changeset 0:3b4ed0e473dc draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/sailfish commit bd2dd2419ea52f30cd7de2f7109a12b49b5d0dba-dirty
author bgruening
date Fri, 16 Oct 2015 15:09:03 -0400
parents
children 06646e81c543
files README.rst sailfish.xml static/images/ReadLibraryIllustration.png test-data/reads_1.fastq test-data/reads_2.fastq test-data/sailfish_bias_result1.tab test-data/sailfish_quant_result1.tab test-data/transcripts.fasta tool-data/sailfish_indexes.loc.sample tool_data_table_conf.xml.sample tool_dependencies.xml
diffstat 11 files changed, 80965 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/README.rst	Fri Oct 16 15:09:03 2015 -0400
@@ -0,0 +1,53 @@
+Galaxy wrappers for sailfish
+=====================================
+
+These wrappers are copyright 2014 by Björn Grüning and additional contributors. 
+All rights reserved. See the licence text below.
+
+Currently tested with sailfish 0.6.3.
+
+
+Automated Installation
+======================
+
+Galaxy should be able to automatically install the sailfish for you.
+
+
+History
+=======
+
+======== ======================================================================
+Version  Changes
+-------- ----------------------------------------------------------------------
+v0.6.3.0  - First release
+
+======== ======================================================================
+
+
+Bug Reports
+===========
+
+You can file an issue here https://github.com/bgruening/galaxytools/issues or ask
+us on the Galaxy development list http://lists.bx.psu.edu/listinfo/galaxy-dev
+
+
+Licence (MIT)
+=============
+
+Permission is hereby granted, free of charge, to any person obtaining a copy
+of this software and associated documentation files (the "Software"), to deal
+in the Software without restriction, including without limitation the rights
+to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
+copies of the Software, and to permit persons to whom the Software is
+furnished to do so, subject to the following conditions:
+
+The above copyright notice and this permission notice shall be included in
+all copies or substantial portions of the Software.
+
+THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
+THE SOFTWARE.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/sailfish.xml	Fri Oct 16 15:09:03 2015 -0400
@@ -0,0 +1,324 @@
+<tool id="sailfish" name="Sailfish" version="0.7.6.0">
+    <description>transcript quantification from RNA-seq data</description>
+    <requirements>
+        <requirement type="package" version="0.7.6">sailfish</requirement>
+    </requirements>
+    <macros>
+        <xml name="strandedness">
+            <param name="strandedness" type="select" label="Specify the strandedness of the reads">
+                <option value="U" selected="True">Not stranded</option>
+                <option value="SF">read 1 (or single-end read) comes from the forward strand</option>
+                <option value="SR">read 1 (or single-end read) comes from the reverse strand</option>
+            </param>
+        </xml>
+    </macros>
+    <stdio>
+        <exit_code range="1:" />
+        <exit_code range=":-1" />
+        <regex match="Error:" />
+        <regex match="Exception:" />
+    </stdio>
+    <version_command>sailfish -version</version_command>
+    <command>
+<![CDATA[
+
+        #if $refTranscriptSource.TranscriptSource == "history":
+            sailfish index
+                --transcripts $refTranscriptSource.ownFile
+                --kmerSize $refTranscriptSource.kmerSize
+                --out ./index_dir
+                --threads "\${GALAXY_SLOTS:-4}"
+            #set $index_path = './index_dir'
+        #else:
+            #set $index_path = $refTranscriptSource.index.fields.path
+        #end if
+
+        &&
+
+        #if $single_or_paired.single_or_paired_opts == 'single':
+            ln -s $single_or_paired.input_singles ./single.$single_or_paired.input_singles.ext &&
+        #else:
+            ln -s $single_or_paired.input_mate1 ./mate1.$single_or_paired.input_mate1.ext &&
+            ln -s $single_or_paired.input_mate2 ./mate2.$single_or_paired.input_mate2.ext &&
+        #end if
+
+
+        #if $geneMap:
+            ln -s "$geneMap" ./geneMap.$geneMap.ext &&
+        #end if
+
+        sailfish quant
+            --index $index_path
+            #if $single_or_paired.single_or_paired_opts == 'single':
+                --libType "${single_or_paired.orientation}${single_or_paired.strandedness}"
+                --unmated_reads ./single.$single_or_paired.input_singles.ext
+            #else:
+                --mates1 ./mate1.$single_or_paired.input_mate1.ext
+                --mates2 ./mate2.$single_or_paired.input_mate2.ext
+                --libType "${single_or_paired.orientation}${single_or_paired.strandedness}"
+            #end if
+            --output ./ 
+            $biasCorrect
+            --threads "\${GALAXY_SLOTS:-4}"
+
+            #if $fldMean:
+                --fldMean $fldMean
+            #end if
+
+            #if $fldSD:
+                --fldSD $fldSD
+            #end if
+
+            #if $maxReadOcc:
+                --maxReadOcc $maxReadOcc
+            #end if
+
+            #if $geneMap:
+                --geneMap ./geneMap.${geneMap.ext}
+            #end if
+
+            $noEffectiveLengthCorrection
+            $useVBOpt
+            $allowOrphans
+
+            $unsmoothedFLD
+            --maxFragLen ${maxFragLen}
+            --txpAggregationKey "${txpAggregationKey}"
+
+]]>
+    </command>
+    <inputs>
+        <conditional name="refTranscriptSource">
+            <param name="TranscriptSource" type="select" label="Select a reference transcriptome from your history or use a built-in index?" help="Built-ins were indexed using default options">
+                <option value="indexed">Use a built-in index</option>
+                <option value="history" selected="True">Use one from the history</option>
+            </param>
+            <when value="indexed">
+                <param name="index" type="select" label="Select a reference transcriptome" help="If your transcriptome of interest is not listed, contact your Galaxy admin">
+                    <options from_data_table="sailfish_indexes">
+                        <filter type="sort_by" column="2"/>
+                        <validator type="no_options" message="No indexes are available for the selected input dataset"/>
+                    </options>
+                </param>
+            </when>  <!-- build-in -->
+            <when value="history">
+                <param name="ownFile" type="data" format="fasta" metadata_name="dbkey" label="Select the reference transcriptome" />
+                <param argument="kmerSize" type="integer" value="21" max="32" label="The size of the k-mer on which the index is built"
+                    help="There is a tradeoff here between the distinctiveness of the k-mers and their robustness to errors. 
+                        The shorter the k-mers, the more robust they will be to errors in the reads, but the longer the k-mers,
+                        the more distinct they will be.  We generally recommend using a k-mer size of at least 20."/>
+            </when>  <!-- history -->
+        </conditional>  <!-- refTranscriptSource -->
+
+        <conditional name="single_or_paired">
+            <param name="single_or_paired_opts" type="select" label="Is this library mate-paired?">
+                <option value="single">Single-end</option>
+                <option value="paired">Paired-end</option>
+            </param>
+            <when value="single">
+                <param name="input_singles" type="data" format="fastq,fasta" label="FASTQ/FASTA file" help="FASTQ file." />
+                <expand macro="strandedness" />
+            </when>
+            <when value="paired">
+                <param name="input_mate1" type="data" format="fastq,fasta" label="Mate pair 1" help="FASTQ file." />
+                <param name="input_mate2" type="data" format="fastq,fasta" label="Mate pair 2" help="FASTQ file." />
+                <param name="orientation" type="select" label="Relative orientation of reads within a pair">
+                    <option value="M">Mates are oriented in the same direction (M = matching)</option>
+                    <option value="O">Mates are oriented away from each other (O = outward)</option>
+                    <option value="I" selected="True">Mates are oriented toward each other (I = inward)</option>
+                </param>
+                <expand macro="strandedness" />
+            </when>
+        </conditional>
+
+        <param argument="--geneMap" type="data" format="tabular,gff,gtf" optional="True" label="File containing a mapping of transcripts to genes"
+            help="Calculates the aggregated gene-level abundance estimations. This file should be eiher a GTF file or tab-delimited format
+            where each line contains the name of a transcript and the gene to which it belongs separated by a tab." />
+
+        <param argument="--biasCorrect" type="boolean" truevalue="--biasCorrect" falsevalue="" checked="False"
+                    label="Perform bias correction" help=""/>
+
+        <param argument="--fldMean" type="integer" value="200" optional="True" label="Calculate effective lengths"
+            help="If single end reads are being used for quantification, or there are an insufficient number of uniquely mapping reads when performing paired-end quantification
+                    to estimate the empirical fragment length distribution, then use this value to calculate effective lengths."/>
+
+        <param argument="--fldSD" type="integer" value="80" optional="True" label="Standard deviation"
+            help="The standard deviation used in the fragment length distribution for single-end quantification or when an empirical distribution cannot be learned."/>
+
+        <param argument="--maxReadOcc" type="integer" value="200" optional="True" label="Maximal read mapping occurence"
+            help="Reads mapping to more than this many places won't be considered."/>
+
+        <param argument="--noEffectiveLengthCorrection" type="boolean" truevalue="--noEffectiveLengthCorrection" falsevalue="" checked="False"
+            label="Disable effective length correction" help="Disables effective length correction when computing the probability that a fragment was generated from a transcript.
+            If this flag is passed in, the fragment length distribution is not taken into account when computing this probability."/>
+
+        <param argument="--useVBOpt" type="boolean" truevalue="--useVBOpt" falsevalue="" checked="False"
+            label="Use Variational Bayesian EM algorithm for optimization" help=""/>
+
+        <param argument="--allowOrphans" type="boolean" truevalue="--allowOrphans" falsevalue="" checked="False"
+            label="Consider orphaned reads as valid hits when performing lightweight-alignment"
+            help="This option will increase sensitivity (allow more reads to map and more transcripts to be detected), but may decrease specificity as orphaned alignments are more likely to be spurious."/>
+
+        <param argument="--unsmoothedFLD" type="boolean" truevalue="--unsmoothedFLD" falsevalue="" checked="False"
+            label="Use the un-smoothed approach to effective length correction" help="This traditional approach works by convolving the FLD with the characteristic function over each transcript."/>
+
+        <param argument="--maxFragLen" type="integer" value="1000" optional="True"
+            label="The maximum length of a fragment to consider when building the empirical fragment length distribution"
+            help=""/>
+
+        <param argument="--txpAggregationKey" value="gene_id" type="text" label="The key for aggregating transcripts during gene-level estimates"
+            help="The default is the gene_id field, but other fields (e.g. gene_name) might be useful depending on the specifics of the annotation being used." />
+
+    </inputs>
+    <outputs>
+        <data name="output_quant" format="tabular" from_work_dir="quant.sf" label="${tool.name} on ${on_string} (Quantification)" />
+        <data name="output_bias_corrected_quant" format="tabular" from_work_dir="quant_bias_corrected.sf" label="${tool.name} on ${on_string} (Bias corrected Quantification)">
+            <filter>bias_correct == '--biasCorrect'</filter>
+        </data>
+        <data name="output_gene_quant" format="tabular" from_work_dir="quant.genes.sf" label="${tool.name} on ${on_string} (Gene Quantification)">
+            <filter>geneMap is True</filter>
+        </data>
+    </outputs>
+    <tests>
+        <test>
+            <param name="single_or_paired_opts" value="paired" />
+            <param name="input_mate1" value="reads_1.fastq" />
+            <param name="input_mate2" value="reads_2.fastq" />
+            <param name="biasCorrect" value="True" />
+            <param name="TranscriptSource" value="history" />
+            <param name="ownFile" value="transcripts.fasta" ftype="fasta" />
+            <output file="sailfish_quant_result1.tab" ftype="tabular" name="output_quant" />
+            <output file="sailfish_bias_result1.tab" ftype="tabular" name="output_bias_corrected_quant" />
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+**What it does**
+
+Sailfish is a tool for transcript quantification from RNA-seq data.  It
+requires a set of target transcripts (either from a reference or _de-novo_
+assembly) to quantify.  All you need to run Sailfish is a fasta file containing
+your reference transcripts and a (set of) fasta/fastq file(s) containing your
+reads.  Sailfish runs in two phases; indexing and quantification.  The indexing
+step is independent of the reads, and only need to be run one for a particular
+set of reference transcripts and choice of k (the k-mer size). The
+quantification step, obviously, is specific to the set of RNA-seq reads and is
+thus run more frequently.
+
+When the quantification output contains a number of columns:
+(1) Transcript ID,
+(2) Transcript Length,
+(3) Transcripts per Million (TPM) and
+(4) Estimated number of reads (an estimate of the number of reads drawn from this transcript given the transcript’s relative abundance and length).
+
+The first two columns are self-explanatory, the next four are measures of transcript abundance and the final is a commonly used input for differential expression tools.
+The Transcripts per Million quantification number is computed as described in [1], and is meant as an estimate of the number of transcripts, per million observed transcripts,
+originating from each isoform. Its benefit over the F/RPKM measure is that it is independent of the mean expressed transcript length
+(i.e. if the mean expressed transcript length varies between samples, for example, this alone can affect differential analysis based on the K/RPKM.).
+
+
+
+Fragment Library Types
+======================
+
+There are numerous library preparation protocols for RNA-seq that result in
+sequencing reads with different characteristics.  For example, reads can be
+single end (only one side of a fragment is recorded as a read) or paired-end
+(reads are generated from both ends of a fragment).  Further, the sequencing
+reads themselves may be unstraned or strand-specific.  Finally, paired-end
+protocols will have a specified relative orientation.  To characterize the
+various different typs of sequencing libraries, we've created a miniature
+"language" that allows for the succinct description of the many different types
+of possible fragment libraries.  For paired-end reads, the possible
+orientations, along with a graphical description of what they mean, are
+illustrated below:
+
+.. image:: ReadLibraryIllustration.png
+
+The library type string consists of three parts: the relative orientation of
+the reads, the strandedness of the library, and the directionality of the
+reads.
+
+The first part of the library string (relative orientation) is only provided if
+the library is paired-end. The possible options are:
+
+::
+
+    I = inward
+    O = outward
+    M = matching
+
+The second part of the read library string specifies whether the protocol is
+stranded or unstranded; the options are:
+
+::
+
+    S = stranded
+    U = unstranded
+
+If the protocol is unstranded, then we're done.  The final part of the library
+string specifies the strand from which the read originates in a strand-specific
+protocol — it is only provided if the library is stranded (i.e. if the
+library format string is of the form S).  The possible values are:
+
+::
+
+    F = read 1 (or single-end read) comes from the forward strand
+    R = read 1 (or single-end read) comes from the reverse strand
+
+So, for example, if you wanted to specify a fragment library of strand-specific
+paired-end reads, oriented toward each other, where read 1 comes from the
+forward strand and read 2 comes from the reverse strand, you would specify ``-l
+ISF`` on the command line.  This designates that the library being processed has
+the type "ISF" meaning, **I**\ nward (the relative orientation), **S**\ tranted
+(the protocol is strand-specific), **F**\ orward (read 1 comes from the forward
+strand).
+
+The single end library strings are a bit simpler than their pair-end counter
+parts, since there is no relative orientation of which to speak.  Thus, the
+only possible library format types for single-end reads are ``U`` (for
+unstranded), ``SF`` (for strand-specific reads coming from the forward strand)
+and ``SR`` (for strand-specific reads coming from the reverse strand).
+
+A few more examples of some library format strings and their interpretations are:
+
+::
+
+    IU (an unstranded paired-end library where the reads face each other)
+
+::
+
+    SF (a stranded single-end protocol where the reads come from the forward strand)
+
+::
+
+    OSR (a stranded paired-end protocol where the reads face away from each other,
+         read1 comes from reverse strand and read2 comes from the forward strand)
+
+.. note:: Correspondence to TopHat library types 
+
+   The popular `TopHat <http://ccb.jhu.edu/software/tophat/index.shtml>`_ RNA-seq 
+   read aligner has a different convention for specifying the format of the library.
+   Below is a table that provides the corresponding sailfish/salmon library format
+   string for each of the potential TopHat library types:
+
+
+   +---------------------+-------------------------+  
+   | TopHat              | Salmon (and Sailfish)   |
+   +=====================+============+============+
+   |                     | Paired-end | Single-end | 
+   +---------------------+------------+------------+
+   |``-fr-unstranded``   |``-l IU``   |``-l U``    |
+   +---------------------+------------+------------+
+   |``-fr-firststrand``  |``-l ISR``  |``-l SR``   |
+   +---------------------+------------+------------+
+   |``-fr-secondstrand`` |``-l ISF``  |``-l SF``   |
+   +---------------------+------------+------------+
+
+   The remaining salmon library format strings are not directly expressible in terms
+   of the TopHat library types, and so there is no direct mapping for them.
+
+
+]]>
+    </help>
+</tool>
Binary file static/images/ReadLibraryIllustration.png has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/reads_1.fastq	Fri Oct 16 15:09:03 2015 -0400
@@ -0,0 +1,40000 @@
+@1:NM_014620:16:182
+GTTCCGAGCGCTCCGCAGAACAGTCCTCCCTGTAAGAGCCTAACCATTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2:NM_014620:1094:172
+ATGAAAAAAATTCACGTTAGCACGGTGAACCCCAATTATAACGGAGGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@3:NM_022658:294:172
+TGTACGGGCCCGGCGGCTCGGCGCCCGGCTTCCAGCACGCTTCGCACCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@4:NM_022658:1362:195
+ACTAGATGTACTTTTTCTAAAAAGGAAAGGACAGAAAAAAATGAAGAAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@5:NM_173860:323:180
+GCGTGAGGAGCGCGGGCGCGACCCGGGAGCCGGGCCCGGGGCAGCGCTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@6:NM_022658:1062:146
+GGAAGGACTCAGAAGGGTGGGGGCAGGGACAAGTGTGTGTGGGGCAAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@7:NM_022658:1912:184
+CTACCTATAGAAAGAAATCCTGCTTTGAGAGTATTTGTAATGCGGTTTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@8:NM_022658:304:172
+AAGGGACTGTCTGGGGAGCGCCTCGTAGCCATAGAATTTGGAGGCGTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@9:NM_174914:46:212
+ATAACATCCAAGAAAGACACCTTGCATATTCTTTCAGTTTCTGTTTTGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@10:NM_022658:25:186
+CCAACCTGCCCAGCCCCCAGCCCACCAGCCCAGCCCAGTCCCGGGGAGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@11:NM_022658:1031:165
+AAGGGTGGGGGCAGGGACAAGTGTGTGTGGGGCAAGGAGTGAGACAGAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@12:NM_022658:1090:157
+CTTTATTTGTTTGGGGGCTGGAGGGGGGAGACGGAGAAACAGTGAAAAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@13:NM_173860:524:97
+CAACGAGGGCAACAAGGGCGCCGGCGCAGGCGACCCCGGCAGCTTGGTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@14:NM_022658:1471:182
+CCCTCCCCCTCCCCAGGGCTCCCTGCTTAGAAAAACCCCCTTGACTTTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@15:NM_022658:1173:198
+CACTTGTCCCTGCCCCCACCCTTCTGAGTCCTTCCTGGATTTTAAGGTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@16:NM_022658:1052:179
+CAGGTCTCAGACCTTAAAATCCAGGAAGGACTCAGAAGGGTGGGGGCAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@17:NM_022658:1351:186
+TCCATCAGGTTCCTAGAGAAAGTCAAGGGGGTTTTTCTAAGCAGGGAGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@18:NM_022658:1777:222
+TAAAGGGAACCTGCAATAATCTTGAAAAAGAAAAAGAGAAAAATTTTAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@19:NM_018953:838:165
+GCAGGTGCTGGAGCACTGGGCTCCCGGGCCCCACAGACAAAAGCGCTTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@20:NM_022658:997:196
+GGTGGGGGCAGGGACAAGTGTGTGTGGGGCAAGGAGTGAGACAGAGAGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@21:NM_022658:1639:210
+TCGGGCCCATGCCTTCCTCTCCTTCGCTGTTTGATTTCTATTCTGTTGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@22:NM_174914:42:131
+TCAGGAAATCTGGAAACCTACAGTCTCCAAGCCTGCTCAGCCAAGAAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@23:NM_022658:782:137
+TTCTTTTTTGCTTAGTCCTTGTTTTCTTCCTTTTCCTCCTCTTCTTTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@24:NM_022658:623:187
+AGGCGCAGTGGACGGCAAACTTACAGCCGGTATCAGACCTTGGAACTAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@25:NM_022658:1061:175
+GGTTTTATTACCTTTGGACTTCCCCCACTCTTTATTTGTTTGGGGGCTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@26:NM_174914:1681:185
+AGCAAGGAACGGAATACTGGAACATAAGACAAGGGGATTGGTAGCCCAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@27:NM_022658:619:223
+GGGGAGGCGCAGTGGACGGCAAACTTACAGCCGGTATCAGACCTTGGAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@28:NM_022658:1432:199
+GAAATAAGGAAAAAAGCAAGGAATATCCCCTCCCCCTCCCCCTCCCCCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@29:NM_173860:122:191
+CGCCGCCACCCTCGGCGCACGGCTCGCGGTAGTAACCCTTGCCGTCCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@30:NM_022658:1594:160
+GCCTGCAGTCGCCTCTAAAATCCTACCTAACCATCCCATGGTCACTCGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@31:NM_153633:1041:170
+ATTTCCCCTGAAATTCACCCAAGCCAGACCATCACACCTTGCAATATATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@32:NM_006897:750:172
+TGTTTTTCCCTTGGCTGTGCTGAGGCAGCAGGCTGGGTAGGGTTTAGGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@33:NM_022658:1258:186
+TTTCCTTATTTCTTTACATTTGTCTTCCTTTCCTTTCTTCATTTTTTTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@34:NM_173860:240:179
+CGCACGTGCGAGCTGGCGCGCGTGGAGGACGGCAAGGGTTACTACCGCGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@35:NM_153633:85:185
+GATCCGAAATTTCCTCCATGCGAAGAATATTCGCAAAATAGCTACATCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@36:NM_014620:30:150
+TCGGCAACTCCACCTGGGAGGAAAAAAAATTAAATGGGGGAAAAATAATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@37:NM_006897:821:170
+TCGAAGGATGAAGATGAAAAAGATGAATAAAGAGAAAACCGACAAGGAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@38:NM_022658:43:181
+GGCTTTGTATTTGGAGAACAGGGGGTTGACGAAGTAGGAGCTCATGCTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@39:NM_022658:671:176
+TCCACCTTCTCCTCATCTCGGGCTCCCGGCAGTTTATCCTTGTTGTTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@40:NM_022658:1767:150
+ACATACTACCTAAAGGGAACCTGCAATAATCTTGAAAAAGAAAAAGAGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@41:NM_022658:114:188
+GGGGGTACTGGGCGGGGTACTCGTGAGCCAGAGGGGAGGGGGCCGCGGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@42:NM_174914:971:197
+TGATTTGTTTCATCTTAAGAGCCAATGTCTCTGCCTTGAGCTTCTTTAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@43:NM_022658:2111:171
+CTGTTTATGCAATGTGCTCGAAAGAAAAAAATGTTAAAAATATATCTATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@44:NM_006897:1237:160
+CCTGTATCGTATTTGGTCCAGGTCATCCCTCCCCGGGCCTGGGGCGCTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@45:NR_031764:234:81
+CTCCATGTCCAGACCTAGTCAGCCTCTCTCACTCCTGCCCCTACTATCTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@46:NM_022658:283:169
+GTAGCCATAGAATTTGGAGGCGTCTCCGTGGCAGCTAAGCGAGCACGGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@47:NM_001168316:1668:198
+CATGTGATCAGTCAGCAAGGAACGGAATACTGGAACATAAGACAAGGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@48:NM_022658:941:172
+CTCCAGCCCCCAAACAAATAAAGAGTGGGGGAAGTCCAAAGGTAATAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@49:NM_014212:971:199
+AAAGAAAAGAAACTGAGCAGAGACCGGCTGCAGTATTTCTCGGGAAATCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@50:NM_173860:153:168
+TCCCTGTCCTGGCCGTCGGCGGAGCCGTGCAATGGCTACCCGCAGCCCTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@51:NM_022658:1407:176
+CTTCTGGAAATGGGGGGAGGGGAAAGACCCACATCTCCTTCAGGTTTCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@52:NM_022658:442:182
+TCCCCGGAGCGTGGGGTCTCATCCATGGAAACATGAGGCTGGGAGACGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@53:NM_174914:161:176
+TCAAGCACAGGGCAGGCTTCCTGAGCATTGAAGAGAATATGTGGGAGAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@54:NM_014620:345:193
+CCCTCTCTCCCTCTCTGCCTCTCTCTCTCCCACTCTCTTTCTCGTCTTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@55:NM_153633:356:180
+TATAGGCTGTCCTCGAGCGCTTGGGTTCCCCTCCGTTATAATTGGGGTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@56:NM_022658:204:201
+GGTTCTGCTGGTAGCCTGAGTTGGAGATGCCGGAGGTGCCGTGGTGGAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@57:NM_006897:743:207
+TTTAACCAGGGACCGTCGGTATGAGGTGGCCCGGGTTCTCAATCTCACCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@58:NM_018953:227:189
+CTCTTAGCTCGCTCCTCCAGCGCCGGGCGAGCCGCCTTCTGACTGTACAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@59:NM_022658:1549:168
+ACACTAATGCAGCTCAGAGGAAGGCGGGCCCAACAGAATAGAAATCAAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@60:NM_022658:1993:214
+AAACCCAACAACTGAGACTGCCTAGCCCGCCGGTCCTGTGCGCTTTTATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@61:NM_022658:1565:169
+GTGATTTCTGAGCACTAACACTAATGCAGCTCAGAGGAAGGCGGGCCCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@62:NM_001168316:201:184
+GTGGGAGAACAAAACAGAAACTGAAAGAATATGCAAGGTGTCTTTCTTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@63:NM_018953:925:142
+GCGGGGCTGTCGGCGCTGCCCCATCTCCCCTCAGCTCGGCTCAGCTCGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@64:NM_022658:1016:168
+AATGACACTCACAACTCTAACTACCTGTCAGATACTTGCAGCTCTGGTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@65:NM_022658:2014:201
+CACAAAATCTACATTCATAGCTGGACATAAAGACAAATGACAAAAAATTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@66:NM_022658:535:181
+CACTAACAGTAGCGAAGGACAAGGCCACTTAAATCAAAACTCGTCTCCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@67:NM_173860:262:165
+TGGAGGACGGCAAGGGTTACTACCGCGAGCCGTGCGCCGAGGGTGGCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@68:NM_022658:1540:205
+CTGAAGGAGATGTGGGTCTTTCCCCTCCCCCCATTTCCAGAAGGGTAGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@69:NM_174914:127:171
+GGAGACCTGTGAGCCTGTGTCCGGCCCTGAACTCTCAAGCACAGGGCAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@70:NM_004503:150:184
+CCTCGCCGGGGGCCAGGACGTCCTCCCCAACGTCGCCCTCAATTCCACCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@71:NM_022658:497:172
+AGCGTGGTGCAATATCCCGACTGTAAATCCTCCGCCAACACTAACAGTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@72:NM_018953:91:162
+CGTGGAGAGAGTTGGAAGGCGCAGGCGGTGGGAAAGTGATGCTTAAGTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@73:NM_153633:23:166
+ATTATTTTCCACTCCAGAAATTAATGATCATGAGCTCGTATTTGATGGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@74:NM_022658:718:183
+TTGTTTTCTTCCTTTTCCTCCTCTTCTTTCTCCTCTTCCTCATTTCCTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@75:NM_022658:411:192
+CGCTTAGCTGCCACGGAGACGCCTCCAAATTCTATGGCTACGAGGCGCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@76:NM_153633:1187:205
+CCCCCCCCCAACAATAATACAAAAGAACTTCATAGCTTTGTTCTCCTTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@77:NM_022658:86:187
+GGTTCGGTCCCGGGGGGAGGGGAGTTTCGGGGGTACTGGGCGGGGTACTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@78:NM_173860:399:228
+CGGGTACCAGGGCGCGCCGCTGGCCGAGAGCCCGCCGCCGGGGTTCAACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@79:NM_014620:569:163
+GAAATTTCGGATCGATGTAGTTAGAGTCCATCAAATACGAGCTCATGATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@80:NM_022658:1067:161
+GTCTCAGACCTTAAAATCCAGGAAGGACTCAGAAGGGTGGGGGCAGGGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@81:NM_022658:258:197
+GGTTCCCTCAGAGCGTGGGCAGGAGCCATGCGCTGGTGTACGGGCCCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@82:NM_174914:1109:196
+AACAATGCCTTTGCTCACCTACCCCAAGGGGTGATATGGAAGTGTCAGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@83:NR_031764:96:177
+ACTGTGGGCACCAGAGACAGGGACCCAATGTGGAGACCTGTGAGCCTGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@84:NM_022658:2025:173
+TAGCTGGACATAAAGACAAATGACAAAAAATTATTATTATAGATATATTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@85:NM_022658:1303:135
+GAGCCCCCTCGAAATGCAGAAAAGGACTTGTGGTTTTGTTTTTATGCTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@86:NM_022658:813:171
+AACTGCCGGGAGCCCGAGATGAGGAGAAGGTGGAGGAAGAAGGAAATGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@87:NM_174914:1194:140
+AGGAAGCCAGTCCACAATTTTCACATTTGCAGCCAGGTGGACATCTTTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@88:NM_173860:234:202
+CGCCGCCCGCCGCGTAGTCGTACTTGAAGCCGAGCGCAGGCGGCCCCGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@89:NM_022658:2091:148
+TTAACTCTGTCTTGAATTCTCTGTTTATGCAATGTGCTCGAAAGAAAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@90:NM_014212:353:208
+GAGGCAGGACGCTGTTCTTGTTGACTGAGGAGTAGAAGCCGGCGGGGGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@91:NM_022658:2049:183
+GAACAGGGCTGTCGGGACACAAAATCTACATTCATAGCTGGACATAAAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@92:NM_022658:738:181
+TTCTTTTTTGCTTAGTCCTTGTTTTCTTCCTTTTCCTCCTCTTCTTTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@93:NM_022658:1014:179
+AGAATGACACTCACAACTCTAACTACCTGTCAGATACTTGCAGCTCTGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@94:NM_014620:933:212
+TTCCCCTCCGTTATAATTGGGGTTCACCGTGCTAACGTGAATTTTTTTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@95:NM_174914:502:169
+ATGAATTTGTAGCAAAATTAGCAAGTGGAAAGGATGATTTTTGGCCATTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@96:NM_001168316:2057:180
+TTGGCGCACTGAGGTGCACAGGGTCCCTTAGCCGGGCGCAGGGCGCGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@97:NM_006897:562:163
+CACTGCCCTCGCCCGAGGCGGACGCGCTCGCCGGCAGCAAGCACAAAGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@98:NM_173860:430:159
+GCGGCGGCGGTGGCGACGGCGGCGGCGGCGCAGGACCTCCGCACGACCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@99:NM_174914:1532:181
+TTGTCTTATGTTCCAGTATTCCGTTCCTTGCTGACTGATCACATGGACTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@100:NM_022658:1321:162
+GGAGGGGGAGGGGGAGGGGGAGGGGATATTCCTTGCTTTTTTCCTTATTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@101:NM_174914:482:161
+ATGTCACCATTTCTAGGGAGCTTCCCACTAGTTCTGGCAGCCCCATTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@102:NM_022658:2024:189
+CAAAATCTACATTCATAGCTGGACATAAAGACAAATGACAAAAAATTATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@103:NM_174914:202:170
+TGGGAGAACAAAACAGAAACTGAAAGAATATGCAAGGTGTCTTTCTTGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@104:NM_006897:1122:199
+ACTGCGTTCTCTTTCCCCAGCGCAACCGAAATAAATGACACATACAAATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@105:NM_022658:1077:181
+GACTTCCCCCACTCTTTATTTGTTTGGGGGCTGGAGGGGGGAGACGGAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@106:NM_014620:666:210
+GGCGCTCAGGGTAGCTAGGGCGCGGAGGCGGTGGTGGGTACAGCTCCTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@107:NM_004503:175:182
+CCCAACGTCGCCCTCAATTCCACCGCCTATGATCCAGTGAGGCATTTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@108:NM_022658:1901:201
+GTATTTTATCACTACCTATAGAAAGAAATCCTGCTTTGAGAGTATTTGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@109:NM_174914:512:173
+ATAAGGCCAGGTGCAGCCTTGGCGGGGTCTGTTTGGTGGGCGATGTCACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@110:NM_022658:1183:149
+AAGTCCTTTTCTGCATTTCGAGGGGGCTCCCCTCTAAAATAAATACCAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@111:NM_174914:1746:200
+TGAAGTGGAAAGAATGGCCACAAATGGCTTCCCAAGCTTCTCAGCAATCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@112:NM_022658:1666:189
+TTTCTCTTTTTTTCTCCTATAGCAGGATTTTAAAATTTTTCTCTTTTTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@113:NM_022658:1785:201
+ACCTGCAATAATCTTGAAAAAGAAAAAGAGAAAAATTTTAAAATCCTGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@114:NM_022658:307:184
+CGGCTCGGCGCCCGGCTTCCAGCACGCTTCGCACCACGTTCAAGACTTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@115:NM_173860:613:161
+CGCCCTGGTACCCGATCAACAGCCGCTCTCGGAAGAAGCGCAAGCCCTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@116:NM_022658:1092:188
+AGCAGGGAGGTGGGAGTGTGGTGAGAGACAGACCGAGGAGCACGGAGGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@117:NM_004503:460:178
+TGGCGATCTCGATGCGCCGGCGCCGCGTTAGGTAGCGATTGAAGTGAAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@118:NM_173860:165:203
+GCTGCCCCGGGCCCGGCTCCCGGGTCGCGCCCGCGCTCCTCACGCTTCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@119:NM_022658:1301:159
+GGGAGCCCCCTCGAAATGCAGAAAAGGACTTGTGGTTTTGTTTTTATGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@120:NM_173860:169:171
+CGGCGGAGCCGTGCAATGGCTACCCGCAGCCCTACCTCGGCAGCCCAGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@121:NM_173860:522:178
+GAAACTCGCCCTCCAGCTCTGCCAGTTGCAACTTCGAATAGGGCTTGCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@122:NM_022658:785:183
+GCTACCATAAAACGAAACTTCAAGGGAGTTGCTAAGGGGGGGGGGGTCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@123:NM_173860:402:209
+CTCGGCTTCAAGTACGACTACGCGGCGGGCGGCGGCGGTGGCGACGGCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@124:NM_174914:304:188
+TGGACATGGAGGCTGGAAGAGTCAGGGTGTGATTCGGAGAGGCGCATGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@125:NM_022658:654:170
+ATCAGACCTTGGAACTAGAAAAGGAGTTTCTCTTTAATCCTTATTTGACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@126:NM_014620:1423:178
+AGGAAGAGAGAAAAGAACCTATATATATATATATATATATATATATTAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@127:NM_022658:2082:163
+AATGTATAGTTAACTCTGTCTTGAATTCTCTGTTTATGCAATGTGCTCGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@128:NM_173860:355:175
+TCGTTGAGCAGGGACGAACTGGAGTCGGATTCCAGCGACTGGCAGGAGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@129:NM_022658:983:184
+GGGCAAGGAGTGAGACAGAGAGTCCGAACTTTTCACTGTTTCTCCGTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@130:NR_031764:655:162
+CTGGCATGAGCAGTACCTGCTCGACGTTTTTGTGTTTCTGCTGGGGCTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@131:NM_022658:1538:204
+ACCTGAAGGAGATGTGGGTCTTTCCCCTCCCCCCATTTCCAGAAGGGTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@132:NM_022658:628:173
+TCTCCTTTTTCCACTTCATCCTTCGGTTCTGGAACCAGATCTTCACTTGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@133:NM_022658:2003:222
+GCTGTCGGGACACAAAATCTACATTCATAGCTGGACATAAAGACAAATGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@134:NM_022658:1801:155
+CGCATTACAAATACTCTCAAAGCAGGATTTCTTTCTATAGGTAGTGATAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@135:NM_022658:1683:138
+GTTGGGCCCGCCTTCCTCTGAGCTGCATTAGTGTTAGTGCTCAGAAATCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@136:NM_014620:1073:184
+GCGAGTGGGCGATCTCGATCCTTCTCCTTCGGGTCAGGTAGCGGTTGTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@137:NM_006897:1319:198
+TTAACACAGGGCTGTTCTACCATAACAAACAGAAGCACGTTACAGGACGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@138:NM_022658:1857:194
+AATAAAAATCAAAAAAAAAAAAAAGAAAGAAAGAAACCTCCAGCGTATTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@139:NM_022658:2099:153
+ATACAAAGTACTTGGACCAGGAACAGGGCTGTCGGGACACAAAATCTACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@140:NM_022658:707:164
+TCCTCTTCCTCATTTCCTTCTTCCTCCACCTTCTCCTCATCTCGGGCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@141:NM_022658:402:173
+GTTTTGATTTAAGTGGCCTTGTCCTTCGCTACTGTTAGTGTTGGCGGAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@142:NM_022658:1122:204
+GGAGAAACAGTGAAAAGTTCGGACTCTCTGTCTCACTCCTTGCCCCACAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@143:NM_022658:756:175
+GGGGGGGGGTCTTTCTTTTTTGCTTAGTCCTTGTTTTCTTCCTTTTCCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@144:NM_014620:1690:187
+CTTTAAAATTTCTTTCCTTTTTTCTTTTCCTCATTTCCCCTGAAATTCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@145:NM_022658:563:179
+AGTCCCAGGGCATGAGAGACTTCAATCCGACGTTTTCGTGTCAAATAAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@146:NM_022658:212:197
+AAATACAAAGCCGGCGAGTCCCTGGAACCGGCCTATTACGACTGCCGGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@147:NM_006897:803:182
+CTTGCTCTTTCCTTTTCTTTTTCGTCTCTCCCCCGCCTGTGTTGGGGTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@148:NM_022658:1426:192
+AGGATTTTAGAGGCGACTGCAGGCTCCTATCTACCCTTCTGGAAATGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@149:NM_174914:426:181
+TAGCCCTTGCTGATGGCAAACAAAGGAGGACAAGAGGACTGGAAAGAATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@150:NR_031764:1336:171
+GTGTTCACCATGGAGCCCAAGGTCACAAGGACAAAACCAGAGTCCCCAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@151:NM_153633:459:188
+TGATCTGCCTCTCAGAGAGGCACAGCGAGTGGGCGATCTCGATCCTTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@152:NM_004503:177:168
+TAAAAGGAATTAGATCCATAGTCATACGGCCCCCGGCTGGAACTGAACAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@153:NM_173860:267:172
+CGCCGCCGCCCGCCGCGTAGTCGTACTTGAAGCCGAGCGCAGGCGGCCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@154:NM_018953:357:174
+CTCGTGGCTCATGTGCAGTTTGGTCATCCACGGGTAAATCTGTGGCGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@155:NM_014620:1606:165
+AAATAAATAACCCCCCAAAATGGCCTTTTAAAAAAAAACACCCAGCAGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@156:NM_153633:480:186
+CACGGTGAACCCCAATTATAACGGAGGGGAACCCAAGCGCTCGAGGACAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@157:NM_022658:1792:163
+ATAATCTTGAAAAAGAAAAAGAGAAAAATTTTAAAATCCTGCTATAGGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@158:NM_022658:1867:193
+ACTGGGGTTAGAAGCACAATAAAAGCGCACAGGACCGGCGGGCTAGGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@159:NM_022658:1127:148
+AACAGTGAAAAGTTCGGACTCTCTGTCTCACTCCTTGCCCCACACACACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@160:NM_022658:602:200
+ATGAGACCCCACGCTCCGGGGAGGCGCAGTGGACGGCAAACTTACAGCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@161:NM_022658:1709:189
+ATTAGTGTTAGTGCTCAGAAATCACCATAATCACGAAAATAATAATAATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@162:NM_001168316:238:184
+GTGATTCTGTCTCTGAGTGACTTGGACCACTGACCCTCAGATTTCCAGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@163:NM_173860:477:206
+TCTGCCAGTTGCAACTTCGAATAGGGCTTGCGCTTCTTCCGAGAGCGGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@164:NM_006897:290:198
+CCGCAGTCCGCGCGGCGCCCGGGGTAGGCGTCCGGCTTGAGGGCGTAGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@165:NM_174914:911:179
+GGTGGGAGCGCAGGATGACACTGGCAGCCACTGCCGCGGACTTGTATCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@166:NM_022658:802:182
+ACTTCTCAATTTATCTGCTACCATAAAACGAAACTTCAAGGGAGTTGCTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@167:NM_014620:2028:178
+TGGGAGGAGAGGGGGCGAAGACAGCAGACAAAGCTAAATGCATCTGGAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@168:NM_022658:2018:151
+ATTATTATTATAGATATATTTTTAACATTTTTTTCTTTCGAGCACATTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@169:NM_004503:114:189
+GAATTCCTACTTCACTAACCCTTCCTTATCCTGCCACCTCGCCGGGGGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@170:NM_022658:681:195
+CTTTCTCCTCTTCCTCATTTCCTTCTTCCTCCACCTTCTCCTCATCTCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@171:NM_022658:1763:188
+TACAAATACTCTCAAAGCAGGATTTCTTTCTATAGGTAGTGATAAAATAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@172:NM_022658:1674:194
+TGATTTTTATTTTTTTCTCTTTTTTTCTCCTATAGCAGGATTTTAAAATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@173:NM_174914:1061:184
+CCCAAAGATGTCCACCTGGCTGCAAATGTGAAAATTGTGGACTGGCTTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@174:NM_022658:400:184
+GGGAGACGAGTTTTGATTTAAGTGGCCTTGTCCTTCGCTACTGTTAGTGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@175:NM_173860:500:210
+ATCCGACTCCAGTTCGTCCCTGCTCAACGAGGGCAACAAGGGCGCCGGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@176:NM_174914:333:192
+TGCTAATTTTGCTACAAATTCATCCTTACTAGCTCCTGCCTGCTAGCAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@177:NM_006897:1009:196
+AAAGAAAAACAAGGAAGGGGAAAAGAAAACTCTTGCGATTTGGGAGGGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@178:NM_022658:268:88
+GAGCGTGGGCAGGAGCCATGCGCTGGTGTACGGGCCCGGCGGCTCGGCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@179:NM_001168316:353:193
+GAAGGAAGGTGGATTTTAAGGCTGGAAATCTGAGGGTCAGTGGTCCAAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@180:NM_022658:1155:207
