view test-data/sample_reads.fasta @ 7:39bed8de8017 draft default tip

"planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/racon commit 315fa3071141484b055db128f7d116a774cc5beb"
author bgruening
date Wed, 13 Apr 2022 15:38:59 +0000
parents 51fd3136069d
children
line wrap: on
line source

>1
AGGTAGCCTGTTTTATGAGTGGGGATTACAAAGGATGGTCATCGGTCACGTGACAGTACGGGTACCTGACGGCCGTCACACTGCTTTCACGCTGGCTAGGAAAAGCCGGCCCGCCTTTGTAGGGCCAATGTCCCCGACGATTTTCCGCCCTCAGCGTACCGTTTATCGTACAGTTTCAGCTATCGTCACATTACTGAGCGTCCCGGGGTTCGCATTCACACTGCCACACTGATATCCGCATTTTAGCGGTCATTTCAGTTTGCTGTGTCAGGGAAAGCGGAGGATTGCGCAGGCCTGTAGTAAGCGTGAGCGTCAGGCGGTGCTTCAGGAACACTTCTTCGTTCGCTGAATATCTGGTTGCCCTGCGCCAAACGACCGGCGTTCATTCCCGTTTGCCGTATAATAAATGCATCCCACGATTGGCGGCATGATCCAGAAACTGGGCTCAGTTTGCCTTCCTCCGTGTCCTCCATGCTCAGCGGACCCGCGACATAATGTTTGCCGTCTTTATTCTGCTCAATTTGACGACGCCCGGGCATTCACACTTATCGACTGGCGGCATCCTTCCACTCTGTTCGAAACCCTCCAGTGCTTAGTTATCCTCCGTCATAGCCGGACTTTTCCAGCAGCTCCTGCCGAGGTATGAGGATTGCTTCTTGCCTTTGGAAAATCGAGGTAACCTTCCGCATCATGCCGCCCGACCGACGGCCTCCACGAATGCCGATTTGCCAACGTGTTCCACTGCGAGATAAACATAATCGCTGGCCCGGTTTGATATTGATACTGCGGCTATCCAGTACAGCGCCGTACCAAGATAACGCGTGCTGGTTTCAATGGCTGTCTGATATCCGCAATCTGCTTTTCAGGGGACCAGAACTCAAACTGTACCGTCCGTATAAACGGCAAGATGCGGCGTGGCGGTTATCTGAAGACCCCGGCGTCAGCTCAATCCTCGACGGTGCTGCAGCAATCAGAACGGAATACCATAAGGACCCGCTTAATCGCGCGCCCGCATTTACCGCCCGGTGACTGTCGACCTGTAGTTCCCCAGCGCCAGTGCGTGAAGCGGTATGTGGTTTCCGTCGTCCGCTGCCGTGCTGACCAGCCGCTCACTGCCGTCGTCGTCCGTTACGGTCACGGCCAGCAGGAAACTCACGCCGGTCCCTAGGCTTCGGTGTGTCCCATCGCGCCAGCACCTGATATTCCATGTTGTAGCAGTACTTCTGCGGTCAGGTGCAGTGAGGGGCGGGCGGGATCACCATTCACCGTGCCACTCTGTTCGCCGTTACACTGCACCCGTTATCCACGATGGCCTCTTTTCCGGCACATGCTGCACGCGGGGCGATGGCATACGTGCCGTCGTCGTTCTCACGGATACTCACGCAGCGGAACAGTCACCTCTGGCTGGCGCAGCGAGCGGTTCGGCAAGCTTCAGCTCCCATACGGTGGGTCAGCAACACCGTCAGGAACACGGCTCACTTTACCTTCAGCCGTCGGTGACGACTGAACCTCCACGCTGACCGGATTGCCATTTCCGTCAACCCGAGGGATGACGGGGTCAAGGAGGATGGCAGCGTGATTCAATCCGTCGAGCGTCAGCGTCCGGTATTGGCTGTTCACACAGGCACACGACCACCGGTTAACTGATACCGGCATCATAGTCATCATGGCGCAGATTTCAATAACATCGCCCGGTACCATGGGGCAACGGATTCTGCGCCGACGGTATGAAATCCACGTCCGTTTCCAGCAGTTCTTGTTTTAATCATAGCCACATGCCCGGCGCGGTGCCTGCCCCGGCTGGTACAGCCAAAGGCATCCATCTTCGTAACATTACGACCTGTAACGGGCAATGGCCTGCGTATCTTCAACAAGCTCTGTCGCCGTCTCGAGTAGATAC
>2
ATCTTGATAGAGATTTCTAGGGGTATGCGTTAATGATCAGAAGCTCCCAATCAGGTTCAGTCAGGCTGGCGGCATCATTTCCGGCAAAATACGGTAATTATTTTCGCCGTGTAGAAAGCCCTGCCACATAGGCTAGAGTCGCAAGCTTCTTCGGTTGTTTACCCGCAAGCGTTAGTCATGGTGGTGGTAGCCAAAATCTGGATCATTCTCCCGAGCGCTGCGGCCAGTTCATTCAGCGTATTCAGTTGCGTCAGGTGACGCGTCGATAACATCTGCTGCAATCGCGGCCAGTACAAAAGCGGTTTCGCAATCTGGGTTTGTTTGTTCCTTGACATCCGGTTGGTGCTGTTGGCGTTCCGGTCAGTGCCGGACTGTTGAGGTTGGCTTTTTCTGTTCGTTTCATCCATTACCACCTTAACCGCCTTTGGCGTTGCAGCAAGCGTTTCAGACGTGCTGTTGGTTGCACTGCTGAGCTGCTATCCGGATTTCTCGTTGTCCGCATCCTCAAGCGCGACAGCTGAAGCTATATCTTCTGCACGTTTTGCCGAATTTGCACGTATTGCCGCCGCTTCTGCCGCGCTCGCATTTGCTCTGCGATGCTGATACCGCACTTCCCGCAGCCTCCCTTCCCTTCGTGATGCCGTTGACGGCACTCCCCGCCGCCGCTGTTTGCGTCGTGCCCCGGCAGGATGAGGGGCGCGTTCCATGCTGTTTCAGATGACCTGGCATTGCGTCTCGGACGTTTTGCCTCACTGGCAGAATTTCTGCCGCCGTTGCCGAGGAAGCTGCACGACTCGGCACTTGATGATGCGTTCGTTTCTGATGATTTTGTGCCTCTTGTTGTACCGGGCATCTCGTGCTGAAGGAGTGGGGGCCTCTGACGCTTTCGTGGCCATGCGGAGGCAGAATTGGCTGATCTTTTAGTCGACTTTGGCTTAGCAGCATTCGTTTCTGTAACGTTTTCGCCGCACCGGCACTGGGCCGCCCGCGTTTTGAGAGAACTCTGCGGCTGCGGCACTTTTCCGCTTCAGTGGCCTTGCTGATGCCGCCTCTTCTGCCGCTACGGGCAGCTTCCTGAGCTGACGGATGCAGCCTGTCCGGCGGACGTGCTGTGGCGGCGCGTCGGGTCAGTTGCATCAGAGTCACAAGCTAGGCCGCGACCTGAGCAGCTGATGCACTGGCATCGCCGGCTGATTTCTTCGCGTCTGCCGTACTCTGTGCCACCACGAAGACGCGTTACGCTGGGAGCTCTTCCACCATGAGTTCGACGAAGCGACGCAGCACCTCCATGGATGGCATCATCCTCGCGTCATGGCACACAGAGAAACCTTCAGCGTCCCCGGTTGTGAATCTTCATACGGTGATGGTCCCGGCGTGCGATGGAAAACCCGTCAACCTGCAGGATATCTGACACTGTACTGACCGTACTCCACATCCATGCTGTAACGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTTGCCCCACCACCGTGGTGCTGTTAATGTCTGGCTTTCAGCTGAATGGTGCAGTTCTTGACTAGTTTTCCTGTGCCTATCTTTCAGACTCCTGAAATCTTTACTGCCATATTCACCGCAAAAGCCCACCGGTTCCGGCGGGCTGTCATAACACTGTGTTACGCCTGGCTAATCAGAATTTATAACCGACCCCAACGATGAATCCGTTTAGATCGCCAGTCGCCACTGCCGGCCCAGCCTTCATAGACAGCAAGATAATGAACGGACGGACGCTGCCGGATTAATCTGTATACCTGCACTCCACGCCAACCAGGTATGCCGCATTGCATTTCGTCCCTGGCAGTGGTCGTCTCTTATCTTTCAATACCCGGGAGTGATTTCCGTCTTACGGTAATGCGGCTTGTACTGCCGGATAAGCGACTGTGAGCCACTCCATGGCTGAGAAGCCGCACTGATTTACTGATTTGTAAAACCGGTCCGGCCATCACGCCCTAACTAACGTCCACGCAGGCTCTCATAGTGAAGAAACGTATCCTCCCCGGTCATCACTGTGCTTGCTCTTTTCGACGGTGGGGACCCCAGGGAAGCCATCCCCCACTGTCCGTCAGCTCAACGGTACTTCACGTTAATGCCTTTCAGATGACTCACATCTATCCCGCCGACAACGACGGCAATGATCGGTTTCATTGAAAATAGCCCACCGTAAACGTACCATGTCCACGCGTCGCACGGCCGGAGTACTGTCACCGCAAGTGCGGCAAAGACAGCAACGGCAATACACACATTACTCGCATCGTTCACCTCCTCACTGTTTTATAATAAACGCCCGTTCCCGGACGACCCTCTGTAACACTCAGACCACGCTTTCGTTTCACAGCGCCTGTTTCTTAATCACCTAAGACCTGCACGCATCGCTGGCAAACGTATACGGCGGAATATCTGCCGAATGCGTTGCCGTGACCTTAAGCGTGAACGTCAGGATCACGTTTCCCCGAACCATGCATGTCAACAATACGGGAGAACACCTGTACCGCCTCGTTCGCCGCCATGAGCTAATCACGCACCGTTCATCAGTACTTTCAGATAACACATGAATACGTTGTCCCTGCCGCTGACAGCTTACCCTTATTTCACTATGAAACGTCAGGGAACGAAGCACCACTATCTGGCGATCAAAGGATGGTCATCGGTCTACGTGACAGGTTCCTAGATAGCTGACGGCCGTCAACCCTGCTTTCACGCTGGCCGGAAAAGCCCTAGCCGCCCCGCTCTTTACAATGTCCCCGACGATTTTCCGCCCTCAGCGTACCGTTTATCGTACAGTTCAGCTATCGTCACATTACTGAGCGTCCCCGGAGTTCGCATTCACACTGCCACTGATATCCGCATTTTAGCGGTCAGCTTTCGTAGCGTCCGTGTTAGGAAAGGCCACCGAGGATTGCCGCCGTAATGGTGGGGCCGTCAGGCGCTTCAGGAACACGTCGTTCATAGTGAATATCTGGTTGCCCTGCGCCAAACATCGGCGTTTCATTCCCGTTGCCGGGTCAATAAATGCGATACGATTGGCGGCAACCAGAAACTGGCTGAGTTTGCCTTCCTCCGTGTCCTCCATGCTGAGGCCAATACCCGAGACATAATGTTTGCCGTCCTTTGGTCTGCTCAATTTTGACAGCCACGGGCATTCCCACTGTATCAACTGGCATCCTTCCACTCTTTCGAAAACTCCTCCTCCAGTTGCTGGCGTTATCCTCCGTTACATAGCTCGACTTTTTCCAGCAGCTCCTTGCCGAGATGGGATTCGGTTATCTTGCCTTTGGAAAATCCAGGTAACCTTCCGCATCATCGCTCGCCCGACCGACGGCCTCCACGAATGCCGATTCAACGGTGTTCACACTGCCGGATATAAATAATAATCATGGCCGGTTTGATATTGATACTGGCGGCTATCCAGTACAGCGCCGTACCAATAACGCGTGCTGGTTTCAACCTGTCTGATATCCGCAGCAATCTGCTTTCCCGAACCAGAACTCAAACTGTACCGTCCGGGTCATAAACGGCACAGATGCGGCGTGGGGGCGGTTATCTGGAAAATAGCCCGGCGTCAGCTCAATCCTCGACGGTGCTGCCCCTTGCGGCAATCCGGAACCATGATACCGACGCCGTACGCCCTGCTGCCCCCACGCATTTACCGCCCGTCAACTGTCAGCCTGTAGTTCCCCCAGCGCCAGTTGCGTGAAGCGTATCTTATGCGTCTTTCAGCGCCGTCGACCAGTAATTCATGGCCTCAAGCCTGCCGTCGTCCGTTACCACGTCAGACGGAGCAGGAACTCGACGGTCCCTCACCGTCCTTGTCCCATCGCGCCAGCAGCTGATATTCCCGCTGTCTGCAGTACTTCTGCGGTCAGGTGAGGCTGCAGCGCCGGGCGGCGTGACACCATTCACCGTGCCTCTGTTCGCCGTCAAAGTGCGCCCCGTTATCCACGATGGCCTCTTTTCCGGCACATGCTGCACGGCGGTGAAGATGGCATCGTCTGCCGTCGTCGTTCTCACGGATACTCACGCAGCGGAACAGTCGCAGCGTAGGCAGCGTCGGCAGCTTCTCAGCTCCAGGGCCGTATTCAGCAACACCGTTGAAGGAACACGGCTCATTTTACCTTCACGCCGTCGGTGAGACGGTGACTCTGACCCTCCACGCTGACCCTAGATTGCCACTTCGTCAACCAGGCTTATCAGCGCGGTACATCGGAGAGGATGGCAGCGTGAGCATTTCACGGTCGAGCGTCAGCTAGGCTTCGGGTCTGGCTGTTCTCACCCCATGGATCAAGGCTACCGCGTGTGCTGATACCGGCATAGTCATCATCGCAAGATTCAATAACATCGCCCGCTTAATGGCGAAGCCCTTCTGCGCCGGCCGACGCTGAAATCCCACGGTCTGCGTTTCCAGCAGTTCTGTTTAATCAGCCACAGCCCGGCCGGTGTTCTTGGTGCGCCTGCCCCCGGCTGGTACAGCCAAAGGCATCCATCTTCGTAACATTACGACCGTAACGGGCAATGGCCTGCGTATCTTCGACAACAGCTCTGTCGCCGTCTCCCAGCCGTTGTTCGGGTCAATCCAGTTCACCTCAAACCGGCATTATGGCGGTCCTTCAGGGCGCTGAAGCTGTAGCGGAACGGCGCGCCATCATCCGGCATCACCACATTATGCGGTTATAGGTCCACGTCTTATCCCACGACGGTCCTGTTGCTGCACGAACGTCAGTCGTATGCCCGTTCCATACCGGCATACAGCGCAGGCGCCGAGCAGAAATCGCTGAGCACATCCACGCCTTACGCTCTGTGTCAGGTGAGCATTACAGGTGATGCGCGGCTCCGTGCAGCCAAAGCAAACCGTCCGGCACTGACTGGTCGCAGTACTGGCCGATGACATACAGCGCCCAGCTTTATCCCACATCCGCAGCATCACAGACGTTTCCCCATGCCCGTAGCGCGGATGGGTCAGGCATATCCACAGACACCCAGGCCATGTTGTGCTGTATGCCCGGTTAAACGTTCCGTCCCAGATCTCGCTGTATTGCCGCGTCTTGGATTATAAGTCGGACGGCACCTGGCAGAATACGCCGGCAGATGATTACGGCTCACCTGCGGCTGGCTGCCGAACTGCTCCGAGTCCACCTGCACGCCGACCAGTGCCGTGTTCGGGAGCACTGTTTCACATCGATGATTTCAGTGTATGACGACCAGCGTTTGTTCTGCAGCACTGGTCGTGTGGTGCTGTCCGGCGTCATCCTTTACGGTGCGCGTGCATCCGTACTTAAACGGGCGCTATGCGGCGTGTACCAGGCTCCACCACCGAGGCCAGATACTGCAGGTAGGTCGCCTTAATGGTGATGTCTTTTCCGTCACCCAGCCACCGTTACGTTGTATCTAAACCAGCAGGCGACTTCCGACGGATTCCTGTCACCCTTTGAGGTGGTTTCCACCAGTGCCTGTACACCCGACTAAAGCGCGACGGTCGATGTTTGCAGACGTAATGGTGCGGGTACTGCGGGCGTCATATTTCACTTCCGTACCCAGCACCGTCTCGGAGCCGGGAGGATCAAATCCCTCCGGCGGAGTCGTGGGACTCCTGCTCACCCAGCCCCGGAACACCAAGGGTGACACCGGATATGTTGGTATTCCCCTCAGTGTCCAGCACCGGCGTACTGTTCAGCAACGGACCCTTTTAAGCCCATCCACCGGACTTCAATCGGCCTTCGCTGATGGCATCGATCACACTCAGCAACTGCGTGGACTTCAAGGTTTTCGCTTCGCGCGGGGTATCCCCTTACTGCTTCCTTTACCCATTCCTCACGCTCCATAAATGACAAAACCGCCCGCAGGCGGTTGCGCATAAAACATTTTGCATCCCTCATCTAGACCAATCACACAACCTGACCACCGTCCCTTCGTCCTGCCCCGATTTCCGTGACGACTGGAGATCCACGATTACCCTAGCGCATTTCCCGTACAGAACAGGCAGAACATTGCGGCCTGGCAACCATGTTATCCAGTGAGGAGAAATAGGTGTTGCTTACCGTATCCGTTGTCTGTACGGGGGTTCCCTTTCGGTGCCTCAGCATCTGCGCCACACCACCGAGCACCATACTGGCACCGAGAGAAAGAGCATGCCGGTCATACCACCGGCTCCAATGGGTGCCCCATGCTGCAAGGGTGGCTCCGGCGGTAAAGAATGATCCGGCAATGGGCGGCAGCCCCCAGGACAATCTGGAATACGCCAGCCCTGACTTGGCCCCGGCGACTCTGGGAACAATATGAATTACAGCGCCATCAGGCAGAGTCTCATGTAACTGCGCCGTTAACCCGGACGTGCCTGACGTCCCGCCCGGCAATCCGTACCTGATACCAGCCGTCGCTCAGTTCTGACGAAACGCCGGGAGCTGTGTGGCCAGTGCCCATCAAGCTTCAGCCCCCGTTTTCACGAAGGTCGATGCGGCGACCAAATCGTTGTAAATCCCGTAAAGGCAGATGCGCGCCATGCCGCGAATGATAGAGGAGTGTGCGTCGCTGCAGGATTTGTCGTCGCTTACCTCTCGTTTGCTCAGTTGTTCAGGAATATGGTGCAGCATAGCCGCCGTCGCCGCAGTAAATTGCGGCGTGATTCCGGCACTGATGAACCAACAGCACAGCAGCACATCGCCCGGCTGTGCCGTGGACAACGCACCTGATACAGCCCCGTCGCCTCCAGATTATCCAGATAGAGATTCTCTGGCCGTTACGCCACCAGTCATCCTCACGATGAAAGTCCGGCATCTCAATCCCGCCAGATATGATAAGCAGCATCCCGGAACAGTGTGTGACAGTCCGTCACCGTGCTCAAAAGCGCCGCCCGGTGGATGCGGCACAAGGGAACTTATGAATCGTCCTCCCCGGCAGACCAGCCACCACGGCAAATCACTCTGCACCTGCAGCCGCCGGTCGAGCCACTCAGCCAGAGGCAGACCACCCGGGGTGGCTGGTCGAGACCAGCGCCAATCTCATCCTGCATTTCTGCCTGCAGCCCAGTCTTCCGGCGACATACGGAAATACGCCTCCGGCTCACCGGAGATATTCACGCAGGGAAATATTTCCGCTCCCGGCGTGAGTCACGAATGACGCACGACTCCGCTGGCGCACATCGCCGGGCGTGCGGCCAGAATCATGATTCTGTCGTCTTGTCATGGGATTTACTGCGAAAGTTTGTTAATGGAAAGGAAACCGCCAAAGTTGCCGACGTTATTGCTAAGAACTTACAACCGCTCAGGCATTTGCTGCATTTATCCTTCGTGATATCGGACGTTGTATGGTCATATTCACGGTGACAGCCGAAGACGACCGCTATACCGCACTCGTCACCGCGATAGTAGTCCAGGTGCAGGTGTTGGCCAGCATGATACGTCCCGGAAAAACAGCGCCATCCGTTTCCGTCGGCGTGACAGTACAAAGGAGGCACTCACCGCGCTCAGTTCGCTGCACTGCTCAATGCGCCAGCGGCTGATCACCTCCTGCTCCGGATCGGCGTAACTGTTTCCGTTGTATAGACGAAGTTCACCGCATCCAGAGAACGGGCGTAAACCTAATCGCCGGACCACCCGTTCCGCCGACCAGACTCTGCATATCTTCCGCCATCCCGGTGACCATACCGTACAGGTTAGAAACCCGTCAAGCGTGGGGCGCGTGATTAGCCTGGGTCCTTTGCCATTCAGTTCAAAACCGCTCCCGCGTAGAATGGGATACGGCTGATATATACTGTCGCCCCCTGCCAGGGACCGGCTCAGCTTTTCGTTCTGCTCATTACCCGATAAATAACGTTCTCCACCGACCTCTGTCAGGTCGATTTCCCGAGAGCACCACGCTGGCCGACTGCTCCGCACGGGTGCATTCATTCAGTGTTTCCTGCCGGATATCCTGCATCAGTTCACGCCTGTTCAAACTCTGCCTACAACTCAACACGCAGCATACTGACCCCGGGACATAATAGGGTTCACAGGTCACCTTTATCTGCCGCCCTCATAAGGCGGCGTCCACAGAAAGATTTCCAGCCCCCGTGCTCTTCCAGAAACGACCCACTCCAGTACCGTGGCCTCCTCACGGGGGACAGAAGGCGTCACGCTGTACGTTCAGGTTGGCATTCAGCCGGCAGGCGCTCGCTGAGAATAGCCATCACCAAAGCGCACCCTTTCGTACAGAGACGGGACCGAAGCCACATCCATAAGGTATCTCATTTGCTTTCCATGGAAGGTCTTCATCGTCCACCTCCGGAGAACAGGCCACCATCACGCAATCTGTGTCTGAATTTCATCACGGCATCCTTGCGGTAAGTCAACACGCGCCTTCAGAGCAGCCGTACTATCTGCCCGTTCCGTGCCGTCGTTGTTAATCACATGCTGGTTATTCTGCTCAACGTCCCGGACGCCTGCGACCGGCTGTCTGCCATGCTGCCCGGTGTACCCAACATAACCGCCGGTGGCATAGCGCCGCATCAAGCCGGTGAAGAAATTCCCCGCCAATCCGGCTCGTTGCCTCCCTTCGTGAAGACAAACTCACCACGTGAACAATCCGCTGGCTCGTTTGCCGCCGGTTCCCGTAAATCCTCCGGTCCAAAATGGAATTTCGCCCGCAGCGGCCTGAATGGCTGTACCGCCTGACGCGGATGCGCCGCTCAGACCACAGCCCGCCAATGGCGCTGCCGATACTCCCGACAATCCCACCATTGCCTGCTTAAGCAGAATTTCTGTCATCATGGACAGCACGGAACGGTGAAGCTGCGCCAGTTCTGCTGCACTGCCGTCTACAGCATCGCCGCCAGATTCTGTGCAATACCATCAAAGGTCTGCGTGGCTGCACCTTTTTACTGCGACATACTGTCCCGTGGCGCTCTTCCCACTGCTATTCCCAGCCGGACTTCAGGCCTGCCATCCAGTTCCCGCGAAGCTGGTCTTCAAGTCGTTA
>3
GTTGCTTGTGCAGGTTACAGGATCCGATCTGCTCGATCCTGAAGAATTTGCCGAGCCCGAGTGGACTCGCACTGCCGTGAGGCATCGAAGGCAGTGCAAGTATCGGAAGCGGAAGCATTTCACGCGTGACGGATCCGGATTGAATGGGTAATCGAAACGCATTCCATCGAATGGCGCACACTCGACCCCGCGAACTTCCACTCGGACAGCACCAGAAGCGAAATGCACCTCACGTAGGAAGCGTATCCTGTCAACGTGGGACGCCTTAAAATGAACTAAATCGACTGATCCACGCGAGGTCTAATGGAACGTTCGGATCTTGTTACGCCTGACCGGAAGCCGAATGAAAGGCGCGAATGGACCATTTCTTGTTGTTCGCCATCCTGAGGAAGACTCCTGTTGACTCAATGCACTGGTACCGGGAAGAGTTCCGGCAGTTAATCGAACAAGACCCGTTAACTATCGACTATTACGCATCGCTATTACGATTGGCAATCGTAATGGCCTCTTCTTCCCTGCGACTTCCTATCTGCATATGATGTCGAAGGAAGCGTGCTCCGCATTCATTAAGGAGTGAGATCGGTTTATACCAAAGATAACGCTTGTAAAATGCTGGACGATTTCGCGTCGTCTTCACAGCGATCCCAGTACTGTAGTGTCAGATGATGACGTACTCAACATCGCTATTGACGTATCTTACTGTTTCTTTACATAAACATTGCTGATACCGTTTAGCTGAAACGACCATTGCAAGGATTTATAAATGAGCATCGATGAGTCGGAGGAAAACGATTCTCCGTAGTCAAGTTAGAGTCGCTTCCTGCAACTACGAATGTTATGTAGATGAAGGTATAGATAGAGTCGCTACAAATATTCAATAAAGTTTATAAGTCGGACTAAATCCCCATTCTGCAATGTGCCAAAATGACTGATACGTGCCACGTGGTGACTCAGAATACGTGGGAACGATACTTGCCTCTGTACAAACATAGATGATTAAACCCAAGAGAAGAAGACTCCGGGATTAGATTTCTCCCACTCCCTCCGGGTTTGTTTATGGAGATGATAAATGCACTTCCGTACAGAGAAGTGGAACCGAGCCATTCAACGAGTTATCGAATAGAAGTAACGACTGATAATAGACGGGTCGATATGGCCAGGTAACAGGACGTAACCAATATTCGAATTGAAGAACTCAAAAGAATACAAGCCGCCTGATGGCTTTGGTCGGGCACGCGACTTTGCGATGTACTTGACATTCAGGAGTGGAACGCACGCCAGCGACGTCAAGAAGCTGCCATCGCTTCCTTCCTTCCGAATGCATATTCCCTACGGTTACGAGTCGAAGAGTATCTGTTCCACGAATCAGCGGTAAATTATCAAGTGGACACTCGACAGTAACAGGGCGTCGAAGTCACGAACGGAAGTGAAGCTTAGCTCGGATTTACCTCTAATTTATAAGAACAATGGATCATGGTTCGCTACATGATCAAGACGGGTAAAGAGTTTGGATTAGCATAAAGCGAATCGCAATCACTGAAGCTATACAGGCCAACATTAGTTATTTTCAGACAAACAAGCCTGACAGCGAGAATCAAATACTTCGCTTCCTTCGCTTCATGGCCTTGATCGCTACGAAAATCCTGACGGGAAGGAAGAAGACTAGTTAAATAGCAGGACTTAAAGCAAGCTAGGCGATGCCTGATCATCGACTTGAAGACCAAAGGAATTGCGCTGAATGCTCAATGGATACATAGACGAGGCAAGGCGGCGTCAGCCAAGTCAATCAAATACGGCTAGGCCGGATCGGTCCAAGAGCTGAAGCATAACAACAAACCATGTGCCTGCCTACGAGCAAATCAGAGGTAAGGAGATTTCGAAGAAAATTTATCAAGCATAAGAATCATCAGATGTTGGCTCAGACTTGCAATGGAACTGGCTGTTGTCACGGGCAACGAGTTGGTACTTTATGCAGAAGAAATGAAGTGGTCCTGATATCGTAGATGGATATGTCGTCACAAAGCAAAGCTTAGGCGTAAAATTGCCATGCCAACAGCATTGCATATTGATGCTCTCGGAATATCAATGAAGGAAACACTTGATGTCGTCAAAGGGAAGATCGGCTAAGAAATAATTGGATACGCTTCGTGCCGAACCGCTTCCAGTATCGGGTTTTATGCGGACGAAAACGGATCAGGTCTTTCCTTCGAAGGGATTCTAGCTTTTCACGGTTGCGCAGTTTGTCTGCAAGACTCTATGAGAAGCAGATAAGCGATAAGTTTATAAACATTCTCGGGCATAAGTCTAGACCATGGCATCACAGTATCGGGCAGAGGAAGGGTGGACAAATTGAAATCAAATAATACTTTATTTGACGGTGACCTGTTCGTTGCAACAAATTACCAATCGTTTTATAATCCCCTGCTCCTGAACGGAGAAACGTAAATGATATAAATATCAATATTAAATCGATTTGCATAAAACAGACTACATAATACTGTAAACACAACATATGCGATCTATGAATCAACTATTAGTATTAGTACTGTGACAGTTAATAGGAAGGTACTTTATTCTTGCTCAATTTTGTCATCAAACCTGTCGCACTCCAGAGAAGCACAAAGCCCCAATCCAGTGCCGACCTTTGTGTGCCACCTACGACCTGCATAACCAGTAAAGAAAGACCATTCGTACTGTCGATGCCTGGGACGTATTCTTTTCGTTGAATAAACTTCTAAGACAAGATTAACGGTACTTTCTCGCCATAACTGTAGTGAATGTCGTTATAGGCGGAGCGAAGTTAACACTTGACGCGGAAGGATTAGCTATCTATCGCTTATTAGTACTTGAAACGCTTCTTCAGAAGCCTGAAGGCTAATCGTTTGATGGGGTCTATGCATTAATAGACCACTGACCTGTTGTATAAACAGTGCACCATGCAACATGAATAACAGTGTGGGTCTAGGAAGCAAGCTCCCACTCTTCCGAACTAATACGATGCCCCGTTAAGTTCAATACTAATTTGATGGAAGCCGAAGAGGAGCATATAACTTAAAGAGGATCTTGTTGCCGCCAAATAAATTGCGGTCGTTTAATAAAATTAAGCGTATATATGTTGGGATTTAGTTATTGAAATAGGGTATTCCTGCAGTAGAAAAATAAGGCATTCCTACGAGCAGATGGTCCGAATGACTATTCCTTTGTCAAATGTTTTATCTTGAGTTGTTAACGACCGTGAAATGGCTCGAAATTGCCGTACTTCCAGAAGGAAGCACGACTTATTCATTAATAGATAAATTCAGTCAACTCCTGAAATGTTTCCTTGACGTAAGCAGGCTTATATACTGTTGACTCAAGGGTCTAGCGATGACTTTAACAGACCTTCTTAAAGCTATTCAGGATTTAGTAGTATGTAAAATCGATTAGCCAATAGTCCAAAATGAAAGCGTCCTTAACAAGTCGCCAGCTCTTCGAGGCGTCAACTCGTCAAAATCCGAAGGAATTTAGTGTCGACGTCATTGCTCGCACGTATAAAGGGGTTCGATGCTTCCTTCCTCCTCCTTTCGGACCTTGCGTGCACTGCTAAGCGCAATTCATGCTTTGACGGCCGATTCTATTGGGACTAACGGAACATCGTTGCGAGTGGAAGTGCGTGGACAATTTAACGACGCAATAGATCGACACTGAATATTTCTCTGAAAATAATAGACTTATCGAGTCAAGAATCCCAAAGGAAGATCTGGAGATTGCTTGTTTCAGTTCGTTTAGTGCATTTGATCCTTTTACTCCTCAAACTCATCTCGAAAGGTACAATACTTTATATTGACTCAAGAATGCTGCCAGCAATAGTTTAAAATCACCCGATCTCCCTTACGAATTCGGGTTTACGGATTTATTGGTTGTATGAGTAGATAGAAAGACTGGCTTGAATAGTAAAACGGATAGTGATGAACTTTCAACAGTCGAGAAGCCACTTCATTTCTAATAACAGGATCAGACGTAATGAACACAGATTCAAGTGACGATGACGCACGTTGACAGGTCTAACTCAGAAATATCTGCTTCGAATGGCCTCCTTCCGATTTCCTGTTATACAAGATCGTAGATGTGTCGTGAAAGGTCATTAGTTTTATTCAGTGAACCAGGTTTGATATGCAGTCCACTTCTCTGCTTACGGAATCACTAATGTTACCGCCGATGCACGCCAATGGTGTAGCAATAATTGCGACTCATTCCCCAGTAGTACTGAAGAGATTCCAAATCCTGCATGTGAAAGTCCACGTCAAGAGAAGCAATAAATATTATCCGTCCCACTTGAGACATTCGGTGAGAACTTAGTTTTTAACTGTAGTCTTCTTTTATTCCATCGCCGTGCTTCCTCACTTATTATCGCACCCGAGCCGATCGGAGGCTCTTGAAACCATTCTAAATTATAATGGTCATGATAGGATTAGAAGGTCGACCGTTTAAAGCGATGATAATGAACAGATGAAGGTAAAGTACAAGTAACGTCCGCGCTCCAGAGAACTTATAGCGAAATGCTTAATAAATGCTCGAACTATTGCAGATAAATCGAAATAATTCATTATACTTCTAGGTTTAAGAAGAACGACAAACACAGTAGAAGGAGGCAGCCCGACATATTGCCTCTAACACATCGTAGCCACGTGTTGGTACGTAACAGTTAATTAGAAAAGCTTTGAATAATCTCGAGATAAAACAATTAGAACACACTATTACGAATGATGGTGTTTCATCAGGTAAAATGTCATTTTGGTAGTAAAGACAAGCTATAATCATTTCTTCTATTGCACATTATCCTGAATTTTGGTGATGCCTATTAATTTATCCCACTCGAGGGGAAGCCAATATGGAGAAAGTCAAGTTTTCCTCGCACTCCTGGCCTCCAAGCAATGGTTCGTATGACATCAACATTTTCGTAGCAATGGGTGCAAATTTCGTTTCTAGAACCCTGGTGCTCTATCAGTTTTATGTTGAATGCCCGGCGAACTGGAGCTAAGGCAGGAAGACAACACAGAGCTCTTCATCATTTCTTCGACTATTAAATATTGCTAACAGGTATCGTTTATAAGGAAGGACTGAGTGATCTACGGAATGAACTCTTTCGTAAAATTATAAGGAATAGGTCGACCGCATTTCCCCTCGCGTCAGAATTTATTGAAGCAAATCTGAACCTATTATAGATTTACAATGACTTCCCCAATTATTGGAAGAAAGAGTTATGTATCGTGGGACTCGAAGATTTTCAGGGATTAGAATATGATGAAGACAGAGAAAATTACGACGGCTTGGAAGGAACGAATTTTTATGGGGGCTGTTTTACAAATCCGGTGACTTGCTCAATTCCAAATCCCCTTCGCTTCCCATTCCACGGCAGAGAAGGACGTTTGACTTGTCCTATGGGCAAGCATTTAGGACAGTGGATCAGTCATAGATGGTCGTAGAGATACAAATTCTCATGCAAATATGTAAATCGGTGAGACTGAAATCATTCACTGAACAGCACTATCGAAGTTCACAGCCCGAAGCTGCAGAAGCTGGGCCCCATATCTCCTATGACCGGCTGTTAGCACTACAAGCCAACTCTAATTTTGATACATAATGAATGATAATAATATTAAAACTTCCTTGACTAATTTACTATTCTGATAAGAATCATTGCACGTAAATAAATGTATTACATTGACAGTTAAGCAGTTGATTTATCACCTCTAAATATATCAGCATCAGCATGCAACGTAGACTTAGAGAGTTTATGACTAACGGAAGAAGCAATGATTTATCTCGACGTGCTCAAATGCTGCATTGATACGACGTTGACCTGAATTATTTCGCTTGAATTTGAATGTTGACTTCTCGGAACCGCAGAACAGTAACATTTATTATTCAAAACAAACCAGTCGCGCTTCTCGTTGGTAACAATAATGTTATTGAAAATGGAAAATGATTGACCGTGACGCTTGGCTAAAATTCTTCTACAGAGGAAGCGATCTAGACGAGCAAAGGCTCTTATTTCATGTACATTGAAGAAAATGACATTAGTCGATTTATTACAAATGAATATGTTAACATTGGTAACAGTTAGTCAGACTTGCACAAAGAAATTACCTTCATATTTAACTGAATCATCTATTAAATCAGAAAGACATCGTATAGATACCTAAAGTACCCCGTATCCCTGCTCCTATAATCTATGGCAGAATGTATAACTGCTGACTCCGAACGGAAGGAATCAATGGGTGACGATGTGATTCGCCAACATCATTCGACTCTTTATTTGATGAAGCCAGGAGAATAACTTATTTAAATTAAAAGATTACTCCATAAGCACGTGTCATTTAGCACGTAATATGACAATAAATAATTCTGACATGAGACCAGCGTCTAAACTGTAGATACTAAAATACTTCGACAGAAGTCTGGAGGCATAGGAGATAGACTTTTACGGTTGCCTCCATTCAACATTAATTTGATAAATTCCATCCAATTGATTTAATCAATACAACAATTTGAAGATCAAGCAGATAAATATACTTTTGGAGGTTGCAGCTGACAGCCAAAATACAAATGCCTATGGCCTTCATTCGATCAGGCTGACGAGGCAAGCATCTACTCAATAAACCAATGATACATACAATGCCAATTAGATGAAGCCCAGAAGGAAGAATTGATTCAAATAATAATCAAATATTCCTCCGATAATTCGGAACGAAGAAAAACCGACTTTACGAATATCAACAGCAGACCCTGAACTGACGAAAACATATTTCATGCGTCCTGTTAGTCTAAAGCATTGGCTTATGTAACACTGAACAATCGATCATAGAACTTCTCATTATTCTCCTGAAGATAATAATCGCCAAATAAACCAATACTGAGCTTACAATATACTAACTAACGGAAAGGCTGCCGAGACGTTGCGGCCATAGAAATGATTACTCATAAGGAAGCACCGACGACCTAAGGTCCGATTCCTGTAACTGACCATTCAGCACCCGATATTCTTCTGCAGCTTCCAGCAACGAGGTTTCTTCCTTCTGTTGCAATTCCCAGATCTGCAGCATGATCCTGAAGCCTCAAATATGCTCACTGGCCTCTGCATCAGGCCTTACTCTCCGGCAGATCGAACAGTTTTTCTGCTTCTATCCTGCTTCACGAGCGATCCGTTCCACTTCTGGGTCTAACTCCCGGCTATAACCATAGAATTTTCTAGTAAAACGCGTCAGGACTTCTATCGCTACTTCCGATCGAAGCTTAAGACATGTCATAGACGCTTTTACCCGATGGTCTTCAACGGAGATCCTAAGATCCCTCATCACTGTTAGGAAACTTAAATCCAGTCGGAATAAGTCTCTTTTGAAGTCGGATGCAGGCAGAAGCCGCTAGTATGAGGCGAAACTATGCGTCACCTTCACAATAAATTCATTAGTTCATAGATCTACTTTATTTATATTGTTCACTCATTCTAATCCATTATGCAAGCCTCAATAGGTTAAATCGAATGTTTTACTTCCACCGTTGACGCGGCTTGCTCCTGCTGTGTCCTTTGAACCAATACTGAAGAAGGAATCGGAAGCCAAGGGTCAACCGTAGATGTGGGTGCCTAGATACGACTGTATGCCTGAAGTGTAAGGCAGCCACGCTGTACCGGACAATGGCTGACTGTGGCTGCCTGACTGTCCGTTTCGATAAAGCCAATACTGTGTGCTCCATTCCTTTAACTGTGATAACTTCTTAATGGTTGCTGTTCCATACTGACTCAGCCAGAACTGTTCATCCTGAATAGACGTCCTTGATCGAACGGCGCCCGGCCCTGTTGGAGATCCCTCCGCGTGTTATTCGTCGATTTGGTGCGTAATCGAAACTGCCTGTCGTTGCCGTAATCAAACGACGGCTTGGTTCTTTAATGCCCAAATCGATCCTAATGCGACGCGCGTGGTGTGCGACCTGTAATTCCATCCTGTTACAACCACATGAAATGGCTCAATTCCCTTAATTTAAGCCTCGCATATTAGAAGCACAGTAGGATACGCGACAGCAAGTTGGGCTCAACGTGTCC
>4
GCTTACTTCGTAGTGCGGCGTCTAATCCTGCTTTGAGGCACTCGTGTTTCGCCTGTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCTTCTTCGTCAGACTTAATGTTTATTTGCCAAATACCCTGAATGACCAGGAAAAGGACAGTGAGCTGAAACGAGCTTTGAGCTCGTCGTTCCTTTCTTCTCTGTTTGTCCGTGGAATGAACAATGGAAGTCAACAAAGGCAGCTGAGTGAACATTTTCGGTGCGAGTATGGTACAGTCACGGTTGAACGCAGAAAGGGAGAATGCCGTTCTGTGAGTGGCGGTGGCAAGGGTAATGAGGGGTGTTATGACTCTTGCCCCGCCGTCATAAGCACAAATGGTATGCCGAAGGGATGCTGAAATTAGAACGAAAGGTAGGGCGATTGAGAGTGAAGCGAATACAGGGCGAGGCAGATCTCCAGCCAAGAGAACTATTGAGTACGAAGCCGACCCTTACGCGTGCCGACTACGCACAGGAACTCTAGAATGCCAGACCCCTATATGCATTGAAGGTGACCGCATTCTGTACTTTCGTGCTGTCGCGGATCGCAAGCCCAAATTGCCAGTATTCTCGACTCCTGGCCTGTCTATGCACCGGCGTTTTCGAACTGGAAAACGACATGTTGATTTCCTGAGAACGGGATATCATATCAAAGCCATGAACATAAAGCAGCCGGCCGCTCATCTAAGGTTAACCTGATAATGGTAGAGCCCCGTTAAAGGTCGCTGAACAGATTTAAAGGGTTCTAATAGGTTCTGAAGCTCGCAGATCTACGCCTTTTGTTGATCCGTATACAGAATGCCTAATCCTATCTATCTCCGAAAGAATCACGCATACCAGGAAGGGCTCCGGGAAACACTGCCTTTCAAGATGGGCCATCAGAGTTGAATGGGATCGCAGCGACTACATCCGGTCAGGTGAATGTGAATTATTGCCCATGCGTCGGTTATTCAAAAGTGCTGCTCTGTTATCCCTACTTTGTTATAGAGCCTACGCAGCAACATGTATCGCTTGCCGACGATGTGATGCCCCAATCTTTATGAAATGACGACTTTTACCACTGGTTCGTGATATTCCGTCGCCTGCTGGCCTGGCCTAGGTCTGGCAAAAGCACCGGGATAACACTCACCATGAAGCGTTCATAAGTACATGCGTCCTTTGATCTCTGGCGCCGTAGCAACCGCACTCTAAATCCAAGGTGAATCAGTGTGAGGTGATCTTATATGATGACTTGCTGCTTTTATCTACTCTTGACAGCCGAAGCTCTGGACGACGTTCTTCCTCTGGGACACCGTATTGAAGCTCGGTCTGTAAAGTCCATCCGTGGCTCCACGCATAATGAGAGCAGGTGTCATACGTGTTGGACCCTCAGTGAATCCGCAGGTCCATTTCATGTTGCCTGCCGCATTGCTGGGGCAGTATCTTAAATTTGGCGACAAAGACGCCGTTTTGGCTCAAATGACGGATCACGACCGCCGTGTTTATCTCCGGATAATGCCTTCTCTGCCCACCCTTCAGCAGGGAGCTGACTTTATGGTTGCCGCCGTTATATCTTAGAAAGACTGGCACGCGTACTCCGTGATGGCATTCTCTGTTTTCGTCATCCGCTGAAGAGATTGAGCCTGACATTATTTTCACATCTACGTACAGCCCGTTCTACCATAGGGCTCTTAGATTGTCAAAGACTGGATGAAACGAAGGGGATACGGGAAAACGTAAAACCTTCTATAAAAGTACGCTGTGAGACGTGAGGAAAATTAGCGAACGTTATCGGATGCTGACAGGTATCTAAGCAGAGGACAGCATTATTCATAGCCGTTCCTGACCGTGGCTTATCTATGACCGCTGTATCGACTCCCAGCTGGACTGAGACGAAATCCCTGTATGGCGATGGGGCCTGAGGAGAAAGCCTGGGTGGTTATCGACCATTATTATGGGCCGCCACCACGATGAACAGACGGGTGCTGCGTACAGGTGGGGCCATCAACTAATAAACCGACCGCCGGAACTTAAGAAAGTGTCGATATCCGTATCTGCTCTACAACCTGGCGGGATTGTACGTGACCAAGCTATTGTGTGGACCTCCGGAAAAACATCTGGTCCGTGATCCCCATTAAAGGGCAGCGTAGTTTACGAAGCCCTGCGTCCAGCATCCATTAAGCGAACAAAACGGGGTTATTTACCTTGAATCGGTACTACGGATACCGCGAAGGACAGAGCAGATTTTAACCGCTTCACACTGACGCCGAAGGGCTTAAACCGTTCCCCTGCCTTCTATATGGTTCCGGAATAACCGATATTTTGATCTGACGGCACGCAGCAGCTATGACTGCTCATGCAGAGGTCGAAAAACTATCAAGGAAAGACCGTGTGCTAGACTAAAGCCCGCAACTGCACCCGACTAACTGACGGTCTCATGTTTATGCTGGCGCCTAGGTGCGCATCAGTATTTCCCGCTGGCAGCTGGATCTCAGTGTCCTGCTCTCCGAGGCCGCTCTGCAGGAAGAGGATGGTGCATACAATAGTAACAAGAAATAGTGGGCAGATTACGCCGTGCCTTATCCAGCCAGGATGAATCTGACGACAGGAAGAACTTGCCCTTCATGCGCTTTGAGCACTCTGCATCTAACCTACTAATGAATATATGAATCAAACGCTATAGGCAAAGGTACAGTTGAATGACTAACCGTCTAGTTTGTATCTACCGCAAAATATATTGCAAGGCAGCGATGCAGACCGGCGGCATGAATACAGACGCACCGAGGAGCAACCTGCAGGATTTTTATGTGAAACGCCACCATTCCCATTCTGGATCGACGGCATGACGGCCCCGTAGAATATGCAGCCGGTTATACACGGCGGCGGTGGCAGCTAGGATTTGGGCGGGGGAGTGGTTTGCGGTCGTGAATCGTAAGGGGTGAAGGATGCTGCAGCCTGTCCGCCAACTTTACCGTGGCAATTGACATGCCCGCGCAGACCGATCTACCGCATAATAACGGCTATGCCGCCAACGCCATCCAGCTGCATCAGGCATTAATATTCTATGGCCTTGTCTTTCCATCTATCAGTCATCGCCCAAGCTGGCTATCTGGGCATTGGAGGAAGAAGCCCGTCTTCCGTTCGCCGAGGTTGAAGCGGCAAGCATGGAAAGAGTCCCCATGAAATATGCTGCCTGCATTGACGACGTTGAGCGACCGCACGTTTACCATGATGATTCGGGGAATGTCTCATGCACCGCTTTAACGGTGAACTGTTCGTTCAGGCCTGGGACCAGTTCGTCGCGGCTTTTCTATGGTAAGACGCGTCGGATGGTCAGCCCGAAGCGCATCAGCATCGCAGAACAGAATGACAGCCGGCGGACAAGTGCCGTGCCGGTGTGCAGATTAATGACATCTAGGTCGGGCGGTAGGGGTTACGTCACGACGGGTATCCTGGCTGGATCCGCAGAAATGACATGAACCCCGAGTTGAGTCCCGGCGGGCGCGCGCCTCGTTCATTCACGTTTGAACCCGTGCGAGGACGGGCAGACTCGCGGGTGCAAAATGTTTTACAGCGGTGATGAGTAAGATGAATAAAGCCGCACGCTGCATTCCAGAAACACGCAGCTGCACCTAGGCGCCATTGTGAAGGCGATGCTAGATACGCCATTCATCATGAGAGTGAGCTGGATCGTCACCCGTCAGCGATGGATTTATTCTGGGGGACAGTCGGAGCCGCCCGGGAAGGACGGGCCTGGATTGAGGAAGTGCCGCGTATTACGCCGCAGGGCCCGGGTCCGGCTGGGGAGGCAAAAGTACCGCACTGATGCCGGTAACTCACTCAACCTGCAATACGGCTCAGGAATACGGATAACGGCTACTCGTGTTTGAGTCACTGCCTTGAGTCCGGGGGTATACATGCTGCTGGGTGTCTCGTATGACGAGCTTTCCGGAATTACGCCCATACCACCTACCACGGACATCAGTCGTGGGATGACGAGTCCGTGATTTATCTAGGCGGCCAAAATTCGTCGCATCCAGTCAGGCGAGCCAGATGTTCTTGCTGGAAGAGGCCATCGTTCGCTGTGTAGACTACTTTGTAAATTCAGCGCTTCAGTTTTCAGGAAGCCCGTGCATTGCCTGGGGAACTGCGACTGATTAGGCTCCGGTCGTATGGCCATCGATGGTCTGAAAGAAGTTCAGGAAGCGTCCGGCTGATAGAAGCTGAACTGAGTATGGACACGAGAAGTCTAGGACCCCGGTACCACTATCAGGAAATTTGCCCAGCAGGTCGTGAAACGATGGAGGCGCCGTGCAGCCGGTCTTAAACCGCCTGGGCGGCTGCAGGAAGAATTCCGTGAGTTGCGGGCTGCGCCGTAGACAAGCACAGAGGAGAGAACCAGAACTACCAGCTGTAATAATCTCCGCATATTGCCACCATGACCGTCGATGAGCCTAGTGATGTTGAACCCTATTCCTAGGTTTATTTCTTGCTTGCAGGCCAGCTTGGGATCAGCACTGACGATCGTGTCGGCGACGACGCCTGGTTAGGAGGCACTCGCGACGGGCATTATCCGGTATGATGACGCTACCAAGGACAGTAGCCGCAGTTATCAGTCACTGAACGGCATCGCCGTCGGTGCCGGTGTCCGGCACGACCTGGTCAGCCGGACGCGGGCGGCGCTGCCGCAGCCGTACTCGAGATGACGGTTACAACGGCATTATCGCCGTCTTGATCGCAACAGCTCGAGTCGGATCCGATCTGACGCATTCTGCTCGATATGGACACGCCGGCGCTGACCGCGCTCGGCGGATTTGAACTGCGCTGACATCATCGCCAGTGCGTAGACAGATAAAACCCGGCTGTGCCCCTCAACGACATGAACTGTGCATAGTGCAGGTCAGTCCTGCTCCTGCTTGCCCGTTGCCGCCTCCCGGCGTCTGGTCACGCAGACAGCGCCCGGCTCCCACCTCCATCGGCGTCATGATGAGCTCACAGTAATTACGGTGCTGCTGGAGAAACAGGGTGGAAATCACGCTGATTTACAGCGGCGGCCGCCATAAGGTGGACGGCATCGCCTACAGCCATCTTCCGGATGACGTCGGGGAGACACTGCAGTCCCGGATGGACGCAACTAAGAGATGGTTTGGAGCAGAAGGGTGGCATACCGGGTCCGTGCAGGCTTGTGCTCGATAGCAGGCTGCATGTACAGCGGTCAGGAGGCCATTGATGCCGGACTGGCTGATGAACTGTTAACAGCACCGATGCGATCACCGTCATGCGTGATGCACTGAGCTTACCGCACGTAAATCCCGTCTCCCACAGGAGGCGAATACCCAAAGAGACTCAATCACCGACTGTTTCAGCCACTGCTTCACCGAGCATGACGTCCTGAATGACGTGGTGCTCAGGCGGGAGGCGAGAACGCCGCACCGCTGGGCGCAGCCGGAACGACGCTGCTAAGAGACAAGTACCGCAGCGGGTCTGCGGCAGAAACAGCGCATTATTATGGGGATCCTCAACTGTAGGGAGGCTTCACGACGCGAAGTGAACAGGCGCGTGCTGGGCAAACCCCCGGGCTTGACCGTGAAATAGCCGCCGCGCATTCTCGCCGCAGCACCACAGAGTGGCACAGGCAGCGCAGTACTATGCGTGGAGTGTACTGTCGTCATGCAGGGGCCGGCACGCTGGCTGCAGGTAACCCGGCATCTTAACCTGCCGTTAACGATTTGCTGAACCACACAGTTGTTTACCGAGTGTTGGAACGAGCAAGAAGCTTTACCGAGTACCAGCCGCAGGGCAACAGTAGATAACCGTAGAGCAGACCGCACCCCGGCGGATTTGAGTGCGACCGCCTGCAATACGACCTGCTGAATCAGCTCTAAGCTGCCTCTTGCGTGGCTTAGCAGCAGACGGTGCCCCTTCCGTTGGCATTCTTGCGGTTGCTGCTGACCAGACGCGCCTCGACGTCACTTGCTTAGCACGTTTAAGTCTTGACCCGGTCTTATATTAGGGATGCTAGGCGGCCGAGGCGCCAGGGACACGAGCACAGAAAAACGACCGCGTTTGCCGGGCATGACGGCATCGTTTAGTTTACCCTTCATCAGGAAGGCCGCCTGTTAGACGGTCCTAGCATTTTATGTCGATGTACTAAAGCCGCTAACTGCTGGCGGCAAATGGCCGCAGAATTTAAGTTTACGGTGCTGTTTCCGGTTCTTTTCCGTGAGCTATCCCTTCACGCGACGAAAGTCTATCGCGTCTCAACTGGGACTGGTAAATGGCGCTGTACGGTTTCGCATGAATTGTTCCGTGAGTGTGGCGTTCCCGTGGCGGCTCCACCTCCTGAATTTACGCCCCGGGATATGTCAGCCCGAAGCATGAATGAATCCCCCAAGATGACGCCTTCCGTCGCTTACATGAGGATCCGCAGAATCTGGCGGACCCGGCTTACCGCCGGTTCTAGCATCATGATGCAGAACATGCGTGACGAAGAAGGCTAGCCATTGCTCAGTCGAAGATCGCAGGCAGTTTCTGCCGTCGTGCTTAGGCAAGGCCAAATACATAGAACCCTTGAAGCCTTCGATCCGGTCCAGGTCCATGGCCGCAGTGAGGAATAACATCACGCAGTCCGGCGGCACGGGGTCGAGCACCGTGACAAGGATTAGTGACTGACCGACGATGGACATATCGCATGGTAGGCCCCGCCTACGCCAGCCGTGGCGTAATATCGTGTTCGATTGCGGACATGGGCGCGTTGGAGTCTCGTTCCTTCAAGTCACAAGGAGAAGCTGGATTACCCGTCTTCGTGGCTCTAATTCCGAGCTCAGAGACAGCGTAGAAGATCACTCGTCCCAAAGCGTCTTTAGCTAAGGGGATGGCTTATCGCGATCGTATCTCGTCGTGTATTCGAACAGTACGTGAAACTGACGAGTCAAAGAACTTCCTGCCGGCAACACGCATCTGCTCCGGAATGGAACTGATCACTCAGGCACGCGGTCCCTACATGGCTGCATTCAGGATGCGGACTAAGCGCGAAGGCATTAACGCCTCTGCACCGTTACTCGAAAATCTACTCACGGCGATCCGGCCGTTGAGTTCACCATGATTCAGTCATGATGCTGCTGACATCATGCTCTATGATCGCTGTTGGTCCTTACAACTCGTAATCATCCTTTGCTAGAGTGTTTCTCTGTGGCCAGCGATCATCACGAATGAACTGATTGCCCGTCTCCGAGCCTGGGACTGAACCGTGATGTCAGCCTGACGGGACGAAAGGAGAAGAACCGCTCCGTGTGAGTAAGAACCAGAGTGTGATGACACGGATGAAACTGCCGGTCATAAATACCCTCAAGGGGAAATGTGCTGAATGGACAGTAAACAAATGAGGTGGGATCAGAGGAGCCGCTGAGCGTGATTCTGGATACGTCGACTGGTCACGGTCGTGGCACTGGTGAAGCTGCATAAGCTCTTACATTCACGGATGAATGGTGGCATTTGTGCTGCCGGGACGGTTTCGTGTCTCTGCCGGTGTGACCGAACAGACTGACAGAGCGCGGCCTGGCCAGAATGCAAGAATACGGGGAGGCCTGTGGCTGATTTCGATAGCCTGTTCGTAATGCTGCCATTGCCCGCCGATGAAACGATGGCGCGGGTACTGGGAACGTCAGCCATTACATCCGGTCGCAGCAGTCAGCTTAGGTGATACGGTCGTTGACCTAACTGAAATATCAGCTATGCCGGACATAAGGCGTGCGCGTTGAAGGCTCCATCGCATTTCCTGTTGTTGTCCGGACTGATGAGGTGCGGCAGCTTATCGGGCGTGAACCCGACATGACCATCGGTGGGAAAATTTCTCTGGGTAATTATCGGGTTGGCCGGATGATGGCGGAAGTTGTCGTATATTCGCTTGGACGATTGCCCTGCCCGTTAACCGTCGCCTGAAGGGGGAGTGTGACCATAAAGTCTTACGCAGGCCGTTGAACTCCTCAGCCGATGCCCGACGGCGTCGCTCTGCAGTCCGCAGTAACTGGCCATTAACCGCGTTGCTTCATCCGGAGATGACGAAGTCGGCGTCACAGGTTGCCCGTGAGACAGGACGGAACTGGTAAAGGAAGAGGCTCAAAGGGCCACGTCAAATCCGCGCAGGCCAGAATCAAAGTTAACCGGGGGATTTGCCCGTAGTAAAGCTGAGATGCGGGTTGTCCTTTCGCGCCGAAGAGTTAGTAAACCTGCGCAGCGTTCATCCTGAAGGTGGCGGCACCGTGCTTGTGGTATAACCCTTATTCCCGTTTGGTCGTATTCAGCAACTGAAAAATGATGGGTGGCATGTCATGCAGCGTGGCTGGGAAAGCTATCGAGTCACCGAAGTCCTGTGGTGAAATCCGATCGCTTGGCATCACGACGGCGTTTAAACAAAAGATCATCAGGGTAATACGGCGTATGAACGTCTTCCACGAGCTCCCTATGCTGCAGCATCATCAACGCTCCGGTAAGGAAGCGATGAAACCTCTGAACTCCGTGCAGCCGTACCTGCACTCGAAGAAGGATACGACACCGACGCGGCACGTTGAATATTACCGCGGAGGTTTGGCATACAGCGGATTTCCGGCAGCAGTCCCCGTTATCTCACCGGCGGCACTTAAAGGGTGAAGAGCTGGACAGGGTCATGAGGCGGAGCTGCATATCGCATTTCCTGCCTGCTCATATGCGCCGGATTCAGAGCTGCCATTCTTTGGATGGAGTCCCGGATTTATCCCTTATCAGCGATATCCGGCACTGTCAGATTTACTCTGATCAGTATCTAGAGGCGTACCCGGCGCGACGATGATCGGGCTTGAGTTTCAGCCGATCGTAACCTTGGGTGACCTATGAAGCGGCGTACGCGCTAGCTGCCTGTACCAAATCCCCCAATGCCGTGAGGAAGGTGCCGGGACCAGCGTGGGTTTATAAGGGGAGCGTACCGTCACGCGAGTCGCTTTCAGACGTTGACTGGTCGGTCTGAAAGTTAAAGACCTGACGCCCGGCGAACCTGACAGCCGGTCCTATGACAGCTATCGCCGATGATGAAAAGTGCAGACTGGACGGTAACTGGGGCAGGGCAAGAAATCTGCCGAGATAAGAGTCGCCACGCTCGTCGATGCCCCGCCAGCAGCGGAAGCAGGCATGCTGGCGGTTTAATGGAAGGCGATATGGCGCGTCGTTAGATAAATCCGCTTCGACGCATCGCACGGTCCGTATTGTGTTCCGTGGCTGGGTCAGCAGTATCGTAAGCCGTTGACGGCGACCAAGGAGATGATGCCCGCACGGTGAACGATTGACAAAACTGTGGACGTCCGTCGATGGCAAGATCGCAGCACGGTAAAGCCGGCAACAGGATGACCGTGACGCCTGCAGCGGTGAAAGGCAGAGCACCACTAAATGTAGGTCGCTTCCAGCCGGAGGCGTAAACCAGGACAGAGCTTTCGTGCGCTGTCTGTGAACAAAAGCCACCGCTGTCGTCAGTATACTCACCATCACCGTGAACGGCGTTGCTGCAGGCAGGTCAATTCCGGTTTGTATCTTACGGTAATGGTGAGTTTGCTGCGGTCCGCAGAAATTACGCCGTCACCACGAGTTAATCCGGGAGTCACGATGTTCCTCCAAAACCGAATCATTTGAACATAACGGTACCGTCACGGTCGACTGTCCTGACGGTGCATTGAGCATCGCTGATGAAACGGCAGGCAGAACAGGCGGAGTCAAACAGCAACCGGAAGTTTACTGTGGAGGACGCCATCAGACCGGCGCGTTCTGGCGACCTTATTCCCTCGTGGCATAACCATCGCAAGAAGACGCACCGATGCCGTCCATGAATGAAGCCGTTAAACAGAGATTGAGCAGGAAATTAGTTATTGTACGGCCTACAGAGGCAATTTTCTCATGATGAAAACGTGGAGCGGCTGTCTGGTATGTATGAGTTTGGTGAATAATCCCTCGGACAGACAGTCCGACGCCCCGGGCCCGCAGAGCCTGTTCTTGCGGGGCGAATGTTCGACGTCAGCTGGGGTTTGCCCTGAAACGCGTGAGATGGGGCGACCCAACTGGCGTGCCTGCCTTCAGGGTCATGTCATCCACGAGTATGCGCCTACTGGCAGGCTTTACAGTACCCATTATTTCATGCTGATGTTCTGCTGGACTTACAATTTTCCGGCTGACGTACACCGTCCCCTCAGCCTTATTTTCAGCGATTACATGATCCCGATCATGGATTCAGTCTTAGCATGAAGCGCGGAGTGACGAAGAGCCTGAATGATGTGCTGATGCAGAAAGCGGCGGCCCGGCTTGCCGGCTAGTGCCGTGCCCTCACGGAATGAATATCCGCTTCCGCACTTGTGAACATCACGATATGACTAATGCTTAAATATCATGGGTACCGGGATCGCCGAGGAGTCGGTATCTAATGAACCTTGGGCCGATCTTCGTCGTATTTGAGTCTCTACTGCTCAGGTTGACGACTAAGATGTAGAGAGTCAGGCGTCATTTTCTGTAAGAAATGATCGAAAAAGCCGCTACAGTCGTTTGATGAATTAGCCCGAGTAACAGGCCGGCTGCTGCACAGAAACGGGGCGATTTCCGTCGGTACAGTATAAATACCGCCAGTGCGTATCCGTAAGTTACTGAACTTGACCGCAAGCTTGCAAGGCGGGCAAAGTCCGTCGTAATCCTGCTGCAACAGGGGCACAGGTACGCTAAGGACTCCCTTCGATGAATCCCATTATTTCCGCGGTGCCATTGCGTGAATCACCCTGCCATGTATCCTGGCGCCTCATGGCGGTGGGGACCGTTGCGCTGGCATCCGCTGGTATCAGGGCAACTCATCAATTCGTGCTAGATTTCAACAAACGCTGTCCTTTCTGGCAATCAGCGACTGACGGACGGCAAGATCCGTATGCTGGTCCTGTCCAGAGCCGGGCAGGCAGCAAGGCAGTAGTTTAACCAAGCCAGTGATAGCGCCGCACCTGGTCGGGGACGGAGCGAGCTAGCATTGAGGCTCATGATTGCGTCCATCAGCCGAGTGGCGCGTCCTTCTCTCCTGCATCCGGCGTAGGACAAGCAGTAGCCTTACGTACTCCTTCGGGAAGCTGACAGACCCGACGTCGACGGGCAGTACTAGCCGCAGTTTCCATAATTTAGCCAGCAGATCCGTATGTCTGAGTCCGTTCCGGCGATGAAGCCGGGGCATTGCAGGCGGCGGCCGCAACGCGAAGCATTTGATGATAAGACCTCCGCCGCCGTGAATAAGAAAACTAGGACGGGCTACTGGGCAGACAGGGTACGGGCATTCAAATCCATGTGGGGTGCGGTGCTGGATATTGGTCCGTCCTGATACCGCGCAGGAGATGCTGATTAAGGCAGAGGTCTCGTATAAGAAGCAGAATACGTTTA
>5
AGTCGCTGTTATACTAAATCACCAGTCTCAGTTCCGTACTAGGCGCAGCCCGGACCCACTTTAAAGTGATAATGATTATCATCTACATATCACAACGTGCGTGGGAGGCCATCAAACCACGTCATAATCAATTATGAACGCAGGTATCGTATTAATTGATCTGCATGCTAACTTAACGTAAAAACACTTCACAGACAATACAAATCAGCGACACTGAATACGGGGCAACCTCATGTCGAAGAACAGAACCCCGATAAACAACAAGCAACATCCGCTTTTCCTAACCAAATGATTTGAACAAATTAACATCGCTCTTGGCAAAAAGTCCGGGAATTTCTCAGCCTGGGTCATTGAAGCCTGCCGTCGGAGACGTCAGACAGAGCCGAGCATATACATCAATTAAAGTGATGAAGAATGAACATCCCGCGTTCCTTTCCCTCCGAACAGGACGATATTGTAAATTCACTTAATTACGAGGCATTGCAGTAATTGAGTGCAGTTTTACCACTTTCCAACCACAGTGACAGACTGCGTGTGAGGCTCTGTCACAGACTAAATAGCGTTGAATGATTAGCAGTTATGGTGAGTCAACCACAGGAATAATCCTTCATATTATTGATTTCCTTCACCAACGCTGCCTCATTGCTGAATGCTTCCAGAGACACCTTATGTTCGTACATGCAATTACAACATCAGGGTAACTCATAGAAATGGTGCTATTAAGCATATTTTTACGCCGAATCAGATCGCACGGCTTATGATCATCAGCAGATTGTTCTTTGTTCGTTTTGTGCTCCATGCGCTTGCTCTTCATCTGAGCGGTTAAATATTACTTCAATCTTTCTGTATGAAGATTTGAGCACGTTGGCCTTACATACATCTTCCTGTTGTATTTCCCTCCAGAATGCCAGCAGGACCGCACTTTGTTACGCAACCAATACTATTAAGTGAAAACATTCCTAATATTTGACATAAATCATCAACAAACAAGGTAGAGGAGGTCAGACCAGATTGAAACGATAAAAACGATAATGCAAACTACGCGCCCCTTATCTACATGGAAGGTTTTACCAATGGCTCAGGTTGCCATTTTAAAACGAAGAAATATTCGATCAAGTGCGAAAAGAGATTTAGACTGACTGTGAATTGTTTATTCGAACTAAAACGTCACAACGTCTCACATCTATTTATGACTATCTAGCCACAGATAATATTCATCGTGTTGTTAGAAAACGATAACACCGTGTTAATAAAAGGACTTAAATTGACGTAAATGTTAAATTCTCAAGAAACACGCATGTATAGAAACGTCCTATGATAGGTCGAAATCAAGAGAATCGCATTTCAGCAATACCGGGGAAAATCTTTAAAGATGCAGAGTTTTCCGATGAGTTATACAATATCCATGAACATAAAGATATTACTATACCTTTGTAATAATTCATTACTATTTACTGGAGCATTCAGAACAACACTACACAAATCTTTCCACGCTAAAATCATAACGTTGCTGTTCCTTCCGTGTCTAAGCATCCCGTTGTCCCGGCATAATGCAATACGTGTGACGCGCTAAACCGTGTGCAGCATCGTTTAATTATTCTTCCAAAGCTCCCGCAGAGAAGTTCCCCGGCTACATAGGCTCTTAAGCTAGTTAATCAATCCGGGAATACAATGACGATTCATCGCAGCTCTACATTAATAAATATTAACAATATGAAATTTCAACTCATTGTTTAGGGGTTTTGTTTAATAATTTTCTACACATACGATTCCTGCGAACTTCAAAGCATCGGGAATAACACCATGAAAAATGCTACTCGCTACTGCCTGGCCTGCTTATTACAGGATGTGCTCAACAGACGTTTACTGTTCAAACAAACCGATAGCAGGTACCTACCCACCAAAGGAACCATCACCATCATTTCTTCGTTTCTGGAATTGGCAGAAGAAAACTGTCATGCAGCCAAATTTGTGGCGGCGCAGAAAATGTTGTTAAACGAAGCCCAGCAAACATTGCGTAAATGGATTGCTCATTTTATTACCTTTAGGCATTTATACTCCGCTGGAAGCGCGTGTGTATTGCTCCAATAATTGCATGAGTTGCCCATCGATATATGAGGTAATCTATTGCACTGCTCATTAAGTTATCTTCTGGGTTCCTCTTCCAGTTTGTTTTGCATAGTGATCAGCCTCTCTCTGAGGGTGAAATAATCCCGTTCAGCGGGGTCTGCCATTTGGGGAGGGTGCATTATCCACGCCGGAGGCGGTGGTGCTTCACGCACTGACTGACCGCAGACTGCTTTGATGTGCAACCGACGACCACCGGCAACATCATCGCAGAGCATCATTTCAGCTTTAGCATCAGCACTCCTTCGTGTATTTTTGCATGGCAGGCAGCAAGCATACGCTGAACGCATCTGCATGTCAGTAATGCCGCGTTCCCGCTGATTCAGTTCTGGCATTTGTCGCGCTGGCTTTGTAGGTAATGGCGTTATCACGTAATGATTAACAGCCCATAGAACCGACAGGCAGACGATGATGCAGATAACCAGAGCGGAGATAAGTAATCGCGGTAACTGCTCATACATCAATCTCTCGACCGTTCCGCCCGCTTCTTTGAATTTTGCAATCAAGCGTATGTCAGCCTTATGCTCGAACTGAGATGACCAGCGCCCCGGCAGTGAAGCCCAGATTGCTGCAACGGTCGATTGCCTGACTGACGGATATCACCACGATCAATCATAGGTAAAGCGCCATCTCCTTAATCTGCTGCCGGCCACAGCGTCCTGACTTTTCGGAGAAGTCTTTCGGCCAAGCTGCAGCTGCGGTAGGCATCCCACCAACGGGAAAGAAGCTGGTAGCGTCCAGCGCCTGTTGATTGGGGTTTGGGTTTAGCGTGACAAGTTTGCAGGGGGTTACGGAGTAATCAGTAAATTAGGCTCTCCGCCTACCAATACCTTTAACCATGATTTCTGGTTTTCTGACGTTAAGGTCCAAGTTCCTCCGACCACGCCAGCATATCGAGGAACGCCTTACGTTATTATTATTTCTACCATCTTCTACTCCGGCTTTTGAGCGAAGCCGTTTGATAAGCGAACCGGGCAGTCAGTACCGATGAGCCGATAAACACGCTCGTTACCCAAGGTAATACTACCGAGATGCTACTTAGTTAAGCGAAGTCGAGAAGGTCACGAAGGATGAACTAGGCGATAATGGCGCACATCGTTGCGTCGATTAATGTTTTGTAAACGCACCGCCATTATATCTGCCCGGGAAGGTAAGCCCCATTGCAAACCGCAAGGATTTCCGCGATGCCTTGTTCCTTTGCCGCACGAGATGGCGGCCAACACAGGTCATGTTTTCTGGCATCTTCACGTCTTACCCCCAATAAGGGGATTTGCTCTACGTCAATTAGGAATAAGGTCGATTACTGATAGAACAAATCCAGGCTACACTGTGTTTTAGTAATCAGATTGTGTTCTGTGACAGGATATGCACGGCAAAACGGCAGGAGATGTTAGCGCATACTCGTCGCCTCCGCTTTCACGAAGGTCATGTGTAAAAGGCCGCAACCGTAACTACTATTACTAATGAATTCAGAGACAGAATGGCTACGGCTCAGTTTGGGTTGTGCTGTTGCTGGTTTAGGCGATGAATGACACGCTTGGAAGCATTTATGATCCCGGTTCTGCTTCCGGTATTCGCTTAATTCAAGAGCACAACGGAAAGAGCAGCTGGCTAACCAGGCCTCGCCGACTCTTCACGATTATCGACTCAATGCTCCTTACCTGTTGTGCAGATATCGACAAATCCCGAAACCCGTTATGCAGGCCTCTAACTATTACCTGCACGTATTTCGGGATTGGAATTCAAGACCTCTCTGCCTGCGATGGTTGGAGTCCAACGATACGTCGAAGTAAGACTAGGCGGAATCGTAGTAAGGGCGCCGCTCTTTTCTTCATCTACTACCACAACGAGTGAATTAACCATCGTTGAGTCAAATTACCCAATTTTATTCAATGATCAATCATGCCGCCGTTAATAACTGTTGCCATCCGCGTGAATAATCATGCTGCCAACGTGTGACCGCATTCACAAATGTCTGCGATTGACTCTTCTTTGTGGCATTGCACCAGAGAGCGTCATACAGCGGCGGCTTAACAGTGCGTGACCAGGTGGGTTGGTAAGGTTTGGGATTAGCATCGTCACAGCGCGATATGCTGCGCTTGCATGCGGCGAAGTACTTGAACGCCTTTGCATCTTCGCACTCTTTCTGGACAACTCTCCCACAGCTCTGTTTGTGGCAAATGATAAATGCACGGCTGTACCATGGCAATCTCTGCATCTTGCCCCGGCGTCGCGGCACTGAGCAGCACGGCAATAATCCGCATAGAGCGAATGTTGCGAGCAGGTGCATCCTTTGCCTTAGAGACTATTTCCTTCAAGCTTTGCCACCACGGTATTTCCCCGATACCTTGTGCAAATTGCATCAGATAATAGTTGATAGCCTTTTGTTTGTCGTTCTGGCTGAGTTCGTGCTTACCGAATGCAGCCGACCGAATCCGGCTTGTGATTGCGCCGTCCCCAAGCAGCCACTCCATCAGTAAGGGAAAGAGGTCAGAAGCCGTGGCCGGTGAGTCGCTCATCATCGGGCGTGGTTTTGTATGAATGAAATTTAGCTACGCTTTCGAGTCTCATGCGCCTTCCCTAGTATCCTGAATCAATGTTAGGTTCCGCAGAACATGCACGCTTATCGATATACATGTTGGTTGGCCAAACTTGAGTGGTTTCACTGCTGGCGTATGACCAAAGATGAACGTGTTGGCGCCTTTATTTCTTTCGCACGATCCCGTTTGTGTGAGTTGCTGATTCGTTCTAAGTTCCAGATTTACCTTAGTGATGATCAACGCTTTCCAAACTCGTATTCGTCAAAGGGATAATCGGCGTGGCAGATAACATATTTTATCTTTGCTCACCAGTTCACATGATTAACGGAAGTTCTTAAGAGTACTGCTTTATGGGCAAGAGCTTTAGCCAGAAGAATTTCTTTGTAATCGAGGATTAAAGAACCAGCCACCGCCATTAAGCAGCCACGTATTGAAGCTGCACTGATTATCGTTCAAGATATGATAAGCCATCACAATCATCATTTGCTGCCTGGTTTCCACGTACAGCTCTGAACCAGGGGAATGTGATTAATTCCCGGCATTCAACGTTCTCTGCACCACGATCAACCAAAATCGCCCCCACCGAGATAAGCAGGTCTTTTGTTGTCAAATCCAATCGTATCCAGTTTGTTCATAAGCTGTCATTTGGCACTGCGTTAAATGCCAACCCAAATATTTCGTAGTATTTGCTGCCATCAATTTTCGTAATAGCGCATCTCTTTCACTCCATCCGCGATACATGAACCAGGTAACGTCGTTGACGATGGCGTGCATTTCCGCGTCTTTATCATCAACGTATTTTCCGACTGGCCCGTACCCAGCCACTTCAGTCTGCGTGCTACTTCTGTCTGATTTCCGTATGTTTCAACGAGCATGTTCTGGAATGGTTTTACTGAGAACGTCTTCATGCGGCCTCACCTTCTGCTATTTCGCAGGTCTTTGAGTTTCTGTTGGTACTCTGCCTTGATCGCCTGTGCACTCTTCGATAGTCTCAGCGATGGCGGTTATGGTTTGAATTCGATTTCGTCTACTGCTTCCCTGCCCGATGCGGCTAATCAGTTCGACGGCGATACGAACGAGATTTCATTTTGTGCCTGTGCG
>6
CATCTTGTGCTGTTTGGCCTGGCTCAACCGCGGTATTTGGCCTTGTCGTCCATTCCGTTAAGTTCCGTTCTTGTTAATCTACTCTGTTTGACCACCCCTCGAAAGAAGCTAAACGAATTATGAAAGGCTGTTGGTCGTTCCTTGCTTTCTTTGATCGGACCGAACAATCGACAGAACAAAACATCATTTTAAAGTTGGGCGTATCCGTACCAGTCAGAACGATGAACAGGGAATTACCGTTTAGCGTAATTAGATAACCGGTGTCTCTGTCACGTGCCCGAGGTACAAACCGGTGCTGAAAAAGTACGGATTGGTACGAAAGCCTGGGGGTAGGACGGAGTCTAAGAGTGTAAGATGCCAGCATGAACCTTACGGACTCATTAAGGCGCGCCCTATCGACGAAAAACAGGACCGAATACGGTACCAGCCCGAAATTACTTTGGTTCGTCTGTCCACGGCAGGTGAACTTACAGAGTGTGACCTACATCCCGTCGTCAAGCTTTTTCGCGCGGACGCGACCCGACAGGGTGGTCTTCCTGAAACGGGCCACCATAAAGCCAGGAACAAATAATAACTATCGATTAATGGTACTGGCTAGGCGTCACAGTTGACCAGATGGTAAATTTGTAAGCGTGACGCTCGTTTTAATGAGAGCCCAAGACCGCCGTTTAACTGCCTGATACGTCAATATTACCCCGAAACCAACCCAAGGACGCCTGGGAAACGGCCGTCCCATGCTACATAAACCGTATGGCATAAGCCACAGCGACCCCTTAGTAATGCCCCTTATCCAAAGTCCGCTCGTTATGTCGAGCTTGGTGTTTATTACCGTACGAACACCGAGCGAGCACGCGTGACTGTTGAGCCAACTTGTGACCACTGTGAGAGCATTCTATTGATCTGAGCGTGCTTATGATGGGGTTGGCCCAAAGGACTAGAGAACCCAGGCACGTTTTAAGTAATCGTCTCTTTGGTGCGGCGCCGGGCCAAAGGCGGTGGGGGTCAAATTATGTGTAAAGTCTCTATATGGTGTTTTATGACTTAGCCGAGGAGGACTGAAGAGCACGTCCTTCGGTACCAAGGATGTAATGCTCGTTATCCCAAGGTTCGACTCATTGACCCATCAAGGCTAGATTGAGAGTGCTTAATTCATAGAATGATATCCCCGCTTTTATCGTTAATGTCACTTGGGGGTCAGGCAGCAGTGGATCTCTAACAAAGACGAGTTCCCCGACTCTGAACTTAGCCGACGAGGCGTGTTTCTCCAGATCGCTCACTTAGTATATGATACCCACCGGGGACTGATCCACTTAGATTTAGAAGACCGGGACTTAGACTGGCTGATCCCTTTGGGTTTCGTACCATTGCCCGTACTGACAGTGGGATCTAAGTTCGCGACCTTAAAGGTCAAGCGCGTTCAGATATTAGATTCCACGGGTTGAAACCGAAAGGGGACCGACCGAGAAATCCAACGTGAAACCGACGCCGACCCGTGACGTACCGGCGATGAACGTCTAAGTATCTTAAAATAAGGCTAAGTGCACCGTTCCGACTCGGTCGTACCTGACCCCGGTTGACGCCCATATGGAACCGCTATCAATCTCATGAGCCCATCGGAGGAAGGTGTCTGATGACCGGATCGTTCGATCACACGACCATGAACAACCTTCCTTGATTATACAAACGGGACCCGACGGACCCCCAAGAAAGACTGTCGAGGTTGGGTACCCATGTGACTCCTTAGATGACCTGAAGCCGTGTGACGCTTAAACAGCGGTATGTTCGATCCCCAGTCGAGCAACTCGATTGTCTGAAGCGACCGGTACATAAGTACATCACGAACAAAACGGGTTAGTACCGAACTGAATTCGACCCCACGAAAGATTATAAAATCCCCTAATGACGACAGGACTGGGGTTGACCCCGTCCGTTCATTACGAAGACCCGATATGTTTGACCCAGCATAATATGACGCTGAAGTCAGAACGTATGGCAGAACACTTCTGGACAGCACGACAAGTAGAAGGCTCTTGGGTCCTGGTGGCTGAATGTTTACAGATGAGCTCGATTCTGTATCAGGTGGCCTCGGGCGGATATGTCAGACCAGCGAAGACAATAAATTGTACGATTTAACTGGCCGCGCCACTCGGCCCAGCCCGACGTGACATGACAAATTCGGCCCTGCACTCTGACCGCAGTACGGCTGACCGACGGGAAACATTAAGAAGACGACCTAATGTAGGGTTTGCTGGCTTAATTTAAATACTAAGAGCTGTACGACCATTGCACATACGGCAGGGACGAGCTATCGCTTTGGTTGAACCACACAGTCCCCGATCTGGGCTCTGACGACATTAGTGACAGTCCGGCATCGGTGTAAGGGTTGCGGGAGTTGCGTCTTAGTTAACCACGAGTAAAGCGTATTATCACTCGCGTGTCTAAAGCGTACCCCAATGCATCCCAACGATCGTGAAGGTAAATACGTAGCCCCCACAAAACCATTACTCCAAGTAATATGTGCGTGTTGCGCTCGAGGTCAGCAGCTGGGCCTGGTACTGGCTAAATACCGGCGCGCTCGCGTCCAATTAGATGGGAAAGTTTTACGATGACTATCTGATTGACGTTGAAACGAAGGGCTAAGAGGTTCGGAACTGTCATGAAGCTTACGGTGGACGCTGTTACCGTGGGTCCGTCGGCCCGGGTGGCACAGTTCTGCTGGGTTCGAATAGAGTTTAATTAACACCGAGGACATACGACGCAGCCCATGGCATGACATAGGGAGCTGACGTCCGGTTGTCAGATCTAACTGGCCCGGTTACCGTGGGCTCTTGGAGCACCCTGAACTGGCTGACGATACGAGACTCTACTTACCGCATGATTGAAGTAGAACCTACCGTTCCTTAAGATTTTGAGTTGTGAATAGCGTTCACCATTTGAGTATTTCTAAGATTACCACAGAGCCGGTAGCCTAGGAACCAGCATTAGAAGAGGACTAGAGCCGGTGTAAAAGGCCGTATTACCCCCGATCATCCCTCTGGCCCAGTCAAAGGACTGATTGGGTTCTAAGGATTACGGCACCACGGCTAGTACCCACGTACTGGGTGGGTCAGATTGAGGGTCCCCCGCTCCGCGTCCCGCAGCTGACTGAAGAGCAGCCGTACCCACGACTTAAGTGAACTAGATATGGGGCGTAAGGCTGGGCGGTAGGACAACCTTAAGCCGGTTTTGAGTCAGTAGAGCCTGCTGTAGGGACTTGTCTATTGTAGCTCATGTCCCAGATCAGGGGTAAACCCCGGGCCGTAGCGTTGAAGCACCCGATCTGCTTCGTGACGTGACGTGTAGTCAGGCCCCGTGGGTCGCCATGAGTCGAGCGAGGCCCAATGTTTTAATGTTATCTGAGAAGCTAACGTTCACGACTTAAATTAGATCCACTAAATCCTTTCCAAGGGACGCCGGTCAGCTGGCAGAGCCTGGGACCCCGTTCTTATCACATGAACTGTTGACAAGGAATTTATACAGACATAAGTTATCTATCCCCGTACCTGTGAGCATGCTTCCGCCCGGGTCTTGACCCGCATGTTAGCAGGCGGTCTCCTTTAGGCATGAGCGTTCGGGACCATTTAAGCCGACGATGGGCTCTGAAGGACTTTGGGTTGACCGACCCCGTAAGGCTCCCGCGAGCAGGTTGACGGACAAGACTGACCCATAGAGTATTGAACGACATCCCTCGTCCGGCCTGATCTTATACGACGCGTTATTTACTTACATCGATGACTGCTAAACGATGAGTGCATGAGCCACTCATGATGCGGCCAGCGGACGTAAGTGGCGTATGTAAATCACCCCTTCCGATGGCGCGAGTTGACGCGGTAGACATACAGCCCGTCCCCTTTAGTAAGACAACTCGTCATGTAGCGTGAACCCGACCTAATTTACTATATGGCCGGTTTTAAGCCTGTAGCCGCGTTAAGCAGACTGATCGGACATCCATCGTGGTAGGTCGTAATAGACAAGTAATGCTGGGCCGTCTGTAGACTTAGTCTAAAGCATTTGGATCCACAGCCCATTGTATGTAATCACAGCCCCTAACTATTCGGATTACGATTTATCCACGTCACCCGGATATCGTCCCCATGAAGCGGCTAAGAACCGATACATGATGATTATATCTGAGACTTATGCATTTAACAGGCGATGTCAGGCCTGTTGCACGGGCGCTAAATGTGAAGACTCAAGCAAGCTATTTGGCTGACCGTGCTGAAGGGACCCCGTCCATGTTGAATGACCATCACAGACGCGCCCGACTTTTACTAAGTGTCACTGACTGGCGTATATTTACGTTAGAACGTTGTTATGGCACGGACGTAAGAAGGATTAGAGCGTCAGAAACAGATCAGTGATATGTTGGGGCCCGAATTAGTCGCCGAGCATGACGTGACGACTTAGGTAGATGAAACCCGGGAGGACCGGAAACCTAAGGCATCGCGGACGTTCAATAATATTACCAACAGTAGTTGATATGTCACAACGGGGCGCCCCACTAGCCCTACCGGGCTGACCCCAACTGAGCCAGGCTTTTGACCCAAGAGGCGAGCCCGGTACCGTATAATGTCGGAACACTCTACGGCCCGGCGACGATAAAGATTATCACATACCCAGTTATCGGTAAAGATGACCCGTGATGACTAAAGCTTCCGCGAGTGCATGAAGTCGCCGTAATATGACCGTTATATGCACTCAGCACCGCTGGCTATCGTAATACCACGAGCCATCGTAATCCGTTGTCGGAATTATAACTAAGAGCGAATTGAGGGGTGTTCTACCGGCCGGCTGTTACGCAGTACCTACGAACTAGGACGCGGTCCCGGACCGTAAGAGCCATAAGATGGCGTACGTACGGCCACTAATAGACCCCGCCTATCTGACGGCAGGCCTTGGACTGACTTTCGTGACTGTAAGAAGGCTTTAAGTTGGCATTAGTCTCGTCCTGGTTATCTCGATACACCGCCACACTTAATTCTGACGCGTCAAACGTTCCCTTCTCAATGTTATGAGCTGAGCCGGGGGTACGCCTCGAGCCCGAAGCGGCCCGTTTTACCTAACTACGGCACCTAACGTTTATCACTTGCCCGCTCCCGATAGTTCCGTATTCACCTTTATTGCTTACCGAGCCCCAGCTGGCTCCTCAACAGGATTAAAGTTTGGTTCATAGGTTTGATTATACCGTCAAGTCCGGCAGGTAACAAGTTGACCGCGATCGACTCCCGATGCGATGACTTAGAGCCAATACTGTTACTTTCTAGGAACTTGTTCATTAGACAGTACCGTTTACGAATTAACCATCACGCCTACTTTGACGGGTCGGCCGGGTACGTACCACTCGCGTAGTCTACCTGAAGTGCGCGTCCCCAAAGTAGATACAGTAATCGGGCCACTCCGTCGGGCCTACCTACTGCTGAGACATGAAAGATCGCCAAACCTAGTTGTAAGCGGTTGGCCGGGCTTCTATCTATTCGTAGCGGCCTCCGAAGTACGTGAACGTCAAAGAATCCGTCCGTAACAACCGATGCGCGGACCCAGACGGAGGGATTAGTCGGAGTACTAGCACGAACACAGTCCTAAGTACTTAACGAGCGGCCGCTACGACTCGAACACCCTATACTCGAGGTCTACATGATTTAGTCAGACCTGGTTCGTTGATCCAGCCGGTCCGCGGACTTACGAACTGGTGTAACAGGTCGAGCGGCCTTGCGCTATCAGAGTTACGAAGAACTGTAATCACTTAGTCCTTGCGAACGATCCTGACCGGGAGGGTCCGGACGTCAATGAACAGAAGACTTATCAGAGCGGCCTAAGTTTGACATAGGTAGTAGGTCCAAATGGTTGAATTGCCGTCGTTACGACATCCCCCATGAACCCTGGACTTAATTCGAAAGCTTGCGATCATAGCAGATGTATAACTATGTATTATGAACTGGTACCGGTTCTTTAACTGTGAAGGTGATATCGATGACATGCATCAAGTTCTGGTTGAATTCTAATGGCGCCTCGACGTAGCGTCTCGCGCTCCTACTGACTAACATTGATGTTGACCTGACAACGCGGAGAGCTGGCGCCATTGTACGAGCCCGCTGGTACTCCGCAACCGAGCTGACCGCCACGTCCAAGAGGGAACTAGGCGATCATCACAGCGATAGGATGAGGGGAGCGGTGGGTTGACGTGGACAGTTATGATGGATCAGGCGGTGGATTGAAGTCGAGCATCCGTGGGCTTGGATTCGATTTCCTTAGTAGGCTGTACAGAGGCGGCGGCCAACCGAATAGGTGGAATTCGGAGATCGGCTCTACCGTATGATGGCGTGGAATATGAGTCGTGTCTTAACTCGAGCGACTCGAGGGACGTGAGGCGGGATCGGGGTTCGAGCGATAGAGTCAAAGAGGTCTAAGCTGACTGGATGAGAGAAACGCGATGGGCAGCAGGCATGAGTAACGGAGGTTATAGCCGGCCCGGTTACTAGGCATGCTGGGTGGAGCACAGCTGCATGCGTTGAATTGGATTGGATTCGATTGAATTGATCAGGATTGAATTGAATGGATTCGAGTACAGACAGAGAATGGCGATTACCCGGCATTTACACCATCCGGTAATGCCTCGTGTGCTTTACTAGGTGGGATCCGGCAGGCCGTCCTGAAGACGGCAGGGGCCTCCTTCTTGGCCCGTCGTATCTTTTATGAGACTAAAATTTTGCCCCTACGCTATCATGTGGCTGTAAACGGTTACCAGGCGTTTGGGCAATCAAACCCCGATGGCTGTCGCTCCGATCGTTAACGCAAACCATCATGATACGTGCGGACTTATGACACTCTAGCTAGCTGATAAGGACTCAGCCAATAACCGTTGAACAGATTGACCTGAGGAGGGACCCCGAATGGGACTATTTTGACTTCGCGACTTTTTACCGGCCTGTTTAGTGCGTGCTCGTTTGGCCCCCATCATAGCTCCGATGCACGGGTGGGCCAAATGGGCCAATACGGGACTATCGGCCGTGCTTGATATCGATCGCCGTGCCGCTACTTGAGCGTACGTGAGAGTCTCGAGTGGCTCATACCCCATCGTCCGTGTATCCCCAGGTCTGTACGGGATGACCCCATCATGATATTAGTGATGATCGGTTCTACGATTGGTGATGGTCGGTGGGACTCGTAGTTAGATGTGTAACTGTCGCACGTCCGGCAGATCGTACAATCCGTAATGTCGTCACCGGGGTATTGGCGGTACCCGATCACGATTTGCTGGATCCAACGCTGTGTATGTAAATTGGTAAGATTTTACGCACCGTGACGGAACCGCCTCTGACGACATAGTGCTGTCGACATATTAAGACTCGACGGCGACTGGTAAGCCACAATCGAATGAGAGACCTTACGGGGGTGCGATGCCCGCTCATTGGTAAGAGCTAGCGCGGGTAATGAAGTAGTTGACCCCTGAGGTAACCGCTTCGCCGACGTACAACGGGTCGTCGCGGCCTCCGTCTGGTTTCATTACTTGCTAAGTGGGGTTCACGGCGTGACGGACTAGAGATCACCGAACGGTGTACGTACCAATGTGGACCGTCCGTCCGTAAGATACGCTAAGTACTAGAACATAGACCGTAAGGACCGTGACGCTTACAGCTATAATCTTCGGGCCAAAGGCCATAATACTATGCTTCGAGCCGATGGACGCACATTTGCGTGCTTGTCTTAGGCCAAACAAAGGATTTAGTCCTATTGGCTAACGATTATGAACTAGGTTCTTACATAAACAGTCGGATTCGGTAACTTAGTTGATCGTTTACTAAACCCGTACACGAGTTAACCCGGGGTCATAGTGTTCCTCAACGAAGTAGGAATGTTATACGCGCCGTGACCGTACCCTTTAACGGTGATAGCTCCTTACATCTACATCGCTCGATGAAACGCTAAGTAAGAACAGGTCAGACAGACCGGATTTGACTTAGACACGGCCATACGACCCTGTCTTGGGCTGTGCGCTGTGTAACACCAACCCTAAGAAGACCCATATCCGTTATCAACCGGCCGTTAAACAGTACTCCACCATTGACCCGCCTTACCACCTTTACCGTATCAAGCGCCTTGTCGAAACCTGTGGACTTGTAGGTTGTGACTCAGTAGGCGACCAAGCCCGACTAAAGTCACGAACGTTCTTACGGCAATGTTCTAGACTTATGACGTGTTTAGCGTGCTCTGAATCCTCTGATGCGGGCAGCTCCTTCCTGATGTACGACTGTCTACCCCGATGGGCCTACTCACGGTTGAATGAACTGTTCGACTGTTTATCGTCCAGTATGGTGGCGTTTAAAGCTGTTCCATAATTAGGACTGTGAGGTTCGGTTATCTGGTTAAGCCGGGTGGCCCCGCTGAACGCGCTCTTTATATTACGACAGGATACAGGTATCTTACATAAATGTTACGTCTTACCGTAGGGCTCCGTGCCCGGATCCGCGAACTTAATAGCTCCCGCTCTACTTATGCTATAATGATTAGGGTGAAGAGAGTTAATTGGACTGCAGCGGTTGAGATCTATTTCCTTTGAATTAGGGCCCATTGCGGCCAGGGCCTAGATCGCTCGTCACCGTTATTACACGTATCAGAGGGAGATAGTTTGAGTCCTCTGGCTAAACCGGGACCTACGAAAAAGTCGATTTAGGACCTTGGCCGACAGTAGCTGGCGTTTAACAGACATCCTAGATGTGAGGTGAGAGTCCAATTGATACGTATGCATGAACAGAGCACTCGAACCCTAACTAAGTCTGCAGGGTACAATATCCGCGGTTCCGGGTTGACAGTTCGGGCCATGACCAATGGTGGGCCTATCAGGTCTGTGAGCCCGTTAGATGATCGTACCGGGCCCCTGAGGTGGCGTGGCTACGACTTCGTCCGGGCTCCGGGCAGAGTAAACCAATCTTATTTCGTTGAAACAAACGAGGGCGGCCGTAATACGTTTAGCAACCCGCACGTCAGACCACGCCTGGTCGCTCGACTGGGTAAGGCTTAACCTGAAGTTAGTTAATAGCCGACTTGGGGTTAGGGGTACATCGTAGTACTAGGTCAGCCTACTTCTAGGCTCCCGCATGGGGCGGACATTTAGGCCCTGGGTGAAGCGACAGACCTGACGCGTTCGGACGTCTGAGCCCACGGCCTAAGTACGTGGTTGGCGTGCTAGTTTAAGCCTGGCTCAACCGGATTAAGTGAACGCTACCTAAACGAAGGCGAGGTTGACCCAACCCGCCTATCAAAGAGAACAGCGACTGCCACTCGATAACAGACGCTCCGTAAGTCAAACCATGTGATACGTCTGGTTGGGCGTCTATCGCCACGAGTATATCCAGCAGGTAAGTTGTAAGAAGCAGACAACGACATGGAATCTATAAGGTTATGTTGTGACGATGAACCTAGTGATTTCGTACTTCACGCGACTTACCGTCTCTTGAATAGCCCGAAGACTGCAGCATAACGACAGACAAAACTAATAAGAGGGTACCGAAGGGTACCGAGTAACAGACTCGAAGAGCTAAGAAGAGCTTGACCGGCCTTACGAGCTGAGAAGACCCTACCGATTAAAGACCGAACAAGCACTGAATGTAAACAATCGATAGTACAAGAACGTATGATGGCGGTACCATAGGCCTGAAGCTAGAAAGCCGAACAGTCCGACTGCCCTGTTAATCTTAAGCAACAAAGTCTAGTATGTAGCATCCTCTAACTTATGTCAGACGCGACCCGTAACAGCATAATCAAAGCCAAACGATAAGCCGGATTGTGCGGCCGTGAGTTTAGATTGGAGGTATAGGCTAAATTAGCCTGTTATCGAAAGAGAATCCGCCGTATACCAAGAGACGCTGCTACACAACCTTATGACATCCTACAAGTCCGTACCAGGGACACTATGGGGACGGCGCGCTAAGCAGGCGATTGACAGCATAAACGGTAAAAACGGGCCCGTATCGAGCGTAATGAACAGAGCCAGGACGACAGCCCAAGACGGCACCATTAAGGACATCTAAAGACCTGGGGTAACCCCGTCGAATGTTTAGATAAGAAAAGACCTGGGCTGAAGACTTACGCCTACATATGAATACCCGGTGGATAGATGGTGACCAGCACGAACATTATTGTCTAAGTAAAAGTTGAGCCCACGATACGCTTTATTGACAGAATATCTGGGCTCCTTGACTTACATGATAAGACTCTACGATCACCGTTCCCGCCGTGGTCCGACCACAATGGTGTAAGCATACATCGTGATGGGGTCAGGCAGATGGGCTAGCCGGGCGTCATTTTATCACTATGAACAGTTGAGGCCGTGCGACGGTTGAGCAACCGCCTATCGATTACACGGTGTTACAACAGCCTTTACCATTAGATGGGCACTGGCGGGGTTTTAGCTAATTGATTTACCAAAGAGCGACCCGGCGTGTAATTGAAATTGGCTGTGGGTCCGTTATTACACCGGGCCTTTCTTTAAATTCGGATAAGGTGTAAGACAGAGCCCGTCTATAAGCGTCTACCGTACGTTCCAAGACACCTGTGTATTAACACGACGAACCGAACGATCAGAGCCGGGCTCTGTATCTTAGCCTGAGTTGACATGACAGGATTAGCATTGGCGTGAAGCCCAATACTTATCCGTTCTCCAGGCTGTAGGGCTACGTTCAATAGCGTGAACCGAATTATGTTCGTTTGGGTCTTAGAAATCCTTTGACTTCGCTAGACTTGAGTCTATCCATAGGCATTAATTACGTTATTTACCGGAATCGGAAACCACCGTGACCGTTTGGCCCCTCCGGCGGCGTAATGGATTAGCGTCTGGTCTTAAAGACCTGTGGAGCGAAAGTGGGACGCCTGGTCGTCTTTAGATCAATGTGACCTGTAAAATGTCCGTTCTAGAGTTTGGGCGGTATGGTCAAGAGGACAGGTAACAGTAT
>7
CGGGTCTCTGAGGGCTCTAATTTTATAATTGTAGCGGTATTGCGCTTCCTCACCGTTGCGTTCTTCTTCGTCATACTTAATGTTATTTAAATACCTGGAAAGAAGGAACCACTATGAAGGCCTTTAGCTCTTATTTCCTTTCTGTTTGTCCGTGAAACCGAACAATGGAAAGTCAACAAAAGCATGAGCTGACATTTCGTGAGTATCTGATCAGATCCGACCAGAACAGGAATGCCGTTGCGAGCGGTGGCAGGTAAGCGTAGTGGTTATGACTCTGCACCGGTCGTCATAAAAATGGTATCAGAAAGGGATGATGAAGTGAACGAAGATGAGGCGCTTAGAGTGAAGACGACCCTATCAGGCTGCGAGTCTCAGAAGAGGAGGAGAAGGAACGCCGACTAAGCGCATGACCCACATTACAAACGACATCAGATTCTTGAATAGGAAGCATTCTGTACTTTCGTGCTGTGCTGGATCGCAGGTAAATTGCCAGTATTCTCGACGGCTCTAGGTCGGTGCACGGCGTCAATACCCGCTCCACTCTATTCTTCCCATTCCGCTCATCAAAGCCAACAACAAAGCAGCGCCGGACGGCTGAATGATACACTTGGTATCAGTGACAGATGAAGTTAAGTATAAAGGGCCTCTAAGTTGTCCGCCGGGTCGCTCATGTTCATAGCAGCCACAGAACGCTGTTGAATGGGCCACTTAATTATATCTCCGAAGAAATCCGCATACGAAGGCTGAATACTGCCTTTCAGCGCTCATCATGAATGCGATGGGGCAAGGTAATACAGTGGGTGAATCGTACAGCTTATAGTCGGTTATTCCTAAATGCTGTTGGTAGCCGTTATAGAGCATAAGCATAGGCAACACCCTTATTGGTTGCCGACGATGATGCCGGAGACTAGAGAAGGAATAGAGGAGCAGCGATATTCCGTCCTGCTCATGGCCCTTGGTATGTAAAGCACCTTAGATAACACGGCACCATGAAGCGTTGATAACTGAGTCCCTTATTCCTCTGGCTGCGGTATAAGCCTCCATTCGGTCATTAGTATTAGGTATATGGACTTGCTGCTTTACTGATATTGAACAGGAAGGCTCTCCGACGTTCCTGGGTAAGCGTATTGAAGGCTCGTCTGTAAAGTCCATCTATCCACGACAAAGTGAGAGCATAGTGTCACTTACTATTGCAGCCAGTTAATCCTAATTTATGCGTTCATGTTGCCTGTGCCGCATTGCTGAGGAGCAGTGTAATTGGCGACAAAGAGACGCCGTTGGCCTCAATGACGCCTGAGTACCCTCCGGCTGTGTTTTATCTGCCAGCCTAATAATGCTTAGTCATCCGGCCAGCACTACTGATTTACTGATCGCCGTTATCTTAGAAGACCGGACGTACTGGTAGATCTGGCATTCTCTGTTTGGAGCGGAGAAGGGGCGAAGCGACCATTGCAGCCGTTGACATAGTGATCACATTGTGACATGGCACTCCAGCCGGCATACGGGGAGCTCCTTCATGCCTCTCGGTTCTTCCTAACACCACGCTCGGTACAACGTGGAGGCGAAAATGAACTTTTACATGCTGAAGTATTAACCATGAAAGAGCATTATTCATAGGCTTTCCTGACTTGTAGTACTGACGGTATCGACTCCCTCTGACGACCAAATCCGTATGGGGATGGGGGCCGTAGAAGCTGGCTCTTGAAGCAGATTATTATGGCCTCACGACGATGACAACGACTATCATGCGTGATGAGGCCATCAATAAAACTATACCGCCGAATGGTGCAGAATGTCATATCCGATGGAAGCCACTGGGCCGGGATTACCACTTGTATGACGCTCTAAAACTGGGCTGTTCGAGACTATCCCCATTACGGCTAAACCGTCTACGAAGCTTAGAGCATCCCACGAAACAAACGCTACCATGATTGACTTACCGATACCGTGACAGCATCACTAGGAAGCCGCACCCCGAAGCGAGAAGCTTCCCGGTCCGTTCATTCTAAATAACTCTCGCCTCCATTCATTCTCCGCTCGCCTCCTGACCAACAGCAGGTCGACTTATGATGGCAGGCAAAATACTGTGACATAAAAGCGACCCAATGAGCATCGACTGCTTTATGCGCTGAGGCCTGGCATCAGTATTTCCGCTGGCAGCTGGATCTCAGTCCTGCTGGCGAGCCTGCAGAAGAGTATTAGCATCAATAAACAAGAACATGGCAGATTACGCCGTGCCTTATCCGCGGAGAGTGAATGACGCTAGAAGAAGAACTTTCATGCTTCAGCACTGCATGATACTGATGACAGGTAACCTGGCTAACAGTACAGAAGACGACGCACTTAGAGTTGACTATATGCGTGACTAAAATATATTGCCGCTGAAGTGCGACCGGCATGACACAGCGACCCGGGTACTGCAGGATTTATGTATGAAAACGCCACCATTCCCACTGTCTGACGGCCGACCGCTATCTAGAATAGTCCAGCATGAGAGCAGCGTTTGAGGGCAGTTGGGAAGCAGGAGAAGGGAGCAGCGAGTTGACAATTTCTTCCGATGCCCCTCCGTGGCCTCTCCAATAAACGCCATCCAGCTGCATCAGATCATATCGTCGGTCTTTAGCTCCGTCATACTCCCGCTGGCTATCTGGCATGGGAGGAAGAAGCCGTGCTTTTCCCCAGTGAAGCGGCATGAAGAGTGCCCTATTGACTGCTGCATTGACGTTGGTGAAACGCACGTTACCATGATGATTCGGCGACTGTACCGCTAATTATGACTGTTCGTCAGCCTGGGATACCAGTTCGTCGCGGCTTTCCGTGACAAGTTCTGATGGTCAGCCCGACCGCATCAGCACTAAACAATAATGACAACATAGACGACTGCCGTGCATGTCTAAGTTAATGACATGTAGCGTGCTGGGATATTACGTCATAGAGGACGGGTATCCTGGCTGGATGCCGCAGAAAGTGACATGATACCCCGTGAGTTACCCGGCGCCTCCGTTCATTCACGTTTTGAACCGTGTCAGACGGGCAGACTCTAGTGCTAAATGTTTACAGCTATTATTCCATGACATATCCGACTTATGGAAGAAGGGAAGTGCATAGCCGTGAAGGTACCTCCTGCTCGCTTCCTCCCTCTGCGTCTTCTGGCTAGAACACAGAGGAGCATAGGGCGACGCTGAGCTGGATTGGTCAAATGCCGTATTACGCACCCCGGTCGGCTGGAGGCCAAAGGTACCGCAGCATGATGCCTGTATCACTGAATACCTGCAGACGTAGAGGCCCACCGATAACGGCTACTCGTGTTGAGCAGTACTGCTTGGTAGATGCTCATGATGTCTCTGGCTTACCGCTTCCGGAATTACGCCATACCTACTCCACGACGACGGCCAGTCCGACCCAGTATTGGAGTACTTTATCTAGGTGAAAATTCGTCGCATGCGTCAGGCGAGCCAGATGTTCTTATGGAAGAGCCATCGTTCATTCTGATTACCTTCAAAGCGCTTCAGTTTTCAGGAAGCCCGCAGTGCTTGGGGACTTAGACTGGATAGCTTACGGTCTGAAGACATCAGATGGTTGTCTCAGAAGCTTTAGAAGAGAGGCAGGAGAAGAGGCGCAAAAACCTAGTAAAGTACTATATCAGAAATTTGCCATAAGTCCGTGAAACAATGCGCCGTGCCTCCTTCTGCTCCTATTCCGGCTGCAGCACTTTGATTTATTCCTGATCAATCAACAGAGAGGAGAATATAGACATCAGAGCTTAGTAATCTCCGCATATTGCCAGCATGGCCTTTAATGAGCCCTTAATGATGAACCTCGCTATCTAGGTTGCGTTTGTGCCTGCAGCCATGTTTAGATCAGCCTGACGTATCGGTGTCGGCGAAGCTGACTGCCAGCGAGGCTAAGCGACGCTGGCATTACGCTGTATGATGACGGACCACGACAGGCCTAAGTTATCAGATGAACGGCAGCCGTGCTGCTTGTCCGGCACGGTGAGCTGGACGGGCTGCATGCAGCCGTACTGGGGTACGTCGACTGAGACAACGATCTCCCTTTAAACAGGCTGCCAGCGATCTTAATGACGGCATTCTGCTCTACATGGACAAGCCGTGGGAAGGCACGAGGGCATTACGCTGACATGCCCTTGCTAACATAAACTGTAGATTAGTCCTGTTGCTTGCCACGTGACATGACTGAAGCAGAGTTGGTCGCCGCTCCCGGTAGAGCATTCCTCCATCGCTTCCTCTCTCTCCGTAATTACGTGTACTGCTGAGAAACAGGGTGTGGAATGACCCTGATTACAGCGGACGATAATAAGTGATGGCATCACCTCATCTTCCGGATGACGTCCGGCGACACTGCATTTACGGACGCAATATCAGATGTTGCGCACAACGTAATATAAGCTGTCCGTGCATATTGTACACTTAGAGCCGCAGTACATGTACTATAGGTCTACCGCAGCGACTTATGCCGACTTAAATATCACTGTATTGTACCACCGAGCGTATGCAGGAGATCACGTTAATCTGCTATCTACGTACCAAAGATCAATTACGGTCTCCAGCGACCCCGCATAACTATTGGACTTTTAGCCTTAGACGGTGAACTGCTTTGGTGACGCAGCCGGACGAACGCCTCACGAGAAGCAGGAGCAGAAGGAAACAGCCGCATTATGGCGAATGCTCAACTGTGAGAGGCTCACGACGCGACAACAGGACGCGTGCTGGCAGAAACCCCGGTATGACCGTGAACGGCCGCCGCATTCTTAAGACAGATATTAATGCGCGCTTATTCCTCCTTGCGTCCCACTACGGCTGCAGGTACGGGATGGTGATCGGTCTACGATTTAGCTGACACAGTTATCAAGTTATCAGGCAAAGAAACCTTTACCATTACCAGCCTAAGGGCAACAGTATACGGCTGATAAGGACCCTCGATAGGTGGATCAGGGCACTTCTTAAATGACGCTGATGGACCTCAGCCGTAAGCTGATGCGTGGGATGGCACCACCGACGTCTCTGCCGTTGGCATTCTTGCGGTTATGCTTACCAAGCCTACCGCTTACGTTCTGACAAGTCCCTACGTTCGTTGAGGATGTGCTGGGCCGTGCTCAGCGACGACCAAAACGTAGGTACCGTTTGCTGAACGGCAGGACCGCTACGAGCGCAAGGAATTTTCAGCCCTTTTGAATGTTAGTACCACAACCGCCACGCTCTTAACCGGCAGGACTAAGTTGATCTTACTGTTTCTTACGTCCTTTTCCGTGATACCTTCCTCGCCCGCGCTTCTCTCCGTTGCCTCTGACTGGTAAACCTGTATGTTTCGCCCGTGTTTCCGTAGTTATCGTTCCCTGTGAGCTCCACCTGAATTACGCTTAGATATTTAGCCCATCATGAAGCATGAACCACGGCATCATCGTCGCCCTGCATGAGGACATTGGCAGAATCTGTACCTGTCACTTCTCATGGACCGACTCATGCAGAATTACGAGCTGGCCTTGCTCAGTCGACAGATGCAGGCATTTCTGCTTTATTAAGGGCAATACTACATGACCGTGAAGCCTTCGATCCGTTAGTGATGGCTAAGTGCGCATAGTAATACGCAGTCCTGAGCACGTATAGAGCAATTGGTGACATTTACGTATACCGACCGACACCATCGAACGCGAGAAGGGGCGACGCCATGTAGTGTCAAATTGAGCTGACCTGACATGTTCCGTTCTATTCCAAAGCCGTCAAGAGACTAGATATAGGCGTCTTACTCGCTTCGAGCTGCGCCTATGCGACTGCGACGGTGTCTATAAGGGCTTATTACCAGATGGCCATCTTTAGTTATTCCTAACAGTACGTGAAACGGTAAAGAACTTCCGTAGACAAACACGTATGAGAGCTCAGCGACAGGTTGATTGTCGCTACCTATGACTGCATTCAGGATCGGGACAGCAAGCGTGACTTAATAATCGCTTTCTCAGCTATGACTCCGGCGAACCACTGATCCGTGTTTACCATGATTCAGTCAGCAGCCTGATGCTGCTCTATCTATGTATGCGTCGTACAACTCGTAACCGTTAGCTATTTCTGTGGAGGATCCATGACGACATCATGATTTACGCCGTCTCCGCTCTATGACATCGACCGAACGTGATGTCAGCCTGACGGACGAAAGAAGAATGGCGCTCGTGTGGCCGAGAAGAGGCCGAGAGAAGGAGGAAGCCGTCAGACAGCCTGACGGGGAAGTGTGACTTAAAGTAAACGGGCCTTAGATGCTAGCATGGATACCGTGATTCTGGGATACTTCTGACTTCCTCCTTCTTCTCATGCTGCATACTTACATCACTTGCACTCACGTGGTGATGTGAATTGTGTACTGCCGACGGCGTTTCGTCTCTGCCGGTGTGGCAGCCCATGACGGACATATCGGATGAAGGCAATAACGGGGAGGCCTGTAGTGGTTTGGGTACTGTTCGATGCTCATTCACCCTGAGTATGAAACGATACCGGGTATGGGAACTACAGCCATTACATCCTGCTCGTCATATTAGTCTGTAGACGTGTTTGATGACCTGGAAAATATCAGCTATGCTGACAGCGTGCCCCGTTGCACTCCAGCCTTTTACTGATTTTGTTTAGGTATGCGGCACTTAAGCGTGAGACACTGACCATCTGCTCCGAAAATTTCTGGGTAATGTTTGCTGAGCTACATCTGAAGTCATCTTATGACGGTGTGACTCTGAGGTCACCGTGCCGAGGAAGCGAGAAGGAGAGAGAAGTCTTACTCACCCGTTGAAAATCGCCTCCGTACCTCAGTAACGGTGCTCTTACGCTTAAATTATTAAACCCGTTGCTTCACCGGTACCATTCCCTTCGGTGCCTCGTGCTATCGCTGCGTATGCCAAGGAAGGCTATGAAGGCCACGGTCAAATCTAAGTAGAATCAAAGTTAACCGGGGATTTGCCTGTAAAGCTGGTAATGCCCCTGTTATTTCCTCCTCAGACGCGTCGCAGCGTAAAGGCAGCGTTCCTTAACTATGGCAGCGTGCTTGGTGATTCTGTATTCCCTGAGTTATTCACTGAAAAACCTATCCTTAAGATGTCATGCAGCGTGTATGTAGAAAACTCGTTACCCATGATGTGTGTGAATCCCCTATCCTTACTGCTCCGACCACGTTAAACAAATATTAAGGATACGTGAACGTCTTCTAAATATGGCTATCTATGCAGCATCAACTTAGATGGTAAGCAATGAGCTGAATACGTGCACTCGTGCAGGAGCCGCAGGAAGCAGGAATTTTTGACCTTATAGATGTTTGGTGGAGCCCACTTTCTATGAAGTTGCCGTTTATCTCACCGGCTGTAAATACAACTATAGAAACCTGCACCTGCCTCTCCGCGCTTTCCTGCTGCTATTAGATTCAGATATGATCGTGATGGATTAGATTATCCTTATCGATATCCCTATGTCACGTAGATTTGATCATATAGTGTATGTAGTACTAAGCTCTGGGACGACATCGTAGGTTGAGTTCAGCCGAATTGACTTATTATATGAAAGTATTACGGTCGCCTTACTGTCAAATCCTACAATGCTAGTAAAAGTGCCGGACCTGTGGTTTACTGAGGCGACCTTACGTGAATCACTGTTCAACGTTGACTGGTCGCGTCTTAAAGTTAAAGACCTGACGCTTAGAACTGACGCTCTATTGTGACTACCTTATCTCGATGATGAAGATGCAGACTGGACTTAGACATCGGGCAGGGACCAAAGTGCTGAGATACCACTTCACGCTGGATGCCGAGAAGGCAGGAGCGAGCGGAGGCAGGAAGTACCGTGCTATGTAATTCCCGACTCCTTCGCTGTGTTCAGTGGGTCAGCAGTATCGTAAGCATGTGACCTAGAAGGAAGTACCGCCTGCACGTACCAATTACTTTACGTCACTTACAAGATCACAACTATGACAGGCAACCGGCATGACCGTGACGCCTTCAGCTCATGTGAAGGGCAGAGCACCTTAGTTGACCTTCCAGCTCTACCATAGTAACCGACAATATTTCGTGCGTGTCCATCAAACAAAGCCACCGTCGGTCAGTGGTATGACTATCACCGTGACTCTAGTTGCTGCAGCAAGGTCAACATTCCGGTTGTATTACGGTAATGGTAGTTGCTTAGTTCAAAATTACATGTCACTGATTGGTCTAAGTCATGTTCCTCTCATTCTGCGCCGTGGGTTTCTCTATACGTGGTCTGGACGTCATGTCCTCTGATAGCACTTAAGCGCGTATAGACTTAAGTAACAACAATAGGCGGTCATAAGAAGGCAAGCGCAAAGAAGCGAAGAATGGTCAGAATGGCGACGCTCCGAGGCGATATCTCGTCGGGGGCGACGATTAGGCAAGTACGACGGCAGGAGTCGCTGAACTAAAGCTATAAAAGAGATTTATAAGTAAGAATAGTGGTATCACATTGACGGCTGTAATAGCCTTAAAAGGCGAGCGACCGGCCGAGGAGCTATTTATGAGAGGTGTCAATAATGGAAAGACAGTTGACGGACGCATGGAGCAGCCGATGCGGCGAAGGCGGAACTATAGGGGTCGCGGTGAACGGGCGCGATCGGCGATAGTAAAGGCGGCAGTTGCTGCCCCCATTACTTGCACTGTTGCTGACGGCACTTTACAGGCTTTCCTCCTTCCAATCCTCGCGCACCTTTGCCTCCAGGTGGCTATGCCATCAGGCTTACGGTACAGCTCAAGGCAGCCCCGGATTTCAGGCGAAACCGCTGCGAGGAGAACCACGAAGGTCGCTTGACAGGATGAAATTAGCCCATTAAGAAACCCAAGGCGAGTGCTCGGCTATGGCCGGAAGGGGAAGGAAGAGAAGCGCTTCCGATGACATGACGTTGATTAATGAGTACCATGAAGAGAAGGTACCGCAGCGAGCCACCCGGAGGGGCTGAATTGTTGTACTGAGGAGGCTATACGCGAGGCGCGATTGGTTCAAGTCACGAGGCTAAGAGAGGGCGCGAGATAGCGGGATTTGAATATCGAATCTACAGGCCGAACATCATGAGGGAAGTTAGCCAGGGGTCGCACAGAATGAAGGGGGCATGCCGTAGCTGTAAGTAATCCCGGAGGCGAGCACAGACTCATTGACGTAGTCACGGCAGAGGCCGTAGAAGTTGAGGGCTATCCGCTGCAACATGGGGCAGGACCTCCTTGGGGCGCTCCGCGCCTCCGGGCGAGCGGTGAAGGGTGCGCTAGCCGGAGAGCATCAATCCATTGCAACAAACGCTGTGCTTCCGGCATCAGGCGACGTACGGCAGATGGTGGCTGTGAGTCCCGGGCAGGCAGCAGGGCTACGTTAGCAGACCGAGTACTCAGCAAGGGAGCTAGGGGAAAGGAGGAGCCACCCCCATCATGAGAGTGCTCCTGCACCCGGCGTGAGTAGACAATACGCTGAAGCCTTAGGAAGGACCACACCCGACTAGGTCGAACGGCGATGAGCCGATCCATAACGTGGGGGCAGATTGGGTACTCATTGTAAGTGCATCTAGTTCTAGAGATGAAGCCGGGGCAGGCAGGGCGAACGAGGCCGCACGAAGGGAGATTACGACCAGACCGCCGCCTGAAAGAGAACAGCGACGAGGGTACTGGGCAAGACAGACCGCGGGCATTCCAACCATGTGGGATTCTTCGGTGCCTTCCTGCTTGCTATGAGAAGTAAGTAAGAGAGCGGTAAGAAGCAGACCACACACATCTACAGTTTGTTATTTAA
>8
ATTGGGTGCTTGGTGTTAACCTTATCTATCGCTTATTAGTACTTGAAACGGTTCTTCAGAACCCTGAAGTCGCTAATCGTTCGGCGATACTATATGCATTAATAGACTATATCGTTGGTATAAACAGTGCACCATGCAACATGAATAACAGTGGGTTATCCAAAGGAAGCAGAAAGCTAAATATGGGGAAAACTACAATACGATGCCCCGTTAAGTTCAATACTACTAATTTTGTAGATGGAAAACGTATGTAATAGAGAGTAACTTAAAGAGAGATCCTGTGTTGAGCCAAATAAATTGCGGTTATTTTAATAAATTAAGGGTTACTATATGTTGGAGTTTAGTGTTATTGAAGAGGCGGGTATAATTCCTGCAGTAGAAAATAAGGCATTCCTACGAGCAGATGGTTGCACGAATGACTATTCCTTTGTTACAATGTTTTATCTTACTGTCTTTGATGGCTGCATGTGAAAATGCGATATCGAAATGTTAAATTGGTTTTGTAGTCAAAAGAAGAAGTAAGCACTTATTCATTAATAGATAAATTCAGTCAACTCCTGAAATGTTTTCCTTAGGTGAAAGCATTGACTATGTTAATCTCAGCAAATTAAGCGATGGTTTAAACATAAACCTTCTTTAAAGCCTATTCAGGATTTAGTAGTATGGCCAAATCGATTAGCCGACATTGAAGATGAAGCGTCCTTAACATCGCCGTCATGAGGGGTAACTCTTTCAGAAATTCATGGACAGTTCGCACGTGTGTTAAATGGTTCAGAATTGTCAGATTCCACTTTTCATTTAATAGAAAGGATGCTCCCGGATTCAGTGATTATATAACTACGTTGAGGTGACGGTTAATTCTATGCCCAGCACGAACATTCATGTGCTTTATCGGGCGGAATGGGTGTAAAACACGACCGTTGAATGGAATGATTGGTGCAATCACCAACCCAGAAATAATGAATAGTTTTCTCTGGAAAATAAGTAGACTTATCGAGGTCAAGAATCCCAAAGGGATATTTTCGATCGCTTGTTTCAGTTTCGTTTAGTGCATTTTAATGCTTTTACTCCTCCTAAAGAACAACCTGATACCCAGCAAAGGTACACAATACTTTTATATTGGACTCAAGAATGCTGCCAGCAATAGTTTAAAGGGTACTAGGCGATCTCCGGTTAGAATTCATTTCAGCATTTATTGGTTGTATGGTGAGAGTAGATAGAAAGACAACTCTGGCTTTGAAGCTATCAAAAACTAAGTAGTGATGAAAACTTTTCCAAATATGGAACTCATCAGCCTCCATTTCTAAATATGAAGAGTTAAGACGTAATGAACCACACCAATTCAAGTGGACGATGATAAATTCACTAAATTGTTTTATGACAATATCCGAAATATGCTTCGAATGAGCTCTGACATGCAATTGTTTTATTTACTATCACAAGATTAGTAGATGTCGTTGTGAAAGTCATTAGTTTTATTCGATGAACCAGAGGTTCATCTGCATCATTTGCTCTCTGCTTTTACGAACATTAAGCGACTTACTCGATGCACGCAATGGTGGCAATAATTGCAACTCATTCCCCAGTAGTACTGCAAGAGGTTCCAAATCCTGCATGTGGAAGGTCCTACGTCAAGAGAAGCAATAAATATTATCCGTCCGGGTTATTGAGACATTCGGTGAGAACTTAGTTTTGTAACTCGTGAGGTGTTTTACTTGAAGTGACAATTCTGGATACCACCACTTATGCAGTCCGTTGATTCAGAGCTTTCTTATGAAACCATTCTAAATTATAATGGTCAGATAGGATTAGAAGTCGAACCGTTTAAAGCGATACCTCATCAGATGAACAGAGATGAAGGTAAAGTACAATGAAAACTACCTCTTCCGCGCGGGAGCAGAACTTAGCTAAGAGAGAGAAATGCTTAATAAATGCTCGGAAGGTATGATGCAGATAAATGTTAGAAATAATTTCGCATTACTCACTTCCCACTTTGCAGAAGAACAACAATATAGAATATTAAGCTCGACAGGTCAGTTATTTACCTACGACAGGACACCCTCTTACAGCCCTACAACCTTAGTAGTTGGTAAGTGGACAAAGGTTAAATTAGAAAAGCTTTATGAAAATAATCTCCAGATAAAACAAACCCGCTAGAACATATTACGATGACATGCTTGTTTCATCAGGTGAAAAATGTCCATTTTGTGGTGATATAGAACAGACAAATATAGATCATTTCTTCCTATTGCACATTATCCTGAATTTTCGGCTTACTGCCTATTAATTTAGTTCCATCGTGCCGCGACTGCAATATGGGAGAGAAAGGTCAAGTTTTCGCAGTAGATGAGGTACACCAAGCGATTCATCCCTATCGACAAGGACATTTTTCGTGAGCAATGTCGGGTATATCCAAATTTCACGGGTTTCCTAGAACTCCGGCTGCTATCAGTTTTATGTTGAATGCCCGGCGACTCTGGAGGCAGGAAGACAAACACAGAGCTCTTCATCATTCAAGCTATTAAATATTGCTAACAGGTATCGTTTTAGAGGCAGGAAAGCACACTTGAAGTGAAGTGATCAAAGGAAACTCTTTCGTAAAGTTATAGGAAATATAGTTCAACCGCAACGTTTCAGCAGCTACAGTCACCAGAATTTATTGAAGCAAATCTGAAACCTATTATAGATTTGAATGACTTCCCCAATTATTGGAAAGAGTCGTATCAGTGCCTAGCAAAACTCGAAAGATTTTCAGAGGGATGTAGAATATGATGAAAGAGAAAATTACGACGCTTATCGGAAGTGAACGAATACTTTTATGAGGGAGGCTGTTTGTACAAATCGGTAGTAACTTGCTAACCAATTCCGGCGGTGGCAGCCAGAGTGGCAACAGTGCAGCAGGCGAAGGTTGTAATGTCCGCTCCGGCACAGCAGTTCTAGGGACAGTGGCGTACAGTCATAGATACGTCGTGGGGAGGTGGTCACAAATTCTCATGCAAAATACTGTAAATCGGTAGCAACTGGAAATCATTCAACACCGCACTATCGGAAGTTCACCAGCCAGCCGCAGCACGTTCCTGCAAGTACGACGTGTAGTCCGGCTCTAATATCTCCTATGAGCAACGTGTTAGCAGAGCCAAGCCACAACTCTAATTTAATACATAATGAATGATAATAATATAATAAAATTTCCTGTGTAACTAATTGTTTATGGTTTCTGATAAGAATCATGCAAAAGATCAAACAACTTGTATTACATTGACAGTTAAGCAGTTAATTTATCACCCTAACTATATCAGCATCTAGCATGCAACGCATCGACAAAATGGAGTTTTATGACTAAAACCATGGGAAGAAGACTTAAAGATTTATCGCACTTGCTCAAATGCTGCACTTGATAATATTTTGACTCCTGAATTATTTCGCTTGAATTTGAATCTAATTCCTCCAAACCGCAGAACAGTAACATTTATTATTTAAAAACAAAACCAGATTGAGGATATGACATTTGGTATGACAATAATGTTATTGAAGCAAATGGAAAATGATCCATTAATGGCTTGGCTAAATTCCGCAATACGATAGAAAACAAGGCGATTTAGAAATGTATAGTAGCGAGGCAAAAAGGCTACTCTTATTTCATGTACATTGAAGAAATGACATTGAGTTATTACAAATGAAAGTATGTTAAACATTGGTAAAAAGTTAGTCAGACTTGCACAAAGAAATTACCTTCATATTTAACTGAATCATCTATTATTAAATCAGAAAGACGATGGGTCGCTAATCCTAAAGATTACGAATTATTACATGCCTTAGCTATAATCGGCAGAATGTATAACTGCTGTAACTCTCTTGGCATACAAATAAACAATCCAATGGACTACGATGTGATTTCGCCAACATCATTCGACTCTTTATTTGATGAAGCCAGAGAATAACTTATTTAAAATTAAAGATCACTCCATAAGCAAATTGTCATTAGCATGATACAATATGACAATAAATAATTCCTGAATATTAAAGGAGCGTCTAAAACTGTAGATAAGCCTAAATATCATTGGGACAGAAGTTAGTTGACTATACAATGTCACAAGCTTTAAGAAACGACTTTTAAAGGACGGTTATCACATTCAAACATTAATTTTATGATAAACAATTCCATCCAATTGATTTAATCAATACAACATTTGAAGATCAAGCAGATAAATATATTTTGGCGTTATGCAGCTGACAGAGCCCCAAAATAACAAATGCCTATGGCTTCATTTGGATATCAGAGCTATGAGCCAGAAAAGCAAGCATCTACTCCAATAAACCAATACATACAATGCCAATTATAGATGAAGACTTCAGGTAATGTGGAATTGATTCAATAAAGATAATCAAAATGTATTTCATGGAAAAATAGTTAGAGAAAACGAAGAAAAACCGACTTTAGAAAACATCAACAGCATAACTCAAACATGACGAAAAACCATATTTCATGCGTTCAGTTCTTAAAGGCAATTGGCGAACCTTGTGGCTTAAACACTATGAATGAACAATTGAGTCATAGAACTTCCATTATTCTCCTGAAGATAATAATCGCCAAATAAACCAATACTCAGCTTACAATATACTAACTAACCGCATGACGTTATTTCATACAACGTTTCTGCGGCAGCTCACAAACGATTACTCCATAACATAGGACAGCAGGCCACTCAATATCAGGTGCAGTTGATGTATCAACACGGTTCGAGCCCCCAATACCGTCGACTTCCTTCCAGGGCTTCCAGCAACGAGGTTTCTTCCTTCGTTTGATTCAGATCTGCAGCATCCTGAAGCGGGGCAATATGCTCACTGGCTACCTGCATCAGGCTTTTTGTTTCTTCCGCCTCCCGGATCTCGGAACAGTTTTTCTGCTTCCGTGGTTCCTTCACGAGCGTTGCCGTTCCACTTCTGATATTCCCTCCCATGAGATAACCGAACACACTTTTCCGGTAACGACTGAGTTCAGAAATAAAGATAACGCGTCGCCGGAAGCAACCCACGTCATAGACGGTTTTACCCCGAGCGATGGTCTTCAACGAGACATGCCACGATGCCTCATCACTGTTGGAAAACAGCCACAAAGCCGCAGCCGGAATATCTGGCGCTTGCAATATCGGTACTGTTTGCAGGCAGACGGTATGAGGCGGAATATATGCGTCACCTTCACCAATAAATTCATTAGTTCCGGCCAGCATATTATAAATTTATGGTCCGTGGTTGTTCACTCATTCGAATGCCATTATGCAAGCCTCACAATATAGTTAAATGCAATGTGGAGTTGACGGTGTTTCCGCGTTACCCGCAGCGTTAACGGTGATGTGTCCGTGTGAACCGGGATACCTGAAAGAATGGGCATGAGCACCCGATAACAAACCGGATGCCTGGTGCGCACCAATACCAACTGTATGCGCATGTGCACTAAGCACTGAGGGGCGACTTATGGGACAATGAGTACTGTCTCGGTGAACTGTCGTTCGATAATAAAGCAGGCATCTTGTGCTGCTTCCTTTAACTGTGATAAACTTCCTGTAATGGTTAGCCTGTTCTCATACCTGACTCCAGCCAGAAATCTGTTCATCCTTAAAACCACTTGTGGGCATGAGCACCGCGGCCCCTGTTGAACCGCTCAGACTGTGAGCATGATCCGCGGTTATTCGTCGATTTGGTGCTCGTAATGAAACTGCCTGTTGTTTTCCTTTTTATGCGGCGTAATCAAACCACGCCGGCTTAGTTTTCGTCCCCCAAATCCGTACCGGATGCACTGGCACCTTGGGTGTGCGACTTAATTCAGCATCCTGTTCCTGAGACAATACAGCACGAACGCTGGCGGGTTTCCCCTTGATGTCCAGCCTCGAGGCGCATATCAGGAGGAAGCACACCCGATGAATACGCGACAGCAAGTTTTGTAGTAGGCTGATTTGTCAAACGCCGCCTGCCCCTGCATCAGGACTTAGCCAGACGGAACGATATTGATGACCACGGGATCGGCGCACCTGCCGAGACCCGAATTCTCACCGGCCCCAAGGTATTCATAAGAACATCTGCAACGGAATTTTGCCAGAATATCCCTGCCAACCTGAGTCAGTTCAGTCAGGCTGGCATGAATTTCCGCGACCGCGGTAATTTATTTTTCGCCGTGGAAAGCCCTGCCAGCGCCGTCAGTGTCGCATTCTTCGGTTGTTTACCCGCAGGGCCGCGTTAGTCATGGTGGCTAAATCTGGATCATTCCCGGCAGCGCTGCGGCCAGTTCATTCAGCGTATTCAGTGCGTCGATAGGTGACGCGTCGATACTCATCTGCAATCGCGGCCAGTCAACAAAGCGGTGTTCGCATCGGTATGATGTTTGTTGCGGCTCCGCTTTGGTGCTGTTGGCGTTCCGGTCATGCCGGCTACGTCGATGGGCTTTCTCTGTTCGTTTCATCCATTACCACCTTAACCGCCTTTGGCGTTGCATCGCACAAGCGTTCAAGACGTGCTGTTGGTTGCACTGCTGAGCTGCATGAGGCTTCTTTCTCGTTGTCCTCGCATCCTCAAGCGACAGGCATAGCTATGAAGCTATCTTCTGCACGTTTTGCCGAATTTTTGCACCGTATTGCCGCCGCTTCTGCCGCACTTTTGCTCTGCGATGCTGATACCGCACTTCCCGCAGCCTCTGTCGCCTTCGTGGATGCCGTTGACGGCACTCCCGCCGCCGCTGTTTTGCGTCTTACGAGCGAGGGAACTCCGTTCCGCTGCCTGTTCAGATGACCTGGCATTCGTCTCGCACGTTGTGCCGCGCCGCTGGCAGAATTTCTGCCGCCGTTGCCGAGGAAGCTGCACGACCGGCACTTACCGTAATGCGTTCGTTTCTGATGATTTTGCTGCCTCTTTTGAGGCCACGCATCTCGTGCTGAAGTGGCGGCGCGCTTGACGCTTTCGTGACCCAAGGCGGTAGGAGGCAGACGTGGCGGCTGATCTTATTTGTGACGGGCAGCATTCGTTTCTGACGTGTTTTCGCGCACCGGACGCGCTCTGAGCCGCGCGTTTTTAGAACCTCTGCGGCTGCGGCACTTTTCGCTTCAGTGGCCCTTGCTGTGATGCCGCTTCTGCGCCGGAGGACCCTTCCTGAGCTGACGATGCAGCCTGTCCGGCGACGTGCTGGCGGCGCGTCGGGCTTACTAGTTGCATCAGTCAAGGGCCGCGACCTGAGCAGCTGAATGCACTGGCATCGCCGGCTGATTTCCTTCGCGTCTGCCGTACTCTGATTGCCACCACGGCTGTTGAAGGACGACACGACGGCTACTTCACCTCTCCACCATCAGTTCAGACGACGCCTCATCTCCATCGGGCATCATCCTCCGTCATGGCACAGAGAAAATCAAGTGCCGTCCCCGGTCGAAATCTTCATACACGGTACTGTTAGCGGCGTGCGATGGTGGAAAAACCGTCAACCTGCAGGATAGAACCTGTACTGACCGTACTCCACATCCATGCTGTAACGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCACCACCACCGTGGTGCTGTTACGTCTGGCTTTCAGCTGAATGGTGCAGTTCTGTACGGTTTCCTGTGCAGCGTCTTCAGGACTCCTGAAAATCTTTACTGCCATATTCACCCCAAAAGCCCACCGGTTCCGGCGGGCTGTATTCAACCACTGTGTTACCTGGCTAAGCAATCAGAATTTAACCGACCCCAACGATGGCGATCCGTCAGTACGCCAGTCGCCATGCCGGAGCCTTCAGCAATATCAACAACGACGCTGACGCTGCCGGATTAATCGTATACCTGCGGCATCACGCCACTGAGGTAACGCCGCATTGCATTTCGTCCCTGGCAGTGGTCGTCTCCTTTCATATACCCGGGAGTGATTTCCGCGTCTTACGGTAATCCATTGTACTGCCGGACCTACAGCGACTGTGAGCCACCTCCGGCCATGGCGTACCGCACTGACCTGCTTACTGATTTGTAAAACCGGTCCGGCCATCACGCTCACATAACGTCCACGCAGGCTCATAGTGAAACGTATCCTCCCCGGTCATCACTGTGCTGCTCTTTTCGACGCGGCGAATCCCCAGGAAGCCATGCCCCCACACTGTCCGTCAGCCATAACGACGGTATTTCACGTTTAATCCCTTTCAGATGACTCACATCGTATCCCCGCCGACAACGACGGCACCGGATTACCCGGTTTTCACTTGAAAATAGCCCACCGTAAACGTACCATGTCCGCTTTCCGCGCACGGGCTCGAGTGACTGTCACCGCAAGTGCGGCAAAGACAGCAACGAAGGCAATACACAGGTCTACGCATCTAGCGTTTCTCACCTGTTTTATAATAAACGCCGTTCCCGGACGAACCTCTGTAACACACTCAGACCGCTGGATGCCCGCCTGTTTCTTAATCACCAGACCTGCACATCGCTGGCAAACGTAAAGCGGAATATCTGCCGAATTGCCGTTAACGTAAGCGTGAACTGTCAGGATCACGTTTCCCCGACCCGCTGGCAGGCGTCAACAATACGGGAGAAGAACACCTGTACCGCCTCGTTCGCCGCGCCGCTCATAAATCACACCCGCACGTTCATCAGTATTTCAGATAACACATCGAACAAACCGTTGTCCCTGCCGCTGACAGTCTACCTTACTTCAGCGAAACGTCTACTGAGGAAGCACCACTATCTGGCGATCAAAAGGATGGTCTATCGGTCACTAGACAGTACGGGCAGATACCTGACGGCCAGTCCACTGCTTTCACGCTGGCTAGGGGAAAGCCGCGCTCACGCGCCTTTACAATGTCCCCGACGATTTTCCGCCCTCAGCGTACCGTTTATCACAGTTTTCAGCTATCGTCGTACATTACTGAGCGTCCGGGGTTCGCATTCACACTGCCTGATATCCGCATTTTAGCGGTCAGCTTTCCGTTGCTGTTAAGGGAAGGGCCGGAGGATTGCCACGCCGCTGGTAATGGGTTGGGGGCCGTCAGGCGCTTCAGGAACACGTCGTTCAGCTGAATATCTGGTTGCCCTGCGCCACAAACATCGGCGTTTCATTCCCCCGTTTGCCGGGTCAATAAATGCGATACGATTGGCGGCAACCAGAAACGGCCGTTGCCCTTCCTCCGTGTCCTCCATGCTGAGGCCAATACCCGGACATAAATGTTGCCGTCTTTGGTCTGCTCAATTTGACAGCCCACATGGCATTCCACTTATCACTGGCATCCTTCCACTCTTTCGAATTCCCTCCAGTCTGCTGGCGTTATCCTCCGTCAGCTCGGTCTTTTTCCAGCATATTCCCTTGCCGAGATGGGATTCGGTTATCTTGCCTTTGGAAATCCAGGTAATTCTCCGCATCATCGCTCGCCCGACCGACGGCCTCCACGAATGCCGATTTGCCAACGGTGTTCACACTGCGGGATATAAAGTAAGCTAATCTCACGCTTTTGGGTCGATATAGCTGGGCGGCTATCCAGTACAAGCGCCGTACCAAGATAACGCGTGCTTGGTTTCAATCCGTTAAGTTT
>9
TTGCTCGCGTATACACGGTATGGCCTGTCCAATCTTAATACGAGAAAGGACCCGTCAAAGTGATAATGATTATCATCTACATATCACAACGTGCGTGGAGGCCATCAAACCACGTCAAAGCGTAATCAATTATGACGCAGTAGATCGTATTAATTGATCTGCGGCATCAACTTAACGTAAAACCAACTTCAGACAATACAAATCAGCGACTAGCAACTAACGCGACCTCATGTCAACGAAGAACACGTAAGAACAACAGCAACATCCGCTTTCTAACCAAAATGATTGACGAACAATTAACATCGCTGGGTCAACAGGGTCGGGAATTTCGGCCTCATGAGTACGTATTGAAGCCTGCCGTTCGAAGCGTCAGAAAGAGAGCATATACATCAATTAAAGTGATGAAGAATGAACATCCCGCGTTCTTCCCTCCGAACAGGACGATATTGTAAATTCACTTAATTACAGGGCATTGCAAGTAATTGAGTGCAGTTTACCACTTTCCTGACAGATGAAGACTGCGTGTTGGCTCTGTCACAGACTAAATAGTTTGAATGATTAGCAGTTGGTGATCAGTCAACCACGAATAATCCTTCATATTATTATCGTGCTTCACCAACGCTGCCTCAAATTGCTCTGAATCGTCTCTCTCAGAGACATTATGTTCTATACATGCAATTACAAATAGGTAACTCATAGAAATGGTGCTATTAAGCATATTTTCAACTAACGAAGTCAGATCCACGCGAGGATCATCTGAGCAGATTGTTCTTTATTCATTTTGTGCTCCATGCGCTTGCTGTCCTCATCTAGCGGTTAAAATATTATTCAAATTTTCTGTATGAAGATTTGAGCACGTTGGCTTACATACATCTGTCGTTTGTATTTCCCAGAATGCCAGCAGGACCGCACTTTGTTACGTACGCAACCAATGATGCCCTGACTAAAACATTCCTAATATTGACATAATCATCAACAAAACACAAGGAGAGTCAGACCAGATCGTGAAACGATAAAAACGATAATTGCAAATGACGCGCCTCGTATCACATGGAAGGTTTACCAATGGCTCAGGTTGCCAGCGTCCACGAAATTTGCCGATCAAGTGCGAAAAGATTTAGACTGTGAACTTGTTTTTATTCTAAACACCGACCGTCACAACGTCTCACAATGCTATTTACTATCTAGCCACAGATAATATTCACATCGTGTTAGAAAGCCAACACCGTGTTAATAAAGGGACTTAAAAGGTTGTAAATGTTAAATTCTCAAGAAACAGCATCTGCCCAAACGTCTATGATAGGTTGAATCACGAAGTGACGCACTTCGACCCAATACAGGGAAGTGGTTAAAGCAGGAGTTTCCGATGAGTCAATATCCATGAACATAAATATTACGTTGATAATTCATTACTATTTACTGAGCATTCAGAACACCACAAATCTTTCGACCCTAAATCCATAACGTCGGTTTCTTCCGTGTCAGCACCGGGGCGTTGGCGGCATAAGTGCAATACGTGTACGCGCTAAAACCCTTGTGCATCGTTTTAATTATTCCCGGACACTCCCGCAGGAAGTTCCCGTCAGGCTGTGGACATGTTAATCCGGAATACAATGACGATTCATCGCACCTGACATACATTAATAAATATTAACAATATGAAATTTCAACCGCCATTGTTTAGGGTTTGTTTAATTTTCTACACATACAATTCTGCGATGGTTCAAAGCATCGGGAGAAAGCCATGAAAAATGTGAGCTCGCTACTGCTGGCCTGCTTATTACAGGATGTGCTCAACAGACGTTTGAACTTTCAAAACAAACCGGCAGCACATCAGGCATCAAAGGAAACCATCACCCATCATTTCTTCGTTTCTGGAATTGGGCAGAAGAAAACTGTCGACTGCAGCCAAAATTTGTGTGGCGGCACGAAAGTGTTTGTTAAAACAGAAACCCAGAGCAAACATTCGTAAATGGATTGCTCGGTTGTTTTAATTTTAGGCATTTACTCCGCTTGGAAGCGCGTGTATTGCTCACAATAATTGCATGAGTTGCCCATCGATATGGGCAATGGGTACTTGGACTGCTCATTAATATTCTGGGTTCCTTCCAGTTGTTTTGCAGTGATCAGCCTCTCGGCCGGATGAACGGAATCCGCGTTCTACTAATCCGTGTCCCGTCGAACGGAAGAAGCAACGGTGCATTATCCGCATTCGCTTCGACGATGACGCAGACTGCTTTGGGTGCATGGGACAACGGACGACGCAACGACTCATCGCAAATCCCGACGCTTTCGACAGCTTGACGACTCCCTCATCTACGTTATTTTGCATCGAACGGAATCCCAACGGGTAGAACGGGATGACTGCACTGTCAGCTCCTAATCCCGTTTCCAAGAAGCGTGCCTCCTTTCTCCTGGCATTCTCATCCCGTGTTGTAGTAATGGCGTTATCAATGATGATGATTAACAGCCAGCATGGTAAGGGGCAGCATCTAAGCTGCAGATAACCAGAGCGAGATAATCGCATGTAGTCAATGCTCATACATCAATCTCTCTGACCGTTCGCCCGCTTCTTTGAATTTGCAATCAGGCTGTCAGCCTTATGCTCGAAATGACCATAACCAGCGCCCGGCAGTAGTGAAGCCCATTATTGCTGCATGAACAGCTGTCCAATTGCCTGAACTGATCATGACGCCAATCAATCATAATAGGTAGAAGAATCTAGCTCCAAGCGCTCCTTAATCTGCTGCAATGCCACAGCGTCCTGACTTTTCCAGAGAAGTCTTTCAACGGACCCAAGCTGCTTGCGGTAGGCATCCCACCAACGGGAAGAAATAAATGGGCCGTCCGGCGCCTGTTGATTTAGGGTTTGGGTTTATGTATCATTGACAGTCTGCGAGGTAATCGGAGTAATCAGAGGCAGCTCAGCCTCCCGCTACAAATGACGTCAAACTAGATATTTCTGGTTTTCGTCTGACGTCCGTCAGTATCCATTTCCCTCCGGACGACGAACGCCAGCATATCGCGGAACGCCTTGATCAGTTTGATTATTACATTTCTACCATCTTCTACTCCGGCTTTTAGCAGCGAAGCGTTTGATAAGCGAACGATCGAGTCAGTATCTAAGATGTAGCCGGACTAAACACGGCCTGTCAAGACGAGATTGCTACTTAGTCCGCTGAAGTCGAAGGTCAACGCAGCACGAACTAGGCGATAACCCGCTAGCACTCCCGTTGCGTCGATTACTGTTTTGTAATAGAACGCACATGCTCATTATTGGACGCGAATGACCCCATTGCAAACGCGCAAGGATTCCCCGATGCCTTGTTCCTTTGTTGTAGAGAATGGCGGCCAACAGGTCATGTTTTCTGGCATCTTCGGTTACCCCCAATAAGGGGATTTGCTCTATTTAATTAGGAATAAGGTCGATCTACTGAACGGAACAAAGGTCGAGGCTACTGTGTTTTAGATCAGATTTGTTCGTGACCGATATGCACGGGCAAAACGGCAGGAGGTTGTTAGGCGACCTCCTGCGGCCAGGGTTTTCACGAAGGTCATGTGTAAAGGCCGCAGGGCCGTCAACTATTACTAATGAATTCAAAGACAGTGGCTACGGCCGTTTGGGTTGTGCTGTTGCTCGGCGGCGATGACGCCTGTTCAATAGGGAGATTTGAGTCATTTCTGCTTCCGGTATTCGCTTAATTCAGCACAACGGAAAGAGGCACTGAGACCAGGCTCGCCGACTCTTCACGATTATCGACTCAATGCTCTTACCTGTTGTGCAGTTAAAACGGGTCGAAAACCCGTTTTATGCAGGCTCTAACTATTACCTGCGAAGTACTGTTTCGGGATTGCATTTTGCAGACCTCTGCCTGCGATGGTTGGAGTTCCAGACGATACGTCGAAGTAAGACAGGCGGAATCGGTAGTAAGCGCCCCTCTATTTCATCTCACTACAACGAGCGAATTAACCCATCGTTGAGTCAAATTACCCAATTTATTCAAGTAAGTCAATATCATGCTAGTTAATATGTTGTTCGATGGAGTGCAATCATTCATGCGCTAACGTGTTGACGCATCGGTAAAAATGTTGCGATTAACTTCTTTGTGGCATTGCACCAGCGTCATACAGCCGGCTTAACAGTGCGTGACAGAGGTGGCTCGTACACGTGGTTTGGGATTAGCATCGTCACAGCGCGATGCTCTGCTGCCTTGTGCTGGCGGCATCCTTGAATAGCCCGACGCCTTTGCATCTTCCCACTCTTTCTAGACAACTCCCACAGCTCTGTGTTTTGACGAAAGTGATGTAACCGCACGGCCTGTACCATGGCAATCTCTGCATCTTGCGCGCGGCGAGGCGTCGCGGCACTGAGCACTAGGCAATAATCCGCATAAGGCGTAAATGTTGCGAGCACTTGCAATCACTTTGCCTTGTAGTATTTCTCCTTCAAGCTTTTGCCACCACGTGTTCCCCGATACCTTGTGTGCATTGGGCATCAGATAGTTGATATAGCCTTTTGTTGTCGTTCTGGCTGAGTTTCGTGCTTACAGAATGCAACGCATGGAGGCAGTCGCACGGCTTGTACTTGCGCCATCCCCATAGCATCCATCACATCAGTACTAGGAAAGAGAGTCAAGAAGCCGTGTAAGCGTGGTCAGTCGCACTCATCATCGGGCTTTGTAGAATGAAGTTCATCTAGCTACGGTTTTCAGTCTCAGTGCGCCTTCTCCCTGTACCTGAATCAATGTTAGGTTCCCGAACATGCGCCGGTATCGATACATTTGGTTGGCAAGACTTGAGTGGTTTCACTGCTGGCGTATGACCAAAGATGAACGTGTCCCTTTGATTTCTGTTCACGATCCCGTTTGTGAGTTGCTGATTCGTTCGCGGTTCCAGATTGACCTGCTGATGATCAACTGGGCTTTCCAAACTGCGTATTCGTCAATTAGGGATAATCACGGCGTGGCAGGATAACATATTTTATCTTAACGAGTTCACTCTAGATGATTGGACGGAAGTTCATCTGCTATTTATGGGCAAGGTCTAGCCAGAATTTCTTCTGTCGTAATCGAGATTAAAGAACCAGCCGCCACCGCCATGTAAGCATGCCAGTGATTAACGTTTCCACGCTCTGATAAGCCATCAATCATCATTTGCTCATGGTTTCCACGTACAATAGCTGACCAGGGAAGTCGTGATTAATTCAGGCATTCAACGTTCTCTGCACGATCAACCAAATGCTCCCCACCGAGATAAGCAGGTCTTTGTTGTCGAATCCAGCACGATCGTATCCGCGTTGTTCATCGAACTTCGTGTAGCATCCGTGCAGATCGCGGCGCGACTCGTATATTTCATGTAAATTTGCGGGTCATTGTATGCCATCAATTTTTCGTAATAGCCCATCTCTTTCACCTCCATCCGCGATGAACCATGAGAACGGTCGTTAACAATGTCCATCGTGCATTTTCCCGTCTTTATCATCAACCGTATTTTCGTATGAATGCACCGCGACTAAGTTTCAGTCTGCGTTGCCTTCACTTCTCCTTTCCGTATGTTTCGAACGAGCATGTCTGGAATGGTTTTACTATGAGACGTCATGCGGCCTCATTCTGCTATTTCGCAGGTCTTTGAGTTTCTGTTGGTGATATGCCTGTGATCGCCTTGCACTCTGTCGATAGTCCAGCGATGGCGGTTATGGTTTGATTGTTCGATTTCGTCTACTGCTTCCTGCCCGATGCTACTAATCAGTTCGACGCGAGTACCGGAACGAGATTTCCGCTTTGTGCCTTGCCACCACGCATTGCTGCGTGAATATTGCGTTCATTAAATCGGAGTCGATGATCATGCAGCAGTTATTCTGTAAGTAATGTCCGGCATCCCACTGAGCGACGTACAAGCGTTCTAATCCGCACGATACATGGTAAGTCGCGGTCTCTTTCTGATGAAGGCGTTTACGGCATTGTTTGGCTTGTTTAATCCAGTGACTGCGGCTGCTTTAAGGCGAGTCGCGTAATCTTAAGTTTATCTTTCGTTTCTGCTCCTCGTCGTCGTTTCTTCTCTGCTGCTTTTCGCTTTCGCGCTTTCTTTATTCGTCGTTCGAGTGCTATCTTGGTTCCACACTCTGGAGAGCACCACATGATTAGCGAATGCAGGTGAAACCATTCCCGGCATTCATCGTTTTACATCGTCTTCGCGCTGGTTTTAGCCATCATCTTCTTCTCCTCGTGCATCGAGCTATTCGGATCGCTCATCAGTTCTGCGCGACCGATCGACGCCACGTGAACTTCCAGCACATGCAGCTTCTGACCGCGAAGTCCTAGCGCAGGACGTTAAAGCTGCTCGCTCGCCGACGCTTTCTTGTTCTGACTTCGATTTAGTTAATCACCTTGTTTTCCTCGCACGACGTCTTATAAGGGGTCCCACAGGTGAGCCGTGTAGTTGAAGGTTTTTACGTCAGTAATTCTTTGTGGGATTGGCTTGGGTTTATATTTCTGGTGCGTTTCTTCGTTGGAAGGTATTTGCAGTTTTCTACAGATTATGTCGGTGATACTTCGTCGCTGTCTTCTCACACGTCCTCCTTTTCCTGCGGTGGTAACACCCTGTTGGTTCTTTCAATAACGAGACAAGATCCGATTCCAGTAAGGAGTGTACTTGGTCGGAAGCGGTTATCTTCTTTGCATTCACCGCAGCCAGACGACACCCGCATCAGATGCAGCTTCCTCCCGAAGTCGAAATCAAGCTGCCCTCGACAAAGAGCGACTCTTTCGCATGACTGATGAAATACCAGCCGGTATCGAATCTTTTATAATTATACAGTCCTGATACGAGGCTTGATAATCATTTTCGTGAATACATTGTTCGCGATACCGTCCCCAGCGACATTCTTCCTCGGTACATAATCTCCTTTGGCGTTTCCCGATGTCCGTCACGCACATGGGATGCCGTGATATACATGCCTACGGAACCCGTTGGATCCTCCTCATCTTTGCGACTACAAGTCCGATTTGCGTTGGGTTTAATGCAGAATATGCATATTTACCAGATGTTCCGGTATTGCAAATCGCGAATGGTTGTTGCCGTCGCCCATGCGGATATCTTCCTTCTCATAAAGTCTGACAGTTCAGCACAGATATCTTGATTCCAGGCGTTGGCTTCGTTAGGCCGCTTCGGTTCATCAGCTCTGATGCCAATCAATCCACGTGGTGGACCTCCCTCGCCGAAATGGTCATCACAGAGAGTATGTTGGTGAAGGGAACGAGTTCCTTAATGATCGTCATCGGAATGCGCAATCCTAAGCCGACGTATGGAGTGCCATATTTCTTTACAGTGAGACCTGGCTTCGATCAGGCATTCGCGTCTGAATATCCTTTGGTTCCCATACCGTATAACCATTTGGCTGTCCAAGCTCTAGGTTGATATCACTGAGCTGCAATACCGGTGAGCGTATATCCAAAGGGGCTAGAGCGAACTTCACAACTTCCCCCGCCTGACAAACCGATATGTCACTTGGATGTTCACATGGCTATCTTGGCCGGCGGACGTAATGCACGTCTTTACCTGCCCGTCGCTTTGCTCCATTAGCCAGAGCATAAATATGCTGACGTCCTTGAGCAGGGGACTAACGACATTTATATGCAGCCCTGTCTCCCCATCTCGTGTTCCACTCCGAGCCAGTCTCGCTTCGTCTGACCACTTAACTCACGCTCTGTACCGAATGCCTGTACAGCTCTAATAGCTGCGCAAATTCACACGCATCCTTAGTGGTTGACCGCTTACTACAAAGCCATTCCCGGCCAAGGTCAGGAACAACATCCTGCTGCTTTAATGCTGCGGTAAACACACACTTCGAGCTTTCTGCATCCAGCCAGCGACCATGCCATTCAACCTGACGGAGAAGGTCTAAGCAGGCCATAGCTTCTTCCTGTTTTGGTCTAAGCTGCATTGCGTTTCGGACATCATAGACTGATGAGTGGTTACCTAGAAAGGATTTGATTCGTGTAATTAGTAGGGAGGAGTGTCGGTACTGACGATCCAACATCAGTTTTGTATAGACCTTCTTGCCTGGGATCGAATGTTCGGATAGTTAATGTTTGTTAGGTGACTTTATACCTATCTACGCCGATA
>10
CTCTATGCTTGTTAAGCGCAGGATTAAGACACACGTGGGACTAGGGCGACAGGATTATGAAGCGACGCTGAAAAAGCCGAAACAGTCCAGCGTGAAGGTGTCTGCGGGCGATCGTCAGGAAGACAGTGCTCATGCTGCCCTCGTTGAATCATCGCTTCAGGCCCAAGAACTCCACGAACGCTCGAGAAGCATGCCGAGCAAATGAGAAAATCAGCCAGCATAAGAGCGCCGGGATTTGTGGAGACGGAGAGTCAGTTCTAGATCCGGGAGAGGCGGCTAAACGTCGCCAGCTGTCTTAAAGGAAGAGAACTCTCCTGCTGGCGCATAAAATGAGACGCATGAGTACAACGCCAGCTGATGCACTTGGCGACAAGTACGTATCAGGAGCGCCTGAACGGCTCAGCGGGCGCAGCAGGATAAATTCGCACAGCAGCAACGGGCAACGCGCTCGGTCCCTAATGCTCTTACGCGAAGCAGGCGAAGCACCGGGAAGCCGCGAGAAGGAAGCGCCGAAGGAAGAGGGCGATCGAGGGCGAGAATAACGTCATGTCAGCAGCAGAAAAGACCTGGGCTGAAGACCAGCTTCGCGGGAACTGAACCAAGGCCTGAAGTCCGGCTGGAGTGAGTGGGAAGAGAGCGCCGGACAGTATGTCGCAGGTAAATGCAGCCACGCAGACCTTTGATGGTATTGCACAGAATATGGGGGCGATGCTGACCGGCAGTACAGAACCCTAAGCTTCACCCGTTCCGTGCTGTCCCATGATGACAGAAATCGGTCTTAATAAGCAGGCAATGGTGGGGCATGTCTGGAGGTATCGCAGGCCATTGGCGGGCTGTTGGTGGGGCGCATCCGTCGGGGCGGTACAGCCATTCAGGCCGCTGCGGGAAATTCCCATTTTAAACCGGAGGATTTGGGAACCGGCGGCAAATATGAGCTACATAGGCTCAGGGGATGTGTTCACGTGGTGAGTCTTCACGAAGGAGGCAACCAGCCGTACCGTGGGGAATCTTTACCGACTATCCCGGCTATGCCACCGGCGGTTATGTCGGTACCGGGCAGCATGGACAGCCGTCTAAGGCGTCAAACGTTTGATAAGAATAACCATGTGGTATTAACAACGACGACGAACGTAAGATAGTCCGGCTGCTCTGAAGGCGTAGTAGTACGCCCGCAGGGTGCCGTGATGAAATTCAGACACAGATGCGTGATGGTGGCCTGTTCCCCGCTGACCTAATGGAAGCCTCTGCTGGAAAGTACGAAACCCGGTATGGATGTGGCTGTTCGTCCCTTCTGTAAGAAGGTGCGCTTTGGTATGGCTATTCTCAGCGAGCGCCTTCAGGGCTGAATGCCAAACCTGGAAAGAGAAGCCGATCCCTCTTATCCGAGAGGAGCCACGATAATTGGAGAGCGCTCTCTGGAATTCATTTCTGTACCTCCACGCCTGCTCTGCGGGCAAAGCTATACTGCTAAAATGGTCGCGGGTCAGTATGCTGCGTGTTGAGTTCAGCAGAGTTTGAACAGGTGGGTGAAATGCAGGATATCCGGCAGGAAACACTGAATGAATGCACCGTTTGAGCAGTCCTGGCCAGCGTGGTGCTGGGCAAATCGACCTGACAGAGGTCATGCGAACGTCTTTTCTGTAATGAGCAGAACGAAAGGTGAGCCGTCACTGGCGGGGCGACAGTATCAGCCGTATCCCATTCGCTAGGAGCGGTTTGAACTGAATGGCAAAGGCACCAGTACCGCACGCTGACGCTTCTCTAACCTGTACGGTATATGTCACCGGGATGAGAAGATATGCAGAGTCTGGTTAGCGGAACGGTAGTCGATCGTTAACGCCGTTTTCTGGATGCGGTAAATTCGTCGTCAACGGAAACAGATTCACGATTTGGAGCAAGGAGGTGATCAGCCGCTGGCGCATTGAGCAGTGCAGCGACTCACGCTTGAGTCCTCCTTTACTATTCCACGCCGACGAAACGATGGCTATGTTTTCCGGACGTATCATGCTGACAACACTTAAGCTGATCTATCGCGGTACGGATTAGTTGAGGTCCTACGGCTGTCGGATGAATATGACCAGCCAACGTCGATATCACGAAGATAAATGCAGCAAATGCCTGGATGTTGTACATTTTGGCATAACGTCGGCAACTTTGGCGGCTTCCTTTCCATTAACAAAGCAGTAAATCCCATGACACAGAAGAAGCCGAGATCCGGCACGCGAAGGGGAGCTCTCCAGGAGGCGAGGCTTCGGCGATCCGAAGCACCGCCGAGGGGGAAAGATATTTCCCTGCGTGAATATCTCCATCCTCCGCGGGGCTTATTTCCCTGCTTCCTCGCAGCTCTCCTTGAGGCGAAATGCAGGGTGAGATTGTGGCGCTGTTAGGACACCCCGGTGGTCTGCCTGCTGAGTGAGGCCGACCGGCGGCTGCAAGGTGCAGTTGATTTGCCGTGGTGGCTGGTCTTGAGCGACGATTCAGACAGTTCTCGTGTGCCAGCCGCATCACCCGGGCGGCGCTTTGGGAGCACCGTGTGACGACTGTTACACTGTTCCGGCTGCTTATCATCTGGGGCATTGAGATGCCGGACTTTCATCTATGTCAGGACTGTAACTCTATCAGAATCTCTATCTGGATAATCTGGAGAGACGGGTCTTATCAGGTGCCGTCAGGCGGCACAGCCGGGCGATCCTGCTGTGCTGTTTGGTTCATCATCAGTGCCGAATCACGCCGCATTTACTACTGCGGACCAACGGCGATGCTGCAGCATATTCCTGACAACTGAGCAAACGAGAGAGGTACACCGGACAAATGGCAGCGACGCACACTCCTCTGGCGTCACGGGCATCGGGGCAGCGCATCTGCTTTACGGCATTTAAAGGCTTTTGGTCGCCGCATGATGCTTCGTGAAAACGGGGCTGAAGCCATCCGGGCATCACACAGCTCCCGGCGTTTCGTCAGAATTAGCGAACCCGGCTGGTATCAGTACGATTGCCGGGCGGGACGTCAGCACGTCCGGGTCGTAACGCAGTTACATGAGACTCTGCCTGATGGCCTGCTGTAATTCATATGTTCCCAGAGTCGCCGGGCCAAGTCAGGTGGCGTATCTTCCAAGATTGTCCGCGGCGAACTCTCCTCTCCGCATTCTTCCCGCTCCTCTCCTCCGCGAGAACTCGGAAAGGAGCCATTGGGGCCGGTGGTATGACCGGCATCCTGTTCTCTCGGTGCCAGTATGGTGCTCTTAAGTGGTGTGACAGGGACTGAATCCGGGCACAGAACAAATGGCCCGTAACCCTATAATAATGAACATACCTATTTCCTCACTGATAACATGGTTGCCCCGGCAATGTTCTGCCGTGTTCGTACGGGGAAATGCGCGTGGGGTCACCGGTTTCTCAGGAGATCGCACGGCAGACGAAGGGACGGTGTCAGCTTGTGGTACTTGGTCGCTGATGCACTGTTTATGTGAAACCGCCTGCGGGCGGTTTGTAGTTTATGAGCGTGAGGGAATGGTAAAGGAAGCAGTAAGGGAGCGAACGCGCGAAGCGAAGGACAACCTGAAGTCCACGAAGTTGCTGAGTACTGGATCATCAGCGAAGGGCCCGATTGAAGGTCCTTGGATGGCTTAAAGCGTCCTATCATGACAGTAATCGCCGGTGCTGGACCGGCTAGAATACCAACATATCCGTGTCACGGTGTTCCGGCTGGTAGCAGGAGCATCAGACTCCGCCTGAGGATTGAATCCTTAGACGTGGAGACGGTGCTGGGTACGGAAGTGAAGAGGTGACACGCCGATCACCGACGATGCAGATTCTGCAACATGAACGTCTGCGCTTTACCTTCGGGTGTACAGGCACTGGTGGAAACCTCAAAGTGACAGGAATCCGTCGGAATTGCCCTGCTGGTTCAATACGATAACGTAGCTGTAGTACTAGAAAGACATCACCATTAAGGCAAAACTCACCTCGCAGTTATCTGCCTCGTATGGTAAGCCGCACCCCGAGGGAAGTCCCAAGGCAGGAGGAGCCGGAAGCCGAGAGCTGCCGGTAATAGATACTTCTTCCTGGCTATGGGGCATGCCTCCTGCATCGATCCTCGCGACCTAGCACTGGTCGTGCAGGTCAACGCGCGCTACAGTTCGGCAGCCAGCAGGTGAGCCGTAATTATCATCTGCGCGGGCGTATTCTGCAGGTGCCGTCAAACTATACCGCAGACCGCGGCAATACAGGGTATCTGGGACGGAACGTTTAAACCGGCATACAGCAACAACATGGCCTGGTGTCTGTGGGATATGCTGTACCGATCGCGCTACGGCATGGAGAAACGTCTTGATCTAGGCGGATGTGGATAAATGGGCGTGTGATGTCATACTTAGACCAGAGCACCGACGTATGCTGAATTGAGTCCCCTAAGCTTTGGCAGCGCCGACCACAATACTAGCTGTAATGCGTACCTGACACGCGGCTGCCCAGGTCCCGTATTGCTCGGCGTTTCTTATGAGCGGGTCGACTGTAAGATCTGAGGACTACGGGCAGACCTAACCGTCGATAAGACGTGCGAGGACCGTGATAAAGCAGTAACCTACCCCCGGCCTTATCTAGGGTGGCCACCGTTCGCTACAGCTTCACGCCCTATGAAGGACCGCCATAATGCCGTTGGAGGTGAACTCGATTGACCCGAACACGGCTCGTAGACGCGACACACTTGTTGAAGACTCACGCAGGCCATTGCCGTTACGGTCGTAATGTTACGAAGATGGATGCTTCTTAGGCTGTACCAGCCGGGGCAGGCACACGCCTGCCGTGGCTGATTAAACAGGACTGCTGGAAACGCAGACCGTGGATTTCAGGCAGAGAAGCGAAGCCAGGGAACTGGCTGAGGAGAAGCCTGGCGAAGGAGGACGCTATGCCGGTATCAGCATCCGTGATTGTCCTGGCTTGGCTGAAACAGCCAGACCCCGGACGCTGACGCTCGTGCATCGCTTACATCCTCCATCTCCCCTCCGTACTCGCCTGGTTCCTCGAAATGCGACTGCCATTCCTGAGTGCGAGTCAGCCTTTACCGACGGCGTGAAGGTAATGAGCCCGTGTTTCCTGACGGTGTCTTGAATACAGCGTATGGAGCTGAAGCTGCCGCCCACGCTGCCGAGGACGTTCCGGCCGCGTCAGTATCCGTGAACGACGGCACGTATGCCATCACCGCCGTGCAGCATGTGCTAGAAAAGAGGCCATCGTGGATAACGGGGCTACTTTGACGGGGAACAGCTTGAATGAATGTTACGCCGCCAGCGGTGCAGCACCTGACCGCAGAAGTCACTGCAGACCAACACCGGGGAATATCAGGTGCTGGCGCGATGGGACACCCGAAGGTGGGGACCGTGAGTTTCCTGCTCCGTCTGACCGTAACAGCGGATCGACGGCAGTGAGCGGCTGGTCTACGCTCAACGGACACGAATACATACGCTTCACGCAACTGGCGCTGGAACTACAGGCTGACAGTCCGGGCGGTAAAATGCGTGGGCAGAGCAGGGCGATCCGGCGTCGGTATCGGTTCCGGATTGCCGCACCGGCACTAGGCGTCAGAGTCACTAGCTGACGCCGGGCTATTTCAGACTCACGCCGCATCTTGCCCGTTTATGACCCGACGGTACAGTTTGAGAGTCTCTGGTTCCCTAAAAGCAGATTGGATATCAGACTCAAGTCACGACTCAGCACGCGTTGGTGACTTAGCTGTACTGGATAGCCGCCATGGTATCAATATCAAACCGGGCCATGATTATTTTATATCCGCAGTGTAAACACCGTTTGAAGGGAATGCGGGCGAATGAGGCGGGGAGGCTCATCAGGGCAGGAAGAGACCCTGGATTTTTCAAAGGCAAGATAACCGAATCCCATGCCTCCTTCCGGGGCATTGCTCTGGAAGCGCCTGCACTCCCGGAGGGACCTCCCGGCTGGAAGAGGAATTTTCGAAGGATCTGCAGTCAGTGATAATGAATGCCATGTGGGGTCGTCAAATTGAGCAGACCAAAGACGGCAAACATTATGTCGCGGGTATTAGCCTCAGCATGGGGAGGACACGAGGAAGGCAACTTAGCCCGTTTCTCGTTGCGCCAATCTGCGGTATCGCATTTATTGACCCGGCAAACGGGAATGAAAGCCGATGTTTGTGCAGCAGGGCAACCATGATATTCTATGAAGACGACGTGTCTCCTGAAGCGCCTGACGGCCCCACCATTACCAGCGGCAATCCTCCGGCCTTTCCAACCCTTAACGGACGAAGCTATAGTACCCTCTAAAATGCGGATATCAGTGGCAGTGTGAATGCGACTCCGGACGCTCAGTAATGTCTACGAGCTGAAAACTGTACGATAAACGGATCACGCTGAGGGCGGAAAAATGGTCGGGACATTGTAAAGGCGGCCTCGAGCTTCCGGGCCTAAACGATCAGGCGGTGTAACTGTATAGTCAGGTATACGATCGTACTAGATTGATAAGATGGGCATATCGGTTTTTGATTCTAGGTAGTGAATTATATTTAGTAACGTTGATAGATAAGCGTGATTACTACAAGCAAAGGTTCGATGTTATCTAAACAGATACGTAAATAGTTAGTTACTTTATGGTCCGTTATGGGCTAGACCCAGGAGGCGGTACAGGTGTTTCCCCGTATGTTACCTGCAGCGCGTTCTCGGGAAGCCTGTGATCTGCTGGCTTTCGCGCCGTATCAAGTTGGGCAGAAGAGAAGGGCCGAGACCACGATGGCGAGGAGTAGGAGAGCTAGATAAGAACAGGAGGAGGGGTGAAACATAGTTAGTAGATGTTACCTAGTTATATGTCCTAGAAACGGGCGTTGATTACAAACATCCAGAACTGAACCATGCGGTAGACGTGTGGTTGCGCTTTTACGTGTGCCCGCATTGCGGTACAGTCATCCCGGCCCGTTAGGCATAGTAACATGATGGTTGATGGGCTATTTCAAGTGAAACCCTGACATTGTCCCGTCTGTCGGGCGGGATACCATTGAGTCGTATACAGGCATTAACGTGAAGTACGTCAATACGTAGTATAGACGGATCAGGTACGTTCTGTTT
>11
AGTAGTGTTGCTGGGCTAACCTTGCCGTTCGGGAAGCGGATTTATGAAACGGTATCGCGCTTCACATTAAACCACGCCAGCAGCGCCTGCGATTCCCTGCTCTCCGGGCATCCACGCCAGCGTGAAGCCTCGGGTCGCGGCAGATTTCTGCCCCTGCCCGGTGGCAGTCCAGTCTGCAACCTTCATCATGAGATAGCTGTCGTCATAGGACTCAGCGGTCAGTTCGCCGGGCGTCAGGTCTTTAACTTTTGCCAGACCCGACCAGTCAACGTCTGAAAGCATTCGCGTAGATTACCGCTCCCGGTAAACCCACAGCCTGTTGAGGCACCTTTCACGGCATTGTAGGATTTGGTACAGGCAGCGTCCTCCACATTTCATAGGCATCGACATAAGTCAGATCGGCTGAACTCCACAAGCCCGCATCATCGTCGCGCCGGTAGTCATAGCCGGGTGGCCACCATACTGGTGATCAAATTGGTAGACAGTGCCTGGATATCGCTCATCACATCTGGATAAATCCGACTCCATTCATCCACGCATCCAGCTCTGAATCCGGCACCTGAGCGGCAGGAAAACTTCGATATGCAGCTCCGCCTGCCAGGATGCCCTGTCCAGCTCTTCGCCCGTGTATTCAGCCCACCGGTGAGAGATAAACGGCATGGACTTGCCGCTGAAAATCCGCCTCAAGTAAAAACAGCGGGGCGACCATCAAAAACGTCGCCCCCGGGCTGTTAATGCTTCTCCAGTGCATCCAGAGTACGGCTGCACGGAGTCCAGTATGTTTCATCGCTTTATCCGGTCCTCAGTTTGATGCTGCAGGCATAGCCCAGCTGATTGGAAGACGTTCTAATCGCCTATCCAATGACTTTGTTTAAACGCCGTGGTTAGCACAGCGCCATCGGGATTTTCACCACAACCTATCATATTTTGGGGTAAAAGCCACGCTGCCAACCCTTAAGCACATCCGCATGTTTCAGTTGCTGAATAAACGCGCCGGGAAGTACAGCGACGGTTACCCACCACAAGCACGCTGCCGCCACCTTTCAGGGATGAACGGGCTCGTGCTTTTACGACGCCGCTCGGCGCGAAAGATGACGCGCATTACCCAGCTTGATTACGGGCAAATCCCCCGGTTAACTTTGATTCTGCCTGTGGATTTGACCGTGGCTTTCATAGCCTGGCCTGTCTTTCCTTTACCAGTTTCCGGCGTACCTTTGTCTCCACGGGCAACCTGTGACGCCGACTGCGGGATATCGCGGATGAAGCAACGCGGTTAATGGCCATTGCGGCGGCACCAGGCACCGCGTTTCGCTGATACGGCTGAGGTTTTCAACGGACCCGCCTGCTCAAGACCTTTTGGTACATACATCCCCCTTTCAGCGGACGGTTAACGGCAGGCTATCACACGCGTCTAGGTAAGGATGACAACTCCATCATCTAGGTGAAACCCGATCTACCCAGAAATTTTCCTCACCGATGGTCACTCATCGTGTGCCGCCACGCAGCTGCCGCTCTAATGCATCAGTCCGGACAAACAGGACGGGCTGGAGGGCTATTCAACGCGCACGCTGTCCGGCATAGTAGTATTTTCAGGTATATCATCAAAACACCACGTATCGCCGCACCTGACTGCTCACCGGATGTAATGGTGGCTGACGTTCCATGTACCCGCGTATCGTTTCATCGGCGCGGGCAAGTGGGCAGCATCGAACAGGTTATCGAAATCAGCCACAGCGCCTCCCGTTATTGCATTCTGACAGGCCGCGCTCTGTCATTTCGGCTGCCACACCGGCAGAGACGGAAACGCGTTCCCGGCAGCACAAATGCCACAGGTTCATCCCGCGTGGCGTGAAGTGCATCAGTGCAGCTTCACCAGTGCCACGTCAATCCAAGTTCAGACGTATCCAGAATCACCACGGTATCCGGCTGCGCTGATCCCACAGCGGTTTCCATGTCCGTCAGCACATTTCCCCCGGCTGAGGGGGTGTTAACCGGCAATTTCATCCGTGTCATCAAGCTCCCTCTCTCTTTCAGGTGCCACACGCCCCGGTTTTTACTTCTTTCGTCCCTAGAGTCAGGCTCAACTAACTAGTTCAGTGTTTATACGAGCGGAGACGGGCAATCCAGTTCATGATTTCGTCATGGACTCCTCCACAGAAACAATGGCCCCGAAGGGCCATGATCGAGTTACTAACGAACTCATCAGAGTCAGCCAGCAGCATCAGTGCTTATGAATCGACTAAATCTGACGGACCCTGCGCCGGATCGCCGGTGTCACCCAGTTTTTAGCCAACGGGCACAAGCAGTTTTAGATGCCTTCGCGCTGTGCGTCCGCATCCTGAATGCAGGCCGGCCGGGGTGTGCGCAGACGCGTGCCTGAGTGTTCCCCAGCATCAAGATGGCGTGTTGTCCGGCAGGAAGTTCTTTTGACCCCGTTTCCACGTACTGTCCGGAATACACGACGATGGGCCACATCGCCATACATCCCCTTATAGGACACCGCTTGCCAGGTCTTTCACGCTGTCTCCAGCTCGGAATTAGAGCCACGACGGGTATCCAGCTTCTCCTTGACGGCTTTGAAGGAAACGGAACAGCGCCAGCCTTTCGGATCGAACACGATGATATTGCGCCACCGCTGGCGTTCAGAGCGGCTTCGATATCGTCGGTCGGGTCATACGGCGTGACTTGTCACGCTTGCTCCACTCCGTGCGCCTAAATGCGTGATGTTATTATTCTCCTCACTGCGTAACGGGTCCACCTACCTTAACGGATCCGAAGGCTTCACGGTCATGGTGTATTTGCCTTAAGCACGGCAGAAACTGCCTGCATCTCTTCGACCTGAGCAAATAGGCCAGCTGCGTACGCAGTGTTGCAGGCTTGATGCGACGCGGCGGTAGTAAGCCGGGTCGGGCCAGATTCTGCGTGATTCATCCGGCAGGCGACGCAGGGTCATCTGCGGATTCACTTCGCCTGCTTCTGAGTGGCATATCCCGGCGTAATTCAGGATGAGCCCACGGAGAACGGATAACCTCAAGCGGAAACAATCGGCGAACGTGATCTCAGCTAGGTCAGTCCCGGAATTTGTAGAGAGATAGACTTTCTCCGTGTGAAGGGGATAGCTCACGGAAAAGGAAGCAGAAACAGCGGATCAACTTAAATTTCTGCTCATTTGCCGCCAGCAGTTGGGCGGTCTTACATCGACATAAAATCCCGTAAAAAGCCGGACAAGGCGGCCTTCAGTGATGAAGGGTAAAGTTAAACGATGCTGATTGCCGTTCCGGCGACAAACGCGGTCCGTTTTTCGTCTCGTCGCTGGCAGCCTCCGATCAGAGCACATCCTCATAACGGAACGTGCTCAACTTGTAGAACGTCAGCGTGGTAGTGTCTGGTCAGCAGCAACCGCAAGAATCGAAAGGCAGGGATTATGGTGGTATGGCCAACGGCAAGAGCCCGTCGGTGAGTGAGGGCATAGGTCGCAGCGCTGGCACTGACCCGCCCATCGGGGGCGTACTGCGGCATGTTCGCACTCAGATTAGCCGCCGGGCTGAGGATTTGCGTATAACAGTATCCTGTTAGGTCCAACATGGGACCCCTGTTGGTCTAGATCCTAGCATGAACGCCTACGTGCCGCGAGCCGTCTCGGGGACCCCTCTGCCGTAGCTGCAGCCAGCGGTGCCGGTGCCCCCTGCATCAGACGATCCAGCGCAGTGTCACTGCGCGCCGTGGCACTCTGTGATGCTGCGGCCAGAATGCGAGTGGCTTTCACGGTCATACGGGGTTTCTTGCCAGCACGATCGTGCCTGTTCTTCGCGTCCGTGAGCCTCCTACAAGTTGAGGATCCCCATAATGCGGCTGTTTCTTACGCAACCGCTTGCGGTGATCTGCGCGTTCTCACGTCCGGCTGCTAGCCGCGCTCGCGTTCTCGCTCGCGCTGGGCTGGCACCACGTCAGTAGACGTCAGCCTGCGAAGCAGTGGCTGAAACAGTTGTTGATTGAGTCTCTGTTGGTCATTCGCCCTCCTGAGAGACGGGATTACGGTGCATCCAGTGCATCACGCATGACGGTGATCGCATCGGTGCTGTTAACAAGTTCATCAGCCAGTCCGGCAGCATCAATGGCCTCCGTAAATGGGTGTGTACTGCAGCCTCGGTATCCAGCACAACCTGCACGGACAGAGCGGTATATGCCGACACCTTCTGCGCAAACATCTGCGGGTTGCGTCCGTATCGATAAATGCAGTGTCTCCCAGGACGTCATCCGGAAGATGGCTGTAGGGTTGCCATCCACCTTATGGCTGCCCTGTAATCATAATCTATTTCCACTGCGTTTCTCCAGCGCAGCACCGTAATTACTGTGAGCCATCATGACGGATGGAGCTGTCCGTCCGGCGGTCTGCGTGACCCCTCCGGAGGCGGCACTGGCAAGCAACTGACTTAAGACTGCAGTTCATTTACCGTTGGCAAGCGCCCATACCGGTTTTATGTCACGCACACGGGCGATGATGTCAGCGCAGAGTCAAATGCCCCGCCACCGGCCTAAATCGCGTGTCCATATCGAGCAGAATGCGTCCACCATCGGATCGCTGGCAGCCTGTTGCAGACGGTGCGATAATGCGTTGTAACCGGTCATCCCCGAGTACGGCTGCAGCGCCCGTCCGGCTGACGAGCGTGCCGGACACCGGCAGCACGGCGATGCCGTTCATGACCTGATAACTGCGGGCCTGTCGGTGTCCGTCAGTATCCATCGGATAATGCCAGCGTCGCGAGTGCCTCCTGGAGATCAGGCTGTCGCCGGACACCGCATCCGTCAGGCTGCTGATCCCAAGCTGGCTGCAAGAAAGCGCACAAAAGAAAACCCGCGCATAGGCGGGTTCAAGGCATCAGCGGCTCATTAAAGCGGTTGGCAATATGCGGGGAGATTACGCATAGCTCTGCTGTCACTTCTCCTCCTCTGTTGATTGTCGCGAGCCCAGATTCAATGCCTGCAGCCGCGAGGCGGGCGTCAGACCGGCTTAAAACGGCGCTCCATCGTTTCGACTGACCTGCTGGCAAAATTTCCTGATAGTCGTCACTACGCGTTTTGCGCACTCTTTCTCGTAGGTACTCAGTCTAGCTTCTATCAGCATCACCGCTTCCTGAATCTCCGTCGGAGACCATCGCCAGCCACGAAGCCGGCACGGAGCCCTATCGATCGCAGTTCCCCCAGGCACTGCGGGCTTCCCTGAAACTGAAAGCGCGCGTTGAAGGTAACGTTACGACGCGGCGAACGATTGGCCTCTTCAGCCAGAACGAGCACGAAACATCGTGCCCTCGCCTGACGGGATGCGACGAATTTTCGCCGCCCCATAAACTGCCCACGATAGTTTCGCAAGCCGTGCTGTCGGAGTAGCTCATCTGGGCGTAATTCCGGGAAAGCTGCGTACGAGACACCCAGCCCGGCGGACCGATATACCGCAGCAGTGACTGCTCAACACGGAGTAGCCGTTATCTTACGTATCCTGAGCGTCTTGCAGGTTCAGTGAGTCACCCGGCATCACAAGATTATGCGGTACTTTTGCCCTCCCATGAGCTGACGGCGCTGCGGCGTAACTGAAGCAGGTTTCACCAATCCAGCCGGTCATGCTTTTCCCGCCTGCTCCTGACTGTTCTAGCCAGAATAGAGCAATCCATCGGGACTGCGTATCCAGCTCACTCTCATTGGTGGCATACACCGCCTTAGATCACAATGGCTCTGCAGCTGCGTTCTGCAGCGTCAAGCATCTTCATCTGCTCCCCATCACGCTGTAAACACAGCGGATTTGCTATAGAGGTCTGCCGTCCTCCACGGGTTCAAAATAGGCAGACCCGAACGAGGCTCCTGCCCGCCGGGTAACTCACGGGTATTCAGGTTCCTTTCTGCGGCATCCAGCCAGGATACGTCCTCGCTGACGGTATCCCATAGCCGCGACGCTGTCATTAATCTGCACACCGGCACGGCATTTCCGGCTGTCGCCGGTGGTTGTTTCGGGTGCCTGATGCGCTTCGAGTGAACTCATCCGACCGTCCCTGAAACGCCGCGACGGACTGGTATCCCCAGGGCCTGAACGAACGAGTTCACCGTTGCTATGAATTCGACTCGACTTCTTCCCGAATCATCATGCTTAAACGTGCGTTTCGCTCAACGTCAATGCAGCAAGCAGTCATCCTCGGCAAACTCTTTCCATGCCGCTTTCATGACGCGGGCGAAAATAGGCACGGGCTTCTTCCTCCGCATTACTGCCCATAAGCTCCAGCTTGGGCGATGACTGAGCCGGAAAAGACCCCGACAAACTATTAATGCGGGTGGGTGCCCGTTGCGATGCGGGCTCGCACCCCGTTATTGCGTACTAGAGATCGTCCCGGGCGGATCAATTGCCACGGGTAAAGTTGGGCAACAGGGCTGCATCCACACTTTCACTCGGTGGGTTCCACGACCGCAACTGCCCTCCAAATCTTGAGCCCTGCCGCCACCGTGTGATAACCGGCATATTCGGCGCAGCGATGTTAGGTCGGTCCGTAGAGAAGGGTGGAATGGTGGGCGTTTGCCACTACGGACAGTCGCTGCAGGTCCCTGCGTCGGTGTGCCTCATGCCGGTCTGCACTTCCTCAGCTCTGCATTACTTTTCAGGTCAGACGCCGAAATGGCTGGGCTAACGCCCCTTCGTGCGTCTTTCTGTATCCTGTTGCCCCGTTTACCTATCGTCATCAGGTTGCACTGCAGTGCACGGCAGCGTGCAAGTTCTTCCGTCGCCGTCATTCATCCTCTCCGATAAGGCACGGGCGTAATCTTATTGCCAGTGTTTTCTGTTGGTTGCTGCACCATCCTCCTTCAATGAGAGCCCAGCAGGCACTGGCAATCTAGAGCTGCCAGCGGGAAATAATGCACGCATCCCGCCGCCAGCGCATAAACGAAGCAGTTGTGAGTCTCGCCTTGCAGTTGCTTTTGCGTGCTAGCCACAGTATTTTTCCTGCCATCCACCCATTTTCGACCTCTGCTCTTCAGCAGTCATTAGTGCGCTTCGTCAATCAACTATCCGGGTTATTCGGGGAATGAAACGCACCGGGAAGCGGTTTCAATCCCCTTCCGGCGTCAGTGTGAAGCGGTTATAATCTGCTCTTTCGCGGTATCCGTACCGATTCGGTAAGGTAAACCCCGTTTGTTTCGCCTTACGTGGCATGCTGGCCACCAAGGCCTTCCGTAGACGCTTACCCCTTTAATGGGGATTACTGAACAGCCCATGTTTCGAGCGTTCATACACACAATGGTATGCTCATAATCAATCCCGCCAGTATCCCAGCAGATACGGATATCGACATTTCTGCACCATTCCGGCGGGTATAGGTTTATTAACCCTCATCCACGCACAGCAGCGTCTGTTCATCGTCGTGGCGGCCCATAATCAATCTGCCGGTCAACTTATCCGGAGCCAGCTTTCCTCACCATCCCCCATCCCCCGACGCGCATTTCGTAGCGGTCCAGCTGGGGAGTGGGATACCCGGGAGTCAAGCACGAGAGAGACGCGGAGGGCGGACAGTAATGCTCTTCCGCTCTGCTAATACTATTCAGCATCCGGACGTTCGCCAATTTTCGCCTCCCACGTCTCACCGAGCGTGGTGTTTACGAAGGTTTTACGTTTTCCGTATCCCTTTCAGTTTCATCCAGTCTTTGACAACTGCACCCGGACTGCGTGCCGTACACTGTCCCATGCAAAGGTCACCACTGTCAGGTGGCTCAATCTCTTCACCGCTGACGAAAAACCAGAGAATTGCCATCGACGGTATCAGATCCCAGAGGTTGTCTTTTCGCAGATATAACGGGCATCAGTACACGTCACTCAGCTCCTGCTGGCGGATCTACGCAGGCATTATGCTCGCAGGAAACACGGCCCTGGAGGGATCATCCGGCGTTGGAGCATTTGAGGCCAAACGGCGTCTCTTTGTCGCCAAATTTAAGATACTGCTCTCCTCCCCGCAATGCGGGCAGGCAACATGAAAGCCGCATAAAATGCGGGTACGCATTCGTAGCACGCTCGTGAATATCTGACAGGTGCCTCTACTTTTGTGAGTTAGAACGGATGGACTTAGAGCCAAACCGAGCCTTCAATACGCTTGTCACCCAGGAACGTCGGAGAGCTTCCTGTTCAATATCATCAAAAGCAGCAAGTTCTATACCTATAACCCGCCACATCCTCCACCGACTTTCACGGTAGTTTTGCCGCTTTACCGCCCAGCAGGAGCAAGAAGTGAGGCAGCCAGGCGTGAAAGCCCCATGGCGTGTGTAGCCACCCGGTGCTTTTGCCATACACGGGGCCAGCGCCAGCAAGAGGACGGAATATCACGAATAGTCGGCTCAACGTGCGGGTTTTCATAAAGTTCTCGGCATCACCATCCGTCGGGGACCCACTCGGGTGTCCCTGCTTATGCTCTATAAAGTAGGCATAAACCCCAGCAGCATTTTGGAATAACCGACGGGCAGACTTCACCACATTCTTCACTCACGGTGATCCGGTGCGTTGCCCATCGCATTCATGATGGCCCGCTGAAAAGGCAGTGTTTCCAAGCGCCCTTCCTGGTATGCGGATTCTTTCGGAGATAGTAATTAGCATCCGCCCATTGCCAACGGCGTCTGTGGCTCCGTGGTGAACAGTGAGCACGAAGCCCGGCGCGGACAAATGCCGCAGCCTAGTTTAACCTGACTGTTCGATATATTCACTCAGCAACCCCGGTATCACGTTTCATCCTAAGCGGCTGCTTGTTCATGGCTTTGATGATATCCCGTTTCCAGGAAATGACATGTCGGGTTTTCCGTTTAGAAAACGCCGGTGCACCGACAGGGAGCCCGTCGAGAATACTGGCAATTTCACGCTTGCACGATCCCGACAGCACGAAAGTACAGAATGCGGTTTCCCACTTCAGGCGTACCTGGCATTCTGTGCTTCCTGTGCCTCGTCGCTGCGTGCACGCGTAAGTCGATGGCGTTCATTGATCCAATAGTTCCTGGCTGGAGATTCTGCCTCGGTGGCCTGCCGCAGTTCTTCAACCTCCAGGGCCGCAGCTTTCGTTCTCAATTTCAGCATCCCTTATGCATACCATTTTATGAATGCAGGTCATAAAGCACCTCTCAGCTTGGATTTGCCTCGACGAACGGGCATTCCCTGTTCCTGCCAGTTCTGAATCGTGACTAGATACTCGCACCGAAAATGTCAGCCAGCTGCTTTTGTTGATTTGCATGTTCATTCTAAAGGACAAAACGACGCCAGTAAAATGCTGGATGTTCCTTCCGGGCCTATACTAAATAAACATTAAGTTATGAAGCAAAGAAGAACGCGAAAGCCGGTAAACCGGAAAATTTTCATAAATAGCAAACGCCGCGAGGTCGCCGCCACGA
>12
CGTGAGTGGTTAACAGCGCCTTAGTGCCCTGCTGCGTAGCTAACAAGGCTGCAGCCTGCTCTTATCTCTCCGGCAGATTTCCAAATGCCAGCGTGAAGCGCGGTTCTCTTAGCAAGATTTCTGGCGCCGGCAGTCTGCATCTTCATCATGAGATAGCTGTCGTCATAGATCAGCCGTCAGTTCGCCGGGCGTCAGGTCTTTGATTACTTTTGCCAGACGCGACCAGTCAACGTGAAAGCGACTTCGCGTAAGGGTCACCGCTCCTAGTCAAACCGCACTGTTATCGAGCAGCTTTCACGGCATTAGGATTTGGTACCACAGGCAGCGTTCACATTTCATAGGTAATGACATAAGTCAGATCGGCTGGAAGTACCTAAGCCCGCATCATCGTCGCGCCGTAGTCATAGCCGCTGGCCACCATACTGGTGATCAAATCGTGACAGGGTCGGGATATCATTCATCACAACATGATCCGGGACTCCCATCCACGCATCCAGCTCTGAATCCTAAGCGGCCGGACGGCAGGAAAACTTCGATATGCAGCTCCGCCTGCCATATTATCATGTCCAGCTCTTCACCGTGTATTCCAGCGCCGGTGAAGATAAACGGCAACTGCCGCAAATCCGCCTCATCAAAGCCTCGGCGACCATCAAAACGTCGCGGTGTGCTATTGCTTCTCCAGTGCATCCAGTACGGCTGCACCGTTGCGTTATGTTTCATCGGATTTATTACCATCCTCAGTTGATGCCTGCAGCACAGCCCAGCTCTTTCGAAGACGTTCACGCCGTATCCGCTCAATATTTTGTTTAAACGCCGTGGTCAGCGGCAGCGCCATCGGGATAGTGCATTCACCACATCAATCGGTAACGGCTTTTTCCCATTACACGCTGCATGACATGCCACCGGCCTTTTCAGTTGCTGAATGGTAACGCGCCGGGGAATACGACGGTTACCCACCACAAGCACGCTGCCGCCTTTCAGGGATGAACGCTGCCCCTTTTACGACGCCTGCCTGAGGCGAAGGACAACCCGCGCATTACCCAGCTTGATTAAAGCGATAAATCCCCCGGTTAATTGATTCTGGCCTGCGGATTTTGACCGTGAGGCTTTTCAGCTCGCCTGGCCTTTCCTTTACCAGTTCCGGCGTGTTGTCTCACGGCAACCTGTGACGCAGGACTGGGAGATATCGCGGATGAAGCAACGCGGTTAGTATCCATTGCGGCGGCACCAGGCACCCCCGTTTTCGCTGATACGGCTGCTATTTCAACGGCCTGCTCAAGACCTTTTATGGCCATACATCCCCCGCCGTTTCAGCGGCACCGTTATAACTGAGCGGGATACGCCCCCATTTAAGACCCGCCAGATGACGACAACTTCCCGCTCATCATCCGGCTCGAAGTCATGGCGATCTACAGAAATTTTCCTCACCATGATGGTCGGCTCTAATGTTGTACCAGCTAGGATTAGAGCTACATCAGTCCAATAAAACAAAGTAGAACCGTAGGGATAGGCCTTCAACACGAAGCTTTATGAGCAGCATAGTATGTTCAGGTACTTAAAAACAAGTACGTTCTTGTTT
>13
AGTCACGAGCCCATTGACTGGTCGACCACTGAGCCATCTCCGTACCGTACGCACTGACCTGCTTACTGATTTGTTAAACCGTTTGGAGTACGCTCAACGTCCACGCAGGCTCTCATAGAACGTATCCTCCTAGTGTCATCACTGTGCTGCTCTTTTCGACGCGGCAAATGGAGGGAAGCCATCAGCGCCAAAGTGTCCGTCAGCTCATAACGGTATTCACGTTAATCCCTTCAGATGACTCACACCGGTATCCCCGCAGGACAAAGACGCAATGTACCCGTTTCACTTGAAAATAGCCCACGTAAACGTACCATGTCAGGTCGCGCACGGGCCGGAGTGACTGTCTACGCAAGTGCGGCAAAGACAGGACGGCAATACACATTACGCATCGTTCACCTCACTGTTTATAATAAACGCCCGTTCCCGGACGGAACCTGTAACTAGACCAACGCTGATTACCGCCAGGCCTGTTCTTAATCACCAAGACCTGCACATCGCTGAAACGTATACGGCGACGAATATCTGCCGAATGCCGTGGACGTACGGCGTCAAACCATTCAGGATCACGTTTCCCCGACCCGCTGGCAGGGTCAACAATACGGGGAGAACACCTGTACCGCCTCGTTCGCCGCGCCATCAAATAAGTACCGCACCGTTCATCAGTACTTTCAGATAACACATCGAATGGGTTTACTTGTACGCTGACAGTACGCGTACTTCTAGAACGTCAGGAAGAGACAGATAGTCTGGCGATCAAAAGGATGGTCATCGGTCACGGTGACGGGCGACTGGATCAGTCGACGCGGTACGTTACACTGCCTCCAACGCTGGCGCAAAGCCTCAGGCCGCCTTTACAATGTCCCCGACGGATTTTCCGCCCTCAGCGTACGCTTATCGTACAGTTTTCAGCTATCGTCACACATTACTGAGCGTCCCGCGATTCGCATTCACAATTGCCACTGATATCCGCATTTTAGCGTCAGCTTTCCGTCCGTGTTAAGGGAAAGGCCGGGAGGATTGCCGCTGGTGAGCGTACGCCTGTCATAGGAGGAAGCCGTCGTTCATGAATATCTGGTTGCCCTGCGGCCACAAACAAATACGGCGTTTCATTCCCGTTTTGCTCATTAATAAATGCGATACCGATTGGCGGCAACCAACGCTCAGTTTGCCTTCCTGCGTGTCCTCCATGCTGAGGCCAAGATCTAGAGACATAATGTTTGCCGTCTTTGGTCTGCTCAATTTTGACAGCCAACCACATGGCATTCCACTTAGTCACTGGCATCCTTCCACTCTTTTAGAAAACCTCCTCCAGTCTGCTGGCGTTATCCGCGTCAGCTCGACTTTTCAGATGCTTGCTAGATGGCATTCGGTTATCTTGCCTTTGAAAAATCCATGACCTTCCGCATCATCGCTCGCCCGAATAGACGGCCTCCACGAATGCGATTTGCCAACGGTGTTTACACCTGCGGATATAAAGTAATAATCAGCATGGATGTTTGATATTGATACTGGCGGCTATCCAGTACACCTAGATTACAAGATAACGCGTGCTGGTTTCAACCTGTCTGATATCCGCAATCTGCTTTTCCCAAACGCAACTCAAACTGTACCGTCGGGTCATAACGGCAAGATGCGGCGTGGCGGTTATCGAAACTACTCACATGGAGTCATAGATCCTCGACGGTGCTGCCGGTGCCAAGGCAATCGAGAACGATACCGACGCCGGATCGCCTTGCTGCCCCACGCATTTACCGCCCGGACTGTCATGCTCGTAGTTCCCCAGCGCCAGAGTTGCGTGAAGCGGTATGTGGTTTCCGTCGTCCGGTATGAGGGGCCCACGTTAGTACAGCCGGACATGCCGTCGTCGGGTGTTACGTCAGACGGAGCAGGAACTCACGGGCCACCTTCGGTGTGTGTCCCATCGCGCCAGCACCTGATATTCCGCCGCTGTCTGCAGTGACTTCTGCGGTCAGGTGCGTCGCACCGCTGGCGTGACACCATTCACCGTTCATCTGTTCGCCGTCAAAGTGCGCCCCGTTATCACGATGGCCTCTTTTCCGGCACATGCTGCACGGCGGTGATGGCATACGTGCCGTCGTCGTTCTCACGGATACTCACGCATGGAACAGTCGCCGGGCCGCAGCGTCGGCAGCTTCAGCTTCATAATACGAGCCTGTATTCAAGCAACACCGTCAGGAACAGGCTCATTTGATCACTAGTTTAGACGTATAGACTGAACCCTCACGCTGACCGGATTGCCACTTCGTCAACCAGGGTATGGGTAAGGCGTACCCGGGCAGCACCGTGATTTCGACGGTCGAGCGTCAGCGTCCGGGTCTGGCTGTTCACCGCCAAGAGCACACAACCACCGGTGATACCGGCATAGTCATCATGGCAGATTTCAATAACATCGCCCGGTACGGGCGTGACGCTTCTGCTGAACGCTGAAATCACGGTCTGCGTTTCCAGCAGTTCGTTTTAATCAGCGCACTAAGCGCGCTGTGCCTGCCCCGGCTGGTACAGCCAAAGGCATCATCTCTTCGTAACATTACGACCGTGACGGGCAATGGGGTCTGCGTATCTTCAACAAGCTCTGTCGCCGTCTCCCAGCCGTTGTTTAGTCGCGACCGAGGTTCTACCTCAACGCATTATGGGCGGTCCTTCAGGCGCTGAAGCTGCTCGAATGGCGCGCCATCAGGTGATGCGGCATCACCACATTACTGCGGTTAAGTCACGTCTTATCCGACGGTCGTTATGCACGAACGTCAGCGTCTGCCCGCGTTCCATACACCGGCATACAGCGCATCGCCGAGCAGGCATGACGAACTCAGCCGACATCCCACGCCTTACGCTGTGTAGTCAGGTACGCATTACAGGTGATGCGGCGCTCCCCGTCCGCCAAAGCCGTCCGGCACGCACTGGTCTCACACGTACTGGCCGATGACATACAGCGCCCATTTATCTAGAACTACCGCCGCACCAAGACGACGTTCCCCATGCCCGTGGCCCCGGATGGTACGCATATCCCACGACACCAGGCCATGTTGTTGCTGTATGCCGGTTTAAAACGTTCCGTCCCAGATACCGCTGTATTGCCGCGTCTGCGGGTTATAGTTCGACGCACCTGCAGAATACGCCCGCGCAGATATAATTACTAAACGGCTCACCTGCTGGCTGCCGAAATGAGCTCCGCATTGACCTGCACGCCGACCACGAGTGCGTGTTCGGGTAGCACGTTCACATCGATGATTGCCGTATGACGACCACAGGGTTTTGTTCTGCAGCTGGTCTGTGGTGCTGTCCGTAGACCCTTAGCAGTGGATATTCCAAACGGCGCGGCGGCTGACCAGGTTACCCATCACACCGAGGCCAGATACTGGGGTGGTTTTGCCCTTAATGGTGATGTCTTTTTCCGTTACGAGACCCGTTACGTTGTATCGACCAAGGCAGGCGACTTCCGACGGATTCCTGTCACCTTTGAGGTGGTTTCCACCAGTGCCTGTACACCGAAGGTAAAGCGACGGTCGATGTTTGCAGACGTAATGGTGCGTGATCGCGTGTCATAGTTTCATTTCCGTACCCACAGCAGCGTCCCTCCAGGATGGAGGTCGACCCCAACGCGCGTATATGCTCCGTAGCCAGCCCGGAACACCACGTGACACCGGATATGTTGGTATTCCCTCGATGTTAAGCACCGGCTACTGTTCAGCAGGACAGGGGTTTTAAGCCAGGTATAATAGCAGGACTTCGAATCGGCCTTGCTGATGGCATCGATTACGCTCAGCAACTGCGTGGACTTCAGGTTGTCCTTCGCTTCCCTAGGGGTCCCCCTTACTGCTTCCTTTACCCATTCCTCACGCTCCATAAATGACAAAGCGCCCGCAGGCGGTTCCACATAAACATTTTGCATCAGCGACCAATTACAAGCGACTCACGTCCCTTCGTCTGCCGTGCTGATCTCCGGCGGAAACCACGCGTACCCACGCGCATTTCGAGTGCTAAGAACAGGCAGAACACTTGCCCTGGCAACCATGTTATCCAGTGGAGAAATAGGTGTTCTGCTTACCAGCGTTATCCGTTGTCTTAATGGGGAGTCCGGCTTTCGGTGCCAGCCCGAACCTGCGCCTACACACCACCGAGCACCATACTGCACCGAGAGAAAACAGGATGCCCGTCATACCACCGGCCCCAATCGCTTGCCCCCATGCTGCAAGGGTGGCTCCGGCGGTAAAGAATGGACGTGGAACGGGCAATGAGCGGCAGCCCCCATAATCTGAATACGCCACCTGACTTAGCCCGGCGACTCATGGGAACAATATATGGAATTAAGCCATCAGGCCGCATAGTCTCATGTGGACTGCCGTTGACTCGAACTGTCCTGACGTCTGCCGCCCGGCAATCCGTACCTGATACCAGCCGTCCTGCTCAGTTTCTGACGCAACGCCGGGAGCTGTGTAGCCATGCCCGGATGGCTTCAGCCCGTTTGCACCGAAGGTCGATGCGGAGGACCAAATCGTTGTAAATCCCCGCTGAAGGTGCACTCCATGCCCCGTGACGCCAGAGGGAGTGTGTGCGTCGGGTGCCATTTGTCGGGTAGGTAGTCACCTCTCGTTTGCTCAGTTGTTCAGGAATATGGTGCAGCAGCTCGCCGTCGCCGCAGTAAATAATTGGGGCGATCGTCCGGCACTGATGAACCAAACAGGCCAGCACTACAGCACATCGCCCGGCTGTGCCGTCCGACAACGGCACCTGATACAGCCCCGTCGCCTCCAGATTATCCAGATAGAGATTCTGGCGTTACGCCACCAGTCATCTTAACCACGATGAAAGTCCGGCATCTCAAATGCGCCAGGTACTCACATCCCGGAACAGTGTAACAGTTAGTCACACGTGCTCGACTAAAGCGCCGCGCCCGGTGAGATGCGGCACACAGGAACTTATGAATCGTCCCCCGCTGGCAGACCAGCCACCACGGCAAATCATGGTACATGCAGCCGCCGGTCGGCTCACTCAGCCGAGAGCGACCACCGGGGTGGCCTTTGCGACCAGCGCCACAAATCTCAGCCCTGCATTTCTGCCTGCAGCCGTCTTCCGGCGACATACCTGAAATACGCCTCCGAGCTATCACCGGAGATATTCACGCAGGGAAATATCTTTCTCCTAGGCGCGGCGTGCTTATGCCACGAAGCCGCACGACTCCTCCGCTGGGCGCACATCGCTAAATCGGCGTGCTAGGAGAGAGAGAAATCTGCCCATGATTTCGTCTGTCTTGTCATTCTTAAGAGGATTTACTGTAGAAAGTTGTTAATATGGAAAGGAAATGAAGCCGCCAAAGTTGCCGACGTTATTGCGAACTTACAACCGGCTCAGGCATTTGCTGCATTTATCCTTCGTGATATTAGGACGTTGTGGCCGCTCAGTCATATTCATCCGCGACAGCCGGAACTCGCTATAACCGCACTCGTCGCCGACTCGTAGTTAGAGGTGGTGCACGGTGTCGCCAGCATGATACGTCTAGAAAATAAGCGCCAATCCGTTTCCGTCGGCGTGACAGTACAAAGGAGGCACTATTCCACCGCGCTCAGGTTCGCTGCACTGCTCGAATGCGCCAGGCTGATCACCTCCTGGCAAATTGGGGTAACTGTTTCCGTTGACGAAGTTCACACCGCATCCAGGAAAACGGGCGTAAACCTTACGGACCACCGTTCCGCCAGACCAACTCTGCGGCATATCTTCCGCCATCCCGGTGACCATACCGTACAGGTCGAAACCGTTCGGCGTGGGGTCCTGGTGTCCTTCATTCAGAGTTTCAAAATGGCCTCCCCGGGTGAATGGATACGGCTGATACCGTGGTCCTCGCGTGCCAGGTGACCGGGTAGCTTTCGTTCTGCTCATTACAGAAAGATAACGTTCTCCACGACCCTGTCAGGTCGATTTCCAGAGCACCACGGCGCCGGCCGAATGCCTCCGCACGGGTGCATTCGAATTGAATGTTTCCTGATCGGATATCCTGCATCAGTTCACCACCTGTTCAACTGCCTCAAATACGGACGCCCGCATCAATATACGCAGCTGGAATAATTTTGCGCAGGTCACTTTATCTGCCGCCATAAGCCACCGGCGGCGTCCACAGAGAAAGGCATTTCCAGCCCCCGTGCTCTTTGCGAAACGACTCCAGTACGGATGTGGCCTCCTCACGGGGGACGAAAACCGTCACGCCGTACGTTTTCAGGTTGGCATTCAGCCCCAACGCAGGCGCTCGCTGAGAATAGCCATCTAAAGCGCACTTTCTTACAGAAGGGTGGGACGAAGCCATCCATACCGGGTTTCACTTTCCAGCGCAAAGTCTTCCATCGTCCACCTCCGGGAACAGGCCACCCATCACGCATCTGTCTTAACGGATTCCTGACGGGCACTGTGCGCATCAGGTCCATACACCGCCGCTTCAGAGCATCGACCTATCTGCCCGTTCGTGCCGTCGTGTCTATCACCACGACCTGGTTATTGCTCAAAACGTCCCGGACGCTGCGACCGGCCCTGTCTTCCATGCTGCCCGGTGTAAGCTAACGGACCGCCGGGCTCACGGCCGCGCATCAGCCGTAAAGATTCCCCACGCCGCCAATCCGGCTCGGTTGCCTCCTAGCTTCGTCGAAGACAAATGACCACCACGGTGAACAATCCCGCTGGCTCTATTGCCGCCGTTCCCGTAAATCCTCCGGTTGCAAAATGAACTTCGCCGCAGCGGCCTGAATCGATGGCAGCTGGTTGACGCGCTGACCCCGCTGCCGCCCAACAGCCCCGCCAATGGCGCTGCCAATACTCCCGACAATCCCCACCATTGCCTGCTTAAGCAGAATTTCTGTCATCATGGACAGGACGGAACGGGTGAGACGCTGCGCCGTTTTGCTCACTGCCGCCGGTTGCATCGCCGGGTCTGTGTTGCAATACCATCAAAGGTCTGCTGTGGCTGCACCGTCTTGTGACATGCATACTGTCCGTGGCGCTCTCTTCCTAAGCCACTCCAGCCGGACTTCAGGCCTGCCATCGAGTTCCGCGAAGCTGGTCTTCACGGCCGCCCAGGTCTTTCTGCCTGACATGACGTTATTCAGCGCCAGCGGATTATCGCCACCGTTCCTTCAGGCGCTGTTCCGTGGCCTTCCCGTTCTGCATTAACGGTTACTCGTGCCCCCGGCTTTTCGCATCGACCCATCGGCTTTGCCCGTTGCTGCTGTGCGAATTCTCATGCTGCGCTCCACCGGAGTTCAGGCGGTGCCCTGATACGATTAACCTTATGCCAAGTGCAGCCCAGCTGGCGTTGTACTCCAGCGTCTCATCATCTTTATGGCGCCAGCAGGGATTTCTCCTGTGCAAGACAGCTGGCGACGTTGGTGGCCACCGCCTCTACGCCCCAGTACCGCGAACTGACTCTCCGCCTTCCCAAATCCAGGGCGCTGCTGGCTCCGATTTTCTCATTTGCTCCGGCATCGTCTCCGCGCCGTCTAGAGTTCTGCCTGAAGCGTCAGCAGGGCAGCATGAGACCTGTCTTCCTGACGTACGCCCGGCAGACACCTTCACGCTGGACTGTTCGGCTTTTCAGCGTCGCTTCATAATCCTTTTCCGCCGGCCTCATTGTTGTAATCCGCTGCAGGATTTTCCCGTCTTTCAGTGCCGTATGTTCAGTTCTTCCTGACGGGCGGTATTTCTCCAGCGGCGTCTGCAGCCGTTCGTAAGCCTTCTGCGCCTCTTCGGTATTTCAGCCGTGACGGTCTATCGGTATCGCTCTGCTGCTGCGCATCTTTTGTCCGTTTGCTTGCTTATAGGGCCTTCTTTCGGGCGGCTCGTCAAGCGCAAGACGAACCGCTTTTCACGATCATCCCCCAGTAACGGCGCCCGCCTTCATCATCGTTAACAAAATAATCATCCTTGCTAGCAGATTCCAGATGTCGTCTGCTTCTTATACGCAGCCTCTGCCTTAATCAGCATCTCCTGCGCGGTACTAACCAGACCAATATCCAGCACCGCATCCCACATGGATTTGAATGCCAGCAGTCCTGTCTGCCCAGGTCTCCAGCGTGCCATGTCTCTTTCTCGAGTAGGCGGCCGGTGGTCATCAAACCCTTTTATGCGAGCCTCGTCGTTCGCCCCCTGCCTGCAATCCCCGGCTTCATCGCCGGGAACGCTGCAACTGAGCAACATACGCAATCTTATGGCCGACACGTTATGGAACTGGTGGCGAGCCATTGCCGTCACTACCTACGCGACGTCGGGTCTTAGTCAGCTTCCCGAAGGCTTTCAGCGACCTTGTCCACCTCGGACCCCGCCACTGCAGAGGAGAAACGCGCCACTGGGCTGATGGACGCAATCTGAGCCTCACGCCTTACCCCCGCCTTAACCAGTGCCTGAGTACTGGCTGTCTGGTTAAACGTCAGCCCTGCCGCCTGCCGGCTGGACAGGACCAGCATACGATCTGCCCGTTCAGTCCGCCTGATTTGCCGGAAAGAGGACCAGCGTTTTTGTTGAAGTGCATAAAGGGTCGTTGCCCTGATACCAGGCATACGCGACGCACCGAGTCCCCACCGCCAGCGGCCCCACCATCGGCGCATGATCGCACCGGCAGCATCCCCTGAACATGGGGATCATCCGCCGAAGGAGTCCTTCATGCCCCCTGTTGCAGCAGGATCAGACCCGACTTTGCCGCCTGCAAGCTGCGTGACCCGCGGTGAACTGTGCAGTGCAGCATACGCATGGCGGCTTTATACTGCCCGACGAAATCCCCGCCTTTCTTCAGCCGGACACTGTCATCCCGGCTCAGCCGACTGTTCAACGAACGACTGCCCATGTGTTTTTCGCATCACTTTCCGTACCAGAAAATGACGCTGACTCTGGCCATCTGCTTCGTCAATCTGGCCGCATCCAGAGACTCAAATCAACGACCAGATCGCCTACGCCCGTTGTCATACGGACTCCTCCTGCGATCCCTTCTGATACTGTCATCAGCATTACGTCATCCTCCAGTCCATAGTGCCACGATACAAGGCGGCGACCGGGGGATAACTTCATTCCCCGTCCGGGCGCTAACTCCGGACAGCGGCAAGCCCTGCCGCTTTTCTGCATATCACCTAATTAACATCATCTTCAGGCTCTCTTCGTCATCCTCGCGCCGGTTCAGACTGAAATCCAGGGATGAGGATGATGCATATCCGGCGAAGATCGCTGACGAAAAACAGGCTGAGCACGGTACCATTCAGCGGAAAATGCACCATATCCAGCAAACCATGAAAATAATGGGTACTGTAAAAGCGGTGCCAGTCGGCATACTCCGTGCATCACTCCCGGCAAAGCATCGGCACGCCAGTTGTTAGGACGGGTCGCCCCAACTCTCACGCCCATTCAGGGCAAACTCAGCTCACGTTGAACACTTTCCCCGAAGAAACAGGCCTCCTGCGGGCCCGGCGTCCTCTGTCTGTTCAGGGGACTGTTCACCACAAAGCCATACGACCAGACAGCCGGTACACCACGGGCTTTCAGCATGAGAAATTGCCTCCGTGGCCAGGTGGTAAGCATTTCCTGCTCAATCTTTACAGTAACGGCTTCATTCATGGACGGCATCTGCGTCTTCCTGCGGATGGTTATGCGCCACAGGGACCCCTACAGAACGCGCCGGTTCTTTGTCCATCGTCTTGCCACAGTAAACGTTGCGGTTTGCTGTCTATCACGCCTGTTCTGCTTACGCGTTCATCGCATCAGGCGAGATGCTCAATGCGCTGCAGGGCTGACAGTTCAGAAAGCGTGACGGTCACACCGTTATGTTCAACGGATTCGGTCGTTTG
>14
GGCTTTATGTTACGTTATACTAGGTCACCGAACCTGTCGGTCGCCAAAGATAGCAGTCGGGCTCCTCGCATCTATTAACTAACCAACTAGGTACAGATAATTCGTTGGCAGCGACTGTACCGACCTTCATGGCGTAGATTACTCCCAGGTAACTAGCTGTAATTATTGATGCGGCCTAACTTATGCCTAGCTGTCATAATACAAACAGATCAAGGCTACTGATACAGGCGAGCCGTGGACGAGGGACCGTAGCGCGAGCTACCGAGCATAACCACGTTTAAATGAGCCCATACCTGTGAGCGTAGCTCTAGTGTAAGGGCCAGGGTTAAGGAATTTTACCGGCAATAATAGTGCGTCCAAACATTGAAGATTGGTCACTGTCATTTGGCAATAGCTCCGTCGAGGGTAAAAGGCACATCAGATCAATTAACAAGTACTGGCCGATACATCCTACCGTTTGTCCTCAGCGAGCCGCTCATGGTCTAAATTAGACTAGCCTTCGAGGGCATTGCGGGTAAGCTTGAGTTGCAAAGGCTTTTACCCCTTTTAAAGTACGCTGTAACAAATCGATGTCGGTATTCTAAGCGAGCCAGTTCAGTGATCGAGTTGATCGATCCTGGGCCGCAGGGAGCTTACTGTCATATCTTATGTAACCCAATTTATTTCTATCGAAAGCCGGTTCACTAATACTTGTCTATGAGATCGTCTGGCACTGGTTACGTCCTCCCATCCGGGACCCAACAGAAGTATTCTATTGCGCCACCTCATGTTTTGGCCTCGAGTCGCGGTGGGGCAAGGGATATGTCCCAGATTGATTTCTTTGGTCGGTTTTCTCTGCTGTGCTCTCATTCATCCTAGCGTGCCTCTTACTTGCCGTATTTCATCTGTGAGGTTTAGGCCGTTACCGTATTACACCATCTGTCGGTTATTTCGCCTCGCAGAATCTAGGCACTCCGCTTTGTTGGGTCGCATGAGATGATGGATAAATGAGGACGGTGTCCGCTCTTTATAATCGATAGCCACTCGCACTACAAAGAGAAGTCAAATATAGAAAGTCGGCGGGCTACCCGGCTGCTATACGACAACGATCACAAATGGAAAGGTCTAAACCGGCCAAAATTGCCCACGTCCAGAAATAGTGAGTGGCTGCGAGACCGGATTCTTCCTATTAGCGTGTTTATTTAACTCGTACAAGCGTCTAAATATTCGTCTACATTAGTCACTTTAGACTAAAGCTTATCAGCCAAAGCTCTTCAGCCATCATGTCAGCAAGCCCGATAACGGACAAGCCTGTTTGTCAGGGTCTTAAAGTGTAATGTTCGTAGCTATTCTAAGGAGCCCATCTTACAGGCGCAACGTCCTGGCGTAAATTACCGTAGGAAGTACACGTCACAGCGAGTACTAGGGAGATCTGTGCCTAGCGAGGAATTTTCTACAATGGATCCATATCGATAATACCTATCCTCCTTTGGCTCGTGTTATTCGATCACTTTGGATGTTGGCCGTAACACAATCTTTCTACACGTAAAACGTTAGGTCTGTTTAGTTGGGGCCCGATGTTGCAGGATAAGCTTGGGCGATACGTTACCACCGCCATCCCTGTGTTAAACGTTTAATGCTTCCCAAACTAGAGGGATTTAAGGCGTCACAGGGGGTGCTAATTAATCGGGAGGTCTAATGAGTTAACCAAGTACACCGCATCGCCTCTATCCCTGGCAGTTTCGGTTGATATCTGCGGTCAATGTTGTTTAATTTTAGGGATAGCGTCGTTGCGCGGTCAGGCATGCTTAAGGAGATAACGAGCAAGTGGCTACCGCTAGCTGTAGGTACATGCCTTATTACAGGGTGTTATACGGCACAACGTTACTGTCAAACCATCTCATACCGAGCAGGCTTAGCACCAAGGAAGACCATCGCGGTACGTCTTCAATAGTTTCTTAACCATTGAGCAGGGGACTGTCGACTATGCAGGCCGTATTTGTACCGCTCTAGGCACAACTTTGTTGATAATATTGGCCCCATCCCAGCAATAAATGTCTATCAAGTCACCGTCGTGCCTGTCCTCATACCATTTATAGTGGAAGGCCAGTCTGTGTAAAGAAGCACCGTGTCTAATAATTGGTAGGGCTCCAACTCGGCAGCCTTAATGCATCCTTAACAATAACTTTGGTGTTATTTCGATTGTTTTAAGGTAATGATCGATAACTGGATGGCGCGGCTGCCCGTTCGGGGTCCGTGAGCAGGAAGCTGCATTGGTGCGCCAAGGGATAGCGGTTCGGTCAGCAAAGCTCTAAGTGGTAGCTAAAGACTTAGTTCTATCGGTGTCTGCCATGAGAGCCACTATACAGCGGCATAATCACTCGCAGGCGGGGTGATTTCACTTTATAGATGGCTATACTTCGTGTATGTTTGCTAAGTGGGGCCAACTAGTCTGGGCATCTGCTGTCGCTGGGTTTAAGCCATTTCCTAAGATGATTTAGGGCGTCTCTCCAGTTCTAAGCCGTTGTAATACATGGCAGATTTACTCCATGGGTACCTACTATAGCGTAAAGGCAATAGATGGAGACTGGTAACCGGATACCGAGCTAGTACGATAAGTGGCTCTAGCCGTAAGTAAAGAGCGTACTCTATCTCGTTCCTAATTCTTTGCAATTTTGAGTACACTCGATTCGGCCTGCTCTGTAACAGTGACAATACAGGCTAAATAACAGTGAAACGATGTGCTTCTGTCACTGGCTTCGCACTTGTTAAAGTACCTGGACTGTAGCGATCGGTGGCCTAAGCCGGCTAAGGATACACTGTAATGTATAGTCGAGGGCCTAAGCGTCCTGTATTTCAGGCAAGGCAGCGGTTCTTTCAAAGGTCCTTAGTTCGAAGGGCATCCAAGCGGATAGCGGCAAGAAGCTGGCTCGTCCGGCACGGTCGTTACAGTTTGGGTTGTAATTAGCGTGCGGATACCAGAGGGAGGACCGTAAGGGATAATCGGTAACTAAACACCTACATCGTCTAACCAATTTCTGGTTTTGCAACGTTCGGTTAGCGGTTCTATAGCAATAGCGCCAGCATATCGAAGCCTGCCGTTGATTACTTGTGATATTCTACATCATTCGCTCCAACAAGTTCGAGCGAAGCGTTGATAAGCAATGAGTGAGAGTCAGGTTGTATAGAATGTGTAGCGATAGCCACCGTCGCGGGGCGCCAAGGCTAAGAGAATTAATTAAATCCAACCGAGTCGAGGAGGGTCTGGGGCGCGAATGAGACCAGGCAAGGGACTACTGGGGCCCTGGAGCTACGTCTGCTTCAGTCGGCTCGGCTTTGCTCCGCACCACGATCATCTGCCTCGTAAGCCAAGTAGCTAGCGAGAGTGTGCGACTCGAATTGGTGCTCCGAGTCCTGTTTAGTTGTTGTAGCGGCACCGATGAAGCGGGACAGGCGCGGTGCTGTTTCTGGCTAGCAACTTCGGTTCTTACCCGCGACCACGCATTTGTCATGAGTTTAGTGCGGAGGCTCGGTAATTACTGGCTCGCCACCAACACATGCCGAGCGGGTGTTGCTCGATCGGATTTGGTTCTGATCAAGCGATATGCGGGCAGGCAAGGGGAATGTTAGGCAGCCCGGTGCAGGCGTCACAGGGGCCTGCTGTGTAAGCGCATATCGTGCTCTATCCTAATGAATTTCGGATAGCGTACCGACACTACACTAGCCGTTAATGTCCTGTTGTTAATGGGGCATGGCCCTGCGTCGGGATTTGGTACATTTTGTAATCGTCCTGTCATTAGATGTCAAAATGAGAAAGAAAAGAGACCAACCTGAGGGGCATACTAGATATTTACCTAGAGAACCCTGAGTTAGTATTACGTTGTTAGAAACAGATCACAGATAGTTATGCCAACTATATAAGGGCATTATTAGGTCAGAATATTAAAGTTGCAGTGTTAAATATGCCTGCGATACAGTTGGAATTTAGAGGCACCGATACGTCAGAACTCTCAAGGACAGGGATCGGTAGTAAGGACATATTTCAGTACACCAACGACGAGATTAAACAGAACGTTAGTTAGGTTATAACAGTTTTATTTAGGTAAGTCATAACCACTGCCGTTAGGTATGTTACAAACCGTGAAGGTTAAGTCATTAATTACACGAGATGTCAAGTGGTCCGATTAGTATATTTGGTTGTGAGAAGTCCACCACCGAGTAGTTCCAAGTATAGAGAGGTAACAGTCCGTACAGGTAATTAAATTTGGGATGAGAGCTTTGGCTAGAAAGTACACTTAGTCAACTCCGGCGATGACATTACAAACACATAGGTTTGCTATGTCAGAAGGTACTTTTAGTGTAAAGGTAACTACAGAGACATCTGATATGTTTTGGCGAAAGTACATACAGGGTATAGAATATTACATGGCAGATGTACTTAAGTTACACAAGGCGTTAGACCGACAGGTAAGGAGGACAATCCATAAAGCGATGTTGGAGCACATAGTCCAGTACACTTTACATCGTACCGTTCTATTTACAACAGTCTAAATGGTTCCTCAATACTTGTGTTAAGTTGGGCGATTAAGATAAGTTGTAACGATTTTGTTATACCAATAGTTCGTAATTTACTTACCCATTGCAGCCATGGAAGGAGTCGATAAATTGTAATTTGTAAAGTGACAGGCGAACTAAGTCACCAACCATGATGACAGGGAAGGCAGTCGGAGTCAATAATTAAAATTTGGCCAATCGGGCAATAGGTACAGGCCGTTGGCGATGGGGTCATAAGCTGTTCGATTAGATACACCAACATTGTAACCTAAAGTATTGTGATAGACAGTGTAAAGTATTTAAATTTAGAGAAAACCATAGAGATGTAATATAGATTGGGATTGGCTAGTGGTATTAGAAGTTTTCCTGCTGGCCGTATAGATGGCTGTCCTAATCGGGGTTGTAATTTCGCCGAGTCCCGTTAGTTAGTCGTTGGCGTCCCAATCGTAAATACTGATCAATAGGCTTTAAACGATCTTCGTTAGGATAACGTAGATGAGTCAAATATAATTTTTATGTTAATAGAAGTTTCCAATATATGATAACTGAACTATTTCGTAATTAAAGTCAAGATTATAAGGGATGTTAAACAACCTTTAACGCAAAATTTTAACTAAGAGAGTTTTATTTGGTGTAGAAGGTAACAAGAGTACAAAAGGGATAAACACAACGAGGACAGTGGTACATGGTAACTATTAGTAACGTTTTTACATGGTGACAAAGCCTATCTAACCTTTATAGCACTATAATATTTTAGGTCAATAGCGAGAAGTTAGTCAATTCAAAAATACCATTGCTCAACGTTCTCTGCCTCGATCGGCCGTATACGAGCTAGCGGTGTTTTGTCCAATTACAGTCGTAAAGTACAAAGTTTAAACTAAAATAGTTGAGTCAAATAATTCAAAGGGTCAACAAACACAAGTATTTCGGACTTGCTTAAGATGAGTTTTAAGTAACTAAGTAACGTTGATAGAACCACGAGATAGTCCGGGCGACGTCAGTTTAGATGAGGTCCAAGGTTTCAACCGTCTTTATCACTCTTTTATCACGTACCAAAGCATTTCAAGGTTAATTCGGCGTCAAGTCTCTTTCAATTAATACTGTTTCGATAGCGAGCACGTTGATGGCAGGAATGGTTTATACCCAAAGCTCGTCTAATCAGTAATAATTTGGTCCTTTCAT
>15
CTATCTGTTTAACCTCGGTTTTGCGCACTCTTTTCTCGTAGTATGATGAGTCCGTCTCTATCAGCAGTACCGCGTTTCCTGAACTTCTTTCCAGACCATCGATGGCCAACGACCGCAGCCTATCCAGTCGCAGTTCCCCAGGCACTGCGGGCATTCCTGAAAAACTGAAGCGCTTTTGAAGGTAACGTCACACGGCGGAAATGATGGCCTCTTCGAGCCAGCACAGAAACATGGGCTCGCCTGACGGGATGCGAGACGAATTTGCCGCCCCATAAATGACGCCACGACTCGTTCGCACTGGCCCGTGCCGTGGAGTAGCTCGATGGGCGTAATTCCGGCCGGGAAAGCTGCTCATACGAGACGAGCCCGTGGGGCAGCATACCGCAGCAGTGACTGCTCAAACACGGAGTAGCGTTATCTAATCTGAGCCGTCTGCAGGTTCAGTGAGTCACCCGGCATCAGGTGCTGGTGTACTTTTGCGCCTCCCAGCCGCGTAACCACTGCGGCATCATCAGCGCGGCAATTTCACCAATCCAGCCGGTCAGCCTTTCTTTGCTGCTCCTGACTGTTCGCGCCAGAATAAAATCCATCGCTGACTGCGTATCCAGCTCACTCTCAATGGTGACCGGCATACATCGCCTACCAATGGCGCTCTGCAGCTGCGTGTTCTGCATGTCGGAGCATCTTCATCGTGCTCCATCACGTAGGTAAAAAGATTTTGCACCGCGAGGTCTGCAGTGTCCCCACGGGTCCAACGTGAATGAAAGCGAGGCGCGCCCGCCGGGTAACGACGCAACTTGGGGCCATGAGTCCATTTCTGCGGCATCCAGCCAGGATATCCGCGTCCTGACTGATATCCCACGCACGCCGCACCGCTGTCATTAGTACGTGCACCGGCACGGGGCAGTTCCGGCTGTCGCCGGTAATATGTTTCGGGTTGCTGATGCGCTTCGGGCTGACCATATCCGGAATGTTTAGAAAAGCCGCGACGAACTGGTATCCCAGGTGCTGAACGAACAGAATTCACCGTTAAAGGCGTGCATGGCCACCTTTCGTCCGAATCATCATGGTAAACGTGCCGTTTCGCTCAACGTCAATGCAGCAGCAGTATCCTCGGCAAACTCTTTCCATGCCCTTCAACCTCGCGGGAAAGGCACGTGAGGCTTCCTCCCCCGATGCCGATAGCGCCAGCTTGGGAGATGACACTGAGCCCGCAAAAAGACCCGACGATATGATCCTGATGGGTCCAGCTGGATGGCGTTGGCGGCACCCGTTATTGCGTACCAGATCGTCTGCGCGGAACATTGCCAATAAATTGGGATAGAAGGCTGCATCGGATTTCACTCGGTGGGTTCCACGACCGCAACTGCCTCCAAATCCTGCTGCCCGCCTCTTAACCGGGATGGTTTGGCGCATACAATGTATTCATGCGTCCGGGCCCCAGAAGGGTGGGAATGGTGGGCGTTTTGGGAGTACATAAAATCCTGCAGGTCTCCCTGCGTCGGTCATGCCGGTTGCACTTCCAGCTCTGCAATATATGTTTCAGGTCAGACGGAAGTGGCCGTAACTCGGCCACCTTCGTCCGTCTTTCTGTACTGTTGCCACCCGTTTACCTGTCATCAGGTCATGCAGTGCCGCACGGGCAGCGGCAAGTCTTCCGTCTTCGTCAGTCAGGGTACCCTCTGGATAAGGCACGGGCGTACGTAATCCCAGTGTTCCTGTTGGTTCGTCGTGACACCATCCTCTTCCTGCAGGCTCGCCAGCAGGCACTATCGAGATCCAATGCCAGCGGAGAGAATATCACTGATGCGCAGCGCCGCCAGCGCATAAACGAAAGCAGTCGAGTGCCTCATTGCGTCGCTTTGCTGTCCACAGTATATTTTCCTGCCATCCACCCATTTTCGACCTGCTCTTCACAGTCACTATGCTGCGCTTCGGGGGTCAGATCAAAATATCCGGGTTATTCGGGGAAGTAGGCTGACGGCACCGGGAAGCGGTTCATCCCCTTCGGCGTCAGTGTGAAGCGGTTACAATCTGCTCTTTCGCGGTATCCGTACCGATTTCGGGTAAGGTAATGGGCGTTTGTTCGTTTTGCTTTGTTCACACTGCTGTACGACGCACCGGCTTTCCGTAGACGGATGCCCCTTTAATGGGGATACCAGGGACGGCCCATGTTTTTCGAGCGTTCGCTACAATGGTCCTCAGTCAATCCCGCCATGTATCCCAGCAGATACGGGATATCGACATTTCTGCACCATTCTAGGCGGGTAAGGTTTTATTAACCCTCATCCACGCAGCAGCGTCTGTTCATCGTCGTGGCGCTCACCATAATAATCTGCCGGTCACGTTCGATGGAGCTTTCCTCTCACCCGGCCCCCATCCCCATACGCATTTCGTCGTTAAGCTGGGAGTCGATACCGGCGGTCAGTACAGGCCACGCCCGTCACCAGGAACGGGCGCTGAATAATGCTCTTTCCGCTCTGCCATCACTTCAGCATCCGGACGTTCTCATGATTTCGCCTCCCACGTCTCACGAGTGGTGTTGACGAAGGTTTTACGTTTTCCCGTATCCCCTTTTCGTTTTCATCCAGTCTTTGACAATCTGCACCCAGGTGAACGGGCTGTACGCTGTCCAGATGCGGAAAGTACACTGTCAGATAGCTCAATCTCTTCAGCATGGATGACGAAAACCAGAGAATGCCATCACGGGTCTAAGTCCGTCTTTCGCACCAGATAACGGGCATCATAGTAAAGTTATTCCTCTCATCGGTGGATGACGCAGGCATTATGCTCTAGCGCAGAGATAAGATAACACGCTGGAGGGGATAATCATCCGGCGTCCATTTGAGGCCAAACGGCGTCTCTTTGTCGCCAAATTTAATACTGCTCCCTCCCCCGCAATGCGGGCAGGCAACATGAAAACGCATAAATGCGGGGATTCACTGGCCTATCATGGACCGTAATTGACAGTGCCTCATTTGGCTGGAGCCACGGATGGACTTTACAGACCGAGCCTTCAATACGCTTGTCGTCACCCAGGAACGTCGCGAGAGCCTTCCTGTTCAATATCATCATCAAAACAGGCAGCAAGTTCATCATAACCCGCCTGACGCAGCGACTTTCACGCCTGCTTTTTGCCGCTTTACCGCCGGCACGAAGCCACGCCGTGTATCGGGCCCAACGCTTCATGGCTGTAGTAGCCTGTATCCCGGTGCTTTTTGCCATACACGGGGCCAGCTAGGGAGAGCAGCGACGGAAGATATCACGAATAGTCGGCTCAACGTGGGTTTTCGGGGTCCAAAACAGCTCCATCCATTAAGCGAATACCCTCCGCCTTGCTCGTAGTCATACAACGGACGAGGCTCTACGAGGCAAAAGAGGTCTTTGGAAAATAACGCTGAAGACGTGAACGACGAGGGTGTCGACGAACATGTAGTCGGTGCCCTATACTTCCTTCATGGGTCTAGGTGGCGGACCGAACATGTTCAACGAGACAAAAGTCAAGTGGTGAATTCATTTTCGCTGGAGGAGCTCATACGATTAGCGACTTAAGGAACAGCGACTTCATGATAGCGTCTTAGGCGGACTAGTACATCCCTCGAATAGGGGCTAGATCCGCAACCTGTTAATAAACTGTTCGACGTGGTTTGTCGAAAGGCCAAAACGAAACCCGCGGTGGCGTTGATGACAGGACGGCTGATTTGTTCGTAGCAGATTCTCTTACGTATTAAACGCGTTTGAGGAAGTAAAACGGTACTGATTTCCGATTTTCGTGCGCAACGCAGGCCGA
>16
CGTCCTGTGAGGCATCGACTTGTCATAGATTTGAATAACTTCCCCAATTATTAGAAAGAGTTATTATCAGGTGCCCAGCAACTCGAAGATTTTCAGAGGGATCTAGAATATGGGTCGAACATACGCAAATTACGACGCTTACCGCGGAAGTGAACGAATGATTTTATATGAGGGAGGCTGTTTGGCCAAATCCGGTAACTTGCTATCCAATTCCTAGGCAAGTCATTGGCATGAATCGCATGCAGGCGAAGGACGTTGTAATGTCTCCTAACCAGCAGTTCCTAGGGACAGTGCGTACAGTCATACATCGTCGGTGGAGGTGGTCACAATTCTCATGCAAAAATATGTAAAATCGGGCCTAACTGGAAATCATTCAACCGCACTATCGGAAGTTCACCAGCCATGCGCTCGCACGTTCCTGCAAGTACGACGTGTCTGCGGCGGCCCATATCTCCTATGAGCAGCAACGTGTTAGCAGCCAGCCAAGCCAACTCTAATTTTAATACATAATGAATGATAATAATAATATTAAATTTCCTGTGTAACTAATTTACTATGGGTTTCTGATAGAATCATTGCAAAGATCAAACAATTATTACATTGACAGTTAAGCGTTAATTTATCACCTGACAAATATATCAGCATCCTAGCATTTCTAATCGTACCCAACTTAGAGGTTTTAGTACCAAACCCATGGGAAGAAAGACTTAAAGATTTATCGCACTTGCTCAAATGCTGCAATTGAATACAGATGTTTTTACCCTGAATTATTTCGCTTGAATTTGAATCAATTCCTCCAAACCTGGCAGAACGAACATTTATTATTCAAAAACAAACCAGATTGTAGGATATGACATTTGGTAACAATAATGTTATCCAAATGGAAAATGATCCATTAATGGCTTGGGCCTAAATTCCGCAATACGATAGAAAAACAAGGCGATTTAGAAATGTATAGCGAGGCAAAGGCTCTTATTTCATCTTGGCCGTCGAAGAAAATGACATGCGTTGGTCAATGAAGAGATATGTTAAACATTGGTCAAAAGTTAGTCAGACTTGCACAAAAGAAATTACCTTCATATTTACTGAATCATCTATTATTAAATCAGAAAGACGATGGGTCGCTACATTAAAAAGATCGAATTATTACATGCCTTAGCTATAATCTATGGCAGAATGTATAACTGCTGTAACTCTCTTGTGAAATAAAATAATAAACAATCCAATGCGTGACGTGGCCCTTGATTTCGCCAACATCATTCGACTCTTTATTTGTCTGATGAAACGCCAGGGAGAATAACACTTATTTAAATTAAAGATTACTCCATAAGCATTGTCATTTAGCATGATACAATACTGACAATAAATAATTCCGTTGAAATGAGATATTAAAGGATGTCCCTAACTGGTAGATAAGCCCAAAATATCACTTCGACAGAAGAGTCGGTTGACTATACAGCCAAGCTTGCAGAAACTACAACGTCCACCGACGGTTATCACAGCTTCAAACATTAATTTGATAACAATTCCATCTAATGATGTCAAGGCCAAGCCAACAGTCGAAGATCAAGCATAAATATATTTGGCGGCGTTATGCAGCCTGACAGGCCAAAGACAAATCCGAGCCATTGGGTCAATCAGAGCTATGAGCCAGAAAAGCAAGCATCTACTCCAATAAACCAATACATACATCCCAATGTTACATGAAAGACTTCAGGTAATGCGAATTGATTCAAATAATAATCAAATGGTATTTCATGGAAATAGTTAGAGAAAACTATGAAGAAAGGCGATTTAGAAGACTATCAACAGCAGACTCAAACGAACTACGAACAACCATACTTCATGCGTTCAGTCTTAAAGCAATTGGCGGTGATGTAAACACCTGAACAATTGAGTCATAGAACTTCCATTATTCTCCTGAACCAATAATAATCACAAATAAACCAATACTCATTTACAATATACTAACTAACCGCAGAACGTTATTTCACAACGTTTCTGCGGCAGAAACAAACCATTACTCCATAACAGGGACAGCAGCGCTCAATATCGATGCAGTTGATGGTGAATCAACACGGTTCAGGCACCGCATCTGATATTCTTCCGGCTTCCAGCAACGAGGTTTCTTCCTTCGTTCGATTCCATAATCTGCAGCATCCTGAAACGGAGCGCAATATGCTCACTGGGCTACCTGCATCAGGCTTTTTGTTTCTTCCCCTCCCGGATCCGGAACAGTTTTCTGCATTCCTAGATTATCCTTCACCCCAGGGTTGCCGTTCCACTTCTGATATTCCCCTCCCCGGCGATAACCAGGACATTTCCGTAACGACTGAAGCGTTCAGAAATAAAGTAACGCGTCGCGCATGGATAAACGCGCACGTCATAGACGGTTTTACCCCGATGATCTTCAACGAGATGCCACGATGCCTCATATCAATGTTGAAACAGCGCCAAGCCCCGGACCGCATCTGGCGCTGTATGCATATCGGTACTGTTGCAGGCGGCAGACCGTATCCCGGGGAATATGCGTCACCTTCACCAATAATTCATTAGTTCCGGCCAGCATATTATAATTTATGGTCCTGTGTTGTTCACTCATTGCTGAATGCCATTATGCAAGCCTCACAATATAGTTAGTGCAATGTTTTGACGGGTGTTTTCCGCGTTACCCGCAGCGTTAACGGTGATGGTGTGTTAGTTGAACCAATACTGAAGAATGGCATGAGCACGAGACGACTCGATGCTGATCGACATCAAGATAACCCCTCTATCTGCCGCATGTGCACTCACGGCGGCCGGACACTAGTGGGGACAATGAGTGACTGTGGCTGCCCTGACTGTCCGTTTTCGATAAGCACTAATACCCTGTGCTCATTCCTTTAACTTAATAAATTCCTGTAATGGTTAGTGCTCATACCTGACTCCAGCCAGAACTGTTCATCCTTAAACCATTGTGGGCATGAGCACCCGCTCGCCCTGTTGAACCCGGCCATCTGTAGGCTGATAGCCCCCGTGTTATTCGATCGTCGATTTGATGCTGTAATACCCAAATCTGCTGTTGTTTTCGTCCCGTAATCAAACGACGATGTGGTCATTTTCGTCCCCAAATCGATTGGCCATGCACTGGCACTGTGGGTGTGCGACTTAATTCCATCCTGTTCCCCACAACCCAAGAGCGACGAATGGCGGGTTTCCCGTGGATGTCCGCCTCAGCGCAAGCCAGGAAGCACACCATCCATCACGCGACAGCAAGTTTGGGTAGTAGCTGATGTCAAACGCCTGCCCTGCATCGCCGACTTAGCCAGACCGAATGGGTAGTATGGTAAGGGTGTAAGCGCACCGTAGAAGGTAGCCGAATTTACTAAACGCGGATAGGTGCCAATAGATATGCATACAGAATTTTGCCCAAACTTAAAGTGTAGATAGCGTGAGATTTGAGTCAGCAGTGAGGCGTCAACCATTTCGCAAAATACGGTAATTTATTTTTACTAGGTTAGAAACCCTGCATAGCGCCGTCAGTCAGCATTCTTCGGCTTTGTTTACCGCAAGGCGTTAGTCATGGTGGGTCAAAGTGTAATCATTCCCGAGCGCTGCGCGGCCAGTTCATTCAGCGTATTCAGGGTCACGTCTCAACCTCGCGTCAACAGCTGACTGCAATCGGCGTATACAAATTACTGAGCACGGGGTTGTTTCGCATGACTTGTTCTTGTCGAGGGCCGCGGTCTTACGTACGTTTGCGTTCCATGTCAATTGAGTGGGTTCCATTGAGGTTGATTTCTTTCGTTCATCCATTACTAGCCGTAACTAGGTCTTATTCGAAGGAGGTTTCAAGGTCCTTTGGTCCGACCCTCCTGCAGCTGTAAACATTTTACGTTGTTAGGATACCATAGAGCTGGGCATTCCGCTATCTTTAAAGGTTTGCCCCGTGCTATCTTTACGTGCCACACTTTTATATGCGATACGCTCATCGCCAAGCTTCTGAGGATCCTCTGTCGCATTCGTGGATGCGCGTTAATGGCATCCCCCGCGCCTAGGCTGTTGGCTGTCTTGCGCGAGCCTGAAGAGGCGGGCGTCGACTGCTGTTTCGATTTAATGGTATATGAAGGTCGTCTCAGCGTTTTTAAAGGTTCGAGAGTTTCTGCTAAATTCTGCCGAGGAAGCTGCACGACAGGCTCTATCGGCACTTGATGATGCGTTCGTTTGATACTTTTAATCGTTGCGAGCGGGGCGAATGGATTTGAAGCATGGCACTAGCTGTAAATTTCGTGGGCGGTTGGGAGGCAGAAAGTGTGAGTAAGGCTTTGTACCTATGCAGCATTCGTGTTCTGTACGTTTCGCGCACGGCGTAATGGGCGCGTTTGAGTGCCTCGGGCTATTTTTACATTGGCTGTAATAGTCCTGATGCGGTCGTAGGGGCAGCTTCCTGAGCTGTAGAAGCTGCGGTCGACCATCCGTCCGGCGACGTGCTGGCGGCGCGTGCTGAGTCAGAGTTGCATCAAGTCTCCCGCCACTAGAGATAGGAGCTGATGCATGCATCGGATTTTCGTTCGCGTTAGGGTACTCTGTGCCACCGCCTCGCGTTACGCGCTCCTTCTGGGCCCAATACAGTTTAAGACGAAACCGACTAAGCGTATGGCATGATGGTAGAGTTTAACCAACACAGAGATCATTCCAGCGTTAGAGTTGAATCTTCATACACGGTATGGTCCCGGCGTCCATCTTGATATGAAAACCGTCACTGCCAGGATAATTACTGATTATCCCACATCCATGCTGTAACGGACAGCCGCGGCTTTCATGTAAGATTCTATCACTAGGGGTTGTTACCACTAGGGCGCGTATGGTCTAGTCAGTTAGGGCACGTACAGTGCGTTGTACTAGTTTTCATGTGCCGTCTTTCAGATATCCTAAACGGGCTGTATTTACTTAAAACTTCGCGCCACACCGCGTTAAGCGGGCTGTCAGACATGTGTTAGTAAGGGTCAGAATTTATACAATTACCCAACGATGAATGCGTCAGATTACCGAGTCGCCTGCCATCCTTCGAGCTGAGAGTAATACAACTAAACGAAGCTAGCCCTTACTAGATTAGTGTAATCTGAAACAAACAAGGGTGAGGTATGCTGGCATTGCACTTTCGTCCTAGGCGTATTGGTCCTTTCATATACCCGGGAGTGATTTCGTTAATAGATCGTGAGGTCACTTAATACGGGAGTCAGCGCTCCATGGGACTGAATGCTAAGTAGTACTGATTTGTAGACTGCGGTCCTTAAGGTCTACAGCCAACGTCCCGAGTAAGGATAGCGCTGTAGCAACGTATCCTCCCCATGTCATCACTGTGCTGCTCTTTTCGCACCCAACGCGGACCCCAGGGAACTAAGGCCATAGGTTTGGCATCGTTGAGCTCAACGGTACTGGTCACGTTATTGCCCTTTCAGATACTCACCGCCAATCGCCGCTAACAAAGGCAATGTACTCCCGGTTTTCGCTTGGCGACTAGCCCACGTAAACTATTATAGTTTAGGTCGCACGGGCTCGAATATACGTCAGGCAAGTCGGCGGACAAGAACATGAATGTAACAAGTACGCATCGTTCTACCTGTTTATAGACAGAAGCCCGCGTTCCCAGGGACAGACCTGGCACCCCAAGCATACCCAAGCCTTAGAGCGCCCTGTTCTTGTAATCACAAGATATAAGTGGCACACATGGCTGGCAAACGTATAAGCGAATATCTGCCGATGCGTTGGACGCGTGACGATTCGGTAGAATGTAATAAGTTCCTAGGATAGGCTGGCCGTCAATACCGGAGAACATGTACCCTGAGTTCGCCTAGGCAGGATAGACTAGTTATCACGAGCGTTCATCAGTACTTTTACAATAACAATAC
>17
AATGTTTAACCTGTGCTTTATTTAATGGCGGGTGTAATAATGCATTAATCTTAAGTTAACGCGGTTGTTACTTGCTGCATTGCCAAATTCTCAAAGTTAGCGTGCAAGAATTTAGCCCTTCAATCGCCAGGGAAATCGCAAGGGAGATGTATGTGAAGCGGTTAGTATGCAGCCGTCATTAGAAGTGAGTATACGACCCTGTTTTCTCATGTTCGCTCGGCAGGGATGTTCTCGCCGACCTTACGAACCTTTACCACTTGGAGAGAGATGGGTAAGCACAACCAAAGCCCAGTGATTCTGCAATAAGAAGGCAGTGGAGTTGAAGGTAGATCCATGACCGCACCGGATGAGGCGGCTCCATCCCATGCTTTCCTCGAATGAATGTTAATTCTCGTTACCTGAGCAGGCTGTTGCTCAGGTATTTCTGCAGCTCAGACTTGGAGGTGAGCGATTTACCTTCAAGAAACTTGATGCAGGGGATAGCGGTTTAGGTGTTGGCCAACCACAACCCACAGTACCCCCAATGATCCCATGCAATGAGAGTTGTTTAATCGTTGTGCTGGGAAAGTGCGAGATAGAAGGCCCTGAAGAGACGTTTGACCGTGGCAGGTGTTCTGGTCGCACATAGTCAACAACAATTGAGCACGAATCTTCATCGAATTAGGGGGAATTTCACTCCCCTCAGAACATAACGACGTAAATGGATTGAATTATGAAAGAATGGTTTTGATCGAGTACTTACCGCAGCATAATAAAGGGAAAGATAAGCGCTCAATAAACCTGTCTGTGTTCCCTTAATTCTCTGCCTGGCCTGATAATCATCATGTGCAGGTTGCTCCAATTATTTGTATTCATAAATCGATGGGAAGAAAAACTTTCTCTTTACCAAACAAATACTGACAAGAGTCTGGTTCAGAAGATAAATCGCTCTAAAGCTTCAGTTGAAAGTATAAGAACAGCCTCGCAGGACGAATCATTGGGATTCCCATCTTTGTTGTTGCGAAGGCGACACCATTAGTTTTGGATCAGAACCTGTTTCGGGCCGACCACATCCGATCTGACAGATTTTAATCGGGGAAAGGAATGTCATGCCTCGAGTGCGAGCGCGTTCTGCGAGTGGAGTACATGATGAGGGGAACTCACGCCCAAAGACGATGTTATGCATAATGCATGTTTAAACATCGAAACGGCCGTGAGGACTAGAAGCCAAGCTACGTATTTGGCGGCGATACTTAAAGATTAGGGGCAACAGATATTGAAGGGGAGCTTTGACTCATTGGATAGTCATTAAGCCAAAATTTAAAGGATATAAAGGTTGCCAAGGATATTATTTTACCGTCCTCAATTTTCAGCACTGCTCGTGAGTAAGAAAAGATGAAGCGGAGATATTTTAACAGAACATTATCTATCAGAAAGGCCATCTCTCAGCGCTCTGAAAATCTGAATGCTGAGCCTGAAGAGATGAGCGGCATAAGATGCTACGCAAGAATGAAAGTGATATACTGGAAGCTTTTAAAGGCAGGTGGTAATTAGGATTAATTATCAGGAGATAGTGCGGAACAGAATCATGCCTGTTGGTCGATAGTAATAATTCCTTACGTTATCTGATAGCATTTGCTATCCTTTCCCCTACTACATTCCTGGTGTTTCTTTTCAGCTCATAGAGATGGTCTTGGGGACATGTCATCATATGCAGGAACCATGATTGCAATGCGATCCTCTTCCTGCCTGCTCGTTTCTCCGATCGGAAGCAGAACGCGCCGACTGGCCATTAGAGTATGGGTATATGACATCTAGTTATTTATTACGCCTGCGTTGTTTTGAGCTTGGAGCTTGCTTTGTTTTCTGCGGGTTATTGCTTCTTTTCATCATGAAGGGCATAAGCGGCTCACATGATACGCGCTATCGCCATCGGCATTGCCTCTGCATCGTTCATTCCATATATGCATCCTTGTTTCCAACTATAATTTACCAGAACAAGAATAACCCGGCCTCAGCTACGCGGGTTTCTTTGCCTCACGATCTCCCCAAAACACATAACCATTGTATTTATGCAAACATCGGGTAAGCCTAATAGCAATTCAGATCTCTCACCTACAAACAATGCCCCCTTAAAATAAATTCATAAACATACAATATACATCATCTGCGTGATAAATTATCTCTGGCGGGTTGTACATAAATACCACTGGCGCTGTAGTACTGAGCACATCAGCATATGACGAGACCACCATGAAGGTGACTATCGATGCGTAAAAAGCAGGGGCGACGAAGTCAAAGCGAAGGCTTTGCAGCATGTGTAAACCCGCATCAACCGAAGCGGTCTCGTAGTGCGTTGGGAATCACTTACATGTCGATGCTTAATCTTATCAAGCAGCTGGATGCGGGGGTTTTCCGTTCAGCACTACAACTGCCACACACCACCAAACCTAACTGACAGAGAATCCAGATGGATGCACAAACGCCGCGAACGTCGCACCGACAGAAACAGGCTCAATGGGAAGCAGCAAATCCCTGTTGTTGTGAGCGCAAAACCAGTTTAACCGCCTATTCTCTCGCCTGAATGCGCAAACCGAATCACGAGTAGAAAGCACTAAATCCGATAGACCTTACAGTGCTGGCTGAATACCACATCGATTGAAAGCAGACTTGCAACGTATTGGACGCAAGAATCAGCGCACATGGTACCCAAGCCTGGCGAACGCGGCATAACATGCAGTGACCTCGAGAGAAAATTAAGGGAAAATCGATTCTCTCTATCTAGTTACTTAGATATTAGTGGCTTTATCTCAATATTATATGGATGCTAGCTGGCAACTAATTCAGTCCAGTAAACTCCTCAATAGGGAATAATATATGCTTTCCATTCCCATCGGGAAAAGTTTGTTCAACACACCAAGCTCAATCAACAATCATTGATGGGAATTGTTTGATGTAACCACATATCTTCCGTGCCTTCAATCACGGCTGCGCACAAACCATAGATTGCTCTTCTGTAAGGTTTGAATTACTGATCTAGCATTTATCAGCAGCATTTTGCATCTTAATGCGTTCTTAGCTTAATCGCTTATATCTGGCGCTGGCAATAGTAATAATCGATGCACATGATTGCTAGCGAAAATGCAAGAGCAAAGACGAAAACAGTGCCACACATGAGGAATACCGATTCTCATTAACATATTCAGGTTATCTGGGGTCGTAAAGCAGAAGTCCATCGAGATAACGATCATATACATGGTTCTCTCCAGAGATGCTTACCTGAACACTCGTCCAACCAGTGGATGCATTTCTATACATCAAACTGTAGGGGTTGTAATAGTTATCCATTTCTCGTAGGGGTGACACGAGAACCACTGAAGCCTGATGGTTACGACAGGCACAATCTTCCTCGCGATTCCCTCCTTCGGGTGATATGGAAGAAGAATTTGAAGGGGTCGAAGAGCATCCCTCAGTATTATGGAACAATACCAGGACTATCCGTATGAGCCGACTATTGATAAAATCAATGGTGTGGACAATTCAAGCGATGCAATGGATGCAAGCTGCAATCGAATGCATGGTTAAGCCTGAAGAAATGTTTCCGTAATGGAAGATGGGAAATATGTCGATAAATGGGCAATACGAACGGCAAACCTTGCCCTCAGAGAACTTAGTAAACCAAACAACAAAGCTGCTGATAGTGGCCTTTACGTTGGCGGTAATAACACGATAAACATGCACTGTATTCATTCCAACGAGTAGCGACTCACGTTCGAGATCATTCGCTCGTAACTAAACATCAGGAGCCGACCTGTTTGATTATTGGAAATCTTCTTTGCCTCCATTGAGGCGATTTTTATCTGTGGATATGAACACAGATGTCAAACATCAAACATCATTGATCGACTGGAAAGCATCAATAGAAATTGAAATCGACCATGACGTAATGACAGAGGAAAATTCACCAGATTAATAATTTTGGTCAGACCTGAATACCTAACTCAATAAACACGGCTGGTATTAAATGAACTTAATCATGCTGGCACAGCCTGCTGGTGTAGCAATTTCAAGCGACTTAATATGCATATCCCTCTGGTGTTTCTTGGATTCGACTGGAGGATGATGGAAATGGTCGGAAAGGATGGCCTCCAATGGATGAGCGAAGGAATAGAATTACCGATATCGATACATCAGGAATATTTGATTCAGATGATATGACTATCAGGCTCGCAGTGGGATTAGGTCTACCCGAGCAGATAATACGCTTCACTCGAGGCGTTCGTTATGTATAATAAGAGCACCATGCAAACTGCCGGGCTTGCAGGGTCGAGGTTTGCTGGCTGCCTTCCCGCAATCTTATTTACTTGAACGAATCCCGTGTAATTACGTACGATGGAAGCCTTATCGACATACTTAATCAGCCAGGAGTCCCCACGAATGGATCAAACACTTATGGCTATCCGAGCGGAGTCGCAGCCGCATTTTATTGGCGCACTTATCGAAAGATGTTTCGTGAAGCCGTCGACGCTGTAAATGGATATTAATACTGAAGTGGTAAGCAAAGCATTCACTAACCCCCTTTCCTGTTTCCTAATCAGCCGGCATTTCGCGGGCAGGTTTTGCCAGCTATTTCAGGGATTCAGCCATGAACACGTATGCCATTCAGGATGGTCTTGAGGCTCAGAGCTGAGCGTCATAGAGCAGCTCGCATTGGAATCGAAAGAGAAGGGGCAGAACTGGCACACTAAGAAAGGCCTGCCCAGCACTGTTTGAATCGCTATGCATCGATGCTTTGCAGCACGGGCCAGCAAAATCCATTACCCGTTAGATTTCGCGCCCGCGTATTTGCGTGCCGGAGCATGACCAGAACACATCCGGTACACTGTTGAAACCATTGCTCACCACCAGGTTGATATTGATTCAGAGGTATAAACGAATGAGTACTGCACTCGGACTCCGCTCGGGGAGCTGCTGGCTGAACGTCGGCATGGATTTCTGTCACTCCACAGGAACGTACCACTATTCGCCAGACGGCATTTAAAGGTGATGCCAGCGGTGCTGCGCAGTTCATCGCATTGATGATCGTTGCCAACCAGTACGGCCTTAATCCGTGTGACAAAGAAATTTACGCCTTTCCTGATAGCAGAATGGCATCGTTCCGGTGGCGGCGTTGAATGGCTGGTCCCGCATCATCAATGAAAACCAGCGTTTGGCGCATGATTGATTCCAACAAATGAATTAGCTGTACCACTTACAGATTTAGTAATCAGGCCACGGGGGAAGGGACCTTAATCATCCCAGTGCCGTGGCGCAAACCATCAAATGCGCGCGAGACCGTTCAGATACCCATGAAGGAGGCAGTATCGGACGTGGCAGTCGCATCCCAAACGGATGTTACGTCATAAAGCCATGATTCAGTGTGTGCCCGTCCTTCCGGATTTGCCTGGTCATGGTGACCTGACAAGGATGAAGCCGAGCTCGCATGTCGAAAATACTGCATACACTGCAGAACGTCAGCCGACCCGACATCACTCCGTCTACAGTGAAACCATGCACAGGAGATTAACACTCTGGACTTACCTCCGGGATAAACAGCACTGGATACAGTTTAG
>18
GCTTCCGTTGCGGCTTATGTCTATTCAGGTGCTTGTCACTATTGGGGTTTTAGTTTGAAAAGAGCCGTTTTACCGTTCTTCTTGGTCAGACTTAATGTTTATTTACGTAACCGCGGAAAGAAGCTAAAAGTACTATGAAGGCTATTTTGGTATGTCGTTTCTTCCTTTGTTAGTGACCCAACAATGGCATTGGACAAACAACATGCGTTTCTTCCTTCCGGGTATCTATTATCAGAAGGCAGGAAGGATCGCCGTTTATCGTCCGTAGCATCCAAGGTAATGAGGTACTCTGCCGGTCACTGTAGCCGAAGGGATTGAAGTGAACACGAAGGTGCCGGGGTCAGTGAAGAAGGGCAAGCTAGGATCTCCATAAACCGAGCTTACATGACAGCCATCAATATTACGCGTGCAGGCCGACCCAAGCACAGAATGAAGAATGCCAGACGGGCCGAATGTAGAAGGCATCGATTCCTTCCCACTTCATTGGAAGGGGAAGCTCCTTGTCGGTGCCGTCCACGCTGAAAACCACATGTTGATTCCTGAAACGGATGATAAAGCTGACAAAGCAGCCCCATGAACCTGATACATTGGTATCAGACCATGAATATAACAGTCGATCTAAGTCCGCTGCGGCTTTTGCTCATCATTCAGTACTGTTCCTGAGCCACATAAACCGTTGAATGAGCTGCTAATCTATCTCCGAAAGAATCACGATAGAAGGCTGAGGAATTCCTTCGGAAGCGACCTACCGTGGATAGATGTGGTAAATTAACAGTGTCGCTTTATGTTCCCAAATGCTCTGTTGCTATTTATAAGCAGCGCACCCTATCGTATGCCGACGTATTAGGTAGCCAGCCAACGTCGAACCCACGTTTACCACTGGTTTATTCCGTCGCTTAGCCATGGCCCGTACCAAAGCACCGGATAACAACCTCATGAAGCTAATCTTTTCTAGTGGGTCTCCTTTCTCGGAAGAGCCGTGATGTTGACATGCTGGGTATCATTGAACAGTGAATCGCTGCTGACGTCTCCTGGGTACAAGGCGAAAATAGTTCTGATCAAAGCATCTTCCACGTCAAAAGGTCTAATAGTCAGATCAGGGCGCATCAGTCAATCCACTACGTTCAGGCTGCCCGCACTTTTAGCGTTTACTGTCATGTAAAGTTAGACAAATACCCTATTTGTAAAGGGACGCTTTGATACCACTACCGCATCTCCAGAAGCTCTGCCCTATTAGTCATCTAAGCAAGGCAATATTTACTCATTTATCTTAGACCAACTAGATTGGATTATCGCATTCTCTGTTTTCGTCATGTAGACAGTACTGAGCCTGACATAGATCTTTTAGATGGACATGTACAGCCGTTTAGACTAAGTCTATACAACCCACCGAACACGAAGCGTCATTAAACGTCACTGTAACACGCTCGGTACGTGGGGAGGAAAGTGGGAAGTCGTCATGGAATGATGGCAGTAGAATAAGTCAGCCGTTGATTCTCCGTCTCCGGTACCGGTACAACGCTCCCAGCTCCCGAACCGCATGAACGGCGTAGATCGGCCGGGAAGCTGGACTGATCCACATCGAGTCGTCTGACACCACGAAAGCTGAGCCTTGGTACGTTAGATAATAATAGCCGCCGAATGGCTAAGAAGTATTCTATCGCTGATTGATACGACCAGGAAGAGATTGTATGAACTAGCCGAACATGGGTTTAGAGCTGCGAATGCTAAAGGGACCGTCTACGAAAGCCGTGAAGCACCGGCATTAATGAACAAGCTTCTCCGTCTCCACAGTACTTGGTAACCGCCATAAGATTTATACGCTTCACTGACGCCGAAGGGATGAACGCTTCCGGTACGTCTATTCCGCAAACAAGACTTTATTATTAGAAGCTTACGCAGCATGACTGGAAGAGCATACCAACCGGGGCATAAATACTGTGGACATAAAGCGAACTAAGCTACTGAACCTTCGTTGCTGAGCGTGCATCAGTATTCCGCTGGCACTTATCTCATTGCTTAGTGCCTTACTTCCGAGCCTTCCGGAAGCATTGCTGAGATGAAGCACGGAATAACCAATCTAATTCATGCCGGAGCCATCTAAGCAGTATTGAGAAGGAAGTAACCTAGCGAACAGATACACGAAGGACGAATGAGTTACTATTCGATTAACTAAATATATTGCAAGCATAGCGAATCAACCGTAAGGACACAGGACCGTAAGGATTTGATGGAAGCCATTCCCCTTTGGACTAAGGACATGGACATACGCTTATATACGATTAGCATCTAAGTCTAGTAAGAGTGGGCTTTAATCCTTCGATTGCTTCCATGGAAGTCGCCAATTTACCGTGTAATCGACTACGGATGGCAATAACGATGCTCAGACGCCATCCAGCTGCCGATGATATCTTCCTGTGTTTTTCAGGCTCAGTCACTCCAAGCTCAAGGGTGGGCATCTGGGAAGAAGCCGTGCCTTCCGTTTAAATGTCGATGGAAAGAGTTCTAAGTACTTACTGCATTGACGTTGTAATGGAAACGAATTACAGGCATGTACGTACCGCCTTTACGTGAACTTGTTCGTTCATAGCGGTAAGTTCTTCCTCGGTTCCTTAGACACAGTTCCCTGTACGAGCGATCAGCATCAGCAGGACAATAAGCGGACAGCTTAAATTTGGTGCCGTGACATTAAGGAATGAGATATAATGGGTCACGGGTATGCTCCTGAGTGCTAAGAATGGACATCATCAGGTCCGTGTCTCCATCAGCCGTTTCACCAGTACGAATGAGTCCGGACGGGCATGGCTTGCAAATGTTTACCTATTAAGATGAAGACATACTCCGCTCCCTTGAGAGCGCATGCAAGGCCTTGAAGGCGTATCCGCCCATTGAGTATGGTACTAAGTCATAGTGGCTTCTGTCTTAGAACAGATGAGTCCACGAGGCGAAAGTACGGCGTGACGTAGAATTGCCGTATTACGCCGCAATACGGAGGCTTAGAAGTAAAGACTTACACTGATCGACCTGTGAGAGCTCAATGACTACCACCGTCATAACCTATTCTTACGGTCCAAGTATGATACGGTATTGAGCCGGCTTCTCCTTCCCCTTTTAGAATTACGCCAGGTACTCCACTAAACGATCAGTCTGAATCTATGGTATTTATGGCTACAAAATTCTTGCATGCGTCACATAGGAGAGCCAGGCCTGGCGCTGTTCGGACAGTCTATTCTATTCACGGTCGATTTCGGAAGGCCAGTCGGAGTGAGTAAACGGTCTGAACTGCCTCGTGACCCCACGCGATTTGTCGGAGTGTATTCTTACCGATGAGGAAAGACCTGACAGGGTCTAAACTAGATGGCTAGACTATATCTACGAAATTTTACTAAACGGGCTGCTTCGTTCCGTAGTGAACGATGGGAATGATGACCTATGAAGCCCGGGCCGCAGCATTTGAATCCGCTGGACAATCAACAGACAGAGAAGAGTACTAAGCTGTAATGCTTACCGCATATTGCCAGCATCCTTTAATGAGCCTGATGCTGACACGCTATCAGGGGTTCTTTGTGCTTGCATCAGCTTACGATCAGCAGCCTTACGATGCGTGGACAGCCTGACTGCCCAGGAGGATAGCGCACGCTGGCATTATCCGAGAAGTGACGGTACACCAACAGTCGGAAGGCAGTTCTCCAGCTCCTTCCTTAGCCCTACGGCCGGTCAGCGGAACGGTCTGACGTTTATTTGATAGTATTG
>19
