view test-data/RF01704.fasta @ 38:1bd039aca44f draft default tip

"planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/sklearn commit d970dae980fbe349414fc0889f719d875d999c5b"
author bgruening
date Fri, 27 Aug 2021 09:58:48 +0000
parents e0067d9baffc
children
line wrap: on
line source

>CP000097.1/1411351-1411410
CAACGUUCACCUCACAUUUGUGAGGCGCAGACAACCCAGGCCAAGGAACGGGGACCUGGA
>ACNY01000002.1/278641-278580
GAUCGUUCACUUCGCAUCGCGCGAAGCGCAGUUCGCCUCAGGCCAUGGAACGGGGACCUGAG