+ACACTAGCCTTAGCATAAAAACAAAACCACAAGTCCTTTTCTGCATTTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@181:NM_022658:1506:197
+CAGAGGAAGGCGGGCCCAACAGAATAGAAATCAAACAGCGAAGGAGAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@182:NM_022658:1359:195
+CACATCTCCTTCAGGTTTCCATCAGGTTCCTAGAGAAAGTCAAGGGGGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@183:NM_174914:254:180
+AAGGGCTATGCTGTGATTCTGTCTCTGAGTGACTTGGACCACTGACCCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@184:NM_022658:1472:163
+CCATGGGATGGTTAGGTAGGATTTTAGAGGCGACTGCAGGCTCCTATCTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@185:NM_006897:788:198
+CACCGAGCGGCAGGTCAAAATCTGGTTTCAGAATCGAAGGATGAAGATGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@186:NM_022658:33:191
+GGCTTTGTATTTGGAGAACAGGGGGTTGACGAAGTAGGAGCTCATGCTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@187:NM_022658:1758:163
+AAATCTTTAACATACTACCTAAAGGGAACCTGCAATAATCTTGAAAAAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@188:NM_014620:984:208
+AATTCCAGGACTTGCTGCCGGGTATAGGCTGTCCTCGAGCGCTTGGGTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@189:NM_006897:391:201
+CGCTGTCCGGCGCCGTCTCCTTCCCCAGCTTCCCGGCCGGGGGCCGTCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@190:NM_022658:781:175
+GATGAAGTGGAAAAAGGAGAACAACAAGGATAAACTGCCGGGAGCCCGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@191:NM_001168316:1274:164
+CCCCTTGGGGTAGGTGAGCAAAGGCATTGTTCATCTCCTTGAAGATTTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@192:NM_022658:163:177
+TTTTCATGTACCCAGCATGAGCTCCTACTTCGTCAACCCCCTGTTCTCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@193:NM_022658:1741:126
+ACGAAAATAATAATAATAAATCTTTAACATACTACCTAAAGGGAACCTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@194:NM_174914:1825:210
+ATATCAAGTTATCAGTTGGCTTGCACCTGAAGATCATCAAAGAGAATTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@195:NM_018953:432:153
+GAGTTCCAGAGTCTGGTAGCGCGTGTAACTGGTTCGGGACCGCTTGCCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@196:NM_022658:1467:192
+CTCCCCCTCCCCCTCCCCAGGGCTCCCTGCTTAGAAAAACCCCCTTGACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@197:NM_022658:1769:175
+ACTCTCAAAGCAGGATTTCTTTCTATAGGTAGTGATAAAATACGCTGGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@198:NM_022658:1207:192
+CTGGATTTTAAGGTCTGAGACCTGGCCTCCGTGCTCCTCGGTCTGTCTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@199:NR_031764:232:190
+GTGATTCTGTCTCTGAGTGACTTGGACCACTGACCCTCAGATTTCCAGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@200:NM_006897:307:171
+CGCGGCGCCCGGGGTAGGCGTCCGGCTTGAGGGCGTAGTGACGGCCCCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@201:NM_014620:193:185
+TGGGGAGGGTGGGGATGGGAGGGGAGAGACAGAAGTTGAGGGCATCTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@202:NM_022658:881:164
+GACAGGTAGTTAGAGTTGTGAGTGTCATTCTATTCTCTATAAAAGCAAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@203:NM_006897:981:169
+CGGTTGCGCTGGGGAAAGAGAACGCAGTTTCTCTCCCCGCCTCCTCCTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@204:NM_174914:294:144
+TGACTAGGTCTGGACATGGAGGCTGGAAGAGTCAGGGTGTGATTCGGAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@205:NM_022658:471:164
+CCCTTTATGGGGCTCAGCAAGAGGCGAGCGTGGTGCAATATCCCGACTGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@206:NM_018953:584:172
+CCCCCGCTGCCTCTAAAGAGCCTCTTTGCTTTTCATTTTGGAATCTTTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@207:NM_014620:938:167
+GGCCACCACCACCCCGAGAAATCACAGTCGCTCTGCGAGCCGGCGCCTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@208:NM_022658:1362:174
+CCATCAGGTTCCTAGAGAAAGTCAAGGGGGTTTTTCTAAGCAGGGAGCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@209:NM_004503:63:184
+AGAAATAAATATTAAAGAAATCATAGACCGACCAGGTAAAGGCAAAGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@210:NM_006897:736:193
+GGGTTTTTGTTTTTCCCTTGGCTGTGCTGAGGCAGCAGGCTGGGTAGGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@211:NM_174914:2115:177
+AAGAATCTGAGAAACCCGGTCCATCAGTAGATAATGGCTTCCACCTACTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@212:NM_022658:488:171
+CTGATACCGGCTGTAAGTTTGCCGTCCACTGCGCCTCCCCGGAGCGTGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@213:NM_014620:34:192
+AACAGTCCTCCCTGTAAGAGCCTAACCATTGCCAGGGAAACCTGCCCTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@214:NM_022658:1515:178
+CTTTCTCTAGGAACCTGATGGAAACCTGAAGGAGATGTGGGTCTTTCCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@215:NM_173860:498:116
+GCGCCGCTGGCCGAGAGCCCGCCGCCGGGGTTCAACGGCGATACCAAGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@216:NM_174914:1883:163
+GAAGAAAAATCATATCAAGTTATCAGTTGGCTTGCACCTGAAGATCATCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@217:NM_174914:669:192
+ACAGGGGGCGCGACGCACCTCAAGCCCTATGTCTTTCAGCAGCCCTGGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@218:NM_022658:308:196
+CCACGCTCGCCTCTTGCTGAGCCCCATAAAGGGACTGTCTGGGGAGCGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@219:NM_014620:280:185
+GGAATGCAGGAGCAGGAGTTGAGCTTGGGAGCTGCAGATGCCTCCGCCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@220:NM_001168316:654:189
+CAGACCCCGCCAAGGCTGCACCTGGCCTTATGTCTCCTTCACCTTTCTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@221:NM_022658:727:192
+TTCTTTTTTGCTTAGTCCTTGTTTTCTTCCTTTTCCTCCTCTTCTTTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@222:NM_022658:357:173
+GGAGGATTTACAGTCGGGATATTGCACCACGCTCGCCTCTTGCTGAGCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@223:NM_174914:137:195
+GAGCCTGTGTCCGGCCCTGAACTCTCAAGCACAGGGCAGGCTTCCTGAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@224:NM_173860:101:171
+GCAGCTTCCCGGGCTGCCTTCGCTGTCCTACCCACGCCGCGACAACGTGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@225:NM_022658:1060:201
+TGGTTTTATTACCTTTGGACTTCCCCCACTCTTTATTTGTTTGGGGGCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@226:NM_173860:144:169
+CGCCGCCACCCTCGGCGCACGGCTCGCGGTAGTAACCCTTGCCGTCCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@227:NM_006897:1015:192
+TACTGGCTTCTCTGAAGAAAGGAGGAAAAAAATCACATTTGTATGTGTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@228:NM_173860:331:178
+AGCGCGGGCGCGACCCGGGAGCCGGGCCCGGGGCAGCGCTGCTCCCGCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@229:NR_031764:1152:203
+GACAAACAGACGGATGCTTGGGTGAGCCAGGAGGTCACTCTGAGGAAGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@230:NM_022658:370:194
+CTCCGGCATCTCCAACTCAGGCTACCAGCAGAACCCGTGCTCGCTTAGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@231:NR_031764:571:149
+TGGTGGCTGCGTGGGGCCAGAAAGGTGAAGGAGACATAAGGCCAGGTGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@232:NM_006897:1198:179
+TCCCCAGCCCTCACCCCTCAGCTCCTGGGCTGGGAATCATTATCATGTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@233:NM_022658:1297:85
+TTAGAAAAAGTACATCTAGTACACTAGCCTTAGCATAAAAACAAAACCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@234:NM_022658:1378:169
+CCTTCAGGTTTCCATCAGGTTCCTAGAGAAAGTCAAGGGGGTTTTTCTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@235:NM_014212:1294:217
+ATTTAGCTGCAAGGTGGGGCGGGGTAGAGGGGGGAGCTCGAGAAGTTTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@236:NM_014212:34:183
+CGTCATCTCGCCTTCCCAAATTTTCCCCCCTCGCTAGACCGGGTCCAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@237:NM_022658:1521:187
+CAGCTCAGAGGAAGGCGGGCCCAACAGAATAGAAATCAAACAGCGAAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@238:NM_153693:1578:174
+AGAGCCGGCTCCTGGGCCTGCTGGGGCCTCTGCTCCAGGGCCTCAGGGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@239:NM_006897:172:193
+GTGTCGGCGCCGAGGTGGGGCTGGGGGCCGTACGGGTGATATACCACGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@240:NM_022658:114:202
+GCCGAGCCGCCGGGCCCGTACACCAGCGCATGGCTCCTGCCCACGCTCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@241:NM_022658:951:201
+CAGAGAGTCCGAACTTTTCACTGTTTCTCCGTCTCCCCCCTCCAGCCCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@242:NM_022658:1137:205
+ACAAAACCACAAGTCCTTTTCTGCATTTCGAGGGGGCTCCCCTCTAAAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@243:NM_022658:100:182
+TCCTGCCCACGCTCTGAGGGAACCGGCAGTCGTAATAGGCCGGTTCCAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@244:NM_004503:76:198
+AAAGGGAGTCGAGTAGATCCGGTTCTGGGCAACGGCCGCTCCATAGGTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@245:NM_022658:101:146
+GGAGGGGAGTTTCGGGGGTACTGGGCGGGGTACTCGTGAGCCAGAGGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@246:NM_014620:908:134
+AATTCGCGAGGCCACGGGCCGGCCCAGGCGGGCCACCACCACCCCGAGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@247:NM_022658:1957:182
+TTTTCTTTCGAGCACATTGCATAAACAGAGAATTCAAGACAGAGTTAACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@248:NM_022658:585:179
+GATCTTCACTTGTCTCTCGGTCAGTCCCAGGGCATGAGAGACTTCAATCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@249:NM_022658:1666:188
+TTCTCTTTTTTTCTCCTATAGCAGGATTTTAAAATTTTTCTCTTTTTCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@250:NM_173860:581:122
+GAACCCCGGCGGCGGGCTCTCGGCCAGCGGCGCGCCCTGGTACCCGATCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@251:NM_022658:960:167
+ATGGTAGCAGATAAATTGAGAAGTTTACGACTGTCATTTGCTTTTATAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@252:NM_022658:1054:180
+GGCCAGGTCTCAGACCTTAAAATCCAGGAAGGACTCAGAAGGGTGGGGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@253:NM_153693:759:203
+GGTCTGGTACCGCGAGTAGATCTGGCGGCCGCGCCTCCGGTCCGCTCCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@254:NM_173860:554:159
+CGACCCCGGCAGCTTGGTATCGCCGTTGAACCCCGGCGGCGGGCTCTCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@255:NM_022658:1182:182
+GTACACTAGCCTTAGCATAAAAACAAAACCACAAGTCCTTTTCTGCATTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@256:NM_022658:1775:203
+CCTAAAGGGAACCTGCAATAATCTTGAAAAAGAAAAAGAGAAAAATTTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@257:NM_174914:628:150
+TAGAAATGGTGACATCGCCCACCAAACAGACCCCGCCAAGGCTGCACCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@258:NM_022658:385:181
+TAAGTGGCCTTGTCCTTCGCTACTGTTAGTGTTGGCGGAGGATTTACAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@259:NM_022658:859:165
+GTGTCATTCTATTCTCTATAAAAGCAAATGACAGTCGTAAACTTCTCAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@260:NM_022658:191:188
+ATGCCGGAGGTGCCGTGGTGGAAGAAGTCTTGAACGTGGTGCGAAGCGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@261:NM_014620:1544:169
+TATAGAATTTAATATATATATATATATATATATATATAGGTTCTTTTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@262:NM_022658:1012:229
+GCACGGAGGCCAGGTCTCAGACCTTAAAATCCAGGAAGGACTCAGAAGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@263:NM_022658:315:176
+TTGCTGAGCCCCATAAAGGGACTGTCTGGGGAGCGCCTCGTAGCCATAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@264:NM_022658:405:180
+TGGGAGACGAGTTTTGATTTAAGTGGCCTTGTCCTTCGCTACTGTTAGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@265:NM_022658:1060:161
+ACCTTAAAATCCAGGAAGGACTCAGAAGGGTGGGGGCAGGGACAAGTGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@266:NM_174914:1300:193
+CCTTTGATTTTGCTCGACCTCTGCTTCCCAACACTGTTTATGTTGGAGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@267:NM_022658:1201:202
+TTTTTTTCTGTCCTTTCCTTTTTAGAAAAAGTACATCTAGTACACTAGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@268:NM_153633:1175:172
+TGTGATGGTCTGGCTTGGGTGAATTTCAGGGGAAATGAGGAAAAGAAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@269:NM_174914:1746:183
+TGAAGTGGAAAGAATGGCCACAAATGGCTTCCCAAGCTTCTCAGCAATCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@270:NM_022658:716:182
+ATTGAAGTCTCTCATGCCCTGGGACTGACCGAGAGACAAGTGAAGATCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@271:NM_022658:1656:183
+TCTCCTTCGCTGTTTGATTTCTATTCTGTTGGGCCCGCCTTCCTCTGAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@272:NM_022658:1383:164
+AAGGAAAGGACAGAAAAAAATGAAGAAAGGAAAGGAAGACAAATGTAAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@273:NM_001168316:181:189
+CTGAGCATTGAAGAGAATATGTGGGAGAACAAAACAGAAACTGAAAGAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@274:NM_174914:46:180
+GAAATCTGGAAACCTACAGTCTCCAAGCCTGCTCAGCCAAGAAGGAGCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@275:NM_022658:726:187
+CTCATGCCCTGGGACTGACCGAGAGACAAGTGAAGATCTGGTTCCAGAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@276:NM_022658:1098:116
+AATCCAGGAAGGACTCAGAAGGGTGGGGGCAGGGACAAGTGTGTGTGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@277:NM_022658:10:188
+TGACGAAGTAGGAGCTCATGCTGGGTACATGAAAACCCGCGGCCCCCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@278:NM_022658:402:190
+ATGAGGCTGGGAGACGAGTTTTGATTTAAGTGGCCTTGTCCTTCGCTACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@279:NM_022658:1398:172
+GGGGAGGGGAAAGACCCACATCTCCTTCAGGTTTCCATCAGGTTCCTAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@280:NM_014620:1070:189
+AAGCAACCCATAGTCTACCCATGGATGAAAAAAATTCACGTTAGCACGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@281:NM_006897:200:202
+CGCCGCCGCCAGACCCAGCGGTTTGGTGCCGGACTGTAGCGATTTTCCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@282:NM_174914:905:187
+ATCCCTCTCTTTGGAGACCAGCCTGAAAACATGGTCCGAGTAGAAGCCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@283:NM_022658:809:189
+AATGACAGTCGTAAACTTCTCAATTTATCTGCTACCATAAAACGAAACTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@284:NM_022658:455:158
+TGGGGTCTCATCCATGGAAACATGAGGCTGGGAGACGAGTTTTGATTTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@285:NM_014620:221:204
+ATTCAAAAATAAAAATAATTATAATCATCCAAAAGCCAAACAAAATTAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@286:NM_004503:1131:203
+GAGGGGCTAGGCAGGGACTGCGGGGAGGCCCTGGGGGTTGGTGTGGGGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@287:NM_174914:57:196
+ACCTACAGTCTCCAAGCCTGCTCAGCCAAGAAGGAGCTCACTGTGGGCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@288:NM_153633:579:191
+CCGCTACCTGACCCGAAGGAGAAGGATCGAGATCGCCCACTCGCTGTGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@289:NM_153633:1477:171
+AGAAAATCAAAATGAACTTTCAGTTCAGAGAGGCAGTCTATAGGTAGAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@290:NM_174914:157:221
+CCAGCCTTAAAATCCACCTTCCTTCTCATGCGCCTCTCCGAATCACACCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@291:NM_173860:403:196
+TCGGCTTCAAGTACGACTACGCGGCGGGCGGCGGCGGTGGCGACGGCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@292:NM_001168316:2022:196
+AGGGTCCCTTAGCCGGGCGCAGGGCGCGCAGCCCAGGCTGAGATCCGCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@293:NM_022658:25:175
+GTTGACGAAGTAGGAGCTCATGCTGGGTACATGAAAACCCGCGGCCCCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@294:NM_022658:1233:188
+CTTCCTTTCCTTTCTTCATTTTTTTCTGTCCTTTCCTTTTTAGAAAAAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@295:NM_153633:939:197
+AATAAATAACCCCCCAAAATGGCCTTTTAAAAAAAAACACCCAGCAGGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@296:NM_022658:182:197
+AGCTCCTACTTCGTCAACCCCCTGTTCTCCAAATACAAAGCCGGCGAGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@297:NM_014620:1743:178
+AAAGGCCATTTTGGGGGGTTATTTATTTTTTAAGAAAAAAAGCTGCAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@298:NM_022658:874:160
+AGAGTTGTGAGTGTCATTCTATTCTCTATAAAAGCAAATGACAGTCGTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@299:NM_022658:1299:169
+AGGGGAGCCCCCTCGAAATGCAGAAAAGGACTTGTGGTTTTGTTTTTATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@300:NM_022658:481:202
+GGCTCAGCAAGAGGCGAGCGTGGTGCAATATCCCGACTGTAAATCCTCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@301:NM_022658:636:168
+TGTTCTCCTTTTTCCACTTCATCCTTCGGTTCTGGAACCAGATCTTCACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@302:NM_014620:1402:117
+GGAGGGTGGGGGCATGGGGTGGGGGCAGGGGTGTGAGTTATGTTTTATAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@303:NM_022658:553:165
+ACAAGGCCACTTAAATCAAAACTCGTCTCCCAGCCTCATGTTTCCATGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@304:NM_022658:639:173
+AAACTTACAGCCGGTATCAGACCTTGGAACTAGAAAAGGAGTTTCTCTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@305:NM_022658:1355:199
+CACATCTCCTTCAGGTTTCCATCAGGTTCCTAGAGAAAGTCAAGGGGGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@306:NM_022658:1313:103
+TTTCCTTTCTTCATTTTTTTCTGTCCTTTCCTTTTTAGAAAAAGTACATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@307:NM_173860:86:194
+AACCCTTGCCGTCCTCCACGCGCGCCAGCTCGCACGTGCGGCCGAAGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@308:NM_022658:1523:215
+AGGAACCTGATGGAAACCTGAAGGAGATGTGGGTCTTTCCCCTCCCCCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@309:NM_173860:216:178
+GCCCCGACGGCTCCAGCGGGAGCAGCGCTGCCCCGGGCCCGGCTCCCGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@310:NM_022658:357:158
+TCCACCACGGCACCTCCGGCATCTCCAACTCAGGCTACCAGCAGAACCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@311:NM_014620:160:190
+GAAGAGCCTGGGAGAGAGGAGGGGCGGAGGCATCTGCAGCTCCCAAGCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@312:NM_153633:1145:193
+AAAAAGCTGCAAAAATTATATATTGCAAGGTGTGATGGTCTGGCTTGGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@313:NM_173860:283:180
+CTGCGCCGCCGCCGCCGTCGCCACCGCCGCCGCCCGCCGCGTAGTCGTAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@314:NM_022658:1832:172
+TTGTTGGGTTTTCTTAGTGAAATAAGCAGCAACAAACGACAACAAAACCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@315:NM_018953:692:160
+CAGGATGAAGTGGAAGAAAGATTCCAAAATGAAAAGCAAAGAGGCTCTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@316:NM_022658:2032:158
+GCGCTTTTATTGTGCTTCTAACCCCAGTAGAGTAGAACTAAATTGCACTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@317:NM_174914:353:194
+GAAGGAAGGTGGATTTTAAGGCTGGAAATCTGAGGGTCAGTGGTCCAAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@318:NM_022658:350:179
+GACTTCTTCCACCACGGCACCTCCGGCATCTCCAACTCAGGCTACCAGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@319:NM_174914:1873:205
+AAAGAGGTCCTTTTATGCCAGATTTTAAAAAGGAAGAAAAATCATATCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@320:NM_153633:292:210
+GTTATAATTGGGGTTCACCGTGCTAACGTGAATTTTTTTCATCCATGGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@321:NM_022658:58:182
+CCCAGTCCCGGGGAGCCAGCTGGCCTGGGGTTCGGTCCCGGGGGGAGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@322:NM_174914:1270:173
+ATCACCCCTTGGGGTAGGTGAGCAAAGGCATTGTTCATCTCCTTGAAGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@323:NM_022658:581:169
+CCCAGCCTCATGTTTCCATGGATGAGACCCCACGCTCCGGGGAGGCGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@324:NM_174914:705:183
+GTGGGCTGGATTGACCACGTCCTCCAGACAGGGGGCGCGACGCACCTCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@325:NM_022658:1492:184
+CCTGCTTAGAAAAACCCCCTTGACTTTCTCTAGGAACCTGATGGAAACCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@326:NM_174914:1850:187
+TTAAGGAATCCATGATATCCTTTCTATTTAAAAAATGACTGCACTGCAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@327:NM_173860:554:151
+GACCAGAAACTCGCCCTCCAGCTCTGCCAGTTGCAACTTCGAATAGGGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@328:NM_018953:1111:188
+GCCCTAGGCCGATGCTCTCCTTTCATATGCAAATCATTCATAAGTGAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@329:NM_022658:1051:226
+TTGCAGCTCTGGTTTTATTACCTTTGGACTTCCCCCACTCTTTATTTGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@330:NM_006897:749:168
+CAGGGACCGTCGGTATGAGGTGGCCCGGGTTCTCAATCTCACCGAGCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@331:NM_022658:653:175
+TATCAGACCTTGGAACTAGAAAAGGAGTTTCTCTTTAATCCTTATTTGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@332:NM_174914:1055:174
+TGGCTGCAAATGTGAAAATTGTGGACTGGCTTCCTCAGAGTGACCTCCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@333:NM_022658:1010:179
+GAATAGAATGACACTCACAACTCTAACTACCTGTCAGATACTTGCAGCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@334:NM_174914:811:211
+AGTTAAAGAAGCTCAAGGCAGAGACATTGGCTCTTAAGATGAAACAAATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@335:NM_173860:303:216
+GGACGAACTGGAGTCGGATTCCAGCGACTGGCAGGAGGGCGGGTCGTGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@336:NM_022658:1530:175
+TGATGGAAACCTGAAGGAGATGTGGGTCTTTCCCCTCCCCCCATTTCCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@337:NM_022658:111:189
+CGTACACCAGCGCATGGCTCCTGCCCACGCTCTGAGGGAACCGGCAGTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@338:NM_173860:10:191
+GGGCTGCGGGTAGCCATTGCACGGCTCCGCCGACGGCCAGGACAGGGAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@339:NM_022658:1639:186
+TCGGGCCCATGCCTTCCTCTCCTTCGCTGTTTGATTTCTATTCTGTTGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@340:NM_022658:530:181
+GCCAACACTAACAGTAGCGAAGGACAAGGCCACTTAAATCAAAACTCGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@341:NM_022658:2073:190
+TCACGTATACAATACAAAGTACTTGGACCAGGAACAGGGCTGTCGGGACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@342:NM_022658:1159:135
+CCTTGCCCCACACACACTTGTCCCTGCCCCCACCCTTCTGAGTCCTTCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@343:NM_174914:853:172
+TTCAGTTAAAGAAGCTCAAGGCAGAGACATTGGCTCTTAAGATGAAACAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@344:NM_174914:504:173
+AGGTGCAGCCTTGGCGGGGTCTGTTTGGTGGGCGATGTCACCATTTCTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@345:NM_022658:1876:196
+AAAAAGAAAGAAAGAAACCTCCAGCGTATTTTATCACTACCTATAGAAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@346:NM_014620:644:177
+GCCTCGCCGGCCGCATGGCCAGAGGGTTGGAAATTAATGATCATGAGCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@347:NM_153633:175:184
+CTGAGAGAGGCGCCGGCTCGCAGAGCGACTGTGATTTCTCGGGGTGGTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@348:NM_022658:2079:198
+TTTATTATTATGACTCACGTATACAATACAAAGTACTTGGACCAGGAACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@349:NM_174914:546:197
+CCATTTTTCCTGTTCTTCAAGAAAACAGGAGATAACTAGAAGGACTAGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@350:NM_173860:364:166
+CAGCGCTGCTCCCGCTGGAGCCGTCGGGGCCGCCTGCGCTCGGCTTCAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@351:NM_022658:1762:169
+GATTTCTTTCTATAGGTAGTGATAAAATACGCTGGAGGTTTCTTTCTTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@352:NM_022658:1964:154
+TAAACAGAGAATTCAAGACAGAGTTAACTATACATTCAGTGCAATTTAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@353:NM_006897:793:193
+TCTTGCTCTTTCCTTTTCTTTTTCGTCTCTCCCCCGCCTGTGTTGGGGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@354:NM_022658:1157:173
+CTCCTTGCCCCACACACACTTGTCCCTGCCCCCACCCTTCTGAGTCCTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@355:NM_022658:736:197
+GGGGGGGGGGGTCTTTCTTTTTTGCTTAGTCCTTGTTTTCTTCCTTTTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@356:NM_022658:2077:197
+ATTATTATGACTCACGTATACAATACAAAGTACTTGGACCAGGAACAGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@357:NR_031764:1646:172
+GATTTTGGCAGCCTCTGAGAGCAGGACCCCAGGGAGAAGGAAGCCCACTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@358:NM_022658:1577:174
+CAGAAGGGTAGATAGGAGCCTGCAGTCGCCTCTAAAATCCTACCTAACCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@359:NM_022658:1546:185
+GAGATGTGGGTCTTTCCCCTCCCCCCATTTCCAGAAGGGTAGATAGGAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@360:NM_174914:1235:190
+AAACCAGTACCACAAGACTTGGAGAACTTCATTGCCAAGTTTGGGGACTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@361:NM_018953:182:192
+CAGGTACTGCTACGGCGGATTGGACTTAAGCATCACTTTCCCACCGCCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@362:NM_006897:36:189
+CAGATAAAAAGTACATATACAGTTCATACAATAATCTTATGTATGTAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@363:NM_006897:577:193
+ACCTCATACCGACGGTCCCTGGTTAAATACATATTGAAGAGAAACTCCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@364:NM_018953:344:171
+AGTTTGGTCATCCACGGGTAAATCTGTGGCGGGGCCGGTGGCTGGCTCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@365:NM_022658:1867:174
+AAAAAAAAAAAAAAGAAAGAAAGAAACCTCCAGCGTATTTTATCACTACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@366:NM_022658:1429:160
+TCTACCCTTCTGGAAATGGGGGGAGGGGAAAGACCCACATCTCCTTCAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@367:NM_173860:121:168
+CGCTGTCCTACCCACGCCGCGACAACGTGTGCTCCCTGTCCTGGCCGTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@368:NM_174914:2102:184
+AGGCTGAGATCCGCGGCTTCCGTAGAAGTGAGCATGGCTGGGCAGCGAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@369:NM_022658:1773:178
+TACCTAAAGGGAACCTGCAATAATCTTGAAAAAGAAAAAGAGAAAAATTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@370:NM_014620:107:191
+TTTTTTAAATTAATCTGATTAATAATTATTTTTCCCCCATTTAATTTTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@371:NM_022658:1828:177
+TCCTGCTATAGGAGAAAAAAAGAGAAAAAAATAAAAATCAAAAAAAAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@372:NM_006897:325:162
+ATCACCCGTACGGCCCCCAGCCCCACCTCGGCGCCGACACGCGCTACATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@373:NM_022658:1008:199
+GAGAATAGAATGACACTCACAACTCTAACTACCTGTCAGATACTTGCAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@374:NM_022658:1811:179
+AGAGAAAAATTTTAAAATCCTGCTATAGGAGAAAAAAAGAGAAAAAAATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@375:NM_022658:607:150
+ACTTGTCTCTCGGTCAGTCCCAGGGCATGAGAGACTTCAATCCGACGTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@376:NM_174914:880:183
+CATGGTCCGAGTAGAAGCCAAAAAGTTTGGTGTTTCTATTCAGTTAAAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@377:NM_006897:581:192
+GGACGCGCTCGCCGGCAGCAAGCACAAAGAGGAGAAGGCCGACCTGGACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@378:NM_006897:1039:167
+ACTGGCTTCTCTGAAGAAAGGAGGAAAAAAATCACATTTGTATGTGTCAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@379:NM_022658:962:178
+GGTAGCAGATAAATTGAGAAGTTTACGACTGTCATTTGCTTTTATAGAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@380:NM_022658:1317:180
+GCAGGGAGCCCTGGGGAGGGGGAGGGGGAGGGGGAGGGGATATTCCTTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@381:NM_018953:1382:192
+AGTTTCAGGAAGGACCCAGAGTCAATAAATAGTTGGACAACAGCAATGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@382:NM_153633:1225:174
+TCCCACACCCCCCCCCAACAATAATACAAAAGAACTTCATAGCTTTGTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@383:NM_022658:1294:371
+TTTAGAGGGGAGCCCCCTCGAAATGCAGAAAAGGACTTGTGGTTTTGTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@384:NM_173860:509:178
+CAGCTCTGCCAGTTGCAACTTCGAATAGGGCTTGCGCTTCTTCCGAGAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@385:NM_022658:1084:188
+CCCACTCTTTATTTGTTTGGGGGCTGGAGGGGGGAGACGGAGAAACAGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@386:NM_006897:701:142
+CTTTTTCATCTTCATCCTTCGATTCTGAAACCAGATTTTGACCTGCCGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@387:NM_174914:1308:169
+CTCCTTGAAGATTTCCGGATTCTGACAGGTGTTCACCATGGAGCCCAAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@388:NM_022658:1421:173
+ACAAATGTAAAGAAATAAGGAAAAAAGCAAGGAATATCCCCTCCCCCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@389:NM_174914:1687:180
+TATCATGGATTCCTTAAAGAATGAGAACTTCGACATGGTGATAGTTGAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@390:NM_174914:295:159
+GACTAGGTCTGGACATGGAGGCTGGAAGAGTCAGGGTGTGATTCGGAGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@391:NM_174914:1981:156
+GGACCGGGTTTCTCAGATTCTTCAAGATCACGGTCATAATGTCACCATGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@392:NM_022658:72:98
+GCCAGCTGGCCTGGGGTTCGGTCCCGGGGGGAGGGGAGTTTCGGGGGTAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@393:NM_174914:487:187
+TGCAGCCTTGGCGGGGTCTGTTTGGTGGGCGATGTCACCATTTCTAGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@394:NM_022658:1354:171
+CTAGAGAAAGTCAAGGGGGTTTTTCTAAGCAGGGAGCCCTGGGGAGGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@395:NM_174914:1139:187
+CCGGAAATCTTCAAGGAGATGAACAATGCCTTTGCTCACCTACCCCAAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@396:NM_022658:708:140
+AACGTCGGATTGAAGTCTCTCATGCCCTGGGACTGACCGAGAGACAAGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@397:NM_174914:1170:192
+TGGGTGAGCCAGGAGGTCACTCTGAGGAAGCCAGTCCACAATTTTCACAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@398:NM_022658:1940:167
+GAGTATTTGTAATGCGGTTTTGTTGTCGTTTGTTGCTGCTTATTTCACTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@399:NM_174914:248:183
+TGGATGTTATTCCATGATAGATAGTAGGGGCAGGAGTGAGAGAGGCTGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@400:NM_018953:898:194
+AGGGCCGCGCTGAGGCTGGGAGCCGGAGATACGGCCCAGGCCAAGGTTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@401:NM_006897:260:105
+CGCGCCCAAGCCGGCAGTGTTCAGCACGTCGTGGGCGCCCGTGCCCTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@402:NM_022658:10:141
+GCACCGAGGCGCCCCCCAACCTGCCCAGCCCCCAGCCCACCAGCCCAGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@403:NM_022658:531:175
+CCAACACTAACAGTAGCGAAGGACAAGGCCACTTAAATCAAAACTCGTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@404:NM_173860:216:191
+CCGAGCGCAGGCGGCCCCGACGGCTCCAGCGGGAGCAGCGCTGCCCCGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@405:NM_001168316:626:154
+CTGCTGGGGCTCACTCTGGGGACTCTATGGCTTTGTGGGAAGCTGCTGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@406:NM_022658:281:170
+TAGCCATAGAATTTGGAGGCGTCTCCGTGGCAGCTAAGCGAGCACGGGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@407:NM_006897:1040:192
+CTTGCGATTTGGGAGGGTTCAGTGTTGAGATATTGGTGTTTTAGAGTTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@408:NM_173860:586:143
+GCGCTGGCGTGTGATGAACTCGTTGACCAGAAACTCGCCCTCCAGCTCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@409:NM_022658:70:166
+GAGCCAGCTGGCCTGGGGTTCGGTCCCGGGGGGAGGGGAGTTTCGGGGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@410:NM_174914:938:180
+CCACTGCCGCGGACTTGTATCTCTTGTCTTCCATGATTTGTTTCATCTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@411:NM_022658:2081:165
+GAATGTATAGTTAACTCTGTCTTGAATTCTCTGTTTATGCAATGTGCTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@412:NM_022658:1349:172
+CTAAGGCTAGTGTACTAGATGTACTTTTTCTAAAAAGGAAAGGACAGAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@413:NM_014620:283:182
+CTGTCTCAGCTCCACACACACACACATATACTTTATATAAATTCAAAAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@414:NM_174914:503:172
+GTGCAGCCTTGGCGGGGTCTGTTTGGTGGGCGATGTCACCATTTCTAGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@415:NM_018953:966:175
+CAGCTCGGTACCCGGGGCCCAGGGCAAGCTCCGCAGGACTTCCCCGGAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@416:NM_173860:444:168
+GACGGCGGCGGCGGCGCAGGACCTCCGCACGACCCGCCCTCCTGCCAGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@417:NM_014620:1403:181
+CCTATATATATATATATATATATATATATTAAATTCTATAAATAAGAGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@418:NM_174914:925:142
+AAAACATGGTCCGAGTAGAAGCCAAAAAGTTTGGTGTTTCTATTCAGTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@419:NM_022658:1631:202
+CAGGATTTTAAAATTTTTCTCTTTTTCTTTTTCAAGATTATTGCAGGTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@420:NM_014620:921:196
+GTGCTAACGTGAATTTTTTTCATCCATGGGTAGACTATGGGTTGCTTGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@421:NM_174914:824:143
+GAAAGACATAGGGCTTGAGGTGCGTCGCGCCCCCTGTCTGGAGGACGTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@422:NM_022658:1047:191
+CGGAGGCCAGGTCTCAGACCTTAAAATCCAGGAAGGACTCAGAAGGGTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@423:NM_174914:2177:185
+GGATTTTGGCAGCCTCTGAGAGCAGGACCCCAGGGAGAAGGAAGCCCACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@424:NM_022658:271:205
+CGTGGGCAGGAGCCATGCGCTGGTGTACGGGCCCGGCGGCTCGGCGCCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@425:NM_022658:659:178
+CCTCATCTCGGGCTCCCGGCAGTTTATCCTTGTTGTTCTCCTTTTTCCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@426:NM_174914:1496:208
+AGTCAGAGTTAATGAACCACAACTCTGCTTTCAGTAGAAGATGAGACAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@427:NM_174914:1157:172
+ACAGACGGATGCTTGGGTGAGCCAGGAGGTCACTCTGAGGAAGCCAGTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@428:NM_153633:1236:178
+CTTCGCCCCCTCTCCTCCCACACCCCCCCCCAACAATAATACAAAAGAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@429:NM_004503:417:170
+GGATTTTAGTTCTGAGCAGGGCAGGACTGCGCCCCAGGACCAGAAAGCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@430:NM_173860:652:170
+GCAAGCCCTATTCGAAGTTGCAACTGGCAGAGCTGGAGGGCGAGTTTCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@431:NM_004503:853:178
+CGAGGAGGAGGAGGCGCGTGGTGAAAGAGAGTTGTGCGGTGAGGGAGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@432:NM_022658:2013:193
+TACATTCATAGCTGGACATAAAGACAAATGACAAAAAATTATTATTATAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@433:NM_022658:1167:182
+CATAAAAACAAAACCACAAGTCCTTTTCTGCATTTCGAGGGGGCTCCCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@434:NM_018953:1346:194
+GGACAACAGCAATGGGTCAGGAGGGCACAGAAATTCGTGGCAGGGACTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@435:NM_014212:887:194
+AACAAAGAGAAGCGGCTGCAGCTGTCCCGGATGCTGAACCTGACGGACCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@436:NM_004503:1008:191
+CACCACGCGCCTCCTCCTCCTCGCTCCCTTGCTAGCTCGTTCTCGGCTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@437:NM_004503:1251:193
+GGGAGGGCCGGAGGCCCAAGGAGGGCGCGCCTTGGCCCCACACCAACCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@438:NM_014620:818:169
+GAGGCGCCGGCTCGCAGAGCGACTGTGATTTCTCGGGGTGGTGGTGGCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@439:NM_014620:1401:167
+TATATATATATATTAAATTCTATAAATAAGAGTCAATTTGTGTGTGAGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@440:NM_006897:843:186
+CCCCTTCCTTGTTTTTCTTTTTAAGCTGATTGGCTTTTGTCTATCTTGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@441:NM_022658:923:183
+CCCCAAACAAATAAAGAGTGGGGGAAGTCCAAAGGTAATAAAACCAGAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@442:NM_174914:472:218
+AATTCTGCTAGCAGGCAGGAGCTAGTAAGGATGAATTTGTAGCAAAATTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@443:NM_022658:442:166
+TCTCATCCATGGAAACATGAGGCTGGGAGACGAGTTTTGATTTAAGTGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@444:NM_014620:1002:160
+GTCCTCGAGCGCTTGGGTTCCCCTCCGTTATAATTGGGGTTCACCGTGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@445:NM_022658:150:168
+GCGCCGAGCCGCCGGGCCCGTACACCAGCGCATGGCTCCTGCCCACGCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@446:NM_173860:583:216
+ACCCCGGCGGCGGGCTCTCGGCCAGCGGCGCGCCCTGGTACCCGATCAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@447:NM_173860:515:171
+GTCCCTGCTCAACGAGGGCAACAAGGGCGCCGGCGCAGGCGACCCCGGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@448:NM_022658:1911:215
+ACATTGCATAAACAGAGAATTCAAGACAGAGTTAACTATACATTCAGTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@449:NM_022658:1052:194
+GAGGAGCACGGAGGCCAGGTCTCAGACCTTAAAATCCAGGAAGGACTCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@450:NM_014620:2150:111
+ATAGGTAGAATCTCTCCCCACCCCTATCGTGGTTATTGTGTTTTTGGACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@451:NM_022658:1559:175
+GTGATTTCTGAGCACTAACACTAATGCAGCTCAGAGGAAGGCGGGCCCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@452:NM_173860:491:186
+AGTTGCAACTTCGAATAGGGCTTGCGCTTCTTCCGAGAGCGGCTGTTGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@453:NM_153633:753:197
+GGCAGCTACCCCGGGTACTTCTGAAGACCACTCCCAGAGCGCCACGCCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@454:NM_022658:2075:197
+TGCACTGAATGTATAGTTAACTCTGTCTTGAATTCTCTGTTTATGCAATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@455:NM_173860:651:189
+CGCAAGCCCTATTCGAAGTTGCAACTGGCAGAGCTGGAGGGCGAGTTTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@456:NM_174914:1540:179
+GACAAAACTGGCCTAGAGCCTTCTGTGAAATGTTCCTTGATGGTGTTGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@457:NM_022658:1764:191
+TTAACATACTACCTAAAGGGAACCTGCAATAATCTTGAAAAAGAAAAAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@458:NM_174914:20:197
+TGTTTTGTTCTCCCACATATTCTCTTCAATGCTCAGGAAGCCTGCCCTGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@459:NM_174914:2090:173
+AGAAGTGAGCATGGCTGGGCAGCGAGTGCTTCTTCTAGTGGGCTTCCTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@460:NM_022658:1729:165
+ATCACCATAATCACGAAAATAATAATAATAAATCTTTAACATACTACCTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@461:NM_022658:13:190
+GGGGTTGACGAAGTAGGAGCTCATGCTGGGTACATGAAAACCCGCGGCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@462:NM_018953:92:187
+CAATTCATTCTATAAGCAGAGCCCCAATATCCCTGCCTATAACATGCAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@463:NM_006897:418:194
+GCTTCCCGGCCGGGGGCCGTCACTACGCCCTCAAGCCGGACGCCTACCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@464:NM_022658:880:172
+AGTATCTGACAGGTAGTTAGAGTTGTGAGTGTCATTCTATTCTCTATAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@465:NM_022658:467:146
+CAGTCCCTTTATGGGGCTCAGCAAGAGGCGAGCGTGGTGCAATATCCCGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@466:NM_001168316:361:162
+CTAATTTTGCTACAAATTCATCCTTACTAGCTCCTGCCTGCTAGCAGAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@467:NM_022658:528:212
+CCGCCAACACTAACAGTAGCGAAGGACAAGGCCACTTAAATCAAAACTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@468:NM_022658:1742:182
+CGAAAATAATAATAATAAATCTTTAACATACTACCTAAAGGGAACCTGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@469:NM_174914:84:184
+CTATCATGGAATAACATCCAAGAAAGACACCTTGCATATTCTTTCAGTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@470:NM_014620:1526:154
+CAGTGGGAGGGAGAGGAGGGCAGGGGGCTTGTTTGTTTATCTGTTTTGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@471:NM_022658:1810:144
+AAGAGAAAAATTTTAAAATCCTGCTATAGGAGAAAAAAAGAGAAAAAAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@472:NM_174914:2169:175
+TATTGTCAGGATTTTGGCAGCCTCTGAGAGCAGGACCCCAGGGAGAAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@473:NM_018953:833:182
+CGGGGGCAGGTGCTGGAGCACTGGGCTCCCGGGCCCCACAGACAAAAGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@474:NM_173860:374:171
+GCGCCCTTGTTGCCCTCGTTGAGCAGGGACGAACTGGAGTCGGATTCCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@475:NM_022658:260:186
+ATAGAATTTGGAGGCGTCTCCGTGGCAGCTAAGCGAGCACGGGTTCTGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@476:NM_022658:708:172
+TCTTCTTTCTCCTCTTCCTCATTTCCTTCTTCCTCCACCTTCTCCTCATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@477:NM_173860:271:170
+GCAAGGGTTACTACCGCGAGCCGTGCGCCGAGGGTGGCGGCGGGGGCCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@478:NM_022658:731:187
+GCCCTGGGACTGACCGAGAGACAAGTGAAGATCTGGTTCCAGAACCGAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@479:NM_022658:1539:161
+AGGAAGGCGGGCCCAACAGAATAGAAATCAAACAGCGAAGGAGAGGAAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@480:NM_022658:870:220
+AGTGGGGGAAGTCCAAAGGTAATAAAACCAGAGCTGCAAGTATCTGACAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@481:NM_174914:617:186
+GGGAAGCTCCCTAGAAATGGTGACATCGCCCACCAAACAGACCCCGCCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@482:NM_174914:1525:184
+TTCAGTAGAAGATGAGACAAAACTGGCCTAGAGCCTTCTGTGAAATGTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@483:NM_022658:594:167
+TTCCATGGATGAGACCCCACGCTCCGGGGAGGCGCAGTGGACGGCAAACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@484:NM_174914:2007:176
+AGGTGCAAGCCAACTGATAACTTGATATGATTTTTCTTCCTTTTTAAAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@485:NM_174914:2075:187
+GAAGTGAGCATGGCTGGGCAGCGAGTGCTTCTTCTAGTGGGCTTCCTTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@486:NM_022658:246:170
+ATTACGACTGCCGGTTCCCTCAGAGCGTGGGCAGGAGCCATGCGCTGGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@487:NM_153693:998:175
+CTAACGCGGCGCCGGCGCATCGAGATCGCCAACGCGCTTTGCCTGACCGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@488:NM_174914:888:169
+CAGCCGCTGTGTGGGGCTGAGCGGGTGGGAGCGCAGGATGACACTGGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@489:NM_018953:253:174
+TCTCCCCACTGCTCTTAGCTCGCTCCTCCAGCGCCGGGCGAGCCGCCTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@490:NM_022658:1358:186
+TCAGGTTTCCATCAGGTTCCTAGAGAAAGTCAAGGGGGTTTTTCTAAGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@491:NM_173860:480:188
+CCCTCCTGCCAGTCGCTGGAATCCGACTCCAGTTCGTCCCTGCTCAACGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@492:NM_017410:1751:177
+ATCCCAACCAAGAAACTGCATTTCCTGGGGCCAGGTGGGAGCTGCCTTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@493:NM_174914:746:159
+GCCCCACACAGCGGCTGGTGGGCTGGATTGACCACGTCCTCCAGACAGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@494:NM_022658:394:181
+CCAGCAGAACCCGTGCTCGCTTAGCTGCCACGGAGACGCCTCCAAATTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@495:NM_022658:1222:176
+TGAGACCTGGCCTCCGTGCTCCTCGGTCTGTCTCTCACCACACTCCCACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@496:NM_022658:123:233
+GGGCGGGGTACTCGTGAGCCAGAGGGGAGGGGGCCGCGGGTTTTCATGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@497:NM_022658:1674:151
+TAAAATTTTTCTCTTTTTCTTTTTCAAGATTATTGCAGGTTCCCTTTAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@498:NM_004503:384:198
+TCCAGTTCCAGGGTCTGGTACCGCGAGTAGATCTGGCGGCCGCGCCTCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@499:NM_022658:1491:160
+CCCTGCTTAGAAAAACCCCCTTGACTTTCTCTAGGAACCTGATGGAAACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@500:NM_022658:1648:203
+TCTTTTTTTCTCCTATAGCAGGATTTTAAAATTTTTCTCTTTTTCTTTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@501:NM_022658:420:198
+GAGCGTGGGGTCTCATCCATGGAAACATGAGGCTGGGAGACGAGTTTTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@502:NM_022658:2097:179
+CTGTCTTGAATTCTCTGTTTATGCAATGTGCTCGAAAGAAAAAAATGTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@503:NM_022658:2065:183
+AAAGTACTTGGACCAGGAACAGGGCTGTCGGGACACAAAATCTACATTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@504:NM_022658:1179:186
+TCCCTGCCCCCACCCTTCTGAGTCCTTCCTGGATTTTAAGGTCTGAGACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@505:NM_001168316:1322:172
+GCCTTTGATTTTGCTCGACCTCTGCTTCCCAACACTGTTTATGTTGGAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@506:NM_001168316:526:180
+GTGGAAAGGATGATTTTTGGCCATTTTTCCTGTTCTTCAAGAAAACAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@507:NR_031764:309:171
+GCAGAATTCTTTCCAGTCCTCTTGTCCTCCTTTGTTTGCCATCAGCAAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@508:NM_006897:765:149
+CCTTGGCTGTGCTGAGGCAGCAGGCTGGGTAGGGTTTAGGACTGCTCCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@509:NM_022658:1758:147
+ATACGCTGGAGGTTTCTTTCTTTCTTTTTTTTTTTTTTGATTTTTATTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@510:NM_173860:642:205
+AAAAGAAGGAGAGAGCTTGCTCCCTCAACAGAAGTCTTTTCTTTTTCATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@511:NM_022658:98:171
+CTGAGGGAACCGGCAGTCGTAATAGGCCGGTTCCAGGGACTCGCCGGCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@512:NM_022658:1467:161
+CTCCCCCTCCCCCTCCCCAGGGCTCCCTGCTTAGAAAAACCCCCTTGACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@513:NM_022658:1026:202
+GTCTCAGACCTTAAAATCCAGGAAGGACTCAGAAGGGTGGGGGCAGGGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@514:NM_017409:959:179