TGTGGGTTGTATGAATCCTAATGTCTGCCTGTTTCCCGCCGCATCTTTTATTTTAATTAGACAAAGAGACGGGTAGGGTGTGCAAACCGCACGCTGAGTATCCTCAGGGGGAGGCTTACATCTTCGTAGTAATGCCCTCGTAGCTGAGCAAGTAATCATTATTAGCCGACTTTACTAGTCCCCAGCCGTTGCTTGAACAATCTAGAATTCTACAACAGCGGTATGGCATTCTTGGTCTGCGTCAGGCGACCATCGAGCTATGTAACAGGCCACATGATGTACATAGGGACGGACATGTGTACTGCCGTGTACCTGTAGGGTCTTACAAAGATCCATTGCACGAACGTCACATTTAGAATTTTCAAACCTGGGACCAAGGCCGCTGGTAACTAGAGCGAAATGGCTAAACATAGGCCATCCCGCCTTGACATGTGTTATCTTTAATAAGGAGGAAACCAGCATTGTTGGTCGCCAGCTCTTGACAGGGTAGGCTTAACGCCGTCCTAGATTCCGTTGAGCACGTAGACTGTGCGTATGCGGTACCTGGCCGCTAAAAGGCTTTGTTGCTTCTTATTAACCGCTAATACGAGGCACCTGTTTTAAGAACGATGAAAGAACTGATCGGCCTCGGCCAGGCTATATCAAACACGAGCCGGACATGTGTCTTAAATGTTGATATGTTTGCTTTCGCATACATATCGTGCGCATTACGTTAACCATTAGTTCGACAGCTGCCGAAACACCGCGCGTCATGGCTCATCCACCTAACGGTGCACTGTCGATCGAAATGGTGGCCAGGTTCTCACGTAAGCGACAACGGATTCTTACGATGTTCACTAAAATGGTCACTACACCTTAGAAATATTTCAGATTATAACATCTGGCTCTCACACTAACGCCGCACGTTTTTGTTGCAAAGCCTTCCTTGGTGCTGTTGAGTTCCCGAATACGTACGATGAATCCAAGGACTTAAGCCACTAAGCGACGCTGTAACAAAGTAAGAGGCCAAAACATGCGCTGGTTTTACATTAAAACCTGTAAATTTAACATTTTAATTTAACAGCCAGCCGGATCGCGTTATTCTCGTTTGGGTCGGCGGCTCCCACCATATTTCCCCGCTAGTCATGTCGGTTTGCGACCTGTTTAGCGGGTGCTGTACTAACACCCAGAGGGCCTAACAAGAAAACATTGGCAGATGTTTGCCAGCGTAGTGGTTAAGCAATGGACTAGAATTTGACGACTTTCCTTTAGGTGCCCCTACACGCCCGTTGTATAGAACAGCGAAATCCATGTAACAGAGCAGTTAAACAACTTAACGACTAGGCCGGACCACCACGATTAGCATATTTCTGTCTACATGGAAAGTCCGCAGAGCGGCGTGACTTTCTAAGACGCTTTTAAGCACATGACGATATGTCAATCTGATTTAATATGAGGTGAATCTCACTTCACCCCTCTGCGTACGGACTTTAAGGCCTAACTTGTCCTTTGAATAGTCGCCGCTGAGTAAGTGGTGATTGATTGTTATAGCAGTCCTCGGCCTGGCAAACCCAAGGAGGAAAGGGTTTAGCACCCTGAGGCTTTTGCCATACACGGCCTTAGCTAGACATCGCTTTGGGTTCTTTAAAGATCTGGTACCTGCAAGAAGCCGGATCCCCGCCACGCGTTACGAGTCGGATGAGCATATCCTAGTGTGCCGGCGCTACTGCCCAAGCCTTAGTTGGCTCGATGGCGACCGGGTGTTTATTAGAAGTTTGACGCCGTGCCTTTCTGTGTATGACGGCAGGAAATATCGTCGTCATCAACGCTGTTCGTACGGACCATGAGCAAACCAGCACGAGCGCCAGCTACTGCGACGACAAAGAAAGGCCAGCAATCGCCGTCTAACGCCGAACTGGCTCCAGTGATGGCTTACACCATGCTGCGGCCCTGCGTACACAGCGGGCCAGGATGGATCCAAAGGCAAGTACCAGCAAGTGAAGCCACAGATCTGACTAGAAACCGCCCTGTATGTGGCCCAACGATAGCATACTGAAGGCGCTGGAGTCAGCTAAGGTGGCTGAAGAGGACTCGTATCCTGGCCTAGTTTACCGCTCGCAGACAATGCAACCTGTTGATAGGGGCGGTCCGTGGTGGCCTCCGTTAGCGTTTAATTATTATCAGAATAGGCTAAAAGGGCACTGTGGTGCAAATGGGCCGTACAGGTCGGTTACGACAGTTCGCCGCAAGTCGCAACATTAAGCGACGCAAGTGGGTTTGTAGTGACAGCGATGAGGCGGGTCCCGCCAGATGAGTCTTACACTAAGTACTAGAGGGATGTACTTGTGCTTCGCTGTAGAAGTCAGGTTACCGTAAACGTTGACACGTGTTAGGGATATGGTGGAGCTACTCAGTCCGCTAAACAATTGCTGCTCATTGATGCCCGTGATGGGCTGGGCTAGGCAAAGCTACAGCACCTAGAGCGCGACTCACTAAACCTGTACACTAACGGCTATGATAATAGTCAACGAGCCGCGTCTCATACGAGGTATCGCGCTCGCGCTATTTATGCTCGGGCTCGTCTTCGGCTAGTCATCTCCCGCAAACCATCCCGACTCATTATCACCCCCACGTAACGCGATGTGCTAGAACGAGTGTGTATACCATTTAGTCTAGCGTTGAAAGGCGCACCCTACACTAGAGGTTAAGGAGTGCGGCGCGTCGGCTGATGACTGAAATCGTTAGCGCGGCCAGCCACCGCCGGGGTAAACCAGCTGCCTCCACGACCTGTCTGGGCTAGCCTGAAGCCCGCAGGCCTGGAGCACGGGACTGGATAGTGTTTATTAGCCAGCCAGCGGAAAGAATATTATAAAGGCGTGTTCTTGATAGACTTAAACGAGTCTGTCCACTCAGACGAAATATAGCAAACGGGTGGAGAACGTCATAGCAGGAAAACTGTCCTCAGGCAGAGCGGCAACGATGAGTCGGCCGCGCAGCCGCTATCGGACGACGCCGCCTGCGTGCACGGAGCCCTGACTTTGGTGTCTTGTCGCGTTAACAAGCAAAGTTGTTATGGAAGAGGAACACTAAGGTCGCGACTTCTTGCCGCATATCGCCAGCATGGCCTTAAGGCCGCTAGTTGCCTGAACCTTGTCTGTGGGTCTGCTCCCTCTGTTGTACGTACCCGGGTTGTCATCCCAGCTACCAAACTCACTCTAGAGCTTTAGCGATAAAGTCCCGACATGCCAGGTGTGCCACTGCGACCCTTAACGTTGTAGAGCCGACGGACACGATGATTCCGTCACGTACGGCAGTCAGGCCAGGAACGGCACTCGCCTAGCGTTGCTGCTATGCTCAATGCCGCTGATCGACCTTAACCGCGCTTATGATACTGTTTAGTTTGTAGAAGCCAAATTTAGCGCAGGTGCCGAGGCAAACAGGCTCTGCTTACACCCATCGGCACCGTTTGGCCCTGATAGCACTCTTACTGTCCTAGATGGCTGTGACGACCGTACGTGAGCGAACCGTTTTCCACGTGCCGGTGAATAACGGCTGGTGTCTAAATAATTTTAAACCATGCACAGGCATCAGTCGCTTCAGCCTTCCATCGCTGTCACGCTGCCCGACTCTCATCTAACAGCTTTTCGTTCTTACTCATGTAGCATATAATTTTACACGACTACTGTCCGCGTGGCCTTTCCAAAACAGCGCTGACGAAATAATCACAGCACTTAGATTAGTCAAGCGCCGGCAATGTTTCCTGCCACTTAATCATCGATTTTCTGATAGACATATGTCCGCTCTGCCAACATCTCACCAGCCTGACTGACCCGACATCCATGTTTGCCACATGACGTCTGATTACAGCGCTAGCCCTAGGCCGGACGAGCGGCGCAGTTTAGTAGCCCGATTTACGTATGTCCCAGCCTAACTCCAGGAGTAACATGCTCTATAAAGAGCAGAAGGCTTCTACAATGTAGTTTCAGGTTGGCATTCATGGACCTGAACGACCCCTGGAGCGAGCGACATAGACCAAAGAGACCTCAATGACAAAGCACCGTTTATCCCAGCCCCAACCATCGCTCGGATGTCGACGTCCGACGCAGGTGCTCATTTAACGCCGCGAGAACGCCAGCGCGCTGACGCCGAACTGACTTTACATTTCACTGACGCTGGCAGACATTGTTGCATTATGGGGATTCGACACGCTAGTCCAGCATCATCAACTGTGACAGAAAGTTTATTCACACGCGTGCTTTTAACGTGTTAACTGACGCCTGGTTGGATTCTGCTCACAATACGTTGGCCAACATGTCGGAGCACCTGTCGTACGCTTAGTGCCCGGTGTACAGCCTAACCTAGTGGGCTGCAGCGACTAGATAGGGTCGCCGTAACGATTTAGCCACGAACATAGTAACGTGATAGTCTATTAAAACTAGTAAATAAAACCTAATGAGCCACTATTTACGTAAAGTTTGATTAGGTTGTACCGGACTTAGCCCGTGTACGCTGGGAAATCTTTCGCAGCAACCATCTAGTGGCCTATCGGACCCGCCCACCAACATAGCCCACCCGCATGGATACAGGACGACGTGCTTCAGTATGGCCCGACATTCTCCGCATTGCTGTGACTAAGAAGTTGACTGTCACTATGACAGCACAGTCGGACTCAGCCGTCCACCCCGTTGGTATAGGTCGGTTAGACGAGACGCTAAAAACTTTGACTTGCTATCGCCAACCTGTAATATTATAATGGCTAATTTTATTGGTTATTGACGTTGCGTGCGCTCTTTAATTAGACTGTCGTCGGAGCGACTAACGCGCCCCAACTCTTTAGCTAAAGCTAAACAGCAGTCCCAACCTGTGGCTCGCGCTTCTTTCTTAGCGTATAGTATTCTTTCACACGCCAACAGTGCTGGCACAAAGCTTCTTTTAACTGTCCAACAGGTTTAGGTGTACGTCTCGCGTTGCTTACGTGTCTCGTGTATAGCCTCCGCGGCTTTCCCATCGTAAATACCGGTCTAGTTTTGATCGACGATTTGAAGTGATCCACAGTATCTGCCCTGCCTGCCGCCGACAAGTTCGGCAGATAAATTAGCCAACCTTGTCCTCTAATGCAGCCCCTCATACCCATGTTTAACTTAAACACTTTGTTAACCAAATATGGTTTGCTTTGACCACCGCAGGCAGTTTCTCGTGTGCCAGCTAAATACAGCAAGCTTTAGTTCGTCGGGATAGCGGCTTAGATCTATCATGAGGTAATCAACATCACGGAGTCTTGAATTATCTTACCCAATTATGACCACGTCACAAGTACGAGCACCTGACTGACGTTTCGACTCATTGTCTGACAGCCATGTAGTTGACAGGTTGGCCGCATTCGAACCGATTGCGCTCCAGCTGTCCGGCCGCCAACGAGGTACAGGTACGTCGGATGTCTGTCCTATCTAATCGCCGAGACACTTCTAGAACATCTGTTTCAACGTGCGATTTTAAGTCGTTAGGTTGGCCTATCCTTTTACCGCCAACATAATTTGGACCCTTACAAAAAGAATTTCCCGTCTTTCACAACAATTGATGTTCCGTTCTTTAAACGTACTATCAGTGAATTTTACTCCAGCAGCGGTGCGCAGCCGTTTGGGACTGACACTTTAATCGACTGATTCGATTCACGGACTCTTTCAGCTCATTGAAAATTCGGGTAATACGTAGTCATCTAGGGTTTTGTCACTGTTCAGTGTACTGGACGTAACTCGTCTGTTTCGGGCCGCTGTTAAGCGCATAATCATTTGTCGATACATCGAGCACTCAGCCCTGTCATCGTCCCCTCGTAGTACTGTTAACGAAAGATGAACTGATTGCCATGTCTTGCCTTTCTGCTCGCGACAACTTGACGTATAGGAGCGCTGACCTGTAAAATGTAAAAGACAGACTTAAAGACGCGCGTGGGTCTAAAATAGTTGAGTGTGACACGTATTTACAATTGACGCACGACGATTCGCTGTTACTTTCAGACAGCCTTGGTCGGTCGTAAAAAGGACGCTGACTAATTGTCGAAATGTTTGATAATAGTTCTCACTAAGTTCAATGCGCGGATACGTCTGACACGCGCGGCATATCAAGCACTATAGGGCAATGTGACATCGTCGCACCACACGTTACTCGATATGCAGATCCATCACTTCGACCCAATGGTCTGAATTGTGGTCACCTGTCGCGACGCTTCTAAAACGTGTTTCCTCGCGCCCCTAGATCAGGAAAGGACAGAGCGCCTGATAACAAGACTTAAATAACGCAGAGGTGCTCTACTACATTGTATACGCGCTATCTCGATGCCTCCGACTCTCATGTGGTTAAACGTCAAGCGGGGTAAGATCTAGAACGATAGGCCACTACAGCGGAGGATGTAGGGTCAAGTGCTAGGTGGTTACGCAAAACAAGAGCTTTTGTTTGCGACTTAAAGCCGTAGTGCTGTGTTGAATGAGCCGCTTATGGCCGAGGCGACGGCCGGTTAGCCAGCCGCCAGGCCAAAGTAGGACCATCGTTAAAAACCCGCGGGGCACTCGGACCTGGCATGATGGCTAGAGCGGGAAATTATGTCACTGCCCCTGTTGGACGCGCTGTAGCCACTTTGCTCGCTGCTATAACGCTGCTGTGAACGGTTCATGAGTGGTCAAAAGAGCGAGCAGGCTCAGAAACCGAGCGTCTATCACTTACGGACGCGAAATGCGCCTTTCTTGCTACGCCTAATTTAGCTACGACTGTTCGGCCTATGTGCCTGTTCGCGATACTTTCGTACCCGCTAATACCTCATCTGGTAAATAACGTTAATCCCATGAGTGGAAAATCGGCCAACTAAAACCTACAGCGTCGAACAGCCACTACAAACATCGATTACATTTGATAATCAAATAACTCTGTCAGCCGTAAGCACTTGGGTTAACATGTCCTGTTAGCGCGCTCCTAGGCGATAGGCAAACTGATTGTCCCAGTCCCTGAAAGGGCGGGACGGCAGCGCCAGGCGGACCTATGCCTATTTCCATCGTAGGCTAGATGTAACTTTGAAAAATCTGTTCGTCCTACTACAGCGTCCGCGGACGACTCCAGTGGATGAGCGGGTGAAAATGTATCGTGCTGAGGATCACGGCTAACAAAAGAGCGCTGTACAGTCCGCTAGAAAGTGCCTCTTAAAAGAGCGGCTATGGGTGCAGATAGACCCTGGTATCTAGATCACGTGATGAAATACCGCACGGGTCGCTGACATCGTACTTAATGGCACGAAGCAGACGCGGGCACGAGTGCTCGCGCTTATAGGCTCTAGCGATTTCTAGGCATATCTCAGCTCTCCATTCCGACCTCTTTTTAAAGAGACCTATAAATATTAAAGGACAGGGAGTGCAGGCGTCTGATATTTGAATATTTCCTGCCGCTTATTGTCGCTGGATCAGCCATAGCACCTAGTCACGCTGTTTACAGGCTGGCGATGCTATACGTGTAAAGGGTACGCGGGTCATACTTAGCCTATGATCATCTTTTGACTCAGTCGTGTTGTGCTCAGCCGAGGATATTAGGATTGTCCATGGTGTGAGCACAAACACGCGAGACGCGCCGTCAAATGGTGATTGTCCGAACATGTCTCGTTAAAGTTCTGTCTGATAGCCACTGTTTGTACGTAGCTGATTCTAACCTCAGCAGATGACTATTGACACGGCTGCTAGGGCAAACCAGTCACAGGCACGCAGCGTGAACTGACGTGAGCCTAACAGGCTTTGGTTCATGATTAGTTTTCGCAGACTCAATAACCGGATTGTAATCTGGCTGACGGTAAGACGTTGTTCTGCATGCCGCGACGCTACTCACCCTTGGCCCATCTCATGAGTGTTGACCTTGTAATGCAGGGCGCTCTAGTTTACGACCTTATATTAGCCTAGTAAAAATCCGTTGTTTATCCCGAACGCGCACGAGCTCATAGGGCTATTGTCGGTTACGTACATAGATGGGGATAGCGCTAAATTAGACTAATTAATATGCTTTT
>20
ATGGGTGTTAACCTGGCTGTATAGTCAACTAACGTCAATTCCGCGGTGACGATATTTTAGGCTTATCTACCAGTTCGACGACTCTTTAAAGTATCTTCAGGAATTATTTTATTGTCATATTGTATCATGCTAAATGGACAATTGCTTATGGAGTAATCTTTTATAATTTAAATAAGTTATTCTCCTGGCTTCATCAAAGTAAAGAGTCGAATGATGTTGGCGAAATCACATCGTCAGCATTGGAATGTTTATTTGGTCCCAAGAGAGTTACAGCAGTTATACAATTCTGCCATAGATTATAGCTAAGGCAAGTCGGCAATTCGTAATCGTTAGCGTATTAGCGACCCATTCTTTCTGATGTCGTCAATAATAGATGATCCAGTTAAATAATATGAAAGGTAATTTCTTTTGTGCAAGTCTGACGACTTTTATACCAATGTTTAACATACTTTCAGTTTGTAATAAACTCAATGTCATTTCTTCAATGATGTAAGATGAAATAAGAGTACTCATTTGCCTCGCTATACATTTCTAAATCGCCTTGTTTTCTATCGTATTGCGAGAAGTTCTTAGCCCAAACGCATTAATGATCACCTTTTCCATTTTCAATACGGTTGTATGTTATACCAATAAACCGTCATATCCTATAATCTGGTTTGTTTTTGAATAATAAATGTTACTGTTCCTTGCGTTGGAGGAATTGATTCAAATTCAAGCGAAATAATTTCAGGGTCAAACCTTATCAATGCAGCATTTGAGCAAGTGCGATAAAATCTTTAAAGTCTTCTTTCCGCATGGTTTTTAGTCATAAACTCTCCCATTTTGATAGGTTGCATGCTAGATGCTGATATATTTTAGAGGTGATAAAGTCGACTGCTGTGACTGTCAATGTAATACAAGTTGTTTGATCTTTGCAATGATTCTTATCAGAAACCAGAGAGGTAAATGGTAGATCTAGTTACACAGGAAATTTTAATATTATTACTTATCATGCTTATGTATTAAATTAGAGTTGTGAGTGTGGCTCTGCGCTAACACGTTGCTCATAGGAAGTACTGGTAGAGCCGCAGACACGTCGTATGCAGGAACGTCATGCGGGTGGCTGGCGACTTCCGATAGTGCGCGGGTGTTGAATGATTTCCAGTTGCCCGATTTTACAGCTTTTTGCATCGAGAATTTGTACCACGCTCACGAACCATCTATGACTGTACGCCAGATTTTGTCCCTAGGACTGCTATGTGCCGGACGACATTACAACGTCCTTCTCGGTGCATGCCACTGTTGCCAATGACCTGCCGGAATTGGTTGGCAAGTCTACCCGGATTTGTAAAACAGCCCTCCTCATAAAGGATATTCGTTCACTTCCGATAAGCGTCGTAATTTCTATCTTTCATCATATTCTAGATCCCTCTGAAAAATCTTCCGAGTTTGCTAGGCGGCACTGATACATAACTCTTTTCCAATAATTGGGGAAGTCATTCAAATCTATAATAGGTTTCAGATTTGCTTCCAATAAATTCTGACTGTAGCTGCTGAAACGTTGCGGTTTGACTATATTTCCTTATAACTTTTACGAAAGAGTTCTTCCGTGAGTAATCGACTTCACTCAAGTGCTTCCCTGCCTCCAAACGATACCTGTTAGCAATATTTAATAGCTTGATGAAGAATGATGAAGCTCTGTTGTCTTCCTGCCTCCAGTTCACGGGCGTAAGCAACATAAAACTGATAGCCCGGGGTTCCGGAAGTAGAAATTTGCATAGCCCATTGCTCACGAAAAATGTCCTTGTCGATATAGGGATGAATCGCTTGGTGTACCTCATCTAATGAAGAAACTTGACCTTTCTCCCATATTGCAGTCGCGGCATGATGGAATGGCAAATTAATAGGCATCACGAAATTCAGGATAATGTGATAGGAAGAAAATGATCTATTTTGTCTGTCCTATCACACAAAATGACATTTTCACCCTGATGAAGCCAAGCATGTCATCGTAATATGTTCTAGCGGGTTGTTTTTATCTCGGAGATTATTTCATAATAAAGCTTTTCTAATTTACCTTTGTCAGGTTACCAATACTAAGGTTGTAGGCTCTCAAGAGGGGTGTCCTGTCCTTGGGTAAATAAACTGACCTGTCGAGCTTAATATTCTATATTGTTGTTCTTTCTGCCCAAAAAGTGGGGAAGTGAGTAATGAAATTATTTCTAACATTTATCTGCATCATACCTTCCGAGCATTTATTAAGCATTTCGCTATAAGTTCTCGCTGGAAGAGGGTAGTTTTCATTGTACTTTACCTTCATCTCTGTTCATTATCGGATGCTTTTAAAACGGTTCGTACTTTACTAATCCTATCTGACCATGTATAATTTTACACGAATGGTTTCCATAAGAAAGCTCTGAATCAACGACTGCGATAATAATAGTGGTGGTATCCAGAATTTGTCACTTCACCAAAACAGCCCTCACGAGTTAAAACCCTAAGTTCTCACCGAATGTTCTCAATGATCGAGTACGATAATATTTATTGCTTCTCTTGACCCGTGAGACTTTCCACAGCATGCAACCATTTGAATGGGTAGCAGTGCAGTACTACTGGAATGAGTTGCAATTATTGCCCACCCATTGCGTGCATCGAGTAAGTGCTTAATGTTCTATCAAAATGAAGAGCAAAGGTGGATGCAGATGAACCTCTGGTTCATCGAACAAACTAATGACTTTCGCCAACGACATCTACTAATCTTGTGATTAAATAAAAACAATTGCATGTCCAGCTCATTCGAAGCATATTTCTGGATATTGTCACCAAAACAATTTAATGAATTTATCATCGTCCACTTGAATCTGTGGTTCATTACGTCTTAACTCTGCTCATTGTTAGAAATGAGGCTGATGGGCGTTCCCCATATTTGAAAGTTTTCATCACTACTTGTAGTTTGGTGATAGCTTCAAGCCAGTTGTCTTTCTATCTACCTCTCATACAACCAATAAATGCTGATGAAAGCCGAATTCTAATGGAGATCGCGCTGATTTTAAACTATTGCTGGCAGCATTCTTAAGTTGGCCAATATAAAGTATTGTGTACCTTGCTGGGTCATGTTCTGTTGCGCGAGGAGTAAAGGATCAAATGCACTAAACGAAACGAAACACTAAGCAATCG
>21
TTCGATGGACGGAGTCTATTAGATTCAACTAAGGCGGAAGCGTACGTCGACTTATTATTCGTCACGGCTGCCAACGATTGTAACATTGATCGTCCACAGAGACATCCAACTTCTAACATGCATTACGCAGGACATCTAGACCGACGAGATGGTACTATGCGGCAATGTTTTGGCCCGAATCGATTAAGGGATGGACCCAATTGTTCTTTACGTCGGTTCAATGAACGGTTTGATATTTAAACGATTCGCTACTGTACTTCGAATCTTTCTGTACAGTCCGGTCTCGTGTACAGCCAACTGTTAATTTGACTTTAGACGCGATCACAGCACCCATTTGTTACCGCATGAATAAGCTTAGATGGAGCTCGGTCGCCTGTTACGACTCCAACTCGACAGGGACCCGGGATGCCAACGCGATTGGAGCCAAGCCACCCATGAAACTCCACGCAAGCACTTAACAATAGGGAGATTTGAATGAGTAAGTGCCGTTAGAAGCTCTTCGATCGGGTCCCAAGAGGGGAAGGAATTTCTAACTTGGATTGTTGGTCAGTACGGACCGTCACAACGTCTAAATCGTTATAACTCGGATAGAAAGCCTGTTAACGGATATTCGCAAGCCAACGAGTTGGTAGCCACGTAAAGATCAAATGTTACACTTCAGCCGAGCCCGGTGTACGAGACCTGTTTGACACCTGACTAATGCGATCGAAGTACGGGTTCCGGATCCCGGAAGTTATTGCCAAGCGAATTTTCGATGAGTACATGACGATCGCTGTGATAACGGTTTGACTAATTAAATCGGCTTCGGCCATGCAAGCCCGCCAACTCGTCCGCCCTAATCGACTTTCCGTTGCCTTCGGGACGATTCTGAATAAATGCGATACGCAATTGGCGACGACAATAAATGTGTTAAATTTCTAAATTCTCCAAGCCTCGGCCCGCGGAATTCTCACGATTTCCACTAGTCGCCGCCGTGACTTGGCCGGGAACCGATGACTGCTCCCGAGCCAGCTAGTCTAGCTGCTCGGACTATCCTACATCCTCCGATTCACGGATTTCAAGTTGCCGCTTTGTTTCACTTTTTCTACAGGCTTCTGCAGTGGTCTTTAAGGGACGGAAGCCCATGCACTTAGGCTACTCGCTACTGCCGGCCTCGGTAATCTGCCCGCTGTGGCTCCGGGTTGGGTTGCACAGCCATGAAGCGATTAGATCGCATACGAGAGGACGGGAACCGGGCCCATCATTTCTGACTTCGTTTCTGGGATTGTTGGCGCGGAAGGACTTCAGATTGCCTAGATTTGGCTCGAAGGGTCGACTAAGTCGCAGCGACTCTCAGCCTTCTGATCGCACTCCATTGCTCGGTTTGCGTGACGTCGCATTTAACTCCGGGCAATCCCGTTGTGTATTGCTCGCGCCTGCAATCGATTGCCGGGCCAACCTGAATGATAGTGAAGGTAGCCTGCTCTCGACCGTCTATTTATTCCGATTGTTGCGAACTCCTTAAGGCTCTACTCGGAGCGTCGCGTTTCCTACTTGCCAGTCGACGAAGTGCGGGCTGACCCTAAAGAAGCAATCGGTAGGTTTGCCCGATGGTATAAAGACTGCGTTGATCTTGAGCGCTAGCCGACGAGAAGCTCAACGCGAGCAACATTTCATAGTCCCTGGACGGCCGTTGCAATTATTTGCCAAACGCACCCCGGGGACATCCTCGGGCAAGTGCCGTGTCACGGTGATTGCGCGTTTAACGATTCAGTTCAACTCCCGTTGTCACAGCCAGATTGACATCGATTTATCGACGGTAACCCTTATACGCCTACACCCCTGACGCCGGCAGCCGGCCTGCATGGGCAAGGCGAGCCTGATCGCATGACCTGCTCGGACTCGGATCTACTTAGTTCCGCCTTCTTTGTGGATTCCGATCGCTAATTCTAAGCTGCTCCAAGCCCGGTACCCACGGCCAGACGCGACGGCGATGCAGCTCGCGACTGTGCTGCAACGGTTGGGTTCGTACTTTAGATCGCCTGGCCGGAATCGGATCGACAACAGCATACGGGCATCCTGCAATCAAGCGTCCTGACTTTCCACAGAAACTGTTCAACGTAAAGCACGCTCATAGTCAACGGTGAAACCAAAGCCAACGGAAGAGACGACCACGTCCAAGGTTTGGGTTTGAATTCATTTACGATGCCCATTTGAAGAGGTGGAAGCTGCAGTACGGACGCTAGATCCCGTCATAAACGACCTTTTGACTGTTCTGACGTTGCTTTAACTAAGTTTTAACAGGCCAGCAGATATACCAAGAATAGTCATTTGACGTACGTGACATTTCGCTGTTAACTAAGCGTCTAGACGAAGCGTTGATAAGGCAATCAATCGATCAAACCCCATTACCGATAACGCTCGTTGAGCGAAGGTTAAACGGGTCATGAACGATCCAGGTCCCCGAATGAACGGCTGACGACGCAACTCCCACGCCGCTTTTAAGTCGAAGAATGCAAACGATGTTTTGACGAAGCCCCAATCTGGTCGCCCCAAGGGTAGCCCGGTTAAATGACGAGAAGTCCACGAAGATCAAATCGTCCTTTACAGAATGGCGAGCCGGCAGGTCATGTTTCTCCATGTCAGTACCCCGAAGGCCAGGGATTTGGACGGCCTTTAGATCGTAAGAGACCCATTGAACATTGGACTACAGACGGATCCAGCAGCCATCATGTTAGATCGAGGTTGTTTATTATACGCGGATACTTAAGTCAAGCATAGACGACGAAGATTGTTAATCCCAAACGGTGAAGTTCACGCAAATCCTGTGGCTCCACAGCACAGTTCAATAACTATTATAAAACCATTCGATTGATAACGCCCCATAGTACCGCTCACGCTGATTTGGACTTGTCGTTGAAGGATACATAAGTGTGAAGCAACGCATTTACTGTACTGCACGTCCTTTAGGTCGTCACGCTGCTTCAGCTAAGTGGAAGCAAGAGCAACCCAACAGGCAACACAAATATTCAGAGATTACCAACCACAATGCTGTACCGATTTACAAACTAATCACGCGAAACCGTTGCTAGATAGACACATAAACATTACTGCCGAACTGTTTCGAGTTGGAAGTTTGCAAACGGATATACTGCCTGCAGTGGTTCGAATTCAGACATCGTCAGGGACTCACGACGAGAATCGGGCTAAGCTTCATCGAAACACAGGTAACGGTAAAGAATGCTGACACATGAACGTTTAAGTCAAGGTTACCCGATTTTACGTCAATAAGTTGAACGAACTGACCCTGCCGGGTTACTGTTACATCGTGAGTGAACATAGTTGACCCCATTCAGGTGGTCCGATTGACCTCCTTCCGTTGTGAAGTTACAGACGAAAGGACATGACGCACAGTGACCACGTGGATTGACGAACGATTCGGACATGTCAGCGGTTAGCAAGGACGTCCCACGATATTAATCGTGGGATACGTATTCGAAACTAACAGACTACGTTGTGAACTTCCCGCCAAACGTCCACGCTAACTCCATACGCCGGACTTTTCTGAACGGGTACTAACGACGGACTTGACGCTGGCGATCTCTGTAAATGTTACACGAAGCAGTTACTCCAGCGACGCCAAAGGCGAGACTAATGCCGCATAGAGTGTTACAGGAAGCCATTCCGTAACCTTTACAAACCAAATATTTCCTTTTCAACAACGTTGTAGATCTGTTCACGAAGCCCGTTGTTAAGAGTCGATCCCAATAGTTGAAGCCACGTTGTTGGTTAACCCAAACGATCCGTTATCCCCGATGCAGACGGAGTCAGAACGGTTAATCGTCGTTGTAAGCCGCATCACGCACCAGAACGATACCAGCCGTCAACGGAGACGAATCGAGAAACACAATTACCTCCATTATCCGTACATCACGTTGTATGAATGGATCGCGTCATAGCGTTTCCGATCTCATTGAACGGTTAACAGTGGACGATTATTACATGTTAGAACGTCCCCAGCCAACCACCGTATCGATATACGTCTTTGGCATATCGCTACTGTTAATAACGTGACCATCTGGCCGACCTGAGTAATTTGCCCCACGGTTGATTCTTTCACGATCCCGTTTGTACCGTGATTTGGTTCTAAGTTCCGACGATTAACGGTGGACTCCTATCATACGTCCAATAATGGTCGTCGACGATAATCGAACGATGCAAGACGAACACCACTTTTATCTTTACGCGTCAATCGACTGACGAAGTCAACCTTTGGCGACGGTTTAACGAGAGTTCATGTTGGACTTACGCGACGAAATCAGAAGCACAAGTTAGAACAGTACTTAACGTTTCCGCTGAACCTAGATAGATCAACGGTTAACATGGTCCGTGGCTATATAATTCCCAAGGAAGTGATCAATTCGAAGGTCAACGTCTCTGCCAACGGATCCTGCGGATCGCCCCCGACTAGCAAGTCTTTGTTTCGAATGCGCCGGGTATCCCGATTTGTCATCGATCCTTTATTGACGCATCGTGAAGGGTTCCCGCCAACGCCCGGATATTTCCTGGCTCCTTGCATGTGATGCAGCCATTTTCTGACTAGCATGACTTTCCTCCATCTCACGCCCAACCGTAAAGCGGACGGTCTCTTATCCTACATCGCGTGCTTTCCACCGTTGCTGACGTAGGTATTTTCTGTAATGCTCCGCAGCTCGCATTTGAGTCCGTGCCTTCTTTATAATTTCTATTGGTTCAACGAGCGGGTCTCCGAAGTTTACTGATCGAGTTCGAACGGACCTCACCTTCTGCACTTTCGCATGTTCAAATTTCTGTTCTGACTGCTTATCTAGATGTAAGCTTCGCACAGAGCTGCTAGATGAGTCGACTTCTGGTGATTCAAGATTCCTGTCTCTACTGCTTCCTTACCGCAATCGATGCGTCAGGCGAACGCCAGACCCGTTTCCGTTTGATTCGACGCCCGCGGTCGGTTGGCTCTGTGCGTTCCTTAGATCGACCGAATCCATTATGAATCGTCGAAGGGTTGTGTTTAAGTAAATTGTCCCTCGAGTCGCGCTCGAGACTTCTAGTTTAGAAACTTAGATCCTAGTCGCACGTCTCTTTCTGATGCAGGCGTTAAGGGTTGGGGGTTTGATCCGATCTGACTTAGGGCGTTGCCACGCGATTTTCCGAATGTTTAGATTTGGTCTGTTTTAACGGATTCGTCGTTCTTCTCATGTAAATCGTCCTCGGTTTGGATTTATTCTTTCCGCTGCCTATCTTGGTTTGCTTCGACTGGCGGACGCGCCACTGATTAGAATGTTCCGAAGGGCGGGACCATTCCGATCGGCACATTCCCGTTTTGTACTCATGGTTTGACGCTGATTTACGCTCCTGTCTTTTTAACGTGCCTCCGACATTTTCAGGTACGGCTGAGTCCGGACGGAATGCTCGCCGTGAGCATCTTCCGGACATGCCAGCGATCGTCGTACGCGTTACGGATTGAGCTCGACGGTTTCTGTTCCTGACTTCAGGTTCTTCATCTGCTCCTCGTCCAAATGCTTGGTACTCTACCTGACATCGTATTTCGTTCTACTGATACTAGCTGGGTGGCATGAGGCACGACTTCTTTACAGCATCCCCGGCTCCGTGTAGTTGAAGGGTTTCGGTTCGCTTCGTCCCATTGACATTGGACTTTATTTTAACTGCGTTTCTACGTTGGCAATCTATTTGCGGATTCGCATTAACTTGCTTAACGTCGTCTAATGTTACCGTTAGCCTTTCCTGCCGTGATGCACCGGATTTCTTCCGTTCTACACGAGGCGCGATCATCGATTCCGTAAAGGGTCTCTTCATTCGAAGCATTTGCTTCCTGTTACGCTTCGCCATCGCACTAGGACGCGCTCCCCCAGGACCCTGCACTTCCCTCAGAATGCGCGATTAGTCGCTAGCTGCCTCCAACTATTCCATGACTCCGACCGCTGACTGGATCTGTTCGGGTCGCGGTGCCTCCGCAGGGCGTACTGAATCGATTTTCTACGCTCCATTCCCATCCGTTTCAGCGCCTGTCGGTTCCTCGCTGTATAAGCGTACCGTCTCGTTTTCTTATCGAATGTCCACGTCACCCGGCCCGTGAATTAATACCCTGCGCTCTAAATGCGATCCTGACCCTGTTTGCGACCCATTCGAGTTTTGCGTTGGTATTTTGATGCAGACTGCGATCCCCAAGTTTAAATTATTTGCGGAGTGGCATCGAATTGCGTCACATGCGAGGGGATATTCCTTTCTAGTCTGGCCGTCAGGCCAACTCTGTCCGGGGTCCTCCGTCGCTCATTCACTCGTTTAGACACTCTGCAATCCGTGATCATTCACGACGAGATGGTTACAATTATTCTCAGGCAGTAGGGATTCCGTAATGGTCCGTGAACGCGCCCCTATCTGGGGTTGCCAATTTTATTTGATCCGACCCTAACCGTCAAAGCGGGACGCATTCACGTCCAAGTACCTTTCTTTAGCACCCGTACTCGAGTTGGCATTCCCACCCCAATCTATCGAGGCGTAGATCACGCCGTATTGGGTTGGGACGCTCCGAGAACTTCACGGACTGTCCTATCTAGACCCCAACTTTAATCCTGTTCCCGCTCGTATCCCTGAAATGGTACTGCATTTGTTACCTTACGGATTCTCCATTTGCTCTCGATTGCTCGCAGAGCGGATATGCGGTACGTCCTGCACGCATGAGCGCTTCCCTGCAACGCTGTCTCTAGAAACCGTCCGCTCCGAACGGGACAGTTCTCGCATTTGAATCGTTAACCCTGACCCCTGGTTGGCTTGCTCCAACATGATCTCATAGCCAACTATACGCGATATTCCGCGCATTAATCGTGTAAATCTAAAGCCAAGACCCGTCTAGACCGGGACGTACGAGACATAAACCTTGACGGTTAATCGTGCACTTAGATCGTACGTAGCCGCACTTCCCACTCGTCCGGCCAATGCGACCTGCGACTTCGACCTGTAGCACCGTGCCCGGATCGCCGACTTCCTGTTTGGTCTAAACCCGTCGTGCACTGAGCGGCGAATCGTGTAGCCGCGGTAGTTTGGTTGATGGAGTCCTGTACGTGCGTGAGACCGTTTAGTATGTGGTAAGAGAATGCTCGCATTTCTAAATTAATTTCTACTTTAACGCCAAAGCCACGCTCCGAACCGGGACGGTGATCCTCGATAGGTTAGGTTGGGTTGGCCGACCTAGACCCGTTTCATGGATAAACTGGCATCGGTCTAATGGCGAGTCGTCAACTTTTAATTTCACGTTCGTCTCGGCCAATATGCGGTAGCGCGTCCCCGCACTCTTAACCTTCGACCCGATAATGTCCACATTGCCGTCGGCCCAACCGTGCTTAAACTTGCTTCCAACTGTTAGGGATGATTTCGCAGCACGAAGCCAAAGTACTGCTCCGTCCCGACATGGCGCTCGGGTGCTATTTGCCACGTCCTACGGCTTGCTCGTTCGTAAAGTCCCAATGACAGTTGACTTTTGCGAATGTCAACGCCAGCCTGTTCCCATTGGTTCTTGAAGCAATTAGCCGCTGACGGAATTGTGTTTTACTAATAA
>22
GCCTTAATCTCATCGCACTTGATTCCCAACTGCTGCACTTGATACAAGGATTTTGACTCTGAATTATTTCGGACTTGAATTTGGATCAATTCCTCCTAAACGCAAGAACCTAATAACAGTTTTATTGTGTATCCTTCAAAAACAAACCATAATAGGATGGACCTTCGTAGACAATCAATTCACTTGAAAAATCGAAAAACTGATTCGTACAGTTCAATGGCTTGGGCTAAAATTCTCGCAATACGATAGAAAAACAAGGCGATTTGTAGAATCGTATAGCGAGGCAAACAGGCTACTCTTATTTCATCTTACATTGAAGAAATGACATTATCATTGAGTTTAGTCAAATGAAAGTATGTTAAACATTGGTAAAAGTTAGTCAGACTTGCACAAAAGAAATTACCTGTCATATTTAACTGAATCATCTATTATTAAATCAGAAAGACGATGGGTCGCTAATACGCTAAAAGATTACGAATTATTACATGCCTTTAGCTACTAATCTATGGCAGAAGGGAGTAACTGCTGTAACTCTTGGCATACAAATAAACAATCCAATGGGTGACGGATGGCATTTCGCCAACATCATTTCGACTCTTTATTTGATGAAGCCAGGAGGAATAATGTACTTTAAATTAAAAGATTACTCCATAAGCAAATTGTCATTTAGCATGATACAATATGACAATAAGAATAATTCCTGAAGATATTAAAGAGCGTCTAAACTGGTAAGCCTAAAATATCACTTCGGACAGAAGAGTTAGTTGACTATACAGCCAAGCTTGCAGAAACGACTTTTTAAAGGACGGTTATCACATTCAAACATTAATTTATGATAACAATTCCATCCAATTGATTTAATCAATACAACATTTGAAGATCAAGCAGATAAACTACTTTTTGGCGTTATGCAGCTGACAGAGCCAAAATAACAAATGCCTATGGCTTCATTTTCGATCAGAGCTGGCTGACAGAAAGCAAGCATCTACTCAATAAACCAATACATACAATGCCAATTATAGATGAAAGACTTCAGGTAATTGGAATTGATTCAAATAATAATCAAAATGTATTTCATGGAAAATAGTTAGAGAAAACGAAGAGACAAACCGACTTTAGAAATATCAACAGCAGACTCAAACATGACGAAAAACCATATTTCATGCGTTCAGTCTTAAAAGGCCGCAATTGGCGGTGATGTAAACACATGAACAATTGAGTCATAGAACTTCCATTATTCTCCTGAAGATAATAATCGCCAAATAAACCAATACTCAGCTTTACAATATATCAACTAACCGCAGGACCGTTATTTCATACAACGTTTCTGCGGCATCAAGAAAGGCCCGATTACTCCATAACAGCGGACATCCAAGGCCACTCAATATCAGGTGCAGTTTACTGTATCAACACGACGGTTCAGCAACACCCGATACTTCTTCCAGGCTTCCAGCAACGGAGGTTTCTTCCTTCGTTGCAATTTCCCAATCTGCATCACATCCTGAAGCCGGCACCATATGCTCACTGGCTACCTGCATCAGGCTTTTGTTTCCTTCTTCCCCCTCCCGGATTAGAACAGTTTTTCTGCTTCCGTATCCTTCACCCAGGCTGTGCCGTTCCACTTCTGATATTCCCTCCCGGCGATAACCAGGTAAAATTTTCCCTGTAACGGACCGAGTTCAGAAAATAAATACGGACGCGTGCCCGCGAAGCCAATCACGACGGTTTTTACCCCGATGGTCTTCAACGAGATGCCACGATGCCTCATCACTGTTGAAACAGCCACAAAGCCAGCCGAATATCTGGCGGTGCAATATCGGTACTGTTGCAGGCAGACCGGTATGAGGCGAATATGCGTCATTCACCAATAAATTCATTAGTTTAAGCCAGCAGATTATAAATTTTATGGCTTTAGGTGGTTGTTCACTCATTCTGAATGCCATTATGCAAGCCTCACAATAGTTAAATGCAATGTTTGACGGTTTTATTCCGCGTTACCTCACGGGGTTAAACGGTGATGGTGTGTCCGTGTGAACCATCAACTGAAGAATCGGCATGAGCACAAGCGATAACAAATGGATGCTCGTATCCCACGTAATACCAACTGCTGCGCATGTGCAGCGGCACTCAACGGCTGTACCGGACAATGAGTGACTGTGGCTGCCCTGACTGTCCGTTTTCGATATTTAATCAATGAAGTACCTTTGTGCTGGTTCCTTTAACTGTGGATAACTTCCTGTAATGGTTGCTGTTCCATACTGACTCCAGCCAGAACTGTTCATCCTTAACTTAAGCCTGTGTAATCGAACGCCCCGCGGCCCCTGTTGAACCGCTCAGACTGTGAGCACTGAGCCCCCGTGTTGTTATTCGTCGATTTGGTGCGTAATCGAAACTGCCTGTTGTTCGTTATCCGTAATCAAACGACGATGGTTTTCGTCCCCAAATCGATCCATTGCACTGGCACTGTGGGTGTGCGACTTAATTCCATCCTGTTCCTGAGACAATACAGCACGACGCCGCTGGCGGGTTTCCCCTTGATTGTCCAGCCTCACGCATATCGAAGGAAGACCCACCCATCGAATACGCGACAGCAAGAAGTTTTGGGTGAGCGGGACGATTTGTTAAAAGCCCTGCCCCTGCATCAGGACGTAGCCAGACGGAACGATATGATGGCCACGGGATTCTCAACGCGCACCTGCCGGAAAGGCCGAATTCTCACCGGCCCAAGGTTTCAAGAAAGACATCTGCAACGGAATTTTGCCACGAATATCCCTGCCAACCGGCGTACTTCAGTCAGGCTGGCGGCGGAATCGATGTCCTCCGCAAAATACGGTAATTTATTTTCGCCGTGCGCAAACCCTGCCAGCGTCGGAGTGTCGCATTCTTCGGTTGTTGACGCCGCAAGCGCGTTAGTCATGGTGTAGCAAATCTGGATTACCCATTCCCGAGCTAGCTGCGGCCCATTTCATTCAGTGGTTCCAGTGCGTCAGGTGACGCGTCGATAACATCTGCAATCGCGCTCAGTCAAAAGCGGTGTTCGCAATCTGGGTATTTTGTTCCCTGAGCGCGGTTGGTGCTGTTGGCGGCGTTCCATTCAATCGACTGTCCAGTGGGCTTTTCTGTTCGTTTCATCCATTACCACTTAACCGCCTTTGGCGTTGCAGCAAGCGTTTCAGACGTGCTGTTGGTTGCACTGCTGAGCTGCACTATCCCTTTCTCGTGTGTCCCATCCTCAAGCGCGACACTATGAAGCTAGTAGTCGTGCACGTTTTGCCGAATTTTGCACGTATATTGCCGCTTCTGCCGCACTTTTGCTCTGCGATGCTGATACCGCACTTCCCCGCAAGCCTGGCTTTGCCTTCGTGGATGCCGTTGACGCACTCCCGCCGCTGTTTTGCGTCTGCCGCGGCAGAGGCGTAGGGTTCCGCTGCTGTTTCAGATGACCTGGCGGCATTCGTCGGGACGTTTTGCTCGCTGGCGCAGAATTTTCTGCTAGTCCCCGCCGAAGCTGCACGACCGGCACTTGATGATGCGTTCGTTTCTATCATTTGCTGCCTCTTTGAGGCAGGGGACTCGTGCTGGATGAATGGCGTGGGTGACGCTTTCGTGGGATGTGGAGGCAGACGTGGCGGCTGATTGTTGTGACGCTGCAGCATTCGTTTCTGACGTTTTCACACGGCGGCACTGGCCGCCGCGTTTGCTGAGGACTCTGCGCGGCTGCGGCACTTTTCGGTTTCAGTGGCCTTTGCTGATGCCCATTCGTGCCTACGGAGGACGCTTCCTGAGCTGACGATGCAGCCTGTCCCTGAAGGCGTGCCTGGCGGCGCGTGCTGAGTCAGTCTCCAAGTCACAAAGCCGCGACCTGAGCAGCCTGATGCACTGTAATCGCCGGCGGGTTTTCTTCGCGTTTGCCGTACTCTGTGCCACCACGACGCGTTACGCGCCACCTTCCACCATCAGTTCGGACGACGCCGAATGACCCCTCCATCGGGCATCATCCTCGTTACGTGGCACAGAGAAAATCATTCAGCGTCCCCGGTTGTGAATCTTCATACACGTGATGGTCCCGGCGTGCGATGGTGGAAAACCGTCAACCTGCAGGATCGTATTGTAACCGTACTCCACATCCATGCTTGGTAACGCCCGGCTTCATCCGCATTCTCTGAGCCCACCGTGTTCACCACCACCGTGGTGCTGTTACGTCTGGCTTTCATAGTAGCTGAATGGTGCAGTTCTGTACCGGTTTTCCTGTGCCGTCTTTCAGAGGACTCCTAATGAAATCTTTACTGCCATATTCACCCCACAAAAGCCCACGGTTCCGGCGGGCTGGTTCAACACTGTGTGTTACCTGGCTAATCGAATTTATAAATGACCCAACGATGAATCCGTCAGTACGCGTCGCCACTGCCGGAGCCTTCAGTCATAAGCAATATCAACAACGACGGACGCTGCCGGATTAATCTGTATACCTGCACTCCACGCCACTCATATGCCGCATTGCACTTTCGTCCCTGGCAGTGGTCGTCTCTTCATATACCGGGGAGTGATTTCCGTACGGTAATCCATGCATTACATGCCAAATACGCGACTGTGAGCCACTCCGGCCGCTGGCGTACGCACTAATGACCTGCTTACTGATTTGTAAAAACCGGTCGGCCATCACGCTCAAGGACGTCCCGGACGCAGCCTGTGAAACGTATCCTCCCCGGTTCATATCACTGTGCTGCTCTTTTCGACGCGGATCCCAGTGGAAGCCATCGGCCCCCACGGTCCGTCAGCTCATAACGGTACTTCACGTTAATCCCTTTCAGATGACTCCACCGCGTATCCCGCCAGCGACACGACGCAATGTATAGGATGTTTCACTTGAAAATAGCCACCGTAAACGTACTCATGTCCCTTTCCACGGGCTCGAGTGACTGTCTGTCACCGCAAGTGCGGCAAAGACCCTAAAAGAAGCCGGCAATACACACATTACGCATCGTTCACTCACTGTTTTATAATAAACGCCGCGTTCCCGGACGACTCTGTAACACACGCAAGCCCTGATGCCCAGCGCCTGTTTCTTAATCAGAGTAACCTGCACATCGCTGGCAAACGTATACGGCGGAATATGCCGGAACTGCGTTGTGACGTAAGCGTGAACGTCAGGATCACGTTTCCCCGAACCCGCTGGCAGTTGTCAACAATACGGGGAACACCTGTACCGCCTCGTTTCACGCGCCATCATAAATCACGCACCCGTTCATCAGTACTTTCAGATAACACATCGAATACGTTGTCCTGCCTGACAGTACGGTGCTGATTCCTCCTCGAACGTCAGCGGAGAAGCATAAGTATGGCGATCAAAAGCATGTATTATACGGTCACGGTGACAGTGACTCCAGACCTGACGGCCGGTCCACACTGCTTTGGACGCTGGCCTAGAAAAGCCGCCTCGCCGCCTTTACAATGTCCCCGACGATTTTTCCGCCCTCAGAGCGTACCGTTTATCGTACAGTTTTCATAGGTATCGTCTACATTACTGAGCGTTGAGGGGTCGCATTCACACTGCACTGATATCTACCGCATTTTAGCGGTCATTTCCGTCCTGTTAAGGAAAACAGGCCGGAGGATTGCTGCACGCTGGTAATGGTGGGGCCGTTACGGCGCTTCAGGAAACACGTCGTTCATGAATATGGTGGCTCCGCGCCAAACATCGGCGTTTCATTCCCGTTTGCCGGGTCAATAAATGCGATACGATTGGCGGCAACCAGAAACTGGGCTCAGTTGCCTTCCTCCGTGTCCTCCATGCTGGCGCCATCACGGCGACATAATGTTGCCGTCTTTGGTCTGCTCAAGGCTTTTGACAGCCCACATTGGCATTCACTTATCGATCTGCATCCTTCTCACTCTTTCGAAAACTCCTCCAGTCTGCTGGCGTTATCCTCCGTCAGCTCGACTTTTCCAGCAGCTCCTTGCCGAGATGGGATTCGGTTATCTTGCCTTTGAAAAATCCAGGACTTCCGCCGAGGATCCATCGCATCGCCCGACCGACGGCCTCCACGAATGCCGATTTGCCAACGGTGTTCACACTGCGGATAACGACAGTAATAATCATGGCCCGGTTTGATATTACTGGCGGCTATCCAGTACAGCGCCGTACCAATAAGGGTAACGCGTGCCCTGGTTTCATTCAACCTGTCTGATATCCGCAATCTGCTTTTCCGAGACCAGAACTCAAACTCGTACCGTCGGGTCATAAACGCAGATGCGGCGTGGCGGTTATCTGAAATAGCCAACCGTCAGCTCAATCCTCGACGGTGCTCTGCCGGTGCGGCAGATCTGCGGAACGATACCGACGCCGCACTGCCCTGCTGCCCCACGCATTTACCGCCCGGACTGTCAGCCTGTAGTTCCCCAGCGCCAGTTGCGTGAATGCGGTATCGTATTCCGTCGGGCTGCCGTGCTGACTCAGCCGCTCACTGCCGTCGTCTTAGATAGGTCAACGGTTTAAGCTGAACTGGAAACGCCCTTCACCTTCGGTGTGTCTCCATGGCGCCAGCACCTGATATTCCCCGCTGTCTGCAGTGACTTCTGCGGTCAGGTGCTGCACCGCCGCGGGCGGCGTGACACCATTCAAGCGTCCACTCTGTTCGCCGTTCAAAGTGCGCCCCGTTATCCACGATGGCCTCTTTTCCGGCACATGCTGCACGGCGGTGATGATGGCATACGTGCCGTCGTCGTTCGACGGTACTCACGCAGCGAACAGTCGCTGGCGCAGCGTCGGCAGCTTCAGCTCCCATACGCTGTATTCAGCATAACACCGTCAGGAACACGGACTCATTTTACCTTCACGCCGTCGGTGACGGACTGAACCTCCACGTAACGGATTGCCACTTCCGTCAACCGAGAGGCTTATCGGGGGCGGTACCGGAGGATGGCAGCGTGATTTCACCCCGCTGAACGGTCGAGCGTCATAGGCGTCGGGTCTCTAATGTTCACCGCCAGCAGCACACGAACCACCGGTGCTGATACCGGCATAGTCATCGAACACAGATTTCAATAACAACATCGCCCGGTACATGGCACTCGCTTTACTGCTCAACGCCGCTGGCTGAAATCCACGGTCTGCGTTTCCAGCAGTTCTGTTTAATCAGCCACAGCCCGCTCCCGCGGTGTGCGCCTGCCCCCGGCTGGTACAGCCAAAGGGCATCCATCTTCGTAACATTACGACCGTAACGGGCAATGGCCTGCGTATGGTCAACAGCTCTGTCGCCGTCTCCCAGCCGTTGTTCGGGTCACGTGGAGTTCACCTCAACGCATTATGGCGTTTTTCAGGGCGCTGAAGCGTTAGCGGAACGGCGCGCCATCGTATAGCGGCATCACCACATTACTGCGGTTATAGTCACGTCTTATCCGACGGTCGGTCCTGCACGAACGTCAGTCAGTGCCGCCCGTTCCATACGATGGCATACAGCGCATCGCCGAGCACGAAATCGCTGAGCACATCCACGCCTTAACTCGTGGTCCGTACGCATTACAGGTGATGCGCGCTGATCCAGTCCGCCAAAGCGTCCGGCACGTAACGGTCTCACAGTACTGGCCGATGACATACAGCGCCCATTTATCTTACCACATCCAGCGCACTAAGACGTTTCCCCATTCAGCGGGCTGGATGGGTCAGTGGCATATCCCACAGACACAGGCCATGTTGTTGCTGTATGCCGGTTTAAACGTTCCGTCCCAGATACCGCCTGTATGTCCCCGTCTGCGGGTTAGCGTTGAAGCACCTGCAGAAACGCCCGCTCACGAGATACTGACTATTACAGCTTGCTGGCTGCCGAACTGCTGCTCCAGTCCACCTGCGACGCCGACCAGTGCCGGTGTTCGGGTAGCACTGTTTCACATCGATGATTTCAGTGTATGACGACCATCGTTTTGTTCTGCATAAGCTGGTCCGTGGTGCTTCAGGCGTCATCCTTAGGATGGTTTGAAACTCTGCTTAGGGGGCGGCAGGTTACCAGAGGATACACCACCGAGGCCAGATACTGCGAGGTGGTTTGCCCTTAATGGTGATGTCTTTCCTATACCCAGCCACGTTACGTAGTTTGTATCTGAACCAGCAGGCGGACTTCCGACGGATTCCTGTCACTTTGAGGTGGTTTCCACCAGTGCCTGTACAGCGAAAGGTAAAGGGGACGGTCGATGTTTGCACTTCGTAATGGTGCGGAGGTAATCGCGTGTCATATTTCACTTCCGTACCCAGCACCGTCTCCATCGGAGGATCCCAAATCCCTCCGGCCAGTGCTCCGCTCACAGCCAGGGAACACACCGTGACACATGGTTTATGGTATTCCCCTGAGTGTCCAGCACCGGCGTACTGTTCAGCAGCACGCTGTTTAAGCCATCAAGCATCTCTTCAATCGTAGTCGCTGATGGCATCGATCACACTCAGCAACTGCGTGGACTTCAGGTTGTCCTTCGCTTCGCGCGGGGTATGCCGGTACTGCTTCCTTTACCCATTCCTCACGCTCCATAAATGACAAAACCGCAGCAGGCGGTTTCCACATAAACATTTTGCATCAGCGACCAATCACCACGTAACATACCGTTTGGTCTCGTCTGCCGTGCTGATCTCCTGGAAACCGCGTGATACGCGCGCATTTCGAATTGCCAAGAACAGGCAGAACATTGCTGGGCAACCATGTTATCCAGTGAGGAGAACAGGGCGTAGTTCTTAGTTACCGTTATCCAGTTTATACGGAATTCGTCATGGGCTTTCGGTGCGCCAGCATCTGCCACACCACCGAGCACCATACTGGCACCGAGAGAAAGCCAGGATGCCGGTCATACCACCGGCCCCAATCGCTGCCCCCATGCTGCAAGCGCTGAGCCGGCGGTAAAGAATGATCCGGCAATGGCGGCAGCCCCAGGACAATCTGAATACGCCACCTGACTTAGCCCCGGCGACTCTGGGAACAATATGAATTACAGCGCCTGCCAGGCAGAGTCTCATGTGACTGCGCCGTTATGATCGAGACGTGCCTGACGTCCCGCCGCGGCAATCCGTACCTGATACCAGCCGTCGCTCAGTTTCGAAACTAAACGAGCCTGTGATGCGCCAGTGCCCGCACTGGCTTCAGCCCCCGTTTCACACGAAGGTCGGTTCCGGCGACCAAATCGTTGTAATCCCCGTCAAAGGCACTGCGCGCCATGCCCGTGACTCCAGAGGGAGTGTGCGTCGCTGCCATTTGTCGGCTTATCCTCTCCGTTTGCTCAGTTGTTCAGGAAACTGGTGCCGGCAGCATCGCCCGTCGCCGCAGTAATTGCGGCGTACCGTGCGGCACTGATGAACCAAAACGAGGCACATGAAGCACATGCCCGGCCTGTGCTCGTCGACAACGATACATCACCTGGATACGCGTCGCCTCCAGATTATCCAGATAGAGATTCTGTCCGTTACGCTAAGTCATCCTCACATCGAAAGTCCGGCATCTCAATTCCCGCCCATCTACACGCATCCCGGAACAGTGTGTAACAGTCCGTCACACCGTGCTCGACGCACGCCGGTGAGATGCGGCACAGCGAACTTATGAATCGTCCCCCACGTT
>23
GTTGGGTGTTGTAAGCTAGAGGAGGCAGCTGAAGCATGCATTAGTCGCGACTTCCCCTCCATCAAGCTTTAATGAACCGCTGATGCTTGAACGCTATGCACGGGTATTCTTTGTGCTTGCACTCATGATGTGGGATCAGCAACGGTAGGACGGCGATGCGGTGTCCGGCGACAGCCTGACTGTTGGCCCAGGAGCGACGAGCTGGCATTATCCGGTATGATGACGTAGACCACGACAGCCGGCAGTTAAGGTCATGAACGGCATCGCCGTGCTGCCCGGTGTCCGGCACGCTGGTCAGCCGGACGCGGGCGCTGCAGCCGTACTCGGGGAGTGACATGGTTACAACGGCATTATCGCGCCGTCTGCAACAGGCTGCCAGCGATCCATCTTGACGGCATTGCTCGATATGGACACGCCGGCGGATGGCGGGGGCATTTGACTGCGCTGACATCATCGCCGTGTGCGTCACTAAAACGCGGTATGGGCGCTTGCCAACGACATGAACTGCAGTGCAGGTCAGTTGCTTGCCAGTCCGCCTCCGAGCCCACGTCTGTTCCAAGACCGCCGGGACAGGGCCTCCATCGGCGTCATGATGAGCCACAGTAATTACGGTGCTGCGCTGGAGAACATGTGGAGGAAATGAACCATTTACAGCGTGAAGCAGGCCATATAAGTGATGGCATCCCTACAGCCATCCGGATGACGTCCGGGAGACACTGCAGTCTTAGATGACTCGCATCCGCCAGATGTTGCAGCAGAACAACGTCGGCATATACCCGGCCTGTCCGCGTGCAGGTTGCTGGATACCGAGCGCAGGATCAGTGAGTGGCTAGGTCAGGCAGCATGCCGACTGGCTGATGAACTTGTTAACAGCACCGATGCGATCACCCGTCATGCGTGACTGCACTGGATGCACGTAAATCCGCGTCTCTCAGGAGCGAATGACCAAAGAGACTCAATCAACAACTGTTTCAGCCACTGCTTCGCAGGCTCAACCTTTACTGATCTGCCCCTCGACGGAGGCGAAGCCAGCGCGGCAAGCCGGACGTGACCCGCAGATCACCGCAGCGGTTGCGTACAGAAATACAGCGCATTATGGGAATCCTCAACTGTGAGGGAGGCTCACGACGCGAAGACAGGCACGCGCGTTAGCTGGCAGAAACCCCGGTATGACCGTGAAAACGCCGCCGCATCTAATTCTCTCCCGCAGGCCACCACAGAGTGCACAGGCGCAGCCGGCGACACGCGAGGCTGGATGTTCGATGCAGGGAAGGGCACGCTGGCTGCAGGTAAACCCGGCATCTGTTATCCGTTAACGATTTGCTGAACACACCAGTGTAAGGGATGTTATGACGAGCAAAGAAACCTTGCCCAGTACCAGCCGCAGGGCAACAGTACCGGCTCAGACCGGCGCAACCGCCTCCGCCGGCGGATCGATCTCAGCACGCCTGCATGACCCCGGTACTGCTGGACCTCCAGCCCGGCAGCTGGTTGCGTGGATGGCACCACCGACGGTGCCTGCCGGTTGGCATTCCTGTGCGCGTCATGCTGACCCAGACCAGCACCACGCTGACGTTCTACAAGTCCGGCACGTTCTAGTCTGAGACGCATGTGCTCTGGCCGGAGGCTGCCAGCGACGAGACGAGAAAACGGACCGCGTTTGCTGAACGGCATCAGCATCGTTTAACTTTACCCTTCATATCTAAAAAGGCCGCCTGTGCGGCTTTTACGGGATTTTATGTCCGTGTACACAACCGCCCAACTAACTCAGGGCAAATGAGCAGAAATTAAGTTTGATCCGCTGTTTCTGCGTCTCTTTTCCGTGAGAGCTATCCTTCACCACCGAGAAAGTCTATCGCACAAATTCCGGGACTGGTAAACCGCTGGCCTGTACGTTTCGCCGATGTTTCCGTGAGGTTATCCGTTCCCGTGGCGGCTCCTACCCTGAATATTTACGCCGGGGTATTTATAAGCCGAAGCATGAAGTGAATCGCAATACTAATGCGTGCCTGCCGGATGAAGATCGCAGAATCTGACGATAGCGGCTTACCGCCGCCGTCGCATCATCATGCAGATAAATGCGTGACTGAAGACCATGCTGTATCATCAGGTCTGAAGAGATGCAGGCAGTTTCTGATGCCGTGCTTAAGGGCAAATACACCATGACCGTCCAACGCCTTCGATCCGGTTAGGTAGAATATGGGCCGCAGTGAGGAGAATAACATCACGCAGTCCTGAGCACGAGTGTGAGCACCGTGACAAGTCACGTATGACCCCGACCGACGATATCGAGACGGACGCGCTGAACTCCATGTGTGACATATCATCGTGTTCGATCGAAAGGCTGGCGCTGTTCCGTTCCTTCAAGCCGTCAATAGAAGCTGGATATCCGTCTTGGCTCTAATTCCGAGCTGGAGACAGCGGTAAAGACCTGGCAAAGCGGTGTCTATAAAGGGGGAGGTATCTGGCGATGTGGCCATCGTCGTGTATTCTGAGGACCGTATAATTAGGAAAGCGTTAAAGAATTTCCTGCCGGACAACAAGCCATCTGCTTGGGGAACACGCCGAACCTGTCTGCGCTACATGAGCTGCATTCAGGATGCCGACGCACAGGCGCGAAGGGCATTAACGCCTCTGCCCGTTACCCGAAAAACTGGGTGACCACCGGCGATCCACCCCGTGAGTTCACCATTGATTCAGTCAGCCACCCTACAATGCTGCTGGCTGTATCGGTGATGAGAGTTCGTGTCGGTACAACTGGCGTAATCATGGCCCTTCGGGGCCATTGTTTCTCTGTCGAGGAGTCGGTTGACGAAAGATGACTGATTGCCGTCTCCGCTCACTGATAGACACTGAACCCGTGATGTCAGCCTCGACCGACGGGGACGAAGAGAAGAACTGGCACTCGTGTGGCATAGCTGAAAGAGGAGCTTGATGACACGGATGAAACTGCCGGTGATAGACAGCCTCTCAGCCGGGAAAATGTGCTGTAGGACATGGACATGAAATGAGGTGGGATGCTAGGACGAGGGATACCGTACTTCTGGATACGTCTGAACTGGTCACGGTCCTTGGCACTGTGAAGCTGCATACTGATGCACTTCACGCCACGCTCATGACCGTGGCATTTGTGCTGCCGGGAGACGCGTTCCGTGTCTCTGCCGTGTGGGCAGCCGAAATGACAGGGCGGCCTGGCCCCAGAACTGCAATAACGGGGACAGTGCTGATTTCGATACCTGTTCGATGCTGCTGCCATTGCCCGCCGATGAAACGATACGCTCGGTACATGGGGAACGTCAGCCACCATTACATCCATGAGCAGTCAGGGCTTAGTGATACGTGGTGTTTTGATGACCCTGGACAGCTATGCCGGACAAGGCGTGCGTTGAAGGCTCCAGCCCGTCCCTGTTGTCCGGACTGATGCGGTGCGGCAGCTTGCGGCGTGGAGACACGGACCATCGGTGAGGAAAATTTCTGGGTACGGGTTTCGCCGGATGATGAGGAAGGTCTTGCTCCTCTCTTCGAAATCCTCGCGTACCGCCTGCCGTTAGCCGTGCTGAAGGGGACCAAGTGTATCATAAAAGTCTTGAGCAGGCCGTTGAAAACCTCAGCCGTATCAGCAAAACGGCGGTGCCTGATCGCCCGCGAGCAATGGGCCATTAACCGCGTTGCTTCACATCCACGCGATATTGGCAGTCGGCGTCACAGGTTGCCCGTGAGACAAAGTACGCCGAACTGGTAAAGGAGGAAGGGCCATGAATAAGGCCCCTTCAAATCCGCAGCCAGAATCAAAGTTAACCGGGGGATTGCCCGTAATCAAGCTGGTAATGCGCGGGTTGTCCTTTCGCAAGCATTTAGTAAAGGGGCAGCGTTCATCCTGAAGGGCGGCAAGCGTGCGTGGTACTCGTCGTATTCCCGGCCGTTTATTCAGCAACGAAAATGTACCACTTGGATTTACTGCAGCGTGGCTGGGGAAAACGTCCCCATTACTGCTCAATCCGCGTTCTCTCCAATCGACCACGGCGTTTAAACAAAAGCTATTGATGGATACCGTGAACGTCTTCCGAAGAGCTGGCTATGCGCTGCAGCATCAACTGGCCGGTAATAAAGCGATGAAACATACTGAACTCCGTGCAGCCTAATCTACCGCAATGCTATGAAGCATGACACCGGGGCGACGTTTTTGATGACGGTCGCCCTACGGAGTTTTGATGGAGGCGGATTTCCGAATATCGAGGTCTCACCGAGGAAGAGACTCGAAGGCAGCTGGACCGAGTACCTGGCAGGCCTACTGCATATCGAAGTTTTCCTGCCTTATGAGTGTGACGGATTTTCAGAGCTCGTGATGCGTCGATGGAGTCCCGGATTTATCCGGTATGAGCGATATCCCGGCACTATGGTCAGATTTGATCAGTATGGTGGCCACGAGCGACTCACCGGCGCTACGATGATTGCGGGCTTGTGGAGTTCAGCCGATTGACTTTATGTCATTACCTATGAAATGTCCGACGCTATGCCTGTACCAAATCCTACAATGCCGTGAAGGTGCCCGGACCCTGTGGGTTGGATAAGGGGGAGCGGTACCTTAGCACGAATCGCTTTCAACGTTGACTGGTCGCGTCTGGCAAAAGTTAAAGACCTGACGCCTCCGGTGACGGAAGCTGAGTCCTATGACGACAGCTATCTCGATGATGACAGATGCAAGACTGGACTGCTGACGGGCAGGGGCAGAAATCTGCCCGGGTACCAGCTTCACGCCTGAGTCGATGCCCCAGCAGCGGCAGCAGGCGCTGCTGGGGGTTAATGAAGGCGATACTCGTCGCTATAAATCCGCCGCTTCCCGAACGCTAGTCGGTGATGTTCCGTGGCCTGAGTCAGCAATATCGGTAAGGCGTGACGGCGAAAGGAAGTACTTACCCTACGGTGAAGTCACCAATGTGGGACGTCCGTCTACTTAAAGAAGATCGCGGCACTGGCCCCTCGCGACTCATGGCACTCGAATCGCCCTGCATAGCACCCTTGGTGAAAGGCACAGCACGCATGACCCGACCGTGGCCTTCCAGCCGGGAGGCGTAATGGACACAGAGCTTTCGTCCTTGGATAAACAAAAGCCACCGTCGTCAGGTTGACCATCACCGTGAACGCGTTGCTGCAGCGGCAAGAGGTCAACAATTCCGGTTGTATCCGTAATGGTAGCGTGCTGCGGTCCCGCAGAAATTACCGTCACTCCACCGCCAGTCCCGATCCGGGAGTCAGCGGCTTTCCTGAAAACCGAATCATTTGAACATAACGGTGACCGTCACGCTTTCTGAACTGTCAGCCCCCTGCAGCGCATTGAGCATCTCGCCCTGATGAAACGGCAGGCAGAACAGGCGGAGTCAGACAGCAACCGGAAGTTACTGTACGAACGCCATCAGACATCTCGGCTTTCTGGTGGCGATGTCGCTTGGCATAACCATCCCGACGCATATCCGTGCATGAATTCCTCCATTCCTTTCTAAACAGATTGAGCACGAAGTGCTGCTAGCCCTGACCTACGGAGGCAATTTCTCATGCTGAAAACGTGTACCGGCTGTCTGGTATGCTGAGTTTGTGAATAATCCCTGAACAGACAGAGGACGCCGGGCCCGCAGCCTGTTTCTTAGAAAGGTTCGACGGCTTAACTGAGTTTGCCCTGAAACTGGCGCGTGAGATGGGCGACCCGACTGGCGTGCAGCTGCTCCGTGCCCGGATGTCATCCCGTATGGATCGACTGGATTTTACAGTACCCATTATTTCATGATGTTTATCCTCCGTACAGCATTTTCCGCTGACGTACCGTTAGCTCATTAGCTTTCAGCGATCCGGATATGCATCCGCTGGATTTCAGTCTGCTGAACCGGCGCGAGGCTGACGGAAGAGCCTGAAGGTTGCTGAATGCGCGGCGGCAAGGGTTCTGCCGGATGTCCGCTTTGAGCAACGGGAATGAAGTTATCCCCGCTTCCCGGATGTGGCGACATCACCGAGGACGTAATGCTGGTACGTACGAGGAGGAAGTACGCAGGAGGTCAGAGCCCGGGGAGGGGCTGAAACGGGGTCGAGATCTGGTCGTTGATTTGGAGTCTGATTCGAGCCAGTTGATATCACTGGACGAGCATCAGAGTCGGGTCATTTTCTGGTACGGAAGGTCATTAGAAAAACAGCGGCAGTCGTTGAACAGTCGCTCTATCATCGACAGGCGCTGGCTGCGACAGAAGCGGGGATTTCCGTTGCGATTATAAAGCCGCCATGCTGATCTGCTGCCTGGCACAGTTCACGACGTGGCCACACGCAGAGCTTGCAAGGGGCAAATTGCTTGCTGGGCTCCTGCATCGCACATCGACAGACTCCTTCGGCGGGATGATCCCCATGTTCAGGGGGCTTGCAGCCTTGCAATCATGCTCATCTTAGGGCCTCGCTGGCGGTGGCGACTGCCTGCTGGCGTATGCCTGGTATCAGGGCAACTCATCAATGTCCGATTTCAACACGACCTGGTCCTTTCCGGCAATCAGGCGACTGACGGCAGATCGTATGCTGTCTCTGTCCAGCAGCCGGGCAGGCGGCAGGCTGACGTTTAACCAAGCACACCATGTACTCAGGCACTGGTTAGGCGGGGGTAAGCGGTGAGGCCAGATCCGCGTCCATCAGCCAGTACCTGAGCGCGTTTCTCCTCTGCAACCCGGCGTGGGGTATAGTCACAACCGCTGAATTCCTGGAAGCTGACCACATACCCAGCTTTGACGGCTGAACGATGAGCCCCAGTTCCATAACGTGTCTGGCTACAGATTGCGTATGTTGCTCAGTTGCAGCGTTCCGGCGATGAAGCCGGGGCATTGCCGGCGGCGAACGAGCGCAACGAAGGGTTTGAGTACAGACCCCCGCCTGAAAGAGACATGGACGCTGGAGACCTGGCAGACATAGACTGCACGGGCATTCAAATCCATGTGGGATGCGGTGCTGATATTGGTCGTCCTGATACCCTAGGCAGGGGGTTACTTAATTAAGGCAAGAGGCTGCGTGAGTAAGAAGCAGACGACATCTGGAATCTGCTAAGGATGATTATTTTGTTAACGATGAAGCGCGGGCGCGTTACATGGGATGATCGTGAAGGCCGTCTTGCTTGAAGCCGCCGAAGAAGGCTGATGCAGCAAGACTCAACAGGGCACAAATGCGCAGCAGCACGACTTATACAGACCGTCACGGCTGAAATACCGAAGAGGCGCAGAAGGCTTACGAACGGCTGCAGACGCCGCTGAGAAATAGCCCGTCAGCAGAAGAACTGAACAAGGCACTGAAAAGACGGGGAAATGCCTGCACCATTACGACACGCTGATGGCTAGGAAAAAGGATTATGAAGCGACGCTGAAAAGCCGAACAGTCCAGCGTGAATGTCTGCGGTGAAGATCGTCAGGAAGACATAGTTCTCTTCCCTGCATCCTGCTGACGATTCCGGCAAACGAGCTGAGACTGCATGCCGGACCAAATGAGAAAATCAGCCATGGCAGCGCCGGGATTGAGGAAGGCGAGTCAGTTCGCGGTGGGATCGAGGCCGAGCGCAACCTTCAGCTGTCTGCACAGGAGAAATTCCTGCTGAGGCATAAAGATGAGACGCCCGGAGTACAAACGCCAGCTGGCTGCAGGTGCGACAAGTACTGACGGAGCGCCTGAACGCGTGCTGGCTAAGCATAGATAAAATTCGCACATAGCAGCGACGGGCGATAAAACGGGCCGCTATTGATGGAAAAGGCCGGGGCTGAACTGACCGGCAGCGAACGGGAAGCCACAATTACGACAGCGCCTGAAGGAACAGTATGAGATAATCCGCTAGCTGAATAACGTCATGTCAGCAGAAAAGACCTGGGCTGAAGACCAGCTTCGCGGGAACTGGATGACGAGCTGAAGTCGGCTGGAGTGAGTGGGAAGAGAGCGCCACGGACAGTATGTGCAGGTAAATGCAGCCCCAATTTGATACTGTGCGCCATCGCAGTAAGCGGGAGATGCTGAACCGGCAGTGGTGCTAAGAAATGGCGCAGCTTCACCCGTTCTCGTGCTGTCCATGATGACAGAAATTCTGCTTAAGCAGGCAATGGTGGGGATTGTCGGGAGTATCGGCAGCGCCATTGGGGCTGTTGGCTAGCATAATCCCGTCAGGCGAAGTACAGCCATTCAGGCCGCTTCTAGGGCCAAATTCTAGGTTTTGCAACCGGAGGATTACGCGATAAACCGGCGTAAATATGAGCCAGCGGGGATTGTTCACCGGTGAGTTTGTCTTCACGAAGGGGGCAACCAGCCCCGGATTGGCGTGGGGAATGTCCGCTGATGCTAGGCTATGCCACCCGGCTTTAGTCGGTACACCGGGCAGCATGGCAGACAGCCGTCACCTCGCGAAGGCGTCCGGACGTTTGAGCAAGACCATGTATTAACCAACGACGCACGAACGGGCAGATAGTCCGGCTGCTCTTAGCGACGCGGTGTATGACATGGCCCGGCATGATCCCCGTGATGAAATTCAGACACAGATCTGTGGTATGGCCTGTTCATCGCGCGGTGACTATAATGAAGACCTTCCGCTGGGAATGAATACGAACCTATGATGCTTCGGTCCCTTCTGACAAGAAGGTGCTTTGGTACTTAGATTCTCAGCGAGCGCCTGCCACGGGCTGAATGCCGTAAGTGGAACGTACAGCGTGACGCTTTCTGTCGCCGTGAGGGAGGCCACCGGTATACGATCGTTTCTGGAAGAGCACGGGGCTGGAAACTCTTTCTGTGACTCAGCCTTATGAGTGGCTAACAGATAAAGGTATACGTAGCAAATGGTCGTCTAGGGTCAGTATGCTGCGTGTTGGATTCAGCAGAGTTGAACAGGTGAACTGATGCAGGATATCCGGCAAGGAAACACTGAATGAATCCAGCGCGTGCGCCCTCGAGTCAGTCTGTGCTGGGAAATCGATGACGACAGGTCGGTGGAGCAACGTTATTTCTGTAATGAGCATGAACCGAAAAAGGTGAGCCGAGGTCAGGGGCAGGGGGAACAGACCCATTATGAGAACCGCGGAAGTTTGATGGTCGACTGAATGGCAAAGGCAGCAGTGAAGCGCACGGTCTACGGTTTCTATAATTGGACTGTTGTCTACCGGGGTATCTAAAGATATGCAAGATTGTATGTCTGAACCAAGAAACGGTGTTGGGGGTCAAGGTTTAACGCCCGTTTTCTGATCGGTGAACTTGGGTTACGTGGTAGAAACAAAGTTACGCTCACGATCGGAGCAGGGGTGATCAGCCTGAGGGGTGCACTATCACAGTGCAGCGACTAGCATTAGTGCGTTCAGCTCCTTTATCGTGCCGACTCGACGAAACTAGCCGTGTGGCTAGTTTTTCCGGGTAACTTATGCCCTCCTTAAGCCTCTCTATCGCACTGTAGAAGATCATGAGTTATAGCGGTCCGGCTGTCGGATGAATTGACCAGCTCAACGATAGTCCTAATACGAAGGATAAATCTGCATAGAATGCCTGCTCAGTTTAAGTTCTAGCATAACGTCGCATGATTTGGCGGCTTCCTTCCCATTAACAAACTTTCGAACCGTAAAATCCCATGACACAGACACCAAATCACTAGATTCTGGCGCACCGCCCGGCGATGTGCCAGCGGAGTCGGTTGCGGGGCGATCAATGAGCGAGAGGGGAAAGTTCCCCGGGGTGAATACGGTACGGCTAGGCGTATTTAGCGTATGTTAGAAGATCAACTATGAGTGCAGCAGATCAACTATCATTCAGTCAAGGCGTAAGGATTCAGGGGGTTCGGTCGGAGTGGAGCGTGAGGAGGAAGAGTGTTTGTAAGTCCTGTTTTCTCGGATTGACCTGCTTAT
>24
AAGGTCGTTGATAGGGAAGGCCTTCTTACAAGTGAAGCAAGTACATATTTAACGTTTAAAGCAGCGATCATCACGTCCTCCCATGAAGAGCCGGCGCCATCACGCCGATATTGTACGCATTTTCATGACGGGCAGCCTGGTTAGTACAAGCCTTGGAAGCAGCTGACGTATTGCCCGTTCGTTCACGTTGTTAATCATAAGCTGGTTATTCTGTGCTCAATACGTCCCTAACGCCTGCGACCGGCTGTCCATGCTGCACCCGGTGTGGCAGGAATGAGACCCGCATCACCTAAGTAGCCGTCACCAATCACGGCCTGTGCTCATTCCGATAAGCCAACAGTGAACAATCCCCTGAGCCATATTTACGTTACCGACGGTGGAAGCCTTTGCTTTACAAATGGAATTTCTACCGCGAGCGTAAGCCGTAATCGACTCATGCCACAACAACGCGCCAATGGCTGCCGATACTCCCGACAATCCCACCATTCGATGGAAGGAATTCTACATGGACAGCAATGAACGAAGCTGCGCCGTCGTATGCTCACTGCCGTCAGCATCACGCCTTGCAATACCATCAAAGGTCTCGTGGCTCATTTACCTTGAGACATAAGGGATCCGCTCTTCCCACTCACTCGCGACTTCCTCCTGCCGTATGCCCGTCCCAGCCATTATTTCTTATGACATGACGTTATTCAGCGCCAGCCGTACCATTTCCCAGATGTTCATGTAGCTTCCCGTCTATCCGTCGGTCAGCCCCGGCTTTCGCATCATCGATACCGTTTTGCCCCGTTATGCTGTGCGAATTTATTCGCGACGAGCCACAGGGCCTTTCGATACGGTAATGTCTCAAGTGCAGCCAGCTGGCGTTTGTACTTATGACGCAGCGTCTCGATATTTACTCCTAGGCATTTACGTATTCGAGTAAGCGACTTTTACTGCTGCTATGCGCAGAAGCCCGCTCGTCGGGCCCTTACCCGGTAATTTCTCATTTAACTGGCATGCTTCTCCAGCGTCCCGTTCGTCGATTACTAACGAATGAGTCGTCACAGGCATGAGCACTGTCTTCCTGACGATCGCCGCAGCATTCACTAACTGTTCGGCTTTTTCACGCGTGCTTCATAATCCTTTTCACGCCGCCATCAGCGTGTTGTAATCGACGCATTTTCCCTTTCGGAAGTTTCTTTAACTCCGACGCTTATTTCTCCAGCGTTATGCAGCCGTTCGTAAGCCTTCCCTCTTCGGTATATTTCAGCCGTGACTACGTGCTCCGCCTGTATGCTGCTTAGGATTTGTCTATTTGCAGTCCTTGGGAGGAACCGGCTTCAAGGCAAGACGGGCCTTTCACGATCGTAACGCCGCTTCATGTTACAACAATCATCTCTGCAGATTCCAGGTGCTTTCTTTATACGCAACCTCTGCTTAATCAGCATCTCCTGCCGTATCAGACGATAAACCACCCGATTGGACCACATGAATTCAGCGTCGCAGTCTCTGTGCCCAGTGGCAGTTTGAGGTTCTCTTTCAGGCGGGTCTTGGGTAATTAAATCTTTCGTCTGCTGGCATTTCCCTGCAATCCGTCTCAGCCGAACGGTCGGATGCGATAGGACGCCTCGCGCGACCGTATGACAGCGTTGACCATCTCAGGCTCCGTGACGGTCGGTAGCCCCAGCTTCGTCGACTTGGTCATTCCGGATGAGGAAGGATCAGCATATGTCCAACGCGCCATTGCGCGAATCTAAGCTACTCTTCAAGGCTCAATATCCTCAGTACCGCTTACCCGCTTAGCGTGAACCTGGTCTGGTGCTCCTTCAGCGTCGGACAGACTGGACGGATAGTACATTGCCGTCAGTCCGCCTGATTACCACGGAAGGACCAGCGTTTGTTGAATCGAGAATTGAGACCTCCAGGCAGCCCGCTCAGGCACCGGTTCTCACCGCCAGGCGGCCCACCATCGGCAGGTCTAAGCATCTAAGCGACATGGGATCATCCCTAAGGAGTGCTCTTCTATGCAGCATTTGAGATTGACGACTTGCCGCCTGCATCCGTGTAAGTCGGTGTAGTCAGGCAGCATACGCATCGAGCTTTATACTGCCAACGAAATCCGGTGCGCAGCCTTTCTATGAGCCGACTGTCGACTGCCCTTATTTTCGCGCATCACTTTCCTATTATACACAAATGACGCCTGTAACCTAGGTACGTGCTGGTAAATCTCGCATCCATCAAATCAAAGGAAGATCGCCGTCAAACACGTAGCCTGCGGTACTGATTCCTCCTGTTGACCGCTGTACGTCATCTAAGTTTATTCCACATCCGGGAAGCGGGGACTTCATTCCGTCCGTAAAGCGGACCTCCGGCAAGCCTGCACTGTTCCGATGCACATCATCGTGCCTCTTTATTCGTCGCCGGTTCAGCAGACTGAATCCGATACAGATGCATGCAGCTGAATTGGGAGGAAAGTACGGCTAATAAGCACGGCTTACCGTCAAACACGCAAGTGCATATCTAAGAACATCTATGAATAATGGTACTGTAAAGCGGTGCGTTGAAGCCGATCCATCACGGCAGCATGGCACGCCGTCGGGTCTCCCATCTCACGCGTTTTCGCATACCCTCCGTCTAACCATTTACGAACATGCGCTGAGAACAGTCGTTTCTTCCCAATCTTCACAAACGACTCATACATAGGAAGTTCAGCGTACAGAAATTATGCCGCATGAAACTCCGTGGCCATGGTAAGCACTTCCTGGCTCAATCTGTTTAACGTCGCTTTCATGGACGGCATCTGCGTCTTCTTAATGAGTCCACAGGGTATAAGCCAGAACGCCCCTTCCGTATGTTCATGCTTTGCACAGTCATAACTTCCGGTTGCTGTCTCCACTGTTTAGCGTTTCGCCTGAGGTTCAGCCGTACATGCCGTACGCCGTTGTCAACAGCGACCGTGACGTCACGTTATGTTCAAATGATTCGGTTTTCAGAACATGGTACTCCGGATTAACTGGCGGTGACGGTAATTTCTGCAACCGTTGCCCAGCAAACTCACCATTACCAACCCGTACTTGCCTGCAGCAACCCGTTCACGGTATGGTCATACCACTGACCGACACTGCTTTTGTTTTATCGCAGACCGCACGAAGGCCTCCTTGTCGGTTACGCCTCCGGCCTGAAGGCATTAATTATGGTCCTTTCACCACCAGGTAGCTGGCAGGCGTCACGGTCATGTGACGCTTCAGGGCTGTTACCGTGCGACGCGGATCTTCTTACGAACGACGTTACATTTACTTTCAAGTCGTACTATTCGTCGCCGTCACGCCTTACCCGATATGCTGGCCGAGCCACTGAACACATCGACCGTGCCGTTCGGGAAGCGGATTTAAATACATTCATTAAACCGACTCATGCCTGCTGCTCTCCGGCATCCACGCCAGCCCGTGAAGCTGGTATATCTCCGGCAGATTTTATCCTGCCATTCCAGCCGTCCGCAGTTGCGATTCTTCGTAGCGGCTGTCGTCATAGACAAGCCGGTCAGTTCACGGGCGTCAGGTCTTTAACTTTGAGACGGGACCAGACAGTCGGAATCCTTTAACCAATTGGGCCGTAAGGTCACCGACTCGGTATAAACCACATTTACATTTCACCGGCATTAGAATTGGTACAGGCACCGTTTAGCATTTCATAGGTAGACATAAGTCAGTTATAAACCCCACAAGCCCGCATTCATGCCCCGGTATAGCCTGATGGCCCCATACTGGTGAATAGAAATTGACAGGCTTAGATATCACCGATATCGGTACAACCATCCACGCATCCAGCTGAATCCGGCACCTGAGCAGGCAGGAAAACTTCGGATATTAAGCTGCCAACTGCATGTCCTATTTAGAAGCTCTTCAGCGTTTCAAGCATTAGTCAAAGGCAAATCGCCTCATCAAAACAAGCGGGTAGACGTCACCAAAAGTCTTGCTGTCATTGCTCCAGTGCATCCAGTACTATCGACCGTTCAGTATGTTCATCGGTTATTACCCGATTGCACCATAGAGCTCTTCCGGAAGACGTTCCGCCGTATCCGCTCAATATTTGTTAACGGGTCACGGCACCGCCATCGGGAGTCCTACATCAATGGGTAACGATGTCTCCATGACACGCTGCATGATGCTACGGCCATTTTTCAGGTCGATAAACGGCCGTAGAATACGACGGTTACCACCAACGCCTGCCCGCCGCTTTCAGGGATGAACGCTGCCTTTGACGCCTTAGGCGAAGGACCCGCATTACCCAGCTTGATTACCGACTCCGTACCGCATTTACTTTGATTCTTAGCTTGGATAGGACCGTGCTTTATTTTTGTAATCTCCACTTTCGGACTCCACTGCATTTTAGTTGACGCCGTCCAGAAATGGTTATCATGAAGCAACGTATACATTGAATATCTAAACCAGGCAGGCTGTTCAACGTATGGCCACATTAGAGCATAAGCCGTTTTCATGAGTATAATCCGTTAACGGCCCGTAGCTGGCTATTTGGAGATAGACATCTCCGGTTTCACGAGCGACGGTTACTCCAAGCATGCCCGTCCAAGCCGGCTCCTGTCGAAGCCGCATGATGGCTCAAGCATGCCGATCACAATGTTCTACGGGAGGTCGGACCTGTCTCACGCGTGGTCGGACGGTTTAGAGCTACAACATTTCACTCATGTCAAGCATAGACTTTTCAGGCGTATAGTAGCG
>25
AGTAGGCAACGAGTTGGTGATTTATGCGAAATGAAATGGTCTGACTTATGCTATCATATCTTTATGTCCAAAGAGCAAAACAAGCATCGGCAAATTGCCATCCCAACAGCATTGCATATTGATGCTCTCGGAATATCAATGAAGGAACCACTTGATAAATGCAAAGAGATTCTTGGCCAAGAAACCATAATGCATCTACTCGTCGGCGAACCGCTTTCTGCGGCACAGTATCAAGGTATTTATGCGCGCACGAAAAGCATCAGGTCTTTCCTTCGAACCAGGGATCTGGTGGTAGAGCTTTCACCGAGTTGCGCAGTTGTCTGCAAGACCTGCTAGGAGCAAATAAGCGATAATTTAACATAATATTCCCTGAGGTCGACAGATGGCATCACATCGATGGTATTGACATATCACAGGGGAGGGATGGGACAAATTGAATCAAATAATGATTTTATTTTACGTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTTATAATGCCAACTTAGATCAAAAGCTGAACGCGGCGAAACGTAAATGATATAAATATCAATATTAAATTAGATTTTGCATAAACAGACTACATAATACTGTCGTAAAACACATATGCAGTCACTATGAATCAACTACTTAGATGGTATTAATACTGTCCGTAACAGAGCATTAGCGACTGATTTTGTCGTCTTGCCTAAGCGTTGTCATCAAACCTGTCACACTCCAGAAGCACTCACCCAGTGCAAAGCTTTGTTGTGTGCGGCTAAGACGACCTGCATAACCAGTAGAAGATAGCAGTGATGTCAAACGACGCAGAGCTGACTTCTTTCTTTCACGACTTCCCCACACCCAGCATGCCGACCTTCCGCCATAACTGTAGTGAATGTCTGTTGGTCGACCAGGGAGCCCGGCGGAAATTAACAGCGTAACCAAATGGCTACCCGAAGTCCGCCGTGGCTATCTATCGGTATTACGTGAAACGCTTCTTCAGAAGCCTGAAGAGCTAATCGTTCTACCATCTATATGCATTAATAGACTGTGATGTTCTGTATAAACATGTCCCACCGCTGCAACATGAATAACAATCGTCTATCTTACAAAGGAAGCAGAAAGCTAAAGCAGAACGGAAAACTACAATACGGTTATTCCCCCGTTAAGTTCAATACTACTAATTTAGATGGAAAACGTATGTAATAGAGAGTAACTTAAAGAGAGATTAGATCCTGTGCCGCCAACTAGTGCGGTTATTTTAATAAATTAGAGATTATATGTTGGAGTTAGTGTGCATAGAGGCGGACTTCATGCGTAGAAAGGCAGGTCACGAGCAGATGGTCCGAATGACTATTCATTTGTTACAATGTTTTATCTTACTGTCTTTGATGAGCACATGGCTAAATGCGATATCGGAAATGTTAAAATTGGTTTGCCTGCAAAAGAAGAAGTAAGCACCTTATTGCTCATTAATAATAAATTCAGTCATTCCCTTAAAACTGTTTTTCCTTAGGTGAAAGCATTGACTATGTTAGTACCAAATGCTGCGATGGTTTGATAAAAGCTTCTGCCTCGGGTCAGGGTTTTACGTATGGCCAAATGTGGATTAGCCGACATGCAAATGAAAGCGTCCTTAACAGCTCATTACTTAGAGGGGTAACTCTTTCAGAAATTCATGGACAGTTCGCGCACGTGTTAAATGGTTTGCCAGGATTGTTGATTTCGCTTTCATTTAATAGAAAAATTAGTATGGCTCCCGGATTCAGTATTGATTTGACCCTTTGAGGTGACGGTTAATTCTATGCCCAGCACGAACACTTCATGCTTTATCGGGCCGAATGGTGTAGGTGAAACAACAATTTTAGAATGGAATGATCTTGAGGCAATCACCAACCCAGAAACAATGAATATTTCTGAGAATAATAGATAGGTACGTGGAGTCAAGAAATGCCCAAAGGGATATTTCGCGTACATTTTCAGTTTCGTTTGAATGCCTGTTATTCCTTTCTTAACCAACAAGCTGGATCACCAAACAGGTACCCAATACTTTTATATTGGACTCAAGAATGCTGCCAGCAAGCCGTTGTTAAATCACTAGGGGATCTCCGGGACTGCCTAATTCGATTTCAGCATTTATTGGTTGTATGAGAGGTAGAAGACGCCTCTGGCTTGAAGCTATCAAAACTAAGTAGTGATGAAAACTTTTGTCAAATATGGAACTCATCAGCTCCCTCATTTCTAAAGTAACCAGTTAAGACGTAATGAACCACAGATTCAATGACGATGATAAAATAATTCACTAAATTGTTTGAGTGACAATATCCGCGAGAATATCTGCTTGAATGAGCTCTGGACTGCAATTGTTTTATTTACTATCACAAGATTAGTAGATGTCGTTGTGAAAGTCATTAGTTTATTCGATGAACCAGAGATTGGGTCGCATCCCACCTGTCCTCCTCTGCTTTTCTACGGAACATTAAGCGAGACTTACTCGATGCACGCAATGGTGTAGCAATAATTGCAATCCATTCCCCAGTAGTACTGCAGAGGTTCCAAATCCTGCATGTGAAAGTCGCTCACGTTAAGAAGCAATAAAGTATGCGTCCCCTGTGAAGCTTCGGTAGAACTTAGGTGTTTATAATTGCGTGAGGTGTTTGACTATTGAAGTGACAAATTCTGGATACCACCACTTATTATCGCAAGTCCGTTGATTCAGACGTTCTTATGAAACCATTCTAAAGATTATAATGGTCAGATAGGATTAGAAGGTCGAACCCGTTTTAAAGCGATGTAAACTGAACAGAGATGAAGGTAAAGTACAATGAAAAACACTATCTTCCAGCGAGAACTTAGCGAAGTCGCTTAATAAATGCTGGAAGGTATGATTGCAGATAAATGTTAGAAATAATTTCATTACTCACTTCCCCACTTTTGCAGAAAGAACAACAATATAGAATATTAAGCTCGGACAGGTCAGTTATTTACCTACGACAGGACATAATCGCGGAGCCTACAAGGCGTAGGTAATTGACCTGACAAGGTTAAAAGGGTCGAAAGCTTTATGAAAATAATAATCTCCGATAAAAACAAACCCGCTAGAACATATTACGATGACATGCTTGTTTCCATCAGTGAAAATGTCCATTTTTGTAGTGACATCTAGACAAAAATATAGATCAACATTTTCTTCCTATTGCACATTATCCTGAATTTTCGGTGATGCCTATTAATTAGTTCCATCGTGCCGCGACGTGCAATATGGGAGAGAAAGGTCATAAGTTTTCGCAGTAGATGAGGTACATCTAAGCGATTCATCCTCCCTATATCGACAAGGACATTTTTCTTAGCAATGGGTATGCATTCGTTTTCCGGAACTCCGGGTGCTATCAGTTTTACTTTGCGCGTTATCAGTGAAACCGCCCGGCGACTGGAGGCAGGAAGACAAACACAGAGCTCTTCATCATTTCAAGCTATTAAATATTGTTAAACAGGTATCGTTGGAGGCAGGGAAGGCTTGAAGTGAATGATCTAAGAAACTATTTCGTAAATTGGGAAGCCTGTCAACCGCAACGTTTCCCTGAGTCGATTTATTGAAAATCTGAAACCGTAGCTAGAGATTTGAATGACTTCCCCAATTATTGGAAAGAGTTATGTATCAGTGCCTAGCAAACTCGAAGATTTTCCAGGGGCATTAGAATATGATAGTGAAGATAGAAAATTGCCGACGCTTATCGGAAGTGAACGCATCGTTATATGCACGAAAGGCTGTTTTACAAATCCGGTGACTTGCTAACGATTCTAGGCAAATCGCTTGGCATGAGTGAAATGAGGAAGAGGAGCGCCTGTTGTAATGTCCCTGGATACGCGCCGGCGTTAGGACAGTGGCGTACAGTCATAATGAGTCCTTGGCAACATGGTAAAATTCTGGCTGCAACGTAGATCGGGCACTGGAAATCATTCAACACCGGCACTATCGGAAGTTCACCAGCCAGCCGCAGCACGTTCCTGCATACGACGTGTCTTGCGGGGTCAGCACCATATCTCCTATGAGCAACGTGTTGAGCGAGCCAAGCCACAACTCTAATTTAATACATAATGAATGATAATAATAATATTAAATTTCCTGTGTTGACTCAATTACTATATGGGTTTCTGATAAGAATCATTGCGGAGATCGACCTATTGTATCCATTAACACGTTAGAGTCCTTTAACACTAATATATCAGCTTAGCATGCATGCTATCAAAAATCGAGAGTTTTATGACTAAACCATGGGAAGACACAATGGCACATTTATCACGCACTTGCTCAAATGCTGCATTGATACATATTTTGTATAGGCGTACTTTCGCCTTGAATTTGAATCATTCCTCCAAAACCGCAGAACAGTAACATTTATTATTCAAAACAAAACCAGATTACGAGTCTGACATTTGGTAACAAGCATGTTATTGAAAATGGAAAAGATGATCCATTAATGGCTTAAATTCCGCAATACGATAGAAAAACAAGGCGATTTAGAAAGGGTACTGAGGCAAAAGGCTACTCTTATTTCATCTTACATTGAAGAAAATGACATTGAGTTTATTATACAATGAAAGTATGTTAAACATTGGTAAAATTAGTCAGTATGTGCTAAGAAGAGTGCAACAACATTCATATTTAACTGAATCAACCGTATGTAATCAGAGATAGAGGTCTTAGTGACAAACGGAATCAGGGTAGCGATTAATCAGAAGACGATGGGTCGGCATAATCTATGGCAGAATGTAACTGCTGTACTCTCTTGGCATACAAATAAACAATCCGAATTACTGTATAAGTACTTTCGCCAACATCATTCGACTCTTTATTTGATGAAGCAGGAGAATAATCTACTTTAAATTAAAGATTATTCCATAGGCAGGTCATTTAGCATGATACAATATGACAATAAAGCGGCAATTCCTGAAGGACTTAGGAGCGTCTAAAGGGTATTAAGCCTGACAAAATATCATTCGACAGACAGAGTTAGTTGACTATACAGCCAGCTTGCAGAAACGACTTTTTACGGACGGTTGACATTCAAACATTAATTTTATGATAAACAACAATTCCATCCAATTGATTTAATCAATACAACATTTGAAGATCAAGCAGATAAATATATTTTGAGTTATGCAGCTGACAAGGCCAAATAACAAATCTGCTAGCTGGCTTCATTTACAATCAGAGCTATGAGCCAGAAAGACGCAAAAGAGCATCACTCTGCCTCAACCAATACATACAATGCCAATGAGGTACTCATAATTAAAGGCACTTGGAATTGATTCAAGGCATCAAATGTATTTCATGGAAAAATAGTTGAGAGAACGAAGAAAAACCGACTTTGTAGAAAATATCAACAGCATACTCAAACAGTACGAAAACAGCATATTTCATGCGTTCAGTCTTAAAGGATTGGCGGTATATGTAAACACTACGAACAATTGAGTCATAGAACTTCGTCATTATTCTCCCTGGATAACATTACTAAAACCAATACTCAGCTTTACAATAACTAACAACCGCAGAACGTTATTTCATACGACAACGTTTCTGCGGCATGACAAAACGATTACTCCATAACAGGGGCCACTCAATATGAGATGGAGTTGACTTAGCCCCACGGTTCAGGCACTACGATATTTCTTCCAGGGCTTCCAGCAACGAGGTTCTTCCTTCGTTGCAGTTTGGCACTCCGATCTGCAGCATCCTATGAAGCACGGCGCAATATGCACTGGCTACCTGCATCAGGCTTTTGTTTCTTCCGCCTCCGGATCGAACAGTTTTCTGCTTCCGTATCCTTCACGAGGCTGTGCCGTTCCATTTCTGAGTATTCCCCTCCCGGCGATAACCCAGCCTTTCCGGTAACGGACGAAATTAAGAGCCTCGCCCGATTCTACGGAAGCCCGGTCGACGGTCATAAGTTCCCGAATGATGGTCTTCATGAAGGTCCACGATGCCTCATCACCTGTTGAAAACAGCCACAAAGCCAGCCGGAATATGCTCTGAGTCCGTGCAATATCGGTACTGTTTGCAGGCAGACCGGTATGAGGGCGAATATGCGTCTACCTTCACCAATAATTCATTAGTTCCGGCCAGCAGATTATAATTTATGGTCCGTGGTTGTTCACTCATTTCTGAATGCCATTATGCAAGCCTCAATAGTTAAATGCAATGTTTGACGGTGTTGGAATTCCCGTTACCAGCGTTAACGGCTTATGGTGTTAGTTGAACCAATACTGAAAGAATGGCATGAGCACGATAGGCCAACCGGATGCTGTGAGCACCAATACACGGTATCTGCATGTGCAGCGGCACTCGAAGGCTGTACCGGACAATGGCGAGGTATGTGACATGCCCTTAACTTCGCCCTGCGTCGTTTCGATAGGCAGCTCCTGTGTGCTCATTCCTTTAACTTGCTGGCTGTCCGTAATGGTTAATTCCGACCTGACTCCAGCCATGTTCATCCTTAAACCGCTTGTGGATAGCACCCGCGCCATCGCTGTTGAACCGCTCAGACTGTGAGCATGATGCCCAGTCGTCGTTCCGCATTTGGTGCCGTAATGTGAATGCCTGTTGTTTTCGTCCCGTAATCAAACGACGATGTATTTCGTCCCCAGATCCGTGACACGGTAGGCACTGTGGCTGCGACTTAATTCCATCCTGTTCCTGAGACAATACAGCACGACCCTGGCTATTCCCCTTGATTGTCCCTCCGGGCATATCAGGAAGCGACGCAGTGGCTGGAGAAGCCGGAAGCAAGTTTGGTAGGCTGATTGTCTCAACGCCTGCGCCTGCGAAGCCATATTAGCCAGACGGAACGATATGGTGATAAGGATCGCACCGTAGAAGCCGAATTCTCACCGGCCCAAGGACTTCAAGAACATCTGCAACGGAATTTTTGCCAGAATATCCCTGCCTAACCTGAGTCAGTTCAGTCAGGCTGGCGGCATCATTTCCGCAAAATACGGTAATTATTTTCGCCGTGGAAGCCTGCCAGCGTCAGTGTCGCATTCTGTCAGTTGTTGAGCCGCAAGCGCGTTAGTCATGGTGGTAGCAAAATCTGGATCATTCCCGAGCGCTGCGGCCATTTCATTCAGCGTATTCAGTGCGTCAGGTTTTTGACGCGTCAGTAACATCTGCAATCGCGGCCAGTACAAAAAGCGGTGTTCGCAATCTGGGTTTGTTTAGACCTCCCATTTGGTCCATGTTGGCGTTCCATTCGGGTCGGACTGTCGATGTGGGCTTTCTGTTCGTTTCATCCATTACCATCTTAACAGCCTTTGGCGTGCAGCAAGCGTTTCAGACGTGCTGTTGGTTGCACTTGGCTGATGGCACTATCCCACTTTCTCGTTGTGTCCGCATCCTACCGCGACAGCTGAAGCTATATCTTCTGCACGTTTTGCCGAATTTAAATGTAAGTCCCACCGCCTTCTGCCCTATTTTACTTACGATTAATGATCTCGCACTTCCCCGCAGCCCTCTGTCTCCGCGGGTTCGTTGAGGAATGGACGCATCGCGCCCCGCCGCTGTTGTTTTGCGTTGCCCGGCAAGAGTAGGCGCGGTCGTTCCCCTGCTGTTCGACTCTACTCTGGGAAGGAGGCAGCCCTGCCTGGCAGAATTTCTGCCGCCGCTTCAGGAGGAAGCTGCTAATGGAAGGGCACTTGGATGATGCGTTCGTTTCTGATGATTTTGCTGCCTCCTTTGAGGCCAAGCGCATCTCGTGCTGAATGGCGGCCTCTGAAGGGGCTTTCGTGGCCCGGTGTCAAGAGGCAGACGTGGCGGCTGATTGTTGTGACGCTGCAGCATTCGTTTCTGACGTTTAGCGCACAGCACTGGCTAGAGTTTTGAGGAACTGCACCTGCGGGGTTTCCTTTTCAGTAAGTTGCTGATGCCTTCTGGCGCGCCTAGAAGGCCTTCCTAGCTGGACGATGCAGCTGTCCGGCGACGTGCTGGCGGCGCGTGCTGGATCAGTTTGCATCAGTTACAAGGGCCGCGACCTGAGCATACGAATGCACTGGCATGCCCTGACGCTGATTTCTTCGCGTCTGCCGTATCTACTGTGCCACGACCGTTGAATGAATCGGAGCAGCGCCACCTTCCTCAGCATCAGTTCAAGACGACGCATAAGCATCGCTGAAACATCCTCCAAGGTCATGTAACCATACAGAAATGGATTCAGCGTCCCGGTTGAATCTTCATACACGGGCTTATGGTCCAGCGGCGTCAGTTGAATACTTAGTGGGAAACCGTCAACCTGCAGGACGGTAATCTTAATGACGATCTCCACATCGCGCTGCTTAACGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCACCACCACCGTGGTAGTGTTAGGCTTCTTTATACCGTTTGCCCTACCTGAATGGTTAAGTTCTGTGTACTAGTTTTCCTGCCGTCTTTCCTCAGATTCCTGAAATCTTTACTGCCATATTCAGCCGCACAAAACGCGCGTCCGGCAGATCGATTCATAGTGTCCTGGCCTATCCATTTATACAGTACAACAAGTGAATCCGTCTAGTACGGAGTCGCCACTGCCGGCCAGCCTTCATAAGCAATATCAACAACGACGGACGGTAGATTAATCTGGTACCTGCATACGCTAAGTAGACTATGCCGCATTGCACTTTCGTCCCTGGCAGTGGTCGTGCTTTCATACCCGGGGTTTCCGTTACGTAATGCGATGTACTGCTTCATGATCACTAGGACTGTGAGCCACTCTGAGAGCCTGGCGTACGGAGACCTGCTTGATTTGTAAAACCGGTCCGGCCATCACGCTCACAGACGTCCACGCAGCGCTCTCATAGTGAAACGTATCCTCCGCGGTCATCACTGTGCTGCTCTTTTCTACCGGCGAATCCCAGGGAAGCCGACCGACGCACTGTTAGCGTCAGCTCATAACGGTATATTGG
>26
CTTAGTCCGTTTCCAGCAGTTCTTTTAATCAGCCACATACGCCCCGGCGCGGTGCCTGCCCCGGCTGGTACAGCCAAAGGCAGCATCCATCTTCGTAGCAATAGTTACGACCGTAACGGGCAATGGCCTGCGTATCTTCAACAAGCTCTGTCGCCGTCTCCCAGCCGTTGTTCGGGTCAATCCGGCGTTAGCCTCAACGGCATTATGAGTCCTTCAGGGCGCTGAAGCTGTAGCCTAGAACGGCGCGCCATCATCCGGCATCACACTAACTGCGTTATAGTCACGTCTTATCCGACGGTTTAGTCCTGCACGAACGTCAGCGTGCCGTTCCATACCGGCGACTCAGCGCATCGCCGAGCAGAAATCGCTGAGCACATCCACGCCTTACGCTGTGGTCAGGTGACCGCGCATTACAGGTGAGCGGCTCGTCGCGTCCCCCAAAGCCGTTCTAGGGCACTGACTGGTCGCAGTACTGGCCCATCATACCACAGCACCGCTTTATTATGCGTATGCACATCCGCCGCATCAACAGAACCGTTTCCTCCCATGCCGTAGCGCCTGATGGGTCGGCATATCCCACAAGACACCAGCCATGTTGTTGCTGTATGCCGGTTTAAACGTTCCGTTCAGATACCGCTGTACTTGCCGTCTTGAGTTATAGTTCGACGAGCTAGCACCTGCAGAGAAGATACGCCCGCGCATCATTAGCGGCTCACCTGCTGGCTGCCGAACTGCTCCCCGTTGGACCCGCCGACCAGTGCCGTGTTCGGCTAATTGTTTCAAGCCGACCTTCAGTGTTGACGACCGACCAGCGTTTTGTCCTGCAGCTGGTCTGGTGGTAGCTGTCCGGCGTCATCCTGCGCATTAGAAGCTTAAACGGGCGCGGCGGCAGGTTACCCATCACCGCCCCAATAGATGATGCAGGTGGTTTACATTAATGGTGATGTCTTTTCCGTTCACCAACAGCGTTACGTTGTATCTGAACCATGTACAAGGCGGCGACTTCCGACGGCTTCCTGTCACCTTTGGCTAGGTATTCCTACCAGTGCCTGTACACCCGACTTAAAGCGCAGACGGTCGATGTTGCAGACCCAATGGTGCGGGTGATCGGCGTCATATTTCACTTCCGTACCCCAGCACCGTCTGGAGCCGCTCGAGGATGCCAAATCCCCTCCGGCGGAGTCTGCTCCGTGCTCACCATACGCGGAACATCACACCGTGACACTGGATATGTTGATATTCCCTCGAGTGTCCAGCACCGGCGTACCTGTTCAGCAGCACGTCGTTTAAGCCATCTAAATGTCGACTTCAATCGTCGCTGATGGCATACCGATCACACTCAGCAACTGCGTGACAACTCAGGTCCTTCGTCGCTTTCTAGGGGTCCCTTACTGCTTCCTTTTACCCATTCCTCACGCTCCATAAATGACAAAACCGCCCAAGCAGGTCCTACACATAAAACATTTTGCATCAGCGACCAATAGATACACCCTAAGCTCGCCGTTCGCGTCTGCCGTGCTGATCTCCTGAGAAACCACGCGTGGTACCGCACGCATTTCCACAGAATTGACAAGCAACATTGCCTGGGCAACCATGTTATGCGTATAGAGAAGCGTAGGTTCTGCTTACCCGTTATCCGTTGTCTGTACGGGGAGTCTGGCTGCTTTCGCTGCCAGCATCTGCGCCACCACCGAGCACCATACTGTACAAGCAGCCAGAAAACAGGATGCCCGGTCATACCACCGGCCCCAATGGGTGCCCCCATGCTGCAAGGGGCTCCGGCGGTAAAGAATGATTAAGCAATGAGGCAGCCCCCAGATCGGAATACGCCCTGTGACTTGGCGCGGCGACTCTGGCACGATATGAATTACAGCGCCATCAGGCAGAGTCTCATGTAACTGCGCCGTTAACCCGGAACGTGCTGACGTCTGCCCGGCAATCGAGCGTGACATATACCAGCCGTCGCTCAGTTTCTACGAGCCGGGAGCTGTGTGAGTCGCATGGATTGAGCCCCCGTTTTCCACGAAGGTCGATGCGGCATACAAATCGTTGTAATCCCCGTAAAGGCAGATGCGCCTCGCTTCACCGGTACCGCCAGAGGGAGTGTGCGTGGACGGTGCCATGTCGTCGGTCTCCTCTCGTTTGCTCAGTTGTTCAGGAATATGGTGCAGCGCAGCTCGCCGTCGCCGCAGGTAAATTGCGGCGTGATTCGGCACTGACCGTAAACCAAAACAGCACAGCAGCACATCGCCGGCTGTGCCCGGTGATCAACGGCACCTGATACAGCCCGTGCCTCCAGATTATCCGAGATAGAGAATGCTTCTGGCCCGTTGAATCAGCTACCGTCATCCTCACGATGAAAGTCCGGCATCTCAATCCCCGCCAGATGATAAGCATCCCGGAACATATTGTGTAACAGTCCGTCACCGTGCTCAAAGCGCCGGTGAGATGCGGCACAGGGCAACTTATGAATCGTTGGGGGCGAGCGCCCCGGCAGGACTTAAAGCTGCACCTGCAGCCGGTCGGCCTCACTCAGCCAGGGCAGACCACCGGGTATGGACTTGCATCAATCAAGCACCCCCTGTCCACCCTGCATTTCTGCCTGCAGCCAGTCTTCCGGCGACACTAGAAATACGCCTCCGGCTCACCGGAGATATTCACGCAGGGAAAATATCTTTCCCCCTCCGGCGTGCTTACTACGAAGCTCGCACGACTCCATGGCGCACATCGCCGGGCGTGCGCCAAGAATCGCGCATGATTCTGTCTGTCATGGGATTTTATAACCCGCGAAAGTTGTTAATGGAAAGGAAGCCGCCAAAGTTGCCGACGTTACTTGCGATCTTACAACCCGCTCCAGGCATTTGCTGCATTTATCCTTCGTGATATCGGACGTTGGCTGGTCATTCATCCGCGACAGCCGCACTGAGTAACCGCACTCGTCACCGCGATAGTCTAGGTGCAGGTGTTAGAGCATGATACCGTCCTAGAAAAGCGCCATCCGTTTCCGTCGGCCGTGACAGATCAAAGGAGGCACTCACCGCTCAGTTCGCTGCACGCGGCCTCAATGCGCCAGCGGCTGATCATAGCCGCTCCGGATCGGCGTAATGGTCTCGTTGTACGAAGTTCACCGCATCCAGAAAACGGGCGTAACCTTACGCCGTAGACCACCCGTTCCGCCGACCAGACCCTGCATATCTTCCGCCATCCCGGTACCATACCGTACAGGTCGAAACCGTCAGCGTGGGCGCGTCGTCATGAAGCTGGTGCTTTGCCATTCAGTTCAAAACCGACTGCTCCCTGAATGGGATACGGCTGATACTATCTTCGCCCTGCCAGGTGACCGGCCAGCTTTTCGTTCTGTAACTCATTACAGAAAAGCTACGTTCTCCACGACCTCTGTCAGGTCGATTTCCACAGCAGCACGGCCGACTGCGCACCGTAGAGCATTCATTCAGTGTTTCCTTGGATCGATATCCTGCATCAGTTCACCTGTTCAAACTCTGCGCTGAACTCAACGCAGCATACTGACCGCGACGACCATTTTGCGCAGGTACCCTTTATCTGCCCCACTCATAAGGCGGCGTCCACAGAAGGATTTCCAGCCCCGTGCTCTTCCAGAAACGAACTCCAGTACCGTGGCCTCCTCACCGGGGGAACAGAAGGCATTTACGCTCACGTTCAGGTTGGCATTCAGCCCGGCACCGAGCCCTGAGAATAGCCATCACCAAAGCACCTTTCGTACAGAAGGGACCGAAGCTCATCCATACCGGGTTTCACTTTCCAGCACGAAGTCTTCATCGTCCTCCGGATGAACTAGCCATCACCCTAATCTTGTCCTGAATTCATCACGGGCATCCCTTGCGGGCCATGTCATACACCGCCTTCAGAGCAGCCCACGATATCTGCCCGTTCTTCAGCGTCGTTGTTAATCACCACATGGTTATTCTGCTCAAACGTGGCGGACGCCTGCGACCGGCTGTTCCATGCTGCCGGTGTACCTCGACATAACCGCCGGTAGGCATCGAAGGCGCATCAGCCGGTACGATTCCCCACGGCCAATCCGGCTCGTTGCCTCCTTCGTCCGACAAACAAACTCACCACGTATAGAACAATCCCCGCTGTAGCTCATATTTGCGCCGGTTCCCGTAAATTCCTCCGGTCCAAAATGGAAGTCGCGCCGCAGCGGCCTGAATGAGATCGCTGACGCGGATGCGCCGCCACCAACAGCCCCCGCCAATGGCGCTGCCGATACTCCCGACAATCCCACCATTGCTGCTTAAGCAGAATTTCTGTCATCATGGACAGCACGAACGGGTGAAGCTGCCTCAGTTCTGCTCAAGCCGTCAGCCGCGCTTCTAGCATCATCAAAGTTCTAAGGTCCTAGAAGATTGGTGTGCTCCATCATTCCAGCGACTCCGCTGCCATGTGATTCCCGACCGTCTTACCTGCCAGCTCTGTTAGTGCTGGAAGGACCATATCATTCAGCGCCCTACCATCATACGATTCCTTCAGGTTCCATCCCGTTGCGCCGCATGGTCAGTCAGCCCCCGGTGCTTTCGACCAAGCGCCCGTTCAGGCGCTTGAGTGCTGATGGAATTACTCAGGTTGCCAGCCAGTGCGGCCGACGGCGTGCCAATATCGCAGCGTTGCTGGTCGTATTCCCAGCAGGGGATTTCTCCAGATTTATTCCTAGGCAGACATCGAGCGGACGTTGCGCACGCCTCCTCCAGTACGCGACTGACTCTCCGCTTTCCACAATCCCGGCGCTGCTGGCTTGATTTTCTCATTTGCTCCGTAAGCGTGCTTGCTTCTCCAGCGTTTAGAGTTCTGCCTGAAGCGTCAGCAGGGCAGCATGAGCACTGTCTTCCTGACGATGCCCGCAGACTCCGTTCACGCTCTTAACTGTTTCGGCTTTTCATAGGTCGGTCTTCATAAGATCGCTTTTCACGCCTCATCAGCTCGTGTTGTAATGCCTGCAGGATTTTCCGTTTCAGTGCCTTGTTCCAGTTCTTCCTGACGGGCGGTATATTTCTCCACAGCGGCGTCTGCAGCCGTTCGTAAACGTGCGCCTCTCTTCGGTATTTCAGCCGTGACGCTTCGGTATCGCTCTGCTGGGTCCTTGAGCATTTTGTCCTGTTGAGTCCTGCTCAGCCTTCTTTCGGGCGGTTCAAGCGCAAGACGGTAGGTTTCACGATCATCCCATAACGCGCCCGCGCTTCATCGTTAACAAAATAATCGTTCCTTGCGCAGATTCCAGATGTCGTCTGCTTTCTTATACGCAGCCTCTGCCTTAATCAGCATCTCCCTGCGCGGTATCAGGACGACCACAAGTGGAGGCACCCGCATCCCACATGGATTTGAATGCCCGCAGTTCCTGTCTGCCCAGATCTCCAGCGTGCCCATGTTCTCTTTCAGGCGGCGGGTCTGGTCGTAAATGCTTTCGTTGCGCGCTCCTCGTTCCCGCCTGCAATGCCCCGGCTTCATCGCCGGAATCTCGGCACTAGCTACCACGCAATCTGCTCCCGACACGTTATGGAACTGGCGAGCCATTGCCGCCGTCAAGCCCCGACGTCGGGTCTGTGGTCAGCTTCCCGAAGGCTTCCCATATGTCCACCTATCCACGCCGATGCACCAGAGAAACGCGCCCACTCTGGCTGATGGGTACGCAATGTGGGACCACTACGCTTACCCGCCTTAACCAGTGCCTGAGTACGGGTCTGGTTAAACGTCACGCGGCCGCCTGCCCGGCTGGGACAGACCAGCATACGATCTGCCGTCAGTCCCGCCTGATTGCCACGCGACAGGACTGAGTTTTGTTGAAATCGGACATTGAGTTAGATAGGCTCCGCCCTGATACCGATGCAGCCAGCGCACCGGTCGCCACCGCCACAGCGAGGTGAGCGCCCACCATCGGCAGGGTACGCACCGGCAAGCCCTGAACATGGGGATGATGCGCGCCGAAGGAGTCCTTCACCTGCCCTGCGTGCAGCACCATTGATCAGCCACGACTTTGCCCGCCTTAAGCTGCGTGGCCACCGTCGGTGGATCTTTACAGGCAGCATACGCATCGGCGGCTTTATACTGCCGACGGAAATCCCGGTTTTCTGCAGCCAGCGCCCTGTCGACTCAGCGACGTTCAACGACTGCCGCTTTTCGCATCATTTTGCGTACCCATAAAAACCCTGACTCTGGCCATCTGCTCGTCAAATCTGTCCGCATCCAGACCCAAATCAACGACCAGATCGCCTAAGCGTTCAGCCATGACGGACTCCTGCGATGCCTTCTGATACTGTCATCAGGACAGTACGTCATCCTCCGTCATGTTGCCACATGGCGGGAAGCGGGGATACTTCATTCCCGTTCGGGCCACGGCGACAACAGAGGCGACTCCGTACGCTTTCTTCTGCATCAGCACATCATCTTCAGGCTCTTCGTCAGCCTCGCGCCGGTTCAAGCAGACTGAAATCCAGGGTAGGCAGATGCATATCTGGATCAGGGTCGCTGGAAAAACAGGCTGAGCACGGTGTACGTCAGCCCGGAAAGTGCATATCCAGCAGAACATCATGAATAATGGGTACTGTAAAAGCGGTGCCAGGTCGGCATATCGATCCTGACATCCCGGCAGCGAACGACCCGCCAGTCGGGTCGCCCCATCGCACGCCAGTTTCCAGCAAAACTCAGCTCACCGTTGAACATTTCCCGAACAGGCTGGTGCGGGCCCGGCGTCCTGATTTATTTCCGGGGCAGTGGTCCTCACCACAACTCTCATACAGATAAGACAGCCGGTTCCACCACGTTTTCAGCATGATTAAACGATCCTAGGTATTAAGCATTCCTTAACTCCGTATTTTAACGGCGATCCATTCGTTGCACGGCATCGCGTCTTCCATGGTTATGCCACAGGGACATCGCCACCAGAACGCGCCGGTTCTTCGATGGCGTCTTCCGCAAGTAAACTTCCGGTTGCTGTTTGACTCCGCCTGTTCTGCCTGCCGTTTCATCAGGGCGATGCTCAATGCGCTGCATGAGTTTAGGTGGACAGAGAAGCGTGACGGTCACCCGTTATGTTCAATAACTGATTTCGGTTTTCAGGGAACATCGCTGACTCTCTAGATGCTGGCGGTGACGTAATTTCTGCATAAACGCAGCAAACACTCACCATTACCAACCATGGAAGAATGTTGACTTGCTTTAAGCAACGAGCTCACGTTCCGGTATGTCACTGACAGGACTCACGGGCGTTGTTTATCCGCAGACAGCACGAAGGCCTCTTATTTGATAGA
>27
CATCCATCGTCTCCATTGGTGTTTATGACTCGCGGCTGCTGCACCATAGTTCCTGAACTGAATGAGAGGGTACGCACCCAACTGGCAGCACTTCCCCGACTCAACTGCGTCACGGGCATGACGGATCTGCCCGCATTTACGCGCTTTACAAGCCCGATTCGTGACGCTCCTATGGTTGAATGCGACCCTGAATGGGATGGCTCCCAAACCGCCGGGTACGAACGCGTTCGTCAGGGGACTCTAAATGGCCCCTGACTACGGATTGCCGGTAGCATAATTAGACTTCTTCGGACTAGGTTACGGCACTCTACTTATGCCAGCTGCCCGCTTCATCTTACTCCAGTACCGCGGTGCCTGGAGTTCGATTGAAATTCATCCTAATCGCCATCGTACTCATTGCATGCATTCTTTGACCTAGATGCCCGTTGCGGCGCAACGCGATTCCTCGCTTCTGTCGAGCATCCTGTTCTCAGTGCCGTGGTGGTACTCGTATCGCGCAATGCGACCCGCACTCCCCGGCGTACATAAACAACGGACTGGGGTAATTCTAACGACCTATCTTCTAAGGCAATCGTCTTTCAATCGTTCCGTTATTGGGAATCCGTCAACGATCGCCCCCGACGTGGTTTCAGGAATTGATCGAAGCGACGCGACGTATTCTAGATTGGCCTATTTGGTCTGAATGCGGTATGTTTGGTGCATCCCTTAAGCGGTCCTTTATGGACGCGTACGAATGGGAACGATCCACGCGAACCCCGCACGCGGCACGACTCGAAGTCTGACCGCAGTCCTGGCTAGTACTGTATTACAGGTGCTACATCACCGAAGCGATTGAAGTCCCTTATCATCATCGGCTCCGACATTTGGTAAACGTATCCGGCGGTTGACTCTAAAGTCAACAGGAGACCCTATCCGTGTAGCGTATTGTTTAAGTAATACGCATGAGAGCCTAAGGATTTGAATCCGGCTAGGTCAACGGCTGGTACGGAAGTGACGAACTCACGAGTCTCACACCATTACGTCTGCAACATCGACGTCTTGGCCTACTTTGTACTAATCGTCGGACGACGAGCTGTAGGACTGGTGAGAAACCAGCACGCCTTAAAGGAATCCGTCCTACGAGTCAAAATACAACTGTTGAGGACTAACGTAACTACAGTACTATCACGGAGGGCCCAAAAACCTCACGCAGTATGGCCTCGGTGATGGGTACCTGCCTAAGCCCGCCGTTTAATTACGACGTATGAGATAGCAGAGCACCGACGCCTACGATAAAGTGGATAATAATTAGTTTATAAACGAATCTATGGCTAATAATCTGAAATCTAGTCATAGGAAACGGGTGAGTCGAACATGGACTAGGTACGCCGTTCGGCAGCCAGCAGCTCTACACGTAATCCTTAGGATGCATCTTGCGAGTGGCGTCCAACGGGCCAGCAATGACGCTCGATAACGAGCAATACAGGGCTGTGACCTCTACGAACGTTAAACCGGCACATACAGCAACAACAGCTGGCCTGTGTTGTGGATGATTGAACTCCGGTCGACGCGGGCAACGGTTAAACAGGTCTAGCCGGCTTATCACCGTATGACCCGTACTGCGACCAGTCAGTTGGCCGGACGCTTTGGCACGGCGCTACCCGCATCACCTGTAATGCAGATCTCTACTGACTCACGATTAGGCGATTAGGTCAGCGATTTCTGTAGCTGGCGATGGCTGCTTAGTCGAACCGTGGAACGACTACCTGCGACATCGTCGTCGTGCAAAGCAACGTCTGATAAAGACGTGACTATAAACCGCAGTAATGTATGCCTGTGATACGCCTAGCGCCATCGTTCCGCTTCGACCAAAACCGCCATAATTCCGTTGAGGACTGGATTACCGAACACGGCGACGCGACTAAAGTTGAGGACTCACCAGGCCATTGCCCGTCGGTCTATTGTTACCCGAAGATGGATGCCTTTGATGCGGCTGTGGCAGCCCAACGAGGCGCCAGCTACGGCTGTGAGCTGATCCCAAAACAGAACTGCTGGAAACGGCAAGACCGTGGATTTCATAGCGGATTCCCAAAGGCTTTCGCCTTATCCATGTGAGCATTGTTGACCCAATCTGCGATGGACCGACTATGCCGGTATCACACAGTCGTGTAATGCGGTGAACAGCCCAAGCTCCGGACTGACGCTGGAATGCTGACGCGGATCGGGCCATCCCGGTACGCCATACGCTGGTTGACGGACGGCGGGAAGTGTAGCAATTCTACCGTGAGTTCAGTCCGTCACTAAACGGCGTGAAGGTAAACCGAGCCGTGTTCCCTGACGTGTTGTGAATACAGCGTATGGGAGCTGAAGCTGCCAGGACGCTGCGCCAGCGACTGTTCCGCTCGTGGGCTGTACCGTGAGAACGACGAACGTAAAGTGCCATCACCGCCGTGCAGCAGGCGCTTTACGAAAGAGCCATCGTGTAGGACGGGGCGCACTTTGACGGCGAACTAAACTTAGGTCACGGCCTCATCTAGTCGCCTAAGGCTTGCAGCCACCTGACCGCAGAAGATCACTGCAGACGCCGGGGAATATGAGCCTATCGTAACATGAATGTCACCCAACTTACTTCCAGGGCTGACCGTTCAACTTGACGTGACGGACGTCTATCTCACGGACGACTGAAATCAATGTCATAAGCCTGAACCTACGCAACTGGCTCGTATAAAAGTCTACGAGTATGAATATGGGGGACTCCCTTTGCCACGGGCGGTAATGCGGTATTGGCGCGGGGCGATTGCCGTTCACTTGACGTTCTCAATTAGATTTTGAGAGCGACGCCGGTGAGAGGATTAGACCTAGAAGCCACTTTCAAGCCGCATCTTCGATGTTTATACCGACGGTACCAGTTTGAGTTCTGTTGTAGAAAAGCAGATTGCGCTCCTCGTACAGTACCGACGACGCGTTATCTTGGTACGGATATGTACCCTCACCAATAAACGGGTCACGGCCTGATCTTTACTTTGGTCACAGTGGGTAACACTAAGTTAGCAAATCGCAATTCGTGGAGGCCGTCTGTCAATCCGGGTGATGCGACGTTACCTGGATTTTTCAAAGGCAAGACTCGAATCCCATCTCGGCAGGATGGTAGGAAAAGTCGAGTCGACCGTGAGCCGATAACGCCAGCAAGCGTCGGAGTTTCGAAAGAGTGACAGAAGGATGCTAAGTGATACGTAGCGAATTCATGCCGAGGCAAATCTTTAGTTACAATAAAGACGGCAAACATCTGTCTAATGCTGGGTACGCCTCAGGGATGGAGGACTAGAGGAAATGAAGCACGAGCCAGTTTTGGTTGCTCGCCGTTAATGGGGATGCATTTTATTATACCGGCAAACGCGAATCGAAACGCCGAGTGTTGTAGCGCAGGTGAATGAGATATTCATGAACGACTTTTGATGCCCTGACGACGAAGCTTCGAACGGCTTACCCCACTCAGCGGCTAATCACTCCGGCTTTTCTGGCTGACGGACGGCGAAACTAGACGGACCTGCTGCGAGATATCAGTGAGATTGAAACGTTCTGTTTAT
>28
TGTTGCCTCCATGCGCAGCGACTTACTCGATGCCGCACGCAATGGTGGGCAGCATAATTGCAACTCATTCCCCAGTAGTACTGCAAGAGGTTCCAAAATCCTGCATGTGGCAAATCCTACGTCGCGAGATAAACTTATCCGTTAGATGCACGGTCGGTATTAGGTGTTTATACGTGAGGTTTTACCTTGAAGTGACAAATTCTGGATACTACCACCCCTTATTATCGCAGTCCGTTGATTCGAGCTTTCTTATGAAACCATTCTAAAAATTAGATGGTCGATAGGATTAGAAGGTCGAACCGTTTTAAAAGGGTGAAGTAATAATGAACAGAGAGATGAAGGTAAAGTACAATGAAAAACTATTCTTCCAGCGAGAAGTGTAGCGAGAAATGCTAATAAATTGATTAGAAGAGTATGATGCAGATAAATGTTCAGAAATAATTTCATTACTCACTTCCCCACTTTTGCCAAGCAAAAGAACAATATAGAATATTAAGCTCGACAGGTCAGTTAGCTTTACCGACAGGACACTATCCTCCATGGACAAAGGTAGTTGATAAAGTGAAAAGGTTAGGTGAGAAAAGCTGTTATGAAAATATAGATCTACGAGTCGACAAACCCGCTAGGCTATTGCCATCATGTGTTTCGTAAAAAGCTGAGGGTCATTTTGTGGTATATAGAAGACAAAATATAGATCATTTTCTTCCTATTGCACATTGATCCTGAAATTTTCGGTGATGCTATTATCATTCGATTCCATCGTGCCGCGACTGCAATATGGGAGAGAAAAGTCAAGTTTTCGCAGTAGATGAGGTACACCAAACCGATTCATCCCTATCATAAGTTCGTGATAGCGGGTGCAAATTTCGTTTCCGGAAACGGGTGCTATCAGTTTATGTTGAATGCCCGGCGGGCAGGAAAGACAGAGCTCTTCATCAGTTTCAAGCTATTAAATATTGCTAACAGGTATCGTTTGGAGGGCAGGAAGCACTATTGAGTGAAGTGATTACTCAACGAGAAACTCTTTCGTAAAAGGTCTACCAGGAAGTAGTTCAAACCGCAACGTTTCATAGGCTACCGTCGAATTTAGCATACAGAGCAATCTGAAACCTATTATAGATTTGAATGACTTCTGGTACGCAATTATTGGAAAAGAGTTATGTATCAGTATTCTAGCAAACTCGAAGATTTTCAGGGGATGTAGAATATGATGAAAGATAGAAAATTACGACGCTTATCGGAAGTGAACGAATACTTTTATATGAGGAGGGCTTTCCAAATCCGGTAGTAACTTGCTAACCAATGTCAGGCGAAAATCGTGGCATACCAGTGGCATCCGGAGGACGTTTGTAATGTCCTAACCGGCACAGCAGTTCTAGGACAGTGAGTCAAGAGTCATAGATCGTCGGTGGAGGACTTAGATTCTCATGCAAAAACATTAAAATCGGTAGCACTGGAAATCATTCAACACATAACCTAGGATATTCGAGCCAGCCGCAGCACGTTCCTGCATACGACTGTCCTTGCGGCTCTACCATATCTCCTATGAGCAACGTGTTAGCAGCCAAGCCAACTCTAATTTTAATACATAATGAATGATAATAATAATATCTTAAATTTCCTGTGTAACTAATTTACTATGGTTCTCTGATAAGAATCAGCGCCTGCAAAGATCAAACAACTTGTATTACATTGACAGTTAAGCAGTTAATTTATCACCTCTAAATATATCAGCATCTAGCATGCAGTAAGGGTCAAAAATAATGGAGAGTTTTATGACTAAACCATTAGGAAAGAAGACTGCCTTTATCGCACTTGCTCAATGCTGCATTGATACATATTTTGATCCTGAATTATTTCGCTTGAATTTGAATCAATTCCCTCCAACCCGCAAGAACAGTAACATTTTATTATGTTCAAAAACAAAACCAGATTATAGGATATGACATTTGGTAACAATAATGTTATTGAAAATGGAAAATGATCCATTAATGGCTTGGCTAAATTCTCGCAATACGATAGAAAACTTCAAGGCGATTTAGAAATGTATAGCGGCGAGCAAAGCTCTCTTATTTCCTGTACATTGGCGGAAAATGACATTGAGTTTATTACAAATGAAAGTATGTTAAACATTGGTAAAGTTAGTCAGACTTTGCACACAAAGGAAATTACCTTCATTTAACTGAATCATCTATTATTAAATCAGAAGCGACGATGGGTCGCTAATACGCTAAAAGATTACGAATTATTACATGCCTTAGCTATAATCTATGGCAGAATGTATAAACTGCTGTAACTCTCTTGGCATACGATAAACAATCCAATGGTACGCTTGATTTCGCCAACAACATGGTTCGACTCTTTACTTTGATGAAGCCGGGAGAATACTTATTTAAATTAAAGTACTCCCATAAGCAAATTGTCATGTTAGCATGATACAATATACGGACTCGACCAAATTAATTCCTGAAGATATTAAATATTAGTCTACGACTGGTAGATAAGCCTAAATATCACTTCGACAGAAGAGTTAGTTGACTACTCAGCCAGCCTTGCGGAACAAGCGTTAGGACGTTATCACATTCAAACATTAATTTTATAGTAAACAATTCCATCCAATTGATTTAATCAATGAACATTTGAAGATCTAAGCAGATAAATATATTTTTGGCGTTATGCAGCTGACAGCCCCAAAATAACAAATGCCTATGGCTTCATTTGGATATCATGGCTTACCAGAAAAGCAAGCATCTACTCCAATAAACCAATACATACAATTGCCAATTATAGATGAAGACTTCAGGTAATTGGAATTGATTCAAATAATAATCAAAATGTATTTCATGGAAAATAGTTAGAGAAAACGAAGAAAAACCGACTTTAGAAATATATCAGCATATCAAGACCCTGACGAAAACCATATTTCATGCGTTCAGTTAAAGCAATTGGCGTGATGTAAACACTGAACAATTGAGTCATAGAACTCTTCCATTATTCTCCTGAAGATAATAATCGCCAAATAAACCAATACTCAGCTTTACAATATACTAACTAACCGCAGAACGTTATTTCATGGGGCATACGTTTAAACAAAACGATTACTCCATAACAGGGACAGCAGGCCACTCAATATCAGGTGCAGTTGATGTATCAACACGGTTCAGCAACGCATCGTGCACGTCGAGCAACAGATTTCTTCCTTCGTTGCGTCCCAATCTGCAGCATCTAGCAACAGCGCAATATGCTTCCTCCAGCCTGCATCAAGCCATTTTGTTCTTTAAGCCAATCCCTGAGTTTTCTGCTTCTCGTATCCTTCGCCCCAGGCTGTTGCCGTTCCACTTCTGATATTCCCTCCCGGCAAAAACAGAACCCTTTTCTCAGTATAAACGAGTCCCGCAGCCTACTACGAATTCTCGAAGCTGGAGCCATGAACCCGGTCAGCTAGTTTACCGCGATGGTCTTCAACGGAGATGCCACGATGCCTCATCACCTGTTGAAAACAGCCACAAAACCGGAGCCGATATCTGGCGGTGCAATATCGGTACTGTTTGCAGGCAGACTCGGTATGAGGGATATGCGTCATTCGCAACGATTCATTAGTTCCGGCCAGCAATTATAATTTATGGTCCGTGGTTGTTCACTCGGTTGAATCCCGCTGCAAGCCTCACAATATAGTTAAATGCAATGTTTTGACGGTGTTTTCCGCGTTAACGCAGCGTGCTCGTGATGGTGTTAATTGAACCAATACTACCCAAAGGGATGGGAGCCGCCCTAAGGATAACACTCCAGATCAACTGCCGCGCATCGCAACTGCGCACCGATTGCACGGCGGCTAGGCTGTACCCGGACAATGAGTGACTGTGGCTGCCCTGACTGTCAGCGTTCGCTCATATACGAGCAATACTCGTGTGCTGTTGCTTCCTTTAACTGTGATAAACTTCCTGTAATGGTTGCTGTTTGCTACTGACTCCAGCCGCTGTTCATCCTTAAACTTGTACTGTCTTAATCTATGACCCTCGTCTCCCCTGTTGAACCGCTCAGACTGTGAGCTGAGCCCCCGTGTTATTCGTCGATTTGGTGCCGTAATGGGGACTCTTGTGCTGTTGTTTTCGTCCCGTAATCAAATAGGGTGGTTTTCGTCCCCAAATCCGTACCGGATGCACTGGCACTGTGCTCTGTGCGACTTAATTCCATCCTGTTCCTGAGACAAACCGCTAAGGCTGGCGGGTTTCCCCTTGATTGTCCATAGGGCATCTAGGAGCACATAGCATCCGGATACGCGACAGCAAGTTTTGGTGAGGCTGATTTGTGTCGACTACAAATCACGGGCTATCGCCAGACGGAACGATATCTGATGGCCAACGGGATCGGCAGGACGGTGCCGAAGGTCGAATTCAGCGGCCCCCAAGGTTCAAGAACATCTGCAACGGAATATTTTTGCCAGAATATCCGTGCCAACCTGAGTCAGTTCAGGTCAGGCGTGCATGAATCGATTCCCAAAATACGGTAATTATTTTCGCCGTGGAAAGCCTGCCAGCACGGTTAATGTCGATTCTTCAGTTGTTACCCCGGGGTTTAGTCATGGTAACAAAATCTGGATGCTTCCCAGCGCTGCGGCCGTTGATTCAGCGTATTCAGTGCGTCAGGTGACGCGTCGATAATGGTGAAATCGCAACCCGCGTACAGCGGTTCGCGGTGATGTTGTTTAGACTCCCGGTTTCTTGCTGTTGGCTTCCGGTCAGTGCCGGACTTCCAATCGGCTTTTCTGTTCGTTCATCCATTACCACCTTAACCGCCTTTGGCGTTGCAGCAAGCGTTTCAGACGTGCTGTTGGTTGCACTGCTGAGCTGCATGACCTCCCCTTTCTCGTTGTTGTGTCCGCATCCTCAAGCCGCGGGTAATGGTTCTTAGTTTGCCGAATTTGCACCGTATTGCCGCCGCCTTCTGCCGCACCTTTTTGCTCTGCACATTAGCTGATACCGCACTTCCCCGCAGCCTGTCTATAAGCTTCGTGGATGCCGTTGACGAGCCCGCCGCTGTTGCGTGCCCAGCGGCAGAGGCTCCGGCTTCGCTGCTGTTTCAGATGACCTGGCATTCGTCTCGGACGTTTTGCCGCCCTGGCAGAATTTTCTGCCGCCCGTTGCCGAGGAAGCTGCACGACCGGCACTTGATGATGCACGTTCGTTTCTGATGATTTGCTGCCTCTTTTGAGGCCACCGCATCTCGTGCTGAAGTGTGGCGGCCTGGATGGATTTCGTGGCCCGGTGGAGGCAGACGGTGCTTACGTGTTGTGACGGTGCAGCATTCGGTTTCTGACGATTTCGCGCACGGCACTGGTGGCCGCCCCGCGTTTGGATATGCGGACTGCGCGGCGGCTATTCGCTTCAGTGGCCTTTGCTGTGCCGCTTCTGCGCCGGAGGACGCTTCCTGAGCTGACGATGCAGCCTGTCCGGCGGGTCGGTGGGAACGCGCGTCGGTGGGCTTGAGTTGCATCAGTCACGGGGCCCCTAGAAGGCATAGTGGTGATGCAGCTCGCATCGCCGGCTGATTTCTTCGCGTCTGCCGTGACTGTGCCACCGACGCGTTACGCTCAGAGCGCTCTTCCACCATCAGTTCCGGCAGCGGCCATGAAACATCCTCGCGTCATGGCCACAGAGAAGCCATTCAGCGTCCCCGGTTGAATCTTCATACACGGTGATGGTCCCGGCGCGTCAGATACCCATGTAGGAAAACCGTCAACCTGCAGGGTACGTGACCCACATCCGGTATCACGACGCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCACCACCACCGTGGTGCTGGTCAGTTGGCTTTCAGCCTGAATGGTGCGTTGCTCTGTGGCTTTTCGCATGTGCCGTTACACGACTCCTGAAATCTTTACTGCCATATTCACCCCACAAAAGCCAAGCGGTTCCGGGCTGTCATAACACTGTGTTACCTGGCTAATCTAGAATTTATAACCGACCCCAACGATGAATCCGTCAGTACGCCAGTCGCCACTGCCGCCAGCCTTCAGCAGCAATATCAACAACGACGGACGCATGGATTAATCTGTATATACCTGCACTCTGACGCCCACTGAGGTATGCCGCATTGCATTTTCGTCCCTGGCAGTGTGGTCGTTCCTTTCATACCCGGGAGGATTTCCGTCTTACCGTAATCCATTGATGCGTAAGCGACTTAGCCACCACTCCAGCGCCGCTGGCGTACTAGACCTGCTTACTGATTTGTAAAACCGGTCCGGCCATCACTACACATAACGTCCCACGCAGGCTCTCATAAGTGAAACGTATCCTCCCCGGTCATCGTCACTCTTTTCGACGAAGCATCCAGGGAAGCCATCACCCCACACTGTCCGTCAGCTCATAACGGTATTCACGTTAGTAAGTTCGGACGACTCGGGGTATCCCGCCCGACAACGAATGTACCCGGTTTCACTTGAAGGTAGCCCACCGTAAACGTACCCTGTCCGTCGCACGGGCCGGACGTCACCGCAAGTGCGGCAAGAAAGAGCAACGGCAATACACATAGTACGCATCGTTCACCTCTCACTGTTTATAATAAAACGCCGTTCCCGGACGAACCTCTGTAACACAGCCAGACCGCTGATCGCCCGACGCCTGTTTCTTAATCACCGGATAAACCTGCCACATCGCTGGCAAACGTATGAGAATATCCCCGAATGCCGTGGACGTAAGCGTGAACGTCAGGATCACGTTTCCCCGACCGCTGGCAGTGTCAACAATACGAGAACACTGTACCCTCGTTCGCCATGAACAGCTAAATCACCGCACCGTTCATCAGTACTTTCAGATAACGATGAAATACGTTGTCCATGCCCTAGTAAATCTAGTCATTCACGAGCGTCACGGAAGGCACCACTATCTGGCGATCAAAGGATGGTCATCGGTCAAACCGTAGACAGGACCTGTATATGACGGCCAGTCCACTGCTTTCGCTGGCCGGAAAGCCAATAGCGCCCCGCCTTTACAAGCTTGACGATGTTCCCTCGTTTCCTCACATACCGTACCGTTATCGTACAGTTTGCCTCATCGTCACATTACTGAGCGTCCCCGGAGTTCGCATCACTGCCACTGGTATCCGCATTTAGCGGTCAGCTTTCCGTCCATGTTAAGGAAAGGCCGGGATGCCGCTTATGGGTAATACTGTGGGGGCCGATTTGAGCGCGGGTCGGAACACGTCGTTCATGAATATCTGGTTGCCCTGCGCCGAACATCGGCGTTTCATTCCCGTTTGCCGGGTCAATAGAATGCGATACGATTGGGCATGAATAGAGACCGTGCTTAACAGTTGACTGGCCGGTGAGACAATACCCGCGACATAATGTTTGCCGTCTTTGGTCTGCTCAATTTTGACAGCCACATGGCATTCCACTTATCACTGGCATCCTTCCACTCTTTCTGGAAACTCCTCCAGTTGCTGAGTTATCCTCCGTCAGCTCGACTTTTCCAGCAGCTCCTTGCCGAGATGGGGGATTCGGTTATCTTGCCTTTGGAAAAATCCAGGTAACCTTCCGCATCATCGCTCGCCCGACCGACGGCCTCCACGAATGCCGATTTGCCAACGTCACACTGCGGATATAAAGTAATAATCATGGCCGGCCATTTGATATTGATACTGGCGGCTATCCAGTACAGCGCCGTACCAAGATAACGCGTGCTGGTTTCAAACCTGTCTGATATCCGCAATCTGCTTTTCCAGAACAGAACTCAAACTGTACCGTCCGTATAAACGGCAGATGCGGCGTGTGTGAGGTCCTGAAAATAGCCCGGCGTCAGCTCAATCCTCGACGTGCTGCCGGTGCGGCAATCCGGAACCATCTAAGCCGGATGCTCTCCCTGCTGCCCGCGCATTTACCGCCGGACTGTCAGCCTGTAGTTCCCCGCATAGAGTTGCTGCGTGAAGCGGTATGTGGTTTCCGTCGTCCGGGCCGTGCTGACCAGCTCACTGCCGTCGTCCGTTAGCCGTCATAACGATAAGGAAACTCATTCACGGTCGGTGTCCCAACCGCGCCCATAAGCTCTTCGCCATGTCCAGTGGGTGCGGTCAATCATGCGCCACTCCATGAGTTAGCAAGGATTTCACGTGCCTATATGTTCACGTCAAAGTGCGCCCCCGTTATCCACGATGGCCTCTTTCCGGCACATGCTGCACGGCGGTGATGGCATACGTGCCGTCGTCGTTCTCACGGATACTCACGCAGCGGACAGTCAACAGTGGGCGCAGCGTCGGCAGCTTCATAACCATACGGTGCAGCATACGCGTCGGAGCCTAACATTTTACTTCACGTCGGTAGACGGGACCTCACGCTCCACGAACCGGATTGCCGCCACTTCCGTCAACCATTATCAGCGCAGTACTGGAGGATGAAAGATTTCACGGTGAGCGTGCGGCGTCCGTGGCTGTTCGCCCGCGCCAGCCCATTGATACCGGCATAGTCATCATCGCATAGATTTTCAATAACATCTCGTAACACCCTATTAATGGAACGCTGATCCTGGGGCCTCCTGCAGCTTGGTAAGCTTCAAAGTGCATGTTCGGGTTTCTTTCCTTACGACCCCTAACGGCAGGCTAAGTTACGTAGAGACAATATCA
>29
CGACTTGCGTCAAATTTGATTGGTTTTGGTAGTAGTCCACGTACATTATAATGCTCCCTATGTGAAGGGAGCGTCGATTGGATAGTCCCACCGAAGCGAATAACAGGTTTTATGCGTTAAATGTTACAGTAAAGAGTGCAACCAGGAGGGATAACCGGCACATTAGTATTAGTGTTAACAGGACACAAGAGACAGTCAATAAGTATAGATGATACATACCAGCGTGTTTATCTCTTACAGACTAGGTATTAGACCAGTCGCCTACGAACATGGACTTTGATCAGATTCTTAAGAAAATAAGGGTGTATAGAGTTAACTGGAGTCTTAAGGTAATATTGTAGTTAACTTAGTCACGTTGAGCTATACCCTGTAAATTTCTAATGGGGTTATGGTATGGTAGATAGCCCGTTCTACTATCAGATTGTCGGGACTGAATAGACTAGTCCAAACCGAATAGAATACGAGAGTAATCATGGTATCCTTTAGCCTAGTAGTGTAGGTGGAGGCAAAATTGACCGAGATAACGTTTTAAGGTGGGCTAGTAGGGAAGGCTACAAAATACCAGGAGCAAATTATGTCAGCTAGGTTTAGTGGGTTGTAATCTATCTCGCTGCTCCCATAGATAAACATAGAAGTATGCGACACGATCTGTGGGTAATCCGTATGAAGCTGAGGAGTAGTAGCTCGTGTAAAGCGGATCGTCTCACCTACAAATGGCTTAAGTAGATTATCATCAGACACTCATCTACAGGCGCGGGTATGCCGCATATGTCATATCCCGTCTCATGCACTGAGGTATAAGGCTTGATTAACAGAACCTATTGGCTCGCCACTCTAACGCTTCGTTTAATCTCCAGGTCGCGCAGCATCCGTCATCAGGCAGGCCTGCACAGCATGCCCTATCGGCCGAAGCCACTCCCTTTGACCTTACCGCATTCGTACCTGCTCCGGCGAAGATTTACCCGGTCCTGACAGGATCACATCTGGACATTTAGATTCAGGTTCACTTCTAAGTAACCCCGAACGAAGGAAACTTTCAACTTTTGGATTAATTAGCGAGACGAGCGAAAAACTTGACTTAGACCGCTGAATCCAGATGAACCAGGAAATAAGTATCTCTACTTGCTCCCGGGCAGGAAGCCCGATGGATTCCCAGCTCGACTGCTTTAATTCTGCACTGAGAGCGACGTGAGCACGAATGAATATTTCTGGCCGCCACTACGATGAAGACGATCTCAGTGCTGCCTGAGACCTTGCGGAGATCAAGTAAAAGGCCCGCCGGAAATCTAACCGAAGGTTGCCCTATTCGCCTTATCCTAGGTACAGTACCCACCATGTTCCGAAATGGTTGCGCGTAAGCGTTAAAGCGACGTGAAGGTGACTGAGCATCACCTAATGAACAAACGGTATGGCATGAATCTGGAGCGACCGCGACATACAGGTTTTAACCTTTCAACCTGAATGATGAAGCTTCCGTTGCTTCCAAGGATGCCTCTTGCCGACGGCGCAGCATGTTAGACCGCTGACAGCACCAGGAAAGCGATGCATAAAAAGATTTTGTGAATAAATAACTAAGTCGATCACTGAAGCCGCTGGCACTCCATTACACCCGTAAGTCTTATCATAGGGGCATGCGACGGATTTGAAGAGGCAGTCCGGTCCAAGAATACAACACCGGGCAAGACGTACGGGTCGAGCCTGTTACACATGATTTAACTGAATTGAAGACTTGCCGCCGCGGACGCAGTCTGATGACTAGAACTGGGTCGACAATACAGAAGACGATCTAAACGCGTATATCACTTTGAGATCTCTGTGTACGAAAAGCATGCTGACGCCAGACTCAGCTATCTGGCATCCGGGGAACGCAGGATAGAGGGGCCAGCGGAAAGCCGTTCCACCGCGCGTGGAGCCGACGGGCAGCGATTCGCCGGAACTGCATTAGTTGACGCATGATTGACGTTGGGCCGAACCCACCGTTGAATGATGCAGCCTCAGAAGGTGTGGCATCCGACGACGGGCTTAATAACGTGGCTGTTCAGCCAACTCAGCATCACGATGTTCGTCCGGCTTTTCCGGCCGCAGAGTTCTCAATGGTGCCTCCGGCCATCGGGGTTGACCGCCCGGGCTCCGGGTCTAAAGCAGCTGAAGAGCCGTACGTTTACGGTGCAGGAATTAAACGCGACCGTTGAATTCGGGAATATCCGTCGAGACTGTGGACCATCCGCGACTCCTCTATGGTACCAGTTCGTCTCCGGCCTGCACATAGGGATTAGAGTCCGAATTAAGAGCAATTAGGACAACCGACCTGGACGCCGGTGCAGGGCCGAATGTTGAACCGTGGGCAAGGCTATTAGACCTACCATGCGAGACGCGATGCGGCTCGATGCAGCAGAAATGTGACAGGATGCACCAGGGTTATCGCTCGCGGTTCATTCACGATGAATTTATTCCACGGCCGTTCGGAGCAAAGCTAGGGCAAGGGTAAGTGGCCCGAAGACGCACTGAAGCATCTCAAGCTGAAGTGCCGTATCCGCCCATAGAGTTTAAGCTGAAGATACGCAGCTGTGCCCTGACTCCTGCGACATCAGGAGTGGCTCGGGACTGGCCGGTTTCGATCCTACTGCTTAGGTTAACTGCATCCCTGCATGGTCTCTATCCTACTCCAAAGCATTTTAGAATGCTCACGACATCGACGAGTACGACGGGGCTTGCGGTAGGCAGTCGATTACGCTGTAGCTGGCGCTCAGGTTCGTCTGAGCATCTCACGTCGACGAGCCATGTTTCTGACTTGAATTTGGTAAGGCGACGAGGCGACCTTTCTAGAATTCTCCTGCATTCTATTCAGCGCCGGCTGTTTCGAGCCGGGGAACCCCAAATGCTGGAGATATGCATATGAAGCCAGCATCGGATCGGTCATCAAGCTCCGAGCTGTAGGCAGTTCGGGATAAGTCTCTTAATGCTCCGCATCCGGACTGAGTACTACTACGAGAAGTACGGCAAAACGCGGTGACGACTATCAGGAAATTTGCCCAGCAGGTCCTGTCGAAGCCATCCCGTGCAGCCGCTTTAAAGCCGCCTGGCAGCAGCATTTGAATCCGTGCTGCGGGACTCAACACAGGAGGAGAACTATACGACATGGCAGCGACTCCGCAGTCGCAGGTGGCCTTTAATGAGCCTGATGCTTGAACCCTATCCGCGGGTTGCGCTTGCACTCAGCTTGGGATCAGCAGCCTGACGGATGCGGTGCGGCGACAGCCTGACTGCCCAGGAGGCCCAGCCCGACGCTGGCATTATCCGGCTTATGACGGACTACGACGCCCGCAGTTATCAGTCATGAACGCAGGAGCCGTGCTGCATTAGGGCGCTTCACTCTAGGCTGCGCCACGCTGCAGCCGTACGGGGTACATTGATCCAACGGCATTATCGCCGTCTGCAACAGGCTGCCAGCGATCCGATGGTGACGGCATTCTGCTCGATATGGACACGCCGGCGGGATGGTGGCGGGGCATTCTGCTGACATCATCGCCCGTGTCGATTAAAAGGCGATCCGCTTGCCAACGACTGAACTGCAGTGCAGGTCGCTTGCCTCTTCCCGGTGCTAATCGAAGCGTGCCCGGACAGGCTCCATCGGCGTCATGGATGGCTCACAGTAATTACGGTGCTGCTGGAGAACATGTGGAAATCACGCTGATTTACGGGGGCACGTAAGTGGCATCGACCCCATGGATGACGTCCGGCCACTGCAGTCCCGTAGCATCTCATGTTGCGCCGACTCGTCGGCATATACCGGCCTGTCCGTGCATACGTTGTGCTGAACCAGGCAGTACAGCGGTCAAGGAGGCCTTGATTGAACCCTATCATGAACTTGTTAACAGCACCGATGCGGAAGCCGAGATGCGTGATGCACTGGATCTAGGTAAATCCCGTCTCTCAGGAGCGAATGACGAAGACTCAATCAACAACTGTTTCATACTCCACTGCTTCACAGGCTGACGTTATTGACGTGTGCCGGGACGGGGCGAGAACGCCAGCGGCGCAGCCACTTGAACGCAGATCACCGCAGCGGTTGCGGAGCAGAAGACGCAGCGCATTATGGAAGCCCAAATCGGAGGCTCACGACGCGAAGAACAGGCACGCGTGGGCAGAAACCCCGGTATGACCGTGAAAGCCTCCGCTTCCCGCCTCAGCCAGTGCCGCTGCAGTACTGCGGATCGTCTAGAGCAGGGCAGCATGGCTGCAAACGAGAATGACTGGATCCGTTAACGATTTGCTCCCGAATACAGGAGCGTTGACGAGCAAAGAAACCTTTACCATTACAGCCGCAGGGCAACAGTGACCCGGCTCATACCCGCAACCGCGCCGGCCGTGAGTGCGAAGCCTGCAATGGCTCTTACTCTACAGCCGGCAGCTGGTTGCGTGGGATGGCACCGACGGTCTCTGCCGTTGGCATTCTTGCGCGATGCTGAGGCACCAGACCCCAGCACCACGCCTGACGTTCTACATTGGCACGTTCCGTTATGGATGTTGCTCTGATGAGTCAGACGAACGAGACGCGCTCGCCTCGCCCGCATGCGTTTGCCATGCGGGCCATCGTTTATGTTACCCTTCATCACCTAAAGCCGCCTGTTGAAATCGGGGTTTTTATGTCTATCTCACAACCGCCCAACTGGCGCGGCAAATGAGCAGAAATTTAAGTTTGATCCGCTGTTTCTGCGTGCATTTTTCCGTGAGCTATCCTTCACCACGGAAGGTCTCTCACAAATTCCGGACTGGTATAAACCGCTGTACGTTCTACTAGTTGCCCGGCGAATATGAATTCCTCGTGGCACTCCCTCTGAAATTTACGCCGGATATGTCGACTCACGAAGCATGAAGTGAATCCCCGCATCAATCTCGTCGCCTGCCGTATGAAGCAATCTCGGCCGGCTTACCGCCGTCGCATCATCATGCAGAACATGCGTGACGAGCTCGGTCCTCCACTAGGTCTCGAGTGCGAAGAAGTTTCTGCCGTGCTTAAAGGCAAATACACCATGACCGTGAAGCCTTCGATCCTGTCAGTGATAGCCCGCAGTGAATATAACATCACGCATTTGGCACTAGACAGTGGAGCAAGCGTGACAAGTCCTACGTACCGACGATATCGAAGCCCACTGAGCCGACGCCTTGTGACAATATCATCGTATTCGATGAAGGCGCGGGCCTGTTCCGTTCCTTCAAGCCAC
>30
CCAGTCCTTGTTCGCTTGGCCTAATTCACGTTAAATACGATGTCGCTGCGATGAATATGGAGTAATGGAAGCGCGTAATGCTTCTATAGCAGAGGATTTGTTCAGTAAGCGAGCGCGCGCTTCAATAGATTGCCGGCTCAGAAGTATACCGCACAGAAGCTTTGTCCTGGCATGCCCATAGAACAGCACACATGTCGCGTATGCGTCACGTTCACGCATCAGGCGATATCGTTTAGCCCACCCATACAAATTCGGTTCTCTTATCGCTCTGCGCTCGGTCTTCGCTGTCGGCTCCGCTCTGCGGCGGTCAGTCTTCCTGTTTACCATTGCTTACATCGATCCGAAGCATCCGTTCAACCTCCGACGGAAGGTCGTTTTCTGGCTCGTGCCGCATTCGCCAGAATTCCTTAACGGGAATAAATCTTTCTTTTCTTTGTAATAGTGTCTCGTTGTGTCCGCAATGGGAGAAGGCCGCAGGTTTGAACCGCGGTTTTATCCTCGTCGGGATTTTCAGCGTTTGAGGGATGCACCCATTCTGGCGCTTTTTATTTGGTTACGACCCTGCCGCCTTGCTGCTTGATAATATTCATTCTGACGAGTTCTAACTTGTAGTCATTGCCGTTTGACAGGTAACTTTGTAATCTCGCTACAGTTGAGAATCGGTGATTCGTCCATTGGTTTATTCCCAGCTGTCACAGTAGCAAGCAGCACTACTTCCTTAAACTGTCGCTTGGTCAGATCTGCCCGAATAAGCCTCTACCACCAGCATATTTACTCAGTCTGAGTAACCATCGAGATCTGCCACATTACTCCTGTCCAACAGGTCTCTATGCCGAAGTTGAGTATTTTGCTTATTTGTCATAAGCCGAGACTCGAAGCGGGAGGGAACTCCATTCTCCGGTTCCGGCCGCTTGCCCGGGCGTTGATTAGTGAGAATCGCAGCAAATGTCGCGCGCCAATCGAGCCATGTCGTCGTCACGTACCGCATTCAAGAACAGCAAGCAGCATTGAGAACTTTGGAATCCAGTCCCTCTTCCACCCTGCTCAATGCGACTTATCAACGCCACAGCTTCCTGTCTTCCCCGTTCCAAGCATGCGATTTGTTAAGCAACGCACTCTGGATTCGTAGAGCCTCGTTGCGTTGTTGCACGAACCATATGTAATATTTCCAAAATAACAATTGATTGAATCTTACAAATAAATGCAGCCCAGGCTTGGTTTAATTTGATGCCCTTTCAGGCTGGAATCATAGGGGTTATTTATGCTGTTGTTTTGTAGAAGCGAGCGTCCGCCTCCGCATAAACGCTTCCATCAGCGTTTATAGTCAAAAATCTTTCGGCCTGCATGAATGGCCTTGTTTAATCGCCATTTGATACGCCGAGATCTTTAGCTGTCTTGGTTTGCTCCGATATTCTCGTATTTCCGGATGCGTTGTTCAGACAATACTGCTCCTGCGTACCGCCAGGTAAATAGTCAACACGCACGGTGTTAGATATTTATCCTTGCGGTGGAGTTACTGACTTGAGCACAAAGAAACCATTAACAACAGAGCAGCTTAATCGCACGTCGCCTTAAAGCAATTTATGAAAGAAAAGTGAAGTGGGCTTATCCAGGAATCTTCGCGCCGAGGGAGCAGTTCTGCTTTATTTAATGGCATCAATGCAGTTAATCAAATTAGCCCGCATCTTGCTTACAAATTCTCAAAGTTAGCGTTGACGAATTTAGCCTTCAATCGCCAGAGAAACCTACGAGATGTATGAAGCGGTTATGCAGCCGTCATGTAGAAATGAACTCTGAACCTTTTCTCATGTTCAGCAGGATGTTCTCACTAAGCTTAGGACCTTTACCACTGATTGGAGATACCGCTCAACAGTGCATTCTGGCTTGAGTTGAAGGTAATTCGATACTACAACGCACCAAACATTTCATGACGAATGTTAATTCTCGTTGACCCTTGAGCAGGGCTGTTGAGCCAGGTGAGTATCGGAGAAGGAGATCCTTCAGAGACCTGGGTGAGGAGCGGTCAGGTGGTGTTTACATCCGCTCGATCTCCCGGGTATTCTCCATGCAAGGTCGAGAGTTGTTCCGTTGTGGAAAGTCATCAGTCAGTGGCCTGAAGGAGACGTTTGGCTGATCCGGCAAGGTGTTCTGGTCGAGCATAGCTGATAACAATTGAGCAAGAATCTTCATCACGAATTAGAGGAACCGTCATCAACCGCATCAAACATGAACCCGTTACCGATCAACCGACGAATGGTTTGAACCGAACCGACTGTACCGAAGCACTAAGGAAAATAAACGGAACCAAGCATCAATAAACCTGTTGTCTTCCTTAATTCTCTTACGGTGATAATCATGCATGTTCCAATGGGAGCGGAGCCAACCGAGAAGGAGGTGGAAATTTCTGGTCAGAACAAATGACAAGAGTCTGGTTCAGAAGATAAATCGCTCTAAAGCTTCAGTTGAATATTAAGAAGCCCTCGCAGATGACGAATCATTGGGATTCCCATCTTTGTTGTTGAAGGCGACACCCATTGTCCTGCCGAACTTTCGCTCCTCCATCCAGTCTCCTTCGCCGTGTTTAATCGGGAAGGAATGTCATTAAGCAGTGGAGAGCGCGTTCAGTAAGGATAGGTGGAGGGGAACTCACCAAAGACGATGTTATGCATATGCATTTCATCGAGACTGAACAACGGTGAAGGTAGAGACAAGCTACCTGTATTTGGCGATATTAAAGTCTTAGGGGCAACAGATATTGAAGGCAGCTTTGCTCATTACGACTCATGTCATTAAGCCACTGTCAGAAGGAGATGGGAAGGATGTATACCGTCACCTCAATTTTCAGACATTAGCCTTGGGCAAAGATGGACAGAAAGTATTTTAGCCATGATGGTGATACAAAAGGCCATCTCTCAGCGCCTCTGAACAAGGTCACCAATGCTGAGACGGGCAAGAGATGAGCATATTGGCCGCAAGAATGAAAGTATACTGGAATGTTTAGGCAAAGTGAAAGTTAAGGATTAATTACTATCAGGAGTAATTATGCGGAACAGAATCATGCCTGTGTTAGACCACGGTAATAATTCCTTACGTTATCGGCTTCGACTCCGCCTTTTCCCTCATTCCTGTGTTTCGTCGCATTTCAATAGAGATGGTCTTGGGGACATTGTCATGCAGGGAGAGTGGAAGCAATCCGTGATTGCTTCCGACTTCGGAAGCGAACGCGCCGACCGTGGCAGTATGGGTATATGACATCGGTAGTTATTGTCTCTTAGGTCCGTTATTTGAGCTTGAGCTTTGTTCCGTATTGCTGTCTGTTCCAGAGGGACGATAATATAAGCTCCCATCGCCATCACCCATTGCCTCTGCATCGTTCATTCATATGCATCCTTGTTTTCAGACTATAATTTACCATAAGAACACAAGAATAACCGGCCTCACCGTCCTGTCCCTCTAGAGTCGCCCCCAAAACACATAACCAATTGTATTTATTGGAAAATAAATAGATACAATCAGAAGCTAACTCACGCCTACCAAACAATGCCCCCTTAAAAATAATTCATAAACATACAAGACCATCCGGTAATTATCTGGCGGTGTTATCCTATCACAACCATGATGGGCCATCAAGGACGCACTGACCACCATGAAGGTACTAACCCACTTCCATCGCTATCGCGCGACGCAGCATTCAAACGAGCGTTGGGGGTGTGATACGAAACGAAGCATTGGCCGTAAGTGCGATTCCGGATTAGCTGCCAATGTGCGTAGGGGGTTTTCGTTCAGGACTACAACTGCCACATAAGGACGACTGACGGAGAATGCCGTAAGCCGCCCGCGAACGTCGCGCAGAGAAGCTAGCACGATAATGGAAAGGGAAGGCAATCCGGCGAGAAGGGGCACCAGTTAACCGCCTATTCTCTCTAGCATTGAATGAGCGCAAACCGAAATCACGAGTAGAAAGCGCACTAAATCCGATAGTAGTCAGGGTGCTGGCTGAATACCACAAACAGATTGAAAGCAACCTGCAACGTATTGAGCAAGAATCAGCGCACATAGATCAGCAAGCCTGGCAACGGGCGGCATAACATGCAGTACCTCAGAAATTGAATAGAAAATGCCATTCCGTATCTAGGTCGGTGGCCTTAGGGCTTTATCTCAATATTATATGGATCTATAGCCCAGCGACTAATTCAGTCCCAGTAATATCCTCAATAGAAGCCTCCTTCCTTTCCCTTCCCATCGGAAAATTCTTTCTACTAATAAGCTCAATCAGAAGCTAAGGGAGCTTTTGATGTAACCACATACTTCCTGCCTTCAATCAAATCAGCCCGCCCCTGGCCGTGATATTTAGGTTTGAATTACCTTAATCGCACTTTATCGTTTGCATCTTGTAATGCGTTTTCTTAGCTTAAATCGCTTATATCCCGCTGGCAAGCCTGATAATCGATGCACGCTTAGTCTAGAAAATGCAGAGCAAAGCACGAACATGCCACATGAGGAAGCCGATCCATTAACATATTCAGGCCAGTTATCTGGCTTAAAGCAGAAGTCCAACCAGATAACGATCTACTCTCCATATTTAAACTCCCCGAGAATGTCATTACCTGGAACACTCGTCCGATAGCAGTGAGTCGATTTCCTCTACTCGTAGGTATGTAGGATTGTAACTTTATCCGATTTCTAGTTAAAAGAAGATACTACACAATCTTTACTACCGCAATCCACCGTGTTAAGGTGATATATGAAGAAAGAATTTGAAAGAGTTCGAAGAGCATCCTCAGGATGTGAGTACAGATCTATCCGTGACGCCTCTGCTCTAGATCGCTTCTTGATAGATTCAGCGATGCAATGGATGCAATAGCTGCAATCGAATGCATGGTTAAGCCTGAAGAAGCCTGTTTCCTGTAATGGAAGATGGGGAAATATGTCGATAAATGGGCAATACGAACGACGCAATGATTGCCAAGGCGTACAAACAGAACAACAAAGCTGCCTGATAGTGGCCTTTATTTTGGCATAAATAACAGAACTAAACATGCACTGTGTGATTCCGAACGATGGAGGCTGAAGAAGAAGACGTGATTGGAAATCTTCTTTGCTCGATTACAAAGGCGATTCTGTACCGACTGAGTGGCTCGACCGGCCTTGAATCTCGACTCCGAGTAGCATGATAGAAATTGAAATCGACCATGACTTAATGACAGAGGAAAAACGTGCCAGATTAATAATTTCTGGTCAGACTCTGAATACCGACTCAATAAACTCTAGGCCTGGTATTAAATGCTGTATTAATCGATGCTGGCTAACATGCTCTGCTTAGCAATTTCAAGCGACTTAAATGCATATGTTGTGTGAGTTCGACTCCTTCGGAATGGGCTGCAGTGATGTCGGTTCGAACCGGCCGTATCGCGGGGCTCCGGGATCGGAATCGCGCTCCATCGCAGGAACTAGAAGAATATCGCCCCGCTCGATTAAGTTTTACCGCATACAGACTACGCTTCAACTAAGCCCGTTTCGTCCTTATAATAAGGGAGCACCATGCAATATGCCATTGCATGAGTGTTCGCTGCCTTCCGCGATCTTTACCTTGAACGAATCACCGTAAATTACGTGACGATGGAAACCGCCTTATCGACATACTTAATTACACGGAGTTAGATGGATCAAACACTTATGGCTATCCAGACTAAATTCACACTTTATTGGCGATGGAACTTTCGTGAGAGCCGTCGGACGGTGTCAAAATGGATATTAATACTGAAACTGAGATCAAGCAAAGGATCATCCCTTTCCTGTTTCCTAATCAGCCCGGCATTTCGCGGAGAGTGGCAGGAGAATTCAGGAGTTCAGCCACGACCGGTGGTCTAATTCAGGATCGTCTTGTGAGGCTCAGAGCCTGGCGCGTCGTAGACGAGCAGCTCCCGTGAAGAGAAAGAGGCAGAACTGGCAGACGACATGGAAAGGCCTGCCCCAGCACCTGTTCGATCGCACTTCCGCTCCGTTGCGCTCCCCTCAATCGATCGCGTTGCGTTGCTCCTCGCCCGCTTGTTGAGTTTCAGGAGCGCATGGCAGAAACACAATCGGTACATGGTTGAACCATTGCTCATACCAGGTTAGTACTTTACGCCAGGTATAAAACGAATGAGTACTGCACCGCAACGGTGGAAGCTGGCTGAACGTCGCATGGATTCGTCTACTCCACAGGAACTGATCACGCGATGGCCAGAAGGCATTTAAAGTGATGCCAGCGATGCGCAGTTCACGAATCGTTTACATCAGTACCTTAATCCTGAAAGAAATTACGCCTTTCCTGATAAGCAGAATGGCATCGTTCCGGTGGGCGTTGATGAGTCCGAATAATGAAATACAGTTTGATGGCATGATTTTGAGCAGGTAAATGAATCCTGTACGGTGCGCCCACTTTACCTCGAAGGGTAATCGTATAGAATGCGTTACCCCGGAATCATCCAACCAATGCGCCGGATGGCTTCAAACGAAGGCAGAGGAGAAGGGAATGGGGCCGTGGCAGTCGCATCCAAACGATGTTACGTCATAACCTACTCAGAGTGCAGCTGGAATGGGGGATCCGTGCTGGTATCGCTATCGCCGCTCCCTCCATCGCGATGCGACTCCTGCATACACTGCAGAACGTCAGCCGACCGACATCACTCCGGTTAACGATGAAACCATGCAGGGAGATCACTCTGCTGGTGATCGCTGGATAAACATGGATGACGACTTATTGCCGCTCTGTTCCCAGATATTTCGTGCCGCGACATTCGTGCATCGTCCATGACAGACGAAACGAACCCAACTTGGATTCCTGAAACAGAAAGCCGCAGAGCAGAAGGGCAGCAGGTGACACCGGACATTATCCTGCAGCGTACCGATGGCTTGGAGCTGTCGAACAGGAGTGCGTGAGGGACAAATCCCTATCGGCGTCATCACGCCATTCAGAAGTTCACAACGTGATAGCAAAACCCCGCTCGAGGAAAGAAGGGCGGAAGGTACTTCCACATCCTTGCTTGGGTTTGCACCCCTTGGCTCCGGGGAAGTTAACGCTAAAGCATGGCCTGGGGAAAACAGTACGCGAACGACGCCAGAACCCTGTTGAATTCACTTCCGGCGTGAATGTTTACTGAATCCCCGATCATCTATCGAATAGAAAGTATGCGTACCGCGCCTGCTCTCCCGATGGTTGATGAATCGCAACGGCTTTAAATGAAATGCGCGTTCCTCCGCTTCGGCGTCGCCTCGACATTATTGGTTTTCGAGAGGCCATAAAGTCATTAGTAAGTAGCCAGGTGCAGTACAGCATGTGGGTATACGCGATAAACGCTGGTATTTGCCAACTATACAGTGGGCTCAGTGCAAGGCATTATGCAGTAGGCGGCTAAGAGAGGAGGAAACGGAGCAGTGTTGACGATCGTGCCGAGTCATTAACGAAGGTAGACAGGCAAAACGGGCGGTTAGTTTGTATTTTGGGGAGCCAATGGCGATACGATCTAATAATATCAGCCCCGGGTGGTACCACCTTTCGTCTATCTAGTTATTCAAAACTATAGAGGCTGGGTCCAGACCTTCTTTATCCGCAGAGTTACGGCGGACACGGAGCAAATAATAGTGAGGAGAGATAAATAAGAAATAGTAGAGGTATGCACACCATCTTCTTTGAGTTGATAGAACCAGATATCGATGGCTAATAGTGTAGTAAAATTGGAATGCCTGTTACATCTATGAGAGCAGAGTAGAAACAAAGAAGTTCGACTCGTCCTCGCGGGTACACGTCGAGAAGAAACCAGGAGAGAGAAGAGAATAAGATGAGAAGTTAGTAATAGAATCGTGGCATTTTCTTTAAGACGGGCTTTCATATTCTGTGTGGTCGGTGCCAACATGTAACACGTTTACATCACCTACAGGAAAGCCCTTCTGACCCAGCATGTGCCGTCAGGTAAGGGCACCAACTAAGAAGGAAGAAGTTCCCTAAGATAAAAACGTCAGTGACATTTGCCGTAGATTATATCGAAGCACCCAAACGGTAAAATATCCCATTCATAAAGTT
>31
AGGGTCGTTCTAATCTGTTAGATGACCAGATCTTAAGGATAGAGACTGTGGGTATTGCTGGCTAAGGGTGTAGATAGTTTGTAGGGCTGGGCGTCAGGCAGTCCCACCGTGCAACAGATGGTATGAGTGGAAATTTAACGCGGTTATTGAAGGACCGGTAAATAGAGCGGCCCATAGGCGTATCTGTACTGTGTGTTTAGTTCGCATTGACTTTTACCAAAGAGCCAGCGTACGTGGGGATTGTACCGGTAGCGGTAGCTAGAGGTTACTGTCGGTGCCACAATCAGATAAGCATAAGGGTAAGAAGGGTCGCAGGCCGTTGGCCAAGACAGAATATGTATGAACCACGACGAGCACGAACGCGTAGAATAAGTCCGTAGCCCTGAATTTACTCCACATGACCTAAGGGGTCGCATCCGGTTGAAGCCCAATACATTGTATCGTTTGGCCGGCGTGACCTGAAGACGGCCTGGAATCGAACCGGTACTGTATGCGTCCGTACTGGTGGCCCAATCGTGTGTATGGTACAGAGCCCCGTGCGGGCGGTAATGAACTACAACGGAATTAAAGGTGACGTCGTCCCCGGTAGGGGTAGAGTCCTAATCGTTCTTTCGCGGGACAGACTGAATCGTTGACTTGTGACGAGCTGTAGGCTGGTAAAGGCCAATGTAAAGGGAGCTTTAGATGTCATTATGTGGTAGGTAGCTACTATTTTGACTTTCCGACGATTTATAAGCGCAGTAACAATGAACTGAAGAGCACTGGATATAGGCATTAGGCTTCGGTAAAGTACTGGAATAAGCTGGCGTACGTCGGATTGTTGACTGAAAGCGGGCCCGTTAAGCGGGTAAGGCGTGACATAGATGTACCCATTCAGGGGCTTTTGACGACCGTAAAGTAAAGAGTCCACTAAGATTACGTCCTACGTGCACCGTCGTCTACACACGCGGCCATGGGTATTTAAAGTTAGATAGTCTGTTGAACGGCCGTGATAGCCCCGATTTGTATCGTGGGAATTGGTCAACGAACAGGATTAAGGATTAGAGGATATCCCGCTCTAGATCGATTTAAGGGACCTGCCCCATTAGTCCTACGGCCGTGACGATTTACGCGGAACGCCAGGCTGACTATTTTTACAACATCACTTACGATTGGTACGAGTGGGTAGCCGTACCGTGGCTTTTAGCGTTAGATTGAGTAACAGATGATAACCAGGCCACGTGCACCATCACAAAGCCTGCCGTAGCTCGTTACGTCCAAGACAAATTAAAATTAGGCATTTCGAGTACAAATTAAGGTCAAACCCATGAAACAGACAGAAAAGTTTTATGACTAAGGGGTAGATGTCGCTTATTTCGTAGGGCTTACACGACAGGGGCGGACTTTGCCCTGTGAACGATCGGCCGGCGTATTCGATGGTCCTAAAGAACTGAGCAGAAAGCAGGTGATGTGACTGTTCGAGGCCGAATTGGTGTAGCCCGGTACTTAATGGGCCAGCCGGCCAACTATGCGATCAGATATTTGGGTGTGACTTTACCATCAAGAGTCCACCGTCCACTGGTGTCCCCTGAATCGGACGTCCACAATCGCGTAATGTCCGCGAGGTTTCGATGATACCGTAATACGGATGGGCTCACTTCTAAACGTGATAATCGGGTATGTAACCGTATAACCAGCACCATCTTGAGGTGCTTCGACAAGCGGTGGGGTGGTCCTTTTTGGTCCTGGCCCATTTATGAAACCACGCGGATTTACTGACATGAGTCGAATGACAGTATCGGACGGGTCGATAAAACGAGAGTTAGAAGGACAAATGGATAGCCACGAACACACTCCGTACCGGCATCTAAGCCATCCTTCCGCCGGCTTGCACGATTTAGCCGGCAATCCACCTGCGGCTGAACGGGCTAAACCATCGGAATGGCACTTCCGGGGTAGACTTGGCAGTTAAAATGCGTCATGAGGGTCCGTGTATCGAGCCGATTGTGCCGGGGACTATCTATCATGACCGTTGAACGTTCACCGATCGCCCGGCCGCGTCGAGGTGTAAAGTTCGGAGAGATGTTACACCTCGGTTACGATGAGTCGTGTAGCGCAGCCAGTGCTAAGTTCGAAGGCTCGGAGCATTACTCGGTTGGGCCCGGCTGAACCGTTCTCGTCGGATCATGGTGCTCGTGGTTAGCGTAACTCCAAAGCCAGACCCCATGAGACAGACAACCGTACGGTAAGAACACCTTTCTACGGACAGGTGTTGCCCAAGCATGTTCTGCACCGTTCTGTCGGGGTAATGCTTACGCTTTTATAAGAATGATACGCCCGGGCACGGTATGTCCGTTGTGTATCCGTCCTGGTAAAGGTGTTCTGTGACGCCGGGCGTGCTTTATAGAATGGGGTAACTGAAGAGGGTACCGTAAGAAGCCGAAGGGACCGACAATCTACGATTTATAGCTTGGATGAGGCTAAAGCCGATCTAAATCGATCTGGTGCGAGGATTATCTATGAACCCGTCTTAACCCTAGACACCAAATATCCCAATGGCGTCTCCGGTTTCGCGTACTGTATACGCAGCCGCTTTACGTACCCCGGTGGGTAAATCCTGTACGCCGGACCCACAGGACTACGATACCCACCAGTCCGGCTTTAAACAGGACCGTCTTAGTCTAGATCGTGGCAACATAGTGACCGCGGCTAGAAGTACCGGTAATTGAATTAGGGTAACTGTCAGACCGAACCGGTCTGGCACGAAAAGACAAGAGTACCAAAACAGGCCATTACTGTAGCGTATGGTAATTACCACCGTCCTGGCGTAAGCCCGTACCGACGCCCGCATGAAGACACATAAGACAAAACGTCTGCTAGCTACAATCGAAGTCCGAGCGAACGTTAGATTCGAACTCACGACGCGTTCGGGCAGGGGTGACGCCACTTACCATACTGGCCGTAAGGTCTGCCGGCTTACGTCAGGGTACGTAGACCTAAGACTACAACAGGCGGGGTCTGGACCGGACGTCCTAACCGGTAATAAAAGACAGGGATGGGTGTCTGTGTAGCTGTGGACCCATCGATCTAACGCGGAATCTTCGCACTTATGGATAAATCTTGCTTAGGATTACAACCGATTGCGTTGACAGAGTAATGACGTGTAGGGACCGGAGCCTAATGGGTCGGTACCCGACATCCATTGATGTCCGCCATTTTATCTATGGAGAATGGTCCGGCCGACGTGACCGGGCACGCGGCGTCGTGCACCGACGACCGTCGGATAAGATCCTACTAGAATGATGATGGGTTAGCGATGAGCGTCCAGCGGTCTAGACAGGCCGACGCCGACGGCCGTTGCTGTAGGTGAATGGGATACGACAACGAGCTCTAACGGACACCATTGTTAGATACGATAGATTGCAGGGTACGTCTACTGTTTGAAGACTGCTTGGGTCGCACCCGGCCACGAACACGATGTGATATTGAGGCCGAACAGACCTGGAACGACGCCGAGGGTATAATTATGCTTTGCACCGGTGGGCTAGACGTGGGGTCGATCGATGTGAATGGTAACTGGTCCGGTGTAGGGTTGACGTTATGACATGCTGACCTGACGAACTGACGCGAATACTACTCCTCGGAAGGGGCCACTCGGTGAACCTAAATCCACTCTACAGTCTAGTAGTTACCTAATGACCGTGGGCAGTCAAACCGTCAGTTCGATCCCCGGACGGGTGCTGAATAACATGTTCGTAAGTCGGCACTTAAGCACCCTGATCACGCCCTGGCTGGGGAGAACCACGACGTTTAAACCGTATGGCCATTAAAGGACGGTACATCTAAAAGTCAGCTGTGCACGCGAGCCAATTGACCGTAAAGTTGAATGGGAGAAGCGTAATCCCGCCTTTGTCACTAGAACCACCACAGTACGATTAAAGGGGAAGGGGCGCGGCCGTAAACTGACAGATGTATTAAGCGTGGGTCGGGCGCGTCGACGTGACAGGCACGTAAGCGTACATGGTCGGATACCAGAATGACTCCACGACGCGGAACAAGTCACGCTGACTAAACGCAACGGCCGTGCGTCAAACTAATTACGAAGTTCGGGTAAAGGGTAGCGTTCGCGTACACCGGGCCACCCGTCGATACTGGTACCCCGTAAGCTGGTTCGACGACTACCGGGAGCTAAAATCCAAGGCGTTACCCAGCCGTGGCGTTGACTTTAACGTCCAACAGAGGGCTGGTCCCTAAATACCAGCCGATTGTAAATAAAAGAATTTATCGTCACGCTGATCACCACAGTCCGAGCCATAGAATCCGGGTATTATTAGTTATGGTACCCATTGACACCGTGTAAGCATTGGTTACAGCCGTCGGTCGGGCTTATCTAATATCGAGCGGATTGACGACGTCAGGGCAGCGATTAGAAAGGCCAATAACGTATAGAATCAATACACGGGGCTAGTGGAAAGAGGATTTTACGAGTAAGTGGATGAATGAGTTGGGTGCCAAATCGGCCCAACAAAGACGTCAAAATGTTAGGGTCCTTACCTGAGACTAGAAGCGAATAAACGCCCATTTCTGGTCCGCCAATGGATCTACCGTTGACCGTAAACGGGGGACTAGACGATGTTTTACGGGCAGCAGGTGCGCGACAGTTGAGGTATGACGAATCCCGGCTCGTAAAACCTGAGCCAGTAATTTTAAACCCCGGCCGGAAACTCACGGAGAATAATGAATGAATTACTGCCAAATAGGAGTAAGGGCGTAACTTAGGACCTGGACGTTAATGGCAGCCGTGACACTCTAAAGCCAAACGTACTAGTGTAAAAAGGCTCCAACATGGTTTAAGGCCCCACGACAGATCGAATTATCGATCCGTGATGGGATCCGTACCGTGACCGGGTGCTGACGTTGTACCGAGTATATGTGGTCTAATTTAAAGTAAGGATTAGTCATAGTAAGGCACGTATTGATGTGTTTGACACGGTTGACGCGTGAGTCTTTATTAGCTCTTATGGCTGAGGACCGTCTAAGTGTCCCGGTTCGGAGTGAACCCACCACTTGCCTGGGGAAAGCGTATCTGACGTCCGCATGCGTGCCGCAACCGTCACTCCATATTTCAGCCATTGGCCGTTGGATGTCAGGTTATGTGAGAACAGGCCTGGTAAGGTTAGGTGTGTCCCGAGGTCCACCGTTGACGCGGGGGTCAAAACAGTAGTTAGTGAACTACCTACTGATCTAATTTTATTGTGCCGACTTAAAGATCGATCGCTGAATACCGTCAGCACTTAATCGTTGACCGCGGTCCTTTGAGTGAACGCGTAAATTACGTGCGTCGTCAGCGGTCGTACTGAGTACGTACCGTACCGGTCTCTGAATGAACATTGGCTGGTCCCTGGGTTTACGATTACAGAACAGGGGTTGACTCGGCGGGTTTCAAGCTATCGTGGGTTCTCTTAACGGGTGGCCGGCCGTTGACCGATGAAGTAAGATCCATTCCTGCGCATCACATCACCGTGCTTGTGTGTTACAGTCCGATGCCATTACACATCGGATAGAATACCGGATCTAAAGCCCCGGGTCGAACCGGGTACCACGATTGGCTTACGATCAAGTGAGAAGCTTGGTCAGGTAAGTCCGTGATTCTTATTACCCTCGTGGGTATGTAAAGATTGAAGCGTTTAGTACGTTGCGTACTGTACGAGCCCATTTGGCCTCGCCCCGGTAACTGATGAGTTGTAAACAAGTGACAGGTCGCATTACCGACGCGCGAGCGTCAGGTACTGACAGTTTGAGGCCTGACACGGAAGAGGGAAGGGTACAGGAATCGCAGTCTGACCAGAATGAATAAGCGGGCGTGAATAGTGTAGGTACCCGGTCGAACCGGCGTACTGATGATCTACGTTTCCGCAGGGTACGGTAGCCCCATTGGATTACCGGACATAACTGTTGACGTTAATTAAAACCGGGGTACGAACCGGGAGGACTTATGATCACTTTATGGTCCGAGCCTTAACGCGTCCGTGGCGAGTCGAGGACGAGCCCGCGAAACAGAGGACGACGGAACCATCCTAATTCATTAAGTACCCCAGTCGATGCCCTGTGTATCATGACGTACCATAACTACCGCACATACGAGCCGGACAGCGTCTAAGCTGAGTAGGTTGGGCCCGGAGATTAAGCCAGTAAAGGCACTGAAGGCACGAGCTAAGGCCGATCTACAAACGGCCGATGCCCCGCGGTAAAACTATAGAACGAATTTGTCAAGTTGTCAAACAAGAGATCCAAGGATGGTGCTAACCGGGATGAAGGGTCTACTCACCGAACCCGGGTACGGCTAGCGTAAAGAGGTAGTACCAAAGAGAAACGAAGCAGAGAGATGAGCAGCGAGCGACCTCCGTAAATTCGTCGATTAAAAAGGGCCCATTGGTAAAACGAGCGTACGAAGCCGATGGAAGTCACTGACGCTACAGCGCCTCGACTTAGAATGAAAGGGCGGCGGGCTCGTACGTAAGCATACGAAGGACCCACCGTCGGGATGCGTCGAGCAGCATTGGGCATAAAGCTTAGATACGGTGAGATCGTAAAAGTCCAAAACGACGTCAGATATTGCCTGCTGTGGCTTAGGACACAAAGGAAGGGGACGTCATAACCACGATGCTGAACGAGCGCTAATTCCACCTTACCAGGCTTTTGAACTTAAACCCGACCGAACAAAACGATTAAGTAAACAGCCCACGCACGCGAACGCCAACAGAACGAGGGAACACCAGATCGACACCGGATTCTACGATTGCCATATGTTGTATCGACGAATCCGTAAATACGACTACTGACGAGCTCGGGACTGTACCATTTACCACAGATGTAACGCCTTAAACACGCAGCAGAAATCGGTGACATCGAACGTCTAAGGGGGCCTGCCCGGTCTAAATAAAGCTCCTCTATGACTTACGATCCCACGCTGATCTGACCGCACGATCCGTTGCCGTATTTCTCAATCGTCTAATCATGACCTCGATCTAGAATTAGTGGGTTCAGATTAGCGTCCGATCGGGAGGGAGGCGGAAGGAACTTAAGGTGACGCATTTTAGGACAAACCTACCCAAAATGTATCTTTACCATCCGCTCGTGTTAGTATCGAAGCACAACCAAGGGCCGAAAGCAGGGGCGGTCCTTGATGTCCACGACGAGCCGGCCGTACGGCCGCATTTAAGTCATCCGTGCACCGGTTTGGCGCTCACGAATAATTGGTTTCTTGCCATCGCACGAAACAGTTTTAGATTACGAATAAAGGCACGACACCGCGGCTCATCTACAGAATGCCGTTTGAAAGCTCTAATGTCGGACAGCGCTTAAGCATCTTTACATGACAGTTCTGTATACGTACCATTGACATAAAGAGACGAAGTGGGCACAGGATTTGACGAAATTTACGAGGCCGAAAACCGTACCGGGTACAGGCCCGATTAACAGATTTAAAGTCCGGTGCTCTTAGTTGAACCGGGTACTTATCTGTCACCCATCGCGTTGTATCGGTCGCTTACCATTGGTCGATGTGGTCCAATTAGCACCATACGCGTTAACGGTACGTAACACCTAAACAGGGTTAGAATTAGTCGTCTGATAATCGTACATAGACCGTCGAACAATGGACAGTAAAGGGGTTACCCTTGATGACTAAGGACTAGCGTGACTTAGATGGATATTCTGAGCTACCGTTTCTTAACCTACGATTACGATATCCCCGACTGTCGCGGAAATGGTTGTGTATTTCTAAGCTGACCACCACTGGGTAACGTGGGGGCTGAACTAGCCCCGTGACCGTGGTCGAACGGCCGTTGATTGGTTCGGCCGTTCGTTACAACAGATTGACGACATTTACCCCTAATGAGGGGGATGAATAAAACTTAGAGCCACCAGGGTTAGGAACAAATGCCGGCCGCAGGAGAGCTATCGATGTAGCCGATGATAGATTACCACTGTGAAAGTGAATGACAAGTGACAGAAACGCTTTGGGTAAAGCAATGGATTTACTCGTGTCTGACTAGCCAACTATCGTATGTTGGATGTCTGAGCTTAATTTTGTGTATCCCCGAACCTATTTGACGACGGTTCCTTTGAGTTGTTGTAATCTTAGGTAGTATCGTTGGTTTAGTATCTTGAGAGAAGACTGGATTTATGACCATTGTGCTTGTTTTAGTAAGAAGGTCAGAAGCGGGTAACGACGACTACTTTCGTGCTGTTCTAGTCTCGTCTGTTCTAAAGTCGGTTCTTGGGTTTTGACGTTGCCGACATCGCTTTTATTTGATCAAGTCCATTAAAGGTTCTACTTAAGTGTATGTAAGTTCTGAGCCTGGTTGGTTTGCTGGCCTATGGTACCAAAGCATATAAGGGTGAGCGGAGTCTTTGACTTTAATACGCCAACTATTTGGCTGTATCTTACAACTTTGCCGGCCTTAAAGTTTACGCCGAATGTAAATGTTCTATGTACTGTAACCGTTGTAATTCCGATCGTTTAGGTAACCGTCTAATGCTGAAGGTCGTCCCTGACTGTTGATACCATTTTTAGACTTTACTTGAGTACTTTTGGTTTATATCCGTATAGACCCATTATCTAGTACTTGCTTTACGATTGTAATATGCTGAGATAAGAGTCGACTGTTAGGGATACCCGAGCTGCCCGCGTATGTTCTTTACAGAGTACATGAGTCACATTTAAGGTACACCGGCTATCACCTTAAGTT
>32
TCGTTTAACCTTAAGTCTTCCGCTCATCCCATTCTTCAGTATTGGTTCACGGACACACCATCACCCGTTAACGCTGCGGTAACGGCGGAAAACACCGTCAAAACATTGCATTTACGAGCATGGGCGAGGCTTGGCAGTAAGGGGCATCAGAAGGGAGGAACAACCACGGACCATAAATTTATAATCTGCTGACGGAACTAGTGGCATCGAATTTATTGGTGAAAGGTGACGGCATATTCCGCCTCATACGTCTGCCTGCAACAGTACCGATATTGCATTGCACAGATTCCGGCTGGCTTTGTGCTGTTCAACAGGTGATGAGGCATCGTGTGGCATCTCGTTGAAAGCCATCATCGGGTAAACCGTTGACGTGGGTCATTCCGGCAGCGACGCGTTATTTATTTCTGAACTCGGTTATCGTTACCCGCAAAAATTTTACCTGGTTATCGCCCGGGAGGGGAAGTAGAAGTGGAACGGCACAGCCTGGGTGAAGAGTACACGAAGCAGAAAAACTGATGAGATCTGTGCGGAAGCGGAGGAAGAACAAAGCCTGATGCAGGTAGCCAGTGAGCATATTGCGCCTTCAGGATGCTGCAGATCACTGGAACAATTGCAACGAAGGAAGAGATGAACCTCGTTGCTGAAGCCTGGAAGAAGCTCCGGCTTCTGCATTCGGCTGCTGTTGATGATGGGTAACTGCACTGATATTGGCTGGCCTGCTGTCCCTGTTATCAGTAATCGTTTGTAGATATGCCCGGCAGAAACGTTGTATGAAATAACGTTCTGCGGTTGTTAGTCGGGCTATTGTAAAAGCTGGATAGATATTGGTTATTTGAGATTATTATCTTCAGGAGAATAATGGAAGTTCTATGACTCAATTGTTCATAGTGTTACATCACCGCATGAATTGAGGCAGACCGACGCAGGAAGAGGGAAGGGTGTACATCCATGTTTGAGTCTGCTGTTGATATTTCTAAAGTCGGTTTAGCGTCGTTTTCTGTACCTACTTTTCTCATGAAATACATTTTGATTATTATTTGAATGCTCAATTCCAATTACCTGAAGTCTTTCATCTAATTGGCATTGTATGGTATTTGTGGTTATTGAATAGATGCTTGCTTTCTAGCCACTATGATATCCCAAATGAAGCCATAGGCATTTGTTATTTTGGCTCTGTCAGCTGCATAACGCCAAAAACATATTTATCTGCTTGATCTTCAAATGTTGTATTGATTAAATCAATTGGATGGAATTGTTTATCATAAAAATTAATGTTTGAATGTAACCCGTCCGTAAAGTCGTTTCTGCAAGCTTATGGAGTATAATTGACTCCTCTTCTGTCGCATGGCTCTTTTGCGCCTGATGACGCGTCTAGCCTTTAATATCTTCAGGAATTATTTATTGTCATATTGTATCATGCTAAATGGACAATTTGCTTATGAGAGTAATCTTTTAATTTAAATAAGTTATTCTCCTGGCTTCATCCCAATAAAGAGTCGAATGATGTTGTAGAAATCAAGTCTACCCATTGAATTGTTGGTTTGTATGCCAAGAGTTACAGCAGTTATACATTCTGCCATAGATTACTAAGGCATGTAATAATTCGTAATCTTTTAGCGTATTAGAAAGAAGGATTAGTGCGGATACGCGCAAGGAAGAGTGGCAACCCCATAAAGAAGTAATTTCTTTTGTGCAAGTCTGACTAACTGTGTTATACCAATGTTTAACATACTTTCATCTTTGTAATAAACTCAATGTCATTTTCTTCAATGTAAGATGAAATAAGAGGCTCTTTGCCTCGCTATACATTTCTAAACGCCTTACTTTCTATCGTATTGCGATAGAATTTTTAGCCCCAAGCCATTAATGGATCAGCTTTTCCATTTTCAATAACATTATGTTACCAAATGTCATATCCTATAATCTGGTTTGTTTGTCGAATAATAAATGTTGCTCTTTCTTGCGTTGCGGGATGCTACTTCAGCACTTCAAACCGAAGTAATTCAGGGTCAAATATGTATGATGCAGCATTTGAGCAAGTGCGATAATAAATCTTTAAGTCTTCTTTCCCATGGTTTTGAGTCATAAACTCTCCATTTGATAGGTTGCATGCTAGATGCTGATATTTTAGAGGTATAAAATTAACTGCTTAACGTGGTACAATGTAATACAAGTTGTTTGATCTTTGCAATGATTCTTATCAGACCATAGTAAATGTTAGTTGACAGGAAATTTTAATATTATTATTAGCTTCATTATGTATTAAATTAGAGTTGGCTTGGCTCTGCTACACGTTGCTCATAGGAGATATGGTAGAGCCGCAATACACGTCGTATGCAGGAACGTGCTGCGGCTGGCATGGTGGGACTTCCGATAGTATGGCGAGGTGGAAGGGAGTCGCGATGGCAGCCGAGATTTTACATATTTTGCATGAGAATTTGTACCACCTCCACACCGACCATCTATGACTGTGACGGTACTAGGTCCTAGGACTGCTATGTGCCGGAGCGACATTACAACGTCCTTCTCGGTGCGCTGCCGCCGTTGCGCCGTATACTGCCTCGCGCGGAATTCGTGGCAAGTTACTACCCGTACTTTGTAAACAGCCCTCCTCATAAAGTATTCGTTCACTTCCGATAAGCGTCGTAATAATTTCTATCTTTCATCATATTCTAGATCTCCTCTGAAAATCTTCCGAGTTTGCTAGGCACTGATACTGGTAATCTCTTTTCCAATAAGATTGGGGAAGTCATTCAAATCTATAATAGTTTCAGATTTGCTTCAATAAATTTCTGACTGTAGCCTGCAGCTGCCCGGATAAACGTTGCGGTTGTTGAACTATATTTCCTTATAATTTTACGAAGAGTTTCTTTGAGTAATCACTTCACTCAAGTGCTTCCCTGCCCAAACGATACCTGTTGGCATATTTAATAGCTTGAAATGATGAAAGCCTCTGTGTTTGTCTTCCTGCCTCCAGTTCGCCGGGCATTCGCAACATAAACTGATAGCACCCGGAGTTCTCGAAACGAAATTTGCATATACCCATTGCTCACGAAAAATGTCCTTGTCAGGTATAGGATGAATCGCTTGGTGTACCTCATCTACTGCGAAAACTTGACCTTCTCTCCCGACTTGCATTTCCGCAGGCGAATGGAAGGGAGACTGGGAGCCGCGAAGGGAAATTCCAGGATAATGTCCAATAGGAAGAAAATGATCTATATTTTGTCTGTCATATCACCACAAAATGACATTTTCATGATGAAACAAGCATGTCACGTAATATGTTCCTCGTGTTTGTTTATCTCGTAGGGAGATATTATTTCTATAAAGCTTTTCTAATTTAAACCTTTGTTAAGGTTACCAACTAAGGTGCGTAGGCTCAAGAGGTGTGTCCTGTCGTAGGTAATAATGACTGTCGAGCTTAATATTCTATATTGTTGTTCGTTCCAAAGTGGGGCGAAGTATAATGAAATTATTTCGACATTTATCTGCATCATACCTTCCGAGCAGATTTATTAAGCAGCATTTCGGTAGCAGTTCTCGCATGGAAAGAGGGCTTTTCATTGTACTTTACCCTTCATCTCCTGTTCATTATCATCGCTTTAAACGGTTCTACTCTTCTAATCCTATCTGACCATTATAATTTTAGAATGGTTTCATAAGAAAGCTCTGAATCAACGGACTGCGATAATAAGTGGTATCCAGAATTGTCATTCCACGGGCCACTCGCCCGTGTAGGCCAAGTTCTCCGATGTCTCATCTGCACTCAAGAGCCGGAATGATAATATTTATTGCTTCTCTTGACCGTGACACTTTCCACATGCAGGCATTTGGAACCTCTTGCAGTACTACTGGGGAATGAGTCCAATTGGTATGCGAAGGATTGCGGGATGGAGGCAGGAGCCAGGCAAGCTGTAAAGGCAGAGAGCAAAGGTGGATGCATATGAACCTCTGGTTCATCGAACCAAACACGATGACTTTTCGCCAACGACATCTACTAATCTTGTGATAGACTTAATAAAACAATTGCATGTCCACCAAGGCTCATTCGAAGCAGATATTTCCCTGTCATAGCACATAAAACAATTTAGTGAATTTATCATCACGTCCACTTGAATCTGTGTCATGCTACGTCTTAACTCTTCATAATTTAGAAATGAGGCTGAGTTCCACATATTTGAAAGTTTTCATCACTACTTAGTTTTAGCCACTTCAAGCCAGTTGTCTTTTCTATCTACTCGACTCAACCGAACATTAAACGCACCGATGAAACGGTCGAACGCTAACGAAGATCGCCCTTATTTTAAACTATTGCTGGCAGCATTCTGCGTGTCAAGAATATAAAAGTATTGTGTACCTTTTGCTGATCAGGTTGTTCGTTAGGAGGAGTAAAAGGATCAAATGCACTAAACGACGAACTGAAACAAGCGATTAGAAAATATCCGTTGGGATTCCTTACCTCCGATAGTCCTTATTTTCAGGGGCAAGGTGCCTGTGTTCTATTAGATTGCACCAATCATTCGATTCCAAAATTGTTGTTGTTACCACCGATGTCGCCAGGATAAAGCATGAATGTTCGTGCTGGCATAGAGAATTAACCGTTTGGACCTACATATAGTCAAATCACTAGAATCCGGAGCACTTTTCTATTAAATGAAAATGGAAAGCGGACAAGCGGCAAACCATTAAAGAAAGGAGTCCCCGCGAAACCAGGGCCCAGGAAGTGCGCGGAAGAGTTACCCCTGGACTAATGAGGTGTTAAGGACGCTTTCATTTCAATGTCGGCTAATCGATTTGGCCACTACTATTAAATCCTGAATAGCTTTAATGAAGGTTATGTTAAAACCATCGCTTAATTTGCTGAGATTAACAGTAGTCAATGCTTTCACTAAGGAAAAACCATTTCAGGGGTTGACTGAATTTATCTATTAATGAATAAGTGCCTTACTTCTTCTTTTGACCTACAAACCAATTTTAACATTTCCGATATCGCATTTTCACCATGCTCATCAAAGACAGTAAGATAAAACATTGTAACAAAGGAATAGTCATTCCAACCATCTGCTCGTAGGAATGCCTTATTTTCTACTGCAGGAATATACCCGCCTCTTTCAGCTCACCCGCCACTCCCCACTAGGCTCTGTATTCGGTAATTTTATTAAAGGACCGCGCAATTTATTTGGCGGCAACACAGGATCTCTTTTAAGTTACTCTGGTATTACATACGTTTTCCATCTAAATTAGTAGTATTGAACTTAACGGGGCATCGTATTGTAGTTTTCCAGATTTAGCTTTCTGCTTCCTTTTGGATAACCCACATGTTATTCATGTTGCATGGTGCACTGTTTATACCAACGATATAGTCTATTAAGCAGAGAGGAGCGCCAGGAACCACCGAACGCGCCTTGGAAGAATGAAGAAGCGTTCAAGTAATCTAATAAGCCGATAGATAGCCACGACTTCGTACCCCGGTTTTTCATAAGTGTTAATTCGCTCCCTCGCTCATAACAGACATTCACTAAGTTATGGCAGAAAGGGTCGCATGCTGGGTGGGAAGTCGTCCAGAAAGAAAGAAGTCAGCTGCGTCGTTTGACATCACTGCTATCTTCTTACCTGGTTATGCAGGTCGTAGTGGGGCACGACACAACATTGTTGTCGCACTGGATTGCAGGCTTTGTGCTTCTGACCTGGAGTGCGACAGGTTTGATGACAAATTAGCACAGAAGACAAATCATGCCTAGGGCATGCTCTGTTACAGGTCACTAATACCATCTAAGTAGTTGATTCATAGTGACTGCATATGTTGTGTTTGAACTTATGCTTCTTTTTATGCGCGCCAAGGTCGCAATTTTAATATATTGATATTTATATCGTTTTACGTTTCTCGTTCAGCTTTATAGAGGTTGATT
>33
GGTTGGGTGTTTACTGGCGGCATACGCGCTATTTCGCTATTTATGAAGATTTTCCGGTTTAAGGCGTTTAGGTTCTTCTTCGTCAGACTGCAGCCTTTTATTTAAAATACCCTCTGAGACAGAAAGGGCAAACGACAGGTGGCTGAAACCGAGCTTTTGACTGGTAGTTGGTTCCTTTCTCTGTTTTGTCCGTCACAATGAATGAACAATGGAAGTCAACAAAGGCAATGAGTGACATTTCGGTGCGAGCCGTGGCTAGTCAGATATCAGAAAACGGGGGATTAAACAGGTTAATGCCGATCTAGTGTAGCAAGGGTAATGAGGTGCTTATGACTCTGCGCGGTCAGCATAAATGGTATGCTTAGAAGGGGATCTGAAATTGAGAACGAAGCTTAGGCCGCCCTCATTGAGAGTGGAACAGAAAGGGGCAGAGTGGAGCTAAGAATGGGTTAATCAGAACCCCATCAGGACCCAATTGAACGAGCCGACAGGGGAATGGCGCGAATGCCGGATGACGACCGGTACGTGGAAGACCGAATTGGTACTGTTCGTTAACTTTACCAAAATGGCAGTGGCAGATTGCGGAGCTCTGATCCTGGACTATACCAGAACTCATGTATTCTCGAGCCTCCTGAGGCGCCGGCGTTTGGGCGGAACTGGAAAACCAGGACATGTTGATTTCCTGGAACAGCGATAGGCGCGAGGCTACACGCGCGCCGAACAAAGGACTCACTGACGCGCTGGATTGAAACTATCGATAATGGTATGGTGGTGGTCAAATATATCGAACAGTCAGGTATAAACCATGCGGCATTTTGTCCGGGGTGCCGGTCCCGCTCATGTTCAGGCCGTTCTCACAAGAAAGCCGTTGAATGGGCGAGTGTAAGGGTTGCTATCTCCCGAAAGAATCGCATACCAGGAACGCGCATGGGAAACACTGCTTTCACCGCGGGCCATATGAATGCGATGGAGCATGAGTACGATCCATAGTGAATCTTGAATACCGCCTGTCGGTTATTCAAAGCCAAATGCTGCTGGGGTGTTGGTCTCAGCTTTATAGAGCATAAGCATAGCAAAGAAGCCCCTTATCTGGTTGCCCTGACGGATGGCTGCTTATAGAGAACTTTATGAAGCCAACCAGCCGTTGGCTCCACTATTCGTACCAGTTATACCGTCTCTATCGCATCGCTGGCCCCGTGTGGTATGGCAAAGAGCAGCGGATAACACTGGATAGAGCGTTCGTTCACCAATGGCTTAGGCGTGGTGCTCCTGGGCTCAGGCGGTAACCAAAATAAGCGTGAGAAGTCGGGCTGTGGGGTGTGATGATTTCCTGCTGTTTGTTTGGTAGTAATATTGAACCGAAGGCTCTCTACAACGTTCCTCCTCTGGTAGACACACCGTATTGAAGCTCGTTATATCCCAAAGTCCATCCGTGGCTCCGCCACGGTACGAAGAGAGGTACAGGATACAGGATGCAGGATAAGAATGCGCAGAAGTGCTGCGTTCATGTTGCCTGCCGCATTAGGGCGAGGAAGGATGGTGTAAATTTGGCGACAAAGAGACGCCGTTTGGCTCAAATGACGCCGGATGATACTCTCTCCAGCCAGCGTGTTTTTATCATGCGAGCGCGCGAGCATAATGCCTGCCGTCATCCGCCAGCAGGAGCTGGACTTTACTGATGCCCGTTGATGGTGAAAAGCCGGGATCTCTGACAATTGTGATGGCATTCTCTGGTTTCGTCATCCGGTACGATTGAGCCCTGACAGTGTGATTTTCACATCTGATAAATTGGTAATCAGTTAGCACCACCTGGGTGCTAAGATTGTCAAACAACGGTCCGGCCGAAACGAAGGGCAGATAAGGGAAAACGTAAACCTTCGTAAACAAAGCCGTGACCTATGGAGGCGAACTTAGCGAACGTCTACATGCTGAAGATAGATGGGCAGAGCGGAAGAGGATTATTCAGGCCCGTTCCTGACCGTGTGGCTTATTGAACCCACTTATCATCGCATACTCAGCTCGAAATGCGAGGATCAACCTGGGGATGGCTCGGCTCGAGGAAAGCTCCGGCTGATTGACCGGCAGATTATTATCGGCCGCCACTAAACCATGACAGACGCTGCTGCGTGTAGATGAGGCCATCAAGCCATAAATAGATATGCCGGAATGGTGTAAGAAATGTCGATATCCGCGCGTATTAGCCAGGCGACCTGGGGCGGGATTAACGGACTACCAGGGGCAGCAGTGTGAACGCTGGAAAAACATGGGCTGTTCCGTGATCCCATGCTAGAAGCATCCGTCTACGGAAAAGGCCGGTGGACAGCATCCACGATTAGCGAAAACAAAACGGGGTTTACCTTACCGAAATCGATCAGATACCCCGGCGAACAGAGCAGATTATACGCGCTTCACACTCCACCCGACAGGGTACTAACCGCTTCCCGGTGCCGTTCATTCTTCCGCAATAACCCGGATATTTTTGATCTGACGAAGCGCAGAGCAGCTGACTGCTTGGCTGAAAGGCAGGTCGAAAAATGGGTGGATGAGGAAGGACCTGTGTGACAGCAAAGCGACCCAATGAGGCACTCGACTGCTTCGTTTATGCGCTGGCGGCTCGCTGCGCATCGAGAGTATTTTCCGATTGCCGGGCAGCTCTAATCTCGATCCCTGCCTGGCCTCCTGCCGGCAGGGGGTCTCGTGCGGACCAACAGACACAAGAAAGCTGGCAGATTTGTTCTGCCCCGTGCTTATCCGGAGAGGATGAATGACGCGACATAGGAACAACTTGCCGCTTCAGCGTGCTAGCGGGTGCCGATATGATGACAGGTAAACGGGTGAGGTAACAGGATGTGATAGAAAGACGCACGAATGGAGTTACGGCCACTTCTGAGATTAAATATTGCAGCATGATTAGAGCTGGAATTGCATCGACGAACGACAAGAGCGACGCCCGGCAAGGCAGGATTTATGTATGAAACGCCCACCATTCCCACCGGTCGCCGACGGCAGTAAAGCCGGCGCGATAAACCCGATCCCCCAGCATGAAGCAATTTACGCGGATTGGGGTCCAAGTTGTTTGCGTTGGAATCAAGGGTGAAAGTGTGATGCAGCCTGTTATAGAGCCAATTTACCCGTGGCAATGCCCGCGGACACGATCTGGTACGCAATAACGATGCCGCCAACGCCATCCAGCCTGCACCGATCATATCGTCGGGTCTGTTCCGGCTCAGTGTCATCGCCCAAGCCCGCTATCTGGGCGCGGTAGAAGAAGCCCGTGCTTTTCCCGCGTTGAAGCGGCATGGAAGAGTTTGCATGAGGATGACTGCTGCTGCATTGACGTTGTTAGCCCCAAAACGCACGTTTGAGTAGGGTAGCTCCTTCGGCGACTTGGCCCGCATGCGCCTTTAACATCCTAACTGTTCGTTCAGGCCTGGGATACCAGTTCGTCTCTAAGCTTTTCCGGACACAGTTCCGGATGGTCAGCCCGAAGCGCATCGATGGCCTAAGGAACAATACCGGCGACAGCCCCAAAACTGCCGTGCCGGTGCCAGATATTAATGACATCAGTTAGCGCTGGGGATATTACGTCAGCGAGGACGTATCCTGGCTGGATGCCGCAGAAGTGACATGGATACCCGTGACCGTGTTATTACCCGGCGGGCGCTCCTCGTTCATTCACGTGTTTTTGAAACTTAGAGTGCCGACGTATAAGACCGCCGCTTGCAAATGTTTTACAGCGTGATCTCAGCAGATGAAGATAGCCTACGGGCAGAACACGGAAGCCGCGCAGGAGCGAGATATGAAGGGAGGGTCGCTGGAGAGAGGGAGCGATGAGCTGGATACGCAGTGTCAGCGATGAATTATTCTCGTTGGGCGCAGAACAGTCAGGAGCAGCAGCGCTGAAAGGCTGAACCCTATGGACCTGGAGAAATTATGCCGGTGCGATGATCGCCGCAAGGGCACGATGTTACGCTCATGGGGAGGCACAAAGTAAGCAGCTGATGCCATGGTACTCACGTAACCTGCAGACGGCCGAGGATGGATAACGCTACTCCGTGTTTGAGCAGTCACTGCTGCCATATCTGGTATCGCCTTGTACGGGCGGCTCTATGTTCTCGTATGAGCAGCTTTCCCCGGAATTATCGCTATACCTTACTCCACGGCAAATGAGTTGCGACATGAGGATCGTGGGCCGTGATTTGTCAGTATGGGGCGGCGAAAATTCGTCGCATCCAGAGCGTCAGGCGAGCCAGATGTTTCTGTGCTGGCTGGAAGAGGCCAACCTGTTCGCCCTGGTGTGACGTTTACCTTCAAAAGCGCTTCGCTGGTTTTTCGCATGAAGCCGCAGTCTTATCTCATGGGGGAACTCTTAAAACACCTGGATAGGCTCCGGTTCTTATCGATGAGTATTGACCAAAGAAGTTCAGGAAGGGTGATGCTGATAGAAGTACCGACCGTATGGACGGAGAGGCTAGAGTACCTAAAACGCGCGCTGACACGACTATCAGGAAATTTTTGCCCAGCAGGTCTGAAAATGATCCATCACGATGTTGAGCCGCCGTTGCAGCCGGTCTTAAACCGCCGCCTGGCCCTATGCAGCATGTCCGATCCGGGCCATAATCGGGACAAGCCGACAGAGAGAGGAGAAGAGTGACAGCATATGCGGTAAGTACCGCATATTGCCCACCTGGCCTTTAATGAGCCATGATGCTTGAAAACGCTAGATGCCGCGGGTTTATTCCCTTGCCTTGCCACGACGCGCTCGTACGATCGGCACGCCCTGACGATGCATTGTCCAGCGACAGCCTGACTGCCAGGAGGCGGCCACCTGACGGCATTATCTAGATGATGACGGTGGTAGACCACGACAGCCGCAGTTATCAGGTCATGAACGGCATCGCCGTGCTGCCGGTTAGCAAGCTGGTTAGCCGGACGCGGGCGCGCTGCGCAGCCGTATTGGTAAGCGTAACCGGTTACAACGGCATTATCGCCGTCTGCAACAGGCTGCCAGCGATCCGATACTTAACGGCACTCTAGTTGATTGGACACGACTCTCACGGCACCGGCTGGTGTTCTCAGGGCATTTGACCTCTGCTGACATCATCGCCGTGTGGGACACTAAAAACCCATTGTATGGCGCTTGCCAACGACATGAATGCAGTGCAGGTCAGTTGCTTGCCAGTGCCTCTGCTCCCCGGCGTCTGGTCACGCAGAAGCCAGCTAGGACAGCTCCATCTACCGTCTACTCTGAGCGTCACAGGATTACGCTGTGCTGGAACAGGAAGTACGAGTGGAACCCACAGCGTACCCGAAGGTAAGGGTGTGATGCATCGCTACAGCCATCTTCTGATGACGTCCTGGAGATGTGAAGTCGCCTTAGGCCACGACGCAACCCGCCAGATGTTTGCGCATAACATGTCGTTCGTTAATATACAGCCTGTCCTACTGTCTCGATGTGTGCTCGATGGGGAGCCATGGCATATTATCCAGCACTTCAGGGCAGCGCTGCTGCCACATTAATACAACTGGCTGTTAAATAAGCCCGTGAGATCACCAGTCATGCGTGACTGCACTGGATGCACGTCAAATCCGTCTCAGGGAGGGCGAATGACCAAAGAGACTCGGATCAACAACTGTTCAGCCACTGCTTCGCAGGCTTAACGTCTGACGTGTAGAGCGACGAGCGCGAGAACGCGCTCGGCGCATGAGGGACGTGAACGCGCAGATCACCGACCGCAGCGGTTGCGGCAGAACAGCGTATGACACCCGGGGATCCTCAACTGTAGGAGCTGGACGGACGCGAAGACAGGCACGATTCGTCGAGGCATACTTAGAATCTGGGTCGAAGCGACCTCAGCCGCATTTCTGAGCAGCACCACAGAGTGCACAGAGCAGCAATACTGGCGCTGGATCGTCTGATGCGCAGGGGCAGCACCGCTGGCTGCATAGTACTAGAGCATCTAGATCCTTTTAACGATTTGCTGAACACACCAGTGTAAGGGATTTGTTTATGACGAGCAAAGAAACCTTTACCCATTACCAGCCGCATCGAAAATATTATGAAGCTCATACGCAACCGCGCCCGGCGCACTTGAGTGCGAAATCGCCTGCAATGACCCCTGATGCTGGACCCGGCCCTGGCCTGGTTAAGTGTTCCCGCCGGCCGACAGCGACGGTGCTGCCGTTGGCATATTCCTGCGGTCCTGCCTGTCAAGTACACAGCCAGCACCACTAGTAACGTTCACACACTTTGAGCACGTTCCGTTATGAGGATGTGCTCTGGCCGGAGCTGCCAGGAGACGAGACGAAAACGGAAGCCTCGTTTGCCGGAACGCATGTAAGCATCGTTTACTTTATCCTTCATGGACTAAAGGTTGCCTCTTTTTAGCTAGATTTTTATGTCTATCCTACACAACCGCCCAACTGCTGCGGCAAATGAGCAGAATTTAAGTTTGATCTTGCTGTTTCTGCTTCTCTTCTTTTCCGTGAGCTATCCTTCACCACGAAAGTCTATCTCTCTCACAAATTCCGGACTGGTAAATGACATGGCGCATGTACGTTTCGCCGATTGTTTCTTAGTGAGGTTATCCGTTCCCGTGGCGGCCCTCGTACCCTGAAATTTACGCCGGGGATATGTCAAGCCGAAGCATGAAGTGAATCCGCACTGAACTCGTCGCCTGCTGGATGATGAAGATTACCGCAGAATGCTCTGGCGGACCAGCGGCTTACACCGCCGTCGCGCCGTGCACGCTCATCATGCAGAACATGCGTTACACGAAGAGCTGGCTCCCCTTGCTCAGGTCTGAAGGATGCGACTTTACTTCTCCGTGCTGGCAGAGCAAGAAGAGGAAGCCGTTAACGTTCTTGCCGATCCGGTTGAGGTACAGCTGGGTGAAATCGGCAGGAGGAAATAACATCAGCAGTCCAGCCTGAGGCCGATACGGCTATTATTAATGGTGACAAGTCCACGATGACCCGACCACACGATATCGAAGCCCACGCGCTGACGCCAGCGTGTGGTGAATATGATGGTTGTTCAAGATCCGAAGAGCGCGGGCGCTGTTCCGTTCCTTCATAAAGGTCAAGGAGAAGCTGGATACCGTCTGTGCTCGATTTGGAGCTCGAGACAGCGGTGAAGACCTGGGCAAAGCGGTGTCTAGCTAAGCGGTACCGAGTGATGGGCCATCGTCAACGTGTATTCTAGACAGTACGTAAGAACGCGTCGTCAAAAGAATTTCCTGCCGGACAACACCGTAGTATGCTCAGAACACTCAGGCACGGCGGTCTTGGAGCTTAGGCTGCATTCAGGATGCGACGCACATAGGAAGGCATTAAACCGCCTCTCATGACAGTTGGAAAATATGGTACCAAGGGATCCGGCGCGTGAGTTGCCCATGATTCAGTCAGCACCGCCTGATGCTGTAGTAAGTATGGTATCTGATGAGTTCTGTCCTGGTACAACGCTGGCGTAATCATGGCCTTCAGGCCATGTTCTGTGCAGGAGTCTAAGTACGAGAAAGATGAACTGATTGCCCGTGCCGCCGGGAAACAACTGAACGGGGAGCATCCGTGCCGACGTAAAAGAAAGGAAGAAAGCCCCGCTCCCGTGTGAGGGGCCCTGAAAGAGGAGCTTGATGACACGCGTAGATGACCCGCCGTCATAAGACATCGGCCTCACAGGCATGTTAAATGGACCGGACATGAAGGTCCCAACCCCGTAATAGGAGCCGGATGATTCTATTCTGATACGTCTGACTGGTCACGGTCGTGGCACTGGTGAATAACAGCTGCATACCTGGATGCATTCACGCCACGCGGGATGAACCTTGGCATTGTGCTGCCGGGAGTAACGGTTTCGTCTCTGCCGGTGTGGCAGCCGACTGACAGAGCGCGGCCTGTAGAGAGAAATGCAATAACGGGAGGCGCTGTGGCTCATTTCGATAATTTCTGCTGTATCTTATCTGCTGCCGCCATTGCCGCGCCGATGAAACGATACCGCGCGGTACCGCGGACGTCATGGAGTCAGCCACCATAATCCGGGGCCGGTAGGCTTCAGGTACGGTGGTAATCTGTTTGATGACAACGCAGGTGAGCTATGCCGCGGACATATGGGCGTGCGTTGAAGCTCCAAGCCCGTCCCTGTGTTTGTCCGGCTGACTCATGAGGTGCGGCAGCTGCGGCGTGAGACACGCTGACCATCGTGAGGAAAATTTCTGGTAACCTGGGATCGTGTTTACAGGTATGGAAGTTGTCATCTCTGGCATTGGACGGGGCTGATTACGCCTGCCGTTAACCGTCGCTGAGGGAAATGGCTTAGCCCAAAAGTATGAGCAGGATTGAGAAAAGCGCCCGACGAGTGGCTCACCAAAACGGCGGTGCCTGCTCTGTATCGTCCGCGCAACCCTATTAACCGCGTTCTGCTTTCATCCGCGATATCGCAGTGCGTCACAGGTCCGCCCGTGCGACAAAGGTACGCCGAACTGGTAAGGAAGGGGGCCTATGAAAGGGCCACGTCAAATCCGCATGAATCAAAGTTAACCGGCGACTTTGCCGTAATCAAGCTGGGTAATGCGCGGGGTGTCCTTCCCCCTCGCGGAGCATTTACGTAAAAGGCAGCGTTTTCATCCGCTACCAAATGGCGGCACCGTGCTGTGTAGGTAACCGTCGTATTCCCGGCGCGTTGGTTCAGCAACTGAAAATGGCCGCTTAGGCATGTCATGCAGCGTGTATGGGAAAACCGTTACCCCATTATTGTGGTAAATCCCGATGGCGTCCGCTGACCACGGCGTTTAAACACAAAGCTTGATAAACGGCGTGAACGTCTGTCGAAGAGCCAGCGTATAGCGTGGATGGCAGCATCAATCGGGTAGAGTAACAGCGATGAAACATACTGAACTCCGTGCAGCCGTACTGGATGCACTGGAGAAGCATGAGACAATGGGCGACGTTTTTATATCTTAGCTAGAGGTTCTTTTATGTTGGAGCCCACTTTTCCGGCAGTTGCCGTTTATCTCACCGGCGGGGTAGGGACAGAAAGGACTAGGCGAAGAGCCGGACAGGGAGACCCGCAGGCGCTGGCAGAGCTCGAAGGTCTTCCTTCAGGCTGCATCAGGTGCTCCACGTGCGCGCCTGGATGCGTGGGATGAGGTCAGCCCCACTTTATCCATTGGTAGGGTATCCCGGCACTGTTACAGATTTGATCACCAGTATGGTGCCCGCGGCTATGACTACCGGCGCAGACGATGATTCCCGGGCTTGTGGAGTTCAGCCGATCTGATCATGGTGCTGTGCTTACGCTACTGGCGGTGGTGCCAACGCCGCCTTCATGGTCAAATCCTACAATGCCGCGTGAAGAAGGTGCCGGGACCGCTGTGGGTTTATAAGAGCGGTAGATGTGTAGAGCGTCGGATTCGGACGTTGACTGGTCTCAGACGTCTGAAGGTCGCTGTTCTTTTATGTTT
>34
CTTCTATGCGGTCTGGCATGTAATTGAATGAGAGACAATTTCCACGGTATCTAAGCACTAGGATAACCGAATAGAGGGTTTCCTATCGCGCATGTTAATTATAGTTGCCGGCATATGTTGACAGACTATTTGTATTAAAGCCATATTGGCTGGGTTGACTATTCCATGAAGGCAAATATCCAATCAAGAGCTCCGACGAGGTTAAAGTAATTCTGGCTAGCCGGCCCCATCTAAGATAATGCCATGAGATAGCAAGAATTTTAATGGTTTGTAGGAAAGTGCTCCAATCCATCCAGCAAGGTTGGCTCTTAGCGGGTTTTTGACGTCACCCTAAGGTACGGCCAACACATTGAGCAAGAATCTTCATCGATTTGGGGAAGTCACTCCGAGTAAAGCCGCTCACTCCATTGAATTATGAAGAATGGTTTTATGCGACTTACCGCATAAAAGGAAGACATAAGCTCAATAAACCTGTCTGTTTATGGGTCTATCCCTGACTCGTAGCCTGCACGTGAGCTCCAACTTATTTGGTTATTCATAAATCGATGGAAAAGACTTTTCTCTTTACCAAACAAATGACAAGAGTCTGGTCCCAGACAATCGCTCTAAAGTCGATGCCATATCAGGACAGCCCAAGACGAATCATTGGGATTCCCATCTTTGTTGGGACACATTGGTTTAATCAGAACTTTCGGGCCACCGCTCCCGTAGCACAGATTTAATCGGGAAAGGAAGTGTCATTAAGCATTATTGGGAGAGAGGGTCATGAGGTGACAACGGAGGAGTCGGCCGCTAAGTCTGCCATCCGGTCATGAAACAACGGTGAGGACCAGAAGCCAAGCTACGTATTGCGGCGATATTAAAGATTAGGGGCAACATATCCAGGAGCTTTTGAGTCATCAGGCTATAATCATGAAGCCAATTTAAAAGCAGTAAAGGTTGCCAAGAGTACTTTATGAGTCCTCAATTTTCATTAGCCGTGAAAGATGAGGATATTTTAACAGAACATTAACCAAAGGCGCTCTCGGACAACAATAAGTATATCTTAGCACTTAGTACAGGCTATATAAGAGCGACTTGCCCAAGAATGAAAGTATACTGGAAGTTTAGGCAAATAGCAAATTAAGGCATTATTATGAGACATCCAGGCTGCCTTAGTGTTGATAGTAATAATTCCTTACTAGTTGGCCCATTTGCTATCTCCTTTCCCCTCATTCCTGGTGTTTTCTTTGCATAACGCGATATGTCTTGGGGACATGTCATGTAGTGCAGGACCATGATTGCAATCCTGATTGCTGCCTTGACGTTTCTAATCGAAGAGCAGAGCCGACGCCTCCCGCCATTAGAGAGAGGTGGGCTGACATCGGTAATTATTGTCCTCTCCTTAGTTTGTTGCTATGCCTTTGTTAGTATGCTTCTTCCCATAGCATAAAGCGGGGCCTGATACGCACTCCTAACCAATCCCTCTGCATCGTCCTTCATATGCATCCTTGTTTCCAACTAGCTTTACCGAGACAGACCTGAAGCCGACGCCTCGCCATTCTTCACCATCCGCGACACCATAACCAATTATGTTATTATGAGGACAACAATAGATACACTCGCTCACATTAAATCTCACTAATCTAAACCTAATCATAGTCATAAACATACAGATAAGTAACGGTGATAATCTATCGCTGTGTAGACATACACTGGCTAGTACTGACTATGAGCACGATAGAACGCTGACATGAAGCTCTAACTTGCCCTGTCGAACGACCAGGGCAGCATTCAGCAGCACTTTGGCTGTGGACCGAAACGAAGCATGCCGTAAGTGCGATTGCATTAGACTTACAAGTGCTTGGCAGCGGGGTTTTCTGGTTCACTACAACTGCCCACCACGCTACACTGACACGAGAAGCCAGATACGTAGAGCACACGCGACTGCGCAGAGAAACAGGCTCAATGAAAGCATAAATCCCTGTCTGTTGGGGGACGGCAAAACCGTAGTTACACCGCCTTCTCGGATGCGCAATGGAAATCACGATAGAAAGCGCAGCTAAATCCGATAGCTTACAGTGCTGGCTGAATACCACAAACATGAGATTGAAAGCAACCTGCAACGTATTAGGCCGATCAAGATGACAGCAAGGCTGGCGACACAGCAAGCCTTGAGATGCACCCGGCAAATCAGGAAAATGAGGTACTTAAAATTACTTAATATCCTGCTTTATCAGACTTATGGATCGCTGGCAACAGGCATTCAATTCTTTAAATAATAATAGAAGCTCTGCTTTCCACTTCCATCGGGAAAGTTGTTTGGACATAAGCTCTCATCCACCTTATGGCATTGTTTGTAACCTATGTCAATCACTTCCTGCACAATCAAAATACCCAGCTATTGCTCTTCTGACACTATTTTGAATTACTGATCGCATTTATGTTCATCTTAATGCCGATTTTCTGTACCTTAAACCTTATCTGGCGCCTGGCATAGCTGACATCGCATTAAGCTGCTTTAGGCGACTGCGCCAAATAAGCACGAAAACATGCCACATGAGGAATACCGATCCATCGCTATTCAGGCCAGGTTATCGGCTGTAAAGCAGAAGTCCAACCATAACGATCATAGACGTTCTCTCCGAGTCTATGCTGAGCTCGTTAGAATAACGAGTACAATGCCATTTCTATAGCCATCAAAACTTAGCGGTTGTAATAGGTTGACCGATTTAATCAAGAGCCGATAAAGAGACTTATTGAGCACATCTTTACCGCAATGCCTATTGTTAATAGAGAATTTACCGATTCGAACGCATCTAACGCTTATGGAACAGACCCACTATCGTACCCTACTGACTAATCGGACTTGTAAACAATTTCGGACGATGCAATGGATCAAGCTGCAATGAGGATTAAGTGCCTGAAGAACTTTCCGTAATGGAAGGGGAAATATGTTAATAAATGGGCAGTGAACACTATTGCCAGAAGTGGGCAAACAGAACAACAAAGCTGCTGATGGCCTTTATTTGGCATAAATAACAGAATAAACACTGCACTGTGTATTCATTCCAACGAGTGAATACACGTTAAGTGTGCTCTATCTAAACAGGGGCCTGTTGATTGGTTTGGAAATCTTCTTTGCCCTCTGAGTGTGGTAAGAATTTATCTTAGAGTCTGAACAGATGTCGACCGTAAATACATCATTGATGTAAGGTGGAAGCATCAATAGAGTGCAATGATATGATCAGGGAAAAACAGATCTATTTCTGGTCCTGACTATCACGCTCAAACTAGCCTTATGTAATCGTATTAATCATGCTGACGCAACATGCTCTGCTTAGCATTTCAAGCGACTTAATGCATATGGTGTTGAATTCTGTGAATGATGGAAATGGTCAGGACAGTATCTAGCCATCCTTAGCGAAGGAATAAGGGGTTACCGATACATCTCACTAGGAGGCTCTTGGTCGTAAAATAAGTATGATACCAGCACGCTATTAAATTTCTCCGCTGGGGCCTCGCTTCACTCGAGGCCCGAATTTCGTCCTTATAAATAGGATGAAGCCTAAATTAGATGTCTGCTGGCTGCTTTTATTCCAAATTTACTGTAGCCGATACGTAATCATGATGCCTATTAGCTTATGAAATAAGGTCTGGCTAAATGGTAAAGCGGAATTACAAGATGGATCTATACTAAACCTCATTCTCCCACTCTAGGTTAGCTCCACTTTGCCTGTATCCAGCTCCGATGTTCTGCCTCGTCCTACCTGCCCTGACAGAACTTAAACTGAGACTGGCAGAACCCTCAGCATTGTCTAACCGCCTTTCATCTAATGTTTTAAAATGGACGGGGCAATTGTTCTAGTATGAGCACGAGGTATTTGCCCTAAGGTCGAATTTGCTATAAGTAGGCTTATTACATTGCCAGTGGTTACAAAACCGACTGCACGTGCTCGCTAAAGCCCGTGCAGAGAAGGGAGCCAGAACGAGCATAGGCAGGACGGACAGATCGCATAGACTTTCGATCGCTATGCCACTAGTACCTTTAAGGACGAACACAGCGCCTATAAGTGCACTTACCGCATTCGTTCTGGCGGCTCGGATGTTGCGTGCTCGAAGCAACCATACGATACAGATCAGTCCATGAAATTAGCTAAGTGGGTCCATAAGCCGACTCCGATGAGTGGTAATAGGACTCAATGGATAGGCAGCTCATGATCGGCTGGTTAAACGTCATGTCACTCCACAGGAATATGCCCCTGGTCACCAAGGCGATTTACAGACTTAGAGCGTAAGCAAGTTCACTCCCATTAAATGGTTTACATCAGAATCGCTCATGCTATCCAGTCTGGCGCGCGTTACTAGGTTTGTAATAACCAGAGTGGCATCGTTTAGTGAATTTATGAGTCATTGCCGAATATAGGGCAAACCGACAGTTGGAGTAATTGTCAGCAAAATGAGTCTATCCTTACAGGTTGATTATGGTCCACGCGGGCCAACATCGTAATACGATTAGTTGGCCGGTGCTGCTGAGTGCGCATACATTCGACCCGGGGCGAAGGGAAGATCATTACCAAATTATGGCATCCGAAAACAAATGTCAGGTCATAATAGGACCGTCACATTACAGTGTCTCGTCGAGTTGTAGTATCTATGACAGGGTGGAGCCGAAGTAGCGGTTGGGCAAGGTACAGCTGCGGGTCAGCCCATGAGACATCTAAATTACCATGAATAATCGAGGGATGTAACACTTAATCTTACAGCCTGAAATAGCTATCTTGCCCACTGGCGGGATCGGCGACTGTTCGCACTGCGGCGTGCTAACCGTCAAACTTAGCACCAAGCGGCCCTCTTGGGTTGAAGATAAGCAGGCCAAACCAATGAGAGCGCTGGCTAGCACTTATCCTTAGATTATAGAGCTTAATGCCTCTTCCAACGCTGAAGCATATTAATTATGGGCTACGAAAATTAAAGCTGGGCTTGCTGGCGCTTCCATGTCGCTATTGAAAACCGATAAAGGCAGAAATTAATCTATGAGAGTGTCGCGTCGGGGCATGTGCTCAATGTTGCCGGCTGTGGCTGGAGCGTGGCTACTAAGCGCTCATGGAGAGCTAATCACAGAGCTAGAGCGTAAATGTTTTCAAGATCCTCACCTTTAATAGTGGATGTCACTATGAGTATTATGAGTTAAACTACAGCGGGCTAGTATGTAATTATAAGGTGCTCGATATGTTATTAAACGAGCTACGTTACATGGCAATGCGCGTTGTATAGGGGTCAACCGAGTCAAGCCGTATTTCAAGAGAGCGGGGATAGTCGGCTCGGTATAAAGTAGGGGTATGGCGGCGGCGTAAAGCATGTGATGACAGCAGGGGCGACGGTATTAAATATTTAAAATAGTAGGGTGGCAACAATTAAGGCCGGTAAATGGTCGGTCATTGGGACAAGAGCGCGTGCAAAGTCCTAACCAGAGTTAGGGATGGTTAAAGAATTGAAGATGAGAGCTGGCGCCCGACTCCCTGAGCAATTAAAGTTTGTGGTCGGGGCACCAATACAGTGGCGATAACATATAGTATGCATAAGGTAACGCGCATACCTTTCGTCTACCGTGCCATAGCGGCTGGAAAGCCTTTAGTATTTGGCAGTGGCGCACCACAGCGGCTGAATAGGAAGCCTCCGGACCGACCCGCGCTGTAGAGCGTATTCTGTTTAATTAAATGAGATATGCGAGAGCAAAGCTTTAATAGGTTGAAGTCAATTCGACCGTGAACCGCAACCGAGCAGCCAGGGGTTCTAACGTTAGCCCTTAAGGTTCTAGAAAAGGCGAGTCAACCGAAAGCGAGCAAGATGAGGCAACCAAATACTATAGAGTGCGTCTGGCTCGCATGAGCTTCATGTCATGTGTATGGTTACATAGTAGATGTTTAATATAGGCGATAACATAGGTCCGGATAAAGTCACCGTCCACCCACGTGGCGTACCGACATAGCATAAAAGTTCTCAGCCTCTAGCTCTTTAATATAGCTGTTGCTAGTGGGTTGGCGCAACATAGAGTATGAACTGACACAATGGATTCAGCGGTGATAGGCTTTAGGCTGGCATGATCACATGTTAGCCGTTATTGTAAGGGGTAAACATAGGCTAAGCGAGGACTTAAGCCGCATAGGCATGGGACTGAATGTTATTGACATTGCCCATTACTAAGCTATCTGCTCAAGCCGTCAAGGATACTGCAAGGGCATACAGCTTAACTTATTAAACCGTAACCAATAGAGGATCGACAGATAGCACGACGCTAGGTTAGGTAAATGGCCAGGGTAACTTATTAGATAAAATTGTAGGTGTGAAAGTTAGACCAAAAGTGAACGCAAGCTACATGGTCGTTTAAAGAGTGTGTCCTATTGTTAAGTGTAGGGAGAATGGCTGTAAAGTAACCGATTTGGCAAGTAAAACGCATATCCTGGAGGTGATTCCGGGCTCAGCAGCGGGGTTGGGCACTATGGGGATTTGACAGAGACCTTTCCATGAGTATTAGCCTAAGCCAGTTATTGGGCTGTAGTAGATAGTAGGGAGAGGTGGCCATCAGGTAGGCCGCTACCGGAGTACCAGGGTTGCTATAGGTAATGAGAAATGTTTTAATGTGGCATCGAGCGGGCGCTCAGCAGCGAGGTCGGGCTAGAGTAGGAAGGTTGTAACAGGTCGAGGCCTAGCGTTATTGTGAGTAGGCGGCAACGCAGTTAATATTGCCAAGGGGTACGTACCGTTATTGTTGTTTAGTAAAGTACTGGAGCTCCTGTTGACAGCTAGGTCCATGGGGGCGCGCGTCTGCCAGTGCCTATCCATACATAATAGCGTTAATATAGTAGACTATGTACGCAACTATGCTAAGGATGCGTGATAGTGATGATAACATTCGATGGCATGGTGACAACTTATTAGAGACGTAATGTCTACTACTATAAATGAGGCTTTGTGTGTCAACAGGTAAT
>35
GTTAACCTGCTTCCGCTGACGTTTCGCGGAAGTAAGCGTAATTTACTATGTCAAGGCACGATGGCTGTGTTATCTGAAAGTACTGATGGTATGAACGGTGCTGCTTATTATGGCTGAGCGGCGAACGCATGTACAGGTGTTCTCCGATGTTGACATGCCAGAAGCGGTAGGGGAAAGGCTCCCGACGATGCCGAAGCCGAATCGAGGAGAAACGGAAGTTCGGCCGTACTAAGTTTCCCTGAGCGATGTGCGGGTCTCTCTTGGAGCCCAGGCGCTGGAGGCCTAATATGCCCAGCTACCGTAAGGATTGGTGAGTGTTGGGCTTACAGTCAGTTCGAGCGACGGTGGCGTTGATTATAAACATCCAGGTGAACGATGCGTAATGTGTATTGCCGTTGCTGTCTTTGGCTCCACCGCCGCACCTTGCGTTGACAGTCACTCCGCTCTCCGTCCGAAGGGGGTGACATGGTACTACCGTTTACGTGGCTATTTCAAGTAGAAACCGGGTACATTGCCGTCGTTGTCCTGCGGGGATACTGGGGTGTGAGTCATCTGAAAGGGATTGACCGTGAAGTACCGTTTAGTTGCTTGAAGCTCCCTAACAGTGTGGGGGTGGCTTCCCTGGGGTCGCCCGCGTTAGAAAGAGCAACAGAGTGACCTGGAGGATACACGTTTCACTGGCGGCCTGCGTGACGTTATGTAGCCGTACATCTACCGACTGAGTTTGTCAATCATAAGCAGGTCATGAGGTCGGGTCCGTACCGGCCATGAGCCTACCGTCATGCATTCGGGGTCGATGGATTGGGATTCCACGGAAATCACTCCCGGTATATGAAGAGACGACCACTGCCAGGCACGAAGTGCAATGCGGCATACTCAGTGTGGCGTGGAGTGCAGGTAACAGATTAATCCGGCAGCGTCCGTCGTTGTCATGTCCTTGAACCGTAAGGCGTACCGGCGGCGTACTTAACGCAGTTCATCGTCTGGGTCGTTATAGTTAAATGATTAGCCAGCGAATACAGCGAGGGGGATCAATGCGCCGGAGATTCTTTTGTGAACGCTCTCTACCGAGTAGATTTGCCTAGGAATTGTAACCGACGGCACAGGAAAACCGGTACAGAAACTTAATACATTCATAGTGAAAGCCAGAATTATAGGACACTACCACGGGTGGTGGTGAACGGTGGCTCAGAGAATCCGATGAAGCCGGGCGTTACAGCATGGATGTGGAGTACGGTCAATCAATGTCATCCTGCAGGGTTGACGGTTTTCCCATCGACCCGCACCGCCAACTATACGTGTATGAAATTCACAACCGGGACGCTGAATGATTTCTCTGTGCCATGACGAGGATGATGCCGGCCGAGCTGCTGCGTCGTTAGAACTGATGGTGGAAGAGGGCGCGTAACGCGTCTGTAGTCTGGCACAGAGTACGGCAGCGAAGAAAATCAGCCGGCGATGCCGTTGCATCAGCTGCTCCAGGCCCAACGTGTATCTTATAACTGGTATGCAACTGACTCAGCACGCCGCCAAGCACGTCGCCGGACAGGCTGCATCGTCAGCTCAGGAACCGTCCTCCGGCTAAGAAGGGCGGCATCAGCAAAGGCCATTGAAGGGAAAAGTGAGCACCGAGCCGCAGAGTCCTCAAAAACGCGGCGAGGGCCAGTCGTGGTGCCGGTTAAGCGGAACGTCAGAAACGAATGCTGCCTCATGCGTCACAACAATCATCAGGGCCTCAAGTTCTGCTCACGATAGGGGGCGTCACGACGCTAGACGTTAGCCACTCGAAGGCGAGATGCGGGCTAGCCGCAAAGAGGCAGCGAAGCAGGAGGAAGGAAAGAAACGCATCAGATGGGAGGGGTCGCAGGGGATTCCGGCAACGGAAGGAACCCTGCCAGGGCGGCAACTACGTCCAGACGAATGCAGGTCATCTGAAACAGCAGCCAACGGGGCTATATGCGCGGCACCGGAGCGGCAGACGGCAACAGGGCGGCTGCGTCACTGGGATGCCTCCAGAAGGCAGACGGGGCAGTGCGGTGCTCCATCGCGCGCCTCCAGGTGCCATTCGTAAGAAGCGGCGGCAATACGTGCAAATTCGGCAAAACGTGCAGAAGATATAGGCTTCAGAGCTGTCGCGCTTAGAGTACCGGGACAACGAAGGGATAGTGCAGCTCACCGTGCATAGCACCAACAGCACGTCGAAACGCTTGCTGCAACGCCAAAGCGGTGTTAAGGTGGTAATGGATGAAACGAACAGAATGAGACTGGACAGTCCGCTACGGAAGGTGACCCCAACAAGCACCAACCGCGCTCCCTAGGGAACAAACAATACGATTGCGACCGCTTTTGTGATACGCCGGTATTGCAGATGTTATCAGCTAACGCGTCTACTGACCCAACCGAATACGCTGAATGAACTGGCCGCAGCGCTCGGGAATGATCCAGATTTGCTACCACCATGACTAAATCAGGGGTAAACAACCGAAGAATGCATGAATACTGAACGCTATGGCAGGGCTTCCACGCGAAAAATAAATTACCGTATTTGCGCAAATGATGCGCCAGCCTTAACGCTGACTCAGGTTGAGGCAGGGATATTCTGAAACCCTAATTCGTTGCATGTTCTTGAAGGCTCCTTGGGGCCGTAGAATTCGGGCCTTCCGGCATGCTCCCCGAATCCGATACCAGCCGCGCTCGTGCGTCTACCAGCGTGGATGCAGCGCAGGCGTTGGACAAATCAGCCTACCCAAATATTGCTGTCGCGTATCCATCGGGTGCTTCCTGATATGCGTAGGGACAATCAAGGAAACCCGCCAGCGGTCGTTGCTGTGGTTGTCTCAGGAACAGGATGGAATTACATGCACAGCCCACAGTGCCGATCTCATCCCCTGCTCTAATTTCGCACGCAATGGGGCCATCGTCGTTTCTATTGGGCTCGCACCGAACAACAGGCAGTTTCGATTACGGCACCAAATCCACGAATAACACGGGGCTCATGCTCACAGTCTGAGCGGTTCAACAGGGGCCGGGTGCTCAGCACAAGTGGTTAAGGATGAATGAAGTTCTGGCTGAGAGTATGAACAGCAACCATTACAGGAAGTTATCCACAGTTAAAGGACCAGCACAGGGTTGCTTATTTATCGAAAACGGACATGTCAGGGCAGCCACAGTCATCATTGTCCCTTAAGCCGTGAGTGCCCTATGCACACTGCGCATACAGTTGGTATTGGTGCGCACCAGCATCCGGTTGTTATCGGTGCTCATGCCCATTCTTCAGTGGTTCGAGACGACACCATCACGTTGTTAAATTCTGATCGGCGGTAACGAGAAATACCGTCAAACATTGCATTTAACTCTATTGTGAGGCTTGCATAATGGCATTCAGAATGAGTGAACAACCACGACCATAAATTTATAATGCTTACTTAAACCCCACTAATGAATTTATTGGTGAAGAGGACGCATATTCCGCCTCCATACCGTCTGCCTGCAAACATCACGTACCATGCACTCAGAGAAGATTCCGGCAGGGATGGGAGGGTCGCACAGGAGCTAGAGGGGAAACGTGGCATCTCGTTGAAGACCATCGGGGGTACAAACCGTCACTGACGTGGCTTCCGGCGACGCGTTATTTATTATTTCGACTCGGTTATGTTTTGTAGAAAATTTTACCTGGTTATCGCCGGGAGGGAATATCAGAAGTGGAACGGCACAGCCTGGGTGAAGGATGAAGCAGAACTGGTCCCGGATCCCTGGGAGGGGAAGAAACGACATTCCTGCAGCCTCCATCCCCTCTTGCGCCTTCCGCTTCCGCCTGCTGCAGGGTCTGGAAATGCAACGAAGGAAGAAACCTCGTTGCTGAAGCCTGGAAGAAGTATCGGGTGTTGCTGAACCGTGTTGATACATCAACTGCACTGATATTGATGGCCTGCTGTCCTAGTGTTGGAGTAATCGTTTGTGATATGCCGCAGAAACGTTGTATGAATAACGTTCTGCGGTTAGTTAATACATTGTAAGCTGAGTATTGGTTTATTTGGCGATTATTATGTCGGGAGAATAATGGAAGTTCTATGACTCAATGTTCATAGTGTTTACATCACCGCTCAAATGCAGGTCCGAAATCAAGACCGCCATGAACGCAACCGAACACTTGTTTTTCGTCATGTTTGAGTCTGCTGTTGATATTTCTAAAGTCGCTTTTCTTCGTTCTAACTATTTTCCATGAATACATTTGATTATTATTTGAATCAATTCCAATTACTGAAATCTTTTACTTATAATGGCATTGGTTATGTTTGGTTGAGTAGATGCTTGCTTTTCTCAGCCATAGCTCTATCCCAAATGAAGCCATAGGCATTTTGTTATGTCCGCTACTTTCGCCCAAACCCAAAGAGAGGCGTACTGGCTGATCAAATGTTGTATTATTAAATCCAAGTGGCTGGAATGTTATCATAAATTAATGTTTGAATGGTAACCGTCCTTTAAAAGTCGTTTCTGCACTGCTGTATAATCATAACACTCTTCTGTCGAAGTGATATTTTAGGGCTTATCTACCAGTTTTAATTCGCTCTTCCTACTCTTCGCTCGGAATTGGCTTCTCTTCCTCTGCTTAAAGATAGTGCTTATGGAGTAATCTTTTTAATTTTAACATAAGTTATTCTCCTGGCTTCATCGATAGAATTACCTAAGAATGATATGTTGCGAACTTACATGTCACCCATTGGATTGTTAGTTGTGATGCCAAGAGGTTACAGCAAGTTATACATTCTGCCATAGATTACTAAGGCATGTAATAATTCGTAATCTTTTACGTATTAGCGGTACGATACGTCTTTCTGGTTTGTAATAGTAATAGATGATTCAGTTAAATATGAGACG
>36
CGTCGAAAACCTTCGAGACCCAACACATGTAGTTTCGAGCAGCCTCGGTTCTACGAGACTAGACTATTTTACTGTCAAAGCGTCCTTATAGCTGGAAGTACAACGCCGCGAAATGACAGGTGTTAAAGTCCGTCGACCCGCGGTGGCTCCCATGCCTGGGTCGAGGGGCGGAATGAAAGATCATTCGACGGTCAAAGCGTCAAACATTCCATTATGGCTTGACATTTTCGCCCCAGCGGAGCCCATTGCTGATACCGGCATAAATCGTAAACGCAGGAAAAGAGTTTGACGCTGCTCGCCCGTATGGGTGGCGGCCACGTACAGGCCCTAGCTGGGCATGCAGCGCCGTCATATGTAAAATCGTTTCAGAAAGGGATGTTCTTTTAATCAAAAATGAGAACGAAAGTGTTGCCGGTGCCGCGGCTGATGAACTAAAAGGAATGGGATGGTCAGTCGTATAGTCACACTCCTGACGTACCATGAAAACCGTAATCTTATTCAACAGGTAAACGGTACTGTCACGGTTCTTGGCGCAACGGTTTCAAAACTTACGTGAAGTTAACATAAAACGGCGAAGTTAACCGGCCTCAGAGATTCCTTCAGGCACGGGCGTATAGGAAACGCACTCATCGGCGTATCGCGTAGGGTGTGATGCGGTCAATCCACCGTCAAACCCCTACGTCATTCTATGCGCCGAACGTCGACCGTCCCGTTCCCCCTGGGGCAACGCGCCCCATCGCCAAGGGCTTCGAAGTGGACTCGGACAAACCCACATTAGCTGTTGATCTTCCTGAACGCGATCAGGTGATGCTAAGCGATGAAACGTCCACAAATAGACCGTCCGGCTATGGTCACCCGTAACGGCCGATACATGGGGCCGCTTTATTACGACAATGACAAAGAGCGACGTTTCAAAACAGTCCCTATCTACGGAATACGTATGCGGCGCATATCCCGCCTCTAGGCCTGTTGTTTGCTGTAATCGTTGCTATCGTTCCGTCCCGACTCAATCTTGCCGGTCCACAGAATGCCGTTGAAGCGGCTTATGCAGGATGACGCCTAGAAATAGCCGTACCCCTCCTGCTGAAATCGAAGTGCTCCGCAGTCATGACGGGCCCCGCGACCCCGTGCCCGTGTTCAGCCCTAACTGCGTTTAGGACCCAATGATTTGCCGTGTAACCTAGGCACGTTCTTTCATGCAGCTGGTTATTCTGTGAAATGCTCGTCGGGGCTTCATTATCCCGTATCAGGATAGTACGACGGCAGCAAAAGCGGCTCGGTTGCGAACCGGATGGTGATGCCCCAAACAGCGCTGAAACAGGACTATTATCAGACTGGTTCTAGATCACTCCGTCTCTTGCTTTTCCGTCGCATAGGCGTCGTGAGGTTTATCTACAAACATCAAGCGGAGCAATTCCAGCGTCATGTCAGCTGTTGAATATGGTTCCTACGATTTAGTGTGGTCTGGCCCCCGGGGCGGAGCTTCAAATGTTGCAACGTAATGAAAGTCGTGAGTATTAGCGGGTCGATGAACTTTCATGCCTTTACGTACCCGAACGAGCACGTCTTATCTGCGAAGTCTCCGCGGAACAAGGCGTCAGCTTACACGGCCGGCCGGCCAAAGTCCACTCCGTAGCCCAACGCCAAAGCTCACTAGGGTTGACGCCATGTTGGTTCATAGAATCTTCCCTCAAGCCGCGTACTGTTCGGCAGCGCTTCCAACTCTCACGGATCGGGGGTATGTCACCGTATTAACCTTCGTGACAAATAACTCCAGGTCGGCGCCAAATCGCACGGACGACGCTGTAAGATCCTGGTTCAGGTCTTCTGCGAGCATGCCTTCACCCGCCAGCACCTACTCACGACGGTGGGTTCATTTACCCGGTTCTATAGACCCGCGAAAGACTCCACGGACCACGCGATGGCATTTCGCGCCATATGCGTCCATCGGGACCCACGATTACGCCAACCTGACAGTTAGATTCATTCTGCCGTTAATCTAGTGGAAACCGCACTGATTACCGCCACCATGCGTTCAGATTAGCCAAAGACTGAACGAACGGATTACATGGGAAACAGGTTTATCCAAACAGTGCGGAGAAACACCAACTTTTATCCTGTGAGACGCGGTTCCGTTTGTTAACGGGGAGTTCGTCGACGTCATCCGGTTTCGCTTGACATAGGATGATGCATCATAGGAACAGCATACTGGCACCAGGGAAACTCAGTGCCATTCGACCGCTCTAGGGTCTAGTCGCCGCATGCTTAGATGGCTCCAAGGATTCCCAGGTGGAATCCATCGAATGCGCGGCTGGGGCGGATGCGGTCTGGAGGTATAGAACATGACTTGGCCCCATGAAAGCCCGGGCAGTACGCTCTGGAGTGCGCCACGACGATGAAAGAACGTGGCCTTACTCTTGCGCCTAGGTTTATGACCCAATAACAGCTTTGCCTGACGTCCCCGGCATTGAAAGTGCTGATACCCGGCTACGTCGCTCGGATTTCACTGGCTCTGACGGATACTAAGGAGCTGTGTATGAACGGGTCTGAAACAACTTAGCTTTGCGAGCCCGCGATTTCGCCGAGATGTTACGGACTGCGGCAACGCTGCGTTGTAGTCACGATCGAAAATGCCGGGGCCAGCATGCCACGGTACCCCAAAAAGAACGGGAGTGTTGTGCATTTGAAAGCTGCGGATTCATGTGATACGTTTTGTGAACAGTTTACAGAGATGAAATGGTTATTCGATTGAATCGCTTCCGCGACCGTGGTCAGTCCAACAATGCTTCCGGCACTGATGGGTAGGGTTCCAGCGACGACCAGCCACATCAGCTCAATCGAATTACGCTTGAACCTAGCCTCACGCATCAGACGCGGTAGCTAACAGATTATCCAGATAGAGATTTAAAAGTTCGCTAGTCATCTCACCGAAAACCAGGTTCTAGCAACCAATCCCACAAAACAGCGACATCCCAATAGCGTTGATTGGCGTCGGACCGCCGTTAGCCGCCCGTCGCGCCCCGGGCGCTGCGCATCAGGGAGGGTCTCCTTAGCGATCGTCCCACGGCGCCAGGGGTTGCTGGCGCTCAGCCACCGACGAGGATGGTGGACCAAACCAACACTGCGACGATTACTCTACTTCGAGGGCTAGCCGGAGAGGCGATAGAGCACTGACGGGTCAACAGCGACGACAAATCTAGCCGCTGCCATGTTCTGCCTGCAACAGTCTGCAGCTAACCTAGAAATGACAGCTCAAACGGGGCAAATATTCACAGAAAGGAACTGTCGTAAAATGAATGAGTTTAGTCGACGACGAAGCCATACGGGGTGGCGCCCTGAAAAAGAGCCCTGCATTCAGTCGGAAGGAGTGGGACTTTAACTTCTTGTCAACATGACGCATGTTAACCTGCAGATGTTGATTTATGGAGGGAAACGCCACAGATGCCACTGTCTCTTGCGCTCGAACTGCCATCTAAACAGGCATTTGACGGTGCGTATCCTTCGTGAATATGCTGGTTATCAATTGTAGGCATGATTTGGGTACGCACCTGGCTGGAATAGCCAGACCGTCTGAACCCGTGGGATGCACTCTTTGGCCCGCCCAAGTGGCCTTTTAGAAAGGCCGCCATCCGTTTCCGTCTGGACGATCTCTAGTACGGAAGAGAATAACGGCCCTCCCGCCCAAACGCGTTTACCTGCACTGACGACCATATTGTCGCTAGAGAGCGGCTCCTTATAGGCTTAACTCCAAGTCGGCTGGCTCTTTCCGTTGATCGAAATTCTATAGAAAACCAAGAAGAAGCCATGCGTAAACCTGCCTAGAGCTAACCGTCCACATGAACACTACTGCGTCGACCGCTGCTCGCATCTAACTAGTCGAAAATTAGAATACCGTCAGCAGTTGATTCGCACGTCAACAAACGGTGCTTTGCCATGTCAAATTCCATCCATCTAGCAAACCGGTGAACGGGCTGATGGTTGAGGCTTCAGATAGATCGGCTCGCTTTTCGTTCGGCCTTTCTTACAGGACAACAGTTCTCCACCCGACCTCTGTTCGAATGTACGCAATTTCGAAAGACCATCCGCTGACAGCGAACTGCTCCGCGCCGTGTGCAGATTAATTCGACATGCCGTGCAGCTGTTCGGTTAAGAGTATCCTTGAATAGAAATTCACGCCCTGTTCATAATACCTGCCCTCAACTCAACGGAGGACCTCAATACCCGTATACCCCGGGCCCCTTTCAGCCATTGACTATTTAATCGTAGGGTAGAACAGCGCATGGATTGCGAGGCGGTTCAAATGCCCCGTTGGACTGTCCAGGTCGCTATCAGTATTAAAGATGCTCATGAGCTAGGCGCTCGAAGGCTTCGACATGTGATTTCGATCTCGCATTCAACACGCATGAAGGCGCTCGCTGCATATAGCCACCCTAGCACCTATCGTTGCTTGGCCAGATGAGGTCCGAGCTGGCCAATGAACGGGTTTTACGTCAGGCATAGTCTTCAATACCGTTCTCTATAGCGCGAACAGTCAGGAGCTAAGGGGAATGACGGCTCCACGATCTGTCTAACAAATTTCGCCGGGCACTACGCCGCTTGCATGAGGTCGTGGGCTAGCGCAAAGGTCAGCATGATAGGGTATCGCCTGACTGCCCGTTCGAATTTGCCGGTCAACGCGTTGTTAATCGAGGGGACGTGTTATTCTGCTCATCGTCCCACTACATGCTGGGGCTGTCATGCAGATGCTGCCCGGTTGGCTAGCTCCGCCGGTAGGCAGCTCCCCGCGATGAATAGATGCCCAGTTGAGGCTAATCCAACAACTTCAAAAGCCTGTTACGTGCGGACAAACGAGCGCTTAGGGCGTACACCATGGCTCGCTGTCTGAAATTGCGCCGTGCCAATGCTTGATAGCGGTCCATAATGGGATTCTTTGTCTTGTTGTGCCTAGAAGGCTATGAATACCCTGTACCCTGACAGATGCGCCGACGAGCTAGCCCGCCAAATGGCGCTTGCCAGTACTCCCATAAATGCCCGCCATTGCCTGCTTAGGTGGAACTTTCAACTTCTGGATAGGTTATCCTGAGCGCCAGTGGGGTCTGATGAGTAGCCTTAAAAGAAGTTCATTAAACTAGCGATGCTAGTGTCAGCAATAGCACGACGTGGTCCATCGCTAAAGTCTGTGAAATTAGTCTGCAAAACTTTTATAACCAAGACGTTAGTTGACAAAACTCTTCAGCAGAGCTGGCGAACGACTTCGATGGGTCCCCGTCCGCATGGTCGTTGGAAGCGCCCATTATTTCTGCGCTATGGACTCCACGTGACGTGCGTTGCCAAAGCAACAGTGATTATCCCAACGTTCAACTTCAGGCACTGTTCGGTAATTGCCTTCCAACCAGTCCTGCCGTCAGTTCACGAGGCGTTCACGAGCTTAGATGGCGGCCGTTGCCTGAAGTTTGCTGCTGTGCGAGTTCCCTGTGCGGCCTGCTGCAGCCAGCCCGGGACGCGTTCAAAGGCACGGTAAATACGTAATGATGTCACCTCGATCCAGACAAAACGATTTGTGGAGCCCGTCTCGCCCCATCTTTGACTGCCCATGAGGGATTCCCTGTGCGACAGCTGGCATAGTTATTCCTTAGAGCCGCCGACTAACAGTACGCATGTACTCTAAGGTCCAGGTCACCGAAACGCACTGCCTGGCTGATGGTTTGTTGTCAACCCCGCTTTGGACGCGGCTTAGTCGCACCGTTAGAGTTGCGTACCAACTGTTACAACGGCATCGTTCGGCAGGCAGCACTGGGACACTGTCTCATTTGATCTAGGGTTTGGCGGACGTGACGGCACTCTGTTCATATGGAATTTTCAGCGTCGGTCAGCCTGTCTCGTCGACAGCGCTAAGACCCTCGTGTTGTAGTGCCTGCACAGGTTTTCCGATTCTTTTCGTGTTGTTCAAATTTAAAATGTTCAGTTCTTCTATCGCCAACGAACCATTAACTTTCTCTGCACCGTCTTGCAGTACCATGCTGCCGCCGGCCGTTCTTAACTCCTTCGTCCTATAGTCCCTGGTCAATAATTAACCCTTCATCTGACATGATCTCACTTGCTGGCCAGGTTTGTCCTGTTACAGTCTAATTAACGGTGGCCTTCTTTCGGTGAAACAGCCTTTGAATCACGGCGCAGCACCGTTTACGGTTACATCTAAGTAGCACATTCATCGTTGACTAGATAATCATCCTTGCAGGTCCAAATGTCGTCCTTTCTTATACGCAACCTCTTACGCTTAATCGACGCAATCTCACCATCTATCGCGGTATCAAGCTGGGACCATTGAGCGTAGCGCATCCCTAGATACATTTACAGTGCCGCGCGTCTCACCGTTGCAGTGCCCACATGTACCGAGCGTTAGCCATGTCTACTTTCAGACGCGATGAACTTGTGATCAACATGAGGACTTAACGGTTTCGTTGCACTCACCGTTTCGCTAGATGCAATCCACCCCAGCTTCAACCCCGGGCGGCTCACGACAGCCCCGATCTGCTCCGCCACCGTTATCGAATGACCAACAGGTAAGCGATCAACAACCGAGCTTCGACGCTTATGTACCACTTCAATTCGCAAGGCTTCAAAGGCTACTTGTCTAGCCGCCGACGTGCCAGGAGGACGCCAGGCTAAAACTGCCGCTGATGGCGCACCCGACGTGAACGGCCCCTACATTACACCGCGCATCTGAAGTTGCGCTCAATGGACCATGGTCTGGTTAATAGCTTCAGCCAATCCACAAATCGGGTAGAGGTGAGCCAAACAGCAACGCGTGACGAATTCACGTCTAACGGGCCTGATTGCAGAAAGACCATCGCGTTTGTTGAAATCTGAACGGATGCTTGGATCCCTGATACCCCATCGCAGCCAGCACCACAGCGAGTGCCGCACAAGGCGCATGACCAACAAGTCGCGTAGCAAGCCTGATGCAGCGGCGAGCAGCCACAGCGCTGGCTCCAAGCTGACGTAACCCGCCAAGTGGGATGCCGTTAACGATTTGCTGAACACAGTCGATTGATGTTTATGACGAGCAAAGAATCAACAGCTAGATATTTGCCGCTTAAGCTGACAGTGATTAGGGCTTGGATCAGTATTTGAAGGCAGCGGCCCCAACCGGCTGTTAACGAGTGCGCGACGAAATCCCCATTTCTTGCAAGGCACCCCGCTGTCGATGCTGAGCAAATATTTCGCTCAGCCGTACATGTTTGGGGATCCCTTCCATTACCCAAGGTAAATGAACCTGGCCTTATGCTATCGTCAATCTCGCGTGGCACTCCATGCTGCTCAACGACCATGATCACGGCGTCGACCAGCCAATAGCGTAACACTGCGTACCGTCGTGATCTCTGTCGTCCTAGCGGCTTGGCTTGCTCCTCCGTCATGTCAGAAACCGTGAGAAGCAAAACGAACTTCGGGTCGCGTTTACAAACGCAGGGCAAGAGCGCATAGCCGAGCGACCTGCGCTTTCGATGAGCACATCATGTTAAAGGGTTCGTCGGCGCGCGCCGTCGGCGTACGCGACTGTGGCGCTGATGAGCAACAAATGCCATAACCGCGTGGGTGGCAAATGAGCAGTATGAACATGTACGTCGACCGCCGGAGGGCTTCGCGCTGCCTCCCCTGAGCGAGAGCTCGGTGGCGATAATTGGGTCAAAGCAAGTCGAGTTCGGCAACTCCGTCAACGGTAAACCAAGCGAGCGGCGCTGACCCATCGCTTGATTAGATCTCTAGAGTGCTCCTAGGCTGGTTTCCGGCAAAACAAAACCTACGCTTCGGATATGCTTTTAAGAAGCCGACATGATCGAATTAACGCATGCGGTTTAATACGTGTCTGTTCCACGCATTATGCCTGCCGCGGGATGAACACCGCATACCGCGGCACCCGGCCCTTACCGCCGCTTTCAGCATCCGAGTTAAGCCATGGCCAAACTCGTGCTGACGAAGGTCGTTTGCTCAGTTGAATTCATACTCGGCATCTGCAGTCTTCTGCGATGGTTATGCAGGGACAAATACAGAGCGAAGGGGACCGCGCTCGCATTTCATCGTCGTCACTGATGGATGATGTCAGAATAAAGAACCCAACTTCACGGTCCTTTAACCCTAGTTTTAGGTCTAGACCGTTCATGACAAGGCAGATGATAATTAGATCAGACAGTGAAGTTCAACGTCATCGGACCGGACGCGTGACATTCTGTCATAGGCGTTATGTTCAACCTTCGGTTTTCAGGAGTACGCTGGTACTGAAAGGTCCTGGCGCTGTAGCCCAAGTGAGTTTTATTTCGGTGCAACCGCCGGCTAATAGGACAGTGCCGGATACATCAGAATGTTGACCTGTCATGCATCCCGGCTTTCGATGTAAACCTTGAACAGACCTGGCTAAATGGCTTTTGATTTTATTAGCCCGACGCCCGCACCGAAGGCGACCTCATCATTGTCATTCAATCCTGAACTAAGCACGTGGAAAACGCCAAAAGAACTTCCCCTCGTATTAAACACGATGCCTTGTTCGCGCCCGAACATCCTGGCACGGCGTCGCCTTCAGTGCGGATTTAAGTCCGTTATGCATTGGTCCATCGGACGTCTAAGCACTTTGGTGACTTTCACGTTTAAATCGCGTGCCTTCACCGTTACTGAAAAAGACTGCGTCACAGTACTTAGTACAATCCTAGCGATACCGATACATAGTTCAGTTCCAGGAGAAGCAATGCTGTTTAGCGCCGCTATCACGGAGAGGGTTCGGTGTAAACCGCGGACAAGGCGCCCTCTGCTGCCATTGGCTCTCCGTGGGAGGATGGCTGACGAACAGTTGAAAGCTGGTACTGCCAGGCAATTCTGCCCTGCTGCCCAAACACGTCGCGAACCGTTTGTCCATGTCTTGAAACTTCGTAAACGAATAACTAACTGTCGTCTAGGCTCAGCATTCCGTTTAGAACAGGTCCGACTTGGATTTGACTTTGCCTGAAGACGAACGCAGTCCAACGACTTCTCCAGCGGGTCATGACAGTGCCCTATCCCTGGCCGTCCCAAAACCGCCGCTGTTAACGGACATGAAAGCTCGTTTAGCATCCCAAGTCCCACATGTTGGTACAGCAGCGTCCACATTTCTAGATAAGCTGACGGGACGGTTCAGGTTACTGAGCATACCACGGCCGCATCGGTGACGTCGCATAAGTACTGTCACTCATCAAACCGCCCACGTACTGGCCATTAACCTGTGGTACGGTTGTGCCTATGCCGGGAACGCTCATCGCCTCCTGTCGATGGGGGTCGCCGCTGTGTGGATACCGTTGAACCAACGAGACAGTAGGCCGGGGAGCATATTCAAACCTGCAATAACGCCCCTGCCAGGTGGCTTAGGCTGATTTCGATAACCTTCACCGCGTTTGCTGCGTATTCACTAGCGCCATTGAAACGATCGCGGGTATACATGGGAACGAGGTTGCCGCAGGTCACACGCTACATGCTCCACTCATAGAGCGACCATCAGCTCGTCACTACAGTCGTGGTCGTCGGATCGTCACCGTGAAACCAGGCCTCGTCCGACAGGCGTGCTTCCGTTGAATGTTTCATCATTTAATCACATGTAGCGGTTACTTAGTCCGGACGCCCATAGCCGCGACCTTTCGAGGCGTTCTACAAATCGCTATGAACGGTTTGTTGCTTAAACACGTGGTTCTTCTAGAGCACTGCGCCATCGGATTTCAGACGATGGACTATCTATCCCTTTTCCCAGCCGCTGCAAACTCTATGCAGCGTACCGCTTTGCCGTTACAACGGCCTCCCGCTGAAATGGCGACATTGTTGTATACATAAAAGCTTAGGCTAATGTTCAGGATGAAAATAGCCGCTTTACGTTTGAACGGCGCTGCCTGGCGCTGGCCGCAATCCTCAGCAGCTTGATCCCTGAAGTCGCCGCGGTTGCTGTTTGTTGACGTTGGTGGGGTACAGATGTTCG
