diff rnaz.xml @ 1:e23c455f8335 draft

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rnaz commit e02ab52f82468dc7751e6564bdf6e959bbba3a65

--- a/rnaz.xml	Sat Feb 22 08:00:02 2014 -0500
+++ b/rnaz.xml	Wed Mar 01 17:15:13 2017 -0500
@@ -1,49 +1,154 @@
-<tool id="rnaz" name="RNAz" version="0.1.0">
+<tool id="rnaz" name="RNAz" version="2.1.0">
     <description>predicting structurally conserved and thermodynamically stable RNA secondary structures</description>
-    <version_command>RNAz --version</version_command>
+
     <requirements>
         <requirement type="package" version="2.1">rnaz</requirement>
     </requirements>
-    <command>
-RNAz $input
-$forward
-$reverse
-$both_strands
-$dinucleotide
-$mononucleotide
-$locarnate
-$no_shuffle
-#if $cutoff_p != -1:
---cutoff=$cutoff_p
-#end if
-&gt; temp.txt;
-grep -v -E "^ |^#|^$" temp.txt &gt; $outfile;
-grep -E "^ |^#|^$" temp.txt;
-    </command>
+
     <stdio>
         <exit_code range="1:" level="fatal" description="Error occurred. Please check Tool Standard Error" />
         <exit_code range=":-1" level="fatal" description="Error occurred. Please check Tool Standard Error" />
     </stdio>
+
+    <version_command>RNAz --version</version_command>
+    <command>
+<![CDATA[
+    RNAz '$input'
+        --$forward_or_reverse
+        $dinucleotide
+        $mononucleotide
+        $locarnate
+        $noshuffle
+        #if $cutoff != -1.0:
+        --cutoff=$cutoff
+        #end if
+        > temp.txt &&
+        grep -v -E "^ |^#|^$" temp.txt > '$outfile' &&
+        grep -E "^ |^#|^$" temp.txt 
+]]>
+    </command>
     <inputs>
         <param format="txt" name="input" type="data" label="Input Alignment File" />
-        <param name="forward" type="boolean" checked="false" truevalue="--forward" falsevalue="" label="Score forward strand" help="--forward" />
-        <param name="reverse" type="boolean" checked="false" truevalue="--reverse" falsevalue="" label="Score reverse strand" help="--reverse" />
-        <param name="both_strands" type="boolean" checked="false" truevalue="-e" falsevalue="" label="Score both strands" help="-e" />
-        <param name="cutoff_p" label="Probability cutoff" type="float" value="-1" help="-1 to deactivate"/>
-        <param name="dinucleotide" type="boolean" checked="true" truevalue="--dinucleotide" falsevalue="" label="Use dinucleotide shuffled z-scores" help="--dinucleotide" />
-        <param name="mononucleotide" type="boolean" checked="true" truevalue="--mononucleotide" falsevalue="" label="Use mononucleotide shuffled z-scores" help="--mononucleotide" />
-        <param name="locarnate" type="boolean" checked="false" truevalue="--locarnate" falsevalue="" label="Use decision model for structural alignments" help="--locarnate" />
-        <param name="no_shuffle" type="boolean" checked="false" truevalue="--no-shuffle" falsevalue="" label="Never fall back to shuffling" help="--no-shuffle" />
+        <param name="forward_or_reverse" type="select" label="Scored strand">
+            <option value="forward">Score forward strand (-f)</option>
+            <option value="reverse">Score reverse strand (-r)</option>
+            <option value="both-strands">Score both strands (-b)</option>
+        </param>
+        <param argument="--cutoff" label="Probability cutoff" type="float" value="-1.0" help="-1.0 to deactivate"/>
+        <param argument="--dinucleotide" type="boolean" checked="true" truevalue="--dinucleotide" falsevalue="" label="Use dinucleotide shuffled z-scores" />
+        <param argument="--mononucleotide" type="boolean" checked="true" truevalue="--mononucleotide" falsevalue="" label="Use mononucleotide shuffled z-scores"  />
+        <param argument="--locarnate" type="boolean" checked="false" truevalue="--locarnate" falsevalue="" label="Use decision model for structural alignments" />
+        <param argument="--no-shuffle" name="noshuffle"  type="boolean" checked="false" truevalue="--no-shuffle" falsevalue="" label="Never fall back to shuffling"  />
     </inputs>
     <outputs>
         <data name="outfile" format="fasta" />
     </outputs>
-    <help>**What it does**
-     RNAz is a program for predicting structurally conserved and thermodynamically stable RNA secondary structures in multiple sequence alignments. It can be used in genome wide screens to detect functional RNA structures, as found in noncoding RNAs and cis-acting regulatory elements of mRNAs.
+    <tests>
+        <test>
+            <param name="input" value="rnaz_input_trna.aln"/>
+            <output name="outfile" file="rnaz_result_trna.fasta"/> 
+        </test>
+        <test>
+            <param name="input" value="rnaz_test_input2.aln"/>
+            <output name="outfile" file="rnaz_result2.fasta"/> 
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+
+**What it does**
+
+RNAz is a program for predicting structurally conserved and thermodynamically stable RNA secondary structures in multiple sequence alignments. It can be used in genome wide screens to detect functional RNA structures, as found in noncoding RNAs and cis-acting regulatory elements of mRNAs.
+
+**Input**
+
+Input is a multiple sequence alignment file. Currently the the following alignment formats can be read: CLUSTALW, FASTA, PHYLIP,NEXUS, MAF, and XMFA. Alignments can be generated by any sequence based alignment program. Sequence alignment tools can be found in Galaxy too (e.g. ClustalW).
+
+Example: 
+
+CLUSTAL 2.1 multiple sequence alignment
+
+
+sacCer1         GCCTTGTTGGCGCAATCGGTAGCGCGTATGACTCTTAATCATAAGGTTAGGGGTTCGAGC
+
+sacKlu          GCCTTGTTGGCGCAATCGGTAGCGCGTATGACTCTTAATCATAAGGCTAGGGGTTCGAGC
+
+sacBay          GCCTTGTTGGCGCAATCGGTAGCGCGTATGACTCTTAATCATAAGGTTAGGGGTTCGAGC
+
+sacCas          GCTTCAGTAGCTCAGTCGGAAGAGCGTCAGTCTCATAATCTGAAGGTCGAGAGTTCGAAC
+
+                \** *   * \** \** \**\** \** \**\**  * *\** \**\**\*  *\**\*    * \**\**\** *
 
