCCTGCGGACGTGTCGGGCTCACCAGGTACATGATTGCGTGCCAAGGCCAAGCCCGGATTTAGATACGGATACATAACATATTAAAATTTCGTGACTAATTTATATGGTTCTGATAAGAATCATTGCAAAGATCAACAATTATTACGTGACAGTTAAGCAGTTAATTTATCTAGCCAAATATCAGCATCTAGCATGCAACTATCAAAATGGAGGATTAACGGAAAGAAGAAGCGGAAGGCAGGCTTGCATGTGACCGCCACTTTACGTACCTGAATTATTTCGCTTGAATTTGAATCAGATTCTAGCAAACCGCAACGGTTATTGGTCGCCTGACAAAACCAGATCTACAGTGACATTTGGTAACAATAATGTGATGTTATTGAAAATGAGAAAAGTAATCCATTACGGGTCTAGTCAAATGCGCAATACGATAGAAAAGCCGGCGATTTAGAAAGCGTATAGCGAGGCAAAGGCTACTGTGGTCGGTACATTACGAAGCTGACATTGAGTTTATTACAAATGAAATATGTTAACATTGGTAAAATTAGTCAGACTTGCACAAAAGAAATTACCTTCGGAGCGCAGAAGCCCGAATCGTTAAATCAGAAAGACGATGGCTTAGATAGATCTCCCGATCTCGTTACATTGCCTTATAGATCTATGGCAGAAGTGACTGCTGTAACTGTGGCTACAAATAAACACGCCAATCGCGGGTGAAGTACGGTGATTTCGCCAACATCATAATTCGACTCTTTATTTGATGAAGCCAGAGAATAACTTGATTAAATTAAAGATTACTCCATAATCAACGAGGTTGTGCTTTAACATGATACAATATGACAATAAATAATTCCTGAATATTAAAGGACGCGTTAAGATAGGAAGAGGAATGGAAGAAGTTAGTTGACTATCACGGCACTTGCAAACGACTTTAAAGGACGTGGCCCGATCGACCATTAATTTGATAACGATTCCATCCCGTACTTCCTTCCACTCCGGTGATTTGAAGATTATAAGCAGATAAATTTGGCGTTATGCAGCTGACAGCCAAATAACAAATGCCTATGGCTTCATTTGGATATCAGAGCTGAGCCGAACCCAAGCATCTACTCGATAAACCAATACATCAATGCCAATTAGATGAAGACTTCAGGTAATTGAACGATTCAACAGGAAGAAGGGATTTCATGGAAGCTTACAGAAACGAAGAAAAACCGACTTTACGAAATATCAACAGCACTCAAAACATGACGAAAAACCATATTTCATGCGTTCAGGTCTGCTTAAAGCAATTGGCGTGGTGATGTGGTAAACACTGAACAATTTGAGTCATAGAACTTCCATTATTCTCAGCCTCCGTATAAGACCATCCATCAGCTTACAATACCCAACGACCGGACGTTATTCATACAACGTTTGCGCATATACAAAACGATTACTCCATAACATGGGAGAAGCAGGAGTGTACGAGTTGATGTATCAACACGGTTCAGCACCGATACTTCTTCCGGCTTCCAGCAACGAGGTTTCTTCCTTCGTTCGGATTCCAGATCTGCAGCATCCTGAAGCACGCGCGAATATGCTCACTGGCTACCTGCATCAGGCTTTGTTTCTTCCGCCTCCTAAGTGCTAGAACGTTTTGCTACTTCCGTATCCTTCACCAGGCCAGTGCCGTTCCTTCTCTTCTGCTCCCGTGAGACCAGGTAAATTTTCCGGTAACGGGACTGAGTTCAGAAAGAGAAGCCGCCTGAAGCGCCACGTCATAGACGCGTTTACCCCGATGGTCTTCAACGAGATGCCGCCAATTACCGCCTCATCACTGTTGAACAGGCAAAGCCAGCCGAATATCTGGCGGTGCAAGTACGGTACTGTTGCAGCAGACCGGTATGAGGCGAATACTTGGTGAGTCGGTCAACAGACGGGTTCATTAGTTAAACGATTATAATTTTTATGTTAGCGTGGTTGTTCACTCATTCTGAATGCCATTATGCAACTCTAGCACAATAGTTAAATGCAATGTTTGACGCTGCTTCCTAGTTAACCGCAGCGTTACGCGAGGGACGAAGATCGAAACGGGACTATCACGGAGAATGTGAGAACGCCCCGATAATAACCGACTGCTCTGACGCGCATCGCACTGACTGTAGCATGTGGGACAAGCTCGAGCTAATCCTAGGCTGCGCTGACTGTGGTGCCCTGCGTCAGACATTTCAATAAGCACCATCTAGTGCTGTTCCTTTAACTTAGATAAACTTCCTGTAATGGTTGGTCCCACCTGACTCCATACCAGAACTGTTCATCCTTAAAGCCACTTGTGGCGACCCGCCAAACGGTTTGAGCCGACGGCCAGACTGTACGTAGCGGGCTACAGTCGCGGCGGCAGCCGGGACTGATGGAACTGCTGTTGTTCCTTTCGATCGTAGATAAATCCTTCTTTCGTCCCCAAATCCGTACCGGATGCACTGGCACTGTGGGTGCGACTTAGATTCCATCCTGTTCCTGAGACAATACATGGAATGAATGACCGGCTGTTCCCTTGATTGTCCCTCTACAGTAGTACCGAAGCACACCCATCCGATAGGGACAGCAAGTTTGAGGCTGATTTAGGTGACGCCTGCCTGCCCTGCATCAGGACGTAGCCAGACGGAACGATATCTGATGGCCACGGGATTAGCACCTTAGAAAGGCCGAATCGCAGGAGAAGGATGGCAGAACATCTGCAAAGGACGAATTTTTCAGAATATCCTGCCATCCTGAGTCAGTTCAGTCAAGGCTGGCGGCATCATTTTCGCGACTGACGATGGCTTCTTTTCCGTGAAACCGCCTGCCAGCGCCGTCATAGTCGCATTCTTCGGTTGTTTACCCCAAGCGCGTTAGTCACTGTGTTACAAATCTAGATCATTCCCGAGCTGCGGCCAGTTCATTCAGCGTATTCAGTGCGTCATGACGCCGTCGATAACATCTGTACTGCAATCGCGGCCAGTACAAAAGCGGTGTTCAACCCGGGAGCCGAGCTCCTTCCCCCTGAGCGCGGTTGGTGCTGTCTTTGGCGTTTCCGTTCCATTCAATTAAAGCGTCAGTGGGCTTTTCTGTTCGTTCTTCATCCATTACACTTAACCGCCTTTGGCCGTGCAGCATGCGTTTCCGGGTTGCCTGTTGGTCGGACTGAGCTGGCACTATCCCTTTCTCGTTTGTCCCGCATCCTCCAAGCGCGACATGAAGGCTATCGTGCACGTTTTGCCGAATTTGGACGTATTGCCGGGTGCCAATTTTGCTCTGCGATGCTGATACCTGCAGACTCCGAGAAGCGCTGCCTTCGTGGATGCCGTTGACGCACTCCCGCCCTAGTTTTGCGTTATTGCCCGGCAGAGGAGGGCGTTTCTCATGCTGCTGTTTCAGATATGGCATTCGTCTGGACGTTTTTGCCGCCCTGGCAGAATTTTCTGCCGCCGTCCGTTGCCGAGGAAGCTGCACGACCGGCGATAATGTGATGCGTTCGTTTCTCTCCTTCCTTACGTCTCATCGACGCATCTCGTGCTGAAGTGGCGGCCTCGTGAATCAAATTTCGTGGCCGTGAGGAGGCGGCAGACGTGGTTACCGGCTGTTAGAAGCTCCAATTCTGACGTGTTTCACGGCACTGGCCGCCGCGTTTGAGAGACTCTGCGGCTGCTAGATTTTCCGCTTCAGTGAGCTTTGCTGATGCCGCTTCGGCCGGGAGGACTTCCTGAGCTGACGATGCAGCCTGTCCGGCGACGTGCTGAAGGCGTGCTGAGTCAGTTGCATCAGTCACAAGGGCCGCATGAGCAGCTGATGCACTGGCATCGCCGGCTGATTTCTTGCTCGATGTGCCCGCTCCTTCTATCTTTGCCACCACGGCAGGAAATAGAAGCCACTACGCGCCTACCTCCATCGGGCATACTGTCATGGCACAGAGAAGTATCGGTCCGTCCCGGTTGAGCAATCTTCATACACGGTGAACTGTCAGGCGTGCGATGGTGGGAATGATTAGCATTCATGCAGGAGGACACTGTACTGACCGTACTCAATGGATGCTCTGACGCCGGCTTGCTTACTCAGATTCTCTGAGCCCACCGTGTTAGCCCACCGTGGTGCTGTTACGTCTGGCTTTCAGCTGAATGGTGCAGTTTGATCCATTTCCTGTGCCGTCTTTCAGGACTCCTGAAAGGCGGCGATCTCCGAGATCCCACTCACGCCCCGTTAGATCGGGCCTCTATGTTACCAACCTATAATCGTGAGATTTATGAACCGATGGATCCGTTAATCGCCAGTCGCCACTGCCGCCGGCTGTTCATACGTAACCAGTAACGGAAGGACGGCTGCCGTACGTGGTACGCTTAGACTCCACGCTACGCTCTGCCGCATTGCATTAATTTCGTCCCTGAGTGAATGGTCGTCTCTTTCATACCCGGGAGTGATTTCCGTTGTACGGTACGTGATTGATTGCGTAACATAAGCGACTGCTCACTCGAGAAGCCCAATGAAGTGACTGCTTACTGATTGTAAACCGCTTTGATGAACCTAACGACGTATGCACGCAGGCGTCTCATAGTGAAATGGCCCGCTTCTCTCCTGTTGCTGCTCTTTTCAACGGCGGCGAACCCCAGGGAAGCTCCATCACCCCACTGTCCGTCAGCTCATAACGGTACTTCACGTTAATCCCTTTCACGACTCACGGTATTCCCCGCCGACAACGACGGCAATGTTCCCAAGTTCGATTGAAAATAGCGCGTAATCTAAAAGCCAGTTTACGTCGCACGGGCCGGGACTGTTGACGGAAATAGGGAAGACAGGACGCAATACAAGTCGCCAGCATCGTTCACTGTTTATAATAAACGCCATTCCCGGACGAACCTGTAACACTCAAGCCTGACCTGCCCGACGCCTGTTCTTAATCACCGACAATCCGCTCTCCACCGCCTCTCCCAACGGTACTCCCCGTGACGATCCGTTGGACGTAAGCACTCCGTGATCTAATGTCAAACCGTTTAGCGAACATGGCGGTTCGCTCGCTCTGGCCGGCGACTACTAAATGTACCGCATGAGAAGTTCATCAGTACTTTTCAGATAACACATCGAATACAGACTTTACCTGCCGCTGACAGTACGGTGATTCAGAATCCCGTCGACGGAAGGCATAAGGTCTGGCGATCAAAGGATGGTCGTAACTGACAGTTACGTAACGCCGTCCGACCTGACGGTCCACATGCTTTGACGCTGGCGCTGAAAGACGCCTGTAGCCGCCTTTACAATGTCTGAGCGACGATTTTCTCGCCCTTCGCTTCTGCGTACAGTTTTCAGCTATGATTGGTCTAGTGCTCGTCTCAGAGTTCGCATTCGGCAGGAGAAGCTTTTGACTAGGTCAGCTTTCCGTTCAGTCAGGAAAGGCCGGCGATTGCCGCCGCTGGTAATGGTGGGGCTTCACAGCTTCAGGAACAGTCGTTCATGAATATGTGCCATCCCGCTCAAACACTCGGCGTTTCATTCCCGTTGCCGGGTCATAATAAATCCATCTAATGCGGCAACCAGAACTGGCTCAGTTTGCCTTCCTCCGTGTCCTCCATGCTGAGGCCAATACCGCGACATAATGTTTGCCGTAGGCCGGGGCAACCGAAAGAACTGGCATTCCTATCTCCCTGGCATCCTTCGATATTCCGACCCTCCAGTCCTGGCGTTATCCTCCGTCAGCTCGACTTTTTCACAGCAATATTCCCCAGCTCCGATTCACGGTTATCTGCCTTTGAAAATCCAGGTGACTTCCGCATCCATCGCATGATCAAATTGAATGGCCTCCACGAATGCGATTTGCCAACGGTGTTCACTGCGGATAAAATAATAAGCCTTGATAGGTCCACCGGGGCTCCCGTTACATCTGGTCAACCTGGCGGCTATCCAAGTCGGGGTCC	*	tp:A:P	cm:i:46	s1:i:422	s2:i:0	NM:i:2578	ms:i:1054	AS:i:758	nn:i:0
+75	16	utg000001l	25869	60	51S6M1I17M1I19M1I14M1D3M1I30M3I1M2I3M3I3M2I3M2D4M3D12M1D13M1D12M2I10M2I6M1D3M1D10M1D6M2I1M1I14M1I12M2I7M1I13M2I22M1I21M5D4M2D3M1D14M1D10M1D5M2D8M3D20M1I10M1D18M1D16M1I2M1I3M2I6M1D7M1I2M1D5M2D15M1I17M2D9M2I26M2I4M2I9M1D4M3I10M1I20M3I11M3I2M1I1M1I5M3D4M1I9M1I3M3D6M4I22M3D9M3I17M2I20M2D2M4I2M6I4M1I2M1I21M2I3M1D35M3I33M1I13M1I2M2D10M3D6M1D3M2D5M2D1M1I4M2I3M2I8M2I13M1I1M5I4M3I5M2I12M1I5M5I2M1I1M1I19M2I10M1D9M2I4M2D21M1I20M7I6M1I1M1I12M2D5M1D2M1D12M3I1M1D4M1I32M2D6M1I14M3I3M2I22M3D6M6I3M2I14M1I4M4I4M1I1M1I3M1D1M1D10M2D17M1I38M1I4M1D13M1D3M1D14M8D9M1D33M8I7M2D19M1I6M1I28M2D9M1D6M2I11M2I10M1I7M2D4M1I1M1I8M1I8M1I9M1I5M1D6M1D3M1D7M1I9M2I2M2D5M2D4M3D4M1D8M1D25M4D2M1D17M1I12M1I10M1D14M5I12M1I8M3I4M1I5M1I9M2I9M2I18M1I2M1I6M1I3M1I6M5I1M2I2M1I6M3D7M1D17M5D11M1D8M1I18M3D2M1D24M3D25M2I20M3D21M1D6M2D1M1I40M2D3M3D23M1D25M1D21M1D5M5I13M5I4M10I13M1D9M3D1M1D29M4D11M2I6M1I9M2D7M1D48M1D3M1D10M1I5M2D23M1I5M1D15M1D5M1I5M1D3M1I12M3I47M1D3M1D21M1I3M2D3M1I50M2I6M1D17M2I16M2I7M2I3M2D15M1I4M1I5M1I5M1I4M1D5M3D26M2D9M1D1M1D5M2I26M1I4M2I10M4I2M1I3M3I1M1I7M2I21M2I17M1I2M1D13M1I3M1I4M2I16M3I39M2I3M1I25M2D15M1I1M1I7M1D8M1D4M5I30M1I1M1I12M1D5M2D2M1I4M1I9M1D2M2I19M1I8M1I1M2I10M9I1M1I9M2I15M1I5M1D3M1D8M1D6M3I3M2I4M1I4M1D8M4D5M1I5M1I8M1I12M1I10M2I10M1I4M2D18M2I14M1D4M3I4M1I16M4D10M1I1M1I2M1I29M1D8M3I10M1D21M1D17M1I6M1D17M2D7M1I10M2D19M1I7M1I8M1I17M2I2M2I8M1I3M3D7M3I7M1I8M1I6M1I23M1D21M3I3M2D5M3I10M1D3M4D23M1I15M1D5M1D9M2D20M1I10M1I7M1I6M2I4M1D4M6D2M4D7M1I5M3I6M1I8M3D10M3D13M1I10M2D8M1I2M1D11M4D16M1D6M1I20M3D1M2D4M1D23M1D3M3D2M2I3M1I1M1I7M1D5M1I21M1I8M1D22M3D17M2D14M2D6M1D10M1D14M3I8M1D42M2I2M4I1M1D5M1I7M3D3M2I6M2I3M3I21M2D2M1I4M1D5M1D3M3I16M1D15M3I2M1I3M1I2M5I18M2I12M3I28M3D45M1D13M1I2M1D1M1D13M4I16M1D52M1D1M1D11M1D10M4D9M2D3M1D6M7I18M1I3M1I11M1I4M2I6M2D13M4D6M1D3M1D5M1I2M1I9M1I8M1D4M1I5M1D7M4D5M1I3M1D18M2I23M1I5M1D1M2I20M1I24M1I9M1D8M2I6M2D31M1I6M1D4M1D27M1D6M1D11M1D2M1D1M1D11M1I5M2I6M1I6M3I2M1I2M1I5M1D5M1I6M3I2M3I3M1D2M1D9M3D21M1D6M1I9M1I11M1I12M1D7M1D6M1I30M1I30M4I8M2I5M1I6M1I19M1I3M3D9M5I7M4I18M1I4M2D10M2D9M1I2M1D5M1I14M3D12M2D5M2I10M1D35M2D45M1I10M1I42M3I5M1I11M2D4M1D2M1D4M1D3M1D5M3D9M1I25M3D7M4D4M4D2M2D7M1I12M3I3M2D11M2D20M1D2M1D47M2D6M4I10M1D6M1I3M2I7M4I2M1D8M1I13M2I29M3I2M2I4M3I12M2I5M3D4M1D6M1D27M1I17M1I4M1D2M5D3M2I1M1D7M4I8M5I12M2I1M1D2M1I3M1I37M1I13M1I11M2I9M4D5M2D4M1I8M2I7M2D14M1I15M1D4M1D3M1I10M5I16M1I3M2D1M1I5M1D3M2I20M1I9M3I5M1I5M1I1M3D1M1D3M2I3M2D7M1D13M1I6M3I9M2D2M1D16M1D16M1D3M1D7M1D8M1I1M1I8M3D19M3D7M2D1M1D10M7D12M2D4M1D1M2D31M1D12M1D13M2I6M1D2M1D10M1I11M1I6M2I10M1I7M2I4M2D2M4D7M1D4M2I7M4I13M1D5M1I32M2I7M1D13M3D13M4D6M1I16M1I12M1I7M2D6M1I9M8I2M1I3M1I9M1I5M1I22M1D11M1I3M1D2M3D7M1D3M2I13M4I4M1I9M6D4M4I32M2I3M1I18M1I5M1I2M1I7M1D5M3I6M1D4M1D8M1I16M1D7M1I16M1D15M2D4M4I4M1I9M2I2M1D2M3I8M2D6M1D23M1I4M1I11M1I10M1D8M2I7M1D17M1I9M2D4M2I11M1I4M1I33M1I1M1I4M2I3M1I3M2D10M1D6M1D13M3I10M1I1M3D14M1I4M1I5M2I13M1I11M1D7M1D12M1I9M1D17M3D13M2D15M1D5M1D4M2I1M1D7M3D4M2I6M1I6M1I2M3I3M1D7M11I15M1I17M2D7M1D9M1D7M1I19M1I26M1D6M2D16M1I3M5I5M3D7M1I2M1I4M1I12M2I13M3I9M1D16M1I6M64S	*	0	0	TAAGGATATTATTTGACGGTGTTTTCCGCCGTCCCCGTAGAATTTAGGTGATGGTGTCCCGTGTGAACCAATACTCGAAAGAATGGGCATGAGCACCGATAACAACCGGATGCATGGTGCGCACCAATACCAACTTGTATGCGCTGGACCTGTGGCGCACCGGCACTCCACGAGCTGTACCGGACAATGAGTGACTGTGGCTGCCCTTGACTGTCCGTTTTCGATAAATAAGCAATACCTGTGTGCTGGTTCCTTTAACTGTGGATAGACTTTCCTATGTAATGAGTTGCTGTTCCATACACTGACTCCAGCCAGAACTGTTCCATCCTTAAACCACTTGTGGGGCACCGGTCCCTGTTGAACCGCTCAGACTGTGAGCATGAGCCCCGTTATTCGTCGATTTGGTGCTCGTAATCGAAACTGCCTGTTGTTTTCGTCCCGTAATCAAACGACGATGTGGGTTTTCGTGCCAAATGTAGATCGATGCACTGAGACTGTGGGTGTGCGACTTAATTCCATCCTGTTCCTGAGACAATACAGCACGACCGCTGGCGGGTTTCCCTTGATTGTTTGCCTGGGATATCAGGAAGCACACCCGATGGATACGCTTAGACAGCAAGTTTTGGTGAGGCTGATTTGTTAAAACGCCTTGCCCCTGCATCAGGGACGTAGCCAGACGGAACGATATCTGATGGCCACGGGATCGGCGCACCTGCCGGAAAGGCCGAATTCTCACCGGCCCCAAGGCCTCTTCAAGAAACATCTGCAACGGAATTTTTGCCAGAATATCCCTGCCAACCTGAGTCAGTTCAGTCATACTATTGGCGGCATCATTTTCCTAGCAAAATACGGTAATTTATTTTCGCCGTGGAAAGCCCTGCCAGCGTCAGTGTCGCCAATTCTTCGGGTTTGTTTACCGCAAGCGCGTTAGTACTGGTGGTGATAGCAAAATCTGGATCATTCCCGATGAGCCTGCGCTCGAGTTCATTCAGCGTATTCAGGGTGCGTCAGGAACGCGTCGATAACATGCAATCGCGGCCAGTAAAGCGGTGTTCGCCAATCTGGGGTATTGTTGTTCCCCTGAGCGGTTGGTGCTGTTGGCTTCCGGGTCAGTGCCGGACTGTCCAGTGGGCTTTGGTGTTCGTTTCATCCATTACTTAACCTTCTTTGGCGTTGCAGAGGCAAGGCGTTTCAGACGTGCTGTTGGTTGCACTGCTGAGCTGCACTATCCCCTTTCTCAGTTGTGTCCCCACTGTAATGCGACAGCTGAAGCTATCTGCTGCACGTTTTGCCGAATTTTGCATGTATTGCCGCCGCTTCTACTGCCGCATTTTGCTCTGCGATGCTGATACCGCACTTCCCGCAGCCTCTGTCGCCTTCGTGGATGCCGTTGACGCACTCCAGCCGCCGCCGCTTTCGATTGCCGCGGCAGAGGCATCCGTTCCGCTGCTGTTTCAGATGACCTGGCATTCATCGGGACGTTTTGCCGCCCTGGCAGAATTTTTCTGCTGCTAGTTGCCGGAATCAGCTGCACGAAGCGGCACTTGATGATGCGGTTCGTTCTGATGATTTGCTGCCTCTTTGAGGCCACCGCATCGTGCGCAAACCGGCCTCTGACGCTTTCGTGGCCGCGGTGGAGCAGACGTGGCGGCTGATTGTTGTGACGGTATGCAGCATTCGTTTCTGACGTTTTCTCGCCGCACCGGCACTGGGCCGCCGCGTTTGAGGACTCTTGCGGCTGCGAGGCACTTTTTGCGCCTTCAGTGGCCTTTGCCTGATGCCGCTTCTCTGCGCCGGAGGACGCTTTCCTGAGCTGACGATGCAGCCTGTCCGGCGACGTGCTGGCGCGTGTCCATGAGTCAGTTGCATCAGTAAGGCCGCGACCTGAGCAGCTGATGCACTGGCATCGCTTGGCTGATTTCTTTCCGCGTCTGCCGTACTCTGTGCCACGGACGCGTTACGCGCCACTCTTCACCATCAGTTCAAGACGACGCAGCACCTCCGGCCGGGCATCATCCTCGTCATGGCACAGAGAAAATCATTCAGCGTCCCGGTTGTGAATCTTCACATACACGCTGATGGTCCCGGCGTTTACGCGATGGTGGAAAACTTACACGTCGGTTCGGTCAGACCTGCAGGAAGCCCTGTACTCTCATCCACATCCATGCTGTAACGCCCGGCTTCATCCGGATTCTCTGAGCCCGCCCCGTACCACCACGTGGTGCTGTTACGTCTGGCTTTCAGCTGAATGGTGCAGTCTGTGTACGGTTTTCCTGTGCCGTCTTCAGGACTCCTGAAATCTTTACTGCCATATCTCGAGCCACAACGGCACCGGTTCCGGCGGGCTGTCATAACACTGTGTTACCTGGCTAATCAGAATTTATAACCGACCCCAACGATGAAATCGTAGTACGCCAGTCGCCACTGCCGCTCACCACTTCATAAGCAATATCAACAACGACGGACGCTGCCGGATTAATCTGTACCAGTGCACTCCACGCCACTGAGGTATGCGCCGCATTGCACTTTCGTGTCCCTGGCAGTGGTCGTCTCTTCATATACCGCGGAGTCCATTTCCGTCGATCGATCCATTGTACTGCCGGACCACCGACTGTGAGCCACTCCATGCGGCGTACGCACTGACCTGCTTACTGACTTTGGCCTCAGTCGATCAAAAGCCAGCCATCACGCTCAAGACGTCCACGCAGGCTCTCATAGTGAACGTATCCTCCCGGTCGTATCACTGTGCTGCGTCTCTTTCTTAACGCGGCAACCCCAGATAGGAAGCCATCACCCCCACACTGTCCGTCAGCTCATAACGGAGTACTTCACGTTAATCCCTTCAGATGACTCACCGGTATCCCCGCTACCGACAGAATGCAATGACCCGATGAGTTTCACTTGAAAATAGCCACCGTAAACGTCAGATATTTAAGGTCCGCACGCTCGGAGGTGACTGTCACCGGCAAGTGCGGCAAAGACAGCAACGGCAAGTACACACATTACGAACTCCTATCAATCGTTCACCTCTCACTGTTTATAATAAAACGCCGTCCCGGACGAACCTCTGGTAACACTAGGACCACGCTGATGCCAGCGCCTGTTTCTTAATATACCATAACCTGCCACATCGCTGGCAAACGTATACGGGCGGAATATCTGCCGAATGCCGTGTGGACGGTAAAGCGGTGAAACGTCAGGATCACGTTTCCCCGACCCGCTGGCATGTCAACAATACGGGAGAACACCTGTACCGCCTCGTCCGCCGCAACCATCATAAATACCGCACCGTTCATCAGTACTTCAGATAACATCGAATACGTTGTCTGCCGCTGACAGTACGCTTACTTCCTAGAAACGTGATGGAAGCACCACTATCTATGCGATCAAAAGGATGAGTCATCGGTCACGGTGAATCATTGAACAAACGTATACGGACGAGTTACACTGCCTTTCACGCCGTGGGCGCGGAAAAGCCGCGCTCGCCGCCTTACAATGTCCCGACGATTTTTCCCTGAGCGATCCGTTTATCGTACAGTTTTCAGCTATCGTCACATTACTGGGCCGTCCGGAGTTCCATTCACACTGCCACTGATATCCGCATTTAGCGATGCCTTCCAGTCCGGTGTCAGGGAAAAGCTCACGCGATTGCCGCTGGTAACCGGTGGGGGCCGTCAGGCGCTTCAGGAACACGTCGTTCATGAATATCTGGTTGCCTGTGCACAAACATCGGCGTTTCATTCCCGTTTGCCGTCAATAAAATGCGATACGATTGGCGGCGGCAAGAAACTGGCTGGTTGCCTTCCTCGTGTCCTCCATGCTGAGGCCAATACCCGCGACATAATGTTTGCCGTCCTTTGGTCTGCTCAATTTGACAGCCACATGGCATTCCATTATCACTGATCCTTCCACTGGTCGAAAATCCTCCAGTCGCTGCGCGTTATCCTCGTCATCAGCCGACTTTTCCAGCAGCTCCTGCCGAGATGGGATTCGGTTATCTATTAAAAGCTTTGAAAAATCCGGTTGACCTTCCACGCATTATCATCGCTCGCCCGACCGACCTCCCACGAATGCCGATTTGCCAACGGTGTTCACTGCGGATATAAAATATCTATAAATACAGAACCAGGCCCGGTTTGATATTGATATACTGGCGGCTATCCAGTACAGCGCCGTCACCAAGATAACGCGTGCTGGTTTCAACCTGTCTGATATCGCAATCTGCTTTTCTAAGAACGAACTCAAACTGTACCGTCGGGTCATAAACGGCGGCAAGATGCGGCGTGGCGGTTATCTGAAATAGCCCGGCGTCAGCTCAATCCTCGACGGTGCTGCCGGTGCGGCAATCCGGAACGATAAGACGCCGGATCGCCCTGCTTGACTACCCACGCATTTACTGCAGCCAACTGTCAGCCGGTGCGTTCCCCAGCGCCAGTTGCGTGAAGCGGTATGTGGTTTCCGTTAGTCCGGGCCGTGCTGACAGCTCGCTCTTGCCGTCGCTGTTACGGGTCAAACGGAGCAGGAGGAACTCACGCCCTTCACCACCTTCGGGTGTGTCCCATCGCGCCAGCACCTCATCTTCCGCTGTCTGCAGTGACTTCTGCCTTTCATCTATGCACCGCCCTGGCGGCGTGACACCATTCACCGTGCCACTCTGTTCTCCCGTCAAATCCGCCCCGTTATCACGATGGCCTCTTTCCGGGAATGCTGCACGGTGATGGCATACGTGCCGTCGACTGGTTCGTCACGGGGTACTCACGCAGCGGAACAGCTTCGCCTGGAGCCGCAGCGTCGGCAGCTTCAGCTCCCATACGCTGTATCAGGACACCGTCAGGAAACACGGCTCACTTTACCTTCACGCGTCGGTGACGGACTGAACCTCCACGCTGACCGGATTGCCACTTCCCCGTCAACCAGGCTTATCAGCCCCGTACCGGGAGGATGGCAGGCGTGATTTTCACGGTCGAGCGTCAGCGTCCGGAGTCTGGCTGTTCATTCACCGCCAGCACACGACTACCGGTGCTGATACCGGCAGTCATCATGGTGCAGATTGTCTTCAATAACATCGCCCGGTACATGGCGTACGCCCTTCTTGCCGACGCTGAAATCCACGGTCTGCGTTTCCAGCAGTTCTGTTTAATCAGCCACAGCCCGGCGCGGGCGTGCCTGCCCCGGCTGGTACAGCCCAAAGGCATCCATCTTCGTAACATTACGACGTAACGGGCAATGGCCTGCGTATCTTTCAACAGCTCTGTCGCCGTCTCCCAGCCGTGTTCGTATAATCCAGTTCACCTCAACGGCATTATGGCTTTCCTTCAGGGCGTCGAAGCCTTGACGAACGGCGCTAGCCATCATCCGGCAGCCACATTACTGCGGTTATAGTCACGTCTTATCCGACGGTCGGTCCTGCACGAACGTCAGCGTCTGCCCGTTCCATACCGGCATACAGCGCATCGCCGAGCAGAAATCCTATGCGAGCACATCCCACGCCTTACGCTGTGTGGTCAGGTACGCATTACAAGCTATACTTAGCCAGCTGGGCCTTGCCTCACAAAGCCGTCCGGCACTGACGGTCGCAGTACTGGCCGATGACATACAGCGCCCATTTATCCACATCCGCCGCACTGCATTCCCCACCGCTGCCGTAGCGCGCCGGATGGGATCAGCATATCCCGCAAGACACCAGGCCATGTTGTTGCTGTATGCCGGTTTAAACGTTCGTCCCAGATACCGCTGTATCTGCCGCGTCTGCGGTATAGGTTCCACGGTGCACCTGCAGAATACGCCCGCGGCAGATGATAATTACGAGGCCTATTTGCTGGCTGCCGAACGAACTCGGCCGAGTCCACCTGCACGCGACCAGTGCCGTGTTCGTAGCACTGTTTCACATCCCTGATGATTTCAGTGTATGACGACCAGAGCGTTTGTTCTGCAGCGTTATGGTCTGTGGTGGTACGGGGTCATCCTGCGCATCGGATATTAAAACGGGGCGGGATGCAGTACCCATCACCACCGAGCGATACTGCTCAGTGGTTTTGCCCTTAACTGATGTCTTCGTCAGAGCCACCGTTACGTTGTATCTGAACCAGCAGGCGAGACTTCCGACGGATTCCTGTCACCCTTTGAGGGCGGGTTTCACAGTGCCTGTACACCCGAAGGTAAAGCGCAGACGGTCGATGTTTTGCAGTAAACGCATCCGGGTGATCATGGCGTGTCCGCTATTTCACTTCCGAGTCACGCACCGTCTCGAGCCGGAGGATTCAAATCCCTGGCGGCGGAGTCTGCTCCTGCTCAGCCCGGAACACCGTGACGCGGATATGTTGGTATTCCCCTCGATGTCCTCAGTGATGGACGGCGTACTGTTCAGCAGCAACGCCTAGCGCTTTAAGCCAGGTAAGGACCTTCAATCGGCCCTTCGCTGATGGCATCGGATACGGACCCATGCAACTGCGACTTCAGGTATATTGTGCCCTGGTTCCGGGGATATGCCCTTACTGCTTCCTTTACCCATTCCTCACCGGTTACCATAAATGAACAAACCGCCCGCAGGCGGTTTCACATAAACATTTTGCAGAGCATGCATCACCACAACCTGACACCGTCCCTTCGTTATGCCGTGCTGATCTCTGAGAAACCACGCGTGACCCCACGCGCCGCATTCCCCGGTCATTCGAACAGGCAACATTGCCCGGGGCAACCATGTTATCCAGGTGAGGAGAAAGCGGTGTTCATGCTTACCGTTATCCGCGTTGTCTGTACGGGGAGTTCTGGCTTTCGATCTCAGCATATATGCGCCACACCGCTAGAGCACCATACTGGCACCGAGAGAAACAGGATGCTGCCGCTTCACTACCGGGCTCAATCCTGCCCCCATGCTGCAAGGGTGGCTCCGGCGTCAAAGAAGCATCCGGCATGATGGCTGCACCCCAGGACAATCTGGAATACGCCACCTGACTTGGCCTGAGGACTCTTGGGAACAATATGAATTACAGCGCCAGGCAGAGTCTCATGTAACTGCCCCATAACCCGACTGGTGCTGACGTCCCTGCACGGCAATCCATCACTATCCGTACCAGCCGTCGCTCAGTTTCTGACGAAACGCCGGGAGCTGTGGCCAGTGCCCGGATGGCTTCAGCCCGTTTTCTTCACGAAGGTCGATGCGGCGACCAAATCGTTGTAAATCCCCGTAAAGCAGATGCGCCATGCCCGGTGACCTCACCAGAGGGATGTGCGTCGCTGCCATTTGTCGGTGTACCTCTCTCGTTTGCTCCGGAGTTGTTCAGGAATATGGTGCAGCAGCTCGCCGTCGCCTTCAATCAATTGAATCAGCACTTGATTGCGTGATTCGTAACCATAACACCAAGCAGTT	*	tp:A:P	cm:i:136	s1:i:1351	s2:i:0	NM:i:1765	ms:i:4686	AS:i:4686	nn:i:0
+76	16	utg000001l	18718	60	34S7M1I7M2I6M1D6M2D1M1I9M1I3M1I2M1I14M1I12M5I3M2I3M1D22M3I2M1I12M1I4M1D10M1D3M1I6M1I28M1D4M3I3M1I4M2I6M5I14M6I1M1I15M1I9M6I35M5I2M1I2M1D5M1I6M1I2M1I3M3I8M4I14M1D5M1D15M1I13M3I18M1D7M2I7M1I8M1D6M1I5M1D2M2I8M1I3M2I3M1I8M7I35M1I3M3I11M2D5M1I9M4I11M4I1M1I12M1I6M1I4M2D7M2D8M3I4M1D5M1D24M2D41M1D5M2D5M5D5M5I11M1I3M1I7M4D3M1I2M2D7M2D4M1I4M2I17M3I5M7I3M1D4M1D5M1D14M1D2M4I2M1I3M2D4M2D5M1I8M2D2M3D2M1D5M2I2M2I6M1I5M3I33M2I19M1D2M1I2M1I5M1D14M1D16M3D4M1I8M2I12M1D3M1I2M1I6M1I23M4I15M1D4M2I5M2I22M1I3M2I1M3I7M2I13M2D17M3I2M3I5M2I3M4I1M1D17M1I1M2D10M2I6M3I6M1I4M1D5M1I2M1I6M3I3M1I9M1D5M1I13M5I7M1I2M2D5M5D9M1I2M1I12M1I5M1I3M1I4M2D15M1I5M1I7M2D2M3I9M1D6M2I4M7D8M4I3M1D5M1D1M1D22M1I5M1I6M1I16M3D4M1D3M2D9M1D14M2I11M2I6M1D16M1I4M2I2M1D1M2I4M3D7M2D12M1I1M1I7M1I2M1D4M1D5M4I8M1I5M1I3M1I4M1D4M1I3M1I12M4I11M1D4M1I4M1D4M1I5M1D8M1D11M1I5M2I3M1I3M2I10M2D6M1I9M1D7M2D12M1I14M1I4M1D6M1D5M1D23M1D15M1I9M4D4M1I12M3D11M6I1M2I19M3I1M2I7M2D15M2I13M1D2M1D7M1D19M1D3M1I2M2I2M1I7M2D6M1I6M5I5M3D6M5I9M2I4M2I3M2I7M1I3M5I2M1I1M2I3M1D15M1D2M2D3M3I9M7D3M3I6M2I5M1I4M1D9M2I12M4I17M2I29M3I11M3I2M1I13M1I9M2D6M2I5M3I13M1I4M1I2M3D11M1I5M1I2M1I32M3I15M1I21M1D25M2I1M1D8M1D15M4D11M1I10M2I1M1I5M1I5M1D2M2D19M2D23M1I22M1I23M2D12M1I10M2I1M1I20M3D6M2I2M3I2M3I6M1D8M1I19M2I28M4D15M1I14M2I15M1I1M2I40M2I3M1D5M1D11M6I10M1D7M1D19M1I2M2D33M1D20M2D6M1D21M1D15M1I5M1I5M1I30M3D19M2D21M1D45M2I6M1D9M2I20M2D5M1D22M1I2M1D7M1I12M8I3M3I7M2D5M2D1M1D4M1I1M2D1M3I15M1D3M2I5M1I5M3D5M1I13M2D16M2D11M2I7M1D13M1I30M3D5M1D3M3I4M2I12M1I6M1I6M2D20M3I31M1I9M3I31M2D17M1D11M1D7M1D5M1I37M1I18M4D8M1D19M1I7M3I9M3I16M2D22M3I10M1I3M3I11M1D3M2D5M1I1M1I6M3D20M1I1M1I2M1I13M1I8M1D17M1D13M1D3M2D37M2D6M1D11M1I7M7D14M2I1M1D5M4I7M1I21M1D3M2D32M24D26M1I8M1D15M1D3M2I4M2I2M2I8M5I5M1I9M5I2M2I6M2I19M2I1M4I9M1D4M1D6M1D4M1D17M3D14M1D9M1I4M1D17M1I9M1I3M1I4M1I13M1D2M1D4M2I5M3D5M1D13M4D13M3I16M2D12M1I5M1D4M1I16M1D2M1D4M2D6M2D3M2D5M2I4M1D17M1D18M5I6M2I13M2D15M2I3M1D6M4I1M8I12M1I6M2I6M1I4M1I2M2I1M1I10M1I10M2I7M1I10M13I3M7I1M2I7M2I9M1I8M1D6M1I9M2I1M4I6M1I10M5I1M1I6M2I8M2I26M1D17M1I4M3I5M1I9M1I5M1I7M2I8M3I11M1D4M9I6M2I4M5I7M1D3M1I4M1I5M1I3M2I1M3I3M1I8M1I10M2I4M6I10M1I1M1I19M1I9M2I10M2I18M1I11M3I4M1I3M6I1M1I12M1D2M1D3M1D17M1I2M3I2M1I4M1I9M2I8M1I3M2I6M5D2M1D8M2I1M2I2M1I4M2I7M2D2M1I4M1D7M2D5M1I16M1D34M5I4M1I18M3I1M2I3M1I1M2I6M1D12M3D1M1D3M1I9M1I3M2D2M1D3M1I5M8I6M3I5M7I33M2D2M2I7M2I1M1I3M1D3M1I10M2I2M1I5M1D3M1D9M1I5M2D15M7I7M1D4M4D2M2D4M2D7M1I2M3D7M1D6M1I4M1I9M1I7M3I2M1I9M1D23M1I2M2I12M5I7M1D3M1I3M1D6M5I11M1I7M3I3M1I4M4D10M3I11M4I4M4I6M1D10M2I10M1D4M1I17M2I3M2I1M1I6M1I19M2I5M2D5M2D8M3D2M2I14M1I4M1I1M2I8M1D3M1D1M2D5M1I1M2I7M1I10M3I3M1D8M1D6M6I1M1I14M1I10M1I2M1I1M1I12M2I15M1D6M3D3M2I3M1I2M2I7M3I5M3I31M1I24M1D4M1I16M4I3M1I3M2D6M4I4M1I18M2I6M1I22M2D14M1I10M1D8M7I3M1D5M1I30M2I3M1I6M1I6M3I8M2I5M1I7M1D1M1D6M3I2M1I7M9I24M1D28M2D15M2I58M1I8M1D14M1D13M1I4M1I24M2I18M1I5M4I17M1D4M1I11M4I1M1I30M1I1M2I3M2I2M1D5M1I14M1D6M3D4M3D2M2D10M3I2M2I1M3I3M2I4M1I11M1D7M1D4M2I4M2D19M3I6M2I9M2I12M1D3M1D12M7I3M1D4M2D15M2I3M2I2M2I4M1I10M3I48M1I9M1I4M1I8M2I4M2I9M2D10M1D11M1D12M2I2M1I10M3I12M1D12M1I11M2D3M3I7M1D27M1I9M1I3M2I9M2I2M6I18M2I2M2I4M1I7M1I4M3I3M1D1M1D6M3I6M7D3M1D12M1D21M1I2M1I8M1I1M1I29M1D7M1D1M1D15M1I7M1I18M1I11M2D17M5I19M3I3M2D10M1D6M1I3M1I20M2I4M1I9M1I9M1D6M5D1M1D6M2D5M1I2M1I6M1I5M9I4M2I7M1I7M1I9M1I3M1I14M2I2M2I11M4D2M1D5M1I6M4D11M3I4M1I7M1I12M1D2M2D16M3I2M1I6M2I6M1I3M1I21M1I1M1I3M1I8M1I22M2I10M1D26M8I1M1I5M1D3M1D11M1I3M2D4M1I7M3I2M2I15M1I10M1I3M2I6M1I3M1I11M3I3M4I6M1D3M2I13M4D10M1I10M1I9M1D6M2D1M1D8M4I6M3D6M2I20M3I20M1I7M2I17M1D13M3D9M1I6M1D12M2I2M1D3M2I4M1D9M1D3M1D12M1I4M1I5M5I1M2I6M1D3M1D7M1D7M4I3M1D13M1I5M2D6M3I16M6I3M1D8M2D5M1I1M11I3M1I1M2I2M1D5M2D4M2D8M2D8M1D3M2D2M1D8M1D4M5D2M1D3M2D6M2I5M1I18M1D3M1I5M3I13M1D4M1I5M2D15M1I5M1I14M409S	*	0	0	AAAGAACGTTGTGCAGATCCGGTCCTTCTTGTCATGCAAATCACGAAGGCTTTATGTGATGAATCATAGATATAGGTCGGCATACAAATATTCCATGAAGGTTTATAAGTCTAATCGAAGACAAATCCCCATTCTGCAATGTGCGGTAAGAAATGACTGATACCGTGCAAATTATTATCACGAGTACGGTGGAAACGATACTTGCCTCTGTACAAAAGAGGCCAGGCAGCAACAACCCAATATTACATAACAATCCTCAATACGCGGGGATTTATTTTATCTGAACTCGCTACAGCGCCGGTTTTGTTTATGGAGATGATAATGCGATTTCCGCCGAGTCACGGCATCCCAATGCGAGGCCGTGCTTCAACAGAGCTTATCGAAGCGGAGAACATCAACGACTGCTACGACCACTGGATGATATCTGGGCGCAGATAGCACATGCAGACGTAACCAATATTCCGATTAACGAACTGAAAGAACAGGATCCGCCTAGATGCGGCGTTTCTTGCTTTGCGTGTAATTGCGGAGACTTGCGATGTACTGACACTTCAGGAGTGATGGAACGCCCGACGAACTGGTCGTCCACGGAAGAAGCCTTGTTGAACAAGGTTCGTCGATGGGTTCGGGAATGCAGGATATTCCCACCTCCCGGTTACGGATGGAAGAGAGTAATCTGTTCCACGAATCAGCGTAAATAGTTTGACTTAAATCGACCAGTAACAGGTGCTTTGAAGAGGATCATGAAATGGGAAGGAATAGCGAAGGAGAAGGGGAATCGTACGCCGCGGCAGCGATCAAGAAACATGGATATTACTGCTCCACAGCCACGTGAAGGACGCGGGTAAAGAGTTTGGATTAGCAGAGACAGGCGAATCGCAATCACGGCAGCTACAGGCCAAACATTGATGAGTCTTTCAGGACACAACACCCTCTGACAGCGAGAATCAACAGTGATAATTCCGTTACGTTACATTCATGGCTTGATCGCTACGAAAATCCTGAGCACCAGGAATTAGAAGCAGGAGCACCTCGCTCAATTACTGAGCAAGGTGGACTAGTAAGGAGCGATGGCTGCCTGATGCTGATTGAAGACATAGACAAAAGAAATTGCGGCAATGCTCAATGGATACAGAGAAGGCGAGCAATTCAGCTACGGTTAATCAATCAACACTGAGAGCGGCGAGGTGATGCATTCGAGAGGCAATAGCTGAAGGCCATATAACAACAAACCATGTCGCTGCCACTCGCGCAGCAAATCAGAGGATAAGGAGATCACGACTTACGGCTGACGAATCTGAACTATGAGCAATTACAGCAGAATCATCACCATGTTGGCTCAGACTATGCAAATGGAACTGGCTGTTGTTACCGGGCAACGAGTTGGGCATTTATGCGAATGAACCGTCGCGCAGAGCGGGAGCGATAAGCGCTGAGCAAAGCAAACAGGCGTAAAATGCCCATCCAACAGCATTGCATATTGATGCTCTGGAATATCAATGAAGGAAACATTTAGATAAATGCAAGCGATTCTTGCGGAGAAACCATAATTGCCGGATCGTTCTTCAGCCCCAGAACCGCTTTCATCCGGCACAGTATCAAGGGTCTTTATGCGCACGAAAAGCGCAGAGCTTTTCCTTCGAAGGGGATCCGCCTACTTTTCACGCTTGGATGTTTGTTGCACAGACTGGTGAGAAGCAGATACACCGATAAGTTTGCTCAACGCTCTTCTCGGATGAGTGCCAATCGCCTGGCAGCCAGCTTGGTGATGACAGGAGGCAGGAGTGGGACAAATTGAAATCAAACTGATTTATTTGACTGATATGACCTGTTCGTTGCAACAAATTGATAATCGAAATGCTTTTATAATGCCAACTTATAAAAGCTGAACGAGAAACGGACATGATAGAATATCAATATATTAAATTAGATTGCATAAACGACTACATAATACTGTAAACACAACATATGCAGTCATAGCTGAATCGATCTACTTAGATGGTATTAGTGACCTGTAACAGAGCATGCCGCATCTGCTGCAAGGTGGCAGAATGTGTCTCTGCGGCTGACTAGGTATCAAACCTGTCGCATCGAGCCCAAGCAGCACAACGGGGCATTGCAATCCAGGTGCAGGCTTTGTGCCACCCACTACGACCTGCTGCATAACCAGTAAGAAGATAGCAGTGATGTCAAACGACGCAGCTGACTTCTTCTTTCTTCTTTCACCGACTTCCCCACACCCAGCATGCACCTTCCTCATAACTGTAGTGAATGTCTGTTATGAGCGGAGCGGAAGTCAACACTTATGAAAATGGCTACGAAGTCGTGGCTATCTATCGGCTTATTAGTATTTGAAACCCCTTCTTCAGAAGCCTGAAGAGCTAATCGTTCGGCGATACTATATGCAGCATTATGACTATATCGTCTCTATAGACCTTGCACCCATGCGGATCGGCACTAATCATTGGGTGTAAAAGGAAGCAGAAAGGAATATGGAAAACTAATACGATGCCCGTTAAGTTCAATACTACTAATTTTAGATGGAAAACGTATGTAATAGAGAGTAACTTAAAAGAGAGATTCCTCTGTGTTGCTGGGAGACGAACGGGAAGCTTCCCTATCCAGCAGACACGAGATCTACTATATGTTGGAGTTTAGTGTTATTGAAAGAGGCGGGTATATTCCTGCAGTAGAAAATTAAGTGCATTCCTACGAGCAGATGGTTGGAATGACTGAGTTTCCTTTGTTACAATGTTTTATCTTACTGTCTTTGATGAGCAGCTGGGTGAAATGCGATGTAAGAGCCGGAAATGTTAAATTGGTTTGTAGTCAAAAGAAGAAGTAAGCACTTATTCATTAATAGATAAAATTCAGTCAACTCCCTGAAATGTTTTTCCTGCCTGAAAGCATTGACTACTATGTTAATCTCAGCAAATTAAGGCGATGGGTTTAAACATAACCTTCTTAAAGCTATTCAGGATTTAGTATGGCCAAATCGATTAGCCGACATTGAAATGAAAGCGTCCTTAACACCTCATTACTTAGAGGGGTAACTCTTTCAGAAATTTACATGGAAGTTCGCACGTGTGTTAAATGGTTTGCCAGAATTGTCAGATTTCGATTTTGATGCACTCAGGCAAGTGCTCTCCGATTCTAGTGGCTTCTGACTCTATACCTTTTGATGACGCGAGCGATTCGCTGCCAGGCAGAAAGGATGCGATGCTTTATCGGGCGGCGGAATCGGTGGTAAAACAACAATTTTGAATCGAATGGAATGATTGGTGCAATCACCAACCCGGAAAACAATGAATATTTTCTCTGAAATAATGACTGTTTATTACGAGTCAAGAATGCCCAAAGGGGATATTCGGATCGCTTGTTTCAGTTTCTCGTTTAGTGCATTTGATCCTTTACTCCTCCTTAAAGAACAACCTGACCCAGCAAAAGGGCCAATACTTTTATATTGGACTCAAGAATGCTGGTAAGCAATAGTTTAAAATACTAGGGCGATCTCCGCTTAGAATTCGGATTCAGCATTTATTGGTTGTATGAGAGTAGATAGAAAAGACACATGGGCTTGAAGCTATCAAAAACTAAGTAGTAGTGATGAAGAACTTTTCAAATATGGAACTCATCAGCCTCATTTCTAAATAACTGAAGAGTTAAGACGACGTAATGAACACAGATTGCTTAAGTGGACGATGATAAATTCACTAACATTGTTTTATGACAATATCCAGAAATATGCTTCGAATGAGCTCTGGACATGCAATTGGTATTATCATACAAGATTAGTAGATGTCGTTGGCGAAAGTTCGTGCTTCTTTCCCCTGGAACCCGCTTCTGCTCTTCTCCTACTTTGCTAACTCTCTGCCTTTTACGAACATTAAGCGACTTACTGATGCACGCAATCCTTTACCCAATAATTGCCGACTCATTCCCCAGTAGTACTGCAAGGAGATTCCAAATCCTGCATGTGGAAAGTTGGTTGACAGGTCAAGAGAAGCAATAAATATTATCAGTCCGGATATTGAGACATTCGGTGAGAACTGCCTGTTTTAACTCGTGCGTGAGGTTTACTTGAATGACAATTCTGGATAAGGCCACTTATTATCGCAGTCGTTGATTCAGAGCTTCTTATGAAACCATTCGTAAAAATTATAATCCGTCAGATAGCATTAGAAGTGAACGGCGTTTAACGGCAGGCGATAATGAATAGATGAAGGTAAAGAAGTACAATGAAAGCCCTCTTCCATCGAGGAACTTACCAGGGAAACGCGCATAAATGCTCGGAGGCTTGCATAAAGCTGTTAGAAATGACTGCCAGGCCGCTTCCCCAAGAGTGGCGCAGAAAGGAAAGAAGAGGAATATAGGGTCAAGCTCGACAGTCAGTTATTATCTACTACGACAGGACACCCTCTTGAGCCCTACAAACCTTAGTAGTGACTGACTCAAAGGGTTAAATTAGAAAAGCTTTATGAGACTCGTTCTCCGCGAGGACCTAACCAGATTGCGAGGAACACTATCACTTACGATGAATACATCTGATTGTTTCATCAGGGCTACGAAAATGTCCATTTTGTATTAAACACGACAAAATATAGATCATGTTTTCTTCCTATTGCACATTATCCTGAATTTTCGGTGATGCCTATTAATTCTATTCGATCGTGCCGCGACTGCAATATGGGAGAGAAATCAGGGTTACCTGCATAGATGAGTACACCAAGCGATTTCATCCCTATGATGACATAGAAGTCCTTTCAGTGCAATGGGTATACTGCAAATTTTCGTTTCCGGAACTCCCGGGCTGCTAGTTTATGTTGTTGAATGCCCGGCGAACTGGAGGCAGGAAGACAAACACAGAGCTCTTCATCATTTCAAGGCTATTAAATATATTTAGCGGACCACAGACAGGTATCGTTTGGAGCAGGAAGCACTTGAGTGAAGTGATTACTCAACGGAAACCCTTCGTAAAATTAGGTAGCAGGAAAGCCGTAAGGAAGGCACGTTTCAGCAGGCTCACCACAGTCAGAATTTGTATGCGAAGCAAATCTGAAACTATTATAGATTTGAATGACTTCCCCAATTATTGGCTGAGAAACGTATGTATCAGTGTTGCCTAGGCAAACTCGAAGATTTCAGTAGAGGGATCTAGAAAATATGATGAAAGATAGAAATTACGCTTCTCTCGCATGGCATTCAGAATCCTTCTCCTGCGGCTGTTTTACAAATCCGGTGGACTCTTAAACCAATTCCTCTAGCAGGTCATTGGCAACAGTGGCATGCACCGAGAAGGAAGGTTTGTAATGTCCCATCCGGCACATAGCAGTCCTAAGACGGTACAGTCAGTAGGTCGGTGGGAGTGGTACAAATTCTCTCATGCAAAATATGTAAAATCGGCTGCACCGGAAATCATTCAACATCTCACAAACTATCGGGGTTCGATAGCCAGCCGCCAGCACGTTCCTGCATACGAAGTGTGTCTGCGTCGATACCATCTCCTATGAGCAACGTGTTTAAGAGCCAAGCCACAACCGGATTTAAACATAATGAATGATAATAATAATATTAAAATTTCCTGTTGACTAGCATTTACTATATGGTTTCTGATAAGAATCATTGCAAAGATCAACAATGTATCACGAACCAGTACAGCAGTGAGATTTGAGCCCTCTAAAATATCAGCATCTAGCATGCATCTATTAAAAGGGCGAGTTTATGACTAAAAACCATGGGAAAGAAGACTTAAAGATTTATCGCACTTGCTCAAATGCTGCATTGATACATAGATTTTGTAACGGATGCTTATGACATTATTGGATCATAATTCCTCTCAAACCGCAAGAACAGTAACATTTATTATTCAAAAACAAAACCAGATTATAGGAGTACTTCTACCTCCCTGATAATGTTATTGGCTCCTCTGGATTCCCACTGGCTCCCTTAATGGCTTGGGCTAAATTCTCTCGCAATACGATAGAAAACAGGCGATTTTAGAAATGTATAGCGAGGGCGACACGAGCTCTTATTTCATCTTACATTGAAGAAAATGACATTGAGTTTATTACAACATGAAAGTATGTTAAAAACATTGGTATAAAATTTAGTCAAGTGCACAAAAGAAATTACCTTCATATTTAACTGAATCATCTATTATTAAATCGAAAGACGATGGGTCGCTAATACGCTAAAGATTACGAATCATTACACATGCCTTAGCTAATCTATGGCAGAATGTATAACTGCTTGGACTCTTGGCATACAAATAAACAATTCAATCCTGACGATGGGTTGCCCAACATCCATTGCCACCCTTGGTCTGATGAAGCCAGGAGAATAACTTATTTAAATTAAAAGATTACTCATAAGCAAATTGTCATACATTTAGCATGATACAATATGACAATAAAATAATTCCTGAAGATATTAAATGCCCGTACCTAAACTGGTAGATAAGCCTAAAATATCACTTCTCGACGAAGGAGGTTAATGACCAGCCAAGCTATGCAGAAACGATTTAAAGGAAACGGTTATAGATTCAAACATTAATTTCTCTTGATAGTTCCTTCCATCCCTGCCTTCTATCAATACAACATTTGAAGATTGACTAATAAGAACTATCTTTGGCGTTATGCTGCAGCTGACAGAGCCAAAATAACAAATGCCCCTGGCTTCATTTGGGAACTCAGAGCTGGCTCAGAAAGCAAGGCATCTACTCCAATAAACGATTACCATACAATGCCAACTAGATGAAAGACTTCAGGTAATTGAATTGATTCAAATAATAATAATCAAAATGTGTATTTCATGGAAATAGTTAGAGAAAACGAAGAAAAACCGATTTAGAAATATCAACAGCAGACTCAAACATGACGAAAAACCATATTTCATATGCGTTCACGGTCTTAACTTAAAGCAATTGGCGGTTGATGTAAAGAGGAGGAACGCATTCCAGAGCGAAAAACGGCTTCCATCTCCTGAAGATAATCGCCAAATAAACCAATACTCAGGCTTTTACAATCACTCGACTGACGCCACGAACGTTATTTCATAAACGTTTTCTGCATATCACAAACGATTACTCTGATAACAGGGACAGCAGGCCACTCAATATCAGGCTGCAGTTGATGTATCATCAACGGTTCAGCAACACCGATACTTCTTCAGGCTTCAGCAACGGAGAATTCTTCCTTCGTTGCAATTTCCAGATCTGCAGCATCCCTGAAGCGGCATTAATGGCTATGCATCCACTGATTTGTTCTTCGCTCCTCCTCCCCGCTCCCCATTTCGCCCTAATTTTTCTCCGTATCCTTCTCACGGAGCTGTGCGTTCCATTTCTGATGATTCCCCTCCGGCGATAACCAGGTCACACCTTTTCCGGTAACGACCGAGTTGGAAATAAATAACGCGTTATGCCCGGAATGGCCACGTTCATAGACGGTTTTACCCCGATGGTGCTTTCAACGAGATGCCCACGATGCCTCATCACTGTTTGAAAACAGCCACAAAGCCAGCCGGAATATCTGTGCTGCAATATCGGGTACTGTTGCAGGCAGACCGGTACGAGGCGGAATATGCGTCACCTTCGTACCAAATAAATTCATCATTAGTTCCGGCCAGCAGATTGACATGCTGGTCGTACTTCAGCCATTCATCGGCATCCCATTATGCAAGCCTCAATATAGTTAAATGCGAATGTTTGACGTGTTCCGTTACCCTAGAGCAACGACTGTGATGTGTCCGTGTGAACCAATACTGATGAAAGAATGGGCATGAGCACCGATAACTAAACCGGGATGCTGGTGCCGGCAATACCAACTGTCTGCATCTTGCAGCACCGGCACTCAACCGGCTGCATACCGGACAATGCTGACTGTGGCTGCCTTGACTTGTCCCAGCTGTTTTCGATAAATAAGCAAGCCCTGTGCGGGTTCGCCTTTAACTGTGGATAACTTCCTGCAGTAATTGATGCTGTTCATTTCTCATCTCCCTCCCCGGATATTCCTTCCTTCCTGATGCTCTCCTTAGCATCTCAGCAAGCACCGCGCTCTTTGAACCGCTCATAACTGTGAGCAGCCCCGTTGTTATTCGTCGATTTTGGCCTTTAATCCCCGCAAACTGCCTGTGTTGTTCGTCCGTAATCAAACGACGATTGGTTTTCGTCCCCAAATCCGTAACGGATGCAGACTGGCACTGTGGGTGTGCGACTTGTGGATTCCATCCTGATGTTCCTGAAATACATGCGCACGACCGCTCTGGCGGTTTCCCCTTGATTGTCCCTCGCATATCAGGAAGCACACCGATGGATACGCGACAGCAAGTTTTGGGGCCGCAGTGGGGCGAACGCCGCGCGCGAAGCGAAGGAAGCGGCTCAGACCGAACGATACGCTTACTCTCACACGGGATCGGCGTACTTCACGCGACGAAAGGCCGAATTCTCACGGCCCAAGGGTATTCAGAACATCGCAACGGGAATTTTTGCCAGAATATCCCTGCCAAGCTTCAGTTCAGGTCGGCTGGCTCGTGCATCATTTTCCGCAAATACATGTCAAGTTTTGTTTCTCACGAGGTTAGAACAGC	*	tp:A:P	cm:i:85	s1:i:769	s2:i:0	NM:i:2506	ms:i:2208	AS:i:2192	nn:i:0
+77	0	utg000001l	28921	60	71S7M1D4M2I14M1D10M2I2M2I1M1D4M2D29M2I4M1D3M6D6M1I6M1D6M2I9M5I5M2I6M1I2M1I3M1D1M1D31M4I8M1D6M1I2M3D2M5D10M7I2M1D7M2D3M2D11M9I2M1I11M1D9M1I8M1I13M1D6M1D15M1I12M3I15M1D5M1D8M1D9M2D12M1I7M2I7M7D4M1D2M4D3M3D7M3D4M2I1M1I8M1D3M1I3M1D10M2D6M1D5M4D8M1I2M1I1M2I1M3I8M1I1M2D9M1D11M4D11M2I3M2D15M2I9M6D1M2D3M1I5M1I1M1I2M1D9M1D10M3D2M2I3M1I2M1I7M2D3M1I26M3D8M1I7M3D6M3I7M1I23M2D7M1D18M3D9M1I9M1D9M1I8M1I4M1I6M2I3M1D10M1I13M3D3M2D21M1I11M2I6M1D5M1D3M3I7M3D7M1I9M1I18M2D9M3D9M4D6M4I6M1D4M2D6M1D8M3I2M1D6M3I9M1I4M3I3M3I25M4D3M1D5M3I4M1D3M6I4M1D6M2I6M2I1M4I5M1I10M4I2M1D8M2D17M11D10M1D9M2D3M2D1M2D3M2I8M1D3M1I16M1I21M2I6M3D9M1I3M4D6M1I4M1D5M1I23M1I18M3I4M1D23M4D10M1D9M2I25M1I16M1D8M1D7M1D3M2D11M1I15M7I22M1D4M1D6M4I7M1I2M3I6M2I26M1D1M2D12M1I4M2D7M1I4M2I2M1I2M4I5M1D5M1I2M1I4M2I5M1D2M1D3M1D6M2D2M4D16M5I6M2I8M3I6M1D5M1I12M1D5M1I7M2D2M1I9M3D17M1D11M1I17M4I8M2I13M1I5M1I3M2I8M1I8M1I8M1I8M1D1M2I9M1D5M1I5M3D7M1I17M1D2M3I5M6D3M7D3M1D7M3I14M1D9M1I20M1I2M1I4M2D11M1D5M1D2M3D4M2D6M1I1M2I6M1I12M1I1M1I3M1I14M1D12M3D8M1I3M5I14M2D4M1D2M1D4M1D11M1D2M1D6M1I11M1I2M3D21M1D14M1D8M6D15M1I5M4D3M1I3M1D10M1D4M1D1M1D1M1D5M1I8M1D3M1I2M5I15M3I7M2D9M1I6M1I2M2I5M5I2M2D7M4D3M1D3M5I11M2I6M2I9M1I11M1D4M2I2M1D3M3D5M1D6M1D5M2I2M1I9M1I9M3I3M1I1M1I2M5I4M3I11M1I10M1D4M2I3M2D2M7D11M1I4M2D1M1D3M2D3M1D2M1D1M1D3M4D2M1D25M1I11M1I5M1D12M1I5M8D16M2D10M3I10M3D7M4D6M2I13M1D4M1I16M1I2M3D10M2I13M2D2M1I2M3I5M2I1M1I3M1D3M3I8M6D8M1D5M1D7M4I9M1I1M2I17M3D1M1D13M4I6M2D5M4D10M2I1M1I2M1I4M4D7M1D9M1D8M4D8M2D2M1I11M6D3M1I1M1I12M1D5M1I9M2I7M1I3M1D14M3D7M1D12M5D11M1D4M1I11M1I6M2I10M1D7M1D3M2D8M2D2M1D4M1I5M2I19M1I5M2D1M1D2M2D4M1D6M2I13M1I1M2D2M3D2M1I7M3I5M1D3M3D8M1D2M1I1M1I1M3I14M1D8M1D1M1D4M5D5M2D2M2D11M2I5M1I9M1D7M4I9M4D3M1D6M1I9M2I3M1I1M2D12M2D8M3D7M1I4M1D13M2I16M1D10M2D2M1D27M3I4M1D3M1I22M1I6M1I6M1I5M2I11M1I4M2D4M4D14M2D8M1I11M1I19M1I36M1I8M1D2M1D2M2I27M1I4M1I5M1D8M2D5M2D5M1I8M3D9M2I1M1D5M1D9M1D12M1I17M1D2M1D12M1D1M2D9M1I6M1D1M2I3M5D5M2I24M4D5M1D1M2D4M1I5M1I2M4D2M1D2M2I11M2D11M2D6M2D11M1I2M1I8M1D4M2D15M1D11M2I12M11I15M1I9M4I3M1D4M5D3M1D8M1I21M1I8M1I17M1D5M1D5M2D2M2D17M4D8M147S	*	0	0	GTCGTGCGGCCAGTCTCCTTAGTTATGGGTCCCCATTACCACGTTTCCCGCGACCGCTGGCAGTGTCAACAATACGGGGAACATAGGTGTACCGCCTCGTTCGCCCCCAGATAGCTAAAATCGCACCGTTCATCAGTACTTTCAGATAACACATGAATACTACGTGCTTAAATACGTACGCTTACTTCGAACCTAGAGGTTCCTACGGAAGCAGCACCACTATCTGGCGATCAAAGGATGGTCAGTAGTGGGTCACGTAACACGTGATGACGGCCGTTAGATAGACCTGCTTTCGCCGGCCGGAAAACGCGCAGCCGCGCGCGCTCGCCGCTTTACAATGTCCCCGACGGATTTTCCGCCCTCAGCGTACCGTTTATCGTACAGTTCAGCTATCGTCTACACATTACTGAGCGTTGGAGTCGCATTCACACTGCCACTGATATCCGCATTTTAGCGTCAGCTTTCCGTCCGTTAAGGAAGGCCGATTGCGCCGCCGTAGTACCGGGGTCAGGCGGCTTCAGAATAGTCGTTCACTGAGAACGATATCTGGTTATCCTGCGCCAAACATCGGCGTTTCATTCCCGTTGCCGGGTCAATAAATGCGATCTACGATTGGCGGCAACCGATATACGGCCGTTTGCTTCCTCCGTGTCCTCCATCATGAGTCAATACCCGCGACATAATGTTTGCCGTCTTTGTTGGTCAATTTTGACAACACGGTACCGGCATTCCACTTATCACTGGCATCCTTCCACTTTCCGAATCTCCTCCAGTTAGCTCGTTATCCTCCGTCAGCTCACTTTCCGACGCAGCTCCTTGCCGGAGCGGCCGGATCGGTTATCTGTGCCTTTGAAGGTGAGACCTTCCGCATCATCGCTCACGCCGACCGACGGCCCTCCACGAATGCCGATTTGCCAACGTTCACACTGCGGATATAAAAGTAATAATCATCGCCGTTTGATATTACTGGCGGGTACAGAATCCGCCGTACCAATAACGCGTTAGCTCAATGTTCATCGCACTGTCTCTGTAAAGAATCAAATCTTGATTTTCCCGATAAACGAACTCATCTGCGTCCTAGCGTATACTAAACACTGAAGATGCCCGGCGTCAGAATTGACGGATTCTCTGAGACCTCTACGCGGCGTGCTCAATCTAGGTCAGTGCGGCAATCCGGAACGATACCGACGCTTAATCCCTGCTGCCCCCACGCATTTACCGCCCGGACTGTCAGCCTGTAGTTCCCCAGCGCAGTTGCGTGGAAGCAATACTTATGGTTTCCGTCGTCCGTCCGTTACAACCAGCCCGCTCACTGCCGTCGTCTTACGGTTACCACGTTTAAGCTACCAGGAAACGCCCTTCACGCCCTCGGCTTGTCCCCATCACGCCAGCACCTGATATTCCGCTGTCTGCAGTACTTCTGCGTCGGGTCAGGCGCTGGCAGCGGCGTGACACCATTCACTTCACCCCGTGCCACTCTGTTCGCCGTCAAGTGCGCCCCGGGCGTTATCTACGATGATGGCCTCTCTTTTCCCTAACATGCTGCACGGCGTTGGCATACGTGCCGTCCGTTCTCTACGGATACTCACGACGCAGCGGAACAGTCCTCGCTGGCGCAGCGTCGAAGCCTCTCCCATACGCTGTATCTGCCTCAGCAACACCGTCAGAATAAACACTATCATTTTACCTTCACGCGTAGTGACGACTAGCAACCTCCACGACCCACTTGCCACTTCCGTCAACCAGGCCGTATCAGCGCGGTACCTAGAGGATGGCAAGCGTGATTTCACGTCAGAGCGGTCCGAGCGTCAGCGTCCGGGTCTGCTGTTCACCGCCAGCACGACCACCCCGTGATACCGGCATAGTCATCGACTCGCAGATTTCAATAACCTCACATGTAGTGACGCGGCCTTCTGCGCCGACGCTGAAATCCACGAGTCTGCGTTTCCAGCAGTTCTTGTTTTAATCAGCCACAGCCGGCCGGTGCGCTCCGAGACCTGGTACCAGCCAAAGGCAGTACATGGTTCGTAACATTACTCGTAACGGGCAGCCGGCGGTTATCTTCAACAAGCTCTGTCGCCGTCTCCCAGCCGTTGTTCGGGTCAATCCAGGTCGCCTGAATCGTTATGAAGGCGGTCCTTCAGGGCTGAAGCTGTAGCGGACCTTAGCGCCATGAGCATCCAAGCATACAGGTATCCGGTTATAGTCCCTTTATCTTAAAGGTCGTCTCTGCACGGCACGAACGTCAGCGTCTTCTGCCCGTTCCCTCCAAGGCATACAGCGCATCACCGAGCAGAAATCAGCCATCCGACCCACCCCTTACGTGCTGTGTAGTCAGGTACGGGATTACAGGTATGCCGGCCCGGCGTGCGTCCGCAGCCAAGGCCGTCCGACTAGGTGGCAGTACGACTCGAGCTATAAAGATATCGCCATCCTCGAGCCATAGTTCCGATGCCGCCCAATTCCACGATGACCGTCGATATTAATCCCACCCGATACATGTTGTTGCTGTATCCCACGTTAAACGTTCCGTCCCATATCTCCGTATTGCCGTGCGGGTTATAGTTTGGACACCCACCTTACAGAATACGCCGCAGATACTACGTTGCCCTCCTGCTGAGCCTGCCGAACTGCTCCGAGTCTATGCACGCCGACCAGTGCCGTGTTCGGCTAACTGTTCACCGGCCATTATTTCGATAGAGGTTGACGACCAGCGTTTGTTCTTGGTGCAGCTCAGTCGTGGTGCTGTCCGGCGTCATCCTGCGCATCCGTGCAGATATTAACGGGCGGCGGCATTAGCTAGCCCACCCGGCTAGATACTGCAGGTGGTTGGGCCTTAATGGTAGTGTCTTTCGTCACCCAGCCGTTAAGCCGTTACGTTGTATCTGTGAACCAGGCATATAGACTTCCATAATTGGTGTCACCCTTTGAGTTCCACCAGTGCTGTACGCAGGAAGGTAAAGCGCAGACGGTCGATGTTGCAGACGTAATGGTGCGTGATCGGGGGTCACTTTCTTCACTTCTATTCCGTGGCAGCTAGCCGAGGGTTATCAAAGCGCGCGGTCAGTGCCTCCGGCCGTTCATCGACATCACCGACGATAGAACACCGGATATGTTGGCTTCCCTCAGTGCCTAAGCGTACTGTTCAGCAGCACCCTTTTAAGCCATCCCACCCTCTTTCAATCGGTCGCTGATGACCATCGATCGTACACTCAGCAACTGCGTGACTTCAGGTCCTTCGCTTCCTAGCGGGGTCCCTGCTTACTGCTTCCGTTACCATTCCTCACTCAACAATGACAAAACCGCCGCAGAGTTCTCGCACATACATTTTGCATCACCGTACAATCACCACAACGATGACCACCGTCCTCCCTTCGTCTGCCCGTTGATGGGGGAACCACGCGTACCGCCGACGCATTCCCGTGACAGAACAAACCGACCGTTCTGCCCTGGGCAACCATGTTATCCAGTGAGTAAAGAACGGTGTTCTGTAGTACCGTTATCCGTTGTCTGTGACCGGGGGAGTCCTGGCTTTCGGTGGCCATCTGCCACACCACCGAGCATACTGGCCTACGAGAAAACAGGATGCCGTCATACCACCGGCCCCAATGGCTGCCCCATGCTGCAAGGGTGAGGCGGTAGAAGAATACCTTAAGGCATGGAGGCAACACCGTACGAATACGCCTGACTTATCGAGCGACTCTGAAACGATATGAATTACCGCCATCAGGCAGTCTCATGTAACTGCGCCGTTTGGGCACGAGTGCTGACCTCGTTGCCCGGCAATCCTAGGTCTGATACCAGCCCGTCCTGAGTTTCTGACGAAACGCCGGGAGGTGTGAGTTGCCGTGCCATCGCTTCAGCCCCCGTTTTCACACGAAGGTCGGATGCGGCGACCAAATCGTTGTAAATCCCGTACGGCATGCGCCATGCCCGGTGACGGAGTGTGCGTCGGTGCCATTTATTCACCTTGTATAGTTTTAACAGTGTTTAAGGAAGTATTGGCTAGCCGTCACCAAAACTTAGATTAAGCGTCCAAAGGTGAACAAAAGGCACAGCAGCGCCACATCGATAGTGTTAGAAGGTTTAGTTATCC	*	tp:A:P	cm:i:15	s1:i:173	s2:i:0	NM:i:1317	ms:i:798	AS:i:790	nn:i:0