>37
AACTTTGCTCCTCTTCCCAAAGCTGAGTAAAGTACTGCTTAACTGTCAATGTAATACAGATTTTGGTCCATCGTCTCCGATGGGGTCATAACAACCAGTGTAAATTACAGAGGAAGTTTAATATTATTATTATCATTCATTATGTGGTGAGCTAAATTAGAGTCGGTTGGGCTCTGCTAAGTCCCTCGGAAGTGGGGCCCCGCAGACACGACGGTGGCAGAACGTGCTTGGCTGAGCGGAAGAAGGGAGTGCGTTGAATGGGTTTTACGCGTTAGCGATTTACTCATATTTGCCGAGGTCTCCTCCGCGGAGCCGCTCCTCGTGACTGTACACTGTCCCCCGTAGACGTGGAGCTCAGCTTACCGTTAACCGTCAAATCCGGTGCGCCTGTTCACCCCAAGGTACCTACTCTGCTAGGAATTGGTTAGGCAAGTCACCGGATTTGTAAAAGCCTCTATAAAGCTACTTCGTTCCTTCCGATAATCGTCGTAATTTCTATCTTTTATCACCTATTCTAGATCCCTCAACCGCCTTCCCGAATGGAGAAGGAACCTTTTCCAATAATTAGGAAGTCATTCAATCTATAATAGTTCAGATTTGCTTCAATAAATTCTGACGGTGAAACGTCCCTTTGAGACCTTCCTCGTTCCTACTCTTTACGAAGAGTTCCGTTGAGTAATCATGCTCAAGTGCTTCCCTGCTCAAACGAATAGTTAGCAATATTTAGCTTGAAATGATGAAGAGCTCTGTGTTGTCCTGCCTCCAGTTCACCGGGCGTCACGCAAGATAACGGCACGCAGGGGTTCTAGAAACGAAATTGCATAACAAGTCCTCACGAAAAATGTTAATGTCAGTGGATGACGCCCGAGCCGGAGCTAAGGGAAGAAGAAAACTTATTTCTCTCCCATATTGCATTCCCTACGATGGAACTAAATTAAGGCATCAAGCAGAAAATTCAGGATCACCTTGCGACGGGAGGAGTAATCCTTTTCGTGTCTTTTAATGACACAAAATGACATTTTAGCCTGTTGAAACAAGCACCGTCATCGTAATATGTTCTAGATTGTTTATCTAGAGAATGTATTTCATAAAGCTTTTCTAATTTAATCGTCAGTTACCAACGATTACCAGCCAAGGTGTCTCTGTCGTAGGTAATCTATGTCCAGCTTAATATTCTATATTGAGCTCCGGAAAAGTGGGGAAGTGAGTACACCGAAATCTTATTTCTAACATTTATTGCATCATTCCGAGCGTCTGCGCCCCTTCTAGATAAGTTCTCGTGGAAGGGGTAGTTTGCCTTGTACTTTACCTTCATCTCCTTTCCGTATCATCAGCGCTTTTTAAAACGCTTCCTGATCTAATCCTATCTGACCATTAATTTTAGAATGGTTTCATAAGAAGCTGAATCGTAAGCTCTCAGTATCCAGAATTTACTTCAAGTAAAGCCTCACGAGTTAAAACAGCCTAAGTTCTCACCGAATGTCTCAATATCCGGACGATAATATTGCTTCGGCGAAGGAGGAAGGAATCCACATGCAGGATTTGAATCCTTGCGTGCTCTGGAATCGCGATTCTGCAGATTATTCAGCCATTGCGTTACATGGCTCGTCAAATCAAGTTTAAAGGGGGCCTGACATGCAAGTAATCGGTGACGTTAGACCCAACTAAGCATCATTTTCGCCAACGACATCGATCTTGTGATAAATAAACGATTGCATGTCCAGAGCTGGCTTCGAAACCGCATATTTCCGTATTGTCATAAAATGACAATTTAGTGAATTTATCGGTTCCTTGAATTGGTTCATTACGTCTTACTCTTCCATATTTAGAAGGAGAGAGGAGTTCTATTTGAAAGTTCATCACTACTTAGTTCTATTTACTCAATCAGTTGTCTTTCTATCTCCGGCTCGATGCGTTCCTGAAATGAAGCATTCTAAGAGATCTCGGTGATTTTAAACTATTGCTGGCAGCATTCTTGAGTCAATATAAAAGTATTGTAGCTTTGCTGGTCAGGTTCTTTAGAGAGAATAAAGGCATTAATCCGGCGAAACGAAACAAGCGTGAGCGACTGTAGATTCTCCACCGATTGCAGAAGGGGTATGGGAAAATGCTTTTCTCGGTCTGATTGCACAGTGAATTCCTAGATCAAATTGTTGTTTTACCACACCCATTCCGCCGATAAAGCATGAATGTTCGTGCTGGGCATAGAGAATCTAACCGTCATAGCATCGGGTCGCTGCGCCTGAAATCCGATAATTTCTATTAAATGAAGGTGGAAATCTGACAATTCTGGCAAATGCGTCATTTAACACACGTGCGAACTGTCCATGAATTTCTCGAATTACCCCTCTAATGAGGTCACGACGCTTTCATTTCAATAATGTTAGCTAATCGATTTGGCCTACCAGAAGGAAGCTAAGGAAGTGTTTGTTAAAACCATCATGATTTGCTGAGATTAACATGAGTCAATGCTTTCACTAAGGAACATTTCGGAGTTATGAATTGATTTTTACTGATGAATAATTAGTGGTTCTTCCTCCAGGTAATTTAACATTTCCGATATCGCATTTTCAGTCCCCTTACCAAAGAACAGATAAAACATTGTAACAAAGGAAGTAGTCATTCCAACCATCTGCTCGTAGGAATGCGTTTTTCTACCTGCAGGAAGTACCGCCTCTTTCAAGCCCGCTCCAACATAGTAAGCGTAATTTTATTAAAACAGGAATGGATAGGAAGTCTCTCTTTAAGTCACTCTGTGATACGTTTCCATCTAAGATTAATCCATGTAAATAGGGCGTATCTTGTAACTTTTAAAGCATTCTATTTCCTTTATCGTTTTACCTCTGGCCGGTTCCTCCTTCGGTTCATGCATGGTGCATCGTTATACCAACGATAGTCTATTGTAATGCAGCATATAGTATCGCCAAACGATGCTGTCAGCGTCGAAGCGTTCAATACTAATAAGCCGATAGATAGCCCCCACTTCTCCATTTTCATAGTTAATTCCGCTCCTAACAGACTCCGAGAAGGCAGAGGGTGATGCATGCTCTGTAGGAATCCGTGAAGAGAAAGAAGTCATAGTCGTTGACATCATCTTCTTACGTATGCAGGTCGTATCTACAAAGCCTTCGATTGCGCCGTTGTGCTTCCTTCCCAGCTGAATGCAACAAATTTAATGACACAAAGCGTGGGGCCCGGAGATAAGGTTCTAATAGTCTACGCTAATGCAGTAGTTTACATGTAGCCGTAACAGTACTAAGTAGTTGCTTTAAAATGATCTAAGTGTTGTTTACGTATGTAAGTCTGTTTTTACAAGTCAGCCGTAGTCCGTATTTACTCCGTCTCGTCGTTCAGGCATATGGGGAAGGGAATCAAAAAGCATTGCATTGGGTAGGGTTGTTCCATGCGCTGAACAGTCATCAGTCAAATCATTATTATTTGATTTCACTTTGTCCCACTCCATGCCTCTGTCATCACGATATGTGATGCCATCGTCCATCTGCCCGGAGATGTTTGGCAAACTTATCGGTGATTCTCAGAGTCTTGCAGACAAACTGCGAGCGTGAAAGGCGTGACTGGCTTCGAAGGAAAGACGATCGTCGTGCCTAAGAGACCCTTGATACTGTGCCGGATGAAGCGTCGGGACGGAGGGAGCGCATGGTATCCCCGCCACGAGACCTTCCATTTATCAAATGTTTCCTTCAATCAGACGGTTCCGCAGCATCGCTCTGCGATGCTTCGCCGTACCGATTTGCCGTTTTGCTTTGACAGCCAAAGTACATCTACCCTATACGTATCAGACCACTTCATTCGCATAAACCACTCGTTGCCGGTAACAACAGCCAGTTCCATTGCATGTGGATAAGCTGGTATGATTCTGCTTGATAATTTCAGGTATTCGTCAGCCGTAAGTCTTGAATCTCCTTACCTGATTTGCTCCGAGTGGCAGCGACATGGTTTGTGTTATGCTTCAGCTATTGCCTCTACGCGGCATCATACGATCGAAGCCGAGGAAGGAAGCTTCCTCTGCATTGAGCGGTCCGCAATTTCTTTGTGATGTCTTCAATCAGGAGCATCAGGCATCAATGGTCCTTTAATTTGCTCATGTAATTTATGAGTGTCTTCTGCTTGATTCCTGCTGGCCATTTTCGTAGCGATCAAGCCATGAATGTAACTGACGAATTATCATCATGTTGATTCTCGGTTTACCGTGTTGTGTTGAAAATAACTCAATGTTGGCTTATAGCTTCAGTGATTGCGATTCGGTTTATGCCCGTACAAACTCTTTACCCGTCCTTGGCAGGCAGGAAGAAGTTCCCTGTTACGGAGCCTCGGTATTCCGCACCCGGATACTTCGCCTTCCATTTCCTCCTTCAAAGGCCACCTGTTATTGCTTTAAGTCAACCTTTACCTGATTCGTGAATAAGATATTTCCATCCTTAACCGGAGGTGGGAACTCATGCATTCCCGAACCCATCGACGAACTTTCAAGGCTTCCTCGTCGCTGGCGTCCGTTCAAGCCTGAAGCGTCAAGTACGGCAAAGTCTCCGATTACGCAGAGATACAAATCATCAGGCGATGGTGTTCTTTCAGTTCTTCAATTCGAATATTATGTGAGATAGAGAGCCCGAGCAGGGAGTTCATCCAGTGGTCTGACAGTCGTTGGTTCTCCATGCCTCCTGTTCCGTACCGCGGCTCCATCTTCCATTCCTGTACTCGAAGTGCATTTATCATCTCCATAAACAATGAGGTACAGAGTCGATAACAATAAATCCCCGGTGCCGATTTATGATATTGGGTTTGATGAGCTGTTTTGTCACAGAGCAACAGTATCGTTTCCACCGTACTCGTGATAATTTGCACGGTATCAGTCATTTCTACATTGCAGAATGGCACCCTGGAGGCAGGAGAGAAGCCGAATATTTGATCAGATCTATATCATGAGCTTCATCTACATAAAACATTCGTGATGTCTAGTCGCAGCTAGACAAGAATGCGCTTCCTTCTTATATCCTAATCTTTTACAGACTCAATCATTGATACCCTTTATAATCCTTGCATCGTATTCAGCTACAAACGGTATCAGCAATGTTATGTAGGAAACAGTAAGATAATACTCAACCCGATGTTTGTCAGTACGTCATCATCTGACAGCAGACTCTGAAGCGCTGTGAAGACGGACCGAATTCAGCATTTCACAAGCGTTATCTTTTACAAACCGATCTCACTGGCCGAAGCCAGGAAGCAGAAGCAGATAGCCTGCATCCTGAACCCATTACCCCAACGCGTAACAGCGATCGTAATGATGTCGATAGTTACTAACGATCTTGTTCGATTAACCCCGCACTAAGAACTTCCGCTGCTCTCCAGTCGCGTGACAGGAGTCTTCCCAGGGTGAGACCTGAACAACTGGTTCCGTCTTCACGACTTCGTTGCTTTCTCAGTTTAAGCCCTTACTCCCATCCGATAACATTCGTAATACGGTACTCGTTGAGTTTGGATTTGCTGTTCTCACCCAACACGGAAGTTCCAGAAGCCAGGCAATATCCTCGTCTCCGTCATTGGCTACCGTTGATGGTCCTGGTTTCTTCCCGTTCATCCAGCAGTTCCATAAGAATCGATGGTTACCAATTCATGGAAAGGTCTCGTCAATCCCCAGTCGTCATGCATTGCCTGCTGCGGGCTTCACGCAGTGCCTGAGAGTTAATTCGCTCCTTCCATTCCTCTCGTTGATAAGTTCCAGATCCTCCGGCAGTGCACAAGTCGACAACCCTACGACCAAGCGTCTTCGTTCATGTAACTAGTACGCCACTCAAACATCAATACAGATATAGCTGTATGTTAGAGGCATTTTTATTGCTGTGAGGAGCGGCAATCTCTATTGATGAATCAATGATGTCTGCCATCTTCATCGTAATCCGACGGTTAATACGGTCGCTAGTGAATGTGCGAATAATAAGAAGCTGCTCCCTGATTCCGTTTTCGTCGCTGTTCTCATCGTTCCTTAAAGACCCCGTTTAACATGCCGATTGCCAGGCTTAATGAATCCGTGAATCCGCTTCCCGTTACCGTTTACTCTCGCGGTGCCGTTGATCAGTACGCTGAATGTCACGTTTATCCGGAAATGCTGTTGGCTTTTGATTTCAGAATGCCTACCTGACGGGCAATCGCTGCACCGATTTCCTGCTGAGGTATTTCCTTGAACAGTCTCCATGAGGGAAGCAGAAGGGACTGCCGAGAGCCAAAATGCATTCCGGTTGTCATAGTTTCTCATCTGCTTCTGCTTTTCGCCCATCATTTCCAGCTTTGAAGGGGTAAGCTAACGTAGTATGAAATTCTTCGTCTTCCTGTACCAAAACCGTCGATTTTACCAAAGTTACATCCAATACGTTTTTGATAGGTAAGATGTAGTTAAAGCCAACACGTTTGGTTATTTGATACAGCCGGCTACAGTTATTCGATCATTTCATGAGAGGGTAGGGAGTACAGCCTTTGTAACTGAACGATCTAGAAACTCCTTCGATCCTATAGAAGAATAGGATGCGTCATTACCTATACACCGATTGCTCACCCCCAAATACAAACCAATTTCAGCCAGTGCCTCGTCCATTTCGATGAACTCCGGCACGATCTCGTCAAAGCCTCGCCGTACTTTCATCCACTCACGTGACACCTACCTCACTGTCCATGATTCACCGGGTATAGTATTGGCAACAGAAGGAGCATTTTCGTAGCCAGTCACCCGCTTAATCTGCACCTCCATGTAAGCTGACTTTACCTCGAAACCATCAGGGAAGCCGCGTATTTCGGGCGATCGCGGGAGCTCCCTTGGATTTCAGTTCAGCCGTTGCTTCATGCATAAATCCATGGGGGAGCATTACACGCATCATTTCGTCGCGATAGATGATTACGCATTCAGTAATTCACGCCGAGTGAATTCAAACAGGGGTTCTGGCGTCGTTCTCGTACTGTTCCCCATCAGTCCTTTAGCGTTAACTTCCGAGCCACACCGGTCGCAATCCTCAGCAAGCAGGGTGTAGGAAGGAATGGGAAGGGAGGCCACTCTCCGGCTTTGTATGCTATCAGTCCAACTGTCGAAGCGGTACTGACGCATGAGCCGTAATTTGCCGCATCATCCCTCCTTCCACCTCCGCGGCTCCGTGGGGTACTGCAAGATGTCCGGTTGGGTCAGCGGGTGTGAGGCCGTCGTTCAGGAATCCGACATGTTGATGCTTCGGTTGTCAGTTCTACGATGCACGAATGTCTCTGGCGGCGAAGTGGGGAACAGAGCGGCGGCATTAGCGTCATCCCATGTTTTATCCAGGATCAGCAGAGGTGTTAATCTCCTGCATCGAAGCCCGGAAGGGGTCATGTCGCGTTCAGTACGTTCTGCAGTCCTGCAGTATTTTCGACTAGATTAGGTAGCTTCATGTCATAGATAGAAGCGTGACGAAGGCCAGACGGGCACACTCAATCATTTATGACGTAAACCGTTGGATGTAAAGCCCGTGATTTCTCTGCCTTCTGAGTTTGAATGGTTCTAAGCGGCGGCTTCGATTCCCCTTCCTGGCTCCGCAGATCGATGATTAGAAGCGCGGGGAATCCGGCACGTACAGGATTCATTTTAGTCAAAGTCGCTGCCATCAACGCTGCTCGGTTTTTCATCGGTCAACCATCAATGGATGAACGAGCCACTCTAGCCCACGGCTAAAGCTCCGCGGATTAAGCATTTAGTACTGTATCTAAAGAGGGCACCCGGCGATGAATGATTCATCGCATCAGGAATCGAGCGTGGTTGACAGATAGAGTCACCCTGATGCGAAAGCATCGTATCAGCACCATCATGGCATCCTCCTTCCGTGGCTTCCTGACCAATGATCGGGCTTTTAATCCTGTAAGCCCCGAATCAGTCCCACCGTTCCGCCAGCTTCCCGAACGGATGGGGAGGATTGCAAGTACCGATTCCGTTTTTACTGGAATCACCGTACGCTCACCGATGGACAGCCGGGGGAGCAATGGTTTTTCATCAGTGCTCATGCTTCTTGTTCTTGACGCCGGGCGACGCCTAGCCTGTAACACTGAAGGATAAGCTCCGTCGTCATCACGTACCAGGTGAACGGTTTGCCCGTAAACCCGAGAAGACGGAAATTCGTCGCGCCTCCTGTAATCATTAAGCGAGGGCGATTCGACCCATGACGAGTGAACAGCTTTTCATCAACTGAGTAACTAGTCGTTAATCAGTTTAGACTATTTCTCTTTACTCCGCTGAAGCTTAATAGTAGCTAAGCGCGGCTCTCTCCATACTACACTACGCCTCGCCGACACCGCCACGTGAATGGAAATGGCAGGGCTCTCCTGAGGATACGAACAACGCCTGTGAGTCCGAGGTATGTATGTCACCGCATTCTGCCGTCAATGCGGAAGGGAGCGATTAGTGAATCCCTTTGCTCCTTGGTCAGTTCAGTATTAGTACCGTCCTCCGTAATGGTTCCATCATTCTATAGCCCGAATCACAATATTTCACTACCCGCCGACTGGGAAGCAGGAAGGGTCTCATCACTACCACAGGCATAAGTGTTATCCGGTTTATCAGTACCTGACAGTTAAATTACTGTCACTCTAGAAGAGTTCCGGGTACTACGTCACGTAAGCACTTTGTCTACCGCCTCCTTCGTTTATTTCTTTTCGGGCCGGTCGAATAAGGAGCCAAGGATAAAAGCGACATGAGTGAAGATTGCGGATACAGACAGGGATGCTTTATACTAATAGAAGCCCCTCGAGTGAAGCCGTTATTATTGAGTAGAAGCGATCAAGAAGATAAGTCATTACCTGATGAGTGCTTCTGTCATTATCAAAATAAAGTACGTAATTATTTAATTTATTCGTTACAGCCTAATGATAGTCCGAGCGGCGTATTTTCATAGTCAGCAACCAGCCGCTCCTTCCGCGTCGGTACATAGAACATGCGTCTCATTACCTAACCAGGTTCGATTGCTAGCAGCATGTCCTCGAGCATGATCGCTCCATTCTTGCTCTCGAAGCCGTGTTAAGTCGAGTCATACGTATGGTCGGGAGCACTCGAAGCAATCCTTAGTACCGTTCTCTGTTCAAATCCGTCAACCTTCGATTTCATAATCAGCTACTTTCTATGCTTGTAAATTTCGTTCAGTCTATCAATGATGTATTTTGGGTGTTCCTCTATGGTCACCGTAGTACCACAACACGTATAGACCGGGGGCAGTTTTACCGGAGGAAGGAAATCAGGTC
>38
GGTGTTGGGTGCTCATGATATTGCGGCGTCTGCTTGGGTGTTAACCTCACTAACTGGCTGGTTACCAACCGTATCAGAACATGCGGGCTGATTGGAGCTTACTGATCAAGAATTAGGCCGTAATAGGCGCCGCGAAGATGATGATGAGAGCTTGTCCATGACTCTAATGGGATCGGCCGTGTCTCGGCGAATTGCCCTGAACCAGTTATCAAACAACTTCCTGTCATGGGCGGTATCTAAATCGTGCACAGGGCTCTGGCGAAGATCGCAGCAGAAATCAAAGCCGTTCGGACTGAAGGAGCATGATGACGGGCGTGCAAAGAGGCAATTGATGCCGCTTACCTGGGGACGCATAATAGCTTCTGTGCCCCTACGAACGTTGCCGCTAACAGGCAAACAGTAACCAGGGCATAAATCAGGGCCGCGGCTAAAATGGCACGGGCAGGTCTTCTGGTTATCTGACGAAGGTAAGTTCGTGAACGGTGTATTACCGGTTTGCTGAGGGAAGAACGGGAAAGCGAAGATGAGCACGAACCCCATAGCTGTTCCCATAGAATGTTCTCCTCGAGTACGATGAAACGGGTTGGGGGCTTATGGAGTTAAAAGTGACCATCTATACATTACAGCCTAATAACAGCCTGCCTGGTAATCGCCGCAGGCCTTTGATTTGGGGAGAGGGAAGTCATGGAAAAACTAACCTTTGAAATTCGATCTCCAGCACATCAGCAAAACGCTATTCACGCAGTACACTAAATCCTTCCAGACCCAACCAAACCAGTACTCGTAGTAACCATTCAGGAACGCAAACACGCAAGCTGTAGACCAAAACAGGAAGCTATGGGCCTGCTTAGGTGATCGTCTGGCGTCAAGGTTGAATGGCATGGTCTTCTAGCTGGAGCTTGGCAGAAAGCTGGAAATGTTACCGCGGGTCTCAGCCACCCAGCAAGATGTTGTTTCCTATACCTTGCCGGGAATGGCTTTGTAGGTACCTCGAGTCAACCAGCAGGATGCCGTGTAGGCGAATTTGCGGAGCTATTAGAGCTTATACAGGCATTCGGTACAGCTACGTGGCGTTAAGTGGTCGGACGAAGCGAGACTGGCTCTGGAGTGGAAAGCGGATGGGGAGAACAGGCTGCATGCATGGTAAATGTCGTTAGTTTCTCCGGTGGCAGGACGTCAGCATATTTGGGTATGGATGGAGCAAAGGGCGACGGGCAGGTAAAGACGTGCATTACGTTTCATGGATACAGCCATGTGGGAACATCCAAATGGGACATATCGGTTTGTCAGGGAAGAGTTGTGAAGTTCTGAGATACCACTGACGTATTGCAGGTCATCAACCCGGAGCTTGGACATCCCAAATGGGTTATACGGTATGGGAACCAAAGGGATATTCAGACGCGAATGCCTGTTCTCGGCAACGCCATTTATCGATATGGTGACAGAAATATGGCACTCCATACGTCGAGCGCGTTCTGCAAGGTGACAGATTAAAACTCGTTCCCTTCACCAAATACTGTGATGACCATTTCGGGCAGGGAATTACCACGTACATTGGCATCAGAGCTGATGAACCGAAACCGGCTAAACGCCAAGACTGCTGGAATCATATCCTTGCTGAACTGTCAGACTTTACCGAAGGAGCAACATATCCTCGCATGGTGGAAGCAACAACCATTCGGATTTGCAAATACCGAACATCTCGGTAACTGCATATTCTGCATTAAAAATCAAATCGGAAAATGCGACTTGCCTGCAAAGTGGAGGGATTTGCAGCGTGTTTTAAAGTGAGGTCATCACGGGATGCTTGCGTGACGGACATCGGGAAACGGCCAAAGGAGATTATGTACCAGCGAGGAAGAATGTCGCATGGACGGTATCGCGAAAATGTATTCAGAAGGGCATTATCAAGCCCTGTATCAGGACATGGTCACGAGCTAAAAGATTCGATACCGGCTCCTGTGTTCTCAGTCATGCGAAATATTTGGAGGGCAGCTTGATTCGACTTCGGGAGGAAAGCTGCATGATGCGATGTTATCGGTGCGTTAATGCAAGGACCAGGACGCCTCCATTTACATCCAAATCGGACCTTACTGGAATCGATGGTCTCCGTGAAAGAACCAACTGACAGTGTTACCACTACCGCAAGGGAAAGGAGGACGTGTGAGACAGCGACGAAGTATCACCGACATAATCTGCGAAAACTGCAAAATGAGCCCTTCCAACGAACGCACCAGAAATAAACCCAAGCCAATCCCAAAAGAATGCATCTGACGTAAAATGCCAAACCCAGCACGAGCTGGATATCCGGTGAGCACCGTCGTGCGGGAAAACAAGGTGATTGACCACAAAATCATGAAGTTACCGAACAAGAAGCGTCGAGCGAGCTTTAACGTGCTAAACTGCGGTGGAGCGAAGCTGCATGTGCTGGAAGTTCACGTGTGTAGCACTGCATGCGCCCAAGAAACTGATGAGCGATTAGAAATAGCTCGATGCACGAGGAAGAAGATGATGGCTAAACCAGCGCGAAGACGATGTAAACGATGAATGCCGGGAATGTGGTTGCCCTCGCATCGGTCGCTAATCGAACCTGTGCTCTGAGAGTTAGAACCAAGATAGCACTCGAACCACAACGAAGTAAAGAACGCGAAAAGCGAGAAAAGCAGCAAGAAGAAACGACGACGAGAGGAGCAGAAACAGATAAACTTAAAGATTCGAAAAACTCGCCTTAAAGCCCCGCAGTTACTGGATTAAACAGCCCAACAAGCCGTAAACGCCTTCATCAGAGAAAGAATGGCGACTTAGAGTATGGGTCCCACGGCTCACGTCTGCTCGTGGATGCCGACATTACCGGTGATGACAACTGCTGCGGCCTCAGACTCGACTGAATTTAATGAACGCAATATTCACAAGCAATGCGTGGTGTGCAACCGAGCACAAAGCGGAATCTCGTTCCGTATCGCGTCGAACTGATTTAGCCGCATCGGGCAGGAAGCAGTAGACGAAATCGAATTGGACAATGGCGATAGCCATATCTACAACTATCGAATGCAAGGCGATCAAGGCAGTACCAACAGAAACTCAAAGCTGCGAAAATAGCAAGAAGTGAGGCCGCATGACGTTCTCAGTAAAACCATTCCAGACATGCTCGTTGTCGAACATACGGAAATCGAGCTACAGACAGAAAGTAGCACGCAGACTGGCGACATCTTAGTCGCGGTACGTCAGAAAATACCGTTGATATGATAAAGACGGGGAAAATGCACATCGTTCACAACGACACCGTTTCCATGGTTCATCGCGGATGGAGTGAAGAGATGCGCTATTACGAAAATTGATGGCAGCAAAATACCGAAAATATTTGGTAGTTGGCGATCTGCACGATGCTACACGAATAGAGCTGATGAACAAAACTGGATACGATTGGATTTCGACAACAAAGACCTGCTTATCTCGTCTGGCGATTTGGTTGATCGTGAGGATCGTTGGAATGCGGAACCCTATGAATCCGGAATTAATCACATTCCGCCTGGTTCGAGCTGTACGTACGTGGAAACCCATGAGCAAATGATGATTACCGGCTTATCAGAGCGTGGAAACGTTAATCAACTGGCTGCTTAATGGCGGTGGCCTGGTTCTTTAATCTGGCCGGATTGACAAAGAAGATTCTGGCTAAACTCTTGCCTAAAGCAGATGAACTTCCGTTAATCATCGAACTGGCTCAAAGTAAATATGTTATCTGCCACGCCGATTATCCCTTTGACGAATACGAGTTTGGAAAGCCAGTTATTACATCATCAGCAGGTAGATCTGGAACCGCGAACCGAATCAGCAACTCACAAAACGGGGTGATCCGGAAGAATATCAAGGCCGTTCATCTTTGGTCGCTCGCCAGCAGTGAAACCACTCAAGTTGCCAACCAAATGTAACGCGGCCCGGGCGCAGTGTTTCTGCGGAAACCGGCAACATTGATTCAGGTACAGGGGAGAAGGCGCATGAGACTCGAAAAGCGTGGCTTATAAATTTCATTCTAAAGCCGCGATGATGAGCGACTCACTAGTCGGATTCTGACTCTTTCCGGTACTGATGTGATGGCTGCTATCTGGGGGATGGCGCAATCACAACGCGGATTCGGTGGCCTGCATTCTGCGGTAAGCACGAAATCTCAGCCCCAGAACGGACAAACAAAGGCTATCAACTATCTGGCAATTTGCACAAGGTACGGGGAAATACCGTGGTGGCACCGCTTGACAGGAAGAGCGCAGGCAAAATAGTACTGCAAGTGCTCGCAACATTCGCTTATGCGGATTATTGCCGTAGTGCCGCGACGCCGGGGGCAAGATGTGCAGAGATTGCCATGGTCAGGCCGTGCGGTTGATATTGCACAAACAGAGCTGTGGGGGAGAGTTGTCGAGAAAGAGTGCGGAGAGCCAAGATGCAAAGGCAGTCGGCTATTCAAGGATGCCAGCAAGCGCAGCATCAGGTCTGCGGTGGATCGACGATGCTAATCCCAAACCTTACCCAAACCCACCCTGGTCACGCACCTGTTAAGCCGCTGTATCGACGCTCTGGCGAGGGTGCGCCGCCACAAGGAAGAGTCAATCGCAAGACAACATTTTGAGTGCGGTTAGCACGTTAGCAGCATGATTGCCACGGATGGCAACATATTAACGGCAAGTAGTGACTTATTGAATAAATTGGGTAAATTTGACTCAAACGATGGGTTAATTCGCTCGTTGTGAAGTGAAGGGCGGAGCGGGACATTACTCCGATTCTGGCTAGGGTCACTTCGACGTATCGTCTGGAACTCCAACCATCGCAGGCAGAGGTCTGCAAAATGCAATCCCGAAACACAGTTCGCAGGTAATGGTTAGAGCCTGCATGAACCTGCATTTCGGGGATTCTATATCTGACTGCACAACAGGTAAGAGCATTGAGTCGATAATCGTGAAAGAGTCGAGCCTGGTTAGCCAGTGCTCTTTCCGTTGTTAGGAAATCGTGAACGCATCTAGAAGCACGAACCGGATCACCAAATGCGTACAGGCGTCATCGCCGCCCAGCAACTCAGCACCAACCAGCTCTCAGCTGAGCCACTGTCTGTCCTCTGAATGGTTCATTAGTAAACAACAGTTACGCTGCGATAGGCTTTTGATCGGATTCTCTGTCGTGAAAGCTGGCAGGAGGTCTAGCCCCTCACTCCTGCGCCAGCGTTTTGCCCCGTTGGCATATCGTCACGGAAACAAATCTGATTACTAAACACAGTAGCATTTGTTTCGTTCAGTAATCATACTTATTCCCTAATTAAATAGAGCAAATCCCCTTATTGGGGGTAAGACATGAAGATGCCAGAAAAACAGGCTTTACCGCATTCTCGAACAGGAACAAGGCATCGGGGCAATCCGGTTGCGTTTGCGGCAATGGCGTACCTTCGCGGCAGATATAATGGCGGTCGGGTTTACAAAACAGTAATCGACGCAACGATGTGCCGCGGAGGCCATCTCCCTAGTTCTATTCGGTACTTCTCGGACTTCGGCCGTACTAAGTAGCAATCTCGGTGTATAACCCAGCGTGTTTATCGGCTACATCGGTACTGACTCGATTGGTTGCTTATCGACGGACAACGCTTCGCTGGGTCACAAAGCCGAGCGAAGAGCCGGGCAATCAATAATCACGTAACCGTTCCGGCGAGATATGCTGGCGTGTAGTCGGCATGAGGAACTGATAACGGACGTCAGAAAATGAGAGAAATCATGGTTATGGCACGTCATGCTGGGGAGAGCTATTTACTGATTACTCCAGATCACCTCGCAAACTTGTCACGCTAAACCCAAACTGAAACAAATCAACAGGCGCCTCATCACGGGTTATTTCTCCGTTGGTGGGGATGCCTACCGCATGCAGGAGGCCCTGAAATACTCAACGCGAACCGAAAGTCAGCGCTGTGGCATTGCAGCAGATTAAGGAGCGTGGCTTCTTGCGTAGCCTATGATTGATCGTGTAACCCGCTTTTAGGCAGACTTACGGTTGCAGCAATATCTGGGGCTTCACTGCCGGGCGCCTGGTTATGGTCAGTTCGAGCATAAGGCTGACAGCCTGATTGCAGCAAATTCGGAAGCGGGCGGAACGGTCAGGCGATTGTATGAGCGGCAGAGTCACCGCGATTATCTCCGCTCTGGTTATCTGCATCATCCGAGCTGCCAGGCTGTTAATCATTACCGTGTGATAACGCCATAGTCACAAAACGCGACGAAGACAAATGCCATAGAACTGAATGCTGGCGGCGAACGCGGCAATTACTATGACATTGCAGATGCGTCAGCGTGATGTCTGCTGCCTGGATCGGGAAGCCAAAATAAGCGAAGGAGTTAGCTGATGCTAAAGCTGAAGGTGATGCTCTGCGTATGATGTTGACGCCGCTGGTCTGGTTCTTCACCGTTGCTAGACTCAGGCGATACTAGCGTGAATGGAGACCATGCGGCCGCCTCCGGCGCGTGAATAAATGCAACGCATCTATTCCCGACTGGCAGACCCGCTGGACGGTACATTATTTCACCGCTCAGAGAGCTGACGTACTATGGCACAAAACAACTGGAAGGAACCCAGAAGTATTAATGAGCAAGTGCCAGATAGAGTTGCCCATATCGATGAAGCTGAGCGATTCATGGCAATTATTGAGCAATACACGCGCTTCCAGCGGAGTATAAATGCTAAAGTAATAAAACCGAGCAATCCATTTACGAGCTGTGCTGGGGTTGCTGTTTGAACAACATTTCTGCGCCGCCACAAATTTGGCTGCTCCGTTGCGATTTATCGCGGGTTCTCCAGAAACGAAGAAATGATGTATGGTTTCCTTTGGTGCTACTGCTGCCGGTTTGTTTGAACAGTAAACGTCTGTTGGCAGCACATCCTGTAATAAGCAGGGCCAGCGCAGTAGCGAGTAGGCATTTTCATGGTGTTATCTTCCCGATGCTTTTGAAGTTCGCAGAATGGTATGTAGAAAGTGAACAAAACCTAAACAATGAGTTGAAATTCATATTTGTAGTAATATTTATTAATGTATGTCAGGTGCGATGAATCGTCACTTGTATTCCCGGATTAACGTGCCCTAGCCCTGACGGGGAATATTCTCTGCGGGAGTGTCCCGGGATAACAATTAAGGGCCAACCCGGACAGGGTTTAGCGCGTACGTATTGCACTATGCCAACGCCCCGGTGCTGACACGCGCAAATGGACGTTATGATTGCGCGTGGAAAGTCTTAGTATGAATGCTCTCAGTAAATAGTAATGAATTATCAAAGGTATAGTAATATCTTTTATGTTCATGGGATATTTGTAACCGATGGAAAACCTGCTTTGGCAGATTTCCCTGTATTGCTGAAGGTGTGATTTCTCTGCAGATTTCACATCCTATCATAGGACGTTTCTATAAGATGCGTGTTTCCTTGAGATTTAACATTTACAACCTTTTAAGTCGCTTTTATTAACACGCGGTTATCGTTTCTAACACGATGTGAATATTATCTGTGGCTAGATAGTAAAGGACTAAATGAGACGAGTTGTGAACCGTTTAGTTCACGATGAAACACAATTCAAGTTAAATCTTTCTAAGACGTACTTGAATATTTCGTCGTAAATGGCATACGGCTCCATTGGTAAAACCTTCCATGTGATACGGGGCGCGTAGTTTGCAAGCTTTATCGTTTTATCGTTCAATCTGGTCTACTCCTTGTTTTGTTGGCTTATTTATGTCAAGACCATATTAGGAATGTTTTCACTTAATAGGGTATGCTTGCCAAACAAAGTGCGGTTTATGCTGGGATGTCGGGGAAACAGACTCGACAGATGTATGGTAAGGCCAACGTGCTCAAATCTTCATACAGAAAGATTTTGAAAGTACATATTTTAACCGCTAGATGAAGAGACTGACAAGCATGGAGCGACAAATGAATAAAACGAATAATCTGCTGATCCTCCGTGGATCTCGTGCGTGTAAATATGCTTAATAGCACCATTTCTATGAGTTACCCTGATGTTGTAATTGCATGTATAGAACATAATGTCTCTGGAAGCATTCGAGCAATTGAGAGCAGGGATTTATGAAAAGCGATAATAATATGAAGGATTATTCCCTGGTGGTTGACTGATCACCATAACTGCTAATCATTCAAACTATTTAGTCCGGACAGCCAACACGCAGTCTGTCACTGTCACGGAAAGTGGTAAAACTGCAACCCAATTACTGCAGCAATCCCTCGTAATTAAGTGAATTTACATAATATCGTCCTGTTCGGAGGGAAGAACGCGGGATGTTCATTCTTCATCATTTTAATTGATGTATGCGTACTTTTCTGACGTTAGTCTCCGACGCAGGCTTCAATGACGGAGGCAGCGAGAATTCCCCGACCCTTTTTGCTCAAGGGATGTTAATTTGTTCAATCATTTGGTTAGGAAGCGGATGTTGCGGGTTGTTGTTCTGCCGTGCTGACTGTTCTTCGTTGACATGAGGTTGCCCGTATTCAGTCTCTATGATTTGTATTGTCTGAAGTTGTTTTACGTTAAGTTGATGTTCAGCAGATCAATTAATACGATACCTGCGTCATAATTGAATTATTTGACGTGGTTGAATGGCACCTCCACGCACGTTGTGACTTAGATGACATAAGGCCATTATCACTTTACGGGTCTCTTTCCGTGATCTCGACGATTGGGGCGGGGACTATAAGTTCTGTTATGTTCGGTC
>39
ATTAATTTAATTCTCAACCTTAATATTGTAACATTGCTGCAGGCTGTATCCATATCCTGCAGGCGACGGTTGCGTCCGAGCATTGCGGCTGTTGTGCTTCGTCGACTCGAATGCGACGCTGATTGATAATCTGTAGCCCAGAAAGGATCATGTAAGAGATCGCAGACGGGCTCGAACTGTCACAGGTCGCCCACTCCGGCCGACATTGGGTGAAGCTATGACTTAATGTTGTGTTTTACGATGACTTAATTGTTGCCTAATCTAGGTCAATATGCTGTCTATGCTTTTACGTTATCTCGTTTAAGTTAACACAATTGAAATGACGCCCATGCATCCGTCAGAATTTGTTGAGCTCCATACGTACTATCAATTCATATACCTATCATATTATTCTTCGTTGTCCCGACTCCTATTACTGGTCCTCAGCTGTGTATTACCACTGTAGTTTAAAATACTGCCGAAAGTGTTGGACCGACTGACCCTTATGCTTCTACGGAGTTATGTCCAGACAGGCCGTCCTCGATAGGATTGCATAATCCAGCAAATGCGTCGTGGAGGAAGATAGTGGATCGCATTTTCTGCCCGCGCCTCTCGGACGGTACTGTGCGCTCTCGCAGGCCGTCCAAAGGGTAATGAATTAACTGTTTACCTAAAGCCGATCTATGTTGGCGTAAATTATCGCTATCGTTGACGAATCCTTAATGATTTAAGAGCGGCCTCCGTGAAGATTAATGTTGCAATGAGATTCATGGAAATGTTTGCTTCAACAGACATAAGATAAATCATACCAACTCAACGGTGAAGTTCGCAGCGTAGCATTAATTCTAATAACATAGAATGTTTAAGAATTAAATTAAGCTATCCTAACATATCTGATTTACTGCTTACTTACCTATTTCCACGACTTGGTGTCAGCCTTAAATTATTAATGTAGCTCGTGTTATTAGTGGCCGCTCCGGCGCTAAGGTATTCATTGCCTGTTGTCTCTGGAATCCACCACTTGCCCTTAACAGGATGCATCTAACCAACTGTTGATCTGACTAACGCGAGCGCGAAGAGAAATGAGGAGTGGCTAAGCTGAGTCATAAGTTGAAAGTTTATTTCTTGGTGTCCTTCAGATGGTAGGCTGAGGCAAACTATAAGTGTAAGTTAATTTATAGTGTAATTATGGAGTGTCTTTAGTACTATTTAATACTTAGTAAGAGTTTACAAACCATCCAACAGGGAGTAAATCAACGGAGTATATCGGAAGTCTATCACTCTTTCGTCCTTCGCTGTCAGTAAGTGTTTGTTAGCGACGGCCTATGTTGGTCGCTGTACACGTTGTCAAACCTTGCGTACCTGTCTCTGCCGCGTGAGATAGTTGGCCGTTTAAATCCTTGTAATGGCTGTAAATATCTACAATGTGTTTTACTGTAACATTAGAGAGCTGTGGCGGCTGGGTAAAGTCGTCCGCTTTTACTTACGTTATTCAAGGCCTATTTTGGACTTGCTTTAGGTCAGGTCGCGCTGGTTGGTCCAATAATATGACTGTCCATCCGTAAGCCAAAGTAGGAAGCTGTGAGTGGCATGTCCACAGATACAACCATAAGTGTTTCAAGCAGTCTTACTGGTTACCTGGCGTGCGTTCGACATACAAGCAATGTCGACCCCCGTTCGCAGATGTAGAAAGTGCCCGCAAAGAAAGCCCAAGCGAGCTTAGTGTTGGTCAAAGTCGTCGTAGTTGAGTATTGATCCTTTGTACATGTGCTATGGGCGCTACTATACTGAGTGGTTATGAGTCGGTCATGTTCTCCGTGGCACTCTACTGTTGAGTATTCCATACCGGTTCGCTTTGCTGTGTATAGAGATCCATTGCTGACTCCCTAGCCAGCTGACAGAGATACGAGTTCGGACCTAATAGTGGCCCGCCGAGTACAAGGAGTGTGTTAATACTATTAATTAAATGAATGACTATAATGTTGTACCGGAGGTAGTATGGGCTTTCTTAAACAATCCCACTATTAGCTATGATATTTGCTAATGGATCCTTTCCGCGCACTTGCAGCAACTGGAAGTCGTCTTGCTATCAAAACGTCATGGAGGGCTCTGTTGACCCTATATGGACGGTGTCATACCACGGCCGTGATGCTTGCGGGCAGCGCTCAAATGAGTTGGTAAGGCCTTAACACCAATATTGTTAACGGGTAAAACAAGTCATGGCCTCTACATTTATCTAACACTTGCCAATATTCGTTTTCCTCGACTCGGTGGCATCGTCTCTCTCGGCATGGCGTGCCAGCTCTAGCAACGATGTTGCACTGCTAGTCGTCTATCTGAGCCAAGCTCTGGCGACCCTGTGCAGCGCTAGCAGCGATTTGAGCGGTTTCGCCAGACAATTTATGTGTTTACCAAAACCACAATCGTCCTATATGAGGTGTTATCCTGCCATGCCGACCAGGGTTGTCGATAGGTAGATGCGAGACTGGTAAGTAAGTGGGAAGCGTATGAGCATTGTAACTAGAGCCGATGACAGGGTGAGTGATGATGTCAGCCTGGATCTAACATATTGTCAGGTCTACTGCCACAAGAGACTTAATTTAAATCACAATTAGGATGTAATCATAGCTAGAGAATCTTTGGCAGAGTATGAGGCTATAGAAGAGATATATGTTAGTTAACAAAATTGAGTTGTAATGTTCACAGGTTGAATGACAAGTCACATCGAGACTACGTCTATGACACCACGTGCTCATTTCAATGTTATTTTGCTGTGTCCCTAACAACGCAGTTCCACTGTTAGCGACTGTACTGAGGTGACATTGCTCAACAGTTGATGATGTGAATAGTTCATTTCTTGGCCGTTCCTTAAGAGCGTCAGCGATAGTGAGTAGTACCGAGTGGCAAGGGAAAGCTCGAGTTGAGGCCGAGATCTGGTTGCTGCGACTTGCCACTGTGTAATCATTCACCAGTGCTAACAGAGTTAATGTTGCTCGTCAGATGAATATGTTGGATAATAAGGTCCGAGTTAACTATCGAGTGCACAAGTCAGGACAGGCTCCCAGCATTCTTCGTTCGCTCTGCGCTTACCTAGGCTATAGACCAGTACGAGCCTGATGGTTCGGGAGCGCATTTTATTAATGTTACATGTAGATTTATTTAGTTTTATTACTGCTGGATCGGACTATGTTCTGCCAACTTTCAGTTGATCGGACTTTCTTGCTCCCTTGCTAGCTGGATTAAGCTCGAGCTATCATCAATGATTTGTAGTTTGGACTGTCCGTCATCGTTGATACAAGCGTTTAACGGTGGCGTGGCACGTAATGCAGTCATTGAATCCCACATCAGCGTTGGCTGTTTGTCGTAACAGCAATTAGTCGTCAATACACATATAGGCGAGGCCAGTGTCATCTAGGTTTAGTGGGGATATGCTGTCTCGTTGTACTCTTTCCGATGCTGGCCCATCCGTGGAAGATCAGTGCAAGAGTTTAGTGGCCAAGCGGACTTGCTTACATACATTGGCGACCCAGCGACAACAAGATATGAGGCCCGGGCCGAGTGCAGTGCTTCTGGTTGTCACACCTGATTTTCGCCTTATGAATTGCTTTTACGACAGGTTAGTTCGGTGTTTCTTAAGAGATACGACAACGTATGAAGTGTTATTGAATTTATGTTTTATAGTGGAATGCATAAACTCTACTTCCATTTACGACAGCGACAGGTCTTCATGGGGCCGTAGGTTAATAGCTGGACGCAAGTGCTTTGTGCATACGACACATAATTCTTATTTATGACATCAGCCAGCCAAACTTGCTTTCAGTACTAGTGCCACCCAGCGGAGATGGCGCTCGCTTGTATACAAGAGAGCTCATAGGCGCAAACCTTGCACCGAGAAGTATGAATGCATCCGTGCGTTCGGCCCCTGTGTGCGCCAGATGGCGCTCCCGCTTTCGGGGTCCTCGTCCCTTCCAACCGTAACAGCGCCATCCTGTCAGGCTATAGGGGCTATCTTATGTCTGATAGTACCGGATACACATAAAATATCCAACGGTTGAATGTCAGACAGAATTAAATTGGCGATAGTGGGAGGAGTCGTTGTTACGGATGTTAGCCAGAACAACTTATTCAGGCTGTAAGCTGACGTGTTATATTAGACGAAGCGGATGACTAGCCGTAAAGCGAGCCAGAGTGTCAGGCGATCTAGGAGATAAACATTGGATAGGAGTCTTCAGTGTTTAGGCGTTGTTAAAGGTCTAAGTCGGAGCCATAAGCATACGGGAGAGCAGCAGTCACAGAGCTGTTAGTCGCAGGTAATACGTAGGCGATTTAAACATAGTCGACAGGAGTGAATTCAGCGGCGACTGTCATCAGGTCGTCCGTTCGTCGTCAATTGATAAATGTTTGTTAAGATAGATTAAGTTAGCGTTGGGTCAGAGAGCCACCGGTTACAAACTGAGGACCAGAAGCAGAAGTATTAGGAGTCGAGAGGGCTTTCGCTTTATAGGTCAAGTCTTCCCATAGATGTTGTAAAGCCCTGATTGTACATATTGGGAGACGAACAAGTGATAGAGACGGTATTTGTCGGCCCATTAGTCATCCTAAGTGTTCATAAACTGGATGAATTAGAGTCACTTGAGAGCTATGTTAAGTGTCAATGATCACGGTCTATATCAACATGTTTATGTTTCAGGAATCCATTTGATGCTTATGAGTATGTCGGTTTCGTAGGGTGCGCATCCTTCGCGGCGCGAACCAATGTAGTAGGAGGGAGGGGGAGCGAGTGATGATCAACGCGATGTTGCGTACGCGAGGAAACAAGATGTTAATACATGCTATGGTTCGTAGTTATGAGAGTGATATTGCGAGTTTAAGCTATCGTTCTGCAGTCTTATGCAAACTGGTTTTCAGGGTGCACGGCCTTTGATCATGTTAACAACTAGGCTCTTAGAGCCAGACATGAAAGGCGTAAATGGCATTGACTATGGAGCTACGTAAAATTTTAGGATGCGCACTGCACAACGTGATTTCTCTGCAGCTGTCACGATTTAGCATCGTCGCGGGGCATTGCTCCCATCCGGTCAAACGCAGATCCAACCTTAATGTCCTTGCGTAATTAAGTAAGTACCGCGGTCATGTCCTTAACAAAGTCAGTGCCATCAACTGCTGGTTTCATTACTCCTGCCTAGCTGAGACCTAACGCCACCAGAGCATGCCATTTATTAGTATCAGGAAAGGCGTAGATGTCTTTCGTTAGAACGTAGGCTGATCCTGGTTAATGAGGCATGATCAGGCCTTACGAGATGAGATGGCTAACCTGGGAGCGATAGCTTTAAGTATTGAATTCTGGCGGTGATATTACAATTCCGTATGCTGTAGGCGTTAAAATCAAAGAGTGGGCTAAAGTTTCAGCCAGAGCTTCCCATAGAGCGTTGCGGGTCGAGTAGCCACTTCGTCGTTTATATGGCTACCAATGCTGGTATAATATCTTAGGGGTGCTGGTTTTAACCATTAGCGTATGTTCTGTGCCGGGCATCTAGCAACATCTGGGGTCATGGAGACCGAAGCTAAGCTGGCATTTTAGGCCCGTGGCGTCGTCGAAGACCATCCATCCGAGGCGATTTAAAACAGGTGGGGGCCTTTTTGCCATGTCGTCTGTGAGTTCATGTGCTCTTTCCTTCGCGCTGGCGACCGTAGTAGTGGCTAAGGGAGGAGCTGGATAACAAGCCAATTAGGCATCAACAGCTAC
>40
AGATGCGGGTCGTCCATCGCTCGCCTAGTTCTCACGAATGTCGCAAGGCGACGTAAGAGGAGTGCTGCTCCGACCGTTACACTTTCCACATGCAGGATTTGGAACCTCTTGCAGTATATACTGGAATGAGTTGCAGGTCCTTCACCATTGCGGCGTGCATGGATAAGTCGCTTAATGTTCGTAAAAGCAGAGAGCAAAGTACGTGAGGTGGATCCTGGTTCATCGACACGAACTAGATAATGACTTTCGCCAACGACATTACTAATCTTGTGATAGTAAATAAACCAATTGCATGTCCAGAGCTCATTCGAAGCAGATTTCTGGGAGTGTCATAAAACAATTTAGTGAATTTATCATCGTCCATTGAATCTGTGGTTCTCATTACGTCTTAACTCTTCATATTTAGAAATGAAATATGGGTTCCATATTTGAAAGTTTTCATCACTACTTAGTTTTGATAGCTTCAAGCCAGTTGTCTTTTTCTATCTATACTCATCGCTCATTAAACAAACCGTCAAAGGCAAACCCTGATTTTAATGCTGGCAGCATTCTTGAGTCAATAAAAAGTGTACCTTTTGCTGGGTCAGGTTGTTCGTATGGAAGAGAAGGCAGGCAGGAAGCACGGAACAAGCGATCCGAAGATATCCTTTGGGATTCTTGACTCGGCTTACTATTTCAGGGCCTTTCTATTAGTTAGAAATCATTCCATTCAAAATTGTTTACCCATTTACGATAAAAGCATGAATGTTCGTGCTGGCATAGAATTAACCGTCAGCAAAAGGTATAGTTAATCGGCGTACAGCACTTTCTATTAAATGAAAGTGGAATGGACAATTCTGGCAAACCATTTAACACACGTGCGAACTGTCCATGAATTTCTGAAAGAGTTACCAGCCTCTAAGTAATGAGGTGTTACACGACGCTTTCATTTCAATGTCGGCTAATCGATTTGGCCATACTACTAAAGCTGAATAGCTTTAAGAAGGTTATGTTAAACCATCATGCTTTGCTGAGATGACATAGTAGTCAATGCTTTCGGAAGGCATTTCAGGGAGTGACTGAATTTTATCTATTAATGAATAAGTGCTTATTTCTTCTTTTGACTACAAAACCAATTTAACATTTCTAGGATATCGCATTTTCACATGCTCATCAAAGACAGTAAGATAAAACATTGTAACAAAGGAATAGTCATTCCAACCATCTGCTCGTGAATGCTTATTTTTCTACTGCAGGAACCGCCTCTTTCCTCGCGCCTCCAGCCTCCACCTCCTGCTATTCTGCCGCCTAAATAACCGCAATTTATTTGGCGGCAACACAGGATCTCTTTTAAGTTACTCTCTATTACATACGTTTTCCATCTAAAAATTAGTAGTATTGAACTTAACGGGGCATCGTATTAGTTTTCCATATTGCTTCTGCTTCCTTTTGGATAACCCACGTACTTGCTGTCCATGGTGCCTCTTTTATACAACGATAGTCTATTAATGCATATAGTATCGCCAAACGATTAGCTCTTCAGGCTTCTGAAGAAGCGTTTCAATATAGATAAGCCGATAGATAGCCACGGACTTCGTAGCCGCTTTTCATAGTGTTAACTTCCGCTCCCTCATCAACAGACTTCGAATATAAGAAGCGCTGGAGGCGAGATAGAAGTCGTGAAAGAAAGAAGTCAGCTGCGTCGTTTGACATCACTTGCTATCTTCTTACCTGGTTATGCAGGTCGTAGTGGTGGCACATTGCACTAGATTGCGAGGCTTTGTGCTTCTGGAGTGCGACAGTTGATGACAAATTAGGCAAGAAGACAAAAATCATTGCTAATGCTCTGTTACAGGTCACTAATACCATCCGCATAGTTGATTCATAGTGACTGCATATGTTGTGTTTACAGTATTATGTAGTCTTTTTATGCAAATCTAATTTAATATATTGATATTTATATCATTTTACGTTTCTCGTTCAGCTTTTATGACGTATGAGCCAAACGGGAAAGTAAAGACAAATAAAGTTGTTTAATACGTTAAGTGAGATGGCATTGCACGCCATCGTGGCAGAGATGATTATCGCCTCCTCCCAGTAATCAGGCGCTGCCGGAACGCATGGCTGGTTAATCCCGAGCCATCGCGCCTGGCACCTATTCATCGACATCACCTACGTTCTATATCCGGGAATTAAACGGTAAAATGGCGTATGCGTCCGTCATCGCCTTTCGGCGCGGATGCGCCATCGTACCCGGTTTACCAAAGTCGATACGCGTCCGGCAACGCCGTCGCATTGCTACAGACCAGAGCCAAACCTTGCGGTATACGCATATCGGGGTAATAGTCTACTCAACACCCAGTGCCCCAGCCGAGCCGCGTTGGCGCGTCCCGGTCGTATGCAGGTGGACAACAAAACTTTCGTTCCTCGCAGGAAGTACGTAGCACAGATGCAGTGGATATTATCACATCGTATGAGATGCCGTTAAAGACGGACGACGCGTCGTAATAGCCGCCATCGCGCAAATCGTTACTATCTAGTTTCATGAACCCTCCTTTCTTGTTGCCAAAAGTGTAGCCAGACCCTCGCACGCGGACTTCTCGTTATTGGCAAATGTTTCATCCTGTACCGCGGTGTTAACCGCTGCGGTCAGACGCTGCAACTGTTGCCGGGAGAGTACGACCTCACGGCGGGGCATATCTAAGCTGTGGGGTTTGCCAACAGATGCAGCCCCTGTTCACGCATTTGCATAAGCTAGAAAATTCAGCACTTAGTTCAGCCGCCCCTGGCCCCGATCGCCCATAAAGAGGCCGCATCAGGCAACCGTTCAACGAGACTCACGGTACAGCGCAGGGTCTCCGCATTCTGCCTTCGGGTCACCCCTGTTGCTGCCGATCCCCAATTCGCCGATCACAGGCTGAATTTTAGGCGCTACCAACAAAAGCAATTGCCCATAAGTCGCTGCGCTCACCCAACCAACATTTAAACAGTTGGGTGGTTTCCCGGCTACGACCATCACCGCGTTTCTGAGTGTAAGGCAAGTACTTGCCCCCTTTAGGCTTTACCGAGGCGACTGTGCACCAATTTCTGCAGGGTGTTCAACTAGGCAGAGTTCTAAATCCACTCATGTTACAGTGAGATCTCGTCGGCAATCGATACTTCAGTACAGGTGCACTTCGTTGCTCCCGATTCCATGTAAGCGCATCCGGTAATCGATCAATCGCCGCGATTTCATGACGATGCGCCGCCATCAGGCGGGCGAAGCCCACCATATCGCGCTCATCCCATTCGCCATCCATGCATTTAGAACAGGTTTTCTGGCACATAGCCTTTCCACAGACTGTGCATGCGTTATCCCTATCCCGCCAACCGTTGTAATATCTAGAATAACCATTGCGGAAGGGTCAGAAAACGCTGGCGCGCTTCGCTTTGGCTTGCCGTATTGCAACGCCATTTCATCGCCACTTCCACGCTACGGAACCGTGGCCCCAAGCCAAAACGAGCGGTTGCGGGGCTTTCAACAGTTTGCGGCACAGCTCAATACCGGCTGGCGCCCGGGCTGATACCGCCAAACGACTTGCAGACTTGGATATCATTGTTTGCGACTTCATCGCCGCATTAAGCTTGTGCGGTGATTAGCCGTGTAATCGCCGCCCACCAGGACGACATACCGTCAACTGAGGCGTGCCGTCAAAAATCAGCTCGCAACCTTCAGCGCTCACCAAGGATAAACCGGCAGAGGGAGGTCATGGATGTATGGGTATCAGATATGAGTTGGTCAAACGCAAGATCGTCCGTTGTCATAATCACTTGTAAACCAAAACTTGAAAGATTTAGGTTACAAGTCACCCGAATTAACAACAAACACGTTTGGAGAAGCCCGGCTCACCGCTGGACACCTTGCAAGTCACAGAATTATTTGAAAAACCGTTGCTGAGTGCTGTTGAAGCCAGCATGCTGCATCGCCCACTAGCATTCAGATTAACGTTGAGCTGTATTACAAATCGGCTAGTCCTGTCAGTGCGCTCGAGTGTCCGGGAAGATTGCAAATACTGCCCAACAAAACCGGTAGGCTGGAATAGAAGCGGTTGATGGAAGTTGAACAGGTGCTGATTAGAGTCAGGGGCGAAAACGCGGCAAATGAATCAGCGCCTTTATGGGCCTAGGCGTGGAAGAATCCCACGAACGCGATATGCCGTACCTGGAACAAATGGTGCAGGGTAAAGCGTGACGGCTGGAGGCGTGACCCTCCGTTGAAGGAAATAGAAGGCGCGAACGCCGGTGGTACGTTTACAACCAACACCGTGACATCTCTTAGCCGGAGTTTTACGGCGACATCATCGCCCACGCACTTATCAGGAACGCCTCGATACGCTTGGAAAGGGTGCGCGATGCGGATCGGTTATGTTCTTAGCGGCATTGTGGGCTGCTGAAACGGTAAAGATCGCGCCGGATTATTGCTGCAACTGAGATAATCAGACAGGAGCGTGCTAAACATTAGTGAGATGAAAGGCACGAGCGGGTTGGCCGACTACCATCGTCAATGCCTTTGATTTGACCGCACCATTGCGCTTCCCACAAATCATCGTATCCAATCCTCTTACGTCGCCTTTCTGCCGGACGCGATGCAGATGAACGAACAGACTCAGGCGATGTGCTTTATGGCAGGCTGAATTTCACGTGCAAACTCGTATCTCTCGCCGAATCCCAGCAAAGCCTAACGTTCGTGACTGTTCCCGACATCTGGAAGGAAGATAAGGAACCAGGGAATCTCTTAACATCTCGTTAGCGGCATGGTATACGAACAACACCGACAGTGATCAGAGCAGCATGACGAGCTGGCAGGGAGAACAACGCGGCGCTCGATGCGCTAGGCGTTGCCGATGCCTGCGTCGGCCGTTATCTTACGGTGCACCGGAACGAGCTATGGTGGCTATCACCGTATCTGAACTTTTCCATGACGATTATTTGCTTTAAGCCATCATCCGCAAATTATCCGTGCCTGGCAGCAGGGGGCGGAGCAATTTGGCATTAGAGGGTGGGGGCGGCTCCATAAGTCAGCGGTTATAGCGTGGTCATCAGGCACTGGAAGAAGAGCCGGATGGATGGCTATTCCGGGCACTGCTGTTTATCTCTGGTTCGCCGCTAATCAGGCAGAGTCTCAGTCCGCGATGATGAAGCGAAGGGGGACCGTGACTTGCTGCCGACCGGCTTAGCCAGTCCTCATGTGCTGGAAGCTGCCGTTTAAGCCCGTCGCAGCTTGCAGGAATTGGCGCAGAAGTATGGCCATAGCTTTAGCGATTGCTTGCTTCCCCTGTCTAGGCAGCAAATGGTGACAGAAGGCGTGTTTCAGGCGGCGGCTGATTAAAATGAAGCGGAAATCCCAGCAGGTAACGCAACAGCACAATGGCTGGTTGATGGTCGATGGAACGGACGGGCGTTATCGGGGAGGCAGGGGGCGCGGCGGGGCCTTACTCCTGCGGCCTCCCAATTGGTAATGGACTTTCTCGGCTGCAAAGGGATTTGGCGTCAGCGGGGCAGCGCTTGCTTTGCTCCAGTACGGTGGCGGATTATCTGCGTTACAGCACTTATCAGTATGCCGCCGCTCAGGCGCAATTAGTCCGTCGCTGGCGGTCCTTCGAAGTGGGCACTAGATATGGCACGCGAGGCTATCCCCCGTTCGTTACAGTACAGGATTTGCCGTTTACCGCTTTAATTCATGCAGCGCCGATCGAGCCGTGTTGATAACAGCCGTGCGTTACAAACTGGCAGAAAAACTGCGTCAGCAAGGCTGCTGGGTCACGGCGATTCGCCCGCCAACCGTACCCCTGGTACTGCGCGACTGCACTTAACAGGACGCTGCACAAACGAATTGCAGGATATCGACCCGTTGCTGGAGGTGCTGCATGGCAAATGAGGTTAATAAACGAGGCCATTGCGAGCGGCATTGGTCGGGCAGCCGACACTATGAGCAACATGCAGATCTAAGCGCCATATTATCTGCTGACCCTTACTGGCAATGCTTCCACAGCGTAATATACAGCACGTACTGACGGGGTTGGGACGGCTGGATGAGCCGCCACTGGCGGGAACGTCAACACGCAGGTGACGGCCTTAGATCTCTCGCCGCCCCAATGCTGTTCAACGCTAGAGGATGCCGCAAGACCATTATCTGGCGGGAGATGGTGAATCCTGCCGTTAGCGACTGCGACGTTCGATCTGCATGAGGCGCATCCGCAGTGCATGTGGTGCGGGCTCTTTCTTACGGGGTCGCGCGAGCTCCCTGGTGCGCCGAGACGCGTGGTCCCGTTACCACGCTGATCGGTGCAGGGATCGTTACCCGAACTGCATGGAGTACAGAGGGGGCATCCAGCGTCCACATGCACGGTGCCCTTTTACCGCTGGCAATCGAGCCGTCACTGGATGGCGTGCATTATCAACATCATATTCAGCGACCCTTGTTGATGATGCGCTCAGTGCGATGCGTTCGCTGAAAGGCATCGGTGCCGCATCTTCATGAAGGGCGCGACCTAGAAATATTAACGCGTTCACAGTTGCAGCGATTGCAACTGTGGCCTGAGGAAGCAAGGCAGGTATCTATGGTATCATCTTTTGGCGATTAACGTGAGCCTCCTTTATTTTGTCTACAAGCGCTCCGCAAATTAGGAAAACTGTCACCGTTGTGCCTTTTACAACCGCAACGAGCGGGGGACCAGGTTATAAACCGGTTCCCTCTGGCAGCGAAGACCCCGGAAGGTTTACGCAAGCGACGCTGGCGTTACAGCACGATGCTGAAGCCTGCAAGCTGGATTACGCAACAGTAAATCCTTACATTCCGCAGAACCCACTTCGCCGCACATCATCAGCGCACCAGGAAGGAGGAAGCCAGGGCAAGCCGATTACGCACTGTAACAGGCTGACTGGGTGTTAGTGGAAGGTGCTGGCGGCTGTTGAGCACGCCGCTTTCTGACATTTCACCTTTGCAGATTGGTAACAAGAGGAACTGCCGGTGATACTGGGTGGTCTGTGAAACTCGGCTGTATTAATCACGCGATGTTGACTGCACAGGTAATACAACACGCCGGGTGACTGATACTGGCGGGTCGTGGGCGAACGAATCTTCTAAGCGGGAGATTAGCCCTGGATGACTCGCGCTCGCCAGATTCTCCGCGCCTGCTGGGAGATTCAGTCCTCGTAACAGTGCAGGAAAATCCAGAAAATGCGGCATGAAGGAAAGTACATAAACCTTGCCTTGTTGTAGCCATTCTGTATTTGGTTACACTGCAGCGAGATGCGTCTTCGACGATTGACTGCATTTAACCGTGCCAAATTCACTAGATAATCAATAAATTCGTCAGACAGTTAAGCGAATGTGGGAATTGCCCAGGCGGCGGGGGAATAGGCTGGAGACAGTTATCCACTATTCCTGTGGATAACCCGGTGTATTAGAGTATAGAAAGCCGCGGCAAGCGACGAGTACCGCGGCTTGCACGCGAATTGGCGTTAAAGACGGCTCAAAGAATATCTTTTATTTTAACTGGTTAGATAAATGCAATGGCAGTCACTGACAGGCATCTCTTGCCTCATAAAACTGTCATCACTCATCGTGACAAATGTTAAAAAGCCCGTCCGTTGGGGACCGGTGGAGTTTAACCCTAAGTACGTGCTCATGATTGACGGAGTTACCGCTGCAATTATGGTATCAGAACTTTTGAGTAGCGTGTTGGCGACGCTTAAATACGACGATAATTGAGCTTACCACCAACGTCAGACCTCATGAACAACCGTTCAAACTGAATTCCGGTTTAAACCTTCTGGCGATCGCTCCGGGAATTCGACGTCTCGAAGGGGCTGGAAGATACGGCCCCTAGCAGACGTTACTGTGGCGTGACTGGCTCACCGGGAAAACCTTCACCATTGCCAATGTCATTGCTTATTCAGCGCCCAACCATGGTACTTGCGCCCAACAAAACGCTGGCGGCCCCGAGGGGGAAGGGAAGTTCTCCTTGGGAAATTCGCGGTGCATCTTTCGTTCCTCCCGCTCGCCTGGAAGCCTTACTCCCCAAGTTCCAGCTTTCATTGAGAAAGATGCCTCGGTTAACGGAACATATTGAGCAATGCGTTTTAAAGCGGCATTGCTGGAGCGGCGTATTTGGTGGCGTCTTTCCGCGATTTATGGTCTGGCAGTCCTGATTATATCAAGACTGATGCTCCATCTCACGGTCGGTATGATTATCGATCAGCGCGATTCCCGACTGAGAGCTGCAATACGCTCGTAATGATGCTCATTCCAGCGTGATTTCAGCGTTCGTGGCCAGGTATAGATATGTCCCAACGATCAAATCGATGCACTTCGCGTGGAACTGTTTGACGAGGAAGTGGAACGATTGTCGTTATTTGACCCGCTGACCGGGCAGATTGTTCCACTATTCCGTTTTACCCAGCCGAAGGAACGCAAACCGCGAGGATCTCAGGCGATGGAGGGTCAAAGAAGAGCTGGCCGCCAGACGAAGTGCTGTTGGAAAACAACAAAACTGCTGAAGAGCAGCGTGAGTATCCCAGCGTACGCAGTTTGGAGACTCTGGCTGGCGGCTACTGTTCGGGGGATTGAAAACTACCCCTTCCTCTCCGTCTGCTGACTCGGCGCCACCGACGCCTGATGTTGATCGCCTGCTTGAATGGCTGCTGGTCGTCAATGAATCTCACGTCACCATTCCACAATTGGCGGCATGTATCGCGGTACGGGCTAGGCGTAAGAGACACTGGTAGAATGGCCCTTCGCCTGCCATCAGCTGGATAACCGTCCCTTAAGTTGAAGAGTTCGAAGCATTAGCGCCGCAACCATCTAGTTTCGCGACGCACTCGTACCGCTCGCAAATCCGGGGATGCTTCGATTCGCCTTCAGGTGCGTCCAACCGGATTGCTTGACCCGTAGAAGTGCGGCCTGCAGCGGTGATGAAAACTCGTGGAATGAGTGGAAGAGGCATGAGATCTCTGGTCAGGACCAAGCGGATGAGTGGAAATCTTACCGAATATCTCGAAGAACATGGCGAGCGCGTGCGTTATCTTGCTCAGATATCGACACGTCGAACTTATGGGATTATCCGCGACTTGCGTCTGGTGAGTTCGACGTGCTGGTAGGGATCAACTTACTGCGCGGATCTCGTAGAGGTTAGTGAATCCTCGACGGTAGGGAGCGTCGAACTGCGTTCCATGGTTCGTCCAACCATTGGTCGTGCGGCACGTAGCTGACGTTAACGGTAAAGGGATTCTCTACGGCGATATCGATCACGCTCCTGGCGAAAGCGATTGGCGATGAAACGTCGCCGTGGAAACAGCAGAAGTACAACGAGGAATAGGGGATTACGCCGCAAGGCTTGAACAAGAAAGTGGTCGATATCCTGGCGCTGGGCAGAACATTGCCAAACCAAAGGCACGGCAGAGGAAAATCCACCGATTTGAGCCCCGGATAATGTGCCGTATGAGACGCTCCCGCAGAAGCGTATCGCAGCAGAAGCATGAGCTGGAAGGGTTGATGATGCAACGGGCAGAACTGGAGTTCGAAGAAGCGGCAGCAAATTCTTACGTGACCAGTTGCATCACTGCGTGAGCTGTTTATCGCGGCATCGTAACAGCGGAGCGAAAGAAGACTGATGACAAACGGAAAACTCGACGCTCTGCTACGGTCCAGCCTACATTTCTCCGCATATCACTCTGAGGTTTGCGCGTTGTAGCGCTCCACTGCAGTTCGCGCATCCGGCATAAGCCTCCGCCTTTGTCTTCGGAAACGGAATTTCCTTCGGATTTCCGTAACCTAAAGCCTGTAACGCCTTTTCCAGCGCGTATGTAACAACCGTCATCGCTCCGATATAGTGGCGGTACACTGGATCACAATGCTCTTTCACCCAGACATCCACTTTTGGCCGACGACTCGCATCAAACCTTTTACCAACATACTGCTCCATAATTGCCAGCTTGCTTTCCAGCTTCAATTAGCCGAAGGCACGCGCATGGAGACTCAACCATCCAAGTGCGTCCCGATCGATCCATGGGCGGTTCGTAATTCAGCAGCAGATTGGCATCAGGCTGTATAAAAACTGCTCAGAACAGATGATGAGATGCTTCATTGATAGCGTGAAATCTCGATACGCGTTGCGGGTATACACTAGGGCGTTAACAATAACTCTTGAATCGGCGTAGTTAACTGCTATCTCCCCGTAAACTTCACTGCTAGTACGTCAATCGCCATCAGATCAACAGGATGCTCTTAACATTGGAATCAAATGCGTATCCACTTTCAGCTACAGATTACGAATTAAATTGATGGCTTCCAGAGGCTACAGCACGCTAAGGTGATCCCCAGCGCTTTAACATCAAGTTTCCGAGATTATGACCGGGAAGCTTCGCCATTGCCACCAAAAACGGGCTTCAAACATCGCGGAGGCGACGCTCGTTGCGTTATCAGCTTGGTTTGAGGCAGTTAAGAGCTCCCAGGCAATGCGCCTTCTGAACGGCGAATACGCCCCGTGCGCTCGCATTATCGGTGGCGCTCCTCGAATTCGACCCGCAGAGCCTCGCGAGAAGGGAAGGGATTCCCTTCCCTGCCTCCGCCGGACGACGATCAAGATCAGCCAGCGTACGATTTAAATATAGATTCCTGGAGTAATTATCCGCCTACATCGCCCAAATTGCGGGGAAGCAATTACCTGCCAATATTGAGGATACAAACTATTTCTTCTATCTAAAGGACGATGCACGCTCTGCCTCCCTGATGATGTATCAAAGTAAAACGCCATTTCTAGTCTTACGACCGCCGTACGTAGCTATACATGATTACAGAGCGAAGGTGTGGATCAAATGGTAGTACCATTTACTAATGAGACGCTAAACATCCTCCTCTGCATACGTGATACGATCGTCCGTGGACAATGCTCGTAAGATTGCGCCAGGGCGGAAGAAATGACTTCGCCTCCGTATGGAGATGATGCTGGCTTCACAACTATGACTGATGCATTTGCCGCGTAGTTTACTTGCCTGCGATTACCGATGTGTATTTCGTTAAAGTCAATAAAGTAGGGGGCAGGCTAGGAGGAGAAATGCCGGAGACCGGCTTCTTGGGGTCACGGGCAGTTGAATCCGCGCCTTCGCCGAATATGAGGCGGTACAGATGAGAGGGAGCCGTCTTTATCGCGCGACTTTGCCCGATATCATCGCCGCTGTGCGGGAAAACGACGTATAAGCCAGATTGCGTCACAACCAATGGTTACCGTCTGGAACGCGATGTAGCGAGCTGGCGCGATGCGGGACTTACTGGCATTAACGTCAGCGTGGACAGTCTGGACCCGCCAGTTTCACGCGTACTAATGAGGGGTAGATTCAACCATCCTGGCGGGGATTCGATGCTGCTGCATTTGAGGCCGGTTTTGGAAGGTCAAAGTCAATACCGTTGAGCTGATGCGTTGAGATGT
>41
GTCCCTGTTTGTAGCTTAATGGAGGGTCCCCCGTTGTTGAGGCACAGCCGGGGAAATGTGCTGCTGTGTGTGCTGTTTGGTTCATCAGTGCCGAATCCACAATTTACTGCGGCGGACGCGAGCTGCTGCACCATATTCCTGAACAACTGAGCAAACGAGAGAGACTACAACAAATGGCAGCATAGCACACTCCCTCTGAGTCACCGGGCAATGGCGCATCTGCCTGTTACGGGGATTTACAACCGACAGTGGTCGCCTCGACCGTCGATTGAGAAAACGGGGCTGAAGCCATCCGGGCAACGCGCACAGCTCCCGGCGTCGTCCGGAACTGAGGGCTGGTATCGAAAGGTAGCCTATTGCACGAACCGGCGGGGCTTTAACGCAGGGAGTCCACTCTGCTCTAGAGTCCCCTGAGACTGGTCATGCTCCATATCCTTTCGATGTCGCGAGATACAGGATGTAGAGGGCCGATATGCGATTTAGGCGGGCTGCCGCCATTGCACCGTACCGGTTCTTTACCGCCGGAGCCAGCGGTGCAGCATGGGGCAGCCATTCGAGCGGTATGACTCGGCATCCTTCTTTCTCGCTTGCTCATCGTACTCTCGTATTACGCCCCAATTCCTGGCACCAGCCGAGACCACCGATCTCAGACGACTAAGCACATACGTAAACCATGATTTCTCCTCACTGGATAACATGGTTGCCCAGGGCAATGTTCTTCGACTTTATGTAGGAACCGCGCGTGGGGTCACGCGTGGTTTCTCAGGAGATCAGCCATCACGGCAGACGAAGACCGGACGGTGTCAGGTTGGTGATTGGTCTGATGCAAAATGTTTTATGTGAAACCGCCTGCGGGCGGTCTTCATTTATGGAGCGTGAGGAATGGGTAAGGAAGCAGTAAGGCATCCCCCGCGCGAATGAAGGACAACCTGAAGTCCACGAAGTTGCTGAGTGGTTACAATTAGAGCCGATCAGCGAAGGGCCGATTGAAGGTCTAGTTGATACCGTAAAGCGTGCTGATGAACAGTACGCCGTTGAGCAACAAGGGGAGGCTCCCAACATATCCGGTGTCACGGTGTGTTCCGGGCTGGTGAGCGGAGCAGACTCCGCCGGAGGATTTGAAGCTCCCTAACGGCGACGGTGCTGGGTACGGAAATGGGAATATGAAAGAATCCGCCATTGGATAATGTCTGCAACATCATACGTCCTGCCTTTACTTTCGGTAGTGTACAGGCACTGGTGGAAACCACTCAAAGGGCTGACAGTGAATCCGTAGAAGTCCGCCTGCTGGTCAAACCAACGTGAGGTCTGGGTGACGGAAAGACAAGAGCCAGGACCCCCAAACCAGCGCGCAGAGCCGCGCCGAAGCCTCCGGCGTGGTATGGTACTGCATGCCGCCGCGCCCCAGGGACCGTTCCTACTGTACCCTAAGGTACCACGCTTAGAACGCCCACCACAGACCAGCTGCAGAACAAAACGCTCTGGTCGTCATACATGAAATCATCGATGCGAACCGTGCTACCCGAACACGGCACTGGTCGGCGTGCATGATAGACCGTTCGGCAGCCAGCATGAGCCGTAATTATCATCTGCTACGGGCGTATTCTGCAGGTGCCGTCGGAACGGACCGCAGCAGACCCGGCTTATCTGGGGGTTTAATGGGGCATACCCGACAACATCGCTCTGTGTCTGTGGGATATGCTGACCCATCCGCTACGCACTGGGGAAGCGTCTGTGAGTGCGGCGGATGTGTGATAAATGGGCTGTATGTCATCGGCCAGTACTGCGAGGTACAGTCAGTCCGCCGACGGTTTGGCGGCACGCTACGCGGCTGCTCTGCGTGGCTCCCGCGACATCCTAGCATTGCTTGCTCGAGCGATTTCTGCTCGCGATGCCTGCGGTGGGGACGGGCAGACGCTGACGTCGTCGTGCAGGGCTCGTCGGATAAGACGTGATTTATAACCGCAGTAATCGGTGATCGACTATTACGGCGCTAGAGCCTACATAATTGAGCGCCCTGAATAGACCGCCATAATGCCGTTGAGGTGAACTCGTACCGACTATGACGGCTGGAGACGGCGACAGATGTTGAGGACGCAGGCCATTGCCCGTTTACCCTTTCGTAATGTTACGAAATGAATGCATTCGCGTACCAGCCGGGGGCAGCCGCGCCGGGCTGTGGCGCTGATTAAAACAGAAGCCTTAGGCATGAAGCCGTGGATTTCGCGTCAGGCAAAGGGGGTTGGCTAAGTACCGGCGATGTTATTGAAGTGTATGCATCATCTATCATGCATGTATCGCTAGTCGTGGTCGTGTTAGTGAATCAACAGCCAGACTAAGCGACTAGCTAAACGCTCGACCGTGAACCGACTTACGCTGCCATCCTCCGGTACCGCGCTGATAAGCCTGGTTGACGGAAGGCAATCCCGGTCATAATCGTGGTGAGGTTCAGTCCGTCACCGACGGCGTGAAGGCTCCAACACGTGTTTAAATACATGTGCTGAATGGAGCTTATCGCAGCTGAAGCTGCGCCATCACGCTGCTAGCAGGCGGGTTTAAGTGAGTCGTACGTCGGACGACGGCACGTATGCCACATCACCGCCGTGCAGCGGCACTTGTCCGCAAAGAGGCCGATTAGATAACGGGGCTAATTCTATAGCGAGTAGCGGCCGACACGGTAGAATGGTGATCGCCACAGCGCTGCAGCGACATGGCAAGAAGTCACTGCAAGACAGCGGGGAATATCAGGTGCTGGCGCGATGGGACACACCGAAGGTGATGAGACACCGTGAGTTTCCTGCTCCGTCATGACATGGACGACGGCAGTGAGCGGCTGGTCAGCACGGCCCGGACGACGGAAACCACATACCATTCACGCAACTGGGCGCTGGTGGAACGAACTACGAGCTGACAGTCCGTGAAGTAATGCGTGGGGGCAGCACTAGGCGATCCAGCGTCGGTATCGTTCTGGCTCAATTGCCAGCGGCAGCATAGGGTCCGGATTGAGCTGACGCCGGGCTATTTTCGATAACCGCCACCCGGACTCTTGCCGTTTATGTATACGGACGGTACAGTTTGAGTTCTGGTTCTGGGGGCGAATTACCAGATGCCAGGGGTGAAGAGGCACCCGCATTGACTGCGTCTCGCGCTGTACTCTGGAGCTACTCCGCCGTATCAATATGGAACCGGGCCATGATTATTACTTTTTATATCCGCAGTGAACACCGTTGGCACGGGCATTCGTGGAGGCCGTCGGTCCCAGCGATGATGCGAGAAGAAGGTCCTGGATTTTCAAGGCAAGATAACCGAATCCCATCCGGCAAGGAGCTGCTGGAAAAGTCGAGTAACACAGAACCTCAGCAGACTGGAGGAGTTTCGAAAGAGTCGAAGGATGCCGTGATAATCGAATGCGTGAGTTTAGTCAAACGACGGCAAACATTATGTCGATGGCCTCAGCATGGAGGACACGAGAAAGCTAAACCTGAGTTTCTGGTTGCCCCGGCCAATCCGTATCGCATTTTATTGACCCGGCAAACGGGAATGAATAACGCCGATGTTTGTGGCGCAGGGCAACCAGATATTCATGAACGACGTGTTCCTGAAACCGCCTGACGGCCCCCACCATGCTTGAGGGGCGGCAATCCTCCGGCCTTTCCCTGGACAGCCGAAGCTGACCGCTAAATGGCGGATATCAGTGGCAATGCGTCGAACTCCGGGTAGACTCGTAAACCTAGCTGAAAACTGTACGATAAACGTGTACGCTCAGCGGAAACCGTCAGCGCTTGCTGGAGCAACAAGCTTTCCGGGGCGTGAGGCAATCCTGGCTTTAAGGTTTTATCGTGACGTACGTGTACGGACTCATCCTTTTGATCGCCAGATAGTGGTGCTTTGCTGACGTTTCTAGAAGTACAAGGTTATCTTCTAAGCAGGGACCGTGCCAGTGTTATCTGAAAATACTGGCTCCTGTGCGTCGTGTCTATGATGGCTAGGCTGAGAGGCGGTACAGGTATTTCCCCGTATTTGACATGCCAGCTCTGTAGGCATCGTGATCCTGACGTTCGCGTACGTCCACGGCATTCGGCATATATTCCGCCGTATGGTTGTAAGGCTTGCAGGTCTGGTAATTAAGAAACAGGCGCTGGCATCAGCGTGGTCTGAGTGTCAGAGGTTCGTCCGCGGGAACGGGCGTTGATTAACAGTGAGAGTGAACGATGCGTAATGTGTATTGCCGTTTGGCTGTCTTCCCCATCCTTGCGGGCCGACGGGTGGGACAGTCCAGATACTATGGTACGTTTGGCCTTAAGATTTCAAATGAAACCGACCTGACATTGCCGTCGTTGAACCGGGAGGACGATGTGTGAATCATTATGGAGCCTAGGATTAACGTGAGGTCGTTGGGCTGACGGCACCGTACCGACTGACGGTCACGTCACAAAGAACCCATAGAGCAGCACGGTAGTACCCTGGAGGATGGTTCATGAGAGCTGCGTACGTTATGTAGGCTGTAACCACCGGTACACGTTGACAGGTCAAGCAAGTCAATTGCTTCCCCGGTAGGGACCTGATAAGGATTACGTATTTAATGAATCGCGCTGGCTTGGATCAGGCAATCGCCAATCCTGGCAGCGAGACAGCCTGCGCGCGGGTCGATGCAGCATACAGTACCGTGGAATGCAGACCAATTAATCCGGCAGCGTCCGTCGTTGTTGATATTGCTTATGAAGCTCCGGCAGTGGCGACCCCGTACTGACGACGATTCATCGTTGGGGTAGCGTAGAGTGTAAATGTACTAGCCAGAGCACATAGAGTATTGACAGCCCCGCAGGCAGCGTAGGCGTGTATCGAGGCGGCAGTAAAGATTTCAGGAGTCCTGAAGACGGCACAGGAAAACCGGTAGAACTTAAGCACATTCAGCTGAAAGCCAGACGACTCACGCCCACGGTGGCTCGCGGTGAGCCAGAGGAATCGGATGAAGCCGGCTTACAGCATGGATGTGGAGTGAACCAGTACAGTCATCCTGCATAGTTGACGGTTTTCCCACCATCGCACGGATGACCATCACCAATTGTATGAAGATTCACAACCGGGGTGCTGAATGATTTTCTCTGTGCCATGACGAGGATGATGCCCGGCCCATCCTTGAATCGTCTTGCCATGGTATGTGAAGAGGTAGCGCGTAACGCGTCCGTGGTGGCGCCAATGAGCAAGCAGAAATCAGCCGGCGATGCCAGTGCATCAGCTGCTCAGTAATCTACAACATTGACTGCATACTGACTGCGCGCGCGCCGGCCGCCCGTCGACGCCGGACATAGGCTGCATCGTCAGCTCAGGAATGTCCGTTGATCGAAGCGGCATCAGCAAAGGCCACCTGAAGGCGACAAAATTGCAGCAGCCGGCAGTCCTCAAAACGCGGCGAACAGTTAGTGCCGGGCTAGCGAGAACGTCGAATGCCTGCAGCGTCACAACAATCAGCCGCCACGTCTGCTTCCACGCGGACCACGACGCGACGGCTTTAGGCGGCCGCCACTTCCGCCCAGATGCGGTAGGCCGCGGCAGCAAAGTATCAACCCCGGCCCGAACGCATCATCAAATCATTGAACGAACGGTTCGCAACGGCGGCAGAAGATTCTGCCAGGCGGCAAAACGTCCCAACGAATGCCAGGTCATCTGAAACAGCAAGGCTGACCGACGCGAGCTGCGCGGGAAGGAGGGCAGAAGGGAAGCAGGGATGGCGTCAGGGAACACGAAGGCAGCACGAAGGGTGAATAAGGAGTGCGGTGTAAGCATCGCAGAGCAATTGCGGCAGAAGCGGCGGCAAGATACGTAAAAATTCGGCAAAACGTGCGCAGATATAGCTTCAGCTGTCGCATGCGGAGTCCCTACAACGAGAAAGGGGATAGTGCAGCTCACGTCTAAACCGCCTCTCGACGTGCCCAACCGGTGCTGCGGCCAGGGCATTGCTGGTAATACGGTGAAACCAGTACGCGCTACGCGCTCTACGTCCTAACTGCATGACGGAACCGGCCACAGCACCAACCGCGCTCAGGGGAACAAACAAACCCAGATTGCAACCGCTTTGTAACTGAATTGCAGATGTTATCGACGCGTCACCTGACGCACTAACGGCGCTTGGTAACAAATGAATGAACTGGCGCAGCGCCCTCCACGGGAAACCAATCCAGATTTTGCTACCACCGACTCGCCTCATTGCCGTGACTGATCGACTGAGTACCGAGGGTGGCACACTCTAGATAC
>42
GTTGGTATTGCAGCGTCTGCTTGGGTTTATGGCATTGTGACATGAATAGCAATACGCTTCAGGAGTCCTCAAAGCAGGAAGCCAAGTCAGAACTCCCAACCATTCAGCTGGCGCACTCCCACCGCCGCAGTGCCGAATGGCTAGAATGCGACGCGACGCTCCGGCGTACATGATCGTACCGATGACGGTTTAATCTAATCTGCACCTTGACGGAACGTGGTACTCCCACTGTTTGCACGCCCGGAATACGCCTAGACGGGACTAGGAATGGCTAGAAGTGGAGATCCGCTCTCATGAACTTATTTTACTGTTACAATCCCACGGGGGCTGCGTGACCGCTTACTGCGTCTTGAACTTAGAGGGGTGGCACGCCGTGACCGTCCGTTAATCGAACGCCCGTAAGGATCCTCGGAAGGAGGACGATGCGATGCAGCCAGTCCGATAGCTGCGCATGCCGCATCTCACGCACTCTGCTGGTAACTGGACCATTGCAACTCAACGCCTCGCCAGCGGCATCAACGCGCCACGACGGATTTAACCGCCAAAGCTCCACACGGAATGCATCATTCTAAACGCCGGGAGCTCCGGTTCTAAAATAGAACGAAACCCGACGCTCCCACTGAAAATCCCAGCCAATGCTCCCAACCGCGGCACTCACGAGTTGCCGGTGCCTCGAGAATGGAAAGCCCGTACGGTGCGGCTTAAAAGCTATCAAGTTAAACACCCGATAAACGAAAGCGTCCAAGCCGGGTTTAGAGCGCGGGTGCATTATCCCTGAAAGGGAGCAAGAAAAGTCTCCACTTAGAAACGATGAAGGAAATGCCTGAACGTGACGGTTTATTCATTCCTCACGAAGCGGCAAAATTCATCCCTAGCACCGGGGACCGTCCCAACGCACGAGGACATAGAGTGCCATGTGGTACGCATCGCATTCTCCAGGCAGATGCCGCATCCAAACCTCGAAAGCCACCAGGCTCCCAGTGCGTCACTGAATTATAAAAAGAAGGCAGCTGAAGGACAATGAAGCTGGAAATGCACTGCTCCAAACGCCAACGCGATTAGATCCAACGGAAGAGAAACTGCATCTACGTGCACTAAATTCGAACGTGCACGCAGGACTTAGCTTCAGCTGTCTAAACCCACGTGCCAACGCGAAGGGATGGTGCAGCTCCACCATGAAGGCCCGTCTGACGGACTCAAAGTCCTGCCGGCCCGCTTCTATTCCGAAACTTTAAGTATGATGGAGCGAACGCTGAGAAAGCCAACCACGTTAGAAACGACCCCAACATCGACGGGCTCACGGGAAGCTCCTAACGACAGGTACCCCAAAATGATTGCAGGGACCTCAAATCATTTGACCCGATTGCCTTTGACGATCCTGTAGCGCACTTCAGAATCTCTACGCTGAGATGAACTGGCCGCAGCGACTCCAGGAGCAGCCCCGGGCAGTTTTGCCTGACCTCGCTCCTCACTCCCGACATTCATCCTCCCCAGGGATCCACGGCGACGATGTAGCTCCATGAAAGCGTTCTAAGCGACTCAATCTAATCTTTGCCCGCATCGAATGCTAAAGCCCGTAAGGCGCGAAGCACAAAATTGACTGCGGGATCCAACTGAAGGACGAATTCACGTTGCAATGTTCTTACGCACATCTCATTGGGGTCGCATTCACGGCTCATGGACGTTTCATTCGAGCAACGATGCCCGTGCCCGCGTGGCCGCATCACGGACTCCAATTACGCGATGTAAAGGCAACGGTTTAATCGATGCAGGATCGTTTGGCTTACAGCCCGGATATTGTCCATGTCCTACGTATCCACTCATCCACTCTTACTTCTAACGTAACGTATCGATCCGGGTAAATCTAAAGGAAATCTCAAGCACTAAGTCGTTTCATGTATTCTTAAGGAAGAAACGCATTAGATCTAAAGCCCACGATCTAAAGCGTGGAATTGACGCATATCCCGCATTTGGGGTCGCCAAATACCGCACGCCATCGCCCGTCGTTTGATCTAAGGCCGCAAGCTAAGCCAATACGGGATTTCGATTACGGCTGAGAAGCGAATCGAGAATCCTATAGAGCCATCCTGACGCCGTGACTCAACGGTTCATGGGACGTTACAAACCCTAAATGGTTATGCCCTGCCGCATGGAACGGTTCTTGGCATGGGCGTACGTAACGAATGCCGGATGCACGCGTCTCACTCCCAGGTTACGCCCACTAAAAAGGGATCTCAGCACGACTTGCCTTATTTAACGCCGAAGGACGGTTGCTGAATGCAGCCAAATCCACGGCTTGTTTGCCGGTGCGGCTTAGATCGATGGCGATGCAAGAAAGCACGTTGTAATGCCCGCTACTAGGAGCGTACGGTTATTACTAGCTTAGCCGCCTTGCCGCTTCTTTCAGTGACCTTGACAGCCCGCTCCGTTGTACTCACGCATGCCTGACGAACGCATTAAAGGCCTTGCGGTCTATCCGGTGCTATATCCTGGCACGTCGATGGCTCCCTGGCTGGACTAAGGCTCCACTAAATTTACGTATCTGACGGACTCCTACATCGAATTTATTGGGCTCGAAAGCGGCTGGTTTCTACGCCCGCCTCATGGCCATTCAGACATGCACGGCCGTACCCGGGTGCTCGTATTGCAAAGCCCAAATATTTACCGGACAGCCTGACCTGTTGTAACGTGTTCAGACGATCTGAGGCAACGTGAGAAACTAACAGCCGTTTCCAAAGCCTGCTTAGATACACGATCTCCATTTTGTCCTCTGACGTGACATTCCATGAGGACGAGTTTATTTATTTCAACGGTACGTCCGTTGTACCCACGCGACTTTGACACTGGTCTCCCATGCAAGGAAGCCGAAATGGAGAAATGGAGCCGCAGCCGGTCGCGACCTGTTTAAGAGTTATCAAGAGGATGCAGAGAAGCACGCATCTAATGCGGATCGGCTCTACAGCACGTGGCCCTGGTCTCCGTAGATGCGCATTAGTGCATGTGGGGAGTGCATTGGAAGTATGACAGTTTTGGAAGCTGGAGAAATGACGGGTCTTGCCTCCACTTAATTAAACTAAGCCTCTTAATGCAATCCTTAGTTTTGCCTGTTACTCCCAAACTTAATCGTTTGACTGATATGCCCGATAACAGCTTTTAGGAGAACGTTCTGTAATGCGGTCCTGCTGGTCTAACGGTACTTATTGGTTGTATTTGCTCCAACGATTGCCCAACGTATTCAGGGATGATAATGGAGAAGTTCTGACCTGTTCCACTGTTGTATAAACCTCCCGAACCCCGTTAAGCCTATCTAAGCAACTGACTTTTCACGTCACTAATTGTTTACGGATCGTATCCTGTTGGACAGTAACTGTCACGGGACGAGCATTTTATGTCGTTTCTCCCTCCTTTTTCCAACCGTACCCCTTACCGGCTTGGATCCATTCCATTGTCTACTGAAGTCTTTCATCTGAACACTTGGCTTGTAAATTGGTTATGCGTGCTTGACGTGCTTTCCATCTCATCTAATGATATGATCTAAAATGGGATCCCTAAATAGGCAGCCGGGAATGGTGACCGCTGGTTTGTAACATGACTTCCTGGTAATGGTGCGACTCGCCTAACTTCTCTGCGTATTAGACTTCCAAATGTTGTATTGGTTAATCGATTTGGCCCACTGCGATTCTTATCTAAATTCGATGTTTGGATCTAAGGATTCGTCTCACACGGGTTCTGCACGGACTTATCTCGTACGCCTGGACTTCGAACTTTTGTGCTCCATCTCACGGAAAAATTTTATCGACTTTATATTCCGACAGCAGGAATTATTTCCTCTCCCTTCCCAACGTATCTAGTTAATCACCTGTCATTATGAACGTATTTTAATTTAACAGAGTCCTGTCTCCGCCTGGCTTCATCGACTGCACCAACTCACAGTGCAGCCGGGTACGCGAAGTGCCCACTCCACCTGTTGCAAACCCCATTACAATTCTTTGATGCACGCGAATTGACTCCCAGTCTCATTCAACTTCAATTAACGGACGCATGTACCGTTAATTAACGTAGCAGGCAGTGACACGACCCGGGTTCTTTCTATTTGTAACGCTGACGTCGGTCGATTAAACTACTTAGCAGCTTTCTTTGTGCCGGTCTACTGGTTTACCAATGTTTACTTTCGTCACCGACTTGTCACGTCTGTCAATGTAATGACGAGCCGACCTTTAGCCCTCGTCACGGTACGCTTGTTTCTATCTGTGCCGAATTTTAACTAACGGAAAGAGATGCATCCTTGACTATTTTCTCATTTCCACTCGTATTCTAAGTGTTCATATCCTCTATCCGTTGTTCCGTAACGGGTCTGGATTTGCCACGGTTCAGGAATTGACGGGCACGCAGTTCGACGCAACGGAATTCAGATTGAGACGTAGATGCATTTACCAAATGCAAGCGTAACAAATCTTTAAGTCGCATTCAACTTTCTAAGATAGTTTGACGTACGCCTCCATTTTGACCTACGTGCCATTAATGGACTCCTGGTTCCTGGGATGCGCAGTCTGACTGCTTAAGGTATTCAATGTAACCTAGATTGTTCTGTGCAATGATTTATCGAAACCCTCATGATTAAATTCTAAGGCAGTTCTAACTTGACTGCTTCATGCACTAGGTTAAGAAATTGCCCGTTATCGTATCGACAGTTTGCCTCACCAAATAATGAGGACGGAGCATCGACGCCACGTCTGATCCCAGGAACTGGTTCCTGCCAAAGAGGACCCGGCTGGTGCTGCTTCCGACCTTGCGATTCAGTATGGGTTCCGAAGCACGCTTTAACGCCAATTCTACTTTTATCAAATCCGCATTTGACTAACCTCCAGCACGACTAGATGGTATGCTCCTGTTTACGCAACTGCTTACGAACTAAACCGAATCTGATTTAACGATGCCGTAAGCTCCTGACTTCCGGATACTACTTAGGGCATTGATCGGTTAGGATGCCTCCCACCTTTGTAGCTAACCTCCTACACGCTCCTACAGCCAACTTCGTTTAGAAGGATTAAGCTTCCAACTGTCACCTCTTAATTAACGCAACGGAGCCGCAGCGAGGAAGCAACTCGACTTTTGCGTAAATTAACAGGAAATCGACTTCAAAGGCTTGACACTCGACTTTTAGAATTGCTTCACGCAACCATCTGTAATCATGACGTGCCTTTGGATTAACGTCCTTATTTACCGCAATTTTCTTTTCGACCTGACGGTCGACTAGGTCTATTTAACCGTACCGCTCCATCTCACGTATAGAAGTGATCTCACCTTACGAAATACTGCCGAGACTGTTGTATTTTAATCGACCCGATTCCCCGGGCGGTTCAACTAAGCACACCTCCCACCCGCGTGCTCCACGCAACGCAACAGTTAAGAACTAGAATAGAAAATGTCTGGTTGCAAGGTACCCCGGTAACGGATCCTATTATCCCCCGCTCCTTAGAACTTAACTCTTTTAACCAGCGACTGTGCAGTCTAGAGCACGATCCGATCTACTAGAAGCACGCGCATCTCTAAGGTTTCAGGACCTATGCGATAGGAAGGCGAACTCGTACTTTTGTCTTTACTATCGCCTCCTTTTAGACTGCATCCGCTCCAGGTTCTATGATCGAAGTGTTTAAAGGATTATGTTTCCTTTTGCTTCTTAAACTACTTTGTCCGTGACGCTCCAACTACGGTTAGATGCCAAATCTTTTGGATACTTTATAACTCTTCCGACATTAACTTCTAAGTATTTGTTTAAATTATCGCAGGGTGACTAATGAAGAATTATTTCTATTTAACTGCATCGCTCTCTGATTCCGAGCGGTCTCATTAGGGCCCGGTCGACTAGTCTCACTGGGGGACCATGTAGTTATTTGATAACATTCCTTTCATTAACCTTTTACACGGATAAGTTTGACGCAACATAACATTTAAAATGCTATCTAATCGTTTGTAGGCCATCGTCATAAGGGGACGATCATACGACTGCAGATGGTACGATTCCGTCAAACTAACTACGATCCCTCTAGTTCTCACGAGTGCTCCAGGTACATACCTCACCTGGGTAACTTTATTGTAATTATGTAGTATAGACGTACGTGAATCTCCGAAAAGGCATTTTAGAGTAGTTAGAGTGCTCTGGGGAATGAACGGGC
>43
CTACCGCGGACGTCATCTGCCTTATGCCATGGACGCGCCGGCGCAGCATGGCAGATCGAGCCAGCGTTGAGAGTCTATGCCAACAGGTGCGGAGAAGTGCAGAGGGATAGGGGTACGATCAGCATTAAGTCAGTACAGGGCAGCTCTAATCGCTGCTAATGGCATGGTAGCAAGCTATCCCCTGTGCTGACCTGGTGGCATGCGCGCAAGAAGTCAATGGCATAATTGACCATTAAGTCGCGTCTAATCCATGAAAATACCGCAATATACTTGAATAAATTAGTTACAACTAAACTATTGGGTTGGCACTCTCAGGCTAAATACCGTGCTCACGATTATTCGTGATCCACTCTTAAATCCAACAGCGCTCTAAGAGAGTGCCAACTGCAATCGAACAGAGTCGCAGGTAATTAGGTGCCTGGAAGCTTGCAGTCTAAACATAGAGCTAAGTCAGTAATGGTGAAGAGTGTGGGCACCTTGATTAGCGCGTACTTTTAGTCTTGGATGTAAGCGAATACGAAAGCAGAACTAAGTAACAGGGCTGCCGGCATTGACAAGAGCACGGAGCGAGCTACGCTCAGTGTATTTAGCGTGATACTATTAATCGTGCGTGAATCGCTCTACTATAGCTATCGTAGCACTCCTTGCTCTTAAGAGCGAGCAGGAACAAAGGCCTATGTAAATTTTGCTTGGATAGGTTGGCTACAATCGCCTCGCTTGTTTCTACAGTAACTTATTCCAAATCGCTCGATGGCGTATTAGAAGCCAACAGTACAGCTCTATGGTCCCGCTTCTGAAGGAATAAGAACGGGTACGGGCCTTTGCAAGCGTAGGTCGGGACTATAATCGTTGGGCTACAACTATCGAAGCACTTGAGCCATCTCTAGATTGCTCACGGTATCTTCTCGTACAAGCCGATAGGATAGCACTTAGGTGACTCGAATGGTCTATGGCCTCGATCTAGATGGCGCTAGAAACCGCGACCCAGCGAAGCCTATAGACAGCGTTAGAAAGGCAACGTAATAGCGTATTAGGAATCAACGTACGAGTGAATACATATTAAATTACTTATCGAAGGTTGGGTGACCCTGATTATCTCCTATAAGTGTGCCCTCCTAACCCAATGTAAAAAGGCACAACTAAATTGTCACGCCTTCTCGATGAGCGCAGCAGGTCCCTGAAAGTCTCTCGAAAAGTCACTAATGGCGTGGTGCAGCATTAGAAGGTAAGTTGATAGCGTATGTAACCGTTAGGCGATACGTTGCGATAGTCTAACATGAAGCACTAATATCTGGTGCTCATTGTCTAGGGACCACGATGATAATGCGGTCGAAAGAGGCGCGCTTGCGCATGTAATGGATCGCCGAACGTATAGCTAATATGTATGAGCTGGTTGCTCATGGGCTCGATGTCGGTACCATCACCGTACTGATCAGCTAAAGCCAAAATCAGAAACGAAGGACCGGGCATGATGAAGCTCATCGTCAGCGTATGTTGCTCCATGCAAAACACGAAGTTAGCTTACGACAGCGAGCTGCTATCATGGATCGGCTGTCGTCGGTTGAACCAAAGCAATTATTGCTTACATTCTGCCGACGGACATGCCTGCAGCCCCGACCAAGGGCTAAGGCTAGGGGTCGCGGCCAGATACTATCAGGGACACTGGAAGAAGCGATAGTCTGACGATACAGCCATCCCCTCCATGAAGGCAGTGTAATGTAAGGAGGCTACACACGCTTCCAGCGATAAATGCTAATAAACTGAAGCGAGATCGCATGTTTGGGTCTGTCTAGTTGGCGCGGTTGTAAACATTTGCCCGCTGCCAAGGCAGACTTTAAAGTTGCTCCTGCCAATTTCAGAACACTTTATGTAGAGCCTCCACAGCGAGCCGAGGCCTAACAGATTTAATCTTTAAGAGCATGAGGCATCGTGCAGTTAGAGTACCCAGTGCCTGGTAGAGCCAGCCATCCGTCCCTTAAGTTCAATGTCTATCTATGTAACTTAAACTCGAACATGGTTTGCTTACTTGCTATGGATGACATTACGGCCATCCGAGGGCTTACTATCGACGGGCAACCGTCTCAGGAGCTGCGGATAACCACCGAACCAATTAGATACATCTGATCGATGGGCCTCGCCAATCCGCGGAACCGACGTACGGCTTGGCTTAGAAAAGAGACATTATGTCTCAATCGCCCAATAGTAAAGCTAACGATAGGCCTCAACTTTATTTAGTACCGCTACGAAAATTCCTTAAGTTTTCTTCTAGTATGCTAGGACTTTATCCTTCCTCTACATCAAGGGCACTTTCTAGATAATCTTTCTTAGAAATTAACATGTCTAAGCTTTGTGTACGTGTAGTCTCTAATAATCGTCTAAATGGAGCTCTGTAGATAGATAATGGCTAATTACTTTGGGTCCAAATAAACATTCACAGTCTAATGGTCCGGCACTATCCAACTGTCTTCGTACAAAGCGGACAATCGCTCTGTCAGTGGGTACTCTCCAATGGGTTGTCTGCATGAGGCTCAATGGTTTTACCTTCCTAGTGTATAGTGTTTACTTTACTTGCTATGGCAGTGTCTATACTTATTGGGCAACAATCCTGGCTCTCTTAAGGCGAAGTTAGGAGCCAACTAAATAAGCGCTATTGAATATTAAAGTTAGCAACGTCGGTACAGGACAGCAAGCGCAGGCACAAAACGAATAAAGAACAATCTAGCTCCACCGTGACGGTATTCGTGACATATGATCTAAGTCATAGCGTCTCTAGCTTGTAATCAAACCACATAGTGTCTCTGGAAGCAATCCAGGATGAGGCGGATTTGTGGAAGCGACAGATAGGCAGTACTTCCGGATATGACTACATATCAAGCCTTCAAGCCTTGGCGTGACAGACAGCGCAGTTATCCTATTGATAGAAATAGGTAACCCACTCAATTACTGCGGTAGGTAATAAGTGAGTAAGTCCTATCGTGCTGTCCTAGAAGACGGAGGTTAGTCTGCCTACTTTATGCTCTTTGACATTAGTCGCGCAGTGCTACAAAGAGCCGAGTACAACTACTTTGAGCCGGCTAGTACGTGTTCCATCAGTCGTATAGGAAGGCTGAACGTAGTGCCGGGTCGATTGTTTGCTGTCATTCTCGTACATCCGCGTATCCTATTAGCTTGTATGTCTGAATGTTAGCTCTTAGTGGATAGATATCAGCATACATCAATTAATACTTATCGTGTAATATTATTTGAACTAGCCCAATTATACGTATACGGTTGTAATGGTTTAAGTGCCATCCCTCCGTTGGTATCGTATTGACTTG
>44
TGTTGCGCCGCTAGGGCGGCGGATACCTCTGAGCGGCGGAGAGCCGGTGAGGTTTAATAGCGCGCTCCCCAAGTAACTGAGTACACCAGTAGTCCATCGGGCAAGCGGTAGAAACATTAAGCAGGTCAACCGGCGGCCCCAATCTGGAATCGCGCTATCTGCACCCGGCGACTCTGGGGGTCAAACTGACGATTATAAAGGGCCATCGGGGTTAACAATGTAAATACGGGTTTGACTGAGGGGTAATTCGACAATACGTTAGAAGCAATCCGTGGGTACAGCCGTCTAATAAGAGTTCATCACCGAGACTAGGGCACCTTACGCACGTGCCGATGGCTTCAGCCCCCGTTGGACACGAAATCCGGGTTGAGGCGGCCTGCGTTGGCTTACCGATCAGGCAATGACAGGCCGGGCGTGACACAAAAGAATGTGCGTCATTGGTAATCCGGATTTACCGGTTCATGTACCGTATAGCTTTTGCTCGAGTTAGTGTTCGGAGGCTCTGAGTCCAGCAAACAGCGTGCAGCAGCCGCAGTAAATGCGGCGTACTTCGGCACTGTATGAACCAAACAGCACAGCAGCACATCGCCCGGCTGGTGCCGGTGGACAACGGCACCTGATAGCGAGAGATGCCCCGTGCCTCCAGATTGTCCAGATAGAGATTCTGGCTGTCAAGAGTCATCCTCACGACTGAAAGTCCGGCATCTCAATCCCCGCCAGATGATAAGCATCCGAACAGTGTGTAACAGTTAGTCACCGTGCTCAAAGCGCCGCCACGGGGTTACATGCGGCACAGGGTGAACTTATGAATCGTCCCCGATTCCAAGACCAGCCACCACGGCAAATCACTGGCCACCTGCATACAGCGGTCGGCCTCATGCAGCCAGGGCAGACCACCGGGGTCGGGGGACCAGCCAATCTCACCCTGCATTTCTGCCTGTGCATCAGTCTTCCGGCGACATACGGAAATACGCCTCCGGCTCACCGGAGATATTCACGCAGGGAAATATCTTTCTCCCTCCGTGCGTGCTTACACGAAGCCGCACGACTCTCCGCTCAGCACATGCCGGGCGTGCGGATAGAATCAATTCTTCTTGTCATGGGGCATTTACTGCGACTTTGTTAATGGAAAGGAAGCCACAAAGTCCCACGACGTTAGTTGTCCCACGATACAACGCTCAGGCATTGCCTGCATTCCTTCGTGATATCCGGACGTTGGCTGGTCACTTCATCCGCAGCTATACCTGAATAGACGGCCAAAACCGTCTACGAGCCGTACAAATGTGAATAGTTACAGAGCAATACCAACCACGTTACTCCGGAAAGGCCACTAGACGCTCCGTTTAGCGTGACATCAGTAAAAGGAGGAGTAATAGCACTACAGTTCGCTGCACTTAAACATCCCACAGCCGGCTGATCAGCTGCTCCAACTGGGGTGACTGTTCCGTTGTAGCACGAAGTTCACCGGACCGGAAAACGGGCGTAGACCTTACCGCTGAGCTAACAGACGTTCCGCCGACCAGACTCTGCATATCTTCCGCCATCCCGGTAATAGATCCGGATTATAGAAACCGTCAGCGTGGGGCGCGTACTGGCTCTGGTGCTGTTGCTTGAGTTCAAAACCGCTCCCCTGAATGGGACCGGCTGATCTGTCGCCCTGCCAGGTGACCGGCTCACTTTTCGTTCTTACTAGTACAGAAAAGCAACGTTCTCCACGACCTGTCAGGTCGATTTCGTCAGAGCACCACCGCCGGCCGACTGCTCCGACCGTATCATTCGATGCGATTTCCTGCCGGATATCCTGCATCAGTTCGCCCTGTTCAAACTCTGCTGAACTCAACGCAGCATACTGACCGCGAACGACCATTTTGCAGCGTATAGCTTATCTGCCGCCACTCATCAGGCAGCGTCATCAGAAGGATTTCCAGCCCCGTGCTCTTTGCGAAACCACTCCAGTATAATTGGCCTCCTCACCCGGAGTAACAGAATCTACGATTTACGTTGCTAGTGGCATTCAGCCCGGCAGGCAGCCTGAGAATAAACCATCAGATGAGGCACCTTTCTTACAGAAGGGACCCAACCCGCCACATCCATACCGGGTTTCACTTTCCATAGAAAGTTCATCGTCCTCCGGAGAACAGGCCACCATCACGCATCTGTGTTGAATTTCATCACGGCACCCTTGCGGGCCATGTCAGACGCCCACGGTTGCAGCAGCTACATCTATCTGCCGTTCTTCGTTGTTAATCACCACATGGTTATTCTGCTCAAACGTCCCGACGCCTGCGACCGGCTGTCGTAAGATGCTGCCCCGGTGTGATAGGCACTAACCGCCGGTGGCAGGCGCATCAGCCGTCAATTCCCACGCCAATCCGGCTGGTTGCCTCCTTCGTGGAAGACAAACTCACCACGGTGAACAATCCCGCTGTAGCTCATATTTGCCGCCGGTTCCCGTAAATCCTCCGTCTTAAAATGGAAACTTCGCCGCAGCGGCCTGAATGGCTGTACCGCCTGACGGGACGAGATGCCGCCACCAACAGCCGGCCAATGGCGCTGCTGATACTCCGACAATCCCCACCATTGCCTGCTTAAGCAGAATTTCTGTCATCATGACAGCACGGAACGGGTGAAGCTGCCCCGTTCTGCTCACTGCCGGTCAGCATCGCCCGCCTATATTCTGTGCATATCAACCGCTCGTCTGCGTGGCTCAAGTGTTGTGACACTGCTATACTGTCCGTGGCGCTCTTCCCGCTCACTCCAGCCCGGACTTCAGGCCTGCCGTAAGCGAGTTCCCCCGAAGCTGTCTTCAGCCCAGGTCTTTCTTATGACATGACGTTATTCGCCCACATCAGCGCTAATTATCGCCATACTGATTTCCTTCAGGCTGTTCCGTGGCCTCGTCTACTCCGTTGCCTGCCGGTCAGTCAGCCCCGGTTCGGGCATCAATGGCGGCCCGTTTTGCCGTTGCTGCTGTGCATTTATCCGCCTGCTGCGCCAGCGCGTTCAGGCGCCTTGATACCGTGATGTCGCCAAGTGCAGCCAGCTGGCGTTGTACTCCAGCGTCTCATCTTTATGCCAGAGCAGGGATTTCTCCTGTCAAGACATGGCAGCTACGTTGCGCCCCGCCTCCTCCACCGTGACGGAACTCTCCGCTTCCACAAATCCCGGCCTGCTGGCTCTATTTTCTCATTTGCTCCGGCATGGCTTCTCCAGCGTAGAGTTCTGCTGAAGCGTCAGCAGGGCAGCATGAGCATGTCTTCCTGTACGTACGCCGCAAGACATTCACGCTGGACTGTTCGGCTTTTCAGCGTCGCTTCAGGATCGCTTTTCGCCATCAGCGTGTTGTGGTAATCGCTGCAGGATTTTCCCGTCTTTCAGTGCCTTGTTCAGTTCTCCTGACCTGACGCGTTACTCGCGCTAGGGCGTGCGACGCTCCCGTTCGTAAGCCTTCTGCCTCTTCGGTATTTCAATTATAGGTGACCCTGGCTGCTGCTTGGCATTTTTGGCTGTTGAGTCTTATGCTCAGCCTTCTTTCGGGCGCCCGACGTGTTAGGCGCATCGATTTCACCGATCATCCCAGTAACGCGCCCGCTTCATCGTAACAAATAATCATCCTTGCCCAAGATTCCAGATGTCGTCTGCCTGTTCTTACGCAGCCTCTTACATCATCAGCATCTCCGGGCTAAGTGAACTGAATGTGGTCAATATGCTGATTAACCGCATCCCACATGGATTTGAATGCCGGCAGTCCTGTCTGCCCAGGTCTCCAGCGTGCCGGTTCTCTTCATCAGGCGGCCTTGGTTGTAGTAAACCGCTTTCGTTGCCTCGTTCGCCGCCTGCAGTCAAGCCGAGCTTCTATCCGGAACGCTGCAACTGAGCAACATACGCAATCATCGCCGCCGACACGTTATCCAAACTGGCCATGATAGCCGTCAGCGACGTCGGGTCTGTGGTCACCTTCCCGAAGGCATTCATAGCATACTTGTCCGCCCAACGCCGCCGGATCGCACGCGAGAAACGCGCCACCTGGCTGATGGACGACGCAATCTGAGCCTCACTCACGCTTATCCCGCCTTAACCAGTGCCGCTCGTAACCTGGTCGGTCTGGTTAAACGTCAGCCCTGCCGCCTGCCCGGCTCCCTAAAACAGCAATCACGATCTGCCGTCAGTCCCGCCTGATTGCCGGGGACAGACCAGCGTTTTGTTGGAAATCGGACAGGGTTAGTCAGCCCTGATACCAGCCGCTAGGGCAGGATCCGTGCCCACTAGAGCCAAGCCTCCGCGCGCCATCGGCAGGTGACCGCACCCGGCAAGCCGCCTCTAACATGGAGACCCGCCGAGACAGGAGTCCTTCATGCGCCCTGTTGCAGCAGGATCAGCCACGGATATTGCCCGCCTGCAAGCTGCGTGATCCGCTGTTAGTGAAATGTGCAGGCAGCATACGCATCATGGCGGCTGTTACCTGCCCGACGGAATCCCGCTTCTGTGCAGCCAGCGCCTGTCGGCTCAGCGACTGTTAAACGACTGCCCTGTTTTTCGCATCACTTTCCGTACCCCAGCAAAAATGACGCGTACTCTGGCCATCTGCTCGTCAATCCGCATGCAGACCCAAATCAACGACCATTCCGATCGCCTACCGGTTCAGCCATACTGACATCCGATTCCGGTTCTGATAATGTCATCATCAGGTCACGTCATCCTCCGTCATGTTGCCACATCGCTGGGAAGGCATATATTCATTCCCGTCCGGGCCACACGGCGACAACATCCTCCGGCATCGGGCTTTCTGCATCAGCACATCATCTTCAGACTTTCGTCAGCCTCGCGCCGGTTCAGCAGACTGAAATCCAGCGGATCATGCATGCGATGCTGGAAAAACAGGCTGAGCACGGTGTACGTCAGCCCCGGGCAAATGCGGACTCTCAGCAGAACATCATGAAAATAATGGGTACTGTAAAGCGGTGCCAGTCGGATATGAGTCCATGGTGAGCAACATCCGGCAAGCATGGCACCGGTTATTTGTTAGCTCCTTACCGCATCTAGTTTCAGGGCAAAACTCAGCTCACGTCGAACATTTTCCCCAAGAAACAGGCTGGTGCGCGGGCCATTAGGTTCTTTTCTACTCAGGGGCATGTTCACCAAACTCATACATACAGACATCGGTACCACCACGTTCACGCAGCATGAGAAATTGCCTCCGTGTAGAGGTAAGCACTTCCTGCTCAATCTGTTTAACGTTCATTCATGACGGCAAGTGCGTCTTCTGCGCATGGTTATTGCCACAGGACATCGCCACCAGAACGCGCCGTCATGATACCCGTCTTCCACACCAAGTAAACTTCCGGTTGCTGTTGACTCCGCCTGTTCTGCCTGCCGTTTCATCAGGGCGGGTTGCTCAATGCGCTGCGCACAGGGCTAAATACAGTTCGTCAGAACCGCGTGACGGTCACGCGTTGGTTCAACTGATTCGGAGTTCAGGAAACATCTAGTACTCTCCAGGACGGACTGGCGGTGACGGTAATTTCTGCATCGCAGAGCAAAACACCAAGTCACATGTACAACCTAGAATGTTGTACTTGCTTGTGCAGCAACCCCCGTTCAAAGTGATGGTCATACCACTGACCGACACGGTGGCTTTTGTTTGACAGACAAGGCACCGAAGCTCTTGTCGGTTACGCCTCCCGGCTCGAAGGCACGGTCAGCGTGGTGCTCTTCCTTTCACGGCAGGTGGCAGGCGTCTACGGTCAGCGCCGGTTGCCTAGCTGTTACTCCGTCTAGCGATCGTGCTCACATCGACGGACGTCCCACATTGGTACTTTCACCCGTTAGATCATTCCTAGTCACCGCCGTCACCTTACCGATACTGCTGACCCCAGCCGCCCGGACATCGAATAGTTCGGTGGAAGCTTTACCTGAGGAAGGGTATCGCCTTCATTAAACCACGCCAGCACGCCTGATCGCGCTCGCCGGGCATCCACGCCAGCGTGAAGCTGGTATCTCCGGCAGATTTCTGCCCCTGCCCATTCGAGGTCTCTCAATATGAGTCTGCATCTTCATCATCGAGATAGCTGTCGTCTATAGGACTCAGCGTCAGTTCGCCGGGCGTCAGTCTTTGACTTTTCAGACGCGACCAGTCGGGACGTCTGAAAGCGGATTCGCGTAGCGATTACGCTGACGCTCCTAACCGCACAGGGTGGTCCCGGCAGCTGATTCTAATGTGTAGGATTTGGTACACAGGCATAGCGTCCTCACATTCATAATAATGACATAAGTCAGATCGGCTGAACTCCACAAGCCGCATCATCGTTGCGCCGTAGTCAGCTCGCTGGCACACCATACTGGTGATCAATCTGACAGTCGGGATATCGCTCATCACGATAAATCCGGACTCATCAAACCGCATCCAGCTCTGAATCCGGCACTGAGCAGGCAGGAAAACTTCGATATGCAGCTCCGCCTAGAGGTACCCGCTGTCCACTCTTCGCCCGTGTATTCAGCGCCCGGTAGGAGATAAACATCGCAACTGCCGCAAATCCGCCTCATACAACAGCGGGTACCAAAAACCTTTAGCGGTGTTAGGTGCTTCTGAGTGCATGCGAGTTACGGCTGAACGGAGTTCAGTATGTTTCATCGCTTTACCATCCTCGAGTTGATGCTGCACCTACCCAGCCTCTTTCGGAAGACGTTCACGCCGTATCCCTTAATATTTTGTTAAACGCCGTGTTACCTACCAGCGCCATCTCCAGCAGTTCACATCAATGGGGTAACGCTTTTCCCAGCCACACGTGCAGGTGACATGCCACCGGCCATTTTCAGTTAGTAACAAACACACGTTTGGTTATGT
>45
GTCGTCTAGTTATGCAGCTGACAGACCAAAGACAAATCCAGGGCTTCATTTGGATATCAGAGCTATACGAAAAGCAAGCATCTACTCAATAAACCAATACATACAATTGGATTAGATGAATTCATACGTGAATTGATTCAATAATAATCAAATGTATTTCATGGAAATAGATGAGAAAACGAAGAAAAATGAATTCTATTGCTTCCGCGGTATCCTCCGGAAGAAGAGATGGGAGCGTTCAGTCTAAAGGATTGGCGGTGATGTAAACACTGAACAAGTCAGTCAGAACTTCCATTATTCTGAAGATATAATCGCCAACCACTCAGAGCTTTACAATATACTACTAACCGCATACGTTATTTCATGACGCTCTTTTTAAGCCAACGATTACTCCATAACACATTAAACGATCATCAATATCAGTGCAGTTACTGTATCAACACGGTTCAGCCCGAATGATTTCTTCAGGCTTCCCAACGAGGTTTCTTCCTTCGTTCGATTCCAGATCTGCAGCATCCTGAAGCGGCGCAATATGCTCACTGGCTATGCATCAGGCTTTGTTTCTTCCGCTCCGGATCCCCTGAAGTTTGCTTCCGTATCCGTGCCCCAGGCTGTGCCGTTCCATTGGTATTCCCCGGCGATACGATAAATTTTCCGTAACGACCCGGTTAGAAAGATAATCGCTTCCCGCGGCTCGCGCACTTCGCAGGCAGCTCGAGAAGAGACGGGAAGGGTTGCGCCATCACTGTTGAATAGCCACAAAGCCAGCCGGAATATCTGGCGGTCGAATATTAGATCTGTTTGCAATGAGGCAGACCGGTATGAGTGAAGATATGCGTCACCTTCAGATAAATTCATTAGTTCCTTAAGATTGTACCAAATTTATGGTCCGTGGTTGTTCACTCATTTGAATGCCATGCAATGGACAATACAGTTAAATCAATGTTTGACGGTGTTCCGTTACCCCCGCAGCGTTGACGGTATGGTGTCCGTGTGAACCAATACTGAAAGAATGGGCAGCCGCACCAACACTCCATCGGTGCGCACCAATACCAACTGTATGCGCATGTGCAGGCACCGGCACGCTTGTACCATAGGACAATGAGTACTGTAGCCTTGAATGACTGTCATTTCGATAAATAAGCATCGCTTCCTCTTCTATTCTGTGATAATTCCTGTAATGGTCCCAACCGAGAAGCTCCAGAAGGTCTCATTGTGACCCAGCTTACAGCACCGCGGCCCCCTGTTGAATGAGACCCTGGTCACATGAGCCCCCGGAGTTATTCGTCGATTTGATCGGGTCGTAATCGAACTGCTGTTGTTTCATTTAGCGTAATCAACGACGATTATTTCGTCCCAAAACCCGTACCGGATGCACTGGCACTGTGGGTCTAGACTTAATTCACATCCTGTTCCTGAGACAATACATAAAGTAAATGAGGGCGTCGCCGTGATTGTCCCTCTACAGATCAGGAAGCACCCGATCGTACGCGACAGCAGTTTTATAGTAGATTTAAACGCCTGCCTGCATCAGGACGGTAGCCAGACGAACGATATCTGGCCCCCGTGATTAGCACTGCTAGAAAGCCGAATTCGCCGGCCCCAATATTCAAGAACATCTTAGAATTTGCCAGAATATCCTTAAACCTGAGTCAGTTTCTTCCGGAAGGAATACGGAAGAGATTATTTCACGTCGAAGCCTGCCAGCGCCGTTAGTCGCATTCTTCGGTTGTTACCCGGCATTTTAGTCATGTAGCACTGTGATCATTCCCCGGCTTAGTCGGTTTAGATTCAGCGTCATTGCCGTCATGACGCGTCATAAATATCTTGGATCGCGGCCAGTCAAAAAGCGGTGTTCGCATCTGGGTTGTTGTTCCCTGAGCCCGGTCCTGTTGTTGGCGTTTGCGGTCATGCATTCAGGGACGTCAGTGAGTGGGCTTTCTGTTCGTTTCATCATTACCATTAAACCGCCTTTGGCTTGCAGCAGCGTTCAACGTTAGTTTATTGCATCCTGAGCTGCATTATCCCCCTTTCTCGTTTGTCCGCATCCTCAAGCGCGACCTATGAAGCTATCTTCTGCACGTTGCCGATTTTGCACTTGCCACTTCCGCCTCTTCCAGAAGGCAGAAGTTCCAGGAAGCCTCTTCGGTCGTGGAGCCGTTGACGCACTCCCCGCCGCCCGTATTTTGCTTGCCCGGCGGAAGGAGGCTCCGTTCCGCCTTAGTTTCAATACCTTAGGATTCGTCTCGACGTTTTGCCTGGCATGAATTTCTTGCCGCCCGTCATGCCGAGGAAGCTGCACGACCGGCAGGTGATCGCGTTCGTTTCTGATGATTTGCTGCCTCTTTGAGGCCACCGATCTCGTGCTGAAGTGGCGGCGCTCGGTACGCTTTCTATTGGCTTGGAGGCAGACGTCCAAGCTGTCTTTGACCTGCAGCATTCGTTCTGACGTTTCGCCAGCGGCACTGAGCCCGTTTTACAACTCTGCGATGCGGCAATTTTTCTATTCATTAGCCTTTGCTGATCCGCTTCCGCCCGGGTCGACCTCGCTCCGGGTTGAACGTGCAGCGTGGAGGGGAATTGGAAGCGGCTGTCGCTAGAGAGCCTCCGAGCTCCTTTCGGCTCCTGGCATCGCCGATGATTTCTTCGCGTCGTCCCGTACTCTGTTACGCCCCCGACGGTCACGGGGCGCCTATTCCACCATCAGTTCAGACGACGCAGCACCTCCATCGATGGCATCCTCCGTCATGGCACAGAAATCATTCAGCGTCCCCCGTTGAATCTTCATACGATCATCTTTGCAGTTCGAGTGGTGGAGCGTACGATTTCATCATCCACATCGTACTGACCGTACTCCACATCCATGCTTAACGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCACCACCACGGTGTATGTTACGTCGGCTTTCATCATATGAATCGGTGCATTCTGTACCGTTTTCCTGTTACGTCTTTCAGACTCCAATGGCGGTTACTGCTAATCCACAAAGGCCGGTTCCGGCGGGCTGCTAACTTGTTACCTGGCTAATCAGAATTATAACCGAACTCCCAACGATGAATCCGTCAGTACGCCGGGAGCCGGAGCCGGGAGGCAGGAAGAAGACGACGGTCGGATCCTTCCTTATCTCCTGCGTATAGAGCGCATCACTCTTGGCAGGTCGAGCTTTCGTCTATATCCCGGTTATACTTCCTTTTACGGTAACCGCTAGAGTAATTTCAGGTCAATACGTGAATCGTGAGCCCCAGCGTATGTACGCACGTAAGCGCTGATTACCATAGTCGTAACCTTGTGAAGGGCTCCGATTTACATCTAACGACGTCGCAGGCTCGGGTGAAACGTATCCTCCCCGGGTCATCACTGTGCTGCTCTTTTCGACGCGGCGAACCGAGGGAAGCCCAATAGCCCCACATGTCCGTTCATAACGGTACTTCACGTTAATCCCTTTCAGATGACTCACGTATCCCCCGCCGACAACGACGGATTACCCATTTTCATTGAATAGCCCACCGTAAACGTACGTTAGCTTCGTCGCACGGGCTGCTTCTCCGTCGCCGCAAATCAAGAAGAAGGAAGGATACAGAAGCCCTATGTTTCGTACTCTAGTAGATAACGCCGTTCCCGGGACGACCCTCTGTAACACATGCCAATACGGTTGCCCGCCCTGTTCTTAATCACCATAACCTGCACATCATGGCAAACGTATACCCGAATATCTGCCGAATCCGTGTAACTTAAGGGTACGTCAAGGATCACGTTCCCCATGACCCGTGCAGTAACAATACGAAATAGCTGTACCGCCTCGTTCAGCGCCATCATAATCACCGCACCGTTCATCAGTACTTTCAGATAACACATCGAATACGTTGTCCTGCCGTGCTGACATGACACGTTAGCCTCATAGAAACGTCAGCGAAGCACTATCTTATCGATCAAAGGATGGTATGGGTCACGTGACAGTACGGGTATAGGTCGAACCGTTCATACCCCAAGCGCTCTCACCCGCCTTCCATTCCCTGTCCCCGACGATTTTCCGGAAGGAATAGCGAAGGAAGTATGGCAGCTATGGTCACGTAACTAGCGTTAGAGTCGCATTCACTGCCACTGATATCCGCATTTTAGCGTCAGGTTCCGTCGGTGTTAGAAAGGCCTAGAGAGATTGCCGCCGGCTGGTAATGGCGTCACATAGGAGCCAGTTAGAATACGTCGTTCATGAATATCTGGTCCCTGCGCCACAAACATCGGCGTTCATTCCCCGTTGCCGTATAATAAATGCGATACGATTGGCGGCGATGAAGCAAGACTGGCTCAGTTTGCTTCCTCCGTCTCCATGCCGGCTGATACCGAGACATAATGTTTGCCTTTATTTGGTCTGCTCAATTTGACAGCCAAGATGAATTCCACTTATCACTGGCATCCTTCCACTCTTTCGAACTCCTCAGTCTATGGCGTTATCCTCCGTCAGCTCGACTTTCCCCTTCCTCTCCTTCCGCAGTGAATTCGTTATCTTTAATTTTCGATCCAATGCTTCGCCGAATGAATGGAGAAGGAAGCCGATTTGCCAAACGGTTCACTTAGATATAAAGTAATAATCATGGCCGGTTGATATTGATACTGGCGGCTGGTGAGAGGTCGCCGTACCAATACCGCGTGCTGGTTTCACTGTCTGATATCCGCAATCTGCTTTCTAGAACCAGAACTCAAACTGTACCGTCCGTATAAACGGCATAATCCGGCGTCGTGTATGAAGTCCGATATAGAGCCGTCACTCAATCCTCGACGTGCTGCCGTCGGGCAATCGAACGATGACTAAGCGTGAGCTGCTGCGTACCACGCATTTACCGCCGTAACTGTCATGATCGTTCCCAGCGCCAGTCCGTGAATGTATGTGGTTTCGTCGTCCATCCGTTGAACCCGCTAAGCCTATGCTTCTTCGCTGTTGGCTTCCTCCGGAGTCTCCGCTTCGATCATTGTGTCCCAAGCCAGCACCGATATTCCCGCTGTCGCAGGATTCCCGGGGAGAAGAGGGAGAGGAGCTGCAGGCCGTGACACATTCGTACCGTGCCACTCTGTTCGCCGTCAAACCCCCGTTATCCACGATGGCCTCTTCCTACATTGATGCACGGCGGTGAATGGCATCACGTGCCGTCGTTCTCACGATACTCACGCAGCGGAAGTCGCTGACGGCGCCGTCGCATTCAGGCCTCCCCATACGTATTCAGCACCGTCAGAACAATTTTACGTCACGCCGTCGTGACGACCTGACCTCCCACGCTGACCGGATTGCCACTTCCGTCAACCAGGCTTAGCTAAGTCGGGGTAAGGAGGATGGCAGCGTACTTCCGCTTCGCTTCGCGGCTTCCAGTTGGCGTTCAAGGCACGACCACCGGTTGGTACCGGGCATAGTCATCATCGCAAGATTTCATCAATAAAGCCCATGTACATGGGCGTTGACTGCTCCGCACTATGAAATCACGGTCTGCGTTCCCGTTCTTTTAATGTATCAACAGGAGAAGCGCCTGGAGGGAAGGGTACAGCCAACGAATGCATCCATCGTGAAGTAGTACGTAACGGGCAAACCTGCCGTATCTTCAACACGCTCTGTCGCCGTCTCCCATCCGTTGTTCGGGTCAATCCAGCAGTTCAAAACGGCATTGAGGCGAGTGCTTCAGGCGCTGAAGCTGTAACGAGCGCCGATCCGGGATACTACAATGCGTTACTTGGTATAGTCCTAAGTCTTATCCGACGTCATTTATGCACGACCGAACGTTATGCCCGTTCTAACAGGCATAAGCGCATGCCTAAGCAGTTCCCTCCTAATTCTCCGCCGTATAGATCTAACTACAGTCCCTATCCGGCTCCGTCCGCCAAAGCGTCCGGCGGACTTTACCGCAGTACTCGATCATGACACAGCGCCATTTATGCACATCCGCCGCAGCACGAGCTTTCCCCATCCGCTCCCAATGGGTCAGCATGCTCAAGACAGGCCTGTTGTCATCCGGTTTAAACGTTCCGTCCCAATACCGCCTGTATTGCCGCTGAGGTCTGCGTGACGGTCCGAGAAGAAAGAAGCCCTTAAGTGATTATCCATGCTGATGAAGCTCCGAGTCGCCCTGCACCCCATGGATTGCCGTGTTCGGCTACTGTTCAAGTAAGTATTTCAGTGGACCAAGAGCGTTTGTTCCTGCAGGTATATTCTGCTTCCGCTTCATCCGCGTAGGATATTAAACGGGGCGGCGGCTTACCCAGGCCGATCGATCAGATACTGCAGGTGGTTTGGCTATTAATGGTGGTCTTTTCGTCACCCAGCCACCGTTACGTTGTATGAACCAGCAGGCGACTTCAGGACGGATTCCTTTACCCTTTGAGGTGGTTTCACAGTCCGTACCCGAAGGTAAAGGCGCATACGTTAGATGTTTGCAGACGTAATGGTGCTGGTATACCGTGTCATATTTCACTTCCGTACCCAGCACCGTCGTCCATCAGGGTCACGGAATCCCTAGAGTCCCCTTGAGCCAGCCCGGAAAGGAGAAGAACAAGGATATGTTGGTATTCCCTCATGTGTTTAAAGCCGGCGTACTGTTCGCACGCTTTCAAGCCATCCGGACTTTGCCTTAACCGTGTCGCTGATGGCATCACGATCACTCCTCGATATTCCGTGACTTCCTCGCCTTGTCCTTCGATCTAGCGGGGGTCCCCTTACTGCTTCCTTTACCATTCCTCACTCCATAAATGACAAATCGACGCAGGCGGTTGCATAAAACATTTTACATCAGCGACCAATCACCACATGATCACCGTCGCTTCGTCTGCCGTTGATCTCCCTGAGAACCACGTGACTCCACGCATTTCCCCCGTCAGAACAGGCAGAACATTGCTGCTGGCAACCATGTTATCCAGTAAGAATAGGTCTGCTTACCGTTATCCGTTTGTATACGACGCGAGAGTTATGGGGTTTCGGTGCCATCTTGAGCGCCACCAAGCTACCAGCATACAGGCAGAGAACAGGATCAGGTCATACCGCCTCCAAGTGGCCTGCCCCGCATGCGTCCATCCGAGAAGAAGAAAGCAGGGATGGAGGCAGCCCCAAATTAGAATACGCCTTATTGGCCCGGCGACTCTGGAACTCCAATATGAATTACAGCGCCATCAGGCAAGTCTCATGACTTTCTCGGTTCCAGATTCACTCCTTCCCACAATCCCGTACGTGATACCAGCCGTCTGAGTTTCTTGAAACGAACGATGTGTATTATGAGGGCGCTTCGATGAGCTTCAGCCCCGTTGGATTACCAGGTCAATTGCTACGATAAATCGTTGTAATCCCGTAAAGCAGATCCCCCTGCAGCCGTGACGGCTAGGATGTGTGCGTCGATCCGCCATTTGTTACTATCCTCGTTTGCTCAGTTGTTCAGAATATGGTGCAGCATAGCCGTCGCCGCATAAACCTTGCGGCGTCACTCGTCGCACTGAACCAAAACAGCAAGGCACATCGCCGAGCTGTTAGGAAGAAGCGGCCAAGTGCTTATCTCAGACCCCAGATTCTGGCCGTTACGCCACCAGTCATCCTCACGATGAAAGTCGGCATCTCAATCCCCGATGATAAGCATCCGAACAGTGTGACAGTCCGTCACCGTGCTCAAAGCGCCATCAGCCGGTCTCGGCTTCCAGGCGCCAGGCTGTGAATCGTCCCCGGCAGACAGCCACGGCAATCATCGGCCCTGCAGCCGCCGTGAGGCTCACTCATGAGGGGGACCACCGGGTAGGTCGTGAAGCACCACAATCTCACTGCATTTCTGCCTTAATCAGTCTTCCGGCGACATACGGAAATACGCCTCCGGCTCACCGGAGATTCACGCAGGGAATATCTTTCGCCTCCGGGCGTGCTTACACCGAAGCCCCTCAACTAAAACGCGCTGACACGCCGTGCAGGAGAAGGGTCGATTCGTCTGTCATGGGATTTACTGGAAATATAGAGAAGGAAGGAAACGTTCCAACTTTAAGTTTAGTTATAGTCT
>46
ATATTAGCCAGCTAGAGTGTCTTCAGCCGGTAGTCAGTCTAGAGCGTGAATAGATTTCGAGATCTCTGGAGAGCCTCAGGAAGCCAACCGTACCAAGTAGGGTTCGCTGAGAGCCAGGTAGCCGCTAGGACAGTGGTGGGCCGTACCGACCCGCACTTATTACAGGGCATCACAGTGGGATTCAGGCATGGCTTGAGATACATTTAATACTCGATTGTCATGTAACCTGCGAACTTGGACACCTGTTCCCGGTATAGGGTAAAGGTAAGGACCACCAAGTCTGGAGGGTTGAACGGAAGGCATCCTTTCTCTGTGCATATCGGAGCGTATACAGATAGTCTAAGCCGAGGTAATCGGTCGTCGAAGCTTCTTACCCTACTGTGGGGGCACTGACCGTACCTCCCGGTCGGTTAATTGGTACAGGCGCCAGTAACAAGAGAGAGGCCCGGAGCCGGCGAAATCAGAATATCGTGGAGAGAGAATAGGCTTAAAGTCGCGATAGGTCCTTATCAATAACCGTTGACAAGTAACGCCGCCGCGCGCTAAAGAGCGCGCCGCAGCGTCCGCTACGATACAGTCCATCATTCACTCGGAAGCGGTTCCTCGACCAAGAAGGCAGCAAGGGGACGCGAAGGCCAAGCGGCGCAGATCCCCGAACGAGGATGTACCCCGGCCGAGGCTGGACAGTGGTGGAGGCACAGTACGGGGCAGCGAAGGCTTCGCCAGGCTCCAGTGCTGCGCTCAGTCTCCCCTGGACCGTGGACAGCGCACGTTCTGCCTCACCGCAGCCGCAAGCGTCAGCACGATGCTTCTGCGACAGGAGGTGAGTAGCACGAAGCGCAAGCAAGTCCAAAGCCGAGATTCGCGAACCGAGTAAACAGTGCCTTCGTGCAATGCCTCGCAGCCCCGTTACCTGCCAGCAAAACGCGGGGCTATCCCGTCCGATAGAATGCACAATCGGTAGGAACAAGAGCGAAGCGAGATACTGCCTCGAAGCGAGCAGAGCTAAGCGAGTGCGGCGCTCGGAATGGAATAACGGGATGAGCGAAAGAAAGGCACGCAAGTGGGAGTGCTTATCAGGCTCCGCGGGGGTGCGGCAGACTCGAGCGGGGCATCGTCCAGGTTGAGGGCGGACGTGCAGCCTTCAGCTGTCACATTGAATGCAAACAGGCGGGGAGTAATGCTGAGCAGCGATTAAAGGCTAAGTCTAGCGGTGAACCAGCGAGGGCTCAGGATGCAGTTAATTAATGAACCGGCAACTAAGAAGATAGATAGGCTTGCCATCCGCGGCCCCGATAAGGGCACCAACGGGGAAGCTAGCCCAATAGCAATTGCGAACACATTCAGAAGTCTTTGTAACGCACTTGCAACGTTCTGTTAAGCTAGGTCACCGTAAGGACATGAAGAGTAAACAGCCGTATCAGAAACCGCGAGACGGGAATTAATCCCAATTGTTACGACGGACACAGATGATAAGCATGTTAGGGCCTCGGCTGGGTAACAACGACTCGCAGGATGCTATGACGCATGAATGAAACCGTTCACGACCGACTAATCCTGAATCTTTGCCGAAGATGATGCACCGCCAACAGTAGCCATACCAGGACTTGAGGGAAGGAACTTCTGGCGATAATCCGTTGCAAATGTTTAGGAAATAAATCCGACCTTACGAATTCATTTCGTCGATCTAAGTAGAGATTCTGAATTCTGAGAGCTCAGCCGAAGGTGCTCGTCCGTTATAGTCCTCCTTAAAGAGGCGAGTTCGTTCCCTGCGGCCCAGACTTGCTGTCTCGCGTATCCGGGGCTACTGTGCTTTAGTAGTGCAGCACCGTAAGGGAGGAAGCGCGGAGGGAAGCACCAACTTCTTGCTGCTTGTGTCTCAGACAAGGAAGCGGGCGGTGCGCTTAGCCATGGACAGCCGATCGTGAATTACAGTGCAACATTACAAGTCTCGATTCAGGCGCCGCATCAGGGACGTCGTTGGCTTACCACCGAATAGACAGGCGATTTTGCCGATTACGGACGAACAAATCGCCCCAACGCAACTCGAGCTTAGCCCAGTCAGCGTTCAACAGGCGAGCGCGTGAGCTGCCGGTGGTTAAGGATGAACAGTTCTCCGGCGTGAACAGTACTCCAATCGAACCATTACAGGAGGAAGTTTATCCACAGTTAGAATGAACAACCAGGACACAACTTGCTTATTTATCGAAACGACAGTCGGAGCAGGCGTCACGTCCGGTACAGGCGCCGAGTCATCAGTACCCCGGGCACCGTTATTAAGCCTGAATCAGTTGTTATCGGCCCTTGTAGCATGCCCATTCTTTCAGTATTGGTTCAACAGGGACACACCACATCACCGTTACGGTGCGGACAGAAGCCCGGTCAAAGCCATTGCATGCATTTAACTATTGTGAGGCTGTGCATAATGGCATTCAGAATGAGTGAACAACCAATAAATTTATAATCTTATGGCACCGATGGAATTATCAAACGAGGTCAGGGCTCATTTACGTGAAACAGGGTACGATATTGTGCGCCAGACTCTTCCGGCAAATACGTTGTAGATATTTCACTCAGTACTGACGGCGCATCGTGATTAGGGGCTCGTTTGCAACAGTAAGGGGCACATCGCGGTCTATAACTGTGGTCCGACGCGTTATTTATTTTCTGAACCATTTACGTCGCCGAAAGCGTGCCTGGTCACCGCGCCGGGGGAGTAGAAGTGGAACGCGACAGCCTGGGACGAGGATGAAGCCGAAGCAGCAGAAAAGCTCTTTGGATGTAGGGGTCTAGGAGGCGAAGAAACAAAGCTGATGCATAGCCAGTGAGGGCTATTTGCGCCCTTCGGAGTGCAGATGGGAATTGCAACGAAGGAAGAAATCCTCGCGTGCTGGAAGCGCTGGAAGAAGTATCGCTATGTTTGAAGCTTAGTTGATACTCTCAAGCTGTAAGTAATCGAGCCTGCTGTCCCTGTTGGCGGCTATCGTTTGTATGCTCTGTAAGAAACGTTGGGTTGAAATAACGTTCTGCGGTTAGTGTTATAGTATGTGTAAAGCTGGTCAGCTGGTATTATGTCTGTTGGCGATTATCTTCAGGGAATAATGGAAGTTCTATGACTCAATGTTCATAGTGTTTACATCACCGCGATTGCTTTGAGACTAGCCGAACGAAATATGGTTTTTCGTCATGTTTTGAGTCCTGTTGAGTATATTTCTAGGTCATTTTCTTCGTTCTCTACGTTGTTCCATGAAATACATTTGATTATTATTTGAATCAGGTCGATTACCTGAAGTCGTCTTTCATCTATAATTGGCATTGTATGTATTGGTTTATTGGAGTAATGAGTCCTTTTCTGAGCCACTCTATCAAATGAAGCCATAGGCATTTGTTATTTGGCTGGTGTCATGCGAGCAACGCCAAAATATATTTATCTTAATCTTCAAATCTTATCCTTAATCAATTGATGAATTAGCCAATCAGATGTTTGCATTACTCGTTATTCCGCAATCGTTCTTAGGTCTCGTATAGTCACTACTCTTCTGTCCGAGTATATTTTAGGCTTATCTACCGAGTTTAGACCCTCTTTAATACTTCGAATTATTTTATTGTCATATTGTATCATCAAACCGCTAAAGCAACAATTTGCTTAGTGAGTAATTATCTTTAATTTTAATTATCTTCTCCTGGCTTCACCAAGAGTCGAATGATGTTGAAATCACATCGTCGCACTTGAGTTTATTTTGTATTTCGAGCAGTTACAGCAGTTATACATTCTGCCATAGATTATAGCTAAGGCATGTAATAATTCGTAATCTTTTATTAGGTATTAGCGGATCCCATCGTCTTTCTCATTTAATAAGCTAATGATTCAGTTAATAACCGAAGGTAATTTCTTTGTGCAAGTCTACGATTTTTATACCAATGTTTAACAGCTTTCATTTGTAATAAATCCTTTCTTCAATGAGGCGATAGCTTTACGCCTCCTTTCGCTGACATGTTCTATCTTGCAGGATTTTAACATAACAAGCCATTAGCTCCTCCTGGATCATTTCGCTGTTTTTCTAGCCTCGGTGTTACCAAGTGTCGCTATCTAATCTGGTTTTGTTGATAATAATGTTGGTACTGTTCTTGCTTCCCGGAGTGTACTTCAGGTCAAGGCAACATTCAGGTAGATGGACCAAACGTTCCGTCCTGGTCTAGTGCAGATAAAGGGTGGTCAGGTCTTCTTTCCGCTGGTTTAGTTAACGACTCCATTTTGAAATAATTGCCATCAGTACAAATATGGTTTAAGATGGACTAAGTCTATCAATTTAGTAATGTCACTTTCTATACAAGTTGTTTGATCTTTGTGCATCATTCTTATCGAAACATATAGATTAGTCACAGGAAATTTTTAATATTATTATTAGTCGATGCCAGTCTCGTGTATCATATCATAAATTTATAGAGACCCAGACAGCTGTCTGATGATGCAGAGACGTGCTGCTAGCTGGCGGCATGAACTTCCGATAGTGCTGTTGAATGATTTCCGATTAGCGATTTTACCTATTTTGTGCACATGAGCCACACGATTTGGCCCTCTACGCCACAGGCCTGCTGACTTATTACCGCTGTGCCGATCGTGAACATTACAAACGTCCTTCTCGCTGCATGCCTGTTGCCAATGATTACTGCTAGGAATTGGTTAGGCAAGTTACTAGCACTTTGTAAGTAAGCTCGCGCATAGACTTCGTTCTTACTTCCGATAGACAGCGTCGTAATTTTCTATCTTTCATGATTCTAGATCGACTGGAAATCTTCCGAGTTTGCCTAGGCAAATACACTCGTCCAATAAGCTTGGGAAGTCATGCCACGTATAATAGATTCAGATTTGCTTCAATAAGTTCTGACATTGGGCTGGTGCATTTGAACCGAACGTCCTTACTGTTACGAAAGAAATATTCTTTACAGTAATCACTTCACTCAAGTGCTTCCCTGCCTCCAAACAAGCCGATACCTGTTAGCACTGTTTAACATTGAGATGAAGAGCTGTGTTGTCTTCCTGCCTCCAGTTCGCCGGGCATTCAACATACTAGATAGCAGGCCGATTCTAGGGGCAATTTGCATAGCCATTGCTGCTCACGAAAAATGTCCCGTGTCACTTATAGGGAACGATCGCTTGGTGTATCGCCATGGCTCTGCGAAAATGTACTTTCTCTCCCACTTGCGAGGCGTGACAAAGCACGATGAGGAACTAAATTAAGGAAACTCCGCAGGTTACACTTGCAATAGAAGAAAACGTATAATATTTTTGTTGGTTAAAACCGCCAACCCTTTTGATGATGAAACAAGCAGTCTATGGTATGTTCAGGTTGTTTTATCTCGGAGATTATTTCGACACTTTTCTTCTAATTTAACCTTTCAGTACCAACTACTAAGTTGCCGTAGAAGTGTTAATTATACTGTCTGTAGCTACTCTGTCGTCAGCTTAGTTCCTCTTTGTTCTGCAAAAGTGGGGAAGTACCTACTGAAATTATTTCTAACATTTATCTGCATCATACCCTTCGAGCATTTATTAGAGCATTTCGACACGTCGCTGAGGAGAGCGTGTTCATTGTACTTTACCTTCTCTGTCATTATCATCGCTTTGAACGGTCCTACTGTTAGATCTAGTGACCGTAAATTTCGCGGTTCATAAGAAGGTAACGATCAACGACCTGCGATGATAGTGGTATCCAGAATTTGTCACTTTCAATAGCACAGCTCACCGGAATTATCACGGATAAGGCCAGTTTCTTGACAGGATCCAATACGCACATAAGCTTGCTTCTCTTAATCAGGTTCCGGGCGTCTTTTGAACCTTGCAGTACTGGAATGAGTGCGTGGTCAGCCCGTGTGCGTTAAACAGGCTGCCTTAATGTTCGTAAAGCAGAGAGCAAAGGTCCTGACATGCAGATGAAGCTCCTGTTGGACTGAATAGTAAAACCTGTTCGCCAACGACATCTACTAATCTTGTGATAGGTAACAGATTGCATGTCCCAGCTCATTCGAAGCACTATTTCTCGCTAATATGTTACAGACAATTTAGTGAATTTATCATCGTCCACTTGAATCTTGAGTCCATTACGTCTTAACTTCCTTCCCAGTGAGGCTGGCTTCCATATTTGAAAAGTTTTCATCACGTAATTTTGGCTAGCTTCAAGCCAGTTGTCTTTCTATATCTATAAGCGCTCATAATATTAGCAATGGGATTAGAAGGCAAACCGCGCTGAGTACTTTAAACTATTGCTGGCAGGCAGTCTGAATCGAGTAGACAGCAAATATTACCTATTTAGCCGTATGCTGTTTGTTAGAATAAAGGATCAATGCACGGGCATGAGAACAAGCGATCGAAAATATGGCCTTTGGGATTGCTCCGATAAGTCTATTATTTTCAGAAAATATTCATTGTTTCTGGGTGTGATTGCACCAATCATTCCATTCAAATTTGTTTACCAGGATTTAAGGAGACTAAAGCATGAATGTTCTTTGGTGGCAGGAATCGACCCGTCAGGGACGTATAGTTAAAATCACTGAATCCGGGGACATTTTTCTATTAAATGAAAATGGAAATCAATGACAATTAAACGAGGTACATTTAACACGTGCGAACTGTTTAAGCTGGCTGTTCTCGAATCTAAGTACACTGAGGTGTTAAGGACGCTTTCATTTTCAATGGTTAGACCTCCAATTAGATTTGACATAGCTAGATCCTACGATAGCTTCCGCAATCTGTGTTCATATAGAGGTCAATCGGTCCTTGGATGAAGTAAATAGTCAATGCTTTCTAAGGAAGAATAAGGCTTTCAGGGATCTCTCGCGTCTACACCTTAAACAGACAGTGACATCCTTCTGTCTTTGTAAGAGCCACATCTAATTTATAGTCCATCGATACCCATTTTCTAATCATCAAAGAACAGGTAATAAAGTCTTGACAAAGGAATAGTCAGCTTCCAACAACCATCTATCGAAATCATTATTTCTACTGCAGAAGCACTACTTTCTATAGCCAACCGCTACATCATTTATTAAAGCAATAGAATTTATTTGGCGGCAACACAGAATGCTCTTTAAGTTACTGGGTGATAGATACGTTCCATCTAATTAGTAGTATTGAACTTAACTCTAATCGTATTAGTTTTCCGGGTTGCTTTCCTTCCTTTGACAACGGCCTGTTATTCATGTCCGTATGCATCGTTCTACATACGATAACAGTCATTAATGGCATATAGTCGCCAATGAATTAGACTTCTTCAGGCGTCTCGAAGCGTTTCAAGTACCTAAGCAGCCGATAGATAACGACTTTCTACATTTTTACACTTTATTCCGCTCCCTGGGCCCCTACTACAGTCTGGCGGAACAGTGCAGATGCTGGGTGTGGGGAATCTGAGGAGGCGCGAAGAAGTCATGCTTCAGTCGTTGATAGTGACATCCACTGGTCTTGGTTATGCAGATCTTATGTAGTACAAGACATTTGCTAGCGGCTTGGCGCCGTTGTGCTTCACTTAAGACAGTTTGATGACAAATTAGCGCAAGAAGACAAATGATGTCCCTGCGGGCATCGAACCGTGGATAGTATTTACAGATCACATCTAAGCCATAGTTGATTCAGCTAAATGACTGCATATTTGTTTACAGTATTATCTTAGTCTGTGTTTTGCTGCATGACGATTAATATTGATATTTATCATTTTACGTTTCTCGCCGTTCACTGCTTTTTATACCTAAGTTGGCATTACCAACGCATTGCGATTATCAATTTGTTAAGCAACGGTATAAACAGTCACATGCTATTATTTAACCTTTCAATTTGTCTAGTCGCTGCTCTGTATTCCTCCGATACCGTATTGATGCCATCGGTGTCCGACTTATGCCCATGTTACCATCATCTGCTTCAGGAGTCATCTTGCAGCAACAAATGGGACTCGTGAAAGTAGGCACTTGCCGTCGTTCGAGGCGGCGCGCGGCCAGCTCCTGATAGTATAAATACGTTCGTGCCGCTCGTACTGGTCAAACGCTTCGCGCGACGAGTAAGGCTGATGCAATTATGATGTCCTCCGCCAAGAATCTCTTTGCATTTATCAATGTTTTAATTCATTAGTGGCACAAGTAATATGCAATGCTGTTGGCTGAATTTACGCCTGTTTTTGTGCTGTTAACAGACATAAGTGACCATACCAACCAGCCTTCATTTCGCATAATCACATACTCGTCACATCACCAAAGACAGTCCGTGCCATTAGCCAACAACTCTATTCTGCTGCTTGATAATTTTTCAAAGCTTCTTCCTTAGTCATCCCTTACTATTTGTAAGCATCGCAGGGACATGGTTGTTAGTAGCGGTGCAGCTATTGCTCGGAATGCATCACGCTCAGTGTTGATCTGATTAACTTGAGTATAGGCAATTGCCCTCGTCTCTGTATGAGTCAGCACTTGCCGCATTTCTTTGTTCCTTGTGCGTCGTCCATCCATCAGGCAGAATTCGCCTCCTTATTGCTTTAATTTCGGCTCATGTAATTTATGAGTGTCTTCTGCGTTAGTACCCATTTTCATCAGTACGGCATGAGCAGGCATCCTCGTAACGGAATTATTACTCCTGTTGATTATAGTTGAGCGCTTGTTGTGTCTGAGCAAATACTCAATGTTGGCCTGTGAGCTTCAGTGCGATCCTGTCTCTGCCTAATCCAAACTCTTTACCCGTCCTTGGCTTAAAGTGAGTGGCTTGTTTCTAGTGCCCGTACGAGCTCTCTTCGCCTTCTTCCCATTCCTCGTACATAAATGTTATTGGTACGTCAATCACTTTACCTGTCGTTAGAACAGATATTCGTAAACCGGAGTGGGAATATCCTGCATTCCCGGTGGCATCGACAAGTGTTTCAAGGCTTCGTGACGTCGCTGGCGTCGTGCGTTCCACTCCTGAAGTGTCAGTACATCGCAAAGTCTCTTACGCAAATCCAGAAAAAGCCATCAGGCGGAGCTCCTGTCTTTCAGTTCTTGATTCGAATATCTTACGTCCCTGTGCTGTAGTATCGGCGCTATCATCCAGTGGTCTAGTCGTTGGTTTCTCCGCTTCGATAATACTGTTGAATGGCTCCCGCGTCATTCTCCTGTACTCGGAAATCCGTCTGACAGCTAGCTCCATAAACAAACCCGCTTAGGGTTCAGATAAACGGAATCCCGCGAGTGCGAGCATTTATGTAATATTGGGTCTAATGAGCCTAGGTCCCCAAGCAAGTATCGTTTCCGTACACTCGTGATAATTTGCACGGTATGAGTCATTTCTCGCCATTGCGCGAATGGGGATTTGTCTTCATTAGACTTGTATAATAACTCTTTCATCGAATATTTGTATGCCGACTCTATCTAGCCTTCATGATAAAGCCCTTCGTACCGTGCATACCGAGCGACAAACAGGACTGCTACAGATGTAATACGCGTATTTGCTCAGACTCTAACTCAGGTTACTGACCATTTATAAATTCCCTTGCAATGGTGGTTTCATAAACGGTATCAGCAAGGTTTATGTAAAGAAACAGTACATATAAACAGATATCCGATGTTTGGAGTACGGTCATCATCACTACAGACCTCTGGCAGCCTGTGAACCGAAGGAGACGGCGAATTCAGCATTTCTAAGCGTTATCTCCTTTTTATACAAACGATCTCACTCCTGTTGATATGCGATCGCGCACGGGCTAATTGAGGCCGCGTACGATGGAGAGTAGCCTGTTCTACACTGCAGAAATCTCCGCTCCGCATCTAGAGCTTGCGTAGTATTACTTGCCTCCAGTCTAACACCGCTTATTCCGTACTGGTCAGCAACCTTCGTAAGATCGCCGGTCCAGTACCTTGGGTCCTCACCAGGAATCTTTAAGAACTCCAGCTACGAGGCATGGTCGGTCTTCTAGTCATTTGCCTTTCCAGGTCCCATCGCTTATACAATGCCCAAAGCTGTCAAACCTCCGTATAGTTCAATTTACTTTGCCTGTTCTAGCCTACGCACGCAGTTTTCTAGCTAGATATTACTTCCCGATATCTGGACCGTTCTCCTGATTACCGTTGATATCTTGCTGGTTTCTTTCCCGTTCTGACTTAACAAGCGTCCGGCGCTGCGTATGTTGGCCGTTGGGACCGCAGATTAGTTTAATCACAGTCTGTCATCAGTGGCTGCTGTCGGCTTGCCCGAGATCGCGGCGAGTGCGGCCGGCCTTTGCCAGCGTCGGAGCTACTGTTGATAACGTCCCAATTAGCCTGAGACTTGCACAGTCAAACTAGACATAATAACAGCTCGCGCGTCTTCTTTGTTTATTTGGTTCATGAGCCGGGTCGCTAGCCAACAGGACCCATCAAGCCTGGTATGTCAAACAGGGAGGCGAATTTTATTGCTGTGTTACTAAATGACTTTATTGTCACTTTCTGATCAGTCAAACCTTGCATTACTAAATTTCATGCGTACGGACACGTGTTATCCCTCCTGCTGAGTGGAACAAGCGCAGACATGATACTCCCTGAGTTTGTCATCGGTTTCTTCGCTGTTCATCGTTATGCGCCTGCCCCGTTAGCCTGCCGATTCCGACGAGCGTCAATCGTAGAATCTAGTCGAGTCGCGGCCCCTTTACCGTTCTTAACCACGATGCTGTGCTTCTCTTCGATCTCCGCCTCGATAGCATGTGCTCCACATTTTCTGTAACAGAAGTACTTGGCTTTATTCGAATTAAGCCTGATCGCTCTTGCGAGTCGGTGCGAGCGGAGTTTTGCTGCCAACAAAATTGCTTCGACCGTCTAAATTGATTCTAGCCAAATAAGCCAGCGATAGCCTCGAAGCCGGTCAGAAGGTGAAGTTCAGTTAAGTAGCCTGGTTTGTACATCTGATTCTTATTTCTAAGCCCAACTTTCCAGCTGTTGGAACCACCCATGCCTCAAACGTATGAAATTCTGTCGTCTTTCTATATCTAAGATGCTCGCTCCTTCCATTTGGACGAGCTAAGCGGATATCT
>47
CGACCCTTGGCGCTGGTCCACAGGCCCCGGTGGTCTGCGCGCTGAGTGGAGCGACCGGCGGCTGCAGGTGCAGAGTGATTTGCGTGTAGTCGTCGGTCGCCGCTGGGGACGATTCATAAGTTCCGCTGTGTGCCGCATCTCACCGCGGGCGGCGCTTTGAGCACGTGTGACGACTGTTACACTGTTCCGGGATGCTTATCATCTGGCGCGGGGATTGAGATGCCGACCTTCATCGTGAGGATGACTGGTGGCGTAACGGCCAGAATCTCTATCTGGATAATCTGGAGGCGACGGGGCTGTATCACAGGTGCCGTTGTCAGCGGCCACAGCCGGGCGATGCTGCTGCTGTGCTGTTTGGTTCATGACCCGTGTCCCCAGAATCACGCCGCAATTTAACTGCGGCGACCGGCGAGCTGCTGTGACCACCATATTCGAACAACAACGGCAAACGAGAGAGGTACACCGACAAATGGCAGCGACGCGCTGACAAGCTCTCCTCGCGTCACCGGGCATCGCATCTGCCTTTACGGGGATTTACAACGATTTGGTCGCCGCATCGACCTTCGTGAAAACGGGGCTGAAGCAGCCATCCGGGCACTGGCCACACAGCTCCCGGCGTTTCGTCAGAAACTGAGCGACGCTATCGATATACGATTGCCCTGAGACGTCCGTCAGCACGTCCGGGTTAACGGGGCAGTCATACATGAGACTCTGCCTGATGAGCGTAATTCATATGTTCCCGGAGTCGCCGCTCCAAGTCAGGTGGGCGTATTCCAGATTGTCCTCCGTGAACGCTTCCGGATCGCTTCGTTACCGTTCTAATGCCGCCGGTTGCAGCGACCCCGGCAGCCATTGGGGCCGGTATGAAGCGGCATCCTGTTTCCTTCTCGTGATCAGTATGGTGCTCGGTGTGGCGCAGATATGCTGGCACCGAAAGCCAGAACTCCCCATTGGGGTAAGACCGGATAACGGTAAGCAGAGAACACCTATTTCTCCCTCACTGGATAACATGGTTGCCCAGGGCAATGTTCTGCCTGTTCCTTCTGTACGGGGAAATGCGCGTGGGGTCACGCGTGGTTTCTCAGGAGATCAGCACGGCAGACGAAGGGGACGGTGGTCAGGTTGTGGTGATTGGTCGCTGATGCAAATGTTTTATGTGAAACCGCCTTGCGGGCGGTTTGTTAGGTTTTATGGAGCGTGAGGAATGGGTAAAGGAAGCAGTAAGGCTAAGAGCCCCGCGCGAAGCGAAGGACACTGAAGTCCACGGAGTTGCTGGCTGTGATCTAATGCCATCAGCGAAGGCCGATTGAAAGTCCGTGAGCATGGCTTAAACGCGTGCTGCTGAACAGTACGCCGGTGCTGACACTGAGGGGAATACCAAAGCCATATCCGGTGTCACGGTGTTCCGGGCTGGTAAGCAGGAGCAGACCCGCCTAGAGGGGATTTGAATCCCCTCGTTCGAGACGGTGCTGGTACGAAGTGAAATATGACACGCCGATCTACCGCCACCATTGAATCAGTCTGCAAAGCCGGCTCGTGCCTTTACCCTTCGCGTACAGGCATACTGTAGGAATACTAGCCTACAAATCCGTTAAATAGGAATCCGTCGGAAGTCCGCCTGCTGGTTCAGATACAACGTAACCCTATCCTGGTACGGAAAAAGAAACACCATTAAGGCAAAACCACCTCGCAGTATCTGCGCCTCGTAGTGATGGGTACTACTCCTCATGCGCCGCCCCGTTTAATATCCGGATGCGCAGGAATCACGACGCCGGAAAGCACCACAGACCAGCTGCAGAACAAAACGCTCTGGTCGTCAGCCACTGAAATCATCGATGTGAAACAGTGCTACCCGAACACGGCACTGGTCGGCGTGCAGGTGACTGGAGCAGTTCGGCAGCCAGCAGGTGAGCCGTAATTATCATCTGCCGGGCGTATTCTGCAGGTGCCGTCGAAACTATACGCATACGGCGGCATACAGACCCGGCGGTATCTGGGACGGAACGTTTAAACCGGCATACAGCAACAACATGGCCTGGGTGTCTTGGCTGTGGATATGCTGACCCATCCGCGCTACGGCATGGAAACCGTCTTGGTGCGGCCATTGTGATAAAATGGGCGCTGTATGTCATCGGCCAGTAACTGCGACCAGTCCATGTTCGACGACGGCTTTGGCGGCACGGAGCCGCGCATCATAGGGTAATGCGTACCTGACCACAGCGTAAGGCGTGGGATGTGCTCTCAGCGATTTCTGCTCGGCGATGCTGTATGCAGCGGTATGGAACGGGCAGACGCTGACGTTCGGGCGTCGCAGACCGACCGTCGGATAAGACGTGATAATAACCGCAGTAATGTGGTGATGCCGCCATGTCCATCTCGCCGTTCTGCTACATTCAGCGCCTGAAGGACCGCCATAATGCCGTTGGAGGTGAACTGGATTGACTGAATAACGTATGGGAGACGGCGACAGCTGTTGAAGATACGCAGGCCATTGCCCGTTACGGTCGTAATGTTACGAAGATGGATGCCTTTGGCTGTACCAGCCGGGGCAGGCGACACAGCGTGCCGTGTGGCTGATTAAAACAGAACTGCATGGAAACGGACGCAAGACCGTGGATTTCAGCGTCGGGCGTGAGCACAGAAGGGCTTTCGCCATGTACCGGGCGATGTTATTGAATCTGCGATGATCACTATGCCGGTATCAGCAGCGGTAGTCGTGTGCTGGCGGTGGTGAACAGCCACCAGGACCCGATGAACTGACTGGACCGTGAAATCGCACGTGCTCATCCTCCGGTACGCGCGCTACTCCCTGGTTACGGAAGGTGGCAATCCGGTCAGCGTGGAGGTTCAGTCCGTTACCGACGGATCGACCGGTAAAGCTGAGCCGTGTTCCTGACGGTGTTGCTGAATACGACGACAAGTATTATACGGAGCTGGCACCCTGCCGACGCTGCGCCCAGCGGAGGCACGCCTCCTTTCCGCTGCGTTCAGTACGTGGTCCAACGACGGCACGTATGCCATCACCGCCGTGCAGCATCGTCGCAGGGAAAAGAGGCCATCGTGATAACGGGGCTAGACGTGTACGGCGAACAGTGGCACGGTGAATGGTGTCACGCGCGCCCTCATGGTGCAGCAGGCCCGACCGCAGAAGTCATGCAGACAGGCAACAGTTCAGGTGCTTACGGAGGCACAATCAAAGGAAGGTGGTGAAGGCGTGAGTTTCCTGCTCCGTCCTGACCTGTACAGCGACTACGGCAGTGAGCGGCTGAGGTCAGCACGGCGGCCGGACTGACGGCGGAAACCAAGTCACCCGCCGCTTCACGCAACTGGCGCTTGGGGAATTACAGGCTGACAGTCCGGGCGTAAATGCGTGGGGCAGCAGGGCGATCCGGCGTTTCCATCGTTCCGGATTGCCGCATCCTTAAGCAGGCGCGTCAGGATTGAGCTGAACGCCGGGCTATTTTCAGATAACCGCCACGCCGCATCTCTTGCCGTTTATGACCCGACGGTACAGCGGTGTTACAGTTCTGGTTTCTTTTGGAAAAGCAGATTGCGGATATCAGACAGGTTGAAACCAGCACGCGTTATCTTGATACGGCGCTGTACTGGATAGCCGCCAGTATCAATAATATCAAACCGGGCCTAGCAGCTTATTATTTATATCCGCAGTGTAGACGAACACCCCGTTGGCAAATCGGCATGATTTCGTGGAGGCCGTCCTTCCTGGCAGGCGATCATCGTGGAAGGTTACCTGGATTTTTCAAAGGCAGATAGACCGAAGAATCCCATCTAAGCAGGAGCTGCTGGAAAAAGTCGAGCTGAACGGAGGATAACGCCAGCAGACTGGAGGAGTTTTCGAAAGAGTGGAAGGATGCCAGTGATAAGTGGAATGCCATGCTGGCTGTCAAATTGACGGACCAAGCAAAGACGGCAAATCATTATGTCGCGGGTATTGGCCTCAGCATGGAGGACACCGAGGAAGGCAAAACTGCTCAGTTCTGGTTGCAGCCAATCTCCCGCATTTATCTTAGCGACCCGGCAACGGGAATGAAACGCCGATGTTTGGCGCAGGGCGAGCAACCAGATATTCATGAACGAACGTGATTCCTGAAGCGCCTGACTAGCCCCACCATTACCAGCGGCGGCAATCCTCCGGCTTTTCCTGACACCGGACGAAAGCTGACCGCTAAAAATGCGGATATCAAGTGGCAGTTGAATGCGAACTCCCCTACGCTCAGTAATGTGACGATAGCTGAAAACTGTACGATAAACGATCTAGTGAGGGCAGAAAATCGTCGGGACATGTAAAGGCGGCGAGCGCGGCTTTCCGCGCCGCACAGCGTGAAGGCAGTGTGACTGGCCGTCAGGTATTACCCGTACCTGTCACCGTGACCGATGACCACTGCTTTTGATCGCCTCAGATAGTGGTGCTTCCGCTGACGTTTCGCGGAAGTAAGCGTACTGTCAGCGGCAGACACGTTTAGATGTTATCTGAAGGTCTACTGATGAACGGTGCGGTGATTTATGATGGCCGCTCGAGAGAACGTCGAGGCGGTACAGGTGTTCTCCCGTATGTTGACATGCCAGCGGGTCGGGGAAACGTGATCCTGACGTTCACGCTTACGTCCACACGGCATTCGGCAGATAATATTCCGCCGTACCGTTTGCCAGCGATGTGCAGCAGGTTATGGTATTAAGAAACAGGCGCTGGGCATCATTCTTTGGGTCTGAGTGTTACAGAGGTTCGTCCGGGAACGGGCGTTCTATTATAAACAGTGAGAGGTGAACGATGCGTCCGTAATGTGTATTGCCGTTGCTGTCGTGCCGCACTTGCGGTGACAGTCACTCCGGCCCGTGCGGAAGGTACTAAATTACGTTTACGGTGGGTGTTCAAGTGAAACCGGGTACATTGCCGTCGTGCTGCGGGGATACCGGTGTGAGTCATGAAGGGATTAACGTGAAGATACCGTTGAGCTGACGGACAGTGGCTATCATGGCTCCGCTGGGGTTTGCGCCGCGTTAGAAAAAGAGCAGCACAGTGATGACCTGGGAGGATACGTTCATGAGAGCTGCGTGTAACGTTAGCGTGAGCGCTGTAACCGACCCGGTTTAGGATCAGTAAGCAGGTCAGTGCGGATGCCATGGCCGATGGCTCACAGTCGGTGTCCGGCAGTCAATGGATTACCGTAAGACGGAAATCACTCCCGTATATGAAGGGACGACCACTGCCAGCACGAAAGTGCAATGCAGCATACCTCAGTGGCGTGGAGCAATGCAGGTACAGATTAATCCGGCAGCGTCCGTCGTTGTTGATATTGCTTATGAAGGCTCCGGCAGTGGCGACTGGCGTACCAACGGATTCATCGTTGGGGTCGGTTATAAATTCTGATTAGCCATAGACACAGTGTTATGACAGCCCGCCTGAACCGTCCGTCGTTGTGGGTGAATATGGCAGTAAAGATTTCAGGAATTGTAACAGACGGCACAGGAAAACCGTACACAGAACTGCACCATTCAGCTGAATTTGTTGACGTTAACAGCTACACGGTGGTGGTGAACACGGTGGCTCAGAGAATCCGGATGAAGCCGGGCACGTTACAGCATGGATGTGAGTACGGTCAGTACAGTGTCATCCTGCAGGTTGACGGTTTTCCACCATCGCACGCCGGGACCATCACCGTGTATGAAGATTCACGGGGACGCTATATGAATGATTTTCTCTGTGCCATGACTAGAGGATGATGCCCGGATGAGGTGCTGCGTCTTGAACTGATGGTGAAGAGGGTGGCGCGTAACGCGTCCGTGGTGGCACAGAGTACGGCAGACGCGAAGAAATCAGCCGGCGATGCCAGTCGCATCAGCTGCTCAGGTCTCGCGGCCCCTTGTGACTGGTGATGCAACTGACTCAGCACGCCCCCGCCAGCTTCAGAGCACGTCCGCCGGACAGGCTGCATCGTCAGCTCAGGAAGCGTCGCGGCGCAGAAGCGGCATCAGGCAAAGCCACTGAAACCAGAAAAATTGCGCAGCCGCAGAGTCCCAAAACGCGGCGGCCTACAGTGCCCGGTGCGGCGAAACGGTCAGAAACGAATGCTTGCAGCGTCACAACAATTATCAGCCGCCACTGCCTCCACCGCGGGTACGAAGCCCGTTACCAGGCCGCCATTCCATGCACGAGATGCGGGTGCTCTACAAAAGAGGCAGCAAAATCAGGATGAGAAACGAACGCATCATCACAGTGCCGGTCGTGCAGGATTCCTCGGCAACGGCGGCGCAGAATTCTGCCAGGGCGGCAAAACGTCCAAGAATAGCGAATGCAGGTCATCTGAAAGCCCGACGCGTCAGCGCCTCTGCCGCGGCATCACGGAAAACAGCGGCGGCGGGGAGTGCGTCAACGCGGCATCCACGAAGGCGACAGGCGGTCCGGGAAGTGCGGTATCAGCATCGCAGAGCAAAGTGCGGCAGAATCCGGCGGCAATACGTGCGGATTCGGCAAAACGTGCAGGACAGATATAGCTTCATAGTGTCGCGCTTGAGGATGCGGACACAACGAAGGGGATAGTGCAGCTCAGCAGTGCAACCAACAGCACCGTCTGAAACGCTTGCTGCAACGGAGACCGGTTAAGGTGTAATGGATGAAACGAACAGAAAAGCCCACTGGACAGTCCGGCACTGACCCGGAACGCCAACAAAGCACAACCAAATGCTCAGGGGAACAAACAATACCCGGGTTACGAACACCGGTTTTGTACTGGCCGCGATTGCAGATGTTATCGACCGCGTCACCTAACGGCACTGGATTGAATACGCTGAATGAACCCTACGCAGCGCTCGGGAATGATCCAGATTTGCTACCACCATGACTAACGCGCCGCTTGCGGGTAACAACCGACAGAATTGCGACACTGACGCTGGCAGGCTTTCCACGGCGAAAATAAATTACCGTATTTGCCTAAATGATGCCGCCAGCCGTGGACGCCACGCTGACTCAGGTTGGCAGGGGATATTCTGCAAAAATTCGTTGCAGATGTTCTTGAAGCTGTGGGGCCGGTAGAGAATTCGGCCTTTCTTCCGGCAGGTGCGCCGATCCCGTGGCCATCAGGTATCGTTCCGTCTGGCTACGTCCTGATGCAGGGGCAGGCGTCTAACAAATCAGCCTACCAAAACTTGCTGTCGCTTCCATCTGCGTAGTGTGCTTCCTGATATGCGAGCTAATGGACAATAATCAAGGGGAAACCCGCCAGCGGTCGTGCTGTATTGTCTCAGGAACATCAGGATGGAATTAAGTCGCACCCCACAGTGATCTTCAGTGCATTCCGGTACGGATTTGGGACGAAAACCACATCGTCGTTTGATTACGGACGAAAACAACACAGGCAGTTTCGATTACGGCACCAAATCGACACGAATAACACGGGCTCATGCTCACAGTCTGAGCGGTTCAACAGGGCCCCTCTGCGTGCTCATGCCACATGGTTAAGCAGGATGAACAGTTCTGGCTGGAGTCAGTATGGAACAAGCAACCATTACAGGAAGTTTATCCACAGTTAAAGGAACCAGGCACAGGTATTGCTTATTTATCGAAAACGGACAGTCAGGGCAGCCACAGTCACTCATTGTCGGTACAGCCGTGGATGCCGGTGCACATGCGCATACAGTTGGTATCAGGCGGCGTGCACCATGCATCAGCTCAGCTCGTCCTGCTCATGCCCATTCGTCCTTCAGTATTGGTTATCACGGACACCATCACCTCCGTTAACGCGTGCGGTAACGGAAAACACCGTCAAAAACATGCATTCTAACTATTGGAGGGCTTGCAGTAATGGCATTTGGAAGGTGAATAACCACGACCATAAATTTATAATCTGCTGGCCGGACCGTGCATGAATTTATTCTGTGGAAGGTGAAGCATATATTCCGCCTCATACCGGTCTGCCCTGCAAACAGTACCGATATTGCACCGCCATATTCCGGCTGGCTTTGGCTGTTTTCAACAGTGATGGAGCGTCATCTTAAGCATCTCGTTGAAGACCATCGGGTAAAACCGTCTATGACGTGGCTTTGAGCGACGCGTTATTTATTTCTGAACTCGGTCGTTACCGGAAAAGCTTTTACCTGGTCAGCGTGCATGGAGGGAATATGAGAGAAGTGGAACGGCACAGCCTGGGTGAAGGATACGGAAACAGAAGTATGTAATATTC
>48
TCATCGTCTCTCACTTTCAGCATTTGATGGTCGTTGTATGAGATAGATAGAAAAGACAACTCTGGCTTGAAGCCTATCAAAAACTAAGTAGTGATGAAAACTTTCCAAATATGAACTCATCAGCCTCATTTCCAAATATGAAGAGTTAAGACGTAATGAACCACAGATTCAAGTGACGATGATAAATTCTAAATTGTTTGGTGGACAATATCCAGAAATATCTGCTTCGAATGAGCTCTGGACATGCAATTGTTTTATTTACTATCAAGATTAGTAGATGTCGTTGTGAAAGTCATTAGTTTTATTCGATGAACCAGAGATTCATCTGCATCCACCTTGCTCTCTGCTTTTACGAACATTAAGCGACTTACTCGATGCACGCAATGGTGTAGCATAATTGCAACTCATTCCCCAGTACTGCAGAGGTTCCAAATCCTGCATGTGGAAAGTCTCTACGTCAAGAAGCAATAAACTATTATCCGTCCGGATATTGAGACATTCGGTACAACTTGTAGGTTTTATATGACTCGTGGGTGTTTTACTGAAGTGACAAATTCTGGATACCACCACTTATTATCGCAGTCCGTTGATTCAGCATAACATTTCTTATGAAACCATTCTAAAGGCTATTAATGGTCAGATAGGATGCGAAGGTCGAACCGTTTTAAGGGCGGTATGATACCGGCGAACAGTAGAGATGAAAGTAAAGTACAATGAAAAACTACCTCTTCCAGAAGGGCGAGTAGCGAAATGCTTAATAAATGCTCGGAAAGCTGATATGATGCAGATAAATGTTAGAAAATAATTTCGCTTACTCACTTCCCCATTTTGCCCGGAAAGAACAACAATATAGAATATTAAGCTCGACAGGTCAGTTATTTACCTACGACAGGACACCGCCCCTCTTGAGCCTACAACCTTAGTAGTTGGTAAGTGGACAAAGGTTAAATTAGAAAGCTTTATGAAAATAATCTCCAGATAAAACAAACCGCTAGAACATATATCCGATGACATGCTTGTTTCATCAGGTGAAAAATGTCCATTTTGTGGTGATGGACAGACAAAATATAGATCATTTTCTTCCTATTGCACATTATCCTGAATTTTCGGTGATGCCTATTAATTAGATTCCATCGTGCCGCGACTGCAATATGGGAGAAAAGTCAAGTTTTCGCAGTAGATGAGGTACACCAAGCGATTCATCCATATCGACAAGGACATTTTTCGTGAGCAATGGGTATATGCAAATTTCGTTTCCGGAACTCCGGGTGCTATCAGTTTTATGTTGAATGCCGGCGACTCGAGCAGGAAGACAAACACAGAGCTCTTCATCATTTCAAGCCTATTAAATATTTAACAGGTATCGTTGGAGGCAGGGAAGACGCACTTGAGTGAAGTGATTATCAAAGAAACTCTTTCGTAAAGTTATAAGGAGAATATAGTTCAACCGCAACGTTTCAGCAGCTACAGTCAGAATTTATTGAAACCAAATCTGAAACCTATTACATTTGAATGACTTCCCCAATTATTGGAAAGAGTTATGTATCAGTGCCCAGCAAACTGCCGAATTTTTCAGGGATGTAGAATATGACCGATGAAAGATAGAGAAAAGTACGACGCCTTATCGGAAGTGAACGATGAATATTTTATGAGGGAGCGGCTGTTTTACAAAATCCGGTATACTTGCTAACCAATTCCTAGGCAGGTCACCTTGGCAACAGTGGCAGCAGGCGAAGGACGTTGTGCTGTTCGGGCACAGCAGTCCCTAGGACAGTGGCGTACAGAGTCGATGGTCCTTGGAGGTGGTCACAAATTCTCATGCAAATATGTAAAATCGGTAGGCACTGGAAATGAGCCTTCAACACCCGCATTACAGGAAGTTCACCAGCCAGCCGCAGCACGTTCCTGCATACGACGTGTCTGCGGCTCTACCATATCTCCTATGAGCAACGTCTGCAGAGCCAAGCCACAACTCTAATTTTAATACATAATATGAATGATAATAATAATATTAAATTTCCTGTGTAACCAATTTATATGGTTCTGACATAAGAATCATGTGCAAGATCAAACAACTTGTATTACATTGACAGTTAAGCAGTTAATTTATCACCCTCTAAAATATATCAGCATCTAGCATGCAGTAAGGGTCAAAATGGAGAGTTTATGACTAAAACCATGGAAAGAAGACTTAAAGATTTATCGCACTTGCTGATAAATGCTGCATTGATACATATTTGACCTGAATTATTTCATTGAATTTGAATCGATTCCTCCAAACCGCAAGACAGTAACATTTACTTATTCAAAACAAAACCAGATTATAGGATATGACATTTGGTATAACAATAATGTTATTGAAATGGAAAATGAATCCATTAATGGCTTGGCTAAAATTCTCGCAATACGATAGAAAAACAAGGCAGATTTTAGAAGGTATATAGAGGCAAGGCGGAGCTCTTATTCATCTTACATTGAAGAAAATGACATTGAGTTTATTACGATGAAAGTATGTTAAACATTGGTAAAAGTTAGTCAGACTTGCACAAAGAAATTACTTCATCTTTAACTGAATCATCTACTTATTAAATTCAAATTGTATTGTATGTGGGTCTACATCTAAAAAGATTACGAATTATTACATGCTTAGCTATAATGCTGGCAGAAATTATAACTGCTGTAACTCTCTTGGCATACAATAAACAATCCAATGGGTGACGGATGTGATTCGCCAACATCGATTCGATGATCGTCTTATTTGATGAAGCCAGGAGAATAACTTACTTTAAATTAAAGATTACTCCATAGCAGCAAATTGTCATTTAGCATGATACAATATGACAATAAAGCGATTCCTGAAAGTACCCATGTTTAAAAACTGTAGATAATCCCAAAAACAGGTTCGACAGAAGAGTTAGTTGACTATACTGCCAAGCTTGCAGAAACGACTTTTTAAAGGACGGTTGACATTCAAACATTAATTTTATGATAAACAATTCCATCCAATTGATTTAATCAATACAACATTTGAAGATCAGCCAAGCAGATAAATATATTTTTGGCGTTATGCATAGTGACGAGCAGCCAAAATAACAAATGCCTATGGCTTCATTTGGATATCAGAGCTATGAGCCAGAAAGCAAGCATCTACTCCAATAAACCAATACATACAATGCCAATTAGATGAAAGACTTCAGGTAATTGGAATTGATTCAAATAATAATCAAATGTATTTCCAGGCAAATAGTTAGAGAAAACGAAGAAAAAGCGACTTTAGAAATATCAACAGCAGACTCAAACATGACGGAGCAAAAACCATATTTCATGCGTTTCAGTCTTAAAGCAATTGGCGGTGATGTATGTAGACACTATGAACAATTGAGTCATATAGAACTTCCATTATTCTCCTGAAGATAATAATCTAAATAAACCAATACTCAGCTTACAATACTAACTAACCGCAGAACGTTATTTCATACAACGTTTCCGGCATACCAAAACGATTACTCCATATAACAGGACAGCAGGCCACTCAATATCAGGTGCAGTTGATGTATCAACACGGTTCAGCAACCGATACTTCTTCCAGGCTTCCAGCAACGAGTTTCTTCCTTCGTTGCGATTCCCAGATCTGCATAAGCATCCTGAAGCGGCGCAATATGCTCACTGGCTACCTGCATCAGGCTTTTGTTCTTCCGCCTCCCGGATCTCGAACACGTTTTCTGCTTCCGTATCCTTCACCAGGCTGTGCCGTTCCACTTCCATATTCCCTCCCGAGATAACCAGGGACATTTTCCGGTAACGGACCGAGTTCAGAAAATAAATAACGCGTCGCCGGAAGCCACGGTCGACGGTTTTACCCCGATGGTCTTTGAATGAGATGCCACGATGCCTCATCATTGTTGAAAACAGCCACAAAGCCAGCCGGAATATCTGGCGGTGCAATATCGGTACTGTTTGCAGGCAGACCGGTATGGAGGCAGAATATGCAGTCGTCTCAGAAGAGCAAATGCCAAGTGGGGTTCCGGCCAGCAGATTTCCGTTTCAATGTATGGTCCGTGGTTGTTCACTCATTCGAATGCCATTATGCAAGCCTCAATATAGTTAAATGCAATGTTTTGACGGGTCGCGGGAGCTCCGCAGCGTTAACATGAATCTATGTGTCCGTGCAACCAATACCTGAAGAATGGGCATGAGCAGCATACATACAATGTATCGGTGCGCACCAATACCAACTGTATGCGCAGCATGTGCAGCACCTCAAGGGCTGTACCGGGTAACAATGAGTGACTGTGGCATGCCCTGACGTGCTTTCCATAAAGCAGCAATACCCTGTGTGCTCGTTTCCTTTAACTGTGATAAATTCCTGTAATGGTTGCTGTTCCATACTGACTCCAGCCAGAACTGTTCATCCTTAAACCACTGTGTGGCATGAGCACCCGCGGCCCCTGTTGAACCGCTCAGACTGTGAGCATGAGCCCCCGTGTTTATTCGTCGATTTGATCCGTAATCGAAACTGCTGTTGTTTTCCTTTCCGTAATCAAACGACGAATGGTCTGCTTTTCGTCCCCAAATCCGTACCGGATGCACTGGCACTGTGGGTGTGCACTTAATTCACATCCTGTTCCTGAGACAATACAGCAAGAACCGCTGGCGGGACTTTCCCTTGATTGTGTCCCTCGCATATCAGGAAGGCCCCGATGGATACGCGACAGCAAGTTTTGGTAGGCCGATAAGTTGTCAACGCCTGCCCTGCATCAGGACGTAGCCATACGGAACGATATGATGGCCACGGGATCGGCACCTGCCGGAAAGGCCGAAGCTTCTCACCGGCCCCAAGGCTTCAGAACATCTGCAACGGAATTTTGCCAGAATATCCCTGCCAACCTGAGTCAGTTCAGTCAGGCTGGCGGCATCCATTTCCGAACAAAATACGGTAATTATTTTCACGTGTGCATCGACTGCCAGCGCCGTCGTCAGTGTCGCATTCTTCGGTTGTTTACCCGCAAGCGCGTAGTCATGGTGGTAGCAAAATCTGGATCATTCCCGAGCGCTGCGGCCAGTTCACTTCAGCCGTATTCAGTGCGTCAGGTGACGCGTCGATAACATCTGCAATCGCGGCCGTTACAAAGCGGTTCGCAATCTGGGTTTGTTTGTTTCCCTGAGCGCGGTCTGTTTGGCAGTCGTTCCGGTCAGTGCCGACTGTCGAGTGGCTTTCTGTTCGTTTCATCCCATTAATTACCACCTTAACCGCCTGTTGGCGTGCAGCAAGCGTTTCACGACGTGCTGTTGGTTGCAACCTGCTGAGCTGCAACTGCTCCCTTTCTCGTTGTGTCCGCATCCTCAAGCGCGACAGCTGAAGCTATATCTTCTGCACGTTTTGCCGAATTTTGCACCGTATTGCCTCAGCTTCTGCAGCCAGCATTTTGCTCTGCGATGCTGATACCGCACTTCCGCAGCCTCCTGTCTCCTTCGTGTCATGCCGTTGACGCACTCCCGCCCCTGTTTGCGTGCCGCGGCAAGGAGGTGCGGTTCCCCTGCTGTTTCAGATGACGGCATTCGTCTCGGACGTTTTGCCGCCCTGGCAGAATTTTCTGCCGTCCCGCTAGGAAGCTGCACGACCGGCACTCTGATGTGATGCGTTCGTTCTGATTGATTTGCTGCCTCTTTTGAGGCCACCGCACGCATCTCGTGCTCTGAAGATCTGCGGCCTCTGACGCTTTCGGTGGCCGCGGTGCTGGAGAGGCAGACGTGTGGAGCATACTGTTGTGACGACTGCAGCATTCGTTTCTGACGTTGCAAGGCCCCTACGAGCGGGATAGTGAGCGCGTTGCACAGGGGAGTAACTCTGCGATGAGGCACTTTTCGGTTCAGTGGCCTTTAGTGATGCCGGCCGTGTCCGGAGGACGCTTCCTGAGCTGAACGATGCAGCTGTTAGATGGGGACGTGCTGAGGCGCGTCCGTACAGTCAGTTGCATCAGTCACAAAGGGCCGCGGGTACTGAGCAGCTGATGCACTGGCATCGCCGGCTGATTTCAGCGCGTCTGCCGTACTCTGTGCCACCACGTAACGCGTTACGCGCGAGAGGGCGCCTCTTTACACCATGAGTTCAAGACGACGACTAAGTGCCGGCAGGGGTAATAGCTCAGCGTCATGGCACAAGAAAGTGGATTCAGCGTCCCCAGTTGAGTGAATCTTCATACACGGTGATGAGCGGCCGTGCGGTGGTGTGATGGAAATAGCATTTAGTAAGTGAGGAACACTGTACTGACCTATAGATCTCCACATCCATGCTGTAACGCCGCGGCTTCATCCGGATTCTCTGAGCCCGCCGTGTTCTCATCACCACCGTGGTGCTGTTACGTCGGCTTTCAGCTGAATGGTGCAGTTTTCTGTACCAGTTTTTCCTGTGCCGTCTTTTCTTGAGGACTCCTGAAATCTTTACTGCCATATTCACCACCAAAAGCCCACCGGTTCCGGCGTCAGTTCAACACTGTTACCTGGCTAATCAGAATTTATAACCGACCCCAACGATGAATCCGTCAGTACTCCAGTCGCCACTGCCAGCCTTCAGATAAGCAAACAACGACGGACGGTGCCGGATTAATCGTATACCTGCACTCCACCGCCACTGAGGTATCCGCCGCATTGCACTTTCGTCCCTGGCAGTGGTCCTTTCAGCGCTACCCGGGAGTGATTTCCGTTGTACGGTAATCCATTACTGCCGGAACAAGCGACGTGAGCCATCGAGCCATGGCGATCACCAACCTGCTTACTGATTTGGTAAACCGGTCCGGCCATCACGGCCCAACGTCACGCAGGCTCGACAGTGAAACGTATCCTCCCCGGTCATCACTTGCTGCTCTTTTCGACGCGGCGACTCCCAGGAAGCCATGTACCCCCACTGTCCGTCATATAGACCGGTACTTCACGTTAATCCCTTTCAGATGACTCACACGGTATCCCCGCCGACAACGACGGCAATGTACCCGGTTTCATATTGAAAATAGCCCACCGTAAACGTACCCGTCCACCGTCGCACGGGCCGGAGTGACTGTCACGCAACATACCGTGGCGGCAAAGACAGCAACGGCAATAAGGCGCGTACGCATCGTTCCTCTCACTGTTTATATAAAACACCACCGTTCCCGGCTGACGTAGTGACCGCCACTCAGACCACGCTGATGCCCAGCGCCTGTTTCTTAATACACCAGACCTGCACATCGCTGGCAACGTATACGGCGGAATATCTGCCGAATGCGCCGTGTAACGTGCCTAAGCGTGAACGTCAGGATCACGTTTCCCGCGACCGCTGGCAGGTCAACAATACGGGAGAACACCTGTACCGCCTCGTTCGCGCCGCCAGCACATAAGTACACCGCACCGTTCATGCCATCCTTTCAGATAACACATCGAATACGATAGGTCCTGCCACGCTGACAGTACGCTTTACTTCAACGGCGCGAAACGTCAGCCGGAAGCAGCACTATCTGGCGATCAAAAGGATGGTCATCGGTCACGGTGACAGTCACGGGTATGAATGACGGCCGTCACACTGCTTTCACGCTGGCGCTAAAGCCGCTCGCCGCCTTTACAATGTCCCCGACTACATTTTCCCTCAGCGTACCGTTTATCGTGAGTTCAACTATCGTCACATTACTGAGCGTCCCGGAGTTCGCATTCACCTCATTAGTGATATCCGCATTTTAGCGGTCAGCTTTCCGTCCGTGTCCATAGGAAAGGCCGGAGGATTGCGCCGGGCTGGTAATGGGTGGGGCCGTCAAGGCGCTTCAGGAACACGTCGTTCATGAATATCTGGTTGCCCTGCCGCCAAAACATCGGCGTTCATTCCCGTTTGCCGGGTCAACCGCTAGGTTGGCGATACGATTGGCGGCAACCAGAAACGCGGCCGTTGCCTTCCTCCGTGTCCTCCATGCTGCTGACGTTCTGGTTC
>49
CTTATGCTCTCATAGACCTGGGGGCGACTACAGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCTTCGTCATAACTTAATGTTTTATTTAAAATACCCTGGACGCACAGAAAGGAAACGACAGGGTGCTGAAAGCGAGCTTTTGGCCTCTGTCGTTCCTTTCTCTGTTTTGTCCGTGGAACCGAACAATGGAAGTCAACAAAAGCAGCTCGGCTGGACATTTTGCGTCGTGAGTATCCGTACCACACGTCACTCAGAACTGCGGCAGGAACACGGAATGCCCGTTTATCGAGGCGGGTGGCAAGGGTAATGAGGTGCTTTATGACTCTGCCCTGCTTACCAAAATGGTATGCCGAACAGGATGCTGAAATTGAGAACGAAAAGCTGCGCCGGGGAGGTTGAAGAACTGCGACCAGGCCAGCGATGAAGATCTCCAGCCAGGAACTATTGAGTACGAACGCCATCATCGACTTACGGCGTTGCCATTTATCAACTAACAGGACGGTGGGAAGAATGCCAGAGACCCCTGAAGTGGAGTGGAAACCGCATTCGTACTTTCGGTGGTTAAGCTGTCGCGGATCGCAGCTGAAATTGCCAGTATTCTCGACGGCTCCCCTGTCACGTGCAGCAAGCAGTTCTAGGCAACTCTTTCCATCCAGCGCCTGTTGGATTCCTGAAACTAACGGGGCTCCTTCCCCTCGAGCGATGCCCACCCAGGCCAGCCGGCGTCATCACGGCTTGCTCGATGGACGGATATGACGACCCAATCCCGGTTGCACGTATTGGCTACGGGCTGAAATTTGTCCCACGCCGGTAGTCGCGTCATAAGCCTGTCCGCGGCATTCACACGCGACCAGGTCGTTCGGTAACAGGGCTGCACATTAATACCCGGGATCATTCGCGGAGCCCATGGAAGATGACCGCTCGGACCTGCCTTTCATAAATCCGGATGCTTGGGATGCAATGGCAGCAGAGCGCGTACCGTTTTACAGCTCCAGTGGTGGAAGTGGTTTAGACCGTGTCGTCGGTTATTCAGATAAAATCCTGCAGCTCCTCTGTTATGCCTCATTGCTGAGGCACCTCCAGCTGCAAGAGGCTTATGGTTAAGATAAACTGTAATTATTACACGGGTATTGTCCTGGAGGTGGCTGCGGGATTCAGCCCTCCATATTGATGCTGTTGCGTCACGAGTCATGCATGGCCCCGTGGCACGCTAAGGCAATACCCTCCGGGCGGCTTTCATAGATGGGCTCTTGACCATTTAACGTGTAATCTGCATGAGTCGGGCGAGGGTCTAGCACCATCCTCTCCTAGATTGCAGGCTTCAGTCTCATCCGGATCTCTGAGATCCAGCTGCCATTTTTGAACAAATACTGGTTTGGACTAAGAGGAGCGCCTCCATCGTTTGCTCTGAGCTTGCAACATAGCTTTTCCCCGGATGTCAGTGGATCTCACCCCCGCATGCACCCAGCTGTCGGATTGGGCTCGGGTCAGACCAAACAGGGGTTATTCGAATGACGGACCTAGAAGGGTTTAATGCGTTCGTATTTTGACATGTATAGAATTGCTCCCGGGGAAGGCGGTACGTGATCTGTAGATTTACAAAGCCCCAGCGTTTGCTAAATGGACTAATGCTCTACGACGCACCGTGTTTTGGTTAACGTATCCAGCACCGCTAATATTAGGGACGATTTACTATCTCGGAGCCGAGGAGTAATCTATTTGGGTCACTCTTACCAGTTCGTATGCAGATACGGGATGTACTGACAGTCCTGGCATTCTATTTTCGTCATCC
>50
ACTATTTAAGCACTGGCATTAAAGCAGCAGGATGCTACTCGATCGGGCGGCCGGGACGCTCGGTGTACGTCGATATAAGAAAGTCAGATCGAGCACTCGGCGCTAGCGTAACCTCGTATATATGTCATAAGCATTCGTACACAGTCGGCGGCCGTTAATAGTAGAAGGAAGGAGAAGACGGCCGGTTAAATCGTCGGGTACTCGCATCATAAAGGCTAGTTTCTAGCGGCGCAGGACCCACTCACGTTGAGCCCTTTCAGCAGGGAGCAACGTGAACGGGACCGTCAACGTGCCCATTATTGCCCGGATACATGAGCCATAAACAGTACGACAGTTCACTACATGGAAGTTGTAGACAGTTCTAATAAGGTGCCTTAACGCTTATTCTGTTTATGAGTCGCCTTTGGTCGGGTGAGCATCTGTGGATTTGTGCGGATGGTTATGCTAGAGGTGACAGCGCCAGGCATCGAGGCTTCCGTATGGGTGGGGTCAAGGGTACGCTCTTCGATTTACTTCTCCGAAAGTTAACGGAACCGAAGTCCGTAGGAAGGCCGTAGTGCCTGCGGCTCTCCGCCCGTTGAAGGAAATCGAAGTCAACAAAAGGAGCCCCGTTAACTTTCGCTGGCGTTACGGTTCAGAAGCCCTGAAACTAAATCCATCATGGCTGAGGACGGTACGCTTAGCTGATTCTGCATCGCCGATACAAACAGCGGTCTCAGATCAAACGGAGTTTGAAATTGAAATGAAAGCTCGCGTTCTACTAAAAATGCGCATCTGGTCATGGCTCCCATAAACCGTTGTACGAACGCCAGCAGGACGCTCTTTAACGGTCGACGGCTCTAACAGAACTAACCGAGTAGAGATTGTTGAATAGCGTGAAACTTGGATCGGTTTCTAGCGCGGATTGGACCGAGGAATCGCCAGTGGGATTCGAAGGGGCTCCTTTGATCCGTCCTGCGTGACGTCGGACGGACCTACTTCCGACGATTGGTACGTAAATGTTTAACACGGTGCGCTGGTTAACGGGTTCTATTCGCTAGGTCCTCGACTTATCGCGGACCTTAGTCTGGCGCTGAATAGCCGCGGGATCAGGGCTCGTCCCGTTCGGAGCATTCTACTCACCCAGGCCGCTGATAACCTCAGGTCCTTAACCCCCGACGCCACCTATTAGTCGCCTTAACCGGGCATCACTAAGCGTTGGGAACACTGGTGGCCCGGCGAGTTTAAGGGCAATTCGCGGTCCGTCAATGGATTATGCATCTAGGCGAAGGGGCACGATGCCCGTATCCTCACAAAGCCGCTTCAGCTCGTCCTACCGTAAGCATTTAACATTATTCTCTTTGCCGAACGCATGGATTGGGTAAAAGCGTCTGAAATGAGTTGACGAGTGTAGACTAATCGGCCGCCTTGCTCGCTGCCCCTTATCGACGACGCACTCTTTAAGACTGTTTACCACGGCGATGCCCGATTTGGTGGGGCCTCGTCTGGCCCTTTCTATAGGTAACGGCAAAAACATTACGTGGACGACCCGCGGAGCCCTAGAGTAGGTTTACGACATGCTGCCTATGAGTGATGAACAGGTAACCTGCCTGACGATCGGGAGACAAGCCAGGAAGGCCGCATTGTAAAGCTCAGGCGTGGCTAGAACTCAAAATGATCTAAGCAGACGAGCGCAGGAGGTGTCAATCCCTTAATAGCTCGGCTGCCATGATCCCCGGTTCGACTTCTATATCACAGTTTGACCTGTCATAAGGCGGTGATTCCCTTCGACGCGACGCTCCGCATAATCCAGGTCGCCGGGGATGCCTGGGTACTGAGCACCTATACTGAGCAAGGCGACTAGACCTTCACCGGTCTTGTGTCCGCGTGAAATGGGTCACGATCCATCCGCATCCTCACTGCTAAGCCCCGTCACGTATATGTTCATCATTTATTGACAGGTGATTGACTAGCGGAATTTGATTAGTCCAGCCAGATAGCCTACACCCAAAGACTTTCAGGACGAAAGCGTGATTCAGAAACGAGAAGCGCGGATATGTTTCTTAGTACTAGTCGTCAACGCTAAACAGCGATCGACAGGTTTTCACGATGAAAATATCACGTACTGGCTTGTTTTCGAAGCGCTTGAAGCCCCATTGACTCCATAGAACCGGAATTTTCGTGCTCCGTACGGGTAGAGCACGGGGAGTGAAAAGCTGTTACCCCTAAGCACGTGCTACAGCTGTTCTAAAGGATGAACGGTGCCCCTTTACGCTAGATGGATAAGACAGCTCGAGCGAATTGTCTACGAACCTACTCTGCTCTCTCTTTCGCCCACGTAAGCAAAGTCAGCCCGAACTTTAACTTTAGTTCTGTATCTCGGTTTAAATTTTGACCGTTGATTTCAAAGCCTGACCTACTTTCATTTGGGATTACGAAAGAAACCGCGGTTTGTTGGACATGAAACTCGTGACTACAGGTGGTGAAATATCAGCATAATGAGGCAACCGCTTCACATGACGCTTGCACGGCTAATGAATGCTCCCCGGAGCGATTCGAGCCACATTTCGATTGATTGAATGAATGAAAGCTGAGATTTCAAGCTCAAGCCTTAACAGATAGTTTTTAAACCGCCTACGGACTAAAACACGGTTCTTTAAAGCAAAAGCAATGGACCCGTCTACGCGAGGCATGCCGCCCGTTGCGGCCGCGCTCCTGTCTACCTCGCGGATCACTACGGGTCGGGCACCTGACCCCATTACCCCCGGCTGTTTTATCGCAGTGACAGTTACGCGAGAAGCAACGAAGAAACACGGTCGCGCAATAAGCCCGCGCTGGACTGAATGGAGACAGGTCGACCCGCCCTTCATCGGCGCTCGGACTGGACTGATTTTACGACAGTAAACGGGGCACTCAAGAATGACGGACGAAGTGAGCTCACCATCAGATTAGTATCTCGTGACGTTCGAAAAGTACCCGCAGTCTGACGTTCATCTAAAGTGGCAGTGAAGACCCAACCGTACCGTAGACCTAAGGCAGCGCTCCGTTGAAATCCCATTCTATCGCGACGCTAAACTGTCACCTTTCAATCGCTCGCGGCACGGAGTACGCGCGTTCTAAGCGGCAGCGGCTAAGAGCTGCGCCAAGGGTTCTAATGGATACGCATGGAGCTCGGAAGGGGCTATGCAATGCCCGTGCAACAGCCACGGACGTGGCTTTCACGGACGGGTCTCGAGTCTCTAAGTACGTAAGGTCACGGCTTTCATGTCCTGTCATAGAGCTTTCACTCCAAGCTGGCGCTTTAGCATCGGGGAGGAAGCCCGTGCTTTTCCTTGAGGTTGACTCAATGAAATATTTCGAGTAACTGCCTAGGCTTCTTTCACGTCCGACCGTTGAGCTCCAAACGGACCCATTTCCATTGATTTCGGAGCGATAGAGACCCGGTTTCTGGATTTCGACTCTTTCATTTACCTGGATACTGGCTCGCGCCGGAGACAATACGCGGGTAATCCATTTACGGACGCATCAGGCAACGAAGAAGAAGGCACGCGAAACTCTACTGGCTTAAGGATATCAATGACCGTAGGGGCCGGGTTAACTACATGCGTGACGCGGTTTTCAGGTATGGATGGCAGAACCCGACGCCACCCGTCTATTGGATCCGGGGCCTTGCTTCCGCGATCGATGCAACGAGCTGACAACCCGAGGAACCGTTAACCTGTTCCAAATCGTGTTGAGCAGGAGGTTTGGTTTTACAGTTCGATCTCTTCCGCATGACGCCTCGCGACGAAATCCAAGCCGCATCAGTGGGATCGACATTTAGGATGTATGTTCACAGTCCCAGCTCGAATGCAGATAGCGCAGAGTACTTATAACGCTTTACATAGGATCCTCGGCGCGGCTAAACAGTTCAGGTTACAATAGGGCGTAAACTGTTGACACATGGCGTTCGACCCTGCTAGCTGAACAAACTCGTCATTCCTTAGCCGTTGGACTCATTCACCTTGCTCACCGGCTCGCGTTATCGACAAAGTATTAAGTCTGATCGTCTGTCACTGCAAGCCGACCTCACAACCGTACGAGACGATCGATTAACTGTATGTCTGCTGTAGAGCATCACGCTGCGAGTAGTTTCTTCCTCCTGAGCATCTCCCTGAACTACTGTCACGGAGGTCCTGAAGGGCAGACGGGCACCCGGGCTGACGGTTGGCCCCGGTGGTTTATGCGGTGTGCTGACGCGTCGCAGGCGGGGCACCGTATTATCCTTGGCGCTCTATCGTGAAGGTCGTCATCGTTTAGATGCTTCGGCGTGACTAGTATCCCAAACCGTAATTCAGAGGTCGCCCGTAACGGATGCCGCGGGAACTGGTGACGGGGATAGTTACTGAGAGGACCTTACAGCGCGGTTTAGGCTTTGACGAATTTACCAAAGCGCTATTCTAATTCTTGGAAGGGAGCTCACGAGAAAGAGGCAAACAGCGGTGACGACTGTTACTGAAAGTTGCTCAGCAGTACCCGAACGTTTGGGATTTGCCGGCCCACCGCCGCTTGAATCGCCCGCTCGTAGCCCCACAGGCGAATAGGGCTTCATGACAATGAGACATAGTAAAGTCGACTAATATCGCGATTAATTGCCGTTCGCATATAGAGTTCTCATTTCATTTAATCGTCGCTGGCATAGCCGGCCGGGGCCCCGCAATCGGCTCATGGTTTCCTAGCCTGCCAGCCTTCAAGCGTTACGTGGACGGGACTCTCGTATTCTCTCATTCAGCGAGCGATCGGAGACGGATTGTTGGCTACTGAAGCAAGACCACCGTCACTTACAGTCATAGATGAACGCATCGCGACTTAGCCGCCGGGGTGTCCGACGCTCTCACGGATCGTGGTGGTGCACCCATTTCTAAGAGAATGGAGAGAAAGGCGAATTCATTATGAGGTAGCCAATCATGTTGCCATGCGACTAGGACTCGTAGGAAGCACTTTCTTTGCTCGTCACTCAACTCATGTGGCTAACTGTTCGGCGGATCGTCGACCGGCATCACGATTTCCCGATCCTTCGCAGCCGGACGCTGCCGCCTGCCAACGAAGGGACTGCGATCTACACGTTACAGAGCGCGATCCTGATGCCTCATTCCCCTCTCCTTGATTGCTGCGGCCAAGAGAACGGACTTCACCGAACCGTCCCATTCATGGCCGGCTCACAGGATTTTAGGGCCCGCCGTCCCTTAGAAAAGTTTCGTTGAAATTCACCGTCCTACGTGGACCTACCGGTTAAGGGATCCGCATAATCCTAAGCGTATTTCCGAGATAGAAATGGGAGACTCTGCACGTTCACGGACCTTCCATCCCCCTCTCCCGTTCTGGACGACCGTCGTACTCTGGACGAGCTTCGACTGAGCTTCAC
>51
TTCCGATGCGTGCTTGGGTGTTTATAATGTTGCAATTATTGCTACACCATTGCGTGCATGGATAAGTCGCTTAATGTTCGTAAAGCAAGCGAGAGAGCTGATGCAGATGAAGCTCCTTCCCATGAATCCAACTAAGTAATTTTCAGACGACATTACTAATCTTATAAATAAACAATTGCCATGTCCCACCCTTCGAAGCATATTTCTGATATCTTTATAAAACAATTTTAGTGAATTTATCATCGTCACTTGAATCTGTGGTTCATCCGTCTGATCCATATTTAGTAGAAATGGAGGCTGATGAGTTCCATATTTGAAAGTTTTCATCACTATTCCTGTTTGATAGGTTCAGCCAGTGTGTTCTACCTCTCATACAACCAAATAAATGCTGAATGAATTCTAAGCGGAGATCTCCCTGTATCATTTAAACTATTGCCTGGCAGCATTCTGCGGTTACCAATAAATATTAGCTTCATTTTGCTCTGGGTCAAGTGTTCTTTAGGAGAATAAGAATCAAATGCACTAACGAACTACGAACAAGCGATCGAATATCCTTTGGATCCTCCCTTACGCATATTTTCAGAAAATATTCATTGTTTTCTGGGTTGATTGCGACGCACCAATCATTCGAATGCACTGTGTTTTACCACCGATTCCGCCGATAAAAGCATGAATGTTCGTGCTCTGGGCATAGAATTAACCGTCAGCTAAAACGTTAAATCACTGAATCCGGAGCAGCATTTTCGCTTAAATGAAATGAGAAATCCACATTCTGGCAAACCATTTAACACACGTGCGAACTTTTCATGAATTTCTGAAGAGTTACCCTCTAAGTAATGAGGTTAAGGACTGACATTTCATTTCAATGTCGGCTAATCGATTTGGCCATACTACTAAATCCTGAATAGCTTTAAGAAGGTTATGTTAAACCATCGCTTAATTTGCTGAGAGTACTAACATAGTCAATGCTTTCACTAAGGAAAAACCATTTCAGGGAGTGACTGAATTTATTAAGTCGAATAAGTGCTTACTTCTTTCTCACGATACAATTTAACATTTCCGATATCGCATTTCACATGCTCATCAAAAGACAGGCCAATAAACATTGACTAAAGGAATAGTTAGTTCCAACCATCTGCTCGTAGGAATGCCTTATTTTTCTATGCAGGAATATATACCGCCTCTTTCACTAAACTCCGACATAGTAATGTAATTTTATGCCTAAATAACCGCAATTTATTTGGCGGCAACACAGGATCTCTTTTAATTACTGAGTAGATACGTTTTCCATCTAAATTAGTATTGAACCTTAACGGCATCGTATTGATAGTTCCATATTTAGCTTTCTGCTTCCTTTTGGATAAGGACTTTATTCATGTTGCATGGTGCACTGTTTATACCAACGATAGTCATTAATGCATATATATAGTATCGCCGAACTAATTAGGCCCTCCGCGTTCTGGAAGCGTTCAAGTACCTAATAAGCCGATAGATAGCCACGACTTCGTAGCCATGTTTTCATAAGTGTAACTTTCCGCTCCTCAGCCAACAGACATTCACCTACAGTTATGAGAAGAGGTTGCATGCTGTGGGGAAGTCGTGGCGACAGAAGGAAGTCAGCTGCGTCGTTTGACATCACTGCTATCTTCTTACTGGTTGCAGGTCCTGTAGTGAGGGCACACAAAGCTTTGCAATTGGAGACTAAGTCCAGCGTTGTGCTTCTCTGGAGTGCGACAGGTTTGAATGACAAATCGTAAGCGCAAGAACACAAATCATGTGCGCCTTGAGGGATAGTTACATGCTAATACCCATCTAAGTAATTGATTCTAATGACTGCATATGTTGTGTTTTACAGTATTATGTAGTCTGTTTATGCAAATCTAATTAATATTATATTTATACCTATTTTACGTTTCTCGTTCCCTTTTATACTAAGTTGGCAGTGACAACGCATTGGGTCGTACAATTTGTTGCAACGAACAGGTCACTATCAGACAAAATAAATCATTATTTGATTTCACACTCTTTGTCCCACTCCTGCCTCTGTCAGCACGATACTGTATCTGCTGCCATGTCCGACTGTATGCCGAGAAGATGTTGAGCAAACTTATCGCTTATCTGCTTCTCAGAGCGCAGTGCACAACTGCGCACTCGTGAAGGTGCGGGGCGGATCCCCTTCGAAGGAAGACGCTAATGCTTTCGTGCCGGCATAAAGCCTTGATACCTTGCCGGATGAAGCGGTTCGCGACGAGGCTGCAATTAGGTTTCTCCGGAATGGTGCATCTATTTGCGGTCCCACATGTTTCCTTCATTGATATTCGAGAGCATCAATATGCAATGCTGTTGGGATGAGATTTTAATCCGCCTGTTTGCTTTAACATAACAGCGTCATGCATCACGATATCAGACCATTCATTTCGCATAAATCACCAACTGACTCCGTTGCCCGGTAACAACAGCCAGTTTCCATTGCAGTCCAGCCCCAACATGATGACTATCTTCTGCTGCTTGATAATTTTCAGATTCGTCAGCCGTAAGTCTTGATCTCCTTACCCTGATTTGCTGCGCGAGTGGCAGCGACATGGTTTGTTATGGCCTTCATAGTTTGCCTCCCCTCGAATGCAGCTCAGTGTTGATCTTAGTACCGACCACGGTCGACGCTTCTCTTATTCATTGAGCACATGCCGCAATTTCTTTTTGGTGATGTGCAGTGAGCATCAGGCAGACTCACCCCTCCTTATTGCTTTAATTTTGCTCATGTAATTTATGAGTGTCTGATTCTGCTTGATTCCTCCTGCTGGCCAGGATTTTCTGAGAGATCGACGCCATGAATGTAACGTAACGAATTATCACTGTTGATTTCTCGCTGTCAGAGGCTGTGTTGTGTCCTGGAAATAACTCAATGTTGGCCTGTAGCTTCAGGTGATTGCGATTCTCATGTCTCTGCCTAATCCAAAGCCTTTACCCGTCCTTGGGTCCCTGTAGCAGTACGACTTATCCATTGTTTCTTAACAGGTCTAGGTAAATCCCGGCTCATGATTCGCCTTCTTCCCATTTCGATCCTGGTCAAAGGGCCCTGTTACTGGTCGATTTAAGTCACTCCTTTACCGCTGATTCGTGGAACAGATACTCTTCCATGCTCCTTAACCGAGTGGAATATCCTGCATTCCCGAAGCATCGACGAACTGTTTCAAGGCTTCTTAGTCGGGCGTGCGTTCCACTCCTGAAATGTCAAGTACATCGCAAGTCTCCGATTACGCAAGAAAAACGCCATCAGGCGGCTTGGTGTTCTTTCAGTTCTTCAATTCGAATATTGGTTAGTCGGTGCTATCTGCGCCGCCCATATCATCCGTATGTGCAGTCGTTGATGTTCGCTTCGATAACTCTGTTGAATGGGCTCGCTTCCATTCCTGTGACCGGAATGCATTTATCATCTCCATAAACAAACTAGATTAGCGATTCAGAGATAAATAAATCCCCGCGAGTGCGGAATTGTTATGTAATATTGGGTTAATCATCTATATGTTGTACAGAGAGAGGGCAAGTATCGTTTCCACCGTACTCGTGATAATTGCACGGTAGATCATTTCTCGCACCGACTTGCAGAATGGGGATTTGTCTTCATAGACTTAATCATGGAATATTTGTATGCCACTCTATCTATCCTTCATCTACATAAAGCCTTCGTGATGTCTGCATGGAGACAAGCGGATCTGCACAACATTGATAACGCCCCAATCTTTTGCTCACTCTAACTCATTGATACTCATTGTAGATAATGGTGCAATGATGTCGTTTCAGCTAAACGGTATCAGCAATGTTATGTGAAGAACAGTAAAGATAAGCCTGAGGAATGTTACCATCATGCACATCTACATACTCTGGCAGCCCTGTGAAGACGACGAAATTCAGCATTTTCACAAGCGTTATCTTTTACAAACCGATCTCACTCTCCTTTTGGGCCGAATGCCAGCGTCAGACATCATATGCAGATAGCCCTGCATCCTGAAGTGACCGCGTACGCGTAATCGATGCGTAATGATGTCAGGTCAGGACGGGTCTTGTTCGATTACTGCCGCAGAAACATTCCCATCCCAGTCCGATTAAGCTTGATAACAGGAGTCTTCCCAGGATGAATCAAGAAACTGGTTTCCCGTCTTCACGACTTCGTCGCTTTCCAGTCTAAACCGCTTACTCCCATCTAGAGATAAGCCCTTCGTAATACTCAATCTGCTCGTTGATTTGATTTGCTGTTTCAAGGACCTCAACACGAATTTCCTCTGAGCCACTGTCCGCAATAGCGTTCCTATTCGCGGCGTTGATGTATTGCTGGTGGTTTCTTCCCGTTCATCCAGCAGTTCCAGCATGGCATCTGTTACCAATTCAGCTGGAAAGGTCTCGTCAAAATGCCCCAGTCAACGTCATGCATTGCCTGCTCTGCCGGTTTCACGCAGTGCCTGAGAGTTAATTTCGCTCACTTCGAAATCTCTGTTTACTGATAAGTTCCAGATCCTCCTGGCACTTGCACAAGTCGACAACCCTGAACTATCGGCGTCTTCGTTCATCTATCGATCGCCCACAGCAACATCAGGCCCAAGATAGTGCCGGGGACGGGAGGCGGCATTTTATTGCTGTGTTGCCTGTAATTCGTCACTTTCTGATGCTGAATCAATGATGTCTGCCATCTTTCATTAATCCGACTGTTGGTTAATACGCTTGAGGTGAATGCGAACAGGATAAATTAGCCCTGATTCCTGTTTGCTTTTCATGTTCATCGTTTCGTAAATACGCCGTTTAACATGCCGATTGCCAGCTTAAATGAGTCATGTGAATCCCATCGATCCGTTTAGTAACGCGGTGATTCTTCAGTACGCTACGGCAAATGTCATCGACGTTTTAATGGAAACTGCTGTCCTTTTACTTTCAGAATGCCTGACGGGCAATGCTGTGAAAGGCGTTTCCTGCTGAGGTGTCATTGAACAAGTCCCATGTTAGCAAGGCACACCAGCACACATGAATAGCCCGCTGCCAGAACTGCATTCGAGAGTCATACCTGGTTTCTCATCTGCTTCCTTTCGCCACCATCATTCCAGCTTTTGTGAAGGGATGCGGCTAACGTATGAAATTCTTCGTCTGTTTCTACTGGTTTGGCACAACCTGATTCCAATTGAGCGACAAAGTGCCATCTGGAGTAGCGTTCTTACTCAACAGAATGCTTTGTGCATACAGCCCCTCGTTTTATTATTTATCTCCTCAGCCAGCCGGTTTGCTGTTCATGTGATTTCGATAACAGAAGGACGGGGAATACGCGACGCTTTGTAACGGAGTAGACGAAAGTAGTCCCTCCCGATATTATCGTTGATGCGTACGCCATTGCTCCCCAATAAACCATTTCAGCCAGCCTCCGTCATTTTCGATGAACTCCGGCACGATCTCGTCAAAACGCCATGTACTTTCATCCCCGCTCAATCACGACAGTGCAAGCCTTCACGGTTCGACCCCGTATAGTTGGCAAAGTACCAGGCATTTTCGCGTCACCCACATGCTGTACTGCATATGACGGCCATGTAAGCTGATTTAGCCTCGAAACCACGAGCCGGAACTTCATGAAATCCCGGGAGGTAAACGGGCATTTCAGTTCAAGGCCGTTGCAGTCGCAACCATCGGGAGAGCAGGCGGTACGCATACTTTCGTCGCGAAGCTAATCGGGGGATTCAGTAACATTCACGCAATGAATTCAACAGGGTTCTGGCGTCGTTCCTCGTATATTTCCCCAGGCCAGTTTGCTTGCCTCCGTTGATTCCAGCCACCGGTGCAACCTCAGCAAGCATGTAGAAATGGGTAAAAGTTCATGTCAGGCCATTTCTTCCGGGATCGTGTTTGCGCTCACGTTGTGAACTTTGAAGCGGTGAGCCCCGAGCCGTAATTGCACGCATCATCCCTGTTCGACAGCTCGCACATCGATCCCGGTACGCTGCAGGGATAATGTCCGGTGTCATGCGGTCCCTTCTGCTCTGCGGCTTTCTGTTCGCATAGGAATCCAAGGATTCACTGCTTCGGCCTGTGTCAGTTCTGACGATGCAGCACGAATGTCGCGGCGAAATATCTGGGAACAGAGCGGCAAGCAAGTCACGTCATCCCATGTTTTATGCAGGCGATCATAGAGTGTTAATCTCCTGCATGGTTTCATCGTTAACCGGAGTGATGTCGCGTTCCCTGAGTGGACGTTCTGCAGTGTACTGCAGTATTTTTCGACAATGCGCTCGGCTTCGTAGGTTGACGCTCTAAAGCATGAACCGAACCGGCACACTGAATGGCTTTATGACGTAACATCCGTTTGGGATGCGAATGACTGCGACTAGTCGTTACTTAGGGTTAGGGGTTTGAAACCGGTTCGCGGCGGCATTCAGTACCGATACCGGTTCGGTAACGAAGATCGGATGATCACTTCGTCGGTAAATCTAGGCATGTACAGCATTCATTGTCCTGCTCAAAGTCCATGCCATCAACTGCTTTGCTGCTCAGCCGTCCTAGTCATCAGGACGCCCAATGACGATGCCATTCTGCTTATCAGGAAGGCGTAATTTCTTTCGTCCTACGGATTAAGCGAGCGTACTGGTTGGCAACGATCAGTAATGCGAGGATGAACCGACGCAACCTGTTCGTGTAAGCTTTAAATGCCGTCTGGCGAATGAGTGATCATAATTCCTGTAGTCGACAGAATCCATGCCGACACGTTCAGCCAGCTTCCCAGCCAGCGTTGCGAGTGCAGTACTCATTCGTTTTACCTCTGAATCAATATCAACCTGGTGAGCAATGGTTTCAACCATGTAAGATGTTGCCTGCCTCCTGAAGCCATCAACATCGTCATCAAACGCACGGTAATGGATTTGCTGGCGTGGCGTTGCACCGGACCGTACATGCATAGGCGATTGCGCTCAAATAGTCTGGGCAGGCCTTTTCCATGTCGTCTGCCAGTTCTGCCTTTCTTCCTCACGTGAAGCTGCTCTGTAGCGCCCTAACCCTCACACGAATCCTGAATGTAAGGACCGTTCATGGCTGAACTCCTGAAATAGCTGTGAAAGTGCCCGAAATGCCGGGCTGATCGTGGAAGACCGGAGGGGTTAGTGAATGCTTTGCTGATCTAGTTTCATATTAATACCGTTACTAGCGACCGTGCGTCGGCTTCACGAAACATCTTTCACGCCAATAAATACCGATAAATTTATCAAGTCGGCCATAAGTGTTTGAATGCTTCTTTGGATGGCTGACATTAAGTAGTCGATAAGGCGTTTCCCTCCGTCACGTAATTAACGGGTGATTCGTTCAAGTAAGATCCGGAAGGGCAGCCAGCAACGCACGAAGCGACGCCTGCAATGGCAGTCGCATGGTGCTCCTTATTATACTAACGAAAAACGACGCGATGAAGCGTTATTGGAGCGTAAACGGCAGGCACTCATGTAGCCTTAATATCATGAATCAATATTCCTGATACATCGGTAATTCTTATTCCTTCGCTACAGCCATCGTGAGGCCATCCTTCCTAACCATTTCCATCATTCCAGTCGAACTCACACACAACACCATATGCATTTAATCGCTTGAAATTGCTAAGCAGAGCATGTTGCGCCAGCGAGATTAAGCATTTAATACAGATAGATTTTTATTGAGTCGGGCTTCAGAGTCTGACAGAATTACCGTGACCGTATGAAGTTTTTCCTGTCGGCTTACATTTAATGCTGATTTCACTTTCTATTGATGCCTTTCCAGTCATCACCGTAAGGGTATTTGATGTTGACATGACTGTTCATATCTCGCAGATAAATCAAGGCTAAAGGCAATTTCCAATAGTCAGAACAAGTGCTCCTGTTTAGTTACGAGCGACATTGCTCCGTGTATTCACTCGTTGGAATGAAACACAGTGCAGTGTCTGTTCTGTTATTTATGCCAAAATAAAGGCCACTATCAGGCAGCTTTGTTGTTCTGTTTACCAAGTTCTCTGGCATCATTGCCGTCGTTCGTATTGCCAGATTTATCAACATATTTCCCATCTTCCATTACAGGAAACATTTCTTCAGGCTTAACGCTGCAATCCGATTGCAGCGAGCTTGCATCCATTGCATCGCTTGAATTGTCCACCATTGATTTAAGGCTTAGTCATGACCGTACTTCTAGTATTGTTCCATCACATCCGGCCGCTGCTCTTCGAACCTTCAAATTCTTCTTCCATATCATGTAAATAGTACATGCGGTAACAATTAGTGTTAACAGACGATGGTTCTCGTGTTCTACACAGCGAGAATCAATAAACTATTACAATGGGGCACAGTCTGAGTAGAAATGAGCGATCGGGGTATTCTCGGACGAGTGTTCAGTAATGAACCTGGGCAGGAGAGAAACCATTACTGATCGTTATGACGTGGGTTAGACTGCTTTAAGCCCAGATAGACTGAGGCCGAATATGTTAAGATACGAATCGGTATTCCTCATGTAGCATGTTCGTCTTTGCTCTTGCATTTCGCGAGCATTAATGCATCGATTATCAGGCCTTGCCAGCGCCAGATATTACCGGGATTTAAGCTAAGAAACGCATTAAGATGCAAAACGATAAATGTGCGATCAGTAATTCAAATGATACAGAAGAGCAATGCTGGTTTTGTGCGCAGCCCTTAATGAAGGCAGGAAATGGTGGTTGTAGCTCCAAACAATTCCCCATACATCCTGAGTTGATTGAGCTTGGTGTTGAACAAAACTTTTCCGATGGAAATGGAAGCATATTATTCCCACTTAAGATTTACTGACCTGAATTAGTTGCCAGCTATGATCCATAATATTAGATAAAGCCACCAATATGGCATACACGATAAGAGGAATCGATTTTCCCTTAATTTGCGTCCACTGCATGTTATGCCGCGTTCAAGGCTTGCCTGTACCATGTGCCTAATTCCTTGCGCTCAATACGTTGCAGGTTGCTTTCAATCTGTTTGGTATTCAGCCAGCACTTAAGTCCCATCGGATTTAGTGCGCTTTCTAACCGTGATTTCGGTTTGCGATTCAGCGGAGAATAGGCGGTCAACTGGTTGCTTACCAACCAACAGGGGATTTGCTGCTTTCCATTGAGCCTGTTTCTCTGCGCGACGTTCGAGGCGTGTTTGTCGTAGCATCCATCTGGATTCTCCTGTCAGTCTAGTCGGTGTGTGGCAGTTGTAGTCCCTGAAAACCGAATCCCGTAAGGTGGCAGCTAATTGGAATGCAGGTACGGCCAATGCTTCGTTTCGTATCACACAGGACGCCTTCTGCTTTTTGAATGCTGCCCTTCTTCAGGGCTTAATTTTAAGAGCGTCACCTTCATGGTAGTCAGTCCGTCCTGCTCTTGCTCAGTATCACCGGTATTTATGTCAACACCGCCAGATAATTGTACCGCAAGATGGTTATCTGTGTATGTTTATGAATTATTTTGCAAGGGGGCATGTTTGGTAGGTGAGAGATCTGAATTGCTGTTTAGTGAGTTGTATCTATTTACTTTCAATAAATACAATTGGTTATGTGTTTTGGGGTGCGATGGTCCGGCAACAGTTTGAGGGTACCGTAGATATCGTAAAAGGTCCAACGATGCACTTGAATGAACGCAGGAGCAAGAGGCAAGCCGCCCGAGACTAGAGCCATGCTACCCGCTAGCTGAAGACTAAAGATTGGCAGAAGCGCCAAGCTGACAAATTAATAGACAAGACTACAGGGTTATATCCTAATTCTGGTCGCGCGTTCTGCTTCCCATTAAACGTCAAGGCAGCAATCAGAATTGCATCTATTCCTGCATATGATAAGTACTCGCCCCAAGACCATGACTAGCCTGAAAAGAAACAGAGGAATGGAGGAAAGGCCATGAATGCTTACGATAACGATGAGGAATTATTACTATGTAAACACCGCATGATTCTCGTTCTCGCGGCATAATTACTCCATATAATTAATCCTTACTTTGCCCTGCTTTAAAGCCATTCCAGTATGAGCTGGTTTCATTCTTGCTAATGAGATGCGCCTCTTCAGCGCTCCCATGGTTCGCACTAGGCGATGGGCTAAGGGTCCCCTTAGGTCAGCTTTGATAGACTGTTCTGTTAAAAGACTCCAGCCTCATCTTTGCCGCAGGCTAATGTCGATCGAGCTGACGGTATAAATAATATCCTTGGCAACCTTTTATCCCTTTAAATTTTGGCTTAATGACTATCCAATGAGTCAAAGCTCCCTTCATTTAATATCTGTTACGCTAAGACCTTTAATATACGCCAAACCAAGCTAGCTTAGTCGCTCACCGTTGTTCGGCCGATGAAATGCATATCCAACATCGTCTTTGGACGGTTGACGCCTCATCTAGTGGACGCTATCTGAACGCGCTCTCCACTGCTTAAACCACTTCCTTTCCCGATTAAATGGTCAGATCGATGGTCGGCCGAACAGTTCTGGCAAAACCAATGGTGTCGCCCTTCAACAAAGATGGGAATCCCAATGATTCGTCATGCGAGGCTGTTCTGCTATCTTCAACTGAATAGTTAGAATTATACTAAACCACTCTTTATTTGTTTGGTAAAGAGAAAAGTTTTTCCATCGATTTTATGAATATACAATAATGCAGCCAACTCGCAGGTGATGATGAGCCAGCAGAATGCAGGAAAACAGACAGGTTTATCAGCTGTATCTTTCCTTTATTTTGCTGCGTAAGTCGCATAAACCATTCTTCATAATTCAATCCATTTACTTTATGTTCTCGGAGGAGTGAAAATTCCTAATTCGATGAATTGTGCTCAATTGTTATCAACTATGCGCCAGACCAGAACAGTCCGATCAGCAAACGTCTCTTCAGGCCACTCCCATTCCTCTTTCCCGCCTGGAACACTCATTGCATGGATCATTGGGTACGTGGGTTTAGGTTAGTTGTAAAACAGGACCGCTATCCTGATCAGTTTCTTGACTGGGTAAAAACCATCACCCCCAAGTCTGGCTATGCGAAGCCTGGCTCAACAGCCCTGCTCAGTGACGAGAATTACATTCTAGCGTCAGGAAAGGGTGTACGCTTGAAGCTGTTACTGGCCGGTCCTGCAATCCTTCAACTCGCCAGAAAGCATTGACCCGATCGGCCTTTTGGTCGTGTGCTTACCCATCTCTCGCAAGCCTTTGGTAAAGTCACAGCTTAGATGAACATCCTGCCTGAACAGTAGAAAGGTACGCTACCCTCACTTCTAAGTGACGGCTGCATACTAACCGCTTCACTCTAGATTCTCGTAAGGAAGCGTAAATGCAACGATTAGAATTTGATTGCAATTCAGGGTAGTCAAGGATGCATTTACTTCAGGGTAAATAAAGCATTAACGCCTGAATGCGAATCCCATGAGGGTAACCATTTCCGGTTAAGGGTACATATGGTTTTTCTTTCAACCTGGGTTAAGGTGACGCTCCTTGATTCGAGGGTATGCGTCGTTCGTTACTTA
>52
ATAACCTTCGCACGTGATGTTTGTGTTTATGGAAAGATAACTCAATGTTGTAATGGCCTTCAGTGATTGCGATTCGCCTGTCTCTGCCTAATCCAAACGCCTTTGGGTCCCTTGTAATTACATCATCCCAGTAATATCCATTGTTTCTTATAAAGGTTAGGGGACAATCCCGGCGCTCATGACTTCGCCTTCTTCCCCATTTCTGATCCTTCAAAGGCCACCTGTTACTGGTCGATTTAAGTCAACCTTTACCGTGATTCGTGGAACAGATACTCTTCCATCCTAACCGGAGGTGGGAATTATCCTGCATTCCCGAACCCATCGACGAAATGTTTGCTCAAGGCTTCGTGACGTTGCTCCGTGCGTTCCACTCCTGAAGTGTCAAGTACATCGCAAAGTCTCTGAAAACTTGACTGCAAGAAAAACCGCCATCAGGCGGCTTGGTGTTCTTTCAGTTCTTCAATTCGAATATTGGTTACGTCTGCCAATCCTATCTCACTGCGCCCATATCATCCAGTGGTCGTAGCAGTCGTTCATGTTCTCCGCTTCGATAACTCTGTTGAATCGCTCTCTCCATTCCATTCCTAGTGACTCGGAATGCATTTATCATCTCCATAAACAAAACCCGCCTGATCCAGGTTCAGATAAATAAATCTCCCGCGAGTGCGAGGATTGTTATGTAATATTGGGTTTAATCATCTATGTTTTGTACAGAGAGGCAAGTATCGCTGTTTCCACCGTACTCGTGATAATAATTTGCACGTGATGAGTCATTTCTAGGCACATTGCAAATGGGATTTGTCTTCGACATTAGACTTATAAACCTTCATGGAATTTATCCACGACTCTATCTATACCTTCATCTACATAAACACCTTCGTGATGTCTGCATGGAGAGACAAGACAAGCAGGATCTGCACAACATTGATAACGCCCAATCTTTTGCTCAGACTCTAACTCATTGATACTCATTTATAAACTCCGTGCAATGTATGTCGTTTCAGGTAAAACGGTATCAGCAATGTTATGTAAAGAAACAGTAAGATAATACTCAACCCGATGTTTGAGTACGGTCATCATTATGACACTACACTCTGGCATCGCTGTGGGAGAAGCACGACGCGAAATTCAGCATTTTCACAAGCGTTGGTGATTCAAAATCACAGTCTCATTTCCTTTGATGCGAATGCCAGCGTCAGACATCATATGCAGATACGTATGCATCCTGAACCCATTATAACCCGGGACCCCGTAATAGCGATGCGTAATGATGTCGATAGTTACTAACGGGTCTTGTTCGATTAACTGCCGCAGAAACTCTTCCAGATCAGTGCAGTGCTTGGTGATAACAGGAGTCTTCCCCAGAGATGCGAACAACAAGAAACTGGTTTCCGTCTTCACGGACTTCGTTGCTTTCCAGTTTAGCAATACGCTTACTCCCATCCGAGATAACACCTTCGTAATACGGACGCTGCTCGTTGAGTTTGATTTGCTGTTCTCAAGCTCAACACGCAGTTTCCCTACTGTTAGCGCAATATCCTCGTTCTCCTATTATGCGGCGTTTGGCTGATGTATTGCTGGTTTCTTTCCCGTTACTATCATCCAGCAGTTCGAGCAGTAATCGATGGTGTTACCAATTCATGGAAAGGTCTGCTTTATAAATCCCCAGTCGTCATGCATTGCCTGCTCTGCCGCTTCACGCAGTGCCTGAGAGTTAATTTCGGCTCACTTCGAATCTCTCTGTTTACTGATAAGTTCCAGATCCTCCTGGTGGCAACTTGCACAAGTCGACAACCCTGAACGACACAGGCGTCTTCGTTCATCTATCGGATCGCCACACTCAGACTAATGAGTGGCAGATATAGCCTGGTGGTTCAGGCGTGCAGAATTTTTATTGCTGTGTTGCGCTGTAATTCCTTCTATTTCTGATGCTGAATCAATGATGTCTGCCATCTTTCATTAATCCCTGAACTGTTGGTTGTAATACGGTTGAGGTGAATGCGAATAATAAAAGGAGCTGCTCCCTGATGATTTGCTTTCATGTTCATCGTTCCTTAAAGACGCCGTTTAACATGCTGTACGATTGCCAGGCTTAAAATGAGTCGGTGTGAATCCCATCAGCGTTACCGTTCACGCGGTGCTTCTTCAGTACGCTACGGCGAGGCAAATGTCATCGACGTTTATCCGAGAAACTGCTGTCGGCTTTTGATTCAGAATCTTAGCCTGACGGGCAGCAAGGGGTCGTGCAAGGCGTTTTCCTGCCTGAGGTGTCACGTGAACAAGTCTCCATGTCGGCAAGCATAAGCACCAGAATTATGAAGCCCGCTGCCAGAAAAATGCATTCCGTGGTTGTCATACCTGGTTTCTCATCTGCTTCTGCTTTCGCCACCATCATTTCCAGCTTTTGGCGACGGGGATGCGGCTAACGTATGAAATTCTTCGTCTGTTTCTACTGGTATTGGCGCCAACTCATAATTCCAATTTATGAGCAAGGCTATGTGCCATCTCGAATACTCGTTCTTGATAACTCAACAGAAGATGCCTTTGTGCATACTTCAGCTCTCCTAAGCCGTTTATTAATTATCTCCTGAGCCCCTGTTACTTTCAGTGGATTTCGGATAACAGAAGGCCGGGAAAACCCAGCCGGCTTTGTATAACGGAGTAGACGAAAGTGGATTGCGCCTACCCGGATATTATCGTTCAGGATGCTTTACTCCGCCATTGCTCCCCAAATACAAAACCATTTCAGCCCAGTGCTCCGTCCACTTCGATGACGACTCCGGACGATCTCGTCAAAACCGCCATGGTACTTTTCGGCTCCCGCTCAATCACGACATAATGCAGGGGCCTTCACGCTTCATACGCGGGTCATAGTTGGCAAAGTACCAGGCATTTTCATGCGTCACCACATGCTGTACTGCACCTGGCCGTGTAAGCTGGTGGACTTTATGGCCTCGAAACGACCTAATCGAACGGAACTTCATGAAATCCCGCGGGAGGCTCCGACGGGCATTTCTCCCGTTCAAGGCCCGTTGCTGCGTTAGACCTTGCATAAACCATCGGCGAGCAGGCGGTAACGCATACTTTCGTCGCGATAGATGATCTGGGGGATTCGTTCAAAGTGATGGATTCACGCTGAATCAGTTAAACTGCGCCAAAACAGGGGTTCTGAGGCGTGTACTCGTACTGTTTTCCCCGCCCGATGCCAGTGCCTTGCTCCAGGTTAACTTCCAGCCGCCACCGGTGCAAACCTCAGCAAGCAGGGTGTGGAAGTGAGGGACATTTTCATGTCAGGCCACCTCTCTTTCCGGAGCGGGGTTTTGCTAATACGTTGTGAACTTCTGAAGCACGGTGATGACGCCGAGCCGTAATTTTCTTGTGCCACGCATCATCCCCTGTTCGACAACCGCATCGATCCCGGTACGCTGCAGGATAATGTCCCTTGTCATGCTGCCACCTTCTGCTCTGCGGCTTTCTGTTTCAGGAATCCAAGAGGCTTTAGACTGCTTCGGCCCTGTGTCAGTTCTGACGATGCACGAATGTCGCGGCGAAATTGGGGGAACAGAGCGGCAATAAGTTAGCTTCATCCCATGTTTTATCCAGGGCGATCAGGACGATGTTATGCATCTCCTGCATGGTTTCATCGTTAACGGAGTGATGTCGCGTTCGGCGGCTGACGTTCTGCATGTATGCAGTATTTTCGACAATGCGCTCGGCTTCATCCTTGTCATAGTACCAGCAAATCCGAAGCGCCAGACGGGGACAATGGAACTTAATGGCTGTTATGGACGGCTCAACATCCGTTTTCTGATTCCGACTGCCACGGCCCCGTGATTTCCCTGCCTTCGCGAGTTTGAATGGTTCTCGCGGCGGCATTCATCCATCCATTCGGTAACGCAGATCGGTATTACCGTCCTTGCGGGCTCAAATCCGGCATGTACAGGAGGATTCATTGTCCTGCTCAAAGTCCATGCCATATCAACTGCTGGTTTTCATTGATGATGCGGGACCAGCCATCAAACGCCACCACCGGAACGATGCCATTCTGCTTATCAGAGGGAAAGCGTAAATTTGCAATTTCGTCCACGGATTACCGAGCGTACTGGTTGGCAACGATCAGTAATGCGATGAACTGCGCATCGCTGGCATCACCTTTAAATGCGTCTGGCGAAGAGTGATCATAGGGTAAAGTTCCTGTGGGTCGACAGAATCCATGCACGTTCCAGCCAGCTTCCGAAGCCAGGGGGCTGTTGCGAGTGCAGTACTCATTCGTTTATACCTGGATCAATATCAACTCTGGTGTGAGCAATGGTTTCAACCATGTACTGGATTGTTCTGCCATGCGCTCCTGAAACTCAACATCGTCATCAAACGGCACGGGTAATGGATTTTGCTGGCCCCGTGGCGTTGCAAAGGTGATCGATGCAGAGGCGATTCAAAACAGGTGCTCGGCAGGCCTTTTCGGCCATGTCGTCTGCCAGTTCTGCCTCTTTCTCTTCGAACGCGAGCTTGCTGGTAGTGACGCGCCCAGCTCTACCTCAAACGATCCTGAATGTAATAAGCGTTCATGTAGTGAACTCCTCCGAACTCCCTTGAAAATACGCCCGCGAAATGCCGGCTGATTCAGGAAACAGGAAAGGGGGTTAGTGAATGCTTTTGCTTATAATCTCAGTTTCAGTATTAATATCCATGTTATAAGCGTCGACGGCTTCACGAAACATCTTTCACTCCAATAAAAGTGGCGATAGTGAATTTAGTCTGGATAGCCATAAGTGTTTGATCCATTCTTTGGGACTCCTGGCTGATTAATATGTCGATATAAGGCGTTTCCATCGTAGACCATTTACGTAATTTACGGGTGATTCGTTCGTACAGTAAAGATTCGGAAGGGCAGCCAGCAACAGGCCACCTGCAATGGCATATTGCATGGTGTCGTGCTCCTTATTTATACATAAATGAAAAACGCCTCGAGTGAATCCGTTATTGGTATGCGGTAAAACCGCACTCAGGCGGCCTTGATAATCATATCATCTGAATCAAATATTCCTGATGTATCGATATCGGTAATTCTTATTCCTTCGCTACCATCCATTCGAGCCATCCTTCCGTGACCATTTCCATCATTCCAGTCGGAACGCACACAACACCATATGCATTTAAGTCGCTTAACGATCCTATAAGCAGAGCAGCATGTCTCAGCATGATTAATACGACAGCATTTAATACAGAGCCGTGTTTATTGTTGAGTCGGTATTTCAGAGTCTGACCAGAAATTGATTAATCTGTGAAGTTTTCCTCTGTCATTACGTCATGGTCGATTTCAATTTCTATTGATGCCTTCCAGTCGTAATCAATGATGGTATTTTGATGTTGTTTGACATCTGTTCATATCCTCACAGATAAACTCCGCTTACACACTGGAGGGCAAAGAAGATTTCCAATAATCAGAAACAAGTCGGCTCCTGTTTAGTTACGAGCGACATTCGTGCGTGTATTCACTCGTTGGAATCGAATACAAAGAGATGTGCATGTTTATTCTGTTATTTATGCCAAAATAAAGGCCCACTATCAGGCAGCTTTGTTGTTCTGTTTACCAAGTTCTCTGGCAATTCATTGCCCCGTCGTTCGTATTGCCCATAATTTATCGACATATTTCCCATCTTCCATTACAGGAAACATTTCTTTCACGGCAACCATGCATTCCGATTGCAGCTTGCATCCATTGCATCGCCTTGCACGTGTCACACCATTAATTTTATCATCAATAGTCGTAGTCATACGGATAGTCGCTACTGTTCCATCACATCCTGAGGATGCTCTTCGAACTCTTCAAATTCTTCTTCCATATCACCTTAAATAGTGGATTGCGGTAGTAAAGATTGTGCTCCTGTCTTTTAACCACATCAGGCTTCGGTGGTTCTTAGTTATCCCTACAGCGAGAAATCGATAAACTATTACAACCCCTACAGTTTGATGAGTGACGAAATGGGATCTGACCTCCGTTGATTCGGACGAGTGGTTCAGTAATGAACCTCTGGAGAGATGACGATGTATATGATCGTTATCTGGGTTGTAATTCTGCTTTAAGCCCAGATAAACTGGCCTGAATATGTTAATGAGAATCGGTATTCCTCATGTGGCATGTTTCGTCTTTGCTCTTGCATTTTTCTAGCAATTAATGTGCATCGATTATCAGCTATTGCCAGCGCCAAAGATATAAGGGATTTAAGCTAAGAAAACGCATTAATTAAGATGCAAAACGATAAAATCCTGAGATCAGTAATTCAAACCTTACAGAAGATGAAATTCTATGGTTTGTGCGCAGCCTTAATGAAGGCAGGAAATATGTAGTCTTATCATATCATAAGTAAACAATTCCCATACATTAGTGAGGGTTATTGACGAGCTTGGTGTTGGAGCGTAGAACAAACTTTTTCCCGATGATGGAATGGAAAGCATATTATTCCCTATTGAGGATATTTACTGGACTGAATTAGTTGCCAGCTATATGATCCATATAATATTGAGATAAAGCCAAGGCCAATATCTAAGTAACTCTAGATAAGAGGAATTCTTACGATTTTCCTGTAATTTCTTAGCGTCCACTGCATCGTCTTCTTAATCGTTCGCCAGGCTTCTGTACGCCCATGTGCTGATTCTTGCGCTCAATACGTTGCATTGCCTTTCAATCTGTTTGTATTCAGCCCACTAACTTAAGGTCTATCGATTTAGTGCGCTTCTACTCGTGATTTTCGGTTTGCGATTCAGCGAGAGAATAGGGCGGTCAACTGCCGGTTTTGCGCTTACCCCAACCAACAGGGGGATTTGCTGCTTTCCATTGAGCCTGTTCTCTGCTCCCTAGAGAACGGGTCAAGAACGCGGCGTGTTTGTGCGAATCCCTACCATCTCCATTCCCTGTCAGTCGCAGTTAATGGTGTGTGGCAGTTGTAGTCCTTGAACGGACGCCGCGTACTGAAAGATTGGCAGCTAATCGAACGGAATTCACATTACGGCCAATGCTTCGTGGTTTCGTATCACACACCCCAAAGCCTGCCTTCTGCTTTGAATGCTGCCCTTCTTCAGGGCTGTAATTTTAAGAGCGTCACTTCATGGTGGTCAGAGTCGCGTCCTGCTGCTGATGTGCTCAGTATCACCGCCAGGGTATTTATGTCAACACCGCCAGAGATAATTTATCACCGCAGATGGTTATCTGTGTATGTTTATATGAAGCACGTGGTTTTTGCAGCCGGCGGCATTGTTTGGTAGGTGAGATCTGAATTGCTATGTTTAGTGAGTTGTATCTATTTATTTTCGCATAAACCACTCCGGGTCCAGTCCTTGGTGTGTTTTGGGGCGATCGTGAGGCGAGGCAATACAGAATAAACCCTATGAGGCTTCGTTATTGTTCTGGTGGTCAAATTAGCTAGTTGGACGGAAAACAAGGATGGCATATGAATGAACGATGCAGAGGCAGCAAGAACGTGGCCGATGGCGATAGTGGGTATCATGTAGCCGCTTATGCCCGTTCATGGAAAGAAGCAATAACCCGCAGAGCAAAAGACGCTCCAAGCTCAACAAACGCGCAGGGCATAGACAATAACTACGATGTCATATACCCATACTCTAATCTTGGCCAGTCGGCGCGTTCTGCTTCCGATTAGAAACGTCAATGAAGCAATCAGGATTGCAATCATGGCTTCCTGCATATGATGGTAGACAATGTCGCCCCAAGACCATCTCTGGGGCTGAAAGAAACACCCAGGAATGTAGTGGCGGAAAAGGAGAGCAAATGCTTACGATAACGTAAGGAATTCTATTACCTTATCAACACCAGGCAATGATTTCTTTGTTCCGCATAATTACCTCCGTGATAATCTAATCCTGACTTTGCCCACCTGCCTTTTACGGAACATTCCAGTATATCACTTTTCACCTTCTTGCGTAGCAGCAATATGCCAAAACCTCTTCAGCTATCTCATCAGCATTAGTACTTGTTCGAGGCGCTGAGAGATGGCCTTTCGTAATAGATAATGTTCTGTTACAGAAATATCTCCATCGCCTCATCTCTTTTGCCCGCAGGCTAATGTCTGAAAATCGAGGTGACGGGTTAAAATAATATCCTTGGCACAGCAGCCTTTTTACTCTCTTACGATGTTTAATTTTGGCTTAATGACTATATCCAGCAATGAGTCAAAAGCTCCCCTTCAATATCTGTTGGGGCAGACTTTAATATATCGCCAAATACAGGTAGCTTGGCTTCTACCTTCACCGTTGTTCTATCGATGAAATGCATATGCATAACATCGTCTTTGGTGGTTCCCTCATCAGTGGCTCTATCTGGACGCGCTCTCCACTGCTTAATGACATTCCTTTCCCGATTAAAAATCTGTCAGATCGGATGTAGTCGGCACGG
>53
GAGTGCTGTTATACCGAGTAACGTCAGCCTGCGAAGCAGTGCTGAAACAGTTGATTGGATTATTCTTTAGTCACCCTCCTGAGAGACACGTCGGTATTACGTGCATGCGATTAGACATCACGCATGACGTACGCATCATGCTGTTTAACAAGTTCATCAGCCAGTCCGGCATCAATGGCCTCCTGACCGCTGTACCTGCAGCCTCGTATCCAGCACACCTGCACGGACATAGGCTTATATGCCGACATTGCGCAAACATCTGGCGGGTTGCTAGGCCTTGAGACTGCAGTGTTATGCAGGGGCCTACGTCATCCGGAGATGGCTTAGCATTGCCCGTAGCTGCTGGCTGCCTGTGCATGCCTCGTGATTTCCACACCCTGTTTCTCCAGCGCAGCACCCGTAATTACTGTAGCCATCATGACGCCGATGGAGCTGTTAGTCCGGGCGGTCCGTGACCAGACGCCGGGAGGCGGCACTGGCAGCAACGTACTGCACTTGCAGTTCATGTCGTTGGCAAGCGCCCATACCGGTTTTATGTCACCGCAAGGGAGCGAGCCGTATTAAGAGATGAATGCCCCAGGAGCCCGCCGGGCGTGTCCATATCGAGCAGAATGCCCGTCCACCATCGGATCTCGCTGGCAGCTTTAGCAGACGGTGCGATAATGCCGTTTGTAACCGGTCATCCGAGTACGGCTGCAGCGCCCGTCCGGCTCTAATGGGTAAGCGTGCCGGACAGGCAGCACGATGCCCGTTCATGATACTGATAACTGCGGGCCTGTCTCGTGGTCCGTCATCATCACGGGATAATGCCAGCGTCGCGGGTCCTCCTGGGCAGTCAGGCTGTCGCCGGACACCGCATCCGTCAGGCTGCTGATCCCAAGCTGGGTGCAATCGACAAAAGAAAACCCGCGCAAGGGCGGGTTCAGGCATCAGGGCCTCATCAAAGCCATGCTGGCACCTCCTGCGGGGAGTGCCGCTCTGCCTTCCTTCCTCTTCTCTACTGTTGATTTAGCAGCCCCGGATTCAAATGCTGCAGCCGCCCAGGCGGGCAGTCCAAGACCGGCTGCACGGCGCTCCATCGTTCACGGACTGCTGGCAAAATTTCCTGATAGTCGTCACCGCGTTTGCGCACTCTTTCTCGTAGGTACTCAGTCCGGCTTCTATCAGCATCACGCTTCCTACGTTCTTTCAGACCATCGATGACGACCGGCCAGCCTATCCAGTCGCAGTTCCCGCAGGCACTGCGGGCTTCCTGAAAACTGAAGCCGTTGAAGGTAACGTCACCACGAGCGAACGATGGCCTCTTCCAGCCAGCACAGAAACATCGGCCGCCTGACGGGATGCTACGAATTTTCGCCGCCCCATAAAGTACGCCCACGACTCGTTCGCACTGGCCCGTGCCGTGGAGGTAGCTCATCCTTAATTCCGGGAAGCTGCTCATACGGAGACACCCAGCCCGGCAGCGATAACGCAGCAGTGACTGCTCAAACACGATAGCCGTTATCCGTATCCTGAGCCGTCTGCAGGTTCAGTGAGTCATCGAGCATCACGTAGTCTCTATTTTGCGCTATCGAGCCGGACCGGCGCTGCGGCGTAATACAGGCAATTCGAGATCCCGCTACATTCCTCTCGTCCTTTCCCCTGCTCCTGACTGTTCGCCTACAGAATAAATCCATCAGTGACTGCGTATCCAGCTCACGCGCTCACTGGGGGCGGCATAGAGATGCGCAGGGCAAGCTGGCAGGGTTCTGCAGCGTGGAGGCATCTTCATCTGCTCCACCGTCCGTAAAACACATTTGCACCCGCGTCTGCCCGTCCTCCACGGGTTCCTCCAAAACGTACGATGAACGAGGCGCGCCGCCGGGTACTCACGGGGTATCCATGTCCATTTCTGCGGCAGCATCCAGCCAGGATAGCGTCGTTGACGGCCGTAACTATCCCAGCGCCGCACCTAATGTCATTAATCTGCACACCGGCACGGCAGTTCCGCTGTCGCCGGTATTGTTCGGCCTTGCTCTGCCTTCGGGCTGACCATCCGGAACTTGTCGGAAAGCGCACGAAGGCGAGTATCCCGATGGCCTGAACGAACAGTTCACCGTTAAAGGCGTGCAGGGCCACCCTTTCGCCCGAAATCATCATGGTAACGTGCGTTTTGCTCACGTCAATGCAGCAGCAGTCATCCTCGGCGACTCTTTCCTGCCTTCATCGCGGGGATAGGCACGGGCTTCTTCCTCCCCGATGCCCAGACGCGCCAGCTTGAGGCGATGACTGAGCCGCATAAAGACCCGACGATATGATGCTCTGCAGCTGGATGAGGCGTTGGCATTGGAGCGTTATTGCGTACCAGATCGTCCCGGGCATTCACGGGTAAAGTTGGGCAACAGGGCTGCATCCACATTTCACTCGTGGGTTCCACGACCGCAACTGCCTCCAATCCGCTGCCGCCTCTAGGATAACCGGCATATTCGCGCAGCGATGTCATGCCGTCCGGCCGAAGGGGGTGAATGGTGAGTTTTCATACATAAATCCGGCAGGTCCCTGCGTGCTGTGTCATGCCGGTCCGGCATTCCAGCTCTGGCAATATTTTGAGGTCAGACACGGAATGGTGGGCCGTAAACCCACCCTTCGTCCGTCTTTCTGTACTGTTGCCACCCCGTTTACCTGTCAGCAAGGTCATGGCAGTGCCGCACGGGCAGGAGCGGCAAGTTCTTCCTGTCGCGTCATGCTCATCCTCTGGATAAGGCATGAATGTAATCGTGGCCAGTGTTTCTTGTTGGTTGCCTGCACCATCCTCTTCCTGCAGGACGCCAGCAGCACTGGCGATCCAGCTGCCAGGGGAACTATGCTGATGCCGCGCCCCAGCGCATAGACGAAGCAGTTGAGTGCCTCATTGCGTCGCTTTTGCTGTCCACAGTATTTTCCTGCCATCCACCATTTTCGACTCTGCTCTTCAGCAAGTCATGCTGCCTTCGCTTCAGATTAAAAATATCCGGGTTATTCGGGAATGAACGCACCGGAAGCGTCATCCATCTTCCGGCGTCAGTGTGAAGCGGTTATAAATCTTATTTCTGGGGTATCCGTACCGATTTCGGTAATAAACCCGTTTTATTTTCGTACGATTAATTAGTAAGGGGCTTTCAGTAGACGACCCTTTAATGGGATGACAGGACAGCCCATGTTTTTCTAAGGGTTGGATAACAATGGTCCTGTAATCCGACAGTATCTCGGAGCAATACGGGTAAGTGACATTTCTGCAACGCACCATTCCGGCGGTATAGTTTATCCTTATCTCATGCACGCAGCAGCGTCTGTTCGGCCGTCGTGGAGCCCCACTCTGGCTGGCGTGAGATGCGAGTCTTCCGCCGCAGGCCCCATCCCCATACCGCATTTCGATGGTCCAGCTGGGAGTCGATACCGGCTGTTAAGGTGAGCGCGCCACGTCAGGACGGGCTGAATAATGCTGTTCCGCTCTGCCATCACTTCAGCATCCGGACGTTCCAATTTTCGCCTCCCACGTCTCACGAACCCGTGGTGTTTACGAAGGTTTTACGTTTCCCGTATCCCCTTTCGTTTCATCCAGTCTTTGACAATGCACCCAGGTGGTGACGGGCTGTACGCTGTCCAGATGTGAAGGTCACTATGTCAGGTGGCTCAATCTCTTCACCGATGACGAAAACCAGAGAATGCCATCACGGGTCTAGATCCCGGTCTTTTCGACAGATAACGGGCATCAGTAAAGTCCAGCTGCTGGATGACGCAGGCATTATGCTCGCAGAGATAAAACACGGCCAGGGGTTATCAGTGAGTTCCGAGGAGATTTGAGGCCAAACGGCGTCTCTTTGTCGCCAAATTTAAGATATACTGCTCCCTCCCGCAATGCGGGCAGGCAACATGAACGCATACAAATGCGGGATGCCTCGCACCGGGCGGCCTCACCGATGCGCCCCATTTTTGGCGTGGAGCCACGATGATTTGACCACGGCCAGACCGAGCCTTCGACATCGCTTGTCACCCAGGAACGTCGAGAGCCTTCCTGTTCTAATATCATCATCAAAGCAGCAAGTTCATCATAACCCGCGCCACATCCACGACTTTTCACGTAGTTTTTGCTCGTTACCCCAGGCATAAGAGTGAAGCCGACGGTTAAGTAGTGAAACGCTTCATGGTGAGCTCGTGTTATCCGGTGCTTTTGCCATACCACGGGGCCATGCGCCGACATAAGGGACGAATACCGAATAGTCGGCTCAACGTGGGTTTTCATAAAGTTCTGGCATCACCATCCCTGTCGGCAACCAGATAAGGGTGTGCCTGCTTATGCTCTATAAAGTAGGCAATAAACACCCCAGCAGCATTTTGGAATAACCGACACGGTAATTAGCTCAAGATTCACCTCACGGATGTAGTGCTGCCCATCGCATGCCTGATGGCCCTGAAGGGGCAGTGTTTCCCAGCCCTTCCTGGTATGCGTGCTTCCTCGGGGTAGGCTATTAGCATCCAGGATGCGACGGGGCGATCTGGAGCAGCGGAGGCAACAGGAGCGAAGCCGGACAAATGCCGCAGCCTGTCCATGACTGTTCCGATATTCATAGCCTCAGCAACCCCGGTATCAGTTCATCCAGCGCGGCTGCTGTTGTTCATGGCTTTGATGATATCCCGAGTTCAGGAAATGATAACATGTCCGTTTTCCAGTTCCGGAAAACGCTTGCACCGACAGGGAGCCCGTCGAATACTGGCATTTCACTGCGTACGCGACAGCACGAAAGTACAGAATGCGGTTTCCACCACCTTCATGGAGTCTCTGGCATTCTTCGCTAGTTCCTGTGCGTGCTTGCGGCGCACGCGTAAGGTCTAATGGCGTTCCGGGTTGGACAATAGTTTCCTGGCTGGAGATGCCTCGCTGCTGCCCGCAGTTCTTCACTCTCCCGGCGCAGCTTTTCGTTCTTAATTTCAGCATCCTTTCGGCATACCGTTGACGGCAGCAGAGTCATAAAGCAGGCCATTACCCTTGCCACCGCCTCGCAGAACGGGCATTCCTGTTTCCTTGCCGATTCTGAATGGTATACGCACCGCAGGAAAGTAGGGAGCCATACAGTGCTTTGTTGACTTCCATGTTCATTCCACGACAAAACAGAAGGAAACGACAGAGGTAAAAGCTCGCTTTCAGCATAGTCGTTCCGTGATTCGTCCCAGAGGGTATTTTAACAAACATTAAGTTATGACGGAAAGAAGAACGGAAATCGCCTTAAACCGGAAAATTTTTACACCTATAGCAAACAGGAGGTCGCCACCGTTTA
>54