+AGGCCGCGCTCTCAGGTGAAATTAAAATTGGAGGTCAGTTCCCGGATCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@515:NR_031764:233:193
+GCAAGGTGTCTTTCTTGGATGTTATTCCATGATAGATAGTAGGGGCAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@516:NM_022658:1265:155
+TCCCACCTCCCTGCTTCTCTGGTATTTATTTTAGAGGGGAGCCCCCTCGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@517:NM_022658:1820:190
+TTTTAAAATCCTGCTATAGGAGAAAAAAAGAGAAAAAAATAAAAATCAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@518:NM_022658:1333:194
+TGGTTTTGTTTTTATGCTAAGGCTAGTGTACTAGATGTACTTTTTCTAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@519:NM_174914:496:162
+GTAAGGATGAATTTGTAGCAAAATTAGCAAGTGGAAAGGATGATTTTTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@520:NM_022658:1939:203
+TTTTTTTCTTTCGAGCACATTGCATAAACAGAGAATTCAAGACAGAGTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@521:NM_022658:390:137
+GGATTTACAGTCGGGATATTGCACCACGCTCGCCTCTTGCTGAGCCCCAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@522:NM_006897:1314:177
+AAGACACACACACATACATGATAATGATTCCCAGCCCAGGAGCTGAGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@523:NM_014620:667:175
+GGGTTGGAAATTAATGATCATGAGCTCGTATTTGATGGACTCTAACTACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@524:NM_022658:1313:198
+GAAATGCAGAAAAGGACTTGTGGTTTTGTTTTTATGCTAAGGCTAGTGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@525:NM_173860:198:193
+CCGACGGCTCCAGCGGGAGCAGCGCTGCCCCGGGCCCGGCTCCCGGGTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@526:NM_022658:741:189
+TGACCGAGAGACAAGTGAAGATCTGGTTCCAGAACCGAAGGATGAAGTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@527:NM_173860:128:174
+CTACCCACGCCGCGACAACGTGTGCTCCCTGTCCTGGCCGTCGGCGGAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@528:NM_174914:1218:176
+ATTTGCAGCCAGGTGGACATCTTTGGGCCAATGAGAACACTGACACTTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@529:NM_174914:1973:138
+ATCACGGTCATAATGTCACCATGCTTAACCACAAAAGAGGTCCTTTTATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@530:NM_174914:1590:177
+AAATGTAGACTGCATGTGCTGTTGCCTCCTGCAGAAACTAAAGAACATCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@531:NM_001168316:1313:216
+TGAAAGCAGAGTTGTGGTTCATTAACTCTGACTTTGCCTTTGATTTTGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@532:NM_006897:38:164
+GATAAAAAGTACATATACAGTTCATACAATAATCTTATGTATGTAAAACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@533:NM_022658:900:191
+AGGACTAAGCAAAAAAGAAAGACCCCCCCCCCCTTAGCAACTCCCTTGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@534:NM_004503:17:175
+TGGAGCCGTCCCTATAACCATCTAGTTCCGAGTACAAACTGGAGACAGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@535:NM_174914:307:184
+CCTGCCTGCTAGCAGAATTCTTTCCAGTCCTCTTGTCCTCCTTTGTTTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@536:NM_173860:336:207
+GCCCTTGTTGCCCTCGTTGAGCAGGGACGAACTGGAGTCGGATTCCAGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@537:NM_174914:329:180
+GGTGTGATTCGGAGAGGCGCATGAGAAGGAAGGTGGATTTTAAGGCTGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@538:NM_022658:68:168
+GGGAGCCAGCTGGCCTGGGGTTCGGTCCCGGGGGGAGGGGAGTTTCGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@539:NM_153693:116:197
+TTAATCTGATTAATAATTATTTTTCCCCCATTTAATTTTTTTTCCTCCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@540:NR_031764:207:99
+CAGACCTAGTCAGCCTCTCTCACTCCTGCCCCTACTATCTATCATGGAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@541:NM_022658:956:190
+GTCCGAACTTTTCACTGTTTCTCCGTCTCCCCCCTCCAGCCCCCAAACAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@542:NM_004503:1217:184
+AAAATGCCATAATGACCCCCAGGATTCTTTAAATACAATTTGCCTGGGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@543:NM_174914:1472:196
+GAGGTCGAGCAAAATCAAAGGCAAAGTCAGAGTTAATGAACCACAACTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@544:NM_022658:781:194
+TTTATCTGCTACCATAAAACGAAACTTCAAGGGAGTTGCTAAGGGGGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@545:NM_022658:716:191
+ATTGAAGTCTCTCATGCCCTGGGACTGACCGAGAGACAAGTGAAGATCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@546:NM_014620:301:203
+AGCTTGGGAGCTGCAGATGCCTCCGCCCCTCCTCTCTCCCAGGCTCTTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@547:NM_173860:375:155
+CCGCTGGAGCCGTCGGGGCCGCCTGCGCTCGGCTTCAAGTACGACTACGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@548:NM_022658:1251:168
+GTCTCTCACCACACTCCCACCTCCCTGCTTCTCTGGTATTTATTTTAGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@549:NM_014620:1582:172
+AAATGGCCTTTTAAAAAAAAACACCCAGCAGGTACCATGCTAAGACAACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@550:NM_022658:1140:184
+TCGGACTCTCTGTCTCACTCCTTGCCCCACACACACTTGTCCCTGCCCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@551:NM_022658:685:174
+TTTCCTTCTTCCTCCACCTTCTCCTCATCTCGGGCTCCCGGCAGTTTATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@552:NR_031764:486:188
+TGCAGCCTTGGCGGGGTCTGTTTGGTGGGCGATGTCACCATTTCTAGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@553:NM_174914:1398:176
+GTTCTCCAAGTCTTGTGGTACTGGTTTAATAGGTTTTTCCATCAAGCCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@554:NM_022658:1731:200
+GATTTCTTTCTATAGGTAGTGATAAAATACGCTGGAGGTTTCTTTCTTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@555:NM_174914:1067:88
+CAGGCTGGTCTCCAAAGAGAGGGATCCCCACCATGGGCACACCATGCTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@556:NM_022658:1960:168
+GCACATTGCATAAACAGAGAATTCAAGACAGAGTTAACTATACATTCAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@557:NM_022658:202:198
+TGCTGGTAGCCTGAGTTGGAGATGCCGGAGGTGCCGTGGTGGAAGAAGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@558:NM_022658:205:181
+GTTCTCCAAATACAAAGCCGGCGAGTCCCTGGAACCGGCCTATTACGACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@559:NM_022658:870:182
+AGTATCTGACAGGTAGTTAGAGTTGTGAGTGTCATTCTATTCTCTATAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@560:NR_031764:537:201
+GATTTTTGGCCATTTTTCCTGTTCTTCAAGAAAACAGGAGATAACTAGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@561:NM_174914:1899:173
+GTCCTTTTATGCCAGATTTTAAAAAGGAAGAAAAATCATATCAAGTTATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@562:NM_022658:1565:182
+TTTCGTGATTATGGTGATTTCTGAGCACTAACACTAATGCAGCTCAGAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@563:NM_022658:775:202
+AATTTATCTGCTACCATAAAACGAAACTTCAAGGGAGTTGCTAAGGGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@564:NM_174914:1809:145
+TTTAGGTGGCAGAGGAAAATTTGAAAACTTATTAAATGTTCTAGAATACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@565:NM_001168316:2039:184
+TTTCTTCCTTTTTAAAATCTACTGTAGATATTGTCAGGATTTTGGCAGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@566:NM_018953:824:167
+GCCCTGGGCCCCGGGTACCGAGCTGAGCCGAGCTGAGGGGAGATGGGGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@567:NM_174914:5:165
+GAGGTTGGGGAGAGATAACGCTGTAAACTTTTATTTTTCAGGAAATCTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@568:NM_022658:1069:136
+TACCTTTGGACTTCCCCCACTCTTTATTTGTTTGGGGGCTGGAGGGGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@569:NM_173860:548:179
+GCTGGCGTGTGATGAACTCGTTGACCAGAAACTCGCCCTCCAGCTCTGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@570:NM_022658:470:163
+TCCCTTTATGGGGCTCAGCAAGAGGCGAGCGTGGTGCAATATCCCGACTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@571:NM_006897:992:166
+ATTTATTTCGGTTGCGCTGGGGAAAGAGAACGCAGTTTCTCTCCCCGCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@572:NM_017410:1540:181
+GGAATTCCAGCTTTTACGGAAACATCCATACTCCAATCACGCTGCCAGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@573:NM_006897:692:180
+TGCTCCTTGTCGGTTTTCTCTTTATTCATCTTTTTCATCTTCATCCTTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@574:NM_022658:1950:218
+AATGCGGTTTTGTTGTCGTTTGTTGCTGCTTATTTCACTAAGAAAACCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@575:NM_022658:637:185
+CCGGCAGTTTATCCTTGTTGTTCTCCTTTTTCCACTTCATCCTTCGGTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@576:NM_174914:1575:192
+GTGGCCATTCTTTCCACTTCATTCGGCTCTTTGGAATTTGGGCTACCAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@577:NM_022658:691:201
+TCCTTATTTGACACGAAAACGTCGGATTGAAGTCTCTCATGCCCTGGGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@578:NM_004503:583:182
+AGGCTGTCGGCGGTGGCCCCTCCGCCGCCCCCCGAGAGAGTGGATGTGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@579:NM_174914:2018:157
+ACAATATCTACAGTAGGTGGAAGCCATTATCTACTGATGGACCGGGTTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@580:NM_014620:769:203
+TGAACACAGTCCGGAATATTACGGCCGGACCAGGGAATCGGGATTCCAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@581:NM_022658:1998:195
+CAACAACTGAGACTGCCTAGCCCGCCGGTCCTGTGCGCTTTTATTGTGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@582:NM_174914:232:195
+ATGCTGTGATTCTGTCTCTGAGTGACTTGGACCACTGACCCTCAGATTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@583:NM_173860:324:203
+CGTGAGGAGCGCGGGCGCGACCCGGGAGCCGGGCCCGGGGCAGCGCTGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@584:NM_014620:1652:184
+GAAATTCACCCAAGCCAGACCATCACACCTTGCAATATATAATTTTTGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@585:NM_006897:1179:177
+TTTCCTCCTTTCTTCAGAGAAGCCAGTACTTGAATCGCTATATTTCTATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@586:NM_022658:1892:186
+ACCTCCAGCGTATTTTATCACTACCTATAGAAAGAAATCCTGCTTTGAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@587:NM_022658:1272:190
+TCCCTGCTTCTCTGGTATTTATTTTAGAGGGGAGCCCCCTCGAAATGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@588:NM_006897:163:170
+TCCTAGCGTCCAGGTTTCCGGCCACCGGGGCTCATCCCGCCGCCGCCAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@589:NM_022658:1597:183
+TTAGGTAGTATGTTAAAGATTTATTATTATTATTTTCGTGATTATGGTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@590:NM_022658:1977:191
+TTATTATTATAGATATATTTTTAACATTTTTTTCTTTCGAGCACATTGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@591:NM_022658:2091:169
+CGTATACAATACAAAGTACTTGGACCAGGAACAGGGCTGTCGGGACACAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@592:NM_022658:302:200
+ACGCTCGCCTCTTGCTGAGCCCCATAAAGGGACTGTCTGGGGAGCGCCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@593:NM_022658:1570:167
+CCATTTCCAGAAGGGTAGATAGGAGCCTGCAGTCGCCTCTAAAATCCTAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@594:NM_022658:987:171
+CGACTGTCATTTGCTTTTATAGAGAATAGAATGACACTCACAACTCTAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@595:NM_022658:65:190
+AGTCGTAATAGGCCGGTTCCAGGGACTCGCCGGCTTTGTATTTGGAGAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@596:NM_004503:9:199
+ATCATAGGCGGTGGAATTGAGGGCGACGTTGGGGAGGACGTCCTGGCCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@597:NM_014620:1359:187
+CGGCCGGCGCTGCGCCCAGCACCCTTTCGGCAGCTACCCCGGGTACTTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@598:NM_022658:2023:160
+CGGTCCTGTGCGCTTTTATTGTGCTTCTAACCCCAGTAGAGTAGAACTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@599:NM_173860:289:192
+AGCCGTGCGCCGAGGGTGGCGGCGGGGGCCTGAAGCGTGAGGAGCGCGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@600:NM_022658:426:191
+AGCGTGGGGTCTCATCCATGGAAACATGAGGCTGGGAGACGAGTTTTGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@601:NM_022658:162:186
+GTTTTCATGTACCCAGCATGAGCTCCTACTTCGTCAACCCCCTGTTCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@602:NM_001168316:1177:188
+CTTGTGACCTTGGGCTCCATGGTGAACACCTGTCAGAATCCGGAAATCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@603:NM_022658:910:202
+TCCAGCCCCCAAACAAATAAAGAGTGGGGGAAGTCCAAAGGTAATAAAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@604:NM_173860:552:152
+ACCAGAAACTCGCCCTCCAGCTCTGCCAGTTGCAACTTCGAATAGGGCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@605:NM_174914:2087:188
+GCATGGTGACATTATGACCGTGATCTTGAAGAATCTGAGAAACCCGGTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@606:NM_022658:1908:191
+ATCACTACCTATAGAAAGAAATCCTGCTTTGAGAGTATTTGTAATGCGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@607:NM_014620:870:207
+AGCGCCAGTATAGCTGCACCAGTCTCCAGGGGCCCGGCAATTCGCGAGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@608:NM_174914:722:187
+CAGCCATGCCCAGCAGCTTCCCACAAAGCCATAGAGTCCCCAGAGTGAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@609:NM_004503:535:193
+GAGTGGATGTGAGATTAGATTCTTTTTTCCACTTCATCCGGCGGTTCTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@610:NM_014620:23:165
+GCGCTCCGCAGAACAGTCCTCCCTGTAAGAGCCTAACCATTGCCAGGGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@611:NM_022658:793:161
+AAAGGAGAACAACAAGGATAAACTGCCGGGAGCCCGAGATGAGGAGAAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@612:NM_174914:623:177
+CTCCCTAGAAATGGTGACATCGCCCACCAAACAGACCCCGCCAAGGCTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@613:NM_022658:2022:181
+CCGGTCCTGTGCGCTTTTATTGTGCTTCTAACCCCAGTAGAGTAGAACTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@614:NM_173860:277:188
+TCCTGCGCCGCCGCCGCCGTCGCCACCGCCGCCGCCCGCCGCGTAGTCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@615:NM_004503:354:178
+GTCCGCTCCGTAGCCGACCCCACTGTGCGAATTCATTCGCTGCATCCAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@616:NM_022658:1833:195
+GACCGGCGGGCTAGGCAGTCTCAGTTGTTGGGTTTTCTTAGTGAAATAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@617:NM_173860:90:188
+GCGTCCGGGGCGCAGCTTCCCGGGCTGCCTTCGCTGTCCTACCCACGCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@618:NM_174914:1189:163
+GCTCCATGGTGAACACCTGTCAGAATCCGGAAATCTTCAAGGAGATGAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@619:NM_022658:1176:167
+TTGTCCCTGCCCCCACCCTTCTGAGTCCTTCCTGGATTTTAAGGTCTGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@620:NM_022658:63:193
+CAGTCGTAATAGGCCGGTTCCAGGGACTCGCCGGCTTTGTATTTGGAGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@621:NM_022658:588:174
+TCATGTTTCCATGGATGAGACCCCACGCTCCGGGGAGGCGCAGTGGACGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@622:NM_022658:1039:159
+CCTGTCAGATACTTGCAGCTCTGGTTTTATTACCTTTGGACTTCCCCCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@623:NM_018953:965:180
+TAGAGGGTCCGGCGAGGGTCCTGTGGCGCGGGCCGGGCCCACCTTAACTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@624:NM_022658:546:179
+GCGAAGGACAAGGCCACTTAAATCAAAACTCGTCTCCCAGCCTCATGTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@625:NM_174914:1495:177
+CATGGACTTCTGGGGCCGAGTGAAGAATTTTCTGATGTTCTTTAGTTTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@626:NM_022658:1674:186
+ATTTTTTTCTCTTTTTTTCTCCTATAGCAGGATTTTAAAATTTTTCTCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@627:NM_022658:1165:157
+CTGCATTTCGAGGGGGCTCCCCTCTAAAATAAATACCAGAGAAGCAGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@628:NM_174914:2008:178
+GGTGCAAGCCAACTGATAACTTGATATGATTTTTCTTCCTTTTTAAAATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@629:NM_022658:1272:185
+TATTCCTTGCTTTTTTCCTTATTTCTTTACATTTGTCTTCCTTTCCTTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@630:NM_022658:603:179
+CCTTCGGTTCTGGAACCAGATCTTCACTTGTCTCTCGGTCAGTCCCAGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@631:NM_153633:133:183
+CCTGAACACAGTCCGGAATATTACGGCCGGACCAGGGAATCGGGATTCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@632:NM_173860:665:168
+GCTTGCTCCCTCAACAGAAGTCTTTTCTTTTTCATTCTCCGGTTCTGAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@633:NM_174914:638:180
+CCTGGCATGAGCAGTACCTGCTCGACGTTTTTGTGTTTCTGCTGGGGCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@634:NM_014620:1338:187
+CCAAAGTCAGGTCAGCACCCCCGGCCGGCGCTGCGCCCAGCACCCTTTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@635:NM_001168316:1387:180
+TTGGCAATGAAGTTCTCCAAGTCTTGTGGTACTGGTTTAATAGGTTTTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@636:NM_022658:507:190
+TAAGGATTAAAGAGAAACTCCTTTTCTAGTTCCAAGGTCTGATACCGGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@637:NM_022658:1620:178
+CTAACCATCCCATGGTCACTCGGGCCCATGCCTTCCTCTCCTTCGCTGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@638:NM_022658:431:177
+GCCTCCAAATTCTATGGCTACGAGGCGCTCCCCAGACAGTCCCTTTATGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@639:NM_006897:145:179
+CTCACGACAATGAAGACCTCCTAGCGTCCAGGTTTCCGGCCACCGGGGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@640:NM_001168316:527:93
+TGGAAAGGATGATTTTTGGCCATTTTTCCTGTTCTTCAAGAAAACAGGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@641:NM_022658:1523:192
+ACTAATGCAGCTCAGAGGAAGGCGGGCCCAACAGAATAGAAATCAAACAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@642:NM_022658:1151:171
+CTGCATTTCGAGGGGGCTCCCCTCTAAAATAAATACCAGAGAAGCAGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@643:NM_173860:346:177
+CGGGAGCCGGGCCCGGGGCAGCGCTGCTCCCGCTGGAGCCGTCGGGGCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@644:NM_173860:180:164
+TCGCGCCCGCGCTCCTCACGCTTCAGGCCCCCGCCGCCACCCTCGGCGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@645:NM_022658:1894:189
+TCAGTGCAATTTAGTTCTACTCTACTGGGGTTAGAAGCACAATAAAAGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@646:NM_174914:462:111
+GACTGGAAAGAATTCTGCTAGCAGGCAGGAGCTAGTAAGGATGAATTTGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@647:NM_014620:1390:189
+ATATATATATATATATATATATATTAAATTCTATAAATAAGAGTCAATTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@648:NM_022658:101:175
+CCACGCTCTGAGGGAACCGGCAGTCGTAATAGGCCGGTTCCAGGGACTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@649:NM_004503:1153:186
+GGGCAGAGGGGCTAGGCAGGGACTGCGGGGAGGCCCTGGGGGTTGGTGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@650:NM_022658:1172:117
+ACACTTGTCCCTGCCCCCACCCTTCTGAGTCCTTCCTGGATTTTAAGGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@651:NM_022658:987:192
+CAAGTGTGTGTGGGGCAAGGAGTGAGACAGAGAGTCCGAACTTTTCACTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@652:NM_174914:1345:186
+ACTGAAAGCAGAGTTGTGGTTCATTAACTCTGACTTTGCCTTTGATTTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@653:NM_174914:459:154
+GTTCTGGCAGCCCCATTCTCTAGTCCTTCTAGTTATCTCCTGTTTTCTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@654:NM_022658:849:204
+AAGAAGGAAATGAGGAAGAGGAGAAAGAAGAGGAGGAAAAGGAAGAAAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@655:NM_173860:427:161
+CGGGCGGCGGCGGTGGCGACGGCGGCGGCGGCGCAGGACCTCCGCACGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@656:NM_022658:1857:220
+CAATTTAGTTCTACTCTACTGGGGTTAGAAGCACAATAAAAGCGCACAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@657:NM_022658:1733:169
+CCATAATCACGAAAATAATAATAATAAATCTTTAACATACTACCTAAAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@658:NM_022658:2060:195
+AGAGTAGAACTAAATTGCACTGAATGTATAGTTAACTCTGTCTTGAATTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@659:NM_173860:178:192
+GCGCTGCCCCGGGCCCGGCTCCCGGGTCGCGCCCGCGCTCCTCACGCTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@660:NM_022658:750:180
+GGGGGGGGTCTTTCTTTTTTGCTTAGTCCTTGTTTTCTTCCTTTTCCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@661:NM_022658:763:170
+CTGGTTCCAGAACCGAAGGATGAAGTGGAAAAAGGAGAACAACAAGGATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@662:NM_004503:866:161
+GAGGAGGAGGCGCGTGGTGAAAGAGAGTTGTGCGGTGAGGGAGGGGGTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@663:NM_173860:143:169
+CAACGTGTGCTCCCTGTCCTGGCCGTCGGCGGAGCCGTGCAATGGCTACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@664:NM_014620:2088:161
+TCGACACTAAAATTCTTTATTGCAAGTTTTACAATAATCAAGTAAATTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@665:NR_031764:1644:166
+CCTTTGGCGCACTGAGGTGCACAGGGTCCCTTAGCCGGGCGCAGGGCGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@666:NM_022658:1360:181
+GTACTAGATGTACTTTTTCTAAAAAGGAAAGGACAGAAAAAAATGAAGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@667:NM_014620:90:184
+CCTTCATTAGCAGTATTTTTTTTAAATTAATCTGATTAATAATTATTTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@668:NM_174914:2195:183
+AGAGCAGGACCCCAGGGAGAAGGAAGCCCACTAGAAGAAGCACTCGCTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@669:NM_018953:87:175
+TGTCTACCCCGTGGAGAGAGTTGGAAGGCGCAGGCGGTGGGAAAGTGATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@670:NM_004503:985:233
+TCCCTCACCGCACAACTCTCTTTCACCACGCGCCTCCTCCTCCTCGCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@671:NM_018953:1067:181
+CTAGTTTAGTCGCTACAAGGAAGCACCCCGAGTCTAGGGCCAGACTCTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@672:NM_174914:260:192
+CATGATAGATAGTAGGGGCAGGAGTGAGAGAGGCTGACTAGGTCTGGACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@673:NM_014620:781:181
+GGAATATTACGGCCGGACCAGGGAATCGGGATTCCAGCATCACCACCAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@674:NM_014620:2189:93
+GTTTTTGGACTGAATTTACTTGATTATTGTAAAACTTGCAATAAAGAATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@675:NM_006897:736:197
+ATATGTATTTAACCAGGGACCGTCGGTATGAGGTGGCCCGGGTTCTCAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@676:NM_153633:884:192
+ACAACATCACATGCTTAAAAGGGTCCTTAACAGTGGGAGGGAGAGGAGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@677:NM_006897:124:180
+ATTACGTGGACTCGCTCATCTCTCACGACAATGAAGACCTCCTAGCGTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@678:NM_022658:343:166
+TTGCACCACGCTCGCCTCTTGCTGAGCCCCATAAAGGGACTGTCTGGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@679:NM_022658:42:197
+CAGCCCACCAGCCCAGCCCAGTCCCGGGGAGCCAGCTGGCCTGGGGTTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@680:NM_022658:1718:186
+AGTGCTCAGAAATCACCATAATCACGAAAATAATAATAATAAATCTTTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@681:NM_174914:1220:175
+ATTGCCAAGTTTGGGGACTCTGGTTTTGTCCTTGTGACCTTGGGCTCCAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@682:NM_022658:1390:179
+GGGAGGGGAAAGACCCACATCTCCTTCAGGTTTCCATCAGGTTCCTAGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@683:NM_022658:706:195
+AAAACGTCGGATTGAAGTCTCTCATGCCCTGGGACTGACCGAGAGACAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@684:NM_022658:114:156
+TCTGAGGGAACCGGCAGTCGTAATAGGCCGGTTCCAGGGACTCGCCGGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@685:NM_018953:697:195
+TGAAGTGGAAGAAAGATTCCAAAATGAAAAGCAAAGAGGCTCTTTAGAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@686:NM_001168316:865:153
+AGGACGTGGTCAATCCAGCCCACCAGCCGCTGTGTGGGGCTGAGCGGGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@687:NM_153693:248:154
+ATCATCCAAAAGCCAAACAAAATTAAGGAGAGTTGCAAGAAGGGGGCAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@688:NM_174914:583:167
+AGAAGGACTAGAGAATGGGGCTGCCAGAACTAGTGGGAAGCTCCCTAGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@689:NM_022658:1643:208
+GCCCATGCCTTCCTCTCCTTCGCTGTTTGATTTCTATTCTGTTGGGCCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@690:NM_014620:698:167
+TTGATGGACTCTAACTACATCGATCCGAAATTTCCTCCATGCGAAGAATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@691:NM_153633:18:140
+CGTAATATTCCGGACTGTGTTCAGGGATGTAGCTATTTTGCGAATATTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@692:NM_173860:550:163
+CAGGCGACCCCGGCAGCTTGGTATCGCCGTTGAACCCCGGCGGCGGGCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@693:NM_006897:1034:163
+AAAACTCTTGCGATTTGGGAGGGTTCAGTGTTGAGATATTGGTGTTTTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@694:NM_174914:1236:178
+ACAAGACTTGGAGAACTTCATTGCCAAGTTTGGGGACTCTGGTTTTGTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@695:NM_173860:107:170
+TCCCGGGCTGCCTTCGCTGTCCTACCCACGCCGCGACAACGTGTGCTCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@696:NM_174914:1114:201
+TGGATGGCCTCCATTATGCTATTCTGCCCGCCGTGGGTGACAAACAGACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@697:NM_174914:753:119
+ACGTCCTCCAGACAGGGGGCGCGACGCACCTCAAGCCCTATGTCTTTCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@698:NM_022658:234:175
+TGGAACCGGCCTATTACGACTGCCGGTTCCCTCAGAGCGTGGGCAGGAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@699:NM_022658:365:205
+GGCACCTCCGGCATCTCCAACTCAGGCTACCAGCAGAACCCGTGCTCGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@700:NM_014620:193:171
+GAAGGGGGCAGGAGGAAGAGCCTGGGAGAGAGGAGGGGCGGAGGCATCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@701:NM_022658:436:174
+GGTCTCATCCATGGAAACATGAGGCTGGGAGACGAGTTTTGATTTAAGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@702:NM_153633:147:186
+GGAATATTACGGCCGGACCAGGGAATCGGGATTCCAGCATCACCACCAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@703:NM_014620:1444:217
+GCAACGGGCAGAGGACATTACCAGGTTATAAAACATAACTCACACCCCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@704:NM_022658:981:177
+AGTTTACGACTGTCATTTGCTTTTATAGAGAATAGAATGACACTCACAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@705:NM_022658:1674:156
+GATTTTAAAATTTTTCTCTTTTTCTTTTTCAAGATTATTGCAGGTTCCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@706:NM_022658:527:183
+TCCGCCAACACTAACAGTAGCGAAGGACAAGGCCACTTAAATCAAAACTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@707:NM_173860:375:200
+GATACCAAGCTGCCGGGGTCGCCTGCGCCGGCGCCCTTGTTGCCCTCGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@708:NM_153633:199:177
+CTGTACCCACCACCGCCTCCGCGCCCTAGCTACCCTGAGCGCCAGTATAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@709:NM_022658:986:185
+TGTGGGGCAAGGAGTGAGACAGAGAGTCCGAACTTTTCACTGTTTCTCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@710:NM_174914:340:198
+CATCCTTTCCACTTGCTAATTTTGCTACAAATTCATCCTTACTAGCTCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@711:NR_031764:1645:188
+CCTACCTCTACCCACAGCCAGTGCCTTTGGCGCACTGAGGTGCACAGGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@712:NM_022658:221:195
+GCCGGCGAGTCCCTGGAACCGGCCTATTACGACTGCCGGTTCCCTCAGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@713:NM_022658:1907:179
+TATCACTACCTATAGAAAGAAATCCTGCTTTGAGAGTATTTGTAATGCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@714:NM_022658:1432:153
+GAAATAAGGAAAAAAGCAAGGAATATCCCCTCCCCCTCCCCCTCCCCCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@715:NM_022658:242:177
+GCTAAGCGAGCACGGGTTCTGCTGGTAGCCTGAGTTGGAGATGCCGGAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@716:NM_014620:1568:107
+GGAGGGAGAGGAGGGCAGGGGGCTTGTTTGTTTATCTGTTTTGTCTGTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@717:NM_022658:84:190
+ACGCTCTGAGGGAACCGGCAGTCGTAATAGGCCGGTTCCAGGGACTCGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@718:NM_022658:142:182
+AGCCGGGCGCCGAGCCGCCGGGCCCGTACACCAGCGCATGGCTCCTGCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@719:NM_006897:1352:143
+GGAGCTGAGGGGTGAGGGCTGGGGACCATGCCGCGGGCTAGGTCGGGCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@720:NM_004503:449:185
+GATCTCGATGCGCCGGCGCCGCGTTAGGTAGCGATTGAAGTGAAATTCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@721:NM_022658:1835:181
+AGGCAGTCTCAGTTGTTGGGTTTTCTTAGTGAAATAAGCAGCAACAAACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@722:NM_173860:39:172
+CCGCTGGTAAACATCCACACGGGAGACACCTTCTACTTCCCCAACTTCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@723:NM_006897:578:210
+AGATTGAGAACCCGGGCCACCTCATACCGACGGTCCCTGGTTAAATACAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@724:NM_174914:179:177
+TCCTGAGCATTGAAGAGAATATGTGGGAGAACAAAACAGAAACTGAAAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@725:NM_022658:494:179
+GCGAGCGTGGTGCAATATCCCGACTGTAAATCCTCCGCCAACACTAACAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@726:NM_173860:120:139
+TCGCTGTCCTACCCACGCCGCGACAACGTGTGCTCCCTGTCCTGGCCGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@727:NM_174914:653:188
+CAAGCCCTATGTCTTTCAGCAGCCCTGGCATGAGCAGTACCTGCTCGACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@728:NM_014620:1612:190
+ATATATAATTTTTGCAGCTTTTTTTCTTAAAAAATAAATAACCCCCCAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@729:NM_022658:1444:160
+GACTGCAGGCTCCTATCTACCCTTCTGGAAATGGGGGGAGGGGAAAGACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@730:NM_022658:2080:140
+TGAATGTATAGTTAACTCTGTCTTGAATTCTCTGTTTATGCAATGTGCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@731:NM_173860:397:172
+AAGCTGCCGGGGTCGCCTGCGCCGGCGCCCTTGTTGCCCTCGTTGAGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@732:NM_022658:30:165
+CGAAGTAGGAGCTCATGCTGGGTACATGAAAACCCGCGGCCCCCTCCCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@733:NM_153633:559:183
+GGGCGCAGCGCCGGCCGGGGGTGCTGACCTGACTTTGGTGTTGGGGAGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@734:NM_022658:235:184
+GGAACCGGCCTATTACGACTGCCGGTTCCCTCAGAGCGTGGGCAGGAGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@735:NM_014620:21:181
+GAGCGCTCCGCAGAACAGTCCTCCCTGTAAGAGCCTAACCATTGCCAGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@736:NM_006897:278:192
+GTTCAGCACGTCGTGGGCGCCCGTGCCCTCTCAGTCGTCCGTGGTATATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@737:NM_006897:446:164
+CTTTGTGCTTGCTGCCGGCGAGCGCGTCCGCCTCGGGCGAGGGCAGTGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@738:NM_004503:1371:201
+AAAGAATCCTGGGGGTCATTATGGCATTTTACAAACTGTGACCGTTTCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@739:NM_022658:1198:164
+GAGTCCTTCCTGGATTTTAAGGTCTGAGACCTGGCCTCCGTGCTCCTCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@740:NM_022658:1421:190
+ACAAATGTAAAGAAATAAGGAAAAAAGCAAGGAATATCCCCTCCCCCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@741:NM_006897:1218:191
+CCTGCACGGGCCCGACCTAGCCCGCGGCATGGTCCCCAGCCCTCACCCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@742:NM_173860:70:130
+TCTACTTCCCCAACTTCCGCGCGTCCGGGGCGCAGCTTCCCGGGCTGCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@743:NM_022658:1835:181
+AGGCAGTCTCAGTTGTTGGGTTTTCTTAGTGAAATAAGCAGCAACAAACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@744:NM_022658:1151:169
+GTCTCACTCCTTGCCCCACACACACTTGTCCCTGCCCCCACCCTTCTGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@745:NM_174914:595:186
+GAATGGGGCTGCCAGAACTAGTGGGAAGCTCCCTAGAAATGGTGACATCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@746:NM_022658:1797:202
+GGGTTTTCTTAGTGAAATAAGCAGCAACAAACGACAACAAAACCGCATTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@747:NM_022658:404:208
+GGGGTCTCATCCATGGAAACATGAGGCTGGGAGACGAGTTTTGATTTAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@748:NM_014620:819:181
+ATCACCACCAGGAGCTGTACCCACCACCGCCTCCGCGCCCTAGCTACCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@749:NM_174914:827:182
+AGACATAGGGCTTGAGGTGCGTCGCGCCCCCTGTCTGGAGGACGTGGTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@750:NM_022658:586:185
+CCTCATGTTTCCATGGATGAGACCCCACGCTCCGGGGAGGCGCAGTGGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@751:NM_006897:361:193
+GCGCGGTCGCGCAGCTCCCCGGGCGAGCCGTACATGTAGTCCGGGTAGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@752:NM_173860:370:199
+TGCTCCCGCTGGAGCCGTCGGGGCCGCCTGCGCTCGGCTTCAAGTACGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@753:NM_022658:1226:209
+ACCTGGCCTCCGTGCTCCTCGGTCTGTCTCTCACCACACTCCCACCTCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@754:NM_173860:133:158
+CTCGCGGTAGTAACCCTTGCCGTCCTCCACGCGCGCCAGCTCGCACGTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@755:NM_022658:680:170
+TTTCTCTTTAATCCTTATTTGACACGAAAACGTCGGATTGAAGTCTCTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@756:NM_022658:2117:154
+ATTATGACTCACGTATACAATACAAAGTACTTGGACCAGGAACAGGGCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@757:NM_022658:232:185
+CCTGGAACCGGCCTATTACGACTGCCGGTTCCCTCAGAGCGTGGGCAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@758:NM_022658:815:178
+CAGTCGTAAACTTCTCAATTTATCTGCTACCATAAAACGAAACTTCAAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@759:NM_153693:552:159
+ACGGCCCCCGGCTGGAACTGAACACGACATTCTCCTGTGGCGAATAAAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@760:NM_022658:2020:194
+ACAAAATCTACATTCATAGCTGGACATAAAGACAAATGACAAAAAATTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@761:NM_022658:202:152
+AGTCTTGAACGTGGTGCGAAGCGTGCTGGAAGCCGGGCGCCGAGCCGCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@762:NM_173860:55:150
+ACACGGGAGACACCTTCTACTTCCCCAACTTCCGCGCGTCCGGGGCGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@763:NM_006897:646:193
+TTCATCTTCATCCTTCGATTCTGAAACCAGATTTTGACCTGCCGCTCGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@764:NM_022658:1938:168
+GAGAGTATTTGTAATGCGGTTTTGTTGTCGTTTGTTGCTGCTTATTTCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@765:NM_173860:381:164
+GCGCCCTTGTTGCCCTCGTTGAGCAGGGACGAACTGGAGTCGGATTCCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@766:NM_017409:281:184
+CACTTTTCGCCCGCTTCTCTGCGCTGTACATGCAGCAGACATTCTCCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@767:NM_018953:261:171
+TTTGATCTCCCCACTGCTCTTAGCTCGCTCCTCCAGCGCCGGGCGAGCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@768:NM_022658:2129:129
+TATACAATACAAAGTACTTGGACCAGGAACAGGGCTGTCGGGACACAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@769:NM_174914:1754:168
+TAAATGTTCTAGAATACTTGGCGTTGCAGTGCAGTCATTTTTTAAATAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@770:NM_022658:1229:203
+TTTACATTTGTCTTCCTTTCCTTTCTTCATTTTTTTCTGTCCTTTCCTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@771:NM_004503:1061:166
+CCCTGGAGCAGAGGCCCCAGCAGGCCCAGGAGCCGGCTCTCTGCACGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@772:NM_022658:1839:175
+GAGAAAAAAAGAGAAAAAAATAAAAATCAAAAAAAAAAAAAAGAAAGAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@773:NM_022658:118:161
+TGCCCACGCTCTGAGGGAACCGGCAGTCGTAATAGGCCGGTTCCAGGGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@774:NM_022658:1612:180
+AATCCTACCTAACCATCCCATGGTCACTCGGGCCCATGCCTTCCTCTCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@775:NM_174914:585:174
+AAGGACTAGAGAATGGGGCTGCCAGAACTAGTGGGAAGCTCCCTAGAAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@776:NM_174914:1718:171
+GTCATTTTTTAAATAGAAAGGATATCATGGATTCCTTAAAGAATGAGAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@777:NM_174914:1895:192
+GCAACGCCAAGTATTCTAGAACATTTAATAAGTTTTCAAATTTTCCTCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@778:NM_022658:1206:159
+CCTGGATTTTAAGGTCTGAGACCTGGCCTCCGTGCTCCTCGGTCTGTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@779:NM_022658:623:177
+AGGCGCAGTGGACGGCAAACTTACAGCCGGTATCAGACCTTGGAACTAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@780:NM_022658:215:173
+GAGTTGGAGATGCCGGAGGTGCCGTGGTGGAAGAAGTCTTGAACGTGGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@781:NM_173860:619:146
+GTCACTAAGATTCAAGCGGTCTGAGAGTTCCCTCCGGCGCTGGCGTGTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@782:NM_014212:976:205
+AAAGAAACTGAGCAGAGACCGGCTGCAGTATTTCTCGGGAAATCCTCTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@783:NM_022658:686:190
+TTTAATCCTTATTTGACACGAAAACGTCGGATTGAAGTCTCTCATGCCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@784:NM_174914:386:159
+CAAAAATCATCCTTTCCACTTGCTAATTTTGCTACAAATTCATCCTTACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@785:NM_173860:374:179
+CTGCGCCGGCGCCCTTGTTGCCCTCGTTGAGCAGGGACGAACTGGAGTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@786:NM_022658:1113:178
+GGGGGAGACGGAGAAACAGTGAAAAGTTCGGACTCTCTGTCTCACTCCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@787:NM_022658:700:173
+TCTCCTCTTCCTCATTTCCTTCTTCCTCCACCTTCTCCTCATCTCGGGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@788:NM_018953:704:159
+GAAGAAAGATTCCAAAATGAAAAGCAAAGAGGCTCTTTAGAGGCAGCGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@789:NM_014620:1542:190
+ACCCAGCAGGTACCATGCTAAGACAACATCACATGCTTAAAAGGGTCCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@790:NM_174914:1352:203
+CCAAGGTCACAAGGACAAAACCAGAGTCCCCAAACTTGGCAATGAAGTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@791:NM_173860:148:206
+GGCTCCCGGGTCGCGCCCGCGCTCCTCACGCTTCAGGCCCCCGCCGCCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@792:NM_014620:855:166
+GCCCTAGCTACCCTGAGCGCCAGTATAGCTGCACCAGTCTCCAGGGGCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@793:NM_022658:2080:172
+TGAATGTATAGTTAACTCTGTCTTGAATTCTCTGTTTATGCAATGTGCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@794:NM_022658:315:158
+GGACTGTCTGGGGAGCGCCTCGTAGCCATAGAATTTGGAGGCGTCTCCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@795:NM_004503:1076:173
+GCTGCCAGGCCGGGCCCTGAGGCCCTGGAGCAGAGGCCCCAGCAGGCCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@796:NM_022658:1779:197
+GCAACAAACGACAACAAAACCGCATTACAAATACTCTCAAAGCAGGATTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@797:NM_001168316:1511:172
+ACCACAACTCTGCTTTCAGTAGAAGATGAGACAAAACTGGCCTAGAGCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@798:NM_022658:1871:176
+GCACAATAAAAGCGCACAGGACCGGCGGGCTAGGCAGTCTCAGTTGTTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@799:NM_006897:190:198
+CGAGCCAAGTCCGCATGTAGCGCGTGTCGGCGCCGAGGTGGGGCTGGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@800:NM_022658:1365:185
+TCTCCTTCAGGTTTCCATCAGGTTCCTAGAGAAAGTCAAGGGGGTTTTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@801:NM_022658:1057:136
+CTCTGGTTTTATTACCTTTGGACTTCCCCCACTCTTTATTTGTTTGGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@802:NM_022658:1754:192
+ATACTCTCAAAGCAGGATTTCTTTCTATAGGTAGTGATAAAATACGCTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@803:NM_174914:1203:187
+GTCCACAATTTTCACATTTGCAGCCAGGTGGACATCTTTGGGCCAATGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@804:NM_022658:1378:194
+CTAAAAAGGAAAGGACAGAAAAAAATGAAGAAAGGAAAGGAAGACAAATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@805:NM_174914:776:174
+CCGCGGCAGTGGCTGCCAGTGTCATCCTGCGCTCCCACCCGCTCAGCCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@806:NM_173860:409:190
+TCAAGTACGACTACGCGGCGGGCGGCGGCGGTGGCGACGGCGGCGGCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@807:NM_022658:81:170
+CCTGGGGTTCGGTCCCGGGGGGAGGGGAGTTTCGGGGGTACTGGGCGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@808:NM_174914:677:149
+TCAGCAGCCCTGGCATGAGCAGTACCTGCTCGACGTTTTTGTGTTTCTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@809:NM_022658:1354:196
+TCTCCTTCAGGTTTCCATCAGGTTCCTAGAGAAAGTCAAGGGGGTTTTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@810:NM_001168316:206:203
+AGAACAAAACAGAAACTGAAAGAATATGCAAGGTGTCTTTCTTGGATGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@811:NM_022658:11:107
+CACCGAGGCGCCCCCCAACCTGCCCAGCCCCCAGCCCACCAGCCCAGCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@812:NM_022658:617:146
+CCGGGGAGGCGCAGTGGACGGCAAACTTACAGCCGGTATCAGACCTTGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@813:NM_006897:497:200
+GGGCCGCAGCTACCCGGACTACATGTACGGCTCGCCCGGGGAGCTGCGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@814:NM_022658:1768:174
+TCTCAAAGCAGGATTTCTTTCTATAGGTAGTGATAAAATACGCTGGAGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@815:NM_173860:535:223
+AGATTCAAGCGGTCTGAGAGTTCCCTCCGGCGCTGGCGTGTGATGAACTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@816:NM_022658:1918:173
+ATAGAAAGAAATCCTGCTTTGAGAGTATTTGTAATGCGGTTTTGTTGTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@817:NR_031764:771:166
+TGCCAGTGTCATCCTGCGCTCCCACCCGCTCAGCCCCACACAGCGGCTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@818:NM_006897:169:196
+GTGTCGGCGCCGAGGTGGGGCTGGGGGCCGTACGGGTGATATACCACGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@819:NM_022658:1015:177
+GAATGACACTCACAACTCTAACTACCTGTCAGATACTTGCAGCTCTGGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@820:NM_014620:1484:182
+GGAGGGCAGGGGGCTTGTTTGTTTATCTGTTTTGTCTGTTTGGAACTGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@821:NM_174914:1852:166
+AAGGAATCCATGATATCCTTTCTATTTAAAAAATGACTGCACTGCAACGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@822:NM_022658:1394:199
+CCTATCTACCCTTCTGGAAATGGGGGGAGGGGAAAGACCCACATCTCCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@823:NM_022658:136:191
+GGAAGCCGGGCGCCGAGCCGCCGGGCCCGTACACCAGCGCATGGCTCCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@824:NM_022658:2057:209
+AGTAGAGTAGAACTAAATTGCACTGAATGTATAGTTAACTCTGTCTTGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@825:NM_022658:133:187
+GGGCGCCGAGCCGCCGGGCCCGTACACCAGCGCATGGCTCCTGCCCACGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@826:NM_153633:831:175
+CAGGTTATAAAACATAACTCACACCCCTGCCCCCACCCCATGCCCCCACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@827:NM_022658:249:164
+CGAGCACGGGTTCTGCTGGTAGCCTGAGTTGGAGATGCCGGAGGTGCCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@828:NM_022658:1490:165
+GAAGGCATGGGCCCGAGTGACCATGGGATGGTTAGGTAGGATTTTAGAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@829:NM_017410:72:145
+CTCTGGCAAGTGGAGTTTTTAAAAAGCTCCAGCAGATCATGTCATGACGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@830:NM_174914:897:164
+TGGTCCGAGTAGAAGCCAAAAAGTTTGGTGTTTCTATTCAGTTAAAGAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@831:NM_022658:59:166
+CGGCTTTGTATTTGGAGAACAGGGGGTTGACGAAGTAGGAGCTCATGCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@832:NM_173860:506:196
+CAGAAACTCGCCCTCCAGCTCTGCCAGTTGCAACTTCGAATAGGGCTTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@833:NM_004503:1365:201
+GTATTTAAAGAATCCTGGGGGTCATTATGGCATTTTACAAACTGTGACCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@834:NM_022658:1192:177
+ATCTAGTACACTAGCCTTAGCATAAAAACAAAACCACAAGTCCTTTTCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@835:NM_174914:558:193
+GCTTTGTGGGAAGCTGCTGGGCATGGCTGTCTGGTGGCTGCGTGGGGCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@836:NM_173860:186:182
+GCTGCCCCGGGCCCGGCTCCCGGGTCGCGCCCGCGCTCCTCACGCTTCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@837:NM_022658:423:176
+ACGGAGACGCCTCCAAATTCTATGGCTACGAGGCGCTCCCCAGACAGTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@838:NM_014620:1423:191
+GAGCGCCACGCCGCCGGAGCAGCAACGGGCAGAGGACATTACCAGGTTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@839:NM_022658:1712:164
+AGTGTTAGTGCTCAGAAATCACCATAATCACGAAAATAATAATAATAAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@840:NM_153633:790:175
+GAAGAGAGAAAAGAACCTATATATATATATATATATATATATATTAAATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@841:NM_173860:318:204
+CTGAAGCGTGAGGAGCGCGGGCGCGACCCGGGAGCCGGGCCCGGGGCAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@842:NM_173860:499:185
+CTCTGCCAGTTGCAACTTCGAATAGGGCTTGCGCTTCTTCCGAGAGCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@843:NM_022658:166:146
+TCATGTACCCAGCATGAGCTCCTACTTCGTCAACCCCCTGTTCTCCAAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@844:NM_006897:1267:180
+CCCCGGGCCTGGGGCGCTCTGCGTGCAGATTTTGTACAAAAAAAAAAAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@845:NM_022658:1710:171
+TTAGTGTTAGTGCTCAGAAATCACCATAATCACGAAAATAATAATAATAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@846:NM_174914:655:192
+GCACCTCAAGCCCTATGTCTTTCAGCAGCCCTGGCATGAGCAGTACCTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@847:NM_014620:1959:165