+78	4	*	0	0	*	*	0	0	GTCTGTTCTGTGGACGTGATTGCGAGCGTGTGACTATTGGGTTTAACTAACTGTGTATTCGGTCCGACTGACGAATCCGATTAAACGGACGCCAATGTCATGAAATGCTGTAACGGACGCAGGACGCTCTTGGTTCTGCAGTATTCTGTTACCAATCTCATCAAAGCGGCGTTGGTATTAAATGGCCTGAATGTCAGCTCGTAGGACCCCTCCATTGGATCTCAACTCAGGAGCATGGAATGGTTCATGATCACGAGATCGAACCACTGACTCATGACTCCCACCGCTATTCACCCCAATTAACGGGTTTCTGTCTAGACTCTGAAACCCCGCTCGGCCTCCAATATGTATTAATTAATGTAGATGGACATGCTGACGCCAGCCTTAACGATCCTTATATGCACCGAGTTTTCGATGCCTTGAAACTGTTGTTGATGCTCGATTCAAACGCATCCTGCAGTGGTTCATGAATGCCATCGACTCCATCCTCGGTAGCGGGAAACGAATTACCGGCTCCAACTCAACCGGGATATTCGTCGGACTATCTCATATCATAAAATGCATCGTGCGGTTTGACGCCGCTGACTAAGCGACTAAGTCGACCCAACGATTTCGTCCTTGACGCTCGCACCACCTGATACTACTGCATCCTCGACGGATGCTCCCTTAGCGTAGCTTGTTGATTCAGTATGATGCATCTAATCTGACCAACGAACTTCTTCGTGACTTTGCCATTGCACGTGAACTGTTGCATACCCTTACACCTTCCCAATCCTTTGACGTATAAATCCGATCCCCGTGCTGCCCTCGTACGCTGTATCGAAGTACTGACGCCGCATCTGTAAACATACTGCATAATGCTACGAATTACGGAATGGATCACTTAATGACTCCGACTGCCAACTAGATTCATCGCCTTTATGCAAACCAATGTTCGTGGAACCCCTTCCTACGGTAAAATGGATATTAAACTGAAGTGGATGGCCTCAGCGGTAAACCCGGTTTAACTTTTTAGACAATCACCGGCTTTCCGGTGAATTTCGCCACCTTTCCACGACCGAATCCTGAACTGGACTAATCGATTCCTAAGATGGTTGCACTCGGCCAAGCCGTTGACAGGATAGACCTAGTTGGACTGCAGGGAGGAGGACTCATGAAGCTGACCTGGGATCGACGCCCATGGCACCCCGGACACTGTTTCTAGCATCCTACGGACTCTTATCCCGAGGTCGTCCGGGCTACGCCACGGCCACGCCGCAGCGCTTGGATTGACGCGTCCGTTGGACCCCTTTCGAGTTTCAGGGGACGCAACCGAAGCGCGTAGCACGGTGGTTCGAGCGGGCCATTAACTAGGTTACTGTACTTCCAAGCGCTCCCACTCGGCCCGTATGATACTCCGGCCCCCAACGCCTGACCTGGAAGCTGAGCCCTGGTTGCATGAATTCGTCATCGAGGAACTTACCACTGGTTGACAGACTCGCGGTCCGCTGGTCACGAGACGAATGCCCATTCACGGTTTCACGAATCTAACGTGACGCATTTCAACCAATCGCTCGTAATCCAATTAACGCCCGCAGCCGAGTCTACATTTCCTGACGGACGCCAAACCCATCGTTCCATTAACTTAGAATTCTATCGCTGGTTGCCCGCATCATGTAATGGCAACTGCTCAACGAATTCTGTAGCAACCTGAATTAACAGCCAGGTGGCGTGGCTCGTAATCCTGCCACGCGGATTTGATCGACAGATGCCACGCAAAATAATGATCAGGTACCGATTAAATTCCCCGTATGCCATGGCTCTACTGATGGAATTAAAGAACTCCCGCCTTCAATGGCCCGGGAGGAAACCTAATTGGAACCGCGATTGGGCAAACGGGTTGTTGACTCGTCGGACCCCCTGGTTAAACCGTGGACGCCGTCCATTCAGCACGGAATTTAGTACTGAACAGGCTGGGGACCCCAGCATGAATTCCGAGACTGACATCCGAAGCTGCGAACCGTCACGGATCCCAATTCTAACGTTCGTAACCGTTACCGTGGCACGCATCCATGCCAAGAGGGAATGCTCTAATGTAGTACTAAATAATGGACGCTCATGGACTATCTCTTTGCCACGATATATTTCCCCGATATTTCGCCCGACATTCAGCGTTAGATACGTTGCGCCCGCTCCTAAGGCCGAACCGAACCCTACTGGTACGGTCTCCAACCACGCGACTCGAACCAAGCATGGCGAGCGCTCCCACGGGTCGATTGACTGACCAAATCCGAGCACGGATTAAGAATAATCTCTGGCACATAGGTCAGGACTCCGGGGGAATGCCGTGAAGGGTCACCTAGCTGAGTCGAGTCAACGCATCGCCCTACATTCACGAGTTTGCACGGGTTAACAATGGGACGCAGCGCAATGACCTGACGCAAACTTTAACTTCCTGTAGTTACAATTGCTAGGTCTACTCAACGCTGAATCCTAGCGCTCGTATGGGAAAGCCGATTACTCCGAATAAGGTACCGCTCCTGTTCGGCGATTCGTTCGTCAATAGAATAATGTTGGGAATCGCCGCGATCTATATCAACGCCACCGCACTAAACTTATCGATCTCACCGCCGCTTGACTCGAGCGTATTTGGTGCGATGTAGCGAGCGCTTGGATCTCATGCAAATGCCCGTTCTCCCGCTTTTCTAACGTACGAATTTAAACGTATTCCATAAATCGACATTACAACCCCAAATGAATCGCCGACGCATTACTGGCCCAGCCTTGGACGCAAATGGTCCGCCTCCCTGACGCCAATCCCAGCGCTGCAGCACCGCCGGTGCATTATTGCAACTCCGTACGGATAGTGGACGGCGAACGTAAACCTCATTAGCAGTGCCGCAATTTGTAACGCGTGATTCAAGGGGTCATCGCACGTAACGCAGAGCGCACTGAATAAATTCATCGTTGTATTTGGGGATCGATTAGCATCTCCGGGGCGTAACGGATTAATTCCGACCTCCCCGCAATCATTTCGTCTCACTCCGATTCCAACGAGACGGGACTTTCCCATCGACGTTCTGTTATCCGAATCGCTGGAGGCCAGCAACTCGCAAGCCCTCACGGCACGGGTTATCCCACGGCACTGTCTGTTAAATTGGCTGGAACGCAACGTAAAGCTGTGCTCAATTGGAATCACGAACGTGTTCAAACTTATCGCGATCTAGAAGCCAACACCAGGATTTCGACTAATTTACGCGATGCTAGTTGTCGGCCCCTGGAGTGATGGTACGAAAGCAGGGATTCCGACTCGAACCAGCGCGACTGACTCCCTAGGATCCGTTAGTATCGAAGCCGGTGGCTTCAATTCTTGCTTTACGACGGGTACGTTCGGACCTCATGGTAAAGACGAAAAGCCTAATTCCGCTCGCTAGCGGTGCTGAACGCACGTTACCGTAAAGCCAAGCCTGAGCGAATTTAAGCCTAATAGGTCCTCAACTCCTTTGCCGTAGATTCTATAACGCAGCCCCGAATGAACTCAGGGACTCTTAGGATTCACGCTCATTTAGGCTGAATGCTCCCAATTCAAGCCCCGTGCACGCAACGGACGCTACGCACTGAAAGGACTTATCGCCACGAGACGCCATCTCGACTCGCCTGTTCTTATTGGGATCCCTCCAAATAAACCAAGCAGTTCGACCACCGAATCGGACGCAGATGGCAAGCTCCTTATTCTAGGATTCCGAACGCCGCAGGATTTTGTTCGTCCGTTACCGCAACGCAGCGGACCTAGACTTAGATAAGGGGCTCCTCGTATGCCTGAAGTCTGAATCAGTCTAAGCCCAAACCATACGCAGCCCTATTGTTCAAGATTGTCGACGTGTTGCGGTTAAAGAGTACCGGTATCTCCGTAATCTATCGCCGATCCGCATCGGCGCAATTACCTCCACGCAAATGGATCGGAGCGGCAGCGAGGCGATCCCGAGGGACCTCACTCTAGCGATCCGAAGTTTGACGCGATACCTTTCTATTAACGCCTGGAATTAACGGAAGCTCCATTGGGCGTAACATGGCTGACGGAGGATGGACCATAACCGGCAGCACGCCTAACGCCGAGCCAGGAGCGGGTCTGCTGAACTGGAAATCTGCGCCGCGTGTTTCCTACGATCGAGCCGGACAGCAAGTGCCGGGTACCCCTCCAGCGAAATCCTGGTATGCCGCGACTGCTTTGACCCACTTCATCTCCAAGCCTAACGCAACGCCGTATTTAGACGACTCCCGCAGCAACGAAGTTAATGCGACGCATCGCACGTTTAAGTTTCTGACGTACTCCATCTACGGCAAACCTGTTATTATCGCACTGCCTGACTCTGGAAGTTTCTTAAGCGATTTTAAAGGTGCCCGAACCGACGCACGGACCCGTTCAACTATCGACTATGGATCGCATCGGACCACGCATTGGGATCGTAGCTAATTCCATGCCAACTCAATCTGCACTGATTGGCGCCTGAGGCAACGTTTGATCGCATCAAACGTCGATCGTTGTAGCTATAAATCCTATATAGGGTGACGATTCCTCGAGCGTCGTCGCCAGCGATATGCATGTAGAATCTGTAAGTTGCTAATAATACCGTTAACTCAATACGTGGGTACTTATTAGACTGTTCTTTATCCATATTAACATAGACCTTGCTCTCCGTTGAGACCTAACGCTTGCCAAGGATTTGGGTGAGCGTAATGAATTGGTTGAGACAGAGTTGGACTAGGTAAAGAATTATGCCGGAGTTAAAGTCGAGATCCATTGTTTACATGCGGCTACAGCTGTTTATGTAATACCGACTCATGGGCCGATCCATACGGTATCCCCTGAAAATTTAGTTGGTAAACCCGATAGATCGCGGTCTGCGTACGAGTACTGGTGACAGTTCAAAATTATCACGATTAGGTTGGGATAGCAGGTGGTTGCTAACTGTACGCTGACGCTCGACAGCTCCTTATAACCTAAGAAATATCCTATAGATCACCCCTCTACGGATTATTTCCTGTGCCAAACCTACTAGCTAAAGTTTGTCCAAGTAGTGAAACGTCAGAAGAGTCTAGGGATGGGCATCTCTCAGGCGAGCCGGTTCGCTCGCGTGGCCGAAACGCAATAACAACTTACTACCCTCACTGGGAACGACCCCTGCAGAGCTACTGGCTAATATTTGAATGTCAGGCGTAGCGGCTACGAATAAATGGCCGTTGGTCCGATTGGGTCCCAACTGACTTTGCGCCATTGGTACCTTCCGGAATTGAGAACTCAGCACAGCAGCGTCCAAAGAGACTATGCAAACGATTCGTCAATACTTTGATCGGGATTATGAAGAAATGATTATTTACCTATACCGGTTACAAATGGAAGAATATCTCTGTTTACAGAATCGAACCTACTACGTGACTTAGATCAGCCGTACCCCTGATAGCTTTTGAGGATACGAGTGAAAGCCCAGAACCGTTAGCCTCGGCGGAATTACCGACCTTTATAAGAGCTAATTAAGTACTATCACAGCTACAACCAAGACAACTAGGATTCCATTAAGCGAGGGCAGTACGCGGTATCTATGGCAACTAACAGGCTCACTTGAATCTGTTTCGCTCACAACATATCTCACCAGTGCTCGTATAGAGTTCACCACGTTTGGGTTCTCATAGCTCTGTTCGACCGTTATATGCTTAGATAGCGAGCCGCTATCCTGGCCCGCTAGGAATCGAGCGACGCTCGCCTAAGCCGTACGGGCCGTACGACGATAGGAGATTAGGTGACTCATGCGAGACGTAACTGACAGAAATTAACCGGTGAGATTAGTACCACGGTGACGAGTACTCGACACCAAAGCAGGCACGAGTCAACTAAGTCCTGTACGAATGGGCTGGATGCATTTAGGGACGCGATAATAGCTGGAGCAAGGTGACCTGGGACTCATGTCACGGTGTACGGCCCAGCACTGCCATCGGGGAGAATGGATCATCCACTCGTAGCAAACCTACAGATTATCGAGGGCAAGGCCAGGGAAATGATAGAAGTCTAACGACTTGCAATGACCGTGGCCGTATTTGACCCTAAGTGAAGCCAACGCAAGTTGGTATCTGCGAGTAGAAGTAAACAATTGGTACTATCGTTCTAAATACTCGTATTTATGTCAAACAGCATCTAGGATTATAGTCCACTTAGAGCACGCGGTCCCATATTACCTTAACTCGAGGATTAGGTGAGGAAATAGCTATCTAATGCGACGAGTCTTGTACCAGCCGGGAAAAATTGCGGTATAATAGTTGGCGATAGGCTTTCACGTCAGAGCGCCGAGTGGGTACACGACTTTTATGCACGCGGGCATAGGCATCGCCTGTATTTTAACTTTACGAGATGAGGCGATTAAGCTTCGACTCTACGAAGTTAAAGAGTTTCTGCTATCTATGGGAGCGAGCATTAGTTATAGGTAAACTTTAAACCAATAAATCCAAACTACGAACTGAAATGAGATCTCAACTGTGTTGGTACGGGATTGTACCTATTGAGGGTTAAAACACTCCTATTTGTTATTTCTGTATGATTAACTCACTGTAACGTTCGTTGCGGCCGTACTACAGTACGTTATAATGCCTGTAATAAAGCTACCGAAGTGGCAGTAAATTAACTATATCGACGTATAATTAAATTAGATGTTGCGGCCTATTAAAGACATCTATCAAACACATAGGAAACTGCATTGACACTGAATCAACACTTTAAATTATTAGTATGAATCTGAGCAAAGAGCATTAGCAGATTTTGTGTTAAATTCTAATCGTGACCTGTTACCGGTATGACTCCGAACCTAAAGCCTAACACCACCCCAATCCGTGAGATAACATAGATTTGTGCCCCGCCACTAAAAACCATCGCGTAGGCGACTGAATCTAGTCATGAGCAGCATTATTCTTTCTGTCAACATAATTTTAAAAGACGCGTATCATACCTTTCCCACGACTTATACGTG	*
+79	16	utg000001l	40502	60	1266S14M1D2M1D3M2I8M1D3M2I24M1D3M1D7M1D10M3D10M2I3M1I2M2D8M2D5M3D2M2I3M1I14M6D14M1D24M1I6M1I7M1D8M3D4M1I1M2D2M1I5M2D6M2D14M3D21M1D16M2I31M2D9M2I2M1I1M1I8M1D17M4D8M3D2M1D15M1D2M4D5M2D2M1I17M1D7M1I1M1I5M1D15M2D11M1I2M1I18M1I13M1D34M1I5M4D30M1I2M3D1M4D31M1I5M1D8M2I3M1D9M1I12M5D7M2I13M1D15M2D7M1D2M2D11M2D2M2D3M1D47M1D7M1D15M1D10M2I26M1I17M1D8M2I3M1I10M1D4M3D15M2D17M2D3M2I2M3I14M1D2M5D8M1I19M10D7M1I14M5I3M1I1M1I4M1D10M1I1M2D8M2I1M3I6M2I2M2I9M3D9M1D22M1I16M3I1M1I6M1D2M1I3M1D20M2I5M1I11M1D23M1I13M1I8M1D9M4I2M1D7M5D18M1D8M1D3M1D31M1D32M1D3M2I12M1I5M1D24M2I4M5D2M2D17M3I1M3I8M1I6M1D14M1I2M1I3M2D11M4I27M5D5M1I5M1D3M1I1M2D13M2D9M1I12M3D11M1D7M2D21M1D4M1I21M3I5M1D14M2D5M1I23M9D16M2I3M2I23M2I1M2I30M1I54M2D9M3D8M1I4M4D3M1D12M1D4M1D2M4I6M1D17M2D12M1I6M2D8M3D6M1D10M5D12M2D5M2D6M1D12M2D10M1D18M4D5M1I3M2D3M4I15M1I5M1I4M1D3M1D53M2D1M1D2M1D5M1I7M2I7M1I31M2D14M1I18M1I1M1I3M1D2M1I8M1D15M1I7M2D4M1I5M3I39M5I1M1D8M1D8M1I8M5D2M2D12M2D3M1I8M2I13M1D2M1I2M2D2M1I6M3I18M1D21M4D6M2D8M2I14M1I5M1I3M2D12M1D8M5D11M1D17M1I2M2D18M1I6M5I19M2D7M1D14M2D15M2I2M1D4M3D7M5D7M2I14M2D9M1I3M1I4M1D20M1D5M6I29M1D19M1D4M1D8M1I9M2D2M1D3M3I15M4D8M1I12M1D11M2D1M1D5M1I10M1I14M1D11M3I15M1D7M2D3M1D4M2I13M2I20M6I6M1D7M8D2M1D6M1D2M2I7M2I4M4I9M2D9M2D3M2D8M2I5M1D4M1I3M1I6M2I3M1I7M3D11M1I3M2I7M1D12M2D4M1D7M10D5M3D5M1D5M2D6M1I17M1D4M1D3M2D29M1D4M1D18M1D4M1I6M2I9M1I1M1I14M1D8M1I2M3I7M2I7M3I9M2D19M1I11M1I1M1I8M1D6M1D3M2I5M4I11M2D12M1I8M1I20M1D2M3D10M1D8M5I7M1I7M1I9M1D6M1I4M6D8M2D11M2I10M1D5M6I7M1D5M2I1M1D4M1D11M1I7M2I14M4D11M1I19M3I9M1I8M1I23M1D14M1D5M1I15M3I16M2I1M1I5M3I4M3D17M1I2M2D4M2D5M1D7M1D8M5D9M2I4M1D6M1D18M3I2M2D12M1D3M1D10M3I5M1I4M4D23M1I16M5I5M1D10M1I5M1I15M2I1M3I23M2I10M4I9M1I7M1I13M3D8M1I19M1D6M2I14M3I11M3D6M3I14M2I2M2D2M1I6M3D3M1D3M1D4M1I15M2D35M1I3M2I1M1I13M1I14M1D9M4I12M4I6M1D18M3I15M1I13M2D3M3D10M3D16M2D13M1D2M2D10M1I13M2I1M1D19M1I5M1I13M1I10M1D18M2D9M2I12M3D5M1I48M1D7M1D6M1D16M3I2M1I8M3I24M4I4M1I2M1I6M1D7M1I2M2D25M1D9M1D21M2I17M1I7M1D4M1D19M1D21M2I6M2D20M1D6M1I2M1I34M1I7M1D2M2I6M1D4M2D10M5I6M3D4M2I5M1I9M1D4M3D1M1I13M2D10M2D7M2D4M1I12M3D4M6D2M1I3M2D2M1D8M1I12M1D33M1D5M1D1M2D13M1D1M3D2M2D9M1I14M1D1M1D1M1D17M2I7M2I5M1I4M4D6M2D6M1D5M2D3M2D2M4D6M1I3M3D3M5D13M2I3M2D2M1I3M4D3M1I11M3D19M3D2M1D20M1D5M5D12M1D2M1D3M1D6M6D8M2I26M2D17M1D2M2D7M2D5M2D21M1D6M2D3M1D10M2I72M1D13M1D1M1D37M1D1M1D8M1I9M1D7M2D16M5D7M2D5M1I24M3D10M1I17M2D2M3D3M1I3M2D1M1D6M2D8M3D5M10D9M1D1M1D6M1D3M2I3M2I1M1D3M2D6M2D4M1I8M5I2M6I2M4I3M2I1M3I3M1D9M3I1M3I4M1D6M1D11M1I27M1D4M1D4M1D16M1D14M5I4M1D8M3I28M1D15M1D5M2D3M1D6M1D8M1D17M5D11M2D5M1D14M2D5M1I2M1I16M4D27M1D36M1D12M1D3M1D13M1I3M1D3M1D24M1D2M1D6M3I5M4I6M1I6M3D4M1I9M3I15M1D6M1D1M1D10M2D1M1D25M1D7M1D6M1D10M1D20M1I5M3D16M1D10M1D6M2D2M1D5M1D1M1D20M1D11M1I30M1D9M2D2M3D15M2D1M1I9M2D13M3D17M2D26M4I3M2I6M1I6M2I17M5I47M2I9M1I39M1D13M5D8M2I2M1D17M1I15M1D7M1D3M1D6M4D3M1D8M1D7M2D1M1I7M1I4M2D3M1I6M1I22M1I3M1D4M1D4M1I18M1D19M1D5M1D9M1I4M1I10M2D2M2D4M1I6M2D8M1I2M1D3M2I4M2I7M1D2M1I8M2I5M1D29M1I9M2D1M2D9M1D10M2D21M4D7M1I8M1D4M1D1M1D9M1I2M3D16M1D8M1I15M2I6M1D10M25S	*	0	0	GTTACACTATCACATCGTGTAACGGTACTTTCCTAATTATGCATGACTATCTCGACGGCCAGTGCCACTATTGACGACCTATCCGACGACGGTCCACCAATAACCCCGCCTCGCTACCTGTTGTAATTTAAACGCTGCGGCCGGCGCAGCCGAAGCCCGCGCGTATGAATGCGCTTCTATTCTCCTCTTCCGATCCCCGGTTAACTTTGATTCTGATGCGATTTGACGTGGCCTTTCAGCCGCTTTCCTTACGTTCCGTACCTTTGTCTCACGGGCAACATGTGACGCCGACTGCGATATCGCGGATGAAGCAACGCGGTCAATGGGATGCAGCAGCCAGGCACCGCCGTTTTGCTGATACGGCTGAGTTCAACGCTCGGCAGGCGCCTTGATGACCTCGAGGACCGGTCGCGCGGAAGCGGTAGACGGCAGGCGGTACGCGTTAGAGCACGCCAGAGATGACAACTTCCATCATCCGGGGGAGAAAACCCGATCTACCCCACAAACATTTTCCCCGATCATTCACAGCTTCCACGCCGCAGCTTGCCGCACCTCATCAGTTCAGACAAACAGGGACGGGCTGCTATTCAACGGCACGCCTATGTCATGGCATAGCTCATGATGATATTTCAAAAGATTACGCTCTATAGATCTCGCTCGCTGACTGCTCCGCGTACCTGAATGGCTGACGTTCCCATCGTACCCGCGGTACTCGTTTCATCGGCGCGGCAATGGCAGCATCGAACAGTATCGAAATCATAAGCGCCTCCCGTTATTGCCCGGATTCTGGCCAGGCCGCTCGCTCTGTCATTTCGGCTGTAAGGGGCAGAGACGAAACGCCGTCACGGGCAGCACAAATGCCACAGGTTTGATAACCCCGTGGCGTGAGTGCATCAGTATGCAGCTTCACCAGTGCCGCCACGACCGTGACCAGGTCAACGTATCCAGAATCACGGTATCCGGATGCGCTGATCCCACCTCATTTTCATGTTGAGCAACCTCCGAGGGGAGTGGGCGGAAGCGATTTCACTCGTGTCGACCACACTCTTTTCAGGTGCCACGGAGTGGGTCTCTTCTTTCTGTCCCGTCAGGCTGACATCACGTTCGTTGTTCACCAGCGAGCGGAGACGGGCAAGTAGTTCATCTTCGTCACTGGGACTCCGGATCAAAGCCCCGACGGCTTGATTACGGTTGTGACTAACACGAACTCATGATAAGGCCAGCAGCATCCAATCAGGCGCTGACTGCACGGCGTAAATGGATCTAGCCGGATCGCCGGTGTACCAGAGTTTTTCTGTCAAACGGGCAGAGGCGTTAATGCCCTGTGTGTGCGTCGCATCCTGAATGCAGCCAGGCCTTAAGGACCCCGTCTGAGTTCCCCAGGCACCATCGGTTGTTCGGCAGGAAGTTCTTTGACGCCGTTTTCCACGTACTGTTCAGAAGATACACGACGATAGCGATCTGATACATTCTATAGGACCGCTTTGCCCAGGTTCACCGCCGTCTCCAGCTCGAATTAGAGCCACGACGGGTATCCAGCTTTCTCCTTGACGGCTTTGAAGGAACGGAACAGCTACTAATATTTCAATCGAACACCGTCAGAAGGAGTCCGGATGCAGCTTCTCCTTGAGTGGTATAACGTGGACTTGTCACGCTGCCTCACTCCGTGCCGCCGGACTGCGTCATTATTCTCCTCTACATGCGGCCCATACTCACCTCAAACCGACTCGAAGGCTTCACCGGTCATGGTGTATTTGCTGATTAACGGGCAGAACTGCCTGCATCTCTTCGACCTGAGCAATAGGGTCGTTACGCATGTTCTGCATGATGATGCGACGGCGGCGTAAGCCGCCAGTCGCCAGATTGATTCTGCGGATCCGGCCGGCAGGGAGAATCGGTATTGCGGATTCATTCATGCTTCGGATCGACATATCCCGTAAATTCAGTGAGGGGAGCCGCCACGGGAACGGATAACCTCACCGGAAACATCGGCGAACGTACAGCGCCATGTTTACCAGTACCCGGAATTTGTGAGAGATAGACTTTCTCGTGGTGAAGGATAGCTGGACGGAAGGAAGAGACGCAGAAACATAGATCAAACTTAAATTTGCTTAATTGCCGCCAGGTTTGGGCTCGCGGTTTGTGTACACGAGACTCCTCGTAAAATTGGACTAGCCGCGAGGAAGCGGTAAACCATAAACGCGAGGATCGCCTGATGCCGTTCGGCAAACGAAGTTCCTATCGTTTTTCTGTTCGTGTCGTCGGCAGCCTCCGGCAGAGCACATCCTCATAACTAGAACGTGCCCGACTTGTGATAAACGTAGTCATGTGCTGGTCTCGTGGGAGCATGACCGCAAGAATTCCAACGGCATAAGGGTCGGTGGTGCCATCCCACGCAACCAGCTTGACGGCTGAGGTCCAGCACAGCGTCGTCATTGCAGGCGCTTTGCACTGATCCGCCGGCGCGGTTGCGGGTATGAGCCGGGTCACTGTTGCCTGCGGCTGGTAATGGTAAAGGTTTCTTTGCCGTCATAAACATCCCTTAAGACTGTGTGTTCAGCAAATCGTTAACGGGCATCAATCGTATTACCTGCAGCCAGGGTGCCGCTGCCCCATGCATCGACGTCAGAGCGGATGTCACTGCGCCTGTGCATACTCTGTGGTGCTGCGGGCAGAATGCGGCGTTCCATCCGTCGACTCGGCATTCTGCCCAACGCGTGCCTGTTCTTCGCGTCGAGCCTCCTCAAGTTGAGGATTCTACCATCGGCTGCTTCTGCCAGGAAGCGCTGCGGTGATCTGCTGAGGGCATTCCGGCTGCGCCGCTGGCGTTCGCCCTCCGTCGCTGGCACTAAAGTCAGCCTGCGAAGTTGAGGATGAGTGAAAGAGAGGAAGAGTGATGGCATCTCTTTGGTCATTCACCTCCCTGAGAGACGGGATTACGTGCATCCAGTGCATCACGCATGACGGTGATCGCATCGCTGCTGTTAAAGTTCATCAGCCAGTCATGGCATCATGGCCTCCTGACGCTTAGACCCTGCAGCTCGGTATCGAGCACAACCTGCACGGACAGGGCCGGTATGCCGACGTCTGTGCAACACCTGATGCGTCATTCAATGCATGTCTCCGGACGTCATCGAAGATGGCTTAGCGATGCGGTCGGCCTGCTTCTCTCGTACATTAGTACGTGATTTCCACCCTGTATTCTCAGGCAGCACCGTAATTACTGTGAGCCATCATGACGCCGATGGAGCCTGTCCGGGCTTGGGTGACCAGACGCCGCGGGAGGAGGGGACTGGCAAGCAACTGACCTGCACTGTACCGATGTCGTTGGCGAAGCGCCCATACCGATTTATGTCACGAACGCACACGGCGATGATGTCAGCGGCAGTCAAATGCCCCCGCCACCATCCCGCCGGCGTGTCCATATCGAGCAGAATGCCGTTAATAAGATCGATCGAACCGCTGTGCAGCCTGGAAGCGATAATGCCGTTGTAACCGGTTGCCTGACCGAGCTCCTGCAGCAGCCCGCGTAGTCCGGCTGACCAGCGTGCGGACCTGCGGAAGGACGGAGCGTCCAAGCGGAGAAGACTGCGGCTTGTCGTGTTGTCCGTTCATCGGGCCAGCACTTCCGGGGCGTCGCGGTGCCTCCCTCGCAGTCAGGCTGTCGCCGGACACCGCATCCGTCAGAGGCTGCTGCTGATCCCCAAGCTGATGCAAGGCACAAAGAGACCCGCATAGGCGGGTTCAATAGACCAGGCTCATTAAAGGCCGGGCGGCAATATGCGGATTACATATGCTACTTCCTCTCTCTTCTAGCTGTTGATGTCTACAGGGGCGCAGCCCGGATTCAAATGCTGCAGCCGCCAGGCGGGCGGTTTAAGACGGCTGCACGGCGGCTCGATCGGCCGGACCGACTTGATGGGCAAAGCCTTCTACGTAGGTACCGCGTTTTGCCACTCTTCGTAGGTACTCAGTCATGGCTTCTATCAGCTCACGGTTTCCTTTTGACTTTCTTTCAGACCATCATCATCGACCACGAAGCCTATTCACGGTCGCAGTTCCCCCAGGCACCGACCGTTCGGCTCCGGCACGGATTTGAGCTGACGTAAATAGAGGATCGCGGACGCTCCTCTTCCATAGCAGAAACATCTGGCTTCATGGACTGGATGCGAGACTGAATTTTCGCCCCATAAAGTGACGCCCACGATCGTTCGCACTGATGTCCGTTGATGGGCATTCCGGAAATGGGAAGTACGAGACACCCAGCCCGGCAGCGATACCGCAGCAGTGACTGCTCAAACACGGGTAGCGTTATCCGTATCCTGAGCGTCTTGCAGGGATTCAGGTGAGTACCGGCATCAGCTGCGTACTTTGCCGCCTCCTCCAGCCCCGGACCCTAGGCGCCGCGGCGTAATACGGGCACTTCACCACAATCCAGCTCAGGTCAGCCTTCCCGCTGCCCTCCTTAGGGACTGTTCGCGCTGACGACAATCGCTCCGGTGAACTGCGTATCCAGCTCACTCAATGGCGGGATAATCGCCTTCATCACAATGGCGGCTCTGCGATCTGCGTGTTCTGCACCGTAGAGCAACCTTCATCTGCTGGCCATCACCCTTAAAAGACCGCCATTTGCGCGCGGTATCTGCCGTCCTCCTCAAGGGTTCAAAAACGTGAATGAACGAGGCGCGCCCGCCGGGTAACTCACGGGGTAATGTACAGGTCCGGTTTCTGCGGCATCCAGCCAGGATACCCGTCCCTATGACGTAATATCCCAGCCGCCGGACCGCTGTCGGTATTAATCTGCACAAGGGACGACGGCACTAGTCGCGATCGAGGGAGCTCTATCGAGGGATGCTTCGGGCTGACCATCGAACTGTGTCCCCTGAAAGCCTAGACGAACTGGTATCCCCATAGCTGAACGAACAGTCACGTTAAAGGCGCAGTGCATACGCCTTCCCGAATCATCATGGTAAACGGTGCGTTTCGGGGCTCGGTCAAAGGTAATGCTGCAGCAGCAGTTCATCCTCGGCAAACATTCGCCCTTCCATGCCGCTTCACCGCGGGAAAAGGACGGGGCGTCTTCTTCCTCCCCGATGCCCAGATAGCGCCAGCTTGGGCGATGACTGAGCCGGAAAAGACCGACGATATGATCCTGATGCAGAGGCTGGATGGCGTTGGCGCATGCATCGTTATTGCGTACCATCCTTCTGCGGATTCCACTCGGTAAAGTTGGGCAACAGGGCTGCAAGGATTTTCACTCGGTGGGTTCGACCGAAGCGCGCAACTGCCCCCTCAAATCCGCTGCCACCCGCTTCATCAGACCGGCATATTCCGGGACCGATTGATGCCGTCATCCGCGAGGGAAGCGGGAATTAGCGCGAGGTCGCCATACAAATGCAGTTCTCGCGTCCCTGTGTCATGCCGGTCTGCACTTCATATGCAATATATTTTTCAGGTCAAATCGACGAGGCCGTAAACTCCACCCTTCATTCAGCTTTCTGTGACTGTTGCCACCCGTTTACCTGTCATCATGATGCAGTCCGCCGGACGGGCAGCAAGTTCTTCCTGTCGCGTCATTCATCCTCTCCGGATAAGGCACGGCGTAATCTGCCAGTATTTCTTGTCTGGTTGCTGCACCATCCTCTTCCTGCACAAGGCTCGCCAGCAGCGCACTGAGATCTTTCCAGGCTTGCGAGGCAAGGAGCTCTGATGCGGATCGCCGCCAGCGCATAACGAAGGATAGAGTGCCTCATTGCGTCGCTTTTTGCTGTCCCACAGTATTTTTCCTTCATCACCCGATTTTCGACCTGCCTTCAGCACAGTCAGCTGCTGCTCGCTTCGTCAGATCAAAATATCCGGGTATTCGTGACAGTGAACGGCAAGCGGAAGCGGTTCATCCCCTTCAGGGCGTCGTCAGTGAAGCGGTTATAAATCTGGTTTACCCCTTAGTACTTACGTGACCGCGTACGTAAACAACCCCGTTTTGTTTCGCTTAATCGAGTGCATCCTACCGGCTTTCCGGACGGCACCCCGATCCGGTTACACTAGGAACAGGGAGCGAGTCCTAGAGCGTTCATACACAATGGTCGGGTACAATCCCGCCAGTTCAGCAAGATACGGGGATATCGACATTTCGCACCATTCGGTCGAGTTCATCGGTAGCCATTACTTGACTCATCGGCGGCGCGTCTTCGGGTGGCGAGTCACGCTCTCGTGGTCAAATTTACGTAGCCCTCCTACCAGCCCCATCCCCATACGCACTTCGGGTCAGTCGGGAGTCGATACCGGGTTCAAGCCAACGGTCAGGAACGGCGCTGAATAATGCTCTTCCGCTCTGCCATCACTTCATAATGGACGTTCGCCAATTTTTCCCCACGTCTCACCGAGCGTGGTGTTTACGAAGGTTTACGTTTCCCGTATCCCCTTTCGTTTTCATCCAGTCTTTGACAATCTTAAGAGCTGGTGAACGGGCTGTACGCTGTCCAGATGTGAAAGGTACAATGTCAGGGCTCAATCTTCTACCGGATGACGAAAACCAGAGAATGCCACCGTCACCAGATCCCGGTCTTCGCAGATAACGGGCATCAGTAAAGTCCAGCTCCTTGCTGGCGGATGACGCAGGCATTATCGCAGAGATAAAACACGCTGGAGGCGAGAGTCGATTATCGAAAGCGTTACTTCTGCGATCCAGCTTCCCTGCATGCCCGATTGACGAACATGAACGCCACGAAATTGCGGGCGGAGAGCGGCAAGGACTTGGATTCCTGGCTGCAACGCTGATCTACTGACAGTGCCTCTCTCATTTACCGTGGAGCCACGGATGGACTTTGAGACGAGCTTCAATACGCTTGATCAGAGGAACGTCGGCAACAAAAGCTTCCTGTTCATCAATATCATCATCAAAAGCAGCAAGTTGTGATAACCTCACATCACCGACTTTCACGGTAGTTTTTCGCTTTACCGCCGAGGCAGAAGCCACGGGTCATGAACGCTTCATGGCGTATGTAGAGCCGTGCTTTTGCCAACGGGGCCAGCGCCAGCAGCGACGGAAGTCACGAATAGTCGGCTCAACGTGGGATTTCATAAATTTGGGGCATCACATCGTCGGCAACCAGAATAAGGGGTGCCTTGCTTATGCTCTATAAATAGCATAACATATACCGGATCTGAAGACGGTTTGACTGTACTGCCACCCATGCGCTCTTCTACGCGTCACCCCCTATGTAGTCGCTGCCATCGCATTCATGATGGCCCTATGAAATTAATGTTCCCCAGCGCCTTCCTGGTATCCGGATTCTTTTCGGAGATAGTAATTAGCACCTCAGATTCAACGGCTTTATGGTCGAGAAGAGGAGGCGGGAAGCAGGCGCGAACAAAATGCCGCAGCCTGTTAACCTGACTGTTCGATATATTCACTGAGCAACCCCGGTAAGGTTCATCCAGCGGCTGCTTTGTTCATGGCTTTGATGATATCCCGCTTCAGGAAATCAACATGTTGTATTCTTCATTCCGGCGTCCGGAAAACGCCGGATGCAAGGAACTAGGAGCCGTCGAGAATACTGATTTCACCTGCGATTCCAGACAGCAACGAGGAATGACGAATTGCTCATTCCACCACTTCAGCGGAGTCTGGCATTCTTCAGTTCCTGTGCGTCGGCACGCGTAAGTCGATGGCGTTCGTACTGCACTCCTTCTATGGCTTAGCGATCTCCTCCCCCTCCTGCCGCTTTCTTCCTCTCTCGGCCTCATTTCTAGTTCTCAATTTCAGCATCCCTTCGGCAGCCATTTATGACGGCGGCAGAGTGATAAAGCTCTCATTACCTTGCCACCGCTCGCAGAACGGCATTCCCTTGTTCCTGCCGTTGAATTTTCAGACTCAATATCTACAACCCGACGAAATGTCAGCCCATAGATGCGCTTTTGTTGACTTCCATTGTTCATTCGACGGACAAAACAGGAAGCGAAAGAAGTAGAAATTCGTTCTACTGACCTGTCGTTTCCTTCGGCGCCGGTATTTTAAATAAAACATTACAGTGACGAAGAAGAACGGAACGCCTTAAACCGGAAAATTTTCATAAATAGGCAAACCCGCGTGACGCCGATCCTCGCCACCCAGG	*	tp:A:P	cm:i:107	s1:i:1023	s2:i:0	NM:i:1882	ms:i:3624	AS:i:3624	nn:i:0
+80	0	utg000001l	22800	60	24S4M1I6M1D6M1D2M1D9M2I1M4D6M1D4M1D5M4D8M1I814M7D14M1I5M5D1M1D2M1I3M1D3M2D2M2D3M2I11M1D23M4D3M1I1M1I4M2D5M1D1M2I7M2I4M1I3M1I7M2I6M2I1M3I2M1I2M1I3M4I1M1I4M3I1M1I3M3I12M4D13M1D12M3D7M4D10M1I9M1I9M1I4M1I9M1I3M2I6M1I1M2D4M1D43M1D3M1D8M1I1M2I8M3I3M2I6M4D4M1I1M2I4M1D5M1I4M1D7M2I3M1I10M1I2M1I1M1I12M3I2M1I7M1I5M1D61M1D9M2D5M1D18M1D6M2I21M1I2M1I26M1D16M4D12M2D7M1I4M2I2M4D8M1I13M3D10M2I5M1I3M1D2M1I9M1I8M2I5M1I18M1I6M2I2M6I5M2D1M1I2M1D14M1D13M1D8M6D4M2I5M3D5M1D5M2D18M3D16M3D3M1I11M3D3M6I1M1I9M3I2M1D1M2I19M2I1M1I14M2I4M1D6M2D2M1I14M7I9M2D7M4I4M1D3M4D5M2D8M1I7M1I11M1I2M2I4M1D10M1D5M1D4M1D4M3D4M2I4M1D3M1D3M2D3M1I13M3D4M2I10M1D9M1D14M1I6M1D1M1D7M1I3M1I3M2I6M2I3M1D3M1D10M7D5M1I1M3I9M2I3M1I1M1I10M2I1M4I7M1I9M2D10M4I12M10D4M2D10M1I4M1I7M2I10M2D2M2D10M1D11M2I4M1I5M1I4M3D9M4I8M1D3M1D21M3I14M1D14M1D2M1D3M2D3M1D9M1I10M1I4M1D15M2D6M1D22M1D6M2D3M1D5M2D13M5I19M1D5M3D10M4D25M1D1M1D6M1D1M1D5M1I4M2I8M1D5M1D7M1D9M1D4M1D1M1D8M1D20M2I4M2D2M2I3M2D3M3D6M1I22M9D5M1D2M4I8M1D10M2D15M1D9M2I7M1I3M1I6M2D5M3D11M9I6M1I11M2I8M2D14M3D2M1D3M1D11M1I13M1I5M6D10M1I2M1I9M2D5M2I3M3D11M3D8M1D5M1I11M1I2M1I3M4D4M1I5M2D5M2I1M1I12M1I3M1I2M1I4M2I5M1I3M1I9M1I3M2I3M2D12M1D13M1I2M3D21M1I7M4D5M1D28M4I1M1I2M1D18M1I9M1I6M3D15M2I7M2D1M1I2M1I2M1I5M3D5M2I2M3D3M1D4M2D5M5D1M4D24M1I3M3D13M1D15M4I7M6D4M1D1M1D3M1I5M1I2M1D3M1I2M1D5M1I6M1I7M2D1M2D8M4D12M3D4M2D6M1D5M1D17M1D21M2D5M1D4M1D4M1I29M2I9M1D7M3D5M3D1M2D15M4I12M1D1M1D2M1D3M2D1M2D7M5I10M7D2M1I15M3I5M2D5M1I5M2D6M1I1M2I9M1D6M2D9M2I6M4D7M2I4M2I2M1D1M2D6M4I3M1I6M1I12M1I2M2D5M1D2M1I13M3D1M1I26M3I2M1D12M1D3M1I3M5I7M2D3M3D4M2D19M1D9M3D3M1D1M1D2M1I4M2I2M1D7M1D6M4I4M1I16M1I8M1D6M1D4M1I2M2D1M3D4M2D5M6D5M1I7M1D15M1D8M2D9M5D2M1D3M2I5M1D15M2D2M2D6M3D1M1D10M2I6M6I3M1D8M2I3M1I7M2D2M1D3M2D8M4D7M2D3M4D1M2D1M1D5M2D3M1I11M6I3M2I5M2D3M1D4M1D15M1I1M4D4M3D8M1D1M1D8M5D26M1D6M1I8M1D6M1I26M1I2M1D6M3I18M1I2M1I3M3I3M1D8M2D2M1D5M3I13M1I9M1D5M5I7M4I14M2D4M2D4M2D6M5D2M1I13M7D3M1D1M2D2M1D2M1D2M1D9M1D3M2I8M3I5M6I3M1I6M2D7M1D8M3I3M1I5M1I8M1D6M1D17M1D2M3I3M1D6M2I11M1I9M2I14M1D9M1D6M1I21M1D3M1D17M1I3M1D4M5D17M1D3M2I1M1D11M1D8M1I13M2D2M1D8M3I5M1D1M4D9M1I3M1I6M2I8M3I20M4I2M3I30M4D2M2I5M1I12M1D13M3D7M1D6M1I11M6D19M1I7M1I11M2D2M4D10M1D3M2D6M3D23M1D4M1I3M2D4M1D4M1D6M4D13M3D7M2D9M4I7M1I3M2D3M2D1M3D7M2I4M1D4M6D1M1D10M2D2M1I8M2D6M4D5M3D9M5D8M4I8M4D22M2I2M1I16M1I26M4I4M2D2M2I3M1I2M2D13M3D1M1D2M4D25M2D10M1D9M1D18M1D2M1I5M1D3M4D2M2D2M3D6M2D2M1I5M1D4M3D4M2D5M1I5M1I1M1I3M3I4M1I1M1I6M1I4M2D3M6I2M6I3M1I5M3I4M5I5M3D9M1D3M1D11M1D7M2D9M5D13M6D2M1D10M1I5M1D7M2I1M1I10M1D1M2D16M1I20M6D1M1D15M3D6M2I11M1I2M3D9M3I7M3I1M2I12M1I10M1I2M2D4M3D5M2D2M3D16M3I1M1D10M5I5M1I2M1D12M2I3M6D1M1D3M1D12M1D12M3I3M1I11M1D1M1D2M5D3M1I5M1D2M1D3M1I3M1I1M5D3M1I5M1D5M1D2M2I3M1D25M2D4M1D4M1D5M1D4M3D14M2I1M1D4M1D3M1D18M1D4M1I4M2D10M1I5M3I1M3I3M1D13M1I2M4I11M3D5M1D2M2D6M3D6M3D4M1I7M1I9M1I14M2D7M2I3M1I5M1D8M4D3M1D19M2D14M1I14M2D22M1I4M2D5M2D3M2I5M2D3M7I3M2I4M2D11M2D34M1D7M1I37M2I5M2I4M1D4M1I2M1D7M5D4M1I3M2I8M1D3M1D8M1I4M1D2M1I9M2I9M1I6M2D1M2D2M1D9M1D5M2D6M2I3M1D11M2D6M1I4M3I14M6I7M1D2M1D14M1I8M2D4M2I2M1D4M2D3M2I1M1I3M1I4M1D3M4D15M3I6M3I6M1D3M1D11M1I2M3D10M2D17M2I5M1D16M9D4M3D6M3I12M2D11M2D2M3D6M4D10M1D2M4D5M2D11M1I10M5D21M4I18M8D3M3D1M3D7M1D16M2I3M3I6M4I1M1D3M3I11M8I3M1I9M2D6M3D1M3D9M2I6M1I7M3D5M1I14M1I2M2I7M2D20M2D4M1D4M1I5M1I4M1I2M2D2M1D9M2D7M1I10M3D7M4I4M1I15M4D1M2D6M4D3M1D14M2D2M1D4M1D5M1D3M3I7M1D8M1D5M2D18M1D8M3D11M2I2M1I7M3D6M1I4M3D7M5D1M1D3M1D11M1I3M6I3M1D2M2I5M1I3M1I3M4D4M1D10M1D8M7D20M1I16M3I12M1D23M1D12M2D14M2D1M2D4M2D27M1D1M3I3M1D7M1I3M1I3M2I6M2D13M2D1M1D6M6D4M3I14M1I1M2D12M1I3M2D5M2D1M1D2M1D3M7D4M2D14M2D4M1D6M2I3M1I10M2D10M1I6M2I13M2I10M1D3M2D9M2D2M3D18M1D6M1D5M1I11M3D13M1I5M3D7M1D6M1D1M2I11M1D13M1D1M1D16M1I2M1I2M1I4M2D3M5I2M1I9M1D4M1D4M1I4M5D5M3D11M1D7M2I10M1I2M1I3M6D15M3D15M1I9M1D5M2D7M1I9M1I3M1D5M4D9M2D3M1D4M4D5M1D5M1I1M1I5M1D8M1I14M1I2M3I7M10I4M7I3M2D4M1I15M4D4M1D8M2D1M1D18M6D2M1D4M4I11M4D12M2D37M2I2M1D3M3D3M1D14M1D13M1I6M1I14M4D10M2I5M2D2M2D11M1D4M4D1M3D4M5D9M2D5M1I7M1I5M2I3M1D6M3D10M4D5M7D4M3D3M2D10M2D6M4I6M1D9M1D6M1I4M1D7M3D2M2I2M1I4M1D3M1D11M3I16M2D6M3D2M1D7M1D6M1I5M4D4M2I16M3D8M2D2M1I11M1D4M1D2M1I1M1I2M2D7M2D9M1I3M1I5M2D2M2D32M3I2M2I4M5D2M2D2M1D5M2I5M3D5M2I11M1D4M1D3M3I2M1I8M3D14M1D1M1D18M10I6M1D11M1I4M1D2M1D8M2D4M1D4M2D2M1I7M3D1M1D11M1I1M1I3M2I3M1D5M1I2M3D1M2D3M1I4M2I2M1I5M1I8M1I6M2I3M1D3M1D1M1D7M5D1M1D1M1D8M4D1M2D14M1I6M2I9M1I14M1I3M2D2M2D1M2D3M1D1M1D6M3D21M4D7M2D7M2D2M1D8M1D4M1D1M1D5M3I17M4D7M2D14M4D5M4I6M5D12M1I4M1D11M3D11M1D8M1D3M2D6M1D2M2D17M3D4M3D1M1D4M1D6M1D9M1I3M2D19M4D6M1D2M2D4M2D10M1I3M1D1M1D2M2D5M3D10M4D9M2D32M1D1M2I4M1D5M1D2M2D6M1I3M2I1M1I1M4I3M3I5M3I1M1D13M2D14M1I22M9D19M1I1M2D7M2D23M1D3M2D35M1D23M2D4M1I7M1D12M1I3M1I15M3I9M3D4M1D8M4D1M1D8M1D9M1I4M1I6M1I4M1I9M1D7M4D5M1D5M4D14M1D8M2D2M3I2M1I26M1D13M1D2M3D2M2D10M2D13M5D6M1I5M1I5M2I2M1I2M3I9M2I16M1I1M1I16M1I10M2D5M7I15M1D3M1I8M1D7M1D9M7D9M11D9M4D5M1I2M2D8M2I11M1I4M2D3M1D7M1D6M4D3M2I2M3I9M4D3M1D4M1I19M11I13M1I7M2I12M2D4M1D2M1D7M1I8M1D8M1D3M3I10M1I9M3I2M1D7M1I7M4D1M1D1M1D25M2I8M2I8M1D3M1I15M2I2M1D16M3D9M1D2M1D7M1D19M4I10M2D12M1I6M1I15M1I36M2D17M1I5M2D4M2D5M3D5M1D3M2I7M2D7M2I21M1D5M13S	*	0	0	CCGTATTCTGCTTGGTTATGACCTTGATGGCAGATAATGTTAGGATAATTTCGGATCACTTCCCATTTTGGCAGAAGACACAATATAGAATATTAAGCTGGACAGAGTCGATTATTACACCCGCCTTACGCTACACCCTATCGTACATCTAAAGGTTAATTAGAAAATTTATGAAATAATACTCCCAAAACACTAGCTAAACATATTACATCATGCTTGTTCATCAGGTAAATGTCATTTGGTATAGACAAAATAGATCATTTTCTTCCTATTGCACATTATCCTGAAATTTTCGGTAATGGGTTTAAGGTTCATCGTGCCGGACTGAAAATCGGCTAAACCGTCACCGGCCTGAGATAAGCGATCATTCATGACAATAAAGTTTTTCGTGAGTAATGGCTAATTTCGTTTCCAACTCTATCAGTTTTATGTTGAATGCCCGGCGAATGGAGGCAGAGACAAACACAGCTCTTCATCATTTCAAGCTGTAAAATATTAGGTAAAGGTATCGTTTGCGAGGCAGGGAACCAAATCAATGAATGACCGACGAAACTATTTTAAATTACTAAGGAAACACTTCCTCGTAAAGAGCGTTCAATGCAAAAGCCGATTACAGAATTTATTTATTGAAGCAAATCTGAAACCTATTATAGATTTGAAGTACTTCCCCAATTATTGGAAATTATGTATGCGTGAAGCCGAACCATTTTTCCAGTAAGGGGATAACCATAGAAGTATCATAAAGTGACTAGAATGAACGAATATTTATATGAGGAGGCTGTTTTACAAATCCTTAGTACTTGCTAACCAATCCTAGGCAGTCATTGGCAAGCGCATCGCAGTAGAGAAGGACGTTACCGTAATGTCCCAACCAGCAGTCTCTAAAGTGGAGTCAGTCATAGATGGTCCTGTATTAGCAAACTCTAAATTTGTAACACGGGCGCAACTTAAATCATGCAACAGCCGAGTGGGAATACCACTTCAGCCGCATAACGATTCTCACGACGGCCGTCCTGCAGCGGGTCCAGCGTACCATCTCCTATGAGCGACTTGTTAGCAGCTAAGCCAAGCCATTTATACATAATGAAGTAATAATAAATTTCCTGTGTAACTAATTTACTATGGTTTCTCTGTAAGAATACCTCGTGCAAAGTAAACACTTGTATTACATTGACAGTTAAGCAGTTAATTTACCTCTAAAATATATCAGCATCTAGCATGCAACGCCGGCCTGAATGTTTACTAAAACGACCCAGGAAGAGACTTAAGAAGATTTATCGCACTTGCTCAAATGCTGCATTAGATATCCTATTTGACCCTGAATTATTTCGCTTACATTTGAATCATTCCCCAACCCTAAGAACAGTGACATTTATTATTCAAACAAAACCATTAGGATATGACATTTGGTATTAACAAGCTGTTATCCAAACCGGAAAATGAATGCGCTTAATGAGTCGGCTAAATTCTAGGATACGATAGAAAACAAGGATTTAGAAACCAGCGACGAGGGACTTATGTTCACTGTAAGTCGAAGATGACATTGAGATTTATTACAATGAAAATATGTTAAACATTGGTATAAAAGTTAGTCAGACTTGGACGGAAATTACTTCATACTTTACTGACGATGAGTAGTGGATCAGAAGACGATGGGTCCTAATACGACAGATTACGAATTACTGCGTGATAATGGCTGGCAGACTTAACTGCTGTAACTCTCTTAAGACAAATAAACAAGCGGATTAGATGACTATCTAGTACTTTCGCCAACATCATTCGACGACTCTTTATTTGATGAAACGCCAGAATAATATTTAAAATTAAAGATTATCCTCCATAAGCAATGTCATTTAAGCCACAACTAAAGATAAAACAGATTCCTGAAAGATATTAAAGGAGCGTCTAAACTGTAGACAGCCGACATATCACTTCGACAGACCAGTGGATTACAGCAAGGTCCAACGGTACTTTAAAGCACGGTTATCACATTCAAACATTAGATTTATAAACAATTCCATCCAATTGATTTAACATCAATACAACATTTGAAGATCACCCAATATATTTTATGCAGAATCCGAGGACAGGTATCACCCAAAGACAAATGCCTGGCTTCATTTGGGTTGGCTATGAGAAAAGAGCATCTACTCCAATAAACCAATACAATGCCATTATAGATGAAAGACTTCAGGTAAATCCGGAAGTTGATGTCAAATAATCAAAAGCTTGTATTTCCGGAAATAGTTAGAGAAACGAAGATACAAGAAGCTTTAGAAACACCCAAATAAGATCAACGACCCAACCATATTTCATGCGTTGCAGTTAAAGGCATTGGCCGTAAACACTGAACAATTGAGTCATAGAAATTCCATGTCTCTCCGACCATAATAATCGCCAACAAATAAACCAATACTCAGGTTACCTAAACTAACCGAACGTTATTTCATAAGACGTTGCGGGCATACCAAACGATTACTCTCCATAAATAGAAGCAGGCCTCAACATCAGGTGCAGTTGATGTATCACGTCAGCAAGCCCGATATTCTTCCCAGTTCCAACGAGGTTTCTTCCTTCTGTCCGATTCCATCCGACTCTAACGAGCATATGCTCACTCTACCTGCATCAGGCTTTTGTTTCTTCCCTCCCGGATGCCGGACTTTTTGCTCCTTTAATCATTCTAGCCCCAGGCTGTGCCGTTCCTATTTCTGATATTCCCTCCCGGGGATACCAGTAAAGTTCCGGTAACGACTGAGAGTTCAGAACAACGCGTAGCGCCGAAGCCATCAGGTCACGTTACCCCGATGTTCACGAGTGCCATTAATAATTCTTGCAGCCGAACAGGCCACAAGCCGGACGCCGGAATATCTGGCGAGTCGTGAATGAGTAGTGCAGAGGCAGACTAGGGTATGAGGCAAATATGCGTCACCTTCACAATAATGCTTAGTTCCGGCCGATTATAAATTTGGTCTATAGCCGCTTCGCAGAATGCCTGCAGCCTCACAAGTATAGATTAATGCAATGTTTTGACGGTGTTTGCCTAGTCCGCAGCGTTAACGGTATCTTGTCTAGTCGATAACAAGGAAACTGAGGCCGAGCGGTACTGATATCGAGCACCAATACCAACTGTATCGCATGTGCACACCAGCGACGCCGGGGCCGTATAAACAATGAGGACTCGTGGCATGCTGTACGTCCGTTTCCATACTAAGCCCTGTGCTGTTTCCTTTAACTGTAAATTCCTGACTGGTGCTGTTCCATACTGACCCAGCCAGAACTGTTCATCCTAACCATTGTGGCAGTGAGCACCGCGGCCCCCTGTTGAACGAACAGCCAGACTGTGGCTAAGGCTCCGATCCTTTACTTTGGTTTAAGTCGTAATCGAAATGCTGGTCCGTCCTTGCTCCGTAAACGATGTATTTCTTCTACAAATCCGTACCACCCTTATCACTGGCACTGTGGGTGTGCGACTGCTTCCATGCTATTCCTGAGACAACCACCCTAACCGACTTTTGCTAGTGGGTTGCCTCCACGCGCATATCAGGAAGCACCCATGGGATACGCGACAGGTTTGGGGCTTCTAAATCGTAGAACGCCTCTCGCAGCCCATCTAGGATACGCTAAATCAGAGGGCGATGTCACGACCCCGGAAGCTTCGCTATTAAGGCATTTACGATAGATCAATCAGAATTCTGCGTCAAACGCGATTTTCCCAGAAAGACTCCCTGCCATTTGGTCAGATTGGGATAGGCATCCGACAGCCCGTCGGTACACGTCTTCGCTTGTTGACCGCGCCATTCAGTACGGGTCTAGCAATCGCCTTATACGTCCCGGCGCGGCTAAATTTGGGTCCACCGTATTCCGTACGGGTCCACTCCCGTTGCTATAGTGAATCGAGCCGTAACGACGCGGTGTCCCAGAATGGTCCCCCTGGAGGCTTCCTGTTGGCGTCCGGTTGCTGTTGTACCGATATTTCCGTCTACGTCCGTTTTCTGTTCGTTTCATCCATTACCATGACCGCCTTTGGCGTGCAGCAAGCGTTTCAGACGTGCTGTTGGTGCACTGAGCCTGGCACTATCCCCTTTCTCGTTGTCCGCATCGCCAAGCGCGACATGAAGGCCTATATCTTCTGCACGTTTTGCCGAATTTGCAATTTACGTATTTATCGACGCCGCTTCTGCCGCATTTGGTGCGATGTAGACCGCACTTCCCCGACTCTTCCCTTCCTCGTACAGCGTTGACGCATCACTCCCGCCGCCTGTGTTTTGCGTGCCCGGCAGGAGTGGCTCCCGTTCCGCTCCTGTTCAGAGCTCTGGCATTCGTCTCGACGGACGTTTTGCCGCCCTGGCAGAATTTTCTGCCGTTGCATTGCCGAGGAAGCTCAACGACGGCACTTGATGATGCGTTCGTTTCTGATGATTTGCTGCTCTTTGTCCGACGCGCATCTCGTGCTGAAGCGGCCTCTGACGGCTTTCGTGGCCCGGTGAGGGAGTGGCAGACGGTGCTGATGGGATTGAGCGCAGCACACTGGTCTCCTGAAGCGGTCTGGTTTCGCCGGCACTGAAGCGCGTTTTGGGATCCGGCTCTGCACCTGCGGCGCTTTTCCGGTTCGCATCGTTGCCTCTGCCGGTCCACGAACCTTCCTGAGCTGACGATGCAGGCCTGTCCGGCACGTGCTGGCGGCGCGTGCATGAGTCAGGTTGCATCAGTCACCGCGACCTGGCATGATGCACTGGCATCGCAGGGCTGATTTCTTGCTGTCCCGTCTCTTGCCACGACGCGTTACGCGCCTCTTCCCATGAGTTCGACCAAGACGAACGGCATGCCTATCTAATCATTCCTATGGCACAGAAATGTAAGTGCCGTCCCGTGAATCTTCATACGATGGTCCCCGGCGTGCGATGGTGGAAACCGTCAACCTGCAGCAGAGTGACACTGTACTGACCTGTACTCCACATCGCTGCTGTAACGCCGCCGCGGCTTCGCTCTATGGATTTATAGCCATTTACCACCGTGGTGCTGTTACGTCTAGTTCAGCTGAAGGTGGAGTCTTGTACCGGTTTTCCGTGGCTGTCTTTCATCGACTGGACGAGTATTCTATCTAAATCACCGGTTCCTAGAGCACGGGCTCGATCAGAAGTGGGACCAACGGATGCTTCGAGCTAAATTATACGAATCTAAGTTATAGAGCCGAGCATGGATGCGTTAATCGCCGATCCTCAGCCTGCCTTCATAAGCAACAGGACTGACGCCTGCCGCTTAATTACTTATACCTGCATCACGCCACTGAGGTATATCCGCATTGCACTTTCTTCCTGGCAGTGCTTTCATAGGGCCTCCGATACCGTCCGTTATAATCCCTTACCGTAAGGCACTCATGTACCACTGACTAGGCTCAGCCACTCCGATGTACGCTCTGCTTACTGATTTGTAGGTAACCGGTCGGCCATCACCACAGCCAACGTCCACGCATAGGTGAAATATCCTCCCCGGTCATCACTGTGCCTCTGACTCTTTTAGACCGCGAGTGGAAGCACGGCCGCTCGTCACGTCACTCATACGTGGTCGCACGTTAATGCTTTCAGGCAACTCACCGTATCCCGCCGACGACGGCATGTACCCCAGTTCATTGAAATAGCCACCGTAAACGACTATTATCGCCGTGCACGCGTCCGCTCGTATAGTACTGTCACCGCAAGGTACGAGCGGCAAAGACACGGCATACATTAATCGTTCTCACCTGTTTATTAATAAACGCCCCGTTCCCGGACGAGCTGTAACACTCAGACCACGCTGATGCCCGCCTGTTCTTAATCACCAACCTGCACATCGCTGGCAACGTATAGGGCCGAATATCTGCCGAATGCCGTGTAACGTAAGCGTGAACGTCGTCAGAAACCCTACGTTTCCCCAGCCCTGGCGATTAACAATACGGGAGAAGACCTGTACCGCCTCGTTCGCCGGCCATCATAAATCACCGCACCGTTCATCAGTACTTTTGGAGATAACACATGAATACGTGTTGTGGACATCTAATCACGGTGATTCCGAAACGTCACTACGAAGGCAGGACGGTACCTGGCGTACCCAAAGTATTAGTCACGTGACCACAAACCCTAATAGTGACCGTGCTCCTCATCAGTCCACATCTGGCCGCACTCAGGAAGCCGCCTGCATGCTTTACAATGTCCCCGACTTTTCCCTCACTTATCCGTTTATCGTACAGTTTTCAGCTATGGTCTATACATTACAGCCGTTATCCGAGTTCGCATTGCACTGCATACATTAGTCGCATTTTATAAGTCCTTTCCGTCGTAGGTTAGAAAGAAGTCCGGGCCAGCCGCTGGTAATGGCCGTCAGGCTGCAGGAAGCGTCGTTCAGGTGAATAGTTGGGCCACAAACATCACCGTTCGGTCGCGTTTCACGGGTATTGGATAAATGCGATACGATTGTAGCATCTGCAATCTGCTTTCGTCCGTACCGGACCGTTAATAAAACTAGCCTGCTCCCTGTCTCCAGCCTAAGAGCATAATGTTCAGTCTGTGCTCAATTTATGACAGCCCACATGGCATTCCACTTATCACTGGCGCTCCTCTTCCACTTTCTGAAAACTCCTCCAGTGCTGGCGATTCTCTCTAAGTCCTTAATTTTCCCAGCTCCTTGCCCCGATGTACGCTTCTAAATCTGTTACTTTGCCTATCCGACTTCCCATGCTCCACCGACCTAGCCAACGAATGCCGATTTGCCAACGTTTACACTGCGGATAAAGTAATAATCATGGCCGGTTGGTTGATACTGGCTAGGTATCAGTATGCCGTAGACCATAACGCGTGGTTCAACCTGTCTTGTACCCCGGATGCCTGCTTGCCTTGTTTGACAGAACCCAAACTAGTACGTTAAACGTAATACGCGGTGAGTAGCGATTGGCAGAAGTCTAAGCCCGGCGTCACTCAATCCTCGTAGTCGCTGCCGGCAGCGGCAATCTAAACGATACCCCGACGCATCCACCCTGCTGCCCGCATTTACCGGACTTTAATTAAGCCTCTTAGGTTCCCCAGCGCCAGTTGCTTGAAGGCTGTAGTTTCCACGTCGTTTGAGCGTAGAACCACCGGTTCAACTCATAGCCTTACGACGTCGTTAAATTCACGGTGCGCACCTCGGCGCGAGAAGCCATAGTCACCACCGTCAGTCAGACGCTCTTAGCAGGTTGCGTATTGCGTCCTGCTGCACATGGAGCGTGACACCATTCACGTGCCCTCTGTTTAGCCGTTAAAGTGCCCCGTTATCCACGACCTCTTTCCGGCAAGTTGCTGCACGGCGTGATGGCATACGGGTCGTCGTTCTCACGGTACTCACGCAGTGACAAACACAGTCGCTGGCCAAGCGTACTGGATTCAGCCATACGCTGTCTCAGCAACACCGTCCGAAGACAACGTTACCTTCACGCCGTTAACCTGGCAAATTTCCCACGCTGACGGATCCATTTCTAAGTTAGCCGAGGGTCTCCGGTACCCGGGCCGTGCACCTGTGTGATACTTCGCCGGTCCGTGATAGCTGAAGCCGTCCGGTATCTCATTTCTTCACCACACGACCAAGCGTGGGTACCGGCATAGTCATCATCGCACTTTCAATAACATCGCCCGGTACACCGACCAGCCCTTCTGCGCCGACGAAATCTACGGTCCGTTTCCAGCAGTTCTGTTTGTAATCAGCCACAGCCCTAGGACGGTGCTGCCCCGGCTGGTGAGCCAAAGGCATCCATCTTCCTTAACATTACGACCTGGCATCGGTATCTTCAACAAGCTCTGTCCGTCTCAGCGTTTGCTGTAATCCAGTTCGCCGCCAACAAATCTTAAGGCGGTCCTTCAGGGCACTAGTGAAACCTAGGCCATCATCCGCGCGGCATACCACATTATGCCGTGTATAGTCCACGTAGGTCTCGACGTCGTTATGCACGAATGACGTCAGCGTCTGCCCCGTTTAATAAGCAGCCCGATATAGAAATGAGCCCACATCCACGCCTTACGTGGTTAGACGGCATTACAGGTATACCGACATGGGCGTGCACCCGCTTTAAGGCCGACTCTTAGCAGTACTGGCTCATGACATACAGCGCCGTGCCTTACATCCGCACCAAGAACCTGTTCCAGGGTCCCTGACGGATGGTTAAGGCATATCCCACAGACAGGCCATGTTGATCGTATCGCTGTTTAACGTTTAGTTCTAGGCCTCAGATACCGCTGTATTGCCCGCGTTATGCCTTACGTTACAGGTAAATCGAATACGCCCGACATCATCCATATAATCTAATCCATGCTCCGATTGGCTGCCGACCTGAATTAGATTGTTCGGGACGCCGACTTTCCCGGCTGGGTCGATTAGCCACAGCGTTTGCGAGGACGAGCTGGTCGTATCCTTCCTGGCAGGTCGGTGAGCGATGCTCCCGTGCATGGGGAGGGACGGGCTCGACCAGTACCCATCACCACTGAGGCCATATCGCAGGGTGGTTTGCGCTTAATGGTATGTCTTTTCCGTAAGGTCCAGCCGTTGATGCGTTGTAATCGAAGGATTAGGGACTTCCGGACGCTTCCTGTCATTTTTAGTATTCCACCAGTGCCTGTACCATAGAGACGGTCATGTTTGCACTATATCAATGGTGCTCGTAGATGTCATATTCGTCTATCCAGCACGCGTTGACGGAGCCAAATGCATTTAGGCTTGCCTCCTCACCAGCCCGGAACAGTCACCGTGACAGCGATAGCTAGATCCTCTAGTGTTGGTCTAAGCGGAATGTCTCAATCGACGGACCGTATTTCTAAAGTTCCATCTAATGATTACACTGACTCGGTCCTGGCATGGATCACACCCAATGATTGCGTGACTTCAGTCAGTGCTTCGGTCGGAGGGGTCCCCTTACTGCTTCCTTTACCCATTCCTCACCTCCATAAATGACAAAACCGCCGGCGTCCGCACAACATTTTGCATCACGGGTACCAATCAGATAATCATTTGACCAAGTCGTCTCTGCCGTACTCCTGAGAACCACGCGTATCGAACCGCGTCGCACTTCCCCGACCAACAGGACATTGCCCTAACCATGTTATCCATTAGAGAAAGCCTGTGCTTAGCGGCCGTCGTTATCCGTTGTCTGTACGGGGAGTTCGTGGCTTTCGTCAAGTGCTACTTACCCGATACATGTAAGCCGAGACAGTAAGGGAGAGCACCGTACGGTCCTCTCCCAGCCTCGCAATGGCTGCCCCGGAGTGGTACAAAGACCGGCAGCAACCGCGGCACTTAGCGATAGCGAAGCGACGCCCCAACCTATCCGAATAGTGACTAAGTGGAGGATAGGCAACCAGTGCCCTAACTCGCAGCGATCTCATGAGCTTAGATTGGGGACTGTTAGACGCTGACGTGCCCGGCAATCCGTACCTGATACCAGCCCGTGCTGAGTTTCTCACGAAATGACGGGAGCTGTGTGGCCAGTGCCCACTGGCTTCAGCCCCCGTTTCACACGAAGTCTTAGATGCGGCAAGCCAATCGTTACCGTAATCCCCAGTGAAGGTCCGCCATGCCCGGTGACGCCAGGAGTGCGTGTGCGTCCGTGCCATTTAGCGTCATCCTCTCGTTTGAGCCAGTTGTCCAGGAACTGTGCAGCACCGTTTCCGCAGTAAATGCGCCGTACTTCGATAATAAATACAAAACAGCACAGCAGGCACATCGCCGGCCTGTGCCGTGGACGGAGCTGATACAGCCCCGTCGCCTCCGAGAGTACGAGAGAGATTCTCTATAGATTCAGCGATGCTCGATGAAGCTTTAAGCATCAATCCCGCACAGATGATAAGCATCCCGGACAGTTCTTTATGTTTGG	*	tp:A:P	cm:i:181	s1:i:1094	s2:i:0	NM:i:3497	ms:i:2124	AS:i:1522	nn:i:0