ACATTTTTCCGATAGACCGGTATACGGTAATTTGGCACGCTACACTTACCATGATACAATGTGAAAGAGCCTTCCATGTAAACGCTGACAGGTCATTTGACAGCACGATAGTCGTTTAAGACAATGAAGAGCGTAGTGATGCTAGGTAAACCACGTTAGGTCGGGCCGGTCGATTTACGTCAGGTCCTTACCTTAGACGTCCCGCTTGACTTTACGTGATGCGAGATCGTTCAAGGCTTTACTCTGAGGTATCAGGTCTTATCATCACGCCACGACATGAATGGCCTGAAGGTATAGGTGAAAGGTATCGGCCTGTTAATCAGATGAGTGCGCGGTGCATGTCATCACGAGTGACTGTCGTCCTAAGATCTAGCGTCCGTTCCTGCGTCATGTACTGTCAGCCGGCGTCAGTATTTAGAACCAAGATTTAAATTATAATTAGATTTGGTAATCCGTAATTTTACTACCGTCACCATTTGTACATAAGTTAGCATTTCATAAGACATAAGTCAGATCTATGAACTCCACAAGCCCATCATGTCGCCCGGTATGCCTATCATACTTATAAATTGACATATTAGATATTATAACTGATAAATCCATCGATCACTAAGCCTATGAATCCTACTGAGCAGGCAGACACGTATGCAGCTCGCCTGCCATCGTGCTCTTCGGTGTATTCAGCGCCGTCAGACTAACGCAACCCAAAGTGGATAAATAGAGCTCAGCATCATAGACGTCGCACGGTTAGTCGTGCCGTGAGTACCATCGAGAGCTCTTTCAGCATGTCACTTACTATTTGTTAGTACGTGTCTGAAGGCCATCCAAGTTAGCACGCCCTATCAGCTACTTCCACCCTGCATATCACCGGCCAGTCGTTGAATAACCCAGGGAGAATACGGTTACCACCAAGCACGGTTCAGGGTACTGCTGTTACGACGGCTAAAGACAATCTAATATCCAGGCTTACTAAGTGTAATGCTTAAGTAATTTTGACCGTGGCTCGTCATAACCGTCCTTTGGGGTCCTATTATTTGACGGCATGTACTCAGACTGCGATACCCTAGATGAAGCAACCATTTACATTTAGGCATAAGGCCGTTGTCGATGAGCTGATTTTTAATATGGCCACTGTCTCACCCCTTACGTTACGGCATAGATCCAAGCAGTGACATTCCAGCCGCTCTGTTAAAAATAGCGATGGATCTCCCCATGTTTAGCCATCTTCCACTTTAAGCGCCCAGTAAAAAGACGTCCAGCTCACCGACGGGCTTAAGTCCTATAGTTCATATAATTTCCACTTATAGACGAGAGCCATGTACCGTATCGTTCTCACCCCTGCGTAAGGATATCGAACAGTTGAATCAGCCACAGCGCTCCAGTTATTGCATTCTAGCCTATAGTCATTTCTAGCGGCAGGGATACGAACCGAGCAGCACAATGCCAAGTTACTCATCCGTGAAGTGCATCAGTATGCATATGCAGCATTGCCACGACGGTACGTTCAGACGTATCAGAATCACGTAGTATCTGAGCTGATCCCAGCGTTGCCGTGCTGTCTAAGTCCCTATGAGGTGTCCAACTTAGTAAGTTCATCCGTCATCTAGCTCTTTCAAGCCCTTTCAGTTCTTTGGTCTCGTCCATGACATCACGTTCAGTCCAGAGCGGACGGCAATCAGTTCTGTTACTTAACTCCACAGAAACAAGCCCACCATGATTCCACGAATTAACCATACAGGTCAGCCAGCAGCATCAGGTCTACTTCCACGTGATATAGCTAGTACATGGTCCAGTTTGGACCGCTGAAGCCGTTATGTAAGACCGGTGCGTTCTAAGGTTAGCTTAAGGACATCCTACCGACGGTCGGGATCGAGATTTAGAGTGACAGTACGATAGCCATCATCCCTTAGACATGTTAGGGTCTTTCAATGTCTCCACCGATCGACGGGTATGCTATTCTCTGACTGAGTTGAAGGAACGGTGAAAGAGCTGTCGATCCAACACGGTATTCACAAGCTAGTTCGCCGTAGGCTTCGATACCGTAGTCGTATACGTAATGTCACGGTGCTCATCCGTGCCGACTCGTGATTATTCTACTTAGGCCATCCTCATGAAGGTCTCAAGGTATGGTATTTAGTAAGCACGCCCAACTGCCTGCATCTGTCACCTTAAGTATTAGTCACGCATGTTGCATCATTAAGGCGAACGTAGATGCCGGTTGCCATTCTTAAGGCAGGCATTCCAATATCCGTCAACGGTATATCGATCACACGGAACTAGATAAGGCCAATAGAAACAATCCAAACTGTAAGCTAAGTTGCCGTAGAATTTGTAGAGCGACGTTACCTTGCATAGAAAACCACGCAGAATAGCAAACTAAGTCGATATGCTGCCGAGAGTGAATAAAACCCTAAAGCTCATTAGTGATGAAGGTAAAGTTAAACTATTAATTGGTCCTAAACGCGTCCGTTTTCTTCTCGTCCTTAAGCGCCTGAGACTCTATAACGAACTTCATAGTACTTTATAAATTATGTCTGTCAGCATCGCAGAATCAACGAGCACCTTTATTAGTCAGGGATGGATCATAGCAGGTGTCCAGCAGCAGCGTATGCAGGCGTGCACTCAATCGCCGGGCCGTCGTATGAGCTTATTGAGCTGGGTAATTTTATACTTCTATAGTAAAATGTGTTTCCGGCTTCCCATAGGTAGGATCATTAGCCCGATCCTGCTCATGATACGACGGATCGGGCGCCGTGGCACTTATGTGAGACAGGCGGCTTAGTTGCATTATAAGCGTGTTCTGCCAGCACGTGCCTGTTCTTCAGCGTCCTTGCTCCACATTAGTCTAGACTGATACTGTCCGCGGCAGTCAAATGCTAGTTCCCGTCAAGCTGCGCTCCGTTTCTCCCGTCCTACATACCAGCGTGAACGGTCGAGAAGTTAGATAGAGCGTTGGGCCACGTTGATTAATCCATCACGCATGACGTACGGACGGTGTTAAAGTTGAGCCGTTAGCATCAAGCTCTGACGTACTTAAGGGCTGCTACAATATGACTAACAGATATGCCGACCTTCTGAGGACATCTAGTCGTCCATCCGGGACTTGGCCCTTCCGATCACTTAGTTAAATAGCTATGACCGGTGCCCTTATGGTAAATCATTCCACGCTGTTTACAAGAAGCCGTAGTGTGACTAATAACCATCTACGTGCATGCGTTGATCAAGGGAGGCAGGCAACCGGGTATGGCTTTATTTACATAAAGCGTTGATCCCCCAGCAGAATGGTGTCAAGGTCGACTGCTAAGGCTCACGCTGTTAATCACGCTTACGGTCTCATCATGTAGACCATGTCTGTGAGACATGAAGTGATCAGTCTCAGTACCCAATGGGGCTAGCGGTCAGTAAGGGTTAAGCCCGTAGGCGATGCGGTCATATAGTCGAGATCATCGATAGCCGTAAGCCAATAGTCATGGCAATTAAATAACTGAGGCGGCCACTAGGGTTCAATAAGCTCTTCCATAAAGCTGGCGATATGCGGGAGATTACGCATATTATTCTCTTCTCTGTTGATCTCATCTAAGTAAATGCATCATAGAGACCGTGCACTACTGCTGAGCATCGATCGTTCTAAAACCTCCAGGTCAATGTGTTAGCATTCCACGACCTTTCTGTTACTTAAGCCTTAATTTGTTCCTAACGAACCCTATAGGACTATACGTACCGGTGAACTAAGGGCCTGCGTTCAGGCATACAGCTGTCGACGTCACGACCAACGCTTGGTAATTGGCACCACCACGGCCTGACGGCCCGGCCCAGTCAGCCCAACCCCTATCGTCAATAGATTGCTTAAGCTGGATATTCAAGGAAGGTCAACCAGCCCATAGAGCGGCCCCAGCAGATGGTATAGGCCCATAGTCGAGATAGCTGCGATGACTGAGTAATCCAATTTCACCAATCAGCCGTCTACCTTTGCCCTGCTCTGACGTTGGCCAGAATAATCCATCGACCCTATCCAGCCTCAATGTAAGCCTACAATCTAAGCCTCTGCACTACTGCCTGTTCCAGCTTCAAACTTTAAAATACCGACCTGTAGCCCTCGCATTTAAAAGTGAACCACGTTAGCTTACTATAATCACGTCATGGAGGCCCTCCGGGCATGTCCATTCCATGATCTTAAGGCACGATACCCGTCGCCGTATGTATTCCACATGTGCTCGGTAGTAAGTTGCTTAAAGTCTTTAAATTATTAGGAACCAACTATCCATGTTAGAGGACGAAATATCGACTATAAAGTGAGCCGTCACGTCCCTGAATCATCATAGCTTCCAGTAAACGTGCTGTCTAACGTCAAGCAGCAGCAGTATCCTCTAAACTCTTTCCATTCATTCAACGGGAAAGCACGGCTTGCTCCCCTTACATCAGCCAGGTGGGCGAGATTTGAGGCACCCACGTTGATCCGATCGTTAGCAGGCTTTAATAGAGCGTACCAGCCCTAGGACTCACGTCAATATTAATTTAAGCCAATATAGCACTGTCAGCACGTACCCACTTCAAACGATGCTGCTTCCGTCCAATGGCATTGGCATAGTTGAGCGCCTATCCAATCGTGAATGTCCTAGTCGTACATACTGCCTCTTGTCATGCCCATGCTTAATAGGTCACGATTTTCTCTTCCCGTTGGGTTCAGGCATTGAGCAATCTAAGCTAAGTTCTTCCTGTCGCTTGCTGCTCTATAAGCACGGTATTATGGTCGCGTTGTTCTCACATCTCTTCTGCAGCTGGCCCTACTGAGATGGCTATCATAGAAGTGATGCGCGCCGCCGGCATAAACGAAGTCATATTAGCTGTCATTGCTGTTAGTGTCCAATATTTCCTTACATCCACCATTTTCGACCTTATGCTAAGTCATGCTGCTTCGTCAGATCAAATCCGTATTCGAAGTACTGAGCGAGATTTAGATGATCGTTGCTTAAAGTAATGGCCGTTCTTAGTCATCCACCATTTAGTAAGTAATCAGGATGGCCGACCTAATGTTCCCGTCGATAAGCTTTGGTACGTAAGTGAGCAGGTACGATGACAGCCCGTCTGCCGTCAGACAATAGTTCTATAAGCCCAGCCACGTTAGACATTTGGCATCATGCCTTTATGAGCTATTTAGCATCACGCATTCCCCAGCCGGATTCATCCGGTCTATGGAGTCAAGGCGTCATACTACACGTCAGAACGGTAGAATACGTAGGGTCGATATTAAGCAGTACCATGGTCAATTTTTAATACTAAGTCCACAGACCGTCTGTTACATGTTGAGTTCTCATTACAGTTAATAGTCGACCCAGACTGAGTACTATGTCAGATACGTATAGTCAATGGTCACGATACGAAAACAGAGATGCTCACGTATCAGATCCCGGTTTACCAAAGCCCATACAGCTGCTTAAGCTGACTCAGTACAGGCATACGAGATACTTTAGTTGATACTTATGGTAAAAGCGTCCCAACCAATATAAGCTGCGGATTCCTGCGCCTCCTTCCCTATCACGTTTACGTAAGGCTCTGTTGGCCACCCAGCTTCATCGTACCCAGTACTAGAGCTGCGTCAATAAGTAAAGCATAAGTCATACTCACATCCACCGACTTTCACTGTTATAGTCGCCGCTAAGCCATTGAAGCCACGTTATAACGTGCTTAGCCGGTGTTGCTATCACTACGCTAGCGCCGACGACAGTAGAAGGTCGGACGTCGTCATAAAGTTCTCTAAGTACCATCCTTTAAGATAATAGTCCCGTATGCTATAAAGTAAGACCCCAGCAGGCATTTTAGAATAACCACGGCAGACTTCACATGCCTCACCATTATGCTGCCCATCGCAATCATTATCATGAAAGCGATGTTTCCCGCCTCTGGTGCTTCTTTGGAGAGATATTAGCATCCGCCTTCAACGGCGTTGGTAGCGTATGAACAGTGAGCGAAGCCGGCTAAAGTCGACATGTAAGTACTGTTCGAGATATGGTTGTTCAACCTTTATCATCAGTTCGGGGAGCCTTCCTTTCCCTTCCAGCGTAAAAGCCGCATACCGTTCAGAATACTGGCAGGTTCGTACCGACACCCAATACAATTAGTTCCACCACTTCGCCGTATGACGGCATTCTTGAGTTCTATGCTTGAGCACGTAAGTCTAGTTCTATTAATAGTTCCTGGGCTGTAAGCTGGCCGGTTGCTCGCAGCCCACTTTCGTCAATTTCAGCATCCCTTTGGCATACAGTTATGACGGGATATAAGGCCTATCCTTGCCACCGCTCGGCGATTAATTCCCGTTCTGAGTGTAATGTACGACTCGCACCAAAGTGTCACAGCTGCTTTTGGTACGGTTCATTCACGACAAAACAGAATAGAAAGACATAGTAAAGCTTATGCAGTCTGTCCAGTATTTTAACAACATTAAGTTGGAAGAAGACAGACGAAACCTTATAAATAGAAAATTTATAAATAGAAGACCGATGGCTAGTTCTTGTATTTT
>55
TGTGCGGCGTCTGCTTGGGTGTTAACCTCTCATTGCATGCAATCATTGGGTACTGTGGGTTTAGTGGTTGTAATAAAACGTTTTGAACCGCTATCCTGATCATTTCTTGAAGGTAAACTCATCACCCCCAAGTCTGGCTATGCAGAAGGTCCTGGGCTCAACAGCCTGCTCAGGGTCAACTACAGAGTTAACATTCCGTCAGGAAAGCTTGGCTTGGAGCCTGTTGGTGCGATGATGGAATTACCTTCAACCTCAAGCCCAGAATGCAGAAGCGACGCGTTGTCTGTAGTGCTTATCATCTCTCCGCAGCCGAAGAGCGTGGTCGTAAAGGTTCTAAGCTTAGGTGAGACATCCTGCTGAACATGAGAAAAACAGCGTATTAATACTCACCTGTTCTAAGTGACGGCTGCATACTAACCGCTTCATACATCTCGTAGATTTCTCTGGCGATTGAAGGGCTAAATTCTTCAACACTGATTTGAGAATTTGTAGATGCGATAATTCCTCGGCGGCTTTATCAGTGCATTCATGCCGATCATTAAATAAAGCACCAACGCCTGAATGCCCCATCCCCATCTTGTCTGCGACAATTCCTGGGATAAGCCAAGTCGGGTTTTTCCTTCATAAATTGCTTGTTAAGGCGACGTGCGTCCTCAAGCTGCTCTTGTTAATGGTTTCTTTTGTGCTCATACGTTAAATCTATCACCGCAAGGGATAAAGGTATCTAACACCGTGCGTGTTGACTATTTACCTCATGGCGGTGATAATGCTTGCATGTACTAAGGAGGTTGTTATGGAACAACGCAGACCCTGAAAGATTATGCAATGCGCTTTGGCGTAAAACCAAGACAGCTAAAGATCTATAGTATCACGCGAGACGAAACACTATCCAAGAAGCCACGCAGAAGTGAATGAACCGCACGTTTTAACTATAAACGCTGATGGAGCCCCGTTACGACTTGGAGGAGGGAAGATAGCCCTTCTCCGAGTAACAAAAACAGCATAAATAACCCGCTCTTACTCCCCCTTAAACGCTGAGGCATCAAATTAAACCACACTATGGTGTATGCATTTATTTGCATACATTCAATCAATTGTTATCTAAGGAAATACTTACATATCTTTCTTCACAATACTCAAACGCGCTCCGGCCGGACCGCGTGAGATGCGACCGTTGAATCAACAAAATCGCAATGCTTGGAACTGAGAAGAGCGGAAGCTGTGGGCGTTGATAAGTCGGCAGATCAGCAGGTGGAAGAGGGACTGGATTCTAAAGTTCTCAAATGCTGCTTGCTGTTCTTGAATGGGGCGTGACGTTGACGACATGGCTCGATTGGCGCGACAAGTCCGTCTAGCGATCCTACAGACAAGACACGCCCGGCGGCAACCGTTCGTCCTGAACAAATCCAGATGGAGTTCCGGGTCATTACTGGATCTATCAACAGGAGTCATTACTGACAAATACAGCAAATACTCAAACTTGTCGGCAGGAGAACCTATCCCAGGAAGAGGAGCGACCGGCAGATCTCGATGATGGTCACGCCAATAGCTATCAAATATGCTGCTTGAGGCTTATTCGGGCGCAGATCTGACCAAGCGACAGTTCAAATGCTGCTTGACGGTTCTGCGTAAACCTATGGGTGGAATAAACCAATGACAGAATCACCGATTCTCAACTGCTGAGATCAAAGTTATGTCAACCGGTGCAATGAAGCCAAGTTAGAACTCGTCAGAATGAAGAGCCGATTAAGCAAGGCGGCATGTTTGGACCCAAATAAAACATCTCAGAGTGAATGCATCCCTCAAACGAGGAAATTCCCCAAACTAGGGGTAGATGGATACACTCCGCCAAATCGGGGATTGCTATCCCTCAAAACAGGGGACAAAGACTATTACAAAGAAAGAAAGATTATTCGTCCGAATTCTGGCGAATCCTGGACTGAGAGACCACCTTTCTGTGGTGAATGAGATGCTGCAATTCAGAGCGGCAGCAAGTGGGGACAGCGACTAACCGAAGAATCCACCTGAAAACCAAGCATCGCCGCATATCGAATTTAGTAGAGTGACATGGTCCGTGAAGACTGTATAATATACCGCCAAGAGCTTGTGCTGTCCAACTGAAGTCCAGGACTTCTTAGTAACGTTAAGCTCGCGGCCTGGCCGCGATAGTGACGGCTCGAAATTAAACGATTACCGGGGACAGGCGGGGCCTTGAGCCGGCATCCAGATATACGACCTGACACTCTCGCGGCCTTTACAACGGGTCTATGAAAAGCCCTAAGATGGTTATCAATTCTTAGGTCGCCATAATGCGTTAATCACAACGGGTCCCTGAAATGCCCAAAGGCACAACAAGCGCAAATCACTTGTTCACCGTGTGAATGAAACATTTCTAAGAGCAAATAACTCGACTCGTGACAAACACAGATGAACGAAAGTGGGATTTAACACAATCGTCTACAATTTCGGGGAAAACAGAAGCCGCCGCATGAAGCGATATAAGGAAACAGTACGCGTCGGCGGAGCATACATTTCTGCCATCGGACAAAGATGCCGGAAAGTTTGATTGCATGAATCACGCATAAGAAGGATACAGTCTACCTAGGACTTAAGATCATTCAACGCGAGCTGGTTACTCTCGTTGAGTGCCGGAGCAGGCTAATTATCCATTGCCAGTCTTATCGTGACGCAGTTAATAGCGCCTCTGGCTGGAAGCTTAGGACTATGCGGTAAAATGCATTAACGTACAGGATTACTAATCAGGCAAATTATCAATGTCCATATAAATGAATTAACCAGTCTGCGGGGTCTAACGACCCGTAATAGTTCATGTCAACCGGTAAATCGTGCGCCGGCTGGCAGATCGCAGAAATTCGAGCTAGTTCGACCAAGCAGCGGTACCCTGAAAGGGGGAAAGATGCTTACTAACGCTACGAACCTGGGTCTGTGCATGCCACCATATCCTTTGCCGCCTAACAGGCGGCCGCCGGGAGAACCGAGGGGAGAGCGAGCGGGCGGGTCTGTCGGTTATCGAAGAACAGCTGCAACGGTTGTATTACCGTTAAGCAGGAGAATAAGAAGGAGATGAGCGCCATGGTTTAGGAATGTCGCGTGAATGAATGATTGGCGGTGAATTATTTGGATGGGGTAGCTAGAATAGGACCGTAGTAATCACAAGCATTTGATTTGGGGAAGGAAGTCATGAAAAACTAACCTTTGAAATTCGATCTCCAGCACATCAGCAAAAACTACGATTCACGCAGTACAGCAAATCCTTCCAGAACCAACCAAACCAATCGTATGACCATTCACGAAACGCAACCGCAGCTTGAGACCAAACGGAGTAAACTTCCTCATGTGTGTAGACCTTCCTGGCGGTCAGGTTGAATGGCATGGTCGCTCGCTGGCTCATGCAAGAAGCTGGAAGTGTTTACCGCAGCATTAAAGCAGCAGGGTTGTTTCCTAACCTTGCCGGCTGAATGGCTTTGTGGTAATAGGCCAGCAAGGCAGGAACGATGGGGGAATTGGGAGGAGAGCGAGGCTACAGGCATTCCTCGGTACAGAGCGTGGCGTTAATGGTCAAGCGAAGCGAGACTGGCTCTGGAGTGGAGCGAGATGGGGAGACAGGGCTGCATGATAAATGTCGTTAGTTTCTCGGTGCGCACTTTCACGACTGTGCTCTCGCTTGAGGCGACGGGCAAATCCTCGGTTCCCATTACGTTCATGGATGACTAGATTGAACGTGACAGGTACAGCATTACGTTGTCGCCTGGGAAGTTGTGAAGTTCTGGGGATATACGCTCACCGTATTGCAGGTTGATATCAACCGCGGAGCTTGGGGACCCCCACTGTAGTTACGGTATGGGAACCAAAGGATATTCAGACGCGAATGCCTGTTCTGGCACCCATTTATCGATATGGTAAAGAAATATGGCACTCCATACGTCGAGCGCGTTCTGCTGCACTGACAGATTAAACTCGTTCCCTCACCAAATACTGTGATGACCATTTCGGGCGAGGGAATTACTAAGTCGGATTGGCATCAGAGCTGATGAACCCGAAGCGGCTAAGGCTAAGGACTCACGCCTGGAAACCAGATACTCTGGCGCTGAATGTCAGATCCGAGCGAGACTTAACAGCTCCGCATGGTCGAAGGCAACAACCATTCGATTTGCAAATACCGGACATCTCGGTAACTGCATATTCTGCATTAAATCAACGCAAATCGGGGAAGCCGCAAAGGAGCTGGAGGGATTGCAGGGCGTAGAGGGCATTAGAGGTTGCATTGTAACAATCAGCTCCGGGATCACTCTAAAGCCACGGGAGCGTGACTGTACCGAGGAAGAATGTCGGACGGTATCGCGAAAATGTATTCAGAAAATGATTATCAAGCCCTGTATAGACATGGTACCAGCTAAAGATTCGATACCGGCTCTTGTTCTGAGTCATGCGAATATTTGGAGGGCAGCTTGATTTCGACTTCGGGAGGAAGCTGCTGCTTCGCAATGTTATCGGTCCGGTGAATGCAAAGAAGATAACCGCTTCCGACCAAATCAACCTTACTGGAATCGATGGTGTCTCCGTGTGAAGGACACCAACAGGGGGTGTTACCACCGCAGGAAAAGGAGGACGTGTGGCGAGACAGGCGACGAAGTATCACCGACATAATCCTGGCGACTGCAAACCGCCATCAACGAGGAACGCAGAAGAGAATAAATCCCGTAAGCCAATCCCCCAAAGAATCTGACGTAAAATGGACTACACGGCTCTACCTGTGGGATATCCGGTGATAAGCCGACGTCGTGCGAGGAAAACAAGGTGATTACCAAATCGAATTACGAACAAGAAAGCGTCGAGCGAGCTTAACGTGCGCTAACTGCGGTTCGAAGAAGCTGCATGTGCTGGAAGTTCACGTGTGAGCACTGCGCCGCCCAATTCGATCCCGGACCCTCTCGATGCACGAGGAAGAAGATGATGGCTAAACCAGCGCGAAGACGACGATGTAAAACGATGAATGCCGGGAATGGTTTTCACATGCATTCTAATCAGGCTAGTGGTGCTCTCGAGTTGGAACCAAGATAGCACTGAACGACGAAGTAAAGAACGCGAAAGGGAAAAGCAGCAGAGAGAGAAGAAACGGACTACGAGAGGAGCTAAGAATAAACAGAAGATAAACTTAAGATTACTCGAAAACTCGCCTTAAAGCCCCGATCAGTTACTGGATTAAACACAGCCAACAAGCCGTACACGCGCCGAGTCAGGCAGAAGAGAAGCGACTTACCATGTATCTCGTGCCCTGAAGCTCACTACGTCTGCTCAGTGGGATGCCGACATTACCGGAATAACTGCTGCAGCTCAACTCCGATTAATGAGACGCAATATTCACAAGCAATGCGTGTGCAACCAGCACAAAGCGGAAATCCTCGTTCCGCGTATCGCGTCGAACTGATTAGCCGCATCGGGCAGGAAGGCAGCAGTAGACGAAAATCGAATCAAAACCATAACCGCCATCGCCACTCCGAAGAGTGCAAAGGCGATCAAGGCAGAGTATAAACAGAAACTCAAATAACCGAGTAAATAAGAAGTGAGGCCGCATGACGTTCTCAGTAAAAACGCTCGTTGCGCTCAACCACGCAAGCGTAAAGGCATACGCCCGACTGAAATGGGTCGCGGTGACCGTCAGAAAAATACGTTGATGATAAAGACGGGAAAATGCACGCCATCGTCAACGACGTTCCTCATCGTCATCGCGGATGGAGGAGTGAAAGAGATTGGCGCTATTACGAAAATTGATGGCAGCAAATACCGAAATATTTGGTAGTTGGCGTACTGGCACGAACCGAATGGATGAAGGCGCCGACACGCGATACGATTGGATTCGACAACAAAAAGACCTGCTTATCTCGTGGCGATTTGGTTGATCGTGGTGCAGAACGTTGAATGCCTGGAATTAATCACATTCCCTGGTTCAGAGCTGTACGTGGAAGTGCATGAGCAAATGATGATTGATGGCTTATCAGAGCGTGGAAACGTTAATCACTGGCTGCTTAATGGCGGGCTGGTTCTTTAATCGAATTACGACAAAGAAATTCTGGCTAAAGCTCTTGCCCATAAAGCAGATGAACTTCCGTTAATCATCGAACTGGTGAGCAAAGATAAATATGTTATCTGCCCCGATTATCCTTTGACGAATACGAGTTTGGAAAGCGGTTATCCTGCCTCAGCTGTGGGGTTGCGCGAACTCTAATGCGAATCAGCAACTCACAAAACGGGATCGTGAAAGAATCAAAGCTAGGGACACGTTCATCTTTGGTCATACGCCAGCAGTGAAACCACTCAAGTTTGCCAACCAAATGTATATCGATACCGGCGCAGTGTTCTGCGGGGAAGGCACATCGATCGCAGGTACAGGGAGAAGGCAGGCGACTCGAAAGCGTGGTAATAAATTTCATTCGCCAAAAGCTCCCGATGATGAGCGACCACTCACCACGGGCCACGTGCTTCTGACTCTTTCCGGTACTGATGTGATGGCTGCTATGGGGATACGCAATGATCAAGCATGGATTCGGTATGGCTGCATTCTGCGGTAAGCACGAACTCATGGATACGACGACAAAGGCTATATCAACTATCTGATGCATTTGCACAATGGATGGGAAATACCGTGGTGGCAACCGCTTGAAGGAATACTAAGGCAAAGTACTGCAAATTAGCCGCAACATTCGCTTATGCGGATTATTGCCGTAGTGCCGCGACGACGCCGGGGGCAAGATGCAAGATTGCCATGGTACAGGCCGTGCGGTTGATATTGCCAAACAGAGCTGTGGGGGAGAGTTGTCGTAGAAGGGAGTCGGAAGATGCAAAGGCGTCAGCACTCTTCATGCATTCAGGCTTCGCGGGGACGGATCGCCGTGGTTCCGCCCGCGATCCCAAAACCTTACCCAACCCACCTGTTACCCCATGTCCCTCGCTGTATGAAGCTCTGGCGAGGCATCCCAACGAAGAGAGAAGCCGACACAGTTGAATGCGGTCACGTTAGCAGCATGATTGCCACGGATGGCAACATATTAACGGCATGATATTGACTTATTGAATAAATTGGGTAAATTTGACTCAACGATGGGTTAATTCGCTCGTTGTGGGTGAGATGAAAAGAGGGGGCCTTACTACCGATTCCGCCTAGTTGGTCACTTCGACGTATCGTCTGGAACTCCAACCATCGCATGGCAGAGAGGTCTGCAAATGCAATCCCGAAAACAGTTCGCAGGTAATAGTGAGCCTGCATGAATGGATTTCGGGGTTTTTGTAGTGGTACAAACAGGTAATAAGCATTGAGTCGATAATCGTGAAGAGTCGAGCCTGGTTAGCCAGATCTGCTCTTTCCGCGTTGTGTGAATCACCGTGAGTGAATACCGAAGCAGAACCGGATCACAAATCCATCAGGCGTCATCGCCGCCAGGCAACAGCACAACCCAAACTGAGCCGTAGCCACTGTCTTCTCTGGGATTCATGCTGGGACGTGTACGGGCTCCTTCCCTCGGGATGACCTTCGTGAAGCGGGCGAGGCAGGAGCCAGGGGACAAATCTCCGTTTTGCCCGTGCATATCGGTCACGAACAAATCTGATTATAAACACAGCCTGGATTTGTTTAGCGTCAGTAATCACTTATTCCTAATTAAATAGAGCAAATCCCTTTATTGGGGTAAGACATGAAGATGCCGAGAAAAACATGACCTGTTGGCCGCTTCTCGCGGCAAAGGAGCCGGAACAAGGCATTGCTTTAATGCGTTTGCAATGGCGTACCTTCGAGGCAGATATAAACCCGGTGCGTTTACAAAACAGTAATCGACGAACCGCAACGATGTGCGCGCGCCATTATCGCCGCTAGTTCATTCTCCTGTACTTCTCGACTTCACGGACTCTAAGTAGCAATCTCGGCTTATAACGAGCGTGTTTATCGGCTACATCGGTACTGACTCGAATTGGTTCGCTTATCAAACGCTTCGCTGCCGTTGTAAAGCCGGAGTAGAAGATGGTAGAAATCAATAATCAACGTAGGCGTTCCTCGATATGCTGACGTGGTCGGAGGGAACTGATAACGACTACCAACCAGAAATCATGGTTATGGACTATTGTGTCTCGGAGGCGGTGTGCGCTGCTGGGAGCTTCCCTGCAGGAGCAAAATGTCACGCTAAACCCAAAACTCAAATCAACAGGCGCCGACTGAGCCAGCTTCTTTCCGTTGGTGGGATGCCTACCCGCAAGCAGCTTGGCTGAAAAGACTTCTCTCCGAAAGTCAGACGCTGTGGCATGCAGCAAGATTAAGCCCGCGTGGCGCTTTACCTATGATTGATCTGTGGTGATATCCGTCAGGCAATCGACCGTTGCAGCATATCTGGGGCTTCACTGCCGTCCCCTGTCTGGTCAGTTCAGCATAAGGCTGACAGCCTGATTGCAAATTCAAGAAGCGTGAGAACGGTCAGAGATTACGTATGAGCAGTCACCGCGATTAGTATCTCCGCTCTGGTTATCTGCATCCTCATCGTCTGCTTATTCATGGGCTGTTAATCATTACCGTGATAACGCCATGCCTACAACGGAGCGCGACAAAATGCTCTCAGAGAAAACGAAGCTGAGAACGCGGCAATTACTGACACTGCAGATGCGTCAGCGGGCTGTATTATCGCCGGCAGCCCGAAATGGGAAAGGCACGAATTAGTTAGTAGGCTGATGCTAAGCTGAAGGATGCTCTGCGTGATGATGTTAAGCTCTTCTCGTCGTGCTCATTTGCCACTCCACGGGGTCGTGCTGCGTGAATGCAGCCACCACCGCCTCCGTGGATAATGCAGCCTCCCCCGACTGGCAGACGGAGCTTAAACGGGATTATTTCACCCTCAGAGAGAGGCTGATCATCACTGCTAAACAACTGGAAGGAACCCAGAAATATATCCTGAGCAGTGCAGATAGAGTTGCCCATATCGGACTGTAATGCATGAATGCAATTATTGAGCAATACACACGCGCTTCCATGAGTATAAATGCTAAAGTAATAAAACCGAGCAATTCCATTTGAATGTTTGCTGGGTTTCTGTTTGACAACATTTTCTGCGCCGCCACAAATTTGGCTGCATCACGACAGTTTTCTTCTGCCCAATTCCAGAAACGAAAGAAGAAATGATGGTGATGGTTTCCTTGGTGCTACTGCTGCTTTTGTTTGAACAGTAAACGTCTGTTGAGCACATCCAATAAGCAGGGGCGGAGGCCCGAGGCATTTTTCATGGTGTTATTCCCGATGCTTTTTGAAGTTCGCAGAATCGTATGTGTAGAAAATTAATAAACCCTATAAACAATGAGTTGAAATTTCATATTTAATATTTACTGCTGTATTCTCGGTGCGGCAATCGGTCGTGATCCCGGATTAACTATGTCCACAGCCCTGACGGGAATTCTCTGCGGGGAGTGTCCGGCGTAAATAATTGAGGACCGATGCACACACAGGGTTTAGCGCGTACACGGTATTGCATTGATGCCAACGCCCCGGTGCTGACACGCACGGAAGAAGCGTAGCAACGTTATGAGCTTCGTGGAAAGATTTGTGTAGTGTTCTGAATGCTCTCAGTAAATAGTAATGAATTATCAAAGGTATAGTAATATCTTTATGTTCATGGATATTTGTAACCGATCGGAAAACTCCTGCTTTAAGATTTTTCCCTTATTGCTGAAATGTGATTTCTCTTGATTTCAATCTATCATAGGACGTTTCTTATAATGCGTGTTTCTTGAGAATTAACATTTACAACCTTTTTAAGATTGGCGGGTTATAACACGCGGCTGTAGCGTGGCACGAAGGCGACAGTAGTCTGGGCTAGATAACAAATATAATGTGAACGTTGTGACGTTTAGTTCAGAATAAAAACAATTCACAGTCTAAATCCTTCGCACTTGATTGGAATATTTCTTTAAATGGCATCTCTCGGCTCCATGCTGGTACTTCCCCTGTACTGCAGGCACGTAGTTTGCATTATCGTTTTTATCGTTCAATCTGTCTTATTCCTGTGTTTGTTGATGATTTATGTCAATATTAGGAATGTTTTCACTTAATAGTATTGGTTGCGTAACAAAATTGCGTCCTGCTGGCATTCTGGAGGGAAATACAACGCTAAACCGACAGATGGCTTAAGGCCAACGTGCTCAAATCTTCATACAGAAAGAGATTTGAAGTAATATTTTAACCGCTAGATGAAGAGCAAGCGCGCATGAGCGACAAAATGAATAAAGAACAATCTGCTGATTTACTCCTCCGTGATCTGATTCGTGTAAATATGCTTAATAGCACCCATTTCTATGAGTTACCCTGATGTTGTAATTGCATGTAGAACAGCAAGGTGTAGGGGAAGGATGCGAGGAAGTGGAAGCGTTGGTGAAGCACGATAATAATATGAAGGATTATTCCTAGTGGTTGACTGATCACCATAACTGCTAATCATTCAAACTATTTAGTCTGTGACACCAGCCAACACACACGCAAGTCACTGTCAGGAAAGTGGTAACTGCAACTCAGATGCTTCACTCCTGCGACTTCGGGACTTAAGTGGGGTTACATACCGTCCTGTTCTCGAGGGAAGAACGCGGGATGTTCATTCTTCATCACTTTAATTGATGTATATGCTCTCTTTTCTGACGTTAGTCTCCAGCAGGCTTCAATGACCCAGGCTGAGAATTCCCGACTCCCTTTGCTCAGCGATGTTAATTTGTTCAATCATTTGGTTGGAAAAGCGGGTCCGGGTTGTTGTTCTGCGGGTTCTTTGGTTTCTTCGTTGACATGAGGTTGCCCCGTATTCAGTGCTGACCTTTGTATTGTCTGAAGTTGTTTTGAACCGTTAAGTTGATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTGGTTTGATGGCCTCCACGACGCACGTTGTAGTAATATGGAGCGCTAAGCCGGAGCCCATTACGCGGGTCTCGTGTGAAATGCGCTAGATTACGGACAGGCTACACGTTCTTTGATCT
>56
TTCACGATTCTGGTCTCTGTAGTACCTGGCGTCGTATTTACGGCGTCAATTAGACTCGTCGGGCCGTGTATTTCTGTGTAGAGGATTAAGTGACGAAAGATGACAACGTGATTCACTTATGCCCGTCTCCGCTCTAACAACGGACGTAGGTCCGTGATGTCGACGGTAACGAAAGACAGAAGAACTGGCGCTCCGATTATCGAAAGGCGGAGGCTTAGTGACACGGATGAAACTGCCGGTTCAAAGACCTGGCCCTACGGGAAAATGTGCTGACGGACATGGAAAATGAGGTGGGACCTACCGCAGCCGGATACCGTGATTCTGGATATGTAACGGTCACGGTCGTGGCACTGTAGCGAAGCTGCATACTGATGCATTCACCACCGCATTAATCGTATCGAACTTTGTGCTTACGGGAACGGCGTTTCGTCTCTGCCGTGTGGCAGCCGAAATGACAGAGCGCTGGCCAGAATGCAATAACGGGAGGTGGCTGATTTCTTCAGACCTGTTCGATGCTGCCATTGCCCGCGCCGATGAAACGATACGCGGGTACGTAGGAACGTCAGCCACCATTACATCCGTGAGCAGTTACGTAGTGGGCGTATCTTTTACTATACCTGAAAATACCAGCTATGCCGGACAGCGTGCGGGCGTTGCATACCCTCCCGTCCCTGTTGTCCGGACTGGCTTAGTGCGTCAATGCGTCGAAGTGGGCAAGATGGGTGAGGAAATTTCTGGGATCGGGTTCGCTAGATGATGGGGAAGTTGTCATCTCTGAGTTGGACGGGGCGATCGCTGCCGTAACCGTCCGTCGACCGACGCATGTATGGCCAAAAGGTCTTACGATAGTTCCGAAAACCTCAGCCGTATCACTAAAACGCGCTCCCGGTGCTGGGCCGCAATGGCCATTAACCGCGTTGCTTCACTTGCTATCGCAAACGCAAGATCCGTCACAGATTACTGCCGTGAGACAAAGGTACGCCGGAACTGTAAAGGAAGCACGAAAGGTCAGGTTGACGATAAGATCAGGTCAAAACAGGCACGAGTCTCCCGTAATCAAAGTAGACGGGGATTGCCGGGTCCACTTTCGCCGCGGGAGCGCGTGCGGCCTTACGAGCGCAGCGTTCATTACTCGCTGAAAGGTGGCGGCATGTGCTGTGGTGGGTAACCGTCGTATTCCCCGGCGCGTTTATTCAGCAACTGAAAATGGCCGGGCCATTGGTCCTCGTTGCTGAGAAAACCGTTGACCCGAGTCGTGGTGAAAATCCGATGGCGGTGCTGTGACCACGGCGTTTAAACAAAATATTATCTAAGATCTAGTGAACGTCTTCCGAACAGAGCTGGGCTATGCTGCACCATTACAACTGAGGATGGTAATAAATAGCGATGAAACATACGGACGCGTGCAGCCGTACTCCACTTAATTAGAAGAAGCACCTTAACACCGGGGCGACGTTTGACTTATTGCCCTGTTGTATGGCGCGATTTTCCTACAGTCGCGTTTATCTCGCCTCGACCCTGAATACACGGCGAAGAGCGGACTAGCGATATGGCACCTAGGCTCTGCATATCGAAGTTTTCCTGCTGCTCCACTTAGCCGAGTTTGTCGCTACACGTGAGTCGATGCGGTTTGCCCGGATTTATCCGTATGAGCGTATCCCGGCACTGTCAGATTCAGTACCAGTATGGTGGCCAGCGGCTATGGACTAAGGCGCGACAGACGATGATGCGGGCCGTGGAGAGGGTTGTACGGATTATGGTACCTATGAGTGAAATGTGAGGACGCTGCCTGTACCAAATCCTCGCCGACTTCGCCCGTGAAAGGTGCCGGGACACCCTGTGGTGACTTTACGGAGCGTATCCGTAAGTTGTAGCCGAAATCCGCTTTCAGACGTTGACTGGTCTCGTTGTGGCAAAAGTTAAAGACTGACGCCGGCGAACTGACGGTGGTCCTATGACGACAGCTATCTCGATGACCATGCAGACTGACTTCGACCGGGCACGGCGAAGAATCTGCCGCCAGATACCAGCTTCACGCGCTCTAGTCCTCATTAGAGCAGGGGCAGCAGGCGGCCTGCTGGCGTGGTTTGATTAATGAAGCAAGCATTGACAGTGTCAGCCGCCGTGACGCTTCCCGAACCTCAACAGGTCGTATGTGTTCCGTACTGGGTCAGCAGTATCGGTAAGCGTCGGTGACGTGAAGGAAGTAGTACCTAAATCTAAAATACCAATGTGGACGTCCGTCACTAATACCAGAAGATCTCGCAGCACGGTAACAGGCAACCGGCATGACTCGTGACTGCTGCCATAGACCTGCGCAAAGGCCGCCACGATGACCACGTGACGGCCTTCCAAGGCCGGGGAGGGCGTAGACCGACACAGAGGCCCCTTTCGTGCTTGTCTTGGGATAAAACAAAAGGGTCCTTTAATCGTATGTATGACAATATACGGTGAACGCGTTGCTGCAGGCAAAGGTCAACATTCCGTGGCTCAGGTCATGGTGACTAGTTTGCTGCGGTTGCAGAAATTGACTACGTCAACAGGCCCGCCAGTTAATCCGCGATCACAGGTCTCTGAAAACCGAATCACTGTTGAACAACGGTGTGACGTCACGCTTTCTGGAACTGTCAGCCCTGCACCGCATTAGCATCTCGCTCATGAAACGGCAAGGATAAACAGGCGTGAGACACCAACTTAGAAGTTACTGTGGGAGCGGACACCGGGGTACGACGGCGCGTTCTGGCTCGGCGATGTCGCTGTGGCGGTAACCATCGCAAGCAATTGTACTGCCGTCCATGAATGAAATGACGGTTAAACAGATTGAGCAGGAAGTGCTTACGCTGGCCACGAGCAATTTCCATTAGCAAACGTGTACCGGCTGTCTGTATGTATGAGTTGTGACCATCCTTAAAACAGACAGGACGCCTGGCCGCCCGCACGTTGCGGGAAAGGTCATTTCGACGTAGCTGAGTTTTGGGCCTGAAACCCTAGATGCGGGTAGAGACCCGGCTGACGCGTGCCATGCTTGCCGGGGTCTAGTTGGACTCGATATGCCGACTGGCACCGCTTTTACAGTACCCATTATTTTCATGTTTTGGGATATGCGCACTTTCTAGTAGTATGACGTACCGTCCGGCCTCTATTTTCAGATCTCGAATATGCATCGCTGGATTTCAGTCCTCAACGCGTGGGGGCTGACGCAAGCCTGAAGATGATGTGCTGATGCAGGAAAGCGGCAGGGCGTTTGCCGCTTAGAGGGGTGTCCCGTTGGCTCAACGGGAATGAAGTTATCCCCGCTTCCCCGGATGTGTGGGACATGACGCAGGGATGACGTAATGCTGATGACAGTATCAGAAGGGATCGCAGGGTAGAGTTACGCTGTATAGTGACGCTGTAGGCGTACTCAGTCGTTGATTTAGTCTCATGCCACTAAATTTACTAAGCGGCCAGTCAGGCGTCACCTTTTGGTACCCGAAAGTGATGTGAAAAGCCAGCAGTCGTTGAACAGTCGCCTATCAACAGCTAGGCGAGGTGAACCAAGAAAGCGGGAGATTTCTCGTCTTAGTGAATAAAGCCCCCATGCGTATGCTGCCGCAAGTTGCTACGGACTGCCACGCAGCTTGCAGCGGGCAAAGTCCGTGTGATCTCTGCAACAGGGGCACTCAAGCTAAAGTATAATTTGGCGGGGTCATCCCCCATGTTTTAGGGTTCGCTTGCCGGTACCTGCCATTAGTGGGGGCCTCGCTGGCGGTGAAGCCTTGCGCTGGCGTATGCCTGGCTAAGAGATAGTAATTCACACCCGATTTCAACAAAACGCTGGTTTTGCGGCAAGTGGGGACATGACGGCAGATCGTATGCTGTTGGTTAGAGCGGGCAGGAGCAGGGCTGACGTTTAACTCAAGAGCACAGGTCTATAGGCACTGGTTACGAGGGGTAAGTACAGGCTGATTGCGTCCATACTCACAGTACTGGGCGCGTTTCTCTGCGTAAGCCTTGGCGGGTAGCTTGACGTCCGTGAAGCCTTCCCGTCGGGGAATAGCTGACCACAGGTGGCGACGTCGCGGCTGACGGGGTACCCGTTGCTACTTGTCACCAGAACAGTCCGTAACTTTGGAATGCCTCGTTTAAGCATGTGAAACAGGCGGTCCAACAGAGGCTCACAAGCGCTGCATAAATGTTGCATCTAGTACCGCGGCACACTAGGCAAACGCTGAAGGCCTCCAGCTAAATGAGTGGCATTTAAATCCATTAGATCTGATCCGTCGTCCTGATACCCCCGCCGGAAACCTCTTACGCAGGGTACGAGCAGACTAACTGCGGAGGATCTGCTAAAGAGGTACACCTCAGCTGGATTATTTCTGCTGGATACGCAGCCATACAGTTCGTGAAGATCTTAAAAGTTCTTAATCCAGG
>57
GGTAGTGTTATGATAGCGCCTGCAGCGTTTAATGCGCCGCGACGCATGGCCCACAACCGTTCACGGACTGAATTCGATTTAGCTCATCTGGCGTAATTCCGGAAAGCTGCTCTAGTACGAGACACAGCCCGGCAGCATACTGGACGCAGCGATACTGACTAATATAGAGACTGGACACGTTATCCGTATCCTGAGCCGTCCCTGTCAGTGAGTCACCCGGCATCAGGTGGGTACTTTGCCTCCCAGCCAAGCGGGCGTAGTAATACGCGGCAATTTCACCAATCCAGCCGTCATGGGTCCGCTGCTCCTATCTGTTCCCACCGAGAATAAAATGCATCGCTGACTGCGTATCCAGCTCACCTCAATGGTGGCGGCATACATCGCCTTCACAATGGCGCTGCAGCTGCTTTCTGCAGCGTGTCCGTCAGGACTAGCATCTTCATCTGCTCCATCACCGATCAAACACATTTGCACCGGGTTGCCGTCCTCTACACGGGTTCAAAACGTGAATGAACGGAGGCGCGCCGCCGGGTACTAATGGGGTATCCAGTGTCATTTTCTGCGGCATCCAGCCAGAGCCCGTCCCTAGTGACGTAATCCCATAGGCCGGACGCTGTCATTAATCTGCACACCGGCACGGCAGTTCCGGCTGTCGGTATGTTGTTCAATTGTGATGCCTTCGGGCTGACCATCGAACTTTGCCCGCAGGGCCGCGACGAACTGGTATCCCCATAGCCTGAACGAACAGTTCACCGTTAAAGGCGTGCCCGTAAGGCTTCCCCCGAATCATCATCTAACGTGCGCGTTTTCGGCTCAACGTCAATGCAGCAGCAATCCTCGGCAAACTATTTTAATCATTGCTCGCGGGAAAGGCACGGGCTTCTTCCTCCGATGCCAGATAGCGCCAGCTTGGGCGATGACTGAGCCGGAAAAACGAGGGTATATTAGTGCAGCTCTAGGATGGCGTTGGCATCCGAGCGTTATTGCGATACCAGATCGTCTGCGCGGGCATTGCCACGATAAAGTTGGGCAACAGGGCTGCATCCACACTTTCACTCGTGGGTTCCACGACCGCAACTGCTGGAAATGCTGCCACCGCCGTGATAACCGGCATATTCGCAGCACTTGTAGACGGTGCGGTTCCAGCCCCAGAAGGGTGGGAATGGTGGGCGTTCATACAGATATCCTTGCCTTGGCTGCGTGATCCGTTGTC
>58
ATCTTGATCTCTGTTTAATGTCCACGGGGTCGGTAGTGGAAGTCCTCCAGGTGGCTCCTCTTTCGTCAAATTAGTCGTCAAGTAAAGAGCGGAATTACGTTTAGAACCAAAGTCGAAAGGGTAGTGCGTATTATTCTCTAGCCTTCCTTGATCGACAAGGACAACTAAAGCATTATGGCACTAGGTCCATCAGACGTAATAGACATGAGTCAAATGCAGTGCTGAGGCATTACAGCTCAGGGTACTCTGTGCTGTAAAGCTGCTTACTATAAATGGTGACGAAGTTCGCTCAGGGAGGATGACGGACGGGGATCCAGCAAGTAAAACGAGTGGTACTGGAATGCCGATTCTGTACTACTTTCAAGTTAAACGACGGTTGGATCGCCGCTGAAGTGAACTTCTCACTCTAGATAGTGCTGCAGCGTTTCCGCACGACGCTCCGAGGCTCCGACATGTTGATTCCGAACTAGTACATCATAAAGCCATGAAGAAAGCCGCTTGCTGGATGAAGCTCTATCAGAACAGTCGAAGTTAACAGGACGGGCATTTGTCCCGCTGCCGGTCGCTCACTGTTCAGGCCAGCCACAGACCGCCGTTGAATGGGCCGGGTTAATTAGCTCCCGACGAATCCGCATACCAGGAGCGGGCAAATTCTTTTCACGGGCCATCATGAATGCGATGGCAGCGACACATCCGTGAGGTGAATGTGAAGTCTGCCCGTCGGTCTCTTCCAAAATGCTGCTGGGTGCGAGCATCGCAGCAACAGTGGTTGCCGACATGTGATGCCTAAACTTTATGAAACCCACGTTGATAAAACTTCTTATATTCCGTCCTGCATGGCCCCGTTGGCAAAGGGTAAAGCCATGAAGCGTTTCTAATGGGCGTGGCTTCTGCACTGGGCGGTAAGCAAAACTACCGTGAAGTCGGTGTATTAGTCTCATGACAATTGCTGCTTTTGATGACAGGAAACCGTTCCTCCTCCGCTAGACACCGTATTGAAGCTCGTCTTAGTAAAGTCCATCCGTGGCTCCACAAATCAACAGGCACTGTCAGATTAGCTCGTGCTGAGTGAATCCGCATTTTATGCCAGTTCATGTTGCCTGCCCGCATTGCGGGGAGCATAGAACTGTAAATTGAGACAAAGAGACGCCGTTGCAGCTGACTAGGTACTACGCCTCCATAGCGTTCGCGGGAGGCAGAGCCTGCGTCATCCGCATAGGCATGGACTTTACTGATGCCGTTATATCGGAAGGGACGGGATTACCGTGGCATTCTGGTTTTCGTCATCCGGTGAAGCGATTAGCTCAGGACCTATCTCTTTCAGCCATCGCCGTACAGCCGTTCCCTCTTAAGGTGTCACTGGATGAAACGAAGCGTAGATGGGAAACGTAAACCTTTAGACACCACTTAGTCACGGGTCGAGAAAATTGGCCGTGAATGAGGATGATGAAGGACCGAGGAAAGGATGCCCGTTTCAACCGTGCTTACCTGACCGTATCGACTCCCAGCTGGACGCTACCGAAATCGAGGTACCGGGCCGGGTGAAGACCTGATTGACCGGCGTATTACGTCGCCACGACGATGAACGACACGCTGCTTAGGTTGGCGCCATCAATAAATAACCGCCGAATCTTGAAATGTCATATCCCGTCGTATCTGCTACGACTAAAGGAGCTGGAAATCCCTGAAAAACATCGTTTGCTGGTATCGCGGTTAAAGGGATCCGTTAATGACGGAGGCTGCAGCACCATTAAGTGAAGCCACTCGCTTTGCTCTTGAATCACGTGACAACCAGAGCAGATTTAACCGGCTTCACGCCGGAAGGATGAACGCTTCCCGGTTGGGCAGTCCGGAAGGGAACTTTTATTGACCCGAAGCAGCAGCTGACTGCTGAATGCACTTGAAAATGGTGGATGAAAAACTGTGACATAAAAGGGACGCAATGAGGCACATCGACTGCTTCGTTTATGCTGGCGGCTGCATCAGTATGCTTTCCGCCTGGCAGCTGGATCTCAGTGCTGCATGAAGCCTGCGAAAGAGGATGGTGCAGCAACCAACAAGAACATGGCAGATTACGCATGCGCCTGGAGGAATGAACGCGACAGAACTTGCTGCCCCGTGCAGCACTTGATGACCTGACAAATAAACGTAGGCAACAGTACAGAAGACAGGTGCCGATTCACTCGTGCTTCTCTGACGGACATATTGCCCAGCTGAAGTGCAGACCGGCATGACACAGCGACGCAGGGTACTGCATTTATGTATGAAACGCCCATTCCCGCTTTGACGGACAACAAGCCTGACATGCCCGGCCGGTCAACGGCTTGGCGGCGCAGGATTTGAGGGCAGTTGCAGCTTCTGAAGCACCGATGAAGTGGATGCAGCTTCGCAGACTTTACCGTGGCAATGCCGCGCAGCAGTACTCTGTACCGGATAACGGCTATTAGACGCGCACTCATCCATCGCATTAATGGTCCTGGTCTTTTCCGGCTCAGTCATCGCCCAAGCTGGCTATCTGGCATCGGAGAGGAAGAAGCCCGTTGCTTTCCCGGAGGTTGAAGCGGCATTTACGAACTTCCTGCCTTCCTCCATTGACGTTAGAACGTTTACCGAGTGATTCGGGGAGTAAGTTAAAAAGTCTCGTGGCTGTTCGTTTAAAGGTAGAACCGTTGGTTTACCATCGTTTACCCGTCCCTATGGTCAACACCGATACCATCATGAAGTAAGCCAGCATAGACACATTGGCCGTTGAAGGTCGAGGTGTAATACACCAAGTTAGGCTGGGAGTCAGTCCATAGAAGGTATCCTGGCTGGATGCGCAGAAACGCAGTACTAGCCTCGGCTGCGTTGGCAGCCGGAAGGCACCGGTCCTTCACGTTGAACCGTGACACAAGCGGACTGGGCTTTAAGTGTTTTACATTATGAACAGCTGACAAGGTGCTCATGCAGAAACCCATTGCAGAGCGCGTGAGGCAATTAGAGGCCTTGAGATACTATAGTACACGGTTAGAGTGGATTTATTCTAGGCGTCAAGAGCGAACAGAAGGCTTAAACATGAGTTATGTAGAGTTAGATGGTCGCATTGAGAGGGTCTGAGGCCACAAATCGCTCTTCCTAGTAAGCCATCATGCAATAGCCAAAGGAGCCACTCATAAAGCTCCGTGTTGAGAGTCATTAGTGCGGTATCAGGGTGCCTAGATCGTGTCTCTCGTGGCTATTTCCCCGAATTACTAGAGACCTACTCCACGGCAAAGGGTCCATGAAGTCATTGCGTCATTAGGTGACTCGCGAGCAGGTCATGTCCAGTGGCTTCGGCGAGGTGACATATCATCTACTGGAGCCATCGTTCTAATTATCTGACACCTTTCTATTCCTCGCTTCGATTCGGAAGCCCAGTCGGTGCGGCTGAATGCGGACTGGAGCCTACGGCGCTTTATCAGGCCGTATTTGACTACGAGCACCGTTGTCACGGGAGCCGGTAATAGTAACCGGCCGTATAAACACCAGGGTACAAAGCGGTAATAATAAGGAGGATTTTGCCCGGGTTGGCGTCAAACCAGGTGAGCTAACCGTGCATGAGGTCTTAAAGCCGCTGGCGGCTTGAAGGATTTACGATCCGGTCAATCAATCAGATAACAGGAGAGTGACCTCCAGCCATCATCGTATAGGATTGCGCCATGGGGTTCCTGGCTCTTACTTAAGTAAGGGCCCACGGGTTTGTTAGATTTAAGCCATAGTCGACCGTGAAGCTGGATAAGGTATAAATCCAAGTTGAGACTTACGAAGAGCCAGCTAACCGAAGTCTGCGGAGGCCCCCGGACCCCTCAGCCCGATTGAATCTAGCGTGAGCTGGATACGGTGATCAGTCAAACGGGCATGCATAGATCTCAACCTTTACTACCCCATTATCACCGTCCGAAGCGGCAGGGTCCGTATTGACCGACGCATTCTACATCTAGGCAACCAGCTAATGGTGACAGCCCATTCCTCTGCTATTCCTGACAGTTAATTAAAGCCGTAAGATGGCCTGCCGGCCTGCAGGAGGGAAGAGATCGGGCCGACAGTCTTCGCATGATAGAGTAAGTAAGTAATGAGTTCTATCAACAGGCTCTTACGGTAAGGCAGGATAGGTCCGAATCTATAGATTTTACAGCGGCAGCGCTACCATCGTAACCTACAACATCTGCATCGTTTAATGAATGCATTTGAGTACCCGGCCCACTTTTAAGATGTTAGCATACTAATATATGGTTTAGTTGAGATTATACAAGTGGCGGGGCGTGTAGGGCTTCCTAATCGTGAGAGTAACCGTAATCTTGTTATTACCGATCCATTACCGTCATGCAATTATGCACTGATTAAGTAATCGCGTCTCAGGGGACGATACCACCAATAAATCATATGTTTCTACATGCTTCGCTAACCGTCATGATCTTACATAGAAGGCGAAGCCGCACCAGGCAGCCGGACGACCCTAGATCACGAGCATTTGAGAGCGGACAGGATCTAGGAACGAGATGCTAAGAAGGGTAGGACCGAACGGGGAAAGAATGTCGGCCAAACCCCTTATACGTGGAAGGCCTGATAAGGGGTACACCAGCGACAGGGTGTAAGGCGCGGTACTGCGCTCTCGGTTCTGCTAAGGGACGGCTGCATATACAGGATATGATCGGGAATACATTTTATAACAGTCTATAGAAGTTACCAACAAACTATTTACCATTACCTACAAAGCAGTAAGTACCATCAACCTGAGCGGAGGAGGAGGGAAGGCGCCTCAAGTCGAGTAGCGTAATAGCCTCCAGCCGTTAAGGTGCGGTTCTAAGTGAAGGGCTAGTCCTGCCGTTGGGATTCTGCGGTTTGGTAACCACATACAAGGTCTACGTTTACCAAGTTAGACAGGGTTTAGTCCATGTTATGGCATAGAAGAGAATGAAACCAAAGCGAGCGGAAGGTAAGCTACCGTTTGTAAGCGTAGGGTCGTTTATATTTACCTTCTATACGCTAGCTAGATTTAATTTATAGGATTTTATGTCACTTATACATCGCCAACTCCGTAAAGTAGATACAAATACAGTTC
>59
CAGTGCTTGGGTGTTAATAGCCACTAACCGCAGAACGTTATTTCATACAACGTTTCTGCGGCAGAGCAAACCTACCGACGCGATCACTAGAGGACAAGCAGGCCTCATCTAAGGTGCAGTTGATGTATCAACTAATTCAGCAACAGGATATTCTTCCAGGCTTCCAGCAACGAGGTTTCTTCCTTCGTGCGATTCCCAATCTGCAGCATCTCGTCGAACCGGCGCAATATGGTAATGGCTACTGCATCAGGCTTTTTGTTTCTTCCCTCCCAATGCCGACAGTAGCGTTGCTTCGCTCCTTCGCCGAAGAGGTCCCGTTCCACTTCTATTCCCTCCCAGCGATAACCAGGTAAAATTTTCCGGTAACGACTGGGGTTGAGAACAAATAACGCGTGGCCGAAGCCACCATAGACGGTTTTACCCCGATGGTCTTCAACGAGATGCCACACTTGCCTCATCATGTTGAGGACAGCCACAAAGCCAGCCGCGAATATCTGGCGGTGCAATATCGGTACTGTTTGCAGGCAATAACCGTATGAGGCAAATATGCGTTACCTTCATACACCATAAAATTCATTAGTTTAGATAAGATTATAAATTTTTATGGTCGTGGTGTTCACTCATTCTGAATGCCATTATGCAAGCCTCACTACGTGTAAATGCAATGTTGACGGTGTTTAGGGTCCGCAGCGTTAACGACGGTATGGTGTCCGTGTGAACCAACATGAAGAAGGCAGTAACGCACCCAACACTGGATGCTGTCCCAATACCAATATCCCACGAGCATGTGCAAGCTAAGCAGCCACCCGTACCGACAATGAGTACTGTGTGCCCTGAACTGTCCGTTTGGATAAAGCAGCAATACCGTGTGGCTTCCTTTAACTGTGATAATTCCTGTAATGGTTGGTTCCATACTCTACTCCAGCCAGAACTGTTGCTCCTTAAACCATGTGGCGTGAGCACCGAGCCCTGTTAGTCCGCTCAGACTGTAGCATGAGCCCCGTGTTATTCGTCGATTTATCGATGTACCGACTCCTGTTGTTTCGTCCCCGTAATCAACGACGACCCGCCTGCTGTTTTCGTTAACTCGATCGGATGCTCAAACCGGCACTGTGTGATTAAGGACTTAATCCGACTCGATTCCTCAGACAATACAGCAAAGAACTAGATGGCGGGTTCCCTTGATGTCCAGCCCGCATATCAGGAAGCACACCCATGATACGGGAAGCCCGACAAGTTTTATAGCTAATTGTCAACGCCCTGCCCTGCATCAGGTATAACGCCAACGAACCACCGATGACTCGAGCAGAGTCCGAGACGAATGCCCGTACTTCAAGACATCTGCAACGGAATTTTCAGAAACTCCTGCCAACCTGAGTCAGTTCAGTCAGGCTGGCGGCATCCATTTCCCCAAATACGGTAATTTATTTTCGCCGTGAAACCGGATGCGCCGCCGTCAGTCGCATTCTTCGGTTTACCGCAAGCGCGTTAGTCATGAGCGTCGGTAAAGGCATTCATCGAGCCGCTCGCCAGTTCATTCAGCGTATTCAGTGCGTCAGGTACGCGTCGATAACATCGCAATCGCGGCCAGTTACAAAGCGGTGCGCAATCTGGGTGTTGTTCCCTAGGCCGTCTGCTGTTGGCGTTCCGGTCAGTGCCGGGACTGTCAGTAGGTCGTTCGTTCATCCATTATTAAAGCCCCGTGTAGCAGTTGCAGCAAGGGTTCAACGTCCTGTTGATGCATTAGCCTTAATAGTACCCCTTTCTCGTTGTGTCCGCAACCTCAAGCGCGACAGCTGACGGTATCTTCTGCACGTTGCCGAATTTGCACCGTATTGCCGCCGCTTCTGCAGCCAAGCGTCCTCTGCGATGTAATATACCGCATTCCCGCAGCCTCTGTCGCCTTCGTGATGCTCGTTGACGCACTCCCGCCTGTTTTGCGTGCCGCGGCAGGAGGAGTCCCCGTTCCGCTTAGTGTTTCAGATGACCTGGCATTCGTCTCGACGTTGCCTGGCAGAATTTTCTGCAGCCGTTGCCGAGGAAAACCGCCCTCAACGCACGAATGACGTATGACCGTTCGTTCTCATCATTTGCTGCTATGCGTGTTGGCCAAGCATCTCGTGCTGAAGTGGCGGCCTCTGACAGCGCCCTTCGTGGCCGCGGTAGGCAGAGGAACCGGATGAGGGAAGCTGCAGCAACGCATCTGTTGGCCTGCACGAATTGCTTTCTCGTTTCAAGGGCACTGGGCCCCGCGTTTTTAAAGGGATATGCGACAAGCACTTTTCCGCTTAGTGGCTTTGCTCATGCCTTCTGCGCCGGAGAACCTTCCTGAGCTGGCTGCACTGTCGGACGTGCTTAAGCGCGTGCTGAGTCAGTTGCGGCCGTCATACAAGGCCGCGACCTGAGCAGCTGATGCACTGGCATCGCCGGCTGATTTCTTCGCGTCCATCCGTGGTCAATACTGTTACAAATGTATACTGAGGAGGCGCGCGTCAAGAACAGTTTAAGACCGCCCCAGGGTACCATCACCGGGCAAGTAAACTTATAGTTTAGTGAGAAGTACCATTGTACACCGTTATAGAGTCTGAGTATTGAACTAGTATTTAAGCAGTCCAAGTGGCAGTAACCAGACCGTAAGTATCGAACCTGTACTGACGTACTCGAGTACGGTGTATCACCCATAGTCGATACAGATTTATAGCCTAATTGTCATGAGGGATTATTACATGTTATTC
>60
GTGGGGTGACTTTGGACGAAATGAAGTCTACTTCTTAATCCCCCTTTCCTCCCCATACGTAATCGTACGATGCGTCACGAGTCAACTGATAACTGAAACCGATGCGATGCTACGCGAAATGACCCTTCTTTGCCTATGAAGGGCAGGGATCACGCTGATTGAGGTCAGCCCGATTATTCCAATATAATGTTGGATTAAATGAACCAAATGAATGCCCGTCTGGCTTCGATTTAATCGAAGCTTAAGAGCCCGCAAGCGAGAAGTATCCGAAATAATCGACCCTGCGGATATTCACTCGACCGCGACATCGACCCCGTTACGGATGGCATGCAACTGCATGCAGGGAATCACTCCAACTCTTGACGGCTCACGACCCTTGGAAGCCCCTATCATTCAAACTGGTTCCCGCACTGTTCGACGCCCGGGTTCTTTAAACGTGCAACCTCGAACTACCTGAACGGCACAGGATGCGAACTCGACTTGATTTAGCATGAGATAAGCAAGGCGCTCCGGCACTCCTCGGATCGATTATCCTGCAACATTCTACGGGGTCAGTAAACTTGAATCCGAACATGTCAAACGGGGTCTGCACGTGGCACGATCGACGTACTGAACTTCCTTCCCCTTCCGCATGTTGTCGCTATCAATGCTCCAAATACCCGCCAACCGGAGAGGCGAAATCGGGCCCTGAAGAAGTGTTCCACTTCCGCCCCTGCTTTACATTTGCACCGGTGGCTGGAATTAAGCCCATAAAGCACTGGCTGGGGGAAATATACGATCGAGAGAAAGCAAATGCAATTCATGCTCGTACATTTGGACGGGTTCGGCAATCCGCGATCGTAAACTCCCAATGCCGCGACTCTTAATCCCCGCCTGCTCTCCCAATGGTTTATGCGTCTGAAGCAAATCGAATGAATGCCCGTTTACCTCCGGATTTCATGAAGTTCAAGCTCCGTATTTCCAGGCCATAAAGTCAGCTTCAAGTGAGCCAGGTGCATGGTGATCCACAGCGGCTTGGGTGACTGAAAAATCCCCTAGTATTTGCCAAGCTGACGCCCCTATTGAAGCGTGAAGGCCTGCATTATGTCGTGATCATGAGCGGATGAAAAGGTAGATGGCGGTGTTTGACGAGATCGTGCCTAGTTCGAGACATCTACCCACCCAAAACTGAAGCTGACGTGAAATCGTTGTATTTGGCGATAATGGCGATGAATACCTCGGACGTACGACGCTCCCCAATCCTTTCGTCTCTCCTTCCTTCATCGTCAAGAAGGGGCCTAGGTCCCCGAGCATTTTCTTTATCCAGAAATCCACTGAAAGCACAGCGGCTGGCTGAGGAGATAATCAATAAACGAGGGCTGTATGCACAAAGCATCTTCTGTTGAGTTAAGAACGAGTATCCAGATGGGACACCTTGCTCAGGTGGAATCAGGTTGTTGAACTAGGAGCGCCACCAGTAGAAACAGACGGAACTTTCAACCGTTAGCCGCATCCTTTCACAAAGCTGGAAATGATGGGCGGGTGAAAGCAAGTACAGGGAAACCAGGTATCAACCACGGAATGCATTTGGCAGCGGGCTTCGACTTCTGGTTGTGCTTATGCTGCCGACTCAAATGTCGATGTAATCATCGATGGAATGAAAGCCCTTCTGAAGCATTGCCCGTCAGGCTAATTCTGAAATCAAAGGCACCCAGTTTCTAAACAGCAACCCGGACCCCATGTACCGACCGATTAACGAAGCACCGCGTAAACGGTAACGGTGGATTCACCACCGACTCCACTTTAAGCTGGATCGGCATGTTAAACGGCGTCTTTAAGGAATGCCATCGCCTACTCCGGCTATCCATCAGGAGTACAGGCTCCTTTATTATTCGCATTGCCCTCAAGCGTATTAACAGACAGTTCAGGAGGATTAATGATGAAGGTACGGCAGCACTCCATTGATTCAGCATCAGAAATAGAGAATTAAAGGCACTGACACAGCGACTAAATGCGCCCTCCTAAACCCAACGATAGCTATCTTGGTTCTTAAGGCTTGTTGAGTGAGATCCGATAGATGAAATGAAGACGCTGTCGTTCAGGGTGTCGACTTGTGTGCAAGTGCCAGGAGGATCTGAATTATCAGTAAACATAGAGAGGTTTGAATAGTCATAGGAAGTCGACTCTACGGACGCGACTTGGATCCAAGCATGAATGCATGACGGGAAGCGGAGACCGAAGCCCGACCTCGAATTACTTGGTAACACCATCGATTGTGCTCAGAACTGCTCATGGGGAGATGAACGGAATAAACAGGCACACGGACGCCGCGACCAGGAGAACGGAAGGGGTTGCGCTATAAACCGTCGGAAAATGCGTGTTGATAGCTTGAATGAAAGACGCAAATCGAGCTCCCATCCCCTTCTTCTCATCGGGCTAATGCGCGAAGTGTTATCCGGGTAGAAGCCGTATTGCTCTGAAGCAACGAAGTCCGTGAAGACGGAAACCAGTTTCTTGTTGTTCGCCATCCTGAAGATCTCCTGTTATCAAGCACTGCACTGACCGAAGAGTTTCTTAAGCAGTTAATCGAACAGACCCGTTGTTAGGTGACTATCGACATCATTACGCATCATTACGGGGTTGGGGGTCATAATGGGTAATTCAGGATGCAGTGAGGTATCTGCGATATGATGTCTGACGCTGGCAATTCGCATCAAAGGAGAGTGAGATCGGTTTATAAAGAAGGAGCGGAGGAAGCGTGCACCGTCGTCTTCACAGCGATGCCAGAGTCTTAGTCCATCAACCGTTCAAACATCGGGTCGGTATTATCTTACTGTTTCTTTACATAAACATTGCTGATACCGTTTACGGCGCTCCAACGACATTGCAAGGAGTTTATAAATGAGTATCAATGAGTTAGAGTTGAGCAAAAGATTGGGCGTTATCAATGTTGTGCAGATCCCTTGTCTTCTCCTGCTATGCTCCAGGTTTCTTCCTGCTCCCATAGTAGATAGAGTCGGCATACAAATATTCCATGAAGGTTTATAAGTCTAATGAAGACAAATCCCCATTCTGCAATGTGCGAGAAATGACTGATACGTGCAAATGCTTATCGAACTCACCGGTGGAAGTCAGTATGCCCTCTCTGTACAAACATATTAATGACGTAATACGAAGACATCCCCGCAACCGCGGGCAGGGAGTGGCTTGAGCTGAACCCTGACTAGCGGGTTTTGTTTATGGAGATGATAAATGCACTTCTTCCAGTCACAGGCGAATGCGAATGGGAGAACGGTTCAACAGAGTTATCGAATAACGGAGGACATCAACGGGACTGCTACGACCACTGGGCTCTGGGCGCACTGATAGCACATGCAATGACTAATATTCGAATTTGAAGAACTGAAAGAGAACACCAAAGCCGCCTGGTGATGGCCGTCCTCCTGCGTGTAATTGGAGACTTTGCGATGTACTTAACCTTCAGGGAATGAACGCACGAGCGACGTCCAACCGAGCCTTGAAACAGTTCGTCGATGGGTTCGGAATGCAGCAGTTCCATCCGGTTAAGGATGGAAGAGAACTTTCCCCAGGCTTCCTGATTCTCTTCCTGCACTGAATAACGATAGCTTTGAAGAGGATCGAAATGGGAAGAAGGGGAAGAGAGAAGGAGCGAGAAGGCAGGAGGAAATCGATTACTGTGATGAGCATCAAGGACGGGCAAGGTTGGATCTAGCAGACATGAATCCAATCATGGCAACGCTCTAGTAACAGGCCAACATTGAGTTATCTTTTCCATGACGACAAACACAAGCCTCTGACAGCGAGAATCATTGATAATTCCGTTACGTAGTTACATTCATGGCCTTGATCGCTACGAAAATCCTGGCCAGCAGAGGAATTAGGACCAGAAGACTCATAATTACATGAGCAAATTAAAGCAATAAGGGAGGGTCTGCCTGATGCTCATTGAAGACATCACAAAGAAATTGCGCAATGCTCAATGGATACGACGAGGGCAAGGCGGCGTCAGCCAAGTCAATCAGATCAACATGAGCGATGCATTCCGAGAGTAGCACCTATGAAGGCCATAACAAAGAAGAGCGCATCCCGATCCCAGCGAGCAAATCAGAGGTACGACCCAATCAATGTCGACCGTATGAATGCCCTCCCAGACTTCTCTCCCGGGGCCAATCACTCCCCTCCTTTCCTCAGACTACCTTGCAATCGAAATGGCTGTTGTTACCGGGCAACGAGTCGGTGATTTATGCGAAATGAAGTGGTCTATCGTAGATGGATATCTTTATGTCGTCAAAGCACTCCTGAAACAGGCGTAAATGCCTCATCCCAACAGCATTGCGATTACTGCTCTCGAATATCAATGAAGGAAACACTTGATAAATGAGAAGAGATTCGTGGCGGAGAAACCATAATTGCATCTACTCGTCTGAAGCCTTTCAGCTTGAGCACATATCACAGGTCATGAGGGGACGAAAATCTAAGGTCTTTCCTTCGAAGGGGATCCGCCCACCTTTCACGAGTCGCAGTTGTTTAAGACTCTATGAGAAGCAGATAAGCGATAAGTTTGCTCAAACATCTTCTCGGGCATAAGTCGACGCTGGCATCACAGTATCGTGATGACAGAGGGAAGGAGTGGACAAATTGAAATCAAATAATGATTTTATTTGACTGATAGTGACCTGTTCCTTCCGTCGGCCATCTTCCTCGCCGCCTTCCTTTTATAATGCACTGTAGTATAAAGCTGAACGAGAACGTAAAATGATATAAACTAATATTAATCCATTTGCATAAAACAGACTACATAATACTGTTAAACACAACATATGCAGTCACTATGAATCAACTACTTAGATGGTGATGAATAGGCGCAGAAGCCGAGGCTTATCTGCTGGCGGAGATCTTAGATGACTTGTCGCCCAATACTCCAAGAAGCCAAAGCCTCGCAATCCAGGTTGTGCCATGACATTTGTGTGCACCCACCGACCTGCATAACCAGTAAGAGAGAGACATACCAAGTGATGTCGACCAACGCAACGTAACTTCTTTCTTTCACGACTTCCCGCGCCCATAAATCATTTCTAGTGAATGTCTGTTATGAGCGGAGAGGGAAGTTAACACTTATGAAAATGGCTACAGGGAAGTCCGTGGCTATCTATCGGCTTATTAGTATTGAAACCGTCTTCGAGACGCTGGAGAGCTAATCGTTCGAGGTATATGCAGATTAATAGACTATATCGTTGGTATAAACAGTGCACCATGCAACATGAATAACAGTGGGTCTCGGCTTCCAGGCCCCTCTCTTTCCGAGCTCCCACAAGATACGATGCGCGTTACGGCAGGCGAGAAGCTGGAGGAAAACGTATGTAATAGAGACTTAAAGAGAGATCCTGTTGAGCGCCAACATAAAGTCGCGGTTATTTTAATAAATTAAGCGTATATATGTTGGAGTTTAGTTATTGAAAGAGGGGTATATTCCTGCAGTAGAAAGCACCAGGATTCCTACGAGCAGATGGTTTAAATGACGTTGCTCCTTTGTTACGTAATGTTTTATCTTACTGTCTTTGATGAGCATGGCTAAATGCGATATCGGAAATTTGTTAAATTGGTTTGCTTAGATAAAGAGAAGTAAGCACTTATTCTATTAATAGATAAATTCAGTCAACTCCCTGAAATGTTTTTCCTTAGGTGAAAGCATTGACTATGTTAATCTAAGCAAATTAAGCGATGTATTTAAACATAACCTTCTTAAAGCTATTCAGGGAGCAGGCGAGGAGGGAGATCGATTAGCCGACATTGAAATGAAAGCGTCCTTAACACCTCGGTTTATAATGTAGGGGCACTCTTTCAGAAATTCGCTCCCCGTTCGCCTTCTTCCCTCTCCTTCTTCGAGGTCTTCTTCGATTTCCACTTTCATTTAATAGAAAAGTGCTCCCGAAGATTCAGTACTTATTTAGCCTCCGTTGAACGGTTAATTCTATGCCCAGCACGAACATTCATGCTTTATCGGGCACGCATCCTTGTCGGGCCACAACAATTTGAATCGAAGAGGCATCCTCTTGATCGATCACAACCCAAAACAATGAATATTTTCTCTGAAAATAATAGACTTATCGAGTCAGAATCCCACGAAGCTCACAGTGTTTTGCCTGCCCTTTCTAGCCCGATGGGAGAAGCGCGAAGGGATGCCTCTCTCTGAATAAACACCCTAAGGCTCAAACAGCACGTAATACTTTATTGTAATGGAATCCTGCCAGCAATAGTTTAAATCAGGCGATCCCCTGCTCGAATTCATTTCAGCATTTATTGGTTGTATGAGTAAGCCGAAAAGACTCGTGGAAGCTATCGACGGACGATAGTAAACCGACTGTTCAGCTGATGAGGGGACTCATCAGCCCCTTCCTAAATATGAAGAGGATCAAGACGTAATGAACCGAGCAGATTCAATGACGATGATACAACGCCCGACTTGTTTTATGACACTGAGAAATCTGCTTCGAGTCTGAACTACCTGCATTGTTTTTATTTACTTATCAAGATTAGTCATCTTCTCATCTTCTTCTCGA
>61
TGTGGTGTTTAACTCCCACGGAGGCAATTTCTCATGCTGAAAACGGAAGTGTACCGGCTGTCTGGTATCTGTATGAGTTTGTGGTGAATAATGCCCGCTGAACAGACAGAGAGCTAGATGACGCCGGCCCGCAAGCCTGTTTCTGCGGGAAAGTGTTCGACGTGAGCTGAGTTTGCCTGAAACCGGCGCGTCGTGAGATGGGGCGACCCGACCCGTGCCATGCTTGCCGGTTAGGATGTTCCACGGAGTTGCCGACTGGCGGCAGCGGTTTACAGTACCCATTATTTTCATGATGTTCCTGCTGGATATGCACTTTTCCTGCTGACGTACACCGTGCTCAGCCGTATTTTCAGCGATCCGGATATGCATCTGCTGGATTCAGTCTGCTGAACCGGCGCGAGGCTGACGAAGAGCCTGAAGATGATGTGCTGATGCAGAAGCGGCAGGGCTTGCCGGAGGTGTCCGCTTTGAGCCGGACGGGAATGAAGTTATCCCCCGCTTCCCCGATGTGGCGGACATGACGGAGGATGGACGTAATGCTGATGACAGTATCATCGAAGGGATCGCAGGGAGGAGTCCGGGGTCTAGGCTGAATGCTAGGCGATCTGGTCGTTGATTTGAGTCTGATGCGCTCAAGAGATTTAGACGCGAGCAGATGGCTAGATCAGGCGTCGGTTTTCTTCTGTACCGGAAAGTGATGTGAAAGAAAAGCGGCAGTCGTTGAACAGTCGCTGAAGCCGACAGGCGCTGGCTGCACAGAAAGCGGGGATTTCCGTCCTGCGATTATAAAGCCGCCATGCGTATGCATGCCTGCACAGTTCACCGACTTGGCCGCCGCAGCTTGCAGGCGGCAAAGTCCGTGGCTGATCCTGCCTGCAACAGGGGGCAGGTGAAGGACAGATTCTTCCGGGGGTATGATCCCCATGTTCGTTCATGCGGTGCCGGTGCGATGTAGCGCCTTACATCTGTGAGGCCTCGGCAGTGGCGGGACCGGTGCGCTGGCGTATGCCTGGTATCAGGGCATACCGACCCTGTCGATTTCAACAAACGCCTGGTCCTTTCCGGCAATCGAGCGACTGACGGCAGATCGTATGCTGTCCCTGTCCCGCAGCCGGGCATGGAGGGAACGTTTAACCAGACCAGGGGTTACCTCAGCGCACTGGTTACCGGCGGGGTAAGCGGTGAGGCTCAGATCAGTGCGTCCGATAGCCAGTGGCGCGTTGCTCCTGCATCCGGCGTGGAGGTGGACAAGGTCGCTGAAGCCTTCCTGGAAGCTGACCACAGACCCGACGTCGGGGCTGACGGCGATGGCTCGCAGTTTCGATAACGTGTCTGGATAAGATTGCGTATGTTGCTCAGTTGCAGCGTTCCGGCGATGAAGCCGGCGCATTGCAGGCGGCGAACTGAGAGGCCGCAACGAAAGGGTTTGATGACCAGACCCCCGCCTGAAGAAAGAACATGGCACGCTGGAGACCTCTGGGCAGACAGGACTGCCCTATGGCATTCAAATGTGAATTCTAGGTCCCGTGGGTTTTATTGGTCGTCCTGATACCGCGCAGGGCGATGCTGATTAAGGCAGAGGCTGCGTATGCAAGAAGGCAGACCGACGACATCTGGAATCTGCGCAAGGATGATTATTTTGTTAACGATGAAGCGCGGGCGCGTTACTGAGCAATCGTGAAGGACTACGTCCTGCCTTGAAGCCGCCCGAAAGAAGGCTGAGCAGCAGACTCAACAGACAAAATGCGCAGCAGGCAGAGCGATACCGACTCCGTCACGGCTGAAGTATACTGAAGAGGCGCAGAAGGCTTACCGAACGGCTGCAGACGCTCCGGAGAAATATACGCCGTTTACGGAAAGAATGAACAAGGCACTGAAGACGGGGAAAATCCTGCCGCAGGCAGATTACAACACGGGTCGATGGCGGCGGCGAAAGGATTATGAAGCCGACGACCGACCGCTGAAGTCCAGCGTGAAGGTGTGCGGGCGGCGAATCGTCAGGAAGACGGTGCTCAGTGGGATGCCTGTAGTACGGTTCAGGCAAGAACTCCGAACGGCTGAGAAGCATTAAGGCAGCAAATGAGAAAATCAGAGCCATCACAGCGCCGGGGATTTGTGGGAAGGCGGAGTCAAGCAGTTCGCGGTACTGGAGGAGGCGGCGCAACGTAGGAGCTTTATCGACAGGAGAAATCCCTTAATGAGCATAAAGATGAGACGCTGGAGTACAAACGCGCCATAGTGGATGCGGCACTTGTAGAGACAAGTACGTAAGGAGCTAAGGCCTGACGCGCTCTAGGAGCAAGGCAGATAGTAAAATGCACATAAAGCAACGGTAAACGGGCCGCCATTGATTAGAAAGGCCGGCTAGAATGACCGGCAAGGCAAGAACGGGAAGCCACAAAGGAACAGGGCGCCTGAAGGAACAGTAACGAGATAATGAGGCCGGTATGAAAAGCACGGCAGTAGACGGTCATGTCAAAGAAAGACCTGTGAGGCTGGAAGACCAGGGTTCAGGGAACTGGATGGCACCATGAAGTCCGGCTCCGATAGAGTGGGAAGCAGCGCCACGGACAGTATGTCTAAGAGACAGTGCATCACGCAAGACCTTTGATGGTACTTGCACAAGAATATGGCGGAGATGCTGACCGGCAGTGAGCAGAACTGGCGCAGCTCCCCGTTCCGTCCTGTCCGCTTAACATGACAAATTCTGCTTAATGCAGGCAATGGTGGGGATGTCGGGAGTATCAAGCGCCATTGGCGGGGCTGTTGGTGGGGGCGCATCCGTCAGGCGGTACAGCCATTCAGGCCGGGCGAAATTCCATTTGCAACCGGAGGATTTAAAGGGGAACCGGGGGCAAATATGGATAGCCAAGCGGGGATTGTTCACCGTGTGAGTTGTCTTCACGAAGGAGGCATGAGAGCCGTACCGTGGGGAATCTTTACCGGCTGGCTCTTGCCTCTAGGCTATGCCACCGGCGGTTATGTCGGTACACCGGGCAGCAGCATGGCAGACAGCCGGTCCGCAGGCGTCCGGACGTTTGAGCAGAATAATCCATGTGTGGTGATTGACAACGACGGCACGAACGCTGGCGTAAGTCCGGCTGCTCTGAAGGCATTATGACATGTACCGCAAGGGGTGCCCGCGTGATGAAATTCAGACACAGATGCGTGATGGTGGCCTGTTCCGGAGGTGGACGATGGAAGACCTTCCGCTGGAAAGTGAAACCCGGTATGGATGTGGCTTCGGTCCCTTCCTAAGAAGGTGCTGCTTTGGTGATGGCTATTCTCCGGACGCAGCGCCTGCCGATGGCTGAATGCCAAGCTGAAAATTAAGCGTGACGCCTTTCGTCGCCTAGGTTGGGATAAGGGTACTGGAGAGTCGTTTCTGGAAGAGCACGGGCTGGAAATCACCTTTCTGTAGACGCCTTATGAGTGGCGGCAGATAAAGGTATACTGCTAAAATGGTCGTCGCGGGTCAGTATGCTGCGTGTTGAGTTCAGCGCAGAGTTTGAACACAGGTGGTAAACTAGATGCACAGGATATCCGGCAGGAAACACTGAATGAATGCACCCGTGCCCATAAGAGCCAGCGTGGTGCTCTGGGAAAATCGACCTGACAGAGGTCGGTGGAGAACGTTATTTTCTGTAATGAGCATACGAAAAAGGTGAGCCGTCACCTGGCAGGGGCGACAGTATCAGGCTTATCCCATTCAGGGGAGGGTTTGAACTGAATGGCAAAGGCACCAGTACGCGCACGGTGACGGTTTCTAACCTGTACGGGCTTAATCCTACATGGCGCGAAAGATATTGGCAGTCTGGTCGGCGGAACGGTGTCCGGCGTAAGGTTTACGCCCGTTTCTGGATGCGGTAAACTTCGTCAACGGAAACATAATTCACGATCCGGAGCAGCGAGACTATCCGGGCGCATTGAGCAGGTTGCAGCGACCAACTGAGCGCGGTGCTGCTCCTTTGTACCTGTCCACGCCGACGAAACGCAGGGCGCTTTTCCGGACGTATCATGCTGTAAAGACGCTGCACTGGACCTATCGCGGTACACGGAGTGCGGTTAGCGGTCCGGCTTCCTCGTAGATGAATATGACCAGCCAACGTCCGATATCACGAAGGATAAATGCAGCAAATGCCTGAGCGTTGTAAGTTCCGCAATAACGTCGGCAACTTTGGCGTTCCTTTCCATTGACAAACTTTCCGCAGTAAATCCCAGTGACAAGACAGAATCAGCGATTCTGTGCACGCCCGGCGATGTGCCAGCGCGTGGTTCCGGCTTCGTGGTAACCGACACGCCGACCCGTCGAGGGGGAAACATATTTCCCTTGGTACCATCCGGCCCGGAGGCGTATTTCCGTGATCCGGAAGACTGGCTGCAGGCAAGAGAAATGCAGGGTGAATTGGCCGCTGTTTACACGCCAGCCCCCGGTGGTCCGCTGGCTGAGTGAGGCCGACCGGCGGCTGCTGCAGGTGCAGAGTGATTTGCCGTGGCTGGTCTGCCGGCGACGATTCCAGTTCCGCTGTGTGCCCGCATCTCACCGGGCGGCGCTTTATGCAGCACGGTGTGACGGACTGTTACACACTGTTCCGGGATGCTGCTCATCTGGCGGGATTGAGATGCCGGACTTTCAATGGGGTCCATGACTGGTGGCGTAACGGCCAGAATCTCTATCTGGGATAATCTGGGCTTGGCGACGCTGGCTTATCACAGGTGCCGTTGTCAGCGGCACAGGGCTAGGCGATGTCCTTGGTTGCTGGCTGTTTGGTTCATCAGTGCCGAATCACGCAATTTACTGCGGCGACGGCGATGCTGCACCATATTCGACACAAACTAGCTGAGCAAACCGAGAGGTATAGACAGGACAAATGGCAGCGACGCACTCCCTGGCGTCACCGGGCATGGCGCATCTGCCTTTACGGGGATTTACAACGATTTGGTCTCGCATCGACCTTCGTGTGAAAGCCGGCTGAAGCCATCCGGGCACGGGCCACAGCTCAGGCGTTTCGTCAGAAACTGAGCGACGACCTTATCTATCAGGGTGGGATTACGGTGGAGACGAGCACGTCCGGGTTAACGGCGCAGTTACATGAGACTCTGCTGATGGCGCCCTGTAATTCAGTGTTCCAGGTCGCCGCGCCATTAACCATGTATTCCAGATCTTCTGGGGCTCTTACGCCATTCAAGGTTTCTTTACCGCCGGAGCCCCTTGCAGCATGGGGGCAGCCATTCTAACCGGTGGTATGAAGCGGCATCCTGTTTCTCTCGGTGCCGTATGGTGCTCGGTGGTGTGGCGCAGATGCTGGCCACCCGACCCCAGATTCCCCGTACAGACAACGGATAACGGTAAGCAGAACACCTATTTCTCCTCACTGATAATGCTTCTAAGGCAATGTTCTGCCTGTTCGTGGCACCGGGGAAATGCGTGCGTATACCGCGTGGTTTCTCAGGAGATCAGCACGGCAAGACGAAGGGGACGGTGGTCAGTTGTGGTGATTGGTCGCTCATGATGCAAATGTTTTATGTGAAAACCGCCTGCGGGCGGTTTGTCATTTATGAGCGTGACCGCGAGGTCAAAGGAAGCAGTAAGGAGCCCCATACAGCGAAGCGAAGGACAACCTGAAGTCCTAAGGAGTTGCTGGTGTGATCGATGCGATAGCGAAGGCCGATTGAAGGTCCGTGAGCTAATCTAGGGGTGCTGAACAGTACGCGCTTACGGCACTGAGGCGAAGTCACCAACATATCCGGTGTCACGGTGTTCCGGTGAGCGAGCAGGAGCAGACTCCGCCCGAGGGATTTGAATCCTCCGGCTCCCACCCTTGCTGGGTACGGAAGTGAAATATGACACGCCGATCAGCCACCATTAAGTCTGCAACATCGACCGTCTGCGCTTTACCTTCGGTGTACAGGCACTGACCGGAAACCACCTCAAAGGGTGACGGGAATGCGTCTAGGGAAGTCCGCCTTGGTGGTTCAGATACAACGTAACGGTGGCTGGTACGAAAAGACATCACCATTAAGCTAAAACCACCTCGCAGTATCTCGGCCCTTATGGACTCATCCGCCGCCCGTTCCTATCCGGATCGCAGGATGACGCCGGACGCCCACAGACCAGCTGCATACGACCCTCTGGTCGTCATACTGAAATCATCGATGTGAAACAGTGCTACCCGAACACGGCACTGGTCGGCGTGCAGGTCAACTCGGAGCAGTCGGCAGCCGACCAGGTGAGCCGTAATTATCATCTGCGCGGGCGTATTCTGCAGGTGCCGTCGAACTATAACCGCAGACGCGGCAATAAGGGTATCTCGGACGGAACGTTAAACCGGCATACAGCAACAACATGGCGCCTGGTGTCTGTGGGATATGCTGACCCATCCGCGCTACGGCAGGTGGGGAACGTCTTGGTGCGTGGATGTCTGATAAATGGGCTGTATGTCATGGCCAGTACTGCGACCAGTCATGTGCCGGACGTTGGCGGCACGGCCCGCCGCGCATCAGCTGTAATGCGTACCTGATACCACAGCTGTAAGGCGTGGGATGTGCTCAGCGATTTCTGCTCGGCGATGCTGTATTGCCGGTATGGAACGGTAAGACGGACGTTCGTCTGCAGGACCGACCGTCGGATAAGACGTGGACTAACCGCAGTAATGTGGTACTTCATGGGATGATGGCGCCCCCGTTCCTACAGCTTCAGCGCCGACGCCATAATGCCGTTGAGGTGAACTGGATTGACGAACAACGGCTGGAGACCGCTAGACGTGAGATACGCAGGCCATGCCGTCGGTCGTAATGTTACGAAGATGAATGCCTTTGGCTGTACCAGCCGGCAGGCACACAGCGCCGGGTCGGTTGATGGTTCAAAACGAACTGCTGGAAACGCAGAAGCCTTTAGATTTCACCGTCGGGCAGAGAAGGGTCGCCATGCGACCGGGCGATGTTATTGAAATCTGAGATGATA
>62
GCCTGTTTTCTATAGCCTGTATATTAAGGGCCGTAAAGCTGGTATTTATTTGGCGTATTATGTTCAGGAGAATAATGGAAGTTCGCTGACTCAATGTTCATAGTGTTTACTACTCAAGCCAATCCGTCCAAGACTGAACGCATGAAATATAGTTTGCCTGCGTCATGTTTGAGTCTGCTGTTGATATTTCTACGTCGGCTTTTTCTTCCTTTGCACTCATTTCCATGAAAGCCATTTACTTATGTTTGAATCAATTCCATTAATGAAATCTTTCACTTGGCAAGATGTATGATGCTTTATTGGAGGCTATCCTTGCTTTTCTAGCTAGCTCATCCAATGAAGCCATAGGCATTGTTATGTTTGGCTCTGTCCATCTGCAGGACACGCCAAAAGATTTATGGCGTATCTTCAAATGTTATTGATTAAATCAATTGGATGAATGTTATCATAAATGCTCATGTTTGAATGATAACGCGTCCTTTAAAATGGTGTTTCTGCAGCTAGTGGCTGTATAGGTCAATTCTGTCGAACTATACTTTTAGGCTGGCCCAGTTTAGACAACGTCCCTAATACTTCTAGAATTATTGTCTTATTGCTACTTATCATGCTAAACCACATTTGCATGCTGAGTAATGGTTTTTAAAGTTTAAGTTATTCTCCTGGCTGCATCAGACCAAAGAGTCGGCATCATGTTGAAATCACATCGTCAGGCATTGAATTGTTTATTTGGCTGCCAAGAGTTACAGGCAGTTACATTCTGCCATAGATTATAGCTAGGCAGTGTAATAATTCGTAATCTTTAGGCTTAGCGACCGAGCGTCTTTCTATTTACTACCTACATGATTCAGTTAATATGAAGGTAATTTCTTTGTGCATTAACCTATGTTACTAATGTTTAACATACTTTCATTTGTAATAAATGCAATGTCATTTTCTTCAATGTAAGATGAAAGGCGATAGCCTATTGCCTCGGCTTTCTAAATCGCCTGTTTTTCCTTATTGCGAAGTTTTAGCCCAACCCATGCTATGATCATTTCCATTTTCAACATTATTGTTATACATATGTCATATCCGGCTAATCTGGTTTTGTGGAATAATATATAAATGTCATGTTTTCTTGCGAGTTTAGAAGTGGCATTGCCGACTTCAAGCGAAATAATTCAGCCAAAAGTCGGATATCAATGCAGCATTTGAGCAAGTGCGATAAGACTCTTTAAGTCTTTCTTTCCCCATAGTTTTAGTCATAACCTCCATTTTGATGATGCATGCTAGATGCTACTTTTTCCGAGGTAAATTAACTGCATGACTGTCAATGTAATAAGATGTTTGATGCTCTTTGCAATGATTGCGGCACTCAGAACATATCCAATTAGCCACAGGAAATTTACATTATTATCATTCATTATGGTCCAAATGCGATATTGGCTTGGGCTGGGCACTAGTGCTCAGAGACTGGCTCGGAGAGCATACGTCGTATGGAAGTGCCTGCGGCTGGCAGGCTGGCACTTCCAGGTAGGTGCGGGTGTTGAATGATTTCCGTTGCTACGATTTACATATTTTGCATGAGAAGATTGTGTACCTAGCACAGGCACTGGCTGACTGCCACTGGACTGTCCCCAATCATGTGCGACAGTGAGACGTCGGCTTCTAGTGTGCATGCCACTGTTGCCAATGACTCAGGAAGTCGGCAAGTCAGCAGGCACTTTGAGTAAAGCGCTCCTCATAAAGTATTGCTTTCACTTCTAAGCGGTAATTTTCTATCTTTCATCATATTCGATCCCTGGAAAATCTTCCAGTGCCGGCATAACCACTCCTTTCCAAGCGTGGAAGTCATTCAAGCTAATGTTCAGATTTGCTTCAATAATTCTGACTGCTGCTGAAAACGTTGCGGTTGAATTTATACTACTTCCTTACTACTTTGAGGATTTCTTTGAGTAATCACTTCACTCAAGTGCTTCCTGCCTCCGGGACCCATACTTTGGCATATTTAATAGCTTGAAATGATGAAGAGCTCTGTCTGTCATGAATTCCGCTGCGATCCTAACAGCAAAATAACGGCAGCAGTCCGGAGATTCGAAATTGCAGCATATACCCATTGCTCACGAAAAGATGTCATGTGCCGACTCGAGATGAGTGCTTGACACTGGGTGAAAACTTATTTTTCTCTGATATACAGTGCAGTCGCGGCACGATGGAAGGCACTTAAGCGCCCAATACGAAAATTCAGGATACTTGCGGGCGAACCGACTGATGGGTATTTTTCTTTAATGATACACAAAATATCATGTTTTGAAGACATAGCCTGGCATGAAGCAAGCAGTCATCAAATCATGTTCCTCGTGTTTTATGGGAGATGGTCGCATAAAGCGTTCTAATTAATGTTGTCTATTACCAGCCCAATTACAGCAGGCGCAAGTGTCCTGTTAGCTATAACGTACTGTCCAGCTTAATATGCTATGGTGTTGTTCTTTTCTGTAAAATGGAAATGAGTAATGAAATTATTTCGACATTTATCTGCATCACCTTCCGGCATTTATGCGGCATGTTCGCTAAGTTGACGCTGGAAAGGCTTTTTCATTGTACATTTACCTTCATACCTCTGTTCAGCTGCATCGCTTTAAACGGTTCCACCTTCTAATGCTGACTATTATAATCATTTTTACGAACTGATATTTCAAGAAGGCCTCTGAATGCTCAACGACTGCGATAAGGCTCTTATCCAGAATTGTCATTGCATACAAAAACAGCACGAGTTAAAACAGCGCAGTCGCCACCGAATGTCTGCATCTGCACGATAATATTATTGCTTCTCTTACGTACACTTTCCACATGCAGGATTTGAATCTCCTTGCATCTACTGGGAATGAGTTGCAATTATAGCGTCAGGCCTGCGCATGGTCGATTCAGGCAAGCGCTGTCAAATTAAGTCGTAAAGGGCAGGCAGATGAATCGATGAACTACTTGCAAATGAAGGCCGACCCAACCTTTCGCAGACGACTCTAATCTTGTATAGTAAAGAAAATGCATGTTGTCCCACCCTTCGAAGCATATATTTCTGAGTTGTCATAAACAATTTAGTGAATTATCATCGTCCATTGAATCTTATTCATAGTCATGTTAACTCTGTCATGTTAGAAGGGAGGCCATCTATGCGAGTCAGTGCAAGTTTCACTATTAGTTTTGAGCTTCAAGCCAGTTGTCTTTTCTATCTACTCTCATACAACCAATAAATGCTATGAATGAATTCGCATGGAGATCGCCCTACTTTAAACTATTGCTGGCAGGCATTCTTACGAGTCCAATAAAAGTATTGTACGTGTCCTGGTCGATAGTGTTAGGAGGATAAAGGATCAAATGCATGAATAGAAGGCGAACAAGCGATGGAAAAACTGCTTTGGCATTCCGACGTAAGTCTATTATTTTCAGAGAAAGATGCCGTTTTCTGCTTGTGATTGCATAATCATTCCATTCAAATGTTGTTTACCACCATTCCTAGGCCGATAAAGCATGAATGTTCGGTCGGCAGGGAATCGACCCAGTGCACAAATATAAATGCGATGAATGCCCAGCATTTTCTATTAAATGAAGATGGAAGAATGGACAATTCTGGCAACCATGTTAGACTAGTGCGAAATGTCTTAATAGGAATTTCTGAAAGAGTGTGGCCCACCATCAAGTGTTAAGGACGCTTTCATTTTCAATGTCGGCTAATGGCATATTGCTACTAAATCCCGATAGCTTTAAGAAAGGTTGACTTGTTTAAACCATCGCTTAATTGCTAGATTAACATAGTAGTCAATGCTTTCACAGGAAAACAGATTTTAGGGAGTTGACTGAATTTATCAGCTTAATGAATAAGTGCTTACTTCTTCTTTGGCCCTAAATACAATTTTAACATTTCGATATTTCGCAGTGTTCACCCATGCCTCATCAAAGAAAACAAGTCACATAAACATGTAACAGGAAGGTCATTCCAACCATCTGCTGGGAATGCGCTCTTTTTCTACTGCAGGAATATACCCCGCCTTTCGGACAAACTCCAACATAGTAATGGCTTAATTTATTAAAGACATGGCAATTTATTTGGCGGCAACAAGAATCTCTTTAAGTTACTATGTGAGTAATTTTCCATGTAAAAATGCTATATTGAATGACGGGGCATCGTATTAGTTTTCAGAGTTTAGCTTTCTGCCTTCCTTTTACAACCCGCCTGTGCTGCATCTTTAATGAGTGCTAAATGTTATAGCACCCGATATATCCTATCCATTGAAAACACTACATGAGTGCCCTGGTCCCTACGATCCGAAGGGCGTTGCACAATACTAATAAGGCATAGATAGCCACGACTTCGTAGCCATTTGCCCTGATTTAACTTCCCTCCTAGGCTAACATAAATTCACTACATTATGGCGGCTGCATCCGGGTGTGGAAGTCGTGAAAGAAGGAGGTCAGCTGCGTCGTTTGACAGACATCACTGCATATCTTCTGTATAGTGCAGTCGTCGGCTGGGCGGAAGCACAATTGTTTGCACTGGCATTGCGCCCGTTGTGCTTTAGCCTCCTGGCGTGAAGGGTTTGATAATGCCCCGGAAAAATGAAGACAAATCAGGGTGGGCATGCTGTGCGAGTAGCCTAATACAGATGGCATAGTACTTCATAGTGACTGCATATGTTGTGTTTACAGTATAGTCGGTATGTTGTCCTGCAAAATGACATTTAATAGTGATATTTATATCATTTTTACGTTGCTTTCGACGTTAGCGTGGCAGTGAGGCAGTCCAAATGCTTATCAATTGTGCATAGAACAGGTACTACCGTCAAAACAATCAGCTTTATTTTACTGTTCAATTGTCCCATTCCCTGCCTCTGTCATCACGATACTGTGATGCCATGTCCACTTAGCGAGAATGTTGGACAGCGACTGCTTATCTGCCTGCACAGTATCTTGCAGACAACTGCACTCGTGAAAGAGGCATTCTAGTCGAAGGAAAGATGCTTTGTTTTCGTGCCGCATAAAGCCCTGATACTCTCTTATGATGAAAGCTGCTTCACGTTACCGCACAGGCTATGCAATGCTCCTCTTTCTCAAGAAATGCTTTGCATTTATCAATGTTTTCCTTCATCCATATTCTAAGAGTAATATGCAATGCTGTCCAATGGCAATTGCCTGTTTTGCCTGTTAACAGACATATCCATCCACCATACCACAAGCTTCATTTCGCATAAATGCCCACTCGTTGCCCTGGACACAGTGCCATTGCAAGTCGCCACCTGGTATGATTCTGCTGCATCAATTTCAGATCCGTCAGCCATCGTAAGTCTTGATCTCCTATCTCACTTTGCTGCGCAGGTGGCAGCGACATGGTTTGTGTGTTAGCCTTGCACCTATTGCGCCTCGGAATGCATCAGCTGAGCATTTACGTACTTGACTGCTGCGATGTGCCTCGTCTATCCATTGAGCATTGCTGCACATTCTTTTGGTATGTGCATATCAGCATCAGGCATACGCGCTCCTGAGTGTGCTACTTTGCTCATGTAATTATGAGTGTCTTCCTTGCTTGACTTCCTCTGCTGGGCCAGGATTTTCGTCGATCAAGTGCCATGAATGGACCTTAACGTGGAATTATCACTGTTGATTCCGCCTGTCAGAGGCTTGTGTTGGTCGGCAAATAATGCCGAGCTTTGGCCTCTTACCAGTGCTAGTACATTGCGATTCATGTTCCTCTAATCCAATGCGGCCGTTTGGGCGTGCTGCTGTAGTACCCAGTAATCCATGTTTCTTATAACAGTTGAGGTAAATCCCGGCTGAGTCGACACTTCTTCCCATTTTCTATCCTCGTCAAAGGCCTGTTGGGTCCATTTAAGAGTCAACCTTTACCCTGATTCGTGGAACAGAGCTCTCTTCCCACTCCTTAACGCGCTTAGGAATATGCGTCGCATGAAGCCCGGAACTGTTTCAAGGGTTCTGCTTCCTGAGGCGTGCGTTTCTACTCCTGACAGCATAGTCATGAGACCGCAAAGTCTCCGCAAATTACACGCAAGAAAGCATCAGGCGCTTAGTTCTTTCGATTCTTCAATTGAATATTGGTTACGTCTGCATGTGCTATGCGCAGAGCTCATCCAGTGGTCGTAGCAGGTCGTTGATGTTCTCCGGTTGCCATAATGTTGAATGGCTCCATTCCATTCTAGGTGCTCGGAAGTGCATTTATCATCCCAAAACAAAACCGAGGGTAGCGCGATTCAGATAAAGAATCCCCGCGAGTGCAGGATGTTAGTGAGCTGGTCATTTAATCATCTACTGTTGTAAGAGAGGCAAGAGTATCGTTTCCGCCCATTCGGGTGAGCATAATTTTGCGGTAGTTCATTTCTGGCACATTGCAGAATGGGCGACTTTGTCTTCATTAGACTTACATCTTCATGGAATATTGTATGCCTGACTGGCTCTCATGGGGCACATAAATAGTCTTCGTGATGTGCATGGAGACACAAGACAAGTCGGATCGGCAATACTTTGTTAACTAGTAATCAGATTCTAATCACATAGGTTGTACTAACTCCTTGGCACTTATGTCCGTTTCACTAAACTAGTATCGACGCAATGTTTAGTGGGAAACAGACCATAAACTCACAACCCATGTTCGATGAGGTCATCATCGACAGCAGATACTCTGGCATACGGCTGTGAAGGACGCAGAATTGCCGGCATTTCAAGCGTTATCTTGTTGCAAAACTGAATGCACCTCCTTTGATGCGATGCCAGCGTCAGACATGAGTGAGAGGTACGCCTGCATCCTGAAATCACCCATCGCGACCCCAGGTGCACTGGTATCCTCGTCAAGCTGGTTAGGCCCATGACTGTTTAGCATTAACTGCGCAGAAAACTCTTTGCGAGTCAGTGCAGATTAGTGACACTGGAGTCTTCCAGGGATGGCGAACAAGAAACTATTCCTTGCCGGATCGTTGCTTTCCAGTTAGGCATGCTTACTCCCACCCCTGAGATAACATGTTCGTAATACTCACGCTGCTCGTTGAGTTTGATTTGTCCTGTTTCAAGACCATAGGAAGTATTTCCACTGTTAGGCAAATATCCTGGATTTCCTGGTCGCGGCTGTTTGAATGTATGCATAGTTCCTTTCCGAGTTCATCCAGCAGTTCCAGCACAATGCATGTTGGCGATTCATGGAAAATGCGTCAAATGCGCAGTTAGTCATGCATTGCCTGCTCTGCCGCTGCCGCAGTGCCTGAAGAGTTAATTTCGACTCATTTCGAACCTCCTGTGTTCACTAGTTAAGATCCTCCTGGCAATGCACAGTGCATACGACAGCGGCGATTCGTTCGCTCTGCATCCACGCCACAGCAACAATGAATACAGCCTCATGGTGGTTCAGGCGGCATGTCCTTGCTGTGCTGTAATTCTGCTGTGACTTCAAGCTTTCATCCTGCAGGCATCCGACTGATGTTAATGATTGTTGAACCTGTGAAAGAAATGGCTCTTTGGTGCTCCATGCGGACGTGCGGCCTGGAGTAGTGATAGCCATCAGTTTAG
>63
GTAGTAACCGTGGGAATGCTTTACCGCACTATATGATGCCCGGCTATGCACTAGGGTTATGTCGGTACACCGGGCAGCATGGCAGACAGCCGTCAGAGCAGGCTTGGCACGAGTGGCAGAAACAAGCGCGGCTGGATCTACTCGCGCCGCAAAACGGGATCAGATAGGTCCGGCTGCTCTGAAACCGGGGCGGTATGACATGGCCCGCACGCTCCCGTTGAATTCATTTCAGACAGATGCGTGATGGTGGCCTGTTCTCCGGCACGATGACATCTATTCGCTGGGAAAGTGAATGGCGGTATGGATGTGGCTTGCTTCCTTATATCAAGAAGCTGCGCTTTGGTGATGGCTATTCTCAGCGAGCGCCTGCCGGCGGGCTGAATGCCAACCTGAAAACGTACAGCGTGACGCTTTCTGTCCCCCTTAGGAGGCCCACCGGTACTGGAGTCGTTCTGAAGGACGCACGGGGCTGGAAATCCTTTCTGTGGACGCTTATGAGTGGCGGCAATAAATATACTTTAAAAATGGTCGTCTCCATAGTCGCTGCGTGTTAGTATTCCTCGCAGGGCGTGTCGGGCACTGACGGGCGACTTAAGCAGGAAGAGCAGGGATGGAAATGAAGGAATGCAGGCGGGCGCAGCCGTGGTGCTCTCAGGAAGCGACCTGACAGGTTACTTGAGAACCGTTATGTTTGACTTGGTAAGGCCGGCTGACGAAAAGTGAGCCGTTAGCTGGCAGGGGGACATATCAGCCGTATCCCATTCAGGGGAGCGGTTTGAACTGAATACTTAAAGGCACCAGTACGCGCGCCTGTGATTACGGTTCTAAGCTCTACTGTACGGTATGGTCACCGGGATGAGGAAGATATGCAGAGTCGGATAGTCGTCGAAACGGCGAGCGTCAATTTACTACGCCCGTTTTCTGGATGCGGTAACTTCGTCACGGAAACAGTTACAGCCGATCCGGAGCCGGCGGCTCTTAGCCTGGCCATGCAGCAGTGCAGCGAACTGAGCTGTAGTGCTCCTTTGTACTGTCCACGCCGACGAAACGATGAGGGCTTTTCCGGACGTATCATGCTGGCCAACACTGCAGCTACCTCCTATCGCGGTACCCTATTAGGTTATCCAGCGTCTAGCTGTGCTCACCGAAGAGGCAGCACCCAGGGAGCACGTGAGATACCCACGAGCACGATAAATGCAGCAAATCGCCTGAGCGTTGTAAGTTCCGCATATAACGTCGGCATGGTCAGACCTTCCTTTCCATTAACAAACTTTCTAAGTAATCCCATGACACAACAGAATCAGCGATTCTTAGCACGCCCGGCGATGTGCCCTCAGTGTATGTCCGGCTTCGTGGTAAGGCCCGCACCGAAGCCGGCTGATTTTCCTGCCGTGAATATCTCCGGTAAGCAGCGGCTTATTTCCGTGGTGTCGCCGGAAGACTGGCTGCAGTAAGCAGAAATGCAGGGTGAGGTATTGGCGCTGTTGCCCACTCACCCCCGTGATGCCTGGCTGAGTGAGGCCGACCGCTGGGCGGCTGCAGGTGCAGTATTTGCCGTGGCTGGTCTGCCGGGGGACGATTCATAAGTTCTATGTGTGCCGCATCGCCAAACCGAGCCTTTGCTTGAGCACGGTGACGGACTGTTACACCGTTCCGGGATGCTTATCATCTGGCGGGGATCGAGATCCGAAAGTGCGCCGGCGAGGATGACTGGTGGCGTAACTACAGAATCTCTATCTACAGATCCTTGGAGGGACGGGCTGTATCAGGTCGCCGTTGTCAGCGAGCGCCTCGGTGCGCAGTGCTGCTGTGCTGTTTGGTTGCATCAGTGCCGAATCACGCCTAATTGGACTGCGGCCGAACCGAGCTGAGCGATGCACCATATTCCTGAACAACTGAGCAAACGAGAGAGGTACACCATAGACAATGGCAAGCGACGCACACTCCCTCTGGCGTCACCGGGCATGGCGCATCTGCCTTTACGGGGGATTTACAACGATTTGGTCGCCGCATCGACCTTCGTGAAAACGGGGCTGACCGCTCATCCGGCATGGCCACAGCTCCCGGCGTTTCGGTACAAACTGAGCGACGGCTGGTATCAGGTACCGATTGCCGCGGGACGTCAGCACGTTAGTTAACGGGGCTAGGGCAGAGTTACATGAGACTCTGCCTTATGTGGCCTGTACTCTTCGACTTTCCTAGAGTCGCCGGCCAAGTCAGGTGTATTCCAGTACGGCATCTGGCTCGCAGAGCCAGCCGAGAATGTATCGAGCATGCTTACCCCAGCGTGCAACCGCAGCAGCCGTGATCACATTGGGCAGGCTGAATGGCATGTTTCTCTCGCTGTCAGTATGGTGCTGCGTGGTGTGAGCAGATGTAGCTCTACCGACTCAGAACTCCCGTACAGACAACGTAATAACG
>64
CACCTTGGGGTGGGTCTGTTTAACCTAAGTGGTTGCATTATTGCTACACGATTGCGTGCATCGAGTAAGTCGCTTAATGTTCGTCAAAAGGCAGAGAGCAAATGATGCAGATGAACCTCTGGTTCATGAATAACCCTAATCAGACCTTTCGCCAACGACATCTACTAATCTTGTGGTGATAGTAATAAACAATGCATGTCCAGAGCTCATTCGAAGCAGATATTTGTAGGATATATCAGAGAAACCAAGGGAAACCCAGCGTCACTTGAATCTGTGGTTCATTACGTCTTAACTCTTCATATTTAGAAATGAGGCTGATGAGTTCCATATTTGAAAGTTTTCATCACTACTTAGTTTGATAGCTTCAAGCCAGTTGTCTTTCTATCTACCTCATACAACCAATTAATGCGGGCATGCTCCGTTCGCGGCTTCCCCTGATTTTAAAACTATTTGCTGGCAGCATTCGTGAGTCCAATAAAGTATTACCTTTTGCTGGGTCAGGTGTTCTTTAAGAGAGTAAAGGATCAAATGCACTAAACGAAACCGAACCGGCGATTGAATATCCTGTCGATTCTGTACTGGATAAGTCTATTATTTCAGAGAAAATATTCATTTTATTCTGGGTTGGTGATTGCACCAATCATTCGATTCAAAATTTATTTACCACCCATTCCGCCGATAAAAGCATGAATGTTTCGTGCCGGGCATAGAATTGGACCCGTCACCTCAACGTTAAATCACTGAATCCGGCACTTTTCTATTAAATGAAAGGTGGAAATCTGACAATTCTGGCAAACCATTTAACACGTGCGAACGTTGAACGCGGAAGAAGAGTTAGGAAGCCGAGGGCAGGCAATGTTAAGGACGCCTTTCATTTCAATGTCGAGCACCGATTTGGCCATACTACTAAATCCTCGCATCGCTTCCGCATAATCTGTCCTGACGATGCTTAATTTGCTGAGATTAACATAGTAGTTCAATGCTTTCACTAAGGAAAAACATTTCGCCGGGGGTTGAATGAATTTATCTATTAATGAATAAGTGCTTATTCTTCTTTGTACTACAAAACCAATTTAACATTTCGATATCGCATTTTCACCATGCTCACCGTAAAGACAGTAAGATAAACATTGTAACAAAAGGAATAGTCATTCCAACCATCTGCTCGTAGGAATGCCTTATTTTTCTACTGCAGGAATATACCGCCTCTTTCAAGCACTAAACTCCAACATATAGTAATGATTTTATTAAAAGGACCGCAATTTATTTGGCGGCAACACAGGACTCTCTTTTAAGTTACTGGTTACATACGTTTTCCATCTAAACGGTAGTAGTGATTGAACTTAACGCGCATCGTATTGTAGTTTCCATATTCTACAGCTTTCTGCTTCCTTTTACACCGAAAATCATGCGAGTGGCGATTCGCTCCGCATGCGGGCTTACACCGAGATAGTCTATTAATGCATATAGTATCGCCGAACCAATTAGCTCTTCAGGCTTCTGGAAACCGTTTCAAATACTAATAAGCCCGATAGATAGCCACGGACTTCGTAGCCATTTTCATAAGTGTTGACTTCCTTATCCGGCTCATAACAGACATTCACTACAGTTATGAGGGGGACCCGTATGCATCCTGATGTGGGGGAGGTCGTACCGTGGAAAAGAAAAGAAGAAGTCATGCTTTCGTTTGACATCACTGCTATCTTCTTACTGGTTATGCAGGTCGTAGTGGGCACCCTTTGCACTGAATCCAGGCATTTGTGCTTCTCTGGGGATGCGACCACGTTGCTTAAAAGAATTAGGGCAAGAAGACAAAAGTACCTTGCGCTAATCTCTGTTACAGGTCACTAATACCATCTAAGTAGTTGATTCAGGTGACTGCATATGTTGTGTTTTACAGTATTATCCGTCTTTTATGCAAAGCTGCCCGTGGGTGGCTCTTTATGGCCTTTTACGTTTCTCGTTCAGCTTTTATACTAAGTTAGGAATATAGATACAGAAGTGCATTGGGAGTACTTATCGAAGGAACAGGAGGTACTATCAGTCAAATAAATCATTATTTGATTTCAATTTGTCCCACTCCCCCTGCCTCTGTCATCGCACGATACTGTGATGCCATCGTGTCCACTGTATGCCCGAGAAGATGTTGAGCAAACTTGTATCGCTTATCTGCTTCATAGAGTCTTGCAGACATAAAACATCCAAGCGTGAAGGTAGGCGTGGATTCGCTGAAGGAAGACCTGGGCGATGCTTTTCGTGCTAGCGCATAAAGCCCTTGATACTGTGCCGGATGAAGCGGTCGCGACGAGTAATGCAATTATGGTTTCTCCGCCAAGAATCTCCTTTGCACTTTATCAAGGTTTCCTTCAGTGATATTCCGAGCATCAATATGCAATGCTGTTGGGATGAAATTTTACGCCTGTTTGCTTTGATAGGACAGAATATCCATCCCCACGTCTAGGCCTTCATTTCGCATAAATCACATACTCGTTGCCCGGTAACAAAGCCAGTTCCATTGCAAGTCTGAGCCAAATAGGTGATGATTCTGCTGCTTGATAAATTTTCAGGTATTCGTCAGCCGTAAGTCGTATTCCTATCCTGATTTGCTCCGCGAGTGGCAGCGACATCATTTATATCAGGAGTATTCCGCAATGGCGGAATGCATCGCTGTTATTATTAATCATACTAAAGATCCGGCTTATGTACGGTGCCCCTTGCGCGGTTTGTTCTTTGTACTTAATGCAATTGCGTGCGGTGAGCGCCGTATCAAGGCAGACCCCTCCTTATTGCTTTAATTTGCTCATGTAATTTATGAGTGTCTTCTGCTTTAATTCCTCTGCTGAGGATTTTCGTAGCGATCAAGCCATGAATGTAACGTAACGGAATTATCAACTGTTGATTCCGCTGTCGAGGCTTGTGTTCTTCTTCGGCAGGCCTCCGACCGTTGGCCCGTATGCTTCAGTAATGCGATTCGCCTGTCTCTGCCTAATCCAATCTCCTTTACCCGTCCTTGATCCCCTGTAGCAGTAATATCCATTGTTTCTATATAAAGGTTAGGGGGTAAATCCCGGCGGCCGTAATGTCGCCTTCTTCGATTTCTAATCCTCTTCAAAACGCCCTGTTACTGTCAGCTAGATTTAAGTCAACCGTTAGGACTGATTCCTCGTCGAACAGATACTCTCTTCCATCCTAGAGGAAGGGGGAGCGGGATATCCTCGGAATTCCGAATGACGAACTGTTCAAGGCTTCGTGGACGTCGCCATGGCGTCGAGTTCCACTCCTGAAGTGTCAAGTACATCGCAAAGTCTCCGATCCACGCAAGAAAAACCGCACCCATAGGCTTGGGTGTTCTTCAGTTCTTTCAATTCGAATATTGGTTACCTGCATCTTTTGCTATCTGCCCATATCGCTCCGATCTTCTGCCATTCGTTATGTTCTTCCCGCTTCGATAACTCTGTTGAATGGCTCCATTCCATTCTCCTGTGACTCTCGAAGCGTCCATTTATCATCTCCATAAAACAAAACCGCCGTAGCGAGTTCAGATAAATAAATCCCCGCGAGTGCGATTGTTATGTAATTGGGTTTAATCATCTATATGTTTTGTGTACAGAGAGGCAAGTATCGTTTCCACCGTACTCGTGATAATAATTTTGCACGGTATCAGTCATTTCCGCACATTGCAGAATGGGGATTTGTCTTCATTAGACTTATAATGATTCATCGAATATTTATCCACTCTATATCTATTCATCTACATAAACGAAGCGCGTAGTCAGGCACCGGAGAAGAAGAAGCACTGGGAAGTAGATAACGCCCAATCTTTTGCTCAGATTCTAACTCATTGATACGGTTTTATAAACTCCCCTTGCAATGTATGTCGTTTCAGCTAAACGGTATCAGCAATGTTCTGTAAGCAGGCGATAGAGAGCTACTCAACCGATGTTTGAGTACGGTCATCATCACCACAGACCTGGCATCGCTGTGAAGACGACGCGAAATTCAGCATTTTCAAGCGTTATCTTTTATACAAAAGTACAATCTCACTCTCCTTTGATGCGAATGCCAGGGTAAGACATCATGCAGATACTCAGCTGCATCCTGAACCCATTGACCTCCAAACCCGTAATAGCGATGCGTAATGAGTGTCGATAGTTACTAACGCCTTATTTCGATTAACTGCACGCAAATTCCTCCAGGTCAGTGCAGTGCTTGATAACAGGAGTCTTCCCAGGATGGCGAACAACAAGAAACTGGTTTCCGTCTTCACGACTTCGTTGCTTTCCAGTCCCAATACCGCTTACTCCCATCCGATAACATTCGTAATACTCACGCTGCTCCGTTGAAGTGGCTTATCTCCAATGCAGGAATTACTTCCCTACTGTTAGCGCCGCAATATCCTCGTTCTCCGTGAGCGGCGTTGAATGTATTGCTCTTCCTTTCTCCGTTCCCCTCGCCGTTTCCGCCGGCACAATCGATGGTGTTACCAATTCATGGAAGGTGCGTCAAATCCCCAGTCGTCATGCATTGCCTGCTGCCGCTTCACGCAGTGCTCAGAGTTAATTTCGCTCACTTCGAACCTCTGTTTACTGATAAGTTCCAGATCCTCCTGGCAACTTGCACAAGTCGACAACCCTGAACGACGCACCGTCTTCGTTCATCTATCGGATCGCCACACTCAACAATGAGTGGCAGATAGCCGGGTGGTTCATAGGAGGGGCCTTTATTGCTGTTGCGCTGTAATCTTCTATTTCTGGTGATGCTGAATCAATGATGTGCCATCTTTCATTAATCCCTGAACTGTTGGTTAATACGCTTGAGGTGAATGCGAATAATAAAGGGGAGCCTGTAGCTCCGTGGATTTTGCTTTCATGTTCATCGTTCCTTAAAGACGCCGTTTAGGGCCAGGCGAAGCAGGAACTCCAGGCTGGAATGGAGAGGCGAAATCCCGTTCATTCGGCGCATTCGGTCTTCTCCACTAATCGCTACGGCAAATGTTACGACGTTTTATCCGGAATATGCTGTCTGGCTTTTGATTTCAGAAATTAGCCTGACGGGCAATCGGTGCACGGCGTTTCCTGCATGAGGTGTCATTGAACAAGTCTGTACCATCTTTAGCAAGCATAAGCACAGAATATGAAGCCGCTTCAGAAAATCGCATTCCGTGGTTGTCAACCTGGTTTCTCTCATCTGCTTCTGCTTTCGCCACCCATCATTTCCAGCTTTGTGAGACAGGATGCGGCTAACGTATGAAATTCTTCGTCTGTTTCTACTGGTATTGGCACAAACCTGATTCCAATTGAGCAAGGCTATGTGCCATCTGCGGAGAATACTCGTTCTTAACTCAACAGAATGCCTTTGTGCATACCACCCCTCGTTTATTTCTCCTCAGCCAGCCGGTGCTTTCAGTCATTTCGGATAACAGAAGATTCGGGAAGCTCCCCATCCTCGTCTGCACTCGAGTAACGAAGGTCAATGCGCGACCCGAGATATCAGCGATACACCGGAGTAGGATGCGCCGAGTCGCTCCCCAAATACAAAACCAATTTCAGCCAGTGCCTCGTCCATTTCGATGAACTCCGAAGCACGTGATTCGTCAAACGCCATGTGGATTTTTCATCCGCTCAATCACGACATAATGCAGGCCTTCACGCTTCATACGCGGGTCAGCTTGTAAACAGATACCAGAGCGCATTTTTCGCGTCACCCACATGCGCTGTGTACTGCAGCTGGGCTTAAGCTGACTTTATGGCCTCGAAACCACCGCCGAAGCCGGAACTTCATGAATCCCGGGAGGTAAACCGGGCATTTCAGTTCAAGGCCGTTGCCGTCACTGCATAAACCATCGGAGAGCAGGCGGTGCATAAGGGATACCTTCCTTCGCGATAGATTACTGGGATTCAGTAACATTCACCGCATGAATTTCAGACTCAAGTCTGGCTTCGTTCTCCTGCTCTGTTTCCCCAGCGAGTGCTTTAGCGTTAATTCCGGAGCCACCCGGTGCAACCTCAGCAAGCAGGGTGTGGAATTATGAGAGGACATTTCATGTCAGGCTCATTCTTTCGAGCGGGGTTTGCTGCATAGGACTGGCGAATCCGAGGTACGGAACGCCCCGAGGGGTGGTAACTGGGCACGCATCATCCCTGTTCGAACACTCTCACATCTAATCCCGGTACGCTGCATGATAATAGCGTCCTTCATGCATGCCTATTCTGCTCTGCGGCTTTCTGTTTCAGGAATCCAAGAGCTTTAATGCTTCGGCCTGTGTCAGTTCATGGACGATGCACGAATGTCGCGGCGAATATCTGGGAACGAGCGGCAATAAGTCATCCCATGTTTTTATCCAGGGCGATCAGCAGTGTTAATCTCCTGCATGGTTTCATCGTTAACCGGAGTATGATGTCGCGTTCGTTCCGGGCCATGACGTTCTGCATTATGCAGTATTTTGGACAATGCGGGTCGGCTTCATCCTTGTTAGGGTCGAGCGAGATCTCGAAGCGACGGGCACACTGAATCATGGGTTGTGACGTAATATCCGTTGGATGCGACTGCCAACCCCGTGATTTCTCTGCCTTCAGTTTGAATGGTTCGCGGCGGCATTCTCATCCCGGTCACCGGTAACGCAGATCGATATTAAGGTCGCGTGGGAGAAGCGGCAGGAGATAGGAACTCATCATTGGTCGTAAAATTTACGATGCCATCAACTGCTGGTTCATTGATGATGCGGACCAGCCATCTCCAACGCCCACCACGAACGATGCCATTTAGCTTATCAGGAAGGCGTAAATTTCCTTTCGTCCACGGATTAAGGGTTACTGGGTCGCAACGATCAGTAATGCGATGAATCGGAACCCTCATGGCATCAGCTTTAAATCCGTTGGCGAAGAGTGATCAGTTCCGTGGGTCGTACCGAATCCATGCCGACACGTTCAGCCAGCTTCCCATACCCGGCGTTGCAAGTGCAGAGAACCTCATTCGTTTGACCTCTGAATCAATATCAACCGTTCTCGCCATTCGTTTCACGGTGTAGCACTGCTTTCCCTGCGCTCCTGAAACTCAACATCGTCATCAACGCACGGTAATGGATTTTGCTGGCCCGTGAGCGGCGTTGCAAAGCTCAATCGATGCACCGAATTCAAACAGGGTGCTGGGGCAGGCCTTTCGATGTCGTCCGTTCTGCCTCTTTCTCTTCACGGGCGAAGCTGCTGGTAGTGACGGGAGGAGCGCATGGAACGAGAAGCGGCAGAAGGGCGATAAGCAGCGTTCATGGCTGAACTCCTGAAGTAGCTGTGAATATCGCCCGCGAAACCGCCGTCGATTAAGGAAAACAGGAAGGGGGAGTTAGTGAATGCTTTGCTTGATCTCAGTTTCAGTGGTTAATATCCATTTTATAATGGTGACGGCTTCACGAAACATCTTTTCATCGCCAATAAAAAGTGGCGATAGTGAATTTGAGTCGTACCTCATAAGTGTTTGATCCATTCTTTTGGGACTCCTGGCTGATTAAGTATGTCGATAAGGCGTTTCCATCCGTCACGTATGCATTCGGCCTCCTTCGGTTTCCATGAGCGTCGAAGGGCGAAGCCAGCAACAGGCCCCTGCAATGGCGCATATTGCATCGTCGTCCTCCTTATTTATACATAACGAAACGCCTCGAGTGAAGCGTTGATGCGGTAAAACCGCACTCAGGCGGCCTTGATAGTCATATCATCTGAATCAAATATTCCTGAGCTTATCGATATCGGTAATTCTTATTTCCTTCGCTACCATCCATTTGGAGGCCATCCTTCCTGACCGTTCCATCATTCCATTTGAACTCACACAACACCATGGCAGTCGCACTCAGGAATTGGCAGAAGCAGCATGTTGCGCCAGCATGATTAATACAGCATTTAATACAGAGCCGTGTTATTGAGTCGGTATTCAGAGTCGACACCAGC
>65
TCTTGACTTGACGGGTCCAAACGGATGCACGTGGCTGCATTAGACCATTATTGGTCGTTTTAATACCGCAGGAAGGTGTAAATTCAAGGCAGGAACGGAACTGCCGATGGAAAGCGACATCTGGAATGCACCGGGATGACGACTTGACGTTGGATGGGATAAGGGGGTCGAAGCACGTCATGAGCGGAACTGATCTGGTCCGACAGTTCTTGCCGCTTGAATGGAGAGCTCAACGACAGAGGCAGTAAAGCTGCAGCGACGGCCGGCCCGGATGCAAGAAGCAGCGGCATCTCCGAAGCCGTCTAACGGGCAGCTCCTCCCCATGAAGCACAGAAGGCTTCGCACCGAACGGGCGGGGCGCTGGAGCAGCCTCCGTGACCGCCGTCGGAAGAGTAATAACGGAAGGGCACTACTCAGGGCTCGCCGGGGGAGGTTGGCTGCATGAAGGGTTATAAGCCCCGACCTGGTGAAGCGGCGAGCCGCGGTCGCATGAGGCCCTGGAGACCCCCGGCCCGTTGACAGCGTAGTGCAAGGTGTCTGCCACGGGCAGAATCGTCAGGAGCTAATTAACGACTTAATCGACGTAATGGGTTCAGGCGAACGAGCTGAAGTTCGAAGCAAATCGAGCAGGTATCAGGCAGAAAATCAAACAGATGCGGGGCCGGCGCGTGTTGTGACGAGATGAAGAATCCGTTGACGAAATCTGGAGGGGACGCGGCTTCTACCCCCGGACTGTGCGCCGGAAGAATCTCATGCCTGCACCGACGCCAATGAAACGATACTCGACCCCGAGCTGGCTGCTATTGGCTTAGCCCGCGGATCGTATCGGAAGCACGGCTGGAAAGGTGAAGGCGCGAGCGGCAGATAGTTCGCAAAAAGCAGCAGCCGGGCCAGCTCATGCGCTAGGATCGCAGGTCGAAGGTACGCCGGCAATACTCTGAGCAGGCGGAATGGGAAATGAATCCCGCCTGGAGGGATACGTATGGCGCCGAATAGTCGGGCTGGATAACGTCATGTCGCGGCCACAGCAGACGACTGGAGCCCTGGTGCGGCTACCCCGGAGCATTCAGCCCGTAGGAATTAACGGATGGCACCTGAAGGTCCGGCTGGAATGGATGGAAGAGCAGCGCCCGGCTGAACTGTATGTCGCGATAGATCCCGGTCGCGATCCTTTGGACTTGCCTACGAAACTGGCAGCGATGCTGATCCGGCAGTGATCAGCATGGCGCAGCTTCACCGAAGCCGTTCTCCGTTAGGTTCTCGACTCATGACGACGAAATGTCGTCCTGCCTGAGACGAGATGCTTACGCATTGTCGTCACGCATCGCGGGCCCCGGCCTTATCAGGCTGGTCTGCGAGCACGTACGCCACGTCGACCCGAAGTCATAGAATTCAGCAAATGAGTCCGGCGGTTCTGCAATAATTTTGCACCTGACCAAATCCATGAATCAGAATAAAGCAGCGACTCTGAGCACGCCGGGGATCTTGTGATTTCACCGTGTGGAAGTTGTCTTCCGCGGGAAGAATATCCGGCACTTGGCGTGGGGGAATCTTTATCCGGACATGATGCATGAAAGGGCTACTGCGTGCGCTCCGGCGGTCTCCGTTCGTAGCCCGGTGCAGCTAGAGCCGGCTGGCAGCTAGCCGGATCAATCAGTCGCGGCGGCGCGTCCGCCTCGTTGAAGCGAACTACAATGTGATCTGAGCCTGAGGCATGGGATCGAGACTCTTAAAGTGCCGGCTGCTCTGAGAAGCCGCGATAATGCGTGACGCTGGCCAGGGTGCCCGTGATGAGGGTTCGAGACGCCGCTGCGTGGGTCTGGACTTTCCGCAATGACGCTCTGCAATATATTCCGGGCGACGGGCAAACCCAGTACCCGACAAATCTTGACGTCGGTTACATTCGTAGGATGCTTTGGCATCGCACTTCTCAGCGGACGGATTAAATCGATCGATGCCTGCATGGATCGCGACTCGTTGAAGGGTCCTACTGGATTTCCCGTCATGCCCGAATCCGGGAAGCACTAGATAACGATCGTTTATACGCGCGCCTAGAGCGCTGGAAGCCATTACTCTATTTCTGGTTGGGGCCGCCGTATGGCTCTCAGCCATTCTACCGCTCTACTGCCGCTATCGTTCCCGGGTCGACTGATTCGTTCCCTTGAGTCTTCGATTTAGGCAAGCCAGAATTCCTTGAACAAAGGTGAACCATGATTGCAGGGATATCCCCCGGCAGGAAGCCTGGATGGGGTGAATCTTGGAGACTCGAGTTCAGAGCACGTTCAACGAAGCGTGATTATGGGCGGGAATCACTCTCCCCGCAAAGGTCCTTGGAACGCTTCCTTTTTATCTATGAACCGGGCAAGGACTAAGTCACTGGCAGAGCAAGGCGACACTAGAATATCGACGCCGTATCCGCTTTACGCCCCGAAAGCGGTTTGAATGAAAGGCAGCGGTGCACCGCTAAATCCTCGTCGACGTACGCTTATTGCTCTACGCTAGAACCAGGATATGCGGATCTTGCTCGAGGGTGCAGGATTCCCGGAGCGATGAATCGTGTACGCGTTTACCGAAGTGCAAATGAACCGTTGCCGTCAACCATCAAAGCGAAGGAAGCGTTTAGCCGATTAGAGCACGAACTAGCCTGACGAAAGAAGTCAGCAGTGCGAGCGATCGCATCCAGTGCACTCGTTATCCTGTCTCACGCCGACGGAACATCAATACTTGCAGACAAATTTTCAGAGCTCGTGAAACCTGCCTGACTCGAGCTGCAGCATATGCTGACGCATCTCAGTGCAGTTAGCATTTAAGGCTGTTCTAGGGCGTATGCATGACTCTGACCTAAGCAGACGGTTCGATATCGACGACGAGGCAGCAACAGCCTGCAGGCTAGGTGCGGCTTTGTAGGTTCTAAGGATAGCTTTACTGAAATTTGAGGGGTTCCTTTCCAACTTATGAGTATTTTAGAGTTAATCCCAATACCCCGACTAGGAATCAGCGTACCAGGGGCATTGCCCCAGTACAAGTCGTGCATTCGTGGGCCGGAGGAGGGAGATGTCTCTACGGGGTGCGTTGAGGTATGAACCAACGGAGCAGTTTCACTAGTTATGTCACCACGAATAGTGGATCAAGGAGAAGGTGCAGATTGGGGGTTGGCTAGTCAGCGAGGGTCACCCCCATGCGTGGTGCAACAGATCGATGGCTAGGTAAAGCATCGGGCAGGTTGAAAATGGTTGTAGATTATAATCAGGCTAAGATTCAAGTTCTCATGTTGTCAAGGATACCATGCAGCCTTTTATTTGGAGCACATTGTAGCTATGTTGAAACAAATGTTTGAAATGAACCTTATATCTCAGGCGGTGAGATTAGAGTATTTCGAGTAGTTAGAACTGTGAGTATAGCCGATCATCCGTATACGCAAGCGCGACGGCTGTAAAATCAGATTTTACGGCTAAAGAGGATTAGAAAGGCATGATGTGATGCTGTCCTGTATTTCGTCACCTGAGTTACGATCAAGGCCATAGAGGTTAGTCAGAATAGAAGTAGCTGGAAGGGCATAGTCGGTAGCACGGACCCTGGTTTACGGCTCTGGAGCGGAATACGAAGAGGTAGCGACGGATGGCGAGCACTAAGTAAAATATACAGGGTAACTGGCGTCACAGTGAAGTGAACAGGAAGCGATCTAGATTTGAGGCATTTACATCGGATTTGACTGTCACCCATCAATAGTCGATTGAGGTAACTACGGGGACGAGCCCGCCTTAGTGAGGCATAACCGACAGGACATCTACTAGGCGTTTCGTCAGGATGGGGCATAGATCTAGATGACCGCTAAGATTGAACCGGCGTCAGCAGGAGTTTAGATCGTGACTACCGCTATTAAGGGCACGAGTTAGTACCGCTGAAGGGTAAGTACTTGCTGAACCGTATCTAGTATGGTCCGGTAATGTTTAACCAGAGTCGCCATAAGGTCAGGTAACGGGTATTCAAGAGATTGTCCTCCATAGATCACATTGTCTAGATGCTTTTATTAAAGAAGCTAAGTCCATGAGACGAGTAGATTTTACGTAAAAGGTCAGGCATCCTGTTTCTCGAATCACCGTATACGTCATCAATCTTGTACAACAGCAAATGTAATAAGCGATACCGACTAGAAGTATAGCGCCATTATTATACATAAACGCTGGAATACCGTAAGCGACCTATCGCTTTCTCTACTATACATGACATGGTTCACAAAGGAGATGTTTAATTTTAACTGGTCGGGGGAAGGATGCGAAATTAGAGTACTACCGATTGATTCTCAGGAGATCGGCTAGGCACCCCAAAGAGATGGTCAAATTGTAATTGGTCGCTCTTGGGGTATGTTTTATGTAACCATCAATAGATAGATATTAGATCCGGCACTACGTTGTGCGTTGGGAAACCATCGATGCGGGAATATTACCAAGGTAGGGGAAGCGATAGAGGGGAGACCTAGACAGAAGCGAGGACGATACATCGGGCGGTGGCCCCAGTTAACCGTATCCGTGACAAATAGCGAGGCGTGAGGATTAGATCATGGCTGCTGCTAGGCGTTAGTACGGCTGGATACGCTAGTCAGTATAGTAGGGGAGGCATCACAAGCCACATCCATGTTGTCTAGGTCTGTTTAGAGTCAAATGAGCGGAGCATCCGCCTAGAGGGGATTTGGGATCGCGGCGGGCTATAAGTTAGGCTCGCAGTGAAATAGCCCTATTAACGCCAGGCGATGCGTCGTGAGATAAACCGTCTGCCGCCTTTACTGTCCTGTACGGGGAGACGTATTGGGGATACAACAGCGGGAGTCCTCCTAGGAATCCAGTTTAGGAGTCGGTAATATTTGCCCTATGGATAACTATCGTAAGCCTATCTACTCTGACCCTAGAAAAGCGCTATACTAGTGGGTAGGCGCTCCTATAGGATCTGCTATCTGGCCTCGTATCGTAATGGGTAGCTGCTAAACACGCGTTTAATACAAGGTGCGCGCCGGTACTACGAAGCGGCTACGGACCAATAATCGAGCCGGCCAACCGTGGTCTATACATGGGATTAATACCATGCGAAGTGGGGTTAGATAGGATATAAGAGACGTGGGGGTCCAGGTAAGACCGTCGGCGAGAGCCAGCAAGACCGTAGGTGGGTATGCTAAGTGAGTGGATTGGTCGCGGATCACCGTCAACATGATAGAGAAAGGCAAACAGGGGGTATGACACTTGAAGGGGTACGTCCACTGCGGCAACCCAGCCTGATAGGTGTCTTAATTGGAAATGTATTGAAGCCGATACAAGCCCGCTGGAGATTCACCGTTAATGCCGGCTTCCGGATGTGGGTCGCGCTGGCCGCGGTGTCAACCTTAGAGTGGTTCGAGCGTCGGTGCTAGGCTTTGGCGAGCACAGCCGCATCACTGGGTGTAGGTGGGGTTGTATAACTTATAAGGAACAATCAAGCGCGTCAGCGGTGTGCTCAGCGATTTTATCGCTGAGTGGCCTGTATGCCATTACTGGCGTATAGCCTCACCTCGTAGCAGCTAATCGTTCGTGCGAGCACTCGTCGGTAAGGTCCTCCTCCTAAGGCGACCGTGGTACTTAAGATACTTAGCGAGCGCCGTTTAAGGCCGAAAGTCTAGCGCCCTGGATAGGGTAGCCAGCGTCCAGCGTTAATAGAGGTAAAACATTACCTCGCAGCCTATAGTGGGAAGGCAGGCACATCAAGCTACGGTGATTGTTGCGGTAAGAGGCCATGTGCCCGTTACGTCATCAATGTTAGCCGAGGTAGCGTAAGTTGGGCTGGTCCAGCCACCGGGAGCAATCAGAAGGGGGCCATCGATT
>66
AATTCGGCGTCGCTCGTGAGGCATGTAGAATTCGGCCTTTCCGGCAGGTGCCGATCCCGTACAGGCCATATCGTTCCGTCTCACCGTTAGGTGCAGGAGGCGTTGATCAAAATCAGCCTACCCAAAACTTGCTGTCGCGTATCCATCGGTGTGCTTCCTGATATGCGAGGCTGAATAATCAAGGGGAAACCCGCCAGAGGTCGTGCGTATGTCTCAGGAACAGGGGGATGGAATGCAGTGCACACCCACAGTGCCAGTGCATCCGATGGATTTGGGCACGAAAACCACATTCGTTTGATTACGGGAAACGACACAGGCAGTTTCGATTACGAGCACCGATCAAAGAATGACGACAGCACACGGGGCTCCGCTCACAGTCTAAGGGTTCAACAGGACGCGCGGGTGCCTCTACAAGTCCGCGCATGGTTAGGATGAACAGTTCTGGCTGGAGTCAGTATGGAAGCAATGAGTCAGGAAAGTTAGCACAGTTAAGGAAACCAGCACACAGGGTATTGCTTATTTACCGAGAACGGACAGTCAGGGCAGCAGAAACAGAGATGGAGAACGAGCGAGCATGCGGCTTCTTCTGCCGCCGCAGTGAGTTGTCTGGCTTCTGCTCAGCATTCCCGGTCTTTCAGTATGCGTCCCTAAGCTAAACGCGTCTCCCGTAGACGCGGAAAAGCCCGTCAAACATTGCATTTAACTATTGTGAGGCTTGCATGGCATCTTCGAGTGAATGAACACTCACGGACCAGTAAAACACTTTACTTGGTGACATTAATGAAGCGTCTTATTTATCTAGACTTAAGAGATAATGTTCCGCTCATCGATTTGGTGCCTGTAAAAGTACCTGTTACCTCGCACTGTTCATGATAATATTCCTGATGGGTTTGGCGTCTGTTTCAATATAGATCAGGCGCTAATGGTCGATATCTCGTTGAAGACTCATCGGGGTAAACCGTCCTTATTGATTCCTGGTAACGTCTTTTAAGTTTCTGAACTCGTTTAGTCTACGGGAAAATGTTTACTGTTATCGCCGGGGAGGGAGTAGAATGGAACGGCACAGCCTGGGTGAAGAGAAGGGGAAGGAAAGAAATCGACGGAAGCGAGGAGGAAAGAAACAAAGCCTGATGCATAGCCAGTGAGCATATTGCGCCGCTTCAGGATGCCCAATCTGGAGATTGCGAACGAAGGAAGAAACCTCGTGCGCTGGAAAGCCTGGAAGAAGAAGTATCGGGTGTTGCTGAACCTGTCGGCTCAACTGCACCTGATATTGGTGGCCTGCCTGTCCCTGTTATGGAGTAATCGTTTGTGATATGCCGCAGAAACGTTGTATGAAATAACGCTTTCCATTTGGTATAGTATATTGTAAAGCTGAGTATTGGTTATTCGAATTATTATCTTCGAATAATGGAATTCATACGTGTTTAGTTTACATCACCGCCAATTAGTTCCTGCTGCACCTCCAATGCATGGCAGCTCTTTTCCTGTTTCGCTGCTGTGCGTGCTCTTTTCTCACTGGTTAGCTTTTCTTCTAATGGTACCCTTTCCATGAGAATACATTTTATTATCGTGAATCAATTCTAATTACTGAGGTCTTTCATCTATAATTGGCATTGTATGTATTGGTTTATTGAATAGGCTTGCTTTTCTAGCCAGCTCTGATCCCAAATGAAGCCATAAGGCTATCTTAGCGGAGTCTCGCAGGACCCGACGCCGAAGAGTACGCTGTAATCTTCAAATGTTGTATTGATTAAATCAATTAGCTTGGAATGTTGACATAGGTCAATGTTTGAATGTGATAACCGTCCTTTAAAGTCGTTTCTGCAGCTTGGCTGTATAGTCAACTAATAATTCTGTCGAAGTACTGTTAGTACCCCGTCTAGCTCTTTAGTATCTTCAAGGAGTTTTGATCCTCTTATCCTGCTAAATGGGGTCGATCTGAGTAATCTTTTTAATTTTAATAAGTTATTCTCCGGCTTCATATACAACAGTCGAATCATGTTGGCGAAATCACATCGTCACCCATTGCAATGTTATTTGTATGCAGAGTTACAGCAGTTATACATTCTGCCATAAGATTACTAGGCATGTAGCAGTCAAACGTATTTTATAATGTACCGGCATCGTCTTTCTATTTAGCTCACCTGATGCGTGCTCTGAAGACATTTCTTTTGCGGTCTAACTTTATAATGTTTACTTTCAGTTAACATGAATGTCACTTTCTTCGTAAGATAGCGACCCGACCTTTTGAGAAGAATCCCGAGCGAATATTAAAGAGCTGGCAGTCGTAAGCCCAAGCCATTAATGAGCTTTCCATTTTCAATAACATTATTTACCAAATGTCATATCTAATCTGGTTTTGTTTGTGAATAATAATGTTATAACTTCTGCGTTGGGGATCCTTCAAATTCAGCGAAATAATTCCGCCGTACACTTATCGCTGCAGCGTTGGGGTGCCATCTCGTATTCCGCTTGTCTTCTTTCCCATGGTTTTAGTCATAAACTCCCCATTTTGATAGGTTGCATGCTAGATGCTGATATTTTAGAGGTATAAATGTCAACTGCTTAACTGTCAATGTAATACAAGTTGTTGATCTTTGCAATGATTCTTATCAGAACCATATAGTAATTAGTCACAGGAAATTTTAGTGGGTAAGTATGTATTAAATGCCAGTTGTGGCTTGTAATCAACGATCTTTAACGGAAATGAGCCGCGACATAGGACTGCAGGAATGGTGCTGCGGCTGGCTGGTGAACTTCCGATAGTGCGGGTGTTGAAGAGATTTCCAGTTGCTACCGATTTACATATTTTGCATGAGAATTTGTACCACCTCCCACCCGACCATCTATGACTGTACGCAGATCGGCGGGGGACTGGAGGCGCAGCGATCGAGGACAGTACAAACGTGTCTCGGTGCATGCGCTGTTATGCCATCTACTTAGGAATTGGTTGAAGGTCTACGGATTTTGTAAACAGCCCTCCATAAAGCTATTCGTTCACTTCCGATAAGCGTCGTAATTTTCTATCTTTCATCATG
>67
CTGGTGTCCCATCGCATAGGGCTCCCTGATATTCTTCCCCGCTGTCTGCAGTCAACTTCTGCGGTCAGGTGCTGCAACCAGCTTAGGCGTGACACCATTCACCGTGCCACTCTGTTCACCGTCAAAGTGCGCCCCGTTATCCACGATGGCTCTTTTCCGGCACATGCTGCACGGGGTGATCTGATGGCATACGTGCCGTCCTTCAATCGTTCACGGATATCTCACGCATGAACAGTTGAGTATGGGGCAGCGTCGGCAGCTTCATGCTCCCATACCTGTATTCATAACAACAGCGATAGGAACACGGCTCATTTACCTTCACGCCGTCGGTACGGACCGAATGAACCTCCACGCTGACCGGATTGCCGCCACTTCCGTCAACCGAGGGTATCAAGCGCGGTACTCGGAGGATGGCAGCGTGATTTCACGGTCGAGCGTCAGGCGTCCGGGATTCGTTTGGCTGTTCACCGGAGCACCAAGACCACCGGTGCTGATACCGGCATAGTCATCATTGCAGCAGATTCAATAACATCGCCAGCGGTACATGGCGAAGCCCTTCTGCGCCGCACGCTGAAATCGCACGGTCTGTTTCCAGCGTTTATTTAATCAGCCACAGCCCGGCGCGCGGTGTCGCCTGCGCCGAGGTATGCTACCTAAAGGGCATCCATCTTCGTAACAGGTCACGACCGTAACGGGCAATGGCCTGCGTGTATCTTCAACAAGCTCTGTCGCCGTCTCCCAGCCGTTGTTCGGGTCAATCCAGTTCACCTCAACAGCAGTAACCGCATAGTCCTTCAGAAGAGGCTGAAGCTGTAGCGGAACGGCGCGCCATCACCGGCATCCATCAGCATCAGGGTGGTCCGGTTATAGGTCCACGTCTTATCTAGGACGGTCGGTTGGTGCACGAACGTCAGCGTCTGATGCCCGTTCCATACCGGCATACAGCGCATCGCCGAGCAGAAGTGGATAGCACATCCCACGCCTTACGCTGTGTAGGTCATGATGGGATTACAGGTGATGCCTAGGCTTCCGTCTGCAGCGCCAAAGCGTCCGGCACTGGTCGGCCCAGTGGCAGTGATTACTCGATGTAGATAGCGACAGCGCTTCCATTTATCCACATCCGAGCACCAATGACGTTTCCCCATGCCGTAGCCGCCCGGAGGTGATCTTACACATATCCCACAACACCAGCGCTGTTGTGCTCTTATTGAGCGGTTTAAACGTTCTCGTCCCCAGATACCGCTGTATTGCCGCGTCTGCGGGTTATAGTTCGACGGCACCTGCAGAATACGCCCGCGCAGATGATAATTACGAGCCCTGCTGGGCTGCCGAATGAGCCCGAGTCGCTCATGCGACGCCGACCAGTGCCGTGTTCGGGTAGCACTGTTCACATCGATGATTTCAGGTTATGACGACCAGAGCGTTTGTTCTGCATAACTTTCAGTCATCTGTGGTGCTGTCCGGCGTCATCCTGCGCATCCGGATATTAAACGGGCGCTAGGCAGGTTACCATCACCACGAGGCCAGATACTGCAGGTAGGTTTTCGCCTTAATGGTGATGTCTTTCTCGTTACCCAGCCACCGTTACGTTGTATCTGACGAACCAGCAGGCGGACTTCCGACGATTCCTGTCATTGTTGAGCTGGTTTCCACCAGTGCCTGTACACCGAAAGACATAGAGCGCAACGGTCGATGTTTGCAGGTATCAATGGTGCGGGTAGATCGGCGTCATATTTCATCCGTACCCAGCACCGTCTCGCTGACCGGAGGATTCAAATCCCTCCGGCGGTTATGCTCCTCTACAGCCCGGAACAGCACCGTGACACGGATATGTTGGTATTCCCTCGAGTGTCCAGCACCGGCGTACTGTTCCGCAGCGCTGTTTAAGCCATCCAACGCACTCTTTTCAATCGGCCTTCGCTGATGGCAACCGATCACACTCAGCAACTGCGTGGACTTCAGGTGTTTAGTGCCCTTCGCCTCCGGGGTATCCCCTTACTGCTTCCTTTACCACCATTCCTCACCCCTCCATAAATGACAAAATGGCCGCAGCAGAGTTCGCATAAAACATTTTGCACATCAGCGACCAATCACCACAACCTGACCACCGTCCCTTCGTCTGCCGTTGATCTCCTGAGAACCGATCGGTACCCACGCGCATTCCCCGTACAGAACAGGCATGACATTGTGCCCTGGGCAACCATGTTATGCGTACGAGAAATAGGTATCCGTTTTCTGCTTACCGTTATCCGTTGTCTGTGACCGGGGAGTTCTGGCTTTCGGTGCAGCATCTGCGCCACACCACCGAGCACCATACTGGCACCAGGAGAGGAAAACAGGATGCCGGTCATACAGACCCCAATGGCTGCCCGCGGATGCTGCAAGGGTGGCTCCGGCGGTGAAGAATGATCCGGCAATACTAGGCAGCGACGCGAGGACAATCTGGAATACGCCACGTAATGGCCCCGGCGACTCTGGGAACAATATGAATTACAGCGCCATCAGGCAGAGTCTCATGCCGCTCATGCAGCCCGTTAACGCGGGACTGCTGACGTCCCGCCGTACCAATCCGTACCTGTACCAGCCGTGCCGTTTCTGACGAAACGCCGGGAGCTGTGTGGCCGTTGCCCGGATGATGGCTTCAGCCCCGTTTTCACACGAAGGTCTTACATTGCGGCATACAAATCGTTGTAATCCAGGCGTAAAGGCAGGATGCGCGCCATGCCGGAACCCCAGGGAGATGTGTGCGGTGTGCATGCTGCCATTTGTCGGTGTTATCCTCTCTGGCCGTTTGCTCAGTTGTTCAGGGAAACTGGTGCAGCAGCAGCCGTCGACGCAGTAAATTGCGGCTAATGCGTCCGGCACTGATGAACCAAAGCACATGCAGCACATCGCCCGGCTGTGCCGGTGGACAACGGCATGATACAGCCCCGTCGCCTCCATATTATCCAGATGAGATTCTGGCCGTTACGTGCCACCAGTCATCCTCACGATGAAAGTCCGGCATCTCAATCCCGCCAGATGATAAGCATCCCGGAACAGTGTGTAACAGTCCGTCACCCGTGCCAGCTCAAAGCGCCGCTCGAGTCAGATGCGGCACAGCGGATTGGCTGATTCGATCGTCCCCCGGCACTCAGCCACCACGGCAAATCACCTCTGCACTGCAGCCGCCGTCGGCCTCACAGCCAGGGCAGACCACCGGGGTGAGTGCGTGAACCAGCGCCACAATTCACCCTGCATTTCTGCCTGCAGCCAGTCTTCCGGCGACTGGGGAAATGCCCCTCCAGGCTCACCGGAGATGCCCGGGGAAATATCTTCCCCTCTCCGGCGAGTGCTTACCACGAAGCCGCACGACTCCGGGCGCACATCGCCGGGCGTGCGGCTGTAGACTGATTCGTGTAGTCACTAGCTGGAAGTCTTAATGGGTGAAAAGTTGTTAATGGAAAAGGAACCCGCCAAAGTTTGCCGACGTTATTGCTAACTTTACAACCGCTCAGGCATTTGCTGCATTTATCCTTCGTGATATCGACGTTGGCTGGTCATATTCATCCGCGACAGCCGGACTTATAACCGCACTCGTCACCGCGATAGTCCGAGTGCAGGTGGTTTAAGAGATACCCTTTAGAAAACAGCCATCCGTTTCCGTCGGCGTGGACAGTACAATAAAGGAGGCACTCACAAGGGCTCGAGTTCATGCACTGCTCAATGCGCCAGCGGCTGATCGACCTCCTGCTCCGGATCGGCGTAACTGTTTCCGTTGACGAAGTTCACCGCATCCAGAAAACGGGCGTAACCTTACGCCGTCACCCGTTCCCCCAGGACCAGACTCCTTGCATATCTTCCGCCATCCCGGTGACCATACCGTACAGGTTAGAAACCGTCAGTCCTAATCCTGGACCTGGTGCTTTGCCATTCAGGTCAAAACCGCTCCCCTGAATGGGATACGGCTGATACTGGTCGCCCGTGCCAGGTAAGCCCTACCTTTCGTTCTGCTCATTACAGAAAATAACGTTCTCCACCGACCTGTCAGGTCGATTTCCCAGGGCACCACGCTGGCCGACTGCTCCGGACGGGTGCATTCATTGGAGTGTTTCCTGCCGGTATCCTGCATGTAGAGTTCATCAGGTGTTCAAACTCTGCTGAACTCAACACGCAGCAAGCTACTTAACCCCGGGACGACCATTTTTGCAGCAGGTCATTTATCTGCCGCTCATAAGGCGGCGTCCACAGAAAGGATTTCCAGCCCCGTTGTACTCTTCCGAAACGACTCCAGTACCGGTGCTCCTCACCGGGGGACAGAAAGCCCGTCACGCTTACGTTTTCAGGTTGGCATTCAGCCCGGCAGGCGCTCGCTGAGAAACCTCATCACCAAGCGCACCTTTCTTACAGAAGGGACGGGTGAAGCCATCCATACCGGGTTTCACTTTCCATAGGAAGGTCTTCAGCTAGGAGCCGGACACTCCCCATCATCTATCTTGTCTGAATTTCATCACGGGCACCTTGCGGGCCATGTCATACGCCCTTCAGAGCAGCCGGACTATCTGCCCGTTCGTGCTCAGCGTCGTTGTCTGTAATCACCACATGGTTATTCTGCTCAAACGTTGAACGCCTGCGACCGGCTGATGCCATGCTGCCCGGTGTACCACCAACCGCCGGTGGGCAGCATAGCCGCATCAGCCGGTAACAAAGATTCCCACGCCAATCCGGCTGTGCTGCCTTCCGTGGAAGACAAACTCACCACGGTGAACAATCCCGATCTGAGCTCGCTATTGCCGCCGGTTCCCGTAAATCCTCTGGCTTTAAAGGCATTTCGCGCCGCAGCGGCCACTGAGGAACGTAGCCGTACCGCCTGACGCGGATGCGCCGCCAGACAGCCCGCCCTAAAACCCCGCTGCCGATACTCCCGACAATCCCCACCATTGCCTGCTTAAGCAGAATTTCTGTCATCATGGACAGCACGAACGGGTGAAGCCTGCACCAGTTTCTGCTCACTGCCGTCAGCGATCGCCGCCAGATATTCTGTGCAATACCATCAAAGTCTGCGTGATGGTTTTAGCCTGCGACATACTGTCCGTGGCGCTCTTCCCACTGAAGCTCCAGCCGGACTTCAGGCCTGCTATCCAGTTCCCGCGAAGCTGGTCTTCAGCCGCCCAGGTCTTTTCTGCTCTGACATGACGTTATTCTAGCGCCATGGATTATCGCCATACTGTTCCTTCAGGCGCTGTTCTCGTGGCTTCCCGTTCTTGCCCTGCCGGTCACAGTCAGCCCGCAGCTTTTCGCATCAATGGCGGAAGCCGTTTTGCCCCGTTGCTGCTGTGCGAATTATCCGCCTGCTGCGCCGCGCGTTCAGGCGCGGGCTGATACGTAACCTTGTCGCCAAGTGCAGCCAGCTGGCGTTTGTATTCCAGCGTCTCATCTTTTATGCGCCAGCAGGGATTTCTCCTGTGCACCGGCGACGTTATGCGCCGCCTCCTCCAGTACCGCGAACGTACTCAGCGCGTCGCAGATCAAATCGCGGCGCTGCTGGCCTGATTTCCCCATTTGCTCCGGCATGCTTCTCCAGCGTCGTCCGCGTGATACTCTTACGCCTGAAGCGTGCAGCTAGGGCAGCATGAGCGCTGTCTTCCTGACGATCTGCCTCGCAGACAGCCTTCACGCTGGACTGTTTCGGCTTTTTCAGCGTCGGTTCATATAAATCCTTTTCGCCGCCGCCATCAGCGTGTTGTAATCCGCCTGCAGGATTTTCCCGTCTTTCAGTGCCTTGTTCAGTTCTTCCTGACGGGCTTATTTCTCCAGCGGCGTCTGCAGCGGCCGTTCGTAAGGTGCTCTTCTGCGCCTCTTCGGGTATATTTCAGCCGTGACGAAGGTTACGGTATCCGCTCTGTAGCTGCTGCGCATTTTGTCCTGTTGAGTCTTGCTGCTCAGCCTCTTCTTTCGGGCGGCTTCAAGCGCAAGACGGGCCTTTTCACGATCATGCGAGTAACGCGCGCCGGTTTCATCGTTAACAAAAATAATCATCCTTGCGCAGATGCGATGTCGTCTGCTTTCTTATACGCAGCCTCTGCCTTAATCAGCATCCCTGCGCGGTATCAGCACGACCAATATCCAGCACCGGCATCCCACATGGATTTGAATGCCATGGCAGTCTTCGTCCCCAGTCTCCAGCGTGCCCATGTTCTCTTTCAGCGGCGGCCTTGGTCATCAATGGATTTCGTTGCGGCCTCGTTCCTCCGCCTGCAATGCCCCGGCTTCATCGCCGGAAGGCTGCAACTGAGCAAGCTACGCAATCTGCTCCGCCGACGCGTTATGGAACTGGAGCCATCGGCTGTCAGCCCCGACGTCGGGTCTGTGGTCAGCTTCCGAACGGTCCCAGCGACCTTTAGGCTCACGGATGCAGAGGAGAAACGCGCCACACTCTGGTGGCTGATGACCGGCAATCTGAGCCTCACCGCTTACCCCCTTAACCAGTGCGCTGAGTACTCGCTGTCTGGTTAAACGTCAGCCCTGCCGCCTGCCGCCCGGCTCTGGACAGGACCAGCATACGATCTGCCGTCAGTCCCTCATGGTGATTGCCGGAAAGACCAGCGTTTGTTGAAATGGGACACCGTACAGTGTTGCCCTGATACCAGGCATACGCCATAAGCGAGGTGCCAAGCACAGGCTAGGGCCCCACCATCGGCAGGGTGATCGCACCGGCAAGCCGACAGAACATGGGGATGCATCCCGCCGAAGGAGATCCTTCACCTGCCCCGTGTTGCAGCAGGATCAGCCACGGACTTTGCCCGCTTGCAAGCTGCGTGGATTCGGTGAAGACTTGCAGGCAGCATACGCAATGGCGGGGTCCTACTGCCGACGGAAAATCCCCGCTTTGGTGCAGCCACGCCAGCCTGTCGGCTCAGCAACTGTTCACGACTGCCGCTGTTTTTCGCATCATTTTCTGATTATAGAAAATTAACGCCTGACTCTGGCCATCTGCTCGTCAAATCTGAGCATCCAGACTCAAATCAACGACCAGATCGCTACCGGTTCCTAGCCATACCGGACTCCTCCTGCGATCCCTTGCTGATACTGTCATCAGCATTACGTCATCCTCCGTCATGTCGCCACATCCGGGAAGCGGGGATAACTTCATTCCCGTCCGGGCCACGACGGCTAACCATGCTGAAGCAAGCCCTGCCGCTTTCTGCATCAGCACATCATCTTCAGGCTCTTCGTCAGCCTCGCGCCGGTTCAGCAGACTGAAATCCTCCTCAGCTGGATGCATATCCGGATCGCTGAAAAACACAGGCTGAGCACAAATTGTACGTCAGCCAGGGAAGTGCATATCCAGCAGAACATCATGAAAATAATGGGTACTGTAAAGCGGTGCCATTGAGCAATACCGTCATGACATCCCGGCAGCAGCAACGCGCCAGTCGGGTCGCCCCATCGCACGCCAGTTTCAGGGCAACTCCAGCTACCGTCGAACACTTTCCCGCAGAAAGGTAGAGGACCCTGGCCCGTGTCCTCTGTCTGTTCAGGGGCATTATTCACCACAAACTCATACATACCAGACAGCCGTCACCACGTTTTCAGCATGAGAAATGCCTCCGTGGGCCGTAGTAAGCACTTCCTGCTCAATCTGTTTATAGCTTCATTCAGCGTAACGGCATCTGCGTCTTCTGCGGATGGTTTGGATGCTAGGACATCGCCAGATCAGAAACGCCGGTTCTGATGGCGTCTTCAACAGTAAACGTCTTCCGGTTGCTGTCTTAACCCGCCTGTTCTGCCTGCCGTTCATCAGGGCAGATGCTCAATGCGCTGCAGGTAGAGTGACACAGTTCGGCCAGAGAAAGCGTGACGGTCACCCGTTGGTTCAAATGATTCGGTTTTCAGGAGTGAACACGCTGACTCTCTCCGGATTAACTGGCGGTACGGTAATTTCTGCAACCGCAGCAAACGCTCACCATTACCGATACAACCGAATGTTGACCTTGCCTGCAGCAACGGCCGTTCACGGTATCTAGTCATACCACTGACGACACGGTGGCTTTTGTTTATCTAGCGCAGACAAGCACGAAAGGGCCTCTTGTCGTTACGCCCTCCGGCTGGAAAGGCCACGTCAGCGTGGTGCTCTGCCTTCACCACCGAGGGCTCTGGCAGGCGTGGCACGGTCATGCAGATTACAGCCGTATTCACGTTAAGGTTGAATGCTTTGCGTGATCAGCATCGACTAAAGTTTCTACAAGTTATGACTTTCACCGTTAGTATATCCACTTCCATGACGGTTCACACATGCGCCAGAGATACCGTAAGGTACCCATCTAAGGAACACGAGGACCTGTTTACCGTTCTGGAAGGTAACGTTGACCACCAGGTGAACCAACTGTTCACGCTTAAGACCACGCCAGCATAGGTGCTGCTTACCCTGCTCATACCGGGCAATCACGCCATAGCGTGAAGCTGATATGCCTAAGCAAATTTCTGCATGCCATTACCAGCACAGCCATTCAAAGTCTGCATCACGTATTCCATGATACAGACTGATCGTCACCCCTCCATTCAGTTCAAGATGTGAAAGAGTCAAAATCTGTCTATTTTGCCAACGAGACCAGTCACTAAATGTCAACCATGCAGATTTCATCCTCCAGTGACAACCAATAGCCACTCCGTGACAAACCCACAGAGCACTGTCTAAGCACCTTTCAGACCTTCCGAAGTTAACAGTTATCTAAGCAGCAAGGCCGTCAACTTAACACATTTCAACAGACTGATGACGACAATCCATCAATCCCTCCACTCCGCCTCCCCATCTATGGTTCCACCACCATGCTTCCTATAGATGCCTCACATACTGATCGGTGATTAAAAATTTAAAACAGTTCGTGCCAATAGTTTGT
>68
TAGTCCTTTATGAATATTTCTTGTGGTCGCTTGCGGGAGGCAATTATAAGTTTAGCCCGCCGCAGAATTACTGTACCACATGCATATCCAATCTTTTATACGAGCTTCCGAATTGAAGCCGTTGAACATAACGGTGATCGTCACGCTTTCTGAACTGTCAGCCCTGCATAGCATTGAGCATCTCGATATGAAACGGCAGGCAGAACGGACAGGGGTCATAGACAGCAACCGGAAGTTACGTATTGGAAGACGCCATCAGAACCCGGCCGCGTTTCTGGCGTGATGTCTCGCTGTGGCATAACCATTGACGCAGACCGCACGGCAGGAGTACCGCGTTAGATGAATGAAACGCTTTAAACAGACTTGGAGCACAGGAAGGTGCTTACCAGCTGTACGGAGGGATTTCTCATGCTGAAACGTGATCTTACCGGCTGTCTGGACTGTATGAGTTGTTGGTGAATAATCCCCCTGAACAGACAGGAACGCCGGCGGGCCGCAGCCTGTTTCCGGGGAAAGTGGTGTTCGGACGGTGAGCTGGCTGTTTGCCCTGAAACTCGCTAATTGCTATCGCTACGAAGCGGCTCGCATATGAGTGCCGGTGCCACGTACTATCACGTATAGTATGCCGACTCCGGCATTTGTCCCCGTACAGTCCCATTATTTTCATGACGGTTCCTTGGATAGCTGGCACTATTTTGCTAGGTAGTGACGTACACGTGCTCAGCTGTTTTCATTCGTCAGATTAGGATATGCATCCGCGCTGGATTTGGCTTGCTGAACCGCTCGAGGAGGAGTACGAGTACCGACCGGAAGCTCGAAGATGATGTGCTCTGCAGAAAGCGGCAGGGCTTGCAGGTGTCCCTTTGGTAGATACAGAGGTCAGTCCCAGCTTGTATGAATGACGACTAAGTTCCCGCTTCCCGCTTCTTAGGACTATGACGCCAGGATGGACGTAATGCTGACGACAGTATCAGAAGGGATCGCGACGAGGAGGAGTCCGGTATGACGGACCGACTGGCGTAAGGCAGTCGTTGATTTGGAGTCTGGATGCGCTCAGATTTGACGAGCAGATGAGCGGTCAGTCAGGCGTCATTTTGGTACGGAAAGTACTGCGGGACAGGGCAGTCGTTAGAACAGTGGGACGGTTCATGGACATAGGCGCTGGCTGCACAGAAAGCGGGGATTTCCGTCGGGCAGTATAAAGCCGCCATGGTCGAGGTCTGCTGCCTGCACAGTTCACGACGTGGCCACGGCAGCTTGCAGGCAACCCAGGGTGCTTAATATTCTCATGCTGCAGCCAAACAGGGGGCAGGTGAAGGGTACTCCTTCGGCGGATGAATGCGCCGAGCCGTTCAGGGGCTTGCCGGTGCCCGTACTGATCGCTGCCGTATTGGCGCGCTAGGCCTGGCATGCGGCGGGACTGGGCTGTACGGCTCCCTATCATTAGGTGACAAGCGCATGACCGTAACCGCTGTCGATTTCAAACAAAACTAGTATTGTATTTCCTTCCTAATCAGGCGGGACTGACGGCAGATCGACCGTCCTGTCCTGTCCCAGCCGGGCAATGGAGGCAGCGGCTGACGTTTGACTCAGGACCCAGTACTCAGGGCTATATTGCCTAAGGCGATAATCTGAGCATGCTAGCCAGATTGCGTCCATCATACTAAGTGAGCGTTTCGCCTCTGCATCCGCTCGTGGGGACAATATAGGGTCACTGAAAGCCTTCGGGAAGCTGACCACAGACCGACGTCGGGCTGACGGGGCGATGATACCTCGCCATGTTCCACAGACCTGTCTGAGCAGATTGCGTATGTTGCTCAGTTGTGCAGCGTTTTCCGGCTCATTGAAGCCGCTAGGAAGCATTGCGGCGAAACGAGTGAGCTCGACCCAACCGAAAGGGTTTGATGACCAGACTCCGCCTGCTGAAAAGAGAACAACAGCGACACGCTATGGAGAGAAGGACTGGGCAGACAGACTTAGGGCATTCAAATCCATGTGGGGTACATCTGCTGGATATTGGTCGTCCTGGCCATAAGGCAGGTTGCTGATTAAGGCAGAGGTCTCGTATAAGAAGCGCAGAATAACCGACGACATCGGTGAATTGGAGTGCTAAGGATGATTATTTGTTAACGCTTAAAGCGCGGGCGCGTTACTGGGATGACGTGAAAGGCCACCGTCTTGCCTTGAAACTCAGCGCCAGGAAAGACCGAAGCCTATGATGCAGCAGACTCAACAGACAAATCGCATAAGCACCATCCGAACCGTCAATAGTCGAAATATACTCGAAGAGGCGCGCAGCCAGCTTACGAACGGCTGCAAGACGCCCCTGGAGAAAATAATCAGCGTCAGAAATGAACGACGAAAACAAGTAAGGCGGAAGAATGTAAATGCTAGCATGTACACTACAACTTAGCGAGCGGCGAGGCTAGGAAATTACGAAGCCGACGTCGACCCCTACCCAAACAGTCCAGCGTGAGACTTAGGGTGAATCGTCAGGAAAGACAGTGCTCTCATGCTTCCCTGCTGACGCCTGTCAGGCAGAACTCCCATGAACGGCCGAGACCGCATGCCGGATAAAGTGGGAGAAAATCAGCCTAGCAGCGCCGGGATTTGTACGCAGGCGGGAGTCAGTTCGGAGATCTGGGGAGGAGACGAGTAGGCGCAACGTCGCCAGTGTCGTAGGGACAGAGAAATCCTGCCTGGCGCATAAAGATGAGACGCTGGAGTACAAACGCCAGCTGGCTGCATATTGGCGACAGGTTACTGATCATTACAGGCACTAGCTGAACGGCGACGGCGCAGCAGCGATAAATTCGCACATACAGCAACGGGCTAAAACGGGCCGGATTGATGCGAAAAGCCGGGGCTGACTGACCCGGCAGGGCAGAACAGAACGGGAAGCTGAATCTCAACGACAGGTGGCGCGCACGAGAACAGTACCGATAATCCTGGCCGGCTGGAGCCCAACGTCAGCGTCATAAGAAAGACTCTAAGGCTCGGGCTGAAGACCAGCTTGCCGGGGAAAACCTGTATCGCAATGCTGAAGTCGGGCTCGATGAGTGGGAAGAGAGGCCACTACTAAATTATGTCGCAGGTAAATTGCAGCCACGCAGACTGT
>69
ACGTCCTTTGGGTGTTTAACTATCTAGTTACTTAGATATTAGTCCGTCTCAATATTATGGATGCTAGCTGAAGCACGATTCAGTCCCGTAGACTCCAAGGGAAGACAGTCGTCCCTTCCATCGAAAAGTTTGTTCACACCACAGCTCAATGATCACCAATGTATGGGAATTGTTTTTATGATACTACATTCCTGCTTCATTAAGTGGCACAAACCATAATTGCTCTTCTTGGACAGCTGCACTTTACGCTTAATGGCCAGCATTTATCGTTTCCATCTTAAACTGCGCGTCCTGCTGGCATTATGATAAGCACATGACGAGCCTCTTAGCGGAATGCGCTCGGTGCCGCAGGTCCAGCAAAGAGACTGAAAGATGCCACACATGAGGATTACCGATTCTCATGACATATTCAGTTACCGGCCGAAGTCTAATGAGATAACGATCATATACATGGTTCTCCAGAGGTTCATTACTGAACACTCGTTAGAATAACGATCAGTGCGGTTCGGTTTCTACTCATCAAACTTACGGTTGTAATAGTTCTTAATTTCTCGGCTGTAGGGGTCACGAGAACGGAAGGCTCGCTGGTCTTCCAAGACGCTCAATGGTCACCGCAATCCACTTTTAAGGTGATATGGAAGAATTTGAAGAGTCCGGAATATCACCCGCGCCGTGATATGGAACAATACCAGACTTAGTACCCACTATTAATCAAGTGGACAATTCAAGGGATGAAGCATGCCTGCAATCGGAATGCATGGTTACTGAGAAATGTTCCTGTAATGGAAAGATGGGGAAATAGTTAGATAAATGGGCAGTACGAACGACGATGATTGCCACCGTAAACAGAACAACAAATCTATCTCCTGTTATTTTTGCAGCATACGAATAAACACTGCACTGTGCTTCCAACGAGTACATCACGGAGCAATGTCGCTCGTAACTAAACAGGCCTAACTTGTCCTTGATCGGAATCTTCTTCCTACGATCAGGGCGATTTATCTGCGACCGAACAGATGTCAAAACATCAAATAAGTTGATTACGACCGAAGCAGCATGATAGAATTATGAAATCGACATACGTAATGACAGAGAGACTTCCATAATTACATTTCTGGTCACTCTGAATAGCACTCATACTGGCTGTATTAAAGCTATTAATCAGTGCCTCCGCAAGAGCCTGCTGGTAGCATTTCAAGCGACTTAATGCATATGTTATGAGTTCGGGACTGGAATGATGGAATACTTTAAGAAAGGGAATAGACCCGCTCCATGAGCGAAGCCAGGAATAGAATTACCGGGCTGGCCAACCGGCCAGGAATATTTGATTCAGATGAGCTCACTATCAAGCTCGCGCCTGAGTGCGTTTTGATCGCAGCCGACACCCTTCACTCGCAGGCGTTTTCGTTATGTATAATAAGGAGCACATGCATATGCGCTTGCAGGCTGTCCTGGCTTATGCCCTTCCACGCGGGGTCTTTGAACTAACAATCACCGTAAGTGGCGTGACGCTGGAAGCCTTATCGACATACTTAATCAGGGAGTCTCAAAGAATGGATCAAACACTTATGGCTATCCAGGCCAATTCATCGCCATTTATTGGCGATGAAAGTGTTTCGTGAAGCCGTCGGACCTTATAAAAATCAGTGATATACTGAAGTGAGTACGGCAGGATCGCCGGTCTATTTCCGTGCCTCCAGCATTTCGCGGTGAATTTTCACAGCTATTTCAGGAGTTCAGCCATAATCCCCTTCGCGGTGCTTCTTAAGCGGACTGAGTCGCCCATAAGCTCATGCGAAGAGAATATGAAGCGGCAGACATGTGACGCCCCAGCACCTGTCGTTGAATCCTGCATCGATCATTTGCAACGCCACGCTAAATCCATTACCCGTGCGTTTGGCCCGACGGTGTTTCAGTTTGCCCGCATGGCAGAACAATTACATGCTGTCCATGGAAATTAAGCCAGGTCTATCCTTTACGAGGTAAACGGCAACCGATACTGCACTCGCAACGCTGGCTGGAAGCTGGCTGAACGTCGCATCCATTCTTTGGGCCCGCATGACAACTTCTAAGCGTCCTATTCAGACGCTTTAAAGGCTTTCACCATGCGTAATCATAGCAGTGTAGGCCTTAATCCGGTTGCCCAAGCAGTTACGTTCCTCCACTCAGAAGTGGCATCGTTCGTTCCGGTGAATTGAATCTCTGGCTGGTGGGCCGAGCTCGGCAATGAAGAGCAGTTTGTAGCATGACGTTGGACAATGAATCCTATCGATCCCGGATTTGCCCGCAGGACCGTAATCATCCGATCTGCGTGCCGAGTGAACCTCCTGAATGCCGCGAACGCTTCAAACTCGAAGGCAGGGAAATCGCGCCGTGGATCCGCATCCCAAACGCTTTACGTCACCCCGGCCTCCTTCGAGTGGCGTCGCCTTCGATTGCTGGTATCTATGACAGGATGAAGCCAGCGCATTGTCCATCACTGCAGCCACTGCAGAACGTCAGCCGAATGGCACTCTACAGTTGACGATGAAACCATGCAGGATACTAACACTCTGCTATCTCCGCTAAAGAGCCCGTACGACGTACTTGCCGCTCTTTCCATCTTTCGCCGCGACATTCGTGCAGCGTCAGAACTGACGATGGACGCAACAGTAATTGCTTCCTGAAACAGAATGAGCCCAGCACAGAAGGTAGCAGCATGACAGCTAAATTATCCTGCAGCGATGGGGGATGGCCGGTGAGGTCGAACAGGGATGGTCCCTGCCAATCGCCTCGAGGTTGCGCCTCATACTAGCGTCAACGCCTTCGCAGTCGCCGTGAAAGCCAACCGGAAGACCTGAAATGTCTATTCCAACGCCGCTGTGAGCAGTGCGCCCCTTGACTATCGAATCTCCCACCCACTGAGCCTGGGGGAAACAGTACGCGACGACGCCAGAACCCTGTTTCGATTCACTTCCGGCGTGAATGTTACTGAATCCCCGATCATGGACGCGACGAAGGTGCGTGACGCCTGCTCCCATGGTTTATCGATGAAAATCGGACGCGTGCCCGTTTGACTCCGAATCCGGTTTCATGAAGTTCGATCGCTCGGTGGTTTCCCGTAAAGTCAGCTTACATGGCCCCTGGCAGTATCGCCGCTGTGACTGTAGAAAATGCCTGGTTTTGCCAACTATACGCGTATGAAGCGTGAAGGCCTGCATTATGTCGGGCCGGAGGCGACATGAGATTTTGTAGGTCCCCAATCGTGCCGGAGTTGCCATCACCGAAGCTGACGCACGGCATGCTGAAATTGGTTTGTATTTGGGGAGCAATGGCAAACGCATCCTCAACTATCTAGGCCGCAATCACTTTCGTGCTCCGTTCGAGGAGCCTTTCCGCTCGTCTTTGACTCCCGGATCTCAAGTAGCGGCGCGCTAGGTAATAAGAATAAGCTAGGGTCTGCACGCATCTTCTTTGAGTTAGAACGAGTATGAGATGGCACTTGCTCAATTGGAATCAGGTTACGAGGCGCGCGCGCGCGCAGTAGAAACGACGAATTTCGACCTTCACCGCTCCTTTCACACTGGAATATGGCTCGAGCGAAGCAGATGAGAAACGATATGACATGGCCAGTGCGTCCTGGCAGCGCTTCGGGTCGTTCTTGCATGATCATCGGATTGTTCATAATACCGCTAGGAAGCCCTTCTGCACGCTTTGCCGTCAGGCGCTTCTGCAATGAAAAAGCCAGACACCGTTTCCGGATAAAAACCTTTAGACCCATTTGCCGTGAGAAGCACTCGCATCTAAACAGGCGTCACGGACCCGGTTAAGCCACTGACGCGATCAGCAATTCCTCACTGACGGGACGGCGTCTTTGAAACGATGGCACAGTGTAATAATCAGGGGAGCGATAGCCTTTTATTATTCGCATTCACCCTCATCCTTGTATGACCAACAGTTCAGGGATCATGAAAGCAGAAGATGCTTGATTCAGCAACGAAAGCGACCGAATCGCAACACCCAAGTCAATCTCCGGACGAGCACTGGCTTCCCACTCATGTTGTAGATGGCGTGAATAATGAACGCGCCTGTACTGTTCCATTTCCGTGTTGATGTGCAAATTTACCGGAGGAAGTAGCGAAGTGGCTGAGCCGATGTCAGAAATAAGGCAATTCGAGTAGCGCGGATGCGGCACTCAGGGCAATGCAGTAGACCGATGGGAGCGAAGTTGACGCAGACCTTTCGGATAGCGAATAGCGGCCATTGAATGCTGGGTCGAAACGGAAAGCAACCAGCATCAGCCAACGCGACCCTAGAAGCGAGTATTGCCTACATCTGGCGGAATGCGTGTCTCCTGCATCAGATCAAACTCTAAATGGCCCAGCAGCGTGAGTACTACGAAGGTGTCTCGCTGGGAGGCCTCGATGGTCCTAACTGGAGGAAGCACCGAATAGCTGAATGAAGAGTTCCTGTTGTTCGCCATCCTGGAAGACTCCTGTTATCACGCCTGCTATACTGGAAGTTTCTGCGGCAGTCCGGATCGGAAGTACCTAGCCGTTACTCGAGCCTCACTCCACTCGGGCCCGGCTCTATGACGCGCTCCGAGCAGTGGGGCGATGGCCTGGATGGATCCGGGCATGACTCATCAATAATGAGAGCTTAGCCTGGCAATCCGCGGCCAACCGCCTGCCCGCATCTCGATCGATTTTGCCACTCGTGGATGCCTGAGGCGCGTCGCGTCTTCACGGCTGCCAAGTCTCAGGTGGTGCGCTCGCGTGGATAAAACATTAGTGGTCGTTTGTCGGACCGGTTAATACATTCGCAAGCTACCTTGCGGGATTTACCGGGCTATCAATGAGTCTTAGAGTCTAGCAAAGATTGGGCGTCTCATGTGGATCCTTGTCCCCTGCAGACAGCCGAAGGTGTTTATGTAGATGAGGGCCTCATACGATCCGACAGGTATGTCTACATGAAGATTCTAGTCGCCTGCGATAAAGGTCACGGATTCTGCAAGTTGAGAAGCTTAACCGTTGAAGGGTCTCTTGGCCAAACAGTGGAACGAGCTGTGCTAACCGTAAGCTATCATAACCCAATATCCCTCGTACTAGCCGGGGCTTCTGACTCGTCTGGGGTCTAGGCGCTGTTTGACCGCAGCCTCCATTAATGACCGTGCAGTACTAGGCATCGAGACCAGCACGAATTCTTCCACGATCTGCGAGCAGAGTAGCCGGCGGGAGCAGCACCGGATAGCTGGGACCGGGCACTGACCAATTCGAATGAATCCAGAAGCACAGCAGCCGCCTGGCCGTTGGTCGATTACTTGCGGGTTGCGATGGTACCTTCAGGGATACGAAGCCCGCACCATTCCGGAAGCTGCGGCAGCCGTTCGTCGATGGGTTGAATCGGGAATGCAGGATCCGCCTCCGGTTACTGAAGTAGAGGAGGGTCTTTCACGATTGAGCTAAGTAGATTACTGTAATCGACTAGTAGCAACGTTGCGCGGCCGAATGGGGATGAAGGCAGATCACACCTACGGCATTTACCACTGATTCGCAGCGGACCAATGTAGTATCGACGCGGCGCGACGGCCGATTTACGGGCTCGAGCTAAGGATCGCAATCGCCTGAAGGCCTGGCCAAGCTTTGAGTCGTACTTTTCCAGCACAACACCAAGCCTGGACCCCGGCGTAACTCAGTGGTATAGATTCCTACGTTGATTCCGCTGCCTGATCTGCTGACGAAAATCCTGGCTAGGAATCCCTCATAACATAATGCTACAAGCTACAATTAAGCAATAGGATGTGGGTGGTCGCTCTTCCCTGACTACTATCTCACCAAGGGATCGAGACTGCCTGGTCATATGGAAGCGCCTAGCAGGCGGCTTCACCATGCTATCAGATACCTCCGCTGCATTCCGGCGGCACTGAGCAAGCGCTACTAAGATACAATTGCTGCCTCCGCAGCAAATCCGAGCGGGATGGCTATGCTATAATCACCGATAGAACTATCCAATTACAGCACAGAATCATCACCATGTTGGCCTCAACTTGCGGACTGGGTTGTTACCGTGAAGCGAGTCTATTTATGCAGATGAAATTAACTGTAGTTGATACGTATGTTATGTCAGCAAAAAGAAAACGAGGTCAAATTGCCATCCGAAGGCAGTGCATATTACTGCTCTAGAATATCAATGAAGGAACATTACTGAATGCAAAGAGATTCTTAGAACCATAATGCAACCGTTCGAAGCCCTTTCCATCCGACAGTATCAGCTACTACGTTATGCCGCACGAAAAGCATCAAGGTCTTCCTTCCGGAATCCCCCACCTTCACGAATTACGCGTTGTCTGCACTGGAGCGAAGCAAGATAAGGGATAAGTTGAGCTGTCTCGGGCATAAGTCGACACTACTAAGCATCACAGTATTATACAGAAGAGGCAAGGGAGTGACAAATTGAAATCAAATAATACTTTATTTTACGTATAGATGTTCGTCATGCACGATAATTGACCAGCGAGTGCTTTTATAATGCCATCCGTATAAAATAGGCTGAGAAACGTAAAGTAAATAATAGATATTAAATTAGATTTTAATAAAAATACCAACATAATACTGTAAACACAACATATGCATTACATATGAATTGACTATTAGATGGTATTATACTGTAACACAGCATTATAAGCAATATATTTTGCCCCTTTGTCACTATTAAAACCTGTCGCACTCCAGAAAGCACTCGCAATCAGTGCACCTTTCACGGCCCCTACTGCCATAGACCATCGCATAAGAAGTAGTGTCAAACGACGCAGCTGACTTCTTTCCTTTCACGACTTCCCCACCCATAAGCATACCTTTCCCATAACTCTACCAAATTGTCTTTACCCGGAGGGAAGTTAATATAAACCGAGCTCCATACGAAGTTAGATGCTATCTATCATGTAGTACGTGAACGATCTTCCGCAGCCCTGAAGCACTAATCGTTTGGGGTACTATATGCATTAATAGACTATACATCGTTGTATAAACGATTAAACAGTGAATAACAGTGGGTCTGCTCAAGGAAGCAGACTAAATATGGAAAACTACAATACGATGCCCGTTGAGTTCAATACACCGATTTTACATGGAAACGTATGTAATAGAGAGGATAGTAAAGAAGATGCCTGTGTTACTCGCCAACAATGCGGTTATTATTTTAAGAAACTAATTAGATTATGTTGGAGTTAGTGAGTGTCTGTGGGCGCATATTCCTGCAGTAGAAAATAAGGCATTCCTACGAGCAGATGGTGGAAGTCACGCTTCATTTCTTTACAATGTTTTATCTTACTGTCTTTATTACCATGGTAGAAATCGAGTATCGAATGTTAAATTGGTTTTATAGTAAAGAAACAACAGACCTACTGTCATGATAGATAAATTCAGTCAACTCCCTGAATTTTTCCTTAGGTGAAGCATTGACGGTGTTAATCTCATAAATTAAGCGATGGTTTAAACACTCTTTAAAGCTATTCAGGCATTTGATAGTATGTAAAATCGTAAGATTATGGACCGACATTGAAAATGAAAGCGTCCTTAACAGCGCTTGGTATGTCTAGGGTAATTTCGAGGATCCGGACAGTGCACGTGTTAATGGTTTACAGAATTGTCGATTTCCACTTTTCATTTAACAGAAAATTAGCCGGATTCAGTGATTTACGTTTGAGGTGACGTTAATTCTATGCCCCAGCACGAACATTCATGCTTTATCGGGCGGAATTGGTGTAAACAACAATTTGAATGGAAGTAACTTGGATCACCAAGCCAGAAATAATGAATATTTCTAAATAATAGACTTATCGAGTCACCAATCCCAAGGATATTTTCGATCATGTTTCAGTTTCGTTTGATTAAGTCTGCTTTTACTCCTCTAAGAACACCTGACCAGCAAAGGTACACAATACTTTATATCAATAAGAAACCTGCCATAATAGTTAGATTACTAGCAGTACCTGCCCCGTCGGTTTCAGCATTTATTGGTTGAGAGTAGATAGAAGACAACCGTGAGGAAGCTATCAAACTAAGTAATGAAAACTTTCCTGATATGGAACTCATCAGCGCATTTCTAAATATGAAGAGTTAAGACGTAATGAACCACATTCAAAGTGACTAAGTAAATTCAAATCGAGTTGTTTGACATATCCAGCGAAATATCTGCTTCGAATGAGCTCTGGACATGCAATTGTTTTATTTATGACAAGATTAGTAGGTCTTATTTGCGAAAGTCAGGCTGTTAACTCGTACCAGATTTATGCATCCACTTTTAACTCTGTTTACGAACATTAAGGGTACTACATGCACGCAATGGTGCGACTATTAAATAATTTGACGCAATCTCACTCTGCCAGATTTAAAGTACTCAAATGATCTGAAGTCCTACCGTCAAGAAGCAGCACTTATCCGTCCTAAGTTGAGACATTCATGTGGGCGGAGAACTTAGGTGTTTTATAACTCGGTTGCTGTTTGACTACTGATCGAGTACGTTACCGCCTTATTATCGCAGTCCGTTGATGCGCCTTTCTTATGAAACCATTCTCGTGACACTGGTGTGACTTAGTCACATAGGATTGAAAGTTGAACCGTTTTAAAGCGAGGTATAATGAACAGAGATGAAGGTAAATACAATGAAAAACTACTTCCCCATGTACTAGAATGCTTAATAAATTAGCCCGAATATATGCAGATAAATGTTAGAAATAATTTCATTACTCACTTCCCCACTTTTTGGCAGAACAGACACATAGAATATTAAGCTAAGTCAGTTATTTATCTACGACAGACACACCTCTGCTACAATAGTAGGTAATTGACCTGACAATTAAATTAGAAAGCTTTATGAAGATAATGCGAGATAAACAAACTTAGAACACTTACTACGAACATGGTTTCATCATAGTAGAAAATTTAGTTTTTGTGGTGATAGACAGACAAATAGATCATTTTCTTCCTGCACATTATCGAATTTTCTGATGCCTATTACTTTAGTCCCATCGTGCCGCGACTGCAATATGAGAAAGGTCAGAGTGTTACCGAGCCAACCAAGCCAGCGATCATCCCCTATGACAAGCCCACATTTTCGTCAGCAATGGGTATGCAAATTTCGTTCCTAGAACTCCGGGTGCTATCAGTTTTATGTTAGAATGCCCGGCGAACTGCAGAGGCAAGAGAAGACAAACACATATTTAACGGTTTCATTCAAGGGTCTAATGTTGTCTAACAGGTATGGTCGTTTGAAGCAAGGAAGCACTTGAGGAATGAAGTACTTAACAGAAACTCTTTCGTAAATTATAGGAATAGATTTATGGTAGAAAGCAACGTTTCAGCACTACAGTCAGAATTTATTGAAGCAATCTAGAAACCTTATAGATTTGAATGACTTCCCCGGCATTACCTTGGCAAAGAGTTATGTATCAGTCACAACTCGAAGATTTTCAGGATCTAGAATATGATGAAGATAGAAAATTACGACTAGTACGAAGTGAACGAATACTTTTATACGAGAGGCTGTTTTACAAATCCGGTAGTACATAGCGGTCCGCATGTAATCCGGCGTAGAGTCCATGAAGAGGCTCGTTGACGTTGGCCTGCAGCAGTCCTAAATACCGTACAGTCATAGATGGTCGGTGGAGGTGTATACAATCCTGCAAATATGTAAATCGGTAGCAACTGGAATCGATCGACAGCCCACTGATACACGAGTTCTACCAGCCAGCCGCAGCTACGTTCCTGCATACGACTGTTAGGGCTCCACATATCTATAGCAACTTTATAGCGCAGAGCCAGCCACAACTCTAATTTTAATACATAATGAATGATAATAATATTACATCAGTGCAACTTGTAATAGGATTTACTATGGTTCTACAGAATCATTGCAAAGATCAAACAACTTGTATTACATTGACAGTTAAGCAGTTACTTTTACCTCTAATATATCAGCATGGAGCATGCACTATCAAATGAGAGTTGACTAAAAACCATGGGGAAGGAGCAACCATTATCGCACTTGCTCAAATGCATTGATACATATTTTACCCTGAATTATTTCGCTTGAATTTGAATCAATTCGCCAACCGCAAGACAGTTGACTTGGTCTCAAACAAACAGATTGACAGTATTTGACATTTATAAGAAGAGGTTTTAAAATGAAGGACTGATCCATTAATGAGTGGCCTATTCCCAATAGATAGAACTAGGCATTTAGAATGAATCGGTGTATAGCGGCAAGGGCCTCTTATTTCATGTACATTGAAGAAGATACCTTGAGTTGGTCAAATGAAGTATGTTAAATCCACGTATAAAGTGAGTCAGACTTGCACGACGAGATCGTCATATTTAACTGAATCATGGCTTAAATCAGACACATCTATCTCGGCCCGCAAGATTACGAATTATTCTTTACGGTAAATCTAAGTACTGAGAGTATAACTGCTGTAACTCTTACAGCCAAATAAACAATCCAAGCGGAAGTGGTCGCCATAACATTCGACTCTTTATTTGATGAAACGCCAGAATAATTATTTAAAATTAAAGATTACTCCATAAGCAAATTAGTTTAGCATGATAGTGACAATAAAGATTCCTGAAGACTTAAAGAGCGTCTAAAATAGGGCTACCCCTAACATATCACTTCGACAGAAGAGTTAGTCTACCACTTGCATACGACTTTAAAGGACGTTATCACATTCAAACATTAGCATCGTTGGTAAACAATTCCATCCAATTACTTTAATCAATACATTTGAAGATCAAGCATAATGTTTTGGCGTTGGCAGCTGACAGCCAAAAGCACTGCGAGCTGGCTTCATTTGGATATCAGGCCTGGCTACAAAAGCAGCATCTACTCAATAATCCAATACAGATAATGCCAATTATAGATGAAGACTTCAGACCGAATTATTCAACTAATAATCAAGGTATTTCATGAAGCCGTGTAGAAACGAAGAAAAACCGACTTTACAGCAGTAGCCAAACATGAACTAAAACCATATTTCCGTTCAGTCTTAAAAGGATTACAGTGGGTGTAAACACCTGAACAATTGAGTACACCATCTTCCCGCACTGCTTCCAATAATACCACAGCCTTGGATATTAAAGTCAAACTCGCTCGCAGAATTCTTTCAGACGAGCGTGCGGCTCCAAACGATTACTCCATAACAAGGGACAGCCGTATCAAGGTGCCAGTTATGTATCAACGGTTCAGCCCGATACTGTCTCCTTCCCACCGTTCCCAACGATTCTTCCTTCGATTCGATTCCAGATCTGCATCATCCAACCACTCCTTCCACATGGAGTGGCCTGGCTATGCATCAGGCTTTTGTTTCTTCCGCCTCCGGATCGAACAGTTTTCTGCATTCGTTATTCCTCATCAGTGTTGCGTTCCTTCTATTCCCTCCCGGGGATAACCCATAAATTTTCCGTAACGACTGAGTTCAGAAATAATAACGCGTCTGAGAAGCGGTCACTAGTTTTACCCCGGCTTGTCAACGCGGTACGCGCCATGCCTAACAGCCAACCTGTGCGGCCCACAATAGAGCCGCAGTATCTACTGAGTGCTGCATATAGTAAGTACTGTTTGCGGCGGCCCTTATGAGGCGGAATATGCGTCACCTTCACCAATAAATCATGATGCCTGGCCACCAGCAGATTACACTTTTATGGTCGTGGTTGTTCACCCCTTCTGAATGCCATTATGCACTCATAGTTAAATGCATGTTTTACGTTTAGGGTCGCAGCGTGACGGTATGGTGTCCGTGATTGACTAATTAAGGTAATACTGAGCACGATGATGGGGTCTAGCGCCGCAGCGGATGGCCGGCTTAGTGTAGGCGCTAGCTAAGCTCCAACTGCTGAAGGTCCCATAAGGTCTCTGGGCGCGCTCCGTAACTGTGATAATCCTGTGTAATGTCCGTTTCCAGCCTGACCGCCTCAGAACTCGTACTTTGA
>70
CCCATTTTCTTTTAGTGCTCTTGCGCCGTGCTTACTGGTTTATCTCGAGATATGCCGCGTTATCGCGCACTTGCTCAAATGCTGCATTGATACATATTTTGACCCTGAATTATTTCGCTTGAATTTGAATCAATTCCTCCAAACCGCAGAACAGTAACATTTATTATTCAAACAAAACCAGATTATAGGATATGACATTTGGTATAACAATAATGTTATTGAAAATGGAAAATGATGATCCATTAATGGCTTGGCTAAATTCCGCAATACGATAGAAAAACAAGGCGATTTAGAAATGTATAGCGAGGCAAAGAGAGGCGCCCTGAGTGCACCCGATAGGAAGAAGCAGAAGTGGAGTTATTAAATGAAAGTATGTTAAACATTGGTATAAAAGTTAGTAGTCAGACTTGCAAAAGAAATTAGCTTCAGTTTAACTGAATCATATCTATTATTAAATCAGAAAGACGATGGGTCGCTAATACCTAAAGATTACGAATTATTACATGCCTTAGCTATAATCTATGGCAGAATCGTATAACTGCTGTAACTGTGGCGACCGTATTAAGATGCGTTCCAATCATCGCCTTGATTTCGCCAACATCATTCGACTCTTTATTTGATGATGAAACAGGAGAATACTTATTTAAAATTAAATTCCATTACTCCATAAGCAAATTGTCATTTAGCATGATACAATATTATGACAATAAATGATGAATTCCTGAAAATATTAAAGAGCGTCTAAACTGATAAGCCTAAAATATCACTTCGACAGAAGAGTTAGTTGACTATACAGCCAAGCTTGCAGAAACGACTTTTTAAAGGACGGTTATCACATTCAATCATTAATCTTTTATGATAAACAATTCCATCCAATTGATTTAATCAATACAACATTTGAAATCAAGCAGATAAATATATTTGGCGGTGGGAGCAGAGGCCGAAGAGAGCCAAAGAAACAAATGCGAGGGGTCCCATTTGGATATCAGAGCTATGAGAAAATACCGCAGCAAGCATCTACTCCAATAAACCAATACATACAATGCCCATTATAGTGAAGACTTCAGGTAATTGGAATTGATTCAAATAATAATCAAATGTATTTCATGGGGAAAATAGTTAGAGAAAACGCAGGCAGGGCTCGGCACTAGATTCGCATATCGCTAGATAAACATGACGAAAAACCATATTTCATGCGTTCAGTCTTAAAGGCAATTGGCGGTGATGTAAACACTACGAACACGTGAGTCATAGAACTTTCCAGGTTCTCCTGAAGATAATAATCGCCAAATAAACCAATACTCAGCTTTACAATATACTAACTAACCGCAGAACGTTTATTTCATACAACGTTTCTGCGGCATCAAAACGATTACTCCATAACAATTGTAGACCAAGCAGGCCACTCAATATCAGGTGCAGTTGATGTATCAACACGGTTCAGCAACACCGATACTCTTCTTCCAGGCTTCCAGCAACGAGGTTTCTTCCTTCGTGCGTTGGCACTCCAGATCTGCATGACCTCCGGACACGGCGCAATATGCTCACTGGCTACCTGCATCAGGCTTTTTGTTTCTTCCGCCCCCGAGATCGAAAGAGTGTGCCTGGCCGGTGGCGAGCCTCCGTCGCCGAGCCGTTGCCGTTTCCACTTCTGCTTATTCCCCTCCCGGGGTAACCATCCTAGATTTTCCGTAACGGACCGGGGTTCAGAAATAAAATAACGCGTCTACAGAAGCCGTCATAGACGGTTTACCCCGATGGTCTTCTAACGAGATGCCACGATGCCTCATCACTGTTAACGAAAACAGCCACAAAGCCAGCCGGAATATATCGCGGTGCAATATCGGTACTGTTTGCAGGCAGACCGTATGAGAGGCGGAATATATGCGTCACCTTCACCAATAAATTCATTAGTTCAGGCCAGCAGATTATAATTTTATGGTCCGTGGTTGTTCACTCATTCTGAATGCCATTATGCAAGCCTCACAATATAGTTAAATGCAATGTTTTGACGGTGTTTTCCCGTTACCTCCCGCAGCGTTAACGGTATGGTGTCCGTGTGAACCAATACTGAAAGAATGGGCATGAGCACACCGATACGACTGGATGCCTGGTGCCACCAATACCAACTGTATGCGCATGTGCAGGGCACTCACGGCTGTACCGCTGGACAAATGAGTACTTAGCTGCCTTGACTGTCACGTTTCGCTCGCGCGAGGAGACGCATCTCAGTGCCGTGCTTCCCTAACGGGCGTAAACTTCCTGTAATGGTTTGCTGTTCCATACTGACTCCAGCCCAGAACTGTTCATCCTTAAACCATGTGTGTGGCATGAGCACCCGCGGCCCCTGTTGAACCGCTCAGACTGTGAGCATGAGCCCCCGTGTTATTCGTCGATTTGTCCGTACGTAATTGAAACTGCCTGTTGTTTTCGTCCCCGTAATCAAACGACGACTTGGTTTTCGTCCCCAAATCCGTACCGGATGCTGCACTGGCACTGTGGGTGCGGTGCGACTTAATTCCATCCCTGTTCCTGAGACAATACAGCACGACCGCTGGCGGGTTTTCCCTTGATTGTCCCCTCTAGCGCATATCAGGAAGCACCCGATGGGGATACGCGACAGCAAGTTTTGGGTAGGCTGATTGTCAAACGCCTGCCCCTGCATCAGGTGACGCCTCAGAACGACGTATGATGCCACGGGATCGGCGCACCTGCCGGAAGGTGAATTCAGCCATCGGCTCCGAGTAATTGCCAATGATACTGCAACGGAATTTTTCAGAATATCCCTGCCAACCTGTCAGTTCAGGAGTGGAAGCGGCAGAAGGAAGAGTGCCGAAAAGAAGGATCGTACAATCTTAGAATCTCTTTCGAACTCCTTCACTGGGCGCCGTCAGTCGCATTCTTCGGTTGTTTACCCGCAAGCGCGTTAGTCATGGTGTAGCATAAATCTGGATCATTCCCGAGCTGCGGCCAGTTCATTCAGCGTATTCAGTGCGTCAAGGTGACGCGTCGATAACATCTGCAATCGCGGCCAGTGATACAAAGCGGTGTTCGCAATCTGGTATTGTTTGTTCCTGAGCGCGGTTGGTGCTGTTGGCGTTCCGGGTCAGTGCCGACTGTCCAGTGGGCTTTCTTCGTTCATCCATTACCACCTTAACCGCTTTGGCGTGCAGCAAGGCGTTTCAGACGTGCTGTTGGTTGCACTGCTGAGCTGCACTATCCGCCCCTTTCTCGTTGTCCGCATCCTCAAGCGCGACAGCTGAAGCTATATCTTGCACGTTTTGCCGAATTTGCACCGTATTGCCGCCGCTTCTGCCGCACTTTGCTCTGCGATGCTGATACCGAGCTTCCCACGAGCTCCTCCTTCGCTCCGGCTGGAATGCAGCGCCGAAGCCGCCGCTGTTTGCGTCTCGCGAGCAGAGGGAGGTGGGGCGTTCCGCTGCTGTTTCAGATGACCTGGCATTCGTCTCGCACGTTTGCCGCCCTGGCAGAATTTCTGCCGCCGTTGCCGGAAGCTGCACGACCGGCACTTGATGATGCGTTCGTTTCTGATGATTTTGCTGCCTCTTTGAGGCCACCGCATCTCGTGAAGTGGCGGCGGCCTCTAACGGGTGGCTTTCGTGGCCGTGGAGGCAGACGTGGCGGCTGATTGTTGTGACGCTGCATCGCATTCGGTTTCTGACGTTTTCGCCGCACCGGCACTGGCCGCCGGAGTTTTGGGGACTCTGCGGCTGCGGCACTTTTCCGCTCGTGCCGTGGCCTTTGCTGATGCCGCTTCTGCGCCGGAGGACCCTTCCTGAGCTGACGATGCAGCCTGTCCGGCGCGGACGTGCTGGCGGCGCGTGCTGGCTTAGTTGCATCAGTCACGGGGCCATCGGGTACCTGAGCAGCTGATGCAGGGCATCGCCGGCTGATTTCTTCGCGTCTGCCGTACTCTGTGCCTACGACGGCGTTACGCGCCTTTGCGCGAGACGAATGCCCCGGAACCCGACGCAGCAGGCAGCGACTCGATTCTCCGTTCATGAGGGGCAAATGAAATGCCGTCCCCGTTGAATCTTCATACACGGTATGGTCCCGGCGTGCATCTTGGAGTGGAAACGTCATACTGCAGGATGACACTGTACTGACCGTACTCCACATCCATGCTGTAACGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCTACCACCCGTGGTGCTGTTACCGTCGGCCTTTCAGCTGAATGGTGGAGTTCTGTACCGGTTTTCCTGTGCCGTCTTTCAGACTCCTGAAATCTTTACTGCCATATTCGCCAGCAAAAGCACCGGTTCCGTGGAGCGTCCACCACTGTGTTACCTGGCTAATGATCAGAATTTATAACCGACCCAACGATGAATCCGTCCGTACGCAGTCTCATGCCGCCAGCCTTCAGCAATAACAACGACGGACGCTGCCGGCATTAATCTGTATACTGCACTCTCCACGCCACTGAGGTATGCCGCATTGCATTTCGTCCCTGGCAGTGGTCGTCTCTTTCGGCCCGGGGAGTGATTTCCGTCTTACGGTAGATCGGGCATTGTACTGCCGACCACTGAAAGCCTCCTCCGCGCGAACGCGCAGGGATGCGCGCCGGCGACCATGTTTGTAAAACCGGTCCGGCCATCACGCTCACATAACGTCCACGGCAGGCTCAGGTGAAACGTATCCTCCCCGGTCATCACTGTGCTGCTCGTTTCGACGCGGCGAAGCGAACCAGGGAAGCCAACGGCCCCCACACTGTCCCGTTCAACGGTACTTCACGTTAATCCCTTCGATGACTCACACCGTATCCCGCCGACAACGACGGCAATGTACCCGGTTTCATTGAAGACTACGCCACCGTAAACGACGTACCATGTCCTTCCGCACGGGCCGCGCGGAGTAACTGTCACCGCAAGTGCGGCAAAGAAGACAGCAACGGCAATACACAAGTCACTCACATCCGTTCCTCTCACTGTTTATAATAAACGCCCGTTCCCGTCCCACGAGGTGAACCTCTGTAACACACTCAGACCACGCTGATGCCCAGCGCCCTATTTCTTAGTACGCCATAACTGCGCATCGCTGGCAAACGTATACGGCGGAATATCTGCCGAATGCCGTGTGGACGTAAGCGTCGAACGTCAGGATCACGTTTCCCGAACTGAGGCGCCTGGCGTGGATACAGGCGATGCGATCGCGATTCCTTCCTCCTCCCCGAGCGAGCAAGCCAAGCACCGTTCATCAGTACTTTCAGATAACACATCGAATACGTTGTCCCTGCCTATGACAGTGCTTGATTCAGGCCTCCTCCGGGTAGAAACGTCAGCGGAAAGCAGCACTATCTGGCGATCAATAAAGGATGGTCATCGGTCACGGTAGAAGTCCACGGGTCCTGACGGCCAGTCCACATGCTTTTCACGCCTGGCTAGGAAAAGCCCGCTCGCCGCCTTTACAATGTCCCCGACGATTTTCCGCCCTCATCCGTACCGTTTATCGTACAGTTTTCAGCTATCGTCACATTACTCATCCGTCCCCGGAGTTCGCATTCACACTGCCACTGATATCCCGGTTTTAGCGGTCAGCTTTCAGCGTCCCTGTTAGGAAAGGCCGGAGGATTGCCATCGCCTAGTAGATGGGTGGGGGCCGTCAGGCAGCTTCAGGAACACGTCGTTCATGAATATCTGGTTGCTCCCTGCGCCAAACATCGGCGTTTCATTCCCGTTTGCCGGGTCAATAAATGCGATTACGATTGGCGGCAACCGACCAGAACTGTAGACGCTCAGTTTGCCTTCCTCCGTGTCCTCCATGCCTCCGGCGCTCCCGCTACCTGACTTCCGTCTGTTGGTCTGTACGAACCCCAAGAGGGATGCGATAGCCTACAAGGCAATCCTTCCACTCTGTTCGAAGCTCCTCCAGTGTTGCTTGGCGTTATCCTCCGTCAGCTCGACTTTTCCATAGCAGCTCCTTGCCCTAGATGGGATTCAGTCTCTTGCCTTTGGAAAAATCCAGGTGACCTTCCGCATCATCTAGCCCGACCGACGACGGCCTCCACGGAATGCAGCAATTGCCAACGTGTTCACACTGCGGATATAAAGTAATAATCATGGCCCGGTTTGATATTGATGGCGGCTATCCAGTACAGCGCTAGTCCATCAAGATAACGCGTGCCTGGTTTCAACCGTCTGATATCCGCAATCTGCTTTTCCTAAGAACCAGAACCAAACTGTACCGTCCGTATAAACGGCAAGATGCGGCGTGGCGGTTATCTGGAAAATAGCCCGGCGTCAGCTCAATCCTCGACGGTGCTGCCGGTGCGGCAATCCGGAACCGATACCGACGGATGTACGCCTTGCTGCCCCCACGCATTTACCGCCCGGACTGTCAGCCTGTAGTTCCCCAGCGCCAGTTGCGTGAAGCGGTATGTGATGCGTTGTAGAATCGTACCAGCCGAGGATTGCACTCGGCGCGGGGCCGTCGTCCACGTCGCGTCGCCTCAGCATTCCGCTCACGCCCTTCGCCCCTTCGGTGTGTCCCATCGCCCCCTCATGATATTCCCGCTGTCTGCATGACTTCTGCGGTCAGGTGCTGCAGCTGGCGGCGTGACACCCATTCACCGTGCCACTCTGTTCGCCGTCAAAGTGCGCCCCGTTATCTAGATTATGGCCTCTTTTCCGGCTAATCCTGCTGCACGGCGGTGATGGCATCCGTTAGAGCGTCGTCGTTCTCACGATACTGACGCATAGAACAGTCGCATGAGGCAGCGTCGGCAGCTTCAGCTCCCATACGCTGTATTCAGCAACACCGTCAGGAACACGGCTCATTTACCTTTTCACGCCGTCGGTGACGGACCCTCCACGCTGACCGCGGATTGCCACTTGCGTCAACCAGGCTTATCACGCCCGGTATACCGGAGAGATGGCAGCGTACACTTCACGACGGTCCAGCGTCGGGAGCGTCGGGTCTGGCTTGTTCACCGCCAGAAGCACGACCCGGTGCTGATACCGGCATAGTCATCATCGCAGATTTCAATAACACGCGCCGAATACCGGGGAACCCCGATGCCTCCCGAAGCTGAAATCCACGTCTGCGTTTCCAGCAGTTCTTTCTGCCATCCGCCCAGCCCGGCGCGGTGTGCCTGCCCCCGGCTGGTACAGCCAAGGGCATCCATCTTCGTAACAGTCGACCGTAACGGGCAATGGCCTGCGTATCTTCAACAGCTCTGTCTCTGCCGTCTCCCAGCCGTTGTTCGGGTCAACCGAGTTCACTCAACGAAATGGTAATAGGCGGCTTTATCTTCAGGGCGCTGAAGCTGTAGCGGAACGGCGCGCCATCAATGAGGCATCACCACATTACTTGAGTTATAGGTCCACTTTATCCGACGGTCGGTCCTGCACGAACGTCAGTGGTGCCCGTTCCATACCGGCATACAGCGCATCGCCGAGCAGAAATCAGCCCCACATCCACGCCTTACTGACGCTGTGGTCAGGTGAGCATTACAGGTGGGTGATGCGCGGCTCCCCGTCCCGCCAAAGCCGTCCGGCACTGACTGGTCGGCCCAATCTATCAGGAATACATGCGGGGCCCATTTATCCCAAGCTTAGCCGCCGCACCAAGACGTTCTCCCCATGCCGTAGCGGATGGAGTGGAAGCCCAAGAAGAGACTTATTGAGGTATGCCGGTTTAAACGTTCCGTCCCGACAGATACCGCTGTATTGCCGTCTTGAGGGTCAGTAGGGCACGCCTGCGCCGATACGCCGCCGGAGGTGGGTAGGTTGCCGGCTCTAGCTGCTGGCTGCCGAACTGCAGCGAGTCCACCTGCACGCCGACCAGTGCCGTGTTCGGTAGCACTGTTCTACATCGATGATTTCAGTGTATGACGACCAGAGCGTTTGTTCTGCAGCTGGTCTGTGGTGCTGTCCGGCGTCATCCTGCGCATCCTTGGAGCAGGATATTAAGCCAAACGCGCGGCGGCAGGTCTACCCATCACACCAGGCCAGATGCTCTGCAGGTGGTTGAGCTGTAATGGTGATGTCTTTTCTCGTTACCCAGCCACCGTTACGTTGTATCTGAAACCAGCAGGCGACTTCCGACGGATTCCTGTCACCCTTTGAGGTGGTTTCCACCAGTGCCTGTACACCGACCATAGAAGGGGCAGACGGTCGATGTTTGCAGACGTAATGGTGCGGGTGAATTGTCATATTTCACATGCCGAGCCCGAGAATTAGCCGAGGAATGCGATTCCCGATCCGCAGGGCTTTATTGCTCCTAGCCCCAGCCCGGAACACCACCGTGACACCGGATATGTTGTATTCCCCTCAGTGTCCCAGCATCCATTCGGCTCTTTCCTCATGCAGCGCGCCGTTGCACTCATCCAAGCGACCTTCAATCGTAGTGCGCTGATGGCGGTGGCACAATCACCACACTCAGCTAACTGCGTGGACTTCAGCTTGTCCTTCATTCCTAGCGGGGTCCCTTACTGCTTCCTTTACCCATTCCTCACTCCATAAATGACAAAACCGCCGCATAGCGGTTTGGTTTAT
>71
TTTGATGGCGTCCTTACCTTATGTTTAACTGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCACCACCACAATCCGTAAGCTGTTACGTCGGCTTTCAGCTGAAATGGTGCAGTTCTGTAGTACTCAGTTCCTGTGCCGTCTTTCAGGACTCCTGAACATCTTTACTGCCATATTCACCCCAAAGCACCGGTTCCGGCGGGCTGTCTAGCCTGTGTTACCTGGCTAATCAGAATTAACCGATCCCAACGATGAATCCGTCCGTACGCCAGTTCCTTCCATGCCTTCATAAGCAATATGGACAACAGGACGGACGCTGCCGGATTAATCTGTATACCTGCACTCCACGCCACTAGGTGCCGCATTGCACTTTCGTCCCTGGCAGTGGTCGCGTTAGTCCTTTCATACCCGGGGAGTGGATTTCCGTCTTACGGTAATCGGATGTACTGCCGGCAGACTTGACTCGCTAGCCGGCCAGTGAATCACCAGACCTGCTTACTGATTTGTAAAACCGGTCGGCCATCACGCTCAATAACGTCCACGCAGGCTCAGGTGAAACGTATCCTCCCCGGTCATCACTGTGCTGCTCTTTTCGACGGGGTGAAATCCCCAGGGAACCCCATCATCCCCACACTGTCCGTCACTCATACGGTACTTCACGTTAATCCCTTTCGTCAGATGACCTACACTCACCGGTATCCCGCCCGACAACGACGGCAAGATGGCCCGGTTTCATTGAAAGTAGCCCACCGTAAACGTACCATGTCCCTTTCCGCACGGGCTGAGAGTACTGTCACCGCAAGTGCGGCAAAGAAGCAAACGGCAATACACCAATCGCATCGTTCCTCTCACTGTTTGGTAATAAACGCCGTTTCCCGGACGAACCTGTAACACTCAGACCACGCTCTTACCCTCCGCTTTCTTAATGCCCCAGATAATGCACATCGCTGACGCAAACCGTATACGGCGGAATATCTGCCGAATGCGTTCATTAGGGCACGTGGCAGCGAACGTCATTCAGCTACAGGATCACTAGCCGTTTCCCGCGACCCGCTGGCAGCGTGAGCACAATACGGGGGAGAACAGCTGTACCGCCTCGTTCGCGCCGGAGCCTCATAAATCACAGCGCACCGTTCATCAGTACTTTCAGATAACACATGAATACGTTGCTTACGACAGTAAATCGCTGTGATTCCTCTACCGAATATTCTAGCGGAAATATTATTAGCAGTCAAAGGATGGTCATCGGTTATCAAGTGACAGTTAAGGGTATAGTACGGCCAGTTAAGTGGGTCGGTTCAAGACATAGCCGTTCTTGTTGA
>72
TAGTGATATTGCGGCGTCTGCTTGGTGTTTAATAATGACTGAATTAGTTGCCAGCTATCCATATAATATTGAGATAAAGCGACCTAAGATATCTAAGTAAAGATAAGAGGAATGATTTCCTTAATTTTCCGTCCACTGCATGTTATGCCCGTTCGCCAGCTTGCTTACCATGTGCCTGGTTCCTTGCGCTCATCAAGCGTTGCAGGTCCTTTCAATCTGTTTGGTATTCAGCCGACCTGTAAGGTCTATCGATTAGTGCGCTTTCGTCACTCGTGATTTCGGTTTGCGATTCGCCGAGAGAAGTGAGGTGTGGCGATCCCGCTCAGCCACGGGATTTGCTGCTTTCCATGCTCTCCTGTTTCTCTGCGCGGGGACGTTCCTCCGGCGTGTCTGCATCCATCTGGATCTCCTGTCAGTCGTTGGTGGTGTGGCAGTTGTAGTCCTGAACCGAAAACCCCCGATTGGCATTGGCAACGATTAGAATCGCACGTACAGGCCAATGCTTCGTTTCGTATCACACCCCAAGCCTTCTGCTTTGAATGCGTCCTTCTTCAGGGCTTAATTTAAGAGCGTCACCTTCATGGTGTCAGTGCGTCCTTAGTGATGTCAAGGGTGGCCAGTATTTATGTCAACACGCCAGATAATTATCACCGCAAGATGGTTATCGTATGTTTATGAATTTATTTGCGGAAGCTGTGGCAGGAGGCTGGGGATGAAAATCGGTGAGTTGTATCTATTTATTTTCAATAATACAATTGGTTATGTGTTTTTGGGGCGAATCGTGAGGCAAAGAATCGCGGCTGAGCGCCGTGATTCTTTCTCCTTACATGTATAGTTGGAAAACAGGGCTGCATATGAATGAACGAGTGCAGAGGCAATGCCGATGGGCGATAGTGGGTAGATGTAGCCCTTATGCTGGGCAGTGGAACAGACTAAGGCAGAAAAACAAAGGCTCCAAGCTCAACAAACTAAGGGCATAGACAATAACTACCCCATTATACCCATACTCTCTAATCTTGGCCACGTCGGCGCGTTCTGCTGCAGGTGTAGAAACTATTCAAGGCAGCAATCAGGATTGCAATCATCGTCCTGCATATGATTATCTTAGCACCTGGTCTAGAAGAAAAGAGAGGAAGCCTAGGGAATGATAACCGCAAGGAGCAAGTGCTTACGATAACGTAAGGAATTATGTACTATGTAAACAGGCATGATTCTGTTCGCATAATGATTATCCTATACGACCTGTCAATCCTTAACTTTGCCCACTGCTTTTAAACATTCCAGTATCACTTTTCCTTCTTGCTCCGATATGCGGCTCTCTTCAGCTATCTCAGCATCTTATCTATGTTCAGAGGCATGAGATGAGCCTTTTCTGATAAGTAGTTCTGTTAAATATCTCCGGCCTCATCTTTTGCCCGGCTAATGTCTGAAAATTGAGGTGACCGACGTGATAAAATAATATCCTTGGCATCTTTTTATATCCTTTTAATTTGGCCTTAATGACTATATCCAATGAGTAAACCGCCTTCAATATCTTTACGCCGGCACCTTTAATATATCATCACAGGCGAGAGCCCGTAGAGTCCGAATTGTTCTGACCGCCATGAAATGCATATGCATAACATCGTCTTTATGTCCTCCTCATCAGTACGCTCTATCTGAACGCTCTCCAACACGCCCTTAATGACATTCCTTTCCCGATTAAAATCTGTCAGATCGCTTGATGCCGAGATAAACAGTTCTGCTTACCAAACCAATGGTGTCGCCTTCGCAAGCCACATCTGGCATGCGGGTTCGTCATCTGCGGGGTTTCTTGCCCTCATCTTCAACTGAAGCTTTGAGCGATTATCTTCTGAACCCAACTCTTGTCATTGTTTGGGAGAATTCCATTTTTCCATCACATTTTATGAATACAAGCCTTACGGAGCAGTAGTCCAGCTCATCTCATGAAGCAAGAGAATTAATCAGGACAGGAAAACAGACCAAGTACGGCCGAGGTAGCCTTGCGCGTAGTCTCGAGTAAGTTGAGCATAAAAACCATTCTTCATAATTCAATGCGACATTTACTATGTTATGTCCGGGCGATACCAGCAAATTCCCTAATTCGATGAAGATTCTTGCTCAATGATTGTTATCAGCTATGCGCCATACCAGAACATGCCGATCATCATCAAACGTCTCTTCAGGCCACTGACTAGCGTATAATTTCCCCACAACGGAACACTCTACCTCTCAAGTCCATGGGATACCTTGGGTACTGTGGGGTTTAGTATATGGTGTAAAACAGTACGACTTAATCCTGCTTTTCTTACCGACGGGTACATCGCCCCCAAGTCTGGCCTGCAGAAATCAGCTGGCTCATCAACATCGCCTGCTCAGGGTCAACGAGAATTAACATTCCGTTGGGAATGCTTATGGAGCTGTTGGTGCGGTCATGGAATGTAGTCTTCAACCTCCAAGCAGGAACGAAGCAAGAATCACTTTGTGCTTACCCATCTCGCATCACCCGTTGGTAAGGTCCTAAGCTTAGTAGAACATCCCTGCCTGAACATGAGAGAAAACAGGGGTATCCACTCATTCTAAGTGACGGCTGCATACTAACCCTTCATACATCTCGTAGATTTCTCTGGCGATTGAAGGGCTAAATTCTTCAACTAACTTTTGAGAATTTTTGGCAGCAATGCGGCGTTACAGCAGGTTTAATGCATTGATGCCATAGTTAATAAAGCACCAACGCCGAACATCCACCCATCCCATCTTGTCCGGTGACAGATTCCTGGGATAAGCCCCAAGTTCATTTCTTTCATAAATGCTTCAGGCAAGAACTTCGTTACAGCTTCCTCTTGTTAATGGTTTCTTTGTTACGTTAATCTATCGCAAGGGATAAATATCGACAGTGGGGTGGCCGAGTCTCAGGGGGTAAGAGCCTTCGCATGTACTAAGGAGGTTGTATGGAACAACGCATATCCCTGAAAGATTATGCAATGCGCTTGGGCAAACCAAGACAGCTAATAAAGATCTCGGCGTATCAAAGCGCGATCAACAAGGCCATTCATTAAGGCAGGGTTTTAACTACGATAGGCATGGTGGAAGCGTTGATGCGGAAGGGTAAAGCCTTCCGAGTAACAAAAAGACAAACAACAGCATAAAGCCCGCTCTTACATTCCAGCCCTCTAAAGGCTTAAGGTCAAACCACACTATGGTCTGCATTATTTGCATTCCTCATTCAATCAATTGTTATCTAAGGAAATACTTACATATGGTTCCAAACAAACGCAACGAGACCCTGGATTCCCCGCATGCGTGCTGGTATGGTAGACAAATCGCAATGCTTGGAACTGAGAAGACGGAAGCTGTGCGTTGGGTAAGTCGCAGATCCAGGCAGGAAGGAGAAACGGGATCCAAAGTCTCAATGCTGCTTGCTGTTCTTGAATGGGGGTCGTTGACGACGACATGGCTCGATTGGCGCAACACAGTTGCTGCGAGGATTCGCACCAAGAAAACGCCAAGCGGCATGACCGAGCGTTCTGAACAAATCCATATCATCCAGAGTTAGATCGGTAGCATCTATCAACAGGAGTCATTATGACAAACCACCAAATACCTCAAACTTCGGCGCGGGTATTCCACTCCAAGCGTAATGTGGCAGATCTCGATGATGGTTCGCCAGACTATCACACTATGCTTGAGGTCATGCACAGATCTTAACCAAGCAGACAGTTCAAATCGGTTAGTTGCCGGTTCTGCGATGAGTACACTGACTGAATAAACCGGACAGAAGCCAGAAACCATCTTAAGCGAGATCAAAGTTACCTGTCAAACGGTGCAATGAAGCCAAGTTAGAAGAACTCGTCAAAGATGAGGCTCTTATCAAGCAGCATAGGCAGCTGGAGAGGTTCTACCAACAAACATCTCAGAATGGTGCATCCCTCAAAACGAGGAAAATCCCGCCTAAAACTAGAACATAAACCTCCAAATTGGGGATGCTATCCCTAAAACAGGGCAACAGACATTAAAGAAAAGAAAGATTATTCGTCAGAATTCTGGCGTGACGGGCCTGAGAAAACGACCTTTCTGTGAACAAACCGGATGCTGCAATTCAGCAGCGGCATAGGCGGTGAAGCAGAAGACTGACCGCAAGGTCGATGTTTGACATGGTGGTGAAGACTATCAAGCACCATCAGCCAGAAGGAAGTGGCGCTTCGGGGCAGCTCCGATAGGTGCGTGAACGTGACCGACTGTAACCACCGCGACATGTGTGCTGTTCCTGGCATGCCAGAACAACTTCGTCCGTAACGTGCTGGCTCTCCCGGCCAATCCGCGATAAGTGGACCCAACTCGAAATCAACCCGTAACTAAGCAACAGAAGGCAGGCGTGACAATAGCCAGCAAACCAAAACTCGACCTTAAACACAGACTGTACTTTACGGGGTGATCCTTATGAAAAACAATAGCACAGATGGTTATTTACGTGAGCAGATGCGTTTGGATCGCCAACAACATTGCCGGAACAAGTACCACGAACGCAGGTACAGCAGGTAGCGCAGATCATCAACGGTGTTCCTCCAGTTACTGGCAACTTTCCCATCCGACTCGACTCGATTGGAGGAAAGAAGGAAACCGAATGCGCCAGTGGGTTCTGGCTTTCGGAAAACGGGATCACCGATGGAACAATCATCGGAATGCGCTGGCTTCGAGTACACTCATTTCTGCCATCAGCGGGCAATTTGTTGCATGGTGATCGGGAAGAAGCATCCGTTACCGCCGGACTGCCAAACGTCAGCGAGCTGGTTGATATGGTTTTGAACTGGTTAGAAGCACCGAAGTGTATCCGGATGCGGAGTCTTATCCGTGGAAATCAACCGGAGCACTGGCTGGTTACCACAACGTATCAGAAAGCTGCGGGCCAATGCGGTGATGCGGGGATTACGGACATGAGGGCAGGTGGCATTAAGCTTGTCCATATGACTGGAATTAACCGTGTGAGGCGAATGCCTGAACCAGTAAACAACTTCCTGTCATGGCGGTAAGCGCCGAAAGCATGCGAGGCACATAGGGGAAGATCGCAGAAATCAAAGGCCGTTATCGACTGAAAGGAGCAATTATGACGGGCAAAGAGGCAATTATTCATTACCTGGCACGGCATAATAGCTTCTGTGCGCCGGACGTCTCAGCTAACAGGCGCAACAGTAACCAGCAGCATAAATCGAGCGCGGATCGCATCTAAATGCAGGTCTTTCCTTATCGAAGGTAAGGTCTGGCGAACCTTATTACCGTTGCTGAGGGAAGAACGGGAAGGAAGACATCAGCACGAACTGGTTTTTAAGGAGTGGCCAGATCGCAGCTCCGAATTAGATGGCGGTATGAGAATTAAGGACCATCTACATTAAGCCTAATAACAGCCTGCTGGTAATCGCAGGCCTTTATTTGGGGGAGAGGAAGTCATGAAAAACTAACCTAAGCGTGGGAATGGAAGCCCCGCAGAGGCAAAACGCTATTCACGCAGTGAGCAAATCCTTCCAGACCCAACCAAACCAATAATCGTAGTAACCATTCCGAGACCGAATGGCAGCTTAGACCAAACAGGAAGCTATGGGCCTGCTTAGACTTTGTCTCCGTCAGGTTGAAATGGCATCTGGTCGGCTGGATGCAGAAAGCTGGAAGTGTGTTGAGCGCAGCATTAAAGCAGCAGGCTCATGTTGTTCCTAACCTTCAGGGGATTCTGGCTTTGTGGTAACGCCAGTTGAGCAGCATGCGTGACAGCGAGTTGGTGAGGTCCAGCTTATACAGGCATTCGGTACAGAGCGTGGCGTTAAGTGGTCAGACGAAGGCGAGACCTGGAGTATGGAGGAGCGAAGATGGGGAGACAGGAGGCGCCCACATAATCGTAGTTCCGGTGGCAGACGTCAGCATATTTGCTCTCCTAATGGAGCAAAAGCGACGGGCAGGACGTGCATTACGTTTCATGGATACAGGTTGAACATCCAATACTATCGGTTTGTCAGGAAGTTGTGAAGTTCTGGATAGCGCTCACCGTATTGCAGGTCTATCAACCTAGGATGCTAACTCACAACTGAGTCACGTATGAAGTGAAGGATATTCAGACGAATGCTGTTCTGAAGCCATTTATGGATATGGTGATAGAAATATGAGCAGCTTCACCTCCGGCGTTCTGCAATGACAGATTAAACCGTTCCTGTCGCCAAAGCTCTGTGATGATTTCGGGCGAGGCGGAATCCCACCACGTGGATTGGCATCAGAGCTGATGAACCCGAAGCGGCCGCGACGCGGAAGCGAGCTCCTGGCCGCTGTCGATGTTAGAAGGAAGATATCCTCGCATGGTGCCGAAGCAACAACCATTCGAATTTGCAAATACCGGACATCTCGGTAACTGCATATTCTGCATTAAATCAACGCAAAATCGACTTGCCTGCAAGGTGAGGGGATGCAGCGTGTTTAATGAGGTCATCACGCATCCCATGTGCGTGACGACATCGGGAAAGCCACAAAGAGATTATGTACCAGGAAGAAGCTGACGGACCTTAGAAAATGTATTCAGAAGACCCATTATCAAGCCCTGTATTCCATGGTGGACAGGGACTAAAGATTCGATACCGCTCTTGTTCTGAGGTCGGTGAAAATATTTGGAGGGCAGCTTGATTTCGACTTCGGGGAGGAAGCGCCCGACGAGCGAAGGTATCTAGCGCGGTGAAGGCAACCAGAAGATAACCGCTTCCGACCAAATCAACCTTACTGGAATCGATGGTGTCTCCGTGAAGAACACCAACAGGGGTGTTACCACTAAGCAGGAAAAGGAGGACGTAATCTGCACTGAGCAGCGAGCCTGGCCACTAATCTGCGAAAACTGCAAATATACTTTCCAACGAAACGCACCAGAAATAAACCCAAGCCAATCCCAAAGAATCTATCAAACCTTCAACTACACTGAGCCTGTGGCATATCCGGTGACGACGTCGTGCGGGAAAACAAGGTGATTGACCAAAATCGGCGTAAAGTTACCGAACGAAGCGTCCGGCCGAGCTTAGCTTTAGACCCTTCGAGAAGCTGCATGTGCTGGAAGATGTCGCTAATTGGGCCTCGACTGCTTGAGGGATGATCTGAGCACGATCCGAACCCGAACGAGGGAAGAGCACTAGTACGACAGAAGGCCATTAGG
>73
TAGGTCGCTGAGTGCGATCCCGTTCAAGGCAATAGAATTTACGTTTTCGTCTCGTTCTAACTCCGAGCTCGGCGCACCGTGCCAGAGCACATCCTCAACGAACGTGCCGGACTTGTAGAACGTCAGCGTGGTGCTGTCTGGTCAGCAAGGCATCGCAAGAATTATCGGACGGCAGCACCCGTCGGTGTACTAAGCACGCAACCAGCTTACGGCTGGAGGTGTCCAGCATCAGCGTATATTGCAGGCGCTTTCACTGAAGCGCCGTACCGCCGTAGGGTCAGGGTTTGCGTAAATGATGGTAAAGCGGTACTGTTAAATGCGACGGTACCTATCGGTTTGGTTTGCTCGTCGCCTCGTAAATTACTCATGGATGTTCGGCGGATCGTCTCCCAACCCTATTGGATTATAATGCGAGCGGTTAAAGTTAGGCCCGGGTGAGGCTCCCTACAGTCGAGCGCGTACTGCGCTAGGTTGGCACTCTGTGGTACTGCGGCCGATCCGGCTCGTTGCCCCGGTCGGCCGGGGTTCGTAAGAGCACGCGCGTCAAGGTTTCGTGAAGTTATGTGCTCCTCCGCGTTGGGATCCCCATAATCCGGCTGTTCTGCCGCGGCCAATGCATGACGTATCCACGTTCGTCGACTCAGGTCCTAGATGATTTCCTAACCCGTCAGCCTGGCGCCGTCAACATGACGTCAACATGCAGTAGCAAGTCGGGGCCAAACCATTGTCGTACTTGCCGTGACTTTGGTCATGTCGCCTAACGGTCGAGACGCGTTAGGGTTGCGGCAATTAGCATCGCATGGCTTGGTCGCATCAATTAGTTTAACAGGGTTAAACAGCCGTTAGACTCAATGACTAGCCCTGACATGTACTATGCGACTATAATGGTACAGCACGGGTCGATGTAAGAGACAGCCTACGGCCGTATATTATTAAGACGGGTTTGACTGCGCGACCGGACTGAGATTGCGTCTGAGTAAAGGCTGGCGACTTTACGAGCCTTTGATCTAGAAGATCTAATCACCGATTGCTAATCGACATTAACGGTGCACGGTCCACTGCAGCGTACTTTCAGCGTTTCTCCACGCAACGACGGTAATTAGTGCCTGGCCGCATCGACTCCGATGGAGCTTCTAATGAAGCGGTCCGTACAGGCCGGGGAGCGCGGGGTAAGCATGGAGGCGGTAACCTTGACGACGTGAAGTTCATGTCGTTGGCTAGCGCCCTGGCTTTTATTCCTAGGTGGAAATGGTCGAAACCGAAGTTAAAATCCACCCGCCGACGCTATCGCTAGATGAGATTCAAAGCCCGGCCGACGGAATGCATTTCTATGAATGAGTACAACCCAGCCTGTTGCAACGGGCAGATAAATGCCGTTTGACGCTGTTGAATGACCCCAGATCGACGAATGCACGCGTCCAATGACCAAGCCCGTTAAGACGAACGGCGAAGGCAACGGAGAGGTCCGACGACGTTCAAATGATAACTCTGAATGAAACGGTCTGTCCTTCATCGACTCCAAACGGGTCACGGCGTCACGGAATGAAAACGTGAAGTCCAACGGAACTGTCACGACGGACGAAAGAATGACGCTTCCATGAATCCCGACGCTCATCCAAGCTGAAGCAGGAACGCTAAGCTACTGATTCAGGCATCAACGGACCATTACATACAAATCGAAATGAAAACTGCAATGCCGAAGCAAACGGTGGACTGATTCACTGTTGAATTGTCGCGGCAACGCACTTCAGGTGCGTGAGAGCGCGGCGGGCGGTCCAACATGCGCTAGGACCGTTCACGACCTTATGAAGGTTTAGTAACGTCTGTTCTCCCGTTTGCACGGCGTTTGGGTTAGACCATTTAAGCACGTCTATCGGCTCGCCTTTGACGGTTCTGTTCGCTATAAATCTAAACTAAGAGCCGACTATCCAGTCGCGTCCCTAGAAGGCACTGCGACCCTTCATGAAGCCAGGCCATTTTGAGCCTCGTCTCTAGAGACCGGCAACGCGTAAACATTTTAGTAGCGAGCCAGCACGCGGCCTTATGATATGAACATGACGCTGCATAGAATTTTCGACATAAGCCCGCAAGCTCGTTCTAGACCCGTTTCGGGTTGGGATCGGATGGGCTATCGGTTTCACGGGGAAGACTAGCCTGGAGGCCCATGGATGCGGGGTATACCCGCAAGCGACTTAACTGGTAGCGCACGGACGAGCGTCAGTTCGGTTAGTCGTTCGGGCTGCATGCGTCCCCATGAGTAAGGTCGGTGACTTTATTAAGCCCGAGCGCGAACTATCGGACATGCGGCGTAATGGAGCGATTCGCGGTCGGGCTCGATTCATTTCAGTCTGACATGACTTTCTGACCTAGAACCGTACATCGCTTATCGATATGCGCTCGATAATGAGCAACTCATCAAAGTTAAAATGGATATGCACGTAAATTTCGTCGTGAAAGATCCGTGCGATACCGTTAGGACATCTGTAAACAGGTATCGACTACCCCATTTGAACACGATCTGCCCGTTAGCCTATTCTCGACCTTGAGGCTGGAGGCACACCGCCCGACTCCAGGACGTGAAATCTGTCATTTCTAGATGCGATGGAGACGAGGATGACGCGTCAAGTAGTGCTATCCAAGACAGCACGTCGGTCCGTATCAAAAGAGCCTGAAGTTCGGACGGTTCTAGGTCTTTCGCCGGGTCCTGATTAAAGTTCGAACGCTGACATGCGTATGTGTCCCCAGCTAAAGCAGGCTGATCTGAAAGCCTACTGGATAGGGTTTAACGCGTCAGCGTGAACTCGACTATTTGTTACGAAATCACGTAAACTTGCTTTCAATAGACCTTTAATTGAAGGCGTCTCCGAGTGGTTTCCGTAAAGATACCCGACGAAGCAGGATTCCAGGAATAGACGGCGAGAAGCAGGAAGAGGGAACAGGAAGCCTAACGCATAGATATTAATCGAGCTGGCGTTGGCGGCACTCCCCGTCCTGTGCAGTGCAAGTGC
>74
GATTGCGGCCTCCGTCTCTTGATATCTCGTCTCTCACTCTATCTCAACCGCCTCGGAGGTTTCCAATCCCGAATGATTGCAGTCAAGCCAGAAGACCTGAATATTTTCTCTGAAAATAACTAATTATCGGAGTCACGAATCCGGAAACGGGGAGAGTGTTTCACGCCGCTTCGTTGCTTGGATTTGACTGCTTTTACTCCCTCTCTAAAGGACCTGACTCATCAAAGGTACACGTACCTTTTTATTGGACCGCAACTGCTGCCGGCAGGTAAAGGGTCCCTATCCTCCGCCCCGAATGCCCTGCCCGATTTAGTTTCGCGGTCGTATGTTACAGTAAAGGACCGCGCTCTGGCTTGAACTCGTAAAAACGCGGCACTTATGAGGTGTTCGACTGACCTTAGAATACATCGGACTTCACCCCATTTCTCCGTATACTCCATGCGATTCCGAAGAAGCAGTACTCCAACTAACGTATTTGACTCGAACTGTTTATGACTAAATCGGAGGAAAGTATATCCTTCGAACTCGGCCTCTGGACGATGCAAGCGTGTTTTATTTACGTAGCCAATGCTGTAGATGTCGTTGGCGGACATTGATGTTATCGTTATTCGACTGAACCCAGAGATTCTCTGCAATCGCCTTTGCTCTCTGCCTTTTGACGAACACTTAAGCGGACTGTACTCGATGCACCGAACTGGTGCCCCGACTAATTCTGCAATCCATTCCCCGAGTCGACCTGCACAATGGAGATTCCACAAATCCTGCTGGAAGCGGAATGGAAGGAGATAATGCGTTAACGACTTGAGACACGTTACGTATGGATATTAGACATCGTTTCCTTCTCGTGAGGTTTTTACTTGAAGTGACAAATTCTGGATACACCACTTATTATCGCAGTCCCGTTGATCCAGCTTTCTTGACCGAAACCCTTCTAAAATTATAATGGTCATGATAGGATTAGCGAAGGTCGAACCGTTTTAAAGCGATGATAATGAACAGAGATGAAGGTAAAGTACAATGAAAAACTTACCTTCGATGAGAACCGTAGCGAATGCTTAATAAATGCTCGCAGACCGATGGGAAGAAGGTTAGAAATAATTTCATTACTCACTTCCCCATTTTTAAGAAAGAACAACAATATAGAATATTAGACCTCCATGCGTTGATTTGACATAAGGACACTTACGGCCCCTCTATGCTGATAATTTGGTAGTACTGACGGTTAAATTTGACGAAAAGCTTTGAATAATCTCGAGATAAACAAACCCGGCGACGATAGATCAAACCTGCTGTTTCATCAGGTAGAAAATGTCATTTTGTGGTATATAAAGACAAAAGATAGATCTATTTTCTTCCTACTTGCAGAAGCTCTAACGGTGATGCCTATTAATTTAGTTCCATCGTGCCTAGAACGCAATATGGGAGAAAGGTCAAGTTTTCGCAGTAGATGAGTAGCCAAGCGATTCCTTCCTAAAGACCCTTTTCTTAGAGCAATGGGTATGCAATTTCGTTTCCGGAACTCCGTAGTGGCTTTTTGGTGTTGAATGCCCGGCGAACGGGCAGCGAGACAAACACAGAGCTGTCATCATTTCAAGCTATTAAATATTGCTAACAGGTAGTTCATCCGAGCAGGAAGCACTTGAGTGAAGGAGCGAAGGGAACCTCTTTCGTAAAGTTATAAGGAATAGTTCAACCGCAACGTTCAGCAGCTACAGTCAGACGATTTATTGAAGCAATCTGAAACCTATTAGATTTGAATGACTTCTAATTATTGGAAAAGAGTCGTATCGCGTGAGCAAACGCGACTTCTTTCCGCATCGCCCGCGAATATGACGGCCGGCCAAATTGACGACGGTATGAGGGGTAGGCTGCTTTTACAAAGAAGGCGACTTTTGCCAAGTACAATCCTGTGCCGATTAGAGCATCATTGGCAACGGTGGCATCCAAGCGAAGGACGTTTGATTTAATGAGGCACATAGCAGTCCTAATAAATCAGTACAGAGCGTTCGATGTAGAGGTACAAATTCTATTTAAATATGTAAATCGGTAGGACTGGAAATCATTCAACAGTGGGGCAGGTCTGACGAGCCAGGCAGCACGTTCCTGCGGACGTGTCGGGCTCACCAGGTACATGATTGCGTGCCAAGGCCAAGCCCGGATTTAGATACGGATACATAACATATTAAAATTTCGTGACTAATTTATATGGTTCTGATAAGAATCATTGCAAAGATCAACAATTATTACGTGACAGTTAAGCAGTTAATTTATCTAGCCAAATATCAGCATCTAGCATGCAACTATCAAAATGGAGGATTAACGGAAAGAAGAAGCGGAAGGCAGGCTTGCATGTGACCGCCACTTTACGTACCTGAATTATTTCGCTTGAATTTGAATCAGATTCTAGCAAACCGCAACGGTTATTGGTCGCCTGACAAAACCAGATCTACAGTGACATTTGGTAACAATAATGTGATGTTATTGAAAATGAGAAAAGTAATCCATTACGGGTCTAGTCAAATGCGCAATACGATAGAAAAGCCGGCGATTTAGAAAGCGTATAGCGAGGCAAAGGCTACTGTGGTCGGTACATTACGAAGCTGACATTGAGTTTATTACAAATGAAATATGTTAACATTGGTAAAATTAGTCAGACTTGCACAAAAGAAATTACCTTCGGAGCGCAGAAGCCCGAATCGTTAAATCAGAAAGACGATGGCTTAGATAGATCTCCCGATCTCGTTACATTGCCTTATAGATCTATGGCAGAAGTGACTGCTGTAACTGTGGCTACAAATAAACACGCCAATCGCGGGTGAAGTACGGTGATTTCGCCAACATCATAATTCGACTCTTTATTTGATGAAGCCAGAGAATAACTTGATTAAATTAAAGATTACTCCATAATCAACGAGGTTGTGCTTTAACATGATACAATATGACAATAAATAATTCCTGAATATTAAAGGACGCGTTAAGATAGGAAGAGGAATGGAAGAAGTTAGTTGACTATCACGGCACTTGCAAACGACTTTAAAGGACGTGGCCCGATCGACCATTAATTTGATAACGATTCCATCCCGTACTTCCTTCCACTCCGGTGATTTGAAGATTATAAGCAGATAAATTTGGCGTTATGCAGCTGACAGCCAAATAACAAATGCCTATGGCTTCATTTGGATATCAGAGCTGAGCCGAACCCAAGCATCTACTCGATAAACCAATACATCAATGCCAATTAGATGAAGACTTCAGGTAATTGAACGATTCAACAGGAAGAAGGGATTTCATGGAAGCTTACAGAAACGAAGAAAAACCGACTTTACGAAATATCAACAGCACTCAAAACATGACGAAAAACCATATTTCATGCGTTCAGGTCTGCTTAAAGCAATTGGCGTGGTGATGTGGTAAACACTGAACAATTTGAGTCATAGAACTTCCATTATTCTCAGCCTCCGTATAAGACCATCCATCAGCTTACAATACCCAACGACCGGACGTTATTCATACAACGTTTGCGCATATACAAAACGATTACTCCATAACATGGGAGAAGCAGGAGTGTACGAGTTGATGTATCAACACGGTTCAGCACCGATACTTCTTCCGGCTTCCAGCAACGAGGTTTCTTCCTTCGTTCGGATTCCAGATCTGCAGCATCCTGAAGCACGCGCGAATATGCTCACTGGCTACCTGCATCAGGCTTTGTTTCTTCCGCCTCCTAAGTGCTAGAACGTTTTGCTACTTCCGTATCCTTCACCAGGCCAGTGCCGTTCCTTCTCTTCTGCTCCCGTGAGACCAGGTAAATTTTCCGGTAACGGGACTGAGTTCAGAAAGAGAAGCCGCCTGAAGCGCCACGTCATAGACGCGTTTACCCCGATGGTCTTCAACGAGATGCCGCCAATTACCGCCTCATCACTGTTGAACAGGCAAAGCCAGCCGAATATCTGGCGGTGCAAGTACGGTACTGTTGCAGCAGACCGGTATGAGGCGAATACTTGGTGAGTCGGTCAACAGACGGGTTCATTAGTTAAACGATTATAATTTTTATGTTAGCGTGGTTGTTCACTCATTCTGAATGCCATTATGCAACTCTAGCACAATAGTTAAATGCAATGTTTGACGCTGCTTCCTAGTTAACCGCAGCGTTACGCGAGGGACGAAGATCGAAACGGGACTATCACGGAGAATGTGAGAACGCCCCGATAATAACCGACTGCTCTGACGCGCATCGCACTGACTGTAGCATGTGGGACAAGCTCGAGCTAATCCTAGGCTGCGCTGACTGTGGTGCCCTGCGTCAGACATTTCAATAAGCACCATCTAGTGCTGTTCCTTTAACTTAGATAAACTTCCTGTAATGGTTGGTCCCACCTGACTCCATACCAGAACTGTTCATCCTTAAAGCCACTTGTGGCGACCCGCCAAACGGTTTGAGCCGACGGCCAGACTGTACGTAGCGGGCTACAGTCGCGGCGGCAGCCGGGACTGATGGAACTGCTGTTGTTCCTTTCGATCGTAGATAAATCCTTCTTTCGTCCCCAAATCCGTACCGGATGCACTGGCACTGTGGGTGCGACTTAGATTCCATCCTGTTCCTGAGACAATACATGGAATGAATGACCGGCTGTTCCCTTGATTGTCCCTCTACAGTAGTACCGAAGCACACCCATCCGATAGGGACAGCAAGTTTGAGGCTGATTTAGGTGACGCCTGCCTGCCCTGCATCAGGACGTAGCCAGACGGAACGATATCTGATGGCCACGGGATTAGCACCTTAGAAAGGCCGAATCGCAGGAGAAGGATGGCAGAACATCTGCAAAGGACGAATTTTTCAGAATATCCTGCCATCCTGAGTCAGTTCAGTCAAGGCTGGCGGCATCATTTTCGCGACTGACGATGGCTTCTTTTCCGTGAAACCGCCTGCCAGCGCCGTCATAGTCGCATTCTTCGGTTGTTTACCCCAAGCGCGTTAGTCACTGTGTTACAAATCTAGATCATTCCCGAGCTGCGGCCAGTTCATTCAGCGTATTCAGTGCGTCATGACGCCGTCGATAACATCTGTACTGCAATCGCGGCCAGTACAAAAGCGGTGTTCAACCCGGGAGCCGAGCTCCTTCCCCCTGAGCGCGGTTGGTGCTGTCTTTGGCGTTTCCGTTCCATTCAATTAAAGCGTCAGTGGGCTTTTCTGTTCGTTCTTCATCCATTACACTTAACCGCCTTTGGCCGTGCAGCATGCGTTTCCGGGTTGCCTGTTGGTCGGACTGAGCTGGCACTATCCCTTTCTCGTTTGTCCCGCATCCTCCAAGCGCGACATGAAGGCTATCGTGCACGTTTTGCCGAATTTGGACGTATTGCCGGGTGCCAATTTTGCTCTGCGATGCTGATACCTGCAGACTCCGAGAAGCGCTGCCTTCGTGGATGCCGTTGACGCACTCCCGCCCTAGTTTTGCGTTATTGCCCGGCAGAGGAGGGCGTTTCTCATGCTGCTGTTTCAGATATGGCATTCGTCTGGACGTTTTTGCCGCCCTGGCAGAATTTTCTGCCGCCGTCCGTTGCCGAGGAAGCTGCACGACCGGCGATAATGTGATGCGTTCGTTTCTCTCCTTCCTTACGTCTCATCGACGCATCTCGTGCTGAAGTGGCGGCCTCGTGAATCAAATTTCGTGGCCGTGAGGAGGCGGCAGACGTGGTTACCGGCTGTTAGAAGCTCCAATTCTGACGTGTTTCACGGCACTGGCCGCCGCGTTTGAGAGACTCTGCGGCTGCTAGATTTTCCGCTTCAGTGAGCTTTGCTGATGCCGCTTCGGCCGGGAGGACTTCCTGAGCTGACGATGCAGCCTGTCCGGCGACGTGCTGAAGGCGTGCTGAGTCAGTTGCATCAGTCACAAGGGCCGCATGAGCAGCTGATGCACTGGCATCGCCGGCTGATTTCTTGCTCGATGTGCCCGCTCCTTCTATCTTTGCCACCACGGCAGGAAATAGAAGCCACTACGCGCCTACCTCCATCGGGCATACTGTCATGGCACAGAGAAGTATCGGTCCGTCCCGGTTGAGCAATCTTCATACACGGTGAACTGTCAGGCGTGCGATGGTGGGAATGATTAGCATTCATGCAGGAGGACACTGTACTGACCGTACTCAATGGATGCTCTGACGCCGGCTTGCTTACTCAGATTCTCTGAGCCCACCGTGTTAGCCCACCGTGGTGCTGTTACGTCTGGCTTTCAGCTGAATGGTGCAGTTTGATCCATTTCCTGTGCCGTCTTTCAGGACTCCTGAAAGGCGGCGATCTCCGAGATCCCACTCACGCCCCGTTAGATCGGGCCTCTATGTTACCAACCTATAATCGTGAGATTTATGAACCGATGGATCCGTTAATCGCCAGTCGCCACTGCCGCCGGCTGTTCATACGTAACCAGTAACGGAAGGACGGCTGCCGTACGTGGTACGCTTAGACTCCACGCTACGCTCTGCCGCATTGCATTAATTTCGTCCCTGAGTGAATGGTCGTCTCTTTCATACCCGGGAGTGATTTCCGTTGTACGGTACGTGATTGATTGCGTAACATAAGCGACTGCTCACTCGAGAAGCCCAATGAAGTGACTGCTTACTGATTGTAAACCGCTTTGATGAACCTAACGACGTATGCACGCAGGCGTCTCATAGTGAAATGGCCCGCTTCTCTCCTGTTGCTGCTCTTTTCAACGGCGGCGAACCCCAGGGAAGCTCCATCACCCCACTGTCCGTCAGCTCATAACGGTACTTCACGTTAATCCCTTTCACGACTCACGGTATTCCCCGCCGACAACGACGGCAATGTTCCCAAGTTCGATTGAAAATAGCGCGTAATCTAAAAGCCAGTTTACGTCGCACGGGCCGGGACTGTTGACGGAAATAGGGAAGACAGGACGCAATACAAGTCGCCAGCATCGTTCACTGTTTATAATAAACGCCATTCCCGGACGAACCTGTAACACTCAAGCCTGACCTGCCCGACGCCTGTTCTTAATCACCGACAATCCGCTCTCCACCGCCTCTCCCAACGGTACTCCCCGTGACGATCCGTTGGACGTAAGCACTCCGTGATCTAATGTCAAACCGTTTAGCGAACATGGCGGTTCGCTCGCTCTGGCCGGCGACTACTAAATGTACCGCATGAGAAGTTCATCAGTACTTTTCAGATAACACATCGAATACAGACTTTACCTGCCGCTGACAGTACGGTGATTCAGAATCCCGTCGACGGAAGGCATAAGGTCTGGCGATCAAAGGATGGTCGTAACTGACAGTTACGTAACGCCGTCCGACCTGACGGTCCACATGCTTTGACGCTGGCGCTGAAAGACGCCTGTAGCCGCCTTTACAATGTCTGAGCGACGATTTTCTCGCCCTTCGCTTCTGCGTACAGTTTTCAGCTATGATTGGTCTAGTGCTCGTCTCAGAGTTCGCATTCGGCAGGAGAAGCTTTTGACTAGGTCAGCTTTCCGTTCAGTCAGGAAAGGCCGGCGATTGCCGCCGCTGGTAATGGTGGGGCTTCACAGCTTCAGGAACAGTCGTTCATGAATATGTGCCATCCCGCTCAAACACTCGGCGTTTCATTCCCGTTGCCGGGTCATAATAAATCCATCTAATGCGGCAACCAGAACTGGCTCAGTTTGCCTTCCTCCGTGTCCTCCATGCTGAGGCCAATACCGCGACATAATGTTTGCCGTAGGCCGGGGCAACCGAAAGAACTGGCATTCCTATCTCCCTGGCATCCTTCGATATTCCGACCCTCCAGTCCTGGCGTTATCCTCCGTCAGCTCGACTTTTTCACAGCAATATTCCCCAGCTCCGATTCACGGTTATCTGCCTTTGAAAATCCAGGTGACTTCCGCATCCATCGCATGATCAAATTGAATGGCCTCCACGAATGCGATTTGCCAACGGTGTTCACTGCGGATAAAATAATAAGCCTTGATAGGTCCACCGGGGCTCCCGTTACATCTGGTCAACCTGGCGGCTATCCAAGTCGGGGTCC
>75
AACTGCTTGGTGTTATGGTTACGAATCACGCAATCAAGTGCTGATTCAATTGATTGAAGGCGACGGCGAGCTGCTGCACCATATTCCTGAACAACTCCGGAGCAAACGAGAGAGGTACACCGACAAATGGCAGCGACGCACATCCCTCTGGTGAGGTCACCGGGCATGGCGCATCTGCTTTACGGGGATTTACAACGATTTGGTCGCCGCATCGACCTTCGTGAAGAAAACGGGCTGAAGCCATCCGGGCACTGGCCACAGCTCCCGGCGTTTCGTCAGAAACTGAGCGACGGCTGGTACGGATAGTGATGGATTGCCGTGCAGGGACGTCAGCACCAGTCGGGTTATGGGGCAGTTACATGAGACTCTGCCTGGCGCTGTAATTCATATTGTTCCCAAGAGTCCTCAGGCCAAGTCAGGTGGCGTATTCCAGATTGTCCTGGGGTGCAGCCATCATGCCGGATGCTTCTTTGACGCCGGAGCCACCCTTGCAGCATGGGGGCAGGATTGAGCCCGGTAGTGAAGCGGCAGCATCCTGTTTCTCTCGGTGCCAGTATGGTGCTCTAGCGGTGTGGCGCATATATGCTGAGATCGAAAGCCAGAACTCCCCGTACAGACAACGCGGATAACGGTAAGCATGAACACCGCTTTCTCCTCACCTGGATAACATGGTTGCCCCGGGCAATGTTGCCTGTTCGAATGACCGGGGAATGCGGCGCGTGGGGTCACGCGTGGTTTCTCAGAGATCAGCACGGCATAACGAAGGGACGGTGTCAGGTTGTGGTGATGCATGCTCTGCAAAATGTTTATGTGAAACCGCCTGCGGGCGGTTTGTTCATTTATGGTAACCGGTGAGGAATGGGTAAAGGAAGCAGTAAGGGCATATCCCCGGAACCAGGGCACAATATACCTGAAGTCGCAGTTGCATGGGTCCGTATCCGATGCCATCAGCGAAGGGCCGATTGAAGGTCCTTACCTGGCTTAAAGCGCTAGGCGTTGCTGCTGAACAGTACGCCGTCCATCACTGAGGACATCGAGGGGAATACCAACATATCCGCGTCACGGTGTTCCGGGCTGAGCAGGAGCAGACTCCGCCGCCAGGGATTTGAATCCTCCGGCTCGAGACGGTGCGTGACTCGGAAGTGAAATAGCGGACACGCCATGATCACCCGGATGCGTTTACTGCAAAACATCGACCGTCTGCGCTTTACCTTCGGGTGTACAGGCACTGTGAAACCCGCCCTCAAAGGGTGACAGGAATCCGTCGGAAGTCTCGCCTGCTGGTTCAGATACAACGTAACGGTGGCTCTGACGAAGACATCAGTTAAGGGCAAAACCACTGAGCAGTATCGCTCGGTGGTGATGGGTACTGCATCCCGCCCCGTTTTAATATCCGATGCGCAGGATGACCCCGTACCACCACAGACCATAACGCTGCAGAACAAACGCTCTGGTCGTCATACACTGAAATCATCAGGGATGTGAAACAGTGCTACGAACACGGCACTGGTCGCGTGCAGGTGGACTCGGCCGAGTTCGTTCGGCAGCCAGCAAATAGGCCTCGTAATTATCATCTGCCGCGGGCGTATTCTGCAGGTGCACCGTGGAACCTATACCGCAGACGCGGCAGATACAGCGGTATCTGGGACGAACGTTTAAACCGGCATACAGCAACAACATGGCCTGGTGTCTTGCGGGATATGCTGATCCCATCCGGCGCGCTACGGCAGCGGTGGGGAATGCAGTGCGGCGGATGTGGATAAATGGGCGCTGTATGTCATCGGCCAGTACTGCGACCGTCAGTGCCGGACGGCTTTGTGAGGCAAGGCCCAGCTGGCTAAGTATAGCTTGTAATGCGTACCTGACCACACAGCGTAAGGCGTGGGATGTGCTCGCATAGGATTTCTGCTCGGCGATGCGCTGTATGCCGGTATGGAACGGGCAGACGCTGACGTTCGTGCAGGACCGACCGTCGGATAAGACGTGACTATAACCGCAGTAATGTGGCTGCCGGATGATGGCTAGCGCCGTTCGTCAAGGCTTCGACGCCCTGAAGGAAAGCCATAATGCCGTTGAGGTGAACTGGATTATACGAACACGGCTGGGAGACGGCGACAGAGCTGTTGAAAGATACGCAGGCCATTGCCCGTTACGTCGTAATGTTACGAAGATGGATGCCTTTGGGCTGTACCAGCCGGGGCAGGCACGCCCGCGCCGGGCTGTGGCTGATTAAACAGAACTGCTGGAAACGCAGACCGTGGATTTCAGCGTCGGCAAGAAGGGCGTACGCCATGTACCGGGCGATGTTATTGAAGACAATCTGCACCATGATGACTGCCGGTATCAGCACCGGTAGTCGTGTGCTGGCGGTGAATGAACAGCCAGACTCCGGACGCTGACGCTCGACCGTGAAAATCACGCCTGCCATCCTCCCGGTACGGGGCTGATAAGCCTGGTTGACGGGGAAGTGGCAATCCGGTCAGCGTGGAGGTTCAGTCCGTCACCGACGCGTGAAGGTAAAGTGAGCCGTGTTTCCTGACGGTGTCCTGATACAGCGTATGGGAGCTGAAGCTGCCGACGCTGCGGCTCCAGGCGAAGCTGTTCCGCTGCGTGAGTACCCCGTGACGAACCAGTCGACGGCACGTATGCCATCACCGTGCAGCATTCCCGGAAAGAGGCCATCGTGATAACGGGGCGGATTTGACGGGAGAACAGAGTGGCACGGTGAATGGTGTCACGCCGCCAGGGCGGTGCATAGATGAAAGGCAGAAGTCACTGCAGACAGCGGAAGATGAGGTGCTGGCGCGATGGGACACACCCGAAGGTGGTGAAGGGCGTGAGTTCCTCCTGCTCCGTTTGACCCGTAACAGCGACGGCAAGAGCGAGCTGTCAGCACGGCCCGGACTAACGGAAACCACATACCGCTTCACGCAACTGGCGCTGGGGAACGCACCGGCTGACAGTTGGCTGCAGTAAATGCGTGGGTAGTCAAGCAGGGCGATCCGGCGTCTTATCGTTCCGGATTGCCGCACCGGCAGCACCGTCGAGGATTGAGCTGACGCCGGGCTATTTCAGATAACCGCCACGCCGCATCTTGCCGCCGTTTATGACCCGACGGTACAGTTTGAGTTCGTTCTTAGAAAAGCAGATTGCGATATCAGACAGGTTGAAACCAGCACGCGTTATCTTGGTGACGGCGCTGTACTGGATAGCCGCCAGTATATCAATATCAAACCGGGCCTGGTTCTGTATTTATAGATATTTTATATCCGCAGTGAACACCGTTGGCAAATCGGCATTCGTGGGAGGTCGGTCGGGCGAGCGATGATAATGCGTGGAAGGTCAACCGGATTTTTCAAAGCTTTTAATAGATAACCGAATCCCATCTCGGCAGGAGCTGCTGGAAAAGTCGGCTGATGACGAGGATAACGCGCAGCGACTGGAGGATTTTCGACCAGTGGAAGGATCAGTGATAATGGAATGCCATGTGGCTGTCAAATTGAGCAGACCAAAGGACGGCAAACATTATGTCGCGGGTATTGGCCTCAGCATGGAGGACACGAGGAAGGCAACCAGCCAGTTTCTTGCCGCCGCCAATCGTATCGCATTTTATTGACGGCAAACGGGAATGAAACGCCGATGTTTGTGCACAGGCAACCAGATATTCATGAACGACGTGTTCCTGAAGCGCCTGACGGCCCCCACCGGTTACCAGCGGCAATCGCGTGAGCTTTTCCCTGACACCGGACTGGAAGGCATCGCTAAATGCGGATATCAGTGGCAGTGTGAATGGAACTCCGGACGGCCCAGTAATGTGACGATAGCTGAAAACTGTACGATAAACGGATCGCTCAGGGAAAAATCGTCGGGACATTGTAAGGCGGCGAGCGCGGCTTTTCCGCGCCCACGGCGTGAAAGGCAGTGTAACTCGTCCGTATACGTTTGTTCAATGATTCACCGTGACCGATGACTCATCCTTTTGATCGCATAGATAGTGGTGCTTCCATCACGTTTCTAGGAAGTAAGCGTACTGTCAGCGGCAGACAACGTATTCGATGTTATCTGAAGTACTGATGAACGGTGCGGTATTTATGATGGTTGCGGCGGACGAGGCGGTACAGGTGTTCTCCCGTATTGTTGACATGCCAGCGGGTCGGGGAAACGTGATCCTGACGTTTCACCGCTTTACCGTCCACACGGCATTCGGCAGATATTCCGCCCGTATACGTTTGCCAGCGATGTGGCAGGTTATGGTATATTAAGAAACAGGCGCTGGCATCAGCGTGGTCCTAGTGTTACCAGAGGTTCGTCCGGGACGGCGTTTTATTATAAACAGTGAGAGGTGAACGATTGATAGGAGTTCGTAATGTGTGTACTTGCCGTTGCTGTCTTTGCCGCACTTGCCGGTGACAGTCACCTCCGAGCGTGCGGACCTTAAATATCTGACGTTTACGGTGGCTATTTTCAAGTGAAACTCATCGGGTCATTGCATTCTGTCGGTAGCGGGGATACCGGTGAGTCATCTGAAGGGATTAACGTGAAGTACTCCGTTATGAGCTGACGGACAGTGTGGGGGTGATGGCTTCCTATCTGGGGTTGCCGCGTTAAGAAAGAGACGCAGCACAGTGATACGACCGGGAGGATACGTTCACTATGAGAGCCTGCGTGGACGTCTTGAGCGTGATGGCTGGCTTTTGATCGACTGAGGCCAAAGTCAGTAAGCAGGTCAGTGCGTACGCCGCATGGAGTGGCTCACAGTCGGTGGTCCGGCAGTACAATGGATCGATCGACGGAAATGGACTCCGCGGTATATGAAGAGACGACCACTGCCAGGGACACGAAAGTGCAATGCGGCGCATACCTCAGTGGCGTGGAGTGCACTGGTACAGATTAATCCGGCAGCGTCCGTCGTTGTTGATATTGCTTATGAAGTGGTGAGCGGCAGTGGCGACTGGCGTACTACGATTTCATCGTTGGGGTCGGTTATAAATTCTGATTAGCCAGGTAACACAGTGTTATGACAGCCCGCCGGAACCGGTGCCGTTGTGGCTCGAGATATGGCAGTAAAGATTTCAGGAGTCCTGAAGACGGCACAGGAAAACCGTACACAGACTGCACCATTCAGCTGAAAGCCAGACGTAACAGCACCACGTGGTGGTACGGGGCGGGCTCAGAGAATCCGGATGAAGCCGGGCGTTACAGCATGGATGTGGATGAGAGTACAGGGCTTCCTGCAGGTCTGACCGAACCGACGTGTAAGTTTTCCACCATCGCGTAAACGCCGGGACCATCAGCGTGTATGTGAAGATTCACAACCGGGACGCTGAATGATTTTCTCTGTGCCATGACGAGGATGATGCCCGGCCGGAGGTGCTGCGTCGTCTTGAACTGATGGTGAAGAGTGGCGCGTAACGCGTCCGTGGCACAGAGTACGGCAGACGCGGAAAGAAATCAGCCAAGCGATGCCAGTGCATCAGCTGCTCAGGTCGCGGCCTTACTGATGCAACTGACTCATGGACACGCGCCAGCACGTCGCCGGACAGGCTGCATCGTCAGCTCAGGAAAGCGTCCTCCGGCGCAGAGAAGCGGCATCAGGCAAAGGCCACTGAAGGCGCAAAAAGTGCCTCGCAGCCGCAAGAGTCCTCAAACGCGGCGGCCCAGTGCCGGTGCGGCGAGAAAACGTCAGAAACGAATGCTGCATACCGTCACAACAATCAGCCGCCACGTCTGCTCCACCGCGGCCACGAAAGCGTCAGAGGCCGGTTTGCGCACGATGCGGTGGCCTCAAAGAGGCAGCAAATCATCAGAACGAACCGCATCATCAAGTGCCGCTTCGTGCAGCTGATTCCGGCAACTAGCAGCAGAAAAATTCTGCCAGGGCGGCAAAACGTCCCGATGAATGCCAGGTCATCTGAAACAGCAGCGGAACGGATGCCTCTGCCGCGGCAATCGAAAGCGGCGGCGGCTGGAGTGCGTCAACGGCATCCACGAAGGCGACAGAGGCTGCGGGAAGTGCGGTATCAGCATCGCAGAGCAAAATGCGGCAGTAGAAGCGGCGGCAATACATGCAAAATTCGGCAAAACGTGCAGCAGATAGCTTCAGCTGTCGCATTACAGTGGGGACACAACTGAGAAAGGGGATAGTGCAGCTCAGCAGTGCAACCAACAGCACGTCTGAAACGCCTTGCCTCTGCAACGCCAAAGAAGGTTAAGTAATGGATGAAACGAACACCAAAGCCCACTGGACAGTCCGGCACTGACCCGGAAGCCAACAGCACCAACCGCTCAGGGGAACAACAATACCCCAGATTGGCGAACACCGCTTTACTGGCCGCGATTGCATGTTATCGACGCGTTCCTGACGCACCCTGAATACGCTGAATGAACTCGAGCGCAGGCTCATCGGGAATGATCCAGATTTTGCTATCACCACCAGTACTAACGCGCTTGCGGTAAACAAACCCGAAGAATTGGCGACACTGACGCTGGCAGGGCTTTCCACGGCGAAAATAAATTACCGTATTTTGCTAGGAAAATGATGCCGCCAATAGTATGACTGAACTGACTCAGGTTGGCAGGGATATTCTGGCAAAAATTCCGTTGCAGATGTTTCTTGAAGAGGCCTTGGGGCCGGTGAGAATTCGGCCTTTCCGGCAGGTGCGCCGATCCCGTGGCCATCAGATATCGTTCCGTCTGGCTACGTCCCTGATGCAGGGGCAAGGCGTTTTAACAAATCAGCCTCACCAAAACTTGCTGTCTAAGCGTATCCATCGGGTGTGCTTCCTGATATCCCAGGCAAACAATCAAGGGAAACCCGCCAGCGGTCGTGCTGTATTGTCTCAGGAACAGGATGGAATTAAGTCGCACACCCACAGTCTCAGTGCATCGATCTACATTTGGCACGAAAACCCACATCGTCGTTTGATTACGGGACGAAAACAACAGGCAGTTTCGATTACGAGCACCAAATCGACGAATAACGGGGCTCATGCTCACAGTCTGAGCGGTTCAACAGGGACCGGTGCCCCACAAGTGGTTTAAGGATGGAACAGTTCTGGCTGGAGTCAGTGTATGGAACAGCAACTCATTACATAGGAAAGTCTATCCACAGTTAAAGGAACCAGCACACAGGTATTGCTTATTTATCGAAAACGGACAGTCAAGGGCAGCCACAGTCACTCATTGTCCGGTACAGCTCGTGGAGTGCCGGTGCGCCACAGGTCCAGCGCATACAAGTTGGTATTGGTGCGCACCATGCATCCGGTTGTTATCGGTGCTCATGCCCATTCTTTCGAGTATTGGTTCACACGGGACACCATCACCTAAATTCTACGGGGACGGCGGAAAACACCGTCAAATAATATCCTTA
>76