+ATTTTGATTTTCTTTTGGCTCCTCAAACTGAACAGCTCTGAGAGGCTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@848:NM_022658:358:176
+CCACCACGGCACCTCCGGCATCTCCAACTCAGGCTACCAGCAGAACCCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@849:NM_022658:1182:187
+ATCTAGTACACTAGCCTTAGCATAAAAACAAAACCACAAGTCCTTTTCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@850:NM_022658:945:177
+TTGAAGTTTCGTTTTATGGTAGCAGATAAATTGAGAAGTTTACGACTGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@851:NM_022658:982:188
+GTTTACGACTGTCATTTGCTTTTATAGAGAATAGAATGACACTCACAACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@852:NM_173860:500:191
+CCTCCAGCTCTGCCAGTTGCAACTTCGAATAGGGCTTGCGCTTCTTCCGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@853:NM_006897:956:182
+GGAAAGAGAACGCAGTTTCTCTCCCCGCCTCCTCCTCGCTGGGTAGAACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@854:NM_022658:2042:166
+TCTACATTCATAGCTGGACATAAAGACAAATGACAAAAAATTATTATTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@855:NM_022658:944:165
+CTTGAAGTTTCGTTTTATGGTAGCAGATAAATTGAGAAGTTTACGACTGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@856:NM_022658:1414:204
+AGGATTTTAGAGGCGACTGCAGGCTCCTATCTACCCTTCTGGAAATGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@857:NM_022658:1229:166
+TGTCCTTTCCTTTTTAGAAAAAGTACATCTAGTACACTAGCCTTAGCATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@858:NM_173860:28:159
+CATTGCACGGCTCCGCCGACGGCCAGGACAGGGAGCACACGTTGTCGCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@859:NM_174914:1641:190
+GGTGATAGTTGAAACTTTTGACTACTGTCCTTTCCTGATTGCTGAGAAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@860:NM_022658:901:187
+TGGGGGAAGTCCAAAGGTAATAAAACCAGAGCTGCAAGTATCTGACAGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@861:NM_173860:338:209
+CGGCGCCCTTGTTGCCCTCGTTGAGCAGGGACGAACTGGAGTCGGATTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@862:NM_174914:74:158
+TATTCTTTCAGTTTCTGTTTTGTTCTCCCACATATTCTCTTCAATGCTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@863:NM_014620:2081:179
+TCTCAGAGCTGTTCAGTTTGAGGAGCCAAAAGAAAATCAAAATGAACTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@864:NM_006897:1060:188
+AGTGTTGAGATATTGGTGTTTTAGAGTTAGTTCTACCCAGCGAGGAGGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@865:NM_014620:1658:168
+TGCCCTCCTCTCCCTCCCACTGTTAAGGACCCTTTTAAGCATGTGATGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@866:NM_022658:755:156
+GTGAAGATCTGGTTCCAGAACCGAAGGATGAAGTGGAAAAAGGAGAACAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@867:NM_022658:273:163
+TGGGCAGGAGCCATGCGCTGGTGTACGGGCCCGGCGGCTCGGCGCCCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@868:NM_022658:1779:197
+AAGGGAACCTGCAATAATCTTGAAAAAGAAAAAGAGAAAAATTTTAAAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@869:NM_022658:1629:172
+CCATGGTCACTCGGGCCCATGCCTTCCTCTCCTTCGCTGTTTGATTTCTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@870:NM_014620:986:168
+GCGCTTGGGTTCCCCTCCGTTATAATTGGGGTTCACCGTGCTAACGTGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@871:NM_022658:530:168
+GCCAACACTAACAGTAGCGAAGGACAAGGCCACTTAAATCAAAACTCGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@872:NM_174914:2082:198
+AGATCCGCGGCTTCCGTAGAAGTGAGCATGGCTGGGCAGCGAGTGCTTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@873:NM_022658:682:165
+TCCACCTTCTCCTCATCTCGGGCTCCCGGCAGTTTATCCTTGTTGTTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@874:NM_018953:418:181
+TGGAATTCTTTCTCGAGTTCCAGAGTCTGGTAGCGCGTGTAACTGGTTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@875:NM_022658:451:180
+CTGCGCCTCCCCGGAGCGTGGGGTCTCATCCATGGAAACATGAGGCTGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@876:NM_014212:1441:212
+ATTTCAAAGGAAGGTTCTACACATTCAGGGGGAGAACAACTAGGCTCGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@877:NM_014620:549:195
+AGCGCTCGCGGGGGCTCAACCCCCAGACCTCCAGAAATGACGTCAGAATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@878:NM_006897:572:177
+GTTAAATACATATTGAAGAGAAACTCCTTCTCCAGTTCCAGCGTCTGGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@879:NM_173860:444:185
+ATCGGGTACCAGGGCGCGCCGCTGGCCGAGAGCCCGCCGCCGGGGTTCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@880:NM_014212:1835:181
+ATTTTTGTAAATAAATTTCCCAAGCGTTTCTTTCCACCTGGAGGGAAAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@881:NM_174914:328:175
+TCCTTACTAGCTCCTGCCTGCTAGCAGAATTCTTTCCAGTCCTCTTGTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@882:NM_006897:435:170
+TGCTTGCTGCCGGCGAGCGCGTCCGCCTCGGGCGAGGGCAGTGTCTGCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@883:NM_014620:1514:193
+ACATCACATGCTTAAAAGGGTCCTTAACAGTGGGAGGGAGAGGAGGGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@884:NM_174914:990:196
+CCTCCTGGCTCACCCAAGCATCCGTCTGTTTGTCACCCACGGCGGGCAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@885:NM_022658:2037:168
+TTTATTGTGCTTCTAACCCCAGTAGAGTAGAACTAAATTGCACTGAATGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@886:NM_173860:13:200
+ATCTCCTGAATCCCGGGTTTGTGGGGCCGCTGGTAAACATCCACACGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@887:NM_022658:2004:186
+CATAAAGACAAATGACAAAAAATTATTATTATAGATATATTTTTAACATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@888:NM_173860:614:194
+TCTTTTTCATTCTCCGGTTCTGAAACCAGATCTTGACCTGCTGGTCACTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@889:NM_173860:459:218
+AGTTGCAACTTCGAATAGGGCTTGCGCTTCTTCCGAGAGCGGCTGTTGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@890:NM_022658:333:180
+GATATTGCACCACGCTCGCCTCTTGCTGAGCCCCATAAAGGGACTGTCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@891:NM_173860:530:164
+GGGCAACAAGGGCGCCGGCGCAGGCGACCCCGGCAGCTTGGTATCGCCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@892:NM_022658:138:168
+CGGGCCCGTACACCAGCGCATGGCTCCTGCCCACGCTCTGAGGGAACCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@893:NM_174914:1058:184
+AAAGATGTCCACCTGGCTGCAAATGTGAAAATTGTGGACTGGCTTCCTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@894:NM_022658:1261:111
+ACACTCCCACCTCCCTGCTTCTCTGGTATTTATTTTAGAGGGGAGCCCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@895:NM_174914:1705:165
+TAAGACAAGGGGATTGGTAGCCCAAATTCCAAAGAGCCGAATGAAGTGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@896:NM_022658:1321:187
+GGTTTTTCTAAGCAGGGAGCCCTGGGGAGGGGGAGGGGGAGGGGGAGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@897:NM_174914:657:168
+ACCCCGCCAAGGCTGCACCTGGCCTTATGTCTCCTTCACCTTTCTGGCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@898:NM_174914:1962:187
+TTATCTACTGATGGACCGGGTTTCTCAGATTCTTCAAGATCACGGTCATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@899:NM_174914:1662:183
+GAGAACTTCGACATGGTGATAGTTGAAACTTTTGACTACTGTCCTTTCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@900:NM_022658:1418:181
+AAGACAAATGTAAAGAAATAAGGAAAAAAGCAAGGAATATCCCCTCCCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@901:NM_022658:1641:172
+CTTTTTCTTTTTCAAGATTATTGCAGGTTCCCTTTAGGTAGTATGTTAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@902:NM_022658:870:171
+GGTAGTTAGAGTTGTGAGTGTCATTCTATTCTCTATAAAAGCAAATGACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@903:NM_022658:1675:157
+AGGATTTTAAAATTTTTCTCTTTTTCTTTTTCAAGATTATTGCAGGTTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@904:NM_174914:712:183
+AGCCACCAGACAGCCATGCCCAGCAGCTTCCCACAAAGCCATAGAGTCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@905:NR_031764:1055:177
+GGACCATGTTTTCAGGCTGGTCTCCAAAGAGAGGGATCCCCACCATGGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@906:NM_022658:283:190
+GGACTGTCTGGGGAGCGCCTCGTAGCCATAGAATTTGGAGGCGTCTCCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@907:NM_022658:1737:172
+TAAAATACGCTGGAGGTTTCTTTCTTTCTTTTTTTTTTTTTTGATTTTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@908:NM_173860:365:174
+TTGTTGCCCTCGTTGAGCAGGGACGAACTGGAGTCGGATTCCAGCGACTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@909:NM_022658:339:207
+TACTGTTAGTGTTGGCGGAGGATTTACAGTCGGGATATTGCACCACGCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@910:NM_174914:1607:166
+GCTGTTGCCTCCTGCAGAAACTAAAGAACATCAGAAAATTCTTCACTCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@911:NM_022658:1455:188
+CCGAGTGACCATGGGATGGTTAGGTAGGATTTTAGAGGCGACTGCAGGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@912:NM_153633:413:172
+TAGCGGTTGTAATGAAACTCTTTCTCTAATTCCAGGACTTGCTGCCGGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@913:NM_014620:743:196
+CCGCCTGGGCCGGCCCGTGGCCTCGCGAATTGCCGGGCCCCTGGAGACTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@914:NM_022658:1952:185
+TTCTTTCGAGCACATTGCATAAACAGAGAATTCAAGACAGAGTTAACTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@915:NM_022658:663:169
+TCTCGGGCTCCCGGCAGTTTATCCTTGTTGTTCTCCTTTTTCCACTTCAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@916:NM_022658:1998:202
+CATAGCTGGACATAAAGACAAATGACAAAAAATTATTATTATAGATATAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@917:NM_014620:1170:78
+CGATCTCGATCCTTCTCCTTCGGGTCAGGTAGCGGTTGTAATGAAACTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@918:NM_173860:623:183
+TTTTTCATTCTCCGGTTCTGAAACCAGATCTTGACCTGCTGGTCACTAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@919:NM_022658:464:187
+GGCTGTAAGTTTGCCGTCCACTGCGCCTCCCCGGAGCGTGGGGTCTCATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@920:NM_022658:789:153
+GGAAAAAGGAGAACAACAAGGATAAACTGCCGGGAGCCCGAGATGAGGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@921:NM_022658:1744:135
+AAAATAATAATAATAAATCTTTAACATACTACCTAAAGGGAACCTGCAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@922:NM_001168316:1337:192
+TGTTCACCATGGAGCCCAAGGTCACAAGGACAAAACCAGAGTCCCCAAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@923:NM_022658:1494:167
+TGCTTAGAAAAACCCCCTTGACTTTCTCTAGGAACCTGATGGAAACCTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@924:NM_174914:2048:184
+TTTTAAAATCTGGCATAAAAGGACCTCTTTTGTGGTTAAGCATGGTGACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@925:NM_022658:242:213
+GCCTATTACGACTGCCGGTTCCCTCAGAGCGTGGGCAGGAGCCATGCGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@926:NM_173860:236:187
+CGGCCGCACGTGCGAGCTGGCGCGCGTGGAGGACGGCAAGGGTTACTACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@927:NM_022658:240:208
+CGGCCTATTACGACTGCCGGTTCCCTCAGAGCGTGGGCAGGAGCCATGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@928:NM_174914:912:173
+TCTTTGGAGACCAGCCTGAAAACATGGTCCGAGTAGAAGCCAAAAAGTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@929:NM_006897:440:129
+CTACGCCCTCAAGCCGGACGCCTACCCCGGGCGCCGCGCGGACTGCGGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@930:NM_153633:132:196
+TGATTTCTCGGGGTGGTGGTGGCCCGCCTGGGCCGGCCCGTGGCCTCGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@931:NM_004503:1013:192
+GGCCCAGGAGCCGGCTCTCTGCACGGGGGGCGGGGGTGGGGGCGTCGAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@932:NM_174914:21:210
+ATTCTTTCAGTTTCTGTTTTGTTCTCCCACATATTCTCTTCAATGCTCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@933:NM_014620:788:209
+GCGCCTGAGAGAGGCGCCGGCTCGCAGAGCGACTGTGATTTCTCGGGGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@934:NM_174914:479:188
+TTGGCGGGGTCTGTTTGGTGGGCGATGTCACCATTTCTAGGGAGCTTCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@935:NM_022658:1763:198
+TTTAACATACTACCTAAAGGGAACCTGCAATAATCTTGAAAAAGAAAAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@936:NM_022658:867:176
+CAGGTAGTTAGAGTTGTGAGTGTCATTCTATTCTCTATAAAAGCAAATGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@937:NM_022658:230:166
+GGTAGCCTGAGTTGGAGATGCCGGAGGTGCCGTGGTGGAAGAAGTCTTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@938:NM_022658:658:196
+GACCTTGGAACTAGAAAAGGAGTTTCTCTTTAATCCTTATTTGACACGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@939:NM_022658:1696:179
+TCCTCTGAGCTGCATTAGTGTTAGTGCTCAGAAATCACCATAATCACGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@940:NM_173860:65:176
+CACCTTCTACTTCCCCAACTTCCGCGCGTCCGGGGCGCAGCTTCCCGGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@941:NM_173860:121:177
+CGCTGTCCTACCCACGCCGCGACAACGTGTGCTCCCTGTCCTGGCCGTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@942:NM_022658:1917:177
+TAACTATACATTCAGTGCAATTTAGTTCTACTCTACTGGGGTTAGAAGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@943:NM_022658:161:185
+GGTTTTCATGTACCCAGCATGAGCTCCTACTTCGTCAACCCCCTGTTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@944:NM_001168316:1547:150
+TATTCCGTTCCTTGCTGACTGATCACATGGACTTCTGGGGCCGAGTGAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@945:NM_018953:731:202
+AGCCCCGCGGGAACCCTGGGTCGGTAGGGATGCGGAATGCCAAGGAAAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@946:NM_173860:248:192
+CCGCCGCCGCCCGCCGCGTAGTCGTACTTGAAGCCGAGCGCAGGCGGCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@947:NM_022658:1050:180
+CTTGCAGCTCTGGTTTTATTACCTTTGGACTTCCCCCACTCTTTATTTGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@948:NM_174914:756:177
+AGTCCCCAGAGTGAGCCCCAGCAGAAACACAAAAACGTCGAGCAGGTACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@949:NM_014620:1183:190
+CCTGGAATTAGAGAAAGAGTTTCATTACAACCGCTACCTGACCCGAAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@950:NM_174914:70:134
+AAGCCTGCTCAGCCAAGAAGGAGCTCACTGTGGGCACCAGAGACAGGGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@951:NM_174914:1430:149
+GTTTTTCCATCAAGCCTCCAACATAAACAGTGTTGGGAAGCAGAGGTCGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@952:NM_014620:19:177
+CCGAGCGCTCCGCAGAACAGTCCTCCCTGTAAGAGCCTAACCATTGCCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@953:NM_022658:1029:181
+CAGGAAGGACTCAGAAGGGTGGGGGCAGGGACAAGTGTGTGTGGGGCAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@954:NM_174914:957:88
+TCTCTTGTCTTCCATGATTTGTTTCATCTTAAGAGCCAATGTCTCTGCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@955:NM_022658:830:196
+GATGAGGAGAAGGTGGAGGAAGAAGGAAATGAGGAAGAGGAGAAAGAAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@956:NM_022658:1516:188
+TTTCTCTAGGAACCTGATGGAAACCTGAAGGAGATGTGGGTCTTTCCCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@957:NM_022658:188:171
+GAAGAAGTCTTGAACGTGGTGCGAAGCGTGCTGGAAGCCGGGCGCCGAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@958:NM_006897:788:191
+CTTTCCTTTTCTTTTTCGTCTCTCCCCCGCCTGTGTTGGGGTATTTTGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@959:NM_004503:579:188
+GGAGAAGGAATTTCACTTCAATCGCTACCTAACGCGGCGCCGGCGCATCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@960:NM_022658:1133:202
+CACAAGTCCTTTTCTGCATTTCGAGGGGGCTCCCCTCTAAAATAAATACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@961:NM_022658:222:186
+CCGGCGAGTCCCTGGAACCGGCCTATTACGACTGCCGGTTCCCTCAGAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@962:NM_022658:1316:201
+AGTCAAGGGGGTTTTTCTAAGCAGGGAGCCCTGGGGAGGGGGAGGGGGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@963:NM_022658:528:185
+CCGCCAACACTAACAGTAGCGAAGGACAAGGCCACTTAAATCAAAACTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@964:NM_022658:277:183
+AGCGCCTCGTAGCCATAGAATTTGGAGGCGTCTCCGTGGCAGCTAAGCGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@965:NM_022658:900:153
+AGGACTAAGCAAAAAAGAAAGACCCCCCCCCCCTTAGCAACTCCCTTGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@966:NM_022658:565:205
+AAATCAAAACTCGTCTCCCAGCCTCATGTTTCCATGGATGAGACCCCACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@967:NM_006897:259:179
+ACGGCCCCCGGCCGGGAAGCTGGGGAAGGAGACGGCGCCGGACAGCGGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@968:NM_174914:1093:196
+CCCACCATGGGCACACCATGCTGGATGGCCTCCATTATGCTATTCTGCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@969:NM_174914:1608:176
+AGCTTGGGAAGCCATTTGTGGCCATTCTTTCCACTTCATTCGGCTCTTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@970:NM_022658:1000:182
+CTTTTATAGAGAATAGAATGACACTCACAACTCTAACTACCTGTCAGATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@971:NM_022658:1907:162
+TTCTACTCTACTGGGGTTAGAAGCACAATAAAAGCGCACAGGACCGGCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@972:NM_001168316:812:189
+AGACATTGGCTCTTAAGATGAAACAAATCATGGAAGACAAGAGATACAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@973:NM_022658:1343:189
+TTTATGCTAAGGCTAGTGTACTAGATGTACTTTTTCTAAAAAGGAAAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@974:NM_174914:766:175
+TGGCTGCCAGTGTCATCCTGCGCTCCCACCCGCTCAGCCCCACACAGCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@975:NM_174914:2020:168
+CTGATAACTTGATATGATTTTTCTTCCTTTTTAAAATCTGGCATAAAAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@976:NM_022658:1120:167
+ACGGAGAAACAGTGAAAAGTTCGGACTCTCTGTCTCACTCCTTGCCCCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@977:NM_004503:169:176
+TAAAAGGAATTAGATCCATAGTCATACGGCCCCCGGCTGGAACTGAACAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@978:NM_014620:1968:185
+TATAGACTGCCTCTCTGAACTGAAAGTTCATTTTGATTTTCTTTTGGCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@979:NM_022658:1464:168
+TGGGATGGTTAGGTAGGATTTTAGAGGCGACTGCAGGCTCCTATCTACCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@980:NM_173860:373:186
+TCCCGCTGGAGCCGTCGGGGCCGCCTGCGCTCGGCTTCAAGTACGACTAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@981:NM_014620:496:180
+AGAAAGAGAGTGGGAGAGAGAGAGGCAGAGAGGGAGAGAGGGAGAGTGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@982:NM_022658:575:163
+TCGTCTCCCAGCCTCATGTTTCCATGGATGAGACCCCACGCTCCGGGGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@983:NM_153693:1682:170
+CACCAACCCCCAGGGCCTCCCCGCAGTCCCTGCCTAGCCCCTCTGCCCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@984:NM_022658:264:190
+TCGTAGCCATAGAATTTGGAGGCGTCTCCGTGGCAGCTAAGCGAGCACGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@985:NM_022658:445:188
+TGGCTACGAGGCGCTCCCCAGACAGTCCCTTTATGGGGCTCAGCAAGAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@986:NM_006897:1278:93
+GGGCGCTCTGCGTGCAGATTTTGTACAAAAAAAAAAAAGACACACACACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@987:NM_174914:1602:184
+GAAGCTTGGGAAGCCATTTGTGGCCATTCTTTCCACTTCATTCGGCTCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@988:NM_174914:2088:187
+CATGGTGACATTATGACCGTGATCTTGAAGAATCTGAGAAACCCGGTCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@989:NM_174914:227:183
+GAATATGCAAGGTGTCTTTCTTGGATGTTATTCCATGATAGATAGTAGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@990:NM_022658:203:197
+CTGTTCTCCAAATACAAAGCCGGCGAGTCCCTGGAACCGGCCTATTACGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@991:NM_174914:2051:183
+TAAAATCTGGCATAAAAGGACCTCTTTTGTGGTTAAGCATGGTGACATTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@992:NM_174914:842:182
+GGTGCGTCGCGCCCCCTGTCTGGAGGACGTGGTCAATCCAGCCCACCAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@993:NM_174914:1427:211
+TAGGTTTTTCCATCAAGCCTCCAACATAAACAGTGTTGGGAAGCAGAGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@994:NM_022658:1109:179
+GGAGGGGGGAGACGGAGAAACAGTGAAAAGTTCGGACTCTCTGTCTCACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@995:NM_153633:51:191
+GGCGCTCAGGGTAGCTAGGGCGCGGAGGCGGTGGTGGGTACAGCTCCTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@996:NM_006897:1285:160
+ATGAGAGGGAACACTATGTACAGCCCAAGGCGCCGGCCTGCACGGGCCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@997:NM_006897:928:206
+AGAGAACGCAGTTTCTCTCCCCGCCTCCTCCTCGCTGGGTAGAACTAACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@998:NM_022658:182:199
+AGCTCCTACTTCGTCAACCCCCTGTTCTCCAAATACAAAGCCGGCGAGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@999:NM_022658:119:198
+TACTGGGCGGGGTACTCGTGAGCCAGAGGGGAGGGGGCCGCGGGTTTTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1000:NM_022658:943:200
+CGAACTTTTCACTGTTTCTCCGTCTCCCCCCTCCAGCCCCCAAACAAATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1001:NM_022658:1355:165
+GAAAGTCAAGGGGGTTTTTCTAAGCAGGGAGCCCTGGGGAGGGGGAGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1002:NM_022658:697:171
+TTTGACACGAAAACGTCGGATTGAAGTCTCTCATGCCCTGGGACTGACCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1003:NM_017409:922:204
+CAGGTGAAATTAAAATTGGAGGTCAGTTCCCGGATCCGATTCTCTCGGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1004:NM_022658:634:194
+GGGCTCCCGGCAGTTTATCCTTGTTGTTCTCCTTTTTCCACTTCATCCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1005:NM_006897:1122:164
+GAGCGCCCCAGGCCCGGGGAGGGATGACCTGGACCAAATACGATACAGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1006:NM_006897:1332:193
+TGATAATGATTCCCAGCCCAGGAGCTGAGGGGTGAGGGCTGGGGACCATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1007:NM_022658:121:200
+CGGGCGCCGAGCCGCCGGGCCCGTACACCAGCGCATGGCTCCTGCCCACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1008:NM_153633:574:156
+TACAACCGCTACCTGACCCGAAGGAGAAGGATCGAGATCGCCCACTCGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1009:NM_022658:1565:157
+TCCCCCCATTTCCAGAAGGGTAGATAGGAGCCTGCAGTCGCCTCTAAAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1010:NM_014620:273:198
+GGCAGGAGGAATGCAGGAGCAGGAGTTGAGCTTGGGAGCTGCAGATGCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1011:NM_153633:460:158
+ATGAAAAAAATTCACGTTAGCACGGTGAACCCCAATTATAACGGAGGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1012:NM_174914:291:170
+TCTTGTCCTCCTTTGTTTGCCATCAGCAAGGGCTATGCTGTGATTCTGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1013:NM_022658:990:167
+TGAGACAGAGAGTCCGAACTTTTCACTGTTTCTCCGTCTCCCCCCTCCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1014:NM_173860:390:196
+GGGCCGCCTGCGCTCGGCTTCAAGTACGACTACGCGGCGGGCGGCGGCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1015:NM_022658:1604:154
+GCCTCTAAAATCCTACCTAACCATCCCATGGTCACTCGGGCCCATGCCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1016:NM_174914:694:178
+ACCTTTCTGGCCCCACGCAGCCACCAGACAGCCATGCCCAGCAGCTTCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1017:NM_014620:1425:195
+TGACAAGGGACAAGGTGAGAGGAAGAGAGAAAAGAACCTATATATATATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1018:NM_022658:1348:189
+TCCATCAGGTTCCTAGAGAAAGTCAAGGGGGTTTTTCTAAGCAGGGAGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1019:NM_174914:1536:180
+CCCTTGTCTTATGTTCCAGTATTCCGTTCCTTGCTGACTGATCACATGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1020:NM_022658:380:170
+TCCAACTCAGGCTACCAGCAGAACCCGTGCTCGCTTAGCTGCCACGGAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1021:NM_173860:280:163
+ACTACCGCGAGCCGTGCGCCGAGGGTGGCGGCGGGGGCCTGAAGCGTGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1022:NM_173860:499:191
+AATCCGACTCCAGTTCGTCCCTGCTCAACGAGGGCAACAAGGGCGCCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1023:NM_173860:282:194
+TACCGCGAGCCGTGCGCCGAGGGTGGCGGCGGGGGCCTGAAGCGTGAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1024:NM_174914:982:199
+TGGCTCACCCAAGCATCCGTCTGTTTGTCACCCACGGCGGGCAGAATAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1025:NM_022658:1496:181
+GAAATCAAACAGCGAAGGAGAGGAAGGCATGGGCCCGAGTGACCATGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1026:NM_006897:797:167
+GCAGGTCAAAATCTGGTTTCAGAATCGAAGGATGAAGATGAAAAAGATGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1027:NM_022658:192:183
+TCGTCAACCCCCTGTTCTCCAAATACAAAGCCGGCGAGTCCCTGGAACCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1028:NM_022658:803:161
+CCATAAAACGAAACTTCAAGGGAGTTGCTAAGGGGGGGGGGGTCTTTCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1029:NM_022658:687:198
+CCTCCTCTTCTTTCTCCTCTTCCTCATTTCCTTCTTCCTCCACCTTCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1030:NM_173860:317:174
+TGGCAGGAGGGCGGGTCGTGCGGAGGTCCTGCGCCGCCGCCGCCGTCGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1031:NM_153633:834:186
+GTTATAAAACATAACTCACACCCCTGCCCCCACCCCATGCCCCCACCCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1032:NM_022658:1541:165
+TGAAGGAGATGTGGGTCTTTCCCCTCCCCCCATTTCCAGAAGGGTAGATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1033:NM_022658:198:175
+GAGGTGCCGTGGTGGAAGAAGTCTTGAACGTGGTGCGAAGCGTGCTGGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1034:NM_173860:216:162
+CGGGAGCAGCGCTGCCCCGGGCCCGGCTCCCGGGTCGCGCCCGCGCTCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1035:NM_022658:217:206
+GGCAGCTAAGCGAGCACGGGTTCTGCTGGTAGCCTGAGTTGGAGATGCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1036:NM_173860:232:198
+CCGCCGCGTAGTCGTACTTGAAGCCGAGCGCAGGCGGCCCCGACGGCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1037:NM_006897:151:212
+ACAATGAAGACCTCCTAGCGTCCAGGTTTCCGGCCACCGGGGCTCATCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1038:NM_017410:375:175
+CCCTCAGGGCGCCGTCTATACGGACATCCCGGCCCCGGAGGCGGCGCGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1039:NM_022658:722:204
+GGGGTCTTTCTTTTTTGCTTAGTCCTTGTTTTCTTCCTTTTCCTCCTCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1040:NM_014620:572:178
+CAGACCTCCAGAAATGACGTCAGAATCATTTGCATCCCGCTGCCTCTACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1041:NM_022658:85:189
+GGGTTCGGTCCCGGGGGGAGGGGAGTTTCGGGGGTACTGGGCGGGGTACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1042:NM_022658:1676:200
+TTTTTTTTTGATTTTTATTTTTTTCTCTTTTTTTCTCCTATAGCAGGATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1043:NM_174914:1249:169
+TACCACAAGACTTGGAGAACTTCATTGCCAAGTTTGGGGACTCTGGTTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1044:NM_173860:246:164
+TGCGAGCTGGCGCGCGTGGAGGACGGCAAGGGTTACTACCGCGAGCCGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1045:NM_174914:152:195
+CCTGAACTCTCAAGCACAGGGCAGGCTTCCTGAGCATTGAAGAGAATATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1046:NM_022658:233:172
+CTGGAACCGGCCTATTACGACTGCCGGTTCCCTCAGAGCGTGGGCAGGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1047:NM_174914:96:186
+ACTGTGGGCACCAGAGACAGGGACCCAATGTGGAGACCTGTGAGCCTGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1048:NM_018953:59:164
+GGAAAGTGATGCTTAAGTCCAATCCGCCGTAGCAGTACCTGGATGCCTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1049:NM_022658:522:194
+AATCCTCCGCCAACACTAACAGTAGCGAAGGACAAGGCCACTTAAATCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1050:NM_022658:899:171
+AAGGACTAAGCAAAAAAGAAAGACCCCCCCCCCCTTAGCAACTCCCTTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1051:NM_022658:616:186
+TTCTCCTTTTTCCACTTCATCCTTCGGTTCTGGAACCAGATCTTCACTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1052:NM_022658:1721:176
+GAGGTTTCTTTCTTTCTTTTTTTTTTTTTTGATTTTTATTTTTTTCTCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1053:NM_006897:465:200
+CGGGCGTGAATCCAGTTGGCCACGGGGTTGCTGGGGTCCAGGTCGGCCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1054:NM_174914:1811:181
+GAATTTAAAAAGAGTTTTGATTTCTTTCTGGAAGAAACTTTAGGTGGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1055:NM_022658:171:82
+TCGTAATAGGCCGGTTCCAGGGACTCGCCGGCTTTGTATTTGGAGAACAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1056:NM_022658:1856:142
+AAATAAAAATCAAAAAAAAAAAAAAGAAAGAAAGAAACCTCCAGCGTATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1057:NM_004503:289:196
+AGGGGTAAATCTGGATACTGGCTTTCTGGTCCTGGGGCGCAGTCCTGCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1058:NM_006897:828:192
+ATGAAGATGAAAAAGATGAATAAAGAGAAAACCGACAAGGAGCAGTCCTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1059:NM_022658:691:157
+TCCTTATTTGACACGAAAACGTCGGATTGAAGTCTCTCATGCCCTGGGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1060:NM_022658:2000:170
+ACAACTGAGACTGCCTAGCCCGCCGGTCCTGTGCGCTTTTATTGTGCTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1061:NM_174914:1123:117
+AGATGTCCACCTGGCTGCAAATGTGAAAATTGTGGACTGGCTTCCTCAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1062:NM_174914:873:108
+GTCAATCCAGCCCACCAGCCGCTGTGTGGGGCTGAGCGGGTGGGAGCGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1063:NM_022658:1937:185
+TGCATAAACAGAGAATTCAAGACAGAGTTAACTATACATTCAGTGCAATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1064:NM_022658:2085:181
+GTATAGTTAACTCTGTCTTGAATTCTCTGTTTATGCAATGTGCTCGAAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1065:NM_022658:1903:198
+ACAGAGTTAACTATACATTCAGTGCAATTTAGTTCTACTCTACTGGGGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1066:NM_174914:1139:182
+AATCTTCAAGGAGATGAACAATGCCTTTGCTCACCTACCCCAAGGGGTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1067:NM_004503:1006:167
+TTCACCACGCGCCTCCTCCTCCTCGCTCCCTTGCTAGCTCGTTCTCGGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1068:NM_173860:140:190
+CTCACGCTTCAGGCCCCCGCCGCCACCCTCGGCGCACGGCTCGCGGTAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1069:NM_153693:1558:190
+CACCCCCGCCCCCCGTGCAGAGAGCCGGCTCCTGGGCCTGCTGGGGCCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1070:NM_022658:1819:200
+GCTAGGCAGTCTCAGTTGTTGGGTTTTCTTAGTGAAATAAGCAGCAACAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1071:NM_174914:1334:181
+AGGTGTTCACCATGGAGCCCAAGGTCACAAGGACAAAACCAGAGTCCCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1072:NM_153633:580:199
+CTTCAGAAGTACCCGGGGTAGCTGCCGAAAGGGTGCTGGGCGCAGCGCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1073:NM_174914:1473:166
+AGGTCGAGCAAAATCAAAGGCAAAGTCAGAGTTAATGAACCACAACTCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1074:NM_022658:1984:172
+TCACTAAGAAAACCCAACAACTGAGACTGCCTAGCCCGCCGGTCCTGTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1075:NM_173860:411:198
+AAGTACGACTACGCGGCGGGCGGCGGCGGTGGCGACGGCGGCGGCGGCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1076:NM_022658:300:176
+AAGGGACTGTCTGGGGAGCGCCTCGTAGCCATAGAATTTGGAGGCGTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1077:NM_022658:528:165
+GATTAAAGAGAAACTCCTTTTCTAGTTCCAAGGTCTGATACCGGCTGTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1078:NM_022658:964:156
+CTCCCCCCTCCAGCCCCCAAACAAATAAAGAGTGGGGGAAGTCCAAAGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1079:NM_022658:1537:195
+GATTTCTGAGCACTAACACTAATGCAGCTCAGAGGAAGGCGGGCCCAACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1080:NM_014620:1624:163
+AGCTTTTTTTCTTAAAAAATAAATAACCCCCCAAAATGGCCTTTTAAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1081:NM_022658:166:201
+CCGTGGTGGAAGAAGTCTTGAACGTGGTGCGAAGCGTGCTGGAAGCCGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1082:NM_022658:1172:179
+ACACTTGTCCCTGCCCCCACCCTTCTGAGTCCTTCCTGGATTTTAAGGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1083:NM_022658:1812:167
+GAGAAAAATTTTAAAATCCTGCTATAGGAGAAAAAAAGAGAAAAAAATAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1084:NM_022658:1972:196
+TTGCTGCTTATTTCACTAAGAAAACCCAACAACTGAGACTGCCTAGCCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1085:NM_022658:11:201
+CACCGAGGCGCCCCCCAACCTGCCCAGCCCCCAGCCCACCAGCCCAGCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1086:NM_022658:792:195
+AAAAGGAGAACAACAAGGATAAACTGCCGGGAGCCCGAGATGAGGAGAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1087:NM_022658:2016:171
+AAAGACAAATGACAAAAAATTATTATTATAGATATATTTTTAACATTTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1088:NM_006897:831:171
+GATTGGCTTTTGTCTATCTTGCTCTTTCCTTTTCTTTTTCGTCTCTCCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1089:NM_173860:168:149
+CCCCCGCCGCCACCCTCGGCGCACGGCTCGCGGTAGTAACCCTTGCCGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1090:NM_014620:151:184
+GAGGAGGGGCGGAGGCATCTGCAGCTCCCAAGCTCAACTCCTGCTCCTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1091:NM_174914:1193:186
+GAGGAAGCCAGTCCACAATTTTCACATTTGCAGCCAGGTGGACATCTTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1092:NM_022658:1909:193
+TCACTACCTATAGAAAGAAATCCTGCTTTGAGAGTATTTGTAATGCGGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1093:NM_022658:1407:109
+GTCAAGGGGGTTTTTCTAAGCAGGGAGCCCTGGGGAGGGGGAGGGGGAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1094:NM_014620:776:194
+AGCGACTGTGATTTCTCGGGGTGGTGGTGGCCCGCCTGGGCCGGCCCGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1095:NM_014620:270:165
+AGGGGCAGGAGGAATGCAGGAGCAGGAGTTGAGCTTGGGAGCTGCAGATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1096:NM_022658:782:188
+CTGCTACCATAAAACGAAACTTCAAGGGAGTTGCTAAGGGGGGGGGGGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1097:NM_022658:790:190
+CTCAATTTATCTGCTACCATAAAACGAAACTTCAAGGGAGTTGCTAAGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1098:NM_022658:720:145
+TCCTCATTTCCTTCTTCCTCCACCTTCTCCTCATCTCGGGCTCCCGGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1099:NM_173860:424:198
+CGGCGGGCGGCGGCGGTGGCGACGGCGGCGGCGGCGCAGGACCTCCGCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1100:NM_174914:1478:179
+CCGAGTGAAGAATTTTCTGATGTTCTTTAGTTTCTGCAGGAGGCAACAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1101:NM_022658:1811:178
+AGAGAAAAATTTTAAAATCCTGCTATAGGAGAAAAAAAGAGAAAAAAATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1102:NM_022658:2080:181
+ACGTATACAATACAAAGTACTTGGACCAGGAACAGGGCTGTCGGGACACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1103:NM_022658:521:165
+AAATCCTCCGCCAACACTAACAGTAGCGAAGGACAAGGCCACTTAAATCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1104:NM_022658:973:210
+GGGACAAGTGTGTGTGGGGCAAGGAGTGAGACAGAGAGTCCGAACTTTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1105:NM_022658:284:173
+GCCTCGTAGCCATAGAATTTGGAGGCGTCTCCGTGGCAGCTAAGCGAGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1106:NM_022658:1331:172
+TTCTAAGCAGGGAGCCCTGGGGAGGGGGAGGGGGAGGGGGAGGGGATATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1107:NM_174914:532:161
+AGGATGATTTTTGGCCATTTTTCCTGTTCTTCAAGAAAACAGGAGATAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1108:NM_006897:785:158
+TCTCACCGAGCGGCAGGTCAAAATCTGGTTTCAGAATCGAAGGATGAAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1109:NM_022658:298:167
+TGGGGAGCGCCTCGTAGCCATAGAATTTGGAGGCGTCTCCGTGGCAGCTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1110:NM_174914:2086:193
+AGCATGGTGACATTATGACCGTGATCTTGAAGAATCTGAGAAACCCGGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1111:NM_014620:1880:164
+ATTCTCATCCTTCTCCTCCTCCTCCTTCCCCCCCTCTTTCCTTAGGCCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1112:NM_022658:128:162
+GGGTACTCGTGAGCCAGAGGGGAGGGGGCCGCGGGTTTTCATGTACCCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1113:NM_018953:259:185
+ACATGGCTGCCAACCCCCGGGCTCACCCCGACCGCCCCGCCTGCAGCGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1114:NM_022658:519:197
+CCGACGTTTTCGTGTCAAATAAGGATTAAAGAGAAACTCCTTTTCTAGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1115:NM_174914:692:186
+TTGACCACGTCCTCCAGACAGGGGGCGCGACGCACCTCAAGCCCTATGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1116:NM_001168316:480:149
+AGGGAGCTTCCCACTAGTTCTGGCAGCCCCATTCTCTAGTCCTTCTAGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1117:NM_022658:330:210
+ACGCTTCGCACCACGTTCAAGACTTCTTCCACCACGGCACCTCCGGCATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1118:NM_174914:297:179
+CTAGGTCTGGACATGGAGGCTGGAAGAGTCAGGGTGTGATTCGGAGAGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1119:NM_006897:1214:170
+CGCTATATTTCTATTTTTTTTTCCCTGTATCGTATTTGGTCCAGGTCATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1120:NM_174914:219:182
+TTGGACCACTGACCCTCAGATTTCCAGCCTTAAAATCCACCTTCCTTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1121:NM_004503:1205:180
+TGCTGGGGCCTCTGCTCCAGGGCCTCAGGGCCCGGCCTGGCAGCCGGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1122:NM_022658:1366:184
+TCTCCTTCAGGTTTCCATCAGGTTCCTAGAGAAAGTCAAGGGGGTTTTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1123:NM_022658:1570:181
+TTATTTTCGTGATTATGGTGATTTCTGAGCACTAACACTAATGCAGCTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1124:NM_022658:1725:169
+GTTTCTTTCTTTCTTTTTTTTTTTTTTGATTTTTATTTTTTTCTCTTTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1125:NM_022658:1464:165
+GATGGTTAGGTAGGATTTTAGAGGCGACTGCAGGCTCCTATCTACCCTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1126:NM_173860:296:171
+CGCCGAGGGTGGCGGCGGGGGCCTGAAGCGTGAGGAGCGCGGGCGCGACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1127:NM_022658:831:166
+ATGAGGAGAAGGTGGAGGAAGAAGGAAATGAGGAAGAGGAGAAAGAAGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1128:NM_022658:51:110
+AGCCCAGCCCAGTCCCGGGGAGCCAGCTGGCCTGGGGTTCGGTCCCGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1129:NM_006897:382:214
+CCGGCGAGCGCGTCCGCCTCGGGCGAGGGCAGTGTCTGCGGGGCGCGGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1130:NM_022658:1446:169
+AGCAAGGAATATCCCCTCCCCCTCCCCCTCCCCCTCCCCAGGGCTCCCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1131:NM_173860:364:199
+CAGCGCTGCTCCCGCTGGAGCCGTCGGGGCCGCCTGCGCTCGGCTTCAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1132:NM_022658:588:156
+TCAGTCCCAGGGCATGAGAGACTTCAATCCGACGTTTTCGTGTCAAATAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1133:NM_022658:14:169
+TCATGCTGGGTACATGAAAACCCGCGGCCCCCTCCCCTCTGGCTCACGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1134:NM_022658:175:181
+CAGCATGAGCTCCTACTTCGTCAACCCCCTGTTCTCCAAATACAAAGCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1135:NM_174914:1221:187
+CTTGGAGAACTTCATTGCCAAGTTTGGGGACTCTGGTTTTGTCCTTGTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1136:NM_006897:1137:177
+TTTTTTTTTTGTACAAAATCTGCACGCAGAGCGCCCCAGGCCCGGGGAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1137:NM_173860:674:152
+ACTGGCAGAGCTGGAGGGCGAGTTTCTGGTCAACGAGTTCATCACACGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1138:NM_173860:553:172
+TGGCGTGTGATGAACTCGTTGACCAGAAACTCGCCCTCCAGCTCTGCCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1139:NM_022658:1053:210
+GCAGCTCTGGTTTTATTACCTTTGGACTTCCCCCACTCTTTATTTGTTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1140:NM_174914:639:191
+TCTTTCAGCAGCCCTGGCATGAGCAGTACCTGCTCGACGTTTTTGTGTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1141:NM_022658:1599:171
+CAGTCGCCTCTAAAATCCTACCTAACCATCCCATGGTCACTCGGGCCCAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1142:NM_014620:1263:194
+TCTCTGAGAGGCAGATCAAAATCTGGTTCCAAAACCGTCGCATGAAATGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1143:NM_173860:499:175
+AATCCGACTCCAGTTCGTCCCTGCTCAACGAGGGCAACAAGGGCGCCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1144:NM_022658:472:180
+CCTTTATGGGGCTCAGCAAGAGGCGAGCGTGGTGCAATATCCCGACTGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1145:NM_022658:1039:209
+CCTGTCAGATACTTGCAGCTCTGGTTTTATTACCTTTGGACTTCCCCCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1146:NM_022658:257:169
+CGTGGCAGCTAAGCGAGCACGGGTTCTGCTGGTAGCCTGAGTTGGAGATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1147:NM_174914:1302:177
+CGACCTCTGCTTCCCAACACTGTTTATGTTGGAGGCTTGATGGAAAAACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1148:NM_153633:741:151
+TGTGAGGGGAGGGTGGGGGCATGGGGTGGGGGCAGGGGTGTGAGTTATGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1149:NM_004503:658:170
+CGACAGATCAAAATCTGGTTCCAGAACCGCCGGATGAAGTGGAAAAAAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1150:NM_174914:317:153
+TGGAAGAGTCAGGGTGTGATTCGGAGAGGCGCATGAGAAGGAAGGTGGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1151:NM_022658:1532:179
+ATGCAGCTCAGAGGAAGGCGGGCCCAACAGAATAGAAATCAAACAGCGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1152:NM_022658:1782:180
+CAAAACCGCATTACAAATACTCTCAAAGCAGGATTTCTTTCTATAGGTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1153:NM_174914:1376:187
+GAAGGCTCTAGGCCAGTTTTGTCTCATCTTCTACTGAAAGCAGAGTTGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1154:NM_022658:458:171
+GCGCCTCCCCGGAGCGTGGGGTCTCATCCATGGAAACATGAGGCTGGGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1155:NM_022658:1235:185
+CCGTGCTCCTCGGTCTGTCTCTCACCACACTCCCACCTCCCTGCTTCTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1156:NM_022658:428:144
+GACGCCTCCAAATTCTATGGCTACGAGGCGCTCCCCAGACAGTCCCTTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1157:NM_006897:682:92
+GGCCACCTCATACCGACGGTCCCTGGTTAAATACATATTGAAGAGAAACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1158:NM_153633:1401:198
+AGAGGGGGCGAAGACAGCAGACAAAGCTAAATGCATCTGGAGAGCCTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1159:NM_153693:1145:187
+GCCGACAGCCTGGGCGGAAAAGAGGAAAAGCGGGAAGAGACAGAAGAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1160:NM_174914:1042:192
+TTGGCTTCTACTCGGACCATGTTTTCAGGCTGGTCTCCAAAGAGAGGGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1161:NM_174914:9:183
+TTGGGGAGAGATAACGCTGTAAACTTTTATTTTTCAGGAAATCTGGAAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1162:NM_173860:430:201
+TGATCGGGTACCAGGGCGCGCCGCTGGCCGAGAGCCCGCCGCCGGGGTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1163:NM_022658:502:214
+CCGACGTTTTCGTGTCAAATAAGGATTAAAGAGAAACTCCTTTTCTAGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1164:NM_174914:896:185
+TGGAGACCAGCCTGAAAACATGGTCCGAGTAGAAGCCAAAAAGTTTGGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1165:NM_022658:1770:195
+TACTACCTAAAGGGAACCTGCAATAATCTTGAAAAAGAAAAAGAGAAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1166:NM_173860:115:179
+TGCCTTCGCTGTCCTACCCACGCCGCGACAACGTGTGCTCCCTGTCCTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1167:NM_022658:360:186
+ACCACGGCACCTCCGGCATCTCCAACTCAGGCTACCAGCAGAACCCGTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1168:NM_004503:1164:182
+TTTGCTGGGGCAGAGGGGCTAGGCAGGGACTGCGGGGAGGCCCTGGGGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1169:NM_001168316:789:110
+AACGTCGAGCAGGTACTGCTCATGCCAGGGCTGCTGAAAGACATAGGGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1170:NM_006897:833:132
+GATGAAAAAGATGAATAAAGAGAAAACCGACAAGGAGCAGTCCTAAACCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1171:NM_022658:229:199
+GTCCCTGGAACCGGCCTATTACGACTGCCGGTTCCCTCAGAGCGTGGGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1172:NM_001168316:195:152
+GAATATGTGGGAGAACAAAACAGAAACTGAAAGAATATGCAAGGTGTCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1173:NM_022658:2014:177
+CTAGCCCGCCGGTCCTGTGCGCTTTTATTGTGCTTCTAACCCCAGTAGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1174:NM_022658:131:188
+TACTCGTGAGCCAGAGGGGAGGGGGCCGCGGGTTTTCATGTACCCAGCAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1175:NM_022658:1352:146
+AGGCTAGTGTACTAGATGTACTTTTTCTAAAAAGGAAAGGACAGAAAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1176:NM_153633:541:195
+AGCGCCGGCCGGGGGTGCTGACCTGACTTTGGTGTTGGGGAGTCGGTGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1177:NM_022658:1493:127
+CTGCTTAGAAAAACCCCCTTGACTTTCTCTAGGAACCTGATGGAAACCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1178:NM_001168316:136:208
+TCTCCGAATCACACCCTGACTCTTCCAGCCTCCATGTCCAGACCTAGTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1179:NM_006897:814:171
+TTCAGAATCGAAGGATGAAGATGAAAAAGATGAATAAAGAGAAAACCGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1180:NM_022658:1091:182
+AGGTGGGAGTGTGGTGAGAGACAGACCGAGGAGCACGGAGGCCAGGTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1181:NM_022658:1606:208