+81	16	utg000001l	13612	60	14S12M1I4M2D7M3I4M1I19M1I18M1D21M2D6M3D14M3I19M1I2M1I6M1I1M2D6M1I12M1I36M1D54M1I8M1D17M1I59M4I31M3D4M2I3M1D5M2D4M3D31M3I50M1I14M1I20M1I2M1I14M2D35M1D37M1D4M4D8M1D19M1D11M1D14M2I2M3D8M1I14M1D9M1I11M2D39M1D9M1D9M1I18M2D13M6D7M5D13M3D3M2D4M4I4M2I2M1I39M1D2M5D8M1D23M1D11M2D3M1I30M1I69M1I7M1I6M1D20M2I12M3I5M1I14M4I10M1D4M2D10M3D20M1I32M1I16M1I17M1D13M1I16M2I5M1I1M3I8M9D18M2D6M1I6M1I21M2D3M2D3M1I10M1I2M1D9M1I3M1D4M2I4M1I3M2I14M1I13M3I4M1D5M3I13M3D1M2D3M1D1M4D6M1D4M2I1M1I8M1D24M6D7M3I4M1I2M2D24M1I5M2D7M1D8M1D16M6D17M1D5M1D8M2D1M3D7M4I1M1D8M1D10M1D1M1D15M1I2M3D24M1D7M2D7M2D7M4I17M4I7M1I14M2D12M4D1M1D13M1I9M2D18M1D4M3I11M1D3M4I13M1I2M3I16M2D1M3D7M1D4M2D6M1D9M2D18M3I1M4I3M1I3M2I1M1I47M3D15M1D30M4D12M1D16M1I3M2I4M1D8M1I7M2D3M4I7M1D6M1I7M3D18M4I5M1I18M7D8M3I3M2D5M1I28M1I5M1D4M2D11M2I14M3D25M1D3M2D19M6I19M2D15M1D2M2D3M1D5M2I11M2D3M2I3M1I7M5I2M2D12M5D12M1D5M4D13M1D3M3I5M1D11M1D3M2D10M1D5M2I4M1D3M3I1M1I3M1D3M3D8M1I11M1D12M2I19M3I4M4D3M1D4M6I2M1I28M1D3M1I7M2D4M4I9M2D6M1D4M2I1M1I5M2D6M2D2M3D10M1I6M1I1M4I5M1D3M1I20M3I3M2I9M7D11M1I3M1D6M2I2M1D3M1I19M1D23M1D12M1I2M1I10M2D9M3D11M2I20M3D7M1D6M1D16M1D4M1D1M1D13M1I4M3I10M3D1M1D22M1D3M3D13M3I7M1D5M1D9M3D5M4D7M1I5M3D1M1D7M3D1M3D12M4D7M1D2M1D10M2D2M1D7M1D1M3I11M3D6M2I9M3D1M5D14M1D21M6D6M2D23M7D8M2I12M1D8M2I5M1D5M1D9M1D10M1D7M1I6M1I15M1I7M1D2M5D4M2D12M3D9M5D3M1D14M1I15M1D9M1D12M1I6M2D3M1I7M2D21M5I5M6D4M1D23M1I13M3D3M2D9M6I4M1I20M2I8M1D8M2D2M1D2M1D2M1D6M6D2M1I5M2D11M2I18M2D7M1I6M1D22M1I1M2D19M1D6M1I4M2I4M1D26M2I15M1I9M1D4M1D8M1D5M2D12M1I5M8I3M3D16M2I6M2D3M1D11M1I32M1D8M2D8M1D11M1I15M3D6M1D8M2D2M2D11M3D21M1I13M1D5M1D9M1D4M3I2M1I23M1I6M3D49M1I16M1I5M2D12M7D4M4D13M2D3M1D5M3D10M1I7M3D2M2I2M1I4M1I2M2I11M3D5M1D9M3D8M1D1M2D23M1I20M1I6M1D5M4I16M1D2M1I2M1I3M6I13M4D3M3D6M1D3M1I3M1I5M1I7M1I5M1D10M6I2M1I3M1D3M2I2M3I4M3D3M1D8M4D8M1I4M1D4M2D22M3I7M2D4M3I15M1I1M4D5M3D1M1D5M3D1M2I3M3D11M2D4M1I7M1D1M1D16M6D3M6D4M1D9M6I8M1I7M5I6M2I6M4D8M2D10M1D3M2I11M2I2M3D5M1D4M3I10M1D14M1D1M1D4M1D6M5I1M1D11M1I3M2I25M6I11M1I1M1I10M1I1M1I13M1D28M4D3M2D3M2D8M3D6M1D2M4D6M1I5M2I1M1I15M1D1M3D23M4D2M1D5M3I6M4I5M1I4M2D2M1I5M1D4M1D27M2D5M2I2M5I8M3D3M1D4M1D7M3I3M1D7M1I5M1D9M2I5M1I5M2I6M1D6M2D1M1D14M5I20M1I3M1I2M1I3M1I4M9I3M1I4M1I2M1I1M1I5M2I2M1I15M2D11M1I2M1I14M1I13M2I2M2I3M1D24M1I6M1I13M4D4M1D3M1I6M2I8M2I9M3I12M2I10M1D6M5I9M2I1M1I1M1I8M1I3M1I7M2I10M2I5M1I4M1I27M2I11M1D3M2I12M4I15M1D5M1D15M1I12M1I8M7I4M1I8M1I1M1I3M2I3M2I5M1I1M1I3M3I4M2I3M1D3M2I6M1I2M1I7M2I3M1D3M1I6M1D6M2I1M1I4M1D10M1I1M2I3M1I2M1I13M1I6M5I5M99I5M2I1M3I6M1D10M4I5M2I19M2D1M2D8M1D1M1D6M1D3M1D6M1D7M1D19M4D7M2D4M1D6M1D14M3D3M2D15M1D5M1D5M1D4M2D4M2D1M1D2M1D5M4D7M4D7M1D3M6D5M1D3M5D1M2D2M4D2M2D5M2D3M1I3M2D2M1D6M3I7M2D4M1D12M5I14M2I9M1I3M3I2M1I5M1I13M2I19M1D10M2I1M1I2M1I12M1I5M1D22M2D1M1I9M1D8M1I6M2I10M3I11M2I3M1I14M1I9M1D2M2I20M1I3M2I1M3I5M1D2M2I5M2I9M1D15M1I1M1I2M1I2M2I7M4D2M1D15M1I4M3I2M1I10M1D3M2I8M1I3M1I2M1I6M1I12M1D5M1I4M3I1M2D7M1I2M1D3M2D4M1I14M2I3M1I14M1I12M2D6M1I3M1D4M1I5M4I6M1D2M1I24M1D1M1D9M1I26M1I4M1I9M1I3M1I5M1D5M2I3M1D3M1D9M3D1M2D9M1D11M1I8M3I4M1I5M1I5M1D6M3I8M1I31M3D2M5I2M1D7M1D5M1D17M1I1M1I1M1I5M1I6M2D28M3I18M2D3M1D16M2I3M2I2M1I3M1I25M2D16M3I4M1D2M1I11M1I4M1D7M4I6M1D2M1I3M1I3M1I4M1I26M1I2M1I7M55S	*	0	0	AATAAAATATTAAACTGTTCGCTGTAGGGGTCACGAGAACCACGAGGCCTGATGTGGTTAAAAGACCAGGCACAATCTTTACTACGCAATCCACTATTTAAGGTGATATGGAAGAAGGCATTTGATCCGGAGTTCGAAGAGCATCCTCGCTAGGCTGCTTGGAACAATACCAGGACTACTTCGTATGACTACGACTATTGATAAAATCAATGGTGGGACAATTCAAGCGATGCAATGGATGCAAGCTGCAATCGGAATGCATGGTTAAGCCTGAAGAAATGTTTCCTGTAATGGACAGATGGGAAATATGTCGATAAATGGGCAATACGAACGACGGCAATGATTGCCAGAGAACTGTGTTGGTAAACAGAACAACAAAGCTGCCTGATAGCCTTCTTATTTTGGCATCAACAGAATAAACACTGCACTCTTGATTCATCGGTTAAACGAGTGAATACACGGAGCAATGTCGCTAGGGTAACTAAACAGGAGCCGACTTGTTCTGATCTATTGGAAATCTTCTTTGCCTCTGCGAGTGTGAGGGCATTTATCTGTGAGGATATGAACAGATGTCAAACATCAAATACATCATTGATTACGACTGGAAAGCATCAATAGAATTGAAATCGACATGACGTAATGACAGAGGAAAACTTCACCGATTAATAATTTCTGGTCAGACTCTGAAATACCGACTCAATAACACGGCTGATCCATTAAATGCTGTATTAATGATGCTGGCGCAACATGCTCTGCTTAGCATTTCAAGCACTTAAATGCCGGATGGTGTTGTGTGAGTTCGACTGGAATGATGGAAATGGTCAGGAAGGAACTTATGCAGCGATGGCTACGCGAAGGAATAAGAATTACCGATATCGATACATCAGGAATATTTGATTCAGATGATATGACTATCAAGGCCGCCTGAGTGCGGTTACCGCATACCAATAACGCTTTCACTCGAGGGGCTTTTCGTTATGTATAAATAAGGAGCACACCAGTGCAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGCCCTTCCGAAATCTTTACTTGAACGAATCACCCGTTCAAATTACGTGACGCTGGATGAGAACGCCTTATCTACGCCCAACTACTTAATCAGCCAGGAGTCTAGAAGAATGGATCAAACACTTTATGGCTATCCAGACTAAATTCACTATCGCCAACTTGAGTCGGCGATGAAAAGATGTTTCGTGAAGCGTCGACGCTTATAAAATGGATATTAATACTATGAAACTGAGATCAAGCAAAAGCATTCACCAACCCCTTCCTGTTTTCCTCAATCAGCCCGGCATTTCGCTGTATTTTCCACAGCTATTCTCGGAGTTTCATGGCTGAACCCCTTATCCTAAGTCAGGATCGTCTGTGAGGAATAGAGCTCTTGAGGCGTCACTACCAGCAGCTCGCCCGTCAGAAAGTGCACCGAAACTGGCAGACGACTCAGAAGAAGGCCTGCCCACCTGTTTGGGAATCGCTGCATCGATTATTTGCAACTACACGGGGCCAGCAAAAATCCATTACCGTGCGTTTGATGACGATGTTGAGTTTCAGGAGTGCGCGCATGGCAAACATCCGGGTACATGGTTGAACCATTGCTACACCAGGTTGATATTGATTTCAGAGGTATAAAACGAATGAGTACTGCATCGCAACGCTGGCTGGGCTGGAAGCTGGCTGAACGTGTCGGCATGGATTTCTGTCGACCCACAGGAACTGATCACCTCTTCGCCAGACGGCATTTAAATGATGCCAGCGATGCGCAGTCAGCCTCATCGCATCATGACACTTCGTTGCCAACCAGGTCACACGGCCTTAATCCGTAGACGAAAGAATTTACGCCTTCCTTATAAGCAGAATGGCATCGTTCGTGCTGTGGGTGGGCTGGATTGATGGCTGGTCCCGCATCAGTACAATGAAAACCAGCAGTTTGATGGCATGGACTTTGAGCAGGACAATGAATCCTGTACATGCCGGATTTACCGCAAGGATCTGATCATCCCGATCTGCCGTTCTACCAATGGATGCGGATGAACCGCGTCCCGCGAACCATTCAAAACTCGCGAAGGCAGAGAAATCACCGGGGCCGTGGCAGTCGCATCACAAACGGATGTCACAAAGTCAACCCTCATGATTCAGTGTGCCCGTCTGGCCTTCGGATTTATGGTATCTATCACACGAGGATGAAGCCGAGCGCATTGTCGAAAATACTGCATACATGCGAACGTCAGCCGGAACGAGGAAGATACGTAATAACGGTTAACGAACGCAGCATTGCAAGGAAACCTCTGCCCTGATCGACATGGAGGCAAGAACATGGAACCAGAAGGTCTTATTACCTAACTTCCCCAACATTCACGAGACATTCGTTGGCATGACGTCCAGAGAACAGCAACCAGTTAAACGACTTGGAACCTTTAACGCTGAACAAGCATCACGAGCAGAAGATGAAGCAACCAGACGCATCAAACATTATTATGCAGATGAGTGGACGATTATACAGTCAGAACAATGTCGAGCACGCATGATTAGTGAATGACATAAGCTCAGATGAGGTCAATAAGGCCATTCAAGAAAGTCTAACGTCAGACCATACCGAAATCAGTAGCGGAAGAATGGACATATCATGAAGAAACTTTACGCATCGTTTGGACACCTTATTGAGCTTAATGAATGTTAAGTGCTACGGAAATTAACGCTAAAGCACTGGCCTGGGGAAAACAGTACGAGAACGACGCCAGAACCCCTGTTTGAATTCACTTCCGTGAATGTTAGTATGGATCCCCGATCATCTATCGCGACGAAAGTATGCGTACCGCCTGCTCCCCGTGATGGTTTATGCAGTGACGTGGCAACGGCCTTGAACTGAAATGCCCGTTTACCTCCGGGATTTCATGAAGCCATTGGAGCGGCTCCTTCATTCGAGGCCATAAAGTCCAGCTTACAGCCCAGGGTGCAGTACAGCATGTGGTGACGCGAAAAATGCCTGGTATCCTTTGCCAACTATGACCTCCGCGTATGAACCGTGAAGGCCTGCATCATTATGTAGTGATTGAGCGGGGATGAAAGTACATGGCGAGTTTGACGAGATCGTGCGTCGGAGTTCATCGAAAATGGACGAGGCACTGGCTGAAATTGGTTTTGTATTTGGGGAGCAATGGCTCGACGCATCCTCACGATAATATCTGGGTAGCGCAATCACCTTCGTCTACTCCGTTACAAAGCGAGGCTGGGGTATTCCCCGGCCTTCTGTTATCGAAATCCACTGAAAGCACAGCGGCTGGCTGAGGAAACATAAATAATAAACGAGGGGCTGTATGCACAAAGCATCTTCTGTTGAGTTACAGAACGAGTATCGAGAGCACGCACATAGCCTTGCTGTAAATTGGAATCAGGGTTGTTGGTACAGTAGAAACAGACGAAGAATTCCATACGTCGTTAGCCTCATCCCTTTTCACAACAGCTGGAAATGATGGTGGCGAAAGCAGAAGCAGATGAGAAACCAGTGATGACAACCACGGAATGCATTTCTGTGAAGGCCGGGTTCATATTCTGTGTGCTTATGCTTGCGTCGACATGGGACTTGTCGTAATGACACTCAGCAGGAAACCCCCTTCGCAGCATTGCCCGTCCATTCATGAGGATTCTGAAATCAAAAGGCCCGGACAGCAGTTTCCGGATAAAAACGTCGATGACATTTGCCGTAGCTGATTGGACTGAAGGCACCGCGAACGGTAACGCTGATGATGGGATTCACCGACTCATTTAAGCCTGGCAATCGGCATGTTAAACGGCGTCTTTAAGGAAACGATGAACATGAAAGCAAATCATCAGGAGCTACAGGCTCCTTTTATTATTCGCATTCACCCTCAAGCGTATTAACCAACAGTTCAGGGATTAATGAAAGATGGCAGACATCATTAGATTCAGCATCAGAAAGTAGAAGAATTACTTAAGGGACACAGCAATAAAATGCCGCCTGAAAACACCAGCGCTATATTCCACTCATTGTGCTGTGGCGATTAGGATGGAGAGGTGAACGAAGACGCCTCCGTCGTTCAGGGTTGTCGGACTTGTGCAAGTGCCAGGAGGATCTGGAACTTATCAGTAAACAGAGGTTTCGAAGTGAGCGAAATTAACTCTCAGGCGGCACTGCGTGGAGCAGCAAGAGCACCAGGGCAATGCATGACGACTGGGATTTGACGCAAGACTTTCCATGAATTGGTAACACCATCATTGTGCTGGAACTCTGCTGGATGAACGGGAAAGAAACCAGCATCAAGCTAAACGCCTGCGACCAGGAGAACGAGGATATGCCTAACGGTAGGGAAGCTTCGTGTTGAGCTTGAAAGCAAATCAAACTCAACGAGCAGCGTGAGTATTACGAAGGTGTTATCGGATGGGAGTAAGCCGGTATTATGGCAACGGGAAGCAACGAAGTCCGTGAAGACGGAAACCAGTTTCTTGTGTTCACCGCCATCCTGGGAAGACTCCTGTTATCAAGCACTGCAACTGACCTGGAAGAGTTTCTGCGGCAGTTAATCGAACAAGACCCGTGATTAGTAACTATCGACATCATTACGCATCAGTCCGCTACGATTGGAGGGGTAATGGGTTCAGGATGCAGGTGAGTATGCATGATGTCTGACGCTGGCATTCGATCAAAGGAGAGTGAGATCGGTTTTAAAGATAACGCTTGTGAAATGCTGATTCGCGTAGTCGTCTTCGTTCACTAGTGCCAGAGTATCTATGTCAGATGATGACGTACTCAACATCGGTTGAGGCGCTCTTTATCTTACTTCGTACTAAACATCAGTGCGCTACGGCTTTAGTGAAACGACATCATTGCCAAGGGAATTTATAATGAGTGATGATTGAGATTACTCACAAAAGATTGGGCGTTATCAATGTTGTGCAGTACGCTTGTCTTGTCTCCATGCAGACATCACGAAGGTGTTTATGTAGATGAAGGTAGATAGGGTCGGCATACAAATATTCCATGAAGGTTTATAAGTAATGAAGACAAATCCCCATTCTGCAATGTGCCAGAAATGACCTGATAAGTGCAAATTATCACGAGTACGGGTGGAAACTACATACTTGCCCTCTCTGTACAAACATATAGATGATTAACCCAATATTACATAACAATCGCATCGCGGGGATTTATGTTATCTGAATCACGACCTGGCCGGGTTTTGTTTTATGGAGATGATAAATGCACTTCCGAATCCCGGAATGGATGGAGAGCCATTCAACAGAGATTATCGAAGCGGAGAACATCAACGACTGCTACGACCACTGGATGATAGCGGCGCAGCAAGAATATAGACACTTGCACATAACTGGTAACCAATACTCTCGAATATTGTCACAAACTTTGAAAAGACACTACCCGCCCCTACGCGCTCTCCGCGTAGCACTCTCTACACCCTCGTACCTGTCATCCGACATTTCATTGTTTGAACGGTCTGCACGGTTAAAGGATAACTTTGCCTTGTGAACACTTGTGTAGCTACTTCAGTTGTCTGGGCCTACCTTGTACAGGATACCCCACCTCTACTAGATGGACGGCTACCCGGTCCTGTACCACCTCAAAGGAGCTTAAATTGAATAACAGTCGTCGTGCGGTCGATGCAGAAGTGTCACACCGGTTAGAAACGGGAAGAAATATCTGTCCACGATCAGCGGTCACTTGACTTAGTACGACCGTCCCCTGATTTGAGAGGTACAGAAAATGGAAGAGGCAGTCGGCTCGGGATTTACCAACCTTTAGAAGTAATGGAACTTGGTAACAGAGCTGGATTTACGGGACAGGCACGGAATCCATTCAAGGCGCTAGCCAGGCCAACATTGAGAGTCTTTCATAGGACACAAACACAAGCCTCTGACAGCGAGAATCAACAGTGATAATTCCGTTATTACGTACATTCCATGGCTTGATCGCTGCAGAAAATGCTGGCCAGCAGAGGATCAAGCAGAAGACACTCATAAATTACATGAGCAAATTAGACAATTAATAAGGCTAGGAGGATCTGCCTGATGCTCTTACGCAACCACAAAGAAATTGCGGCAATGCTCAATGGATACATAGACGAGGGCAAGAGGCGTCAGCCAAGTAATAATCAACACTGAGCGATGCATTCCGGAGGCAATAGTAATAGCTGAAGGCCATACCAACAAAGCCATGTCCCTTCATCGCGCAGCAAATCAGGTAAGGAGATCAAGACTTACGGGCTGACGAATACCTGAAAATTTATCAAGCAGCAGAAAATCATACCATGTTGGCTCAGACTTGCAATGGAACTGAGCTTTGTCACCGGGCTCGAATTATCGGTGATTTATGCGAAATGAAGTGGTTCATCGTAGATGTCCGGATATTTATGTCGAGCAAAGCAAAACAAGGCGTAAATTACTCATCCCAACAGCATGCCATATTGATGCTCGAATACTAATGAAGGAAACACTTGATAAATGATGCAAAGAGATTTCTTGGCGGAGAAACCATAATTGCATTACTCGTCTCGAACCGCTTTCATCCGGCAACAGTATCACGTATTTATGCTAGGCGCACGAAAGCATCAGGTCTTCCTTCGAAGGGGATCTCACTTTCACGAGTGCGCAGGTTTTGTCTGCAAGACTCTATGAAGCAGATAAGCGATAAGTTTGCTGATAACATCTTCTCGGGCATAAGTCCTAACGCCGGCAGCCACAGTATCGTGCTGATGACAGAGGCAGGAGTGGGACAAATTGAAATCAAATAATGATGTGCTGTTATCTGAACTAATATAGACCTGTTCGTTGCAACAAAATTGATAAGCGATAACCGCTGTGTACGCCAACCGCTCATAAAGCTGAACGAGAAACGGTC	*	tp:A:P	cm:i:84	s1:i:777	s2:i:0	NM:i:2109	ms:i:2756	AS:i:2571	nn:i:0
+82	4	*	0	0	*	*	0	0	TGGCGCGATCGTATACTGTTTAACCTGATGTATTGCTGTTTCTTTCCCGTTCGTCTCAGCAGTTCCATTACAATCAATGGTTACCAATTCATGGAAGGGCTTGCGTCAAATCGCGTCGTGCTGCCATTGCTGCTCTGCCGCTTCACGCAGTGCCTGAGTTAAATTTCGACTCACTTCGAACCTCTGTTACTGATAAGTTCCAGATCCTCCTGGCACTTGCTAAATCCGACAACCGCTACCCGCGTCTTCGTTCATCTATCGGATCGCCACACTCACAATAGAGCCTTAGAGTGAGGTGGACTAATAGTGAGTTCGGGAGCGAGGGCATTTCTTGGTCATGTGTCCGTATGGCCGTGATCTGACGTTCGTTTATTTACTACTTTCATGCTGAGACGTAAATACTTGTCTTCAGGTCTCATCTTTCGGGCAGAAGCCGAGGAAAAGGAAATAATGCGATATAGGAGCTGACTCAGGTGAATTTGCTTTTCACTGTTCGTCGTTTACTGCCTCACCACGTTTACGGTTAAAATGCCTAGACAGTAATGAGTCTATCCGTACGCTCCGTTGGGGTCGACCTCGACAGATTGGTCGTCCAATCGCTACGGCGAACGTATTTATGAGGTGTTTATCTTGCGAATCTGCTGTCGGCTTTCTCTTTCCTCGAATTCCATAGCCTGACCTGCGGCAGCCGGATCATGCACTCCCGTTTAGTGAAGGTGTGCTTCATACAGAGTCTAAGTGTCAAGCAGGCACACCGCCCAGAATATGGAAGGTAAGTCAAGAGAACAAATGCGAAGATTAGATTG	*
+83	4	*	0	0	*	*	0	0	CTCGTCTGCTTAATGCATGCGACGCCCTCCGAACTTAGAGGTGTAAAGCTGATAAAACAGCGGGGGTAAATAAAAACGTCGCCGTCTGCTATCCTTCTCCAGTCGATCCCAGTACTAATGCACGAGTTCAGTATGTTCTTCATCGCTTTATTATCAGGTTCCTAGGGTTTGGCTTGGTGCGCATAGCCCATGGAGCGTCGGAAGACGTTCTACGTTTATCCGCTCAATATTTGTTTAACGATCTAGGCTAAGGGTAGGGTTTAAGCCCGCCAACGGGTACGGACGTCCCGCTACATGTAATTAGCGGTAAAGCCATTTTCAATCCATCAACACAACAGGAGTGCAAAGTTGACCGACAAGCCACCTTACATTTCCCACGAAGACGGCGCTTGGACATTTTACCGCCACCGTAGTCAGGCCAAGCACAATGAGCCGCTGCTCGCATTGATGTCTTAATAGGTTGAATTAGCCGCATTGCTCTTTACTTTAACTCCCCTTTATTAGAATAACATTTGTAAGTACTATTAATTTCTACGACATGGCCTTTCATGCTGTCTCCAGTTTTAGATTATTTGTCTCACCGGCACTCTGACAAGTGCGACTCCCATGAGAACGCGGAGCCGTGATGAACTTGCAACCGGCTAAGCAAGGGCCATTTCGGTGGATATACTACTCTCATGTTTTGGTAGCTTACAGCACTCTATGTTCTCAAACGCGTTCCCAAGACAGTTAGCGGCCAGTACACTCGGAGCCATGGCCACGATAACCTAACTCTTCTAGAACAGCCAGTCCGATCACGAAGATTTTCCCCATGGTTAGGTGTTAACCGCCCCAGAAAGTCGCGCACCATGAGTTACAACGACGCTGGAGGGACAAAAGTCGGCCCGCACCATGGTTTAGCGACTAGCACTCTTTAGATGATAGGCCCTGGCCATAGCCTACTTAACACTCCACCAAGTATCGTACCGCATCGTTCCCGGCTGTACCCCATGTAATTCTAGCACGGCTGGCAGTCTCAGGCAATGGCACCTAAACAGGTTATCGAAATCATGCCACCTCCTCCGTTATTGCTTTACAGCGCTCTGTCATTTCGCTGCCACCGGCAGAGACACGAAACGGGTTCCGGCACCGCCACAGATGCCGCGCTAGGAATTGGCAGTATGCCCGATTATCAGTCAGTCGATACAACTATTAGAGTGTCACCAGGGTCAACACGACCGTGAGCCAGAAGTCGCATCCCGCATCCTATCTATCCGTAGATCCCACCCTCATTTTCTATGTTACGTCAGCACATTTTCTAGCGAGGGCGCTTTACTTATCGCAGTTCATCCGTCATCAATATTTCCTGGTGGCCCACCCGTCATCTTGTTCTTTCTTCGCGTCATGACAGCCACGTCCGTTGTTGTCCCAGCGAGCTAGAGACGGGCAGAATCAGTTCATGTTCTTTAGTACAGGGATTCCTCCAATACGAAAGGGTACGGAGTTGTACCAACACGAACTAGCACGATAGCCAGCAGGCACAGGCGGCCTAACGATCAACTGAATCATGGCTCAAAACCTCAACTTCACGCGATTTCGACGGGCGAGGAGCAGTTATTCGTCCCTTCGCTGTCGGTCGCATCCTGAATGCGACCGCATCCCAGCCAGTGTCGACCAAATGTCCTTATTATGCCGCAGCACCATGGTGTTGAGCTCTAAGGAAGTTCTTTGTACCGTTTGCCGTACTTTAGCGGCCCACATAAAATACAAGCTAATTATCAATCTAGATATAAGTCCCCCATGTTTCACCGCTGTCTCCGGCTAGAATTAGAGCCAAGACTATCGACGTCTATTAGCGTTGAAGTACGAACCTCCGATAGGGCCGGACACTTTCCATTAAGAGCCACATGATCCTAGCTAGTGGCGTCCTAATCAGTCATGGTCGGTTGATATCAATAGTCACTACGGTCTCCATTAGCCGGCCGTCACGGGTGATGCTTATGTTATTCTCCTCACTTAGGGCCGCTATCTAAGCCAACTGATGAAGGCTTCACGGTCTGACATGGTATTGCCTGCTAAGCAAATTAGATCGATATTCGATAGCATCGCGACTTGGTCACGCATGTTGCAGGCTAGATGGGCCTCCGACGGGCTAGGTACCCCGGGTTCTTAGGAATGTTCATCCGGCAGCAGACGCAGTAATCAGATTCACTTCATGCTTCGGCTGATCATATCCCGGCGTAAATTCCAGGTGAGTTAGCGCCGGCACGAACAGGGGATACATCAAGGGAAGCTCGGTGAAAAACGTTACAGCGCCATCTTTACCAGAGTTGTAGAAGTCCGCGATAGACTTTCTCGTGACTTAAGGCAGCTCGCATGGAAAAGAGACTAAGAAACAGCGGATCAACGACATATTAAATTTCCTCTAGCTAGTCGCCGCCAGCAGTTGGCGGTTGTCATGGACATAAAATCTAGGTCAAAGCGAGCGCAACATTTAGTGAGACATAGGTCAACGGTAAACTATTGTAGATCGACGTTCCTCTAAACGCGGTCCAGTTTTCGTCTCGTTGGCATAGCTCCCATAAGCACATCCTAACAGAACTGTCGACTGCCGAGACGTCATGTCGATCTGCCTGTTACCAGCCATACAGGGATCGAGCAGGTCACTGTATGTCAAGAATGAGACATGAAGCTTACACTAGCTGGGGACTTCGACGCATCATAGGGTCATTGCAGGGCGCTTTTAGCCAGCGTAGCCGCCGGCGGTCATCCCTCCTCCTAGGTGGGTTTCTTCGGTGATAGATAAACCGTCTTCGTCAAGCTGTAGTGTTTAGCAAATGGTTATCGCAGCCATGCTGTGCCGGGTATGCGCCTGCACCGACAATCCCTGCCCACCGCACCTGCGGCCGTGGCGCATTGCTTAGATGTCAGATATTGGTGGTCAGAATGCGGCTGAGCCGTTTCATACTACGGTCACCTCCTAGGGGTCCCTAGTGCCTGTTCTTCTAGTCCTTAGCCTCCTACAGTTGAGGATCCCCATAATGCGGTAATGTTTTCCCGCATGCTGTAATGTAGCGTCCACGTCGTCCCTGTAAGCACTCCGTTTCTCTAGCCGTCCTATAGCCTGGCGCCGTCGCTTAAGGTGATAGACGTCAGCCTGCGAAGCGAATCGAGCTAGAAACAGTTGTTGATCGAGTCTCTTTTATTGCTTCCTATAGTACGAGGCCCAGTCGTTAAGCGATTAAGTACGAACGGTACGATTAGCCGTGGTGCTCTAGCTATAACAAGTTCAGCCAGTCCCGGCAGCCAAGCTCCTGACGCTGTGTACATCCAATACGGTGGCCACGCTAATCGGGTAGGCCTCGTATTACACACTTTGACAGACATGGCTATTAGGTTGATACGAGCTCCTGCAAATTACTAGTGTCATCGAGACTGGACGGTAAGAAGTTGAGCCTTACTCCGTGACAGTACATCCCTATTACGTCCTTAGGCCTACGTCGTCCTTTTGGCTAAACAGTCGTCGGGTGTGGGTCAGCCATGATACCGATGAGGCCTGTTTTACAATCAGAGTCTGCGTACACAGCGGGGATCGCGGGTGGCAGCAATAGTAATGAGTCGGCCTGTTGGTTGAACCAGCGCCATACATTTGGTCT	*
+84	4	*	0	0	*	*	0	0	GCGGGAGCCTGTCGCTCGTACTCGACCTGGCAAGGCTCGTAAATTCATCAACTGTTGGCCGCTGCTTGTTGTAATGCCGAGCGTTGTAAACGAAATAACGTTTGCGATGTTAGTCAGGTAAAGGTGGTCCCATTATGTACTGTTAAGAAGTAATGGAAGTTCACTCAATTGTTAGTTACAGCCCGCATCCTTGCAAGGGAACGAGGAACGGTTTAGTTCCTGTTGGCTTAGTTCGTCAAAGTGCTTTTCTTCAGTTTCTCACGTTGCCATGAAGCCATTTGATCTATCTTTGAATAATTCCAATTACCTGAAGTGGTCTAATGGCAAGTGCTTTATCCAGGCCTTAGTTCCTTTCTAGCCTATATCCAAATGAAGCCAGGCAGGGGTTGGGAATGTTACAACGTCAGCTCCTGAACGGATCCTGTCTGACGTGATCCAAATGTTATTAAAACCCGTGGATGAAGTCTAGTCAAACTTTAAACCGTTAGTTTGCAGGTTGGCTGTATAGTCAACTAACTGTCGAACTATTTAGAGCCAGTTTAGACGTGCGTGCCCGGAATGCTTTATTACTGCTCAACCCAACCTGTCGGTAACTTCAATTGAAGATTATTCTCCGTGCCATAGAACCAAATTGAATCAAAGATCCATTGACGCTTTATTTGTATGCAGTTACGCAGTTATACATTGCTAAGTCTAAGGCAGTGGATAATTCGTACGTATTTAGATGGCAGGCATACGTCCGTTAATTAAAGCACTCGTACGATTAACTAAGGTAAAGTTGGTTTGCGACGTACTATTCAACGGTCTATTTCAGTCGCCTCGTGATTCGACTGCCTGGCTCGAGCGTCTAGACGGTCAATCACGTTGGATGTACGAATTTAGAGACCGTAGCGTACGTCCGGTCCTGTCTACAATCTATCTAGGTAAATTACCAGCAAATGTACGTGCGTTGGAAATCGTCAAAATTCAGCAGCCATTTACATCGACTTAGAATTTACATCTGCGAGCTGTCAAATCGTCAGGTTTATCCACTCATTTGATAGTGCTTAATCCATATGTCAAAGCACTGTAACTGTCATCTAAGTCGAATTACCGGTAAACTATAGTAAATTAGTACAGGAAGTGCTTATGTACTTCAGGTCTAAATTGGCTGTGGCCTTGGGACCTTAGATAGGTTTAACATAGGGATAGAAAGCGCGTCGTGAATTCCGAGCTGGCGACCGATTCCAGCCATTACATATTTGCATTTGAAATTGAGTTGCCGACGTTGGCGACCGAATTTACCGCAGCGACTGCTGTCCCGCTTAGTTGAGGACATTACAACGTCCTGCGTGCACGCTGCCACTGTTGCATGGGACTAGGAATCTGCAAGTCACGGATTTGTACGGCCAACACCTCATAAAATATTCGTTCATTCCGATAATCTGATTCTATGGTTGCTCCTTCACAATGCCTCGTGCACTTCAGGATAACTAGCTTCCAAGCATTGGGGAAGTAGATTCAAATCTATAATAGTTTCAGATTTGCTTCTAAATCTGACGTGCTGAAACGTTGCGTGACGATAGTTTCCGTAATTTACGAAATTTCTTTGAGCATCATGCCTCAACTCCTTCCCTCCAACGATAGCACATTGTATCACCCGAACGTACCTTGAAGCTCTGGCTATGTGTCTTCCTGCCTCCAGTTTGCCAGGCATGCCGCACGAAGCAGTTGGCCGGAACGAACTTGCAGCCGATGCTCACGAAATTAGTTGAGCATGAATCGCTTGTAGCCATCTGCGAAAATGACGGTTACCCATTGAATGCACGATGGAACCCGTACATAGGCATACGAAAATTCAGAATGTGCATGAATAACTGTCTGTCCTATATCATACAAAGGACATTTTCATGAAACGATTACGTAATGTTTAGCGGGTTGTTTACCGCGACTTATTCGACTTTTCTAATTAATTTAAGTACGAGCCGGTGGCGGGTGTTAATTAATAACGGTTCCATCTCATATTCTATTGTTGGCAAAATGGGAAGTAGATGAAATTATTTCTAACATTACCCTGTGCAGAGTCTCTGAGCATTTCAGGGTCTACCGGGTAATTCGCTTGACGTCTCGTCATCTATTTCTATCGGTTGAGCGTTTATCGTCTGAAATCTACATCTAATTTGCGATTTCAGAGACAGCAGTGACGCTCATAATCCGATTAACGGTTGCTCGACGCCGGATCAACGGATCCCAAATAATCC	*
+85	16	utg000001l	29927	2	2637S5M1D5M3D5M2D2M1D13M3D4M1D3M2D2M1D10M1D33M4589S	*	0	0	GTAATTACCAAATCGACTAACAGTCTTGGAAAACTTGACTAGTTGGAGAATATCCTTACATGATGAGCATGGTCGTGTACGGTCTCGGCTGGAGAAATTATTTAGGTTAGAAAGCCCTCATTTATTCAATTCTTCGGGTTGTTACCGGACATTTAGTCTATAAAATCTGGACCATCATTCTAAGCTGCCCTTCCTTCATACGTATTCATTGCGTTCATACCGTCAACATTAATCGGGCCAGTACAACGGTGTCTAATTGGCTATTGTTGTTCCTAGCTTTATTATTGGCTTCATTAGTAAGTCTAAATGGCTTTCCTGTTTAGTTTACATCTAAATAGCCTTTGATGCAGCAAGCGTTTAAAGTGCTGTTGGTTAGACTTATGAGCTGCACTATCCCCTTCATCTAATTGGAAGGAATGTCTGTGGACGTTTTAGAATTTAGACGTATGCCGCTTTATCGCACTTTATGCGATGTATACGCCGACTTCCCGCTATGTCGCCTTCGTTGGATGCCGTGACGGACTCCCCTATTGCCGTATGCCTAGAGATGTAGCTTCCTCCTTCGGCATTCGTCTGACGAGTGCCTAACCCGCTTCGTTTGCCGACCTGGAATAATTAGACCTATCGATGCGTTGGTTTCTGATTTATGCCTCTTTACAGCACCCTAAACCTTAGCAACCAGCCCTGGCTTCGTGAGCACGCTGTTAGGAAGGAGGATCTAATGCACTTCGTTTCTTTACCCAGCCGGCAATAGGATTTGCTCTGCTCGGCTGATTTAGCTTCAATCTCGTTGCAGTCGGTCGTTAAAGCTTCATAGACGATGCAGCCTGTCCGTGGTGACTGTGGGGCCAGTTTAAGTACGTGCAGCGTACCGATACCTCAACCTGCAACGGCCGGCTGATTTGTCCGTCGTAGTATTAAAGCCAGACGCGTTACGCTATTTGTCGCCATCGTTACGTCATCATAGACGCAACGGATACCTTCATCGGCATCATCCTAGTAAGCGGCAGGAAATCAGCGTCGCTTTGTTGGATCTCTTCCTCACGCTTAAACGTAAGTGCAGATAAGTACGGTAACTTAGAATCTAATCGTACATGATGTAACGGCAGCTTCATGGATTCTGAGCCACGTGTCACGTGATGTTGGTCGGTTGGCTGAATGGTGCATTTATCTAAGTTCCTGTTAATTCCTGAAATCATTCATATTTACCCCAAAGCCAATTCAAGCGGCTGTCATAACACTGTACTGGCTAATACTAATTACAGCCAACGATAGTTTCTCGCCGTCACTATCCAGCTTCAAGGAAGAAAGAAGGACGGATTAATCTGTATATTAATAGACTAAGCTCGACGCAGTGCGTGTCGTAAGGCTTGGTTGGTCATTTCGTACGGTAACCGGAGTGATTCGTTAACAGTAATCCATTGTGGTCTATACTAACCTAATAGGTCCAACTGCTCAACGTTGGTAAGTTCGTCACATAACGTCACGCATAGGCCCAACGTATCCTCATGTCATCACTGTGCTGCTTCCTTCCATCTAAGAAGCCATCACCCACACCTATGTTTATAACGTGACTAACTATAATCCTATATGGTATTTCACGTAATCTAGTCATCCTCAGGAAGGAAGCACCATTTATCCATGACACTAAGTAACGTACGGTTACGTCGGACTGTCCAATCACAGCGGGCAAAGACAGCATAAAGCAATACAAGTTCTATACTGATCTATACTACGTCCTGCCGGTACTGTATAGACCAACGCATGATGCTAGACCACTGTTGTGGTAACATTAATACTGATGGTCTCGGACTTGACATCGTGTGGACGTACGTGAAGTCCGGTGACGTTCTACTAGGCGGACGTACGGAGAACTAACCACTCCACGTCTACGGAAGACCCGTTAAACAGTGACTTTCAGCCCTCCATGGCCGTGTTTATCATAAATACTTTGACGAGGTCGGAGACTAACTATCTGTGAGTTACGAAGCGTACTCCTTTAGAACCACCGTAAATAATACTTAGGTCAAAGGTCATTCGTACGGAGACTCTCGTCACGCCTGACGCCTTACTTTAAAAGCCCTTTATCGTAATTTGGTGACGATCGTCCCTTACTAGTCACGAGTTTACAAGTTACTGCCTATACATTTACCCGTACTTCACGTAATTCAAGGAGCGGAAGATAGGAATATGGTGAGCAAAGGTCCACGGTCCTGAGATCCAGGAGCCTAGACGTCGTTCATGAATATCGGTCCTGCTAGCCATCGGCTTTCCTTCCCGTTTAGGTCAATAAATGCGATACGATTGGGGCAACCAAAACTCAGTTGCCTTCCTCGTGTCTCATGCTGAGCTATCTAGCACTATTTGCCCGGGTCTTCTGCTAATCTAACTACATGGCATTCACTTACTGATCCTTCACTGTCGAAAACTCATAGTGTATGGGTTATCGTCCTCATATTTCTACGGGACTCTATTAGAAACCCATTCCTTCCTTCCGAAGGAAAGCCTCACGAATGCTAATTGGACCTGTTACCACTTAGATATAAAATAATAATTTACTTAGATACCGGCTCAGTACATAGTCTAAGATAACGGTGCTGGTCTGACTTATGATATCTAATCTGCTTTCTAAGAACCAACTCAACTTACGTCGTATAACGGCAAGATGCGTGGCTTTATGAAATAGCCGGCGTCAGCTCAATCCTGGACGGTGCTGCCGGTGAGCAATTAGAACGATAAGTCTCGCCTGCTTAGACGGAATACCGGAAGGAATGTAATTTACCCGGCTGCCTAGTCGTGAAAGCTTATAGGCTTCGTAGTTCATCGTAGTAACCAGCTCACTGCCGTCGTTACATGTTAAATCGGTCGGAAACTCACGCTTCACTTTCATGTCTCATCCATAAGCTGATATTCCCCATGTCTTACGATCCTGTCGGTCAGCTGCTTAATGAGGCGGCCCTTCTCGTAAACTTCACGTCGGTCAACTTAGCCGTTATCACGATGGCCTCTTTAGCGTGATCTTAAAGGGTGATGGCATACGTGCCGTCGTTCGTACGGATACTGCAGGAACAGTCTGGGGTGGAAGGGAAGTGCGAGCTCCCACGCTGTATTCATCATAGACACGTCAGGAAGCTTCACTTTATTCACCGTCGTGACAGCTGACTAACGGACCTGACCGGATTGCCACTTCCGTCACCAGTATTAGTATAGGGATGGCTATTCCTTCCTTCCAGGTTAGTCCGGAGTGGCTGTTCACACCGCCAGCACACGACCTACATTAATATGAGGTTAATAATTTTCAATAACCCGCTTACATGAAGCGCTTCTGTGACGCTGAAATTGACGGTCTTAGTTTCCATTTCTGTTTAATAGACCTACGGAAGGAATAGGCTCCTTGTTAGGTACGGCCAACTAATCATGCGCAACCTTAATGGTCAACGTATTTCCGACACATGTCGCTCGTTGTTGGTAATCCATGTTCAACGGATTATGGGTCTGTCATAGCAAAGCTGACCTTAAGAGCGTAATACATTAAGCGGGTGACAATATGAGCGACGTTTAACGACGTTACGTCTCGCCTTCAAGTCTGCACCACAGGTCTAATTAGTCAACGCTGAGCAACCCCAATCGATAGGGCCAGAGATCTCTCGAGCCGTACCTTACAAGCTGTGGACCTTACGGAAGCGTCGCATCACTAGTATCAACATAATTTGGTACCGCTCACAGCAGACGTTTCCCCATGCTGGATGGGTATCAATATCCTACACAGCCATGTTGTGCTGTATGCCGGTTTAAAAGTTCGTCGTCATCTATGTATGCCCGTCTTGAGCTTGGACGTAAGTGCAGACAAATACGCTACGATGATAATTACGGCTCACCTGCTGGCTGCCGAACCGGTCCTGCGACCCATGCACTTCCTGAGCACTGTTTCACTCAGCTTCATAATATCTATAGGCCGCATAGTTTTGTCTTAAGCGGGCGCAAGGAGGCGGAATCCTTACGGTAGCTCGGTCCAAGCATCCTATTACATACCGCTAGATATGCCGATAGATTTAGTAGCTCGGTATCAGTGTTTGACCATTAACTAGACGTACGCGTGATAGGCTGATGCATATTTCCTCCTTCTCTTCCATATGATTTGACTTCTAATTAGTATGTACCGCGTAAGCTCCATAGATTCAATCCTTTAGTCGGTTCCGGTTCACCTTCTTCAACTACGGTCGTATCCCCACGCGTCTAACGGCCCGTCATCAAGGATTCAATCTAGCTCGAGTATCGATCACCCATAAATGGAGAGAGGAATGCCTTCCTACGGCCTTCTGTCATCCTAATTGATAACGGACAACTTCAAGTGATGGACATTTTCACATGAGCATCACGTAAATAAGGCCTTAGTCGGTGCTAATCTCCTTCAAAGCATCTATTAACTTTAATCCCACATTCGACCGGACAACCTAAACACCCTGGCTTCACAAGTTATCATAGTCAACGTCTATTCGTATTAGTTTAATCGATGGAGCGCCAGCATTCTAGATTAAGGCATACTTCTCGGCTCCATTGTTACGATCACGCATGACTGTCTGCTGCCCGTACGGTGTTAGAGGAAGAAGTACTAAAGGCACTTAGACAATCGACATACTGAGCGACCGGTGAGTCATCTAAACAGTCTAAATGATAGCCCACCATGCTGCGACATGGCTAAGCATTAGAAGCGGTGACGGCTATGCAGCACCCTATCGATACGTCTGTTTGGACGATGAAAACGCTGATTACTCATCTAAGGCGGTCGCTGTATTTCACGACCAGTGCTCTTCTCGCTTCCAAATTACATCCTATCGACCGTCACGGCTAGTTGTAGCGATAGGGCTGTGGGTAGGGCTCAGTCGACCCGTTCAAGCATCGCCTGCTGCATAAATGATTTAGTACCGTAAACGATGAACAAACAAGGAAAAAGGAATGAAAGTCTCGTTAAGTCAGAAACGATTAATAGGTCATTAAAACTTACGGCTCGATCAATTCAGCTGATACGATCGCCTCGCCGGCGCTCCTAATAATCGACGGTAAACGGACTCACGTAAACGACATTACAATAGAATCGTTTATTAAGAGTCAATAGAAAATCAACAGTATAAATCTAAACTAGCTCATGTAAGAACAGTAACTACAATTTAAGTCGCCATCCAAGCTGCTCATGAGGCTGATTCACTATTAAGACCACGGCTCTGCTATGCGACATTAGATCTCAAGCGCACCGGGAAGGAAGAAAGGAGTATGCGAGCTTCTTCCCCTTCCTATAGATAAGCCATCGAACGGATAGAAACTTTCTATAGGTCACGAAGCCCGACCAATGGCACAGCCGGCGTGAGAATCGATCTGTCTTGTCATGGATTACTTAGAAATTTATTAGAAAGGAAGTCCGCCAAATTTAAAGTTATTTAGAACTGTAAAGCTCAGGCATTTGCTGCATTATCCTTCGTGATGGTTAAATATTACTGTCAGCCTGACATCCCTCCTCCCACCGTAGATGGAGTAGCAGGGCTGTGGATGAGTTGGAAAACTACCTGATCATTCGTCGGTGGACAGTACACGAGCACGGAAGGAGGAAGGCTGATGGACCCTGCTCAATCCGTCGTATTTAGTTACCAGTCCCCTTGTACGCTAACTGATGGTGACGACAGGTTCATTAGACCAAACTGCGACTATTTAAATACGATGGTCACTGGTCTCATTAGAATACGTACAGTTTCCTTCTCGCGTACTGCCTTCCAAAGCTCGCTGAATGGATAGGGCTGATACTGTCGCCCTGCCGACCGGCTCACCTTTGGTCGTATAAAAAGACGTCTCGCATATCTGTCAGTGATTCCCGCTCATACACGCTCGACTGCTCAACGGTGGATTCATTCAGTGTTTCCTGCCGGATACGTGCACGTTGTCACCTGTTCAACTTAGAACATGAAACCTCCTCCTCCTGGAAGGAATCTACATTTATGCCGCCACTCAAGGCGGTAGTCACAGAAAGGATTTCCAGCCGTGCTGTCGCCAAACGACTCATCATGCCTCACGCTAAAGAAAGCGTCACGCTGTACGTTTCAAGTTGGCATTCATCATGCAGCTGTGAGAATAGATAAAGCACCTTCTAAGGACGAAGTACATCCATACCGGATTCAGTCGCGCTATTCGGTTAGTACCGGGAACAGCAAGATACCGATCTGTGGCACTTCATCAACTTCCATGCGATAATGCCTTCATACGGTCCAAGGAGGCCCATGGTGATAATGTTCGTTAAAAGTCGTGACGTAGGGACCGTATGTCTTCAGCCTATCGTCGGAAGCGAGGAAGGAAGCCCTTGACCAGCCCTGCGATAGGTAAAGATTCCCACGGATTGTAGGTCCTCCTGCTAACAATCCAAGGTGAACATTCTGTTAGGGCTTCAGTCGCTTATCTCGCTTAATGGATTCACGAGGCGGCCTGAATACTGTACCGCCTGACGGGATGCGCCGGATAAACCACTCATCTCAATTACCTCATTAATCCTTAGCAATCGGTCATGCCTGCTTAAGCGTATTAACATAGACCTTAAACGGTCATAATCTGTGCGATGTAAGCCTATTAATTGGCTGCTTTGGTGCAAGATAACGTTGTGTATGCAAGCTTTCTAACATGTCCCTGAGGAAGGAATATTCAGCCGATCCAGGTCTTCCTTGCTCTCATAGTGCGTCGACGACCGTTACTATTTAACTTTAAGGCTTTCAGGTGGCTTCAGCTGCGCTTCCATTCATACGGCTGTCTAATCAAGCGGCCGTTTTGCCCGTTGCCTTAGTGCGAATTTATCCGCCTGCTTAGGGTTGGGAGCGCTCTGATACGTACATGTCTAAGTGCATCATGAGTTGTACTCAGTCCCTTTATTAAGCAGGATTGGTGCTGAGACATTCCGCTTCCTCAGTACGGTAACGCTTCACGCTTGTCGGGACATGCTGGCTGATTTTCTCATTTAAGCGGTTGCGGAATGGGAAGGAGCGTGGACGCAGGCAAGCAGTAACCTTCGCTATTCACGGACTTCATTTAAAGTTCGATTAGACTTCACTCGTTGGTCTATTCAGATTCGTGCTTTCATTTTCCGTGGTGTACTATCGGCATTAATTCAGGCTGAGTTCTTGCGACGTAGTCCTCATGTCGGACTATATTCGTACTTCCGTGACCTTCGGTATCATGCTGCGCATTTGTTATTGAGTGCTGCTCAGCTTCGTCGGGGCTTCAAGCAAGACGGGCCTTTGGATCAGCCAGACGAGCCCGCTTCATCAATTAATC	*	tp:A:P	cm:i:5	s1:i:42	s2:i:0	NM:i:16	ms:i:92	AS:i:92	nn:i:0
+86	4	*	0	0	*	*	0	0	AAAAAGAGGAGCTTGATGACACGATGAACTGCCGGTCAGGACATCCCCTCAGCCGGGAAAATGTTGAAACTGAACGGATGAAAATGAGGTGGGATCAGCGCAGCCGGATACCGTGATTCTGGATACGTCTGAACTGGTCACGGTCGTGGCACTGGTGAAGCTGCATACTGATGCATTCACGCCACCGGGATGAACCTGTGGCATTGTGCATGCAGCGGACGCGTTCGTGCAATGTACGGTGCAACGCAACCCAGCCCGCGCGTGCCTGACGCAGGCAACTCTACGGGGAGCGGTGCTGATTTTCTTCGATAACCTGTTCGATGCTGCCATTGCCCGCCGATGAAACGATACCTAGGTACATGGGAACTGGTCAGCCAGCATGCTATCCGGTGAGCAGTCAGGTGCGGTGACGTGGTGTTTTGATGACCCTGAAAATACAGCTATGCCGGACAGGCGTGCGCGTTGAAGGCTCCAGCCCGTCCTGTTTTGTCCGGACTGATGAGGTGCGGCAGCTTGCGGCGTGGAGACACGGACCATCCTTAGGAGGAAAATTCTGCTCGGTAATGTTTCGCCGGCTGATGGCGGAAGTTGTCATCTCTGGCTTGGACGGGGCGTACTCCCTGCCGTTAACCCGTCGCCTGAAAGGCGTATGAGGCCATAAAGGTCTTGAGCAGCCGTTGAAATGCCCCAGCCATTAAGCAAACGGGGTGCCTGGTGCGCGCAACCTACATTAAACCGCGTTGCTTCATCCGCGATATCGCAGTCGGCGTCAGGTTGCCCGTGAGACAAAGCGAAGCCCTGAGCGAACTCGAGAAGGAAGCGGAGAGGAGAGGACCGAATCGAGAATCCGCAGTCAGAATCAAATTAACCGGGGGATTTGCCCGTAATCAGCTGGGTAATGCGCCGTGTCCTTTCCTCGCGCCGCAGGCAGTGCTTAAAGGGGCAGCGTTCATCCTGACTGACCACTGAAGACGTAGAGGCATCTTTAGTGTGGTGTAACCCGTTATCTTCGCGGGGCTCATCTTTCGTTGAGCAGCCAAAGACTGGCCATGCTACAGGTCTATCGCATTGGTAGTACAGGGAATATCCGTTACCCCATTTACACTTATGTAGAACTAATCCCGATGGCGGTGCCGCTGACTAAGCGTTTAAACAAATACTTGAGCGTAAGACCGTGAACGTCTGTCGAAGAGCTGGCTATGCTGCAGCATCAACGGCCGGTAATAAAGCGATGAAACATACTGAACTCCGTGCAGCCGTACTGGATGCACTGAGAAGCATGACACCGGGGCGAACGTTTTTGATCCTCCGCGTGGTTTTTGATGGAGGCGACTTTTCCGGCAGTTGCCGTTCATCTCACCGGCGCTGAATACGGGTGAAGCGAGCTGGACAGCGATACCTGGCAGGCGGGAGCTGCATATCATCGAAGTTTCCTCCGTAGCGTAGCCAGGTGCTAAGATTCGCAGAGCTGGATGCGTCGATGGAGTCTAGGATTTATCCGGTATGAGCGATATCCCTACTGTCGGCTACGTTTGATCACCAGTATCTGGTTAGAGCGACTACCGGCGCGACGGCTTACTGCGGGCTGTGGTGGAGTTCAGCCGATCTGACTTATGTCATGCTATGAAATGTCGACGCTATGCCTGTACCAAATCCTACAATGCCGTGAAAGGTGCCGGGACCAGCGGTGGTCAAGTCTAAGGGAGAGCGGCCGGGCACGAAGCGGTTCAGACGTTTAACCG	*