GCTGTTCTAACCTCGTGAGAAACAAAACTTGACATGTATTTGCGGAAAATGATGCACGAGCCAGCCGACCTGAACTGAAGCTTGGCAGGGATATTCTGGCAAAAATTCCCGTTGCGATGTTCTGAATACCCTTGGGCCGTGAGAATTCGGCCTTTCGTCGCGTGAAGTACGCCGATCCCGTGTGAGAGTAAGCGTATCGTTCGGTCTGAGCCGCTTCCTTCGCTTCGCGCGCGGCGTTCGCCCCACTGCGGCCCCAAAACTTGCTGTCGCGTATCCATCGGTGTGCTTCCTGATATGCGAGGGACAATCAAGGGGAAACCGCCAGAGCGGTCGTGCGCATGTATTTCAGGAACATCAGGATGGAATCCACAAGTCGCACACCCACAGTGCCAGTCTGCATCCGTTACGGATTTGGGGACGAAAACCAATCGTCGTTTGATTACGGACGAACAACACAGGCAGTTTGCGGGGATTAAAGGCCAAAATCGACGAATAACAACGGGGCTGCTCACAGTTATGAGCGGTTCAAAGAGCGCGGTGCTTGCTGAGATGCTAAGGAGAGCATCAGGAAGGAAGGAATATCCGGGGAGGGAGATGAGAAATGAACAGCATCAATTACTGCAGGAAGTTATCCACAGTTAAAGGCGAACCCGCACAGGGCTTGCTTATTTATCGAAAACAGCTGGGACAAGTCAAGGCAGCCACAGTCAGCATTGTCCGGTATGCAGCCGGTTGAGTGCCGGTGCTGCAAGATGCAGACAGTTGGTATTGCCGGCACCAGCATCCCGGTTTAGTTATCGGTGCTCATGCCCATTCTTTCATCAGTATTGGTTCACACGGACACATCACAGTCGTTGCTCTAGGGTAACGGAACACGTCAAACATTCGCATTTAACTATATTGAGGCTTGCATAATGGGATGCCGATGAATGGCTGAAGTACGACCAGCATGTCAATCTGCTGGCCGGAACTAATGATGAATTTATTTGGTACGAAGGTGACGCATATTCCGCCTCGTACCGGTCTGCCTGCAACAGTACCCGATATTGCAGCACAGATATTCCGGCTGGCTTTGTGGCTGTTTTCAAACAGTGATGAGGCATCGTGGGCATCTCGTTGAAAGCACCATCGGGGTAAAACCGTCTATGAACGTGGCCATTCCGGGCATAACGCGTTATTTATTTCCAACTCGGTCGTTACCGGAAAAGGTGTGACCTGGTTATCGCCGGAGGGGAATCATCAGAAATGGAACGCACAGCTCCGTGAGAAGGATACGGAGAAAAATTAGGGCGAAATGGGGAGCGGGGAGGAGGAGCGAAGAACAAATCAGTGGATGCATAGCCATTAATGCCGCTTCAGGGATGCTGCAGATCTGGAAATTGCAACGAAGGAAGAATTCTCCGTTGCTGAAGCCTGAAGAAGTATCGGTGTTGCTGAACCGTTGATGATACATCAACTGCAGCCTGATATTGAGTGGCCTGCTGTCCCTGTTATCAGAGTAATCGTTTGTGATATGCAGAAAACGTTTATGAAATAACGTTCGTGGCGTCAGTCGAGTGATTGTAAAAGCCTGAGTATTGGTTTATTTGGCGATTATCTTCAGGAGATGGAAGCCGTTTTTCGCTCTGGAATGCGTTCCTCCTCTTTACATCAACCGCCAATTGCTTTAAGTTAAGACCGTGAACGCATATGAAATATGGTTTTTCGTCATGTTTGAGTCTGCTGTTGATATTTCTAAATCGGTTTTTCTTCGTTTTCTCTAACTATTTCCATGAAATACACATTTTGATTATTATTATTTGAATCAATTCAATTACCTGAAGTCTTTCATCTAGTTGGCATTGTATGGTAATCGTTTATTGGAGTAGATGCCTTGCTTTCTGAGCCAGCTCTGAGTTCCCAAATGAAGCCAGGGGCATTTGTTATTTTGGCTCTGTCAGCTGCAGCATAACGCCAAAGATAGTTCTTATTAGTCAATCTTCAAATGTTGTATTGATAGAAGGCAGGGATGGAAGGAACTATCAAGAGAAATTAATGTTTGAATCTATAACCGTTTCCTTTAAATCGTTTCTGCATAGCTTGGCTGGTCATTAACCTCCTTCGTCGAGAAGTGATATTTTAGGCTTATCTACCAGTTTAGGTACGGGCATTTAATATCTTCAGGAATTATTTTATTGTCATATTGTATCATGCTAAATGTATGACAATTTGCTTATGAGTAATCTTTTAATTTAAATAAGTTATTCTCCTGGCTTCATCAGACCAAGGGTGGCAATGGATGTTGGGCAACCCATCGTCAGGATTGAATTGTTTATTTGTATGCCAAGAGTCCAAGCAGTTATACATTCTGCCATAGATTAGCTAAGGCATGTGTAATGATTCGTAATCTTTAGCGTATTAGCGACCCATCGTCTTTCGATTTAATAATAGATGATTCAGTTAAATATGAAGGTAATTTCTTTTGTGCACTTGACTAAATTTTATACCAATGTTTTTAACATACTTTCATGTTGTAATAAACTCAATGTCATTTTCTTCAATGTAAGATGAAATAAGAGCTCGTGTCGCCCTCGCTATACATTTCTAAAATCGCCTGTTTTCTATCGTATTGCGAGAGAATTTAGCCCAAGCCATTAAGGGAGCCAGTGGGAATCCAGAGGAGCCAATAACATTATCAGGGAGGTAGAAGTACTCCTATAATCTGGTTTTGTTTTTGAATAATAAATGTTACTGTTCTTGCGGTTTGAGAGGAATTATGATCCAATAATGTCATAAGCATCCGTTACAAAATCTATGTATCAATGCAGCATTTGAGCAAGTGCGATAAATCTTTAAGTCTTCTTTCCCATGGTTTTTAGTCATAAACTCGCCCTTTTAATAGATGCATGCTAGATGCTGATATTTTAGAGGGCTCAAATCTCACTGCTGTACTGGTTCGTGATACATTGTTGATCTTTGCAATGATTCTTATCAGAAACCATATAGTAAATGCTAGTCAACAGGAAATTTTAATATTATTATTATCATTCATTATGTTTAAATCCGGTTGTGGCTTGGCTCTTAAACACGTTGCTCATAGGAGATGGTATCGACGCAGACACACTTCGTATGCAGGAACGTGCTGGCGGCTGGCTATCGAACCCCGATAGTTTGTGAGATGTTGAATGATTTCCGGTGCAGCCGATTTTACATATTTTGCATGAGAGAATTTGTACCACTCCCACCGACCTACTGACTGTACCGTCTTAGGACTGCTATGTGCCGGATGGGACATTACAAACCTTCCTTCTCGGTGCATGCCACTGTTGCCAATGACCTGCTAGAGGAATTGGTTTAAGAGTCCACCGGATTTGTAAAACAGCCGCAGGAGAAGGATTCTGAATGCCATGCGAGAGAAGCGTAATTTCTATCTTTCATCATATTTTCTAGATCCCTCTACTGAAATCTTCGAGTTTGCCTAGGCAACACTGATACATACGTTTCTCAGCCAATAATTGGGGAAGTCATTCAAATCTATAATAGTTTCAGATTTGCTTCGCATACAAATTCTGACTGTGGTGAGCCTGCTGAAACGTGCCTTCCTTACGGCTTTCCTGCTACCTAATTTTACGAAGGGTTTCCGTTGAGTAATCACTTCACTCAAGTGCTTCCTGCTCCAAACGATACCTGTCTGTGGTCCGCTAAATATATTTAATAGCCTTGAAATGATGAAGAGCTCTGTGTTTGTCTTCCTGCCTCCAGTTCGCCGGGCATTCAACAACATAAACTAGCAGCCCGGGAGTTCCGGAAACGAAAATTTGCAGTATACCCATTGCACTGAAAGGACTTCTATGTCATCATAGGGATGAAATCGCTTGGTGTACTCATCTATGCAGGTAACCCTGATTTCTCTCCCATATTGCAGTCGCGGCACGATCGAATAGAATTAATAGGCATCACCGAAAATTCAGGATAATGTGCAATAGGAAGAAAACATGATCTATATTTTGTCGTGTTTAATACAAAATGGACATTTTCGTAGCCCTGATGAAACAATCAGATGTATTCATCGTAAGTGATAGTGTTCCTCGCAATCTGGTTAGGTCCTCGCGGAGAACGAGTCTCATAAAGCTTTTCTAATTTAACCCTTTGAGTCAGTCACTACTAAGGTTTGTAGGGCTCAAGAGGGTGTCCTGTCGTAGTAGATAATAACTGACTGTCGAGCTTGACCCTATATTCCTCTTCTTTCCTTTCTGCGCCACTCTTGGGGAAGCGGCCTGGCAGTCATTTCTAACAGCTTTATGCAAGCCTCCGAGCATTTATGCGCGTTTCCCTGGTAAGTTCCTCGATGGAAGAGGGCTTTCATTGTACTTCTTTACCTTCATCTATTCATTATCGCCTGCCGTTAAACGCCGTTCACTTCTAATGCTATCTGACGGATTATAATTTTTACGAATGGTTTCATAAGAAGCTCTGAATCAACGACTGCGATAATAAGTGGCCTTATCCAGAATTGTCATTCAAGTAAACCTCACGCACGAGTTAAAACAGGCAGTTCTCACCGAATGTCTCAATATCCGGACTGATAATATTTATTGCTTCTCTTGACCTGTCAACCAACTTTCCACATGCAGGATTTGGAATCTCCTTGCAGTACTACTGGGGAATGAGTCGGCAATTATTGGGTAAAGGATTGCGTGCATCAGTAAGTCGCTTAATGTTCGTAAAAGGCAGAGAGTTAGCAAAGTAGGAGAAGAGCAGAAGCGGGTTCCAGGGGAAAGAAGCACGAACTTTCGCCAACGACATCTACTAATCTTGTATGATAATACCAATTGCATGTCCAGAGCTCATTCGAAGCATATTTCTGGATATTGTCATAAAACAATGTTAGTGAATTTATCATCGTCCACTTAAGCAATCTGTGTTCATTACGTCGTCTTAACTCTTCAGTTATTTAGAAATGAGGCTGATGAGTTCCATATTTGAAAAGTTCTTCATCACTACTACTTAGTTTTTGATAGCTTCAAGCCCATGTGTCTTTTCTATCTACTCTCATACAACCAATAAATGCTGAATCCGAATTCTAAGCGGAGATCGCCCTAGTATTTTAAACTATTGCTTACCAGCATTCTTGAGTCCAATATAAAAGTATTGGCCCTTTTGCTGGGTCAGGTTGTTCTTTAAGGAGGAGTAAAGGATCAAATGCACTAAACGAGAAACTGAAACAAGCGATCCGAATATCCCCTTTGGGCATTCTTGACTCGTAATAAACAGTCATTATTTCAGAGAAAATATTCATTGTTTTCCGGGTTGGTGATTGCACCAATCATTCCATTCGATTCAAAATTGTTGTTTTACCACCGATTCCGCCGCCCGATAAAGCATCGCATCCTTTCTGCCTGGCAGCGAATCGCTCGCGTCATCAAAAGGTATAGAGTCAGAAGCCACTAGAATCGGAGAGCACTTGCCTGAGTGCATCAAAATCGAAATCTGACAATTCTGGCAAACCATTTAACACACGTGCGAACTTCCATGTAAATTTCTGAAAGAGTTACCCCTCTAAGTAATGAGGTGTTAAGGACGCTTTCATTTCAATGTCGGCTAATCGATTTGGCCATACTAAATCCTGAATAGCTTTAAGAAGGTTATGTTTAAACCCATCGCCTTAATTTGCTGAGATTAACATAGTAGTCAATGCTTTCAGGCAGGAAAAACATTTCAGGGAGTTGACTGAATTTTATCTATTAATGAATAAGTGCTTACTTCTTCTTTTGACTACAAACCAATTTAACATTTCCGGCTCTTACATCGCATTTCACCCAGCTGCTCATCAAAGACAGTAAGATAAAACATTGTAACAAAGGAAACTCAGTCATTCCAACCATCTGCTCGTAGGAATGCACTTAATTTTCTACTGCAGGAATATACCCGCCTCTTTCAATAACACTAAACTCCAACATATAGTAGATCTCGTGTCTGCTGGATAGGGAAGCTTCCCGTTCGTCTCCCAGCAACACAGAGGAATCTCTCTTTTAAGTTACTCTCTATTACATACGTTTTCCATCTAAAATTAGTAGTATTGAACTTAACGGGCATCGTATTAGTTTTCCATATTCCTTTCTGCTTCCTTTTACACCCAATGATTAGTGCCGATCCGCATGGGTGCAAGGTCTATAGAGACGATATAGTCATAATGCTGCATATAGTATCGCCGAACGATTAGCTCTTCAGGCTTCTGAAGAAGGGGTTTCAAATACTAATAAGCCGATAGATAGCCACGACTTCGTAGCCATTTTCATAAGTGTTGACTTCCGCTCCGCTCATAACAGACATTCACTACAGTTATGAGGAAGGTGCATGCTGGGTGTGGGGAAGTCGGTGAAAGAAGAAAGAAGAAGTCAGCTGCGTCGTTTGACATCACTGCTATCTTCTTACTGGTTATGCAGCAGGTCGTAGTGGGTGGCACAAAGCCTGCACCTGGATTGCAATGCCCCGTTGTGCTGCTTGGGCTCGATGCGACAGGTTTGATACCTAGTCAGCCGCAGAGACACATTCTGCCACCTTGCAGCAGATGCGGCATGCTCTGTTACAGGTCACTAATACCATCTAAGTAGATCGATTCAGCTATGACTGCATATGTTGTGTTTACAGTATTATGTAGTCGTTTATGCAATCTAATTTAATATATTGATATTCTATCATGTCCGTTTCTCGTTCAGCTTTTATAAGTTGGCATTATAAAAGCATTTCGATTATCAATTTGTTGCAACGAACAGGTCATATCAGTCAAATAAATCAGTTTGATTTCAATTTGTCCCACTCCTGCCTCCTGTCATCACCAAGCTGGCTGCCAGGCGATTGGCACTCATCCGAGAAGAGCGTTGAGCAAACTTATCGGTGTATCTGCTTCTCACCAGTCTGTGCAACAAACATCCAAGCGTGAAAAGTAGGCGGATCCCCTTCGAAGGAAAAGCTCTGCGCTTTTCGTGCGCATAAAGACCCTTGATACTGTGCCGGATGAAAGCGGTTCTGGGGCTGAAGAACGATCCGGCAATTATGGTTTCTCCGCAAGAATCGCTTGCATTTATCTAAATGTTTCCTTCATTGATATTCCAGAGCATCAATATGCAATGCTGTTGGATGGGCATTTTACGCCTGTTTGCTTTGCTCAGCGCTTATCGCTCCCGCTCTGCGCGACGGTTCATTCGCATAAATGCCCAACTCGTTGCCCGGTAACAACAGCCAGTTCCATTTGCATAGTCTGAGCCAACATGGTGATGATTCTGCTGTAATTGCTCATAGTTCAGATTCGTCAGCCGTAAGTCGTGATCTCCTTATCCTCTGATTTGCTGCGCGAGTGGCAGCGACATGGTTTGTTGTTATATGGCCTTCAGCTATTGCCTCTCGAATGCATCACCTCGCCGCTCTCAGTGTTGATTGATTAACCGTAGCTGAATTGCTCGCCTTCTCTGTATCCATTGAGCATTGCCGCAATTTCTTTTGTCTATGTCTTCAATCAGCATCAGGCAGCCATCGCTCCTTACTAGTCCACCTTGCTCAGTAATTGAGCGAGGTGCTCCTGCTTCTAATTCCTGGTGCTCAGGATTTTCGTAGCGATCAAGCCATGAATGTAACGTAACGGAATTATCACTGTTGATTCTCGCTGTCAGAGGGTGTTGTGTCCTGAAAGACTCATCAATGTTTGGCCTGTAGCTGCCGTGATTGCGATTCGCCTGTCTCTGCTAATCCAAACTCTTTACCCGCGTCCTTCACGTGGCTGTGGAGCAGTAATATCCATGTTTCTTGATCGCTGCCGCGGCGTACGATTCCCCTTCTCCTTCGCTATTCCTTCCCATTTCATGATCCTCTTCAAAGCACCTGTTACTGGTCGATTTAAGTCAAACTATTTACGCTGATTCGTGGAACAGATTACTCTCTTCCATCCGTAACCGGGAGGTGGGAATATCCTGCATTCCCGAACCCATCGACGAACCTTGTTCAACAAGGCTTCTTCCGTGGACGACCAGTTCGTCGGGCGTTCCATCACTCCTGAAGTGTCAGTACATCGCAAGTCTCCGCAATTACACGCAAAGCAAGAAACGCCGCATCTAGGCGGATCCTGTTCTTTCAGTTCGTTAATCGGAATATTGGTTACGTCTGCATGTGCTATCTGCGCCCAGATATCATCCAGTGGTCGTAGCAGTCGTTGATGTTCTCCGCTTCGATAAGCTCTGTTGAAGCACGGCCTCGCATTGGGATGCCGTGACTCGGCGGAAATCGCATTATCATCTCCATAAACAAAACCGGCGCTGTAGCGAGTTCAGATAAAATAAATCCCCGCGTATTGAGGATTGTTATGTAATATTGGGTTGTTGCTGCCTGGCCTCTTTTGTACAGAGGCAAGTATCGTTTCCACCGTACTCGTGATAATAATTTGCACGGTATCAGTCATTTCTTACCGCACATTGCAGAATGGGGATTTGTCTTCGATTAGACTTATAAACCTTCATGGAATATTTGTATGCCGACCTATATCTATGATTCATCACATAAAGCCTTCGTGATTTGCATGACAAGAAGGACCGGATCTGCACAACGTTCTTT
>77
GTCGTGCGGCCAGTCTCCTTAGTTATGGGTCCCCATTACCACGTTTCCCGCGACCGCTGGCAGTGTCAACAATACGGGGAACATAGGTGTACCGCCTCGTTCGCCCCCAGATAGCTAAAATCGCACCGTTCATCAGTACTTTCAGATAACACATGAATACTACGTGCTTAAATACGTACGCTTACTTCGAACCTAGAGGTTCCTACGGAAGCAGCACCACTATCTGGCGATCAAAGGATGGTCAGTAGTGGGTCACGTAACACGTGATGACGGCCGTTAGATAGACCTGCTTTCGCCGGCCGGAAAACGCGCAGCCGCGCGCGCTCGCCGCTTTACAATGTCCCCGACGGATTTTCCGCCCTCAGCGTACCGTTTATCGTACAGTTCAGCTATCGTCTACACATTACTGAGCGTTGGAGTCGCATTCACACTGCCACTGATATCCGCATTTTAGCGTCAGCTTTCCGTCCGTTAAGGAAGGCCGATTGCGCCGCCGTAGTACCGGGGTCAGGCGGCTTCAGAATAGTCGTTCACTGAGAACGATATCTGGTTATCCTGCGCCAAACATCGGCGTTTCATTCCCGTTGCCGGGTCAATAAATGCGATCTACGATTGGCGGCAACCGATATACGGCCGTTTGCTTCCTCCGTGTCCTCCATCATGAGTCAATACCCGCGACATAATGTTTGCCGTCTTTGTTGGTCAATTTTGACAACACGGTACCGGCATTCCACTTATCACTGGCATCCTTCCACTTTCCGAATCTCCTCCAGTTAGCTCGTTATCCTCCGTCAGCTCACTTTCCGACGCAGCTCCTTGCCGGAGCGGCCGGATCGGTTATCTGTGCCTTTGAAGGTGAGACCTTCCGCATCATCGCTCACGCCGACCGACGGCCCTCCACGAATGCCGATTTGCCAACGTTCACACTGCGGATATAAAAGTAATAATCATCGCCGTTTGATATTACTGGCGGGTACAGAATCCGCCGTACCAATAACGCGTTAGCTCAATGTTCATCGCACTGTCTCTGTAAAGAATCAAATCTTGATTTTCCCGATAAACGAACTCATCTGCGTCCTAGCGTATACTAAACACTGAAGATGCCCGGCGTCAGAATTGACGGATTCTCTGAGACCTCTACGCGGCGTGCTCAATCTAGGTCAGTGCGGCAATCCGGAACGATACCGACGCTTAATCCCTGCTGCCCCCACGCATTTACCGCCCGGACTGTCAGCCTGTAGTTCCCCAGCGCAGTTGCGTGGAAGCAATACTTATGGTTTCCGTCGTCCGTCCGTTACAACCAGCCCGCTCACTGCCGTCGTCTTACGGTTACCACGTTTAAGCTACCAGGAAACGCCCTTCACGCCCTCGGCTTGTCCCCATCACGCCAGCACCTGATATTCCGCTGTCTGCAGTACTTCTGCGTCGGGTCAGGCGCTGGCAGCGGCGTGACACCATTCACTTCACCCCGTGCCACTCTGTTCGCCGTCAAGTGCGCCCCGGGCGTTATCTACGATGATGGCCTCTCTTTTCCCTAACATGCTGCACGGCGTTGGCATACGTGCCGTCCGTTCTCTACGGATACTCACGACGCAGCGGAACAGTCCTCGCTGGCGCAGCGTCGAAGCCTCTCCCATACGCTGTATCTGCCTCAGCAACACCGTCAGAATAAACACTATCATTTTACCTTCACGCGTAGTGACGACTAGCAACCTCCACGACCCACTTGCCACTTCCGTCAACCAGGCCGTATCAGCGCGGTACCTAGAGGATGGCAAGCGTGATTTCACGTCAGAGCGGTCCGAGCGTCAGCGTCCGGGTCTGCTGTTCACCGCCAGCACGACCACCCCGTGATACCGGCATAGTCATCGACTCGCAGATTTCAATAACCTCACATGTAGTGACGCGGCCTTCTGCGCCGACGCTGAAATCCACGAGTCTGCGTTTCCAGCAGTTCTTGTTTTAATCAGCCACAGCCGGCCGGTGCGCTCCGAGACCTGGTACCAGCCAAAGGCAGTACATGGTTCGTAACATTACTCGTAACGGGCAGCCGGCGGTTATCTTCAACAAGCTCTGTCGCCGTCTCCCAGCCGTTGTTCGGGTCAATCCAGGTCGCCTGAATCGTTATGAAGGCGGTCCTTCAGGGCTGAAGCTGTAGCGGACCTTAGCGCCATGAGCATCCAAGCATACAGGTATCCGGTTATAGTCCCTTTATCTTAAAGGTCGTCTCTGCACGGCACGAACGTCAGCGTCTTCTGCCCGTTCCCTCCAAGGCATACAGCGCATCACCGAGCAGAAATCAGCCATCCGACCCACCCCTTACGTGCTGTGTAGTCAGGTACGGGATTACAGGTATGCCGGCCCGGCGTGCGTCCGCAGCCAAGGCCGTCCGACTAGGTGGCAGTACGACTCGAGCTATAAAGATATCGCCATCCTCGAGCCATAGTTCCGATGCCGCCCAATTCCACGATGACCGTCGATATTAATCCCACCCGATACATGTTGTTGCTGTATCCCACGTTAAACGTTCCGTCCCATATCTCCGTATTGCCGTGCGGGTTATAGTTTGGACACCCACCTTACAGAATACGCCGCAGATACTACGTTGCCCTCCTGCTGAGCCTGCCGAACTGCTCCGAGTCTATGCACGCCGACCAGTGCCGTGTTCGGCTAACTGTTCACCGGCCATTATTTCGATAGAGGTTGACGACCAGCGTTTGTTCTTGGTGCAGCTCAGTCGTGGTGCTGTCCGGCGTCATCCTGCGCATCCGTGCAGATATTAACGGGCGGCGGCATTAGCTAGCCCACCCGGCTAGATACTGCAGGTGGTTGGGCCTTAATGGTAGTGTCTTTCGTCACCCAGCCGTTAAGCCGTTACGTTGTATCTGTGAACCAGGCATATAGACTTCCATAATTGGTGTCACCCTTTGAGTTCCACCAGTGCTGTACGCAGGAAGGTAAAGCGCAGACGGTCGATGTTGCAGACGTAATGGTGCGTGATCGGGGGTCACTTTCTTCACTTCTATTCCGTGGCAGCTAGCCGAGGGTTATCAAAGCGCGCGGTCAGTGCCTCCGGCCGTTCATCGACATCACCGACGATAGAACACCGGATATGTTGGCTTCCCTCAGTGCCTAAGCGTACTGTTCAGCAGCACCCTTTTAAGCCATCCCACCCTCTTTCAATCGGTCGCTGATGACCATCGATCGTACACTCAGCAACTGCGTGACTTCAGGTCCTTCGCTTCCTAGCGGGGTCCCTGCTTACTGCTTCCGTTACCATTCCTCACTCAACAATGACAAAACCGCCGCAGAGTTCTCGCACATACATTTTGCATCACCGTACAATCACCACAACGATGACCACCGTCCTCCCTTCGTCTGCCCGTTGATGGGGGAACCACGCGTACCGCCGACGCATTCCCGTGACAGAACAAACCGACCGTTCTGCCCTGGGCAACCATGTTATCCAGTGAGTAAAGAACGGTGTTCTGTAGTACCGTTATCCGTTGTCTGTGACCGGGGGAGTCCTGGCTTTCGGTGGCCATCTGCCACACCACCGAGCATACTGGCCTACGAGAAAACAGGATGCCGTCATACCACCGGCCCCAATGGCTGCCCCATGCTGCAAGGGTGAGGCGGTAGAAGAATACCTTAAGGCATGGAGGCAACACCGTACGAATACGCCTGACTTATCGAGCGACTCTGAAACGATATGAATTACCGCCATCAGGCAGTCTCATGTAACTGCGCCGTTTGGGCACGAGTGCTGACCTCGTTGCCCGGCAATCCTAGGTCTGATACCAGCCCGTCCTGAGTTTCTGACGAAACGCCGGGAGGTGTGAGTTGCCGTGCCATCGCTTCAGCCCCCGTTTTCACACGAAGGTCGGATGCGGCGACCAAATCGTTGTAAATCCCGTACGGCATGCGCCATGCCCGGTGACGGAGTGTGCGTCGGTGCCATTTATTCACCTTGTATAGTTTTAACAGTGTTTAAGGAAGTATTGGCTAGCCGTCACCAAAACTTAGATTAAGCGTCCAAAGGTGAACAAAAGGCACAGCAGCGCCACATCGATAGTGTTAGAAGGTTTAGTTATCC
>78
GTCTGTTCTGTGGACGTGATTGCGAGCGTGTGACTATTGGGTTTAACTAACTGTGTATTCGGTCCGACTGACGAATCCGATTAAACGGACGCCAATGTCATGAAATGCTGTAACGGACGCAGGACGCTCTTGGTTCTGCAGTATTCTGTTACCAATCTCATCAAAGCGGCGTTGGTATTAAATGGCCTGAATGTCAGCTCGTAGGACCCCTCCATTGGATCTCAACTCAGGAGCATGGAATGGTTCATGATCACGAGATCGAACCACTGACTCATGACTCCCACCGCTATTCACCCCAATTAACGGGTTTCTGTCTAGACTCTGAAACCCCGCTCGGCCTCCAATATGTATTAATTAATGTAGATGGACATGCTGACGCCAGCCTTAACGATCCTTATATGCACCGAGTTTTCGATGCCTTGAAACTGTTGTTGATGCTCGATTCAAACGCATCCTGCAGTGGTTCATGAATGCCATCGACTCCATCCTCGGTAGCGGGAAACGAATTACCGGCTCCAACTCAACCGGGATATTCGTCGGACTATCTCATATCATAAAATGCATCGTGCGGTTTGACGCCGCTGACTAAGCGACTAAGTCGACCCAACGATTTCGTCCTTGACGCTCGCACCACCTGATACTACTGCATCCTCGACGGATGCTCCCTTAGCGTAGCTTGTTGATTCAGTATGATGCATCTAATCTGACCAACGAACTTCTTCGTGACTTTGCCATTGCACGTGAACTGTTGCATACCCTTACACCTTCCCAATCCTTTGACGTATAAATCCGATCCCCGTGCTGCCCTCGTACGCTGTATCGAAGTACTGACGCCGCATCTGTAAACATACTGCATAATGCTACGAATTACGGAATGGATCACTTAATGACTCCGACTGCCAACTAGATTCATCGCCTTTATGCAAACCAATGTTCGTGGAACCCCTTCCTACGGTAAAATGGATATTAAACTGAAGTGGATGGCCTCAGCGGTAAACCCGGTTTAACTTTTTAGACAATCACCGGCTTTCCGGTGAATTTCGCCACCTTTCCACGACCGAATCCTGAACTGGACTAATCGATTCCTAAGATGGTTGCACTCGGCCAAGCCGTTGACAGGATAGACCTAGTTGGACTGCAGGGAGGAGGACTCATGAAGCTGACCTGGGATCGACGCCCATGGCACCCCGGACACTGTTTCTAGCATCCTACGGACTCTTATCCCGAGGTCGTCCGGGCTACGCCACGGCCACGCCGCAGCGCTTGGATTGACGCGTCCGTTGGACCCCTTTCGAGTTTCAGGGGACGCAACCGAAGCGCGTAGCACGGTGGTTCGAGCGGGCCATTAACTAGGTTACTGTACTTCCAAGCGCTCCCACTCGGCCCGTATGATACTCCGGCCCCCAACGCCTGACCTGGAAGCTGAGCCCTGGTTGCATGAATTCGTCATCGAGGAACTTACCACTGGTTGACAGACTCGCGGTCCGCTGGTCACGAGACGAATGCCCATTCACGGTTTCACGAATCTAACGTGACGCATTTCAACCAATCGCTCGTAATCCAATTAACGCCCGCAGCCGAGTCTACATTTCCTGACGGACGCCAAACCCATCGTTCCATTAACTTAGAATTCTATCGCTGGTTGCCCGCATCATGTAATGGCAACTGCTCAACGAATTCTGTAGCAACCTGAATTAACAGCCAGGTGGCGTGGCTCGTAATCCTGCCACGCGGATTTGATCGACAGATGCCACGCAAAATAATGATCAGGTACCGATTAAATTCCCCGTATGCCATGGCTCTACTGATGGAATTAAAGAACTCCCGCCTTCAATGGCCCGGGAGGAAACCTAATTGGAACCGCGATTGGGCAAACGGGTTGTTGACTCGTCGGACCCCCTGGTTAAACCGTGGACGCCGTCCATTCAGCACGGAATTTAGTACTGAACAGGCTGGGGACCCCAGCATGAATTCCGAGACTGACATCCGAAGCTGCGAACCGTCACGGATCCCAATTCTAACGTTCGTAACCGTTACCGTGGCACGCATCCATGCCAAGAGGGAATGCTCTAATGTAGTACTAAATAATGGACGCTCATGGACTATCTCTTTGCCACGATATATTTCCCCGATATTTCGCCCGACATTCAGCGTTAGATACGTTGCGCCCGCTCCTAAGGCCGAACCGAACCCTACTGGTACGGTCTCCAACCACGCGACTCGAACCAAGCATGGCGAGCGCTCCCACGGGTCGATTGACTGACCAAATCCGAGCACGGATTAAGAATAATCTCTGGCACATAGGTCAGGACTCCGGGGGAATGCCGTGAAGGGTCACCTAGCTGAGTCGAGTCAACGCATCGCCCTACATTCACGAGTTTGCACGGGTTAACAATGGGACGCAGCGCAATGACCTGACGCAAACTTTAACTTCCTGTAGTTACAATTGCTAGGTCTACTCAACGCTGAATCCTAGCGCTCGTATGGGAAAGCCGATTACTCCGAATAAGGTACCGCTCCTGTTCGGCGATTCGTTCGTCAATAGAATAATGTTGGGAATCGCCGCGATCTATATCAACGCCACCGCACTAAACTTATCGATCTCACCGCCGCTTGACTCGAGCGTATTTGGTGCGATGTAGCGAGCGCTTGGATCTCATGCAAATGCCCGTTCTCCCGCTTTTCTAACGTACGAATTTAAACGTATTCCATAAATCGACATTACAACCCCAAATGAATCGCCGACGCATTACTGGCCCAGCCTTGGACGCAAATGGTCCGCCTCCCTGACGCCAATCCCAGCGCTGCAGCACCGCCGGTGCATTATTGCAACTCCGTACGGATAGTGGACGGCGAACGTAAACCTCATTAGCAGTGCCGCAATTTGTAACGCGTGATTCAAGGGGTCATCGCACGTAACGCAGAGCGCACTGAATAAATTCATCGTTGTATTTGGGGATCGATTAGCATCTCCGGGGCGTAACGGATTAATTCCGACCTCCCCGCAATCATTTCGTCTCACTCCGATTCCAACGAGACGGGACTTTCCCATCGACGTTCTGTTATCCGAATCGCTGGAGGCCAGCAACTCGCAAGCCCTCACGGCACGGGTTATCCCACGGCACTGTCTGTTAAATTGGCTGGAACGCAACGTAAAGCTGTGCTCAATTGGAATCACGAACGTGTTCAAACTTATCGCGATCTAGAAGCCAACACCAGGATTTCGACTAATTTACGCGATGCTAGTTGTCGGCCCCTGGAGTGATGGTACGAAAGCAGGGATTCCGACTCGAACCAGCGCGACTGACTCCCTAGGATCCGTTAGTATCGAAGCCGGTGGCTTCAATTCTTGCTTTACGACGGGTACGTTCGGACCTCATGGTAAAGACGAAAAGCCTAATTCCGCTCGCTAGCGGTGCTGAACGCACGTTACCGTAAAGCCAAGCCTGAGCGAATTTAAGCCTAATAGGTCCTCAACTCCTTTGCCGTAGATTCTATAACGCAGCCCCGAATGAACTCAGGGACTCTTAGGATTCACGCTCATTTAGGCTGAATGCTCCCAATTCAAGCCCCGTGCACGCAACGGACGCTACGCACTGAAAGGACTTATCGCCACGAGACGCCATCTCGACTCGCCTGTTCTTATTGGGATCCCTCCAAATAAACCAAGCAGTTCGACCACCGAATCGGACGCAGATGGCAAGCTCCTTATTCTAGGATTCCGAACGCCGCAGGATTTTGTTCGTCCGTTACCGCAACGCAGCGGACCTAGACTTAGATAAGGGGCTCCTCGTATGCCTGAAGTCTGAATCAGTCTAAGCCCAAACCATACGCAGCCCTATTGTTCAAGATTGTCGACGTGTTGCGGTTAAAGAGTACCGGTATCTCCGTAATCTATCGCCGATCCGCATCGGCGCAATTACCTCCACGCAAATGGATCGGAGCGGCAGCGAGGCGATCCCGAGGGACCTCACTCTAGCGATCCGAAGTTTGACGCGATACCTTTCTATTAACGCCTGGAATTAACGGAAGCTCCATTGGGCGTAACATGGCTGACGGAGGATGGACCATAACCGGCAGCACGCCTAACGCCGAGCCAGGAGCGGGTCTGCTGAACTGGAAATCTGCGCCGCGTGTTTCCTACGATCGAGCCGGACAGCAAGTGCCGGGTACCCCTCCAGCGAAATCCTGGTATGCCGCGACTGCTTTGACCCACTTCATCTCCAAGCCTAACGCAACGCCGTATTTAGACGACTCCCGCAGCAACGAAGTTAATGCGACGCATCGCACGTTTAAGTTTCTGACGTACTCCATCTACGGCAAACCTGTTATTATCGCACTGCCTGACTCTGGAAGTTTCTTAAGCGATTTTAAAGGTGCCCGAACCGACGCACGGACCCGTTCAACTATCGACTATGGATCGCATCGGACCACGCATTGGGATCGTAGCTAATTCCATGCCAACTCAATCTGCACTGATTGGCGCCTGAGGCAACGTTTGATCGCATCAAACGTCGATCGTTGTAGCTATAAATCCTATATAGGGTGACGATTCCTCGAGCGTCGTCGCCAGCGATATGCATGTAGAATCTGTAAGTTGCTAATAATACCGTTAACTCAATACGTGGGTACTTATTAGACTGTTCTTTATCCATATTAACATAGACCTTGCTCTCCGTTGAGACCTAACGCTTGCCAAGGATTTGGGTGAGCGTAATGAATTGGTTGAGACAGAGTTGGACTAGGTAAAGAATTATGCCGGAGTTAAAGTCGAGATCCATTGTTTACATGCGGCTACAGCTGTTTATGTAATACCGACTCATGGGCCGATCCATACGGTATCCCCTGAAAATTTAGTTGGTAAACCCGATAGATCGCGGTCTGCGTACGAGTACTGGTGACAGTTCAAAATTATCACGATTAGGTTGGGATAGCAGGTGGTTGCTAACTGTACGCTGACGCTCGACAGCTCCTTATAACCTAAGAAATATCCTATAGATCACCCCTCTACGGATTATTTCCTGTGCCAAACCTACTAGCTAAAGTTTGTCCAAGTAGTGAAACGTCAGAAGAGTCTAGGGATGGGCATCTCTCAGGCGAGCCGGTTCGCTCGCGTGGCCGAAACGCAATAACAACTTACTACCCTCACTGGGAACGACCCCTGCAGAGCTACTGGCTAATATTTGAATGTCAGGCGTAGCGGCTACGAATAAATGGCCGTTGGTCCGATTGGGTCCCAACTGACTTTGCGCCATTGGTACCTTCCGGAATTGAGAACTCAGCACAGCAGCGTCCAAAGAGACTATGCAAACGATTCGTCAATACTTTGATCGGGATTATGAAGAAATGATTATTTACCTATACCGGTTACAAATGGAAGAATATCTCTGTTTACAGAATCGAACCTACTACGTGACTTAGATCAGCCGTACCCCTGATAGCTTTTGAGGATACGAGTGAAAGCCCAGAACCGTTAGCCTCGGCGGAATTACCGACCTTTATAAGAGCTAATTAAGTACTATCACAGCTACAACCAAGACAACTAGGATTCCATTAAGCGAGGGCAGTACGCGGTATCTATGGCAACTAACAGGCTCACTTGAATCTGTTTCGCTCACAACATATCTCACCAGTGCTCGTATAGAGTTCACCACGTTTGGGTTCTCATAGCTCTGTTCGACCGTTATATGCTTAGATAGCGAGCCGCTATCCTGGCCCGCTAGGAATCGAGCGACGCTCGCCTAAGCCGTACGGGCCGTACGACGATAGGAGATTAGGTGACTCATGCGAGACGTAACTGACAGAAATTAACCGGTGAGATTAGTACCACGGTGACGAGTACTCGACACCAAAGCAGGCACGAGTCAACTAAGTCCTGTACGAATGGGCTGGATGCATTTAGGGACGCGATAATAGCTGGAGCAAGGTGACCTGGGACTCATGTCACGGTGTACGGCCCAGCACTGCCATCGGGGAGAATGGATCATCCACTCGTAGCAAACCTACAGATTATCGAGGGCAAGGCCAGGGAAATGATAGAAGTCTAACGACTTGCAATGACCGTGGCCGTATTTGACCCTAAGTGAAGCCAACGCAAGTTGGTATCTGCGAGTAGAAGTAAACAATTGGTACTATCGTTCTAAATACTCGTATTTATGTCAAACAGCATCTAGGATTATAGTCCACTTAGAGCACGCGGTCCCATATTACCTTAACTCGAGGATTAGGTGAGGAAATAGCTATCTAATGCGACGAGTCTTGTACCAGCCGGGAAAAATTGCGGTATAATAGTTGGCGATAGGCTTTCACGTCAGAGCGCCGAGTGGGTACACGACTTTTATGCACGCGGGCATAGGCATCGCCTGTATTTTAACTTTACGAGATGAGGCGATTAAGCTTCGACTCTACGAAGTTAAAGAGTTTCTGCTATCTATGGGAGCGAGCATTAGTTATAGGTAAACTTTAAACCAATAAATCCAAACTACGAACTGAAATGAGATCTCAACTGTGTTGGTACGGGATTGTACCTATTGAGGGTTAAAACACTCCTATTTGTTATTTCTGTATGATTAACTCACTGTAACGTTCGTTGCGGCCGTACTACAGTACGTTATAATGCCTGTAATAAAGCTACCGAAGTGGCAGTAAATTAACTATATCGACGTATAATTAAATTAGATGTTGCGGCCTATTAAAGACATCTATCAAACACATAGGAAACTGCATTGACACTGAATCAACACTTTAAATTATTAGTATGAATCTGAGCAAAGAGCATTAGCAGATTTTGTGTTAAATTCTAATCGTGACCTGTTACCGGTATGACTCCGAACCTAAAGCCTAACACCACCCCAATCCGTGAGATAACATAGATTTGTGCCCCGCCACTAAAAACCATCGCGTAGGCGACTGAATCTAGTCATGAGCAGCATTATTCTTTCTGTCAACATAATTTTAAAAGACGCGTATCATACCTTTCCCACGACTTATACGTG
>79
CCTGGGTGGCGAGGATCGGCGTCACGCGGGTTTGCCTATTTATGAAAATTTTCCGGTTTAAGGCGTTCCGTTCTTCTTCGTCACTGTAATGTTTTATTTAAAATACCGGCGCCGAAGGAAACGACAGGTCAGTAGAACGAATTTCTACTTCTTTCGCTTCCTGTTTTGTCCGTCGAATGAACAATGGAAGTCAACAAAAGCGCATCTATGGGCTGACATTTCGTCGGGTTGTAGATATTGAGTCTGAAAATTCAACGGCAGGAACAAGGGAATGCCGTTCTGCGAGCGGTGGCAAGGTAATGAGAGCTTTATCACTCTGCCGCCGTCATAAATGGCTGCCGAAGGGATGCTGAAATTGAGAACTAGAAATGAGGCCGAGAGAGGAAGAAAGCGGCAGGAGGGGGAGGAGATCGCTAAGCCATAGAAGGAGTGCAGTACGAACGCCATCGACTTACGCGTGCCGACGCACAGGAACTGAAGAATGCCAGACTCCGCTGAAGTGGTGGAATGAGCAATTCGTCATTCCTCGTTGCTGTCTGGAATCGCAGGTGAAATCAGTATTCTCGACGGCTCCTAGTTCCTTGCATCCGGCGTTTTCCGGACGCCGGAATGAAGAATACAACATGTTGATTTCCTGAAGCGGGATATCATCAAAGCCATGAACAAAGCAGCCGCTGGATGAACCTTACCGGGGTTGCTCAGTGAATATATCGAACAGTCAGGTTAACAGGCTGCGGCATTTTGTTCGCGCCTGCTTCCCGCCTCCTCTTCTCGACCATAAAGCCGTTGAATCTGAGGTGCTAATTACTATCTCCGAAAAGAATCCGGATACCAGGAAGGCGCTGGGGAACATTAATTTCATAGGGCCATCATGAATGCGATGGCAGCGACTACATAGGGGGTGACGCGTAGAAGAGCGCATGGGTGGCAGTACAGTCAAACCGTCTTCAGATCCGGTATATGTTATGCTATTTATAGAGCATAAGCAAGGCACCCCTTATTCTGGTTGCCGACGATGTGATGCCCCAAATTTATGAAATCCCACGTTGAGCCGACTATTCGTGACTTCCGTCGCTGCTGGCGCTGGCCCCGTTGGCAAAAGCACGGCTCTACATACGCCATGAAGCGTTCATGACCCGTGGCTTCTGCCTCGGCGGTAAAGCGAAAAACTACCGTGAAAGTCGGTGATGTGAGGTTATCACAACTTGCTGCTTTTGATGATGATATTGATGAACAGGAAGCTTTTGTTGCCGACGTTCCTCTGATCAAGCGTATTGAAGCTCGTCTCAAAGTCCATCCGTGGCTCCACGGTAAATGAGAGAGGCACTGTCAGTAGATCAGCGTTGCAGCCAGGAATCCAAGTCCTTGCCGCTCTCCGCCCGCAATTTCGTGGCGTTCATGTTCGTCAATCGGGCATGCAGGGAAGCTGGATCGCAGAAGTAACGCTTTCGATAATCGACTCTCGCCTCCAGCGTGTTTTATCTCTGCGATAATGCCTGCGTCATCCGCCAGCAAGGAGCTGGACTTTACTGATGCCCGTTATCTGCGAAGACCGGGATCTGGTGACGGTGGCATTCTCTGGTTTTCGTCATCCGGTAGAAGATTGAGCCCTGACATTGTACCTTTCACATCTGGACAGCGTACAGCCCGTTCACCAGCTCTTAAGATTGTCAAAGACTGGATGAAAACGAAAGGGGATACGGGAAACGTAAACCTTCGTAAACACCACGCTCGGTGAGACGTGGGGAAAAATTGGCGAACGTCCATTATGAAGTGATGGCAGAGCGGAAGAGCATTATTCAGCGCCGTTCCTGACCGTTGGCTTGAACCCGGTATCGACTCCCGACTGACCCGAAGTGCGTATGGGGATGGGGCTGGTAGGAGGGCTACGTAAATTTGACCACGAGAGCGTGACTCGCCACCCGAAGACGCGCCGCCGATGAGTCAAGTAATGGCTACCGATGAACTCGACCGAATGGTGCGAAATGTCGATATCCCCGTATCTTGCTGAACTGGCGGGATTGTACCCGACCATTGTGTATGAACGCTCTAGGACTCGCTCCCTGTTCCTAGTGTAACCGGATCGGGGTGCCGTCCGGAAAGCCGGTAGGATGCACTCGATTAAGCGAAACAAAACGGGGTTGTTTACGTACGCGGTCACGTAAGTACTAAGGGGTAAACCAGATTTATAACCGCTTCACTGACGACGCCCTGAAGGGGATGAACCGCTTCCGCTTGCCGTTCACTGTCACGAATACCCGGATATTTTGATCTGACGAAGCGAGCAGCAGCTGACTGTGCTGAAGGCAGGTCGAAAATCGGGTGATGAAGGAAAAATACTGTGGGACAGCAAAAAGCGACGCAATGAGGCACTCTATCCTTCGTTATGCGCTGGCGGCGATCCGCATCAGAGCTCCTTGCCTCGCAAGCCTGGAAAGATCTCAGTGCGCTGCTGGCGAGCCTTGTGCAGGAAGAGGATGGTGCAGCAACCAGACAAGAAATACTGGCAGATTACGCCGTGCCTTATCCGGAGAGGATGAATGACGCGACAGGAAGAACTTGCTGCCCGTCCGGCGGACTGCATCATGATGACAGGTAAACGGGTGGCAACAGTCACAGAAAGCTGAATGAAGGGTGGAGTTTACGGCCTCGTCGATTTGACCTGAAAAATATATTGCATATGAAGTGCAGACCGGCATGACACAGGGACGCGAGAACTGCATTTGTATGGCGACCTCGCGCTAATTCCCGCTTCCCTCGCGGATGACGGCATCAATCGGTCCCGGAATATGCCGGTCTGATGAAGCGGGTGGCAGCGGATTTGAGGGGGCAGTTGCGCGCTTCGGTCGAACCCACCGAGTGAAAATCCTTGCAGCCCTGTTGCCCAACTTTACCGAGTGGAATCCGCAGAAGGATGGTACGCAATAACGATGCATGCGCCAACGCCATCCAGCCTCTGCATCAGGATCATATCGTCGGTCTTTTCCGGCTCAGTCATCGCCCAAGCTGGCGCTATCTGGGCATCGGGGAGGAAGAAGACGCCCCGTCCTTTTCCCGCGGTGAAGCGGCATGGAAGGGCGAATGTTTGCCGAGGATGAACTGCTGCTGCAGCATTACCTTTGACCGAGCCCCGAAACGCACCGTTTACCATGATGATTCGGGAAGGCGTATGCACTGCGCCTTTAACGTGACTGTTCGTTCAGCTATGGGGATACCAGTTCGTCTAGGCTTTCAGGGGACACAGTTCGATGGTCAGCCCGAAGCATCCCTCGATAGAGCTCCCTCGATCGCGACTAGTGCCGTCGTCCCTTGTGCAGATTAATACCGACAGCGGTCCGGCGGCTGGGATATTACGTCATAGGGACGGGTATCCTGGCTGGATGCCGCAGAAACCGGACCTGTACATTACCCCGTGAGTTACCCGGCGGGCGCGCCTCGTTCATTCACGTTTTTGAACCCTTGAGGAGGACGGCAGATACCGCGCGCAAATGGCGGTCTTTTAAGGGTGATGGCCAGCAGATGAAGGTTGCTCTACGGTGCAGAACACGCAGATCGCAGAGCCGCCATTGTGATGAAGGCGATTATCCCGCCATTGAGTGAGCTGGATACGCAGTTCACCGGAGCGATTGTCGTCAGCGCGAACAGTCCCTAAGGAGGGCAGCGGGAAGGCTGACCTGAGCTGGATTGTGGTGAAGTGCCCGTATTACGCCGCGGCGCCTAGGGTCCGGGGCTGGAGGAGGCGGCAAAGTACGCAGCTGATGCCGGTACTCACCTGAATCCCTGCAAGACGCTCAGGATACGGATAACGCTACCCGTGTTTGAGCAGTCACTGCTGCGGTATCGCTGCCGGGCTGGGTGTCTCGTACTTCCCATTTCCGGAATGCCCATCAACGGACATCAGTGCGAACGATCGTGGGCGTCACTTTATGGGGCGAAAATTCAGTCTCGCATCCAGTCCATGAAGCCAGATGTTTCTGCTATGGAAGAGGAGCGTCCGCGATCCTCTATTTACGTCAGCTCAAATCCGTGCCGGAGCCGAACGGTCGGTGCCTGGGGGAACTGCGACCGTGAATAGGCTTCGTGGTCGATGATGATGGTCTGAAAGAAAGTCAAAAGGAAACCGTGAGCTGATAGAAGCCATGACTGAGTACCTACGAAGAGTGGCAAAACGCGGTACCTACGTAGAAGGCTTTGCCCATCAAGTCGGTCCGGCCGATCGAGCCGCCGTGCAGCCGTCTTAAACCGCCCGCCTGGCGGCTGCAGCATTTGAATCCGGGCTGCGCCCCTGTAGACATCAACAGCTAGAAGAGAGAGGAAGTAGCATATGTAATCCGCATATTGCCGCCCGGCCTTTAATGAGCCTGGTCTATTGAACCCGCCTATGCGGGTCTCTTTGTGCCTTGCATCAGCTTGGGGATCAGCAGCAGCCTCTGACGGATGCGGTGTCCGGCGACAGCCTGACTGCGAGGGAGGCACCGCGACGCCCCGGAAGTGCTGGCCCGATGAACGGACAACACGACAAGCCGCAGTCTTCTCCGCTTGGACGCTCCGTCCTTCCGCAGGTCCGCACGCTGGTCAGCCGGACTACGCGGGCTGCTGCAGGAGCTCGGTCAGGCAACCGGTTACAACGGCATTATCGCTTCCAGGCTGCACAGCGGTTCGATCGATCTTATTAACGGCATTCTGCTCGATATGGACACGCCGGCGGGATGGTGGCGGGGGCATTTGACTGCCGCTGACATCATCGCCGTGTGCGTTCGTGACATAAATCGGTATGGGCGCTTCGCCAACGACATCGGTACAGTGCAGGTCAGTTGCTTGCCAGTCCCCTCCTCCCGCGGCGTCTGGTCACCCAAGCCCGGACAGGCTCCATCGGCGTCATGATGGCTCACAGTAATTACGGTGCTGCCTGAGAATACAGGGTGGAAATCACGTACTAATGTACGAGAGAAGCAGGCCGACCGCATCGCTAAGCCATCTTCGATGACGTCCGGAGACATGCATTGAATGACGCATCAGGTGTTGCACAGACGTCGGCATACCGGCCCTGTCCGTGCAGGTTGTGCTCGATACCGAGCTGCAGGGTCTAAGCGTCAGGAGGCCATGATGCCATGACTGGCTGATGAACTTTAACAGCAGCGATGCGATCACCGTCATGCGTGATGCACTGGATGCACGTAATCCCGTCTCTCAGGGAGGTGAATGACCAAAGAGATGCCATCACTCTTCCTCTCTTTCACTCATCCTCAACTTCGCAGGCTGACTTTAGTGCCAGCGACGGAGGGCGAACGCCAGCGGCGCAGCCGGAATGCCCTCAGCAGATCACCGCAGCGCTTCCTGGCAGAAGCAGCCGATGGTAGAATCCTCAACTTGAGGAGGCTCGACGCGAAGAACAGGCACGCGTTGGGCAGAATGCCGAGTCGACGGATGGAACGCCGCATTCTGCCCGCAGCACCACAGAGTATGCACAGGCGCAGTGACATCCGCTCTGACGTCGATGCATGGGGCAGCGGCACCCTGGCTGCAGGTAATACGATTGATGCCCGTTAACGATTTGCTGAACACACAGTCTTAAGGGATGTTTATGACGGCAAAGAAACCTTTACCATTACCAGCCGCAGGCAACAGTGACCCGGCTCATACCCGCAACCGCGCCGGCGGATCAGTGCAAAGCGCCTGCAATGACGACGCTGTGCTGGACCTCAGCCGTCAAGCTGGTTGCGTGGGATGGCACCACCGACCCTTATGCCGTTGGAATTCTTGCGGTCATGCTCCCACGAGACCAGCACATGACTACGTTTATCACAAGTCGGGCACGTTCTAGTTATGAGGATGTGCTCTGCCGGAGGCTGCCGACGACACGAACAGAAAAACGATAGGAACTTCGTTTGCCGAACGGCATCAGGCGATCCTCGCGTTTATGGTTTACCGCTTCCTCGCGGCTAGTCCAATTTTACGAGGAGTCTCGTGTACACAAACCGCGAGCCCAAACCTGGCGGCAATTAAGCAAATTTAAGTTTGATCTATGTTTCTGCGTCTCTTCCTTCCGTCCAGCTATCCTTCACCACGAGAAAGTCTATCTCTCACAAATTCCGGGTACTGGTAAACATGGCGCTGTACGTTCGCCGATGTTTCCGGTGAGGTTATCCGTTCCCGTGGCGGCTCCCCTCACTGAATTTACGGGATATGTCGATCCGAAGCATGAATGAATCCGCAATACCGATTCTCCCTGCCGGCCGGATCCGCAGAATCAATCTGGCGACTGGCGGCTTACGCCGCCGTCGCATCATCATGCAGAACATGCGTAACGACCCTATTGCTCAGGTCGAAGAGATGCAGGCAGTTCTGCCCGTTAATCAGCAAATACACCATGACCGGTGAAGCCTTCGAGTCGGTTTGAGGTGAGTATGGGCCGCATGTAGAGGAGAATAATGACGCAGTCCGGCGGCACGGAGTGAGGCAGCGTGACAAGTCCACGTTATACCACTCAAGGAGAAGCTGCATCCGGACTCCTTCTGACGGTGTTCGATTGAAATATTAGTAGCTGTTCCGTTCCTTCAAAGCCGTCAAGGAGAAAGCTGGATACCCGTCGTGGCTCTAATTCGAGCTGGAGACGGCGGTGAACCTGGGCAAAGCGGTCCTATAGAATGTATCAGATCGCTATCGTCGTGTATCTTCTGAACAGTACGTGGAAAACGGCGTCAAAGAACTTCCTGCCGAACAACCGATGGTGCCTGGGGAACTCAGACGGGGTCCTTAAGGCCTGGCTGCATTCAGGATGCGACGCACACACAGGGCATTAACGCCTCTGCCCGTTTGACAGAAAAACTCTGGTACACCGGCGATCCGGCTAGATCCATTTACGCCGTGCAGTCAGCGCCTGATTGGATGCTGCTGGCCTTATCATGAGTTCGTGTTAGTCACAACCGTAATCAAGCCGTCGGGGCTTTGATCCGGAGTCCCAGTGACGAAGATGAACTACTTGCCCGTCTCCGCTCGCTGGTGAACAACGAACGTGATGTCAGCCTGACGGGACAGAAAGAAGAGACCCACTCCGTGGCACCTGAAAAGAGTGTGGTCGACACGAGTGAAATCGCTTCCGCCCACTCCCCTCGGAGGTTGCTCAACATGAAAATGAGGTGGGATCAGCGCATCCGGATACCGTGATTCTGGATACGTTGACCTGGTCACGGTCGTGGCGGCACTGGTGAAGCTGCATACTGATGCACTCACGCCACGGGGTTATCAAACCTGTGGCATTTGTGCTGCCCGTGACGGCGTTTCGTCTCTGCCCCTTACAGCCGAAATGACAGAGCGAGCGGCCTGGCCAGAATCCGGGCAATAACGGGAGGCGCTTATGATTTCGATACTGTTCGATGCTGCCATTGCCGCGCCGATGAAACGAGTACCGCGGGTACGATGGGAACGTCAGCCATTCAGGTACGCGGAGCAGTCAGCGAGCGAGATCTATAGAGCGTAATCTTTTGAAATATCATCATGAGCTATGCCATGACATAGGCGTGCCGTTGAATAGCAGCCCGTCCCTGTTTGTCTGAACTGATGAGGTGCGGCAAGCTGCGGCGTGGAAGCTGTGAATGATCGGGGAAAATGTTTGTGGGGTAGATCGGGTTTTCTCCCCCGGATGATGGAAGTTGTCATCTCTGGCGTGCTCTAACGCGTACCGCCTGCCGTCTACCGCTTCCGCGCGACCGGTCCTCGAGGTCATCAAGGCGCCTGCCGAGCGTTGAACTCAGCCGTATCAGCAAAACGGCGGTGCCTGGCTGCTGCATCCCATTGACCGCGTTGCTTCATCCGCGATATCGCAGTCGGCGTCACATGTTGCCCGTGAGACAAAGGTACGGAACGTAAGGAAAGCGGCTGAAAGGCCACGTCAAATCGCATCAGAATCAAAGTTAACCGGGGATCGGAAGAGGAGAATAGAAGCGCATTCATACGCGCGGGCTTCGGCTGCGCCGGCCGCAGCGTTTAAATTACAACAGGTAGCGAGGCGGGGTTATTGGTGGACCGTCGTCGGATAGGTCGTCAATAGTGGCACTGGCCGTCGAGATAGTCATGCATAATTAGGAAAGTACCGTTACACGATGTGATAGTGTAAC
>80
CCGTATTCTGCTTGGTTATGACCTTGATGGCAGATAATGTTAGGATAATTTCGGATCACTTCCCATTTTGGCAGAAGACACAATATAGAATATTAAGCTGGACAGAGTCGATTATTACACCCGCCTTACGCTACACCCTATCGTACATCTAAAGGTTAATTAGAAAATTTATGAAATAATACTCCCAAAACACTAGCTAAACATATTACATCATGCTTGTTCATCAGGTAAATGTCATTTGGTATAGACAAAATAGATCATTTTCTTCCTATTGCACATTATCCTGAAATTTTCGGTAATGGGTTTAAGGTTCATCGTGCCGGACTGAAAATCGGCTAAACCGTCACCGGCCTGAGATAAGCGATCATTCATGACAATAAAGTTTTTCGTGAGTAATGGCTAATTTCGTTTCCAACTCTATCAGTTTTATGTTGAATGCCCGGCGAATGGAGGCAGAGACAAACACAGCTCTTCATCATTTCAAGCTGTAAAATATTAGGTAAAGGTATCGTTTGCGAGGCAGGGAACCAAATCAATGAATGACCGACGAAACTATTTTAAATTACTAAGGAAACACTTCCTCGTAAAGAGCGTTCAATGCAAAAGCCGATTACAGAATTTATTTATTGAAGCAAATCTGAAACCTATTATAGATTTGAAGTACTTCCCCAATTATTGGAAATTATGTATGCGTGAAGCCGAACCATTTTTCCAGTAAGGGGATAACCATAGAAGTATCATAAAGTGACTAGAATGAACGAATATTTATATGAGGAGGCTGTTTTACAAATCCTTAGTACTTGCTAACCAATCCTAGGCAGTCATTGGCAAGCGCATCGCAGTAGAGAAGGACGTTACCGTAATGTCCCAACCAGCAGTCTCTAAAGTGGAGTCAGTCATAGATGGTCCTGTATTAGCAAACTCTAAATTTGTAACACGGGCGCAACTTAAATCATGCAACAGCCGAGTGGGAATACCACTTCAGCCGCATAACGATTCTCACGACGGCCGTCCTGCAGCGGGTCCAGCGTACCATCTCCTATGAGCGACTTGTTAGCAGCTAAGCCAAGCCATTTATACATAATGAAGTAATAATAAATTTCCTGTGTAACTAATTTACTATGGTTTCTCTGTAAGAATACCTCGTGCAAAGTAAACACTTGTATTACATTGACAGTTAAGCAGTTAATTTACCTCTAAAATATATCAGCATCTAGCATGCAACGCCGGCCTGAATGTTTACTAAAACGACCCAGGAAGAGACTTAAGAAGATTTATCGCACTTGCTCAAATGCTGCATTAGATATCCTATTTGACCCTGAATTATTTCGCTTACATTTGAATCATTCCCCAACCCTAAGAACAGTGACATTTATTATTCAAACAAAACCATTAGGATATGACATTTGGTATTAACAAGCTGTTATCCAAACCGGAAAATGAATGCGCTTAATGAGTCGGCTAAATTCTAGGATACGATAGAAAACAAGGATTTAGAAACCAGCGACGAGGGACTTATGTTCACTGTAAGTCGAAGATGACATTGAGATTTATTACAATGAAAATATGTTAAACATTGGTATAAAAGTTAGTCAGACTTGGACGGAAATTACTTCATACTTTACTGACGATGAGTAGTGGATCAGAAGACGATGGGTCCTAATACGACAGATTACGAATTACTGCGTGATAATGGCTGGCAGACTTAACTGCTGTAACTCTCTTAAGACAAATAAACAAGCGGATTAGATGACTATCTAGTACTTTCGCCAACATCATTCGACGACTCTTTATTTGATGAAACGCCAGAATAATATTTAAAATTAAAGATTATCCTCCATAAGCAATGTCATTTAAGCCACAACTAAAGATAAAACAGATTCCTGAAAGATATTAAAGGAGCGTCTAAACTGTAGACAGCCGACATATCACTTCGACAGACCAGTGGATTACAGCAAGGTCCAACGGTACTTTAAAGCACGGTTATCACATTCAAACATTAGATTTATAAACAATTCCATCCAATTGATTTAACATCAATACAACATTTGAAGATCACCCAATATATTTTATGCAGAATCCGAGGACAGGTATCACCCAAAGACAAATGCCTGGCTTCATTTGGGTTGGCTATGAGAAAAGAGCATCTACTCCAATAAACCAATACAATGCCATTATAGATGAAAGACTTCAGGTAAATCCGGAAGTTGATGTCAAATAATCAAAAGCTTGTATTTCCGGAAATAGTTAGAGAAACGAAGATACAAGAAGCTTTAGAAACACCCAAATAAGATCAACGACCCAACCATATTTCATGCGTTGCAGTTAAAGGCATTGGCCGTAAACACTGAACAATTGAGTCATAGAAATTCCATGTCTCTCCGACCATAATAATCGCCAACAAATAAACCAATACTCAGGTTACCTAAACTAACCGAACGTTATTTCATAAGACGTTGCGGGCATACCAAACGATTACTCTCCATAAATAGAAGCAGGCCTCAACATCAGGTGCAGTTGATGTATCACGTCAGCAAGCCCGATATTCTTCCCAGTTCCAACGAGGTTTCTTCCTTCTGTCCGATTCCATCCGACTCTAACGAGCATATGCTCACTCTACCTGCATCAGGCTTTTGTTTCTTCCCTCCCGGATGCCGGACTTTTTGCTCCTTTAATCATTCTAGCCCCAGGCTGTGCCGTTCCTATTTCTGATATTCCCTCCCGGGGATACCAGTAAAGTTCCGGTAACGACTGAGAGTTCAGAACAACGCGTAGCGCCGAAGCCATCAGGTCACGTTACCCCGATGTTCACGAGTGCCATTAATAATTCTTGCAGCCGAACAGGCCACAAGCCGGACGCCGGAATATCTGGCGAGTCGTGAATGAGTAGTGCAGAGGCAGACTAGGGTATGAGGCAAATATGCGTCACCTTCACAATAATGCTTAGTTCCGGCCGATTATAAATTTGGTCTATAGCCGCTTCGCAGAATGCCTGCAGCCTCACAAGTATAGATTAATGCAATGTTTTGACGGTGTTTGCCTAGTCCGCAGCGTTAACGGTATCTTGTCTAGTCGATAACAAGGAAACTGAGGCCGAGCGGTACTGATATCGAGCACCAATACCAACTGTATCGCATGTGCACACCAGCGACGCCGGGGCCGTATAAACAATGAGGACTCGTGGCATGCTGTACGTCCGTTTCCATACTAAGCCCTGTGCTGTTTCCTTTAACTGTAAATTCCTGACTGGTGCTGTTCCATACTGACCCAGCCAGAACTGTTCATCCTAACCATTGTGGCAGTGAGCACCGCGGCCCCCTGTTGAACGAACAGCCAGACTGTGGCTAAGGCTCCGATCCTTTACTTTGGTTTAAGTCGTAATCGAAATGCTGGTCCGTCCTTGCTCCGTAAACGATGTATTTCTTCTACAAATCCGTACCACCCTTATCACTGGCACTGTGGGTGTGCGACTGCTTCCATGCTATTCCTGAGACAACCACCCTAACCGACTTTTGCTAGTGGGTTGCCTCCACGCGCATATCAGGAAGCACCCATGGGATACGCGACAGGTTTGGGGCTTCTAAATCGTAGAACGCCTCTCGCAGCCCATCTAGGATACGCTAAATCAGAGGGCGATGTCACGACCCCGGAAGCTTCGCTATTAAGGCATTTACGATAGATCAATCAGAATTCTGCGTCAAACGCGATTTTCCCAGAAAGACTCCCTGCCATTTGGTCAGATTGGGATAGGCATCCGACAGCCCGTCGGTACACGTCTTCGCTTGTTGACCGCGCCATTCAGTACGGGTCTAGCAATCGCCTTATACGTCCCGGCGCGGCTAAATTTGGGTCCACCGTATTCCGTACGGGTCCACTCCCGTTGCTATAGTGAATCGAGCCGTAACGACGCGGTGTCCCAGAATGGTCCCCCTGGAGGCTTCCTGTTGGCGTCCGGTTGCTGTTGTACCGATATTTCCGTCTACGTCCGTTTTCTGTTCGTTTCATCCATTACCATGACCGCCTTTGGCGTGCAGCAAGCGTTTCAGACGTGCTGTTGGTGCACTGAGCCTGGCACTATCCCCTTTCTCGTTGTCCGCATCGCCAAGCGCGACATGAAGGCCTATATCTTCTGCACGTTTTGCCGAATTTGCAATTTACGTATTTATCGACGCCGCTTCTGCCGCATTTGGTGCGATGTAGACCGCACTTCCCCGACTCTTCCCTTCCTCGTACAGCGTTGACGCATCACTCCCGCCGCCTGTGTTTTGCGTGCCCGGCAGGAGTGGCTCCCGTTCCGCTCCTGTTCAGAGCTCTGGCATTCGTCTCGACGGACGTTTTGCCGCCCTGGCAGAATTTTCTGCCGTTGCATTGCCGAGGAAGCTCAACGACGGCACTTGATGATGCGTTCGTTTCTGATGATTTGCTGCTCTTTGTCCGACGCGCATCTCGTGCTGAAGCGGCCTCTGACGGCTTTCGTGGCCCGGTGAGGGAGTGGCAGACGGTGCTGATGGGATTGAGCGCAGCACACTGGTCTCCTGAAGCGGTCTGGTTTCGCCGGCACTGAAGCGCGTTTTGGGATCCGGCTCTGCACCTGCGGCGCTTTTCCGGTTCGCATCGTTGCCTCTGCCGGTCCACGAACCTTCCTGAGCTGACGATGCAGGCCTGTCCGGCACGTGCTGGCGGCGCGTGCATGAGTCAGGTTGCATCAGTCACCGCGACCTGGCATGATGCACTGGCATCGCAGGGCTGATTTCTTGCTGTCCCGTCTCTTGCCACGACGCGTTACGCGCCTCTTCCCATGAGTTCGACCAAGACGAACGGCATGCCTATCTAATCATTCCTATGGCACAGAAATGTAAGTGCCGTCCCGTGAATCTTCATACGATGGTCCCCGGCGTGCGATGGTGGAAACCGTCAACCTGCAGCAGAGTGACACTGTACTGACCTGTACTCCACATCGCTGCTGTAACGCCGCCGCGGCTTCGCTCTATGGATTTATAGCCATTTACCACCGTGGTGCTGTTACGTCTAGTTCAGCTGAAGGTGGAGTCTTGTACCGGTTTTCCGTGGCTGTCTTTCATCGACTGGACGAGTATTCTATCTAAATCACCGGTTCCTAGAGCACGGGCTCGATCAGAAGTGGGACCAACGGATGCTTCGAGCTAAATTATACGAATCTAAGTTATAGAGCCGAGCATGGATGCGTTAATCGCCGATCCTCAGCCTGCCTTCATAAGCAACAGGACTGACGCCTGCCGCTTAATTACTTATACCTGCATCACGCCACTGAGGTATATCCGCATTGCACTTTCTTCCTGGCAGTGCTTTCATAGGGCCTCCGATACCGTCCGTTATAATCCCTTACCGTAAGGCACTCATGTACCACTGACTAGGCTCAGCCACTCCGATGTACGCTCTGCTTACTGATTTGTAGGTAACCGGTCGGCCATCACCACAGCCAACGTCCACGCATAGGTGAAATATCCTCCCCGGTCATCACTGTGCCTCTGACTCTTTTAGACCGCGAGTGGAAGCACGGCCGCTCGTCACGTCACTCATACGTGGTCGCACGTTAATGCTTTCAGGCAACTCACCGTATCCCGCCGACGACGGCATGTACCCCAGTTCATTGAAATAGCCACCGTAAACGACTATTATCGCCGTGCACGCGTCCGCTCGTATAGTACTGTCACCGCAAGGTACGAGCGGCAAAGACACGGCATACATTAATCGTTCTCACCTGTTTATTAATAAACGCCCCGTTCCCGGACGAGCTGTAACACTCAGACCACGCTGATGCCCGCCTGTTCTTAATCACCAACCTGCACATCGCTGGCAACGTATAGGGCCGAATATCTGCCGAATGCCGTGTAACGTAAGCGTGAACGTCGTCAGAAACCCTACGTTTCCCCAGCCCTGGCGATTAACAATACGGGAGAAGACCTGTACCGCCTCGTTCGCCGGCCATCATAAATCACCGCACCGTTCATCAGTACTTTTGGAGATAACACATGAATACGTGTTGTGGACATCTAATCACGGTGATTCCGAAACGTCACTACGAAGGCAGGACGGTACCTGGCGTACCCAAAGTATTAGTCACGTGACCACAAACCCTAATAGTGACCGTGCTCCTCATCAGTCCACATCTGGCCGCACTCAGGAAGCCGCCTGCATGCTTTACAATGTCCCCGACTTTTCCCTCACTTATCCGTTTATCGTACAGTTTTCAGCTATGGTCTATACATTACAGCCGTTATCCGAGTTCGCATTGCACTGCATACATTAGTCGCATTTTATAAGTCCTTTCCGTCGTAGGTTAGAAAGAAGTCCGGGCCAGCCGCTGGTAATGGCCGTCAGGCTGCAGGAAGCGTCGTTCAGGTGAATAGTTGGGCCACAAACATCACCGTTCGGTCGCGTTTCACGGGTATTGGATAAATGCGATACGATTGTAGCATCTGCAATCTGCTTTCGTCCGTACCGGACCGTTAATAAAACTAGCCTGCTCCCTGTCTCCAGCCTAAGAGCATAATGTTCAGTCTGTGCTCAATTTATGACAGCCCACATGGCATTCCACTTATCACTGGCGCTCCTCTTCCACTTTCTGAAAACTCCTCCAGTGCTGGCGATTCTCTCTAAGTCCTTAATTTTCCCAGCTCCTTGCCCCGATGTACGCTTCTAAATCTGTTACTTTGCCTATCCGACTTCCCATGCTCCACCGACCTAGCCAACGAATGCCGATTTGCCAACGTTTACACTGCGGATAAAGTAATAATCATGGCCGGTTGGTTGATACTGGCTAGGTATCAGTATGCCGTAGACCATAACGCGTGGTTCAACCTGTCTTGTACCCCGGATGCCTGCTTGCCTTGTTTGACAGAACCCAAACTAGTACGTTAAACGTAATACGCGGTGAGTAGCGATTGGCAGAAGTCTAAGCCCGGCGTCACTCAATCCTCGTAGTCGCTGCCGGCAGCGGCAATCTAAACGATACCCCGACGCATCCACCCTGCTGCCCGCATTTACCGGACTTTAATTAAGCCTCTTAGGTTCCCCAGCGCCAGTTGCTTGAAGGCTGTAGTTTCCACGTCGTTTGAGCGTAGAACCACCGGTTCAACTCATAGCCTTACGACGTCGTTAAATTCACGGTGCGCACCTCGGCGCGAGAAGCCATAGTCACCACCGTCAGTCAGACGCTCTTAGCAGGTTGCGTATTGCGTCCTGCTGCACATGGAGCGTGACACCATTCACGTGCCCTCTGTTTAGCCGTTAAAGTGCCCCGTTATCCACGACCTCTTTCCGGCAAGTTGCTGCACGGCGTGATGGCATACGGGTCGTCGTTCTCACGGTACTCACGCAGTGACAAACACAGTCGCTGGCCAAGCGTACTGGATTCAGCCATACGCTGTCTCAGCAACACCGTCCGAAGACAACGTTACCTTCACGCCGTTAACCTGGCAAATTTCCCACGCTGACGGATCCATTTCTAAGTTAGCCGAGGGTCTCCGGTACCCGGGCCGTGCACCTGTGTGATACTTCGCCGGTCCGTGATAGCTGAAGCCGTCCGGTATCTCATTTCTTCACCACACGACCAAGCGTGGGTACCGGCATAGTCATCATCGCACTTTCAATAACATCGCCCGGTACACCGACCAGCCCTTCTGCGCCGACGAAATCTACGGTCCGTTTCCAGCAGTTCTGTTTGTAATCAGCCACAGCCCTAGGACGGTGCTGCCCCGGCTGGTGAGCCAAAGGCATCCATCTTCCTTAACATTACGACCTGGCATCGGTATCTTCAACAAGCTCTGTCCGTCTCAGCGTTTGCTGTAATCCAGTTCGCCGCCAACAAATCTTAAGGCGGTCCTTCAGGGCACTAGTGAAACCTAGGCCATCATCCGCGCGGCATACCACATTATGCCGTGTATAGTCCACGTAGGTCTCGACGTCGTTATGCACGAATGACGTCAGCGTCTGCCCCGTTTAATAAGCAGCCCGATATAGAAATGAGCCCACATCCACGCCTTACGTGGTTAGACGGCATTACAGGTATACCGACATGGGCGTGCACCCGCTTTAAGGCCGACTCTTAGCAGTACTGGCTCATGACATACAGCGCCGTGCCTTACATCCGCACCAAGAACCTGTTCCAGGGTCCCTGACGGATGGTTAAGGCATATCCCACAGACAGGCCATGTTGATCGTATCGCTGTTTAACGTTTAGTTCTAGGCCTCAGATACCGCTGTATTGCCCGCGTTATGCCTTACGTTACAGGTAAATCGAATACGCCCGACATCATCCATATAATCTAATCCATGCTCCGATTGGCTGCCGACCTGAATTAGATTGTTCGGGACGCCGACTTTCCCGGCTGGGTCGATTAGCCACAGCGTTTGCGAGGACGAGCTGGTCGTATCCTTCCTGGCAGGTCGGTGAGCGATGCTCCCGTGCATGGGGAGGGACGGGCTCGACCAGTACCCATCACCACTGAGGCCATATCGCAGGGTGGTTTGCGCTTAATGGTATGTCTTTTCCGTAAGGTCCAGCCGTTGATGCGTTGTAATCGAAGGATTAGGGACTTCCGGACGCTTCCTGTCATTTTTAGTATTCCACCAGTGCCTGTACCATAGAGACGGTCATGTTTGCACTATATCAATGGTGCTCGTAGATGTCATATTCGTCTATCCAGCACGCGTTGACGGAGCCAAATGCATTTAGGCTTGCCTCCTCACCAGCCCGGAACAGTCACCGTGACAGCGATAGCTAGATCCTCTAGTGTTGGTCTAAGCGGAATGTCTCAATCGACGGACCGTATTTCTAAAGTTCCATCTAATGATTACACTGACTCGGTCCTGGCATGGATCACACCCAATGATTGCGTGACTTCAGTCAGTGCTTCGGTCGGAGGGGTCCCCTTACTGCTTCCTTTACCCATTCCTCACCTCCATAAATGACAAAACCGCCGGCGTCCGCACAACATTTTGCATCACGGGTACCAATCAGATAATCATTTGACCAAGTCGTCTCTGCCGTACTCCTGAGAACCACGCGTATCGAACCGCGTCGCACTTCCCCGACCAACAGGACATTGCCCTAACCATGTTATCCATTAGAGAAAGCCTGTGCTTAGCGGCCGTCGTTATCCGTTGTCTGTACGGGGAGTTCGTGGCTTTCGTCAAGTGCTACTTACCCGATACATGTAAGCCGAGACAGTAAGGGAGAGCACCGTACGGTCCTCTCCCAGCCTCGCAATGGCTGCCCCGGAGTGGTACAAAGACCGGCAGCAACCGCGGCACTTAGCGATAGCGAAGCGACGCCCCAACCTATCCGAATAGTGACTAAGTGGAGGATAGGCAACCAGTGCCCTAACTCGCAGCGATCTCATGAGCTTAGATTGGGGACTGTTAGACGCTGACGTGCCCGGCAATCCGTACCTGATACCAGCCCGTGCTGAGTTTCTCACGAAATGACGGGAGCTGTGTGGCCAGTGCCCACTGGCTTCAGCCCCCGTTTCACACGAAGTCTTAGATGCGGCAAGCCAATCGTTACCGTAATCCCCAGTGAAGGTCCGCCATGCCCGGTGACGCCAGGAGTGCGTGTGCGTCCGTGCCATTTAGCGTCATCCTCTCGTTTGAGCCAGTTGTCCAGGAACTGTGCAGCACCGTTTCCGCAGTAAATGCGCCGTACTTCGATAATAAATACAAAACAGCACAGCAGGCACATCGCCGGCCTGTGCCGTGGACGGAGCTGATACAGCCCCGTCGCCTCCGAGAGTACGAGAGAGATTCTCTATAGATTCAGCGATGCTCGATGAAGCTTTAAGCATCAATCCCGCACAGATGATAAGCATCCCGGACAGTTCTTTATGTTTGG
>81
GACCGTTTCTCGTTCAGCTTTATGAGCGGTTGGCGTACACAGCGGTTATCGCTTATCAATTTTGTTGCAACGAACAGGTCTATATTAGTTCAGATAACAGCACATCATTATTTGATTTCAATTTGTCCCACTCCTGCCTCTGTCATCAGCACGATACTGTGGCTGCCGGCGTTAGGACTTATGCCCGAGAAGATGTTATCAGCAAACTTATCGCTTATCTGCTTCATAGAGTCTTGCAGACAAAACCTGCGCACTCGTGAAAGTGAGATCCCCTTCGAAGGAAGACCTGATGCTTTCGTGCGCCTAGCATAAATACGTGATACTGTTGCCGGATGAAAGCGGTTCGAGACGAGTAATGCAATTATGGTTTCTCCGCCAAGAAATCTCTTTGCATCATTTATCAAGTGTTTCCTTCATTAGTATTCGAGCATCAATATGGCATGCTGTTGGGATGAGTAATTTACGCCTTGTTTTGCTTTGCTCGACATAAATATCCGGACATCTACGATGAACCACTTCATTTCGCATAAATCACCGATAATTCGAGCCCGGTGACAAAGCTCAGTTCCATTGCAAGTCTGAGCCAACATGGTATGATTTTCTGCTGCTTGATAAATTTTCAGGTATTCGTCAGCCCGTAAGTCTTGATCTCCTTACCTGATTTGCTGCGCGATGAAGGGACATGGCTTTGTTGGTATGGCCTTCAGCTATTACTATTGCCTCCGGAATGCATCGCTCAGTGTTGATTATTACTTGGCTGACGCCTCTTGCCCTCGTCTATGTATCCATTGAGCATTGCCGCAATTTCTTTGTGGTTGCGTAAGAGCATCAGGCAGATCCTCCTAGCCTTATTAATTGTCTAATTTGCTCATGTAATTTATGAGTGTCTTCTGCTTGATCCTCTGCTGGCCAGCATTTTCTGCAGCGATCAAGCCATGGAATGTACGTAATAACGGAATTATCACTGTTGATTCTCGCTGTCAGAGGCTTGTGTTTGTGTCCTATGAAAGACTCTCAATGTTGGCCTGGCTAGCGCCTTGAATGGATTCCGTGCCTGTCCCGTAAATCCAGCTCTGTTACCAAGTTCCATTACTTCTAAAGGTTGGTAAATCCCGAGCCGACTGCCTCTTCCATTTTCTGTACCTCTCAAATCAGGGGACGGTCGTACTAAGTCAAGTGACCGCTGATCGTGGACAGATATTTCTTCCCGTTTCTAACCGGTGTGACACTTCTGCATCGACCGCACGACGACTGTTATTCAATTTAAGCTCCTTTGAGGTGGTACAGGACCGGGTAGCCGTCCATCTAGTAGAGGTGGGGTATCCTGTACAAGGTAGGCCCAGACAACTGAAGTAGCTACACAAGTGTTCACAAGGCAAAGTTATCCTTTAACCGTGCAGACCGTTCAAACAATGAAATGTCGGATGACAGGTACGAGGGTGTAGAGAGTGCTACGCGGAGAGCGCGTAGGGGCGGGTAGTGTCTTTTCAAAGTTTGTGACAATATTCGAGAGTATTGGTTACCAGTTATGTGCAAGTGTCTATATTCTTGCTGCGCCGCTATCATCCAGTGGTCGTAGCAGTCGTTGATGTTCTCCGCTTCGATAATCTCTGTTGAATGGCTCTCCATCCATTCCGGGATTCGGAAGTGCATTTATCATCTCCATAAAACAAAACCCGGCCAGGTCGTGATTCAGATAACATAAATCCCCGCGATGCGATTGTTATGTAATATTGGGTTAATCATCTATATGTTTGTACAGAGAGGGCAAGTATGTAGTTTCCACCCGTACTCGTGATAATTTGCACTTATCAGGTCATTTCTGGCACATTGCAGAATGGGGATTTGTCTTCATTACTTATAAACCTTCATGGAATATTTGTATGCCGACCCTATCTACCTTCATCTACATAAACACCTTCGTGATGTCTGCATGGAGACAAGACAAGCGTACTGCACAACATTGATAACGCCCAATCTTTTGTGAGTAATCTCAATCATCACTCATTATAAATTCCCTTGGCAATGATGTCGTTTCACTAAAGCCGTAGCGCACTGATGTTTAGTACGAAGTAAGATAAAGAGCGCCTCAACCGATGTTGAGTACGTCATCATCTGACATAGATACTCTGGCACTAGTGAACGAAGACGACTACGCGAATCAGCATTTCACAAGCGTTATCTTTAAAACCGATCTCACTCTCCTTTGATCGAATGCCAGCGTCAGACATCATGCATACTCACCTGCATCCTGAACCCATTACCCCTCCAATCGTAGCGGACTGATGCGTAATGATGTCGATAGTTACTAATCACGGGTCTTGTTCGATTAACTGCCGCAGAAACTCTTCCAGGTCAGTTGCAGTGCTTGATAACAGGAGTCTTCCCAGGATGGCGGTGAACACAAGAAACTGGTTTCCGTCTTCACGGACTTCGTTGCTTCCCGTTGCCATAATACCGGCTTACTCCCATCCGATAACACCTTCGTAATACTCACGCTGCTCGTTGAGTTTGATTTGCTTTCAAGCTCAACACGAAGCTTCCCTACCGTTAGGCATATCCTCGTTCTCCTGGTCGCAGGCGTTTAGCTTGATGCTGGTTTCTTTCCCGTTCATCCAGCAGAGTTCCAGCACAATGATGGTGTTACCAATTCATGGAAAGTCTTGCGTCAAATCCCAGTCGTCATGCATTGCCCTGGTGCTCTTGCTGCTCCACGCAGTGCCGCCTGAGAGTTAATTTCGCTCACTTCGAAACCTCTGTTTACTGATAAGTTCCAGATCCTCCTGGCACTTGCACAAGTCCGACAACCCTGAACGACGGAGGCGTCTTCGTTCACCTCTCCATCCTAATCGCCACAGCACAATGAGTGGAATATAGCGCTGGTGTTTTCAGGCGGCATTTTATTGCTGTGTCCCTTAAGTAATTCTTCTACTTTCTGATGCTGAATCTAATGATGTCTGCCATCTTTCATTAATCCCTGAACTGTTGGTTAATACGCTTGAGGGTGAATGCGAATAATAAAAGGAGCCTGTAGCTCCTGATGATTTGCTTTCATGTTCATCGTTTCCTTAAAGACGCCGTTTAACATGCCGATTGCCAGGCTTAAATGAGTCGGTGAATCCCATCATCAGCGTTACCGTTCGCGGTGCCTTCAGTCCAATCAGCTACGGCAAATGTCATCGACGTTTTTATCCGGAAACTGCTGTCCGGGCCTTTTGATTTCAGAATCCTCATGAATGGACGGGCAATGCTGCGAAGGGGGTTTCCTGCTGAGTGTCATTACGACAAGTCCCATGTCGACGCAAGCATAAGCACACAGAATATGAACCCGGCCTTCACAGAAATGCATTCCGTGGTTGTCATCACTGGTTTCTCATCTGCTTCTGCTTTCGCCACCATCATTTCCAGCTGTTGTGAAAAGGGATGAGGCTAACGACGTATGGAATTCTTCGTCTGTTTCTACTGTACCAACAACCCTGATTCCAATTTACAGCAAGGCTATGTGCGTGCTCTCGATACTCGTTCTGTAACTCAACAGAAGATGCTTTGTGCATACAGCCCCTCGTTTATTATTTATGTTTCCTCAGCCAGCCGCTGTGCTTTCAGTGGATTTCGATAACAGAAGGCCGGGGAATACCCCAGCCTCGCTTTGTAACGGAGTAGACGAAGGTGATTGCGCTACCCAGATATTATCGTGAGGATGCGTCGAGCCATTGCTCCCCAAATACAAAACCAATTTCAGCCAGTGCCTCGTCCATTTTCGATGAACTCCGACGCACGATCTCGTCAAACTCGCCATGTACTTTCATCCCCGCTCAATCACTACATAATGATGCAGGCCTTCACGGTTCATACGCGGAGGTCATAGTTGGCAAAGGATACCAGGCATTTTTCGCGTCACCACATGCTGTACTGCACCCTGGGCTGTAAGCTGGACTTTATGGCCTCGAATGAAGGAGCCGCTCCAATGGCTTCATGAAATCCCGGAGGTAAACGGGCATTTCAGTTCAAGGCCGTTGCCACGTCACTGCATAAACCATCACGGGGAGCAGGCGGTACGCATACTTTCGTCGCGATAGATGATCGGGGATCCATACTAACATTCACGGAAGTGAATTCAAACAGGGGTTCTGGCGTCGTTCTCGTACTGTTTTCCCCAGGCCAGTGCTTTAGCGTTAATTTCCGTAGCACTTAACATTCATTAAGCTCAATAAGGTGTCCAAACGATGCGTAAAGTTTCTTCATGATATGTCCATTCTTCCGCTACTGATTTCGGTATGGTCTGACGTTAGACTTTCTTGAATGGCCTTATTGACCTCATCTGAGCTTATGTCATTCACTAATCATGCGTGCTCGACATTGTTCTGACTGTATAATCGTCCACTCATCTGCATAATAATGTTTGATGCGTCTGGTTGCTTCATCTTCTGCTCGTGATGCTTGTTCAGCGTTAAAGGTTCCAAGTCGTTTAACTGGTTGCTGTTCTCTGGACGTCATGCCAACGAATGTCTCGTGAATGTTGGGGAAGTTAGGTAATAAGACCTTCTGGTTCCATGTTCTTGCCTCCATGTCGATCAGGGCAGAGGTTTCCTTGCAATGCTGCGTTCGTTAACCGTTATTACGTATCTTCCTCGTTCCGGCTGACGTTCGCATGTATGCAGTATTTTCGACAATGCGCTCGGCTTCATCCTCGTGTGATAGATACCATAAATCCGAAGGCCAGACGGGCACACTGAATCATGAGGGTTGACTTTGTGACATCCGTTTGTGATGCGACTGCCACGGCCCCGGTGATTTCTCTGCCTTCGCGAGTTTTGAATGGTTCGCGGGACGCGGTTCATCCGCATCCATTGGTAGAACGGCAGATCGGGATGATCAGATCCTTGCGGTAAATCCGGCATGTACAGGATTCATTGTCCTGCTCAAAGTCCATGCCATCAAACTGCTGGTTTTCATTGTACTGATGCGGGACCAGCCATCAATCCAGCCCACCCACAGCACGAACGATGCCATTCTGCTTATAAGGAAGGCGTAAATTCTTTCGTCTACGGATTAAGGCCGTGTGACCTGGTTGGCAACGAAGTGTCATGATGCGATGAGGCTGACTGCGCATCGCTGGCATCATTTAAATGCCGTCTGGCGAAGAGGTGATCAGTTCCTGTGGGTCGACAGAAATCCATGCCGACACGTTCAGCCAGCTTCCAGCCCAGCCAGCGTTGCGATGCAGTACTCATTCGTTTTATACCTCTGAAATCAATATCAACCTGGTGTAGCAATGGTTCAACCATGTACCCGGATGTTTGCCATGCGCGCACTCCTGAAACTCAACATCGTCATCAAACGCACGGTAATGGATTTTTGCTGGCCCCGTGTAGTTGCAAATAATCGATGCAGCGATTCCCAAACAGGTGGGCAGGCCTTCTTCTGAGTCGTCTGCCAGTTTCGGTGCACTTTCTGACGGGCGAGCTGCTGGTAGTGACGCCTCAAGAGCTCTATTCCTCACAGACGATCCTGACTTAGGATAAGGGGTTCAGCCATGAAACTCCGAGAATAGCTGTGGAAAATACAGCGAAATGCCGGGCTGATTGAGGAAAACAGGAAGGGGTTGGTGAATGCTTTTGCTTGATCTCAGTTTCATAGTATTAATATCCATTTTATAAGCGTCGACGCTTCACGAAACATCTTTTCATCGCCGACTCAAGTTGGCGATAGTGAATTTAGTCTGGATAGCCATAAAGTGTTTGATCCATTCTTCTAGACTCCTGGCTGATTAAGTAGTTGGGCGTAGATAAGGCGTTCTCATCCAGCGTCACGTAATTTGAACGGGTGATTCGTTCAAGTAAAGATTTCGGAAGGGCAGCCAGCAACAGGCCACCCTGCAATGGCATATTGCACTGGTGTGCTCCTTATTTATACATAACGAAAAGCCCCTCGAGTGAAAGCGTTATTGGTATGCGGTAACCGCACTCAGGCGGCCTTGATAGTCATATCATCTGAATCAAATATTCCTGATGTATCGATATCGGTAATTCTTATTCCTTCGCGTAGCCATCGCTGCATAAGTTCCTTCCTGACCATTTCCATCATTCCAGTCGAACTCACACAACACCATCCGGCATTTAAGTGCTTGAAATGCTAAGCAGAGCATGTTGCGCCAGCATCATTAATACAGCATTTAATGGATCAGCCGTGTTATTGAGTCGGTATTTCAGAGTCTGACCAGAAATTATTAATCGGTGAAGTTTTCCTCTGTCATTACGTCATGTCGATTTCAATTCTATTGATGCTTTCCAGTCGTAATCAATGATGTATTTGATGTTTGACATCTGTTCATATCCTCACAGATAAATGCCCTCACACTCGCAGAGGCAAAGAAGATTTCCAATAGATCAGAACAAGTCGGCTCCTGTTTAGTTACCCTAGCGACATTGCTCCGTGTATTCACTCGTTTAACCGATGAATCAAGAGTGCAGTGTTTATTCTGTTGATGCCAAAATAAGAAGGCTATCAGGCAGCTTTGTTGTTCTGTTTACCAACACAGTTCTCTGGCAATCATTGCCGTCGTTCGTATTGCCCATTTATCGACATATTTCCCATCTGTCCATTACAGGAAACATTTCTTCAGGCTTAACCATGCATTCCGATTGCAGCTTGCATCCATTGCATCGCTTGAATTGTCCCACCATTGATTTTATCAATAGTCGTAGTCATACGAAGTAGTCCTGGTATTGTTCCAAGCAGCCTAGCGAGGATGCTCTTCGAACTCCGGATCAAATGCCTTCTTCCATATCACCTTAAATAGTGGATTGCGTAGTAAAGATTGTGCCTGGTCTTTTAACCACATCAGGCCTCGTGGTTCTCGTGACCCCTACAGCGAACAGTTTAATATTTTATT
>82
TGGCGCGATCGTATACTGTTTAACCTGATGTATTGCTGTTTCTTTCCCGTTCGTCTCAGCAGTTCCATTACAATCAATGGTTACCAATTCATGGAAGGGCTTGCGTCAAATCGCGTCGTGCTGCCATTGCTGCTCTGCCGCTTCACGCAGTGCCTGAGTTAAATTTCGACTCACTTCGAACCTCTGTTACTGATAAGTTCCAGATCCTCCTGGCACTTGCTAAATCCGACAACCGCTACCCGCGTCTTCGTTCATCTATCGGATCGCCACACTCACAATAGAGCCTTAGAGTGAGGTGGACTAATAGTGAGTTCGGGAGCGAGGGCATTTCTTGGTCATGTGTCCGTATGGCCGTGATCTGACGTTCGTTTATTTACTACTTTCATGCTGAGACGTAAATACTTGTCTTCAGGTCTCATCTTTCGGGCAGAAGCCGAGGAAAAGGAAATAATGCGATATAGGAGCTGACTCAGGTGAATTTGCTTTTCACTGTTCGTCGTTTACTGCCTCACCACGTTTACGGTTAAAATGCCTAGACAGTAATGAGTCTATCCGTACGCTCCGTTGGGGTCGACCTCGACAGATTGGTCGTCCAATCGCTACGGCGAACGTATTTATGAGGTGTTTATCTTGCGAATCTGCTGTCGGCTTTCTCTTTCCTCGAATTCCATAGCCTGACCTGCGGCAGCCGGATCATGCACTCCCGTTTAGTGAAGGTGTGCTTCATACAGAGTCTAAGTGTCAAGCAGGCACACCGCCCAGAATATGGAAGGTAAGTCAAGAGAACAAATGCGAAGATTAGATTG
>83
CTCGTCTGCTTAATGCATGCGACGCCCTCCGAACTTAGAGGTGTAAAGCTGATAAAACAGCGGGGGTAAATAAAAACGTCGCCGTCTGCTATCCTTCTCCAGTCGATCCCAGTACTAATGCACGAGTTCAGTATGTTCTTCATCGCTTTATTATCAGGTTCCTAGGGTTTGGCTTGGTGCGCATAGCCCATGGAGCGTCGGAAGACGTTCTACGTTTATCCGCTCAATATTTGTTTAACGATCTAGGCTAAGGGTAGGGTTTAAGCCCGCCAACGGGTACGGACGTCCCGCTACATGTAATTAGCGGTAAAGCCATTTTCAATCCATCAACACAACAGGAGTGCAAAGTTGACCGACAAGCCACCTTACATTTCCCACGAAGACGGCGCTTGGACATTTTACCGCCACCGTAGTCAGGCCAAGCACAATGAGCCGCTGCTCGCATTGATGTCTTAATAGGTTGAATTAGCCGCATTGCTCTTTACTTTAACTCCCCTTTATTAGAATAACATTTGTAAGTACTATTAATTTCTACGACATGGCCTTTCATGCTGTCTCCAGTTTTAGATTATTTGTCTCACCGGCACTCTGACAAGTGCGACTCCCATGAGAACGCGGAGCCGTGATGAACTTGCAACCGGCTAAGCAAGGGCCATTTCGGTGGATATACTACTCTCATGTTTTGGTAGCTTACAGCACTCTATGTTCTCAAACGCGTTCCCAAGACAGTTAGCGGCCAGTACACTCGGAGCCATGGCCACGATAACCTAACTCTTCTAGAACAGCCAGTCCGATCACGAAGATTTTCCCCATGGTTAGGTGTTAACCGCCCCAGAAAGTCGCGCACCATGAGTTACAACGACGCTGGAGGGACAAAAGTCGGCCCGCACCATGGTTTAGCGACTAGCACTCTTTAGATGATAGGCCCTGGCCATAGCCTACTTAACACTCCACCAAGTATCGTACCGCATCGTTCCCGGCTGTACCCCATGTAATTCTAGCACGGCTGGCAGTCTCAGGCAATGGCACCTAAACAGGTTATCGAAATCATGCCACCTCCTCCGTTATTGCTTTACAGCGCTCTGTCATTTCGCTGCCACCGGCAGAGACACGAAACGGGTTCCGGCACCGCCACAGATGCCGCGCTAGGAATTGGCAGTATGCCCGATTATCAGTCAGTCGATACAACTATTAGAGTGTCACCAGGGTCAACACGACCGTGAGCCAGAAGTCGCATCCCGCATCCTATCTATCCGTAGATCCCACCCTCATTTTCTATGTTACGTCAGCACATTTTCTAGCGAGGGCGCTTTACTTATCGCAGTTCATCCGTCATCAATATTTCCTGGTGGCCCACCCGTCATCTTGTTCTTTCTTCGCGTCATGACAGCCACGTCCGTTGTTGTCCCAGCGAGCTAGAGACGGGCAGAATCAGTTCATGTTCTTTAGTACAGGGATTCCTCCAATACGAAAGGGTACGGAGTTGTACCAACACGAACTAGCACGATAGCCAGCAGGCACAGGCGGCCTAACGATCAACTGAATCATGGCTCAAAACCTCAACTTCACGCGATTTCGACGGGCGAGGAGCAGTTATTCGTCCCTTCGCTGTCGGTCGCATCCTGAATGCGACCGCATCCCAGCCAGTGTCGACCAAATGTCCTTATTATGCCGCAGCACCATGGTGTTGAGCTCTAAGGAAGTTCTTTGTACCGTTTGCCGTACTTTAGCGGCCCACATAAAATACAAGCTAATTATCAATCTAGATATAAGTCCCCCATGTTTCACCGCTGTCTCCGGCTAGAATTAGAGCCAAGACTATCGACGTCTATTAGCGTTGAAGTACGAACCTCCGATAGGGCCGGACACTTTCCATTAAGAGCCACATGATCCTAGCTAGTGGCGTCCTAATCAGTCATGGTCGGTTGATATCAATAGTCACTACGGTCTCCATTAGCCGGCCGTCACGGGTGATGCTTATGTTATTCTCCTCACTTAGGGCCGCTATCTAAGCCAACTGATGAAGGCTTCACGGTCTGACATGGTATTGCCTGCTAAGCAAATTAGATCGATATTCGATAGCATCGCGACTTGGTCACGCATGTTGCAGGCTAGATGGGCCTCCGACGGGCTAGGTACCCCGGGTTCTTAGGAATGTTCATCCGGCAGCAGACGCAGTAATCAGATTCACTTCATGCTTCGGCTGATCATATCCCGGCGTAAATTCCAGGTGAGTTAGCGCCGGCACGAACAGGGGATACATCAAGGGAAGCTCGGTGAAAAACGTTACAGCGCCATCTTTACCAGAGTTGTAGAAGTCCGCGATAGACTTTCTCGTGACTTAAGGCAGCTCGCATGGAAAAGAGACTAAGAAACAGCGGATCAACGACATATTAAATTTCCTCTAGCTAGTCGCCGCCAGCAGTTGGCGGTTGTCATGGACATAAAATCTAGGTCAAAGCGAGCGCAACATTTAGTGAGACATAGGTCAACGGTAAACTATTGTAGATCGACGTTCCTCTAAACGCGGTCCAGTTTTCGTCTCGTTGGCATAGCTCCCATAAGCACATCCTAACAGAACTGTCGACTGCCGAGACGTCATGTCGATCTGCCTGTTACCAGCCATACAGGGATCGAGCAGGTCACTGTATGTCAAGAATGAGACATGAAGCTTACACTAGCTGGGGACTTCGACGCATCATAGGGTCATTGCAGGGCGCTTTTAGCCAGCGTAGCCGCCGGCGGTCATCCCTCCTCCTAGGTGGGTTTCTTCGGTGATAGATAAACCGTCTTCGTCAAGCTGTAGTGTTTAGCAAATGGTTATCGCAGCCATGCTGTGCCGGGTATGCGCCTGCACCGACAATCCCTGCCCACCGCACCTGCGGCCGTGGCGCATTGCTTAGATGTCAGATATTGGTGGTCAGAATGCGGCTGAGCCGTTTCATACTACGGTCACCTCCTAGGGGTCCCTAGTGCCTGTTCTTCTAGTCCTTAGCCTCCTACAGTTGAGGATCCCCATAATGCGGTAATGTTTTCCCGCATGCTGTAATGTAGCGTCCACGTCGTCCCTGTAAGCACTCCGTTTCTCTAGCCGTCCTATAGCCTGGCGCCGTCGCTTAAGGTGATAGACGTCAGCCTGCGAAGCGAATCGAGCTAGAAACAGTTGTTGATCGAGTCTCTTTTATTGCTTCCTATAGTACGAGGCCCAGTCGTTAAGCGATTAAGTACGAACGGTACGATTAGCCGTGGTGCTCTAGCTATAACAAGTTCAGCCAGTCCCGGCAGCCAAGCTCCTGACGCTGTGTACATCCAATACGGTGGCCACGCTAATCGGGTAGGCCTCGTATTACACACTTTGACAGACATGGCTATTAGGTTGATACGAGCTCCTGCAAATTACTAGTGTCATCGAGACTGGACGGTAAGAAGTTGAGCCTTACTCCGTGACAGTACATCCCTATTACGTCCTTAGGCCTACGTCGTCCTTTTGGCTAAACAGTCGTCGGGTGTGGGTCAGCCATGATACCGATGAGGCCTGTTTTACAATCAGAGTCTGCGTACACAGCGGGGATCGCGGGTGGCAGCAATAGTAATGAGTCGGCCTGTTGGTTGAACCAGCGCCATACATTTGGTCT
>84
GCGGGAGCCTGTCGCTCGTACTCGACCTGGCAAGGCTCGTAAATTCATCAACTGTTGGCCGCTGCTTGTTGTAATGCCGAGCGTTGTAAACGAAATAACGTTTGCGATGTTAGTCAGGTAAAGGTGGTCCCATTATGTACTGTTAAGAAGTAATGGAAGTTCACTCAATTGTTAGTTACAGCCCGCATCCTTGCAAGGGAACGAGGAACGGTTTAGTTCCTGTTGGCTTAGTTCGTCAAAGTGCTTTTCTTCAGTTTCTCACGTTGCCATGAAGCCATTTGATCTATCTTTGAATAATTCCAATTACCTGAAGTGGTCTAATGGCAAGTGCTTTATCCAGGCCTTAGTTCCTTTCTAGCCTATATCCAAATGAAGCCAGGCAGGGGTTGGGAATGTTACAACGTCAGCTCCTGAACGGATCCTGTCTGACGTGATCCAAATGTTATTAAAACCCGTGGATGAAGTCTAGTCAAACTTTAAACCGTTAGTTTGCAGGTTGGCTGTATAGTCAACTAACTGTCGAACTATTTAGAGCCAGTTTAGACGTGCGTGCCCGGAATGCTTTATTACTGCTCAACCCAACCTGTCGGTAACTTCAATTGAAGATTATTCTCCGTGCCATAGAACCAAATTGAATCAAAGATCCATTGACGCTTTATTTGTATGCAGTTACGCAGTTATACATTGCTAAGTCTAAGGCAGTGGATAATTCGTACGTATTTAGATGGCAGGCATACGTCCGTTAATTAAAGCACTCGTACGATTAACTAAGGTAAAGTTGGTTTGCGACGTACTATTCAACGGTCTATTTCAGTCGCCTCGTGATTCGACTGCCTGGCTCGAGCGTCTAGACGGTCAATCACGTTGGATGTACGAATTTAGAGACCGTAGCGTACGTCCGGTCCTGTCTACAATCTATCTAGGTAAATTACCAGCAAATGTACGTGCGTTGGAAATCGTCAAAATTCAGCAGCCATTTACATCGACTTAGAATTTACATCTGCGAGCTGTCAAATCGTCAGGTTTATCCACTCATTTGATAGTGCTTAATCCATATGTCAAAGCACTGTAACTGTCATCTAAGTCGAATTACCGGTAAACTATAGTAAATTAGTACAGGAAGTGCTTATGTACTTCAGGTCTAAATTGGCTGTGGCCTTGGGACCTTAGATAGGTTTAACATAGGGATAGAAAGCGCGTCGTGAATTCCGAGCTGGCGACCGATTCCAGCCATTACATATTTGCATTTGAAATTGAGTTGCCGACGTTGGCGACCGAATTTACCGCAGCGACTGCTGTCCCGCTTAGTTGAGGACATTACAACGTCCTGCGTGCACGCTGCCACTGTTGCATGGGACTAGGAATCTGCAAGTCACGGATTTGTACGGCCAACACCTCATAAAATATTCGTTCATTCCGATAATCTGATTCTATGGTTGCTCCTTCACAATGCCTCGTGCACTTCAGGATAACTAGCTTCCAAGCATTGGGGAAGTAGATTCAAATCTATAATAGTTTCAGATTTGCTTCTAAATCTGACGTGCTGAAACGTTGCGTGACGATAGTTTCCGTAATTTACGAAATTTCTTTGAGCATCATGCCTCAACTCCTTCCCTCCAACGATAGCACATTGTATCACCCGAACGTACCTTGAAGCTCTGGCTATGTGTCTTCCTGCCTCCAGTTTGCCAGGCATGCCGCACGAAGCAGTTGGCCGGAACGAACTTGCAGCCGATGCTCACGAAATTAGTTGAGCATGAATCGCTTGTAGCCATCTGCGAAAATGACGGTTACCCATTGAATGCACGATGGAACCCGTACATAGGCATACGAAAATTCAGAATGTGCATGAATAACTGTCTGTCCTATATCATACAAAGGACATTTTCATGAAACGATTACGTAATGTTTAGCGGGTTGTTTACCGCGACTTATTCGACTTTTCTAATTAATTTAAGTACGAGCCGGTGGCGGGTGTTAATTAATAACGGTTCCATCTCATATTCTATTGTTGGCAAAATGGGAAGTAGATGAAATTATTTCTAACATTACCCTGTGCAGAGTCTCTGAGCATTTCAGGGTCTACCGGGTAATTCGCTTGACGTCTCGTCATCTATTTCTATCGGTTGAGCGTTTATCGTCTGAAATCTACATCTAATTTGCGATTTCAGAGACAGCAGTGACGCTCATAATCCGATTAACGGTTGCTCGACGCCGGATCAACGGATCCCAAATAATCC
>85
GATTAATTGATGAAGCGGGCTCGTCTGGCTGATCCAAAGGCCCGTCTTGCTTGAAGCCCCGACGAAGCTGAGCAGCACTCAATAACAAATGCGCAGCATGATACCGAAGGTCACGGAAGTACGAATATAGTCCGACATGAGGACTACGTCGCAAGAACTCAGCCTGAATTAATGCCGATAGTACACCACGGAAAATGAAAGCACGAATCTGAATAGACCAACGAGTGAAGTCTAATCGAACTTTAAATGAAGTCCGTGAATAGCGAAGGTTACTGCTTGCCTGCGTCCACGCTCCTTCCCATTCCGCAACCGCTTAAATGAGAAAATCAGCCAGCATGTCCCGACAAGCGTGAAGCGTTACCGTACTGAGGAAGCGGAATGTCTCAGCACCAATCCTGCTTAATAAAGGGACTGAGTACAACTCATGATGCACTTAGACATGTACGTATCAGAGCGCTCCCAACCCTAAGCAGGCGGATAAATTCGCACTAAGGCAACGGGCAAAACGGCCGCTTGATTAGACAGCCGTATGAATGGAAGCGCAGCTGAAGCCACCTGAAAGCCTTAAAGTTAAATAGTAACGGTCGTCGACGCACTATGAGAGCAAGGAAGACCTGGATCGGCTGAATATTCCTTCCTCAGGGACATGTTAGAAAGCTTGCATACACAACGTTATCTTGCACCAAAGCAGCCAATTAATAGGCTTACATCGCACAGATTATGACCGTTTAAGGTCTATGTTAATACGCTTAAGCAGGCATGACCGATTGCTAAGGATTAATGAGGTAATTGAGATGAGTGGTTTATCCGGCGCATCCCGTCAGGCGGTACAGTATTCAGGCCGCCTCGTGAATCCATTAAGCGAGATAAGCGACTGAAGCCCTAACAGAATGTTCACCTTGGATTGTTAGCAGGAGGACCTACAATCCGTGGGAATCTTTACCTATCGCAGGGCTGGTCAAGGGCTTCCTTCCTCGCTTCCGACGATAGGCTGAAGACATACGGTCCCTACGTCACGACTTTTAACGAACATTATCACCATGGGCCTCCTTGGACCGTATGAAGGCATTATCGCATGGAAGTTGATGAAGTGCCACAGATCGGTATCTTGCTGTTCCCGGTACTAACCGAATAGCGCGACTGAATCCGGTATGGATGTACTTCGTCCTTAGAAGGTGCTTTATCTATTCTCACAGCTGCATGATGAATGCCAACTTGAAACGTACAGCGTGACGCTTTCTTTAGCGTGAGGCATGATGAGTCGTTTGGCGACAGCACGGCTGGAAATCCTTTCTGTGACTACCGCCTTGAGTGGCGGCATAAATGTAGATTCCTTCCAGGAGGAGGAGGTTTCATGTTCTAAGTTGAACAGGTGACAACGTGCACGTATCCGGCAGGAAACACTGAATGAATCCACCGTTGAGCAGTCGAGCGTGTATGAGCGGGAATCACTGACAGATATGCGAGACGTCTTTTTATACGACCAAAGGTGAGCCGGTCGGCAGGGCGACAGTATCAGCCCTATCCATTCAGCGAGCTTTGGAAGGCAGTACGCGAGAAGGAAACTGTACGTATTCTAATGAGACCAGTGACCATCGTATTTAAATAGTCGCAGTTTGGTCTAATGAACCTGTCGTCACCATCAGTTAGCGTACAAGGGGACTGGTAACTAAATACGACGGATTGAGCAGGGTCCATCAGCCTTCCTCCTTCCGTGCTCGTGTACTGTCCACCGACGAATGATCAGGTAGTTTTCCAACTCATCCACAGCCCTGCTACTCCATCTACGGTGGGAGGAGGGATGTCAGGCTGACAGTAATATTTAACCATCACGAAGGATAATGCAGCAAATGCCTGAGCTTTACAGTTCTAAATAACTTTAAATTTGGCGGACTTCCTTTCTAATAAATTTCTAAGTAATCCATGACAAGACAGATCGATTCTCACGCCGGCTGTGCCATTGGTCGGGCTTCGTGACCTATAGAAAGTTTCTATCCGTTCGATGGCTTATCTATAGGAAGGGGAAGAAGCTCGCATACTCCTTTCTTCCTTCCCGGTGCGCTTGAGATCTAATGTCGCATAGCAGAGCCGTGGTCTTAATAGTGAATCAGCCTCATGAGCAGCTTGGATGGCGACTTAAATTGTAGTTACTGTTCTTACATGAGCTAGTTTAGATTTATACTGTTGATTTTCTATTGACTCTTAATAAACGATTCTATTGTAATGTCGTTTACGTGAGTCCGTTTACCGTCGATTATTAGGAGCGCCGGCGAGGCGATCGTATCAGCTGAATTGATCGAGCCGTAAGTTTTAATGACCTATTAATCGTTTCTGACTTAACGAGACTTTCATTCCTTTTTCCTTGTTTGTTCATCGTTTACGGTACTAAATCATTTATGCAGCAGGCGATGCTTGAACGGGTCGACTGAGCCCTACCCACAGCCCTATCGCTACAACTAGCCGTGACGGTCGATAGGATGTAATTTGGAAGCGAGAAGAGCACTGGTCGTGAAATACAGCGACCGCCTTAGATGAGTAATCAGCGTTTTCATCGTCCAAACAGACGTATCGATAGGGTGCTGCATAGCCGTCACCGCTTCTAATGCTTAGCCATGTCGCAGCATGGTGGGCTATCATTTAGACTGTTTAGATGACTCACCGGTCGCTCAGTATGTCGATTGTCTAAGTGCCTTTAGTACTTCTTCCTCTAACACCGTACGGGCAGCAGACAGTCATGCGTGATCGTAACAATGGAGCCGAGAAGTATGCCTTAATCTAGAATGCTGGCGCTCCATCGATTAAACTAATACGAATAGACGTTGACTATGATAACTTGTGAAGCCAGGGTGTTTAGGTTGTCCGGTCGAATGTGGGATTAAAGTTAATAGATGCTTTGAAGGAGATTAGCACCGACTAAGGCCTTATTTACGTGATGCTCATGTGAAAATGTCCATCACTTGAAGTTGTCCGTTATCAATTAGGATGACAGAAGGCCGTAGGAAGGCATTCCTCTCTCCATTTATGGGTGATCGATACTCGAGCTAGATTGAATCCTTGATGACGGGCCGTTAGACGCGTGGGGATACGACCGTAGTTGAAGAAGGTGAACCGGAACCGACTAAAGGATTGAATCTATGGAGCTTACGCGGTACATACTAATTAGAAGTCAAATCATATGGAAGAGAAGGAGGAAATATGCATCAGCCTATCACGCGTACGTCTAGTTAATGGTCAAACACTGATACCGAGCTACTAAATCTATCGGCATATCTAGCGGTATGTAATAGGATGCTTGGACCGAGCTACCGTAAGGATTCCGCCTCCTTGCGCCCGCTTAAGACAAAACTATGCGGCCTATAGATATTATGAAGCTGAGTGAAACAGTGCTCAGGAAGTGCATGGGTCGCAGGACCGGTTCGGCAGCCAGCAGGTGAGCCGTAATTATCATCGTAGCGTATTTGTCTGCACTTACGTCCAAGCTCAAGACGGGCATACATAGATGACGACGAACTTTTAAACCGGCATACAGCACAACATGGCTGTGTAGGATATTGATACCCATCCAGCATGGGGAAACGTCTGCTGTGAGCGGTACCAAATTATGTTGATACTAGTGATGCGACGCTTCCGTAAGGTCCACAGCTTGTAAGGTACGGCTCGAGAGATCTCTGGCCCTATCGATTGGGGTTGCTCAGCGTTGACTAATTAGACCTGTGGTGCAGACTTGAAGGCGAGACGTAACGTCGTTAAACGTCGCTCATATTGTCACCCGCTTAATGTATTACGCTCTTAAGGTCAGCTTTGCTATGACAGACCCATAATCCGTTGAACATGGATTACCAACAACGAGCGACATGTGTCGGAAATACGTTGACCATTAAGGTTGCGCATGATTAGTTGGCCGTACCTAACAAGGAGCCTATTCCTTCCGTAGGTCTATTAAACAGAAATGGAAACTAAGACCGTCAATTTCAGCGTCACAGAAGCGCTTCATGTAAGCGGGTTATTGAAAATTATTAACCTCATATTAATGTAGGTCGTGTGCTGGCGGTGTGAACAGCCACTCCGGACTAACCTGGAAGGAAGGAATAGCCATCCCTATACTAATACTGGTGACGGAAGTGGCAATCCGGTCAGGTCCGTTAGTCAGCTGTCACGACGGTGAATAAAGTGAAGCTTCCTGACGTGTCTATGATGAATACAGCGTGGGAGCTCGCACTTCCCTTCCACCCCAGACTGTTCCTGCAGTATCCGTACGAACGACGGCACGTATGCCATCACCCTTTAAGATCACGCTAAAGAGGCCATCGTGATAACGGCTAAGTTGACCGACGTGAAGTTTACGAGAAGGGCCGCCTCATTAAGCAGCTGACCGACAGGATCGTAAGACATGGGGAATATCAGCTTATGGATGAGACATGAAAGTGAAGCGTGAGTTTCCGACCGATTTAACATGTAACGACGGCAGTGAGCTGGTTACTACGATGAACTACGAAGCCTATAAGCTTTCACGACTAGGCAGCCGGGTAAATTACATTCCTTCCGGTATTCCGTCTAAGCAGGCGAGACTTATCGTTCTAATTGCTCACCGGCAGCACCGTCCAGGATTGAGCTGACGCCGGCTATTTCATAAAGCCACGCATCTTGCCGTTATACGACGTAAGTTGAGTTGGTTCTTAGAAAGCAGATTAGATATCATAAGTCAGACCAGCACCGTTATCTTAGACTATGTACTGAGCCGGTATCTAAGTAAATTATTATTTTATATCTAAGTGGTAACAGGTCCAATTAGCATTCGTGAGGCTTTCCTTCGGAAGGAAGGAATGGGTTTCTAATAGAGTCCCGTAGAAATATGAGGACGATAACCCATACACTATGAGTTTTCGACAGTGAAGGATCAGTAAGTGAATGCCATGTAGTTAGATTAGCAGAAGACCCGGGCAAATAGTGCTAGATAGCTCAGCATGAGACACGAGGAAGGCAACTGAGTTTTGGTTGCCCCAATCGTATCGCATTTATTGACCTAAACGGGAAGGAAAGCCGATGGCTAGCAGGACCGATATTCATGAACGACGTCTAGGCTCCTGGATCTCAGGACCGTGGACCTTTGCTCACCATATTCCTATCTTCCGCTCCTTGAATTACGTGAAGTACGGGTAAATGTATAGGCAGTAACTTGTAAACTCGTGACTAGTAAGGGACGATCGTCACCAAATTACGATAAAGGGCTTTTAAAGTAAGGCGTCAGGCGTGACGAGAGTCTCCGTACGAATGACCTTTGACCTAAGTATTATTTACGGTGGTTCTAAAGGAGTACGCTTCGTAACTCACAGATAGTTAGTCTCCGACCTCGTCAAAGTATTTATGATAAACACGGCCATGGAGGGCTGAAAGTCACTGTTTAACGGGTCTTCCGTAGACGTGGAGTGGTTAGTTCTCCGTACGTCCGCCTAGTAGAACGTCACCGGACTTCACGTACGTCCACACGATGTCAAGTCCGAGACCATCAGTATTAATGTTACCACAACAGTGGTCTAGCATCATGCGTTGGTCTATACAGTACCGGCAGGACGTAGTATAGATCAGTATAGAACTTGTATTGCTTTATGCTGTCTTTGCCCGCTGTGATTGGACAGTCCGACGTAACCGTACGTTACTTAGTGTCATGGATAAATGGTGCTTCCTTCCTGAGGATGACTAGATTACGTGAAATACCATATAGGATTATAGTTAGTCACGTTATAAACATAGGTGTGGGTGATGGCTTCTTAGATGGAAGGAAGCAGCACAGTGATGACATGAGGATACGTTGGGCCTATGCGTGACGTTATGTGACGAACTTACCAACGTTGAGCAGTTGGACCTATTAGGTTAGTATAGACCACAATGGATTACTGTTAACGAATCACTCCGGTTACCGTACGAAATGACCAACCAAGCCTTACGACACGCACTGCGTCGAGCTTAGTCTATTAATATACAGATTAATCCGTCCTTCTTTCTTCCTTGAAGCTGGATAGTGACGGCGAGAAACTATCGTTGGCTGTAATTAGTATTAGCCAGTACAGTGTTATGACAGCCGCTTGAATTGGCTTTGGGGTAAATATGAATGATTTCAGGAATTAACAGGAACTTAGATAAATGCACCATTCAGCCAACCGACCAACATCACGTGACACGTGGCTCAGAATCCATGAAGCTGCCGTTACATCATGTACGATTAGATTCTAAGTTACCGTACTTATCTGCACTTACGTTTAAGCGTGAGGAAGAGATCCAACAAAGCGACGCTGATTTCCTGCCGCTTACTAGGATGATGCCGATGAAGGTATCCGTTGCGTCTATGATGACGTAACGATGGCGACAAATAGCGTAACGCGTCTGGCTTTAATACTACGACGGACAAATCAGCCGGCCGTTGCAGGTTGAGGTATCGGTACGCTGCACGTACTTAAACTGGCCCCACAGTCACCACGGACAGGCTGCATCGTCTATGAAGCTTTAACGACCGACTGCAACGAGATTGAAGCTAAATCAGCCGAGCAGAGCAAATCCTATTGCCGGCTGGGTAAAGAAACGAAGTGCATTAGATCCTCCTTCCTAACAGCGTGCTCACGAAGCCAGGGCTGGTTGCTAAGGTTTAGGGTGCTGTAAAGAGGCATAAATCAGAAACCAACGCATCGATAGGTCTAATTATTCCAGGTCGGCAAACGAAGCGGGTTAGGCACTCGTCAGACGAATGCCGAAGGAGGAAGCTACATCTCTAGGCATACGGCAATAGGGGAGTCCGTCACGGCATCCAACGAAGGCGACATAGCGGGAAGTCGGCGTATACATCGCATAAAGTGCGATAAAGCGGCATACGTCTAAATTCTAAAACGTCCACAGACATTCCTTCCAATTAGATGAAGGGGATAGTGCAGCTCATAAGTCTAACCAACAGCACTTTAAACGCTTGCTGCATCAAAGGCTATTTAGATGTAAACTAAACAGGAAAGCCATTTAGACTTACTAATGAAGCCAATAATAAAGCTAGGAACAACAATAGCCAATTAGACACCGTTGTACTGGCCCGATTAATGTTGACGGTATGAACGCAATGAATACGTATGAAGGAAGGGCAGCTTAGAATGATGGTCCAGATTTTATAGACTAAATGTCCGGTAACAACCCGAAGAATTGAATAAATGAGGGCTTTCTAACCTAAATAATTTCTCCAGCCGAGACCGTACACGACCATGCTCATCATGTAAGGATATTCTCCAACTAGTCAAGTTTTCCAAGACTGTTAGTCGATTTGGTAATTAC
>86
AAAAAGAGGAGCTTGATGACACGATGAACTGCCGGTCAGGACATCCCCTCAGCCGGGAAAATGTTGAAACTGAACGGATGAAAATGAGGTGGGATCAGCGCAGCCGGATACCGTGATTCTGGATACGTCTGAACTGGTCACGGTCGTGGCACTGGTGAAGCTGCATACTGATGCATTCACGCCACCGGGATGAACCTGTGGCATTGTGCATGCAGCGGACGCGTTCGTGCAATGTACGGTGCAACGCAACCCAGCCCGCGCGTGCCTGACGCAGGCAACTCTACGGGGAGCGGTGCTGATTTTCTTCGATAACCTGTTCGATGCTGCCATTGCCCGCCGATGAAACGATACCTAGGTACATGGGAACTGGTCAGCCAGCATGCTATCCGGTGAGCAGTCAGGTGCGGTGACGTGGTGTTTTGATGACCCTGAAAATACAGCTATGCCGGACAGGCGTGCGCGTTGAAGGCTCCAGCCCGTCCTGTTTTGTCCGGACTGATGAGGTGCGGCAGCTTGCGGCGTGGAGACACGGACCATCCTTAGGAGGAAAATTCTGCTCGGTAATGTTTCGCCGGCTGATGGCGGAAGTTGTCATCTCTGGCTTGGACGGGGCGTACTCCCTGCCGTTAACCCGTCGCCTGAAAGGCGTATGAGGCCATAAAGGTCTTGAGCAGCCGTTGAAATGCCCCAGCCATTAAGCAAACGGGGTGCCTGGTGCGCGCAACCTACATTAAACCGCGTTGCTTCATCCGCGATATCGCAGTCGGCGTCAGGTTGCCCGTGAGACAAAGCGAAGCCCTGAGCGAACTCGAGAAGGAAGCGGAGAGGAGAGGACCGAATCGAGAATCCGCAGTCAGAATCAAATTAACCGGGGGATTTGCCCGTAATCAGCTGGGTAATGCGCCGTGTCCTTTCCTCGCGCCGCAGGCAGTGCTTAAAGGGGCAGCGTTCATCCTGACTGACCACTGAAGACGTAGAGGCATCTTTAGTGTGGTGTAACCCGTTATCTTCGCGGGGCTCATCTTTCGTTGAGCAGCCAAAGACTGGCCATGCTACAGGTCTATCGCATTGGTAGTACAGGGAATATCCGTTACCCCATTTACACTTATGTAGAACTAATCCCGATGGCGGTGCCGCTGACTAAGCGTTTAAACAAATACTTGAGCGTAAGACCGTGAACGTCTGTCGAAGAGCTGGCTATGCTGCAGCATCAACGGCCGGTAATAAAGCGATGAAACATACTGAACTCCGTGCAGCCGTACTGGATGCACTGAGAAGCATGACACCGGGGCGAACGTTTTTGATCCTCCGCGTGGTTTTTGATGGAGGCGACTTTTCCGGCAGTTGCCGTTCATCTCACCGGCGCTGAATACGGGTGAAGCGAGCTGGACAGCGATACCTGGCAGGCGGGAGCTGCATATCATCGAAGTTTCCTCCGTAGCGTAGCCAGGTGCTAAGATTCGCAGAGCTGGATGCGTCGATGGAGTCTAGGATTTATCCGGTATGAGCGATATCCCTACTGTCGGCTACGTTTGATCACCAGTATCTGGTTAGAGCGACTACCGGCGCGACGGCTTACTGCGGGCTGTGGTGGAGTTCAGCCGATCTGACTTATGTCATGCTATGAAATGTCGACGCTATGCCTGTACCAAATCCTACAATGCCGTGAAAGGTGCCGGGACCAGCGGTGGTCAAGTCTAAGGGAGAGCGGCCGGGCACGAAGCGGTTCAGACGTTTAACCG
>87
AGGATAGCGTCTTACTTGGGTATTTAACCTAGCAGTTAAGTCCGGTACGGTGTTTACATAACCCTGAAAATGAGCTATGCCGACAGGGCGTGCGCGTTGAAGGCTCCAGCCGTCCCTGTTGTCCGGACTGATGAGGCTGCGGCAGCTTGCGGGATCCGCTGAAGCCTGAGGAAAATAATTTCTGGGTAATCGGGTTCGCCGATGATGGCGGAAGTTGATGGCTCTGGCTTGACGGGGCGTACCGCCTGCCGTTGGACCGTCGCCGGCTGAAGGGATGGCCATAAAGTCTTATCACGATAAATTCCATCAGGCCACGGTTAAAACCGACTCCGGCTGCTCATTAGGGACTATTAACCGCGTTGCCTTCGTCGCGACTCCCGAATTCGGCGTCACATATTCGCCGTGAGACAAAGGTGACGCCGAACTGATCAGGAAGACGCTAGCACGTCGACCCAGCACGGCCGAATCGACAAGTTCAACCGGGGATTTGCCGTAATCAAGGCTGGGTAAGGTGCGCGGGTCCTTTCGCAGGCGTCGTAAAGGGGCCGTTCATCCTGAAAATAGCGGCAGCGTGCTTATGATTTCTTATTCCGTTTATTCAGCAACATGAAAATGGCCGGTGGCATGTCATGCAGCGTGGCTGAGAAAACCGTTGATAGCTAGAAGTCTCTTAGATTAGCCGAACGAGTGAACAAAAGGATTTGAGGACCTTATGAACGATGCGTCGAAAGAGCTGGCTATGCGCTGCATTAATGACTGAGAAGTAATAAAGCGATTGAAACATACTGGACTCCCCGTGCCTCGATTCAACGCTGCATATGAAGACATCGAGGATAGACGGGACGGTTTTGGTCGCCCCGTATTTTGATGAGAGGCTTTTCCGGCAGTTGCCGTTATCTCACGGCTGAATACACGTGAAGAGCTGAACCATGAGGCCGATACGCATATCGAAGTTTCCTGCCGCTCAGGTGCCGATTGCTACAGCCATTGCGTTGATGAGTCTAATTTATTGAGGATGAGCGATACGCGGCACTGTCAGATTGATCACCGATGGTGGCCAGCGGCTATAACTACCGAGCGACGACAAGGATTGCGGGCTTGTGGGGTTGCTCACGATTGACTTATGTCAGTACTATGAAATTGAGACGACGCTATGCTGTACCAAATCCTACAATTGCCGTCCAAAGGTGCCGGGACCACGTGGGGTTTACAGGAGCTATCTCTTACGCGATCGCTTTACGGACCGATTCTCTCCTTGCGTCTCCCAAAGTTAAAACATACCGAAATGCGATCTAAAACGATCCGCTGAGCTAATGACGAATGATGGGATGCAGACTGAATGAAGCCGGGCAGGGCAGAAGTGCCGGAGATATCCAGCTTGCCGCTGGCGTGGATGCCCGGGATGAGGGAAGCAGGCTGCTGGCGTCGTTTAATGAAGGCGATATCCGCGTGCTATAAATCGGATTCCCGAACGGACGTTTAATGTTCCGTACGATTAAGTAAGTGGCGATCCGTAGAAACCGAAGGAAGTAATCGCCGGAAGCTAAATCACCAATGTGAGACGTCCGTCGATGGCACAGATCGCAGCACGGTAACAAGCAACCGGCATTAACCGTGACGCCTGCCAGATGGCTATAAAGTGACCGACAGCTGAAGGCCCTGCTGCTTCCATGAGGGCAGTGGACAAGAGCTTTCGTGCGTGTTAAACGCTCGGCTAGATTCCTGTTCGCTTGAGTGACTCATCACCGTGAACGACGGCGTTGCGTTGCAGGCAGTAAAGCAGTTCCCGGTTGTATCCGGTAATACATGAGTTTCTTCCGTTGTTGTGTACGCAAGAAATTACCGTCACCGCCAGTAATTGGAGAGTCGACAGAGTGTTTCCTGAAGCCGAATGCATTTGAATAAACGTGACCGTCACGCTTTCTGAACTTTGATATGCCCTGCATAGGGATATGAGCATCTCGCTCATCCATGAAGCAGTACATGAAGAGTGTAGAAAGGACCGGAAGTTTACTGTGGGAAGACGCCATCAGAACCGGCGACGCGTTCTGTAGGGATTCCCTTGGCGGACCAATACAGGCGCAGACGCATATTGCCGTCCATGAATCTGAAGCCGTTAAAGATTGAGCAGGAAATTAGTACGCCTGAAGCGATTTCTCATGCTGAAAGCTGTGAATGTCTGTATGAGTCTCGGCCACTGCTCCGCATAGATCGACGCCAGCGGGCCGCAGCCTGTTCTTAGAAGGTTTCGACGTGAGACGGTTTGCCCTGAAGCTGGATGCGGATGGGCGACCCAAAGCGTGCCGGTGCTTGCCGGATGTCATCCACGATATGCCATGAACCGATTTTACTAAGTACCCATTATTTTCATGAGTGTTGCCTCATCGCACTTTGCAGGGTGGACTAGATTTAGCAGCCTAGTTTTGCCGGTCAAGGATATGCATCCATGGATTTCAGTCTTAGACGGATGAAGCGCGAGTGATCGACGAAGCCGCTATGAAGATGATGTGCTGATGCAGAAGCGGCAGGGCTTGCCGGAGGTGTCCATTTGATGGAACGAAGTGAAGTTGCTCGCCATTCCCCGGATGTGGCGACATGACGGAGGATGACGTAGTTAATGGCTGAGACGAATAGAGAATTAGATCTCAATAAGGTCTTAAAGGCGATCTGGTCGTTGATTTGAGTCGCTTAAGCCGACGTCATAGAGAGCGACTCAGTTGGGGCGTGCTTTTCTTATCGAAAGTGATGCGAAAATAGAGGCAGTCGTTGAACAGTCGCTGAGCCGACAGGCATGAACAGAAGGGATTTCCGTCCTGCGATAACGCCTGCCAATCTGCTTGTATGCTGCACGTTGCCGACGTGGCCACGCAGCTTGCAGGCGGGCAAAGTCGCTTGGCTGATCTGCTGCAACAGGGGCATGAACCGAATAGATTCCCGGCGAGCGTACTCGAGTGTTTCAGAGGCTTGCCGGTGCGATCAGCGCATGCATCTTAGCGGCGCCTGAGGGTGGCGACCGGTGCGCTGGGGTATGCCTGGTATCAAGGGCAACGCCATCTAATTCCGCTTTCAACAAAACCCTGGTCCTTTCCGGCATCCAGGCCAACTGACGGCAGATCAGTGCTGGTCGTGCCGGGCAGGCAGCGGCTGACGTTTAACTGAGACCAGCGAGTCACTCAGCGTCGCACTGGTTAGGGCTCGGCTGCGGGGCCGTTCCCGTCCATCAGCCAGAGTGGCTTTCCTGCATCCCGGCGTGAGTGACAAGGTCGCTGAAGCTTCGGGAAGCTGACCACATACCCGACGTCGGGGTGAGTGACAGGCGAGCTCACAGTTCCATAACGACGTGTCGGCGAGCCAGATTGCGTATGTTAGCCATTCCAGCCGTTTGCAGCGATGGACTCGGGGTGCAGGCGGCAACGCACCGCATGGAGTAGGATTTTCATTAACCGATAGCACGCAAAATTGAAGGGAGAGGCCGGGCATACTGAAGGCCGGATGAAGAACAGTCCGGTACGCTGTATTAGATTGGAAGTTGAAATCTTGCGTTAGGTAGCACATTGGAAAATCCTATTGTAAGCGCGAGGGCTTAAGTCAGGAGCAGACATGGAATGCCCCATATTAGCTTGCTGTTTTCTGGCTTCGTATCGATAGCATAATCAACGATTTATGAGATCTTAGCACTCCACGTCTTTAATTGAGTAGGCCAGCAAACGACATCAGACCTGGCTATGGTCACCGGCTAAGGCTAAATTACCGAGCGTCTCATCCAAACCATCGCCGACGAATAGAATTACTAATCACTTCACGACAACTGGCCGACTCACCGTCAGCATCAACCGGCGACCCTATGAATAGTTGCATGAAATTTAAGAAATAACGACGTATGCACAACGAGCTAGAAGTTGACCGGCCTCATGATAGACAGAAACGTCGAACAATTACAAACTTGTGAATGGAACCTTCAAATCCTCATTAACGTGACACGTGATCACTTAGCTACGTTGAAAACCTAGGCCAAGGCAATTAGGACCTATGTAGAAGCTATTAAAACAGGCTACTAGCGTTACTCGATAGAACAAATTGCTGTTTACGCTTCTCTTATGAAGCCAGCCTAATTCAACAGCTAAACTTTCGTACGCCTCCGGATCTACTTCTTAACTGCCGCCTCACAAGTGAGACATCTAAGTGGCCTAACCTATCGTGAGGTTAGCAATAGTCGCCTGTACCAAAGCCCTCTATGGGCATCAGCAACAGATGAATGCTTGGTACCACAAACCGCCATGAGGTATGCATAGACAAGGTTGATCCATCATTATTAGCCACTAACGCGAGCCATGGGAGGCCGCATAGGATTAGCACAGCCACTAATGAGCAACCTTATCTAAACTGTACTATCATTACTGCTATAAACTCATTCTATTACTTTACGGACGCCATAAACTCTGTAAAACCAACCAAATACTGTCCTCGCTGAATGACAGTACGACTACTGAGCGTTGAATACGAGTGATACTATCAAGAAGACTATCTTTTATTCTAAATACTTGCCAGCCGGCGACTGTATTTGATATTAGTTGACACCATGGGAGCCAGGTTAGTGATGAAGCGAGCTATTGCCAAACGACTTTATAGCAGAAGTTTCGGTTCCATTTCTCATCTGGTCTCTCCAGGCTTTCTTATTGCTCATAACGGGCATTATTGAACTGTCGATGAAGCCGATGCCATGTTGCTGGCTCATCACGTCGACAGAATTACGGGGTTTAATCAATTAAGCGTGTCCCTGTCCAACTTAGGATTGACTAGCGACCCTGGAGCAGGTATGGGGCGCGATTGTTTAACATATTGCCGATGTTGTGTTAACGCCATTTGCAACGAATGAGTAAAGTGCACGTCAGAACTTTATAACCAGGTCATGATAGCGGGGTATATTGCTACATCACGTTGGTAACGTTACCTTATAAGGTGAAGCGAGCGGCTAGCAGCGGCTATGGCACTCATTCTAGGTCTAGTTTAGATCCTAACGTTTGATCACCTAAATACATATTATTCTCTACTCCACCGCCTCGCTCCACATCTGGATACCATGGTAAGTCCATTAAACAATTGACGCCACGTGACGGTGATCATTTCCTAGCTAAATTAGTAACATTATCTTACTTCTCCGGCCCACTATAAATTCAACCATATTGCGTCCATTGGCGTATTAGCCTCGTTGGACGTCTATCACTACTTCTGCCCCTATGTAAATTTAAATGTAGTGTTTGTACACCTACCGCAGCTTGGATCAACCGTCGGTGGGCTATTACCGTTCTCGACGGTTTCATTTCTATTGTTTACGCCAAGTCGAAACTAATGTATGAATTGGTTTTGCTAGCAGCTTATCAACGATTGGAGTTGTACTGAAGTTTCTTGACGCTATTGTAAATACTCTGGACCGCATGCTATCTATTGGGCTAAGACATCTTTACTTTGCTACAAATCGTCTGTCGGTTACGTTAGGGCTTGTTGCTTCTCATCTTAGCATCTTCGCAGCATCGCATATCCGTGGGGAGCTCTAATAGAAATCGATCCACGCCCCGTTAGGGCATTCCTGGCCAGCTTCTTGTAACTGGATTGACTATGGCTAGAACGTTATCACATTGACGCAGACGACATTTATTTTATTATACCGACCCTATGATAGACATATTCTATGAAGGGTGTATCACTCAGTCACGTTGAAACCTTTTAACCCTGGAAACAGGCAAGAGAGCACTTATCCGACGACGTACCTTCCCATTGACGTGTAGATGTATCTTTACCTATCAAACAGACTTGCATAAGTCTTAGAACTTGTCGGTATGTATTTAACGCTTAGTCCTGTTCTAAAGTTTCGGTACGAAGAGTACCCTATTACTGTCATTCATGAGTAAGGTTTAGCTAGATCCACCATCACGCATGTACGCTATCTAGTGCTTCCCTTGTATGAAAGCGATGAAATTGAACGTGAATTAGGCTCGTTATTTCTAGACGAGTATCATATCGTTTTGCCCTGACTTATGCATCGACCTTGGGTACTCTGGCCGCGTAGCGCTGTACCCGGTTGGCTGTCATGAATGTTCGTCAATGACCAGCCTGATTCCACTAAATACACAGACCTTGCAGCAACTTGCTCATGTCTCAGCTTTCAAGACCTTAATCTTTGTGGACTCTTCCTTTCATAAATTAAAACTTTCTAAGTTAATCCCACCACGAATAACAGCCGTTACATGTTCTCCTCACGCCATCGATATTGTCCTCAGGATTAGCTTTCGTCAATTCGACACTTCTCACCTAGATGAAATATTCCCTTGGATTATCTCCGGCTCCACCGTACGTTTCGGTTGTCTACGAACAACTGCTTGCACATGAAAATTAAGGGTCAATTGACGCCTATGTCCTACCTCAGCCTAGCCCGGCTTATTTATTAAATCTATATCAAGCGCTGGAAGTAGTGCATAGTCGCCGTATGTTAGCCCGTGTAAATTTAATAGCCAGATGTTTAGCCGCATTCACTCTTGCGTCTGCATCGCCAATCGCTACTCGGGTTCAACAATGCTCTGTGACATGTTTTATCAGCGTGATTAGTGGATATTCAATTAATAACTTTTCATCTATTAAGCGCGTAAATGTAACCTCCATTGACTGGTGTAGACGGGTCGTATCAGCCCTACCGTAATCAGCGTGATTTCGCCGCTGCATGTCGTACTTTAATGTTTTATTTCATTAAATTTACGCCGATTACACCGGACGTTATTCAGCAGGCCATATTCCTTAACAACTTTCATCAAACCTATCAGATACTACAACCTATCGGGACGCAACACTCCTCTTAGATCCTTACATCTACATCTAGTTGACGGGGGTACTTTACAACGCGTTTTATCTTCACGACCTGGTTTAAAGGTTTATGTTTAG
>88
CATTGGGTGTTTAACCTCTGAAAGCGATTCGCGTAAGGGTCACCGCTCCCTTATAGACCCACATGGTCCCGGCACCTTTCACCGGCATTGTAGGATTTGGTACAGGCATAGCGTCTACAGTTCATAGGCATCAACATAAGTCAGATCATCGGCTGAACTCCAAGCCGCATCATCTATTCCTAGCCGGTAGTCATAGCCGCTGGCCCATGATATTTCTGTGATCAATTGACAGGCTAGAAGGAGCGCCGAAGGGATCCCGGGATTCCACGAAACGCATGCGTTGTGCTTTGAATCCGGCAGCTGAGCAGGCAGGAAAACTTCGATATGCAGCTCCGCCGTGAGAGGTACCGCCGTCCCTCTCTTCACCGTGTATTCAGCGCCGGCGGTGAGATAAACGGCAAATGCCGGAAATCGCTCATAGTAAAACAAGGGCGACCATCAAAACGTCGCCCCGGTGTCCATTGCTTCTCCAGTGCATCCAGTACGGCTGCACCGTCATGCAGTATGTTTCATCGCTTTATTACCCATCCTCAGTTGATGCTGCAGCGCATAGCCCAGCTCTTTCGGAAGACGTTCACGCCGTATCCGCTCAATGACTATTTTGTTAAACGCCGTGGTCACAGCGGCAGGCCATCGGGATTTTCACCACATCAATCGGTAACGGTTTTCCCAGCCACACGCTGCATGACATGCCACCGGCCTTTCAGTTGGAATAAACGCGCCGGGGAATACGACGGTTACCCACAAGCACGCTGCCGCCTTCGTTTCAGCGCCCCATGACGCCTCCGTAGATTCGACTCCGGGGGCGCGACCACAAGCCGGCGCATCCCCAGCTTGATTACAGGCGATTCCCGGTTAACTTTGATTCTGCTGCGGATTTTGACCGTGACCCTTTCAGCCGCCTGGCCCTTTCCTTTACCAGTTTCAGCGTGACTTTTTGTCTCACGGGCAACCTGTGACGCCGACGCGGGAGATATCACGATGAAGCAACACGCGGTTAATGGCCATTGCGGCGGGGCACCAGGCACCGCCGTTTTGCGCTGATACACCGGCCTATTTCAACGGCCTGGCTCAATACTTTTATGGCCATACATCCCCCTTTCAGCGGGGTACGTTAACGCAAGCGGGCCACGCGTCCAAGCCAGAGATGACAACTTCCGCCATCATCCGGCGAAACCCGATCTACCCAGAAATTTTCCTCACCGATGGTCAGCGTGTCTCCACGCGCAGCTGCCGCAGGGCCATCAGTCCGACAAACAGGGACGGGCTGAGCCTTCAACGCGCACGGGTTTGAGCATAGCTGATATTTCAGGGTCATCAAACACCACGTATCACCGGACTGACTGCTCACTCCATGTAAGCTCTGGCTGACGTTCCCAGCTGTATCGCGTATGTTTCATCGGCGCCGGCAATCTCGCAGCAAGGAACAGGTTATCGAGATCAGCCAGCGCCTCCCGTTATTGCATTCCTTAGGCCAGGCCGCGCTCTGTCATTTCGGCTGCCACACGGCCAAGACACGAAACGCCGTTCCCGGCAGCACAAATTGCCACAGATTCATCCGCGTGGCGTGAAGTGCATCAGTATGCAGCTTCACCAGTGCTCCCGCCACGACCGTGACCAGTTCAGACGTATCCAGAATCACGGTATCCGGCTGCTGATCCACACCCATTTCATGTCCGGTCAGCACATTTTCCGGCTGAGAGGGTGTCCTATGACCGGCAGTTTTCATCCGTGTCATCAAGCTCCTCTTTCAGCTCCTGCCACGCTCGCGCGGTTGTGCTTCAGTTCTTCTTTCGTCCCCGTCAGGCTGACATCACGGTTCAGTGTTCACCCGGCCGCGGAGACGGGCAAATCAGTTCATCTTTCGTCATGGACTCCTCCACAGAAACATCTACGAAGCTCATGATCCCAGTTGTACGGACACGAACTCATCAGGGTCAGCCAGCAGCATCCCAGGGTGCTGACTGAATCAGGGTACTCCAACCGCGCCGTACTCCCCCGGTGTTACCCCAGTTTTCGGGCACGGGGCAGTTAGTCAGTAGCATTTCCGCTGTGCGTCCGCATCCTGAATGCAGCCATAGGTGGCGCAGACTCGCGTGCCTGAGGTGTTCCCCAGCACCCATCGTGTTGTCCGGCAGGAAGTTCTTTTGACGCCGTTCCTACGTACTGTCCCTAGAAACCACAGGACGGAGTGGCCACATCGCCATACATCCCTTATAGACACCGTTTGCCCAGGTCTTTCACGTGTCTCCAGCTCGGAATATGCCTACGACGGGTATCCAGCTTCCTTGACGGGTCGAAAGGAACGGAACAGCGCCCAGCCTTTTCGGATCGAACACGATGATATTCACACCGCTGGCGTTCCCCGTAGGCTTCGATATCGTCGGTCGGGTCATACGTGGACTATGTTACCGCTTGCTCCACTCCGTGCCGCCGGACTGCGTGATGTTATTTCTCCACTGCGCTCCATATCCTCCACCTCAACCGGATCCGAAGGCTTCACCGGTCATGGTGGTCCCTTAAGCACGGCAGAAACTGCCTGCATACTTGCCTCACCGCTTCCAATGGCCTCTTCGTCACGCATGTTCTGCATGGATGCGACGGCGGCGGTAAGCCGGGTCGCATAGAATTCTGCGGATCTTCATCCGGCAGGCGACGCAGGGTCATCTGAGATTCAATTTCAGGTCCTTCGGCTTGACATATCCGAGCGTAAATTCAGGTCGGAGCCGCCACGAAACGATAACTCACCGGAAACAATCGGCGAAACGTACAGCGCCATGTTTACCATTTAGAATTGTAGAGATAGACTTTCTCCGTGGTGAAGCAGGGAGCTCTCACGGAAAAGAGCTAAGAAACAGCAGAACAACACTCTTAAATTCCTTAGCCCATTTGCCGCCAAGAGTTGGGCGGTTGTACATCGACATAAATCCCGTAAAAAGCCGCACAGGCGGCCTTTAGTGATGAAGGGTAAAGTTAAACGATGCCTGATTGCCGTTCCGGCACGGCGGAGTCCGTTTTTCGTCTCGTCGCTGGCAGCCTCCGGCCAGCACATCCTCATAACGAACGCCTGGACTTGTAGAACTATTTAGGCTTATGCTGGTCTGGTCAGCAGCATGGGCAAGAATGCAGACGGCAGGACCCGTCGGTGCCATCCGACGCAACCAGCTTACGGCTGGAGGTGTCCAGCATCAGCGGGGGCCTTGCAGGCGCTTTCGCACTCAATCCGCCGGGCGCGGTCTGCGGTATGAGCCGTTACTGTTGCCTGCGGCTGGTAATGGGTAAAGGTTTCTTTAGCGTCATAAACATCCTTACACTGGTGTTCAGCAAATCGTTAACGGCATCAGATGCCGGGTCATGCAGCCAGCGGTGCCGGTGCTACGCCTTCCGCATCAGACGATCCAGCGCAGTCAATTGGCGCCTTCACCTCTGTGGTGCTGCGGCCAGAATGCGGCGGGCCGTTCACGGTCATACCGGGGTTTCTGCCAGCACGCGTGCCTGTTCTTCGCGTCCGTGCCTCCTCCAAGTTGAGGATCCCCATAATGCGAGCTGTTTTCTGCCGCAACGCGCTGCGGTAATCTGCGCGTTCACGTCCGGCTGCGCCTGTCCCGTTCTCGCCCTCCGTCGCTGGCACCACGTCAGTAACGTCATCCTTGCGAAGCAGTGGGCTGAAACAGTTGTTGATTGAGTCTCTTTTGGTCATTGCGCCGCGTAGAGAAGGGGATTGATCAGTGCATCGAGTGCATCACGCATGACGATCGCATCTAGTTAGTGTTAACAAGTTCATCAGCCAGTCCGGCATCGACCCTCCTGACCGCTGTACACTGCAGCCTCGGTAATCCAGCACAACCGTAGCACGGACAGGCTTATAGTGCCGACAGCTTGCGCAACATCTGCGGGTTGGGGCCGTCTTAAACCGGCAGATGTCTCCCGGCTTTAACGTCATCCGAAAGATGGCTGTAGGGGTTGCCAAGCTACTTTATCGGTCCCCGGCTGTAATCAGCGTACTTCACCACCCTGTTTCTCCAGCGCAGCACCGTGATCAATTACTGTGAGCCATCATGACGCCGATGGAGCCTGTCCGGGCGTCTGCGTGACCAGACGCAGGGAGCGTAGGCGGCACTGGCAGGCAACGTTACCTGCACTGCAGTTCATGTCGTTGGCAAGGCCCATACAGGCTTTTATGTCTACGCACACGACTGCGATGATGTCAGCGCAGTCAAATTCCCCGCACCATCCCACGGGCGTGTCCATATCGATAAGAATGCCGTCCCGTACCAATCGCTGGCAGCTAGTTGCAGACGGGCGATAGTCGCCGTTGTAACCGGTCATCCCCGAGTACGGCTGCAGCGCCCGCGTCCGGGGCCGTAACCAGCGTGCCGGGACACCCGGCAGCACGGCGATGCCGTTCATGATAGTGATAACTGCGGGCCTTCCGTGGTCCGTCATGATGCCCCGGATAATGCCAGCGTCGCGAGTGCCTCCTGGCAGTCAGGCTGTCGCCGGACACCGCATCCGTCAGGCTGCTGATCCCAAGCTGGCCTGCCAAGCGGCACAAAGAAAACCGGCGCATAGGCGGGTTCAAGGCATCAAGCGGCTCATTAAAGGCCATGCTGGCAATATGCGGGAGATTACGCAGCTCTGCTGTCACTCTTCTCCTCCTGTTGATTGTCGCAGCCCTAATTCAATCGCTGCACCGCCCGATGGCGGGCGGTTCCGTAAGACCGGCTGCACGGCGCTCCATGGCTTTCACGGACTTGCTGGCGGCAAAATTTCCGATAGTCGTACCGCGTTTGCGCATCCTTTCTCGTAGACCTCAGTTAAGCTTTCTTTATATCAGCATCACCGCTTCCAACAACTTCTTTCCAGACCATCGGATGGCCACTAGACCGAGCCTATCCAGTCGCAGTTCCCAGGCACTGCGGGCTTCCTGAAAACTGAAGCGCTTTTGAAAAAGGTAACGTCAGACGCGGCGAACGATGGCCTCTTCCATGACCAGCCATAGCACAGAAACATCGGCTCGCCTGACGGGATGCGACGAATTTCGCCGCCCCCATAAAGTGACCTCCACGACTCGTTCGCACTGGCCCGTGCCGTCGAGTAGCTCATCTGGGCATCATTCCGGGAAAGCTGCTCATACGAGACACCCAGCCCGGCGACTAGGATAGCCCGCAGCAGTGACTGCTCAACACGGAGGCCGTTATCCGTATCCTGAGCCCCGTCTGCAGGTTCAGTGAGTCACCCGGCATCAGGTCGGTACTTTTGCGCCTCCCAGCCGGACCCTAGCACTGCGGCGTAATACGCGCGGCAATTTCACCAATCCAGCCGTCAGCCTTTCCCGCTGCTCCTGACTGTTCTAAGCCAGAATAAATGCTATCGAGCCGAACTGCGTATCCAGCCTCTCAATGGTGGCGGCATACATCCCCTTCACAATGGCGCTCTGCAGCTGCGTGATGCAGCGTGAGCATCTTCATCTGCTCCATCACCTGTAAAACACATTTGCACCGCGAGTCTGCCCGTCCTCCACGGGTCATGAAACGTAGTAAAGCCGTGAATGAACGAGGCGCGCCCGCCGGGTAATAGCACGGGGTATCCATGTCCATTTCTGCGGCATCCATCAGGATACCCGTCCTCGCCTGACGTAATCCCAGCGCCGCACCGCATGTCATTAATCTGCACCGGCACGGCAGTTCCGGCTGTCCCGGTATTGGTTTCGGGTTGCTGATGCGCTTCGGGCTGACCATCCTAGAACTTGCCTAGAAAAGCGCCGGGACGATAGTGACGAGACCATAGCATGACGAACAGTTCTTCACCGTTAAAGGCGTGCATGGCCACCCTTCCTCCCGAATCATCATGGTAAACGTGCGTTTTCGCTCAACGTCAATGCAGCAGCAGTCATCCTCGGCATAAACTCTTTCCATGCCGCTTCAACTCGCGGGAAAGGCAACCGTCGCTTCTCTCTCCCCGATGCCCAGATAGCGCCAGCTTGGGCGATGACTGAGCCGGAAAGACCCGACGATATGATCCTGATGCAGCTGGATGACCCGTTGGCGGAGGCCGTTATTGCGTCAGAGATCGTCCCTCAGGCATTGCCATTCCAAAGTTGGGCAACAGGGCTGCATCCACATTTCACTCGGTGGGTTCCACGACCGCAACTGCCCTCCAAATCCGCTGCCACCGCCGTGATAACCGGCATATTCGCGCAGGCCAGAGGGTGCTCATGCCGTCCGGCGCGCAGAAGGGTGGGAATGGTCGGCGTTTTCATACATAAATCCTGCATTATGCCTGCGTGCTGTGTCGGTGCCGGTCTGCACTTCCAGCTCTGCATATATTTTCAGGTCAGACACGTCAGAAGTGTCGTAAGTGGTAAACTCCACCCTTCGTCCGTCTTTCTGTACTGTTGCCCCGTTTACCTGTCATCAGGTCATGCAGTGCCGCACGGGCAGCGGCAAGTTTCTTCCTGTCGCGTCATTCATCTCTAGCGACAGGCATGAAACGCCTGTATCTATAATGCGCCAGTGTTTTCTTTGGTGCTGCACCATCCTCTTCCTGCAGCAGCCAGCAGCACTGAGATGCAGCTGCCAGCGGGAAATACTGATGCGCAGCGCCGCCAGCGCATAAACGAAGCAGTCGAGTGCCTCATTTGCGTCGCTGTTAGGGCGTCCCACAGTATTTTTCCTGCCATCCACCATTTTCGACCTGCTCTTCAGCAGGTTACTATGCTGCTTCGGTCAGATCAAATATCCGGGTTATTCGGAAAGCGACGACTGAGGAAGCGGTTCATCCCCTTCCGGCGTCAGTGTGAAGCGGTTACGAACGATCTGCTCTTTCGCGGTATCCGTACCGATTTCGGTAACGGGTGATCCCGTTTTTGTTTCGCTTACGTGGCATGCCTGACCACCGGCTTTCCGATCATCCCTTTAATGGGGAACCCGGAACAGCCCATGTTTTCGAGCGTTCATACAAGGTCGGGTCAATCCCGCCAGTATCCCAGCAGATACGAGTATGGGACATTTCTGCACCATTCCAAGCGGGTATAGGTTTTATTATGGCCTCATCCACACGCAGCAGCGTCTGTTCATCGTCGTGGCGGCCCATAATAATCTGCCGTCAATCAGCCAGCTTTCCTCACCCGGCTCCCCATCCCCATACGCGCATTTCGTAGCGGTCCAGCTGGAGTCGATAGCGGCCGTCAGGTGAGCTCTAGCCACACGTCAGGAACGGGCTGAAACAATCTCTTTCCGCTCTGCCATCACTTCAGCATCCGGACGTTCGCCAATTTCGCCTCCCACGTCTCACCCCGGTGTTTACGAAGGTTTACGTTCTCCCGTATCCCCTTTCGTTCATCCAGTCTTTGACAATGCACCCGAGCTGGTGAACGGGCTGTACGTGCCATGTGAAGGTCACCTGTCAGGGCTCAATCTCTTCACTGGATGACGAAAACCAGAGAATGCCATCACGGGTCCCAGATCCCCGGTCTTTCGAAGATATAACGGCATGAGTAAAGTTGGAGCTCCTGCTGGGGATGACGCAGGCAGTCTATGGCTCGCAAGAGATAACAAACCTAGTTGGAGGGTCATCCGGCGTCCGATTTGAGGCCAAACGAGTCTCTTTGTCGCACAAATTTAAGATACTCTGCTCCCTCCCCGCAAACCGGGCAGGCAACATGAAAACGCATAAATGCGGGGATTCACTGGCTGCACGCTCAATCGTACGACAGGTGCCTCCCATTTTGGCGTACCGTACGGATGGACTTTGGCCAGACCGAGCCTTCAATACTAGTGTCACCCAGGAACCTTTAGAGAGCCTTCCTGTTCAATATCATCATCAAAGCAGCAAGTTCATCATAACCCTACATCCACCGACTTTCACGGTAGTTTTGCCCGCTTTACCGCCAGCATCAGAAGCCACGCCCATTAGTGAAACACGCTTCATGGTGAGCGTGTTCCGCATTGCTTTGCCATACCACGGGGAGGGCGCCACTAAGGCGACGAATATCACGAATAGTTCAACGGGTCATTTCATAAAGTTCTCGCATCACCATCCGTCGGCAACCAGATAAGGGTGTTGCTGCTTATGGTAAATACTAAGGCATAAACCCCAGCAGCATTTGGAGAAACTGACTATGAACACGGCAGACTTCACCACATTCACCTCACGGATGTATGATCGCTGCCCATCGCATTCATGATCTCACCCCTGAAAGGCAGTGTTTCCCCAGCGCCCTTCCTGGCTGCGCGGATTCTTCGGGGAGATAGTAATTAGCATCCGCCCATTCAACGAGTGTGGGCTCCGGCTCCCTGACAGTGAGCGAAGCCCGGCGCGGGGTAGACAAAATGCCCAGCCTGTTGACTCGTAACTCTGTTCGCTGGTTATTCACTCATAGCAACCCCGGTATCAGATTCATCCGGGGGCTGCTTTGTTCATGGCTTTGATGGATATCCGTTCAGGAAATCAACATGTCGGTTTTCTTCCAGTTCCGGAAAGCCGCTGCACCGACACGCAGGCGTCGAAGTAATGGCAATTTCACTGCGATCGCGACAGCACGAAAATACAGAATGCGGTTTCCACCACTTCAGCGGAGCTCCTGGCATTCTTCAGTTTCCTGTGCGTCGGCCTGCAACGCGTAAGTCGATAGGACGAGTTCGTATCCTCAATAGTTCCTGGCTGGAGATCTGCCTCGCTGGCCTGCCGCAGTTCTTTGCACAATACCGCTCCCGGACTTTTCGTTCTCAATTTCAGCATCCTTTCGGCATACCGGTTTATGACGGCGGCAGAGTCATAAGACCCGCATTACCCTTGCCACCGCCTCTAAGAACGGGCATTCCCTGTTCCTGCCAGTTCGTAAAGCGGTGACTTAGATACTCGCACGAAAATGTCAGCCAGCTGCTTTGTTGACTTCCATGTTCATTCCACGGACAAAACAGAAAGGAAACGACAGAGGCCAAAGCTCGCTTTCGAGCAGCTAGGTCGTTCCTTTCGTCCCAGGGGTATTTTAAATAAAAACATTAAGTTATGACGAAGAAGAACGGAAAACGCCTTAATGCGCAAATTTTCATAAATAGCGACTCGAGGTCGCCGCCGTTCTGTTT
>89
CTCTGTTACTAATCCCAAAGGGATATTTTCGATCGGTTGTTCAGGTTTCGTTTAGTACATTTAATCCTTTACTCCCTAAAGAACATGATCTCGATCCCAGCAAAGGTCACAATATTTATTTACTCAAGAATGCTGCCACAGCAATAGTTGTAAATCAGGCGGTAATCTCGCTTAGAATTCATTCCAGCATTTATTGGTTTGTATGAGAGGTAATAGAAAGACAACGCGTATGAAGCTACAACCCACCCAGCCAATGACTGAGACTTTTTCGACCAAACTCATCAGCCTCATTTCTAAATATGAAAGATCAGTAAGACGTAATGAACAATTCAAGTGACTAGATGATTCACTAAATTATTTTAAACACATATCCATCGCCGAAGTATGCTTCGAATACTGCATGTTATTTAATAGATGCATAGATGTCGTTGTAGAAGGTCATGTAGTTTATTCGATGAACCAGATTCATCTGCGTGCCGCCTATTGCTCTGCTTTACGAACATCCACCGGACTTACTCGGCTGCTACACGGACTTAATAATTTGCACTCATTCTAGTAGTACTGCACAGGTTCCAAATCCTGCATGTGAAGTCCTACGGTCAAGAAGCAATAATATTAGCCGTCCCACTTGAAGCACGATTGGGTACAGTGGGTTTGACCGTGACAAATTCTTGGATATCACCGTTGCATACGCTTACTCCGATCGTGTAGTCTAAATTATCCATTCTAAATTATAATGGTCATACCGTACTAAATTAAATAGGTTTTAAAGCGATACTGAACAGATGAAAGTAAAGTACAACCAACTACTTTCCAGCGAACTGAGAAATGCTTAATAAATGCTCTAAGTATGATTGGCAGATAATGTTAGAATAATTTCATGTACTTCCCACTTTAAGACAACGGAATATTAATAATGACAGTTATTTACCACTATTCCTCCTACGGTAGTAATTACACTGACAAAGTTAAATTAGAAGCTGTTGACCATAATCTCCAGACAACAATCTAGACAATAATCATGCTTGTTTCATCATGAAAGTGTCATTTGGTAACGACAAATAATCATTTCTTCTATTGCACATTATCCGACGGGATTGCCTATTAATTAGTTCCTTATTCGCCGCGACTGCAATATGAGAAGGTCACTTGCAGTGATGAGGTACCTACCGATTCATCCTATCGACAAGGACATTTTTCTTAGCAATGGTCCAGCAACGAAATTTCGTTACGGAATGGCTCATCTATCGTTATGTTGAATGCCCGGGGACTAGGCAGCAGGAAGACAAACACATATGCATTTCAATAAAGTCATGGTCAACAGGTATCGTTGGAGGCAGGAAGCACTTGGAGTGAAGTGATAGAATGACTTTCTTGACAGTTACAGGAAAACCGTTACGCAAATTTCCCCACCCGTCAGTTATTAGCGACTAAATCTAAACCTATTATAATTTGAATGTAATCCCCAATCCCAGCGTACTTATCATCTTCTAACCACTCGAACATTTTCAGGGATGTAGAAGTACATGAAAGTGAATTACCACGCTATCACGAACGAAAGCTTTACGAGCTGTTGACAAAATCCGGTAACTTGCTCAATTCCTAGGCAGTCATTGGCAACAGTGCATGCACTCGAGAAGGACGTTGTAATGTTGCTCCGACAGCATGTTAAAGTACAGGTCGGTCAACCTGCTTGGCAAATATGTAAATTGGACTGTAGAAAATCATCGCACTCGGCAGGTCAGCTTCACCGACTGCATACGACGCTGTCGGGACGCCTCGTCCATAGTGCCGGCGCCAACTTATAGCAACTGTACAGCCTACAACTCTAATTTAATACATAATGAATGTATAATAATATTAAATTTCTGTACTAATTTACTATGGTTTCTCATAAGAATCATTGCAAAGATCAAACACTGGTCAGAAAGTTGACGGGTCTAACCGTCTATTTATCTAAATATAAGCTCAGCATACGCGGTAGCCGCACGCTCAAAACCGTTGACTAAACCATGGAAGAAGACTTACGATTTATCGCACTTGCTCATTCCCGTGCACCGTGATATCATTTACCTGAATTATTAGCCGCTTGAATTTGAATCAATTCCCAAAACCGCAAAGACCATACTTTATTCAACAAACTAGATCTAGGACTCGTTGACAATAATGTTATTGAAAATGTCAAATGATCCATTAACCTATTGGCTAAATTCCTAATACGATAGAAAATAGGCGATTTAGAAGGTACGAGCAAATCCATATCTTTCATCTTACATTACGAAAGAATGAAGGTTTAAACATGAAAGTATGTTAACATTGTAAAGTTAGTCATATTGCACGAAATTATTCATATTTAACTGAATCATCTATTATTAAATCAGAAGACCTATCGTACTAGACTAAAGATTACCGAATGATACCCTTAATGTATGAAGCGTATAAACTGTAATCTGCCTCCTTAATAAAGGTTACATCTACTTATTCAAGCTTCTATTCGACTCTTTATTTGATGAAGCCGGGAGAAGGTGACTTATTTAAATTAAATTACTCCATAAGCAAATTGTCATTTAGCATGATACTACACCAATAATTCCTGAAGATATTACTAGTCGACTGGTACTCCATAAATATCACTTCGACGACAGTAGTTGACTATACAGCCACTTGCAGAACGACTTTTAAACGACCGTTACACTTCAACTATTAATTTTTATAAACATTCCATCCGTACTTTGATCAATACAACATTTGAAGATCAAGCAGACATATTTTAGTTGCAGCCCTACTAAGTAGAGCGTAACAAAGCCTTATTCACTTACATATTCCATGTAGCCAAAGCAAGCATCTACTCTACAAGCAACCAATACATACAATGCCAATTAGATGAAAGACTTCAGTAATGTCGACCGTGATTCAACGACTAATCAAATGTATTTCATGGCAAATAGTTACGAACTACCGACAAAACGACTTTGACAGATGACAGCGACTCAAATGACGAAAAACCATATTTCCATGCGTTCAGTTAAAGGCAATCCAATGTAAACTACTGAACAATTGAGTCAGACAACCTTCCATTATTCCTGAAAATAAGTACGCCAACCATCCATGACCTACTTTACTAATAGACCCCGAACGTTGTTCACTCCTATACGTTCGGCTCCAACTTACGATCCATAACATAGAAATGAGCTCAATAGTGGCAGTTGATGTACGGTTCAGCACCTCCCGTATTCTCAGCTTCCAGCAACGAGGTTCTTCCTTCTAATTCCGATTGCATGCCGCATCCTGAATCCACAGCCAACTTATACTTAATCACGTTGTTTCTTCCCTCCGGATCGAATACGGTTCTTATTCCTTGACGTTAGCCGGGTGCATTTCTATTCTGTGCTCCCCGTAAGGTACCCAATTTCCGTAACGTACCGGTTCAGAATAAATAACGCGTGCTGAAGCCACGTCACGTTTATCCGATGGTCTTCAACCATTCACGTGCCTCATCACTGTTTAAATACAACAAAGCCAGCCGGAATGGCTTTAATATCGGTACTGTTGCAGGCAGACCGTATCAGGCAAAGAATATGCGTCACCTTCAATAAATTCACGTTCCGGCCCGACCGTACTGTTCTGTTATTCTATTCAGCAGTATGCTGCAAGCTAGTAGAATCAATGAATGTTATCGTCCGCAGTTAGCGTTAACCTTATCTTGTCCGTGGACCCAAGCCGACGAATGGCATGAGCACGTAACCGACTGCTGTGAGCACCAATACCAACTGTAGATGTGCAATAGCAGGCACTCACGGCTGTACCGCTACGTGAAATGGTGCCTTTGACCTTCCGTTTGATAATAAGCACTCTGTCGTTCCTGTTAACTTGCTCTGATTCCTTGGTCAATGTTTACTGACTCCATCAGAACTGTTCACTCCTTAAACCTATTGCGGGCCCGTACCCTGTTCATCTAAATCAGACTGTGATCAAGGTTCCCCGTGTCGTTAATTCTTACTGTATTGAATGCCTGTTTATTTCCGTAATCAAACCACGATGGGTCCTTTCTAGATCCGTGTAATCGGACCCGGACTGTGATCGACTTAATTCCATCCTGTTCCGGACAATACAGCGACGAACCTGGTGGGTTTCCCTTGATTGTTCCGCATCATGAATGACGGAACACGATGATTACCGACAGCAAGTTTGTAGCCCTGTCAACCTCCTTTCGCCTGCATCAGGTGACGGTAACGGAACCGACGTATCATCACGGATCACCTGCCCGGAAAGCCGAATTCTCACGACATCTACAATATTCAAGACATCTAACCAATTTCTAGAATATCCTTCACTCGGTGAGTTCAGATCTATCAGGCATCATTTCAAATACGGGTCACGTTTTGCTTTAGAAGCTCTGCCACCCTCACGTCATGTCGCATATTCCTTCGGTTGTTGGCCCACTCGCGTTAGATATGGTAGCAAATTAGCATCATTCACAGCTGCGGCCAGTGCTTGCCGTATTCAGTGCGTCAACCGTCGAGCTCGTATTAAATTCTAGTAAATTAATGGTCCTCAATCTGGTATGTTTCTTTCACGGTCCCTTGGTCCGTTCCGGGTCGCTTACGTGCTTGACTTTCTGTCTGTTTCCATGTAATTATTAGGACTCATTTAGTTCAATGGATGCACCGTTTCAACGCTGTTGGTTGCACGTGATTGCTCAATATCCTTTCCTTTGTCCGCATCCTCACCGCTACTGAAGCTACTCTGCACTTTTGCCCGAATTTTTACGTATTTGCCTATTCGACGCATTTTATTCTGCGTGATACGGACTTCCCGGACTGTCTCCTTCATTGCCGATGCCGTTTGACGGACTCCTATGTTTCATGTTGAACGGAGCATTTCTCATCGACTTTCCAATGACTAGTCCATCATGTTGATTCGTCTCCTTAACTTTCCTCTTACGATTTTCTGCCCCAGTCGAAGGGAAGCACAACGCTATGAAGCGTAGGGTTCATGTTACTATGATCCGCGTCGCTTTGTAAGAAGCACGCATCCTCCGTGGCTGAAGGCGGCGCTGGAAGTGCCTTAGCAGAAGTAGGAAGAGACGTGGAAGGGTGTGACGCTGCAGGCATTCGTTGGATAGTTGCCCGCACCGGCACTGAGCAGGGATCCGAGCCTGGCGGCACATTGCCCGCTTCAGGATCCAGCTCCCGGTTGAACCATTCCTAGCCCGGCAGCTGTCATCCGACGCACGGGCTCCGAATCGGCGCGTGGAGCATCCCCAGACAAAGGCACTGGTAAGTGGCGACGCAGCCGCAGCATTCACTTACGATCCCCATCTACTTGCACGACGATTGCCGCTGCGACAGTCACGAGCCAATTGAACCGCAGCAGCGGCCGGCATCACGCGTCAGGCACAGAAAACGAGTGCCAGGGTCCCGTTGTGAATGGTGCGCCAGATCTATTAGGGGTCGCGAGTATGCGGAACCGATGCAGCGGGCAGAAGTAATGACATGTACCCCACTCCATCTAAACGCCCGGCTCCATCCGGCATCCTCACGGACGCAGGATCGATCTTAGTGCAGTCAGCATGTGCGCCTACTATGAGTGCCTGAATTTAGCATGGCCGAGTCTCGTGCCAGTCTTGCCCACTCCGAAGCGTACACTGCCATGCCCCAAAGCGCCCGGTTCCGGCGGGGTCCATAATACTGTATTACGGCTAAGCATCAGAATGTAGACCTAAACCCAACGCATGAATGCGTAGTCAGTACGCAGTGCCCTCACGGCCAGCTGCCGAGCAAGGCAAGAGCCAAATCAAACTGAACCGACGACGCTATCCGAGTAAGTCAATGTTAGGGTCTCATTCCCGAACTGCTTCTGGCCGTTGCCTCGCAGGCATTTCTCGCATATTTTCTAGTTCTAAGTAAGCATCCCTACGCGATCATCTAAGCCGGACGATACGAAGGGCTCTACTGCTCCTATTGTAAGCATTAGACGCTAGGTCCGCAGCGCCACTGGCGACTGAGCGCGGTTCACTTAAGACCAAAGCATGTCCGCAGGAACCGAGCTAATCCGGTTCACCCCTCGACTCGTGAATCCGAACCGGTCCACAGCCCAACTTACCATAAAGCAGCTCCACCCGATTCGGGCGCCACGAACTCAAGCTATCCGCCGTACACGTCGAACGCAAGCCTGTACCGAGTCGAAACAGGCTGCTACGAAACGGTTCCTATTGCCTCGACCGCGTTCGCAGGCCGGCCTCCCCACTAGCAAGACAGACCTTAAAGTCACATTTGACTCAAGCCAGCCTGCACTGGAGGCATAAACGCCCCGATTCCCGATCGACGAATCGATCAGTGCCAGAAACCCGCATTCAGCAGCAGGCAATCGAAGCTAATCAGATTCCGCACCGGCCAAACCCAGACCCGTTGAACCATCGGTTTACCGACACTAAGCCGACTAGTTAATGTAGAATGAGCGATCGATTGATTCAGTAAGGCCCCGCAACAATTACACGGGGAGAACAGGGTAACCGCATCCGCGATGCTCTAGCCAATCAATCCACAGCCGATAGCGCCTCGATCACGAATACGTCCGCCATCCCGACAGCGACCGGATCTCCGAATATCCGAAGCATTACAGCCCGACGAACCGTCATCGTACGAATTTAGACTGATCGACGAGTCCACCTCACGCCGGAACTGCTTCTCCGAATTGGCACGATCTCCACTGCACTCCGCGACGGTCGCCGTACATTCCCGTCACGATCACGGAGAGCAGGGATTCAGAGCATCGGCATTAGCGAGCCGTTCCGACGAAGTCCGGAAGGCCGATTCATGCAGTTCGGTAATGATCGTACGGAACCTAAAGCCTCTCAACACCGTTTCATTCCGATTTGGACCGAACCGCGATACGATAACCCTTGAAGCATGAAACAGAATTGCCGGTCTAGCAATCCCCATGCAGCAGCGATAGCGACAGTAATGTTTGCCGTCGTCTCAATCCGACGCCATTGCTAAGCATCCAGGGAGAGCAGCGTCTCCATCCTGGGTTCGAAATTCCCAGTCTGAGCGGCGTTCCTCCCGTCAGCTCCGCACCCTTTCCAGCAGCTCCTTAGCATGAGATGGGATGCGGTTCTCCTTAACCGCTTACTAGCAGATCGAAGCCTCAGTCGAAACCGACGCAGCACTCCAAGGGAAACCGCATTACGCGACGGTATTCACCGGGCGGATATAAAGTAAATAAAGCCCGGTTTGATACTGGGGGCTCCCAGTACAGCCGTATACAAGAGATAACGCGTGCTGGGTTCAATACCCTGATCCGCAATCGCTTTGCAGGCGACCAGAATCAACTGTAAGCGTGGTCAAGCTAAACGGCAGGATCGGGCAGTGGAAGTCTGGCGCCCGGGAGTCGACAATCCACGGTGCTGCCGGTGCATCAAACGATAGACGAACGCAGCATCAGATTCCGTCTCGACCGCATTACGCCGGACTGTCACCCTTAGTTCCCCAGTGCGATGCGGCAACCGGCGTTTCATCGATCCTTCCGGCGTTGTAAGCCCCTCAGATCACGTCGTTGAACTTACGTCAGACTGGAGAGCAGGAATCCACGCAGTTCGTAGTCCGAAGCCAGCATTTATTCCAGGGTCTGCAGTAATTCCGTCAGTGCGTCGCAGCGATTAAGAGTCCACCGGTTGCCACTCCTGTTCAGCCGCGTCAAATGCGCGTTCCACATCTACGCTCTCCTTTCCGAGCAAGCGCTGCAACGATGGCATCCGTTGCGTTCTACGAAGGACTCACAGGAGCGGAACAGTCGCAGCTGGCAGTACTCAACGCAGTCGGGATTGTAATTCCAACGCAACACGGTATTAAGGATCCTACGTCAGAGGAGCGCGAAGCCTTTGACGGATCGAATTCCATCTAGGCAACTCGGATTTCATCCGCGTCAAGGTCCGTCCGTCATGCATCGGGCGATGACGGAGCATTCGATTTGAGCGGTCAGCGTCGGAGTCCGGACTTAACGCTTCACCGCAGCACGAAGCGCAGTGCTGATGGCAGCATTGCAATAGATTTCGCAGTCAAGCGACAGAATGCCGGGATCTACGTCCTGATGAACGGAAGCCCGAATTATCTCCTACCGGTCCGTTCAAGGGTCGGTTCCGTGGATCGCTCCCGAAGCGTCGGTAGATCAGAAGCTCCGGCACCAAGGATTGAACTGGCATTCGCCTGCGTACCATCGAAGCGTTCGAGTTCTCTCTTCCCAGCCGTCCGTCTCCGATGCCGTTTGTTCAGTAAACGCGTCTAAGAGCGGCGCCAGCGGAGCGGCGAATCATGTCGGAGCGTCGAACGGATCGAGGAGCCGTCTGAGGTTGGAGCGGCTGGATCTGAGCGACGAGGGCTTGCATGCAATCACGAAGCACGGATGCTCATGATTCAACCGTAGCACCACAGCTTCGATTTAGTCAGCAGAAAACTTCAGGCTTCTACTGCATTTCCAATCCTACCCCGGCGGTCACCGGTAAGAATGCATCACGCGAGCAGAGATCGGAGCGCTCCAAAGCATCCAGCGGCAGGACCGTTATCATGTAGACGCGTGTGGTCAGTAGGAAT
>90
GCGCAGCATGCTGAATGGCTGTACCGCCTGACGCGGATGCGCCCCGCCACAACAGCCCCGGCCAATGGCGGTGCCGATACTCCCGACAATCCCCACCATTGCCTGCTTAAGCAGATTTCTGTCATCATATGGACAGCACGAACGGGTGAAGCTGCGCAGTTCTGGACTGGGCTTGGTGCTCGCTGCCGTTAGGCTTCTCCCGCCGACTTAATGGAGACGCAGCGAAAACGGCGGCTCTACAGGCGGTATTGGTACAAGAGAGCATGTCCTTAATTGTAGGCGCTCTTCCCACTCACTCCAGCCGATTGCCAGGCCTGCCATCGAATTCCCGCGAAGCTGGTCTTCAGCCGCCAGGTCTTTTCTGCTCTGACATGACGTTATTTCAGCGCCATAGATTATCAGATAACTGTTCCTTCAGGCGCTGTTCCGTGGCGGCTTCCCGTTCTGCCTGCCGGTCAGTCAGCCCCGGCTTTCGCATCAATGGCGCTCCGTTTTGCACCCAGCGTTGCTGTGCTTAGAATTTATCGCCTGCGCCGCGCCAGCGCGTTCAGGCATGCGGTACGTAACCTTTAGCCAAGTGGTGCAGCCATAGTGAGTTTGGGCACTCCGTCTCATCTTTTATGCGCCATAAGGGATTTCTCCTGTTAAGACAGAGCTGGCGACGTTGCCACCGCCTCCTCCAGTACCGCAACCATACTCTCCGCTTCCACAAATCCCCGGCCTGCTGCTGATTTGCATTTGCTCCGCTGCTTCTCCAGCGTCTTAGAGTTCTGCCTGAAGCGTCATAAGGCAGCATGAGCCAAATTTATTCCTGACGATCGCCGCAAGACATTGCATTGTACGCTGGACTGTTTCGGCTTTTCAGCGTGCTTCATAATCCTTTCGCCGCCGCCATCAGTGGTGTTGTAATCCGCCTGCACCATTTCCCGTCCTTCTTTCGTGCCTTTCCGTTTCTTCCTGGCCTCGGGCTTATTTCTCCGGCGTCTGCATGAGTCCGGCCACTTCTGCGCCTCTTCAGTATTTCAGCCGTACGCTGCGAGCTCGAGCGGCGCTCTAGGCAGTGCATCTTACATGTCCGCTCTGCTCAGCCTTCTTTCGGGCGGCTTTCAAGCACGACGGGCCTTTCACGATCATCGAGTAACGCCCCTTCATCGTTAACAAAATAATCATCCTTGGCAGATTCCATATGTCTGGTCCTTCTTATACGCAGCCTCTGCTATTAATCAGCATCTCCTTAGGGTGGTATCAGGACAGACCACATCCAGCACCGCATCCCACATGGATTTGAATGCCATTAGGACGAGTCCTGTCTGCCCAGGTCTCCAGCGTGCCCATGTCCTTTCAGGCGGCGGGTCTGGTCATCAAATGGCTTTCGTTGCGGCCTCGTTTAGCGCCTGCAATGCCCGGCTTCACCTCAGGAACGTGGGCAACTGAGCAAAGCAACCGCGCAAGTGGTGCTCCACGACACGTTATGGGACTGGCGAGCCATCATCAGTCAGCCGAGGACATTTGGGTCTTGGTGAGCTTCCGAAGGCTTCAGCGACGTGTCCACCTCCACCGTACGCACAGAGAAACGCGCCACACTCTGGCTGATGACGGCAATCTGAGCCTCACCGCTTACCCCCGCCTTAACCAGTGCCTGAGTACTCGCTGTTGGGTTAAACGTCTGTCGCTTCAGCCGCTGCCGCCTGCCAGCCCGGCTCTGGACAGACCAGCATACGATCTGCCGTTCAGTCCCGCCTGATTGCCTCGCTCAAGGGGATTCTTCTGGCATGTTCACTTGTTCTTTCCGCTGATACCAGGCATACTCCAGGCACCGTCCGCCACCGCCAGCGAGGTGGCGCGCCTACAGGAGCAGCAGGGTACGCAAGCAGGCACCGCGAGAACAGGGGGAGCCGCTAGGCCGACAGGAGTGCTTGCTGCCCCTGTTGCAGCAGGATCATGGACGGGACTTTACGCCGCCTGCAAGCTGCGTACCCTTCGGTGAACTGTGCAGGCAGCATACCGCATGGCGGCTTTATACTCTGCCCGACTAGAAATCCGCCATGTCTGTGCAGCCGCTGCCGTCGGCTCAGCACGACTGTTCCGACGACTGCCGCATGTTTTTCGCATCACTTTCGTGACAGAGACTGACGCCTGACTTCTCTGGCCATCTGCTCGTCAAATCTGAGCATCCAGACCCAAATCAACGACCAGATCGCCTAAGCGGGTTCAGCCATACATCTACCTCCTCCTGCGATCCCTTCTGATACTGTATTCTAGCATTACGTTCCTCCGTCATGTTCACACATCCGTGAAAGGAAGCGGGATAACTTCATTCCCGTCCGTAACGCACGGCACAGCTCCGGCAAGCCCTGCACGCTTTCTGCATCAGCAACATCATCTTCAGGCTTCGTCAGCCTCGCGCAGGCCGGTCGTCAGCAGACTGAAATGCTTAGGCAGATGCATATCCGGATCGCGCTGAAAACAGGCTGAGCACGGTACGTCACGCATAGGGAAAATGCATATCCGATAGCAGACTCATGAAAATAATGGGTACTGTGTTAAAGCGTTCAGTCGGCATGACCGTGGATGACATCCCGGCAAGCAGCAACGCACACCAGTCGGGTCTCCCCATCGCCCGCGTTTCCGCGCAGAAGCGCAGCGCCGCGGGCACAGTGCTCCGAAGGCAAAGAGGAGCGGGGCCGTCCTCTGTCTGTTTAGGATGGTTCACCACAAACTCATACCATACAAGCCGGTACACCACGTTCAGCATGCAGAGAATTGCCTCCGTGGTAAAGTATACTAGCACTTCCTGCTCAATCTGTTTATAGGTCGGTTGCTGGACGGCATCTGCGTCTGTCGTCCACTGGTTATGCCAATGACAGCGCCATAGAAACGCGCCGGTTCGTAATGGCGTCTTCCCACAGTAGACTTCTTCCGCTTTAGGTTTGACTGCGCCTGTTCTGCCTGCCCGTTCATCAGGGCGAGATGCTCGTACGGTGCATGAGGACAGTTCCAGAAGCGTGACGGTCACCCGTTGGTTCACTGATTCAGTTTTCAGGAACATCGCTGACTCTCCGGATTAACTGGCGTAGACCCACTTTCTGCAACCGACGCAGCAAACTCACTAAGTCCGGATACAACCGGAATGTTGACTTGCTCTGCAGCAACGCGTTCACGTTGGGTCATACCACTGACCGACACGGTGGCTTTTGTTTATCCGCAGACACAGCGCAATCGACACCTCTGGTCGGTTACCCTCCGGTGGAAGGCCACGTCAGCGTGGTGCTCTGCTTTCATTCACGCAGGTGCTGGCAGGCGTCACGTCATCCGGTTGCCGCTGTTACCGTGCTGCGAGTGTCTGCCATCGACGTCCCACATTTATTGATACTTTCACATTTAGGGTGATCACTTCCTTCCGTGCGCCGAGATAGCCGAAGGCCAGGCGCTCACGAGACACGAAAAGGCAGCGAAGGATGCCGATGCTGGAACCGGTTTGCTCGGCATATCTCGCTTCCTGCCTGGCCGCCAGCGACGCCTGCTTCCTCGCTGCTCTCGCCTGCATCCACGCCAGCGTGAAGCCTGGTATCCCGGCAGATTTCCCTGCCCGGTCGCAGTGAGTCTGCATCTTCATCATCGAGATAGCTGTCGTTAGGGACTCAGCGTCAGTTCACGCCATGGTGAGTCAATGTATGTTGACTTTGCGCCAGACGCGACCAGTCAACGTCTGAAATGGATTCGCGTAAGGGTCACCGACTCGCGTAGCTAACCCACAGGGTGTCCAGCGGCACCTTTCACCGGCATTGTAGGATTTGGTACAGGCAGCGTCCTCACATTTCATAGGTAATGACATAAGTCAGATCGGCTGAACTCCACAAGCCCGCATCATCGTCTCCGCCGTAGTCAGGTCGCTGGTGGCCTACACTACTGGTACGTAAATCTGTACCCGTGTAAGGGATATCGCTCATCACGATAAATCCATGGGATTCCATCCACGCAATCCAGCTCTGAGATCCGGCACCTGAGCAGGCAGGACAAACTTCGATATGCCTCCCGCTGCCTAGGTTATATCGATGTCCAGCTCCTTCGCCCGTGTATTCAGCGCCGGTGAGATAAACGGCAACTGCCGCAAATCCGCCTCATCAAACAGCGGGGCGACCAATGATGATAAAAACGTTAGCCCAGTGTCATGCTGCTTTCTCCAGTGCATCCAGGTCCGCTGCACCGAGTTCAGTGTTCATCGCTTCTGCGCGCTCCTCGATTCCTTGCCTTCTGCCGAAAGAAGGCCACGTGCAGGGTCCCGAGCTCGCGACTGGTTTTGTTTAAACGGTTGGTCAGCGGCAGGCCATCGGGATTTTCACATCAATGGGTAACGTTTTTCCCATACACGCTGCATGACATGCCACCGGCCATTTTCAGTTGCTGAATAAACGCACCCGGGGAACCGACGGTTGGCCCACAAGCACTGCCGCCACCTTCAGGGATGAACGCTGCCCTTTTACGACGCCTGCGGCTAGAAGGGACAACCAGCGCATTACCCATAGTACTTTACGGCAAATCCCCCGGTTACTTTGATTCTCAGCGTTTGATTTTACGTGCTTTTCAGCCTGGCCTTTCCGTCAGTTTCCGGCGTACCTTGTCTCACGTCGCAATACTGTGACGCCGACTGCGATATCGCGGATGAAGCAACGCGGTTAATAGGCCATTGCGGCGGCAGGCACGCCGTTTGTCGATACGCTGAGGTTTTCAACGGCCTGCTCAATACTTTTATGGCCATACATCCCCCTTTCAGCGGGACGGTTAACGGCAGGCGGTACGCGTCCAAGCCAGATGACACTTCCGCTATCATCCGGCGAAACCCGATCTACCCAGAATTTTCCTCACGATGTAGTCAGCGTGTCTCCACGCAGCAGCTGCCGCACCTCATCAGTCCGGACAAACAGATGACGGCTGAGGCCTTCAACGCACGCCCTGTCCGGCATAGCCTGATATTTCATCAGGTCATCAAAAGGATAACACGAGAGCACCGCAGTAGAACGCTCACCGACGGATTGTGAGAGACCGCGTGTCTGCGTTTCTATCGCGCCTGGCGGGGATGGAGGGAGTGCGCAACCATGTTATCGCAAATCAGCCACTAGCCCGTTATTAGAGGTTGTCCATAGAGGGCGTCATTTCGGCTTGAGCCACACCAGGCGCAGACAGGAAGCCCGTTGCTAGGGCAGAGCACAAATGCACAATTGCTCAAGATTGAGTCAGGTCGATGGCGTGAAGCTTCACCAGTGCAGGCTCTCAGTTGACTCGATTTCATAACTGTACAAGAGTCG
>91
CAGTGCTTGGGTCTACCGCCGTCGCATCTTTATCGCACAGGAATTCCTCCTGTGCCGACAGCTGGCGACGTTGCCGCCTCCTCCAGTACCGCGACTGACTCTCCGCCTTCCACAAATCCCGGCGCTGCCTGATTTGCCATTTGCTCCGGCATGCTTCTCCAGCGTCCGATGCGCCTGAAGGCGTGCAGGGCAGCATGAGCACTGTCTTCCTGACGATCGCCCGCAAGACATCTTCACACGCTGGACTGTTTCGGCTTTTTCGCCGTGCTTCATAATCCTTTTCGCCTCATCACCGTGTTGTAATCCTCATGCACCAATTTCCCTTTTCCTTCCTCTTTCGCGTTTCTTCCTGACCTCTGCGTATTTTCTCCATAAGGGGTGCAGCAGGGTCGGCCACCCTGCCTGCGCTGCGATATTTCAGCCGTACGTTCGGTATCGCTCTGCTGCTTGGCATTTGTCCTGTTGAGTCTGCTGTTCAGCCTTCTTTCGGGCGGCTTCTAAGCGCAAGACGGGCCTTTCACGATCATCCCAGTAACGCGCCCGCTTCATGATTCCAAATAATCATCCTTGGCAGATTCCAGATGTCGTCTGCTTGGTAACCTCGCAGCCTCTGCTTAATCAGCATCTCCTGCTAGGTATCAGGACTAAGTACAGGAGCACCGCATCCCACATGGATTTGAATGCCGCGCATTTAGCCCAGTCTCCATGCACGTGCCCATGTCTCTTTCAGGCGGCGGGTCTGTAGTCATCAAACCCTTTTCGTGCCTCCTCGTTTGCTCGCTTGCAATGCCCCGGCTTCATCGCCGGAACGCTGCACTGAGCAACATCACGCAATGACCTATAGGACTGGCTCAGCCATCGCCGTCAGCCCCGACGTCGGGTGTGGTCAGCTTCCGAAGGCTTTCAGCGACCTTATTCCTACCTCCGCCTGCCCTAGGGACTCCGCGAGATTCGACGGGATGGACGCAATGAGCGCCAAGCCCCGCCTTAACCAGTGCGCTGAGTACTCGCTGGTCTGGTTAAACGTCAGCCCTGCCGCCTGCCCGGCTCTGGACGACCAGCATCACGATCTGCCGTCAGTCTAGCACGCATGTTAGGAAAGACCAGGGCTCCGTTGTTGAATGGACAGGTAGATCAGTTGCGATAGCTGATACCAGGCATACGCCATAGGCGCAGCGGTCGCCACCGCCATAGGCTAGCCCACCATCAACCGGATCGCAAGGGCAAGCCCCTGAACATGGGATCATCCGCCGACAGGAGTCCTTCACCCCTGTTGCAGCAGGATGACGCCACGGACTTGCCCGCCTGCAAGCTGCGTGGCCACGTCGGTAGAAACTTTGAGCAGCGACTAAGCCGGCTTTATACTGCCCGACGGAAATCCCCGCTTTCTGTGCAGCCATGCCTGTCGGCTCAGCGACTGTTTCACGACTTCACTGTTTTTCACCCATCTTTCTCGTACCCCAAAATGACGGTACTCTGGCCATCTGCTCGTCAAATCTGGCCGCATCCAGACTCAAATCAACGACCAGATTGCTACCGAGCGTTGATAAATAGACTCCTCCCTTAGAATCGCGTGGGTAGATCAGCGCGGCCGTACTAAGCGTCGTTACTATCACACGGGAATAGGGGATAACTTCAATTCCGTTAAGTAAGGTACAAACTAGACAGGCAAGCCTGCCCGCTTTCTGCATCAGCACATCATCTTCAGCTGTCGTTCACTCGCGCCGGTTCAGCAGACTGAATGCATGAGCACAGATGCAGGACTGCAGAGAAAAATCATAGTGAGCTCGACCCTTACCGTCAGCCCGGAAGTGCATATCCAGCAGAACATCATGAAATAATGGGTACTGTAAAGCGGTGCCAGTCGGCATACTCCGTGATGACATCCCGGCAAGCTTAAGCACGCCAGTCGGGTCTCCACATCTCACGCTCAGTTTCAGGGCACTCAGCTCACCGTCGAACACTTTCCCGCAAGAAACAGGCTCTGCGGGCCGCTAGTCCTCTGTCTGTTCAGGGCATTATTCACCACAAACTCATACATACCAGACAGCCGGTCACAACCACGTTCACGCATGAGAATTGCCTCCGTGGCCAGGTGGTAAGCACTTCCTGCTCAATCTGTTTAACGTTCATTCATGGACGGCATCTGCGTCTTCTTGCCTGGGTGGCGCCGCGACTTCCGAGGAGGCAACGCACGGTTGATGGCGTCTTCCACAGTAAACTTCCGGTTGGTGTCTGACTCCGCCTGTTCTCCCGTTGCCGTTTTATTCAGTTCGTTCAATCCCGCTCGATTACTCAGAAGCGACGTGATACACGTTATGTTCACAACCGACTTCGGTTCATAGAACATTAGTACTCTCCGGATTAACCCGGTACGGTAATTTCTGCAACCGCAGCAAACTCACCATTACCGATACAAACGACCGGAATGTTATCTTGCCTGCAGCAACGCTTTCTACGGTATGGTCATCACTAATGACCGACACGGTGGCTTTGTTTATCGCAAGACAAGCACGAAAGCTCCCTCTTTAGTTACGCCTCCGAGCTGAAGCCACGGTCAGCGTGGTGCTCTGCCTTTCACCACCGAGGTGAGCATGAGGATCTAGTCATCGCATGTATGCTTTACCGTGCTGCGATCTTCTGCCAACGACGTCCCACATTGGTACTTTTCTAGGTTAATATTCCTTCGGTCACGTCGCCTTACCGATACTGCTGACTCAGCCACAACGAACGAACATTGAATGTCGGAGGGAGTCGCACCGATGGCATCCTATTCGCTGTAATGACGCCAGCAGCGCCTGCTGCCCCTGCTCTCCGGGCATCACGGGTCGGCGACCTGGTATCTCCGGCAGATTTCTGCGCGCGCCGTAGCATTCTCCGTCTGCATCTTCATCATGAGATAGCTGTCGTCATAGACTCAGCGTCAGTTCACGGGCGTCAGGTCTTTATTTTGCCGACGCGACCAGTCAACGTCTGAAGGCCAATTGCTAATGTATAGATCGCTCCCTTATAAACCCACAGGTGTCCCGGCACCTTTCAGCCGGCATGTGTGGGATTTGGTACAGGCAGCGTCTCACATTTCATAGATGACATAAGTCAGATCGGCTGAACTCCAAGCCGCATCATCGTCTCCGCCGTAGTCAGCTCATCTAGCTCATACTGGTGATCAAATCTGACATGTGCCGGATATCGCTCATCACCGATAAATCCGGGATTCCATCCACGCATCCAGGCGGAAGCACCTGAGCAGGAAAACTTCGATATGCAGCTCCGCCGAGAGCCGAGTTGAGGTGCCGTGTATTCCTCGCCGGTGAGATAAACGGCAACTGCCCAAAATCGCCTGATACACTCGCGGGGATAGGCCACACTCCTTCTACGCTGTGTTGAGTGCTTCTCCAGTGCATCCAGTACTATGCAACCGACAGTTCAGTATGTTTCATCGCTTTATTACCATTACTCTCAGTTGATGCTGCAGCATAGCCCAGCTCTTTCGGAAGACGTTCACGCTGTATCCGCTCAATATTTTGTTAACGCCGTGGTCAGCACTCAGCGACCCATTTCACACATCAATCTAACGGTTTTTCCTCAGCCACTGCTGCATAATCATAATCCTATTTCAGTTGGAATAAACGCATGGTGAATTAAAGACCGACGTTATCACGCCGCCTCACTCATGCCCTTTCAGGGCCGAACCTGCTGCCCTTTACGACGCCTGCTATAGCGAAAGACGACAACCGACAGTGACGAGCGTATTACGCTGAAAGTTCCCGGTTATTTGAATTCTGCTCTGCCTATTTTGACGTGTAGTGGCCAGCTCCGTCTTCCGTGGCCCAGATCCGGGGCCCTTACGGGCAACCTTGACGCCGTAGAACCGCGACTCTAGGATGAAGCAACGCGGTTATATCATTGCGGCAGCACCGGCGCCGTTTTGCTGATACCCAGGCCTTTCAACGGCCTGCTCAATACTTTTATCATACTCCCTTTCCTCGAGCATACCGTCTGACTCAGCAGGTCACGCCCCGTCCAGACATAATCATAAGACGGATGACAACTTCCGCCAATCACCGTGAACCCGATGCGTACCCCAAATTTCTCACCTGATGGTCACTCGTCTCCACGCCGCAGCTGCAGCTATCAGTCCGGACAAACATGAACGAGCTCTTCAACGCGCACGCCTTAATGATAGTATTTTCAGGTCAGTCAAACATCACGTATCACCGCATAGTGTAACCTCACCGGATGTAATGGTGTATAGTGACGTTCCCATGTACCCGCGTATCGTTTCCATCTACGGGCATGGCAGCATCGAACAGGTTATCCAAATCAGCCACCTCTCCCGTTATTGCATTGGCCTAAGCGCTGGTCAGTCTCGGCTGCCACACAGCGGCAGAGACACGAAACGCCGTTCCCGACCAGCACAAATGCCACAGGTTCATCCGCCTGTGAACAGGTCGCATCAGTGATGCAGCTTCACCAGTGCCACACGACCGTGACCAGTTCGACGTATCCAGAATCTACGGTATTATCTGCTGATCCTTGTAGGTTCCATCATTCAGGGCCGGAGTTCGACACTTTCAACTGTCCTGCCCGCCTTTCCCCTCCTTAGTCATGGCATTTCTCAGTCACTCTTTCAGCTCTGCCACGCTACCTCAGTTCTTCTTTCGTCCCCGTTGAGCTGACATCACGTTTAGTTGTTCACGGCCGGCCCTATCTTGAGACGGTGGCATGTTCATCTTTCGTCATGACTCCTCCACAAGAAACAATGTAGCACCCATGATTACGCCAGTTGACGACACGACTCATCACTGGTTACTCAGCAAGGCATCAGCGGTTAGACTGAATCATGGTAAATCACGCGCTGTACGCCGGTGTCAGTTTTTGGTAACCTGCGGGGCAGTGGTAGTCACTCTTCGCTATGTCGTGCCGCATCCTGAATGCATACTAGCCATTAGCACCGAATGCGCTGAGTAGTTCCACGGAGCACCGGAGGCTTACAGCAGAAGTTCTTTTGACGCCGTTTTCCACGTACCTGTCGGAATACTAGACGGTACCTCACATCATCCTATGAGTGACACTGCTATCACCTTCTAAGTCTTTCACGTCTCCACTGAATTAGAGCCACTACGACTTATCCAGCTTCCTTGACTCGTTTAATGAATAGAACGACAGCGCCTCCTTTCGGATCGAACACGTATGATATTCCTCACCACTCTCGTTCCTCTCGGTGCTTCGTATGTTCTCTTCGTCGTAACCGTGACTTTAAGCCTTGCTCCACTCCGTTACGCTGGCATGATCTGGTTTATTCTCTCTGCGACCCCTCTCTGTTATACCTCAAACCGGATCTAAAGGCTTCACCGGTCATGTGTATCTTGTTTGATCACGACCAAACTGCCTGCATCTTCCCACCCAGTAGCAAGCCTTCGTCACGCAGGGTCTGCATGATGATGCGACGGCGTAAGTGATAGGTCCGGATAGATTCTTCAATCTTCATCCGGCATGAGGACGCAAGGTTATCTTAGATTCATTCATGCTTCGGCTTGTGACATATCCCGGCGTAAATTCAGCTATCATCGCCACGGAACGATATCTCACCGACTCGTGAAACGTACCTCATGTTTACCGGTCCCGGAATTTGTAGATAGACTTTCTCGTGTGAAGGGCAGGTAGTAGCGCAGCAAACAGCAGAATACTACCGTACGTACATTTTCTTATGCTATTTGCCTCACTCAGTTGGCGGTTGTACATCGACATAAAATCCCCGTAAAAGCTCAACATAGGCATCGTCATGACTGTAAATATAGTTAAACTACATTATGAATTGCCGTCCTCCTGGATTCCTTTCTTTCCTTCCTCTGCATACTCCCTCCGCCCAAGCACATCCATAACGAACTCGTTGGACTTTCACGTCTACCGTCTAGCCGGGTGGGTCAGCAGCAACCAGGCAGAATGCCAACGGCAGCACCCTTCCTTATGATGCACGCAAACCAGCTTCTATGGAGGTGTCCAGCATCATAAGCTGTATATTGCATCTAGGTGCTTTGCAGCTCAATCACGGGCCAGTTCGGTATGAGCCGGTACTTATTTCCGTAGGGTAATGGTACTGGTTTCTTTATGGTCATAAACATCCCTTTACTGTGTGTTCTATAAATCGTTAACGGCATCATAATGCCGGGTTATGCAGCCGGCCTTGCTTACGCCTGCATCACGAGCCGGTGCACCCACTGTCTGCCTCGTGCATCTGGTGCTGTGTGATAGAAGCGCGTGAGCTTACGTTTTCACGTTATACCGGGGTTTCTTCAGCACGGGGTCATAATTTCAACGCGTTAGTGCTCTCTCCACAGTTTACGATCCCCATAATTAAGCTGTTTTCTGCCCGGCAAATTGCCTCGTATTGGCGTTCACGGGCTTCGCTCATCCGTTCTCTCCGTCCTTAATACACGTCAGTAACGTCAGCCCTGCGAAGCAGTGTGGCTGAAACAGTTAGTTGATAGAGTCTCTTGTAGATTCTCCGCCTACGGGGACGGATTCCTTTCATCCGTGCATGACTACTAAGGACGTGGGGTACTCACCTTGCTGTTGGTATAACAAGTTCATCATGAGTCCGGCATGATCGCTCCTGACCGCTGTACAATGCACTCTGGGTATCCAGCACAACCTGCGACTAACGGTATATGCCTACTTCTAGCAAACATTATCTAGGGTTGCGTCCCATCCGGGACTGCATGTCTCCGAGACGTCATCCGGGACATCTATGTAGGGTTGCTATTAGCTTATCGCTTAGCTGTAAATCCGTGATTTCCACCCTGTTTCTCCAGCAGCACCGTAATTTACTGTGAGCCATCATGACGCCGATGGCTGGGTCGGGCGTCTGCGTCAAGAACTCGGGGAGGCGGCACTGGCAGCAACCGTACCTGGACTGCAGTTCTATGTCGTTTTAAGCTAATACCGGTTTTATTTAAGCACCGCTATACTATCCAGGTACTTTAGCAAGTCAAATGCCCCTCATCCACCACTGCCGTGTCCTATATCTAATAAATCAGTCCACCATCGACCCCGCAGCCAGGCGAGGTAGGAGGCAGAACGCGTAGTAAGCCGGTCAACTCGAGCTCCGGGGCAGCGCGTTCCATTTCCTCCCCGCGCGTGCGCAGGGCCCCGGCGACAAGGCATCCGAATTCGAGCCAGCTACCTTACCAGATAAATGCGTGCTTGAGGGGCTATCATCACCGGATAATGCCAGAGCGGTGCGCGAGTGCCTCCTGGGCAGTCAGGCTTCACCGACGACCCGCATCAGTCAGGCTGCATCCCAAGCCGGCCTGCAAAGGCACAAAGAAACTACCGAGGCGGCGCAGGTTCAAGGCATCCCGGCTCATTAAAGCCATGCTGGCAATATGCGGAGATTACGCAGCTTAGTGCTATTCGCTCCCTGTTGATTTGTCGCAGCCCGGATCAAATGCATGCCTCGAGGCGGGCGGTTGCGACCGGCTGCACGGAGGGGCTCATCGTTTCACGACCTGCTGGGCAAAATTTCGATAGTCGTCACCGTTGCACTCTTCTCGTAGATGAGTCCGGCTTCTATCAGCATCACCGCTTCCAATTCTTTCAGACCATCGAGCCGGCCAAACGAAGCTGGGAATCCAGGAGTGCAGAAGTTCCCAGGCAGCGGCTTCCGAAGGAAGCGCGGCCCCTTGAAGGTAACGTCAGAAGCGAACGAGCCTTCTTCCAGCCAGCACAGAAGCGCTCCCTACGCCGTTTCTACGGCATCCATTCCGCCGAGGGACCGGGCCCACGACTCGTTCGCACTGGCCGTGCCGTGGAGGCTATGGCGCTCATTCTTGGATTCCGGGGGAAGCTGCTCACGAGACAGCCGAGCAGGATATACCGCAGCAGTGACTGCTCAAACACGGAGCCCGTTATCCGTATCGGACAGCCGTCTGCAGTTCAGTGAGTCAGCGGAGGCATCAGGTGCGGTACTTTGTGCGCTCCCCAGCCGGACCGGCATGCAGTAGGGGCGTAAGCGATTTATCCACCAATCCAGCCGGTCAGCCTTTCCGCTGCTCCTGACCTGTTCGCCCAGAATAAATCAGCCGTAACCGTATGCCCAGCTCACCTCAATGGTGGCGCATACATCGCCTTACAATGGCGCTCTGCAGCTGCGTGTTCTGCAGCGTGTCGAGGCATCTTCACTCTGCTCCATCTAAGTGTAAACACAGTGCACGCGAGTCTGCCGTCGGCGCGACTTACCCAAAACGAAGAATGAAACGAGGAGGCGCGCCAAGCCGGGGGTCAGATTCACGGTTCAGGTACAGCGCGGCAACGCGTCCGCCAAGTAGTAATACCCAGCGCCGACGAGCAATTGCTTCATGCCTCCGGGTCGGCCGCCCACCCGCCGCTTTCGCAGCGTGCCCCGGTATTGTTCGGGTTGCTGGATGGCCATTCGGCTGAGACCAACTGTCGGAAAAGCCGCGACGAACTGGCTCCCAGCCTGAACCCGACAGTTCACCGTTAAATTAGGAGTGCATGGCCACACCTTCCGAAGCATCATGGGCTCGTGCGTTGGGGCCAACGTCAATGCAGCAGCAGTCATCCTCGGCAACTCTTTCCATGCCGCTTCAAGCGCGGGAAAGGGCACGGGCTTCTTCCTCCCGGTGGGATAAGCCACGCCAGCTTGGAGGATCAACGGCCCCGGGAAAAAGACCCGACGATATAATCCTGATGCAGCTGGATTGAGGCGGCAGAGCGTTATTGCGATCACAGAAGCGGGGTCGCGGAAGTGCCCGGTAAAGAGAGGGCAAAGAGGGCTGCATCAAGTCTCACTCGTGGGTTCCACGAACCGCAACTGCCCCAAATCCGCTGCCACCGCCGTGATAACCGGCATATTGCCGCAGCGTGCTATTAAGTCCGTAGGATGAATCTGCCGTCCGTCAGACAGGGGCGAAATCGGGCGTGAGTGCGTACAGATCGCTCCTGCGCGCTTCTGCACTTCCCGACTCTGCAATATTTTCAGGTCAGACACGAGTGGAATTATTCAACTCCATTCGTCCGTCTTTCTGTACTGTTGCCACCGTTTACCGTCGTCATCACAGGTCATGCAGTGCCGCACGGGCAGCGGCAAGTTCTTCCTGTCTAGTCATTCATCTCCCTCCATAAGGCACGGCGTAATACTGCCAGTGATGTTCTTGTTGTTGCTGCACCATCCTTCCTGCAGGCTCAGCAGCGCAAGGCGATCCAGCTGCCAGGGGAAATACTGATGCGCAGCGCCGCCGCATAAACGAAGGGCAGTCGAGTGCCTCATTGCGTCGCTTTGCTGTCCACAGTACTTTTCCCTCCATCCAGAAGAGTGTGCGGACGCTCTTCAGCAGAGTCCGCCTGCTGCGGTCAGATTACAAAATACGGGTTATTTCGGGAAGTGAACGCACCGGAAGCGTCATGCTCCCCTTCAGGCGTCATGTTGAAGCGGTTATAATCGCTCTGTTCGCGGTATCCGTACCGATTTCGGTAAGGTAAAACCCGTTTTTATTCGCTTACGTGGCATGCTGAGGATTTTCCGTAGACGATCCCGTAATGGGGATGACAGGGACACCGCTGTTGGGGCGCCTCGTTGCTACAGATGCGCGTAATGCGCCAGTATGCAGCAGATACGGATATCGACATTTCTGCACCATTCCGGCGGTATAGTTTTATTGATGGCCTCATCCACACGCATGCAGCAGCGTCTGTTCATATCGTCGTGGCGGCCCATAATAATCAGTCAATCAGCCAGCTTTCCTCACCCGGCCCCCATCCCCATACGCGCATTTCGTAGCGGTCCAGCTTAGGAGTCGATACCGGCGGTCAGGTAAGCCACACGAGAGTCAGGAACGGGCTGAATAATCCTCTTTCCGCTGCCATCACTTCAGCATGGACTATCCCAAGTTCGCGGTCCCACGAGTCGCCACGAAGGGGTGATTACGAAGGTTTACGTTTTCCGAGTATCCCTTTCGCTAGTTTGCTCCAGTGTTGACAATCTGCACCGAGGTGAACGGGCTGTACGCTGTCCAGATGTGAAAGGTCACTGTCAGGTGGCTCAATCATCCTCTTCACCGATGACGAAAACCAGAATCTGCCATCACGGGTCCAGATCCCGGTCTTCGCAGATAACGGCATCAGTAAGTCGAGCTCCGCTGGGGATGACGCAGGCAGTGTAGCCGCAGAGTAAAGCAGAATCTGGAGCGTGCGCGGCTTTAGGGACGGCGTCTCTTTGTGCCCCAAATTTAAGATACTGCTCCCTCCCGCAATGCGGGCAGGCAGCACATGAAAGCATAAAATGCGGGGATTCACTGAGCCAACCGGCTCAATCTGACAGGTGCCTCATTTGGCGTGGAGCCACCTAAGGACCTAGATGACTTTACTCTCAAGCCGATATCAGGACCCTTGTTCTCCAGGATTTCCCAATCAGGTCCAAAAGCAGCAAGAATCATCATACCCGCCACATCCACCGACTTTCACGGTAGTTTGCCGCTTTACCCGCCCAGGCACCAGAAGCCACGCCCATTAGTGAAACGCTTCATGGTGAGCGTGTTGGTGCTCAGATAGAAATCCTGTTGCCAACAGGCCCTCAAGAGGGCTACGAATATCACGAATAGTCGGCTCAACGTGGGTTTTCATAAAGTTCTCGGCATCACCATCCGTCGGCAACCAGATAAGGGTTGCTATGCTTATGCTCTAAAGTAGCATAAACACCCCAGCAGCATTTGGAATAACCTGACACGGGCAGACTTCACCAAGTCCTCATCACGGATGTTCCATCCGATCTCGAAGGAGGTGCTGCTCGCTAACCGGACGGGGGTTTCCCAGCGCCCTTCCTGGTATGCGGATTCTTTCGGGAGATAGTAATTATAGCATCCGCCCATTCAACGCGGTTTGGCTCCAGGAACAGGCTTACGAAGCCCGGCGCGGACAAATGCCGCAGCCTGTTAATGACGGTATGTTCGATATTTCACTAGCAACCCCGGTATCAGTTCATCAGGGCGGCTGCTTGTTCATGGCTTTGATGATATCTAGTTTCAGGAAATCAACATGTCGTTTTCTGAGTTCCGGGAAAACGCCTGCACCGACAGGGAGCCCGTCGAGATACCGGCATTGCCCGCGATTGAGAAGAGCACGAAAAGTACAGAATTGCGGTTTCCACCACTTCGGATGTCTTATCTCTGGCATTCTTCAGTTCCTGTGCGTCCTGAATCGTGCGCACGCGTAAGTCGACCCGTTCGTACTCAATAGTTCCTGGCTCGATTCTGCTCGCTGGCCTGCCGCAGTTCTTCAAAGCCTCCGAGCGCAGCTTTTCGTTCTCAATTTCAGCATCCTTTGGGCATACCATTTTATGACGGGGCAGAGGTCAGCACATCACCTCATTACCCTTGCCACCGCCTCCCGACGGGCAATTCTCAGTTTCCTGCGTTTCCTCCTTCGAATGGTACGGATACTCGCACGAAAATGTCAGCCAGCCGTGTTGTACTCCATTGAATATTCATTCGCACGGACAAAACAGAAGGAAACGACAGAGGCCAAAGCCGCTTTCAGCAGCATGTCGTTCCTTTTGCGTCTCAGAGGGTATTTTGTAAAATAAAAACATTAAGTTATGACGAAGACAGAACGGAAACGCCTTAAACCGGAAAATTTTCATAAATAGAGCGACCGCGAGGTCCGCCATTTCTCGTCC
>92
AGGGTCCTTGGGTTGTGACCACGATGACAGACGGTGCTGCGGCGTTTATCACTACAAGTCAAACAGCTTTTCCAGCAAACCCTTGCCGCAGAAAGTGAGGGCAGTTCATTGCTGGGTCTGTGCCACGTTACACAGGACCATTAGCGAACGTCCGAAACATGGGGCTCGGGTATCGCCCGACCGTAAGGGACGCTCGAAATCGTGGCTCCGATTTGCATCAAGCCGTCACGGTGAACAACGGGTCAGCATGAAATCGGTATCACGTTGGATACTTGGACCATAACCAGCGACTGATGCGCGTAACCGACGCCGGAATTACCAGATGACGCTCCCGTGCTTGTTCACTTCTGCTGACGAAGATCGTGATTGGTCGATTTTCCGAAGCCCGACCGATATTACGGTTTAAGCTGACAACTGGCATCCAACAGTACAGTTATCATGAAAAACACCGGGTGAGTCGGCTCACTCAATCACCCGACTAAAAAGGTCACTGCCGTGGGACAGCAACGTGACTCAGCAAGGGATAAGAAACCACCGGATTCATCCCCACGCTGCGGTGTAGCCGCGCATTTACTCCCCGTATGTTCAAGCTGTAATCTCAGTGCTGTCGTAGCCGCAGGACAGAGGTTTAGTGCAACAAGACGATGGTGCAGTTTCAGTTCGTTGACGGGCCGGGTTAACTCAGCGCTCGGTGCGGTTCTTTAGGTTTACGTCGACCGGACAGGGAAACGACGACCGCCCTTCAGTCTTTAATTCACGAGACCTGATGACAGGTAAACGCTCAAACATGTCACAGACCGACGACTTTATTAGGGATCTACTTCTGTGGATTTGAAAAGTATCGGTTGAGAAATTAAATGAAGCAGTACACAAGGCATTCACCGTGCTAGACTTTCACCGTCACGTGGTGCTAGAGCGATTCAATCGAAACTCGATACATACATTTCCCACCCCTGCTGCGCTGAATCCAAACCGGCAGCGTACGTGCTTCGTTGGTTCGTTCGCCGGTATATACGGCAGGATCCGGCTAGAGCACAGTCTCTAGTAGCGACGCACCGTCATGAAATTCAGCGCTCTACTCCGCAGCCCTGTTCGGATTTATTTAATTCAGCGGACACCATTTCCACGCAAGACCCGGCTCCGCCAAATTTTGATTCACCCCATTAGATCACTAATATCTATGGGTCTAGCCTCTAGAGCCATTGCTCCAATGTCCGTGCTCGCGGTACACCGCGGTATAGAAGAAGCCCGAGTGCCTTTCCCGCGGTCCAAACCGTCAATGGAACAGGCTATTGCGTCGTTACGACTTGTTGCAGTGAATGTTTAATAGAACTAAAGAGCCCGTACTTACTGATCTCCGATGAAGGCTTACTTAAACGCGCTTTTAAAACGGCCCAACGGCCCGGTCTACCTGAGATATACCGCTTTCGTCTGCGCCGACACATGAAATCGCGCGGTTTAGTTCAGCGAAGTTCTTTTGATTAATCATACGAACACAGCGACAGGGAACTTGCTTGGTTGGTTAGGCAGATTGACAGCCGCGGCGCTGGTACAGCCACTAGAATGGCCATCTTCGTAGCCTGAGACTGCTTAACGGACCCGATACCCTTATTATCCGTATCTTCGAGCCAGCTCTGTCACGTTTGACGATAAGTTCACTGAATCGTGGCGTTAACGGGCAGATCGGCAAATCGCGGCTCTACGGCTGAGCAGTCCTTCAGGCGCTGAATGACAGGCGCTCGCATACGATAATGAAACACGGATGCTGCACAGTTTACCCGTGACACCGTTTATCCCTGATACTAGTCCGTCTCTTAAGTAAGAGATCTGTCATGGATTTAGTTCTGCGCGTTCTAGAACATACGAGCACTGATAAACGGCTAACCGCCATGGATCGAGCGAAATCGCGCTCCTAATACGCCGCATTACCACTGTGGTCGGGTAGGCAAAGATCCAGACTTACGCCATCGCTTCGATTCATACGCGCGCACGTCGTCCCACAAAGACGGCCGGTCCACCGATAAACTTATTCTCCAGTGGTACTGACCCACACGCTCCTATGAGCTCCGCTGCTCTTACCCGCCTTCTACTAGAGGCAGCTTTCCCCAATCGAATGACGACGATGGGTTTGAGGCATATCCCACGCCAACGGCCAGTCTAGAACTTTGTTGATATCCGTACCGTCCCTCCTTTCCGTTGACAAAACTCTAATCTTCAGTCAGCGGTTGATGCGTAGCGTTGCCCAACGGTTAAGCAGAATGAGGCCCCTAAGGGGTATGCTCGTGACGCTAGCCTGCAAAATGGCTGCCAGTTGCGAAGCCCGCAGTCGCCTCGTGCTAGAACTGGGATTGTAAGTTGTTCGGCTACGCTATGTTTCTAAGCTTAAACGACAGCCAAACCGTGATTTTCACCGTATCAACGAGCAAGCGTTTTACGTCCAGAACGGTCGTGACACTGTCCAACCAAGGTCAGGAAACCTGCCAGTTAAGTACGGGCGAAACGATGATGCTCGCTCCATCCCGGCGGATCTACGAGCCGCAGACGCCCCGACTCTATGCAGACTTCACTTGACATCTGTAGTTGCTTTAACAGCAACAGTTACGTTAGTACCAACCCAGCGAATAGCATATTGCGCTAATTCCTTCACTTTCGATGATCTGTTTTTAAGCGAATGATTGCTGTACGCCCCGAACCTAGCTGCGCGACACCTTCCGTGCTTTGCACTATCATCTTAAGATCAGTCGATTTCATTCCGTACCCAAAGCGCCACGTCTCGAGGCGACCCCAGGGATTGCCGATAGTCAGCCTAGACCCGTGCATTATGCTCGTTTAACGGACTAAGAATAAGACAATTACTAGATATGTTATCATATTTGAACGAAGCGATCGTGTGTCCGCCCTACAGCTGAATTACCTGTTCAGCGACGCGCGGTGTCTTTGCAGCTCATTGCGCCATCTAAGGACTGTTACAACGCATTATCGGCCGTCTAAATACTCCCATGTACTAGATCGATAAAAGCGGCACTGGGTCGGGTTTAAAGTGCTTCTAGGTTCTAAGCGGGGCAAGTGTACGCCTTACTGACATTCCTTTACCCATTTGCCCGGTGACATAAAACCGCTCAGGGGCGTCCGCGCCAACGGTTTAAACAGCACTCGGACTAGATAGTACCGTTGCTCGCCTTCGTTGCCTATTCGTAATCCCTCCCCGGCCTTGTACGCACCGCCCGTTCACGAATTACCTCATGGACGCATGGAGTCTGTTACATGGGCATTTACGCTGTTATCCGCGTAGAAACAGCGAAATAGATCGTCCTTACCGTCTGATTACATGGATTTGTCTTATAAGGCGAGTTCTACAATGCGTAACTAGTTTTTCCATTGAACGATGGTGCTAGATAAAGAAGCACGCGACGAGCCTGACCGACGGACCCGGAGAGAGCTACTCGCAGAATCGATTAGCTTACCCTAAGCCCCGGTGGATACCGTATAGCCGCAGTGATTAGTTAGAGGCTGATGAGCATGCCGAGAATCGGCTTGAGCGAATGGAGAGGCAACTACACGAGGAGCGTACGAGGTACCGCCCTTATATTGACCGCACTGAGATGGACTTATGAAGCGCTCTCTGAGTGTTGACATCAAGTAAAGAGATCTCAATCAACAACTGCATCGGATCCCGACTTCATCGCATTTACGGAATGAGAGGTCGATCTGATACTGAAGCGTCTAGCCATTTCTTATGACGTATAGAAACGCCAGGGCATGTTGTGCAGGGTCCAAACGGTTGTCAAGCCCCCGTTCACGCGGGAACGGATGCGGACGAAAACAGCTTGCATTTTGTAGATCCCCGGATCGGGCGATGCCACGAGGACGCGTAAAGAACAGAACGGAATGTGTGCGTCTAACCAAAATCTTCTTGCTCATGTGACTGAACGTTCGTTTGCACTCTAGTTGTAAGTAAGAGATCCAGCGACTTTGGATCGTCGCATCGTCTGATGCAGGGCAGCGCATACGGTGCTAGCGTGAGTTGCATGCAGGCATCATCGATCCGATGCTCCAGACGCACAGCAGCGACACATGACTAGATAGTGACGGTAAAGAAACAGCGATAGTTCATCAGCTCACCGTCTAACAGATTATCGTTACGCAATGGCCCGGATTTATCTCGTTGGACATCGCAAGTCCATCTATCTACCCCGGACCATTGCTGAACCGTACGGCCTAGATGCGGCCTCATCTAAGATAATGTGACGGTCCGTCGCCCTACAATTCTCTCGGCCACGGCTTGGCCTTGCGAGCACACGAGCAATGACTACGAATCGTTGACGATAGGGACGTACACACGCCTGAGCAAATCACTCTGAGCTGCTACGCCTAGTCGGCCTCATCGGAGGCTGCCAGGCAACGAGAAGAAAGCAACTCGTATTGGGAACCGGCAAGAGCACACGGGCCGACTTTACCCTCATCATTTCTTGACATCATGCCCCGTGTCTTTATCTAGATCGAGACTATAGGGAGGGGACCTCAGCCAACGCTCGTAGGCAAAGCGTGAGCAGGGAAATTAATATGATCTGTTTCTTCTGCGTCCCCCTCCGAGCTCCTCGAGTTAATCTAGAAACAGGTGGCTCGGCCAAATTCTGAGGACGGGTAACAGCGGGCGTACGTGCGCGAGGATTATTTCTAGCTAGTTATTTATCTCTTGTCGGGCATTGTTACTGCTCGAAGGTTTGTTGGGATAGGAGATCGAAGGAAGCACGCACGCACAGATGCCGGATTCTTTGCCTTATCCGGAGCGTCTGCCGCTCCATCGAAGCATGGAATTTGCTTAGCATTTATCTATTTATTAACCCTCGTTGCTGGTTCATATTCATGGAAAACAGCCGGGTAACGACCATAGCGGCCAAGCTCGTCGCCGAGATAGTCCAAATGAGGTTGCACAAGGGACTCGTCTTAGCAGGCAAATAAGGACCGTAATCCGTTCGTCCTGGCCGTACTAGTAATCAAGGGTAGAGAAGAGACATCACGCACGGACTAAGTTTGTAAATGAATCAGGGTCGCTACAAGCGGTAACATTAACCAAGTGTTGACTAAATGACGTTTCTTAATCGATTTGTAAACGCGTCACCCTAGAAACCAGGGGCCATGAGATCGAAACCTTAGCCGCTGGGCCCCGTTCCCTATCCCTAGCCAAACGTGATTTAAACTGTCCTAGATACCCGGTGGCTCGATCCCTAAATCGAAACCGTCACGTGGGGCAACGGTGCGTAACTGATAACCTGTTGTGGGTTTGCTTAGGGTTTGAGTTCCTGACCAATACTAAACAGGGTACGAACAACCAACGAACTCTCTCACTGTTAACACGATGCCGCTGGGAACATTTCGTTCGTAGTAAATCCCAGCCTACGTTTATCCTAATATACTGTCCGTACATTTCGGCAAAGCACAGGGCACGTAATGAATCCCCGCCCGTCGAAAACTGCGTAAGCGTTAAGTGCGATGTTTCACTGCCCATAATCTAGTCGCTCCGTTACCACCTGTTCACTCTTAGCTAGTACAACGCGGCTGACCCCAGCGCTCGGGTGTTTGCCAGGTCACTTCCGCGCCTACCCATAGAGCAAAGAACAGTCCGAAGCCTGCATTTTACATACGCCCGTTGCGCTCGTCCCAACAACTGACCGTATAGGATCTAACGGGGGACGAAAGACAGTCACCAAATTGACGGTGTTCCGTGGCAGTTATGAACAGGTCCAGGCGACTACAACTCATTAACAAAACGGGTAAGGACATTTCTTACGAGCGGAAAAGCGGATCTAAACAGGAAACAGCCGGACTTAAGCCTACTAATACCGTGATTCTACGTCCGACGCAGGTTCGACGCTCTTTTAACGCGCGAAGGCCTTCACAGCATCAGCGATGGTGTCCAATTTCAACCGCTGAGCACTCGTGCATGAATTCGTAACAGCGCTTTCCAGCAGCCGACCGTATTCGCTTTCTTCAATCGTCGTTGTTAACGTGAAATGACAGGTCTGTCTTAGCCATCGTTACAAAGACATGCAACGGGAGCTGTCCGTAATCGATCGTGACGATCTTACCGGGTCGCTCTCCATGCCAGCGCTAGAGATGAACGATACGCGTCACAAGGGACGATCGTACCAGTAATGGTTGATAGTTACGTGAGGCTAATAGGCTGCTCATAGATCTAAAAATATCAGCTTTGGACAGCGCGCGTTGAACCCTTAATCCAGCTGGCTTTAAATGGGATTTTATAGCGCAGCTCGGCGGTAAATGTGACATATCGGCGAGGACGCTGCGCCACGCCGGGGCTCGCCGGATGATGGCGACAGGTGTTCTTCGATACCCGGACGCGTACCGCCGTTAAGCTGCTTAGCGAAATGTTCTGTCATCATGGGCCCATAAAAGAGCTGATGAGTGAAACGGCCCCGTCGTATCACTTGACGAACGGCTTCGCCTGGCGCCGCTGACTTTGTATTGCAATGGCTCCCGGCCACGTGGGAGTCTCCTGCATAACGGATTTTGGGGCAGATAGTTGCCGTGTACAACGTCAAGCCGGACGCCAACGGAAATGTCAGGCCTTGAAACCGTCACACGAGACTTGATTCAGCCACCCAAAGTCAACTGTTTTCTTAATATCGCCGTAACTATGGTGATTTGGTCCTAGCGCCGGCAGCGTGGCCGTAAACTTTCCGTCAAGCATGTTCCTGACGTGGGCTTTAAACCCGTTCTTTAGGTCAACCGTCGGTAATCCCCGGAGGCTTTCAACTGAAAATGAGCCTGGCAACCGTTTGTAAGCGCGTTTTGTTAAACTTATTGCGATTATCGTGAAACGCGCTGCCTGCTGCTGCTAACCACGGCGTTCAACAACAAAGAGATGAGTGGATACGTAAACGTCTTCTGAAAGAGTGCGAGCCCTAGCTGGCAGCAGTAATTTTGTGATAGGGATAAAGCGTTGATGAAAGATTTAATGCACGCGCAGCGATCGGATGCATTCTAATCTTGCCACCCGACGACTGGCGACGTTTTTGATGTGGTCCGCCTATAGCCATGAGGCGCGATCTCCGCATATGCCTATCTACTCACGCATCCGTCGACCAGACTGTGACAGGACATGTATCTGAACGTGTTTTGATATCTAAAGTCTTCCTCGCCTGAGTGGGATTAGAGCGGTTTCTAGGATGGGTTGCGGATTAGATGGGGGCCTCATGTCATGGAGGCGGATCGAGACAGATCCGATTTATTTTAGTGCCGTATCTATCACGCAGCCTGTCAGACATACTGTTTCGTGGCTTTTCTAGCGTCATGTTATAGATCTTTCACACCGCCGATAGCTAGTCTTAATCAAAAATCGAGGACGCTTTTCCCGTCATTTCAAATGGGCAATGCCTGTTGAACTGTCTGTCCTGTAACATGGCTTATACGGCTTTATACGCGCCTACGCGTTGACAGCCGTTCGTAACACTATTTGATCGACTGGTTCGAATGGTCGTAAAGAGGACACTTGACGGTTCGGTATGTGGACGGACTTACTTAGCTTAAACCAAATTTTGTTGACTTTGGTTAAATCATCCTCACGACTTCTTTCCCTGAGACATGCTTCAAGCGCGACGGGCAGAACATTTCACCGATTGTACTATCGCGATCTAGCGCCATTCATCGTTAGCACCGTAATGACCTGTCCGGATATGATTTACCAAAGCTGTCAGTCCGTTCTTATACACCAAATCCGCTCCTTGAACGTAACGAGCGATGGCTGTAGGGTACTAAGATAAGCCATCGTAAGGCGACGACTAGAATGAAGTACTAACAGGGACGAAGTCAGATTAGGGACCCGTCTATTTAACCAAGCATGTACCGACGGTAAACATATCTTTCTGACTTTCGAAAGGAAGGGACGGGTCTGGTCTCATCATCTCGCTTTTATGAAATTTAATAATACGTGCTGACAGCGCCTGCAGGAGGGTCGGAGCGTCAACTGACAAGAGAGCCGTCGCGGCCTAGGCTCGCGATTAAACAAAAGGTTTATGGAGGGGTATGAAGATAGATACCGTTGAACGGCTAGCAGGCAAGAGACATTCTGAGCGTATCTGTACTTGGCTAGCTTTCTATCCCAAGACGAAATTAAGGCTACTTGTCATTTAATCTGTAGGTCACGACTAGATGCGGAACCGAAGGTTGAGCCGAACAGAGGACGCGCTCTAACCGTCAATCGTCTCGCGAACTGATCGGCCTCGCACCTCACGCTGTACCCCGCCTGAGTCATGAACTGACTAAACATGTGGTGGTTAACGGTTCAACGGACAGGTCGCCCCTTGACAGACGGGTACATCAGATAAGCAACGATTAAAGCGTCGGTCCCCTATATTGCCTGAAGCACCGCAGAAGACGGACCAGCCGTTGTTGAAGTGACGGTAAAGATTAGTCATGACGAGGCGACCTAGGCTTTACTCCACGGAGCGAAGCTCTCGAGCGCGATGAAAATGGTACCACCGGCGAGCCGCCGGCTGAGTCGGTGAATACGCTCCATCCTAAACAGACAGAGGAATGCTTCACCTTACACCCTGTTTCTGCGGCTAGAATGAGCCGCCTCTTTGACGACGCTGCGAGCTGAGTGCCTTAGAACTGTGTGCGAGATGCGAGCAGCCCCGACTGGCGGCTTTGCTACCTGCCTCGCATAGGGAGTGCCCCACGGAGTTCTTGCCACCGGCACCGCTGTCGACGCTCCGACTGTTCTACGCTATCCATGTTTTCGCTCCGATATGCACTTTTCCGGGTCTACGAGCAAAGACGTAGGTACTGTGAGCCGGTGCTCGTTGGTAATCTCGAATATGGATGT
>93
AATAGTCGTCATTGGGTTACTCGCGGCAATCGCCCGACCTGACCCTTTCAACGGACTTTATGAAAGGACTGTTTCGGGCTTCCACCGCGTTCCACGTTTATTTAATTCGTTCTATATGCCTTTTCGTGTCCCCTCTCCTACCCACCGAAGCAGGAGCGCCAACAGGACCGTAACGGGCAATGGCGCCTCATTTTGACAACATGTCGTTTCCTTTCCCATGTTGTTAGTTCGGGATACGTAGATGGAAGTGGTCAACGGGCACCTGGCTTAGGCTTTTCATGTCCGACCTTATGAACGTGGCCTTCATGGAGGGGCAGAGATCGGGGGATCACCGTTCTTAGAAGGCGGTGCTCGCAAAACGAACGTTATACTTACCTTCAGCCTCACCGGCACAACCTTAATGCCGAGCAGAATGGGTCAACCGGATCCGATCGAGATAGTATTCCACGCAGTCGATGATGCGGCTGCCGACGAGGCAATCTAGGGATCTATTACGGGTCCATGAATAAGCCAGACCTATCCTACACCGTGCTCACAGACGCCTCCAGCCGGAGTGGGGATGCCATCCACGTGAAGACAAGTTGGTACTTATTGGGATGCTCGAATTTGGTGGGTTCGTTGGGTCGCCTTGGGGGTCAGTGTTTAGAACTCACTTCTCAACAGCCCTAAGTATCACGGTGAGTCCTTGTCCAAACGCGTCCCAGTATGGAACTCAGAAGTCCCTTATTTACTTTTATCGGCTACAACTCATGGATAGCGGGCTACGCCCGAGCTACTAAAGACCATGAGTAGCTCCGCAGGCCGGGGCGGTTATGATGAGTACTGGCATCCGGTCAGTGAACGGGCGCCTTAGACCGTTGTCACCACAGGGTTGCCTACTGTCGACTAGAGCGCGCGGCTACGGTCAGGTCGATGGACAGATTTAGACTCCCGACGAGATCCCAGCCGGAGGGCTCCACATGGAGCCTTAAGTTCGACGGTAAAGGACGAGGGTAGGTCGCAGAATGCAATGGCGCGGTAGATCTCGTCAGAGCTCGATCTCGTACCGGTCCACGTCTTCCATTGTTATTCCAAATCCCTTATGTTTATCCCTCGTGCCCACCAGCCCGGACGAGACGGTGACTAGTCATAGGTGGTATTCCCGCGGGTGTTGACTGGCGATCTCAGGGTTGGACCCTACTTTACGTGACTGTCACGTCGCTGCTAACTGGCGCTCTCGCCGGTCTGACTGGCACTGAATGCGACGCGACGGAGCGCTCGCCGCGGGCGGCGTTCCTAGTGGATGCTTCAGTATTCCACCTGGGACCCGGCAAAGCCCGTGGATGCTTAATCAAAACAATCTCTCACGTGATGCTTTGACCAATCACTCCCAATCCAAGGCATACCCGCTTTCCTGGCTATGATGCGCTAGCGTATTCCTGAAACCAACGGTTTGACCCTAACGGTAATCCCAACCACATGAAGGAAACTAAAATTCGATCCGTTAAGACGAGTGGCTTGGTAGAAAGGTGTTCGTGAGTTCATGTTGGGTACGCGGTTGCCTTCGCTGAGGAGCATCTGCGTGCACCAGGTACCACCGTCCAAGGGTAAAATGGACAGGTACCCCACTCATAAGATTTTTGATCTCTGCCAGCAAGGGTGCTCCGTCAAACCCAGCAGAAGCTTCTATGATCCGGTCAACTGCGACAGACAGACGCCCGTATATGTACCGTGGTGGCGATCCTCTTTTCGTCAAAGTCGAAGCAGGGTCATAGGTAAGTAGCCCGTGACCTTTCGATTATAAGCCGTGACCGCTGAAGCGCCCGCCTACACGCGGTCGTGATAGGTGGCGCTTCGACACTGAAACGAAGGGGCGTATAGCGGCGATATGCCCTGATTTAGCCCCCGCCGGCCCTCGTACGAATATGTTTGGGAGCAATAAATTACCGAACTTCGTATAAATTAACCGAATACTGGCGACGCCGGCACGCCAGTGAGTCTAGCCGCCATTTTAGTCTCGTTTACGTATAGTACGGTATGACAAACTCTACGAGCCTCGCCGCAGTAATCGCGTACTGGGGATCGATGAAGGAAGAACATGACATCAATTAACTCGGCAGCCTTGGTGTGTGACCACACCTAGATACGGCTAGCTGCTTGCGTACGTAGCACGTAGATAGATTCATCACTATCCACGATGAAATTAGAGACTGACTTCAGATGACCCCGTAAACCCGTAACACAGTAACCGGGAATGCTTGTACCCGGCTTGTGTAACATGACGGGCACGCTCTAACAGGTCACGGCAAATGCCCGCAGTCGCACGGACGCATTCACGGTTCTTACTCCACTCAGGGAGAGGGACCAATGCGAGGGCCCGGCACAACAGGAGCCAAATAGCCATTTACCTGCCCAATCGCTTAAGGTCCCCGGGGACAGTTCTGAACCGCGCTTCCACTGACGCCGCAGCGAACGGCCACCTTCTAGGTCAGACCATTCACCTTCCCGAACTACGCGCTCTTTGATCTCGTCGCGGCGCGGAGACTCTATGACTCTGATGTATCTGTACTTAACGGGAAAGTCGAGTAAATGAATGAAGGAGCCAAATACTGTGACAGCTTCTAAAGCAGACGAGTGTACCGCCGCACCTATCGTTCGTCCATGAGGACGAGCTTAGAGGCCAGATCGTTTGCCCTGACCGGACGCTCGTGACTAATTAGATCGTACCGATAGTCAGGCGCAGGAGGGGATATATTAGAAACAGCCAGGGTCTCGCTGGCGTGACAGTTAAATTATTACACGCGGATGGGGTCTCGCGGACCCCGAAGTGCGCCATGTTACGTTAAGCTCCCTCGATCCGAGACTCGTAACCGGCTCCCTGAGCAACAGTACCCGACAACGCAGCAGGAGAACGGGTACGAATTTTTACGGCTGAATGCTGCACAGTTCTCTGGCTAAAGATCGCACTTGCGCGGGAGATCCAGACCAGCATGACAGGCCACCCAGGAAACGTGAGGATTTATCTGGCGGCCCGCTTCGGCCTCATTCTCATGAAATAACCTGCCTGAATGGTACGGTTACGCTGCCCCTTGGGAGCTAGTTTGAAGGGAGTCTTTCGGTCTGTCAAGAACAGCAGAAATACAGAAGGTTGCTGCATCACCTGTTACGATATTTACTCCCCAGAGTTACGATCCCCCGGCTAATCTCTTAACGCGAGCTCACTCTACTGGTGACTCCTGCCCTACCAATACTCATGCATCAGGGGTCCTGTTCAAACTGTGTCCAACATGAATCTAATGACGCCAGCTCAATGGGAATACCGGGGCAGGAGTCCCGTTGCTTCCCAGGGTCAAGCGGGAGAAAGAGGATTGCCCTCCAGAAACGATTGTGTACTTAGCTCTCCAATCGTAGACGAACCGTTACACTAGCGAGCACGTTTGGGGTCATCGTCAGCTCCATCGAAGCTGGCCGCGTAGACGACGTCTACGTCAAACTTTTGGTTTCGATAAGGACCGACGTACCGTTTGGTCACCCTCGGTTTCATTCGAGCCAGAAGAGGCACCGGTTTAGATGGTTAACGAGATCGCATCGGGGCTGAAGCCAAGGATTGGATGGCCGGCGATTCAGCCCATATTCAGGTCAAGTGTGCGAGTCGCTCCGCCGGTTGCGTAGAGGCATACCGGAGATCAGTTCGCCGAAAGCTATCTAACCCTGAATGCGAAATGAGCTGGCTCCCTGCGTGCCCGTACCCAAGCGACCGCCCTAGCATTGTTCGTCACCGTTTGGTAAAGATTCCGGATTGGCACTGGCGCTCCGCTGCGAAGACGAGACTTTATAACACATTCAGTGCTGGCTAGATGAGATGCTCGCTAGATTCGAGACCGCGGGTCGAGCCGCAAAATCCGACCGCGATGTAAAGCGCCTGAATCGGCATCGCCTGACGGCTCCGCCGCAGAACCTCCAATGAGTTTCTTAAATTCACCATTCGGAGCACCATGCGTCAGGACAGGAAGCAGGGGACCCGCGCCCGCTAGATCGGGAGCATCGCTGGGATCGTAGCAGTCCAAATCGCGCGGCGCCAAGTTAGCTGGAGACAGGCGCGCTGCTCCCACGCCAGCTGCCTGACTCCAGCTGCCAGGCGACTCCTGAACCCGTCGAGTAGCCAGTGCGGGAAGCACGGCTCCAGCCATGACTACTCATACCGTGTTCCCGTTTATGATCGTGTTCCCATCTGGCCTGCTGCTCATACTGTTGTAGTCTCACGATTTAGCAGGAGTGCCCGGCTGGCCCCTATAACTAGGCGCTCAGTGCGAAGCCCGGTCGTTGGGGTTGATTTGTTATGGGATAGCGACGGTCGTCGGTCGCGTATTCAGGCTTCATCTAGGCGATAGGATTTCTTTAACCTATCGAGGACACGTTCTAGTCTGGTCACTGTCAACGGCACGCCTTCCAATCCTTTTAGGGAGCGCAGTTGCGGTAAGAAGTGCTGGCGGCCCTCGAGCTGGCTTCTTGGGCTGAATGGTTGACCGACGATTCAGGAGCATCAGGACTATGCTCCTCCGAACGAGACTGAACTTAACACCTCACCGCGAAGCGATGCGCGGCCTCCAGATCCCTCTGCCGGAGTTTTAGGCGAGCGGATTGCTTGCATCGATCTCCGAGCGCCGGTGCTGGATTTATCCCTGACGGCCACTGCCTGGGGTGCAGGTTCGGCGTACATCCTGCGGGCTCGGGGTATAGCCGAGGTGACGGCCAGCCTGCTGCTGTGTACCCGCTTATTGCCGCCTCGGCTGGCGGCTTCAATTAACAACCGTGTTGGTACGTCACACTATCCTACGACTTGTTCGTTATTCATTGCGAATAAAGTCGATGGACCTCCAGAGCCTGCTCCTCATTACATGTGTCCCCGATTAAGCTATCCTAGGAGAGCAGATCACGAGCTAACTGCATTGGTACGGTACTCTTATCGACCGCCCCTACCCCCAGTCTCCATATGCCTCCATGGATATAGTTCGGCTGCACGGTCTAGGTACTTGGGTAACGGACCGCTGCCGCGGCGCCGCCTGCCGTGCAATGCCCCGTTGATGGTACTCGGGAACGGAACCGTTACAACAGATCTGACCCTGCGGCCGACAGGTCCGACGCGGTGAGTACTCTCTATCTACTGGTGGACGAAGCTGCTCGGGGTTACTCCCCGTCGAAGGATGGCCGACTAGAGGTCTGACGTACTCAAGTAGGTAAAACTAGTCGATTAGGGTCGATGGACGCACTCGTTGAGCACCGCTAGGCCTCGCTGGGACCAGTGCGTGCGATCGGTGCTTGCGCGGTTAAGCTCCTAAGCCCCGCGTCTTAATCCCAAGCCGACCTAGCCGGAATAAAGCGTCAATACACGATCTCACTTGTGCCTTACGCGAAACGAGCACAGGGTGCGAAATCGGACATGGCTTTACTCGGCGGGGGTTACAGATCCATGACTCATGGCAACCCACGCTAGGGCTTAGTTTAAGATGGCAGCGGGTTCCACGGCAATGCGGTCTAAACCTCTGAGACCCTAGCCGAAGGTTGTGCTCGCCCGCGGTGCTCCGACCGTACGTTAGTCCAGATCCAATCTTGCTCATCGCGAGGCTGCAATGCGGCCACCCGCGTCAACGGGGAGCATTGATCTAATGGCTGGGGTCTCACCGACGGAATGCGATCGCGGTTCATCGCTGTCTACTTAGACTCAGCGTAAAGTTAATCGCCGCGTCTCTCGAAGCATCGCCTAGAGATAAAATGACGCTGACTGTTTTGCTCGCCTATCAAATTGGGGTCCTTCATCGTACAGCAAATAACGAAAGAGACCCCCGACAGGCGGCCAGCTTGAGCCACCGCCCAATCCTGGAGCCCCCGGGGTTTAGAGAGCATTACGTATGGGGGTCTAAATGGTCAAGGGGGACAGCGAGACCGCCCCATTCCGATCCTGGCGGAACCCCCGAACCTCTCGTACAAACGGCCCCGCCGCTTCTCGCAGAGCACACGATGCTACGGGGCCGCGGTATGATGCCAATGGAAATTCATTCCAAGAGCGGCGCCAAATACGGTGCAAACAGGCGGTATGGGTCAGTTAACGATTTGTAGTACGTCAGCCAGTGGACGTCTGACCCAGCACGAAATAATGTTACGCGGTGTAAAAGGGGGTGGAGATCGATCTCTCCATCAACGGGCAAGTACCCGGCACGGGTCGCTGCGAACGGACTAGATGCCGGCAAACCTCAGGTAGTACCGTAACACCTCTCCCGCAACACGGGCTCTTGCGTTGGGGGCGGTAGGGAGCTAGACTTACGGTCACGAATTCTGTTAAGTTAACTTACTGTAAGACCACCCTACGTAACGTTCTCGAGTTAGTAAGCATTTCCGTTGGATTATGGAGGAAGCCATGCCATTCAGGGACGCACTCGGGTGCCCGTTTGCCACGTGGAAGAATGCCAAACGTCCTCTTTACTCACATTCATGCTCCCACATAAACTTCCGGCTTTGTAGCGCATTCTTGGGTGCCTGCTAAGCCATGATGCTCAATGGGCAGGTAGACGAGAATTTGACGTACCGTTGTAAATGATCGGTTTCCGTTAACCGTGATTTCTAGATTAACGCGGTAAATGGCACTTCGACCGCAGGTCAACTCAGCCAGGTTTAAGACATGGACCTATCAGTACTTTCGCGTGTTCATTAAGTGAACTTGTATTGACCGGTTGACGAGTCAGGTAAAGGACTAGTCCTTTTACTAGGCTCTTCACACACAAGCAGACAATAGCAACGAAATGAATCCGCGGCGCCATCGCTGCGTGCCTGCGGGCGAGTCGGAAGAATCTCAACTCATTTAGCCCTAGCCACCGTCTAGCAGGTAATAGATGCCTGATGCGAGCTTGGCTTTACCCCGACTCTCATTGACGGACGATGTACAGGGGCAGTGCATGGAGAGTTATACTTCCCGTCATTAACGGAGCCACTCGCTGATCTAATCGAACATTCGAATCCGTTGCTATGAACTCCGCAGGGTGAGGAACTCTATACGCCTTCGCGTCAGCAAACCACGGAGCAGGCGCCTGTCTCTGCTCTTAGCATTCACGGTATGACCCGGGCCACCTCTTAACGATCTCGCTCGCACGGCTCGCACTAGTCTGCATCTCAGTATCGAGATATGTCATAATGGTTGTCAGTCCCCCAGGGCCACGGCTAGGACTTTCAGACCGTTTAACAGTCAGACGCCGTCGAAACTATACCGCGCTGACCGTTTATTCTATAAAGTCCACGAGCGGCATTACAGCACGGTGGGCACTGGGCACAGCATTATTTAGACCTCATAGGAGAGAGGTCAATGACAGTACGACTCGTTGAATCGGATTATTCACGATGCTCGTGGGAGTAGCGTCTGGCCAGTTCTATACCAATCGACAGTGCTCCGGAATACAGTGCGCGACGAGCAATTAGACTGTACCGACTCTACGCTGTGAATTCGTCAGGATGCGACTAAACCGCGACGCATTAGCGCCTCATTACGTTATCGCGAGCTCTCCTCTCACGGGCGATCCCTAGTCGGTGGTTAAACGCAATCGTCGAAATCCCTCAAAACGTGTAATCATCAAACCTCGTAGCGTCATGTTGCCGTGGACTGAGTAATCTAACTCGTCAGGCTGTTTCATTGGGAGTGGCCGTACCGCGGGTAGGCTCTTTGCCCGTCTAAGCCCGACCTGAGCCGTGGGTCATGACATAACGGATACGGAGCGCATGGCTATGGCTAAATTGTACCAGGGCACCGGAGCTTCGACCCTCACCACATCAATCGGTCAACGGCCGCCAACCGCATAGACGGGGAGATGTGGTCTTAGTATGCCTAAACGCAAATGAGGCGCAATACGAAGTCACGCAACGCTCGCTTGGTTGGTTGGATGAACGCCTTCTCTAACTTGAAGCTTCGTGTAAAGGACAATCTGTACCCAGCTTGATTAGGACCTCTTAATTCACGCGGCCTGCGGTACGTGACGGCGGCGGTTGCTTAGCGCGGCGTTTCCTTTATTACGGTTCCGACGAGAGTGGCACGGCACAGCCGAACGCTGACCGCGATGCGGATGAATAACGGGAGTAGATCTTGGCTGATATACTGATATATATTTGCGCGCACCATGACTCATAGTTTTACGGCTTAGTCAGATGCCGCAAAGCCGCTT
>94
TGCTACTCTTAACGTAGCTGCTATGCCTATTGCCAGGCTCCGCTGCCCTCAGACCATCTGAGCGCGACCTCCGCTGTCGAAGATCAGTACGCACGAGTAGCTCGCTCGCAACATCCGTTTAGTATTAGATGATCGGGCAGTTACTATGATATGTACGGCGCGCCGGGTCCGGGGATTTCTCATTGCTGATCATTGAGAATAGGTCAGTTTAGAGACCTCGTTCGCGCGCGAGCGACCATCAAAGATTAGACCTGCATCGCCTCCATCCCCGTTCCCTCCGAGCCGAAGAGCTGGGGTGGCCAGGCGGGCGAGAAGTACGCATTCTCCATGAGTGCGCTTTTAGCGCTTTCTATCGATGACGAAAAACCGTGTTGGCAACTTTAGGCACTACCCGCACTGAGGTTTGGAATGATTAGCGATCTTAATGCTTCACTCCCAAGGGAATAATCCTTCAATCTTATTCGTCTAAGCCCTGCCTCAATTAGTATGCACTTTACGTTAGAGCTGCTCTTTCCTCTCGGTGCATTCGCCTCCTAGCTCAAGGGAGTAGTGCTATTAAGCGACTTTTAACACCGCAGTCAGATCCACGCACGAGCTCCGGATTGTTCTTTATTTAAATGTTTTTGTCGATTGGCGTACATTGCTCTTCATCTAGCGTTAGCTAACTTGACGTCCGCCCTTATTTTAGTATCCATTTGAGCGTTGGATCAAATACATCTGTCCGGTTATTTTAGTAGAGAGTGCGCTAGGACCCCTTTGTTGACGCATCAAACCTTAGGTGAGGCCTTCCGCTCTTTACTAGTGCCTGCTCTAAGACTAGGAGGTCTAAACAAGCAGGCAGAGAGGCACCGAACGGAGCGCCGAGGCGCAATGCCATGGGGGAGCTGTTACCGATGGCTCAGGTCGCCTTGTCCGGAAATATTCGATTAACAATCCAAGATTTAATATTGGACGTGTTTTGATTTATGAACTAAAACTACGTCTACAACGTTAACAAGTACTTTACTATCTAGCCAGGTACTCTTCAGCATCTCATATTGTCGCAGCTCGCCTCCCATTGATAAAACCACGTGTAGTGTTACGATTAAAGAGGACTCCGCATCTTACTCCGCATCGTTTAACCTATTCCAGTCAGGAGATCGCTTTCTAGCGGACAGGGAAAATGGTTAAAGCGAGGCGGAATTTTTACGCAATGGATCAGATAACGTACATGAACACGCTTATTACTGACATTTGACTATTCAATCGGCACTTTACAAGGCTTCCATACACCTAGATCTTTCCTAATCGTCCCATTTTCCGTCCGTGTCGGACAATGCGTTGCATAATGCAATACGTGGCGCCTCATCCCTGTGTGCATCGTTTAATTATTCGCCAGCTCCCGCCGAAGTTCCCCGTCAGCGTGGTCATAGTTTAATGCGGGATTAGCGGCGTGCATGCGACGAGAGGCGCCCAGGCGCATATGCTCGCTCTGAAGGTTTCAACTAGGTCGTTAAAAGTTGTTGCCTGGTTTTTAGCCCGTACCGATTCTTGAAATAGTTCACCTATGAAACGGGATAACACAGTAGCAAGGTATCCGACCCTACTGCGCACTGGCCCTTAATGATTATCCAAGTGCTCATACAGACGTTTCTATGCATTTGGTCAATGGGGCTGCGGCAAGCATATCGCCCCAAAGGATGTAGCGGGTCTCCCTGCTTTCTTCGTTTTAACTCGCATTGGAAGCAGGCGAGGCGGGTGGTTCCTGCAGCCAGGGTTTGTGGCCTCGACGCAAATGTTGTTTGCCCAACGAATGAGGGCAGGACATTCCTGCCTATCAAGCTTAAAGTTTTATTAATTCTGTAAGGCGGTTAACCTCCATGGAAACAGTTATTGCTCACAAAAGATCCATACCGTGTCGCGCTCCATGAAACAACGATGCATTAAACCCTTAATGACTCTTCTGATGTCCCGTCCAGTTGTTTGCGGGTGATCAGCCTCTCAAAGTTCGACTGAGTCGCGTTCACGTTGCGCACGTCAATCGGGGGAGCGGGCTCTAACGAGAAAAGAGTGCCGGCAGGCGTAGAAGAGAAGGACTGGCCCGACTGCATTTACGTGTGGATGAGAGCTACGACCCACGATGGAAACAATAAACAGCAGAGCATCATTTTCAGCTTTCCTCATGAGCTATGTAGCCTTCGTGTACATTTGCATGAACAGATGCCCTCCGCCAGTACGCATCCGGATGTCAGGTGTCCCGTTCGCCGAGTTGAAAAGTTCTCTGGCATTTTGTCTAACAGTTCTGCCTGAATGGCGTGCTCCCTGCTCTGATTAACATATGCCCGACCCTCAGGCGATACGCAAGGTGGATGCATAACCTCCCAAACGCAAACAATCGCATGTACTGCTCATACATCAGATCTTATACATCTCGTTCCACCCTTTATTTGAATTTGCAATCCAGCCCCTGTCATACGTATGCGCTCGAACTGGCCAACTCAGCTAAGCGATCTTGAATAGGATATGTGCTGCAACACGTCAGTGCCTGACATTAGCCCGATCAATCATAACGACGACAACCTGCGTATTAAACGAGTGCCAGCGTCCTGACTTTTTCAGGGGCTTGGTGTTCAGAAGAGGCCTCTGCAACGGAAGCCGCAGAAGGGGAAAGAAGCATACTCGTCGGCGCCCCTTTGTTAATTTGGATTTGGATGTTAGCGTGACACTACGCGCGGCACGTTGCGGAGTCACAGCGGCTGCCGTAACCATGATAAAAACAGGGCCATCGTCACTGATTTCTTTTGACGTCCAACGTCGCAGTTCAACGAGCCGCCAAGGCTTCTAGGAGCCATCCTTTTGATTGACGTGAATTTCTAAACTTTATAACTCCAACAGTTTTTAAGCAACCGCGGCCGTTTCAAGCATGGATCGATCGATGCCATGCCTCCATCTCACTCCACGCTTAATTCCTCGGACGCCCGCCAGGTGCTACTGCTTAGACCAGATTCCGGAGATCACCGAGATTGCCAGTGGGCGCTCCAAAGCTCCCACATCGACGTCCGTCAGTGCACTATGCTTTTGGCTATACAGGCCATGCCTCTTAGTCAGACAGAGGACTCGCCATTGCAACCTAAGAAGGATTAGCGCGATTAATGTTCCTGTTAGAGGATGGCACTTAAGCCATCAGGTTAGTGTTTCTGAAATTGCGATGTACGCGAAAGAAGTGGCACCGCGCTGTGAAACCAAGAAAGTCAGTTAACATCTGGGCTGAGTCCAACAAGCTCTGATTGTTTAACAATCAGATTGTTTGATTACGAAAGTATGCACGAAAAACGGCAGGGAAGTGGTCGGCATATAAACTCTGCCGACAAAAGAAGAATTTCACGAAGATTAGCCTGTGGCACACTCCCAGCGTGGAAACTATTACTAATGAATTCAAAGGACACAGTGGCCTCGGCTCGTCATTGTGCTTGATCATGGTGAAGCAAGTGGCGCCTGTGAATTTGATCCGTCTTCCGTTATTTCAGCTGCGTGCCACAAAGGCAACGCACTGGCCTGAGGCTCACGACTTCAGAGTGCCTGACAAACAATGCACTTACCTAAACGTTGTGCCATAAATAAATTGACGAATGATTCTGCGGGGCTATAGTACTAATCACAGTGTTCAAACGTTAGAATTTGCACTCCAACACTCTGCAATGGTTGCGTCGCTACATCTAGTTCGTCCGAACCCTCTAGAGAGTCGATGACGCTCACCTCACTAGGACATTTTCTTCGATCGGGTAAGCAAACTCACCCTAACAGGCGTGGCTCCGAACAACGTTCAGTTACGTGCCCAATTGGTCAATAGTCAGACCCGGCATTGAGCACGTACCCGACAAATACGAAACATGAGAGTGCAGACAGTGGCATTCAAAGTGTTGCGTGTAACTATTCTGTTGTGAAAGATGTGCACCGAACAGTCCCTCCAGCATGAGTCAGTGCACGTACAAATATGGTCGGCCTGTTGGCGTAGCATCACTTACGGTGTCACAGCGCAAACTTAAATCAGTCGGGCATCGTGAATAGCCGGCTTGCATCTTCCCAAATAACGTTTATGAGGACCCACACTGACTCAAGCAGCTCTGTTTCAATTGGAGATATCAACCACCCAACGGACTTAAATGCAGATTAAACCATCTTGCCCCAGCGTCACAGCAACAGCAAGAGATAGTCAACTAACAGGACCTACCGATGTTGCACGACCAACATGCAGTGACATTTGCCTGCACTCTTTCAAACGTCGGACGTGCCCTCGAACTGTTCACGAAACCTTGTGCAAATTGAATGGCACTCGTGGACCTTTGTTCGTTCTGGCAACGATTCGTGCTTAACAAAAGAGGATTGAAGAAATAAAAATATACCGAATCCCATCAGTTAAATTCGGCCGACATCCCCGACACCAGCCAGAACACCCCTGGCGTATATACCGAAAAGAATCGAGAAGCCGCAATACTCCCGAGTCGGCATCAAGGGGGACGAGCATTTGGCAGTGAAGCGTTCTAAGGCTTTCAGTGCTTAAAGTCTCGTGACACGACTATCGATCAGATGTTAAAATTCGAACCTCGCTGCGCCGGTATCAAACTCATTTGGTTGGCGATGCGTGAACTGTCAACGTAACCGTAACCACTTAGGCTGAATTTGTCCTAGGTGTCCTTTCTTTCGAGTCTCCCGTTCAAGTTAATTCGTTCCCCGTCCAGAATTACCTTAGTATGCTCGTTTAGACCGTATTCGTCCACCATTAATCAACAGTGCAAAACATATTTTATCTTTAACACCGTCAACACCAAAGTGACTGATTAACACGAGTTCAAACCAAATGGCATTTGGGCAAAACATTAACGCCGATTTTATTTGTCTATCCAGATCAGGGGTAGAACACACCCGCTGCTAGCAAAGATCATTAACGTTTCCACTAACTATAGAATGATCATTTGCTCATGGTTTAGATCGCTATACAAACAAGGAAGCTTGATGCGTTTGAACAGAGATCAACGTTTAAACGAGGCAGCTCACAGGCAGGGCCGAGAAGCAGGAACGCGGTGTGTTTGTTGTCCGTGAGGTTAGTGGTGTCCGAGTTGTTTGCATCTCCCTGTCGTGTAACATGCGGATCACGAACGACACCCGAACTTTCAAACCCTTTGCATGCCATCAATTTTTCGTAGCCCATCTCTTTTAAACGCGGTACGATACATGAGAACGTCGTTGTAACGATGGCGTGCACTTTCGGCGTCTTTATCATCGTATTTTTAAATTAGCCGAAGCCATTTCGATTAGTTAATTAGTTTATTTCGATCTGTGCTTTCTGAAGACTAAGTTGTAGAATGGTTTGGACTGCCAACGTCATGCGATAGGCCGCTTCTGCC
>95
TAGATAGCGGTCGGCTCCGGCCTGAACGCATCCAAGGCATCGGAGTAAGCGACGACTGCCGCAACGTGTGATAGTGTTCCATCGTCGACCATAGGCCGAAGCCCGAAATGCCGCAGCCGAGAAGGAAGCATGTATCATTGCTAACCGTTGACTGCTGTGCACGTTTCGGAAATGGACGGTCAGGTTTCCCACGTTAAAAGGAAGGTATGACATGCACGACATAAGGGAGCCCGTCGAATACTGGCGATTTCACCTGCGATGCCCGACAGCACGAAAGTACAGAATGCGGTTCGCACCACTTCAGCGGGGTCTCTGGCATTCTTCTATTCCGTTGCTGTGCACGTGCTCGTTAAGAGTGGCTTAGATGAGTTTCGTGGTAGCCAACAGTTCGTAGTACGTATGCAGTACCTGCTTACGAGATTCTTCGTAACTAAGAGGCGACG
>96
AGCGGCCGTCTCTATGCTTGGGTGTTTAACCTTAAACCAATACATACAATGCCAATAGAGGCACCATGCCGAGGTAATCCGAATTGATTCAAATAATAATCAAAATGTATTTCATGGAAAATAGTTAGAGAAAACGAAGAAAAACCGACTTTAGAAATATCAACAGCAGACTCAAACATGACGAAAAACCATATTTCTATGCGTTCAGTCTTAAAGCAATTGGCGGTGATGTACTATGAACTATTCGATCAGCTAATTCCCCTTATTCTCCGACCATAATAATTACAAATAAACCAATACTCAGCTTTACAATATACTAACCGAAGGGTCATTGCCAGACCCAGGGTGCGGCATATCACAAAACGATTACTCCATAATCAATCAAAGGGACACTCATCAAGGTGCAGTTGACGTATCAACACGGTTCAGCAAAGCCCGATATTTCTTCCCGCTTCCAGCAACGAGGTTTCTTCCTTCGTTGCGATTCCCAGATCTGCAGCATCCTGAAGCGGCGCAATATGCTCACTGGCTACCTGCATCAGGCTTTTGTTTCTTCCGCCTCCCGGATCGAACAGTTTTCTGCCTTCCTATTCTGCCTTCGCGAGGTCCGATTCCATTGGATATTCCCCTCCCGGCGATAACCAGGTAAATTTTCCGGTAACGGACCCGAGTTTCAGAAATAAAGGACGCGTCGCCGGAAGCCCATAGACGGTTTTACCCCGATGGTCTTCACGATACGCCACGATTGCCCTCATCACTGTTTAGAAAACAGCCACAAAGCCAGCGGCCGGAATATCTGGCCAGTGCAATATCGGTACTGTTGCAGGCAAGACCCGGTATGAGAGGTAGAAGAGTATGCGTCACCTTCACGATAGATTCATGCGATCCGAGCAGGCAGATTATAATATTTTTATGGTCCGTGGTTGTTCACTCATTTGAATGCCATTATGCAAGCCTCGCAATATAGTTAAATCTGCAATGTTTTGACGTTTAGTTTTCCGTTACCCGCAGCGTTAACGGTATGGTGTGTCCGTGTAGGACAGTAATGAAAGAATGGGCATGAGCACAGAACAAAAGCGGATGGTGCCTCCGCCCAATACCAACTGTATGCCGCCGTGCGCACTCGACCTAAGGGGCGTGACAGCTAAATGAGTGACTGTGTTCCGTAATGACTGTCCGTTTGGTAAACCGCACAGGCAATACCCTGTGTGTGCTGCTTCCTTTAACGTGGACGATAAACTTCCTGTAATGGTTGCTGTTCCATACTGACTCCAGCCAACTGTTCATCCTTAAACCCTTGTGGCATGAGGCGCATCGCTGTTGAACATACAGACTGTGAGCATGAGCCCCCGTGTTATTCAGTCGATTTGATCAATTGAACTCCATCTGTTAGTATTTCGTCCCATGGTAATCGACCGACGGGTGGTTTTCGTCCCCAAATCCGTACCCGGATGCATGGCACTGTGGGGTGCGACTAGGATGCCGAGCCGATGTTTCCTGAGACAATACAGCACGACCGCTGGCGGGTTTCCCTTGATTGTGCCTCCTCGCATATATCAGGAAGGCACCCGATGGATACGCGACAGCAAGTTTTGGGTAGCTGATTGTCAAACGCCTGCCTGCATCAGGACGTAGCCAGACGAATGACGATGGTACGGGATCGGCGCAGGTCGGAAAGGCATGAATTCTCACCGGCCCCAAGGTTCAAGATATCCAACGGAGATTTCAGAGACTATCCTGCCAACCTGAGTCAGTTTCAGTCAGGCTGGCGGCAGTGGATTGCCCGAATACGCGGTAATTATTTTCGCCGTGGAAAGCCCTGCCAGCTAGTCGTCATAGTGTCGCATTCTTCCGGTTGTTTACCCGCAAACCGTTAGTCATGGCCTTATAAAGTGGGATTTCCCCAGCTGCCTCCGCAGTTCATTCAGCGTATTCAGTGCGTCAGGTGACGAGTCAGTAACATCTGGCGGATCGCGGCCAGTCAAAAGCGGTGTTCGCAAGTACTTGTTGGTACCGAATTAGTTTGGCGTTCCCGCTTCTTCGTGTTCGATATTCTATCGTAACGTCCAGTGGGCTTTCTGTTCGTTTCATGCACTTATTACCACCTTAACCGCCTTTGGCGTTGCAGCAGCGTTTCAGACGTGCTGTTGGTTGCACTGCTGAGCCTGCACTATCCCTTTCTCGTTGTCCGCATCCTCAAGCGCGACAGCTGAAGCTATATCTTCTGCACGGTATTTTGCCCAACGTTAGTCTCAAAGGTACTTTGCCACCTTTGCAGCTCACGCAAGCTCGTGTGAGCTGGGAGGACTCATTCCGCAGCCTCTGTCTCCGCCTTCGTGATGCCGTTGACGGCACTCCCGCCGCCGCTGTTTTGCGTGCCCAACAGAGGCGGGCTTCCATGCTGTTTCAGATGACCTTAGCATTCGTCTCCCGACGTTTTGCCTGAAGCAGAATTTTTCCTTTGCAGCCGTTGCCGCAGGAAGCTGCACGACCGGCTACTTGATGCGTTCGTTGCGCCGTATTTTGCTGCCTCTTTGAGGCCACCGCATCTCGTGCTGAAGGCAGGGCGCGTAACGCTTTCGTGGCCGCGGTGCGGGGCGGGTTGAATGGGTAATTGTTGTGACGCTGCAGCATTCGGTTTCTGACGTTTTCGCCGCACCGGCACTGGTGGCAGCCCCCGTTTTTGGATAGCGGGTAGCCTTAAGCACTTTTCCGCTTTCAGTGGCCTTTTAATGCCGCTTCTGCGCCGGAGAGGACGCTTCCTGATGAGCTGACGATCGCAGCCTTGTCCGGCGACGTGCTGGCGGCGCGTGCTGAGCGGCTTAGAGTGCAAGACGGTTACAAGGGGCCGCGGTACCTTACATGGCAGCTGATGCACTGGCATCGCCGGCTGATTTCTTCGCGTCTGCTCGTTCTCTGTGCCACCACGACGCGTTACGCGCCCTCTTCCACCATCAGTTCGACGACGCAGCAGCCTCCGGCCGGGCATCATCCTCCGTTTCCTGGCACAGAAAATGGATTCAGCGTCCCCGGTTGAATCTTCATACACGGTGATGGTCCCCGGCGTGCGATGGTGGGAAAACCGTCAACCTGCAGGAAGTACTGTACTGACCGTACTCCACAGCCGAGGGTACGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCACCACCACCGTGGTGTAGTTGACGTCTGGCTTTCACTATGAATGGTGCATAGTTCTTACCCTTTTCCTGTGCCGTCTTTCAGAACTCCTGAAATCTTTACTGCCATATTCGCCGCTAAAGCCCACCGGTTCCGGCGGGCTGTCAGCACTGTGTTACCTGGCTAATCAGAATTTATAACCGACTCCCAACGATGAATTGGTCAGTATCGCCAGTCGCCGCCTGCCGGATAGCAAGAAGGTAACAACGTGAACGGACGGTGCCTATTAATCTGTATACCTGCACTCCAAAGCCACTGAGGTATGCCGCATTGCAGCACTTTCGTCCCTGGCGTATTACCGTCCATTTCATAGATATACCCGGGGGTGGATTTCCGTCTTAATGGATCGCTGTACTGCCGCTACAAGGCGACTGTAGCCACTCCGGCCATGGCGTACCGCACTCTACTGCTTACTGATTTGTAAAACCGCCGTTATCATGACTTAATACACATGGACGACTCACCGTCCGCATAGAACGAGACATCCTCCCCCGGTCATCACTGTGCTGCTCTTTTCGACGCGGCGAATGGAGCGAAGGAAGCCATCACCCCACTGTCCGTCAGCTCATACGGTACTTCACGTTAATCCCTTTCCATATTAACTCACCGGTATCCCGCCCGACAACGACGGCACATCCGGTTTCGGCTGCTGAAAATAGCCCACCGTAAACGTACCATGTCCGTCCTCCGCACGGTAGGGGATGACTGTCACCGCAAGTGCGGCAAAGAGAAAGGCAATACAGGCACTCGCATCGTTCGCCTCTCACTGTTTATAATAAACGCCCGTTCCCGGACGAACCTGTAACACATAGCCAGACCACGCTGATGCCCGCCTCGTTTCTTAATCACCATAACCTGCACAACGGGCAAACGTATACGGCGGAATATCTGCCGAATGCCGTGGACGGGCGTGAACGTCAGGATCGCGTTTCCCCATTCTGAACGCGTCAACAATACGGGGAGAACACCTGTACCGCCTCGTTCGCCGAAGCCGATAAATCACGCACCCGTTCATCAGTACTTTTGAGATAACACATCGAATACGTTGTCCCTTGCCGCTGACAGTACGGGTTTCAGCGAAACGTCAGCCGGATGAGGCGAAGCACTATTATTGGCGATCAAAGGATGGTCATCGGTCACGGTGACAGTCACGGGTAGCTGACGGCCAGTCCACTGCTGCTTTCACGGCCTAGGAAAAGCCGGACTAGCCGCCGCCTTTACAATGTCCCCGACGATTTTCCGCCCTCACAGCGTACCGTTCTGAGTCGCGTTGGACGGTCAGCAGTACACTCCAGGGATCCCGGGGTTCGCATTCACTGCCACTGATATCCGCATTTTTAGCGGTCAGCTTTCGCGTCCGGTGTTAGAAGGTAGAGGATTGCCGCATGATGACTGTACCGGGTGATAGACCTGTTCCCGAACACGTCGTTCATCGAATATCTGTTATGCTCCTCGACAAACATCTATAGTTTCAATTCCCTATTTCACTGTACAAATAAAGCGATACGATTGGCCGACCATCCAAGAACTTATCAGCTCTCCTGTTTGGTTCTCCTGTCTCATTGCCTGCTACATGTACCCCGCAGACATAATGTTTCACGTCTGTTGGTCCTCAATTTGACAGCCCACATGGCATTCCACTTATCACTGGCATCCTTCCACTCTTTCGAAAACTCCTCCAGTTAGCTGGCGTTATCCTCCGTCAGCTCGACTTTTTCCATCATCGGTGCCGAGATGGGATGGGTTGCGTCTATCCGTGGGAAAATCCAGGTACCTTCCGCATCATCGCTCGCCGACCGACGGCCTCCACGAATGCCGATGATTGCCACGGCCGTGTTCACACTGCGGATATAAAGTAATAATCATGGCCCGGTTACTTGGGTACTGAGGACTCGGGTCCAGTACAGCGCCGTACCAATAACGCGTGCTGGTTTCAACCTAGTTAGATATCCGCAATCTGCTTTTCCCGAGAACCAGAACTCAACTGTACCGTCGGGTCATAAACGGCAAGTGCGATGGGATGGGGGAGAGTACTGGAAAAGAGCCGTCACATAGGCTCAATCCTCGGACCGTGTGCTGCCGGTGCGGCAATCCGGAACCGATATCCGACGGATCTCTGAGCCTGCTGCCCGCATTTACCGCCCGGACTGTCAGCCGTAGTTCTCCAGGGTTGCGTGAAGCGGTATGTGATTCCGGTTCTGGTTCCCTGCGTTAGACTCAGCCGCTCACTGCCGTCGTTTAACGACGTTACCGTTAAACACGCGGGAGTACGCCCTTCACCTGCTTGTCCCATCGCGCCAGCAGCTGATATTCCCCAGGTCGCATAGTACTTGCGTCGGGTCAGTCGAGGCTAGCACATGGCGGCGTGACACCATTCACCGTGCCCTCTCTGTTCGCCGTCAAAGTGCGCCCCGTTATCCACGATGGCCTCTTTTCCGGCACATGCTGCACGCGGTGATGGCATACGTGCCGTCGTCGTTCTCACGATACTCACGCAGCGGAACAGTCGATCGCGCGGCTTCATCGGGTGGCATTCATAAGCTTCATCTCCACGCGGCCCTGTATTCAGCAACCCGTCAGGAACACGCTAAGTACGCTGCCAAGCCGTCGGTGACGGACTATGATCCTCCACGCTGACCGGATTGCCACTTCTCGTCAACCAGGCTTATCAGCGCGGTACCGATGATGGAACCGTGATTTCACGGCTAGGGTCGGGGTCAGCGTCGGGGTCTGGCTGTTCACTAGGGAGCACGACCACCGGTGCTGATACCGGCATAGTCATCATCGCAGATTTCAATAACATCACCGGTACAGGGTGAAGCCCTTCTGCGCCGACGCTGAAATCCACGAATTCGGCATTCCCAGGAATTCGGTGTTCTTAATCAGCCACAGCCCGGCCGGTGCGCCTGCCCCGGCTGGTACAGCCAAGGGCATCCATCTTCGTAATAGATCGACCGTAACGGGCAATGGCTGCGTATCTTCAACAAGCTCTGTCGCCGTCTCCCAGCCGTTGTTTCGGGTCAATCCAGTTCACCTCAACGACGCATTATGGCAGTCCTTCAGGGCATGAAGCTGTAGCGGAACGGCACGCCATCATCCGGCATCACCACATTACTGCCGGTTATAGTCCACTAGAATCCCGACGCGTTAGCGCCGCACGAACTATGGTCGGCCTTCTGCCGCGTTCCGCTCATACCGGCATACAGCGCATCACCCGGCAGAGACTTGGCTGAGCACATCCCACGCCTTACGCTGTGGTCAGGATGGGCATTACAGGTAGTACCACGGCGTAGCGGCGTGCAGCCAAAGCCGTCCGGCACTGACTGGTCGCAGTACTGGCCGATGACATACAGCGCCCATTTATCTACCCATCACCACAAACCTATTTCCCATGCTATCGATGGGTCGCATATCCCAACACAGACAGCCATGTTGTTGCTGTGCCGTTAAACGTTCCGTCCCATACCCCGAGCTTACCCTCCGCGCGTCTTGAGTAGTTCGACGGCATCGGGCAGAATACGCCCGCGCAGATGATAATTAGAGCCCTGCTGGCTGCCGAACTGCTCCGAGTCTACCTGCACGCCGACCAGTGCCGTGTTCGGCACTGTTTCACATCGATGATTTCAGTGTTGACGACCAGAGCGTTGTTCTGCTGCAGCTGGTCGTGGTGCTGTCCGGCGTCATCCCCTGCGCATCATCTGGATATTAAACGGGCTAGGTAGTACAGGTTACCCATCACACCGAGGCCAGATACTGCAGGTGGTTGGGGCGGGCACTAGTGATCTTTGCGTTCTACCCAGCCGCGTCCGTGCTGGAACCAGCAGGCGACTTCCGACGATTCCTGTCACCCTTTGAGGTGGTTCCACCAGTGCCTGTACACCGAAGGTAAAGGCAAGACGGTCGATGTTTGCAAGTGATTAAGCTGGATAGATCGGGCGTCATATTTCACTTCCGTACCCCAAGCGTCTCGGAGCCGGAGGATCAAATTCCCTCAGGCCGTATTGCTCCTATCAACCAGCCCCGGAACACCACCGTGACACCGGATATGTTGGTATTCCCCAGGATTATCCCTCATTCTCTGTTCACAGACCCTAGTTTAAGCCATCCAAGCACTCTTCAATTCAACTGTCGCTGATGGCATCGATCACACTCAGCAACTGCGTGGACTTCAGGTCCTTCGCTTCGCGCGGGGTCCCTTACTGCTTCCTTTACCCATTTCCTCACGCTCCATAAATGACAAAGCTCCGCAAGCGAGTCCGCACAAAACATTTTGCATCAGCGACCAATCACCACAACCTGACCACCGTGATCCCGGGCCGTCTGCCGTGCTATCTCCTGAGAAACCACGCGTGGTACCGCAATCGCATTTCCGATTAACCCTGGACGGCAAGACATTGCCCTGGGCAACCATGTTATCCAGTGAGGAGAAATAGGTGTTCTGCTTACCGTTGTGACCGTTGTCTCGGGAGTTCGTACTGGCTTTCATAGTCAGAGCATCTGCGCCACCACCGAGACGCACCATACTGGCACCCAGAAAACAGGATCATTCTATAAGCACCCAAATGGCTGCCCCCATGCTGCAAGGCTCCGGCGGTAAAGAATGATCCGGGGATGGCGGCAGCCCCCAGACAATCTGGAATACGCCCTGACTTGGCCCCGGCGACTCTGAATACATACTGGCATTGAGCGCCTGACAGGCAGAGTCTCATGTAACTGCGCCCTTTCTGCAGGTTACTGAACTGATGACGTCTGCCCAATCGGAGAGGATGTCAGTCCTTATTATCTTAACGAAACTGATTCTATCAGTTTCTTACCAGAAACGGGAGGTTGTAACTAGAGTGCCATCATTCAGCCCCCGTTGCAGAAGTCGACGGTTAAGCGGTAACAAATCGTTGTAAATCCCCAAATCGAAGATGCGCCATGCCCGGTGACAGGGATGTTAGTCGGTTAGAGCCTTCATGTACCTCGTTTGCTCCGCGTGTTCCGGAATATGGTGCAGCAAGCCGCCGTCGCCCGCAGTAAATTGCGGGGTGTCCGGCACTGATGAACCAAAACAGCAACAGCAGCACATCTCACGGCTGTGCCGGCACGGAAGAGGCTACAGCCCCGTCGCCTCCATATTATCCAGATAGAGATTGCTTAGATTCGCCACCAGTCATCCTCACCGATGAAAGTCCGGCATCTCAATCCCGCCATGATAAGCATCCGGAACAGTGTGTAACAGTCCGTCACCGTGCTCAAAGCGCCGCCCGGTGAGATGCGGCACACGAGTGGGATCGGTTCTCCCCGGCAAGACCAGCCACGGCAAATCAACGCAGGCAGCGAGCCGGTCGAGCTTCAGCCAGGCAGACTCACAACCGGCTTGAGGTGAACAGCGCCACAATCTCACTCATGCATTTCTGCCTGCAGCCAGTCTTCCGGCGACATACGGAAATACGCTCCGGCTCACCGGAGATATTCACGCAGGGAAATACCTTTCCCCTCCGATTGGGCGTGCTTACCACGAAGCCGCACGACTCCCGCTGGCACAGCCGGCCGGGCGTGCTACAGAAATCGCTGATTCTGTCTGTGCTTTCGGCTTCTGCATTGCGAAGGTCTTAATGGGAAGGAAGCCGCCAAAGTTGCCGAGGACGTTATTGCGGAACTTACAACCCGCTCAGGCATTTGCTGCATTTATCCTTCGTGATATCGACGTTGGCTGGTCATATTCATCCGCGACAGCCGGACCGCTAACCGCACTCGTCTACCGCGATAGTCCAGGTGCATGTTGAGTGAGCATGATACGTCCTCAGGGGAAAAGCGCCATCCGTTTCCGTCGATTAACAGTACAAAGGAGGCACTCACCGCTCAGTTCAGCAACTGAGATGCGCGGCGACGGATCAGCCTCCTGCTCCGTACTGAGTAACTGTTTCCGTTGAAGGAAGTTCACGCATCCAGAAAACGGGCGTAAACCTTACGCCGGACCACCGTTCCTAAACAGACCTGCATATCTTCCGCCATCCCGGTACATACCGTACAGGTTAGAAATACAGTCGGCGTGGGGCTAGTCGTCATACTGGTGCCTTTGCCGGTCGATTCAAACCGCTCCCTGAATGGGGATACGGCTGAGCCATACTGCGCCAGGCGACCGGCTCACCTTTTCGTTCCTTACTCACAGAGAAAAATAACGTTCTCCACCGGCTCTCTGTCCTTAGATTTCCAGAGCACGCTGGCCGACTGCTCCGCACGGGTGCATTCATTCAGTGTTTCCCGTCACATACCGTTCTTTATT