+CTCTAAAATCCTACCTAACCATCCCATGGTCACTCGGGCCCATGCCTTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1182:NM_153633:335:180
+TGGGTTCCCCTCCGTTATAATTGGGGTTCACCGTGCTAACGTGAATTTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1183:NM_022658:1299:162
+AGGGGAGCCCCCTCGAAATGCAGAAAAGGACTTGTGGTTTTGTTTTTATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1184:NM_006897:1345:190
+TTAAGTGACTTCAATATATTAACACAGGGCTGTTCTACCATAACAAACAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1185:NM_022658:734:182
+TTTTTTGCTTAGTCCTTGTTTTCTTCCTTTTCCTCCTCTTCTTTCTCCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1186:NM_022658:1613:178
+ATCCTACCTAACCATCCCATGGTCACTCGGGCCCATGCCTTCCTCTCCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1187:NM_022658:1167:166
+CACACACACTTGTCCCTGCCCCCACCCTTCTGAGTCCTTCCTGGATTTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1188:NM_022658:2021:198
+GCCGGTCCTGTGCGCTTTTATTGTGCTTCTAACCCCAGTAGAGTAGAACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1189:NM_022658:624:201
+GGCGCAGTGGACGGCAAACTTACAGCCGGTATCAGACCTTGGAACTAGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1190:NM_022658:1687:195
+GGCCCGCCTTCCTCTGAGCTGCATTAGTGTTAGTGCTCAGAAATCACCAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1191:NM_022658:301:166
+TCTGGGGAGCGCCTCGTAGCCATAGAATTTGGAGGCGTCTCCGTGGCAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1192:NM_001168316:1392:169
+AATGAAGTTCTCCAAGTCTTGTGGTACTGGTTTAATAGGTTTTTCCATCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1193:NM_153633:1212:184
+AGGAAAAGAAAAAAGGAAAGAAATTTTAAAGCCAATTCTCATCCTTCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1194:NM_022658:1163:171
+ACAAGTCCTTTTCTGCATTTCGAGGGGGCTCCCCTCTAAAATAAATACCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1195:NM_001168316:274:169
+GGGGCAGGAGTGAGAGAGGCTGACTAGGTCTGGACATGGAGGCTGGAAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1196:NM_022658:1881:199
+GTGCAATTTAGTTCTACTCTACTGGGGTTAGAAGCACAATAAAAGCGCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1197:NM_173860:661:179
+ATTCGAAGTTGCAACTGGCAGAGCTGGAGGGCGAGTTTCTGGTCAACGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1198:NM_173860:142:184
+ACAACGTGTGCTCCCTGTCCTGGCCGTCGGCGGAGCCGTGCAATGGCTAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1199:NM_022658:673:175
+AAAGGAGTTTCTCTTTAATCCTTATTTGACACGAAAACGTCGGATTGAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1200:NM_022658:619:220
+GGGGAGGCGCAGTGGACGGCAAACTTACAGCCGGTATCAGACCTTGGAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1201:NM_022658:1389:188
+GAAATGGGGGGAGGGGAAAGACCCACATCTCCTTCAGGTTTCCATCAGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1202:NM_006897:612:188
+GAGAAGGCCGACCTGGACCCCAGCAACCCCGTGGCCAACTGGATTCACGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1203:NM_022658:1827:173
+ATCCTGCTATAGGAGAAAAAAAGAGAAAAAAATAAAAATCAAAAAAAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1204:NM_022658:487:187
+GCAAGAGGCGAGCGTGGTGCAATATCCCGACTGTAAATCCTCCGCCAACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1205:NM_173860:168:196
+CCCCGGGCCCGGCTCCCGGGTCGCGCCCGCGCTCCTCACGCTTCAGGCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1206:NM_014620:1623:207
+CACCCAAGCCAGACCATCACACCTTGCAATATATAATTTTTGCAGCTTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1207:NM_014620:1633:171
+AAAACAGATAAACAAACAAGCCCCCTGCCCTCCTCTCCCTCCCACTGTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1208:NM_022658:1646:155
+CATGCCTTCCTCTCCTTCGCTGTTTGATTTCTATTCTGTTGGGCCCGCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1209:NM_022658:135:157
+CGTGAGCCAGAGGGGAGGGGGCCGCGGGTTTTCATGTACCCAGCATGAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1210:NM_014620:1784:209
+GCTGCAAAAATTATATATTGCAAGGTGTGATGGTCTGGCTTGGGTGAATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1211:NR_031764:1277:201
+CTTGGGGTAGGTGAGCAAAGGCATTGTTCATCTCCTTGAAGATTTCCGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1212:NM_022658:1992:157
+AAAACCCAACAACTGAGACTGCCTAGCCCGCCGGTCCTGTGCGCTTTTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1213:NM_022658:205:197
+GTTCTCCAAATACAAAGCCGGCGAGTCCCTGGAACCGGCCTATTACGACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1214:NM_153633:823:171
+TTTGGAACTGACAAGGGACAAGGTGAGAGGAAGAGAGAAAAGAACCTATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1215:NM_022658:1854:183
+AGCGCACAGGACCGGCGGGCTAGGCAGTCTCAGTTGTTGGGTTTTCTTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1216:NM_173860:474:186
+GGGCTTGCGCTTCTTCCGAGAGCGGCTGTTGATCGGGTACCAGGGCGCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1217:NM_174914:357:176
+TTTCCACTTGCTAATTTTGCTACAAATTCATCCTTACTAGCTCCTGCCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1218:NM_022658:1362:192
+CACATCTCCTTCAGGTTTCCATCAGGTTCCTAGAGAAAGTCAAGGGGGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1219:NM_173860:381:165
+GAGCCGTCGGGGCCGCCTGCGCTCGGCTTCAAGTACGACTACGCGGCGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1220:NM_173860:513:181
+TCGTCCCTGCTCAACGAGGGCAACAAGGGCGCCGGCGCAGGCGACCCCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1221:NM_022658:93:202
+TCCCGGGGGGAGGGGAGTTTCGGGGGTACTGGGCGGGGTACTCGTGAGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1222:NM_017409:1614:204
+TCTGTCTTTGCTTTGCTATGTTCTATTTTTAATTTTTTTGTTCCTCTGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1223:NM_022658:297:180
+ACGGGCCCGGCGGCTCGGCGCCCGGCTTCCAGCACGCTTCGCACCACGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1224:NM_022658:134:477
+GGGTCTCATCCATGGAAACATGAGGCTGGGAGACGAGTTTTGATTTAAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1225:NM_153633:903:147
+TTAACAGTGGGAGGGAGAGGAGGGCAGGGGGCTTGTTTGTTTATCTGTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1226:NM_014620:734:152
+CCATGCGAAGAATATTCGCAAAATAGCTACATCCCTGAACACAGTCCGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1227:NM_022658:1503:178
+AATAGAAATCAAACAGCGAAGGAGAGGAAGGCATGGGCCCGAGTGACCAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1228:NM_018953:582:156
+CTCGAGAAAGAATTCCACTTTAACCGCTACCTCACTCGCCGCAGGCGCAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1229:NM_014620:893:185
+CTCCAGGGGCCCGGCAATTCGCGAGGCCACGGGCCGGCCCAGGCGGGCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1230:NM_022658:1854:185
+AAAAATAAAAATCAAAAAAAAAAAAAAGAAAGAAAGAAACCTCCAGCGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1231:NM_006897:1098:147
+GATACAGGGAAAAAAAAATAGAAATATAGCGATTCAAGTACTGGCTTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1232:NM_173860:562:187
+GCAGCTTGGTATCGCCGTTGAACCCCGGCGGCGGGCTCTCGGCCAGCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1233:NM_001168316:196:180
+AGCCTTAAAATCCACCTTCCTTCTCATGCGCCTCTCCGAATCACACCCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1234:NM_022658:185:195
+GATGCCGGAGGTGCCGTGGTGGAAGAAGTCTTGAACGTGGTGCGAAGCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1235:NM_022658:1773:175
+AAATACTCTCAAAGCAGGATTTCTTTCTATAGGTAGTGATAAAATACGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1236:NM_006897:955:206
+GAGAGACGAAAAAGAAAAGGAAAGAGCAAGATAGACAAAAGCCAATCAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1237:NM_022658:288:181
+CGCTGGTGTACGGGCCCGGCGGCTCGGCGCCCGGCTTCCAGCACGCTTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1238:NM_022658:132:173
+GGGCCCGTACACCAGCGCATGGCTCCTGCCCACGCTCTGAGGGAACCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1239:NM_022658:1919:177
+TAGAAAGAAATCCTGCTTTGAGAGTATTTGTAATGCGGTTTTGTTGTCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1240:NM_174914:1671:188
+ATTCCTTAAAGAATGAGAACTTCGACATGGTGATAGTTGAAACTTTTGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1241:NM_014620:1958:195
+TATAGACTGCCTCTCTGAACTGAAAGTTCATTTTGATTTTCTTTTGGCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1242:NM_004503:612:170
+GCGGCGCCGGCGCATCGAGATCGCCAACGCGCTTTGCCTGACCGAGCGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1243:NM_022658:2143:101
+TACTTGGACCAGGAACAGGGCTGTCGGGACACAAAATCTACATTCATAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1244:NM_022658:2036:173
+TTTTATTGTGCTTCTAACCCCAGTAGAGTAGAACTAAATTGCACTGAATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1245:NM_173860:664:181
+CGAAGTTGCAACTGGCAGAGCTGGAGGGCGAGTTTCTGGTCAACGAGTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1246:NM_022658:2035:164
+CTTTTATTGTGCTTCTAACCCCAGTAGAGTAGAACTAAATTGCACTGAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1247:NM_022658:369:158
+CCTCCGGCATCTCCAACTCAGGCTACCAGCAGAACCCGTGCTCGCTTAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1248:NM_006897:607:212
+CTGAAACCAGATTTTGACCTGCCGCTCGGTGAGATTGAGAACCCGGGCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1249:NM_022658:1816:147
+AAAATTTTAAAATCCTGCTATAGGAGAAAAAAAGAGAAAAAAATAAAAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1250:NM_022658:497:169
+AGCGTGGTGCAATATCCCGACTGTAAATCCTCCGCCAACACTAACAGTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1251:NM_022658:1480:180
+TCCCCAGGGCTCCCTGCTTAGAAAAACCCCCTTGACTTTCTCTAGGAACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1252:NM_022658:553:194
+CGGTCAGTCCCAGGGCATGAGAGACTTCAATCCGACGTTTTCGTGTCAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1253:NM_006897:210:183
+CGGCTCGAGCCAAGTCCGCATGTAGCGCGTGTCGGCGCCGAGGTGGGGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1254:NM_022658:851:197
+GAAGGAAATGAGGAAGAGGAGAAAGAAGAGGAGGAAAAGGAAGAAAACAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1255:NM_022658:377:174
+ATCTCCAACTCAGGCTACCAGCAGAACCCGTGCTCGCTTAGCTGCCACGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1256:NM_174914:2203:176
+ACCCCAGGGAGAAGGAAGCCCACTAGAAGAAGCACTCGCTGCCCAGCCAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1257:NM_174914:46:186
+TATTCTTTCAGTTTCTGTTTTGTTCTCCCACATATTCTCTTCAATGCTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1258:NM_006897:166:136
+ACGGGCGCCCACGACGTGCTGAACACTGCCGGCTTGGGCGCGAAGCTACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1259:NM_022658:2077:192
+TATGACTCACGTATACAATACAAAGTACTTGGACCAGGAACAGGGCTGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1260:NM_022658:521:174
+AAATCCTCCGCCAACACTAACAGTAGCGAAGGACAAGGCCACTTAAATCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1261:NM_174914:2010:208
+TGCAAGCCAACTGATAACTTGATATGATTTTTCTTCCTTTTTAAAATCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1262:NM_018953:1016:188
+GCTGCGGCGTACAGGCTGGCGCAGAACGAACCTTGGCCTGGGCCGTATCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1263:NM_022658:696:167
+CTCATTTCCTTCTTCCTCCACCTTCTCCTCATCTCGGGCTCCCGGCAGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1264:NM_173860:573:179
+AAGCGGTCTGAGAGTTCCCTCCGGCGCTGGCGTGTGATGAACTCGTTGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1265:NM_174914:350:197
+TGAGAAGGAAGGTGGATTTTAAGGCTGGAAATCTGAGGGTCAGTGGTCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1266:NM_022658:783:208
+TGAAGTGGAAAAAGGAGAACAACAAGGATAAACTGCCGGGAGCCCGAGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1267:NM_022658:1934:113
+CTTTGAGAGTATTTGTAATGCGGTTTTGTTGTCGTTTGTTGCTGCTTATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1268:NM_022658:656:189
+CACCTTCTCCTCATCTCGGGCTCCCGGCAGTTTATCCTTGTTGTTCTCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1269:NM_022658:2041:187
+TTGTGCTTCTAACCCCAGTAGAGTAGAACTAAATTGCACTGAATGTATAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1270:NM_022658:180:186
+CGTGGTGGAAGAAGTCTTGAACGTGGTGCGAAGCGTGCTGGAAGCCGGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1271:NM_022658:890:157
+CTGACAGGTAGTTAGAGTTGTGAGTGTCATTCTATTCTCTATAAAAGCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1272:NM_173860:636:134
+CGCTCTCGGAAGAAGCGCAAGCCCTATTCGAAGTTGCAACTGGCAGAGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1273:NM_174914:589:108
+ACTAGAGAATGGGGCTGCCAGAACTAGTGGGAAGCTCCCTAGAAATGGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1274:NM_022658:574:149
+CTTCAATCCGACGTTTTCGTGTCAAATAAGGATTAAAGAGAAACTCCTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1275:NM_004503:1290:157
+ACACCAACCCCCAGGGCCTCCCCGCAGTCCCTGCCTAGCCCCTCTGCCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1276:NM_022658:108:166
+AGTTTCGGGGGTACTGGGCGGGGTACTCGTGAGCCAGAGGGGAGGGGGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1277:NM_173860:627:176
+TTCATTCTCCGGTTCTGAAACCAGATCTTGACCTGCTGGTCACTAAGATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1278:NM_018953:602:172
+GGCGCGCTCTGCGGGCCTCCCCCGCTGCCTCTAAAGAGCCTCTTTGCTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1279:NM_173860:638:205
+GAAGGAGAGAGCTTGCTCCCTCAACAGAAGTCTTTTCTTTTTCATTCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1280:NM_022658:1268:200
+GGGGGAGGGGATATTCCTTGCTTTTTTCCTTATTTCTTTACATTTGTCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1281:NM_014620:1893:171
+TAGCTTTGTCTGCTGTCTTCGCCCCCTCTCCTCCCACACCCCCCCCCAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1282:NM_173860:510:170
+GCCAGTTGCAACTTCGAATAGGGCTTGCGCTTCTTCCGAGAGCGGCTGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1283:NM_001168316:1924:138
+AGTAGATTTTAAAAAGGAAGAAAAATCATATCAAGTTATCAGTTGGCTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1284:NM_173860:406:187
+CCGCCGGGGTTCAACGGCGATACCAAGCTGCCGGGGTCGCCTGCGCCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1285:NM_014620:1744:170
+AAGGCCATTTTGGGGGGTTATTTATTTTTTAAGAAAAAAAGCTGCAAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1286:NM_022658:948:178
+CTCCGTCTCCCCCCTCCAGCCCCCAAACAAATAAAGAGTGGGGGAAGTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1287:NM_022658:1132:177
+GGGCTCCCCTCTAAAATAAATACCAGAGAAGCAGGGAGGTGGGAGTGTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1288:NM_022658:1585:155
+TAGATAGGAGCCTGCAGTCGCCTCTAAAATCCTACCTAACCATCCCATGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1289:NM_022658:1762:149
+GATAAAATACGCTGGAGGTTTCTTTCTTTCTTTTTTTTTTTTTTGATTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1290:NM_022658:1529:185
+CTAATGCAGCTCAGAGGAAGGCGGGCCCAACAGAATAGAAATCAAACAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1291:NM_174914:1815:174
+AGTTTCAACTATCACCATGTCGAAGTTCTCATTCTTTAAGGAATCCATGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1292:NM_173860:587:183
+CGGCGGCGGGCTCTCGGCCAGCGGCGCGCCCTGGTACCCGATCAACAGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1293:NM_174914:211:166
+AAAACAGAAACTGAAAGAATATGCAAGGTGTCTTTCTTGGATGTTATTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1294:NM_153633:525:214
+CGCAGCGCCGGCCGGGGGTGCTGACCTGACTTTGGTGTTGGGGAGTCGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1295:NM_014620:1752:175
+TTTGGGGGGTTATTTATTTTTTAAGAAAAAAAGCTGCAAAAATTATATAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1296:NM_174914:1664:188
+AGTCCATGTGATCAGTCAGCAAGGAACGGAATACTGGAACATAAGACAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1297:NM_022658:835:176
+CTCTATAAAAGCAAATGACAGTCGTAAACTTCTCAATTTATCTGCTACCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1298:NM_174914:1514:177
+ACAACTCTGCTTTCAGTAGAAGATGAGACAAAACTGGCCTAGAGCCTTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1299:NM_014620:1956:197
+TTAGTGAGGGGGAAGTCATTTTAAGGAGAACAAAGCTATGAAGTTCTTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1300:NM_022658:194:133
+GTCAACCCCCTGTTCTCCAAATACAAAGCCGGCGAGTCCCTGGAACCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1301:NM_014620:82:159
+GGGCGCTCCCTTCATTAGCAGTATTTTTTTTAAATTAATCTGATTAATAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1302:NM_022658:1496:171
+CTTAGAAAAACCCCCTTGACTTTCTCTAGGAACCTGATGGAAACCTGAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1303:NM_014620:637:189
+TGGTGATGCTGGAATCCCGATTCCCTGGTCCGGCCGTAATATTCCGGACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1304:NM_001168316:1194:117
+AGGAAGCCAGTCCACAATTTTCACATTTGCAGCCAGGTGGACATCTTTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1305:NM_006897:305:180
+CAGTCCGCGCGGCGCCCGGGGTAGGCGTCCGGCTTGAGGGCGTAGTGACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1306:NM_022658:1038:176
+ACCTGTCAGATACTTGCAGCTCTGGTTTTATTACCTTTGGACTTCCCCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1307:NM_022658:1518:196
+CTAATGCAGCTCAGAGGAAGGCGGGCCCAACAGAATAGAAATCAAACAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1308:NM_022658:1290:176
+GGGAGGGGATATTCCTTGCTTTTTTCCTTATTTCTTTACATTTGTCTTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1309:NM_022658:1599:183
+CTTTAGGTAGTATGTTAAAGATTTATTATTATTATTTTCGTGATTATGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1310:NM_022658:659:180
+CTCCTCATCTCGGGCTCCCGGCAGTTTATCCTTGTTGTTCTCCTTTTTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1311:NM_001168316:1413:183
+ACATTTGACAACACCATCAAGGAACATTTCACAGAAGGCTCTAGGCCAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1312:NM_173860:137:166
+CCGCGACAACGTGTGCTCCCTGTCCTGGCCGTCGGCGGAGCCGTGCAATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1313:NM_004503:1196:193
+TGACCCCCAGGATTCTTTAAATACAATTTGCCTGGGCTGGGCATTTGCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1314:NM_022658:761:212
+ATCTGGTTCCAGAACCGAAGGATGAAGTGGAAAAAGGAGAACAACAAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1315:NR_031764:1477:155
+GTGCAAGCCAACTGATAACTTGATATGATTTTTCTTCCTTTTTAAAATCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1316:NM_022658:983:157
+TTTACGACTGTCATTTGCTTTTATAGAGAATAGAATGACACTCACAACTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1317:NM_174914:458:172
+TAGGGAGCTTCCCACTAGTTCTGGCAGCCCCATTCTCTAGTCCTTCTAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1318:NM_022658:157:124
+CGCGGGTTTTCATGTACCCAGCATGAGCTCCTACTTCGTCAACCCCCTGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1319:NM_004503:1035:193
+GCCCTGGAGCAGAGGCCCCAGCAGGCCCAGGAGCCGGCTCTCTGCACGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1320:NM_004503:705:182
+GTGATTAGGGGAGAGTTGGTGGGGAGCGAGGGAGAAAGGGAGAGAGGGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1321:NM_006897:204:169
+GCCGCCAGACCCAGCGGTTTGGTGCCGGACTGTAGCGATTTTCCGTCCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1322:NM_173860:355:187
+CCCTTGTTGCCCTCGTTGAGCAGGGACGAACTGGAGTCGGATTCCAGCGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1323:NM_018953:658:171
+ATGAGAGACAGATCAAGATCTGGTTCCAGAACCGCAGGATGAAGTGGAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1324:NM_014620:824:192
+TGGGGACGGGGAGGCGGAGGCGCCTGAGAGAGGCGCCGGCTCGCAGAGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1325:NM_022658:786:190
+AGTGGAAAAAGGAGAACAACAAGGATAAACTGCCGGGAGCCCGAGATGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1326:NM_022658:1537:157
+AACCTGAAGGAGATGTGGGTCTTTCCCCTCCCCCCATTTCCAGAAGGGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1327:NM_022658:37:195
+GACTCGCCGGCTTTGTATTTGGAGAACAGGGGGTTGACGAAGTAGGAGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1328:NM_014620:246:184
+TATAAATTCAAAAATAAAAATAATTATAATCATCCAAAAGCCAAACAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1329:NM_022658:79:180
+GGCCTGGGGTTCGGTCCCGGGGGGAGGGGAGTTTCGGGGGTACTGGGCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1330:NM_022658:1975:170
+ACATTTTTTTCTTTCGAGCACATTGCATAAACAGAGAATTCAAGACAGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1331:NM_014620:1509:190
+CCCACCCTCCCCTCACACACAAATTGACTCTTATTTATAGAATTTAATAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1332:NM_174914:10:177
+TGGGGAGAGATAACGCTGTAAACTTTTATTTTTCAGGAAATCTGGAAACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1333:NM_022658:835:193
+GGAGAAGGTGGAGGAAGAAGGAAATGAGGAAGAGGAGAAAGAAGAGGAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1334:NM_022658:583:204
+TTCATCCTTCGGTTCTGGAACCAGATCTTCACTTGTCTCTCGGTCAGTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1335:NM_022658:602:198
+ATGAGACCCCACGCTCCGGGGAGGCGCAGTGGACGGCAAACTTACAGCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1336:NM_022658:758:192
+AAGATCTGGTTCCAGAACCGAAGGATGAAGTGGAAAAAGGAGAACAACAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1337:NM_022658:1645:165
+TTTCTTTTTCAAGATTATTGCAGGTTCCCTTTAGGTAGTATGTTAAAGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1338:NM_022658:137:200
+TGAGCCAGAGGGGAGGGGGCCGCGGGTTTTCATGTACCCAGCATGAGCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1339:NM_018953:895:205
+ATTCCGCATCCCTACCGACCCAGGGTTCCCGCGGGGCTGTCGGCGCTGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1340:NM_022658:220:195
+AGCCGGCGAGTCCCTGGAACCGGCCTATTACGACTGCCGGTTCCCTCAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1341:NM_014620:1068:166
+CTCCTTCGGGTCAGGTAGCGGTTGTAATGAAACTCTTTCTCTAATTCCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1342:NM_174914:1568:190
+CTTTCCACTTCATTCGGCTCTTTGGAATTTGGGCTACCAATCCCCTTGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1343:NM_174914:1112:186
+GCTGGATGGCCTCCATTATGCTATTCTGCCCGCCGTGGGTGACAAACAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1344:NM_018953:49:198
+AGAAATTTTTTTGGGCCCTCCCCGCCATGAGCTCCTACGTAGCCAATTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1345:NM_022658:728:183
+CATGCCCTGGGACTGACCGAGAGACAAGTGAAGATCTGGTTCCAGAACCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1346:NM_022658:1939:207
+AACATTTTTTTCTTTCGAGCACATTGCATAAACAGAGAATTCAAGACAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1347:NM_022658:1366:152
+AAGTCAAGGGGGTTTTTCTAAGCAGGGAGCCCTGGGGAGGGGGAGGGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1348:NM_022658:637:174
+TCCTTGTTGTTCTCCTTTTTCCACTTCATCCTTCGGTTCTGGAACCAGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1349:NM_022658:87:175
+GTTCGGTCCCGGGGGGAGGGGAGTTTCGGGGGTACTGGGCGGGGTACTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1350:NM_014620:345:145
+CCCTCATTCTGTGCCGCTGCCGAGCCTGTCTCAGCTCCACACACACACAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1351:NM_174914:919:177
+GGGGATCCCTCTCTTTGGAGACCAGCCTGAAAACATGGTCCGAGTAGAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1352:NM_173860:355:164
+GGCCCGGGGCAGCGCTGCTCCCGCTGGAGCCGTCGGGGCCGCCTGCGCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1353:NM_174914:1879:178
+AAAAAATGACTGCACTGCAACGCCAAGTATTCTAGAACATTTAATAAGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1354:NM_022658:1577:204
+TTTAGGTAGTATGTTAAAGATTTATTATTATTATTTTCGTGATTATGGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1355:NM_022658:377:192
+ATCTCCAACTCAGGCTACCAGCAGAACCCGTGCTCGCTTAGCTGCCACGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1356:NM_022658:1429:185
+AAAGAAATAAGGAAAAAAGCAAGGAATATCCCCTCCCCCTCCCCCTCCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1357:NM_022658:1502:176
+AAAACCCCCTTGACTTTCTCTAGGAACCTGATGGAAACCTGAAGGAGATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1358:NM_014620:1770:202
+ACTTCCCCCTCACTAACCTCCCCTGGTGCATTTTCAATGCAAAAGGCCTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1359:NM_022658:392:207
+TGGAAACATGAGGCTGGGAGACGAGTTTTGATTTAAGTGGCCTTGTCCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1360:NM_022658:908:169
+GCAAAAAAGAAAGACCCCCCCCCCCTTAGCAACTCCCTTGAAGTTTCGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1361:NR_031764:947:173
+CGGACTTGTATCTCTTGTCTTCCATGATTTGTTTCATCTTAAGAGCCAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1362:NM_022658:1702:133
+GAGCTGCATTAGTGTTAGTGCTCAGAAATCACCATAATCACGAAAATAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1363:NM_022658:1339:189
+TGTTTTTATGCTAAGGCTAGTGTACTAGATGTACTTTTTCTAAAAAGGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1364:NM_022658:683:160
+CCTTCTCCTCATCTCGGGCTCCCGGCAGTTTATCCTTGTTGTTCTCCTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1365:NM_022658:670:164
+CATCTCGGGCTCCCGGCAGTTTATCCTTGTTGTTCTCCTTTTTCCACTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1366:NM_174914:1104:195
+GCCTTTGCTCACCTACCCCAAGGGGTGATATGGAAGTGTCAGTGTTCTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1367:NM_001168316:1246:176
+CCAGTACCACAAGACTTGGAGAACTTCATTGCCAAGTTTGGGGACTCTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1368:NM_173860:542:148
+CGCCGGCGCAGGCGACCCCGGCAGCTTGGTATCGCCGTTGAACCCCGGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1369:NM_022658:687:189
+CTTTCTCCTCTTCCTCATTTCCTTCTTCCTCCACCTTCTCCTCATCTCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1370:NM_001168316:772:179
+CCCAGCAGAAACACAAAAACGTCGAGCAGGTACTGCTCATGCCAGGGCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1371:NM_153633:487:178
+AACCCCAATTATAACGGAGGGGAACCCAAGCGCTCGAGGACAGCCTATAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1372:NM_022658:930:178
+GCCCCCAAACAAATAAAGAGTGGGGGAAGTCCAAAGGTAATAAAACCAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1373:NM_014620:1506:93
+GCCCCCACCCTCCCCTCACACACAAATTGACTCTTATTTATAGAATTTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1374:NM_173860:642:170
+CTTTTCTTTTTCATTCTCCGGTTCTGAAACCAGATCTTGACCTGCTGGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1375:NM_022658:1325:178
+AGGACTTGTGGTTTTGTTTTTATGCTAAGGCTAGTGTACTAGATGTACTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1376:NM_022658:467:182
+CAGTCCCTTTATGGGGCTCAGCAAGAGGCGAGCGTGGTGCAATATCCCGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1377:NM_153693:1146:201
+GTTTGACTCCCTAATTTTGTTTTAGGGAATCAAAACACATCAATTGTGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1378:NM_022658:1704:199
+GCTGCATTAGTGTTAGTGCTCAGAAATCACCATAATCACGAAAATAATAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1379:NM_022658:996:131
+TTTGCTTTTATAGAGAATAGAATGACACTCACAACTCTAACTACCTGTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1380:NM_022658:513:176
+CCGACTGTAAATCCTCCGCCAACACTAACAGTAGCGAAGGACAAGGCCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1381:NM_174914:661:180
+CGCCAAGGCTGCACCTGGCCTTATGTCTCCTTCACCTTTCTGGCCCCACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1382:NM_022658:334:171
+TTCGCACCACGTTCAAGACTTCTTCCACCACGGCACCTCCGGCATCTCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1383:NM_173860:564:179
+AGCTTGGTATCGCCGTTGAACCCCGGCGGCGGGCTCTCGGCCAGCGGCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1384:NM_022658:1825:167
+AAATCCTGCTATAGGAGAAAAAAAGAGAAAAAAATAAAAATCAAAAAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1385:NM_022658:173:124
+ACACCAGCGCATGGCTCCTGCCCACGCTCTGAGGGAACCGGCAGTCGTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1386:NM_022658:1006:202
+TAGAGAATAGAATGACACTCACAACTCTAACTACCTGTCAGATACTTGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1387:NM_022658:1598:180
+AGGTAGTATGTTAAAGATTTATTATTATTATTTTCGTGATTATGGTGATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1388:NM_173860:278:184
+TGCGCCGCCGCCGCCGTCGCCACCGCCGCCGCCCGCCGCGTAGTCGTACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1389:NM_174914:1709:196
+ACAAGGGGATTGGTAGCCCAAATTCCAAAGAGCCGAATGAAGTGGAAAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1390:NM_018953:20:176
+CACAAATCACCCTTAATCAAAAAGGGTGCAGAAATTTTTTTGGGCCCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1391:NM_006897:913:176
+TAACTCTAAAACACCAATATCTCAACACTGAACCCTCCCAAATCGCAAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1392:NM_014620:1092:171
+GGATGAAAAAAATTCACGTTAGCACGGTGAACCCCAATTATAACGGAGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1393:NM_022658:1714:231
+TACTCTCAAAGCAGGATTTCTTTCTATAGGTAGTGATAAAATACGCTGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1394:NM_022658:1625:177
+TCAAGATTATTGCAGGTTCCCTTTAGGTAGTATGTTAAAGATTTATTATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1395:NM_022658:967:112
+CAGATAAATTGAGAAGTTTACGACTGTCATTTGCTTTTATAGAGAATAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1396:NM_022658:1037:197
+TACCTGTCAGATACTTGCAGCTCTGGTTTTATTACCTTTGGACTTCCCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1397:NM_173860:226:194
+GTCGTACTTGAAGCCGAGCGCAGGCGGCCCCGACGGCTCCAGCGGGAGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1398:NM_022658:843:153
+TGACAGTCGTAAACTTCTCAATTTATCTGCTACCATAAAACGAAACTTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1399:NM_173860:501:179
+GCCAGTTGCAACTTCGAATAGGGCTTGCGCTTCTTCCGAGAGCGGCTGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1400:NM_014620:374:172
+CCTTAATTTTGTTTGGCTTTTGGATGATTATAATTATTTTTATTTTTGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1401:NM_174914:2084:172
+TAAGCATGGTGACATTATGACCGTGATCTTGAAGAATCTGAGAAACCCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1402:NM_006897:1095:178
+CCCAGCGAGGAGGAGGCGGGGAGAGAAACTGCGTTCTCTTTCCCCAGCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1403:NM_022658:1308:77
+CCCTCGAAATGCAGAAAAGGACTTGTGGTTTTGTTTTTATGCTAAGGCTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1404:NM_022658:564:193
+TAAATCAAAACTCGTCTCCCAGCCTCATGTTTCCATGGATGAGACCCCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1405:NM_022658:1465:191
+GGAAGGCATGGGCCCGAGTGACCATGGGATGGTTAGGTAGGATTTTAGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1406:NM_022658:205:187
+GCCTGAGTTGGAGATGCCGGAGGTGCCGTGGTGGAAGAAGTCTTGAACGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1407:NM_173860:151:166
+CCCCCGCCGCCACCCTCGGCGCACGGCTCGCGGTAGTAACCCTTGCCGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1408:NM_174914:983:198
+TCTTAAGAGCCAATGTCTCTGCCTTGAGCTTCTTTAACTGAATAGAAACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1409:NM_022658:812:168
+AAACTGCCGGGAGCCCGAGATGAGGAGAAGGTGGAGGAAGAAGGAAATGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1410:NM_022658:1757:187
+TAAATCTTTAACATACTACCTAAAGGGAACCTGCAATAATCTTGAAAAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1411:NM_022658:1784:183
+AACCTGCAATAATCTTGAAAAAGAAAAAGAGAAAAATTTTAAAATCCTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1412:NM_022658:1579:179
+GAAGGGTAGATAGGAGCCTGCAGTCGCCTCTAAAATCCTACCTAACCATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1413:NM_022658:250:163
+CGAGCACGGGTTCTGCTGGTAGCCTGAGTTGGAGATGCCGGAGGTGCCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1414:NM_022658:591:164
+TGTTTCCATGGATGAGACCCCACGCTCCGGGGAGGCGCAGTGGACGGCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1415:NM_022658:1965:147
+TCGTTTGTTGCTGCTTATTTCACTAAGAAAACCCAACAACTGAGACTGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1416:NM_001168316:1996:79
+TGACAATATCTACAGTAGATTTTAAAAAGGAAGAAAAATCATATCAAGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1417:NM_018953:174:193
+CAGGCATCCAGGTACTGCTACGGCGGATTGGACTTAAGCATCACTTTCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1418:NM_014620:914:148
+CGCTGGAGGGATGGTCGGGGGCTGGCTGGCTGCAGGCTGGCGGGGCTGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1419:NM_006897:267:190
+CCGGCTTGAGGGCGTAGTGACGGCCCCCGGCCGGGAAGCTGGGGAAGGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1420:NM_174914:539:182
+TTTTTGGCCATTTTTCCTGTTCTTCAAGAAAACAGGAGATAACTAGAAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1421:NM_022658:759:160
+AGATCTGGTTCCAGAACCGAAGGATGAAGTGGAAAAAGGAGAACAACAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1422:NM_022658:1650:178
+TTTTAAAATTTTTCTCTTTTTCTTTTTCAAGATTATTGCAGGTTCCCTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1423:NM_174914:1271:178
+GGAGGCTTGATGGAAAAACCTATTAAACCAGTACCACAAGACTTGGAGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1424:NM_153633:38:170
+TGGGTACAGCTCCTGGTGGTGATGCTGGAATCCCGATTCCCTGGTCCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1425:NM_014620:1363:201
+CGGCGCTGCGCCCAGCACCCTTTCGGCAGCTACCCCGGGTACTTCTGAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1426:NM_022658:1810:167
+AAGAGAAAAATTTTAAAATCCTGCTATAGGAGAAAAAAAGAGAAAAAAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1427:NR_031764:465:182
+TGGAAAGAATTCTGCTAGCAGGCAGGAGCTAGTAAGGATGAATTTGTAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1428:NM_174914:68:174
+ACACCTTGCATATTCTTTCAGTTTCTGTTTTGTTCTCCCACATATTCTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1429:NM_174914:458:208
+TGGCGGGGTCTGTTTGGTGGGCGATGTCACCATTTCTAGGGAGCTTCCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1430:NM_022658:1805:186
+TTAGTGAAATAAGCAGCAACAAACGACAACAAAACCGCATTACAAATACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1431:NM_006897:993:202
+TGAAGAAAGGAGGAAAAAAATCACATTTGTATGTGTCATTTATTTCGGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1432:NM_006897:819:185
+CTGATTGGCTTTTGTCTATCTTGCTCTTTCCTTTTCTTTTTCGTCTCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1433:NM_174914:1877:184
+CCAGATTTTAAAAAGGAAGAAAAATCATATCAAGTTATCAGTTGGCTTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1434:NM_174914:1077:183
+TCCAAAGAGAGGGATCCCCACCATGGGCACACCATGCTGGATGGCCTCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1435:NM_018953:8:171
+ACTTCAAAGAGTCACAAATCACCCTTAATCAAAAAGGGTGCAGAAATTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1436:NM_022658:710:183
+CGTCGGATTGAAGTCTCTCATGCCCTGGGACTGACCGAGAGACAAGTGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1437:NM_022658:508:161
+ATATCCCGACTGTAAATCCTCCGCCAACACTAACAGTAGCGAAGGACAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1438:NM_022658:1213:209
+TTTAAGGTCTGAGACCTGGCCTCCGTGCTCCTCGGTCTGTCTCTCACCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1439:NM_022658:550:184
+GGCATGAGAGACTTCAATCCGACGTTTTCGTGTCAAATAAGGATTAAAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1440:NM_022658:123:168
+GCGCATGGCTCCTGCCCACGCTCTGAGGGAACCGGCAGTCGTAATAGGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1441:NM_022658:1365:161
+AGATGTACTTTTTCTAAAAAGGAAAGGACAGAAAAAAATGAAGAAAGGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1442:NM_022658:256:173
+CCGGTTCCCTCAGAGCGTGGGCAGGAGCCATGCGCTGGTGTACGGGCCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1443:NM_153633:333:158
+GCTCTGCGAGCCGGCGCCTCTCTCAGGCGCCTCCGCCTCCCCGTCCCCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1444:NM_022658:283:198
+CCATAAAGGGACTGTCTGGGGAGCGCCTCGTAGCCATAGAATTTGGAGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1445:NM_173860:407:173
+ACGGCGATACCAAGCTGCCGGGGTCGCCTGCGCCGGCGCCCTTGTTGCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1446:NM_022658:1052:139
+TGCAGCTCTGGTTTTATTACCTTTGGACTTCCCCCACTCTTTATTTGTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1447:NM_173860:270:188
+GGCAAGGGTTACTACCGCGAGCCGTGCGCCGAGGGTGGCGGCGGGGGCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1448:NM_022658:1934:191
+CTTTGAGAGTATTTGTAATGCGGTTTTGTTGTCGTTTGTTGCTGCTTATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1449:NM_022658:1249:130
+GAAAAAGTACATCTAGTACACTAGCCTTAGCATAAAAACAAAACCACAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1450:NM_173860:106:205
+CCGCCACCCTCGGCGCACGGCTCGCGGTAGTAACCCTTGCCGTCCTCCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1451:NM_017409:434:183
+ATGTACAGCGCAGAGAAGCGGGCGAAAAGTGGCCCCGAGGCAGCTCTCTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1452:NM_173860:5:181
+CGAGCATAATCTCCTGAATCCCGGGTTTGTGGGGCCGCTGGTAAACATCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1453:NM_022658:1795:85
+ATCTTGAAAAAGAAAAAGAGAAAAATTTTAAAATCCTGCTATAGGAGAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1454:NM_022658:291:200
+TGGTGTACGGGCCCGGCGGCTCGGCGCCCGGCTTCCAGCACGCTTCGCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1455:NM_022658:204:173
+TGTTCTCCAAATACAAAGCCGGCGAGTCCCTGGAACCGGCCTATTACGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1456:NM_022658:2033:182
+CGCTTTTATTGTGCTTCTAACCCCAGTAGAGTAGAACTAAATTGCACTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1457:NM_022658:161:172
+CGTGCTGGAAGCCGGGCGCCGAGCCGCCGGGCCCGTACACCAGCGCATGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1458:NM_022658:2057:187
+TACTTGGACCAGGAACAGGGCTGTCGGGACACAAAATCTACATTCATAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1459:NM_014620:342:205
+GGCTCTTCCTCCTGCCCCCTTCTTGCAACTCTCCTTAATTTTGTTTGGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1460:NM_022658:297:175
+ACGGGCCCGGCGGCTCGGCGCCCGGCTTCCAGCACGCTTCGCACCACGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1461:NM_173860:183:196
+AATGGCTACCCGCAGCCCTACCTCGGCAGCCCAGTGTCTCTCAACCCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1462:NM_001168316:625:194
+CCCTGGCATGAGCAGTACCTGCTCGACGTTTTTGTGTTTCTGCTGGGGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1463:NM_153633:1216:214
+AAAGAAAAAAGGAAAGAAATTTTAAAGCCAATTCTCATCCTTCTCCTCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1464:NM_001168316:80:160
+ACCTTGCATATTCTTTCAGTTTCTGTTTTGTTCTCCCACATATTCTCTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1465:NM_018953:1400:169
+CAGGAAGGACCCAGAGTCAATAAATAGTTGGACAACAGCAATGGGTCAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1466:NM_174914:1867:186
+TAAAAAGGAAGAAAAATCATATCAAGTTATCAGTTGGCTTGCACCTGAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1467:NM_022658:1189:174
+TACACTAGCCTTAGCATAAAAACAAAACCACAAGTCCTTTTCTGCATTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1468:NM_022658:99:180
+GGGGAGGGGAGTTTCGGGGGTACTGGGCGGGGTACTCGTGAGCCAGAGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1469:NM_014620:545:178
+CAGCAGCGCTCGCGGGGGCTCAACCCCCAGACCTCCAGAAATGACGTCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1470:NM_174914:1174:183
+TGAGCCAGGAGGTCACTCTGAGGAAGCCAGTCCACAATTTTCACATTTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1471:NM_014620:1590:179
+TCTCTCTTCCTCTCACCTTGTCCCTTGTCAGTTCCAAACAGACAAAACAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1472:NM_022658:957:184
+AACTTTTCACTGTTTCTCCGTCTCCCCCCTCCAGCCCCCAAACAAATAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1473:NM_174914:1892:176
+TTTTATGCCAGATTTTAAAAAGGAAGAAAAATCATATCAAGTTATCAGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1474:NM_022658:2048:132
+AATGACAAAAAATTATTATTATAGATATATTTTTAACATTTTTTTCTTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1475:NM_022658:1169:194
+TACACTAGCCTTAGCATAAAAACAAAACCACAAGTCCTTTTCTGCATTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1476:NM_017410:1611:176
+ACCTGGCCCCAGGAAATGCAGTTTCTTGGTTGGGATGGAGTGTAGGGGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1477:NM_174914:1467:208
+AAGCAGAGGTCGAGCAAAATCAAAGGCAAAGTCAGAGTTAATGAACCACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1478:NM_173860:316:176
+CTGGCAGGAGGGCGGGTCGTGCGGAGGTCCTGCGCCGCCGCCGCCGTCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1479:NM_022658:939:173
+TCCAGCCCCCAAACAAATAAAGAGTGGGGGAAGTCCAAAGGTAATAAAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1480:NM_004503:1345:185
+TTGTAATTTTCCCTCTTTTTTTTCCTTTTTTGAAATTGGATAGGAACACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1481:NM_001168316:425:166
+GTCCTTCTAGTTATCTCCTGTTTTCTTGAAGAACAGGAAAAATGGCCAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1482:NM_022658:557:174
+GGCCACTTAAATCAAAACTCGTCTCCCAGCCTCATGTTTCCATGGATGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1483:NM_014620:1638:177
+ATCACACCTTGCAATATATAATTTTTGCAGCTTTTTTTCTTAAAAAATAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1484:NM_173860:424:112
+TTGCCCTCGTTGAGCAGGGACGAACTGGAGTCGGATTCCAGCGACTGGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1485:NM_022658:370:208
+CTCCGGCATCTCCAACTCAGGCTACCAGCAGAACCCGTGCTCGCTTAGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1486:NM_022658:1474:177
+GCATGGGCCCGAGTGACCATGGGATGGTTAGGTAGGATTTTAGAGGCGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1487:NM_022658:596:159
+TTGTCTCTCGGTCAGTCCCAGGGCATGAGAGACTTCAATCCGACGTTTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1488:NM_014620:365:166
+TCCCTCTCTGCCTCTCTCTCTCCCACTCTCTTTCTCGTCTTCCCTCATTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1489:NM_174914:2123:189
+TTAGCCGGGCGCAGGGCGCGCAGCCCAGGCTGAGATCCGCGGCTTCCGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1490:NM_004503:418:139
+GATTTTAGTTCTGAGCAGGGCAGGACTGCGCCCCAGGACCAGAAAGCCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1491:NM_174914:2085:178
+AGAAGTGAGCATGGCTGGGCAGCGAGTGCTTCTTCTAGTGGGCTTCCTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1492:NM_022658:1953:143
+GTTAACTATACATTCAGTGCAATTTAGTTCTACTCTACTGGGGTTAGAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1493:NM_022658:138:172
+CCGCCGGGCCCGTACACCAGCGCATGGCTCCTGCCCACGCTCTGAGGGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1494:NM_022658:1483:163
+CCAGGGCTCCCTGCTTAGAAAAACCCCCTTGACTTTCTCTAGGAACCTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1495:NM_022658:1800:198
+GAAAAAGAAAAAGAGAAAAATTTTAAAATCCTGCTATAGGAGAAAAAAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1496:NM_022658:721:179
+AGTCTCTCATGCCCTGGGACTGACCGAGAGACAAGTGAAGATCTGGTTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1497:NM_173860:140:217
+CGACAACGTGTGCTCCCTGTCCTGGCCGTCGGCGGAGCCGTGCAATGGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1498:NM_006897:1012:121
+GAGAACGCAGTTTCTCTCCCCGCCTCCTCCTCGCTGGGTAGAACTAACTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1499:NM_006897:273:192
+GTAGGCGTCCGGCTTGAGGGCGTAGTGACGGCCCCCGGCCGGGAAGCTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1500:NM_006897:510:160
+CCGGACTACATGTACGGCTCGCCCGGGGAGCTGCGCGACCGCGCCCCGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1501:NM_022658:85:112
+GGGTTCGGTCCCGGGGGGAGGGGAGTTTCGGGGGTACTGGGCGGGGTACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1502:NM_022658:369:176
+CCTCCGGCATCTCCAACTCAGGCTACCAGCAGAACCCGTGCTCGCTTAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1503:NM_173860:415:193
+CTGGCCGAGAGCCCGCCGCCGGGGTTCAACGGCGATACCAAGCTGCCGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1504:NM_022658:1955:182
+TTCTTTCGAGCACATTGCATAAACAGAGAATTCAAGACAGAGTTAACTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1505:NM_174914:436:187
+TGATGGCAAACAAAGGAGGACAAGAGGACTGGAAAGAATTCTGCTAGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1506:NM_022658:312:156
+GTCTGGGGAGCGCCTCGTAGCCATAGAATTTGGAGGCGTCTCCGTGGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1507:NM_022658:1548:186
+GTGATTTCTGAGCACTAACACTAATGCAGCTCAGAGGAAGGCGGGCCCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1508:NM_173860:187:163
+GCTACCCGCAGCCCTACCTCGGCAGCCCAGTGTCTCTCAACCCTCCCTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1509:NM_022658:1704:196
+CTGGAGGTTTCTTTCTTTCTTTTTTTTTTTTTTGATTTTTATTTTTTTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1510:NM_014620:570:211
+CCCAGACCTCCAGAAATGACGTCAGAATCATTTGCATCCCGCTGCCTCTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1511:NM_022658:5:174
+GCTCAGCACCGAGGCGCCCCCCAACCTGCCCAGCCCCCAGCCCACCAGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1512:NM_022658:236:203
+GAACCGGCCTATTACGACTGCCGGTTCCCTCAGAGCGTGGGCAGGAGCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1513:NM_022658:706:201
+AAAACGTCGGATTGAAGTCTCTCATGCCCTGGGACTGACCGAGAGACAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1514:NM_022658:36:173