+87	16	utg000001l	36314	60	3628S26M1D6M1D16M1D2M1D2M1D6M1I10M2D3M4D24M1D1M1D3M3D4M2D19M3I17M1D2M3D13M1I1M2D3M1I13M4D2M3D2M1I4M2D2M1I14M2D12M1D9M1I5M1I15M2I2M1D3M1I8M2I20M2D11M1D4M3D2M1D2M1D4M1I2M1I7M2D3M1I20M1D6M1I4M1I6M2D1M1I8M2D4M1I5M3I4M2D2M1D14M1D9M2I4M1I8M3D10M1D14M1D4M1D2M4D9M2I3M3I4M1I4M3D21M4D9M5D39M2D4M1I14M2D12M5I7M2D2M2D3M1D2M4I4M7D8M5D2M1D25M6D5M5D2M3D2M2D10M1I6M1D4M1D4M1D5M1I3M4I5M1D25M1I5M2I13M1I2M2D12M2D26M4D7M1D6M1I10M1I3M1I4M1D4M1D1M1D11M3D6M6I13M1D13M1I6M2D7M2I4M2D10M1D2M1I11M1D4M1D3M1I7M3D2M1D5M1I14M2I2M1I8M1D3M1D1M1D6M1D13M1D10M1I8M2D9M1D6M3D3M2I2M1I10M1D4M1D7M1D7M1D5M2D29M3I5M1D12M8D1M2D10M5D6M5D4M1D2M1D23M7D26M2D12M2I13M1I12M1D2M2I1M1I21M2I1M1D5M1I3M1I22M1D17M1D8M1I19M2D1M1D20M1I11M1I3M3I27M1D13M1I6M2D7M1I4M1I2M1I37M3I9M2I13M1I18M1I4M1I2M1I2M3D13M1D7M3I14M1I15M2I13M1I5M7D3M1D10M2I6M3D3M1I10M1I3M1D7M2I11M1D1M3D1M1D14M1D5M1D11M1I10M1D2M2D2M2D14M1D1M1D2M1D1M2D17M1D16M4I3M1D2M1D7M2I6M1I5M1D3M2I2M3I8M2D5M2D1M1D6M2D11M1D11M1I10M1D5M1I2M1I27M2D15M1I39M2D22M1D13M1D7M1320S	*	0	0	CTAAACATAAACCTTTAAACCAGGTCGTGAAGATAAAACGCGTTGTAAAGTACCCCCGTCAACTAGATGTAGATGTAAGGATCTAAGAGGAGTGTTGCGTCCCGATAGGTTGTAGTATCTGATAGGTTTGATGAAAGTTGTTAAGGAATATGGCCTGCTGAATAACGTCCGGTGTAATCGGCGTAAATTTAATGAAATAAAACATTAAAGTACGACATGCAGCGGCGAAATCACGCTGATTACGGTAGGGCTGATACGACCCGTCTACACCAGTCAATGGAGGTTACATTTACGCGCTTAATAGATGAAAAGTTATTAATTGAATATCCACTAATCACGCTGATAAAACATGTCACAGAGCATTGTTGAACCCGAGTAGCGATTGGCGATGCAGACGCAAGAGTGAATGCGGCTAAACATCTGGCTATTAAATTTACACGGGCTAACATACGGCGACTATGCACTACTTCCAGCGCTTGATATAGATTTAATAAATAAGCCGGGCTAGGCTGAGGTAGGACATAGGCGTCAATTGACCCTTAATTTTCATGTGCAAGCAGTTGTTCGTAGACAACCGAAACGTACGGTGGAGCCGGAGATAATCCAAGGGAATATTTCATCTAGGTGAGAAGTGTCGAATTGACGAAAGCTAATCCTGAGGACAATATCGATGGCGTGAGGAGAACATGTAACGGCTGTTATTCGTGGTGGGATTAACTTAGAAAGTTTTAATTTATGAAAGGAAGAGTCCACAAAGATTAAGGTCTTGAAAGCTGAGACATGAGCAAGTTGCTGCAAGGTCTGTGTATTTAGTGGAATCAGGCTGGTCATTGACGAACATTCATGACAGCCAACCGGGTACAGCGCTACGCGGCCAGAGTACCCAAGGTCGATGCATAAGTCAGGGCAAAACGATATGATACTCGTCTAGAAATAACGAGCCTAATTCACGTTCAATTTCATCGCTTTCATACAAGGGAAGCACTAGATAGCGTACATGCGTGATGGTGGATCTAGCTAAACCTTACTCATGAATGACAGTAATAGGGTACTCTTCGTACCGAAACTTTAGAACAGGACTAAGCGTTAAATACATACCGACAAGTTCTAAGACTTATGCAAGTCTGTTTGATAGGTAAAGATACATCTACACGTCAATGGGAAGGTACGTCGTCGGATAAGTGCTCTCTTGCCTGTTTCCAGGGTTAAAAGGTTTCAACGTGACTGAGTGATACACCCTTCATAGAATATGTCTATCATAGGGTCGGTATAATAAAATAAATGTCGTCTGCGTCAATGTGATAACGTTCTAGCCATAGTCAATCCAGTTACAAGAAGCTGGCCAGGAATGCCCTAACGGGGCGTGGATCGATTTCTATTAGAGCTCCCCACGGATATGCGATGCTGCGAAGATGCTAAGATGAGAAGCAACAAGCCCTAACGTAACCGACAGACGATTTGTAGCAAAGTAAAGATGTCTTAGCCCAATAGATAGCATGCGGTCCAGAGTATTTACAATAGCGTCAAGAAACTTCAGTACAACTCCAATCGTTGATAAGCTGCTAGCAAAACCAATTCATACATTAGTTTCGACTTGGCGTAAACAATAGAAATGAAACCGTCGAGAACGGTAATAGCCCACCGACGGTTGATCCAAGCTGCGGTAGGTGTACAAACACTACATTTAAATTTACATAGGGGCAGAAGTAGTGATAGACGTCCAACGAGGCTAATACGCCAATGGACGCAATATGGTTGAATTTATAGTGGGCCGGAGAAGTAAGATAATGTTACTAATTTAGCTAGGAAATGATCACCGTCACGTGGCGTCAATTGTTTAATGGACTTACCATGGTATCCAGATGTGGAGCGAGGCGGTGGAGTAGAGAATAATATGTATTTAGGTGATCAAACGTTAGGATCTAAACTAGACCTAGAATGAGTGCCATAGCCGCTGCTAGCCGCTCGCTTCACCTTATAAGGTAACGTTACCAACGTGATGTAGCAATATACCCCGCTATCATGACCTGGTTATAAAGTTCTGACGTGCACTTTACTCATTCGTTGCAAATGGCGTTAACACAACATCGGCAATATGTTAAACAATCGCGCCCCATACCTGCTCCAGGGTCGCTAGTCAATCCTAAGTTGGACAGGGACACGCTTAATTGATTAAACCCCGTAATTCTGTCGACGTGATGAGCCAGCAACATGGCATCGGCTTCATCGACAGTTCAATAATGCCCGTTATGAGCAATAAGAAAGCCTGGAGAGACCAGATGAGAAATGGAACCGAAACTTCTGCTATAAAGTCGTTTGGCAATAGCTCGCTTCATCACTAACCTGGCTCCCATGGTGTCAACTAATATCAAATACAGTCGCCGGCTGGCAAGTATTTAGAATAAAAGATAGTCTTCTTGATAGTATCACTCGTATTCAACGCTCAGTAGTCGTACTGTCATTCAGCGAGGACAGTATTTGGTTGGTTTTACAGAGTTTATGGCGTCCGTAAAGTAATAGAATGAGTTTATAGCAGTAATGATAGTACAGTTTAGATAAGGTTGCTCATTAGTGGCTGTGCTAATCCTATGCGGCCTCCCATGGCTCGCGTTAGTGGCTAATAATGATGGATCAACCTTGTCTATGCATACCTCATGGCGGTTTGTGGTACCAAGCATTCATCTGTTGCTGATGCCCATAGAGGGCTTTGGTACAGGCGACTATTGCTAACCTCACGATAGGTTAGGCCACTTAGATGTCTCACTTGTGAGGCGGCAGTTAAGAAGTAGATCCGGAGGCGTACGAAAGTTTAGCTGTTGAATTAGGCTGGCTTCATAAGAGAAGCGTAAACAGCAATTTGTTCTATCGAGTAACGCTAGTAGCCTGTTTTAATAGCTTCTACATAGGTCCTAATTGCCTTGGCCTAGGTTTTCAACGTAGCTAAGTGATCACGTGTCACGTTAATGAGGATTTGAAGGTTCCATTCACAAGTTTGTAATTGTTCGACGTTTCTGTCTATCATGAGGCCGGTCAACTTCTAGCTCGTTGTGCATACGTCGTTATTTCTTAAATTTCATGCAACTATTCATAGGGTCGCCGGTTGATGCTGACGGTGAGTCGGCCAGTTGTCGTGAAGTGATTAGTAATTCTATTCGTCGGCGATGGTTTGGATGAGACGCTCGGTAATTTAGCCTTAGCCGGTGACCATAGCCAGGTCTGATGTCGTTTGCTGGCCTACTCAATTAAAGACGTGGAGTGCTAAGATCTCATAAATCGTTGATTATGCTATCGATACGAAGCCAGAAAACAGCAAGCTAATATGGGGCATTCCATGTCTGCTCCTGACTTAAGCCCTCGCGCTTACAATAGGATTTTCCAATGTGCTACCTAACGCAAGATTTCAACTTCCAATCTAATACAGCGTACCGGACTGTTCTTCATCCGGCCTTCAGTATGCCCGGCCTCTCCCTTCAATTTTGCGTGCTATCGGTTAATGAAAATCCTACTCCATGCGGTGCGTTGCCGCCTGCACCCCGAGTCCATCGCTGCAAACGGCTGGAATGGCTAACATACGCAATCTGGCTCGCCGACACGTCGTTATGGAACTGTGAGCTCGCCTGTCACTCACCCCGACGTCGGGTATGTGGTCAGCTTCCCGAAGCTTCAGCGACCTTGTCACTCACGCCGGGATGCAGGAAAGCCACTCTGGCTGATGGACGGGAACGGCCCCGCAGCCGAGCCCTAACCAGTGCGACGCTGAGTGACTCGCTGGTCTCAGTTAAACGTCAGCCGCTGCCTGCCCGGCACGACCAGCACTGATCTGCCGTCAGTTGGCCTGGATGCCGGAAAGGACCAGGGTTTTGTTGAAAGCGGAATTAGATGGCGTTGCCCTTGATACCAGGCATACCCCAGCGCACCGGTCGCCACCCTCAGGCGCCGCTAAGATGCATGCGCTGATCGCACCGGCAAGCCTCTGAAACACTCGAGTACGCTCGCCGGGAATCTATTCGGTTCATGCCCCTGTTGCAGCAGATCAGCCAAGCGACTTTGCCCGCCTGCAAGCTGCGTGGCCACGTCGGCAACGTGCAGCATACAAGCAGATTGGCAGGCGTTATCGCAGGACGGAAATCCCTTCTGTTCATGCCTGTCGGCTCAGCGACTGTTCAACGACTGCCTCTATTTTCGCATCACTTTCGATAAGAAAAGCACGCCCCAACTGAGTCGCTCTCTATGACGTCGGCTTAAGCGACTCAAATCAACGACCAGATCGCCTTTAAGACCTTATTGAGATCTAATTCTCTATTCGTCTCAGCCATTAACTACGTCATCCTCCGTCATGTCGCCACATCCGGGGAATGGCGAGCAACTTCACTTCGTTCCATCAAATGGACACCTCCGGCAAGCCCTGCCGCTTCTGCATCAGCACATCATCTTCATAGCGGCTTCGTCGATCACTCGCGCTTCATCCGTCTAAGACTGAAATCCATGGATGCATATCCTTGACCGGCAAAACTAGGCTGCTAAATCTAGTCCACCCTGCAAAGTGCGATGAGGCAACACTCATGAAAATAATGGGTACTTAGTAAAATCGGTTCATGGCATATCGTGGATGACATCCGGCAAGCACCGGCACGCTTTGGGTCGCCCATCCGCATCCAGCTTCAGGGCAAACCGTCTCACGTCGAAACCTTCTAAGAACAGGCTGCGGCCCGCTGGCGTCGATCTATGCGGAGCAGTGGCCGAGACTCATACAGACATTCACAGCTTTCAGCATGAGAAATCGCTTCAGGCGTACTAATTTCCTGCTCAATCTTTAACGGCTTCAGATTCATGGACGGCAATATGCGTCTGCGCCTGTATTGGTCCGCCAAGGGAATCCCTACAGAACGCGTCGCCGGTTCTGATGGCGTCTTCCCACAGTAAACTTCCGGTCCTTTCTACACTCTTCATGTACTGCTTCATGGATGAGCGAGATGCTCATATCCCTATGCAGGGCATATCAAAGTTCAGAAAGCGTGACGGTCACGTTTATTCAAATGCATTCGGCTTCAGGAAACACTCTGTCGACTCTCCAATTACTGGCGGTGACGGTAATTTCTTGCGTACACAACAACGGAAGAAACTCATGTATTACCGGATACAACCGGGAACTGCTTTACTGCCTGCAACGCAACGCCGTCGTTCACGGTGATGAGTCACTCAAGCGAACAGGAATCTAGCCGAGCGTTTAACACGCACGAAAGCTCTTGTCCACTGCCCTCATGGAAGCAGCAGGGCCTTCAGCTGTCGGTCACTTTATAGCCATCTGGCAGGCGTCACGGTTAATGCCGGTTGCTTGTTACCGTGCTGCGATCTGTGCCATCGACGGACGTCTCACATTGGTGATTTAGCTTCCGGCGATTACTTCCTTCGGTTTCTACGGATCGCCACTTACTTAATCGTACGGAACATTAAACGTCCGTTCGGGAATCCGATTTATAGCACGCGGATATCGCCTTCATTAAACGACGCCAGCAGCCTGCTTCCCTCATCCCGGGCATCCACGCCAGCGGCAAGCTGGATATCTCCGGCACTTCTGCCCTGCCCGGCTTCATTCAGTCTGCATCCCATCATTCGTCATTAGCTCAGCGGATCGTTTTAGATCGCATTTCGGTATGTTTTAACTTTGGGAGACGCAAGGAGAGAATCGGTCCGTAAAGCGATCGCGTAAGAGATAGCTCCTGTAAACCCCACGTGGTCCCGGCACCTTTGGACGGCAATTGTAGGATTTGGTACAGCATAGCGTCGTCTCAATTTCATAGTACTGACATAAGTCAATCGTGAGCAACCCCACAAGCCCGCAATCCTTGTCGTCGCTCGGTAGTTATAGCCGCTGGCCACCATCGGTGATCAATCTGACAGTGCCGCGTATCGCTCATCCTCAATAAATTAGACTCATCAACGCAATGGCTGTAGCAATCGGCACCTGAGCGGCAGGAAACTTCGATATGCGTATCGGCCTCATGGTTCAGCTCTTCACGTGTATTCAGCCGTGAGATAACGGCAACTGCCGGAAAAGCCTCTCATCAAAATACGGGGCGACCAAAACCGTCCCGTCTATCCTCGATGTCTTCATATGCAGCGTTGAATCGAGGCACGGGGAGTCCAGTATGTTTCAATCGCTTTATTACTTCTCAGTCATTAATGCAGCGCATAGCCAGCTCTTTCGACGCATCGTTCATAAGGTCCTCAAATCCTTTTGTTCACTCGTTCGGCTAATCTAAGAGACTTCTAGCTATCAACGGTTTTCTCAGCCACGCTGCATGACATGCCACCGGCCATTTTCATGTTGCTGAATAAACGGAATAAGAAATCATAAGCACGCTGCCGCTATTTTCAGGATGAACGGCCCCTTTACGACGCCTGCGAAAGGACCCGCGCACCTTACCCAGCCTTGATTACGGCAAATCCCCGGTTGAACTTGTCGATTCGGCCGTGCTGGGTCGACGTGCTAGCGTCTTCCTGATCAGTTCGGCGTCACCTTTGTCTCACGGCGAATATGTGACGCCGAATTCGGGAGTCGCGACGAAGGCAACGCGGTTAATAGTCCCTAATGAGCAGCCGGAGTCGGTTTTAACCGTGGCCTGATGGAATTTATCGTGATAAGACTTTATGGCCATCCCTTCAGCCGGCGACGGTCCAACGGCAGGCGGTACGCCCCGTCAAGCCAGAGCCATCAACTTCCGCCATCATCGGCGAACCCGATTACCCAGAAATTATTTTCCTCAGGCTTCAGCGGATCCCGCAAGCTGCCGCAGCCTCATCAGTCCGGACAACAGGGACGGCTGGAGCCTTCAACGCGCACGCCCTGTCGGCATAGCTCATTTTCAGGGTTATGTAAACACCGTACCGGACTTAACTGCTAGGTTAAATACCCAAGTAAGACGCTATCCT	*	tp:A:P	cm:i:13	s1:i:138	s2:i:0	NM:i:632	ms:i:602	AS:i:602	nn:i:0
+88	0	utg000001l	40354	60	1837S8M1I3M1I20M1I12M2D5M1D3M2D6M1D1M1D7M3I12M1I13M2I15M2I3M1D20M4D4M2I1M1I9M1I1M1I10M1I6M1D18M2I8M2D28M3D8M2I4M1I8M1I17M2I6M1I6M2D7M3D24M2D4M1I9M2I11M1I4M1I2M1I3M1D12M1I11M1D7M1D8M1I4M1D4M1D2M1D16M1D2M1D4M1I5M2I10M3D10M1D8M1D9M4I6M1D1M2I23M4D36M1I3M4I13M1I5M1I11M1I1M1I5M1D20M1I5M2D14M3I16M1I4M1D20M2D16M3D14M1I2M2I4M1D2M2I2M1D9M3D25M2D8M1I17M1D3M1I4M2D17M3D4M1I10M3I7M1D7M2I4M3D23M1I3M2D3M1D6M1D2M1D12M1D5M1D5M1D36M1D8M1D7M1D4M1D12M2I12M2I28M3D12M1I1M2I11M2I28M3D13M2D6M2I20M3D21M1D10M1I15M2D4M1I3M2I10M1D26M2D16M1D4M2D3M1I5M2I6M2I22M1I12M1I11M1D7M1I5M3D10M1I25M1D1M3I1M1D7M1D6M1I11M1I21M1D5M1I6M1D7M2D10M1D15M1I15M1I2M2D2M2I7M1D10M2D22M1I3M4D11M2D10M10I10M3I22M2I4M1D6M1D1M1D2M3I26M1I5M2D14M1D10M1D14M1I15M2D17M2D3M1I10M2I18M1I14M2I21M1I38M1D10M1I11M1I27M1I10M1I21M1I1M1I1M1I25M3D9M2I21M3D12M4D5M2D16M2I14M1I11M2D2M1I1M1I12M2D5M1I11M2D3M1D9M1D19M3I17M5I23M1I8M1I11M1I13M1D4M2I3M1D4M2I3M1I24M4I43M1D7M1I3M1D11M5I20M1I15M1I2M2D14M1D17M1I13M2I22M2D9M2I38M4D42M1I3M2D3M1I21M1I3M1I2M2D14M3I1M1I13M1I5M2I4M2D22M1I12M1I5M1D8M1I12M1D12M7D19M1D8M1I2M2D18M1I15M1D14M1I5M1I8M1I24M1I28M2D11M1I28M2I17M1D1M2D22M1D6M1I1M1I11M3I10M1D17M1I6M1D10M2I3M1D9M1D9M1D6M2D11M1I9M1D3M1I9M1I3M4I19M1I11M1I4M1D5M2I2M3I3M1D2M1D4M1D20M2D12M1I22M1D5M3I4M2I5M2I22M6I6M2I13M1I12M1I12M1D8M1I9M1I3M1I2M1I88M1I30M1D9M2D20M2I16M3I17M1D6M1I9M1I11M2I9M2D8M4I12M1D10M1D14M1D37M2I4M1I14M1D5M1D24M2I30M8D1M1D9M3D16M1D7M2I35M9I2M2I1M1D3M2I11M4D11M6I2M2D3M2D27M1I7M1D18M1I10M3D16M1I16M1D22M1D9M2I17M1I7M1D8M2D8M1D11M2I5M1D5M1I4M2I1M1D6M1I6M1D8M3I30M3I28M2D21M2D16M2I24M3I7M1I3M2I2M1I7M1I11M1I13M3D8M1I13M1D12M2I22M2I14M2D12M2I8M1D15M2I1M3D12M2D16M1I52M1I19M4I2M2I2M1I2M3I2M1I14M1I4M1I5M1I35M1D12M1D8M1I3M2D24M1I4M1D4M4I3M1D1M1D4M3I8M3I5M3I6M1I12M1I13M3D50M2I21M1D9M1D5M5I5M1I2M1D4M4I1M2I13M4D4M1D8M3I2M1I9M1D2M1D8M2D22M1I8M4D47M1I10M1I2M3I2M1D11M1I15M1D3M1D20M1I1M2D4M1D1M2I4M2D5M1D9M1D19M1I5M1D3M2D4M1I36M1D6M1D4M2I37M2I3M1D11M1D11M1I5M2D3M1I4M1D16M5D1M3D2M1D7M2D7M2D21M1D5M2D6M2D4M1D4M2D2M3D17M1D4M2D3M1D8M1D3M1I7M1D1M1D11M2I2M1D10M2D7M1D11M2I23M2D13M4D12M1D11M1D4M1D6M1D5M3I4M3D9M2I9M1I12M1D23M1I1M3I1M1I12M1D2M1D5M2D6M1D2M1D3M1D44M1D15M2D5M6D17M1D5M1D5M1D7M1I7M1D21M1I27M1D2M1D2M2D5M1D8M1D10M1D1M1D12M1I33M1I3M1I2M1I22M1D10M5D4M1D15M1D14M1I1M1I3M1I6M1I8M1I4M3I8M1D1M2D5M3I4M2I14M1D12M1D17M2I8M1I16M1D18M1D11M1D13M2I7M1I1M2I24M2D1M1D2M2I13M2I36M1I33M1D35M2D3M1D6M1D9M1I11M1D3M1D3M2D23M3I11M1I1M1I7M3D3M3I3M1D29M2I5M1D16M3D1M1D4M2D4M2I15M1D35M2D17M1I2M2D10M1D10M1D9M2I4M2I2M1I35M2I10M2D57M1I11M1D6M1D29M4D8M1D8M3I4M1D4M1I17M5I3M1I7M1D12M1I1M1I3M2I7M2I3M1D5M2D6M1D17M1I5M1D3M1D13M3D13M1I5M3D3M1D23M3I14M3I25M1D7M2I2M1I4M1D6M1I1M2D6M1D12M1I28M1I1M1I40M2I3M3I15M2I10M1D6M2D6M1D12M1D3M4D13M4I3M3I1M1I7M3D1M1D10M1I19M2I11M1D4M1I13M1D16M1I12M1D7M1I4M1I12M1D7M1I4M2D8M1I12M1D10M1D4M2D10M2D10M1D16M1I5M1D6M1I14M1D11M4I6M3D5M1D23M1D4M1D32M1I24M2I9M24S	*	0	0	CATTGGGTGTTTAACCTCTGAAAGCGATTCGCGTAAGGGTCACCGCTCCCTTATAGACCCACATGGTCCCGGCACCTTTCACCGGCATTGTAGGATTTGGTACAGGCATAGCGTCTACAGTTCATAGGCATCAACATAAGTCAGATCATCGGCTGAACTCCAAGCCGCATCATCTATTCCTAGCCGGTAGTCATAGCCGCTGGCCCATGATATTTCTGTGATCAATTGACAGGCTAGAAGGAGCGCCGAAGGGATCCCGGGATTCCACGAAACGCATGCGTTGTGCTTTGAATCCGGCAGCTGAGCAGGCAGGAAAACTTCGATATGCAGCTCCGCCGTGAGAGGTACCGCCGTCCCTCTCTTCACCGTGTATTCAGCGCCGGCGGTGAGATAAACGGCAAATGCCGGAAATCGCTCATAGTAAAACAAGGGCGACCATCAAAACGTCGCCCCGGTGTCCATTGCTTCTCCAGTGCATCCAGTACGGCTGCACCGTCATGCAGTATGTTTCATCGCTTTATTACCCATCCTCAGTTGATGCTGCAGCGCATAGCCCAGCTCTTTCGGAAGACGTTCACGCCGTATCCGCTCAATGACTATTTTGTTAAACGCCGTGGTCACAGCGGCAGGCCATCGGGATTTTCACCACATCAATCGGTAACGGTTTTCCCAGCCACACGCTGCATGACATGCCACCGGCCTTTCAGTTGGAATAAACGCGCCGGGGAATACGACGGTTACCCACAAGCACGCTGCCGCCTTCGTTTCAGCGCCCCATGACGCCTCCGTAGATTCGACTCCGGGGGCGCGACCACAAGCCGGCGCATCCCCAGCTTGATTACAGGCGATTCCCGGTTAACTTTGATTCTGCTGCGGATTTTGACCGTGACCCTTTCAGCCGCCTGGCCCTTTCCTTTACCAGTTTCAGCGTGACTTTTTGTCTCACGGGCAACCTGTGACGCCGACGCGGGAGATATCACGATGAAGCAACACGCGGTTAATGGCCATTGCGGCGGGGCACCAGGCACCGCCGTTTTGCGCTGATACACCGGCCTATTTCAACGGCCTGGCTCAATACTTTTATGGCCATACATCCCCCTTTCAGCGGGGTACGTTAACGCAAGCGGGCCACGCGTCCAAGCCAGAGATGACAACTTCCGCCATCATCCGGCGAAACCCGATCTACCCAGAAATTTTCCTCACCGATGGTCAGCGTGTCTCCACGCGCAGCTGCCGCAGGGCCATCAGTCCGACAAACAGGGACGGGCTGAGCCTTCAACGCGCACGGGTTTGAGCATAGCTGATATTTCAGGGTCATCAAACACCACGTATCACCGGACTGACTGCTCACTCCATGTAAGCTCTGGCTGACGTTCCCAGCTGTATCGCGTATGTTTCATCGGCGCCGGCAATCTCGCAGCAAGGAACAGGTTATCGAGATCAGCCAGCGCCTCCCGTTATTGCATTCCTTAGGCCAGGCCGCGCTCTGTCATTTCGGCTGCCACACGGCCAAGACACGAAACGCCGTTCCCGGCAGCACAAATTGCCACAGATTCATCCGCGTGGCGTGAAGTGCATCAGTATGCAGCTTCACCAGTGCTCCCGCCACGACCGTGACCAGTTCAGACGTATCCAGAATCACGGTATCCGGCTGCTGATCCACACCCATTTCATGTCCGGTCAGCACATTTTCCGGCTGAGAGGGTGTCCTATGACCGGCAGTTTTCATCCGTGTCATCAAGCTCCTCTTTCAGCTCCTGCCACGCTCGCGCGGTTGTGCTTCAGTTCTTCTTTCGTCCCCGTCAGGCTGACATCACGGTTCAGTGTTCACCCGGCCGCGGAGACGGGCAAATCAGTTCATCTTTCGTCATGGACTCCTCCACAGAAACATCTACGAAGCTCATGATCCCAGTTGTACGGACACGAACTCATCAGGGTCAGCCAGCAGCATCCCAGGGTGCTGACTGAATCAGGGTACTCCAACCGCGCCGTACTCCCCCGGTGTTACCCCAGTTTTCGGGCACGGGGCAGTTAGTCAGTAGCATTTCCGCTGTGCGTCCGCATCCTGAATGCAGCCATAGGTGGCGCAGACTCGCGTGCCTGAGGTGTTCCCCAGCACCCATCGTGTTGTCCGGCAGGAAGTTCTTTTGACGCCGTTCCTACGTACTGTCCCTAGAAACCACAGGACGGAGTGGCCACATCGCCATACATCCCTTATAGACACCGTTTGCCCAGGTCTTTCACGTGTCTCCAGCTCGGAATATGCCTACGACGGGTATCCAGCTTCCTTGACGGGTCGAAAGGAACGGAACAGCGCCCAGCCTTTTCGGATCGAACACGATGATATTCACACCGCTGGCGTTCCCCGTAGGCTTCGATATCGTCGGTCGGGTCATACGTGGACTATGTTACCGCTTGCTCCACTCCGTGCCGCCGGACTGCGTGATGTTATTTCTCCACTGCGCTCCATATCCTCCACCTCAACCGGATCCGAAGGCTTCACCGGTCATGGTGGTCCCTTAAGCACGGCAGAAACTGCCTGCATACTTGCCTCACCGCTTCCAATGGCCTCTTCGTCACGCATGTTCTGCATGGATGCGACGGCGGCGGTAAGCCGGGTCGCATAGAATTCTGCGGATCTTCATCCGGCAGGCGACGCAGGGTCATCTGAGATTCAATTTCAGGTCCTTCGGCTTGACATATCCGAGCGTAAATTCAGGTCGGAGCCGCCACGAAACGATAACTCACCGGAAACAATCGGCGAAACGTACAGCGCCATGTTTACCATTTAGAATTGTAGAGATAGACTTTCTCCGTGGTGAAGCAGGGAGCTCTCACGGAAAAGAGCTAAGAAACAGCAGAACAACACTCTTAAATTCCTTAGCCCATTTGCCGCCAAGAGTTGGGCGGTTGTACATCGACATAAATCCCGTAAAAAGCCGCACAGGCGGCCTTTAGTGATGAAGGGTAAAGTTAAACGATGCCTGATTGCCGTTCCGGCACGGCGGAGTCCGTTTTTCGTCTCGTCGCTGGCAGCCTCCGGCCAGCACATCCTCATAACGAACGCCTGGACTTGTAGAACTATTTAGGCTTATGCTGGTCTGGTCAGCAGCATGGGCAAGAATGCAGACGGCAGGACCCGTCGGTGCCATCCGACGCAACCAGCTTACGGCTGGAGGTGTCCAGCATCAGCGGGGGCCTTGCAGGCGCTTTCGCACTCAATCCGCCGGGCGCGGTCTGCGGTATGAGCCGTTACTGTTGCCTGCGGCTGGTAATGGGTAAAGGTTTCTTTAGCGTCATAAACATCCTTACACTGGTGTTCAGCAAATCGTTAACGGCATCAGATGCCGGGTCATGCAGCCAGCGGTGCCGGTGCTACGCCTTCCGCATCAGACGATCCAGCGCAGTCAATTGGCGCCTTCACCTCTGTGGTGCTGCGGCCAGAATGCGGCGGGCCGTTCACGGTCATACCGGGGTTTCTGCCAGCACGCGTGCCTGTTCTTCGCGTCCGTGCCTCCTCCAAGTTGAGGATCCCCATAATGCGAGCTGTTTTCTGCCGCAACGCGCTGCGGTAATCTGCGCGTTCACGTCCGGCTGCGCCTGTCCCGTTCTCGCCCTCCGTCGCTGGCACCACGTCAGTAACGTCATCCTTGCGAAGCAGTGGGCTGAAACAGTTGTTGATTGAGTCTCTTTTGGTCATTGCGCCGCGTAGAGAAGGGGATTGATCAGTGCATCGAGTGCATCACGCATGACGATCGCATCTAGTTAGTGTTAACAAGTTCATCAGCCAGTCCGGCATCGACCCTCCTGACCGCTGTACACTGCAGCCTCGGTAATCCAGCACAACCGTAGCACGGACAGGCTTATAGTGCCGACAGCTTGCGCAACATCTGCGGGTTGGGGCCGTCTTAAACCGGCAGATGTCTCCCGGCTTTAACGTCATCCGAAAGATGGCTGTAGGGGTTGCCAAGCTACTTTATCGGTCCCCGGCTGTAATCAGCGTACTTCACCACCCTGTTTCTCCAGCGCAGCACCGTGATCAATTACTGTGAGCCATCATGACGCCGATGGAGCCTGTCCGGGCGTCTGCGTGACCAGACGCAGGGAGCGTAGGCGGCACTGGCAGGCAACGTTACCTGCACTGCAGTTCATGTCGTTGGCAAGGCCCATACAGGCTTTTATGTCTACGCACACGACTGCGATGATGTCAGCGCAGTCAAATTCCCCGCACCATCCCACGGGCGTGTCCATATCGATAAGAATGCCGTCCCGTACCAATCGCTGGCAGCTAGTTGCAGACGGGCGATAGTCGCCGTTGTAACCGGTCATCCCCGAGTACGGCTGCAGCGCCCGCGTCCGGGGCCGTAACCAGCGTGCCGGGACACCCGGCAGCACGGCGATGCCGTTCATGATAGTGATAACTGCGGGCCTTCCGTGGTCCGTCATGATGCCCCGGATAATGCCAGCGTCGCGAGTGCCTCCTGGCAGTCAGGCTGTCGCCGGACACCGCATCCGTCAGGCTGCTGATCCCAAGCTGGCCTGCCAAGCGGCACAAAGAAAACCGGCGCATAGGCGGGTTCAAGGCATCAAGCGGCTCATTAAAGGCCATGCTGGCAATATGCGGGAGATTACGCAGCTCTGCTGTCACTCTTCTCCTCCTGTTGATTGTCGCAGCCCTAATTCAATCGCTGCACCGCCCGATGGCGGGCGGTTCCGTAAGACCGGCTGCACGGCGCTCCATGGCTTTCACGGACTTGCTGGCGGCAAAATTTCCGATAGTCGTACCGCGTTTGCGCATCCTTTCTCGTAGACCTCAGTTAAGCTTTCTTTATATCAGCATCACCGCTTCCAACAACTTCTTTCCAGACCATCGGATGGCCACTAGACCGAGCCTATCCAGTCGCAGTTCCCAGGCACTGCGGGCTTCCTGAAAACTGAAGCGCTTTTGAAAAAGGTAACGTCAGACGCGGCGAACGATGGCCTCTTCCATGACCAGCCATAGCACAGAAACATCGGCTCGCCTGACGGGATGCGACGAATTTCGCCGCCCCCATAAAGTGACCTCCACGACTCGTTCGCACTGGCCCGTGCCGTCGAGTAGCTCATCTGGGCATCATTCCGGGAAAGCTGCTCATACGAGACACCCAGCCCGGCGACTAGGATAGCCCGCAGCAGTGACTGCTCAACACGGAGGCCGTTATCCGTATCCTGAGCCCCGTCTGCAGGTTCAGTGAGTCACCCGGCATCAGGTCGGTACTTTTGCGCCTCCCAGCCGGACCCTAGCACTGCGGCGTAATACGCGCGGCAATTTCACCAATCCAGCCGTCAGCCTTTCCCGCTGCTCCTGACTGTTCTAAGCCAGAATAAATGCTATCGAGCCGAACTGCGTATCCAGCCTCTCAATGGTGGCGGCATACATCCCCTTCACAATGGCGCTCTGCAGCTGCGTGATGCAGCGTGAGCATCTTCATCTGCTCCATCACCTGTAAAACACATTTGCACCGCGAGTCTGCCCGTCCTCCACGGGTCATGAAACGTAGTAAAGCCGTGAATGAACGAGGCGCGCCCGCCGGGTAATAGCACGGGGTATCCATGTCCATTTCTGCGGCATCCATCAGGATACCCGTCCTCGCCTGACGTAATCCCAGCGCCGCACCGCATGTCATTAATCTGCACCGGCACGGCAGTTCCGGCTGTCCCGGTATTGGTTTCGGGTTGCTGATGCGCTTCGGGCTGACCATCCTAGAACTTGCCTAGAAAAGCGCCGGGACGATAGTGACGAGACCATAGCATGACGAACAGTTCTTCACCGTTAAAGGCGTGCATGGCCACCCTTCCTCCCGAATCATCATGGTAAACGTGCGTTTTCGCTCAACGTCAATGCAGCAGCAGTCATCCTCGGCATAAACTCTTTCCATGCCGCTTCAACTCGCGGGAAAGGCAACCGTCGCTTCTCTCTCCCCGATGCCCAGATAGCGCCAGCTTGGGCGATGACTGAGCCGGAAAGACCCGACGATATGATCCTGATGCAGCTGGATGACCCGTTGGCGGAGGCCGTTATTGCGTCAGAGATCGTCCCTCAGGCATTGCCATTCCAAAGTTGGGCAACAGGGCTGCATCCACATTTCACTCGGTGGGTTCCACGACCGCAACTGCCCTCCAAATCCGCTGCCACCGCCGTGATAACCGGCATATTCGCGCAGGCCAGAGGGTGCTCATGCCGTCCGGCGCGCAGAAGGGTGGGAATGGTCGGCGTTTTCATACATAAATCCTGCATTATGCCTGCGTGCTGTGTCGGTGCCGGTCTGCACTTCCAGCTCTGCATATATTTTCAGGTCAGACACGTCAGAAGTGTCGTAAGTGGTAAACTCCACCCTTCGTCCGTCTTTCTGTACTGTTGCCCCGTTTACCTGTCATCAGGTCATGCAGTGCCGCACGGGCAGCGGCAAGTTTCTTCCTGTCGCGTCATTCATCTCTAGCGACAGGCATGAAACGCCTGTATCTATAATGCGCCAGTGTTTTCTTTGGTGCTGCACCATCCTCTTCCTGCAGCAGCCAGCAGCACTGAGATGCAGCTGCCAGCGGGAAATACTGATGCGCAGCGCCGCCAGCGCATAAACGAAGCAGTCGAGTGCCTCATTTGCGTCGCTGTTAGGGCGTCCCACAGTATTTTTCCTGCCATCCACCATTTTCGACCTGCTCTTCAGCAGGTTACTATGCTGCTTCGGTCAGATCAAATATCCGGGTTATTCGGAAAGCGACGACTGAGGAAGCGGTTCATCCCCTTCCGGCGTCAGTGTGAAGCGGTTACGAACGATCTGCTCTTTCGCGGTATCCGTACCGATTTCGGTAACGGGTGATCCCGTTTTTGTTTCGCTTACGTGGCATGCCTGACCACCGGCTTTCCGATCATCCCTTTAATGGGGAACCCGGAACAGCCCATGTTTTCGAGCGTTCATACAAGGTCGGGTCAATCCCGCCAGTATCCCAGCAGATACGAGTATGGGACATTTCTGCACCATTCCAAGCGGGTATAGGTTTTATTATGGCCTCATCCACACGCAGCAGCGTCTGTTCATCGTCGTGGCGGCCCATAATAATCTGCCGTCAATCAGCCAGCTTTCCTCACCCGGCTCCCCATCCCCATACGCGCATTTCGTAGCGGTCCAGCTGGAGTCGATAGCGGCCGTCAGGTGAGCTCTAGCCACACGTCAGGAACGGGCTGAAACAATCTCTTTCCGCTCTGCCATCACTTCAGCATCCGGACGTTCGCCAATTTCGCCTCCCACGTCTCACCCCGGTGTTTACGAAGGTTTACGTTCTCCCGTATCCCCTTTCGTTCATCCAGTCTTTGACAATGCACCCGAGCTGGTGAACGGGCTGTACGTGCCATGTGAAGGTCACCTGTCAGGGCTCAATCTCTTCACTGGATGACGAAAACCAGAGAATGCCATCACGGGTCCCAGATCCCCGGTCTTTCGAAGATATAACGGCATGAGTAAAGTTGGAGCTCCTGCTGGGGATGACGCAGGCAGTCTATGGCTCGCAAGAGATAACAAACCTAGTTGGAGGGTCATCCGGCGTCCGATTTGAGGCCAAACGAGTCTCTTTGTCGCACAAATTTAAGATACTCTGCTCCCTCCCCGCAAACCGGGCAGGCAACATGAAAACGCATAAATGCGGGGATTCACTGGCTGCACGCTCAATCGTACGACAGGTGCCTCCCATTTTGGCGTACCGTACGGATGGACTTTGGCCAGACCGAGCCTTCAATACTAGTGTCACCCAGGAACCTTTAGAGAGCCTTCCTGTTCAATATCATCATCAAAGCAGCAAGTTCATCATAACCCTACATCCACCGACTTTCACGGTAGTTTTGCCCGCTTTACCGCCAGCATCAGAAGCCACGCCCATTAGTGAAACACGCTTCATGGTGAGCGTGTTCCGCATTGCTTTGCCATACCACGGGGAGGGCGCCACTAAGGCGACGAATATCACGAATAGTTCAACGGGTCATTTCATAAAGTTCTCGCATCACCATCCGTCGGCAACCAGATAAGGGTGTTGCTGCTTATGGTAAATACTAAGGCATAAACCCCAGCAGCATTTGGAGAAACTGACTATGAACACGGCAGACTTCACCACATTCACCTCACGGATGTATGATCGCTGCCCATCGCATTCATGATCTCACCCCTGAAAGGCAGTGTTTCCCCAGCGCCCTTCCTGGCTGCGCGGATTCTTCGGGGAGATAGTAATTAGCATCCGCCCATTCAACGAGTGTGGGCTCCGGCTCCCTGACAGTGAGCGAAGCCCGGCGCGGGGTAGACAAAATGCCCAGCCTGTTGACTCGTAACTCTGTTCGCTGGTTATTCACTCATAGCAACCCCGGTATCAGATTCATCCGGGGGCTGCTTTGTTCATGGCTTTGATGGATATCCGTTCAGGAAATCAACATGTCGGTTTTCTTCCAGTTCCGGAAAGCCGCTGCACCGACACGCAGGCGTCGAAGTAATGGCAATTTCACTGCGATCGCGACAGCACGAAAATACAGAATGCGGTTTCCACCACTTCAGCGGAGCTCCTGGCATTCTTCAGTTTCCTGTGCGTCGGCCTGCAACGCGTAAGTCGATAGGACGAGTTCGTATCCTCAATAGTTCCTGGCTGGAGATCTGCCTCGCTGGCCTGCCGCAGTTCTTTGCACAATACCGCTCCCGGACTTTTCGTTCTCAATTTCAGCATCCTTTCGGCATACCGGTTTATGACGGCGGCAGAGTCATAAGACCCGCATTACCCTTGCCACCGCCTCTAAGAACGGGCATTCCCTGTTCCTGCCAGTTCGTAAAGCGGTGACTTAGATACTCGCACGAAAATGTCAGCCAGCTGCTTTGTTGACTTCCATGTTCATTCCACGGACAAAACAGAAAGGAAACGACAGAGGCCAAAGCTCGCTTTCGAGCAGCTAGGTCGTTCCTTTCGTCCCAGGGGTATTTTAAATAAAAACATTAAGTTATGACGAAGAAGAACGGAAAACGCCTTAATGCGCAAATTTTCATAAATAGCGACTCGAGGTCGCCGCCGTTCTGTTT	*	tp:A:P	cm:i:144	s1:i:1339	s2:i:0	NM:i:1526	ms:i:5862	AS:i:5862	nn:i:0
+89	0	utg000001l	23583	60	1589S7M3D3M1I19M2I7M1D18M3D7M2I1M1I4M1D5M1D3M1D9M1I10M32D2M1D3M2I5M1I1M1I9M3I4M1D2M4D5M1D2M4D2M1D4M3D5M2D6M2I2M1D3M1D2M2D3M1I7M1I4M1I10M5I3M1I6M5I13M1D5M3I3M2I30M1D11M2D3M1D5M1I9M1I19M2I5M1D4M1D6M1I11M1I3M1I3M1D11M2D10M7I1M1I3M1I3M2I8M2I3M4D13M2D2M3D29M1I2M1I7M2I5M2I6M1I5M1D3M1D8M2I17M1I6M1I8M2D2M4D2M1I12M2D3M1D8M1D5M4D3M3D59M1D1M1D13M3D5M1D2M1I8M5D2M1D2M1I2M1D7M2I4M1I5M1I7M1D7M1D2M3D3M2I3M2D4M1I6M1I12M1D15M1D13M2I1M5I27M1D5M1D2M2D4M1D12M3I3M4D7M1D3M3D3M4D9M2D1M1D9M2D7M1D3M2D6M5D5M3D9M1D14M1I4M1I27M2I3M2I18M1I2M1I1M1I18M4D10M2D26M1D7M3D5M2D1M1D6M1I1M1I12M1D12M1I3M4D16M1D22M1D1M1D2M1D15M1D4M1I11M2I2M1D8M1D3M1D11M2I2M1I5M1I4M1D10M2I16M1D9M1D3M1I2M1I6M1I12M3D3M5D1M2D16M3I3M1I9M1I4M2I9M2D10M1D4M1D5M1I4M1I11M1D2M1I30M1I2M1D1M2I12M1D5M1D2M1I4M3D6M1D7M2D6M1I11M2I12M4I12M6D4M1I2M1D33M6D11M1I8M2I2M3D7M1D11M1D6M6D10M1D5M1I3M1I1M1I5M4D4M3D2M1D1M1D3M1D4M2I19M3D6M5D3M1D11M2D14M1I4M1I4M3D3M1D26M2I9M1I2M3D14M5298S	*	0	0	CTCTGTTACTAATCCCAAAGGGATATTTTCGATCGGTTGTTCAGGTTTCGTTTAGTACATTTAATCCTTTACTCCCTAAAGAACATGATCTCGATCCCAGCAAAGGTCACAATATTTATTTACTCAAGAATGCTGCCACAGCAATAGTTGTAAATCAGGCGGTAATCTCGCTTAGAATTCATTCCAGCATTTATTGGTTTGTATGAGAGGTAATAGAAAGACAACGCGTATGAAGCTACAACCCACCCAGCCAATGACTGAGACTTTTTCGACCAAACTCATCAGCCTCATTTCTAAATATGAAAGATCAGTAAGACGTAATGAACAATTCAAGTGACTAGATGATTCACTAAATTATTTTAAACACATATCCATCGCCGAAGTATGCTTCGAATACTGCATGTTATTTAATAGATGCATAGATGTCGTTGTAGAAGGTCATGTAGTTTATTCGATGAACCAGATTCATCTGCGTGCCGCCTATTGCTCTGCTTTACGAACATCCACCGGACTTACTCGGCTGCTACACGGACTTAATAATTTGCACTCATTCTAGTAGTACTGCACAGGTTCCAAATCCTGCATGTGAAGTCCTACGGTCAAGAAGCAATAATATTAGCCGTCCCACTTGAAGCACGATTGGGTACAGTGGGTTTGACCGTGACAAATTCTTGGATATCACCGTTGCATACGCTTACTCCGATCGTGTAGTCTAAATTATCCATTCTAAATTATAATGGTCATACCGTACTAAATTAAATAGGTTTTAAAGCGATACTGAACAGATGAAAGTAAAGTACAACCAACTACTTTCCAGCGAACTGAGAAATGCTTAATAAATGCTCTAAGTATGATTGGCAGATAATGTTAGAATAATTTCATGTACTTCCCACTTTAAGACAACGGAATATTAATAATGACAGTTATTTACCACTATTCCTCCTACGGTAGTAATTACACTGACAAAGTTAAATTAGAAGCTGTTGACCATAATCTCCAGACAACAATCTAGACAATAATCATGCTTGTTTCATCATGAAAGTGTCATTTGGTAACGACAAATAATCATTTCTTCTATTGCACATTATCCGACGGGATTGCCTATTAATTAGTTCCTTATTCGCCGCGACTGCAATATGAGAAGGTCACTTGCAGTGATGAGGTACCTACCGATTCATCCTATCGACAAGGACATTTTTCTTAGCAATGGTCCAGCAACGAAATTTCGTTACGGAATGGCTCATCTATCGTTATGTTGAATGCCCGGGGACTAGGCAGCAGGAAGACAAACACATATGCATTTCAATAAAGTCATGGTCAACAGGTATCGTTGGAGGCAGGAAGCACTTGGAGTGAAGTGATAGAATGACTTTCTTGACAGTTACAGGAAAACCGTTACGCAAATTTCCCCACCCGTCAGTTATTAGCGACTAAATCTAAACCTATTATAATTTGAATGTAATCCCCAATCCCAGCGTACTTATCATCTTCTAACCACTCGAACATTTTCAGGGATGTAGAAGTACATGAAAGTGAATTACCACGCTATCACGAACGAAAGCTTTACGAGCTGTTGACAAAATCCGGTAACTTGCTCAATTCCTAGGCAGTCATTGGCAACAGTGCATGCACTCGAGAAGGACGTTGTAATGTTGCTCCGACAGCATGTTAAAGTACAGGTCGGTCAACCTGCTTGGCAAATATGTAAATTGGACTGTAGAAAATCATCGCACTCGGCAGGTCAGCTTCACCGACTGCATACGACGCTGTCGGGACGCCTCGTCCATAGTGCCGGCGCCAACTTATAGCAACTGTACAGCCTACAACTCTAATTTAATACATAATGAATGTATAATAATATTAAATTTCTGTACTAATTTACTATGGTTTCTCATAAGAATCATTGCAAAGATCAAACACTGGTCAGAAAGTTGACGGGTCTAACCGTCTATTTATCTAAATATAAGCTCAGCATACGCGGTAGCCGCACGCTCAAAACCGTTGACTAAACCATGGAAGAAGACTTACGATTTATCGCACTTGCTCATTCCCGTGCACCGTGATATCATTTACCTGAATTATTAGCCGCTTGAATTTGAATCAATTCCCAAAACCGCAAAGACCATACTTTATTCAACAAACTAGATCTAGGACTCGTTGACAATAATGTTATTGAAAATGTCAAATGATCCATTAACCTATTGGCTAAATTCCTAATACGATAGAAAATAGGCGATTTAGAAGGTACGAGCAAATCCATATCTTTCATCTTACATTACGAAAGAATGAAGGTTTAAACATGAAAGTATGTTAACATTGTAAAGTTAGTCATATTGCACGAAATTATTCATATTTAACTGAATCATCTATTATTAAATCAGAAGACCTATCGTACTAGACTAAAGATTACCGAATGATACCCTTAATGTATGAAGCGTATAAACTGTAATCTGCCTCCTTAATAAAGGTTACATCTACTTATTCAAGCTTCTATTCGACTCTTTATTTGATGAAGCCGGGAGAAGGTGACTTATTTAAATTAAATTACTCCATAAGCAAATTGTCATTTAGCATGATACTACACCAATAATTCCTGAAGATATTACTAGTCGACTGGTACTCCATAAATATCACTTCGACGACAGTAGTTGACTATACAGCCACTTGCAGAACGACTTTTAAACGACCGTTACACTTCAACTATTAATTTTTATAAACATTCCATCCGTACTTTGATCAATACAACATTTGAAGATCAAGCAGACATATTTTAGTTGCAGCCCTACTAAGTAGAGCGTAACAAAGCCTTATTCACTTACATATTCCATGTAGCCAAAGCAAGCATCTACTCTACAAGCAACCAATACATACAATGCCAATTAGATGAAAGACTTCAGTAATGTCGACCGTGATTCAACGACTAATCAAATGTATTTCATGGCAAATAGTTACGAACTACCGACAAAACGACTTTGACAGATGACAGCGACTCAAATGACGAAAAACCATATTTCCATGCGTTCAGTTAAAGGCAATCCAATGTAAACTACTGAACAATTGAGTCAGACAACCTTCCATTATTCCTGAAAATAAGTACGCCAACCATCCATGACCTACTTTACTAATAGACCCCGAACGTTGTTCACTCCTATACGTTCGGCTCCAACTTACGATCCATAACATAGAAATGAGCTCAATAGTGGCAGTTGATGTACGGTTCAGCACCTCCCGTATTCTCAGCTTCCAGCAACGAGGTTCTTCCTTCTAATTCCGATTGCATGCCGCATCCTGAATCCACAGCCAACTTATACTTAATCACGTTGTTTCTTCCCTCCGGATCGAATACGGTTCTTATTCCTTGACGTTAGCCGGGTGCATTTCTATTCTGTGCTCCCCGTAAGGTACCCAATTTCCGTAACGTACCGGTTCAGAATAAATAACGCGTGCTGAAGCCACGTCACGTTTATCCGATGGTCTTCAACCATTCACGTGCCTCATCACTGTTTAAATACAACAAAGCCAGCCGGAATGGCTTTAATATCGGTACTGTTGCAGGCAGACCGTATCAGGCAAAGAATATGCGTCACCTTCAATAAATTCACGTTCCGGCCCGACCGTACTGTTCTGTTATTCTATTCAGCAGTATGCTGCAAGCTAGTAGAATCAATGAATGTTATCGTCCGCAGTTAGCGTTAACCTTATCTTGTCCGTGGACCCAAGCCGACGAATGGCATGAGCACGTAACCGACTGCTGTGAGCACCAATACCAACTGTAGATGTGCAATAGCAGGCACTCACGGCTGTACCGCTACGTGAAATGGTGCCTTTGACCTTCCGTTTGATAATAAGCACTCTGTCGTTCCTGTTAACTTGCTCTGATTCCTTGGTCAATGTTTACTGACTCCATCAGAACTGTTCACTCCTTAAACCTATTGCGGGCCCGTACCCTGTTCATCTAAATCAGACTGTGATCAAGGTTCCCCGTGTCGTTAATTCTTACTGTATTGAATGCCTGTTTATTTCCGTAATCAAACCACGATGGGTCCTTTCTAGATCCGTGTAATCGGACCCGGACTGTGATCGACTTAATTCCATCCTGTTCCGGACAATACAGCGACGAACCTGGTGGGTTTCCCTTGATTGTTCCGCATCATGAATGACGGAACACGATGATTACCGACAGCAAGTTTGTAGCCCTGTCAACCTCCTTTCGCCTGCATCAGGTGACGGTAACGGAACCGACGTATCATCACGGATCACCTGCCCGGAAAGCCGAATTCTCACGACATCTACAATATTCAAGACATCTAACCAATTTCTAGAATATCCTTCACTCGGTGAGTTCAGATCTATCAGGCATCATTTCAAATACGGGTCACGTTTTGCTTTAGAAGCTCTGCCACCCTCACGTCATGTCGCATATTCCTTCGGTTGTTGGCCCACTCGCGTTAGATATGGTAGCAAATTAGCATCATTCACAGCTGCGGCCAGTGCTTGCCGTATTCAGTGCGTCAACCGTCGAGCTCGTATTAAATTCTAGTAAATTAATGGTCCTCAATCTGGTATGTTTCTTTCACGGTCCCTTGGTCCGTTCCGGGTCGCTTACGTGCTTGACTTTCTGTCTGTTTCCATGTAATTATTAGGACTCATTTAGTTCAATGGATGCACCGTTTCAACGCTGTTGGTTGCACGTGATTGCTCAATATCCTTTCCTTTGTCCGCATCCTCACCGCTACTGAAGCTACTCTGCACTTTTGCCCGAATTTTTACGTATTTGCCTATTCGACGCATTTTATTCTGCGTGATACGGACTTCCCGGACTGTCTCCTTCATTGCCGATGCCGTTTGACGGACTCCTATGTTTCATGTTGAACGGAGCATTTCTCATCGACTTTCCAATGACTAGTCCATCATGTTGATTCGTCTCCTTAACTTTCCTCTTACGATTTTCTGCCCCAGTCGAAGGGAAGCACAACGCTATGAAGCGTAGGGTTCATGTTACTATGATCCGCGTCGCTTTGTAAGAAGCACGCATCCTCCGTGGCTGAAGGCGGCGCTGGAAGTGCCTTAGCAGAAGTAGGAAGAGACGTGGAAGGGTGTGACGCTGCAGGCATTCGTTGGATAGTTGCCCGCACCGGCACTGAGCAGGGATCCGAGCCTGGCGGCACATTGCCCGCTTCAGGATCCAGCTCCCGGTTGAACCATTCCTAGCCCGGCAGCTGTCATCCGACGCACGGGCTCCGAATCGGCGCGTGGAGCATCCCCAGACAAAGGCACTGGTAAGTGGCGACGCAGCCGCAGCATTCACTTACGATCCCCATCTACTTGCACGACGATTGCCGCTGCGACAGTCACGAGCCAATTGAACCGCAGCAGCGGCCGGCATCACGCGTCAGGCACAGAAAACGAGTGCCAGGGTCCCGTTGTGAATGGTGCGCCAGATCTATTAGGGGTCGCGAGTATGCGGAACCGATGCAGCGGGCAGAAGTAATGACATGTACCCCACTCCATCTAAACGCCCGGCTCCATCCGGCATCCTCACGGACGCAGGATCGATCTTAGTGCAGTCAGCATGTGCGCCTACTATGAGTGCCTGAATTTAGCATGGCCGAGTCTCGTGCCAGTCTTGCCCACTCCGAAGCGTACACTGCCATGCCCCAAAGCGCCCGGTTCCGGCGGGGTCCATAATACTGTATTACGGCTAAGCATCAGAATGTAGACCTAAACCCAACGCATGAATGCGTAGTCAGTACGCAGTGCCCTCACGGCCAGCTGCCGAGCAAGGCAAGAGCCAAATCAAACTGAACCGACGACGCTATCCGAGTAAGTCAATGTTAGGGTCTCATTCCCGAACTGCTTCTGGCCGTTGCCTCGCAGGCATTTCTCGCATATTTTCTAGTTCTAAGTAAGCATCCCTACGCGATCATCTAAGCCGGACGATACGAAGGGCTCTACTGCTCCTATTGTAAGCATTAGACGCTAGGTCCGCAGCGCCACTGGCGACTGAGCGCGGTTCACTTAAGACCAAAGCATGTCCGCAGGAACCGAGCTAATCCGGTTCACCCCTCGACTCGTGAATCCGAACCGGTCCACAGCCCAACTTACCATAAAGCAGCTCCACCCGATTCGGGCGCCACGAACTCAAGCTATCCGCCGTACACGTCGAACGCAAGCCTGTACCGAGTCGAAACAGGCTGCTACGAAACGGTTCCTATTGCCTCGACCGCGTTCGCAGGCCGGCCTCCCCACTAGCAAGACAGACCTTAAAGTCACATTTGACTCAAGCCAGCCTGCACTGGAGGCATAAACGCCCCGATTCCCGATCGACGAATCGATCAGTGCCAGAAACCCGCATTCAGCAGCAGGCAATCGAAGCTAATCAGATTCCGCACCGGCCAAACCCAGACCCGTTGAACCATCGGTTTACCGACACTAAGCCGACTAGTTAATGTAGAATGAGCGATCGATTGATTCAGTAAGGCCCCGCAACAATTACACGGGGAGAACAGGGTAACCGCATCCGCGATGCTCTAGCCAATCAATCCACAGCCGATAGCGCCTCGATCACGAATACGTCCGCCATCCCGACAGCGACCGGATCTCCGAATATCCGAAGCATTACAGCCCGACGAACCGTCATCGTACGAATTTAGACTGATCGACGAGTCCACCTCACGCCGGAACTGCTTCTCCGAATTGGCACGATCTCCACTGCACTCCGCGACGGTCGCCGTACATTCCCGTCACGATCACGGAGAGCAGGGATTCAGAGCATCGGCATTAGCGAGCCGTTCCGACGAAGTCCGGAAGGCCGATTCATGCAGTTCGGTAATGATCGTACGGAACCTAAAGCCTCTCAACACCGTTTCATTCCGATTTGGACCGAACCGCGATACGATAACCCTTGAAGCATGAAACAGAATTGCCGGTCTAGCAATCCCCATGCAGCAGCGATAGCGACAGTAATGTTTGCCGTCGTCTCAATCCGACGCCATTGCTAAGCATCCAGGGAGAGCAGCGTCTCCATCCTGGGTTCGAAATTCCCAGTCTGAGCGGCGTTCCTCCCGTCAGCTCCGCACCCTTTCCAGCAGCTCCTTAGCATGAGATGGGATGCGGTTCTCCTTAACCGCTTACTAGCAGATCGAAGCCTCAGTCGAAACCGACGCAGCACTCCAAGGGAAACCGCATTACGCGACGGTATTCACCGGGCGGATATAAAGTAAATAAAGCCCGGTTTGATACTGGGGGCTCCCAGTACAGCCGTATACAAGAGATAACGCGTGCTGGGTTCAATACCCTGATCCGCAATCGCTTTGCAGGCGACCAGAATCAACTGTAAGCGTGGTCAAGCTAAACGGCAGGATCGGGCAGTGGAAGTCTGGCGCCCGGGAGTCGACAATCCACGGTGCTGCCGGTGCATCAAACGATAGACGAACGCAGCATCAGATTCCGTCTCGACCGCATTACGCCGGACTGTCACCCTTAGTTCCCCAGTGCGATGCGGCAACCGGCGTTTCATCGATCCTTCCGGCGTTGTAAGCCCCTCAGATCACGTCGTTGAACTTACGTCAGACTGGAGAGCAGGAATCCACGCAGTTCGTAGTCCGAAGCCAGCATTTATTCCAGGGTCTGCAGTAATTCCGTCAGTGCGTCGCAGCGATTAAGAGTCCACCGGTTGCCACTCCTGTTCAGCCGCGTCAAATGCGCGTTCCACATCTACGCTCTCCTTTCCGAGCAAGCGCTGCAACGATGGCATCCGTTGCGTTCTACGAAGGACTCACAGGAGCGGAACAGTCGCAGCTGGCAGTACTCAACGCAGTCGGGATTGTAATTCCAACGCAACACGGTATTAAGGATCCTACGTCAGAGGAGCGCGAAGCCTTTGACGGATCGAATTCCATCTAGGCAACTCGGATTTCATCCGCGTCAAGGTCCGTCCGTCATGCATCGGGCGATGACGGAGCATTCGATTTGAGCGGTCAGCGTCGGAGTCCGGACTTAACGCTTCACCGCAGCACGAAGCGCAGTGCTGATGGCAGCATTGCAATAGATTTCGCAGTCAAGCGACAGAATGCCGGGATCTACGTCCTGATGAACGGAAGCCCGAATTATCTCCTACCGGTCCGTTCAAGGGTCGGTTCCGTGGATCGCTCCCGAAGCGTCGGTAGATCAGAAGCTCCGGCACCAAGGATTGAACTGGCATTCGCCTGCGTACCATCGAAGCGTTCGAGTTCTCTCTTCCCAGCCGTCCGTCTCCGATGCCGTTTGTTCAGTAAACGCGTCTAAGAGCGGCGCCAGCGGAGCGGCGAATCATGTCGGAGCGTCGAACGGATCGAGGAGCCGTCTGAGGTTGGAGCGGCTGGATCTGAGCGACGAGGGCTTGCATGCAATCACGAAGCACGGATGCTCATGATTCAACCGTAGCACCACAGCTTCGATTTAGTCAGCAGAAAACTTCAGGCTTCTACTGCATTTCCAATCCTACCCCGGCGGTCACCGGTAAGAATGCATCACGCGAGCAGAGATCGGAGCGCTCCAAAGCATCCAGCGGCAGGACCGTTATCATGTAGACGCGTGTGGTCAGTAGGAAT	*	tp:A:P	cm:i:12	s1:i:88	s2:i:0	NM:i:637	ms:i:168	AS:i:98	nn:i:0
+90	0	utg000001l	34893	60	10S14M2D9M1I13M2I8M4I53M1D12M2I11M2D22M6I1M3I8M1I7M1D15M4I7M1D2M1D9M1D1M2D11M6I2M3I3M2I6M1D11M6I2M1I4M2D23M1D2M2I3M2I2M1D32M2I14M2I14M1I6M2D2M3I12M1I20M2I2M3D16M1I1M1I11M1D11M2D4M1I20M1D14M2D5M3I3M1D5M3I14M2D23M2I3M1D4M2I1M2I20M2I6M4D9M1I36M5D14M3I22M2I1M1D8M1D11M1I6M2I4M1D8M1D10M1D2M1D15M2I3M1I3M1I7M1D4M1D1M2I14M2I19M1D11M1D4M3I19M1D25M2I5M1I6M1I23M1D9M2I9M2I5M1D17M1I6M1D7M4D5M1D5M1I4M1I7M1I5M1I1M2D23M1I16M1D3M1I1M1I4M1D3M1D6M1I2M1I5M2I30M2D24M1D7M2D5M1D10M2I33M2I3M2D7M1I1M3D12M2I16M3I3M1D11M2D2M6I33M4I2M1I2M1D23M3I8M3D44M2I11M1D9M1D6M2D15M1D1M2I12M2I2M1D7M6I4M3I8M2I6M2I3M1I2M1D15M2I4M1I9M1D10M2D16M1D14M2D9M1I4M1I22M1D3M1I41M1D6M1D8M3D3M3D10M10I2M4I4M1I2M1I12M1I8M1D18M1I5M1D12M1I10M3D8M5D17M7I1M1I21M3D5M1D9M1D10M5I5M2I11M1D4M1D1M1D4M2I6M2D11M2D3M1D6M1I1M3I5M1I3M1D7M3D4M1D20M2I10M1D18M1D3M1D3M1D26M1I20M1I7M1I25M1D2M1I3M1D10M2I8M1I22M1I9M1D22M3I18M1D8M5D1M1D33M1D2M2I10M5I5M3D24M1I3M1D5M1D10M3D24M5I6M1I21M3D5M2I3M1I20M2D12M1D6M2I12M2D3M1D22M2I17M2I1M1I18M2I22M2D8M1I2M3I7M2D1M2D17M1I5M1I15M3I9M2D10M1I2M1D23M1D1M4I26M1D1M1D14M1I15M1D17M3I14M6D19M3D21M1I5M3D1M1D15M2D9M1I3M1I14M1I7M1I30M2D2M1I23M1I2M1I16M1D11M2I16M1I13M1D10M3I47M2I11M3D1M2D2M3I15M1I5M1D12M1I10M1D8M1D25M2I18M1D8M4D6M3I43M2D2M1D2M1D11M1D11M2D17M2I28M2I4M2I8M1I1M1I9M2D4M1D3M3D7M4I1M1D3M1D14M3I19M1D9M1D5M1D5M2I4M5D14M1D4M3D14M5D6M4I6M1D10M3I1M1D7M1I13M1I8M2D5M2I4M3I2M1I4M6I5M2I9M1I5M1I15M4D6M1I7M1I33M3I5M4I3M1D29M1D11M3D17M1D33M1673S	*	0	0	GCGCAGCATGCTGAATGGCTGTACCGCCTGACGCGGATGCGCCCCGCCACAACAGCCCCGGCCAATGGCGGTGCCGATACTCCCGACAATCCCCACCATTGCCTGCTTAAGCAGATTTCTGTCATCATATGGACAGCACGAACGGGTGAAGCTGCGCAGTTCTGGACTGGGCTTGGTGCTCGCTGCCGTTAGGCTTCTCCCGCCGACTTAATGGAGACGCAGCGAAAACGGCGGCTCTACAGGCGGTATTGGTACAAGAGAGCATGTCCTTAATTGTAGGCGCTCTTCCCACTCACTCCAGCCGATTGCCAGGCCTGCCATCGAATTCCCGCGAAGCTGGTCTTCAGCCGCCAGGTCTTTTCTGCTCTGACATGACGTTATTTCAGCGCCATAGATTATCAGATAACTGTTCCTTCAGGCGCTGTTCCGTGGCGGCTTCCCGTTCTGCCTGCCGGTCAGTCAGCCCCGGCTTTCGCATCAATGGCGCTCCGTTTTGCACCCAGCGTTGCTGTGCTTAGAATTTATCGCCTGCGCCGCGCCAGCGCGTTCAGGCATGCGGTACGTAACCTTTAGCCAAGTGGTGCAGCCATAGTGAGTTTGGGCACTCCGTCTCATCTTTTATGCGCCATAAGGGATTTCTCCTGTTAAGACAGAGCTGGCGACGTTGCCACCGCCTCCTCCAGTACCGCAACCATACTCTCCGCTTCCACAAATCCCCGGCCTGCTGCTGATTTGCATTTGCTCCGCTGCTTCTCCAGCGTCTTAGAGTTCTGCCTGAAGCGTCATAAGGCAGCATGAGCCAAATTTATTCCTGACGATCGCCGCAAGACATTGCATTGTACGCTGGACTGTTTCGGCTTTTCAGCGTGCTTCATAATCCTTTCGCCGCCGCCATCAGTGGTGTTGTAATCCGCCTGCACCATTTCCCGTCCTTCTTTCGTGCCTTTCCGTTTCTTCCTGGCCTCGGGCTTATTTCTCCGGCGTCTGCATGAGTCCGGCCACTTCTGCGCCTCTTCAGTATTTCAGCCGTACGCTGCGAGCTCGAGCGGCGCTCTAGGCAGTGCATCTTACATGTCCGCTCTGCTCAGCCTTCTTTCGGGCGGCTTTCAAGCACGACGGGCCTTTCACGATCATCGAGTAACGCCCCTTCATCGTTAACAAAATAATCATCCTTGGCAGATTCCATATGTCTGGTCCTTCTTATACGCAGCCTCTGCTATTAATCAGCATCTCCTTAGGGTGGTATCAGGACAGACCACATCCAGCACCGCATCCCACATGGATTTGAATGCCATTAGGACGAGTCCTGTCTGCCCAGGTCTCCAGCGTGCCCATGTCCTTTCAGGCGGCGGGTCTGGTCATCAAATGGCTTTCGTTGCGGCCTCGTTTAGCGCCTGCAATGCCCGGCTTCACCTCAGGAACGTGGGCAACTGAGCAAAGCAACCGCGCAAGTGGTGCTCCACGACACGTTATGGGACTGGCGAGCCATCATCAGTCAGCCGAGGACATTTGGGTCTTGGTGAGCTTCCGAAGGCTTCAGCGACGTGTCCACCTCCACCGTACGCACAGAGAAACGCGCCACACTCTGGCTGATGACGGCAATCTGAGCCTCACCGCTTACCCCCGCCTTAACCAGTGCCTGAGTACTCGCTGTTGGGTTAAACGTCTGTCGCTTCAGCCGCTGCCGCCTGCCAGCCCGGCTCTGGACAGACCAGCATACGATCTGCCGTTCAGTCCCGCCTGATTGCCTCGCTCAAGGGGATTCTTCTGGCATGTTCACTTGTTCTTTCCGCTGATACCAGGCATACTCCAGGCACCGTCCGCCACCGCCAGCGAGGTGGCGCGCCTACAGGAGCAGCAGGGTACGCAAGCAGGCACCGCGAGAACAGGGGGAGCCGCTAGGCCGACAGGAGTGCTTGCTGCCCCTGTTGCAGCAGGATCATGGACGGGACTTTACGCCGCCTGCAAGCTGCGTACCCTTCGGTGAACTGTGCAGGCAGCATACCGCATGGCGGCTTTATACTCTGCCCGACTAGAAATCCGCCATGTCTGTGCAGCCGCTGCCGTCGGCTCAGCACGACTGTTCCGACGACTGCCGCATGTTTTTCGCATCACTTTCGTGACAGAGACTGACGCCTGACTTCTCTGGCCATCTGCTCGTCAAATCTGAGCATCCAGACCCAAATCAACGACCAGATCGCCTAAGCGGGTTCAGCCATACATCTACCTCCTCCTGCGATCCCTTCTGATACTGTATTCTAGCATTACGTTCCTCCGTCATGTTCACACATCCGTGAAAGGAAGCGGGATAACTTCATTCCCGTCCGTAACGCACGGCACAGCTCCGGCAAGCCCTGCACGCTTTCTGCATCAGCAACATCATCTTCAGGCTTCGTCAGCCTCGCGCAGGCCGGTCGTCAGCAGACTGAAATGCTTAGGCAGATGCATATCCGGATCGCGCTGAAAACAGGCTGAGCACGGTACGTCACGCATAGGGAAAATGCATATCCGATAGCAGACTCATGAAAATAATGGGTACTGTGTTAAAGCGTTCAGTCGGCATGACCGTGGATGACATCCCGGCAAGCAGCAACGCACACCAGTCGGGTCTCCCCATCGCCCGCGTTTCCGCGCAGAAGCGCAGCGCCGCGGGCACAGTGCTCCGAAGGCAAAGAGGAGCGGGGCCGTCCTCTGTCTGTTTAGGATGGTTCACCACAAACTCATACCATACAAGCCGGTACACCACGTTCAGCATGCAGAGAATTGCCTCCGTGGTAAAGTATACTAGCACTTCCTGCTCAATCTGTTTATAGGTCGGTTGCTGGACGGCATCTGCGTCTGTCGTCCACTGGTTATGCCAATGACAGCGCCATAGAAACGCGCCGGTTCGTAATGGCGTCTTCCCACAGTAGACTTCTTCCGCTTTAGGTTTGACTGCGCCTGTTCTGCCTGCCCGTTCATCAGGGCGAGATGCTCGTACGGTGCATGAGGACAGTTCCAGAAGCGTGACGGTCACCCGTTGGTTCACTGATTCAGTTTTCAGGAACATCGCTGACTCTCCGGATTAACTGGCGTAGACCCACTTTCTGCAACCGACGCAGCAAACTCACTAAGTCCGGATACAACCGGAATGTTGACTTGCTCTGCAGCAACGCGTTCACGTTGGGTCATACCACTGACCGACACGGTGGCTTTTGTTTATCCGCAGACACAGCGCAATCGACACCTCTGGTCGGTTACCCTCCGGTGGAAGGCCACGTCAGCGTGGTGCTCTGCTTTCATTCACGCAGGTGCTGGCAGGCGTCACGTCATCCGGTTGCCGCTGTTACCGTGCTGCGAGTGTCTGCCATCGACGTCCCACATTTATTGATACTTTCACATTTAGGGTGATCACTTCCTTCCGTGCGCCGAGATAGCCGAAGGCCAGGCGCTCACGAGACACGAAAAGGCAGCGAAGGATGCCGATGCTGGAACCGGTTTGCTCGGCATATCTCGCTTCCTGCCTGGCCGCCAGCGACGCCTGCTTCCTCGCTGCTCTCGCCTGCATCCACGCCAGCGTGAAGCCTGGTATCCCGGCAGATTTCCCTGCCCGGTCGCAGTGAGTCTGCATCTTCATCATCGAGATAGCTGTCGTTAGGGACTCAGCGTCAGTTCACGCCATGGTGAGTCAATGTATGTTGACTTTGCGCCAGACGCGACCAGTCAACGTCTGAAATGGATTCGCGTAAGGGTCACCGACTCGCGTAGCTAACCCACAGGGTGTCCAGCGGCACCTTTCACCGGCATTGTAGGATTTGGTACAGGCAGCGTCCTCACATTTCATAGGTAATGACATAAGTCAGATCGGCTGAACTCCACAAGCCCGCATCATCGTCTCCGCCGTAGTCAGGTCGCTGGTGGCCTACACTACTGGTACGTAAATCTGTACCCGTGTAAGGGATATCGCTCATCACGATAAATCCATGGGATTCCATCCACGCAATCCAGCTCTGAGATCCGGCACCTGAGCAGGCAGGACAAACTTCGATATGCCTCCCGCTGCCTAGGTTATATCGATGTCCAGCTCCTTCGCCCGTGTATTCAGCGCCGGTGAGATAAACGGCAACTGCCGCAAATCCGCCTCATCAAACAGCGGGGCGACCAATGATGATAAAAACGTTAGCCCAGTGTCATGCTGCTTTCTCCAGTGCATCCAGGTCCGCTGCACCGAGTTCAGTGTTCATCGCTTCTGCGCGCTCCTCGATTCCTTGCCTTCTGCCGAAAGAAGGCCACGTGCAGGGTCCCGAGCTCGCGACTGGTTTTGTTTAAACGGTTGGTCAGCGGCAGGCCATCGGGATTTTCACATCAATGGGTAACGTTTTTCCCATACACGCTGCATGACATGCCACCGGCCATTTTCAGTTGCTGAATAAACGCACCCGGGGAACCGACGGTTGGCCCACAAGCACTGCCGCCACCTTCAGGGATGAACGCTGCCCTTTTACGACGCCTGCGGCTAGAAGGGACAACCAGCGCATTACCCATAGTACTTTACGGCAAATCCCCCGGTTACTTTGATTCTCAGCGTTTGATTTTACGTGCTTTTCAGCCTGGCCTTTCCGTCAGTTTCCGGCGTACCTTGTCTCACGTCGCAATACTGTGACGCCGACTGCGATATCGCGGATGAAGCAACGCGGTTAATAGGCCATTGCGGCGGCAGGCACGCCGTTTGTCGATACGCTGAGGTTTTCAACGGCCTGCTCAATACTTTTATGGCCATACATCCCCCTTTCAGCGGGACGGTTAACGGCAGGCGGTACGCGTCCAAGCCAGATGACACTTCCGCTATCATCCGGCGAAACCCGATCTACCCAGAATTTTCCTCACGATGTAGTCAGCGTGTCTCCACGCAGCAGCTGCCGCACCTCATCAGTCCGGACAAACAGATGACGGCTGAGGCCTTCAACGCACGCCCTGTCCGGCATAGCCTGATATTTCATCAGGTCATCAAAAGGATAACACGAGAGCACCGCAGTAGAACGCTCACCGACGGATTGTGAGAGACCGCGTGTCTGCGTTTCTATCGCGCCTGGCGGGGATGGAGGGAGTGCGCAACCATGTTATCGCAAATCAGCCACTAGCCCGTTATTAGAGGTTGTCCATAGAGGGCGTCATTTCGGCTTGAGCCACACCAGGCGCAGACAGGAAGCCCGTTGCTAGGGCAGAGCACAAATGCACAATTGCTCAAGATTGAGTCAGGTCGATGGCGTGAAGCTTCACCAGTGCAGGCTCTCAGTTGACTCGATTTCATAACTGTACAAGAGTCG	*	tp:A:P	cm:i:51	s1:i:542	s2:i:0	NM:i:969	ms:i:1860	AS:i:1860	nn:i:0