>97
CTAGAGCCCCAGATCATCTAGCCCCTTGTGTTTGAGCGCTTTACTGAAGGTTTCGGGCGCGTGCGAGCTAGTACACTCAACCGTTGACCGACAAGAGCATCACCCTGAATAGCGATGCCGTGACAGTGATTTGCTCCGTTTCCAGCTCCGCCCTAAGCGTACACATCCATGCGCTTATAACGCGGAGTCGGATTTGAATATGGATTTCTGCGTAGCCCCAGTGAAGTTTGTCCAACCTTGTTCGGAGGGAACACGTTACCACTAGACTTAAATGCATTCGGCACTCTCTTTGATGACCTTTAGAAATGCCCGCATACGCGATGCAGTAACCCAGAGAGTTAACCGTACTAGTGGAAGCAAGGCACACTCATCTTACCCAACAGTGTATGCAATAAAATGCGGTACGGTCAGATCTGATCCGAATTCGACGCGGAATGGAAAATTCGAAGCGTGTTGCCTGACTGCGATCCTTAAATCAGGCAGTCCCTGACAAAAGAATAGGCTGTCAACTTCCTTGAAGTAAACTACTCTAATCGTGCCGGGACTAACGCTAAGCTGACCCAAATGTGAAGCCGGAGTGCACTCAGCGGTTCGATAGGCACAGCGTAATGACCTCCATGTGCGAGTAGGCAATCCGTGATTACCATACCGCACCAGCATATAAATTTGGTTAAAGCGCGTGGACGGTTGCGACTGAATGAAGCGGCAGTACTGAAGGCGCCTTCTAGATTCAGGATAAAGCATCTCAGCTGAATTCTGGTCTCCGCATGGGGTAACTCTGGCGATACATTATTACCCCATTTCTGAAGGCCCGGGGAAATGGGAAGAAGTCGGCCCGCTAAAGAAGTGATTTTAAATACGGTAAGGAATCTTTACCCCTTAAAATGCCACAGTGAGTAATTACCGGTGGTATCCGATCCAATACATCGCTATTGGACATGACTGAACTCATTAGATGGGTTGAGAAGCGCCTTCTTTTACGCGCAGGGAATGCAACCAAATAAAGCGCTATTCGAGTTCAGTACCAAAGCAGCACATCAGCAAACAAGGGTCACCGAGTACGGCGCTTGATTGGATAATAGAAGCACCATCCCGAGTATCAGCCTCCTCGCGGCACAGAAGCAGCGAGATCGAAAGCGCTCAGGAAGCTCTCCGTACTTAATATGGTCTCCGTCGGATTGGATGGCGCGTACTGGTCATGCTGAGTGCGGCGAACCAAACCGGCAGTGTTGGGGTTAAGGCGGCTGAATTGTTCCTAGATCCTTTAGGATGGCTTGTAACCGGCCTCACGATTGATCCATAGGCGCATTCGATTGATCGGCGCGAGTTTTATTCCAAAGCTAATCCGCTATCGTAATGGCATTCAGCCCTTGGGGCACTTGCGTCTCAATCAATCGAAGCATCGACCTCGGCAGTGAGAGGCAATCACAAGAGGGATCAAGGGTGAGGTCCTGCACTCAGTATTTCGTCCGTTGACCTTAGCGGATTTCAAAGGTGTCACTCAATGAAGCAAGGCGCGGGGCAACGCTAATGCATTATAGTTCCTGCCTGGCAAGTAAGAGTCGGACTGCGTCGGGTCTCGGTTCAGGGAAGCGAATCGTGAAGTTCTGGGACTGACCCTGGCTATAGCCTGCAGTCTTGTCCAGGTCTCTCTATCCCAATTCGCTCGAATGGTTCATACGTAACCAGTACCAAGGATATCTTCACCAGACCTGCTGTTCCCAAGCCGATTCTTGAGTATGGCCCCAGGACCCATAAAGCGGACCTTCCAGGCCGTTCTTAAACTCACCAATTAAAACTGGTTCCATTCACCAACTGTAACCGGGTTCATGCAGGAATGCCCCCACAGAAGTCGATTGGCATCGCAGAGCTGATATAGGACTGAATAAGACTCGGCCAGCCTCCGAGTGCCCCGCAGAGTACTGCAAACACAACGTGGCGCTTGCCCGGAGTAGACGCTAACGCCGCCCGGACTGCGAGCAACGGCTCTACATTTGCCATTTAAGTATCACGGACTCGTGAGACTTTGGTATGCGAGGTGCTACGCGACATCAGCGTGACCGTCCGACATCAAAGAATTGGAAGCGTCGGTGGCACGTTCGTACCTCAGCATTACAGATCTAGTCTCGCTCGGGAAACTAAGGGGTCTCTGTACCCGGAAGCAATGTCTAACGGTGACGCGAAGGTCTTCCGCAGGACCTATTAATCAGCCGTATCGCTAACCTTACCGCCCTTCAATACGGACTTTCCCGTAGTCAACCGAGACTGATTTTCGCAAGGCATTGATTTCGGGTTCGGGGCATCCGCTGCAATGCTTGCCTGATCCAGGGAGAAGATAATAAACTATAGCGTGCGACCATCCATCGGTCCTCTGGAATCCGTACAGTTGCCAATCCAGCCCCTCCGCATGTTACACCCGCCAGGAGGCAAGGTCTCGAGCTAAAGGATACCTAAGGCTCACTGTACGAATGCGAACTGATTCTAATCGGCAACCATCCGAAATGCTACTAGACCCGAACACATGCGCACGATCTACTGCACACATCATTCGACCTCACGGGACCGACAGTTCTGAGTACGGTCTCGCCACCAATTTGACGTGCCAACGGAGATTCGCACAACTTGTAACTAGATCGCATGTGCAGCCCATACCGGAGCATTCTACCTCGAGCGACTTCGGGAATCGCCAAAACCGATGCGATGAAATTAAAGGAAGTCCGCGTGTACCGCGCATGAACCGAGAACTGACTATCAGCGATCCCGATAACAGTGCGCCGCAGGAGAAGCTAGTACTCGATGGCGCCCAGCCATCCACTCGAATGAGTTGGCCGGGAATGGTTTCTAATCGCGTACGGTGCTGCATCTCGTTGACTCTAGCGTCGAACTCCAAGACAGACCAACGCCCTACGCATCGGAACGCAAAGGGAGGGCGCGGAAGAATAGACACGAGGAGCGAGACCCCGACCTGATCCCTATTCTAAAGCCACCTTAGGCCGCAAGTTACTCTAAATGCCATCAAGCCGGACCAACGGTATAACCACGGATTCAACCGCACGAGCAACGCGACGACCTTACCATCTTAAGTTAGAACTAGCCGGTGTAAACAATCACGTCACAACATTGACGCAATAACACTGACTGCTTAGGGACACCCTACTCTCCCGATTAATGAACGCGACTTCACGGCAATCCGGGTCTTGCATCGAGCGCCTACAGGAATCTTCGGTTTAATAAATTACCGGAGTTGCATGGGTCTACGAAGCTGCAAAGGAAGCGATCAACCGAATCGAATGCCCTGGCTAACGCCGACTCACTCTCCAAGCAGCGCGTGGCAAGGCAGATCAAGCGGAACCGAACCCACCCCGAAACCTAAAAGACCTGCAACGAGCAGGATTGGCACGAACCGTTCTCAAATCTAAATGAATTCGAGCTGCTCGTTGCACTCATCTACAGCGAAGCAATCAGGCATCTCCCCCGCCCAATAACGAACTGCTTACGCGTAATTCCTCGAACCGTGCAGGCTCTAGGAAATATGAAGAGGAGCCAATCTAGCATTTCTTAGCAGCTTGCTCGCATCCGGAACCGCACGCGATCGGATCACCCACTAGATTCTGGCAGCAAGTAACTTACGCGATATTCGGTTGGCAATGCACTTCCAGCCCCGAACCGTAGGACATAACCGACGAACCCAATTCATTCAAGCCACATCCTTAACCGTACCGGACTTTACGTTATTGATCTGCAGCAACATTTCGATCATGGAATCCGTAAAATTTCCACTTTCCGCCTAGCTGTACGTGAAGCAACCAGCAATCTGATTACTGCATGCTGCACTCTAGAGTGCAACACTTCCTATCAACCTGCTGCATCAATCTAACTTTCTTTAATCTAATCCACGCAATTCTCAACAACTGGTTCCACAATAAGCAGCCGATTCGTCCGTAGAAGTATGGATCCACGGACCTCCGCTGGTTATCTGCACGCCGATTATCCGTGCTGCTGAATACGAGTTCTGACCGCTTTACTCGTGAGCGCCTGGATCGCGGCCGCTCCGATCGCAGCAACAGAACGGGGTGATCCAGGGATGCCCACCCACGGACGCTTTCAAATGGTCCAAGTCAACACAGCAATCATGGATAGCGTTGCGGACCGCCTGTGACTCCATCTAAGCGCAGTTCTGCACGCATCAAAGCTTGGTCCCCAACCCCATGCGAATAGAAGGACGCACATCGAGCCGCAGCAACCGTTTCATTCCGACCTCATCTGGAGCTAAGCCCTAAATCGAACATTTATCACCTACTTCGAACACTGCAACGGATATGCATACGCAGCGAAGCCGACCCGCCAATTCCTTACTCCTGCGAGCCTTCTGCTGCTAGCACGACTCGATCGACCCCGAATGAAACCGACAAAGGCCACCATCAACTATCTGATGCAATTGCGCACAAGGTATCGGGGAATACCGTGTGGCAAGAGCTTGAATGAATACTAAGGCAAAGGTATGCAAGTGCTGACAAGCGTTAGATGCGGATTATTGCCGTAGTGCCCGCGACGGGACGGGGCAAGATGCAAGATTGGCCATGATAGGACGGTCCGGTTGATATTGCCACAAAGCCAGAGCTGTGGGGGAGTTAGAAAGAGTGGGCGGAAGATGCAAAGGCGTCGATTCAAGGATGCCAGCAGCAGCAGGTACGCGCTGTACCCGCTAATCCCAAACCTTACCCAACCACTGGTCACGCAAATTGTCCTATAGAACTGCTCTGGTGCAATCCAAAGAAATCATGGTACGCAGACAACATTTGAATCCGGTCACGGTTAGCAGCATGATTGCCACGATGGCAACATATTAACGGCATGATATTGACTTATTGAATAAATTGGATTTACTGAATAGTATTAGATTCGCTCGTTGTGGTAGTGAATACCAGGCGGCGCTTACTACGAATTCCCTAGTTGGTCACTTCGACGTATCGTCTGGAACTAAACAACCATCGCAGGCAGAGATCTGCAAATGCAATCCCGAAACAGTTCGCATATAATAGTTAGAGCCTGACGAGACGCTTCCGTGTAGACCTGGCACAGAAGGCCGAGGATACGATCATAGTAATTGAAGAGTCGAGCCTGGTTAGCCAAGTCGGGTTTGCGTTGTTGAATGATAGTTGAATAGCATCTACAGAAGCAGAACCCTAGTACCGAATGCGTACAGGCGTCATCCGCCGCCCGGCAACAGGACCAAACTGAGCCGTAGCCACCGTCTTTATGAATTCATTAGTAATAGATTGGGTGCGGCCTTTACACATGATTCGTGAAGCGGGGTGGCAGGAGGTCGACAACACTCCTGCCGTTTGCCGTGCATATCGGTCACGAACAAATCTGATTACTAAACGAGTAGCCTGGATTTGTTCGTAATCACGGCCTCTATTATTCCTAATTAAAATAGAGCAAAATCCCTTATTGGGGTAACATGAAGATGCCAGAAAGATAAAACTACTGTTGGCCGCCTTCGCGGCAGGGAACAAGGCATCGGGGCAATCCTGCGTTTGCAATGGGGTCCTTCGCGTAACCAGATATAATGGCGGTGCGCGTTTACAAAACAGTAATCGACGACGCAACGATTAGGGTGGCCACAAGTCATTCGGTCTTATTCTCATTCGTACCTCCTAATAGCCCACTAAGTAGCAATCGCTTATAACGAGCGTGTTATCGGCTACATCCTATCTGACCGTGATTGACTGTTGCTTATCAAACTCGGTCGGTAAAAAGCCAGAAGCAGAGCGTAGAAGTAATAATCAACGTAAGGCTCCGATATGCTCCGAGTGCTTTAGGGGAATCTGATAACGACCACGTTACAGAAAGAGAAGCCGGTGATCATAGGGTGGCTAGAGAGATTAAGCTTACTCCATGCGATCAGCGCAAACTTGTCACCTAAACCCAAAACTCAAATCAACATAGGCTGGACTCAGCTTCTTTCCCGTTGGTGGGATGCCTACCGCAAGCAAGCTTAAGCCTGAGGACACTTCTGCGAAAAGTCAGGACGCTTGGCATGTCGGCAGCAAGATTAGGAGCATGTGGCGCTTTACCTATGATTGATCGTGATATCCGTCAGGCAATGAACCGTTGCAGCATAATATCTGGGCTTCAATGCCGGGCGTGTATGGTCAGTTCGAGCATAAGGCTGACAGCCTGAATGTGCAAATTCAAAGATCCGTCGAACGTTACAGAGATTGATGTATGAGCAGAGTCACCTAGAATTATCTAGGCTGGTTATCTGCATCGACATCGTCTTCATGTCATCTAGGTTGCTGCTTGAGTAACGCTAGTGACAAAGCCCAGCGCGACAATCCGATAAACGAAGCTGGCGAACCGGCAATTGACTCTGCATATTGCGTCAGTGGTTGTTGCTATCCGGCTCGATGCAAATAGAAGGAGTCTAGTACACAGCTGAAAGTGATGGGTCCGTGATGATGATGTTAGGTGGTCGTCGGTTTGCACATCAAAGCAGTCGTTAGTCAGTCGTGAAGCCACCACTCTCCGGCGATAAGCCCTCCCGAATAGGCCGAGACCAAGACAGCTGAACGCATTATTCAGCCCTCAGAGAGAGGCTGATCACTTAGCTGGCAAAACAAAGGCGGAATAGAAGTAAACCAGACCCACGGCAGTGCAGATAGAGTGCCCATATCAATGGCAACTCAGGCAATTATTGGCTAATACACGCTTCCATGAGTAAATGCTAAAGTAATAAACCGAGCAATCCATTTACGAATGTTTGCTGGGTTTCGTTGACAACATTTCTGCCGCCACAAATGTATGCAGCATGAAGTTCTTCTAGCCAATTCCAGAAACGAAGAAATACGATGGTATGTTTCCTTTGGTGCTACTGCTGCCGGTTTGTTTGAACAGTAAACGTCTTTCAGCACATCCTGTAATAAGCAGGGCCAGCGCAGTAGCGGATAGCATTTTCATGGTGTTATTCCGATCTCGTTGAAGTTCGCAGAATCGTATGTGTAGAAAATTAAACAAAGCGGACCACGGCTTTACGCGTTGGGTTGTCCTATATTTATCCTGTAGTCGGACGTAGTGAGATGAATCGTCAGTTGTATTCCCGGATTAACGTATGTCACAGCCCTGACGGGAATTCTCTGCGGGGAGTGTCCGGGAATAAACAAAGGCATGCACACAGGGTTTAGCGCGTACAATTATGGCATTATGCCAACGCCCCCGGTGCTGACACGAAGAAAACCGGGTCGGACACTATTCTAAGTCGAAAGATTTGTAGTGTTCTGAATCCTTCATACAGTAATAGTAATGAATTATCAAATAGTAATATCTTTTATGTTCATCAAATTACGATAGGCAGTAATCCTTTAGCATTTCGATGCGACCTTTACTTTAAACAAATTAGCGTGAGTTTTAGAATTAGCTTTACAACCTTTCCTTCTTTGACGCTTTATTTCAACACGATGTGAATATTATCTGTGAGCTACTCAAATATAATGTGAGACGTTGACGTTCTTAGTTCAGAATAAAACAATTCACAGTCTAAATCTTTCAAGTGATCGAATATTTCTTTAAACGCAACCTGAGCCATTGTAAAACCTTCCAGTGGTACGAGGCGGGCTTTTGCATTATCGTTTTATCGTTCAATCTGGTCTCCTGTGTTGTTGATACTTTATGTCAATATTAGAATGTTCACTTAATAGTATTGGTTTGCGTAACCCACAAATCCGGTCCTGCTGGCATTCTGGAGGAAATACAACCGACAGATGTATGTAAGGCGACTATGTGCTCAATCTTCATACAGAAGATTTGAAGTAATATTGACGCTAGATGAAGAGCAAGCGCGATGGAAGGGACAAAATGAATAAAGAATAATCTGCTGGTATTAAGCCGGTGGATCTGATTCGTGTAAAAACTGCTTAATAGCACCATTTCTATGAGTCCCTGGTTGTAATTGCATGAGGTCTGAACATAAAGTGTCTCTGGAAGCATTCAGCAATTGAGGCAGCGTTAATCAAGAGTATAATAATATGAAGGATTATTCCCTGTGGTTGACTGATCACAGCCATAACTGCCTAATCATCAAACTATTTAGAAGTTGGTCAGCACAACACGCATGTCGTTAGATTGAGGAAGTGGTAACGCAATGAAGACGATATGCTGCATTCCGAGTAAGCATACGAATTACAATATCGTCCTGTCGGAGGGAAGAACGCGGGATGTTCATTCTTCATCACTTTTAATTATATGTATGCTCTTTTTCTGACGTTAGTCTCCGACGGCAGGCATTCAATTATACCAGGCTAGAAATTCCCGACTGGCTTTTAGCCGACGATGTTAATTTGTTCAATCGTTATTTGGGGAGCAATGTCCGGCTTCGTGTTGTTCTGCGGGTCTTCTTCGTTGACATGAGGTCCCCGTATTCAGGTGTGCTGATTGTATTGTCTGAAGTTGTTTACGTTAAGTTGATGCAGATCAATTAATACGATATGCGGTAGATTGATTATTTGACGTGGTTGATGGCCTCCACGCACGTTGTATGATATTAACTAGCTCCTTATCACTTTACGTACTTCGGGGTATTAAGCTAGATCG
>98
GTTCGTAGTTACCTGTTTAAACTCTGCAGGATGCGTGTAAGGCGAATTCAGGCATACGGGTCCAGAACACCTTAACCGATAGAAGTCAATCGAGAAGATCACCGTTAATAAACCGTCAAGACAGAAACCAGCAAACGGTGAGCGGGATGGAGAAGCAGATGGGGAGACGGACACCAGTCTGCATGGACTAGTATTCGTCGTGCCCGTTAATACGACGTTCAAGCATAACATTCCATCATCTATACGGACGGACGAGGCTCCGAAGAGACACGACGTGCATTACGTTTTCATGGATACCAGGTTGTGAACATCCAATGACATATCGGTTTAAGGAAGTTGAAGTTCTGAGATACCGCTCACCCGTATTGCAGGTTGATATCAAACCCGGAGCTTGTGGACAGCCAACCGGTTAACGGTATGGGAACCAAAGGATATTCAGACGCGAATGCCTGTTCTGAAACCCATTTATCGATATGGTAAAATATGGCACTCCATACGTCGGCGGCGCGTTCTGCACCTATGACAGATTAAATTCGTTCCTTCACAAATACTCTGTGATGACCATTTCGGGCTAGAATTACCACCGTCATTAGCATCAGAGCTGATGAGGCAACGCAAGGCTAAAGCCAAACGCCTGGAATCAGATATCTTGCTGAAACTGTCAGACTTTGTAGAAGAGGGAAGATACGCGCATGGTCGAAGAGCAACAACCATTCGGATTTGCGAGCAAATACCCCGGACACTCGGTAACTGCAGCTTCTGCATTAAAAATCAACGCAAAATCGGACTTGCCTGCAAAGATGAGGAGGGATTGCAGCGTGTTTTAATGGCGGTATCACGGGATCCCATGTGCGATTAGACATCGGGAACCGCCAAGGAGATTATATGTACCCCAGGAAGAATGTCGCTTAACGTATCGCGACTGTATTCAGAAGGTATTATCAAGCCCTGTATAGCAGGACAACTGGTACGAGCTAAGGAAGATTCGATACCGGCTCTTGTTCTGAGTCATGGCGAAATATTTGGAGGCAGCTTGATTTCGACTTCGGGGAGGGAAGCTGCATGATGCGATGTTATCGGTGCGCGGTGAATGCAAAGAAAGACTAAACGCTTCCGACCAAATCAAACCTTGGAATCGATGGTCTCCGTGAAAGAATCACCAACAGGGGTTACCACCGCAGGAAGGAGGACGTGTGTGAGACAGCGACGAAGTATCACTAGACATAATCTGCGAACTGCAAATACCCTTCCAACGAAACGCACCAGAAGGTAAACCCAAGCCAATCCCAAACGAAGTCCTCAACGTAAAAACCTTCAACTACACGGCTCACTTGGGTACATGCTCCCTAAGACGTCGTGCGGGAAAACAAGGTGATTGACCAAAATCGAAGATCTGAATAAGAAAACCGTCGAGTCCTCTGAGCGTGCTAACTGCGGTCAGAAGCTGCATGTGCTGGAAGTTCACGTGTGAGCACTGCTGCGCAGAACTGATACGCGATTAGAATAGCTCGATGCACGGAGGAAAGAAAGTGATGGCTAAACCAGCGCGGGACGCCGGTAAAAACGATGAATGCCGGGAGAATGGTTTCACCCTGCATTCGCTAATCAGTGGTGGTGCCTCCAGAGTGTCCGAATCAAGATAGCACTCGAACTACGACGAAATAGAAGGGAAAAGCAGCAGAGAAGAAACGACGACGAGGAGCAGAAACAGAAGATAAACTTAAGATTTCGAAAACTCGTTAAAGCCGCAGTTACTGGATTAAACAAGCCCAACAAGCTGTAAACGCCTTCATCAGAGAAGGGAACCGCGACTTACCTCCGTATCTCCGTGCCGACCGCTCACGTCTGCTCAGTTGGGGTTGCCCGCTAACATTACCGGACAACTGCTTGCGGCACCTCAACTCCATTTTAATGAACGCAATATTCAAGCAATGCGTGTCTTGCAACCAGCACAAAAGCGGAAATCTCGTTCGTATCGCGTCGAATGACCTGATTAGCCGCATCGCATGGCAGGAAGCAGTAGACGAAATCGAATCAAACCATAACCGCCATCGCTGGACTATCGAAGAGTGCAAAGGCGATCAAGGCAGTATACAACAGAAATTCAAAAAGACTGCGAAAACCTACCAGAAGTGAGGCCGCATGACGTTCTCAGTAAAACCATTCCAGACATGCTCGTTGAAACATACGGAAATCAGACAGAAGTAGCACGCAGACTGAAATGGGTCGCGGTTGGTAAATGTCAGAAGTAGTCGTTGATGATAAAAGAACGGAAAATGCACGCCACATCGTTCAACGACGTTCTCATGGTTCATCGCGGATGGAGTGAAAGAGAGCGCTATTACGAAAATTGATGGCAGCAAATCCGAAATATTTGGTAGTTGGCGATCTGCACGGTTCAGCCACACGAACCTGATGAACAACTGGATACGATTGGATTCGGACAACAAAAAGACCTGCTTTATCTCGGTGGCGATTTGGTTGATGGTGCAGAACGTTGAATGCCTGGAATTAAGCACATTCCCTGGTTCAGAGCTGTACGTGGAAACCATGAGCAAATGATGATTGATGGCTTATCAGAGCGTGGAAACGTTAATCACTGCTGCTTAATGGCGGTGCTGGTTCTTTAATCTCGATTACGGACAAAGAAATTCTGGCTAAAGCTCTTGCCCATAAAGCAGATGAACTTCCGTTAATCATCGAACTGGTAGGCAAATCAAAAATATGTTATTGCCGCGACCGCCGATTATCCCTTTGTAACGAATACCGAGTCGGAAGCCAGTTATTGGTCATCACTACAGGTAATGGGACCGCGAACCGAATCAGCAACTCACAAACGGGATGGTAGTTAAAAGAAATCAAAGGCGGGACACGTTCATCTTTGGTCATACGCCAGCAGTGAAACCACTCAAGTTTGCCAACCAAATGTATATCGATACCTAGCATGTTCTGCCGGAAACCTAACATGATGCTTCAGGTACAGGAGAAGGCGCATGAGACTCGAAAGCGTAGCTAATTTCATTCGCCGACAAAGCCCGATGATGAGCGACTCACCACGGGCCACGGCTTCTGACTCTCTTTCCGGTACGGTATGTGATGAGTCTGCTATGGGGGATGGCGCAATCACAAGCTCGGATTCGGTATGGCTGCATTCTGCGGTAAGCACGAACTCAGCCCGAACGACAAACAAAGGCTATCAACTATCTGCGAGCAATTGCACAGGTATCGGGAGAATACCGTGGTGTGGCAAGGCCTTGAAGGAAATACTAAGGCAAAGGTATACTGCAATCTAGCCCCGGCAACATTCGCTTATGCGGATCTTATTGCCGTTAGTCCGCGACGCGCTCGGGGGCAGATGCAGATTGCCGGAGTGGAGCGTCCGGTTGATATTGCCAAACAGAGCTGTGGGGCGAGAGTTGTTAGAAAGAGTGCGACAGTGCAAGGCGTCGGCTATTCAAGGATGCCAGCAAGCGCAGCAGACCCCTGTGACGATGCTAATCCCAAACCTTACCCAACCCACCCTGGTCACCTAAACTTTGGCCTACCCGCCTGTATGACGCTCTGTAGTGCAATGCCGCCACGAAGAGTCATAATCGCAGACAACATTTTGAATGCGGTCACGTTAGCAGCATGATTGCCACGATGAAACATATTAACGGCATGATATTGACTTATTGAATAAATTGGTAATTGACTCAACGATGGGTTAGGATTCGCTCGTTGTAGTGAGATGAAAGAGGCGGCTTACCGATTCCGCCTAGTTGGTCATTCGACGTATCGTCTGGAACTCCAACCATCCCGGCAGAGGTCTGCAAAATGCAATCCCGAAACAGTTCGCAGGTAATAGTTAGAGCCTGCAGACCGTCATTTCGGGAGTTCTATCTGCACAACAGGTAAGCATTCGTGATAATCGTGAAAGAGTCGGCGAGCCTGGTTCCAGTGCTCTTTCCGTTGTGCTGAAGCAGTCGAGAATACCGGAAGCAGAACCCACTTACCAAATGCGTACAGGCGTCATCGCGCGCCGCAGCAACAGCACAACCGCGACTGAGCCGTAGCCACTGTCTGTCCTGAATTCAGGTTAGTAATAGTTACTCATGCGCTTTGTCACATGATTCGTGAATTGCGAGCGACCAGGAGGTCGCGCCTAACACTCCCTGCCGTTTGTCTTCGATCGCGTTGGCATATCGGTCTACGGAAACAAATCTGATTACTAAACACAGTAGCCTGGATTTGTTCTATCAGTAATCGACCTTATTCCTAATTAAATAGAGCAAATCCCCTTATTGGGGACATGAAGATGCCAGAACAGTACTGTTGGCCATTCTCGCGGCAAAGGAACAAGGCATCGGGCAAATCCTTGCGTTTGCAATGGCGTACCTTCGCGGCAAGATATAATGGCGGTGCGTTTACAAAAACAGTAATCGACGCAACGATGTGCCGCTTATCGCCTAGTTCATTCGTACTTCTCGACTTCGCCGACTAAGTAGCAATCTCGCTTATAACGAGCGTGTTTATCGGCTACATCGGTACTGACTCGATTGGTTCCCTTATCAAACGCTTCGCGCGTTAAAAAGCCGATAGAAGATGGTAGAAAATCAATAATCAACTAAGGCGTTTCCTCGATATGCTGGCGTGGTCGCTGAGGGAATGATAACGACGTCAGAAACCAGAAGAAATCATGGTTATGACGTCATTAGGCGAGGAGAGCCTTTACTATTACTCCGATCACCGCAAACTTGTAAGGACCCCAAAACTCAATCAACAGGCGAGCCGACGGCTACCAGCTTCTTTCCCGTTTCTGCTCATCCTACCGCAAGCAGCTTGGCCTGAAAGACTTCTCTGGAAAGTCAGGACGCTGTGGCATTAATGCAGCAGATTAAGGAGCGTGGCGGTCGTAGCTGATTGATCGTGGTGATATCCGTCAGGCAATCGACCGTTGCAGCATATCTCGTATTCACTGCCGGGCGCTGGTTGGTCAGTTCAGCAGGCTGAATAGCCTGATTGCAAATTCAAAGAAGCGGGCCGAACGGTCAGATTGATGGCTGAGCAGAGTCACCGCGATTATCTCTCCGCCCGCTCTGGTTATCTGCATCATCGTCTGCCTGTCATGGCTGTTAATCATTACCGTGATAACGCCATTACCTACAAAGCCCAGCGCGACAAATGCCAGAAACGAAGCTGGCGAACGGCGGCAATTACGACATACATGCAGATGCGTCAGCGTGATGTCCTGCCTCCATGCAGAGCCAAAAATACGAAGGAGTTAGCATGGTTAAAGGCTGAAAATGATGCTCGTGTGCGTGATGATGTTGCCGCTGGTCGTCGTCGGTTGCACATCAAAGCAGTCGTCAGGTTAGGTGCGAACCGCCACCGCCTCCGGCGTGGATAATGCAGCCTCCCGACTGGCAGACACCGCTGAACGGGATTATTTCACCGACCAGAGAGGCTGATTACTATGGCAAAACAACTGGAGGAATGAGAAGTATATTAATGAGCAAGCAGATAGAGTTACGCCATATCGATGGCATGAGTAATTCAGCAATTATTGTAGCAATACACGCGCTTCCAGCGATAAATGCCTAAAGTAATAAAACCGAGCACCGGATTTACGAATGTTTGCTATCTGGGTTTCGTTTTAACAACATTTTCTGCGCCGCCACAAATTTGGCTGCATCGACAGTTTTCTTCTGCCCAATTCCAGAAACGAAGAAAGCTATCTATAAGTGGTTTCCCTTTGAGTGGCTATGCTGCCACGTTGTCATTTTTGAACAAGTAAACGCTGTTGAGCACTGCTGTAATAAGCATGAGCGCAGTAGCGAACAGCATTTTCATGGCGTTATTCCCGATGCTTTTACCGGCAGAATCGTATGTGGCAAATGCTAAACAAACCCTAAACAATGAGTTGAAATTTCATATTGTTAACTTTATTAATGTGCTGTCACTGTGCGATGAATCGTCATTGTATTCCCGGATTAACTATGTCCACAGCCCTGACGGGGAATTCCTGCGGGAGTGTCCGGGAATAATTAAACTCCGATGCACACAGGGTTTAGCGCGTACACGTATTGCATTACTGCCAACGCCCCGGTGCTGACACGGAAGAAACCGGACGTTATGATTAGCGTGGAAAGATTTGTGTAGTGTTCTGAATGCTCTCAGTAAATAGTAATGAATTATCAAATATAGTAATATCTTTATGTTCATGGATATTTGTGACCCCATCGAAAACTCCTGCTTTAGCATGATTTTCCCTGTATTGCTGAAATGTACTTCTCTTGATTTCAAGCTCATCGGACGTTTCTATAAGATGCGTGTTTCTTGAGAATTTAACATTTACATCTTTTTAAGTGCTTTTATTAACACGGTGTTATCGTTTCTAACACGATGTGAATATTATCTGTGGCTAGATAGTAAATACTGTGTGAGACGTTGTGACGTTTTAGTTCAGAATAAAACAATTCAAGTCTAAATCTTTCGCATTGATCGAATATTTCTTTAAAATGGCAACCTGAGCCCGCTTGGTAAACATCTTCCATGTGATGAGGGCGCGTAGTTTGCGCATTATCGTTTTTATCGTTCAATCTGGTCTGTACTCAACGTGTTTTGTTGATGATTTATGTCAAATATTAGGAATGTTTTCATCTTAATAGTATTGGTTGCGTAACAAAAGTGCGGTCCTGCTGGCATTCTGGAGGGAACAGACTCGACAGATGATGTTGTAGGCCAACGTGCTCAAATCTTCATACAGAAAGATTTGAAATAATATTTGCACGCTAGATGAACAGCAAGCGCATGGAGCGACAAAATGAATAAAGAACAATCTGCTGATGATCCCTCCGTGGATCTGATTCCGTGTAAAAATATGCTTAATAGCACCATTTCTATGAGTTACCCTGATGTTGTAGTATTGCATGTATAGAACATAAGGTGTCTCTGGAAGCATTCAGAGCAATTGAGGCAGCGTTGGTGAAGCACGATAATAATATGAAGGATTATTCCCTGGTGGTTGACTGATCACATAACTGCTAATCATTCAACCTATTTAGTCTGTGGACAATAAGCTGACACGCAGTTTGTCGTCACTGTCGGAAAGTGTAAAACTGCAACTCAATTACTGCAATGCCGCCCTCGTAATCCGTGAATTTACAATATCGTCCTGTTCGGAGGAAGAACGCGACACGTTCATTCTTCATCATTTTAATTGATGTATATGCTCTTTCTGACGTTAGTCTCCGACGCAGGCTTCAATGACCCAGGCTGAGAAATTCCCGACCCTTTTGCTCAAGCGATGTTAATTTGTTCAAATCATTTGGTTAGGAAGCGGATGTTGCGGGTTGTTCTGCGGGTTCTGTTCTTCGTTGACATGAGGTTGCCCGTATTTCAGTGTCGCTGATTTTGTATGTCTGAAGTTGTTTTTACGTTAAGGTTGATGCAGATGTCAATTAATACGATACCTGCGTCATAATTGATTATGTCGACGTGGTTTGTCAATGGCCTCCACGCACGTTGTGATATGCTTGATAATAATCATTACTATTTACGGGTCCTTTCCGGGTGATCCGACAGGTTACGCGGCGGCGACCTACGCCGTTCTGTTATGTAG
>99
CTGTTCTTTCGTGGTGGTGAGTCCGTTGCTTGGGTGTTTAACCTTCGTCAAAGTTAACCAGCATCTGTTAGGATGTTTCAGCGTACCCCGTAAATCCAGTCTGTTTGTCACGGTTACAACAGTTTTGGTTAGTATTATAAGATTAAGTCCACGTTCTAAGTCGCCACGTTTGGGTTTCTAGGTTGGGGTCCAACTCACTTAGACAGAATTTTGGCCCGGACTCCATCGAACAGCGCAAGTTGGGCTCGCGGGTCATCAGACCCAATCGACGCACCCGTAAGATGGGTCTACAAATCTCGTTACTCGTCCCTACGTCTCACCACGTTCGCATCAAAACAGGCATCGGTTCTTCGCGGGGGTCCCTGCTTTCTGTAACGCCTCGCTGCTGCCAACGTCTTCTGAAATCCTGAATTCAAACTATGCATCTGCTACCGGTCAAGTTAAAATGTTGTAGCCGGTTCGGTGCTTATATCAGGATCGGGAGCCGAGTTGAAACCATTTCGCAAATCCCGTTTCTGACGATTTAAAGCACGAAGCATTCTTTCTCCGATTCTCTATGGAGGCATCATTATGCTTTTTCTTTCTTTCGCTGTGTTTGTCTTATACCTAGGACTGTTTCGCAGTAACGATCTCACCCATTCGGATGTTCCCTCGTTTTCCGCGATTTCCCTCGTTCTACGCAATGCACCATTCATCGGAGATTGATGTTTTATTTGGTCAAAACCGCTTCTCACGCTGCTTAATATTCATTCGTTCTGACGAGTTCTAACTTGGCTCCATTGCACCGTTTGACAGGTCGACTTTGTAATCTCGGTAAGTTGAGAACGCAAATCGCTTACGATTCTGTCTACGGTTTATTCATATTCGACGATGATGTCGTTTTACGCAGAATGGCAAGCAGCCCCACTTTAAACTGTCGCCTGCTTCCACGTGCCTCGCCCGAATAACGGACTCGCCCCTGAAGCAGCATATTTGATAGTCTGGGGGCCGGTAACCATCATCGCGGGAGATCTGCCATTGATTACGGCTCCCGTGCCTTAGCAAAGTCTCTGCCGAAGTTGTATGCATTTTGGTATTTTAGTACCGATTCCTTGTCATAGGTACTGTAATGATTTGTGACTCTAAGTGCATGGACTCGAGAACGAAACGCTTCGTTCGCTGGCCGCTCGGTCGGGCGTTTTTATTGGTGAGAATCGCAGCAACGTACTAGCGCCAATCGGATCGAGCCATGTCAGTCGTCAACGACCCCCATTCAAGAACAGCAAGCAGCATTGAGAACTGTCGGAATCCAGTCCCTCTTTACCTGCTGATCTGCGACTTATCAACGCCCACAGCTTCCGTCTTTGCGTCCGGGATCCCAATTTGTTCACGAGCACTCCATAACCGGCGTTAAGCTTACAACGGCAAGTTCGATTCGGCGTCAGGGATGCGTATCCTGGTGTTCTATCGACTAAATTGAATTAGGATGATCTCCGACTAATGCAACACGCGGTGATTTGAATCTCGTTTCGCAATGGAATGTGCCCACCTATAAGCGGATTATTCTAATCCTGTTGTTCTAAAGGAAGGGGTCGTCACACCATGGAGGTTTCGATAGGCCCCGTTATAGTTCGTAAAATTATTTCACCTCCTGCATAACGCTCGCAGGTCTTGACGCTTGTTAAAATCGTGCGGTCCTCCGCCCAATCTTTAATCCTGTTTGTGTGATTCGCCCCGTCACGCCCATTGCGGCGCTGTATTTCAAATGCATTGCCTAATCCTGCAGTTCAGGCTCAGGTCGCGTCGGTACACTTCCTCAGTACATGCAACCATTAGCCCGCTATAAATAGTCAACACGCACGGTGTTAGTATTTTATCCTTGCGGTAGAGTTAACGTATGAGCACAAAAGAAACCGGTTAGACAAGAGCAGCTGCACGGACGGACGCACGTCGCCTTAAAGCAATTTTATGAAAAGAAAATGAAATGGCGGCTTATCCCAGGAATCTGTCGTCGCAAGACGAGCAGATGGGTATCGGGCAGTTACGGTACCTGTTATTTAATGGCATCAATGCATTAAATTCACGGTAACGCCGCTTTGCATGAACAATCGCCAAAATTCTCTCAAAGTTAGCGTTGAAGAATTTAGCCCTTCAATCGCCCCAAGAAATCTACGAGATGTATGAATGGCGGCCGGTTATAGTATGCAGCCGTCATTAGAAGTGAGGCTGAGTACCTGTTTTTCATGAGCCGAGGCATGTTCTACGCCGGGACCTTAGAACCTTTACCAAAGGTGATGCGGAGATGGGTAAGGCACAACCAAAAGGCCAGTGATTCAATGGCTTCTATAGTCGATTGAAGGCTAATTCCTAAGTGACTGAAGCCACCAAAGACAGGCTCCAAGCCAGACCTTTCCTGACGGAATGTTAATTCTCGTTATACGTGAGCGAGGGAGGCCGTATTTCGCGCAGGTGGATTCTGCGACAGACTTGGGGTGATGGCGTTTACCTTCTAGGATAACGGTACCGAGCGGTCGGTCGTTACAGGTCAGGGGCCTAACTATACAGGACCCAATGGGTCCCGATAATCCAGATGGGTACGAGTGTTCCGTTGGCGGGAAATTGCTCGTCAGTGGCCTGAAGAGACAGGTTCTATAATCCAACGCAAGCGTCGGTCGCAGTCGTTCTTTACAACGAGCATACGAATTTCACTGGCACGAATCGTGCAAACGAATTGTCGGAAACTTCTATACAACAGATCAACAGTAAATGGATTGAATTATGACGCAAGGGTCCTGCGTCCAACTTACCGCAGCCAAAATAAAGGAAAGATAAGCGCTCAATAAATCCTGTCTGTTTCCTTAATTCTATCGATAATGATACCTGCATGCAGGATCCAATTATTTGTGGTATTCATAAAATCGATGGAAAACTTTTCTCTTTACAAACAAATGACAAGAGTCTGGTTCCCAAATACCAAATGGGACGCTTCTAAGTTGAAGATATATTAAGAACAGCCTCGCAGATGACGAATCATTGGGATTCCCATCTTTTGTTTGAAGGCGACACCATTGGTTTTGTGCCAGAACTGTTCGGGGTAGAACCACATCCGATCTGACAGATTTTAATCGGGAAAGGAATGTCATTAAGCATGCGTCAGTGGGAGAGGCGTTCAGATAAGCCAGCCACTGATGTATGAGGAAATACCAAAGACGATGTTATGCATATGCATTCATTTCATCTAGATAGAACAACGGTGAAGGTAGAAGCCAAGCTACCTGTATTTGGCGTATTTAAAGGTCTGTAGAAGCCAGATATTGAAGGGGAGCTTTGACTCATTATGGATAGTCATTAAGCCAAATTAAAAGGGATAAAATGCTAAGGATATTATTTTATACGTCACCCCAATTTTCAGACATTATCGGGCAAAGATGAGGGCCGGAGATATGTTGTAACAGAACATTATCTATCAGAAAATAGCCATCTCATGCCTCTGAACACAGTACTAAGATGCTGAGATGAAGAGATGAGATCAGTTGAGGCAAGAATGAAAAGTGATACTGGAATGAGGGACGTTAAGGATAGGCACAACCATAGTACGGATTAGTCTAGGAGTAATTATGCGGAACGAATCATTGCCTGGTGTTTACATGACCATAATTCCTCCTTACGTTATCGTAAGCATTTGCAGCTCCCGATTCCTTTCGACGCCACTACATTCCTGGTTTCTTTCATGGGTGCCTCATGAGAATGGTCTTGGGGCGAAGACGACATTGTCATCATGTAATGCAGGAACCATGATTCCAATCCTGATTGCTGCCTTGACCGACGTTTCTCTAACAATCGCCGACGAAGGCACGACCTCAATAGAACTTCTGAATGACTGAGATTAGTTGGGGTCGTGACCCGGGTAGCTGCGCTTTGTTGGCTGGCGTTGTGTTCATCAGGTGGTCCTTCTTTCGTGTATCGTTCATCCCTCTCACGGACTCAACCGTGGTATCCTATCTATAAGCTCCCATTCAATCTTCCATCCTGCATCGTTCATTCATATGCATGCGCTTTCCAAAGGGTATAATTGTAGGGGATATAGAACGAATAACCGAATAAGACCCGCCGGCCCGCTTCGGTTTTCTGCCTCACGATCGCCCCCAAAACACAGATAACCAATTGGTATTTATTGACGAAAGACCGACCTAGATGACTAAACCTACGAACGACAGCAATTCGGATGATCTCTACCAAACATTAACCGCCATCCCGCAAAATAATTCATATTAAAACATACAGATAACCATCTGCGTTAACTAGTCTCTGACAGTGTTAACCTAATACCACTGGCGGTACTGAGCACATCAGCAGCATAGACGCACGCACTGACCACCATGAAGGTGACGGCAAATGTGTAGATTAAGCCCTGAAGAAGCGCAGCATTCAAAGCAGAAGGAAGCGCTTTGGGTGTGCTTCCATCCCGAAACGAAGCATTGGCCGTAATCTGGCGAATTCGGATTAGCTGCCAATGTGCCAATCTGCGGGGGAGCTTTCGTCGTTCTAGAGACGACTGACGGGACTGCCACAGATATACATAAAGGACTAGACTAGAATCCCAATCGGATGCCACGACGCCCGCAATTCGGAACGCTCGTTCTTAATAGAAATACGAGCAGCAAGCTCGACTTTGCCTCACGAAACCCAAGTCTGACTCCTAGTCTCATATTCTACAGCGATCGCAAAACCAGTAGAATGCCGCCGAGGCCATTCGAAATCGCAAAGCCTTGACGGAATTGACTGAGGTGAACGGAATGTGACTAGAATCGATAGATTGAGCCCAAGGATAGCTGTGAGGCACGTGAAGAATCAGATTACGGACCCATTCGAACCGCAACGGGAGCGCTTGAGAATCCAACGGAACGATCCGGAAATCAATGGTACAGGTTAACTGTAATATTGGCGACGCGCATAATCACGTCTCAAGCGTTTACGTGACGCGTCAAAATCTAGACTAAAATGGCAGCCAATTCCGTTAAGCCTAGTACTAGATAGGGAGCCTCTTAGTCCGTCCATGGAACAGTTTGTTCCACCATAGCCAACCTAATCGGTATAAAGTACGCATTGTTTACCTTAAATAACCCGCTGACTTCCACTGCTTCGGTAAGGGGTCCTAAAACCAGCCGTACTGTATTTGACCACGTTGACCAATTATACGTACATTTAGTTCGAAGTGGGTCGCGTTTAGACTTAAATACGGTTATATCTCCTCATCGCGATAATTGCCATTAAGGGCTGCTGAATTGACGAGTTGATTCCGCTGCGGATAAGGGAGCGGAAGTCCATGGAATACGCCGAGTCGCCGTGCCTTAGACGATACTTCCCATCGCGTTATCTCTCTAAATCGCTACGAGTCCCTGGCGGCGTGAGCGGGCAACGTTATTACCAATTAGATCTAACATCTAATTCGCGGCGTGAAATGCATTTCTATAAATAAAGTGAAAGCCACATTATGTTAACCATTCTCACGTAACAGAGCCCCAGTGGGATAATCCACCAGTTACCTCGCGATTAACATAGACGGTTAATTAACGAGGCATGCGGGATTCCGAGGAGCGTGGGCATATTAATCTGACGCTATTAATAACGCGTTAATGTATTGGGGGTCAATTCAGCAGTGATTCGATACGTTGGATCGCATTACCGTTGGCTGGAGGATGGTTTTAATGGAGGTGGGAAATGTTGGACAGACGATATAATGGGCGATACGAGTAGACGATGATGCCCGCGTACCAATCCTCATTAGTACCTTTACCGTTGGCCAATACCGATAGATAACGTGCACTGTGTTGTACGTCGGCTTCCAACGGGACGAACCAAACACGGAGTCATACGGTATAAGACGTAAAAGGATCAGGTGGAGTGTATTCTTTACACTGAACGCGTACGGCGATTCTTGTCCACGTAAGAGATAACATACTCAATGTGCACTCATCGACCCCTTAGTCGTCGACTCGAGCGGGCCCGTGAGAAACTTAATGCCGTAACACGGAACGGGTTGCTCCAGGATGCTATCATTTCTGGTTAAGGTACCCGGTACAATAAAACAACGCCGATAACTGCCGTGGCGTGAAATGTAGGTCCTATTAGCCGCGAGATCCTGTAATGGGTGACGATTTCAAAAGGCCAAGCTTAGTGCATCCTTCCTTGGCAGAGGTCAAAGGATGCCACTCGTGCTCGCTCGTACGAACCGTGGAATGGTTAAAGACGAGGGAGGGTTGGACCCCGCTTAATCCCGGCAATCCCGCATTTACTCGCCGATTAGCTTCCCGCTGGTTTGTTACTTCGCGTAACATCACCTCGGACTGTGCGGTTTACCGCGGTACCGGGACTATAATCCGCCGGCGTTTCGTTATGTAATATGGGAAACCAAATGAGATCCGTAAGTGTTAGTACCACTAATCACTTCGCTCCGATCTTCGCACGGTAAGGACCATTATAATCGTACTTCCTTAGAAGTCACCACGGTATCGACTATGGTTACAACAGGGATCCCGCTACGAATTCGTGGACCATATCTCAGCCGTTATAACTCCGCACTTGTTATTACGATTGGATGTTCGTTGCACGTCGCCCATCGGTATCGTAGCAGTAGCGACGTTCCCCACCTCAGTTCTAAGCCCGCTTTCCTGTTTAAGGACTCCATCCGTTTATAGCCGGAATTTCGAGGGCTTTCCCGCAGAAGCTTCCATCCATACCCAATCGATTCAGACTTGGTGCGGGGCCGACGCTCGCGTTCGGCTCCTAGCCGTGGCGTGAAGGCGAGAGTATCCATCTACGGAGCATCGCTCGAGACTCCCTAGTTACCAGCCCTATTCACGTATAATAGGTGCATGATTCTTCGTTAGAGCGGACAAATCCA
>100
TCCGACAACGCGCCGTCCTGCGGGCCTTCATGTGTTATAAGCCATCGAGTTGCTCATCGCGGACATCAAATTGTTATCTTTAAACCGCGTGGCCTGCTAGAACGCCTTCAGCTAGGTAGGCCTAATAATCATTAAATGTATACTTAGTAAAAGGCTATGCGCGGTCACTATGTTCGTCTATGAGATCTTATTTAAGTATTAACGTTTTAGACAGGGATGATTTAAGGTTGCTGATCAAAATTACTGCCCCTGAAGACTTGACTAACGATAGGCGTACTAGGTACTTAGTGCTCTTTGCTCAAACATTTACAACTAACACAGAGCTTTAGAGAACTAGTCGCGGATATGTACTAACGACAGTAGCTTATTATGTACTTTCTAGGCAAACAGAGGAAGCCAGCCTAAGTGCACGTGCTCGCTACCGTATTAAATTGGACTAGTCAAAAGTAAGATGACCCACGCTAGCCACGCTGACCCGTCATGCGACTCTACACGGGAGTACTAGATGCTTAAAGTCCACCAGGGCCACAGTATGTCTAGGAGAACGCTATTAGGCACCAAGCAGACGCCATCCCATCGTTTAACGTTATCCTCGGCCTCCGTCCATAGAACCTCTGTAACGACTAAACATACTTGAGCTATAATGTTCTTGATGACTAAACTATCATATAGGTAATCTATCGCTGGTGGATGCGTCATTGACTTAAATTGAGTGCGGTCTCGCTGTTCCTAGACTAGATGAATTGCTAAACGGGGAAGACTTAATTCACTAGGCGCTTATCGCGCGTTCAACGATGCTCTTTACAAGACGCCTCCCATCTGGATTTATTGGGTAAATACCTGTAGTGGTCGTCCGCGGTATGTCGCGATGAAGAGCTAAACCATGCTACAAATGTCGTAAGTCAATAAAGTAGATAACCGCATGCCTAGTCCTACTTGATTCACCTGGCGCGGCAAGACAAAGCCCTCAAGTTACAACTTTATCTAGGGTGTCCCCTACGTGACGCCGCATTTCTGAACGATTTTCAACACTTCTAATCAACTTCAGTTACCACAAAGAATTGAGCATTGCTGCCCTGACCGCATTTTATAGTCGGTCCGTGCTGTTAGGAGCGCGGTTGCGCGTAAGTAACTGATGTAGGGACAGTCAGCTCCCTGCGAAGGTCGTTCCGCTGTAGCTGCGCTACTGAGTTTCTAGTCGCATTTTAAAGACTTAGGCTGCAGGTACAGAAATGCAGCGGCGAGATAGCGCTCGATTTACGTGGTCAGCCTAGTTGCCTCGGCCGGTCAGGCTAAACCGCGGCCTAATGTTTACGTTGTGATTAGCCCCTTTACGGCCGCCCTGGCATTCGTGTAACCATCGTCACTGGTCCGGCCTCCATTGTACGTGTAGCGCTGTCATAACGACTTTTTAGACGACTCGTGACGCCAACCCGGTCGGTATGTTACGTTGGCCTGTGCATATGAGTTTCGAGCACATCGCTAAGGCCTACACCACGGGTGGCACGTGTCAGACCTGTGCTATGCCATACATACATAATCATGGCCATGTCAACTTGGGCTCATATGCCGCTATCTAATCCACAGGCCGCTACTCGCGTGCTCGTCGTGCTGGTCTATCGCAATGATGGTCGTCCGCAACGAACGGACTTGGCTTTAATACCAGCGGCAAAGGGCCTAGCGTACAGTTTCTGGGGACAACTAGACTACAAACGTGCTACATGCGACAATCGTGACTAATCTGCACATGCGCGATGCAGGGGCCATCTGCTCACGCCGGTAAATGCTTACACAAAGCATTTGAGCGCCGGACTGTCGACCTGTGAATCGTGGTGGTCGAATTAATCCAGCATGTATTTGCTGGTGGTCCGTAATTGATACAACACTATGCGCGGTTGCGTTAAAATTAGTTAGACGGCTAGGGCTCATAGATTCAATTGCTGTGTTCAAACCACCGACATATTGCCCATGATCCAAACCTGCTTAATGAGTCAGATGAGATCGCGGTTAGCGTGCTCGACTTGTTTAAGGTCTATCCCACCCATCGTTGGCCAACCACCTTTTAAGCGGGTCGGGCTGCGCCTCATCGTTCCATACGTGCGTCGTCGGTCACGACCTCCAGCCAGGCTTACCTCTAGCTCCCACAGCGTTCGGCGGATTGCCACTCAGCGCGGCTAATGGTTCGGCACCCTGGCTTTCCGCGGCTAGCCACTGTTATTAGCGTCGCGTGCTTAGCATGGCTCACCACTTAAAATGCCGGTCAGATTCCTCCAGGCTTAAGACAAATGACGCAGAGAACGAGGTACATTCACAAAGTTAGGCTTCGGGATGGATAACAGCGGTCGGGTACCGTCTAAAGGCTCGCCGGTCGTGACTCGTGAAATGCGCGTAATCGTAGCTCCCAGGTTACACCAACCCGTAAAGCAACCCAACGTGCTAAGAGCGGCAATGGCCCTTGCCTGTTTAAAACCGTTGTTTGAGCTAGGGACGGGACGCGGTTATTAGCCAGGCTGGCTAAAAGAATGGCCAACTTTAACACGTACTACTGATTAGCCTTAAGCAATACATGTACGTATAATTAACCAGCTCTATGTCTACGTTGGCCCAGCCAGTTGTTAAATCTATTACGCGAAGTTTAGCAGGCTTAAACAGTCGTCGATTCAGAGCGAACAGGATGCTGTAGGCGGACGCTAAAGAATACATCCGGCACTCTAGAGCTGCTCTGTAGTTACGTATCACGTGTATTACATAGTCATTTAATCCGAACTTCCGCGTCGTATGCCGTTTAAAGCAGCCGGCGCGACTCAGGACACGAACCTAACACATCTCGCCCGTCATCTAATGTATTAATAGGCAACATCCCGACCGTCCGTGCGCGGGGCCGTCCTACAGGTACTGCGAATACTGGCAAACCGTAGACAGGCCAATCTATGACCATGGCCGCTGTTTG
>101
GGGTGAACCTCTGGGAGAGCACGAGGGCCTTCCGCGTCCTCGCTGCGCTCCATACACCGTACGAGAGGCGGCTGAACATTTCATGCAAACACCCACAACGATCATCTTCGCACTCTTCGTCCTCCTCGCGGATTTCCTCCCTCTGGGGTCGAGGCGTGAGACGTGAAAGATCTAGTGAAGAGCCAACAAACGGTACGTCTAGCCCCGCAAGTCGCTATCCGAGGCTACATCGGGCGATACTATCACTCATGAACTGTAAGGAACAGGAATGCCCGTTCGCATACTCCGTGCTTAACTATCTAAGCAGCATGGCGCGTCGTCGTCGACGTGGCCGCCGATGATAAAAGCCAGTTCGAAAGGATGCTGAAATTAAACGAAAGCTCGCTTGATCCATACATTTCCGCGAAGAAACGGGGATGATAGGCTGATAATGTGGTCGAGATCCAGGCGTTAACGTGTCTGTTCCACGAACTCATTCACACGCGCTCTCAACGCACCCATAGACGCTGCACACGTTTCAAACGCACGCCAGAGATCCCTGAATTTAGAAACTCGCACTCGTCATGCCTATCTGTTTAACTGGACGTGAAAGCTTCAGTCCATTCTGACGGCATCTGCGTCTTTATGGTGCATGGTTATGCGCTAAACGGAAAAACGACGAGGCACTCCCCGAACGCCATTTATGATGAATTTACGAACAAAGTACCCTTTGGATGTCCAACGCCGCCTGTCTTCTGCTCCTGCAGCGTTCTAACCTAGCAGATGCTCCAGATTAACAGGCTGCGGCTGACAAGTCGAGGCGTACGCTTCTAGCGTTGGTTTCGCTCATCGTTCGTTGCTCAAGAATGCTCACCCTGACTCAACCGGGTGACTGGCATTACGTTAATTTCTTGACCAACTCGCAGCAGATATAGACACCCTTTCTAAAACCATCGCGCATCTTTGGTTGTGAGAGCAGGAGGAGTCGAAGCCGGGTACGCGCATGCGAAAGCACTTTTGTTGAATCGCGACAGAGCGCAGCTCTTGTCGGTCCACCCTCCAAACAATGGAAGCGCCGCGTCAGTGCTCTGCTGTTTATAGAGCATAATCAATGAAGGCGTCAACATTCATGCCGGTTGCCGACGGATGTTACGCCGTTAAACCGTGGTTAGAAACGACGTCCCACATTATCTATTTCACGTTCCTGATCATTCATTCCGTCGCCCCTTAGAGTACTGCTGGTGGCGGTAAGGGGACTAAACAGCCACGTGCCGTTCGGGAATTACCCATAATATCACGGTTCATTAATGGCCGCCAGCGAGCGCCTGCTGCCTAGTCAACCGGGCAAACCACAGCGTGAAATATGGTGGTAAGGGGCGGGTTTTCCTACGAATTCTCGCATTCCGCTGCTGCATCTTCAACCTGGCACTCGCTCTTCCGACGTTCTGGCCACATGAGGTCCGTTGAAGGCCGGGCTTTACAAAGTCCATCTTTTTGCCGGACGCCAAAGGCTAAGAGCGGTTACGAGCGCTCATTTAAGTGAATCCCCGGGACAGGCTTCGCGTAAGTCGCCATCGCCGTAGCTCCACGCACTCGTGGGGAGAGTCATCCGAAGAAGAGTGGGGGAATAAAGAGACGCCGTTAGCCGGGACTGTTCGACGCTCCATCACGCCTTCAGGGTCGGCTCCCTGGGGCTCACGATAATGCCTTTGCGCCGTAATCCTCACTCAATGCCACCCCAACCTGACTGATGCCCGTTATTGGTGAACAATTGGACGGACTTAGACCATCGATGGCATTCGTCGTATCTCGTATCCGTGAATGAGTACGAGCTATCTAAACTACCGATCCGGCACCTGAGGCAGGAAGACTTTAGATATCCAGCTCCACCTGCCTGATACAGGTCAAAGACTTCACGAACGAAATTTATTCACACCATTAGAACGAGACAACAGGTGCGCAAACCACGAGCGTAGAGACGCTCCGGAGGCGAACAAACCCGCTAAACGTCACCCCATTGCTTTAATGATGCCTTCTCCAAGCATCCGATCGCATGCCTCCGCGTTCTTCCAATTCCTCCCATGTTCGGCTTTATCTAAACCTCGTTGGTCATCCAATTCCCATAGCGCAACTCTTTCGAGAGTTCACGAAATGTGGGCTCGAGTACTTTTGTTAACGCGTGGTCAGCGAGGCAAAACCCGGCGTTACAGGAAGCCTAATACAGCCCTAGTTTCCCGGCCACACGACGATGAACAGTTAAAGCCGGCCGCGGTTTTCAGTTCACAATAAACGCACCGGGAGTGCCGACAGTTGGCCGCATAAAAAGGTAGGGCGCCATGCTAGGTTTGCTCGGAACGACCTGCTTTTGACTACAGCTTAGACGAGACTCAGCATCCGAACGTATCCCTGAAAAATCTCCCCCGTTATTCTTCTGTAGTTCGAGGTTTTTGACCGTGTACCGTTAGACCTGACCGCTTTCCGTTACCGTTTAAGCGTACCGATTTGTCTCCCACGTGAAGTAATGTAAACAAAACTGCATCGCGATGAGGCGAGCCCGAAATTGGTACGTACATGTGCGAAACCAGCACCAGGCACCGCGTTTCAATGGCCTCAAAGCACTTTTCATCGACGCTGCTCGACCTTTTATACGAACGCTCCCCGCTTTCACCAGCATTCCCCGTTAACGAAGATAGCAGTACGCTAGGATTCCGACGCAGCATCTAACTTCAGGTGACAGTACATATGAAAATCCCGATCTACGAGAAAATTTTTCCTCACCGTATTTCTAATTGCCCGCGGTGCCGCACCCTTAGACAGTCCATTCGCTCAGAGCTGCGTGCGCGTGCCTCCGCGCACCTGTCCCAGCTGATATTTCCATTATGGCACTAGCCCACGCGTATCGCCTAGCTGGCTGCTCGCTAAATGTAGTACGTAGCGTTCCCAACCAACAGAAAAGTACCGCGTATCGTTCAGCGCCGGGCAGTGGGAGTAATGAAGCCACGTGACATGACGAAATCAACCGCCCGCCGCTCCTACCCCGTTAACTTGCAGGATTTGATGACAGGCTCAAACGTGCTTTCAACAGTACATAAAAGACGAATGAATGGCGAGAGCCCGGAATAAGTTCCCGGCGAGGCCAAATGCGGAAAAGAGTCGCATATCTAGAATTGGAATGCATAGTTGAAGCTGACGCATCGTAATGCAGCTTCCCGTGCGCGGAGCCGCTGAATTGACGAATTCAGACGTATCCCGAATCACCCTGCTTACGGACGCATCGCTGGGATTGCTCAGAGCATTTCGTGCTTTGTCACACATTTTCCCAACCTGGAGGGATGTTGCTGGCTGTTTGAAGCGTTAATGAGTTGAAACCCTATACTGGTTCGGCTCTGCCGACAGGCGTCCTTGATCTTTCGTTCGCGTGCACCAACGACTCCAGTTCGATTCACGAGCAACGGAGGCCTCCCTGGGAATCTTCCGTTCTTATCTGCCAGCGTTCATCTTTCGTTCCTCGCTCCTCCGGAGGCTCATCGCCCAAGCGCTCGTGGGCTTTGTACGGGGCATCGCTCCGTATAGAGCAAAGAATGGACCTCATCTCCGGGGTGATATGAAGTGGATATGGAAGTACCCGCCTAGATCACGCCATTGGTCGCAGTTTTTCAAAGCTCAGTGAAAGAATCGTCCATTCTAAGGTCCATTTGGGAATGATAGGCGTACGAGTGGCACTCGTAGGCGGACGCGTTCAACGGCGTTCCCCAGCGAGCATCGTGTTGTCCCAAGGAAGTTCTCTTTTGGCCGTTGCTAGTCGTCCGCGCAATACGGGTAGAGATGGCTAAGCCCTCTAATGACTAATCGACAATACTCGACACGTGTGAAAGTTTCACGTGCTCCGGCTTAGGGATCAAGCCACGACATCCGGCCTTTTACTTATAGCGTTACAGGACTAGTAGGACGGGAGCCCGGCTCGGTTTCAATGCAAAACTAAACCTGTGCACCAGCCCCGTGAGTGTTCAGCGGGCGTGCGCTCCGTTCATTCGACTAGTCGACTTGTTAACGGTGGACGACCGCGTGCTAGACTGCGTGGTAGTTTGATTGTCTATAATGTCCATCACATATCAGCTAACCATCCGGATCCCAGCCGCAATCACCCTTCACTGTATTTAATCACACAAAGCATCTTATTCTGCCTTATTCGGCCTCGCCCGGATGGCCTCTTCGTTCCTCGCATGTTCTGCGGCTGCTCCATGCATAAGGCAGCAGTCAGGGCTCGATCCCGAGTGCGGGGTCTTTAAACCAGGAGCATGGAAAGGCAGTGACGTATGCAATTTCAAATTCATGCTGTCAGTACTATCCGCAGCGTGCTTATTCGCATGGGCTCGCGCAAAGAGAGTACGCACTCTACGCCGAGGGTAGGTTTGGTTTACGCTCCGTACAGCGCCAAGTTTAACGCGTCCGGAATTTGTGGAGCCGAGCATATGGTTTGCTCGTGGTGAGGGAGGAGTGCTCGCCGCAGGAGGGCGGCTCGCGCTATTCGGGTCGAGGACTTTTCTTAGCCTGTTGCCTAAAGCGATCCCATTTACCTACTCGACAAATCCGATCGACGCGCCAGGCGGAACGGCCGGCGTCAGTGGAGGGGGCCCTAACAAATTAAACGATGCGGATGGGGATCCCAGGAGGGAGAGTGAATTTGTGCGTAGTCGGCTGGCATGGTAACGATAGAGGCGGATACGGCTCGTGCCGGGTGGTGCCGGAGCTCTTCACGACCGTGGTCCTGGTCTGGTTGAAGCCCGGACAAATGCCTCGGAGGAAACTGGGCCAACGGCATAGGCTTCGTGGTCGATGAGGATGAGATGAGCTGAAAGAAGTTGAGGTAAAGGGGTGATGTGCGAGGCATTTCGCACTCTGCGTACCTCGGGCGCGGTTGCGCATCCTCCTAAAACCTGTTGTGAAGCTCCATACGTAAAATTTCTTTTGCTCGTCATAAGCCATCCGTATAAAATGTTTAGCAAATCGTCCTCGCATCGATTAAGGGTCATGCAACCGCCCGGTGCCCTAGGTCCCCACATGCATCGAAGGCGTTGCAAGCAGTCAACAGAGGCTGTCAGACCGTATTAATCAGGCAGAGTCGCGGCGATCCGTTCCATGCATATCGCCAGCATTTAGGCCAAGGCCCGTCGCTGTTTCTTCACGTCCGTGATCCTGAGCTCCCCGTGCGCCGTTGGCATGAGCCAGGCTGTTCTTGCGCAACCCATGCAGCCTAACGGCATTGCCCCGTGAAGCGACGCCCATGGCGTTTACACCTCCGTGACGCTGGCGCCGTCAGTACCTCGTCATTGCAGACGGCAATCAAGAACGAGGGATCTGACCAGTTATTGTTGATTGAACGTGACTGTTGGTGCTTCGCCTAGCCCTAACTGCTCGAGATCGACGCTGCTCGTCGATGCAGTGCATCACTAGGGGATGACGAGTCAACGCATCAGCTTGCCATGTCTGCAACAGCCGCCATTTTACACCCCGTTAAGCATCGTAGGACGGTACGTACTGCAGCCTCATTATCTTAAATCCACCGGCGGCCACCTAGCGGTGA
>102
AAGCCGGCGTTTCCAAGGGTACGTCAATGACATTTGCCGTACGTGACCGGAAGCACGCGAAACGGTGACGCTGATGGGATTCACACACCCTACTCATTTAAGCCTGGCAATCGGCTGTTAAACTGGGGTTTAGGAACGATGAACATGAAGCAAAGCCATCAGGGAGCTACAGGCTCCCTTTTATTATTCGCATTCACCGGCCGTATTAACCAACAGTTCAGGGATTAATGAAGATGGCAGACATCATTGATTCAGCATCAGAAATAGAAGAATTACGCATACAGCGACTAAATGCGCCGCCTGAAACCACCCGGGGCTATCTCTTCCCTCGCCTTGTTCTTCGGTATGCCCGTCGATAGATGAACGAAGACGCCTGGTCGTTCAGGGATTGTTGGACTTGTTGCAGTGAGGCGGAAATAGGAGACGAGACAGGCGAGGTTCGAAGTGAGCGAAATTAACTAGGCATCCGTGAAGCAGGGCAATGCATGACGACTGGGGGATTTGACGCAAACGGTTTCGCATGAATTGGTAGCGTGTGCTCTGGAACTGCTGGATGAACGAGGAAACCAGCAATACATCAAACGCCGCGACCCGGAGAACTACCAGGATATTGCCTATAAATGGAAACTGCGTGTTGAGCTTGAAACAGAAGGTTACGACTCAACGAGCATAGATGCGTACAGGTTGACAAGTGAAGCGTATTGCCTAACTGGAAAGCAACGAATTAGTCCGACGAAACCAGTTTCTTGTTTACATCCTGGGAAGACTCCTGTTATAAGCACCTGCACTGGTACTGGAAGAGTTTGCGGCGTGCTATGCATCGCCTGGCGTTAATATAATGGACAAGCCTTACGCATAGAGTACGGATCGATCGTAGGTTCGCAACCAGGGCATAGGCGACGCTGGCTGGCATTCGCATCAAAGGAGAGTATGCAATCGGTTTTGTAAATACAATCCGACTTAATGAATTTCACGTCGTCTTCACAGCGATGCCAGTCTGTAGTGTCAGATGATGACCGTACTCAAACATCAGCGGGTCATATTATCTTACTGTTTCTTTACATAAACATTGCTCATCCGTTTAGCTGGAAACCGACATACATTGCAAAGGAGTTTACCACTGGCTGGTATGATTGAGTTAGAGTCTGAGCAAAGATTGGGCGTTATCAATGGTTGTGCCATCTCGTCTTCTCCCTGCAGGTAAGCCGCAGGTGTTATGTAGATGAAGGTATAGATAGCGTGAGGTATAATTCCATGAAGGTTTACAGTCTAATGAAGACAAATCCCCATTCTGCAATGTGCCGAGAATGACTGATACGTGCACTGGCTACGAGGAAGACGAGTAGGAAAGGGAAGAGCTGGCCGCCTCCGGCCCATAGATGATTAAACCCAATATTACACCGTACTAAGCCGGGGATCTTATTTTATCTGAATACGGACCGGGTTTGTTTATGGAGATGATAATGCATTCTGAAGTCAGGAGTGAATGGAGAACACATGTCAACGATTATCGAAACTAGGATAGTAGACTAACAACAGCCTCCATGATATGGGGCAGATAGCACATGCAGACGTAACAATATTCGAATTGAAGGACGAAAGAACACCAAGCCGCCTATCGAGTTTTTCTTGCGTGTAATTGCGGAGACTTTGCGATGTAGGATGGAGCCACATGAAAGTCCAAGAAGCCTTGAAACAGTTCGTTAGATGGGTTGGGAATGCAGGATTCCCACCTCCGGTTAAGGATGGAAGAGAGTATCTGTTCCACGAATCAGCGGTAAAGCTTTGACTTAAATCGACCAGTAACAGGCCTTTGAAGAGGATGTCAGAAAGGCGGAAGAAGGCGCACGAAGAGGGATTTACCCTAACCTGTTATAAGAAACAATGGATATCTATCACGCTCCAAGACGGACCGATTTGGATCGAACAAGCGCGTGAAATGGGTAGAAGCATAACAGGCTATTGAATCGTCCGGCTCCGCTCTATCGCGCCGAATCGGCCGTGATAATTCCGTTGGGTCACTTCGGTATTGAGCCCATATCCTGGCACAGGATCAAGCGACACTCATAAAATTACATGAGCAAAATTAAAGCAATAAGGAGCGCGTATGTGATGCTCCACTTGACAGACATGCCCACAAAGAATTGCGGCAATGCTGGCTGACTGTGAATACATCAAGGACGAGGGCAAGGCGGCGTCACTCTCACAAGTTAATCAGATCAACACTGAGCGATGCATTCGAGAGGCAATAGCTGAAGGCCATATAACAACATCAGATCCTGCCCACTCGCGCATAAATCTTAAGAGATGGAAGCAAGACCACGAGGAACTGAATAGCGACCAAATTTATTCAAGCAGCGATCACTCCATGTTGGCTCATACTTGCAAATGGAATGGCTGTTGTTACCGGGCATGAAGTCGTGCGGGCATGGTCTGATATCGTTAGATGGATATCTTTATGTCAAAACAGCAAAACAGGCGTAAAAGTGCCATCCCAACAGCATTGCATATTGATGCTCTCGGAATATCAATGAGGCATTACTCGTGGGCAGTGCGCGAAGCCATAATTGCATCTACTCGTCGAACATTTCATCCAACAGTATCGACTAGGTATTTTATGCACGACGCACGAAAAGCATCAGGTCTTTCCTTCCGCATGGGAGTGAGCTTTCACCGAGTCCCGCAGTTTGTCTGCAAGACCTGCGAAGGCAGATAAGGGCGATAAGTTTGCTCAACATCTTCTCGGGCATAAGTCGGACAGATGGCATCACAGTATCGTGATGACAGAGGCAGGGAGTGGGACAAATTGAAATCAACCAGCGATCGCTGTGTAGGGGCACCGCTGTGCTTCTGCAGCCAAATGCTCACGCCAATGCTTTTATAATGCCAACTTAGTATAAAAGCCTGAACGAGAAACCTGTAAAATGATATAAATATCAATATATTAAATTAATTTGCATAATAAGACCCCTCTGTAAAACACAACAATGCAGTCATCTATGAATCAACTACTTAGATGGTATTAGTATAGTGGTCACTTAACAGGCTTAGCAAGTGATTTTGTCTTCTTGCGCCTTGTTACATCTAATACGTCAGACCCCGGAGCGCGACGCCTCGCAATCCAGTGCAAAGCTTTGTGTGCCGACGACCTGCATAACCAGTAAGAAGATAGCAGTGATGTCAAACGACGCAGCTGACTTCTGTTCTTTCACGACTTCCCCACACCCAGCATGCATACCTTTCCGCCCACTGTAGTGAGTGTTCATGTTGAGCGGTGAAGAGGAAGTCTG
>103
GCGCGGTCGCGGCGCCGCCAGCGAGCTCACGCGACGATCGGCAGGGTGATCGCACGGCAAGCCGCGGACGAACATGGGGATGTGTGATGACCACGGAGTCTCTTCACTGCCCTGTTGAGCGGATCAGCCACTTTGCCCGCCAGTGCAAGCAATGGCTTCCGGTGGGACTGGTGCAGGCAGGCATACGCATCGGCGGCTTTATACTGCCCGACGGAAAATCCCGCTTTCTGTGCAGCCATGCCGTGCTCTCAGCGACTGTTCAACGACTGCCGCTGTTTAGCGCATCACTTTCGTACCCCAAATGAGTACTCTGGCCATCTGCTCGTCAAATCTGACCCAGCAATCCAGACTCAAATCAACGACCAGATCGCCTACCGTTCACTACCCTCCATCAGCCTGCGTGGGTCGTATACTGTCATCAGCGGGTACGTCATCCTCCGTCTGTCCCATTACGGGAAGCGGGGGATAACTTCATTCCCGTCCGGCCAAAGCGACGGCACTCAGGGCAAGCCCTGCCCTTTCTGCATCAGCACATCATCTTCAGGCTCTTCGTGCTCGCGCCGGTTCGAGCAGCTCTGAAATGCGGGGCCAAACTTAGATCGAGGTGCTGGCACTGAGGCCGTATGCCTCGAAAATGCATATCCGACGATAAACATCATGAAAATAATGGATCTGTAAAGCGGTGCAGTCGGCATACTCCGTCATGAATCCCGGCAGCATGCACGCCAGTTCGGACCCCATCTCACGCGCCATTCAGGGCAAAACTCAGCTCACGTCGAACATTTTCCCGGCAGGAAACAGAGGCGCCTGCGGGCCCGGCTTCCTCTGTCGTTCAGGGGCATTATTCACTACAAACTCATACATACAGACAGCCGGTACACCACGATTTCAGCATGAGAATTAAGCGTGGCCAGGTGGTAAGCACTTCCTGCTCAATCTGTTTAACGGTGCTTCATGGACGCATCTGCGTCGTTCTTAAGATGGTTATGCCACAGGGACATCGCCACCGATAGAACGCTTTCCGTATGATGGCGTCTTCCACAGTAAACTTCCGGTTGCTTGGCCGCCTGTTCTGCCTGCCGCGTTTCATCAGGGCGAGATGCTCAATGCGCTGCAGGGTTAACAGTTCAGAGAAGCGTGACGGTCACACGCGTTACGTTCAAACTGATTCGGTTTTCAGGAAGCCCGACTCTCTCCGGGTTGTAACTGCGGTGACGTAATTTCTGCAACCGCAGAGCAAACGCCCATTACCGGATACAACCCGGAATGTTAACCTTGCCGTTGCAGCAACACGCGTTCAAGTGGGTCATACCAAATATGGCTAGTGGCTTTTATCCGCAGACACCGCGCCGCGAAGCTCTTGTCGGTTACTAGCCGGCCTGAAAGCGCCACGGTCATAATTAACCGCTTTCAGCGAAGGCCTGAGGAGGGATCCCATGCCTTAAGCGAGTGCTGTTATCCCGTCCTGCGATCTTCTGCCATCGACGGACGTCCCCACATTGGTGACTTTCACGTGCTGATCATTCCTTCGCTATACGCCTTACCGATACTGCTGATCTCCAGCCACGGAATAGCCATCAATAATTCATGTTCGACGGGAGCGGCTTTTACACCGGGTATCGCGTGCTTAAACGCCAGCACCTGCTTGCCCTGCTCTCCCTGAAACCGCCAGCGTGGAGCTGGTTTCCCGGCAGATTTCTGCTACGTCGGTCACGGATTTGCGGTCTGCATCTTCATCATCGAGATAGCTGTCGTCATAGATAAGCGTCAGTTCGCCGGGCGTTAGTCTTTAATATTTTTCAGACGCATACCGGTTGTGCAACGTCTGAAGGGATTCGGGGTGTAAGGGTCGCTCCGGTATAAACCCACAGGGTGTCCCGGCACCTTTCACCGGCATTGTAGGATTTGGTCACAGCATAGAGCGTCACATTTCATAGGTAATGACATAAGTCAGATCGGCTGGCCAACGCATCATCATCGTCGCACCATTAATCTAACATCAAAGCATGACTGATCGTAGGGTCGGGATATGGCTCATCGCACTAGTACCAAATCTGGGATATCGCCGAAGCAGGACGGCATCCAGCTGAGCAGGAAGAGTGGTTACGATATGCAGCTCCGCCAGCTGCCGACTCCTGTCCCTCTGCCCGTGTATTCAGCGCCGTAGAGACATACGGCACTTAGAAAATCGCTCATCAAAACTAGGGCGACCATCAAAAACGTCGCCCCGGTGTCAGCTGCCTTCCAGTGCATCCGATCGACGGTAAATGGGAGGCGTGCATGCGATGCTCCGTTATTGAACCTCAGTTGATGCGACGCTACTCGCAGCTCTTTCAGGAAGACGTTCACGCTGTATCCGCTCAATATTTTGAGTCTTTCCTCAGCGACGCCGTCCGGGGATTTCACACATCAATCGGCTACGTTTTTCCCAGCCGCTGCATGACATGCCGGCCTTTCAGTTGTTGAATAAACGCGCCGGGGATGCCAGCTTCTCACTAAGGGGACAGATCGACGTTTGCCCTAGGATGAACTCATCCCTTTTATAAAGGACAAGCGCACATAACCAAGGATCTCAGTGTACGTACGGCAAAATCCCGCGGTCTATATTTACTTCTGCCTGCCGGGTTTTGACTCGTGGCCGGTTGCGCCTCCGTTGGATCTCCCGAGTGTTACGGCGTACCCTTGTCTCACGGGCAACCTGTGACGCCGACTGCGATATCGCGGATGAAGCAACGCGGTTAATGGCCATTGCGGCGGCACCAGGCACCGTTTGCGGCTGATACGGCTGAGGTTTTCATAACGACGGCCTTAGCCACCTTTATGTATCCCCCTCCATCCGTTCGACCGGGCACCGTTATAACGAGAACGGCGTCCGACAAGCCCTCTTCCGCCATGGGTACGAGCATCTGAAGTCTCCAGAAATTTTCCTCACCGATGGTCTCACGTGTCTCCACGCATTGGCACCATCAGTCGCAGCTAACCGACGGCTGAGCCTTCAACGCGCACGCCGTGCGACCATCGCTCTTTCGGTCATCAAACACCACGTATCACCGGTAATGGTCTTAGCCCCTTGTATGGTGGCTGACGTTCCCATTACAGCGTATCGTTTCATCGAGCGGGCAATGGAGCAGGCATCGAACAGTATCGAAATCGCGCCCTCCCGTTACTGCACATTTGGCCAGGCCGCGCCTCCGTCATTTCGGCTGCCACCGGCAGGACGAAACGCGTTCCCCTCCCAGCACAAATGCTAGGGTTCATCCCGCCGTGTGGCGTGAAGTCGCATCCAGTATTCATGCAATGCCGTGCCCACTAACAGGGGACCAGTTGATATCCGTTCGACCGTATCCAGAATCACGGTATCCGCTCGGTGCTGATGCCTCAGTTTTCATGTCCGGTCAGCACATTTTCCCGTAAGGGTTAGCTTAGTGCGTCAGGCATTTCAATCGGTTCTATCAGCTCTGGTTTCAATGGTCACACCTCATCAGTTCTTCTTCTTTCACCGTTAGCCGTCCGGGACGGTAATACGTTCCGGTTCTTTCCATGGATCCCACAACAAGCTTGAAGTCTGCGTCATCTTTCGTCTGATGGATAATGACAGGCGCTGCTTGCGCCGTTGTTGCCCATTAATCAATCCTCCAAGCGGGGTATCTCGCTCGGTGCTGACTGAATCATCTGTGAACCTCCACGCGGCTCGTACGCCTTATCGAGTTTGGGGTAACGGGCAGAGGCGTTAGTCGTGGGTCGATTCACGTGCGTCCGCATCCTGAATGCAGCCATAGGTGGCAGACCCGTGCCTGAGTGTTCCCGGGAGGCCCATCGTGTTGTTAGCAGGAAAGTTCTTTTTGACGCCGTTTTCCACGTACTGTCCGCATCTAAGACATGGCCATCGCGGGCTTAGAACCACCGCTTTGCCCAGGTCTTTCGCCACTGTCTCCAGCTCGGAATTAGAGCCACGACGGGTATGCACTTCCTTGACGGTTTGAAGGAACGGAACAAGAGCCGCCTTTCAGATCCAGCCATCCTGTGACACACGGGCGTTCAGCGGGCTTCGATATCGTCGGTCGCTTATACAGATTGGTAAATGTCACTAGTTGCTCCAAAGCCGTGCCGCCGACTGTGCGTGATGTTATTCTCCACTGCGCTCCATATCCACCTCAACCGGATCGAAGGCTTCACCGGTCATGGTGGTTTGCATGCAGCACGGCAGACTGCCTGCATCTCTTCGACCTGAGCAAACCGCTCTTCGTCACGCATGTTCTGGCTGGCATGGTTGACCGACGGCGGCGGTAAGCGGGTCCGCCAGAAATTCTGCTTACAATCTTCATCCGGCATGGGGACGCAGGGTCAGCCCGGATGCTTCAGTGGATTCGAGTACACACTCCCGGCGTAATTCAGAGGGTGGAGCCGCCACGGGAACCGGATAACCTCGGAAACAATCCATCATCGTGAACACGCTGTTTTAAAACGAGTCCCGATTTGTGGAGAGCTATGTCTAATTATACGGGGACACTAGCCACGGAAAAGAGACGCAGAAACAGGTGATATCCAATTTCTGCTCACTTTGCCTGGCATTTGTACGGCCTCAATCCCGTACGATAGCGCTAAGCGTCGGTGAAGGGTAAATTGGCCTCCATTAATTGCCGTTCCGGCTGGGGATTCCGTTTCGTCGTCACTGGCAACGGACCTAAGAGCACATCCTCATAACGCTGGTTAGACTTGTGAACGTCAGCGTGGTGCTGGTCTGGTCAGGTAAGCAACCGGCAAGAATGCCAACGGCATTCCTTAGATGGGCTAACCGACGCTCGGCTCGAACTTCCAGCATCAGCGGGGTTGCAGAAGGCGCCTTTCGCACTCAAGCCTGATCCACGGGCGCGCTTTGCGCGGTATGAGCCGGGTTACTGTTACGTGCGGCCTGGTAATGGGTAAAGTTTCTTTGCTCGTCAGCTAAAACATGCGGTCACACTGGTGTTGCGCAAAATGGGTTAACGGCATCAGATGCCGTGGGTCTGCAGCCATGTCGAGCCTAGTCGCCGCCTGCATCAGACGATCCAGCGCAGTCACTGCGCGCCTGTGCACTCTGTGGTGCTTCCATCGAATGCGGCGGGCCGTTTTCACGGTCATCTCAAGGCGATTTCTGCCAGCGCGTGCCTGTTCTTCGCGTCCGTGAGCCTCCCCGTTACAGGATCCCCATAGTGCAAGCTGTTCTGCCCGCAACCGATGCGGTGATCTGCACGTTCGTCCAACCTGCACCGGGCGTTCTCGCTCAGCGTCGGCGCTCCGACGACGTCAGTAACGTCAGCCTGTGCGAAGCAGTGGGGCTGAAACAGTTGTTGATTGAGGTCTCTTTGGTCACTTCGCCCTCCTGAGAGACCGCTTCGACGTGCATCCAGTGCATCGCGCATGACGTGATGCGCATCGGTGCTGTTAACACAGTTCATCAGTCCGGCATGATACCTACCTGACATTACTGAGAGACGGTATGCGCCAACTATCATAGGCTTATGCCGACGTCGCAAACACTGGCGTGGTCCCGTCCATCCAGCTGGCGACTTTAACGAGCGTCGTGAGGAAGATGGCTGTAGGGTTGCATCCCACGTAGGCTGCCCCCGTAAATGCACATCCTTTACAAGATGTCTCCGACACAGCGTAAGTGCTTAGCCATGCCTGACGGATGCAACTGTCCGGGCGGTCTGCGTACAGACGGGAGGCGGCGCGCTCGGCAGCAACTGATCGTGCACTGCAAGTTCAGGTCGTTGGCACACCGGCTTTTGATCCGCTAGAGTGGAGATGGTTGAGGGCGTCAAATGCCCGCCACCATCCTAGGGGCGTGTCCATATCGAGCACGATGCCGTCCACCATCGGATCACTGAGACTGTTGTGCAAGCCTGAGATAATGCGTTGTAACCGGTCATCCCCGAGTACGGCTGCAGAGGCGCCCCCGTCCGGCTGATAGGCTCGTGCTTAGACACCGGCATAGAAATTAGATGCCGTTCAGTAACGTAATAACTGCGGGCCTGTCTTATGTTAGTCATCATCACCGGATAATGCCAGCGTGCGAGTGCCTCCTGGGCAGTCAGGCTGTCTCAGCAACACGCATATCCGTCAGGCTGCTGATCCCAAGCTGGCCTGCAAGGCACAAAGAAAACCCGCGCATAGTGGGGTTCAAGGCATCAGCTAAGCAACATGCCTACATGCTGGCAATATGCGGGGATTACGCAGCTCTGCTGTCACTCTTCCTCCTCTGTTGAATGTCGCAGCCCGAGCGGATCAGCAATGGACTCGAGGCCAGGCATCGTCGAAGTCCGGCCTCATCAAACAGGCGCACGGCCGGCCGTTTCACGTCAATATCATGGCAAAATTTCCAGATAGTAGTCGTCACCGCGTTTTGCGCACTCTTTCTCGTCCACTCAGTTCGGCTTCTATCACAGCATCACCGCTTCCTGATTCCGCTCAGGACCATACCGGCCGGTAGCCTATCCAGTCGCAGTTCCCCCAGGCACACCTGCGGGCTTCATGAAAACTGAAGCGCTTTCAACGTCACGCCCAACCAAGGACGATGGGCCTCTTCCAGCCAGCACAGAAACATCTGAGCCTGATGACGGGATGCGACGAATTTTGCCCGCCCCATAAACCACGACTCGTCACGACTCGCCGTGCTTTTGGGATAGCTCATCTGGCGTAATGCGTCGGGAAAGCCTGCTCATACTCGAGACGAGCCCCTCCGGCCGGGTCTACCGAGCAGTGACTGCCTCAAACACGGATAGCCGTTATCCGTTCCTGAGCCCGTCTGCAGGTTGGTTAGTGAGTCACCCGGCATCGACTTAGTCGTTGCGCCTCCCAGCCGGCTGGCGACGCTGCGGCGTAATACGAGGCGATTGCCCACGCGATCGCGACAGTCACCTCCCGGTTCACTCCTAGCGCTTAACCTGACTTTCGCCCGAATAAAATCCAATGACGGACTGCGTATCCAGCTCACTCATCTGCACTAGCATACATCGCCTTCCACAAACCGCTCTTGCATCATGCGTGTTCATGCATGTCGTGAGGCATCTTCATCTGCTCCATCATCACACGCTGTAAACACATTTGCATACCGCGAGTCCCGTCCTCCACGGGTCAGGACGTAGCGATGAACGAGGCGCGCCCGCCCGGATAACTCACGGGTATCCATTCCTATTTCTGCGGCATCCAGCCAGGATATACCCGTCCTCGCTGAACTATCCGCGCCGCACCTCATGTCATTAATCGTGAGCTAGGGCCGGCGTTTAGCTGTCAGCGCGTATTGTTCGGGTTACTCTGCGCGTCAGTACAATCTCATCTACAAATGTCCGCGACGACCCGGGGTATATCCCAAGTAGGCCTGACGAACAGAGTTCACCCGTTAAAGGCGTGCATGGCCACACCTTTTCCACGAATCATCATGGTAAACGTGCGTTGCTCAACGTCAATGCAGCAGCAGTCATCCTCGGCGACTCTTTCCATGCTTCAACCTCGCGGGGAAGCACCCGGGCTTCTTCCTCCCCGATGCCCAGATAGCGCCATGGAGGGGGTATCGACAGCCCGACGAAGAGGTAATCCTGATGCATATGATGGCGTTGGCGGCATAGCACGTTGATTGCGTACCAGATCGTCCCGGGCATTGCCACGGGTAAAGGTTGAGCAACAGGTAAGCATCCCTTCACTCGGTGGGTTTCCCCTACAAACTGCCTCCAATCCCTGCCTACCGCTGTGTAACCGGCCCATATTCGCAGAGCGATGTCATGCGTCCGTGCTACAGAAGGGTGGGAATGGTGGGCGTTTCATACATAAAATCCTGCAGGTCTCCGCTGCGTGGATGTCATGCCGGTCCGTGCACTCTGCAAGACCATTTTTCAGGTCAGACACGGAATGGCGCTTAAATTCCACCCCTTCGTCCTTTCTTATGTTGCCCCCGTTTACCTGTCATCAATCATGCAGTGCCGCGCCGGGCAGCGGCAAGTTCTTCATGTCGCGTCATTCATGCTCTCCGGCCCGGGCATCGTAACTTAGTGTAATGCCAGTGTTTTCTTGTTGGTGCTGCAGCATCCTCTTCCTGCATGAACGCCAGCAGCGCACTGAGATCCAGCTGCCGACGGGAAATACTGATGCGCAGCGCCGCCAGCCCATAAAACGAAGCAGTCGAGTGCCTCATTGCGTCGCTTTTGCTGTCCACAGTATTTTCCTGCCATCCCCATTTCCTCTGATGGGAATCCAGGCAGCCCAGTGCAGTGCGGCCAACCTGCTGTTTATGAAGTCAATCAAAAGAGACGGGGAGCGGTTCGTACACGGTCGGACGGCGTCAATCGACCAGCATTTATAAATCTGCTCTTTCGCGGTATCCGTACCGATTTCGGTACGGCGACCCGTTTTGTTTCGGATCACCGTGGCATGCTGGCCACCGGCTTTCCGTAGACGCATCCCCTTTGGCACGAACACAATCACGCATGTTTTCGAGCGTTTCGAACACAAACCGTCGGGTCAATCCCGGAGTATCCCAGCAGATGACTCGATATCGACATTTCTGCACCATTCCAGCGGTATAGTTTTATTACCGGCCTCATCCACGAGCAGCGTCTGTTCATCGTCGTGGCACTAGGTAATGCCGTCATAATCAGCCATAATCGTCCTGAACCCCATTAGAACTCGCGCGGTCATCCGTCCAGCTGGGAGTCGATACCGGCGGTCAGTAGCACCCGCGCCAAGTCAACGTGGGAGCATCGAACGATAATGCTCTTTCCGCTCTTGCCATCACTTCAGCATCCGACGTGTTCTCACAATTTTCGCCTCCCACGTCTCACCCGGCGTACTGTTCACGAGGTTTTACGTTTTCTCGTATCCCCGTTAATTCATGAATCTGGTCTCCGATGGGCACGAAGCGTGCATCAGTGGTAGAAACGTCCAGATGCAAAGGTCACCTGTCAGGTGGCTCAATCTCATTGCCGCATGGCAATGAGGAGAATGCCATCACGGGTCCCAATCCCGGTCTTTCGCAGGTTAACGGGCATCAGTAAAGTCGCCTCCTGCTGGATGACGCAGGCATTATGCTCAGCATAGAGATAAAACCCTGGGAGGGTCATCCCGGCGTCAGAGTCGGTTTTGCCAAAACGCGTCTCTTTGTCGCACAATTTAATACTGCTCCTCCGCAATGCGGCAGGCAACTGAAACGCATAAAATGCGGGGTTAACCTGCGCTCGTGACAGGTGCCTCATTTTGGCGTGGAGCCACGGATGACTTTGACAGGCGGCCTTCATCAATGTCGAAGAGACTTCGAGAGCTTCCTGTTCATATCATCATCAAAGCAGCAGTTCATCATGGCCACATCCACCGACTTTCACGGTAGTTTTGCCGCTTTACGCCCGGCAGCGAAGCGCATTAGTGAAACGCTTCATGGTGAGCGTGTTATCCGGTGCTTTGCGTGCCATACCACGGGGCCCGCCAGCAGCGACGGAATATCACCGAATAGTTAGCTCAACGTGGGTTTTCATAAAGTTCTGAGGGGCATGAGTCGGAAGGCGAGCACCGGTGGTGCGGGCTGCTGCTAGCGCGTAAAGTAGGCATAACGAGCAGCATTTTGGAATAACTTGACACGGGCAGACATCTTCACGATTTCACGGATGTAGTCGCTGCCCAATCGCATTCATGATGGCCCCTGAAAGGCAGTGTTTCCCATGCCCTTCCTGGTATGCGGATTCTTTCGGGGAGATAGTAATTAAGCTCGCCCATTCATGGGGCGTCTGCTCCGGCCTGAACAGTGAGCGAAGCCCGGCGCGGACAAAATGCCGCAGCTGGCCTGTCTGACGGTATGTTCGATATTGCTCTCAGCAACGAGTGGGGATCCAGCGGCTGCTTGTTCATGGCTTTGATGATATCCCGTTCAGGAAATCGCTCGTGGGTTTTCCAGTTCCGCAAACGCCGCTGCACGACAGGGGGAGCCCGTCGAATACTGGCAATTTCAGCTGCGATCCGCGACAGCACGAAAGTACATCGAATGCGGTTTCCACCACACTTCAGCGAGTCTCTGGCATTCTTCGGATTCCTCCTGTGCGTCAACATTGGTCAGCGCGTAGTCAATGAGGCGTTCGTACAGCCGTTGCTGGCTCGAGATGCCCTGGCCGAATTCGTCCCTCGCCGAGAAAGTCCGTTGGGGTTGCGCAACCCTTTCGAGCAGTTTATGAGTCAAGCACCTCGATCGCTTGCCACCGCCTCGCAGAACGGGCATTCCCTGTTCCTGCCAGTTCTGAATGATACGTATACTCAACTTATAGAAAATGTCAGCCGGCTGCTTTTGACTTCCATTGTTCATTCCACGATAACAAAACAAGAAGGAGAACGACAGAGGCCAAAGCTCGCTTTCAGCAGCATGTCGTTCCTTCCAGAGGGTATTTTTAAATAAAACATTAGTCAAGTTATGACGAAGACGAACGGAAACGCCTTAAAACCGGAAAATTTTCAGCTATAGCTGGGGTAC
>104
CCCGTATCATGCGGCGTTCGACCCATGGCTTAAGCCGAACCTCCTGTGTCCAACTAGAGATTACCGATGAATGATTCAGAGACGCGAGGAAAGGATGCTTAAGAATGCTTTTGCGTGGTATCAGTTTCCGGTGGTGACATAAATGGATTTTACCCTCAGTTCATATTCCCAGCCTCGTCACGATAGTATTTCACAGAGACTCAATGATGGGAGCTCAATGAGAGTTCAATCCCTGGCGCGAGCAAATGTTGCAATCGTGGTCAGTCGTGATCGTGATCGTGATCTGCCGTGATCTTCCGTGAATCAAATTGATCAAATGCAAATTAGTTATGCTTGGTCGTGATCGTGATCATTGATCGTGATCAAATTGGTCGTGGTGCATGTGATCTTGATCCATGTGATCGTATGCTGATCGTGGTGATCGTTATTATTGATCGTGATCTTATTCAATTAATCCTTGAATTATTGAATCCTTGAATTAATTTGTCGTGGAAATTATTGCTGTGAATCCGTTGATCGTGAACTTGAATTGGTATTATTGAATGCTTGGATTCTTTGGATAGAACTGATTGGATATGTCGATAGAGCGAATCGTTCCATCCGTCGGTAATTCCTCGCTGATTCGTTCAATAGGCTTCGAGGAGGCAGCTATTCCGATGGGCACCACGACGGTGAGATACGCATATTCGAGGCTCTTGCAGTAATCATTACTTCGTAACGACGCAAGTAGCCCCTCGAGTGAAGCGTCTCTTATGGTGAGAACAAACGCACTGAGAGAAGGCGGCCTTGATAGTCATATCATCTGAATCAATATTCCTGATGTATCGATATCATCTAGGTAATTCTTATTCCTTCAGCCATCCATTGGAGGCCATCCTTCCTGACCATTTCCAACCGGTTTCCGAACTTCAATCACACAACACCAGATGCATTTAAGTCGCTTCGAAATTGCTATAAGCAGCATTGCGCCAGCATGATTAAATACAGCATTTAATAATACGATAGTTTATTGAATCCGTACGTGATCGGTATTCAGAAGGATTGACCAGAAATTATTAATCTGTGAAGTTGGTTTTTCCTCTGTCATTACCGTCAGGTCGATTTCAATTTCGTACTGCTTTCCATCCTTTAATCAATGAAGGCTTGTAAGTGTGGTAGATAGTGTTGCCGTTCTCCCCAAGCCCTGCTCACACACTCGAGGCAAGGATTCAATAATCAGAACAAGTTAGCTCCCTGTTAGGTTACGAGCGACACGTCGGCCGGTTGTATTCGCACTCGTTTGGAATGAATACACAGTGCATTATTCCGTTATTTATTTATGCCAAAATAAAGGCCAACCATCAGGCAGCTTTGTTGTTTGATTTTACCCAAAGTTACTGGCAATCATTGCCGTCGTTCGTATTGCGCCCATTTGATGGACACTTTCCCTGTCCGTACAGGAAACATTTCTTCAGGCTGGCTGCATTCCGATTCAGTGTGAATGAGGTCCATCATTGAGTCCATTGATTTTATCAATAGGTCGTAGTCAGCCAACGTCAGTATTGTTCCATCACATCCTGAGGATGCTCTTCGAACTCCTCAAATTCTTCTTCCATATCAGCTCCGGTGTGAGCACATTGCATGATAGATTGCCTGTCTTCCCCATCGGACTCGTCTCAGTTACCCTAGGGAGAAATCGGATAAACATCATTACAACCCTACAGTTTGATGAGTATAGAAATGGACAATCTGATCCGGCCGTTATTCTCGACGAGTGTTCAGAGTAAGTGAACTCTGGAGAGTGAACCTCGTAGTTCGTTATCGTGACTTCTGCTTTTAAGCCCGATAGATAACCGGCCTGAATATGTTAATGAGAGAATCGGTGACGCCTTGGCTTGTTCGTCTTTGCTCTCTTGCATTTCGCCCGATTAATGTGCATCGATTATCAGCTATTGCCAGCGCCAGATAAGGATTTAAAGGCTAAGAAAACGCATTAAGAAGATGCAAAACCGATAAATCTGGTGAATCACAGTAATTCAAAACCTTACAGAGAGCAATCATGGTTTGTGCGCATCGCATTAATGAAGGCAGGAAGAGTATGTGGTCGACCCAAACAATTCCCCATACATTAAATGAGTTGATTGAGCTTGGTGTTGAGCGACTTTTACGATGGAATGGAAGGAGGCTATTATTCCCTATTGAGGATATTTATAACGATCCGTGCCAGCTATGATCCATAAGTACTTGAGATAAAACAGCCAACCAAGCTACCCACGATAAGGAATCGATTTTCTAACCTTTTCCCGTTGGCTTTACGCGTTCCGCGCGGCTTCTACATGTTAAAGATCTTGCGCTCATCATTTGCAGGTTGCTTTCAATCTGTTTGTGATTCAGCCAGCACTGTAAGTCTATCGGATTTAGTGCGCTTTCTACTCGTGATTTCGGTTGCGATTCAGCGAGAAGCGGGGGATTGCTCTTTGCTTACCCCAACCAACGGGGATTTGCTGCTTTCCATGCTGCCTGTTTCTCCTGCGACGTTCGCGGCGTGTCTTGTCGTCGCATCCAACCTGGATTCTCCGTCAGTCGCTTTAGTGGTGTGGCAGTCCTTGGACGAACTCCGCGATCCCGCTTGGCAGCGCTGATCCGGAATCGGCAATCAATAATTCGTTTCGTATCACACCCCAAGACGCCTTCTGCTTTGAATGCTGCGCTTCTTCAAGCAGGCTTAATTTTAAGAGCCGTCGCCTTAGGTGGTTAGTCGGCGTCCTCTGCTCCTATCTTCAGTATCACGGAAGTACTTCTGCCCGCCAGATAATTATCACCGCAAATATTTATCTGTATGTCCTGGCAATTATTTGCATTAGAGGCGGTGTTTGAACGCCTGAGAATGGGGTCTATGTCCGTAATACAAATTGTATCTATTTATATTTTCGACGACCCATGCTTGCTTGTTTACCGGGTTATTGGAGAAAGGGAGTAAAGAACATGAGGTGATCGTTGACTTTCAACTTCAAGTTAGCCATTCAGTTGGAAAGCTCAAAAGGATGCATATGAATGAACGATTGCAGAGGCAGTCGAGTGTAGAGAGCTTAGCTTAATGAGCCGCTTGATGCCGTGGAAGAAGCAATAACCCGCAGAAAAACAAAGCTCCAACTCAACAACAAAACTAAGCGAAGACAATAGCCGATGTCATATACGATATACCCCTAATCTTACGGTTAGCGCGTTCTGCTTCCGATTAGAAACGTCAAGGCAGCAGTGCCGATTGCGACCGGCTCTTCCTGCATATGATGACAATGTCGCCCCCAAGACCATCTCTATCAGCTGAAAGAATAGGAATTAATGAGAAGGAGAGCAGCGCAAATGCTTACGATAACTAAGGAATTAATCATCCTCCAGGCAATTCTGTTCCGCATAATTATCACTCCTGATAACAATCCTTAACTTCATAATGCCTTTTAATTCCAGTATCACTTTCTATTCTTGCTATCAATATTGTTACAATATCATCTCTTCAGCTATCTCAGCATTGATGTTCGCACCCGGCCAGATGAGCGTTTTTGATAGATAATGTTGTTCTGTTAAAATATCTCCGGCCTCATCTTTTGCCGCAGGCTAATGTCTGAGGTTAGATGACGGGTTAAAATAATCGTGGCAACCTTTTATCCTTTTAATTCCCTGCACTAGGTATAATCTAATGAGTCGCTAATGCGTGCTAATATCCTGTTACTCCCTAAGACCTTTAATATGACGCCAAATACAGGTAGTGGCTTCGCCTTCACCGTTGTTTCTGATGAGTGAAATCCAATGCATAACACCGTCTTTTAGTGGTTCCCTCCAAGATGACAGTGGCTCTATCTGAACGCGCTCGCCTGCATCACTCTTAATTCCTTTCCCGATTAAAATCTGTCAATCCGCTTGGTCGCGACCACGTTCTGGCAAAACCAATGGTGTTAGCCTTCAACAAACAAAGATGGGAACCCAATGATTCGTCATCTGCGAGGTTTCTATCTTGGACTGAAGCTTTAGAGTTATCTTCTGAACCAGACTCTTGTCATTTGTTTTGGTAAAGAGAAAGTTTCCATCGATTTTATGAGTACTCCGGCTGATTGAACAAACCTGCATGATTATCAGCCAGCAGAGAATGCAGGAAATATCAGACAGGTTTATTGAGCACTTATCTTTCATTTATTTTGCTGCTGTAAGTCGCATAAAACCCATTCTTCATAATTCAATCCATTTACGTATTTATGTTCTGAGGGAGATGAAGGTTTCTAATTCAGTGAAAAATTCTTGCTCAATTGTTATCAGTCCTATGCGCCGACCAGAACCCTTGCCGATCAGCCAAACGTCTCTTCGAGGCCACACTGACAAGCTTTTACCACAAACAACTACGAACACTCTCATTGCATGGGATCATTGGGTACTGTGGGTTTAGTTAGTTGTAAAACGCCCTGACCGCTATCCTAATCAGTTTCTTGAACCAACTCATCACCCCCAAGTATGGCTATGCAGAAATCAGCGGCTCAAAGCCCTCATGCCGGGGTCAACGAGAATTAACATTCCGTCAGGAAAACCGTGGAGCCTGTCTTAGTGCGGTCATGGAATTACCTTCAACCTTGACTCATCACAGAATCGCAGAATCAAACGATTTCGTTGTGCTTTGTACCCCATCTCTCCGCATCATTTGGTAAAGTCCGTAAACAGCTATCTAGTCCAACGGGCACTCAGCCCTCATTCTAAGTACCGCTGCATACTAACCGCTTCATAAGACTCGTAGATTTCTCTGGCGATTTACCGGGGCTAAATTCTTCAACGACTTTGAGAATTTTGTGGCAGCAATGCGGGGCGTTATAAGCATTTAATGCATTGATGCCATTAAATAAAGCACCAACGGAACGGTTGCATCCGCCAGTGGCCCCCATCTTGTCTGCGACAGATTCCTGAGGGATAAGCCATTTGATTTTCTTTCATAAATTGCTTTAAGGCGACCGTGCGTCCTCATGCTCTTGTGTTAATGGTTTCTTTTGTGCTCACATACGTTATAAATCTATCACCGCAAGGGATAAATACACCCGTGCGTGTTGACTATTTTATAACGCGGTGGGTGATTGCATGTACTAAGGAGGTTTGTATGGAACAACGCATAATCCCTGAAAGATTATGCAATGCGGTCGGCACAAACCAAGACAGCTAAATCTCGGCGTATAAGGGCGCGATTGTAAAGCACCCTACCGCAGCCATTCATTGAATGAAGATTTATTTTATAAACGCTTACTTGGAAGCGTTATGCGAGGAAGAGGTAAAGCGCTTCCCGAGTAACAAAAATAAACAGCATAAACAGATATTACATTCCAGCCCTGAAGGGCAGGATTAAAACCACAGCTCTTATGCATTTATTTGCATACATTCAATCAATTGTTATCTAAGGAAATATTATTACATCGTCGTGCAAACAAACGCAACGAAGCCCCGTGAAGAGTGCGTTGCTTGAATCGAACCGCGATTAGTCGAATGAGAAGACGGAAGCTGTGGGCGTTGATAAGTCACCGTGAGCATGGAGAGGGACTGGATTCCAAAGTTCTCAATTAATGAATGCTGTTCTGTGAAGCATCGAATCGTTGACATGGAGCGATTGGGGCGCGACAAGTCGGTGGCGATTCTCAGCCCAAGCCAAAAACAGGGGCGGCAACCGAAGCGTTCGGAACAAATCCAATGGCTGGAGTTCTGAGGTCATTACTACCGGATCTATCAACAGGAGTCATTATGACAAAATACAGCAAAATACTCAACTACCGCGGTAACTTTGCCGGACAGGGAGCACGTAATGGCAGATCCGCACTGATGATGGTTACGCCAGACTAACATTACCTGCTTGAGGCTTATTCGGGCAGCAGATCTGACCGGCAGCAACAGTTCAAATCCTGCTGCTTGCCATTCTGCGTAAAACCTATGGGTAGAATAAACCAAACCAATCACCGATTCTCGTAAGCCGAGAGATTACAAATTATAGTTCAAACGGTGCAATGGGATGACCGGTTGAAGAGAACCGTCAAGAGTAGAACTTGCGGTGAGCAGCATGAATGGAATGAAGTTTGATAAGATAAGATAATACGATGGTGCATCTAGCGGACAAGGGAGGTCGCCCAATAACGAGGATAAAACATCCCAAATTGGGGATTGCTATCCCCTCCCAAACAGGGGACAAAGGTACAAAGAAGAAAAGATTATTCGTCAGAGAATTCTGAATCCTGCTCAACAGCCAGAAATAATTTCTTGTGTGAATGGATTGCTGCGATTCGAGAGCGGCAGCACGAATTAAGAAAGAAAACCTGCCCGCAAGTGAGGATGTTGACATGGTGAAAGACTATCGCACCATCAGCCAGAACCCGAATTTGCTGGTAGCGAGTCCGCTGATCCGTGAACGTGACCTGATACCACCGCGACATGTGTGCTGTTCGGGCATTATGCGCGCCAAGGTTTGGTAACTTTGCTTACCTTTAAGGACGCACTGGGACATGAGCCCGATAAAGCCGAGTAATCAACACCAAACGCGGTAGACCACCGTAACCTAGCAACGGGGGCGATCTAACAGCAGCTCCAACTCAATAATGTATAAGCTGACGAATGGCTTTATAAGATGATGCTGAAAAACACTCGCCAACACAATGATGGAAGTTAACTTTGACGAATTCAGCATCCGTTAATCTAAGCTAGCTTAAGAACGATCACGCGGCCTCCGCAGGGTACCAGAACTACCGAAAGTGACTAACGGTGTTTCAGCCGGTTACTGGCGGTATTTCGCGGCGAAAACCGTCAAGACAATATGAAACAGTCTCAGAAGTGACGAAGGTGGCTGGAAATCGAACCCCTGCCCTTTAAGATGTAAGTTTTCAAGGAGGGGTACACAGGATCACGATGAGTGGAACAATC
>105
GGGAATAAGTGCTCCGCTACCATTTTAATGTCGTTTCATTTCGTGATAATTCCCTTGCATCGATAGTGGAAATCCTCTGAAAGAAACAGTAGGCGCTAGTTTCCTAGTTAGCCAAATGTATACGGTGGATTCAGAACTGGAACGGAATGCCCGTTCTGCAGGCGGTGGAAGGGTAATGGGAGGTACTGCCGTCAGCAACCCGGGATGCTGAAGTGCTTACTTGAGCAACGAAAGCTTAGGCAGTTGTAGATGAAGAAATGCGGCAAGCAGGGCAGATCTCGAGCAAGAAAGGTGCATGGCCGGATGAACGGATACGGACTGCTCCCGTGCACAGAGCCCGACGCACAGGAACTGAAGAATCCCACGGCCTGAAGTGGTGAAATCGAATTTACTGTGATTTCGTGCTCCTTCACGGGCCGCACGCAGGTGAAGTTGAACTTGCTACGGGCTCCACGTGCTTCCAGGCGTTGCGGAACTGGAAAACCGACACTATGTTGGGTTTCCTGAAACGGGGTAAAAGCATGGGGCACTCATGATGAGGTCTAACGGGCATACTCCGAACAGTTAAATCCCACGATGCTGCATTCCCTACGGATTCTAAGCCATCGTTTGAACGGAGCCAATACGCCGTTCAATCGGGCAGATGCTAATTACTATCCCAACGAATCGAATACCAGAGAAGGGCGCTCGTAGGAAACAATGCCCTTTCAGCGGGCTGACTCATCGAGGACGAATTCGAGGCGATGGGCGGCGACTAGAACCCGTGAGGTAGGCACGTATGCCCGGCTTATTCGAACCCCGTTTCGCCTTTACGTCGAGGTCATTAATAATTCCAATCCGACACCTTTAGCCGCACGCCCATAGAAGCCATTATCTGTGCTACGGGTATGCCGAGAATTTATGAAATACCCACGTTACGACTACTTCGTGGTTACTCCGTCTAGCCTTAGTAATGGCCCCGTGGTATCGAAAAGCTAAGCGGGACTAACAAGCCGATAGGCAACGCGTCAATGGGCGTGGCTTCTGGTGCCTGTGCATGTAAGCGGGGACAGCCGTCAGATTAGCTTACATTACATATTAAATGCTGCTTTTGATGATGATTGAACGAACAGGAGCCTCTCACGTTCCTGGGTGAAGCGTATTGAATTAATCGCTTTAAAGTCGATACGTGGCTCCAAGCCAAAAGTGGAACAGGTTCGATCGATTCAACGATGAATCCCCGGATTTTATCGTGAGCTTTCATGTTAATGCCCCGCATTGCGGGGAGGATGGTATTAATTTGGCGACAAAGAGACGGTCCCTCATGGCCTCAAATGGACGGCCCGGCTAATTTTGACCCTGCGAGCGGCTGATCCATCCGGTTAATCACCGGGCACGGAAACTGAGGTTAATGCCCGTTATCTGCGCACTCACGCACCCGTACTGGATCCCAATTCTCTGGTTTCGTCATCCAAAGTCAAGGGAGTCCAACATGACAGTGATTTTCACATCTGGACAATCCAAGCCCGTTCTACCTGGCTTAAGATTTGTCAACAGACTGGATGAAAACGAAAGGGGATACGGGAAAACGTAAAACCTTCGTAGACACCACGGCTTAGAGACGTGGGATGAAAATTAGAACGTCTCATTAGTGCTGAATGATGAAGAGCGGAAAGAGGATTGATTCTTGCTTGCACGGTTCCGTCCTGACCGTGTAGGTCTACGTGACCGCCGGTATCGACTCCCATAGGCAACAGGCTACGAAATGCGTATGGCGGTACTGGGGTACGGGGTAGGAAAGGTGGGGTTGACCGGCAGATTATTATGGGGCCGCCACGACGACCGTCGCTCGGTGAGTTGGATGAGGCCATCAATACAACCCAGCCGGAATGGTGCAGAAATGTCGATATCCCGTATCCGCTCTGGATGCTGGAGCGTGTACTAAATACATGGCGCTCATGAACTGTTTGAAAGTGCTGATCCCCATGCCCTAGAGGGGAATGGCCGTCGAATGGGAGACTAGA
>106
AGGTCATTCCGTTAACGTCTGGTCGGCGAGATAATCGACGAGATTCACGTTCGAGCACTCCACTGTTGAATAGGCCACAAAGCGATAGCCAGGGAATATCTGGCGCGGTGCAATACGGTACTGTTTGCAGGGCAGACCGGTATGAGGCGGAATATATGCGTCATCTTCACCAATAAATTCATTAGTTCCGGCCAGCAGATTATAAATTTATGGTCCGTGGTTGTTCACTCATTCTGAATGCCATGCAAGCCCCAATATAGTTAAATGCAATGTTTTTGACGGTGTTTTCCCGTTACCGCAGCGTTAACGGTGATGGTGTGTCCGTGAACCAAGTGGAACAACAAAGAATGGGCATGAGCACAGCAGGTAACAACCGGATGCTGTGCCACCAATACCAACTGTATGTAGCGCATGTGCACGGCACTCACGCACCGTACCGTAGACAATGAGTGACTGTGGCTGCCTGACGTCCGTTCGATAAAGCTAAGCAAGCCCTGTGTGCTGGTTCCTTTAACTGTGATAAACTTCCTGTAATGGTTGGTCCTGATACTCCAGCCAGAACTGTTCATCCTTAAACCATTTGTCGGCATGAGCACCCGCGCTCCTGTTGAACGCTCCAGACTTGAGCATGAGCCCCGTGTTATTCGTCGATTTGATGCTGTAATCGAACTGCCTGTTGTTTTCGTCCCGTAATCAAACGACGATGTGCTTTCGTCCCCAAATGCGTGGCCGATGCACTGGCACTGTGGGTGTTAGACTTAATTCCATCCTGTTCCTGAGACAATACAGCACGACCGCCTGGCGGGTTTCCCCTTGATTGTCCCTCCGGCATATCAGGAAAGCACAGCCCGATGGATACGCGACAGCAAGTTTTGGGGCTGATTTGTCAAACGCCTGCCCCTGCATCAGGACGTAGCCAGACACGACGAACGATATTATGATGGCCACGGGATCGGCGCGCACCTGCCGGAAAGAGCTGAATTCTCACCGGCCCAAGCTTCAAGAACACTGACTGCAACGGAATTTTTGCCAGAATATCCTGCCAACCCTGAGTCAGTTCAGTCAGGCTGGCGGCATCATTTCCCAAATACGGTAATATTTATTTTTCGCCGTGGAAAGCCCTGCCACCGTCGATGTCAGGGGCACGCACTTCTTCGGTTGTTACCCGCAAGCGCGTTAGTCATGGTGGCTATAAAATCTGGATCTCATTCCCCGGAAGGCTGCGGCCAGTTCATTTCAGATGTATTCAGTGCGTCAGGTGACGCGTCAAACAACGCTCTGCAATCGCGGCCAGTACAAAAGCGTGTTCGCAATCTGGGTATTGTTTGTTCCCCTGAGCGCGGTCTGCTGTTGGCGTTCCGGTCAGTGCCGGACTGTCCAGTGGGCTTTTGGTCGTTTCATCCATTACCCTGTAACCGCCGTGCGTTGCAGCAGCGTTTCAGACGAACGTGCTGTTGGTGCACTGCTCAGCTGCACTATCCTCCCCTTCTTTCTCGTTGTGTCCGCATCCTCAAGCGCGACAGCTGAAGCTATATCTTCTGCACGTTTGCCGAATTTTTGCACGTATTGCCGCCGCTTCTGCCGCACTTTTGCTGTGCGGATGCTGATACCGCACTTCCCCGCAACCCTCTGTCGCCTTCGTGGGCTGCCGTTGACGCACTCCCGCCGCCGCCGTTGTTTGCGCGTCTGCCGCGGCAGGAGGTGGCGTTCCGGTATGTTTCAGATACCTTAAGCATTCGTCGACGCACGTTTTTGCCTGGCAGAATTTCTGATGCCGCCGTTGCCACCGAGGAAAGCTGCACGACCGGCACTTGATGGGTGCGTTCGTTTCTGATGATTTTGCTGCCTCTTTGAGGCCACACGCATCTCGTGCTGAAGTGGCGGCTCGGACGGCTTTCTCTGTCCGGTGGAGGCAGACGTGGCGGCTGATTGTTTTGTATCACTGCAGCATTCGTTCTGACGTTTCGCCGCACCGGCACTGGTAGCCGGCGCGCGTTGTAGAACTCTGCGGCTGCGGCACTTTTCCGCTTCAGTGGCTTTGCTGATGCGCTTCTGCGCCGGAGGACGCTTCCTGAGCTGACGATGCAGCCTGTCCGGCGGACGTGCTGGCGGCGCGTGCTGGATCAGTTGCATCAGTTACAAAGCCGCCGCGACCTGAAGGCTGATGCACTGGCATCGCAGGCTGATTTCTTCGCGTCTGCCGTACTCTGTGCCACCACGAGCTGACGCGTTACGCGCCACCCTCCTTCCACCATGAGTTTAAGACGACGCAGCACCTCCGGCCGGGCATCATCCTCCGTCATGGCACAGAGAAAATCATTCAGCGTCCCCGGTTGTGAATCTTCATACACGGTGATGGTCCCGGCGTGCGTACAGGGCTAGGGAAAACCGTCAACCTGCAGGTCAGGACAAGTACTGACCGTACTCCACATGCTGCTGTAACGCCCGGCCTTCATCCGGATTCCTCGGCCCACCGTGTTTCACCACCACCGTGGTGCTGTTACGTCTGGCTTTCAGCTGAATGGTGCAGTTCGTGCTTTATGTACCATTTTCCTGTGCGTCTTTCAGGACTCCTGAAATCTTTACTGCCATATTCACCCCACAAAGCCCACCGTCCATCCGGCTGTCATAACACTGTGTTACCTGGCTAATCAGAATTTATAACCGACCCAACGATGAATCCGTCAGTACGCCAGTCGCCACTGCCGGATGCTTCATAAGCAATATCAACAACGACGGACGCTGCCGGATTAATCTGTATACTGCACTCCACGCCACTGAGGTATATGCCGCATTGCACTTTCGTCCCTGGCAGTGGTCGTTCCTTTCATACCCGGGAGTGATTTCCGTCTTACGGTAATCCATTGTAATGCCGACCACCGACTGTGAGCCACTCCATGAGTGAGCATTAGGACCTGCTTACTGATTTGTAAACCGGTCACATCACACGGCCACATAACGTCCCACGCAGGCTCATAGTGAAACGTATCCTCCCCGGTCATCACTGTGCTGCTCTTCTTTTCTACTGACGCTCGAGCAATGAGAGGGAAGCCATCACCGCGCACACTGTCCGTCACTCATACGTATTGCACGTTAATCCCTGTTTACAGCTCTCCAACACCGGTATCCGACAACGACGGCAATGTATACCCGGTTTCATTGAATAGCCCACTTAAACGTACGATTTGAGCGTTCCGGCACGGGCTCAGTGACTGTCACGCAAGTGCGGCAAAGACAGCAACGGCAATACACATTACGCATCGTTCGCCTCTCACTGTTTTATAATAAAACGCCCGTTCCCGGACGAACCGTAACACACTCGAGACCACGCTGATGCCCAGCGCCTGTTTCTTAATCACCAGACCTGCACATCGCTGGCAAACGTTAACTGGGTGGAATATCTGCCGATCCGATTTGACATCGGGGCGTGAACGTCAGGATACCGTTTCCCCGACCCGCTGGCAGGTCAACAATACGGGAGAACACCTGTACCGCCTCGTTCAAGCGCCATCATAAATCACCGCAATACCGTTCATCAGTACTTTTACATAACACATCGAATACGTTGTCCTTGCTTTACATATCGACCCTTACTTCCGACACAAACGTCCACTAGGAAGCAGCAGCACTATCTGGCGATCAAAGGATGGTCATCGTCACGGTGACAGTCAAACTATATTGACGGCCAGTCCACACTGCTTTCACGCTGGGCGCGGACCGCCCCCTGGGCGCCGCCGCTTTACAATGTCCCCGACGATTTTTCCCTCAGCGTACCGTTTATTACGTACAGTTCGTCAGCTATCGTCACATTACTGAGCGTTGGAGTTGCATTCACACTGCCACTGATATCCGCATGTTAGCGGTCAGCTTTCCGTCCGGTGTTAGAAGACGCCGGAGGATTGCGACCCGCTGTCATCGTGGGGGCCGTCAGGCGCTTCAGGAACACGTCGTTCATGAATATCTGGTCCCTGCCACACAAACATCGGCGTTTCATTCCCGTTTGCCGGGTCAATAAATGCGATAATACGATTGGCGGCATGAATAGAGAAACTGGCTCAGTTTGCCTTCCTCCGTGTCCTCCAGTGCTGAGGCCATCACGCGACATAATGTTGCCGTCTTTGGTCTGCTCAATAATTTGACATAGCCCACATGGGCATTCCACTTATCACTGGCAGTTCCTTCCACTCTTTCCAAACTCCTCCAGTGCTGGCGTTATCCTCCGTCAGCTCGACTTTTCCAGCAGCTCCTTGCCGAGATGGGATTCATTTATCTTGCCCTTTGAAAATGCAGGTAACCTTCCCATCATCAAGCCGACCGACGCCTCCACGAATGCCGATTTGCCAACGCGTTCACACTGCGGATATAAAGTAATAATCTCTTGAGCGGTTTGATATTGATACTGGCGGCTATCCAGTACAGCCGTACCAAGATAACGCGTGCCTGGTTTCAACCTGTCTGATATCGTCGCAATCTGCTTTCCAGAACCAGAACTCAAACTGTACCGTCGGGTCATAAACGCAAGATGCGGCCGTGGCGGTTATTATGAAAATATCAGCGAGCGTCTACCTCAATCCTCGACGGTGCTGCCGGTGCGGCAATCCGGAACGATACCGACGGATGACATGCGCTCTGCCCGCATTTACCGCCGGACTGTTGCTCGTAGTTCCCAGCGCCAGTTGCGTGAAGGCTTATTGGTTTCCGTCGTCCGGTGGATTCATCTCAGCCGCTCACTGCCGTCGTCCCTGTTACGTCGACGGATACAGGAAATTCACGCCCTTCACTCCACCCTTCGGTGTCCCATCGCGCCAGCAGCTGATATTCCCCTGTCTGCAGTACTTCTGCGTCAGGTGCTGCACGCTGGCGGCGTGACAGGATGCCCGTGCCACTCTGTTCGCCGTCAAAGTGCGCCCGTTATCTAATGACAGCCTCTTTTCCGGCACATGCGAATTAGGGCGGGCTGGCATACGTGCCGTCGTCGTTCTCACGGATCTCACGCAGCGGAACAGTCGCCTGGCGCAGCGTCGAAGCTTCAGCTCCCATACGCTGTATTCAGCAACACGTTGGAGCAAGCTCATTTTACCTTTCACGTTGCTGTGACGGGACCTGAACCCTCCACGCTGACCGGATGCCACTTCCGTCGTAACCAGGCTGTATCAGCGGTACAGGGGAGGATGGCAGCGTGATTTCACGGTCGAGCGTCAGCGTCCGGGTCTGGCTGTTCACCACAGCGCACGCACGACCACCGGTGCTGATACCGGCACTAGTCATCATCGCAGATTCAATAACATCGCCCGGTACATGGCGAACCCTTCTGCGCCGACGCTGAAATCGCACGGTCTGCGTTTCCAGCAGTTCTGTTCTTAATCAGCCACAGCCCGGCTAGGGTCGCCTGCCCCGGCTGGTACAGCCAAAGGCATCCATCTTCGTAACAGTCGACCGTAACGGGCAATGGCCTGCGTATCTTCAACAGCTCTGTCGCCGTCTCCCAGCCGTTGTTCGTATAATCCAGCAGTTCACTCACAACGAACCGGCAGTCCTTCAGGGCGCTGAAGCTGTAGCGGAACGCGCCATCATCCAGGGCATCATACACAGCTTACTGCGGTTATAGTCCACGTCTTATCCGACGACGTCGTCTCTGCACGAACGTCAGCGTCTGGTGCCGTTCCATACCGGCATACAGCGCATCGCCGAGCAGAAATCGCTGAGCACATCCCACGCCTTACGCTGTGGTCAGGTACGCATTACAGGTGCGCGGCGCCGTGCAGCCAAAGCGTCCGGCACTGACTGTCGCAGTACTGGCCGATGAAGCCAGCGCGGCTTTATCCACATCCGCCGCACGACGTTTCCCGCAGGGCTGCTATCCGCGGATGGGTCAGCATATCCCACAGACAGGCCTGTCTTGTCCTGTATGCCGTTAAACGTTCCGTCCCATACCGCTGTATTGCCGCGTCTGCCTTATAGTTCGACGAGCACCTGCAGAATACGCCGGCATGATAATTACGGCTCAGCTGCTGGCTGCCGAACTGCTCCGAGTCCACCCTGCACGACCAGTGCCGTGTCGGGTAGCACTGTTCACATCGATGATTTCAGTGTATGACGACCAGAGCGTTTGTTCTGCAGCTGGGTCGTGGCTGTCCGGCGTCATCCTGCGCATCCATATTAAACGGGCGCGGCGGCAGGTTACCGAGCTCCACCGAGGCCAGATACTGCCAGGTGTTAGTCCTATCGTGTTTTTGCGTCACCGAGCCACCGTTACGTTGTATCTGAACCAGCATAGCGACTTCCGACCTATTCGGGTCGGTTTACGACTTCCACCAGTGCCTGTACACCGAAAGGCGCGCAGACGGTCGATGTTTGCATACGTAATGATGGTGCGGGTACTGCGTGTCATATTTCACTTCCGTACCAGCACCGTCTCCGGAGCCCGCTAGTCATTCAAATCCCCTCCGGCCATGCTCCGTGCTCACGACCCCGGAAAGCCACCGTGACACCGGATATGTTGTATTCCCCTCAGTGTCCAGCGCACCGGCGTACTGTTCAGCAGCACCGTTGCAGCCATCCACCGGACCTTCAATCGGCCTTCGCTGATGCATCGATCACACTCAGCAACTGCGTGACTTCAGGTCCTTCTTCGGTCGCGCGGGGCTCTGCTTACTGCTTCCTTTACCCATTCCTCACTCCATAAATGACAAAACCGCCGCAGGCGTCCAGCGCACATAAAACATTTGCATGAGCGACCAATCACAAGCTGACCACCGTCCCCCTTCGTCTGCCGTGCTGACAATCTCCTGAGAAGTTCTAGATGCCCGCGCATTCCCGTACAGAACAGGCAGAACATTGCCCTGGGCAACCATTTATCCAGTGAGGAGAAATAGGTGTTCTGCTTACCGTTATCCGTTGTCGTGACCGGGGAGTTCGGCCCTTTCGGTGCCAGCATCTGCGCCACACCACCGGGAGCACCATACTGGGCACTAGAGAAAACAGGATGCCGGTCATACCACCGGCCCCAATGACTCTAATCCCCCATGCTGCATGGCTCCGGCGGTAAACGAATGATTAAGCAGCTTAATATGGAGGCAGCCGCGGATAAACTGGAATACGCTAGTACTTGTATGCCCCCGGCGACTCCTGGGAACAATATGAATTACAGCGCCAGCACTAGGCAGAGTCTCATGTAACTGCGCCTTAACTGATAGGACGTGCTGACGTCCCGCCGCGGCAATGCGTACCTGATACCAGCCGTCGCTGAGTTTCTGACGAAACTCGCCGGGAGCTGTGCTTGGCCAGTGCCCGGGTTTCTTCAGCCTCGCCCGTTTTCACACGAAGTCGATGCGGGGCGACCAAATCGTTGTAATCCCGTAAAGGCAGATGCGCGCCATGCCCGGTACGCCAGAGAGGGAGTGTGCGTCGGTTCCATTTGTCGGCTGCCTCGTTTGCTCAGTTGTTCAGGAATATGGTGCCGCTAGCCGTCGCCGCAGAGTAAATGCGGCGTATTCTCGGCACTGATGAACCAAACAGCACAGCAGCACATCGCCGGCTCTGCCGGTAGGACAACGAGCTGATACATCCGTCGCCTCCAGATTATCCAGATAGAGATTCTGGCCGTTACGCCCAGTCATCCTCGATGAAAGTCCGGCATCTCAATCCCGCCATGAGCAGCATCCCGGACAGTGTATGAAGTCCGTCACAATTCAAAGCCGGCGCCGCGTACATGCGGCACACAGCGTAAACTGAATCGTCCCCCGGCAGACCAGCCACCACGGCAAATCACTCTGCACCTGCAGCCGCCGGTCGGCCTCACTCAGGCGGGATAGGCAGAAGAGACGGGGGTGGCCTGGTCCAAGCGAAGCGCCAATCTCACCGCTGCATTTCCTGCCTCACTGCAGAGGCTTCCGGCGACATACGGAAATACGCCTCCGGCTCACCGAGAGCTTCGCAGGGAAATATCTTTCCCCTCCGGCGTGCTTACGAAGCTCGCACGACTCCGCTGCACACATCACCCCGGGCCGGCGTGCAGCGAGAATCCCTGATTCTGTCTGTGTCATGGGATCTTTACTGCGAAGTTGTTAATGGAAGGAAGCCAAAGTTGCCGACGTTATTGCGGAACTTACAACCGACTCAGGCATTCATGCATTTATCCTTCGTCATCGGACGTTGCTGGTCATATTCATCCGCGACAGCCGACCGCTATAACCGCACTCGTCACCGCGATGGGTCCAGGTGCATATTAGAGCATACGTTTACACGAGGAACACCCGCCATCCGTTTCCGTTAGCGTGAGACAGATCAAGGAAGGATAACACCCACTGAGGAGGTTCGCTGCACTGGCTCAAACCCTCACAGCATAGATGATCATAGCGCTGTAACCCTATTATACAACTGGTTTCTCCGTTTACGGAAGTTCACGCATCCAAACGGGCGTAGACCTTACCGACCCGTTCTGAACAAGAGCGTGATAAAGACTCTGAAGATGGTCGCCCCATCCCATGTAACATACAATTAAGATCAGAAACCGTTAAGGCCGTGGGCTAGTTGGTACTGGTGCTTTAAGTCAGTCAAAACCGACTCGGAGTGAACCGGGGTAACTGATACTGTCGCCCTTACCATGACCGGCTCACCTTTTCGTTTAACATGTACAGAAAAATAACGTTCTCCACCGATAACTGTTTAAGTCAATTTCGGAGCACCACGCTGGCCGACTGCTCCGACGAGTGCATTCATTCAGAGTGTTTCCTTACCAGATATCCTGCATCAAGTTCACCCTGTTTAAAACTGCGCTGAACTCAACACGCAAGCATACTGACCCCGACGACCATTTTACAGGTCACCTTCTGACCCCCACTACAGGCATGGAGGCAAGAAAGATTTCCATGAGCGTTACTTCCGGAAACGACTCCAGTACCGTAGGCCTCCTACGGGAGGGACAGAAAGCGTCACGAGTCACGTTTCAAGTGGCATTCATGAAGCAGGCACTAACATGAGGAACACCACATCACAAAAGGGCACTACGTCTGTCAAGAAGGACCCGAACATCAAGCCAATTATTCACTTTCCATAGAAAGTTGCCGTTACACTCAGGAACAGCACCATCACGCATCTGTTGAATTTCACTGACGGGCACCCTTGCGTCAGTCATACACCGGTCAGAGCAGCCGTATAATACTTGCCCGTTCGTGCCGTTATTTGTTAATCACACACTGGTTATTCTTATAAAACGTCCGGACGCCTTGAAGCGTCGTCCGGATGCTGCCGGTGTACCGACATAACCGCCCCAGTGGCACACCCATCGACCTACGGTAAACAATTCCCCACGATCAGGTATGTTGCCTCCTTCTGCGGACAACTCACACGGTAAACAATCTAAGTAGTCATATTTGCCGCCGTTCCGTTAAATCCTCCGGTTTAAAAATGGGGAAACTTCTTTACTAAAGGAGCGAACGTAGATGTACCGCTGACGCGGATGCGCCTAGGATAAAAGCCCCACGATGGCTGCCGATACTCCCGACAATCCCCACCATTGCCTGCTTAGACCGATTTGGTCACTTAAGTAAGCACGGAACGGGTGAAGCTGCGCCGGAGTTCTGCTCACTGCCGTCACCCAACCCGCCGACTTCTGTGCAATACCAATAAATTATCTAGTCTGCTTAATTTTACTGCGACATACTGTCCGTGGCTAGCGCTCTTCCACGCCTCACTCCGACGACTTCAGGCTTGGATGAGAGTTCCCCGAGACCTATTGCAGCCAGGTCTTTCTTATGACACTGACGTTATTCAGCGCCATAGATTATCACATACTATTCCTTCAAGCATGTTTAGTTATCTCGTTAACTCCGTTCTTAGTCAGTCCGTTCATACCCCCGTAAGTTCGCATCAATACCAGCATGAGTTTTGCCGAGTCCTGCTGTGCGATTATCCGCCTTAGGTCCCCCACCCGTTCAGGCGGGTACACGTAATACGTAGTTGCCAATATGCAAGCCATAATGAGTTTACTCCATAGTTTAATGACTTTATATCCACCATAAAGGGATTTCTCCTGTGCACAGACAAGCTGGCGACGTTGCGCCGCCTCTGAGCAGTACCGCGAACTGACTCTCCGCTTCGACAAATCCCGGCGCTTAGTATAATTTTAAGGTTTGCTCTAAGCGGGCTTCTCCAGCGTTAGAGTCGCTGAAGGGTCAGCAGCAAGAGAAGCATGAGCACCTGTCTTCCGTGACGACTTACCCCCGACATAGTTGGACGCTGGACTGTTCGGCTTTTCACTAGTTAGCTTCATAAATCCTTTCGCCGCCATCGCATAAGTGTTGTAATCCGCTTACGGGATTTTCCGCGTCTTTCAGTGCTGTTTGAGTTTCTTCCTGACGGTAGGATACTTTCTAAGGCTAAGCGATTTATCAGAGCCGTTCTGCCACCTCCACTTTAGACGTCGGTACTGTTCAGGCTTGATTTAATATCAGATATGCTGCTATCAGCATTCTTTTGTTAGTGTTTCAATTAACCGTAGTTAACAGATCATTTCGGTAGAAACCTTCATGATCAC
>107
GAGTCCTTGATATTTCTTTAGCCGCGTATAAGGGCTGCTCTTAATGTCCGTACCGGAAAGGACCACCCGTAAAGTACTACTGATTATCATCTACATCACAACGGGCGTGGAGGCCATCAAACCACGTCAATGGATCAATTAGTACCTCTGACGCAGGTATCGTATTAATTGATCTGCATCAACTTAACGTAAAAACAATTCAGACAATACAAATCAGCGACATGAATACGGGGCAGCCTCGTCAACCGAAGAACAGAACCCGCAGACAACGCAACATCCGTTCTTCCTAACCAAATGATTGAACAAATTACGCTCCTGGTTGAGCAAAAGGGTCCGGGAAATTTCTCGACGCCTGGGTCATTGAAACGCCTGCCGTCGGAGACCTCGTCAGAAAGAGAGCATATACATCAATTAAAGTGATGAAGAATGAACATCCCGCGTTCTTCCCTCCGAACAGGACGATATTGTAAATTCACTTAATTACGAGGGCATTGCAGTAATTGAGTGCAGTTTTACCACTGTTTCCTGACAGTGACATATGACTGCGTGTTGGCTCTGTTACAGACTAAATAGTTGAATGATTAGCAGTTATGGTGACCAGTCAACCACCAGGGAATAATCCTTCATATTATTATCGTGCTTCACCAACGCTGCCTCAATTGCTCTGAATGTGCTTCCAGAGACATTATGTTCTATACCCTGCAGCAATTACAACATCAGGTAACTCAGAAATGGTGCTATTAAGCATATGTTTACGAATCGATCCACCTAGAGGATACATCAATGAATAGTTTGTTCTGTTGGATTTTGGTCGCTCCATGCCTTGCTCTTCATCTAGCGGTTAAAATATTACTTCAAATCTTTCTGGGCACATTTACGGCTTTACCCTTACATACATATGTCGGTTGTATTTCCTCTACCAGAATGCCAGCAGGACCGCACTTTGTTACGCAACCATCATTAAGTGAAAACATTCCTAATATTTGACATAAATCATCAACAAAACAAGGAGGTCAGACCAGATTGAAACGATAAAACGATAATGCAAACTAACGCGCCCTCGTATCACATGGAAGGTTTACCAATGGGGCTCAGGTTGCCGGTTTTTAAAGAAATATTCTAATCAATATTAGAAAAGAGAATTTAGACTGTGAATGTTTTATTCTGAACTAAAACGTCACAACGTCTCACATTACTTTACTATCTAGCCACAGATAATATTCACATCGTGTTAGAAAACGATAACACCGTGTTAAAGGACTTAAAGGTTGTAAATGTTAAATTCTCAAGAAACACGCATCTTATAGAAACGTCCTATGATAGGTTGAAGATCAAGAGAATCACGTCGCAGGCAATACAGGGAAAATCTGTGCTAAGCAGGAGTTTTCCGATGAGTACATCCATGAACATAAAATATTATAGCTTTGATAATTCATGCTTTACTGAGAGCATTCAGAACACTACACAAATCTTCCACGCTAAATCATAACGTCCGGTTTCCTTCCGTGTAGAGAGCAGGCAGCGTGCGGCTGATCGAACTGATACGTACGCGCTAAACCGCTTGTGCATCGTTTTAATTATTCCCGGACACTCCCGCCCGGAAGTTCCCCGTTACGGGGCTGTGGACATAGGTTAATCTGGCTAAAGGATACAATGACGATTCATCGGACATGACATACATTACAATATATTAACAATATGAAATTTCAACCGCTTGTTTAGGGTTTGTTTTAATTTTCTACATACGATTCCTGCGAATCTTCAAAAGCATCGGGAATAACACCATGAAAATGCCTACTCGCTACTGCGCTGGCCCTGCTTATTACCCATGTGCTCAACAAACGTTTACTGTTCCAAACAAACCGGCAGCAGGTAGCACCAAAGGAAACCATCACCCATCATTTCTTCGTTTCTGGAAATCCAGGAAGATAAACTGTCGATGCAGCCAAAGTTGTGAGGGCATAGAAAATGTTGTTAAACAGAAACCCATAGCAAACATTCGTAAATGGATTGCTCGGTTTAGCTTTAGGCATTTATACTCCGCTGGAAGCGCGTGTATTGCTCAATAATTGCATGAGTTGCCCATGTACATGGGCAATAATCTATGCACGGCACTTAAGCCTTAATACTTCTGGGTTCCTTCCAGTTAGTCTTTGCATAGTGATCAGCCTCTCTCTGGTGAAAGGCAATCCGCGTTCAGCGGTGCCAGTCGGGGGAGGCTGCAGCATTATCCACGCCGAGGCGTAGCTTCACGGACCTACACGAGCTGACAGACTGCTTTGATGTGCATAGGACTCGACGACCAGCGGCAACATCATCACGCAGCATCATTTCAGCTTTAGCATCAGCTAATCCTTCGTATTTGCATGGAGCGCAGCAACATCACGCTGACGCATCGGGATCCGTATGCCAGATGTCACTGCATATTGCGCGTTCGCCAGGCATTCAGTTCTCTGGCAGTTTTTGTCGCGCTGGGGGTTGTAGTAGGCGTTATCACGGTGATCATTAACACGCCCATGACAGGCAGACGATGATGCAGATAACCAGAAGGGATAATGCGGTACTCTGCTCATACAACCCAATCTCTCTGACCTACGTTCCGCCGCTTCTTTGAATTTTGCAATCAGGCTGTCAGCCTTATGCTCGAACCCACTGACCAGCGCCGGCAATTGAAGCCCATAGTATTGCTGCAACGGTCGATTCAGGCTGAACCCCCACAGGATTACATTGATAATCAGGTAAAGCGCCACGCTCCTTAATCTGCTGCAATGCCCCACAGCGTCCTGACTTTTCGGAGAAATCTTTCAGGCCAAGCTGCTTGCGTAGGCATCCCACCAACGGGGAAAGAAGCCTGGTAGCGTCCGGCGCCTGTTGATTTGAATTTGATTTAGACGCGTGATCAAGTTTGCGGGTGGGACCGTACCAAGGTAATAGCTCTCCGCCTACAATGACGTCAGTATAACCATGATTTCTGGTTTTAACGTTAGTCCAGTTCCTCTACAATCACGCCAGCAGCGACTGAGGAACCGCCTTACGTTGATTATTGATTTTACCATCTTCTACTCCAGCGTTAGCAGCGAAGCGTTGATAAGCGAACCAATCGAGTCAGTACCGATGACCCGATAACAACGCTCGTTATAAGCGGAGAGATGTGCTACTTAGTCTGGCCAACCGAAGTCGAGAGAAGGTCACGAATGAACTAGGCGATAATGGCGCACATCGTTGCGTCGATTACTGTTTGTAAACGCACCGCCATTATATCTGCCCGGAAGGTACGCCATTGCAACCGCAAGGATGCCCGATGCCTTGTTCCTTTGCCGCGAGAATGGCGGCCAACAGTCATGTTTTCTGGCATCTTTCATGTCTTACCCCCAATAAGGGGATTTGCTCTATTTAATGCCGGAATAGTCGACGTACTGATAGAACAAATCCAGGCTACCACTGTGTTAGTAATCAGATTTGTTCGTACGATATGCACGGGCAAAACGGCAGGAGGTTGTTGGAGACCTCCTGCCACTGAGCTTCACGAAGGTCATGTGTAAAGCGCAGCGTAACTATGTTACTAATAATGAATTTCAGGACAGACAGGCTAGCTCAGTTTGGGTTGTGCTGTTGCCTGGGCGGCGATGATCGCCTGTGGATCGGGATTTGGTAATCCGGTTCTGGTGGTTCCGGTATTCGCTTAATTCAGCACAACGGAAAGGAGGCACTGGCAGCTGAGGCAGCCGACTCTTCACGATTATCACTCAATGCTCTTATGTTGTCGATATATAAATCCCGAAACCGTTATGCAGGCTGACAACTACTAGCCTCGCAGTCTAACCGTACGAAATGTTTCGGGAGTGCGCATTTTTGCATACCTCTGCCTGCGATGGTCCGATTCCAGACGATACGTCGAACCACTCACGGCGGAATGCGTAGTAAGCGCCGCCTTTCATCTCACTACAACGAGCGAATTAAGCATCGTTGAGTCAAATTACCCAATTTTATTCAATAAGTCAATATCATGCCGTTAATATGGTTGCCATCCGTGGCAATCATGCTGCGCTAAACGTGACCGCATTCACAAATGTTGTCTGCGATTGACTCTTCTTTTGTGGCATTGCACCAGCGTCATACAGCGGCTTAACAGTTAGTACAGATTGATAGCTAGATAGATTTGGGATTAAGCATCGTCACAGGGCGATATGCTGCGCTTGCTGGCATCCTTGAATAGCCGACGCCTTTGCACTCCTTCCGCAGCACTCTTTCTCGGACAACTCTCCCCACAGCTCTGTTTCGAGGACTGTAACCGCACGGCCTGACATGGCAATCTCTGCATCTTGCCCCGGCGTGCTCCCTCTACGGCCAAGGGCAATAATCGCATAAGCGGAATGTTGCGAGCACTTGCAGTACTTTGCCTTAGGTTTCCTTCACACTCGTTGCCACACCACGGTATTTCCCCGATACCTTGTGTGCCAAATTGCAATACAGATAGATAGTTACTCGTTTGTTTATTTGGTTCTTAAGGGTTCGTCGTGCTTACCCACAGAATGGCAGCCATGAATCCGGCTTTACTTGCCTCATCGGAGAGCATCTAAGCCTTAAGAGTCACGAGGAATCACAGAAGGCGTACGCGTGTGAGTGCTCATCATCGGGCTTTTAGTGAAGAGTGAAATTTAGCTACGCTTTCGAGTCTCATGCCTACTTCCTCAACTTACCTGAATCAATGTTAGGTTTCCGCATACCTGCCGGTATCGATACTCATTTGGTTGGCAACTTGAGTGGTTTCACTGCTGGCGTATGACCACGGATGAACTGTCCCGCCTGTTATTTCTTTCACGATCCCGTTTGTGGATTGCTGATTCGTTCGAGTTCCAGATTATCTACCGCTGATGACTCGTTCCAAACTCGTATTCGTTAAAGGATAATCGGCGTGGCAGAGGTAATATTTTATGTTGCTCTGAGTTCGATATGATTAACGGAAGTTCATCTGCTTGTTGGGCAAGATCCGTTAGCCAGAATTTCTTTTAATGGCCATTAAAAGAACCAGCCACCGCCATGTAAGCAACCTCAGTGATTAACGTTTCCTGATAAGCCCATCAATCATCATTTGCTCATGGTTTCCACGTACAGCTCTGAACCCCGGAAACCGTGATGCACTTCCAGGCATTCAACGTTCTCTGCATAAAGGATGGAAGATCGCCCACTAGATAAGCAGGTCTTTTGTTGTCGAATCCAATCGTATCCAGGTTCTATCAGGTTCGTGTAGCATCCGTGCAGATCGCACTACCCAAATATTTCGGTATTTGCTTGCCATCAATTTTCGTAATAGGCGCATCTCTTTCACTCCATCCGCGATGACCGCTGAGAACGTCGTTGACGATGGCGTGCATTTCCCGTCTTTATCATCAACGTATTTTCTGACTCGTACCGCGACTAAGTTCAGTGCGTAGACCTTCTGTCTGATTTCCGTATGTTTAAGCCCGACCAG
>108
AAGTCTTTAAATCCTTCTCCATTGCATGGAGTGGGGCTCCCCGTTGCGGCTGCTGTTCGTAGTTAATCTAATGACCTCAGTCTATTAAACCCCCGGACGACGCAAACTTTCGACGTTTGAAAGGGCCGTATCCGGCCTCTTTTGTTAGACGCCAATTGGCTTTAGCATAGCGGACAGGAACATCGACAGTTCAACAAACGCCAAGTACGTGACGACATTTTCCCTAGTATAAGTGGAGTCATATTAAGCACCATTTTCAGTTGACGGCATTAAACAGCGGGAATGCCAGGGCTTTGGCTAGGGACTATAAGCGGGTGCGCCTACCTTTCAGAGTCGATCGCTCCGTTACATAAAACCGGTATGCGCCGAAAGGGTACCCTAAAGAATCTGAGACGAAAGTCTATCCTGAGGTCGAGCCGCGGTTATCAGTCGGTCAACGGGCAGGATTAGCATCTCCAGCGAGTTGCAAAACGGTCCTTTGACAGAACGTTTCCATCGATCCTTCTTCTCCTGAAATCCTGTGACGCGCTCGAATCGCAGATGGAGCAACTCGCATTCGACCTCATTGCCAACGCGGCTGAGGCACACGTTTTGTCGAACCGCATCGGGGGTTTTCGGCCTGGCCTATGGGCACTCATTTTATACAACGGGTCGCCAGGTTTCGACCGGGCATAGTCTCTCTATAGCAGGCGGTGCAGGGGCTTTCTTAAACGGAAACCTATGACAGGTACTCCCCGAACGCGATCATACCAAAGCGATGAAATTTTAACAAAGCCATCCGTCGCTGTCTCCGCTACGAATCCGCCATCCGGCTCCGTCTGAGTAGCTAGCCGACAGTTTGAACAGTCAGCGGTTACGGACAGGGCTCGCGCACCTGTCCGGCGGCGCTGCTCTGGTGTTTCGACGGATGGTAAGCCTAATCGTATCTACAGACGCGTCTATCGACCGCGCTGTAATGGTACGTAGCTTTCCCGAAAGAATCTCACGATGACCTTTTCTGAACACTCCCCGGGCATGGGAGCATCGACCGCGATGGGCAGGATTAAGGGGGCGAAGAGGCGCTACGAAGTTATTGCATTTATGGCCGACCTCCAAAAATGCTTCCTTTCGGCTGCCTCGCGGCGCCAGGGAGCCGTTCCCAAGCAGCCCGCTCTGCCGCCGACGGATCCATCCCCCGTGAGACGTGAGGTTGAAAACCCACGTATGCAGCTTCACGAGTGCCTAGAGCCGGATTCTTATGCTGCTGTGGCCGCGTTCACAACGTAGTATGGACGAAAAAGGACTTAAGACAATCCACTAACTGTAGTCTGGGCCTAACGATTTCATGTCCTTTAGGCTTTCCGCTCGGGCGCGGCTGTCAACCGGCAAAAGGATTTGAAAATACCCTGTCATCTAGCTCTGTTTATGATCGACAGCCGCGTTGGTACTTTCGTCCCATTTGAACAGTAAAGCTCCCTTTCAAAGTGTTCCTGGGAGCAAGGGCCGAAGGCCCTGCAGTGCGTTACTGTCGTCAAATAGTACCTCCCTAGGGGATCCAATACGCCAAAAGGCTGATCTAGAGTTACGAGCGACTCATGAATCCCGCATTAGCTGGTCGCGCAGCATCCCCGCCACTGCATTGCTCCTCTGGGAGGTTAAGTATACCCTAGGACAGCGGATCAAAGAGACCTGTAGGAGTGCTGGGCACGCGACGCCGGGGTTAATGCCTTCCATGTGCGTCCGCATCCTGGGCGTGGAGCCATAATGCCCGGCCAGTTCGGGTGTTCCCCAGCGCATCGTGTTGCCCGGGAGTTTCTTTTATCTCCGTTCCGTACTTTGCGAAAACCGCCTAATCTAGGACCCCCTCCGATGCCGGTACGCCCCTGTTACAGGTCTTTCTACGCGTCTCCAACAGAGATTAAGCTACCCTAACAGGTGACCTTCTATCTCACGTTGGGACAGCGAGTAAGAGCGCCCCAGCCACCTGCCGTACGAGCCAAATGGACTTCACGAACAGGACGGCGTACACCGTAAACGTAAAATCGTTGGGGTCAACAGATCTATTCTACGTGAGACTAGGTACCCGTTAAAACTGCGTGAACGTTATCTGGTCACCTGCATGAATGGAGCGTAAGAGATGCGAACGAATCACATTGATATGTATTTGTTCCCTTAGGGCGGCGGGACTGCTGCGGCCCTGCGCCGAGCCCGACGACCGTGCCGGAGATGTACTCCCAGTGGACTGTTACGAAAGCGGCGGGCTGGGCCATCGTGGAGCGGGCGTTATGCGAGTGTCAAACCCGGCAGGCAGACGCGCGCAGATCTAGCTGAGCTGATGGTCAACCATTTGAAAGACGTGCTGCTTCGGCGTACCTATGTACCCAATAAACCTATTCTAGGATGGAACGCCGCAGAACAGGAGCCACTGATAGGGATGCTCGTACTGGCGCATCGTACACCTAAAGTTTTTCGCGTGCCAATTCTGCGCAAGCCTCTTTCTCCAGGGTCTTAGGCGACCTCCCATTAAAGGGGCAAGCCTAAGATCGACTTAAAATTTCTGCTCGCTTTGCGCCAGCAGTCGCATTTGTACCCGAAACAAAAATCCCATTACCTAACAGGCTGAAATCGGTCAATTACATGTGAAAGAGCAGATAGGTCAAACGATGCCTGATTGACGCCGTTTAAAGCGGGTATACGAAGTTTCCGTTTTCGTCCGTCGCTCAGCCACTCCATCGACAAAGATTATAACAGCTCTAATTCGACTTGAACCTTCTACCGTACGTAGTGACCCGCAGGAAGAGGACCAGGAAATGGGGATGGCAGGAAAAGAGAATCGGTGCTAAACCGCAAAACCGACGAATCCACCCACGCTGACCGCTATCCCATCAGCGGGGTTGGGTGCGGCGCTTTCGCACTCAGATCTCCCGCCCCGGGCAGGCTTTGCATGACCCTCTAAACCTGTTGCCCTGCGGCTCTGATAAATGAGGTTTCTTTAACGTCACACGTACGAAACCACTGGTGTTCGACCAAATCGTCCTGGGGCTTAGAGGTGCCGTACCTGCAAGCCGACGGAGTCAAATTGACGACAACGACGCCGCTGCATCATCCTCGGATGCACGCCCAGTCGCCTTACGGGGCCAACTCTTTCAACATATGTACAGAAATCAACGGACGAATGCTGAGGCCAGTAGGAGTTCACCATTGATAAAGCGCCCATTTCTGCTAGCACCGTCGAAAAGTTTCTTCGCGTTAGTCAGCCTCACCCGTGCAGGAAGCGTACCGACAATGCATGGATTTCCCAACCGGATGCAAGATCTGCACGTTCACGTCCGGCTGAACGCCACCATTCCCATCGTTCTCGCTTCCAACGGCATGGCAGCAATGCCGCGAAGAGGCCGGTTGAGCACCCCTTAGAGACCGGTGGATAGGGGCTTTGTTGATTACAGTCTCTTTACGTGGACTAATGTTATAAAATAGGCGGCTTACGCCCGTCCATCCGATTGCCCAACTGTAGCGCAACCTTATCCCATCCTTGATTTAACGATTTCGGTACGCAATAAACCGGCCCTCATCTCAACCTGGTACTAGTTATGCATTAAGAGAGCCCCGGTGGCCAGCGCGGACCTGCGCGGGGCCGTATATGCCACCTTCCTGCCCAAGCTGGCGCTTAGTACAATGCGTTGGAATCAGACTGAACCCTGTTATCTCCCGGTGGTTGAATGACTAGAAAGTGATGCCGTACCCATTCTCTGCCAATGGCCCCTGCTCCGTAAATGCATCGGTATGGAGCGTGATTTCGACAAATGTTTCTTTACTCCGCACGCCTAAACGTGAATCGGCTCTAAGCCTACCCCTTACAGTAGATCGTCGGGCGCTTTGCGTGTAAACAGACGGATGATGGAAGCGCATCAGCAACCCGTGAAAATATGCACTGCAGTTCACGTCGTTGGCAGAACCGCCCTCCATTTTATGTACGCACGAGAATGAAGAAGGCCTGTCGGGATTACGTCAGGGGGAAATCGCTATCCTAGGGGCCATCCCGCCGCAGAACCGTGCGACCCCAGCCGATTACCCCGTCCCATCAGGTGCTGGCGGGTGGCCTGTTGCGACGGGCAAGCCGGCTTTTGACAACCTAGTCAAACCCCAAGACTCGGGTGCACCGCGTCCGATTAGCGTGATGGAGCAGTTTGAAGATGGCTCGACGCGCTTCACGAACACGCAGGCGATGCAGTTTCATACTCTGACTGCGGGCCTATTCTTCTGTTGCTTCCATCACCATTAGAGCGTCGCAGATTAATAGCCTGGCAGTCAAGCATTTAAGGCCGAATCACATTCCAGCTGAATCATATTAAGAACGACCCTGAAGCGCTAAGCCAGGAGGAAAACCACCATACGACGACTTCACAAACAACCGGCTCACTGCCCCCTGCCTCTGAAAACTGCGGGAGTCCCGAGCTCATTATGATCCTCATTCTCTGCTCTGTTGATTGTCTGAAGCCGGATCCCTGTGAGTGCAGCCACAAGCAGTGCAGTTCCAGCCGGCTGCAGCGCCTACTCTA
>109
GGGTGTCCTCCCCTGAAGGTGACTCGTCAGGCCTCAAATCCAGGACGCCTCCGACGCATGGACGCCGCAGCATTCAAAGCAGAAGGCGTCGGGGTGTGTGATACGAAACCGAAGCATTGGCCTGATCAAGTGCGATTCCGGATTAGCTGCCAATGTCGAGGACCCCGGGGGTTTTCGTTGCTAACTACAACTGCCACACACCACAATAGGACTGACAGGCGAATCCAGATGGATGCACAAAAGCCCGCCGCCTAAGAACGTCGCGCAGGGAAACAGGCTCAAGCATCGTGAAGAAAGCAGCAAATCCCTGTTGTATTCGGCGTAAGCGCAAAACCAGTTAACCACCGCCTATTCTCGCTGCAAATTCGCAACTGAAATCACGATATGAAAGCGCACGCACTAAATCGATAGACCTTACAGTGCTGGCTGAATACCACAAACAGATTGAAGCAACCTGCAACGTATTGGAGCGCAAGAATCAGCGCACATGGTACAGCAAGCCTGGCGAACGCAGCAATAACATGCAGTGGACGCAGAAAATCTAATGTTAATAAGGGAAAATCGATTCCTCTTATCTAGTTACTTAGATATTGGCCTTGGCTTTATCTCAATATTATACGCATTACTATCTGGCAACTAATTCAGTTAGAGTAAATATCCTCAATAGGGAATAATATGCCGCTTTCCATTCCATCGGGAAAAGTTTTGTTCAACACACCAAGCACTCAATCGACCTACTAATGTATGGGAATTGTTTTGATGTAACCACATACTTCCTGCCTTCATTAAGGGCTGCGCACAAAACCATAGATTGCTCTTCTGTAAGGTTTTGAATTACTGATCGCATTTATCGCGTTTTTGCATCTTAATGCGTGCGTTTTCTTAGCTTAAATGACGGTCTATCTGGCGCTGGCAATAGCTGATAATCGATGCACATTAATTGCTAGCGAAAATGCAAGCAAGACGAAAACATGCCACCACATGAGGAATACCGATTCTCATTATAACATATTCAGGCCAGTTATCTGGCTTAAAGCAAGTTAATACCAATAAGATCATATACATGGTTCTCTCCAGAGGTTCTCATTACTGAACGCTCGTCCTACAGAATAACGAGTGGATCCATTTCTATACTCATATCAACTGTAGGGGTTGTAATAGTTTATCCGATTTCTGCTCGCTGTAGGGTAACACGAGAACGAGCCTGATGTGGTTAAAAGACAGGCACAATCTTTACTACCGCAATCCACTATTTAAGGTGATATATGGTCAAAGAAAGAATTTGAAGAGTTCGAAGAGCATCCTACAGGATGTGATGGAACATACCAGGACTATCCGTATGACTACGACTATTAACTAAATCAATGGTGTGGACAATTCAAGCGATGCAATGGATGCAAGCTGCAATCGGAATGCATGGTTAAGCTGAAGAAGATGTTTCCTGTAATGGAAGATGGGAAATATGTCGATAAATGGGCAATACGAACGACGGCAATGATTGCCAGAGAACTTGGTAAACAGAACAACAAAGCTGCCTGATAGTGGCCTTTATTTTTGTAGCATAAATAACAGAATAAACACTGCACTGTGTATTCATTCCAACGAGTGAATACACGATGCAATGTCGCACTCGTAACTAAACAGGAGCTAAATGTTCTGATTATTGGAAATCTTCTTTGCCCTCCAGTGTGAGGGCAGTTTTATCTGTGAGGATATGAACAGATGTCAAACATCAAAATACATCATTACGTACGACTGGAAAGCATCAATAGAAATTGGACGAAATCGACCATGACTTAATGACAGAGGAAAAACTTCACCAGATTAATAATTTCTTCAGTAGACTCTGAATACCGACTCAATAAACACGGCTCTGTATTAAATGCGCTGTATTAATCATGCTGGCGCAACATGCTCTCAGTAGCAATTTCAAGCGACTTAAATGCATATGGTGTTGTGTGTGGATTCGACTGGAATGATGTGAATGGAAAACCTTTAGTCAGGAAGGATGGCCTCCAATGGATGTAGCGAAGGAATAAGAATTACCGATATCGATACATCAGGAATTACTTTCTTTGATTCAAGATGATATGACTATCAAGGCCGCCCTGAGTGCGGTTTTACGCATACCAATAACGCCTTCACTCGAGGCGTTTTCGTTATGTATAAATAAGGAGCACACCCATGCAATATGCCATTGCAGGGTGGATCGTCGCTGGCTGCCTTCCGAATCTTCTACTTGAACGAATCACCCGTAAATTACGTGACGGATGGAACGCCTTATCGACAACTACTTAGATCACGGCCAGGAGTCCCAAAGAATGATGGATCAAACACTTATGGCTATCCAGACTAAATTCACTATCGCCACTTTTATTGGCGATGAAAGATGTTTCGTGAAGCCGTCGACGCTTATAAATGGATATTAATACTGAAATATCGAGCAGATTACAACAAAGCATTCACTAACCCCCTTTCCTGTTTCCTAATCAGCCCGGCATTTCGCGGGCGATGATTTCACAGCTATTTCAGGAGATTCAGCCATGAACGGTGCCATTCAGGATCGTCTTGAGGCTCAGAGCTGGGCGCGTCAGCAGCAGCTCGCATTCATGGTGCAAAGAGAAAGAGGCAGAACTGGCAGGACGACTGAAAAGGCCGCCTGCCCCAGGCTACCTGTTGAATGCTATGCATCGATCATTTGCAACGCCACGCGCCGGAGCAAAAGAACCATTACCCGTGCGTTTGATGACGGGCCGGATGTTGAGTTTCAGGAGGAGCGCCGCATGGCGAACGGAACATCCATCCTGGTCGAAACCATTGCTCACCACCAGGTTGATATTATTGATTCAGAGGTATCAAACGAATGGCTGACTGCATACCGCAACGCCCTGGCTGGGAAGCTGGCTGAACGTGCATGGATTCTGTCGACCCACGAAGGAACTGATCATCACCACTCTTCGCCAGACGCATTTAAAGGTGATGCCAGCGATGCGCATTTCATCTTCGCATTACTGATCGTTGCCAACCAGTACGGCCTTAATCCCTAAGGTCAACGAAAGAAATTACTACGCCTTTCCTGATACCGGAAGAATGGCATCGTTCCGGTGGCGTTGATGGCTGGTCCCGCATCAGGTTAATGAAAACCAGCAGTTTGATGGACGCATGGACTTTGAGCAAGGACAATGAATCCTGTACATGCCGGATTTGGTCACCGCAAGGACCGTAATCATCCAGATCTGCGTTACCGAATGGATGGGATGAATGCCGCCGCGAACCCATTCAAACTCGCGCCGAAGGCAGAGAAATCACGCTGTGCAGTCGCATCCCAAACGCTCCATTGTTGTTACGTCATAAAGCCATGATTCAGTGTGCCCGTCTGGCCTTCGATTTGCTGGTATATCTATGACAAGGATGAAGCCGAGCGCCGCATTGTCGAAAATACTGCATACACTGCATGAACGTCAGCCTGAACGCGACATCACTCCGGTTAACGATGATGAAACCATGCAGGAGATTAACACTCTGCTGATCTGCCTCCGGATAAAACATGGGATGACGACTTATTGCCGCCGCTCTGTTCCCCAGATATTTCGCCGCCCGACATTCGAATGTGACGTTGCACATGACAGGCACGAGCAGTAAAAGCGCCTGATCGCTTCCTGAAACAGAAAGCCGCAGAGCAGAAGGTGGCAGCAGCATGACACCGGACATTATCCTGCAGCGTACCGGGATCGATGTGGAGCCCTGTCGAACAGGGATGATGCGTCGAACAAATTACGGCTCGGCGTCACTCCACGCCCGCTTCGAAGTCCACAACGTGGCACCCGAAAACCCCGACTCAGAAAGAAGTGGCCTGACATGGAACAACTTTAACCTTCCACACCGCTGCCGTTGCTGAGGTTTTGCACCGGTGTGGCTCTGAAGTTAACGCTAAAGCAACTCGTCCGGGGAAAACAGTACGCAGAACGACGCCAAAGCCTGTTTGACGATTCACTTCTAGCGTGAATGTTACTGAATCCCCAATCATCTATCGCCGCGACGCAAACTACTGCGTACCGCCTGCTCTCCCGATGGTTGGCTTATGCATGACGCAACGGCCTGAATCGAACTGAAATGCCCGTTTACCTCCCGCCTGGATTTCATGAAGTTCTATCAGGCTCGGTGGTTTCGGGTGGGTCAGAGACAAAGTCAGCTGGATGATAGCCCCTGACCCAGGTGCAGTACAGCGGGCATGTGACTCGACGCGAAAAAGATCGCCTGGTGATTTGCCAACTAACCTGACGTGCGTATGAAATCCAAATGCGTGAAGGCCTGCACGCATTATGTCGTTATTGAGCGCTACCCTGAACGAAAAAGTACATGGGGGTTTTGACGACGAGATTGATCGTGCCGGAGTTCATCGAAAAATGGAAGGGATCGAGCATGAAATTGGTTTTTGTATTTGGGGGAGCATCGATGACGCATCCTCACCACGCACCTCGGCCTAAGTAGGCCGCAATCACCTTTCACGTCTACTCCTAGTCGTATACAAAGCGAGGCTGGGTATTTCCCGGCCTTTCTGTTATCCGAAATCCACTGAAGCACTAAGCACTGGCTCGGAGGGTAGATAATCAATAAACGCTGTTATCTCATGCAACAAAGCATCTTCTGTTGAGTTAAGAACGAGTATCGGCCAGATGGCACACTCATGCTCAAATTGGAATCAGGTTTGTGCCCAATATGAAAGAGAACCGCAACGACCCTCCAGGATTTTAGCCGTTATAGCCGCATCCGTTCACAAAGGCTGGAAAACCGATGGTGCGAAAGGCAGAAGCAGATGAGAAACCAGGATATGACAACCACGGAATGCATTTTCTGGCAGCGGGCTTCATATTCTGTGTGCTTATGCTTGCCGACATGGGACTTGTTTAATGACACCTCATGCAGGAAAGCCCTCGATTCACAGCATTGCCGTCAGGCTAATTCTGAAATCAAAAGCCAGACATAGCAAGTTTCCGGATAAAACGTCGATGACATTTGCCGTAGCGGGTCGATACTGAAGAAGCACCGCGAAACGGTAACGCCCTGATGGGATTCACACACGACTCGATTTAAGCCACTAATGCAATCGGCAGCCTGTTAAACGATGTCTTTAAGGAACGATGAACATGAAAAGCAAAATCATCAGGGAGCAGCTCCTTTTATTATTCGCATTCACCTCAAGCGGCGTATTAACCAACAGTTCAGGGATTAATGAAAGATGGCAGACATCATTGATTCAGCATCAGAAATAGTACGGAATTACGGACGCAACACAGCACTAAATGCGCCGCCTGAAACCACCAGGCTATCTGCCAGCTCCATTGTTGAGTGTGGAGTTACATCCGATAGATGAACGAAGACGCCTGGTCGTTCAGGGTCTTGTTAATGTGCAAGTGCCAGGAGGGATCTGAGAACTTATCAGTAAACATAGAGAGGATTTGCTGAAGTGAGCGAAATTAACTCAGGCAACTGCGTGAAGGCAAGCAGAGCAGGCAATGATGCAATCAATGACGACCTGGGGATTTGACGCAGACCTTTCCACTGAATTGGTAACACCATCGATTGTGCTCTGGAACTGCTGGATGAACGGGAAAGAAACCAGCAATACGATACATTAAAGCCGCGACCAGGAGAACGCTGAGGATATTGCGCCTATAACAGTAGGAAGAAACTGCGTGTTGAGCTTGAAACAGCAAAAATCAAACTCAACGAGCAGCGTGAGTGAGTACGAAGCTGTTATCTCGGATGGGAGTAAGCGTATTGCTAAACTGGAAAGCAACGAAGTCCGTGAAGACGGAAACCAGTTTCTTGTTGTTCGCCATCCTGGGAAGACTCCTGTTATCAAGCACGGCACTGCACTGGTGATTATGGAAGAGGTTTCTGCCAAGCAGTTAATCGAACACAGACCTAGCGTTAGTAACTATCGACATCATTACGCATCGCTATTACGGGGTTGGGAGGTCAATGGGTTCAGGATGCAGAACCAACGGCTATCTGCATATGATGTCCTGAACTGGCATTCGCATCAAAGGAGAGTGAGATCGGTTTGTAAAAGATAACGCTTGTGAAATGCTGAGACTTCGCGTCGTCTTTCACAGCGATGCCAGAGTCTGGTAGTGTCAGATGGACCGGTCTCAAACATCGGGTTGAGTATTATCTTACTGTTTCTTTATTCCATAAACATTGCTGATACCGTTTTACTGAATGAAACGACATACATTGCAAGGAGTTTATAAATGAGTATCAATGAGTCCCGCCTATAAGAGTCTGAGCAAAGATTGGGCGCGTTATCAATGTTGCAGATCCTTGTCTTGTCTCCATGCAGACATCACGAAGGTGTTTATGTGATGAAGGTATAGATATAGAGTCGGCATACAAATATTCCATGAAGGTTTATAAGTCTAATGAAGAAGACAAATCCCCATTTGCAATGTGCGAAATGACTGATACCGTTGGATGCAAAGAGCGCTCTTATCACGGGTACGGTGCGGAACGATACTTGCCCTCTCTGTACAAAACATATCATCTGATTAAACCCAATATTACATAACAATCCCCACTCGCGGGGGATTTATTTTATCTGAACTCGCTACGGCGGGTTTTGTTTATGGAGATGATAAATGCATTCCGAGTTACAGGGAATGGAAACCTGGAGAGCCCATTTCATATGAATCCGAGCGGAAGAACATCAACGACTGCTACAGCACTAACGCATGGCTCTGAGCACAGATAGCACACATGCAGACGTAATACTCTTCGAATTGAAGAACTGAAAGAACATAAGCCGCCTGATGGCGGTTATTGCGTGTAATTGCGGAGACTTTGCGATGTACTTAACATTTCAGGAGTGGAACGCACGCCATGAGGACCCAAGAAGCCTTGAAACAGTTCTTCGTCGATGATTTGGGAATGCAAGCAGTTGCCACCCCGGTTAAGGATGGAAGAGAGTATTGGTCCCACGAATCAGGGCGGTAAAGGTTGATCGTAAATCAACAATAACAGGTGTAGCTTTTGACCAGCATCCAGAAATGGGAAGAAGACTGAAGTCATGCAGGGATTTACCCCTAACCTTTATAAGAAACAATGGATATTACTGCTACAGGGACCCAAGGACGGGTAAAGCAGAGTTTGGATCAGGCGCATAAAACAGCGAATCGCAATCACTGAATAGTACAGGCCAAACATTGAGTTATTTTCACAGGACACAACACAAGCCTCTGACAGCGAGAATCAACAGTGATAATTCCGTTACGTTACATTCATGGCTTGATCGCTACACTACGAAAAATGCGGCCAGCAGAGGAATCAAATCAAGCAGAAGACACTCATAAATTACATGAGCAAAATTAAAGCAATACGGAGGGGTCTGCCCTGATGCTCCACTTGAAGACATCACACAAAAGAAATTGCGGCAATGCTCAATGGATACAGCACGACGAGGCAAGGCAGCCGTCAGCCAAGTTAATCGATCAACACTGAGCCATGCATTCCAGAGGCAATAGCTGAAGGCCATATAACAACAAACCGGTTAGTGCCCTCACTCGCGCAGCAAAGTCCAGAGGTAAGGAGATCAAGACTTACGGCTGACGAATACCTGAAAAGATTATCAAGCAGCAGAATCATCACCATGTTGGCTCAGACTTGCAATGGAACTGGCTGTTATGAGGTCGGCAACGCAGTTGGTGATGTCGGTGATGCGAAATGTGGAATGGTCTGATATCGTAGATGGATATCTTTATGTCAGGCCAGCAAAGCAAAACAGGCGTAAATTGCCATCCAACAGGCATTGCATATTGATGCTCGGAATATCAATGAAGGAAACACTTGATAAATGCAAAGAGATTCTGTGGCCAGAGAAACCATAATTGCGATCCATCTACTCGTCGCCGAAATGCCGCTTTCATCCGGCACAGTATCAAGCTATTTATGCCTAGCACGAAAGCATCAGGTCTTTCCTGCTTCGAAGGGGATCGCTACTTTCGCCGCACTGTTGCGCAGGTTGTCTGCAAGACTCTATGAGAAGCAGATAAGCGGCGATAAGTTCTGACATTTTGCCTTGGGACCATTGGACTGATGGCATCACAGTATCGTGATGACATAGAGGCAGGGAGTACGCTTAAAATTGAAATCAAATAATGATTTATTTTGACATGATAGTACTGTTCGTGCCGTTGCAACAATTGATAAGCAATGCTTTATAATGCCAACTTAGTATAAAAGCTGAACGAGAAACGTAAAGTGGTATAAATACTAATATATTAAACTCATTTTGCATAAAACAGACTACATAATACTGTAAACACAACATATGCAGTCACTATGAATAATCAACTACTTAGATGGTATTAGTGACCTGTAACAGAGCATTAGCGCAAGGTGATTTTGTCTTCTTCCTAGCATTTTGTCATCAAAACCTGTCGCACTCCAGAAGGCAGCACAAAGCCTGGACGCAATCCAGGTCCAACGTTTGTGTGCCACCCACTACGACCTGCATAACCAGTAAGAAAGATAGCAGTGATGTCAAACGACGCAGCTGACTTCTTTCCTTTCACGACTTCCCCACACCCAGCATGCAGCCTTTCCCACTGTAGTGAATGTCTGTTGAGCGGAGGGGAGCGGAAGTTAACACTTATGAAAATGGCTACGAAGTCCGTGGCTATCTATCGATCTATTGTAGTACTTATTGAAACGAACTCGTCTTCCGCAGCCTGAAGAGCTAATCGTTCGGCGATACTATATGCATTAATAGACTATATCGTTTATCGTATAAACAGTGCACAGTGCAACATGAATAACGATCTATTACTTAGAAAGGAAGCAGAAAGCTAAATATGGAAATTATCACAATACCAGAGTGCCCGTTGGTTAAGTTCAATACTACTAATTTTAGATGGAAAGAAAACGTATGTAATAGAGAGTAACTTAAAAGAGATATCCTGTGTTGTGCCGCCAAATAAATTGCGGTTATTTAATAAAATTAAGGGTTACTATGTTGGGGTTTAGTGTTATTGAAAGAGGCGGGTATATTCCTGCAGTAGAAAATAAGGCAGGGATTCCTACGAGCAGATGGTTGGAATGACTATTCCTTTATAATATGTGTTTTATCTTACGTGTGTTTGATGAGCAATGGGGTAAAATGCGATATCGGAAATGTTAAATTGGTTTGTAGGTCAAAAGAAGTAAGCACTTATTGCTCATTAATAGATAAATTCAGTCAACTCCCTGAAATGTTTTTCCTTAGGTGAAAGCATAGTGGACCTACTATGTTGTTAATCTCAGCAAATTAAGCGATGGTTTAAACATAACCTTCTTAAAGCTATTCAGGATTTAGTAGTATGGCCAAATCGATTAGCCGACATTGAAATGAAAGCGTCCTTAGCCACATGCCAGCGGAGGGGTAACTCTTTCAGAATTCATGGACACGTGTTCGCACGTGTGTTAAATGGTTTGCCAGAATTGTCAGATACGATTTTCCACTTTTCATTTAATAGAAAAGTGCTCCCGGATTCAGTGATTTAACTTATAGCCCTTTGAGGTGACGGTTAATCGTCGCTCCAGCACGAACACTCTTCATGCTTTATCGGGCGGAATGGGTGGTAACGCAACAATTTTGAATGGAATGATTGGTGCATTACAACCCAGAAAACAATGATATTTTCTCTGAAAATACAGTAAGCTCTTATCTGAGTCAAGAATCCCAAAGGGGATATTTTCGATCGCCCTTGTTTCAGTTTCGTTTAGTGCATTGATCCTTTTACTCCTCCCTAACAGAACAACCTATTGACCCAGCAAAAGCCACAATATTTTATATTGGACTCCCGCAATGCTGCCAGCAATAGTTTTAAATCACGGCGATCTCTAGTCTCGAATTCATTTCAGCATTTATTGGTTGTATGGATAGATAGAAAAGACACACTCTGGCTTGAAGGCTATCAAAATAGCGGATAGTGATGAAAACTTTTCAAATATGGAACTCATCAGCCTCATTTCCCTAAATATGAGGAATTAAGATAACGTAATGAACCACAGTACCGTTTCAAGTGGACGATGATAAATTCACTAAATTGTTTTATGACAATATCCAGAAAATATCTGCTTCGAATGAGCTCTGGACTGCAATTGTTTATTTACTATCACAAGATTAGGTGATGTCGTTGTGAAAGTCATTAGTTTTATTCGATGAACCAGAGGTTCATCTGCATCCACCTTCTCTGCTCCTTTTACGAACATTACGGCGACTTACTCGATGCACGCAATGGTGTAGCAATAATATAATGCAACTCATTCCCCAGTAGTACTGACTGCAAGAGGGTTCTCAAAATCCTGCATGTGGGAAAGTCCTACGTCAAGAAGCAATAAATATTATCCGTCCGGATATTGAGACATTCATGCGGTGAGGAAGTCGGGCCTTAACTCGTGAGGTGTTTTACTTGAAGTGACAAATTCTCATCACCACTTATTATCGCAGTCCCGTTGATTCAGAGCTTTCTTATGAAACCATTCTAAAATTATAATGGTTTCCCTGAAGATCGAAGGTCGAAATCCGTTTAAAGCGATGATAATGAACAGCCATGAAGGTAAAGTACATCGAAAAACTACTTCCTCCAGAGCGAACTGCTCACGAAATGCCGTAATAAATGCTCGCCGCGAAGGAAGGTATGATGCAGATAAATGTTAGAAATAATTTCCATTACTCACCTTCCCCCTTTTGTCGCAGAAAGAACAACAATAGAATATTAATAAGCGCCTTGACAGTTATTTACCCTACGAACTAACATATCGTAGCCTCCTACAACCTTAGTAGTTGGGTACACCTGACAAAGGTTAAAATATTAGAAGGACGGTTTATGAAAATAATCTCCAGATAAAACAAACCGCTAGAACATATTACGGACCTGCTGCTTGTTTCCATCAGGTGAAAATGTCCACTTTTGTGGTGATGAACAGACAAAAGTAGATCGTTTCTTCCATTGCACATTATCCTGAATTTTCGGTACCTCTGCCTATTGTAATTCAGTTCCATCGTGCTTCGCCCGACTGCGATATGGGAGAAAAGTCATAAGTTTTCGCAGTAGATGAGGTAAGCAGGCGATTTCATCCCTATATCACGCGACCCTTTTCGTACGCAATGGGGTATTGCAAAGAAATTTCGTTTCCTTAGAACTCCGGGTAGTGAGCGTTATGTTGGAATTCCCACGGCAAACTGGGAGGCAGGGAAGACAAACACAGCTCTTCACTCCATATTTCAAGCTATTAAATATTGCTAACAGGTATCGTTGGAGGCAGGGAAGCACTTGAGTGAAGTGATTACTCAAAGGAAACTCTGCTTTCGTAAAGTTATAAGGAATAGCTAATTCAACCGCAACGTTTCATAGCAGCTACAGTTACGAATTTATTGAAGCAAATCTGAAAACCTATTATTATAGATTTGAATGTGACTTCCCCAATTATTGGTCGAAAGAGTTATGTATAGTGCCGGCGCAACTCGAAGATTTTCAGGGGCATTAGAGTAGTGAAAGATAGAAAATTAAAGCCGCTTACGGAAGTGAACGAGCATCGTTACTGAGGGAGGCTGTTTTACAAAATCCGGTAACTTGCTAACCAATTCCTAGCAGGTCATTGGCAACAGTGGCATGCACCGAGAAGGACGTTTGTAATGTCCCGCTCCGGCACAAGGAGCCCATTTAGGGACAGTGGCGTACAGTCAGTATTGGTCGGTGGGAGGTACAAATTCACGTATGCAAATAGTGACGCCTGAATCGAACCGATGGAACCATTGGGTTAGTAGCGTGTC
>110
CGCTTTAATCCTTTTAGTTATCGGTGAATGCAAGAATAACGACCAACCCTTACTGGAATGATCGTCTCGTGAAAGAACACCAACGGGGTCACTACCGCAGGAAAGGAGGACCGTGAGAATGGGACGAATATCACATAATCTGCGACTGCAAATCTCGTACGAATGGATCAGAATAAACCAATCAATCCCAAAGAATTGACGTAAAATGATTACACGGCTCAGCGTGGATATCTGGGAAGGAGGAAGGTGATTGTAACAATCGAAGTTACGAACAAGAAAGCGTCGGCCGGCTTTACTGTTAAACTGCGGTCGAAGCTGCATTAGTGGAAGTTCACGTGATGCGGCTTCCTCGAATCCGCATCAACGAGGAAGAAGGATGGTGAAGGTATGAAGAACGCCGTAAAGCAACGATGAATTGAGCGAATGGTTTCTGACCGTGCGATTATAAATCAGTCGTGCTCCAGTGTCGAATCAAGATAGCACTCGAAACGACGAATAGGAAGGAAGAAACGAGACAGACCAAACAGAATAAAACTTAAGATCCAACTCGGTGGACCGCAGTTACCGTGATAGACACTCCATCAGTAAAATCTGATATAAAGTGAACGGGACTTACCATGTAGTTTCCTGAACGCTCTCACGTCGTGCTCATTGGATCATGACTATTGGACAAATGCTTGGATCAACTCCGATTTAATGAACGCAATATTCACAGCGTGGATTGTGCGTGACCAACAAATGAATCTCGTTCGTGACTGGGAGGAACGATTAGCAATCAATGGCACTGACAGACCAGAACCGAATTAAAGGAATCGGAGAGTTCCCCTCGCAACTCAAAATGAAAATAGCAGAAGTGAGGCCGCATGACGTTCTCAGTAAAACGATTCCAACTGCTCGTTGAAACATACGAATCAGACAGAAATAGCACGCAGACTGAAATGGGTCGCGGTACGTCAGAAGATACGTTGATGATAAAGACGGGAAAATGCACGCCATCGTCAACGTCACGCCATGGTTCACCGTACAGTGAAGGATGGCTATTACGAAATTACTGACCATAAATACCGAATATTTGGGTCGTACTGCACCTTACACGAACTGATGAACACTGGATACGATTGGATCGACAACAAAGACCTTATCTCGTCGGCGATTTACGTGGTGCCAAACGTTGAATGCATGGAATCCGCTCAGGAAGGAAGCTTAATGATTGATGGCTTATCAGGTGGAAACGTTAATCAACCTGCTTAATGGCTGACTTCTAATCTCGATTACGACAAAGAATTCTGGCTAAAGCTCTTGCCATCATAATCCTTCCTCAAATATGTAGCCACTCACTGTTATCCACGAATTACAGTTGTAGAATCACAGTTGGGACCGTTATCTAAGGTAATTGGAACCGCGAACGAATCAGCAACCACAAAACGGGATGTGCGACAGAATCAAAGGCACGTTCTTTGGTCATACGCCAGCAGTGAAACCACTCAAGTTGCCAACCAAATGTATCGATACCCGATTTATCGAAACCGACATTGATTCAGGTACAGGAGAAGGCAGCATGAGACTCGAAGCGTAGCTAATTCATTCGCCAATAGGAAGCTCTTTTAATCTATCATGATCATGAACCCACGATGAGCACTCTTCGAGGGATTGGTCATGATGAGTGCGGTATAAGGGCAATAAGCCGGACTCGAGGCTCACTCTGGCGATTGCACGACTCAGGAACTACACGATTATTGGCATGCAAGGATAGGAAATCTAGGCAAGGTGAAATTAAACAGGCTTCCTTCCTTCCATTGGTCCGGGTGCCGCTAGCCGGGGCAAGATGCAGATTGCCATGGTACAGCGTCCGGTTATTGCCAAACAGAGCTGTGCGGAGTCGTAGAAGAGTGGAAGATGCAGGCGTCAGCATGACACTCGAGCGCAGCATATCGCCTTACGATGCTAATCCCAAACCTTACCCAACCCCTGATCACGCATGTTTACTGGTTGTATGACTGTGTGTCTTCAATGCTCTACAACAGGAAGAGAGACTAGACAACAGGAAGCGAGGACAACGTTGGCAGCATGATGCCACGATGGCAACATATTAACGGCATGATATTATGACTTATTGAATAAGTTAAATTTATAAACAGTGGATTCACTATTTGGGTCAGACCGCACCGAGCGGTAGCCGAATTCCTTTGTAGTCTTGATTCACACCACTCCTTTGGAGCCTCCATCGCGGACGATCTGCCTTCCTTCCGGTTCCCAACAGTTCACCAATAGTCCATCCGGACCGTTCGGGATTTTTATATCTGCACAACAGTAAGCATTGAGTCGATAATCGTGAATTATGAGCCTGGTCGCCTTCTTCGGTCCTGAATCCACCGAATACCGAAGCAGAACCCTATTACCAAATGCGTAAGGCGTCACCGAGCCTAAAGCAAGCCCAAAGCTCACGTAGCCACTGTCTGTTCTAAGAGGAAGCCCCCAGGAAGATGCGACCTGGCTGAAATCCTGGGCCTAAGCTGGCCTACTCCCTGCCGTTGCCCGTTAATATCGTCACGAACAAAGTCTGATTATAAACACAGCCTGAGATTTGTTCCATTAATCTACTTATTCTAATTAAACTAAATCCCTGTAGGGTAGACATGAAGATGCCATAAACATGACCTGTTGCCGCCATTCGCGGCAAAGGAACAAGGCATCTAGGCAATCGTCAGTTCAATGGATCTTCCTTGCGATGAAACTATCGCTGTGCTTTACGCTCATCGCGGCGATGTGCGCGCCGGCTTAACTAAGTTAATCTCTTTATACCTATTCGCTACCGACCTAACCCTTACCCGGCTGTTGACGGACAAATCTCGTCCGTAAATGATCCTGTAGACAGCCGTAGAACCAATAATCAACTACTCCTACTTGAGCGTTTACGACTGACCAGGAAGGAAGCTTAACTTTATACTTCCTGCACTAGGTTTACTATCCGATCTAGCAAACTTGTCACGCTAAACCAAAACTCAAATCAAAGCCGACGCTACCATTCTTTCCCGTTGGTGGATGCCTCGCAAGCAGCTTGGCCTGAAAGACTTCTCTCCGAAAGTCATGACTGTCGATGCAGCAGATTAAGGAGTGGCGCTTACTATGATTGATCGTGGTATCCGTCAGGCAATGACCGTTGCAGCAATATCGGTTCACTGCTTCCGGTGCTTTTAAGGCACTCAATACGACTATTCAGATTCAGGGAGCGGCAGAGTTGGATTGATGGCCTCCGAGTTATCTCATCATCTGGTTGGCATCATCGTGATTGGGTTTACAAATCGCAGGAATCTTTAGACAAATCAGAACTGAAGCTGGCGAACGGCAATTACTGACATGCAATGCCGTCACGTGATGTTGAGCCGCTGCAATACGAAGGTTAGCTGATCTTAAAGCTGAAGGTGATGCTCTTAGTGATGATGTTGCCGCTGGTCGTCGTTGCACATCAAAGCATTGTCAGTCAGTGCGTGAAGCCACCACCGCCTCCGTCAATAATGCAGCCTCCCCGACCCGAGACAAGCTGACGGGGATTATTTCACCTCATAGAAGGTACTATGCAAAAACTGGAAGGAATGAGGATATTAATGAGCAGTGCATAGTCATATCGATGAAGGCTTCCTTCCTCATCGCACACGCTTCCAGCCAGTATAAATGCTAAAGTAATAAACCGAGCAAATCCATTTACGAATGTTGCTGGGTTCTGTTTAACAACATTTCTGCCGCCACAAATTGTCCCTGCATGAACAGTCCTCAGATCCAGAAGGAAGAAGGGAAGGGAGCTCCTTACGCCGGTTTGATGAACAGTACTATCGTTGAGCACATCCTGTAATAAGCAGGGCCTAGCGCAGGTCGAGTAGGCACTTTTCATGTTATTCCCGATGCTTTGAAGTTCGCAGAATCGTATGTAGAAAATTAAACAAACCTAAACAATGAAGTGCATATTTTCTGTTAATATTTATTAATATGTTAGCTATCCGATGAATCGTCATTGTATTCCCGTGATTATACTGTCCCACAGCCCTGACGGGGAACTTCTATCGGGGAGTGTCCCGGGGAATAATTGAACGATGCACAATTTAGAGTGGGCCCGTATTGCATTATGCCAACGCCTTATGACTAAAGAATGAAGCTTCCTTCCTTGCAGAAGGTGTAATGTTAACTAATATTAAGGCTCATGATATGAATTAAAAACGCTTTAATACGTCTTCCTGTATTCTCATGAAGCTCCTGCTTTACTCAAGGACTTCGGTATAATGCGTTGCGAGAAGGAACATTAATTTTGAGGATCCTTTACTAACCTTTTAGTCGTCTCTCCCGTACGTTTAGACAGTTATCTTAGATAACATACTTAGACGTTTGACGTTTAGTTCAGAATAAACAATTCACAGTTAAAATCTTTTCGCATTGATCGAATATTTCTTTAAAATGGCAACCTGAGCCATGTAAAACCTTCCATGTGATACCTAGAGCGTAGTTTGCATTACCGTTTTATCGTTCAATCTGGTCTGACCTCCTTGTTTTGTCTGATTTATGTCAAAGATAGTGAATGTTTGGCCTTAATAGTATTGATGCGTAACAAAGTGCGGTCCTTAATGAACTGGTTCCCATTCCTCCGCAGAAATACTATGACCACCACAGTGTAAACGCTTATTAACCGACAATTGATGATTTAACAAAATGAATAAAGAACAACCCGCTGATCCGCATGATCGGAAGTCTAACTATGCTCACCATTTCTATGAGTCCCTGATGTTGTAATTGCATGTATAGAACATAAGGTGTCTCTGAAGATCCAGCAATTGAGGCAGCGTTGGCACCGATAATAATATGAAGGATTATTCATGACCGTGATCACCATAACTGCTAATCATTCAAAGGCTACTTTAGTCTGTGACATACAGCCACGCAGTTATTTACTGTCAAGGAAATGTAAAACTGCATCAATTACTGCAATCCTATAATTAAGTGAATTTACAATACGTCCTGTTTAAAGAACGCGGGATGTTCATTCTTCATACTTTTAATTATGTATGCTCTTTTCTGACGTTAGTCTCCGACGGCAGGCTTCAATGACCTGAGACAAATTCCGACCTTTGCTCAAAGCATTCCTTCCAAATGTACGTTGGTGGAGATGTTAGTTGCGGGTTCTGTTCTTCGTTGACATGAGGTTGGGAAGCCGAGGAATAGTTAGTTATTGAAGAGTACTATTAATACCAACTGATACGTCACCGCTGTATTATTGACGTGGTTTGATGGCCTCCACGCACGTTGTGATACCTATCGATACTTTACGACCTGCTTTCCAAGTAAAGTACAGGCGGTACACCACGGTTC
>111
ACGTCTGCTTGGGTTGTTTAACCTGTAGTTTTTGCTCGTCGATTACGCTGCCCAGGCATAAGAGGCCACGCCCATTAGTGAAACGCTTCATGGGCTTACCGTGTTATCCCGGTGCTTTTGCCATACACGGGGCCAGCGCCAGCAGCGACGGAATATCACGAATAGTCGGCTCAACGTGGGTTTTCGCTACCGTCTGAAAACCATCTCGTCTGAGACCGATAAGGGGTATTTCCGTCCTGCTGCGTATAACTAACCGCCCAGCTAGCCCCAGGAAGCATTTTGGAAAATCAACGACCGACTAGAAACGAAACTTTAGCGTCGACGCCCTTAGTTACCTGCCGCTCCGGCGGCTCTTCCTGGGGTCTAGTAGCGACGGAACATGTTTCCAGCACGTCAACAACGTAATGAGGGTTTCTTTCGGGAGGACACTCGGGTGGGGCGATGTATACACCATTCAGCGACGTCTTGGCATGAACAGGCTGACGGGCAGGTACCCTCGAGGCTCTAGCGGCAAGGGTAAAGTGCGCGGTGCTGTTAACTCGCTCCTCGTCCATAACGGGTTGCTCACGAAATGAGATGCTGAAACCGAGAACGAAATGGGATTCTATCATGACCGACGCGGCTGCTTTGTTCATGGCTTTGACTCAATCGCGTTCAGGAGTTAAACATGTCGGTTTTCCCGTCCACGCAAACGCCATTGAATGGCACGAGGGGGAGCCCGTTAACGGCACATCACGAACTGAAGTTTCAAATGCCGG
>112
TTTTATGTCGTATTCGTGGCGTCTGCTTGGGTATTTAACCGATTAGAAGAGGCACGTTTAGTTGTAGGGCCACAGCAGTCCTAAATACCGTACAGTCATAGATGGTCGGTAGCGAGTATACAATTCTCGCTGCAAAAGTAAATCGGGTAGCAATGGGAATCATTCAATAGCTACACGATGGAAGTTGCCAGCCAGCCGCACCGTTCCACGACGTGTCTTAGGCCGCGACTCCGGGGTGTTAGCAACTATAAGAGCCAACTAATTTAATACATAATGAAACTATAATAAGTATTAAATTTCCTTGTAACTAAGTCCTATGGTTCTGGTAAGAATCATTGCAGATCAAAACAACTTGTATTACATTGACAGTTAAGCAGTCACTTTACCTCTAAATATACTACCGGGACGCATGCAATAGTAAATGGAGATTTATCACGTAAATAGAAGAAGACTTAAAGTTTATCGCACTGTAAATGCTGCGCTTACATATTTATCCTAGAATTATTTCGCTTGAATTTGGATCATTCCCAATCCGCACGAACAGTGACATTTATTATTCAAAACAAAACGAGATTATAGAGGTGACATTTGGTATATAATAATGTGGTCCAAAATGGAAAATGATCCATTAATGGCTTGGTAAAATTCTCGCAATACGATAGAAAACAATAGAGCATTTAGAAAGCCCGGCTAGAGGCTAAACTATCTTCATGTACATTGAAGAAAGTAACATTGAGTTGGTCAAGTGAAATATGTTAACATTGGTAAAATTAGTCAGACTTGCACAGAATTACCTTCATATTTAACGAATCATGGCTTATTAAATCAGAAGAACGATGGGTCTAGGTACAAGTCAGAATTATCCGGTAAACCTATTACTCCGATGTGAACGTATAGTACCGGCCTAGGTAAGCCGTGAATGGACTCGCTTATTTTCTACAAAATAAACAATTCGACTTTATTTGAAGCAGGAGAATAACTTATTCCACGTACGACTCTCAGACATAAGCGAGTGAATAAATTTCTATAAGTAAACGATAGCATGACAATAAGAAGCATTCCTGAAGATATTAAAGGAGCGTTAAAACGACTAGAGTAAAGATATCATTCGACAGAATTAGTTATACACGCCATAGTCCGAAACGACTTTACGACGTTACATTCAAACATTAATTTATGATAACAATTCCATCCACCGTACTTTAATCAATACAACATTTGAGCAAAGTCAAGCAGATAAAGCTTTGGCGTGGCACTGACATACAAAAGACAAATGCCTATGGCTTCATTTGGATATCAGAGCTATGGCCCAGAAACGAAGCACCAACTACTCCAATAACCAATACAGCAATCGATAAGCGGCTATTCGACATTGGAGTCACTTCAAGCTACTTAAAAGATCGTCAAGGAAGGGTGCCCGAATAGAGAACCGCAACAAACCAACTTTATAGAAATAACAGCAAGACTCAAACATGACGAAAAGGCTATTTCGGTAGTTCAGTGGACTAAGGCGTGAGTGATGTAAACATAGGACATTGAGTCATACACAACTTCCATTATTCCTGAAGATAAGCCCCAAATACAACCAATACTCATTTACAATATAATAAAGCCCGAACGTTATTTCATACAACGTTTTGGCATGACAAAACGATTAACCGACGCGACAGGGACAGCCGATATCAATACGATTGATGAGCACGGTTCAGCAACAGATGATATTCTTCCAGGGCTTCCAGCAACGAGGTTTCTTCCTTCTATTCGATTCCAGATCTGCAGCATGACGCGGCACGCGGCTTAATATGGCTCACCTGCAAGCCATGTTTTTGTTGCCCTCCCGGATCGAACAGTTTTCTGCACTTCTATTCCTTCACCAGGCTTGCTTTCCACTTCTGATATTCCCTCCAGGCGATAACCAGGTAAATTTTCCGGTAACGGACCAGTGGTTCAGAACAAATAACGCGTGCGCCGGAATTCCCAGCCACGTCATAGTTACGCGGTGGTTGTTCAACGAGATGCCACGATGCCTCATCACTGTTGAACAGGCCAAAGCCAGCCGGAAGTACAGTGCGGATAGCGGTACTGTTGCAGGCAACTCGGTATGAGGGCGAATATAATGCGTCACCTTCAGATAAATTCATTAGTTCCTAGCAGATTCGTACTATTTGGTGGTCGGCGTATGTTCACTCATTCTAATCAGTATGCAAGCCCCAATATAGTTAAATGCATGTTTTGACGGTTTTCCGGTAGCAGCGTTACGGTATGTCCTTTACCGTAAGATGAAAGAAACTAAGATGAGAGCAAGTAACGGCCGCGCTGCTGTACAAGGATACCACGATGTAGGCTGTGCACGCACCTACAGCACGCTGTACCAGCTAATGAGTAACTTGACTGCCCTTGAACTGTCGGTCATAAATAAGAGCCGTGTGCTCTTCCTTTAACTTGGACATAACTTCCGTAATGGTGCTGTTCCATACTGACTCCAGCCCCAGAAATGTTTCATGGGACCATTGGCGGCTGAGCACCCGCGGCCCTGTTGAACCGCTCAGACTGTAGAGCATGAGCCCGATTCTGTCGTGGTCATTCTGTACGCCGTAATCGAAACTGCCTGTTGTTTTCTTTACAACCGTAAACGACCCTATTAGTTTTCGTTAGCCAAATCGATTGGCCATGCACTGGCACTGTGGGGTGTGCGACTTAATCCATCTCGTATTTCCTCCGCCAACACAGATAAAAAGATAAACCGTGTTCTAGTCATTCCCTACTAGGAGACTCCGGAAGAGTACGAAGAGCAACAGGGTTTTACGGACATAATAGGGCTGATTTGTCAACCTGCCTCGCGCCTGCATCAGGACCGAGCCATGACTGAACCAGCGGGATGAGACGTGATTAGCAGCCGAGACGAATTACCACCTCGAACAACTAAGGTTCAAGAAACCTGCAAGGCGGTTCAGAAGTTCCCTGCCAACCTGGGTCAGTTCAGTCGCTAATGAGCGGGATCATTTTCCGCAAATACGGTAATTTATTTCGCTTAGAAGCCCTGCCAGCGCCGTCATAGTGTAGCATGCGTCGGTTGTTCTCGCAAGGCGTTAGTCGGTGAGCAAAATCTGGATCATTCCCCAGCGCTGCGGCCAGTTCATTCAGCGTATTCAGTGGGTTAGACCGTGCATATAGTACAGTGCGCAACTCGAGTCAAAGCGAGCCGTCGCAATCTATGTTTGTTCCGCGTAGAGTCTGTGAGTCCGTCGTTGGGCTCCGTTCCTTCATGAGCACGTACGATGTCCAGTGAGTTTTCTGTTCGTTTCATCCATTACCATCGACCGTCTCGTTGCAGCAGCGTTCAGACGTTGGTTGCACTGCTTACCTTAATATTATCTCGCCTTTCTCGTTGTCGCATTCACGGACAGGCTGAAGCTATATCTTCTGCAACGTTTTGCCGAATTTGCACTTGGTTCCGCCCCTTGCCCGCTTTTGCATGATCGGCATGCTCCCCGGGTTGTTGACTGACACTCCGCAGCCTTCTGTCGCCTTCTGTAGTTGACCGTGACGCACACTCCGACGCCTAATGTTTGCAGTGCCGGCAGGGTAGGCGCGGTTCTGCTGCTGTTTCATAAGTACTGAGCATTCGTCTTCGCACGTTTTGCCGCCCTGGCAGAATTTTCTGCCCGCATGTTGCCGAGGAAGCTGCACGACCGGCACTTGATGCGTTCGTTTCTGTATGATTTGCTGCCTGTTTAAGCACGCATCTCCTTTGAATGGCGGCCTCTATCTGACCGTTTAGGCATGTAGAGGCAGACGTGGCTGAACTGTTGACGCTGCAGCACCCTTCGTTTCTAACTACTATTTCGCCGCAGCGGCACTGGGCCGCCGGGTTTAGGACCTCTGCGGCCTGCGCACTTTTCCGCTCGGTTGGCTTTGCTGATTGCTTCCTGAGCTACGAGCTTCCTGAGCTGTGACATCCGTGCCTGTCCGGCGGACTTCGCGGCGCGTGCTGCCAGTCCTTGCTGCATATCAAGCGTACGGGATATGAGCAGCTGAGCATGGCAGCCCGGCTGATTTCTTCTAGTCCTATTCTGACTGTTACGACGGGTGCAGCCACTTCTTCCACCATCAGTTCAATGCACCACCTGAGCCCGGCACTCCGTCATGGCACAGAAATGGATTCAGCGTCCCGTTGAAGTCTTCTTCATACGGTACTGTTGAGCGTGGGTATGTAGAAACCGGTCAACCTGCAGGATATGACCTGTACTGACGTACTCATGCTCCCTTGGACCCCGGCTGCTACGCATCCCTCGCTAATTTGTCCTAATTATTATATTTAGCGTCTGGCTTTCAGCTGAATGGTGCAGTCTGTACCGGTTTCCTGTGCGTCTTTGAGTAGAACGCTCCTGAAATCTTTACTGCCATATTCACCGCACAAAGCCCCGGTTCCTATAGATTCAACACTGTGTCCTGGCTAATCAGAATTTATAACCTACATCTAAGAACCATGAATCCGTCAGGTAATCGCCAGTCGCCACTGCCGGAGCTTCTTCAGCACCAGCAACACCAACGACGGACACGCTGCCGGATGATCTTACCTGCACTCCACGCCAAGCTATCCGCATTGCATTTCGTCCTGGCAGTGGTCTTCCTTTCATATCTAGGATACTTCCGTCTTACGGTAATCCATTGTACTGCCGGACCACCGACTGTGAGCCATCAGGCCATGGCTTACCCAACCTGCTTACTGATTTAAAGCCGTTGATGAACTACAGACGTCCACGCATAGCCATAGATCGAACGTATCCTCCCCGGTCACTGTGCTGCTCTTTTCTACCGGCGAATGGAGGCGACCGAAGCCAGGTTGATGGATTTAGGTACGACTAGGTACTTCACGTTAATCCCTTTCATACTCACATTAGCCGTTTCAGGACAACGACGGCATGTACCCGGTTCATTGAAATAGCCCTAATAAACGTAGTACCATGTCCGTCCGCAACGGGGACTGTCACCCGCATGTAAACAGACAGCAACGATACACATTACGCATCGTCCTCATGTTTGATAAAACGCCGTTCCGGACAGTACTGACAGGCCAACTAGATGATGCCCGCCTGTTCTAATCACCAGACCTGCACTCGCTGGCAACGTATACGGCGAAACTGCCGAATGCAGTCTAACTAATTGAACGTCGAATAAGCACTACGTTTCCCCGACCCCCTGGCACGTCAACAATACGGGAGAACACCTGTACCCTCGTGCCCGCCGGCCCATAATCACCGCACCGTTCACTCAGTACTTTCAGATAACACAACGAGTAGGGTCCGCTTAAATACGCTGCTTCCGAAACGTTAGCTAGAGGCGGCACTAATATTATGAATAAAGGATCGCTTGGGTCACCGTTAAAGACTATCGGCCAGTCCACTGCTTTCACGGGTGGCGGAAAGCCGGCCCGCCTTTACAATGTCCCCGACCACTTTCCGCGCACTTAGGTTTATCACACAGTTTTCAGGTGGTCGGATCTACGTCCCCGGTCCCATGGCATTCACACTGCCACGTACTGGCCCGTCCCGTTGCTTTCCGTCCGGTTACTAGAGGAAAGGCGCGAGAGTGCCGCTGATGGTACAAGCGTCATAGCTTCAGGAACACGTCGTTCATGAATATCTGTTGGTAATCACAAACAGCGTTTCATTCCCGTTGCCGTAATAAATGCAACCGCGTACCGGCAGTGACCGATAATCGCTAGTTTGCTGTCCTCGTGTCGCTTATGAGCGATACAGGGACATAATGTTTTAGGTTCTTACAATTTGTACCTACATGGCATTCATTATACCTGGCATGCTCCTTCCTGTTCCGAACTCCTCCAGTCTGGCTAATCCTCGTCGGCCCACCTTTTCCAGCACTCCGTCGCATGGCATTTAGTCTGTTACGTCATGGAAAATCCAGGTGACGGTCCCCGGCCTCCCGACCGACCGAAGCTTGCCCGATTTGCCAACTAGGTTCACACTTAGATAAAATAGATAATCACCCTGTACCCGTCCATATTGATACTGGCTGAGTACATCCCTACAGTTACAAGATAACGCGTGCTGTTCACTGTCTGATATCCCGATCTGTTTTTCCTACAGAACCCAAACGACTGTACGTCGTATAAACGAAGATGGGGTGGGCGGTCTGGCAACAGCCGGCGTCATAAATCGACGTGGTTGGTAGAGTGCGGCAATCGTGACGAACGATGACCGACGCCCACTCCCTGCTGCCCGCATTTACCCGGACTGTCAGCCGTAGTTCCCCGAGGCCGATTGCGTGAAGCGGTGGTTTCCGTCGTCCACCTATGTCTACCCGGCATGCCGTCGTCCCTGTTACCGTGCTAACTAAGGAATAAATTGCCCCTTCATCTTGCTGTCCCATCGCACCACCTATATTCCCGCTGTTGTCTGCAGTACTTCTGCCACGTCTAACCTGCAGCCATGGCGTGACACATTTATTCACCGTGCCTCTTTAGCCGTTAAAGTGCCCGTTGGCCCGATCCTCTCTTTTCCCTAAGGCATGCTGCACTAAGGCACTCAGTGAGTCGCAACGTCAGTCGTCTCACGGAACGCAGCTAAAAGTTAGCCGTGACCGCAAGCGTCGGCACTATTCAATACAGGCCTCGTATTTATTCAGCAACACGTCCGGAACACTACTTTACCTTCACGCCGTCGTAGACTGAACTCCACCTAATGTAGATTGCCATTCCGTCAAGCAGTGGCCCCGTATGGGCCATGACGCATGATTTCATTTACCAGCGTCGATTTGTCCGCTATGGTCTGAGCACTGTTAACACCAAGGGATCAGGCTACAATCTACCGGCATAGTCATCAGCAAGATTTCAATAACAGCCGGTACATCGAAGCCCTTCTAGGCCGACGGCGAAAATCCGACGGTCTTAGTTTCCAGCATTCTGTTTTAATCAGCCACAGCCGGCTGTGAGCTGCCCTAGGGTAAGTGGTAAAGGCATCCATCTTCGCTGACATTACGACCTTAACGGGCAACCTGCGTATTCAACAAGCTGTCGCCGTCTCCCAGCCGTTGCTGTAATCCAGTTCGCCATCCCAAATCTAAGAGCGTTATTCGAATGAAGCTGTAGAACGGCGCCATGAGTAAGCTGCTCGAGCATACACATTACTTAGTTATAGTCACGTCTTATCTAGGACGTCATTTATGCACGAACTACTTCAGCTTCTACATGTCTAATACCTAGCAGCCCGCCGATACCTACCAGCAGAAACCGTAGCACATCCCACCCTTACGCTGTGTAGTATACGCATTACAGGTAATGCGCGGGCTCGAGTCGACGCCAAACGGAGAGCACTGACTGGTCGGCAGTACTGGCCGATGACATACCCCGCCCCTCAGTTATCCACATCGCCGCACCAATACGTTCCCCATGCTTACGGTGGGCCATCGTAGGCATATCCCACACCAGGCCATGTTGTTGGTCGTAGGGTTTAAACGTTCCGTTACAGATACGCTGTGGTCAGCCGCGTCTGCGTATAGTTCGACGCACGATGATCAGAATACGCCGCGCAGATGATAATCAGCTAGCCTGCTCGTACGAACTGCTCCAGTTGGCTGCACGCCGACTAGTGCCGTGTTCTAGCACTGTTTCACGGCCATCTATTTCATAGTACCACATATCAGAGCGTTTTGTTCCTGCATAGCGGTCTTAGTGTAGTTTAGCGTCATGCATCTATGCATCCCATGCAGCGGATATTAAACGGGCTCGGCGGTGTACAAGTATAGCTCAGCAGGCCAGATACTGCTGCAGGTATTTGGCCTTAATGGTGTCTTTTTCCGTCTACCCAGCCATTTACGTTGTATCGACAGCGATAGCATAGACTTCCGACGATTCCTGTCACCCTTTGAGGTTCCATGCCTGTACCGAAGGTAAGCGCAGACGTCATGTTGCTGCAGACATCAGCCTCTGTAGATCGGCGTTATTGCCCAGCTTTCACTTTAGTCTCGGCACGCTTTACCAGCATTCAATCCCTCAGCGGTCTGCCTCCTGCTCACCAGCCCCGGAACACCACGTGACACCCCATGTTGGTATTCCCTCAGTGCTAAGCGTACTGTTCAGCAGGCTTTAAGCCAAGCTTCATGACCTTCACTCTGGCATGAATCAGCAACTGCTGTCACTGTCAGTGTCCTTCGGTCCTAGCGGGGTCCCTTACTGCTTCCTTTACCCATTCCTCACGCCCATAAAACTAAACAAAGCGTTGCACTAAGCCGTCATCAAAACATAGCACTCATCACCGTCCGTTAGTTGATATACCGTACAAGGCGTACGATCTCCGCGTCTCGTTTCGCCGATCTCCGGTAACGACGCGGCTTCGACGGCACTCCGGTACAGACTTAAGAAATTCTCGGCACTGTTGTACTTAGGTTCTTACCGTCTTCTTACGGGGGATTCGGCTTTCGGTCAGCATGCCATCAGCGCCGAGCACGCTACTGGCCACCGAGAGAAGGCCCATGCCGTCATATACGACCGATGGCGCTGCCCATGCTGCAGGGCCCTGTACTCCGGGCGGTAAGAATGATCGGCATGGCGGCACCCCAAGATCTCGAATCGCTATCTGACTTGACCGGCGTACTCTCGAATCAAGTAACTAAGATCGCGCCATCAGGCAGTCTCATGACTGCCCGTTGGTGACCCGGACTGACGTCTGCCGGCAGGCGTGGGTTACTATGAGCGTGCTCCAGTTTCTGACGAAGCCGGGGGTCTTGACGCCAGTGCCTGCCACATGGCTTCAGCCGCGTTTTCACGAAGGTCATGCTAGCAGTACCAATCGTTGTAATCCCTAATCGGCAGTACGCTAATCCGGGCCGCCAGGGGTCTTGCGTCGCTGCCATTTTAGGTCTCTCGTTTGCTAGTTGTCCGAAGTGCCACCTGCATGGATCCGTGCTGCAGTAATCGATGCGTCGGCACTGACCAAGTAAAGAGCACAGCACATCGCCCGGCTGTGCGCTCCACGCACCTGGGCTACCCCCGTTCCCATCCAGAGCCGATTTATCTAGATTCCTGAGCGAGCGAGTCACTCCTCACGATGAAAGTCCGGCATCAATCCCCAGGTACCACCCCATCCGCGGACACTTGTAAGTCGTCACCGTGCCACGCTGCGTTATCCGGCACAAGGCACTGTAGCAATCGTCCCCCGGCACGAGCCAGGCCGGCAATGCCTCTGCTGCAGCCCTTTAGCCGCCTCAGCGCATACTACCGCGGCTCGTGATCCATGCCAAGCCACGCCATCCTGCATTTCCTGCAGCAGTCTTCCGGCACACCGGAATACCGCCTCCGCTCACGGGGAGACTTCACGCAGGGGAAACTTTCCCCTCCGGCTTGATCTACGAAGCCGCACTACTCGGCTGGCACCCATCGCCGGCGTGCGCCAGAATCGCTCTGTCTGTGTAACCGGTTTACTGCGAAAGTTTGTTACTGAAGAAAGGAAGCCCGCCAAGTCTGCCGACGTTATGCGGAACTTACATACGCTCAGGCTTTGCATTATCCTGCTTATGGACGTTGTAGTTATTCATCCACAGCCGGACCGGCCCGCACTCGTCACCGCGATAGGTCCAGGTGCAGGTGTCTTAAGGGACCGTCTCAGAGAGCCGCTAAAACGTTCCCGTGCTTCCTGCTAAAGGAGCAAGCCTAAGCCGCGTTCTTCATCGGTAATCGCCTTAAAGCTGATCCTCCTGCTCCGGATCGGCATCTGTTTCCTGATTTACCGATTTGCCCGCATCCAGAAAGCGTGGATGGACCGCCTTACACGACCGTTCCCACCAGACTGATGCCGCCTCTGTCCACCACGTAAGTACGACCGTGGCCAATCCGCGGCCGTCGGCTTCGTTCCGTTGCCGTTAGTATGCCTTTACGACGCTTCCGTTAATGACTCGGATACCGTAGAGCCTCCTGTCGCCCGTACGACTGAGCTTTCGTTCTTGAGTCACAATAACGTCGCCGACCTACTGTCCGTGGCTTCCCAGCGCTGGCCGGACCTCCGCACGGGTGGGTTCATTCAGTGTTTCCTGCCGGGTCTCCTGCAGGTCCGTCTAGCTGTTAATATCTCTGCACTCAATGACGCAGCTGGACCCGCGACTACCATTTGCTAAGTACTTTATCTGCCGCTCAGCGCAGGGCGTCACAGAAGGAGGATTCCCTCCCCGTGGTCCCAACGGACTCCAGTGATTGGCCCTCCTCACGGGGCACCAAGGGGCAGGCTTCACGGTATTACGTTTCAATCCGGTCGACCGGCGCGAGCTGAGAATAGCCTCAGTAAAGCACCTTTCTTACGAAGGGACCTGGAAGCCATCGGCTCGCTATTCCTTCCGCAGTATTCGTCAAACCACGATAGACGACAAGGCTGTGTTGAATTTCAATAACGGCTACGGTTAAGACCGCTGTCAGCCGTCAGCACCTAATAGTATTACGTCCGTCTGTTGTATAATCACAAGGGTTATTGCTAAAACGTTGGCCGACGCTGCGACCTGTCCAGGTCGGGTGCCGGTGACAGACGGTGAAGAGCGCATCAGCCCGTAACATTCCACGACAATTAAGCTGATGCCTCCTTCGTGAGGACAAACAACTCAATCTAAGTGAACAATTTGCCTAGGTCATTACTAGACTCCACCCCGTGCTCAATGAAGCGGAAGTTCACGCACGGTAGATGAATGTACCCTGACCTATGCACGGCCAACACCGCACAAGTGATGACGCTGCCGATACTCGCCCATAAATCCTACAGATTGCCTTATTAAGCAGAATTTCTTCTATATAAGTATAGAATAAACGGACCCGTTAACACTGCCGTCACAGCCCTGTCAATGTCCGATACTAAGCCGGTATTGCTTAATCATTTTACCATTAAATATTTATTGATAGTAGCTTCAAGGTAGGCCAAACAGCTAGTGCTCCACTTACTCCATCGATTTAGCAGATAGCTGTACTGTCAGCCAGGGAATGTTCTTATATCTATCACCTTGGTCATAGAGCCGTATAGAATAACGTTACTTCGTCAGAGTTTGATTATTACATTATTCCCGTTCTTATGATCGGTGACCGTCATGCCCGAGCGTCCGATAAGACTCAGCCGTTTTGACAATTTGGTCAGTGTCCGATTTATCTATAGAACTTATCAGGCCCGTTCAGGCACATCGATATGAGCGTCATCACGTAATGTCTCAACAGTGCATCAGGTAGTACGATTCTTACTAAGGTCTATATTTGTAAGGGATTTCCTATCAGACATCAGACGGTCAGCCCGATCTGATACTAGAAGTACTCTCCGTTCTAAATCCACCGAGCTTGAGTACGTACTTTTAAGTTGAGCGAATTATTCTCCGTTGAGGGTTCTGCTGAATACGTCACCAAAGAAGAGCCAAGGTTTTCCACGTAACCGCGACATGTCGCACGTAACTGTTCTATCACCGTCGTTCAAGCGTCGGTCGACCACGTATAGATTTCCGCCGACCGACATAATTGTCTCCAGTCTCATGCGAGTCCCATTCTTTCCGTACGTGTTATTTCACGTTGTCCGTATGAACTTTCACAGCGTGCAGCCGTTCTGAGCTCGTCCTATTTCATCAGTGACTGTTCATACTCTAGATTAGCTGTCGACCCTCTTAAGTCCCATTTTGTCTTACTTTGGGTCTTAGTCAGGACCGTCTTTCAAGCAGCTTCGCCATAGAAAGCTGCCGTTCACAGTGGGCCAAACATAAAGTCATCGTCCTCAAGACTGATAGTTTGCCCGTGTTTAGAGACTGTCTTCTTGGTCTACGCTACTGCCTTATAGTAGATAGA
>113
TTTCTTACTGCAGCCGTGTTATTCTAAGCGACAACGACGAGATACAGCCCCTCCGGAAAGTAATTTTACACCCGGGGAGATATTTCCACATGAGAATTGAGTTGAATCTAGGGATGCCCTAAGACCCGCCCAACCTAAACGACCGCCGTAGGCGTCCCACTCAGCCAGTGAGCATACTGATTCTGTCTTGCTGGGATGCCAATGGAAGCATTTATCCTTCGTGATATCAAGCGTTGACAAATGCTCTTCTTGTGCCCTTACGAGCTACGGACCCTACTCCCTCGTCGCAAACAATCTCATCCTAGGTGGAGCTTTGAGCTGAGATCGCGTCCACCGCGAGAGCCTAGTCGTTCTGCAGTAGCGTGGACATTACGGGAGGGAAAAACAGAGCCATTTTATTCCCTTGACAGAGCACTGCTCAATGCGCCAGCGGCTGATCACCTCCTGCTCCGGATCTAGTGATCTGTTTCCGTTGTAGAGACCGGAAGGCGACTCCATGCGGCGTAGACCTGCCTAATAGGCACCCGTTCCACCAGCCAACTCTGCATATCTTCCCGCCATCCCGGTACATACCGTACAGGTTAGAAACCGTCAGTCAGTCTTATGCTTTGCCATTTGAGTTCAAACCGCTCCGATGAATGGGGATACGGCTGATAATCTTCGCCCTGCCAGCTCAGCCCTTTTCGTTCTTAGCCTTACAGAAAATAACGTTCTCCACCGACCTCTGTCATAGTTAGATTTCGCAGAGCACCACGCTTACCGACTGCTCCGACGGGTGCATTCATTCAGTGTTTCCTGTACGCTTACATCATGCCGTGTTCAAATGGTCGAAGCACGCAGGCAGGCGACGAACAGGAGCATATAGTG
>114
AACCCATCGTTATGTAGTTTAACCCCATCTGCTCGTCAAGTGGCCGCATCCAGACTCCAAATCGACAACGACCAGATCGCCTACCGTTGCCCTCATACCGTACCTTCCGATCGCCACTATCAGCACATTACGTCATCCTCCGTCATGTCCCACATCGGGGAAAACCGGGGGTAACTTCATTCCCGTCCGGGCCGGCGACGCGGCACTCTAATCGCTTTCTGCATCAGCACATCATCTTCAGGCTCTTCGTCAGCCTCGCGCCGGTTCAGCAGACTGAATCCAGGCGCACATCCAAGTACTCAATGAGTGAAAAACAGAGCCCTTACTGACCTACGTCAGCCTAGAAAGTGCATATCCAGCAGAACATGAAAATAATGGTACTGTAAAGCGTACAGTCAGGCATATGAATTCTAAGCAACGAGACGCCAGTTGGGTCTCCCCATCTCACGCGCCAGTTTCAGGCAAAACAGCTCACCGTCGAACACTTCTTCCCCAAGAACAGGCTCTGCGTGAGGGCTTCTCTGTCTGTTCGCATTGGTCACAAACTCATACCAACAGACAGCCGGTACTACACGTCTAGCATGAGAATTGCCTCCCTGTCTAAGTAGGGCAGGGCTCCTCTCAATCTGTTTACGTCGTTGGTCTGTGCCATCACATCTGCGTCTTCTTAAGTATGTCTCAAGAGAAGGCGCCAGAAAACGCACCGTCAGTGGCCGTGCCACAGTAATTTAGTTGCTGTTGACTCCGCCTGTTCTGCCTGCCGTTTCACTAGGCGCGGTAGCCAATGCGCCTGCACGTAGTCACAGTTCCAGAAGAGCGTGACGGTCACCCGTTATGTTCAATGATTCGGTTTGTCGCATAGACATGACTCTCCGATTAAGCTGGCGCTGACGGTAATTTCTGCAACCCGACCAAACTAAGTTACCGGCCTGAGGATGTTGACCTCGTGTTCCTGCAGCACCCGAGTCCCACGAGCCGGTCATACCACTGACGACACGTGGCTTTTGTTTATCCGCAGACACCGCACGAAAGCTCTTTAGGTCACCTCCAGCCTGAAGGCCTCAGGTCAGCGTGGTGCTCTGCCTTTCACCACCCAGTGAGCGTTCACGGTCGACGTTCGTCAGGTTGCTGTTACCGTGCTGTAATGTCTCTCTGTGCCATCGACGACGTCCCCACATTGATTTCACCTGTCGGGTACCTTCCTTCCGTTGATAGCCTTACGATAGTATCATCACGAAGAACGAAGGTTCAGGTTTAGAAGGCTTTGACAAAGGTATCGCCTTCATTAAACCACGCCAGCACTTCCTGCCTGCTCTCCCATCCCCTCGTGAAGCTGGTATGCCGAGCAGATTTCTGCGCCGTTCACAGTCAGTCGTCTGGCAGTCTGCATCTTCATCATGAGATAGCTGTCAGTCACTCACGGCCGTCAGTTCGCCGGGCGTCAGGTCTTTAACTTTGCCGCCAGACGGTACAGTCAATAGTCTGAAAGCGGATTCCCGCGTAAGCTCCTCGCGTAAAGCCCACAGGCGACCCGAGCTTTCACCGGCATTAGGATTTGGTACAGGCATAGCGTCTAAGTTCATAGGTAATGACAGTCAGATTAGCTGAACTCCACAAGCCGCATCATCGTCCCCCGTAGTCATAGCCTGACGCCATACTGGTGATCAAATCTGACAGTGCCGGGAGCGCTCATCACCGATAAATCCGGGTGATTCCATCCGCATCCGCTCTGAATCCCTCGAGCCTCGCCGGCAGGAGATATTCCGAGGCAGCCGAATCGAGTAGCTGTCCATATTTCGCCGTGTATTCAGCGCCGGTAGGGATAAACGGCAACTGCATAGAAAATCCGCCTCATCAAACAGCGGGGCGACCATCAAAAACGTCGCCGTGTCTCATGCTTCTCCAGTGCATCCAGTGACGGACCGTAGAGTTCAGTATGTTCATCGCTTTATTACCATCCTCAGTGCTTAGTGCACCGACGCCCAGCTCTTTCGGAAGACGTTACGCCTGTATCCTAACGACTTTTGTTAAACGCCGTGTTCACTAAGCGCATCGGGATTTCGCCTAAGTAATGGGTAACGGTTTTTCCCACCCGAGGCAGCGAATAAGGGCCATTTCAGTTGGAATAAACGGGGAAGTACGAAGGTTGGCCCCGCCTCATTCGCGCCTTTCGCAGGATGAACGCTGCCCTTTTACCTAAACCGACCGCACGCGACTAAAGGCATTACCCAGCTTATTACGGGCAAATCCCCCGGTGATTGATTCTGCTGCCGGGTTTGACTTACCTTTCAGCCTGGCCTTTCCTTTACCAGTTTTCCGTACCTTTTACGGGCATTAACCGACGTGGCCGACTGCGATAGGCGATAGAAGGAACGCGGTTAATATGAGGTCCATTTCCAGCACCAGGCACCGTTTGGATACGGCTGAGGTTTTCAACGGCCTGCTCAAGACCTTTTGGCCATACATCCCCCTTTCAGCAGCGACGTTACGGCAGGCGGTACGCGTCCATGACCCATACTACCGACTTCCGCCTGATGGCGAAACCCGATCTACCAGAATTTTCCTCACGATGTCACCTATTCCGCATGCCGCCTCGCTCCGTGCCAACAAACAGGGACGGCTGATGGCGATGGCACGCAGTGAGGGCATGACTTTTCTTCAGGGTCATCAAAACACACCACGTATCACCGCACTGACTGCTCACCGGATGTAATGGTGGGACGTTCCCATGTACCCGTATCGTTTCATCGGGCAATGGCAGCATCGAACGCTTATCGAGTAGCCATAGCGCCTCCCGTTATTGCATTCTGGCCAGCGCTCTGTCATTTCGGCTGCCACACCGGCAGAGACACGAAACGCCGTTCCCGGCAGCTAAATGCCACAGTTCATCCCCCGTGGCCTGTCGAAGGTAGGCAGGGAGCAGCACCCATCGCCAGTGCCACGACTATTGACCAGTTCAGACTGGTATCCCGAATCACGTATCCGGGCCGTAAATGCCTAGCATTTTCATGTCCGGTCGCACCATTTTCCCCTCGGCTGTGCTCTGAATTTTAATGAGTTGCTCTTATGATTTCCTCTGATATGATCCTGGGTCAAATGACGGAGGGGCGGTCTTCTTCTTTCGTTTACGTCTGACATCAACCGGATGATATCATAGCCGTTGGTTTATAAGAACCGGGGGTCAACCAGTTCAGCGGCATCCAGGTTCGTCACTCCTCCAAGAGAACTAAACCGCACCATGATCTCAGTGATTGTGACACGAACTCATGAGTAGCCAGCAGCACAGCGGCTCCTAGTGTAACTGAAGTGCCATGGTAACTCACGCCGCCTAGGTACCCCCGTATGCCCAGTTTTCGGGTAACGGGCAGGAGGCGTTAATGCGCTTCGCCTGTGCGTCTCGCATCCTGAATGCATAGGGTAGTGGCCCCAAGCGTGCCTGAGTGTTCCGGGCCCAAGAGCATGGGTTGTCCGGCAGGAAGTTCTTTTGACGGGCTTCCCGGCCTGTCCGCATCTCGACGCCACAGAACTCCACATCACAGCCATCCCTTATAGACGCTTTGCCCCATGTCTTTCATGTCTCCGATAGGGATTAGAGCCACGGGTATCCAGCTTCTCCTTGACGGTGTTTAGAATAGAACGACAAAGGCGCCAGCCTTTCGGATTGAACACATGATATTCACACGCTGAGTTCACCCGTAGGCTTCGATATGGTCGGTCAGTGATAACGTGTAATGTTCCCATCGCGGCGCATCCGAGACTGCGTGATGTTGCTTCCTCACTGCGGCCCATATCCACCTCAACCCGGATTAGAAGGCTTCACGCTTATATGGTATTTGCCTTAAGCACGACCAACTGCCTGCATCTCTGTCAATATAGCAATGAGCTCTCTTCGTCACCGCATGTTGCGCATGATGCGACGCTCGTAAGCGCCGGGTCGCCAGGTTCCTAGTCTTCATCCGGCAGGTACGCAAGGCTCCTGAGCAGATGCCTGACTGCGGATTCCGTCAATTCATGCTATTTAGCTGTACACTGTAACGATAATCGTGGAGAAAGAAGCGAAAGGTAATAGGCGGGCGTGGCGTGGTGCCATGTTTACCAGTCTAGAATTTGTGGTAGAGATAGACTTTCTCCGTGGTACGGCAGTAGCTCTAAGGAAAGAGCAGAAACAGCGGATCAAACTTAAATTTTAGCCATTTGCCGCCAGCAGTCCCGGTTGTACATGACATAAAATCCCGTAAAGCCGCTAGTAGAGCTTTAGTGATGAAGGGTAAAGTTAAACGATGATGATTGCCGTTGAGCAAACGCGTTAGTTTTCGTCTCGTGTCCGAGGGCAGCGCCGAAGAGAAGCTACAACGCGTATTCGGACTCTGCCGGTACGTCAGCGTGGTGCTGACGGGTCTGTTGACTAAGGCAGACCACCGAGAATTAAGCAGGGCCGTCCTGCCATGCACGCAACCAAGGTCGACCGAGGTGTCCCAGCATCAAGGGTACTTTAAGCGTAGGCCTTTCGCACTCAATGCCGGGCCATTGCGGTATGAGCGGGTCATGTTGCCCTGCGGCTGGTAATGGGTAAAGTTTCTTTACTTCCTACGTAAACATCCTGTACACTGTGTATGCCGAAGCAGACCTAGGCATCAGATGCCGGGTCCTGCAGCCAGCGGTGCTGTTACGCCTGCATCAGACGATCCAGTGGCAGAGCGCGTACTGCGCTTGCACTCTGTGGTGCTGCGGCCCGAATGCGGCTGTCAGTTTTCACGCACGGTCACTCGGCTTTTCTGCCATGCGCGTTCATAATTTCTTCGCGTTAGTCCTCCTCGCAGGTTGAGGATCCCCATAATGCGAGCTGTTTTATCCGCATGGATCTAGATCTGCGCGTTCACGTCCGGCTCGCCGCTGGCGCATGTTCTCCCTCCGTCCTCTACTACTACTATAACCACCGTGCCTAGAACCCGGAAGAGTGATGAAACATTGTTGATTGAGTCTCTTTGGTCATTCTAGCTCCGACGCGTCACCGGCGGTGCATCCGATCCATCACGCATGACGTACGCTCGCATGTTATTTAACAAGTTCATCAGCCAGTCCGGCATCAATGGCCTCCTGACCCTGTACACTGCGACTAGTATCCAGCACAATAACGACATAGCCGGTATATATGCCGACGCTTCTGCCCAATAAACATTGCGTGCACTTACGGACTGCAGTGTCTCCGACGTCATCCGGAAGGGCTGTAGGGATTGCCATCCACCTTATGATCCGAGCAGCGAAATATTTCCACCCCTGTTTCTCCAGCATAAGTGATTACTGTAGCCATCATGACGCCGATGAGCCTGTCCGGGCGGTCGGTGGGCAAGAGACGGGAGGCGGCACTGGCAGCATGACCTGCACTGCAGTTCATGTCGTTAGCAAGGCCCAGACCCGGTTTTATGTCTACTAAACGGGCGAGTAGTTCATAGGCAGTTAAATGCCCCCGCCATCTCACGGGCGTGTCTATCAGGGCAGAATGCCGTCCACCATCGGATGCTGGCAGCCTGTTGCGACGCGGCGAGGCATTAACCTGCTCCCGAGTACGGCTGCACCGCCGTCCGGCCGTCCGATTCGACCCGGCATAAGGCAATTACCGGTTTCCTGACTGCTGATTCTGTGCTAGTCATCACCATAATGCTTAGGGTCGCGTGCCTCCTGGCGAGTCATAGTGTCGCCGGACAGCGCATCCGTCAGGCTGCTGATCCCACAGCTGGCCTGCACCTAAAAGAGAAGAAAACCGCGCATAGCGGGTTCAAGGCATCAGCGGTCATTAAGGCAGGCCTACAGGTGCGGGATTACGCAGCTCTGCTGTCTATTCCTCCTCTGTTGATTGTGCAGCCATGTCAAATGCTGCAGCCCAGGCGGGCGGTTTACAGGTACGACTATCGGACTAGGCGCTCCATCATGTTCACGGACTTAGTGAAAAATTTCCTGATAGTCGTCACCGTTTTGCTAAGCTCTTTCTCGTAGGTACTCAGTCCGGCTTCTATCAGCATCACGCTTCCTGAACTTCGTAGGCACAGTACGGCCTCCATGACATCCCGTTCCAGTGCCAGGCTTCCTTAGATTCTCCTGAAAACTGAACCTAGGTCGAATATGACTGCGACACTCGTCACCGACCGACCGGCCCTCTTCCAGCCAGCACAGAAACATCTTAGCCTATCACATGCCACGATTTCGCCCCATAACACCACGCTCCACGACTCGTTTAGCACTGGCCCTGCGTTGAGTGCGGGTAAGATGGGGCCGTCAAGGAAGCTGCTCATACGAGACGAGCCGGCAGCGATATACGCAGCAGTGACTGCTCAAACATGATAGCCGTTATCCGTACCTCCGTCTGCAGATTTAAGTGAGTCACCAGCATCAGGTAGTGATATTTTGCCTCCCAGCCGGACCGGCCTGCGGCGTAATACGCGGCAATTCACCAATCCAGCCGGTCACTCTTTCCGCTGCTCCTGACTGTTCCCTACAGAATAAATCCATCGCTGTAAATGGCGCTCTCACTCATCTGCCTCGCATACGGCCTTCCGCAGAGCCCGCTCTGCAGCATGCTGTTCGTGAATCGAACGCATGTCAAGCATCTTCATCTGCTCCATCACCTATGTAAAACACATTGCACCCCAGTGCCGTCCTCCACGACGATTTAAAAACGTGAATGAAGGCGGCGCGCCGCCCGGGTAATAAGGGTATCCATGTCCATTTCTGCGGCATCCAGCCGATACCCGTCCTCCTGACGTATCCCAGCGCCGCACGCTGTCATTAATCTGCACACCTAGCACGGCAGTTCTAGGCCCTTCGCCTTATTTGTCGGGTGGCTGGCAGTGGCGGGCGAGCACCATCCGGAACTGTGTTAGAAAAGCCGCGACGAACTGGTATCCCATGAACGAACAGTTCACGTTAAAGGCGTGCTGGCCACCTTCCCCGAATCATCATGGTAAACGTGCGTTTTCGCTCAACGTCACTTCCAGCAGCAAGATCTAGCGACTCTGGTTCCTGCCGCTTCACCGGGGAAGAGGCACGGGCTTCTTCCTCCCCGATGCCAGATAGCGCCTTGGAGGTTGAACTGAGCCGAAAAGACCCGACGATATGATCTAAGGCAGGGAGCGTTGCGGCACCCGTTATTGCGTACCAGATCGTCCCGGGCATTGCCACGACAAAGTTGGGCAACAGGGCTGCATCCACTTTCACTCGTGGGTTCCCACTCGCAACTGCCCTCTAAATCCGCTCTAATGCTCTTATAACGAGCGACTTCGCAGCGATGTCATGCCGTCCGTGAATGAGCGAAGGGGCGATGGTGAGGTTCATACATAAATGCTGCATGCCCTGCGTGCTTGTCATGCCGTCTGCACTTCCGACTATGCATATACAGTGGCAACAGACAGAAGTGGTGGTGGAATAGTGGTCCACTCCTTCGTGCTTCGTCTTTCTGTACTCTTTACGCGTTGACTTGTCATCAGGTCATGCAGTGCCGCACGGGCAGGGCAAGTTCTTCCTGTCCGTCATTCATCCTCTCCGATAAGGCACGGGCGTAATCTGCCAGTGTTTTCTTGTTGATGTTGAGCATCCTCTTTAATCAGCCAGCAGCGCATCGATCCAGCTGCCGGGAAATACTGGTGCGCAGCGCCGCCAGCGCATAAACGAAGCAGTCAGTGCCGAGTGCATCCCATTGCCTTAGCTAGGCACAGTATTTCCTGCCATCCACCATTTTCGACTGGTCGACCGTCATGCTGCCTTCATAGGCTTCGATCAAAATATCCGGGTTATTCGGGGAATGAACGGCACAGGGAAGCGGTTCATCCCTTCCGGCGTCGATCGGCGGCGCATTCGCTGTGATATTTCGCGGTACGTGGCCGATTTCGGTAATAGTGGGCCAGTTTTGTTCGCTTACGTGGCATGCTGGCCAAGCGGTCGCGTACGATGCCCCCTTTAATGGGGATGACGACCCCAGGTGCGAGTGCGAGACAATGAGTAATGCGCTAGTATCCAGCATCTAGAGTGACATTTCTGCACATTCGGGGTATAGTTTATTATGGCCTCATCCACGCAGAGCAGCGTCTGTTCATCGTCTGTGTGGCCTCCATAATAATGCCGGTCAATCAGCCAGCTTTCCTCACCGGCTCCCCATGCCGCCCCATACCCCCATTTCGTAGCGGTCCAGCTGGGAGTCGATACCGGCGTCAAGTAGAAGCGCGCGGTCAAGGTCAGGAACGGGCTGAATAATGCTCTTTCTCCTGGTCGCTCCTGGATGCGAGGATCGACCGGGTCCCCAATTTCGCCTCATGTCTCACGAGCGTGTTTACGAAGGTTTACGTTTCCCGTATCCCTTTCGTTTCATCCGTCTTTACAATCTTAAGGCCAGGTGAACTTACCTGTCCCATGTGAAGGTCACTGTCAGGTGGCTCAATCTCTTCTCATGATAGACGGAAAACCAGAATGCCATCACGGGTCTAGATCCCCGGTCTTTCACAGATATAACGGGCATCAGTAAAGTCCAGCTCCTGCTGGCGAGTACGCAAGGCATTATGCTCGCAGAGATAAAACGAGGGGAAGGAGGAGTGCATTTGAGGCCATAAACGGCGTCTCTTTACAAATTTAGATACTGCTCCTCCCAATGCGGCAGGCAACATGAAACGCATAAATGCGGGATTCACTGGCACGTAAGCGTACTGACAGGTAACTCTCGGTTTGGCCGTGAGCCATCTTTGATGATCGCTATCGCACTTTCGCTCCATTCTGACGCGAGAGACTTTAGAGAGCCTTCCTGTTCAATATCATCATAAACAGCAGCAAGTTCATACGGCCACATCCACGACTTTTCACGGTATTTATCTCAGCATCCCGACAGAGAGCCACGAGTGAAACGCTTCATGGTGAGCGTGTTATCCGGTGCTTTGCCATACGCCAGCGCCAGCAAGCATACGAATATCACGATAGTCGGCTCAACGTGGGTTTTCATAAATTCTCTAGCATCACCATCTCGTCGGCAACCAGATAGGGTGTGCTTATGCTCTATAAAGTAGCATAAACACCCCAGCAGCATTTTGGAATAACCCGACACGGGCAGACTTATTACAGCATTCACCATGTAGTCGCTGCCCATCGCATTCATACTGGACCGAAATGCCTCGGCACGCGCGCTTCCTCCTGTACATTCTTTTGGAGATAGTAATTAGCATCCGCTTCAACGGCGTCTGTGGCTCCATGAACAGTGCTGAAGCCCGGCTAATAAAATGCGCATACTGTTGAACCTGACTGTTCGATATTCACTCAGCACCCCCGTATCAGCCGTTGGGTCGCTTTGTTCATCGTTATGATATCCCGTTTCAGTAAGGAATCAACATGTCGGTTTTCCGTTAGAAAACGCCGTGCACGACAGGGGAGCGTCGAATAACTGGCAATTTCACTGCGATTAGTACCGACGCGGAAAGTAAGAAGGGGTCTCCACTTCAGCTAGAGTCTCTGGCATTCTTCCTCAGTTCCTGTGCGTCCGTGCACCGTGAGCACAGGTCGATGAGTTCTATTAATAGTTCCTGGCTGGAGATGCCTCCCTCCTGCCGCGTTCTTCTTCATCTCCCGGCGCAGAGCTTTTCGTTCTCAATTTCAGCATCCCTTTCGGCACATACCATTTTATGACGGGGGCAGTTATAAAGAGCACTTACCCTTGCCACCGCCTCTAAGAACGGGCATTCCCTGTTCCTTCAGTTCTCGAAGGGGCACCCACCATGCATAGAAAATGTCAGCCATATGCTTTTGTTGACTTCCATGTTCACTTCCACGACAAAACAGAAGGAAACACCCAACATAGCCTTTCAGCATAGTTATTTCTTTCGTTAGAGAGCTTTTAACAAACATTAAGTTATGACGCGACGAAGAACGAAACGCCTTAAACCTAGAAAATTTTCATAGTAGAAAACCCGCGCGTATATGCCCAC
>115
AGTAGCTAGGAAAATTTGCGCCAGGGAAGCTTAGTTTCGGCCGCTCGCGTGCGGTTAATCCACGAGGCCGGACAATACGCTGGCGGGGACGAAAACGGCCGCTGAGTTTCGAACAGAAGAAGTGTATCTAAACTATTTGTCGTCTGTGTGTGTTTCCTTCGCGCGAGTTTGTCTATGCGAAGTTGACATCGAAGGAGACAAAAGTCTGCACTTTATTGCAAGTGGCTCCGGCTTTAGTCAAATCGTTAGTCATCATTTGGCTGGTCGACGTGCGTAATCGAAACTAACGGACTCATCGAGGCGGCTGTCACCGACCGTACCCGGTGGAGGTGGTTCGCCGGGTGATACGTCCCGCAGACCAAAATGGCTTTCCGTCAAAGGGTCAGCCTAGCACGGTTGAAAGGAAAGAGCTCCGCGCTCGCGTTACGTAAACCTCAAATGCGCCACGGACCTTATAAGACTAGTCGTAAGATCAATCTCTCTGTTCCGTTGACGCATTTACAGAGTACGAAAACGGAGCGTAATGTCCTTACGGGCCCGTTCCGACGCATAACCGTACGAACTTCGCACATCCCATCCAACGGTTGTGTGTAACCAAATCCCATCAGTTCAATCCGCGCTTAACGCTCTATGAAAACTTAATTTGCCCATTCAGGGGTCCCTGGCGTAGCCAACGATCGATAAGCTAAACTGGGTCCATTCGACGGGCTGCCCCGGCGCCTTCACGGCTTTCCGTTCTTGTATAAATCCTCGAAAAATAACGTAGGTTTCCCTCGAACACTGTCACTACGTAAAGCGTTAGAAATCAAGCGCTGGCCTCATTAACCCCACCGTGGGGTCCGTGCCATGTTTCCTTAAAGTACGGTGAAACAGTCACCGCTGTTCGACCTTAAACAGTACGGCCGCGGCTAACAGTGGGCGGCTCGGGTTTGGCGATGTAGCTTCGCTGACTTATCAGGCTAGCCACTAAGAAGCGGTCGACGAAGGCCGCGGTTTGTTATCAAGCCCGTTGCTCTTCCGTAAACCAAACGCGCATCAGTACCAGTCTCAACGGGCCCTCGAAAGAGGCTTCGCCCTGCCCTTTCAGGTTGGAATTCGGAGCGAGCAGGGCTCATGAGAACGGCGCTGACAGGGCACGAGCTTTCTTACGAGCGGCCCAGTAGCCGCGTAAAATAGCCGCCGCTCTTTCTACCTTTCGAGCGAGGTTAAGTACGTCGACGCGCAAGACTAGGCCGCCATCGCCGAATGGTTTGTCTAGTTTCATCCTAAACAGCTTGCAAACCCAAGGTCGAGCTACTAAGGGCCGGGGACGACCCTTATGCCCCTTTCGTCCTTTATTTGTGTCATGACGCCAAGACTTGCTGTCAACTGCTCATCGTCCCAAACGGACTAAATGCAACGACGTAGTTATGCGATTAATGCGCGGTCTCGCCGCCTGGCCGGTGGAGGCAACAGGCGCAAACAACGATGTAAAGTCCTAGCGATGTGCGATAGTGGTCCAACTCTAGCTTCAGTGCATCACTAAGTGAACAATCCATGAATAGTTGCGCTAAATTTCCGGGCACTTAGCCATTTAAAGGTTATCGAGTTCTTACAAAGAGCGATAGGCGGTATCTAGTACGGTAACAAAATCCAGCACTAGAGCACTACAATGGCTATGCGCTGACCCCATAGTCAAAGATTCTTTGCACTTATCGGGTCGCGAGTTTATTCTTCACTCTCACTGGACATAGAACCTGGCGGCTTAAGAGTTTGTCGTGGACTATGCGTCAAACACACGACGACGGTGTTTTGGTGCCAACGGACGCCGTGATTATCCATGTCTTTATCTCCTGCGTGTTACTGCATAGACTCTGCTTCCGTACCCTATACTTCACAAGCTACTCACGGCCGGGTCCCCATCCCGTCCATTTTCTAAAGAATAGTGCCCAACTTTCTTAACCTGACATCGTTATTTACACGCCAGCGGTCACCCTCTAGTTTTATAACCAGCATGTTCAGTTGCGTTAACAGGCGATTTGCTGCACATTCTAGTCAACACATTTCACCGTAGTACCGGCCCGTTCCTACAGTCCTGCGTCAGTTGATCATAAAGAATGCTGCTACGAACACGTTGAAAGGCATAATGGAACGACGTAAACTCCGTAACATTCACGGTGCGGCCAACGGTAGGCGAAATTTTGTGAACGAGCGTCTGATTGCACGAGCACGGAGTTTGTAAGGTTGCGAAAGAGCTACGTTGGCACGTTATTTCGACCGTGGCGCTAGGCTCTATAACTCACGGTACGCGAGGACTCCATAGGACTTCGCTAAGTCAGACGAAATCCTGGCTCTTTTTACCAATTTGGCTCCGGCGCTATCGGTCTAGGCTTTGAGGAAATTTGGTCCATCGCAGGCCGTCAGCAAGGCATCACATGGCTATGTCGGTCGGTACAATCACGAAGCTCATTGAAAGACGCTCTGTTGCGGCTGGATGTTACGGTCAATAAAATTATTATGCTTTTCACGCCGCTCACGAAATTTACCTTACATGCCGATTTTCGCTTTCAAGTTACACTTGTGTTCACGTTGATTCATGACATCTAGGTCGTTAACGAGCGTCCAAACGATTCGTAGAGCGTGATCCTAATTAAATTTTAAGCGTGTTGACATTCAACCCTGATCTATTAGTCGAGTTTAATTTGGAGATTATTATAAGCTTCTTTCAAACAAACGGGTTCAGCAGGACGGTAATTTTACACCGTGAACAGTAACAGCTAAAGTGCTACTCGTCTACATGACGCGCCTGCCTGACGTGCGCGTTACGAATGCTTCTGCTTTGTAGCCCCAGCCTACTGCCTTCCGAATACCTGTACTAGATCTGACGCACGGCCAATCAAGCACCGCGAATACCCACATCATTTGAAAATCCGCGGTCATGTCTTAAGGAAAAGTACTGTGGCACCGTCTCAAAATGTTGACTTTCAATTAGAGGCACTTGGTGAAATCGCTTTCGTTTGCGGCCTCGTTCTAGCGCCTTCGATCCACCAGCTTCACCACTCCTTTGGCAGCTCGACCTCATAGCCGCGCGGTATGCTCCGCCTACCGACGTTATACGCTCTTACAGCCAATAAAGAACATTCGGCACTTCCACTTATTTAGACGGACTGAGCGAGCGCGTTAAGGCTCTTGTCCTACACGACGGTGCACAGGAGAATAACCGGAGCGCTGGACCTGCAGTGATCTGGAGTGACAACTATAAACGCCTTAACAGTACAGGTTAAAATAAATGGACTAACGTGTGGTCTAACTACTTCGGCCGTAATGTGAAAATATACGCCTGGAGCATGAGTGCGTCACGTCGCATAAATTGCAGCACACTCAACGGTTTTGTCAATCGACTAGATTAGTCCTATCTACGCATGACGGAAACGCCAGCAGTTCCGACCCTCGCGCCTGGACGCACCAGTGACGCGACGTGACGCTAGGCGGAAGACGCTCGGTACTAACTGAATCATAATCAGGCGGGATTGATTTGGCTCCTAAGTTTGGCTAGGGATCATAAATGGTCTAAAAGTGGCGCCATCGTACCGTCGTGGAGCGTTGCGTAAATGTTGCGGCATCCCAACTCTCCACCAAACGATTCTGACTTGACAGACGAGGTGCCCATTTCGTGAGACTCGCACCCGTCATCATAGCACTGTTTAGACTACGACGTGGGTGTTCGCGTTAGGTTTTCCGTACCCGAGCTATCTAAGTATGGTCATAAATACCTTATGCTCGTCAATCTCGATGAGACTCATCAACATACAAATCTACAGCGCCTTTGCCCCTCCATAACCCTACGTGAAATCCGTCATGGGTAGTTGGTACAATCGCTTGCTGCTCGCCCACGTCGAATGTCCGCTAATGAACGGAAGCAGCATATGTCAGGTCGATTGCGCTGGCCGACAAAGCAAGGGGCGGCCGGATCGAGGCGACGGCCTTAACGGGTTTCATCCGTAGGCCGGGTAATATTCGCCTGGCCCTCTTCGTCAACACCATTTCGGCTGGCATTGAGATGATGAAGTGCATATCCAAGTCGCTGAAAGACCCGGACAGCCTAGAAATCGCCTTTAGCCGGCGGTGGATATCGAGCATAGTAGATGAAAGCCTGGCTCCTGTAAGCATTACCGTTGAAGGGCATACTCTGGCTTCGGATGCCTGACCAAAGCGACGAGGCACGCTTCACTATGTAGCCGATACCTAGGCGCCTTTTCAGGCGATGGCACTCACCGTTCAAACACTTTCTAGAGAATGGCAGACTGCTGCCCAACGCGGCTTTAATGTCTGTTTACACCATTAAATATTCGCCCTGAACGGCAACAACCACGTGGGCCCTTTCACGACCGAAATTCAAGCTCGAAGTCGGCCATGGGCACTAGGTTCATGCTCATTATTTTATAGTCGTGCATCTACGATATTGAGTCTTCTGCAGTGGTCATGCTAGAACATATCACATAGAGTGAACGGATTTTAAATGAAATGTTAGACCTGAGCGGTAACTTCGCTTTATGTCTTAACCCGCCTGTCCATTACGCCGTTCACTCACGAACGGAGGGCCGTATGGCTCGTGAGCTGCATAAAATCAGTTCGAGACTAGCGTGAGTCGCCGCGTTGACTGTTCATGAGGTTTGACATTTTCGGAGCTCCAACGGCCGTTGATAACTGGCACTGACGGTAGTATTCATCTATCCGGCCGAGCATACCACCGGTCGCCTGGCTAATGGCCGCGTATTGTTATCGTGTCGCGTACGAGCACCGTTCGCCTTGATATTCATGAAGCACGGTGGGTTTGTGTTATCTACGCGACAGGGACGCGGCTAATATTGTCAACGGTTACCCGCTACAGGCTGGAAGCGCGTGCCCCTTATGTCAAACTCTGCTTTCACGCCGAGGTAGACCCGAGCCAGTCACGAGTCTTCGTGCCGCGCTTGCACGTTACTACGTCCTGCAGATCGTTGGTCGCGGCCTACGTCTAGCTAAAGGTTACTTTCACGTTAAAAGCTTAGCTATTCGGTCGGTCGCCCGTAACGGATATGCCTGGCGAACATAGAACGCGCGGATAGCGTCCCGTTCGGGGAGCGGTTTGTCATGAGCCCTGAAACGACAGGTATCATAAAATTAGGTGCTGATAGACGAGCGACACTGCTTAGTCATACCGTAGAAACCTAGCAAAACGCGTGAAGCTGACCCATGAAAATTTCTTAGTCGCGTGCCCAGTCAGAGTCGTGAAATGGTTTGGGTCATCAGAGCTGTTCGTCGCCGCTCAAGCGGTCCGTTTAGACGAATGGATGTTCGCTTATTCACTGTTCACAGGCATCGGCGGTCCTAGACACGGGACATGATAGTCCAAAGCAACTTTAAGAGTCCGCCTAATCGCCCTCACATCAGCCATTACATCTAAGGTTGGAGGCCTATTTCGCCGGCATTGTAGGATTTATCGCGCCGCCGTCTAGCCATTTCGCGCTCTAGCGCCTTGCTAATCACCCTGGTACTAAGGCCCGAATAGACCTTCTAGTCCGGTGCTCACGCTGACCGCCCAATAGTATTAATCGTGACGATTTACGGATAGTCGCTCATCACGCTCAAATCCAACCAATCAGAAGTACATAGCTCCGTACGGCTAGTACCATGAAAGGAAGGACGTGGACTGCAACGGCCTATGCCGGGCTAGTATGGACGCTAGTTCCCGCGACGGCGTGCTCGCAGTCTGTCAGCGGATCCAGATAAACGGCACGTAGAGATGCCACGGCTCGCATAAACAGCTATCGCGACCATCTAGATAATTTACGCCCGGTGTTAGAATTGGATTCGCGTGCGATACAGTACGGCTGCGACGCCCGTTGGGGCGCTTATGTTCATCGGTCCTTTATTACACAGTCGCATTTGATCCTGCGGCGCGGCACGAGCTCTTTCCAATCCTTTTAGCCGTATCAAACAAATTCTAATAAACGGTTGGGGCGCCAAATGACATGAAATTCACGCCATCAAGCCTTCCAGGCCTGCGGTAATGCGCTCCCTGTCTTTTGAGGTCCCTGGATAAACGGGACGGGCACTTTACGGAAGGACAGGTGCTACGCCTAAGGTTTGGGATAAGCATTGACGCCTTTCTAAAACAGGGCAAACCACGCAGCCACACTCCGATTGATCGCATAGTGATCGGGCAAATCCCCAGATTTATTTATTCTGGATCGATTTTGACCGTTGCGGGTTTAGATAACCCTTTCAACGTCTGAAGTTCCAACGGACCCGTACCATTTGTCTACGGGCGGTATTAGCGGGTGCGATATCGAAGGTGCGACCAGACCGGTCCTTAATGAGCGGCGCAGCTTATTGCAGGCTAAGCGCGGAGCACCGTTTGTCATCATCGGACCGGCTGTTTCAAACATCCTATCAACCGACTATTTCTATACGACGATGGTACGCCCACGGTTTGGACGCGCTTCTACTGAAGGGGCCCGTTAGGACCCAATAAAGTACATTCAAGGAAAACATAAAGACATGTACCTCATCCGATCGCGAGGTTCCTCACCGTATGACGTCAGCGTTGACGCCTAGAATGCGCTAGACGGGCCGTCGAACGGACGAGCTTAGGGCGCAGCGTTGC
>116
ACTCGATTTGCGTTCGTCTATGCATCGTCAGTCTACCGAATGTTCAATCTTGCAGGTATCCGAGCCGAGCCTCCAAGAGCAGAAGTATTCCTTCTCAAAGTCTACAGTTCATAAGATATCTGATCCAGGCTTTGGCTTTAGCCGCTTCGGTTCATCATAGCGGGCTGCCAATCCACGTGTAATTCCTCACCAAATGGTCACAGTATTTGGTGAAGGGAACAGTTTTAATCTGTCAGTGCAGAACGCGCCGGACGTATGAGTGCCGTTATTGCCGTAAAGCCTGACGGTCAAACAGGCGTCACATTCTGAATATCCTGTCTGGTTCCCATACCGTATAACCATTTGGGCTGTCCAAGCTCCATATTACTTAACCTTAGCAATACGCTATCAGCCGTATGCTACAGAACTTCACAACTTCCCTGACAAACCGATATGTCACTTGATGTTCACAACCTTATCCATGAAACGTAATGCACGTCGTCATTTGATCGCGTCACCTTTGGAGAAGAGGAAGTCCTTAAGGGAGAAACTAACGACATTTATCATGCAGCCTGTCTCCCCATCTCGCTTTCCACTCCAGAGCCAGTCGCTTCGTCTACCTTAACGCCATGATCGCGATTCCTGCCTCGCCTCCGCGAGTTCCCTCGCGTATGACTTTATGATTACTACAAAGCCATTCCCGGCAAGGTTAGAGAGAACAACATCCTGCTGCTTTAATGCTGCGTAACACACTTCTATTTCTGCATCCAGCCAGCGACCTGCTTCAACCTGACGAGAGACGTCACCTAAGCAGGCTATTCATTTTATTCTTAGCATCCGGTTGCGTTCCTGAATGGTTATAGGAGCGATTGGTTTGAAGAGAAGGGAGGTGAAGTCAGCGTTTGCTGATGTGCTGGAGATCGAATTTCAAAGTTAGTTCATGACTTCCCTCCCCAACTAAATGAGTACCAGCAGCTAGTTATTATAAGCGGTAATGTAGTGCTTTTAACTCCATACCGCCAATACCCGTTCATCTAGGCACTCTGGCGGACACTCCTTAAAACCAGGTTGCTCATCTTTCCTTCCGTTCTTCCCTGATAAAACCGGGTAATACACCCGTTCGCCATATTACCTTCGATAACCAGAAGACCTGCCCGTTGCCATTTCTAGGCTTGATAGTCTCTGTCGTCATGTCTAGGCAACGTGCGCACGAGATTATTATGCGTCCCCAGGTAATGAATAAGCGTTGCTCTTCGCTTCCTCCTAATGTCATGGGAGTAGAAGGGAGAGGAAGAGTGAATATGTCGCCAGGACTAGGTTGCTAATTTAGGATCTACAGATGACAGGAGATCTTTTTACTCGTCGGATTATACCGGCTACATTACTTCACGCAGGTCCTATACACATAGTAATGGTCGATAGACGTGAGCGTATTCGCGGACGGTAAGATCCGCGTCATCCGTGATACATACAGTGCCGTTCGTTTCCTAAGCCACTCCAAATCATCAACGCTGACCAGGCATAGCCGTGTAGAAGCGACCCTTGCTGGCCTAATATTAACCAAAACATGCTTTTAGAGCGTTAAGACAAGCGTGATTCTTCAGCACGAATGAATGGAACGGCTACTTGCATGAGATATTCCTGTTAAAGGTTCGAGCAGGGGGAGCGTCATTGCGTCAACCTGTTTAAACCGTAAGTGATCAAGTTCCTTCCCCAGCAAATAGATATCAGAGCGTCGGCGTCGTTCGAAGAAGGGAAGAGGCCAGGGCAAAGTCCGGTATGAACACACGTTGATATTGGCTATAGGGTGTACCTGCGGCTTTCGCGTCGTACTGTTCCGGCATGTTGTTGGCGATCCGACGCATCTGACATTCACTTGATAAACTGTTAAGCGATGTTTCATAGATCTAGTTAGTCGAGTCTTGTTCATGCAGTTTAGTCGATTCGCCCTGCTGTTGCTTTACGGTTGATTTCGAGTCGTACCTGACAGGGGGTTTGACGGGCCGTTACTCTAATAGAAGTTGGCATGCCCGGAACAGGATGTCACAGTGCTCGTCTAGGTCACGTTCACGCATCAGGCGGATATCGTCTAGAAGAACGGGAAGTGGGCTGACGTATTAGATAGTCTTCACCATGTCAAACATCCACTCTGCGGCTTCCTTGGTCCTGTCCCCGGGTTCATTACAACCAGGAGTGCGGCGGGTCAGTTTGTCAACGCGACGGTGGAGCGAATTCACGCGTGGAATAAATCTTTCTTTTCTTTGTAAGCTGTCTTTTGTTCCCCTGTTTCGGGACTCCGGGTCGCGTGCCGCGGTTTCTCGCCTTCCGGAGATTTTTAGCGTTTAGGATCAGCGTCGATGTTTATTTGGTCCAACATGCCGCCCTTGCTTAATGTAATAATTCACTTTGACGCGTCACGTACCGTTACAGTCCAACCGTTTGACCTGTTACTGATCTCTCAAGTTGAAGAATCATCTTCTTCGATTGGTCACTAAGCTTTACCAGAGCGAGAAGAGAGGCAGGCAAAGAGTCCGCATCAAAGAGGCCATATTTGATAGTCTGAGTTAACCATCACTCCAGTACGATCGATAGTTCGGCACGTACTATGCCCAAATTGCAGTTTGCTTGTCAACTCCCTGTTCACGTGAGGGTCTGAACTCATCGGTCGGATAGTCCACGGGCGTTGGTTGAAAATCGCAGCAACTTGTCCACAATCGAGCCGTCGTCAAACGACCCCCATTCAAGAACAGCAAGCAGCACTTACAACTTTGAATCCAGTCCTGTCAGCTGATCTGCGACTTATCAACGCCACAGCTTCATGTCTTCTCAGTTCCAAGTCCGATTTGTTAAGCAACGCACTCGATTCGTAGCCGTCCGTGCATTTCGGAGGAAGAGAGGGCAGAGAAGATGCAGTGTAGATAATCCGACTAAGCACTTATTTAATTGAATCGCATTTCAGGCTGGAGTCCACAGCTAATCTGTCTCTGCTGTTGTGCTCTCGCGCATTCTCCTTCTAAGACCGCTTCCATCATAGTTTATACAGTCAAAAAGTTTCATGCGGCTGTAATTGCTTAACCGCTTTATACTAGATCTTCGTTAACAAAAGGCATTGCATAATCTTTCAGGTATCTAGTTTCGATACAACCTCCGTAATCATGCAACCAGTACGCCAGGTAGACCGGTCAACACGCACGTGTTAATATGTCTCATTGCAAATAATGCAGTTACGTGAGCACGCAACCGTAGCCATAGAAGGAAGGAGGAAAAGAAGACGAAACAGTGGCTTATCCCAGGAATCTTCGCAGACAATGGGGATGGGGATCAGCATTTTTATTAGTTAATTTAATGGCATCGTGCATTAAATGCTTATAACGCCGCATTGCTTTAAAATTCAAAGTTAGCGTTGAAGAATTTAGCCTTCAATCGCCAGAAATCTACGAGTGTATCGAAGCGGTTATGCAGCCGTCGTGAATGAGTATGAGTACCCTGTTTTTCTCATGTTCCCAGGGAGGTCGCACTTCCCGTCACTTTACCAACCAAAGCCCTCAGTAAGCGGATGATCCGTCATTGAGTTGAAGGTAATTCAGTAAGACAGGCAGGCTCCAAGCCAAGCTTCCATCCTCGAGAATTCTTCCTTCTCCCATAGAAGGAATTTGAGAGCCATCATATTAAGTGAGTCTCTTCGCATGATACTGGTAGTCAGGAGGCCTTCAACTTTTGATAGGGTACGGAATACAGTGAATCAAGTCAGTGAATCGTTCCGTTGGAAGGTCATCAGTCGGTACGTGAAAGAGGCCGTTACAGTGAGCGTCCGTTCGAGCGGAGCATAGCGTAACAATCGTCCCTCAAGAATCTTCATCGAATTAGGGAATTTGCCCCTCAGAACATAGGTAAATGGATCGATCTGAGAATGGTTTATTAATCGCATAAAGGGAAGAAGGGCCTCAATAAACCTGTCTTGTTTCCTTAATTCTCTTATGAGTATAATCATCACTGCAGAAGGGAGCGAAGCGAGGAATGATCGAAAACTTTCTCTTTACCAAAACAAATGACAGTTGGTGTTCAGAATAATCGCTCTAAAGCTTCAGTTGAATATTAAGACAGCTCGCAGATGACGAATCATTGGGATTCCCATCTTTTGTTGTTGAACGCACCATTTATTTGCCAGAACCGTTTTCCATCGACCAATCGATCTTGAACGTCCAACGGCGAAAGGAATGTCATTAAGCAGTCGCTTCCCTCGCGTTCTGAGCCCGCCTCATGGCCGAATAGGCACCAATGTTATCCAGATGCAAGTTACGGCCGATGAGTAGTCAAAATAGAAGCCAGCTACGTATGTTGAAGTGAGTTAAGGATAATCAAAGGGAGCGAGAAGAAGGGAGAACGGTTGTAAGGATATCGTTTAACCCGTTACCTAATTTTCAGACATTAGCCTGTGAAGAGTGAACGATATTTAACAAGAACATTATCTATCAGAAAAGGCCATCGCGCCTCTGAACAAGGTTACAATGCTCAGTAGCCGTGAAGATGGCATATATGCTACGCAAGAAATGAAAGTATACTCTAACGAATGTTTTAAAACGCAGGTGGGCAAAGTCACGATTAATTATCAGGATAGTGGGACAGAAGTGATGCATGTTGCCTAGGTAAGTAATAATTCCTTACGTTATCTGACTAAGTGCTATCTCCTTTTCCGCCACATTCCTCTTTTCTTTCATAGCCAGATGGTCGGCACTTCATATAGAAGGAAAATCCTACTTTCGGACGTTTCTAAATCAAGAAGCCAGAAGCGACAATATGAGTTACCAGAGTGGTGATAGCTCCTTATAGTCTGGTCTTCCTTCCTGCTTCTTCCTCTTCGGTTGTTTCCGTATTGATTCTTTCGAGCATCCAGCCTCATACTCCCACTATCGCCAACGTAGCATTTAATGAGAAACCGTTCATTCAACTGCATCCTTTTCAGCTCTACTTCTCCGCGACGCATACTGGATAGGATAGCTACAAAAACTTCTTCGACAGTCACGACCTAATACAATTATTTATTACAAAATACACTCGGTCTACGCTATCATGAGTCAAATCTAAATAATCAGTCAAACATTTACATAGACCAACCACTCTGGGGAGAAGAAGAAATGGCCTGTCTATAGATCAAGCGGTGATACTGAGCACATCAGCAAGGAAGCATGACCACCATGAAGGTGACTATGGTAAATTAAGCCTGAAGAAGGCATTCAACCAGAAGCTTTGGGTGTGATACGATGAAGCGTACGTAAGTGCGATTCGTCAATTAGCTGCCAATGTGCTGCCGGCGATTTCGTTCAGACCAAATGCCACACCACCGTTAAAGCTGACAGAGAATCCATCCACTCACACGGGACTTCATGCAGAGAAACAGGCTCAATGAAGCATGAGCAAATCACGCTGTTGATTAGGTAAGGCAAAATACAGTTAAACCTATTCCTCCGTTGCCTCCGTCGGCTCCTCCAAACCGCTTACGGAGTACGAGGACATTGGCTGAATATTTACAAATTATA