 
-Gruber AR, Findeiss, Washietl S, Hofacker IL, and Stadler PF. 
-RNAz 2.0: Improved noncoding rna detection. 
-Pac Symp Biocomput, 2010. 15:69–79.
+**Output**
+
+In Galaxy RNAz gives you 2 output files: a summary file and a result file. For the example input they look like this:
+
+Summary:
+
+ Sequences: 4
+ Columns: 60
+ Reading direction: forward
+ Mean pairwise identity:  82.50
+ Shannon entropy: 0.28395
+ G+C content: 0.51667
+ Mean single sequence MFE: -16.67
+ Consensus MFE: -15.59
+ Energy contribution: -15.53
+ Covariance contribution:  -0.06
+ Combinations/Pair:   1.26
+ Mean z-score:  -0.66
+ Structure conservation index:   0.93
+ Background model: mononucleotide
+ Decision model: sequence based alignment quality
+ SVM decision value:  -0.64
+ SVM RNA-class probability: 0.238023
+ Prediction: OTHER
+ 
+ 
+Result file:
+
+>sacCer1
+
+GCCUUGUUGGCGCAAUCGGUAGCGCGUAUGACUCUUAAUCAUAAGGUUAGGGGUUCGAGC
+
+..((((...((((........))))....(((((((((((....))))))))))))))). ( -19.00, z-score =  -1.44, R)
+
+>sacKlu
+
+GCCUUGUUGGCGCAAUCGGUAGCGCGUAUGACUCUUAAUCAUAAGGCUAGGGGUUCGAGC
+
+..((((...((((........))))....((((((((..(....)..)))))))))))). ( -16.00, z-score =  -0.11, R)
+
+>sacBay
+
+GCCUUGUUGGCGCAAUCGGUAGCGCGUAUGACUCUUAAUCAUAAGGUUAGGGGUUCGAGC
+
+..((((...((((........))))....(((((((((((....))))))))))))))). ( -19.00, z-score =  -1.44, R)
+
+>sacCas
+
+GCUUCAGUAGCUCAGUCGGAAGAGCGUCAGUCUCAUAAUCUGAAGGUCGAGAGUUCGAAC
+
+.((((((..((((........))))..............)))))).(((......))).. ( -12.69, z-score =   0.35, R)
+
+>consensus
+
+GCCUUGUUGGCGCAAUCGGUAGCGCGUAUGACUCUUAAUCAUAAGGUUAGGGGUUCGAGC
+
+..((((...((((........))))....(((((((((((....))))))))))))))). (-15.59 = -15.53 +  -0.06) 
+
+
+
+
+
+
+]]>
+
     </help>
+
+    <citations>
+        <citation type="doi">10.1142/9789814295291_0009</citation>
+    </citations>    
+    
 </tool>