+91	0	utg000001l	40370	60	4727S28M1D10M2I5M2D17M1D8M1D8M3I11M2I11M2D1M1I17M3D12M1D7M1D2M3D8M2D6M5I9M1I7M2D11M1D3M1I12M1I6M1I5M2D5M2D9M1I13M1I10M4D12M1D29M1I5M1D10M1D5M5D5M1D9M2D3M1I2M1I15M5I5M1D5M4D7M1D2M2D11M3I15M3D8M1D8M2D18M5I15M1I8M3D20M3I2M2D6M1D3M1D5M5I5M2I3M1D5M1D14M1I1M1I3M3I10M1I3M1D2M4D7M1D2M2D14M5I5M1I30M1I7M1I1M2D8M4D19M1D7M4D11M1D32M2D4M1D5M1D2M3I5M1I11M4D20M1D6M3I3M1I3M2D11M2D7M3D3M2I8M1I6M2D3M1D6M1D4M1D2M1D7M1D5M1D3M1D9M3D2M2D2M1D15M3D1M1D10M1I11M3D12M1I3M1D7M3D1M4D10M2D8M2D5M1I4M1I3M4I5M1I6M3I4M1D17M1D6M3D13M1D5M2I10M1I1M1I8M1D13M1D4M3D5M1D6M2I7M1I8M2I3M2I3M8D13M1D5M1I12M1D14M2D6M1D15M2I1M1I1M3I6M1I9M2D6M3D1M1D7M2I13M1D19M2D8M1I7M1I2M1I1M4D7M1D1M3I1M1D6M1D8M3I4M4I12M1I7M2D6M2D5M1D4M1D7M1D3M1D2M1I7M2D4M2D21M1D5M2I12M1D4M1D24M1I3M2D3M1D11M2D4M4I7M1I12M2D13M1I13M1I5M1D12M1I7M1D3M1I3M1I3M3I8M1D8M1D9M2D8M3D1M2D4M5I2M3I10M3D3M1I2M1I9M2D4M1I7M1I16M2I4M2D5M2I3M1D13M3D15M2D2M2D9M1D16M1D8M1I11M2I15M1I16M2D2M1I35M1D6M2I1M1I9M4I18M1I2M1I16M4D8M1I1M2D4M4D1M1D16M2I23M2D5M3D3M1I1M2D14M3D5M1I2M2D4M3I4M2D10M1I5M2I7M2D44M1D12M1D3M1D20M1I12M2D12M1I27M2D12M1D6M1D4M1D2M1I21M1D8M1I25M1D4M2D9M1D6M1D10M1D1M2D10M1I3M3I1M4I2M1I5M2D8M1D5M2I14M1I10M1D3M1D3M1D4M1D6M1D1M2D1M1D11M2D2M1I2M2I3M1I3M1D15M1D7M2I2M3I1M1I3M4I11M2I3M1I7M2D2M2D14M2I8M2D3M1D2M3I4M1D3M1I1M1I20M1I5M1D3M1D2M1D1M1D1M1D5M2D14M1I1M2D4M1D3M1D24M2D9M2I3M1D7M1I10M2D2M1D31M2I3M1I3M3D4M2I7M1I5M2D8M1I6M2D5M2D26M1D5M3D6M1I2M1I8M1I5M1D1M2D9M1D8M1I3M2D1M1I2M3D10M1D11M1D5M3I6M1D11M2D12M1D8M2D14M5D3M1D4M1D10M1D2M1D31M2D2M1D14M3I13M2I4M1D1M2D5M3I3M1I1M1I6M2D8M2D9M1D3M3D9M3I9M2I6M1D11M2D3M1I21M3D4M1D3M1D4M2I7M1I4M2I3M2D3M1D4M2I28M1D14M2I1M4I5M1I6M4D5M1I13M2D6M4D3M1D7M1D1M1D34M2D15M3I1M2D11M1D6M3I6M1I2M1I18M2I5M1I16M2I4M1I10M4D7M3I3M1D21M1D3M1D10M1I5M2D10M1D4M1D10M2D5M2I8M1I3M1D9M1D14M1I23M1D6M1I5M2D1M1D1M1D2M1I9M1D1M1D11M1I3M1D6M1I3M1D5M1D10M1D5M2I6M4D2M3I1M1I5M1I6M1I4M1D12M7D2M1D9M3I5M4D8M1D1M2D34M2D10M1D2M1I3M3I2M1D1M1D5M2I4M4D10M3I5M2I7M9I20M1I3M2D9M2I3M1D2M4D2M2D6M3D10M1D12M1D6M1D7M2I2M1D15M3I35M2I1M3D8M2D5M1D15M2D16M1D22M1I1M1I7M2I23M2D5M1D5M1I1M1I8M1I4M1I11M2I13M2I21M4D3M2D6M2I12M2I1M1I3M1I10M1D10M1D1M1D7M1I8M1D24M1D12M1I12M2D17M1I19M4I2M13I2M5I4M2I2M1D8M1D12M1I5M2D7M2I8M2D5M6D1M1D2M1D6M1D4M14D13M1I11M1D4M4I3M1D1M1D4M2D5M3I12M2D10M1I16M2D9M1I1M1I5M2I33M1I21M1D35M1I6M1D2M1D2M1D11M2I14M3D37M4D16M3D12M2I33M1D8M1I15M1I10M1I3M2D18M1I7M6D8M2I7M2D7M1I3M1I10M1D5M1D7M2D3M3I16M1I2M1D5M1D7M3D4M1D4M1I44M1D1M1D9M1I5M2D7M6D15M4D3M2D6M2D10M1D8M2D2M1D6M1D6M3I12M7D5M1D2M1D3M1D10M2D3M2D3M1D5M1D13M1D1M1D10M1I4M2D7M3D22M6I35M4D7M4D13M1D4M1D19M1D2M1D5M2I9M1I11M1I26M1D5M4I7M1D2M1D5M2D3M6D9M3I6M2D17M2D8M1D4M1D6M1I8M1D1M1D10M1D17M1D5M1D22M4I10M1D14M2I5M3D33M2D9M2I3M1D4M2I2M1I44M1I9M1D7M2D5M1D9M6D5M2D7M1D5M1D18M1I2M1D7M1D4M1I2M1D1M3I5M1D3M1D3M2D5M1D3M1D3M3D18M1D41M2I2M1D8M2D16M1D7M1I2M2D2M5I17M2D4M1D16M4I3M2I1M1I1M2I8M5I2M1D4M3D1M1I22M3D1M9D4M4D2M2D4M2I2M2D13M1I8M1D6M2I9M2D3M1D6M1D4M1D12M1I11M2D22M1I12M1I1M1I7M1I2M1I3M5I1M3I11M1D1M1D2M3D4M2D6M1D1M2I5M1D74M1D3M1D18M2D7M1D9M1I10M1D4M2D8M1I5M1I32M9D1M1D9M1I2M2I4M2I2M2I6M3I8M2D6M1D34M2D11M2I16M1D3M1D6M3D9M3D7M2I38M2D4M4I6M3D5M1D5M4D22M1D12M1D4M3D17M2D25M1D6M1I9M3I6M1I14M1I8M1D3M1I7M1D8M1D6M1D2M1I5M1I7M1I3M1I17M3D4M1I1M7I14M1D13M2I1M1I4M1I1M1I7M2I2M1D4M1D20M1D6M2D1M2D8M1D7M1D3M4D16M2I23M1I19M2I11M1D12M1I4M1I18M1I14M2D8M2I6M1I7M4I2M1I5M1D4M3D3M1D2M1D11M1D10M1D4M2D11M4D2M1D7M4I7M1I7M1I6M2D4M1I12M2D16M1D9M1D6M3I1M1I7M1D5M1I34M1I16M1I15M2I6M30S	*	0	0	CAGTGCTTGGGTCTACCGCCGTCGCATCTTTATCGCACAGGAATTCCTCCTGTGCCGACAGCTGGCGACGTTGCCGCCTCCTCCAGTACCGCGACTGACTCTCCGCCTTCCACAAATCCCGGCGCTGCCTGATTTGCCATTTGCTCCGGCATGCTTCTCCAGCGTCCGATGCGCCTGAAGGCGTGCAGGGCAGCATGAGCACTGTCTTCCTGACGATCGCCCGCAAGACATCTTCACACGCTGGACTGTTTCGGCTTTTTCGCCGTGCTTCATAATCCTTTTCGCCTCATCACCGTGTTGTAATCCTCATGCACCAATTTCCCTTTTCCTTCCTCTTTCGCGTTTCTTCCTGACCTCTGCGTATTTTCTCCATAAGGGGTGCAGCAGGGTCGGCCACCCTGCCTGCGCTGCGATATTTCAGCCGTACGTTCGGTATCGCTCTGCTGCTTGGCATTTGTCCTGTTGAGTCTGCTGTTCAGCCTTCTTTCGGGCGGCTTCTAAGCGCAAGACGGGCCTTTCACGATCATCCCAGTAACGCGCCCGCTTCATGATTCCAAATAATCATCCTTGGCAGATTCCAGATGTCGTCTGCTTGGTAACCTCGCAGCCTCTGCTTAATCAGCATCTCCTGCTAGGTATCAGGACTAAGTACAGGAGCACCGCATCCCACATGGATTTGAATGCCGCGCATTTAGCCCAGTCTCCATGCACGTGCCCATGTCTCTTTCAGGCGGCGGGTCTGTAGTCATCAAACCCTTTTCGTGCCTCCTCGTTTGCTCGCTTGCAATGCCCCGGCTTCATCGCCGGAACGCTGCACTGAGCAACATCACGCAATGACCTATAGGACTGGCTCAGCCATCGCCGTCAGCCCCGACGTCGGGTGTGGTCAGCTTCCGAAGGCTTTCAGCGACCTTATTCCTACCTCCGCCTGCCCTAGGGACTCCGCGAGATTCGACGGGATGGACGCAATGAGCGCCAAGCCCCGCCTTAACCAGTGCGCTGAGTACTCGCTGGTCTGGTTAAACGTCAGCCCTGCCGCCTGCCCGGCTCTGGACGACCAGCATCACGATCTGCCGTCAGTCTAGCACGCATGTTAGGAAAGACCAGGGCTCCGTTGTTGAATGGACAGGTAGATCAGTTGCGATAGCTGATACCAGGCATACGCCATAGGCGCAGCGGTCGCCACCGCCATAGGCTAGCCCACCATCAACCGGATCGCAAGGGCAAGCCCCTGAACATGGGATCATCCGCCGACAGGAGTCCTTCACCCCTGTTGCAGCAGGATGACGCCACGGACTTGCCCGCCTGCAAGCTGCGTGGCCACGTCGGTAGAAACTTTGAGCAGCGACTAAGCCGGCTTTATACTGCCCGACGGAAATCCCCGCTTTCTGTGCAGCCATGCCTGTCGGCTCAGCGACTGTTTCACGACTTCACTGTTTTTCACCCATCTTTCTCGTACCCCAAAATGACGGTACTCTGGCCATCTGCTCGTCAAATCTGGCCGCATCCAGACTCAAATCAACGACCAGATTGCTACCGAGCGTTGATAAATAGACTCCTCCCTTAGAATCGCGTGGGTAGATCAGCGCGGCCGTACTAAGCGTCGTTACTATCACACGGGAATAGGGGATAACTTCAATTCCGTTAAGTAAGGTACAAACTAGACAGGCAAGCCTGCCCGCTTTCTGCATCAGCACATCATCTTCAGCTGTCGTTCACTCGCGCCGGTTCAGCAGACTGAATGCATGAGCACAGATGCAGGACTGCAGAGAAAAATCATAGTGAGCTCGACCCTTACCGTCAGCCCGGAAGTGCATATCCAGCAGAACATCATGAAATAATGGGTACTGTAAAGCGGTGCCAGTCGGCATACTCCGTGATGACATCCCGGCAAGCTTAAGCACGCCAGTCGGGTCTCCACATCTCACGCTCAGTTTCAGGGCACTCAGCTCACCGTCGAACACTTTCCCGCAAGAAACAGGCTCTGCGGGCCGCTAGTCCTCTGTCTGTTCAGGGCATTATTCACCACAAACTCATACATACCAGACAGCCGGTCACAACCACGTTCACGCATGAGAATTGCCTCCGTGGCCAGGTGGTAAGCACTTCCTGCTCAATCTGTTTAACGTTCATTCATGGACGGCATCTGCGTCTTCTTGCCTGGGTGGCGCCGCGACTTCCGAGGAGGCAACGCACGGTTGATGGCGTCTTCCACAGTAAACTTCCGGTTGGTGTCTGACTCCGCCTGTTCTCCCGTTGCCGTTTTATTCAGTTCGTTCAATCCCGCTCGATTACTCAGAAGCGACGTGATACACGTTATGTTCACAACCGACTTCGGTTCATAGAACATTAGTACTCTCCGGATTAACCCGGTACGGTAATTTCTGCAACCGCAGCAAACTCACCATTACCGATACAAACGACCGGAATGTTATCTTGCCTGCAGCAACGCTTTCTACGGTATGGTCATCACTAATGACCGACACGGTGGCTTTGTTTATCGCAAGACAAGCACGAAAGCTCCCTCTTTAGTTACGCCTCCGAGCTGAAGCCACGGTCAGCGTGGTGCTCTGCCTTTCACCACCGAGGTGAGCATGAGGATCTAGTCATCGCATGTATGCTTTACCGTGCTGCGATCTTCTGCCAACGACGTCCCACATTGGTACTTTTCTAGGTTAATATTCCTTCGGTCACGTCGCCTTACCGATACTGCTGACTCAGCCACAACGAACGAACATTGAATGTCGGAGGGAGTCGCACCGATGGCATCCTATTCGCTGTAATGACGCCAGCAGCGCCTGCTGCCCCTGCTCTCCGGGCATCACGGGTCGGCGACCTGGTATCTCCGGCAGATTTCTGCGCGCGCCGTAGCATTCTCCGTCTGCATCTTCATCATGAGATAGCTGTCGTCATAGACTCAGCGTCAGTTCACGGGCGTCAGGTCTTTATTTTGCCGACGCGACCAGTCAACGTCTGAAGGCCAATTGCTAATGTATAGATCGCTCCCTTATAAACCCACAGGTGTCCCGGCACCTTTCAGCCGGCATGTGTGGGATTTGGTACAGGCAGCGTCTCACATTTCATAGATGACATAAGTCAGATCGGCTGAACTCCAAGCCGCATCATCGTCTCCGCCGTAGTCAGCTCATCTAGCTCATACTGGTGATCAAATCTGACATGTGCCGGATATCGCTCATCACCGATAAATCCGGGATTCCATCCACGCATCCAGGCGGAAGCACCTGAGCAGGAAAACTTCGATATGCAGCTCCGCCGAGAGCCGAGTTGAGGTGCCGTGTATTCCTCGCCGGTGAGATAAACGGCAACTGCCCAAAATCGCCTGATACACTCGCGGGGATAGGCCACACTCCTTCTACGCTGTGTTGAGTGCTTCTCCAGTGCATCCAGTACTATGCAACCGACAGTTCAGTATGTTTCATCGCTTTATTACCATTACTCTCAGTTGATGCTGCAGCATAGCCCAGCTCTTTCGGAAGACGTTCACGCTGTATCCGCTCAATATTTTGTTAACGCCGTGGTCAGCACTCAGCGACCCATTTCACACATCAATCTAACGGTTTTTCCTCAGCCACTGCTGCATAATCATAATCCTATTTCAGTTGGAATAAACGCATGGTGAATTAAAGACCGACGTTATCACGCCGCCTCACTCATGCCCTTTCAGGGCCGAACCTGCTGCCCTTTACGACGCCTGCTATAGCGAAAGACGACAACCGACAGTGACGAGCGTATTACGCTGAAAGTTCCCGGTTATTTGAATTCTGCTCTGCCTATTTTGACGTGTAGTGGCCAGCTCCGTCTTCCGTGGCCCAGATCCGGGGCCCTTACGGGCAACCTTGACGCCGTAGAACCGCGACTCTAGGATGAAGCAACGCGGTTATATCATTGCGGCAGCACCGGCGCCGTTTTGCTGATACCCAGGCCTTTCAACGGCCTGCTCAATACTTTTATCATACTCCCTTTCCTCGAGCATACCGTCTGACTCAGCAGGTCACGCCCCGTCCAGACATAATCATAAGACGGATGACAACTTCCGCCAATCACCGTGAACCCGATGCGTACCCCAAATTTCTCACCTGATGGTCACTCGTCTCCACGCCGCAGCTGCAGCTATCAGTCCGGACAAACATGAACGAGCTCTTCAACGCGCACGCCTTAATGATAGTATTTTCAGGTCAGTCAAACATCACGTATCACCGCATAGTGTAACCTCACCGGATGTAATGGTGTATAGTGACGTTCCCATGTACCCGCGTATCGTTTCCATCTACGGGCATGGCAGCATCGAACAGGTTATCCAAATCAGCCACCTCTCCCGTTATTGCATTGGCCTAAGCGCTGGTCAGTCTCGGCTGCCACACAGCGGCAGAGACACGAAACGCCGTTCCCGACCAGCACAAATGCCACAGGTTCATCCGCCTGTGAACAGGTCGCATCAGTGATGCAGCTTCACCAGTGCCACACGACCGTGACCAGTTCGACGTATCCAGAATCTACGGTATTATCTGCTGATCCTTGTAGGTTCCATCATTCAGGGCCGGAGTTCGACACTTTCAACTGTCCTGCCCGCCTTTCCCCTCCTTAGTCATGGCATTTCTCAGTCACTCTTTCAGCTCTGCCACGCTACCTCAGTTCTTCTTTCGTCCCCGTTGAGCTGACATCACGTTTAGTTGTTCACGGCCGGCCCTATCTTGAGACGGTGGCATGTTCATCTTTCGTCATGACTCCTCCACAAGAAACAATGTAGCACCCATGATTACGCCAGTTGACGACACGACTCATCACTGGTTACTCAGCAAGGCATCAGCGGTTAGACTGAATCATGGTAAATCACGCGCTGTACGCCGGTGTCAGTTTTTGGTAACCTGCGGGGCAGTGGTAGTCACTCTTCGCTATGTCGTGCCGCATCCTGAATGCATACTAGCCATTAGCACCGAATGCGCTGAGTAGTTCCACGGAGCACCGGAGGCTTACAGCAGAAGTTCTTTTGACGCCGTTTTCCACGTACCTGTCGGAATACTAGACGGTACCTCACATCATCCTATGAGTGACACTGCTATCACCTTCTAAGTCTTTCACGTCTCCACTGAATTAGAGCCACTACGACTTATCCAGCTTCCTTGACTCGTTTAATGAATAGAACGACAGCGCCTCCTTTCGGATCGAACACGTATGATATTCCTCACCACTCTCGTTCCTCTCGGTGCTTCGTATGTTCTCTTCGTCGTAACCGTGACTTTAAGCCTTGCTCCACTCCGTTACGCTGGCATGATCTGGTTTATTCTCTCTGCGACCCCTCTCTGTTATACCTCAAACCGGATCTAAAGGCTTCACCGGTCATGTGTATCTTGTTTGATCACGACCAAACTGCCTGCATCTTCCCACCCAGTAGCAAGCCTTCGTCACGCAGGGTCTGCATGATGATGCGACGGCGTAAGTGATAGGTCCGGATAGATTCTTCAATCTTCATCCGGCATGAGGACGCAAGGTTATCTTAGATTCATTCATGCTTCGGCTTGTGACATATCCCGGCGTAAATTCAGCTATCATCGCCACGGAACGATATCTCACCGACTCGTGAAACGTACCTCATGTTTACCGGTCCCGGAATTTGTAGATAGACTTTCTCGTGTGAAGGGCAGGTAGTAGCGCAGCAAACAGCAGAATACTACCGTACGTACATTTTCTTATGCTATTTGCCTCACTCAGTTGGCGGTTGTACATCGACATAAAATCCCCGTAAAAGCTCAACATAGGCATCGTCATGACTGTAAATATAGTTAAACTACATTATGAATTGCCGTCCTCCTGGATTCCTTTCTTTCCTTCCTCTGCATACTCCCTCCGCCCAAGCACATCCATAACGAACTCGTTGGACTTTCACGTCTACCGTCTAGCCGGGTGGGTCAGCAGCAACCAGGCAGAATGCCAACGGCAGCACCCTTCCTTATGATGCACGCAAACCAGCTTCTATGGAGGTGTCCAGCATCATAAGCTGTATATTGCATCTAGGTGCTTTGCAGCTCAATCACGGGCCAGTTCGGTATGAGCCGGTACTTATTTCCGTAGGGTAATGGTACTGGTTTCTTTATGGTCATAAACATCCCTTTACTGTGTGTTCTATAAATCGTTAACGGCATCATAATGCCGGGTTATGCAGCCGGCCTTGCTTACGCCTGCATCACGAGCCGGTGCACCCACTGTCTGCCTCGTGCATCTGGTGCTGTGTGATAGAAGCGCGTGAGCTTACGTTTTCACGTTATACCGGGGTTTCTTCAGCACGGGGTCATAATTTCAACGCGTTAGTGCTCTCTCCACAGTTTACGATCCCCATAATTAAGCTGTTTTCTGCCCGGCAAATTGCCTCGTATTGGCGTTCACGGGCTTCGCTCATCCGTTCTCTCCGTCCTTAATACACGTCAGTAACGTCAGCCCTGCGAAGCAGTGTGGCTGAAACAGTTAGTTGATAGAGTCTCTTGTAGATTCTCCGCCTACGGGGACGGATTCCTTTCATCCGTGCATGACTACTAAGGACGTGGGGTACTCACCTTGCTGTTGGTATAACAAGTTCATCATGAGTCCGGCATGATCGCTCCTGACCGCTGTACAATGCACTCTGGGTATCCAGCACAACCTGCGACTAACGGTATATGCCTACTTCTAGCAAACATTATCTAGGGTTGCGTCCCATCCGGGACTGCATGTCTCCGAGACGTCATCCGGGACATCTATGTAGGGTTGCTATTAGCTTATCGCTTAGCTGTAAATCCGTGATTTCCACCCTGTTTCTCCAGCAGCACCGTAATTTACTGTGAGCCATCATGACGCCGATGGCTGGGTCGGGCGTCTGCGTCAAGAACTCGGGGAGGCGGCACTGGCAGCAACCGTACCTGGACTGCAGTTCTATGTCGTTTTAAGCTAATACCGGTTTTATTTAAGCACCGCTATACTATCCAGGTACTTTAGCAAGTCAAATGCCCCTCATCCACCACTGCCGTGTCCTATATCTAATAAATCAGTCCACCATCGACCCCGCAGCCAGGCGAGGTAGGAGGCAGAACGCGTAGTAAGCCGGTCAACTCGAGCTCCGGGGCAGCGCGTTCCATTTCCTCCCCGCGCGTGCGCAGGGCCCCGGCGACAAGGCATCCGAATTCGAGCCAGCTACCTTACCAGATAAATGCGTGCTTGAGGGGCTATCATCACCGGATAATGCCAGAGCGGTGCGCGAGTGCCTCCTGGGCAGTCAGGCTTCACCGACGACCCGCATCAGTCAGGCTGCATCCCAAGCCGGCCTGCAAAGGCACAAAGAAACTACCGAGGCGGCGCAGGTTCAAGGCATCCCGGCTCATTAAAGCCATGCTGGCAATATGCGGAGATTACGCAGCTTAGTGCTATTCGCTCCCTGTTGATTTGTCGCAGCCCGGATCAAATGCATGCCTCGAGGCGGGCGGTTGCGACCGGCTGCACGGAGGGGCTCATCGTTTCACGACCTGCTGGGCAAAATTTCGATAGTCGTCACCGTTGCACTCTTCTCGTAGATGAGTCCGGCTTCTATCAGCATCACCGCTTCCAATTCTTTCAGACCATCGAGCCGGCCAAACGAAGCTGGGAATCCAGGAGTGCAGAAGTTCCCAGGCAGCGGCTTCCGAAGGAAGCGCGGCCCCTTGAAGGTAACGTCAGAAGCGAACGAGCCTTCTTCCAGCCAGCACAGAAGCGCTCCCTACGCCGTTTCTACGGCATCCATTCCGCCGAGGGACCGGGCCCACGACTCGTTCGCACTGGCCGTGCCGTGGAGGCTATGGCGCTCATTCTTGGATTCCGGGGGAAGCTGCTCACGAGACAGCCGAGCAGGATATACCGCAGCAGTGACTGCTCAAACACGGAGCCCGTTATCCGTATCGGACAGCCGTCTGCAGTTCAGTGAGTCAGCGGAGGCATCAGGTGCGGTACTTTGTGCGCTCCCCAGCCGGACCGGCATGCAGTAGGGGCGTAAGCGATTTATCCACCAATCCAGCCGGTCAGCCTTTCCGCTGCTCCTGACCTGTTCGCCCAGAATAAATCAGCCGTAACCGTATGCCCAGCTCACCTCAATGGTGGCGCATACATCGCCTTACAATGGCGCTCTGCAGCTGCGTGTTCTGCAGCGTGTCGAGGCATCTTCACTCTGCTCCATCTAAGTGTAAACACAGTGCACGCGAGTCTGCCGTCGGCGCGACTTACCCAAAACGAAGAATGAAACGAGGAGGCGCGCCAAGCCGGGGGTCAGATTCACGGTTCAGGTACAGCGCGGCAACGCGTCCGCCAAGTAGTAATACCCAGCGCCGACGAGCAATTGCTTCATGCCTCCGGGTCGGCCGCCCACCCGCCGCTTTCGCAGCGTGCCCCGGTATTGTTCGGGTTGCTGGATGGCCATTCGGCTGAGACCAACTGTCGGAAAAGCCGCGACGAACTGGCTCCCAGCCTGAACCCGACAGTTCACCGTTAAATTAGGAGTGCATGGCCACACCTTCCGAAGCATCATGGGCTCGTGCGTTGGGGCCAACGTCAATGCAGCAGCAGTCATCCTCGGCAACTCTTTCCATGCCGCTTCAAGCGCGGGAAAGGGCACGGGCTTCTTCCTCCCGGTGGGATAAGCCACGCCAGCTTGGAGGATCAACGGCCCCGGGAAAAAGACCCGACGATATAATCCTGATGCAGCTGGATTGAGGCGGCAGAGCGTTATTGCGATCACAGAAGCGGGGTCGCGGAAGTGCCCGGTAAAGAGAGGGCAAAGAGGGCTGCATCAAGTCTCACTCGTGGGTTCCACGAACCGCAACTGCCCCAAATCCGCTGCCACCGCCGTGATAACCGGCATATTGCCGCAGCGTGCTATTAAGTCCGTAGGATGAATCTGCCGTCCGTCAGACAGGGGCGAAATCGGGCGTGAGTGCGTACAGATCGCTCCTGCGCGCTTCTGCACTTCCCGACTCTGCAATATTTTCAGGTCAGACACGAGTGGAATTATTCAACTCCATTCGTCCGTCTTTCTGTACTGTTGCCACCGTTTACCGTCGTCATCACAGGTCATGCAGTGCCGCACGGGCAGCGGCAAGTTCTTCCTGTCTAGTCATTCATCTCCCTCCATAAGGCACGGCGTAATACTGCCAGTGATGTTCTTGTTGTTGCTGCACCATCCTTCCTGCAGGCTCAGCAGCGCAAGGCGATCCAGCTGCCAGGGGAAATACTGATGCGCAGCGCCGCCGCATAAACGAAGGGCAGTCGAGTGCCTCATTGCGTCGCTTTGCTGTCCACAGTACTTTTCCCTCCATCCAGAAGAGTGTGCGGACGCTCTTCAGCAGAGTCCGCCTGCTGCGGTCAGATTACAAAATACGGGTTATTTCGGGAAGTGAACGCACCGGAAGCGTCATGCTCCCCTTCAGGCGTCATGTTGAAGCGGTTATAATCGCTCTGTTCGCGGTATCCGTACCGATTTCGGTAAGGTAAAACCCGTTTTTATTCGCTTACGTGGCATGCTGAGGATTTTCCGTAGACGATCCCGTAATGGGGATGACAGGGACACCGCTGTTGGGGCGCCTCGTTGCTACAGATGCGCGTAATGCGCCAGTATGCAGCAGATACGGATATCGACATTTCTGCACCATTCCGGCGGTATAGTTTTATTGATGGCCTCATCCACACGCATGCAGCAGCGTCTGTTCATATCGTCGTGGCGGCCCATAATAATCAGTCAATCAGCCAGCTTTCCTCACCCGGCCCCCATCCCCATACGCGCATTTCGTAGCGGTCCAGCTTAGGAGTCGATACCGGCGGTCAGGTAAGCCACACGAGAGTCAGGAACGGGCTGAATAATCCTCTTTCCGCTGCCATCACTTCAGCATGGACTATCCCAAGTTCGCGGTCCCACGAGTCGCCACGAAGGGGTGATTACGAAGGTTTACGTTTTCCGAGTATCCCTTTCGCTAGTTTGCTCCAGTGTTGACAATCTGCACCGAGGTGAACGGGCTGTACGCTGTCCAGATGTGAAAGGTCACTGTCAGGTGGCTCAATCATCCTCTTCACCGATGACGAAAACCAGAATCTGCCATCACGGGTCCAGATCCCGGTCTTCGCAGATAACGGCATCAGTAAGTCGAGCTCCGCTGGGGATGACGCAGGCAGTGTAGCCGCAGAGTAAAGCAGAATCTGGAGCGTGCGCGGCTTTAGGGACGGCGTCTCTTTGTGCCCCAAATTTAAGATACTGCTCCCTCCCGCAATGCGGGCAGGCAGCACATGAAAGCATAAAATGCGGGGATTCACTGAGCCAACCGGCTCAATCTGACAGGTGCCTCATTTGGCGTGGAGCCACCTAAGGACCTAGATGACTTTACTCTCAAGCCGATATCAGGACCCTTGTTCTCCAGGATTTCCCAATCAGGTCCAAAAGCAGCAAGAATCATCATACCCGCCACATCCACCGACTTTCACGGTAGTTTGCCGCTTTACCCGCCCAGGCACCAGAAGCCACGCCCATTAGTGAAACGCTTCATGGTGAGCGTGTTGGTGCTCAGATAGAAATCCTGTTGCCAACAGGCCCTCAAGAGGGCTACGAATATCACGAATAGTCGGCTCAACGTGGGTTTTCATAAAGTTCTCGGCATCACCATCCGTCGGCAACCAGATAAGGGTTGCTATGCTTATGCTCTAAAGTAGCATAAACACCCCAGCAGCATTTGGAATAACCTGACACGGGCAGACTTCACCAAGTCCTCATCACGGATGTTCCATCCGATCTCGAAGGAGGTGCTGCTCGCTAACCGGACGGGGGTTTCCCAGCGCCCTTCCTGGTATGCGGATTCTTTCGGGAGATAGTAATTATAGCATCCGCCCATTCAACGCGGTTTGGCTCCAGGAACAGGCTTACGAAGCCCGGCGCGGACAAATGCCGCAGCCTGTTAATGACGGTATGTTCGATATTTCACTAGCAACCCCGGTATCAGTTCATCAGGGCGGCTGCTTGTTCATGGCTTTGATGATATCTAGTTTCAGGAAATCAACATGTCGTTTTCTGAGTTCCGGGAAAACGCCTGCACCGACAGGGAGCCCGTCGAGATACCGGCATTGCCCGCGATTGAGAAGAGCACGAAAAGTACAGAATTGCGGTTTCCACCACTTCGGATGTCTTATCTCTGGCATTCTTCAGTTCCTGTGCGTCCTGAATCGTGCGCACGCGTAAGTCGACCCGTTCGTACTCAATAGTTCCTGGCTCGATTCTGCTCGCTGGCCTGCCGCAGTTCTTCAAAGCCTCCGAGCGCAGCTTTTCGTTCTCAATTTCAGCATCCTTTGGGCATACCATTTTATGACGGGGCAGAGGTCAGCACATCACCTCATTACCCTTGCCACCGCCTCCCGACGGGCAATTCTCAGTTTCCTGCGTTTCCTCCTTCGAATGGTACGGATACTCGCACGAAAATGTCAGCCAGCCGTGTTGTACTCCATTGAATATTCATTCGCACGGACAAAACAGAAGGAAACGACAGAGGCCAAAGCCGCTTTCAGCAGCATGTCGTTCCTTTTGCGTCTCAGAGGGTATTTTGTAAAATAAAAACATTAAGTTATGACGAAGACAGAACGGAAACGCCTTAAACCGGAAAATTTTCATAAATAGAGCGACCGCGAGGTCCGCCATTTCTCGTCC	*	tp:A:P	cm:i:72	s1:i:544	s2:i:0	zd:i:2	NM:i:2099	ms:i:2628	AS:i:2628	nn:i:0	SA:Z:utg000001l,35452,+,19S2929M96D8747S,60,664;
+91	2048	utg000001l	35452	60	19H14M2D4M1D18M6D1M1D596M3I28M1D7M4D1M1D8M1D8M4I2M2I5M1D3M1D19M2I18M1D3M2I10M1I2M1D16M2D19M1D12M1I5M1D12M1I4M2D6M1D25M2D12M2D8M1I12M1I4M1I5M2D4M3D3M3I2M2D4M1I11M1D3M1I12M2D4M6D32M1D8M1D2M3D1M1D11M1I2M3I2M2D14M1I5M1D2M1D7M1I17M3I5M3D1M1D10M1D2M1I3M5I2M1D6M1D3M1D6M3I10M5I19M2I2M1D12M1D4M1D5M2D5M2I15M4D15M1D16M1D3M1D7M1I3M1D3M1D6M5D20M1I5M1I11M3D10M1D15M1I1M1I7M1D1M1D5M1I1M1I5M1D5M3D7M1D33M1D33M1I1M1I7M1D6M2D5M1I17M1D2M1D19M1D11M4D31M2I1M1D8M5D3M2I10M1I6M1I5M4D1M1D5M1D3M1D5M3D11M2I5M2D5M3I4M2D5M2I13M1I5M4I20M5D6M1D5M2D12M1D6M1I10M1D5M2D3M5D25M1D6M1I5M2D5M1I9M2I7M1I1M2I2M1D5M3I5M1D2M1I6M1I6M3D2M2D61M1I3M1D20M1I33M1I10M3D29M1I2M1I9M2I6M4D2M2I16M1D42M1I2M1I6M2D4M1I7M1D19M1D1M2I29M2D28M1I17M2D6M1D3M1I2M3I5M1D5M2D11M2D45M2I10M1I4M2I2M3D1M2D8M3D10M3D7M1I1M1I5M3D1M1I13M1I2M1I3M1I5M3D4M1I11M1D5M2I8M2D5M1D11M4D27M1D6M4I15M2D5M3D9M1D5M1I5M1D8M1I11M2I12M1D5M1D3M1I5M1D12M3I1M1I10M3D10M1D4M4I2M1D3M1D18M3I10M2D4M2I3M1D3M1I1M2D5M1I10M5D1M1D12M1D1M1D2M1D1M1D14M5D12M1D5M1D2M1D9M1D7M3I3M2I1M1I7M2I19M2I5M2I7M2D3M4D4M2D7M4D4M1I2M2I12M1I27M1I5M2I10M1D3M2I7M3D4M1D24M1D14M1I19M1D12M1D3M1D16M3D21M8747H	*	0	0	CGTCGCATCTTTATCGCACAGGAATTCCTCCTGTGCCGACAGCTGGCGACGTTGCCGCCTCCTCCAGTACCGCGACTGACTCTCCGCCTTCCACAAATCCCGGCGCTGCCTGATTTGCCATTTGCTCCGGCATGCTTCTCCAGCGTCCGATGCGCCTGAAGGCGTGCAGGGCAGCATGAGCACTGTCTTCCTGACGATCGCCCGCAAGACATCTTCACACGCTGGACTGTTTCGGCTTTTTCGCCGTGCTTCATAATCCTTTTCGCCTCATCACCGTGTTGTAATCCTCATGCACCAATTTCCCTTTTCCTTCCTCTTTCGCGTTTCTTCCTGACCTCTGCGTATTTTCTCCATAAGGGGTGCAGCAGGGTCGGCCACCCTGCCTGCGCTGCGATATTTCAGCCGTACGTTCGGTATCGCTCTGCTGCTTGGCATTTGTCCTGTTGAGTCTGCTGTTCAGCCTTCTTTCGGGCGGCTTCTAAGCGCAAGACGGGCCTTTCACGATCATCCCAGTAACGCGCCCGCTTCATGATTCCAAATAATCATCCTTGGCAGATTCCAGATGTCGTCTGCTTGGTAACCTCGCAGCCTCTGCTTAATCAGCATCTCCTGCTAGGTATCAGGACTAAGTACAGGAGCACCGCATCCCACATGGATTTGAATGCCGCGCATTTAGCCCAGTCTCCATGCACGTGCCCATGTCTCTTTCAGGCGGCGGGTCTGTAGTCATCAAACCCTTTTCGTGCCTCCTCGTTTGCTCGCTTGCAATGCCCCGGCTTCATCGCCGGAACGCTGCACTGAGCAACATCACGCAATGACCTATAGGACTGGCTCAGCCATCGCCGTCAGCCCCGACGTCGGGTGTGGTCAGCTTCCGAAGGCTTTCAGCGACCTTATTCCTACCTCCGCCTGCCCTAGGGACTCCGCGAGATTCGACGGGATGGACGCAATGAGCGCCAAGCCCCGCCTTAACCAGTGCGCTGAGTACTCGCTGGTCTGGTTAAACGTCAGCCCTGCCGCCTGCCCGGCTCTGGACGACCAGCATCACGATCTGCCGTCAGTCTAGCACGCATGTTAGGAAAGACCAGGGCTCCGTTGTTGAATGGACAGGTAGATCAGTTGCGATAGCTGATACCAGGCATACGCCATAGGCGCAGCGGTCGCCACCGCCATAGGCTAGCCCACCATCAACCGGATCGCAAGGGCAAGCCCCTGAACATGGGATCATCCGCCGACAGGAGTCCTTCACCCCTGTTGCAGCAGGATGACGCCACGGACTTGCCCGCCTGCAAGCTGCGTGGCCACGTCGGTAGAAACTTTGAGCAGCGACTAAGCCGGCTTTATACTGCCCGACGGAAATCCCCGCTTTCTGTGCAGCCATGCCTGTCGGCTCAGCGACTGTTTCACGACTTCACTGTTTTTCACCCATCTTTCTCGTACCCCAAAATGACGGTACTCTGGCCATCTGCTCGTCAAATCTGGCCGCATCCAGACTCAAATCAACGACCAGATTGCTACCGAGCGTTGATAAATAGACTCCTCCCTTAGAATCGCGTGGGTAGATCAGCGCGGCCGTACTAAGCGTCGTTACTATCACACGGGAATAGGGGATAACTTCAATTCCGTTAAGTAAGGTACAAACTAGACAGGCAAGCCTGCCCGCTTTCTGCATCAGCACATCATCTTCAGCTGTCGTTCACTCGCGCCGGTTCAGCAGACTGAATGCATGAGCACAGATGCAGGACTGCAGAGAAAAATCATAGTGAGCTCGACCCTTACCGTCAGCCCGGAAGTGCATATCCAGCAGAACATCATGAAATAATGGGTACTGTAAAGCGGTGCCAGTCGGCATACTCCGTGATGACATCCCGGCAAGCTTAAGCACGCCAGTCGGGTCTCCACATCTCACGCTCAGTTTCAGGGCACTCAGCTCACCGTCGAACACTTTCCCGCAAGAAACAGGCTCTGCGGGCCGCTAGTCCTCTGTCTGTTCAGGGCATTATTCACCACAAACTCATACATACCAGACAGCCGGTCACAACCACGTTCACGCATGAGAATTGCCTCCGTGGCCAGGTGGTAAGCACTTCCTGCTCAATCTGTTTAACGTTCATTCATGGACGGCATCTGCGTCTTCTTGCCTGGGTGGCGCCGCGACTTCCGAGGAGGCAACGCACGGTTGATGGCGTCTTCCACAGTAAACTTCCGGTTGGTGTCTGACTCCGCCTGTTCTCCCGTTGCCGTTTTATTCAGTTCGTTCAATCCCGCTCGATTACTCAGAAGCGACGTGATACACGTTATGTTCACAACCGACTTCGGTTCATAGAACATTAGTACTCTCCGGATTAACCCGGTACGGTAATTTCTGCAACCGCAGCAAACTCACCATTACCGATACAAACGACCGGAATGTTATCTTGCCTGCAGCAACGCTTTCTACGGTATGGTCATCACTAATGACCGACACGGTGGCTTTGTTTATCGCAAGACAAGCACGAAAGCTCCCTCTTTAGTTACGCCTCCGAGCTGAAGCCACGGTCAGCGTGGTGCTCTGCCTTTCACCACCGAGGTGAGCATGAGGATCTAGTCATCGCATGTATGCTTTACCGTGCTGCGATCTTCTGCCAACGACGTCCCACATTGGTACTTTTCTAGGTTAATATTCCTTCGGTCACGTCGCCTTACCGATACTGCTGACTCAGCCACAACGAACGAACATTGAATGTCGGAGGGAGTCGCACCGATGGCATCCTATTCGCTGTAATGACGCCAGCAGCGCCTGCTGCCCCTGCTCTCCGGGCATCACGGGTCGGCGACCTGGTATCTCCGGCAGATTTCTGCGCGCGCCGTAGCATTCTCCGTCTGCATCTTCATCATGAGATAGCTGTCGTCATAGACTCAGCGTCAGTTCACGGGCGTCAGGTCTTTA	*	tp:A:P	cm:i:137	s1:i:1034	s2:i:0	zd:i:1	NM:i:664	ms:i:2288	AS:i:2288	nn:i:0	SA:Z:utg000001l,40370,+,4727S6938M246D30S,60,2099;
+92	4	*	0	0	*	*	0	0	AGGGTCCTTGGGTTGTGACCACGATGACAGACGGTGCTGCGGCGTTTATCACTACAAGTCAAACAGCTTTTCCAGCAAACCCTTGCCGCAGAAAGTGAGGGCAGTTCATTGCTGGGTCTGTGCCACGTTACACAGGACCATTAGCGAACGTCCGAAACATGGGGCTCGGGTATCGCCCGACCGTAAGGGACGCTCGAAATCGTGGCTCCGATTTGCATCAAGCCGTCACGGTGAACAACGGGTCAGCATGAAATCGGTATCACGTTGGATACTTGGACCATAACCAGCGACTGATGCGCGTAACCGACGCCGGAATTACCAGATGACGCTCCCGTGCTTGTTCACTTCTGCTGACGAAGATCGTGATTGGTCGATTTTCCGAAGCCCGACCGATATTACGGTTTAAGCTGACAACTGGCATCCAACAGTACAGTTATCATGAAAAACACCGGGTGAGTCGGCTCACTCAATCACCCGACTAAAAAGGTCACTGCCGTGGGACAGCAACGTGACTCAGCAAGGGATAAGAAACCACCGGATTCATCCCCACGCTGCGGTGTAGCCGCGCATTTACTCCCCGTATGTTCAAGCTGTAATCTCAGTGCTGTCGTAGCCGCAGGACAGAGGTTTAGTGCAACAAGACGATGGTGCAGTTTCAGTTCGTTGACGGGCCGGGTTAACTCAGCGCTCGGTGCGGTTCTTTAGGTTTACGTCGACCGGACAGGGAAACGACGACCGCCCTTCAGTCTTTAATTCACGAGACCTGATGACAGGTAAACGCTCAAACATGTCACAGACCGACGACTTTATTAGGGATCTACTTCTGTGGATTTGAAAAGTATCGGTTGAGAAATTAAATGAAGCAGTACACAAGGCATTCACCGTGCTAGACTTTCACCGTCACGTGGTGCTAGAGCGATTCAATCGAAACTCGATACATACATTTCCCACCCCTGCTGCGCTGAATCCAAACCGGCAGCGTACGTGCTTCGTTGGTTCGTTCGCCGGTATATACGGCAGGATCCGGCTAGAGCACAGTCTCTAGTAGCGACGCACCGTCATGAAATTCAGCGCTCTACTCCGCAGCCCTGTTCGGATTTATTTAATTCAGCGGACACCATTTCCACGCAAGACCCGGCTCCGCCAAATTTTGATTCACCCCATTAGATCACTAATATCTATGGGTCTAGCCTCTAGAGCCATTGCTCCAATGTCCGTGCTCGCGGTACACCGCGGTATAGAAGAAGCCCGAGTGCCTTTCCCGCGGTCCAAACCGTCAATGGAACAGGCTATTGCGTCGTTACGACTTGTTGCAGTGAATGTTTAATAGAACTAAAGAGCCCGTACTTACTGATCTCCGATGAAGGCTTACTTAAACGCGCTTTTAAAACGGCCCAACGGCCCGGTCTACCTGAGATATACCGCTTTCGTCTGCGCCGACACATGAAATCGCGCGGTTTAGTTCAGCGAAGTTCTTTTGATTAATCATACGAACACAGCGACAGGGAACTTGCTTGGTTGGTTAGGCAGATTGACAGCCGCGGCGCTGGTACAGCCACTAGAATGGCCATCTTCGTAGCCTGAGACTGCTTAACGGACCCGATACCCTTATTATCCGTATCTTCGAGCCAGCTCTGTCACGTTTGACGATAAGTTCACTGAATCGTGGCGTTAACGGGCAGATCGGCAAATCGCGGCTCTACGGCTGAGCAGTCCTTCAGGCGCTGAATGACAGGCGCTCGCATACGATAATGAAACACGGATGCTGCACAGTTTACCCGTGACACCGTTTATCCCTGATACTAGTCCGTCTCTTAAGTAAGAGATCTGTCATGGATTTAGTTCTGCGCGTTCTAGAACATACGAGCACTGATAAACGGCTAACCGCCATGGATCGAGCGAAATCGCGCTCCTAATACGCCGCATTACCACTGTGGTCGGGTAGGCAAAGATCCAGACTTACGCCATCGCTTCGATTCATACGCGCGCACGTCGTCCCACAAAGACGGCCGGTCCACCGATAAACTTATTCTCCAGTGGTACTGACCCACACGCTCCTATGAGCTCCGCTGCTCTTACCCGCCTTCTACTAGAGGCAGCTTTCCCCAATCGAATGACGACGATGGGTTTGAGGCATATCCCACGCCAACGGCCAGTCTAGAACTTTGTTGATATCCGTACCGTCCCTCCTTTCCGTTGACAAAACTCTAATCTTCAGTCAGCGGTTGATGCGTAGCGTTGCCCAACGGTTAAGCAGAATGAGGCCCCTAAGGGGTATGCTCGTGACGCTAGCCTGCAAAATGGCTGCCAGTTGCGAAGCCCGCAGTCGCCTCGTGCTAGAACTGGGATTGTAAGTTGTTCGGCTACGCTATGTTTCTAAGCTTAAACGACAGCCAAACCGTGATTTTCACCGTATCAACGAGCAAGCGTTTTACGTCCAGAACGGTCGTGACACTGTCCAACCAAGGTCAGGAAACCTGCCAGTTAAGTACGGGCGAAACGATGATGCTCGCTCCATCCCGGCGGATCTACGAGCCGCAGACGCCCCGACTCTATGCAGACTTCACTTGACATCTGTAGTTGCTTTAACAGCAACAGTTACGTTAGTACCAACCCAGCGAATAGCATATTGCGCTAATTCCTTCACTTTCGATGATCTGTTTTTAAGCGAATGATTGCTGTACGCCCCGAACCTAGCTGCGCGACACCTTCCGTGCTTTGCACTATCATCTTAAGATCAGTCGATTTCATTCCGTACCCAAAGCGCCACGTCTCGAGGCGACCCCAGGGATTGCCGATAGTCAGCCTAGACCCGTGCATTATGCTCGTTTAACGGACTAAGAATAAGACAATTACTAGATATGTTATCATATTTGAACGAAGCGATCGTGTGTCCGCCCTACAGCTGAATTACCTGTTCAGCGACGCGCGGTGTCTTTGCAGCTCATTGCGCCATCTAAGGACTGTTACAACGCATTATCGGCCGTCTAAATACTCCCATGTACTAGATCGATAAAAGCGGCACTGGGTCGGGTTTAAAGTGCTTCTAGGTTCTAAGCGGGGCAAGTGTACGCCTTACTGACATTCCTTTACCCATTTGCCCGGTGACATAAAACCGCTCAGGGGCGTCCGCGCCAACGGTTTAAACAGCACTCGGACTAGATAGTACCGTTGCTCGCCTTCGTTGCCTATTCGTAATCCCTCCCCGGCCTTGTACGCACCGCCCGTTCACGAATTACCTCATGGACGCATGGAGTCTGTTACATGGGCATTTACGCTGTTATCCGCGTAGAAACAGCGAAATAGATCGTCCTTACCGTCTGATTACATGGATTTGTCTTATAAGGCGAGTTCTACAATGCGTAACTAGTTTTTCCATTGAACGATGGTGCTAGATAAAGAAGCACGCGACGAGCCTGACCGACGGACCCGGAGAGAGCTACTCGCAGAATCGATTAGCTTACCCTAAGCCCCGGTGGATACCGTATAGCCGCAGTGATTAGTTAGAGGCTGATGAGCATGCCGAGAATCGGCTTGAGCGAATGGAGAGGCAACTACACGAGGAGCGTACGAGGTACCGCCCTTATATTGACCGCACTGAGATGGACTTATGAAGCGCTCTCTGAGTGTTGACATCAAGTAAAGAGATCTCAATCAACAACTGCATCGGATCCCGACTTCATCGCATTTACGGAATGAGAGGTCGATCTGATACTGAAGCGTCTAGCCATTTCTTATGACGTATAGAAACGCCAGGGCATGTTGTGCAGGGTCCAAACGGTTGTCAAGCCCCCGTTCACGCGGGAACGGATGCGGACGAAAACAGCTTGCATTTTGTAGATCCCCGGATCGGGCGATGCCACGAGGACGCGTAAAGAACAGAACGGAATGTGTGCGTCTAACCAAAATCTTCTTGCTCATGTGACTGAACGTTCGTTTGCACTCTAGTTGTAAGTAAGAGATCCAGCGACTTTGGATCGTCGCATCGTCTGATGCAGGGCAGCGCATACGGTGCTAGCGTGAGTTGCATGCAGGCATCATCGATCCGATGCTCCAGACGCACAGCAGCGACACATGACTAGATAGTGACGGTAAAGAAACAGCGATAGTTCATCAGCTCACCGTCTAACAGATTATCGTTACGCAATGGCCCGGATTTATCTCGTTGGACATCGCAAGTCCATCTATCTACCCCGGACCATTGCTGAACCGTACGGCCTAGATGCGGCCTCATCTAAGATAATGTGACGGTCCGTCGCCCTACAATTCTCTCGGCCACGGCTTGGCCTTGCGAGCACACGAGCAATGACTACGAATCGTTGACGATAGGGACGTACACACGCCTGAGCAAATCACTCTGAGCTGCTACGCCTAGTCGGCCTCATCGGAGGCTGCCAGGCAACGAGAAGAAAGCAACTCGTATTGGGAACCGGCAAGAGCACACGGGCCGACTTTACCCTCATCATTTCTTGACATCATGCCCCGTGTCTTTATCTAGATCGAGACTATAGGGAGGGGACCTCAGCCAACGCTCGTAGGCAAAGCGTGAGCAGGGAAATTAATATGATCTGTTTCTTCTGCGTCCCCCTCCGAGCTCCTCGAGTTAATCTAGAAACAGGTGGCTCGGCCAAATTCTGAGGACGGGTAACAGCGGGCGTACGTGCGCGAGGATTATTTCTAGCTAGTTATTTATCTCTTGTCGGGCATTGTTACTGCTCGAAGGTTTGTTGGGATAGGAGATCGAAGGAAGCACGCACGCACAGATGCCGGATTCTTTGCCTTATCCGGAGCGTCTGCCGCTCCATCGAAGCATGGAATTTGCTTAGCATTTATCTATTTATTAACCCTCGTTGCTGGTTCATATTCATGGAAAACAGCCGGGTAACGACCATAGCGGCCAAGCTCGTCGCCGAGATAGTCCAAATGAGGTTGCACAAGGGACTCGTCTTAGCAGGCAAATAAGGACCGTAATCCGTTCGTCCTGGCCGTACTAGTAATCAAGGGTAGAGAAGAGACATCACGCACGGACTAAGTTTGTAAATGAATCAGGGTCGCTACAAGCGGTAACATTAACCAAGTGTTGACTAAATGACGTTTCTTAATCGATTTGTAAACGCGTCACCCTAGAAACCAGGGGCCATGAGATCGAAACCTTAGCCGCTGGGCCCCGTTCCCTATCCCTAGCCAAACGTGATTTAAACTGTCCTAGATACCCGGTGGCTCGATCCCTAAATCGAAACCGTCACGTGGGGCAACGGTGCGTAACTGATAACCTGTTGTGGGTTTGCTTAGGGTTTGAGTTCCTGACCAATACTAAACAGGGTACGAACAACCAACGAACTCTCTCACTGTTAACACGATGCCGCTGGGAACATTTCGTTCGTAGTAAATCCCAGCCTACGTTTATCCTAATATACTGTCCGTACATTTCGGCAAAGCACAGGGCACGTAATGAATCCCCGCCCGTCGAAAACTGCGTAAGCGTTAAGTGCGATGTTTCACTGCCCATAATCTAGTCGCTCCGTTACCACCTGTTCACTCTTAGCTAGTACAACGCGGCTGACCCCAGCGCTCGGGTGTTTGCCAGGTCACTTCCGCGCCTACCCATAGAGCAAAGAACAGTCCGAAGCCTGCATTTTACATACGCCCGTTGCGCTCGTCCCAACAACTGACCGTATAGGATCTAACGGGGGACGAAAGACAGTCACCAAATTGACGGTGTTCCGTGGCAGTTATGAACAGGTCCAGGCGACTACAACTCATTAACAAAACGGGTAAGGACATTTCTTACGAGCGGAAAAGCGGATCTAAACAGGAAACAGCCGGACTTAAGCCTACTAATACCGTGATTCTACGTCCGACGCAGGTTCGACGCTCTTTTAACGCGCGAAGGCCTTCACAGCATCAGCGATGGTGTCCAATTTCAACCGCTGAGCACTCGTGCATGAATTCGTAACAGCGCTTTCCAGCAGCCGACCGTATTCGCTTTCTTCAATCGTCGTTGTTAACGTGAAATGACAGGTCTGTCTTAGCCATCGTTACAAAGACATGCAACGGGAGCTGTCCGTAATCGATCGTGACGATCTTACCGGGTCGCTCTCCATGCCAGCGCTAGAGATGAACGATACGCGTCACAAGGGACGATCGTACCAGTAATGGTTGATAGTTACGTGAGGCTAATAGGCTGCTCATAGATCTAAAAATATCAGCTTTGGACAGCGCGCGTTGAACCCTTAATCCAGCTGGCTTTAAATGGGATTTTATAGCGCAGCTCGGCGGTAAATGTGACATATCGGCGAGGACGCTGCGCCACGCCGGGGCTCGCCGGATGATGGCGACAGGTGTTCTTCGATACCCGGACGCGTACCGCCGTTAAGCTGCTTAGCGAAATGTTCTGTCATCATGGGCCCATAAAAGAGCTGATGAGTGAAACGGCCCCGTCGTATCACTTGACGAACGGCTTCGCCTGGCGCCGCTGACTTTGTATTGCAATGGCTCCCGGCCACGTGGGAGTCTCCTGCATAACGGATTTTGGGGCAGATAGTTGCCGTGTACAACGTCAAGCCGGACGCCAACGGAAATGTCAGGCCTTGAAACCGTCACACGAGACTTGATTCAGCCACCCAAAGTCAACTGTTTTCTTAATATCGCCGTAACTATGGTGATTTGGTCCTAGCGCCGGCAGCGTGGCCGTAAACTTTCCGTCAAGCATGTTCCTGACGTGGGCTTTAAACCCGTTCTTTAGGTCAACCGTCGGTAATCCCCGGAGGCTTTCAACTGAAAATGAGCCTGGCAACCGTTTGTAAGCGCGTTTTGTTAAACTTATTGCGATTATCGTGAAACGCGCTGCCTGCTGCTGCTAACCACGGCGTTCAACAACAAAGAGATGAGTGGATACGTAAACGTCTTCTGAAAGAGTGCGAGCCCTAGCTGGCAGCAGTAATTTTGTGATAGGGATAAAGCGTTGATGAAAGATTTAATGCACGCGCAGCGATCGGATGCATTCTAATCTTGCCACCCGACGACTGGCGACGTTTTTGATGTGGTCCGCCTATAGCCATGAGGCGCGATCTCCGCATATGCCTATCTACTCACGCATCCGTCGACCAGACTGTGACAGGACATGTATCTGAACGTGTTTTGATATCTAAAGTCTTCCTCGCCTGAGTGGGATTAGAGCGGTTTCTAGGATGGGTTGCGGATTAGATGGGGGCCTCATGTCATGGAGGCGGATCGAGACAGATCCGATTTATTTTAGTGCCGTATCTATCACGCAGCCTGTCAGACATACTGTTTCGTGGCTTTTCTAGCGTCATGTTATAGATCTTTCACACCGCCGATAGCTAGTCTTAATCAAAAATCGAGGACGCTTTTCCCGTCATTTCAAATGGGCAATGCCTGTTGAACTGTCTGTCCTGTAACATGGCTTATACGGCTTTATACGCGCCTACGCGTTGACAGCCGTTCGTAACACTATTTGATCGACTGGTTCGAATGGTCGTAAAGAGGACACTTGACGGTTCGGTATGTGGACGGACTTACTTAGCTTAAACCAAATTTTGTTGACTTTGGTTAAATCATCCTCACGACTTCTTTCCCTGAGACATGCTTCAAGCGCGACGGGCAGAACATTTCACCGATTGTACTATCGCGATCTAGCGCCATTCATCGTTAGCACCGTAATGACCTGTCCGGATATGATTTACCAAAGCTGTCAGTCCGTTCTTATACACCAAATCCGCTCCTTGAACGTAACGAGCGATGGCTGTAGGGTACTAAGATAAGCCATCGTAAGGCGACGACTAGAATGAAGTACTAACAGGGACGAAGTCAGATTAGGGACCCGTCTATTTAACCAAGCATGTACCGACGGTAAACATATCTTTCTGACTTTCGAAAGGAAGGGACGGGTCTGGTCTCATCATCTCGCTTTTATGAAATTTAATAATACGTGCTGACAGCGCCTGCAGGAGGGTCGGAGCGTCAACTGACAAGAGAGCCGTCGCGGCCTAGGCTCGCGATTAAACAAAAGGTTTATGGAGGGGTATGAAGATAGATACCGTTGAACGGCTAGCAGGCAAGAGACATTCTGAGCGTATCTGTACTTGGCTAGCTTTCTATCCCAAGACGAAATTAAGGCTACTTGTCATTTAATCTGTAGGTCACGACTAGATGCGGAACCGAAGGTTGAGCCGAACAGAGGACGCGCTCTAACCGTCAATCGTCTCGCGAACTGATCGGCCTCGCACCTCACGCTGTACCCCGCCTGAGTCATGAACTGACTAAACATGTGGTGGTTAACGGTTCAACGGACAGGTCGCCCCTTGACAGACGGGTACATCAGATAAGCAACGATTAAAGCGTCGGTCCCCTATATTGCCTGAAGCACCGCAGAAGACGGACCAGCCGTTGTTGAAGTGACGGTAAAGATTAGTCATGACGAGGCGACCTAGGCTTTACTCCACGGAGCGAAGCTCTCGAGCGCGATGAAAATGGTACCACCGGCGAGCCGCCGGCTGAGTCGGTGAATACGCTCCATCCTAAACAGACAGAGGAATGCTTCACCTTACACCCTGTTTCTGCGGCTAGAATGAGCCGCCTCTTTGACGACGCTGCGAGCTGAGTGCCTTAGAACTGTGTGCGAGATGCGAGCAGCCCCGACTGGCGGCTTTGCTACCTGCCTCGCATAGGGAGTGCCCCACGGAGTTCTTGCCACCGGCACCGCTGTCGACGCTCCGACTGTTCTACGCTATCCATGTTTTCGCTCCGATATGCACTTTTCCGGGTCTACGAGCAAAGACGTAGGTACTGTGAGCCGGTGCTCGTTGGTAATCTCGAATATGGATGT	*