>117
CTTACTCTGCTTATGACTGTAATGACAATTGTTAATTAGAAAAGCTTTATGAAAATAATCTCCAGATAAAACAAAACCCGCTAGAACATATTACGATGACATCCTTGTTCATCAGGTAAAATGTCCATTTTGGTATATAGAAGACAAATATAATCATTTTCTTCTATTGCACATGATTATCCTGAGAATTTGCTTATGCCCTATTAATTAGTTCCATCGTGCCGCGACTGCAATATGGGAGAAAGTCAAGTTTTCGCAATGATGAGGTACTACCCTAAGCGATTCGTAGTAAGGACACTCCTAACATCTTTTTCGTGAGCAATGGGTATATCCGGCAAATTTCGTTTCCTAGGACTCCGGGTGCCTCAGTGTTTATGTTGAATGCCCGGCGAACCGGAGGCAGGAAGACAAACAGAGCTCTCTTCATCATTTCAAGCTATGTAAATATTGCTAACAGGTATCGTTGGCAGCGAGGAAGCACTTGAGTGAAGTGATTAGCACGAAAACTCTTTCGTCAAAAGTTATAAGGAAGCTAGTTCAAACCGCAACGTTTCAAGCAGCCTACAGATTAGAGTTGACGTGAAACAGGTCTGAAACCGTATAGATTTGAATGACTTCCCCAATTATTGGAAAGGGTCCTTACTAATTGACTAGCAAACTCGAAGATTTTCAGAGGATGTAGAATATACTGTATGAAGATAGAAAATTACTAAAGACGGTTATGATAGAGGAAGTGACGAATACGTTATATGAGGGAGGGCTGTGTTTTATTACAAATCCGTAGTACTGTGCCTACCAATTCCTAGGCAGGTCATTGGCAACAGTGGCATGCAGCGGAGAAAGGACGTTGTAATGTCCGCTCCCACAGCAGTTCTAGGGACATGAGTACAGTCATAGATGGTCCTTGGGGTGGTACAATTCGCCTGCAAATATGTAATCGGTAGCAACTGGAAATCATTCAACACCGCACTATCGAAGTTCACCAGCCAGCCGCAGCACTTCCGTTCCTGCATACGACGTGTCTGCGGCGGGCGCCCATATTCTCCTATGAGCAACGTGTCGCAGAGCCAAGCCACTCGATAATTTGATACATAATGACTGATAATAATAATATTAAAAATTCCTGTGTAACTAATTACTACTGGTTTCTTATCATAAGAATCATTGCAGCACATCAAACAAACTTATTACAAGTGACAGTTAAGCAGTTAATTTTATCACCTCTAAAATATATCAGCATCTAACGCATGCATAACCATGACAAAATGGAGAGTTTATGACCTAAAACCATGGAAAGAAGACTTAAAGATTTATCGCACTTGCTCAAATGCTGCATTGATACATATTTTGACCTGAATTATTTCGCTTGAATTTGAATCAATTCCTCCAAACGCAAGAACAGTAACATTTATTGGTTCAAAACACAATACCAGATTATAGGATATGACATTTGGTAGACAATAATGTTATTGAAAATGGAAAATGATTGGGCTTAATGGCTTGGGCGACATTCTCGCAATACGATAGAAAAACAAGGCGATTTAGAAAAGGTCGAGGCAAGGCTACTCTTATTTCATGTACATTGAAGAAGGACATGAGTGAGTATTAAATGAAAGTATGTTAAACATTGGTATAAAAGTTAGTCAGACTTGCACAAAGAAAATTGTTAGCTTCATATTTAACGAATCATCTATTATTAAATCAGAAAGACGATGGAGTGCTACATCGGTAAAGATTGAATTATTACATGCCTTAGCTAATCTATGAAGGCGCGTATATAACTGCTGTAATCTCTCTTGGCATACAAATAAACAATCCAATGGGTGACGATGGTATTCGCCAACATGATTCGACTCTTTATTTGATGAAGCCGGAGAATACTGTGATATTTAATTAAAGGACCATTACTCCATAAGCAAATTGTCATGTCCCATGATACAATAGTGACAATAAAGGCTAATTCCTGAAGATATTAAAGGAGCGTTAAAAACTAGATAAGCCTAAAATATCATTCGACAGAAGAGTTAGTTGACTATACAGCCACCTTGCCCAAACGACACTTTTTAAATCGGTTATCACATTCAAACATTAATTTTTATGATAAACAATTCCATCCAATTGATTTAATGATCAATACAACATTTGAAAGATCAAGCAAGTAAATATATTTGGCGTTATGCAGCTGACGCCAGCCCAAAATAACACAAATGCCTATGGCTGCCTGTTGGATATCAGAGCCTGAGCTAAGAAAAGCAGCATCTACCTCCAATAAACCCAATACATACAATGCCAATTATAGATGAAGACTTCAGTAATGTGGAATTGATTCAAATAATAATCAAAATGTATTTCATGGTAAAGAAAATAGTTAGAGAAAACGAAGAAAAACCGACTTTAGAAATATCAACAGCAGACTCAAAACATGACGAAAAACCATATTTCATGCGTTCAGTCTTAAAAGGCAATTGGGGGTGATGGTAAACAAAGGCTGAATTGAGTCTATAGAACTTCCATTATTCTCCTAACATAATAATCGCCCAAAATAAACCAATACTCAGCTTTACAATAACTAACATCGCAGAACGTTATTTCATACAACGTTCTGCGGCAGACTCACAAACGATTACTCCATAACAGGACAGCAGGCCACTCAATATCATGCAGTTGATGTATCAACTAAGTTCAGCAACAGGATACTTCTTCCAGGCTTCCAGCAACGAACGTTTCTTCCTTCGTTCAATTCAGATCTGCAGCATCCTGAAGCAGGCAATATGCTCAACCTGGCTATGCATCAGGCTTTTGTTTCTTCCGCCTCCGGATTAGGAACAGTTTTCTGCTCTTTAGATCTCCTTCACGAGGTGTTGCCGTTCCACCTTCTGATATTCCCCCTCCCGGCGTAACCCCAAAGGCCCTTTTCCGTAACGGACTGAGTTCAGAACAAAGTACGCGTCGCCGGAAACGCCCACCATTCATAGACGGTTTTTACCCCGATGGTCTTCAACGAGATGCCACCATGCCTCATCACTGTTGGAAAACAGCCACAAAGCCAGCCCCGAATATCTCTGAGTGCAATGGATGATGTTTGCAGGCAGACTGGGCTGGGGGCAGAATAAAGGTGCGTCTATTCACCAATAATTCATGCTGTTTCCGGCCCGACAGATTGGTAATTTATGGTCCTTAGTTGTTCATCATCATTCTGAATGCTAAGTGCAAGCCTCACAATATGTTAAATGCAGCTGTTTTTGACGGTCTTCCGCGTTACCCGCGCAGCGTTAACGGTGATGTGTCCGTGTGAACCATCACCTAAACAAAGAATTCCAAGCAGCACTACCAACAACCGGTATTGCTGCGCAGCACCAATACCAACTATCTGCAGCATGTGCACTTAAGCACATCACGGCTGTACCCAGACAACTGAGTGACTGTGAGGTGCCCTGACTGTCCGTTTGTAAAGCACCCAATACCCTGTGTGCTGGTTCCTTTAACTGTGATAACCTCTGTGACTGCTTCATGTTCTCGATACCTGACTCCAGCCAGAACTGTTCATCCTTAAACCACTTGTGTGGGCATGAGCACCCGCGGCCCCTGTTGAACCGCTCAGACTGTGAGCATAATGAGCTCCCCCGTGTTATTCGTCGATTTGGTGCTGTAATCGAAACTGCCTGTTGTTTTCGTCCCGTAATCAAACGACGATGCTTTTCGTCCCCAAATGCGCGTTCTCGGATGCACTGGCACTGTGGGTGTGCGACTTACCTCCAATGCTTCCGGGTACAATGTTTAAGCAACAGGAAAGCCTGGCCATTCCCTTGATTGCTACTGAGCATATCAGGAAGGCCACACCCGATGGATACGCGACAGATTTGGGTAGGCTGATTTGTCATAAACGCCTGCGGCTGCATCACGTAACGAGACGGAACGAGATATCTGATGGCCACGGATCGGCGCACCTGCCCGGACCCCGAATTCTCACCGGCCCAAGGTTCAAGAACATCTGCAACGGAATTTTTGCCCACGATATCCCTGCCAACCTGGGGTCAGTTCAGGTCAGGCTGGCGGCAGTGAGTTTTCCCAAAGTACGGTAATTATTTTCGCCGTGGAAAGCCCTGCAGCGCCGTCAGTCGCATTCTTCGGTTGTTACCCGCAAGCTGTTAGTCATGGTGGTAGCAAAATCTGGATCATTCCCGGCTGCGGCCAGTTCATTCAGCGTATTCAGTGCGTTAGACCGCGTCGATAACATCGCAATCGCGGCCAGTACAAAGCGGTGTTCGCAATCTGGGTTTGTTCCCTGAGCGCGGTTGGTGCTGTTGGCGTTCCGGTCAGTGCCGGACTGTCCAGTGGGCTTTTCTGTTCGTTCTCATCCATTACCTATCTAACCGCCTTTGGCTATTCGCAGCAGCGTTCAGACGTGCTGTTATGCACTGCTGAGCATTATCCCTATCGCGCGGTCTTGTTCGCAGCCAAGGGAAGGAAGCTATATCTTCTGCACGTTTGCCCGAAATTTGCACGTATTGCCGCCGCTTCTGCCGCACTTTTGCTGCGATGCTCATACTCCGCACTTCCCGCAACGGGTCTCCCTTCGTGTGATGCCGTTGACGCACTCCCGCCGCCTGTTTTGCGTCTGCCGAGCAGAGGCTGGCGTTCCGCTGCTGTTCAGATGACCTGGCATTCGTCTCGGCACGTTTTGCCCCTGGCAGAATTTCTGCCCGTTGCCGAGGAAGCTGCAATGAAGCTACTTGATGATGCGTTCGTTCTGTATGATTTGCTGCCTCTTTGAGGCCCGCATCTCTTTGAAGTGGCGGCCCTCTGACGCTTTCGTCCGCGGTGGAGGCAGACGTGGCGGCTGATTGTTGTGACCTGCAGCATTCGTTTCTGACGTTTCGCCGGACGCTACTGGGCCCCCGTTTTTGAGGATCTGCGGCTGCGGCATTTTCGCTTCAGTGGCCTTTGCTGATGCTTCTGCCGGAGGAATTCCTGAGCTGACGGATGCAGCCTGTCCGGCGGACGTGCTGGCGGCGCGTGCAGTGAGTCAGTTGCATGAGATCACAAGGGGCCGCGACAGGCAAGCTGCATGGCATCGCCGGCTGATTTCTTCGTCTGCCGTACTCTCTGTGCCCACGACGCGTTAACCGGCGCCTCTTCCACCATCAGTTCAAGACGACGCAGCACCTCCGGCCGGGCATCATCCTCCTTCATGGCACAGAAAATCATTCAGCGTCCCCGGTTGAATCTTCATACACGGTACTGTTAGCGGCGTGCGATATCCGGAAAACCGTCAACCTGCAGAGTACTGTACTGACTCGTACCACATCCGGTAACGCCCGGCTTCATCGGATTCTGTGGGTGACAGCGTGTTCACCACCACCGTGGTGCTGTTACGTCTGGCTGTTCAGCTGAATGGTGCAGTTCTGTACCGGTTTTCCTGTGCCGTCTTTCAGACTCCTGAAATCTTTACTGCCATATTCGCCAGCAAAAGCCCACCGGTTCCGGCGGGCTGTCAGACACTTTACTGGCTACAGCAAGATTATAACCGAACCCAACGATGAATCCGTCAGTACGCCGCCGATCCGGATGCTCAGATAACAGCAATACTACGGACGCTGCCGGCTTAATCGTATACGCTGCACTCCACGCCACTAGTATCCGCATGCATTTCGTCCCTGGCAGTGGTCGTCTCGTTGCCTCCAGGGAGTGATTTCCGTCTTACCGTAATGCGTACATTAGGACCTCAGAGACTGTACTCGCTCCGGCCATGGCTTACGCTCTGCTTACTGATTGGTAAAACCGGTTAGCCATCACGCTACAGGACGTCCACGCAGGCTCTCATAGTGAAACGTATCCTCCCCGGTCATCACTGCTGCTCTTTTCGACGTGAAGCGACCCCGACGGGAGCCATCGCCCACACTGTCCTTCTATAAAACGGTATTGCACGTTAATCCCTTTCAGATGACTCACACCGGTATCCCGCGACACGACGACTTACCCGGTTCATTAAAATAGCCCACCGTAAACGTACGTTCGTCCTTCGCACGGTAGGAGTACTGTCTACCGCAAGTGCGTAAAGGACCGAATTACACATTACGCATCGTTCACTCATGTTTTATAATAAACGCCCGTTCCCGGACGACCTGACACCACTCAGACCACGCTGGTTGCCCAGCGCCTGTTCCTTAATCACCATAACCTGCACATCATGGCAAACGTATACGGCGGAATATCTGCCCGAATGCCGTGTAACGTAAGCGTGAACGTCAGGATTCACGTTTCCCGACCTCCGACCCGTAGACAATACGGGAGACACCTGTACCGCCTCGTTGCCCCGCCAGCCCAATGCCACCGTAGCACCGTTCATCAGTACTTTCCTCATAACACATGAATACGTTGTCCTGCCGCTGACAGTCACGCTTACTTCCGTAACGTCGAAAATTCACTAAGAGCGCCTGGCGATTGAAGGATGGTCATCGGTCACGTAGACAGTACGCTGACGGCTCAGTCCACACCTGCTTTCACGCTGGGGCGGAAAAGCAGCCGCGCCCTTTACAATGTCCCCCGACGATTTTTCCGCCTCAGCGTACCGTTTATCGTACAGTTTTCAGCTATCGTCTACATGATAGCCTCGTTGGAGTTCGCATTCATTAGATATATCGCATTTTATGGGGTTCCTTTCCGTCCTGTTAAGGAAAGGCCTGAGGATTGCCGCATGGATGGTGGGGGCCGTCAGGCGGGCTTCAGGAACACGTCGTTCATGAATATCGTTGCCCTGCGCCACAAACATCGCGTTTCATTCCCGTTTGCCGGGTCAATAAAGGGATACGAGATTGGCGGCATACAGAAACTGGCTCAGTTTGCCTTCACCCTGTCCTCCATGCTGAGGCCAATACCGCACATAAATGTTGCCGTCCTTTGGTCTGCTCAATTTGACATCGTTGTACTTAATTCCACTTATCAACTGGCATCTCCTGCCTCTTTCGAAATTCCTCCAGTGCTGGCGTTATCCTCCGTCACTCTATTAAAGCTTTTTCCAGCAGCTCCTTGCCGAGGTATGGATTCGGTTATCTTGCCTTGAAAAATCCAGGTACCTTCCGCATCAGCCGCTCACCGACCTACTGATAAAGAATCCGATTCAACAGTGTTCACACTGCGGATATAAAATAGACATAATCATGGCCCCACGGTTTTGATATTGATACTGGCGGCTATCCAGTACCCGCCGTACCAAGATAACGCGCCGTGCTGGTTCAATGATTTGATATCCGCAATCTTAGTTCCTAGAGAACCAGAACTCAACCTGTACCGTCGGGTCATAACGGCAAGATGCGGGGTCTAGTTATCTGAAAATAGCCGCGTGAGTCAGCTCAATCCGGGACCGTGCTGCCCGGTGCGGCAAGTGCGGAACGATACCGACTCATCACGCCCTAGCTGCCCCACGCATTTACCGCCCGGGTAGACTGTCAGCCTGTAGTTTCCCGGCCAGTTGCGTGAAGCGGTATGTGGTTTCCGTCGTCCGGGCCGTGCTGACCAGCGCTCACTGCCGTCGGCCGTTACCTAGTTACGACGCACCAGGAAGCCGACCCCTTCACTGTGTCCCGTAAAGCCAGCACCTGATATTCCCCGGTGTCTGCATGACTTCTGCGGTTAGTGCTGCACATGGCGGCGTGACACATTCACCGTGCCTCTGTTCAGTAAAGTGCGCCCCGTTATCCGATGAGCCTCTTTTCCGTACAGGGTGCACGGCGGTGATGGCATACGTGCCGTCGTGCAATTATCACAACCGCAGCGGACAGTCGCTGGCGCAGCGTCGGCATAAGCTTCAGCTCCCCATGAGCTGTATCTTGAGCAACAAGGTCAGGAACAAGCTTTACTTCACGCCGTTTAGACGTGACACTGAACCTCCACGCCGAACTGGATTGCCACTTCCGTCAACCGAGGCTTATCAGCGCGGTACTAGAGGATGGCAGCGTACTTCACGGTCCAGCGTCAGCGTCGGGTCTGGCTGTTCCCACGAGGCACACGACCACCGGGCGTGATACCGGCATAGTCATCATCGCACTTTCAATAACATCGCCGGTAAGTGAGACCCCTTCTGCGCCGACGCTGAAATCCACGGTCTTGTTTCCAGCAGTTCTGTTTTAATCAGCCACAACACAGCCGGTGTCCTTCCGCCCCCGGCTGGTACAGCCAAAGGCATCCATCTTCGTAACAGTACGACCGTAACGGGCAATGGCCTGCGTATCTTCAACAAGCTCTGTCTCGCCGTCTCCCAGCCGTTCGGTAATCCAGTTCCTCGCCTCTAACCGGTAAGGCGGTCCTTCAGGGCGCTGAAGTGCTCGAACGCGCTAGATGATCGTAAGCATACACATTACTGCGGTTATAGTCACGTCTTAACGTCGGTCCTGCACGAGGACCGTCAGCGTCTGCCGTTCCATACCGGCATACGATATAAGCGCCCCTCATGAGCAGAAGGGGCATGTAATCTAGTAGGCACATCCGCGTAGATCTTGCTAGACTGGGGCATTACAGGTACTGCGCGTAGCCGTGCTAAGGCCGTTCCCGGCACTGACTGTCGGCAGTACTGGCTATCATCACATACAGCGCCGGTTATTATCCACATCCGCGCAGGATCGTTCCCCATGCTGCGCCGGCTTACGCGTACAGACAGGCCATGTTGTTGCTGTATGCCGGTTTTAAACGTTCCGTCCCAGATACGCTGTATTACGCCGGTGTCTGCGGGTTATAGTTCGACGGCAGGCAGAATACCGCCGCGCAGATGATAATACGGCTCACCTGCTGGCTGCCGAACTGCTCCGAGTCTCACCCTGCACGACCAGTGCCGTGTTCGGGTAGCACTGTTGCTACAGCCGATACTTCAGTGTATGACGACCAGAGCGTTTGTTCTGCAGCTGGTCTGTGGTGCTGTCCGGCGTCATCCTGCGCATCCGAATATTAAACGGGCGCGCTCGACCAGGTCACCCATCACACGAACGCGGACTCTGCACTATGGTTTCGGGTTAATGGTATGTCTTTTCCGTTACCCATAGGCCGTTACGTTGTATCTGAACTTAAGGGACCGACTTCCCTCACGATTCCTGTCAGCTTTGAGGTGGTTCCACCAGTGCCTGTACATCACGAAGGTAAAGGCGCATAGACGGTCGATGTTTGCAGACGTAATGGTGCTGATCGGGCGTCATATTTCACTTCCGTACCCCAGCACCGTCTGGAGCCGGAGGATCAAACCCTCCGGCTTATTCATCTAGCTCACCAGCCCGGAACACCAAGCGTGACACCGGATATGTTGGTATTCCCCTCAGTGTCCAGCACCGGCGTACTTTCAGCAGCACGTTTAAGCCATCCACCGGACCTTCAATCGGCCTTCCTGATGAGCACATCGATCACACTCAGCAACTGCGGTGACTTCAGGTTTAGTCGCCTTCGAGGGTGCTAGGTCACTGCTTCCTTTACCCATTCCTCACCCCATAAATAGACAAAACCGCCGCAGGCGGTTCCACATAAAACATTTTGCATCAGCGACCAATACAATAGTACCACGTCCCTTCGTCTGCCGTGCTCCTGATCTCCTGAAACCACGCGTGACCGCACGGGCATTTCCCCGTACAGAACAGGCAGAACATTGCCTGGGCAACCATGTTATCCAGTGAGGAGAAGCTAGGTGTTCTGCTTACCACGTTATCTAGAGTGTCTGTGACCGGGGGTTCTGGCTTTCGGTGCCAGCATCTGCGCCACACCACCGAGCACCATACTGGCACCCAGAGAAATGAGGATGCCGGTCATACCACCGGCCCAATGGCTGCCCCCATGCTGCATAGCTCCTGAGGCGGTACGAAACGTACGGCAATGAGGCAGCCCGCGACAATCTGGAATACGCCATGACTTGGCCCCGGCGACTCTGGGAACAATATGAATTACAGCGCCATCAGGCAGAGTCGCCCGTAACTGCGCCGTTACCGGACGTGCTGACGTCCCGCCCGGCATTGGGTCCTGATACCAGCCGTCGCTCAGTAGTTTCTGACGAACGCCGGGAGCTGTGTGCCAGTGCCGGCTTAGATGCCCCCGTTTAGCACGAAGGGTATAATGTGTGAGACCAAAGCGGATGCGTGTAAATTACGATCCTTCATGCTCGTAATCAGGGTCGTGCGTGCGGAGGCGTCGTGAGAGAGGTTAGTTCTTCGTTTGGTCATCAGTCGATGAGCTGGGAAGTCGGCGTCTCGCAGCATGCTCGCCGTCTCATGGCAGTTACAGT
>118
CATGGTTATACTCTAGCTTAGAGGATCAGGATCATGACCTGCCGCCGGTCAGCACAGCCGGCGCGCCCAGCCGGGAAGCGTGGCTGACAGGGACATGAAAATGAGGCGACCCGTAGCGCAGCCGGATGAGATTCTGGATACGTCTGAACTGGTCACGCGGTCGTGGCACTGGTGAAGCTGCATACTGATGCACTTCACGCCACGCGGGATGAATCTGTGGCATTTGTGCTGCCGGGACGGCGTTTCGTGTCTCTGCCGGTGTGGCAGCCGAAATGGACAGAGCGCGGCCTGGCCACAGTCGACCGACTTAATAACGGGAGGCGCTGTGTAGGCTCTTCGATACCTCCTGTTCGATGCTGCCATTGCCCGCCGATGATGAAACGATACGCGGGTACATGGGAACTTCACCACCATTACATCCGTGAGCAGTCAGGTGCGGTATACCCCGTGGTTTTGATGACCCTGAAAATATCAGCTATGCCGGACAGGGCGTGCGCGTTGAAGGCTCCATCCCGTTCATATTTTGTCCGGACTGATGAGGTGCGGCATGCGGCGTGGAGACACGCTGACCATCGGTGGGAAAATTTCTGGGATCGGGTTTGCAGCCGGATGATGGCGGAAGTTGTCATCCTGGCTTGGACGGGGCGTACGCCTGCCGTTAACCGTCGCCCCTTCAGGAAGGGATGTATGGCCATAAAGTCTTGAGCAGGCCGTTGACATCCTCAGGCTTACTAAACGGCGGTGCCTGGTGCACCGGAGCAATGAGGCGATTAACCGCGTTGCTTCATCCGCGATATCGCAGTCGGCGTCACAGGTTGCCCGTGTCAAGACAAAGGTACGCCGGAAACTGGTACTTAAAGGAAGGGCCATAGAGCGGGAAGGGCCGGTCAAATCGCATCAGAATCAAAGTTAACCGGGGGATTTGCCCGTAATCAAGGCTGGGTAATGCGCCGGGTCCTTTCGCACCGCAGGCGTCGTAAAGGGGCAGCGTTCATCCCTGAAAGGTGGCGGCAGCGTGCTTGTGGTGGTAGTACGTCGTATCCCGGCTAGGTTTATTCAGCACTGAAAAAGCTCCATTAGCATGTCATTGCAGCGTGTGGCTGGCAGAAAAACCCGTTACCCCATTGATGTGGTACCAAATCCCGATGGCGGTGCCCAACCACGGGTTTAAACCCAAAGTCATTTGAGCGGTACATAACCCGTGAACGTCTTCCGAAAGAGCTGGCTATGCGCTGCAGCATCAACTGAGGATGGTAATAAAGCGATGAAACATACTGAACTCCGTGCAGCCGTGACGGATGCACTGGAGAAGCATGACAAGGGCGACGTTTTTACTGTTGACGGAGTTCTTGAGGAGCCCGGATTTTCCGGCAGTTGCCGTTTATCTCACCGGCTGAATACACGGGCGAAGAGCTGGACAGGGATACCTGAAGCGAGCTGCATATCGAAGTTTTCCTGCCCTTATCAGGTGCCGGATTCAGAGCTGGATGCGTGGATGGAGTCCCGGGATTTATCCGGTAGTCAGGCTTATCCGGCAGGGGTCAGATTTGATCACCAGTATCTGTGAGGGGTAGTACTACCGGCGCGACGATGATGCGGTGAGTCGTGGAGTTCAGCCGATCGTACTGTCATAGCCTATGAAATGTGAGGACGCTATGCTGTACCAAATCCTACAATGCCGGAGTCGAAGCTGCCGGACCAGCGTGGGTTGTATAAGGGGAGCGGTACCCTTACGAATCCGCTTTCAGACGTTGACTGGTCGCGTCTGGCCAAAAGTTACGCTATAACTGCCCGGCGAACGGGTCCTATGACGACAGCTATCTCGATGATGAAGATGCAGACTGGACTGCTGACGGGCAGGGGCAGAAATCTGCCGATACCCAGCTTCACGCCTGGCGTCGATGCCCGGGAGAGCAGCAGGGCAGGACAGGCGGTGGCGTGGTTTAATGAAGGCGATATGTCGCGTTGCTATATAAAATCCGCTTCCCGAACGGCACGTCGATGTTCCGTGGCTGGGTCAGCGAATATCGGTAAGGGGCGACGGTGAAGGAAGTGATCAGCACGTGAGAAAGTCACCAATGTGGGAATAA
>119
ATAATCTGGCGGCGGTATCGCGCGGGTTTTCGCTATTTATGAAAATTTCCGTTGAAGGCGTTCCGTTCTTCTTCGTCATAACTTAATGTTTTTATTTAAATGACAAATAGCGGGGAAGGAAACTAACGACAAGGGTGGATGAAAGCGAGCTTTGGCCTCTGTCGTTCCTTTCTAGTTTTTGTCCGTGGAATGGAACAATGGAAGTTAACAAAGCAGCTGGCTGACATTTTCGGTGCGAGTACGTACCATTCAGAACTGGCAGGAACAGGGATTGCCGTTCTGCGAGGCATGTGGCAGGGTAATGAGGTGCTGTTGACTCTGCACGTTAGGTAAAATGATCGAGCCGAAGGGCTGCTGAAATTGGAACCAACAGCTGCCGCTGGAGATCGAAGAACTGCGGCAGCTCATGAGGCAGATCTCCAGCCGCAGGAGTAAATTATGAGTACGAACGCCATCGACTTACGCGTGCCCGATGACGGCACAGGAATGACAGAATGCCAGACTCCCCTGAAATGGTGGAAGCGCATTCGGTACTTTCGTCATGTTATGGTCACAATCGCAGGTGAAATTCAGTATTTGACCTACGAACGCTCCGCCGTGCTTGCAGCGGCGTTCCGACGCGCGACAAATGGAAATGAGGTTGATTTCCTGAAACGCTATCATCAAAGCCATGAACAAAGCAGCCGCGCTGGATGACCGATACCGGGGTTGAGGTCGAATATGACTCCGAACAGTCAGATTATAAATAGCGGCATTTTTGTCCGCGACGCATGTCCGCTCTCATGTTCAGGCCGGAGCCACAGAAGCCGTTGAATGGGCCGGCTAATTACTATCTCGAAAGAATCCGCATACCAGGAAAGGCGCTGGGGAAACATGCCTTTCAGCGGGCCATCATGAATGCGATGGCAGCGACTACAATGAGCGTGGGTGAATCTGTGAAGTCTGCCCTGTCTTTAGTGGGTTATTCCCAAAACACGATCGGTGCTGGTGTTATGCCTACTTTATAGAGCATAAGCAGCGCAAAGAGCCCCTTATCTGGGTCCCGACGGATGTGATGCCCCCAAACTTTATGAAAACCCACGTTGGCTCACGACTATTCGTGACTTCCTGCTGCTGGGCCGCTGGCCCCGTGGTATGGCAAAGCACCGGGATAACACGCTCACCATGAAGCGTTCACTAATGGTGAACCTGTCGTGGGGGCTCTGGATCCGTAAAGCGGCAAAACTACCCGTGAAAGTGGGGTGTGATGTGGCGGGTTATGATGAACTTGCTGCTTTTGATGATGATATTGAACAGGAAGGCTCTCCAACGTTTCCTGGGTACCGGGTTGAAGGCTCGGTCTGGCCAAAGTCCATCCGTGCATCTAGCCACAAAGTAGAGGCACCTGTCGTCAGATTGTTAGCGGAGCAGCCAGTGAATCCGGATTTATGCGTTTCATGTTGCCTGCCCATGCGCATTGGGAGAGGAGCAGTATCTTAAATTTGGGGACAAAGACGCATAGCGTCCAACATGGACGGATGACCCCTCCAGCGTGTTTTATCTCTGCGAGCATAATGCCTGCGCGTCATCCGCCAGCAGGAGCTGATTTACACTATGATGCCCGTTATCTGTGATCGAAAGACCGGGATCTGGACTAGTCAATGGCATTCTCTGGTTCGTCGTCATCCGGTACAAGAGATTACGCTCCAGTGACAGTGTGTACTCTTTCACATCTGGACAGCGTACAGCCCGTTCACCACCTGGGTGCGCATTGTCAAAGACTGGAGCAAACGAAGGGGATACGGGGAAAACGCGTAAACCTTCGTAAACAGATCCGTGAGATTCCCGAGGAGAAAATTGGCGAACGTCCGGATGCTGAAGTGATGGCAGAGCGGAAAGAGGCAGTACGTGCGCCGCCCCGTTCCTGATTGGCCGTAGCTGGACCCCGGTATCGACTCCCAGCTGTGACGCTACGAAATGCGCGTATGGATGGGGCCAATGATAGGAAAGCTGGCTACTGATGAATTGTAAGCAGATTATTGGGCCGCCACGACGATGAACAGACGCTGCTGCGTGGATGGGCCATCAATAAAGCTAGCCGGAATCTGTAAGAAATGTCGATATCCCGTATGCTGGGATACTGGCGGGATTGATAATACGAACCATTGTGACTGAACCCCGACAAACATGGGCTGTTCCTGGTAATCCCCATTTAAAGGGCAGCGTCCACGGAAAGCCTGTAGGCCAGCATGCCACGTAAGCGAATAAAAACGGGGTTTACCTTACCAAATCGGTACCGGATACCGCGGGAAGAGCAGATTTATAACCGCTTCACTGACGCCCGCTGAAAGGGGATGAACCGGCTTCCGGTGCCGTTGCTTCCCAAATAACCGATATTTTATTGACCGAAGGCCGAGCATAGCTGACTGCTGAAAGCAGGTCGAAAATGGGTGATGGCAGGAAAAATACTGTGGACAGCAAAAGCGACTAATGAGGCACTCGACTGCTTCGTTATGCGCTGGCGGCGCCTGCGCATCAGTATTCCGCTGGCAGCTGGATCTCAGTGCTGCTGGCGAGCCTGCAGCAGGAAGAGGATGGTGCAGCATGGATAAAGAGAAAACACGGGCAGATTACGCCGGTGCCTTATCCGGAGAGGATGAATGACGCGACAGGAAGAACTTGCCTGCCCGTGCGGCACTGCATGACCTGATGACAGGTAAACGGGGTGGCAACAGTACAGAAGACGGACGAAGGGTGGAGTTAACGACCACTCTATTCCACTTTAACAGAGGCTGGCATATTAGATGGAAGTGCAGACCGGCAATCCGACAAGAGGCACGGGGGATCCTGCAGGATTTTATGTATGCGAACGCCCACCATTCCCAGCGCCTTCTACGCCGTACGGCATGGACATCGCTTGCTAGAATATGCAGGGTTGACAGGCGGTGGCAGCGGATTTGGAGGGAAGTCTGCGGTCGTGGAATCCCACCGAGTGAAAGTGCCATGCAGCCGTGTTGTTCAGACTTTACCCGTGGCAATCCCGCAGACACGATCTGTATCTACAGATAACGGGCTATGCCCGCCAACGCCATCCAGCTGCATGCCGATCATATCGTCGGGTCTTTTTCCGGCTCAGTCATCGCCCAAGCTGGCGCTATTGGGCATCGGGGGAGGAGAGAGGAAGGTAACGCCCGTGCCTTTCCGCGAGTGCAAACGCGGCATGGAAAGGAGTTTGCCGAGGATGACTGCTGCCTGCATTGACGTTGAGCGAAAACGCACGTTACCATGATGATTCGGGAAGGTGTGGCCATGCACCGGCTTTAACGGTAGACTGTTCGTTCAGGCCTGGGGAGTCAGTTCGTCTAGGTTTGCACCGGTCCGTCGGATGGTCAGCCGAAGGCATCAGCAACCCATGACAATACCGGCGACATAGCACGCCGTGGCCGTCCGCTTGTGCTCAGATTAATGACAGCAGATCAGGCGTAGGGGGTGGGGGATATTACGTCAGCGAGGACGGGTATCCTGGCTGGATGCCGCAGAAATGGACATGGATACCCCGTGAGTACCCGGCGGGCGCGCCTCGTTCATTCACGTTTTGAATACGCGTGGAGGACGGCAGACCGGCACTGTGAGGCAAAATGTTTACAGCGTGATGGAGCAGATGAAGATGCTCACGCCTGCAGAACACGCATGATGCAGAGCGCCATGTGAAGGGGTTGTATCCCGCCACCATTGAGAGTGAGCTGGATACGCATAGTCAGCGATGGAATTTTATTCTGGCTAGAACAGTCAGGGGAGCAGCGGGAAAGGCTGACCAGCTGGATTAGTGAATTGCGTATTCACGCAGCGTACGCCCCCGGTCTCGGGCTCGGCTGGGAGGCGGCAAAGTACTGCAGCTGATGCCGCTGACTCGACATCACTGCAGACGGGCTGAGGATACGGATAACGGCTACTCTCCGTGTTTGAGCAGAGTCACTGCTGCGGTATATCATGCCGGGCGGCTGGGTGTTCTCGTATGAGCAGCTGTTCCCGGGAATTACGCCCAGATGAGCTCCACGGCACGGGCCAGTGCGAACCCGAGTCGTGGGGTCTATTTATCTAGGGACCAAATTCGTCGCATCCCGTCAGGCGAGCCAGATGTTTCTGTGTGCTGGCCTGGAAGAGGCCAGCCATCGTTCGCCGTGACGTTACCTTCGACCCTAGCTTCAGTTTAGGAAGCCCGCAGTGCCTGGGGAACCCAATGGATAGGCTCCGGTCGTATGATGGCCATCGATGGTCTGGGGACAGAAGAGTTCAGGAAGCGGTGATGCTGATAGAAGCTCGGACTAGTATCTACGAGAAAGGATTAGGCAAACGCGGTACGACTATCAGGAAATTTTGCCCAGCATTAGTCGAAACGTTGAGCGCCGTGCAGCCGGTCTTAAACCGCCGCCTGGCGGCTTGCAGCATTTGAATCCGGCTGCGCCTCCTAATCAAGGACAGAGGAGAGAAGAGTGACAGCAGAGCTGCGTAATCTCCGCATATTGCCAGCATGGCCTTTAATGAGCCTGATCATGCTGAGCCGACTGCCGACGGGTTTTCTTTGTGCGCCTTGCAGGCCACTTGGGGATGATCGAAGCCTGACGATGCGGTGTCCGGGCGACAGCCTGACTGCCCAGGAGGCATAGCGCGACGGGCATTATCCGGGTGATGATGACGGACTGACGCCGACAGGCCCGCAGTTATCAGTGTAACGAACGGCATCTGCCGTGCTGCATGTCCGGCACGGGTCCCGGACGCGGGCGCTGCAGCCGTACTGGGGATGACGGTTACAACGGCATTATCACCGTCTGCAACAGGCTGCCAGCGATCGATGGTGACGGCATTCTGCTCGGATATGGACACGCCCGGCGGGATGGTGGCGGGGCATTTGACTGGTGATGCATGACATCATGCCCGTGTGGATTGGCACCAAACCCATTAGTAGAGCCTTGCCAACGACATGAACTGCAGTGCAGGTCAGTTGCCTCATGCCAGTCCCTCCGGCGTCTGGTCACCGACGCCCGGACAGGCTTCCATCGGCGTCATGATGAGCAGTAATTACGGTGCTGCGCTGGAGAACAGGGTGGAAATCACGCTGATTTACAGCGGCGGCACCATAAGTATAGTACCATCTAAAGCACAGCCATCTTCCGGATGACGTCCGGGGAGACGCAGTCTGGATGATAGGCGCGGCACAGCGACGAGCAGGCCAGATGTTTGGGCAGAAGGTGTCGGCATATAAGCTGTCCGGGCCACTATGTGCTGGATACCGAGGCTCGCAGTGTACAGCGGTCAGGAGGCCATTGATGCCGACTGGCTGAACTTGTTAACAGCACCGATGCGATCACCGTCATGCGTGATGCACTGGATGCACGTAAATCCCGTCTCTCATAGGGAGGCGAAGTAAAGAGACTCAATCAACAACTGTTTCAGCCACTGCTTCGCATAGGGACCTTTACTATGACGGTGCCAGCGACGAGGCGAGACGCCAGCGCGGCGCGGCCAAGCTTGGACGCGCAGATCACGCAGCGTTGCGGCAGAATGGAGCGCATTATGGAATTGGCTCCCAACTGTGGAGGCTCACGGACGCGGAAGAACAGAGCATGCACGCGTGCGGCAGACCCCCGGTATGACGTGGAAAACATCAGCCGCCGCATTCTGGCCGCAGAGCACCACAGAGTGACAGGCGCGCAGTACTGCGCTGAATCGTCTGACTGCAGGGGCACCGGCACCGCTGGCATGCAGGTAACCGAGCATCTGGGCTGATCCGTTAACGATTTGCTGAACACACCAGTGTAAGGGATGTTTATGACGAGCAAAGAAACCTTTACCCAGTTACCAGCCGCAGGGCAGCCAAGTGACCCGGCTCATGAACCGCAACCGCGCCCGGCCAATGCAGTGCGAAAGCGCCTGTAATACCAAGTAATGCCTGGACACCTCCAGCCGTAAGCTGGTCCGTCGCGGCCCGGCACCACCGACGGTGCTGCCGTTGGGCATTCTTGCGGTTGCTGTGTAGACCATACACAGCACCCCCTTAACGTTCTAAGTCCGGCACGTTCTAGTTTATGAGGATGTCGGCGGAGGGTGCCAGCGACGAGACGAAAACGGACCGCGTTTGCCGACGGCATCAGCATCGTTTAACTTTACCCTTCATACTAAAGGCCGCCTGTCCCTTTTTACGGGATTTTATGTCGATGTACACAACCGCCCAACTGCTGGCGGCAAATGAGCAGAAATTTAAGTTGATCCGCTGTTTCTGCGTCTCTTTTCCGTGAGGCTCCTTCACCACGAAAGTCGCTCCTCGCAAATTCGGGACTGTCAAACATGGCGCTCGGATCACGTTTCGCCGATTGTTTCCGGTGAGAGGTTATCCGTTCCCGTGGCGGCTCCACCCTCTGAATTTACGCCGGGATATGTCAAGCCGAGCGACGCATGAAGTGAATCCGCAGGTACCCTGCGTCGCCTGCCGATGAGAAGATCATACAGAAGCAAACGCTGAACCTATCTACAGCGCCGCCGTCGCATCACGCCTGCTGCAGAACATGCGGTCACGAAGAGCTGGCCATTGCTCAGGTCGACAGAGATGCAGGCAGTTTCTGCCGTGCTTAAGGGCAATACACCATGACATGCATGATTCTTCGATCCGACG
>120
ACGTCTCGTTGGGTGAAGACAAATCCCGAATGGCAACTGTAGAAGCCGACTAGGATGCAAACTAGATGGAGCTTCACGAGTACGGTGGAAACGATACTTCTTGCCTCTGTACAAAATCGGGTTAAACCCAATATTACATGACAATCCACAGCCGGGGGATTTATTTATCTGGAACTCGCTACCGGGTTTTGTTTATGGAGGTGATAAATGCACTTCCGAGTCAGAGGGAGTGGAATGGAGAACATTCAACAGTTGATCGGCATGAAAACGACTGCTGAGTGGATGATATGGCTAAGATAACATGCAGACGTAACCAATATTCGAATTGAAGACCTAGAAGACACCGGAGCCTGATGGCGGTTTTTCTTGCGTGTAATTGCGCAGACTTTGCGATGTACTTGGCCTTCAGGGATGGAACGCACGCAGCGACGTCCAAGAAGCCTTGAAAACCGTTCGTCGGGTTCCTGGAATGCAGTGTTACTCCCACCTCCGGTTAAGGATGGAAGAGAGTATGTTCTACGAATCAGCGTAAGGTTGACTTAAATCGGACCAGTAACAGGTGCTTTTGAAGAGGATCAGAATGGGAAGAAAGCGAAGTCAGCCGGGATTTACCCCTAACCTGTTATAAGAACAATGGATATTACTGCTACAGGACCCCAAGGACGGCCCGTGCTTGAGGTGAATCGCAATCATCTGAAGCTATACAGGCCAACATTGAGTTATTTCCATAGCTAAACACAAGCCTCCAACCGTAGAATCAACCCGTGATAATTCCGTTACGTTACATTCATGAAATCCCTCGGAGTCACTCTAAGGAATCAAGCAGAACACTCATAAATTATAAGCTCAAATTAAAGCAATAAGAAGTCTTCGGGTGCTCCGCGCTCCTTGGGCACCACTCCGCCAAGGATCTTCCGGCCACTGCTCAAGTGGATACGCTAGGGCAAGGCGAGCGTCATACAGTTAATCAGATCAACACTGGGCTCATTGCATTCCAATAACCATACATAACAAACCATGTCGCTGCCACTCCGCAGCATTAAAGAGGTAAGGAGATCAAGACTTAGGACCTGACGAATGACATGAAAATTTATCAAGCGCTGCAGAATCATGCCCCTTGGTTGGCTCAGACTTGCAATGAGGAACGCGGTGTCTTAGAATGGAAGGGAGTGGGGCCCTGCTGGAAATGAAGTCTATCTATCATCCGTATTGCAGTCGTCGAGGGCCAGCAATTAAAGCGGGTCAAATTGCCCTCATCCCAACAGCATGCATATTATTAGTGGCCGAAGTATCAATGGAAGTATAAATCTGTAAATGCAGAGATTCTTAGAGAAACCATAAGTGCATTATACTCGTTAGCGGTAAATTTCTTAAGGCTAATAACACTTTC
>121
AGCGCCGCCCAGGCACAATACTGAATACTAATATGAATTACAGCGCCATCAGGCAGAGTCTCAGATGTAACTGCGCGTTGGGCCCAGACTTCACTGACGTTATCGCCGCGGCATGCGTACCTGATACCAGCCGTGCTCAGTTCTTAACGAAACGGGAGGTGTGGCCAGTGCCGCTGCTTCAGCCCCGTTCACACGAAGGTCGATGCGGCATACGTTGTAAATCCCGTAAAGGCAGATGCGCCATGCCCGGTGACGCCGGAGTGTGTGCGTCTATGCGATTTGTGTATTCCTTACCTCTCTCGTTTGCCGATATTGTTCAGAAGAGCTCACTAATGCGCATAGCGATCAGCAGAGACTCGTGAGACTCGTGAGCACTGATGAACCAAACAGCACAGCAGCACAACGCCCGGCTGTGCTTAAACAACGAGCTGATACAGCCCCGTCGCCTCCAGATTATTCCGAGGTAGAATTGCTAATTCAGAGTCATCCTCACGATGAAGTCCGGCATGGATCCCGCCCGGGTAACGATACCAAGCGTGACTCGTCCGTCAGCGTTGGACAGTGGATGAAGAGTGGGATCGTCTCGCATGCATGGTACAGCTAGAGCATGACGCTCTGCACTGCGCAGCCGGTCCTCACCAGCCGAGGCATCGCGGGGCTCGGCTTCGTGGATAGCGCCCACAATGCCTCGCCCTGCATTCCTTTCTTGCCTGCATAGTCTTCCGGCGACATACGGAAACCACTCCATCAAGCTACTGGAGGACTTCGCAGGGAGTATTTCCCCTCCGGCGTGCTTACCACGAAGCCATGGCACGGCTAGGTGGACAGGGTCGGCGTGCGAGGGGAGTAAAGGTAATTCTGTCTTGTCATGGGATTTACTTAGAGAAAGTTAGGAGGAACCCGAATGGCCTCCAAAGATGCTTGGAAGGTAGAACGCTCTAAAACCAACGCTGTTGCTGCATTTATCCTTCGTGACTTACAACGTTGTAGCTGGTCATATTCATCCGCGACAGCCGCCGACCCTATAACCGCACTCGTCACCGCGATAGTCCATAGGTGCAGGTTAGGCCAGCATGATACGTCCTCAGAAAAACAGCGCCATCCGTTTCCGTGGACAGTACAAAGGAGGCACTCACCGCGCTCAGTTCCTGCACTGCTCATGCGCCGGGGCTTACACCTCCTGCTCCGGATCTGAGTAACCGTTTCCGTTGTGACGAAGTTCACCGCATCCAGAAAACGGGCGTAAAACCTTACGCTGATTACCCGTTTCCTACAACACACTCTGCTGCATATCGTCGCCATCCCGGTACATACCCGTACAGGTTAGAAACCGTCAGCGTGGGGCTAGTACTGGTGCTTTGGCCATTCAGTTCAAAGCATCTCGCTGAATGGGATACGGCTGATACTGTCGCCGCCGATCGGAGGACCGCTCTCTATTTCGTTAGCCATTAAGACTACGTTCTCCCGCAGAGACAGACTTGAATGAGTCGAGAACTAGTGCTCCGCACGGGTGCATTCATTCAGGGTTTCCTGTAATCAGTTCACCTGTTCAAACTCTGCGCCTGAACTCAACGCAGCATACGTAGCGACGACCATTTTGCTAAGTTACCTTTATCTGCCGCGAGCCTACAGCGCGGCCACCAGGACGCATTTCCCTCCGCGTGCTCTTCCGACTCTAGTACGATCTCCTTACGTGGCCTCCTCACGGGGGCGTCACGTACGTTCACGTGGCAATTCAGCCCGGCAGGCGCTCCTGAATAGCCATCATAAAGGCACCTTTCGTACAGAAGGGACCCGAAGCCACAATGGGACGGGTTCCTTTCCATAGAAGGTCTTCATCGTCTATAGAGAGCGGGACAGCGCATCTTTGAATTTCATCACGGCACCCTGCGGGCCAAGTCATACACCCTTCCAGCAGCCGCTGACGTATCTGCCCCGTTCGTGCCTCCGTCGTTGTTAATCACCACATGATCTTCTTAACTCATCGTCCCCTCATGCGCTCGCTCGTGCGTAATCACCATTAACATAACCGCCCCTTGGCATAGCCGCGCATCGGGCCGTGCCAGTGCACGACTGCGGCTGCCTGGCGACAGAAACAAATCCATGGCTCAATTGCCGGTTCCGTAGTAACGCCGTGCAGCAAAATGGAATTTCGAGCACTCCTGAATCGCTGTGATAGACATCGCGCTGCGCTAAGCACAATGGCGCTGCCGATACTCCCGACAATCCCACCATTGCCTGCTTAAGCAGAATTTCTGTCATCCTCCATGGACAAGCACGAACGAGCTGCGACAGTTCTGCTCACTGCCGTCAGCATCGCCCGCCATATTCTTCTTAATACATCAAAAAGGTCTGCTGCACTTTACCTGCGACATACTTTAACTTGGCGCTCTTCCGCTCACTCCAGCCGGACTTCAGGCCTGCCATCCAGTTCCCGAAGCTGGTCTTCAGCCAGGTCTTTTCTTGATATCGCTGACGTTATTCACGACGCCTCGATGCCATACCTGTTCCTTCAGGCGCTGTTCCTGCTTTAGACGTTCTGCCTGCCGTCAGTCATCCCCCGGCTTTTCGCATCAATGAGGCTCCGTTTTGCCGATTCATGCTGTGCGTGTCTGCCTGAGCGCGGAGTGCGAGGGAGGCGGATGCGGCCAACATAAGTACGTGCGGAGCCAATCCATCGCGTTGTTCTGGCTAGCGTCTCCTTCTTCTGCGCCTCAGGGATTTCTCAATGCGGACATCTCCGACGTGCCGCCTCCTCCAGTACCACCGCGAACTGACTCTCTAGCCTTCCACAAATCCCGGGTGCTGGCCTGATTTTTCCATGCTCCGGCATGCTTCTCCAGCGTCCGCGTTCGTTAATGAAGCGTCAGCAAGGCAGCATGGGACGTGTCTTCCTGACGATCCGCAGACACCTTCACGCTGGACTGTTGTTCCGTCAGTTTTTCAGCCGTCCTTCATAATCCTTTCACGCCGCCATCAGCGTGTTGTAATCCGCTGCAGGATTTCCGTCTTTCAGTGCCTTGTTCAGTTCTTCCTGACGGGCGGTATATTTCTCCATAAGGCGTGCAGCCGTTCCTCCACTCTTCTTGCCTCTTCGGTATTTCAGCCCGTGACGCTTCGGCGGTATCGCTCTGTAGTCCCGGATTTTGTTTCTGTTGAGTCTGCTCAGCCTTCTTTCGGGCGGCTTCAAGCGCTAAGACGGGCCTTTCACGATCATCCCATCAACGCGCCTTCATCGTCCCAAGCAACGGATAATCAGAAATCGCAGGTTCTTTAAGATCTTACTCGCATACTGCCTTAATCAGCATCTCCGCTTAGAGATATCATAGGACGACCAATATCCCATCCACACATACATTTGAATGCCCGCGTTATGTCCCGAGTCTCCAGCGCGTGCCCATGTTCTCTTTCAGGCGGCGGGTCTGTTGTCATCGACCTTTCGTTAAGCCTCGTTCTCGCAATGCCCGGCTTCATCACCGATGCAACTGAGCAACATACCGCAATCTGCACCCGCCGACACGTTATGAGTATGGATAAACAGTCGGCCCCATTTGGGTCAGCTTCCGAAGGCTTCAGCGACCTCTTTTTACCTCCACCCCATTAGAGGAGAAGGCGCCACACTCTGGGCTGATGGACCAATCCTCACCCTTACCGCGCTCTCGATTGAGTACTCCTGTCTCTTGCCTCCTTCCTCGCGTAGATCAAGATAACGTAATAGGCTCGATGCCGTGCAGTCCGCACTGATTGCCCGGAAAGGACCAGGGTAGCGTTTTGGAAGTAGGGGGTACCATCTCGAGAGCCGAGAGGACGCCAAGCGGTTAGCGCCCACCCATTAGGCATACGATGAGGTTAGAGCAACGCCTCAACATGGCATCCCGCGGAACGTCATTAGCGTGCAGCAGGATCAGCCACGGACTTTACGCCGCTGCAAGCTGCGTGGCCACGTGTCGGTGAACTGCCGGCAGCATACGCGCATGGAAGCGTTGATATATGCCCGAAGGGAAATCCCCTTTCTGTGCACGACGCTTCATGTCGCTCAGCGACTGTTCAACGACTGCCTGTTTTTCGCATCACTTTCCCTTATACCAGAATGACGCCTGACTCTGGCCATCGTCGCATGCCCATCCAACTCAAGATACTGGGCAATCTACAGCCGTTGATAAGCTACAACTCCTGCGATCCCTTCTGATACTGTCTATCAGCATTACGTCATCCTCCGTCATGTCCGCCACATGCTGGAAGCGGGGATAACTTCATAGTTCCCGTCCGTAAAAGGCACCCCGGCAAACATGCTCGTTCTGCATCAGCACATCATCTTCAGGCCTCGTCGTCAGCCTCGCGCCGGTTCAGCAGACTGAAATCGAGGCGGATGCATATCCGGATCGCTGAAAAACAGGCCGGACACGAGTACTATCAGTTAGAAAGCAGCTCCATAAGAAAGCATAGGAAATAATGGGTACTGTAAAAAGCGGTGCCAGTCGGCATACGCGTGATGACATCCCGGCAGCATCGCACAATCGCTTACCGATACCCCCGTTGCAGGGCAAAACTCAGCTACCGTGCTGACATTTCCCGCAGAAACATATGCGGGCCGGCTTCTATGTCTTTCTAGGATGGTAAGGGTACCCTCAGACAACAAATCCTACAGTTTCAGCATGGAGAATGCCTCCGATCCTAAGTAGTAAGCACTTCCTGCTCAATCTTTTAACGGTTCATTTCAGCCACCCATCTGCGTCTTCTGCATGGTTGTGATGCCTAAACGAAACGCGCCGGTTCGCTCCGTGCCTCCACAGTAAACTTCCGGAGTGCTGTCTGACTCCGCCTGTTCTGCCTGCCGTTTCATCAGGCGATGCTCAATGCGCTGCCAAGGTGACAGTTCAGAAGCGTGACGACGGTCACCCGTTATGTTCAAATGATTCGGTTTTCAGGAAACAATGCTCCATTAACTCCATCCTTAATTTCTGCAACCGCAGCGGGTAGCGACGCAGGCGGGATAATCTAGTGGGCAAGAGTTCCGTACTGTCATACAACTCAAAGGTCTCGTTGTTTATCCGCAGCACGAAGGCTCTTGCTTGCCACTGAGACGCAACGCCGTTCACGTGGTTATATCATTTCACGACACGCGAGCTTGATGAGGCAGAAGGCGTCAGCGGTCGATTTGTCGTTGCGCGCTCTTTTGAAGGACTTAATGATAGTGCTTTGTGTACTTAGACTAGTTTGAGCTCATTGGTTGCTTGAAGAGCGTGTTCTCGTTCTGCCGCCATCGACGTTAGAATTGGTACTTTCACGTGCGGTGATCACTTCCTTCACGTCACTCGCTAACGATATCATCCAGCCAGCCATGAACCGTGCCGTTCGGGAAGCCATTTATAGGCACGGGTATCGCCTTCAGTCCGCCTCGGCCGACGCCTGCTTAGGACTGGATGAAGCCAGCGTGAAGCTGGTATGCCGGCAGATTTCTGCCGCCCGGTGTCTGAAGTCCAGTCTGCATCTTCATCATCGAGCTGTCGTCATAGGACTCAGCGGTCAGTTCAAGCGTCAGTAGTCGATTGGAGAGGACGAATACAGGGTCACGTCGAAAGCGGATTCGCGTAAAGGGTCACCGCTCCCTGCTAACCGCTAGAGGTCCCGGCACCTTTCACCGGCATTGTACCGGTTTGGTTTAGGGCGGTTTCAGCGCGGATGTAAGGACTAGATTCGGCTGAATGACAAGCCCGCATCATCGTCTAGGGTAGTCACCTCGCTGGCCACCATACTGGTATCAAATCTGACAATTGAGGGGAGCGGAGCCGACTGATATAAATCCGGATCCATCCACGCATCCAGCTCTGAATCCGGCACCTGAGCAGGGAAAACTCGATATGCAGCTCCGCCTGCCAGTATCTAAGTTGCCTCTTCGCCCGTGTATTCGCCTCATTGAGATAAACGGCAACTGCCGCAAAATCGCTCATCGCTCCGGGTAACATTAAAAACGTCGCCCGGTGTCCACTGCTTCTCCATTTCATCCAGTACGGCTGCACCGGAGTTGCTTATGTTTCATCGCTTTATTACCATCCTCAGTTGATGCGCGACGCCCAGCTCTTTCGGAAGCCGTATCCGCTCAACTGTTTGTTAAACGCCGTGGTCAGGCGGCCCGGGATCTGCCCGACCAAGCCGACGATTTCCCAGCCACACCCGGGCTAAGCCATTTTCAGTTGAATAAACGCGCCGGGGAATACGACGGTTACCCACCAAGCACGCCCGCCGGGTTTCAGGGATGACGCTGCCGTTGGCCCCTGCCTGAAGGACAACCCGCGCATTACCCAGCTTGATTACGGGGTAAATCCCCCGGTTACTTTGATTCTGGCCTGCGGATTTGACCGTGGCTTTTCAGCCTCGGCCTTTCCTTTACCAGTTTCCGGCGTACCTTTGTCTCACGGGCAACCTGTGACCGAGGTATGCGAATGGGATGAAGCAACGGCGCGGTTAATGGCCATTGCGGCGGCACCAGGCACCGCCGTTTTGCTGATGAGCGCTGAGGTTTCAACGGCCTGCTCAGACCTTTTATGGCCTCCATCCCCTTCCTCGCCGGACGGTTAACGGCAATGCCCGTCCACTCAGGATGACAGACTTCCGCCATCATCTAGCGAAACGATCTCGAAATTTTCCTCACCGATGGTCATAATTGCCCGCATTGGCCGCAGGACGATCGCAGCAGAGGCAACAAAGTCGACGAGGCACGCCCTGTCCGGCGAGCTGATATTTCCACGTATAAAGCCTATCGCACGTAACGCTGCTGACGTTCCCATCCCCTTATTTCATCGGCCGGGCGGTAAGGCAGCATCGAACAGATTATCGAAATCAGCCACGCCTCCGCGTCCATTTATCTAGGCCGCGCTGTCATTTCGGCTGCACCGGCAGAGACACGAAACGCCGTTCCCGGCACAAATGCCACAGGTTCATCCCGCGTGGCGTGAAGTCCAGGCTTATGCAGCTTCACGATCGGATAGATTATGGGCGTTCAGACGTATCCAGAATCACGGTATCCGTAGATCCCACCTCATTTCATGTCCGTCAAGTTCCAACAGGACTTCCTGGCGTCATCCGTGTAAGCTCCTTTCACGCTCTGCCCTCGCACCGGTTCTTCTTTCGTCCCCGTCAGGCTGACATCACGGTTCTAGTGTTACCCAGCGACGGAGCTCTAAAGGAGTTCATGCGTGCGTTTAGATTCAAGCGCCAGGAACAATGGCCCGACACATGATTAGAGTTGTACCTACGCGAACATCAGATGCTACAGCAGCGAATGAATCAACATTGGCGTAAACTGCTGACCGCTAGATCGCCGGTGGTCACCCAGTTTTCGACTATAATGGCAGAGAGGCGTTAATGCCTTCCGCTGTGCGTCCCATCCTGAATGCAGCCATAGTAGGGCAGACCGTGCCCTCGTTTACCAGCGGCATCACTTTCCTAGCAGGAAGTTCTTTTGACGCCGTTCCAATATGTTGACAATACGGGCCACATCGATATCGCGTAGCCATGCCTCATTGCCCAGGTCTTTCACGCTGTCTCCAGCTGGAATTAGAGCCACTACGGACTGCGGGTCTATTACCGTTTCTCCATGAAGCCAGGCGCCCAGCTTTCGGATCGAACACGATGATATTCACCACACCTGGCGTTCACGGGCTTCGATATCGTCGGTCGGGTCATACGTGACTTGCTTGCTCCACTCCGTGCGCCATCCGTGATGTTATTCTCCTCACTGCGGCCCACTTACACCCGACTCAAGGGTCAGAGGGGGTCCGCGATCGACTGACGTTACAGAACTCAGGCGCAAATGCCTGCGTACTTTAGTGAGCAATGGCCAGCTCTTCGTCACGCATGTTCTGTAGAGTGATTGAAGGGCATGAGCCGGGTCCGCAAGATTCTGCATCTTCATCCGGCAGGCGATGGAAGGGTCATCTGCGGTCAATTTCATTGGCTGTCAACAAGTTAG
>122
AACTTCTGCTCAACTGTTAGTCCTGCTGTGGCATACCCCTTTGGCCGCTGATTTGACAACCTTTTAAGACCGTGAATTAAATAAGTTCGGGCTCAAGAATACAGTACTTAGAATGAACGTCACCATTGAATGTTATTTATCAAGAGTTACAGCAGTTACTGGATTAGGAAGGCATGTATAATTCGTAATGTCCGTATTAGGTACCATCGTCTTTCTATTAATAGACGCTGATTCAGTTAAATATGAAGATAATTTCTTTGTGCAAGTTGACTAATTGTTACCAATGTTGACATATTTTCATTTGTAATAAATCAATGTCATTTCTGCTTAGATGAATAAGTAGTCCCTCCATTTCCTTCCAGTACCGGTTTCTGTTAGAATTTTAGCCCCGTAATGGAGCTTTTCCATTTTTCGACATATTTATAAATGTCACTGTAATCGTTGTCCCGGACAATAAATGTTACTGTTCTTGCGTTGGGGAATTACGTCAATTTCTAAGCGAAATAATTCAAAGTAGCTCTATCATGCAGCATTTACCAAGTGCGTAATCTTTAAGTCTTCTTTCCCATGGTTTAGTCATAAACTCGCCGTTATCGCATGTTGGAATATTTTAGAGGTAAAGTGATCTGCTTAACTGTCATGTAATACAAGTTTGATGTGCATGATGCGGTCAGACAACAATTAGTTACCAGTTTAGTATTATTAGTCAAACAGAATTACGTTGAGTAGCCGTGCTCATAGGAGTAAATAGAGGGCCTAGGGCCGGTCATGTAGCAGGATAATTAGCATGACCTGGGCTTTCCGTAGTCCGACTGTTCGATTTACGATTTAAGGCCAATTTGGATAGTCTTCCCATTTACCATGGTAGGAAACTGTACGGTTTGGACGCCTTAGCTGTTACGACATAGTCAAACGTCCTTCGCTGCATGCCACTGTCCCGATACCTTACGGCAGTTGAAGTCTACCGGATTTGTAAAACAGCGCCCTATAAAGGTTCGGTTCCGATAGATCTATTTCTTCCACTTCGATCCTGGAAGGTCTAGTCCTAAACCATACTGTTCGATAATTAGAAGTCATTCAACCGTAAGGTTCAGTTGCTTCAAGCAATTCTGACTTAGCTGCTGAAACGTTGTGCGGTTGAACTATATTTCCTTATAACTTTACGAAGAGTTTCTTTGAGTAAGCTTCACTCAATGCTTCCTGCCTCCAACGATGGCTTTAACAGGCATTTAGGAAGCGATATGAAGAGCTCTGTGTTGTCTTCCTGCTGCGTCGCCGGCTTCAACATAAACTATAAGCCCGGAGTTCCGAAACGAAGTCCAGCCCAGTCAGCGAAAAATGTTGGCGAGTTAGGTACGAAGCCGTGATCATGTGAACCACAACCTTCTCCCATATGCAGTGCGAGCACGATGAATAAATGTAATAGGCATCACGGAAATCCATAATTAATAGGAAGAAGTATCTATTTTGTTGTTGGGAAGGCTCCTTCCTGAAACAAGGCAGTCATCGTAATATGTTCTAGCGGGTTGTTTAGGGATTATTTCCACTTTTCTAATTACGTCAATCTATAAGGTTGAGCCCGCCTTGTCCTGTGGTAATAACGTGCTAGCTTAATATTCTATTGTTGTTCCGTAACTCCGGAATAGTACTGAAATTATTTCTACTTTATCTGGCATCATACCTTCGAGCATTTATTAAGGCCCGGTAAGGTTGCTGAAGAGCGTTTTTCATTGGTCATTTATTTCATCTCTGGCTTCATAGCCGGTTTAATAACGTACCGGCATCCTATCTCAATAGATTTGAATGGTTCATAAGAAAGCTCTGAATCAACGAATGGCGATAAGCGTATGGGAATTATTCAAGTAAAACAATCTCACGTAAACAGTCTACAGCATGAATGTCTCAACTTGAACTATTATTGCTTCTGGTACTTACACTTCCACATTCACCGAATGGTGCAGTACTCGTAGAATCCGTACTCCGCTTCCGCTTATAGAGCTTAATGTTCTAGAAGCAGATATAAAGTCGAGATGGCATATAATGGTTCATGAATAAACCTAATGACTTTCGCCAACGACATCTATAATCTTGTAGTAATAAACAATGCAGTTAAGGCCTTCGAAGCATATTCTGAGTGTCATAATAAAACAATTTAGTGAATTATCATCGTCACTGAATCTTATCTTACTTAATCTGGTTGAGGAAGCTATGTCCGTGCTATTCGGTTACTGACTTCCTTCCTAGCCAGTTGTCTTTTCTATCTATCAAGTAATAAATGCTGAAATGAATCTAAGGGGATCGGAGGAGTCTAACCAGCTTGAATCCATCGCTACTTGTAACATTTAAACTTTATTAGCTTTGTTTGTTAGGGGAGAAGTAAAGCATTAAACGACTGAACAAGGGTCATACGAAGCTGGCGGCTAATCGCGGATCGGTTAAGTGAGTAGTCGTCAGAAAATATTCATTGTTTTCTGGTCGTGACGCCGTAAGCTTCGATTCAATTGTTGTTTACCACCCATTCCGCATCGACAACCGAATGTTCGTGCTGGCAGAATGGAAGTAGCCAAAATAGTTAAATCACCGTACAGAAGCTTTTTAACTGCGTAGAAGGACCGAATCTGACAATTCTGGCAAACCATTTAACAATTGAAATGTTGCTGGATTCGGAAGAGAGCGCTACGTAAGCGAGTGTTAAGGACGCTTTCATTTGATGTCGACCGATTTGGCTATAAATCCTGAACCTTTAAGACGAGGTTATGTTAAACCATCATGATTTGCCGTACCGACATAGAGAGACCGTTACCTAAGAAAAACATTCAGGAGTTGACTGAATTTTATCTATTACTGAAGTACTTACTCTTCTTTTTGTACTACAAAACCGCTTTAATTCGTCGATATCGCATTTTCAGCCCCGTAATGTAAACATGACAAAGGAAGGGATTCGATCATTCTAGTGACCGCGTACTCTACTGACGCATTAATTCCCAAGGCAACTAAAAGTTCATAGTAAGCGTAATAGGTCGGTTAAAGACCGCATTATTTGGCACAAGGGAACTCTTTTAAGTTATGCTGGATTTCCATGGTAAATTATAGTGAACTTAACGGGGCATCGTATTAGTTCCATATTTACCTTTCTGCTTCCTTTTGATAAGGTACGTTCATGTTGCATGGTGCACTATCACTTTATACTAAGCCTGCATATAGTATCGCCGAACCATTACTCTTCAGGCTTCTGAAGAAGCGTTCAAATAATAAGCCGATAGATAGCCACGACTTCTCATTTCAAGTGTTAAGCTCCCTCCTTCATAACATACGATTATGGAAAGTATGCATGCTGGTGTAGGAATATGCGGAAGCGAAGCTATCGTCGTTTGACATCATCCTGTCTGGTGGTTATGCAGGTCTATCTAAAGCTTTGCACTGGATTGCCGTGTCGTCTACTCCGTGGAGGCCCGGTTTGATGACAATTAGCAAGAAGACAAATACGTCTAGGTGCATGGCTGATATGTTACATTAATACCATCTAATAGTTGATTCATAGACTGCATATGTTGTTTGATACAGGCGAGTTTTTATTGGCAAAATCCTAATTTTAATATTATATTTATCATTTACGTTCTCGTTCATTTTTATACTAAGTCTAAGGTAACGACGCTTTATGTACGTGTGAACGGGAAGAGTTAGTAAAATTCCTTTCCGTGTCCTGGATTCCCTCTGTCATCGATACTGTATGCCATGGTCAATGTAGAAGTTTGGAAATTATCGCTTATTCTCACGGTTATTGTGCAGACAACTGCGCAACTCGTGAAGGTAGCATCCGGATTCGAAGAAGACTTAGCTTTCGTGGCCCAAAGTGATACTGTCCGTCGAAGGCTTCCAGCAACGAGTAGATGCAATTATGGTTTCTCCTCAAGAATCTTCCATTTATCATGTTTCCTTCCTTATTCCGACTAAGTAACTTGCAATGTCGGTTCTAATCGAGTTAGCCTGTTTTAAAGTTGGAAGTCCATCTAAGTATCAAACATTCATTCGATAAATCACCAACTCGTTGCCCCGGTAACAACAGCCAGTTCCCATTTGGCAGGTCAACATGGTATGATTCTGCTTGATAAATTTTCAGGTACTGGTTCGGAAGTCTATCTCCTATCTATTTGCTGCGAGTGGCAGCGACATGGTTGTTATGGTCGATCTATTGCCTCCGGAATGCATCGCTCAGTGTTGATCAATACCGTAGCCACGCTCTTCTAGCCCGGAAGAGCCCGATTGCCGATTTCTTTGTGGTCTTCAATCCAGCATCAGGCAGACGCCTTATTGCTTTGATTTTAGCCTTATTTATGAGTGCTGTTCCTGGCCCATTTTCGTACGATCGGCCATGAATTGACGTAACGAATTATCACTGTTGATCTCGTCCGCCTTGTTGTGTTCTAAAGACTCAATGTTGGCCCTGTAGCTTCAGTGATTGCGATTGCTTTATGCTAATCCAAATTCTACGTCCTTGATCCTGTGAGACATATTGGAGCGATTTATAGTCAAATCCCGGCTCATGATCGCTTCTTCCCATTTCTGATGCTTCCAAAAGCCTGTTATTAGTCCGTACTTTACAGACTTTAAGCTGACTCGGAAGAGCCCGCGGTGGGGATGGGCTTTAAACCCCTTGGCATCGACCCTAATGTTCACCGTTCTTGACGTCGCTGGCGTGCGTTCCTGAAGTGTCAAGTACATCGCAAAGTCTCCGATCAAGAAAAGCCATCAGGTGGCGCGGGAGTTCGGATCGAATATTGGTTACTGCATGTCTGTGGTACGCGCTATCATCCGTATGTTGGCGTTGATGTTCTCCCTTCGATACTCTCGTTGAATGGCTCCATTCCATTCTCCTGTACCTAGAATGCATTTATCTCCATAAACAAAACCCGCCGTAGCGATCGATAAATAAATCCCGCGAGTGCGAGTGTTATCTATTAAGGTTAGTGATATGTTTGTCAAGAGGCAGTATGGTTTCCACCGTACTCGTATAATACTTTGCACGTATCATTTCTAACACGGTGCAGAATGGGGATTTGCTTAGATTGGATTATCCATGGTGGGACATACTAGCTACGGTCGTTCATTATTCCAAGGAAGTGCTATTACTCGCCGTATTTTACACTGGACCGTAACGGTCACTCGTGCATCTGTGATTCAGCTAGTAAATCTGTAGCATGTTTATCTACGAGCAGCCGTAAAGACAGTACAGATACGGATTGTTGAGTACGTCATGATAACACCACTCTGGCAGCCGTGAAGAATGAAGCGAATTCAGCATTTCACACCCGTCTTTGGCCAAAACCGATCACTCCGTGATGAATGCCGTCAGACCGTATAATGCATCATCAGTCTCGCTCGCATCCTAGAATGAGTGATTTCCAACGGTGTAATTCCGGGTCTTGTTCCATTAACTGCCGCAGAAGCTTCCAGGTCTCAGTGCATGCTTGATACCAGGAGTTCAGGAAGTGGAACACAGAACTGGTTCCGTCTTCACGACTTCGTTGCTTTCCAGTCTAATGGCCGTACTCCCATCCGAGATAAGTCGTATACTCACTGCTCGTTAGTTTGATTTTAGTGTTCCACTCAACCCGATTTCCCTACTGTTAGCGCAACTCGTTCTCCTCTTAGAGGCGTTGGTATTTAGTTCTTCCGTATCTCAGCAGTTCCCGGAAATGTGAATTCAGAAAGTCCGTCAAATCCCCAGTCATGCATTGCCTGCTCGGTTCACGCAGTGCCTTAGAGTTACTTCGCTTCGAACCTCTGTTATACGATTCCAATCTCCTGACGCGCAGTAGGAAGACCCTAACGACCAGCGTCTTCGTTCATCTATCGTACGCCACGACAATCACGTGACCAGATATAGCCTGGTGTTCAGGCGGCAGGCGTTTGGTCCTGTGCTGTAATTCTGCTATTCCTGCTCACCGTAATGTCTGCCATCTTTGCTTAATCCAACGGCTTAATGTATGTTGTTACGTGAGGTAGAATTAGACCACCAAATAGCCTGGCTCCGTATTTTGCTTTTCATGATTCATCGTTCCTTAAAGACGCCGTTGGAAGCCGATTGCCTTAAATGAGTCCGTGAAGCGTTACCGTTTGCTCTGGGCCCAGTACTTAGATCTAAAGGGCCGTACGTTATCCGGTACTGTCTTAGTCGTCCGATTGGAAGGATTGAACCAAGCGAATTTAGTCCTCCTATGTCATTGAACAAGTCGAGTTAGGCAGCATAAGCACAGAATATGAAGCCTTAGCGCCAGAATGCATTCTGAGTCAGTCCGTGCGTTCTTCAGCTGGCTTCTGTCCT
>123
CGTCTCTCTTATGACCTATGACAGGATGAAGCCCGGCTTGCATTTAGAAAATACTGCATATAAGTCTGCAGAACTTCAGCCGGAACGCGACATCACTCCGTTAACGATGAAACCATGCACAGGAGATTAACACTCTGCTGATCTCTCGGCTGAACATGGATATCGACGTACTGTCCCTCATCTGTTCCCAGATATTTCGCCGCGACATTCGTGCATCGTCAGACTGACACAGGCCGAATGAAGCAGTAAAAGGGCTCTTGGATTCCTGAAACAGAAAGCGCATAAGAAGGTGGCAGCATGACGGAAGATTATGACTCCTGCAGCAGCGTGACGGGATCGATGTGGAGCTGTCGAACTAGGATGATGCGTGGCAAGAAGAACAAAATTAAGCTCGGCGTCATCACGCCGGTTCAGACAGTTCACAACGTGATAGCAAATCCCGCTCCGGAAAGAAGTGGCCTGACATGAAAATGTCCTACTTCCACACCCTGCTTGCTTATCAGTATTTAAGGCGGTGTCATGGAAGTTAACGCTAAACTAAAGTGGGTGGGGAAAACAGTACGAACGACTATGAGAATGGTATGTTGACCGTACTTCCGGCGGCGTGAATGTTACTGAATCCCGATCATGATCATCATCTATCGCGACGAAAGTAGATTAGTAATCAGGGGCCTGCTCTCTCCCGATGGTTATGCAGTGACGGCAACGGCCTTTCACGTATGAAATCGCCCGTTACCTCCCGGGGATTTCATGAAGTTCCGGCTCGGTGGTTCGGCCAGAGACACATAAGTCATTACACATACACAGGTGCCAGTAAGTACTCAAGAGCAAGTGTGAATGGGAAAAATTCCATGGTACTTTGCCAACTATACCGCGTATGAAGCGTGAAGGCCTGCATTATACGTCTTATTATTGAGCTAGGATGGAAAGATACATGGCGAGTTTTGACGAGATTGGTTAGAGTTCATCGAAAAGGTGACGGAGGCAACAACCGGGTAGGAGACAATTGGTTTGTATTTGGGGAGCAATGAGATAGCACGCATCCTCACGATAATATCCGGTAGGCGCAATCATTTCGTCTACTCCGGTCAAAGGGTAGAGGTATTTCCCGGCCTTTCTGTTATCCGAAATCCACTGAAAGCACAGCGGCTCGTATCTGAGCTGAGGAGATAATAATAACGAGGGTACGTATTAAAAAGCAAGTATTCTGTTAGTTAAGAAGAGTATCGAGATGGCACTAGCCTATGTGCTCAAATTGGAATCAGGTTGTTACAATGATAGGAGTAGAAACAGACAGAAAGAATTTCATACGTCAGCCGCATCCCTTTCACAAAATAGGGAACATTATTAGTGTAGAAAGGCAGAAGGCAGATGAGAGAAACATGGAGGACAACTGATACGGAATGCAAGTTCTGGCGGACGGGCGGTTCATATTCTGTGCTTGTATGCTTGCCGACAACAGAGACTTGTTCAATGACAGCTCACAGCAGGAAAGGCCTGTCGGCAAGGCTTGCCCGTTAAGGCTAATTTGGCAAATCAAAGCCAACAGCAGAGTTCCGATAAAAACGTCAGATGACATTTGCCGTAGCGTAACTGAAGAAGCACCCAGAAACGTAGTAACTAATGGAGCGTAAGCAAGACCACGGTTTAAGCCTGGGATCGGCATGTTAAACGGCGTCTTTAAGGAACGGATGAACATGAAGCAAATCATCAGGGAGCTACATAGTAGCGTCTTACTTCGCATTTCACCTCAAGCGTATTAACCAACAGTTCAGGGATTAAGATGAAGATGAAGACACATCGTACTTCAAGCATTAAGAATAGAAGAATTACAGCGCAACACAGCAATAAAAATGCGCCGCCTGAACCACCATAGAGACTATCTTATGTAAGCCATGTTTGAGTGTGGCGATCTAATAGATGAACGAAGACGCTGGTCGTTCAGTGTTAGACATTTGCACAGTTGCCATAGAAGGATTAGAACTTATATCAGTAAACAGAGGTTCGAAATGAGCGAAATGCTCTCAGGCACTGCGTGAAGCGGCAGCAGGCAATGCATGACGACTGGGGCATTTGACGCAGACCTTTTCCATGAATTGGTGACACCATCGAATTGTGCTGCAATCGTGGCTGAACTAGGAAAGAAACCAGCAATACATCAAACGCCGCGACCAGGAGAACCGAGAGTGCGCTAACAGCGTAGGGAACTGCGTGTTGAGCTTGAACAGCAAGATCAAAAGCCGCACGGCAGCAGCGTGAGTACTTACGAAGGTGTATCTCGGATGGCTTAAGCGTATTGCACTAACCTGGAAAGCAACGAAGTTAATTGAAGACGAGAAACCAGTTCTTGTTGTTCGCCATCTGGGAAGACTCCTGTTATCAAGCACTGCACTGGTACTGGAAGAGTTCTGCGGCAGTTAATCGAACAAGACCCGTTAGTAACTATCGACATCATTACGCATCGCTATTACGGGGTTGGAGGGTCATAATGGGTTCAGGATGCAGGTGAGTATGCGCATATGATGCTTGCTGACGCTGGCATTCGCATCAAAGGAGTGAGATCGGTTTTGTAAAGATAACGCTTGTGAAAATGCTGAATTTCGCGTCGTCTTCATCAGCGATGCCAGAGTCTGTAAGTGTCGATGATGACCGTACCCTATTAAACAATCCGTATTATCTTACTGTTTCTTTACATAAACATTGCTGATACCTCGTTTAGCTGACCGAAGCCATACATTGCAAGGAGTTTATAATGAGTTATCAATGAGTTAGAGTCTGAGCAAAAAGATTGGGGTTATCAATGTTGTGCAGATCCGGATGTCTGTCTCCATGCAGACATGACGAAGGTGTTTGGTAGATGAAGGAGGATAGAGCCCTGGAGTCGGCATACAAATATTCCATGAAGGTTATAGTCTAATGAAGACAAATCCCCATTCTGCAATGTCGAGAAATGACTGATACCGTGCAGCAAAATGCTTACGTAGGATCCCTTGAAACGATATTGCCTCTCTGTACAAAACATAGATGATTAAACCCAATATTACATAACAATCCTCGCACTCGCGGGGATTGATTTTATCTGAACTCGGACGCGGGTTTGTTTTATGGAGATGATAATGCACTTCCGCGATCACAGGAGAAGATGGAATGGGTCAGCCATTCAACGAGATTATCGAAGCGGAGGAACATCAACGACTGCTACGACCACTGGATGACTGATATGGGGCAGATAGCACATGCAGAACGTAACCAATATTCGAATTGAAGAACTGAAAGAACACCAAGGCCGCCTGATGGCTTTTCTTGCGTGTAATTGCGGAGACTTTGCGATGTACTTGATTCAGGAGTGGAACGCACGCCAGCGACGTCCCAAGAAGCCTTGAAACATTCGTCGATGGGTTCGATAGGAATGCAGGATATTCCCAAGCGGTTAAGGATGGAAGAGAGTATCTGTTCCACGAATCAGCGGGACCCTTGACTTAAATCGACCGCCTAATAGCCGGCCTTTTGAAGGGATCAGAATGGGAAGAAGGCGAAGTCATGAGCGCCGGGATTTACCCCTAACCTTTATAAGAACAATGGATATTACTGCTACAGGCATCACAGGACGACGGCAAGAGTTTGGGACATTAGGCAGAGACAGCGAATCGCAATCATGAAGCTATACGATGATACAACATTGGCAGTTGTTCGCCATAACAAACACAAGCCTCTGACAGCGAGAATCAACAGTGATAATTCCAGTTTACGTTACTCATGGCTTAATCGCTACGAAAAATCCTGGCCAGCAGAGGAATCAAGCAGAAGACACCTCATAAATTACACTGAGCAAATTAAGCAATAAGGAGGGTCTGCTGATGCTCCACTTGAAGACAACCACAAAGAAATCCGGCAATGCTCAATGATACAGATGAACGAGGCAAAGGCAGCGTCTGAGCCATTAGATCAGATCAACACTGGCCGGTCTGCATTCCGGAGGCAATAGCTGAAGGCTACTAACAAACCATGTCGCTGCCACTCGCGCAGCAAATCAGAGGTAAGGAGATCATCCACTTACGGCTGACGAATACGCTGAAAATTTATCAAGCAGCAGAATCATCACCATGTTGGCTCAGACTTGCAATGGAACTCTGGCTGTTGTTGACGGGCAACGAGAGTCGTGATTAGCTGCGAAATGAATGGTCTGATATCGTAGATGGATATCTTTATGTCGAGCAAAGCAAAAGGCGTAAATTGCCATCCCAACAGCATTGCATATCCTGCTCTCGGAATATCAATGAAGGAACACTTGATAAATGCAAGGATTCTTGGCGCCAACCATAATTGCATCGTTAGCGAACCCGCTTTCATCCGGCACAGAGCCGTAGTGGCTGCGCGCACGAAAAGCATCAGGTCTTTCCTTCCGACGCGGGGATCCGCCTAAGCGCCGTCCCGCAGTGCGGAAATTCTGCAAGACTCTAGGAAGCAGATAAGCGATAAGTTTGCTCAACAACTTCTCGGGCATAAGTCGGACATGAGGCATCACAGTATCGTGATGACGGAGGCAGGGAGATGGACAAATTGAAGCCAAATAATGATTTTTATTTTACTGATGTCTACTGTTCGTTGCAACAAATGATAAGCAATGCTTTTATAATGCCAACTTAGTATAAAAAGCTGAACTGCGAAACGTAGACACTGATATAAATACTAATATATTAAATTAGATTTTGCATAAAACAGACTACATAATACTGTAAACACAACATATGCAGTCACCTGAAATCAACTACTTAGATGGTATTAGTACTATCGTAACAGAGCATTGGCGCAAGGTGATTTTGTCTTCTTGCGCTAAGTTTGTCATCAAACCTGTCGCACTCCAGAGAAGCACAAAGCCTCGCAATCCAGTGCACGGAGCTTTGTGTGCCACCCCACCCGACCTGCATAACCAGTAAGAAAGACGCAGCAGTGATGTCAAACGACGCAGCCTGACTTCTTTCTTCTTTCACGACTTCCCACCGCTAGCGCATGCATACCTTTCCGCCGACTGTAGTGAATGTCTGTTGAGCGGAGCGGAAGTCTACGGTGAGAGAAAAATGGCTACGAAGTCTCTCGGCGTGGCTATCTATCGGCTTATTAGTACTTGAAACGCTTCTTCAGAAGCCCGACCAGCGGATCGTTCGGCGTCTACTGCATTAATAGACTATATCGTTAGTATATAAACAGTGCACCGTGCAACATGACTCCAAAGTGGGTCTTAGAAAGGAAGCAGAAAGCTAAATATGGAAAACTACAATACGGATGCCCGTTAAGTTCAATACTACACGTTAATGGAAAACCTTATGTAGTAGAGTAACTTAAAGAGAGAATCCTGTGTTCAAAGATAAAGTGCGGTTATTTTAATACAAATTAAGGGTTACTATGTTGGAGTTAGTGTGTCGTGAAAGAGGCGATATTCCCTGCAGTGAAAATAAGGCATTCCTACGAGCAGATGGTTTGCATCACGATTCCTTTGTTACAATGTTTTATCTTACTGTCTTTGATCCCCACTAGTGAAAATCCCGATATCGGAAATGTTAAAATTGGTTTGTAGTCAAAAAGAAGGAACCTAAGCACTTATTCATTAATAGATAAATTCTAGTCACTCCTGACGCTTTTTCCTTGGGTGAAGCATGTAACGTCTTAATCTCAGCAAATTACGAGCGATGGTTTAAACATAACCTTCTTAAAGCTATTCAGGATTTAGTGGGTATGGCCAAAATCGATGCTCTCCCGACATTGAAAGCTGAAAAGCGTCCTTAAGCGCTTACTTAGAGGGACTCTTTCAGAAATTCATGACAGTTCGCACGTGTTAAATGGTTTGCACAGATTGTCAGTAGATTCCATTTTCATTTAATAGAAAATGCTCCCGGATTCAGTGATTAACTACCTTTTGAGGTGACGGTTAATTCTATGCCCAGCACGAACATTCATGCTTTTTATCGGTGAGAATGATGTGGTAAAACAGAACAATTTGTTGAATGGAATGATTGGTGCAATCAGACCGAGAAAACAATGAATTTTCTCTGAAAATAATAGACTTATCGAGTCAAGAATCCCAAAGGGATATTTTCGATCGCTTGTTTCAGTTCGTTTAGTGCATTTGATCCTTTACTCCTCTAAAGAACCAACCTGACCCAGCAAAAACCACAATACTTTTATTGATCTCAAGAATGCTGCCAGCAATAGTTTAAATCACTAGGCGATCTCCGCTTGTGTAGAATTCATTTCAGCATTTATTGGTTGTATGACCAGTAAGTAGAAGCCACCACTCTGGCTTGAAGCTATCAAAACTAAGTAGTGATGAAAACTTTTCCAATATGGAACTCATCAGCCTCATTTCTAAATATGAAGAAGGTTAAGACCTACTGAACCACACCAATTCAAGTGACGACTGATAAATTCAGCAATTGTTTATGACAATATCCAGAAATATCTGCTTCGAATGAGCTCGGAACCTCCCTGCAATTGTTTATTTACTATCACAAGATTAGATGTCGTTGGCCCAAAAGTCATTAGTTTATTCGATGAACCAGAGTTCATCTGCATCCCGCTTGCTCGCCTGCTTTTACGAACATTAAGCGACTTACTCGATGCACGCAATGGTGGCTAATAAGGTGCAACCCCATCTCATTCCCCAGTTAGTACTGCAAGAGGTTCCAAATCCTGCATCTGCTCGAAAGTCCTACGTCGTAAGAGAAGCAATAAAGTATTATCCGTCGGATATTGAGAACATTCGGTACAACTTAGTTTTAACTCGTGAGGTGTTTTACTTGAAGTGACAAATTCTGGATATCACCACTTATTATCGACGAGTCCGTTGATGATTCATATGTCTTGTGGTATGAAACCATTCTAAATTAGGATGGTTACCACTCCGATTAGAAGGTCGAACCGTTTAAAGCGATGATAATGAACAGAGAGATGAAGGTAAAGTACAATGAAACTACCTCCTTCCGAGCAGAATTAGCGAAATGCTTAATAAATGTTGGAAACGAGTGATGATGCAGATAAATATGTTGAAATAATTTCATTACTCACTTCCCACTTGTTCAGAACAGAACAACAATATAGAATATTAAGCTCGACAGGTCAGTTATTTACGACGACGACACCCCTCTGCTCACGCTCACTGCTCGTGTCGTAATGACAAAGGTTAAATTAAGAAAGACATTTATGAAATAATCTCCGAGATAAAACAAACCGCTAGAACATATTACGATGACATGCTTGTTTCATCAGGTGAAAATGTCCATTTTGTGGTACTGGACAGACAAAGCCGTATGCTTTTCCTTCCTATTGCAGGTCATCCTGAATTTCGGTGATCAGCTTAATTTAGTTCCATGATTCATGCGACTGCAAACTGGAGAGAAAGTCAAGTTTTCGCAGGTAATGAGGTACACCAAGCGATTCATCCTCTGAGCGCGACGTAAGGACATCTTTTCGTGAGCAATGGGTATATGCAAATTTCGTTTCCGGACTCCGGGTGCTATCAGTTTTTGGTGTTGGAATGCCCGCTTTAACTAGGCTGGGCAGCAGAGAAGAAGACAACACCAGCTCTTCATCAGCTTCAAGCTATTAAATATTGGACACAGGTATCGTTGGCAGCAGGGGAAGCACTTGTTTACGTCGATACTGATTAAAAGAAACTCTTTCGTAAAGTTATAAGGAACTAGTTCAACCGCATGACATGTTTCCAGCAGCGAAGCTACAGTCAGAATTTATTGAAGCAATCTGCATGAAACCTGAGTCACTAGATTTGAATGACTTCCCAATGA
>124
CCCGTGCTTGGGTGTTAACCTGTAACTCCACTCTTGGCATACAAATAAACAATCCAATGGGTGACGCTTATTTCTACAACATGATTCCATCCTTTAGTTACTGAAGCCAGGAGACATCGGTTAGAACATTAAAGTACTCCAATAAGCAAATTGTCATAGCATTTACAATAATATGACAATAAATAATTCCTGAAGATATTAAGGAGCGTGCTCAAACTCCTACCGTAAAAATATCATGGACAGAATTAGTTATAACCATCAAGCTTGCAGAAACGACTTTTAAAGGACGGTTATCACATTCAACATTAATTTTATGATAAACAATTCTCATCCAATTGATTTAATCAATACAACATTTGAAAGATCAAGCAAGATAAATATATTTTTGGCGTTGCAGCTGACATATCATACCCAACGAGACAAATGCCTATGGCTTCATTTGGATATCAGAGCTATGAGCCCAGAAAAGCAAGCATCTACTCCAATAAACCAATACATACAATGCCAATTATGAAAAGTTCAGGTAATTAGAATTGAATTCAAATAATAATCAAATGTATTTCATGGAAAATAGTTGAGAAACGAAGAAAAGTACCAAAGTCCAGAAATATCAACAGCAGACTCAAAACATCACGAAAAACCATATTTCATGCGTTCAGTCTTAAAGCAATTGGCGGTACTGTAAACTATGAACAATTGAGTCATAGAAATTCCATGCTTCTCCTGAAGATAATAATCCCAAATAAACCAATACTCATTTACAATATACCCACTAACCGCAGAATTATTTCATAAGCACGTTCTGCGGCATCAAACGATGCTCCATAACAGGGACAGCAGGCCTCAATATCAGGTGCAGGTCCGTATCACGGTTCAGCAAGCCCCGATATACTTCTTCCCAGGCTTCTCCAACGAGGTTTCTTCCTTCGTGCGATTCCAGATCTGCAGGGACTCTGAAGGCGCAATATGCTCATGGCTACCTGCATCAGGCTTTTGTTTCTTCCCTCCCGGATCGAACAGTCCTTCCATCTCGTCATTCCCGCAGAGGTCCCGTATTCTATTTCTGATATTCCCCTCCCGGCTAGATAACCCGACATTTTCCGTAACCGTACCGAGTTCAGAAATAAATAACGCGTCGGAGGACCGTCAACGACGGTTTTACCCCGATGGTCTTCCCAAAGCTGCCGATGCCTCATCACTGTTGAAACAGGCCACAAAGCCAGCCCCGGAATATCTGGCGGTGCATATCGGTACTGTTGCAGGCAGACCGGTATCCGGCGGGCAATAGCTGCGGTCCTTCATAGGATAAATTCATTAGTTCCGGCCAGCAGATTATAATTTTATGGTCCGTGGTTGTTCACTCATTCTGAATGCCATGCAAGCCTCGCAATAGTTAATAAATGCAATGTTTTGACGTGTTTTTCCGGCGTTACCCGCAGCGTTACGGTACTGGTGTCCGTGAACCAATACCTGAAGAATGGCAGGCCGCAACACCAACTGGAGCCTGGTGCCCACAGCAATACCAACTTATCGCATGTGCAGCGGCACATTGGACGAGCGTACCGACAATGAGTGACTGTGCTGCCCTGACTGTCCGTTCGATAAAGCAGCAATACCCTGTGTGCTGGTTTCCTTTAACTGTGATAAATTCCTGTAATGGTCCTGTTCCATACTGACTCCAGCCAGAACTGTTCATCCTTAAACCGGCTTGTGGGCAGGCTGAAGCCCCTGTTTGAACCCGCTCAGACTGTGTAGCATGAACCTCCCCCGTGTTATTCGCGTTGAGATTTTAGTCTAATCGATGAAATGCCTGTTGTTTCGTCCCCGTAATCAAACCACGCCTTGTAGTTTTCGTCCCCAAATCGATTGGCCATGCACCCGGCACTGTGGGTGTGCGACTTAATTCATCCGTTCCTTCCGACAATACAGCACGACCGCTGGCGGGTTTCCCCTTGATTGTCCCTCCGCATATCAGGAAGCACGCAAGTGGAGGGATAAGGGGACAGCAGATTTTGGGTAGGGTATTTTGTCAAACGCCTGCCCTGCATCAGGACGTAGCCAGACAGGACCGATATCTGATGGCCACATGGATCGGCGCACCGTGCCGGAAGCTCAGAATTCTCACGGCCCAAGCTTCAAGAACATCTGCAACGGAATTTTGCCAGAATATCCTGCCAACCTGGAGTCAGTTCAGTCAGCTGGCATCATTTCCGCAAAATACGGTAATTATTTTCGCCGTGGGAAGCCTGCCAGCGCCGTCAGTCGCATTCTTTCGGTTGTTATCCGCAAGCGCGTTAGTCATGGTGGTAGCAAAATCTGGATCATTCCGAGCTGCCTGGGCCAGTTCATTCAGCGTATTCAGTCTCGTCAGGTACGCGTCGATATAACATCTGCAATCGCGGCCAGTACAAAGGGGGTCGCAATCGTAGCGGGTCTTATTCTTCGCCTCGCGGTTGGTGCTGTCGTCGGCGTTCCGGTCAGTGCCGACTGTCCATGTAGCTTTTCTGTTCGTTTGCAGCCTTATTACCACCTTAACCGCCTTTGGCGTGCAGCCAAGCGTTTCAGACGTGCTGTTGGTGCACTGCTGAGCTGCGACTTAATAGGGCTCCCCTTCTCGTTGTGTCCGCATCTCCTCAAGCGCGACAGCTGAAGCTATATCTTCTGCACGTTTTGCCGAATTTTGCACCGTATTGCCGCCTTCTGCCCGCACTTTTGCTCTGCGATGCTGATACCGCACTTCCCGCAGCCTCTGTCTCCCTTCGTGATGCCGTTGACGGCACTCCCGCCGCCGCTGTTTGCGTGCCCGGCAAGAGGGCGGGCCGTTCGGCTGCTGTTTCAGATGACCTGGCATTCGTCTCGACCGTTTTGCCGCCTGGCAGAAGCTTTTCCCGCCGTTTCAGCTGGACGGGGAGCTGCACGACCGGCACTATCATGGGTGGGGTTTCGTTGATAGCTTTGCTGCCTTTGTGCGCCAGGCATCTCGTGCTGAAATGGCGGCCTCGCCTGACGCGTCTTTCGTGGCCCGGTGGAGGCAGACGTGGCATCAATTGTTGACGCTGCAGCAAGCATTCGTTCTGACGTGTTTTTCCCGCACCGGCACTGGTGAGCCGCGTTTGTTAGGGACCTCTGCGGCTGCGGCACTTTTCGTCGATTCAGTGGCCTTTGCTACTGCTTCTGCGCCGGAGGACCTTCCTGAGCTGACGCTGCAGCCTGTTCGGCGACGTGCTGGCGGCGCGCGTCGTCATGAGGTCAGGTTGCATCAGTCACAAGGGCCGCGACCTGAGGCAGCTGATGCACCTCTGGCATCGCCGGCTGATTTCTTCCTCGCGTCTGCCGTACTGTGCCTACGGACGCGTTACGCGCCTCTTCCACCATGAGTTCAAGACGACGCAGCACCCCTCCTGAGCGTAACCGATTCCTATGGCACAGAAGGTATTCAGCGTCCCCGGTTGAATCTTCATACACGGTATGGTCCCGGCGTGCGATGGTGGAAAACCGTCAACCTGCAGAGTACGTGATGACCGTACTCCACATCCATGTGCTGTAACGCCCGGCTTCATCCGGATTCTCTACCTCCCACCGTGTTCACCCACCGTGGTGCTGTCCGTCTGGCTTTCAGCTGAATGGTGCAGTTCTGTACCGTTTTCCGTGCCCGTCTTTCAGGACTCCTGAAATCTTTACTGCCATATTGCCCCAAAAGCCCACCGGTTCAGGGGGCTATGAGTCATAACATTGTCTACTGGCTAATCAGAATTTATACAATACCCCAACGATGAATCCGTCAGTACGCCAGGTCGCCACTGCCGGAGCTTCATACAGCAATATGACAACGACGGACGCTGCCGGATTAATCGTATACCTGCACTCCACGCCCACGTGCGGCTATGCCGCAGTGGCATTTTCGTCGCCGGCAGTGGTCGTTCCTTTCATATCCCGGGGTGATTTCCGTCTTACGGTAATCCATGTACTGCCGACCGACTGTAGCCTCCATACGGCGTACGCACTGACCTGCTTACCGATTTGTAAACCGGTCCGGCCATCACTACTAACGTCCCACGCAGGCTCATAGTGAAACGTATCCTCCCCGGTCATCACTGTGCCTGCTTTTCTATAGACGCGACTCCCAGGGAACCGCTGACGCCACTGTCCGTTCATAACGACGGTACTTCACGTTAATGCTGTCCATGACTCACAGCGTATCCCCGCCCACGCACAACGACGGCAATGTACCCGTCATGCAGGAATAGCCCACAGTAAACGTACCTGTCCACCGTCCGCACGTAGGATGTATGACTGTCACGCAAGTGCGGCAAGAACAGCAACGAGATACACACAATACGCATCTAGTTCAGCCTCAATGTTATAATAAAAACGCCCGTTCCCGGACGACCTCTGTAACACACTCAGACCACGCTGATGCCCAGCGCCTGTTCTTAATCACCATAACCTGCACATGGGTGGCAAACGTATAGACCGGAATATCTGCCGAATGCCGTTAACGTAAGCGTGAACGTCAGGATCGCACCGTTTCCCCGACCCCGCAACTGGCGTCAACAATACGGGAGAACACCTGTACCGCCTCTCGTTCTAAGCGCCATCATAATCACCGCACGTTCATCAGTACTTTCCATAACACATCGAATACGTTGTCCTGCCTAGTACGTACCTTATTCCGAAAATCGTCAGGGAAAGCAGCCCTATCTGGCGATGTCAAAAGGATGAGTCATCGGTCACGGGCCGTAAACAGGTACGGGTCGACAGTCCACTGCTTTCACGCTGGCTAAAAGCCAGCGCTCGCACGCCGTGTATCACAAGGTCCCGACGATTTTCCGCGCTCAGCGTACCGTTTATCGTACAGTTTTCCACCCATCGTCACATTACTACTGAGCGTCCGGAGTTCGCATTCATGCCACTGATATCCGCATTTTTAGCGGTCCTTTCCGTCCGGGTTTAAGGAAAGGCCGGAGGATGCCGCCGCTGGTAATGGGTGGAGCGTCAGGCGCTTCAGGAACACGTCGTTCATGAATATTGGGTCGCCTGCCTCAAAACATCGGCGTTTCATTCCCGTTTCACGGGTCAATAAATGCGATGGATTGGCATGAAGTACAGACGCTCAGTTTGCCTTCCTCTTTTCTCCATGCTGAGGCCAACCCGCGACATAATGTTGCCGTCTTTGGTCCTCCATTTTGACAGCCCACATGGATTCCACTTATCACTGGCATCCTTCCTAAGCTCTTTCGAAAACTCCTCCCAGTGCTGGGGTTATGCGTCACTCGACTTTTCCAGGCCTCCTTGCCGATGGGATTCGGTTATCTTGCCTTTTAAAATCTACAAGCTCTTCCGCATCATCGCTCGCAGAACCGACGGCCTCCACGAATGCCGATTCAACGGCCGTAGTTCACACTGCGGATAAAGTAATAATCATGAGCGTCATATTGATACTGGGCTATCCAGTACAGCCGTACCACAGATAACGCGTTATGGTTTCAACCTGTCTCATGGTGCGCAATCTGCTTTTCTCGAGAACCAGAACTCAACTGTACCGTCGGGTCATAAACGGCAGATGCGGGCGTGGCGGTTATGGCAAATAGCCGGCGTCTAGCTCAATCCTGGACGGTGCTTCAGTGCGAGGGGCAAGTGCGAGTAAGATACCGGACGCCGGATGGCTGCTGCCCGCATTTACGCCCGGACTGTCAGCCTGTAGTCTCCAGCGCCAGTTGCGTGAAGGGGGTCGTAGGTTTTCCGTCTATGTCCGGGCCGTGCTGACCGACCCGCGCTCATTGCCGTCGTGCTCGTTACGCCGTCAGACGAGCAGGAAACGCCCTTCACCACCCTTCGGTGTGTCCCATCGCGCCTCATAGATGATATTCCCCGCTGTCTGCAGTACTTCTGCGGTCAGGTGCTGCACCGGGCGGCGTGACAGGATTCACCGTGCCACTCTGTTCAGCGTTAAATGCGCCCCGTTATCCACGATGGCCCTCTTTTCCGGCACATGCTGCACGGCGGGCTGGCATACGTGCCGTCGTCGTTCTCGCACGATACTCACGCAGGCGTAACAGTCGCTGTAGGCAGCGTCGGCAGCTTCCCTCACTATCCCCATACGCCCTTATTCAGCAACACGTCAGGAACACGGCTCATTTTACCTTCGCGCCGTCCTTGACGGACCGTACCTCCACGGTGACGGATTCCTTGCCACTTCCGTTAACCATTATGAGCGCGTGATGGAGGATGGCAGCGTACTTTCACGAGTCGAGGCGTGGGAGGGATAGGCGTCGAGCTGTAGCTTTCCCCCATTCAGCACGACCACCGTGAGACCGGCATAAGTCATCATCGCAGATTTCAATACCTCCGGTACCTGGCGAACCCTTCTGCGCCGACCGTGGCAATCTACGCTTTAGTTTCCAGCAGTTCTGTTTAATCAGCCACCGCCCGGCGCGGTGCCGATCCCCCGGCTGGTACAGCCAAAGGCATCCATCATCTTCGTAATAGATCGACCGTAACGGGCAATGGCCTTAGTATCTTCAACAAGCTCTGTCGCCGTCTCCCAGCCGTTGTTCGATATTAATGCGAGTTCACTCCTGGACCGGCATTGGCGGTCCTTCAGGGCGCTGAAGTGGGGCTGACGCGCCATCATCCGGCATCACATTACTGAGTTATAGTCCACGTCTTATCCGACGTTAGTCCTGCACGAACTACTCTTCGCAGTCTGCGTCCATACCCGGCATACCCCGCATCGCCGAGCAGAAGATCAGGCACATCCACGCCTTACGACTTGGTCGGAGTAGAAGGCATAGCAGGTGATGCGCGGCTCCCGTCGCAGCCAAAGCCGTCCCGGCACTGATGACTGGTCGCAGTACTGACCATCATAACAGACGGCCCATTTATCCACATCCGCCTCGCAGGCAGACCTTTCCCCATGCTTACCCTAGGGGTGATGGTTAGTCAGCATATCCACAGAACAGACAGGCTGTTTGTCTTACTGTATGCCGTTAAACGTTCCGTCCCAGATACGCTGTATGCCCGTGCGTATAGTTCGACGGACGGGCAGAATACGCCGGCAGATGATAATTAAAGAGCCCTGCTGGCTTCGAGGAACTGCTCCGAGTCCACCTGCACGCCGACCCAGTGCCGTGTTCGGGTAATCGTTTCACATCGATGATTTCGATATATAGACCAAGAGAGCGTTTGTTCTGCGGCAGCTGGTCCTTGGTGCTGTCCGGCGTCATTCCTTAGGATGGATGGGTTAAACGGGCGGCAGGTCACCCCCATCACCACCGAGGCCAGATACTGCGGGTTTTGCCCTTAATGGTGATGTCTTTTCTCGCGTCACCCAGCCACCGTTACCGTTGTATCTGAACCAGCAGGCGGACTTCCGACGATTCCTGTCACCTTTGAGGTGGTTTCCACCAGTGCCTGTACTAGAAGGTAAAGCGCAGACGGTCGATGTTAGATTCACGTAATGGTCGGGATCGTGAGTCCTTCATTTCGTCCGTAGCAGCACGCGTTGTACCAGTAGAACAGTTTTAA
>125
CCGTCCTACCTCGAGTGGCCCATCATGCGGTGTCGCTGCGGATCTAGGTGAGGATGGACCCACGTTGAGCTTATTTAAGGCGTGAAATGGAGTGTACTAAATTCGGGGAAATCAACAACCGAAAACATATGAAAGAAAGGTAGAGAGACGAAGATTACAATGCAAGAGATAACATACAAACAACCAACTGATTAGATGCAAAAGTAACAGATTAATCCGGCGAGCGTCCCGTCGTTTCATGGACTTGCGTATGAGACAAATAAGCAGAGTACCATATGCGTACATCACGGGTTCATCGTTTAGATTACATGTTATAGGGTCGTGATTAACACAAGCCCGATTACTGAGGACGACAAACGCCAATCCGGTGAGTTCGAAGGGCAGAGCGCAGCAGTGCGAAGTCGCCTGGCAAGCAGGGGAGTATGGATGCCGCGGCCTTATGAATTCGAGCCTAATATAGGCGACGCGGGTACAGCACGACGCCGGTGGTATGGGGTCGGCTAAATCACTAGGATCAGGTGCAACACAGTGAATTCGAGCATCGCATGTGGAACTCGTCGCTGTGGGCCGTGTCATCCTGCATGTGGTGACATAGTTTCCCATCAGAGCACTCATCACGTGTGGAAGGAAACTGTCACCAACCAAGAGACGCTGAATCGATTTTACTGTTAAATGGGGAGTGCTAAGCCCTAGAGTACGGTCAGAGTTGGTTCCTTACGTATGAAGATGAGTGACGCGTCCGTGATGGCACGCCGCCACGATATGAGAAGAACGCAGCAATGTGAACGCCGGACCGATGCCATGACGTGGTGGTGAATTAGAGCGTAGTAGGACAGGTCGCGCCCTTGTGACTCTTGGGCTGGTACAGAGCACGACGCGACAGCCGTCGCTACATTCAGTGCATCATCGTTCCTATAGGAAGCGTCCTCCGGCTAGAGACGCGAAGCAACTCCACTCAGCACTGCAGCCATGCAAGGTCGCAGCCCCGAGTCGCCACGGCCGAGCAGTAAAGGGATCGCGATGGCAGGCAAAGCGATCGAAGGGAAACGGGCGGGGTTCTCGCCGCTGCATATCCACGGCCCTGAGTCCTCCCGCTCTAGAAAGGTCAGAAAAAGAACCTGCCTCAGATGCGGTGATAAACAGAGGCAGCCCAAGTGCGCTCCAACCGCGGCTTACCGCAATCGCTTGGCTGTGGCTTCGTGCGGGATTCAGGGCAACGAGCAAGAATTCATCAGAACGAACGCGGACCGTTGGCAGACGCCGATTGCAGGTCACTCCGCTCGCGGCGTCAACGGCCTCTGCGCACCAACAGGGCGGGACTAGGACGAATGCCGTCGACGGGATGGCGCGCCCGGGGGCAGACGGGCAAAGAGTGGCGGGGAGCGGGGGAGTGCGTAACTAGCATCACGAAGGACAGAGCGTGAAGGCGAGATAGAGCATCGCAATACACGTGCATAAATTGAAAACGTGCAAGAAAGATATAGCTTCAGGCCTGTCGCACCATGTTGGATGCGGACACCAACGAAGGGGATAGTGCAGCTCAGCAGTGCAACCAACATGCACGTCTGAAACTTGGCTTGCTGCAACGCCAAAGGCGGTTAAGGTGGAGCCGATTGGGAACAGGAGGCAGCGGATCCGACTGAAGACGGAACGCACTCCCACCAACCGCGCTCTAAGGGAACAAACAATACCCAGATTGCGAACACCGCTTGTTGTGACCGCGATTGCAATGTTATCGACGCGTCACCTGACTAATACGAGGGCTGAATGAACGGCCGCGCAGCGCTGAATGATCCAGATTTGCTACCACCATGACTAACGCGCTTGTTGGGTAAATAAACAGGATGCGACATGACGGCGCTGCAAGGCTTTCCACGGCCAAAATAAATTACCGTATTTTGCTAGGAAGACTGATGCCGCCAGCCCTGAACAACTCAGGTCGAGAGCGGCAGGATATTCTGGCAAAAATTCGTTGCAATGTTTGAATAATCCGTACCCGCATTCGCTTTCGATGAGGTACGATCCCGCCCGTGGCCATCAGAGCTCTCCGTTCCGTCCGACTGCTCATGCGGGACGCAGGCGTTTGGATACATACGCGAACTTGCTGTCGCGTATCCATCGGGTGTGCTTCCTGATATGCAGGCAGGCGGCCAGGAGGCGAATCGTGGTATTTGCCGGAACAGGATGGAATTAAGTCGCACACCCACAGTGCCAGTGCATCCGTACGGATTCTACCAGCACGAAAACCATCGTCGTTTGATTACGGGGCAATAGACAACAGGCAGGTTCAATTAAAGCACGATCAGAACGGGGGCTCATGCTCACAGTCTGAGCGGTTCCAACAGGGCCACATCGGCTTGCCCACATGGTTAAGGATGAACAGTTCTGGCTGGAGTCAGTATGGATAGGCAACCATTACAGGAAGTTTTATCCACAGTTAAAGGAACCAGCACAAGGGGGCTTGCTTACTTTATCGAAAACGGACAGTCAGGGCAGCCACAAGTCACTCGGTTTAGTGAAGCGTGAGTGCCCCTGCGCGCTTAGGCATACAAGTTGGTATGCAGCAGCATCCGGTTATCATGCTGCCCATTCGTCTTTCAGTATTGGTTCTGACACGGACACCCATCACCGTTAACGCTGCGGTAACGCGGAAAACACCGTCAAACATTGCATTTAACTATTGAGCGTGCATAATGGCATTCAGAAGGCATAGACAAGCACCGAGCACCAGATTATAATCTGCTGGCCGGGCATTTAATCTTAAATAGGTGACGGCATATTCCGCCTCATACCGGTGCCTGCAACAATCCAACTTGCACCCGACTTCCCGGCTGGCTTTGGCTGTTTCAACAGTACTTGAGGCATCGTGGCATCTCGTTGAAAACATCGGGGTAAACCGTCTTAACTCTGCTTCCGGCACTCCTAGGTCCTGTCTCTTCAATTCTCGGTCGTTGACGCGCAAATTTTACCTGGTTATCGCCCGGGGAGGGAATATCAGAAGTGGAACGGCACAGCCTGGCGAAGGATACGAAGCAGAAAACTGTTCCCAATCGGGATGGAGAGGAAGAACAAAGCCTGATGCAAGCCGTAGCCATATTGCGCCTTCAGGATGAATCTGCAGATCTGGAAATTGCAACGAGGAAGAAACCTCGTTGCTGAACGCCTGGAAGAAGTAGGTGTGCTGAACAGTTGCATCAACTGCACCTGATATTGAGTGGGTGCCTGTCCTGTTATGGAGTAATCGTTTGTGGCTACTATGCTGGCAGAACCGTGTATGGAAGCACGTTTGAGTCGTGTCATACTTGTAAAGCTGAGTATTGGTTATTTGGCATTATTATCTGTCGGAGAATAATGGAAGTTCACTCGTGTTCACTGGTTTACATCGCTAATGCTTTAAGACTGAACGCATGAATATGGTTTTCGTCATGTTTGAGTCTGCTGTTGATATTTCTAAAGCAGCTTTTTCTTCGTTTCTCTAACATGTTTCTCATGAAATACATTTTGATTATTATTTGAATCAATTCCAATTACTATGGCGGTCTTTCATCTATAATTGGCATTGTATGTATTGGTTTATTTGAGTAGATGCTTGCTTTCTGAGCCACCTGAGACCCAAATGAAGCCATAGGCATTTGTTATTTTGGCTCTGTCAGCTGCATAACTAAGTAACTTTGTGTATTCTGCGTGGTTGTTCACTGTGGTGTTGTGATTAGATCGATTGGGTGGAATTTGTTATCATAAAATTAATGTTTGAATGAGCAGTTGCGCTGCATTTAACGGCGAGTCGAGTGTAGTCAACTAACTCCTTCTGTCGAAGTGATATTTTAGGCTTATCTACCAGTTTTAGACGCTCTTTAATATCTTCAGGAATTATTTTTATTGTCATATTGTATCATGCTAAAACCTAACAATTTGCTTATGAGTAATCTTTTAATTTTAAATAAGTTATTCTCCTGGCTTCATCAAATAGGAGTCGAATGATGTTGTGAAATCACATCGTCAGCATACAGCAGTTACATCAGATGTTATTTACATGCAAGGGATTGATTCGTGTACCGGCGGCTTTATCTCTGACGCCATCTTCTGTACTAATAATATTACGCCATAACATGAAGTGTGGTAATAGCGTGCAAGTACTAATCTTTTATAATGATCATCGCCAGGTACAGCAACTCACGTCTTTCTCAATGTTAATAAATAGCCTGCCTCTATTCTAAATCCGTCTCGACCAGAAGCTCGCGACCTATTAATTCCCGTTGTGCCATTGGTAATAACATTATTTTATACCAAATGTTAACATCTGGTCCTGTTGTAACAAATAAATGTTACTGTTCTTTTGGTTTGCTAAATGTAGATGAAGCAAGGATGCGCCCAAGGCTTGCCGCTCGAGTTTTCTACTCTGCTTTCTTTCCGATGTTTAGCCCAAACTCCCATTATTACTCAATCGTGTTTCCGTTTTTAGTAATAACGCTTATTTACCAAGTGTCAATATCCATAATTTTGTTTGAAATATAGTAAATGTTACACTCCGTTCTTGCGAAGTTTTTAAGAGGAGGTCTATTCAGGTTGAAGTAGATTTGTGTATTGTGCCGAGTTGGGCTCACTGACGCGTATTATAGTGCGAGCATTTACATAAGTGCAGGTCCAGATCTTTGGTTTCCCGACCGATTTGGACGTACTAGACTCATTTTGGACTCGGTGCTGTATCAAACATGAACTTTTCCGTGCATGCCGCTCAAGCCACGCCTGAATCTAATATTACCCACTTGTAACTTCCATAACTGATTCGTTCAAGTTGGTTTGATCTTTGCGTAATTTCTTATCGCCCATCTCTATCCGGAGCCTGGGTCTAATTGATACAGGAAATTCTCCAATAATCTTGACTTATCAATTTCAGATCGTATGCATAAATCCAATTGGCTTGGCTCTGCTAGCCGTGCTCACCGAACGAGACTCGTAGAACTAGGAGCTCCGTCGTAACTTGATCGAAGAGTATGCGGCTATACGATAGCGCCGCTTCCGCGACAAACCCATATTGGCATTGGGATGCGGGACCCGCTTTACGACTTTGCATGGGGGTTTACCCTCCCTCCAGAGCCGGCATCACTGTAACTTACGCAGGGTTCCCCCTGGAACCACTGTATTCAAGGCCTCACTTGAAAGCTTCTTCCCTTGTGAACGCCTGTTAGGGTCTCTCACTTACCGCGAAATTGATTGCAGGTTACTAGCACGTTGTACTAATAGACACCTCCATAAATGTCAAGTTTTGAAGACTTTGAACTATAAGTGTCCTTTCTATATGTTCAAACCGACATTGTCTAAGTGCTCTGGAACAGCAGGCCTGTAATTTACGAGTTGCTGGAGCCTTATCTCGTAAGTAGTTTGCATAACATTGTCAGGAGTCATGTCAATCTACTAATAGTGTCGATTGAGTCGACCAGATTCTGGTATGTAGCTCCTCTGTAAACGGGGACGTTGCGGTCTTACTGAAGTGGCTATTTCCTTACTATTTTATCGCATAGGATTTTCTGTTACAGGTGATCATTCACTCGGTGTAAGTTCCCTGCCTCCAAACGATACCTGTTATGCGACTTATTTAAGCTCACTTGAGGCCTATCATCGAGGGTAAAACTGTTGTCTTCCACTGGAGCGCAATTACTAAGGCGGTGAAGCGAAAGCTCTGAATCAACGACCGGGGTTTAGGGGATGCAGAATTTGCGACCCCAAGTGTAAATTCACGATAAAGTTGATGTTCTCATCTACCCCGCCAGGCTCTCGAATGCTTACCTCCTCGACGGACCTCCATCCAAACTTGACCTCTTTCTTAATACGATATTGCGAAGCGTTCTAAGGCCGGATGGAACCCCGCAGGAGTGCTTAAGCTCGTAAATCAAGTACCAGCAAAGGTTCAAGAAGCTTGCGGGATGAAGAAGGCATGATCTGACTGTTGGTCTTTCACTGACGCAAGACTCCTATTTTCAAGTGAGTGAAACTAGAGCATGTCGATACTGAATCACTCTGTTTACTAATTCTTTGTTATCTAGAAGAGCTTATGTTTCATGTTTCTAAGATTTAACCTTCAAGTACCATGGCTAGCTAAGTGCTTCAATCAGAGGTGTGCGTTGCTCACGAATTGCTTACTAAGCCTCTGGTATTTACCAAAGAGCTTGCTGGTCTATTGTTTAGTTCTTGAGAAGGATCAAATGGAAGGAAACGAATGAAACCGTAATGAAGTCTCTTTCTACTCCTTTATCTGCGATATAATAGCGTCCGAGACAAAGTTATGCCTCAGTTTCAGCCTCGTTGGCTAACGCAGCCAAGGGTTTCCATCAAATCCGCTACTAGTTTTACCAGTACTCTCACCATAAAATCGTCCCTAATAGAAGTTCTAACTCTTCCATGCAAAACCACGTTATAAATTCACACTAGAATGGTTCCACTATCGGAGGCAAGCTCAACGGAATCTAAAGTGAGATAGTACACGTATGTAAATTCTGGCAATTTGTTCTATTTACATGCGGCCACTGACTCGCCCTCGAGTTAATCAATGGCTAGCCATGTCACTGGCAATGTCGACTATCCTAAGAAGAGTAGCTAACTACTGTCTGATTGCTTCTATTAATAGTCAATGTTCCGCCATGCAGGCGCATGTTGAGAAATCACCTTGCAGCGTATAACGGAATGAATTTGCGGAGGTGATTAATTGAACAGCATTGCGTGCTTACTTCCGGATTAAGTCAATTACTTCTGATACAGCAGAGGCGCATCAGCTGCAGGTAAACGTCTGACAGTAAGATAAAACCTTTTACCAACAAAGGACATCTATTCCAATTATTGCTCTGGCGACCGCGATGCGTGCCAATAATAAATTCGCAACCATATTTACCCTTAACTTGTCATAACAGACCGCAATTGTCCTTAACACATTTATCGTGGCAGTTCATTGAGTACATGGTCTTCCATCCAAAGGTCTTGACTTAACTCTTCAATGAGAAGGCGACAGCTGAATGCTCCGCACTGCGATTGCATCTAGCACTTAGTGGTTTGACGATAGTCATAAGCCGCAGTTATTTCAAACTTACCTCTCAGCTCTCAACCAAGCCGATGCTGAAACGACTTCCCCTCCGGCAATCACCACAGTACTTTTAGGAAAGTAGCATTGCTGGTGCGAAAGTCGTGAAAGAAAGAAGTCAGCCTCCTATCCTTCCTGATCGCTGTTGCCTGGAATGCTCACCGCGATGCGCTAGCTCCCGCCTGGAAGTGAAACGAGCAATGCGAAGACAAATGCTTCTGGCATTCTTATACAGATAAGTCATTAATGTTGTTTGAGCACGCGCATATGTCCTTGTTTTAATATTAGTTGCTAGCAATCGTGCATTCAAGGTTGTTGTTTACCTATAGGCATTCCGCTCCAGGGGTAAGGCAGATGTTCTTTGGGCATAGAATTAACCGTTACTAGCACTGACAGGTTATCATATCAAATAAAGCGAGTCAGGCACTCAATTTTTCTATTCTGCCTATCGCAGAGCTGTGGAGCCGTGGTGGATTCATGAGACCAGCCGTCTAACACACGTGCATCGTGCTTATCGCATTTCTCAGGAGTACGCAGACAAGCATACTCGGAAAACCCGAGGATCCTTTCGATGTCGCTCTTAATCTAATTTGGCCACTCTAGCCGTGACCTGGGACTATAGGTAGTCCGCAATTATGGTTGACATCTCCTGCACTTTGCTGAGATGTAGCCTCCTTCATATTAAGTTTCTACTAAGGAAGAGCAAGCCTGTTCAAGGAATCCCGTGTTGCGCCTCTTAATAAAGTCCCATCCACGTATCACTTACTTCTTCTTTTACTAAATGAGATTCGTTGCCTCTACATTTCCGGACTCCCATTTTCCTCTAAGTTGCTCGCTCCCTCGCTGTAAAGGACTAGGCCTTGTTCTTGTAAGGAGGTAAGTCATTCCAACCATCTGCTCGTATTGAATGCCTTATTTTCTCTGCAGGGAAGCCAGCTATTTCTTCGCTCATCGCTATGAGCCACTACTGACTCATGCCTCTTTGGTCTCATTAGCATCCGCAATTGCGTGTTGGCTCACAAGTGAGAGCATCAGGCAGAATCTCCTCTTTTAAATTGAGCTCTCACTTATAAGTAGCGTTTTGCGCTCCTAATTCCCTCTGATTATGCGTGATGTAAGCCATGAAGTACTTAACGAATTATCACTGTTTACATATGTTGGCTTTCTTGGAAAGATCCCACAGCGAGCTTGGGTGCCATATGTTACACTGGTGCCTGTCCTCCAAGCCAACCGCTTCTATTAGTGCATATAATGACTACCGCGGTAGGCGTGGTAAACTTCAGGCTTTCTCGAGAGCGGGTTCTTCAAAGTATGGCTACGCTCACTGGCACCACATCGACCGCTGATTCTGACTAAGTTTCGCCTCTAGTCTTAACTTCCGCTCCCGAAAGCCCATCGACGGACACGCCAAGGGCTTCCTCTAGGACGATTCATGGCGCGGATATGCGGATGCCTGATGTGGAAGTCAAGTATTGCAAAGTCTCCGGAATCAAGAAAAAGCTGCCGTGCTCGTTTCCGCCTATCGCTGCTATCTTCTTACTCTTGCTATCTGCATGCTATCTGGCGCCGCAGAGCTTTGCACTAGCTTACTCTCCGCTTGCGATTCTAGTTGAATCGTCCTCCGATGCGGCCTCTTTGGGTACTCGGAAGCAGGCTAGATGCCCAGAAAACAAACCCGCTTGCTAGTGATCGATAACTTTACAAATCCCCGCTCCAGCATCTAAGTAGTCGTACTTCACTGATAATCATGGTGTTGTTTTACAGGCAGTATCTATCCACTTAGTTCTTTTATTGATACGCACTTATCCACAGAGTCTCCTGGCATTGGACTTTAACTTAGATTTGCCGATTTACACGTGCCGGATCCGCTGTGTTGGCGCTTACATAAAGCTGCGGTCTTCTTGACAAGATTTGTTAAGGCACAACCATAGATCTATAATGGCGCCAATTCTAACTCATGATTATTTGGATTTTTCAATTCCCTGGCAATGCTATATGTCATCAGATACTGTGGACTAGATGGTTTAAAGCTTATGTAAAGAGGATAAGATGTTTGCTCATCTTATCACGTTATCTGCTTTAACATAAGCCGTGGATGTGCGAAGACGACTGCGAAACTCTACAGTGCACACTGAGCGGATTGTACGCATTCGAGGCCGGAAAAGCCATGGGTACATGTTCGTGCCCATAGATAGCCATCTGCAGACTCTGTGCCGGCGACTGCATTTCGAAGCGGGGTTAGGTGCGATTATGGTTTAAGAGGGGTTACTTTAGTATTTATCATCAAGTGTTTTGAGTAGTTAGTTTGATATTTGGAGAGCGAACCGAGGCAGCGGATAGATAAACGAGAGGTAAGTATTTTAAACAAAATGAGGAGAATTTTACGCCTGTTTTGCTTTGCTCACAGCTCATAAGGTATCCATACGATATCACTCAACACTGCTTTTAGGAGAGCTATCTATAGGGATAAATTCAAGATCTACAGGAGTTAGCGATTGAATCACATCAAGAGTAGAAGAGATAAGTATATGGTTACAAAGTTAGTGTAGTATAATTTTCGGGTCGTCACAAGCCGTAGTCTTGGTCTCCATTACAACAGACCATTTGCTGCCAGTGAGGCGACAGACCAGTTTGTTGTTATATAGGTACAACATTCAGCTATTTAACTAGAGTCGCGATAGTACCACACACTGGCCATGTTGATTATTAGTACAAACCAATTAGACATTAAAAGTATGAGTCAAGTAACGGTTAAAAAGAGTTTTCTTTGTGGCTTCAGTACAAACAGGTCAGGCAGGTAAGACCTTATTAGTCGTCAGTAATTTGCTCATGTAATTTATGAGGTGTCTTTAAAGTGGGTCAGTGTGGGTTGATAGTAGATAACTCCACAGTTCGTACAGATTGGCCAACTAGATATGAGAATACTTAACGTAACAGAAGATTGTATCAACACCTGTTGGTTTAGGTTACAGTGTTGTTGAGACAGTAATAAGATGTTGTAAAGTACCAAATTAACAGTACTGTGCGATTTACTAGGTCTCTTAAGGCGGCGGGTAAGTGGCGTCAGTACTAATACTTATAGAGGTGAAATCGACTTGTTTTATAAATCACCACAACGTACGAAGGCTAACATGGTCAAGTTTAGAATTTCTGATTACTCGGTTTAGGAGTATTGAAGAGAC
>126
TTATTGGTCGTGTTAATCTTCCCGAGGTCTCGGCCCGAACACGTTGGCAAATCGGCATTCGTGGAGCGTCGGTCGGGCGAGCGATGATGCGGAAGGTTACCTGGATTTTCAAAGGCAAGATAACCGATCCCATCGGCAAGGAGCTGCTGGAAAAGGAGGCGAACCGAGGAGAATCGAGAGGAACTGGAGGTTTTCGGAAAGAGTGGAAGGATGCCAGTGATAAGTGGAATGCCATGTGGGCTGTCAAATTGAGCAGACCAAAGACGGCAAACAGTCTATGTGCGGGTTGGCCTCAGCATGAGACGGAGGAAGGCAAACCTGAGTTCTGGTTGCTCCAATCAATCGTATCGCATTTATTGACCCGGCAAACGGGAATGAAACGCCGATGTTTGTGGCGCAGGGCAACCAGATATTCATGAACGACGTGTTCCCTCGACTCCTCTCGCACGCTGCCCCTCCCTCCCAATCCTCCCGGCCTTTCCTGACACCGGACGGAAAGTGACCTCATAAAATGCGGATATCATGACCGACTTGGAATGCGGTAAGCTCAGGTAATGTGACGATAGCTGGAAGCAAACTGTACGGATAAACGGATTGGCTGAGGCGGAAAATCGTCGTAACATTGTAAAGGCGCGAGCGGCCTTTCCGCGCCAGCGAACAGTCGCAGTGTGGACTCCGTTACGTAGGTACCCGTACTGTCACGTGACCGATGACCATCCTGTTGATCTGGAGATGGTGCTTCGCTCCCTGTTCAGAAGGAGCGGGCAGAAGAGATAGATAGGAGCGGCAGTACAAACTCATCGACCTGCGTAGTTTACGTCCGTGAAAGAGTTCAGTGAACGTGTTCTACGATCTTTACCTGCCGGCTAAACGTGGAGGGGAGATTACTCCCGTATTAGTGACGTTCGCCCGTACCGTTAAACCCTAATGAAGTCAGCGACTTCATCACGTACTCTAAGTTTGCCTATACCATTGCCGGCAGGTCTGGTGATCAGAAACAAGCATGACTTCGGGCTCTTCTTCTTGTTACAGGTTCGTCCGGGAACGGGCGTTTATTATAAACAGTGAACGATGCCGTAATGTGTATTGCCGTTGCTGTCCTTTGCCGCACTTGCGAACCATGCTCCGAGCCCGTGCGCGACGTAGACATGGTACGTTTACGGTGGCTATTTTCAATGACGAACCGGGTAACATTGCGTCCTTTTGTCCATGCGGGGGATACGCTGTGAGTCATCTGAAAGGGATTAACGTGAATACCGTTGAGCTGACGGACAGTGTGGGGGTGATGGCTTCCTGCGTCACCGCGTCGAAAAGAGCATGAAGCACAGAGTGACTCGGGGAGGATACGTTTCACTGCAGCTGCTCCCCGACCGAGGAGAGGCGGAGGGATGATATTTAGGAAGCCACTGAAGGTTACGATCCGTACGCCATGGCCGGAGTGGCTCACAGTCGGTGTCCTGAAGTACAATGGATTACTAATCACCTCGAAATCATCAAGAACTGAAAATCCAGCCTGCCATTCCCCGGGTGAGTGCGAAACGATAACCAAGATCTCAGTCCAACGAATGCAAGCCATATTAGTCTCGGCGCTCGTCTGCCTTCTTTCTTATATTGCTTATGAAGGCTCCGGCGGATGGGAGACCCGTACTGACGCATTCATCGTTGGGGTCGGTTATAAATTCTGATCTAAGCTAACACAGTGTTATGACAGCCCGCTTAACGCTTGGCTTTTTGTGGGTGAATATGGCAGTAAAGATTTCAGGAATTGAAAGCACGACAGGAAAACCGGTACAGAACTGCACCATTCAGCTGAAAGCCAGACGTAACAGCACCACGGTGGTGGTGAACACGGTGAGCCAGAATGCGGATGAAGCCGGCGTTACAGCATGGATGTGGAGTACGGTCACGTCCCTGTGCAGGTTGACGGTTTTCCACCATCGCACGCCGGGACCATCACGTGTATGAAGATTCACAACCGGGGACGCTGAATGATTTGCGCGGGTGGGAGGAACGGAGGAGAGGAATGCAGGAGCGTCGTCTGTTGTCTTGAACTGATGGTGTGACGAGGGTGGCGCGTAACGCGTCCGTGGTGGCACAGAGTACGGCAGACGAAGAAATCAGCCGGCGTTGGAGTGCATCAGCTGCTCAGGTCGCGGCTTCTGCTCCTTCCCATGGTAGCTCCCTCATTCCCCCGCCGCCATTTCCCTCGGACAGGCTGCATCGTCAGCTCCCAGGAAGCGTCCTCCGGCGCAGAAGCATCAGGACCGAGATACATACTCAAGGCTAGAAAAAGTGCCGCAGCCGCAGAGTCCTCAAACGCGGCGGCCAGAAGTGCCGGTGCGGCGAAAACGTCAGAAACGAATGCTGCAGCGTCAACAATCAGCCGCCACGTCTGCCTCCACCGCTCACGAAAGCCGTCAGGCCGCCACTTCGTTAAGCACGAGATGCGGTGGCCTCAAAGAGGCAGCAAAATCATCGAAACGAACGCATCATCAAGTGCCGTCGTGCAGCTTCCTCGGCAACGGCGGCAGAAAATTCTGCCAGGGCGAGCAAAACGTCGGAGACGAATGCCAGGTCATAGGAAGAAGCAGGAACCGGCACCTCCCGGCATGGGACGCAACATAGGCGTACTCGTCAACGGCATCCACAGAAGGAGGACAGAGGCTGCGATGGAAGTGCGGTATCAGCATCGCAGCAAAGGTGCGGCCAAGCACTAGCGGCAATACGTTAAAATTCGGCAAAACGTGCAGAAAGATAGCTTCAGCTTCTTCTAGGTCCATGCTCCATCCCAGAAGGGATAGTGCAAGGCTCACAGTGCAACCAACAGCACGTCTGAAACGCTTGCTGCAACGCCAAAGGCGGTTAAGGTGACTTGATGGAAACGAACAGAAAAGCCCACTGGACAGTCTAGACCCAACTCCAAACGCCAACAGCACCAACCGCTCAGGGAACAAACAATACCCAGATTGCGAACACCGCTGTTGTACTGGCCGCGATTGCAGAGATGTTATCGACGCGTCACCTGACGCACTGAATACGGCAAATGAACTGGCCGCAGCGCTCGGGAATGATCCAGATTTTGCTACAGTGGACGCGGTGTGCCTAGGTAACATGAAGAAATGCGAAGACCCGAAGGGGGATGGCAGGTTGGAAACCGAAATAAATTACCGTATGTCCTGCGTGGAAAATACTGCCGCCAGCCTGACTGAACTGACTCAGGTTGGCAGGAATTTATACTGGCAAAAATTCCGTTGCAGATGTTCTTGAATACCTTGGGGCTTGAGGATTCGGCCTTTCCGGCAGCTGTAAGCGTGAGTCCACTCCATATCGTTCCGTTATCATACGTCCTGATGCGCAGGCGTTTGGACTAGGTTAGACAAATATTGCTGTCTGAGTACATTTCCCTCTTGCTTCCCTCTGGTAGCAACAATCAAGGGGAAACCCGCCAGCGGTCGTGCTGTATTGTCTCAGGAACAGGATGGAATTAAGTCGCACACCAGTGCCAGTGCATGCATTAACATTTGGGGAGAAATGACCACATCGTCGTTTGATTACGGACCAAAACAACAGGCAGTTTCAATTACGGCTAAATCGACGAATAACACGACGGGGCTCATGCTCACAGTTGAGCGCAGCGTCAACAGGGGCCGGGTCTAGCGCTGCCACACAGTGGTTTAAGGATGAACAGTTCTGGCTGGAGTTACGTATGGAACAGCAGACCATTACAGGAAGAATTATCCACAGTTAAAGGGAAAGAGCAACACAGGGTCGCCTCATGAAACGTGGACAGGCAGGCCACAGTCACTCATTGTTGCTAATCCGGCTTGCAATCGCTGCTCCACACTATGCGCACATACAGTTGGTGTGGTGCCAGCGTCGATTCATCCAGTTATCGGTGCTCATGCCCATTCTTTCATGATGATCCAATTTAGCACACCATCACCGTTAACGCTGCGGACTAGAAAAGCCGTCAAAACATTGCATTTAACTATTCTCCGGCTGCCTATCGCGGTTCGGATGAAACCAACGATAAAAACATCATAATTGCTCTATTAACTTAAGGACTAATGAATTATTGGTGAACTGACGCATATATTCCGCCTCATACGGTCTGCCTGCAAAACAGTACCGATATTGCACCGCCAGATATTCCGGCTGGCTTTGGCTGTTTGCAACAGTGATGAGGCATCGTGGCATCTCGTTGCAACCATCGGGGTAAACCGTCCTGACGTGGCATTCCGGCGACGCGTTATTTATTTCTGAACTCGGTCCGTTGACCTAAGAAAATTTATCGAGAGCGCCGGAGGGAAGAGGAAGGAACGGCAAAGCCTGGGTGAAGGATACGGAAGCAGGATAAACTGTTCCGATACAGCGGGAGGCGGAAGAAACAAAAGGCTCATTATGCAGGTAGCCAGTGAGCATATTGCGCCGCTTCAGGATGCTGCAGATCTGGAAGAGTGCAACGAAGGAAGAAACCTCGTTGCTGGGAAGCGGGAAGAAGTACCTGTTGCTGAACCGTGTTGATACGGACTGCACCTATCTGTTGAGTGGCCTGCTGTCCCTGTTATGGAGCTCCTGCCTTTTGCCTCTGCCCGATCCTCCTTTGGGATAATAACGTTCTGCGGTTAGTTAGTATATTGTAAAGCTGAGTATTGGTTTATTTGGCGATTATTATCTTCAGGAGAATAATGGAAGTTGGTGACTCAACTTGTTCATAGTGTTACCATCACCGCCAATTGCTGTTAAGAAGACTGAACGCATGAAATAGCCTCATTTTTCGTCCTGTTTTGAGTCTGCTGTTGATATTTCTAAAGTCGGTTTTTCTTCGTTTTCTCTAACTATTTTCCATGAAATACATTTTGATTATTATTTTGGGAATAGAATCGCGAAGCGTACCCGAAGTCGGAGCGCTAATGGCATTGTATGTTCCAAGGCCGGAGTAGATGCTTGCCGTTTTTCTGAGCCCTATGGTATCCAAATGAAGCCAGAGCGGCATTTGTTATTTGGCTCTGTTGAGCTGCATAACGCCAAAATATATTTATCTGCATTGATCTTCAAATGTTGTATTGATTAAATCAATTGGATGGAATTGTTTATCATAAATGCCTTTCTGCATTACTCCTTAGCCGTTCCTTTAAAAGTCGTTTTCTGCAAGCTTGGCTGTATAGTCAACTAACTCTTCTGTCGAAGTGATATTTTAAGGCTTACCAGTTTTAGACGCTCTTTAATATCTTCAGGAATTATTTTATTTACTTGTATCATCCTAAATGACACTTTGCTTATGGAGTAATCTTTTAATTTTAAATAAGTTATTCTCCCTGGCTTCATCAAATAAAGAGTGGACGGTCATGTTGGCCAAATCACGGGCGTCACCATTGGATTGTTATGTTGTATGCAGCCAAGAGTTACAGCAGTTATACATTCTGCCATAATTATAGCTAAGCAGGAAAGAGAAACGCGAGCATCTAGGAGTGTAGCGACCCATCGTCTTTCTGATTTAATAATAGATGATCTAGTTAAATATGAAGGTAATTTCTTCTTTTGTGCAAGTCCTGACTAAATCTTTACCAATGTTTGAACATATTTCATTGTAATAAACTCCCAATTACTTTCTTCATCAAAGTGGCAATAAGCTGAAATACTATTGCCCCTCCCTTTCGCCTGCCCCTTTTCCTGGCTTCCTTCCCGGGATTTTATCCTCCAAGCCATTGACTGTACGATCATTTTCCATTTTCAATAACATTATTGTTACCAACAGTCATATCCTATAATCTGGTTTTGTTTGAATAATAAATGTTACTGTTTC
>127
GAGTGGCATGCACGCTTGGGTCTAATCTCACTCGTATACGAGCTTACAAAGTTACCTGTCAAACGCGGTGCAATGAAGCCAAGTTAGAACTCGGTCAGAATGAATATTATCAAGCAAGGCAGCATGTTTGAACCAAATAAAACATCGCCCACAGAATGGTGCATCCCTCAAACGGGGAAAATCCTAAACGAGGGGTAATAAACCGCCTACAAATTGGGGGATTAGTCACGCTCCAAACAGGGGACACAAAGAATTGAGTAAAACAGAAAGAAAGATTATTCGTCCACGAATTCCCGAAAATGCCCTGACCAGCCAGAAAACGATCTTTCTTGGTGAATGGATGCTGCAATTCAGCGGCAGCAAGTGGGGACACGAAGACCTGACGCCGCAAGAGTGGATGTTTGACATGACTGGTGAAGACTATCACGCACCATCAGCCAGAAAACCGAATTTTGCTGGTGGCTAACGATATCCGCCTGATGCGTGAACGTGACGGACGTAACCACCGCGACATCTTGTGCTGTTCCGGCGCTCGTTGACTTTGCCAGTGACAAATTCGCTGGTAACCCCGCCCGGCCAAACCGCCTCCGTGAGCATCACAACTCGAAATCAACCGTATACAAAAGCAACAGCAGCGTGACAGCCAGCAAACCAAAGACTCGACCTGACAAACACAGACTGGATTTACGGTGGATCTATGAAGAAACATCGCCGCACAGATGGTTAATGTTGTGGACTGAATTAGCATGCGTCGGATCGCCAACAACATGCGCCGGAACAGTGCCACGAACCCACGACCGCCGCAGGTAAGGATCGTAGCGCATCAATCATCAACGGTGTGTTCAGCCAGTTACTGGCAACTTTCCCGGCGAGCTCCCCTAACCGTGACCAGAAACGAAGTGAACCGAAATCTCCGTCGCCAGTTGGGTTCTGGCTTTTCGGGAAAGCCGGGATGCCCACGATGGAACAGATCGCAGGAATGCGCGTAGCCCGTCGAGCAGAATCGACCACTATTTCTGCCATCAGTCCGGGCAGTTTTGTTGCATGGTGCTCGGGGACAACGCATCCGTTACCGCCGGACTGCCAAACGTCAGCGAGCTGGTTGATATGGTTTACGAGTATTGCCGGAAGCGAGGCCGCGTATCCGATGCGGAGTCTTATCCGTGGAAATCAACGCGACTACTGACTGGTCAAACCTGTATCAGAACATGCGGGCGTACCATAATCCTTGAGGGATTACTCACGCGGATCAAGCAGGGCAAATCAGCATGCTTCTAATATATCCGAATTAGTGAGTTGACCGAAAGCGCGAATTAAAACCGTCTTAATCCCTGAACCAGTAAATTCCTGTCATGGGGATGCTCTAAATCGTGCACAGGCTCTGGCGAAGATCGCAGAAATCAAAGCTAAGTTCGGACTGAAGGAGCAAGTGTATGACGGCGAAGGAGGCAATTATTCATTACCTGGGACGCATAATAGCTGTGCGCGCCGGACGTTGCCGCTAACAGGCGCAACTCAGTAACCAGCATAAATCAGGCCGCGGCTAAAATGGCACGGCAGGTCTTCTGGTTATCGAAGGTAAGGTCTGGCGAACGGTGTATTACCGGTTTGCTACCAGGGAAGAACGGGAAGGAAGATGAGCAACCACGAACCTGGTTTTAAGGAGTGTCTCCTCAGAGTGCCGCAGCGTGAAACGGGTATTGGCGTATATGGAGTTAAAGGACCATCTACCATTACAGCCTAATAACAGGCCTGCTGGTAATCGCAGGCCTTTTATTCTAGGAGAGGGAAGTCATGAGGACAAACTAACCTTTGAAATTCGATCTCCAGCCTGTAAGCAAAACGCTATTCACGCAGTACAGCAAATCCTTCCAGACCCAAACCAAACCAATCTATTAACCATTCAGGAACGCAACCGCACGCAGCTTAGACCAAAACAGGAAGCTGGGCCTGCTTAAGCTGACGTCTCTCGTCAAGGTTGAAAACCGCATGGTCGCTGGCTCATTAATGCGAAGAACAGCTGGAATGTGTTTACCGCAGCATTTAAAGCAGCAGGATGTTGTTTCCTAACCTGCCGGGAATGGCTTTGTAATAGGCCAGTCAACCAGCACGATGCGTGTAGGCGATTTGCGCTATTAGAGCTTATACAGGCATTCGGTACAGAGCGTGGCGTTAAGTGGTCAGACGAAACCGAGACTGGCTCTGGAGTGGAAGCGAGATGGGGAGACAGGGCTGCATGATAAATGTCGTTAGTTTCTCCGGTGGCCGTCAACGTCAGCATATTTGCTCTCTTGGCTATAATGGAGCAAAGCGACGGGCAGGTAAAGTCCGCATTACGTTTCATGGATACAGGTTGTGAACATCCAATGGACATCGGTTGTCATAGGAAGTTGTGAAGTTCTGGGATAACCCCGACTCGTATTGCAGGTTGATATCAACCCGGAGCTTGACAGCGCATCATCGGTTATACCGGTATGGAACCAAAGGATATTCAGACGCGAATGCCTGTTCTGAAGCCATTTATCGATATGGTAACAGAATATGGCAACCCATACGTCGAGCGCGTTCTGCAAACTGACAGTTTAAACTCGTTCCCTTCACCAAATACTGTACTGACCACTTTCAGTGAGGGAATTACACCACGTGGATTAAGCGCATCAGAGCTGATGAACCGCGAAGCGGCTAAACGGGACGCTCCGTGATCAGATATCTGTTGAACTGTCAGACTTTGGTAAGAAGGAAAATACTCCCAGGGCAAACTGGTGGAAGCAACAACCATTCGATTTGCCTAAATACCGGACATCTCGGTAACTGCATATTCTGCAGGTAAAATCAACGCAAATCGGACTTGCCTGCAAAGTGAGGAGGGATTGCAGCGTGTTTTTAATGAGGTCATCACGGGATGCCCGGTGCGTGACGGACATCGGGGACGCCAAAGGATTATGTACCGGAAGAATGTCGCTGGACGGACGTATCGCAGAAAATGTATTCAGAAAATGATTATCAACGCCTGTATCAGACATGGTACGGAGCTAAAGATTCGATACCAAGCTCTTGTTCTGAGTCATGCGAAATATTTGGAGGGCAGCTTGATTTCGACTTCGGGAGGGAAGCTGCATGATGCGATGTTATCGGTGCGGTGAATGCAAAGAAGATAACCGGTTCCGACCAATCAAACCTTACTGGAATCGATGGTGTCTCCGGTGTGAAAGAATCACCAACAGTGTTACCCACCGCAGGAAAGGGAGGACGTGTGAGACAGCGAGCTACGAAGTATCCACCCGACATAATCTGCCGAACTGCAAATACCCTTCCAACGAAACGCACCAGAAATAAACCCAAGCCAATCCCAAAGATCTGACGTAAAACCTTCAACCTAACGACTTATCGATATCCGGTGGCTAAGACGTCGTGCGGGAACAAGCTGATTGACCAAAATCGAAGTTACGAACAAGAAGCGTCGCCGAGCTTTAACGTGCTAACTGCGGTCGAATAAGCTGCATGTGCTGGAAGATTCACGTGTGTGAGCACTGCTGCGCAGAACTATCAGCGATCCGATGACACTCGGAATGCACGAGGAAGAAGTGATGGCTAAACCAGCGCGAAGACGACGATGTAAAACGATGAATTGCCGGGAATGGTTCAGCGCTTGCATTCGCTAATCAGTGGTGGTGCTGTCTCTCCGAGTCCGAATACAAGATAGCACTCGAACGACGAAGTAAAGGAACGCGAAAAAGGGAAAAAGCAGCAGAGAAGAAGCACGGACGAGGAGCGAAACAGAAGATAACTTAAGATTCGAAAAGCCTTAAAGCCCGCAGTTACTGGATGTAAACAAGCCCAACAAGCCGTAAACGCCTTCATCAGAAGGAGACGCGACTTACCATGTATCTCCTGTCGGAACGCTCACGTCTGCTCAGTCGGATGCCGTAGACATTACCGGACAACTGCTGCGGCTACCCTCAACCCCGATTTAATGAACGCAATATTCACCAAGCAATGCGTGTGCAACCAGCACAAAGCGAAAATCTCGTTCCGTATCGCGTCGAACTGATTAGCCGCATCGGGCAAGGAAGCAGTAGAAGTCGAATCGACCCATAACCGCCATCGCTGGACCCGAAGGAGTGCAAGGCGAATCAAGGCAGTACCAACAGAAACTCAAGACCTGCGAAATAGCAAGAACCGTGAGGCCGCATGACGTTCTCAGTAAAACCATTCCAGACATGCTCTAATTCGAACATACGGAAATCAGACAGAATGGAGCACGCAGACTGAAATGTAGTCGCGGTACGGTCCAGAAGCCGTTGATGATAAATAACGACGGGGAAAATGCGACCGCCATCGTCAAACGACGTTCCATGGTTCATCGCGGATGGAGTGAAAGAGACCCTATTACGAAAAATTGATGGCAGCAAATACCGAATATTTGGTAGTTGGCGATCTGCACGGATGCTACCGAACCTGATGAACCAAACTGGATACGATTGGATCCTAACAAATACTGCTTATCTCGGTGGGGATTTGGTTGATCGTGGGTGCGCAGACGTTGAATGCCTGGAATTAATCACCATTCCCCGGGTCCGCTCGTACCGTGGAATGGCTGAGCAAATGATGATTGATGGCTTATCAGAGCGTGGAAACGTTAATCACTGGCTGCTTAATGGGGTGGCTGGTTCTTTAATCGATTACGACAAAGAAAATTCTGGCTAAAGCTCTTGCCCATAAAGCAGATGAACTTCCTCCGTTAATCATCGAACTGTAGCAGCAAAGATAAATATGTTATCTGCCACGCCGATTATCCCTTTAACGAATACGGAGTTTGGAAAGCCAGTGATCATCAGCAGGTAATCTGGAAGCCGAACGAATCAGCAACTAAAACGGGATCGTGAAAGAAATCAAAGGCGCGGACACGTTCATCTTTGTCATACGCCAGCAGTGAAACCACTCAAGTTGCCAAACCAAATGTATATCGATACCGGCGCAGGGTGTTCTGCGGAAATGAACATTGATTCAGGTACAGGGAGAAGGCGCATGAGACTCGAAGCGGCGTATAAATTTCATTCACAAAGCCCGATGATGAGCGACTCACCACGGCCACGGATTCGTACTCTTTCCGGTACTGATGTGATGGCTGCGTAGGGGATAGCAATCTAAGGCCGGATTCGTATGGCTGCATTCTGCGTAAGCACGAACTCAGCCCCAGAACGACAAACAAAGGCTATCAACTATCTGGATGCAATTTGCAACACAAGGTATCGGGGAATACCGTGTGGCAAAGGACGGTGAAGGAAATATCTAAGGCAAAGTACTGCAAGTGCTCGCACTCGTTGGATGTATGCCTAGATTATTGCCATCCCGACGCCGGGGCAAGATGCAGAGATGCCATGGTACAGGCCGTCCGGTTGATATTGCCAAACAGGAGCTGTGGGGGAGAGTTGCGAGAAGAGTGCGGAAGGATGCATCGGCGTCGGCTATTCACCGTATCCGCCGACGCAGCATATCGCTGTGAACGATGCCTAATCCAATACCTTACCCAAACCCACCTGGTCCTCACGCACTGTTTACCGCTCTAATCTGACGCTCTCTGGTGCAATGCCACAAAGAAGTCAATCGCAGACAACATTTTGAATGCGGTCACGCCGTTAGCAGCATGATTGCCACGATGGCAACATATTAACGGCATGATATTGACTTATTGAAGATAAAATCTGGGTAAATTGATCCAACGATGGGTTAATTCGCTCGTTGTAGTGAGATGAAAGAGGCGGCGCTTACTACCGATTCCGCCTAGTTATTACTTCGACGTATCGTCTGGAACTCCAACCATCGCAGGCAAGAGGTCTGCAAAATGCAATCCGAAACAGTTTCGCAGGTAAGCTTTAGAGCTGCATGAACCGTTCTAGACATTCTATATCTGCACAACAGGTAAGCATTGAGTCGATAATCGTGAAGAGTCGAGTTCTTGGTTAGCCAGTCCTCTTTCGGTTTGTGCCTGAATGCAGCGAATACCGATGGAAGCAAGAACCGGATCACCAAATGCGTACGGCGTCATCGCCGCCCAGCAACAGCACCAACCCAAACTGAGCCGTAGCCACTGTCTGTCTCTGAAATTCATTAGTAATAGTTACGCTGCGGCCTTTTACACATGACCTTCGTAGAAAGCGCCTGGCAGGAGGTCGCTAACACACTCCCTGCCGCTTTCAGCGTGCGCATATCGGTCACGAACAAATCTGATTACTAAACACAGTACTCATGGATTTGTTCTCTATCAGTAATCGACCTTATTCCTAATTAAATAGAGCAAATCCCCTTATTGGGGGTAAGACATGAAGATGCCAGAAAAGCTGACCTGTTGGCCGCCATTCTCGCGGCCCAAAGGAACAAGGCATCGGGGCAATCCTTGCGTTTGCAATGGCGTACCTTCGCGGCAGATATAATGGCGGTGCGTTGTTACAAAACAGTAATCGACGAACGGACTTGCGCCATTATCGCCTAGTTCATTCGTACCTTCTCGACTTCGCATAACTACATGAGCAATCTCGGTATAACGCAGCGTGTTTATCGGCTACATCGGTACTGATAACTCGATTGGTTCGCTTATCAAACGCTTCGCGCGTTAAAGCCGGAGTAGAATATCGTAGAAATCAATAATCAACGTAAGGCGTTCCTCGATATGCTGGCGTGTTAGGGAACTGATAACGACGTCAGAATGAGAGAAATCATGGTTATGGACTATTAGGCGAGCTATTTACTGATCTATCCACCTCCGCAAACTTGTCACGCTAAACCCAACTCAAATCAACAAGCGCCGCACGCTACCAGCTTCTTTCCCGTTTCTTAGGATGCCTACCGCCGCAAGCATAGCCTTGGCCTGAAAGATTGCTCCGAAAGTCACGACGCTGTGGCGCATTGCAGCAGATTAAGGAGCCCGTGGCGCTTTATGATTGATCTGGTGATATCCGTCAGGCAATCGACCGTTGCAGCAATATCTGGCTTCACTGCCGGGCGCCTGGTTGGTCAGCGTTTAAGCAAGGCTGACAGCCTGATTGCAAAATTCAAAGAAGCGGGCGAACGTCAGAGATTGATGGTGAGCAGATCACTAGGATTATCTCCGCTCTGGTTATCTGCATCATCGTGCCTGTCATGGCTGTTAATCATTACCGTGTATAACGCTTACCTACAAAGCCCAGCGCGACAAAAATGCCAGAATGAAGCTGGCGAACGCGGCAATTACCTGACATGCAGATGCGTCAGCGTGATGTTGCTGCTAGCCGCTGCAAAATACACGAAGGAGTTAGCTGATGCTAAAGCTGAAAGCGATGCTCTGCCGATGCTCTGTTGCCGCTGGTCGTCGTCGGTTTGCCACATTAAAGGAAGTTGGTCCGTCGGCTATTAATTGCATACAGACACCTAGCCGGCGATTAATGCAGCCTCCCCAGCACCCGACAAGGCGACCGTATTTGTTTGCCCTAGGCCACAGAGAGGTATAGCATAGTGGCGGAAAAACTAGCGAAGAATGAAGTAACGTATGAACCCAGCAGTGCAGCTCGCAGAGTTACGCCATCGATGGCGATGGCAGGCAATCCTTGGGCAATACGCCATGTCCAGACTGGAGGATCAATGCCAAAAAGCACGACCTAGACCGCGACCGATCCGGTTCGAGTATGTTTAAACATTTCTGTTCTCCCTCGTCCGCCACAAAGATTTTGGCTGCATTAGACAGTTTCTCTGTTGAGATTTCCCCAGAACGCAAGAAACCATGGGTATGGTTTCCTTTGGTATCCTGCTGCCGTTGTTTGAACAGAATAACGTCTGTTGCTACCCTAGGTAGTGACAGCGACAAGCCGCAATATACAAGAGCTAACCATATTTTCATAGTATTCTTCATTAGTTTGGGGTTCTAGAGTGATTGGTTGTGGACAGATTAGTAAAGTGACAAACAGTGAATTGAGGACTTTCATATTATACTTTATGTAATGTATGATAGTGAGGATGGGATCGTTGATTACTCTTTACCATTGTAATAGTGTCTAAGCTCTAATGGGGAATTCTCTTAGGGATGTTAGGGTAAAGGATTAAAAACCATGCACAGGGTTAGCGCGTGGTAAGCGTATTGCGTAAGAGCCACGCGTTGGCTTATAACCTAGAAGAAGTGAAGTAGGTTAGTAAAACATTTAGCGTGGTATCGAAGATTTGTAACGTTATGCATTAACAGAGAGTAAATAGATAGATGGCATTACGTAGACGGGATCTACATACGTATTTATGTCATGAAACATGCGGGTGGATTTACGCGTCATATTTTCTATATTTAGCTAAATTAGAGCGGCTGTTTCTTGGGGATTGTAAGGTTTACAACCTGTTTTAGTTGACATTTGCTAGGTGTTATCGTTCTAACATAGAAGTCAAAGTATGGTTATCTGTG
>128
ACGTTGATGCTCGTTATGATCGAGAGGGGAGTGTGTGTGCGTCGCTCATTTGTCGGTGTACCTCTCGTTTGCTCAGTTGTTGGGAATATGGTGCAAGCAAGCCACGCCGTCGCCGCAGTAAAATTGCGGCGTGATTCTCGGCACTGATGAACCAAAACAGCAACAGAGCAGCACATCGCCCGGCTGTGAGGCTGACAACGAGCTGATACAGCCGCGTCGCCTCCAGATTATCCAGATAGAGATTCCGTTTACGCCACCAGTCATCCTCAAACCGATGAAGTCCGGCATCTCAATCCCGCCATGATAGCATCCCGGACGCGTGTAACAGTCCGTCACTAGGTTAGCTCAACAAGGCGCCGCCGGTACGCGTAACAGGGAAGCGGTTGTAACGGCGTACGTCCCCCGGCGAAGAAGAGGAGAACCAAACGACAGGGGCAAGTACTAGACCCACTGCAGGCGGTCGGGACATAAGCCATGGATAGAAGAAGCCACAGATATTCCGTGGGACCAGCGCCACAATCTCACCCTGCATTTCTGCCTTGCAGCCAGTCTTCCGGCGACATACGGAAATACGCGCCGGCTCACCGGAATATTCACGCAGGGAATATCTTTCTCTCCGGCGTGCTTACCACGAAGCCGCGCAACCCGACGGGCGCACATGGCCGGGCGTGCGCCAGAATCGCTGATTCGTGCGTCATGGGATTTACTGCGAAGTTTGTTAATGAGGAAAGGAATGCTCAAAAGTTCAGGACGTTATTGCGGAACTTACAACGCTCAGGCATTTGCTGCATTTATCCTTCGTGATATCGACGTTGTACGCTGGTCATATTCAACGCGACAGCCGGACCGCTATAACCGCACCGGCTTACCGCGATAGTCCAGGTGCAGGTGTTGGCAGCATGATACGTCCCTAGAAAAACAGCGCCATCCGTTTCCGTCGGCCGTGACAGTTACAAAGAAGAGCCCAGCTACTCACCGCTAAGCTCAGTTCGCACCTGCACTGCTCAATGCGCCAGCATCGTGCTCACGTTTCCTCGCTCCGGATCGGCGTAACCGTTTCCGTTTACGAAATTCACGCATCCAGAAAACGGGCGTAACCTTACGCCGGACCACCGTTCGAGGACCAGACTCTGTGCATATCTTCCGCCATCCGGTACATACCGTACAGGTTAGAAAGTCGTCAGTCCGGTGTGGGTACTGGTGCTTTGCTTCAGTTCCAAACCGCTCCCCTGAATGGGATGATCGAGGCTGATACTGTCGCCCCTTCAGGTGACCGGCTCGCTTTTCGTTCCTGCTCATTACAAAATAACGTTCTCCACATACTGTTAAGTCATATAGGTTTCCAGAGGCAGCACGCTGGCCCGACTGCTCCGCACGGGTGCATTCATTCAGTGTTTCCTGCCGGTATCCTGCATCAAGTTCACCAGCTGTTCAAACTCTGCGCTGAACTCAACACGCAGCATACTGACCGCGACGACCATTTTGCGCAGGTCACTTTATGCCGCCACTCATAAGGCGGCGTCCACAGAAAGGATTTCCAGCCCCGTGCTCTTCCAGAAACGACTCCAGTACCGTGGCCTCCTACGGGGGACAGAAGGCGTCACGCTGTACGTTGCCGTTGGCATTCAGCCCGGCAGGCGCTCGCTGTGAGAATAGCCATCACAAAGCGCACCTTTCTTACAGAAGAAGGGAAGCGAAGCCACATCCATACGGGTTCACTTTCCGACGAAGGTCTTCATCGTCCACTCCGGAGAACAGGCCACCATCACGCATCTGTGTCTGAATTTCATCACGGCACCTGCTTGCGTCGAGTCATACACCGCCTTCAGAGCAGCCGGACCTATCTGCCCGTTCGTGCCGTTGTTGTGTTAATCACACATGGTTATTCTGCTCAAACGTCCCGACGCCTTGCGACCGACCCGTGCGGTCGCTGCCCGGTGTACCACATAACCGCCGGTGGCACCTCAGCATCAGCCGGTAAGATTCCCGCACGCCAATCCGGCTGGTTGCTGCCTCCTTCGTGAAGACAAACTCACCACCACGTGGTGAATCAATCCCCGCTGGCTCATATTGCCCCGGTTCCCGTAAATTCCTCCGGTTAAATGAATTTCGCCGCAGCGGCCTGAATGGCTGTGTACCGCCTGACGCGGATGCGCCGCAGCCACCAACAGACGCCAATGGGCTGCCAATACTCCCGACAATCCCCACCATTGCCTGCTTAAGCGAATTTCGTCATCATGACAGCACGAACGGGTGAAGCTGCTAGTTCCTGCCGTCAGCATCACGCCATATTCTGTGCAATACCATCAAAGGTCTGCGTGGCTGCACTTTTACCTGCGACATACTGTCCGTGTGGCTCTTCCACGCACCCTCCAGCCGGACTTCAGGCCTGCCATCCAGTTTCCCCGAAGCTGTCTTCGCTCGCAGGTCTTTCTGCTCTGACATGACGTTATTCAGCGCCACTAGATTATCGGCCATACTGTTTCCTTCAGGCGCTGTTCCGTGGCTTCCCGTTCTGCTGCCGGTCAGTCAGCCCCCGGCTTTCGCATCAATGGCGGCCCAGTTTTGCCCCCGTTGCTGCTGTGCGATTTATCCGCCTGCTGCGCCGTAAGCGCGTTCAGGCATCAAACGATACGTAATCTCTTGTCCTCAAGTGCCAGCCATAGGTGAGTTTGTACTCCAGCGTCTCATCTTTATCTGCGCCAGCAGGGATTTCTCCTGTTAAGACAGCTGGCGACGTTGCATCCCGCCGCCTCCTCCATGTACCGCGAACGTACTCCGCCTTCCACAAATCCCGGCCTGCTGGCTGATTTCTCATTTGCTCCGGCATGCTTCTCCAGCGTTGCCGCGTTCGTGGGACCCGTCATAAGGGCAGCATGAGCATGTCTTCCTGACGATCGCCCGCAGACATTCACGCTGGACCTGTTTCCGGCTTTTCAGCGTCGCTTCATAAATCCCTTTTCGCCGCCGCCATCAGCGTGTTGTAATCCGCCTGCAGGATTTTCCGTCTTTCAGTGCCTTGTTCAGTTCTTCCTGACGGGCGGTATTTCTCCAGCGGGGGTCTGCAGCCGTTCGTAAGCTCTTCTGCGCCTCTTCGGTATTTCAGCCGTGACGCTTCGGTATCGCTCTGCTGCTGCCCATTTGTCCTGTTGAGTCCTGCTCAGCCTTCTTTCATGAGCTTCAGGCAAGACGGGCCTTTCACGATCATCCCAGTAACGCGCCCGCTTCATCGTTGTAACAAAGCGTCCTGCTTGCAGCAGATTCCAGATGTCGTCTGCTGTTCTTATACGCAGCCTCCTCTGCTATGTAATCAGCATCTCCTGCTAGCGGTATCAGGACCGACCAATATCAGCACCGCATCCCACATGGATTTGAATGCCCGCAGTCGCTGTCTGCCCAGGTCTCCAGCGTGCCCATGTTCTTTCAGGCGGCGGGTCTGTCATCAAATCCATTTCGTTGCGGCCTCGTTCCCGCCTGCAATGCCCCGGCTTCATCACCCCCGGAACGCTGCACTGAGCAACATACGCAATCTGCTCCGCCGACACGTTTGGAACTGCGAGCCATCAGCGTCAGCCCCGACGTCGGGTCTTGGTCAGCTTCCCGAAGGCTTCAGCGACCTTGTCCACCTCCACGCCGGATGCAGAGAAGCCCCACATCCTGGCGCTGATGACGCAATCTAGCCTCACCCTTATCCCCCGCCTTAACCATGTGCCTGAGTACTCGACTGTTATGGTTTAAACGTCAGCCCCCTGCCGCCTGCCCGGCTCTGACAGGACCAGCATACGATCTGCCGTCAGTCCCGCCTGATTCAGAGACAGGACCACAGCGTTGTTGAAATCGGACAGGGTTGAGTTGCCTGATACCAGGCATACGCCAGCGCACCGTCGCCCGCCAGCGATAGCGCGACAGTACGGCACTGATCGCACCGGCAAGCCCCCTGAACATATGGGGATCATCCCGCCGGGAATGGAGTCCTTCATTGCCCTGTTGCAGCAGGATCAGCCACGACTTTGCCCGCCTGCAAGCTGCGTGGCCACGTCGGTGAACTGTTGTCGCAGGCAGCATACGCATGAGAGGCTTTACTGTGCCCGACGGAAATCCCCTTTCTTGCAGCCAGCGCCTGTCGGCTCAGCGACTGTTCACGACTGCCGCTGTTTTTCGCATCACTTTCCGTATTCAGAGAAAATGACGCCGTAACTCTGGCCATCTGCTCGTCAAATCTGGCCGCATCCAGACTCAAATCAACGACCAGATCGCACACCGGTTCAGCCATACCGGACTCCTCCTGCGATCCTTCTGATACTGTCATCAGCATTACGTCATCCTCCGTCTCATGTCCGCCACATCCGGGGAAGCGGGGATACTTCATTCCGCGTCCGGGCCAAAGCAGCACCCCGGCAAGCTGCCCCCGGTCTTCTGCATCAGCACATCATCTTCAGGCTCTTCGTCAGCCTCGCGCCGGTTCAGCAGACTGAAATCCAGGGCGAGTGCATATTCGAGATCGCTGAAAAACAGGCCGGCAGCACGGTGTACGTCAGCCCGGAAAAGTGCATATCCAGCAGAACATCATGAAAATAATGGGTACTGTAAAGCGGTGCCAGTCGGCATACCGGGCGTCATGACATCCCGAGCAAGCATGAAGCCAGTTGGTCTTCACTTACATCTCACGCGCTTTCAGGCAACTCAGCTCACCGTCGAACATTTCCCCGCAGAATGAGCTCTGCGGTGAACCGTCCTCTGTCTGTTCATAGGGCATTATTATTCACCACAAACTCACATACCATACAAAGCCGGTACACCACGTTTTCAGCATGAGAAATTGCCTCCGTGGGCCTAGTAGTAAGCACTTCCTGCTCAATCTGTTTAACGGTTCATTTCATGACGCATCTGCGTCTTCTGCGGATGGTTATGCCACAGGGACATCGCCACCAGAAACGCGCCGGTTCGTCGATCCCGTCTTCCCAAGTAATTCCGGTTGCTGTCACTCCCTGTTTCTGCCTGCCGTTCATCGCCTGAGATGCTCAATCCATGCCCAGGGCGTGACAGTTCAGAAAGCGTGACGGTCCACCCGTTATGTTCAACTGATTCAGGTTTTCAGAAACAATTATGATCCTCCGGATTAACTGGCGGTGACGTAATTTCTGCAACCGCAGCAAGGACGCCCGGTTACCGATACAAACCGGAATGTTGACTTGCCTGCAGCTGAAGCCCCGTTCACGGTATGGTCATACCACTGACCCACGGTGGCTTTTGTTTTATCCGCAGACACCGCACCGAAGGCTCCTTGTCGGTTACGCTCCCTCCGGCTCAGAAGGGCACGGTCAGCGTGGTGCTCTGCCTTTCACCACCGAGGTGCTTGGCAGGCGTCACGTCAGTCCCGCATGTTGCCATGTTACCGTCCTGCGATCTTCTGCCATCGACGACGTCTCCACATTGGTGACTTTCACCGTAGGTGATCACTTCCTTCGCGTCACGCCTTACCGATACTGCTGATCCAGCCACGGAACATGAACGTGCCGTTCGGGAAGGGATTCTATAGGCACGTAGATGCCTTCATGTAAAACCACGGGAGCCGCCTGTGCTGCGCCTGCTCTCCGGGCATCCACGCCAGCGTGAAGCTGGTATCCCGGCAGAGCATTTCTGCGCGGTCGCGCGCCAGCACGTTATTTACTGGCGGTCTGCATCTTCAATCATCGAGATAGCTTAGGTTGCGTCACGCTCAGCGGTCAGTTCGACGGGCGTCAGGTCGTCGACTTTGCAGACGCGACCAGTCGACGGGACTTTATGAAGCGGCGATTCGGCTTAGGGTCACCGCTCCCCTTATAAACCCACAGGGTCCCGGCACCTTTCACCGGCATTGTAGGATTTGGTACTTAAAGAGCGTCGCATTTCATAGGTAATAACATAAGTCAGATTAGCTGAACCCCACAAGCCGCATCATCGTTCTAGCGCCGGTAGTCAGCCGCTGGCCCATACTGTGATCAAATCTGACAGTGCTAGATACGCTCATCAACGATAAATCCGGCGATTCATCCACGAGCATCCAGCTCTGAATCTAAGGCGAGCAGCCTCAGCAGGAAAACTTCGATATGCAGCTCCGCCTGCTCAGGTACCGTGCTGGTCAGTTCTTTGATC
>129
ATATTCTTGCTTGAGTCCTTAGTGGGATGGTGTTATGAAGCATGCGACGAATTCCGACGGTTTACTAATGTCGGGCACCCGCAGGATCTCAAATGACGTCATTCGATGTTGTAACCGGAAGCCGAAGCAAATCGACCGAATCGTTATCAGAATCGGATGTTGAAATGTAACCGTCCGTCTAAATTAGTTCTGCAGCTGTAGGATTAATCCTCTACGAGCGTCGTGGAGCGATGATGACGGCTTTAAGATATCGCCAGAATTTAATGTCCTATGGTCAGGGAGCAACCGTTAAACATTAGCGTCCTAGATACACAGTCGGTACTGAAGCTTATTTATTCTCGTCCCTGAATCCAGTCAACCAGCACGATTGAAGCTTATGTGAAGCCCCAATGTCACCGATCATTGGAGCTTTAATCGTTAGTTCAGAATCAGAGTTAAGCAGTCCAAGTTCCGCCAGGATCCCGTTAATTAATGGTTAAGCGTACCGGCGGCCTTTATCTTTCTGAGCTTTGACTAACATAAGCCGAAGCTTCAGTTAAGCTGAAGGATTCTTTATTCCGATCTAAGCTTTACCAAGGTTTAACAGCCGTTGCCGTTTTGTAAGGCAAATTCACGTTTGCTTCAATCACATGAAGCATAGTTGCGCCTGGGGTTCTAAACTCCCCTTGTTCGTAGTATTGCGAGATTTGCTATAGAGACCCATGCATCTAATCACCTTTTCCATTTTCAAGACAGTATGTTACCAATGTCAGGTACGGGTACTGTTGTTGAAGCGTACTACTGTTCTTGAGTGAATTAGAATTGAATCCATTCAAAGCGGCAAGCGTGAATAAGCCGTAAAGTGAGAGCAGTCAGCATCCGAGCGTACCAATCTTTTGGCAGTACTCTGTTTAGTACAACTCGCGTTTGGGGTTGGCTGCCGCTGCAGCTTTAGAGAAAAGCGTACCTCTGCTTAACGTGAACCGAGCCCAAGGTCGTATCTTTGCGATTAACCCGAAGCGGCACTCAGAATAGTCAAATGAGTTACAGGAAACCGTTTAATATTATGACCGTCATCAGTATGCCAAATCCAGTGGCTGTGGCCTCGAGCGTCCATAGCGTTATCGGAAGCGGCCGCAGACGCCGTCGTAGAAGCCTTGCGGGCTGACCATGGATTCCGATGCGATGTCGAGCTTTTGCATCAGAATCTTTTACTTCCCAAGACTTTTACGGGGAGCAGGATTTATCCTACGCGAGCGCTAGTAAAGTAAACTTCTCTGTCCTTGTCCCCTTAGGTGCACATGCCACCCTCATTTACTTCCGTGAACCGGTTGGCAAATAAGGGATTGAAGTTCTCCAGAAGTTTGCCTCAGCCGACAATAATCCGTCAATTTGCGGCCGTTACCGTTGATATTTCGGGGATTCTAGAATCTTCCGAGTCCCGGAAGGGAGACCACTCTCGTTGCGATACGTGGAATCAGTCAGATCGACCGGTGGGTTCCATTTGCTGCCACCGATCCTGACGGTAGGTCGGAGCACGTTGCGGTTGACGACCTTCCTATTTACGACCGAAGAGTTTCTTGCGTATACATCATTGCCCCAATCGTTCCGCTCCAACGAAATAGTCCCCAAGGCATTGCTTGAATGATGAAGAGCTGTCTTCCTATCGCGTTCACCCGGCATTCAATAAAGGCGCATTTGGCAGTCGGAGATCCCTACGAATTCGCAGCCAATGTCTGGAATTGTCGATAGAGTGAATCAGCGTCTCATCTACCGGTAAACCGAGTACTTTCTCTCCCGATATTGCAGTGCGGCACGAGCGAGCAACGATTACATAGGATGGCAGGTCGCACGATAATGTGCAATAGGAATAGGTACTATTTTTATTTGTAGACCGCCAAAACCTACGACATTTTCAGGCCCGAACAAGCATGTCATGTAATAGTTTCTAGATCTTTTGGAGTCGTTGCCGTTTACCGTCATTGCGTGCTAAAGCCAGCGCGGAATGCCGCAGATGTCCTGGTCAAACTATTCTAAGGTCCTATTAATGTCTTTTGCGTAGGGAGTAATACTGACGGGCAGGGCTTATGTTCTCTAGCCAAATCGTCTGAATAGTAATTTAGAAGAGCGACTTTATCCCAAGGCATTTCTAGCGTTGAGCCGGCGAGGTTCCTGCTTACTTTAGTTCATGGTTAGTCGCTCTCATTTCATCGGTTTAAACGTCCGTACTGTAACCGATCACCGTTACCGACTTATTTCAAGAACCGTATGGAAGACGTACAGATGTAAGTTTGGTCAGACTAGTTCGCATAAACTTTCTCACGAGTTAAATGTATGCAGCTGAAGCACAACTGTTTATTTAGTTTTACGACGTCCAAGTCCGTATTCCGTACGCGATTAGTCCCAAGTGATTTAGCACTTGCGTGCATATTACATGGATCCGTAAGTTCCGCCGTACGCCCAGCAGGGTTCAATATGCTGCAGGCTGGCGTCAACGCATATAAAGCCGAGCAGTTCGACCGTCCGACGACATCACCGTATTACCGGCTAAGACCGCATTCGAGTTACGCAGGTACGTCGAAGCAGATATTTCTGAGTCTAAACAATTTAGTGAGAATTATCATCGTCCATTGAATCGTATTCGTTACGTCTACTCTGTCAGTTAGAATGCCCGAGCCGATTCCATCGGTTTGAATTTTCATCACTTAGTTTTTGATAGCTTCAAGCGCGAGTTGTCTGTTCTATCACCAATAAACGAGCTCAATGCGGCATGGGATTCGTCACGGGATACAAACTATTTGAGCCTTGGCAGCATTCTTGAGTCGCCAAAGCCCTATCTATAGTTTGCATCCGTTAGAGAATAAGGAATCCAACGAACTGAATAGGGATGAAAACTCGATCCGGTTAACCGTACCTTAGTTTGAGAAGCTTCATGTTTTCTGGGTCGTTGGAATTGCAGCATCAATTCCATTCAAATGTTGTTTTACCAAGCCGAGTTCCGCCGAATAAGCAGTGAATGTTCGTGGAATTAATCCATTTAGCACAAACGTTAAACCTGAATCCCGGCAGTGCGGTTTAGAATGAAATGGAATTAACAATTCGGCAACGAGTCCCCCGTGCAATTGCGAACGGGGCGTTAGAATCGCCGACAGATCGGGCACGTAATGTCTAGACGCTTTCGCTTTCAAATGGGATCTAATCGATTTGGCTACGATGAATGAAGCTAGGTCCACGAGAGTCGTTAAGATGAAGCCCGTAAGTCCCGTAGATACCGATGTAGTCAATCCGGTTCTAAGGAACAGTTCAGGGATTGACTGAATTTGGCTGCTGAAGAATAAGTGGGATCGTCTTGCGTTGGCCCCAAACCAATGATTTAACATTTCCGATATCGCATTTCACTGAGTCAAATACGATAAACAGGACACAACGGATTACCCCAAGGAGCCTGCTCGTCGAAGCCTGAGTGGCTCCGGCATTAAATATTTTCTTTCCTTGGAGGATACTAAATTCCAACAGAGCCAGCTATACGGGCGTTATGTAAAGCTAACCGGCATTTATTTGGCGGCAACGATCTCTTTAAGTTACTGGGTTACATACGATCGTCCCGAGCCAAAATTAGATAGACCGTAACCGGCATCCGTATTAGTTTCCATATTTAGCTTTTGCTCCTTTAGATCCACCCTGTTATTCATGTTGCATGGTGCAGCTGTTAACGAGCATCGGGCAGTTACTGCTTGAATAGACTCGCGGATTACTTCGAAGACCGTTGCAGGCAGGCAGCCGTTCAGACTCCAACGGATCCTCCCAGCTCATAAGGGTCAACCTCCGCTTTTCCGCGTGTGGTTCAGAAGCCACTACCACATAGTTAGAATTGAGAAGCATGCTAGTGGGGAATCGTCGAGGAAAGAAGTCCTATGCGTCGTTGACAGCCTGCTAATTAGTTATGCAGTTGGTAGCGCGGATTGCACTGGATTGCGAGCGTGTGCTTCCTGGAGTGCGACGACGAGTTGACAAATCTAAAGAAGACAAATCAGTGCGGGCTACCTGTTACCCAAGGTTATCTAAGTAGAAGCCAGTACTTGAACTGCATATTTGTTGGAGCTTATGTAATTATTTTATGCAAAATCTAATTAATATTAGCTATTTACGTTAGTTTCTCGTTCAGCTTTACTAAGAGTTGGCATAGAATCAAAAGCATTGGAGCTTATAGATTTGTTGCAACGACAGTGAGAAGCAAATCATGAGTCGTTACGGCCGTAAATTCCTCCTTCTTTTCTAACGATTTACCATGGCTGCTGTCAACTAGGATATGAGCTTAACTTGAGCCTGTTGCATCCCAGGAGGTTTTGGGGATAACTCGCTGCTTAGAATTATGTGCATCCGGAAGCGTGAAGGATTGGCTTCGAAGGAAGACGTAGATTTCGTGCCGAGGATACAGCCCGTATGATTGAAGCGGTCAGCAGCCTGCATTAGCTTTCTCCGCCAAGAATCTCTGTGCATTTATCAGATTCCTTCATTCTATTTAAGGAAGATTTAACCGAGGGGCTTAGATGAAGTGGATCCCGAGTGGGATTTACACCACGTTCGTCCTACGATAAGAAGATATGGATTAACAAACCACAAATAAGGATAGTCAAAATTTCCAACATGACAGATATGATACATTTACAGAATAGTAGATAAAGGCGTCCATTGAGTCAACAAAACAGTTGTAATCTCGTATACATTTACATAACAGTTTAAATTCCTTATGTACCTGCTTCTATTTGAGGCAGGTAGAAGCGACCTGTTGTTATCTCAGTCATTGCCTCGAAATCGCAGCCCGTATGAATGTTAATACTTAGCTTGACGCTCCATTGCGCGTCTAACCCGTACGGGCTTAAGTTGCCGCATTTCTTTTACCGTATTGCAGTGAGAGCACAAGGCATCCCTTATTGCTTTAATTTGCTCAGGGACCCTTTATGAGTGTCTTCTGCTTGATTCCTGCTGGCCGAATTTTCGTAACCGAAGTGTGATCAACTAACTATGGGATTATACGAATCTCCTGTCGTCACCGTCAGTGTGTTGTGGCAAATAACTCAATATGTTGTAATGCTGCCGTAACGTGAATTCGCTGTCTCTGCCCGTACGAAGCCTTTACCCGTCTCATCCTGTAGCAGTAATATCGCTTGTCCCCTGTAGAAGCTAGGGTAAATCCCGGCGCTCGATCGCTTCTTCCCAGTTCATCGTCGGACAAAATCTGTTGGTTACGCTCATTTAATCAACGTCTAAGCTGATTCCTTAGAATCAGACTCTTCCGCTCCTGACGGAGGTGGGAAGCTCCTAATGCGTCCGAACCGAGCACGAACGTTTCAATAGAGTCTCGACGTCGCCGGCGTGCGTTCCATCCTGAATGTCAAGGTTCCACATCGCAAGTCGCTAAAGGATCACGAAACCGGCCATCAGGCGGCTGCTGTTCTTTCAGTTCTTCGATTCGAAGCGATCTATTGGTTACGTCTGCAATGTGCTGGTGACGCGAGTGAGTCGCAGTCGTTATGTTCCCCTTCCTTCGCTTCGATAATCGTTGAATGGCTCACTCCATTCCGTCTAATCTGGCCGAATCCATGCGTCTCCAACCGCCAACACAAACGATGGCGTTGCCAACGCCATAAATCCCGATTAGGGATTAGTAATATTGATGTCCGTATATCTACTGTTGTAGTCACAGTGAAGTATCGTTTCCACGATCTCGTGATAATTTGCTGACTGAGTCAGTCATTTCTAAGATTGAATGGGATTTATTCGATCGTATAAACCTTCATGGAAATATTTGTATGCCCACTCTATAGCCGTCAGATAACAGTCCTTAGTTTGCACTGGAAGCACAAGAATGGATCTCAAACCGTGATAACGCCAACCGCATCTTTTAGCGCTCACTCTAATCAACCGTTACATGACGGTTGCGGGTAAATTCCTTCGGAAGCTGTAGCCCAACGTTATTACGGAGGAGCGGCGTACCAAAGGTACATACAGAAGTTCTCATCACGTTGGGTACCAGACCCATGAGTGGCATAGGATTGCGCATTTCGCTAGACGACGGAATTCTCAGCATTTTGTACAATACCGTTGACAACGTTGATGGATTGCGTCGAGCCGACTGCGACTTATAAATCAGAACGGGCAGTTATCACTCGCAGCCGAATGAGCGATGCGTAATTAGATTTATCCAAGCTTATTTCAGTACGGTTTGACTGTACGGCAACTCTGCGTACCGTGAATCTCCTCCAGTCGCCCGAGGATCTTTGCGCGGAGTACGAACAACAAGAGTATGACTGGTTTCCGTCTTCACGACTTCGTTGCTTTCCAGGCGTCTAAATACCGCCGTACTCCATCCGAGTCACCTTCGTAATACTCAACGGGTCGTCAGGTTTACATTTGCTGTTCCACCCCGATCGAATGAATTTCCCTGTTACTTAGAGCAACCTCCGGCCGTCTCCTGGTCGCGGCGTTTATGTATTGGCGTTCCATCCATCCGTTGCACATTCTAAGAATCGATGGTTACCAAGCATTCATTGAGAAGGGAGGTGCGTCAAATCCCAGTGGTTGCATTGCCTGCTCTGCCGCTTCACGCAGATCGCCTGAGAGTTAATTTCGCTCACTTCGAACCTCTGTTACTGATAAGTTCCGAGATCCTCCGGCAGCAGTGCACAAGTCAGAACACTGAACCACCGGCGTCGTTCCATCTATCGATGCCACCCAAACAATGAGTACCAGAATATAGCTAGTAGTTCAGGAGCTTTTACTTTAGTGGTCCTATCGTCAATTCTTCGGTTCATTTCTGATCGTCTGAATCGATGATGTCTGCCATGCTTTCATTAATCCCTGAACTGTTAGCGTTACGCTCGTGGCGAAGCGGAGACAACAAAAAGTACCCTGGCTTCCTGAGCCCGTTTGCTGTTCGTTCATGCGTCGGAGCACGATTTAACATGCCGGATTGCCAGGGTCGGAATGAGTCGGTGAATCCATTTACCGTTTCGCGGTGCTTCTTCAGTACCCTACGAAATGTCAGCACGTTTATCCGGAAATGCTGTCTGGCCGTTACCGTCGAATCGCCTGACGGGAGTGGATGCGAAGGCGTTTCCTTGAGGGTGTCACCGTTGAACAAGAGTCCCAATCGTGGCAAGCAGCACATAGGCATCCGAAGCCGCGTTACGAACTGCATTCGTCGAGTTGGTTACCTGGTTTCGCATCTGCTTTGCTTTCACATACGTCATTTCCATCCGTTGTGGAAGGGAGCGTACGGAATTCTTCGTCTTTTCTACTGGCTTAACAAACGTCGGATCCCAAGGTTTATAGTGCCATGAATAGCGTTCATGCCTCAAAGAAGCAGATGCGTGGCCGTTGAGGCTTCCTCAGCTTTTATCCTTATGTTGGTA
>130
CAATCTGACTGTCTTAACGTGAGGAATGCATCTCCCCTCTGCTCGCAAAACTTAATGTACTTAATCCAACTGCCGCGGCTCGGGATGATGCCACCTCCTAGATTTGCCTCGAACTCGCCACATTGCCTCTCACTCCGAACGGCAGGAACCGCGTGAAGACAAAATGCTGGCCTACTACGCCGCTAAATGAATGAAGAACGCGTTCGACCCCGCACGACCCATCTGAATGGTTTACGCAGATGGTTGGCTGCTCGATAGTACGGCTCTCAATCCAAGAAATTTACTGAAGCCGGGGTCGTTGAGTCCCAAATGTTTGGATGCCGATGCTCTCAGGTCAGCCCTTACCGCATTGCTCGGATTCGGAATGCATCGACAGTCCGATTGTAGAGCCAGCTCTCCGTTCGGATGGCTACGTGCCTCGTATGCATGCAGGAGGCGTTTGAGATCGGACTCCCAAGGTGCACTTAGCGGCTCATCGACTTAGCTTTAATGGCCGAGCGGGGTCGCCGGAAGCCGGGATGTCACGTGCTATCTTGTCTCCGGAATTGCCATAATGCAACCCGTTTAATTAACGCATTGTGTCCTACGCTTTAAATGCACTGCTGTTGGCTGACGCTCTAACGGGTCGTTGGGTCGCAGAAGCGGCAGTTTTCCCCGTGGCCCCGCTGCTGCCACGCATATCGCCGGTAGCCATTGCTACTGGGACGCCAGTTCCCGCGCCTCCGTTAACGGTCTAAAATGAACTGATTTAGATGATTTGACGAGTCGATTATCGCACCATGAAGTCAGAAGTCTCGAGGATGCTCGAAGCGCCACGACTTCTAATCGTGTGGCGCGACTAAGCGTGCGCAGCGGAGGATCCAGTAACGGAATTTAATCAGTGGATCCAATGTGGCTTGAGCCATGCCGCAACGATTCTTGATCGACGCTCCGGTTGGCTTACAGCTGCCCATTAGTCTTTCGATCGATGATCTGTCCCCACCGCCAATAAATTTAGCCGTGAGGACCCGGAGCCCGTCAACGGTTACCGCTTCTATCCATGAATAAATTACGGACTGAATTCCAAACCCGGAGCCCAACCCCTAATGTCTCCTATCCCCCAACTCCATGGATGCGATTGCTGGCTCTGGAGCAGCGAGCGAGACTTTATTTATTCCACGCCCCTCAGCCAGTTCGGTTAGCCTGCGACTAGCCATCCGCGCAACTTATTGCACCTAAACTTCAAGCACTGACGGTTTGATAAAGGGTCGCATTCGACGCCAATCTTAACTGAGGCATACGTGGCGAACATGACCGTGCCCGGAACCGCATACGTCTCGTAATTGGCTTCCGCGACGATTCTTCTCATTTCTCGCTCGTCTCTATTCCCCGCAATTTGCCTGGTTGCCATCACCGCAACAGGAGCCACGCGAGTACGAGCCTCAGATAGACCAGGAATAGAAGCAAACTGACGTGGTCCGATTGAAGAGGATCGCCTAATAGTAGTGCAACATATAGCCAGTCTTAGGCGCTAAATTGGCACGAGTTATGTAATGGAAGATTATTATTGATAGAAATTAAGAGAAAGAAGAGGACTAGTTGGACGGAAGCTAACGAAGAACGACCATGTTAGTAGTGTTGGTGAGCCCTCTGAGACTGCGGCCTGCCAACTTCTTTAAGTATTGGCAACAGTGATTTTGTAACTAGAGAAGTAACGTTGCGGCAACGTTCTTGAAGTTTAAGTGGATATGTAATAAACTATTAGTACCAGTACATGTTACAGAGACTATTGTAGGCGTTACAAATCCTCATGTTTTAAAATGTTTATAAACACGATGCTTAGAGCTAACTCAGAACCCATCTGGTTTTTCTGCTTCATGTTTCGACGCAGTCGGTATTAATTCAACCTCTTTCACGGACCGTCTGTCGTTGTACTACTATTTTCCTATGAGATACAAATTTTATTACAGTCAGTACACACGTCAATTACGGGGATCGTGTAATACATACGAAGTGATAAGTTACATTTAAATCCTTATGACTAATCGTTGAGTCGTTCCCATCGCCAAATGAATGATGTGCCTTGAATACCACTGGGCGTTTTGATCTTTATTAAGGTACTAGGTAGTCTTAGTTAAAATGTTACTTTAATCAATCTATAAAATGGAGTTGTTGACATAATTAAAATTTTAGAAACCAATTAAAGATTTAAAGATCTTTATCATAATCTTATCGTAACGCTGGTTGCATTGTCAGATACTTTTAATACCGTTTTAGACTATTTACTGTGAAGGAATTATTTGACGATCCTGTGACGTAAAATATAATTGTGCTGCTCTGAAACAACTTTGACATTTAATAGTGTCTATACAGTCAACCTAGAGACAAAGAGATCCAGTATGTTGAGAAACCGAAAACGTCACCATTTATTGGGGTGTTAAAACTTTGTGCCAAGATTACGAGTTAACAAGTTAGATTAGCGACGAGTGTAACGTTACTATCTTATTTGA
>131
GAAGCGATGCAAGCGCGTCGGCGGACGGCGAGTGTCTGGGCCGCAGGTGAACTCAGTACCCGCTGCGTCGCACCATCGGAGCTCCGAGTCAGGCGTTGGTGTACTTTATGAAACAATGCAATCAGGCCGTAACAGGATGCTGATCAGGTCCGCGGCTTACGTTGCGATTTAACCGTAGTACTACACGAATCTACGAGATGGCGACTGCGTTATTATGCGGCGTGCTGCCGAGTGGAGTAATAACCCTGTTTTACGTTTAAGCAGGAGCAATTTTACTACAGACGATCAGTAGTCTAAGGACCCGCAATATACAGCGGCCAAAAAGCGTACGTCTGCTTAGCCCGTGAGGTTTGTGAAAATAGTCAGGTCGCACAACAGCAGGCAACCACTAAGTTCATATCACCAGATGTTAATTAATTTGTATACAGTAGGCGCCTTTGATAATAGAGACTTTCTGCCTCCGAGCTGTAGAGGTACTGCGTGGCTTTAGAAAGTATGATCCGCTGGCTTTAAACTTTTATGAAATAAAAGACCAGTACGCGTATTAACATACGTGGGCTGCGATTGTTTAAGGTCGTTGGAGGTCTGACAAAGTCGGATCATGCGAGGAGGCTTTCTCGTATAGCGACAGGTTTTATTGACAAAACGGTAACAATTACCAGTGGGGCAGGGGAACGAGAGTTAATACTAAGGCTCACTCAGTAGATCATTATGGGCTAGTATATCTTTTCTGTCTTAGATATGTAGCGCAAAGGGAAGGACTCACGACATACAAACCTTCTTTCCTGCCCTTCTCCTGCTTCTGATGATACGTGAAGTCAACTAATTGGTTAATTTATTCGACGAACTAAACCCAGACTTTTATTTACAAAATAAAATACGAGTGGTTCCAACTAGCCACTTCCGTGCCTCTGCTACCAATAGAGTCATTGGCGATGCCGTAGTGACTTATCTCAGGAGAAGTTTTGCCGAGACGTTGCTGAGCCGCTCCAGTCTAAATCGTTAATCGGGAAAGGAGTCATCCCGTGGGAAGAAAGATTTTAAGCCGGCCTGATAAACCAGGAGAATGGCGCCGTACGAAATGCGTTCTGACGAGCTATAGTTTAAGGCCCGGCCAACACCTGCTTTGGCGCTCTCTCTTCCTCGGTGCTCCGAGCCAATGCATTTTGACCTTAGGCTTGTCATCTACAAATGTCCGGAGCTGTGCCGCAATAACTGTATTATTTTACAGTTTAACCTCATTTTCCATAATCACTCGGCTGCCGGCATGAGAAGGGTCCCGCAGAATAACCAGGCTACAACCCTAGGGTACTACTCGGCTCATAAAGTCGCTATTAGTACAGCTACAGCGACTCCCTATTGTAAGCTAGCGGCGGCGGAGTGAAAGGTCAACCGGTTTAGTAGAGGTGACCAGGTCCGCTTGGACGTATCGAGGTAGTCGATCCGATCACTAACTTGTTGCACGCTCGTGCTTAATTCTCGCCTCGATTTGCGCTCCTTCCACCCCTTAGTATGTTTGTTCAATAGTACTAAGATTGTGGGCGGCTTGTCAACCTTGGAGGGGATAGTGGTCCGGTCGACTTCCTTGTCATTACATTTTGGCTGTACCAAGCCAGGAAGGCAAAGGCAACGAGAAGGGTACTCTATACTCTATGATTATTTATGCTTAGTTTGTTTGGACGATTAATGTTTTAATCTTTATCTTATCGTCTGTTTAATCGGTAATCGATAGGCCCCTCATCAAACCCTACCTACTCCACATCACGAGTCCTACTGCGTAACGTTCCTTTATAAATCCATCCTTGTCCTACTACGTTACCGCTCTCCGCTCGCCTCCTCAACGTTTTTACGTTGTAGCGATCTACAACCTATGATTGGTTGATCCAACGCTAAACAGATACTCGCTCGCGTTCGGATCTATATAGCCAACTATCCCTTAGCGTCACTCCTACCACTAAAGCTCATTAACGAAAGAACGGCCCCCACGAGCTCTCCTAAAGGCCTGGCGGTGCTCTATCGGATGACGCAAAGCATACTAGCAAATACTGCCTAACACCCACGCAAGGCAAGCGGTCAGCGAGCGTTGGCTGTACTGGCATCGAGAAGTCTTAGGGTCATGATTATGTATGGCCAGTTAAGGTTGATAGCCTGCCGCTTGTCAATCGGCCATGAAGGCTTTTCGTTCCCTTCTCGGCTGCCGCCACCGCCGGCTACCCGCCTGGTAAAAGAAAGTCCAGGTGATGGATAAAAGACGCCCCGGTGTCTAGAGGATACGAGCTACATCGGAGCATAAGTGGCTGTTTAGGCCAACCAGTTAACAGGTCTCGCATCCCGAAAGGAGCGAGAAGAGACCCTAAATCCGATATATTACATTGGACTTAAATGGATTATCGCCAACCGTGAGAACAGCCTTAAATATGTTGTAAGCGAGTGAGCTAGTGGGCCGATAACCAGCCTCTAGAGCTGCATCCAACACAGGCACTTGCACGAAATGAGTTAACTCAATTATGCTAATCCCCCTTGACTCATTTATCTCGACTTATAAACCCCTTAAAGCAGCCGTACGTGCTAGAACTATATCAAAGGAGGTAATATGGTCGTCCGTTGCTCGTGCGCCGGTTTGTTTAACATAAGACTAATGGTGACACGACTTAGGAAATGTAGCACCCGCAAGATCGGTCGTAAGACGACCCGCCTGGCCGCCGTGACTGTCATGTAGACATAATTTGGCATTACTCCCATTTGACTTTTAAATCTATTAAGAGGTTCTTAATCGTAGATGTGACCGGGCATATAGTAGTAGAGCACCAACTTAGTTACGCGATGCGAAGCACCCGACCCTTAAAGAAACCCCATTTACATTATAGTCAAACAGTTTGCCGTAAGCGGTTAAACAAATAAAACCTCTGATATGTTGACCTCGAGGCAATTTAATCTCGGCTCGTCCCCAGGTGTAGCAATAATGCTTCTTTCTTTACTCTCGTAGTATCCGCGTGCGGATACTACGAGATCACGAGGCCGGAGGCCCCGATAGGCGAGCTGGTTGTAAGGCACACGTACTTCTACGATCACTTTAGTAGGCAAGTTGCGCGTTCCGAGCATCCCCTAGTTATCATCGAGCGACTTAATCTCTACTACTTGTAACTAGATCAATGTATGTGGCTAATTCAGCGAAAGGTGCGTAAATGCCTATGAGTTAGGATCCCGCTGGTGCCTGAGAAGCATCTGTCCTGTATGGAGACTCGGAAGTATTTAAGCCTGTGGGCAGTACTCAGTACGGCATCCTTGCCGCGTACACGGCACAAGTAACACGGACCACAGGGCCCCTATCTATCCTAACTGCCAAGTAAACTCGGCCTGTGTGCTTCGGCTGGCTCCGCGGCAATGTCGTAGCCGGCCGGGTCGACTTGTTCTTGGGGATCTTCTTTACCGTGGTGGAAGGATTTATCTGTAGAGCCCTCGACTTCGACCCTAGTGATACAGCCTTAGTCTAACGAGCAAGTAATAACGAGTCGAGTCTCCTCATCTGCTCCAGGAGGTCGATGATGCCTATAAATTTTATTAAACTGGATCGCCGTAAAGCTCTAGACTGTATTAATTAGTTATCTGTATCGTAGCTGCGTATAAGTGATCTAAAGGCTAGAAGTGAGAAGGGGCAAAACTGTGTTGTGTGGCTTCGACTGAGAAACCTTAGGGAGTGGTTGACGAACTAACAATGAGGGAACGATCGCCTCCCCCTCGGCCTCGAAGCTTCAGATGGACTGATACAGCAACATTAGAATTTTGACGAGCGTATAAAATCCTACGGGGTTTAGTTTATCTCAGCCGCGGCCATGCCTCTGCGCCTTGCAGATGTCACTCCTGCCGAGTCTTTGTCGTGGCGTAGCCGTAGTTACGTATAAACGGAGCTGCTAACTATTAAAATCCTAGGATCCGATGGATCGCTCCTTATGACCCATCCAACACCGTATTCAACTACACGTTATTGGATGAGAAGGTGCATGAAACAGAAGATGGGTATCATACCGGTGGATACAGCGGCGCGTCACTACGTTTAGCTGTTTTCGCTAATCAGCCGGCGCGTTAGCATGCGATAACTTTCAAAAGCTTTCGGGATCCCCTCCTGCCTTCGAATGGTTAACCAACAGGATTAGGGTCCTACAGAGCGGGTACTAGATGCAGGCGCCAAAGAAATAACGAATAGGCAGCCATGTAGCCCAGCACCTGTTGGAATCGACACTGCGTAAATCGTTTTAAGCCCTCAGCATAAATCACATGCCCGTTGATTCAGCATTGAGTTTCACAGGGGCCAGTATGAGACG
>132
GGTGTTTAACCTTTCCACCGAATCAGCGGTAAAGGTTGACTGCGTAAATCGACCAGTAACATGGGCCTTTTGAAGAGGATCAGAAATGGGGAAGAAGGCGAAGTCAACTGAGCGCCGGGATTTACCCCTAACCTTTGAGGATAGATGCGCTGTGCTTCCAGCGGAGCGGGACGGGTAAAGAGTCCATTAGGCAGAGACGGCGAATCGCAATCATGAAGCTATACAGTACAACATTGGAGTTATTTCAGACACAAACACAAGCCTCTGACAGCGAGAATCAACAGTGATAATTCCGTTACGTTACATTCATCAGCTTGATCTGGATCGAAAAATCCTGGCTACTAAGAGGATCAAGCAGAAGACACTCAAATTACATGAGCAAAATTAAAGCAATAAGGAGGGGTCTGCCTGATGCTCCATTGAAGACATCACCACAAAGAAATTGCGGCAATGCTCAATGGATACATAGGGAGGGCAAGGCGGCGTCAGCCAAGTTAATCAGATCAACACTGAGCGATGTGCATTCGAGGAGGAGAAGAGCGAAGAGGAGAAGAAGAAAGGAGGCCCGCTCACTCGCGCAGGCAAATCAGGGGTAGGAGATTACGGGTGGACGATGAATACCTGAAAATTTATCAAGCAAGCAGCAGAATCATACCATGTTGGCTCAGACTTGCAATGGAACCTGTTGTTACCGGGCAACGAGTCGGTACTTTGGTCGGTGCGAAATGAAGTGGTCTGATATCGTAATGGATATCTTTATGTCGAGCAGCAAAACAGGGCGTAAATTGCCATCCCAACAGCATTGCATATTGATGCTCGGAATATCAATGAAGGAAACACTTGATAAATGCAAAGAGATTCTTGGCGGAGAAACCATAATTGCATCTACTCGTCTGAAATGCTTTCATCCGGCTAATCATCTTAGCGCCTCTGGTTTTATGCCGCCCGCAGCATCGCTAATCTTTCCTTTCGGAAAGGGGATCTGCGCCTACCTTTCACGAGTTGCGCAGTTTGTCTGCAAGACTCTATGGAAGCATATAAGCGATAAGTTTGCTCAACATCTTCCCTGCATAAGTCGGACACCATGGCATCACAGTATCGTGATGACAGAGGCAGGGAGTGGACAATTGAAATCAAATAATGATTTTATTTGACTGATAGTGACTTCGTTCGTTGCAACAAATTGATAAGCAATGCTTTTATAATGCCAACTTAGATACCAAAGCTGAACGAGAAACGTAAAATGATATAAAGAGCACAGATGGCATGAAGTGGCGACCAGGCAGAAAGAACACGATAATACTGAGAACACAACATATGCAGTCATGAATCAACTACTTAGATGGTATTGGTACTATCAACACAGAGCATTAGCGCAAGGTGATTTTGTCTCCTTCTTGCTAGCATTTTTGTCATCAAACCTCGTGCAGCACTCCAGCCAGAAGCACAAAGCCTCGCAATCCAGTGCAAGCTTTGTGCCACCCACTACGCTACTGCATAATAACCGAGTTAAGAAGACGCAGTGGGTCAAACGCACTCCCAGCTCTGTTCCTTTCCTTTCAGCCATATTCCCCCAGCGCAGCATGCAGTCCTTTCCGCCATAACTTAGTGAACCGTCTGTTGAGCGGAGCTGGGAAGTTAACATAGGTGGAAAAATGGCTACGAAAGTCCGTGGCTATCTATCAGCTTATTAGTACTTGAAACGCTTCTTCACGAGCCTGAAGCTAATCGTTCGGCGATACTATATGCATTAATAGACTATATCGTCTTATAAACAGTGCACCAGCACATGCATGAATAACAGTGCGGGTCTTAGTACAAAGGAAGCAGAAGCTAAATATGGAAACTACAATACGATGCCCGTTAAGTTCAATACTACTACATCTTTAGATGGAAAACCGTATGTAATAAGAGTAATTTAAAGAGAGATCCTGTTGCCGCCAAATAAATTGCGGTTATTTTAATAAATAAGGCAGCCAGAGGTGGGAAGTGAGATGGCTGGAGGAAGAGGAGAGGTATTCCTGCAGTGAAAATAAGGCAATTCCTACGAGCAATGGTTGGAACTGATTTCCTTAGATTCAGTGTTTTATCTTACTGTCTTTGATGAGCATGGTGGAAAAAGCGATATCGGAAATGTTAAAATTGGTTTGTAGTCAATAGAGATAGCACTGGTTCATGCCTCCGCTCGCTGATTCAGGTCACTCCTGAAATGTTTTTCTCCTTAGTGAAGGCGTACTATGTCGTCAATCTCAGCAAATTAAGCGATGGTTTTAAACATAAACCTTCTTAAAGCTATTCAGGATTTAGTAGTATGGCCAAATCGAATTAGCCGACATTGAAAATGAAGCGTCCTTAACACTCATTACTTAGAGGGTAATCTCTTTCAGAAATTCATGACAGTTCGCACGTGTTAAATGGTTCAGAATTGTCAGATTTCCACTTTTCATTAATAGAAGGTGCTCCCGGATTCAGTACTTTATAACGCTGCCGTTGAGGTACCCTTTACTTCTATGCCCAGCAGCACGAACATTCATGCTTTTATCGGTAGAATGGTGGCGTAAACAACAATTTTGAATGGAATGATTGGTGCAATCACCAACCCAGAAAACAATGAATATTTTCTGGCGGAAAATAATAGACTTATCGAGTCAAGAATCCCAAAGGGATATTTCGATCGCCGAGGTTGCGAGATGTGATTAGCATGAATCTCGTGGCTTTCCCTAAAGAAACAACTGAAGCAAGGTACACAATACTTTTACTTGGACTCAAGAATGCTGCCAGCAATAGTGCCACTATCGCGCTCCGCGATCTCCTGCCCGTGCTGCTTTCGATTATTGGTTGTTGTGAGAGTGATAGAAAGGACACACTCTGGCTTGAAGCTATCAAACTAAGTAGTGATGAAAACTTTCCAACTATGGAACTCGTAAGCCTCATTTCTAAATATGAAGAGTTAAGACGTAATGAACCACAGATTCAAGTGATAGATGATAAATTCACCAAATTGTTTATGACAATATCCAGAAGATGCATCTGCTTCGAATGAGCTCTGGACATGCAATTGTTTTATTTACTATCTAAGATTAGTAATGTCGTTGGCGACAGTCATTAGTTTTTATTCGATGAACCAGAGGGTTCATCTGCATCCTATTTGCTCTCTCTGCTTTTTACGAACATTAAGCGATTTACTCGATGCACGCAATGGTGTAGCAATAATTGCAACTCATTCCCCAGTAGTACTGCAGAGGTTCCAAATCTGCATGTACGAGGTCCTACGTCAAGAAGCAATAAATATTATCCGTTTAGATATTGAGACATTCGGTACAACTTAGTTTTAACTCGTGAGGTGTTTTACTTGAAGCCGAAGTGACAAAGAACCGCGCGATACCATCACCCCAGGAATGAAGTCTGCTATGATGCAGTCTTCTTATGAATGACCATTCTAAAATTATAATGGTCATAATAGGATTGAGAAGGTCGAACAACCGTTTAAAGCGATGATAATGAACAGAGATGAGATCGGTACATCGAGCCTATTCTACTGGCTTCCTCGGCGATATCGCGCGCAAATGCTTAATAATAAATGCTGGAAGGTATGATGCAGACTGATGTTAGAATAATTCATTACTATTTCCCACTTTACAGAAAGAACAACAATATAGAATATGTAAGCTCGACAGGTCAGTTATTTACCTACGACAGGACACCTCTTACTCTAACAACCTTAGTAATTAACCTGACAGGTTAAATTAGAAGAGCTTTATGAAAATAATCTCCAGGGTAAAACAAACCGCTAGAACATATTACCGATGACATGTGCTTGTTCATCAGGTACAAATGTCCATTTTGTGATATGGACAGACAAATATAGATCATTTTCTTTCCTTGCACAGATTATCCACTGAATTTTCGGTGCCTATTAATCAATTTAGTTCCATCGTGCCGCGACTGCAATATGGGAGAAAGTCAAGTTCGCAGTAATGAGGTACCAAGCGATTCATCCCTATGACAAGACATTTTCGTGAGCAATGGTATGACTGCAAATTCGTTTCCGGAACTCCGGGGTGCTATCAGTTTTTATGTTGAATGCCGGCGAACGGGGAGGCAGGAAGAAAGAAGTTCCGCCGTGGAGTCGCAGAACGAGTAAAGTTTGCTATAACAGGTATCGTTTGGCAGCGAAGGAAGCACCATTGAACCATGATTATTAAAGAAACTCTTTCGTAAAGTTATAAGGAAAATATAGTTCAACCGCAACGTTCAGCAGTAAGCCAAGTTAAGAATTTATTGAAGCAAATCTGAAGTGGCTATCCTTACCCGCCTTTATTCCCATCTTCGTCGGAGATCCTTGGGAGGGAATCTGTGAATTCGCAGCAAACTCGGAAGAAGATTTCAGAGGGGCATTAGAATATGATGAAAGGATAGAAAATTACGACGCTTATCGGAAGTGAACGAATACTTTATGAGGAGGGCTGTTTACAAAATCCGTAGTAACCTGGTCCAACCAATCCGCAGGTCATTGGCAACAGTGCATGCACCGAGAAGGACGTTTGTAATGTTTAGGTGGCGGCACAGCAGTCCTAGGGACATGTACCGTACAGTCATAGATGGTCGGTGGAGGTGGTACAAATTCTCATGCAAAGATATGTAAATCGGTAGCAACTGGAATCATTCAACACCGGCACTATTCGGAAGTTCACCAGCCAGCCGCAGCACGTTCCTGCATACCGACGTGTCTGCGTTCGACGCACTCTTAGCTGAGCAACGTGGAGGCGCAGGCAGCCACCGAGATTGGCACGAGGCAAGATAAGGAAGGCTAAGAGCATATTAAATTTCCTGTAATTACGATTTTACTGGGTTTCTGATAAGAATCGGTTTGCAAAGATCATCAAACACTTATCCATTGACAGTTAAGCAGTTAATTTAGCTCTAAAATATATCAGCATCTAGCATGCAACCTATCAAAATGGAGAGTTTTATGACTAAAACCATGGAAGGAAGACTTAAAGATTTATCGCAGTGCTCAAATGCTGCATGCATCTGGATTTTGGCTCCCTGGGATCTCTTTCCGCATGCGATTCGATCATTCCTCCAAACCGCAGAACAGTAACATTTATTATTCAAAACAAAACCAGATTACAGTGACATTTGGTATAACAATAATGTTATTGAAAATGGAAAATGATCCATTAATGGCTTGGCTAATTCGCAATACGATAGAAAAACAAGGCGATTAGAAGCGTATAGCGAGGCAAAGGCTACTCTTATTTCATCTTACATTGAAGAAAATGACATTGAGTTATTACAATGAAAGTATGTTAAACATTGGTAAAGTTAGTCAGACTTGCACAAAGAAATTACCTTCATATTTAACTGAATCATCTATTATTAAATCAGAAGACGATGGGTCGTAGCTAATACGCTAAAGATTACGAATTATTACATGCCTTAGCTATAATCTAGCTGGCAGAATGACTGCCCGGCACCGCCGCGGCAGAAGAGGAAGGATGGAAAATGCGGACGAGTGATTTCGCCAACATCATTCGACTCTTTATTTGATGAAGCCAGGAGAATAACTGCTTTAAATTAAAGATCACTCCATAAGCAACTTTAGCTTTAGCATGATACAATATGTGACAATAAATAATTCCTGAAGACTTAAAGAGCGTCTAAAACTGGTAGAGCCTAAATATCACTTCGACAGAAGAGTCCGTGTAACGGCCGGCCTCGTTTCTGCCGCATCGACTTTTAAAGACGTTATTACATTCAAACATTAATTTTATGATAAACAATTCCATCCAGTGATTGATTTAATCAATACAACATTTGAAGATCAAGCAGATAACTTTTGGCGTTATGCAGCCTGACAGCCAATAACAAATGCCTATCGCTTCATTTGGATATCAGAGCTATGGCTCAGAAAAGCAAGCATCTACTCCAATAAACCAATACATACAATGCCAATTATCATGAAGACTTCAGGTAATTGGGGATTGATTCAAATAATAATCAAATGTATTTCATGGAAACTAGTTGAGAAAACGAAGAAAAACCGACTTTAGAAATATCAACAGCAGACTCAAAACATGACGAAAAACCATATTTCACTGCGTTCAGTCTTACGCAATTGGCGGTGATGTAATAAACTATGAACAATTGAGTCATAAACTTCCATTATTCTCCTGCAAAGAAGGCAGAGATCGAGAAAAGGAACCAATACCCAGCACAAGAGACTACTAACCGCAAGAACGTTATTTCATACAACGTTCTGCGGCATCACAAACGATTACTCCATAACAGTAGGGACAGCAGAAGGCCGACTAATATCAGGTGCAGTTGATGTATCAACACGGTTCAGCAACACCGAGATACTTCTTCCAGGCTTCGCATGCGGGTTTCCTGCTTCCTTCCGTTTCCGTTGAGATCTTCCCAGCATCCTGAAGCGGCGCAATAGCTCACTGGCTGAGCATCAGGCTTTTTGTTTCTTCCGCCTCCCGAAGGATCCGGAACAGTTTTCTGCTTCCGTATCCTTCACCAGGCGTGCCGTTCCACTTCGATATTCCCCTCCCGGCGATACCCGGTAAATTTTCCGGTAACGGACTGAAGTTAGAAATAAAGGTAACGCGTCGCCGAAGCCACGTCAGCGACGGTTTTATCCGATGGTCTTCAACGAGATGCCACGATGCCTCATCATCACTGTTGAAACAGCCACAAATAGCCGCTCGGAATATCTGGCGGTGCATATCGGTACTGTTTGCAGGCAGACCGGTATCAGGCGGAATATGCGTCACCTTCACCAATAACAATTCATTAGTTCCGGCCAGCAGATTATAATTTATGGTCCGTGGTTGTTCATCATCCATTCGAACGAAGCGGGAGAGCCCAACCGCAGCAATGAGGTGGAAGAAGCAAGCTTGACGGTGTTTTCCGCGTTGACGCAGCGTTAATAACGGTACCGTGTTGTCCGTGTGAACCAATACTGAAGAATCGAACATGAGCACGATAACAAATGAGATGCTGGTGCGCATAATCAGTACGCGTATGCGCATGTGCACGGCATAGCACAACGAGCGTACCGGACAATGAGTGACTTGGCTTCCCTGACTTCCGCCGTTCCATCCCTCAGCAATACCCTGTGTTATGCTGGCTTCCTTTAACTGTGATAAACTTCCTGTATAATGGTTGCCTGTTCCATACTGACTCCAGCCACGAACTGTTCATCCTTAGACCACTTGTGGGCATGAGCACCCGCTCGCTGTTGAACCGCTCAGACTGTGAGCATGAGCCCCCGTGTTGACGTTCCTTTGATCGACTGCATCGTAAATGCCTGTTGTTTATTTCCCCTAGTAATGAACCTAATGTAGTTTCGTCCCCAATCCGTACCGGATGACCGGGCACTGTGGGTGTGCGACTTAATTCCATCCTGTTCCTGAGACAATACAGCACGAAGCTGCGGGTTTCCCCTTGATTGCCTCCGCATATCAGGAAGCACACCCAGGGCATTACGCGACAGGGCAGTTTACGGCTGATTTGTTAGTAAACGCCTGCCCTGCATCAGAAGGTTATAACAAACCGGAACCGGTATGGGGGAGCGGAGAAGAGACGGCGAGGAATTCTGAGCATCACGAGGACTGTCAAGAGTAATACTTAAGAAACAGAATTAG
>133
ATGACCTCCGTCGACGGTAAAATGGGACTTAATACTGAAACTGGATCAAGCAAGCATTCACCTAACCCCTTTCCTGTTTTCCTATCCTCCCGCGCTTTCCTCGGGCGATATTTTCATGCGCTATTTCAGGGAGTTCAGCCATGAACTGAGCGTATTGAATTCAGGATCTTTGAGGCTCAGAGCTGGCGCGTCTACCACCGACCGCCTTAGTGAAGAGAGACGGGAGGCATGAACTGCTTAACCAAGACGACATGAAAGGCCTGCCCCAGCATAGCTGTTTGAATCGCTATGCATCAATCATTTGCAGCAACGCCACGGGGCCAGCAAAAATCCATTACCCGTGCGTTTGATGGACGATGTTGGTCTCAGTTTTACCGCATGAACCAGAACACATCTTAAGTGGTGGTTGAACCATTACTGCTCACCCACCAGGTTGATATTGATTCATAGAGGTATAAACGAATGAGTACTGCACTCGCAACGCTGGCCTCTCTGAAGCTGAGCAACGTCGCATGGATTCTGTCACTCCACCGGAACTGATCACCATATTCTAGCCAGACGGCATTTAAAGGTGATGCCAGCGATGCGCATTTCATCGCATTACTGATCGTTTCAACCAGTACGGCCTTAATCCGTGACGAAAGAAATTTACGCCTTTCTCCGTATACTAATGGCATCGTTCATGCGTTCTCTGCTCTTCGCCGCATCAATGAAATACAGCAGTTTGATGGCAGGGACCTGTTTACATAAATGAATTCCTGTGATCAATTCTGGTGCGCGCTCAGGGACAGGCAGCACCGAGAAGGGCAAGCCATCCGATCTGCGTTACCCGAATCTGATGGCGGCCGTCGACACGCCATGCCTTCGGACCGCCAAAGCGAAAAGGCAGATCACTGGCTGTCTGCATGCGTGACGATTAGATGTTACGTCATAAAGCCATGGATTCAGTTGTCGTCGCCGTCTGGCCTTTGGATTTGCTGGTACTGTTGACAAGTACTGAAGCCGAGCATTGAGGAAACTGCATACTGCGAACGTCATCACGAACGCGACATCACTCCGGTTAACACGATGAAACCATGCAGGAGATTACCCTCTGGTTGATCGCCCTCGTAAAACATGGGCATTGACGACTTATTATTGCCGCTCTGTTCAGATATTTCGCCGCGACATTCGTGCATCGTCAGAACCTAAGGCCGAAGCAGTAAACGCTCTTGATTCCTGAAACAGAACCCGCATACCAAGAAGGTGGCAAGCATGACACCGGACATTATCCTGCATGATCTCGATACCGCCGTGTTGAGCTGTCGAACAGGGGATGATGCGTACAAAGTCGACCTCGTCACATCACGCTTCAGAAGTTCACAACAATTACTAAAACGCCCTATGGAAAAGAAGTGGCCTGACATGGAAAATGTCCTCTACTTCCACAGCGCTTATTTGCTGAGGTTCTCACCGGGTGTGGCTCCGGAAGTTAACGCTAAAGCACTCTGCTGGGAAAACAGTACGAGAACGACTCAGAACCTGTTTGAATTCACTTCCGGCCGTGAAATGTTACTGAAATCCCCGATCATCTATCCCGGACGAAAGTATGCGTAATGCCTGCTCCTAATGGTTATGCAGTGACCGGACTGGCCTTGAACGACTGCCGTTTGCTCTAGATTTCATGAAGTTCAGGCTCGGTGGTTTCCGGCTAATAAAGTCAGCTTACATGGCCCACCGTAGGCAGTACAGCATGTGCGTTAACGCGGGAAAAATGCCTGGTATTTTCACTATGACCGCGTATGAAGCGTGAAGCCCTTGCATTTATGTCGTGATTGATGGATGGAAAGGTACAGGCGATTGACCACGCGGTAATGCCGTTATCGAAAATGACGAGCACTGTATGAATGTGGTTTGTATTTGGGGAGCGCAATTGAGATGTGACGCATCCACGATAATGCCTGGGCGCAAGTACCTTCTTTTATCGCGTTGGTCGATCAAAGCGAGGCTGGTATTTCCCGCTTTCTGTTTGTACAAATCCACTGAAAGCTAACATCTATCATCGACTGAGGAGATAATAAACTAGCGGCTGTATCAAACGCATCTTCTGTTAGTTAAGAACGAGTATCCAGATACAGCCCTACTCTTGCTCTCAAATTTACCGAATCAGGTTTGTCGGATACCATATAGACAGTACGATACCGACCGAAGAATTTCATTATAGCCGTTCTCGCATTACGTTCACAAAGCTGGAAATGGCATCTTAGAAGCAGAAGCGCTATCCAGAAACCAGGTATGACAAACTAGAATGCATTTTCTGTACCGGCTGCTTCTGGTGGTTGCTTGGTCAGACATCGGGACTTGTTCGTAATGACCTCAGCAGGAAAACCGCCTTCGCACTCATTTGATTCATGATAGGTCATAATTCTGAAATCGACAAAGCCAGACGCTTTTCGGGTATAGACTGGTCCTTACTTTCCGCTTGGGTCTGACAGAAGCTCACCGTAGCTTAACGGTGATCGATGGGATTCACACCGACTCATTTAAGCCTGGCAATCGGCATGTTAAACGCGTCTTTAAGGAACGATGAACATGAAAAGCAAATCATCAGGCATCTACCCTACTCCTTTTATTGGTCGCATTCTACCCTCAATCTTATTAACCAACTCCGTCACAGCATTGACTTAAGACATCATATGATCTGATTCAGCATCAGAATAGAAGAATTAAGGCACAACAGCAATAAAATTCCAGCTATGAATTATCACCCGGCTATATCTGCCACTCATTGTTGGCCTGTGGCTTTAGATAGATGAACGAAGACGCCTGTCGTTCTAGTTTATTGCCTTTAAAGCGCAAGTTGCCAGGAGGATTGGAACTTACCTGTAAACATAGAGAGGTTCGAAAGTGTAATAGAAGTGTCTACTCTGTAAGCAACTGCGTGAATTAGGCATATCAAGGCAATGCATGACTGACTGGGGATTTGACGCAGATACGTTTCCATGAATTGGTACCGTAATTGCTCGAATGTGGTGGGTCATGACGCGACGAAACCACCTCTAATACATCAACTCCGCCTGATAGGCAACCCTAGTCTTCTAGCAGCTCGGTGAAACTGCGTGTTTAGCTTGAATAAAATCGACTCAACCATCGCTCGTCGTGAGTATTATACGAAGGTGTTATCCCTCGATGGAGTAAGCCGTGGTTACCTGGCAACGAGACCTCAACGAATTTAGTCCAACGAATCGTACGTTTCTTGTTGTTCTCGCTTCCTGGGAAGACTCCTGTTTTCACTCACTGCACTGGTACTGAAGGGTTTCTGTGATAAGTTAATCGAACACAATACCGTTAGTAATAACTATGAAGCTTACGCATCTAGTATAACCGTGAGTGCTGGTCAACCGTCATCAGCATGCAGACAGGTATCGCATAGGCTGTGGACCCCGGCATTCTAATCAACACCGTTGAGATCGGTTTGACATGACGCTTTGTGAAAATGCTGAATTTCGCGTCCTTTGTTCACCGGCTCAATGCCCAGTCTTGTAGTGTCATAGGTTGACTTGTATTCTCAAACATCCTGGTTGGGGTCTTCTTTACTGTTTCTTTACATAACATCGTCACTTACCGTTTTACTGTGAAACGACATCACTTCAAGGAGTTTGATAAATGAGGTTATCAATGCGTTAGGTAAGTTGCTCATAATTGGCGTTGTAATGTTGCACCTTTAGGTGTCTTTATCCATGCAGACATCACCTGGTTTCTTGTAGTGTGGAAGGTATAGATATAGAGTCGATACAAAATATTCCATGAACCATAGTTTGCCTTTACTAATGAAGACAAATCCCCATTCTGCAATGTTGAAAGTGACTTATACGTTCGAGCAAAATTATGTACACGTATGACGTCTGAAACGGATATTTGCCTCTCTCGTGACATATATCATACAACATTAAACCCAATATTACAGCACAATCCGCAGCGCGGGGATCTATTTGATGAACGCCCACGCGGGTTGGTCTATGGAGGATAAATGGACGGACTGCATGCGAGTCACCAGGAGAATGGAATGGAGAGCCATTCAACAGAGTTATGAAGGGAGAATCAACGAAGCGCCCACCCACCTGGACATGATATGATTTCCAGAACAAGAGCATGCAGGTACTGGAGCGAGCTTCGCATTAAGCAGCCCGCAACTGAAAGAACACCAGCCGCCTATGGATTTTTATTGGCGTGTAATTGCGGAGACCTTGCGATGATCTACACTTCAGGAGTGGAACGCACGAGCCGCGACGTCCAAGAAGCCTTGAAACTCGTTGAGTCGATGGGTTCGAGGGAATGCAGGATGATCCAGCGCGAGTCCACCGAATGGAAGAGAGAGCTCTGTTCCACGAAGCGGTAAAGGTTGACTTAAATCGACCAGTAACAGGGCCGTTTTTGAAGAGGATGGAAATGGGAAGAAGGCGAAGTCAGCCGCCGGGATTTGGCACCTAAGAACAATGGTTAGCAGCCACATGGACTGACGGCGGAGCAAAGAGCCGATTGCCGGGCAGAGACAGGAATCGCAATCACTGAAGCTATACAGGCCAACATTGAGTTATTTTCAGGACACAACACAGCGCCTGACAGCGAAGGGTCAGACCAGCGTCAGTTACGTTACTCATTAGATAGTACGCTACGAAGAAATCTAATAGAACGAATCTAAGCAGAAGACCGCCTCAATGCCATATGCGCAAATTAAAGGCAATAGAAGAGAATGTAGAGCCTTACCTCCATTGAAGACATCACAAAGAAAATGCGGCAATGCTCAACCGGAGAATAGAACGAGGCAAAGGCGGGGTCATAGCAGATCAGGCAAGAGATGACACTGAGCGATGCATTCCGAGAGGCATAGCTGAAGGCCATAGACAAACCATGTCGCATGCCACTCGCGCAGCAAATCAGGTAAGGAGATCAAGACTTACGGCACTGACGAATACCTGAAAATTTATCAAGCAGCAGAATCAGCCCCATGTTGGCTCAGACTTGGCAATGGAACTCGGCTGTTGTTACCGGGCAACGAGTCCTTAATGTGAGCGGCGAAAGAGGGCGAAGGTCTGATATCGTAGATGGATATCTTTATGTCGAGCAAAGCAAACAGGCGTAAATGCCATCCCAACAGCAGTGCATATTACTGCTCTGGGGAATATCAATGAAGGAACATGATAAATGCAAGAGATCTCCGAGAAACCATAATGCATCACTCGTCGCGAACCGCTTTCATCCGGCACCAGTATGAAGGGGTTTTATGCGCGCACGAAAGCATCAGGTATTTCCTTCGAAGGGGATCGCCCAGCTTTTCACGACCAGTGCGCAGTTTGTCTGCAAGACCTCCGGAAGGATAAGCGGGATAAGTTGCTCAACATCCTTCCGGGCATAAGTCGGACACCAGGCATCACAGTATGATGACAGAGGCAGGAGTGGGACAAATTGAAATCAAATAATGATTTTATTTACTGATAGTACTGTTCGTTGCAACAATTAAGCGCAATGCTTTATAATGCCAAGGGCTTAACAAAAAGGCGGAATAGAAACCAAAGGATAAAGAGGATAGAGGGCAACGAGTACGCATAAAACAGACTACATAATACTGTAAAACACAACAGCTGCAGTCAGCTATGAATCAACCACTTAGATGGTATTGAGGTACCTGTGAGACCAGCATTAGCGCAAGGTGATTTGTCTTCTGCGCGTTAATGTCATCAAACCTGTCGCACTCCCGAGGGAGCACCAAGCGCCACCCGAATCCCTTGCCATTCTTCGCGGATCCACTAAGTACTGCATAACCAGTAAGAAGATAGCAGTGATGTCAAACGACGCAGCTGACTTCTTCTTTCACGACTTCCCCACCCCAGCATGCAGCCTTTCCCCCATAACCTGGCTGAATGTCTTTGGGTGGAGCGAGGAGCGGAAGATCATAACACCCCTTATGAAAATGGGACGAAGTCCGTGGCTATCTATCAACGGCTTATTAGTACTTGAAACGCTTCTTCGAAGCCTAAAGGAGCTAATCGTTCGCGGCGATACTATATGCATTAATAGACTATATCGTTGATCATAGGCACATGCAACATGAAATAACAGTGGGTATGGAACGGAAGCAGAAGGCTAAATATGGAAAACTACAATACGATGCCCCGTTAAGTTCAATACCACATTTAGATGGAAAACGTATGTAATAGAGTAACTTAAAGAGAGATGCATCCGGCTTGCCGCCAAATAAAATGCGGTTATTTAATAAATTAAGGGTTACTATGTTGGAGTTAATGTTATTGAACGAAGAGGGGCGGGTATATTCCTGCAGTAGAAAAAGTAAGGCATTCCTACGAGCAGATGGTTGCAAAGGATTACCGTTTCCTTTGTTACAATGTTTTATCTTACTGTCTTTGATGAGCATGGTGAAAATGCGATATCGGAAATGTTAAATTGGTTTTAGGTCAAAAGAAGAAGTAAGCACTTAATGCTTAATAGATAAATTCAGTCAACTCCCTGAATGTTTTTCCTTAAAGCAGGCATTACTATGTTAATCTCAGCAAATTACCGAGCGATGGTTTTAAACATATAATTCTTAAAGCTATTCAGGATTTAGTAGGTATGTAAATCGATTAGCCGACATGCGGAAAGGGAATCTAAAGCCAGGAGCCTTAGAGGGGTACAATTCCAGAAATTCAGTGGACAGTTCGCACGTGTGTTAAATCAGTTTGCCAGAATTGTCAGATTTCCATTTTCATTTAATAGAAAGGTGCTCCGATTCAGTGATTTAACTAGCCCTTTGAGGTGACGGTTAATTCTATGCCCAGCACGAACATTCATGCTTTATGATGCGGAATGGGTGTAAAAATAACAATTTGAATGGAAGTGATTGGTGCAATCACCAATGGAGAGAACAATGAATATTTTCTGAAAATAAGGACTTATCGATCGAATCCCAAAGGGATATTTTCGATCGCCTGTTTCAGTTTCGTTTAGTGCATTTGATCCTTTTACTCCTCCTAAAGAACAACCTGACCCAGCAAAGGTACAATACCTTTTATCAATCTCATCAAGAATGCTGCCAGCAATAGTTAAGCCACTAGGCGATCTCCGCTTAGAATTCATTTTCAGCATTTATTGGTTGTATGGCGAGATATAGATAGAAAAGACACACTCTGGCTTGAAGGCTCCAAACTAAGTGAGGTCATGAAAACTTTTCAAATATGGAACTCATCACCTCATTTCTAAAATATGAAGAGTTAAGACGTAATGAACCCAAGATTCAATTGACGATGATAAATTCACTAAATTGTTTAGTTGACAATATCCAGAATATTCTGCTTCGAATGAGCTCTGGACATGCAATTGTTTATTTACTATCAAGATTAGTAATGTCGTTGGCGAAGGTTGAGTTTTATTCGATGAACCAGTTCATCTGCAGGCCTATTCTCTCTGCTCTTTTTACCGAACATGAGCGACTTACTCGATGCACGCAATGGTGGCATAATGCAACTCATTCCTCCCCAGTAGTACTGCAAGAGGTTCCAAATCGCTGCATGTGGAAAGTCCTACGTCAAGAAGCAATAAAATATTATCCGTCCGGATATTGGAGAAGGTTCGTAGAGACCCGGGGTGGCACGCGGGCAGGTCTAGAGTCGAAGTGACAAATTCTGGATACCACCATCTTATCAGCAGTCCGTTGATTCAGAGCTTTCTTATGAAACCATTCTAAAATTATAATGGTCCATACTAGGATTAGAAGGTCGAACCGTTTAAAGCGATGATAATGAACAGAGATGAAGGTAAAGTACAATGAAAGACCTACTTCTCAGCGAGATCGAGTCTACCGAAGTGCTTAATAAACATGCTCGAAGGTATGATGCATATAAATGTTAGAAGTAGATTTCATTACTCACTTCCCACTTTTGCAGAAGAAACAACAATATAGAAATATTAAGCTCGACAGGTCAGTTATTTAGCGCCGGCACCGACTTCGCCCCTCCTGCTTCGGTAGTTGGTAACCTGACAAAGTCAGTTAAGCAGAAGAGAAGCTTTATGAAAATAATCTCCGAGATAAAACAAACCCGCTAGACATATTTACGATGACATGCTTGTTTCATCAGGTGAAAAATGTTAGGTTTTGTGAATATAGACAGACAAAATATAGATCATTTCCTTCTATTGCACATTATCCTGAATTTTCTAGCCTTATTAGTGATCCTAGTTCCATCGTTGCCGCGACTGCAATATGGGAGAGAGAAAGGTCAAGTTTTCGCAGTAGATGAGGTACTAAGCGATTCATCCTACATGACACACCACATTTTTCGTTGAACCGTAGTATGCAAATTTCGTTTCCAGGGGACTCCGGTGCTATCCAGTTTTTGGTGTTGAATGCCCGGCGAAAACTCGAGGCAGGAAATCAAACACAGAGCTCTTCATCATTTCAAGCTATTAAATATTGTTGACAGCTAGGTATCGTTTTAGAGGCAGGGAAGCACTTGAGTGAATACCATCCAAAGAATCCTTTCGTAAAGTTATAAGGAAGTAGCGTTAACCGCAACGTTTCAGCAGCTACAGTCAGAATTTATTACGCAAGCAAATCTGACCGTACGTATAGATTTGTGAATGACTTCCCCAATTATTGGAAAGAGTTATGTATCAGTGCCTAGCAAACTCGGAAGATTTTCAGGGATCTCAGAATATGATGAAAGATAGAAAATTACGACGCTTATCGGAAGTGAACGAATACTTTTATATGAGGGAGGCTGTTTACAAAATCCGGTAGTAACTTGCTGCTAACCAATTCCTAGGCAGGTCATTGGCAACAGTGGCATGCAGGGAGAAAGGACGTTTGTAATGTCCGCTCGGCACATAGCAGTCCCTAGGGACAAGTGGCGTACAGTCATAGATGGTCCTGTGGAGGTGGTCACAAATTCTCTCATGCAAAATACTTAAATCGGTAGCAACTGGAAATCATTCAACACCCGCACTATCGGAAGTTACTCACCAGCCAGCCGCAGCACGTTCCTGCATACGACGTGTCTGCGGCTCCAGACTTCTCCTATAGGCAACGGCGTGTTAGGCAGAGCCAAGCCACACTCTAATTTTAATACATAATGAATGATAATAATAATAATATTAATAAATTTCCCAATTACCGATTTATATGGTTTCTGATAAGAATCATTGCAAAGATCAAACAATGTATTACATTGACAGTTAAGCAGTTAATTTTATCAGCCTAAAATATATCAGCATCTTGGCGCATGCATCGGGTCAAAAATGAGAGTTTTATGACTAAACCATGGAAAGAAGACTTAAATTTATCGCATTGCTCAAATGCCTGCACTTGATACATATTTTGACGCTGAATTATTTCGCTTGAATTTTGAATCAATTCCTCCAAACCCTAAGAACAGTAACATTTATTATTCAAAACAAAACCAGATTGGGATATGACATTTGGTATAACAATAATGTTATTGAAAAATGGAAAATGATCATGATTAATGATGTCAAAATTCCGCAATACGATAGAAAAACAACGATTTAGAAGGGTAGCGAGGCAAAGGCTACCTCTTATTCATCTTACATTGAAGAAAGTGACATTGAGTTATTACAAAGGAAAGCTAGTTAAACAGGGGTAAAGCGAGTCAGATGAAGATTAAAAAGAAATTACCTTCATATTTAACGATCACTCTATTATTAAATCAGAAAGACGATGGGTCGCTACTAGGCCTACAAAGATTACGAATTATTACATGCCTTAGCTACCGCTGGCAGACTTAACTGCTGTAACTCTCTTGGCATACAAATAAACAATCCAATCAACTGGGTACGTTCTTTTACATGTTC
>134
ATCTAATCTGTTCATCTAATTGGCATTGTATGTATTGGTTTGGAGTAGATGCTTGCTTTCAGCCCTAGCTGATATCCAAATGAAGGACGGGAGGGGCATTTGTTATTTTGGCTCTGTCATAGGGCATAACGCCCCAAAATATATTTATCTTAGCGGCTCCAGATCTCCTCCTGGCTGAAGGCGATTGGATGGAATTGTTATCATAAAAATGCATGTTGAATGTGATAACCGTCCTTTAAAAGTCGTTTCTGCAGCTTGGCTGTATAGTCAACTAACTCTTCTGTCGAAGTACTGTTTAGGCTTATCTACCAGTTTTAGACCTCTTTAATATCTTCAGGAATTATTTTATTGTCATATTGTATCATGCTAGTACCGCAATTTGCTTATGAGTAATCTTTTAATAGTTTAAATAAGTTATTCTCCTGGCTTCATCAATAAAGAGTCGAATGATGTTGGCGAACAGCATCGTCACCATTACTGAATGTTTATTTGTATGCCAAGAGTTACAGCAGTTATACATTCTGCCATAGATTATAGCTAAGGCATGTAATAATTCGATCTTTGAGTGCCGACCCATCGTCTTTCGATTTAATAATAGATGATTCAGTTAAATATCGAATAATTTCTTTGTTGCAGTCGACCCGACCCTAGAGACTGTGGCGCATTTCGGTTGTAACAACTCAATGTCATTTCTTCAAGCCTTAACATGAAGTAAGAGTAGCCTTTGCCTCGCTATACATTTCTAAATCGCCCTTGTTCATCGTATTGCCAGAATTTAGCAAACGAGATGATATCGATCATTTTCCATTTTCAATAACATTATTGTTATACCAAATGTCATATCCTATAATCTGGTTTTGTTTTTGAATAATAATGTTACTGTTCTTGCGTTTAGAGGAATTTAATCAAATTCAAGTGAAATATTCAGGGTTCAGATAAATACTTATCACAATGCAGCATTTGAGCAAGTGCGATAAATCTTTAAGTCTTCTTTCCCATGGTTTTAGTCATAGACTCTCCATTTTGATAGGTTGCATGCTAGATGCTGATATTTTGCGCGGGTGATAATCATTCTGCTGCTATATTCGTAATACAAGTTGTTTGATCTTTGCAATGATTCTTATCAGAAACCAGTAAATTAGTCACACAGGAAATTTTAATATTATTATTATCATTCATTACCTTATGCGAACGCATCTGGTAGAGGCAGGCGCGAATTGGCGCAGGAGAACTGGTGAGCCGCAGACACGTCGTATGCAGGAACGTGCTTGAGGCCTGGCTGGCGACTTCCGATAGTGCGTGTTGAATGATTCCGTTGCCCCAATTTTACATTTTAAGTGAGAATTTGTACCATCACCTCCCACATAGGACCATCTATGACTGTACGCTGTCCCACGGGGCACGGGTAGTGCCGGAGGGACAAGTCACAAACGTCCTTCTCGGTGCATGCCACTGTTGCCAATGACCTGCCTAGGAATTGGTCCAAGTTACTACCGGATTTGTAAAACAGCCCTCCATAAAAGTATTCGTTCCTTCCGGACTAGTTCTGTATATTTCTCATCTTTCATCATATTCTAGATCCCTGGAAAAATCTTCCGGGATTGTTAAAGAGCAAGACAAACCTATACCGTTAAACAAATTAGAGAAGTCATTCAATCTATAATAGGTTCAGATTTGCTTGCAGAATCGAACTAGCCGAGCGGAAAGGTTGCGGTTGAATGGCATATTTCCTTATAACTTTACGAAAGAGTTTCTTTGAGTAATCACTTCACTCAAGCTTGCTTCCCTGCCTCCAAACGATACCTGTTAGCAATATTTAATAGCCCTTGAAGATGATGAAGAGCCTCTGTGTTTGTCTTCCTGCCTCCAGTTCACCGGGCATTCGCACACCAAAATAGCGACGCAGGGGTTCCCGCGCAACCGAAGTTGCCGACCTCGCATTGCCTCACGAAAAATGTCCTTGTCGATAGGGATGAATGCCGCTTGGTGTACCTCATCTACTGCGAAGACTGTACCTTTCTCTCCCATATTGCAGTCGCGGCACGATGGAATCTAAATTAATAGGCATCACCGAAAATTCAGGATAATGTCTAATAGGAAGAAAATGATCGTGTTTGTCTGTTGCTCTTAAAGGCCCGCTGACAGCTTTTCCCTGATGAAACAAGCATGTCATCGTAATATGTTCCAGCGCGAGGTTATCGGAGAAGAGTGCCAACTTGTTAGCAATTAAGCGTGATAGTTGTCAATTACAACTAAGGTTAGGCTCAAGAGGTGTCTCTGTCGTGGACGGTAATATGACCTGTCCAGCTTAATACTTCGTATGTTGTTCTTTCTGCCAAAGTGGGGCAGTGGGGCCTGGCAGTGCTTTCCCACCCTTTATCTGCATCATACTTCCGAGCATTTATTAAGCATTTCGCTATAATTCTCGCTGGAAGAGCTGTTTTTCATTACTTTACCTTCACTCCTGTTCACTTATCATCGTTAAAACGCGTTTCCTACTTCTAAGTTCCTATCTGACTATTACTTTGAATGGTTTCATAAGAAGCTGAGAATCAACGACTGCGATAATAAGTGGTGGTATCCAGAATTTGTCACTTCAAGTAAAGCCTCACGAGTTAAACCACCTAAGTTCTCACGAAGGTGTCTCAATATCTGAACGATAACTTTATTGCTTCTCTTGACTAGGTGCACTTTCCACATGCAGGATTTGGAATGGTGCATATTACTCGGGGAAGGGATAGGAGTCTAAGTATGGAGAAGTCCATTTCTTGCATGACGAGTAAGTCGCTTAATGTTCGTAAAGGCATATGAGAAGGGGTGATGCATATGAACTCCTCTTTAACCCAAGCCGACTCAAACCTTTCGCCGACTACAGCTCTACTAATCTTGTAACGTAAACAACTGCATGTCCAGGTCCACTCATTTCGAATAAGATATTTCTGATGTCATAAAACAATTTAGTGAATTTATCATCGTCCACTTGAATCTTGGTTCATTACGTCTTGACTCTGTCATATTTACAGAACCGGGTCGATGAGTTCCATATTTGAAGTTTTCATCACTACTTAGTTTTTACCTTCAAGCCAGAGTGTCTTTTCTATCTACTCATACAACCAAGATAATGCTGAAGATGAATTTCTAATGGAGAATGCCTAGTACATTTAACCACCTTGCTGACGCAGGCAGCATTCTTGAGTCAAGCGATACGCAAAGTATTAGGATCTTGGCGCAGGCATTTATCGAGGAGGTAAAAGGATCAAATGCACTAAACGAAACGAACAAGCGATGGAAAATATCCTTTGGCATTCTTGACTCGATAAGTCTATTATTTTCAGAAAAATATTCCGCTTTCTCCTTATTGCTTCAGGAGAGTGCCTTCCATTCTCAAAATGTTGTTTTACCACACCATTCCGCCGCCGATAAAGCATGAATGTTCGTGCTGGGCATAGAATTAAACCGTCATCTTAAAAAGGTATAGTTAAATCACTGAATCCGGCAGCACTTTTCTATTAAAGTCCAAATGAGAATGACAATTCTGGCAAACCATTAACACACGTGCGACTGTCCCTGAGCTGAATTTCTGAAAGAGTTACCCCTACGAACATGGAGGTGTTAAGGACCCTGTTCATTTTCAATGTCGGCTAATCGATTTGGCCACTAGATAGCACAAATCCTGAAGCTTTAAGAAGGTTATGTTAAACCATCGCAGGCAGTGGCGCCCAGACACAGAATAGTCAATGCTTTCACCTAAGGAAAAACATTTCAGGGGTTGACTGAATTTATCTATTAATGAATAAGTGCTTACTTCTTCTTTTATCTAAAACCAACCATTTTAACATGCGCTCCCATTTTCTTCGCCTTGGTAAGCCACCATCGATAAACATTGACAAAGGAATAGTCATTCCAACCATCTGCTCGTAGGAGAATGCCTTATTTTTCTACTGCAGGAATATACCCGCCTCTTTCGAATAACACTAAATCCCAACATATAGTACCGCTTCCTTTATTAAAACCGCAATTTATTTGGCGGCTACAGGATCTCTTTAAGTTACTGGGTACATACGTTTCCATCTAAATTAGTAGTATGACATTGAACGGGGCATCGTATTGTCCTATCTTCCACCATTTAGCTTTCTGCTTCCTTTGATAATATCCCACTGTTATTCATGTGCAACGCAGGTGCACCGCCGAAGAAGCACCACAGAGTAATGCATATAGTATCGCCAAACCATTAGCTCTTCAGGCTTCTGAAGCGTTCAAGTAGCTAATAAGCCGATAGATAGCCACGACTTCGTAGCCATTTTCAGGCCTGTGACTTCCCTCCTCCAACAGACATTCACTACAGTTATGAGAAGAACCATGCATGCTGACTGTGGGGAAGTCGTGGAAAGAAGAAGTCAGCTGCGTCGTTTGACATCACTGCATATCTTCTTACTGGTTATGCAGGTCTTAGTGTAGTCGGCACAAAGCTTTGCACTGGATTGCAGGCTTTGTGTGCTTCTCTCCGGAGTGCGACACCATAGGTTTGACATCAAAATTAGGCAAGAAGACAAAATTAGCTTTAAGCGCCTTACTGTTACATCCTAATACCATCTAAATAGTTGATTCATAGTGACCTGCATATGTTGTGTTTTACAGTATTATGTGGGTCTGTTTTTACTTAAAATCTAATTTAATATTGATATTTATCATTTCGGATCGGTTTCTCGTGCCCGTTCCGAGTACCCACAGGCATTATGGAGACCGAAAACAGCATGCTTATCAATTTGTGCAACGAACAGTACTATCAGTCAAAATAAAATCATTATTTGATTTCAATTTGTCCCACTCCTGCCTCTGTCATCACGATACTGTGATGCCATGGTGTCCATGACTTATGCCCCAGAGAAGATGTTGAGCAAACTTATCGCTTATCTGCTTCTCAGAGTCTTGCAGACAAACTGCGCACTCGTGAAGAGGGTAGGTGCGGATCCCTTCGAAAGGAAAGACCTGATGCTTTTCGTGCCGAGCATAAAAAGGTAGATAATCGTAGCATGTCACATGAAAGCGGTTCGCGACGAGTAATGGCAATTATGGTTTCTCCCGCAAGAATGATCTCCCTTTGCATTTATCAAGTGTTTTCCTTCGGTGTGATTTCCGCGCATCAATATGCAATGCTGTTGGGATGATTTTACGCCATGTTTAGCTTTGCTTAACATAAACAGCGCCGGCTTATCCAACCATGACCACTTCATTTCGAGCATAAATCGACGATAATTCGTTGCCCGTAACAACAGCCAGTTCCATTGCACAGTCGAGACAGCGGTGAGCGGCGTACTCCCAATAGGACTTTCAGGTATTCGTCAGCCGTAAGTCCTTAATCTCCTGAGTGGGTTTTGCTGCGCGAGAGTGGCAGCGACATGGTTTGTTGTTATGGCTTCAGCTATTGCCCTCCGGAATGCATCGCTCAGGTGTTGATCTGATTACTTGGCTGAGGGACTCATTCCGCTTCCTCTTATCCATTATTGAGCATTGCCGCAGCACTAATTTCTTTGTGGTATGTCCAAGTGAAGCATCAGGCAGACCCCTCCTTATGCTTTAATTTTGCTCATGTAATAATTTATGAGTGTCTTCTGCTTGATCCTCCTGCTGGCCAGGATTTTCTGAGATCACCAGCCATGAAGATGTAACGTAACGAATTATCACTGTTGATTCCGCTGTCAGAGCTTGTTTGTGTTGACTGAAAATAACTCAATGATGTTGGCCCTGTATAGCTTCAGTGAATTGCGATTCGCCTGTCTCTGCCTAATCCAACCTTCTTACCCGTCCTTGCTTCTATCGAGTTCCTATATGCGGTGTTCCGACCAGGTTAGGGGAGAAGCCGAGGAACTCATGATCGCCTTCTTCCCATTTCTAATCCTTCAAAGCTGTTACTGGTCGATTTAAGTCAACCTTTACCGCTGATTCGTGGAACAGATATCCTCTTCCATCCTTAACCGGAGGTGGGAATATCCTGCATTCCCGAACCGCATCGACGAACTGTTTCAAGGCTTCTTGGACGTCGCCTCCGTGCGTTCCTCATCCCTGAAGTGTCAAGTACATCGCAAAGTCTCCGGCAATTACGCAAGAAAAACCGCCATCAGGCGGGTTGGTGTTCTTTCAGTTCTTCATCAATTCGGAAGATCTTGGTTACGTCTGCATGTCGTATCGAGCGCCCATATCATCCCTGCCTGTGCGTCGTGCTTTCTCCGGTTCGATAACTCTGTTGGAATGGCTCTACATTCCATTCCTCCTGTGACTCGGAAGTGCATTTATCGCTCCATAAACAAACCCGCTCATTAGCGATTCAGATAAAGAGCAAATCCCGCGAGTGGGGAATGAGGCGACAATATTAGGGGTTTAATCATCATACTATATGTTTTACACAGAGAGGCAAGTATCGTTTCCCACAATTATAGTCTCTGATAATTTGCACGGTATCAGTCATTTCGCACATTGCGGAATGGGGATTGTCTTCATTACTGGTGACATCCTTCATGGAATATTTTATGCCGACTCTATATCTATACCTTCATCTACATAAACACCCTTCGTGATGTCTGCCGGGCATAGAGCGCCAATGCCACAACATTGATAACGCCCAATCTTTTAGCCACTCTAACTCATTGATATATCATTTATAAATTCCTGTGCAATGTATGTCGTTTCACTAAACGGTATCAGCAATGTTATGTAAAGAAACAGTAAGATAAGTACATCAACCCGATGTTGAGTACGGTCAAGGATGGTACTACAGACCTGGCATGGGGTCGGGCGAAGACGACGCGGATTCAGCATGTTCACAAGCGTTATCTTTTGTACAAACCCGATCCACTCTCCTTTATCGTGAATGCCAGCGTCAGACATCATATGCATATCTCAACGCCCTGCATCCTGAATGGAGGATCGCCCACGGGCAGAGAAGGCGCGATGCGTAATGATGTCGATAGTCACTAACGGGTCTTGTCCATTACTCCGCCGAGCACTCCTTCCCTTACCAGTGCAGTGCTGTAATAACAGGAGTCTTCCAGTATCGAACAACAAGAAACTGGTTTCCGTTCACGGACTTCGTTGCTTTCTCAGTTAGCAATACCGCTTACTCCCATCCGATAACACTTCGTAATATCTCACGCTGCTCGTTAGATTTTAATTTGCTGTTCAAGCTCAACACGCAGTTTCCCACTGTTAGGCAATATCCTCGTTTCCCTGGTCTCCAGGCGTTTGATGTATTGCTGGTTTCTTTCCCGACAGTTCATCCAGCAGTTCCAGCACAATCGATGGTGTTACCAATTCATGGAAAGGTCTCGTTAGTCAAATCCCCAGTCGTCATGCATGCCTTGCTCTGCCGCTTCACGCATCGCGGGGGAAACGAGTCGCGCGTGCCCAATCTCTCTGTTTACTGAAGTTCCAGATCCTCCTGGCACTTGCACAAGTCGAACAACCCTGAACGACAGAGGCGTCTTCGTTCATCTATCGGATCGCCACACTCACAACAATGAGTGACCAGATATAGCCTCTTATTTGGAGGCGGCAGAATTTTATTGCTGTGTTGCGCTGTAATTCTTCTATTTCTGATGCTGAATCAATGATGTCTGCCATCTTCATTAATCCACGGCTGTTGGTTAAACCGCTAGTCAGGACCGACTGCGAATAATAAAGGAGCCTGTAGCTCCTGATGATTTGCTGCTTTCATGTTCATCGTTCCTTAAAGACGCCGTTTAACATGCCGATTGCCAGGCTTAAATGAGTCGGTGTGAATCCCATCAGCGTTACCGTTTCTGGCGCCTCCTTGCTTCTTCGATCACAACGCGATGTCATCGACGTTATCCGGAAACCCGCTTAGGGGCGTACTTACAGAATCGAGGAAGCAAGGTGCTGCGAAATTAGGCGTGAGGGCGTTTCCTGCTGAGGTGTCATTGAACAAGTCCCATGTCGGCAGCATAAGCACACAGAATATGAAGCCCGCTGCCAGAAAATGCATTCCGTGGTTGATAGCTGGTTTCTCTCATCTGCTTCTGCTTTCGCCACCATCATTTCCAGCTTGTTGTGAAGGGATGCGGACGTATGAAATTCTTCGTCTGTTCTACTGGTATTGGCACAATGATCCAATTTGAGCAAGGCTATGTGCCATCTGCAATGATACTCGTTCTTAACTCAACAGAACATGCTTTTGTGCATACGACCCCTCGTTTATTATTTATCTCCTCAGCCAGCCGCTGTGCTTCTTCCCTTGGGGTTTCCGACAGAAAGGCCGGAAATACCACCCAGCCTCGCTTTGTAACGGAGTAGACGAAGAAGTACATGCGACAGCATGATATAGCTTGAGGATGCGTCATCGCCATTGCTCCCAAATACAAAACCAATTTCGAGCCGAAACGCGCGTGAGTGCCGAACTCCGAACCGAAAAGGATGCGTCAAACCGCCATGTACTTTCTATCCCGCTCAATCACTACATAATGCAGGCCTTCACGCTTCATACGGGTCATAGTTGGCAAAGTACCAGGCATTTTCGCCGTTACCCACATGCTGTACTACTGCACCCTGGGCCATGTAAGCTGATTTATGGCCTCGAAACCACGAGCCGGAACTTCATGAAAATCCCGGGAGGTAAACGGGCATTTCTTCCATTTCGCGACACGATTCCGTCGGCATAACCATCGGGGAGCACCGACGGTACGCATACTTTCGTCGCGATAGATGATCGGGGATTCAGTAACATTCACGCCGGAAGGTGAATTCAAACAGGGTTCTGGCGTCGTTCTCGTACTGTTTTCCCAGGCCAGTGCTGTCCCTCGTTAATTTCCGGAGCCCGCTGCCACAATATGAGCAATCAGCAAGCATGTGGGATGAGGACATTTCATAGATCATTCTTCCGAATGGGTTAGGCGAGATCACACGAGTGGTAACTTCTGAAGCATGTGTAGATGACTCACGAGGCCGTAATTGTGCCACGCATCATCCCCTGTTCGACAGCGCTCACATGGATCCCGGTACGCTGCAGGATACACTATGTCCTGTCATGCTGCCCTTCTGCTCTGCGGCTTTTGCTGTTCAAAGAAGCGTACAGGGTTTGCTCTGCTTCTCTGCTGTCAGTTCTGACGATGCACGAATGTCGAGCAATGGTGAATATCTGGGAACAGAGCGGCAGACCAAGTCGTCATCCCATGTTTATCCAGGGCGATCACTACCAGTGTTAATCTCCTGCATGGTTTCATCGTTAACCGGAGTGATGTCGCGTTCCGGCTGACGTTCTGCAGTGTATGCAGTATTTTCGACAATGCGCTCGGCTTCATCCTGTCATAGAGCCAGCAAATCTTAGAAGGCGACGGGCACACTAGAATCATGGCTTTGTGTGACGTAACATCCGTTGGGATGCGACTGCCACGGCCCCCGATTTCTCTGCCTTCGCGATTTGACCGGAGAGCGTGGCGGAATCCATGGAAGGGATCGGTAACGCAGATCGCTGGTCATGATTTACGTTGCGGTATCCATGCGGTACTAGGATTCATTGTCCTGTGATCAACAGCTTCAGTCAAACTGCGCTCTGCGCTGGTTTTCATGTAATGATGCGGACCAGCCGTAAACGAGCCCACCACCCGGACGATGCCATTCTGCTTATACCGGAAAGGCGTAAATTCTTTCGTCCACGATTAAGGCCGTACTGGTTGGCAACGATCATAGTAATGCGATGAACTGCGCATCGCTGGCATGGCCCTTTAAATGCCGTCTGGCGAACAGTGGTGATCAGTTTCCTGTGGTATTAATCGACAGAATCCATGCCGACACGTTCAGCCAGCTTCCCAGCCAGCGTTGCGAGTGCAGTATCCATTCGTTTGACTATCTGAATCAATATTAGGTCAAGTGGTGTAATAGGTATGGGG
>135