+AGCCCCCAGCCCACCAGCCCAGCCCAGTCCCGGGGAGCCAGCTGGCCTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1515:NM_174914:843:186
+GTGCGTCGCGCCCCCTGTCTGGAGGACGTGGTCAATCCAGCCCACCAGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1516:NM_004503:1420:186
+GTGTGAAGATTTTTAGCTGTATTTGTGGTCTCTGTATTTATATTTATGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1517:NM_014620:1210:174
+AGGGTGCTGGGCGCAGCGCCGGCCGGGGGTGCTGACCTGACTTTGGTGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1518:NM_022658:1952:203
+TATATTTTTAACATTTTTTTCTTTCGAGCACATTGCATAAACAGAGAATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1519:NM_001168316:1888:188
+CTGCACTGCAACGCCAAGTATTCTAGAACATTTAATAAGTTTTCAAATTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1520:NM_022658:1194:153
+TTCTGAGTCCTTCCTGGATTTTAAGGTCTGAGACCTGGCCTCCGTGCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1521:NM_173860:168:195
+CCCGGGCCCGGCTCCCGGGTCGCGCCCGCGCTCCTCACGCTTCAGGCCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1522:NM_174914:1760:190
+GGTGGCAGAGGAAAATTTGAAAACTTATTAAATGTTCTAGAATACTTGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1523:NR_031764:1367:172
+TCCTTTTATGCCAGATTTTAAAAAGGAAGAAAAATCATATCAAGTTATCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1524:NM_006897:463:167
+ACCCCGGGCGCCGCGCGGACTGCGGCCCAGGGGAGGGCCGCAGCTACCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1525:NM_022658:1894:174
+CTCCAGCGTATTTTATCACTACCTATAGAAAGAAATCCTGCTTTGAGAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1526:NM_018953:440:172
+GGCGCAGACAGGGCAGCCCGCCGGACTGAGCCAGCCACCGGCCCCGCCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1527:NM_004503:917:154
+TGTGTTTTGATTCCCTAAAACAAAATTAGGGAGTCAAACGTGGACCTGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1528:NM_174914:1950:217
+TACAGTAGGTGGAAGCCATTATCTACTGATGGACCGGGTTTCTCAGATTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1529:NM_022658:952:185
+TTTCACTGTTTCTCCGTCTCCCCCCTCCAGCCCCCAAACAAATAAAGAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1530:NM_022658:33:155
+CCCAGCCCCCAGCCCACCAGCCCAGCCCAGTCCCGGGGAGCCAGCTGGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1531:NM_001168316:1098:173
+CATGGGCACACCATGCTGGATGGCCTCCATTATGCTATTCTGCCCGCCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1532:NM_173860:574:153
+GCTGGCGTGTGATGAACTCGTTGACCAGAAACTCGCCCTCCAGCTCTGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1533:NM_006897:303:181
+AGTCCGCGCGGCGCCCGGGGTAGGCGTCCGGCTTGAGGGCGTAGTGACGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1534:NM_017409:1215:121
+TGAGTATAAATGCAATGCGACTGCAAAAAAGGCAAAGACCTCAGACTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1535:NM_018953:1272:161
+TAGTTGAGCTAGCTAGCAGGCTGGGGCTGCCGGCCTGAGAGGGCATGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1536:NM_022658:812:197
+CTATAAAAGCAAATGACAGTCGTAAACTTCTCAATTTATCTGCTACCATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1537:NM_022658:844:144
+GTAAACTTCTCAATTTATCTGCTACCATAAAACGAAACTTCAAGGGAGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1538:NM_022658:122:168
+CGCATGGCTCCTGCCCACGCTCTGAGGGAACCGGCAGTCGTAATAGGCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1539:NM_022658:1521:199
+CTAACACTAATGCAGCTCAGAGGAAGGCGGGCCCAACAGAATAGAAATCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1540:NM_174914:555:192
+CTGTTCTTCAAGAAAACAGGAGATAACTAGAAGGACTAGAGAATGGGGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1541:NM_018953:119:192
+GCGGCGCTGCAGGCGGGGCGGTCGGGGTGAGCCCGGGGGTTGGCAGCCAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1542:NM_173860:169:160
+TCACGCTTCAGGCCCCCGCCGCCACCCTCGGCGCACGGCTCGCGGTAGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1543:NM_022658:1918:182
+CAGAGTTAACTATACATTCAGTGCAATTTAGTTCTACTCTACTGGGGTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1544:NM_174914:1690:114
+CGGAATACTGGAACATAAGACAAGGGGATTGGTAGCCCAAATTCCAAAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1545:NM_014620:1739:195
+GCAAAAGGCCTAAGGAAAGAGGGGGGGAAGGAGGAGGAGGAGAAGGATGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1546:NM_018953:70:169
+CCGCCATGAGCTCCTACGTAGCCAATTCATTCTATAAGCAGAGCCCCAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1547:NM_006897:24:193
+TTGTTCTGTGAGCAGATAAAAAGTACATATACAGTTCATACAATAATCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1548:NM_022658:1257:172
+ACATTTGTCTTCCTTTCCTTTCTTCATTTTTTTCTGTCCTTTCCTTTTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1549:NM_173860:626:202
+GATCAACAGCCGCTCTCGGAAGAAGCGCAAGCCCTATTCGAAGTTGCAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1550:NM_006897:1144:194
+TTATCATGTATGTGTGTGTGTCTTTTTTTTTTTTGTACAAAATCTGCACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1551:NM_022658:941:137
+CCAAAGGTAATAAAACCAGAGCTGCAAGTATCTGACAGGTAGTTAGAGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1552:NM_014620:324:87
+ATAATTATAATCATCCAAAAGCCAAACAAAATTAAGGAGAGTTGCAAGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1553:NM_022658:261:165
+TCCCTCAGAGCGTGGGCAGGAGCCATGCGCTGGTGTACGGGCCCGGCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1554:NM_018953:937:167
+CCTTAACTCGGGAGGGCCGCGCTGAGGCTGGGAGCCGGAGATACGGCCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1555:NM_173860:274:202
+TCGTGCGGAGGTCCTGCGCCGCCGCCGCCGTCGCCACCGCCGCCGCCCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1556:NM_022658:201:183
+TGGAGATGCCGGAGGTGCCGTGGTGGAAGAAGTCTTGAACGTGGTGCGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1557:NM_022658:4:194
+AGCTCAGCACCGAGGCGCCCCCCAACCTGCCCAGCCCCCAGCCCACCAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1558:NM_173860:173:186
+GGCCCGGCTCCCGGGTCGCGCCCGCGCTCCTCACGCTTCAGGCCCCCGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1559:NM_174914:259:190
+CCATGATAGATAGTAGGGGCAGGAGTGAGAGAGGCTGACTAGGTCTGGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1560:NM_022658:1380:164
+AAAAAGGAAAGGACAGAAAAAAATGAAGAAAGGAAAGGAAGACAAATGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1561:NM_022658:428:188
+GACGCCTCCAAATTCTATGGCTACGAGGCGCTCCCCAGACAGTCCCTTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1562:NM_173860:24:195
+CCCGGGTTTGTGGGGCCGCTGGTAAACATCCACACGGGAGACACCTTCTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1563:NM_006897:877:177
+TCCCAAATCGCAAGAGTTTTCTTTTCCCCTTCCTTGTTTTTCTTTTTAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1564:NM_022658:600:212
+ATCCTTGTTGTTCTCCTTTTTCCACTTCATCCTTCGGTTCTGGAACCAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1565:NM_014212:200:180
+GCTGTTCCGATGGTGCCACTTGCCGGATGGCTCCAGGCCGTAGGAGACCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1566:NM_022658:752:173
+CAAGTGAAGATCTGGTTCCAGAACCGAAGGATGAAGTGGAAAAAGGAGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1567:NM_022658:268:158
+GAGCGTGGGCAGGAGCCATGCGCTGGTGTACGGGCCCGGCGGCTCGGCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1568:NM_022658:797:189
+AAACTTCTCAATTTATCTGCTACCATAAAACGAAACTTCAAGGGAGTTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1569:NM_022658:1584:188
+TATGTTAAAGATTTATTATTATTATTTTCGTGATTATGGTGATTTCTGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1570:NM_022658:1557:204
+CTTTCCCCTCCCCCCATTTCCAGAAGGGTAGATAGGAGCCTGCAGTCGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1571:NM_022658:324:180
+CCACGCTCGCCTCTTGCTGAGCCCCATAAAGGGACTGTCTGGGGAGCGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1572:NM_022658:221:195
+GCCGGCGAGTCCCTGGAACCGGCCTATTACGACTGCCGGTTCCCTCAGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1573:NR_031764:1362:215
+AAGGACAAAACCAGAGTCCCCAAACTTGGCAATGAAGTTCTCCAAGTCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1574:NM_022658:1032:200
+CCAGGTCTCAGACCTTAAAATCCAGGAAGGACTCAGAAGGGTGGGGGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1575:NM_022658:1317:173
+GCCCTGGGGAGGGGGAGGGGGAGGGGGAGGGGATATTCCTTGCTTTTTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1576:NM_022658:1658:164
+AATTTTTCTCTTTTTCTTTTTCAAGATTATTGCAGGTTCCCTTTAGGTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1577:NM_174914:235:162
+AAGGTGTCTTTCTTGGATGTTATTCCATGATAGATAGTAGGGGCAGGAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1578:NM_173860:541:147
+CCAGCTCTGCCAGTTGCAACTTCGAATAGGGCTTGCGCTTCTTCCGAGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1579:NM_022658:629:194
+CCCGGCAGTTTATCCTTGTTGTTCTCCTTTTTCCACTTCATCCTTCGGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1580:NM_022658:51:208
+CGGCAGTCGTAATAGGCCGGTTCCAGGGACTCGCCGGCTTTGTATTTGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1581:NM_022658:1793:152
+TACTCTCAAAGCAGGATTTCTTTCTATAGGTAGTGATAAAATACGCTGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1582:NM_022658:545:158
+AGCGAAGGACAAGGCCACTTAAATCAAAACTCGTCTCCCAGCCTCATGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1583:NM_022658:1480:220
+AGGAAGGCGGGCCCAACAGAATAGAAATCAAACAGCGAAGGAGAGGAAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1584:NM_174914:688:166
+GCGCGACGCACCTCAAGCCCTATGTCTTTCAGCAGCCCTGGCATGAGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1585:NM_004503:931:198
+CTAAAACAAAATTAGGGAGTCAAACGTGGACCTGAAAGTCAGCTCTGGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1586:NM_173860:127:174
+CCTACCCACGCCGCGACAACGTGTGCTCCCTGTCCTGGCCGTCGGCGGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1587:NM_014620:759:167
+GCTACATCCCTGAACACAGTCCGGAATATTACGGCCGGACCAGGGAATCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1588:NM_022658:1848:175
+GCGGGCTAGGCAGTCTCAGTTGTTGGGTTTTCTTAGTGAAATAAGCAGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1589:NM_022658:1571:184
+ATTATTATTTTCGTGATTATGGTGATTTCTGAGCACTAACACTAATGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1590:NM_022658:1968:197
+TTTGTTGCTGCTTATTTCACTAAGAAAACCCAACAACTGAGACTGCCTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1591:NM_006897:1339:189
+ACTTCAATATATTAACACAGGGCTGTTCTACCATAACAAACAGAAGCACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1592:NM_173860:311:169
+CGGGGGCCTGAAGCGTGAGGAGCGCGGGCGCGACCCGGGAGCCGGGCCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1593:NM_022658:1595:195
+CAGGTTCCCTTTAGGTAGTATGTTAAAGATTTATTATTATTATTTTCGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1594:NM_014620:1414:201
+CCACTCCCAGAGCGCCACGCCGCCGGAGCAGCAACGGGCAGAGGACATTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1595:NM_014620:823:169
+CCACCAGGAGCTGTACCCACCACCGCCTCCGCGCCCTAGCTACCCTGAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1596:NM_173860:636:191
+TCCCTCAACAGAAGTCTTTTCTTTTTCATTCTCCGGTTCTGAAACCAGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1597:NM_022658:1728:126
+TTCTCTTTTTTTCTCCTATAGCAGGATTTTAAAATTTTTCTCTTTTTCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1598:NM_174914:223:166
+GAAAGAATATGCAAGGTGTCTTTCTTGGATGTTATTCCATGATAGATAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1599:NM_022658:1863:165
+GACCGGCGGGCTAGGCAGTCTCAGTTGTTGGGTTTTCTTAGTGAAATAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1600:NM_014620:1598:179
+CCTCTCACCTTGTCCCTTGTCAGTTCCAAACAGACAAAACAGATAAACAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1601:NM_022658:2091:182
+TTATTATGACTCACGTATACAATACAAAGTACTTGGACCAGGAACAGGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1602:NM_022658:936:173
+AGCCCCCAAACAAATAAAGAGTGGGGGAAGTCCAAAGGTAATAAAACCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1603:NM_014212:1446:176
+GAGAACAACTAGGCTCGGGCGGGGCCTTGGCGAAGACGGAGGTAGGACAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1604:NM_022658:1936:180
+AACAGAGAATTCAAGACAGAGTTAACTATACATTCAGTGCAATTTAGTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1605:NM_004503:376:142
+CGACCCCACTGTGCGAATTCATTCGCTGCATCCAGGGGTAAATCTGGATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1606:NM_022658:1530:154
+CAGAATAGAAATCAAACAGCGAAGGAGAGGAAGGCATGGGCCCGAGTGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1607:NM_174914:206:180
+AGAACAAAACAGAAACTGAAAGAATATGCAAGGTGTCTTTCTTGGATGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1608:NM_173860:158:169
+GTCCTGGCCGTCGGCGGAGCCGTGCAATGGCTACCCGCAGCCCTACCTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1609:NM_174914:27:192
+GTAAACTTTTATTTTTCAGGAAATCTGGAAACCTACAGTCTCCAAGCCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1610:NM_022658:646:193
+CTCCTCATCTCGGGCTCCCGGCAGTTTATCCTTGTTGTTCTCCTTTTTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1611:NM_022658:1778:175
+AAAGGGAACCTGCAATAATCTTGAAAAAGAAAAAGAGAAAAATTTTAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1612:NM_022658:380:161
+TCCAACTCAGGCTACCAGCAGAACCCGTGCTCGCTTAGCTGCCACGGAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1613:NM_004503:915:204
+TGTAGAGTCTGAGTTCAGGGTCCGAGCCCCCAAGGCCTGGACGGGGAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1614:NM_174914:1849:176
+ATCAGTTGGCTTGCACCTGAAGATCATCAAAGAGAATTTAAAAAGAGTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1615:NM_174914:1380:170
+CCCAAACTTGGCAATGAAGTTCTCCAAGTCTTGTGGTACTGGTTTAATAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1616:NM_174914:433:178
+TGCTGATGGCAAACAAAGGAGGACAAGAGGACTGGAAAGAATTCTGCTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1617:NM_022658:748:184
+GAGACAAGTGAAGATCTGGTTCCAGAACCGAAGGATGAAGTGGAAAAAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1618:NM_022658:514:162
+TTTTCTAGTTCCAAGGTCTGATACCGGCTGTAAGTTTGCCGTCCACTGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1619:NM_022658:2015:167
+TAGCCCGCCGGTCCTGTGCGCTTTTATTGTGCTTCTAACCCCAGTAGAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1620:NM_022658:1573:177
+TATTTTCGTGATTATGGTGATTTCTGAGCACTAACACTAATGCAGCTCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1621:NM_006897:133:188
+ACTCGCTCATCTCTCACGACAATGAAGACCTCCTAGCGTCCAGGTTTCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1622:NM_022658:617:189
+CCGGGGAGGCGCAGTGGACGGCAAACTTACAGCCGGTATCAGACCTTGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1623:NM_022658:581:203
+CCCAGCCTCATGTTTCCATGGATGAGACCCCACGCTCCGGGGAGGCGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1624:NM_022658:40:169
+GAACAGGGGGTTGACGAAGTAGGAGCTCATGCTGGGTACATGAAAACCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1625:NM_022658:204:194
+TGTTCTCCAAATACAAAGCCGGCGAGTCCCTGGAACCGGCCTATTACGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1626:NM_022658:1754:200
+CATTACAAATACTCTCAAAGCAGGATTTCTTTCTATAGGTAGTGATAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1627:NM_022658:1060:165
+TCAGACCTTAAAATCCAGGAAGGACTCAGAAGGGTGGGGGCAGGGACAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1628:NM_174914:1228:190
+TACCACAAGACTTGGAGAACTTCATTGCCAAGTTTGGGGACTCTGGTTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1629:NM_022658:1580:203
+AAGGGTAGATAGGAGCCTGCAGTCGCCTCTAAAATCCTACCTAACCATCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1630:NM_022658:1049:211
+ACTTGCAGCTCTGGTTTTATTACCTTTGGACTTCCCCCACTCTTTATTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1631:NM_173860:58:165
+GAGACACTGGGCTGCCGAGGTAGGGCTGCGGGTAGCCATTGCACGGCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1632:NM_022658:1035:180
+AAATCCAGGAAGGACTCAGAAGGGTGGGGGCAGGGACAAGTGTGTGTGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1633:NM_022658:493:188
+GGCGAGCGTGGTGCAATATCCCGACTGTAAATCCTCCGCCAACACTAACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1634:NM_006897:377:164
+GCTCCCCGGGCGAGCCGTACATGTAGTCCGGGTAGCTGCGGCCCTCCCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1635:NM_022658:1822:187
+CTCAGTTGTTGGGTTTTCTTAGTGAAATAAGCAGCAACAAACGACAACAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1636:NM_022658:1332:166
+GTGGTTTTGTTTTTATGCTAAGGCTAGTGTACTAGATGTACTTTTTCTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1637:NM_004503:221:182
+TCTCGACCTATGGAGCGGCCGTTGCCCAGAACCGGATCTACTCGACTCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1638:NM_006897:596:189
+TTGAGAACCCGGGCCACCTCATACCGACGGTCCCTGGTTAAATACATATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1639:NM_006897:628:164
+ACCCCAGCAACCCCGTGGCCAACTGGATTCACGCCCGCTCCACGAGGAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1640:NM_174914:2246:136
+CTGGCAGGATCCTTACTCCTACCTCTACCCACAGCCAGTGCCTTTGGCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1641:NM_006897:719:180
+GGCAGCAGGCTGGGTAGGGTTTAGGACTGCTCCTTGTCGGTTTTCTCTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1642:NM_022658:1643:165
+TCTTTTTCAAGATTATTGCAGGTTCCCTTTAGGTAGTATGTTAAAGATTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1643:NM_014212:910:208
+GTCCCGGATGCTGAACCTGACGGACCGACAAGTGAAAATTTGGTTTCAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1644:NM_004503:991:165
+ACCGCACAACTCTCTTTCACCACGCGCCTCCTCCTCCTCGCTCCCTTGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1645:NM_022658:1108:180
+ACCAGAGAAGCAGGGAGGTGGGAGTGTGGTGAGAGACAGACCGAGGAGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1646:NM_022658:1364:171
+TAGATGTACTTTTTCTAAAAAGGAAAGGACAGAAAAAAATGAAGAAAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1647:NM_022658:1891:186
+CAATTTAGTTCTACTCTACTGGGGTTAGAAGCACAATAAAAGCGCACAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1648:NM_022658:817:193
+GCCGGGAGCCCGAGATGAGGAGAAGGTGGAGGAAGAAGGAAATGAGGAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1649:NM_018953:1152:170
+GAAAGCATAGAGCAACTGTGGGGGCCCTAGGCCGATGCTCTCCTTTCATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1650:NM_022658:855:204
+GAAATGAGGAAGAGGAGAAAGAAGAGGAGGAAAAGGAAGAAAACAAGGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1651:NM_022658:1561:192
+TATTATTTTCGTGATTATGGTGATTTCTGAGCACTAACACTAATGCAGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1652:NM_006897:119:192
+TGAGAGGGCACGGGCGCCCACGACGTGCTGAACACTGCCGGCTTGGGCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1653:NR_031764:841:168
+CAAGGCAGAGACATTGGCTCTTAAGATGAAACAAATCATGGAAGACAAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1654:NM_174914:11:192
+GGGGAGAGATAACGCTGTAAACTTTTATTTTTCAGGAAATCTGGAAACCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1655:NR_031764:577:185
+ATAACTAGAAGGACTAGAGAATGGGGCTGCCAGAACTAGTGGGAAGCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1656:NM_022658:289:192
+CCATAAAGGGACTGTCTGGGGAGCGCCTCGTAGCCATAGAATTTGGAGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1657:NM_153633:1162:167
+ATATATTGCAAGGTGTGATGGTCTGGCTTGGGTGAATTTCAGGGGAAATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1658:NM_174914:401:191
+AGTCCTTCTAGTTATCTCCTGTTTTCTTGAAGAACAGGAAAAATGGCCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1659:NM_022658:1861:167
+GACCGGCGGGCTAGGCAGTCTCAGTTGTTGGGTTTTCTTAGTGAAATAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1660:NM_173860:230:175
+TCCCTTCGGCCGCACGTGCGAGCTGGCGCGCGTGGAGGACGGCAAGGGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1661:NM_022658:1091:199
+TTTATTTGTTTGGGGGCTGGAGGGGGGAGACGGAGAAACAGTGAAAAGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1662:NM_022658:370:173
+CTCCGGCATCTCCAACTCAGGCTACCAGCAGAACCCGTGCTCGCTTAGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1663:NM_014620:1600:194
+TCTCACCTTGTCCCTTGTCAGTTCCAAACAGACAAAACAGATAAACAAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1664:NM_017410:1116:193
+GGGGGTGGAGGCTGGGGATGGGATAGGGAGTTGGGGATGGCCCAGCAGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1665:NM_022658:165:178
+TGGTGCGAAGCGTGCTGGAAGCCGGGCGCCGAGCCGCCGGGCCCGTACAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1666:NM_174914:1790:184
+CAATCAGGAAAGGACAGTAGTCAAAAGTTTCAACTATCACCATGTCGAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1667:NM_022658:773:198
+AACCGAAGGATGAAGTGGAAAAAGGAGAACAACAAGGATAAACTGCCGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1668:NM_022658:2035:185
+CTTTTATTGTGCTTCTAACCCCAGTAGAGTAGAACTAAATTGCACTGAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1669:NM_022658:1574:189
+GATTTATTATTATTATTTTCGTGATTATGGTGATTTCTGAGCACTAACAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1670:NM_174914:93:191
+CTCCTGCCCCTACTATCTATCATGGAATAACATCCAAGAAAGACACCTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1671:NM_022658:570:156
+AGACTTCAATCCGACGTTTTCGTGTCAAATAAGGATTAAAGAGAAACTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1672:NM_022658:1542:195
+GAAGGAGATGTGGGTCTTTCCCCTCCCCCCATTTCCAGAAGGGTAGATAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1673:NM_022658:1424:188
+TTAGAGGCGACTGCAGGCTCCTATCTACCCTTCTGGAAATGGGGGGAGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1674:NM_173860:590:142
+CCGGCGCTGGCGTGTGATGAACTCGTTGACCAGAAACTCGCCCTCCAGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1675:NM_022658:1378:189
+GAGGGGAAAGACCCACATCTCCTTCAGGTTTCCATCAGGTTCCTAGAGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1676:NM_004503:1271:205
+GAGGGCGCGCCTTGGCCCCACACCAACCCCCAGGGCCTCCCCGCAGTCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1677:NM_174914:450:168
+CACTAGTTCTGGCAGCCCCATTCTCTAGTCCTTCTAGTTATCTCCTGTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1678:NM_006897:586:184
+ACCTCATACCGACGGTCCCTGGTTAAATACATATTGAAGAGAAACTCCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1679:NM_173860:291:197
+CAGGAGGGCGGGTCGTGCGGAGGTCCTGCGCCGCCGCCGCCGTCGCCACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1680:NM_022658:989:201
+ACTGTCATTTGCTTTTATAGAGAATAGAATGACACTCACAACTCTAACTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1681:NM_022658:1026:190
+ACAACTCTAACTACCTGTCAGATACTTGCAGCTCTGGTTTTATTACCTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1682:NM_022658:371:157
+TCCGGCATCTCCAACTCAGGCTACCAGCAGAACCCGTGCTCGCTTAGCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1683:NM_006897:1121:166
+AACTGCGTTCTCTTTCCCCAGCGCAACCGAAATAAATGACACATACAAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1684:NM_022658:1689:162
+TCTTTTTTTCTCCTATAGCAGGATTTTAAAATTTTTCTCTTTTTCTTTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1685:NM_006897:891:177
+CTGCTGCCTCAGCACAGCCAAGGGAAAAACAAAAACCCCACAAAATACCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1686:NM_022658:592:194
+TCATCCTTCGGTTCTGGAACCAGATCTTCACTTGTCTCTCGGTCAGTCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1687:NM_022658:443:164
+CTCATCCATGGAAACATGAGGCTGGGAGACGAGTTTTGATTTAAGTGGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1688:NM_022658:944:141
+CTTGAAGTTTCGTTTTATGGTAGCAGATAAATTGAGAAGTTTACGACTGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1689:NM_001168316:684:168
+GCGACGCACCTCAAGCCCTATGTCTTTCAGCAGCCCTGGCATGAGCAGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1690:NM_018953:1291:145
+CACTAGTTGAGCTAGCTAGCAGGCTGGGGCTGCCGGCCTGAGAGGGCATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1691:NM_022658:1936:159
+TTGAGAGTATTTGTAATGCGGTTTTGTTGTCGTTTGTTGCTGCTTATTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1692:NM_001168316:380:172
+ATCTGAGGGTCAGTGGTCCAAGTCACTCAGAGACAGAATCACAGCATAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1693:NM_022658:1605:195
+CCTCTAAAATCCTACCTAACCATCCCATGGTCACTCGGGCCCATGCCTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1694:NM_174914:1997:178
+ACAATATCTACAGTAGGTGGAAGCCATTATCTACTGATGGACCGGGTTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1695:NR_031764:1134:171
+ATTCTGCCCGCCGTGGGTGACAAACAGACGGATGCTTGGGTGAGCCAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1696:NM_174914:1564:165
+GTGAAATGTTCCTTGATGGTGTTGTCAAATGTAGACTGCATGTGCTGTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1697:NM_022658:46:180
+CCGGCTTTGTATTTGGAGAACAGGGGGTTGACGAAGTAGGAGCTCATGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1698:NM_022658:300:173
+GGACTGTCTGGGGAGCGCCTCGTAGCCATAGAATTTGGAGGCGTCTCCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1699:NM_022658:496:182
+CCTTTTCTAGTTCCAAGGTCTGATACCGGCTGTAAGTTTGCCGTCCACTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1700:NM_173860:77:161
+CGAAGGGAGGGTTGAGAGACACTGGGCTGCCGAGGTAGGGCTGCGGGTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1701:NM_022658:1246:151
+GGTCTGTCTCTCACCACACTCCCACCTCCCTGCTTCTCTGGTATTTATTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1702:NM_153693:1477:190
+CCCTCCTTGGGCCTCCGGCCCTCCCCGGCTGCCAGGCCGGGCCCTGAGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1703:NM_006897:378:187
+ACTTGGCTCGAGCCGCTGTCCGGCGCCGTCTCCTTCCCCAGCTTCCCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1704:NM_173860:480:173
+CCCTCCTGCCAGTCGCTGGAATCCGACTCCAGTTCGTCCCTGCTCAACGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1705:NM_022658:412:137
+CGCTACTGTTAGTGTTGGCGGAGGATTTACAGTCGGGATATTGCACCACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1706:NM_022658:494:167
+GCGAGCGTGGTGCAATATCCCGACTGTAAATCCTCCGCCAACACTAACAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1707:NM_022658:181:184
+GTGGTGGAAGAAGTCTTGAACGTGGTGCGAAGCGTGCTGGAAGCCGGGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1708:NM_022658:1981:181
+ATTTCACTAAGAAAACCCAACAACTGAGACTGCCTAGCCCGCCGGTCCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1709:NM_018953:379:179
+AGGCGGCTCGCCCGGCGCTGGAGGAGCGAGCTAAGAGCAGTGGGGAGATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1710:NM_022658:195:168
+GGTGGAAGAAGTCTTGAACGTGGTGCGAAGCGTGCTGGAAGCCGGGCGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1711:NM_014212:176:187
+GATTTCGGCGAGCGAGGGAGCTGCGCCTCCAACCTCTATCTGCCCAGTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1712:NM_022658:1984:168
+TCACTAAGAAAACCCAACAACTGAGACTGCCTAGCCCGCCGGTCCTGTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1713:NM_004503:413:171
+TCTCCAGTTCCAGGGTCTGGTACCGCGAGTAGATCTGGCGGCCGCGCCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1714:NM_174914:551:183
+TGGGCATGGCTGTCTGGTGGCTGCGTGGGGCCAGAAAGGTGAAGGAGACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1715:NM_022658:1618:93
+ATGCAGCTCAGAGGAAGGCGGGCCCAACAGAATAGAAATCAAACAGCGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1716:NM_006897:29:170
+GATGAGCCCCGGTGGCCGGAAACCTGGACGCTAGGAGGTCTTCATTGTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1717:NM_022658:335:179
+TCGCACCACGTTCAAGACTTCTTCCACCACGGCACCTCCGGCATCTCCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1718:NM_174914:286:179
+AGAGAGGCTGACTAGGTCTGGACATGGAGGCTGGAAGAGTCAGGGTGTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1719:NM_018953:725:184
+AAGCAAAGAGGCTCTTTAGAGGCAGCGGGGGAGGCCCGCAGAGCGCGCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1720:NM_022658:239:191
+TCTCCGTGGCAGCTAAGCGAGCACGGGTTCTGCTGGTAGCCTGAGTTGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1721:NM_022658:254:161
+AGCGAGCACGGGTTCTGCTGGTAGCCTGAGTTGGAGATGCCGGAGGTGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1722:NM_017409:661:213
+ATCGCCTCAGCTGGGGGGCAAAGTGAGTTTCCCTGAGACCCCCAAGTCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1723:NM_006897:962:179
+GAAAAAGAAAAGGAAAGAGCAAGATAGACAAAAGCCAATCAGCTTAAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1724:NM_022658:379:170
+CGCTACTGTTAGTGTTGGCGGAGGATTTACAGTCGGGATATTGCACCACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1725:NM_022658:2020:203
+TGTCGGGACACAAAATCTACATTCATAGCTGGACATAAAGACAAATGACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1726:NM_004503:1443:158
+GAAGGGATTTATTTATTTATTTATTTTCTCCTACTGGCTAAACAAACGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1727:NM_174914:1148:162
+GGGTGACAAACAGACGGATGCTTGGGTGAGCCAGGAGGTCACTCTGAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1728:NM_022658:1480:181
+GGAGAGGAAGGCATGGGCCCGAGTGACCATGGGATGGTTAGGTAGGATTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1729:NM_022658:1821:162
+TTTAAAATCCTGCTATAGGAGAAAAAAAGAGAAAAAAATAAAAATCAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1730:NM_006897:1008:181
+AAAAGAAAAACAAGGAAGGGGAAAAGAAAACTCTTGCGATTTGGGAGGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1731:NM_022658:1741:204
+TACTCTCAAAGCAGGATTTCTTTCTATAGGTAGTGATAAAATACGCTGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1732:NM_014620:1969:205
+GGGGTGGGGAGAGATTCTACCTATAGACTGCCTCTCTGAACTGAAAGTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1733:NM_022658:897:175
+GTAATAAAACCAGAGCTGCAAGTATCTGACAGGTAGTTAGAGTTGTGAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1734:NM_006897:0:196
+GAGCCCCGGTGGCCGGAAACCTGGACGCTAGGAGGTCTTCATTGTCGTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1735:NR_031764:1075:162
+TGTCCACCTGGCTGCAAATGTGAAAATTGTGGACTGGCTTCCTCAGAGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1736:NM_022658:1144:178
+CTGCATTTCGAGGGGGCTCCCCTCTAAAATAAATACCAGAGAAGCAGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1737:NM_022658:1540:80
+CTGAAGGAGATGTGGGTCTTTCCCCTCCCCCCATTTCCAGAAGGGTAGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1738:NM_174914:1264:187
+TTGGAGGCTTGATGGAAAAACCTATTAAACCAGTACCACAAGACTTGGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1739:NM_006897:885:171
+CCCAGCCTGCTGCCTCAGCACAGCCAAGGGAAAAACAAAAACCCCACAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1740:NM_174914:255:166
+TGATTCTGTCTCTGAGTGACTTGGACCACTGACCCTCAGATTTCCAGCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1741:NM_174914:1542:172
+CAAAACTGGCCTAGAGCCTTCTGTGAAATGTTCCTTGATGGTGTTGTCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1742:NM_022658:863:196
+AGCTGCAAGTATCTGACAGGTAGTTAGAGTTGTGAGTGTCATTCTATTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1743:NM_174914:649:165
+CCAAACAGACCCCGCCAAGGCTGCACCTGGCCTTATGTCTCCTTCACCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1744:NM_022658:794:191
+AACTTCTCAATTTATCTGCTACCATAAAACGAAACTTCAAGGGAGTTGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1745:NM_173860:348:192
+GGAGCCGGGCCCGGGGCAGCGCTGCTCCCGCTGGAGCCGTCGGGGCCGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1746:NM_174914:510:176
+CATAAGGCCAGGTGCAGCCTTGGCGGGGTCTGTTTGGTGGGCGATGTCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1747:NM_006897:845:193
+TTTTCTTTTCCCCTTCCTTGTTTTTCTTTTTAAGCTGATTGGCTTTTGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1748:NM_022658:1326:195
+GGACTTGTGGTTTTGTTTTTATGCTAAGGCTAGTGTACTAGATGTACTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1749:NM_022658:51:181
+AGCCCAGCCCAGTCCCGGGGAGCCAGCTGGCCTGGGGTTCGGTCCCGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1750:NM_022658:742:108
+GACCGAGAGACAAGTGAAGATCTGGTTCCAGAACCGAAGGATGAAGTGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1751:NM_174914:1731:187
+TTCCAAAGAGCCGAATGAAGTGGAAAGAATGGCCACAAATGGCTTCCCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1752:NM_174914:1057:182
+ACCATGTTTTCAGGCTGGTCTCCAAAGAGAGGGATCCCCACCATGGGCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1753:NM_022658:1018:178
+AAGGGTGGGGGCAGGGACAAGTGTGTGTGGGGCAAGGAGTGAGACAGAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1754:NM_014620:1197:182
+AAGAGTTTCATTACAACCGCTACCTGACCCGAAGGAGAAGGATCGAGATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1755:NM_022658:1172:155
+CTTTTCTGCATTTCGAGGGGGCTCCCCTCTAAAATAAATACCAGAGAAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1756:NM_022658:419:162
+AGACGAGTTTTGATTTAAGTGGCCTTGTCCTTCGCTACTGTTAGTGTTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1757:NM_004503:939:164
+AAATTAGGGAGTCAAACGTGGACCTGAAAGTCAGCTCTGGACCCCCTCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1758:NM_022658:1228:187
+TTCCTTTCTTCATTTTTTTCTGTCCTTTCCTTTTTAGAAAAAGTACATCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1759:NM_022658:101:159
+GGAGGGGAGTTTCGGGGGTACTGGGCGGGGTACTCGTGAGCCAGAGGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1760:NM_014620:1086:188
+ACCCATGGATGAAAAAAATTCACGTTAGCACGGTGAACCCCAATTATAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1761:NM_014620:1668:156
+TCCCTCCCACTGTTAAGGACCCTTTTAAGCATGTGATGTTGTCTTAGCAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1762:NM_153633:1346:166
+GGAGAACAAAGCTATGAAGTTCTTTTGTATTATTGTTGGGGGGGGGTGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1763:NM_022658:549:159
+AAGGACAAGGCCACTTAAATCAAAACTCGTCTCCCAGCCTCATGTTTCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1764:NM_014212:900:177
+GGCTGCAGCTGTCCCGGATGCTGAACCTGACGGACCGACAAGTGAAAATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1765:NM_174914:174:170
+TCTCCGAATCACACCCTGACTCTTCCAGCCTCCATGTCCAGACCTAGTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1766:NM_022658:1990:197
+AGAAAACCCAACAACTGAGACTGCCTAGCCCGCCGGTCCTGTGCGCTTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1767:NM_022658:1573:175
+TTTCCAGAAGGGTAGATAGGAGCCTGCAGTCGCCTCTAAAATCCTACCTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1768:NM_173860:213:204
+CCAGTGTCTCTCAACCCTCCCTTCGGCCGCACGTGCGAGCTGGCGCGCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1769:NR_031764:1139:79
+GCCCGCCGTGGGTGACAAACAGACGGATGCTTGGGTGAGCCAGGAGGTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1770:NM_153633:873:199
+CATCACATGCTTAAAAGGGTCCTTAACAGTGGGAGGGAGAGGAGGGCAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1771:NM_022658:1930:181
+CCTGCTTTGAGAGTATTTGTAATGCGGTTTTGTTGTCGTTTGTTGCTGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1772:NM_022658:1466:184
+CATGGGCCCGAGTGACCATGGGATGGTTAGGTAGGATTTTAGAGGCGACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1773:NM_022658:1989:188
+GACAAAAAATTATTATTATAGATATATTTTTAACATTTTTTTCTTTCGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1774:NM_173860:233:178
+CTTCGGCCGCACGTGCGAGCTGGCGCGCGTGGAGGACGGCAAGGGTTACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1775:NM_022658:1508:179
+CAACAGAATAGAAATCAAACAGCGAAGGAGAGGAAGGCATGGGCCCGAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1776:NM_022658:1915:185
+CCTATAGAAAGAAATCCTGCTTTGAGAGTATTTGTAATGCGGTTTTGTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1777:NM_014620:307:191
+GGAGCTGCAGATGCCTCCGCCCCTCCTCTCTCCCAGGCTCTTCCTCCTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1778:NM_022658:932:211
+CGAACTTTTCACTGTTTCTCCGTCTCCCCCCTCCAGCCCCCAAACAAATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1779:NM_022658:2040:213
+AATACAAAGTACTTGGACCAGGAACAGGGCTGTCGGGACACAAAATCTAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1780:NM_022658:1495:162
+GCTTAGAAAAACCCCCTTGACTTTCTCTAGGAACCTGATGGAAACCTGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1781:NM_022658:1026:150
+ACAACTCTAACTACCTGTCAGATACTTGCAGCTCTGGTTTTATTACCTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1782:NM_022658:1250:174
+TGTCTTCCTTTCCTTTCTTCATTTTTTTCTGTCCTTTCCTTTTTAGAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1783:NM_174914:1118:198
+TGGCCTCCATTATGCTATTCTGCCCGCCGTGGGTGACAAACAGACGGATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1784:NM_006897:905:185
+CTAACTCTAAAACACCAATATCTCAACACTGAACCCTCCCAAATCGCAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1785:NM_022658:99:175
+ACGCTCTGAGGGAACCGGCAGTCGTAATAGGCCGGTTCCAGGGACTCGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1786:NM_017410:1998:171
+GGAACTGTTAGGCAGCATCTACATCTAGCTAATTGAGGGCCAGATCTTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1787:NM_022658:105:193
+TACACCAGCGCATGGCTCCTGCCCACGCTCTGAGGGAACCGGCAGTCGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1788:NR_031764:1242:185
+GGGCCAATGAGAACACTGACACTTCCATATCACCCCTTGGGGTAGGTGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1789:NM_173860:454:187
+GCGGCGCAGGACCTCCGCACGACCCGCCCTCCTGCCAGTCGCTGGAATCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1790:NM_022658:1071:189
+CCTTTGGACTTCCCCCACTCTTTATTTGTTTGGGGGCTGGAGGGGGGAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1791:NM_022658:1625:178
+TTCAAGATTATTGCAGGTTCCCTTTAGGTAGTATGTTAAAGATTTATTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1792:NM_173860:233:173
+CGAGCGCAGGCGGCCCCGACGGCTCCAGCGGGAGCAGCGCTGCCCCGGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1793:NM_006897:559:162
+TCTCCAGTTCCAGCGTCTGGTACTTGGTGTAGGGGCAGCGCTTCTTCCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1794:NM_022658:853:216
+ATAAAACCAGAGCTGCAAGTATCTGACAGGTAGTTAGAGTTGTGAGTGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1795:NM_022658:170:168
+GTACCCAGCATGAGCTCCTACTTCGTCAACCCCCTGTTCTCCAAATACAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1796:NM_001168316:1991:177
+CTTCCGTAGAAGTGAGCATGGCTGGGCAGCGAGTGCTTCTTCTAGTGGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1797:NM_022658:1099:179
+CAGGGAGGTGGGAGTGTGGTGAGAGACAGACCGAGGAGCACGGAGGCCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1798:NM_014620:1514:179
+CCTCCCCTCACACACAAATTGACTCTTATTTATAGAATTTAATATATATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1799:NM_022658:1438:165
+ACTGCAGGCTCCTATCTACCCTTCTGGAAATGGGGGGAGGGGAAAGACCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1800:NM_018953:313:170
+GGCCGGTGGCTGGCTCAGTCCGGCGGGCTGCCCTGTCTGCGCCTGCTCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1801:NM_022658:1928:175
+AGACAGAGTTAACTATACATTCAGTGCAATTTAGTTCTACTCTACTGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1802:NM_022658:468:176
+AGTCCCTTTATGGGGCTCAGCAAGAGGCGAGCGTGGTGCAATATCCCGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1803:NM_174914:1769:176
+CAGAGGAAAATTTGAAAACTTATTAAATGTTCTAGAATACTTGGCGTTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1804:NM_174914:2021:198
+TGATAACTTGATATGATTTTTCTTCCTTTTTAAAATCTGGCATAAAAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1805:NM_022658:1401:173
+AATGAAGAAAGGAAAGGAAGACAAATGTAAAGAAATAAGGAAAAAAGCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1806:NM_022658:1540:181
+CTGAAGGAGATGTGGGTCTTTCCCCTCCCCCCATTTCCAGAAGGGTAGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1807:NM_022658:2022:172
+CCGGTCCTGTGCGCTTTTATTGTGCTTCTAACCCCAGTAGAGTAGAACTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1808:NM_153633:1447:183
+TCTCAGAGCTGTTCAGTTTGAGGAGCCAAAAGAAAATCAAAATGAACTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1809:NM_153633:316:188
+CCCGAGAAATCACAGTCGCTCTGCGAGCCGGCGCCTCTCTCAGGCGCCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1810:NM_022658:1664:173
+GCTGTTTGATTTCTATTCTGTTGGGCCCGCCTTCCTCTGAGCTGCATTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1811:NM_174914:0:188
+TTAGTGAGGTTGGGGAGAGATAACGCTGTAAACTTTTATTTTTCAGGAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1812:NM_022658:790:168
+AACGAAACTTCAAGGGAGTTGCTAAGGGGGGGGGGGTCTTTCTTTTTTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1813:NM_022658:446:124
+GATTTAAGTGGCCTTGTCCTTCGCTACTGTTAGTGTTGGCGGAGGATTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1814:NM_006897:1173:139
+TTTTTTTTGTACAAAATCTGCACGCAGAGCGCCCCAGGCCCGGGGAGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1815:NM_022658:1834:185
+GCTAGGCAGTCTCAGTTGTTGGGTTTTCTTAGTGAAATAAGCAGCAACAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1816:NM_174914:720:173
+GACAGCCATGCCCAGCAGCTTCCCACAAAGCCATAGAGTCCCCAGAGTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1817:NM_174914:934:212
+GGCGGGCAGAATAGCATAATGGAGGCCATCCAGCATGGTGTGCCCATGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1818:NM_174914:743:188
+CACAAAGCCATAGAGTCCCCAGAGTGAGCCCCAGCAGAAACACAAAAACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1819:NM_174914:1151:192
+TGAACACCTGTCAGAATCCGGAAATCTTCAAGGAGATGAACAATGCCTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1820:NM_022658:1130:187
+AGTGAAAAGTTCGGACTCTCTGTCTCACTCCTTGCCCCACACACACTTGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1821:NM_173860:157:197
+GGCTCCCGGGTCGCGCCCGCGCTCCTCACGCTTCAGGCCCCCGCCGCCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1822:NM_174914:1199:182
+GCCAGTCCACAATTTTCACATTTGCAGCCAGGTGGACATCTTTGGGCCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1823:NM_022658:319:157
+AAGGGACTGTCTGGGGAGCGCCTCGTAGCCATAGAATTTGGAGGCGTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1824:NM_022658:1854:149
+TGTTGGGTTTTCTTAGTGAAATAAGCAGCAACAAACGACAACAAAACCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1825:NM_004503:396:187
+CACACAGACCTCAATCGCTCAGGATTTTAGTTCTGAGCAGGGCAGGACTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1826:NM_174914:2028:190
+TTGATATGATTTTTCTTCCTTTTTAAAATCTGGCATAAAAGGACCTCTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1827:NM_004503:882:153
+GGAGCGAGGAGGAGGAGGCGCGTGGTGAAAGAGAGTTGTGCGGTGAGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1828:NM_174914:592:191
+AGAGAATGGGGCTGCCAGAACTAGTGGGAAGCTCCCTAGAAATGGTGACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1829:NM_022658:1010:141
+AGAGAGTCCGAACTTTTCACTGTTTCTCCGTCTCCCCCCTCCAGCCCCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1830:NM_022658:148:205
+GGAGGGGGCCGCGGGTTTTCATGTACCCAGCATGAGCTCCTACTTCGTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1831:NM_022658:819:202
+CGGGAGCCCGAGATGAGGAGAAGGTGGAGGAAGAAGGAAATGAGGAAGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1832:NM_022658:1006:186
+TAGAGAATAGAATGACACTCACAACTCTAACTACCTGTCAGATACTTGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1833:NM_174914:1358:118
+CCTCTGCTTCCCAACACTGTTTATGTTGGAGGCTTGATGGAAAAACCTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1834:NM_173860:249:190
+CGCCGCCGCCCGCCGCGTAGTCGTACTTGAAGCCGAGCGCAGGCGGCCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1835:NM_006897:1122:195
+CTTTTTTTTTTTTGTACAAAATCTGCACGCAGAGCGCCCCAGGCCCGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1836:NM_174914:490:180
+GCCTTGGCGGGGTCTGTTTGGTGGGCGATGTCACCATTTCTAGGGAGCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1837:NM_022658:1492:224
+CCTGCTTAGAAAAACCCCCTTGACTTTCTCTAGGAACCTGATGGAAACCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1838:NM_022658:356:193
+TTCCACCACGGCACCTCCGGCATCTCCAACTCAGGCTACCAGCAGAACCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1839:NM_022658:234:166
+TGCTGGTAGCCTGAGTTGGAGATGCCGGAGGTGCCGTGGTGGAAGAAGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1840:NR_031764:1482:172
+CCAAAATCCTGACAATATCTACAGTAGGTGGAAGCCATTATCTACTGATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1841:NM_022658:1735:100
+ATAATCACGAAAATAATAATAATAAATCTTTAACATACTACCTAAAGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1842:NM_022658:815:174
+CTGCCGGGAGCCCGAGATGAGGAGAAGGTGGAGGAAGAAGGAAATGAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1843:NM_174914:506:179
+ATTTGTAGCAAAATTAGCAAGTGGAAAGGATGATTTTTGGCCATTTTTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1844:NM_022658:197:193
+CTGAGTTGGAGATGCCGGAGGTGCCGTGGTGGAAGAAGTCTTGAACGTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1845:NM_174914:957:201
+TTTGTCACCCACGGCGGGCAGAATAGCATAATGGAGGCCATCCAGCATGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1846:NM_173860:382:177
+AGCCGTCGGGGCCGCCTGCGCTCGGCTTCAAGTACGACTACGCGGCGGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1847:NM_022658:1228:178
+CTGGCCTCCGTGCTCCTCGGTCTGTCTCTCACCACACTCCCACCTCCCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1848:NM_006897:540:188