+93	4	*	0	0	*	*	0	0	AATAGTCGTCATTGGGTTACTCGCGGCAATCGCCCGACCTGACCCTTTCAACGGACTTTATGAAAGGACTGTTTCGGGCTTCCACCGCGTTCCACGTTTATTTAATTCGTTCTATATGCCTTTTCGTGTCCCCTCTCCTACCCACCGAAGCAGGAGCGCCAACAGGACCGTAACGGGCAATGGCGCCTCATTTTGACAACATGTCGTTTCCTTTCCCATGTTGTTAGTTCGGGATACGTAGATGGAAGTGGTCAACGGGCACCTGGCTTAGGCTTTTCATGTCCGACCTTATGAACGTGGCCTTCATGGAGGGGCAGAGATCGGGGGATCACCGTTCTTAGAAGGCGGTGCTCGCAAAACGAACGTTATACTTACCTTCAGCCTCACCGGCACAACCTTAATGCCGAGCAGAATGGGTCAACCGGATCCGATCGAGATAGTATTCCACGCAGTCGATGATGCGGCTGCCGACGAGGCAATCTAGGGATCTATTACGGGTCCATGAATAAGCCAGACCTATCCTACACCGTGCTCACAGACGCCTCCAGCCGGAGTGGGGATGCCATCCACGTGAAGACAAGTTGGTACTTATTGGGATGCTCGAATTTGGTGGGTTCGTTGGGTCGCCTTGGGGGTCAGTGTTTAGAACTCACTTCTCAACAGCCCTAAGTATCACGGTGAGTCCTTGTCCAAACGCGTCCCAGTATGGAACTCAGAAGTCCCTTATTTACTTTTATCGGCTACAACTCATGGATAGCGGGCTACGCCCGAGCTACTAAAGACCATGAGTAGCTCCGCAGGCCGGGGCGGTTATGATGAGTACTGGCATCCGGTCAGTGAACGGGCGCCTTAGACCGTTGTCACCACAGGGTTGCCTACTGTCGACTAGAGCGCGCGGCTACGGTCAGGTCGATGGACAGATTTAGACTCCCGACGAGATCCCAGCCGGAGGGCTCCACATGGAGCCTTAAGTTCGACGGTAAAGGACGAGGGTAGGTCGCAGAATGCAATGGCGCGGTAGATCTCGTCAGAGCTCGATCTCGTACCGGTCCACGTCTTCCATTGTTATTCCAAATCCCTTATGTTTATCCCTCGTGCCCACCAGCCCGGACGAGACGGTGACTAGTCATAGGTGGTATTCCCGCGGGTGTTGACTGGCGATCTCAGGGTTGGACCCTACTTTACGTGACTGTCACGTCGCTGCTAACTGGCGCTCTCGCCGGTCTGACTGGCACTGAATGCGACGCGACGGAGCGCTCGCCGCGGGCGGCGTTCCTAGTGGATGCTTCAGTATTCCACCTGGGACCCGGCAAAGCCCGTGGATGCTTAATCAAAACAATCTCTCACGTGATGCTTTGACCAATCACTCCCAATCCAAGGCATACCCGCTTTCCTGGCTATGATGCGCTAGCGTATTCCTGAAACCAACGGTTTGACCCTAACGGTAATCCCAACCACATGAAGGAAACTAAAATTCGATCCGTTAAGACGAGTGGCTTGGTAGAAAGGTGTTCGTGAGTTCATGTTGGGTACGCGGTTGCCTTCGCTGAGGAGCATCTGCGTGCACCAGGTACCACCGTCCAAGGGTAAAATGGACAGGTACCCCACTCATAAGATTTTTGATCTCTGCCAGCAAGGGTGCTCCGTCAAACCCAGCAGAAGCTTCTATGATCCGGTCAACTGCGACAGACAGACGCCCGTATATGTACCGTGGTGGCGATCCTCTTTTCGTCAAAGTCGAAGCAGGGTCATAGGTAAGTAGCCCGTGACCTTTCGATTATAAGCCGTGACCGCTGAAGCGCCCGCCTACACGCGGTCGTGATAGGTGGCGCTTCGACACTGAAACGAAGGGGCGTATAGCGGCGATATGCCCTGATTTAGCCCCCGCCGGCCCTCGTACGAATATGTTTGGGAGCAATAAATTACCGAACTTCGTATAAATTAACCGAATACTGGCGACGCCGGCACGCCAGTGAGTCTAGCCGCCATTTTAGTCTCGTTTACGTATAGTACGGTATGACAAACTCTACGAGCCTCGCCGCAGTAATCGCGTACTGGGGATCGATGAAGGAAGAACATGACATCAATTAACTCGGCAGCCTTGGTGTGTGACCACACCTAGATACGGCTAGCTGCTTGCGTACGTAGCACGTAGATAGATTCATCACTATCCACGATGAAATTAGAGACTGACTTCAGATGACCCCGTAAACCCGTAACACAGTAACCGGGAATGCTTGTACCCGGCTTGTGTAACATGACGGGCACGCTCTAACAGGTCACGGCAAATGCCCGCAGTCGCACGGACGCATTCACGGTTCTTACTCCACTCAGGGAGAGGGACCAATGCGAGGGCCCGGCACAACAGGAGCCAAATAGCCATTTACCTGCCCAATCGCTTAAGGTCCCCGGGGACAGTTCTGAACCGCGCTTCCACTGACGCCGCAGCGAACGGCCACCTTCTAGGTCAGACCATTCACCTTCCCGAACTACGCGCTCTTTGATCTCGTCGCGGCGCGGAGACTCTATGACTCTGATGTATCTGTACTTAACGGGAAAGTCGAGTAAATGAATGAAGGAGCCAAATACTGTGACAGCTTCTAAAGCAGACGAGTGTACCGCCGCACCTATCGTTCGTCCATGAGGACGAGCTTAGAGGCCAGATCGTTTGCCCTGACCGGACGCTCGTGACTAATTAGATCGTACCGATAGTCAGGCGCAGGAGGGGATATATTAGAAACAGCCAGGGTCTCGCTGGCGTGACAGTTAAATTATTACACGCGGATGGGGTCTCGCGGACCCCGAAGTGCGCCATGTTACGTTAAGCTCCCTCGATCCGAGACTCGTAACCGGCTCCCTGAGCAACAGTACCCGACAACGCAGCAGGAGAACGGGTACGAATTTTTACGGCTGAATGCTGCACAGTTCTCTGGCTAAAGATCGCACTTGCGCGGGAGATCCAGACCAGCATGACAGGCCACCCAGGAAACGTGAGGATTTATCTGGCGGCCCGCTTCGGCCTCATTCTCATGAAATAACCTGCCTGAATGGTACGGTTACGCTGCCCCTTGGGAGCTAGTTTGAAGGGAGTCTTTCGGTCTGTCAAGAACAGCAGAAATACAGAAGGTTGCTGCATCACCTGTTACGATATTTACTCCCCAGAGTTACGATCCCCCGGCTAATCTCTTAACGCGAGCTCACTCTACTGGTGACTCCTGCCCTACCAATACTCATGCATCAGGGGTCCTGTTCAAACTGTGTCCAACATGAATCTAATGACGCCAGCTCAATGGGAATACCGGGGCAGGAGTCCCGTTGCTTCCCAGGGTCAAGCGGGAGAAAGAGGATTGCCCTCCAGAAACGATTGTGTACTTAGCTCTCCAATCGTAGACGAACCGTTACACTAGCGAGCACGTTTGGGGTCATCGTCAGCTCCATCGAAGCTGGCCGCGTAGACGACGTCTACGTCAAACTTTTGGTTTCGATAAGGACCGACGTACCGTTTGGTCACCCTCGGTTTCATTCGAGCCAGAAGAGGCACCGGTTTAGATGGTTAACGAGATCGCATCGGGGCTGAAGCCAAGGATTGGATGGCCGGCGATTCAGCCCATATTCAGGTCAAGTGTGCGAGTCGCTCCGCCGGTTGCGTAGAGGCATACCGGAGATCAGTTCGCCGAAAGCTATCTAACCCTGAATGCGAAATGAGCTGGCTCCCTGCGTGCCCGTACCCAAGCGACCGCCCTAGCATTGTTCGTCACCGTTTGGTAAAGATTCCGGATTGGCACTGGCGCTCCGCTGCGAAGACGAGACTTTATAACACATTCAGTGCTGGCTAGATGAGATGCTCGCTAGATTCGAGACCGCGGGTCGAGCCGCAAAATCCGACCGCGATGTAAAGCGCCTGAATCGGCATCGCCTGACGGCTCCGCCGCAGAACCTCCAATGAGTTTCTTAAATTCACCATTCGGAGCACCATGCGTCAGGACAGGAAGCAGGGGACCCGCGCCCGCTAGATCGGGAGCATCGCTGGGATCGTAGCAGTCCAAATCGCGCGGCGCCAAGTTAGCTGGAGACAGGCGCGCTGCTCCCACGCCAGCTGCCTGACTCCAGCTGCCAGGCGACTCCTGAACCCGTCGAGTAGCCAGTGCGGGAAGCACGGCTCCAGCCATGACTACTCATACCGTGTTCCCGTTTATGATCGTGTTCCCATCTGGCCTGCTGCTCATACTGTTGTAGTCTCACGATTTAGCAGGAGTGCCCGGCTGGCCCCTATAACTAGGCGCTCAGTGCGAAGCCCGGTCGTTGGGGTTGATTTGTTATGGGATAGCGACGGTCGTCGGTCGCGTATTCAGGCTTCATCTAGGCGATAGGATTTCTTTAACCTATCGAGGACACGTTCTAGTCTGGTCACTGTCAACGGCACGCCTTCCAATCCTTTTAGGGAGCGCAGTTGCGGTAAGAAGTGCTGGCGGCCCTCGAGCTGGCTTCTTGGGCTGAATGGTTGACCGACGATTCAGGAGCATCAGGACTATGCTCCTCCGAACGAGACTGAACTTAACACCTCACCGCGAAGCGATGCGCGGCCTCCAGATCCCTCTGCCGGAGTTTTAGGCGAGCGGATTGCTTGCATCGATCTCCGAGCGCCGGTGCTGGATTTATCCCTGACGGCCACTGCCTGGGGTGCAGGTTCGGCGTACATCCTGCGGGCTCGGGGTATAGCCGAGGTGACGGCCAGCCTGCTGCTGTGTACCCGCTTATTGCCGCCTCGGCTGGCGGCTTCAATTAACAACCGTGTTGGTACGTCACACTATCCTACGACTTGTTCGTTATTCATTGCGAATAAAGTCGATGGACCTCCAGAGCCTGCTCCTCATTACATGTGTCCCCGATTAAGCTATCCTAGGAGAGCAGATCACGAGCTAACTGCATTGGTACGGTACTCTTATCGACCGCCCCTACCCCCAGTCTCCATATGCCTCCATGGATATAGTTCGGCTGCACGGTCTAGGTACTTGGGTAACGGACCGCTGCCGCGGCGCCGCCTGCCGTGCAATGCCCCGTTGATGGTACTCGGGAACGGAACCGTTACAACAGATCTGACCCTGCGGCCGACAGGTCCGACGCGGTGAGTACTCTCTATCTACTGGTGGACGAAGCTGCTCGGGGTTACTCCCCGTCGAAGGATGGCCGACTAGAGGTCTGACGTACTCAAGTAGGTAAAACTAGTCGATTAGGGTCGATGGACGCACTCGTTGAGCACCGCTAGGCCTCGCTGGGACCAGTGCGTGCGATCGGTGCTTGCGCGGTTAAGCTCCTAAGCCCCGCGTCTTAATCCCAAGCCGACCTAGCCGGAATAAAGCGTCAATACACGATCTCACTTGTGCCTTACGCGAAACGAGCACAGGGTGCGAAATCGGACATGGCTTTACTCGGCGGGGGTTACAGATCCATGACTCATGGCAACCCACGCTAGGGCTTAGTTTAAGATGGCAGCGGGTTCCACGGCAATGCGGTCTAAACCTCTGAGACCCTAGCCGAAGGTTGTGCTCGCCCGCGGTGCTCCGACCGTACGTTAGTCCAGATCCAATCTTGCTCATCGCGAGGCTGCAATGCGGCCACCCGCGTCAACGGGGAGCATTGATCTAATGGCTGGGGTCTCACCGACGGAATGCGATCGCGGTTCATCGCTGTCTACTTAGACTCAGCGTAAAGTTAATCGCCGCGTCTCTCGAAGCATCGCCTAGAGATAAAATGACGCTGACTGTTTTGCTCGCCTATCAAATTGGGGTCCTTCATCGTACAGCAAATAACGAAAGAGACCCCCGACAGGCGGCCAGCTTGAGCCACCGCCCAATCCTGGAGCCCCCGGGGTTTAGAGAGCATTACGTATGGGGGTCTAAATGGTCAAGGGGGACAGCGAGACCGCCCCATTCCGATCCTGGCGGAACCCCCGAACCTCTCGTACAAACGGCCCCGCCGCTTCTCGCAGAGCACACGATGCTACGGGGCCGCGGTATGATGCCAATGGAAATTCATTCCAAGAGCGGCGCCAAATACGGTGCAAACAGGCGGTATGGGTCAGTTAACGATTTGTAGTACGTCAGCCAGTGGACGTCTGACCCAGCACGAAATAATGTTACGCGGTGTAAAAGGGGGTGGAGATCGATCTCTCCATCAACGGGCAAGTACCCGGCACGGGTCGCTGCGAACGGACTAGATGCCGGCAAACCTCAGGTAGTACCGTAACACCTCTCCCGCAACACGGGCTCTTGCGTTGGGGGCGGTAGGGAGCTAGACTTACGGTCACGAATTCTGTTAAGTTAACTTACTGTAAGACCACCCTACGTAACGTTCTCGAGTTAGTAAGCATTTCCGTTGGATTATGGAGGAAGCCATGCCATTCAGGGACGCACTCGGGTGCCCGTTTGCCACGTGGAAGAATGCCAAACGTCCTCTTTACTCACATTCATGCTCCCACATAAACTTCCGGCTTTGTAGCGCATTCTTGGGTGCCTGCTAAGCCATGATGCTCAATGGGCAGGTAGACGAGAATTTGACGTACCGTTGTAAATGATCGGTTTCCGTTAACCGTGATTTCTAGATTAACGCGGTAAATGGCACTTCGACCGCAGGTCAACTCAGCCAGGTTTAAGACATGGACCTATCAGTACTTTCGCGTGTTCATTAAGTGAACTTGTATTGACCGGTTGACGAGTCAGGTAAAGGACTAGTCCTTTTACTAGGCTCTTCACACACAAGCAGACAATAGCAACGAAATGAATCCGCGGCGCCATCGCTGCGTGCCTGCGGGCGAGTCGGAAGAATCTCAACTCATTTAGCCCTAGCCACCGTCTAGCAGGTAATAGATGCCTGATGCGAGCTTGGCTTTACCCCGACTCTCATTGACGGACGATGTACAGGGGCAGTGCATGGAGAGTTATACTTCCCGTCATTAACGGAGCCACTCGCTGATCTAATCGAACATTCGAATCCGTTGCTATGAACTCCGCAGGGTGAGGAACTCTATACGCCTTCGCGTCAGCAAACCACGGAGCAGGCGCCTGTCTCTGCTCTTAGCATTCACGGTATGACCCGGGCCACCTCTTAACGATCTCGCTCGCACGGCTCGCACTAGTCTGCATCTCAGTATCGAGATATGTCATAATGGTTGTCAGTCCCCCAGGGCCACGGCTAGGACTTTCAGACCGTTTAACAGTCAGACGCCGTCGAAACTATACCGCGCTGACCGTTTATTCTATAAAGTCCACGAGCGGCATTACAGCACGGTGGGCACTGGGCACAGCATTATTTAGACCTCATAGGAGAGAGGTCAATGACAGTACGACTCGTTGAATCGGATTATTCACGATGCTCGTGGGAGTAGCGTCTGGCCAGTTCTATACCAATCGACAGTGCTCCGGAATACAGTGCGCGACGAGCAATTAGACTGTACCGACTCTACGCTGTGAATTCGTCAGGATGCGACTAAACCGCGACGCATTAGCGCCTCATTACGTTATCGCGAGCTCTCCTCTCACGGGCGATCCCTAGTCGGTGGTTAAACGCAATCGTCGAAATCCCTCAAAACGTGTAATCATCAAACCTCGTAGCGTCATGTTGCCGTGGACTGAGTAATCTAACTCGTCAGGCTGTTTCATTGGGAGTGGCCGTACCGCGGGTAGGCTCTTTGCCCGTCTAAGCCCGACCTGAGCCGTGGGTCATGACATAACGGATACGGAGCGCATGGCTATGGCTAAATTGTACCAGGGCACCGGAGCTTCGACCCTCACCACATCAATCGGTCAACGGCCGCCAACCGCATAGACGGGGAGATGTGGTCTTAGTATGCCTAAACGCAAATGAGGCGCAATACGAAGTCACGCAACGCTCGCTTGGTTGGTTGGATGAACGCCTTCTCTAACTTGAAGCTTCGTGTAAAGGACAATCTGTACCCAGCTTGATTAGGACCTCTTAATTCACGCGGCCTGCGGTACGTGACGGCGGCGGTTGCTTAGCGCGGCGTTTCCTTTATTACGGTTCCGACGAGAGTGGCACGGCACAGCCGAACGCTGACCGCGATGCGGATGAATAACGGGAGTAGATCTTGGCTGATATACTGATATATATTTGCGCGCACCATGACTCATAGTTTTACGGCTTAGTCAGATGCCGCAAAGCCGCTT	*
+94	4	*	0	0	*	*	0	0	TGCTACTCTTAACGTAGCTGCTATGCCTATTGCCAGGCTCCGCTGCCCTCAGACCATCTGAGCGCGACCTCCGCTGTCGAAGATCAGTACGCACGAGTAGCTCGCTCGCAACATCCGTTTAGTATTAGATGATCGGGCAGTTACTATGATATGTACGGCGCGCCGGGTCCGGGGATTTCTCATTGCTGATCATTGAGAATAGGTCAGTTTAGAGACCTCGTTCGCGCGCGAGCGACCATCAAAGATTAGACCTGCATCGCCTCCATCCCCGTTCCCTCCGAGCCGAAGAGCTGGGGTGGCCAGGCGGGCGAGAAGTACGCATTCTCCATGAGTGCGCTTTTAGCGCTTTCTATCGATGACGAAAAACCGTGTTGGCAACTTTAGGCACTACCCGCACTGAGGTTTGGAATGATTAGCGATCTTAATGCTTCACTCCCAAGGGAATAATCCTTCAATCTTATTCGTCTAAGCCCTGCCTCAATTAGTATGCACTTTACGTTAGAGCTGCTCTTTCCTCTCGGTGCATTCGCCTCCTAGCTCAAGGGAGTAGTGCTATTAAGCGACTTTTAACACCGCAGTCAGATCCACGCACGAGCTCCGGATTGTTCTTTATTTAAATGTTTTTGTCGATTGGCGTACATTGCTCTTCATCTAGCGTTAGCTAACTTGACGTCCGCCCTTATTTTAGTATCCATTTGAGCGTTGGATCAAATACATCTGTCCGGTTATTTTAGTAGAGAGTGCGCTAGGACCCCTTTGTTGACGCATCAAACCTTAGGTGAGGCCTTCCGCTCTTTACTAGTGCCTGCTCTAAGACTAGGAGGTCTAAACAAGCAGGCAGAGAGGCACCGAACGGAGCGCCGAGGCGCAATGCCATGGGGGAGCTGTTACCGATGGCTCAGGTCGCCTTGTCCGGAAATATTCGATTAACAATCCAAGATTTAATATTGGACGTGTTTTGATTTATGAACTAAAACTACGTCTACAACGTTAACAAGTACTTTACTATCTAGCCAGGTACTCTTCAGCATCTCATATTGTCGCAGCTCGCCTCCCATTGATAAAACCACGTGTAGTGTTACGATTAAAGAGGACTCCGCATCTTACTCCGCATCGTTTAACCTATTCCAGTCAGGAGATCGCTTTCTAGCGGACAGGGAAAATGGTTAAAGCGAGGCGGAATTTTTACGCAATGGATCAGATAACGTACATGAACACGCTTATTACTGACATTTGACTATTCAATCGGCACTTTACAAGGCTTCCATACACCTAGATCTTTCCTAATCGTCCCATTTTCCGTCCGTGTCGGACAATGCGTTGCATAATGCAATACGTGGCGCCTCATCCCTGTGTGCATCGTTTAATTATTCGCCAGCTCCCGCCGAAGTTCCCCGTCAGCGTGGTCATAGTTTAATGCGGGATTAGCGGCGTGCATGCGACGAGAGGCGCCCAGGCGCATATGCTCGCTCTGAAGGTTTCAACTAGGTCGTTAAAAGTTGTTGCCTGGTTTTTAGCCCGTACCGATTCTTGAAATAGTTCACCTATGAAACGGGATAACACAGTAGCAAGGTATCCGACCCTACTGCGCACTGGCCCTTAATGATTATCCAAGTGCTCATACAGACGTTTCTATGCATTTGGTCAATGGGGCTGCGGCAAGCATATCGCCCCAAAGGATGTAGCGGGTCTCCCTGCTTTCTTCGTTTTAACTCGCATTGGAAGCAGGCGAGGCGGGTGGTTCCTGCAGCCAGGGTTTGTGGCCTCGACGCAAATGTTGTTTGCCCAACGAATGAGGGCAGGACATTCCTGCCTATCAAGCTTAAAGTTTTATTAATTCTGTAAGGCGGTTAACCTCCATGGAAACAGTTATTGCTCACAAAAGATCCATACCGTGTCGCGCTCCATGAAACAACGATGCATTAAACCCTTAATGACTCTTCTGATGTCCCGTCCAGTTGTTTGCGGGTGATCAGCCTCTCAAAGTTCGACTGAGTCGCGTTCACGTTGCGCACGTCAATCGGGGGAGCGGGCTCTAACGAGAAAAGAGTGCCGGCAGGCGTAGAAGAGAAGGACTGGCCCGACTGCATTTACGTGTGGATGAGAGCTACGACCCACGATGGAAACAATAAACAGCAGAGCATCATTTTCAGCTTTCCTCATGAGCTATGTAGCCTTCGTGTACATTTGCATGAACAGATGCCCTCCGCCAGTACGCATCCGGATGTCAGGTGTCCCGTTCGCCGAGTTGAAAAGTTCTCTGGCATTTTGTCTAACAGTTCTGCCTGAATGGCGTGCTCCCTGCTCTGATTAACATATGCCCGACCCTCAGGCGATACGCAAGGTGGATGCATAACCTCCCAAACGCAAACAATCGCATGTACTGCTCATACATCAGATCTTATACATCTCGTTCCACCCTTTATTTGAATTTGCAATCCAGCCCCTGTCATACGTATGCGCTCGAACTGGCCAACTCAGCTAAGCGATCTTGAATAGGATATGTGCTGCAACACGTCAGTGCCTGACATTAGCCCGATCAATCATAACGACGACAACCTGCGTATTAAACGAGTGCCAGCGTCCTGACTTTTTCAGGGGCTTGGTGTTCAGAAGAGGCCTCTGCAACGGAAGCCGCAGAAGGGGAAAGAAGCATACTCGTCGGCGCCCCTTTGTTAATTTGGATTTGGATGTTAGCGTGACACTACGCGCGGCACGTTGCGGAGTCACAGCGGCTGCCGTAACCATGATAAAAACAGGGCCATCGTCACTGATTTCTTTTGACGTCCAACGTCGCAGTTCAACGAGCCGCCAAGGCTTCTAGGAGCCATCCTTTTGATTGACGTGAATTTCTAAACTTTATAACTCCAACAGTTTTTAAGCAACCGCGGCCGTTTCAAGCATGGATCGATCGATGCCATGCCTCCATCTCACTCCACGCTTAATTCCTCGGACGCCCGCCAGGTGCTACTGCTTAGACCAGATTCCGGAGATCACCGAGATTGCCAGTGGGCGCTCCAAAGCTCCCACATCGACGTCCGTCAGTGCACTATGCTTTTGGCTATACAGGCCATGCCTCTTAGTCAGACAGAGGACTCGCCATTGCAACCTAAGAAGGATTAGCGCGATTAATGTTCCTGTTAGAGGATGGCACTTAAGCCATCAGGTTAGTGTTTCTGAAATTGCGATGTACGCGAAAGAAGTGGCACCGCGCTGTGAAACCAAGAAAGTCAGTTAACATCTGGGCTGAGTCCAACAAGCTCTGATTGTTTAACAATCAGATTGTTTGATTACGAAAGTATGCACGAAAAACGGCAGGGAAGTGGTCGGCATATAAACTCTGCCGACAAAAGAAGAATTTCACGAAGATTAGCCTGTGGCACACTCCCAGCGTGGAAACTATTACTAATGAATTCAAAGGACACAGTGGCCTCGGCTCGTCATTGTGCTTGATCATGGTGAAGCAAGTGGCGCCTGTGAATTTGATCCGTCTTCCGTTATTTCAGCTGCGTGCCACAAAGGCAACGCACTGGCCTGAGGCTCACGACTTCAGAGTGCCTGACAAACAATGCACTTACCTAAACGTTGTGCCATAAATAAATTGACGAATGATTCTGCGGGGCTATAGTACTAATCACAGTGTTCAAACGTTAGAATTTGCACTCCAACACTCTGCAATGGTTGCGTCGCTACATCTAGTTCGTCCGAACCCTCTAGAGAGTCGATGACGCTCACCTCACTAGGACATTTTCTTCGATCGGGTAAGCAAACTCACCCTAACAGGCGTGGCTCCGAACAACGTTCAGTTACGTGCCCAATTGGTCAATAGTCAGACCCGGCATTGAGCACGTACCCGACAAATACGAAACATGAGAGTGCAGACAGTGGCATTCAAAGTGTTGCGTGTAACTATTCTGTTGTGAAAGATGTGCACCGAACAGTCCCTCCAGCATGAGTCAGTGCACGTACAAATATGGTCGGCCTGTTGGCGTAGCATCACTTACGGTGTCACAGCGCAAACTTAAATCAGTCGGGCATCGTGAATAGCCGGCTTGCATCTTCCCAAATAACGTTTATGAGGACCCACACTGACTCAAGCAGCTCTGTTTCAATTGGAGATATCAACCACCCAACGGACTTAAATGCAGATTAAACCATCTTGCCCCAGCGTCACAGCAACAGCAAGAGATAGTCAACTAACAGGACCTACCGATGTTGCACGACCAACATGCAGTGACATTTGCCTGCACTCTTTCAAACGTCGGACGTGCCCTCGAACTGTTCACGAAACCTTGTGCAAATTGAATGGCACTCGTGGACCTTTGTTCGTTCTGGCAACGATTCGTGCTTAACAAAAGAGGATTGAAGAAATAAAAATATACCGAATCCCATCAGTTAAATTCGGCCGACATCCCCGACACCAGCCAGAACACCCCTGGCGTATATACCGAAAAGAATCGAGAAGCCGCAATACTCCCGAGTCGGCATCAAGGGGGACGAGCATTTGGCAGTGAAGCGTTCTAAGGCTTTCAGTGCTTAAAGTCTCGTGACACGACTATCGATCAGATGTTAAAATTCGAACCTCGCTGCGCCGGTATCAAACTCATTTGGTTGGCGATGCGTGAACTGTCAACGTAACCGTAACCACTTAGGCTGAATTTGTCCTAGGTGTCCTTTCTTTCGAGTCTCCCGTTCAAGTTAATTCGTTCCCCGTCCAGAATTACCTTAGTATGCTCGTTTAGACCGTATTCGTCCACCATTAATCAACAGTGCAAAACATATTTTATCTTTAACACCGTCAACACCAAAGTGACTGATTAACACGAGTTCAAACCAAATGGCATTTGGGCAAAACATTAACGCCGATTTTATTTGTCTATCCAGATCAGGGGTAGAACACACCCGCTGCTAGCAAAGATCATTAACGTTTCCACTAACTATAGAATGATCATTTGCTCATGGTTTAGATCGCTATACAAACAAGGAAGCTTGATGCGTTTGAACAGAGATCAACGTTTAAACGAGGCAGCTCACAGGCAGGGCCGAGAAGCAGGAACGCGGTGTGTTTGTTGTCCGTGAGGTTAGTGGTGTCCGAGTTGTTTGCATCTCCCTGTCGTGTAACATGCGGATCACGAACGACACCCGAACTTTCAAACCCTTTGCATGCCATCAATTTTTCGTAGCCCATCTCTTTTAAACGCGGTACGATACATGAGAACGTCGTTGTAACGATGGCGTGCACTTTCGGCGTCTTTATCATCGTATTTTTAAATTAGCCGAAGCCATTTCGATTAGTTAATTAGTTTATTTCGATCTGTGCTTTCTGAAGACTAAGTTGTAGAATGGTTTGGACTGCCAACGTCATGCGATAGGCCGCTTCTGCC	*
+95	4	*	0	0	*	*	0	0	TAGATAGCGGTCGGCTCCGGCCTGAACGCATCCAAGGCATCGGAGTAAGCGACGACTGCCGCAACGTGTGATAGTGTTCCATCGTCGACCATAGGCCGAAGCCCGAAATGCCGCAGCCGAGAAGGAAGCATGTATCATTGCTAACCGTTGACTGCTGTGCACGTTTCGGAAATGGACGGTCAGGTTTCCCACGTTAAAAGGAAGGTATGACATGCACGACATAAGGGAGCCCGTCGAATACTGGCGATTTCACCTGCGATGCCCGACAGCACGAAAGTACAGAATGCGGTTCGCACCACTTCAGCGGGGTCTCTGGCATTCTTCTATTCCGTTGCTGTGCACGTGCTCGTTAAGAGTGGCTTAGATGAGTTTCGTGGTAGCCAACAGTTCGTAGTACGTATGCAGTACCTGCTTACGAGATTCTTCGTAACTAAGAGGCGACG	*
+96	0	utg000001l	24970	60	71S30M1I28M1I11M3I2M1D9M1D27M1I9M1I3M1I11M1I17M1I3M1I4M2D9M1I2M1D2M2D2M1I16M4D2M1D11M1I32M2D6M4D12M2I4M1I5M3D14M1I4M1I12M1I9M2D2M1I5M3D3M1D3M2D2M1I11M2I4M2I9M2I1M1D4M3I3M2D19M1I21M2I4M1I17M1I37M1I3M1I4M1I34M5I3M1I6M3I9M6D3M2D3M1I7M3D10M4I4M3D5M1I5M1I2M1I11M1D15M1I10M1D3M1D1M1D38M1I2M1I14M3I10M1D7M3I13M2I8M3I5M4I3M1D6M1I1M1I4M1I8M1I4M3I5M1D16M3I5M1D2M1D5M2I1M1I3M1I7M5I2M1I6M1I1M2I10M1D2M3D6M2I5M1I1M2I7M2I3M1I2M1D4M3I11M1I1M4I4M1D4M2D22M3I1M1I10M1I3M1D27M1D6M3D4M1I8M4I3M1D12M1I4M1I3M1D11M3D3M2I2M3I2M3I2M1D7M9D6M1D6M2D4M4I24M3I14M4I1M1I11M1I2M2I7M1D38M2D19M1D5M1D8M4D17M2D11M1D5M2D18M1I11M2D1M2D6M2D5M2I5M1I2M1I9M2I14M1I5M1I14M3I3M3I3M2D5M1D2M4D15M1D2M2I6M1D4M2I5M2I1M1I24M2I4M2I9M5I46M4I8M4D19M1I4M1D2M2D11M1D5M2D4M2D4M1D26M1I11M2D2M4I2M2I4M2D15M1I1M2D7M1I5M1D18M1I19M1I9M4D6M2I19M1I2M2D11M2I2M3D4M1I3M1I25M1D4M3I14M4I4M1I1M1I4M2D12M5I39M1I1M1I7M1I2M1I14M2I4M1I7M2I4M1D2M1D4M4D7M2I5M6D14M2I6M2I1M1I4M11I2M1I8M1D18M4I7M2I7M1I38M3D6M7I3M2I6M1D11M1I2M1I3M2I16M2D4M2I13M4I9M2I2M2I4M2I5M2I7M2D3M1D18M1D8M1D5M2D4M1D5M5D9M1D4M3I9M1D12M1I7M8I2M1D5M2D7M1D36M1I19M1D5M2D4M2I9M3I1M2I14M1I5M1D14M1I3M2D15M1D14M1I9M2I2M2D5M5D13M3I11M1D17M1D3M1D1M1D5M2D4M2I7M1I12M1D24M3I13M5I1M1I8M4I4M4D6M1I2M4I11M1I15M2D1M1I15M7I1M2I18M1D3M1I6M1I8M5D24M4I4M1I5M2I10M1I8M2I6M4I11M3D11M1D22M1I18M1D14M2D19M2D12M1I17M2D3M2D4M2I12M2D15M1I6M2D4M3D22M4I13M2D23M1D26M1I3M2D2M1D9M4D11M2I6M1I31M1I14M1D1M2I10M2I2M1I2M3D5M2D11M1I6M1D23M1I8M2D5M1D11M1I5M1D3M1I12M1I33M1I10M1D12M1I11M3D4M5D3M1D4M1D10M2I6M3I12M1D10M2I36M3I15M4I1M1D3M2D6M1I4M6I12M1I5M1I11M2D3M1I1M2D10M1I5M1I8M3D5M1I1M1I13M1I29M3I5M4I2M3I8M1I8M1I3M1D1M1D3M1D11M3I51M4I11M1D4M2D17M1D6M1I16M2I4M1I5M2D9M1D16M1I3M1I2M3D8M1I3M2I13M1I17M1D4M2I41M2D14M2I4M1D12M2I33M1D11M3I1M4I5M1D15M2D4M1D44M2D25M4D3M2D3M2I4M1I5M3I9M6D3M3I2M1D7M2D5M1I22M1D7M3I3M2D6M1D7M1I18M1I5M2I9M1I8M2I16M1D9M2D7M1I2M6I2M1I15M1D37M1I4M1D13M1I5M3I10M1I4M4D15M3I15M1I17M6I11M1D11M2D1M1D4M1I3M1I3M1I2M1D30M3D6M2D12M2I5M1I2M2I14M1D2M3D1M4D3M5D12M1I6M1I2M1I5M3I13M1D3M1D8M3D14M2I8M1I7M1D5M1D6M1I9M3D6M2I4M1D5M2I7M1D18M2I9M2I7M1I9M1D3M1D4M1I10M1D2M3D9M4I1M1I21M1I6M3D13M1I7M3D5M1I29M1D21M1D11M1I12M1I10M2D2M1I14M1D6M2I4M1I15M2D24M1D11M1I6M1D7M2I2M2I4M1D3M3I9M1I31M3I2M1I8M1I4M2D5M1I14M1D4M2D7M3D16M1I2M1D1M1D5M3I5M1I14M1D2M2I6M1D4M1I2M1D1M1D11M1I9M1D4M2I3M1I6M1I1M1I3M1D3M2I7M4D5M5I10M1I3M1I2M1I9M1D1M1D24M2D2M3D4M1I27M1I14M1D5M2I5M1D1M5D10M4D7M1I1M1I2M2I5M1I4M2D9M2D1M1I3M1I20M3I3M1I6M2D8M2D1M1I5M2D3M1D16M4D3M1D19M2I12M1D2M2I3M1D4M1I1M1I9M2I1M1I4M1I4M2D6M2D20M1I22M1D12M1I32M1D18M1I16M1I3M1I2M1I5M1D5M1I3M2I6M1I3M2I1M4I22M1D7M3I13M1I13M1D3M1D6M1I2M1I13M1I1M2I4M1D62M2I7M1I12M2I5M1I1M3I15M3D11M2I6M1D1M2I4M1I11M1I15M4D13M2D1M1D5M1D7M3D9M1I4M1D15M1D9M2I20M2I3M2I3M2D17M1D1M1D35M1I19M1I15M1D7M5I1M1D14M2D4M1D2M1D4M1D6M1I5M1D2M1D6M1I13M2I9M3D10M4D5M2I2M2I7M9D7M1I4M2D25M1I8M1D6M1D6M1I6M1I17M4I5M1I6M1D9M1D2M1I3M4I4M1I2M2I5M5I22M1I23M1I19M1D5M1I3M3I8M4I1M1I5M3D4M1D34M1I11M1D3M3I6M1D3M1D2M1D7M1D7M2D4M1D7M1I3M2D12M1I3M1D15M2D4M1D10M1I5M1D6M4I3M1D2M3I1M1D5M1D9M5D15M1D31M2D3M2D2M2D9M1I16M1I3M2D1M1I9M2I13M2D5M1I14M1I5M4D5M2I3M2D9M1I13M2I20M1D2M1D12M2I1M1I7M1D6M2D9M2I4M1I7M1I20M1D17M2D4M1D4M2D11M2D2M1I8M3D6M2D4M5D12M2D7M1D3M1D8M1D16M1D16M1I3M1D13M3I16M1D9M1D3M2D9M1I22M1I4M2D8M1I11M1D5M1I6M1I2M1I4M2D1M1D7M1D3M1I5M1I11M1D8M1D1M3I17M1D1M2I8M4D3M7D6M2I3M5I5M1D1M1D9M1D1M3I5M1I17M1D18M1I1M2D13M1D8M3D7M1I6M3D29M1I22M1D10M1I3M2I2M1I9M1I22M1I9M3I6M1I4M3I1M2D13M1D20M1D3M1I5M2I11M2I2M3I6M1D11M1D27M1I26M1I12M5D8M1I1M2I1M1I2M1I3M1I4M1I3M2D13M1D7M3I20M1D9M2D5M1I2M1I4M3D14M1D12M1D7M2D15M2I6M1I20M1I10M3D19M1I2M3D9M1I1M1I5M1D7M2I1M1D13M2D11M2I7M2D3M3I7M3I6M1I1M5I10M1D3M19I9M3I14M2I6M2D3M1I8M2I11M7D18M3I7M1D29M2D3M1I7M2D16M2D6M1D3M2I6M2I5M2D1M1D2M1D6M2D13M1I6M1D17M2I1M1D7M1I4M1I4M10I9M2D3M1D3M1D6M2D4M1D2M2I11M1I13M2D4M3I27M1D7M1I10M1I2M1D2M1D4M2I45M1D12M1D24M2D38M1D3M2D2M1D19M1I7M3D13M1D2M1D9M1I9M1I10M1I6M1D8M2D4M3I4M1I18M1I35M4D7M3D5M1I2M1D24M1D9M2I3M1D7M5I30M31I6M1I9M1D8M4I5M2I2M1I6M2D25M1I1M2D3M4I7M1I3M1D8M1I2M1I13M3D5M1I13M5D2M1D3M3I5M1D8M1I7M2I17M539S	*	0	0	AGCGGCCGTCTCTATGCTTGGGTGTTTAACCTTAAACCAATACATACAATGCCAATAGAGGCACCATGCCGAGGTAATCCGAATTGATTCAAATAATAATCAAAATGTATTTCATGGAAAATAGTTAGAGAAAACGAAGAAAAACCGACTTTAGAAATATCAACAGCAGACTCAAACATGACGAAAAACCATATTTCTATGCGTTCAGTCTTAAAGCAATTGGCGGTGATGTACTATGAACTATTCGATCAGCTAATTCCCCTTATTCTCCGACCATAATAATTACAAATAAACCAATACTCAGCTTTACAATATACTAACCGAAGGGTCATTGCCAGACCCAGGGTGCGGCATATCACAAAACGATTACTCCATAATCAATCAAAGGGACACTCATCAAGGTGCAGTTGACGTATCAACACGGTTCAGCAAAGCCCGATATTTCTTCCCGCTTCCAGCAACGAGGTTTCTTCCTTCGTTGCGATTCCCAGATCTGCAGCATCCTGAAGCGGCGCAATATGCTCACTGGCTACCTGCATCAGGCTTTTGTTTCTTCCGCCTCCCGGATCGAACAGTTTTCTGCCTTCCTATTCTGCCTTCGCGAGGTCCGATTCCATTGGATATTCCCCTCCCGGCGATAACCAGGTAAATTTTCCGGTAACGGACCCGAGTTTCAGAAATAAAGGACGCGTCGCCGGAAGCCCATAGACGGTTTTACCCCGATGGTCTTCACGATACGCCACGATTGCCCTCATCACTGTTTAGAAAACAGCCACAAAGCCAGCGGCCGGAATATCTGGCCAGTGCAATATCGGTACTGTTGCAGGCAAGACCCGGTATGAGAGGTAGAAGAGTATGCGTCACCTTCACGATAGATTCATGCGATCCGAGCAGGCAGATTATAATATTTTTATGGTCCGTGGTTGTTCACTCATTTGAATGCCATTATGCAAGCCTCGCAATATAGTTAAATCTGCAATGTTTTGACGTTTAGTTTTCCGTTACCCGCAGCGTTAACGGTATGGTGTGTCCGTGTAGGACAGTAATGAAAGAATGGGCATGAGCACAGAACAAAAGCGGATGGTGCCTCCGCCCAATACCAACTGTATGCCGCCGTGCGCACTCGACCTAAGGGGCGTGACAGCTAAATGAGTGACTGTGTTCCGTAATGACTGTCCGTTTGGTAAACCGCACAGGCAATACCCTGTGTGTGCTGCTTCCTTTAACGTGGACGATAAACTTCCTGTAATGGTTGCTGTTCCATACTGACTCCAGCCAACTGTTCATCCTTAAACCCTTGTGGCATGAGGCGCATCGCTGTTGAACATACAGACTGTGAGCATGAGCCCCCGTGTTATTCAGTCGATTTGATCAATTGAACTCCATCTGTTAGTATTTCGTCCCATGGTAATCGACCGACGGGTGGTTTTCGTCCCCAAATCCGTACCCGGATGCATGGCACTGTGGGGTGCGACTAGGATGCCGAGCCGATGTTTCCTGAGACAATACAGCACGACCGCTGGCGGGTTTCCCTTGATTGTGCCTCCTCGCATATATCAGGAAGGCACCCGATGGATACGCGACAGCAAGTTTTGGGTAGCTGATTGTCAAACGCCTGCCTGCATCAGGACGTAGCCAGACGAATGACGATGGTACGGGATCGGCGCAGGTCGGAAAGGCATGAATTCTCACCGGCCCCAAGGTTCAAGATATCCAACGGAGATTTCAGAGACTATCCTGCCAACCTGAGTCAGTTTCAGTCAGGCTGGCGGCAGTGGATTGCCCGAATACGCGGTAATTATTTTCGCCGTGGAAAGCCCTGCCAGCTAGTCGTCATAGTGTCGCATTCTTCCGGTTGTTTACCCGCAAACCGTTAGTCATGGCCTTATAAAGTGGGATTTCCCCAGCTGCCTCCGCAGTTCATTCAGCGTATTCAGTGCGTCAGGTGACGAGTCAGTAACATCTGGCGGATCGCGGCCAGTCAAAAGCGGTGTTCGCAAGTACTTGTTGGTACCGAATTAGTTTGGCGTTCCCGCTTCTTCGTGTTCGATATTCTATCGTAACGTCCAGTGGGCTTTCTGTTCGTTTCATGCACTTATTACCACCTTAACCGCCTTTGGCGTTGCAGCAGCGTTTCAGACGTGCTGTTGGTTGCACTGCTGAGCCTGCACTATCCCTTTCTCGTTGTCCGCATCCTCAAGCGCGACAGCTGAAGCTATATCTTCTGCACGGTATTTTGCCCAACGTTAGTCTCAAAGGTACTTTGCCACCTTTGCAGCTCACGCAAGCTCGTGTGAGCTGGGAGGACTCATTCCGCAGCCTCTGTCTCCGCCTTCGTGATGCCGTTGACGGCACTCCCGCCGCCGCTGTTTTGCGTGCCCAACAGAGGCGGGCTTCCATGCTGTTTCAGATGACCTTAGCATTCGTCTCCCGACGTTTTGCCTGAAGCAGAATTTTTCCTTTGCAGCCGTTGCCGCAGGAAGCTGCACGACCGGCTACTTGATGCGTTCGTTGCGCCGTATTTTGCTGCCTCTTTGAGGCCACCGCATCTCGTGCTGAAGGCAGGGCGCGTAACGCTTTCGTGGCCGCGGTGCGGGGCGGGTTGAATGGGTAATTGTTGTGACGCTGCAGCATTCGGTTTCTGACGTTTTCGCCGCACCGGCACTGGTGGCAGCCCCCGTTTTTGGATAGCGGGTAGCCTTAAGCACTTTTCCGCTTTCAGTGGCCTTTTAATGCCGCTTCTGCGCCGGAGAGGACGCTTCCTGATGAGCTGACGATCGCAGCCTTGTCCGGCGACGTGCTGGCGGCGCGTGCTGAGCGGCTTAGAGTGCAAGACGGTTACAAGGGGCCGCGGTACCTTACATGGCAGCTGATGCACTGGCATCGCCGGCTGATTTCTTCGCGTCTGCTCGTTCTCTGTGCCACCACGACGCGTTACGCGCCCTCTTCCACCATCAGTTCGACGACGCAGCAGCCTCCGGCCGGGCATCATCCTCCGTTTCCTGGCACAGAAAATGGATTCAGCGTCCCCGGTTGAATCTTCATACACGGTGATGGTCCCCGGCGTGCGATGGTGGGAAAACCGTCAACCTGCAGGAAGTACTGTACTGACCGTACTCCACAGCCGAGGGTACGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCACCACCACCGTGGTGTAGTTGACGTCTGGCTTTCACTATGAATGGTGCATAGTTCTTACCCTTTTCCTGTGCCGTCTTTCAGAACTCCTGAAATCTTTACTGCCATATTCGCCGCTAAAGCCCACCGGTTCCGGCGGGCTGTCAGCACTGTGTTACCTGGCTAATCAGAATTTATAACCGACTCCCAACGATGAATTGGTCAGTATCGCCAGTCGCCGCCTGCCGGATAGCAAGAAGGTAACAACGTGAACGGACGGTGCCTATTAATCTGTATACCTGCACTCCAAAGCCACTGAGGTATGCCGCATTGCAGCACTTTCGTCCCTGGCGTATTACCGTCCATTTCATAGATATACCCGGGGGTGGATTTCCGTCTTAATGGATCGCTGTACTGCCGCTACAAGGCGACTGTAGCCACTCCGGCCATGGCGTACCGCACTCTACTGCTTACTGATTTGTAAAACCGCCGTTATCATGACTTAATACACATGGACGACTCACCGTCCGCATAGAACGAGACATCCTCCCCCGGTCATCACTGTGCTGCTCTTTTCGACGCGGCGAATGGAGCGAAGGAAGCCATCACCCCACTGTCCGTCAGCTCATACGGTACTTCACGTTAATCCCTTTCCATATTAACTCACCGGTATCCCGCCCGACAACGACGGCACATCCGGTTTCGGCTGCTGAAAATAGCCCACCGTAAACGTACCATGTCCGTCCTCCGCACGGTAGGGGATGACTGTCACCGCAAGTGCGGCAAAGAGAAAGGCAATACAGGCACTCGCATCGTTCGCCTCTCACTGTTTATAATAAACGCCCGTTCCCGGACGAACCTGTAACACATAGCCAGACCACGCTGATGCCCGCCTCGTTTCTTAATCACCATAACCTGCACAACGGGCAAACGTATACGGCGGAATATCTGCCGAATGCCGTGGACGGGCGTGAACGTCAGGATCGCGTTTCCCCATTCTGAACGCGTCAACAATACGGGGAGAACACCTGTACCGCCTCGTTCGCCGAAGCCGATAAATCACGCACCCGTTCATCAGTACTTTTGAGATAACACATCGAATACGTTGTCCCTTGCCGCTGACAGTACGGGTTTCAGCGAAACGTCAGCCGGATGAGGCGAAGCACTATTATTGGCGATCAAAGGATGGTCATCGGTCACGGTGACAGTCACGGGTAGCTGACGGCCAGTCCACTGCTGCTTTCACGGCCTAGGAAAAGCCGGACTAGCCGCCGCCTTTACAATGTCCCCGACGATTTTCCGCCCTCACAGCGTACCGTTCTGAGTCGCGTTGGACGGTCAGCAGTACACTCCAGGGATCCCGGGGTTCGCATTCACTGCCACTGATATCCGCATTTTTAGCGGTCAGCTTTCGCGTCCGGTGTTAGAAGGTAGAGGATTGCCGCATGATGACTGTACCGGGTGATAGACCTGTTCCCGAACACGTCGTTCATCGAATATCTGTTATGCTCCTCGACAAACATCTATAGTTTCAATTCCCTATTTCACTGTACAAATAAAGCGATACGATTGGCCGACCATCCAAGAACTTATCAGCTCTCCTGTTTGGTTCTCCTGTCTCATTGCCTGCTACATGTACCCCGCAGACATAATGTTTCACGTCTGTTGGTCCTCAATTTGACAGCCCACATGGCATTCCACTTATCACTGGCATCCTTCCACTCTTTCGAAAACTCCTCCAGTTAGCTGGCGTTATCCTCCGTCAGCTCGACTTTTTCCATCATCGGTGCCGAGATGGGATGGGTTGCGTCTATCCGTGGGAAAATCCAGGTACCTTCCGCATCATCGCTCGCCGACCGACGGCCTCCACGAATGCCGATGATTGCCACGGCCGTGTTCACACTGCGGATATAAAGTAATAATCATGGCCCGGTTACTTGGGTACTGAGGACTCGGGTCCAGTACAGCGCCGTACCAATAACGCGTGCTGGTTTCAACCTAGTTAGATATCCGCAATCTGCTTTTCCCGAGAACCAGAACTCAACTGTACCGTCGGGTCATAAACGGCAAGTGCGATGGGATGGGGGAGAGTACTGGAAAAGAGCCGTCACATAGGCTCAATCCTCGGACCGTGTGCTGCCGGTGCGGCAATCCGGAACCGATATCCGACGGATCTCTGAGCCTGCTGCCCGCATTTACCGCCCGGACTGTCAGCCGTAGTTCTCCAGGGTTGCGTGAAGCGGTATGTGATTCCGGTTCTGGTTCCCTGCGTTAGACTCAGCCGCTCACTGCCGTCGTTTAACGACGTTACCGTTAAACACGCGGGAGTACGCCCTTCACCTGCTTGTCCCATCGCGCCAGCAGCTGATATTCCCCAGGTCGCATAGTACTTGCGTCGGGTCAGTCGAGGCTAGCACATGGCGGCGTGACACCATTCACCGTGCCCTCTCTGTTCGCCGTCAAAGTGCGCCCCGTTATCCACGATGGCCTCTTTTCCGGCACATGCTGCACGCGGTGATGGCATACGTGCCGTCGTCGTTCTCACGATACTCACGCAGCGGAACAGTCGATCGCGCGGCTTCATCGGGTGGCATTCATAAGCTTCATCTCCACGCGGCCCTGTATTCAGCAACCCGTCAGGAACACGCTAAGTACGCTGCCAAGCCGTCGGTGACGGACTATGATCCTCCACGCTGACCGGATTGCCACTTCTCGTCAACCAGGCTTATCAGCGCGGTACCGATGATGGAACCGTGATTTCACGGCTAGGGTCGGGGTCAGCGTCGGGGTCTGGCTGTTCACTAGGGAGCACGACCACCGGTGCTGATACCGGCATAGTCATCATCGCAGATTTCAATAACATCACCGGTACAGGGTGAAGCCCTTCTGCGCCGACGCTGAAATCCACGAATTCGGCATTCCCAGGAATTCGGTGTTCTTAATCAGCCACAGCCCGGCCGGTGCGCCTGCCCCGGCTGGTACAGCCAAGGGCATCCATCTTCGTAATAGATCGACCGTAACGGGCAATGGCTGCGTATCTTCAACAAGCTCTGTCGCCGTCTCCCAGCCGTTGTTTCGGGTCAATCCAGTTCACCTCAACGACGCATTATGGCAGTCCTTCAGGGCATGAAGCTGTAGCGGAACGGCACGCCATCATCCGGCATCACCACATTACTGCCGGTTATAGTCCACTAGAATCCCGACGCGTTAGCGCCGCACGAACTATGGTCGGCCTTCTGCCGCGTTCCGCTCATACCGGCATACAGCGCATCACCCGGCAGAGACTTGGCTGAGCACATCCCACGCCTTACGCTGTGGTCAGGATGGGCATTACAGGTAGTACCACGGCGTAGCGGCGTGCAGCCAAAGCCGTCCGGCACTGACTGGTCGCAGTACTGGCCGATGACATACAGCGCCCATTTATCTACCCATCACCACAAACCTATTTCCCATGCTATCGATGGGTCGCATATCCCAACACAGACAGCCATGTTGTTGCTGTGCCGTTAAACGTTCCGTCCCATACCCCGAGCTTACCCTCCGCGCGTCTTGAGTAGTTCGACGGCATCGGGCAGAATACGCCCGCGCAGATGATAATTAGAGCCCTGCTGGCTGCCGAACTGCTCCGAGTCTACCTGCACGCCGACCAGTGCCGTGTTCGGCACTGTTTCACATCGATGATTTCAGTGTTGACGACCAGAGCGTTGTTCTGCTGCAGCTGGTCGTGGTGCTGTCCGGCGTCATCCCCTGCGCATCATCTGGATATTAAACGGGCTAGGTAGTACAGGTTACCCATCACACCGAGGCCAGATACTGCAGGTGGTTGGGGCGGGCACTAGTGATCTTTGCGTTCTACCCAGCCGCGTCCGTGCTGGAACCAGCAGGCGACTTCCGACGATTCCTGTCACCCTTTGAGGTGGTTCCACCAGTGCCTGTACACCGAAGGTAAAGGCAAGACGGTCGATGTTTGCAAGTGATTAAGCTGGATAGATCGGGCGTCATATTTCACTTCCGTACCCCAAGCGTCTCGGAGCCGGAGGATCAAATTCCCTCAGGCCGTATTGCTCCTATCAACCAGCCCCGGAACACCACCGTGACACCGGATATGTTGGTATTCCCCAGGATTATCCCTCATTCTCTGTTCACAGACCCTAGTTTAAGCCATCCAAGCACTCTTCAATTCAACTGTCGCTGATGGCATCGATCACACTCAGCAACTGCGTGGACTTCAGGTCCTTCGCTTCGCGCGGGGTCCCTTACTGCTTCCTTTACCCATTTCCTCACGCTCCATAAATGACAAAGCTCCGCAAGCGAGTCCGCACAAAACATTTTGCATCAGCGACCAATCACCACAACCTGACCACCGTGATCCCGGGCCGTCTGCCGTGCTATCTCCTGAGAAACCACGCGTGGTACCGCAATCGCATTTCCGATTAACCCTGGACGGCAAGACATTGCCCTGGGCAACCATGTTATCCAGTGAGGAGAAATAGGTGTTCTGCTTACCGTTGTGACCGTTGTCTCGGGAGTTCGTACTGGCTTTCATAGTCAGAGCATCTGCGCCACCACCGAGACGCACCATACTGGCACCCAGAAAACAGGATCATTCTATAAGCACCCAAATGGCTGCCCCCATGCTGCAAGGCTCCGGCGGTAAAGAATGATCCGGGGATGGCGGCAGCCCCCAGACAATCTGGAATACGCCCTGACTTGGCCCCGGCGACTCTGAATACATACTGGCATTGAGCGCCTGACAGGCAGAGTCTCATGTAACTGCGCCCTTTCTGCAGGTTACTGAACTGATGACGTCTGCCCAATCGGAGAGGATGTCAGTCCTTATTATCTTAACGAAACTGATTCTATCAGTTTCTTACCAGAAACGGGAGGTTGTAACTAGAGTGCCATCATTCAGCCCCCGTTGCAGAAGTCGACGGTTAAGCGGTAACAAATCGTTGTAAATCCCCAAATCGAAGATGCGCCATGCCCGGTGACAGGGATGTTAGTCGGTTAGAGCCTTCATGTACCTCGTTTGCTCCGCGTGTTCCGGAATATGGTGCAGCAAGCCGCCGTCGCCCGCAGTAAATTGCGGGGTGTCCGGCACTGATGAACCAAAACAGCAACAGCAGCACATCTCACGGCTGTGCCGGCACGGAAGAGGCTACAGCCCCGTCGCCTCCATATTATCCAGATAGAGATTGCTTAGATTCGCCACCAGTCATCCTCACCGATGAAAGTCCGGCATCTCAATCCCGCCATGATAAGCATCCGGAACAGTGTGTAACAGTCCGTCACCGTGCTCAAAGCGCCGCCCGGTGAGATGCGGCACACGAGTGGGATCGGTTCTCCCCGGCAAGACCAGCCACGGCAAATCAACGCAGGCAGCGAGCCGGTCGAGCTTCAGCCAGGCAGACTCACAACCGGCTTGAGGTGAACAGCGCCACAATCTCACTCATGCATTTCTGCCTGCAGCCAGTCTTCCGGCGACATACGGAAATACGCTCCGGCTCACCGGAGATATTCACGCAGGGAAATACCTTTCCCCTCCGATTGGGCGTGCTTACCACGAAGCCGCACGACTCCCGCTGGCACAGCCGGCCGGGCGTGCTACAGAAATCGCTGATTCTGTCTGTGCTTTCGGCTTCTGCATTGCGAAGGTCTTAATGGGAAGGAAGCCGCCAAAGTTGCCGAGGACGTTATTGCGGAACTTACAACCCGCTCAGGCATTTGCTGCATTTATCCTTCGTGATATCGACGTTGGCTGGTCATATTCATCCGCGACAGCCGGACCGCTAACCGCACTCGTCTACCGCGATAGTCCAGGTGCATGTTGAGTGAGCATGATACGTCCTCAGGGGAAAAGCGCCATCCGTTTCCGTCGATTAACAGTACAAAGGAGGCACTCACCGCTCAGTTCAGCAACTGAGATGCGCGGCGACGGATCAGCCTCCTGCTCCGTACTGAGTAACTGTTTCCGTTGAAGGAAGTTCACGCATCCAGAAAACGGGCGTAAACCTTACGCCGGACCACCGTTCCTAAACAGACCTGCATATCTTCCGCCATCCCGGTACATACCGTACAGGTTAGAAATACAGTCGGCGTGGGGCTAGTCGTCATACTGGTGCCTTTGCCGGTCGATTCAAACCGCTCCCTGAATGGGGATACGGCTGAGCCATACTGCGCCAGGCGACCGGCTCACCTTTTCGTTCCTTACTCACAGAGAAAAATAACGTTCTCCACCGGCTCTCTGTCCTTAGATTTCCAGAGCACGCTGGCCGACTGCTCCGCACGGGTGCATTCATTCAGTGTTTCCCGTCACATACCGTTCTTTATT	*	tp:A:P	cm:i:111	s1:i:1072	s2:i:0	NM:i:2568	ms:i:3556	AS:i:3565	nn:i:0
+97	16	utg000001l	31	60	49S5M1I22M1D20M1I2M2D5M2D32M2D1M2D21M3D6M3I12M2D17M6D3M1D14M3I9M3D3M1I4M2D6M3I20M1D5M2I15M1I4M1D7M1I9M1I6M2I1M1I19M1D13M1D4M1I37M1D2M1D11M1I5M1I5M2I4M3D8M1D6M1D1M2D14M1D8M1D7M2I1M1I14M1D3M2D4M5D5M3I12M1D7M1I9M3I44M1D15M2I8M1D10M1I6M1D9M5I2M1D14M2D5M2D12M1D14M1I18M1I3M2D8M1I33M2I3M1D22M2D1M1D17M3D13M1D10M2I8M1I12M7D9M1D20M1I9M2I7M1I18M2D6M1D24M1D8M4D3M1I13M1D16M2D1M1I7M1D1M1D3M1I9M4I2M1D2M2D3M2D6M1D4M1D16M1D9M2D22M1D15M2I5M2D6M1I14M1I6M2D6M1D4M5D4M10D3M3D7M3I12M2D4M2I12M1D9M1D11M4D3M9D4M1D1M3D11M1D1M3D6M5D1M7D1M2D9M3D4M1D2M2I9M2D1M3D3M1D11M1I13M4D18M1D6M1I1M1I1M1I15M2D18M2D4M2D2M1I5M2I5M1D3M2D14M1I13M1D9M1D18M2D9M2D1M1D3M3D7M2I1M1D37M1D6M1I19M3I5M1D1M2I5M2I2M2I11M1D5M5D6M5D17M4I2M5I3M1I40M1D3M1D14M1D7M1I3M1D3M2I6M3I11M3I12M1D22M2I15M1I7M1D3M1D10M1D3M1D24M2D4M1D10M2D13M2D4M1D10M1D3M1D18M2I6M1D9M1D17M2D13M4D7M1I2M1D10M3D1M1D6M1I5M2D9M1D16M6I5M1D9M2D5M1D3M1D9M1I3M1I3M1I21M1I2M1D6M1D3M1D6M2I2M2I5M2I3M1I4M2D6M2D2M1D12M2D9M4D6M1I3M1I1M2I13M1I2M1D5M4D1M1D9M3D13M1I6M1D1M2D6M1D3M4D5M3I6M1I8M1D1M2D4M1D3M2D3M3D5M2D4M2I1M1D3M1D11M1I12M3D8M1D4M1I9M1D9M7D10M2I7M3D2M1I8M1D3M3D10M2I2M3D4M1I2M2D25M2D10M2D11M2I12M1I8M1I7M1D8M1I11M1I1M1I21M1I14M1D15M1D6M3I35M4D42M4I7M1D5M1I5M1I5M2D17M2I4M1I7M1D18M1I12M4D4M2D1M1I3M2I24M1D5M1I9M4I1M1D6M1D2M1D1M3D1M2D6M1D3M1D3M1D12M1D1M1D7M1D5M1I8M4I14M1I14M1D2M2I8M2D3M2D3M1I13M1D16M2D15M2D5M3D11M1D3M3I4M1I3M1D5M1I2M1D13M1D18M3D18M1D1M2D5M1D7M2I8M2I11M2D7M1D16M2D22M2I19M3I9M1D16M3I20M5D2M2D8M1D13M2I13M1D12M2D10M1D6M1I9M1I15M8I6M4D3M3D14M1I2M1I5M1I30M1D6M4I1M1D14M3D10M1D13M2D4M3D9M3D8M1I3M5I3M2D6M1D5M1D25M4D18M1I11M1I7M1I22M2I4M1I4M1I11M1D7M3D2M1D32M2D3M4D3M2D3M2I5M2D3M2I1M2I2M1I7M3I5M7D14M1D7M2I18M1D21M2D8M1D11M2I34M2D15M1I7M1I7M1D2M1D1M1D15M1I6M1D1M1D7M1D4M4D46M1D20M1I18M1I9M2I1M1I16M3D9M2I3M1D4M5D5M2I13M1D12M1D7M1I7M6D7M3D9M1I18M3D1M1D1M1D19M3I3M1D6M5D2M2D16M3I2M1I17M1I5M2D8M1I15M1D7M1D7M1I22M2I3M1D7M2D4M2D7M1D2M1I32M1D13M1I9M2I22M1I13M4406S	*	0	0	CGATCTAGCTTAATACCCCGAAGTACGTAAAGTGATAAGGAGCTAGTTAATATCATACAACGTGCGTGGAGGCCATCAACCACGTCAAATAATCAATCTACCGCATATCGTATTAATTGATCTGCATCAACTTAACGTAAACAACTTCAGACAATACAATCAGCACACCTGAATACGGGGACCTCATGTCAACGAAGAAGACCCGCAGAACAACACGAAGCCGGACATTGCTCCCCAAATAACGATTGAACAAATTAACATCGTCGGCTAAAAGCCAGTCGGGAATTTCTAGCCTGGTATAATTGAATGCCTGCCGTCGGAGACTAACGTCAGAAAAAGAGCATACATATAATTAAAAGTGATGAAGAATGAACATCCCGCGTTCTTCCCTCCGACAGGACGATATTGTAATTCGTATGCTTACTCGGAATGCAGCATATCGTCTTCATTGCGTTACCACTTCCTCAATCTAACGACATGCGTGTTGTGCTGACCAACTTCTAAATAGTTTGATGATTAGGCAGTTATGGCTGTGATCAGTCAACCACAGGGAATAATCCTTCATATTATTATACTCTTGATTAACGCTGCCTCAATTGCTGAATGCTTCCAGAGACACTTTATGTTCAGACCTCATGCAATTACAACCAGGGACTCATAGAAATGGTGCTATTAAGCAGTTTTTACACGAATCAGATCCACCGGCTTAATACCAGCAGATTATTCTTTATTCATTTTGTCCCTTCCATCGCGCTTGCTCTTCATCTAGCGTCAATATTACTTCAAATCTTCTGTATGAAGATTGAGCACATAGTCGCCTTACATACATCTGTCGGTTGTATTTCCTCCAGAATGCCAGCAGGACCGGATTTGTGGGTTACGCAAACCAATACTATTAAGTGAACATTCTAATATTGACATAAAGTATCAACAACACAGGAGACCAGATTGAACGATAAAACGATAATGCAAAAGCCCGCCTCGTACCACTGGAAGGTTTTACAATGGCTCAGGTTGCGTTTAAAGAAATATTCGATCACTTGAAAGATTTAGACTGTGAATTGTTTTATTCTGAACTAAGAACGTCAACGTCTCACATTATATTTGAGTAGCTCACAGATAATATTCACATCGTGTTGAAATAAAGCGTCAAAGAAGGAAAGGTTGTAAAGCTAATTCTAAAACTCACGCTAATTTGTTTAAAGTAAAGGTCGCATCGAAATGCTAAAGGATTACTGCCTATCGTAATTTGATGAACATAAAAGATATTACTATTTGATAATTCATTACTATTACTGTATGAAGGATTCAGAACACTACAAATCTTTCGACTTAGAATAGTGTCCGACCCGGTTTTCTTCGTGTCAGCACCGGGGGCGTTGGCATAATGCCATAATTGTACGCGCTAAACCCTGTGTGCATGCCTTTGTTTATTCCCGGACACTCCCCGCAGAGAATTCCCGTCAGGGCTGTGACATACGTTAATCCGGGAATACAACTGACGATTCATCTCACTACGTCCGACTACAGGATAAATATAGGACAACCCAACGCGTAAAGCCGTGGTCCGCTTTGTTTAATTTTCTACACATACGATTCTGCGAACTTCAACGAGATCGGAATAACACCATGAAAATGCTATCCGCTACTGCGCTGGCCCTGCTTATTACAGGATGTGCTGAAAGACGTTTACTGTTCAAACAAACCGGCAGCAGTAGCACCAAAGGAAACATACCATCGTATTTCTTCGTTTCTGGAATTGGCTAGAAGAACTTCATGCTGCATACATTTGTGGCGGCAGAAATGTTGTCAACGAAACCCAGCAAACATTCGTAAATGGATTGCTCGGTTTATTACTTTAGCATTTACTCATGGAAGCGTGTATTAGCCAATAATTGCCTGAGTTGCCATTGATATGGGCACTCTATCTGCACTGCCGTGGGTCTGGTTTACTTCTATTCCGCCTTTGTTTTGCCAGCTAAGTGATCAGCCTCTCTCTGAGGGCTGAATAATGCGTTCAGCTGTCTTGGTCTCGGCCTATTCGGGAGGGCTTATCGCCGGAGAGTGGTGGCTTCACGACTGACTAACGACTGCTTTGATGTGCAAACCGACGACCACCTAACATCATCATCACGGACCCATCACTTTCAGCTGTGTACTAGACTCCTTCTATTTGCATCGAGCCGGATAGCAACAACCACTGACGCAATATGCAGAGTCAATTGCCGGTTCGCCAGCTTCGTTTATCGGATTGTCGCGCTGGGCTTTGTCACTAGCGTTACTCAAGCAGCAACCTAGATGACATGAAGACGATGTCGATGCAGATAACCAGCCTAGATAATTCTAGGTGACTCTGCTCATACATCAATCTCTGTAACGTTCGACGGATCTTTGAATTTGCACATTCAGGCTGTCAGCCTTATGCTCGAACTGACCATACACGCCCGGCATTGAAGCCCAGATATTATGCTGCAACGGTTCATTGCCTGACGGATATCACGATCAATCATAGGTAAAGCGCCACATGCTCCTAATCTTGCTGCCGACATGCCAAGCGTCCTGACTTTTCGCAGAAGTGTCCTCAGGCTTAAGCTTGCTTGCGGTAGGCATCCCACCAACGGGAAAGAAGCTGAGTCCAGCCTATGTTGATTTGAGTTTTGGGTTTAGGTGACAAGTTTGCGCTGATCGCATGGAGTAAGCTTAATCTCTCTAGCCACCCTATGATCACCGGCTTCTCTTTCTGTAACGTGGTCGTTATCAGATTCCCCTAAAGCACTCGGAGCATATCGGAGCCTTACGTTGATTATTACTTCTACGCTCTGCTTCTGGCTTTTTACCGACCGAGTTTGATAAGCAACAGTCAATCACGGTCAGATAGGATGTAGCCGATAACACGCTCGTTATAAGCGATTGCTACTTAGTGGGCTATTAGGAGGTACGAATGAGAATAAGACCGAATGACTTGTGGCCACCCTAATCGTTGCGTCGTCGATTACTGTTTTGTAAACGCGCACCGCCATTATATCTGGTTACGCGAAGGACCCCATTGCAAACGCAGGATTGCCCCGATGCCTTGTTCCCTGCCGCGAAGGCGGCCAACAGTAGTTTTATCTTTCTGGCATCTTCATGTTACCCCAATAAGGGATTTTGCTCTATTTTAATTAGGAATAATAGAGGCCGTGATTACGAACAAATCCAGGCTACTCGTTTAGTAATCAGATTTGTTCGTGACCGATATGCACGGCAAACGGCAGGAGTGTTGTCGACCTCCTGCCACCCCGCTTCACGAATCATGTGTAAAGGCCGCACCCAATCTATTACTAATGAATTCATAAAGACGGTGGCTACGGCTCAGTTTGGTCCTGTTGCCGGGCGGCGGATGACGCCTGTACGCATTCGGTACTAGGGTTCTGCTTCTGTAGATGCTATTCAACTATCATTCAACAACGCAAACCCGACTTGGCTAACCAGGCTCGACTCTTCAATTACTATGATCGTATCCTCGGCCTTCTGTGCCAGGTCTACACGGAAGCGTCTCGTCAGGCTCTAACTATTATATGCGAACTGTTTCGGGATTGCATTTGCAGATCTCTGCCTGCGATGGTTGTTTAGTTCCAGACGATACGTCGAAGTGACCAACTAGGGAATTCGTAGTAAGCGCCGCCTGGTATTCACTACCACAACGAGCGAATCTAATACTATTCAGTAAATCCAATTTATTCAATAAGTCAATATCATGCCGTTAATATGTTGCCATCGTGGCAATCATGCTGCTAACCGTGACCGGATTCAAATGTTGTCTGCGTACCATGATTTCTTTGGATTGCACCAGAGCAGTTCTATAGGACAATTTGCGTGACCAGTGGTTGGGTAAGGTTTGGGATTAGCGGGTACAGCGCGTACCTGCTGCTGCTGGCATCCTTGAATCGACGCCTTTGCATCTTCCGCCCACTCTTTCTAACTCCCCCACAGCTCTGGCTTTGTGGCAATATCAACCGGACCGTCCTATCATGGCCAATCTTGCATCTTGCCCCGTCCCGTCGCGGGCACTACGGCAATAATCCGCATCTAACGCTTGTCAGCACTTGCATACCTTTGCCTTAGTATTCATTCAAGCTCTTGCCACACGGTATTCCCCGATACCTTGTGCGCAATTGCATCAGATAGTTGATGGTGGCCTTTGTCGGTTTCATTCGGGGTCGATCGAGTCGTGCTAGCAGCAGAAGGCTCGCAGGAGTAAGGAATTGGCGGGTCGGCTTCGCTGCGTATGCATATCCGTTGCAGTGTTCGAAGTAGGTGATAAATGTTCGATTTAGGGCTTAGCTCCAGATGAGGTCGGAATGAAACGGTTGCTGCGGCTCGATGTGCGTCCTTCTATTCGCATGGGGTTGGGGACCAAGCTTTGATGCGTGCAGAACTGCGCTTAGATGGAGTCACAGGCGGTCCGCAACGCTATCCATGATTGCTGTGTTGACTTGGACCATTTGAAAGCGTCCGTGGGTGGGCATCCCTGGATCACCCCGTTCTGTTGCTGCGATCGGAGCGGCCGCGATCCAGGCGCTCACGAGTAAAGCGGTCAGAACTCGTATTCAGCAGCACGGATAATCGGCGTGCAGATAACCAGCGGAGGTCCGTGGATCCATACTTCTACGGACGAATCGGCTGCTTATTGTGGAACCAGTTGTTGAGAATTGCGTGGATTAGATTAAAGAAAGTTAGATTGATGCAGCAGGTTGATAGGAAGTGTTGCACTCTAGAGTGCAGCATGCAGTAATCAGATTGCTGGTTGCTTCACGTACAGCTAGGCGGAAAGTGGAAATTTTACGGATTCCATGATCGAAATGTTGCTGCAGATCAATAACGTAAAGTCCGGTACGGTTAAGGATGTGGCTTGAATGAATTGGGTTCGTCGGTTATGTCCTACGGTTCGGGGCTGGAAGTGCATTGCCAACCGAATATCGCGTAAGTTACTTGCTGCCAGAATCTAGTGGGTGATCCGATCGCGTGCGGTTCCGGATGCGAGCAAGCTGCTAAGAAATGCTAGATTGGCTCCTCTTCATATTTCCTAGAGCCTGCACGGTTCGAGGAATTACGCGTAAGCAGTTCGTTATTGGGCGGGGGAGATGCCTGATTGCTTCGCTGTAGATGAGTGCAACGAGCAGCTCGAATTCATTTAGATTTGAGAACGGTTCGTGCCAATCCTGCTCGTTGCAGGTCTTTTAGGTTTCGGGGTGGGTTCGGTTCCGCTTGATCTGCCTTGCCACGCGCTGCTTGGAGAGTGAGTCGGCGTTAGCCAGGGCATTCGATTCGGTTGATCGCTTCCTTTGCAGCTTCGTAGACCCATGCAACTCCGGTAATTTATTAAACCGAAGATTCCTGTAGGCGCTCGATGCAAGACCCGGATTGCCGTGAAGTCGCGTTCATTAATCGGGAGAGTAGGGTGTCCCTAAGCAGTCAGTGTTATTGCGTCAATGTTGTGACGTGATTGTTTACACCGGCTAGTTCTAACTTAAGATGGTAAGGTCGTCGCGTTGCTCGTGCGGTTGAATCCGTGGTTATACCGTTGGTCCGGCTTGATGGCATTTAGAGTAACTTGCGGCCTAAGGTGGCTTTAGAATAGGGATCAGGTCGGGGTCTCGCTCCTCGTGTCTATTCTTCCGCGCCCTCCCTTTGCGTTCCGATGCGTAGGGCGTTGGTCTGTCTTGGAGTTCGACGCTAGAGTCAACGAGATGCAGCACCGTACGCGATTAGAAACCATTCCCGGCCAACTCATTCGAGTGGATGGCTGGGCGCCATCGAGTACTAGCTTCTCCTGCGGCGCACTGTTATCGGGATCGCTGATAGTCAGTTCTCGGTTCATGCGCGGTACACGCGGACTTCCTTTAATTTCATCGCATCGGTTTTGGCGATTCCCGAAGTCGCTCGAGGTAGAATGCTCCGGTATGGGCTGCACATGCGATCTAGTTACAAGTTGTGCGAATCTCCGTTGGCACGTCAAATTGGTGGCGAGACCGTACTCAGAACTGTCGGTCCCGTGAGGTCGAATGATGTGTGCAGTAGATCGTGCGCATGTGTTCGGGTCTAGTAGCATTTCGGATGGTTGCCGATTAGAATCAGTTCGCATTCGTACAGTGAGCCTTAGGTATCCTTTAGCTCGAGACCTTGCCTCCTGGCGGGTGTAACATGCGGAGGGGCTGGATTGGCAACTGTACGGATTCCAGAGGACCGATGGATGGTCGCACGCTATAGTTTATTATCTTCTCCCTGGATCAGGCAAGCATTGCAGCGGATGCCCCGAACCCGAAATCAATGCCTTGCGAAAATCAGTCTCGGTTGACTACGGGAAAGTCCGTATTGAAGGGCGGTAAGGTTAGCGATACGGCTGATTAATAGGTCCTGCGGAAGACCTTCGCGTCACCGTTAGACATTGCTTCCGGGTACAGAGACCCCTTAGTTTCCCGAGCGAGACTAGATCTGTAATGCTGAGGTACGAACGTGCCACCGACGCTTCCAATTCTTTGATGTCGGACGGTCACGCTGATGTCGCGTAGCACCTCGCATACCAAAGTCTCACGAGTCCGTGATACTTAAATGGCAAATGTAGAGCCGTTGCTCGCAGTCCGGGCGGCGTTAGCGTCTACTCCGGGCAAGCGCCACGTTGTGTTTGCAGTACTCTGCGGGGCACTCGGAGGCTGGCCGAGTCTTATTCAGTCCTATATCAGCTCTGCGATGCCAATCGACTTCTGTGGGGGCATTCCTGCATGAACCCGGTTACAGTTGGTGAATGGAACCAGTTTTAATTGGTGAGTTTAAGAACGGCCTGGAAGGTCCGCTTTATGGGTCCTGGGGCCATACTCAAGAATCGGCTTGGGAACAGCAGGTCTGGTGAAGATATCCTTGGTACTGGTTACGTATGAACCATTCGAGCGAATTGGGATAGAGAGACCTGGACAAGACTGCAGGCTATAGCCAGGGTCAGTCCCAGAACTTCACGATTCGCTTCCCTGAACCGAGACCCGACGCAGTCCGACTCTTACTTGCCAGGCAGGAACTATAATGCATTAGCGTTGCCCCGCGCCTTGCTTCATTGAGTGACACCTTTGAAATCCGCTAAGGTCAACGGACGAAATACTGAGTGCAGGACCTCACCCTTGATCCCTCTTGTGATTGCCTCTCACTGCCGAGGTCGATGCTTCGATTGATTGAGACGCAAGTGCCCCAAGGGCTGAATGCCATTACGATAGCGGATTAGCTTTGGAATAAAACTCGCGCCGATCAATCGAATGCGCCTATGGATCAATCGTGAGGCCGGTTACAAGCCATCCTAAAGGATCTAGGAACAATTCAGCCGCCTTAACCCCAACACTGCCGGTTTGGTTCGCCGCACTCAGCATGACCAGTACGCGCCATCCAATCCGACGGAGACCATATTAAGTACGGAGAGCTTCCTGAGCGCTTTCGATCTCGCTGCTTCTGTGCCGCGAGGAGGCTGATACTCGGGATGGTGCTTCTATTATCCAATCAAGCGCCGTACTCGGTGACCCTTGTTTGCTGATGTGCTGCTTTGGTACTGAACTCGAATAGCGCTTTATTTGGTTGCATTCCCTGCGCGTAAAAGAAGGCGCTTCTCAACCCATCTAATGAGTTCAGTCATGTCCAATAGCGATGTATTGGATCGGATACCACCGGTAATTACTCACTGTGGCATTTTAAGGGGTAAAGATTCCTTACCGTATTTAAAATCACTTCTTTAGCGGGCCGACTTCTTCCCATTTCCCCGGGCCTTCAGAAATGGGGTAATAATGTATCGCCAGAGTTACCCCATGCGGAGACCAGAATTCAGCTGAGATGCTTTATCCTGAATCTAGAAGGCGCCTTCAGTACTGCCGCTTCATTCAGTCGCAACCGTCCACGCGCTTTAACCAAATTTATATGCTGGTGCGGTATGGTAATCACGGATTGCCTACTCGCACATGGAGGTCATTACGCTGTGCCTATCGAACCGCTGAGTGCACTCCGGCTTCACATTTGGGTCAGCTTAGCGTTAGTCCCGGCACGATTAGAGTAGTTTACTTCAAGGAAGTTGACAGCCTATTCTTTTGTCAGGGACTGCCTGATTTAAGGATCGCAGTCAGGCAACACGCTTCGAATTTTCCATTCCGCGTCGAATTCGGATCAGATCTGACCGTACCGCATTTTATTGCATACACTGTTGGGTAAGATGAGTGTGCCTTGCTTCCACTAGTACGGTTAACTCTCTGGGTTACTGCATCGCGTATGCGGGCATTTCTAAAGGTCATCAAAGAGAGTGCCGAATGCATTTAAGTCTAGTGGTAACGTGTTCCCTCCGAACAAGGTTGGACAAACTTCACTGGGGCTACGCAGAAATCCATATTCAAATCCGACTCCGCGTTATAAGCGCATGGATGTGTACGCTTAGGGCGGAGCTGGAAACGGAGCAAATCACTGTCACGGCATCGCTATTCAGGGTGATGCTCTTGTCGGTCAACGGTTGAGTGTACTAGCTCGCACGCGCCCGAAACCTTCAGTAAAGCGCTCAAACACAAGGGGCTAGATGATCTGGGGCTCTAG	*	tp:A:P	cm:i:67	s1:i:616	s2:i:0	NM:i:1198	ms:i:1974	AS:i:1974	nn:i:0