CGGCACTGGCTAGGGTATTTCGCGGGTATTTGAGTGAAAATTTCCGGTTAATAAGGCGTTCCGTTCTTCTTCGTCATAACTTAATGTTTTATTTGCTAAATACCCTCTACGAAAGAAGGAGAAGCCACCAAGAACGAAGGTGAAGCGGGTTGTTGTTGGCCTCTGTCGTTTCCTTTCTCTGTTTTGTCCGTGGAAGATGAACAATGGAAGAGACAAAGCAGCTGCTGACACTTTCGGTGCGAGTATCTTACAGATCCCTTCAGAACTAGCAAGGGAACAGGGAATGCCCGTTCTGTGAGGGGCACTTGAGGGTAATGAGATGCTTTTATCTATGATGCAGCCATGCTATACCAAATGGTATGCCAGGAAGGGATGTGCTGAAATTGAGACGAAAAAGCTGCGCCGGGAGGTTGGGAAGAATGGCGGCAGGCCAGCGAGGCAGAGAATTCCGCATAACTAGGAGGTGAGTACGAACTCACGACCCTAACTCCCGCGCCCGACGACGCACAGGATCTGAAGAATGCCAGAGACTCCGCTGAAATGGTGGAAATCCGCATTCTGTACTTTTCGTCTGTTATGTCGCGGATCGCAGGTGAAATCCCAGTATTCTCGACGGCTCCCCCTTGGTCGGTGCAGCCGGCGTTTTCCCTAGGAACGCGGAAAAACCGACATGTTGATTCCTGAAACGGGATATCATCAGCAAAGCCATGAACAACGCAGCCGCGCTGGATGAACTGATACCGGGGTTGCTCGCTGTAGAGAATATGAAGCCAGTCAGGTTAACAGGCTGCGGCCATTTTGTCCGCTAGCCGGATGCGCCGTTAAGCTGTTCCGGCCGGCCACAGACGCCGTTGAAGCGTATGAGGATCAGTCCATCCTCCGAAAGAATCCGCATACCAGGAAGGCGCTGGGAAACACCTGCTTTCAGCGCGGGTCATCATGAATGCGATGGGCAGCGACTAATCGATTGAGGTGAATCGTGAAGTCTGCCGTCGGTTATTCCCAAAATGCTGCTGGTGTTATGCCTATTTATAGAGCATAAGCAGGCACAGCCCCCTTATCTGGTTGCCGACGATGGTGATGCCGCCGAGACAAATTGTTATGAAAACCCACGTTGAGCCGACTATTCGTGATATTCGTCTCTGTTGGATGCTGGCCTGTAGCCCCGTGACCAAGCAAAGCACCGGATGATAACACGCTCACCATGAAGCGTTCACTAATGGGCGTGGCTTCCGGGCCCTCATAGGCGGTAAAGCGGGCAAAACGATCCGACAGTGGGGCCTTGTAGCGGGTTATGATGAACTTGCTGCTTTGATGATGATATTGAACAGGAAGCTCTGGACGTTCCTGGTAACAAGGGTCGAAGGCTCGGTTATGGCCAAAGTCCATCCCTGTCTCACGGCCTAAATGAGAGGCACCTGTTTAGATTGAGCGTAGCAGCCATATCCAAATCCGCATTTTGGTGCGTTTCATGTTGCCTGCCCGCATTGGCGGGGAGCAGGCTGTAATAATAAAAATTTGGCACAAAGAGACGGTTTATCAGCTCAAATGGACGCCTTATCTCGCCTCCAGCGTGTTTATCTCTGCGAGCATAATGCCTGCGTCATCCGCCAGCAGGAGCCCCGGACTTTACTGACTCTGCCGTTATATCTGCGAAAGACCGGATCTGGGTACCGTGATGGCATTCTCTGGTTTTCGTCATCCGGTGAACAGAGATTGAGCCACCTGACAGTGTATCTTTCACATCTGGAAACACGTCGTAAGCCCGTTCACCACCTGGCCTTAAGATTGTCAAAGACCTCATGAAACGAAAGGGTAAGAACGGGAAAACCTGTATAAACCTTCGTAACATCAACGCTCGTGAGACGAGGAGGCGACTTGGCGAACCCCGTCCACACATGCTGAAATTACTGCACCAGCGAAGCCGCATTATTCAGCACGTTCCTGACCGTGTGGCTGTACCTGACCGCATTCGGTATGGATTCCCAGCTGGACCGCTACGAAATGCGCGTATGGGGATGGCGCGGGGTGAGGAAAGCCTGGCTGATTGACCGGCAGATTATTATGGCCGCCACAACCGACTCCATGAACATAACGCTGCTGCGTGATGAGGCCATCAAGATAAAGGCTATACCGCCGAATCTTAAGAAATGTCGATATCCCGTATCTGCTGGGATAACTGGGCGGGATTGATCGCACAGCCATTGTGTACCTGGGACGCCGGAAAACATGGGGTTCCGGTGATCCCCATCCTAAAGCATCCGTCTACGAAAGCCGTCCAGCATGCTAATTAAGCGAATCAAAACGGGGTTACCTTACCGAATTCGATCATTAATCCGCGACCATACCAGCAGATTTATAACGCTTCACACTGACGCGCCGGAAGGCATGAACCGCTTCCGCAGGTCAGTTCACTTCCCCGAATACGGGTTTGATCTGACTGACGAGCGCAGCATGAACTGCTGAAGATGCAGGTCGAAAATGGGTGGATGGCACCAAAGACTGTGGACAGCAAACAGCGACGCAATGAGGCACTCGACCTTCGTTATGCGCTGGCGGCGCCTCGCGGCAGGTCAGGATAGTTTTCCTCTCTCGGCAGCTGATTCAGTGCGCTGCCGGCAGAAGCCTGTACTGCAGGAAGAGGATATGCGCAGCAACAACAAGAAAACAACCTAAGATCACGCCGTGCCCTTATCCGGAGGATGAATGACGCGACAGGAAGTTCCAACTTGCTGCCGCCGTGCGGCATTGCATGATAGCCATGACAGGTAAACGGGTGGCAACAGTACAGAAAGACGGACGAAGGGTGGAGTTGTACGGCCTTCCGTGTGACTGAGGACCTATATTGCAGAGCTTAGAAGTGCAGACCGGCATGACAAGGGACGCATGGGAGACCTGCAGGACCTTTTATGGCCGAACGCCACCATCTTCCCACCCTTCTCTCATCGACGGCATGACATCGCTTGCGCGAATATGCCGGTTATCACGGCGGGCAGCACATTTGAGGGCAGTTGCGGTCGTCGAATGCACCGAGTGAAGTGTATGATGCAGCCTTAGTTGCCCCCAACTTTACCGTGGCAACCGCCCGCGCAGACGATCTGGTACAGCGACTACATTGAGCTGCTCAACGCCATCCAGCTGCATCAGGATGATATCGTCGGGTCTTTTCCGGCTCAGTCATCGCCCAAGCTGGCGCTATCTGGGCATCGGGGAGGAAGAAGCCCGTGCCTTCCGCGAGATTGAAGCGGCATGGAAGAGATTGCCGAGGATGACTGCTGCTGCATTGACGTTGAGCGAAAACGCACGTTTACCATGATGATTCGGGGAATAGTGTGACCGCTGCACGTGACTAGTCCCTGTTCGTTCGCCTCAGCTGGATACCAGTTCGTCGCGGCTTTCTGGACACAGTTCTTCCCACTTAGTCAGCCGAATGCAGGCATCAGCAACCGAACAATACCGGCGACAGCCGGAAATGCGTTGCCCCTCGGTGTGCAGATTAATGACAGCGTAGGGCGTGGGGATATTACGTCAGCGAAGGCCTCTTAGTAGCTGGATGCCGCAAGAATGGACATCGGATATCCCCGGCGTGAGTTACCCGGCGGGCGCGCCTCGTTCATTCACGTTTTGAACCCCTGTCGAGCGCCCGGCAGACCTCGCGGTGCAAATGTTTACGACAGTGATGGAGCAGATGAAAATGCTCGACAATCTGGCAGAATTAAGGGTGCAGAGCGCCAGGTCTTGAAGGCGATGTATGCGCAGCCGCATTACAGGCTGGCCTGGATACGCAGTCAGCGATGGATTTTATTCTAGGGACAGTCATAGGAGCAGCGGAAAGGCTGAACGGCTGGATTGGTGAAATTGCCCGTATTACGCCGCAAGGCGCCGGTCGGCTCTGGAGAGGGCAAAGTATACCGCACCTGATGCCGGGTACTCACTGAACCTGCAGACGGCCGGAGGATGGATAACGGCTACTCCGTGTTTGAGCAGTCACTGCTGCGGTATACGCTGCCGGGCTACTGTCTCGTATGAGCAGCCTTTCCTAGAAGGATGCCCAGATGAGGCCTCCACCGACGGCACGGCCGTGAACGAGTCGTGGATCCTTCTATGGGCGGCGAAAATTCGTCGCATCCGAGACGAGCCAGATGTTTCTGCCTGGCTGGAAGAGGCTCATCGTTCGCCGTGGTGACGTTACCTTCAAAAGCGCCGATGCTTCAGTTTTCAGGAAGCGCAGTAGTGCCTGGGGGAAGTACGCATAACGGGATAGGCTCCCTCGGTGGTCTGGCCATCGATGGTCTGGAAGAAGTTCAGGAAGCGGTGATGCTGATAGAAGCCGGACTGAGTATAGCTACGAAAGAAGTCGCAAAACGCATGTAGACTAATGAGGAAATTTTGTGGCCTCTAAGTCCGTGAAACGATGCACCTGTTCCTGCAGCCCGGTCTTAAACCGCCGCCTGGGCGGCTGCAGCATTTGAATCCGTGGATCTGCATAAATCGACAGATGAGGAAGAGAGAAGATGACAGAGCTCGTAATCTCCGCATATTGCCAGCATGGCCTTTACAATGAGCCCTTATTGCTTGAACCCGCCTATGCGCGGGTTTTCTTTTGTGCGCTTGCAGGCCGCTTGGGATCAGCAGCCTGACGATGCGGTGTCCGGCGACAGCCTGACTGCCAGGAGGCAGCCCGACGCTGGCAGCATTATCATCCGGTATGATGACGACCACGACAGGCCGCCGCAATTATCAGGTCATGAACGGCAGCTGCCGTGCTGCATGTGAGCACTGGTCAGCCGGACGGGCGGATGCAGGCCGTACTCGGGGATGAACCGGTCAACGGCATTATACTGCCGTCTGCAACAGGCTGCCAGCGATCCGATGGTGACGGCATTCTGCTCGAGGGTACGCCCGGCGGGATGGTGGGGCATTTATGACTGCGCTGACATCATCGCCCGTCGTGACATAAAACCGGTATGGGTGCTGCCAACGACATGAACTGCAGTGCAGGTCAGTTGCTTGCCATGTGCCGCCTCCGGCGTCTGGTCACGCAGACGAACGCCGGACATGAACTCGACCGTCATGACCTTAACAGTAATTACGGTGCTGCGCTGGTGGAGAATACCGGTGGAAATCAAACGTCGATTACAGCGGCAGGCTAAGTGAGATGGCAAATGGCTAAGCCATCTTCCGGATGACGTCCGGGAGACATTGCAGTCCCGGATGACGCAACCTCAGATGTTTGCGCAGAAGGTGTCGTTCTTGTTATAAGCTTTATCTCGTGCAGGTTGTGCTGATACCAGGCTGCATAGTGAGGTACAGCGGTCAGGAGGCCTCTTAATTGCCGGACTGGCTGATGAACTTGTTAACATGTAACACTGAGCGTACCGATCACCGTCATTCTTATGCACTGGATGCACGTAGTAAATCGCGTCTCCCGCCGAGGCGAATCAACCAAAGAGCTCAATCAACAACTGTTCCAGCCACTGCTTCGCAGGCTGAATTTACTGACGTGGTGCCAGCGGGACGGAGGGCGAAGGCCAGCGCGGCGCAGCCGGACGTGAACGCGCAGATCACCGCAGCGGTTGCGGCAAGAACAGCCGCATTATGGGCATCCTAACTGTGAGGGAGGCTCAACGACGACGAGAACAAAGGCACGCGTGCTGGCAGAAAACCCCGGTATGACCGTGAAATAGCCCGCCGCATTCTGCGCAGCACCACAGTGCACAGGCGCGCAGTACTGCTGGATTCGTTTGATGTGCAGGGGCACCGGCACGCTGGCTGCAGGTAAACCCGGCATCTGATCCGTTAACGATTTGCTGAACACACCAGTGTAGGCATGTGATGTTATGACGGTGAGCAAGAAACCTTTACCATTACAGCCGCAGGGCAATAGTGACCCGGCTCATACCCGCAACGCGCCCGGCGGCCGTGAGGGTTGTATGCGAAAGCGCCTGCAACAATACGCTGATGCTGGACATCCAGCCGTAAGCTGGTTGCGTGGGATGGCACCACCGACGGGTGCCTCGCCGTTGGAGCTCTTCTGCGGTCCTGCTGTAACAGACCAGCACCACGAACGTTCTAAGTCGGCACGTTCCGTTATGAGAAGTGCTCTGGCCGGAGGCTGCCATGAAGACACGAGCCGAGACGACTGAACCGCGAGTTCTTGAATGGCATCAGCATCGTTTAACTTTACGGATCATGAAGAAGGCCGCCTGTGCCCTCGTGTTGCCCGACGCATTTTATGTCGATGTACACAACCGCCCAACTGCTGGCGGCAAATGGCCGACAGAAATTTAAGTTTGATCCTGTTCCCTGCGTCGTTGCGTGGAGCTATCCCTTCACCACTCCCAGAAAATCTTATCCTCACAAATTCCGGACTGGTAAATTGAGGTACGTTCCCCCGCCGTGTTTCCGGTGAGGTTATCCGTTCCCGTGGCGCTCCTACCCTGAATTACGGGGATATGTCAAGCCGAAGCATCGAAGTGAATCCGCAAGATGACCTGCGTCGCCTGCCGGATGAAGATCGCAGAATCTGGCCGACTGAGGCTTACGCCGCCGTCTCGCATCATCATGCAGAACATGCGTAGACGAAGAGCTGATAGCCGGTTGCTCAGGTCGAAGAGATGCAGGCAGTTCTGCCGTGCTTAAGGCAAATACACCATGACCGTGAAGCCTTCGATCCGGTTAGGTGAGGCTCTCCGCAGTGAGGAGAATAACCGCATCGCAGGTCCGGCGGCACCGATGAGAGCAATGTGACAAGTCCACGTATGACCCGACCGAATGATATCGAAACGCCCCCTAACGGTAGCCGAACCTCCGGTGTGGTGAAATATCATCGTGTTCGATCCCGACGCTGGCGCTGTTCCGTTCCTTCAAAGCCGTCAAGGAGAACAGCTGGATACCCGTCGTGGCTCTAATTCCGAGCTGAGAAGCTAGAACCACTGGTAAAGCAGGGCTGTGTCCTATAAGGGGATGTATGAGATGTGGGCCATCGTCGTGTATTCTAGAACATAGTACGTCGAAAACGGCGTCGTCAAAAGAACTTCCTGCCGGCAACACGATACTCGTTCCGTGTGAACACTCAGGCACGCGGTCTTGAGGACATGAGCTGCATTCAGGATGCGACGCCACATAGAAGGCATTAACGCCTCTGCCCGTTACCCAAGGAAAAACTGGGTGACCACCGGCGAAGTCCGGCTTCGGTATTCACCATGATTCAGTCAGCACTAGTGATGCTGCTGGCTGACCGGTGATGAGTTCGTGTTAGTACAACTGGCGTAATCATGGCCTTCCGGCGACGAATTGCGTTGATCGTGGAGGAGTACCTGACGAAGATGAACTGATTGCGCCGTTCCTCAGCCCGGTGAACAACGATGACGGGCTTAGTCATGCTGTGACGGGGGCACGAAGAAGAACGGCCGCTCCGTGGCAGAGCTGAAAGAGGAGCTTGATGAACGATGAACTGCCGGTTAAGCACAGCCCTGCACCGGGAGGGGACTGTGCTGACGACATGAAGTATGAAGGTGGGATCAGCGCAGGCTTACCGTGATTCTGGATACGTCTGAACTTCTCGTCAACTGTGATTAGCGAGGCACTGGTGAAGCTGCATACTAATGCATTTCACGCCACGCGGGATGAACCTGTGCATTTGTGCCTGCCGGGAACGCGTTTCGTGTCCTCGCCGCTGTGGCAGCCGAAATGACATGCGCGGCCTATCTCGAGAATGCATAACGGGCTAGGCGCTGTGGCTGATTTCCTAATACCTGTTCGATGCTGCCATTGCCGCGCCGATGAAACGATACCGCGGGTACAGATGGGGAACGTCAGCCACCATTACATCCGGGGTCAGGCGCGTCAGTACCGGTAGTGGTTGATCTTTCTAAACATACCTACAGGGCCTATGCCGGACAGGGCGTGCGCGTTGAAAGGCTCCAGCAGCCCGTCCTGTTTGTCCGGACTGATGAGGTGCGGCAGCTGCGGCGTGGAGAAGCTAGACCATCGGTGGGAAATTCTGATAATCAGATTCGGGTCGCCGGATGATGAGGAAGTCATCTCTGGCTTGGACGGGGGCGTACCGCCTCTGCCGTTAACCGTCGCCGCTGAAAGGGGATGTATGGATAAATAGTCTTGAGCAGGCCGTTGAAAACCTCAGCCGTATCAAGCAACGGCGGTGCCTGCTCTGCATGCCCGCAATCGGCCATTAAACCGCGTTGCTTCATCCATCCGCGATATCGCAGTGGCGTCACAGGTTGCCGGTACCAAAAGGTACGCATGGAATTGGTAAAGGAAAGGCCGACAGGCGCCACGGTCAAATCGCAGGCCAGAAGGATCAGATAACCGGGGGATTGAGTGTAAAGATCAATCAAGCTGGTAATGCCGCCCCTGGGTTCCTTCGCGCCGCAGGCTTTACGTAAAGGGGCAGCGTTCATCCGACTTAGCCTGGCGGCAGCGTGCTTGGTGGTGACTTTAGTATTCAGGCGCGTTATTCAGCAACGGAAAAATGGCCGGTGGCATGTCATGCAGCGTGTGCTGGAAGCGGTAAACCGTTACCCCATTTACTGCTTACCAAATCCCGATGGAGCTGTTGAACCACGGCGTTAAACAAAATACATTGAGCGGATACGGGGTGGTGAACGTCTTCCGAACAGAGCTGGGGGTGCGCTGCAGCATCAACTGAGGATGGTAATAAAGCGATGAAACATACTGAACTCCGTGCAGCCGTACTGGAAGTTCCAAGGCGAAGCATGAAGCGGGGACGTTGATGAAGGTCTACGCGGCTGTTTTATCGAGGCGGATTTTCCGGCAGTTGCCGTTTATCTCACCGGCTGAAGTGGACGGGCGAAGAGCCCCATGACATGGAGTGAGCGAGATGACTGCATATCGAATATTTCCTGCCTGCTCAGGTGCACCGGATTCAGAGCTCGATCTGGAGTCGATGAGTCTAGATTTATCCGGTGATGAGCGATATCCCGGCACTGTCGATTTGATCACCAGTTATGGTGGCCAGCGGCTATCACGACCGGCGGGACGATGATGCGGGCTTGTGGAGTTCAGCCGATTGACTTATGTCAGTCAGCTATGAAATCGTGAGACGGGTGCCTGTACCAAATCCTACAATGCCCGTGAAGGTGCCGGGACCAGCGTGGGTTTATCAAGCAATAAAATTATCTTAGATGGCACGTGACATTTGCTTTCAACGTTGACTGGTCGCGTCTGGCAAAAGTTAAAAGACCTGATGACGCCCGGCGAACTAGACCGCTGGATTGCTGACGACAGGTGTCTCGATGATGAAACATGCAAACTGGACTGCGACCGGGCAGGGGCACAGAAATCTGCCGGATACCAGCTGACGCTGGCGTGGATGCCAAGAAGATCCCTGAGAAGCAGGCTAAGGCAGGCGCTGCTGGCGTGGTTTAATGAAGGCGATACCCGTGCCTATAAATCCGCTTCCCTGAACGCCCCAAAACGGCTAGTCGATGTTCCGTGGCTGGGTCAGCAGTATCGTAAGGCGAACCCTACCAGGGGAAGTGATCGCCAGCGCACGTCGAAAGTCACCAATGTGGACGTCCGTCGGCTTAATACAGAAGATCGCAGCACGGTAACAGCAACGGCATGACCGTGACGCCTTCAGCACCCTGGTGGTGAAAGGGCAGAGCACCACGGCCGACCGTGGCCTTCCAACGGAGGCTGATACGACAAGAAGACTTCTTCGTGCTTGTCTGTGGATAAAACTAAAGCCACCGTGTCGTCAGTGGTATCACCATCACCGTGAACGCTGTTGCTGCAAGGCAGGTCAATTCCGGTTGTATACAGAT
>136
TCGGTTTCGTCTGCTTGGGTGTTGATCTAAACCGTTTCAATACTAATAAGCCGATGCAGAGAACCGGACGCGAGAGTGCGAGATACGATTCCGCTCCCTCGGGCCTAACAGACATTCACTAAGTTATGAGGAGGACTATGCATGCTGGTGTGGGAAGTTGGTGAAAAGAAAGAAGTCAGCTGCAGTCGTTTGACATCACTGCTATCTTCTTACTGGTTATGCAGTCGTAGTGATGAGGGGCCTAAAAGTTGGCCTGACGGATTGCGGATCCGTGCTTCTCTCTCGCGTGCAGCGCTGTTGATACACACGTGGGCCCAAGAAATCAAAGTACCTTGCGCTAAGCTCTGTTACAGGTCACTAATACCATCTAAGTAGTTGATTCATAGTACTGCATATGTTGTTTACAGAGTGTTTGTCTTAGTCTGTTTATGCAAAAGGCCAATTGTAATATATTGATATTTACAGTACGTTATTTCTCGTTCATAGGGTTTATACTAAGTTGACAAGTTATAAAAGCAAGTCGAGTTATCAATTTGTTGAGGTATGAATAAATCATATCAGTCAAAATAAAATATCATTATTTGATTTCGGATTTTTGTCCCACTCCCTGCCTCTGTCATCACGCGATGGTCATCCACATGGTGTCCGACTTATGCCCCGAGAAGTTAGGCCAAACTTATCGCTAGTTATCAGGCGTCCGCAGGAGTCGACAAACCAGGCAAGGCGAGGAACAGGAGGATTCTGCCGGTCCAAGGAGCTGGGTGCTTTTCGTGCGCATAGATAGTGGTACTGTGCCCGCTGCAGCACGTTGGGGATCAGTAGATGCAATTATGGTTCTCCTAAGAATGCTTTGCATTTATAAGGTGTTCTGGATCATCTTCCAGCATCAATATGCATGCCCCTGTTGGGATGAAATTTAAGCGCTGTTTTAGCTTTAACAGACACTGATATCCATCACCATATCAGACTATTCATTTCCCATAATCACCAACTCGTTGCACCGGTAACAGCCAGTTCCATTGCAAGTCTAGCCAACATGGTGATGATTCGGCCTTAGTCAATAGGGTGTTTCGATGTCAAGTCATGCCGTAGTCGTATTGCTCCTTACTATACTTTGCCCCGATGAGGCGGCGCCTATGGTTCTTTGTTATAACCGGCAAGGTCAGCTATTGCTCTCACGGAATGCAAATCACACACACGGGACCGTGTTATTCTGGTCTATCCGTAGCTAGATTGCCTCGTCATCTTAATCATGATTCGGCTTGCGCTTTAAGGACGCAATTTCTTTGTGGTTGCTTCAAGTGAGGCTCCGGCAGTACCACCTTATTGCTTTAGATTTGCTCAATCCCTTTATGAGTACTGGCGGGGCCGAGCAGCAGGAATATTAGAAGCGAGGCTGAATGTAGTGGAATTATCACGTTGATTCCCTGTCAGAGAGGCGTTGTTGTGTCCAAACCAAGCTCAATGTTGGCCTGTATAGCTTCAGTGATTGCGATCCCTGTCTCTGCCTAATCTAAAGCTCTTTACCACGTCCGTGATTAGCTGTGAAGTAATATCCATGTTCTTATACCTGTTAGGGGTAATCCGGCGCTCATGACTTCGCTAGCTTCTTCCCATTGGATCCTCTGTCAAAGCACCTGTTACTGTCACTTTAATCAGACCTTTACCGCTGATTCGTCTGAACAGATACTCTCTTCCATCCTTAACCGGAGGTGGGAATATCCTGCATTCCCGAACCCATCGACGAACTTGTTCAAGGCTTCTTAACGTCGCTGGCGTGCGTTCCCTCCACTGGGTCGGGCTCCCATGCCCAATTACGCCCGCAAGAAAAACCGCCATCAGGCGGGTCGTTCGTTTCGGTTTCTTTCAAATTCGAATATCGTGGTTACGTCTGCATGTGCTATCTGCGCCCATATCATCCAGTGGTCTAGCAGTCGTTGATATGCCCCGATCCGAGGACAAATGGGAGCCCGCCCATTCCATTCTCCTGTGACTCGGAAGGTGCATTTATCATCTCCATAAAACAAAACCCGCCGTAGCGATTCAGATAAATAAATCCCCGCGAGTGCGAGGATTGTTATGTAATATTGGGTTTAATCATCTATATGTTTGACAGAGAGGGCAAGTATATCGTTTCCACCGTACTCGTGATAATAATTTTGCACGGTATCAGTCATTTCTCGCACATTGCAAGAATGGGGATTTGTCTTCATTAGACTTATAAACCTTCATGGAATATTTGTTGCCGACTCTATATCTATACCTTCATCTACATAAACAGCTTGGGTCTGCATGGAGACTAGAGGATCTGCCGGCTTCATACTCTACGCGTATTTTTGCTCAGACTCTAACTCATTGATACTCATTTGTATAAAATTCCTTGCGGACTTATGTCTGATGTTCATAGAAAAACGGGTATCAGCAATGTTTATGTAAAGAAACAGTCAAGATAATACTCAACCCGATGTTTGAGTACGTCATCATCTGACACTACAGACTCTGTACATCGCTGTGAAGACGACACGAAATTCAGCATTTCACAAGCGTTATCACCGTACGCAAAGGAAGCCGCGAGCGAATGCCCGGGAGAGAAACCAGGAGTGCAGATACTCACCTGCATCCTGAATGGCATTGACCTCCAACCGCACGTAATAGCGATGCGTAATGATGTCGATAGTTACTAACGGGTCTTGTTCGATTAACTGCCCGCATACTGTTCAAGAAATCTCTCCAGAGTTGCAGTGCTTGATAACAGGATCTTCCCATGGCGAACAAGAAACTGGTTTCCGTCTTCACGACTTCGTTGCTTTCCAGTTTAACCGACTCCCATTGTAGCTTGCGAGACTAGCTTCCTCATCCTCTCCCTGCTCGTTGCTGTTGATTTGCCTGTTCACTCAACACGGCAGTTTCCCTACTGTTAGGCATATCCTCGTTCTCCTGTCGCGGCGTTGTATTGCTGGTTCTTTCCCGTTTTCCATCCCAGTTCCAGCACAATCTAATGGTGTCACCATTCATGGAAAGTCTGCGTCAAATCCCGCAGTCGTCATGCATTGCCTGCTCTGCAGCCATTCACGCAGTGCCTGAGAGTTAATTTCGCTCACTTCGAACCTCTCTTTTACTGATGGTTTCCACTTCCTGGCAACTTGCACAAGTCCGACAACCCTGAACCGAGACCTGTCCGATGCCAGGCCGACTCGAAGGCGCAGGAACAATGAGTGGAAGATATAGGTGGTTCAGGCGGGCAGAATTTTATTGCTGTGTTGCCTTAATTCTTCGTTCTGATGCTGAATCAATGATGTGCCATCTTTCATTAATCCCTGAACTGTTGGTTAATACGCTTGAGGTGAATGCGAATAAAGGAGCCTGTAGCTCCTGATGATTTTGCTTTTCATGTTCATGCTTCCTTAAAGACGCCGTTTAACATGCCGATTGCTGCCATTGCCTGGCTTCGGTGCATTCCCATCGATTCTCGTTTCTAACGCGGTGCATTCGTCAAATCTACATCACGGCAAATGTGCATCGAAGCGTTTTAACGGAAACTGCTTATCGGGCTTTTGATTTCAGAATTAGCCTGACGGGCAATGCTGCAGAAGGGCGTTTTCCTGCTGAGGTGTCATTGAACAAGTCCCATGTCGGCAGCATAAGCACACAGAAGAATATGAAGCCGCTGCCAGCAAAATCCGGATTCCGTGGTTGTCTACCTGGTTTCTCTGACTGCTTCTGCTTTCGCCACCATCATTCCAGCTTTTGAAAACCCCATTAAGCGTAACGTATACCGAAATTCCTTCGTCTGTTTCTACGGGTAGAAGGCACAATCCGAACTCCAAGAGGCGAGCTTAAAGTATGGCGGCCTCGATACTCGTTCTTAACTCAACAGAAGATGCCTAGGAGGCATACCCTCTAGCGTTTATTATTATCTCCTCAGCCATGCCCTGTGCTTTCAGTGGATTTCGAATAAGCCAGAGCCGGCAGTCTCGCGCGACCGCTTTGTATGAACGAAAGTGATTGCGCCTACCCGGATATGCGTATCGTGAGGATGCGTCATCATTGCTCCCCAAATACAAAACCAATTTCAGCCAGTGCCTCGTCCACTTTTCGATGAACTCCGGCGCACGATCTCGTCAAAACTCCCCATGTACTTTTCATCCCGCTCAATCACGACATAATGCAGGCCTTCACGCTTCATACGCGGGTCACGTTGGCAAAGATACCAGGCATTTTCGCGTCACCCACATGCTGTACTGCACTGGGCCATGTAAGCTGACTTTATGGCCTCGAAACCACCGAGCCGGAACTTCATGAAATCCCGGGAGGTAAACGGGCATTTCAGTTCAAGGCCGTTGCCGTCACTGCATAACCATCGGGAGAGCAGGCAGGTCACGGGGCATACTTTCGTCGCGATAATGATCGGGGATCTTCAGACAGCGCCGAACCCCGAAGGAAATGGAAAGGAAGCGCGTCGTTCTCGTACTGTTTTCCCCATCAGTGCTTTAGTCACGTTAACTTCCGGCCTCCAGTCGCAATACTCCAGCAAGCAAGTGTCGAAGTGAGGACATTTCATGTCAGCCATTGTTCTCCGGAGCGGGGTTTGCTATCACGTTGAACTTCTGAAGCGGTATGACGACGCCGACGGCCGTAATTTGCCCACGCATCATCCCCCTGTTCGACTCACATCGATCCCGGTACGCTGCAGGGATAATGTCCGTGTCATGCTGCCCTTCTGCTCTGCGGCTTTCTTATACTGTTCAGGAATCCAAGAGCGTGCATCTGCTTGCTGTGTCAGTTCTGACGATGCACGAATGTCGCGGCGAAATGTATCTGGGAACAGAGCGGCAATAAGTCGTCATCCCATGTTTATCCGGGGCGATCAGCAGTGTTAAATCTCCTGCATGGTTTCATGTAGTTAACCCTAGAGTGATGTCGCGTTCCGGGTTGACGTTCTGCAGTGTATGCAGTATTTTCGACAATGCGCTCAGCGGCTTCATCCTTGTCATAGATACCAGCAAATCCGAAGGCCAGACGGGCACTGAATCATGGCTTTACCGTAACATCCGTTTGGCTGCGGCAAGAAGCAATCTCCGCGGCATTCCGGAATTCTTTGAATGGTTCGCGGCGGCATTCATCCATCCATTCGGTAACGCAGATCCATGATTACGGTCCTGTGCGGTAAATCCGGCATGTACAGGATTCATTGTCCTTAGCCAAAGTCGATGCCATCAAACTGCACTGGTTCATTGATGATGCGGCGACCAGCCATCAACGCCCACCGGAACATGCCATTCTGCTTATCAGGAAAGGCGTAATTCTTTCGTCCACGGATTAAGCCGTACTGGTTGGCAACGGAGTCAGTAATGCGATGAACTGCGCATCGCTGGCATCAGCTTTAAATGCCGTCTGGCGAAGTGGTGACACCGTTTCCTGTGGGTCTAGAATCCATGCCACGACACGTTCAGCCAGCTTCCCAGCCAGCGTTGCCGAGTGCAGTACTCATTCGTTTATACCTCTGAATCAATATGATACCTGGTGTAGCAATGGTTCAACCATGTACCGGATGTGTTCTGCCGTGCGCTCCTGAATCAACATCGTCATCAAACGCACGGTAATGGATTTTGCCTCGCCATTCGGAAGTCCTCCCGCGGCATGCGATAGGAGTGGCGGGAGATGAGGCTTCCATGTCGTCTGCAGTTCTGCCTCTTTCTCTTCACGCGTCGTCAGCTGCTGTAGTGACGCGCTAGCGCGCTCTAGCACCGATCCTGAATGTAATAAGCGTTCATGGCTGAACTCCTGAAGTAGTGGAAAATATCGCCCGCGAAATGCCGGGCTGATTAGGAAAACAGGAAAGGGGGTTAGTGAATGCTTTGCTTGATCTCAGTTTCAGTATTAATATCCATTTTATAAGCGTCGGACGGCTTCACGAACATCTTTCATCGCCAATAAAGTGGCGATAGTGAATTTAGTCTGGATAGCCATAAGTGTTTGATCCATTTCTTTGGACTCCTTATTAAGTATGTCGATAAGGCGTTTCCATCTACCGTCACGTAATTTGAAGGGTGATTCGTTCAAGTAAAGAATTTGGAGACGGCAGCCAGCAACAGGCCACCCTGCAAATGGCAGTGCATGGTGTGCTCCTTATTTATACATAACGAAAAACGCCTCGAGTGAAGCGTTATTGGTATGCGGTAACCGCCTGGGGGCCTGCTTGGGTGTCATATCATCTGATCAAATATTCCGGATAGACACCGAGAGCGAGAACCCTATTCCCGGGCGGAGGCATTGGAGGCCCATCCTTCCTGACCATTTCCATCATTCCAGTCGACCGCCACAACAGATGCATTTAAGTCGGTGCAACTTGCTATAAGCAGAGCACTGTTGCACCAGCATGATTAATACAGCATTTAATACAGAGCCGTGTTATTGAGTCGGTATTCAGAGTCTGACAGAAATTATTAATGGTGAAAGTTTTCCTCTGTCATTACGTCATGGTCGATTTCAATTTCTATTGATGCTTTCCAGTCGTAATCAATGATGTATTTTGATGTTTGACATCTGTTCATATCCTCACAGATAAAATCCCTCACACTGAGGCAAAGAAGATTTCCAATAATCAGAACAAATTAGCTCCGTTAGTTACGAGCGACACTTGCTCATTGTATTCGGTTCCGAATGAATACACAGTGCAGTGTTTATTCTTTTCTTTACATTGAGACTCGGCTATCAGGCGGGTTTTGCTTCTGCTCTACCAAGTTCTCTGGCAATCATTGCCGTCGTTCGTATTGCCCATTTATCGACATATTTCCCATCTTCCATTACAGGAAACATTTCTTCAGGCTTAACCATGCATTCCGATCGTGCAGGCGCATATGCAGGCATGGCACGAATAGGACCCGAGATTGATTTTATCAATAGTCGTAGTCATACGGATCCTGGGCTTGTTCCATCACATCCTGAGGATGCTCTTCGAACTCTTCAAATTCTTCTTCCATATCATGTAAATAGTGGATTGCTGTAGTAAAGATTATTCGTCTTTTAACCGCACCGGCTCGGTGTGGTTCTCGTGTACCCTACAGCGAGAATGATAAATAGTTACATCCCCTACAGTTTGAGTAGAAATGGATCCACTCGTTATTCTCGGACGGTTCAGTAATGAACCTCTGGAGAAACCATCTTATATGATCGTTATCTGGGTTGGACTTCTTGTCCTAACCCAGATAACTGCGGCTGAATATGTTAATGAGAATCGGTATTCCTCATGTGTGCATGTTTTCGTCTTTGCTCTTGCATTTCGCTAGCAATTAATGTGCATCGATTATCAGCTATTGCCAGCGCCAATATAAGCGATTTAAGCTAAGAAAACGCATGCGATGCAGGGCGCTCTCAAAGTGCGAGATCGCTCGATTCCAACATCGTACAGAAGAGCAATCTAGCTGGTTTGTGCAGCCTTAATGAAGGCAGGAAGACAACCCAGGGGAAGGAAGTACGCGAGAAGCATAGGAGGTCGATTGAGCTTGGTGTCGAACAAAACTTTCCCGATGGAATATGGAAGCATATATTATTCCCTATTGAGGATATTTACTGGACTGAATTAGTTGCCAGCTACTGATCCATAATATTAAGGTATAAAGCCAAGGCCAATATCAAGTAACGATAAGAGGAAATCGATTTTTCCCTTAATTTTCTGAGTCCTACTGCATGTTATGCCGCGTTCAGGCTTTGAACTGTACCATGTGCTAGCTGATTCTTGCGCTCAATACGTTGCAGGTTGCTTTCAATCTGTTTGTGGTATTCAGCCAGCACCTGTAAGGTCTATCGGATTTAGTGCGCTTTCTACTCGTGATTTCGGCTGCGATTCAGCGAATAGGCGGTCGTAACTGGTTTTGCGCTTACCCCAACCAAACAGGGGATTTGCTGCTTTCCGTGAGCCTGTTCTCTCTGCGCGGGTTTCCTAAGCGGCGTGTTTGTGCATCCATCTGGATTCTCCTGTCAGTGCTTTGGTGTGTGGCAGTTGTAGTCCTGAACGAAAGCCCGCGATTGGCACATTGGCAGCTAATCCGGGGAACGCAGGAACCCGGGCAGCCTCGAGAAGCGCGATCACAGCAATTATGGAGTCAAATCGCTGTCTTCACGGCTTTAATTTTAAGATATCACTTCATGTAGTTGGTGCGTCGGTTAGTAGTCAGTATCGCCCCAGTGGTATTTATGTTAACTAGAGATAATTGTTATCACCGAAGATGGTTATCTGTATGTTTATGAATTTATTTTGCACTAGGGCATGTTGGGTAGAGATGCGGCGTGGTAACTTTTAGTGAGTTGTATCTATTTATTTTTAGCTACATGACAATTGGTTATGTGTTTTGGGGGCATTGGTCAAAGAAGGAAAACAGGCAGCGGGCCGTGATTCTCTTTCTCTGGTCAAAGTAGTTAGAAAACAAGGAGTCCATAACTGATGAACCATTACAGGATGGAGATTAGAGATGGCGATAGTATAGTAGGTGTAACAATTGACTACTGCGTGGAAAGGAGCAGTAACCACAGAGACCACAATATAAGACTAACAGTATACCAAGGGCGACGGTATAGCGATGTTCTATATAGAATATACTACCAATCTGCCAGTTAATAGCACAGTTCGTATCGTCCGATTAGAAACGTCAGGCAGCGTAGAGTCCAATCATGGGGTCCCGGGAGAGGCACGAAGAATAACCCGAGGAGAAACCAACCGTATAGA
>137
GTTCAGTCTTAGGTATTGCGGCGTTGCTCGTTAACTGTGAATGGTGCCCGCTTGCAGCATGATAACCGCAGAAGTCACTGTGCAACGGGGAAGATAGTCGCTCCGATGGGACGAATGAGGCACGTGAGTTTCCTGTAGCGTCCGTAACGTAACAGCGGACGACCGGCAGTGAGCGGCTGGTTAACAGGCTACGAGAAACCAAACGGGTCGGAAACCACATACAGAATACCCCATAGGACTGGCCTTTGCTGCAACGTTAAATTGGGGTCAAAAGAGGCATGATCCAGCGTCACTGTATCGACTCGTTCTAATTGTGCCACGCAACGTCCGCATTGAGCTGACGCCGGTGGCTATTTTCTAAATGGGACGCTCGCCGCATCTTGCCGTTTGACCCGACGGTACAGTTTGAGTTCTGTTTAGAAAGCAGATTCTGCGGATACAGACAGGTCGACGAAACCCGTTAACGGGTGTGCTCACGGCGCCAGTATCTCGACTCGTTGTACCAAACCGGGTTGTAACTATTTTATATCCACGAACTTTGGGACCCCGTTGGCAAATCGGGGTTGAGGCTGGGGTTGATGGGAAGCATCGGATTATGCAGCGAAGTACTAACTGAAGGTTTTGGGGCAAGTGAAGTCGACCGCGATAAACGCATCAACCGTGGGGTACTCGGAAATAAGAGCGAAGACCGGAATTTTCGAGGAGTGGCGCAAATCGAGTGAGGTCTGGAATGCCGGTACGGGGTATTCAACTCATACGGCAACGCGTGACGTCGAACGCCGAGCCGGCCCGGGCGGTCACGGAGCAGATATGCTCATGAACGACGCGTTTTCTGACGTTGCCGCACGGTGTAGTACGCATTTGTAATTGTGGTCTCCGAGCGCAAACGGACGAATGGAATGAATCCACGAATGTTTGTGGCCCAAGGGACTGAATATTCCTAACGCTAAAATGTTTAAGCGGCGACAGAGCTGAACAACGCATTGATACCAAACGGCCATCCAGGCGAGATGGAAATCCGGCTCGCGGCGCAACATTTCTAATCTTACTAACCGACCTAGGAATGGCCGTATACGAGGACGCCTAGTATTGAAGATGCCTGTAGCGATCTGCGTTGGCAGTATCTCCCCGAAGCGGGGCAGCCATTAACAGTATAAACTTATACGCCTACGCTATACCTAGAACGAACTTGAACTGTATTAGTACCGCCGAGCCTGAAAGGGAGATTACCTGCACGGCCGGGGAACGGGCCATTTGGGAGCCTTATGAATCCGCAGCAGCATAACGCATTTTTCATCCCCCACCGCTGGAGCGTGAGGAGGCAGGTTATGGGCCGTCACGGACGATGCTGACCATACCCCCAGTCGCTGTCTATACGATCCCCCGGGAACCGGCTTATAAAAGTTTAAACCCCGCACTCGGCTATGCATTCCGTACTGTTTCGCGGAGGGTCGCCGCTTATAATTTCACGAGCAACATGTTGTACGATGTGTTATCTGAAGTAATGACGGTAACGGTTAGTGCGGTAACGATTGGTGAGTCGGCTGTTCTTGACTACGAATGTAACTTGTTGACGCAACGTCGGGGCCCGGATCCCCGGTGGAAACGTTACGACATTGGACCGTGTACATACCCGTTCTAGTGGACGTCGAGCCGGAGCGGCATAAACTTCACGAAGTAATATTCACCCACGCCGTACCTCAAGTTTTGCCAGGTCGGGCACATGTATAATCGTGATTAAGGGCGAATGAATCCCGCTGAGTGAAAGAGACGACTCAGCACGAATCTTTATCGCAGTGTTACCGATCCGACGTTTTAGAGTTCGGGCGTTTAACGGTGGCTGTGGAAGGTGACGGGCTGAATGCAGTACGCGATGTGTATTGCCGTTTTGTAGTTAAATCGTGCCCGTGTGCGCTGCCAGGTCAAAGTCACCGAAGCCCGTCCTGCCAAAATGGGTCCTCAATCTACGTTACACATGCGATGTTCAAAATCAAAGAATACCAAACTGGTAATTGCGTCAATTCCATGAAAGCGACGCGCGGTGTGAACTGCCTTATACCCCATGAACGGAAGTCCTTAACGAACCCCGTTACCACTGACACTCTAGATCTGAGTCACGTTCTCATTTAATAGAAGCTTCCCCAGTTCGAATCCGGCACGGAACTCCAATCGACGCGAAGGGGTCTCTGCATCTCAAATGAGGATACCACGCCCGTTCACTGGCGAGCTGCGTGTCGACGAGTTTATGAATATGTGCGAAGCCGGTGGACAATAATTAACGGTTTTCCAAAATCAGGCGCCATGCGTCCTGACCCGGGAATCCTCAGATCCATTAGAAACCTAATCCTCCAGTCATCAAATGGTCCAACGCTTCGAATCTACGAACTGCGGTCTCACGAATGTTAAAGGCTACAGGAATTAGGCTACAACGCCGAGATGGTTGAAAGCCTGATAGTCCCGGAGGCGAAAGGAAAGTGCGACGAGTCAACTGATTGAAGCTCCGAGACGAAACTCATAGAGTGTACCCCTAAGCCCGCACGAGTTGGTGAAGAATGCGAACATACGATTAAATTACAGAACGAACCCCGTCACGTCATTCAATAGTCCTATCTATGGCAGGCTTCCTGGCAGGACGGCAAGCAACGCCAGTGGCAACGGACCGAATCCTCTATACTACGATTCATCGAAACAGGCAGTGTAGAACGGTTATCCCGGGTTATGTTAACGAGACAACACGGGAGTCGGACGTAAGGCACGGTGACGCCATTGGCTTTCTTGGGAATAGCGATTAGGCAATCCACGGAAGCTTTCAGAAGGAATTATGGACTATGAGAAAAGCACGGGATCGGCAAAACCGTGACGCCATCTCTGCCATCGAGCGTCGCGGCTGAGGATGGGACAACGAGAAACTATAACCTTATACCCAGCACGCATCAACAGCACGTTGAAACGCGCTGCAACGGAGACGTGTTAACCGAGGGGTAATCGAAACGAACGAGTTGAAAGGATGGAAGATGTTCTAATCGAATGGAACGGTCAAAGCCAATCTAGGTTGGCGGGAATATCACATGCGAAATGTGTAACGGTCGGTTCGCATGACGGAAGCAGCCTAACGACCGGCTCCACGTTGTCTCGAGAAGGTTACACATCGTAAGCGCCAGCAATAAGCATCACAGTGGACGGGTTTTCTGTTATCCCAAAACACGAAGAATCCCATTGAACCGCGGTGGCATCCAACTGTAGAAGTCGACGTTTTGCCTGACTGGAAATCTGACTGCCCAGGGATTAACGGATGATAGTGAGTCGCGGTTTAAGTTGGCCTAAAATTCCGGGCTTCAGCGGACCCGGGGTCAGGGCTGGAGGCAGTGGCCACGCCTCATCACCCCGGGCCGTGCATTCAACTCAAAGCCGCGATGGCCATCGGTGGCTTCCGATAAGATCACGGGCTCTACGTGACCAGGTACTTAGAACGTACGCACACCACATAGCGCCCCAAGAGCCAATTTGGCCCTAACGGTGAAACCAATTCTATTCTAACGAAACCGTTCTCTAAGCAGGGCACCAAGAAACTCGACGAAGGACCTAGGTAGGAGTGCGCCCGCATATTGGCCCCCAGCCAAACAGGCGCAGCGGAGAGTCGCCTCCGAAGCAGCGAAATATCCCAGGCGTTTCGTGCGAACAGGACAGTTAGAAAGAAGGCTTTAACAGAAGCCGAATGCAAGACGGTGAGTCGCCGGCAGGCCGTGAAACCTAGGACGGTTTTGCCCAACTCACAGCTAGAAGCCCGGGCCCGTTCCACAGCGCCCCTGAATTCCGCAGAGATATTATACCGCTTAACCACGGGGGCAGCCCGGAGGTCTGGTGGCTCCGATGCGCCCATTCTCCCGCGAGCATGGACCCAATCCCAAATTTATTTAAAGAGACTTCGCGGTAACGCGGAGAAAACGTTACAAACACTTGCCACAGGGGCAAAGCCGTCCGCAGCGGCGTCCAGCTGCATAATCCTCACGGGCATAACGCCTGAAAGAGACGGAAGACATATGCCGGAATGGAAACGCATAGCACGCGGCGGCTGTGAGGAATCAGGCGAATGCAGTTACTGGCATCCGCTCCAGGAAAGTTACACGAGCGCACCGGGATCCCGGCTTATCGACGATGAGCGCAATCGAGCATTCCGAAGCATCGGGAGACGCGAGTGACCGTTGCGAAGGTTTGTTCGGGGACCCCGTTTGAGGGGCTACCGAGAACCTATGCACGCCTCTAGTTGACAGAAGCTTGCGCGAAGTACAACGGATGACGCAGAAATGGGTCTGTGGAAGAAAACGGACGGGGTTGCTGAAGTAGCGGTTACCGCCGCGTTCTCCAGGTACCCACTTGCTGCAACGCCAACGACCAAAGAAGATTTGCCGTATGAATGGATCATCGGGGAGCGGACGCTAACTCACGTTTAGACCCCGTAGCCAGCCACGCCTTAGCCATCGGAAACCTGGAGGGGTACCCAAAGGCTGGATCCGGTAGCATCGAAGTTTGGTACGATTGTTGCGAGTGTTGATACGCGTCAATCGCGGTACAGAATGAACGAGAATAAGAACCCGGCTCGGCGATGGGTCGCCGGAGTTCTGTAAAGGCCCACCGTACCCCTACACGGTTTCTCCATGAACCTGATAGCCTGAAGGATTCGAAGGTAGCAAATGAAGAGCGTTCACGGCACGCTGAGGTTGTATTGCTACAGTTTTGGAGAGGGTATCGTCCGCGTAGTGGGGCTCTCAGTTGTAAAAGCAGGGAAATGTCGCAAGTTCAGAGGTTTTAGCGGGTCAGCGATACCGGTCAATCGTAAAGAGGCGTTGAGCTTCATCTGCAAATGTATGAGCCAGTTGCCCGACGATTGTATCGACGCTATCACAAAATCGTACCGTTTCTCGGTTTAACAGTTTAACTATTGCGAGACGAGCGTTGCACCGGTGCTAACTACCCGGGTGGTTAGTTTAGAATACTCATTAGCATATCTGCGTAACTGTAGGGAGTAGAGGCGATCGGAAACCCGCCAAAGGATTTCTGGTTTAGTAATCTTTAGAATTAAAGGATAGTTCCGAGGAGTCTCAATCTATAAAGTAAAGAGTCTGAATAGAGTCGATTCGAGCGAAAGTATCGTCAGATATGTAACTCCGTTTGGTCGGGATATACAGCGCAGTCACACTCGATGGAGTTTTACAGGTTACTAAAGGGAGCAGATCGATCCGTACTATCACGGAGGATGGTGCTCTACACGGCATACGATCCTATTAACTACAAGTTCTCCGTGCAATAGGCACCAAAGCGTCACGGGTTGACCTAAAGAGAACCTTTGCCCGATGTAAGTAATCGATCCGTTTCTCCAATGCGATCGAATAAGTATGTCCTGCGGCCCCGCTACCATTGGGAAGTTTCTTATCCGCGTTGGTTTGGGGGAATTAGAGCGCTAAGCGAGATGCTTAGCTTTAATGTGACCCATGCAGCTCCAAGCACGGTTCAGGATCAGTTAACACGGTTAGTTATCCCTATAAATTGGGTCCCCGGGCACACCGATAACAGGTCCGCGGCCGTTTGGTATTAGAATTACGCAAATTCAAACCGAAAGTACGGGATTAGAATAGTTTCAATCCTGCATGTTAACGGGTAAGCCAGACCCGTTAATTACAGTCTCTCCGTAGCCCGGGAGCAGGCGTCATAATAAATTCCTGAATTCTCTACTATTGTATCCGGATTGCACCGGTATCCCATGTCAGAACCTACGCCAATTAGCATGGATAATAGTACCTACGGACCTACACTGTCTTATACTAAACGATTGATGTAATCTCACGAACAGGCATCATTCTTATTGGTGGCCCACCCGAAACTGTTTTAGCCGCCTCAATACCGGTTTAATCATGGGGGCCGCCGCAATCTGATATTCAAGGCCGAACGAACTTCCTATAATACGTCGTGTTGAATGATTTCGCTCTCACGATTGATACCCAGCGCATCGTTGGTAAACCGTGACCCGTTTCCAATGAACCACTCCAATTCTATGACTGTATCAACGCTTTACAGGCCGACCGCCCGTTATTTAGAACCAAACTTTCTATTCTAAGTGGCTCAACGGTTAAGGTCCTCGAACGTTGTAAAACACTGGTCTCCCTAAGAGGGAATGACTCTGCCCGCGATAAGTGGCGTACCTCTATGCCAGCTGGGTGAGAGCAATTCTAAAGGGATCCGAGATATAATTCGTCCACGGGATCCCGGGCAGAAGGGAGCACGGGATATACGCGCCGCGGACTCCCACGTAGTGCGAAGCTATTCCGTTACCTAACGTATTTCCACCTCACTATTCCTTTGCTCGGGATCTGCTTCCTTGCGAACGTGATATAGGAAGAGTTGCAATAGCGAAGGAAATGCACGCATCTACGCCTTCCTGTTGCCCGTAAACAGAAACCGCATCTGGCCACTCGAAGGGACCTCGAAATTCAACTAACGCTGTTTTACGCAACATGCCTTAGTTATTCTCATCGACTGACCTCCCGCTCCTGACTCTTTGGCTTAGTAACGACGTCCACGTGCTGTTTATCGCGTAATCACCGTTTGCATCTTGCCCACGCGAATCTCTGTTCAATCAAAATGGAACACTAGCTCGTTCTGCGGTTTAGTCAAAATCCCTCATATTGGCCCTCCTCGGTGATATTTGTTTGCGGTCAACTTTGGATTATTATGTTCGGAGAATAATGTACGGAGGCATTTCTATATCCGCAAAATTGGTCTGAACGTGTTTGACTCAAACTTATCTCCCTAAATTTGCTTCAACCTCCGGGAGCCACAGCCCAACCTGGTGAGCATATTCTACTTTTCATCGTCATGTTTTTCATCGCTTGTTCTTATTAGAAACTTCATCGATTAATTTCTACGGATTATAGCGAACGGTTTTCTGTCAGACTTTATAAACCGTTCCCTGAAGTACCGACGTTTTGGATTATCTTGTGGTTAATGTAATGCCCGATTACCAAAGTTCACGGTAAATTTACCTGAAGTCTCCGGTTTCGCAAACCCTCACTCGACGGGTGGCATTATTCCAAATCTTTACGTTGATCCAATCAATTGACGGTTTCTGACTCGGCTGACCGGGCTGCGCATCCCCATTTGTTTCTTTGAATGGGCTGTTACCTGCCTCAACTCGCAAAATTCTCACCTCGTTAACGATTGTATCGATTTCTAGTTAAGGACGTATCATTTTCTCATTGGTTAACTGTTTGGTCCCGTAGATTTGGACTGCGTGTTCTTATCGACTCCTCACTAGTATCCAACAGATGTTTCCATTAACTCATATCCGTCCCTAAGTTAGCGTTTCCCAAGGGTTATCCGGGTTAACGTAGACCAACTCTTCTGTCACGAAACTGACGTATTCCGCATCGTATACTCCCGTTTTATAAACTGTCCCCTGACTTGATTCTCCGTCAATAGGAATTATTTTATTGTCGCCCGTACCCCTATCAACGACAATTCAACGTGACGCACTCACTGAAATTCTTTTAGATTCTTTAATAGGCGTTATCGTCTCCCATATCGGTTCGGAGCCCGCACGGTACTGCACGGCCTTGTTGCAGTACTCACTAAAAGCATGAAGTCCTACGAATTGGACTTTTATTTGTAACGTGAGGAATCCACTGAATTGGATTTCTTATCTAGACAGGACGTGTAACAACGCAATCTGGCAACGTTTGACACTGAAACGTATTTTATAAATCTCGGCGCTGAATTGCTGGCATGCTATAATAAACCGCTCTTCGAGTTGCAGGTGGCATAATTCTTTTGATTTGAGTCTACAAATGGTTTTTGACGGATGTTTTAACCTATATTTCAGACGGTTTCGTTGTACCTGGGATATAAAGATGTCAACTTTTCTTCTGTGCCGATGTAGATACCGCAAGCATACAACCAGAGACCACTCACGTTTTACAAACGACGGACCTAAAGCCTCCACGGATTTCCCACAGTTTACCGCATTGTTTTCCATAACTGTAAATTGTCCATTTTAGCCACCCCGGACCACATTATGGGTTAAAACTTTCCGACATTGTTGTTTCTACTATAGGTGTATTGAAACGCGTATTCTACAAACCCTTGAATAGACATCGATCTGGTGTTTGTTTGGATCTAATATAATAGGTCGTTCTTGCCGTTTAGAGATGTTAACGTCTAAGGTTTGGCGCAACTAACAATTCAGGACCTATCAAAGGTGAAATCAGAACATTTGACGCCAAAGTTGCAGTACCTGCTTTATACATTGTAAGTTTAATCTGGTTTGAATTATAGACTATGACTAACGAAAGTTTTATACGCGTGTTGCCGTGCTACAATTAAATAAATCTCTTATTTTACCAAATAAATTAACTGTCATATGTAGGTACCCGTTGTTTATGGTCCGAACGTCTTATACCATCCTCCATAACGATAAAAGGTTTAATCCCATTACCACGGAAATTTTGACTATTCCTTATTATTAATGGCTTCATTACTTATTAAATCCCGTGTGACATGTAGTACCACGTGTTAAACCTGGGTACGCCGGAAAGTGGTAAACCCCCATAATCGTCGTTACAAAAGAAGAATGGTCACTTATCCGATATGACGAGCAACGGTACCAATTTCGAAACTATCTGCCGTGTTACAGAAAGGGATTTTACGATCGTTGTAATCTCACGATTTACGGTATTTTTAACGACTTCGAAGTTGTAGCCTATACCGGCTAGGCCAATCTCATCTATGGTGTAACATTGATTTATAAAAGGCTGAACTATGTTACGAACCACTATCCTCATCATTCTATTTATGTAATTCATGCCTCTGTTAAATTCAGGACTCACCGTAAAGCGGAAGTCGTGTGAAGCAGGTCTCCCCACTTTTCATCTTATAAGCTACAACGGGACCCCGTGACTCTTCGTTCTATGTCCGATAGGATCCAGCGTCTGACGCTATTCGTTTTCAGTAAAGGAATTCTATCTCTGTCGTTTTCGGGTAACTTGGGGTTAGGTAACCTTCAATCTGTCTGAATTTACGAGTCCCACCACGAAACATTAACGACTATTTTTCCGAAAATAATAGATTATTGGTAAGAAATCGGGATTCCCGACGTACCTGGATTCGCTGGTTGCTACTTCGGCTCGACCGTAATTCTATGGTACTCTATGTAAACAGAAACACGTGCGGTTCAGGAAACTACACTGGTGGTTTCTATCGTAACTTTGGGATCCGCCGAGGGATTTGTTGAGTAGACGATGCTCTTCACTCGCCTAAATTCATCTCAGCATTTTAGTTCTCCATGTTAATACCGAACAGACAATACTTAGGATGTATGAAGGTTTACCAAACTAAGTATTGTCTTTACGAATTTTAGCTTGTGGCGGTAACATTAGCGAACAGCTAATACCATGTTTGTCCTACGTCTAGATAACCGTTGGTGAACCGTGAAGTTAACTTCAATGACAAACCATAACTCAAGCACCGACGTTTAATCGGAGATAGAAGTTTTGTTGTAGCACAATTATATAAAAGTCTTGCTCCTGACAGGCCCTCATAAAATTGGATCTGGTTCGTACCTTGTTAATACGCGGCGTTTGAGCCCTTGTGGTTGTAGTGTAACGCCATCTACCTGCGAGTGCTACTGCGTGGTTAACTCGTCTATACTGATATTCTCTGCACTCATCTTTGTTTGATCTGCAGTCTCTCGCGAGCTCGGCGCGCGCTACGAACACGAATTGAGCAGGATAGGGGTTTGGAGCACGGCAATCGGCCCAGAAAGGTTTCGGAGCGGCGTAGCCGTGGTTGGCAGTAATTCGATTGCCAATTGCTTCCCCATTGTGTGAGTTTCAACTATAGATTCAACTTCTGACCTTCAAAACTTTGTGATGTGCAGAGCCTACAGCCGGAAGAGGAGCAATGTAATAGACTATATCTTTTTGTCTGTTTGCTCACGATAGTCTCCCAATGCTCCACAGCTTCGTTACGATGAGAAACTCGCGGTGGTTGGCGTGCTTAATTCGGGTCCTGTTCTAGCGGGGTATTTGGATTTTATCTCACACAAGAATTCGTTACATACTACGCTTTTCCAGTTGTTTCCTACGTCTTGTCCCATTCGTGTGTCTCTCCCCGCTAGGGCTAATGGACAGGGTCATAATCCGGGGGAGAAGATGGTTTAGTATTTGGTTACGCTACCCGTGATCCTCTAGTTACAAACGTTACGATATTCTACTGAGTGTTGTTCGTCTTTCTGATGAGGTTAACACGGAAATTCAGTAATGGAAGGAGATCTCTTTTCGCTTCCGGCTTATCACTTAGAATACGTATGATTTAGCAAGAAGCGGTTAATACATGAGCAGCTTCACAAAA
>138
GTGTTTACTCCCTTCTTAGGGATATTCTAGCGTTTAATCCTGTCATAAAGCGACCTGCGTCCGATGTCATGACCAAGTAACTACTGAGCGTCCCTGAAAGTATCGTTGACTCGTCAGGCTTGGGCGGCGAACTTAGCTAGATGGTCTCTCCATTATGTGACATGCCAGCGGGTCTAGGAAACGTGATGCTGACGTTCACGCTTACGTCCACGACGGCATTCGGCATATTCCGCCGTACGTTTTGCCAGCGGTTGGTGCAGGTTGGTGATTAAGAAACAGGCGCTCGGGCGTAAGGCCAAGTCGGTCTGAGTGTTACAGAGGTTCGTTAATCGGGACGGGCGTTGTTCGTAAAACAGTAGAGGTGAACAATCGTCCGCGGTAATGTGACGTGCCGTTGCTGTCTTTGCCGCACTTGCTGACAGTCATCCCGGCCCCTTTCGAAGGTGACATGACGTTAGGGCCGTCCAGGTGTTCAAGTGAAACCGGGTACATTGCCGTCGTTGTCTTCGGGCGGGGATACGCGGTGGCTTACTGAAGGGATTACGTGAAATACCATTTATGAGCCTGAATGTGGACAGTGGATTGGGGTGACCCGTCGTTCCCTGGAGTCGCCCGTTGAAAGCAGCAACAGTGATGACCGGGGGAGGATAGTTCTCACTGAGAGCCTGCGTGGACGTTATGTGAGCTATTGATGGCCGTACCGTCATGAGATCAAATAAGCAAGGTCAGTGTGCGTACGCCATGGATGAGCCCCGTCAAGCTGTGGTCCGGCAGTACAATGGATTACCGTACAGACGAAATCACTCCCGGGTATATGAAAGGAGACACGATTGCCAGGGACGAAGTGCATGCGGCGTAGCAGTGCCGTGGAGTGCAGGTATAATACAGATTTAATCCGGCAGCGTCCGTCGTTGTTGATATTTGCTTATGAAGGCTGGGGCAGGTGGCGACTGGCGTACTGAATGACGGAATGCATCATCGTTGGGGTCGGTTAAAGATCTGATTAGCCAGGTAACAGTGTTATGACAGCCCGCCGAACTTAGGTGGGCTTTTGGGGTGAATATGGCAGTAAAGATTTCAGGAGTCCTGAAGACGCACAGAAAACCGTGGTAAGACTGCACCATTCATAGTGAAGCCACTAATAGCCACCACGGTGGTGAACACGGTGAGCCAGAATCGATGAAGCCGGCGTTACAGCAGCCGGTGGAGTACGTCAGTACAGTCATCCTGCAGGTTGTACGGTTTCCACCATCCGCACGCCGGGACCATCAGCGTGTATGAAGATCCACCCGGGGAAGCTGAATGATTTTCTCTGTGCCTGACGGAGCGATGCCCGGCCGGAGGTGCTGCGTCGAATTAGTCCGTGAATATATGTAGGGGGCGCGTAACGCGTCCTTAGACATTGGTCACGGCACGAATGGCCGGGCGAACAGAAATCAGCCGGCGATGCCAGTGCATCAGCTGCTCAGGTCTCCGGCCCTTGTGACTGATGCAACGTAACTCGAGCACGCGCGCGCCGCCAGGCACGTCCGCCGACAGGCTGCATCGTCAGCTCAGGCACGGAGCGTCCTCCGGCGCAGAAGAGGCGGCATCAGGCAAAGGCCACTGAAACGGAAAGTGCCGCAGCCGCAGTTCTCCAAAACGCGGCGGTAAGGAGGAGTGCCGCTAATCGAGGCGAAAACGTCAGAAACGAAGGGTGCATGTAAGGGTCACAACAATCAGCCACGTCTGCCTCCCAACCGCCACGAAAACCGTCAGAGCTCGATTCCAGCACGAGATGCGGGCCTCAAAGAGGCAGCAAATCTGCATCAGAAACGAACGCATCATCAAGTACGGTCGTGCAGCTTCCCCGGCAACGGCGGCAGAATTCTGCCAGGGCGGCAAAACGTCCAACGAATGCCAAGGTCATCTGAAACAGCAGCGGAACGCTCCTGCCGACAGCGCGGCAAGGCACGGACAGCGGCGGGGCGGGGGTCCGCGTCAACGGCATCCACGAAGGCGACAGGAGGCTGCGGGAAGTGCGGTATCAGCATGGCAAGGAAGGTGCGGCAGAAACCGGCGGCGGCAATACCGTGCAAATTCGGCACGTGCAGAAGAGCTCCATGCTAATGCTCAGCATGCAGGGATGCGGACACGAGCCAGAAGGGGAGGTGCAGCTCAGCAGTGCGGCACCAACAGCACGTCTGAACGCTTGCTGCAACGCCAAAGGCGGTTAAGGTGGTAATGGATGAAACGAACAGTGAAAAGCCCACTGGGAAGTCCGGCACTGACCCGGAGCACGCCAACATACACAGACGGCCGGGGGAATAAACAAGCTCCCAGATTGCGAACACCGCTTTGTACTGGCCGATTGCAGATGTTATCGACGGGTCGCCTGACGCACTGAAGCTGAATGATAAAGCGGCTATCGGACCGGCGCGCTCGGGAATGATCCAGATTTGCTACCACCATGACTAACGCGCTTTTGGGGTAACAACCAGGAAGAATGCGACTGACGCTGGCAGGGGCTTCCACCGAAAATAATCACCGTATTTAGAAAATGATGCCGCCATCGGACTTATTCGAACTGACTCAGGTTGGCAGGGATATTCTGGCAAAATTCCGTTGCAAGATGTTCTTGAATATGCTATTGGGTGAGAATTCGGCCTTTCCGGCAGGGCCCCCGATCCCGTGTGGCCATCAGATACCGTTCCGTCTCTACGTCCTGATGCAGGGGCACCGGCGTTTAGGACAAATCAGCCTAGCCAAACTTGCCTGTTCCATCCATCGGGTGCTTCCTGATATGGTCGAGGGACAATCAAGGGGAAACCGCCAGCGGTCGTGCTGTATGTCTCAGGAACAGGATGGAATTACAGATCGCAAGGACAGTGCCAGAGTGCATCCGTGATCGATTGGAACGAAAACACAGGGGTCGTTTGATGCACGGCACGAAAACAACAGGCAGTTTCGATTAAAGGCACCAAATCGACGGACGAAGAATAACACGGGGGCTCATGCTCACAGTCTGAGCGTCATCAGGGGGCCGCGGGTGCAGCTCGATGCCCACACAAGTGGTTTAAGGATGAACAGTTCTGGCTGGAGTCAGTATGGAACAGCAACCATTACAGGAAGTTTATCCACAGTTAAAGGAACCAGCACACAGGCTTTCCATTGCTTATTTATCGAAAACGACAGTCAGGCAGCCACAGTCACTCAGATGTCCGGTACAGCCCGTCGATCGCTGCTGCACAAGCGCGCATCCGAACAGTCGTGATCGCAGCACCAGCAATCCGGTTGTTATCTGCCTCATCGGTACCATGCGGAGGCTTGGTTCAGACGTCACGGACACATCACCCCGTTAACGCTGCGGGTAACGCGGAAACACCGTCAAAAACATTCCATTTAACTATTGTGAGGCTTGCATAATGGCATTCAGAATGAGTGAAAACACGGACCATAAATTTATAAGACAATCTGCTGGCCGGAACTAATGAATTTATTGGTGAAGGTGAATGGCATATTCTCTCATAAGCTACGTCTGCCTTAAACAGTAAGGATATTGCACACTCACAGATATTCCGGCTGGCTTTGGGCTGTTCAATAGGCTGGTGGGCATGGATTATCGGCGCATCTCGTTGCAGCACTCACGATCGGGGTAAAACCGTCTAGCTGACGTGGCTTCCGGCGACGCGTTTTATTTATTTCTGAACTCGGTCGTTACCGGAAATTTGCCCCTGGGTATCTCGCCGGGGGAATATCAGAAATGGAACGGCACGCCTGGGACCGAACGAAGCAGAAAAACTAGGTTCCTTAGATCCGGGGGAGGGGAAGAAAGCAAAGCCTGATGCATAGCCAGTGAGCATATTGCGCTTCGCATCTCATGCAGATCTTGGAAATTGCAACGAAGGAAGAAACTCGCTTGCTGAAGCGTGGGAAGAAGTATCGGTGTGCTGAACCCGTGTTGATACATCAACTGCAGCTGTAATATTGAGTGCTGTCCTGTTGGAGTAATCGTTTGTGACTACTGCCCGCAGAAACGTTGGTAGGAAATAACGTTCCGGTTAGTTATAGTATATTGTAAAGGGCTATTGGTTGATATTGTGGGATGTAGGTCTTCAGGAGAATAATGGAAGTTCTATGACTCAATTGTTCATAGTGTTTACATCACCGCCGCCAATCTGCTTTTGCGACTGAACGCATGAAATATGGTTTTCTTTACTGTTTTGAGTCTGCTGTTGATATTTCTAAAGTCGGTTTTTCTTCGTTTCTCTAACTATTTTCCATGAAATACATTTTTATTATTATTTGAATCAATTCCAATTACCTGACGAAGTCTGTTCATCTATAATTGGCATTGTATGTATTGGTTTATTGAGTAGATGCTTGCTTTTCCCTCCAGCTCTGATATCCATGAATGAAGCCATAGGCATTTGTTATTTTGGCTCTGTCACTGCAAGGACCGCACAAAATATTTACTCTGCTGACATCTTCAAATGTTGTATTGATTAATCAATTGGATGGAATTGTTTATCAGACAAAATTAATGTTTGAACCGTATAACCGTCCTTTAAAAGTCGTTTCTGCAAGCTTGGCTGTATAGTCAACTACTCTTCTGTCGAAGTGATATTTAGGCTTATCTACCAGTTTAGACTCTTAATATCTTCAGAGGAATTATTTTATTGTCATATTGTATCATGCTAAAACCGACAATTTGCTTATGTGGGGAGTAATGCTTTTTAATTTAATAAGTTATTCTCCTGAGCTTCATCAATAAACCGTGAGTGGCACTGTTGACCCCGCGAAATCACATCGTCACCCATTGGAATGTTTATTTGTATGCCAAGAGAGTTAATAAGCAGTCTACATTCTGCCAGGGTACCTAAGGCATCAATAATTCGTAATCTTTGAGCGTATTAGCGATCACATCGTCTTTCTATTTAATAATAGATGATTCAGTTAAATATGAAGGTAATTTCTTTGTGCAAGTCTGACTAACTTTTATAATGTGTTGACATACTTTCATTTGTAATAAACTCGATGTCATTTTCTTCAATGTAAGATGAAATAAGAGTAGCCTTGCCTCGCTACATTTCTAAATCGCCTAGTGTTCCTCATCGTATTGCGAGAATTTCTGCTCTAAGCCATGTAATGGAGCTTTTCCATTTTCAATAATCATTATTGTTACCAAATGTCATCCTAATCTGGTTTTGTTTTTGAATAATAAATGTTACCTGTTCTGCGGTTTGGGGAATTAGGCATTCAAAATTCTAAGGCGAACGATTCAGGGTCAAAACGTATCAATGCAGCATTTGAGCAAGTGCGATAAATCTTTAAGTCTTCTTTCCCATGGTTTAGTCATAAACTCCATTTTACTAATGCATGCTAGATGCTGATATTTAGAGGTAAAATTAACTGCTTAATTGTCACTTGTAATACAAGTTGTTGATCTTTGCATGATTCTTATCAGAAACCATAGTAATTGTAGTCACAGGAAATTTTAATATTATTATTATCATTCATTATGTATTAAAATTAGAGTCCTTTGATATTAGCTCTGGATTTAACTACCGAGCGGGTGATATGGTTAAGCCCCCTGAGCGCCGGCAGACACGTCGTATGCAGGAACGTGCTGCGGCTGGCTCTCCAACTCGTCAGTAGTCGGTCGACTGATTTCACGTTTTCGTTACCCATTTAACAGTTTGCCTCTTTCTAACCTGAGAATTTGGCCTCCCTCACCACTCATCCTGTACTGTACGCCACTTTGGGCCCTACGGGTTAGTGTCCACCTAACATTACAAACGCTGGGCTTCTTCTTAGCTTGCATGCCAACTGTCCTCAATGACTCTTACGGAATTGGTTAGGCAAGTTACTACCGGATTTGTAAAACAGCCTCCTCATAAATATTCGTTCTATTTCCGATAAGCGTCGTAATTTCTATCATCATATTCTAGATCCCTCTGAAATCTTCCGAGTTTAGGGCACTGATACATAACTCTTCCAATGATTGGGGAAGTCATTCAAATCGCTAGATAATTATTCAGATTTGCTTCAATAAATTCTGACTGGCTTACTGAAACGTTGCGGTTTGAACTATTTCCTTATAACTTTACGAAAGAGTTTCTTTGAGTAATAGCTTCACTCAAGTGCTTCCCTGCCTCCAAACGATACCTGTTACTAATATTTAAGCTTGAATGATGAAGACCTCTGTGTTTGTCTTCCTGCCTCCAGTTCACGGGCATTCAACATAAACAAACTGATAGCACCCGGGGTTCCGGAAGAACCGAAATTTGCAGCTACCCAGCCCTTGCTCACGAAAAATGTCTATGTCGATAGGGACTGAAATGCTTGTGGTCCTCATCTACTGCGAAAACTGTACCTTCTCCCCAGATGCAGAGTCGCGGCACGATGGAACCAATTAATAGGCATACCGAAAGATTCAGGGATAATGTGCAATAGGAAGAAAATAATTAATCTATATTTCTTGTGTTTATGACTACAAAACTTGACTTTGTTTCTACTATGGTTGAAACAAGCATGTCATCGTAATATGTTCGCTATTTGTTTTTATCTCGGAGATTATTTTCATAAAGGCTTTTCTAATTTAATGCTTTGTCAGGTTACCAACTAAGGTTGTGAGCCAAGTTTATATGTGTTCCTTAGGTATAAATACTGTCGATTAGCCTTAATGGTATATTGTTGTTCTTTCTTCAAAAATGGGGGAAGTCACCAGCATGAAATCTATTTCGACATTATCTGCATCATACCTTCCCCGGCATTTGAGCATTTCGACGGGTAAGTTCGCTGGAAGAGGTAGTTTTTCATTACCGTATTTTACCTTCATACTCTGTTCATTATCATCCCCTTTAAAACGGTTCGACCTTCTAATCCTATCTGACCATTATAATTTACGACTGGTTTCATAAGAAAGCTGAATCACAACGACTGCGATAATAAGTGGTATCCAGAATTTGTCATTCGCAGTAAAGCCTCACGAGTCACCTCCCGCAGTCTCGCCGAATGTCTCCAATATCCGCACGGTAATATTTATTGCTTCTCTTGACCTTAGGTACCATGCGAGCATTTGCAGTACGTGACGCAGTACTGGGGATGAATGCAGCCAGGCATTACTGCCCACCCATTGCGTGCATCAGTAAGTCGCTTACTATAATCTTCTAAAGCAGAGAGCAAAATAGTGGAGCAATGAATCTACTGTTGGACAGAAGCGGACCGTAATTTTCGCCAACGACATCTACTAATCTTGTATCAATAAAACAATTGCATGTCCCAGCTCATTCGAAGCAGATATTTCTGGATATTGTCATAAAAACAATTTAGTACATTTATCATCGTCCACTTGAATCTGTGTGTTCATTACGTCTTAACTCCCTTCATATTTAGAAAATGGGACGGCTGAGCGTATGCGTTAGATTTGAAAGTTTTCATCACTACTTAGTTTTTGATAGCTTCAAGCCAGTGTCTTTGCTCTACTCATACAACCAATAAATGCTGAATGAATTCGCACCCTAGAGATCGCCTAGTGATTTTAAACTATTGCTGGCAGCATTCTGCATGAGTCCACAATATAAAAAGTATTGTATGCTCGTTACTGAGGTTCTTTAGAGGAGTAAAGGATCAAATGCACTAAACGAAACGAACAAGCGATCTCGAACATATCCCTTTGGGATCCTTGACTCGATAAGTCTATTATTTTCAGAAAATGCCTGTTTTCTGGGTTGGTGATTGCACCAATCATTCGATCAAAATGTTGTTTTACCCACCCATTCCGCCCCATCAAGAAAAGCATCTTCGTGGCATAGGAATTAACCGTCACCTAAAACGGTATAGTTAAATCACTGAATCCGGGGAGCACTTTTCTATTAAATGAAGGACGAATCTGACAATTCTGGCAAACCATTTAACTACACGTGCGAACTGTCCATGAATTTCTGAAAGAGTTACCCCTCTAAGTAATGAGGTGTTAAGGACGCTTTCATTTTCAATGTCGGCTAATCGCAAGCTTTATCCATAAATCCTGAATAGCTTTAAGAAGGTTATGTTTAAAACCATCGCTTAATTTGCTGAGATTAACATAGTAGTCAATGCTTTCACCTAAGGAAAACATTTCAGGGGTTGACTGAATTTATGAGTACATGAATAAGTGCTTATTTCTTCTTTTTACCTACAATGGATTTTAACATTTCCGATATCGCATTTTCACCATGCTCATCAAAGACATATCAATAAACATTGTAACAAAGGAATAGTCATTCCAACCATCTGCTCGTAGGAATGCTTATTTTCTACTGCAGGAATACCCGCCTCTTTCAATAACTAAACTCCAACATAGTAACCGCGTAATTTTATTAAAATAGAAGCAATTTATTTGGCGGCAAACACAGGATCTCTCTTTAAGTTACTCTCTATTACATACGTTTTCCCATCCTAAAAATTAGTAGTATTGAACAATGACTTAACGGGGCATCGTATTGTAGTTTTTCCATATTTAGCTTTCTGCTTCCGGTTACACCCCAAGGGTGTTCTTCTACTGTGCAATCGGTTTATAGACGAATATAGTCTATTACTGCATATAGTATCGCCGAAAACGATTAGCTCTTCCATTCTCGAAGCGGGTTTCAAGGTACTAATAAGCCGATAGATAGCCTAATATTTCGTAGCCATTTTCATAAGTGTTACTTCCGCTCCGCTCAGCCAACACTTCACTACAGTTATGAGAAATATGCATGCTCGGTGTGGAGAAGTCGTACGAAGAAGAAAGAAGTCATGATGCGTCGTTGACATCACTGCTATCTTCTTACTGGTTATGCAGTCGGTGGGTGCACAAGGCTTTGCAGCTGGATTGCAGGCTTTGTCCTTCCTCCTCGGCATTGGCGACAGGTTTGATGACAATTAGCGCAAAGAAGACAACCCGTCGGGACTGCTGTTACAGGTCACTAATACCATCTAATAGTTGATTCATAGTGACTGCATATGTTGTTTACAGTATCTTAGTCTGTTTTATGCAAAATCTAATTTAATATTATTTATATCATTTTACGTCGTTCTCGTTCAGCTTTTATACTAAGTTGGCATTACCAAAAAGCATTGCTTATCGATTTGTTGCAACGAACAGGTCACTATCAGTTCAAAAAGCTAAATCATTATTTGATTTCAATTTTGTCCCACTCCTGCCTCTGTCATCACGATACTGTGATGCCATGGTTCCGCTCTCCGAGAAGGGAGCAGGAGCGAGGGATTCGGAAGAGAGAGGGGCGCAGACAAACTGCGCAACCGTGAAAGGGCCGAATGCGTCCTTCGAAGGAAGACTACTGATGCTTTCGTGCCCTACATAAATACCCTTGATACCTAGT
>139
GTGCTTGGGTGTTTAACCTTTGCAGGCAGACCGGTATGGAGCTAAGAATATGCGTCATTCACCAATAAATTCATTAGTTCCGGCCAGCAGATTATAATGATTTGTACGGGTCGATGGTGCTTCAGCATTAGGATGGAGTAGTGCAGCACAATATAGTTAAATGCAATGTTTTGACGGTGTTTCCGCGTTACCCGCAGCGTTTAACGGTGATGTGTCCGTGAACCATCATGAAAGAATGGGGCATGAGCACCCAACAAACTGGATGCTGGTGCACCAATACCAACTTATCTGCGCATGTGCATAGGGGCACTCACGCTGTACCGGGACAATGAGTGACTGTGGCTGCCCTGACTGTTAGTTCGTAAATAAAGCAAGATACCCTGTGTGCTGGTTTCCTTTAACGTGATAAATTTCCTATCGCCAATGGTCCTGTTCCATACTGACTCCAGCCGAACTGTTCATCCTTAAACCACTTGTGGCATGAGCACCCGCGGCCCTGGTCGGACTCATCAGACTGTGAGCATGAGCCCCCGTGTTATTCGTCGATTTGGTGCCGTAATGAAACTGCCTGTTGTTTTCGTCCCGTAATGAATAAACGATGTAGTTTTCGTCCCCAATCCGTACCGGATGCACTGGCATGTGGGTGTGCGACTTAATTCCATCCTGTTCCTGAGACGACTCCAGCAGCCCACTCTTCGGGTTTCCGTACTTGTCCAGCCTCGCATATCAGGAAACCACACCCGATGGTGGATACGCGACAGCAAGTTATGGGTAGGCTGATTTGTCAAACGGTCCCTGCATCAGGACGTAGCCATAACGGAACGATATCTGATGAAGGGATCGGCGCACCCTGCCGGAAAGGCCGAATTCTCACCGGCCCCAAGATGCCAAGAGAACATTGCAACGGAAGTGTGCCAGACAGGCGACCTCCGGATCGGGTTCAGTCAGCGGCTGGCGGCGGCAGAGTTTGCGGCAAAATACGGGTAATTATTTTCACGTGTAGGAAAGCCCTGCCAGCGCCGTCAGTGTCGCATTCTTCGGTTGTTACCCGCAAAGCGCGTTAGTCATGGTGTAGCAAAATCTGGATCATTCCCTACAGGGTGCGGCCATTTCATTCAGCGTATTCAGTGCGTCAGACCCGTCGATAACATCTGCAATCGGGCGTATACAAAGCGGTGTTCGCAATCTGGTATTGTTTTGTTCCCTGAGCGCGGTTAGTGCTGTTGTAGATTCCGGTCATGTTAGAACTGTCGATGGGCTTTCTGTTCGTTTCATCCATTACCACCTTAACCGCCTTTGGCGTGCAGCAAGCGTTTCAGACGTGTGGGTCGTTGCACTGCTGAGCTGCACTATCCCCTTTCTCGTGTCCTCGCATCCTCAAGCGCGACATAGCTGAAGCTATATCTTCTGCACGTTTTGCCGAATTTTTGCACGTATTGCCCCGCTTCTGCCGCACTTTTGCTCTGTGCGATGCTGGGTATACCGCACTTCCCGCAGCCTCTGTCGCCTTCGTGGATGCCGTTGACGCACTCCCGCCGCGCCCCCTGTTTGCGTCTGCCGAGCAAGAGGTGCGTCTGAGCGCTGCTGTTCAGATGACCTGGCATTCGTCTCGGACGTTGCCGGCAGAGAAGTCTCCTGAGGAGTGCTGCGAGGAAAGATCGCACGAAGGGGCAGGTCATCGATGCGTTCGTTCTGATGATTTTGCTGCCTCTTTTTGAGGCCACCGCATCTCGTTAACTGAAGTGGGCGTGAACCCTTCGTGGCCCGGTGAGGAGGCAGACGTGAGCTGATTGTTGTGACGGTGCAGCATTCGTCTTTCTGACGTTTTCGAGCAAGCGGCACTGGCGCCGCGTTGTTTGCGATTCTTGGCTATACGGTGAGGCATTTTTGCTTCATGTATCCTTTGCTGATGCCGCTTCTGCTCAAGAGGACCCTTCCTGAGCTGACGGATGCAGCCTGTCCGGCGACGTGCTGGCGGCGCGTGCTGAGTCAGTTGCATCAGTCAAAGGGCGGCCTGGCAGCTGACCTTATGCACTGGCATCGCCGGCTGATTTCTTCGCGTCTGCCGTACTCTCTGTGCCCACGGACGCGTTACGCCTCCTTCCACCACCATCAGAGTTCAAGCACTACACGCAGCACCTCCATCGGGCATCATCCTCCGTCATGAAGAGAAAATGAGTGCCGTCCCCGGTTGAATCTTCATACACTTATATCTATGGTCCCGGCGTGCGATCGTGGAAAACCGTCAACCTGCAAGGATGACATCATTGAACTCGTACTCCACATCCATATTCCTGTAACGCCCGGCTTCATCCGGATTCTCTGAGCCCACCGTGTTCACCACACCGTGGTGCTGTTACGTCGGCTTTCATGAATGGTGCGGTTTCTGTACCGGTTTTCCTGTTAGCGTCTTTCATAGACGCGGAAAGCGTATCGGAGATGCCAGAAGCAAAGCCCGAGAATCCCGAGGAGACCAAACACTGTGTTACCTGGCTAGATCAGAATTTATAACCGACCTCAACGATGAATCCGTCAGTACGCCAGTCGCCACTGCCGGAGCCTTCAGCAATATCAACAACGACGACGCCTTAGATTAGTAATCGTATACCTGCACTCCACGGGGTACTCTTACGCATGCAGCATTTCGTCCCTGACCGCAGTGGTCGTCTCTTTCATACCCGGCTGGCTTTCGCGTTCGATCGCTGCTATCCATTGTACTTAGAACGCGGGTGAGCCACTCCGGCCATGGCGTACGCACTGACCTGCTTACTGATTTGTAAAACCGGTCATCATCACGGCCACTACGTCCACGCAGGCTCTCATAGTGAAACGTATCCTCCCCGGTCATCATGTGCTGCTCTTTTCGACCTCGCGGCGACCCAGGAAAGCCATCACCCCACACTGTCTAGTCAGCTCATAACGGTACTTCACGTTAATCCCTTTCAGATGACTCACAATGTATCCCCGCCCGACAACGACGGCAATGTACCCGGTTTCGTCATTGAAAATAGCCCACCGTAAACGTACCCATGTCCGTCCCGCACGGTAGAGTAACTGTCACCGCAAGGCGGCAAAGACAGCAACGGCAATACACATTACGCGCATCGTTCACCTCACTGTTTTATAATAAATACCCGTTCCCGGACGATACCTGTAACACACTCAACCCACGCTGATCGCCAGCGCCTGTTTCTTAATCACCATAACCTGCACATCGCTGGCAAACGTATACGGACAAGAATATCTGCCGAATGCCGTGGACGTAAGCGTGAACGTCAGGATCACGTTTCCCCGACCGCTGGCAGTAACAATACGGGAGAACACCTGTACCGCCTCTTACCCCCGCCATCCATAAATCACCAAGGCGTTCATCAGTACTGTTCATATAACACATCGAATACGGTCCCTGCCTGACTAATCGCTTACTTCAGGCATCGTGCTAGCGGGCAGCGCCTATATCTGGCGATCCGCCTAGGGTATTGCTTCGCTGCTACGGGCAAAGTAATGTATGACGGCCAGTCCACTGCTGTTCACGCTGCTAGGAAAAGCCGGCCCGGCGCCTTTACAATGTCCCCGACGATTTTTCCGCCCCACCGTGACGGTCCGTACAGTTTCAGCTATCGTCACATTACTGAGCGTCCCGGAGTTCGCATTCACTGCCACTGATATCCGCATTTTAGCGGTCCTTCCGTTAGGTTAGAAAAGCACGGAGGATTGCCGCATGATCAATGGTGGGGCCGTCAGGCGGATGCGAACACGTCGTTCATGAATATCTGGTTGCCCTGCGCCACAAACATCACGGCGTTTCATTCCCGTTTGCCGTATAATAAATCGGCGATACGATTGGCGGACCGATATATGAACGAGTTTGCCTTCCTCCGTGTCCTCCATTGTGCTGAGGCCAATACCCCAGACATAATGTTGCCGTCTTTGATATTCTGCTCAATTTTGACAGCCACATGGCATTCCACTTATCACCTGGCATCCTTCCACTCTTTCGAAAACTCCTCCCATGCTGGCGTTACTCCTCCGTCAGCTCAGACTTTTCCAGCAGCTCCTTGCCGAGATGGGATTCGGTTATCTTGCTTTGAAAATCGAGACGTATCTCTTCCGCATCATCGACGCCCGACCGACGGCCTCCACGAATGCCGATTCAACGCTGTTCACTTAGATATAAAGTAATAATCATGGCCCGGTTTGATATTGATACTGGCGGCTATCAGTACAGCGCCGTGACAAGACGCGTGCATGGTTTCAAGGTACGTGATATCCGCAATCTGCTTTCCAGAACCCAGAACTCAAACTGTACCGTCGGGTCATAAACGAGGGCAGACGCGTGCGGCTTATCTGAAGGTAGCCCGGCGATAGCTCAATCCTACGTGACGTGCTGCCCGGAGTCCGGCAATCGAACGATACCGACGGATCAAGCGCTGCGTGCTGCCCCCACGCATTTACTCAGGGACTGTCAGCCGTAGTTCCCCAGCGCAGTTGCGTGAAGTGGTGTGGTTTTGTCATCCGTCGTCCGGGCCGTAGGACTCAGAGCCGCTCAATAATGCCGTCGTCCGCTTTACGTCAGACGGCAGGAAACACGCCCTTCACCACCCTTCGGTGTCCCATCGCCACCATAGACATGATATTCCCCGGGCGTCTGCAGTACTTCTGCGGTCAGGTGCATGCAAGCGCTGGCGGCGTGACAGTCATGCCCGTGCTCTGTTCGCCGTCAAAGTGCCCCGTATCTACGATGGCCTCTTTTCCGGCACATGCTGATGCACAAAGGTCAGTGGGCATACGTGCCGTCGTCGTTCTCACGATACTGACTCGCAGCGGAAGTGCTAGGATCGCAGAGAGGATCAGGAGCGCTTGGAGACCCGAGACAGGCTGATCAGCGCCTATGAAGCGCCTTTACCTTCACGCCGTGCGTATCGACGGTGACTGAACCACGCTGACCGGATTGCCACTTCCGTCAACCAGGCTATCGCCGCGGTACTCGAGGATGAAGGGGTCGATTTCAGCCTCACGGTCGCGGTTGGGGGTACCAGTCGGGTCTGGCTGTTCTACCGCCAGAGCACGCCCAAGCATGCTGATACCGGCATAGTCATCATCGCAGATTTCAAGACATCGCCCGGTACGGGCGAACCCTTCTGCGCCGACTAGTGAAATCACGGTCTGCGTTTCCAGCAGTTCTGTTTAGATCAGCCAACACAATCAGGGGCTGTGCCTGCCCCCGGCTGGTACAGCCAAGGGCATCCATCTTCGTAACATTACGACCCGTAACGGGCAATGGCCTGCGTATCTTCGACAAGCTCTGTCGCCGTCTTCCCAGCCGTTGTTGGGTCAATCCAGTTCACTGAACCGGCATTATGGCGGTCCTTCAGGGCGCTGAAGCTGTATACGAACCAGCGCCATGATAGGGTCAGGCATCACATTACTGCGGTTATAGTCCACGTCTTATCCATAACGTCTAGTCCTGCACGAACGTCAGCGTGCCCGTTCCATACCGGCATACAGCGCATCGCCAGCAAGAAATCGATGAGCACATCCACGCCTTACGCTGTGGTCAGTACGCATTACAGGTGATGCGGCGGGGGCGTCCCCGTCCGCAGCCAAAGGCCGTCCGCTGATTCTGAGTACTGGCCGTAAGTCACAGCGCCCGCTTTATCCGATACGCCGCACCAAGACGTTTCCCCATGCCGTGGCCCCTATCGTCTGCGTATTAGTCAGCATATCCCACAAGACAGGCCATGTTGTTGCTGTATGCCGGTTAAACGTTCCGTCCCAGATACAGCGCTTACCTTGCCGTCTTGAGTTATAGTTCGACGGACGGGCAGAATACGCCCGAGGTGCTCACTGATTACGAGCCCTTATGGCTGCCGAACTGCTCCGAGTCCACCTGCACGCCGACCGCCAGTGCCGTGTTCGGCAGCACTGTTCACACGGCTGATTTCAGTACCACAGCGTTTGATTCTGCAAGCTGGTCGTCGTGGTGCTTGTCCGGCGTCATCCTGCGCATCCAGATATTAAACGGGCGCCTGGGCATGTACCCATCACACCGAGGCCAGATACTGCAGGTGAGTTTGCCCTTAATGATGTCTTTTCCGTTACCCAGCCACCGTTACGTTGTATCTGAACCCAGCGACTTCCATAATTCCTATTCCTCATTCCGTGGTTTCCTACACAGTGCCTGTACCGAAGGTAAAGGCGCAGACGGTCGATGTTGCAGACGTAATGGTGCGGGTAGTTTAGGCGTCATATTTCACTTCCGTACCCAGCACCGTCTCGGAGCCGGGATCAAATCCCTCCCCGGCCTTGATCATCGGGCTCTACAGCCCCGGACCCACCGTAGCACTGTTATTCTCGGACTTCCGCTCCCCTCATTCTGTTCGCGCCTCACCGCTTTTAAGCCATCCACCGGACTTCAATCGGCCTTGCTGATGGCATCGATCACACTAAGCAACTGCGTGACCCGCAGTGATCCTGCCGTGCCCCGGGGGTATCGCGTAAGCCTCCTTTACGCCCATTCCTCACTCCATAAATGACAAAACCGCCCGCAGGGCGGTTCCCGGATAAACATTTTGCATTCAGCGACCAATCACACAACCTGACCACCGTCCCCTTCGTCTGCCGTGCTGATCTCCTGAGAAACCTCGATCAACGCGCGCATTTCCCGTACCATACAGGCAGAACATTGCCCTGGGCAACCATGTTATCCAGTGAGAGAAATAGGTGTTGCTTACCAGTTGGCGTTGTGACCGGGGGTCGTCGGTTTCGGTGCCAGCATCTGCGCCACACCACCGAGCACCATACTGGCACCCAGAAACAGGATGCCGGTCATACCACCGGCCAATGGCTGCCCCATGCTGCACGGCTCCGGCGGTACAAAGAATTGGAGCGGCAATGGCGAGCAGCCCCAGACAATCTGGAATACGCCACCTGACTTGGCCCGGCGACTCTGGGACAATATGAATTACAGCGCCATCAGGCAAGAGTCTCATGTAACTGCTAGGTTAACCCGGACTTTGAACGTCCCGCCCGGCAATCCGTGGCTGATACCAGCCGTCGCTCAGTTTCTACGAAACGCCGGGGTAGTTGTATAGTGCCCGGATGGCTTCAGCCCCCGTTTTCACACGAAGAAGTCAATTAAGCAACAAATCGTTGTAATCCCGTAGGTAAAGAATAATGCGGCGCCATGCCCGGTACGCCAGAGGAGTGTGTGCGTCGGTTACAGATTTGTCTTCGTTATCCTCTCGTTTGCTCAGTTGTTCAGGAATATGGTGCAGCAGCTCGCCGTCGCCGCAGTAAATTGCGGCGTGATTCGGCACTGATGAACCAAACAGAGGCACAGCAGCACATGGCCCGGCAGATCGAACGACAACGGCACCTGATACAGCCCCGTCGCCTCCAGATTATCCAGATAGAGGATTCTGTAGATTCAAGCCAGTTATCCTCTCACGATGAAAGTCCGGCATCTCAATCCCGCCATGATAAGCATCCCGGAACAGTCTTGACAGTCCGTCACCCCGTGCTCAAACGCCGCCCGGTACAATGCGGCACATGCAGGGCTTGAATCGTCCCCCGGCAGACTCAGCCACCACGGCAAATCACTGCACTGCAGCCGCCGGTCGGCCTCAGCTCAGGCAGACCCGACTGGGCTAGGGACCGGATAATCATCCGGCACTAAATCTGCCTGCAGCCAGTCTTCCGGCGACACTAGAAATACGCGCCGGCTCACCGAGATATTCGCAGGGAAATATCTTTCCCCTCGAGCGTGCTTACCGCAGCACTCCATGGATCTCCTCGAGGGCTCCGCGTAGAAGCGCTGATTCGTCTTCGTCAGGATTTACTGCGAAAGTTGTTAAACCGGGGAAGGAAGCCGCCAAAGGCTTGCCGACGTTATTGCGGAAGTATCAACCCGCTCAGGCATTTGCTGCATGTCTGTTTCTTCGTGATATCGCTGGTTAGACTTTCCTATTCATCGCGACAGCCGGACCCTATAACCGCTCGTCACCGCGATAGTCCAGGTGCAGGTGTTGGCCTAAGAGACCGATCCTAGAGAAAGAGAGGAACGAGTTCGCGTGGGGCGGTAAAGATACAAAGGAGGCACTCACCGCGCTCAGTTCGCTGCACTGCTCAATGCGCCAAGCTGATCACCTCCTGCTCCTAGGATCGGCGTAACTGTTTCTAGGTCACGAAGTTCACCGCATCCAGAAAACGGGCGTAAACCTTACGCCGGACCACCGTTCTAGAGGACCAGACGTTCTGTTTAT
>140
CCGTGCTTGGGTGTTTAACCTGGCAGAATCAGCTGGATTCATTGCGCCATCACCCGCGGGCAGTTTGTTGCATGGTCGCGGGAAGAAGCATCCGGTCACCGCCGGACTGCCAAACGTCAGCGAGCTGGTTGATATGGTTGAAGGCGTATTGCCGAAGCCGAGGCCTGTATCCGGGTGGAAGAGTCTTATCCGTGCGAAGGATCAAACGCGCACTCACTGGCTGGTTACCAACCTGTGGTTCAGAACATGCGGGCCAATGCGGCTTACTGATGCGGAATTACGCTTACGGCACGCAGATGAAGCATTGTCCTAGGTATGACTGCGAGAATTAACCGTGGTGAGGCGAATGCCCTGACCAGTAAAACAACTTCCTGTCATCTGCGGGCGGTAATACCTCTAAATCGTTGCACAGGCCGCTGGTGAAGAAGATCGCAGAAAATCATAAAAGCTAAGTTCGACTGAAGGAGCAGCACATGTATGACGGGCAAGAAGGATTATTCATGCTGGGGACCGCATAATTCCTCTGCTCGCTTAACGTATCTTGCTAAAGCTTTAGAGCTAACGGCAGCAACAGTAACCAGCATAAGCATAAATCAGGAGCGCGGTAAAATCAACCCACGGGCAGGTCTTCTGGTTATCGAAGGTAAGGTCTTGGCGAACGGTGTGTATTACCGGTTCAGCCCAGGGAAGAACGGGAAGGAAGGAAGATGAGCACGAACCTGTTTAGGATGTTAGCCAGTCGCTCGAGATGAAACGGGTACCGGTATGGGGGTTAAAGATGACCATCTACATTACTGAGCCATAGATAACAGGCCTGCTGGTAATCGAAAGCACTTTTTGATTTGGGGGAGAGGAAGTCAGCTGAAAACGACCTGTTGAAATTCGATCTCCAGCCCTACATCAGCAAACGCTATTCACCCAGTACAGCAAATCCTTCCCATACGCACTGGATAACCAATCGTAGTATATCACATTCAGGAACGCAACCGCAGCTGCTATACCAAACAGGAAGCTATGGGCCTGCTTAGGTGAATGTCTCCGTCAGGTTGAATGGCATGGTCGCTGGCTGGATGCAGAAGCTGGAAGTGTGTTACCGCAGCATTAAAGCAGCAGGATGGTGTTTCGTTAATCTCCTTCAGGGGAATGGCTTTGTAATAGGCCAGGTCAACCCAACCAGCAGGATGCGTGTAGGCGAATTTGCGGAGCTATTAGAGCTGTACAGGCATTCGGGCCACAGAGCATTGGATCGGTGATGTCAGACGAATGAGAAGACTGGCTCTGGAGTACGAAAGCGACTTAGATGGGAAGACAGGGCTGCATGATAAATGTCGTTAGTTTCTCCGGTGGCAGGACTGTCAGCATATTTGCTCTGGCTAATGCCTCAGCAAAGCGACGGGGCAGGTAAAGACGTGCATTACTACGTTCATGGATACAGGTTGTGAACATCTCAATGACATATCGGTTTGTCAGGGAATTGTGAAGTTCTGGCTCACCACCGCTCACCGTATTGCAGGTTGATATCAAATCGGGAGCTTGAATTCAGGACAAATGAGTTATGACCGGTATGGGAACCAAAGAGGATATTCAGACGGCGAAATGCCTGTTCTGAAGCCATTTATCGATATGGTGACGAAATATGGCATCCCATACGTCGGCCTCGCGTTCTGCACTGACAGATTAAACTCGTTCCTTCACAGACCTGTGTACACTGACCCGTTCCTGCAGAGGGAATTACACCACGTGGATTGGCATCAGAGCTGATGATAATGAAACTGAAGCTAAACGGCCAAAGCCTGGAATCAGACAGCTCGTGTAACCTGTCAGACTTTTGAGAAGGAAGAACAGATATCGCGCATGGTACGACCAACAACCATTCGGATTTGCAAATACCGGACTATCTCGGTAACTGCATATTCTGCATTAAATCAACGCAAATCGGACTTGCCTGCAACATGAGGAGGGATTGCAGCGTGTTTTAATGAGGTCATCACGGGATGCCCCATGTGCGTGACTACATCGGGGAAGCCAAAGGAGATTATGTACCCGAGGAAGAATGTGCTTAACGACGGTATCGCGACTTATTCAGAAAATGATTATCAAGCCCTGTATCAGGACATGGTACGCTACGATTCGATACCGGACTGGTCCGTGGTTGCGAAATATTTGGAGGGCAGCTTGATTTCGACTTCGGAGGGAAGCTGCATGAATGGCGATGTTTGACGGTTAGTGAATGCAAGAAGATAACCGCTTCCGACCAAATCAAGCCTTACTGGAATCGATGGCTTGTCTCCGGGTGAAAGAAGCCCAACAGGGGTGTTACTACACCGCAGGAAAGGAGGACGTGTGAGAACCACGCACGAAGTATCACCGACATGATCTTAGAAAACTGCAAATGAGCTTCCCTCCCGAAACGCACCAGAAATAAACCCAAGCCAATCCCAAAGGCATTGACGTAAAACCTTCCTCACCACACGGCTCCGCCTGTGGGATATCCGGTGGCTAAGACGTCGTGCCTAGGAAAACAAGGTGATTGACCAAATCGAAATTGGCCGAACAGAAGCGTCGAACAGCGAGCTTTAACGTGCTAACTGCGGTCAGAAGGAGCTGCATGTGCTGGAAGTTCACGTGTGCTCACTGCTGCGCCGCCCAGAACTGATCCCGTACCTAGAATAGCTCGATGCACGAGGAAGGAAAAGTGACATGGCTAAACCAGCGCGAAGACGTGTAAACGATGAATGCCGGGAGTAAAGTTCGTCAGTTCATCCCTGCATTCGCTAATCAGTGGTGGTGCTCTCCAGATGTAAGAATAAGGATAGCACTCGAACTACGAAGTAAAGAACGCGAAAGGGCAAAAGCAGCAGAGAAGAAACGTGACGACGAGAGGAGGCATCAGAAAGATAAACTTAAGATTCCAGAAGACTCGCTTTAAAGCCCCGCGATTACTGGATTAAACCCCTCCCCAACAAGCCGTAAAGCGCCTTCATCAGAAAGAGACCCCGGACTTACCATGTATCTCCTGATTCGAACGCTCACGTCTGCTCAGTGGGATGCCGACATTACGCACCTCTGCTGCGGCAGCGCCTCCATTTAATGACGGCCCAATATTCACAAGCAATGCGTGGCTTGCAACCAGCACAAAAGCGGAAATCCTTCGTTCCGTATCGCCCTTTGAACCGTGATTATCTGCATCCGCATCGGGCAGGAAGCAGTAGACGAAATCGAATCGACAACCAGACCGGCCATCGCTAGGACTATCGAAGAGTGCAACCGAGATCAAGGCAGAGTATACACAACAGAAACTCAAAGACCTGCGAAATAGCAGAAGTGAGGCCGCATGACGTTCTCAGTAATAACCATTCCAGACATGCTCGTTGAAACATACGGAAGAATCAGACAGAATAGCACGCAGACTGAAATGGGTCGCGGTACCGTCAGAAAATACGTTGATGATAAAGACGGAAAATGCACGCCATCGTTCAACGACGTTCCGCCATGGTTCATCGCGGATGGAGTGAAGGATGCGCTATTACGAAAAATTGATGAAGCTAAATACGAAATATTTGGTAGTTGGCGATCTGCACGGTGCCCGGCTACACGAACTCCTGATGAACAAACTGGATACGATTGGATTCGACAACAAAAGACCTGCTTATCTCGGTGGCATTTGGTTGATCGTGGTGCAAGAACGTTGAATGCCTGGAATTAATCACATTCCCTGGTTCCATAATGTACTGATTAGAAACTCAGGCAGATGATGACATTGATGGCTTATCAGAGCGTGGAAACGTTAATGATATGGCTGCTCTAATGGCGTATGGTTCTTTAATCTCGATTACGACAAAGAAATTTACTCCTAAACTTGCCCATAAGCATATGAACTTCCGTTAATAATCATCGAACTGGTCATAAGAGCAACAAATAGCGTTATCTGCCACGATTATCCCTTGACGAATGGGGTTTGGAAAGCCAGTCATCCATCAGCAGGTAAGATCTGAAAACCGCGAACTGAATCAGCAACACAATGCAACAAACGGAGTGATCCAACCAAATCAAAGGCGCGGACACGTTCATCTTTGGTCATCCTCGTCATCGAGCAGTGAAACCACTCAAGTTTGCCAACCAACCGTATGAATACGGCGCAGTGTTCGTATGGTGCCGGAATGATGAACATTGATTTCAGGTACAGCGTGGAGAAGGCGCATGAGACCCGCGGACATCTAAATTTCATTCGCTAAAGCCCACTAGCGCACTCATGAACCGACTAGCGCTCGGATTCTCTCTTTCTCGGTACTGTGATGGCTGTATGCTATGAGAACGCAATCACCGACTAGGATTTCGGTATGGCTGCAGCATTCTGCGGTAAGCACGAAATGCAGCCCCAGAACGACAAACAAAGGCTATCAACTATCTGATCGCAATTGCACAAGGTATCGGGGAATACCGTGGTGGCAACCAGCTTGAAGGAAATACTAAGGCAGGTACTGCAAGTGCTCGCAACATTCGCTGATGGTACCGTATTGCGCCGTAGTGCCGCGACGCCTTCGAGGCAAGATGCAGAGATTGCCATGGTAATCAGGCGTGCCTTTGGCTATTGCCAAACAGAGCTGTGGGGGAGAGTTTAGAGAAAGAGTGCGGAAGATGCAAAGCGTAGGCGTCGCTATTCAAGGATGCCAGCAAGCGCAGCAGCTCCGCTGTGACGATGCTAATCCCAAACCTTACCATCAAGCATTAGCTCACGCACTGTTACGCTCGCTGTATGACGCTCTGGTGCGGGTGCGTTCCACAAAGAGTCAATCGCAGACAACATTTTGATGCGGTCACCGTTAGCAGCATGATTGCCACGGATGAAACATATTAACGGCATGATATTGACTTATTACGATAAAATTGGTAAATTGACTCAACGATGGGTTAATTCGCTCGTTGTAGTGAGATGAAAGAGGCGGCTTACTACGATTCCGCCTAGTTGGTCACTTCCCGACGTATCGTCTGGAACTCCAAACCATCGCAGGCAGAGAGGTCTGCAAAATGCAATCCCGAAACAGTTCGCAGGTAATAGTGCCGCTCACTGCACGGCTTTTCGGGATTCTATATCTGCACAGGCCAACAGCATTGAGTCGATAATCGTGAAGGATCCGGGGCCTGGTGCTCTCTATCAGTGCTCTTTCAGTTGTGCTGAATCCAAGCGAATTACCGGAAGCATCGGATCACCAAATGCGTACAGGCGTCATCGCCGCCCAGCATCAGCACCAACCCAAACTGAGCCGTAGCCACTGTCTGTCCTGAATTCATGCTTTAATATAGTTACGCTGCGGCCTTTACAGGACCCTTCGTGAAAGCGGGTGGCAGGAGGTCGCTAACACTCCCTGCTTACGTTTTTGCCCGTGCATATCGGTCACCGACAAATCGATGACTATTAAACACAGCTCCTCGACCATTTGTCCTTACTCAGTAATCATCTTATTCCTAATTAAACGAGCAAATCCCTTATTGCCGTAAGACATGAAGATGCCAGAAAAACATGACCTGTTGGCCGCTTCTCGCGGCAAAGGAACAAAGGCATCGGGGCAGTTCGGTGCGTTTGCAATGGCGATCCTTCTGCGGCATATAATGGCGGTGCGTTATGACAAAACAGTAATCGACGCAACGATGTGCTCGCGCTTATCGCCTAGTTCGGTTCCTGTACCTTCTCGACTTCGCCGGTACTAAATAGCAATCTCGGTGGTAACGAGCGTGTTGATCGTCACATCGGTACTGACTCGATTGGTTCGCTTATCGACAAAACGCTTCTAATCTGCTAACAGCCGATAGAAGATGGTAGAAATATCAATAATCACGTAAGGCGTTTCCTCTGAGATATGCTGGCGTGGTCGGAGGGAACTGATAACGACGTTACAGAAAACCAGAAATCATGGTTGGTGGCACGTCATGTGCGGCTACGAGGCAGGACGGATTTACTCTTACCATCCTAGCAAACTTGTCACGCTAAACCCAAAGCTCAAATCAACAGAGCGCCGTACGCTACCAGCTTCTTTCACGTTGGCGTATCCACCGCAAGCAGCTTGGCCTGAAAGACTTCTCTCCGAAAGTCAGCCCTGTGGCATTGCAGCAGATGCAGGAGAGGGCCGTGGCGCTTTAGAGCTGATTGATCGTGATATCCGTCAGGCAATGAACCGTTGCAGCATATCTGGCTTCACTGCCGGGCGCTGTGCTTGGTCAGTTCCAGCATAGGCTGACAGCCTGATTGCAATTCAAAGAAGCGGGCGACCGTCAGAATTGATGTGAGCAGAGTCACCGCGATGCTCTCTCTGGGCTAATATATTCTGCATCATCGTCTGCCCTGTCATGGCTGTTAATCATTACCGTGATAACGCCATGTCACAAAGCCCAGCGCGACAAATGCCAAGAGAACTGAAGCTGGCGAACCCGGCATTATTGACATCACTGCAGATGCGTCAGCGTGATGTTGCTGCCTCCCGGTCCGGCAAATACACGAAGGAGTTAGCTCTGCCTAAAGGCTGAAGCTATCATCCTCTGCGTGATGATGTTGCCGCTGGTCGTCGTCGTCGGTTGCACATCAAAGCAGTCTTCCATGTCAATTGATGCGCCCACCGCCTCCGGCGTGGATAATGCAGCCTCCCCCGACGTCCGAGCTCTAGGCAGACAGCTGAACGGGATTATTTCAGCGCAGAGAGGCTGATCATGCAAACAACATGGAAGGAACCCAGAAGTATTAATGAGCAGAGTGCCAGATATCTAGCTAGAATTACCGACCCACCGATGGCGACTTCAGTGCAATTATTGTGAGCAATACACAAATCATTCCATAGAGATATAAACTGTAGAAGTAATAAACCGAGCAATCCGGTTACGAATGTTTACTTAGGTTTTCGGTTTTAACAACAGTTTTCTTAGGCCGCCAAATTTACCTGCACATCGACAGGTTTTCTTTGGTTACAATTCCAGAAACGAAAGAAATTACGTGATGGTTTCCTTTGGTGCTACTTAGTGCCGTTGTTTGAACAGTAAACGTCTGTTGAGCACATCTAGTGGTAATAAGCATAGAGCGCAGTAGCGAGTAGCATTTCATATGTTATTCCCGATGCTTTTGAAGTTTTAAGAATCGGGGTTAGTGTAGAAAATTAAATCAAACCTAAACAATGAGTTGAAATTTCAGTGTTACTGTTATTAATTATGTCAAGTGAGATGAATCGTCATTGTACTTCCCGGATTAACATAGTGTCCCACATGAGGTGACTATGAGGAACTTCCTTAGGGAGTGTTGTAGAGAATAATTGCGTAAACGACGATGCACAGGATTTATAGGGTCACGTATTTGCATTACTTAGCGGCCGCGGTGCTCAACTTCGCCGGAGAGGGAGAAACGAATACAACGTGCAAACGATAGTGATTTAGCGTGGAAGATTTGTGTAGTGTTTATGAATGAGCAGTAAATAGTAATGAATTATCAAATATAGTAATATTTTATGTTATGTTCATGATAAGTTGTAACCCATCGGAAAACTCCTTAGTCCCAAAGATTTTCCCTGTATTGCTGAAATACTTTCTGGTGATTTTGCATCTATCATAGACGTTTCTATAAGATGCGTGTTTCTGTGAGAATTTAACATTTACAAAGACCTTTTAAGTCCTTGTTTATTAACACGGTGTTATCGTTCTATACACGATGTGAAGAATATTATCTGCTAGATAGTAATATAATGTGGATCGTTGTGACGTTTAGGTTCAGAATAAACTGCACAATTCACAGTCTAATCTTCTTTCGCATTGATCGAATATTTCTTTAAATGGCATCTGAGCCATTGGTAATGACGGTCAGTGATAATGAGGGCGCGTAGTTTGCATTATCAGGTCCGTTTTTATCGTTCACAATCTGTTGACTCTCCTTGTGTTTTGTTGGCTTACTTTATGTCAAATATTAGGAATGTTTTCACTGCTACTTAATATTGGTTGCGTAACAAAGGTGCGGTCCTTGCTTAATGAATTCTCGAGGGAATACAACCGCACCATGCTGTAAGCCAACGTGCTCAAATCTTCATACAGAACAGATTTGAAGTAATATTTTAACCGCTTAAACCAGCACAAGCGCGTGGAGCGACAAAGTGAATAAAGAACAATCTGCTGACTTAATCCTCTAATTCCGTACTTCGTGTAAATATGCTTAATAGCACAAAATTTCTATGAGTTACCCTGATGTTGTAATTGCATGTAGAACATAAGGTGTCCTGGAAGCATTCAGAGCAATTGAGGCAGCGTTGGTGAAGCACGAATAATAATATGAAGAGGATTATTCCCTGGTGGTTGACTTGACACCATAACTGCTAATCATTCAAACTATTTAGTCTGTGACCAGCCAATACGCAGTTGGTCACTGTCAGGAAAGTGGTAAACTGCAACCCAATTACTATGCAATGCGCTCGTAATTAAGTGAATTTACAATATCGTCCTAGCGTTAGAAGAGAACGCGGCCATGTTCATTCTTCATCATTTTAATTACTTATATGCTCTTTCTGACGTTAGGTCTCCGACGGCAGGCTTCAATGACCCAGCAGGCCGAGAATTCCCGGACCCTTTGCTCAAGAGCGATGTTAATTGTTCAATCATTTGGTTGGAAGCGGATGTGCGGGTCATGTTGTTCTGCGGGTTCTGTTCGTCTTCTTCGTTGACATGAGGTTGCCCCGTATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTACGTTAAGTTGACTGCAGATGTCAATTAATACGATAGCTGCGTCTATAATTGATTATTTGACGTATTTGATGGCTTCCACGCACGTTGTGATATGTAGATGATAATCATTATCACTTTACGGGTCCTTTCCATTATTAAGCGTGACAGCAGGATAACGCTTTCTTTATTAA
>141
GTTCTTGCTTACTGTTAAGCTGATAATGACATAAATCCGTAGGATAAAGAGGCAATAGTCCGTATGAAGGTAAAGTTAAACGATGCTGATTGCCCGTTCTTAGGGCAAACGCGGTCTCGTTTTCGTCTCGTCGCTGGCAGCCTCCAGTCAGAGCACAGCGGCCATAACGACGATTCACGGACTTGTGAACGTCAGCGTGGTCTGGTTATTGAGCAGCAACCGCAAGAATGCCAACGGCAGCACGTCGGTGCCATCCGCACGCAACCAGGTCTACGTGAGTATAGAGTCCAGCAGCCGGGGGTCATATGCAGCGCAGTTCGCAGCATCCGCCGAGTAGGGATTTGCGGTATGAGCCGGGTACTGTCCCTGCGGCTGGTACACCGTAAAGGTTTCTTTAGCGTCATAAACATGCTTACTGGTGTTCAGCAAATCGTTAGCTAACGGCAGTACCATGCCGGGTTGTAGCTGCAGACGCTAGTCGCTTGCCCCTGCATCACACCGATCCGAGGCCCGTACTGCGCTTGCACTCTGTGGTGCTGCGGCCGAGAAGCGGAGCGTTTTCACGGTCATACAGCGGTTTCTGCCAGCACGCGCGTTAATTTCTTGCGTCCGTGAGCCTCCTCCGCAGCAGTTGACTGAGGATCCCCATAATGCGAGCTATTTCTTACCGCAACCGCTTGCGGTATTGGTGCGTTCCTCATTTAGGCTGCTCCGCGCTGGCGCGTTCGCCCCTCCGTCGCTGGCACCACGTCAGTAACGTCGCTGCGAATGAATCACGGGCTGAAACAGTTGTTGATCAGTACGTCTCTTACATGCGCCTCCGGGTCAGAGACGGGATTTACGTCGAGCATCCAGTGCATTACGCCGAACTGACGTGATCGCATCTAGTCGTTACTGTTAACAAGTTCATAGAGTCCAGCATCACTCCTGAATGACAATCAATGCAGCCTGGGTATCCAGCACAACCTGCACTAAATCAGGCTTCCCGAGACATCTGCAAAGTGTGCGTGCGGCTTAGCGACTGCAGTTGTCTCCCGGACGTCATCCGGAAGATGAGCGTGACGCCCGGGTCCCGTAGATGCATCCGTAAATCCCGTGAGCGTGATTTCCACATCTTAGTTTCTCCAGCGCAGCCAGCATGTAATTACCGTGAGCCATCATGACCGCCGGATGGAGCCGTGCGGGCGTCTGCGTGACCAGAGACGCCGGGAGGGGAGCTAGGCAGCGAATACTGCAACTACCTACTCTGGATTGCATTCGTCTTTGTTGTGCAATTTCGTTACTACTGGTTTTACTTTTAAGGCACACGCGAGCCCGTTTGGTTACCTAGGCATAAATCCGCTTGCGATACTATCCGCGATGCGTATGCCCCCAGGATCGATTTAATATCACGAACCCCGTACGTCCACCATCGCTCCACTTAGCCTGGCAGCCTGTTGCGGACGGGCGATAATGCTCGTTGTAACCGGTCATCCCCAGGGCTGCAGCGCCGTCCGGCGCTAACCAGCGTGCCGGACACCGGCAGGAAGCACGGCGAGTGCTCCGTTCTATACTGATGACTGCGTGAGGTCGTGGTCTTTAGTCATGAGCCCCACTGATAATGCCAGCCAGTTGGTAGCGAGTGCCTCCTGGGCAGTCAGGCTGTCGCCGACACCGCATCCGGTTCCACCGTAATGCACAGCCTCAATGACCGTGGCACAAAGAAAACCAGGCGCATAGGCTATTCAAGCATCGAGCTTAAAGCGGTTAGTCGGCGATATGCGGGGAGATTACCGCAGCTCTGCTGTCACTCTTCTCCTCCTCTATGTTGATTGTTAGCAGCCCGGATTCATAAATGCTGCAGCCCGAGGCAGCCGGGCGGTTTAAGAAGCGAGCAACGACGGCGCCTCGAAGCATGATTCACGACCTGAGGGCAAATTTATTTCCTATACTTGGTCACGCGTTTGCGCACTCTTTCTCGTAGGTATCAGTTATGAGCCGTTTAGTAACAAGTAAGCCCATTCCTATGAATATGCGTCTTTCATACAACCATGGCCGGATAGGCCAATAGTACGAATCAGGGAGTCGCAGTTCCCCAGGCACTGCCGTTCCTTCGATGACAAACTAGCACGGTCGTTGAAGGTAACGTTACCACGCGGCGAACCATCGCCTCTTCCAGCCACAGCACGAAACATACCTCTACCGCCTGACGGATGCGACGAATTTCGCCGCCCCATAAAGTACGCCCACGACTCGTTCGCACTGGCCGTGGCCGTCAGGCCTCATCTGGGCGTGCACGGGGGAAGCTGCTCGTACGAGACACCCAGCCGAGCAGCGATACCGCAGCAGTGACTGCTCAAACACGATACTACGGTTTATCCGTATCCTGAGCCGTCTGCAGGTTCAGTCAGTACCGAGCATCAGGTTAGTTACTCTATTTTGCCTCCCAGCGCTAGCTGACACGGTGCGAGAATAAGCCGCGGCAATTTTCAGCCCAATCTAAGGCTGTCCTTTCCGCTGCTCCTTGACTGTTCTCGCCAGAAGAATAAAATCAACCGCAACAATCATCCAGACGCTGAAGCGTGACTGCTCAGCCAATCTAGGCTACATTCCGCACAATGACAGCTCTGCACTGCGTGTTCTGCACCGTGTCGAGCACATCTTCATCTGCTCCCACTGTAATCAAAAACACATTTGCACCCCGATGGTCTGCTCTGCCCGTCCTCCACCACGCTATTCCAACGTGGATACGAACGAAACGAGGCGCCGCCGGGTACTCACGGGGTATCCAAGTCCATTTCTGCGGCATCCGCCCGCTCATACCGTCCTCGCTGACGTAATATCCCAGCCGCCGCACCGTGTCATTAATCTGCACCGACGACGGCAGTTTCCGGCTTTGGATGTATTAGTTTGTCCTCGGTTGATGCGCTTTCGGCTGACCATCCGAACTGTGTCCCACGAAGCCGCCCGCACGAAGCTGGGCGACTCGGTTTGAACGAACAGTTCACCGTTGAAGGGCGTGCCGGCCATAATTCCCGAATCATCATCAGCCCGTAACCGTAGATTTTGCTCAACGACGTCAATGCAGCAGCAGTCATCCTCGGCAACTCTTTCCATGCCGCTTCAATCTAGCGCGGGGAAAGGCACGGTGGCTTCTTCTCTCCCCGATGCCAGATAGCGCCCCGCTTGGGATGACCTCTACCCTACGAAAAGACCCGACGATATGATCCTGATGCAGCCATTGAGGCGGCATGAGTTCGATGAGATTAGCGGCACTCGCCAATTCGTCAGTGGGCAAATCGTTAGAGCCATGCCGCATTCCACACTCACTAGTTGGGCAGCCGACGGTGAAACCTAAATTCCTTAGTCGCTACAAATGGACCTCCATAATCGCCGGTAAACCGGCATTACTCGGGATGCGCAGCGATGTCCATGCCGTCCGTAAGAAGGGGTGGGAAGTGGGGCGGTCGCCAACAATCCTGCATTACCCTGCGCGTCTCTTCGATCGACTGCCGTCTGACCGACTTCCAGCTCTGCAATATTTTTCAGGTCAAGACACGAAGTGGCCGTACCTCCACCCTTCGTCCGTCTTTCTCTGTACTGTTGCCGCCCCGTTTACCTGTCATCACAGTATGCAGAGCGTGCCGCACGGGCAGCGGCAAGTTCTTCGTCTCTCGTCATTCATCGGGTACATAATAAGGCCCAGCGTAATCAATTGCCAGTTCTTGTTGGTTTGAGCATCCTCCTCTTCCTGCATAAGCCAGCAGCACTGAGATCCAGCTGCCAGCGGGAAATACTGATCGCCGAGCCGCCCGCATAAACGACTGAAGCATTGAGTGCCTCATTTGCGTCTGACTGGTTTCCTCTTTCGTACCACAGAGTTTTCCTGCCATCCACCATTTTCGACCTGCTCTTCAGCAGTCAGCTGCTGCTAGCCTTCGGTTAATCAAATATCCGATGGTTCGGGGAATGAACGACGCACCGGCGACCGGTTCATCCCCATTCGAGTCAGTGGCAACCGTCTACAGTAAACCTGTTCCCGGTATCTTAGTACCGATTTCGGTAAGGTAAACCCCGTTTGTTTCGGTCTAATTATAGCATCGTAAGGGGTAGCTTTCCGTAGATCGATGCTTTAATGGGGATTATAGCGACGCCCATGTTTTTCGAGCAGTTCACAATGGTCCTGTGGGTCAATCCACGCCAGTATCCAGCAGATCTCGATATCAGACATTTCTGCCTCATTCACCATCCGGGGGTATAGGTTTTATTAGCCTCATCATCCACACGCAGCAGCGTCGTTCATCGTCGTGGCGGCCATAAGTAATCTGCCGCCGGTCATAATCAGCCAGCTTTCCTCACCGAGCCCATCTAGAAGCCCCCATTTCGTAGCCTTTTGAGCTCGGAGTCGATACCGGCGTCAGCCTAAGCCACACGTCATACGAATAGACGGGCGCTGAATAATGCTCTTTCCGCTCTGCCATGGTCCACCGTCTCGGGTCGCATTCTTGACGCCATTGCCTCCAAAGTCTCACAGGCACCGTGGTGTTTTACGAACTTTTTACGTTCCGCATCCCTTTCGTTCATCCAGTCTTTGGACAATCTGCACCCGAGGTGGTGAACGGCTGTACGCTGTCCCAATGTACAAAAGGAGTCACTGTTAGTAGCTCAATCTCTTCTACCGGCTATCACGAAAACCAGAGAATGCCATCACGGGTCCCATAGATCCGGTCTTCGCAGATAACCGCATACCAGTAAAGTCCATCGTACTCCCAGCTTAACGCAGGCATTATGAGCCGCCCGATAAACTAGCTGAGAGTATATACAGCGTCGGTGATTTGAGGCCAAACGTCTTCTTTGTCACAATTTAAGACTGCTCCTCCCCGCAATGCGGCAGGCAACATGAAAACGCATAAATGCGGGGATTCACTGGCACGCTCAATGACAGGTGCCTCGTTTGTAGCGTGAGCCACGGATGACCTTTGTAAGAAAACGAGCCCCTTCAATACGTCGCTAGGAGCTTTGACGCGAGCTCTTCCTGTTCAATATCATCATAAAGCAGCAGCAAGTTCTCATAGTAAGCCACATCCACCGACTTTTCACTGGTAACGTGCCCGTTGACCGCCCAGCAGCCAGAAGCCACGCCCATTAGTGAAGCTCCCTTCATGGTGAGCGTCTTTATCCCGGTGCTTTGCCATACAGAAGGGCCGCCAGCAGCGACGAATATCACGAATAGTCGGCTCAACGTGGTTTTCAAAGTTCTCGCATCTACCATCCGTCGGCATGACCAGATAAGGGTGCCTGCTGCTCTATAAAGTAGGCATAAACCGAGCAGCATTTGGAAGGATTGACCGACACGGCAGACTTCGCCATTCGCCTCACGATGTAGTCGCTGCCCATCGCATTCAGGTGGCCCGCTGAAAGGGCAGTGTTTCCCAGCGCCGTCACTCCTGCGGAGGCGGATTCTTTCGGGAGAAGGTAGATAATTGCAGCATCCGCCCATTCAAACGGCGTCTTAGGCTCGCATCAGCCCTGAACAGTACGAAGCCCGGCGCGACAAATCCGCAGCGTAGATCTACCCTGACTGTTAGACTTCACTCAGCAACCCCGGGATATCAGTTCATCCCGCGCGGCTTGCCTTTGTTCGACCGTTGATACTATCCCGTTCAGGAATTAAGCAAATGTCGGTTTCCAGTTCTTAAACGCATCCGCATGCACCGACAGGGGAAGCCGCGAGAATACTGGCATTTCATGCGATTAGCGACAGCACGAATGAAAGTACAGAATGCGGTTTCCACCACTTCAGCGGAGTCTCTGGCATTCTTCAGTTTCCTGTGCCTTTAGCTGCGTCGGGCGCACGCGTAAGTCGATGGCGTTCGTACTCAATAGTTCCTGGCCACTCGAGTCTGCCTCGGCCTGCGCAGTTCTTCAACCTCCGCTAGCAAGAGCTTTCGTTCTCAATTTCAGCATCCCTTTCTAGGATACCGTTATTATATGACGCGGCAGTCATAAAGCACCGATAGCGTGATGCCAATGCGCGCATAAGAACGGGCATTCCGATTCCTGCCAGTTCTGAATGGTGACCTAGATACTCACGCACGAAGGTGTCAGCCAGCTGCTTTTGTTGACTTCCATTGTTCATTCCACCGACGGACAAACAGAGAGAAAGGAACGACAGGTCCAAAGCCGCTTTCATAGACGGGTGTCGTTTCCTTCTTCGTTAGATGTTTAAATAAAAGCATTAAGTTAGACCCTACGAAGAAGAACGAAACGCCTTAAACCGGAAATTTCATAAACTAGAAAACCCGCGAGGTCGCCGCCCACGTTCTGTTGTTGA
>142
TGGTGTTAACCTGCCGTCGGCCGTTTCTGACGAAACGCCGGAGCTGTGGCCAGTGCATTCACATGTGCTTCAGCCGCGTTTGCTCACGAAGGTCGATGCGGCAACAAATCGTTGTAAATCCCCGTAAAGGCAGATGCGCGCCATGCCCGGTGACTCAGGGAGTGTGTGCGTGCGCCATTGTCGGTGTACCTCTCGTTTGCTCAGTTGTTCAGGGAATATGGTGCAGCACTCGCCTTCCCCGAGCATCTCCGGCATTCTGCATGCAGGCAATGAACAGGCCAGCAGCACATGCCCGGCTGTGCCCTGACAACGATGATACAGCCCCGTCGCCTCCATAATTATCCCATAGAGATTCTGTATGATTCTAAGAGTCATCCTCACCGATGAAAGTCCGGCATCTCAATCCCACAGATGATAAGCATCCCGGAACAGTGTGTAACAGTCCGTCACACCGTGCTCAAAGCGCCACGCCGTGAGATGCGGCACATAGAACTTATGAATCCTTTTGCCCCGGCAGACCAGCCACCACGGCAAATCACTCTGCATGCAGCCGCCGGTCGGCCTCACTCAGCCGACGAGACCACCGGGGCTCGTGACTGCGCCACAATCTCACCCTGCATTTCTGCCTGCAGCCAGTCTTCCGGCGACTAGAATACAGACTGGACACCTCCCGGCTCACCGGAGATATTCACGCAAGGGAAATATTTCCCCCTCCGGCGTGCTTACCACGAACTCGCACGACTCCTAGCGCGAGCACCGAGGCTTGTGCAGGCATCCGCGATTCTGTCTTCGGTGGGATTTACTGCGAAAGTTGTTAATGGGAAAGGAAGCCGCCAAAGTCTCAGGACGTTATTGCGGAACTTACAACCGCTCAGGCATTGCTGCATTTATCCTTCGTGATATCTAACGTTGGCTGGTCATATTCATCCGCGACAGCCGGACCCCATAACCGCACTCGTCACCGCGATAGTCCAGGTGCAGGTGTTGAGCATGATAGCCGTTACAGGAAAGGCCCGCCATCCGTTTCCTTTGGAGCAATCAGTCAAAGGAGGCACTCACCGCTCAGTTCGCTGCACTGCTCAATGCGCCAGCGGCTGATCACCTCCTGCTCCGTACTGAGTAATGTTTCCGTTGACGAAGTTCACCGCATCCAGAAAACGGGCGTAAACCTTACGCCGGACCACCGTTCCCACGACCACTCTGCATATCTTCCCTCATCCGGTGACCATACCGTGTAAGGTTAGAAACCGTCAGCGTGGGCCGTACTGGTGCCTGTTGCCATTCCAAATTCCGGGCAAAGCCGAGGATAGAAGCCTGGAGGCCCTCGGCTTCTCCCTGCCAGGTGACCGGCTCACTTTTCGTTCTGCTCATTACAGAAAATAACGTTCTCCACCGACCTCTGTTAGTCGATTTCCACACTAACTGACCCTATTAACTCGCACGGGTGCATTCATTCAGTGTTTCCTGCCGCTATCCTGCATCAGTTCACCACCTGTTCAAACTCTGCTGAACTCAACGCAGCATACTGACCGCGACGACCATTTTGCGCAGGTCACTTTATCTGCCGCCTCATAAACCGGCTGGGCGTCCATCACAGACTGGGATTTCCAGCTCCCGTGCTCTTTTCCAGAAACGACTCCAGTACCGTGGCCTCCTACGCACGGAAGGGCGTCACGCTTACGTTCAGGTGGCATTCAGCCGGCAGGCGCCTAGCCCTGAGAATAGCCATCAAAGCACCTTTCTTACAGAAGGGACTGAAGCCACATCCATACCGGGTTCACTTTCCATAGGAAGGTCTTCATCGTCTCCTCGGAGAGCACCGAGGAGCTCGGAGCCTCTGTACGCATTGCCGCATGGCACCCTTGCGTAAGTCATACACCGCCTTCCAGCAGCCGATCTACACCTATCTGCCCGTTCGTGCCGTCGTTGTTAATACACATGGTTATTCTGCTCAAACGTCCCGACGCCTGCGAACCGGCTGTCTGCCATGCTGCCCCTTGACGACATAACCGCCGGTGAAGGCCGCCGCGCATCAGCCGTAACAATTCCCCACGAGATCCGGCCTGTGCCTCCTTCCTTGCGGAAGACAAACTCACCACGTGAACAATCCGCTGGCTCATTTGCCGCCGGTTCCCGTAATTCCTCCGGTCCAAAATGGAATTTCACGCCGCAGCGGCTGAATGGCTGTACCGCCTGACGCGGATGCCGCCTCACAGACAGCCCCGCCAATGGCGCTGCCGATACTCCCGACAATCCGCCCATTGCCTGCTTAAGCAGAATTTCTGTCATCATGACAGCACGAACGGGTGAAGCTGCGCCAGTTCTGCTCACTGCCGGTCGCCATCCACGACTTCTGTGCACCGAGCAAATATGCGGCCCGGCAAGTTAGAACTGGCGAACATGTCCGTGGCTCTTCCACCTCACTCCAGCCGGACTTCAGCCTGCCATCCAGTTCCCGAAGCTGGTCTTCAGCCAGGTCTTTTCTGCTCTGACATGACGTTATTCAGCGCCATAGATTGCGCCATACTGTTCCTTCAGGCGCTGTTCCGTGGCTTCCCGTTCTGCCTGCCGTCAGTCAGCCCCGGCTTTCGCATCAATGGCTGACACCGTTTTGCCCCTCGTTGCTGTGCGAATTTATCCGCCTGCTGCGCCAGCGCGTTCAGGCGCTCCATGATACGTACTTGTCGCCAAGTGCAGCCATATGAGTTTGTACTCCAGCGTCTCATGTTATGCGCCAGCAAGGATTTCGTGCAGACAGCTGGCGACGTTGCGCCGCCTCCTCCAGTACCGCGAACTGACTCTCCGCCTTCCACAAATCCCGGCTAGCTGCCTGGCCTGGGTTTTCTCTCATTTGCTCCGGCGGGCGTCGCGGGGTCCGCGTCGTGAACGAAGCGTCAGCAGGAGCAGGCAATTATGCCGACGAACTCCGCAGAAGCTTCACGCTGGACTGTTTCGGCTTTCACGTGCTTCATAATCCTTTCGCCGCCGCCATCAGCGTGTTGTAATCCGCCTGGCGCACCATTTTCCCGTCTTTCAGTGCCTTGTTCAGCGTTTCGTCTCCTGACGGGCTTATTTCTCCAGCGGCGCGTCTGCAGCTCCGTTCGTAAGCCTTCTGCGCCTCTTCGGTATTTCAGCCGTGACGCTTCGGTATCGCTCTGCTGCTGCGCATTTGTCCTGTTGAGTCCTGCTCAGCCTTCTTTCGCGGCTTCAGCAGGCAAGACGGGCCTTTCACGATCATCCCAGTAACGCGCCCGCTTCATCGTTAACAAATAATCATCCTGCCCATTCCAGATGTCGTCTGCTTTCTTATACGCAGCCTCTGCCTTAATCAGCACTCCTGCTAGATTATCGACCGATATCCAGCACCGCATCCACATGGATTTGAACCGCGAATGCACCTTATGGAGAGCTCCCAGGATTCGCTGTCTCTTTCAGGCGGCGGGTCTAGTCATCAACTCATTTCGTTGCGGCCTCGTTCCGCCTCGCTGCAATTGCCCGGCTTCATCACCTAGAACGCTGCACTGAGCAACATACGCAATCTGCCGCCCACGTTATGGAACTGGGCTCATCGCCGTCAGCCCCGACGTCGGGTCTTGGTCAGCTTCCCGAAGGCTTCAGCGACCTTGTCCGCCTCCACCATGCGCATGGCGCCTAAACGCCACTCTTAGCCCAATCTGACGGCAACCTCTCAACTGAGCTCGGTCTTATCTTATCTTAAACTATTTATCTAGTTTCCAGCCTGACCTGTCTGGTTAAACGTCAGCCCTGCCGCCTGCCCGGCTCTGGACAGGACCAGCATACGATCTGCCATAGTCCCGCCTGATTGCCGGAAAGGACCAGCGTTTGTTGAAATCGACGGGGGTGGGGTGGCCGCGCTACGAGAGGCATACGCGAGCAGCGGTCGCCCGCCAGCGAGCCCACCATCGGCAGGGTAATCGCACAGGGCAAGCCCCTGAACATGGGGCATCATCCGCCGAAGGAGTCCTGCCTGCCCCCTGTTGCTACGATCAGCACGGACTTTGCCGCCCTGCAAGCCTGCGTGGCTTCACGGTGAACTGTGTGCAGGCAGCATACGCATGGCGGCTTTACTGCCCGACGAAATCCCGCTTTCTGTGCAGCCAGCGCCGTGCTCAGCACTGTTCACGACATGCCTGTTTCTTTCGCATCACTTTCCGTACAGAAAATGACGCCCGTACTCTGGCCATCTGCTCGTCAAATCTGGCCCGCATCCAGACTCAAAATCAACGACCAGATCGCCTACCGGTTCAGCCATACCGACTCCTCCTGCGATCCCTTCTGATACTGTCATCAGCATTACGTCATCCTCCGTCAGTCGAGCAGGGAGGGGGAACGGGCGGATGCGATCCGTAGGGACGCACCTCCGGCCATTCCTGCCTTTCATGCATCAGCACATCATCTTCAGCTCTTCTCGTCACTCCCGGTTCAGCGACTGAAATCCAGCGGATGCATATCCGGATCTCGCTGAAAAACAGGCTTATTCCACGTCAGCCCCCGGAAAAGTGCATATCCAGCAGAACATCATGAAAATAATGGGTACTGTAAAATCCTCAGTTGGCATACTCCGTGAGCTTGACATCCGGCAAGCATGGCACGCCAGTCGGGTCTCCCCATCGCCGGCCAGTTTCAAGGCAAAACTCAGCTCACGTTGAACATTTCCCGCAGAAACAGGCTCTGCGGGCGTCCGTCCTCTGTCTGTTCAGGGCATTATTCACCACAAACTCATACAGACCAGACAGCCGGTACCACTAGTTCAGCATGAGAAATTGCCTCCGTGGGCCAGGTGAGCACTTCCTTAGCCGTGTTTGACGGCTTCATTCATGGACGGCATCTGCGTCTTCTGCATGGTTATGCCGCGACAGAAGGCGAATTCAACTCCGTCTTTAAAGCAGTCGCTCTTCCATTTAACTTCTGTATCTACTCCGCCTGTTCTGCCTGCCGTTCATCAGCGCGAGATGCTCAATGCGCTGCAGGGCTAGGACAGTTCAGAAGGCGGAATGACGGTCACCCGTTATGTTCAAATGAATTCGGTTTTCTCATAGAACATCATGACTCTCCGGATTAACTGGCTGACGGTAATTTCTGCAACCGCAGCAAAACTCACCATTACCGGATACAACCCGGAATGTTGATTGCCTGCAGCAACGCCGTTCACGGTGATGGTCATACGACCGACACGGGCGGCTTTTATCTTAAGAACACCGCACGAAGGCCCTCTTGTCGGTTACGCCTCCGGCTGGAAGGCCACGGTCAGCGTGGTGATGCTTTCGCCCTCACCGAGGTGCTGGCACGGCGTCACGTCATTGCGCTTTGCCTGTCCGTGCTGCGATCTTCTGCCATCGACGACGTCCCACATTAGACTTGCCCATTAGATGCGTGGCGTAGAAGCGCCTTACCGATACTGCTGGTACCGACAGCCATCTAATAGTCCGTTCGGGAAGGCATTTATAGAAGGTATCGCTTCATTAAACCGCCAGCACCTGCATGCGCTGCTGGCCGGGCATCGCCCGAGCGTGGAGCTGGTACAGGCGGATTTCTGCCCTGCCCATTCCCAGCGCCGGTCCAGTCTGCATCTTCATCATGAGATAGCTGTTATTTATAAAGTAAGCGTCAGTTCGCCGGCGTCAGGTCTTTAACTTTTGCCTGAGACCGTCAACCGTCCGGCAGAGAAGTTGGACAGGCAGCTAGGACACCGTAGTCACATCAGTACATCTAGAGACTTTAAGCGGCTACGTTGAGCGGCAGGTTGTAGCATTTGATACACAGCAGCGTCTATAGGATGTTCACTAAACATAAGATCTAAATGCATCACTTAAGCCCATCGTCGTCGCCCGGTAGTCATAGCCCTGGCTAGAGGCTCTGGTGGATCTAACAGGGATACTAGAGCTCAACCCCTTAGATCCATGGCATCCACCATCCAGCTCTACCAGTGAGCATAGGTACTACAAGCGAAGGAGATATTCGATATGCGACCTGCCATATTAGTTTTAAATTCTAGCCGTGTATTCAGCCGGTGAGATAAACGGCGGGCCGCAAATCGCAGCCATGAATACCTAGCCATAAAGGCGATAATCAAAAATAGTCGCGGTTAGATGCCTTCTCCAGTGCATCCAGGTTACCGGGCGCGTTTAGAATGATATGTTTGGACCTGTTATTACCATGAGTTGATGCTGCAACCGACTACGATATTCAGGAGCTTTTAACAACTTAAGCTGATTTGTTAATATAGCGTGGTCAGAATGAGGCCATCAGGCGTCACAGCCATGCTATAAGTTTCCCAGCCTATAGATGCGTAATGCGCCGGCTTTTCTAGTTCACTGAATAAACACGGGAGTGAGCGAGGGAATCTAGCGAAGAACCGAGTTACAGAACTGAACCGTTACGCCCCTGCCTGAGGCCCCGTAAAACTAGGATCACGCAGCTTATGCTGAAAGTACGCCCGCGTTATTTATTTATGTAAATCGTTGTAATTACCGCTTCTAGCCTGGCCTTTCCTTTACCAGTTTTAAGCGTGATTTTTATAGTCGAGCCTGTAGCTCCAGATATTTCGAGGAAGCACTCCAAGGTGAAGCAGGACGCGGTTCTTTAATACCCTTTAAAGCAAAGCGGCGATGAGAGGCCCTAAGTTTGCAAGTGGTCATAGGCCTTTTCAAGGTAGTAGTCATCTAAAGCTTTTAACCCACTAGATACGCCGTTGAGCGGGGTACGTTATAGCGAAGGCGGTGGACACACCGGTTCCGGCCCCCATGGTAGACCGTCTAAACAAACCCTCCCATGTAACCCGATTATGAGAAATTTTCTACCATGATGGTGTCGCCTTTACCGCCTGAAACTGCCCGACGCTCCGTTAAGACAAAGAGAAGGCGGCGTCCAGCGCAGAATGTCCACCGCTATATATTTCGGGTCATCAAAAACAAGGTATCAGCCGCTAACTTACGGCCCCACTTACTGTAGCTGACGTTCCCATGTACCCCGTATCGTTTCATCGGCTAGTAATGAAGTGGAAGCAGTGAAACAGTTATCGAAATCAGCCACTAGGCCTCCCGTTATTGCATTCTGGCCAGCGCTCTGTCATTTCGGCTGCCACACCGATAGAGACAGAAGCCCGTTCTAAGCAGCACAAATTGCCACAGTCATCCGCGTGGCGTGAAGTCGATAGTATGCAGCTGTCACCGTGCCAAGACTAGATAGTCCGTGACCGTTTCGGACCCAATCGCTTATCCAACGGTCGGGCCTACCGGTTTCATGTCCGTTAGGCCTTTTACCAACACACTCAGGGGGTGTTAGTAGTACGGCAGGCGCGTTAGATACGATTCTATCTATAGCCTCTTTCAAGCTGGTCAGCTAGGCCAGTTCTTCTTTCGTCCCCGTCAGTAGCACCCTAAGGCGTACGAGTTAGTGCCCAGGAGGAAGGGCAATCGTTACTTTTATTTATACTCCAACACAAGAAACAATGGCTACGAGACTACATGATCCCCAGTTGTACCAATCATCATAGATCACTAAGGGGGCGATGAGCAAGTTAGTATGAAATCGCATGGCTGGCCCCGCCTGATCGCCTTATTATAGAGTTCGGACCGAATGAGCAGAGGCGTTAATGCCTTCGCGCTTTACGTCCCGATGCTGAATGCGGACATGCCGAGTAGTGGACCGTGCCTGGATGTTTATCCCCAGACAGGATTGTTGTCCGGCGAGGCAGTTCTTTTACCGCGTTCGTAAGGTCACCGTTGAGGATACAAGACAGTAGGATAGCCATACATCCTAGTCGACACATTTGCCCCAATCTTTCAGAGTTATCGAGCTCGGAGTGCCAGCCTAAAGGTACAAGATCTATTATATAGTTTGCGAATAGTAGGACGAACCTTTCAGACACGTGAACTAGGCTAGTCCCCGAAAGGCAAGTTAGGCTTACAGTCACATCGTCGGTCCAGGGCTCGTATAGTCGTATTTATAGTTAACTAGGTAGATTCCACCGGGTCCAATCTGGTTATTTCTCTACTGCGTAGAGTGATAGGGCCAACCGTACCGACAGTCACGGTCAAGTATGTATTTGCTGTAAAGAGGGCAGAAACTGCCTGCGATATTCTATACGAGTACATGGTCGTGCCCGCATGTTCTGCGACCATCATCATGCGGTGAAGCGATCAGCCAGTGCTCAGATTCTGCGCCACTGCCTCGTATGAAGCAGGCAGGCAGGTCATACTTATTAAGCGTGCATATTCATTAGTCGGCTTGTATATCCCAACATCCTGTCAAGAACAGCCCCTATAGAGGCCCCACAGGAACGGATGATAGCCACGAATAATCGTGAATGGTACATAGGCCATGTTATACAGTTAGAATTTGTAGAGATAGACTTTTGGCGTGTGAGGGATAGTAGGCCAAGGAAAGAAGGCAGCACAGCGCGAGAAGTAAAGAGCGTGGCGCCAGTGCCCATCAAGCGTTGGCGGTTGTACATCGACATAAAAATCCCGTAAAATAGAGCACAGGCGGCCTTTAGGTACTTTCCAGCAATAAAAGTCATATCGATTAATATTGCGTTTAAGCGGACGAATGGCTCGTTTTCGTCCTTTAGCTGGAGCCTCCATCAGACAGCATCGAGATACAACGAACCTGTCGATTAGAATAGATTATTACTGTTCTTCACTACCAACCGCCGGAGGATCCGGGTAATCGGAGCTGTATCCATCCAAGGATAACCAGCTTGAGCTGAGGTGTCCAGCATCAGCGGGGTCATTGCAATAGCATTCATATCGGCAGCAATCCGCTGAGGGGTTTGCGGTGTATGATAGGGTCACTGTTGCCCTTGGGGTAGTGATGGGTAAAGTTTTCTTTATACGTCATAAACATCCGTCACTGTGTTTACCAAATCGTTATAGAAGGCAGATATCCCGGGCTGAAGGATCGGTTCTTACCCCGTGAGTGCGCGCGACGATTGCTAGGCAGGTTGCTGCGCTTGCATACTGTCGTAGTGCGGCCGATCCGGCTGAGTTCGACCGGTCATCGGGGGTTCTGCCAGCACCGTTGCTGTTCTTCGCGTTAGTCCTCTACAGTTAGAATCCCCATCCGGCTGTTCTGCCCGCACCCCTTCGTGATGCGCGTTCTCCGTCGGGTAGCGCTCGTTCTCGCTACCGTCTACTATAATGAGGCCCTTTAGTAATAAGTAAACAGTCACTATGCGGCGGTATCTTGGGGCCAACCGGTTATTTGAATTGGATCTCTGTTATGCATGTCACCACTACGGGCATCGGATTGCTCGTTAGATACAATTAAGCTCATAGGATACCTTATCCGCGTAAATTAGTTTAAGCATGTCGGTATGAGTCCACTGAATGACATATCTATACGTGGTAAGTCCTTAAACACCTGTGGGGGCCATGGGTCAGGACACTCATTATGCAGAGTCGAAAGGGAACAGGGTAGGGAGCTGGTTGAGGCGTCAGTCAAAT
>143
CCGCGACATCTTTTTACGACTGTCACCAAAGTCGTTGTTGCCATCGGTTCCGGCCCCAAAGCGGCACATCGCTCTGCTTCCTCACTGAGACGCTAAAGCGACCGACTGACCATACAAGTATGACTGAAGCCGGGTCGTAACTGCAGCCGTGGGATGCGCCTGCCTCGTCGGATGAACTCTTGAATGCCAAGTTACCTCCGTTGACGGATTTAAGTCAGAATTCTAATATAATTACATCCACTCCCATAGAAGTAGTAGCCTGCAATGTCTATTCGGGTAAGGTTAGTTAAACATTTAGACCATTAGTGGAGTACACAAAACTAACTGGGCGACTCGTAGCAGCCTCATCACACGTTTACAATTACTATTTAAAGCGTGATGTTGGGATCCCCGATCATCTAGGCTGTAATTATAAAGTAAACTAATGGTTGTGAATAAGCTTGAACTCCAATCTTAAGTTGGAAGACCAGTCAAACGGTATTTACGGTGAGCTTGAACTCTAAGGTGCGAGTACGACGAAAATGCTATCTTGCCTAGCCTGACGGATGGCAACGATCCAGGCCTGCATTACTGTCGTGATCGGAGCTATACATGAGATTTGAGGTGCGATGCATGACGCATAAACCGCTGGATATGAGATTGATTTGGTCGAAGCGATGGCAGTGGATACTAGACTTGGAGGAAGTTAGACGTTAGCCGTGTCAGGGACAGGTGAACTATTTTCTGAATAGGTCGTCTTAAGAAGTACGGCAGCCGGAAACATATACAAGTATTAGTAGCATGGTCAATTAAGCAACCAAGGTGAGACATTACTAGTTGAATCCGTGTGTCAATGGACGAATACCGAGCTACAAAGAATTTAGCTTTGACAATGTATACGTCAGGGCAGTACAGGCGGATGGATGAATAAGAGTGCGTCTTCCATAGATCACTGGTATTAGCTTAATCCAATGGACTGTTCTATACAGACAGAAAGTAAAAGTCACAACAAGTCCGTCAAAGCATTAGAAACAGCTAGCCATCTAGGCGTTGACGCGCAAAGTAATAGTCAATGGCTTCGACAATCTAATCCGGAGCGCCCGCATCATCTAATGGGATCTAAACGCTTTAAGCCTGGCGTAGCATGTTAACGGCGTGTGCTGGGAGCATCGGACTGGAAGCTCCAAAGGAACCTAAACCTCGTTATTATTGTCACCATTACGGCCGTGACCAACTAATTCGGCTGGGGTTAATCCAAGCATAGTATCCGTGCGTGATAAGCTCGTAAATATCGTGTGATCCATGACGGAACCAAAGAATGGAAGATAGGTTAGGCTCACTAAGACTGCGCCTTTAATGTGAATTCTAATAATGGAGCGACGCTCTTGCGTTCGACGGATGTCAATGTGCGAAAGTTGCCTAAGAATGAGTACCGTAAACAGGCGTGCATCATGAAGGTGTTAACGACAGACGGATGAAACAAGACGGGATCAAACCTGAGGATTTACCCGACCGTTTCCAACCGTGTAGCCATCGATCGGCCGTAGACTGAAAACAAGCCGGCCTCCCTAAGCTAAGAAGCGTATTGCGCTCGATTAGGAAGTTAATGGGCTCTAAGTGCCTGGCCTCCAACAAATTAGTGAGACTGTTGACCGGGTGAATAGCATTAATTACGACTCTGGGATAGCGAATTAATTAAGGCAACGGCCGTCTTTGTTCACGGATGGGGACATCGTACCGGAAGCCCGTTACGGCGATTAATCACATACAAAGCCGTTAGTAACGTAATGATCACGATAGTACACCGTGAGGTCTATCAATTCACACATTAGAGTAAATGCGTGGGCTCTTTGACATGAAGTCAAATGAAATCAGATGCTTTTTGGAAGGTGTACATGGACGGGTTAGTTAGCACAGCGATGCCGGTGTAGTATTAGTAAGTACATCAATGTAATCCTGTGACTTTGACGGACGACCTTGCTGGACTCGTTAGCTCCATCAGCCATGCAGGATCCTCTAGTGGGACTCCTGAATCGATTAGATCTGAATTTGTAAGCTATTTGTGCACATGTGCATTGTTACGCTGCAGACGCTGTTATGCGGGAGTAAGCCGTTACGGGTACAGCTCTTCGCCTGAAGGTCGGTACCTGCGACGGGAAGGTCTTAGATGGTCAAAGAGACTCTCCGTTAAAAATTGACGCGAGCCTGCATCAGAATGGTTATATTAAGCCTATGATTAATGGCCAGATGACGACCGTACTAAACACGGCTTCCTCGTACGTAGCCTCATTCTTTGGAGATAGGTTGCAGCTTCTAGGATCTGACACGGAGATGGAATGAGAGCCGGTCGCGTGACGCGGCAAAACCTATATCAACGGTATGAAGACGGGCGACCCACAATGGGAAGGGAAACAAGGAGCCCAAGCCTATCACATTTGGTGCGTAGTCCAATCTGCTTCCAGCAGAATGAATGCTAAGCGACGGTTGAGGAAGCCTTGAGTGAGTTCGTCATGCTGAATGCGAGTGCCTCCATGTGCACCGGTGGCAGAGAGTATGACGGAAGTCAAATCGATCTTAATCGACTCATCACAACGTGCACGCGTACAATGGAAGGAAGCGAGAATCGCATAAGCATTTACCTAGATGGTCTACGGAACTGTATCCTTACAGATACAACAGATTTAAGTGAGAGACAATGGAAGACTCGGGCCTCGGCCTCCTTGGATCTTTTCTAGCCGGCCTATAACTCCGATGGGGTGATAACCGTTAACAATTCTCGTTACGGGTCATGATGATCACCATAGTCGACCCTCGAATCATCCAAAACCACTAGAAGGCATGAGCGCGTAGTCTAGCAGATAGGGTTAATGACGTATAATGCAGCTCTACGACGAAATCCAGCGGACTGGATACAAGCAGCAGCGTCACGGTTCTTAGTGCGTAGACGGATGCGGTCGGAAGCACTACTCAGCCGTACATGTCTAATCAAACGCCCCGACTAGGTCCCACGGGAGTGAAAATGTGACATCGGTACGCGTAGTAAACCGACTTTATCGCAGTCATCGCCTGCTGTTGACTGAACATATGTGCATGGAAGCCTGTCGGGCGGGAGAAGGAATGAGAAATGAATATTATCGTCATCGCATGTGTATGTTAAGCAAGAAAGACAAGCATCCTGTGCTATCCTAAGCCCAACGGTCCGACTTAGTAAGAGTAATGAAGAGACATGTGTAACTGCGGAGGCAATTATCTTAAGCGGCCTGTTATTGAGAAGAAGGTCATCCACTTAAAGACATCGACTTTATCACGCCCACCCATCAGGTCTTTCCTTCGAGACGCTCGAATGCTCGCCCGTTCTACACAATTGCCCGTTGCCATAACCAGAAGCAGGACTAAGCGTAGTTGCTCATCGTACCCTGAAAGGTCATAAACCAACCGTAACTTAGCAATCGAAGGGAGTACGTACAGATAGACTCTATCGTCTTTGTATGGTACTGTTCGTTGCATGGGGTCACAATTAAGTTGACGCTCTGCCTGTAATAGCCTGAAGCCCAGAGAAGGAAGACTTAATCCGATTGCCTCACTAACGCTAAGACATAACGACTTAATAACTAAGCCTATGCAGGTCTATGAATCAGTACTGCTATCTTATACTGCAAGGATCTAGGTGTTGTGGGAAGGGAAGTTCTAAACAGGAGCCGACCGCTACGCGAGTGCGTACAGCTTTGTGCGGCTAAGCTATAAAAGCGACTCATCCAACGATGCATGTCACTGACAGCAGCTCCTTCTTTCTCGTCCACTGTTAAGCCGACATTAAACCTTCCTAACGGACCGGTGTTGGGACCAAGCCGCGGTACACCATCCTCTGCGACTCCCGCATTAATCCTATCGGTATTAGTATGCATCATTTAATCCGCTCCTGAAGACGCCGTTTTGCATCTATGCATTGGCATCTACTCCGTGCCCCTGCAGACGCCTGGACTAGTGACTTAAGGAGTGCGCATAGTGGAGCCTGGCCGATCGATTCGACGCGTCAATACAATTTGATGGCATCGTATGTAACGGAGGTATGCACGATGCTATCCGCAGACCGGTGCGCTTTATTTTAAGCCACTTAGGGTGACTGTCCAAAATGCTGTGTGAAGGGACTGTCATGAGTAAATAAGGCGTCACGACCAAATGGTTGCAGTGATTCCGTGTTACTTTGACTTTGGAAGCTGTGAGATGAATGTTAGTTGGGTTTGTGATCTAGAAGAGTAGCCTCATCTTCTAGGTGACGCTCGTGCGTGATAAGCCGATGTTTCCATCCAGCATCTATGTTGACTTAAGCAAATCTCGGCCAATGGTTGGCAGGAAAATTCCGTGCTCTGGCCGCTGCACTCGATTATAAGGTCAAATGCAGCGTTTATAAACCTCCATCCGCAGCTCTCTTTCGATCCTCGTTCTAGTGCACTGATTCAAGTCAACGGTTCCACTTTTCGTTACTCCGCATAGCCGAATGCGGCTCTATTCTATAACGCTTTGGGTGACGTTAATTCTATTAAAAGCGCCATGATTATGCTTTGACGGCGCATCCTTGACGCCAACGCCTCAATTTGAATGGAGTGATTGGTGCTATCCATGAGATAGATGAGTATGTTTATAACATAATAATAGACATAGTGGATTCACGAATATTAAAGAGCTGAATATTTCGATCATGTTTAAATTCGTTAGATTAAAGTTATCCTTTTACCCTCACGAGTAATACAATAAGGTACTAGTGATTTTTATGCTCCGTAATCAGATTAATTCCTAATGAGCACGCGATAGTCTCCTTAGGATTAGTCCCATTATTACGTGTAGAAGGGTCGACTAGAAGGTGAGGGTAAACACATGAGTAACCATAAAACTTTCAACTCTATCCATGTACCTATCATAACATGTTTAAAGGTACTCGATTAGTATGAAGCCGTCATGGAAGAAACGGGCACCTGTTTAGGTATCTCAGAAACTTCATCGACTGGATTAGATTGTTTGGTTACTATCGCCGTGGTAAACTTTATTCCAAGGTCATTAATTTATTACGATGGGCACGATTCCGTAGTCCAACTTAGAATAGGAAGCGACTTACCTAATCAGCATGGTACAATAATTAAGCCTTTCTAGAAGTAGTACAGATTCCAAAGTGATGATCGCAGGTCCTCGTCGGAGGCTCGTATCCTCTCGTTAATGCACATAAAGGTTAGTGGAAGGCAATAGTCAATGGTTTGATGTGAAACCTGTCGCTCCTATGTAGAAGTCCGTTACTTTGCCGACGTCTTAAACCATCTCAATTAATTATAATGGTACTTTAATATGGATCAGGTCGAACCGTTTAGGAAGGCATCCGTTAAGTAGTATGAGACTTTACATAGAGTGGCTGTAAATACGTACGCATAGTGCGAAAATAGATGTTAGCTAAGTAAGGTTCATCCTTCCCTTTACGCTACTCGACTCGCAATATTAACTAGCCTTACGTAGATACCTACAACTTATAGATATGTAAATAGTCTGTGAATAGTAAATTAGTACAGCTTTATCCCATAGTACAGCCTAACTCTAAACCTATTACAGATGGTGTTTATACGACTTAAAGGTGTCAGTTGACTATAGTGGTCTACTTGCGGATGGTACTGAATTTTCCTACGTACCTACTCTTAATTTAGTCCATCAATTAGACAGACTGGTTCCAATATGAGAAAGTCATAAGTTCGCCCAGTAATGGATATAATAAAGCGATTCGTAAAGACGTAGACATTTGATGGCTGATATGCGATAGAAGGTTTGATTCCAATAGTACGTTATTCCATTAAGAGCGAAGTGGGAGCGGAGCTCCATCCTTTCGACTATTAGTAGTCTAATATCGTCACAGCGGGAGCCTATTGGAAACTGAATATTTCGTAATTATAAAGGAACTCCGTCGGCCCAGTAGTTCTAAGCCGTACGATTGCAGCCACTGTAAAGTACGTAACATTTAGATGGTCACGAATTATTAAGCAAAGATTGCCGTGTAAATAGAATATAAAGGCATTTTCAGGATACCAACTTAAACGCAAATCGACATGTAGGATAGCTCCAATATTTGGGAAAGTTTTAGGTCTCAGTAACTTACTATGAGTTCGTACTAGCAGGTCAACTATTACGAGGTATGAATGAACCAATAGAGGGACGTTATGTTAATGGATTCCTAGGAGGAAAGTGAGATCACTAGTCACCATCTTGCTTAGAAGTGTAGGGGTCTCATGCAAAATATGTAATTAGTAAACGCGATCACTTCACCTAAGGTACGTACTCAGCCTCCACCACGTCCTGTAAATAGTTGCGGCCAACCTATGAGCCAATTGTTACCTAGATCAATAAACTCCTAATTTAACCTATATTGTAAATGTTTAATTGACAATTTATATTTGACAGTAGTTAAATCAATATGTACATGTAGTTAACAGTTTACTTTGGAAGCAACTTATAAACCTAGTCCATACCTATCAATAGAGGATCCTGCTGAAGGCGGACCTTTGACACTTGGTAAACTTAAACAGTAACATTTGTAACAATTATTTTATAAATCCGTGTACAATCACCTTTATAAAGCCAAAATAGCTTTATGTGAATCCATAAAACCGTACTAGAAACGTTATCTAGTAATGTTATGTTTCATCCATGATGCTTACTATACATGTAAAGTCTAGGACCCTATAAACATTTACGGCAATACAGGCTACGACTGTTGTCATGTAAATTAGACAAATGTAGATGAAGTTAACTAAGTGAAAATATTCACTTAA
>144
GTCGTGCTCTATAATGACCAACAGCACGTCTTCTGAAACGCTTGCTGCAACGCCAAAGGCGGTTAAGGTGGTAATGGATGAAACGGAACAGAAAGGCGCGCGCATACTGGACAGAGTCCGGCACTGACCGCGGAACTGCCAACAGCACCAACCGCGCTCCGGGAACAACAATAGATGGAGATTGCAACCGGTCGTTGTACTGGCCGCGATTGCATAATGTTATCGACGCGTCACCTGACGCACTGAATACGCTGGCAATGAACTCGCCGCAGCGCGCTCGGGAATGATGCTCCAGATTTTGCTACCACCACGACTGACGCGCTTGCGGGTAAAACTGACCTGAAGAAATGCGACACTGACGGCGCTGGCAGGGCTTTCCACGGCGAAAATAAATTACCGTATTTGCGCAATGATGCCGCCAGCCTGACACGCCGCTGACTCAGGTTGGCAGGGGATATTCTGGCAAAATTCCGTTGCAGATGTTCTTGAAGATGGTAGTCGGGGCTGCGAGAATTCGCGGCCTTTCCGGCAGGTGGCTAGAGTCCCGTTGTACATCCCTAGGGAGAGGATAGAATATCGTTCCGTCCGCTACGTCCTGATGCAGGGGCAGGCGTTGACAATCAGCCTACCCAAAACTTGCTGTCGCGTATCCATCGGGTGTGCTTCCTGAATGGTCCGAGCTAACAATCAAGGGGAACCCGCCAGCGGTCGTGCTGTATTGTCTCAGGAACAGGATGGAATTAAGTCGCACAGCACAGTGCACAGTCACATCCAGTGGGGGACTTTGTAATAGGGAGCCAACGTAGAAACAGACAAGGTAGTCAGTTGATTACGGGACGAACGACAGGAACAGTTCGATTAAGCCAGACAAATTGATCAATAGAAACACTACGGGGCTCATTGTAACTAAGTTGGCACTAAGTTCAACAGGGCTAAGGTAGCCATGCCACACAATGGTTAGGATGAACAGTTCTGGCTGAGATAGAGTGGAACCAGCAACCATTACAGGAAGTTATCCACAGTTAAATAGAATACAGGACAGAGGTATTGCTTATTTATCGAAAACGGACAGTTACTAGAGGCAAGGCCACAGTCACTCATTGTCCGGTACAGCCGTGAGTGCCGGTGCACATGCAGCATACCGTTATTGGTGCGCACCAGCAATCCGGTTGTTATCGGTGCTCATGCCCATTCTTTCAGTATTGGTTCTAACGACACACCATCACCGTTAACGCCGGTAACGGAAAGCCACCGTCAAAAACATTGCATTTAACTATATTGGAGCTTGCATAATGGCATTCAGAATGAGTGAACAACCACGGACCATAAAATTATAATCATCGCCGGAACTAATGAATTTATTGGTGAAGGTGACAGCAGCATATTCCGCCTCATACCGGTCTGCCTGCAAAACAGTACCGATATTGCACCGCCAGATATTCCGGACTGGCTTTGTGGCTGTTCAACAGTGATGAGGCATCGATGGCTAGGCAGCCTTTGAAGACCATACACGGGGGAGCAACCGTCTATGACGTGGCTTCCGGCGACGCGTGCTGTTATTTCTGAACTCGTTAGGTTACCGGAAAATTTTACCCTGGTTATCGCCGGGAGGGAATAATAGAAGTGGAACGGCACAGCCTGGTCGACGTACCGAAGCAGAAAAGCCTGTTCCGGATCCGGGGAGGCGGAAGAAACAAAAGCCTGATGCGAGGTAGCCAGTGAGCATATTGCGCCGCTTCAGGATGCTGCAGATCTGGGGAAATGCATACGAAGGAAGAAACCTCGTTAGCTGAAGCCTGGAAGAAGTATCGTAGGTGTGCTGAACTTAGTTGATACATCAACTGCACCTGATATTGGCTGGCCTGCTGTCCCTGTTATGGAGTAATCGTTTGTAGTTGCCGCAGAAACGTCTTGAGTTGAAATAACGTTCCTGCGGTTAGTCGGGCTATTGTAAAGCTGAGTATTGGTTTATTTGGCGTGATTATCTTCAGGGATAATGGAAGTTCAACCTCTGCTACTCTTGTTCATAGTTTACATCACCGCAGAATTGCTTTTAAGACTGAACGCATGAAATATGGTTTTTCGTCATGTTTTGTCGAGTCTGCTGTTGATATTTCTAAAGAGCGAGTGTCTCTGCTTGCCCCTAATTGAGAGGCTCTCCATGAAGTTTTTGGATTATTATTTGAATCAATTCCAATTACCTGAAAGTCCTTTCATCTACGTGGCATTGTATGTATTGGTTATTGAATAGATGCTTGCTTTCTGAGCCATAGCTCTGATACCCCAAATGAAGCCATAGGCATTTGTTATTTGGCTCTGTCAGCTGCATAACGCCAAAATATATTTATCTGCTTGATCTTCAAATGTTGTATTGATTTAAATCAATTGGATGGAATTGTTTATCATAAATTAATGTTTGAATGTGATAACCGTCCTTTAAAAAGTCGTTTCTGCAAGCTTAGCGTATAGTCAACTAATTCCTTCGTCGAAGTATATTTTAGGCTTATCTACCAGTTTTAGACGCTCTTTAATATCTTCATAGGAATTATTTTATTGTCATATTATCATGCGCTAACCCATCCACAATTTGCTTATGTACCGTAATCTTTTAATTTTAAATAAGTCATTCTCCTGAGCCGTCAACCATAAAGGCCCGTGAATGATGTTGCGAAATCACATCGGTCACCCATTGAATGTTTATTTGTATGCCAAGAGGTTACAGCAGTTATACATTCTGCCATCAACATTAACTAGCTAAGGCATGTAATAATTCGTAATCTTTTAGCGTATTAGCGACCATCGTCTTTCTGATTTAATAATAGATGATTCAGTTAAATATGAAGGTAATTTCTTTTGTGCAGTCTGACTAACTTTTATACCAATGTTTAACATACTTTCATTTGTAATAAACTCAATGTCATTTTCTTCAATGTAGATGAAATAAGAGTAGCCTTTGCCTCGCTATACATTTCTAAATCCGGCTTTTCTATCGTATTGCGAGAATTTTAACGGCCCAAGGGCCATTAATGGATCATTTTCCATTTTCAATAACATTATGTTATACCAAATGTCATATCCTATAATCTGGTTTTGTTGAATAATAAATGTTACTGTTCTTGCGGTTTGCTGAAGAATTACTGTCAAATTCTGCCCGAAATAATAATTCAGGGTCAAATATGTATCAATGCAGCATTTGAGCAAGTGCGAGATAAATCTTTAAGTCTTCTTTCCCATGGTTTTAGTCATAAACTCTCCATTTTGATAGTGCTGCATGCTAGATGCTGATATTTTAGGAGAGGTAATAAATTAACTGCTTAACTGTCAATGTAATACAAGTTGTTTGATCTTTGCAATGATCCTACCCAGAAACCCAGTAAAGCGATACACAGTGAGGAAATTTTTAATATTATTGTATTATCATTTCATCCTTATTAAAATTAGAGTTGTGGCTTGGCTCTGCTAACACGTTGCTCATAGGAGATATGGTAGAGCCCGCATAAGCACGTCGTATGCAGGAACGTGCTGCGTTCGGCTGGCTGGTGAACTTCCGATAGTGCGGGTGTTGAATGATTTCCAGTTGCTACGATTTTACATATTTGCATGGCGCAGAATTTGTACCACCTCTCCCCACCGACCATCTATGACTGTGACCCCACCTGTCCCTAGGACTGCTATGTGCCGGATCCGGACATTACAAACGTCCTTCGGTGCATGCCACTGTTGCCGCCAATGACCTCTTAGGAATTGGTTAGGCAAGTTACTACCGGATTTGTAAAACAGCCCTCCTCATAAAATATTCGTTCACTTCCGATAAGCGTCGTAATTTCTATCTTTCATCATATTCTAATCCCCTCTGAAAATCTTCCGAGTTGCTAGGCACTGATACATAACTCTTTTCCAATAATTGGAAGTCATTCAAATCTATAATAGGTTTCAGATTTGCTTCAATAAAATTCTGAATCGGGTGCCTGAACGTTGCGGTTTGAACTATTTCCTGTAATAATTTACGAGGGGTTTCTGTTGGTAATCACTTCACTCAAGTGCTTCCCTGCCTCCAAACGATACCTGTTAGCATACTTTAATAGCTTGACCGTTCGATGAATGAGCTCTGTTTGTCTTCCTGCCTCCAGTTCACCGGGCATTCACCATAAACTGATAGCACCCCGAGAGTTCTCAGGGGAAACGAAATTGCATATACCCATTGCTCACGAAAAATGTCCTTGTCGATATAGGGATGAATCGGTTAGTGTACCTCATCTACTGCGAAACTTGACCTTTCTCTCCCATATTGCGATAGCGGCACGATGAATTACCAAATTAATAGGCATCACCGAAAATTCAGGATAATGTGCAATAGGAAGAAAATGATCTATATTTTGTCTGTCCTATCACCACAAAATGGACATTTTCATGATGAAACAAGCATGTCCATCGTAATATGTTCTAGCGGGTTTGTTTTATCTCGAGAGATTATTTTCGCATAAAGCTTTTCTAATTAACCTTGTCAGGTTACCACTACCAATTAGAGGGGCTCAAGAGGGGCTTGTCCTGTCGTAGGTAAATAACTGACCTGTCGAGCTTACATATTCTATATTGTTGTTCTTTCTGCCAAAGTGGGGAAGTGAGTAATGAAATTATTTCTAACATTTATCTGCATCAGCCTTCCGAGCATTTATTAAGCATTTCGCTATAAGTTCTCGCTGGAAGAGGGCTTTTTCATTGTACTTTACCTTCATCCTCCTGTTCATTATCATCGCTTTAAAACGGTTCTACCTTCTAATCCTATCTGACCATTATAATTTTAGAATGAATGGTTTCACCGGAAAGCTCTGAATCGTAACGACTGCGATAATAAGTGGTGGTATCCAGAATTTGTCATTTCAAGTAAAAGCCTCGCACGAGTTAAAACTCTAAGTTCTCACCGAATGTCTCAATATCCGGACGATAATATTTATTGCTTCTCTTGACCGTAGGACTTTCCACATGCAGGATCATTTTGGAACCTTGCGAGTACTACTCGGGGAATGAGTCCAGGCAATTAGTGATGCTACACCATTGCGTGCATCGAGTAAGTCGCTTAATGTTCGTCAAAGCAGGAGCAAAGGTAGGCTGCAGATGAACCTCTGGTTCATGAAGCAACTAATGACTTTTCGCCAACGACATCTACTAATCTTGTGATAGTAATATAAAACCAATTGCATGTCCAGAGCTCATTCGAAGCAAGATATTTCTGGATATTGTCATAAAACAATTTAGTGAATTTATCATCGTCCATTGAATCTGTGGTTCATTACGTCGTACTCTTCATATTTAGAAATGAGGTATGGAGGTTCCATATATTTGAAAGTTTTCATCACTACTTAGTTTTGATAGCTTCAAGCCAGAGTTGTCTTTCTATCTACTCATACAACCAATAAATGCTGAATGAATTCTAAGCGGAGATCGCCTAGTATTTTAAACTATTGCTGGCAGCATTCTTGAGTCAACATATAAAAGTATTGTGTACCCTTTGCTGACGGGTCAGGTTGTTCTTTAGAGAGAATAAGGATCAAATGCACTAAACGAAACGAACAAGCGGGTCACGAAAATATCCCTTTGGGATTCTTGACTCGATAAGTCTATTATTTTCAGAGAAAATATTCATTGTTTCTGGGTCGTGATTGCACCAATCATTCCATTCAAAATGTTGTTTACCACCGAGAATTCCGCCCGTAAAGCATGAATGTTCGTGCTCGGCATAGAATTAACCTTCTAAACCATAGTTAAATCACTGAAATCCGGGAGCACTTTTCCTTATTAAATGAAAGTGGAATGGTGACAATTTTCTGGCAAACCATTTAACACGTGCGAACTTCCATGAATTTCTGAAAGAGTTACCCCTCTAAGTAATGAGGTGTTATAAGGACGCCCTTTCATTTCAATGTCGGCTAATCGATTTGGCCATACTACTAAATCCTGAATAGCTTTAAGAAAGGTTATGTTTAAACCATCGCTTAATTTGCTGAGATTAACATAGTAGTCAATGCTTTCACCTAAGGAAAAACATTTCAGGGTTGACTGAATTTTATCTATTAATGAATAAGTGCTTACTTCTTCTTTTGACCTACAAACCAATTTTAACAGTTTCCGATATCGCATTTTCACCCATGCTCATCAAAGACAGTAAGATAAAACATTGTAACAACCAAAGGAAGGTAGTCATTCCAACTCCATCTGCTCGTAGGAATGCCTTATTTTTCTACTGCAGGAATATACCGCCTCTTTCAATAACACTAAACTCCAACATAGTAACCGGGGTAATTTATTAAATAACCGCAATTGCTTTATTTGGCGGCAACACAGGATCTCTCTTTTAAGTTACTCTCTATTACATACGTTTTCCATCTAAATTAGTAGTATTGAACTTAACGGGGCATCGTATTGTAGTTTTCCATATTTAGCTTTCTGCTTCCTTTTGGTGATATCCACTGTTTATTCATGTTGCATGGTGCCACTGTTTACCAACGATATAGTCTATTAATGCATATAGTATCGCCAGGACGATTAGCTCTTCAGGCTTCTGAAGAAGCGTTTCAAGTACTAATAAGCCGATAGACCTCACGACTTCGTAGCCATTTTCATAATGTTACTTCCGCTCCGGCTCATAACACAACATTCACTACAGTTATGAGAAGGGGTGCATGCTGGGTGTGGGGAAGTCGTGAAGAAAGAAGTCAGCTTGCGTCGTTTTTGACATCACTGCTATCTTCTTACTGGTTATGCAGGTCGGTAGTGGGCACAAAGCTTTGCACTGGATTGCGGGCGTGATTAGCTTCTCTGGGTCATACCGATGCGACAGGTTTGATGACAAATTAGGGCAAGAAGACAAATCATTGCCTAGGGTGCAACGCTCTGTTACAGGTCACTAATACCATCTAAGTAGTTGATTCATAAGTGACTGCATATGTATGTTGTGTTTTACAGTATTATGTAGGTCTTTTATGCAAATCTAATTTAATATTGATATTTATATCATTTTGATGTTTCTCGTTCAGCTTTTATACTAAGTTGGCATTATAAAAGCATGCTTATCAATTTGTTGCGACCCAAACAGGTCATCAGTCAAATAAATCATTATTTGATTTCAATTTTTGTCCCACTCCGTGCCTCTGTCATCACGATACTGTGATGCCATGGTGTCCAACTTATGCCCGGAGAAGATGATCTTTCTAAACTTATCGCTTATTGCTTCTCCTCAGTTGCATACACAACAATCCGCAAACGCACTCGTGAAAGTAGGCGTGTAATCCCCTTCGAAGGAAAGACCTGATGCTTTTCGTGCCGCGGCATAAAGCCTGTGATACTGTGCCGGATGAAAGCGGTTCGAAGGGGTCAATGCAATTATAGTTTCTCCGCCAAGAATCTCTTTGCATTTATCAAGTGTTTCCTTCATTGATATTCCTAAGCATCAATATGCAATGCTGTTGGCTGGCATTTTAACCGCCTGTTTTGCTTTGCTCTAACATAAAGTACCCCATCTACGATATCAGACCACTTCATTTCGCATAAATCACCAACTCGTTGCCCGGTAACAACAGCCAGTTCCATTGCAGGTGTCGGCCAACATGGTGATGATTCTGCTGCTGCTTGATAAATTTCAGGTATTCGTCAGCCGTAAGTCTTGATCTCCTTACTGATTTTGCTGCTGCGCGTGGCAGCGACATGGTTGTTGTTATATGGCCTTCAGGGCTATTGCCTCTCGGAATGCATCGCTCAGTGTTGATCTGATTAACTGCTGACGCCGCGCCTTGCCCTCGTCCTGTATCCATTACTAGCATTGCCGCAATTTCTTTTGGTGATGTCTTCAAGTCAGCATCAGGCAGACCCCTCCTTATTGCTTTAATGTCTCATGTAATTTATGAGTGTCTTCTGCTTGATTCCTCTGATGGCCAGGATTTTTCGTAGCGATCGACTGCCATGAATAGCGTAACGTAACGGAATTATCACCTGTTGATTCTCGCTGTCAGAGGCTTGTGTTTGTGTCACGTTC
>145
TGTCGTTGTGCTTTCCTCAGGTGTATGTTATTACATCGTCCCATAGGAAGGTCCGGTCTAATACACGGTCTGAAGAGCAGGGATAGAGCCGTAGCCGTCGCTAATCATACTGTTACTTCTGTAAAGCCCTGACGGTGACCGTATAGTAGTCGCTTTGCCGTAGTACAGTCAATGGATTTGTTATAAGAGAGCCGGCATCATGTATAGATCAATGCCCACGCCAATGAGATGCGCGTATGACAACAAACGGAAGAGAAAGCGATTCTGTAGCCTGACGGGGCTCCGTAAAGCCGTCATTAAGCGTCAAAACTAGCCGGATCTTGCCATCGCCAAGCCTGCTTGATAATTTTACTGCTATATTCTAGTTACACTGATTCAGATAATACAATAGACTGTCAAGTCAGTACCGTCACGAATAGTGCTCGATGTCTGACGCTTATATTTGGAAGGCCATGGCTCTTCCACAGTTTAAAGTTGGCTTAGCCGTTTTAAGTCAAGTCCGTTAGCCCGCTTCCCATCATCGAGCCGTTTGCCTAGTTTGGTTGCGATTTATCTAGCTGCCATAGGCGTCGGCGCTGATACCTGACTATTGCCCTGCCAGCTCCGTTACTCAGCTTCTCATGTCTATCCAGCGGAGTTACTTGCGACTCCATTCTTCCGTCCTTGGTGAAGTGATCTGCCTAGTGGCCACCTAGCTCAGTGGGGAGAAGAGGAAGGGCCAAGTCCGATAGGTAGGTTTCCGTCTCACATCCTTGGCCAGCATAGATTTCCTAAGTCGACCATGCCGTCGCTAAGGCGACAGTAAGCGCCTGTCTTCGTAAATCCCCGTAGCTTAGCTAGTATTTTCTACGTCAGCCGTGCTCCTTCAGCCTGTAGTTCTAGCCGATAGCATAGATTTGATCACCTTCCACCATTCCGGAAGTGCCCATAGGAAGGAGGTTCGTCTTCATGATGAATACTCTTTCGCCATCGCGATCTGCTGCATACATTTCGTAGGCCTTCTAGCCTGGTGGACTGTATTTGCTCGGTTGTTGCCCGTCATCTAACCTGCTGCGCGTTGCTGTCCGTGACCTTCTATTTCCCTGAGGCCTTCTAGCGCTAGGGCCTTTCACGTAATACCAGTAGCGCGATCATCGTTATAAAGCTGACTCATGCGGAAGAGATCGTCTTACACGCGATAGTAGCTTGGTAATCAGCGTAGCGTAAGTTCCCCTCGGTACAGCTAAGGATCCAAGTGATTTGAATGCCTAGCATTTATGTCTAGTCTCCATAGTCGCTGTTAGTTGTCAGTAAATTATTGAACTCGCTTTCGTTGCCTCGTTCTAATGCAATCCCCGGCTTCATCGCCTGAATTAGCAACTAAGATACACGCAATCGCAGGAAGTAACCAGTGAAGCCGGCCATTTGGCCACCGCGACGTCGTATTACTATTCCCATAAAGTCTTCAGCGGTACTTGTCAACACGGATCAGAAACGAGCGCTATATATGAGTGACGCAATCTGGACGCCCCTTACCCCGCTAAGTCGCGTTCCCTGGGACTTCTGGTGCCTTCAGCTTAAAGTCAATAAGTAAGGCTCAGTCATTGGAAGGAGGGAAGTCAATAAGGGTAGGTAGAAGGTAAGGCGTCCGTTGAGATCGACGATCAGTTACATGACGCCAGGCAGCCAGCGCCATTCTCAGGCTATAGCCCCATATGGATCTAATAGAGCAGCCCTAAGCTCGAATGGGCCCGACGGGAAGTCCTTCACTGCCCTAGTTGCAGCAGTAAGGTTTACGGGCACCTGCAGCCTTAAGTGCGAGCCATTCGCCGATTAAGACCCTTTATACTGCCGACGAAATCCGCCTTTCTGACTTATTGCCTAGCCGACTAGTTCTAACAGACTGTTCATGCCTGTTGTCGCATCATTTCGTGATAAGAAAATGAACTCTCAGGTACTGCTCGTCATGTAACCGCGATGCAAGCCATCAACGACCCAAGTTATAAGCGTCATCAGGAAGACCAATCCTTTGCTCTGATTCTATCGATACGTGATCACGTTATGTCCATAGCCACATCCGGGGAACGGGGTAACTTCATTCCGTCCAACATAGCATAACGCGACTCCGCAGCCTGCCTTCTGCATCAGCACATCATCTTCATGAGCCTGTCGTCCTCTATCCGCTTCTAAGACCCAATCCGAGCTTAAGCGTAAGTGTGAAAGTACTAATAGATAGAGCCTTAAACATTCATGGAAGCAGAACATCATGAAATAAGTACGTAAAGGCTGCCAGTCGCCGCAATAAGTCCTGGCCAACAGCACTCAGTCAATACTACGATACAGTCGACCAGCTCCAGCTGCTGACGTCCCAGCCGTAAGCGTAAGTAGTGAACATTTCTACTGTCTTTCCGCGGTGTGCTAATAAGGCTCACAAAGCTCACAGAAGCTAGAGCTGAGGATCACGTACCAACTGGCCTAGGCCACTTCCTTAATAAATCTTTATAGTTCATTCATGACTAAGTGCGTCTTGCACATCGTTATGCTAGGACATCGCCAGAAGCGCCGTCATCGAGTCTTCCAAGTAAACTTCCGTTGGTGACTCGACTTTCCTGCCGTTTCATCAGGCGATGGCTCAATCGGGCTGATAGTTGAACAGTAAAAGGAGGAAGGGTATTTCTATGATTCGGTTTTAGAACATGGATCTCCGATGTGACGGTAATTCTGCAACCGCAGCAACGCCCATTACCGATACAACCCGAATGTTGATTGCTCAGACGCTTTCATGACGTGATAGTAATGACGTTACGAGTAAGGAAGGTAACTGTGTTAGTCTAAGACAAGCAACGAAGCTAGGAGAGCGAGGAAGCCAAGTGATACAGGCGTCGTCGCCTTCATTCATTTAATGTTACACGTTGCTGCAGGTTGGTAGATACTAGCCGTCCCTTACTGTTCCTCTACGTGCATGAGTGGTACTATTCCTTCAGCGTCAGCCTTACCGATACTGCTGACGGAGCGCAACGGAACACATCGACCGTTACGTTCGGAAGCGATTTATAGCACGGTATCATAATTCATTAGGAAGTGCCTCCGGCCGCCGTGGATAACTGGAGAGCGAAGGTTTAGCTTAAGATGCGCGGTCTAGTCGAGTGTTATGCATCACAGCTGTCATTTATAGATAAGCCGTCAGTCCGTCAGTCCACTTATCATTCTCTTCGCCTCGAAGCCGTCAAGCTCGTTACCAGTTACTCGCGTAGATCTAATAGTCGCCTTGGAAGGAAGCGGCATTGTACATTTGGTAACATAGCATAGCCTTCTACATTTCATAGACCAATAAGTCATAATCTACTACTCCACAAGCCCGCATCGTCGCTTATAGCCTGAGCAGGTATATTCCCAAATTATGACAAGTTGAGCGGATGGCTTACATCTAATAAATCATGGGACTCGATCGGACTAAGTCGACGGCACCTGAGCGGCAGGCAGAAGTTGGAAGCTCCCTTCCACTGTTGACGTTTTGTTATCTTTCGTTTTATTCATAGAGGTCAAAGCTGCCCAACTTACGCATTAAAAAGGGAAGGGCCTCTTCACCGGTCTTACTTGCACGTACGTTATCGCCGTAGGTACAGTCAGCTGCGCGTCATTACTGTTCATCATGTCTAATATAGTCCTTAGACAGACGTTCGAAGGTTTCTAAGTTAAAGCTGTTTATACCGTGTAAGGCCATCGATTTCACAATAGTAAGGGTAGGTTTTCCCAACACTGCATGGAAGCCATTGAGTCTCGCGCCGGGGATTCCGCTGCGTTACCACAAGCACTGCTGCCGCCTTTCAGGACGGCTGCCCTTTACGACGCTTAGGCCTAGTAAGGACATTACAGAGCTTGATCTAAATCCCCCGGTTGACTTTACTTCTATGCGATTTGACCTGTAGCTTTAGCTCCTTTCTATTCTATTTGTCTCACCGTCAGGCGAAACGGAAGCTTATACATATTGAAACAAACGTGAGAGCCATTCGTAAGTTAAGGCGCCGTTTTATCATGATACGGCTGAGGTTCAAAGGCCTATCACAGCTTTTGTTACCGCTCATCCACGTCATAAGCATAGGTCACCCATACCATGCCCTTCCTCGACTAAGAAATAGTTCCTCATGATGAGGAAGGCGTCCTCACCGTATTCACTGTCCCGTAAAGCCGTTTAAACAAAGGACGGAGCGTTCAACGACGCTGTCCTACGATAGCTGATATTTCAGGGTCATCAAACACGTAACCGCACCTTATTAGCCGGATGTAATGGCCTGACGTTCCCATTACCGTATCGTTCATCGGGCTCCGAGCAACTAATTATCGAAGTCTAACAGGAAGTGCCCCGATTGATTGGCCTATGGTCGGTTCTATGCCACCGGCAGACACGAAGCCGTTCCCGGCAGCTAAATCCCACAGTCATCCCCCGTGGCCGTGAAGTCGCATCAGTATGCAGCTTCGCCGCGTGCGCTCCTGCTCGCCACACGTTACTGTAAGAATCACTAGCTTATCGGTGATCCCAGCATTTCATGTTAGTCTAACACATTTCCAGCTTAGAGGTTAGCTATGGAAGGGCATCCGTCATCAAGCTCCTCTTTCATATGCCACTACGGTTCTGTTCGTCCCCGTCAGCTGACATCACGTTCAGTTCACCAGCGATGAGACCGTTAAGTTCATGTTCGTTAGTACTCCCAAGAAACAATGACACCAGGCTCAGTTGTACGACGAACTCATCAGGTCAGCCAGCAGCATCATAGGCCTTGATGACGATCATGAACTCGGAAGTCGCCGATTTCGCGCGTCTTAGTCAATTCTATGGTCGTCGTCCGCATCCTGAATGCAGCCAGCTTAAGAAGCGTGCCTTAGTGTTCCCCAGCAGGTTTACTAAGGAAGTTCTTTGACGCCGTTTCCCACGTACTGTCTAACACGATACACTGGGATATAAGCGTAGTTGGAAGCTAGGTCTTTCTATGTCTCCATCGAATTGAGCCATAACTTATCCAGCTTCTCCTTGACGGTTGAATAGAATGAACGCCCAGCTTTCGGATTGAACACGATATTCATACCGTTACACGGTGGATGCTCTTCATTCGCCGTGTAACTTGTCACCTTGCTCACTCCGTGCCGCCGACTGCGTACTGTTATTCTACACTGCTCCATATCGGAAGGACTACTAAGGTTACTGTATTTGCCTTAAAGCAAGACTGCCTGCATCTCTTTAGACTAATGAGCTCTTCGTCACGCATGTTCTGCAGGGCTTACGTGAAGGCGGCGGTAATGCTAAGTTCTGCTAATCTTCATCCGGGGACGCAGGTCATCTTATCATTCGTTGATGCTTTAAATCATATCCAAGCGTAGTTGAGTGGAGCCGCCACTAGGAAGGATCAAGTGAAATTAGTAAAAATCTGCCGTCGCGAGATTGTGAGGTAGACTTTTAAGTCTGCAATAGAAAGAGACTAAGAAGTAGATCAACTTAAATTTATCATTGCCGCCAGCAGTCGCGGTTGTACATGACATAAATCCGTAGATAAAGGCAACGTCAGTGATGAAGGTAATAGGAAATTAAGCCGTTCCCAAACGCGTTGATTTCGTCTCGTCGCTGGCAGCCGTCATAAGACTCCATAACGACGTGCCGTACGTCAGCCGTGGTCGTGGTCTAGAGCCAGAGTCAGGCATTCGATGCAAGAATGGCACCTTACGGCATGTCCAGCCATCCACTAAGATTATTGAAGGTATAGAGGAAGTCGCGCTTCCTTCCTCAGTACTGTTTAGCTTAGATGGCTATCGTTATTTACTGTCTATCGGTAATGTCACCATGCTTTATACAAACAATCGGGTCAAGTCGGTTAAATCGGTAATAAGTCACGCCGAGTTACTTAAGGTTGAGTAGTCTGCCGGATCACGATCAGGCAGTACGTCCGGCACGGTCTCTAGGAAGTCGTCGTTTGCCCGTTAATCCTAGGTTGCGGGATCCGCCAGCCTGTAGGTGTTCCACAGTGGATCGATGTAGCGTCGCTTTAACCTAGCGTAAGCCTGCCGTTTTCTCCCTCCGTCGCTTAAGGACGGTCATGACTTCACTGCGAATAATCTAGTCGAACAGTTGATTGAGTCGCGCGAGGAAGCGGCTTCGGTACGTAAGTGCATCCATGCATGAATGATCGGATAGCTTAGTCGACAAGTTCATCAGCCGTTGAGCATCAATAGCCTCCTGACCCTTACCACTGCAAGCGTATCTAATCAACAAATTAAGGTAGCTTTGTCAGGGCAAAACATCTTAGATATTGCGTCCGTAATTGGCAGGTGAGTGTCTCCGGAAGGAGTGGAAGATGAGCTTGTGGCGATGCCATCACTTATGGCTGCCTGCGTAAATTATTCCTATAATTTCTCCACAGCTTCCTTCCTCGCCTGATACGATGAAGCTGTCATGCGGTCTGCGTGACGAGGGTAGGCAGCGGCAGCAAGTACTTAATGCAGTTCATAGGTCGAGCCATACGGTTTTACCGTCACACCCTATCAGTAAGGCAGAGGAAGCGCTCATCTAGGGCCATTTAATCAGCCAATTAGATTTAGCACTCATGACCGATAATTATTAGACCAGTGCCGTTTACGTCGCATGAGCTGCGCCGCTTTAAGTGAGCTTTACAACAAGGCATAAAGGCGATGCCGTTCATGACGTATATCGGTGGTTCTTTGTACTTCGCGGGTCGCCTCCTGCTAGAGTCTAAATTGGAAGGAGGGCCCGATCGTCAAGCTGCATTAATAATAAACCCGGCTAGGCGGCCACAGCACTGTCAGCGAACTAGCCTTAAGCGTAGTGGATATTAAGGCGATTAGAGGTATTCGTTCCTCTGTTAAGTGTCGCAGCCGGATTCAAATGCTGCAGCCAGCGGGCGGTCGAGGAAGCTCTAAACGTCCTCTGGACCTATCGCAGGTAATTTCAACTCGTACGTCACCGTTTGCTAATTTCTCGTAGTATCCATTTAGCTTCTATCATTCCCTGTCTTTCCGCTCCGTAAGACAGCTATCCAGTCGCAGTTCCCGCACGGGCTTCAACGAACTATGAATAAAGTCCATGGGGGAAGGTACTAGCCTTCCAGCCATAAGAAACTCAGCCTGACGGGGTGCCGAATTTTGGACGCCCATAAAAGTGACGCCACTAATCGTCGCACTGGCCGTCGGTGAGATAGTCTGAGCGTAATTCAGGGGAAGCTTAGCCAACCAAGCCCAGCCGGCATAGATAGCAGCAGTGACTGCTCAATAGAGCCGTCTTATCCTTGAGGAGGCTAGTTCGCAGATCAGTACCCGGCATCAGGTCGGTATTCCTCCCGGCCGACCTAGCTTCAGTATAAGAAGCGATTTCACCAATCAGCCGTCACCTTTCCCTGCTCCTGACTGTTCCGCCATGAATAAATCTAATAGGTGAACCGTATCCACTCATCAAGGCTAATACATTCGCTGACAACTAGTGCCTGTTCTGCATGTCAGCATTGGTTCGTATAATAGGAAGACAGCGCAGGTCTTGCCGTCCTCCACGGTTCAAATAAATTGAACATGAGGGCCCTGACGCTTATCAAGGGTTCTATTTCTGCGGCATCCAGCCAGAGCCGTCGGCCTGACGTAATATCCCAGCGCCGCATGTCTATTAATCCACCGGCATTTCCCTGTCATGTTGGTAGTCAGCCTTCGGGCTGACCATGTTAGAAAGGTGGAAGCTGACCGACTTATCATGAACGACAGTTCACGTCCACCGTGCATGACATCGTCGCGAATCATCATGGTAACGTTAGTTTGCTCAACGTCAATGCAGCAGCAGTCATCGGCAATCTTTCATGCATGCTTCACCGGGGAAGACCCGGGCTTCCTCCGATCAGAGCGCCAGCTTGAGAATGAGCCCCAAAGACTGGAAGGAGGGAATGGCGTCAGGCATACGTCTGTTGAGTACCAGGTTGGGACCATTTAGGTAAGTCGCAGCCTGCTCCTATTTCCTCTCACTTATTCACGACCCGCACTGTAGCCAAATCTAGATCATAGATTACAGACTTCCGCAAGGCTGTTAATGCCGTCCGTACAGAAGATGAGGATGGTGGCGTTCAACGGAAGAGGAAGTCGCTTGTCATCCGGTCTTAATTCCATCTTGCATATTTTAGTCACACGAAGTCATGTAAACGCTTTTAGTCTTTCTGTACTGTCAGCCCGTCTATGTCATCAGGTCATGCATGCCGGACATGAAGGCATTCTTCCTTCCGCGTCATTCATCGTATACTCCCATGCGTTCCTTATTGCATGTTCTTGCTCCTGCTGGTCGGAAGAGCACTAACCCGTATCCAGCTGCCATAGAAATGATGGATGAGCCGCCAGCGCATAACGAAGCATTCAGTGGTGCCTTCAGTCGCTTTGCTTTAGATATTTTCCTGCCATCCACCATTTCGACCTTATTCATAAGTCTATCCTGCTTCGGTCAATCAAAAGTACGATGTCATATGAGAATGAACTAAGGCGAACAGGTCATCCCCTTCCGGCGTCAGTGTGGAAGGAGGATCCTCTTTCTAGGATATCCGTACGATTTCGGTAATAAACCAGTTTCTATTACGTGACCGGTGGCCATTTAGCGTATACGATTCGCTCCCATTCCCTAGTTTTCGAGCGTTCAACAATGGTCGTATAATCCCGCCAGTATCCAGCAGATACCGTAATTTCCTGCACCATTCCTAGTAGGCGAGAGGAGGAGCCCACGCATAAGTCTGTTCATCGTCTTGAGTATAAGACCTGCCGTCAATCAGCCATATTCCTCACGCTCCAGTACCGGATAGCGGTCACGTCCTATGGAGTCGATACGGCGTCAGTAAGGCCACGGTCCGAAATCGGTAGGTTCAATAATTTCTATCCATCACTTCAGCGGATCGCCAAGTTCTCCAATTTTCACTCGGAGGAAGACGAAGGTTTACGTTTTAGTCCCTTTCCTTTCGGTCTTTGACAATCACGGTGAACTAGTCCACGCTATTGAACCACTGTCATGGCTCAATCTTCACCGATGACCACGAACAGTTACGCCATCACGGGTCCAGATCCCGGTCTTTTCGCAGATAAACGGGCGCAGCGTAAAGTCCACTCCTTATACCGATAGGAAGAGATAAACTAGTGGTCAGCCGTCGGATTTAGTAAAAGGGCGTCTCTTTGACAATTAGATACTGCTCCTCCCCGCAATTAGGGGGCAGTAAACGAACTACAAAAGTGCGGGATTCATGTCATGCACCGTCAATGACATAGTGCTCGCTTCCCGTGAGCTCCTCTTCCGCTCCCCTCCTTCACATCGCTTGTCAGCCAGCGAACGTCGCATAGGAAGGAAGTAAAGCAGCAAGTTCATCATAACCACATGCACGCGACTTTCACGTAGTTTGCCGTTACCGCCAGCATCAGAAGCCGCCCATGATGAAACCTTCATGGCCGTTATCCAGGTCCTTTGCATACAAAGGCCGCCAGCAGCGACGAATATCGCAGTAAAAGTCTATGAATCCTTTTCATAAAGTTCTAGGAAGTACGTCACTGAGGGATAAGATACGGGTCCTTATTATGCTCTATAATAGGCATAAACAGCCCAGCAGCATTTTAGAAGTAACGGGCACGTGCCCCTTCCACCATTAGTTAGCTGCCCATCGCATTCATGAGCCGTCGAAAGGCAGTGTTTCCCAGCTTCTGGTATCGATTTCATAGCGAGTAATTAGCATCCCGTGGGAAGGAAGCGTAGCCGTAGCGGAACAGGCACCTAGCTAAATCCGCAGCCTGTTGACATCTACTTTCATGATATTCACTCAGCAACCCCGGTACCGTTCATCAGGCTACGTGTTCGCTTTATGATATCCCCGTTCAGAATGACATTAGTTTTACCCGTTGGGAACTCATTGAGCGCATTCGAATGGTCGCGTTAGGAAGATGACAATGCTTTTAAGGTCGACAAGGATCTGGATTCTTCCTCGCGTTCCTGTTAGTCTGGGCCGGGCCGTACACCTGATGAGTTCGTTATCAATAAGTTCCTGAGGGAGATCGCTGTGGTGCCCGTTCTTCAACCTCCAATAGCGCACTTTCGTTCTCAATTTCATAAGCCTTCTGGAAGTTATGACGGGCAAGTATATAATCACTAGCTTGCCACCGCTGGACGATTCCTGTTCCTGCCGTTGAATGGTACTAGATGGACGAAAGTATGTCACCGTATTTTGTTGACTTCGGTTGTTCATTCGACGACAAACAGAAGGAACACAGTAAAAAGCTGCTTTCAGCATAGTCTGTTCCGTTATTTCTAGGTAGGAAGTAAGTTATGACAGAAGAAGAACGAACCCCTTAAACTAAATTTCATAATAGAGACCTAGGTCGCCATTTCTTTATC
>146
AACTTGATTAGCCGGCTAATTGTAATCCAACAGTTGTACTTGGACATGTCCACAGTCCACCGGAGGTCACAAATCGCCAAAAGAAGTCGAGGTAAAATGCGGGTCTAATTCTCGTCCCGGAAGCCGCCGCTGAACCTCAATACCGCATTATCACTTCAGCCCCGCAACCGATTCTACGCTGCACCATACGACGTCACTGCGGCCTGTCCGGCGACTCCTATGAGCAACGTGTAGCATAAAGCCACAGCCGATTTTAATACATAATGAATGATAATAATAATAAATTTCCTGTGTAACCTAATTACTCCTACTATGGTTTCTGATACCAGAATCAGTGCAAGATCAAACACTCGTATTACATTGACAGTTAAGCAGTTAATTTATCACCTAGTAAAGAGCGATAGCATGCAGCCCGTAAAATGGAGAGGAATTTACCCAACCGGGGAAAGAATAACTTAAAGAAGTACCGCACTTGCTCAATCCGCTGCACTTGATACATATTTGACCTGAATTATTTCGCTTTAGAATTTGAATCGATTCCCCAAACAAGAACAGTACCTTTTATTATCAAAACAGATGAGATTATAGGATAGAATAACGGGTAATAATGTTATCCAAATGGAAAAGGAAGCTTGGGCCATTAATGGCTTGGTAAAATTCTCGCAATACGATAGAAAACAAGGATTTAGAAAACCGAGCGAGGACCGGCCTCTTATTTCGAGATACGAAAGTAAACATTGAGTTGGTTACAAATGAAAGTGTTAAACAATTGGTATAAAGTTAGTCAAGACTTGCACAAAGAGAATTACCTTCATATTTAACTGAATCATGGTCATTAAATCAGAAGACGATGGGTCTCTACATCAAAAGATTGAAGAATTATTACATGCTACGTCTAATCTATCGAATGATGTATAACTGCTGTAACTCTTAGCATACAAATAAACAATCCAATGGTACCATCCGTTACAACATCATTCACTCTTTATTTGATGAAGCAGGAGTACTTATTTAAAATTAAAGATTACTCCATAAGCAAATTGTCATTTAGCATCAATATGACAATAAAATAATTCCTCCGATACTAAAGTCTAAAACTGGGCTCGGTAAAAACTCCACTTCGACAGAAGAGTTAATCTATACAGCCATAGTGCATGACGACTTTACGGTTATCACATTCAAACATTAATTTTACCAAACAATTCCATCCAATTACTTTAATCAATACACGAATGGAAGACGCCTCGACCAAATATATTTTGGCGTTATGCAGCTGACAGCCAAATAACAAATGCCTATGGCTTCATTTGGATATCATGGCTGAGAAAAGCAAGCATCTACCTCCAAGCAAACCAAGATTGGCCAATTATAGATGAAGACTTCAGGTAATCCAAAGGATTGATTCATGATCGCCACTCGTATTTCATGGAAATAGTTAGAAACGAAAAGCGACTTTAGAATAAACAGCATAACTCAAACATGACACGACCATATTTCATCGTTCCAGTCTTAAAGGATTGGCGGTGATGTAAACACTATGAACAATTGAGTCATAGAAATTCGCTTATTCCAACAGACTATAAGATCAAATAAACCAATACTCAGCTTTACAATATTAATAAACGGAAGAACGGTCGACTCAACGTTTCTGCGGCAGACCCAAAACGATTACTCCATAACAAGGGACCACTCCATGCGTGCTCCGGTTCGAGCCCGTAACTTCTGTCCATTGACGCCAGCAACAGGTTTTCTTCCTTTATCCGTTGAATCTCCCGGCAGTAAGCAGCAACCGATCTCGAATGGTACACTGGCTATGCATCGCTTTTGTTCTGTCCGCCTCCCGGATCGAACAGTTTTTCTATTCCTATGCTTCACGAGCCGTATTCGTTCCGTCAGTATTCCCCTCCCGGCGATAACCATAGACATTTTCCGTAACGACCGAGTTCAGAAGGACGCGTCTCGCATCATGATGCCACGTCATAGACGGTTTTACCCCGATGGTCGCGGAAGGATGCCCAACCTATTCACTGTTGAATAGGCCACAAAGCCAGCCGGAATATCTGGCGAGTCGTGCATCGGTACTTTAGAGTGCGGGACCCGGTATGAGAGGCGTAACAAATATGCGTCACCTTCACCAATAAATCCTGCCGTCCCGCTCAGAAGATTATAATTTATGGTCATCGTGGTTGTTCACTCATTCTGAATGCCATTATGCAGCCTCAATATAGTTAATGCAATGTTTTGACGGTATTTCCGCGTTACCCGCAGCGTTAACGGTATGGTGAAGCGATACTGAAAGAATGGAAGTAAGCAACCACAAACGCTGTAATCAGGGATCTAAGTAATCTGCCATGTGCGCACGAGCGCACCGTACCCCTACGGACATCAGTGACTGTACCCTGCCCTGACTGTCCGTTTCCATAAAGCAATACCCTGTTGGTTCCTTTAACTGTGATAAATTCCTGTGACGTGCTGTTCCATACTGACTCCAGCCGAACTGTTCATCCTTAAACCCTTGGCAATGAGCAGCGGCCCGCTGTTGAAAATGAGCCAACTGTGGCTGAGCCCCGTGTTATTCGTCGATTTGGTGCCGTAATGTGATGAAACTGCCTGTTGTTTTCGTCCCGTAATGTTGACAAACGACGGTGGTTAGTTTCGTCCCCCAAATCCGTACCGGATGCACTGGCACTGTGGGTGTGCGTCAGGTAATTCACGACCTGTTTCTAGGAACAATACAGCACAGCCGGGCGGGTTTCCCCTTACTTGTCCCAGCCCATATCAGGAAGCACAGGCCCGATACGCAACCAAGACGCTTTGGGGCTGATTTGTCAAACGCCTGCTCACATAAGTGAAGCAGGACTCACGACGATACAGGCCGATACGGATTGGGGCACCTGCCGGAAGGCCGAATCTAAGCTCCAGGTAAGTCACATCGAACTGCAACGGAATTTACGCGTAACTTATCCCTTGGATAATCCGATCAGTTCAGTCAGCTGAGGCGAATTATTGCATTCCAAAATACGGTAGACAATTATTTTCCGGGTTAGAAACGGTCCCGTCATAGTCGCGGTCGGTTGTTACCCAGCCCGCGTTAGGTCAAGCTGTACTAAATCTGGATCATTCCGAGCCGCTGCCTCCAGTTCATTCATTCAGGACGACGCGTATTCAATGCCGTCAGACCGTCGGAGAAGGAAGGGAGGGTCTTAACGCTCCATGTGTTGGGCAGTGGGTCCTACGCCGGACGCGGTCTGCTGTTTGGCGTTCCATTCGGTTAAGGACTGTCGGTCTTTCGTTTCTGCACTCGCTTCTCTAATCATACGGTTCAATCTGGAGTGCAGCGTTTCGTTGGTCTTGCTCATCACTCATAAGGTCTACACGCCATTTCTCACGTTGTCCTGAATTACCACCCGGACCTGAAGGTATCTTCTGCCCGTTTCCCGTTTGCCTGTTAAGCCGGTCCGAATACCGGTGCATTACTCCGCACTCTTCTGACTCCGCCCGCTACTGTTAAATCGATTCCCGGACCCCGCTGTTTTGCGTCTGCCCGGCAGGAGTGGCGTCACGCTCCTGTTCCATCTCTCCATTCGTCTCGATGCGTTTTGCCGCCTGGCAGAAGCTGTTCTGCCCCGTTGCCGAGGAAGCTGCACTCGATACATGCGTTCGGTTCTGATTTGCTGCATTCTCAGCTCCAGCATCTCGTGCTGAAGTGGCGGCCTCTGGCTTTCGTGGCCCGGTGGAGGCACCGACGGAGCTTGGCAGGTGTTGACGCTGCAGCATTCGTTTCTGACGTTCACGGCACTGGCCCGCGTTGAGGGTACTGCGGGTGGCTCTTTTAATTTCAGTGGCCTTTAGTACGCTTCTGCTTTGGAGGACTCCTAGTTGAGCCCTGACGATGCAGCTGTCCGGCGGACGTGCTGGCGGCGCGTCCTGCATTGAGTCTTTGCATCAGTCACAAGGCCGGACTGAGCAGCTGATGCATACTGGCATCACGGGGTTTTCACCGTCCCGTACCTGCTTTCATAAAGCGCGTTGAGGAGCCACCTCTTCCACCATGAGTTCCACCACGCACTACACCCCGGCCGGGCATCATCCTCCGTCGGGCACAGAGAAAATCATTCAGCGTCCCCGGTTGTGAATCTGTCAGCCAAGGGTCAGAGCGTCCCGGGTGGAGTTCGAGTAACCAGCAGCGGGGCATCGGGAGCAAGCGGGATTAACCCCGGTATCTACATCCATGCTGTAAGCCCGGCTTCATCCGGATTCTCTGAGCCGTCGCCCGTGGTGCTGTCCCTTTATCGTCATAGCTGAATTAAGTTCTGTATTGGCTTTCCTGTGCCGTCTTTCAGGACTCCTGAAATCTTTACTGCCATATTCGCCGCACAAAAGCCCACCGGTTCCGGGGCACTGTTGGCTTAATCAGAATTTATAACCGACCTCCCAACGATGATCCGTTGGTCTAGTGATCGCCAGTCGCCACTGCCCAGCCTTCAGCAATATCAACATAGACGACTGCTGCCGGGTGTAATCGTATATCGCATCACGCCACTGAGGTATGCCCATTGCACTTTCGTCCCTGGCAGTGGTCGTCCTTTCAGCCCCGGGGATGATTTCCGTCTTACGTAGATAATCCATTGTACTGCCGGCTTACCACTCCAACGCTCCGATCGCCGACTCGTACCTTACTGATTTGTAAAACCGGTCCTCCAACCTACATAACGTCCACGCAGGCTCATAGGTGAAACGTATCTCCCGGTCGCGTGACCTTTTCCGACGCGGCGTAGAAGCCTGACGCCAGCCACTGTCAGGTACTCATAACGGTATTTCACGGGCATCGCGAGCCGAATTCACAACCCCGGTATCCGCATAGACGACGGCATTACCCGGTTCACTTGAATAGCCCACCGTAAACGTACCCTGTCCTTCCGCACGGGCTGACTGTCACCGCAAGTGCGGGGAAGAGCAGTAAGTCGCATCGTTCCTCTCACTGTTTTATAAACAGCCCGTTCCGACGACCTGTAACACTCAGACCACGCTGATGCCCGCCTGTTCCTATCTAAGCTGCCACTCCTCCAGAGACCGTATAAAGCATCTGCCGAATGCCGTTAACGTAAGCGTGAACGTGTCAGGATACGTTTCCCGACCCGCATGAGTGCAACAATACGGGAAAGAGCTGTACCCCTCGTTCGCCGCCGGCCATAAATCACCGCATGTTGCGAGTACTTTCAGATAACAAGCCGATTAGTTTATGCCGTAAAATACTAAATGCTTGATTCCACTCGAAACGTCACTCGAAGCACCATCCCGATCAAAGGATGGTCATCGGTCTACCTGAGTCGACCTGACAGTCTACATGCTTTCACCTGCGCGGAAAAGCGCTCGCAGGGTCAATGTCCCCGACGATTTTCCGCCTCAGCGTACCGTTATCGTGGTACAGTTTTATAGGGCTCTCTTTCTAGTACTAGTTCTGGAAGCATTCACTGCCACTGATATCGCATTTTATGGTAGCGGTCCTTCGTTTAGATTAGAAGGCCGGAGGATTGCCGCCTGATGGGGCTCGGCCGTCAGGCGGTTCAGGAACACGTCGTTCATGAATATCTGGTCTCCCGCCAGACAGCGTTTCATTCCGTTGTGAATGGTCAATAAATGCGATACGATCTGAAGCAACCAGAAACTGAGTTTGCCTTCCCTCCGTCGCCGCTGCTCAATACCCCGGACATAATGTTCAGTGGGTCTGCATTTGACATCTACACATGGCATTCCACTTATCACTGCATCCTTCCTTTCCGACTCCTGGCGTCTGCTGGCGTCTCGTCACTCGGACCTTTCCCGCTCCGCTTTACAATGGGATTCGGTTAGTTCTCCAAATCCAGGTAATTTCCGCATCGCTCACCGAACGGCCTCCACGAATGCCGTAATTTTGCCAACTATGTTCACCTTTAAGAGCCACGTCGCATAATAATCAGCCGTTTGATATCCAGCCGTATGCTGTGATAAGATTACAAGACGCGTGCTGGTTTCAACCTGTCTGGTATCGCAATCTGCTTTTCTTAGAACCAGAACTCAAACTGTACCGTCCGTAAACAGATGAATTGACCAATGGTGGATGCGGTTATCTGCAAATAGCCCGGCGTCACTCAATCTCCTGTGCTGCCGGTGCGGCAATCCGACCATCACGACGCAATGCCCTGCTCCGCCGCAGCATTTACCGCCCGGACTTCTATCCCGGTACCCAGCAGCCAGTTGCGTGAAGCGGTATGGTGGTTTCCGTCGTCCATGGATCCCGCTCACATGCCGTCGTTAAGTTGGGACGGTTTAAGCACGGAAGCCCTTCACGGTCGGGTCTTAGCATCGCCATGACGCTGTCTGCAGTACTTCTGCCGGTCCTTAGTCAGCACGCTGGCGTGACACCATTCCTTGTTCCTCCGTTAGACCTTCCGTTCCCGTTATTCTAGTGCCCCGTTACCATCTCAACGTCCCTGCTTAAGGATGGCATACATACGGTGCCGTCGTCGGTTCTCACATCACGCAGCGGAACAGTCGCTGTAGGCAGCGTCGGCAGCTTCAACTCCCATACGTAGGCGAGCATCAGGCAGCAATAAGGTAGACACGGTCACTTCACGTGCTGACGGACCGGCCTCCACGCTGAAAGTCCTGCGTCACAGGGGTGGCCCGGTGAGGGGATGAGACGATCAATGTCCACCACGGTCGAGCGTCAGGAGTCCGGTACCTGTTTACCGCCAAGCACACCATGCGGCTCCGGCATAGTCATCACGCAGATTTCAATAACCTCGCCGTAGTGACCGGCCCTTCTGCGCCGACGCTGAAATCCACCGGTCTGCGTTCGTTCCAGCAGTTCTGTTTAATCAGCCAACAAGCCGGTGCGCCTGCCCCCGGGTACAGCCAAGGCATCCATCTTGCTTACGACCGTAACGGGCAATGGCACTGCGTATTCGCTCAACTGTCGCCGTCCAGCCGTTGTTCCGTTGGACGCGGTACGAGTCCTTCAAAAACCGAACGGCATCCAATAGCGCCATGGGATCAGCTGAAACTAAGTCGGTTATGTGACGTCTCAGTTACCATCCGAAGTATCCATAGTAGTCCCACTTCGCCGTTCTGCCGCCGTCCGTACCTCGATGAACTCAAGCGCATCGCCAGCGAGAAATCGACCTACATCCACGCCTTACGCTGTGGTCAAATGGGATCGCTTACAGGTGCGCATCGTAAACCGTCCGGCGTCCGGCACTGGTCGCAGTACTGGCCGATTAAATACCGCCCATTTATCCACATTAGCGCCGCATCAGACCGTTTCCCCATGCCGGCCCCGGATGGGTCAGGCATATCCACCCGGCTTTAGTATGCCGGTTTAACGTTCCCAGATACTGGTTCTTTACGCCTTTGTTGCGGACGTGGGTTGGAGGTGCATTACTCCGCATAGATAACTATGCCACTGCTGGCTTGAATGCTCCGAGTCGCCCTGCACGCCGACCAGTGCCGTTCGGGTACTAGTTCAAGCCGATTTTCAGTGTACCAAGCGTTTTGTTCTGCAGCGATTAGAGTCGTGCTGAGTCCGGTAAGCATCCGGATATTAAACGGGCCGGCGTACTAGAGCATCGCCCCGAGTCAGACTCTGCGAGGTATTTGCCTTAATGGTTTTGCGTCCACAGCCACCGTTACGTTGTATGTATAAGGCGACTTCCGACGGATTCCTGTTACCCTTTGCTGGTTCCACCAGTGCCTGTACGCAGCCTCGGTCTCGCAGCTTCGGGTCCCGTAATGGTGCGGCTTATATTTCACTTTAATGCCCCAGCACCGGCATCAGGAGGATCAAATCTCCTAACGGCTTAGGTCGCCGCTCACCGCCGTGACAGGGACTGTTGGTATTCCCCGTGTCCCGGCGTACTGTTCACGGTTTAAGCCGGGAGGCAATCAATCGGCCCTTCGACCTCATGAGATCACACTCAGCAACTGCGTGGGTTAAAGTAGTCTCTTTTGCTTCTAGGGTCCTACTGCATTCCTTTACCATTCCTCACGCGTAAAGGCAAGAAGCCGGACGCACGTTCCACATAAACATGTTTGCGCTCCGGCCGTACGGAGACCTGACCACCGTCTCGTCACTTGCCCCGATTCCTAGTACCCTATCCGAACCGTACCCTAGCATTTCCTTTACAGAACAGGCAGGAACATTGCCCTGGCAACCGGTACAGTGAGAATAGGTGTTGCTTTATGGTTCCTTTATCCGTTGTATCGTACGGGGAGTTCGTGGGCTTTCGTACAGCATCTGCGCCACAGCACCATAAGCGGCGGAAGAGAAAACAGGATGTAAGGGTCATACCACCGAGCAATTAATCCCCATGCAAGTAGCTCCGGTACACGAATGATCTAATCGCATCTGGCGGCAGCCCCAGATCTGGAATACGCCTGACATCCCGAGACCTCCCAAGCCTCTACTCCAATCAGGGCAATACGGTATGCCGCCGTTGGGCCAGTTACTTAACGGTTTACGCCGCGGCAATCCGTGACCTGATACAGCCGTCCGTTGCACGAAGCCGGGGTTGTATGGCCAGTCCCGGATGGCTTCCGTATAGCCACGAAGAGTTTTACGCGGTACAATGCCAAAGCCGTAAATTGTAATCTTACCGTAGGGGTGCCATGCCCGGTAACGCAGGGAGTGTGCGTCTGGATGCGAAACTATGGCGAAACCTCGTTTGGCCAGTGTTCCAGGAAACTGGTGCAGCAAGCCGTTGCCGCAGTAATGCGCTTCGTTGCGCCAACTCAACCCAATGCACGAGCATACGCCGGCTGGTTGAACAACGGAGCAGAAGGCAGTCCTCCATTAGAATAGAGATTCTCGTTGATAAGTTCTGTTTGGTT
>147
GATCTATGTCCGATACCAGTTACTTATCTAACACAGTTCAGCAGCCCGATTATGATTCTTCCATTTCCCAACGAGGTTTCTTCCTTCGTTGCGATTCAGAGTGCAGCATCCTGAAGCGCGGACTATGCTCACTGGCTACCTGCATCAGGCTTTTTGTTTCCCCTCCCGATTAGAACAGTTTTTATCGTTCCTGTTATCCGAGGTATTCCATTGCTTCCACATTGATTCCCTCCCGGGGGCTATAACCAAATAGGGTTCCGTAACGACTGAGATTCAGAAAATAAACGACGCGTGCCGGAAGCCACGTCAGGACGGTTTTGACGCGATGGTCTTCATGAGATGCCACGATGCCTCATCACTGTTTAAACAGCCACAAAAGCCAGCCGGAATATCTGCGGTGCGACCGTATGCGAGGCAAACAGGATGGCAGGCGAATATGCATTTATAATCACTAAAGCGTGCTTAGTCCTAAACAATTATAATTTGGTCCTTCTTTCACTCGATCCAATAAATCATTAGAGCCTCGATAAGATTAATGCAATGTTTTATAGTGTTTCCGCGTTACCCGCAGCGTTAACGGTGGTGTCCGTGTGAACCAATACTGAAAGAATGGGCATGAGCACGATAACAACCAAAGTGCTGGTGCGCACCAATACCAACTTATGTGCGCATGTGCAGTCTTAGTCAAGCACGAGCTAAACAAGTACCCTGAGTGAACTGTGGCTGCCTGACTGTCCGTTCCATCAAAGGCAGCAATACGCTGTGTTATTCCTTTAACTGTGATAAATCTTCCTGTAATGGTTACTGTTCCATACTGACTCCAGCCAGAACTGTTCATCCTTAAACCACTTGTCGGCATGAGCACCGCGGCTCGCTGTTGAACCGACTCAGACTGTAGACTAAGTGAGCCCCCGTGTTATTCGTCGATTTGGTGCCGTAATCGAATACTGCCTGTTGTTTTCGTCCCCGTAATCGACTCACATTGGTTTCGTCCCCAAATTACGATTGGCTTGCGCTCAGACAATTATGTGCGACTTAATTCGGCATCCTCTTTTAGACCATAAACCACCAGCCCTATCATTTCTAGATCGTCTAGCGCATATCAGGAGCACACCCGATGGATACGCGACAGCAAGTTGTAGCTAATACTTTGTCAAACGCCCGCCTGCCCTGCGAGCCATCGCCAGACGGAACGAAACTATCTGATGACGGGGTTAGCGCAGCTTAGAAAGGCCGAATTCTCACATCGCACTTCAGAACATCTGCAACGGAATTTTTCAGAAATATCCCTGCCAACCTGGATCAGTTCAGTCAGGCTGGCGGCATCCATTTCCGAGGCAAATACGGTAATTATTTTCGCCGTGATGAAGCCCTGCCATAAGCGTCGCGTGGGGCGCGGCATTCCGGTTGTTGACTAGGCCCGTTAGTCATGACTAAATGGATCATTCCCATGCGGCCATTTCATTCAGCGTATTCAGTGCGTCAGGTGACGCGTCGAACATCTGCAATCGCGGCCAGTCAAGCATGTTCGAGTATCTGGGTTAAACGCTACGGTTGGTGCTGTCTTGGCGTTCCCACTTTAGTGCATATGTCAGTGGGCTTTTCTGTTCGTTTCATCCATTACCATTGACCGCTTTGGCGTTGCAGCAGCGTTTCAGACGTGCTGTTGGTCCATGCACTCTGCTATCCTATTTCTCGTTGCCCATTAACTCGCGACAGCTGAAAAGCTATCTTCTGCACGTTTGCCGAATTTTGCACGTATTGCCGCCGCTTCTGCAGCGCACTTTTGCTCTGCGAGAGCTTGATACCGCACTTCCTTATGAGCCGCAGCCTACTGTCGCCTTCGTGGATGCCGTTGACGCACTCCCTAATTTTGCGCGTGCCGCGGCAGGAGCTCCGTTCGCTGCTGTTTCAGATGACCTGGCATTCGTCTCTGAACGTTTTTGCCCCTGGCAGAATTTCTGCCGCCGTTGCCGAGGAACGCTGCACGACCGGCACTGATGATGCGTTCGTTTCTGACTGATTTTGCTGCTCTTTGAGCAGGCCGCATCTCGTCTCGTGCTGAAGTGGCGCTCATCGGATTTCGTGAACCCGGTGGCGAGAGGCAGACGTGGCGGCTGATGTTGTGACGGTGGCAGCATTCGGTTTCTGACGTTTTAGCACTAGCACTGACCCCCGTTGAGACTCTGCGGCTGCGGCACTTTTCCCCTTCAGTGGCCTTTGCTCTGCCGGTCCTACGCGGCTTCCTGGCTAGCTGACGGATGCAGCCTGTCCGGCGTGCATGGCAGGGCGCGTCGGGCTTGCATCAGTAACAAGGTAAGCGCGACCTGAAGCAGCTGATGCACTGGCATCGCCATGATTTCTGTCGCTTTAGATGTCTCTGTGCCCTTCATAAGGACGGACGCGTTACCGCGCCATAGCTTCGCCTCCACCCATCAGAGTTCACGACACGGACGGCAGCACCCGCTCCGGGCAGGCATCATCCTCCGTCATGGCCAACAGAGAAAATGAGTTACGTCCGGTTGAATCTTCATACACGGTATGGTCCCGGCGTGCGATGGTGGAAAACCGTCAACCTGCAGGAGTAACACTGTACTGACCGTACCGCACATCCAGCTGCTGTAACGCCCGGGGCTTCATCCGGATTCTCTGAGCCCACCTTCTACAGCGCGTGGTGCTGTTACGTCTGGCTTTCACTGAATGGTGCAGTTCTGTACCGTTTTCCTGTGCCGTCTTTCAGGACTCCTGAAATCTTTGATTGCCATATTCACCCCACAAAAAGCCCACGTTGCCTAGCGGGCTGAATAAATGTGTTACCTGGCTAATCAGAATTTATACGCTCCCAACGATGAATCCGTCAGTACGCCAGTCGCCTGCCCAGCCTTCATAAGCATATCAACAACGACGGACGCTGCCGGATTAATCTGTATACTGCACTCCACGCCACTGAGGTGCCTGCCCGCATTGCACTTTCGTCCCTTACGACTGGCAGTGGTCGTGCTTTCATACCCGGGGAGTGATTTCCTTTGAACCGTGATTCCATTGACGTAATAGCTGCAGACTTGACAGCCACTCCGGCCATGAATCCAGACCTGCTTACTGATTTGTAAAACCGGTCCGGCCATGGACGACCCCCTACTACCGTAGCGCATAATAGTGAAACGTATCCTCCCCGGTCATCACTGTGCTCTTTTTCGACGCGGCGAATCCCAGGGAAGCCATCACCTCCCACACTGTCCGTCAGCTCATAACGGTACTTCACGTTAATCCCTTTCAGATGACTCACTCACAGTATCCCCCGCCTCGACGGCAATGTACCCGGTTTCATTGAAAATAGCCCACCGTAACGTACCATGTCTAGCCGTTGCGCACGGGCCGATGACTTATGTCACCGCAAGTGCGTAGCAAGACAGCAACGGCAAGCCACATTACACGCATCGTTCATCCTCACTGTTTATAATAAACGCCGTTCCCGCTGTAACATCACCAACCAGGCCTAATGCCCCAGCGCCTGTTTCTTAATACTAAGACCTGCACATCGCTGGCAAACGTATAAGCAGCACGAATATCTGCCCCGAATGCCGTGGACGTAGAAGCGTGAACGTCAGGATCACGTTTCCCCGACCTCGCTGGCAGGGTCAACAATACGGCGAGAACACCTGTACACTCGTTTCGCCGCCGCCATCATAAATCACGCACCGTTCATCGGGCCAGTACTTTCCGATAACACATCGAATACGTGCTGTAGAACCCTTACTTCCGGCGAAACGTCACTAGGAACGAGGCACCACTATCTGGCGATCAAAGGATGGTCATCGGTCACGGTGACAGTGAACTGGGTCGACCGTCGGATCAGTTCTAATTAGAAAAGCCTAGGGCCCTAGCCGCCGCCTTTACAATGTCCTACCGCGACACGTCCGCCCCTCGTACCGTTTATCGTACAGTTTTCAAACGCTATCGTCACATTACTGAGCGTCCGGAGTTCGCATCTTCACACTGCCTGGGTATCCGCATTTTTAGCGGTCAGCTTTCCGTCCTGTGTCCATAGAAGGGCCGGGATTGCGCCGCTGAGCTGACGGCGTAGCGTCAGGCGCTTCAGGAACGGTCGTTCCTGAAACTTGCCTGCCACCACAAAGATAGGCGTTCATTCCCGTTTGCCGGGTCAATAAATGCGATACGAATTGGCGAGCAACCAGGAGAAACTGGGCTCAGAGTTTGCTTCCTGATTCCGTAACCTCCCGTGTTAACAGTAATGAGGCTGACGCATAGATGTTGCCGTCGTTATTGCTCGATCAATTTTGACAGCCCACATGGCATTCCACCTTATCACTGGCATCCTTCCACTCTGTGTCGAAAACTCCTCCAGTTGCTGGCGTTATCCTCCAAGTCGCTCGACTTTTCCAGCAGCTCCTTGCCGAGATGGGATTGGTTATCTTGCCTTTGGAAAATCCAGGTAACCTTCTCACATCATCACCTCGCCGACTCGACGGCCTCCGCAATTAAACCGATTTGCCAACGGTGTTCACACTTAGATAAAGTAATAATCATGGCCCGGTTTGATATTGATAACCGGCGGCTATCCGATCAGCGCCGTACCAATAACGCGTGCTGGTTTCAACCGCTGTCTAATCAGAATCTGCTTTTCCGAGACCAGAACTCAACTGTACCCTTTTAGGGTCAGAACGGCAAGATGCGGCGTGGCGGCGGTTATCTTGAAAAGAGTAGCCCGGCGTCAGCTCAATCCTCGACGTGATCGGTCCCGGCATGTCGAGTAGCATCTATAGCACGATACTAGTCGACGCCGCTCATTCTTTAGCCGCCCCACGGACTGTTCATCCTATCGTTCCCCAGCGCGTGTTGCCAGCGTGAAGCGGTATGTGATTTCCGTCGTCCATCCGTGCTCCGACCACCCGCTCACTGCCGTCGTTAATAGGTCCGTCAGACGGAGCAGGAACTCACGCCCTTCACCACCTTCGGTGTGTCCCATCGCGCCTGGTCGCCTGTCTGCAGTACTTCTGCGGTCAGGTGCTGCACCACCGCTGGCGGCGTGACACCGGATTCACCGTGCCACTGTTCGCCGTCAAAGTGCCCCGTTATCCACGGCCTCTTTTCCGGCACATGCTGCACGGCGGCATGAATGGCATACGTGCCGTCGTCGTTCTCACGTACTCACGCAGCGGACATGCTGGCGCAGCGTCGGCAGCAGCTTCAGCTCCCAGCCACGCTGTATTCAGCAACACCGTCAGGAACACGGGGCATTTTACCTTCACGCCGTCGGTATAGACTAGCATCTGACCTCCACGTAACGACTTTAGATTCCATGCCGTCAACCAGGCTTATCAGCGCGCGGTACAGGGGGAGGATGGCAGCGTGATTTTCAGCGTCAGTCAAGCGTCCGGGTCTGGCTGTTCACGCCAGCACGACCACCGGTGCTGATACCGGCATAGTCATCATCGCAGATTTCAACATAACATCGCCGGTACCTGGCGGCCGCTTTCTGCGCCGACGGGCGAAATCCGATCGAGAGTCTGCGTTTCCAGCAAGTTCTGTTTAATCAGCCACAGCCCGGCCATGTGGCGCGCCTGCCCCCATGAGCCAAGGCATCCATCTTCGTAGCCTTACGACCGTAACGGGCAATGGCCTGCGTATCTTCGGCCATAACGTGCCGTCTCCCAGCCGTTGTTCATGGTAATCCAGTTCGCCTCCAAATCCCGGTCCTTCAGGCGCGCTGAAGCTGTGACGAACGGCGCTCATCATCCGGCATCACACATTACTGCGGTTAGTCCACGTCTTATCTAAACGTCACCGTCCTTAGAACGTCGTGCCTTCTGCCCGTTCCATACGGCATACAGCGCATCGCCGAGCAGAAATCGCTGAGCACATCCCACATCCCTGTGTATTAATGGCATTACAGGTAGTGGGGCGTAGTTATCCGTCGGGCCTAGGTGCAGCGGTCAAAGCATGACTGGTCACTAGCTGAAGGAGCGTTACTGGCTAAACATACAGGCCACCATTTATCCCACATCCGCGCGCGCCTCGTTTTAACGCATGCCGTAGCCATCGTGCGGCTAGAGCATATCCCACAGACAGAGGCCATGTTGTTAGCTGTATGCCGGTTTAACGTTCCGTCCCAGATACCTAATCTTGCCGTCCGTGGTATAGTTCGACGGCACCTGCCAAGAATACGCCCGCGCAGATGATAATTAGACCTGCTGGCTGCCGAACCTGCTCCGAGTCCACCTGCACGCTCAGGAACAGTGCCGTGTTCGAGCACTGTTCACATCGATGATTTCGAGTGTATGACGACCAGCGTTTGTTCTGCAGCAGCTGGTCTGTGGTGCTGTCCGGCGTCATCCTGCGCATCCGGATATCCTTAACGGGCGCGGCGGCAGGTGTATAGAGCCCAAGCGGGTCTACTGCAGGTGTCAGGCTTAATGGTATGTCTTTTCCGCGTCGCAGCCGTTACGTTGTATCTGAACAGCAGTGGGCGACTTCCGACAATTCCTGTCATTTGAGGTGGTTCCACCCAGTGCTGTACACCGAAGAGAAGCGCATCAGACGGTCGATGTTTGCAGACGTAATGGTGCTATTGGCGATCCGGCTTTCACTTCTGATCCCAGCACACGTCTCGGAGCCCTAGAGGATCAAATCCCTCCGGCGGAGTCGTGATTCCCTGTATCACCAGCCCGGACACACAGTGACAGGTATTGTTATTTAGAGTGCCGCTAGGCGTACTGTTCAGCAGCGCTTTTAAACCGCTCTTCGCTGTAATGTCACGTAACCATCGATCACACTCAGCAACTGCGTGGTAACTTCAGGTTATGCTTCGCGCGGGGTATGCCCCTTACTGCTTCTTCCTTTACCCATTCCTCACGCTCCATAATGACACTAAAACCGCAGGCAGTCGTCCTGCGCACATAAAACATTTTGCACATCAGCGACCAATCACCACAATAGTACTACCCGTCCTCGTCGTCTTGGGGTTCGTATTAAGCTGCATGGCCGCATCCCCGCACGCATTTCCCCGTACAGAACAGGCAGAACATTGCCTGGGCAACGATTTATCCAGTGGAGAAGGCTGTTCTGCTTAGCGCCGTTATCTTATGTCTGGAATGTGCGTCAGCGGCCTTTCATGTACACATCTGCGCGCCGAGCACATACTGAGACGCAGGGAAGAGTTAAGTCCTACACCGGCCCCCAATGGCTGCCCCAGCATGCACATGGGTAGCGGCGGGCAAAGAATGATTAAGCATCTAATGAGGCAGCCCCCATAAATCTGGAATACGCCTGACTGCCCGGCGACTCTGGGAACAATATGAATTACAGCGCCATTAAAGCAGAGTCTCATGTAACTGCGCCGTTAATTCGTGGCCCGGACGTGCTGACGGTCAGAGGCATGGTTGCGTACGTAAACGAGCCGTCTGAGTTTCTACGAGCCGGGGTGTGAGTCCCATGGCTTCAGCCCCGTTCACACGAAAGTCTCAATGCGGCAACAAATCGTTGTGTAATCCGCGTTAGTGTAAAGGCATGCCGCCATGCCCGGTGACGCCAGAGGGAGAGTGTGTGCGTCGGTGCGGATTTGTCGGTGTACCTCTCGTTTGCTCAGTTGTTCAGGAATATGGTGCAGCAAGCCGCCGTCGCCGCAGTAAATTGCGCCTCAGTGTCCGGCAACCATCAAACAGCACAGCAGCACCGCCATCGCCGGCTGTGTGCCGTAAAGACAACGGCACCTGATACAGCCCCGTCGCCTCCAATTATCTGCGACCACCATTCTGGCCGTGATTCTAAGAGTCATCCTCACGATGAAAGTCCGGCATCTCAATCCCGCCAGATGATAAGCATCCCGGCTGTGACTAGTCCGTTATTCGCGTGCTCAGCACACATGCGGGCACAGGATGAACTTGAATCGTCCGGCATGAGCTACGGCAAATCACTCTGCACTGCATCACGCCGGTCATAGGCTCACAGGCAGCCACGAGACCGCTGTCGGAGCGGCTAGTACCCTGCATTCTGCAACAGTCTTCCGGCGACAACGGAAGGACCCTAGCCAGCTCACCGGAGAATATTCACGCAGGGGAAAGCTCTCTTTCCCCTCCGGCGTGCTGTACGGAGCCGCACGACTCCGCTTGGCACAATAGCCCGGGCGTGCACGAATCCCCCATGATTCTGTCTTGTCATGGGGATTTACTGCGAAAAGTTTGTTAATGGAAGAGGAAGCCGCCATAGTCTCATGTTAGAACTTACGACCCTAAACAGGCATTTGCTGCATTTATCCTTCGTGTAACCCTGATTCTCATATTAATATTGCATCGCATAGCCTCCGACTCGACCGTCACGAGCCTTAAATCAGGTGTTGGGCGGTGACAGTTTAGGATAAACCGTTTCCGTTAACCGTGACAGTACTCAGGAAGAGACGCGCTCAGTTCGCTGCACTGCTCAATGCGCCATAGCGGCTGATCACCCTCCTGCTCTAAATCTAATCTGTTTCCGTTGACGAAGTTCACGCATCCAGAAAACGGGCGTAAACCTTACGCAGGCACCACCGTTCTCACGACCAGACTCTGCATATCTTCCGCCATCCCGGTACACATACCGTACAGGTTAGAAACCGTCAGCGTGGGCGGTAGCTCTGATCATTTGCTTCAGTTCAAACCGCTCCTCGGACAGAATGGGGACGGCTGATATGTCGCCCTTACCAACCGGCCTTTTCGTTTAGCCTTACCATACGTTCCCGACCTGTTTCCTTACGTCAGAGAGCACCACGCTGGCCGACTGCTCCGCACGGGTGCATTCATTCAGTGTTTCCTGCTGCCCTATCCTGCATCAGTTCACGCCCTGTTTCAAACTCTGCTGAACTCAACGCAAGCATACTCCAGACCATTTGCTCGCAGGTCATTTATCTGCCCTAACAGGCGGCGTCCACAGAAAGAGGATTTCCTGACCCCGTGCTCTTCCGTCAGAAACGACTCCAGTACCGTGGCCTCCTCACGGGGACAGAAGGCGTCACGCTTACACGTTTTCAGGTCGGCATTCAGCCCCGGCAGGCGCTCGCTGAGACGCCATCAGGGCCAGCTTTCTTACAGAAGGGACCGAAGCCACATCTATACATACGGGTTTCATTTCCAGCGGAAGAGGTCTTCATCGTCCTGCCTCCGGAGAACAGGCCACCATCACGCATCTGTGTCTGAATTTCATCACGGGCACCCTTGCGGGCCATGTCATACACCGCCCTTCAAAGCAGCCGGACCTATCTGCCCGTTCGTGCCGTCGTGTTAGTAAGCTTACATGGTTATTCTGCTCAAACGTTAGCGGACGCCTGCATGACCGGCTGTCGCCATGCTGCCCGGTGTACCTACTAACATAACCGGGCAGCGCATCATCAGGGTAAAGATTCCCCACGTACAAGCTGGTCCGGCTCTTCCTTCGTGAAGACAACTCACACGGTGAACAATCTAAGTAGCTATCATATTTGCCGCCGGTTCCCGTAAATCCTCCGTGCAAAATGGAATTTCGCAGCACCGGCCTGAATGGCTGTACCGCCTGGCACGGGCCCGCCGCCGCCCAACAGCCCCGCCAATGGCGGTGCCGATACTCCCGACAATCCCCACCATTTGCCTGCTTAAGCAGATTTCTGTCATCATGGACAGCACTAGAACGGGTGAAGCTGCGCCAGTTCTGCTCACTGCCGGTCATAGCCGCCCGCCATATTCTGTGCAATACCATCAAAGGTCTGCGTGGCTGCGCATTTTACCTGCGACATACTGTCCTATCTGCGCTCTCTTCCACTCACTCCGACCGCGACTTCAGGCCTGCCATCCAGTCCACGAAGCTGGTCTTCAGCCAGGTCTTTTCTGCTCTGACATGACGTTATTTCAGGCCCCTCAATTATCGCCATACTGTTCCTTCAGGCGCTGTTCCGTGGCTTCCCGTTCTGCTTGCCGGTCAGTCAGCCCGGCTTTTCGCATCAATGGCGGCCGTTTTGCCCGTTGCTGCTGTGCGAATTTATCCGCCTGCTGCGCCAGCGCGTTCAGGCGCTCCGATACGTAGTAATACTTGTCCTCAAGTGCAGCCAGCTGGCGTTTGAGACTCCAGCACCGTCTCATCTTTGGTTATGCTAAGGGATTTCTCCTGTGCAGACAGCTGGCGAAGGTTGCGCCGCCTCCTCCAGTACCCTGTAACTCTCCGTTCCGCACAAATCCCGGCGCTGCTGGCTGACTTTCCATTTGCTCCGGCATGCTTCTCCAGCGTCCGGAGATTCGTCGCCTGAAGCGTCAGCTCGAGGCAGCATGAGCACTGTCTTCCTGACTAATCGCCGCACTGCTGGACTGTTTCGGCTTTTCATAGCGTGCTTCATAATGCTTTTCACGCCGCCATCAGCGTGTTGTAATCTAGCTGCACCATTTTCCCGTCTTTCAGTGCCTTGTTCAGTTCTTCCTGACGGGCGGTATTTCCAGCGTGCAGCCGTTCTATCAGCCTTCTAGCCCTCTTCGGTATATTTCAGCCGTGACGGGTATCGCTCTGCTGCTGCGCATTTGTCCTGTTGAGTCCTTAGCCTTCTTTCGGGCGCGGCTTCAGGCAGGGCCTTTCACGATCATCCGATAACGCTAAATGCTCGTTAACAAAATAGATCATCCTTGCGCAGATTCCAGGTACTTTGCTTTCTTATACGCAGCCTCTGCCTTAATCAGCATCTCCTGCGCCCCTGTATCACGACCACAGACCCACCTCGCATCCACATGGATTTGAATGCCCGCGCAGTTAACTTCTTGCCCATGTGGCCGTGCCCCGCTGTTTATTTCGATTCCAAATCTTCGGGTCTCGTTCGTGCCTCCGTTCGCGCCTGCAATGCCCCGGCTTCATCGGATGCATGACGAGCCTCGCAATCTTAACACCCACGTTATGGAACTGGCGAAGCCATCGGTCAGCCCCGACGTCGGGTGCTTCCCAGAAGGCTTCAGCGACCTTGTCTCCACGCCGGATGCCGCAACCAGGCGCCACACTCTGGCTGATGACGGCAATCTGAGCCTCACCCCTTACCCTATTAACCAGTGCTAGCTGAGTACACTTCTGGTTAAACGTCAGCCCTGCCGCCTGCCCGGCTGGGACAGACCAGCATACACGATCTGCCGTCAGTCCGCCTGATTGCCGCAGGGGCATATACAACAGTTTGTTGAAATCAACGATTAGTCGTAGGGTAGATGATGCTGATACCAGGCATACGCCTCAAGGAGCATGAGTCGCCACCGCCAGCGGTAGAGTATCGGCCGACTTAGAGCAAGCAAGCCGGCTACATGGGATGGGTGGCCGAAGGAGTCCTTCACTGCCCCCTGTTGCAGCAGGATCAGCCACACGGACTTTGCCCGCCTGCACCTGCGTGGCTGCCTTGAACTGTGCAGGCAGCATACGCATGGGCGGCTTTATACTGCCCGACGAGAAATCCCCGCTTTCTGTGCAACGCGCCGCCTGTCGGCTCAGCGACTGTTCAACGACTGCCGCTGTTTTTCGCAACACTTTTAATTACAGAAAATGACGGCCTGGCTCTGGCCATCTGCTCGTCAAATCTGCCGCATCCAGACCATTAAACATAACAAGTACAAGTTCTGTTTAATATGTTCA
>148
GCTTGGGTGTTTAACCTCGGACGGAATGAAGTTATCCCGCTTCCCCGATGGCGGACATCGACGAGGATGACGTAATGCTGATGACAGTATCAGAAGGGATCACGCAGGGAGTCCGTATGGCTGAACCGTAGGCGATCTGGTCGTTGATTTGAGTCTGGGATGCGGCACAGATTTGACGAGCGGCCGGAGTCAGGCGTCATTTTCTGGTACGGAAAGTGATGCGAAAACAGCGGCGGCAGTCGTTGAACAGTCGCTGAGCCGACAGGCGCTGGCTGCACAGAAAGCGGGATTTCCGTCCTGAAGTATATAACAACCGCCGATGCGTATACATGCCTGCACAGTTCACGACCGACTTAGGGATCATCCAGGCAGGCGGGCAAAGTCCGTGTGATGATCCTGCTGCAACAGGGGGCAGCTAAGCATGAAAGGACTCCTTCGGCGCGGGATGATCCCCATGTTCAGCCGGCTTGCAGCGCTGCGATCACCCTGCCGATGGTGGGGGCTAGCCGGGGCGAATGGCGGTGGCGACGCTGGCGTATGCCTGGTATCAGGGCATAACTATCAAGCCGTCGATTTCAAACAAATAGCGTCCTTTCCGGCAATCAGGCGACTTAACGGCAGATCGTATGCTGTCCTGTCCCAGCCGGGCAGCAGGCGGCAGGGCTGGACGTTTAACCAGACCGAGCGAGTCAGTCACTCAGCGCACTGGTTAAGGCGGGGGTAAGCGGTGAGGCTCAGATTGCGTCCATCAGCCGAGTGTGGCGCGTTTCCTCTGCATCCGGCGTGGGAGGTGGACATAGTCGCTGAAGCCTCTTTCGGGAAGCTGACCACATAGGACGCGACGTCGGGGCTGACGGCGATGGCTCGCCCCCGTTTCTGGATAACCTGTCGGCCAGCAGATCCGTATGTTGCTCAGTTGCAGCGTTCCGGCGATGAAGCCTCCGGGGCATTGCAAGCCCGGCGAACGAGGCCGCAACCGAAGGGTTTGATGACCACAACCGCCGCCTGAAAGAGAACATGCACGCTGGAGACCTGGGCAGACAGGACTGCCGGGCATTCAAATCCATGTGGGATGCGGTGCTCGTATTGGTCGTCCTGATACCGCAGCAGGAGATGGTGGATGTAAGGCAGAGGCTGCGTATAATGAAGCAATCAAGAAGCGACTAGACATGGCTGGAATCTTGGCGCAGGATGATTATTTTGTTAACGATGAAGCGCGGGCGCGTTACTGGGATGATCGTGAAGACGCCGTCCTTGGCTTGAAACGCCGCCCGAACCGACGAAGGCTGAGCAGCAGACTCAACAGGACAAAATGCGCAGCAGCAGCGATACCGAAGCGTCAACATGAGGAACAATATTGAAGGCGCAAGAAGGCTTACGAACGGCTGCAGACGCCTGGGAATATACCGCCGTCCACCGGAAGAACTGAACAAGCAAGCGACACGGGGAAAATCCCTGCAGGCGGATTACAACACGCTAGTACTGAGGGCGACAGGATTATGAAGCGACGCTGAAAAGCCGAAGAGTCCAGCGTGAAGGTGTGCTTCAGTGAATCGTCAGGAAGACAGTGCTCATGCTGCCCTGCTGACGGCTTCAGGCAGAACTCCACGGCTGGAGAAGCATGCCGGTTACTAAATGAGAAAATCAGCCAGCCGCTCAGCAGCGCCGGGATTTGTGGAAGGCGGAGAGTCAGTTCGCGGTACTGGAGGGAGGGGCGCAACGTCGACGCACAGCTGTCCAACAGGAGAAATCCTGCTGGCGCTAATAAAGATGAGACTCTAGGCCTGAGTACAAACGCCAGCTGGCTGCACTTGGCGACAAGTATTACGTATCAGGAGGCCTGACGGCCGCTGAGCGCAGCAGGCAAGTAAATTCGCACGAACATGCAGCAACGGGCAAAACGGGCCGCCATTGGATGCGAAAAGCGACGGGGGCTGACTAACCGGCAGGCAGAACGGGAAGCCACGGAACAGCGCCTGAAGGAACAGTATGAGATCGCTGGCTAGGCTGACTGGACGTCATGTCAGGCAGACAACACTGGGCGGCTGAAGACCAGCTTCGGGGAACTGGATGAAGCCGAAGTCCGGCTGGAGTGAGTGGGGAAGAGAGCGCCACGGACAGTATGTCGCAGGTAAATGCAGCCACGCAGACCTTTGATGGTATTGGCACAGAATATGGCGGGAGATGCTGACGGCAGTGATTACAGAACGCTGGCGCAGCTTCACCCGTTCCGTGCTGTCCATGATGACAGAAATTCTTCTGCTTAAGCAGGCGATGATTGGGGATTGTCGGGGAGTATCGGCAGCGGCCATTGGCGGGGCTGTTGGTGGGGGCGCATCCGCGTCAGGGGCGGTACAGCCATTCAGGCCGCTGCGGCGAAATTCCATTTTGCACTGCGGAGGATTTACGCGACTTAGGCGGCAAATAGCCTAGCCAGCGGGGATTGTTCACCGTGGTGAGTTGTCTTCACGAAGGAGGCAGTAGAGCCGGATTGGCGTGGGGAATCTTTACCGGCTGGTCAGCGGCTATGCCACCGAGCGGTTATGTCGGTCGGTACACCGGGCAGCATGGCAGACAGCCGGTCGCAGGCGTCCTAACGTTTGAGCAGAATAACCATGTGGTATTAACAACGACGGCACGAACGGGCAGATAAGGTCCGGCTGCTCTGAAGGCGGTGTATGACATGGCCCGCAAGGGTGCTCCCGTGATGAAATTCAGAACACAGATGCGTGATGGTGGCCTGTTCTCCGGCAACTTATAGATGAAGACCTTCCGGTGGAAAGTGAAACCCGGTATGGATGTGGCTTCGGTCCCTTCTGTAAGAAGGGTGCTTTGTGATGGCTATTCTCAGCATTCCGCCTGCCGGGCTGAATGCCAACCGCGACCGAAACGTACAGCGCCAATCAGCCCCTTCCGTTGGTCCCCCATTAAGGAGGCTAGATCTGGAGTCGTTCTGGAAAGAGCACGCCTGGGGCTGGAAACCTCCTTTCTGTGGACGCCGCCTTATGAGTGGCGGCAGATAAAGGTACTCTGCGCAAATGGTCGTCGCGGGTCAGTATGCTGCTGCGTGTTGAGTTCAGCGCAGAGTTTGAACAGGTGGTGACGCTGATGCAGGATATCCGGCAGGAAACATCGAATGAATGCACCCGTGCGCGGAGCAGTCGGCCAGCGTGGTGCTCTGGGGCGGGAAATCGACCTACTGACAGAGGTCGGTGGAGAACGTTATTTTCTTGACTTGAGCAGAACGAAAGGTGAGCCGTTACCTGGCAGGGGCACAGAGACGCTTATCATGAGGGTTATCCCATTCAGGGAGCTCATGCGGTTTGAACTGAATGAAAGGATAGAGTCACGCGCCTAATCTACGGTTCCACCTGTACGGTATGGTCACATGGCGATCGAAGATATGCAGTTGACTTGCTCGGCGGAACCGGTGGTCCCGGGGCACCCGTAGTTTACGCCGTTCTGAGGATGCGGTGAACTTCGTCAACGGAAACAGATTCGCCGATCCGGAGCAGGAGTGATCAGCCGCTGGCGCATTGAGCAGTGCAGCGAACTAGCGCCCATCCTGTGCCTGGCTCCTTTGTACCTGTCCACGCCGACGAAACGCCCGATGGCGCTGTTTTTCAGACGTATCATGCTGGCCACCCTGCAGCTACTCCTATCGCGGTACGCCGTGGGGTTATAGCGGTCCGGCTGTCGGGGACCGATGACCAGACCAGCCAACGTCCGATATCACGAAGGGATAAATGCAGCAAATGCCTGAGCGGTTGTAAGTTCCGGCAATAACGTCGGCAACTTTGGCGGCTTCCGCTTTCCATTAACAAAACTTTCGCAGTAAATCCCATGACACAGACAGAATCAGCGAGATTCTGCACGCCCGGCGGCGATGTGCGCCAGCGGAGTCGTCTGCGGCTTCGGCTGGTAAGCGAAGCCGGAGGGGAAAGATATTCCCTGCGTGAATATCTCCGGTAGCCGGAGGCGTATTTCCGTATGTCGCCGGAAGACTGGCTGCAGGCAGAAATGCATGGTGAGATGTGTGGCGCTGGTCCACAGCCAGCGCATTGGTCTGCTGGCTGAGTGAGGCCGACCGGCGGCTGCATGCAGGTGCAGAGTGATTTGCCGGTGGCTGGTCTGCCGGGGGACGGATTCATACAGTTCCGCTGTCGTGCCTCAGCATCTCACCGGGCGGCGGCAGTTGAGCACGGTGTGACCTACTGTTACACGGAGCCTCCGTACCCTTATCATCTGCGGGGATTGAGATGCCGCTCGATTTTCATCGTGAGGATGACTGTGGCGTAACGGCCAAATGCTCTATTGGATAATCTGGAGGAGGCGACGGGGCTGTATCAGGTGCCGTTGTCAGCGGCACAGCCGGGCGATGTCCTGTGCCTGTTTGGTTCATCAGTGCCGAATCACGCCGGCATTTACTGCGGCGACGGCGAGCTGCTGCACCATATTCCTGAACAACTGAGCAAACGAGAGAGGTACAAGGACAAATGGCAGCGACGCACACTCCCTCTGGCGTCACGGGCATGGCGCATCTGCCTTTACGGGGGATTTACAACGATTTGGTCGCCGCATCGACCTTCGTGAAAACGGGGCTGAAGCCATCCGGGCACTGGCCACACAGCTCCCGGCGTTTTCTTGCTTCCAGACTGAGCGACGCTGGTATCAGGTACGGACTTGCCGGTGGCACGGGTGAGGCACGTCCGGGTTAACGGCGCAGTTGCCATCGAGACTCTGCCTGATGGCGCTGTAATCATATTGTTCCCAGAGTCGCCGGCCGGGCCAAGTCAGGGCGTATTCCAGATTGTCCTGTCGCAGCCGTGCCCCGGCAGGTTGCGCCTAAGCTTGGTTCTGTTCTGCAAGCATCGGCCGATGTCTCGTACCGGGGTGAGTTGAAGCGGCATTAATGGCATGCCGTGGTTTCTCCTTCAGTGGTCTTAGTGCTTCGGCGTGCATGTCGGTGGCGTACGAAGCCAGAACTCCCCGTACAGAAGACAACGGATAACGTAAGCAGAACACCTATTTCTCCTCACTGGATAACATGGTTGCCCCAGGGCAATGTTCTGCTGTGGTCTAGCGGAAATCGTGAATGCGCGCGTGGGGTCACGCGTTGGTTTCTCAGGAGATCAGCACGGCAGACGAAGGGGACGGTGGTCAGGTTGGTGATTGGTCGCTGATCTGCAAAGTGTTTTTATGTGTGAAACCGCCTGCGGTGGCGGTTTGTTATTTATGAGCGTGGGAATGGGTAAAGGAAGCAGTAAGGGGCATACCCCGAGCGAATGAAGGACAACCTGAAGTCCACGCAGTTGCTGAGTGATCAGCCATCGTTCCGAAGGGCCGATCTTGAAGGTCCTTAATGGCTTAAAGCGTGCTGCTGAACAGTACGCCGGTGCTAACACTGAGGGAATACCAACATATCCGGTGTCACGGTGTTCCGGGCTGATGAGCAGGAGCACTCCGCCATGAGGGATTTGAATCCCCTCGGAGACGGTGCTGGGTACGGAAGTGAAGAATATGACCCCGTACTCAGGGTAAGTCAGCCGTCTGCAAACATCGACCGTGCGCTTTACCTTCGGCGGTGTACAGGCACTGGTGGAACCTCAAAAGCTGACAGGAATCCGTCCTGAAGTCTCGCCTGCTGGTTCAGATACAACGTAACGTGGCTGGTACGTAAAAAGACATCACCATTAAGGGCAAAACCATAGCGCAGTATCTGGCCTGCTGTGGTATGGTAAGCTGCATCATGCGCCCGTTTTAAGCTGTACGCAGGGCCCGACGCTGACAGCACCACAGACCAGCTGCAGAACAAAACGCTCTGGTCGTCATACACTGAAATCATCGATGTGAAACAGTTGCTACCCGACACGGCACTGGTCGCGTGCAGGTGACTCGAGCAGTTCTGGCAGCCACCAGCAGTGAGCCGTAATTATCATCTGCGCTGGCGTATTCTGCAGGTGCCGTTGAACTATAACCGCAGACGCGGCACTACAGGGGTATCTGGGACGGAACGTTTAAACCGGCATACAGCAACAACATGGCTCTGTCTGTGGGATATGCTGACCCATCCGCGCTACGCATGGGGGAAGCGTCTTGGTGCGGCGGATGTGGATAAAATGGGCGCTTATGTCATCGGCCAGTACTGCGACCAGTCAGTGCCGGACGGTCGCGGCACGGAGCCGCGCATCAGCTGTAATGCGTACCTGACCACACAGCGTAAGGCGTGGGATGTGCTCAGCGATTTCTGCTCGGCGATGCTGTATGCCGGTATGGAACGGGCAGACGCTGACGACGTTCGTGCAGGACCGACCGTCGGATAAGACGGTACTATATAACCGCAGTAATCTTATCGCCGGATGATGGCGCGCCGTTCCGCTACAGCTTCATCGCCCTGAAGGACCCCCATAATGCCGTTGAGGTGAACGGATTGACCCGAACAACGGCTGAGAAGACGGCGACAGAGCTGTTGAAGATACGCAGGCCATTGCCCGTTACGGTCGTAATGTTACGAAGATGGATGCCCATTTGGCTGTACCAGCCGGGCAGGGGCACAGCGCCGGGCTGTGATTATTACAAACAGAACTGCTGGAGAAACGCAGACCGTGGATTTCAGCGTCGGGGGCAGAAGGCTTCGCCATGTACCGGGCGATGTTATTGAAATCATCTGCGATGATGACGTATGCCGGTACCACTACCGGTAGTCGTGTGCTGGCGGTGACTATAGGGAGCCACACACCCGGCGGACGACGCTGACGCTCGACGTGAAATCACGCCTGCCATCCTCCGGTACGCGCTGATAAGCCCTGGTTGACGGAAGTGGCAATCCGGTCAGCGTGAGGTTCAGTCCGTCACCGACGGCGTGAAGGTAAAGTGAGCCGTGTTCCTGACGTGTCCTGAATACAGCGTATGGAGCTGAAAGCTGCCTACGCTGCGCCAGCGACCTGTTCGCTGCGTGAGTATCCGTGAGACGACGACGACGGCACGTATGCCATCACCGCCGTGCAGAGCATCTGTGCCCAGGGAAAGCCATCGTGTAATAACGGGGCACATTTGACGGCGAACAGAGTGGCACGGTGAATGGGACCTGTGTCGCCACCTAGCAAGTCCATAGGCAACCGCAGAAGTCAACTGCAAGACAGCGGGGAATATCAGGTAGGTCGGCGCGATGGGACACCGAAGGTGGTGAAGGGCGTGGATTTCCTGCTCTGCGTCAACTCGTAACAACCATGGACGACGGCAGTGAGCGGCTCAGTCACCTAACGACCGCCGGACGACGGAAACCACATACGCTTCACGCAACGCTGGGGAACTACAGGACGAAACACGTCCGGGCGGTAAATGCGTGGGGGCAGCAGGGCGATCCGGCGTCGGTATGCCGTTCTACACGATTGCCGCACCGGCAGCACCGTCCAGGATTGAGCTGACGCCGGGCTATTTTCAGATAACCGCCACGCCGCATCCTTGCCGTTTATGACCCGACGGTACAGTTTGAGTTCTGGTTCTCACGGAAAAACTAAGATTGCGGAGTCAGACAGGTTGAAACCAGCACGCGTTATCTTGGTACGGCGCTGTACTGGATAGCCTCAGTATCAAGTAAATGGACTGCCATGATTATTACTTTATATCCGCAATGTGAACACCGTTGGCAAATCGGCATTCGTGGAGGCCGTCGGTCGGGCAGGGATGATGCGGAAGGTCTCTGGATTTTTCGAAGGCAAGATAACCGAATCCCATCCGGCAAGGAGCTGCTGGAAAAAGTCGAGCTGACGTAGAGGATAACGCCAGCAGACTGGAGGAGTTTTCGAAAGAGTGGAAGGATGCCAGTGATAAGTGGAATGCCATGTGGCTGTCAAATTGAGCAGACCAAAGACGGCAAACATTATGTCGCGGGTATTGGCCTCAGCATGGAGGACACACGAGGAAGGCAAACTGAGCCAGTTCTGGTTGCCGCCAATCCGTATCGCAGGTTTATTGATCGAGCAAACCGGGAAGGCGAACGCCGATGTTGGCGCAGGGCAACCAGATATTCATACGGACGACTGTTTCCTGAAGCGCCTGACGGCCTCCCACCATTACCAGCGGCGGCAATCCTCCGGCCTTTCCTGACACCGGACGGAAGCTGGCACGCTAAATGCGGATATCAGTGGCAGTGTGAATGCGAACTCCGGACGCTCAGTAATGTGACGACTACCTGAAAACTCTGTACGATAAACCGTACGCTGAGGGCGGAAAAATGTCGGGACATTAGGGCAAAGGCGGGGCCGGCTTTTCTAGGGGCTCCGTCAGGACGCATGTACTGGCCCGTTAGATAGCCCGTACTGTCACCGTGACCGATGACCATCCTTTTGATCGCCATATAGTGGTGCTTCCGCTGACGTTTCTAGGGGACTGTAAGCGATCTGTCATATAGCGGCATAGAACGTATTCGATGTTATCTGAAAGAGTACTGATGAACCGCCTTGCGGTACTTTATGATGGCGCGGCGAACGAGCGCGGTACAGGTGTTCCCCGTATGTTAGGATCAGCGGGTCGGGGAAACGTGATCCTGACGTTCGCACCCTTACGTCAACCCTAAGCATTCGGCAGATATTCCGCCGTATACGTTTGCCAGCGATGTGCAGGTTATGGTGATTAAGAAACAGGCGCGCTGGCATCAGCGTGGTCAGTGTTACACAGAGGTTCGTCCGGGACGGGCGATTTCTATTATAAACAGTGAGAGGTAGACGATGCCGTAATGTGTGTATTGCCGTACTGTCTTGCCGCATTTGCGGACAGATGATGCTCCGCCCGTGCGTCGAAGGTGACATGGTACGTTTACGGTGGCTATGTTCAAGTGAAACCGGGTACATTGCCGTCGTTGCTGCGGGGATATACAGCGGTGTGAGTCATCTGAAGGGATTAACGTGAAGTACATTAGTTGAGCTGACCTAACAGGGTCGGGGTGATGGCTTCCGGCTTCGCCGCGTCGAAAGAGCAGCACAGTGATGACGACCGAGGATAGTTCTATGGCGAGCCTGCGTGACGTTTGGTGCTAGGTGATGATGGACTCGCGTTGCGTAATACCCAAATCAGTAAGCAGGTCAGTGCGTACGCCATGGCCGATGGCTCACACAGTCGGTGGTCCGGCAGTACAATGGATTACCGTACAGACGAAATCACTCCCGGGTATGAAGGGACGACCTAACTCAGGGACGAAAGTGCAATGCGGCATACCTCAGTGGCGTGGGAGTGCAGGTACAGATTAATCCGGCAGCGTCCGTCGTTGTCGATATTGCTTATGAAGGCTCCGAAGGCAGTGGCGACTGGCGTACTGACGGATTTCATCGTTGGGGTCGGTTATAAATTCTGATTAGCCAGGTAACCCGTTATGACAGCCGCATGGAACGGTGGGCTTTGTGGGGTAAGAATATGAAGTAAAGATTTCAGGAGTCCTGAGAAGACGCACAGGAAAAACCGGTACTCCGACTGCACCATTCAGCTGAAAGCCAGACGTAACAGCACCACGGTGGTGGTGAACACGGTGGCTCAGAATCCGGATGAAAATGGCCGGGCGTTACAGCATGGATGTGGAGTACGGTCAGTACAGTGTCATCCTGCAGGTCGACGGTTTCCGCCCATCATCGCACGGGACCATCACCGTGTATGAAGAAGATTCACAACCGGGACGCTGGACTGATTTCCTCTGTGCCATGACGGTCCGGAACTGATGCCCGGCCGGAGGTGCTGCGTCGTCTTGAACTGATGTACGAAGAGGTGGCGCGTAACGCGTCCGTGGTGGCACAGAGTACGGCAGACGCGACGAAATGAGCCGAGCGATGCCAGTCGTGCATCAGCTGCTCAGGTCGCGGCCCTTGTAACTGATGCAACTGACTCAGCACGCGCCGCCAGCACGTCGCTGGACAGGCTCCACCGGGGACGTCAGGCTCAGGAAGCTCCTCCGGCGCATAAGAAGCGGCATCATGTAAAGGCCACTCCCACGGACCGAGGGGCAAAATAGGTCTCATGCAAGCCGCAAGAGTCAACAACGTTCTGTTTGGTA
>149
AAGGGCCATTTCGCGGTGGGAGTGGGGGCATGCGTAGCAGGCTGGGCACTCACCGGGCCGGTGCTTTAGACACGAAGATCCGGGTCGAGCGCGACCCTGAGAGCCTCGTAACGTAAGGCGAGGTCGAGTCGAGACTCCATCACTCTATCGGAGAACGAGCATGGGGCTAGGGTCGCATCTCCGCATCGCGACGATTTCCACTCCGGCAGCCTCCCAGCTACTCACCGTTAATCCTTTCCCCGAAGCCACTGCCGGACATGAACCGCGACAGGCTTTCACTGTCTGTTCAGCATCCTTGCCGCCCGACTCATGAGCGGCTCTAATCGCACCACGTTTCGGGGGCGCAGTCCTCCGTGGCCGCTCAGCGGATTCTTCTTCGCTTAGATCTGTTTCGGATCAGGCATTCTGCAGCCCCTGGCGTGGAATGGTTGTCGTGTGCACATCGCGCGCAGACGGCGCTTTCAATCATCAGTAAACCGCCCGTCTTCAGGGACAGTAATGGTTCCCTTTGGTTCTTATACGCACTGTTCTGCCTTAGATTCCTGCACCCAGGTGGCGTGAGCACCATGCAGACAGGTCACCGTTCACAGCAGTCTACGTGAACAGCCGTTATTTCATGATTCGGTGCTTTTTAGCCAGGAGTAAATGGTACTCCCGCCGGGTTGCTCTGGCAAATCGCTTCATTTCATCCAACCGCAGCAATACCTAAGTCGCCGCTCAACCGAATGTTGACGTGCTCCAGCAGCCCGTTCACGGTGGGTCGGGCCTGGCCCACCTATCGCATTTGCCATTTGGCCGAAGGACGAGACACTTGTCATGCTCACCGGCAGCCGCCGGTCAGCGTTGGTTATAATGCCGTTCGCCCGGATGGACCCAGCAGTCGCCTTCATTCGATTTGCCGGGACATGTTGAACTAGAACATTTTAGTCAGTGTATCTTCTGATCAGATACGGACGTCCGCGTGATTTCGATTCTAATCGGACATCGTCGATCAGCGTCGCCGAAGTCTCCCGCGCGATGGTCGGTACCAAGCGCCGCCAGCCAAGCCTGGATTCGGTTCGGGAAGCGTCACCCCGACTGACGCGTGCCTGCATCGCCTAGAGCGACGCCCTTAGTCACGTAACTGGAACGAACCGCCCCCGGCTGCCCATAGCTCCGAATGTTACGCCGATTCGAGTCGGAGAGTGCGTCAAACTGCACGGTACGTTAACCTGCCAGACGGATTCCGGTTCCTCGATAAGCGTCATTCACTAAGTCACCATTCGCCTTATTCATCTGGTGACTTTTACAAGCCTCCCGGCTGGGGGTAAGCTTCCCAATCGATTTGCAGTCGCTAATCACATCACGGTAGGGCGCCAGGTCGCGCATTCTGCCCGGCATTGACGAAGCTTTATCACAGGCACCGTTGACAGGTTTCAGCACTCCACCTGCCGTGAACGACCATACTGTATAGGATAAACGTCACGGTAGTCGACTAACTCGAGGCAGCATGGACTGGTGGCCTGATCTGACGGTTAGATACAAAGCTCGCTCTAAGCTTACGACATTCCCGGACAGAAACGAGCCCCGTGAGGCGGCTGGAGGCAGGAGTATTCACAAACTGCATAAGTCAGATGACATGTCATGTCACCACGTGCCCCCTTCAAAGCTCAATGAGAACTGCCGCGGTTCCTAGCGTAAAGGCGGACGAGCCCTCATCGACCGTCACCCGGTGTGGTCCGATCGGTCGCGTACATTAGAAATCGCTCCGCGTCAAATCTCTGTTCGCCCTTTATCCACCAAACCTCAGTTGATGCTTAGGCGACTCCGCAGCTCTTTCCGGAGATGTTCTAGTATCCGCTCAACTCTTTTGTTCCTCACTGGGGTTGGACAGGCCATCAGCATTTCACAGTAAATGGGACCTTTTCCCACCTAGTCCGTAAAACCGCACCGGTTTCAGAATTAGCGTAAGCGCCGGGAACTAGGTTGTACCCGCCCAAATCATAGCTAGATCAGGTTTCAAGAACAACCTGCACTTTTACCGCGCCTGTAGGCCAGGACCAAGCGATCGCGGGTGATGCTGAAATCCTAAGAATTTATATTTATGCATCTCATGCCTTTTAGGTCACCGTCCGCTCATCTAGCTTTCGCTTTGACGAACTTCCAAGCGTACCTTTGTAAGTGGGGTATTGGTACCCCGACTGCGAATGAGCAGGTGGAGCAACGCGGTCATCACATTGCGGCACGCCAGGCACCCGTTTCCGTCGACAAGATTTTCGCTGGACCGTAGCCGACTATTTTTATACCAAGCCAGCCGAGTTGCCAACGCGACATTTAACGCAGCGGTACCGCCGATTCTAAGCCCATCGCACTGGTGACCTAAGCGCCATCATCTACGGCGGGCAGTGGTACAGGCAATTTTAGCTCGCCGATGGTCACATATTTACCGCATTCCACGCCTCATCCGGTCTAGGCTCGCCACTAACTCGTGAAGCTGTCCCGCCCCACCGTCAGCAGCTGTTCGAACTACTAGCCTAGATCTACAGAACTGATAGCCTCATGTGATGGTATCGTCTGGGTTCCGCTTATAGAACTTAACTTTCTAGCACCAAGTGAAGTGGAAAACGAGCCGGTGCTGCGAGTGCACCGCAGAGACGACGCGGTTATTGCATTCTCCAGCACTGGTTCCTTTCGACGCTGCCACGGAATGAGCTGAAGAGGCTAGAAACGCCGTTCCCGGCAGCACAAGTCGCCACAGTCAATCGATCCATGTACATCCAATGAGAGCTGAATAAACGGTCTACCTCCAGTTAGGACGCTTCGCGCGTCAGGTACGAATCGCTGTAGGGCCGTCTTAAGGACGCTAAATCCCGCGCTAGCGATTTTCGACATGTCCCTTCACGCCCCTTTTCTAGAGCTCCGGATGTCATCTCACGTGCTGACGGTCGTAAAGCTCTATTTCATGACTGCCGCTAGAGCGCCATTCTTTCGTCACCGTTGGACGGTAGGCCCGTCCGTGTTCAACGAGCGGCGAGATAGGGAGATGCGTGCTTCGTGAACGGACTAGCCCGCGGAGCCATCGCGGAGCAGCCACCGATAGTCGACAAGTTGTGAGCGAACCTATCGATCGCGCCCGAGCGATGCTCACGGTTGCTCATCTACCGATCATCAACGCGCCAAATGCGTGGCTTAAGAGCTAGGCGTATTACCAGTTCAGCTACCAATGAAGGCGTCCGTTACTAGGTTGACGCTTCCCCATCCGCTCCGTGGCAACTACGCTAGTACGCACTCTGAGTTGAGCTGAGTGGTTTCCCCAAGCATCGTTAATAACAGGAAACGCTTCTTTTGACGCCCATTTCAATCTTTAGAAGCCGCCACCAGTATCAGACCTACGCCAACGATCTAGATCCGCCCCTTTAGGCGTATTTCGCCGTCTCCATACCGCATCCAGAGCACTCCGGTCTATGTTGACGGTCGAGCGAATCTAAGCCGCGGAGCGTAATTTCGATCCAGCCATCTAAGCCAGCGCTGGCGTTCAACATGCTGCTGGATGCCATCGTCATTCCGTAACGGTGGGTTGTAAGTCCTCCACAGACTTAGCACGTTGAGCCAGATCACGTTGATGTTATTCTACGCTTAAAGCCGGTAACTCACCGCTCAGGTTGAGAGCGCGTCACGGTGATATGTATTGCTAATGCCTCAGGGCGCTCTTCCTGCAGGTTAGTAGCGGACCGACTTCGTCGACGCATGTTCTCCAACCATCACTGATGCGGCGGCTGCACTACCCCACGTGGTACGCGCTTCGTCCGTATGTCGAATGAAGGCAGCGCGGAAGAACTATATCGCGATCAATTCATTAGTTCATGTAGGTCGCGGCTGCTGTTACAGATACCGGCACGGAGGCGCGGCTCCGGCCCGGAAGCCGTGAGAGTGGTTCCACCGCGGTTCTCCATTTAATCAGAATTTACGAGACTGCCTGGCATTTCTTCTAATTGCTCAAGGATCACCTACGGAGAGGGAGCGCGAAACGCTAGATCATGTTCAGATTTCTGACCGCTTGCCCTAGACGAGTTCACAGTTGTGTATAGACCCTAAATCCCGTAGCTAGATCGCCACGGGAATAATTCAAGTGAAACAACAGCGTCAAAACGATTAGTGCCGTTGCTGAAATAGCGATTCACTTTCGTCTCGTCGGTGAAGCTATACACCACCGCCAAGGGACAGACCCTAAGAAAGCTTAGACTTGTAAATACTTCTAGCGTATTATTGCTTCACAGCATGAGAATGCAATAGGAAGGGTAAAGAACGTCATGCTGCCGATGCGGCAACGCTCCGGGTCTCTCGCTGGCCGATTCCAGCATCCAGCACGTAACGTCCAGGCGCTTTCTAGACCGAGCTAGAACCATTGCGGTGATAGCATAAGTACTGTTACGCGACGGCATCAAGCTGACTGACATTTCTTTGCTCGTCACGGCATATGCTTAAAGTGTTTGGGGTGGGTCTACTGAATAGATGTGACGCCGGGTCATGCTTCCGGCTAGCGTTACATTGTAAAGGCCATTCCAAACAGCGATCCGCGTGATGCTGTCAATGGGTTGGTGCCTCTGCGGCCGCATTAGCAGGCGTACCGTTGCGGAGCGAACCTAGGGATGTTAGAGCGCCGTTAAACTTTCTTCGCGTCCGTGAGCCTCCTCACAGTTTGAGGATCCCCATAATGCGGCTGTTTTCTGCCCGCATCCGATCCGGTGATCTGCGCTTTCTAGCTTTCCCTTGGGTCTCACCTTATGGGGCTAGTTTCTTATCCCCCTCCGTCATGCACCGTCAGTGACTAACGTCAGCCTGCGAAGCAGTGGCTGAAACATTGTTGATTGAGTCTCTTTGGTCATGCCCTCCTGAGAAGGCTTCAGACCTTGCATCCAGTTGCATCACGATGAATGATCGCATCGCTGCTGTTCTGACAGTTCATCAGCCATTCGGGGATGCATCTAGCCCACTTCCTAAACCCCACTGGCAGCTAGATACTCCAGCGCTCACGTAAAGCGTATATGCCGACCTTCTGCGCAACATCTGGCGGGTTGCGTCCATCGAGACTGCAGTGTCTCGAACGTCGCAGGTAGGTCACCGATTGCTGTATGCCATCCTTATTAGATGGCTGCCGCTGTAAATCAGCGTGATTCATAAGTGTTTCTGCAGCCAGCGCATAAGTATGTAATTAGTCAGCCGGCCTGGCCATCATGTCGGGCGGTCTGCGTGAGACGGGGAGGGGCAGGGCAGGCAACGTACTTAATTGGGCATTCGGTCGTTTAGCAAGCGCCCATACACCGGTTTATGTCGCACGCTGCAGCAATGGGTTGTCAGGCAGTCAAATCCGCCACCATCCGCCACGGGCGGTGCCCATCGCAGCGAATGGAGTCCACCGTAAGGTAGTGAAGCTGTTTGAACGGGCGTAATGCCGTTGTATAACCGGGTCATCCCCAGTACGGCTGCAGCGCCGATTTTCAGGGCCGTACGCACCGTCTAAGCACGGCGAAGCGCTGGTTCAGAAGGTCCATTCAATATAAACCTCTGCGGTAGAGGGTGTCCAGTCTGTCATTCACTCATCAGGCTCTTCCGGGGCCGTCGCGGTGCCCTCGCGTCAGGCTGTCTCAGGCCGATCGCTTCCTACAATCCCGACGGCCTGCACCAGCACAAAAGAAAACCCGCGGACAGTGGATTGCTTCAAGCGATAGGCTCATTAAAGGCTGCTGAAGCTGGCAGGAAACCCGCAGGTGCTTAATCCTTCCTCCTCTGTTGATTGTCGCAGCCGTGGATGCTGCAGCCGCCAGGCGGGCGGTTGAAGCTACCTGCACGGCGCCTACACTCCATCGTTTCACGACCTGCTGGCGAACTTCCTGATAGTCGTCACCGTTTGCACCTCTTTCTCGTAGACTCATTTAAGCTTCTATCAGCATCACCGCTTCCTGAATTCTTTCGTAACATCCACGATACGACCCTGAGCCTATCCAGTCGCAGTTCCCCAGGGCACTGCGATTCCTGAAGCTGGACAGGCGCTTTGAAGCTACGTCACGCGGCGAACGAGCCCCTTCTTGCGCAAGAGCAGAAACATCTGAGCCTGACACGGGATGCGACGAATTTTGTCGCCCCCATAAAGTACGGGACGAC