+CTGCGCGACCGCGCCCCGCAGACACTGCCCTCGCCCGAGGCGGACGCGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1849:NM_022658:1556:193
+ATTTTCGTGATTATGGTGATTTCTGAGCACTAACACTAATGCAGCTCAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1850:NM_014620:1740:199
+TCAATGCAAAAGGCCTAAGGAAAGAGGGGGGGAAGGAGGAGGAGGAGAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1851:NM_022658:380:211
+TCCAACTCAGGCTACCAGCAGAACCCGTGCTCGCTTAGCTGCCACGGAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1852:NM_014620:2060:193
+GCTAAATGCATCTGGAGAGCCTCTCAGAGCTGTTCAGTTTGAGGAGCCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1853:NM_153693:193:201
+TGGGGAGGGTGGGGATGGGAGGGGAGAGACAGAAGTTGAGGGCATCTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1854:NM_014620:1420:191
+CCAGAGCGCCACGCCGCCGGAGCAGCAACGGGCAGAGGACATTACCAGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1855:NM_022658:295:190
+AGCCCCATAAAGGGACTGTCTGGGGAGCGCCTCGTAGCCATAGAATTTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1856:NM_006897:332:184
+GTACGGCCCCCAGCCCCACCTCGGCGCCGACACGCGCTACATGCGGACTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1857:NM_022658:1718:156
+TTTTTTTGATTTTTATTTTTTTCTCTTTTTTTCTCCTATAGCAGGATTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1858:NM_022658:1524:203
+GGAACCTGATGGAAACCTGAAGGAGATGTGGGTCTTTCCCCTCCCCCCAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1859:NM_174914:884:186
+CTGAAAACATGGTCCGAGTAGAAGCCAAAAAGTTTGGTGTTTCTATTCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1860:NM_174914:835:151
+GGCTTGAGGTGCGTCGCGCCCCCTGTCTGGAGGACGTGGTCAATCCAGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1861:NM_173860:373:194
+TCCCGCTGGAGCCGTCGGGGCCGCCTGCGCTCGGCTTCAAGTACGACTAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1862:NM_022658:142:217
+CAGAGGGGAGGGGGCCGCGGGTTTTCATGTACCCAGCATGAGCTCCTACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1863:NM_017410:1297:199
+GCCTCCACCCCCATCCAGATGGGACTCACGTGGCTTCAACAGCTTTGGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1864:NM_173860:419:145
+GCCGGGGTCGCCTGCGCCGGCGCCCTTGTTGCCCTCGTTGAGCAGGGACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1865:NM_022658:5:187
+GCTCAGCACCGAGGCGCCCCCCAACCTGCCCAGCCCCCAGCCCACCAGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1866:NM_173860:203:183
+CCTCGGCAGCCCAGTGTCTCTCAACCCTCCCTTCGGCCGCACGTGCGAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1867:NM_174914:952:202
+TCACCCACGGCGGGCAGAATAGCATAATGGAGGCCATCCAGCATGGTGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1868:NM_022658:1964:152
+AACAGAGAATTCAAGACAGAGTTAACTATACATTCAGTGCAATTTAGTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1869:NM_017410:683:200
+GCTGCTCACCTCGGGCTGCAGGGGAACCACGTCTGGGAAGGGAGACTTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1870:NM_014620:1944:182
+CACCAGGGGAGGTTAGTGAGGGGGAAGTCATTTTAAGGAGAACAAAGCTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1871:NM_022658:1120:173
+TAAATACCAGAGAAGCAGGGAGGTGGGAGTGTGGTGAGAGACAGACCGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1872:NM_022658:578:174
+TCTCCCAGCCTCATGTTTCCATGGATGAGACCCCACGCTCCGGGGAGGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1873:NM_022658:1458:200
+CCCCTCCCCCTCCCCCTCCCCCTCCCCAGGGCTCCCTGCTTAGAAAAACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1874:NM_174914:1179:155
+CAGGAGGTCACTCTGAGGAAGCCAGTCCACAATTTTCACATTTGCAGCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1875:NM_022658:1020:172
+GTGGGGGCAGGGACAAGTGTGTGTGGGGCAAGGAGTGAGACAGAGAGTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1876:NM_174914:1991:173
+AGTAGGTGGAAGCCATTATCTACTGATGGACCGGGTTTCTCAGATTCTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1877:NM_174914:1047:184
+TTCTACTCGGACCATGTTTTCAGGCTGGTCTCCAAAGAGAGGGATCCCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1878:NM_014620:1207:173
+TTACAACCGCTACCTGACCCGAAGGAGAAGGATCGAGATCGCCCACTCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1879:NM_174914:1109:173
+CCAAGGGGTGATATGGAAGTGTCAGTGTTCTCATTGGCCCAAAGATGTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1880:NM_006897:884:132
+ACCCAGCCTGCTGCCTCAGCACAGCCAAGGGAAAAACAAAAACCCCACAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1881:NM_173860:279:195
+TACTACCGCGAGCCGTGCGCCGAGGGTGGCGGCGGGGGCCTGAAGCGTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1882:NM_022658:1227:173
+TTTTCTGTCCTTTCCTTTTTAGAAAAAGTACATCTAGTACACTAGCCTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1883:NM_022658:954:178
+CTGTTTCTCCGTCTCCCCCCTCCAGCCCCCAAACAAATAAAGAGTGGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1884:NM_006897:781:134
+TCAATCTCACCGAGCGGCAGGTCAAAATCTGGTTTCAGAATCGAAGGATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1885:NM_014620:1943:168
+GCACCAGGGGAGGTTAGTGAGGGGGAAGTCATTTTAAGGAGAACAAAGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1886:NM_174914:1651:201
+ACTCGGCCCCAGAAGTCCATGTGATCAGTCAGCAAGGAACGGAATACTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1887:NM_022658:564:166
+TAAATCAAAACTCGTCTCCCAGCCTCATGTTTCCATGGATGAGACCCCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1888:NM_022658:802:210
+CAACAAGGATAAACTGCCGGGAGCCCGAGATGAGGAGAAGGTGGAGGAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1889:NM_174914:258:163
+TCCATGATAGATAGTAGGGGCAGGAGTGAGAGAGGCTGACTAGGTCTGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1890:NM_004503:589:190
+TTTCACTTCAATCGCTACCTAACGCGGCGCCGGCGCATCGAGATCGCCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1891:NM_174914:1760:151
+TGGCCACAAATGGCTTCCCAAGCTTCTCAGCAATCAGGAAAGGACAGTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1892:NM_173860:534:185
+AACAAGGGCGCCGGCGCAGGCGACCCCGGCAGCTTGGTATCGCCGTTGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1893:NM_006897:747:170
+ACCAGGGACCGTCGGTATGAGGTGGCCCGGGTTCTCAATCTCACCGAGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1894:NM_174914:1519:150
+TCTGCTTTCAGTAGAAGATGAGACAAAACTGGCCTAGAGCCTTCTGTGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1895:NM_173860:470:176
+TCCGAGAGCGGCTGTTGATCGGGTACCAGGGCGCGCCGCTGGCCGAGAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1896:NM_006897:370:154
+TACATGTAGTCCGGGTAGCTGCGGCCCTCCCCTGGGCCGCAGTCCGCGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1897:NM_174914:1439:176
+GCAACAGCACATGCAGTCTACATTTGACAACACCATCAAGGAACATTTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1898:NM_006897:720:203
+TTGTTTTTCCCTTGGCTGTGCTGAGGCAGCAGGCTGGGTAGGGTTTAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1899:NM_022658:1038:187
+TCAGACCTTAAAATCCAGGAAGGACTCAGAAGGGTGGGGGCAGGGACAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1900:NM_022658:325:199
+CCAGCACGCTTCGCACCACGTTCAAGACTTCTTCCACCACGGCACCTCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1901:NM_004503:399:157
+GTAGATCTGGCGGCCGCGCCTCCGGTCCGCTCCGTAGCCGACCCCACTGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1902:NM_022658:2067:171
+GACCAGGAACAGGGCTGTCGGGACACAAAATCTACATTCATAGCTGGACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1903:NM_022658:261:178
+TCCCTCAGAGCGTGGGCAGGAGCCATGCGCTGGTGTACGGGCCCGGCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1904:NM_022658:1565:180
+TCGTGATTATGGTGATTTCTGAGCACTAACACTAATGCAGCTCAGAGGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1905:NM_014620:972:190
+GTCCTCGAGCGCTTGGGTTCCCCTCCGTTATAATTGGGGTTCACCGTGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1906:NM_006897:1075:154
+GTGTTTTAGAGTTAGTTCTACCCAGCGAGGAGGAGGCGGGGAGAGAAACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1907:NR_031764:1632:189
+GTAGATATTGTCAGGATTTTGGCAGCCTCTGAGAGCAGGACCCCAGGGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1908:NM_174914:1725:185
+CCCAAATTCCAAAGAGCCGAATGAAGTGGAAAGAATGGCCACAAATGGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1909:NM_174914:1692:186
+AATAGAAAGGATATCATGGATTCCTTAAAGAATGAGAACTTCGACATGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1910:NM_173860:115:149
+TGCCTTCGCTGTCCTACCCACGCCGCGACAACGTGTGCTCCCTGTCCTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1911:NM_022658:5:145
+GCTCAGCACCGAGGCGCCCCCCAACCTGCCCAGCCCCCAGCCCACCAGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1912:NM_153693:237:194
+TCTCTCTCTTCCTTCCCGACCCTCTGGCCCCCAAGGGGCAGGAGGAATGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1913:NM_022658:831:187
+TTCTATTCTCTATAAAAGCAAATGACAGTCGTAAACTTCTCAATTTATCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1914:NM_173860:598:172
+TCTCGGCCAGCGGCGCGCCCTGGTACCCGATCAACAGCCGCTCTCGGAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1915:NM_014620:1548:186
+ACACCCAGCAGGTACCATGCTAAGACAACATCACATGCTTAAAAGGGTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1916:NM_174914:195:197
+GAATATGTGGGAGAACAAAACAGAAACTGAAAGAATATGCAAGGTGTCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1917:NM_022658:338:111
+GCCATAGAATTTGGAGGCGTCTCCGTGGCAGCTAAGCGAGCACGGGTTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1918:NM_006897:1306:84
+AAAAAAAAAAGACACACACACATACATGATAATGATTCCCAGCCCAGGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1919:NM_022658:829:181
+TCTATAAAAGCAAATGACAGTCGTAAACTTCTCAATTTATCTGCTACCAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1920:NM_004503:949:141
+CCAAGGCCTGGACGGGGAAAAGGGCCTGTAGACAAGCCGAGAACGAGCTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1921:NM_022658:1350:163
+AAGGGGGTTTTTCTAAGCAGGGAGCCCTGGGGAGGGGGAGGGGGAGGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1922:NM_173860:368:197
+GCTGCTCCCGCTGGAGCCGTCGGGGCCGCCTGCGCTCGGCTTCAAGTACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1923:NM_014620:1626:203
+ACCCAAGCCAGACCATCACACCTTGCAATATATAATTTTTGCAGCTTTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1924:NM_174914:915:179
+GGATCCCTCTCTTTGGAGACCAGCCTGAAAACATGGTCCGAGTAGAAGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1925:NM_022658:320:163
+CCCCATAAAGGGACTGTCTGGGGAGCGCCTCGTAGCCATAGAATTTGGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1926:NM_022658:1926:211
+TTCTTTCGAGCACATTGCATAAACAGAGAATTCAAGACAGAGTTAACTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1927:NM_022658:965:199
+CAAGGAGTGAGACAGAGAGTCCGAACTTTTCACTGTTTCTCCGTCTCCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1928:NM_174914:770:168
+GCCCCAGCAGAAACACAAAAACGTCGAGCAGGTACTGCTCATGCCAGGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1929:NM_014620:939:191
+ATTGGGGTTCACCGTGCTAACGTGAATTTTTTTCATCCATGGGTAGACTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1930:NM_006897:1361:174
+GGGTGAGGGCTGGGGACCATGCCGCGGGCTAGGTCGGGCCCGTGCAGGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1931:NM_014620:1735:154
+TTTTTTTAAAAGGCCATTTTGGGGGGTTATTTATTTTTTAAGAAAAAAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1932:NM_014620:716:205
+ATCGATCCGAAATTTCCTCCATGCGAAGAATATTCGCAAAATAGCTACAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1933:NM_153633:367:178
+GCTGCCGGGTATAGGCTGTCCTCGAGCGCTTGGGTTCCCCTCCGTTATAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1934:NM_018953:289:166
+ACCGCCCCGCCTGCAGCGCCGCGGCCGCTCCGGGACACGCTCCGGGCAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1935:NM_006897:979:168
+TTGCGCTGGGGAAAGAGAACGCAGTTTCTCTCCCCGCCTCCTCCTCGCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1936:NM_173860:497:184
+GGAATCCGACTCCAGTTCGTCCCTGCTCAACGAGGGCAACAAGGGCGCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1937:NM_174914:1329:202
+ACTGAAAGCAGAGTTGTGGTTCATTAACTCTGACTTTGCCTTTGATTTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1938:NM_173860:131:183
+CCCACGCCGCGACAACGTGTGCTCCCTGTCCTGGCCGTCGGCGGAGCCGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1939:NM_022658:553:205
+CACTTGTCTCTCGGTCAGTCCCAGGGCATGAGAGACTTCAATCCGACGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1940:NM_022658:517:198
+CTGTAAATCCTCCGCCAACACTAACAGTAGCGAAGGACAAGGCCACTTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1941:NM_006897:1213:191
+TCGCTATATTTCTATTTTTTTTTCCCTGTATCGTATTTGGTCCAGGTCAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1942:NM_022658:1899:137
+GCGCACAGGACCGGCGGGCTAGGCAGTCTCAGTTGTTGGGTTTTCTTAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1943:NM_174914:924:175
+GATGACACTGGCAGCCACTGCCGCGGACTTGTATCTCTTGTCTTCCATGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1944:NM_022658:1418:185
+AAGACAAATGTAAAGAAATAAGGAAAAAAGCAAGGAATATCCCCTCCCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1945:NM_173860:197:221
+CGTACTTGAAGCCGAGCGCAGGCGGCCCCGACGGCTCCAGCGGGAGCAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1946:NM_174914:1767:154
+AAATGGCTTCCCAAGCTTCTCAGCAATCAGGAAAGGACAGTAGTCAAAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1947:NM_173860:434:160
+CGGCGGTGGCGACGGCGGCGGCGGCGCAGGACCTCCGCACGACCCGCCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1948:NM_174914:2178:185
+TACCTCTACCCACAGCCAGTGCCTTTGGCGCACTGAGGTGCACAGGGTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1949:NM_022658:1001:200
+CTCAGAAGGGTGGGGGCAGGGACAAGTGTGTGTGGGGCAAGGAGTGAGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1950:NR_031764:544:169
+GGCCATTTTTCCTGTTCTTCAAGAAAACAGGAGATAACTAGAAGGACTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1951:NM_018953:842:211
+GCCAAGGTTCGTTCTGCGCCAGCCTGTACGCCGCAGCCCTCCGGGGAAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1952:NM_004503:1163:176
+GGGCAGAGGGGCTAGGCAGGGACTGCGGGGAGGCCCTGGGGGTTGGTGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1953:NM_006897:935:181
+CCCCGCCTCCTCCTCGCTGGGTAGAACTAACTCTAAAACACCAATATCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1954:NM_014620:1830:180
+ATACAAAAGAACTTCATAGCTTTGTTCTCCTTAAAATGACTTCCCCCTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1955:NM_022658:588:170
+TCATGTTTCCATGGATGAGACCCCACGCTCCGGGGAGGCGCAGTGGACGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1956:NM_174914:2035:193
+GATTTTTCTTCCTTTTTAAAATCTGGCATAAAAGGACCTCTTTTGTGGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1957:NM_174914:1321:179
+GACTTTGCCTTTGATTTTGCTCGACCTCTGCTTCCCAACACTGTTTATGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1958:NM_014620:1660:190
+TCCTCATTTCCCCTGAAATTCACCCAAGCCAGACCATCACACCTTGCAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1959:NM_022658:1453:183
+AATATCCCCTCCCCCTCCCCCTCCCCCTCCCCAGGGCTCCCTGCTTAGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1960:NM_153693:1232:194
+GGAGCGAGGAGGAGGAGGCGCGTGGTGAAAGAGAGTTGTGCGGTGAGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1961:NM_022658:1173:152
+CACTTGTCCCTGCCCCCACCCTTCTGAGTCCTTCCTGGATTTTAAGGTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1962:NM_174914:1834:198
+TCAAGTTATCAGTTGGCTTGCACCTGAAGATCATCAAAGAGAATTTAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1963:NM_006897:1255:187
+CAGGTCATCCCTCCCCGGGCCTGGGGCGCTCTGCGTGCAGATTTTGTACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1964:NM_022658:486:185
+TAGTTCCAAGGTCTGATACCGGCTGTAAGTTTGCCGTCCACTGCGCCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1965:NM_022658:1054:183
+GGAGGCCAGGTCTCAGACCTTAAAATCCAGGAAGGACTCAGAAGGGTGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1966:NM_022658:1360:187
+GTACTAGATGTACTTTTTCTAAAAAGGAAAGGACAGAAAAAAATGAAGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1967:NM_006897:686:180
+CCCCTACACCAAGTACCAGACGCTGGAACTGGAGAAGGAGTTTCTCTTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1968:NM_174914:199:189
+ATGTGGGAGAACAAAACAGAAACTGAAAGAATATGCAAGGTGTCTTTCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1969:NM_174914:1482:202
+AAAATCAAAGGCAAAGTCAGAGTTAATGAACCACAACTCTGCTTTCAGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1970:NM_174914:782:193
+ATCATGGAAGACAAGAGATACAAGTCCGCGGCAGTGGCTGCCAGTGTCAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1971:NM_004503:1078:161
+TCCAGGCCTTGGGGGCTCGGACCCTGAACTCAGACTCTACAGATTGCCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1972:NM_174914:1908:185
+CCATGCTTAACCACAAAAGAGGTCCTTTTATGCCAGATTTTAAAAAGGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1973:NM_022658:1447:168
+GCAAGGAATATCCCCTCCCCCTCCCCCTCCCCCTCCCCAGGGCTCCCTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1974:NM_006897:928:207
+CCACAAAATACCCCAACACAGGCGGGGGAGAGACGAAAAAGAAAAGGAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1975:NM_022658:1712:172
+AGTGTTAGTGCTCAGAAATCACCATAATCACGAAAATAATAATAATAAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1976:NM_022658:2079:184
+CTGAATGTATAGTTAACTCTGTCTTGAATTCTCTGTTTATGCAATGTGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1977:NM_022658:1230:173
+GGCCTCCGTGCTCCTCGGTCTGTCTCTCACCACACTCCCACCTCCCTGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1978:NM_018953:1046:157
+CCTTGGCCTGGGCCGTATCTCCGGCTCCCAGCCTCAGCGCGGCCCTCCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1979:NM_022658:1541:191
+GATTTCTGAGCACTAACACTAATGCAGCTCAGAGGAAGGCGGGCCCAACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1980:NM_022658:2048:182
+ACAGGGCTGTCGGGACACAAAATCTACATTCATAGCTGGACATAAAGACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1981:NM_174914:98:213
+ATGTCCAGACCTAGTCAGCCTCTCTCACTCCTGCCCCTACTATCTATCAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1982:NM_022658:51:194
+AGCCCAGCCCAGTCCCGGGGAGCCAGCTGGCCTGGGGTTCGGTCCCGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1983:NM_022658:898:172
+AATAAAACCAGAGCTGCAAGTATCTGACAGGTAGTTAGAGTTGTGAGTGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1984:NM_022658:104:185
+GGGGAGTTTCGGGGGTACTGGGCGGGGTACTCGTGAGCCAGAGGGGAGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1985:NM_173860:515:185
+GAAACTCGCCCTCCAGCTCTGCCAGTTGCAACTTCGAATAGGGCTTGCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1986:NM_022658:1673:194
+GATTTTTATTTTTTTCTCTTTTTTTCTCCTATAGCAGGATTTTAAAATTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1987:NM_014620:1620:168
+GTTCCAAACAGACAAAACAGATAAACAAACAAGCCCCCTGCCCTCCTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1988:NM_014620:2024:161
+TAACCACGATAGGGGTGGGGAGAGATTCTACCTATAGACTGCCTCTCTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1989:NM_022658:833:184
+GAGGAGAAGGTGGAGGAAGAAGGAAATGAGGAAGAGGAGAAAGAAGAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1990:NM_022658:457:217
+TTCTAGTTCCAAGGTCTGATACCGGCTGTAAGTTTGCCGTCCACTGCGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1991:NM_022658:1652:169
+TTCCTCTCCTTCGCTGTTTGATTTCTATTCTGTTGGGCCCGCCTTCCTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1992:NM_001168316:530:180
+AAAGGATGATTTTTGGCCATTTTTCCTGTTCTTCAAGAAAACAGGAGATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1993:NM_022658:1281:184
+GGAGGGGATATTCCTTGCTTTTTTCCTTATTTCTTTACATTTGTCTTCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1994:NM_001168316:1902:209
+TCCCTGGGGTCCTGCTCTCAGAGGCTGCCAAAATCCTGACAATATCTACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1995:NM_174914:729:191
+GCCCAGCAGCTTCCCACAAAGCCATAGAGTCCCCAGAGTGAGCCCCAGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1996:NM_153633:52:198
+GCTATACTGGCGCTCAGGGTAGCTAGGGCGCGGAGGCGGTGGTGGGTACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1997:NM_173860:526:169
+ACGAGGGCAACAAGGGCGCCGGCGCAGGCGACCCCGGCAGCTTGGTATCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1998:NM_173860:214:195
+AGCCGAGCGCAGGCGGCCCCGACGGCTCCAGCGGGAGCAGCGCTGCCCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@1999:NM_022658:434:160
+TCCAAATTCTATGGCTACGAGGCGCTCCCCAGACAGTCCCTTTATGGGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2000:NM_173860:246:97
+CGCGCCCGCGCTCCTCACGCTTCAGGCCCCCGCCGCCACCCTCGGCGCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2001:NM_014212:1045:159
+CCTTTTGGGGGCGGGGGGAGGGGAAAATTATTTTATTTTATTTTTATTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2002:NM_022658:1175:215
+TTTCCTTTTTAGAAAAAGTACATCTAGTACACTAGCCTTAGCATAAAAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2003:NM_022658:1821:166
+TGAAATAAGCAGCAACAAACGACAACAAAACCGCATTACAAATACTCTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2004:NM_022658:291:181
+GACTGTCTGGGGAGCGCCTCGTAGCCATAGAATTTGGAGGCGTCTCCGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2005:NM_022658:1453:170
+AATATCCCCTCCCCCTCCCCCTCCCCCTCCCCAGGGCTCCCTGCTTAGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2006:NM_022658:353:182
+TTGGCGGAGGATTTACAGTCGGGATATTGCACCACGCTCGCCTCTTGCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2007:NM_022658:1317:208
+TGCAGAAAAGGACTTGTGGTTTTGTTTTTATGCTAAGGCTAGTGTACTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2008:NM_022658:1852:173
+AAAAAAATAAAAATCAAAAAAAAAAAAAAGAAAGAAAGAAACCTCCAGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2009:NM_022658:1412:199
+TAGAGGCGACTGCAGGCTCCTATCTACCCTTCTGGAAATGGGGGGAGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2010:NM_022658:914:81
+GACAGTCGTAAACTTCTCAATTTATCTGCTACCATAAAACGAAACTTCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2011:NM_014620:1221:195
+TGACCCGAAGGAGAAGGATCGAGATCGCCCACTCGCTGTGCCTCTCTGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2012:NM_022658:2055:230
+TTCTTCTTTTTATTATTATGACTCACGTATACAATACAAAGTACTTGGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2013:NM_022658:1835:207
+ATAAAAGCGCACAGGACCGGCGGGCTAGGCAGTCTCAGTTGTTGGGTTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2014:NM_022658:1450:168
+AGGAATATCCCCTCCCCCTCCCCCTCCCCCTCCCCAGGGCTCCCTGCTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2015:NM_022658:1893:175
+CCTCCAGCGTATTTTATCACTACCTATAGAAAGAAATCCTGCTTTGAGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2016:NM_022658:2058:195
+GTAGAGTAGAACTAAATTGCACTGAATGTATAGTTAACTCTGTCTTGAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2017:NM_001168316:858:180
+TGTCTGGAGGACGTGGTCAATCCAGCCCACCAGCCGCTGTGTGGGGCTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2018:NM_022658:875:188
+GAAGAGGAGGAAAAGGAAGAAAACAAGGACTAAGCAAAAAAGAAAGACCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2019:NM_022658:441:179
+TCTATGGCTACGAGGCGCTCCCCAGACAGTCCCTTTATGGGGCTCAGCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2020:NM_174914:554:160
+CTGCGTGGGGCCAGAAAGGTGAAGGAGACATAAGGCCAGGTGCAGCCTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2021:NM_022658:875:193
+TAAAACCAGAGCTGCAAGTATCTGACAGGTAGTTAGAGTTGTGAGTGTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2022:NM_001168316:98:170
+TGTGGGCACCAGAGACAGGGACCCAATGTGGAGACCTGTGAGCCTGTGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2023:NM_004503:1450:202
+TAAATATTCGAGAACGGACCCAGAGGTTGGATTTATACAGGAGGGTAACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2024:NM_022658:326:134
+AGCGCCTCGTAGCCATAGAATTTGGAGGCGTCTCCGTGGCAGCTAAGCGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2025:NM_022658:1400:173
+TGGGGGGAGGGGAAAGACCCACATCTCCTTCAGGTTTCCATCAGGTTCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2026:NM_173860:493:199
+CGCTGGAATCCGACTCCAGTTCGTCCCTGCTCAACGAGGGCAACAAGGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2027:NM_174914:1007:154
+CTGTTTGTCACCCACGGCGGGCAGAATAGCATAATGGAGGCCATCCAGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2028:NM_022658:78:169
+TAGGCCGGTTCCAGGGACTCGCCGGCTTTGTATTTGGAGAACAGGGGGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2029:NM_174914:863:171
+GTGTTTCTATTCAGTTAAAGAAGCTCAAGGCAGAGACATTGGCTCTTAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2030:NM_022658:933:179
+TCCAGCCCCCAAACAAATAAAGAGTGGGGGAAGTCCAAAGGTAATAAAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2031:NM_022658:1809:163
+AAAGAGAAAAATTTTAAAATCCTGCTATAGGAGAAAAAAAGAGAAAAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2032:NM_022658:698:170
+TTGACACGAAAACGTCGGATTGAAGTCTCTCATGCCCTGGGACTGACCGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2033:NM_022658:70:171
+GAGCCAGCTGGCCTGGGGTTCGGTCCCGGGGGGAGGGGAGTTTCGGGGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2034:NM_022658:1818:127
+AATTTTAAAATCCTGCTATAGGAGAAAAAAAGAGAAAAAAATAAAAATCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2035:NM_153693:1289:183
+GGACGGGGAAAAGGGCCTGTAGACAAGCCGAGAACGAGCTAGCAAGGGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2036:NM_001168316:503:181
+TGAATTTGTAGCAAAATTAGCAAGTGGAAAGGATGATTTTTGGCCATTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2037:NM_022658:639:174
+TATCCTTGTTGTTCTCCTTTTTCCACTTCATCCTTCGGTTCTGGAACCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2038:NM_022658:1792:194
+ATAATCTTGAAAAAGAAAAAGAGAAAAATTTTAAAATCCTGCTATAGGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2039:NM_006897:1307:168
+CAGGACGGACGCTGGGGACGAACCCTGGGGATGAGAGGGAACACTATGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2040:NM_004503:1107:176
+TCAGACTCTACAGATTGCCCTCCAAGTGAGGACTTGGCTCCCCCACTCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2041:NM_018953:459:171
+GCCGGACTGAGCCAGCCACCGGCCCCGCCACAGATTTACCCGTGGATGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2042:NM_174914:14:157
+CTGTGCTTGAGAGTTCAGGGCCGGACACAGGCTCACAGGTCTCCACATTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2043:NM_022658:1696:210
+AATACGCTGGAGGTTTCTTTCTTTCTTTTTTTTTTTTTTGATTTTTATTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2044:NM_004503:1319:207
+AATTTTCCCTCTTTTTTTTCCTTTTTTGAAATTGGATAGGAACACTGACG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2045:NM_174914:1657:116
+CCCCAGAAGTCCATGTGATCAGTCAGCAAGGAACGGAATACTGGAACATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2046:NM_022658:2092:189
+TAACTCTGTCTTGAATTCTCTGTTTATGCAATGTGCTCGAAAGAAAAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2047:NM_022658:1776:194
+AACGACAACAAAACCGCATTACAAATACTCTCAAAGCAGGATTTCTTTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2048:NM_022658:564:186
+TCTCGGTCAGTCCCAGGGCATGAGAGACTTCAATCCGACGTTTTCGTGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2049:NM_153633:0:176
+CCGATTCCCTGGTCCGGCCGTAATATTCCGGACTGTGTTCAGGGATGTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2050:NM_006897:365:181
+GCGCAGCTCCCCGGGCGAGCCGTACATGTAGTCCGGGTAGCTGCGGCCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2051:NM_022658:211:194
+CAAATACAAAGCCGGCGAGTCCCTGGAACCGGCCTATTACGACTGCCGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2052:NM_022658:323:174
+CGCCTCTTGCTGAGCCCCATAAAGGGACTGTCTGGGGAGCGCCTCGTAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2053:NM_174914:837:198
+GGTGTTTCTATTCAGTTAAAGAAGCTCAAGGCAGAGACATTGGCTCTTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2054:NM_006897:151:206
+ACAATGAAGACCTCCTAGCGTCCAGGTTTCCGGCCACCGGGGCTCATCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2055:NM_018953:174:140
+GCCGCGGCGCTGCAGGCGGGGCGGTCGGGGTGAGCCCGGGGGTTGGCAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2056:NM_174914:92:175
+TATCATGGAATAACATCCAAGAAAGACACCTTGCATATTCTTTCAGTTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2057:NM_022658:696:198
+CTTCCTTTTCCTCCTCTTCTTTCTCCTCTTCCTCATTTCCTTCTTCCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2058:NM_014620:2122:136
+ATGAACTTTCAGTTCAGAGAGGCAGTCTATAGGTAGAATCTCTCCCCACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2059:NM_022658:820:156
+GGGAGCCCGAGATGAGGAGAAGGTGGAGGAAGAAGGAAATGAGGAAGAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2060:NM_173860:564:167
+AGCTTGGTATCGCCGTTGAACCCCGGCGGCGGGCTCTCGGCCAGCGGCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2061:NM_022658:1459:182
+CCCTCCCCCTCCCCCTCCCCCTCCCCAGGGCTCCCTGCTTAGAAAAACCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2062:NM_174914:1142:179
+CGCCGTGGGTGACAAACAGACGGATGCTTGGGTGAGCCAGGAGGTCACTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2063:NM_022658:1661:180
+TTCGCTGTTTGATTTCTATTCTGTTGGGCCCGCCTTCCTCTGAGCTGCAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2064:NM_022658:2063:150
+GTAGAACTAAATTGCACTGAATGTATAGTTAACTCTGTCTTGAATTCTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2065:NM_022658:104:167
+GGGGAGTTTCGGGGGTACTGGGCGGGGTACTCGTGAGCCAGAGGGGAGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2066:NM_022658:1911:201
+GAGAATTCAAGACAGAGTTAACTATACATTCAGTGCAATTTAGTTCTACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2067:NM_006897:378:177
+ACTTGGCTCGAGCCGCTGTCCGGCGCCGTCTCCTTCCCCAGCTTCCCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2068:NM_022658:1106:181
+CCAGAGAAGCAGGGAGGTGGGAGTGTGGTGAGAGACAGACCGAGGAGCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2069:NR_031764:529:161
+GAAAGGATGATTTTTGGCCATTTTTCCTGTTCTTCAAGAAAACAGGAGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2070:NM_022658:942:168
+CCCTTGAAGTTTCGTTTTATGGTAGCAGATAAATTGAGAAGTTTACGACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2071:NM_022658:827:189
+CTATTCTCTATAAAAGCAAATGACAGTCGTAAACTTCTCAATTTATCTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2072:NM_022658:78:178
+TGGCCTGGGGTTCGGTCCCGGGGGGAGGGGAGTTTCGGGGGTACTGGGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2073:NM_022658:151:191
+GGGGGCCGCGGGTTTTCATGTACCCAGCATGAGCTCCTACTTCGTCAACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2074:NM_022658:1998:174
+CAACAACTGAGACTGCCTAGCCCGCCGGTCCTGTGCGCTTTTATTGTGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2075:NM_022658:1215:159
+AGTACATCTAGTACACTAGCCTTAGCATAAAAACAAAACCACAAGTCCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2076:NM_022658:692:195
+TTCCTCCTCTTCTTTCTCCTCTTCCTCATTTCCTTCTTCCTCCACCTTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2077:NM_022658:1727:187
+AAATCACCATAATCACGAAAATAATAATAATAAATCTTTAACATACTACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2078:NM_022658:726:180
+CTCATGCCCTGGGACTGACCGAGAGACAAGTGAAGATCTGGTTCCAGAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2079:NM_022658:1448:177
+GTTAGGTAGGATTTTAGAGGCGACTGCAGGCTCCTATCTACCCTTCTGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2080:NM_006897:1278:126
+GGGCGCTCTGCGTGCAGATTTTGTACAAAAAAAAAAAAGACACACACACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2081:NM_022658:1236:138
+CGTGCTCCTCGGTCTGTCTCTCACCACACTCCCACCTCCCTGCTTCTCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2082:NM_022658:1156:176
+ACTCCTTGCCCCACACACACTTGTCCCTGCCCCCACCCTTCTGAGTCCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2083:NM_153633:380:192
+CAGCCCCGCCAGCCTGCAGCCAGCCAGCCCCCGACCATCCCTCCAGCGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2084:NM_022658:1873:192
+AAAAAAAAGAAAGAAAGAAACCTCCAGCGTATTTTATCACTACCTATAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2085:NM_022658:1349:188
+CTAAGGCTAGTGTACTAGATGTACTTTTTCTAAAAAGGAAAGGACAGAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2086:NM_022658:1709:198
+ATTAGTGTTAGTGCTCAGAAATCACCATAATCACGAAAATAATAATAATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2087:NM_022658:882:209
+AGGAAAAGGAAGAAAACAAGGACTAAGCAAAAAAGAAAGACCCCCCCCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2088:NM_153633:757:152
+ATAAGAGTCAATTTGTGTGTGAGGGGAGGGTGGGGGCATGGGGTGGGGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2089:NM_174914:1079:205
+CAAAGAGAGGGATCCCCACCATGGGCACACCATGCTGGATGGCCTCCATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2090:NR_031764:1491:176
+ATAACTTGATATGATTTTTCTTCCTTTTTAAAATCTGGCATAAAAGGACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2091:NM_018953:936:181
+GGCGCTGCCCCATCTCCCCTCAGCTCGGCTCAGCTCGGTACCCGGGGCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2092:NM_022658:1463:149
+CCCCCTCCCCCTCCCCCTCCCCAGGGCTCCCTGCTTAGAAAAACCCCCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2093:NM_022658:1188:188
+CCACCCTTCTGAGTCCTTCCTGGATTTTAAGGTCTGAGACCTGGCCTCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2094:NM_153633:277:156
+TCGCGAGGCCACGGGCCGGCCCAGGCGGGCCACCACCACCCCGAGAAATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2095:NM_014620:1556:164
+CCATGCTAAGACAACATCACATGCTTAAAAGGGTCCTTAACAGTGGGAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2096:NM_006897:1327:197
+ATACATGATAATGATTCCCAGCCCAGGAGCTGAGGGGTGAGGGCTGGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2097:NM_174914:1998:190
+ATGATCTTCAGGTGCAAGCCAACTGATAACTTGATATGATTTTTCTTCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2098:NM_004503:155:187
+CCGGGGGCCAGGACGTCCTCCCCAACGTCGCCCTCAATTCCACCGCCTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2099:NM_022658:660:175
+TCATCTCGGGCTCCCGGCAGTTTATCCTTGTTGTTCTCCTTTTTCCACTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2100:NM_022658:737:177
+GGACTGACCGAGAGACAAGTGAAGATCTGGTTCCAGAACCGAAGGATGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2101:NM_153633:1002:205
+ACAGATAAACAAACAAGCCCCCTGCCCTCCTCTCCCTCCCACTGTTAAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2102:NM_022658:1974:146
+CATAAACAGAGAATTCAAGACAGAGTTAACTATACATTCAGTGCAATTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2103:NM_022658:759:157
+AGATCTGGTTCCAGAACCGAAGGATGAAGTGGAAAAAGGAGAACAACAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2104:NM_022658:1520:161
+TCTAGGAACCTGATGGAAACCTGAAGGAGATGTGGGTCTTTCCCCTCCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2105:NM_153693:1732:179
+GCAAATGCCCAGCCCAGGCAAATTGTATTTAAAGAATCCTGGGGGTCATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2106:NM_022658:2063:178
+TTGGACCAGGAACAGGGCTGTCGGGACACAAAATCTACATTCATAGCTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2107:NM_022658:1451:149
+GGAATATCCCCTCCCCCTCCCCCTCCCCCTCCCCAGGGCTCCCTGCTTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2108:NM_022658:1400:181
+TCTGGAAATGGGGGGAGGGGAAAGACCCACATCTCCTTCAGGTTTCCATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2109:NM_022658:504:203
+TCGTGTCAAATAAGGATTAAAGAGAAACTCCTTTTCTAGTTCCAAGGTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2110:NM_173860:436:157
+CCGCCGGGGTTCAACGGCGATACCAAGCTGCCGGGGTCGCCTGCGCCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2111:NM_022658:114:212
+GAAGCCGGGCGCCGAGCCGCCGGGCCCGTACACCAGCGCATGGCTCCTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2112:NM_014620:1686:172
+ACCCTTTTAAGCATGTGATGTTGTCTTAGCATGGTACCTGCTGGGTGTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2113:NM_022658:1969:166
+CTTTCGAGCACATTGCATAAACAGAGAATTCAAGACAGAGTTAACTATAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2114:NM_153633:159:197
+AGAGAGGCGCCGGCTCGCAGAGCGACTGTGATTTCTCGGGGTGGTGGTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2115:NM_173860:297:209
+TCGGATTCCAGCGACTGGCAGGAGGGCGGGTCGTGCGGAGGTCCTGCGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2116:NM_022658:534:172
+ACACTAACAGTAGCGAAGGACAAGGCCACTTAAATCAAAACTCGTCTCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2117:NM_022658:1574:181
+ATTATTATTTTCGTGATTATGGTGATTTCTGAGCACTAACACTAATGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2118:NM_174914:14:168
+GAGAGATAACGCTGTAAACTTTTATTTTTCAGGAAATCTGGAAACCTACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2119:NM_022658:1041:214
+TGTCAGATACTTGCAGCTCTGGTTTTATTACCTTTGGACTTCCCCCACTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2120:NM_174914:2093:161
+TGACATTATGACCGTGATCTTGAAGAATCTGAGAAACCCGGTCCATCAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2121:NM_022658:1749:156
+AATAATAATAAATCTTTAACATACTACCTAAAGGGAACCTGCAATAATCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2122:NM_022658:1778:180
+ACCGCATTACAAATACTCTCAAAGCAGGATTTCTTTCTATAGGTAGTGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2123:NM_022658:1802:197
+AAAAGAAAAAGAGAAAAATTTTAAAATCCTGCTATAGGAGAAAAAAAGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2124:NM_006897:921:178
+AAAAACCCCACAAAATACCCCAACACAGGCGGGGGAGAGACGAAAAAGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2125:NM_173860:192:171
+CCCGGGCCCGGCTCCCGGGTCGCGCCCGCGCTCCTCACGCTTCAGGCCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2126:NM_022658:1440:138
+GGAAATGGGGGGAGGGGAAAGACCCACATCTCCTTCAGGTTTCCATCAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2127:NM_022658:996:196
+TTTGCTTTTATAGAGAATAGAATGACACTCACAACTCTAACTACCTGTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2128:NM_006897:1202:185
+CAGTACTTGAATCGCTATATTTCTATTTTTTTTTCCCTGTATCGTATTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2129:NM_022658:1938:174
+GAGAATTCAAGACAGAGTTAACTATACATTCAGTGCAATTTAGTTCTACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2130:NM_006897:1296:80
+TTTTGTACAAAAAAAAAAAAGACACACACACATACATGATAATGATTCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2131:NM_022658:1324:173
+AAGGACTTGTGGTTTTGTTTTTATGCTAAGGCTAGTGTACTAGATGTACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2132:NM_014620:118:185
+AATCTGATTAATAATTATTTTTCCCCCATTTAATTTTTTTTCCTCCCAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2133:NM_022658:85:178
+GGGTTCGGTCCCGGGGGGAGGGGAGTTTCGGGGGTACTGGGCGGGGTACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2134:NM_173860:434:179
+CGCCGCTGGCCGAGAGCCCGCCGCCGGGGTTCAACGGCGATACCAAGCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2135:NM_174914:1892:189
+ACTGCAACGCCAAGTATTCTAGAACATTTAATAAGTTTTCAAATTTTCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2136:NM_006897:255:184
+GACGGCCCCCGGCCGGGAAGCTGGGGAAGGAGACGGCGCCGGACAGCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2137:NM_174914:1900:195
+GCCAAGTATTCTAGAACATTTAATAAGTTTTCAAATTTTCCTCTGCCACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2138:NM_022658:713:187
+TGTTTTCTTCCTTTTCCTCCTCTTCTTTCTCCTCTTCCTCATTTCCTTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2139:NM_006897:1004:154
+ATTTATTTCGGTTGCGCTGGGGAAAGAGAACGCAGTTTCTCTCCCCGCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2140:NM_022658:937:196
+CAACTCCCTTGAAGTTTCGTTTTATGGTAGCAGATAAATTGAGAAGTTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2141:NM_022658:1719:152
+TTTTGATTTTTATTTTTTTCTCTTTTTTTCTCCTATAGCAGGATTTTAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2142:NM_006897:882:159
+CTACCCAGCCTGCTGCCTCAGCACAGCCAAGGGAAAAACAAAAACCCCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2143:NM_022658:1621:196
+TTCTCTTTTTCTTTTTCAAGATTATTGCAGGTTCCCTTTAGGTAGTATGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2144:NM_022658:1697:209
+AATACGCTGGAGGTTTCTTTCTTTCTTTTTTTTTTTTTTGATTTTTATTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2145:NM_001168316:2040:182
+GCACAGGGTCCCTTAGCCGGGCGCAGGGCGCGCAGCCCAGGCTGAGATCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2146:NM_173860:551:204
+AGGCGACCCCGGCAGCTTGGTATCGCCGTTGAACCCCGGCGGCGGGCTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2147:NM_014620:1029:160
+GCAGCCAGCCAGCCCCCGACCATCCCTCCAGCGCCGCCAGCAAGCAACCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2148:NM_004503:1050:184
+TCGGCTTGTCTACAGGCCCTTTTCCCCGTCCAGGCCTTGGGGGCTCGGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2149:NM_022658:619:187
+GGGGAGGCGCAGTGGACGGCAAACTTACAGCCGGTATCAGACCTTGGAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2150:NM_022658:1495:164
+AGAGGAAGGCATGGGCCCGAGTGACCATGGGATGGTTAGGTAGGATTTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2151:NM_173860:290:203
+ACTGGCAGGAGGGCGGGTCGTGCGGAGGTCCTGCGCCGCCGCCGCCGTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2152:NM_006897:1014:166
+AAAAATCACATTTGTATGTGTCATTTATTTCGGTTGCGCTGGGGAAAGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2153:NM_022658:2026:151
+GACAAAAAATTATTATTATAGATATATTTTTAACATTTTTTTCTTTCGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2154:NM_022658:225:194
+GCGAGTCCCTGGAACCGGCCTATTACGACTGCCGGTTCCCTCAGAGCGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2155:NM_022658:537:179
+CTAACAGTAGCGAAGGACAAGGCCACTTAAATCAAAACTCGTCTCCCAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2156:NM_022658:1754:188
+TCTCAAAGCAGGATTTCTTTCTATAGGTAGTGATAAAATACGCTGGAGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2157:NM_022658:1218:167
+GGTCTGAGACCTGGCCTCCGTGCTCCTCGGTCTGTCTCTCACCACACTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2158:NM_022658:1516:162
+AGAAATCAAACAGCGAAGGAGAGGAAGGCATGGGCCCGAGTGACCATGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2159:NM_022658:569:159
+CAAAACTCGTCTCCCAGCCTCATGTTTCCATGGATGAGACCCCACGCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2160:NM_006897:997:182
+AAAATCACATTTGTATGTGTCATTTATTTCGGTTGCGCTGGGGAAAGAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2161:NM_173860:474:182
+GACCCGCCCTCCTGCCAGTCGCTGGAATCCGACTCCAGTTCGTCCCTGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2162:NM_022658:163:189
+TCTTGAACGTGGTGCGAAGCGTGCTGGAAGCCGGGCGCCGAGCCGCCGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2163:NM_174914:549:158
+GGGCCAGAAAGGTGAAGGAGACATAAGGCCAGGTGCAGCCTTGGCGGGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2164:NM_022658:2005:215
+TGAGACTGCCTAGCCCGCCGGTCCTGTGCGCTTTTATTGTGCTTCTAACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2165:NM_174914:1794:177
+TTCTTTCTGGAAGAAACTTTAGGTGGCAGAGGAAAATTTGAAAACTTATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2166:NM_022658:686:199
+TTTAATCCTTATTTGACACGAAAACGTCGGATTGAAGTCTCTCATGCCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2167:NM_022658:0:169
+GCCGAGCTCAGCACCGAGGCGCCCCCCAACCTGCCCAGCCCCCAGCCCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2168:NM_022658:742:175
+GACCGAGAGACAAGTGAAGATCTGGTTCCAGAACCGAAGGATGAAGTGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2169:NM_014620:1317:189
+AGGACCACCGACTCCCCAACACCAAAGTCAGGTCAGCACCCCCGGCCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2170:NM_173860:33:159
+GTGGGGCCGCTGGTAAACATCCACACGGGAGACACCTTCTACTTCCCCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2171:NM_153633:1150:167
+GCTGCAAAAATTATATATTGCAAGGTGTGATGGTCTGGCTTGGGTGAATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2172:NM_014620:2082:189
+CTCAGAGCTGTTCAGTTTGAGGAGCCAAAAGAAAATCAAAATGAACTTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2173:NM_174914:1888:170
+CTGCACTGCAACGCCAAGTATTCTAGAACATTTAATAAGTTTTCAAATTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2174:NM_173860:333:169
+CGCGGGCGCGACCCGGGAGCCGGGCCCGGGGCAGCGCTGCTCCCGCTGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2175:NM_022658:1699:195
+GTTTCTTTCTTTCTTTTTTTTTTTTTTGATTTTTATTTTTTTCTCTTTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2176:NM_014620:239:171
+TCTCTCTTCCTTCCCGACCCTCTGGCCCCCAAGGGGCAGGAGGAATGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2177:NM_022658:617:183
+CCGGGGAGGCGCAGTGGACGGCAAACTTACAGCCGGTATCAGACCTTGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2178:NM_022658:1776:199
+CTAAAGGGAACCTGCAATAATCTTGAAAAAGAAAAAGAGAAAAATTTTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2179:NM_174914:823:167
+TGAAAGACATAGGGCTTGAGGTGCGTCGCGCCCCCTGTCTGGAGGACGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2180:NM_014620:722:159
+ATACTGGCGCTCAGGGTAGCTAGGGCGCGGAGGCGGTGGTGGGTACAGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2181:NM_174914:803:156