+98	16	utg000001l	16	60	72S14M1I6M1D20M3I11M1I36M2I11M1I7M2D17M1D7M1D5M3I5M1I5M1D24M2D1M2D11M3D9M1I3M2I4M2D4M1I10M1I19M1I11M1D8M1I27M1I1M1I17M3D50M1D4M1D14M1I11M3I3M5D5M2D26M2I3M1D8M1D9M6I13M3D6M1I34M1D18M1I42M2I9M1I10M1I10M1D6M2I10M2I27M1D16M2I7M1I9M1I8M1D37M1I3M2D20M1D19M2D38M2I9M1I2M4D1M2D2M3D23M1I32M1I17M1I18M1I6M1D1M2I5M1I3M1I25M2I26M2I4M2I4M1I3M2D2M1D6M1D7M1I14M1D7M1D17M1D7M1D14M1I14M1I24M1I4M1D15M4I8M1I3M2D1M1D6M1I4M1D4M2D1M1D8M1D12M1I19M2I4M1D14M2D20M1D14M1I8M2I19M1D4M1I38M2D59M2I2M2D9M2D1M2D1M1I8M4D35M1D18M2D24M2D1M1D9M1D7M1D5M1I37M3I2M1D5M1D1M2I9M3D6M1I7M3I3M2I24M2D8M1I4M2I6M2D14M1I2M3D2M2D24M1D7M2I24M3I3M1D11M1D7M1I10M2I1M1I2M4I6M1D3M1I3M1I3M2I8M1I3M1D2M1D43M2D50M4I11M2I4M2I2M3D20M1I8M1D3M1D9M2D10M1I10M3I2M3I6M4D2M1D1M1D8M1I14M1D7M1I12M1D6M1D33M1D19M1D20M2D18M3I17M1I3M1I5M1D3M1D13M1I2M1D7M3D11M1I3M2D14M3I7M2I7M2I3M2D4M3D15M3D3M4D11M1I32M1I1M2I4M1D10M1I5M1I11M3D4M3D3M1D11M2I10M1I29M1D5M1D13M3D16M4I9M1D12M2I12M1I2M2D11M1I9M1I19M1I7M3D33M1D45M1D8M2D5M1I11M1D9M1D6M4I12M1I9M1D10M1D5M1I14M1D6M1D2M1I9M1I13M1D1M2I7M2I10M1D14M3D6M1I7M1D4M1D7M1D8M3I13M2D2M1I3M6D2M1D12M3I11M1I1M1I10M1D7M2I22M1I21M1I16M1D1M1D12M1D2M1D25M1D43M1D14M2D22M4D10M2D8M4D3M1D11M5D12M1I26M1I28M4I18M6D16M1D9M1D6M3D4M1D13M4D38M1I2M1I9M3D2M1I12M3I9M1I14M2I3M1I11M2I3M8I6M4I25M1D9M2I8M2D4M3D7M2D5M4I3M1D2M2I14M1D4M1D2M1I38M2I1M1D4M1I13M1I8M1I17M1I7M2D3M1I2M2D7M1I5M2D11M3D4M2D9M3I6M1I12M1D2M1D6M3D7M1D6M4D3M1I5M1I8M1I6M1D9M2I18M1D13M1I9M2D7M2D32M1D20M3D4M1D8M1D10M1D15M2I19M2D3M1D41M1D4M1D33M1I5M1I7M2I4M2I10M1I2M1I23M1I5M2I5M4I6M1I4M1I16M1D7M1I4M1D4M3D13M1D6M1D19M2D9M1D5M1D2M1I7M1D7M2D9M1I34M2D16M1D6M1D8M1I3M1D8M1D3M1I9M2I21M3I15M3I13M1I17M2I12M1I4M1I2M1I2M2D11M1D1M2I10M2D10M1I7M1D2M3I1M1D47M1D8M1I3M1I11M1I1M1I8M1I11M2I12M1D15M3D15M2D5M1I1M1I11M1D3M2D20M2I7M1D9M3I2M1D3M1D4M2I1M1D15M1D3M1D76M2D1M1I6M1I6M3I1M1I9M1D19M7D7M2D6M1I6M1I7M4I13M1D5M1I8M2I4M1I10M7I4M1D13M1I75M1I5M1D2M2I15M1I14M1D53M1D63M3D16M1I6M1I19M1I20M1D1M4D1M2D5M1D2M2I4M1I2M3I1M4I4M1D27M1D30M3D9M3D14M1I7M1D11M1I4M2I19M1I28M3I1M1I19M1D4M2D3M2I3M3I4M1I7M1I4M4D9M2I2M9I32M2I2M2I10M1I16M1I4M2D27M1I4M2I17M1D10M1D21M1I2M2D16M4I13M3D6M1D9M1I14M3I12M2D12M1D5M2I3M1D13M4I7M1D12M3I1M1I8M2I11M3D6M1I3M2D5M1I7M2I1M1D10M2I9M2D4M1D21M1I4M1D18M2D1M2D8M2D11M2D21M3D4M2D6M4D16M3D1M1I11M1D3M3D1M2D5M2D13M1I14M3I10M1D26M1D11M2I13M1I2M2D5M1I7M1D14M1D11M1I5M1I17M1I7M1D1M1D38M1I10M1D6M1I13M1I9M2D5M1I46M1D9M2I4M1D4M1I4M1I4M1D2M1D19M1I7M1I3M1I2M1I10M3I2M2I4M1I8M3I17M3I5M1D17M2I2M1I9M3I1M1D7M1I9M1D6M4I3M1I3M2D2M1D2M1D1M1D13M2D8M1D11M2D20M2D7M1I2M1I13M3I36M2I4M1D1M1D12M4D15M1I33M2I13M2I7M2I1M1I8M1D1M1D6M1D14M1D9M1D8M3D18M1I11M1D18M2D3M1I19M1D3M2I5M1D16M2D23M1I3M2D40M1D2M1D5M6I2M1I22M2I12M2D10M3I5M1I13M1I6M3D21M2D7M2I2M2I2M1D2M1D2M1D8M1I8M1D5M1I2M2I9M1D3M3I15M2I7M1D5M1D8M1D12M3I8M1D16M1I4M2I6M4D19M3I8M1D3M1D35M1D16M1D5M1D7M1D8M5I6M1D8M5D7M3D3M1D8M2D10M3D14M2D16M2I26M271S	*	0	0	CTACATAACAGAACGGCGTAGGTCGCCGCCGCGTAACCTGTCGGATCACCCGGAAAGGACCCGTAAATAGTAATGATTATTATCAAGCATATCACAACGTGCGTGGAGGCCATTGACAAACCACGTCGACATAATCAATTATGACGCAGGTATCGTATTAATTGACATCTGCATCAACCTTAACGTAAAAACAACTTCAGACATACAAAATCAGCGACACTGAAATACGGGCAACCTCATGTCAACGAAGAACAGAACCCGCAGAACAACCCGCAACATCCGCTTCCTAACCAAATGATTTGAACAAATTAACATCGCTTGAGCAAAAGGGTCGGGAATTTCTCAGCCTGGGTCATTGAAGCCTGCGTCGGAGACTAACGTCAGAAAGAGCATATACATCAATTAAAATGATGAAGAATGAACGTGTCGCGTTCTTCCTCCGAACAGGACGATATTGTAAATTCACGGATTACGAGGGCGGCATTGCAGTAATTGAGTTGCAGTTTTACACTTTCCGACAGTGACGACAAACTGCGTGTCAGCTTATTGTCCACAGACTAAATAGGTTGAATGATTAGCAGTTATGTGATCAGTCAACCACCAGGGAATAATCCTTCATATTATTATCGTGCTTCACCAACGCTGCCTCAATTGCTCTGAATGCTTCCAGAGACACCTTATGTTCTATACATGCAATACTACAACATCAGGGTAACTCATAGAAATGGTGCTATTAAGCATATTTTTACACGGAATCAGATCCACGGAGGGATCATCAGCAGATTGTTCTTTATTCATTTTGTCGCTCCATGCGCTTGCTGTTCATCTAGCGTGCAAATATTATTTCAAATCTTTCTGTATGAAGATTTGAGCACGTTGGCCTACAACATCATCTGTCGAGTCTGTTCCCTCCAGAATGCCAGCAGGACCGCACTTTTGTTACGCAACCAATACTATTAAGATGAAAACATTCCTAATATTTGACATAAATCATCAACAAAACACGTTGAGTACAGACCAGATTGAACGATAAAAACGATAATGCGCAAACTACGCGCCCTCATCACATGGAAGATGTTTACCAAGCGGGCTCAGGTTGCCATTTTAAAGAAATATTCGATCAATGCGAAAGATTTAGACTTGAATTGTTTTATTCTGAACTAAAACGTCACAACGTCTCACACAGTATTTACTATCTAGCCACAGATAATATTCACATCGTGTTAGAAACGATAACACCGTGTTAATAAAAGCACTTAAAAAGATGTAAATGTTAAATTCTCAAGAAACACGCATCTTATAGAAACGTCCGATGAGCTTGAAATCAAGAGAAGTACATTTCAGCAATACAGGGAAAATCATGCTAAAGCAGGAGTTTTCGATGGGGTCACAAATATCCATGAACATAAAGATATTACTATATTTGATAATTCATTACTATTTACTGAGAGCATTCAGAACACTACACAAATCTTTCCACGCTAATCATAACGTCCGGTTTCTTCCGTGTCAGCACCGGGGCGTTGGCAGTAATGCAATACGTGTACGCGCTAAACCCTGTGTGCATCGGAGTTTAATTATTCCCGGACACTCCCGCAGGAATTCCCCGTCAGGGCTGTGGACATAGTTAATCCGGGAATACAATGACGATTCATCGCACAGTGACAGCACATTAATAAAGTTAACAATATGAAATTTCAACTCATTGTTTAGGGTTTGTTTAGCATTTGCCACATACGATTCTGCCGGTAAAAGCATCGGGAATAACGCCATGAAAATGCTGTTCGCTACTGCGCTCATGCTTATTACAGCAGTGCTCAACAGCGTTTACTTGTTCAAAAATGACAACGTGGCAGCATAGCCACTCAAAGGGAAACCACTTATAGATAGCTTTCTTCGTTTCTGGAATTGGGCAGAAGAAAACTGTCGATGCAGCCAAATTTGTGGCGGCGCAGAAAATGTTGTTAAAACGAAACCCAGATAGCAAACATTCGTAAATCCGGTGCTCGGTTTTATTACTTTAGGCATTTATCGCTGGAAGCGCGTGTATTGCTACAATAATTGCTGAATTACTCATGCCATCGATATGGCGTAACTCTATCTGCTTGCTCATTAATATACTTCTCATTCCTCCAGTTGTTTTGCCATAGTAATCAGCCTCTCTGGTCGGTGAAATAATCCCGTTCAGCGGTGTCTGCCAGTCGGGAGGCTGCATTATCCACGCCGGAGGCGGTGGCGGTTCGCACCTAACCTGACGACTGCTTTGATGTGCAACCGACGACGACCAGCGGCAACATCATCACGCACACGAGCATCATTTTCAGCCTTTAACCATGCTAACTCCTTCGTATTTTTGGCTCTGCATGGAGGCAGGACATCACGCTGACGCATCTGCATGTATGTCGTAATTGCCGCCGTTCGCCAGCTTCGTTTCTGGCATTTGTCGCGCTGGGCTTTGTAGGTAATGGCGTTATCACGGTAATGATTAACAGCCATGACAGGCAGACGATGATGCAGATAACCAGAGCGGGCGGAGAGATAATCGCGGTGACTCTGCTCAGCCATCAATCTGACCGTTCGGCCCGCTTCTTTGAATTTGCAATCAGGCTATTCAGCCTGCTGAACTGACCAACCAGCGCCCGGCAGTGAATACGAGATATGCTGCAACGGTCGATTGCCTGACGGATATCACCACGATCAATCAGCTACGACCGCCACGCTCCTTAATCTGCTGCATTAATGCCACAGCGTCCTGACTTTCCAGAGAAGTCTTTCAGGCCAAGCTGCTTGCGGTAGGATGAGCAGAAACGGGAAAGAAGCTGGTAGCCGTCGGCTCGCCTGTTGATTGAGTTTTGGGGTCCTTACAAGTTTGCGGTGATCGGAGTAATAGTAAAGGCTCTCCTCGCCTAATGACGTCATAACCATGATTTCTTCTGGTTTCTGACGTCGTTATCATTCCCTCAGCGACCACGCCAGCATATCGAGGAAACGCCTTAGTTGATTATTGATTTTCTACCATCTTCTATCGGCTTTTTAACGCGCGAAGCGTTTGATAAGGGAACCAATCGAGTCAGTACCGATGTAGCCGATAAACACGCTCGTTATAAGCGAGATTGCTACTTAGTCGGCGAAGTCGAGAAGTACGAATGAACTAGGCGATAAGCGGCACATCGTTGCGTCGATTACTGTTTTTGTAAACGCACCGCCATTATATCTTGCCGCGAAGGTACGCCATTGCAAACGCAAGGATTTGCCCGATGCCTTGTTCCTTTGCCGCGAGAATGGCCAACAGTACTGTTCTGGCATCTTCATGTCCCCAATAAGGGGATTTGCTCTATTTAATTAGGAATAAGGTCGATTACTGATAGAACAAATCCAGGCTACTGTGTTTAGTAATCAGATTTGTTTCCGTAGACCGATATGCCAACGCGATCGAAGACAAACGGCAGGGAGTGTTAGGCGCGACCTCCTGGTCGCTCGCAATTCACGAATCATGTGACAAAGCGCATGAGTAACTATTACTAACCTGAATTCAGGACAGACAGTGGCTACGGCTCAGTCGCGGTTGTGCTGTTGCTGCGGCGCGCGATGACGCCTGTACGCATTTGGTAAGTGGGTTCTGCTTCCGGTATTCTCGACTGCTTCAGCACAACGGAAAGAGCACTGGAACCAGGCTCGCCGACTCTTTCACGATTATCACGAATGCTTACCTGTTGTGCAGATAGAACTCCCGAAATGACGGTCTGCAGGCTCTAACTATTACCTGCGAACTGTTTCGGGATTGCATTTTGCAGACCTCTGCCGGGATGGTTGGAGTTCCAGACGATACGTCGAATGACCAACTAGGCGGAATCGGTAAGCCGCCTCTTTCATCTCACTACAACGAGCGAATCCTAACCCATCGTTGAGTCAATTACCAATTTATTCAATAAGTCAATATCATGCCGTTAATATGTTTCATCGTGGCAATCATGCTGCTAACGTGACCGCATTCAAAATGTTGTCTGCGATTATGACTCTTCGTGGCGGCATTGCACTACAGAGCGTCATACAGGCGGGTAGGCCAAAGTTTAGGTGACCAGGGTGGGTTGGGTAAGGTTTGGGATTAGCATCGTCACAGGGGTCTGCTGCGCTTGCTGGCATCCTTGAATAGCCGACGCCTTGCACTGTCGCACTCTTTCTAACAACTCTCGCCCCACAGCTCTGTTTGGCAATATCAACCGGACGCTCCACTCCGGCAATCTGCATCTGCCCCCGAGCGCGTCGCGGACTAACGGCAATAAGATCCGCATAAGCGAATGTTGCCGGGGCTAGATTGCAGTATACCTTTGCCTTAGTATTTCCTTCAAGGCCTTGCCACACCACGGTATTCTCCCGATACCTGTGCAATTGCTCGCAGATAGTTGATAGCCTTTGTTTGTCGTTCGGGCTGAGTTCGTGCTTACCGCAGAATGCAGCCATACCGAATCCGAGCTTGTGATTGCGCCATCCCCCATAGCAGACTCATCACATACCGTACCGGAAAGAGAGTCAGAAGCCGTGGCCCGTGGTGAGTCGCTCATCATCGGGCTTTGTCGGCGAATGAAATTAGCTACGCTTTCGAGTCTCATGCGCCTTCTCCTGTACCTGAAGCATCATGTTAGGTTTCCGGCAGAACATGCTAGGTATCGATATACATTTGGTTGGCAAACTTGAGTGGTTTCACTGCTGGCGTATGACCAAAGATGAACGTGTCCCGCCTTTGATTTCTTTTAACTACCATCCCGTTTGTGAGTTGCTGATTCGGTTCGCGGTCCCATTACCTGTAGTGATGACCAATAACTGGCTTCCGACTCGGTATTCGTTACAAAGGGATAATCGGCGGTCGCGGCAATAACATATTTTTGATTTGCCTACCAGTTCGATGATTAACGGAAGTTCATCTGCTTTATGGGCAAGAGCTTTAGCCAGAATTTCTTTGTCCGTAATCGAGATTAAAGAACCAGCACCGCCATTAAGCAGCAGTGATTAACGTTTCCACGCTCTGATAAGCCATCAATCATCATTTGCTCATGGTTTCCACGTACAGCTCTGAACCAGGGAATGTGCTTAATTCCAGGCATTCAACGTTCTGCACCATCAACCAAATCGCCACCGAGATAAAGCAGGTCTTTTTGTTGTCCGAATCCAATCGTATCCAGTTGTTCATCAGGTTCGTGTGGCTGAACCGTGCAGATCGCCAACTACCAAATATTTCGGATTTGCTGCCATCAATTTTCGTAATAGCGCTCTCTTTCACTCCATCCGCGATGAACCATGAGAACGTCGTTGAACGATGTGGCGTGCATTTTCCGTTCTTTTATCATCAACGACTACTTCTGACATTTACCAACCGCGACCCATTTCAGTCTGCGTGCTACTTCTGTCTGATTTCCGTATGTTTCAACGAGCATGTCTGGAATGGTTTTACTGAGAACGTCATGCGGCCTCACTTCTGGTAGGTTTTCGCAGTCTTTTTGAATTTCTGTTGTATACTGCCTTGATCGCCTTTGCACTCTTCGATAGTCCAGCGATGGCGGTTATGGTTTGATTCGATTTCGTCTACTGCTTCCTGCCATGCGATGCGGCTAATCAGGTCATTCGACGCGATACGAACGAGATTTCCGCTTTTGTGCTGGTTGCAAGACACGCATTGCTTGAATATTGCGTTCATTAAAATGGAGTTGAGGTGCCGCAAGCAGTTGTCCGGTAATGTTAGCGGGCAACCCCAACTGAGCAGACGTGAGCGGTCGGCACGGAGATACGGAGGTAAGTCGCGGTTCCCTTCTCTGATGAAGGCGTTTACAGCTTGTTGGGCTTGTTTAATCCAGTAACTGCGGCTTTAACGAGTTTTCGAAATCTTAAGTTTATCTTCTGTTTCTGCTCCTCGTCGTCGTTTCTTCTCTGCTGCTTTTCCCTTCTATTTCGTCGTAGTTCGAGTGCTATCTTGATTCGGACACTCTGGAGGCACCACCACTGATTAGCGAATGCAGGGTGAAACCATTCTCCCGGCATTCATCGTTTTTACCGGCGTCCCGCGCTGGTTTAGCCATCACTTTCTTTCCTCCGTGCATCGAGCTATTCTAATCGCGTATCAGTTCTGCGCAGCAGTGCTCACACGTGAACTTCCAGCACATGCAGCTTCTGACCGCAGTTAGCACGCTCAGAGGACTCGACGGTTTTCTTATTCAGATCTTCGATTTTGGTCAATCACCTTGTTTTCCCGCACGACGTCTTAGGGAGCATGTACCCAAGTGAGCCGTGTAGTTGAAGGTTTTTACGTTGAGGACTTCGTTTGGGATTGGCTTGGGTTTACCTTCTGGTGCGTTTCGTTGGAAGGGTATTTGCAGTTCGCAGATTATGTCTAGTGATACTTCGTCGCTGTCTCACACACGTCCTCCTTCCTGCGGTGGTAACCCCTGTTGGTGATTCTTTCACGGAGACCATCGATTCCAAGGTTTGATTTGGTCGGAAGCGTTTAGTCTTTCTTTGCATTCACCGCGCACCGATAACATCGCATCATGCAGCTTCCCTCCCCGAAGTCGAAATCAAGCTGCCTCCAAATATTTCGCCATGACTCAGAACAAGAGCCGGTATCGAATCTTCCTTAGCTCGTACCAGTTGTCCTGCTATACAGGGCTTGATAATACCTTCTGAATACAGTCGCGATACGTTAAGCGACATTCTTCCTGGGGTACATATAATCTCCTTGGCGGTTCCCGATGTCTAATCGCACATGGGATCCCGTGATACCGCCATTAAAACACGCTGCAATCCCTCCTCATCTTTGCAGGCAAGTCCGATTTTGCGTTGATTTTTAATGCAGAAGCTGCAGTTACCGAGTGTCCGGGGTATTTGCTCGCAAATCCGAATGGTTGTTGCTCTTCGACCATGCGCGTATCTTCCCTCTTCTACAAAGTCTGACAGTTTCAGCAAGATATCTGATTCCAGGCGTTTGGCTTTAGCCTTGCGTTGCCTCATCAGCTCTGATGCTAATGACGGTGGTAATTCTAGCCCGAAATGGTCATCACAGAGTATTTGTGAAGGAACGAATTTAATCTGTCATAGGTGCAGAACGCGCCGCCGACGTATGGAGTGCCATATTTTACCATATCGATAAATGGGTTTCAGAACAGGCATTCGCGTCTGAATATCCTTTGGTTCCCATACCGTTAACCGGTTGGCTGTCCACAAGCTCCGGGTTTGATATCAACCTGCAATACGGGTGAGCGGTATCTCAGAACTTCAACTTCCTTAAACCGATATGTCATTGGATGTTCACAACCTGGTATCCATGAAAACGTAATGCACGTCGTGTCTCTTCGGAGCCTCGTCCGTCCGTATAGATGATGGAATGTTATGCTTGAACGTCGTATTAACGGGCACGACGAATACTAGTCCATGCAGACTGGTGTCCGTCTCCCCATCTGCTTCTCCATCCCGCTCACCGTTTGCTGGTTTCTGTCTTGACGGTTTATTAACGGTGATCTTCTCGATTGACTTCTATCGGTTAAGGTGTTCTGGACCCGTATGCCTGAATTCGCCTTACACGCATCCTGCAGAGTTTAAACAGGTAACTACGAAC	*	tp:A:P	cm:i:180	s1:i:1523	s2:i:0	NM:i:1591	ms:i:5648	AS:i:5648	nn:i:0
+99	0	utg000001l	10316	60	1822S26M1I2M1D21M3D2M1I1M1I7M1I9M1I4M1I3M2D12M7I21M1I6M1I8M1D7M2I7M1I10M1I3M1I3M4I3M6I3M1I1M4I6M1I3M3I2M1I21M1D4M2I10M1I4M1D1M1D6M2I2M8I4M2I22M1I4M45I4M2I16M1D14M1D8M1I6M1I2M3D4M1I3M1I4M3D12M9I12M1D1M2I4M1D11M1I5M2D11M3I3M4D12M3I5M1D7M3I5M2I2M1I5M2I7M3I3M1I9M3D2M1I13M3D5M1I10M2I3M1I5M1I4M4I1M1I8M1I2M3I6M1I2M3D9M1D18M2D3M1I4M1I10M3D6M1D4M1I11M4I5M2I5M1D9M1I5M5I5M1I2M6I9M2I13M2D2M1I19M2I15M1D16M1I13M1D5M2I2M1I2M1I4M1I1M4I5M2I1M4I10M4I6M3I1M2I1M1D6M1D38M4I5M1I5M1I18M2I1M1D3M1I6M1I8M1D13M1D12M1D17M1I4M1I4M1I19M1D16M1D9M1I1M1I5M2I5M3I5M1I15M2I11M3I15M2I25M1I4M1I5M1D17M2I16M7I2M1D1M1D3M1I9M1I2M1I17M1D1M1D2M2I5M7I4M1I6M1D10M1I3M2I1M1D5M1D4M1I9M3D1M1I13M2I8M4I9M2I16M2I1M1I3M2I24M1D10M1I3M3D2M2I11M1D1M2D16M2I17M1D18M3D14M1I6M1D11M3I2M1I9M2D1M1D11M1I8M3I15M2I8M5D2M3D2M4D1M4D5M4I3M1D4M8I8M1D4M1I3M2D12M1D6M1I2M1I1M1I12M2D2M1D12M3I2M1I8M1I4M1I4M4I10M1D6M1D11M3D3M1D4M2D6M1I3M2I27M2I16M2I2M2I1M3I1M2I7M7I10M1D6M1D5M2I2M3I2M4I2M1D20M4I2M3I5M3I8M3I2M1D2M1I24M3081S	*	0	0	CTGTTCTTTCGTGGTGGTGAGTCCGTTGCTTGGGTGTTTAACCTTCGTCAAAGTTAACCAGCATCTGTTAGGATGTTTCAGCGTACCCCGTAAATCCAGTCTGTTTGTCACGGTTACAACAGTTTTGGTTAGTATTATAAGATTAAGTCCACGTTCTAAGTCGCCACGTTTGGGTTTCTAGGTTGGGGTCCAACTCACTTAGACAGAATTTTGGCCCGGACTCCATCGAACAGCGCAAGTTGGGCTCGCGGGTCATCAGACCCAATCGACGCACCCGTAAGATGGGTCTACAAATCTCGTTACTCGTCCCTACGTCTCACCACGTTCGCATCAAAACAGGCATCGGTTCTTCGCGGGGGTCCCTGCTTTCTGTAACGCCTCGCTGCTGCCAACGTCTTCTGAAATCCTGAATTCAAACTATGCATCTGCTACCGGTCAAGTTAAAATGTTGTAGCCGGTTCGGTGCTTATATCAGGATCGGGAGCCGAGTTGAAACCATTTCGCAAATCCCGTTTCTGACGATTTAAAGCACGAAGCATTCTTTCTCCGATTCTCTATGGAGGCATCATTATGCTTTTTCTTTCTTTCGCTGTGTTTGTCTTATACCTAGGACTGTTTCGCAGTAACGATCTCACCCATTCGGATGTTCCCTCGTTTTCCGCGATTTCCCTCGTTCTACGCAATGCACCATTCATCGGAGATTGATGTTTTATTTGGTCAAAACCGCTTCTCACGCTGCTTAATATTCATTCGTTCTGACGAGTTCTAACTTGGCTCCATTGCACCGTTTGACAGGTCGACTTTGTAATCTCGGTAAGTTGAGAACGCAAATCGCTTACGATTCTGTCTACGGTTTATTCATATTCGACGATGATGTCGTTTTACGCAGAATGGCAAGCAGCCCCACTTTAAACTGTCGCCTGCTTCCACGTGCCTCGCCCGAATAACGGACTCGCCCCTGAAGCAGCATATTTGATAGTCTGGGGGCCGGTAACCATCATCGCGGGAGATCTGCCATTGATTACGGCTCCCGTGCCTTAGCAAAGTCTCTGCCGAAGTTGTATGCATTTTGGTATTTTAGTACCGATTCCTTGTCATAGGTACTGTAATGATTTGTGACTCTAAGTGCATGGACTCGAGAACGAAACGCTTCGTTCGCTGGCCGCTCGGTCGGGCGTTTTTATTGGTGAGAATCGCAGCAACGTACTAGCGCCAATCGGATCGAGCCATGTCAGTCGTCAACGACCCCCATTCAAGAACAGCAAGCAGCATTGAGAACTGTCGGAATCCAGTCCCTCTTTACCTGCTGATCTGCGACTTATCAACGCCCACAGCTTCCGTCTTTGCGTCCGGGATCCCAATTTGTTCACGAGCACTCCATAACCGGCGTTAAGCTTACAACGGCAAGTTCGATTCGGCGTCAGGGATGCGTATCCTGGTGTTCTATCGACTAAATTGAATTAGGATGATCTCCGACTAATGCAACACGCGGTGATTTGAATCTCGTTTCGCAATGGAATGTGCCCACCTATAAGCGGATTATTCTAATCCTGTTGTTCTAAAGGAAGGGGTCGTCACACCATGGAGGTTTCGATAGGCCCCGTTATAGTTCGTAAAATTATTTCACCTCCTGCATAACGCTCGCAGGTCTTGACGCTTGTTAAAATCGTGCGGTCCTCCGCCCAATCTTTAATCCTGTTTGTGTGATTCGCCCCGTCACGCCCATTGCGGCGCTGTATTTCAAATGCATTGCCTAATCCTGCAGTTCAGGCTCAGGTCGCGTCGGTACACTTCCTCAGTACATGCAACCATTAGCCCGCTATAAATAGTCAACACGCACGGTGTTAGTATTTTATCCTTGCGGTAGAGTTAACGTATGAGCACAAAAGAAACCGGTTAGACAAGAGCAGCTGCACGGACGGACGCACGTCGCCTTAAAGCAATTTTATGAAAAGAAAATGAAATGGCGGCTTATCCCAGGAATCTGTCGTCGCAAGACGAGCAGATGGGTATCGGGCAGTTACGGTACCTGTTATTTAATGGCATCAATGCATTAAATTCACGGTAACGCCGCTTTGCATGAACAATCGCCAAAATTCTCTCAAAGTTAGCGTTGAAGAATTTAGCCCTTCAATCGCCCCAAGAAATCTACGAGATGTATGAATGGCGGCCGGTTATAGTATGCAGCCGTCATTAGAAGTGAGGCTGAGTACCTGTTTTTCATGAGCCGAGGCATGTTCTACGCCGGGACCTTAGAACCTTTACCAAAGGTGATGCGGAGATGGGTAAGGCACAACCAAAAGGCCAGTGATTCAATGGCTTCTATAGTCGATTGAAGGCTAATTCCTAAGTGACTGAAGCCACCAAAGACAGGCTCCAAGCCAGACCTTTCCTGACGGAATGTTAATTCTCGTTATACGTGAGCGAGGGAGGCCGTATTTCGCGCAGGTGGATTCTGCGACAGACTTGGGGTGATGGCGTTTACCTTCTAGGATAACGGTACCGAGCGGTCGGTCGTTACAGGTCAGGGGCCTAACTATACAGGACCCAATGGGTCCCGATAATCCAGATGGGTACGAGTGTTCCGTTGGCGGGAAATTGCTCGTCAGTGGCCTGAAGAGACAGGTTCTATAATCCAACGCAAGCGTCGGTCGCAGTCGTTCTTTACAACGAGCATACGAATTTCACTGGCACGAATCGTGCAAACGAATTGTCGGAAACTTCTATACAACAGATCAACAGTAAATGGATTGAATTATGACGCAAGGGTCCTGCGTCCAACTTACCGCAGCCAAAATAAAGGAAAGATAAGCGCTCAATAAATCCTGTCTGTTTCCTTAATTCTATCGATAATGATACCTGCATGCAGGATCCAATTATTTGTGGTATTCATAAAATCGATGGAAAACTTTTCTCTTTACAAACAAATGACAAGAGTCTGGTTCCCAAATACCAAATGGGACGCTTCTAAGTTGAAGATATATTAAGAACAGCCTCGCAGATGACGAATCATTGGGATTCCCATCTTTTGTTTGAAGGCGACACCATTGGTTTTGTGCCAGAACTGTTCGGGGTAGAACCACATCCGATCTGACAGATTTTAATCGGGAAAGGAATGTCATTAAGCATGCGTCAGTGGGAGAGGCGTTCAGATAAGCCAGCCACTGATGTATGAGGAAATACCAAAGACGATGTTATGCATATGCATTCATTTCATCTAGATAGAACAACGGTGAAGGTAGAAGCCAAGCTACCTGTATTTGGCGTATTTAAAGGTCTGTAGAAGCCAGATATTGAAGGGGAGCTTTGACTCATTATGGATAGTCATTAAGCCAAATTAAAAGGGATAAAATGCTAAGGATATTATTTTATACGTCACCCCAATTTTCAGACATTATCGGGCAAAGATGAGGGCCGGAGATATGTTGTAACAGAACATTATCTATCAGAAAATAGCCATCTCATGCCTCTGAACACAGTACTAAGATGCTGAGATGAAGAGATGAGATCAGTTGAGGCAAGAATGAAAAGTGATACTGGAATGAGGGACGTTAAGGATAGGCACAACCATAGTACGGATTAGTCTAGGAGTAATTATGCGGAACGAATCATTGCCTGGTGTTTACATGACCATAATTCCTCCTTACGTTATCGTAAGCATTTGCAGCTCCCGATTCCTTTCGACGCCACTACATTCCTGGTTTCTTTCATGGGTGCCTCATGAGAATGGTCTTGGGGCGAAGACGACATTGTCATCATGTAATGCAGGAACCATGATTCCAATCCTGATTGCTGCCTTGACCGACGTTTCTCTAACAATCGCCGACGAAGGCACGACCTCAATAGAACTTCTGAATGACTGAGATTAGTTGGGGTCGTGACCCGGGTAGCTGCGCTTTGTTGGCTGGCGTTGTGTTCATCAGGTGGTCCTTCTTTCGTGTATCGTTCATCCCTCTCACGGACTCAACCGTGGTATCCTATCTATAAGCTCCCATTCAATCTTCCATCCTGCATCGTTCATTCATATGCATGCGCTTTCCAAAGGGTATAATTGTAGGGGATATAGAACGAATAACCGAATAAGACCCGCCGGCCCGCTTCGGTTTTCTGCCTCACGATCGCCCCCAAAACACAGATAACCAATTGGTATTTATTGACGAAAGACCGACCTAGATGACTAAACCTACGAACGACAGCAATTCGGATGATCTCTACCAAACATTAACCGCCATCCCGCAAAATAATTCATATTAAAACATACAGATAACCATCTGCGTTAACTAGTCTCTGACAGTGTTAACCTAATACCACTGGCGGTACTGAGCACATCAGCAGCATAGACGCACGCACTGACCACCATGAAGGTGACGGCAAATGTGTAGATTAAGCCCTGAAGAAGCGCAGCATTCAAAGCAGAAGGAAGCGCTTTGGGTGTGCTTCCATCCCGAAACGAAGCATTGGCCGTAATCTGGCGAATTCGGATTAGCTGCCAATGTGCCAATCTGCGGGGGAGCTTTCGTCGTTCTAGAGACGACTGACGGGACTGCCACAGATATACATAAAGGACTAGACTAGAATCCCAATCGGATGCCACGACGCCCGCAATTCGGAACGCTCGTTCTTAATAGAAATACGAGCAGCAAGCTCGACTTTGCCTCACGAAACCCAAGTCTGACTCCTAGTCTCATATTCTACAGCGATCGCAAAACCAGTAGAATGCCGCCGAGGCCATTCGAAATCGCAAAGCCTTGACGGAATTGACTGAGGTGAACGGAATGTGACTAGAATCGATAGATTGAGCCCAAGGATAGCTGTGAGGCACGTGAAGAATCAGATTACGGACCCATTCGAACCGCAACGGGAGCGCTTGAGAATCCAACGGAACGATCCGGAAATCAATGGTACAGGTTAACTGTAATATTGGCGACGCGCATAATCACGTCTCAAGCGTTTACGTGACGCGTCAAAATCTAGACTAAAATGGCAGCCAATTCCGTTAAGCCTAGTACTAGATAGGGAGCCTCTTAGTCCGTCCATGGAACAGTTTGTTCCACCATAGCCAACCTAATCGGTATAAAGTACGCATTGTTTACCTTAAATAACCCGCTGACTTCCACTGCTTCGGTAAGGGGTCCTAAAACCAGCCGTACTGTATTTGACCACGTTGACCAATTATACGTACATTTAGTTCGAAGTGGGTCGCGTTTAGACTTAAATACGGTTATATCTCCTCATCGCGATAATTGCCATTAAGGGCTGCTGAATTGACGAGTTGATTCCGCTGCGGATAAGGGAGCGGAAGTCCATGGAATACGCCGAGTCGCCGTGCCTTAGACGATACTTCCCATCGCGTTATCTCTCTAAATCGCTACGAGTCCCTGGCGGCGTGAGCGGGCAACGTTATTACCAATTAGATCTAACATCTAATTCGCGGCGTGAAATGCATTTCTATAAATAAAGTGAAAGCCACATTATGTTAACCATTCTCACGTAACAGAGCCCCAGTGGGATAATCCACCAGTTACCTCGCGATTAACATAGACGGTTAATTAACGAGGCATGCGGGATTCCGAGGAGCGTGGGCATATTAATCTGACGCTATTAATAACGCGTTAATGTATTGGGGGTCAATTCAGCAGTGATTCGATACGTTGGATCGCATTACCGTTGGCTGGAGGATGGTTTTAATGGAGGTGGGAAATGTTGGACAGACGATATAATGGGCGATACGAGTAGACGATGATGCCCGCGTACCAATCCTCATTAGTACCTTTACCGTTGGCCAATACCGATAGATAACGTGCACTGTGTTGTACGTCGGCTTCCAACGGGACGAACCAAACACGGAGTCATACGGTATAAGACGTAAAAGGATCAGGTGGAGTGTATTCTTTACACTGAACGCGTACGGCGATTCTTGTCCACGTAAGAGATAACATACTCAATGTGCACTCATCGACCCCTTAGTCGTCGACTCGAGCGGGCCCGTGAGAAACTTAATGCCGTAACACGGAACGGGTTGCTCCAGGATGCTATCATTTCTGGTTAAGGTACCCGGTACAATAAAACAACGCCGATAACTGCCGTGGCGTGAAATGTAGGTCCTATTAGCCGCGAGATCCTGTAATGGGTGACGATTTCAAAAGGCCAAGCTTAGTGCATCCTTCCTTGGCAGAGGTCAAAGGATGCCACTCGTGCTCGCTCGTACGAACCGTGGAATGGTTAAAGACGAGGGAGGGTTGGACCCCGCTTAATCCCGGCAATCCCGCATTTACTCGCCGATTAGCTTCCCGCTGGTTTGTTACTTCGCGTAACATCACCTCGGACTGTGCGGTTTACCGCGGTACCGGGACTATAATCCGCCGGCGTTTCGTTATGTAATATGGGAAACCAAATGAGATCCGTAAGTGTTAGTACCACTAATCACTTCGCTCCGATCTTCGCACGGTAAGGACCATTATAATCGTACTTCCTTAGAAGTCACCACGGTATCGACTATGGTTACAACAGGGATCCCGCTACGAATTCGTGGACCATATCTCAGCCGTTATAACTCCGCACTTGTTATTACGATTGGATGTTCGTTGCACGTCGCCCATCGGTATCGTAGCAGTAGCGACGTTCCCCACCTCAGTTCTAAGCCCGCTTTCCTGTTTAAGGACTCCATCCGTTTATAGCCGGAATTTCGAGGGCTTTCCCGCAGAAGCTTCCATCCATACCCAATCGATTCAGACTTGGTGCGGGGCCGACGCTCGCGTTCGGCTCCTAGCCGTGGCGTGAAGGCGAGAGTATCCATCTACGGAGCATCGCTCGAGACTCCCTAGTTACCAGCCCTATTCACGTATAATAGGTGCATGATTCTTCGTTAGAGCGGACAAATCCA	*	tp:A:P	cm:i:24	s1:i:203	s2:i:0	NM:i:650	ms:i:380	AS:i:395	nn:i:0
+100	4	*	0	0	*	*	0	0	TCCGACAACGCGCCGTCCTGCGGGCCTTCATGTGTTATAAGCCATCGAGTTGCTCATCGCGGACATCAAATTGTTATCTTTAAACCGCGTGGCCTGCTAGAACGCCTTCAGCTAGGTAGGCCTAATAATCATTAAATGTATACTTAGTAAAAGGCTATGCGCGGTCACTATGTTCGTCTATGAGATCTTATTTAAGTATTAACGTTTTAGACAGGGATGATTTAAGGTTGCTGATCAAAATTACTGCCCCTGAAGACTTGACTAACGATAGGCGTACTAGGTACTTAGTGCTCTTTGCTCAAACATTTACAACTAACACAGAGCTTTAGAGAACTAGTCGCGGATATGTACTAACGACAGTAGCTTATTATGTACTTTCTAGGCAAACAGAGGAAGCCAGCCTAAGTGCACGTGCTCGCTACCGTATTAAATTGGACTAGTCAAAAGTAAGATGACCCACGCTAGCCACGCTGACCCGTCATGCGACTCTACACGGGAGTACTAGATGCTTAAAGTCCACCAGGGCCACAGTATGTCTAGGAGAACGCTATTAGGCACCAAGCAGACGCCATCCCATCGTTTAACGTTATCCTCGGCCTCCGTCCATAGAACCTCTGTAACGACTAAACATACTTGAGCTATAATGTTCTTGATGACTAAACTATCATATAGGTAATCTATCGCTGGTGGATGCGTCATTGACTTAAATTGAGTGCGGTCTCGCTGTTCCTAGACTAGATGAATTGCTAAACGGGGAAGACTTAATTCACTAGGCGCTTATCGCGCGTTCAACGATGCTCTTTACAAGACGCCTCCCATCTGGATTTATTGGGTAAATACCTGTAGTGGTCGTCCGCGGTATGTCGCGATGAAGAGCTAAACCATGCTACAAATGTCGTAAGTCAATAAAGTAGATAACCGCATGCCTAGTCCTACTTGATTCACCTGGCGCGGCAAGACAAAGCCCTCAAGTTACAACTTTATCTAGGGTGTCCCCTACGTGACGCCGCATTTCTGAACGATTTTCAACACTTCTAATCAACTTCAGTTACCACAAAGAATTGAGCATTGCTGCCCTGACCGCATTTTATAGTCGGTCCGTGCTGTTAGGAGCGCGGTTGCGCGTAAGTAACTGATGTAGGGACAGTCAGCTCCCTGCGAAGGTCGTTCCGCTGTAGCTGCGCTACTGAGTTTCTAGTCGCATTTTAAAGACTTAGGCTGCAGGTACAGAAATGCAGCGGCGAGATAGCGCTCGATTTACGTGGTCAGCCTAGTTGCCTCGGCCGGTCAGGCTAAACCGCGGCCTAATGTTTACGTTGTGATTAGCCCCTTTACGGCCGCCCTGGCATTCGTGTAACCATCGTCACTGGTCCGGCCTCCATTGTACGTGTAGCGCTGTCATAACGACTTTTTAGACGACTCGTGACGCCAACCCGGTCGGTATGTTACGTTGGCCTGTGCATATGAGTTTCGAGCACATCGCTAAGGCCTACACCACGGGTGGCACGTGTCAGACCTGTGCTATGCCATACATACATAATCATGGCCATGTCAACTTGGGCTCATATGCCGCTATCTAATCCACAGGCCGCTACTCGCGTGCTCGTCGTGCTGGTCTATCGCAATGATGGTCGTCCGCAACGAACGGACTTGGCTTTAATACCAGCGGCAAAGGGCCTAGCGTACAGTTTCTGGGGACAACTAGACTACAAACGTGCTACATGCGACAATCGTGACTAATCTGCACATGCGCGATGCAGGGGCCATCTGCTCACGCCGGTAAATGCTTACACAAAGCATTTGAGCGCCGGACTGTCGACCTGTGAATCGTGGTGGTCGAATTAATCCAGCATGTATTTGCTGGTGGTCCGTAATTGATACAACACTATGCGCGGTTGCGTTAAAATTAGTTAGACGGCTAGGGCTCATAGATTCAATTGCTGTGTTCAAACCACCGACATATTGCCCATGATCCAAACCTGCTTAATGAGTCAGATGAGATCGCGGTTAGCGTGCTCGACTTGTTTAAGGTCTATCCCACCCATCGTTGGCCAACCACCTTTTAAGCGGGTCGGGCTGCGCCTCATCGTTCCATACGTGCGTCGTCGGTCACGACCTCCAGCCAGGCTTACCTCTAGCTCCCACAGCGTTCGGCGGATTGCCACTCAGCGCGGCTAATGGTTCGGCACCCTGGCTTTCCGCGGCTAGCCACTGTTATTAGCGTCGCGTGCTTAGCATGGCTCACCACTTAAAATGCCGGTCAGATTCCTCCAGGCTTAAGACAAATGACGCAGAGAACGAGGTACATTCACAAAGTTAGGCTTCGGGATGGATAACAGCGGTCGGGTACCGTCTAAAGGCTCGCCGGTCGTGACTCGTGAAATGCGCGTAATCGTAGCTCCCAGGTTACACCAACCCGTAAAGCAACCCAACGTGCTAAGAGCGGCAATGGCCCTTGCCTGTTTAAAACCGTTGTTTGAGCTAGGGACGGGACGCGGTTATTAGCCAGGCTGGCTAAAAGAATGGCCAACTTTAACACGTACTACTGATTAGCCTTAAGCAATACATGTACGTATAATTAACCAGCTCTATGTCTACGTTGGCCCAGCCAGTTGTTAAATCTATTACGCGAAGTTTAGCAGGCTTAAACAGTCGTCGATTCAGAGCGAACAGGATGCTGTAGGCGGACGCTAAAGAATACATCCGGCACTCTAGAGCTGCTCTGTAGTTACGTATCACGTGTATTACATAGTCATTTAATCCGAACTTCCGCGTCGTATGCCGTTTAAAGCAGCCGGCGCGACTCAGGACACGAACCTAACACATCTCGCCCGTCATCTAATGTATTAATAGGCAACATCCCGACCGTCCGTGCGCGGGGCCGTCCTACAGGTACTGCGAATACTGGCAAACCGTAGACAGGCCAATCTATGACCATGGCCGCTGTTTG	*
+101	4	*	0	0	*	*	0	0	GGGTGAACCTCTGGGAGAGCACGAGGGCCTTCCGCGTCCTCGCTGCGCTCCATACACCGTACGAGAGGCGGCTGAACATTTCATGCAAACACCCACAACGATCATCTTCGCACTCTTCGTCCTCCTCGCGGATTTCCTCCCTCTGGGGTCGAGGCGTGAGACGTGAAAGATCTAGTGAAGAGCCAACAAACGGTACGTCTAGCCCCGCAAGTCGCTATCCGAGGCTACATCGGGCGATACTATCACTCATGAACTGTAAGGAACAGGAATGCCCGTTCGCATACTCCGTGCTTAACTATCTAAGCAGCATGGCGCGTCGTCGTCGACGTGGCCGCCGATGATAAAAGCCAGTTCGAAAGGATGCTGAAATTAAACGAAAGCTCGCTTGATCCATACATTTCCGCGAAGAAACGGGGATGATAGGCTGATAATGTGGTCGAGATCCAGGCGTTAACGTGTCTGTTCCACGAACTCATTCACACGCGCTCTCAACGCACCCATAGACGCTGCACACGTTTCAAACGCACGCCAGAGATCCCTGAATTTAGAAACTCGCACTCGTCATGCCTATCTGTTTAACTGGACGTGAAAGCTTCAGTCCATTCTGACGGCATCTGCGTCTTTATGGTGCATGGTTATGCGCTAAACGGAAAAACGACGAGGCACTCCCCGAACGCCATTTATGATGAATTTACGAACAAAGTACCCTTTGGATGTCCAACGCCGCCTGTCTTCTGCTCCTGCAGCGTTCTAACCTAGCAGATGCTCCAGATTAACAGGCTGCGGCTGACAAGTCGAGGCGTACGCTTCTAGCGTTGGTTTCGCTCATCGTTCGTTGCTCAAGAATGCTCACCCTGACTCAACCGGGTGACTGGCATTACGTTAATTTCTTGACCAACTCGCAGCAGATATAGACACCCTTTCTAAAACCATCGCGCATCTTTGGTTGTGAGAGCAGGAGGAGTCGAAGCCGGGTACGCGCATGCGAAAGCACTTTTGTTGAATCGCGACAGAGCGCAGCTCTTGTCGGTCCACCCTCCAAACAATGGAAGCGCCGCGTCAGTGCTCTGCTGTTTATAGAGCATAATCAATGAAGGCGTCAACATTCATGCCGGTTGCCGACGGATGTTACGCCGTTAAACCGTGGTTAGAAACGACGTCCCACATTATCTATTTCACGTTCCTGATCATTCATTCCGTCGCCCCTTAGAGTACTGCTGGTGGCGGTAAGGGGACTAAACAGCCACGTGCCGTTCGGGAATTACCCATAATATCACGGTTCATTAATGGCCGCCAGCGAGCGCCTGCTGCCTAGTCAACCGGGCAAACCACAGCGTGAAATATGGTGGTAAGGGGCGGGTTTTCCTACGAATTCTCGCATTCCGCTGCTGCATCTTCAACCTGGCACTCGCTCTTCCGACGTTCTGGCCACATGAGGTCCGTTGAAGGCCGGGCTTTACAAAGTCCATCTTTTTGCCGGACGCCAAAGGCTAAGAGCGGTTACGAGCGCTCATTTAAGTGAATCCCCGGGACAGGCTTCGCGTAAGTCGCCATCGCCGTAGCTCCACGCACTCGTGGGGAGAGTCATCCGAAGAAGAGTGGGGGAATAAAGAGACGCCGTTAGCCGGGACTGTTCGACGCTCCATCACGCCTTCAGGGTCGGCTCCCTGGGGCTCACGATAATGCCTTTGCGCCGTAATCCTCACTCAATGCCACCCCAACCTGACTGATGCCCGTTATTGGTGAACAATTGGACGGACTTAGACCATCGATGGCATTCGTCGTATCTCGTATCCGTGAATGAGTACGAGCTATCTAAACTACCGATCCGGCACCTGAGGCAGGAAGACTTTAGATATCCAGCTCCACCTGCCTGATACAGGTCAAAGACTTCACGAACGAAATTTATTCACACCATTAGAACGAGACAACAGGTGCGCAAACCACGAGCGTAGAGACGCTCCGGAGGCGAACAAACCCGCTAAACGTCACCCCATTGCTTTAATGATGCCTTCTCCAAGCATCCGATCGCATGCCTCCGCGTTCTTCCAATTCCTCCCATGTTCGGCTTTATCTAAACCTCGTTGGTCATCCAATTCCCATAGCGCAACTCTTTCGAGAGTTCACGAAATGTGGGCTCGAGTACTTTTGTTAACGCGTGGTCAGCGAGGCAAAACCCGGCGTTACAGGAAGCCTAATACAGCCCTAGTTTCCCGGCCACACGACGATGAACAGTTAAAGCCGGCCGCGGTTTTCAGTTCACAATAAACGCACCGGGAGTGCCGACAGTTGGCCGCATAAAAAGGTAGGGCGCCATGCTAGGTTTGCTCGGAACGACCTGCTTTTGACTACAGCTTAGACGAGACTCAGCATCCGAACGTATCCCTGAAAAATCTCCCCCGTTATTCTTCTGTAGTTCGAGGTTTTTGACCGTGTACCGTTAGACCTGACCGCTTTCCGTTACCGTTTAAGCGTACCGATTTGTCTCCCACGTGAAGTAATGTAAACAAAACTGCATCGCGATGAGGCGAGCCCGAAATTGGTACGTACATGTGCGAAACCAGCACCAGGCACCGCGTTTCAATGGCCTCAAAGCACTTTTCATCGACGCTGCTCGACCTTTTATACGAACGCTCCCCGCTTTCACCAGCATTCCCCGTTAACGAAGATAGCAGTACGCTAGGATTCCGACGCAGCATCTAACTTCAGGTGACAGTACATATGAAAATCCCGATCTACGAGAAAATTTTTCCTCACCGTATTTCTAATTGCCCGCGGTGCCGCACCCTTAGACAGTCCATTCGCTCAGAGCTGCGTGCGCGTGCCTCCGCGCACCTGTCCCAGCTGATATTTCCATTATGGCACTAGCCCACGCGTATCGCCTAGCTGGCTGCTCGCTAAATGTAGTACGTAGCGTTCCCAACCAACAGAAAAGTACCGCGTATCGTTCAGCGCCGGGCAGTGGGAGTAATGAAGCCACGTGACATGACGAAATCAACCGCCCGCCGCTCCTACCCCGTTAACTTGCAGGATTTGATGACAGGCTCAAACGTGCTTTCAACAGTACATAAAAGACGAATGAATGGCGAGAGCCCGGAATAAGTTCCCGGCGAGGCCAAATGCGGAAAAGAGTCGCATATCTAGAATTGGAATGCATAGTTGAAGCTGACGCATCGTAATGCAGCTTCCCGTGCGCGGAGCCGCTGAATTGACGAATTCAGACGTATCCCGAATCACCCTGCTTACGGACGCATCGCTGGGATTGCTCAGAGCATTTCGTGCTTTGTCACACATTTTCCCAACCTGGAGGGATGTTGCTGGCTGTTTGAAGCGTTAATGAGTTGAAACCCTATACTGGTTCGGCTCTGCCGACAGGCGTCCTTGATCTTTCGTTCGCGTGCACCAACGACTCCAGTTCGATTCACGAGCAACGGAGGCCTCCCTGGGAATCTTCCGTTCTTATCTGCCAGCGTTCATCTTTCGTTCCTCGCTCCTCCGGAGGCTCATCGCCCAAGCGCTCGTGGGCTTTGTACGGGGCATCGCTCCGTATAGAGCAAAGAATGGACCTCATCTCCGGGGTGATATGAAGTGGATATGGAAGTACCCGCCTAGATCACGCCATTGGTCGCAGTTTTTCAAAGCTCAGTGAAAGAATCGTCCATTCTAAGGTCCATTTGGGAATGATAGGCGTACGAGTGGCACTCGTAGGCGGACGCGTTCAACGGCGTTCCCCAGCGAGCATCGTGTTGTCCCAAGGAAGTTCTCTTTTGGCCGTTGCTAGTCGTCCGCGCAATACGGGTAGAGATGGCTAAGCCCTCTAATGACTAATCGACAATACTCGACACGTGTGAAAGTTTCACGTGCTCCGGCTTAGGGATCAAGCCACGACATCCGGCCTTTTACTTATAGCGTTACAGGACTAGTAGGACGGGAGCCCGGCTCGGTTTCAATGCAAAACTAAACCTGTGCACCAGCCCCGTGAGTGTTCAGCGGGCGTGCGCTCCGTTCATTCGACTAGTCGACTTGTTAACGGTGGACGACCGCGTGCTAGACTGCGTGGTAGTTTGATTGTCTATAATGTCCATCACATATCAGCTAACCATCCGGATCCCAGCCGCAATCACCCTTCACTGTATTTAATCACACAAAGCATCTTATTCTGCCTTATTCGGCCTCGCCCGGATGGCCTCTTCGTTCCTCGCATGTTCTGCGGCTGCTCCATGCATAAGGCAGCAGTCAGGGCTCGATCCCGAGTGCGGGGTCTTTAAACCAGGAGCATGGAAAGGCAGTGACGTATGCAATTTCAAATTCATGCTGTCAGTACTATCCGCAGCGTGCTTATTCGCATGGGCTCGCGCAAAGAGAGTACGCACTCTACGCCGAGGGTAGGTTTGGTTTACGCTCCGTACAGCGCCAAGTTTAACGCGTCCGGAATTTGTGGAGCCGAGCATATGGTTTGCTCGTGGTGAGGGAGGAGTGCTCGCCGCAGGAGGGCGGCTCGCGCTATTCGGGTCGAGGACTTTTCTTAGCCTGTTGCCTAAAGCGATCCCATTTACCTACTCGACAAATCCGATCGACGCGCCAGGCGGAACGGCCGGCGTCAGTGGAGGGGGCCCTAACAAATTAAACGATGCGGATGGGGATCCCAGGAGGGAGAGTGAATTTGTGCGTAGTCGGCTGGCATGGTAACGATAGAGGCGGATACGGCTCGTGCCGGGTGGTGCCGGAGCTCTTCACGACCGTGGTCCTGGTCTGGTTGAAGCCCGGACAAATGCCTCGGAGGAAACTGGGCCAACGGCATAGGCTTCGTGGTCGATGAGGATGAGATGAGCTGAAAGAAGTTGAGGTAAAGGGGTGATGTGCGAGGCATTTCGCACTCTGCGTACCTCGGGCGCGGTTGCGCATCCTCCTAAAACCTGTTGTGAAGCTCCATACGTAAAATTTCTTTTGCTCGTCATAAGCCATCCGTATAAAATGTTTAGCAAATCGTCCTCGCATCGATTAAGGGTCATGCAACCGCCCGGTGCCCTAGGTCCCCACATGCATCGAAGGCGTTGCAAGCAGTCAACAGAGGCTGTCAGACCGTATTAATCAGGCAGAGTCGCGGCGATCCGTTCCATGCATATCGCCAGCATTTAGGCCAAGGCCCGTCGCTGTTTCTTCACGTCCGTGATCCTGAGCTCCCCGTGCGCCGTTGGCATGAGCCAGGCTGTTCTTGCGCAACCCATGCAGCCTAACGGCATTGCCCCGTGAAGCGACGCCCATGGCGTTTACACCTCCGTGACGCTGGCGCCGTCAGTACCTCGTCATTGCAGACGGCAATCAAGAACGAGGGATCTGACCAGTTATTGTTGATTGAACGTGACTGTTGGTGCTTCGCCTAGCCCTAACTGCTCGAGATCGACGCTGCTCGTCGATGCAGTGCATCACTAGGGGATGACGAGTCAACGCATCAGCTTGCCATGTCTGCAACAGCCGCCATTTTACACCCCGTTAAGCATCGTAGGACGGTACGTACTGCAGCCTCATTATCTTAAATCCACCGGCGGCCACCTAGCGGTGA	*
+102	0	utg000001l	18516	60	967S30M1D19M1I7M1I6M1I2M6I3M5D34M1D10M1I4M1I4M3I6M1I5M1I10M1D2M7I5M2I1M1I13M2D16M2I3M1D3M5I3M1I3M3I10M3I4M2I29M1I7M3D7M1I8M1D5M4I1M2I3M1D23M1I17M1D3M1D16M2I9M3I3M1I2M3I11M3D26M1I2M1I3M3I2M1I4M2I3M1D12M1I29M1D4M1D7M2I7M1D8M2I1M1I3M1I5M1I5M3D1M5D5M1D6M1D3M1I1M1I2M1I6M2I29M1D6M1I10M1I5M1D11M2I12M3I2M1D11M2I14M1I10M2D1M8D2M1D4M6D4M2D26M1I5M1I4M1I10M2D7M4D7M2I3M1D4M1D14M1D10M2D42M4D9M1D1M1D5M1I2M2I6M1I11M4D5M1D2M1D4M4D5M2D8M2I2M1I7M1I3M3I2M1I8M1D12M3I17M4D2M1D4M7D6M1I8M2D2M4D4M1D1M2D9M1D6M4D6M1I29M1D14M2D2M2I5M7D11M4D8M2D1M1I4M4D1M1D8M2I6M2I4M1I26M1I10M1I3M1I1M2I6M3I5M1D14M7I1M4I2M1I3M2I6M2I11M1D3M7I2M1I10M1I4M3I2M2D25M5I2M4I7M2D5M3D1M2D12M1D25M1I6M1D4M1D6M2I4M4I8M1I9M1D18M1I8M1I4M2D3M1D11M1I5M1I8M2D1M5D4M3D4M1D7M1I5M1I4M3D6M2D3M1D5M1I3M3I3M1I13M2I8M1D3M3I12M1I1M1I4M1D1M6D9M1D3M1D5M2I2M1I4M5D3M3D4M4D1M1D17M2I7M3D1M1D8M4I6M1I4M1I5M4D8M1D12M1I5M1I1M1I1M1I5M2I7M1D6M1I4M1D6M1I5M1I6M1I13M1D1M2D14M2I9M2I3M1I5M1I17M1D5M1D9M1D13M1D2M1I16M1I6M1D5M2I7M3I7M3I9M1D3M2D1M2D3M2D4M2I5M2I4M1D17M4I3M1D2M1D6M3I1M1D13M2I2M1I14M2I7M2I5M1D4M6I5M4D5M5D15M1D8M1D2M1D7M1D1M2I4M1I6M1I8M6I6M1D2M1D10M1D4M1I17M4I2M2I24M10D3M3D9M2I21M1I1M4D1M1I4M1I17M2I34M1I21M1I16M49S	*	0	0	AAGCCGGCGTTTCCAAGGGTACGTCAATGACATTTGCCGTACGTGACCGGAAGCACGCGAAACGGTGACGCTGATGGGATTCACACACCCTACTCATTTAAGCCTGGCAATCGGCTGTTAAACTGGGGTTTAGGAACGATGAACATGAAGCAAAGCCATCAGGGAGCTACAGGCTCCCTTTTATTATTCGCATTCACCGGCCGTATTAACCAACAGTTCAGGGATTAATGAAGATGGCAGACATCATTGATTCAGCATCAGAAATAGAAGAATTACGCATACAGCGACTAAATGCGCCGCCTGAAACCACCCGGGGCTATCTCTTCCCTCGCCTTGTTCTTCGGTATGCCCGTCGATAGATGAACGAAGACGCCTGGTCGTTCAGGGATTGTTGGACTTGTTGCAGTGAGGCGGAAATAGGAGACGAGACAGGCGAGGTTCGAAGTGAGCGAAATTAACTAGGCATCCGTGAAGCAGGGCAATGCATGACGACTGGGGGATTTGACGCAAACGGTTTCGCATGAATTGGTAGCGTGTGCTCTGGAACTGCTGGATGAACGAGGAAACCAGCAATACATCAAACGCCGCGACCCGGAGAACTACCAGGATATTGCCTATAAATGGAAACTGCGTGTTGAGCTTGAAACAGAAGGTTACGACTCAACGAGCATAGATGCGTACAGGTTGACAAGTGAAGCGTATTGCCTAACTGGAAAGCAACGAATTAGTCCGACGAAACCAGTTTCTTGTTTACATCCTGGGAAGACTCCTGTTATAAGCACCTGCACTGGTACTGGAAGAGTTTGCGGCGTGCTATGCATCGCCTGGCGTTAATATAATGGACAAGCCTTACGCATAGAGTACGGATCGATCGTAGGTTCGCAACCAGGGCATAGGCGACGCTGGCTGGCATTCGCATCAAAGGAGAGTATGCAATCGGTTTTGTAAATACAATCCGACTTAATGAATTTCACGTCGTCTTCACAGCGATGCCAGTCTGTAGTGTCAGATGATGACCGTACTCAAACATCAGCGGGTCATATTATCTTACTGTTTCTTTACATAAACATTGCTCATCCGTTTAGCTGGAAACCGACATACATTGCAAAGGAGTTTACCACTGGCTGGTATGATTGAGTTAGAGTCTGAGCAAAGATTGGGCGTTATCAATGGTTGTGCCATCTCGTCTTCTCCCTGCAGGTAAGCCGCAGGTGTTATGTAGATGAAGGTATAGATAGCGTGAGGTATAATTCCATGAAGGTTTACAGTCTAATGAAGACAAATCCCCATTCTGCAATGTGCCGAGAATGACTGATACGTGCACTGGCTACGAGGAAGACGAGTAGGAAAGGGAAGAGCTGGCCGCCTCCGGCCCATAGATGATTAAACCCAATATTACACCGTACTAAGCCGGGGATCTTATTTTATCTGAATACGGACCGGGTTTGTTTATGGAGATGATAATGCATTCTGAAGTCAGGAGTGAATGGAGAACACATGTCAACGATTATCGAAACTAGGATAGTAGACTAACAACAGCCTCCATGATATGGGGCAGATAGCACATGCAGACGTAACAATATTCGAATTGAAGGACGAAAGAACACCAAGCCGCCTATCGAGTTTTTCTTGCGTGTAATTGCGGAGACTTTGCGATGTAGGATGGAGCCACATGAAAGTCCAAGAAGCCTTGAAACAGTTCGTTAGATGGGTTGGGAATGCAGGATTCCCACCTCCGGTTAAGGATGGAAGAGAGTATCTGTTCCACGAATCAGCGGTAAAGCTTTGACTTAAATCGACCAGTAACAGGCCTTTGAAGAGGATGTCAGAAAGGCGGAAGAAGGCGCACGAAGAGGGATTTACCCTAACCTGTTATAAGAAACAATGGATATCTATCACGCTCCAAGACGGACCGATTTGGATCGAACAAGCGCGTGAAATGGGTAGAAGCATAACAGGCTATTGAATCGTCCGGCTCCGCTCTATCGCGCCGAATCGGCCGTGATAATTCCGTTGGGTCACTTCGGTATTGAGCCCATATCCTGGCACAGGATCAAGCGACACTCATAAAATTACATGAGCAAAATTAAAGCAATAAGGAGCGCGTATGTGATGCTCCACTTGACAGACATGCCCACAAAGAATTGCGGCAATGCTGGCTGACTGTGAATACATCAAGGACGAGGGCAAGGCGGCGTCACTCTCACAAGTTAATCAGATCAACACTGAGCGATGCATTCGAGAGGCAATAGCTGAAGGCCATATAACAACATCAGATCCTGCCCACTCGCGCATAAATCTTAAGAGATGGAAGCAAGACCACGAGGAACTGAATAGCGACCAAATTTATTCAAGCAGCGATCACTCCATGTTGGCTCATACTTGCAAATGGAATGGCTGTTGTTACCGGGCATGAAGTCGTGCGGGCATGGTCTGATATCGTTAGATGGATATCTTTATGTCAAAACAGCAAAACAGGCGTAAAAGTGCCATCCCAACAGCATTGCATATTGATGCTCTCGGAATATCAATGAGGCATTACTCGTGGGCAGTGCGCGAAGCCATAATTGCATCTACTCGTCGAACATTTCATCCAACAGTATCGACTAGGTATTTTATGCACGACGCACGAAAAGCATCAGGTCTTTCCTTCCGCATGGGAGTGAGCTTTCACCGAGTCCCGCAGTTTGTCTGCAAGACCTGCGAAGGCAGATAAGGGCGATAAGTTTGCTCAACATCTTCTCGGGCATAAGTCGGACAGATGGCATCACAGTATCGTGATGACAGAGGCAGGGAGTGGGACAAATTGAAATCAACCAGCGATCGCTGTGTAGGGGCACCGCTGTGCTTCTGCAGCCAAATGCTCACGCCAATGCTTTTATAATGCCAACTTAGTATAAAAGCCTGAACGAGAAACCTGTAAAATGATATAAATATCAATATATTAAATTAATTTGCATAATAAGACCCCTCTGTAAAACACAACAATGCAGTCATCTATGAATCAACTACTTAGATGGTATTAGTATAGTGGTCACTTAACAGGCTTAGCAAGTGATTTTGTCTTCTTGCGCCTTGTTACATCTAATACGTCAGACCCCGGAGCGCGACGCCTCGCAATCCAGTGCAAAGCTTTGTGTGCCGACGACCTGCATAACCAGTAAGAAGATAGCAGTGATGTCAAACGACGCAGCTGACTTCTGTTCTTTCACGACTTCCCCACACCCAGCATGCATACCTTTCCGCCCACTGTAGTGAGTGTTCATGTTGAGCGGTGAAGAGGAAGTCTG	*	tp:A:P	cm:i:26	s1:i:212	s2:i:0	NM:i:825	ms:i:260	AS:i:104	nn:i:0
+103	0	utg000001l	40469	60	3654S18M1I6M1D3M1I5M1I2M1I4M1D4M2D1M2D7M2D27M1D3M3I3M3I3M1D17M3D8M2I2M1D10M1D12M1D4M4I10M2D3M4D10M1I6M1I27M1D10M1D2M1D5M3D10M6D1M1D5M1I14M1I4M1D37M2I7M1D2M3D10M1D7M2D14M1I3M2I8M3D2M1I4M2D7M1D4M1D2M2D11M2D14M5I4M1D4M1I1M2I3M1I9M2I1M1D8M3I6M1D4M1D3M2I17M2D34M1D39M5D28M2D3M1D21M5I4M1I5M1D5M1I11M1D12M2I30M1D6M3I3M1I1M2D8M1D12M2D3M1D15M2D2M2D27M1I10M3D11M2D1M1D1M2I5M1D14M3I10M1D6M1I8M1I1M3I4M1I7M3D8M3D10M1I9M3D9M3D1M1D15M1I6M1I1M3D12M8D4M8D9M2I1M1I2M1D3M1D6M4D2M6D12M2D3M2I7M2D17M3D4M2I7M3D2M2D14M2D3M1D2M2I19M3D12M1I27M1I1M1I2M1I7M1I2M1I11M1D4M1D12M1D4M3D2M1D4M2D3M2D22M1D3M2D6M3I6M2I14M1I1M3I1M1I5M1D6M3I5M1D18M1D8M1I8M1I6M1D14M4I1M1I6M1I15M1D3M1D2M1I4M1I9M1I3M4D8M1I4M2D11M6I2M4I3M1I25M1I16M2I10M3D4M2I9M1I21M2I11M1D4M2D8M1I23M3D5M1I3M2D3M1I10M2I3M1D29M2I4M2D5M1I10M4D3M1I9M2I3M3I18M1D10M2I11M2I22M1I13M1I23M2I27M1D5M1I19M1I7M7D9M1I1M2D3M2D1M3D3M1I6M2D2M1D5M1D13M1D2M1D3M3D2M2D1M1I1M2D6M3D1M1D8M3D4M1D2M2D5M1D6M1I23M1D38M1D11M1D7M1D9M1I1M1I8M2D5M1I14M3D4M3D4M1I8M1I7M2D6M1D18M1D2M1D5M3D9M2I5M1I3M1D9M1I10M1I2M1I4M2D10M6D1M2D14M2D3M1I14M1D7M1D4M2D6M2I40M1D4M1D8M1D6M2D7M2I19M3D3M1I21M1I3M1I2M1I20M1D3M3I5M1I6M1I25M1I15M1I8M1I15M2D14M7D5M1D22M1I8M1I2M2D4M1D5M3I15M1D18M1D8M1I24M1I6M2I11M2D9M2D44M2I12M1D1M2D5M4I4M1D3M2I4M2I6M2D1M1D6M1I1M2D1M1D15M12I7M1D4M2D22M1D12M3I14M1D6M1I13M2I3M3D15M2I19M2D2M1I6M1I3M4D2M1D3M3D7M1I29M3I4M1I18M2D9M3D9M3I3M2I7M1I27M2D2M1I4M3I4M1I29M3D2M1D10M1I3M1D5M1D9M2I3M1D10M1D10M2I8M1I9M2I6M1I13M2D1M1D9M1D11M1I12M1D14M1D7M1I12M3I4M3I13M1I4M2D3M1D10M1I8M1D1M3I10M2D9M2I7M2I20M1D3M5I9M3I3M3I7M1D2M2D5M1D11M1I27M2D2M1D3M1I2M1I15M1I2M1I9M1I6M1I19M4D3M1I6M3D13M5I11M1I8M2I9M3D15M2D3M1I5M1I1M1I7M4D10M2I14M1D10M1D3M1I8M1I13M2I17M3D7M3D12M1I11M1I15M1D2M1D9M1I21M1D5M1I4M3D2M1D6M1I1M1I7M2D7M1I10M1D1M2D3M4D6M4I7M1D6M2I6M1I25M3I4M1I25M5D18M2D16M1D12M3D9M3I1M1I8M2I13M1I7M1I13M1I1M2D10M1I3M2D7M1I5M6D18M1D7M3D10M4I4M1I6M2I10M2D1M1D20M1I8M2D14M1D1M1D13M1I9M2D6M1D5M1D5M1D5M1I3M1I6M1D6M2I7M4I12M1D6M1I6M1I5M1I14M1D10M1I17M1I8M2D8M2D6M4D6M1D8M3I8M4I3M1D1M1D7M1D4M1I11M2I9M1D1M1D4M1D2M1D6M2D19M1D15M1I15M1I38M1I2M7I6M3D14M1D2M1D5M2I7M1I45M1I11M4D24M1I32M1I8M1D21M2D7M1I3M1I2M2D2M3I3M2D3M1D4M1I4M1D8M4D5M1D3M6D10M3D8M1I1M4I4M1D15M1I8M3I9M1D3M2I3M2D3M1D47M2D10M2D9M3I4M2D6M1D14M1D8M3D13M3D7M4D2M1I2M1D10M1D6M1D12M3D3M2D3M1I11M1D6M1D4M2D3M1D3M1I16M1D1M1D10M1I4M2D7M3D23M1D18M2D4M3D5M1D7M5D4M1D3M2I8M1D1M2D7M9D8M1D9M1I5M1I2M4I31M1D3M1I5M2D13M2I6M1I1M1I2M2D3M1D7M3I6M1I21M1D3M2I6M1I19M2D5M1D3M1D14M1D9M1D5M1D10M2I2M2D7M1D5M2D2M3D3M1D5M1I9M1I5M5I1M1I3M1D1M3I1M1D9M1D10M1D19M1I13M3D5M1I18M1I22M1D15M5D5M2D1M1D9M3D22M1I2M2I9M1D5M1I5M1D1M2D5M4I5M7I3M2D21M1D3M1I1M2D6M2D6M2D15M1D3M1D6M1D2M1D19M2D5M3D8M3D11M2D25M1D6M1I4M1D3M1D10M3D4M3D6M1I5M1D5M1D10M1D11M1D8M1D14M2D10M2D3M1D6M1D17M1D5M1D6M3D4M3D2M2D8M1I12M1I1M1I19M3I17M2D22M1I8M1D4M1I24M3I8M6D5M1D2M2I4M1D12M2I6M2I2M1D4M1D15M4D14M2D7M1I6M1I15M1I3M4D13M2D1M1D6M2I18M2D17M1D4M1D30M1D12M1I3M1D1M1D17M2D3M3D16M1I20M1I10M4I6M4D5M4I6M3D4M2D2M1D2M1D8M3D2M1I2M4D9M2D8M1D4M3D17M2D5M1D11M1D22M1I7M3I3M1D4M2I6M1I5M2D8M2I2M1I20M1D11M3I16M2I9M1D3M2I17M3I14M2I6M1I4M1I5M2I2M1D11M5D2M4D1M3D4M3D1M3D15M2D7M1D8M2D4M1I9M3D14M1D7M1I4M2D9M7D1M3D5M3D30M1D5M1I4M1I12M1D12M3D3M1D2M1D8M1I2M2I12M1D4M2D8M4D24M2I3M1I11M1I15M1D15M1D9M1D7M3D4M1D13M1D1M1D8M4I31M2I16M16S	*	0	0	GCGCGGTCGCGGCGCCGCCAGCGAGCTCACGCGACGATCGGCAGGGTGATCGCACGGCAAGCCGCGGACGAACATGGGGATGTGTGATGACCACGGAGTCTCTTCACTGCCCTGTTGAGCGGATCAGCCACTTTGCCCGCCAGTGCAAGCAATGGCTTCCGGTGGGACTGGTGCAGGCAGGCATACGCATCGGCGGCTTTATACTGCCCGACGGAAAATCCCGCTTTCTGTGCAGCCATGCCGTGCTCTCAGCGACTGTTCAACGACTGCCGCTGTTTAGCGCATCACTTTCGTACCCCAAATGAGTACTCTGGCCATCTGCTCGTCAAATCTGACCCAGCAATCCAGACTCAAATCAACGACCAGATCGCCTACCGTTCACTACCCTCCATCAGCCTGCGTGGGTCGTATACTGTCATCAGCGGGTACGTCATCCTCCGTCTGTCCCATTACGGGAAGCGGGGGATAACTTCATTCCCGTCCGGCCAAAGCGACGGCACTCAGGGCAAGCCCTGCCCTTTCTGCATCAGCACATCATCTTCAGGCTCTTCGTGCTCGCGCCGGTTCGAGCAGCTCTGAAATGCGGGGCCAAACTTAGATCGAGGTGCTGGCACTGAGGCCGTATGCCTCGAAAATGCATATCCGACGATAAACATCATGAAAATAATGGATCTGTAAAGCGGTGCAGTCGGCATACTCCGTCATGAATCCCGGCAGCATGCACGCCAGTTCGGACCCCATCTCACGCGCCATTCAGGGCAAAACTCAGCTCACGTCGAACATTTTCCCGGCAGGAAACAGAGGCGCCTGCGGGCCCGGCTTCCTCTGTCGTTCAGGGGCATTATTCACTACAAACTCATACATACAGACAGCCGGTACACCACGATTTCAGCATGAGAATTAAGCGTGGCCAGGTGGTAAGCACTTCCTGCTCAATCTGTTTAACGGTGCTTCATGGACGCATCTGCGTCGTTCTTAAGATGGTTATGCCACAGGGACATCGCCACCGATAGAACGCTTTCCGTATGATGGCGTCTTCCACAGTAAACTTCCGGTTGCTTGGCCGCCTGTTCTGCCTGCCGCGTTTCATCAGGGCGAGATGCTCAATGCGCTGCAGGGTTAACAGTTCAGAGAAGCGTGACGGTCACACGCGTTACGTTCAAACTGATTCGGTTTTCAGGAAGCCCGACTCTCTCCGGGTTGTAACTGCGGTGACGTAATTTCTGCAACCGCAGAGCAAACGCCCATTACCGGATACAACCCGGAATGTTAACCTTGCCGTTGCAGCAACACGCGTTCAAGTGGGTCATACCAAATATGGCTAGTGGCTTTTATCCGCAGACACCGCGCCGCGAAGCTCTTGTCGGTTACTAGCCGGCCTGAAAGCGCCACGGTCATAATTAACCGCTTTCAGCGAAGGCCTGAGGAGGGATCCCATGCCTTAAGCGAGTGCTGTTATCCCGTCCTGCGATCTTCTGCCATCGACGGACGTCCCCACATTGGTGACTTTCACGTGCTGATCATTCCTTCGCTATACGCCTTACCGATACTGCTGATCTCCAGCCACGGAATAGCCATCAATAATTCATGTTCGACGGGAGCGGCTTTTACACCGGGTATCGCGTGCTTAAACGCCAGCACCTGCTTGCCCTGCTCTCCCTGAAACCGCCAGCGTGGAGCTGGTTTCCCGGCAGATTTCTGCTACGTCGGTCACGGATTTGCGGTCTGCATCTTCATCATCGAGATAGCTGTCGTCATAGATAAGCGTCAGTTCGCCGGGCGTTAGTCTTTAATATTTTTCAGACGCATACCGGTTGTGCAACGTCTGAAGGGATTCGGGGTGTAAGGGTCGCTCCGGTATAAACCCACAGGGTGTCCCGGCACCTTTCACCGGCATTGTAGGATTTGGTCACAGCATAGAGCGTCACATTTCATAGGTAATGACATAAGTCAGATCGGCTGGCCAACGCATCATCATCGTCGCACCATTAATCTAACATCAAAGCATGACTGATCGTAGGGTCGGGATATGGCTCATCGCACTAGTACCAAATCTGGGATATCGCCGAAGCAGGACGGCATCCAGCTGAGCAGGAAGAGTGGTTACGATATGCAGCTCCGCCAGCTGCCGACTCCTGTCCCTCTGCCCGTGTATTCAGCGCCGTAGAGACATACGGCACTTAGAAAATCGCTCATCAAAACTAGGGCGACCATCAAAAACGTCGCCCCGGTGTCAGCTGCCTTCCAGTGCATCCGATCGACGGTAAATGGGAGGCGTGCATGCGATGCTCCGTTATTGAACCTCAGTTGATGCGACGCTACTCGCAGCTCTTTCAGGAAGACGTTCACGCTGTATCCGCTCAATATTTTGAGTCTTTCCTCAGCGACGCCGTCCGGGGATTTCACACATCAATCGGCTACGTTTTTCCCAGCCGCTGCATGACATGCCGGCCTTTCAGTTGTTGAATAAACGCGCCGGGGATGCCAGCTTCTCACTAAGGGGACAGATCGACGTTTGCCCTAGGATGAACTCATCCCTTTTATAAAGGACAAGCGCACATAACCAAGGATCTCAGTGTACGTACGGCAAAATCCCGCGGTCTATATTTACTTCTGCCTGCCGGGTTTTGACTCGTGGCCGGTTGCGCCTCCGTTGGATCTCCCGAGTGTTACGGCGTACCCTTGTCTCACGGGCAACCTGTGACGCCGACTGCGATATCGCGGATGAAGCAACGCGGTTAATGGCCATTGCGGCGGCACCAGGCACCGTTTGCGGCTGATACGGCTGAGGTTTTCATAACGACGGCCTTAGCCACCTTTATGTATCCCCCTCCATCCGTTCGACCGGGCACCGTTATAACGAGAACGGCGTCCGACAAGCCCTCTTCCGCCATGGGTACGAGCATCTGAAGTCTCCAGAAATTTTCCTCACCGATGGTCTCACGTGTCTCCACGCATTGGCACCATCAGTCGCAGCTAACCGACGGCTGAGCCTTCAACGCGCACGCCGTGCGACCATCGCTCTTTCGGTCATCAAACACCACGTATCACCGGTAATGGTCTTAGCCCCTTGTATGGTGGCTGACGTTCCCATTACAGCGTATCGTTTCATCGAGCGGGCAATGGAGCAGGCATCGAACAGTATCGAAATCGCGCCCTCCCGTTACTGCACATTTGGCCAGGCCGCGCCTCCGTCATTTCGGCTGCCACCGGCAGGACGAAACGCGTTCCCCTCCCAGCACAAATGCTAGGGTTCATCCCGCCGTGTGGCGTGAAGTCGCATCCAGTATTCATGCAATGCCGTGCCCACTAACAGGGGACCAGTTGATATCCGTTCGACCGTATCCAGAATCACGGTATCCGCTCGGTGCTGATGCCTCAGTTTTCATGTCCGGTCAGCACATTTTCCCGTAAGGGTTAGCTTAGTGCGTCAGGCATTTCAATCGGTTCTATCAGCTCTGGTTTCAATGGTCACACCTCATCAGTTCTTCTTCTTTCACCGTTAGCCGTCCGGGACGGTAATACGTTCCGGTTCTTTCCATGGATCCCACAACAAGCTTGAAGTCTGCGTCATCTTTCGTCTGATGGATAATGACAGGCGCTGCTTGCGCCGTTGTTGCCCATTAATCAATCCTCCAAGCGGGGTATCTCGCTCGGTGCTGACTGAATCATCTGTGAACCTCCACGCGGCTCGTACGCCTTATCGAGTTTGGGGTAACGGGCAGAGGCGTTAGTCGTGGGTCGATTCACGTGCGTCCGCATCCTGAATGCAGCCATAGGTGGCAGACCCGTGCCTGAGTGTTCCCGGGAGGCCCATCGTGTTGTTAGCAGGAAAGTTCTTTTTGACGCCGTTTTCCACGTACTGTCCGCATCTAAGACATGGCCATCGCGGGCTTAGAACCACCGCTTTGCCCAGGTCTTTCGCCACTGTCTCCAGCTCGGAATTAGAGCCACGACGGGTATGCACTTCCTTGACGGTTTGAAGGAACGGAACAAGAGCCGCCTTTCAGATCCAGCCATCCTGTGACACACGGGCGTTCAGCGGGCTTCGATATCGTCGGTCGCTTATACAGATTGGTAAATGTCACTAGTTGCTCCAAAGCCGTGCCGCCGACTGTGCGTGATGTTATTCTCCACTGCGCTCCATATCCACCTCAACCGGATCGAAGGCTTCACCGGTCATGGTGGTTTGCATGCAGCACGGCAGACTGCCTGCATCTCTTCGACCTGAGCAAACCGCTCTTCGTCACGCATGTTCTGGCTGGCATGGTTGACCGACGGCGGCGGTAAGCGGGTCCGCCAGAAATTCTGCTTACAATCTTCATCCGGCATGGGGACGCAGGGTCAGCCCGGATGCTTCAGTGGATTCGAGTACACACTCCCGGCGTAATTCAGAGGGTGGAGCCGCCACGGGAACCGGATAACCTCGGAAACAATCCATCATCGTGAACACGCTGTTTTAAAACGAGTCCCGATTTGTGGAGAGCTATGTCTAATTATACGGGGACACTAGCCACGGAAAAGAGACGCAGAAACAGGTGATATCCAATTTCTGCTCACTTTGCCTGGCATTTGTACGGCCTCAATCCCGTACGATAGCGCTAAGCGTCGGTGAAGGGTAAATTGGCCTCCATTAATTGCCGTTCCGGCTGGGGATTCCGTTTCGTCGTCACTGGCAACGGACCTAAGAGCACATCCTCATAACGCTGGTTAGACTTGTGAACGTCAGCGTGGTGCTGGTCTGGTCAGGTAAGCAACCGGCAAGAATGCCAACGGCATTCCTTAGATGGGCTAACCGACGCTCGGCTCGAACTTCCAGCATCAGCGGGGTTGCAGAAGGCGCCTTTCGCACTCAAGCCTGATCCACGGGCGCGCTTTGCGCGGTATGAGCCGGGTTACTGTTACGTGCGGCCTGGTAATGGGTAAAGTTTCTTTGCTCGTCAGCTAAAACATGCGGTCACACTGGTGTTGCGCAAAATGGGTTAACGGCATCAGATGCCGTGGGTCTGCAGCCATGTCGAGCCTAGTCGCCGCCTGCATCAGACGATCCAGCGCAGTCACTGCGCGCCTGTGCACTCTGTGGTGCTTCCATCGAATGCGGCGGGCCGTTTTCACGGTCATCTCAAGGCGATTTCTGCCAGCGCGTGCCTGTTCTTCGCGTCCGTGAGCCTCCCCGTTACAGGATCCCCATAGTGCAAGCTGTTCTGCCCGCAACCGATGCGGTGATCTGCACGTTCGTCCAACCTGCACCGGGCGTTCTCGCTCAGCGTCGGCGCTCCGACGACGTCAGTAACGTCAGCCTGTGCGAAGCAGTGGGGCTGAAACAGTTGTTGATTGAGGTCTCTTTGGTCACTTCGCCCTCCTGAGAGACCGCTTCGACGTGCATCCAGTGCATCGCGCATGACGTGATGCGCATCGGTGCTGTTAACACAGTTCATCAGTCCGGCATGATACCTACCTGACATTACTGAGAGACGGTATGCGCCAACTATCATAGGCTTATGCCGACGTCGCAAACACTGGCGTGGTCCCGTCCATCCAGCTGGCGACTTTAACGAGCGTCGTGAGGAAGATGGCTGTAGGGTTGCATCCCACGTAGGCTGCCCCCGTAAATGCACATCCTTTACAAGATGTCTCCGACACAGCGTAAGTGCTTAGCCATGCCTGACGGATGCAACTGTCCGGGCGGTCTGCGTACAGACGGGAGGCGGCGCGCTCGGCAGCAACTGATCGTGCACTGCAAGTTCAGGTCGTTGGCACACCGGCTTTTGATCCGCTAGAGTGGAGATGGTTGAGGGCGTCAAATGCCCGCCACCATCCTAGGGGCGTGTCCATATCGAGCACGATGCCGTCCACCATCGGATCACTGAGACTGTTGTGCAAGCCTGAGATAATGCGTTGTAACCGGTCATCCCCGAGTACGGCTGCAGAGGCGCCCCCGTCCGGCTGATAGGCTCGTGCTTAGACACCGGCATAGAAATTAGATGCCGTTCAGTAACGTAATAACTGCGGGCCTGTCTTATGTTAGTCATCATCACCGGATAATGCCAGCGTGCGAGTGCCTCCTGGGCAGTCAGGCTGTCTCAGCAACACGCATATCCGTCAGGCTGCTGATCCCAAGCTGGCCTGCAAGGCACAAAGAAAACCCGCGCATAGTGGGGTTCAAGGCATCAGCTAAGCAACATGCCTACATGCTGGCAATATGCGGGGATTACGCAGCTCTGCTGTCACTCTTCCTCCTCTGTTGAATGTCGCAGCCCGAGCGGATCAGCAATGGACTCGAGGCCAGGCATCGTCGAAGTCCGGCCTCATCAAACAGGCGCACGGCCGGCCGTTTCACGTCAATATCATGGCAAAATTTCCAGATAGTAGTCGTCACCGCGTTTTGCGCACTCTTTCTCGTCCACTCAGTTCGGCTTCTATCACAGCATCACCGCTTCCTGATTCCGCTCAGGACCATACCGGCCGGTAGCCTATCCAGTCGCAGTTCCCCCAGGCACACCTGCGGGCTTCATGAAAACTGAAGCGCTTTCAACGTCACGCCCAACCAAGGACGATGGGCCTCTTCCAGCCAGCACAGAAACATCTGAGCCTGATGACGGGATGCGACGAATTTTGCCCGCCCCATAAACCACGACTCGTCACGACTCGCCGTGCTTTTGGGATAGCTCATCTGGCGTAATGCGTCGGGAAAGCCTGCTCATACTCGAGACGAGCCCCTCCGGCCGGGTCTACCGAGCAGTGACTGCCTCAAACACGGATAGCCGTTATCCGTTCCTGAGCCCGTCTGCAGGTTGGTTAGTGAGTCACCCGGCATCGACTTAGTCGTTGCGCCTCCCAGCCGGCTGGCGACGCTGCGGCGTAATACGAGGCGATTGCCCACGCGATCGCGACAGTCACCTCCCGGTTCACTCCTAGCGCTTAACCTGACTTTCGCCCGAATAAAATCCAATGACGGACTGCGTATCCAGCTCACTCATCTGCACTAGCATACATCGCCTTCCACAAACCGCTCTTGCATCATGCGTGTTCATGCATGTCGTGAGGCATCTTCATCTGCTCCATCATCACACGCTGTAAACACATTTGCATACCGCGAGTCCCGTCCTCCACGGGTCAGGACGTAGCGATGAACGAGGCGCGCCCGCCCGGATAACTCACGGGTATCCATTCCTATTTCTGCGGCATCCAGCCAGGATATACCCGTCCTCGCTGAACTATCCGCGCCGCACCTCATGTCATTAATCGTGAGCTAGGGCCGGCGTTTAGCTGTCAGCGCGTATTGTTCGGGTTACTCTGCGCGTCAGTACAATCTCATCTACAAATGTCCGCGACGACCCGGGGTATATCCCAAGTAGGCCTGACGAACAGAGTTCACCCGTTAAAGGCGTGCATGGCCACACCTTTTCCACGAATCATCATGGTAAACGTGCGTTGCTCAACGTCAATGCAGCAGCAGTCATCCTCGGCGACTCTTTCCATGCTTCAACCTCGCGGGGAAGCACCCGGGCTTCTTCCTCCCCGATGCCCAGATAGCGCCATGGAGGGGGTATCGACAGCCCGACGAAGAGGTAATCCTGATGCATATGATGGCGTTGGCGGCATAGCACGTTGATTGCGTACCAGATCGTCCCGGGCATTGCCACGGGTAAAGGTTGAGCAACAGGTAAGCATCCCTTCACTCGGTGGGTTTCCCCTACAAACTGCCTCCAATCCCTGCCTACCGCTGTGTAACCGGCCCATATTCGCAGAGCGATGTCATGCGTCCGTGCTACAGAAGGGTGGGAATGGTGGGCGTTTCATACATAAAATCCTGCAGGTCTCCGCTGCGTGGATGTCATGCCGGTCCGTGCACTCTGCAAGACCATTTTTCAGGTCAGACACGGAATGGCGCTTAAATTCCACCCCTTCGTCCTTTCTTATGTTGCCCCCGTTTACCTGTCATCAATCATGCAGTGCCGCGCCGGGCAGCGGCAAGTTCTTCATGTCGCGTCATTCATGCTCTCCGGCCCGGGCATCGTAACTTAGTGTAATGCCAGTGTTTTCTTGTTGGTGCTGCAGCATCCTCTTCCTGCATGAACGCCAGCAGCGCACTGAGATCCAGCTGCCGACGGGAAATACTGATGCGCAGCGCCGCCAGCCCATAAAACGAAGCAGTCGAGTGCCTCATTGCGTCGCTTTTGCTGTCCACAGTATTTTCCTGCCATCCCCATTTCCTCTGATGGGAATCCAGGCAGCCCAGTGCAGTGCGGCCAACCTGCTGTTTATGAAGTCAATCAAAAGAGACGGGGAGCGGTTCGTACACGGTCGGACGGCGTCAATCGACCAGCATTTATAAATCTGCTCTTTCGCGGTATCCGTACCGATTTCGGTACGGCGACCCGTTTTGTTTCGGATCACCGTGGCATGCTGGCCACCGGCTTTCCGTAGACGCATCCCCTTTGGCACGAACACAATCACGCATGTTTTCGAGCGTTTCGAACACAAACCGTCGGGTCAATCCCGGAGTATCCCAGCAGATGACTCGATATCGACATTTCTGCACCATTCCAGCGGTATAGTTTTATTACCGGCCTCATCCACGAGCAGCGTCTGTTCATCGTCGTGGCACTAGGTAATGCCGTCATAATCAGCCATAATCGTCCTGAACCCCATTAGAACTCGCGCGGTCATCCGTCCAGCTGGGAGTCGATACCGGCGGTCAGTAGCACCCGCGCCAAGTCAACGTGGGAGCATCGAACGATAATGCTCTTTCCGCTCTTGCCATCACTTCAGCATCCGACGTGTTCTCACAATTTTCGCCTCCCACGTCTCACCCGGCGTACTGTTCACGAGGTTTTACGTTTTCTCGTATCCCCGTTAATTCATGAATCTGGTCTCCGATGGGCACGAAGCGTGCATCAGTGGTAGAAACGTCCAGATGCAAAGGTCACCTGTCAGGTGGCTCAATCTCATTGCCGCATGGCAATGAGGAGAATGCCATCACGGGTCCCAATCCCGGTCTTTCGCAGGTTAACGGGCATCAGTAAAGTCGCCTCCTGCTGGATGACGCAGGCATTATGCTCAGCATAGAGATAAAACCCTGGGAGGGTCATCCCGGCGTCAGAGTCGGTTTTGCCAAAACGCGTCTCTTTGTCGCACAATTTAATACTGCTCCTCCGCAATGCGGCAGGCAACTGAAACGCATAAAATGCGGGGTTAACCTGCGCTCGTGACAGGTGCCTCATTTTGGCGTGGAGCCACGGATGACTTTGACAGGCGGCCTTCATCAATGTCGAAGAGACTTCGAGAGCTTCCTGTTCATATCATCATCAAAGCAGCAGTTCATCATGGCCACATCCACCGACTTTCACGGTAGTTTTGCCGCTTTACGCCCGGCAGCGAAGCGCATTAGTGAAACGCTTCATGGTGAGCGTGTTATCCGGTGCTTTGCGTGCCATACCACGGGGCCCGCCAGCAGCGACGGAATATCACCGAATAGTTAGCTCAACGTGGGTTTTCATAAAGTTCTGAGGGGCATGAGTCGGAAGGCGAGCACCGGTGGTGCGGGCTGCTGCTAGCGCGTAAAGTAGGCATAACGAGCAGCATTTTGGAATAACTTGACACGGGCAGACATCTTCACGATTTCACGGATGTAGTCGCTGCCCAATCGCATTCATGATGGCCCCTGAAAGGCAGTGTTTCCCATGCCCTTCCTGGTATGCGGATTCTTTCGGGGAGATAGTAATTAAGCTCGCCCATTCATGGGGCGTCTGCTCCGGCCTGAACAGTGAGCGAAGCCCGGCGCGGACAAAATGCCGCAGCTGGCCTGTCTGACGGTATGTTCGATATTGCTCTCAGCAACGAGTGGGGATCCAGCGGCTGCTTGTTCATGGCTTTGATGATATCCCGTTCAGGAAATCGCTCGTGGGTTTTCCAGTTCCGCAAACGCCGCTGCACGACAGGGGGAGCCCGTCGAATACTGGCAATTTCAGCTGCGATCCGCGACAGCACGAAAGTACATCGAATGCGGTTTCCACCACACTTCAGCGAGTCTCTGGCATTCTTCGGATTCCTCCTGTGCGTCAACATTGGTCAGCGCGTAGTCAATGAGGCGTTCGTACAGCCGTTGCTGGCTCGAGATGCCCTGGCCGAATTCGTCCCTCGCCGAGAAAGTCCGTTGGGGTTGCGCAACCCTTTCGAGCAGTTTATGAGTCAAGCACCTCGATCGCTTGCCACCGCCTCGCAGAACGGGCATTCCCTGTTCCTGCCAGTTCTGAATGATACGTATACTCAACTTATAGAAAATGTCAGCCGGCTGCTTTTGACTTCCATTGTTCATTCCACGATAACAAAACAAGAAGGAGAACGACAGAGGCCAAAGCTCGCTTTCAGCAGCATGTCGTTCCTTCCAGAGGGTATTTTTAAATAAAACATTAGTCAAGTTATGACGAAGACGAACGGAAACGCCTTAAAACCGGAAAATTTTCAGCTATAGCTGGGGTAC	*	tp:A:P	cm:i:71	s1:i:631	s2:i:0	zd:i:2	NM:i:2023	ms:i:2824	AS:i:2824	nn:i:0	SA:Z:utg000001l,36658,+,36S1757M63D8693S,60,466;
+103	2048	utg000001l	36658	60	36H7M1D11M1D11M3I1M1D9M3I3M1I3M3D8M1D10M1D3M2D8M1D3M1D11M2D12M1D5M3D11M2D4M1I5M1I9M1I10M1I14M1D33M1D4M1D35M1D4M1I9M1D6M1D8M1D1M2D1M1D19M1D11M1D36M2D8M4D4M2D5M1I1M3I6M1D1M1D10M1I5M3D5M1I7M1D11M1D4M1D3M1D11M3I20M1D10M2I4M1D3M1I14M4D9M1D6M1I17M1D3M2D1M3D2M2D11M1I5M1I8M3D20M7D3M1I4M1D18M1I6M2D1M2D11M1I1M1I10M1I11M1D13M1D13M1I3M1D5M1D8M1D5M1D9M1I4M3D39M1D16M1I4M2I5M4I1M1I8M2D15M1D35M1D33M1D4M2I1M4D10M1D1M2I30M1D3M1D9M1D11M1I3M1I18M1I11M2I2M3I5M2I4M2D13M2D23M3D2M2D18M2I10M2I16M1I1M2D4M1I15M1I14M4I13M1I6M1D17M1I12M2I5M1D8M1D8M4D9M2I9M1D16M1I12M1I2M2D4M2I9M1D3M1D6M1D4M2D25M4D19M1I3M1I4M2I14M4D15M1D5M1D8M3I3M1D27M1D1M3D6M1D6M1I10M2I9M1D1M1D2M1D1M1D44M2D12M3I1M1D2M2I7M2I10M1I1M1I14M2I12M1I6M2I14M2D2M1I14M1D4M3D9M3D5M1I9M3I4M2D4M1D15M1D6M1D14M2D4M1I10M3I34M1D3M1D5M1D10M3D6M1I7M1D8M8693H	*	0	0	ATCGGCAGGGTGATCGCACGGCAAGCCGCGGACGAACATGGGGATGTGTGATGACCACGGAGTCTCTTCACTGCCCTGTTGAGCGGATCAGCCACTTTGCCCGCCAGTGCAAGCAATGGCTTCCGGTGGGACTGGTGCAGGCAGGCATACGCATCGGCGGCTTTATACTGCCCGACGGAAAATCCCGCTTTCTGTGCAGCCATGCCGTGCTCTCAGCGACTGTTCAACGACTGCCGCTGTTTAGCGCATCACTTTCGTACCCCAAATGAGTACTCTGGCCATCTGCTCGTCAAATCTGACCCAGCAATCCAGACTCAAATCAACGACCAGATCGCCTACCGTTCACTACCCTCCATCAGCCTGCGTGGGTCGTATACTGTCATCAGCGGGTACGTCATCCTCCGTCTGTCCCATTACGGGAAGCGGGGGATAACTTCATTCCCGTCCGGCCAAAGCGACGGCACTCAGGGCAAGCCCTGCCCTTTCTGCATCAGCACATCATCTTCAGGCTCTTCGTGCTCGCGCCGGTTCGAGCAGCTCTGAAATGCGGGGCCAAACTTAGATCGAGGTGCTGGCACTGAGGCCGTATGCCTCGAAAATGCATATCCGACGATAAACATCATGAAAATAATGGATCTGTAAAGCGGTGCAGTCGGCATACTCCGTCATGAATCCCGGCAGCATGCACGCCAGTTCGGACCCCATCTCACGCGCCATTCAGGGCAAAACTCAGCTCACGTCGAACATTTTCCCGGCAGGAAACAGAGGCGCCTGCGGGCCCGGCTTCCTCTGTCGTTCAGGGGCATTATTCACTACAAACTCATACATACAGACAGCCGGTACACCACGATTTCAGCATGAGAATTAAGCGTGGCCAGGTGGTAAGCACTTCCTGCTCAATCTGTTTAACGGTGCTTCATGGACGCATCTGCGTCGTTCTTAAGATGGTTATGCCACAGGGACATCGCCACCGATAGAACGCTTTCCGTATGATGGCGTCTTCCACAGTAAACTTCCGGTTGCTTGGCCGCCTGTTCTGCCTGCCGCGTTTCATCAGGGCGAGATGCTCAATGCGCTGCAGGGTTAACAGTTCAGAGAAGCGTGACGGTCACACGCGTTACGTTCAAACTGATTCGGTTTTCAGGAAGCCCGACTCTCTCCGGGTTGTAACTGCGGTGACGTAATTTCTGCAACCGCAGAGCAAACGCCCATTACCGGATACAACCCGGAATGTTAACCTTGCCGTTGCAGCAACACGCGTTCAAGTGGGTCATACCAAATATGGCTAGTGGCTTTTATCCGCAGACACCGCGCCGCGAAGCTCTTGTCGGTTACTAGCCGGCCTGAAAGCGCCACGGTCATAATTAACCGCTTTCAGCGAAGGCCTGAGGAGGGATCCCATGCCTTAAGCGAGTGCTGTTATCCCGTCCTGCGATCTTCTGCCATCGACGGACGTCCCCACATTGGTGACTTTCACGTGCTGATCATTCCTTCGCTATACGCCTTACCGATACTGCTGATCTCCAGCCACGGAATAGCCATCAATAATTCATGTTCGACGGGAGCGGCTTTTACACCGGGTATCGCGTGCTTAAACGCCAGCACCTGCTTGCCCTGCTCTCCCTGAAACCGCCAGCGTGGAGCTGGTTTCCCGGCAGATTTCTGCTACGTCGGTCACGGATTTGCGGTCTGCATCTTCATCATCGAGATAGCTGTCGTCATAGATAAGCGTCAGTTCGCCGGGCGTTAGTCTTTAA	*	tp:A:P	cm:i:28	s1:i:249	s2:i:0	zd:i:1	NM:i:466	ms:i:928	AS:i:928	nn:i:0	SA:Z:utg000001l,40469,+,3654S6816M264D16S,60,2023;
+104	16	utg000001l	9780	60	1267S9M1I4M1I37M1I1M3D2M1D4M1I13M1I29M1D4M3D22M1I11M1D5M1D14M1I8M1I2M1I17M2D2M2D13M1I3M1I7M1D7M1I11M1I22M1I14M2D4M1I3M1I3M1I5M2D8M1D4M1I8M2I5M4D1M1I13M2I6M1I2M5I6M4I1M1D9M1D5M1D10M2I12M2D3M1I7M4D5M1I9M2I1M2I1M4I2M1I3M2I6M1I5M1D11M2D24M3I4M1I1M1I12M4I10M1I7M1D2M2D10M11I9M4I19M1D2M2D1M1D7M1I10M3I6M1D4M3I1M1I7M1I24M2D3M2I1M1D5M1I29M1D6M1D8M3I9M1I4M13I3M3I6M1I3M3I4M6I31M1I7M1I1M1I6M2D5M2I3M1I13M3D12M41I20M1D8M1D12M1I11M4D5M1D6M4D4M4D14M1D4M1I7M1I4M3I7M2D6M3D11M2D3M1I6M6I1M1I3M1I8M2I12M2D5M2I3M1I8M1D2M6D10M3D5M1I10M3I5M1D2M3I6M1D7M2D2M4I3M1I24M1I6M6D26M4I1M1D13M1D10M1I12M1I9M2I8M1I3M6I8M1D2M3I1M2D12M1I12M1I9M2I12M1D9M2I16M1I4M3I22M1I2M1I4M2D10M3I27M2I14M1I22M1D1M2I3M1I14M1I1M1I10M2I18M2D18M1I5M1I18M2D4M1D12M1I8M1I1M1I5M2I8M2I27M3D4M1D1M1D6M2I16M1D8M4I36M1I6M2D5M1I3M1I3M1D4M1I2M1I17M5D5M1D3M6I21M1D5M1D1M2I2M4I4M1D1M2D19M2I5M1D9M1I7M1I11M2I4M2I3M2D17M1I15M2I8M1I7M3D7M2D2M2I26M2I3M1D24M3D7M1D2M2I9M2I1M1D3M1I16M1I16M1I15M5I10M8D2M7D1M3D7M2I13M2I2M4I19M1D4M5I2M4I1M2I10M1I3M3D2M1D11M5D5M2D1M1D4M5I3M1I8M1D11M3I7M3D3M1D4M1D5M2D3M2I4M4D3M1D1M1D10M2D17M2D2M1I2M2I9M6I6M3D4M1D6M2I15M1I7M1I22M3I3M1I4M1D4M1I17M2I20M1I4M3I2M1D6M10I7M2I1M2I10M1I5M1I8M1I4M1D9M1D9M5I3M2I1M2I4M6I12M5I3M1I3M1I10M4D4M1D6M1D3M1D3M1D17M1I12M13I1M1I2M8I4M1I15M3D4M1D6M2D4M2I7M1I5M1I8M2I6M3I9M2I14M1D6M1I9M2D5M4I5M2I3M1D7M2D6M4I3M1D8M2I2M1D6M2D12M1D7M1I15M4D1M1D9M2I11M1I2M1I7M2I6M2I11M1D1M1D8M1I17M2I1M1I18M2D17M3I23M3I4M1I10M2I8M1D1M1D2M1D11M3D5M2D1M3D10M2D13M1I7M1D10M1I9M1I2M1I5M1I8M4D6M2D6M1I9M3D4M3D2M2D21M1D3M1D7M2D5M1I4M3D9M3D9M2D2M1D18M1I2M1D5M4D10M1I7M1D19M2D13M1I18M2D9M1D3M3I1M4D4M1D2M2D2M1D9M1I6M1D1M3D3M1D5M4D3M2D4M4D7M6D12M2D6M1I6M1I5M3D5M2D1M1D12M1I2M1I4M2D6M1D8M1D5M1D2M1D4M3D25M1D18M1D7M2D7M2D8M2D10M1I12M1I13M2D2M1I9M2I17M1I11M1D7M1D8M1D20M2I3M1I4M3I8M1D1M1D7M3I6M4D14M2I6M2D1M1D2M1D41M2D6M1D7M4I3M1I6M2D9M7D6M1I6M2I6M2D23M4I5M1I5M2I6M4D6M1I4M3D9M2I9M1D6M1D3M2I13M3D16M8I17M1I1M2D7M1D10M1I1M1I13M3D5M2D9M1D4M1D15M4D8M2D11M3D5M3I1M1I3M1D10M2D6M3D3M1D29M1D16M1I4M2D7M2D12M1I16M5D5M3D4M1D21M1D12M2D14M1D11M1D4M1D3M1D6M1D8M1I6M2I29M1D6M2I6M2I2M1D21M1I15M2I2M1D17M4D19M1I7M2I7M6I5M3D5M2D14M1I8M1I15M2D4M2D1M1D3M1D18M4D4M1D8M2I2M1I4M1I5M2I5M1D19M2I4M1D7M3D5M1I6M4D10M1D4M1I16M4I7M1D16M2I3M2D4M1I11M7I2M4I9M1I1M1I2M2D3M1D8M2D6M1I17M2D5M1I4M1D10M1I30M2I4M1I3M4D10M3D6M5D29M2D2M1I18M5I19M1D2M6D7M1D25M4I18M2D3M2I4M1I3M1D12M732S	*	0	0	GATTGTTCCACTCATCGTGATCCTGTGTACCCCTCCTTGAAAACTTACATCTTAAAGGGCAGGGGTTCGATTTCCAGCCACCTTCGTCACTTCTGAGACTGTTTCATATTGTCTTGACGGTTTTCGCCGCGAAATACCGCCAGTAACCGGCTGAAACACCGTTAGTCACTTTCGGTAGTTCTGGTACCCTGCGGAGGCCGCGTGATCGTTCTTAAGCTAGCTTAGATTAACGGATGCTGAATTCGTCAAAGTTAACTTCCATCATTGTGTTGGCGAGTGTTTTTCAGCATCATCTTATAAAGCCATTCGTCAGCTTATACATTATTGAGTTGGAGCTGCTGTTAGATCGCCCCCGTTGCTAGGTTACGGTGGTCTACCGCGTTTGGTGTTGATTACTCGGCTTTATCGGGCTCATGTCCCAGTGCGTCCTTAAAGGTAAGCAAAGTTACCAAACCTTGGCGCGCATAATGCCCGAACAGCACACATGTCGCGGTGGTATCAGGTCACGTTCACGGATCAGCGGACTCGCTACCAGCAAATTCGGGTTCTGGCTGATGGTGCGATAGTCTTTCACCATGTCAACATCCTCACTTGCGGGCAGGTTTTCTTTCTTAATTCGTGCTGCCGCTCTCGAATCGCAGCAATCCATTCACACAAGAAATTATTTCTGGCTGTTGAGCAGGATTCAGAATTCTCTGACGAATAATCTTTTCTTCTTTGTACCTTTGTCCCCTGTTTGGGAGGGGATAGCAATCCCCAATTTGGGATGTTTTATCCTCGTTATTGGGCGACCTCCCTTGTCCGCTAGATGCACCATCGTATTATCTTATCTTATCAAACTTCATTCCATTCATGCTGCTCACCGCAAGTTCTACTCTTGACGGTTCTCTTCAACCGGTCATCCCATTGCACCGTTTGAACTATAATTTGTAATCTCTCGGCTTACGAGAATCGGTGATTGGTTTGGTTTATTCTACCCATAGGTTTTACGCAGAATGGCAAGCAGCAGGATTTGAACTGTTGCTGCCGGTCAGATCTGCTGCCCGAATAAGCCTCAAGCAGGTAATGTTAGTCTGGCGTAACCATCATCAGTGCGGATCTGCCATTACGTGCTCCCTGTCCGGCAAAGTTACCGCGGTAGTTGAGTATTTTGCTGTATTTTGTCATAATGACTCCTGTTGATAGATCCGGTAGTAATGACCTCAGAACTCCAGCCATTGGATTTGTTCCGAACGCTTCGGTTGCCGCCCCTGTTTTTGGCTTGGGCTGAGAATCGCCACCGACTTGTCGCGCCCCAATCGCTCCATGTCAACGATTCGATGCTTCACAGAACAGCATTCATTAATTGAGAACTTTGGAATCCAGTCCCTCTCCATGCTCACGGTGACTTATCAACGCCCACAGCTTCCGTCTTCTCATTCGACTAATCGCGGTTCGATTCAAGCAACGCACTCTTCACGGGGCTTCGTTGCGTTTGTTTGCACGACGATGTAATAATATTTCCTTAGATAACAATTGATTGAATGTATGCAAATAAATGCATAAGAGCTGTGGTTTTAATCCTGCCCTTCAGGGCTGGAATGTAATATCTGTTTATGCTGTTTATTTTTGTTACTCGGGAAGCGCTTTACCTCTTCCTCGCATAACGCTTCCAAGTAAGCGTTTATAAAATAAATCTTCATTCAATGAATGGCTGCGGTAGGGTGCTTTACAATCGCGCCCTTATACGCCGAGATTTAGCTGTCTTGGTTTGTGCCGACCGCATTGCATAATCTTTCAGGGATTATGCGTTGTTCCATACAAACCTCCTTAGTACATGCAATCACCCACCGCGTTATAAAATAGTCAACACGCACGGGTGTATTTATCCCTTGCGGTGATAGATTTATAACGTATGTGAGCACAAAAGAAACCATTAACACAAGAGCATGAGGACGCACGGTCGCCTTAAAGCAATTTATGAAAGAAAATCAAATGGCTTATCCCTCAGGAATCTGTCGCAGACAAGATGGGGGCCACTGGCGGATGCAACCGTTCCGTTGGTGCTTTATTTAATGGCATCAATGCATTAAATGCTTATAACGCCCCGCATTGCTGCCACAAAATTCTCAAAGTCGTTGAAGAATTTAGCCCCGGTAAATCGCCAGAGAAATCTACGAGTCTTATGAAGCGGTTAGTATGCAGCGGTACTTAGAATGAGGGCTGAGTGCCCGTTGGACTAGATAGCTGTTTACGGACTTTACCAAATGATGCGGAGAGATGGGGTACAAAGCACAACGAAATCGTTTGATTCTGCGATTCTGTGATGAGTCAAGGTTGAAGGTAATTCCATGACCGCACTAAGACAGGCTCCACGGTTTTCCTGACGGAATGTTAATTCTCGTTGACCCCGGCATGAGGGCTTTGAGCCGCTGATTTCTGCATAGCCATACTTGGGGGTGATGAGTTGGTTCAAGAAACTGATTAGGATAGCGGTCAGGGCGTTTTACAACTAACTAAACCCACAGTACCCAATGATCCCATGCAATGAGAGTGTTCGTAGTTGTTTGTGGTAAAAGCTTGTCAGTGTGGCCTCGAAGAGACGTTTGGCTGATCGGCAAGGGTTCTGGTCGGCGCATAGGACTGATAACAATTGAGCAAGAATTTTTCACTGAATTAGAAACCTTCATCTCCCTCAGAACATAAATACGTAAATGGATTGAATTATGAAGAATGGGTTTTATGCGACTTACAGCAGCAAAATAAATGAAAGATAAGTGCTCAATAAACCTGTCTGATATTTCCTGCATTCTCTGCTGGCTGATAATCATGCAGGTTTGTTCAATCAGCCGGAGTACTCATAAAATCGATGGAAACTTTCTCTTTACCAAAACAAATGACAAGAGTCTGGTTCAGAAGATAACTCTAAAGCTTCAGTCCAAGATAGAAACCTCGCAGATGACGAATCATTGGGTTCCCATCTTTGTTTGTTGAAGGCTAACACCATTGGTTTTGCCAGAACGTGGTCGCGACCAAGCGGATTGACAGATTTTAATCGGGAAAGGAATTAAGAGTGATGCAGGCGAGCGCGTTCAGATAGAGCCACTGTCATCTTGGAGGGAACCACTAAAAGACGGTGTTATGCATTGGATTTCACTCATCAGAAACAACGGTGAAGGCGAAGCCACTACCTGTATTTGGCGTCATATTAAAGGTCTTAGGGAGTAACAGGATATTAGCACGCATTAGCGACTCATTAGATTATACCTAGTGCAGGGAATTAAAAGGATAAAAGGTTGCCACGATTATTTTAACCCGTCATCTAACCTCAGACATTAGCCTGCGGCAAAAGATGAGGCCGGAGATATTTTAACAGAACAACATTATCTATCAAAAACGCTCATCTGGCCGGGTGCGAACATCAATGCTGAGATAGCTGAAGAGATGATATTGTAACAATATTGATAGCAAGAATAGAAAGTGATACTGGAATTAAAAGGCATTATGAAGTTAAGGATTGTTATCAGGAGTGATAATTATGCGGAACAGAATTGCCTGGAGGATGATTAATTCCTTAGTTATCGTAAGCATTTGCGCTGCTCTCCTTCTCATTAATTCCTATTCTTTCAGCTGATAGAGATGGTCTTGGGGGCGACATTGTCATCATATGCAGGAAGAGCCGGTCGCAATCGGCACTGCTGCCTTGACGTTTCTAATCGGAAGCAGAACGCGCTAACCGTAAGATTAGGGGTATATCGTATATGACATCGGCTATTGTCTTCGCTTAGTTTTGTTGTTGAGTTGGAGCTTTGTTTTTCTGCGGGTTATTGCTTCTTCCACGGCATCAAGCGGCTCATTAAGCTAAGCTCTCTACACTCGACTGCCTCTGCAATCGTTCATTCATATGCATCCTTTTGAGCTTTCCAACTGAATGGCTAACTTGAAGTTGAAAGTCAACGATCACCTCATGTTCTTTACTCCCTTTCTCCAATAACCCGGTAAACAAGCAAGCATGGGTCGTCGAAAATATAAATAGATACAATTTGTATTACGGACATAGACCCCATTCTCAGGCGTTCAAACACCGCCTCTAATGCAAATAATTGCCAGGACATACAGATAAATATTTGCGGTGATAATTATCTGGCGGGCAGAAGTACTTCCGTGATACTGAAGATAGGAGCAGAGGACGCCGACTAACCACCTAAGGCGACGGCTCTTAAAATTAAGCCTGCTTGAAGAAGCGCAGCATTCAAAGCAGAAGGCGTCTTGGGGTGTGATACGAAACGAATTATTGATTGCCGATTCCGGATCAGCGCTGCCAAGCGGGATCGCGGAGTTCGTCCAAGGACTGCCACACCACTAAAGCGACTGACGGAGAATCCAGGTTGGATGCGACGACAAGACACGCCGCGAACGTCGCAGGAGAAACAGGCAGCATGGAAAGCAGCAAATCCCCGTTGGTTGGGGTAAGCAAAGAGCAATCCCCCGCTTCTCGCTGAATCGCAACCGAAATCACGAGTAGAAAGCGCACTAAATCCGATAGACTTACAGTGCTGGCTGAATCACAAACAGATTGAAAGCAACCTGCAAATGATGAGCGCAAGATCTTTAACATGTAGAAGCCGCGCGGAACGCGTAAAGCCAACGGGAAAAGGTTAGAAAATCGATTCCTTATCGTGGGTAGCTTGGTTGGCTGTTTTATCTCAAGTACTTATGGATCATAGCTGGCACGGATCGTTATAAATATCCTCAATAGGGAATAATAGCCTCCTTCCATTCCATCGTAAAAGTCGCTCAACACCAAGCTCAATCAACTCATTTAATGTATGGGGAATTGTTTGGGTCGACCACATACTCTTCCTGCCTTCATTAATGCGATGCGCACAAACCATGATTGCTCTCTGTAAGGTTTTGAATTACTGTGATTCACCAGATTTATCGGTTTTGCATCTTCTTAATGCGTTTTCTTAGCCTTTAAATCCTTATCTGGCGCTGGCAATAGCTGATAATCGATGCACATTAATCGGGCGAAATGCAAGAGAGCAAAGACGAACAAGCCAAGGCGTCACCGATTCTCTCATTAACATATTCAGGCCGGTTATCTATCGGGCTTAAAAGCAGAAGTCACGATAACGAACTACGAGGTTCACTCTCCAGAGTTCACTTACTCTGAACACTCGTCGAGAATAACGGCCGGATCAGATTGTCCATTTCTATACTCATCAAACTGTAGGGTTGTAATGATGTTTATCCGATTTCTCCCTAGGGTAACTGAGACGAGTCCGATGGGGAAGACAGGCAATCTATCATGCAATGTGCTCACACCGGAGCTGATATGGAAGAAGAATTTGAGGAGTTCGAAGAGCATCCTCAGGATGTGATGGAACAATACTGACGTTGGCTGACTACGACCTATTGATAAAATCAATGGACTCAATGATGGACCTCATTCACACTGAATCGGAATGCAGCCAGCCTGAAGAAATGTTTCCTGTACGGACAGGGAAAGTGTCCATCAAATGGGCGCAATACGAACGACGGCAATGATTGCCAGTAACTTTGGGTAAAATCAAACAACAAAGCTGCCTGATGGTTGGCCTTTATTTTGGCATAAATAAATAACGGAATAATGCACTGTGTATTCATTCCAAACGAGTGCGAATACAACCGGCCGACGTGTCGCTCGTAACCTAACAGGGAGCTAACTTGTTCTGATTATTGAATCCTTGCCTCGAGTGTGTGAGCAGGGCTTGGGGAGAACGGCAACACTATCTACCACACTTACAAGCCTTCATTGATTAAAGGATGGAAAGCAGTACGAAATTGAAATCGACCTGACGGTAATGACAGAGGAAAAACCAACTTCACAGATTAATAATTTCTGGTCAATCCTTCTGAATACCGATCACGTACGGATTCAATAAACTATCGTATTATTAAATGCTGTATTTAATCATGCTGGCGCAATGCTGCTTATAGCAATTTCGAAGCGACTTAAATGCATCTGGTGTTGTGTGATTGAAGTTCGGAAACCGGTTGGAAATGGTCAGGAAGGATGGCCTCCAATGGATGGCTGAAGGAATAAGAATTACCTAGATGATATCGATACATCAGGAATATTGATTCAGATGATATGACTATCAAGGCCGCCTTCTCTCAGTGCGTTTGTTCTCACCATAAGAGACGCTTCACTCGAGGGGCTACTTGCGTCGTTACGAAGTAATGATTACTGCAAGAGCCTCGAATATGCGTATCTCACCGTCGTGGTGCCCATCGGAATAGCTGCCTCCTCGAAGCCTATTGAACGAATCAGCGAGGAATTACCGACGGATGGAACGATTCGCTCTATCGACATATCCAATCAGTTCTATCCAAAGAATCCAAGCATTCAATAATACCAATTCAAGTTCACGATCAACGGATTCACAGCAATAATTTCCACGACAAATTAATTCAAGGATTCAATAATTCAAGGATTAATTGAATAAGATCACGATCAATAATAACGATCACCACGATCAGCATACGATCACATGGATCAAGATCACATGCACCACGACCAATTTGATCACGATCAATGATCACGATCACGACCAAGCATAACTAATTTGCATTTGATCAATTTGATTCACGGAAGATCACGGCAGATCACGATCACGATCACGACTGACCACGATTGCAACATTTGCTCGCGCCAGGGATTGAACTCTCATTGAGCTCCCATCATTGAGTCTCTGTGAAATACTATCGTGACGAGGCTGGGAATATGAACTGAGGGTAAAATCCATTTATGTCACCACCGGAAACTGATACCACGCAAAAGCATTCTTAAGCATCCTTTCCTCGCGTCTCTGAATCATTCATCGGTAATCTCTAGTTGGACACAGGAGGTTCGGCTTAAGCCATGGGTCGAACGCCGCATGATACGGG	*	tp:A:P	cm:i:33	s1:i:364	s2:i:0	NM:i:1574	ms:i:1464	AS:i:1485	nn:i:0
+105	4	*	0	0	*	*	0	0	GGGAATAAGTGCTCCGCTACCATTTTAATGTCGTTTCATTTCGTGATAATTCCCTTGCATCGATAGTGGAAATCCTCTGAAAGAAACAGTAGGCGCTAGTTTCCTAGTTAGCCAAATGTATACGGTGGATTCAGAACTGGAACGGAATGCCCGTTCTGCAGGCGGTGGAAGGGTAATGGGAGGTACTGCCGTCAGCAACCCGGGATGCTGAAGTGCTTACTTGAGCAACGAAAGCTTAGGCAGTTGTAGATGAAGAAATGCGGCAAGCAGGGCAGATCTCGAGCAAGAAAGGTGCATGGCCGGATGAACGGATACGGACTGCTCCCGTGCACAGAGCCCGACGCACAGGAACTGAAGAATCCCACGGCCTGAAGTGGTGAAATCGAATTTACTGTGATTTCGTGCTCCTTCACGGGCCGCACGCAGGTGAAGTTGAACTTGCTACGGGCTCCACGTGCTTCCAGGCGTTGCGGAACTGGAAAACCGACACTATGTTGGGTTTCCTGAAACGGGGTAAAAGCATGGGGCACTCATGATGAGGTCTAACGGGCATACTCCGAACAGTTAAATCCCACGATGCTGCATTCCCTACGGATTCTAAGCCATCGTTTGAACGGAGCCAATACGCCGTTCAATCGGGCAGATGCTAATTACTATCCCAACGAATCGAATACCAGAGAAGGGCGCTCGTAGGAAACAATGCCCTTTCAGCGGGCTGACTCATCGAGGACGAATTCGAGGCGATGGGCGGCGACTAGAACCCGTGAGGTAGGCACGTATGCCCGGCTTATTCGAACCCCGTTTCGCCTTTACGTCGAGGTCATTAATAATTCCAATCCGACACCTTTAGCCGCACGCCCATAGAAGCCATTATCTGTGCTACGGGTATGCCGAGAATTTATGAAATACCCACGTTACGACTACTTCGTGGTTACTCCGTCTAGCCTTAGTAATGGCCCCGTGGTATCGAAAAGCTAAGCGGGACTAACAAGCCGATAGGCAACGCGTCAATGGGCGTGGCTTCTGGTGCCTGTGCATGTAAGCGGGGACAGCCGTCAGATTAGCTTACATTACATATTAAATGCTGCTTTTGATGATGATTGAACGAACAGGAGCCTCTCACGTTCCTGGGTGAAGCGTATTGAATTAATCGCTTTAAAGTCGATACGTGGCTCCAAGCCAAAAGTGGAACAGGTTCGATCGATTCAACGATGAATCCCCGGATTTTATCGTGAGCTTTCATGTTAATGCCCCGCATTGCGGGGAGGATGGTATTAATTTGGCGACAAAGAGACGGTCCCTCATGGCCTCAAATGGACGGCCCGGCTAATTTTGACCCTGCGAGCGGCTGATCCATCCGGTTAATCACCGGGCACGGAAACTGAGGTTAATGCCCGTTATCTGCGCACTCACGCACCCGTACTGGATCCCAATTCTCTGGTTTCGTCATCCAAAGTCAAGGGAGTCCAACATGACAGTGATTTTCACATCTGGACAATCCAAGCCCGTTCTACCTGGCTTAAGATTTGTCAACAGACTGGATGAAAACGAAAGGGGATACGGGAAAACGTAAAACCTTCGTAGACACCACGGCTTAGAGACGTGGGATGAAAATTAGAACGTCTCATTAGTGCTGAATGATGAAGAGCGGAAAGAGGATTGATTCTTGCTTGCACGGTTCCGTCCTGACCGTGTAGGTCTACGTGACCGCCGGTATCGACTCCCATAGGCAACAGGCTACGAAATGCGTATGGCGGTACTGGGGTACGGGGTAGGAAAGGTGGGGTTGACCGGCAGATTATTATGGGGCCGCCACGACGACCGTCGCTCGGTGAGTTGGATGAGGCCATCAATACAACCCAGCCGGAATGGTGCAGAAATGTCGATATCCCGTATCCGCTCTGGATGCTGGAGCGTGTACTAAATACATGGCGCTCATGAACTGTTTGAAAGTGCTGATCCCCATGCCCTAGAGGGGAATGGCCGTCGAATGGGAGACTAGA	*
+106	0	utg000001l	25823	60	263S13M2I17M1D17M5I6M2D9M1I1M6I2M2D19M4I13M1D4M1D4M1D14M1I5M1I11M1I3M2D9M1I2M1I3M1I7M6D6M1D16M1D11M1D3M1D2M2I5M1D9M2I1M1I20M1D14M3D6M1D4M1D47M1I4M1D4M1D8M1D2M1D2M1I10M1D1M2D1M1D4M1D35M2D18M1D16M1I2M1I16M1D4M2D4M2I7M2D6M1I1M2I16M2D9M2I20M1I6M2I4M3I9M2I15M2I6M1I23M2I10M3D16M3D6M4I1M1D11M2I3M2I11M2D5M3I7M2I10M2I7M1I13M2D2M3I2M2I4M1I6M1I1M2I16M2I3M1D5M1D8M1I30M1D7M4D12M3I3M1I10M1I2M2D10M3D7M1I3M2I7M1D3M1I3M2I8M1D2M3I15M3I5M3I3M2I4M2I8M4I1M3I13M1I5M1I32M4I1