+GATACAAGTCCGCGGCAGTGGCTGCCAGTGTCATCCTGCGCTCCCACCCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2182:NM_173860:168:184
+TCGGCGGAGCCGTGCAATGGCTACCCGCAGCCCTACCTCGGCAGCCCAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2183:NM_022658:262:176
+CCCTCAGAGCGTGGGCAGGAGCCATGCGCTGGTGTACGGGCCCGGCGGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2184:NM_153693:973:179
+GAAGGAATTTCACTTCAATCGCTACCTAACGCGGCGCCGGCGCATCGAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2185:NM_022658:1114:178
+AAATACCAGAGAAGCAGGGAGGTGGGAGTGTGGTGAGAGACAGACCGAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2186:NM_022658:1609:178
+TAAAATCCTACCTAACCATCCCATGGTCACTCGGGCCCATGCCTTCCTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2187:NM_022658:1515:117
+CTTTCTCTAGGAACCTGATGGAAACCTGAAGGAGATGTGGGTCTTTCCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2188:NM_022658:1485:204
+CCCAACAGAATAGAAATCAAACAGCGAAGGAGAGGAAGGCATGGGCCCGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2189:NM_022658:1772:208
+AGCAGCAACAAACGACAACAAAACCGCATTACAAATACTCTCAAAGCAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2190:NM_022658:649:176
+CTCCCGGCAGTTTATCCTTGTTGTTCTCCTTTTTCCACTTCATCCTTCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2191:NM_022658:935:180
+AGCAACTCCCTTGAAGTTTCGTTTTATGGTAGCAGATAAATTGAGAAGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2192:NM_022658:1397:187
+AAAAAATGAAGAAAGGAAAGGAAGACAAATGTAAAGAAATAAGGAAAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2193:NM_006897:312:196
+AGCTGCGGCCCTCCCCTGGGCCGCAGTCCGCGCGGCGCCCGGGGTAGGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2194:NM_173860:163:184
+GGGTCGCGCCCGCGCTCCTCACGCTTCAGGCCCCCGCCGCCACCCTCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2195:NM_022658:36:195
+AGCCCCCAGCCCACCAGCCCAGCCCAGTCCCGGGGAGCCAGCTGGCCTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2196:NM_174914:1567:196
+CCATTCTTTCCACTTCATTCGGCTCTTTGGAATTTGGGCTACCAATCCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2197:NM_022658:74:188
+CAGCTGGCCTGGGGTTCGGTCCCGGGGGGAGGGGAGTTTCGGGGGTACTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2198:NM_173860:456:176
+GGCGCAGGACCTCCGCACGACCCGCCCTCCTGCCAGTCGCTGGAATCCGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2199:NM_173860:303:175
+GGTGGCGGCGGGGGCCTGAAGCGTGAGGAGCGCGGGCGCGACCCGGGAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2200:NM_022658:876:174
+TATCTGACAGGTAGTTAGAGTTGTGAGTGTCATTCTATTCTCTATAAAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2201:NM_022658:948:144
+AGAGTGGGGGAAGTCCAAAGGTAATAAAACCAGAGCTGCAAGTATCTGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2202:NM_022658:5:190
+CGAAGTAGGAGCTCATGCTGGGTACATGAAAACCCGCGGCCCCCTCCCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2203:NM_173860:464:177
+GAGCGGCTGTTGATCGGGTACCAGGGCGCGCCGCTGGCCGAGAGCCCGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2204:NM_014620:920:172
+ATGGGTAGACTATGGGTTGCTTGCTGGCGGCGCTGGAGGGATGGTCGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2205:NM_153633:475:91
+GTTAGCACGGTGAACCCCAATTATAACGGAGGGGAACCCAAGCGCTCGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2206:NM_014620:1245:172
+TCGCCCACTCGCTGTGCCTCTCTGAGAGGCAGATCAAAATCTGGTTCCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2207:NM_173860:205:173
+TCGGCAGCCCAGTGTCTCTCAACCCTCCCTTCGGCCGCACGTGCGAGCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2208:NM_022658:1114:157
+GGGGAGACGGAGAAACAGTGAAAAGTTCGGACTCTCTGTCTCACTCCTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2209:NM_001168316:739:192
+TGTCATCCTGCGCTCCCACCCGCTCAGCCCCACACAGCGGCTGGTGGGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2210:NM_022658:350:192
+GACTTCTTCCACCACGGCACCTCCGGCATCTCCAACTCAGGCTACCAGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2211:NM_006897:481:151
+GGGTCCAGGTCGGCCTTCTCCTCTTTGTGCTTGCTGCCGGCGAGCGCGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2212:NM_006897:853:195
+ATCGCAAGAGTTTTCTTTTCCCCTTCCTTGTTTTTCTTTTTAAGCTGATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2213:NM_173860:297:169
+GCCGAGGGTGGCGGCGGGGGCCTGAAGCGTGAGGAGCGCGGGCGCGACCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2214:NM_014620:1923:176
+AACTGAACAGCTCTGAGAGGCTCTCCAGATGCATTTAGCTTTGTCTGCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2215:NM_006897:83:178
+AAACCCCGTTACGATGTCGGCGACGGGGCCCATCAGTAACTATTACGTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2216:NR_031764:61:173
+ACAGTCTCCAAGCCTGCTCAGCCAAGAAGGAGCTCACTGTGGGCACCAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2217:NM_006897:1122:186
+ACTGCGTTCTCTTTCCCCAGCGCAACCGAAATAAATGACACATACAAATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2218:NM_174914:1716:175
+CAGTCATTTTTTAAATAGAAAGGATATCATGGATTCCTTAAAGAATGAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2219:NM_173860:364:194
+GTCGCCTGCGCCGGCGCCCTTGTTGCCCTCGTTGAGCAGGGACGAACTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2220:NM_174914:2178:177
+GATTTTGGCAGCCTCTGAGAGCAGGACCCCAGGGAGAAGGAAGCCCACTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2221:NM_022658:647:185
+TCTCGGGCTCCCGGCAGTTTATCCTTGTTGTTCTCCTTTTTCCACTTCAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2222:NM_014620:1750:190
+TTCAATGCAAAAGGCCTAAGGAAAGAGGGGGGGAAGGAGGAGGAGGAGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2223:NM_174914:1916:177
+CATTTAATAAGTTTTCAAATTTTCCTCTGCCACCTAAAGTTTCTTCCAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2224:NM_014620:1926:184
+TTGGCTCCTCAAACTGAACAGCTCTGAGAGGCTCTCCAGATGCATTTAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2225:NM_022658:677:170
+TCCACCTTCTCCTCATCTCGGGCTCCCGGCAGTTTATCCTTGTTGTTCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2226:NM_018953:1422:177
+TAGCTCAACTAGTGGGGTTTCCTGGCACTGGACCCCAGCAAGTGGTCCTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2227:NM_174914:567:203
+AAAACAGGAGATAACTAGAAGGACTAGAGAATGGGGCTGCCAGAACTAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2228:NM_022658:1363:212
+CTAGATGTACTTTTTCTAAAAAGGAAAGGACAGAAAAAAATGAAGAAAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2229:NM_014212:299:177
+GGAGCCTTCGTTTTTCATGAGGATCTCGGTGACGGTGGAAGGAGGCAGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2230:NM_173860:16:170
+TCCTGAATCCCGGGTTTGTGGGGCCGCTGGTAAACATCCACACGGGAGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2231:NM_022658:334:179
+TTCGCACCACGTTCAAGACTTCTTCCACCACGGCACCTCCGGCATCTCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2232:NM_173860:391:173
+GGCCGCCTGCGCTCGGCTTCAAGTACGACTACGCGGCGGGCGGCGGCGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2233:NM_174914:1223:177
+CAGCCAGGTGGACATCTTTGGGCCAATGAGAACACTGACACTTCCATATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2234:NM_022658:92:182
+ACGCTCTGAGGGAACCGGCAGTCGTAATAGGCCGGTTCCAGGGACTCGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2235:NM_022658:323:165
+TTCCAGCACGCTTCGCACCACGTTCAAGACTTCTTCCACCACGGCACCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2236:NM_004503:618:206
+CCGGCGCATCGAGATCGCCAACGCGCTTTGCCTGACCGAGCGACAGATCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2237:NM_022658:1308:175
+CCCTCGAAATGCAGAAAAGGACTTGTGGTTTTGTTTTTATGCTAAGGCTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2238:NM_022658:2113:173
+GTTTATGCAATGTGCTCGAAAGAAAAAAATGTTAAAAATATATCTATAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2239:NM_022658:887:174
+AGAGCTGCAAGTATCTGACAGGTAGTTAGAGTTGTGAGTGTCATTCTATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2240:NM_173860:77:168
+CCCCAACTTCCGCGCGTCCGGGGCGCAGCTTCCCGGGCTGCCTTCGCTGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2241:NM_022658:311:170
+CCATAAAGGGACTGTCTGGGGAGCGCCTCGTAGCCATAGAATTTGGAGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2242:NM_022658:422:170
+CACGGAGACGCCTCCAAATTCTATGGCTACGAGGCGCTCCCCAGACAGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2243:NM_022658:1035:187
+ACTACCTGTCAGATACTTGCAGCTCTGGTTTTATTACCTTTGGACTTCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2244:NM_014620:102:172
+GTATTTTTTTTAAATTAATCTGATTAATAATTATTTTTCCCCCATTTAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2245:NM_174914:27:168
+GTAAACTTTTATTTTTCAGGAAATCTGGAAACCTACAGTCTCCAAGCCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2246:NM_022658:140:163
+GCCCGTACACCAGCGCATGGCTCCTGCCCACGCTCTGAGGGAACCGGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2247:NM_006897:1104:207
+GAGGAGGCGGGGAGAGAAACTGCGTTCTCTTTCCCCAGCGCAACCGAAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2248:NM_174914:1223:197
+AGTACCACAAGACTTGGAGAACTTCATTGCCAAGTTTGGGGACTCTGGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2249:NM_022658:53:200
+TCGTAATAGGCCGGTTCCAGGGACTCGCCGGCTTTGTATTTGGAGAACAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2250:NM_173860:81:192
+GCCGTCCTCCACGCGCGCCAGCTCGCACGTGCGGCCGAAGGGAGGGTTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2251:NM_174914:1672:162
+CATGGTGATAGTTGAAACTTTTGACTACTGTCCTTTCCTGATTGCTGAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2252:NM_022658:1289:189
+GGGAGGGGGAGGGGGAGGGGATATTCCTTGCTTTTTTCCTTATTTCTTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2253:NM_022658:1798:110
+TTGAAAAAGAAAAAGAGAAAAATTTTAAAATCCTGCTATAGGAGAAAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2254:NM_022658:150:158
+AGGGGGCCGCGGGTTTTCATGTACCCAGCATGAGCTCCTACTTCGTCAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2255:NM_173860:666:164
+AAGTTGCAACTGGCAGAGCTGGAGGGCGAGTTTCTGGTCAACGAGTTCAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2256:NM_173860:214:174
+ACGGCTCCAGCGGGAGCAGCGCTGCCCCGGGCCCGGCTCCCGGGTCGCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2257:NM_022658:1429:174
+ACTGCAGGCTCCTATCTACCCTTCTGGAAATGGGGGGAGGGGAAAGACCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2258:NM_022658:102:204
+GAGGGGAGTTTCGGGGGTACTGGGCGGGGTACTCGTGAGCCAGAGGGGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2259:NM_022658:897:201
+AAATAAAGAGTGGGGGAAGTCCAAAGGTAATAAAACCAGAGCTGCAAGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2260:NM_153633:846:179
+AGGGGGCTTGTTTGTTTATCTGTTTTGTCTGTTTGGAACTGACAAGGGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2261:NM_022658:754:173
+GGGGGTCTTTCTTTTTTGCTTAGTCCTTGTTTTCTTCCTTTTCCTCCTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2262:NM_004503:1388:123
+TTTTCCTTTTTTGAAATTGGATAGGAACACTGACGGTGCTAAACATAAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2263:NM_022658:334:188
+TTCGCACCACGTTCAAGACTTCTTCCACCACGGCACCTCCGGCATCTCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2264:NM_006897:283:178
+GCGTCCGGCTTGAGGGCGTAGTGACGGCCCCCGGCCGGGAAGCTGGGGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2265:NM_022658:1540:195
+CTGAAGGAGATGTGGGTCTTTCCCCTCCCCCCATTTCCAGAAGGGTAGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2266:NM_022658:275:153
+TCCGTGGCAGCTAAGCGAGCACGGGTTCTGCTGGTAGCCTGAGTTGGAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2267:NM_022658:737:153
+GGACTGACCGAGAGACAAGTGAAGATCTGGTTCCAGAACCGAAGGATGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2268:NM_022658:1307:200
+GTTTTTCTAAGCAGGGAGCCCTGGGGAGGGGGAGGGGGAGGGGGAGGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2269:NM_174914:576:184
+GATAACTAGAAGGACTAGAGAATGGGGCTGCCAGAACTAGTGGGAAGCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2270:NM_006897:839:198
+TTTCTTTTCCCCTTCCTTGTTTTTCTTTTTAAGCTGATTGGCTTTTGTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2271:NM_022658:687:171
+TTAATCCTTATTTGACACGAAAACGTCGGATTGAAGTCTCTCATGCCCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2272:NM_017409:927:186
+AACACCAGACGCTGGAATTGGAGAAAGAATTTCTGTTCAATATGTATTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2273:NM_022658:624:178
+TTCTCCTTTTTCCACTTCATCCTTCGGTTCTGGAACCAGATCTTCACTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2274:NM_014620:2072:170
+TAAAATTCTTTATTGCAAGTTTTACAATAATCAAGTAAATTCAGTCCAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2275:NM_153633:1397:177
+GTAAATTCAGTCCAAAAACACAATAACCACGATAGGGGTGGGGAGAGATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2276:NM_022658:1759:165
+TTCTATAGGTAGTGATAAAATACGCTGGAGGTTTCTTTCTTTCTTTTTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2277:NM_022658:1131:156
+GTGAAAAGTTCGGACTCTCTGTCTCACTCCTTGCCCCACACACACTTGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2278:NM_022658:840:216
+AGGTGGAGGAAGAAGGAAATGAGGAAGAGGAGAAAGAAGAGGAGGAAAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2279:NM_001168316:375:196
+TGGAAATCTGAGGGTCAGTGGTCCAAGTCACTCAGAGACAGAATCACAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2280:NM_014620:370:163
+TCTCCCTCTCTGCCTCTCTCTCTCCCACTCTCTTTCTCGTCTTCCCTCAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2281:NM_022658:2039:194
+GGAACAGGGCTGTCGGGACACAAAATCTACATTCATAGCTGGACATAAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2282:NM_014620:631:204
+AGCTCCTGGTGGTGATGCTGGAATCCCGATTCCCTGGTCCGGCCGTAATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2283:NM_018953:635:234
+GATCGCCAACAACTTGTGTCTCAATGAGAGACAGATCAAGATCTGGTTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2284:NM_006897:932:136
+TCAACACTGAACCCTCCCAAATCGCAAGAGTTTTCTTTTCCCCTTCCTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2285:NM_022658:843:186
+TGTGAGTGTCATTCTATTCTCTATAAAAGCAAATGACAGTCGTAAACTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2286:NM_022658:1837:165
+AGGAGAAAAAAAGAGAAAAAAATAAAAATCAAAAAAAAAAAAAAGAAAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2287:NM_022658:1514:206
+ACTTTCTCTAGGAACCTGATGGAAACCTGAAGGAGATGTGGGTCTTTCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2288:NM_173860:466:182
+CTTCCGAGAGCGGCTGTTGATCGGGTACCAGGGCGCGCCGCTGGCCGAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2289:NM_022658:1787:192
+GCAGCAACAAACGACAACAAAACCGCATTACAAATACTCTCAAAGCAGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2290:NM_022658:1780:192
+CAAACGACAACAAAACCGCATTACAAATACTCTCAAAGCAGGATTTCTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2291:NM_174914:563:154
+CAAGAAAACAGGAGATAACTAGAAGGACTAGAGAATGGGGCTGCCAGAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2292:NM_022658:945:160
+CCCAAACAAATAAAGAGTGGGGGAAGTCCAAAGGTAATAAAACCAGAGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2293:NM_022658:916:175
+GAGTGGGGGAAGTCCAAAGGTAATAAAACCAGAGCTGCAAGTATCTGACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2294:NM_173860:622:156
+TCTTGACCTGCTGGTCACTAAGATTCAAGCGGTCTGAGAGTTCCCTCCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2295:NM_022658:2048:175
+TGTCGGGACACAAAATCTACATTCATAGCTGGACATAAAGACAAATGACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2296:NM_022658:2052:188
+ACCCCAGTAGAGTAGAACTAAATTGCACTGAATGTATAGTTAACTCTGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2297:NM_022658:1229:162
+TGGCCTCCGTGCTCCTCGGTCTGTCTCTCACCACACTCCCACCTCCCTGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2298:NM_022658:1300:190
+GGGGAGCCCCCTCGAAATGCAGAAAAGGACTTGTGGTTTTGTTTTTATGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2299:NM_022658:2131:76
+AAAGAAAAAAATGTTAAAAATATATCTATAATAATAATTTTTTGTCATTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2300:NM_174914:232:189
+TGATTCTGTCTCTGAGTGACTTGGACCACTGACCCTCAGATTTCCAGCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2301:NM_022658:1104:123
+GGGCTGGAGGGGGGAGACGGAGAAACAGTGAAAAGTTCGGACTCTCTGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2302:NM_022658:457:199
+ATACCGGCTGTAAGTTTGCCGTCCACTGCGCCTCCCCGGAGCGTGGGGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2303:NM_022658:1319:200
+AAAGTCAAGGGGGTTTTTCTAAGCAGGGAGCCCTGGGGAGGGGGAGGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2304:NM_153693:503:198
+GAGTGGGAGAGAGAGAGGCAGAGAGGGAGAGAGGGAGAGTGACAGCAGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2305:NM_174914:1615:169
+CTCCTGCAGAAACTAAAGAACATCAGAAAATTCTTCACTCGGCCCCAGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2306:NM_022658:176:168
+GTGGTGCGAAGCGTGCTGGAAGCCGGGCGCCGAGCCGCCGGGCCCGTACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2307:NM_022658:586:188
+TCTGGAACCAGATCTTCACTTGTCTCTCGGTCAGTCCCAGGGCATGAGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2308:NM_022658:355:166
+ACAGTCGGGATATTGCACCACGCTCGCCTCTTGCTGAGCCCCATAAAGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2309:NM_022658:34:149
+CCAGCCCCCAGCCCACCAGCCCAGCCCAGTCCCGGGGAGCCAGCTGGCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2310:NM_022658:279:192
+ACTGTCTGGGGAGCGCCTCGTAGCCATAGAATTTGGAGGCGTCTCCGTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2311:NM_022658:1426:132
+TGTAAAGAAATAAGGAAAAAAGCAAGGAATATCCCCTCCCCCTCCCCCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2312:NM_173860:376:190
+CTGCCGGGGTCGCCTGCGCCGGCGCCCTTGTTGCCCTCGTTGAGCAGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2313:NM_022658:1894:161
+CTCCAGCGTATTTTATCACTACCTATAGAAAGAAATCCTGCTTTGAGAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2314:NM_006897:1315:191
+AGACACACACACATACATGATAATGATTCCCAGCCCAGGAGCTGAGGGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2315:NM_173860:250:186
+AGCTGGCGCGCGTGGAGGACGGCAAGGGTTACTACCGCGAGCCGTGCGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2316:NM_022658:1775:185
+CCTAAAGGGAACCTGCAATAATCTTGAAAAAGAAAAAGAGAAAAATTTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2317:NM_014620:925:183
+TGAATTTTTTTCATCCATGGGTAGACTATGGGTTGCTTGCTGGCGGCGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2318:NM_174914:1265:103
+TCCATATCACCCCTTGGGGTAGGTGAGCAAAGGCATTGTTCATCTCCTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2319:NM_006897:27:207
+GTCCGGCACCAAACCGCTGGGTCTGGCGGCGGCGGGATGAGCCCCGGTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2320:NM_173860:256:135
+CCGACGGCTCCAGCGGGAGCAGCGCTGCCCCGGGCCCGGCTCCCGGGTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2321:NM_174914:480:190
+GCCTTGGCGGGGTCTGTTTGGTGGGCGATGTCACCATTTCTAGGGAGCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2322:NM_022658:1749:195
+AATAATAATAAATCTTTAACATACTACCTAAAGGGAACCTGCAATAATCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2323:NM_174914:1415:194
+GCACATGCAGTCTACATTTGACAACACCATCAAGGAACATTTCACAGAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2324:NM_022658:1348:138
+TGGGGAGGGGGAGGGGGAGGGGGAGGGGATATTCCTTGCTTTTTTCCTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2325:NM_022658:1876:177
+AAAAAGAAAGAAAGAAACCTCCAGCGTATTTTATCACTACCTATAGAAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2326:NM_001168316:168:189
+CAGGGCAGGCTTCCTGAGCATTGAAGAGAATATGTGGGAGAACAAAACAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2327:NM_022658:1165:215
+CCCACACACACTTGTCCCTGCCCCCACCCTTCTGAGTCCTTCCTGGATTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2328:NM_022658:1989:180
+AAGAAAACCCAACAACTGAGACTGCCTAGCCCGCCGGTCCTGTGCGCTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2329:NM_022658:462:164
+CCAGACAGTCCCTTTATGGGGCTCAGCAAGAGGCGAGCGTGGTGCAATAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2330:NM_022658:756:181
+TGAAGATCTGGTTCCAGAACCGAAGGATGAAGTGGAAAAAGGAGAACAAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2331:NM_022658:1319:164
+GGAGGGGGAGGGGGAGGGGGAGGGGATATTCCTTGCTTTTTTCCTTATTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2332:NM_153633:1021:186
+CCCTGCCCTCCTCTCCCTCCCACTGTTAAGGACCCTTTTAAGCATGTGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2333:NM_173860:398:179
+GCGATACCAAGCTGCCGGGGTCGCCTGCGCCGGCGCCCTTGTTGCCCTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2334:NM_022658:182:163
+AGCTCCTACTTCGTCAACCCCCTGTTCTCCAAATACAAAGCCGGCGAGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2335:NM_018953:1152:155
+CCTCTCCTTTGTTCCCGGCTGGACGGGTTAGACAGCCAAAGGCTGGCGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2336:NM_014620:1113:160
+CTCTCAGAGAGGCACAGCGAGTGGGCGATCTCGATCCTTCTCCTTCGGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2337:NM_173860:349:186
+GAGCCGGGCCCGGGGCAGCGCTGCTCCCGCTGGAGCCGTCGGGGCCGCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2338:NM_022658:435:165
+ATGGAAACATGAGGCTGGGAGACGAGTTTTGATTTAAGTGGCCTTGTCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2339:NM_001168316:1665:177
+AACTTCGACATGGTGATAGTTGAAACTTTTGACTACTGTCCTTTCCTGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2340:NM_022658:1995:178
+AAAAATTATTATTATAGATATATTTTTAACATTTTTTTCTTTCGAGCACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2341:NM_022658:1636:197
+CAGGATTTTAAAATTTTTCTCTTTTTCTTTTTCAAGATTATTGCAGGTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2342:NM_004503:834:195
+GCCACCCCTCTCTCCCTTTCTCCCTCGCTCCCCACCAACTCTCCCCTAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2343:NM_014620:64:175
+GCCAGGGAAACCTGCCCTGGGCGCTCCCTTCATTAGCAGTATTTTTTTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2344:NM_174914:666:123
+AGGCTGCACCTGGCCTTATGTCTCCTTCACCTTTCTGGCCCCACGCAGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2345:NM_022658:710:175
+CCTCCTCTTCTTTCTCCTCTTCCTCATTTCCTTCTTCCTCCACCTTCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2346:NM_022658:1617:183
+AAGATTATTGCAGGTTCCCTTTAGGTAGTATGTTAAAGATTTATTATTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2347:NM_022658:48:155
+GGGGTTGACGAAGTAGGAGCTCATGCTGGGTACATGAAAACCCGCGGCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2348:NM_022658:838:183
+TCATTCTATTCTCTATAAAAGCAAATGACAGTCGTAAACTTCTCAATTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2349:NM_014620:431:199
+AAAGTATATGTGTGTGTGTGTGGAGCTGAGACAGGCTCGGCAGCGGCACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2350:NM_022658:1965:209
+AAAAAATTATTATTATAGATATATTTTTAACATTTTTTTCTTTCGAGCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2351:NM_173860:233:188
+AGTCGTACTTGAAGCCGAGCGCAGGCGGCCCCGACGGCTCCAGCGGGAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2352:NM_006897:811:183
+GGTTTCAGAATCGAAGGATGAAGATGAAAAAGATGAATAAAGAGAAAACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2353:NM_022658:279:193
+GGAGCCATGCGCTGGTGTACGGGCCCGGCGGCTCGGCGCCCGGCTTCCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2354:NM_022658:526:167
+CTCCGCCAACACTAACAGTAGCGAAGGACAAGGCCACTTAAATCAAAACT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2355:NM_004503:1139:166
+CTTGGCTCCCCCACTCCTTCGACGCCCCCACCCCCGCCCCCCGTGCAGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2356:NM_022658:794:175
+AAGGAGAACAACAAGGATAAACTGCCGGGAGCCCGAGATGAGGAGAAGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2357:NM_022658:753:202
+GAAACTTCAAGGGAGTTGCTAAGGGGGGGGGGGTCTTTCTTTTTTGCTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2358:NM_022658:377:207
+GGGAGACGAGTTTTGATTTAAGTGGCCTTGTCCTTCGCTACTGTTAGTGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2359:NM_173860:617:186
+TTCATTCTCCGGTTCTGAAACCAGATCTTGACCTGCTGGTCACTAAGATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2360:NM_173860:78:217
+CCCAACTTCCGCGCGTCCGGGGCGCAGCTTCCCGGGCTGCCTTCGCTGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2361:NM_022658:1105:188
+TAAATACCAGAGAAGCAGGGAGGTGGGAGTGTGGTGAGAGACAGACCGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2362:NM_173860:265:186
+CGCCGTCGCCACCGCCGCCGCCCGCCGCGTAGTCGTACTTGAAGCCGAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2363:NM_022658:235:105
+TGCGAAGCGTGCTGGAAGCCGGGCGCCGAGCCGCCGGGCCCGTACACCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2364:NM_022658:1879:178
+GGGGTTAGAAGCACAATAAAAGCGCACAGGACCGGCGGGCTAGGCAGTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2365:NM_022658:1005:211
+AAAATCCAGGAAGGACTCAGAAGGGTGGGGGCAGGGACAAGTGTGTGTGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2366:NM_174914:869:170
+GTTTGGTGTTTCTATTCAGTTAAAGAAGCTCAAGGCAGAGACATTGGCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2367:NM_001168316:1181:174
+TGGGCTCCATGGTGAACACCTGTCAGAATCCGGAAATCTTCAAGGAGATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2368:NM_022658:886:188
+AGGTAATAAAACCAGAGCTGCAAGTATCTGACAGGTAGTTAGAGTTGTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2369:NM_022658:2011:210
+TGCCTAGCCCGCCGGTCCTGTGCGCTTTTATTGTGCTTCTAACCCCAGTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2370:NM_022658:194:211
+GTCAACCCCCTGTTCTCCAAATACAAAGCCGGCGAGTCCCTGGAACCGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2371:NM_153693:869:175
+TCAGGCAAAGCGCGTTGGCGATCTCGATGCGCCGGCGCCGCGTTAGGTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2372:NM_022658:542:191
+GCATGAGAGACTTCAATCCGACGTTTTCGTGTCAAATAAGGATTAAAGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2373:NM_173860:88:187
+TTGCCGTCCTCCACGCGCGCCAGCTCGCACGTGCGGCCGAAGGGAGGGTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2374:NM_022658:1808:194
+AAAAGAGAAAAATTTTAAAATCCTGCTATAGGAGAAAAAAAGAGAAAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2375:NM_022658:1675:173
+TTTTTTCTCCTATAGCAGGATTTTAAAATTTTTCTCTTTTTCTTTTTCAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2376:NM_022658:1160:196
+CTTGCCCCACACACACTTGTCCCTGCCCCCACCCTTCTGAGTCCTTCCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2377:NM_022658:365:173
+GTGTTGGCGGAGGATTTACAGTCGGGATATTGCACCACGCTCGCCTCTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2378:NM_022658:59:186
+GGCCGGTTCCAGGGACTCGCCGGCTTTGTATTTGGAGAACAGGGGGTTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2379:NM_022658:1123:192
+GAGAAACAGTGAAAAGTTCGGACTCTCTGTCTCACTCCTTGCCCCACACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2380:NM_173860:401:200
+GCTCGGCTTCAAGTACGACTACGCGGCGGGCGGCGGCGGTGGCGACGGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2381:NM_153633:626:182
+CTCCGGCGGCGTGGCGCTCTGGGAGTGGTCTTCAGAAGTACCCGGGGTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2382:NM_014620:660:202
+CTAGGGCGCGGAGGCGGTGGTGGGTACAGCTCCTGGTGGTGATGCTGGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2383:NM_006897:128:201
+TGATATACCACGGACGACTGAGAGGGCACGGGCGCCCACGACGTGCTGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2384:NM_022658:53:179
+GACTCGCCGGCTTTGTATTTGGAGAACAGGGGGTTGACGAAGTAGGAGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2385:NM_173860:515:171
+GTCCCTGCTCAACGAGGGCAACAAGGGCGCCGGCGCAGGCGACCCCGGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2386:NM_153633:1483:178
+CTAATTCACATCCACTGGTTTATTATTGATCACGGGGCATTTCACATCGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2387:NM_173860:520:193
+TGCTCAACGAGGGCAACAAGGGCGCCGGCGCAGGCGACCCCGGCAGCTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2388:NM_014620:1639:209
+GATAAACAAACAAGCCCCCTGCCCTCCTCTCCCTCCCACTGTTAAGGACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2389:NM_174914:281:209
+CTGCCTGCTAGCAGAATTCTTTCCAGTCCTCTTGTCCTCCTTTGTTTGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2390:NM_153693:218:195
+AAATAATTATAATCATCCAAAAGCCAAACAAAATTAAGGAGAGTTGCAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2391:NM_006897:648:154
+CCTGCCGCTCGGTGAGATTGAGAACCCGGGCCACCTCATACCGACGGTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2392:NM_174914:278:178
+CAGGAGTGAGAGAGGCTGACTAGGTCTGGACATGGAGGCTGGAAGAGTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2393:NM_006897:997:194
+CAATCAGCTTAAAAAGAAAAACAAGGAAGGGGAAAAGAAAACTCTTGCGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2394:NM_022658:1244:174
+TCGGTCTGTCTCTCACCACACTCCCACCTCCCTGCTTCTCTGGTATTTAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2395:NM_022658:1120:186
+CTCCCCTCTAAAATAAATACCAGAGAAGCAGGGAGGTGGGAGTGTGGTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2396:NM_022658:858:160
+ATGAGGAAGAGGAGAAAGAAGAGGAGGAAAAGGAAGAAAACAAGGACTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2397:NM_173860:507:156
+ATAGGGCTTGCGCTTCTTCCGAGAGCGGCTGTTGATCGGGTACCAGGGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2398:NM_022658:1603:201
+CGCCTCTAAAATCCTACCTAACCATCCCATGGTCACTCGGGCCCATGCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2399:NM_006897:109:182
+GGCCCATCAGTAACTATTACGTGGACTCGCTCATCTCTCACGACAATGAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2400:NM_022658:1056:185
+GCTCTGGTTTTATTACCTTTGGACTTCCCCCACTCTTTATTTGTTTGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2401:NM_174914:1478:179
+CCGAGTGAAGAATTTTCTGATGTTCTTTAGTTTCTGCAGGAGGCAACAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2402:NM_018953:31:160
+CAGTACCTGGATGCCTGCACCTCTGAGGCCGATCCATAGTTCCCACAAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2403:NM_022658:973:154
+TCTCCGTCTCCCCCCTCCAGCCCCCAAACAAATAAAGAGTGGGGGAAGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2404:NM_173860:41:164
+GCTGGTAAACATCCACACGGGAGACACCTTCTACTTCCCCAACTTCCGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2405:NM_174914:200:178
+TGTGGGAGAACAAAACAGAAACTGAAAGAATATGCAAGGTGTCTTTCTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2406:NM_022658:1631:181
+ATGGTCACTCGGGCCCATGCCTTCCTCTCCTTCGCTGTTTGATTTCTATT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2407:NM_173860:391:179
+CAAGCTGCCGGGGTCGCCTGCGCCGGCGCCCTTGTTGCCCTCGTTGAGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2408:NM_022658:696:174
+CCTCTTCCTCATTTCCTTCTTCCTCCACCTTCTCCTCATCTCGGGCTCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2409:NM_004503:1194:203
+TGCCATAATGACCCCCAGGATTCTTTAAATACAATTTGCCTGGGCTGGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2410:NM_022658:1332:180
+GTGGTTTTGTTTTTATGCTAAGGCTAGTGTACTAGATGTACTTTTTCTAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2411:NM_022658:705:191
+TTCTTCCTTTTCCTCCTCTTCTTTCTCCTCTTCCTCATTTCCTTCTTCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2412:NM_022658:21:153
+GTACATGAAAACCCGCGGCCCCCTCCCCTCTGGCTCACGAGTACCCCGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2413:NM_022658:1116:185
+GGAGACGGAGAAACAGTGAAAAGTTCGGACTCTCTGTCTCACTCCTTGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2414:NM_153633:407:182
+CCCCCGACCATCCCTCCAGCGCCGCCAGCAAGCAACCCATAGTCTACCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2415:NM_022658:412:193
+CATCCATGGAAACATGAGGCTGGGAGACGAGTTTTGATTTAAGTGGCCTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2416:NM_022658:976:220
+TGAGAAGTTTACGACTGTCATTTGCTTTTATAGAGAATAGAATGACACTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2417:NM_022658:1907:195
+GACAGAGTTAACTATACATTCAGTGCAATTTAGTTCTACTCTACTGGGGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2418:NM_022658:1872:158
+AGGACCGGCGGGCTAGGCAGTCTCAGTTGTTGGGTTTTCTTAGTGAAATA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2419:NM_014620:1552:171
+GTACCATGCTAAGACAACATCACATGCTTAAAAGGGTCCTTAACAGTGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2420:NM_174914:1259:186
+GCTTGATGGAAAAACCTATTAAACCAGTACCACAAGACTTGGAGAACTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2421:NM_173860:635:184
+CCGCTCTCGGAAGAAGCGCAAGCCCTATTCGAAGTTGCAACTGGCAGAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2422:NM_022658:1238:201
+TTATTTCTTTACATTTGTCTTCCTTTCCTTTCTTCATTTTTTTCTGTCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2423:NM_174914:931:186
+CTGGCAGCCACTGCCGCGGACTTGTATCTCTTGTCTTCCATGATTTGTTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2424:NM_174914:2158:185
+GCCTTTGGCGCACTGAGGTGCACAGGGTCCCTTAGCCGGGCGCAGGGCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2425:NM_022658:1387:158
+TTCAGGTTTCCATCAGGTTCCTAGAGAAAGTCAAGGGGGTTTTTCTAAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2426:NM_022658:102:172
+ACGCTCTGAGGGAACCGGCAGTCGTAATAGGCCGGTTCCAGGGACTCGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2427:NM_022658:572:128
+AAATAAGGATTAAAGAGAAACTCCTTTTCTAGTTCCAAGGTCTGATACCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2428:NM_022658:1596:211
+CTTTTTCAAGATTATTGCAGGTTCCCTTTAGGTAGTATGTTAAAGATTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2429:NM_022658:1095:150
+TTTGTTTGGGGGCTGGAGGGGGGAGACGGAGAAACAGTGAAAAGTTCGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2430:NM_174914:2168:201
+TACTCCTACCTCTACCCACAGCCAGTGCCTTTGGCGCACTGAGGTGCACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2431:NM_174914:1852:147
+TCAAAGAGAATTTAAAAAGAGTTTTGATTTCTTTCTGGAAGAAACTTTAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2432:NM_022658:91:193
+GCTCCTGCCCACGCTCTGAGGGAACCGGCAGTCGTAATAGGCCGGTTCCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2433:NM_153633:56:180
+GCTCGTATTTGATGGACTCTAACTACATCGATCCGAAATTTCCTCCATGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2434:NM_022658:1589:168
+TAGGAGCCTGCAGTCGCCTCTAAAATCCTACCTAACCATCCCATGGTCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2435:NM_006897:212:194
+CGGCGCCGGACAGCGGCTCGAGCCAAGTCCGCATGTAGCGCGTGTCGGCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2436:NM_153633:1306:195
+ACTGAAAGTTCATTTTGATTTTCTTTTGGCTCCTCAAACTGAACAGCTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2437:NM_022658:1928:176
+ATCCTGCTTTGAGAGTATTTGTAATGCGGTTTTGTTGTCGTTTGTTGCTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2438:NM_022658:125:175
+GCGGGGTACTCGTGAGCCAGAGGGGAGGGGGCCGCGGGTTTTCATGTACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2439:NM_006897:784:180
+TCGTCTCTCCCCCGCCTGTGTTGGGGTATTTTGTGGGGTTTTTGTTTTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2440:NM_014620:1961:159
+TGATTTTCTTTTGGCTCCTCAAACTGAACAGCTCTGAGAGGCTCTCCAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2441:NM_022658:1321:228
+GAAAAGGACTTGTGGTTTTGTTTTTATGCTAAGGCTAGTGTACTAGATGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2442:NM_022658:416:176
+AGCTGCCACGGAGACGCCTCCAAATTCTATGGCTACGAGGCGCTCCCCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2443:NM_174914:2004:197
+TGCTCTCAGAGGCTGCCAAAATCCTGACAATATCTACAGTAGGTGGAAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2444:NM_006897:617:169
+GGCCGACCTGGACCCCAGCAACCCCGTGGCCAACTGGATTCACGCCCGCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2445:NM_022658:1547:184
+ATTTCTGAGCACTAACACTAATGCAGCTCAGAGGAAGGCGGGCCCAACAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2446:NM_022658:1843:94
+AAAAAAGAGAAAAAAATAAAAATCAAAAAAAAAAAAAAGAAAGAAAGAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2447:NM_174914:1425:174
+AATAGGTTTTTCCATCAAGCCTCCAACATAAACAGTGTTGGGAAGCAGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2448:NM_022658:1033:89
+GTCTCCCCCCTCCAGCCCCCAAACAAATAAAGAGTGGGGGAAGTCCAAAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2449:NM_022658:1319:153
+CAGAAAAGGACTTGTGGTTTTGTTTTTATGCTAAGGCTAGTGTACTAGAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2450:NM_022658:1648:202
+CTTTTTTTCTCCTATAGCAGGATTTTAAAATTTTTCTCTTTTTCTTTTTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2451:NM_022658:148:172
+GGAGGGGGCCGCGGGTTTTCATGTACCCAGCATGAGCTCCTACTTCGTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2452:NM_153693:1442:180
+GAGGCCCTGGAGCAGAGGCCCCAGCAGGCCCAGGAGCCGGCTCTCTGCAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2453:NM_006897:104:156
+AAGCTACAGGACGGAAAATCGCTACAGTCCGGCACCAAACCGCTGGGTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2454:NM_174914:1370:194
+AGAAGGCTCTAGGCCAGTTTTGTCTCATCTTCTACTGAAAGCAGAGTTGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2455:NM_006897:866:174
+AGTTTTCTTTTCCCCTTCCTTGTTTTTCTTTTTAAGCTGATTGGCTTTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2456:NM_022658:1695:120
+CTCTTTTTCTTTTTCAAGATTATTGCAGGTTCCCTTTAGGTAGTATGTTA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2457:NM_022658:1969:195
+TTGTTGCTGCTTATTTCACTAAGAAAACCCAACAACTGAGACTGCCTAGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2458:NM_022658:1334:128
+GGTTTTGTTTTTATGCTAAGGCTAGTGTACTAGATGTACTTTTTCTAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2459:NM_022658:1685:147
+TGGGCCCGCCTTCCTCTGAGCTGCATTAGTGTTAGTGCTCAGAAATCACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2460:NR_031764:1557:185
+GCGGCTTCCGTAGAAGTGAGCATGGCTGGGCAGCGAGTGCTTCTTCTAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2461:NM_173860:545:161
+TGACCAGAAACTCGCCCTCCAGCTCTGCCAGTTGCAACTTCGAATAGGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2462:NM_022658:1445:197
+AAGCAAGGAATATCCCCTCCCCCTCCCCCTCCCCCTCCCCAGGGCTCCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2463:NM_022658:2089:166
+AGTTAACTCTGTCTTGAATTCTCTGTTTATGCAATGTGCTCGAAAGAAAA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2464:NM_014620:207:174
+ATGGGAGGGGAGAGACAGAAGTTGAGGGCATCTCTCTCTTCCTTCCCGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2465:NM_153693:1338:212
+GAAGGAGTGGGGGAGCCAAGTCCTCACTTGGAGGGCAATCTGTAGAGTCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2466:NM_022658:1620:100
+CTAACACTAATGCAGCTCAGAGGAAGGCGGGCCCAACAGAATAGAAATCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2467:NM_006897:360:186
+GCGCAGCTCCCCGGGCGAGCCGTACATGTAGTCCGGGTAGCTGCGGCCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2468:NM_174914:2060:160
+TTCCTTCTCCCTGGGGTCCTGCTCTCAGAGGCTGCCAAAATCCTGACAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2469:NM_001168316:526:164
+GAGACATAAGGCCAGGTGCAGCCTTGGCGGGGTCTGTTTGGTGGGCGATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2470:NM_173860:55:175
+ACACGGGAGACACCTTCTACTTCCCCAACTTCCGCGCGTCCGGGGCGCAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2471:NM_022658:446:200
+TAAGTTTGCCGTCCACTGCGCCTCCCCGGAGCGTGGGGTCTCATCCATGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2472:NM_022658:1067:174
+ATTACCTTTGGACTTCCCCCACTCTTTATTTGTTTGGGGGCTGGAGGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2473:NM_022658:644:193
+TACAGCCGGTATCAGACCTTGGAACTAGAAAAGGAGTTTCTCTTTAATCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2474:NM_004503:450:126
+TCCAGGGTCTGGTACCGCGAGTAGATCTGGCGGCCGCGCCTCCGGTCCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2475:NM_006897:1325:210
+ACATACATGATAATGATTCCCAGCCCAGGAGCTGAGGGGTGAGGGCTGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2476:NM_022658:785:181
+AAGTGGAAAAAGGAGAACAACAAGGATAAACTGCCGGGAGCCCGAGATGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2477:NM_004503:1405:176
+ACTGTGACCGTTTCTGTGTGAAGATTTTTAGCTGTATTTGTGGTCTCTGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2478:NM_022658:2096:171
+TGACTCACGTATACAATACAAAGTACTTGGACCAGGAACAGGGCTGTCGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2479:NM_174914:1622:176
+CCTGATTGCTGAGAAGCTTGGGAAGCCATTTGTGGCCATTCTTTCCACTT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2480:NM_022658:321:164
+GCTTCCAGCACGCTTCGCACCACGTTCAAGACTTCTTCCACCACGGCACC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2481:NM_022658:1851:208
+CTGGGGTTAGAAGCACAATAAAAGCGCACAGGACCGGCGGGCTAGGCAGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2482:NM_173860:598:182
+GATCTTGACCTGCTGGTCACTAAGATTCAAGCGGTCTGAGAGTTCCCTCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2483:NM_018953:931:231
+AAAGGAGAGGGCGAGGTTAGAGGGTCCGGCGAGGGTCCTGTGGCGCGGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2484:NM_173860:272:164
+CAAGGGTTACTACCGCGAGCCGTGCGCCGAGGGTGGCGGCGGGGGCCTGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2485:NM_022658:4:199
+GGGGTTGACGAAGTAGGAGCTCATGCTGGGTACATGAAAACCCGCGGCCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2486:NM_022658:1049:186
+AGGCCAGGTCTCAGACCTTAAAATCCAGGAAGGACTCAGAAGGGTGGGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2487:NM_022658:381:184
+CCAACTCAGGCTACCAGCAGAACCCGTGCTCGCTTAGCTGCCACGGAGAC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2488:NM_153693:1559:190
+CTGGGCTGGGCATTTGCTGGGGCAGAGGGGCTAGGCAGGGACTGCGGGGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2489:NM_173860:611:169
+CGCGCCCTGGTACCCGATCAACAGCCGCTCTCGGAAGAAGCGCAAGCCCT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2490:NM_022658:696:186
+CCTCTTCTTTCTCCTCTTCCTCATTTCCTTCTTCCTCCACCTTCTCCTCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2491:NM_174914:2191:163
+TCTGAGAGCAGGACCCCAGGGAGAAGGAAGCCCACTAGAAGAAGCACTCG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2492:NM_173860:477:183
+GGGCTTGCGCTTCTTCCGAGAGCGGCTGTTGATCGGGTACCAGGGCGCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2493:NM_022658:926:81
+CCCCCCCTTAGCAACTCCCTTGAAGTTTCGTTTTATGGTAGCAGATAAAT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2494:NM_006897:475:164
+GTTGCTGGGGTCCAGGTCGGCCTTCTCCTCTTTGTGCTTGCTGCCGGCGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2495:NM_173860:89:171
+CGCGTCCGGGGCGCAGCTTCCCGGGCTGCCTTCGCTGTCCTACCCACGCC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2496:NM_014620:1630:192
+GACAAAACAGATAAACAAACAAGCCCCCTGCCCTCCTCTCCCTCCCACTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2497:NM_022658:1978:180
+AGATATATTTTTAACATTTTTTTCTTTCGAGCACATTGCATAAACAGAGA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2498:NR_031764:523:188
+CAAGTGGAAAGGATGATTTTTGGCCATTTTTCCTGTTCTTCAAGAAAACA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2499:NM_173860:640:188
+CTCGGAAGAAGCGCAAGCCCTATTCGAAGTTGCAACTGGCAGAGCTGGAG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2500:NM_022658:67:168
+GGGGAGCCAGCTGGCCTGGGGTTCGGTCCCGGGGGGAGGGGAGTTTCGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2501:NM_022658:1884:177
+TACTGGGGTTAGAAGCACAATAAAAGCGCACAGGACCGGCGGGCTAGGCA
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2502:NM_014620:177:189
+AAGAAGGGGGCAGGAGGAAGAGCCTGGGAGAGAGGAGGGGCGGAGGCATC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2503:NM_014620:1167:187
+ATACCCGGCAGCAAGTCCTGGAATTAGAGAAAGAGTTTCATTACAACCGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2504:NM_022658:1576:182
+ATTATTATTATTTTCGTGATTATGGTGATTTCTGAGCACTAACACTAATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2505:NM_174914:744:171
+ACAAAGCCATAGAGTCCCCAGAGTGAGCCCCAGCAGAAACACAAAAACGT
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2506:NM_174914:513:175
+GACATAAGGCCAGGTGCAGCCTTGGCGGGGTCTGTTTGGTGGGCGATGTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2507:NM_022658:1123:195
+ATTTCGAGGGGGCTCCCCTCTAAAATAAATACCAGAGAAGCAGGGAGGTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2508:NM_006897:1202:178
+TGGTCCCCAGCCCTCACCCCTCAGCTCCTGGGCTGGGAATCATTATCATG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2509:NM_006897:703:192
+AGACGCTGGAACTGGAGAAGGAGTTTCTCTTCAATATGTATTTAACCAGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2510:NM_022658:1035:125
+GAGTGAGACAGAGAGTCCGAACTTTTCACTGTTTCTCCGTCTCCCCCCTC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2511:NM_174914:2195:151
+AGTGCCTTTGGCGCACTGAGGTGCACAGGGTCCCTTAGCCGGGCGCAGGG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2512:NM_174914:1597:187
+AGCTTGGGAAGCCATTTGTGGCCATTCTTTCCACTTCATTCGGCTCTTTG
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2513:NM_022658:177:189
+CGTGGTGGAAGAAGTCTTGAACGTGGTGCGAAGCGTGCTGGAAGCCGGGC
++
+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
+@2514:NM_022658:50:174
+GGCTTTGTATTTGGAGAACAGGGGGTTGACGAAGTAGGAGCTCATGCTGG
++